Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Metabolic engineering and characterisation of the malolactice wine yeast ML01 Husnik, John Ivan 2006

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2007-267288.pdf [ 11.83MB ]
Metadata
JSON: 831-1.0100406.json
JSON-LD: 831-1.0100406-ld.json
RDF/XML (Pretty): 831-1.0100406-rdf.xml
RDF/JSON: 831-1.0100406-rdf.json
Turtle: 831-1.0100406-turtle.txt
N-Triples: 831-1.0100406-rdf-ntriples.txt
Original Record: 831-1.0100406-source.json
Full Text
831-1.0100406-fulltext.txt
Citation
831-1.0100406.ris

Full Text

METABOLIC ENGINEERING AND CHARACTERISATION OF THE MALOLACTIC WINE YEAST ML01  By JOHN I V A N HUSNIK B . S c , University of Guelph, 1994 M . S c , University o f Guelph, 2001  A THESIS S U B M I T T E D IN P A R T I A L F U L F I L L M E N T OF T H E R E Q U I R E M E N T S F O R T H E D E G R E E OF D O C T O R OF P H I L O S O P H Y  In  T H E F A C U L T Y OF G R A D U A T E STUDIES (Genetics)  T H E U N I V E R S I T Y OF BRITISH C O L U M B I A  December 2006  ©John Ivan Husnik, 2006  ABSTRACT  Malolactic fermentation ( M L F ) is essential for deacidification o f high acid grape must and the production o f well-balanced wines. The bacterial M L F is unreliable and stuck M L F s often lead to spoilage o f wines and the production o f biogenic amines. A genetically stable industrial strain o f Saccharomyces  cerevisiae was constructed by  integrating a linear cassette containing the Schizosaccharomyces  pombe malate permease  gene (mael) and the Oenococcus oeni malolactic gene (mleA) under control o f the S. cerevisiae PGK1 promoter and terminator sequences into the URA3 locus o f an industrial wine yeast strain. The malolactic yeast strain, M L 0 1 , completes the M L F during the alcoholic fermentation in a variety o f musts including a high acid Chardonnay must containing 9.2 g/L o f malate. M L 0 1 cannot appreciably decarboxylate L-malic acid to L lactic acid when present at levels below 1% o f the total inoculum. M L 0 1 contains no antibiotic resistance marker genes or vector D N A sequences. Global gene expression patterns and analysis o f the proteome showed that no metabolic pathway was affected by the introduction o f the malolactic cassette. The presence o f the malolactic cassette in the genome does not affect growth, ethanol production, fermentation kinetics or metabolism of M L 0 1 . Wines produced by the M L 0 1 yeast have lower volatile acidity and improved color properties compared to wines produced with the parental yeast and a bacterial M L F . G C / M S analysis o f volatile compounds revealed that wine produced by M L 0 1 did not contain any compounds that were not detected in wine produced with the parental strain S92 or with S92 and malolactic bacteria. Moreover, M L 0 1 reduces the processing time after alcoholic fermentation and produces wine that is judged highest in overall quality by trained tasters.  Analyses o f the phenotype, D N A , R N A , and proteins demonstrate that the recombinant yeast M L 0 1 is substantially equivalent to the parental strain S92. M L 0 1 has been approved for use in Canada and has 'Generally Regarded A s Safe' status with the U S F D A . It is the first metabolically engineered yeast to be commercialised by the wine industry and is currently available in Canada, the U S A and Moldova.  T A B L E OF C O N T E N T S  ABSTRACT  ii  T A B L E OF CONTENTS  iv  LIST OF T A B L E S  xi  LIST OF F I G U R E S  xiv  LIST OF A B B R E V I A T I O N S  xvi  PREFACE  xxi  ACKNOWLEDGEMENTS  xxii  1 INTRODUCTION  1  1.1 Saccharomyces cerevisiae  2  1.2 Overview o f winemaking  4  1.3 The malolactic fermentation  7  1.3.1 W i n e acidity  7  1.3.2 Oenococcus ami and other lactic acid bacteria o f wine  8  1.3.3 Biochemistry o f the malolactic fermentation  11  1.3.4 The effect o f the malolactic fermentation on wine and the winemaking process 1.4 Genetic engineering o f Saccharomyces cerevisiae to perform the M L F  11 17  1.5 Genetically engineered Saccharomyces cerevisiae strains in the wine industry.... 21 iv  1.6 Proposed Research  31  1.6.1 Significance o f research  31  1.6.2 General hypothesis  31  1.6.3 M a i n objectives  32  2 MATERIALS A N D METHODS  33  2.1 Strains and plasmids employed i n the genetic construction and characterisation of M L 0 1  33  2.2 Culture conditions  34  2.3 Genetic construction o f malolactic wine yeast  35  2.3.1 Co-transformation o f the malolactic cassette and pUT332  35  2.3.2 Screening o f transformants for the integrated malolactic cassette  36  2.3.3 Loss o f plasmid pUT322  37  2.4 Functionality o f malolactic wine yeast  37  2.4.1 Malate decarboxylation and residual sugar concentrations o f wine produced by malolactic clones 2.4.2 Functionality o f active dry wine yeast M L 0 1 2.5 Genetic characterisation o f M L 0 1  37 38 38  2.5.1 Chromosome karyotyping o f M L 0 1 and S92  38  2.5.2 Southern blot analyses  39  2.5.3 Sequencing o f the malolactic cassette integrated into the genome o f M L 0 1 .. 40 2.5.4 Sequence analysis  42  2.5.5 Genetic stability o f the malolactic cassette in the genome o f M L 0 1  42 v  2.5.6 Global gene expression analyses  43  2.5.7 Confirmation o f D N A microarray results by Real-Time P C R  45  2.5.8 Transcription o f URA3 and transgenes mael and mleA  46  2.5.9 Analysis o f the proteome o f M L 0 1  47  2.6 Phenotypic characterisation o f M L 0 1  49  2.6.1 Growth kinetics o f M L 0 1  49  2.6.2 Utilization o f malate as sole carbon source by M L 0 1 and S92  50  2.6.3 Winemaking with M L 0 1  51  2.6.4 Analyses o f must and wine  54  2.6.5 Sensory analysis  55  2.6.6 Analysis o f volatile compounds in wine by gas chromatography/mass spectrometry 2.6.7 Quantification o f ethyl carbamate in wine produced by M L 0 1  57 58  2.6.8 Effect o f residual M L 0 1 populations on M L F in wine fermented primarily with the parental strain S92 2.6.9 Post-fermentation viability o f M L 0 1 2.7 Statistical analyses  3 RESULTS  58 59 59  61  3.1 Integration o f the malolactic cassette into the genome o f S92  61  3.2 Functionality o f malolactic wine yeast  61  3.3 Genetic characteristics o f M L 0 1  63  3.3.1 Confirmation o f the identity o f the parental strain  63  vi  3.3.2 Correct integration o f the malolactic cassette into the genome o f M L 0 1  63  3.3.3 Genetic stability o f the malolactic cassette in the genome o f M L 0 1  66  3.3.4 M L 0 1 does not contain bla and Tn5ble antibiotic markers  66  3.3.5 Sequence o f the malolactic cassette integrated into the genome o f M L 0 1  68  3.3.6 Effect o f the integrated malolactic cassette on the transcriptome o f M L 0 1 .... 71 3.3.7 Effect o f the integrated malolactic cassette on the proteome o f M L 0 1 3.4 Phenotypic properties o f M L 0 1  76 77  3.4.1 Growth kinetics  77  3.4.2 Utilization o f malate as sole carbon source by M L 0 1 and S92  77  3.4.3 Malolactic fermentation in Chardonnay and Cabernet Sauvignon musts by M L 0 1  78  3.4.4 Sensory profile o f Chardonnay wines produced by M L 0 1  84  3.4.5 Volatile compounds in wine produced by M L 0 1  88  3.4.6 Ethyl carbamate in wine produced by M L 0 1  90  3.4.7 Effect o f increasing populations o f M L 0 1 on M L F in wine conducted with the parental yeast 3.4.8 Post-fermentation viability o f M L 0 1  4 DISCUSSION  91 93  94  4.1 Integration o f the malolactic cassette into the genome o f S92 yielded the functional malolactic yeast M L 0 1  95  4.2 M L 0 1 completes the M L F during alcoholic fermentation in Chardonnay and Cabernet Sauvignon musts  97  4.3 Wines produced by M L 0 1 have improved physicochemical and organoleptic properties  ,  99  4.4 Integration o f the malolactic cassette in S92 does not confer an advantage to M L 0 1 nor does it affect the production o f A D Y or wine making  104  4.5 The malolactic cassette without any antibiotic resistance markers is integrated correctly and stably into the genome o f M L 0 1  105  4.6 The malolactic cassette has a minimal effect on the transcriptome and proteome o f M L 0 1  110  4.7 Ethical considerations concerning use o f the genetically modified yeast ML01  114  5 CONCLUSIONS 5.1 Future Directions  REFERENCES  APPENDIX A  124  125  Schematic representation o f pUT332 and probes used to confirm the absence o f antibiotic markers in M L 0 1  APPENDIX B  121  156  Strategy for sequencing the malolactic cassette from the genome ofMLOl  157  A P P E N D I X C The University o f British Columbia Clinical Research Ethics Board approval certificates for sensory analysis o f wines produced by M L 0 1  158  APPENDIX D  Participant consent form  160  APPENDIX E  P C R confirmation o f the screening method  164  APPENDIX F  Degradation o f malate and consumption o f glucose and fructose by malolactic wine yeast clones  APPENDIX G  Confirmation o f the identity o f the parental strain by P C R amplification o f the d elements o f the T y l retrotransposon  APPENDIX H  165  166  Southern blot confirming integration o f the malolactic cassette into the URA3 locus o f S92 (PGK1 promoter probe)  167  APPENDIX I  Ascospore formation by the M L 0 1 and S92 strains  168  APPENDIX J  Detailed description o f the D N A sequences that comprise the malolactic cassette  APPENDIX K  Discrepancies between the integrated malolactic cassette and published sequences  APPENDIX L  169  172  Confirmation o f D N A microarray data b y real-time reverse transcription P C R  173  APPENDIX M  Transcripts o f mael, mleA and URA3 in the M L 0 1 yeast  174  APPENDIX N  Vinification trials with M L 0 1 and S92 i n Chardonnay must (2004 harvest)  175  ix  A P P E N D I X O Physicochemical characteristics o f Chardonnay wines (2004 harvest)  APPENDIX P  produced by M L 0 1 , S92, and S92 plus O. ceni  176  Correlation matrix  177  A P P E N D I X Q Health Canada approval to use M L 0 1 for the commercial production o f wine i n Canada  A P P E N D I X R U S Food and D r u g Administraion G R A S notice  178  180  LIST OF TABLES  Table 1.  Oenological targets for the genetic improvement o f S. cerevisiae wine strains  22  Table 2.  Genetic engineering o f wine yeast and stratagies used for their modification  24  Table 3.  Different strains used in the metabolic engineering and characterisation o f the malolactic yeast M L 0 1  Table 4.  33  Different plasmids used in the metabolic engineering and characterisation o f malolactic clone M L 0 1  Table 5.  34  Primers used for the sequencing o f the malolactic cassette integrated into S. cerevisiae M L O l  Table 6.  41  Primers used i n semi-quantitative reverse transcriptase real-time P C R to confirm D N A microarray data  46  Table 7.  Definition o f sensory attributes for visual, olfactory and gustatory evaluations  56  Table 8.  Effect o f the integrated the malolactic cassette in the genome o f S92 on global gene expression patterns in S. cerevisiae M L O l at 48 hours (> 2 fold change)  Table 9.  Effect o f the integrated malolactic cassette in the genome o f S92 on global gene expression patterns in S. cerevisiae M L O l at 144 hours (> 2 fold change)  Table 10.  74  74  Physicochemical and colour measurements o f high-acid Chardonnay wines (2000 harvest) produced by M L O l , S92 and S92 plus O. ami  82 xi  Table 11.  Physicochemical and colour measurements o f Cabernet Sauvignon wines produced by M L 0 1 , S92 and S92 plus O. ami  Table 12.  83  F-values from analysis o f variance o f Chardonnay wines for sensory attributes (three wines, 14 judges, two replications)  Table 13.  85  Concentration o f volatile compounds in Chardonnay wines produced with ML01,S92,S92plusa«m  Table 14.  89  The production o f ethyl carbamate in Chardonnay wines produced with M L 0 1 , S92 and S92 with a bacterial M L F  Table 15.  91  Degradation o f malate (g/L) by individual colonies o f malolactic clones inoculated into synthetic must containing 4.5 g/L o f malate  Table 16.  165  Consumption o f glucose (g/L) by individual colonies o f malolactic clones inoculated into synthetic must containing 100 g/L o f glucose (and 100 g / L fructose)  Table 17.  165  Consumption o f fructose (g/L) by individual colonies o f malolactic clones inoculated into synthetic must containing 100 g/L o f fructose (and 100 g / L glucose)  165  Table 18.  Comparison o f the M L 0 1 and S92 strains capability to sporulate  168  Table 19.  The source and description o f the malolactic cassette D N A sequences  169  Table 20.  Discrepancies found when comparing the genomic sequence o f the integrated locus and previously published sequences  172 xii  Table 21.  Comparison o f fold change data for ten genes as determined by D N A microarray and by real-time reverse transcription P C R  Table 22.  Table 23.  173  Physicochemical and colour measurements o f Chardonnay wines (2004 harvest) produced by M L O l , S92 and S92 plus O. ami  176  Correlation matrix obtained from the sensory analysis o f Chardonnay wines  177  xin  LIST OF FIGURES  Figure 1.  Schematic representation o f the malolactic cassette integrated into the URA3 locus o f S. cerevisiae S92  Figure 2.  61  Test for L-lactic acid production in S92 cells transformed with the malolactic cassette and pUT332  62  Figure 3.  M L 0 1 and S92 chromosomes as separated by pulsed field gel electrophoresis  63  Figure 4.  Integration o f the malolactic cassette into the URA3 locus o f S92 was confirmed b y Southern blot analysis using a URA3 probe  Figure 5.  64  Integration o f the malolactic cassette into the URA3 locus o f S92 was confirmed by Southern blot analysis using a mleA probe  Figure 6.  65  Integration o f the malolactic cassette into the URA3 locus o f S92 was confirmed by Southern blot analysis using a mael probe  65  Figure 7.  The phleomycin resistance gene is absent in the genome o f M L 0 1  67  Figure 8.  The ampicillin resistance gene and 970 bp o f pUT332  non-Saccharomyces  vector are absent in the genome o f M L 0 1  Figure 9.  68  The upstream and downstream sequences flanking the malolactic cassette in S. cerevisiae M L 0 1 are 100% identical  69  xiv  Figure 10. A schematic representation o f new open reading frames (ORFs) o f more than 100 codons generated during construction o f the malolactic cassette; four new O R F s primarily composed o f S. cerevisiae sequences, were created  70  Figure 11. Malate degradation and lactate production by M L O l and S92 yeast strains in synthetic must (n=3)  72  Figure 12. Growth o f M L O l and S92 yeast strains i n synthetic must (n=3)  73  Figure 13. Ethanol production and C 0 loss o f M L O l and S92 yeast strains in synthetic 2  must (n=3)  75  Figure 14. M L O l and S92 cannot consume L-malate as a sole carbon source  78  Figure 15. Ethanol production by M L O l and S92 i n high-acid Chardonnay grape must fermented at 20 °C was positively affected b y introduction o f the malolactic cassette into a URA3 locus i n the industrial wine yeast S92  80  Figure 16. M L F by M L O l is completed in the first five days o f the alcoholic fermentation in high-acid Chardonnay grape must (9.2 g/L)  81  Figure 17. Cobweb diagram showing the significantly different mean sensory attributes o f Chardonnay wines produced by M L O l , S92, and S92 plus O. ceni (n=26)  86  Figure 18. A principal component analysis plot showing the significantly different mean sensory attributes for Chardonnay wines produced by M L O l , S92, and S92 plus O. azni  87  xv  Figure 19. M L F was not detected i n wines containing an inoculum less than 1% o f M L 0 1 yeast  :  92  Figure 20. Post-fermentation viability o f M L 0 1 is similar to that o f S92 in Chardonnay wine  93  Figure 21. Plasmid map o f pUT332 and schematic representation o f the probes used i n Southern blot experiments to confirm the absence o f antibiotic markers in S.  cerevisiae M L 0 1  156  Figure 22. Strategy used to sequence the malolactic cassette from the genome o f S.  cerevisiae M L 0 1  157  Figure 23. P C R confirmation o f the screening method used to detect integration o f the malolactic cassette into the URA3 locus o f S92  164  Figure 24. Genetic patterns o f the M L 0 1 and the S92 yeast strains based on amplification o f genomic D N A regions in between d elements o f the T y l retrotransposon  166  Figure 25. Integration o f the malolactic cassette into the URA3 locus o f S92 was confirmed by Southern blot analysis using a PGK1 promoter probe  167  Figure 26. The presence o f the mael, mleA and URA3 transcripts i n the M L 0 1 yeast during fermentation  174  Figure 27. Malate degradation and lactate and ethanol production by M L 0 1 and S92 i n Chardonnay must (from fruit harvested i n 2004).....  175  xvi  LIST OF ABBREVIATIONS  aa  A m i n o acid  ADY  Active dry yeast  amu  Atomic mass unit  ANOVA  Analysis of variance  AO AC  Association of Official Analytical Chemists  bp  Base pair  BC  British Columbia  BCE  Before the Common Era  °C  Degree Celsius  cDNA  Complementary deoxyribonucleic acid  CFU  Colony forming units  CIELAB  Color model o f the International Commission on Illumination  cm  Centimetre  Co.  Company  cRNA  Ribonucleic acid derived from c D N A  DNA  Deoxyribonucleic acid  DTT  Dithiothreitol  EC  Ethyl carbamate  EDTA  Ethylenediamine tetraacetic acid  FDA  Food and Drug Administraion  g  gram  g  .  Unit of acceleration (9.80665 m/s ) 2  xvn  GC  Gas chromatography  GC/MS  Gas chromatography-mass spectrometry  GM  Genetically modified  GMO  Genetically modified organism  GO  Gene ontology  GPvAS  Generally regarded as safe  hL  hectolitre  ID  Inner diameter  kbp  kilo base pair  kg  kilogram  L  Litre  LAB  Lactic acid bacteria  LC MS/MS  Liquid chromatography-tandem mass spectrometry  log  Logarithm  LSD  Least square difference  m  metre  M  Molarity  uL  microlitre  um  micrometre  u ax  M a x i m u m specific growth rate  mg  milligram  min  minute  mL  millilitre  m  MLF  Malolactic fermentation  mM  millimolar  MMTS  Methyl methanethiosulphonate  MS  Mass spectrometer  NAD  Nicotinamide adenine dinucleotide  NCBI  National Center for Biotechnology Information  ng  nanogram  nt  nucleotide  OD  Optical density  ORF  Open reading frame  PARC  Pacific Agri-Food Research Centre  PCA  Principal component analysis  PCR  Polymerase chain reaction  PDM  Prise de Mousse  PEST  Protein region that consists o f proline, glutamic acid, serine, threonine and to a lesser extent aspartic acid  PFGE  Pulsed Field G e l Electrophoresis  RNA  Ribonucleic acid  rpm  Revolutions per minute  RT-PCR  Reverse transcriptase - polymerase chain reaction  s  second  SCX  Strong cation exchange  SDS-PAGE  Sodium dodecyl sulfate polyacrylamide gel electrophoresis  xix  SGD  Saccharomyces genome database  sp.  Species  SPME  Solid phase microextraction  TA  Titratable acidity  TBE  Buffer consisting o f Tris base, boric acid, E D T A and water  TCA  Tricarboxylic acid  TE  Buffer consisting of Tris base, E D T A and water  TOFMS  Time-of-flight mass spectrometry  UK  United Kingdom  USA  United States o f America  V  volt  v/v  volume per volume  YANC  Yeast assimilable nitrogen concentration  YEG  M e d i u m consisting o f yeast extract and dextrose  YPD  M e d i u m consisting o f yeast extract, peptone, and dextrose  xx  PREFACE The following dissertation is prepared in the traditional format as described by the Faculty o f Graduate Studies at the University o f Brtitsh Columbia. It encompasses two different fields of study, oenology and molecular biology. Hence, some o f the terms used by oenologists may not be familiar to molecular biologists and vice versa. In most cases the meaning of certain terms w i l l be evident to the reader. The remaining terms, such as "must" may be confusing to non-oenologists and therefore I have provided a short list o f definitions o f such oenological terms.  Brix  A measurement o f the dissolved solids (primarily sugars) in fruit juices at 20°C.  Lees  The sediment from an alcoholic fermentation (primarily composed o f yeast).  Must  The unfermented or fermenting juice o f grapes (or other fruits).  Racking  The process o f removing wine off the lees to allow clarification and aid in stabilisation.  xxi  ACKNOWLEDGEMENTS I would like to acknowledge the contributions o f the following people and organisations, each o f whom played a critical role in the completion o f this research and m y development as a scientist. First m y sincere thanks to Dr. Hennie J J . van Vuuren, m y Research Supervisor, for his support, guidance in writing this thesis, financial assistance, and for the innumerable occasions that I have knocked on his door and was immediately welcomed. Working with Prof has provided me the opportunity to do cutting edge research i n a very well equipped laboratory, and helped me to appreciate how fundamental science can partner effectively with industry. I truly appreciate the opportunities that have been presented to me as a member o f his lab. I would also like to acknowledge the contributions o f m y Supervisory Committee: Dr. Brian Ellis, Dr. Phil Hieter and D r . J i m Kronstad. I appreciate the breadth o f experience and perspectives which they brought to our meetings and I learned a lot from their advice and criticism. A special thank you to Dr. R o n Subden (University o f Guelph), who was key to m y early development as a scientist and M r . J.P. Rossi (Lesaffre International) for his commitment to the idea o f a commercial malolactic wine yeast strain. I am also thankful for the productive collaboration with Drs. Jurgen Bauer, Margaret Cliff, Didier Colavizza, Pascal J. Delaquis, Zongli L u o , and Heinrich Volschenk, m y co-authors on the manuscripts that have arisen thus far from this thesis. Also a thank you to my W i n e Research Centre lab colleagues past and present, especially Dr. Joanna Coulon, Dr. Danie Erasmus, Dr. Zongli Luo, Dr. George van der M e r w e and  xxn  Dr. Heinrich Volschenk for their friendship and scientific discussions. I would also like to thank my colleagues and friends at Lesaffre Development, especially J.P. Rossi^, D r . Didier Colvizza, Dr. Jurgen Bauer, and Olivier Letalleur that welcomed me to their research centre in Marcq-en-Baroeul, France. I greatly appreciate the contributions o f those who funded this research or a portion o f m y studies: Natural Sciences and Engineering Research Council o f Canada, Lesaffre International and the Canadian Vintners Association. Thank you also to the Genetics Graduate program and the U B C Faculty o f Graduate Studies for their assistance with travel awards to enable me to present some o f my results at international conferences. I would also like to thank D r . Hugh Brock and M o n i c a from the Genetics Graduate Program for their assistance over the years. A n d a final thank you to m y parents, Ignac and Annie Husnik, and m y sister, Angela, for their unconditional support. Their love and sincere happiness in m y pursuits are, and have always been, a great source o f encouragement, fala. A l s o thank you to B o b and Marlene Rideout for their support and assistance. To Candice, thank you, thank you, and thank you - for the love, inspiration, motivation, and support you provided. I also greatly appreciate the time you have spent reviewing this dissertation, the help with the preliminary pages, and for all o f the suggestions and comments throughout the manuscript. The thought o f trying to complete this thesis without you is unimaginable.  * - deceased  xxin  1 INTRODUCTION Approximately 27 billion litres o f wine are produced annually worldwide (Pretorius and Bauer, 2002); the quality o f wine depends on the grapes used i n its production, the microorganisms involved in the alcoholic and malolactic fermentations, and the skills o f the winemaker. The malolactic fermentation ( M L F ) is an indispensable tool for the deacidification o f high acid grape must; it is also one o f the most difficult steps to control in the winemaking process. Oenococcus ceni and other lactic acid bacteria ( L A B ) deacidify wine by converting L-malic acid to L-lactic acid and CO2, resulting i n a decrease in titratable acidity and an increase in wine p H (Bousbouras and Kunkee, 1971).  The decarboxylation o f malate to lactate is catalyzed by the malolactic  enzyme ( L - m a l a t e : N A D carboxy lyase) without the production o f any free intermediates +  (Caspritz and Radler, 1983; Naouri et al., 1990; Spettoli et al., 1984). The reduction o f acidity i n wine is particularly important in cooler climates where L-malic acid can be present at concentrations up to 9 g/L. In spite o f the use o f commercially available bacterial malolactic starter cultures, stuck and sluggish M L F s are common in wines because growth o f L A B can be inhibited by many factors including sulphur dioxide, low temperature, p H , ethanol, l o w nutrient content o f wine, the presence o f fatty acids and interactions with other microorganisms (see reviews Davis et al., 1985; Henick-Kling, 1995; van Vuuren and Dicks, 1993; W i b o w o et al., 1985). For the entire duration o f the bacterial M L F , wine is at risk from microbial spoilage and oxidation since the addition o f sulphur dioxide must be delayed and the temperature is often elevated in order to achieve a satisfactory M L F . Moreover, L A B can produce toxic substances such as biogenic amines and precursors o f ethyl  1  carbamate that are o f concern to consumers (Liu, 2002; Lonvaud-Funel, 2001; Marcobal et al., 2006). This research was undertaken to construct and characterise an industrial wine yeast strain that can avoid the negative aspects o f the bacterial M L F by completing the M L F during the alcoholic fermentation. The resulting wine can be immediately sulphited and processed; thereby reducing the effects o f chemical oxidation and the probability o f microbial spoilage and the production o f off-flavours. The construction o f a malolactic yeast strain that can complete the M L F during the alcoholic fermentation w i l l be a significant addition to the repertoire o f tools that winemakers can access to produce highquality wines that should be free o f toxic biogenic amines such as histamine and tyr amine. In this chapter the yeast Saccharomyces cerevisiae w i l l be briefly introduced, followed by an overview o f winemaking, a detailed description o f the M L F and the history o f the genetic engineering o f S. cerevisiae to perform the M L F . Finally, a review of all the genetically engineered S. cerevisiae strains applicable to the wine industry w i l l be presented.  1.1 Saccharomyces cerevisiae The budding yeast S. cerevisiae is considered by many as a domesticated unicellular organism. For centuries, S. cerevisiae has been used by humans i n the fermentation industries o f baking, brewing, distilling and winemaking. In 1996, the laboratory strain o f S. cerevisiae S288C, was the first eukaryotic organism to have its entire genome sequenced (Goffeau et al., 1996). S288C is largely derived from a strain,  2  E M 9 3 , that was originally isolated in 1938 from rotting figs (Mortimer and Johnston, 1986). The yeast genome contains approximately 5800 genes (-70% characterised as o f September, 2006) (http://www.yeastgenome.org/) containing relatively few introns and little repetitive D N A . Haploid laboratory strains have approximately 12-13 M b o f D N A confined to 16 linear chromosomes (Olson, 1991). Saccharomyces cerevisiae as haploid or diploid cells can reproduce vegetatively through budding. Haploids can be either "a" or " a " mating types; mating o f opposite types w i l l yield a diploid cell (Herskowitz, 1988). D i p l o i d cells can undergo sporulation (meiosis), induced by growth i n poor carbon sources or nitrogen starvation, to produce four haploid spores formed within an ascus (Herskowitz, 1988). The recovery o f the meiotic products allows advanced genetic analyses to be performed that are not possible in most eukaryotic organisms. S. cerevisiae can also be heterothallic or homothallic. Heterothallic strains have a fixed mating type and homothallic strains are able to switch mating types (Herskowitz, 1988). Most laboratory strains o f S. cerevisiae are haploid or diploid, heterothallic, sporulate efficiently when diploid and contain multiple nutritional auxotrophic mutations. In contrast, industrial strains are predominantly diploid or anueuploid and occasionally polyploid, homothallic, prototrophic and have low sporulation efficiency combined with poor spore viability (Codon et al., 1998; Snow, 1983). Industrial strains are grown under commercial manufacturing conditions to be used as inocula in their respective industries, such as baking and winemaking. W i l d isolates are mostly homothallic diploids that are often heterozygous (Bisson, 2004).  3  Although many natural isolates o f S. cerevisiae have been obtained from grapes, the actual origin o f wine strains is the subject o f some controversy. Some researchers claim that the principal source o f wine yeast is the vineyard (Mortimer and Polsinelli, 1999; Torok et al., 1996); others believe that modern wine strains are the result o f an association with artificial environments such as wineries (Martini, 1993; VaughanMartini and Martini, 1995). The controversy is due to the fact that it is relatively difficult to find S. cerevisiae on the surface o f healthy, undamaged grapes (Martini, 1993), although it can be isolated in berries damaged b y birds or insects which represent about 1 in 100 grapes (Landry et al., 2006). The population size o f S. cerevisiae within any damaged fruit can range from 10 to 10 cells (Mortimer and Polsinelli, 1999). However, 4  5  a recent investigation on the survival and development o f an inoculated S. cerevisiae wine strain showed that this particular wine strain failed to colonise and was unable to out compete the epiphytic yeast present on damaged and undamaged grapes (Comitini and Ciani, 2006). Other environments that S. cerevisiae has been isolated from include soil associated with oak trees (Sniegowski et al., 2002), the Danube River (Slavikova and Vadkertiova, 1997) and occasionally from immunocompromised humans (Malgoire et al., 2005; Sethi and Mandell, 1988). Evidence also exists that insects and birds are important vectors for the dispersal o f yeasts (Mortimer and Polsinelli, 1999; Phaff and Starmer, 1987).  1.2 O v e r v i e w of w i n e m a k i n g Several lines o f archaeological evidence suggest that wine was made as early as the seventh century B C E (Robinson, 1994). Molecular evidence for fermentation by S.  4  cerevisiae in wine has been obtained from wine jars discovered i n Egypt dating back to 3150 B C E (Cavalieri et al., 2003). Alcoholic fermentation represents the oldest form o f biotechnological application o f microorganisms and from the early days o f winemaking to the present, the basic principles have changed very little. Following the harvest o f grapes (which can be performed manually or b y machine), the berries are delivered to the winery where they are crushed and the stems removed. A t this point, modern winemakers generally add pectolytic enzymes to increase the volume o f free juice and to assist with clarification (Moreno-Arribas and Polo, 2005). After crushing, the grape must can be used directly for fermentation (for red wines) or pressed to separate the juice from the skins (for white wines). The must may be fermented with selected wine yeast strains or left to be fermented by the resident microflora found on the surfaces o f grapes and i n the winery. The inoculation o f commercial yeast starter strains into must was started in the 1960s and by the mid-1980s became common practice i n most o f the world's wine regions (Moreno-Arribas and Polo, 2005; Reed and Nagodawithana, 1988). Approximately 150 different strains are now commercially available; these strains produce high quality wines with reproducible characteristics including a complete and rapid fermentation (Schuller and Casal, 2005). In uninoculated "spontaneous" fermentations there is a sequential growth pattern o f indigenous yeasts. Yeast o f the genera Kloeckera, Hanseniaspora and Candida generally predominate in the early stages, followed b y Metschnikowia and Pichia when ethanol concentrations reach 3-4% (Fleet and Heard, 1993). The final stages are ultimately dominated by the ethanol-tolerant S. cerevisiae, which rapidly ferments the present sugars (18-40%, depending on style and geography o f wine being  5  produced) to produce ethanol and carbon dioxide (Querol et al., 2003). The high levels of ethanol, the low p H , osmotic stress and anaerobic conditions essentially eliminate the other less tolerant microorganisms. During the fermentation o f red wines, the skins and other insoluble material w i l l form a cap on the surface that must be submerged or stirred in order to extract the skin cell components (Bisson, 2004). The cap can be submerged by either "punching down" or must from the bottom o f the tank can be "pumped over" the cap. Red wines are also fermented at higher temperatures, 18-30 °C, and whites are commonly fermented at 1218 °C. After the alcoholic fermentation, certain styles o f wines are immediately treated with SO2 to prevent chemical oxidation and inhibit microbial activity. Most red wines and certain white wines are not sulphited until after they have undergone a M L F . After the M L F , the wine is clarified by racking, fining, centrifuging or filtering (Boulton, 1996). The winemaker may also choose to delay the clarification i n order to extract desired flavours from the lees (yeast sediment) (Ough, 1992). During wine processing and storage, the SO2 levels are adjusted to prevent oxidation o f wine and proliferation o f spoilage microorganisms; protective SO2 levels are then monitored and maintained until bottling. After clarification, wines can be stored, at low temperatures with no air contact, in inert containers or oak barrels. Prior to the final step in the winemaking process, bottling, wines may be blended and tested for physical instabilities, such as the potential to form precipitates (Boulton, 1996).  6  1.3 The malolactic fermentation The M L F refers to the biological conversion o f the dicarboxylic L-malic acid, into the monocarboxylic acid L-lactic acid, and CO2. In 1858, Pasteur's "Memoire sur la fermentation lactique^ revealed that the M L F was caused by living organisms; MullerThurgau, i n 1891, showed that the organisms were bacteria (Bartowsky, 2005; Paul, 1996). In 1901, the equation for the conversion o f L-malic acid to L-lactic acid and CO2 was independently revealed by Moslinger and Seifert (Bartowsky, 2005). In 1928, using Moslinger and Seifert's equation, Ferre showed that the bacteria transformed 1.0 g o f malic acid into 0.671 g o f lactic acid and 0.329 g o f CO2 (Paul, 1996). Since this time, M L F has continued to attract considerable attention from researchers around the globe. The bacterial M L F is an important secondary fermentation that typically occurs after the alcoholic fermentation has been completed. The M L F deacidifies wine and is favoured i n cool-climate regions (such as northern Europe, eastern United States, N e w Zealand and Canada) where the grapes at harvest tend to have naturally higher acid at harvest. Conversely, in warmer regions o f the world, grapes usually have lower levels o f acidity and the M L F is less desired (Beelman and Gallander, 1979). The difference in total fixed acids between cool and warm climates is partly the result o f respiratory catabolism o f L-malic acid by the grape that is enhanced by warmer temperature during the ripening (Jackson and Schuster, 1987).  1.3.1 Wine acidity Grape juice contains a variety o f organic acids, the dominant acids being tartaric, malic and citric acids. Tartaric and malic acids represent, on average, 90% o f the  7  titratable acids prior to the fermentation (Boulton, 1996; Radler, 1993; Ribereau-Gayon et al., 2000a). Near maturity i n warmer climates, tartaric acid is the predominant acid i n grapes, accounting for 2.0-8.0 g/L, with malic acid accounting for 10-40% o f the total acid fraction (Boulton, 1996; Ough, 1992). In cooler climates or in grapes picked at early maturity, the amounts o f malic acid can exceed those o f tartaric acid and may constitute as much as 60% o f the organic acid fraction (Boulton, 1996; Ough, 1992). M a l i c acid is usually present i n grapes at concentrations ranging from 2.0-6.0 g/L (Boulton, 1996), but can reach 9 g / L i n cool viticultural areas. L - M a l i c acid is an essential compound, with important cellular functions i n metabolic pathways such as the tricarboxylic acid ( T C A ) cycle, glyoxylate cycle, and malate-aspartate shuttle; i n grapes it is synthesized from glucose v i a pyruvate (Mathews and van Holde, 1990). Smaller amounts o f citric acid and trace amounts o f other acids o f the citric acid cycle are also present i n the juice.  1.3.2 Oenococcus ceni and other lactic acid bacteria of wine Lactic acid bacteria ( L A B ) responsible for the M L F i n wine are from the bacterial genera Lactobacillus, Pediococcus, Leuconostoc and Oenococcus (Dicks et al., 1995; London, 1976; van Vuuren and Dicks, 1993). The L A B can be isolated from the skins o f healthy grape berries in low concentrations (<10 colony forming units/g) (Fleet, 1998; 3  Lonvaud-Funel, 1999; W i b o w o et al., 1985) and can also be found i n the winery (Boulton, 1996). In grape must the L A B population varies from 10 cfu/mL to 10 2  4  cfu/mL, however, during alcoholic fermentation the L A B population w i l l decrease to a few cells per m L (Lonvaud-Funel, 1999; van Vuuren and Dicks, 1993). Moreover, the original diversity o f the species diminishes and O. ceni typically remains as the  8  predominant L A B at the end o f alcoholic fermentation (Lonvaud-Funel, 1999; Tracey and Britz, 1989; van Vuuren and Dicks, 1993). In 1967, O. ami was first characterised and classified as Leuconostoc oenos, to differentiate it from other less acid-tolerant Leuconostoc species (Garvie, 1967). Leuconostoc oenos was later re-classified into the new genus, Oenococcus, o f which O. ceni is the only species (Dicks et al., 1995). The genomes o f two O. ami strains, IOEB8413 and P S U 1 , have recently been sequenced (Klaenhammer et al., 2002; M i l l s et al., 2005), although neither o f the sequences are currently accessible by the public. The reported size o f the O. ceni genomes are 1.78 and 1.75 M b for P S U 1 and IOEB8413, respectively ( M i l l s et al., 2005). The use o f multilocus sequence typing and phylogenetic analyses revealed that O. ceni seems to have a high level o f genetic heterogeneity and may also have a panmictic (highly variable) population structure (de las Rivas et al., 2004). A number o f O. ami genes have also been studied at the molecular level including genes associated with the M L F (Denayrolles et al., 1994; Labarre et al., 1996a; Labarre et al., 1996b; Volschenk et al., 1997b), genes involved with diacetyl metabolism (Garmyn et al., 1996), genes associated with amino acid metabolism (Coton et al., 1998a; D i v o l et al., 2003; Marcobal et al., 2004; Tonon et al., 2001), and stress-related genes (Bourdineaud et al., 2003; Bourdineaud et al., 2004; Fortier et al., 2003; Jobin et al., 1999a; Jobin et al., 1999b; Jobin et al., 1997). A putative glucosyltransferase gene, dps, was also detected i n O. ami isolated from a highly viscous wine (Walling et al., 2005). The M L F begins during the early stages o f O. oeni growth (or the growth o f other L A B ) and a significant rate o f malate degradation is usually not observed until cell densities reach a concentration o f 10 cfu/mL or more (Costello et al., 1983; Lafon6  9  Lafourcade et al., 1983; W i b o w o et al., 1985). L A B cannot grow with L-malic acid as a sole carbon source and they rely on residual sugars not fermented by the yeast ( L i u et al., 1995a) or amino acids such as arginine to allow cell growth ( L i u and Pilone, 1998). Although, O. ceni cannot grow on L - m a l i c acid as a sole carbon source, the malolactic conversion confers an energetic advantage to the cell. The M L F provides cells with additional metabolic energy from the increased intracellular p H which produces an increased proton motive force (? p) across the cytoplasmic membrane (Cox and HenickK l i n g , 1989; C o x and H e n i c k - K l i n g , 1995). The proton gradient is created across the cell membrane after one molecule o f lactate (after malate decarboxylation) leaves the cell accompanied by one H (Cox and H e n i c k - K l i n g , 1989). The resulting increase i n the +  proton gradient can be used to drive transport processes and to produce A T P v i a the membrane-bound A T P a s e (Cox and H e n i c k - K l i n g , 1989; H e n i c k - K l i n g , 1995; Olsen et al., 1991). A t a p H o f <4.5 and with limited amounts o f sugar (as prevalent in wine conditions), the additional A T P can allow for increased growth yields (Garcia et al., 1992; H e n i c k - K l i n g , 1993; Renault et al., 1988). This theory helps to explain a stimulatory effect observed during the early stages o f growth (Kunkee, 1991). In addition to indirect generation o f A T P , the M L F may allow O. ceni to take up nutrients by the chemiosmotic mechanism and help to maintain a suitable p H for enzymatic activity and cell growth (Cox and H e n i c k - K l i n g , 1989). Once all o f the malic acid is decarboxylated, wine is sulphited and further activity from O. ceni is inhibited (as well as activity from other S02-sensitive bacteria and yeast). After the M L F , the risk o f further microbial activity in the wine is considerably reduced  10  since the wine is essentially depleted o f essential nutrients and fermentable substrates (Davis etal., 1988).  1.3.3 Biochemistry of the malolactic fermentation Decarboxylation o f L-malic acid to L-lactic acid is catalyzed by L - m a l a t e : N A D  +  carboxy lyase without the production o f any free intermediates (Caspritz and Radler, 1983; Naouri et al., 1990; Spettoli et al., 1984). This enzyme has been termed the malolactic enzyme and it requires the cofactors M n  2 +  and N A D (Caspritz and Radler, +  1983; Naouri et al., 1990; Spettoli et al., 1984). The malolactic enzyme was first purified from Lactobacillusplantarum  (Lonvaud, 1975; Schutz and Radler, 1973).  Characteristics o f the malolactic enzyme from the various malolactic bacteria (£. plantarum, L. casei, L. murinas, L. mesenteroides, and O. ceni) show significant differences in regards to the enzyme affinity constants for L-malic acid, N A D  +  and M n , 2 +  but they are quite similar in molecular weight (ranging form 60-70 kDa) (Battermann and Radler, 1990; Caspritz and Radler, 1983; Lonvaud-Funel and Desaad, 1982; Naouri et al., 1990; Schutz and Radler, 1973; Spettoli et al., 1984; Strasser de Saad et al., 1984). The malolactic enzyme is hypothesized to be active as a homodimer or homotetramer (Battermann and Radler, 1990; Labarre et al., 1996b) and it is inducible by L-malic acid in the presence o f fermentable sugars (Nathan, 1961; Renault et al., 1989).  1.3.4 The effect of the malolactic fermentation on wine and the winemaking process The main effect o f the M L F on wine is the reduction o f the total acidity and the increase in p H as a result o f the decarboxylation o f L-malate to L-lactate and CO2. The  11  consequences o f an elevated p H can leave some wines susceptible to the growth o f less fastidious spoilage microorganisms whose growth is normally inhibited by low p H (Davis et al., 1988). Bacteriological stability in low-acid wines can be accomplished by the addition o f acidulating agents (tartaric acid, citric acid, lactic acid or D(+)-malic acid) after the M L F (Boulton, 1996; Rankine, 1977). Another disadvantage o f p H increase after the M L F is the relative loss o f colour (up to 30%) i n red wine (Kunkee, 1967). A s wine p H increases, anthocyanin pigments undergo structural changes to uncoloured forms (Jackson, 1994; Lonvaud-Funel, 1999; Ribereau-Gayon et al., 2000b). The most notable sensory difference after a M L F is the disappearance o f the taste o f malic acid ('tart') and the appearance o f lactic acid ('soft'). The next most evident sensory characteristic o f a M L F is the production o f diacetyl, an aroma compound with a 'buttery' or 'butterscotch' flavour/aroma (Martineau et al., 1995a; Martineau et al., 1995b). Diacetyl is produced from the oxidative decarboxylation o f a-acetolactate, an unstable intermediary compound formed during the reductive decarboxylation o f pyruvic acid to 2,3-butanediol (Cogan, 1987; Ramos et al., 1995). Pyruvic acid is derived from the metabolism o f citrate and sugar. Yeast cells are also able to synthesise diacetyl as an intermediary compound but it is generally further reduced to acetoin and 2,3-butanediol during the alcoholic fermentation (Martineau and Henick-Kling, 1995). O. oeni and other L A B in certain conditions are also capable o f further metabolising diacetyl to acetoin and 2,3 butanediol, thereby reducing the buttery sensory characteristics (Ramos et al., 1995). Diacetyl i n wine usually tends to be found at a concentration o f 5-10 mg/1 (LonvaudFunel, 1999).  12  The impact o f the M L F on the organoleptic qualities o f wine beyond the primary role o f deacidification and the production o f diacetyl is not completely defined. Numerous studies have concluded that the M L F affects wine aroma, however, few compounds or mechanisms have been implicated in those changes. The M L F has been implicated i n an increase o f the fruity aroma o f wine (probably due to the production o f esters b y wine L A B ) , a decrease in vegetative/grassy aromas (likely due to the catabolism of acetaldehyde) and it may improve the body, mouthfeel and after taste o f wine (potentially through the production o f polyols and polysaccharides) (Henick-Kling, 1993; L i u , 2002; L i u and Pilone, 2000). These observations suggest benefits to the winemaking process beyond the deacidification that results from the M L F . However, not all sensory changes attributed to the M L F can be considered advantageous (Davis et al., 1985). A substantial increase in acetic acid (the main component o f volatile acidity) can accompany a M L F due to the metabolism o f sugars by L A B , especially i f the yeast did not completely ferment the sugars or the L A B started to multiply prior to the completion o f the alcoholic fermentation (Wibowo et al., 1985). O. ceni and other heterofermentative L A B {Leuconostoc sp. and certain Lactobacillus sp.) ferment hexoses via the phosphoketolase pathway to lactate, ethanol, CO2 and A T P ( L i u , 2002). Acetic acid (and additional A T P ) is generated during hexose fermentation by converting acetyl phosphate to acetate (instead o f ethanol) (Liu, 2002; Pilone et al., 1991). The heterofermentative L A B can also use oxygen and pyruvate as electron acceptors which further results in the production o f more acetate and A T P (Liu, 2002). Homofermentative species of Lactobacillus and Pediococcus produce D-lactic acid and A T P through the Embden-Meyerhof-Parnas pathway (Liu, 2002; Sponholz, 1993).  13  Pentoses are thought to be metabolised by both heterofermentative and homofermentative wine L A B v i a the pentose phosphate pathway to produce A T P , lactate and acetate (Sponholz, 1993). Hence, the volatile acidity o f wine can increase significantly after a bacterial M L F . Other sensory faults attributed to L A B are acrolein formation, development o f a 'mousy' off-flavour and an increase i n viscosity known as 'ropiness'. Acrolein is produced b y L A B degradation o f glycerol and is associated with an unpleasant bitterness (Sponholz, 1993). Mousy off-flavours (2-acetyltetrahydropyridine, 2ethyltetrahydropyridine and 2-acetyl-l-pyrroline) are also produced by L A B , possibly by the catabolism o f glucose and fructose, and the amino acids ornithine and lysine, in the presence o f ethanol (Costello and Henschke, 2002; Lonvaud-Funel, 1999). Ropiness is caused by L A B strains that can synthesize extracellular polysaccharides from residual sugars (Gindreau et al., 2001; Manca de Nadra and Strasser de Saad, 1995). In addition to the production o f spoilage chemicals and cosmetic problems, L A B can produce harmful compounds such as biogenic amines and ethyl carbamate. More than twenty amines have been found i n wine (Lehtonen, 1996), the most notable being histamine, cadaverine, phenylethylamine, putrescine and tyramine (Lonvaud-Funel, 2001; Zee et al., 1983). Biogenic amines are produced from their respective precursor amino acids by specific amino acid decarboxylases. The characterisation o f a histidine decarboxylase gene from an O. ceni strain (Coton et al., 1998a; Coton et al., 1998b) and the tyrosine decarboxylase operon from a Lactobacillus brevis strain (Lucas et al., 2003; Moreno-Arribas and Lonvaud-Funel, 1999; Moreno-Arribas and Lonvaud-Funel, 2001) have been completed. The presence o f biogenic amines in wine can be o f great concern  14  for consumers since these molecules have been shown to produce undesirable physiological effects in susceptible individuals. For example, histamine is known to cause headaches and other allergenic symptoms such as hypotension, edema, palpitations, flushing, diarrhea, and vomiting (Santos, 1996; Soufleros et al., 1998; Wantle et al., 1994). Tyramine and phenyl ethyl amine have been associated with migraines and hypertension (Soufleros et al., 1998). It is important to note that alcohol, acetaldehyde, antidepressant drugs and other biogenic amines such as cadaverine and putrescine can potentiate the toxic effect o f histamine, tyramine and phenyl ethyl amine (Straub et al., 1995; ten Brink et al., 1990). Given that wine consumers w i l l be exposed to toxic biogenic amines through a fermented alcoholic beverage that likely contains acetaldehyde, suggests that the negative effects o f the biogenic amines w i l l in all cases be enhanced. Biogenic amines are also linked to carcinogenesis. Nitrosable secondary amines (dimethylamine, piperidine, pyrrolidine, spermidine, spermine) detected i n wine can react with nitrous acid and its salts to form carcinogenic nitrosoamines (Santos, 1996; Shalaby, 1996). This may represent an additional risk for consumers. Arginine metabolism by certain strains o f O. ceni and other L A B leads to the formation o f ethyl carbamate (urethane) precursors (Liu and Pilone, 1998). Ethyl carbamate is a known animal carcinogen and potential human carcinogen (Ough, 1976; Ough, 1993). Ethyl carbamate precursors i n wine are urea (produced by yeast), and citrulline and carbamyl phosphate (produced by L A B ) . Ethyl carbamate is formed through the chemical reaction o f these carbamylic compounds and ethanol. The metabolism o f arginine in L A B involves three enzymes: arginine deiminase, ornithine transcarbamylase and carbamate kinase ( L i u et al., 1995b). The genes involved in the  15  arginine deiminase pathway have been characterised at the molecular level in O. ceni (Tonon et al., 2001) and L. hilgardii (Arena et al., 2002). The legal limit for ethyl carbamate in table wine i n Canada is 30 ug / L (Battaglia et al., 1990; Conacher et al., 1987), and in the U S A there is a voluntary limit o f 15 ug/L (Canas et al., 1994; L i u and Pilone, 1998). However, there are preliminary data to suggest that wines purchased i n Canada may commonly exceed the legal limit for ethyl carbamate in this country (van Vuuren, personal communication, 2006). Given its potential role as a carcinogen i n humans, ethyl carbamate in wine could represent an additional health risk for habitual wine consumers. A l l L A B , to various degrees, are inhibited by ethanol, low p H , SO2, low temperature, fatty acids produced b y yeasts, decreased nutrient content, competitive interactions with yeast and other L A B , and bacteriophage infections (see reviews by Alexandre et al., 2004; Davis et al., 1985; Henick-Kling, 1993; van Vuuren and Dicks, 1993; W i b o w o et al., 1985). Thus, malolactic bacteria often grow poorly and unpredictably in wine, especially Chardonnay wines, and thereby complicate the management o f the winemaking process. The M L F can also occur in bottled wines, resulting i n off-flavours and trapped carbon dioxide. Even under favourable conditions (optimal p H , no ethanol) the specific growth rate o f O. ceni is low, 0.01 - 0.04 h" on 1  glucose and 0.06 - 0.10 h~' on glucose and fructose (Maicas et al., 1999; Salou et al., 1994; Zhang and Lovitt, 2005). To overcome some o f the difficulties associated with a M L F , selected starter cultures have been developed and commercialized (Maicas et al., 1999; Nielsen et al., 1996; Rodriguez et al., 1990). In some cases the use o f starter cultures w i l l reduce the time required to complete the M L F compared to a spontaneous  16  M L F . However, wine is still prone to oxidation and possible microbial spoilage because the malolactic starter culture is usually inoculated only after the conclusion o f the alcoholic fermentation i n order to avoid an increase i n volatile acidity due to sugar metabolism b y O. ceni. Despite the use o f malolactic starter cultures, wineries still experience many problems i n ensuring an efficient M L F in high-acid white wines. Indeed, a 'stuck' or 'sluggish' M L F that may take weeks or months to complete is detrimental to wine quality because the addition o f protective concentrations o f SO2 are delayed and wine is exposed to the negative effects o f oxidation and the possibility o f microbial spoilage. To avoid the negative aspects o f the bacterial M L F , winemakers can use blending, carbonate additions, precipitation o f acids, dilution and carbonic maceration to reduce the acidity o f wine or grape must. Although these methods can reduce the acidity o f wine, they are laborious and often result in poor quality wine. Alternative technologies include the use o f Schizosaccharomycespombe (Gallander, 1977; Silva et al., 2003), high density cell suspensions o f yeasts (Gao and Fleet, 1995), and immobilization o f O. ceni, Lactobacillus sp., or the malolactic enzyme on a variety o f matrices (see reviews by Kourkoutas et al., 2004; Maicas, 2001; Zhang and Lovitt, 2006). Unfortunately these methods often result i n wine o f inferior quality and they are not applicable to production of quality wine on a commercial scale.  1.4 Genetic engineering of Saccharomyces cerevisiae to perform the M L F W i n e microbiologists have been studying the problems associated with a bacterial M L F for many years; however, it was not until the advent o f genetic engineering that a  17  possible solution to the M L F dilemma became available. Research concerning the construction o f a malolactic wine yeast strain by cloning the malolactic gene o f L A B and expressing it in S. cerevisiae has been progressing for over two decades. In 1984, a D N A fragment containing the malolactic enzyme from Lactobacillus delbruekii was first cloned into Escherichia coli (Williams et al., 1984). However, only a very low level o f expression o f the malolactic enzyme was obtained from the isolated clones (Williams et al., 1984). A D N A fragment containing the malolactic enzyme from O. ceni was cloned into E. coli as well, but due to instability problems with the cloned D N A , no further research was conducted (Lautensach and Subden, 1984). The malolactic gene (mleS) from Lactococcus lactis was also cloned and characterised (Ansanay et al., 1993; Denayrolles et al., 1994). The open reading frame ( O R F ) o f the mleS is 1620 nucleotides, encoding a putative protein o f 540 amino acids (59 kDa) (Ansanay et al., 1993; Denayrolles et al., 1994). A n alignment o f the deduced protein sequence o f the mleS with malic enzymes from different sources revealed highly conserved regions described as N A D - b i n d i n g domains, a malate binding site, and other regions o f unknown function (Denayrolles et al., 1994; Lonvaud-Funel, 1995). Expression o f the mleS gene in E. coli and S. cerevisiae resulted in a weak M L F (Anasanay et al., 1993; Denayrolles et al., 1995). The first gene isolated and sequenced from the M L F system o f L. lactis was the regulatory mleR gene (Renault et al., 1989). The product o f this gene serves as a positive activator o f the malolactic gene o f L. lactis i n the presence o f L-malic acid. The structural gene for the malolactic enzyme o f O. ceni (mleA) was eventually sequenced from a 3.4 kb fragment that also contained a gene for a malate carrier protein (mleP) (Labarre et al., 1996b). The mleA gene encodes a protein with a theoretical mass  18  of 59.1 k D a and the m l e A amino acid sequence has a 66% homology to the mleS amino acid sequence (Labarre et al., 1996b). The heterologous expression o f the mleA i n E. coli and S. cerevisiae resulted i n low M L F activity (Labarre et al., 1996b). In addition to the mleA and mleP genes, a third O R F transcribed i n the opposite direction was found upstream o f the apparent M L F operon and encoded for a protein belonging to the L y s R type regulatory protein family (Labarre et al., 1996a). This protein seems to be similar to the activator protein mleR found i n L. lactis (Labarre et al., 1996a). Commercial wine yeast strains o f S. cerevisiae can metabolize malate to a very limited extent (10-20%) (Kuczynski and Radler, 1982). The basis o f the inefficient malate degradation by S. cerevisiae is the lack o f an active malate transporter (Grobler et al., 1995; Volschenk et al., 1997b) and the low substrate affinity o f its NAD-dependent malic enzyme ( K = 50 m M ) (Fuck et al., 1973) which is also subject to catabolite m  repression (Redzepovic et al., 2003). The malic enzyme o f S. cerevisiae has been isolated and requires M n  2 +  and N A D or N A D P +  +  as cofactors (Fuck et al., 1973;  Osothsilp, 1987). Due to the absence o f an active malate transport system i n S. cerevisiae, previous attempts to construct recombinant yeast strains capable o f M L F did not succeed. W h i l e S. cerevisiae cannot degrade malate efficiently, other K (-) yeasts like Schizosaccharomyces pombe can (Baranowski and Radler, 1984; Kuczynski and Radler, 1982; Rodriquez and Thornton, 1989). Yeast can be categorised into K ( - ) or K(+) groups depending on their ability to use L-malic acid and other T C A cycle intermediates as sole carbon or energy sources (Barnett and Kornberg, 1960; Barnett et al., 1990; Rodriguez and Thornton, 1990; Volschenk et al., 2003). The K ( - ) group can use the T C A cycle intermediates only in the presence o f an assimilable carbon source  19  such as glucose; whereas the K(+) group can utilise T C A cycle intermediates directly as sole carbon or energy sources (Barnett and Kornberg, 1960; Volschenk et al., 2003). The efficient S. pombe malate metabolism depends on three enzymes: a malate permease, a malic enzyme, and a mitochondrial dehydrogenase enzyme (Osothsilp and Subden, 1986a). Malate transport i n S. pombe is constitutive, active, and not subject to glucose repression (Grobler et al., 1995; Rodriguez and Thornton, 1990; Sousa et al., 1992; Sousa et al., 1995). The malate permease is also a general dicarboxylic acid transporter, responsible for the transport o f L-malic acid, succinate and malonic acid (Grobler et al., 1995), and it functions as a proton dicarboxylate symporter (Sousa et al., 1992). The optimum p H o f the transport o f malate in S. pombe is 3.5 (Osothsilp and Subden, 1986b). Under fermentative conditions the cytosolic malic enzyme is solely involved in the degradation o f L-malic acid to ethanol and CO2, commonly known as the malo-ethanolic fermentation pathway (Magyar and Panyik, 1989; Mayer and Temperli, 1963; Taillandier and Strehaiano, 1991; Taillandier et al., 1988; Volschenk et al., 2003). Under aerobic conditions both the malic enzyme and malate dehydrogenase metabolise L-malic acid. However, the malate dehydrogenase only degrades approximately 10% o f the malate in aerobic conditions (Osothsilp and Subden, 1986a; Subden et al., 1998). The creation o f S. pombe mutants unable to transport malate and the subsequent cloning o f a S. pombe Hindlll D N A fragment capable o f complementing this mutation (Osothsilp and Subden, 1986a; Subden et al., 1998) was the first step that lead to the cloning o f the malate transport gene. Grobler et al., (1995) used this Hindlll  DNA  fragment to subclone, sequence and characterise the malate transport (mael) gene. The structural gene o f the malate permease encodes an O R F o f 1314 bp that translates into a  20  protein o f 438 amino acids with a theoretical weight o f approximately 49 k D a (Grobler et al., 1995). The mael gene is located on chromosome 1, is constitutively transcribed and is not subject to catabolite repression (Grobler et al., 1995). Analysis o f the hydrophobic and hydrophilic composition o f the amino acid sequence o f the malate permease revealed typical motifs similar to other membrane transport-proteins. The maelp contains a hydrophillic amino- and carboxy-terminal as well as ten putative membrane-spanning domains separated by hydrophilic linkers. Several conserved elements were identified in the maelp, such as a leucine zipper motif, P E S T region and several N-linked glycosylation and protein kinase C phosphorylation sites (Grobler et al., 1995). Volschenk et al. (1997), functionally co-expressed the S. pombe mael gene and the L. lactis mleS gene under the regulation o f the S. cerevisiae 3-phosphoglycerate kinase (PGK1) promoter and terminator sequences on multicopy plasmids in a laboratory strain of S. cerevisiae. The recombinant laboratory strain was able to efficiently decarboxylate 4.5 g/L L-malate to L-lactate and carbon dioxide i n 4 days (Volschenk et al., 1997a; Volschenk et al., 1997b).  1.5 Genetically engineered Saccharomyces  cerevisiae strains in the wine industry  The possible targets for the genetic improvement o f wine yeast strains are presented in Table 1. Several strategies and methods can be used to obtain these desired properties in wine yeast. The classic methods include selection o f clonal variants, mutagenesis and selection, and hybridisation via mating, rare-mating, cytoduction or spheroplast fusion (Bisson, 2004; Pretorius, 2000; Pretorius and Bauer, 2002). The recent application o f recombinant D N A technologies have enabled a far more specific  21  and rational approach to improvements o f industrial yeast strains. The capability to transform yeast based on chemical, electrical or biolistic methods, the development o f a variety o f vectors, and the publication o f the yeast genome has led to major advances i n the construction o f wine yeast strains (Akada, 2002; Bisson, 2004; Pretorius, 2000; Pretorius and Bauer, 2002).  Table 1. Oenological targets for the genetic improvement o f S. cerevisiae wine strains (adapted from Bisson, 2004; Giudici et al., 2005; Pretorius, 2000; Pretorius and H o j , 2005)  Target Fermentation performance • • • • • • •  Improve stress tolerance Improve fermentation rate Improve substrate utilisation Improve nitrogen assimilation Improve competitiveness Increase range o f growth temperatures Reduce foam formation  Improve sensory attributes • • • • • •  Biological adjustment o f acidity Increase glycerol production Increase desirable esters Liberate grape terpenoids Optimised fusel o i l production Increase autolysis flavour production  Reduce off-character production • • • •  Decrease Decrease Decrease Decrease  sulphur volatiles acetate, volatile acidity aldehydes higher alcohols  Reduce off-character production •  Decrease phenolic derivatives  Improve wine processing • • •  Optimise flocculation and sedimentation Improve protein and polysaccharide clarification Tannin reduction 22  Target Improve biological control of wine spoilage microorganisms • •  Increase production/tolerance to SO2 Express antimicrobial peptides or enzymes  Improve wholesomeness • • • • •  Decrease ethyl carbamate Decrease bioamine formation Increase production o f resveratrol Increase vitamin production Increase pesticide and metal ion scavenging  •  Decrease ethanol concentration  The current state o f progress o f genetically engineered wine yeast is illustrated i n Table 2. Although significant advances have been accomplished i n the last two decades only one genetically modified ( G M ) wine yeast is currently commercially available, it is the malolactic yeast reported i n this dissertation. Furthermore, the urea-degrading yeast also produced by our group (Coulon et al., 2006) is ready for commercialisation. The majority o f genetically engineered yeast strains reported in Table 2 are only at the 'proof o f principle' stage and cannot be commercialised until several further requirements are met.  23  Table 2. Genetic engineering of wine yeast and stratagies used in their modification (adapted from Schuller and Casal, 2005) Target Fermentation Performance -Stress tolerance -Killer factor synthesis Sensory Attributes -Acidity adjustment  Protein  Glycogen synthase  K l killer toxin (Zymocin)  Malate permease/ Malolactic enzyme Malate permease/ Malolactic enzyme Malate permease/Malic enzyme Acetaldehyde dehydrogenase Lactate dehydrogenase  Gene(s)  Source  Promoter/ Terminator  Marker  Plasmid/ Integration  Host Strain*  Reference  GSY2  S. cerevisiae  Native  URA3  2u  Laboratory  (PerezTorrado et al., 2002)  KIL-K1  S. cerevisiae  ADH1/ADH1  LEU2 and Kl immunity  CEN-based plasmid and integration  Laboratory  (Boone et al., 1990)  None  Integration  Industrial  PGK1/PGK1  URA3  2u  Laboratory  PGKl/PGKl  SMR1-140  Integration  Industrial  Integration of marker 2n  Laboratory  (Husnik et al., 2006) (Volschenk et al., 1997b) (Volschenk et al.,2001) (Remize et al., 2000) (Dequin et al., 1999)  mael/mleA  S. pombe/O. ceni PGK1/PGK1  S. pombe/L. lactis mael/mae2 S. pombe mael/mleS  ALD6  S. cerevisiae  (Deletion)  kanMX4  LDH  Lactobacillus casei  ADH1/ADH1  Tn903 (G418 )  S. cerevisiae  ADH1/ADH1  Tn5We  2u  Laboratory and industrial  (Michnick et a l , 1997; Remize et a l , 1999) (PerezGonzalez et al., 1993) (SanchezTorres et al., 1996)  GPDl  Industrial  r  -Increase glycerol production  Glycerol-3-phosphate dehydrogenase  -Liberate grape terpenoids  Endoglucanase  egU  Trichoderma longibrachiatum  ACT  CYH2  2u  Industrial  Arbinofuranosidase  abjB  Aspergillus niger  ACT  CYH2  2u  Industrial  Target Sensory Attributes -Liberate grape terpenoids  Protein  Gene(s)  Source  Marker  Plasmid/ Integration  Host Strain*  Reference  ACT  CYH2  2u  Industrial  GPD/PGK  CYH2  (Ganga et al., 1999) (Manzanares et a l , 2003)  URA3  2u  Laboratory  (Cebollero et a l , 2005)  Endoxylanase  xlnA  Rhamnosidase  rhaA  -Acclerated autolysis  A A A ATPase  cscl-l  S. cerevisiae  TDH3  -Volatile phenol formation  Phenolic acid decarboxylase  pdc  Lactobacillus plantarum  PGKl/PGKl  URA3 and SMR1-140  2u and integration of plasmid  Laboratory and industrial  (Smit et al., 2003)  -Optimise ester production  Alcohol acetyltransferase  ATF1  S. cerevisiae  PGKl/PGKl  LEU2 and SMR1-140  ATF2  S. cerevisiae  PGKl/PGKl  SMR1-140  Laboratory and industrial Industrial  (Lilly et a l , 2000)  Alcohol acetyltransferase Isoamyl acetatehydrolyzing esterase Ethanol hexanoyl transferase  IAH1  S. cerevisiae  PGKl/PGKl  SMR1-140  EHT1  S. cerevisiae  PGKl/PGKl  SMR1-140  2u and integration of plasmid Integration of plasmid Integration of plasmid Integration of plasmid  Sulphite reductase  MET 10  S. cerevisiae  Endopolygalacturonase  PGU1  S. cerevisiae  -Decrease sulphur volatiles Wine Processing -Improve clarificaiton  Pectate lyase  pelA  Aspergillus nidulans Aspergillus aculeatus  Promoter/ Terminator  Fusarium solani  MET3  PGKl/PGKl ACT  Industrial  LEU2  Industrial Industrial  (Lilly et al., 2006) (Lilly et a l , 2006) (Lilly et a l , 2006)  Laboratory  (Sutherland et al., 2003)  (Vilanova et a l , 2000) (GonzalezCandelas et a l , 1995)  kanMX  2(x  Industrial  CYH  2fi  Industrial  Protein  Target Microbial spoilage control -Production of antimicrobials  Pediocin Chitinase Leucocin Glucose oxidase  Promoter/ Terminator  Marker  Plasmid/ Integration  Host Strain*  Reference  Pediococcus acidilactici S. cerevisiae  ADH1/ADH1  URA3  2u  Laboratory  PGKl/PGKl  URA3  IcaB  Leuconostoc carnosum  ADH1/ADH1  URA3  gox  Aspergillus niger  (Schoeman et a l , 1999) (Carstens et a l , 2003) (Du Toit. and Pretorius, 2000) (Malherbe et al., 2003)  Gene(s)  pedA CTS1-2  Source  PGKl/PGKl  Laboratory 2u  Laboratory  Integration  Laboratory  Integration  Industrial  (Coulon et al. 2006) (GonzalezCandelas et al., 2000) (Becker et al., 2003) (Becker et al., 2003)  URA3 Health Aspects -Ethyl carbamate reduction -Resveratrol production  -Reduction of ethanol  ON  Urea amidolyase  DUR1,2  S. cerevisiae  PGKl/PGKl None  bglN  Candida molischiana  ACT/ACT  CYH2  2|i  Industrial  Resveratrol synthase  4CL216  Hybrid poplar  ADH2/ADH2  URA3  2u  Laboratory  Coenzyme-A ligase  Vstl  Vitis vinifera  EN02/ENQ2  LEU2  2u  Laboratory  Glycerol-3-phosphate dehydrogenase  GPD2  S. cerevisiae  ADH1 promoter  SMRl-140  2jx  Industrial  Glycerol-3-phosphate dehydrogenase and Acetaldehyde dehydrogenase  GPD2/ALD6  S. cerevisiae  ADH1 promoter and ALD6 deletion  LEU2  2(i  Laboratory  ? -Glucosidase  (de Barros Lopes et al., 2000) (Eglinton et al., 2002)  Target Health Aspects -Reduction of ethanol  Protein  Glycerol-3-phosphate dehydrogenase and Acetaldehyde dehydrogenase Hexose transporter 1 and 7  Gene(s)  Source  GPD1/ALD6  S. cerevisiae  Hxtl/Hxtl  S. cerevisiae  Promoter/ Terminator  Marker  Plasmid/ Integration  Host Strain*  Reference  ADHl/ADHl and ALD6 deletion  kanMX  Integration  Industrial  (Cambon et a l , 2006)  URA3  Integration  Laboratory  (Henricsson et a l , 2005)  HXT7pvom/ HXTlterm  industrial strains are defined here as wine yeast of the genus Saccharomyces that are used by the wine industry. Host strains that are derived from industrial yeast but have undergone significant alterations (multiple auxotrophies) in order to facilitate genetic modification are defined here as laboratory strains.  In general, G M wine yeast for commercial use should not contain any drug resistant markers such as CYH2, Tn5ble, kanMX(Tn903)  or SMR1-140, conferring  resistance to cycloheximide, phelomycin, geneticin (G418) and sulphometuron methyl ( S M M ) , respectively; nor should they contain vectors or vector sequences with bacterial resistance markers such as the E. coli ampicilin resistance (bid) gene. Genetic modifications relying on plasmids should also be re-constructed with the genes/elements of interest stably integrated into the genome of the host strains. Moreover, all genetic material should be derived from the host species ("self-cloning") or from G R A S (Generally Regarded A s Safe) organisms with a history of safe use in the food industry; the use of D N A sequences from pathogenic species or organisms known to produce allergens should be avoided. One o f the main features of recombinant D N A technology versus classical genetics is the possibility to introduce a specific gene(s) into the host without loss of the phenotypic characteristics o f the host strain. Apart from the introduced change, a commercially available G M wine yeast strain should produce wine that is not significantly different from the parent strain. Currently this last requirement may be very difficult for polygenic traits that are not well-characterised in wine yeast and only well-characterised traits requiring modifications to one or two genes have been successful (Coulon et al., 2006; Husnik et al., 2006). A G M wine yeast strain for commercial use requires approval from the regulatory authorities of each country where the yeast w i l l be sold. There are two major approaches to regulating G M products in the world. The first is exemplified by the United States and the other is the approach adopted by the European Union. The U S system essentially evaluates the final product and is based on the principle o f substantial equivalence.  28  Substantial equivalence means that i f a food from a genetically modified organism ( G M O ) is "as safe as" the corresponding conventional food product then they should both be treated equally. A detailed knowledge o f the genotype, phenotype and supporting transcriptomic, proteomic and metabolomic data are necessary for a successful evaluation. The U S system works within existing regulations for the commercialisation of foods and does not require labelling unless an introduced gene encodes for a novel product that has never been part o f any other food. Other countries like Canada, Australia and Japan are also based on the U S system but with varying degrees o f additional requirements and levels o f stringency. The E U system is considerably more complex. The E U approach, in addition to evaluating the final product, also takes into consideration the technique used to obtain the product and it is primarily based on the precautionary principle. The recently amended European N o v e l Food Regulations define the procedures for authorisation, labelling and traceability. The regulations for authorisation require the applicant to demonstrate that the product is safe to human and animal health, that it does not differ nutritionally from the conventionally produced product, it does not mislead consumers, and it is safe for the environment (Schuller and Casal, 2005). The government o f the country introducing the proposed product must also inform all the commissions o f the other members o f the E U and the European Food Safety Authority in Brussels, Belgium (Ramon et al., 2005). In the E U , labelling is compulsory for G M food regardless o f whether D N A or protein can be detected in the final product, although it is not required for foods with accidental or technologically unavoidable trace amounts o f G M O s (<0.9%) (Schuller and Casal, 2005). The E U also requires that G M O s and products derived from G M O s must be traceable  29  through all o f the stages o f production and distribution (Schuller and Casal, 2005). However, G M 'processing aids', which are products used i n the food and feed production process, do not fall under the strict E U regulations outlined above. G M yeast can be viewed as a processing aid in the E U : i f less than 0.9% o f the yeast is present in the final product, no labelling is required. In addition to the demanding technical requirements to construct a suitable G M wine yeast strain and the regulatory hurdles that must be traversed, the largest challenge to a commercial G M wine yeast strain is consumer and winemaker acceptance. Several authors have suggested that the first G M wine products should demonstrate a direct benefit to consumers (Dequin, 2001; Pretorius and Bauer, 2002; Pretorius and Hoj, 2005; Ramon et al., 2005). Ideally, this benefit should be related to health, such as an increased concentration o f a nutritional ingredient or the reduction in a naturally present toxic compound (Tables 1 and 2). Although the increase in a health-related compound such as resveratrol or vitamins could be viewed as a direct benefit to the consumer, an alcoholbased beverage may not be the most appropriate delivery method for bringing a healthrelated ingredient to the public. However, the reduction o f a naturally occurring toxic or harmful compound already present in wine, such as biogenic amines and/or ethyl carbamate (Tables 1 and 2) would provide a direct benefit to wine consumers and the removal o f such compounds should not affect the organoleptic qualities o f the product. This direct benefit, in addition to the fact that the G M wine yeast would be removed by filtration, could increase the consumer acceptance o f the first G M wine product. A G M yeast strain that provided a direct benefit to the winemaker, in addition to the consumer, is more likely to be commercially acceptable. In conclusion, a successful G M wine yeast  30  strain should provide a direct benefit to the consumer and to the winemaker without affecting the organoleptic qualities o f the product.  1.6 Proposed Research 1.6.1 Significance of research The research reported i n this thesis addresses the need for a wine yeast strain capable o f completing the M L F . M L O l , the malolactic yeast described herein, is the first genetically engineered wine yeast to be commercialised. The development o f a commercially-acceptable malolactic yeast strain is o f great benefit to the wine industry. The application o f M L O l w i l l provide a direct advantage to the winemaker (by reducing processing time), improve wine sensory qualities (by reducing volatile acidity and preventing deterioration o f colour by L A B ) , and possibly a direct health benefit to the wine consumer (by preventing the production of biogenic amines and ethyl carbamate by L A B ) . The preservation o f wine immediately after alcoholic fermentation could also improve the organoleptic characteristics o f the wine by preventing chemical oxidation and microbial spoilage often associated with a delayed bacterial M L F .  1.6.2 General hypotheses The hypotheses that guided this research were that the construction o f a genetically engineered wine yeast strain capable o f M L F is possible and that this malolactic yeast could produce high quality wine.  31  1.6.3 Main objectives The main objectives o f this study are to: 1. Construct a genetically stable industrial wine yeast strain o f S. cerevisiae that w i l l be capable o f performing an efficient M L F . 2. Characterise the genome, transcriptome and proteome o f the malolactic yeast. 3. Characterise the phenotype o f the malolactic yeast and evaluate the wine produced b y the genetically engineered wine yeast.  32  2 MATERIALS AND METHODS 2.1 Strains and plasmids employed in the genetic construction and characterisation of MLOl The different strains and plasmids used in this study are listed i n Tables 3 and 4, respectively.  Table 3. Different strains used in the metabolic engineering and characterisation o f the malolactic yeast M L O l .  Strains  Description  E. coli D H 5 a  F end Al glnY 44 thi-l reck.1 relAl gyrA96 deoR nupG F 80d/acZ? M l 5 ? (lacZYA-argF)U\69 hsdR17(r m ) , ?"  (Hanahan, 1983)  O. ceni  Viniflora® Oenos, a freeze dried pure culture o f 0. ami.  Chr. Hansen Ltd., Hoersholm, Denmark  S. cerevisiae 35977 78-1  A hybrid industrial baker's yeast strain containing an integrated Tn5ble gene cassette at the SUC2 locus.  Lesaffre Development, Marcq-en-Barceul, France  S. cerevisiae MLOl  Industrial "Prise de Mousse" strain S92 containing the malolactic cassette integrated into the URA3 locus.  (This study)  S. cerevisiae S92  Industrial "Prise de Mousse" strain originally isolated from the Champagne region in France.  Reference  +  K  K  Bio Springer, Maisons-Alfort, France (a division of Lesaffre International, Marcq-en-Barceul, France)  33  T a b l e 4. Different plasmids used in the metabolic engineering and characterisation o f malolactic clone M L 0 1 . Plasmids pJH2  Description YEp352(? Kpnl) containing the mael and the mleA expression cassettes cloned between URA3 flanking sequences.  Reference (Husnik, 2001)  pJH3  Y C p l a c 3 3 - K a n M X containing the malolactic cassette subcloned from pJH2.  (Husnik, 2001)  pUT332  E. co/z'/yeast episomal shuttle vector containing the Tn5ble dominant marker.  (Gatignol et al., 1987)  YCplac33KanMX  E. co/7/yeast centromeric shuttle vector containing the K a n M X dominant marker.  Lesaffre Development, Marcq-en-Baroeul, France  2.2 C u l t u r e conditions Escherichia coli D H 5 a was used for plasmid propagation and cultured according to standard methods (Ausubel et al., 1995). A l l S. cerevisiae strains were cultured i n Y P D broth (Difco, Becton, Dickinson and Co., Sparks, U S A ) according to standard methods (Ausubel et al., 1995). Active dry yeast ( A D Y ) were used either directly or rehydrated at 40 °C in 7% synthetic must for 30 m i n ( D N A mieroarray and proteomics studies) or re-hydrated at 37 °C in sterile distilled water for 15 m i n (post-fermentation and effect o f residual M L 0 1 concentrations on M L F studies). A D Y was mixed intermittently during re-hydration and prior to inoculation. The medium Y E G ( 1 % yeast extract, 2 % dextrose, 1.5% Pastagar B [Bio-Rad, Hercules, U S A ] ) supplemented with 100 ug/mL o f phleomycin (Invivogen, San Diego, U S A ) was used for selecting co-transformed yeast colonies and testing for phleomycin sensitivity. Synthetic must was prepared by adding 1.0 m L / L o f Tween 80 to synthetic 34  broth (Denayrolles et al., 1995). The p H o f the synthetic must was adjusted to 3.5 for all studies except the D N A mieroarray, Real-Time R T - P C R and i T R A Q experiments. The tartaric acid concentration o f the synthetic must for the growth kinetics, D N A mieroarray, Real-Time R T - P C R and i T R A Q experiments was adjusted to 4.5 g/L using L-tartaric acid. Pasteurized, commercially available Chardonnay grape must ("Vine Fresh", W i n e K i t z , Vancouver, Canada; 22.65 B r i x , p H 2.9, T A 4.39 g/L, 0.92 g/L malate, Y A N C 348.1 mg/L) was used to study growth kinetics and viability o f M L 0 1 post-fermentation. Malate concentration was adjusted to 4.5 g/L and the must was filter-sterilized (0.22 pm). Utilization o f malate as a sole carbon source by M L 0 1 was examined in modified Y P D medium containing 10 g/L Yeast Extract (Difco, Becton, Dickinson and C o . , Sparks, U S A ) , 20 g/L Peptone (Difco, Becton, Dickinson and Co., Sparks, U S A ) , 5 g/L Dextrose and 20 g / L L-malic acid. The p H was adjusted to 6.5 with K O H pellets and the medium was filter-sterilized (0.22 pm).  2.3 Genetic construction of malolactic wine yeast 2.3.1 Co-transformation of the malolactic cassette and pUT332 The malolactic cassette was isolated from plasmid pJH2 (Husnik, 2001) by digestion with Srfl and subsequent gel extraction and purification o f an 8683 bp fragment containing the mael and mleA expression cassettes flanked by homologous ura3 sequences. S. cerevisiae S92 was co-transformed with the malolactic cassette and p U T 3 3 2 (Gatignol et al., 1987) combined at a 10:1 (malolactic cassette:pUT332) molar ratio. After electroporation (Ausubel et al., 1995) 1 m L o f ice-cold Y P D media was used to recover the yeast.  Yeast cells were transferred to a 1.5 m L microfuge tube and gently  35  mixed at 30 °C for 4 h. Aliquots o f the yeast suspension were then directly plated onto Y E G plates containing 100 (ig/mL phleomycin and incubated at 30 °C for 3 days.  2.3.2 Screening of transformants for the integrated malolactic cassette Co-transformed yeast colonies and the positive control strain, S92 transformed with pJH13 ( Y C p l a c 3 3 - K a n M X with the malolactic cassette cloned into the Xbal site) (Husnik, 2001), were inoculated into sterile 96 round bottom micro-well plates containing 200 u L o f synthetic must, wrapped in parafilm and incubated at 30 °C for 3-5 days. After incubation, 75 u L o f the supernatant from each well was removed and placed into a new micro-well plate. A 25 u L volume o f the L-lactic acid dehydrogenase/NAD/ phenazine methosulfate/nitro blue tetrazolium reaction mixture (pH 8.3) (Subden et al., 1982) was added to each well containing 75 u L o f the test sample and plates were incubated at 37 °C in the dark for 30 min. The reaction mixture causes wells containing L-lactic acid to show a purple/blue colour and yeast cells from the corresponding plate would be recovered by inoculation into 5 m L o f Y P D and incubated at 30 ° C for 1-2 days. After recovery, malolactic clones were re-inoculated into 5 m L synthetic must and streaked onto Y E G plates and incubated at 30 °C for 3-5 days. The degradation o f malate and production o f lactate in synthetic must was confirmed by enzymatic analysis (RBiopharm, Darmstadt, Germany). Confirmation o f integration was performed by P C R on genomic D N A (Promega, Madison, U S A ) from individual colonies from each clone identified in the screening. The P C R reaction was done according to manufacturer's recommendations (Invitrogen, Carlsbad, U S A ) using primers 5 ' - T T G T A A T G T G A C C A A T G A G - 3 ' (inside the cassette, PGK1 promoter) and 5 ' - C T C T T T A T A T T T A C A T G C T A  36  A A A A T G G -3' (outside the cassette, 3'-end URA3 flanking region). The 1095 bp P C R product was visualized by 0.8% agarose gel electrophoresis and ethidium bromide staining (Ausubel et al., 1995).  2.3.3 Loss of plasmid pUT322 Each positively identified clone was sub-cultured daily in non-selective Y P D for one week to ensure loss o f the co-transformed plasmid pUT332. Cultures were grown at 30 °C on a shaking platform (180 rpm) and sub-cultured by inoculating yeast from a 24 h culture into 5 m L o f Y P D to a final O D o f 0.05. Malolactic clones, S92 (parental strain and negative control), and S. cerevisiae 3597? 78-1 (positive control containing phleomycin resistance gene Tn5ble) were plated onto Y E G medium with and without 100 ug/mL o f phleomycin to demonstrate sensitivity.  2.4 Functionality of malolactic wine yeast 2.4.1 Malate decarboxylation and residual sugar concentrations of wine produced by malolactic clones The parental strain S92 and three individual colonies selected from each subcultured malolactic clone were grown i n 250 m L Erlenmeyer flasks containing 50 m L o f Y P D at 30 ° C with agitation (180 rpm) for two days. S92 transformed with p J H l 3 and Y C p l a c 3 3 - K a n M X were cultured i n the same way as the parental strain and the malolactic clones except for the addition 200 ug/mL o f G418. Yeast cells were harvested by centrifugation for 5 m i n at 3000 x g and re-suspended i n 1 m L o f sterile distilled water. A l l yeast cultures were inoculated into 500 m L sterile Erlenmeyer flasks  37  containing 500 m L synthetic must to a final cell density o f 4 x 10 cells/mL. Synthetic 6  must inoculated with S92 transformed with Y C p l a c 3 3 - K a n M X or pJH13 also contained 200 ug/mL o f G418. Each fermentation flask was fitted with an autoclaved glass vapour lock. Fermentations were incubated at 20 °C with agitation (65 rpm) for 14 days. Malate was monitored for 14 days and residual sugar on day 14. L - M a l i c acid, D-glucose and D fructose concentrations were determined by enzymatic analysis (R-Biopharm, Darmstadt, Germany).  2.4.2 Functionality of active dry wine yeast MLOl Malolactic yeast clone 4 ( M L O l ) was produced as active dry yeast at the Lesaffre Development pilot plant facility (Lesaffre Development, Marcq-en-Baroeul, France) and tested for functionality i n synthetic must. Active dry yeast strains M L O l and S92 were inoculated at a concentration o f 0.2 g / L into 500 m L sterile Erlenmeyer flasks containing 500 m L synthetic must i n triplicate. Each fermentation flask was fitted with an autoclaved glass vapour lock. Flasks were incubated at 20 ° C with agitation (65 rpm) for 14 days and monitored for malate degradation, lactate production and residual sugar on day 14. L - M a l i c acid, L-lactic acid, D-glucose and D-fructose concentrations were determined b y enzymatic analysis (R-Biopharm, Darmstadt, Germany).  2.5 Genetic characterisation of MLOl 2.5.1 Chromosome karyotyping of MLOl and S92 Yeast chromosomes for pulsed field gel electrophoresis were prepared i n l o w melting point agarose plugs (Schwartz and Cantor, 1984). Cells were harvested by  38  centrifugation and washed with 5 m M E D T A , p H 7.5. The cell pellet was re-suspended i n 10 u L o f 1 M Sorbitol, 0.1 m M E D T A (pH 8), 14 m M p-mercaptoethanol and 10 m g / m L o f Driselase (Sigma-Aldrich, St. Louis, U S A ) . Cell suspensions were mixed with low melting point agarose (Invitrogen, Carlsbad, U S A ) and placed into molds. Agarose plugs were incubated overnight at 37 °C i n 0.5 M E D T A (pH 8), 10 m M Tris (pH 8) and 20 m M D T T . The plugs were subsequently incubated in 0.5 M E D T A (pH 8), 10 m M Tris (pH 8), 1% laurylsarcosine, 1 m g / m L proteinase K (Merck, Whitehouse Station, U S A ) for 6 h at 55 °C. After extensive washing in solutions o f 50 m M E D T A (pH 7.5), T E , and I X T B E the plugs were inserted into a 1% agarose-TBE gel. Yeast chromosomes were separated by Gene Navigator P F G E apparatus (Pharmacia Biotech, Uppsala, Sweden) in T B E buffer at 12 °C. Electrophoresis was performed at 165 V for 20 h with 90 s pulses, followed by 10 h with 110 s pulses, followed by 10 h with 125 s pulses and 4 hours with 30 s pulses. The gel was stained with ethidium bromide and photographed.  2.5.2 Southern blot analyses Southern blotting, labelling o f probes, hybridization, stringency washes and detection were completed as recommended b y the E C L direct nucleic acid labelling and detection system ( G E Healthcare, Buckinghamshire, U K ) . Genomic D N A was digested with EcoRV, Ncol, Nsil, or Pvull. After fractionation by electrophoresis in a 1% agarose gel, the D N A was blotted onto positively charged membranes (Roche, Basel, Switzerland) and fixed by heating at 80 °C for 1 h. Probes corresponding to the malolactic cassette were excised from pJH2 (Husnik, 2001) with the following restriction  39  enzymes: XballKpnl  to produce the 5' end 938 bp URA3 probe, Sphl/BamHl to produce  the 842 bp mael probe, NaeVPmel to produce the 721 bp mleA probe, and ClaVNoil to produce the 674 bp PGK1 promoter probe. Probes corresponding to p U T 3 3 2 were either excised from the plasmid or P C R amplified (Appendix A ) . The 471 bp probe for the Tn5ble gene was prepared by P C R amplification using primers J20 ( 5 ' - A A T G A C C G A C C A A G C G A C G - 3 ' ) and J21 ( 5 ' - A T C C T G G G T G G T G A G C A G - 3 ' ) and Pwo polymerase (Roche, Basel, Switzerland). A probe for the bla gene and 970 bp o f non-Saccharomyces sequences o f pUT332 was prepared b y digesting p U T 3 3 2 with SspVClal resulting i n a 1758 bp fragment (Appendix A ) .  2.5.3 Sequencing of the malolactic cassette integrated into the genome of MLOl Synthesis o f primers (Table 5) and sequencing was completed at the Nucleic A c i d Protein Service Unit (University o f British Columbia, Vancouver, Canada). Synthesis was performed on a Perkin Elmer - Applied Biosystems synthesizer using solid support phosphoramidite chemistry (Applied Biosystems, Foster City, U S A ) . Sequencing o f the malolactic cassette from S. cerevisiae M L O l (both strands) was completed using an A B I P R I S M 377 D N A sequencer and A B I ' s A m p l i T a q F S DyeDeoxy Terminator Cycle Sequencing chemistry (Applied Biosystems, Foster City, U S A ) . A minimum o f two sets o f 13 unique templates spanning the entire malolactic cassette were obtained by P C R using PfuTurbo (Stratagene, L a Jolla, U S A ) and primers listed i n Table 5. One set o f templates was used for the sequencing o f one strand while the other set was used for the sequencing o f the reverse strand. Primers used for sequencing are also listed in Table 5.  40  The two complete sequences were aligned and analyzed for differences using Discovery Studio Gene v l . l software (Accelrys, San Diego, U S A ) . If anomalies occurred, another round o f P C R and sequencing o f the region in doubt was run to determine the correct sequence. Genomic D N A for the P C R reactions was obtained using a Promega, W i z a r d ® Genomic D N A Purification K i t (Promega, Madison, U S A ) . A l l P C R templates used for sequencing were unique to the malolactic cassette. A schematic representation o f the sequencing strategy is presented i n Appendix B .  Table 5. Primers used for sequencing o f the malolactic cassette integrated into  S. cerevisiae M L 0 1 Primer name Forl9g For20g Forl5B For3p For4g For5g For6g For7p Forl8g For21g For8g For9p ForlOg Forllp Forl2g Forl3p Forl4p Forl7B Revl8g Rev2p Rev3bp Revl9g Rev20g Rev4bg Rev5g  Primer sequence 5'' 5' 5' 5' 5' 5' 5' 5' 5' 5' 5' 5' 5' 5' 5' 5' 5' 5' 5' 5' 5' 5' 5' 5' 5'  AACTAATGAGATGGAATCGG-3' GAAGGTTAATGTGGCTGTGG-3' AAGGAACGTGCTGCTACTC-3' AGATCTCATATGCAAGACGC-3' TGGAGGATGGGCATCTTCG-3' TGAGAAAGCTGGTGGACCG-3' TGGCAAGCATGTCGATGAAC-3' AGTTCACCCATGTCGAATCG-3' TCTTGAGTTGAAGTCAGGAATC-3' TGATGCGTTCATGCCTGATC-3' T G G T A C C G C G G C C G C A A G -3' A C T T C A A A T C G T C G A C G G C -3' • T G G T C T T T C A G T A T A A C C A G -3' • C C A G T T C C T T G A A T A T C A T C -3' • T G A T A T C G C G G C C A T T A G C -3' A C T T A C T G G A T C T G T C A T G -3' G C T T G C G G C C G C A C A A A G -3' A G G T A G A G G G T G A A C G T T A C -3' •TTGTTCCGTTTGACTTGTCGC -3' A C C A G A T T A G A G T A C A A A C G C -3' • T C G C A A T G T C A A C A G T A C C C -3' A C T A T A G T A G A G A T A A C G T C -3' A C A A G C A A T C G A A G G T T C T G -3' T T G T T G A A C C G C A A G G T G C -3' T G C T A A T G G C C G C G A T A T C -3' 41  Primer name Rev6g Rev7p Rev8gb Rev9p RevlOg Revllg Revl2g Revl3p Revl5p Revl7B Rev21g  Primer sequence 5' - T T G C C G G C G T T C T T G G A G - 3 ' 5' - A A G C C T T G A T C G G T A C T G G - 3 ' 5' - A C T A A T G A G A T C T C C T C G A G - 3 ' 5' - A G C T T G C G G C C G C G G T A C - 3 ' 5' - A T C T C T C G A T T C G A C A T G G G - 3 ' 5' - T G G A T G G T G T G G G T C A T T C - 3 ' 5' - A A C T C A T C C G A G T A T C T T G G - 3 ' 5 ' - A C A G G T G T C C T T A A C C C T A C -3' 5' - C T T G G T A C C T A C T T C T T C C - 3 ' 5' - A T G A G T A G C A G C A C G T T C C - 3 ' 5 ' - T C C T T C T G C T C G G A G A T T A C -3'  2.5.4 Sequence analysis The assembled sequence o f the malolactic cassette from M L 0 1 was aligned to an assembled sequence containing previously published sequences. The published sequences for URA3 and the PGK1 promoter and terminator sequences were obtained from the Saccharomyces Genome Database (SGD) (http://www.yeastgenome.org/), and for mael and mleA from the National Center for Biotechnology Information ( N C B I ) (http://www.ncbi.nlm.nih.gov/). The sequence o f the malolactic cassette was also analysed for the presence o f O R F s o f more than 100 codons in length. A l l analyses were completed using Discovery Studio Gene v l . l (Accelrys, San Diego, U S A ) .  2.5.5 Genetic stability of the malolactic cassette in the genome of ML01 The M L 0 1 strain produced as A D Y (large-scale 'trade' fermentation) (Bio Springer, Maisons-Alfort, France) was inoculated into filter-sterilised Chardonnay grape must from fruit harvested in 2004 (23.75 Brix, p H 3.41, T A 8.78 g/L, malate 5.5 g/L, Y A N C 401.2 mg/L, 25 m g / L total S 0 ) by Calona Vineyards, Okanagan Valley, B C . 2  42  M L O l was inoculated at a concentration o f 0.05 g / L into a 500 m L sterile Erlenmeyer flask containing 500 m L grape must. The fermentation flask was fitted with a disinfected vapour lock and was incubated at 20 °C for 6 days.  The flask was stirred once daily and  samples for monitoring O D were obtained by puncturing the #6.5 rubber stopper (Fermenthaus, Victoria, Canada) with a sterile syringe and 18G x 3" needle (Air-Tite, Virginia Beach, U S A ) .  After absorbance readings, samples were centrifuged and the  supernatant stored at - 3 0 °C until chemical analyses were completed. L - M a l i c acid, and L-lactic acid concentrations were determined by enzymatic analysis (Megazyme, W i c k l o w , Ireland). O n day 6 yeast cells were plated onto Y P D medium and incubated at 30 °C for 4 days. Four hundred and four randomly selected colonies were inoculated into 200 u L o f synthetic juice and incubated at 20 °C for 6 days. The presence/absence o f L lactic acid in each micro-vinification was determined by enzymatic analysis (Megazyme, W i c k l o w , Ireland).  2.5.6 G l o b a l gene expression analyses One m L o f re-hydrated M L O l (25 mg/mL) and one m L o f S92 (25 mg/mL) were each inoculated in triplicate into 500 m L sterile flasks (with an additional 130 m L head space), containing 500 m L o f synthetic must and a magnetic stir bar. Each fermentation flask was fitted with a disinfected vapour lock. Additional flasks were similarly prepared in order to monitor weight loss, measure optical density and take samples for chemical analyses. A l l flasks were stirred once daily and incubated at 20 °C. After stirring, samples for monitoring O D were obtained by puncturing the #6.5 rubber stopper (Fermenthaus, Victoria, Canada) with a sterile syringe and 18G x 3" needle (Air-Tite,  43  Virginia Beach, U S A ) . After absorbance readings, samples were centrifuged and the supernatant stored at - 3 0 °C until chemical analyses were completed. A t 48 and 144 hours, five 30 m L volumes from each culture were centrifuged i n 40 m L tubes for 3 m i n at 3500 x g. The supernatant was decanted and the pellet resuspended (briefly vortexed) in 10 m L o f d H 0 . A second centrifugation was completed 2  for 3 m i n at 3500 x g. The supernatant was decanted and the cell pellet was placed i n liquid nitrogen for 30 s and then stored at - 8 0 °C. Optical density measurements and chemical analyses were conducted on the remaining fermentation broth and the initially decanted supernatant. Total R N A , poly ( A ) R N A purification, c D N A synthesis and +  biotin-labelled c R N A synthesis and fragmentation procedures have been previously described (Erasmus et al., 2003). The only modification was that the isolated total R N A was also passed through an RNeasy M i d i kit (Qiagen, Hilden, Germany). Twelve Y G S 9 8 oligonucleotide arrays (Affymetrix, Santa Clara, U S A ) were used as targets for hybridization. Hybridization, fluidics and scanning procedures have been described previously (Erasmus et al., 2003). Data were analyzed using Affymetrix Microarray Suite v 5.0. A l l detection and comparison tunable parameters were set to default values (Affymetrix, Santa Clara, U S A ) . Absolute analysis was completed on triplicate data for M L O l and S92 at 48 hrs and 144 hrs. N i n e comparative analyses were generated for each time point. Only probe sets that had a change call o f T or ' M F and change p value o f < 0.003 across all nine comparison were called 'increasers', probe sets with ' D ' or ' M D ' and a p value > 0.997, 'decreasers'. Average Signal L o g (base 2) Ratio values were used to calculate the fold change. Probe sets were linked to their target descriptions and to their gene ontology ( G O ) annotations using the NetAffx analysis centre (Affymetrix,  44  Santa Clara, U S A ) (http://www.affymetrix.corn/analysis/index.affx) and S G D (Saccharomyces Genome Database; http://www.yeastgenome.org/).  2.5.7 C o n f i r m a t i o n of D N A m i c r o a r r a y results by R e a l - T i m e P C R Confirmation o f the D N A microarray data was done by semi-quantitative reverse transcriptase Real-Time P C R . Total R N A isolated for D N A microarray assays was treated with DNase I as per manufacturer's instructions (RNeasy M i n i kit, Qiagen, Hilden, Germany). After three applications o f DNase I, 100 ng o f total R N A was used as template i n a P C R amplification (Fermentas, Burlington, Canada) to show the absence o f genomic D N A using primers specific to ACT1 (Table 6). Control genomic D N A was isolated (Ausubel et al., 1995) and 50 ng was used for the P C R reaction (Fermentas, Burlington, Canada). The 100 bp P C R product for ACT7 was visualized by 4% NuSieve G T G Agarose (Cambrex Corp., East Rutherford, U S A ) gel electrophoresis and ethidium bromide staining (Ausubel et al., 1995). One microgram o f clean total R N A was used to synthesize c D N A using Superscript and a random hexamer primer m i x as per manufacturer's instructions (Invitrogen, Carlsbad, U S A ) . Semi-quantitative real-time P C R was conducted using S Y B R Green P C R Master m i x and an A B I P R I S M 7500 instrument (Applied Biosystems, Foster City, U S A ) . P C R reactions were done i n triplicate using 100 ng o f c D N A as template. ACT1 was used as the control gene. The genes and primer sets used are shown i n Table 6.  45  Table 6. Primers used i n semi-quantitative reverse transcriptase real-time P C R to confirm D N A microarray data.  Gene Symbol ACT! ACT1 AQR1 AQR1 CTT1 CTT1 DIP5 DIP5 ENA2 ENA2 PH084 PH084 PRR2 PRR2 PUT4 PUT4 SUE1 SUE1 YPC1 YPC1 YML089C YML089C  Primer Direction  Primer Sequence  Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse  5' - G T T T C C A T C C A A G C C G T T T T G - 3 ' 5' - G C G T A A A T T G G A A C G A C G T G A G - 3 ' 5' - T C G A G C A A G A C A A A G C T A A C G G - 3 ' 5' - G C T A C G A C G G C C A A G A A A T T T T - 3 ' 5' - G A G A A A G A G T T C C G G A G C G T G T - 3 ' 5-ATTCTGGTATGGAGCGGCGTA-3' 5' - T T T G T G G C T T G G C G T A C A T G - 3 ' 5' - G G T G A T C C A A C T C A A G A T T C C G - 3 ' 5' - C A T T C G A C T C A A C T G T G A A G C G - 3 ' 5' - G C A A C A A C T G A T G A T G C T T T C G - 3 ' 5' - G C C A T T A T T G C A C A A A C C G C - 3 ' 5' - C G A A A A T T T C C A T G A C G T G A G G - 3 ' 5 -GACTGC AGAACACGCCTATTCC-3' 5 -TTATTTAGCGCCTCACCCGTC-3' 5 -C A T C C A C G G C A G A C G T G T T T A-3' 5 -A G C C T T G C G G A A T C T C A G G T A C - 3 ' 5 -TTGTTTGGTG A A C G T G G C ACT-3' 5 -CC A C C A A T T G A A T G G C A A C AG-3' 5 -A C T G C T T G A A C C A C A C G G A T G - 3 ' 5 -TGACGTTG AGCGTAATG ACCC-3' 5 -C A A T G A A A T G C A A G A G C G C A-3' 5 -GGAATTGTAAGGCACACCGAGT-3'  2.5.8 Transcription of URA3 and transgenes mael and mleA Transcription o f URA3 and transgenes mael and mleA was analysed b y reverse transcriptase P C R (One-Step R T - P C R , Qiagen, Hilden, Germany). R N A isolation, DNase treatment and clean-up were completed as previously described and 1 jig o f clean total R N A was used as a template for each R T - P C R reaction. URA3 primers F o r l 5 B and Rev3bp, mael primers For4g and R e v l l g , and mleA primers For9p and Rev6g are shown in Table 5. Primers A C T F o r 2 6 9 ( 5 ' - A A G A G A G G T A T C T T G A C T T T A C G - 3 ' )  and  A C T R e v 1 c (5' - A C A A T A C C A G T A G T T C T A C C G - 3 ' ) were used as internal controls. 46  Control genomic D N A was isolated (Ausubel et al., 1995) and 50 ng was used for each R T - P C R reaction (One-Step R T - P C R , Qiagen, Hilden, Germany). The 269 bp, 783 bp, 807 bp and 499 bp P C R products for ACT1, mael, mleA, and URA3 respectively, were visualized by 1.5% agarose gel electrophoresis and ethidium bromide staining (Ausubel etal., 1995).  2.5.9 Analysis of the proteome of M L 0 1 Cell pellets obtained for mieroarray analysis at 48 h were also used for protein extraction. Each cell pellet was re-suspended in ice-cold 5 m L lysis buffer (50 m M Tris, p H 8.5, 0.1% SDS) and aliquoted into four 1.5 m L tubes also on ice containing sterile glass beads. Cells were lysed in a cold room using a mini-beadbeater 8 (Glen M i l l s , Clifton, U S A ) with intermittent vortexing. After lysis the samples were centrifuged at 18000 x g for 2 m i n at 2 °C. The supernatant was transferred to clean tubes and centrifuged at 18000 x g for 10 m i n at 2 °C. Trichloroacetic acid precipitation o f the proteins required adding an equal volume o f ice cold 40% trichloroacetic acid and incubation (on ice) for 60 min. Samples were centrifuged at 18000 x g for 30 m i n at 2 °C. Precipitated proteins were washed twice with 100% acetone (-20 °C) and centrifuged at 2 °C for 30 m i n and 20 min. Pellets were dried at room temperature until all visible liquid was evaporated and then stored at -80 °C. Proteins were examined by one dimensional S D S - P A G E (Ausubel et al., 1995) and total protein determination was completed using a commercial Bradford assay reagent (BioRad, Hercules, U S A ) . Protein pellets were shipped on dry ice to Genome B C Proteomics Centre for i T R A Q analysis (University o f Victoria, Victoria, Canada). Denaturation, blocking o f  47  cysteines, digestion with trypsin and labelling with i T R A Q tags were done according to the i T R A Q protocol (Applied Biosystems, Foster City, U S A ) . Protein samples were labelled with the i T R A Q tags as follows: M L 0 1 replicate 1, i T R A Q l 14; S92 replicate 1, i T R A Q l 15; M L 0 1 replicate 2, i T R A Q l 16; and S92 replicate 2, i T R A Q l 17. Strong cation exchange ( S C X ) chromatography, fractionation and L C M S / M S analyses have been previously described (DeSouza et al., 2005). The modifications to the S C X method were that the flow rate was set to 0.5 m L / m i n and the gradient applied was 0-35% buffer B i n 30 min. Fractions were collected every min. Prior to L C M S / M S analysis fractions were brought up to 20 p L with 5% acetonitrile and 3% formic acid and transferred to autosampler vials (Dionex/LC Packings, Sunnyvale, U S A ) . The modifications to the L C M S / M S procedure were that the mobile phase (solvent A ) consisted o f water/acetonitrile (98:2 [v/v]) with 0.5% formic acid for sample injection and equilibration on the guard column at a flow rate o f 100 uL/min. A linear gradient was created upon switching the trapping column inline b y mixing with solvent B that consisted o f acetonitrile/water (98:2 [v/v]) with 0.5% formic acid and the flow rate reduced to 200 nL/min. A 10 p L o f sample was injected i n 95% solvent A and allowed to equilibrate on the trapping column for 10 min. U p o n switching inline with the M S , a linear gradient from 95% to 40% solvent A developed for 40 m i n and i n the following 5 min the composition o f mobile phase was decreased to 20% A before increasing to 95% A for a 15 m i n equilibration before the next sample injection. The M S data acquisition method consisted o f a 1 s T O F M S survey scan o f mass range 400-1200 amu and two, 2.5 s product ion scans o f mass range 100-1500 amu. The two most intense peaks over 20 counts, with charge state 2-5 were selected for fragmentation and a 6 amu window was  48  used to prevent the peaks from the same isotopic cluster from being fragmented again. Once an ion was selected for M S / M S fragmentation it was put on an exclude list for 180 s. Curtain gas was set at 23, nitrogen was used as the collision gas and the ionization tip voltage used was 2700 V . Data files were processed using the ProQuant software (v. 1.0) (Applied Biosystems, Foster City, U S A ) i n Analyst using the following parameters: The M S and M S / M S tolerances were set to 0.15. A S. cerevisiae subset database o f the Celera Discovery Systems database (Ver. 3.0, 01/12/2004) (Celera, Rockville, U S A ) was used for the protein searches. Methyl methanethiosulphonate ( M M T S ) modification o f cysteines was used as a fixed modification. A l l results were written to a Microsoft Access database (Microsoft, Redmond, U S A ) . In order to reduce protein redundancy, experimental software, ProGroup viewer (Applied Biosystems, Foster city, U S A ) was used to assemble and report the data. Four comparative analyses were generated using S92 replicate 1 and S92 replicate 2 as denominators. Weighted average ratios were calculated for protein ratios with a p-value < 0.05 across all comparisons.  2.6 Phenotypic characterisation of ML01 2.6.1 Growth kinetics of ML01 A Bioscreen C™ Automated Microbiology Growth Curve Analysis System (Thermo Electron Co., Waltham, U S A ) was used to examine the growth kinetics o f the M L 0 1 or S92 yeasts in Y P D and commercially available Chardonnay must. A single colony from stock culture plates was inoculated into 5 m L o f Y P D broth which was incubated at 30 °C until the culture reached stationary phase. One u L o f the culture was  49  inoculated into one well o f a microtiter plate (Thermo Electron C o . , Waltham, U S A ) containing 99 u L o f Y P D test media or Chardonnay must. A total o f nine replicates and one blank control were inoculated per type o f test media. The plate was incubated at 30 °C for 64 h with continuous shaking at high intensity. Optical densities for all wells were measured every 10 m i n using the wide band measurement filter (ODeoonm)specific growth rate ( p  max  Maximum  ) was calculated b y converting the O D readings to natural log  values and the maximum slope during the exponential growth phase was determined for each replicate. Generation time was calculated as described b y (Reed and Nagodawithana, 1991). Data was analyzed using Excel 2000 (Microsoft, Redmond, USA).  2.6.2 Utilization of malate as sole carbon source by ML01 and S92 Single colonies from stock culture plates o f the parental strain S92 or the M L 0 1 strain were transferred to 5 m L Y P D broth and were incubated at 30 °C until the cultures reached stationary phase. Four 1-L Erlenmeyer flasks were filled with 150 m L o f modified Y P D containing 2% L-malic acid and were closed with cotton plugs. T w o o f the flasks were inoculated with M L 0 1 to achieve an initial O D 6 o o  nm  o f 0.01 and two  additional flasks were similarly inoculated with S92. The flasks were incubated at 30 °C under constant agitation at 180 rpm. Samples were removed at each sampling time and optical densities were measured at abs 600 nm. The samples were then centrifuged i n a micro-centrifuge at 18,000 x g for 10 m i n (Eppendorf, Hamburg, Germany), and supernatants were frozen at -30 °C for later analysis. The OD6oonm readings from the two M L 0 1 flasks and the two S92 flasks were averaged and growth curves were generated  50  using Microsoft Excel 2000 (Microsoft, Redmond, U S A ) . L - M a l i c concentrations were determined in triplicate for each sample at 350 h by enzymatic analysis (Roche, Basel, Switzerland).  2.6.3 W i n e m a k i n g w i t h M L 0 1 Wines were made from Chardonnay and Cabernet Sauvignon grapes. Chardonnay grape must from fruit harvested in the year 2000 (22.5 B r i x , p H 3.18, T A 13.45 g/L, 9.2 g/L malate, Y A N C 285.7 mg/L, 60 m g / L total S 0 ) was obtained from 2  Quails' Gate Estate Winery, Okanagan Valley, B C , Canada. T w o carboys (11.7 L capacity) and two flasks (3 L capacity) o f Chardonnay grape must were directly inoculated with 0.2 g / L o f M L 0 1 and four carboys and four flasks were directly inoculated with 0.2 g / L o f S92. After the alcoholic and M L F fermentations were completed by the malolactic yeast M L 0 1 , the wines were racked, topped-up, provided with sulphite (40 m g / L total S 0 ) , and aged at 7 ° C for nine months. The alcoholic 2  fermentations were considered complete once the wines reached a specific gravity o f 0.990 - 0.996. After alcoholic fermentation with the parental strain S92 was completed, two carboys were racked, topped-up, sulphited (40 m g / L total S 0 ) , and aged at 7 °C for 2  nine months. Wines i n the remaining two carboys fermented by S92 were racked, topped-up, and inoculated with a freeze dried preparation o f O. ceni as per manufacturer's recommendations (Vinoflora Oenos, Chr. Hansen, Hoersholm, Denmark) and placed at 20 °C. The two carboys inoculated with O. ceni were re-inoculated one week later with O. ceni (recommended concentrations) and again two weeks later with a double inoculum o f O. ceni and placed at 25 °C. Six months after the initial inoculation with O. ceni, the  51  M L F was stuck at 0.25 g malate/L i n one carboy and at 2.98 g/L in the second carboy. The wine was racked, sulphited (40 m g / L total SO2) and aged at 7 ° C for 3 months. After ageing, all wines were racked and bottled (total SO2 adjusted to 40 mg/L). Sensory analyses were performed after four months and again after four years o f bottle ageing at 14 °C. Physical, chemical and sensory analyses were performed on at least three bottle replicates from one carboy. Analyses for wines inoculated with S92 and O. ceni were conducted on the carboy with a residual o f 0.25 g malate/L. In order to obtain sufficient biological replicates to analyse the volatile compounds in wine by G C / M S , the fermentations with M L O l , S92 and S92 plus O. ceni were repeated in Chardonnay grape must from fruit harvested in 2004 (23.75 Brix, p H 3.41, T A 8.78 g/L, malate 5.5 g/L, Y A N C 401.2 m g / L , 25 m g / L total S 0 ) by Calona 2  Vineyards, Okanagan Valley, B C , Canada. Eight 500-mL flasks, two carboys and two 2L flasks were directly inoculated with 0.05 g/L o f M L O l . Sixteen 500-mL flasks, four carboys and four, 2 - L flasks were directly inoculated with 0.05 g/L o f S92.  The must  was incubated initially at 19 °C for 35 h, then 13 °C for 1 week and finally 19 °C until completion o f the fermentation. After the alcoholic and M L F fermentations were completed by the malolactic yeast M L O l , the wines were racked, topped-up, sulphite levels adjusted to 0.8 m g / L molecular SO2), and kept at 4 °C for 11 months. After alcoholic fermentation with the parental strain S92 was completed, half the wines were racked, topped-up, sulphite levels adjusted to 0.8 m g / L molecular SO2, and aged at 4 °C for 11 months. The remaining S92 produced wine was racked, topped-up, and inoculated with O. ceni as per manufacturer's recommendations (Vinoflora Oenos, Chr. Hansen, Hoersholm, Denmark) and placed at 20 °C. The S92 wine inoculated with O. ceni was re-  52  inoculated 2 weeks later with a double inoculum o f O. ceni. Nine days after the double inoculum the temperature was increased to 25 °C. One month after the temperature increase, 1.5 L o f wine undergoing M L F was mixed with wine not showing active M L F . Two months later a double inoculum o f O. ceni and 50 m g / L o f Leucofood (Gusmer Enterprises, Mountainside, U S A ) were added. Nine months from the initial inoculation with O. ceni, the bacterial M L F was completed. The wine was racked, sulphite adjusted to 0.8 m g / L molecular SO2 and aged at 4 °C for two months. After ageing, all wines were racked and bottled. Flasks for chemical analyses (500 m L fermentations) were stirred once before daily sampling i n order to obtain a homogenous sample. Sampling was done anaerobically as described for the transcriptome/proteome study (Section 2.5.6). Physical, chemical and G C / M S analyses were performed on three biological replicates. Cabernet Sauvignon must (22.9 Brix, p H 3.72, T A 7.41 g/L, malate, 6.2 g/L, Y A N C 325.9 m g / L , 30 m g / L total S 0 ) was obtained from Hawthorne Mountain 2  Vineyards, Okanagan, B C i n the 2000 vintage. The grapes were crushed and must was vinified without skin contact at the Pacific Agri-Food Research Centre ( P A R C ) using standard winemaking procedures. Fermentations were conducted using the same procedures as described for the Chardonnay 2000 must. The two carboys inoculated with O. ceni (Vinoflora Oenos, Chr. Hansen, Hoersholm, Denmark) after the completion o f the alcoholic fermentation were re-inoculated two weeks later with O. ceni (recommended concentrations). After completion o f the M L F the wine was racked, sulphited (80 m g / L total SO2) and stored at 7 °C for eight months. After ageing, all wines were racked and  53  molecular S O 2 adjusted to 0.4 m g / L before bottling. Physical and chemical analyses were performed on at least three bottle replicates.  2.6.4 Analyses of must and wine Microbiological populations i n grape musts were determined in samples diluted with 0.1% peptone that were spread onto Modified Rogosa Agar (Pilone and Kunkee, 1976) and Dichloran Rose Bengal Agar (Difco, Becton, Dickinson and C o . , Sparks, U S A ) . Plates were incubated for two and seven days at 25 °C to enumerate yeast and lactic acid bacteria, respectively. Plating was done in duplicate. Soluble solids (Brix) in wines were determined by specific gravity and with a Reichert A B B E M a r k II Refractometer (Reichert Analytical Instruments, Depew, U S A ) . Titratable acidity was determined according to A O A C method number 926.12 and by using a Metrohm 686 Titroprocessor (Metrohm, Herisau, Switzerland) (tartaric acid as reference). The p H was determined using a Corning 455 pH/ion analyzer (Corning, Corning, U S A ) and a Metrohm 686 Titroprocessor (Metrohm, Herisau, Switzerland). The viscosity o f the wine was determined with a Brookfield viscometer M o d e l D V - I I (Brookfield Engineering Labs, Stoughton, U S A ) equipped with a L V spindle. The viscometer was set at 60 rpm at 25 °C. Colour according to C I E L A B tristimulus scales was measured i n Chardonnay 2000 wines and Cabernet Sauvignon after four months o f bottle ageing at 14 °C in the dark. The wines were analyzed with a Beckman D U 6 4 0 B scanning spectrophotometer (Beckman Coulter, Fullerton, C A ) and  /4420nm+520nm  with an Ultrospec  3000 ( G E Healthcare, Chalfont St. Giles, U K ) . A l l colour analyses were completed without dilutions. Malate, lactate, glucose, fructose, acetate and ethanol determinations  54  were done by enzymatic analysis (Megazyme, W i c k l o w , Ireland). Physical and chemical analyses were performed on at least three biological replicates or at least three bottle replicates.  2.6.5 Sensory analysis Chardonnay wines produced i n 2000 were evaluated i n duplicate after four years o f bottle ageing at 14 ° C for colour, aroma, flavour-by-mouth and overall quality, by thirteen trained judges. The methodology o f the sensory study was approved by the Clinical Research Ethics Board at the University o f British Columbia (Appendix C ) . A l l tasters provided written informed consent to participate in the study (Appendix D ) . Prior to the sensory evaluation, five experienced wine judges bench tested the samples to select attributes that would characterise the wines. The bench testers were also instructed to screen out any defect wines. The attributes selected for aroma were fruity and buttery; the attributes selected for flavour-by-mouth/taste were fruity, sweet, buttery, acidity and body (Table 7). Thirteen judges (six females and seven males) evaluated the wines in duplicate using a completely randomized design. A l l judges were experienced wine tasters. Judges participated i n a training session to become familiarized with the tasting protocol and unstructured line scale. The tasting/rinsing protocol required judges to swirl and sniff the glass for the aroma assessment, and sip and swirl the wine in their mouth for the flavour/ quality assessment. Judges were instructed to rinse well with water between assessments. A l l aroma, flavour-by-mouth and quality assessments were conducted i n individual tasting booths. A 30 m L wine sample was presented at room temperature i n 250 m L  55  I A N O - ISO glasses. Glasses were labelled with a three-digit random number and covered with plastic Petri dishes. The colour assessment was conducted on 20 m L samples i n 25 m L plastic Petri dishes. Evaluations were conducted against a white background and were evaluated under natural light. Different random codes were used for the colour, aroma, flavour-by-mouth and quality evaluations to prevent bias among assessments. Evaluations took place on two successive afternoons. Judges scored each attribute on a 10 cm unstructured line scale, anchored at 1 cm and 9 cm with low and high (or light and dark for colour). Data were quantified b y measuring the distance o f the judge's mark from the origin.  Table 7. Definition o f sensory attributes for visual, olfactory and gustatory evaluations  Attributes  Definitions  Visual Colour  Relative degree o f colour intensity from light yellow to dark yellow  Olfactory Fruity A r o m a Buttery A r o m a  Intensity o f fruity aromas (generic) from low to high Intensity o f diacetyl and/or lactic qualities from l o w to high  Gustatory Fruity Sweet Buttery Taste Acidity Body  Overall Quality  Intensity o f fruity tastes (generic) from low to high Intensity o f sweetness from low to high Intensity o f diacetyl and/or lactic qualities from l o w to high Intensity o f sour taste from low to high Tactile sensation (mouth coating) differentiating low-ethanol (thin) from high-ethanol (full-bodied) wines within the context o f these wines A composite response o f all sensations (Visual, aroma, flavor and aftertaste) from l o w to high quality  56  2.6.6 Analysis of volatile compounds in wine by gas chromatography/mass spectrometry Volatile compounds in Chardonnay wines were analyzed by G C / M S headspace analysis as described by Danzer et al., (1999) except that no S P M E was used. A 10 m L sample o f wine was placed into a 20 m L headspace vial containing 3 g o f N a C l and then positioned into the headspace auto sampler. Sample equilibration was done at 85 °C for 10 m i n with agitation set on high. 3-octanol (100 u L o f 0.565 mg/L) was used as the internal standard. Volatile compounds were analyzed and quantified using an Agilent 6890N G C (Agilent Technologies, Palo A l t o , U S A ) interfaced to a 5973N Mass Selective Detector. A 60 m x 0.25 m m ID, 0.25 urn thickness D B W A X fused silica open tubular column ( J & W Scientific, Folstom, U S A ) was used.  The carrier gas was ultra high purity helium  at a constant flow o f 1.3 m L / m i n . The headspace sample valve and transfer line temperatures were set at 100 °C and 110 °C, respectively. The G C oven temperature was initially set at 40°C for 5 min, then raised to 100 °C at 5 °C/min, then raised to 200 °C at 3 °C/min, held for 1 min, and then raised to 240 °C at 20 °C/min. The injection volume was 1 m L and the injection mode was split with a ratio o f 10:1. The M S was operated i n scan mode (35-400). The analysis was completed in triplicate, data were analyzed using Enhanced Chemstation software ( M S D Chemstation Build75, Agilent Technologies, Palo A l t o , U S A ) , and compounds found were matched with the Wiley275 library (Wiley and Sons, Hoboken, U S A ) .  57  2.6.7 Quantification of ethyl carbamate in wine produced by ML01 Determination o f ethyl carbamate concentration in wine was done by solid phase microextraction and G C / M S as described by Coulon et al., (2006). Chardonnay wines were heated at 70 °C for 48 h to maximize ethyl carbamate production.  2.6.8 Effect of residual ML01 populations on M L F in wine fermented primarily with the parental strain S92 The effect o f different concentrations o f M L 0 1 on the decarboxylation o f malic acid to lactic acid was examined i n 500 m L fermentation flasks containing 500 m L o f synthetic must inoculated with S92 and M L 0 1 . S92 and M L 0 1 were inoculated in the following ratios: 50:0.005, 50:0.05, 50:0.5, 50:5 and 50:50 mg/L. Control fermentations were inoculated to a final concentration o f 50 mg/L, 55 mg/L, and 100 m g / L with S92 or M L 0 1 strains alone. The flasks were incubated at 20 °C without shaking and ODgoonm was measured in two samples from each flask at each sampling time. After measurement of O D , individual samples were centrifuged (18000 x g, 10 min) and the supernatants were stored at -30 °C. L - M a l i c and L-lactic acid concentrations were determined by enzymatic analysis as described earlier. The OD oonm readings and the L-malic or L-lactic 6  acid concentrations from each replicate were averaged and plots were generated using Microsoft Excel 2000 (Microsoft, Redmond, U S A ) .  Fermentations were conducted in  duplicate.  58  2.6.9 Post-fermentation viability of M L O l Fermentation flasks (250 m L capacity) containing 200 m L Chardonnay grape must were inoculated with 100 m g / L o f re-hydrated M L O l or S92 yeast. Each fermentation flask was fitted with an ethanol-disinfected vapour lock.. The flasks were incubated at 20 °C without agitation for 269 days. Samples were removed from stirred flasks after 0, 6, 20, 50, 81, 115, 170, and 269 days. Samples were vigorously vortexed, serially diluted i n 0.1% peptone water (with vortexing between serial dilutions) and cultured on Y P D agar at 30 °C to estimate viable cell populations. A l l fermentations were conducted in duplicate. Results were expressed as mean colony forming units (CFU)/mL.  2.7 Statistical analyses A three-way analysis o f variance ( A N O V A ) was used to examine the main effects o f judge, wine and replication for each o f the sensory attributes. A l l two-way interactions were calculated (judge x wine, judge x replicate, and wine x replicate), i n order to track the panel consistency, judge reproducibility and sample-to-sample variation, respectively. Mean scores and least significant differences (Fisher L S D p < 0.05) were calculated. The mean scores with significant differences among wines were plotted using a cobweb diagram (Figure 17). A correlation principal component analysis ( P C A ) was performed on the mean sensory scores (n=13) from each o f the replications (n=2). This allowed the location o f both replicates to be on the diagram (Figure 18). A N O V A s were used to preselect the most relevant attributes prior to P C A analysis. The term 'overall quality' was  59  not included i n the P C A in order to clearly delineate the objective flavour profile analysis (attribute intensities) from the more subjective quality assessment. One-way A N O V A s were used to evaluate the variation in physico-chemical properties and volatile compounds among the wines. Duncan's post-hoc tests were performed to determine which treatment means were statistically different for each o f the measurements (p < 0.05). Differences in generation times between M L 0 1 and S92 as well as differences in sugar concentrations o f wines produced by M L 0 1 and S92 were evaluated using a two-tailed independent samples t tests (p < 0.05). A l l statistical calculations were performed using Minitab 14 (Minitab, State College, U S A ) , SPSS v. 11.5 (SPSS, Chicago, U S A ) and Excel 2002 (Microsoft, Redmond, U S A ) .  60  3 RESULTS 3.1 Integration of the malolactic cassette into the genome of S92  After screening approximately 2000 yeast transformants for integration of the malolactic cassette (Figure 1), five clones were found that produced lactic acid from malic acid using the screening method developed for the production of L-lactic acid (Figure 2). After recovery of the malolactic clones in Y P D and subsequent inoculation into synthetic must, clone 2 was removed since it no longer continued to produce lactic acid. The PCR with primers specific to PGKlp and downstream of the 3'-end integration site were used to show that the four remaining clones had the malolactic cassette integrated into the URA3 locus (Appendix E).  ura3  PG  •4— mael  PGK1p  PGKU  '  •*—mleA  PGK1p  ura3  Figure 1. Schematic representation of the malolactic cassette integrated into the URA3 locus of S. cerevisiae S92. The linear cassette was co-transformed with pUT332 that contains the Tn5ble gene that encodes resistance to phleomycin.  3.2 Functionality of malolactic wine yeast  Three individual colonies from each malolactic clone were inoculated into synthetic juice containing 4.5 g/L of malate. Each of the three selected colonies from clones 1, 3 and 4, and two colonies from clone 5 was able to degrade the 4.5 g/L of malate in the synthetic must to = 0.05 g/L by day six (Table 15, Appendix F). A l l three of the selected colonies from clone 4 were also capable of completing the alcoholic fermentation within 14 days (Tables 16 and 17, Appendix F). Clones 1, 3 and 5 were 61  A  B  Clone 4 , M L 0 1 Figure 2. Test for L-lactic acid production in S92 cells transformed with the malolactic cassette and pUT332. (A) S92 industrial wine yeast transformants growing in a microwell plate containing 200 pL of synthetic must per well (4 days at 30 °C). (B) Microwell plate containing 75 pL of the L-LDH/NAD/phenazine methosulfate/nitro blue tetrazolium reaction mixture per well and 25 pL of supernatant from micro-wells in panel A . Wells containing L-lactic acid were a purple/blue colour. The positive controls were S92 yeast transformed with pJH13 (a CEN-based plasmid containing the malolactic cassette and KanMX marker) (Husnik, 2001).  either unable to complete the alcoholic fermentation by day 14 or did not ferment as rapidly as clone 4 by day 7 (Appendix F). The residual sugar (glucose and fructose) in the synthetic must after 14 days was = 1.3 g/L for all of the colonies selected from clone 4 (Appendix F). Based on these results, malolactic clone 4 (ML01) was selected for pilot-scale A D Y production. ML01 produced as A D Y was capable of decarboxylating 4.46 ± 0.02 g/L of malate (99.1%) within the first three days and producing equimolar amounts of lactic acid (3.01 ± 0.07 g/L) by day 14. In contrast the parental strain S92 consumed 0.89 ± 0.1 g/L of malate and only 0.02 g/L of lactate was detected in the media after 14 days of fermentation. Residual sugar (glucose and fructose) was 1.71 ± 0.99 g/L and 3.79 ± 0.95 g/L for ML01 and S92, respectively. The final pH of the fermentations was 3.31 ± 0.01 and 3.15 ± 0.01 for ML01 and S92, respectively.  62  3.3 Genetic characteristics of ML01 3.3.1 C o n f i r m a t i o n o f the identity of the parental strain  Chromosome separation by pulsed field gel electrophoresis (Figure 3) and PCR amplification patterns of genomic D N A regions in between d elements of the T y l retrotransposon (Appendix G) confirmed that the parent strain of ML01 was S92.  ML01  S92  Figure 3. ML01 and S92 chromosomes as separated by pulsed field gel electrophoresis. Chromosomal patterns for ML01 and the parent S92 were identical. In addition, PCR profiles of amplified D N A between T y l retrotransposon d sequences were also identical for both strains (Appendix G).  3.3.2 C o r r e c t integration of the malolactic cassette into the genome of ML01  A Southern blot was performed using a 5 ura3 probe on /Vs/I-digested genomic ,  DNA of ML01 and S92. Two signals were detected for ML01 corresponding to 1.7 kbp and 2.8 kbp D N A fragments, and one signal was detected for S92 corresponding to a 1.7 kbp D N A fragment (Figure 4). The 1.7 kbp fragment matches the expected fragment size for a non-disrupted URA3 locus and the 2.8 kbp fragment is in accordance with the 63  presence of a malolactic cassette integrated into the URA3 locus. To clearly characterize the integration event in the M L O l strain, Southern blot analyses were performed using probes corresponding to the mael and mleA genes (Figures 5 and 6), and the PGK1 promoter (Appendix H). Blots with the mael, mleA and PGK1 promoter probes confirmed the presence of these genes in the MLOl strain and correct integration into only the URA3 locus.  S92  ML01  M2URA3  U2URA3 <  Malolactic cassette  2.8 Kbp 2.8 Kbp URA3,  <  1.7 Kbp  1.7 Kbp  Figure 4. Integration of the malolactic cassette into the URA3 locus of S92 was confirmed by Southern blot analysis using a URA3 probe. The schematic representation illustrates the Nsil restriction sites with vertical lines and the URA3 probe (area with hatched boxes in panel on the right).  64  URA3  S92  ML01  No hybridization  M2URA3  M2URA3  <  4.9 K b p  Malolactic casi  j  i  4.9 K b p  Figure 5. Integration of the malolactic cassette into the URA3 locus of S92 was confirmed by Southern blot using a mleA probe. The schematic representation illustrates the Pvull restriction sites with vertical lines and the mleA probe hybridization site is depicted as a hatched box in the panel on the right.  S92  ML01  URA3 No hybridization  M2URA3  M2URA3 <  Malolactic cassette  2.8 K b p 2.8 K b p  Figure 6. Integration of the malolactic cassette into the URA3 locus of S92 was confirmed by Southern blot using a mael probe. The schematic representation illustrates the Nsil restriction sites with vertical lines and the mael probe hybridization site is depicted as a hatched box in the panel on the right. 65  Both S92 and ML01 form ascospores (Appendix I). Analysis of the ML01 spores revealed 2:2 segregation; cells from two spores were auxotrophic for uracil but positive for M L F while cells from the remaining two ascopores had the opposite phenotype.  3.3.3 Genetic stability of the malolactic cassette in the genome of ML01 After large-scale A D Y production and completion of M L F in Chardonnay grape must, 401/404 randomly chosen ML01 colonies tested positive for the M L F phenotype (99.3 ± 1 . 0 %, p < 0.05). The integration of the malolactic cassette in the URA3 locus of S92 strain is therefore sufficiently stable for A D Y production and the subsequent M L F during the winemaking process.  3.3.4 ML01 does not contain bla and TnSble antibiotic markers After transformation, ML01 was cultured successively for seven days on a nonselective medium to eliminate pUT332, whose only purpose was to serve in the early steps of screening for transformants.  A single colony was plated on non-selective media  and on phleomycin containing media (Figure 7). A Southern blot using a probe specific to the Tn5ble genes of pUT332 revealed that this gene was absent in ML01 (Figure 7). Southern blot analyses also verified that ML01 does not contain the bla gene (nor an additional 970 bp of bacterial derived pUT322 sequences) (Figure 8).  66  F i g u r e 7. The phleomycin resistance gene is absent in the genome o f M L 0 1 . (A) Growth o f M L 0 1 , S92, S92 transformed with pUT332 and S. cerevisiae 3597 ? 78-1 (integrated 7n5ble gene) yeast strains on Y E G media with or without 100 pg/ml phleomycin. (B) Agarose gel showing fractionated genomic D N A o f S92, M L 0 1 and S. cerevisiae 3597 ? 78-1 digested with Ncol restriction enzyme. (C) Southern blot analysis o f the genomes o f S92, M L 0 1 and S. cerevisiae 3597 ? 78-1 probing for the presence o f the Tn5ble gene.  A  B  C D E F G  F i g u r e 8. The ampicillin resistance gene and 970 bp o f pUT332 non-Saccharomyces vector are absent i n the genome o f M L 0 1 . Lane A represents a D N A Ladder, lane B contains 3 pg o f EcoRY digested S92 genomic D N A , lanes C and D each contain 3 pg o f M L 0 1 genomic D N A , lanes E to G contain increasing concentrations o f EcoRV digested D N A from S92 transformed with pUT332 (0.3 pg, 0.75pg and 1.5 pg). A description o f the probe used is given i n Appendix A .  3.3.5 Sequence of the malolactic cassette integrated into the genome of ML01 The sequence o f the malolactic cassette integrated at the URA3 locus as well as 35 bp upstream and 184 bp downstream o f the genomic flanking sequences were verified by sequencing (Figure 9). A detailed description o f the sequence is given in Appendix J.  68  Alignment of DNA sequences: ML01 and Native URA3 locus Upper line: ML01, from 1 to 8901 Lower line: Native URA3 locus, from 1 to 2081 1  CAGCAATTAATACTTGATAAGAAGAGTATTGAGAAGGGCAACGGTTCATCATCTCATGGA  IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII I 1 61  CAGCAATTAATACTTGATAAGAAGAGTATTGAGAAGGGCAACGGTTCATCATCTCATGGA TCTGCACATGAACAAACACCAGAGTCAAACGACGTTGAAATTGAGGCTACTGCGCCAATT  I'l I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I 61  TCTGCACATGAACAAACACCAGAGTCAAACGACGTTGAAATTGAGGCTACTGCGCCAATT  continuation of malolactic cassette 8 641  CGCTGCCTTGGGACAAGGCTTGGGCCGATAAGGTGTACTGGCGTATATATATCTAATTAT  I I I I I I I Ii I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I II I I I I I I I 1821 8701  CGCTGCCTTGGGACAAGGCTTGGGCCGATAAGGTGTACTGGCGTATATATATCTAATTAT GTATCTCTGGTGTAGCCCATTTTTAGCATGTAAATATAAAGAGAAACCATATCTAATCTA  I I I II II I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I 1881 87 61  GTATCTCTGGTGTAGCCCATTTTTAGCATGTAAATATAAAGAGAAACCATATCTAATCTA ACCAAATCCAAACAAAATTCAATAGTTACTATCGCTTTTTTCTTTCTGTATCGCAAATAA  I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I II I I I I I I I I I I I I I I I I I I I I I I I I I I 1941 8821  ACCAAATCCAAACAAAATTCAATAGTTACTATCGCTTTTTTCTTTCTGTATCGCAAATAA GTGAAAATTAAAAAAGAAAGATTAAATTGGAAGTTGGATATGGGCTGGAACAGCAGCAGT  I II I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I 2001  GTGAAAATTAAAAAAGAAAGATTAAATTGGAAGTTGGATATGGGCTGGAACAGCAGCAGT  8881  AATCGGTATCGGGTTCGCCAC  2061  AATCGGTATCGGGTTCGCCAC  IIIIIIIIIIIIIIIIIIII I  Figure 9. The upstream and downstream sequences flanking the malolactic cassette in S. cerevisiae MLOl are 100% identical. The sequence obtained from M L O l is shown in the upper line and the native sequences are shown in the lower line. Only a partial sequence of the malolactic cassette is displayed. The Srfl half sites (integration sites) are indicated in bold and underlined.  Comparison to previously published sequences obtained from the Saccharomyces Genome Database for URA3, PGK1 promoter and terminator, and the National Center for Biotechnology Information for mael and mleA showed four nucleotide differences in the URA3 flanking sequences and two nucleotide differences in one of the PGK1 promoter sequences (Appendix K). These anomalies could be due to genetic polymorphisms or  69  amplification errors during the construction o f the cassette. T w o changes were found in the coding sequence o f the mleA gene (Appendix K ) . The first difference resulted i n a change from aspartic acid to glutamic acid (aa position 538); both amino acids are acidic and did not affect the functionality o f the malolactic enzyme. The second change ( C - T , mleA nt position 996) resulted in a silent mutation (aspartic acid, aa position 332). The mael sequence was identical to the published sequence. In silico analysis o f the integrated cassette revealed that four new O R F s were created during construction o f the malolactic cassette; these O R F s were primarily composed o f Saccharomyces  sequences (Figure 10). In addition to the S. cerevisiae  sequences, three O R F s contained one or two restriction endonuclease sites that were required for construction o f the cassette. Novel O R F 1 (435 bp) contains one Kpnl (6 bp) restriction endonuclease site; novel O R F 2 (663 bp) contains a Kpnl and a Noil (8 bp) site; novel O R F 3 (636 bp) contains a Noil site; novel O R F 4 (360 bp) is entirely composed o f S. cerevisiae  5' URA3 flanking  PGK1I  Novel O R F 1 5' ura3 truncated  mael  sequences.  PGK1p  PGKH  Novel O R F 2 5' adpl truncated  mleA  PGK1p  3' URA3 flanking  Novel O R F 3 , 5' adpl truncated Novel O R F 4 3' ura3 truncated  F i g u r e 10. A schematic representation o f new O R F s o f more than 100 codons generated during construction o f the malolactic cassette; four new O R F s primarily composed o f S. cerevisiae sequences, were created.  70  3.3.6 Effect of the integrated malolactic cassette on the transcriptome of ML01 Global gene expression patterns i n M L 0 1 and S92 were investigated using the Affymetrix G e n e C h i p ® Yeast Genome S98 Array. The transcriptome o f M L 0 1 and S92 was analyzed at 48 hours and 144 hours, corresponding to the middle o f the M L F and completion o f the M L F (Figure 11). The 48 h and 144 h time points also corresponded to log phase and stationary phase, respectively (Figure 12). A t 48 h the M L 0 1 strain had consumed 1.73 ± 0.04 g/L o f malate and produced 0.92 ± 0.04 g/L o f lactate. In contrast, the parental strain S92 had consumed 0.28 ± 0.16 g/L o f malate and only 0.05 ± 0.01 g/L o f lactate was detected in the media. Equal amounts o f glucose/fructose remained; 169.9 ± 4.0 g/L and 166.7 ± 7.3 g/L for M L 0 1 and S92, respectively (difference not significant atp < 0.05). Transcription o f 19 genes was affected = two-fold in M L 0 1 after 48 hours; 11 genes were expressed at higher levels and eight genes were expressed at lower levels (Table 8). A t 144 h the transcription o f six genes was affected = two-fold; three genes were expressed at higher levels and three genes were expressed at lower levels (Table 9). After 144 hours o f fermenting, the M L 0 1 yeast had consumed all o f the malate (4.47 ± 0.002 g/L) and produced 3.05 ± 0.14 g / L o f lactate, whereas the control strain consumed 0.51 ± 0.05 g / L o f malate and negligible amounts o f lactate (0.06 ± g/L) was detected in the medium (Figure 11). The fermentation rate (monitored as ethanol production and CO2 loss) was similar to that o f the parental yeast S92 (Figure 13) and the sugar concentrations (glucose/fructose) at this time point were 37.09 ± 2.79 g/L and 36.5 ± 1.74 g/L for M L 0 1 and S92, respectively (difference not significant atp < 0.05).  71  48 h  I  '  i  144 h  48 h  144 h  Figure 11. Malate degradation and lactate production by M L 0 1 and S92 yeast strains in synthetic must (n=3). (A) Malate degradation by yeast strains M L 0 1 and S92; at 144 h M L 0 1 and S92 degraded 4.47 g/L and 0.51 g/L o f malate, respectively. (B) Lactate production by M L 0 1 and S92; at 144 h M L 0 1 had produced 3.05 g/L o f lactate (negligible amounts o f lactate could be detected i n S92 fermentations). Yeast were harvested at 48 h (during M L F by M L 0 1 ) and 144 h (completion o f M L F by M L 0 1 ) for D N A mieroarray analysis (represented schematically as vertical lines).  0  1  2 pj  3  4  5  6  7  8  ,i  Days  .9  10  11  12  13  14  15  48 h 144h F i g u r e 12. Growth o f M L 0 1 and S92 yeast strains in synthetic must (n=3). Daily absorbance readings showed no difference in growth. Yeast were harvested at 48 h (log phase) and 144 h (stationary phase) for D N A mieroarray analysis (represented schematically as vertical lines).  The introduction o f the malolactic cassette into S. cerevisiae S92 thus had a minimal effect on the transcription o f the 5773 O R F s (Saccharomyces Genome Database; June 1, 2005) i n the M L 0 1 strain. Moreover, no metabolic pathway was affected by the presence o f the malolactic expression cassette integrated into the genome o f M L 0 1 . Only one gene, AQR1, was found to be expressed differently at the two time points; -3.23 and 1.77 fold change at 144 hours and 48 hours, respectively.  73  Table 8. Effect o f the integrated the malolactic cassette i n the genome o f S92 on global gene expression patterns i n S. cerevisiae M L O l at 48 hours (> 2 fold change). Gene Symbol DIP5 YLR073C PCL1 SUL1 OPT2 RPL7B PH084 RLP24 YOR315W  Genes Fold Change 2.81 2.79 2.69 2.47 2.32 2.19 2.18 2.08 2.08  MAK16 HAS1  2.02 2.01  Expressed at Higher Levels in M L O l Biological Process Amino acid transport Unknown Cell cycle Sulfate transport Oligopeptide transport Protein biosynthesis Manganese ion transport and phosphate transport Ribosomal large subunit biogenesis Unknown Ribosomal large subunit biogenesis and host-pathogen interaction rRNA processing  Genes -5.13 -3.44 -3.29 -3.13 -2.41 -2.31 -2.23 -2.18  Expressed at Lower Levels in M L O l Protein catabolism M A P K K K cascade Response to stress Neutral amino acid transport Unknown Unknown Unknown Ceramide metabolism  SUE1 PRR2 CTT1 PUT4 YGR243W YR02 JID1 YPC1  Table 9. Effect o f the integrated malolactic cassette i n the genome o f S92 on global gene expression patterns i n S. cerevisiae M L O l at 144 hours (> 2 fold change). Gene Symbol ENA2 RDH54 YOL048C  AQR1 YML089C YIL152W  Genes Expressed at Higher Levels in M L O l Fold Change Biological Process 5.27 Sodium ion transport Double-strand break repair via break-induced replication, meiotic 2.18 recombination, and heteroduplex formation 2.10 Unknown  -3.23 . -3.14 -2.46  Genes Expressed at Lower Levels in M L O l Monocarboxylic acid transport and drug transport Unknown Unknown  74  B  A  Figure 13. Ethanol production and CO2 loss o f M L O l and S92 yeast strains in synthetic must (n=3). (A) Ethanol production by M L O l and S92 in synthetic must; no difference was detected. (B) CO2 loss i n fermentations by M L O l and S92 in synthetic must; no difference could be detected. Yeast cells were harvested at 48 h and 144 h (represented schematically as vertical lines) for D N A microarray analysis.  -a  The D N A mieroarray data was verified by semi-quantitative reverse transcriptase P C R o f 10 genes shown to have a = 2 fold change in the mieroarray experiments (Table 6); similar levels o f expression for nine genes were obtained (one gene, ENA2 was below the threshold for the real-time P C R experiment) (Appendix L ) . Transcripts o f the mael, mleA and URA3 were also detected by reverse-transcriptase P C R at 48 and 144 hours (Appendix M ) .  3.3.7 Effect of the integrated malolactic cassette on the proteome of ML01 The proteomes o f M L 0 1 and S92 were analyzed after 48 hours using i T R A Q (DeSouza et al., 2005) and multidimensional liquid chromatography and tandem mass spectrometry. Proteins were extracted from the same samples used for mieroarray analysis. i T R A Q analysis identified 559 proteins (confidence level >94%) using a subset of the S. cerevisiae Celera Discovery System database (Ver 3.0, 01/12/2004). Only one protein, lanosterol 14-demethylase cytochrome P450 ( E r g l l p ) was shown to be different at a p-value < 0.05 (default parameters) and across duplicate experiments. Lanosterol 14demythylase cytochrome P450 had a weighted average ratio o f 0.799 (using the S92 data as the denominator); E r g l l p is involved in ergosterol biosynthesis. Furthermore, 199 o f the 559 proteins detected are involved in major metabolic pathways including carbohydrate and amino acid metabolism, and pyrimidine, purine, fatty acid, ergosterol and formate biosynthesis. Other than E r g l l p , no difference i n protein ratios for M L 0 1 and S92 were detected for any other identified protein. In order to search for unique M L 0 1 proteins, a custom database was constructed which included the sequences for the mleAp, maelp, and the three new O R F s (5' ura3  76  truncated O R F , and the two 5' adpl truncated ORFs). The fourth new O R F could not be tested using this method since it contained only homologous URA3 sequences. The mleAp was present i n M L O l (confidence level >99%) but absent in S92. The membrane bound m a e l p and the three putative proteins that might be encoded by the novel O R F ' s created by cloning were not identified at a confidence level as low as 50%.  3.4 Phenotypic properties of MLOl 3.4.1 Growth kinetics In Y P D , there was a slight difference in |a.  between M L O l (0.54 ± 0.01 h" ) and 1  max  S92 (0.55 ± 0.005 h" ); the corresponding generation times were 1.28 ± 0.02 h and 1.26 ± 1  0.01 h for M L O l and S92, respectively (p < 0.05, n=9). In Chardonnay must no statistical difference was observed between the  p ax m  for M L O l (0.37 + 0.03 h" ) and the parental 1  S92 (0.37 ± 0.02 h" ); the corresponding generation times were 1.88 + 0.13 h and 1.86 ± 1  0.08 h for M L O l and S92, respectively (n=9). Growth during the commercial production of M L O l A D Y was not affected b y introduction o f the malolactic cassette into the URA3 locus o f S92 (Didier Colavizza, Lesaffre Development, rue Gabrie Peri 137, F-59700 Marcq-en-Baroeul, France, personal communication).  3.4.2 Utilization of malate as sole carbon source by MLOl and S92 The M L O l and parental strains were unable to consume malate as a sole carbon source. When grown aerobically i n modified Y P D media containing only 5 g / L o f glucose (to trigger the PGK1 promoter) and 20 g/L o f malate, the strains had similar growth kinetics (Figure 14) and no malate was consumed by M L O l or S92. After 350  77  hours, malate concentrations i n the media inoculated with M L O l and S92 were 20.4 ± 0.99 g/L and 20.2 ± 1.03 g/L o f malate, respectively.  12 n  0 40  >  >  r  1  1  1  50  100  150  200  250  300  •  1  1  350  400  Time (hours)  Figure 14. M L O l and S92 cannot consume L-malate as a sole carbon source. M L O l (?) and S92 (? ) strains were inoculated (0.01 ODgoonm final concentration) into modified Y P D medium containing 20 g / L o f malate and 5 g / L o f glucose and grown aerobically for 350 hours (n=2). Malate analyses after 350 h showed no reduction i n malate levels in the medium; 20.4 ± 0.99 g / L and 20.2 ± 1.03 g/L o f malate remained i n media inoculated by M L O l and S92, respectively.  3.4.3 Malolactic fermentation in Chardonnay and Cabernet Sauvignon musts by MLOl The sulphited and cold stabilized Chardonnay must (from fruit harvested in 2000) contained 105 C F U / m L o f yeast and 40 C F U / m L o f lactic acid bacteria prior to inoculation with M L O l or S92 A D Y . The M L O l and S92 strain both attained a final specific gravity o f 0.996 i n the high-acid Chardonnay wine at the end o f the alcoholic  78  fermentation. The M L 0 1 strain completed the alcoholic fermentation in 22 days and the S92 strain in 32 days (Figure 15). The M L 0 1 strain consumed 9.04 ± 0.03 g/L o f malate (n=2) within the first five days o f the alcoholic fermentation (Figure 16a) and produced an approximately equimolar amount o f 6.0 ± 0 . 1 g/L o f lactate i n the must by day seven (Figure 16b). In contrast the S92 strain consumed only 0.93 ± 0.26 g/L o f malate (n=4) and no lactate was produced in the Chardonnay wine at the end o f the alcoholic fermentation. O. ceni required 171 days after alcoholic fermentation to consume 5.29 g / L and 8.02 g/L o f malate (n=l) (Figure 16a) and produce 3.96 g/L and 5.42 g/L o f lactate (n=l) (Figure 16b), respectively in wine fermented with S92. N o further decarboxylation o f malic acid was observed (Figure 16b). Analysis o f titratable acidity, acetate, p H , viscosity and colour properties o f the Chardonnay wines produced by M L 0 1 , S92 and S92 plus O. ceni are shown in Table 10.  79  F i g u r e 15. Ethanol production by M L 0 1 (? ) and S92 (?) in high-acid Chardonnay grape must fermented at 20 °C was positively affected by introduction o f the malolactic cassette into a URA3 locus in the industrial wine yeast S92. M L 0 1 completed the alcoholic fermentation to a specific gravity o f 0.996 in 22 days and the parental strain in 32 days. Duplicate biological replications were analysed i n triplicate.  80  A 12 -,  0  20  40  60  80  100  120  140  160  180  200  220  140  160  180  200  220  Days  B 7 i  0  20  40  60  80  100  120  Days  Figure 16. M L F by M L 0 1 is completed in the first five days o f the alcoholic, fermentation in high-acid Chardonnay grape must (9.2 g/L). (A) Malate degradation and (B) lactate production by M L 0 1 (? / ? ) and S92 (? /? ) and S92 + O. ceni (? I\ ). The M L 0 1 strain fully and efficiently degraded 9.08 g/L o f malate and produced equimolar amounts o f lactate (6.07 g/L o f lactate). Wine inoculated with O. ceni required 171 days post-alcoholic fermentation to complete the M L F in carboy replicate 2 (0.25 g / L residual malate). A stuck M L F was observed for S92 + O. ceni in carboy replicate 1; 2.98 g/L o f malate remained despite four inoculums o f O. ceni. The parental strain consumed approximately 10% o f the malate during the alcoholic fermentation.  81  Table 10. Physicochemical and colour measurements o f high-acid Chardonnay wines (2000 harvest) produced by M L 0 1 , S92 and S92 plus O. ceni . 1  ML01  S92  S92 + O. ceni  7.7 a  10.9 b  7.4 c  ***  0.452 a  0.399 b  0.5 c  ***  pH  3.22 a  3.09 b  3.24 c  ***  Viscosity (mPa.s)  1.64 a  1.62 ab  1.60 b  *  L (degree o f lightness)  99.07 a  98.72 b  99.06 a  *#*  a (greenness)  -0.44 a  -0.53 b  -0.82 c  ***  b (yellowness)  4.77 a  5.50 b  5.84 c  ***  ^420nm + ^520nm  0.151  0.158  0.174  ns  Titratable acidity (g/L) Acetate (g/L)  b  Colour measurements  The mean values for bottle replicates are given for all quantities (n=3) a*, significant at/? < 0.05, 0.01, 0.001, or not significant Means separated atp < 0.05 by Duncan's post-hoc test n s ;  b  In Chardonnay grape must from fruit harvested in 2004 the M L 0 1 and S92 strains both attained a final specific gravity o f 0.990 at the end o f the alcoholic fermentation. This specific gravity corresponded to a residual glucose/fructose concentration o f 1.23 ± 0.05 g/L and 0.47 ± 0.02g/L for the M L 0 1 and S92 produced wines, respectively. The M L 0 1 and S92 strains completed the alcoholic fermentation i n 21 days (Appendix N ) . The M L 0 1 strain consumed 5.43 ± 0.002 g/L o f malate (98.7% complete) and produced approximately equimolar amount o f 3.69 ± 0.03 g/L o f lactate by the end o f the alcoholic fermentation; 97.7% o f the malate was consumed within the first nine days predominantly at a temperature o f 13 °C (Appendix N ) . The S92 strain consumed only 0.50 ± 0 . 1 g / L o f malate and no lactate was produced i n the Chardonnay wine at the end o f the alcoholic fermentation (Appendix N ) . O. ceni required 9 months at 20 and 25 °C after the alcoholic fermentation to complete the M L F . Analysis o f titratable acidity, 82  acetate, p H and colour properties o f the Chardonnay wines produced by M L O l , S92 and S92 plus O. ceni are shown i n (Appendix O). The sulphited Cabernet Sauvignon must (without skin contact) contained 7.2 x 10 C F U / m L o f yeast and no lactic acid bacteria prior to inoculation with M L O l or S92 3  A D Y . The M L O l and S92 strains completed the alcoholic fermentation i n 16 days. The M L O l and S92 strains both attained a final specific gravity o f 0.990 i n Cabernet Sauvignon wines at the end o f the fermentation. The M L O l strain consumed 6.13 ± 0.02 g/L o f malate (n=2) within the first four days o f the alcoholic fermentation. In contrast, the S92 strain consumed 1.87 ± 0.07 g/L o f malate (n=2) by the end o f the alcoholic fermentation. O. ceni required 42 days after alcoholic fermentation to consume 6.13 ± 0.03 g/L o f malate (n=2) i n wine fermented with S92. Analysis o f titratable acidity, acetate, p H , and colour properties o f the Cabernet Sauvignon wines produced by M L O l , S92 and S92 plus O. ceni are shown i n Table 11.  T a b l e 11. Physicochemical and colour measurements o f Cabernet Sauvignon wines produced b y M L O l , S92 and S92 plus O. ceni . 1  MLOl  S92  S92 + O. ceni  6.38 b  4.27 a  ***  Titratable acidity (g/L)  4.39 a  Acetate (g/L)  0.324 a  0.237 b  0.355 c  ***  3.98 a  3.80 b  4.05 c  ***  L (degree o f lightness)  84.60 a  84.56 a  88.05 b  ***  a (redness)  12.67 a  14.32 b  8.01 c  ***  b (yellowness)  24.34 a  22.05 b  24.78 a  ***  ^420nm +^520nm  1.00 a  1.14b  0.84 c  ***  pH  b  Colour measurements  T h e mean values of bottle replicates are given for all quantities (n=3) in the title relates only to p H a*. **^ significant atp < 0.05, 0.01, 0.001, or not significant Means separated atp < 0.05 by Duncan's post-hoc test a  n s :  b  83  3.4.4 Sensory profile of Chardonnay wines produced by M L O l The A N O V A results o f the sensory attribute ratings for wines produced by M L O l , S92 and S92 with M L F are summarized i n Table 12. Significant differences among wines were observed for seven sensory attributes (colour, fruity aroma, fruity taste, sweetness, acidity, body and overall quality) o f the nine which were measured. Judge variation was significant for all attributes, except for acidity (Table 12). This was expected due to individual physiological and scoring differences. Panel inconsistencies as indicated b y significant judge x wine interactions (Table 12) were present for two o f the seven significantly different attributes observed for wines (fruity aroma and overall quality). Therefore F-values were re-calculated for these two attributes using a more conservative random effects model (MS i atment/MSj* ) (Goniak and Noble, 1987). W h i l e t  e  w  the new F-value for fruity aroma (2.29) was not significant, the new F-value for overall quality (7.99) was statistically significant. This indicates that the panel inconsistencies were relatively minor compared to the magnitude o f the overall quality effects. Judge x replication and wine x replication interactions are shown in Table 12. The significantly different mean sensory attributes were plotted on a cobweb diagram (Figure 17) and a P C A plot (Figure 18). W i n e produced by M L O l was significantly highest i n overall quality, body, and perception o f sweetness and lowest in acidity when compared to wines produced by S92 with and without a M L F . W i n e produced by M L O l was also significantly highest for fruity taste when compared to wines produced by S92 with a bacterial M L F . The main characteristics o f wine produced by S92 without a M L F were its darker colour and high acidity. Wines produced by S92 with  84  bacterial M L F were judged to be more acidic, less sweet, have less body, less fruity taste and lower i n quality than wines produced with M L 0 1 .  Table 12. F-values from analysis o f variance o f Chardonnay wines for sensory attributes (three wines, 13 judges, two replications)  Descriptor  Wine  Y e l l o w colour  16.02***  Fruity aroma  Judge  Rep  Judge X  Judge X  WineX  Wine  Rep  Rep  9.81 ***  0.19  1.48  1.10  4.85*  6.36*  1 ] 7^***  0.01  2.78*  1.44  1.44  Buttery aroma  1.14  4.73**  0.00  1.74  0.86  1.27  Fruity taste  16.71***  7.68***  1.72  1.27  2.01  0.74  Buttery taste  1.55  7 jg***  1.39  4.50***  2.57*  0.95  Sweet  49.46***  8.46***  0.92  1.40  2.14  0.92  Acidity  23.05***  1.81  4.01  1.24  1.03  1.12  Body  12.01***  3.37*  0.09  1.45  1.85  0.67  Overall quality  16.51***  5 72***  0.29  2.02*  1.16  1.29  a*, **, ***. i g i f s  n  l c a n t  a  t  p  a  < Q.05, 0.01, 0.001  85  Overall Quality***  + O. oeni  Body*'  F i g u r e 17. Cobweb diagram showing the significantly different mean sensory attributes o f Chardonnay wines produced by M L O l , S92, and S92 plus O. oeni (n=26). ***p< .001.  86  Yellow Color  Fruity Taste  Sweetness Acidity  B o d  y  #  M L 0 1 rep 2  P C 1 (82.4%) •  S 9 2 + O. oeni rep 1  o  M L 0 1 rep 1  S 9 2 + O. oeni rep 2  F i g u r e 18. A principal component analysis plot showing the significantly different mean sensory attributes for Chardonnay wines produced by M L O l , S92, and S92 plus O. oeni. P C A factors 1 and 2 explain 82.4% and 15.2% o f the variability, respectively (n=13).  The first two factors o f the P C A mean sensory scores accounted for 97.7% o f the variance among the wines (Figure 18). The attributes fruity taste, body, sweetness and acidity were most heavily loaded on P C I accounting for 82.4% o f the variability. Colour was most heavily loaded on P C 2 accounting for 15.2% o f the variability. The P C A plot showed that body was negatively correlated with acidity, as indicated by the 180 degree angles between the vectors. B o d y was positively correlated with sweetness and fruity taste, as indicated by the small angles. Overall quality (not shown in the P C A plot o f objective aroma/flavour assessments) was also strongly correlated with body (Appendix  87  P). In contrast, yellow colour and fruity taste were uncorrected, as shown by their 90 degree orientation. The wines from M L 0 1 , located on the right, were characterized by their full body, sweet taste and fruity flavour. In contrast, S92 and S92 + O. ceni wines, located to the left, were higher i n acidity and lower in body, sweetness and fruitiness. S92 wines located slightly higher i n the plot were distinguished by their darker yellow colour. These traits are consistent with characteristics identified from the cobweb diagram (Figure 17).  3.4.5 Volatile compounds i n wine produced by ML01 G C / M S headspace analysis (Table 13) revealed that no additional compounds were detected i n wine produced b y M L 0 1 when compated to wine produced with the parental strain S92 or wine produced with S92 and malolactic bacteria. One compound, ethyl 2-methylbutanoate, was detected in wine produced with S92 plus O. ceni that was not present i n wines produced with M L 0 1 and S92 without a M L F . Wines produced with M L 0 1 and S92 without a M L F contained several compounds, acetal, 2,4,5-trimethyl-l,3dioxolane, 1,1-diethoxyisopentane, n-hexanal, and benzaldehyde that were not detected in wines produced with S92 plus O. ceni.  88  Table 13. Concentration o f volatile compounds i n Chardonnay wines produced with M L 0 1 , S92, S92 plus O. ceni. Wines were analyzed by G C / M S headspace assay . 1  Compounds  acetaldehyde dimethylsulfide ethyl formate methyl acetate ethyl acetate isobutyl acetate ethyl butanoate propanol ethyl isovalerate isobutyl alcohol isoamyl acetate n-butanol 2-methyl-1 -butanol 3 -methyl-1 -butanol ethyl hexanoate 1-hexyl acetate acetoin 3 -methyl-1 -pentanol ethyl lactate 1 -hexanol 3 -ethoxy-1 -propanol 3-octanol (IS) ethyl octanoate acetic acid ethyl decanoate diethyl succinate phenylethyl acetate hexanoic acid phenylethyl alcohol octanoic acid  c  S92 (mg/L)  ML01 (mg/L) 83.71 0.04 a 0.2 0.32 180.21 a 0.008 8.16 71.93 0.003 a 229.09 a 1.24 1.29 8.21 94.66 0.94 0.16 5.7 ab 0.06 177.9 a 21.69 20.6 0.21 0.96 a 6.35 a 0.46 a 0.21 a 0.33 1.31 0.95 2.62 b  78.33 0.05 a 0.28 0.33 173.18 a 0.008 8.04 64.02 0.005 a 262.89 a 1.24 0.91 8.79 102.34 0.89 0.16 1.56 a 0.05 5.63 b 20.27 16.27 0.21 0.95 a 5.33 a 0.46 a 0.35 a 0.22 1.76 0.98 3.13  S92 + O. ceni (mg/L)  P  43.52 0.43 b 0.28 0.35 277.08 b 0.007 12.24 91.54 0.014 b 393.11 b 2.33 1.40 12.64 150.7 1.63 0.15 9.96 b 0.04 295.88 c 30.92 20.99 0.21 2.9 b 14.27 b 1.3 b 1.22 b 0.2 1.06 1.12 2.85  ns  a  ** ns ns  * ns ns ns  * * ns ns ns ns ns ns  * ns  *** ns ns -  * * ** *** ns ns ns ns  The mean values for biological replicates are given for all compounds (n=3) *' **, ***, ns: significant atp < 0.05, 0.01, 0.001, or not significant Means separated at p < 0.05 by Duncan's post-hoc test  N o significant differences were found for acetaldehyde, ethyl formate, methyl acetate, isobutyl acetate, ethyl butanoate, propanol, isoamyl acetate, n-butanol, 2-methyl1-butanol, 3-methyl-l-butanol, ethyl hexanoate, 1-hexyl acetate, 3-methyl-1-pentanol, 189  hexanol, 3-ethoxy-l-propanol, phenylethyl acetate, hexanoic acid, phenylethyl alcohol and octanoic acid concentrations when the three wines were compared. The only significant difference between wines produced with M L O l and S92 without a M L F was that ethyl lactate was detected at a higher concentration in wine fermented with M L O l (177.9 mg/L) than S92 without a M L F (5.63 mg/L). Ethyl lactate concentration i n wine produced with S92 plus O. ami was 295.88 m g / L . Wines produced with S92 plus O. ami also contained significantly higher concentrations o f dimethyl sulfide, ethyl acetate, ethyl isovalerate, isobutyl alcohol, ethyl octanoate, acetic acid, ethyl decanoate, and diethyl succinate than wine produced with M L O l or S92 without a M L F . Acetoin was also significantly higher in wines produced with S92 plus O. ami than wines produced with S92 without a M L F . Physicochemical characteristics o f Chardonnay wine produced for G C / M S analysis is given i n Appendix O.  3.4.6 Ethyl carbamate in wine produced by MLOl Ethyl carbamate ( E C ) produced b y the M L O l yeast and the S92 yeast with a bacterial M L F in Chardonnay grape musts is shown i n Table 13. The S92 yeast and O. ami bacterium produced Chardonnay wine (2000 harvest) that had a maximum potential E C concentration o f 71.32 p g / L and wine produced by M L O l had 50.89 pg/L, a reduction o f 28.6%. In the Chardonnay (2004 harvest) wine, S92 and O. oeni produced wine with 99.14 ug/L o f E C and the M L O l yeast produced wine with 89.58 pg/L, a reduction o f 9.6%. N o significant difference i n maximum potential E C concentration was determined between wines produced b y M L O l and the parent strain S92 without a bacterial M L F .  90  Table 14. The production o f ethyl carbamate i n Chardonnay wines produced with M L 0 1 , S92 and S92 with a bacterial M L F .  Wines  ML01  S92  (Hg/L)  S92 + O. ceni  P*  (Hg/L) Chardonnay (2000 harvest) Chardonnay (2004 harvest) a b c d  b  d  50.89 a 89.58 a  c  44.92 a 84.24 a  71.32 b 99.14b  *** ***  ***, significant atp < 0.001 The mean values for bottle replicates (n=3 ) Means separated atp < 0.05 by Duncan's post-hoc test The mean values of biological replicates (n=3 )  3.4.7 Effect of increasing populations of ML01 on M L F in wine conducted with the parental yeast To test the effect o f different levels o f M L 0 1 cell populations on fermentations conducted with S92, fermentations in synthetic must were performed using mixed cultures o f M L 0 1 and S92 in different ratios. The M L F did not occur when the M L 0 1 strain was present at < 1 % o f the total yeast cell population at the beginning o f the alcoholic fermentation (Figures 19 a, b). Fermentations containing a 10% M L 0 1 inoculum resulted in a partial (33.3 %) M L F (Figures 19 c, d). If 50% o f the yeast population comprised M L 0 1 , an almost complete (95.3%) M L F was observed.  91  B  3H  - ML01  m •a 3  S92 *  S92 + 1%MI01  -ML01  c  •S92 - S 9 2 + 1% ML01 • S92 + 0,1% M L O l  1  S92 + 0.1%ML01  - S 9 2 + 0.01%ML01  - S92 + 0 0 1 % M L 0 1  8  10  12  22  14  10  12  18  14  20  22  T i m e (days)  T i m e (days)  D 4  i  3H  MLOl S92 -ML01  S92 + 10% ML01  •S92 - S 9 2 + 10% ML01  —i— — i — —i— 12  Time (days)  14  16  —i— 20  22  8  10  12  14  16  18  20  22  Time (days)  Figure 19. M L F was not detected i n wines containing an inoculum < 1% o f M L O l yeast. (A) Malate degradation and (B) lactate production by M L O l (?) and S92 (?), and S92 + 1% M L O l (?), S92 + 0.1% M L O l (? ) and S92 + 0.01% M L O l (?) co-cultures i n synthetic must containing 4.5 g/L o f malate. (C) Malate degradation and (D) lactate production by a co-culture o f S92 + 10% M L O l (] ); only 33% o f the malate was consumed when M L O l was present at 10% o f the total inoculum. The control M L O l culture completely decarboxylated malate within 5 days (n=2).  3.4.8 Post-fermentation viability of M L O l The viability o f M L O l and S92 yeast cells post-fermentation was determined by plate counts on Y P D for 269 days (Figure 20). The viability o f M L O l and S92 cells postfermentation declined at similar rates for M L O l and S92.  Days  Figure 20. Post-fermentation viability of M L O l (? ) is similar to that o f S92 (? ) i n Chardonnay wine. Both strains were inoculated (100 mg/L) in duplicate into filtersterilized Chardonnay must and viability o f cells was determined by plate counts on Y P D for 269 days (n=2).  93  4 DISCUSSION  The objective o f this study was to genetically engineer and characterise a commercially acceptable S. cerevisiae wine yeast strain capable o f decarboxylating extracellular L-malate (one o f the major organic acids found i n grape must) to L-lactate. The correct integration o f the S. pombe malate transporter (mael) and the O. ceni malolactic enzyme (mleA) under the control o f the S. cerevisiae PGK1 promoter and terminator signals into the genome o f the industrial wine yeast S92, yielded the malolactic yeast M L O l . The genetically stable M L O l yeast strain does not contain any antibiotic marker sequences and can complete the M L F during the alcoholic fermentation ( in a variety o f musts; M L O l cannot appreciably decarboxylate L-malic acid to L-lactic acid when present at levels below 1% o f the total inoculum. Analysis o f the transcriptome and the proteome showed that no metabolic pathway was affected b y the introduction o f the malolactic cassette. G C / M S analysis o f the volatile compounds showed that wine produced by M L O l did not contain any compounds that were not detected i n wine produced with the parental strain S92 or with S92 and O. ami. W i n e produced b y M L O l also revealed improved colour properties and lower volatile acidity than wines produced with a bacterial M L F . Moreover, processing time after alcoholic fermentation is reduced and wine produced by M L O l is judged highest in overall quality by trained tasters when compared to control wines.  94  4.1 Integration of the malolactic cassette into the genome of S92 yielded the functional malolactic yeast M L 0 1 S. cerevisiae cannot effectively metabolise extracellular malate due to its lack o f an active malate transporter (Grobler et al., 1995; Volschenk et al., 1997b) and the low substrate affinity o f its NAD-dependent malic enzyme (K  m  = 50 m M ) (Fuck et al., 1973)  that is also subject to catabolite repression (Redzepovic et al., 2003). The successful integration o f the malolactic cassette (Figure 1) into the URA3 locus o f the wine yeast S92 yielded the first malolactic wine yeast M L 0 1 . In addition to the ura3 flanking sequences required for homologous recombination, the malolactic cassette contains the S. pombe malate transporter (mael) gene (Grobler et al., 1995) and the O. ceni malolactic enzyme (mleA) (Husnik, 2001); both genes are under control o f the S. cerevisiae  PGK1  promoter and terminator sequences. It is important to note that the transgenes, mael and mleA were acquired from wine microorganisms (Barnett et al., 1990; Garvie, 1967; Lodder, 1970). The S. pombe strain used i n this study can trace its roots back to a strain isolated from sulphited grape must (Osterwalder, 1924). Moreover, S. pombe has recently been commercialised (Proenol, Industria Biotecnologica Lda., Portugal) as an alternative method for the deacidification o f wines (Silva et al., 2003). O. ceni, formerly designated Leuconostoc  cenos (Dicks et al., 1995), has only been isolated from wines and  related habitats such as wineries and vineyards (Williams et al., 1989). The ura3 flanking sequences and the PGK1 promoter and terminator sequences were acquired from S. cerevisiae strains G C 2 1 0 (Cunningham and Cooper, 1991) and A B 9 7 2 (Olson et al., 1986), respectively. The parental strain o f M L 0 1 is S92 and this was confirmed by electrophoretic karyotyping (Figure 3) and P C R amplification using d sequences o f the  95  T y l retrotransposon (Appendix G ) . S. cerevisiae S92 is an isolate from the Champagne region i n France and belongs to a family o f very close or identical commercial strains designated as "Prise de Mousse" ( P D M ) strains. P D M strains are some o f the most popular commercial strains and are found in every wine region i n the world. The S. cerevisiae M L O l strain is the first genetically engineered wine yeast strain to be constructed without the integration o f an antibiotic marker or E. coli vector sequences (Schuller and Casal, 2005). Since the malolactic cassette did not have a selectable marker to detect transformants, a phenotypic screen was developed based on the previous work o f Subden et al. (1982). This colorimetric method relies on the specific reaction between L-lactate present i n the media and L-lactate dehydrogenase. The screening method was specific, economical, undemanding and effective (Figure 2). Individual colonies from each o f the identified malolactic clones were tested for functionality i n synthetic must. A l l o f the randomly chosen colonies o f clone 4 were able to completely decarboxylate malate to = 0.05 g/L within the first five days o f the alcoholic fermentation (Appendix F). The M L F is generally considered complete when the malate concentrations are - 0.05 to 0.2 g/L (Avedovech et al., 1992; du Plessis et al., 2002; H e n i c k - K l i n g and Park, 1994). Individual colonies from clone 4 were also capable o f consuming the glucose and fructose i n the synthetic must to less than 2.0 g / L of residual sugar b y day 14 o f the alcoholic fermentation (Appendix F). The alcoholic fermentation is considered complete when the residual sugar concentration (glucose and fructose) is < 2.0 g/L (Bisson, 1999).  96  Based on these results malolactic clone 4 ( M L O l ) was selected for pilot-scale A D Y production. Originally, wine yeasts were commercialised as compressed cakes and as liquid cultures. In 1963, the first active dry wine yeast were produced and marketed to the wine industry (Reed and Chen, 1978). Since that time wine A D Y have become widely accepted and are the preferred form o f commercial yeast at wineries. M L O l was successfully produced as A D Y and after direct inoculation into synthetic must (without rehydration) it was capable o f completely decarboxylating the malate i n the medium to equimolar amounts o f lactic acid. M L O l was also capable o f completing the alcoholic fermentation within 14 days (1.71 ± 0.99 g/L residual sugar), whereas the residual sugar for the parental strain under the same conditions was 3.79 ± 0.95 g/L. A s expected, the final p H o f the fermented synthetic must was 0.16 p H units higher than the fermentation with S92. The p H o f wine that has undergone a M L F is generally 0.1 - 0.2 p H units higher than wine that has not gone through a M L F due to the decarboxylation o f malate (Bartowsky, 2005; Beelman and Gallander, 1979; Boulton, 1996). The successful construction and subsequent production o f a functional malolactic yeast as A D Y (pilot plant and eventual large scale manufacturing) was a major achievement towards the commercialisation o f the first genetically modified wine yeast.  4.2 M L O l completes the M L F during alcoholic fermentation in Chardonnay and Cabernet Sauvignon musts Most red and some white wine styles (such as Chardonnay) are subjected to the M L F . The M L F is especially favoured i n cooler wine regions where the grapes at harvest tend to have naturally higher acidity. High-acid Chardonnay must is one o f the most  97  difficult musts winemakers are confronted with to produce a well-balanced quality wine. After inoculation o f the M L 0 1 strain into a high-acid Chardonnay must ( T A 13.45 g/L, p H 3.18), 98.3% (9.06 g/L) o f the malate was consumed i n the first five days o f the alcoholic fermentation and an equimolar amount o f lactate (6.0 g/L) was produced by day seven (Figure 16). The parental strain S92 consumed only 10.3% (0.95 g/L) o f the malate in the media and no lactate was produced. The two carboys inoculated with O. ceni after the alcoholic fermentation required 171 days, three additional inoculums and an increase in temperature (25°C) to consume 64.0% (5.29 g/L) and 97.0% (8.02 g/L) o f malate in S92 produced wine (Figure 16). These vinification trials, conducted under ideal conditions at a research facility, confirm that the bacterial M L F relies on long and demanding protocols, which are not always in accordance with good winemaking practices. Indeed, wines had to be kept at a relatively high temperature that is conducive to the growth o f O. ceni for a long time; this prolonged fermentation at a higher temperature could alter wine aromatic volatile compounds and increase chances o f spoilage by unwanted microorganisms and lead to oxidation o f wines i n wineries. In contrast, M L F by M L 0 1 occurred rapidly, which w i l l allow for early stabilization o f wine in the cellar. The rapid M L F in high-acid Chardonnay conducted by M L 0 1 was also demonstrated i n the Chardonnay must from fruit harvested i n 2004 (Titratable acidity, 8.78 g/L, p H 3.41) and the Cabernet Sauvignon must (Titratable acidity, 7.41 g/L, p H 3.72). In Chardonnay must from fruit harvested i n 2004, the M L 0 1 strain efficiently decarboxylated 5.5 g/L o f malate and produced equimolar amounts o f lactate by day nine (Appendix N ) . In contrast, O. ceni required nine months after alcoholic fermentation to  98  complete the M L F despite four additional inoculums, an increase in temperature (25°C) and an addition o f L A B nutrients (Leucofood). In Cabernet Sauvignon must, the M L 0 1 strain completed the M L F within the first four days o f the alcoholic fermentation; O. ceni required 42 days after alcoholic fermentation to complete the M L F . The parental strain S92 required 10 additional days to complete the alcoholic fermentation i n the high-acid chardonnay must compared to the M L 0 1 strain (Figure 15). The low p H o f Chardonnay must (pH 3.18) may have contributed to the slower and longer fermentation times for S92, whereas the M L 0 1 was able to complete the fermentation more easily due to the slight p H increase resulting from malate degradation over the first five days (Table 10). In higher p H wines, the alcoholic fermentations by the two yeast strains were completed at the same time: 21 days i n the Chardonnay from fruit harvested in 2004 (pH 3.41) and 16 days for the Cabernet Sauvignon must (pH 3.72) . These data indicate that the presence o f the malolactic cassette i n M L 0 1 does not negatively affect ethanol production when compared to the parental strain S92.  4.3 Wines produced by ML01 have improved physicochemical and organoleptic properties The main effect o f the M L F is a decrease in titratable acidity due to the decarboxylation o f L-malic acid to L-lactic acid. Titratable acidity o f Chardonnay and Cabernet Sauvignon wines produced by M L 0 1 , S92 and S92 with a bacterial M L F are shown in Tables 10 and 11 and Appendix O. A s expected, titratable acidity was considerably reduced in wines that had undergone a M L F . This deacidification is crucial for the production o f less sour and balanced wines, particularly for higher-acid wines  99  from cool-climate regions. The decrease in titratable acidity after a M L F is also accompanied by an increase in p H which could affect microbiological stability in higher p H wines (Tables 10 and 11 and Appendix O). However, wines produced by the M L 0 1 strain had lower p H than those produced with the parental strain and O. ceni (Tables 10 and 11 and Appendix O). Therefore, winemakers conducting a M L F using L A B or the malolactic yeast i n higher p H wines can adjust sulphur dioxide to appropriate concentrations (and acidity, i f desired) to provide microbiological and chemical stability. The slightly lower p H o f wines fermented by M L 0 1 than S92 with a bacterial M L F (Tables 10 and 11, Appendix O) are probably due to the amount o f L-lactic acid present in the wines. M L 0 1 decarboxylates all o f the malate present initially in the must to lactate, whereas O. ceni starts the M L F with less malate in the wine since S92 has already consumed approximately 10 - 30% o f the malate, probably v i a the malo-ethanolic pathway. A n increase i n p H also plays a role in loss o f colour in red wines. The substantial loss o f colour after a bacterial M L F is generally attributed to the p H effects on anthocyanins (Boulton, 1996). In an acid medium, anthocyanins are red and as the p H increases their colour changes to blue and eventually fade to yellow (Ribereau-Gayon et al., 2000b). Interestingly, Cabernet Sauvignon wines produced b y M L 0 1 and S92 without a M L F , had a darker colour than wine produced with S92 with a bacterial M L F (Table 11, degree o f lightness). A s expected, the wine with the lowest p H produced by S92 without a M L F (pH 3.80) had the highest value for redness and colour intensity (^420nm + ^520nm) and the lowest value for yellowness; wine produced by S92 with a bacterial M L F had the highest p H (pH 4.05) and was significantly lighter, the least red,  1  and the least intense (Table 11). W i n e produced by M L 0 1 (pH 3.98) had a similar degree o f yellowness to wine produced by S92 with a M L F , but redness and intensity were significantly higher (Table 11). These data clearly indicate that the metabolic activity o f O. ceni impacts negatively on anthocyanins in red wine and the loss o f colour cannot be attributed simply to an increase i n p H . Volatile acidity is another important component o f wine acidity. Acetic acid, the main component o f volatile acidity in wine, was found i n significantly lower concentrations i n wines produced with M L 0 1 and S92 without a M L F than in wines produced with S92 and a bacterial M L F (Tables 10 and 11 and Appendix O). High-acid Chardonnay wine produced with M L 0 1 had lower concentrations o f acetate (0.452 g/L) than the wine produced with a bacterial M L F (0.5 g/L) but higher levels o f acetate than wine fermented with S92 alone (0.399 g/L). The Chardonnay wine produced by M L 0 1 from fruit harvested i n 2004 had lower levels o f acetate (0.25 g/L) than the wine produced with and without a bacterial M L F (0.424 g/L and 0.328 g/L, respectively). Acetate concentrations i n Cabernet Sauvignon wines produced by M L 0 1 was 0.324 g/L, by S92 with a bacterial M L F 0.355 g/L, and by S92 alone 0.237 g/L. The higher concentration o f acetic acid i n wines produced with O. ceni can be attributed to the metabolism o f remaining sugars and citric acid i n the wine (Liu, 2002; Ribereau-Gayon et al., 2000a; van Vuuren and Dicks, 1993). In addition to the acidity properties o f wine, numerous other metabolites influence the organoleptic characteristics o f wine. G C / M S headspace analysis o f volatile compounds was conducted on 2004 Chardonnay wine since no biological replicates were available for the 2000 Chardonnay wines (only one carboy completed the bacterial M L F ) .  101  G C / M S analysis showed that no additional compounds were detected in wine produced with M L O l when compared to wine produced with the parental strain with or without a M L F . However, concentrations o f certain compounds such as ethyl lactate, an aroma compound (buttery), that also gives the wine a 'broader', 'fuller' taste (Henick-Kling, 2002), varied greatly. Ethyl lactate concentrations were high in wines produced by M L O l (177.9 mg/L) and S92 with a bacterial M L F (295.88 mg/L) but were low i n wine produced by the parental strain without a M L F (5.63 mg/L). The different ethyl lactate concentrations are most likely related to the lactate concentrations found i n the wines. Concentrations o f the following compounds were higher in wines produced with S92 and O. ceni than wines produced by M L O l or S92 alone: dimethyl sulfide (quince, truffle odour), ethyl acetate (fruity at lower concentrations, acescence and unpleasant at higher concentrations), ethyl isovalerate (fruity, vinous odour), isobutyl alcohol (fruity), acetoin (milky and fatty odour), ethyl octanoate (soapy, candlewax odour), acetic acid (vinegar), ethyl decanoate (oily, fruity, floral), and diethyl succinate (faint, pleasant odour) (Table 13) (Clarke and Bakker, 2004; Ribereau-Gayon et al., 2000b). Although these volatile compounds were found in higher concentrations i n wine produced with the S92 and O. ceni, it is difficult to ascertain i f the higher concentrations o f several different chemicals in a complex matrix w i l l detract from the quality o f wine or improve it. Sensory analysis o f Chardonnay wines aged for four years showed that wine produced by M L O l was judged highest for overall quality (Figure 17). Overall quality was also strongly correlated with body and negatively correlated with acidity (Appendix P). Chardonnay wine produced by S92 without a M L F was judged to be significantly darker than wines produced by M L O l or S92 with M L F and this correlates well to the  102  degree o f lightness measured b y C I E L A B colour measurements (Table 10). C I E L A B colour measurements also indicated that Chardonnay wine produced with M L 0 1 had the lowest amount o f 'greenness' and 'yellowness' and S92 with a M L F had the highest amount of'greenness' and 'yellowness' (Table 10). These colour subtleties were not perceived by the panellists. B o d y and perceived sweetness was highest for wines produced with M L 0 1 and lowest for acidity. The complete degradation o f malate by M L 0 1 may have contributed to the perceived sweetness o f wines produced by M L 0 1 . The main descriptive attributes that are associated with wine produced b y M L 0 1 are highest overall quality, fruity taste, sweetness (perceived because o f a lack o f acidity when compared to other wines) and body, whereas, high acidity is an attribute o f wine produced with S92 with and without a M L F , and dark yellow colour is an attribute o f wine produced with S92 without a M L F (Figures 17 and 18). In addition to compounds that affect organoleptic properties o f wine, lactic acid bacteria produce harmful compounds such as biogenic amines and ethyl carbamate (Lonvaud-Funel, 1999). Biogenic amines are produced from their respective precursor amino acids by specific amino acid decarboxylases. Histamine, the best studied biogenic amine, can cause headaches, hypotension, sneezing, flush, skin itch, shortness o f breath and digestive problems (Soufleros et al., 1998; Wantle et al., 1994). The increase in biogenic amines after M L F is well documented (Marcobal et al., 2006) and could be dramatically reduced i f wine were to be sulphited and processed immediately after alcoholic fermentation. Arginine metabolism by certain strains o f O. ceni and other heterofermentative L A B leads to the formation o f ethyl carbamate (urethane) precursors (Liu and Pilone,  103  1998). Ethyl carbamate is a potential human and known animal carcinogen found i n wine (Ough, 1976; Ough, 1993). The main ethyl carbamate precursors in wine are urea (produced by yeast), and citrulline (produced by L A B ) . The utilisation o f M L O l to conduct the M L F during alcoholic fermentation prevents the formation ethyl carbamate from citrulline. The concentration o f ethyl carbamate i n Chardonnay wines produced by M L O l and S92 without a bacterial M L F were significantly lower than wines produced with a bacterial M L F (Table 14). Complete reduction o f ethyl carbamate is not possible with the M L O l yeast since other precursors such as urea and other carbamyl compounds are still available for E C production  4.4 Integration of the malolactic cassette in S92 does not confer a growth advantage to MLOl nor does it not affect the production of ADY or wine making The M L F by M L O l coincides with the log growth phase o f the yeast. In laboratory media ( Y P D ) the maximum specific growth rate was slightly lower for the M L O l strain (0.54 ± 0.01 h" ) than the parental strain S92 (0.55 ± 0.005 h" ). However, 1  1  the slightly longer doubling time observed in Y P D media did not affect the growth o f M L O l on molasses during the production o f A D Y (Didier Colavizza, Lesaffre Development, rue Gabrie Peri 137, F-59700 Marcq-en-Baroeul, France, personal communication). Moreover, the M L O l strain and the parental strain, S92, have the same maximum specific growth rate in Chardonnay must (0.37 h" ) and die at a similar rate 1  (Figure 20) indicating that the introduction o f the malolactic cassette should not affect wine making.  104  The M L 0 1 strain, like the parental strain S92, is unable to consume malate as a sole carbon source (Figure 14) showing that the malolactic cassette does not confer any competitive advantage to the M L 0 1 strain i n this respect. Furthermore, although the M L 0 1 yeast can efficiently decarboxylate malate to lactate in a variety o f musts, it cannot appreciably decarboxylate malic acid to lactic acid when present at levels below 1% o f the total inoculum (Figures 19 a,b). Even at inoculum levels o f 10% M L 0 1 , the decarboxylation o f malate to lactate was limited (33.3%) and the M L F did not continue after the first few days (Figures 19 c,d). These data indicate that the M L F mainly coincided with the growth phase o f the M L 0 1 strain and that the M L F was not active during the later stages o f the fermentation. Hence, cross-contamination o f M L 0 1 yeast i n must not destined for deacidification in wineries should not be a concern under commercial conditions.  4.5 The malolactic cassette without any antibiotic resistance markers is integrated correctly and stably into the genome of M L 0 1 Screening for the integration o f the malolactic cassette in the genome o f S92 was completed with the assistance o f a co-transforming plasmid pUT332. The purpose o f pUT332 was to reduce the number o f transformants to be screened by the colorimetric method. The linear malolactic cassette was combined i n a 10:1 molar ratio with p U T 3 3 2 in order to select yeast cells that were permeable to D N A . After successive subculturing in non-selective media the plasmid was lost (Figure 7). Southern blots probing for Tn5ble (phleomycin resistance) (Figure 7) and the bla gene (ampicillin resistance) (Figure 8) confirmed absence o f these antibiotic genes. The probe for the bla gene also  105  contained 970 bp o f pUT332 non-Saccharomyces sequences comprising 67.1% o f all the p U C 1 9 sequences distributed throughout the sequence of p U T 3 2 2 (Appendix A ) . Southern analyses confirmed that pUT332 or components o f the plasmid (antibiotic markers and E. coli vector sequences) are not present in M L O l or S92. M L O l is therefore the first genetically engineered wine yeast strain to be constructed without the integration o f an antibiotic marker or E. coli vector sequences (Schuller and Casal, 2005). The screening method and the colony P C R results (Appendix E) demonstrated that at least one copy o f the malolactic cassette was integrated into one copy o f the URA3 locus. Southern blots were performed in order to confirm the absence o f concatamers and illegitimate integrations elsewhere in the genome (Figures 4-6 and Appendix H). Utilising different restriction enzyme digests (EcoRV, Nsil and PvulT) and four different probes corresponding to the mael, mleA, and URA3 genes, and the PGK1 promoter, it was confirmed that a single copy o f the URA3 gene was disrupted by the malolactic cassette without the formation o f concatamers; no additional copies o f the malolactic cassette were intergrated elsewhere in the genome. Furthermore, analysis o f M L O l ascospores confirmed that one copy o f the URA3 gene was disrupted by the malolactic cassette since yeast cells from two spores were auxotrophic for uracil but positive for M L F and cells from the remaining two ascospores were prototrophic for uracil and negative for M L F . The targeted integration o f the malolactic cassette to the URA3 locus ( Y E L 0 2 1 W ) was completed using flanking sequences that are 925 bp (5' end) and 933 bp (3' end) long. Although it has been previously shown that flanking sequences o f 30 bp are sufficient for homologous recombination in lab strains o f Saccharomyces  sp. (Baudin et  106  al., 1993; Manivasaskam et al., 1995), the efficiency largely depends upon perfect homology at both ends o f the transforming D N A to the target locus (Wach, 1996). Sequence polymorphism in different strain backgrounds reduces the efficiency o f homologous recombination when short-flanking sequences are used. Transformation efficiencies can be increased approximately 30- to 50-fold using flanking sequences o f several hundred base pairs in length (Wach, 1996). Both strands o f the integrated malolactic cassette were sequenced (Appendix B ) . Eight unexpected nucleotide differences were found after comparing the sequence o f the integrated malolactic cassette to previously published sequences (Appendix K ) . Six differences were found i n either non-coding regions (PGK1 promoter) or i n the nonfunctional disrupted URA3 O R F (Appendix K ) . T w o changes were found i n the mleA sequence, one corresponding to a silent mutation, the other involving the exchange o f one amino acid for another amino acid o f the same family (Appendix K ) . These anomalies could be due to genetic polymorphisms or amplification errors during the construction o f the cassette. Alternatively, the differences may be attributed to errors in the original published sequences. The two differences involving one o f the PGK1 promoter sequences have likely originated from polymerase errors during the amplification steps involved i n the cloning o f the malate expression cassette because the other PGK1 promoter did not contain these two nucleotide differences. The two differences found in the coding sequence o f the mleA gene could have originated from a mistake during the amplification steps or could be attributed to errors i n the published sequence or a mutation within the strain isolate used for the cloning o f mleA. Regardless, one change resulted i n a silent mutation and the other change resulted in a switch between two acidic  107  amino acids, aspartic acid to glutamic acid and did not affect the functionality o f the enzyme. N o differences were found in the mael sequence when compared to the published sequence which comes from the same S. pombe strain. These results indicate that the sequences composing the malolactic cassette that is integrated i n M L O l are not significantly different than the original sequences isolated from the donor strains. Other than the eight nucleotide differences, the malolactic cassette contained only synthetic polylinkers and D N A from the two donor microorganisms (Appendices J and K ) . The upstream and downstream sequences o f the malolactic cassette were also sequenced and show the native half-Sr/I sites and perfect homology to native sequences surrounding the integration sites at each end o f the malolactic cassette (Figure 9). The blunt-end restriction enzyme Srfi was specifically used so that after digestion from pJH2 the remaining half sites o f the linear malolactic cassette would be completely homologous to native sequences (Figure 9). The integrated malolactic cassette must be stable for A D Y yeast production and subsequent winemaking procedures. In general, yeast production starts with pure culture slants and then proceeds through several pure culture laboratory scale fermentations (0.2 - 25 k g o f yeast), followed by several larger batch and fed-batch fermentations (25 15,000 k g o f yeast), and then it concludes with the final fed-batch "trade" fermentation (15,000 - 100,000 k g o f yeast) (Reed and Nagodawithana, 1991). Throughout yeast production and growth i n grape must, S. cerevisiae cells divide mitotically by forming a bud that eventually leads to a daughter cell. Theoretically, i f one diploid yeast cell (80 x 10" g) (Sherman, 1997) and its progeny continuously doubled (with each mother cell 12  forming no more than 20 - 30 daughter cells) it would take 60 generations before  108  approximately 92,230 k g o f yeast is produced. During commercial winemaking, yeast generally undergo a maximum o f seven generations since large initial inoculums o f 1.5 6 x 10 cells/mL (5 - 20 g/hL o f A D Y ) are used and the cells multiply to a maximum o f 5 6  - 1 5 x 10 cells/mL (Reed and Chen, 1978; Reed and Nagodawithana, 1991). Hence a 7  relatively low number o f generations (< 70) are required to produce wine using A D Y . Over this length o f time the majority o f M L 0 1 cells are expected to retain a functional malolactic cassette since the frequencies o f molecular mechanisms that could affect stability o f the malolactic cassette, and therefore the M L F phenotype, are relatively low. Spontaneous mutations (10~ to 10" per generation i n S. cerevisiae) (Magni and von 9  8  Borstel, 1962), loss o f the malolactic cassette via mitotic gene conversion or crossing over (10~ to 10" per generation) (Petes et al., 1991; Puig et al., 2000) or loss o f a portion 6  5  o f the malolactic cassette (either the mael or mleA expression cassettes) due to recombination at the direct repeats (the two PGK1 promoter or terminator sequences) (10 4  to 10" per generation) (Estruch and Prieto, 2003; W a c h et al., 1994) are infrequent and 3  w i l l have a minimal effect on the M L F performed by the majority o f functional M L 0 1 yeast cells. T o date, several wine fermentations with M L 0 1 A D Y (produced at a pilot plant and large-scale fermentation facility) have been done and all have achieved a complete M L F . Even wine fermentations conducted with a 1:1 ratio o f M L 0 1 and S92 cells are able to accomplish an almost complete M L F (95.3% o f malate degraded, data not shown). Moreover, after growth and completion o f M L F in Chardonnay must by M L 0 1 A D Y (produced at a large-scale A D Y production facility, Lesaffre, Turkey), 99.3 ± 1.0 % o f M L 0 1 colonies tested positive for a M L F phenotype.  109  4.6 The malolactic cassette has a minimal effect on the transcriptome and proteome of MLOl Global gene expression patterns o f M L O l and S92 were analysed at 48 hours and 144 hours. These two time points were selected because at 48 hours the M L O l yeast cells perform the M L F and at 144 hours the M L F is complete (Figure 11). The two time points also correspond to log and stationary growth phase o f the yeast (Figure 12). A t 48 hours the transcription o f 19 genes were affected = two-fold, and at 144 hours, the transcription o f six genes were affected = two-fold (Table 9). W i t h only 25 genes having a = two-fold change at both time points it is clear that the introduction o f the malolactic cassette into S. cerevisiae S92 had a minimal effect on the transcription o f the 5773 O R F s (4286 verified amd 1487 uncharacterised, Saccharomyces  Genome Database, June 1,  2005) in the yeast cell. Moreover, the data suggests that no metabolic pathway was affected by the presence o f the malolactic expression cassette integrated into the genome of M L O l . The difference in the number o f genes being affected at 48 hours (19 genes) and 144 hours (6 genes) is likely due to the M L F that is proceeding within M L O l cells at 48 hours. Only one gene, AQR1, was found to be expressed differently at both time points. At 48 hours, AQR1 is expressed 1.77 fold higher in M L O l than S92 and at 144 hours AQR1  is expressed -3.23 fold lower. AQR1 is a gene involved i n the excretion o f short-  chain (C2-C6) monocarboxylic acids (such as lactate), quinidine, and excess amino acids (Tenreiro et al., 2002; Velasco et al., 2004). A t 48 hours, lactic acid is present within M L O l yeast cells and it is likely that A q r l p is involved i n the transport o f lactic acid out of the yeast. Interestingly, an A q r l p - G F P fusion protein was shown to be localized to  11  multiple internal membrane structures and appears to cycle between these components and the cell surface (Velasco et al., 2004). According to this model, it is possible that A q r l p catalyzes transport o f lactic acid into vesicles that subsequently release the lactic acid into the external medium by exocytosis. Excretion o f lactic acid via exocytosis may also explain the observation in the lag o f lactic acid accumulation i n the external medium during M L F . A t 144 hrs there was a -3.23 fold decrease in expression o f AQR1 i n the M L 0 1 strain (Table 9). A t 144 hrs, the malolactic fermentation was complete with the production o f equimolar amounts o f lactic acid from malic acid and no further increases in lactic acid were observed. This indicates that the yeast has transported all o f the lactic acid into the surrounding media and no longer requires higher levels o f A q r l p to remove the intracellular lactic acid. AQR1 is also involved in the secretion o f excess amino acids (Velasco et al., 2004). The amino acids reported to be present in the highest concentrations i n the cytosol o f cells growing i n glucose-ammonium medium (such as the synthetic must) are glutamate, aspartate and alanine, followed by asparagine, glutamine, serine and glycine (Messenguy et al., 1980). Other amino acids present at high levels are predominately found i n the vacuole. The higher levels o f AQR1 during M L F could also result i n the excretion o f the main cytosolic amino acids, in addition to exporting lactic acid out o f the cell. This depletion o f amino acids may explain the increase in expression o f DIP5 (2.81 fold, Table 8) at 48 hours. DIP5 is a dicarboxylic amino acid permease that mediates high affinity and high-capacity transport o f glutamate and aspartate (Regenberg et al., 1998). DIP5p also transports alanine, glutamine, asparagine, serine and glycine; the same  111  amino acids potentially excreted by the over expression of AQRI (Regenberg et al., 1999). Another gene o f interest, PH084, is a high-affinity inorganic phosphate transporter and a low-affinity manganese transporter involved i n manganese homeostasis (Jensen et al., 2003). It is likely expressed at higher levels at 48 hours since the malolactic enzyme requires manganese as a cofactor to complete the decarboxylation o f malate to lactate during the M L F .  PH084 (2.18 fold, Table 8) may be required at higher  levels in order to fulfill the manganese demand on the cell due to the presence o f the transgenic m l e A p . Global gene expression patterns o f M L O l indicate that no metabolic pathway was affected by the presence o f the malolactic cassette integrated into its genome. The analysis also suggests that the genes AQR1, DIP5 and PH084 are affected in order to remove intracellular lactic acid and maintain homeostasis. The proteomes o f M L O l and S92 were analysed after 48 hours o f fermentation i n synthetic must. The time point was selected because at 48 hours the M L O l yeast cells are performing the M L F (Figure 11) and the analysis o f the transcriptome indicated that more genes are affected at this time point (Table 8). i T R A Q analysis identified only one protein, lanosterol 14-demethylase cytochrome P450 that was shown to have a weighted average ratio o f 0.799 (±0.031) at a p-value < 0.05 across duplicate experiments. The protein corresponds to the gene ERG11 and is one o f the 19 enzymes involved i n ergosterol biosynthesis. Since i T R A Q analysis identified 12 o f 19 enzymes involved in the ergosterol pathway and only 1 protein showed a lower ratio, it is unlikely that the ergosterol pathway is affected by the malolactic cassette.  11  The analysis o f the proteome o f M L 0 1 showed that 199 o f the 559 detected proteins were involved in many o f the major metabolic pathways including carbohydrate and amino acid metabolism, and pyrimidine, purine, fatty acid, ergosterol and formate biosynthesis. Other than E R G 1 l p , protein ratios for M L 0 1 and S92 were identical. The malolactic cassette encodes unique proteins such as the m l e A p , maelp, and possibly the three putative proteins created b y cloning (Figure 10). The m l e A p was identified i n both M L 0 1 duplicate samples (confidence >99%); the m a e l p and the three putative proteins were not identified at the default parameters (confidence >94%, or at a confidence >50%). The difficulty in detecting the maelp could be due to its membrane bound nature and possibly lower levels o f protein due to degradation. The m a e l p contains a P E S T region (aa 421-434) at the C-terminal end that targets the protein for degradation (Grobler et al., 1995). M a n y proteins with short intracellular half-lives contain a P E S T region that consists o f proline, glutamic acid, serine, threonine and to a lesser extent aspartic acid (Rogers et al., 1986). Since the mael transcript was detected by R T - P C R (Appendix M ) and the M L 0 1 yeast performs the malolactic fermentation efficiently; it is reasonable to suggest that the m a e l p was present, even though the protein was not detected. The three putative proteins composed entirely o f Saccharomyces sequences and one or two common restriction endonuclease sites (Kpnl and/or Notl), were not detected at a confidence level o f >50%. The introduction o f the malolactic cassette into S. cerevisiae S92 affected the concentration o f one protein out o f 559 identified proteins; no metabolic pathway in the yeast cell was found to be affected. Therefore, the introduction o f the malolactic cassette had minimal effect on global gene expression and protein levels.  11  4.7 Ethical considerations concerning use of the genetically modified yeast M L O l The issues surrounding the use o f the malolactic yeast M L O l are the same as those facing every G M O designed for use i n the food industry. Broadly speaking, these issues include possible effects on the health o f consumers, potential environmental impact and social considerations. S. cerevsiae is an organism which has an extensive history o f safe use. It has been used for millennia i n fermentation processes such as bread leavening, and wine or beer production. The introduction o f non-harmful, limited and well-characterised D N A from two other wine microorganisms should not adversely affect the safety o f S. cerevisiae M L O l . The mleA gene was isolated from O. ceni which is not only found i n wine but attains very high populations during M L F (10 to 10 cfu/mL) (Wibowo et al., 1985). Despite the two nucleotide differences discovered in the mleA gene integrated into M L O l , the primary sequence o f the malolactic enzyme is similar to the native malolactic enzyme since one difference corresponds to a silent mutation and the other involves the change o f an acidic amino acid for another acidic amino acid. Moreover, the M L O l strain displays an efficient L-malate decarboxylating activity indicating that the secondary and tertiary structure o f the enzyme is conserved. Sequencing o f the inserted mael gene o f M L O l showed that no sequence discrepancy could be found between the mael gene in M L O l and the native mael gene from S. pombe. Therefore the primary structure o f the malate permeases are the same and the fact that the malate permease is functional in M L O l indicates that the secondary and tertiary structures o f the proteins are similar as well. Although S. pombe is a wine related microorganism and it may occasionally participate i n spontaneous grape must fermentations (and was recently commercialised for use in the wine industry), this  114  organism is not as predominant i n wine fermentations as S. cerevisiae and O. ceni. Therefore, a literature search was carried out by Lesaffre's library department using Medline and Biosis databases to evaluate the allergenicity o f S. pombe. Not a single paper implicating S. pombe in allergenic reactions was found (Didier Colavizza, Lesaffre Development, rue Gabrie Peri 137, F-59700 Marcq-en-Baroeul, France, personal communication). Moreover, it is likely that at the end o f the fermentation very little malate permease w i l l remain in M L 0 1 yeast cells due to rapid intracellular degradation o f the protein as a consequence o f the presence o f a P E S T region in its C-terminus (Grobler et al., 1995). Storing the wine on lees (sediment composed primarily o f yeast), i f desired, would also further enhance this degradation o f the malate permease. During storage on lees, cell proteins and nucleic material first undergo intracellular enzymatic degradation due to the liberation o f intracellular proteases, aminopetidases, nucleases and phosphatases (Charpentier and Feuillat, 2002; Charpentier et al., 2005; Moreno-Arribas and Polo, 2005; Perrot et al., 2002). The yeast cell gradually loses its hydrolyzed contents as integrity o f the cell wall is compromised. In the wine, further degradation can occur by proteases present i n the extracellular media (Charpentier and Feuillat, 2002). Therefore the protein content o f wines stored on M L 0 1 lees or S92 lees should result i n very similar hydrolysis products, namely small peptides and amino acids. Given the origin o f the malate permease and the safe history o f the presence o f S. pombe strains in fermented beverages, as well as the absence o f data concerning the allergenicity o f this yeast, it can reasonably be concluded that i f any small peptides hydrolyzed from the m a e l p are present in wine they w i l l not constitute a health safety issue.  11  Standard winemaking procedures also consist o f various forms o f clarification, wine stabilisation and filtration procedures that drastically reduce yeast cell numbers after alcoholic fermentation. It is a common practice to employ filtration prior to bottling to improve clarity and stabilisation o f the wine. Various types o f cellulose and membrane filters can reduce the viable yeast cell count from 50 cells/100 m L to <1 cell/100 m L , depending on the porosity o f the individual filters (Ribereau-Gayon et al., 2000b). Although most wines (especially white wines) are filtered prior to bottling, some winemakers may rely only on clarification o f their red wines with gelatins or egg white albumin and bottle without filtration. The use o f M L 0 1 is compatible with such a procedure although the final concentration o f yeast in the bottle w i l l be greater than filtered wine. The thorough genetic characterisation o f M L 0 1 has confirmed that the integration site contains no D N A sequences other than those described in the malolactic cassette. . The discovery that four new O R F s were created during construction o f the malolactic cassette also does not affect the safety status o f M L 0 1 . The three o f the four putative proteins that could be checked by i T R A Q , composed entirely o f Saccharomyces sequences and one or two common restriction endonuclease sites (Kpnl and/or Noil), were not detected. The fourth new O R F is entirely composed o f S. cerevisiae sequences (truncated URA3, 3' end) and the i T R A Q method is incapable o f differentiating it from the native U R A 3 p . None o f the putative proteins o f these novel O R F s were detected by liquid chromatography and tandem mass spectrometry ( i T R A Q ) even at the 50% confidence limit.  11  The environmental impact o f the M L O l strain should be no greater than the environmental impact o f the industrial S92 strain. Commercial yeasts such as S92 are annually released i n large quantities into the environment surrounding wineries. Recently, a large-scale three-year study o f six different vineyards revealed that dissemination o f commercial yeast in the vineyard is limited to short distances over short periods o f time and is largely favoured by the presence o f water run-off (Valero et al., 2005). Despite the annually intensive dissemination o f commercial yeast into the local environment, 94% o f the commercial yeast strains were found between 10 to 200m from the winery. This underscores the limited range o f possible environmental impact beyond the winery. Moreover, analysis o f population variations from year to year indicated that commercial strains do not settle i n the vineyard or predominate over the indigenous flora (Valero et al., 2005). It has also been shown that colonisation o f damaged grapes, where the modified ecology favours fermenting yeast species, by a selected S. cerevisiae wine strain is no different from colonisation o f undamaged grapes (Comitini and Ciani, 2006). In both cases the inoculated wine strain could not out-compete the indigenous microflora resident on the grapes (Comitini and Ciani, 2006). Survival o f G M yeast strains i n a confined wine cellar and greenhouse vineyard has been studied (Bauer et al. 2003 - see Schuller and Casal, 2005). In this study, four G M yeast containing resistance markers (KanMXox SMR1-140) and expressing the transgenes (with strong yeast promoters) for a-amylase, endo-6-l,4-glucanase, xylanase or pectate lyase were sprayed onto vines in a confined greenhouse vineyard. Results showed that despite high initial cell counts, few S. cerevisiae cells were isolated from grapes, leaves, stems and soil during weekly monitoring. Furthermore, no significant  11  difference between the occurrences o f the modified strains compared to the parental strain was detected, including G M strains secreting glucanases and pectinases (modifications thought to provide a selective advantage). The total yeast population o f treated vines was also very similar to the untreated control vines and spontaneous microvinifications resulted i n no significant differences i n the fermentations performances amongst the trials (Schuller and Casal, 2005). Survival o f G M and "self-cloned" baker's yeast i n a simulated natural environment (water and soil) also showed that G M and selfcloned yeast decreased at an equal or faster rate than the wild-type control (Ando et al., 2005). In this case, the G M and Self-Cloned yeast were both modified for freeze tolerance by disruption o f the acid trehalase gene (ATH1). The possibility o f horizontal gene transfer to other organisms cannot be ignored. Horizontal transfer o f D N A can occur v i a interspecies mating among yeast belonging to the Saccharomyces sensu stricto complex and across species barriers v i a transfer o f plasmid D N A (Marinoni et al., 1999; Mentel et al., 2006; Nevoigt et al., 2000). A s no antibiotic resistance markers are present in the M L 0 1 strain, much o f the concern associated with horizontal gene transfer is not applicable. The transfer o f the entire malolactic cassette or part o f it to another organism would also not constitute a threat to the environment. The transfer o f both transgenes to another organism i n the environment (most likely another Saccharomyces sensu stricto strain) may give that particular cell the ability to degrade malate, like M L 0 1 ; an ability that is already present i n numerous lactic acid bacteria and malate degrading yeast such as S. pombe present i n the ecology i n and around the winery. Individually the mleA and mael genes are also predominant in the environment and it is presumable that i f they conferred a selective advantage to an  11  organism this transfer o f genetic material would have already occurred. The combination of S. cerevisiae promoter sequences with transgenes is also not a major concern since recognition o f these regulatory sequences would only be effective in S. cerevisiae strains (and possibly other phylogenetically close species) and less so i n distantly related organisms. It is also conceivable that due to the massive world-wide production and utilisation o f baker's yeast, brewer's yeast and wine yeast (as well as other industries utilising Saccharomyces sp.) D N A fragments containing PGK1 regulatory sequences have been dispersed into the environment over the centuries. The addition o f the malolactic cassette to this mileu is o f minimal concern. The well-characterised malolactic cassette is safe, does not confer any advantage to M L O l and should be considered as very low risk to the environment. Specific social consequences o f using the M L O l strain in the wine industry also exist. W i n e is a traditional product that is perceived to be more than just an alcoholic beverage. W i n e also has strong geographical ties to certain regions/countries and in many cases the wine industry in these regions is unreceptive to the use o f G M O s . W i t h this background in tradition it is very difficult to incorporate new technologies and i f they are to be successful, they have to offer advantages to the consumer. In this regard the M L O l yeast can succeed i f the consumer is educated about the toxic effects o f naturally occurring bioamines and how improvements i n winemaking (early sulphiting) and the use of M L O l can reduce or eliminate these compounds. In this respect the M L O l yeast is unique as a G M O since it provides a direct health advantage to consumers and a direct benefit to the producer (specifically a complete M L F during alcoholic fermentation).  119  Although there w i l l always be wine makers that prefer inoculation o f malolactic bacteria or even the use o f the natural microflora o f the wine cellar to complete the M L F , the malolactic yeast is an important additional tool for winemakers to produce wholesome, well-balanced high quality wines.  120  5 CONCLUSIONS The production o f high quality wines that are enjoyable, healthful and produced by environmentally sustainable production methods, has become important i n a globalized world where there has been a paradigm shift from a production-driven to a market-driven wine industry (Pretorius and Hoj, 2005). Consumers have become sensitized and concerned about food safety issues (e.g. mad cow disease and dioxin in chocolates) and are increasingly demanding safe food and beverages. Moderate consumption o f wine protects consumers against cardiovascular disease, dietary cancers, ischaemic stroke, peripheral vascular disease, diabetes, hypertension, peptic ulcers, kidney stones and macular degeneration (Bisson et al., 2002). These potential health benefits may have contributed to the increased popularity o f wine in recent years. However, wine also contains compounds such as biogenic amines that exert negative effects on the central nervous and vascular systems o f consumers. Naturally occurring lactic acid bacteria present in wine as well as O. oeni, the bacterium used i n commercial starter cultures, produce these bioamines by decarboxylating naturally occurring amino acids in grape must to their corresponding bioamines. After consumption, biogenic amines are usually metabolized by amine oxidases such as monoamine and diamine oxidase and histamine N-methyltransferase to physiologically less active products (Santos, 1996). However, in consumers without sufficient bioamine detoxifying enzymes, these amines can be absorbed into the bloodstream causing negative health affects. Genetic engineering o f wine yeast can be used to prevent the formation o f bioamines in wine. It has also been used to minimize the formation o f E C , a well-known carcinogen in wines (Coulon et al., 2006). Moreover, powerful genomic, transcriptomic,  121  proteomic and metabolomic techniques are now available to demonstrate that recombinant yeasts are substantially equivalent to the parental strains. The genetically stable commercial wine yeast strain, M L 0 1 , was constructed by expressing the S. pombe malate transporter gene (mael) and the O. ceni malolactic enzyme gene (mleA) under control o f the S. cerevisiae PGK1 promoter and terminator signals i n a popular industrial wine yeast strain o f S. cerevisiae. The malolactic cassette integrated into the URA3 locus o f M L 0 1 contains no vector sequences or antibiotic resistance marker genes. D N A sequencing confirmed that the integration site contains no D N A sequences other than those present in the isolated malolactic cassette. Results obtained from the hybridization o f genomic D N A with various probes indicate that the malolactic cassette is correctly integrated into a URA3 locus. D N A mieroarray and i T R A Q analyses o f the transcriptome and proteome o f the yeast indicated that the introduction o f the malolactic cassette had little effect on global gene expression patterns and protein levels. Phenotypic results show that the novel malolactic yeast M L 0 1 is capable o f efficiently decarboxylating malate to lactate within the first five days o f the alcoholic fermentation at 20°C; at lower temperatures (13°C) M L F by M L 0 1 can take up to nine days. Wines produced by the M L 0 1 yeast had lower volatile acidity than wine produced with the parental strain S92 and a bacterial M L F . M L 0 1 also produced Chardonnay wines lighter in color than wine produced by the parental strain and Cabernet Sauvignon wines darker i n color than wines produced with S92 and a bacterial M L F . G C / M S analysis o f volatile compounds and sensory analyses o f wine produced by M L 0 1 , the parental yeast S92 and S92 plus O. ceni indicated that M L 0 1 is ideal for the  122  production o f wine on a commercial scale as MLOl-produced wines were judged to be superior in overall quality by trained tasters. The bacterial M L F is unpredictable and often results i n stuck M L F , and the production o f off-flavors and biogenic amines. S. cerevisiae M L O l conducts an efficient malolactic fermentation that w i l l solve the important issue o f cellar capacity and prevent oxidation and microbial spoilage o f wines that result i n financial losses to wineries. Early sulfiting o f wine produced with M L O l w i l l prevent the growth of undesirable lactic acid bacteria that produce biogenic amines. It is therefore conceivable that wines produced with M L O l should be free o f toxic bioamines, providing great relief to wine lovers who were previously unable to consume many wines that underwent the bacterial malolactic fermentation. This thesis represents an integrated approach, conducting analyses at the phenotypic, D N A , R N A , and protein levels to determine i f recombinant yeast M L O l is substantially equivalent to the parental strain S92. Based on these results it was concluded that the M L O l strain is substantially equivalent to the parental strain S92. M L O l has been approved for use i n Canada (Appendix Q) and has G R A S status with the U S F D A (Appendix R ) . It is the first metabolically engineered yeast to be commercialised by the wine industry and is currently available i n Canada, the U S A and Moldova. Notifications are currently being submitted to all o f the major wine producing countries in the world.  123  5.1 Future Directions Several lines o f future investigations with the novel M L 0 1 yeast and its impact on the wine industry should be pursued. First, analysis o f the bioamine content o f wines produced b y M L 0 1 in several different commercial wineries should be conducted. It is expected that wines produced b y the M L 0 1 yeast would contain significantly lower levels o f bioamines and these data could be used to educate wine consumers on how yeast biotechnology can reduce the toxic properties o f naturally occurring biogenic amines i n wine. Secondly, the ageing o f commercially prepared wines using M L 0 1 and appropriate control wines should be studied. This experiment would provide important data to the wine industry which places high regard on wines that age well. Thirdly, the construction o f other strains containing the malolactic cassette would be o f particular importance to winemakers. Although the strain S92 can be used to produce red and white wines, it is generally preferred for white wine production. Creating other malolactic strains well suited to red wine production could increase the options available to winemakers seeking to complete the M L F during the alcoholic fermentation o f their red wines.  124  REFERENCES Akada, R. 2002. Genetically modified industrial yeast ready for application. J. Biosci. Bioeng. 94:536-544. Alexandre, H . , P.J. Costello, F. Remize, J. Guzzo, and M . Guilloux-Benatier. 2004. Saccharomyces  cerevisiae - Oenococcus ceni interactions i n wine: Current  knowledge and perspectives. Int. J. Food M i c r o b i o l . 93:141-154. A n d o , A . , C . Suzuki, and J. Shima. 2005. Survival o f genetically modified and selfcloned strains o f commercial baker's yeast i n simulated natural environments: Environmental risk assessment. A p p l . Environ. Microb. 71:7075-7082. Ansanay, V . , S. Dequin, B . Blondin, and P. Barre. 1993. Cloning, sequence and expression o f the gene encoding the malolactic enzyme from Lactococcus  lactis.  F E B S Lett. 332:74-80. Arena, M . E . , M . C . M . de Nadra, and R. Munoz. 2002. The arginine deiminase pathway i n the wine lactic acid bacterium Lactobacillus  hilgardii X I B : structural and  functional study o f the arcABC genes. Gene 301:61-66. Ausubel, F . M . , R. Brent, R . E . Kingston, D . D . Moore, J . G . Seidman, J A . Smith, and K . Struhl. 1995. Short Protocols in Molecular Biology. 3rd ed. W i l e y & Sons, N e w York. Avedovech, R . M . , M . R . Mcdaniel, B . T . Watson, and W . E . Sandine. 1992. A n evaluation o f combinations o f wine yeast and Leuconostoc  oenos strains i n malolactic  fermentation o f Chardonnay wine. A m . J. Enol. Viticult. 43:253-260. Baranowski, K . , and F. Radler. 1984. The glucose-dependent transport o f L-malate in Zygosaccharomyces  bailii. Anton. Leeuw. Int. J. G . 50:329-340.  125  Barnett, J.A., and H . L . Kornberg. 1960. The utilization by yeasts o f acids o f the tricarboxylic acid cycle. J. Gen. Microbiol. 23:65-82. Barnett, J . A . , R . W . Payne, and D . Yarrow. 1990a. Yeasts: Characteristics and Identification. 2nd ed. Cambridge University Press, N e w Y o r k . Bartowsky, E.J. 2005. Oenococcus oeni and malolactic fermentation - moving into the molecular arena. Aust. J. Grape W i n e R. 11:174-187. Battaglia, R., H . B . S . Conacher, and B . D . Page. 1990. Ethyl carbamate (urethane) i n alcoholic beverages and foods: A review. Food A d d . Cont. 7:477-496. Battermann, G . , and F. Radler. 1990. A comparative study o f malolactic enzyme and malic enzyme o f different lactic acid bacteria. Can. J. Microbiol. 37:211-217. Baudin, A . , O. Ozier-Kalogeropoulos, A . Denouel, F. Lacroute, and C . Cullin. 1993. A simple and efficient method for direct gene deletion i n Saccharomyces cerevisiae. Nucleic Acids Res. 21:3329-3330. Becker, J . V . W . , G . O . Armstrong, M . J . van der Merwe, M . G . Lambrechts, M . A . Vivier, and I.S. Pretorius. 2003. Metabolic engineering o f Saccharomyces cerevisiae for the synthesis o f the wine-related antioxidant resveratrol. F E M S Yeast Res. 4:7985. Beelman, R . B . , and J.F. Gallander. 1979. Wine deacidification. A d v . Food Res. 25:1-53. Bisson, L . F . 1999. Stuck and sluggish fermentations. A m . J. Enol. Viticult. 50:107-119. Bisson, L . F . 2004. Biotechnology o f wine yeast. Food Biotechnol. 18:63-96. Bisson, L . F . , A . L . Waterhouse, S.E. Ebeler, M . A . Walker, and J.T. Lapsley. 2002. The present and future o f the international wine industry. Nature 418:696-699.  126  Boone, C , A . M . Sdicu, J. Wagner, R. Degre, C . Sanchez, and H . Bussey. 1990. Integration o f the yeast K l killer toxin gene into the genome o f marked wine yeasts and its effect on vinification. A m . J. Enol. Viticult. 41:37-42. Boulton, R . B . 1996. Principles and Practices ofWinemaking. Chapman & H a l l , N e w York. Bourdineaud, J.P., B . Nehme, S. Tesse, and A . Lonvaud-Funel. 2003. The ftsHgene o f the wine bacterium Oenococcus ceni is involved i n protection against environmental stress. A p p l . Environ. Microbiol. 69:2512-2520. Bourdineaud, J.P., B . Nehme, S. Tesse, and A . Lonvaud-Funel. 2004. A bacterial gene homologous to A B C transporters protect Oenococcus ceni from ethanol and other stress factors in wine. Int. J. Food Microbiol. 92:1-14. Bousbouras, G . E . , and R . E . Kunkee. 1971. Effect o f p H on malolactic fermentation i n wine. A m . J. Enol. Viticult. 22:121-126. Cambon, B . , V . Monteil, F. Remize, C . Camarasa, and S. Dequin. 2006. Effects o f GPD1 overexpression i n Saccharomyces cerevisiae commercial wine yeast strains lacking ALD6 genes. A p p l . Environ. Microbiol. 72:4688-4694. Canas, B.J., F . L . Joe, Jr., G . W . Diachenko, and G . Burns. 1994. Determination o f ethyl carbamate i n alcoholic beverages and soy sauce by gas chromatography with mass selective detection: Collaborative study. J. A O A C Int. 77:1530-6. Carstens, M . , M . A . Vivier, P. V a n Rensburg, and I.S. Pretorius. 2003. Overexpression, secretion and antifungal activity o f the Saccharomyces cerevisiae chitinase. A n n . Microbiol. 53:15-28.  127  Caspritz, G . , and F. Radler. 1983. Malolactic enzyme oi Lactobacillus plantarum: Purification, properties, and distribution among bacteria. J. B i o l . Chem. 258:4907-4910. Cavalieri, D . , P . E . McGovern, D . L . Hartl, R. Mortimer, and M . Polsinelli. 2003. Evidence for S. cerevisiae fermentation in ancient wine. J. M o l . E v o l . 57:S226S232. Cebollero, E . , A . Martinez-Rodriguez, A . V . Carrascosa, and R. Gonzalez. 2005. Overexpression o f cscl-1. A plausible strategy to obtain wine yeast strains undergoing accelerated autolysis. F E M S M i c r o b i o l Lett. 246:1-9. Charpentier, C , and M . Feuillat. 2002. Yeast autolysis, p. 225-242, In G . H . Fleet, ed. Wine Microbiology and Biotechnology. Taylor and Francis, N e w Y o r k . Charpentier, C , J. Aussenac, M . Charpentier, J.C. Prome, B . Duteurtre, and M . Feuillat. 2005. Release o f nucleotides and nucleosides during yeast autolysis: Kinetics and potential impact on flavor. J. A g r i . Food Chem. 53:3000-3007. Clarke, R.J., and J. Bakker. 2004. Wine flavour chemistry. Blackwell Pub., Oxford. Codon, A . C . , T. Benitez, and M . Korhola. 1998. Chromosomal polymorphism and adaptation to specific industrial environments o f Saccharomyces strains. A p p l . M i c r o b i o l . Biot. 49:154-163. Cogan, T . M . 1987. Co-metabolism o f citrate and glucose by Leuconostoc spp: Effects on growth, substrates and products. J. A p p l . B a c t e r i d . 63:551-558. Comitini, F., and M . Ciani. 2006. Survival o f inoculated Saccharomyces cerevisiae strain on wine grapes during two vintages. Lett. A p p l . Microbiol. 42:248-253.  1  Conacher, H . B . S . , B . D . Page, B . P . Y . L a u , J.F. Lawrence, R . Bailey, P. Calway, J.P. Hanchay, and B . M o r i . 1987. Capillary column gas-chromatographic determination o f ethyl carbamate i n alcoholic beverages with confirmation by gas-chromatography mass-spectrometry. J. A O A C 70:749-751. Costello, P.J., and P . A . Henschke. 2002. M o u s y off-flavor o f wine: Precursors and biosynthesis o f the causative N-heterocycles 2-ethyltetrahydropyridine, 2acetyltetrahydropyridine, and 2-acetyl-l-pyrroline b y Lactobacillus hilgardii D S M 20176. J . A g r . Food. Chem. 50:7079-7087. Costello, P.J., G . J . Morrison, T . H . Lee, and G . H . Fleet. 1983. Numbers and species o f lactic acid bacteria i n wines during vinification. Food Technol. Austr. 35:14-18. Coton, E . , G . C . Rollan, and A . Lonvaud-Funel. 1998a. Histidine carboxylase o f Leuconostoc oenos 9204: Purification, kinetic properties, cloning and nucleotide sequence o f the hdc gene. J . A p p l . Microbiol. 84:143-151. Coton, E . , G . Rollan, A . Bertrand, and A . Lonvaud-Funel. 1998b. Histamine-producing lactic acid bacteria i n wines: Early detection, frequency, and distribution. A m . J . Enol. Viticult. 49:199-204. Coulon, J., J.I. Husnik, D . L . Inglis, G . K . van der Merwe, A . Lonvaud, D . J . Erasmus, and H.J.J, van Vuuren. 2006. Metabolic engineering o f Saccharomyces cerevisiae to minimize the production o f ethyl carbamate i n wine. A m . J. Enol. Viticult. 57:113-124. C o x , D.J., and T. Henick-Kling. 1989. Chemiosmotic energy from malolactic fermentation. J . Bacteriol. 171:5750-5752.  129  Cox, D . J . , and T. H e n i c k - K l i n g . 1995. Protonmotive force and A T P generation during malolactic fermentation. A m . J. Enol. Viticult. 46:319-323. Cunningham, T.S., and T . G . Cooper. 1991. Expression o f the DAL80 gene, whose product is homologous to the G A T A factors and is a negative regulator o f multiple nitrogen catabolic genes i n Saccharomyces cerevisiae, is sensitive to nitrogen catabolite repression. M o l . C e l l B i o l . 11:6205-6215. Danzer, K . , D . D . Garcia, G . Thiel, and M . Reichenbacher. 1999. Classification o f wine samples according to origin and grape varieties on the basis o f inorganic and organic trace analyses. A m . Lab. 31:26-34. Davis, C , D . W i b o w o , G . H . Fleet, and T . H . Lee. 1988. Properties o f wine lactic acid bacteria: Their potential enological significance. A m . J . E n o l . Viticult. 39:137142. Davis, C.R., D . W i b o w o , R. Eschenbruch, T . H . Lee, and G . H . Fleet. 1985. Practical implications o f malolactic fermentation: A review. A m . J . Enol. Viticult. 36:290301. de Barros Lopes, M . , A . ur-Rehman, H . Gockowiak, A . J. Heinrich, P. Langridge, and P . A . Henschke. 2000. Fermentation properties o f a wine yeast over-expressing the Saccharomyces cerevisiae glycerol 3-phosphate dehydrogenase gene (GPD2). Aus. J . Grape W i n e Res. 6:208-215. de las Rivas, B . , A . Marcobal, and R. Munoz. 2004. A l l e l i c diversity and population structure i n Oenococcus ozni as determined from sequence analysis o f housekeeping genes. A p p l . Environ. M i c r o b i o l . 70:7210-7219.  130  Denayrolles, M , M . A i g l e , and A . Lonvaud-Funel. 1994. Cloning and sequence analysis o f the gene encoding Lactococcus lactis malolactic enzyme: Relationships with malic enzymes. F E M S Microbiol. Lett. 116:79-86. Denayrolles, M . , M . A i g l e , and A . Lonvaud-Funel. 1995. Functional expression i n Saccharomyces cerevisiae o f the Lactococcus lactis mleS gene encoding the malolactic enzyme. F E M S Microbiol. Lett. 125:37-43. Dequin, S. 2001. The potential o f genetic engineering for improving brewing, winemaking and baking yeasts. A p p l . Microb. Biotech. 56:577-588. Dequin, S., E . Baptista, and P. Barre. 1999. Acidification o f grape musts b y Saccharomyces cerevisiae wine yeast strains genetically engineered to produce lactic acid. A m . J. Enol. Viticult. 50:45-50. DeSouza, L . , G . Diehl, M . J . Rodrigues, J. Guo, A . D . Romaschin, T . J . Colgan, and K . W . Siu. 2005. Search for cancer markers from endometrial tissues using differentially labeled tags i T R A Q and c I C A T with multidimensional liquid chromatography and tandem mass spectrometry. J . Proteome Res. 4:377-86. Dicks, L . M . , F . Dellaglio, and M . D . Collins. 1995. Proposal to reclassify Leuconostoc oenos as Oenococcus ceni [corrig.] gen. nov., comb. nov. Int. J . Syst. Bacteriol. 45:395-397. D i v o l , B . , T. Tonon, S. Morichon, E . Gindreau, and A . Lonvaud-Funel. 2003. Molecular characterization o f Oenococcus ceni genes encoding proteins involved i n arginine transport. J. A p p l . Microbiol. 94:738-746.  13  du Plessis, H . W . , C . L . C . Steger, M . du Toit, and M . G . Lambrechts. 2002. The occurrence o f malolactic fermentation in brandy base wine and its influence on brandy quality. J. A p p l . M i c r o b i o l . 92:1005-1013. D u Toit., M . , and I.S. Pretorius. 2000. Microbial spoilage and preservation o f wine: using weapons from nature's own arsenal. S . A . J. o f Enol. and V i t i c . 21:74-96. Eglinton, J . M . , A . J . Heinrich, A . P . Pollnitz, P. Langridge, P . A . Henschke, and M . D . Lopes. 2002. Decreasing acetic acid accumulation by a glycerol overproducing strain o f Saccharomyces cerevisiae by deleting the ALD6 aldehyde dehydrogenase gene. Yeast 19:295-301. Erasmus, D . J . , G . K . van der Merwe, and H.J.J, van Vuuren. 2003. Genome-wide expression analyses: Metabolic adaptation o f Saccharomyces cerevisiae to high sugar stress. F E M S Yeast Res. 3:375-399. Estruch, F., and J.A. Prieto. 2003. Construction o f a Trp- commercial baker's yeast strain by using food-safe-grade dominant drug resistance cassettes. F E M S Yeast Res. 4:329-338. Fleet, G . H . 1998. The microbiology o f alcoholic beverages, p. 217-262, In B . J. B . W o o d , ed. Microbiology of Fermented Foods, V o l . 1. Blackie Academic and professional, Glasgow. Fleet, G . H . , and G . M . Heard. 1993. Yeasts - Growth during fermentation, In G . H . Fleet, ed. Wine Microbiology and Biotechnolgy. Harwood Academic Pub, Switzerland. Fortier, L . C . , R. Tourdot-Marechal, C . Divies, B . H . Lee, and J. Guzzo. 2003. Induction o f Oenococcus oeni H - A T P a s e activity and m R N A transcription under acidic +  conditions. F E M S Microbiol. Lett. 222:165-169.  132  Fuck, E . , G . Stark, and F. Radler. 1973. Apfelsaurestoff-wechsel bei Saccharomyces II. Anreicherung und eigenschaften eines malatenzymes. A r c h . M i k r o b i o l . 89:223231. Gallander, J.F. 1977. Deacidification o f eastern table wines with Schizosaccharomyces pombe. A m . J . Enol. Viticult. 28:65-68. Ganga, M . A . , F. Pinaga, S. Valles, D . Ramon, and A . Querol. 1999. A r o m a improving i n microvinification processes b y the use o f a recombinant wine yeast strain expressing the Aspergillus nidulans xlnA gene. Int. J. Food M i c r o b i o l . 47:171178. Gao, C , and G . H . Fleet. 1995. Degradation o f malic and tartaric acids b y high density cell suspensions o f wine yeasts. Food Microbiol. 12:65-71. Garcia, M . J . , M . Zuniga, and H . Kobayashi. 1992. Energy production from L-malic acid degradation and protection against acidic external p H in Lactobacillus plantarum C E C T 220. J. Gen. M i c r o b i o l . 138:2519-2524. Garmyn, D . , C . Monnet, B . Martineau, J . Guzzo, J.F. Cavin, and C . Divies. 1996. Cloning and sequencing o f the gene encoding alpha-acetolactate decarboxylase from Leuconostoc oenos. Ferns Microbiol. Lett. 145:445-450. Garvie, E.I. 1967. Leuconostoc oenos sp.nov. J . Gen. M i c r o b i o l . 48:431-438. Gatignol, A . , M . Baron, and G . Tiraby. 1987. Phleomycin resistance encoded b y the ble gene from transposon T n 5 as a dominant selectable marker in Saccharomyces cerevisiae. M o l . Gen. Genet. 207:342-348.  133  Gindreau, E . , E . Walling, and A . Lonvaud-Funel. 2001. Direct polymerase chain reaction detection o f ropy Pediococcus damnosus strains i n wine. J. A p p l . M i c r o b i o l . 90:535-542. Giudici, P., L . Solieri, A . M . Pulvirenti, and S. Cassanelli. 2005. Strategies and perspectives for genetic improvement o f wine yeasts. A p p l . Microbiol. Biotechnol. 66:622-628. Goffeau, A . , B . G . Barrell, H . Bussey, R . W . Davis, B . Dujon, H . Feldmann, F. Galibert, J.D. Hoheisel, C . Jacq, M . Johnston, E.J. Louis, H . W . Mewes, Y . Murakami, P. Philippsen, H . Tettelin, and S . G . Oliver. 1996. Life with 6000 genes. Science 274:546, 563-567. Goniak, O.J., and A . C . Noble. 1987. Sensory study o f selected volatile sulfur-compounds in white wine. A m . J. Enol. Viticult. 38:223-227. Gonzalez-Candelas, L . , A . Cortell, and D . Ramon. 1995. Construction o f a recombinant wine yeast strain expressing a fungal pectate lyase gene. F E M S M i c r o b i o l . Lett. 126:263-269. Gonzalez-Candelas, L . , J.V. G i l , R . M . Lamuela-Raventos, and D . Ramon. 2000. The use o f transgenic yeasts expressing a gene encoding a glycosyl hydrolase as a tool to increase resveratrol content i n wine. Int. J. Food. Microbiol. 59:179-183. Grobler, J., F. Bauer, R . E . Subden, and H.J.J, van Vuuren. 1995. The mael gene o f Schizosaccharomyces pombe encodes a permease for malate and other C-4 dicarboxylic acids. Yeast 11:1485-1491. Hanahan, D . 1983. Studies on transformation of Escherichia coli with plasmids. J. M o l . B i o l . 166:557-80.  134  H e n i c k - K l i n g , T. 1993. Malolactic fermentation, p. 289-326, In G . H . Fleet, ed. Wine Microbiology and Biotechnology. Harwood Academic Publishers, Switzerland. H e n i c k - K l i n g , T. 1995. Control o f malolactic fermentation i n wine: Energetics, flavor modification and methods o f starter culture preparation. J. A p p l . Bacteriol. 79:S29-S37. H e n i c k - K l i n g , T., and Y . H . Park. 1994. Considerations for the use o f yeast and bacterial starter cultures: SO2 and timing o f inoculation. A m . J. Enol Viticult. 45:464-469. Henricsson, C , M . C . D . J . Ferreira, K . Hedfalk, K . Elbing, C . Larsson, R . M . B i , J. Norbeck, S. Hohmann, and L . Gustafsson. 2005. Engineering o f a novel Saccharomyces cerevisiae wine strain with a respiratory phenotype at high external glucose concentrations. A p p l . Environ. Microbiol. 71:6185-6192. Herskowitz, I. 1988. Life cycle o f the budding yeast Saccharomyces cerevisiae. Microbiol. Rev. 52:536-553. Husnik, J.I. 2001. Genetic construction o f malolactic wine yeasts. M . S c , University o f Guelph, Guelph. Husnik, J.L, H . Volschenk, J. Bauer, D . Colavizza, Z . L u o , and H.J.J, van Vuuren. 2006. Metabolic engineering o f malolactic wine yeast. Metab. Eng. 8:315-23. Jackson, D . , and D . Schuster. 1987. The Production of Grapes and Wine in Cool Climates Nelson, Melbourne. Jackson, R . S . 1994. Wine Science: Principles and Applications. Academic Press, San Diego.  135  Jensen, L.T., M . Ajua-Alemanji, and V . C . Culotta. 2003. The Saccharomyces cerevisiae high affinity phosphate transporter encoded b y PH084  also functions i n  manganese homeostasis. J . B i o l . Chem. 278:42036-42040. Jobin, M . P . , D . Garmyn, C . Divies, and J. Guzzo. 1999a. The Oenococcus ceni clpX homologue is a heat shock gene preferentially expressed i n exponential growth phase. J. Bacteriol. 181:6634-6641. Jobin, M . P . , D . Garmyn, C . Divies, and J . Guzzo. 1999b. Expression o f the Oenococcus ceni trxA gene is induced b y hydrogen peroxide and heat shock. Microbiology 145:1245-1251. Jobin, M . P . , F. Delmas, D . Garmyn, C . Divies, and J. Guzzo. 1997. Molecular characterization o f the gene encoding an 18-kilodalton small heat shock protein associated with the membrane of Leuconostoc oenos. A p p l . Environ. M i c r o b i o l . 63:609-614. Klaenhammer, T., E . Altermann, F . A r i g o n i , A . Bolotin, F. Breidt, J . Broadbent, R . Cano, S. Chaillou, J. Deutscher, M . Gasson, M . van de Guchte, J . Guzzo, A . Hartke, T. Hawkins, P. Hols, R . Hutkins, M . Kleerebezem, J . K o k , O . Kuipers, M . Lubbers, E . Maguin, L . M c K a y , D . M i l l s , A . Nauta, R. Overbeek, H . Pel, D . Pridmore, M . Saier, D . van Sinderen, A . Sorokin, J . Steele, D . O'Sullivan, W . de V o s , B . Weimer, M . Zagorec, and R. Siezen. 2002. Discovering lactic acid bacteria b y genomics. Anton. Leeuw. Int. J . G . 82:29-58. Kourkoutas, Y . , A . Bekatorou, I . M . Banat, R . Marchant, and A . A . Koutinas. 2004. Immobilization technologies and support materials suitable i n alcohol beverages production: A review. Food M i c r o b i o l . 21:377-397.  136  Kuczynski, J.T., and F. Radler. 1982. The anaerobic metabolism o f malate o f Saccharomyces bailii and the partial purification and characterization o f malic enzyme. Arch. Microbiol. 131:266-270. Kunkee, R . E . 1967. Malo-lactic fermentation. A d v . A p p l . Microbiol. 9:235-279. Kunkee, R . E . 1991. Some roles o f malic-acid i n the malolactic fermentation i n winemaking. F E M S Microbiol. Rev. 88:55-72. Labarre, C , C . Divies, and J. Guzzo. 1996a. Genetic organization o f the mle locus and identification o f a mleR-like gene from Leuconostoc oenos. A p p l . Environ. Microbiol. 62:4493-4498. Labarre, C , J. Guzzo, J.F. Cavin, and C. Divies. 1996b. Cloning and characterization o f the genes encoding the malolactic enzyme and the malate permease o f Leuconostoc oenos. A p p l . Environ. Microbiol. 62:1274-1282. Lafon-Lafourcade, S., A . Lonvaud-Funel, and E . Carre. 1983. Lactic acid bacteria o f wines: Stimulation o f growth and malolactic fermentation. Anton. Leeuwen. Int. J. 49:349-352. Landry, C.R., J.P. Townsend, D . L . Hartl, and D . Cavalieri. 2006. Ecological and evolutionary genomics o f Saccharomyces cerevisiae. M o l . Ecol. 15:575-591. Lautensach, A . , and R . E . Subden. 1984. Cloning o f malic-acid assimilating activity from Leuconostoc oenos in Escherichia coli. Microbios 39:29-39. Lehtonen, P. 1996. Determination o f amines and amino acids i n wine: A review. A m . J. Enol. Viticult. 47:127-133.  137  L i l l y , M . , M . G . Lambrechts, and I.S. Pretorius. 2000. Effect o f increased yeast alcohol acetyltransferase activity on flavor profiles o f wine and distillates. A p p l . Environ. M i c r o b i o l . 66:744-753. L i l l y , M . , F . F . Bauer, M . G . Lambrechts, J . H . Swiegers, D . Cozzolino, and I.S. Pretorius. 2006. The effect o f increased yeast alcohol acetyltransferase and esterase activity on the flavour profiles o f wine and distillates. Yeast 23:641-659. L i u , S.Q. 2002. Malolactic fermentation in wine: Beyond deacidification. J. A p p l . M i c r o b i o l . 92:589-601. L i u , S.Q., and G.J. Pilone. 1998. A review: Arginine metabolism in wine lactic acid bacteria and its practical significance. J. A p p l . Microbiol. 84:315-327. L i u , S.Q., and G.J. Pilone. 2000. A n overview o f formation and roles o f acetaldehyde in winemaking with emphasis on microbiological implications. Int. J. Food S c i . Tech. 35:49-61. L i u , S.Q., C R . Davis, and J.D. Brooks. 1995a. Growth and metabolism o f selected lacticacid bacteria in synthetic wine. A m . J. Enol. Viticult. 46:166-174. L i u , S.Q., G . G . Pritchard, M . J . Hardman, and G.J. Pilone. 1995b. Occurrence o f arginine deiminase pathway enzymes in arginine catabolism by wine lactic acid bacteria. A p p l . Environ. Microbiol. 61:310-316. Lodder, J. 1970. The yeasts: A taxonomic study. 2nd ed. North Holland Publishing, Amsterdam. London, J. 1976. The ecology and taxonomic status o f the LactobacUli. A n n . Rev. M i c r o b i o l . 30:279-301.  138  Lonvaud, A . 1975. Recherches sur renzyme des bacteries lactiques assurant la transformations du malate en lactate, University o f Bordeaux, Bordeaux. Lonvaud-Funel, A . 1995. Microbiology o f the malolactic fermentation: Molecular aspects. F E M S Microbiol. Lett. 126:209-214. Lonvaud-Funel, A . 1999. Lactic acid bacteria i n the quality improvement and depreciation o f wine. Anton. Leeuw. Int. J. G . 76:317-331. Lonvaud-Funel, A . 2001. Biogenic amines i n wines: Role o f lactic acid bacteria. F E M S M i c r o b i o l . Lett. 199:9-13. Lonvaud-Funel, A . , and A . M . S . Desaad. 1982. Purification and properties o f a malolactic enzyme from a strain o f Leuconostoc-mesenteroides isolated from grapes. A p p l . Environ. Microb. 43:357-361. Lucas, P., J. Landete, M . Coton, E . Coton, and A . Lonvaud-Funel. 2003. The tyrosine decarboxylase operon o f Lactobacillus brevis I O E B 9809: Characterization and conservation i n tyramine-producing bacteria. F E M S Microbiol. Lett. 229:65-71. Magni, G . E . , and R . C . von Borstel. 1962. Different rates o f spontaneous mutation during mitosis and meiosis i n yeast. Genetics 46:1097-1108. Magyar, I., and I. Panyik. 1989. Biological deacidfication o f wine with Schizosaccharomycespombe entrapped i n Ca-alginate gel. A m . J. Enol. V i t i c . 40. Maicas, S. 2001. The use o f alternative technologies to develop malolactic fermentation in wine. A p p l . Microbiol. Biotechnol. 56:35-39. Maicas, S., P. Gonzalez-Cabo, S. Ferrer, and I. Pardo. 1999. Production o f Oenococcus ceni biomass to induce malolactic fermentation i n wine by control o f p H and substrate addition. Biotechnol Lett. 21:349-353.  1  Malgoire, J . Y . , S. Bertout, F. Renaud, J . M . Bastide, and A . M a l l i e . 2005. Typing o f Saccharomyces cerevisiae clinical strains b y using microsatellite sequence polymorphism. J. C l i n . Microbiol. 43:1133-1137. Malherbe, D . F . , M . du Toit, R . R . C . Otero, P. van Rensburg, and I.S. Pretorius. 2003. Expression o f the Aspergillus niger glucose oxidase gene i n Saccharomyces cerevisiae and its potential applications in wine production. A p p l . Microbiol. Biot. 61:502-511. Manca de Nadra, M . , and A . M . Strasser de Saad. 1995. Polysaccharide production by Pediococcuspentosaceus from wine. Int. J. Food Microbiol. 27:101-106. Manivasaskam, P., S.C. Weber, J. M c E l v e r , and R . H . Schiestl. 1995. Micro-homology mediated PCR-targeting i n Saccharomyces cerevisiae. N u c l . Acids Res. 23:27992800. Manzanares, P., M . Orejas, J . V . G i l , L . H . de Graaff, J . Visser, and D . Ramon. 2003. Construction o f a genetically modified wine yeast strain expressing the Aspergillus aculeatus rhaA gene, encoding an alpha-L-rhamnosidase o f enological interest. A p p l . Environ. Microbiol. 69:7558-7562. Marcobal, A . , B . de las Rivas, M . V . Moreno-Arribas, and R. Munoz. 2004. Identification o f the ornithine decarboxylase gene i n the putrescine-producer Oenococcus ceni BIFI-83. F E M S Microbiol. Lett. 239:213-220. Marcobal, A . , P J . Martin-Alvarez, M . C . Polo, R. Munoz, and M . V . Moreno-Arribas. 2006. Formation o f biogenic amines throughout the industrial manufacture o f red wine. J. Food Protect. 69:397-404.  140  Marinoni, G . , M . Manuel, R . F . Petersen, J. Hvidtfeldt, P. Sulo, and J. Piskur. 1999. Horizontal transfer o f genetic material among Saccharomyces yeasts. J . Bacteriol. 181:6488-96. Martineau, B . , and T. H e n i c k - K l i n g . 1995. Formation and degradation o f diacetyl i n wine during alcoholic fermentation with the Saccharomyces cerevisiae strain EC1118 and malolactic fermentation with Leuconostoc oenos strain M C W . A m . J . Enol. Viticult. 46:442-448. Martineau, B . , T. Henickkling, and T. Acree. 1995a. Reassessment o f the influence o f malolactic fermentation on the concentration o f diacetyl i n wines. A m . J. Enol. Viticult. 46:385-388. Martineau, B . , T . E . Acree, and T. Henickkling. 1995b. Effect o f wine type on the detection threshold for diacetyl. Food Res. Int. 28:139-143. Martini, A . 1993. The origin and domestication o f the wine yeast Saccharomyces cerevisiae. J. W i n e Res. 4:165-176. Mathews, C . K . , and K . E . van Holde. 1990. Biochemistry. Benjamin/Cummings Publ. C o , California. Mayer, K . , and A . Temperli. 1963. The metabolism o f L-malate and other compounds b y Schizosaccharomycespombe. A r c h . M i k r o b i o l . 46:321-328. Mentel, M . , M . Spirek, D . Jorck-Ramberg, and J. Piskur. 2006. Transfer o f genetic material between pathogenic and food-borne yeasts. A p p l . Environ. Microbiol. 72:5122-5125.  141  Messenguy, F., D . C o l i n , and J.P. ten Have. 1980. Regulation o f compartmentation o f amino acid pools i n Saccharomyces cerevisiae and its effects on metabolic control. Eur. J . Biochem. 108:439-447. Michnick, S., J.L. Roustan, F . Remize, P. Barre, and S. Dequin. 1997. Modulation o f glycerol and ethanol yields during alcoholic fermentation i n Saccharomyces cerevisiae strains overexpressed or disrupted for GPD1 encoding glycerol 3phosphate dehydrogenase. Yeast 13:783-793. M i l l s , D . A . , H . Rawsthorne, C . Parker, D . Tarnir, and K . Makarova. 2005. Genomic analysis o f Oenococcus ozni PSU-1 and its relevance to winemaking. F E M S Microbiol. Rev. 29:465-475. Moreno-Arribas, M . V . , and M . C . Polo. 2005. Winemaking biochemistry and microbiology: Current knowledge and future trends. Crit. Rev. Food Sci. 45:265286. Moreno-Arribas, V . , and A . Lonvaud-Funel. 1999. Tyrosine decarboxylase activity o f Lactobacillus brevis I O E B 9809 isolated from wine and L. brevis A T C C 367. F E M S Microbiol. Lett. 180:55-60. Moreno-Arribas, V . , and A . Lonvaud-Funel. 2001. Purification and characterization o f tyrosine decarboxylase o f Lactobacillus brevis I O E B 9809 isolated from wine. F E M S Microbiol. Lett. 195:103-107. Mortimer, R., and M . Polsinelli. 1999. O n the origins o f wine yeast. Res. Microbiol. 150:199-204. Mortimer, R . K . , and J.R. Johnston. 1986. Genealogy o f principal strains o f the yeast genetic stock center. Genetics 113:35-43.  142  Naouri, P., P. Chagnaud, A . Arnaud, and P. Galzy. 1990. Purification and properties o f a malolactic enzyme from Leuconostoc oenos A T C C 23278. J. Basic Microbiol. 30:577-585. Nathan, H . A . 1961. Induction o f malic enzyme and oxaloacetate decarboxylase i n three lactic acid bacteria. J. Gen. M i c r o . 25:415-420. Nevoigt, E . , A . Fassbender, and U . Stahl. 2000. Cells o f the yeast Saccharomyces cerevisiae are transformable by D N A under non-artificial conditions. Yeast 16:1107-1110. Nielsen, J.C., C . Prahl, and A . Lonvaud-Funel. 1996. Malolactic fermentation i n wine b y '  direct inoculation with freeze-dried Leuconostoc oenos cultures. A m . J. E n o l . Viticult. 47:42-48.  Olsen, E . B . , J . B . Russell, and T. Henick-Kling. 1991. Electrogenic L-malate transport b y Lactobacillusplantarum:  A basis for energy derivation from malolactic  fermentation. J. Bacteriol. 173:6199-6206. Olson, M . V . 1991. Genome structure and organization i n Saccharomyces cerevisiae, p. 139, In J. R . Broach, et al., eds. The Molecular and Cellular Biology of the Yeast Saccharomyces, V o l . 1. C o l d Spring Harbor Laboratory Press, N e w York. Olson, M . V . , J.E. Dutchik, M . Y . Graham, G . M . Brodeur, C . Helms, M . Frank, M . Maccollin, R . Scheinman, and T. Frank. 1986. Random-clone strategy for genomic restriction mapping i n yeast. P N A S 83:7826-7830. Osothsilp, C . 1987. Genetic and biochemical studies o f malic acid metabolism i n Schizosaccharomyces pombe. Ph.D., University o f Guelph, Guelph.  143  Osothsilp, C , and R . E . Subden. 1986a. Malate transport i n Schizosaccharomyces pombe. J.Bacteriol. 168:1439-1443. Osothsilp, C , and R . E . Subden. 1986b. Isolation and characterization o f Schizosaccharomyces pombe mutants with defective NAD-dependent malic enzyme. Can. J. M i c r o b i o l . 32:481-486. Osterwalder, A . 1924. Schizosaccharomyces liquefaciens n.sp., eine gegen freie schweflige Saure widerstandsfahige Garhefe. Mitt. Geb. Lebensmitt. H y g . 15:528. Ough, C S . 1976. Ethyl carbamte i n fermented beverages and foods. J. Agric. Food Chem. 24:323-328. Ough, C S . 1992. Winemaking Basics. Food Products Press, N e w Y o r k . Ough, C S . 1993. Ethyl carbamate i n foods and wine. B u l l . Soc. M e d . Friends W i n e 25:78. Paul, H . W . 1996. Science, Vine, and Wine in Modern France. Cambridge University Press, N e w Y o r k . Perez-Gonzalez, J.A., R . Gonzalez, A . Querol, J. Sendra, and D . Ramon. 1993. Construction o f a recombinant wine yeast strain expressing beta-(l,4)endoglucanase and its use i n microvinification processes. A p p l . Environ. Microb. 59:2801-2806. Perez-Torrado, R., J.V. Gimeno-Alcaniz, and E . Matallana. 2002. W i n e yeast strains engineered for glycogen overproduction display enhanced viability under glucose deprivation conditions. A p p l . Environ. Microbiol. 68:3339-3344.  144  Perrot, L . , M . Charpentier, C . Charpentier, M . Feuillat, and D . Chassagne. 2002. Yeast adapted to wine: Nitrogen compounds released during induced autolysis i n a model wine. J. Ind. M i c r o b i o l . Biotech. 29:134-139. Petes, T . D . , R . E . Malone, and L . S . Symington. 1991. Recombination i n yeast, p. 407521, In J . R . Broach, et al., eds. The Molecular and Cellular Biology o f the Yeast Saccharomyces, V o l . 1. C S H L Press, Cold Spring Harbor, N Y . Phaff, H.J., and W . T . Starmer. 1987. Yeasts associated with plants insects and soils, p. 123-179, In A. H . Rose and J . S. Harrison, eds. The Yeasts, V o l . 1. Academic Press, London. Pilone, G.J., and R . E . Kunkee. 1976. Stimulatory effect o f malolactic fermentation on growth-rate o f Leuconostoc oenos. A p p l . Environ. Microb. 32:405-408. Pilone, G.J., M . G . Clayton, and R . J . Vanduivenboden. 1991. Characterization o f wine lactic acid bacteria: Single broth culture for tests o f heterofermentation, mannitol from fructose and ammonia from arginine. A m . J. Enol. Viticult. 42:153-157. Pretorius, I.S. 2000. Tailoring wine yeast for the new millennium: Novel approaches to the ancient art o f winemaking. Yeast 16:675-729. Pretorius, I.S., and F . F . Bauer. 2002. Meeting the consumer challenge through genetically customized wine-yeast strains. Trends Biotechnol. 20:426-432. Pretorius, I.S., and P . B . Hoj. 2005. Grape and wine biotechnology: Challenges, opportunities and potential benefits. Aust. J. Grape W i n e Res. 11:83-108. Puig, S., A . Querol, E . Barrio, and J.E. Perez-Ortin. 2000. Mitotic recombination and genetic changes i n Saccharomyces cerevisiae during wine fermentation. A p p l . Environ. Microbiol. 66:2057-61.  145  Querol, A . , M . T . Fernandez-Espinar, M . del Olmo, and E . Barrio. 2003. Adaptive evolution o f wine yeast. Int. J . Food Microbiol. 86:3-10. Radler, F . 1993. Yeasts-metabolism o f organic acids, p. 165-182, In G . H . Fleet, ed. Wine Microbiology and Biotechnology. Harwood Academic Publishers, Switzerland. Ramon, D . , S. Genoves, J . V . G i l , O . Herrero, A . MacCabe, P. Manzanares, E . Matallana, M . Orejas, G . Uber, and S. Valles. 2005. Milestones i n wine biotechnology. Minerva Biotecnol .17:33-45. Ramos, A . , J.S. Lolkema, W . N . Konings, and H . Santos. 1995. Enzyme basis for p H regulation o f citrate and pyruvate metabolism b y Leuconostoc oenos. A p p l . Environ. Microbiol. 61:1303-1310. Rankine, B . C . 1977. Developments i n malolactic fermentation o f Australian red table wines. A m . J. E n o l . Viticult. 28:27-33. Redzepovic, S., S. Orlic, A . Majdak, B . K o z i n a , H . Volschenk, and M . Viljoen-Bloom. 2003. Differential malic acid degradation b y selected strains o f Saccharomyces during alcoholic fermentation. Int. J. Food Microbiol. 83:49-61. Reed, G . , and S.L. Chen. 1978. Evaluating commercial active dry wine yeasts b y fermentation activity. A m . J . E n o l . Viticult. 29:165-168. Reed, G . , and T . W . Nagodawithana. 1988. Technology o f yeast usage i n winemaking. A m . J . Enol. Viticult. 39:83-90. Reed, G . , and T . W . Nagodawithana. 1991. Yeast technology. 2nd ed. V a n Nostrand Reinhold, N e w Y o r k .  146  Regenberg, B . , S. Holmberg, L . D . Olsen, and M . C . Kielland-Brandt. 1998. Dip5p mediates high-affinity and high-capacity transport o f L-glutamate and L-aspartate in Saccharomyces cerevisiae. Curr. Genet. 33:171-7. Regenberg, B . , L . During-Olsen, M . C . Kielland-Brandt, and S. Holmberg. 1999. Substrate specificity and gene expression o f the amino-acid permeases in Saccharomyces cerevisiae. Curr Genet 36:317-28. Remize, F., E . Andrieu, and S. Dequin. 2000. Engineering o f the pyruvate dehydrogenase bypass i n Saccharomyces cerevisiae: Role o f the cytosolic M g 2 and +  mitochondrial K acetaldehyde dehydrogenases A l d 6 p and A l d 4 p i n acetate +  formation during alcoholic fermentation. A p p l . Environ. Microbiol. 66:31513159. Remize, F., J.L. Roustan, J . M . Sablayrolles, P. Barre, and S. Dequin. 1999. Glycerol overproduction b y engineered Saccharomyces cerevisiae wine yeast strains leads to substantial changes i n by-product formation and to a stimulation o f fermentation rate i n stationary phase. A p p l . Environ. Microbiol. 65:143-149. Renault, P., C . Gaillardin, and H . Heslot. 1988. Role o f malolactic fermentation in lactic acid bacteria. Biochimie 70:375-379. Renault, P., C . Gaillardin, and H . Heslot. 1989. Product o f the Lactococcus lactis gene required for malolactic fermentation is homologous to a family o f positive regulators. J. Bacteriol. 171:3108-3114. Ribereau-Gayon, P., D . Dubourdieu, B . Doneche, and A . Lonvaud. 2000a. Handbook of Enology: The Microbiology of Wine and Vinifications John W i l e y & Sons, Chichester.  147  Ribereau-Gayon, P., Y . Glories, A . Maujean, and D . Dubourdieu. 2000b. Handbook of Enology: The Chemistry of Wine Stabilization and Treatments John W i l e y and Sons, Ltd, Chichester. Robinson, J . 1994. The Oxford Companion to Wine. Oxford University Press, N e w Y o r k . Rodriguez, S.B., and R.J. Thornton. 1990. Factors influencing the utilization o f L-malate by yeasts. F E M S M i c r o b i o l . Lett. 72:17-22. Rodriguez, S.B., E . Amberg, R . J . Thornton, and M . R . Mclellan. 1990. Malolactic fermentation i n Chardonnay: Growth and sensory effects o f commercial strains o f Leuconostoc oenos. J. A p p l . M i c r o b i o l . 68:139-144. Rodriquez, S.B., and R.J. Thornton. 1989. A malic acid dependent mutant o f Schizosaccharomyces malidevorans. A r c h . M i c r o b i o l . 152:564-566. Rogers, S., R. Wells, and M . Rechsteiner. 1986. A m i n o acid sequence common to rapidly degraded proteins: The P E S T hypothhesis. Science 234:364-368. Salou, P., P. Loubiere, and A . Pareilleux. 1994. Growth and energetics of Leuconostoc oenos during cometabolism o f glucose with citrate or fructose. A p p l . Environ. Microbiol. 60:1459-1466. Sanchez-Torres, P., L . Gonzalez-Candelas, and D . Ramon. 1996. Expression i n a wine yeast strain o f the Aspergillus niger abfB gene. F E M S M i c r o b i o l . Lett. 145:189194. Santos, M . H . S . 1996. Biogenic amines: Their importance i n foods. Int. J. Food Microbiol. 29:213-231.  148  Schoeman, H . , M . A . Vivier, M . D u Toit, L . M . T . Dicks, and I.S. Pretorius. 1999. The development o f bactericidal yeast strains by expressing the Pediococcus acidilactici pediocin gene (pedA) in Saccharomyces cerevisiae. Yeast 15:647-656. Schuller, D . , and M . Casal. 2005. The use o f genetically modified Saccharomyces cerevisiae strains in the wine industry. A p p l . Microbiol. Biotechnol. 68:292-304. Schutz, M . , and F. Radler. 1973. [The "malic enzyme" from Lactobacillusplantarum  and  Leuconostoc mesenteroides]. A r c h . M i k r o b i o l . 91:183-202. Schwartz, D . C , and C R . Cantor. 1984. Separation o f yeast chromosome-sized D N A s by pulsed field gradient gel-electrophoresis. C e l l 37:67-75. Sethi, N . , and W . Mandell. 1988. Saccharomyces fungemia i n a patient with A I D S . N e w Y o r k State J. M e d . 88:278-279. Shalaby, A . R . 1996. Significance o f biogenic amines to food safety and human health. Food Res. Int. 29:675-690. Sherman, F. 1997. Yeast genetics, p. 302-325, In R . A . Meyers, ed. The Encyclopedia of Molecular Biology and Molecular Medicine, V o l . 6. V C H Publishing, Weinheim, Germany. Silva, S., F. Ramon-Portugal, P. Andrade, S. Abreu, M . D . Texeira, and P. Strehaiano. 2003. M a l i c acid consumption by dry immobilized cells o f Schizosaccharomyces pombe. A m . J. Enol. V i t i c . 54:50-55. Slavikova, E . , and R. Vadkertiova. 1997. Seasonal occurrence o f yeasts and yeast-like organisms in the river Danube. Anton. Leeuwen. Int. J. G . 72:77-80.  149  Smit, A . , R . R . C . Otero, M . G . Lambrechts, I.S. Pretorius, and P. V a n Rensburg. 2003. Enhancing volatile phenol concentrations i n wine by expressing various phenolic acid decarboxylase genes i n Saccharomyces cerevisiae. J. A g r . Food Chem. 51:4909-4915. Sniegowski, P . D . , P . G . Dombrowski, and E . Fingerman. 2002. Saccharomyces cerevisiae and Saccharomyces paradoxus coexist i n a natural woodland site i n North America and display different levels o f reproductive isolation from European conspecifics. F E M S Yeast Res. 1:299-306. Snow, R . 1983. Genetic improvement o f wine yeast, p. 439-459, In J. F . T. Spencer, et al., eds. Yeast Genetics: Fundamental and Applied Aspects. Springer-Verlag, N e w York. Soufleros, E . , M . L . Barrios, and A . Bertrand. 1998. Correlation between the content o f biogenic amines and other wine compounds. A m . J. Enol. Viticult. 49:266-278. Sousa, M . J . , M . Mota, and C . Leao. 1992. Transport o f malic acid i n the yeast Schizosaccharomyces pombe: evidence for a proton-dicarboxylate symport. Yeast 8:1025-31. Sousa, M . J . , M . Mota, and C . Leao. 1995. Effects o f ethanol and acetic acid on the transport o f malic acid and glucose i n the yeast Schizosaccharomyces pombe: Implications i n wine deacidification. F E M S M i c r o b i o l . Lett. 126:197-202. Spettoli, P., M . P . Nuti, and A . Zamorani. 1984. Properties o f malolactic activity purified from Leuconostoc oenos M L 3 4 b y affinity chromatography. A p p l . Environ. Microb. 48:900-901.  150  Sponholz, W . R . 1993. Wine spoilage by microorganisms, p. 395-420, In G . H . Fleet, ed. W i n e Microbiology and Biotechnology. Harwood Academic Publishers, N e w York. Strasser de Saad, A . M . , A . A . Pesce de Ruiz Holgado, and G . Oliver. 1984. Purification and properties o f malolactic enzyme from Lactobacillus murinus C N R Z 313. J. A p p l . Biochem. 6:374-383. Straub, B . W . , M . Kicherer, S . M . Schilcher, and W . P . Hammes. 1995. The formation o f biogenic amines by fermentation organisms. Z . Lebensm. Unters. Forsch. 201:7982. Subden, R . E . , W . L . L i n , A . Lautensach, and A . G . Meiering. 1982. A n L-lactic acid dehydrogenase based method for detecting microbial colonies performing a malolactic fermentation. Can. J. Microbiol. 28:883-886. Subden, R . E . , A . Krizus, C . Osothsilp, M . Viljoen, and H.J.J, van Vuuren. 1998. Mutational analysis o f malate pathways i n Schizosaccharomyces pombe. Food Res. Int. 31:37-42. Sutherland, C M . , P . A . Henschke, P. Langridge, and M . D . Lopes. 2003. Subunit and cofactor binding o f Saccharomyces cerevisiae sulfite reductase: Towards developing wine yeast with lowered ability to produce hydrogen sulfide. A u s . J. Grape W i n e Res. 9:186-193. Taillandier, P., and P. Strehaiano. 1991. The role o f malic acid i n the metabolism o f Schizosaccharomyces pombe: Substrate consumption and cell growth. A p p l . M i c r o b i o l . Biotechnol. 35:541-543.  15  Taillandier, P., J.P. Riba, and P. Strehaiano. 1988. Malate utilization by Schizosaccharomyces pombe. Biotechnol. Lett. 10:469-472. ten Brink, B . , C . Damink, H . M . L . J . Joosten, and J.H.J.H.I. Tveld. 1990. Occurrence and formation o f biologically-active amines i n foods. Int. J. Food Microbiol. 11:7384. Tenreiro, S., P . A . Nunes, C A . Viegas, M . S . Neves, M . C . Teixeira, M . G . Cabral, and I. Sa-Correia. 2002. AQR1 gene ( O R F Y N L 0 6 5 w ) encodes a plasma membrane transporter o f the major facilitator superfamily that confers resistance to shortchain monocarboxylic acids and quinidine i n Saccharomyces cerevisiae. Biochem. Biophys. Res. Commun. 292:741-748. Tonon, T., J.P. Bourdineaud, and A . Lonvaud-Funel. 2001. The a r c A B C gene cluster encoding the arginine deiminase pathway o f Oenococcus ceni, and arginine induction o f a C R P - l i k e gene. Res. Microbiol. 152:653-661. Torok, T., R . K . Mortimer, P. Romano, G . Suzzi, and M . Polsinelli. 1996. Quest for wine yeasts: A n old story revisited. J. Ind. Microbiol. 17:303-313. Tracey, R . P . , and T.J. Britz. 1989. The effect o f amino-acids on malolactic fermentation by Leuconostoc-oenos. J. A p p l . Bact. 67:589-595. Valero, E . , D . Schuller, B . Cambon, M . Casal, and S. Dequin. 2005. Dissemination and survival o f commercial wine yeast i n the vineyard: A large-scale, three-years study. F E M S Yeast Research 5:959-969. van Vuuren, H.J.J., and L . M . T . Dicks. 1993. Leuconostoc oenos: A review. A m . J. Enol. Viticult. 44:99-112.  152  Vaughan-Martini, A . , and A . Martini. 1995. Facts, myths and legends on the prime industrial microorganism. J. Ind. M i c r o b i o l . 14:514-522. Velasco, I., S. Tenreiro, I.L. Calderon, and B . Andre. 2004. Saccharomyces cerevisiae AQR1 is an internal-membrane transporter involved i n excretion o f amino acids. Eukaryot C e l l 3:1492-1503. Vilanova, M . , P. Blanco, S. Cortes, M . Castro, T . G . V i l l a , and C . Sieiro. 2000. Use o f a PGU1 recombinant Saccharomyces cerevisiae strain i n oenological fermentations. J. A p p l . M i c r o b i o l . 89:876-883. Volschenk, H . , H.J.J, van Vuuren, and M . Viljoen-Bloom. 2003. Malo-ethanolic fermentation i n Saccharomyces and Schizosaccharomyces. Curr. Genet. 43:379391. Volschenk, H . , M . Viljoen-Bloom, R . E . Subden, and H.J.J, van Vuuren. 2001. M a l o ethanolic fermentation i n grape must b y recombinant strains o f Saccharomyces cerevisiae. Yeast 18:963-970. Volschenk, H . , M . Viljoen, J . Grobler, F. Bauer, A . Lonvaud-Funel, M . Denayrolles, R . E . Subden, and H.J.J. V a nVuuren. 1997a. Malolactic fermentation i n grape musts b y a genetically engineered strain o f Saccharomyces cerevisiae. A m . J. Enol. Viticult. 48:193-197. Volschenk, H . , M . Viljoen, J. Grobler, B . Petzold, F. Bauer, R . E . Subden, R A . Young, A . Lonvaud, M . Denayrolles, and H.J.J, van Vuuren. 1997b. Engineering pathways for malate degradation i n Saccharomyces cerevisiae. Nat. Biotechnol. 15:253-257.  153  Wach, A . 1996. PCR-synthesis o f marker cassettes with long flanking homology regions for gene disruptions in S. cerevisiae. Yeast 12:259-265. Wach, A . , A . Brachat, R. Pohlmann, and P. Philippsen. 1994. N e w heterologous modules for classical or PCR-based gene disruptions i n Saccharomyces cerevisiae. Yeast 10:1793-1808. Walling, E . , E . Gindreau, and A . Lonvaud-Funel. 2005. A putative glucan synthase gene dps detected i n exopolysaccharide-producing Pediococcus damnosus and Oenococcus ceni strains isolated from wine and cider. Int. J. Food Microbiol. 98:53-62. Wantle, F., M . Gotz, and R. Jarisch. 1994. The red wine provocation test: Intolerance to histamine as a model for food intolerance. A l l e r g y Proc. 15:27-32. W i b o w o , D . , R. Eschenbruch, C R . Davis, G . H . Fleet, and T . H . Lee. 1985. Occurrence and growth o f lactic acid bacteria in wine: A review. A m . J. E n o l . Viticult. 36:302-313. Williams, S., R . A . Hodges, T . L . Strike, R. Snow, and R . E . Kunkee. 1984. Cloning the gene for the malolactic fermentation o f wine from Lactobacillus delbruekii i n Escherichia coli and yeasts. A p p l . M i c r o b i o l . Biotechnol. 47:288-293. Williams, S.T., M . E . Sharpe, and J . C Holt. 1989. Bergey's Manual of Systematic Bacteriology. W i l l i a m s & Wilkins, Baltimore. Zee, J.A., R . E . Simard, L . Lheureux, and J. Tremblay. 1983. Biogenic-amines in wines. A m . J. Enol. Viticult. 34:6-9. Zhang, D . S . , and R . W . Lovitt. 2005. Studies on growth and metabolism o f Oenococcus ceni on sugars and sugar mixtures. J. A p p l . Microbiol. 99:565-572.  154  Zhang, D.S., and R . W . Lovitt. 2006. Strategies for enhanced malolactic fermentation wine and cider maturation. J. Chem. Technol. Biot. 81:1130-1140.  APPENDIX A Schematic Representation of pUT332 and Probes Used to Confirm the Absence of Antibiotic Markers in ML01  Clal  Figure 21. Plasmid map o f pUT332 and schematic representation o f the probes used i n Southern blot experiments to confirm the absence o f antibiotic markers i n S. cerevisiae M L 0 1 . The bla gene (ampicillin resistance) probe was retrieved as a Clal-Sspl fragment after restriction digest o f the pUT332 plasmid. This probe includes an additional 970 bp of plasmid pUT332 which trace back directly to plasmid p U C 1 9 (Gatignol et al., 1990). The 1758 bp plasmid probe comprises 67.1% o f all the p U C 1 9 sequences distributed throughout the sequence o f pUT332. The Tn5ble probe was retrieved by P C R amplification o f a region o f the pUT332 plasmid using primers J20 and J21.  1  APPENDIX B  Strategy for Sequencing the Malolactic Cassette from the Genome of M L O l Insert For19g  For20g For15B  For3p  For4g  For5g  For6g  For7p  )  \  I  I  I  I  t  5' U R A 3 f l a n k i n g  i  Rev17B  I I  ForQp  FonOg  For11p  I  For12g  I  For13p  I  {  For14p  PGK1 promoter  r  2K Rev15p  For18g  I  P G K 1 tsi  1K Rev2 1g  For8g  1  -l  Rev11g  1  1  1  1  3' URA3 flanking  I  6K  3K  Rev13p  i  -I  For17B  Rev1Og  Rev20g  Rev19g  Rev9p RevSgb  Rev7p  Rev1 2g  Rev6g  Rev4bg  Rev20g  Rev3fap  1  Rev5g  I  Rev19  Rev2p Rev18g  {  {  11  12 6  •  13  10  Figure 22. Strategy used to sequence the malolactic cassette from the genome of S. cerevisiae M L O l . A minimum of two sets of 13 unique PCR templates (lines), spanning the entire malolactic cassette, were used in the sequencing. Primers for sequencing of each strand are indicated as arrows.  APPENDIX D Participant Consent Form  Title of Study: Sensory evaluation of wine produced by the malolactic yeast M L O l Principal Investigator: Professor Hennie J.J. van Vuuren (Ph.D.) Wine Research Centre UBC (604) 822-0418 Sponsors: South African Wine Industry 1994-1996; Bio-Springer 1997-2002 1. I N T R O D U C T I O N Y o u are being invited to take part i n this research study because o f your expertise and extensive experience in the sensory evaluation o f wine. Y o u w i l l not receive any remuneration to participate i n this tasting. 2. Y O U R P A R T I C I P A T I O N IS V O L U N T A R Y Y o u r participation is entirely voluntary, so it is up to you to decide whether or not to take part i n this study. If you wish to participate, you w i l l be asked to sign this form. If you do decide to take part in this study, you are still free to withdraw at any time and without giving any reasons for your decision. Please take time to read the following information carefully. 3. W H O IS C O N D U C T I N G T H E S T U D Y ? This study was initiated i n the laboratory o f Dr. Hennie van Vuuren at the University o f Stellenbosch in August 1994. Financial support was received from the South African W i n e Industry and B i o Springer. John Husnik, Ph.D. student under supervision o f Dr. Hennie J.J. van Vuuren, continued with the research i n the W i n e Research Centre at U B C . B i o Springer sponsored the research at U B C from January I, 2001 - June 2002. 4. B A C K G R O U N D Most red wines and some white wines undergo the bacterial malolactic fermentation that catalyses the bio-conversion o f L-malate to L-lactate. Some naturally occurring lactic acid bacterial strains in wine produce undesirable compounds, such as biogenic amines, from amino acids present i n grape musts. The presence o f bio-amines can be o f great concern for consumers since these molecules, particularly histamine, have been shown to be the causative agent o f head aches and other allergenic symptoms such as, diarrhea,  Page 1 o f 4  160  palpitations, rashes and vomiting. Moreover, strong scientific evidence suggests that other biogenic amines such as cadaverine, putrescine, spermine, and tyramine can potentiate the toxic effect o f histamine. During the last two decades new technologies such as metabolic engineering, protein engineering, and novel enzyme and fermentation technologies have been developed that have greatly enhanced our capabilities to produce safer wines o f a higher quality. The malolactic yeast M L 0 1 is such an example. Over the last 10 years we have succeeded to genetically enhance an industrial wine yeast strain to perform the alcoholic and malolactic fermentations simultaneously. W e have conducted rigorous scientific examination o f the M L O l malolactic yeast and this yeast has now received Generally Regarded as Safe ( G R A S ) status from the F D A . A l l food grade microorganisms are required to have this status before they can be applied i n the food or wine industry. The application o f the M L O l malolactic yeast w i l l minimize or prevent growth o f lactic acid bacteria capable o f producing allergens and at least ensure a reduction, or elimination, o f these allergens from wine. Consumers sensitive to bioamines are unlikely to get headaches when drinking wines produced with the M L O l yeast. 5. W H A T IS T H E P U R P O S E O F T H E S T U D Y ? The purpose o f this study is to evaluate and compare the colour, aroma, flavour and overall quality o f the wine produced b y the malolactic wine yeast, wine produced with the parental yeast, and wine produced with the parental yeast and malolactic bacteria. The yeast is being used for the production o f commercial wines in Moldavia and large-scale fermentation trials have been conducted in South Africa and are currently being conducted i n the U S A . T o the best o f our knowledge, wine produced with the malolactic yeast M L O l is safe to consume. 6. W H O C A N P A R T I C I P A T E I N T H E S T U D Y ? A n y experienced wine taster. 7. W H A T D O E S T H E S T U D Y I N V O L V E ? Sensory evaluation o f the wines at P A R C in Summerland. Wines w i l l be tasted blind and each panel member w i l l be given a questionnaire to complete. The time required for tasting is approximately 2 hours. 8. A F T E R T H E S T U D Y IS F I N I S H E D M r . Husnik w i l l use the data as part o f his Ph.D. thesis and i n publications resulting from this study. Every member o f the panel w i l l receive a copy o f the paper. 9. W I L L M Y T A K I N G P A R T I N T H I S S T U D Y B E K E P T C O N F I D E N T I A L ? Y o u r confidentiality w i l l be respected. N o information that discloses your identity w i l l be released or published without your specific consent to the disclosure.  Page 2 o f 4  161  10. W H O D O I C O N T A C T IF I H A V E Q U E S T I O N S A B O U T T H E S T U D Y D U R I N G M Y PARTICIPATION? If you have any questions or desire further information about this study before or during participation, you can contact Dr. Hennie J.J. van Vuuren at (604) 822-0418. I f you have any concerns about your rights as a research subject and/or your experiences while participating i n this study, contact the 'Research Subject Information Line i n the University o f British Columbia Office o f Research Services' at (604) 822-8598.  Thanks for your willingness to participate in this study.  Sincerely yours  Hennie J.J. van Vuuren (Ph.D.)  Professor and Eagles Chair Director  September 22, 2003  Page 3 o f 4  162  CONSENT I understand that m y participation i n this study is entirely voluntary and that I may refuse to participate or withdraw from this study at any time. To the best of our knowledge, wine produced with the malolactic yeast M L O l is safe to consume and there are no foreseeable risks. There are no direct benefits to subjects from participating in this tasting.  I have received a copy o f this consent form for m y own records. I consent to participate i n this study.  Subject signature  Printed name  Date  Signature o f a witness  Printed name  Date  Signature o f PI  Printed name  Date  Version 2  November 18, 2003  Page 4 o f 4  163  APPENDIX E PCR Confirmation of the Screening Method  CD 0  CM CD CO  c o O  CO CD  c o O  c o O  LO CD C  o O  4072 bp 3054 bp 2036 bp 1636 bp 1018 bp 506, 517 bp 396 bp  Figure 23. PCR confirmation of the screening method used to detect integration of the malolactic cassette into the URA3 locus of S92. The 1095 bp PCR product was visualized by 0.8% agarose gel electrophoresis and ethidium bromide staining. PCR primers specific to PGKJp and outside the malolactic cassette (3'-end) were used.  164  APPENDIX F Degradation of Malate and Consumption of Glucose and Fructose by Malolactic Wine Yeast Clones  Table 15. Degradation o f malate (g/L) b y individual colonies o f malolactic clones inoculated into synthetic must containing 4.5 g/L o f malate.  Day 0 1 2 3 4 5 6 7 14  Malolactic 1 1 2 4.38 4.38 2.38 2.27 0.28 0.25 0.07 0.07 0.07 0.07 0.06 0.06 0.05 0.04 0.04 0.04 0.02 0.02  clone Malolactic 3 1 2 3 4.38 4.38 4.38 3.26 3.08 3.29 0.30 0.91 0.36 0.07 0.11 0.07 0.07 0.06 0.06 0.06 0.06 0.05 0.05 0.05 0.04 0.04 0.04 0.05 0.02 0.02 0.02  clone Malolactic 4 1 2 3 4.38 4.38 4.38 3.30 3.94 4.08 0.33 0.88 1.20 0.07 0.08 0.08 0.06 0.06 0.05 0.05 0.04 0.04 0.04 0.03 0.02 0.04 0.02 0.02 0.02 0.02 0.01  clone Malolactic 5 1 2 3 4.38 4.38 4.38 4.05 4.02 3.67 1.11 1.88 2.50 0.17 0.16 0.50 0.08 0.06 0.07 0.05 0.05 0.06 0.04 0.04 0.05 0.03 0.04 0.04 0.02 0.02 0.03  clone S92 3 4.38 4.34 4.08 nd nd nd nd nd 3.48  4.38 4.29 4.31 3.84 3.89 3.90 3.91 3.31 2.98  S92 + YCplac33KanMX  S92 + pJH13  4.38 4.35 4.19 4.04 3.88 3.95 3.61 3.33 3.21  4.38 3.94 1.39 0.15 0.05 0.04 0.03 0.03 0.01  Table 16. Consumption o f glucose (g/L) by individual colonies o f malolactic clones inoculated into synthetic must containing 100 g/L o f glucose (and 100 g/L o f fructose). Day 0 7 14  Malolactic clone Malolactic clone Malolactic clone Malolactic clone S92 1 3 4 5 1 2 1 2 1 2 3 3 3 1 2 3 107 107 107 107 107 107 107 107 107 107 107 107 107 10.0 5.18 9.18 20.5 11.2 8.04 1.19 .704 1.27 5.46 10.2 19.6 3.22 0.13 0.08 0.10 0.21 0.10 0.10 0.05 0.06 0.06 0.07 0.17 0.46 0.05  S92 + YCplac33KanMX  S92 + pJH13  107 6.31 0.05  107 1.46 0.04  Table 17. Consumption o f fructose (g/L) by individual colonies o f malolactic clones inoculated into synthetic must containing 100 g/L o f fructose (and 100 g/L o f glucose). Day 0 7 14  Malolactic clone Malolactic clone Malolactic clone Malolactic clone S92 1 4 3 5 1 2 1 2 1 2 3 3 3 1 2 3 105 105 105 105 105 105 105 105 105 105 105 105 105 23.9 30.6 29.5 27.5 21.8 20.5 12.7 10.3 12.1 20.2 33.0 43.4 22.9 3.07 1.52 2.60 4.34 2.22 2.10 0.57 1.24 0.93 1.82 3.41 16.5 1.58  S92 + YCplac33KanMX  S92 + pJH13  105 26.8 1.76  105 12.3 0.71  165  APPENDIX G C o n f i r m a t i o n of the Identity of the P a r e n t a l S t r a i n by P C R A m p l i f i c a t i o n of the d Elements of the T y l Retrotransposon  CD  s_ CD  E O  —I ^  CN O) CO  > > ^  Figure 24. Genetic patterns o f the M L O l and the S92 yeast strains based on amplification o f genomic D N A regions in between d elements o f the T y l retrotransposon. A detailed method o f the P C R amplification procedure is given by Ness et al., 1993.  166  APPENDIX H Southern B l o t C o n f i r m i n g Integration of the M a l o l a c t i c Cassette into the URA3 L o c u s of S92 (PGK1 promoter probe)  S92 ML01  <  6.3Kbp 6.0Kbp 5.1 Kbp  PGK1 6.3Kbp  Malolac  cassette 6.0Kbp  5.1 Kbp  URA3 No hybridization  Figure 25. Integration of the malolactic cassette into the URA3 locus of S92 was confirmed by Southern blot analysis using a PGK1 promoter probe. The schematic representation illustrates the EcoRV restriction sites with vertical lines and the PGK1 promoter probe hybridization site is depicted as hatched boxes in the lower panel. 167  APPENDIX I Ascospore formation by the M L O l and S92 strains  Sporulation was done according to standard protocols (Ausubel et al., 1995). The only modification was that cells were plated on S A A medium (6.5 g/ sodium acetate and Pastagar B 15 g/L) and incubated for 72 h at ambient temperature.  Table 18. Comparison of-the M L O l and S92 strains capability to sporulate. Following spore formation on S A A medium, the percentage o f ascospores (containing 3 or 4 spores) was determined b y microscopic evaluation.  Total counted Percentage of triads and tetrads formed per total number of cells  MLOl 782 11%  S92 612 8%  Analysis o f the M L O l spores revealed that cells from two spores were auxotrophic for uracil but positive for M L F and cells from the remaining two ascospores were prototrophic for uracil and negative for M L F .  168  APPENDIX J Detailed Description of the DNA Sequences that Comprise the Malolactic Cassette  Table 19. The source and description o f the malolactic cassette DNA sequences. Nucleotide position 1-4 1-928  Designation  Srfl half cloning site  Reference for cloning details This study  Saccharomyces cerevisiae GC210  URA3 sequence  This study  Saccharomyces cerevisiae GC210  Source  1-508 5' non coding sequence 509-928 Part of open reading frame 929-934  Kpn\ cloning site  This study  Synthetic  935-1198  PGK1 terminator  Crousefa/., 1995  Saccharomyces cerevisiae AB972  Crous et al., 1995  Synthetic  Grobler et al., 1995 Volschenk et al., 1997a and 1997b  Schizosaccharomyces pombe 972  935-940 Hindlll site 941-1194 Rest oiPGKl terminator 1195-1198 Remainder of Clai site 1199-1218  Part of linker used in cloning strategy  1199 C residue from linker 1200-1204 Remainder of BgUl cloning site 1205 C residue 1206-1211 Xhol cloning site 1212 G residue 1213-1218 BgUl cloning site 1219-2818  mael gene  IT (leul-32)  1219-1224 Ndel site 1225-1456 3' non coding region 1457-1459 STOP codon 1460-2770 Coding region 2771-2773 START codon  169  Nucleotide position  Designation  Reference for cloning details  Source  2774-2812 5' non coding region 2813-2818 Ball site 2819-2829  Part of linker used in cloning strategy  Crous et al., 1995  Synthetic  Crous et al., 1995  Saccharomyces cerevisiae AB972  2819-2824 EcoRl cloning site 2825 C residue 2826-2829 remainder of BgUl cloning site 2830-4316  PGK1 promoter  2830-4310 Part of PGKlp 4311 -4316 Hindlll cloning site 4317-4322  Kpnl cloning site  This study  Synthetic  4323-4330  NotI cloning site  This study  Synthetic  4331-4594  PGK1 terminator  Crous et al., 1995  Saccharomyces cerevisiae AB972  Crous et al., 1995  Synthetic  Volschenk, unpublished  Synthetic  Volschenk, unpublished  (Enococcus ceni Lo 8413  4331-4336 Hindlll site 4337-4590  RestofPGKlt  4591-4594 Remainder of Clal site 4595-4614  Part of linker used in cloning strategy  4595 C residue 4596-4600 Remainder of Bglll cloning site 4601 C residue 4602-4607 Xhol cloning site 4608 G residue 4609-4614 BgUl cloning site 4615-4616  C A residues left from oligonucleotide used for amplification  4617-6242  mleA gene  mleA  4617-4619 STOP codon  170  Nucleotide Designation position 4620-6239 mleA open reading frame  Reference for cloning details  Source  6240-6242 START codon 6243-6253  Part of linker used in cloning strategy  Crous et al., 1995  Synthetic  Crous et al., 1995  Saccharomyces cerevisiae AB972  6243-6248 EcoRl cloning site 6249 C residue 6250-6253 Remainder of BgUl cloning site 6254-7740  PGK1 promoter  6254-7734 Part of PGKlp 7735-7740 Hindlll cloning site 7741-7748  NotI cloning site  This study  Synthetic  7749-8683  URA3 sequence  This study  Saccharomyces cerevisiae GC210  7749-8132  Part of open reading frame  8133-8683  3' non coding region  8680-8683  SrfL half cloning site  This study  Saccharomyces cerevisiae GC210  171  APPENDIX K Discrepancies between the Integrated Malolactic Cassette and Published Sequences Table 20. Discrepancies found when comparing the sequence o f the integrated malolactic cassette and previously published sequences. Nucleotide position 821  Description Difference in the 5' region of the URA3 open reading frame  929-934  Additional sequence resulting from cloning strategy  1199-1218  Additional sequence resulting from cloning strategy  2819-2829  Additional sequence resulting from cloning strategy  2896  Difference in the PGKlp sequence  4298  Difference in the PGKlp sequence  4317-4330  Additional sequence resulting from cloning strategy  4595-4614  Additional sequence resulting from cloning strategy  4629  Difference in the mleA open reading frame. This difference corresponds to a change of amino acids from aspartic acid (in the published sequence) to glutamic acid (in the  5247  Difference in the mleA open reading frame. This difference corresponds to no change of the amino acid sequence  6243-6253  Additional sequence resulting from cloning strategy  7741-7748  Additional sequence resulting from cloning strategy  7751  Difference in the 3' region of the URA3 open reading frame  8234  Difference in the 3' region of the URA3 non coding sequence  8543  Difference in the 3' region of the URA3 non coding sequence  172  APPENDIX L Confirmation of DNA Mieroarray Data by Real-Time Reverse Transcription PCR  Table 21. Comparison o f fold change data for ten genes as determined by DNA mieroarray and by real-time reverse transcription P C R .  Gene Symbol  Fold change by semiquantitative R T - P C R  Fold change by DNA mieroarray  48 h  48 h  DIPS PH084 SUE1 PRR2 CTT1 PUT4 YPC1  4.92 3.60 -3.15 -1.11 -2.99 -6.33 -1.74  2.81 2.18 -5.13 -3.44 -3.29 -3.13 -2.18  144 h  144 h  ENA2 AQR1  Below threshold -2.74 -3.14  5.27 -3.23 -3.14  YML089C  173  APPENDIX M Transcripts of mael, mleA and URA3 in the M L O l yeast  mleA  mael  »  CN  cn  00  —  -  If— 48h  144h  URA3  -783 bp mael  807 bp m/&4  -269 bp ACT!  269 bp ACT! 48h  144h  CM  CM  O  00  oo  2  48h  E  -499 bp 3 -269bp^C7-7  144h  Figure 26. The presence of the mael, mleA and transcripts in the MLOl yeast during fermentation. Reverse transcriptase PCR was conducted on total R N A extracted from cells harvested from fermentations at 48 and 144 hours. The mael and mleA transcripts are absent in S92 at both time points.  174  APPENDIX N Vinification Trials with MLOl and S92 in Chardonnay Must (2004 harvest)  A 6 i  Time (days)  Figure 27. Malate degradation and lactate and ethanol production by M L O l and S92 i n Chardonnay must (from fruit harvested i n 2004). (A) Efficient conversion o f L-malate (?) to L-lactate ( A ) during alcoholic fermentation by M L O l ; no significant degradation of L-malate (? ) or production o f L-lactate (? ) was observed for S92. (B) Production o f ethanol b y M L O l (?) and S92 (| ); introduction o f the malolactic cassette did not affect ethanol formation.  175  APPENDIX O Physicochemical Characteristics of Chardonnay Wines (2004 Harvest) Produced by MLOl, S92 and S92 plus O. oeni  Table 22. Physicochemical and colour measurements o f Chardonnay wines (2004 harvest) produced b y M L O l , S92 and S92 plus O. ceni. 3  MLOl  S92  S92 + O. ceni  Titratable acidity (g/L)  6.1 a  7.8 b  6.3a  **  Acetate (g/L)  0.25 a  0.328 b  0.424 c  ***  pH  3.68 a  3.52 b  3.78 c  ***  L (degree o f lightness)  97.86 a  97.96 b  96.55 a  ***  a (greenness)  -1.85 a  -1.73 b  -2.39 c  ***  b (yellowness)  9.76 a  9.47 b  13.95 c  ***  ^420nm + ^520nm  0.198 a  0.179 a  0.255 b  **  c  P  b  Colour measurements  "The mean values for biological replicates are given for all quantities (n=3) *'**, ***, ns: significant atp< 0.05, 0.01, 0.001, or not significant Means separated atp < 0.05 by Duncan's post-hoc test b  c  176  APPENDIX P Correlation M a t r i x  T a b l e 23. Correlation matrix obtained from the sensory analysis o f Chardonnay wines.  Overall Quality Yellow Colour Fruity Taste Body Sweetness Acidity  Overall Quality Yellow Colour Fruity Taste Body 1.00000 -0.69810 1.00000 0.93026 -0.38672 1.00000 0.99958 -0.71850 0.91927 1.00000 0.97510 -0.52192 0.98847 0.96828 -0.99459 0.76872 -0.88710 -0.99718  Sweetness Acidity  1.00000 -0.94677  1.00000  177  APPENDIX Q Health Canada Approval to use MLOl for the Commercial Production of Wine Canada  V  3  " tl)t !  f  and F  i± B atl ••• '• ¥'«niiey's Pasture • -'•Po^lLw&for G7OTA*• •' OTTAWA, Onteio, ' ''••KiA-'Oli'' " '  -  • -  • « L iftW;''" ' ' Dr. Ilcnric J J . van Voiarcn ' FactrtiV of Afric«il«Ktt Sciences' Ifni versity -of Bf i:t»h. Columbia Suite 23i) 2:205 E - M a i l "  '  f  ;  •"  ;  V6T1Z4 ..Dear DT. van Vuuren:  •. • ,  ' .' •  , Thisletier Defers toilve Nm'el;FaQd'S«bmissiei» wnccrriing WmsY^mt' Mt-i)l;'SB43 its use .its wiaemaMng in' Canada.- Officers of the MMrth'iybdacls-iu*d-:Foe^l. 8ea«eh;htorr reviewed the iiifbniiaiiopyou pro^id>stlfi>f ascssnKtit ofthe acwpfebility of tire WSf Yeast "•ML-OI and ofti»"wfn«s derivedfronditfartasmanfoodusefiiCsBa&ti According to the subrojtt&i information,. Ms: yeast .'swain catties two Movel §erKS which peranits the yeast to coasiuet malolactic fenpehtelioti. Based m ©a«*atoaio« of;!%sulwiiiled:'data. we haw no oi^cctiori to ftsfbod use of the Wine Yeast ML-01 i i Ciisaija,: . / • ;  Ii should 6ie noted that iMs-opinion is solely with respect to the suitabilityforsifts as' food of prodnefe <teriw»*.#«BS Winci'mi ML-Cil.  /2  APPENDIX R US Food and Drug Administration GRAS Notice  ( i M  I M H  i  H H ». .1 I ] V A N P \ • ! I I I l > N l  M i l UIIN  FDA Home Page I C F S A N Home I Search/Subject Index [ Q & A I Help  CFSAN/Office of Food Additive Safety June 30, 2003  Agency Response Letter GRAS Notice No. GRN 000120 Robert Biwersi Lesaffre Yeast Corporation 433 East Michigan Street Milwaukee, W I 53202 Re: G R A S Notice N o . G R N 000120 Dear M r . Biwersi: The Food and Drug Administration ( F D A ) is responding to the notice, dated January 2, 2003, that you submitted in accordance with the agency's proposed regulation, proposed 21 C F R 170.36 (62 F R 18938; A p r i l 17, 1997; Substances Generally Recognized as Safe ( G R A S ) ; the G R A S proposal). F D A received the notice on January 7, 2003, filed it on January 10, 2003, and designated it as G R A S Notice N o . G R N 000120. The subject o f the notice is Saccharomyces cerevisiae strain M L O l (S. cerevisiae strain M L O l ) carrying a gene encoding malolactic enzyme from Oenococcus ceni and a gene encoding malate permease from Schizosaccharomyces pombe. The notice informs F D A of the view o f Lesaffre Yeast Corporation (Lesaffre) that S. cerevisiae strain M L O l is G R A S , through scientific procedures, for use i n winemaking as a yeast starter culture for grape must fermentation. Lesaffre recommends using between 0.1 to 0.2 grams o f active dry yeast per liter o f wine.  180  Lesaffre describes generally available information about traditional manufacturing processes for the production o f wine from grapes. These processes include the harvesting, de-stemming and crushing o f grapes (resulting i n must), the separation o f the juice from the skins and seeds, one or more distinct types o f microbial fermentation, clarification, stabilization, and bottling. Winemakers may vary the sequence o f operational steps or modify procedures, depending upon the desired characteristics and nature o f the wine. Lesaffre describes generally available information about two distinct fermentation processes (i.e., alcoholic fermentation and malolactic fermentation) that occur either through the action o f microorganisms that already are present on the grapes or through the action o f microorganisms that are specifically added b y the winemaker. Alcoholic fermentation (i.e., a process whereby the sugars glucose and fructose are converted to ethanol) is mediated b y metabolic pathways associated with yeast (usually S. cerevisiae or closely related species). Malolactic fermentation (i.e., a process whereby the dicarboxylic acid malic acid is decarboxylated to the monocarboxylic acid lactic acid) is mediated by lactic acid bacteria through the combined action o f a protein (called malate permease) that transports malic acid from the wine into the bacteria and an enzyme (called malolactic enzyme) that converts the malic acid to lactic acid. Because malolactic fermentation reduces the number o f carboxylic acid groups on organic acids present in the wine, it reduces the acidity o f the must. Although alcoholic fermentation is an inherent process associated with all winemaking, malolactic fermentation is a secondary process that may or may not be induced by the winemaker, depending on the desired characteristics and nature o f the wine. Lesaffre describes generally available information about clarification o f wine, which can occur either at the end o f the alcoholic fermentation or after the wine has been kept on the lees (the sediment formed by spent yeast cells and grape particulate matter). W i n e clarification encompasses the removal o f solid particles in the wine v i a gravity or centrifugation and subsequent elimination o f the sediment or pellet. When clarification occurs at the end o f fermentation, the clarification process removes most yeast cells. When the wine is kept on the lees before clarification, the yeast cells undergo autolysis, which releases cellular material that ultimately is degraded through the action o f enzymes such as proteases. Lesaffre describes generally available information about stabilization processes, which differ depending on whether the wine is a white wine or a red wine. For white wine, stabilization involves removing proteins via filtration with bentonite. For red wine, stabilization involves adding gelatin or egg white albumin to precipitate colloidal structures that include tannin-protein complexes. Prior to bottling, most wines undergo filtration (e.g., with diatomaceous earth, cellulose filters, or membrane filters) that eliminates any remaining yeast cells. Lesaffre describes published articles about bioengineered strains o f S. cerevisiae, including strains o f S. cerevisiae that have been modified to conduct malolactic fermentation. Lesaffre notes that the use of bioengineered strains that can conduct both  181  alcoholic and malolactic fermentation eliminates the need for separate additions o f two distinct microorganisms (i.e., yeast and lactic acid bacteria). Lesaffre describes the development o f its own bioengineered strain o f S. cerevisiae. The host strain, S. cerevisiae strain S92, was isolated from the Champagne region i n France and is closely related or identical to commercial strains commonly used i n winemaking. The microbial source o f malate permease (i.e., Schizosaccharomyces pombe), is a yeast^ that was first isolated from African beer and has frequently been found in sugarcontaining products i n tropical and sub-tropical regions and i n grape must and cider i n moderate climates. The microbial source o f malolactic enzyme (i.e., Oenococcus oeni) is a lactic acid bacterium that has been isolated from wines and related habitats such as wineries and vineyards. It is the preferred, and most commonly used, lactic acid bacterium for malolactic fermentation o f wines. The malate permease is a 49 k D a protein with a hydrophobicity profile typical o f membrane transport proteins. It contains a peptide sequence (composed o f proline, glutamic acid, serine and threonine) that characterizes proteins with a rapid turnover. The malolactic enzyme is a dimer with a total molecular weight o f approximately 130 k D a . Lesaffre describes the construction o f an integration cassette that contains genes encoding malate permease from S. pombe and the malolactic enzyme from O. ceni, regulatory sequences associated with the expression o f these genes, and sequences used for integration into an appropriate chromosomal site i n S. cerevisiae strain S92. Lesaffre also describes the transformation strategy that it used to reduce the numbers o f potentially transformed yeasts that needed to be screened for the successful integration o f the integration cassette. This strategy involved co-transformation o f S. cerevisiae strain S92 with a plasmid (pUT322) that carries a selectable marker conferring resistance to the antibiotic phleomycin and was based on the hypothesis that cells transformed with ** plasmid pUT322 are more likely to also have been transformed with the integration cassette. U s i n g this strategy, Lesaffre first screened transformed yeast for resistance to phleomycin and then screened the selected phleomycin-resistant yeast for the ability to produce lactic acid. Lesaffre obtained a phleomycin-sensitive isolate and confirmed that it is free o f plasmid p U T 3 3 2 sequences. Lesaffre designated this strain as M L O l . Based on D N A analysis, Lesaffre concluded that the chromosomal patterns o f S. cerevisiae strains S92 and M L O l are the same except for the presence o f the integration cassette. Lesaffre found that the integration cassette remained stably incorporated after 100 generations. Lesaffre also found that S. cerevisiae strain M L O l functions as intended in that it efficiently degrades malic acid. Based on studies that evaluated yeast physiology under different culture conditions, Lesaffre concluded that S. cerevisiae strain M L O l has the same growth kinetics, fermentation rate, and ethanol yield as S. cerevisiae strain S92 under winemaking conditions and that uptake and utilization o f malic acid did not confer a growth advantage to S. cerevisiae strain M L O l . Lesaffre describes the method for routine production o f S. cerevisiae strain M L O l and notes that this method is based on well-established procedures for the production o f active dry yeast. The yeast is grown primarily under aerobic conditions to promote yeast 182  propagation rather than alcohol production. The yeast is harvested v i a centrifugation and is subsequently dewatered with a rotary vacuum filter, processed through an extruder, and dried, resulting i n active dry yeast. The yeast is packaged in vacuum foil pouches prior to shipping. Lesaffre discusses potential dietary intake o f S. cerevisiae strain M L O l and o f the proteins that Lesaffre has introduced into that strain. Lesaffre considers that exposure to the yeast itself or to the newly introduced proteins would be negligible because the processing procedures used i n winemaking remove intact yeast cells, debris associated with autolyzed yeast cells, and proteins released during autolysis o f yeast cells. Based on the information provided by Lesaffre, as well as other information available to F D A , the agency has no questions at this time regarding Lesaffre's conclusion that Saccharomyces cerevisiae strain M L O l is G R A S under the intended conditions o f use. The agency has not, however, made its own determination regarding the G R A S status o f the subject use o f S. cerevisiae strain M L O l . A s always, it is the continuing responsibility of Lesaffre to ensure that food ingredients that the firm markets are safe, and are otherwise in compliance with all applicable legal and regulatory requirements. In accordance with proposed 21 C F R 170.36(f), a copy o f the text o f this letter, as well as a copy o f the information i n the notice that conforms to the information i n proposed 21 C F R 170.36(c)(1), is available for public review and copying on the homepage o f the Office o f Food Additive Safety (on the Internet at http://www.cfsan.fda.gov/~lrd/foodadd.html). Sincerely, /s/ Laura M . Tarantino, P h . D . Acting Director Office o f Food Additive Safety Center for Food Safety and Applied Nutrition 'Although malolactic fermentation is usually mediated by lactic acid bacteria, Lesaffre chose a yeast (rather than a lactic acid bacterium) as a source o f the permease, because the permease must function in the membrane o f the yeast S. cerevisiae. (1  Food Ingredients and Packaging  I Summary of all G R A S Notices  C F S A N Home | C F S A N Search/Subject Index | C F S A N Disclaimers & Privacy Policy | C F S A N Accessibility/Help FDA Home Page | Search FDA Site | FDA A-Z Index I Contact FDA  FDA/Center for Food Safety & Applied Nutrition Hypertext updated by rxm/pmg August 17, 2004 183  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0100406/manifest

Comment

Related Items