UBC Undergraduate Research

Analysis of DNA variations in genes under selection on the mountain pine beetle (MPB) fungal associates Lauermeier, Mackenzie Apr 7, 2015

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
52966-Lauermeier_Mackenzie_FRST_ 498_2015.pdf [ 241.08kB ]
Metadata
JSON: 52966-1.0075636.json
JSON-LD: 52966-1.0075636-ld.json
RDF/XML (Pretty): 52966-1.0075636-rdf.xml
RDF/JSON: 52966-1.0075636-rdf.json
Turtle: 52966-1.0075636-turtle.txt
N-Triples: 52966-1.0075636-rdf-ntriples.txt
Original Record: 52966-1.0075636-source.json
Full Text
52966-1.0075636-fulltext.txt
Citation
52966-1.0075636.ris

Full Text

Mackenzie	  Lauermeier	   	   FRST	  498	  	  	   1	  	   	  	  Analysis	  of	  DNA	  Variations	  in	  Genes	  under	  Selection	  on	  the	  Mountain	  Pine	  Beetle	  (MPB)	  Fungal	  Associates	  	  	  	  By	  	  Mackenzie	  Lauermeier	  	  	  A	  thesis	  submitted	  for	  the	  partial	  fulfillment	  of	  the	  requirements	  for	  the	  degree	  BACHELOR	  OF	  SCIENCE	  in	  FOREST	  SCIENCES	  	  	  Department	  of	  Forest	  and	  Conservation	  Sciences	  	  Faculty	  of	  Forestry	  	  University	  of	  British	  Columbia	  (Vancouver)	  	  	  	  Supervisors	  	  Dr.	  Richard	  Hamelin	  	  Dr.	  Yousry	  El	  Kassaby	  	  	  	  	  	  	  April	  7th	  2015	  	  	  	  	  	  	  	  Mackenzie	  Lauermeier	   	   FRST	  498	  	  	   2	  Abstract:	  The	  Mountain	  Pine	  Beetle	  (MPB),	  Dendroctonus	  ponderosa	  Hopkins,	  is	  a	  small	  bark	  beetle	  that	  has	  affected	  over	  13	  million	  hectares	  of	  forests	  in	  western	  Canada	  and	  the	  USA	  since	  1990,	  and	  more	  recently	  has	  affected	  forests	  at	  higher	  elevations	  and	  more	  northern	  latitudes	  (Logan	  et	  al.	  2001).	  The	  MPB	  attacks	  the	  trees	  alone;	  it	  has	  a	  mutualistic	  association	  with	  fungal	  species	  that	  are	  mainly	  in	  the	  Ophiostomoid	  family	  of	  the	  Ascomycota	  phylum,	  which	  provides	  many	  biological	  benefits	  (Lee	  et	  al.	  2006a).	  	  To	  develop	  a	  better	  understanding	  of	  the	  biology	  and	  to	  provide	  information	  for	  the	  development	  of	  MPB	  growth	  models,	  single-­‐nucleotide	  polymorphisms	  (SNPs)	  were	  identified	  from	  multiple	  candidate	  Grosmannia	  clavigera	  DNA	  samples.	  	  G.	  clavigera	  is	  one	  of	  the	  mutualistic	  fungal	  species,	  and	  DNA	  samples	  were	  used	  from	  various	  populations	  in	  western	  North	  America.	  	  PCR	  using	  DNA	  oligonucleotides	  was	  the	  main	  method	  to	  obtain	  the	  amplified	  genes	  for	  sequencing.	  	  After	  sequencing	  at	  Laval	  University,	  Geneious	  software	  was	  used	  to	  contig,	  edit,	  and	  align	  sequences.	  	  Using	  concatenated	  sequences,	  SNPs	  that	  were	  found	  within	  the	  adaptive	  genes	  were	  used	  to	  construct	  three	  different	  phylogenetic	  diagrams.	  	  The	  geographical	  locations	  of	  the	  populations	  tested	  in	  the	  phylogenetic	  analysis	  were	  compared	  to	  the	  genetic	  distance	  of	  the	  different	  samples.	  	  The	  data	  shows	  that	  there	  is	  a	  trend	  where	  populations	  of	  G.	  clavigera	  that	  are	  further	  apart	  geographically	  have	  a	  greater	  genetic	  distance,	  and	  populations	  that	  are	  geographically	  closer	  together	  share	  similar	  SNP	  variations.	  	  	  	  	  	  	  	  Keywords:	  	  	  Fungal	  phylogenetic,	  phylogeography,	  Mountain	  Pine	  Beetle	  (Dendroctonus	  ponderosae),	  Fungal	  symbionts,	  Grosmannia	  clavigera	  	   	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  Mackenzie	  Lauermeier	   	   FRST	  498	  	  	   3	  Table	  of	  Contents:	  	  Introduction	  –	  page	  4	  Materials	  and	  Methods	  –	  page	  6	  Results	  –	  page	  10	  Discussion	  –	  page	  15	  Conclusion	  –	  page	  16	  Acknowledgement	  –	  page	  17	  Bibliography	  –	  page	  18	  	  	  List	  of	  Figures	  and	  Tables:	  	  Table	  1	  “DNA	  samples	  selected	  to	  be	  amplified	  and	  used	  for	  study”	  –	  page	  7	  Table	  2	  “DNA	  oligonucleotides	  targeting	  10	  genes	  of	  the	  MPB	  fungal	  associates.	  	  The	  genes	  were	  selected	  based	  on	  their	  expression	  during	  growth	  on	  host	  tissue”	  –	  page	  8	  Table	  3	  “DNA	  samples	  that	  were	  sequenced	  and	  used	  to	  make	  concatenated	  sequences”	  –	  page	  11	  Table	  4	  “Gene	  size	  and	  number	  of	  SNPs	  in	  Concatenated	  data	  for	  all	  genes	  for	  G.	  clavigera	  samples”	  –	  page	  11	  Figure	  1	  –	  page	  12	  Figure	  2	  –	  page	  13	  Figure	  3	  –	  page	  13	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  Mackenzie	  Lauermeier	   	   FRST	  498	  	  	   4	  1.	  Introduction	  	  1.1	  The	  Recent	  Mountain	  Pine	  Beetle	  Epidemic	  The	  Mountain	  Pine	  Beetle	  (MPB),	  Dendroctonus	  ponderosa	  Hopkins,	  is	  a	  small	  bark	  beetle	  that	  has	  affected	  greater	  than	  13	  million	  hectares	  of	  forests	  in	  western	  Canada	  and	  the	  USA	  since	  1990,	  and	  more	  recently	  has	  affected	  forests	  at	  higher	  elevations	  and	  more	  northern	  latitudes	  (Logan	  et	  al.	  2001).	  	  The	  MPB	  has	  in	  the	  most	  recent	  outbreak	  crossed	  the	  Rocky	  Mountain	  barrier,	  and	  has	  thus	  started	  to	  invade	  hybrid	  lodge	  pole-­‐jack	  pine	  hybrid	  (Pinus	  contorta	  var.	  latifolia-­‐Pinus	  banksiana)	  stands	  in	  forests	  that	  are	  largely	  a	  part	  of	  the	  boreal	  jack	  pine	  forests	  that	  span	  across	  the	  entire	  continent	  east	  of	  the	  Rocky	  Mountains	  (Safranyik	  and	  Carroll	  2006).	  	  This	  insect	  has	  highly	  influenced,	  and	  will	  most	  likely	  continue	  to	  influence,	  the	  forest	  management	  practices	  used	  in	  the	  industry.	  	  	  1.2	  Mountain	  Pine	  Beetle	  and	  Fungal	  Symbiont	  Biology	  	   The	  MPB	  does	  not	  enter	  the	  tree	  alone;	  it	  has	  a	  mutualistic	  association	  with	  fungal	  species	  that	  are	  mainly	  in	  the	  Ophiostomoid	  family	  of	  the	  Ascomycota	  phylum,	  largely	  in	  part	  because	  this	  type	  of	  organism	  provides	  many	  biological	  benefits	  (Lee	  et	  al.	  2006).	  This	  tiny	  bark	  beetle	  species	  carries	  parts	  of	  blue	  stain	  fungi	  such	  as	  the	  spores	  within	  its	  mycangia,	  which	  are	  like	  sacs	  that	  reside	  on	  the	  maxillary	  cardines	  of	  both	  the	  male	  and	  female	  beetles	  (Whitney	  and	  Farris	  1970).	  	  The	  three	  main	  species	  of	  the	  fungal	  associates	  of	  the	  MPB	  are:	  Grosmannia	  clavigera	  (Robinson-­‐Jeffrey	  and	  Davidson)	  Zipfel,	  de	  Beer,	  and	  Wingfled;	  Leptographium	  longiclavatum	  Lee,	  Kim	  and	  Breuil;	  and	  Ophiostoma	  montium	  (Rumbold)	  von	  Arx	  (Lee	  et	  al.	  2005).	  Mackenzie	  Lauermeier	   	   FRST	  498	  	  	   5	  	   When	  the	  adults	  are	  able	  to	  enter	  the	  phloem	  tissue	  successfully,	  the	  females	  create	  brood	  galleries	  in	  the	  phloem	  tissue	  and	  inoculate	  the	  cambium	  with	  the	  blue-­‐stain	  fungi	  spores	  (Six	  and	  Klepzig	  2004).	  	  As	  the	  blue-­‐stain	  fungus	  mycelium	  grows	  and	  spreads	  through	  the	  sapwood,	  it	  can	  be	  used	  as	  both	  a	  food	  source	  for	  the	  larvae	  (Six	  and	  Paine	  1998)	  and	  can	  also	  aid	  the	  beetles	  in	  restricting	  the	  tree’s	  defenses,	  which	  help	  the	  beetle	  to	  weaken	  the	  host	  tree	  (Raffa	  and	  Berryman	  1983).	  	  	  	  	  	  1.3	  Phylogeography	  of	  Grosmannia	  clavigera	  	   There	  is	  a	  significant	  correlation	  in	  the	  population	  structure	  between	  the	  MPB	  and	  its	  fungal	  symbionts,	  which	  reveals	  that	  there	  is	  an	  intimate	  relationship	  between	  the	  two	  (Tsui	  et	  al.	  2014).	  	  This	  type	  of	  intimate	  relationship	  can	  be	  described	  as	  obligate	  since	  the	  beetle	  is	  the	  only	  vector	  by	  which	  the	  fungus	  can	  move	  across	  the	  landscape	  and	  into	  host	  trees,	  so	  it	  has	  an	  obligate	  dependency	  on	  the	  beetle	  for	  movement	  (Roe	  et	  al.	  2011).	  	  Within	  this	  circumstance	  the	  phylogeographic	  structure	  of	  the	  fungi	  ends	  up	  reflecting	  the	  northern	  and	  southern	  populations	  in	  its	  range	  and	  shows	  congruent	  patterns	  of	  genetic	  diversity	  (Roe	  et	  al.	  2011).	  	  It	  has	  also	  been	  determined	  that	  over	  a	  broad	  scale	  genetic	  analysis	  that	  there	  were	  populations	  structured	  congruently	  across	  the	  three	  previously	  described	  species	  of	  blue-­‐stain	  fungi	  (Roe	  et	  al.	  2011).	  	  	  When	  the	  population	  structure	  was	  determined	  for	  Grosmannia	  clavierga	  by	  Tsui	  et	  al.	  (2012)	  the	  presence	  of	  repeated	  multilocus	  haplotypes	  in	  the	  regional	  populations	  and	  the	  linkage	  disequilibria	  in	  six	  of	  the	  regional	  populations	  indicated	  that	  clonal	  propagation	  is	  the	  most	  likely	  form	  of	  reproduction	  (Tsui	  et	  al.	  2012),	  even	  though	  it	  was	  determined	  that	  this	  species	  is	  capable	  of	  sexual	  reproduction	  Mackenzie	  Lauermeier	   	   FRST	  498	  	  	   6	  (Tsui	  et	  al.	  2009).	  	  Sexual	  recombination	  of	  alleles	  may	  be	  an	  important	  contributor	  of	  the	  high	  genetic	  diversity	  that	  has	  been	  observed	  in	  the	  Grossmannia	  clavigera	  populations	  (Tsui	  et	  al.	  2012).	  	  By	  knowing	  that	  this	  species	  is	  capable	  of	  sexual	  recombination	  of	  genes,	  there	  is	  an	  inherent	  potential	  for	  adaption.	  	  1.4	  Analysis	  of	  Single-­‐nucleotide	  Polymorphisms	  within	  Selected	  Genes	  	   The	  study	  of	  single-­‐nucleotide	  polymorphisms	  (SNPs)	  can	  be	  very	  useful	  for	  identifying	  DNA	  markers	  for	  evolutionary	  studies,	  especially	  for	  non-­‐model	  organisms	  (Ojeda	  et	  al.	  2014).	  	  Specially	  designed	  primers	  for	  L.	  longiclavatum	  were	  previously	  made	  and	  used	  to	  target	  SNPs	  in	  potentially	  adaptive	  genes	  that	  may	  play	  a	  role	  in	  pathogenicity	  towards	  the	  host	  (Ojeda	  et	  al.	  2014).	  	  In	  my	  study,	  after	  selecting	  one	  individual	  to	  represent	  each	  distinct	  population	  of	  Grosmannia	  claviegera,	  I	  used	  the	  primers	  from	  Ojeda	  et	  al.	  (2014)	  to	  test	  for	  SNP	  genetic	  variation	  within	  specifically	  selected	  genes.	  	  By	  comparing	  inter-­‐population	  variation	  of	  single-­‐nucleotide	  polymorphisms	  it	  can	  be	  determined	  if	  the	  geographical	  distance	  between	  populations	  is	  also	  matched	  by	  the	  amount	  of	  relative	  genetic	  variation.	  2.	  Materials	  and	  Methods	  2.1	  DNA	  samples	  used	  in	  the	  analysis	  	   I	  obtained	  13	  specific	  DNA	  gene	  sequences	  from	  12	  individual	  samples	  of	  previously	  extracted	  DNA.	  	  Each	  sample	  used	  represents	  a	  different	  population	  of	  the	  species	  G.	  clavigera.	  	  The	  DNA	  samples	  that	  I	  amplified	  are	  described	  in	  the	  following	  table.	  	  Mackenzie	  Lauermeier	   	   FRST	  498	  	  	   7	  Table	  1.	  	  DNA	  samples	  selected	  to	  be	  amplified	  and	  used	  for	  study	  Date	  Collected	  12-­‐April-­‐08	  03-­‐April-­‐07	  26-­‐March-­‐08	  30-­‐June-­‐2010	  18-­‐May-­‐2010	  14-­‐June-­‐2011	  19-­‐July-­‐2011	  05-­‐December-­‐2007	  24-­‐October-­‐2011	  28-­‐June-­‐2011	  9-­‐June-­‐2011	  26-­‐July-­‐2011	  Internal	  Code/DNA	  code	  M002-­‐12-­‐03-­‐06-­‐UC30DL32/ss500	  M001-­‐13-­‐01-­‐06-­‐UC09DL35/ss235	  M002-­‐02-­‐02-­‐03-­‐UC11G1/4ss433	  M024-­‐08-­‐01-­‐06/TRIA295	  M024-­‐01-­‐01-­‐01/TRIA35	  M033-­‐04-­‐03-­‐01/TRIA655	  M033-­‐10-­‐01-­‐03/TRIA783	  M002-­‐16-­‐01-­‐05-­‐UC32G34/ss484	  M033-­‐05-­‐02-­‐06/TRIA944	  M033-­‐01-­‐01-­‐15/TRIA500	  M033-­‐04-­‐02-­‐03/TRIA	  667	  M033-­‐11-­‐01-­‐04/TRIA838	  Host/Substrate	  Pinus	  contorta/Larvae	  	  P.	  contorta/larvae	  P.	  contorta,	  wood	  Not	  Available	  Beetle	  Larvae	  Pinus	  flexilis	  P.	  contorta,	  Ploeam	  B	  P.	  contorta,	  wood	  Pinus	  ponderosa	  P.	  ponderosa	  P.	  	  ponderosa	  P.	  albicaulis	  Country,	  Province/State,	  Locality	  Canada/BC,	  Sparwood	  Canada/BC,	  Fairview	  Canada/Bc,	  Willmore-­‐Kakwa	  Canada/BC,	  Tumbler	  Rdidge	  Canada/BC,	  Smithers	  USA/Utah,	  Logan	  Canyon	  USA/Idaho,	  Boise	  Canada/BC,	  Kootenay/Yoho	  USA/Montanan,	  Greenough	  USA/South	  Dakota	  USA/Utah,	  Unitas	  USA/Washington,	  Okanogan-­‐Wenatchee	  Species	  Gc	   Gc	   Gc	   Gc	   Gc	   Gc	   Gc	   Gc	   Gc	   Gc	   Gc	   Gc	  Mackenzie	  Lauermeier	   	   FRST	  498	  	  	   8	  The	  remaining	  set	  of	  data	  used	  in	  the	  phylogeographic	  analysis	  were	  obtained	  from	  the	  lab	  that	  made	  used	  the	  G.	  calvigera	  DNA	  samples	  to	  test	  the	  primers	  that	  were	  used	  to	  find	  prove	  the	  presence	  of	  SNPs	  (Ojeda	  et	  al.	  2014).	  Table	  2.	  	  DNA	  oligonucleotides	  targeting	  10	  genes	  of	  the	  MPB	  fungal	  associates.	  	  The	  genes	  were	  selected	  based	  on	  their	  expression	  during	  growth	  on	  host	  tissue	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  Product	  size	  (bp)	  416	   764	   528	   718	   581	   795	   477	   503	   499	  Sequence	  description	  Short-­‐cahin	  dehydrogenase	  reductase	  Methyl	  transferase	  type	  12	  C2	  h2	  transcription	  factor	  ABC	  transporter	  Fungal-­‐specific	  transcription	  factor	  domain	  protein	  Cytochrome	  P450	  momooxygenase	  Cytochrome	  P450	  monooxygenase	  FAD-­‐binding	  protein	  Lignostilbene	  diooxigenase	  Primer	  Sequence	  (5’-­‐3’)	  6904F	  TGAAAGGACAGCAGGACAGTGGAA	  6904R	  TCGCCATGCTCATCCTTGCTATCT	  2132F	  TATGTCCGGCCTATGTCTTTGCGT	  2132R	  GCGGGTTAGCATTTAGCAGCACAA	  	   7264F	  ACAACGATTTCTGTGACCCTCGGA	  7264R	  ACGAGTCATTCTGCTCGTCCGAAA	  8030F	  AACCTCGTCATCTTCCTTGTGCTT	  8030R	  TGTCACCAACAACAAAGTCGGCAC	  6897F	  	  AAGCACACAGTCCACAAACACAGC	  6897R	  TGACTTCGTACTCGCTCAACAGCA	  7953F	  	  TCTCGACGCAGATGATCTTTGGCT	  7953R	  AGCGCTGGAAGGAATAACTCACCA	  5485F	  CAATTTCTTCTACGCTGGACGCGAT	  5485R	  TGGCGCAGTAGATGGTACATGACA	  2141F	  TCAAGGACAAGACCAAGGTGCTCA	  2141R	  TTTCGTGTACGTCGGGATGTCGTT	  684F	  CTTTGAAACCTECGCGTGTGCATGA	  684R	  TTGCACAATGGCAACAGGTGTCTC	  Leptographium	  genome	  reference	  39304_66970_4784777.g21	   39304_66970_4784777.g16	   38895_58241_3874774.g1	  36886_27385_1704050.g8	  39304_66970_4784777.g1	  39012_19536_1576951.g6	  38547_30050_2163587.g3	  39304_66970_4784777.g3	  36332_15963_1175472.g5	  Contig	  in	  G.	  clavigera	  reference	  genome	  GLEAN_6904	  GLEAN_2132	  GLEAN_7264	  GLEAN_8030	  GLEAN_6897	  GLEAN_7953	  GLEAN_5485	  GLEAN_2141	  GLEAN_684	  Mackenzie	  Lauermeier	   	   FRST	  498	  	  	   9	  Another	  gene	  that	  was	  amplified	  from	  each	  sequence	  was	  GLEAN_8030F1	  made	  by	  Ojeda	  et	  al.	  at	  the	  University	  of	  British	  Columbia.	  	  The	  other	  4	  sets	  of	  DNA	  oligonucleotides	  that	  were	  used	  were	  alpha	  tubulin,	  BT/BT12	  (beta	  tubulin),	  UMF1,	  and	  EF	  (elongation	  factor)	  from	  Ojeda	  et	  al.	  group.	  	  These	  four	  genes	  are	  considered	  to	  be	  the	  ‘housekeeping’	  genes,	  and	  they	  occur	  with	  a	  high	  frequency	  within	  the	  genome	  of	  G.	  clavigera	  (Ojeda	  et	  al.	  2014).	  	  Each	  PCR	  reaction	  that	  was	  done	  to	  amplify	  the	  genes	  was	  done	  so	  with	  all	  of	  the	  DNA	  samples	  and	  one	  set	  of	  primers	  at	  a	  time	  in	  this	  study.	  	  	  	  	  2.2	  Method	  used	  to	  amplify	  the	  DNA	  PCR	  Protocol:	  	   For	  the	  primers	  T2/BT12,	  alpha	  tubulin,	  and	  GLEAN_6904,	  the	  protocol	  that	  successfully	  amplified	  all	  of	  the	  different	  DNA	  samples	  was	  95	  °C	  for	  3	  minutes,	  (95°C	  for	  30	  seconds,	  57	  °C	  for	  1	  minute,	  72°C	  for	  1	  minute)	  x30	  cycles,	  72°C	  for	  5	  minutes.	  	  The	  resting	  temperature	  was	  set	  at	  4°C.	  	  This	  protocol	  did	  not	  work	  successfully	  for	  the	  other	  primers	  on	  any	  of	  the	  DNA	  samples,	  so	  to	  trouble	  shoot	  the	  PCR	  protocol	  the	  RT	  PCR	  machine	  with	  a	  gradient	  setting	  was	  used.	  	  The	  TB/BT12	  primer	  (with	  samples	  ss500,	  TRIA655,	  and	  TRIA783),	  the	  alpha	  tubulin	  primer	  (with	  TRIA500	  and	  TRIA677),	  and	  primer	  6904	  (with	  TRIA500)	  at	  the	  annealing	  temperatures	  varying	  in	  the	  PCR	  machine	  settings.	  One	  lane	  was	  55°C,	  57°C,	  60°C,	  61°C,	  62°C,	  63°C.	  	  The	  annealing	  temperature	  that	  lead	  to	  the	  most	  product	  being	  produced	  was	  61°C,	  so	  it	  was	  used	  for	  the	  rest	  of	  the	  PCR	  runs.	  	  PCR	  machine	  and	  master	  mixes:	  Using	  a	  Bio-­‐Rad	  PCR	  machine,	  the	  master	  mix	  I	  used	  for	  each	  primer	  was:	  Mackenzie	  Lauermeier	   	   FRST	  498	  	  	   10	  (each	  unit	  is	  multiplied	  by	  the	  number	  of	  samples,	  plus	  one	  extra	  unit,	  for	  each	  primer)15	  μl	  water,	  2.5μl	  buffer,	  0.75	  μl	  dNTPs,	  0.5	  μl	  MgCl,	  2.5	  μl	  forward	  primer,	  2.5	  μl	  reverse	  primer,	  and	  0.2	  μl	  Taq	  polymerase.	  For	  each	  sample	  3	  μl	  DNA	  with	  22	  μl	  of	  the	  master	  mix.	  	  The	  positive	  control	  that	  was	  used	  was	  the	  DNA	  sample	  TRIA	  409.	  	  Genetic	  Analysis:	  	   The	  software	  used	  to	  edit	  the	  DNA	  sequences	  and	  create	  the	  phylogenetic	  trees	  was	  Geneious.	  	  The	  genetic	  analysis	  was	  done	  first	  by	  creating	  consensus	  sequences	  and	  then	  creating	  nucleotide	  alignments	  for	  each	  set	  of	  samples	  for	  each	  gene.	  	  The	  DNA	  gene	  sequences	  were	  then	  concatenated	  for	  each	  sample.	  	  The	  concatenated	  nucleotide	  alignment	  was	  used	  to	  create	  the	  phylogenetic	  trees.	  	  The	  genetic	  distance	  model	  for	  creating	  the	  phylogenetic	  diagram	  was	  the	  Tamura-­‐Nei	  model,	  the	  tree	  build	  method	  selected	  was	  the	  neighbor-­‐joining	  method,	  and	  there	  was	  no	  outgroup	  selected	  for	  these	  particular	  trees.	  3.	  Results	  	  	  3.1	  DNA	  that	  was	  successfully	  sequenced	  	   Majority	  of	  the	  genes	  were	  sequenced	  from	  each	  sample.	  	  Using	  these	  sequences,	  three	  different	  concatenated	  sequences	  were	  made	  for	  each	  sample:	  all	  genes,	  ‘housekeeping’	  genes,	  and	  GLEAN	  genes.	  	  The	  following	  table	  lists	  the	  two	  main	  groups	  of	  genes	  and	  the	  samples	  that	  were	  used	  to	  create	  the	  phylogenetic	  diagrams.	  	  	  Mackenzie	  Lauermeier	   	   FRST	  498	  	  	   11	  Table	  3.	  	  DNA	  samples	  that	  were	  sequenced	  and	  used	  to	  make	  concatenated	  sequences	  	  GLEAN	  genes	   ‘Housekeeping’	  genes	  SS500	  Canada/BC,	  Sparwood	  	  SS235	  Canada/BC,	  Fairview	  	  TRIA	  35	  Canada/BC,	  Smithers	  	  SS433	  Canada/AB,	  Kakwa	  	  TRIA	  295	  Canada/BC,	  Tumbler	  Ridge	  	  TRIA	  655	  USA/Utah,	  Logan	  Canyon	  	  TRIA	  783	  USA/Idaho,	  Boise	  	  TRIA	  838	  USA/Washington,	  Okanagan-­‐Wenatchee	  	  SS484	  Canada/BC,	  Yoho	  	  TRIA	  944	  USA/Montana,	  Greenough	  	  TRIA	  667	  USA/Utah,	  Unitas	  	  TRIA	  500	  USA/South	  Dakota,	  Black	  Hills	  	  TRIA	  655	  USA/Utah,	  Logan	  Canyon	  	  SS235	  Canada/BC,	  Fairview	  	  TRIA	  667	  USA/Utah,	  Unitas	  TRIA	  783	  USA/Idaho,	  Boise	  	  TRIA	  838	  USA/Washington,	  Okanagan-­‐Wenatchee	  	  SS484	  Canada/BC,	  Yoho	  	  TRIA	  35	  Canada/BC,	  Smithers	  	  TRIA	  944	  USA/Montana,	  Greenough	  	  SS500	  Canada/BC,	  Sparwood	  	  SS433	  Canada/AB,	  Kakwa	  	  TRIA	  295	  Canada/BC,	  Tumbler	  Ridge	  	  	   When	  all	  genes	  were	  concatenated	  together	  the	  size	  of	  each	  gene	  and	  the	  number	  of	  SNPs	  were	  recorded,	  as	  seen	  in	  the	  following	  table.	  	  	  Table	  4.	  Gene	  size	  and	  number	  of	  SNPs	  in	  Concatenated	  data	  for	  all	  genes	  for	  G.	  clavigera	  samples	  	  Gene	  Name	   Size	  (bp)	   Number	  of	  SNPs	  GLEAN_2132	   726	   3	  GLEAN_2141	   427	   0	  GLEAN_5485	   452	   0	  GLEAN_6897	   552	   1	  GLEAN_6904	   353	   1	  GLEAN_7264	   489	   0	  GLEAN_7953	   721	   0	  GLEAN_8030	   791	   0	  GLEAN_8030F1	   685	   0	  Alpha	  tubulin	   751	   6	  Beta	  tubulin	   1116	   >10	  EF	   667	   >10	  UMF1	   443	   5	  	  Mackenzie	  Lauermeier	   	   FRST	  498	  	  	   12	  All	  of	  the	  GLEAN_684	  sequences	  that	  were	  retrieved	  had	  very	  poor	  quality	  and	  thus	  they	  were	  eliminated	  from	  the	  analysis	  at	  this	  stage,	  and	  were	  not	  included	  in	  the	  final	  phylogenetic	  diagrams.	  3.2	  Phylogenetic	  diagrams	  	   Three	  phylogenetic	  diagrams	  were	  created	  using	  the	  concatenated	  gene	  sequence	  data:	  all	  genes,	  ‘housekeeping’	  genes,	  and	  GLEAN	  genes.	  	  Each	  tree	  contains	  certain	  regions	  that	  show	  specific	  individuals	  from	  different	  populations	  that	  have	  short	  genetic	  distance	  between	  the	  two	  of	  them	  compared	  to	  the	  genetic	  distance	  of	  neighboring	  sequences	  in	  the	  phylogenetic	  tree.	  	  	  	  TRIA	  409	  USA/Colorado,	  Fort	  Collins	  TRIA	  618	  USA/Wyoming,	  Bridger	  TRIA	  887	  USA/Nevada,	  Rose	  Mount	  ski	  resort	  TRIA	  190	  Canada/BC,	  Terrace	  ss89	  Canada/AB,	  Crowsnest	  Pass	  ss500	  Canada/BC,	  Sparwood	  *	  ss235	  Canada/BC,	  Fairview	  *	  ss383	  Canada/BC,	  Valemount	  	  ss388	  Canada/BC,	  Golden	  TRIA	  35	  Canada/BC,	  Smithers	  *	  ss433	  Canada/AB,	  Kakwa	  *	  TRIA	  295	  Canada/BC,	  Tumbler	  Ridge	  *	  ss59	  Canada/AB,	  Grande	  Prairie	  	  TRIA	  655	  USA/Utah,	  Logan	  Canyon	  *	  TRIA	  783	  USA/Idaho,	  Boise	  *	  TRIA	  838	  USA/Washington,	  Okanagan-­‐Wenatchee	  *	  ss484	  Canada/BC,	  Yoho	  *	  TRIA	  944	  USA/Montana,	  Greenough	  *	  	  TRIA	  667	  USA/Utah,	  Unitas	  *	  	  	  	  	  Figure	  1.	  	  Phylogenetic	  tree	  showing	  relatedness	  between	  concatenated	  data	  	  of	  GLEAN	  gene	  sequences,	  and	  the	  locality	  of	  each	  sequence.	  	  Asterisks	  (*)	  denote	  samples	  that	  were	  sequenced	  during	  the	  time	  of	  this	  study.	  	  	  	  	  Mackenzie	  Lauermeier	   	   FRST	  498	  	  	   13	  	  	  ss59	  Canada/AB,	  Grande	  Prairie	  	  TRIA	  496	  USA/South	  Dakota,	  Black	  Hills	  TRIA	  500	  USA/South	  Dakota,	  Black	  Hills	  *	  TRIA	  774	  USA/California,	  Moldoc	  NF	  TRIA	  870	  	  USA/Wyoming,	  Bridger	  NF	  TRIA	  280	  Canada/BC,	  Terrace	  ss89	  Canada/AB,	  Crowsnest	  Pass	  TRIA	  618	  USA/Wyoming,	  Bridger	  NF	  ss383	  Canada/BC,	  Valemount	  TRIA	  655	  USA/Utah,	  Logan	  Canyon	  *	  TRIA	  187	  Canada/BC,	  Peachland	  TRIA	  166	  Canada/BC,	  Peachland	  ss235	  Canada/BC,	  Fairview	  *	  TRIA	  667	  USA/Utah,	  Unitas	  *	  TRIA	  783	  USA/Idaho,	  Boise	  *	  TRIA	  838	  USA/Washington,	  Okanagan-­‐Wenatchee	  *	  ss484	  Canada/BC,	  Yoho	  *	  TRIA	  887	  USA/Nevada,	  Mount	  Rose	  Ski	  Resort	  TRIA	  35	  Canada/BC,	  Smithers	  *	  TRIA	  944	  USA/Montana,	  Greenough	  *	  ss500	  Canada/BC,	  Sparwood	  *	  ss433	  Canada/AB,	  Kakwa	  *	  TRIA	  295	  Canada/BC,	  Tumbler	  Ridge	  *	  TRIA	  190	  Canada,	  BC/Terrace	  	  	  Figure	  2.	  	  Phylogenetic	  tree	  showing	  genetic	  relatedness	  between	  concatenated	  data	  	  of	  ‘housekeeping’	  gene	  sequences,	  and	  the	  locality	  of	  each	  sequence.	  	  Asterisks	  (*)	  denote	  samples	  that	  were	  sequenced	  during	  the	  course	  of	  this	  study.	  	   	  	  	  TRIA	  280	  Canada/BC,	  Terrace	  TRIA	  496	  USA/South	  Dakota,	  Black	  Hills	  TRIA	  500	  USA/South	  Dakota,	  Black	  Hills	  *	  TRIA	  774	  USA/California,	  Moldoc	  TRIA	  870	  USA/Wyoming,	  Bridger	  TRIA	  187	  Canada/BC,	  Peachland	  TRIA	  166	  Canada/BC,	  Peachland	  ss59	  Canada/AB,	  Grande	  Prairie	  TRIA	  655	  USA/Utah,	  Logan	  Canyon	  *	  TRIA	  295	  Canada/BC,	  Tumbler	  Ridge	  *	  ss433	  Canada/AB,	  Kakwa	  *	  TRIA	  190	  Canada/BC,	  Terrace	  ss383	  Canada/BC,	  Valemount	  ss388	  Canada/BC,	  Golden	  TRIA	  618	  USA/Wyoming,	  Bridger	  ss89	  Canada/AB,	  Crowsnest	  Pass	  ss235	  Canada/BC,	  Fairview	  *	  TRIA	  667	  USA/Utah,	  Unitas	  *	  TRIA	  783	  USA/Idaho,	  Boise	  *	  TRIA	  838	  USA/Washington,	  Okanagan-­‐Wenatchee	  *	  ss484	  Canada/BC,	  Yoho	  *	  TRIA	  887	  USA/Nevada,	  Mount	  Rose	  Ski	  Resort	  	  TRIA	  944	  USA/Montana,	  Greenough	  *	  TRIA	  409	  USA/Colorado,	  Fort	  Collins	  	  ss500	  Canada/BC,	  Sparwood	  *	  TRIA	  35	  Canada/BC,	  Smithers	  *	  	  	  Figure	  3.	  	  Phylogenetic	  tree	  showing	  genetic	  relatedness	  between	  concatenated	  data	  	   of	  all	  gene	  sequences,	  and	  the	  locality	  of	  each	  sequence.	  	  	  	   Asterisks	  (*)	  denote	  samples	  that	  were	  sequenced	  during	  the	  course	  	   of	  this	  study.	  	  	  	  Mackenzie	  Lauermeier	   	   FRST	  498	  	  	   14	  	   The	  red	  squares	  on	  all	  three	  of	  the	  phylogenetic	  trees	  show	  areas	  where	  the	  sequences	  underwent	  the	  most	  evolutionarily	  recent	  changes.	  	  Some	  figures	  show	  areas	  where	  genetic	  distance	  is	  significantly	  shorter	  then	  the	  others	  relative	  to	  the	  outgroup	  individual.	  	  In	  Figure	  1,	  the	  top	  square	  contains	  six	  individuals,	  five	  from	  British	  Columbia	  and	  1	  from	  Alberta.	  	  Most	  of	  these	  samples	  are	  from	  localities	  that	  are	  within	  close	  proximity	  to	  the	  Rocky	  Mountain	  Range.	  	  The	  shortest	  genetic	  distance	  is	  seen	  between	  the	  Valemount,	  BC	  and	  the	  Golden,	  BC	  individuals,	  with	  other	  individuals	  from	  BC	  showing	  some	  genetic	  relatedness.	  	  In	  the	  bottom	  square	  the	  majority	  of	  the	  individuals	  that	  show	  recent	  genetic	  changes	  are	  from	  the	  USA.	  	   In	  Figure	  2,	  the	  top	  square	  has	  two	  individuals	  from	  Black	  Hills,	  South	  Dakota	  that	  have	  the	  most	  recent	  genetic	  change,	  and	  the	  next	  closest	  individuals	  are	  also	  from	  localities	  within	  the	  USA.	  	  The	  middle	  square	  on	  the	  phylogenetic	  tree	  has	  a	  mixture	  of	  localities	  present,	  but	  the	  shortest	  genetic	  distance	  can	  be	  seen	  between	  two	  American	  samples,	  one	  from	  Unitas,	  Utah	  and	  the	  other	  from	  Boise,	  Idaho.	  	  The	  bottom	  square	  in	  Figure	  2	  has	  two	  more	  northern	  localities	  that	  are	  more	  genetically	  distinct	  from	  the	  outgroup,	  Tumbler	  Ridge,	  BC	  and	  Kakwa,	  AB.	  	  	  	   In	  Figure	  3,	  when	  all	  of	  the	  genes	  are	  considered,	  some	  of	  the	  genetic	  distances	  change.	  	  For	  example,	  ss500	  and	  TRIA	  35	  had	  larger	  genetic	  distances	  in	  Figure	  1	  and	  Figure	  2,	  but	  in	  Figure	  3	  the	  two	  stem	  from	  a	  node	  that	  is	  representative	  of	  a	  recent	  genetic	  change.	  	  Other	  patterns	  that	  exist	  from	  Figure	  1	  and	  Figure	  2	  do	  show	  up	  again	  in	  Figure	  3,	  such	  as	  the	  clad	  containing	  ss383	  and	  ss388.	  Mackenzie	  Lauermeier	   	   FRST	  498	  	  	   15	  	   Overall	  in	  all	  three	  of	  the	  figures	  the	  longer	  branches	  that	  are	  outside	  of	  the	  red	  boxes	  tend	  to	  belong	  to	  genetic	  populations	  that	  are	  associated	  with	  geographical	  locations	  that	  are	  more	  distant	  from	  the	  geographical	  location	  of	  the	  genetic	  populations	  that	  are	  within	  the	  red	  boxes.	  	  	  4.	  Discussion	  	   While	  microsatellite	  markers	  have	  been	  used	  very	  effectively	  in	  the	  past,	  and	  continue	  to	  be	  effective,	  the	  identification	  of	  SNPs	  is	  increasingly	  becoming	  the	  marker	  of	  choice	  for	  large-­‐scale	  population	  studies	  (Ojeda	  et	  al.	  2014).	  	  The	  study	  of	  single-­‐nucleotide	  polymorphisms	  (SNPs)	  can	  be	  very	  useful	  for	  identifying	  DNA	  markers	  for	  evolutionary	  studies,	  especially	  for	  non-­‐model	  organisms	  (Ojeda	  et	  al.	  2014).	  	  For	  non-­‐model	  organisms	  that	  have	  a	  significant	  impact	  on	  both	  the	  ecological	  and	  economic	  sustainable	  of	  forest	  ecosystem,	  such	  as	  the	  MPB,	  it	  is	  important	  to	  conduct	  studies	  that	  can	  aid	  in	  the	  development	  of	  models	  to	  best	  predict	  future	  scenarios.	  	  	  	  	  	  	  	  	  Specially	  designed	  primers	  for	  L.	  longiclavatum	  were	  previously	  made	  and	  used	  to	  target	  SNPs	  in	  potentially	  adaptive	  genes	  that	  may	  play	  a	  role	  in	  pathogenicity	  towards	  the	  host	  (Ojeda	  et	  al.	  2014).	  	  In	  this	  study	  these	  primers	  were	  used	  to	  sequence	  genes	  from	  individuals	  representing	  various	  G.	  clavigera	  populations	  to	  identify	  if	  any	  SNPs	  were	  present	  and	  if	  they	  exhibited	  a	  geographic	  pattern.	  	  It	  was	  discovered	  that	  some	  SNPs,	  which	  are	  the	  result	  of	  recent	  evolutionary	  changes	  in	  the	  genetic	  structure,	  are	  shared	  between	  different	  populations	  that	  are	  geographically	  close	  together.	  	  	  Mackenzie	  Lauermeier	   	   FRST	  498	  	  	   16	  There	  are	  some	  theories	  as	  to	  how	  genetic	  variation	  is	  influenced	  in	  the	  G.	  clavigera	  species.	  	  Sexual	  reproduction	  of	  fungal	  species	  is	  a	  main	  source	  of	  genetic	  recombination,	  with	  asexual	  propagation	  spreading	  the	  new	  recombinants	  through	  via	  clones	  (Roe	  et	  al.	  2011).	  	  While	  sexual	  recombination	  could	  potentially	  be	  responsible	  for	  the	  establishment	  of	  the	  SNP	  pattern	  across	  the	  species	  range	  it	  could	  also	  be	  responsible	  for	  a	  decrease	  in	  genetic	  variation	  if	  the	  MPB	  is	  preferentially	  selecting	  spores	  to	  carry,	  which	  would	  be	  a	  form	  of	  non-­‐random	  selection	  (Roe	  et	  al.	  2011).	  	  Studies	  to	  determine	  sexual	  and	  asexual	  reproduction	  regimes	  are	  needed	  to	  provide	  information	  for	  the	  mechanisms	  of	  genetic	  variation	  and	  pattern	  of	  distribution	  within	  a	  species.	  	  	  While	  it	  is	  too	  soon	  to	  suggest	  ways	  that	  the	  SNP	  variation	  discovered	  was	  caused,	  the	  variation	  still	  remains.	  	  Populations	  that	  are	  close	  in	  proximity	  tend	  to	  share	  similar	  SNPs	  from	  evolutionary	  events	  in	  recent	  history.	  	  Since	  these	  polymorphisms	  reside	  in	  functional	  genes,	  the	  potential	  for	  functional	  adaption	  to	  different	  environments,	  competition,	  or	  hosts	  is	  possible.	  	  5.	  Conclusion	  	   Single-­‐nucleotide	  polymorphisms	  are	  shared	  in	  common	  between	  individuals	  of	  different	  genetic	  populations	  that	  are	  from	  areas	  that	  are	  geographically	  close.	  	  To	  further	  the	  assessment	  of	  SNP	  variation	  between	  populations	  of	  G.	  clavigera,	  it	  is	  suggested	  that	  multiple	  individuals	  from	  a	  population	  are	  used	  rather	  then	  just	  one	  single	  individual.	  	  While	  the	  single	  individuals	  were	  chosen	  at	  random,	  using	  multiple	  samples	  can	  provide	  a	  better	  statistical	  analysis	  to	  annotate	  the	  Mackenzie	  Lauermeier	   	   FRST	  498	  	  	   17	  phylogenetic	  diagrams	  with,	  and	  to	  provide	  a	  quantitative	  amount	  of	  genetic	  relatedness.	  	  	  Acknowledgements:	  	   I	  would	  like	  to	  thank	  Dario	  Ojeda	  for	  his	  supervision	  and	  aid	  for	  the	  laboratory	  work	  and	  for	  his	  guidance	  for	  the	  genetic	  analysis.	  	  I	  would	  also	  like	  to	  thank	  Richard	  Hamelin	  for	  the	  direction	  he	  provided	  for	  this	  study,	  and	  both	  Richard	  Hamelin	  and	  Yousry	  El-­‐Kassaby	  for	  the	  use	  of	  their	  laboratory	  equipment	  and	  space.	  	   	  	   	  	  	  	  	  	  	  	  	  	  	  	  	  	  Mackenzie	  Lauermeier	   	   FRST	  498	  	  	   18	  BIBLIOGRAPHY	  Bentz,	  B.	  J.,	  G.	  Schen-­‐Langenheim.	  2007.	  The	  mountain	  pine	  beetle	  and	  whitebark	  pine	  waltz:	  has	  the	  music	  changed?	  Pages	  43–50	  in	  E.	  M.	  Goheen	  and	  R.	  A.	  Sniezko,	  eds.	  Proceedings	  of	  the	  conference	  Whitebark	  Pine:	  a	  Pacific	  Coast	  Perspective.	  R6-­‐NR-­‐FHP-­‐2007-­‐01.	  USDA	  Forest	  Service,	  Portland,	  OR.	  	  Geneious	  verstion	  6.0	  created	  by	  Biomatters	  http://www.geneious.com	  Lee,	  S.,	  Kim,	  J.J,	  Breuil,	  C.	  2005.	  Leptographium	  Longiclavatum	  Sp.	  Nov.,	  a	  New	  Species	  Associated	  with	  the	  Mountain	  Pine	  Beetle,	  Dendroctonus	  ponderosae.	  	  Mycological	  Research	  109(10):	  1162-­‐170.	  	  Lee,	  S.,	  Kim,	  J.J.,	  Breuil,	  C.	  2006(a).	  Diversity	  of	  fungi	  associated	  with	  themountain	  pine	  beetle,	  Dendroctonus	  ponderosae	  and	  infested	  lodgepole	  pines	  inBritish	  Columbia.	  Fungal	  Diversity.	  22:	  91-­‐105.	  	  Logan	  J.A.,	  Powell	  J.A.	  2001.	  Ghost	  forests,	  global	  warming,	  and	  the	  mountainpine	  beetle	  (Coleoptera:	  Scolytidae).	  American	  Entomologist.	  47:	  160–173.	  Raffa,	  K.	  F.,	  B.	  H.	  Aukema,	  B.	  J.	  Bentz,	  A.	  L.	  Carroll,	  J.	  A.	  Hicke,	  M.	  G.	  Turner,	  and	  W.	  H.	  Romme.	  2008.	  Cross-­‐scale	  drivers	  of	  natural	  disturbances	  prone	  to	  anthropogenic	  amplification:	  the	  dynamics	  of	  bark	  beetle	  eruptions.	  BioScience.	  58:501–517.	  	  Raffa,	  K.	  F.,	  and	  A.	  A.	  Berryman.	  1983.	  The	  role	  of	  host	  plant	  re-­‐	  sistance	  in	  the	  colonization	  behavior	  and	  ecology	  of	  bark	  beetles	  (Coleoptera:	  Scolytidae).	  Ecological	  Monographs.	  53:27–49.	  	  Roe,	  A.,	  Rice,	  A.,	  Coltman,	  D.,	  Cooke,	  J.,	  Sperling,	  F.	  2011.	  Comparative	  Phylogeography,	  Genetic	  Differentiation	  and	  Contrasting	  Reproductive	  Modes	  in	  Three	  Fungal	  Symbionts	  of	  a	  Multipartite	  Bark	  Beetle	  Symbiosis.	  Molecular	  Ecology.	  20:	  584-­‐600.	  	  	  Safranyik	  L,	  Carroll	  AL.	  2006.	  The	  biology	  and	  epidemiology	  of	  the	  moun-­‐tain	  pine	  beetle	  in	  lodgepole	  pine	  forests.	  Safranyik	  L,	  Wilson	  B,	  ed.	  The	  Mountain	  Pine	  Beetle:	  A	  Synthesis	  of	  Its	  Biology,	  Management	  and	  Impacts	  on	  Lodgepole	  Pine.	  Victoria	  (Canada):	  Canadian	  Forest	  Service,	  Pacific	  Forestry	  Centre,	  Natural	  Resources	  Canada.	  3-­‐66.	  	  	  Six,	  D.	  L.,	  and	  K.	  D.	  Klepzig.	  2004.	  Dendroctonus	  bark	  beetles	  as	  model	  systems	  for	  the	  study	  of	  symbiosis.	  Symbiosis	  37:207–232.	  	  Mackenzie	  Lauermeier	   	   FRST	  498	  	  	   19	  Tsui,	  C.,	  Roe,	  A.,	  El-­‐Kassaby,	  Y.,	  Rice,	  A.,	  Alamouti,	  S.M.,	  Sperling,	  F.,	  Cooke,	  J.,	  Bohlmann,	  J.,	  Hamelin,	  R.	  2012.	  Population	  structure	  and	  migration	  pattern	  of	  a	  conifer	  pathogen,	  Grosmannia	  clavigera,	  as	  influenced	  by	  its	  symbiont,	  the	  mountain	  pine	  beetle.	  Molecular	  Ecology.	  21:	  71-­‐86.	  	  	  	  Tsui,	  C.,	  Farfan,	  L.,	  Roe,	  A.,	  Rice,	  A.,	  Cooke,	  J.,	  El-­‐Kassaby,	  Y.,	  Hamelin,	  R.	  2014.	  Population	  structure	  of	  mountain	  pine	  beetle	  symbiont	  Leptographium	  longiclavatum	  and	  the	  implication	  on	  the	  multipartite	  beetle-­‐fungi	  relationships.	  PLOs	  One.	  9(8):	  1-­‐15.	  Tsui,	  C.,	  Massoumi	  Alamouti,	  S.,	  Bernier,	  L.,	  Bohlmann,	  J.,	  Breuil,	  C.,	  Hamelin,	  R.	  2009.	  Population	  structure	  of	  Grosmannia	  clavigera,	  a	  pine	  pathogen	  associated	  with	  mountain	  pine	  beetle.	  Canadian	  Journal	  of	  Plant	  Pathology.	  31(139).	  	  Whitney,	  H.S.,	  Farris,	  S.	  H.	  1970.	  Maxillary	  mycangium	  in	  the	  mountain	  pine	  beetle.	  Science.	  167:	  54-­‐55.	  	  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.52966.1-0075636/manifest

Comment

Related Items