UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Transgenic expression of human alpha-L-iduronidase in mouse and characterization of the long term pathophysiology… Russell, Christopher Spencer 2003

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2004-902595.pdf [ 22.93MB ]
Metadata
JSON: 831-1.0099792.json
JSON-LD: 831-1.0099792-ld.json
RDF/XML (Pretty): 831-1.0099792-rdf.xml
RDF/JSON: 831-1.0099792-rdf.json
Turtle: 831-1.0099792-turtle.txt
N-Triples: 831-1.0099792-rdf-ntriples.txt
Original Record: 831-1.0099792-source.json
Full Text
831-1.0099792-fulltext.txt
Citation
831-1.0099792.ris

Full Text

T R A N S G E N I C E X P R E S S I O N O F H U M A N A L P H A - L - I D U R O N I D A S E I N M O U S E A N D C H A R A C T E R I Z A T I O N O F T H E L O N G T E R M P A T H O P H Y S I O L O G Y O F M U R I N E A L P H A - L - I D U R O N I D A S E D E F I C I E N C Y B y Chr is topher Spencer R u s s e l l B . S c , U n i v e r s i t y o f B r i t i s h C o l u m b i a , 1993 A T H E S I S S U B M I T T E D I N P A R T I A L F U L F I L L M E N T O F T H E R E Q U I R E M E N T S F O R T H E D E G R E E O F D O C T O R O F P H I L O S O P H Y In T H E F A C U L T Y O F G R A D U A T E S T U D I E S Department o f M e d i c a l Genet ics W e accept this thesis/^s conforming toA)(e required standard T H E U ^ V E R S I T ^ O F B R I T I S H C O L U M B I A December 2003 © Chris topher Spencer R u s s e l l , 2003 Abstract Mucopo lysaccha r idos i s type I ( M P S I) is an autosomal recessive genetic disorder result ing f rom def ic iency o f a lpha-L-iduronidase ( I D U A ) , a lysosomal hydrolase required i n the catabol ism o f heparan and dermatan sulfate g lycosaminoglycans ( G A G s ) . M P S I presents as a c l i n i c a l spectrum o f disease ranging f rom a severe mul t i sys tem disease w i t h associated death i n the first decade (Hur le r syndrome) to mi lde r forms o f M P S I w h i c h are compat ib le w i t h a normal l ifespan (Scheie syndrome). Towards a better understanding o f M P S I, I have characterized the long term pathophys io logy o f murine I D U A def ic iency. Skeleta l manifestations represent the earliest c l i n i c a l f ind ing i n M P S I m ice w i t h h is to logic analysis o f g rowth plate and cor t ical bone reveal ing evidence that significant early pathology is present. A n a l y s i s o f the central nervous system has revealed the nove l f inding o f progressive neuronal degeneration w i t h i n the cerebel lum. In addi t ion, bra in tissue from M P S I mice show increased levels o f G M 2 and GM3 gangliosides. W h i l e persist ing to adul thood and capable o f mat ing, the I D U A deficient mouse most c lose ly resembles severe M P S I i n humans or H u r l e r syndrome. W h i l e many efforts are directed towards so lv ing the problems o f l ong term therapeutic gene expression, it remains to be determined i f gene therapy w i l l have the desired curative effects o n the host o f M P S I symptoms, and, addi t ional ly , whether expression o f therapeutic genes i n an unregulated manner w i l l disrupt normal ce l lu lar metabol i sm, i.e. induc ing disease. I have successfully generated mur ine strains w h i c h have the potential to express human I D U A i n a condi t ional transgenic approach. In addi t ion to genetic crosses into the I D U A deficient strain to address the benefit o f I D U A expression i n specific tissues at defined t ime points , these transgenic mice l ines can provide a source o f human I D U A expressing cel ls for use i n transplantation studies. F i n a l l y , the phenotype o f transgenic human I D U A expression, i f any, can be determined. It is hoped that these mouse strains w i l l be useful i n determining levels , locations, and t ime points important to the efficacy and safety o f gene therapy for M P S I. T a b l e o f C o n t e n t s Abstract Table of Contents , Table of Figures Table of Tables List of Abbreviations CHAPTER 1: INTRODUCTION 1 1.1 Thesis Focus and Chapter Overview 1 1.2 MPS 1 4 1.2.1 Clinical Presentation of MPS 1 4 1.2.2 Glycosaminoglycans and proteoglycans 7 1.2.3 Secondary storage in MPS 1 12 1.2.4 The MPS family of disorders 13 1.2.5 Genetics 1 4 1.2.7 IDUA protein synthesis and transport to the lysosome 21 1.3 Therapies for MPS I 23 1.3.1 Rationale 23 1.3.2 MPS animal models 26 1.3.3 Bone Marrow Transplantation for MPS I in humans 29 1.3.4 Bone marrow transplantation in MPS animal models 30 1.3.5 Cellular transplantation in MPS animal models 31 1.3.6 Gene therapy for MPS 1 32 1.3.7 Gene therapy in animal models of MPS disorders 33 1.3.8 Enzyme replacement therapy for human lysosomal disorders 37 1.3.9 Enzyme replacement in animal models of MPS 38 1.3.10 Generation of a murine model of MPS 1 39 1.4 Thesis objectives and supporting hypotheses 45 CHAPTER 2: MATERIALS AND METHODS 46 2.1 Polymerase chain reaction 4 7 2.2 Preparation of the human IDUA cDNA 4 7 2.3 Construction of the myeloid-specific transgene constructs. (CD11B-IDUA and CD1 IB-reporter gene) 4 8 2.4 Construction of the myeloid-specific transgene constructs with a selection cassette for selection in ES cells. (CD11B-IDUA and CD1 IB-reporter gene) 48 2.5 Construction of a ubiquitous IDUA expressing transgene construct. (CMV-IDUA) 49 2.6 Construction of a ubiquitous IDUA expressing transgene construct with a selection cassette for selection in ES cells. (pFlox-IDUA) 50 2.7 Construction of a ubiquitous IDUA expressing transgene construct with a selection cassette for selection in ES cells. (pCAGGS-IDUA) 50 2.8 Construction of a conditional Cre regulated transgene construct with a selection cassette for selection in ES cells (pCCALL2-IRES-IDUA) 52 2.9 Histopathology 52 iv 2.10 Radiography 53 2.11 Thin Layer Chromatography of Gangliosides 53 2.12 Colorimetric Assay of Glycosaminoglycans 54 2.13 Embryonic stem cell growth and electroporation 54 2.14 Transfection of ES cells with Cre plasmid 55 2.15 IDUA enzyme assay 55 2.16 Beta-galactosidase staining of ES cells and tissue fragments 56 2.17 Alkaline phosphatase staining of ES cells 56 2.18 Alkaline phosphatase staining ear punches and tissue fragments 57 2.19 DNA Isolation 58 2.20 Transformation 59 2.21 Southern blotting 59 2.22 Animals 59 CHAPTER 3: CHARACTERIZATION OF THE LONG TERM PATHOPHYSIOLOGY OF MURINE MPS 1 61 3.1 Abstract 62 3.2 Introduction 62 3.3 Results 64 3.31 Clinical Features 64 3.32 Life span of MPS I mice 66 3.33 Growth Profiles 67 3.34 Radiographic Examination 70 3.36 Glycosaminoglycan Excretion 72 3.37 Gangliosides 73 3.38 Bone Histopathology 74 3.39 Neuropathology 77 3.4 Discussion 80 CHAPTER 4: PRONUCLEAR AND EMBRYONIC STEM CELL ATTEMPTS AT GENERATION OF MURINE TRANSGENIC LINES WITH UBIQUITOUS OR MYELOID SPECIFIC EXPRESSION OF HUMAN IDUA 89 4.1. Introduction 90 4.1.1 A model of in utero bone marrow transplantation 93 4.1.2 Widespread high level IDUA expression 95 4.1.3 The use of the human IDUA cDNA 97 4.1.4 The generation of transgenic mice 99 4.2 Results 103 4.2.1 Pronuclear injection approach for the generation of myeloid specific, and ubiquitous, IDUA expressing transgenic mice 103 4.2.2 Embryonic stem cell approach for the generation of myeloid specific and ubiquitous IDUA expression I l l 4.3 Discussion 120 v CHAPTER 5: CONDITIONAL TRANSGENIC EXPRESSION OF HUMAN ALPHA-L-IDURONIDASE IN A MURINE MODEL TO ESTABLISH EFFECTIVE AND TOLERABLE LIMITS FOR GENE THERAPY FOR MPS 1 121 5.1 Introduction 122 5.1.1 Conditional transgene regulation systems 123 5.1.3 Experimental Approach 130 5.2 Results 137 5.3 Discussion 151 CHAPTER 6: SUMMARY AND CONCLUSIONS 155 6.1 Characterization of the long term pathophysiology of murine MPS 1 156 6.2 Future work: 157 6.3: Generation of transgenic murine strains expressing human IDUA 157 6.4 Future work 163 REFERENCES 164 vi T a b l e o f F i g u r e s F igure 1.1: Heparan sulfate exodegradation 8 F igure 1.2: Dermatan sulfate exodegradation 10 Figure 1.3: Organiza t ion o f the human I D U A gene locus 15 F igure 1.4: The human I D U A c D N A 16 F igure 1.5: Endogenous and exogenous pathways for transport o f lysosomal enzymes i nc lud ing I D U A to the lysosomes 22 F igure 1.6: Routes for the introduct ion o f therapeutic I D U A 24 Figure 1.7: Targeted inact ivat ion o f the murine Idua gene 41 F igure 1.8: C l i n i c a l feature o f Idua -/- m ice at 12 weeks o f age 43 F igure 1.9: E lec t ron micrographs f rom 8 week o l d Idua -/- and control mice 44 F igure 3.1: Phenotype o f M P S I m ice 65 F igure 3.2: L i f e span o f affected animals 67 F igure 3.3 A : G r o w t h curves o f male Idua -/- m ice relative to normals 68 F igure 3 . 3 B : G r o w t h curves o f female Idua -/- and control mice 69 F igure 3.4: Rad iograph ic examinat ion o f Idua -/- and control m ice 70 F igure 3.5: Sku l l s o f Idua -/- and normal male mice at 70 weeks o f age 71 F igure 3.6: G l y c o s a m i n o g l y c a n excret ion i n male Idua -/- and normal m ice 73 F igure 3.7: T h i n layer chromatogram o f bra in l ip ids 74 Figure 3.8: P r o x i m a l t ib ia l g rowth plates 76 F igure 3.9: Po la r i zed l ight mic roscopy o f cor t ica l bone samples 77 F igure 3.10: P A S D staining o f the Purkinje ce l l layer o f cerebel lum 79 F igure 4 .1 : Identity between human and mur ine Idua exon II 99 Figure 4.3: E m b r y o n i c stem ce l l approach for the generation o f transgenic mice 101 Figure 4.4 Transgenic construct for m y e l o i d specific expression 104 Figure 4.5: A map o f the backbone C D 1 l b - h g h vector for m y e l o i d transgene expression 105 F igure 4.7: The p E G F P - C 2 p l a s m i d for expression o f enhanced green flourescent protein 106 Figure 4.8: A n a l y s i s o f 18 samples f rom co-microinj ect ion o f C D 1 l b - I D U A and C D 1 l b -L a c Z constructs 107 F igure 4.9: A n a l y s i s o f 11 samples f rom co-microinj ect ion o f C D 1 l b - I D U A and C D 1 l b -E G F P contructs 108 F igure 4.10: Ub iqu i tous Transgene Construct C M V - I D U A 109 F i g 4 .11: A n a l y s i s o f samples f rom micro in jec t ion o f ubiquitous I D U A construct C M V -I D U A 110 Figure 4.12: p F L O X - C M V - I D U A - E G F P 112 F igure 4 .13: The F l o x vector used for E S select ion o f the ubiquitous I D U A and E G F P expressing construct used prev ious ly for pronuclear injection 113 F igure 4.14: Ub iqu i tous Transgene Construct p C A G G s - I D U A 114 F igure 4.15: p C A G G s vector for h i g h leve l eukaryotic expression 115 F igure 4.16: The pGT1 .8 I r e sBgeo vector 116 F igure 4.17: C D 1 l b - L a c Z reporter construct integrates into E S clones after co-electroporat ion w i t h the C D 1 l b - I D U A - N e o construct 117 Figure 4.18: Representation o f E S clones screened for beta-galactosidase staining intensity 118 vii Figure 5.1: C r e / l o x P recombinat ion 128 F igure 5.2: Schematic o f the select ion and screening for desirable E S clones 132 Figure 5.3: p C C A L L 2 - I R E S - h A P / c g parent construct 133 F igure 5.4: Schematic o f the p C C A L L - I D U A construct 134 Figure 5.5: Recombina t i on and the expression o f human I D U A 136 Figure 5.6: Rearrangement check o n p C C A L L 2 construct 137 F igure 5.7: P C R detection o f bacterial clones conta ining p C C A L L 2 l igated w i t h the human I D U A c D N A 138 Figure 5.8: Pst I restrict ion digest o f p l a smid f rom l iga t ion o f p C C A L L 2 construct w i t h human I D U A c D N A to determine orientation 139 Figure 5.9: Res t r ic t ion digest ion to identify clones w i t h correct ly inserted and unrearranged h I D U A c D N A into p C C A L L 2 139 F igure 5.10: A n a l y s i s o f large scale p l a smid isola t ion o f p C C A L L - I D U A 140 F igure 5.11: L a c Z staining o f E S colonies demonstrating expression var iab i l i ty 141 F igure 5.13: Southern blot analysis o f 48 E S clones w i t h good reporter gene expression for single copy integrates 143 Figure 5.14: A l k a l i n e phosphatase staining o f E S cel ls conta ining single copy integrations o f p C C A L L - I D U A 145 F igure 5.15: O v e r a l l Pedigree 150 Figure 5.16: Schematic o f the select ion and screen for desired E S clones 152 viii T a b l e o f T a b l e s Table 1.1: Representative proteoglycan 12 Table 1.2: Strategies for the introduct ion o f therapeutic I D U A 25 Table 1.3: Therapies for M P S I assessed on M P S mode l 34 Table 2 .1: P C R primers 46 Table 4 .1 : S u m m a r y o f Pronuclear M i c r o i n j e c t i o n attempts at generation o f transgenic l ines 110 Table 4.2: Blas tocyst inject ion o f engineered E S clones produces on ly l o w leve l chimeras 118 Table 5.1: Representative C r e expressing mice 124 Table 5.2: S u m m a r y o f E S clone analysis 145 L i s t o f A b b r e v i a t i o n s A G U aspar tylgycoasminuria beta-geo n e o m y c i n and beta-galactosidase fusion gene B M T bone mar row transplantation C D - M P R cat ion dependent mannose-6-phosphate receptor c D N A complementary D N A C H O Chinese hamster ovary cel ls C I - M P R cat ion independent mannose-6-phosphate receptor C M V cytomegal iv i rus C N S central nervous system C r e causes recombinat ion recombinase C R M cross reactive material C S chondroi t in sulfate D M S O d imethyl sulfoxide D N A deoxyr ibonucle ic ac id D o x doxycyc l ine D S dermatan sulfate E C extracellular space E E early endosome E G F P enhanced green flourescent protein E R endoplasmic re t icu lum E R T enzyme replacement therapy E S embryonic stem ce l l E S embryonic stem (cell) G go lg i G A G g lycosaminog lycan G M ganglioside G T gene therapy G U S beta-glucuronidase H & E haematoxyl in and eosin stain h A P human alkal ine phosphatase H D huntington H L A human leucocyte antigen H S heparan sulfate H S C hematopoietic stem cel ls i .v . intra venous I D U A alpha-L-iduronidase enzyme, c D N A , or m R N A IDUA alpha-L-iduronidase gene, human Idua alpha-L-iduronidase gene, mouse I E immediate early I R E S internal r ibosome entry site k D A k i l o Dal tons K S keratan sulfate L lysosome X L a c Z beta-galactosidase l o x P locus o f crossover L S D lysosomal storage disease M - 6 - P mannose-6-phosphate M P R s mannose-6-phosphate receptors M P S mucopolysacchar idos is m R N A messenger R N A p A polyadenyla t ion s ignal P A S per iod ic -ac id sch i f f w i t h diastase stain P B S phosphate buffered saline P C R polymerase cha in react ion P G K phospho-glycerate kinase P M p lasma membrane R E R rough endoplasmic re t icu lum R N A r ibonucle ic ac id SAT-1 sulfate transporter-1 gene, human Sat-1 sulfate transporter-1 gene, mouse S A T - 1 sulfate transporter-1 protein, c D N A , or m R N A S R P s ignal recogni t ion particle T e t R tetracycline responsive T S P tissue specific promoter V ves ic le xi Chapter 1: Introduction 1.1 Thesis Focus and Chapter Overview T h i s thesis describes the long term characterizat ion o f murine I D U A def ic iency and the generation o f transgenic murine strains condi t iona l ly expressing human I D U A . Severe M P S I i n humans is a mul t i sys tem, progressive disease w i t h a characteristic phenotype, however the pathological and b iochemica l alterations w h i c h underl ie the development o f overt symptoms i n M P S I are not w e l l understood and dif f icul t to study i n humans. U s i n g a mouse mode l o f I D U A def ic iency, I have studied specif ic features o f I D U A def ic iency and provide new observations and insights o n the pa thophys io logica l progression o f I D U A def ic iency i n mouse, and, l i k e l y , humans. Importantly, I D U A def ic iency i n the mouse is found to most c lose ly resemble severe I D U A def ic iency i n humans, w i t h mul t i sys tem progressive involvement o f most tissues inc lud ing skeletal and neurologic systems. The second objective o f this w o r k was the generation o f mouse strains condi t iona l ly expressing human I D U A for use i n determining the outcome o f specific therapeutic reconsti tution o f I D U A i n a background o f complete I D U A deficiency. T h i s w i l l a l l o w for the assessment o f different therapy approaches for M P S I, w h i c h , a long w i t h a number o f other members o f a larger group o f genetic disorders ca l led ly sosomal storage diseases ( L S D s ) , are some o f the on ly genetic diseases to have reached the point o f gene product therapy. F o r M P S I, therapy is presently i n the fo rm o f ce l l transplantation us ing bone marrow, or enzyme replacement us ing recombinant human I D U A protein enzyme, however approaches us ing gene therapy are also considered suitable. 1 The structure o f the thesis is as fo l lows : Chapter 1 provides background informat ion relevant to this thesis, describes the objectives o f the thesis, and presents hypotheses explored i n the thesis. The current understanding o f human M P S I is presented, i nc lud ing the b iochemica l basis o f M P S , the genetics o f the disease inc lud ing the presence o f an over lapping sulphate transporter gene (SAT-1), and the normal product ion and de l ivery o f I D U A enzyme to the lysosome. The potential for therapy o f M P S I is then discussed, i nc lud ing various routes and methods for correct ion o f I D U A deficiency. A discuss ion o f an imal models o f M P S disorders and attempts at correct ion o f enzyme deficiency provides an up to date r ev iew o f therapeutic approaches for the M P S disorders. The objectives and supporting hypotheses o f the thesis are then presented. Chapter 2 details the materials and methods used i n this project. Chapter 3 is an examinat ion o f the l o n g term c l i n i c a l , b iochemica l , and pa thologica l course o f murine I D U A def ic iency. One o f the major goals o f the characterizat ion o f mur ine I D U A def ic iency is to establish the breadth o f I D U A def ic iency i n mouse and place it o n the spectrum o f human I D U A def ic iency. In addi t ion, the progression o f I D U A def ic iency i n cr i t ica l tissue systems can be determined thus leading towards a better understanding o f the pa thophysio logy o f I D U A deficiency. F i n a l l y , characterization o f murine I D U A def ic iency m a y establish markers o f disease useful i n the assessment o f therapies for I D U A deficiency. Important f indings include the presence o f early pathology i n the growth plates o f bones, the presence o f secondary accumulat ions i n brain s imi la r to those described i n human M P S I, and the presence o f neurologic disease inc lud ing dysmorpho logy o f Purkinje cel ls i n the cerebel lum. The 2 observations are important as they conf i rm the u t i l i ty o f the Idua - /- mouse, and provide a better understanding o f the pathology occur r ing over t ime i n tissues not yet responsive to therapy. Chapter 4 describes the attempted product ion o f transgenic mouse l ines expressing human I D U A either ubiqui tous ly , or i n the m y e l o i d hematoipoiet ic l ineage, for use i n transplantation studies as w e l l as genetic crosses into I D U A deficient l ine . The m y e l o i d specif ic transgenic w o u l d address the m a x i m u m potential o f bone mar row der ived cel ls for the correct ion o f I D U A def ic iency. U s i n g both a pronuclear inject ion approach and an embryonic stem c e l l approach, attempts at generation o f germline transmissible founders or chimeras were unsuccessful. Chapter 5 documents the successful generation o f transgenic l ines expressing human I D U A , emp loy ing a condi t ional transgenic approach i n v o l v i n g Cre-media ted act ivat ion o f human I D U A expression. T h i s approach includes a dual reporter system indica t ing the state o f transgene recombinat ion. In i t ia l mat ing into a widespread C r e -expressing l ine produced double transgenic offspring, some o f w h i c h express human I D U A and the reporter gene a lkal ine phosophatase. These mi ce can be used to express human I D U A speci f ica l ly i n a w i d e variety o f tissues and can fu l f i l l the dual objectives o f chapter 4, namely mar row der ived I D U A expression to represent bone m a r r o w transplantation, and ubiqui tous I D U A expression for transplantation experiments and to determine the phenotype o f I D U A overexpression. Chapter 6 is a d iscuss ion o f the results f rom the thesis. B r i e f l y , the observations described here o n the l ong term pathophys io logy o f I D U A def ic iency i n the mouse improve our understanding o f the cel lu lar events under ly ing the development o f overt 3 symptoms i n human M P S I. The I D U A - d e f i c i e n t mouse mode l o f M P S I represents a l l major aspects o f human I D U A def ic iency so far examined , i nc lud ing significant invo lvement o f the neurologic and skeletal compartments. Secondary accumulat ions o f tox ic gangliosides associated w i t h morpho logy changes and inappropriate ce l l death are found i n the I D U A - / - mouse as they are i n human I D U A def ic iency. F i n a l l y , the generation o f transgenic murine l ines expressing human I D U A w i l l he lp determine effective therapeutic approaches for M P S I and determine the phenotype o f transgenic expression o f I D U A . 1.2 M P S I 1.2.1 C l i n i c a l P r e s e n t a t i o n o f M P S I D e f i c i e n c y o f the ly sosomal enzyme a -L- iduron idase ( I D U A ) underlies mucopolysacchardos is type I (or M P S I), w h i c h can result i n a w i d e range o f c l i n i c a l symptoms. M P S I represents the most c o m m o n severe M P S subtype, occur r ing w i t h a frequency o f approximate ly 1/100,000 i n most populat ions ( L o w r y et al, 1990) Three forms o f M P S I are recognized, differing i n onset, system involvement , and overa l l severity, w i t h Hur l e r syndrome ( M P S IH) the most severe, Scheie syndrome ( M P S IS) i n v o l v i n g a m u c h mi lde r course, and Hur le r -Sche ie syndrome ( M P S I H / S ) representing an intermediate phenotype. M P S I therefore presents as a spectrum o f disease phenotypes (Roub icek et al, 1985). H i s to r i ca l l y the differentiation between M P S I phenotypes was based on c l i n i c a l symptom criteria, however molecula r characterization o f the IDUA gene encoding a-L-iduronidase and its mutations increasingly a l lows genotyping o f patients, useful i n prognosis based o n established genotype-phenotype correlations. A l l forms o f M P S I share i n c o m m o n excessive urinary excret ion o f heparan and dermatan sulphate and absence o f a lpha-L-iduronidase act ivi ty . M o s t often born w i t h no obvious phenotype, patients w i t h the most severe fo rm o f M P S I ( M P S I H -Hurler ) usual ly present c l i n i c a l l y before age 2 w i t h developmental delay, coarse facial features, enlargement o f the spleen and l iver , skeletal deformities, a prominent forehead, and jo in t stiffness. Symptoms rap id ly become more severe and diagnosis o f M P S I H typ ica l ly occurs between 6 and 30 months o f age ( C o l v i l l e and B a x , 1996). Deve lopmenta l delay is a precursor to developmental decl ine, w i t h a m a x i m u m functional age o f 2 to 4 years obtainable fo l l owed by progressive deterioration. L i m i t e d language sk i l l s result f rom a combina t ion o f mental handicap, tongue enlargement, a i rway obstruction, and possible hearing loss. Cornea l c loud ing is progressive and m a y result i n bl indness. Hydrocepha lus result ing f rom increased intracranial pressure i s c o m m o n and, again, progressive. Skeleta l deformities are widespread and progressive and include the s k u l l , denti t ion, vertebrae, phalanges and the l o n g bones among others, leading to the term dysostosis mul t ip lex (Fields et al., 1994). Shortened stature and very coarse features are seen w i t h M P S I H . Obstruct ive a i rway disease, respiratory infect ion, and cardiac compl ica t ions are the most c o m m o n causes o f death, w h i c h usual ly occurs before age 10. The m i l d form o f M P S I, Scheie syndrome ( M P S I S) presents at a later age than M P S I H w i t h c l i n i c a l l y significant symptom development usual ly after 5 years o f age w i t h diagnosis no rmal ly between 10 and 20 years o f age, depending on severity. M P S I S is characterized by jo in t stiffness, back pain , aortic va lve disease, and corneal c loud ing , w h i l e intel l igence and stature are normal . W h i l e progressive, the accelerat ion i n disease 5 severity observed i n M P S I H is not seen i n Scheie syndrome. S u r v i v a l into late adul thood is normal , however cardiac compl ica t ions may result i n death before midd le age (Scheie et al, 1962). Intermediate forms o f M P S I (Hur ler -Scheie or M P S I H / S ) have a c l i n i c a l phenotype between Hur l e r and Scheie syndromes. T y p i c a l l y , progressive dysostosis mul t ip lex is present, however l i t t le or no intel lectual dysfunct ion is observed. Other somatic features o f M P S I, i nc lud ing corneal c loud ing , j o in t stiffness, deafness and cardiac disease, are usual ly present. S y m p t o m development occurs between the ages o f 3 and 8 and surv iva l into adul thood is c o m m o n . C l i n i c a l mortal i ty no rmal ly results f rom cardiac involvement and a i rway obstruct ion ( M c K u s i c k and Neufe ld , 1983). The diagnosis o f M P S I i n patients is conf i rmed by measurement o f enzyme act iv i ty i n leukocytes, p lasma, or fibroblasts. Rou t ine ly the enzyme act ivi ty is measured w i t h the use o f a f lurogenic substrate 4-methylumbel l i feryl -a lpha- iduronide ( H o p w o o d and M u l l e r , 1982). Samples used i n the diagnosis o f M P S I include cul tured fibroblasts, p lasma, or serum, and cul tured cel ls der ived f rom amniot ic f l u id for prenatal diagnosis. C h o r i o n i c v i l l u s biopsies are used for diagnosis for a number o f M P S disorders i nc lud ing II, III A , III B , III C , and I V A , however it has been reported that the l o w leve l o f I D U A act iv i ty i n v i l l i makes diagnosis o f M P S I more diff icul t (Poenaru, 1987). The advent o f molecula r diagnosis coupled w i t h the extensive characterization o f mutations i n the IDUA gene p lay an increasing role i n diagnosis as w e l l as w e l l as prognosis and w i l l be discussed later. 6 1.2.2 Glycosaminoglycans and proteoglycans Def i c i ency o f I D U A i n M P S I results i n the accumula t ion o f undegraded mucopolysacchar ides , c o m m o n l y ca l led g lycosaminoglycans ( G A G s ) . G A G s are sulfated, l inear carbohydrates consis t ing o f repeating sugar groups, and inc lude heparan sulphate ( H S ) , dermatan sulphate ( D S ) , keratan sulphate ( K S ) , and chondroi t in sulfate ( C S ) . G A G s are no rmal ly found l i nked to a prote in core as part o f macromolecules termed proteoglycans, to w h i c h they impart functional properties. A s M P S I invo lves accumula t ion o f H S and D S the role o f these G A G s and their associated proteoglycans w i l l be discussed here. H S consists o f uronic ac id residues alternating w i t h a lpha- l inked glucosamine residues ( H o p w o o d , 1989). The uronic ac id m a y be g lucuronic or iduronic ac id , and m a y be sulphated. The glucosamine m a y be N-su lpha ted or N-acety la ted , and m a y also be 3- or 6-sulphated. Different permutations o f m o d i f y i n g sulphat ion and acetylat ion o n a carbohydrate backbone, w h i c h i t se l f varies i n sugar group representation, impart G A G s w i t h their unique functional properties and provides for huge complex i ty and b i o l o g i c a l divers i ty w i t h i n each type o f G A G . Degradat ion o f H S and other G A G s begins w i t h proteolysis i n the early endosomes produc ing liberated chains o f G A G (approx. 30kDa) . Endoglycos idases then cleave G A G chains into ol igosaccharides (approx. 5kDa) , w h i c h are targeted to the lysosome for stepwise exodegradation ( reviewed i n H o p w o o d et al., 1989). The structure o f a hypothet ical H S ol igosaccharide and the enzymes required for its lysosomal endodegradation are pictured i n F igure 1.1. 7 o® | K © 0(5} Mc I H2C0H COQrt HjCO© O-L-ldurtiildDW I H @ 0 ® *Ac I D U A ' 2 |:;::::::s :s::;::::, l l l i l ; P ; i l I f ^ l p l i ^ § ' o i l ; I j l ^ v ' ' Nty 1 0 ® Ufa i i i i f i Q ' : : : ; : : : : : v ' ; r 1 i ^ | ^ ^ COOK HgCO© . I - Nftt H:X;.; Figure 1.1: Heparan sulfate exodegradation I D U A hydro lyzes r emova l o f terminal desulfated iduronic ac id residues, step 2 above. T h i s produces free iduronic ac id and leaves a terminal g lucosamine for further exodegradation. 9 enzymes are required for H S degradation. N o t shown: glucosamine-3-sulphatase. F r o m Scr iver e t a l . , 1989. 8 The lysosomal exodegradation o f H S oligosaccharides requires at least nine enzymes, w i t h def ic iency o f any single enzyme result ing i n b lockage o f the entire pathway and accumulat ion o f part ia l ly degraded H S chains. These enzymes include glycosidases such as I D U A , sulphatases, and include a biosynthet ic enzyme that adds an acetyl group required for subsequent enzymat ic degradation. A s shown i n F igure 1.1, a lpha-L-iduronidase ( I D U A ) acts o n terminal desulfated iduronic ac id residues p roduc ing free iduronic ac id and a terminal g lucosamine residue for further degradation. The degradation o f G A G s releases monosaccharides and sulfate w h i c h exit f rom the lysosome for r ecyc l ing i n biosynthetic reactions ( H o p w o o d et al, 1989). Dermatan sulfate ( D S ) consists o f iduronic ac id , w h i c h may be C-2-sulphated, and g lucuronic ac id residues alternating w i t h beta- l inked N-acetylgalac tosamine, w h i c h may be sulphated (Roden , 1980). A s for H S , degradation o f D S containing proteoglycans includes proteolysis f o l l o w e d by endoglycosidase act ivi ty , p roduc ing D S oligosaccharides. The structure o f a hypothet ical D S ol igosaccharide and the enzyme required for its exodegradation are shown i n F igure 1.2. A s for H S catabol ism, def ic iency o f any single enzyme i n the pathway results i n accumula t ion o f undegraded D S oligosaccharides. A s for H S oligosaccharides, I D U A recognizes and cleaves terminal desulfated iduronic ac id residues f rom D S chains, leaving on D S chains terminal N -acetylgalatosamine residues for further enzymat ic degradation. In I D U A def ic iency, H S and D S oligosaccharides w o u l d be expected to accumulate w i t h terminal iduronic ac id residues. The demand for lysosomal degradation o f G A G s varies i n tissues according to G A G and proteoglycan content and turnover. Proteoglycans, the fo rm i n w h i c h G A G s are 9 •'• M?COH COOH H.COH I, A; IDUA * € -... (SxTUci^ N4c 13 0~eic M e l I * jS-t)1ijcnwiiJa« |,JJ H2C0H v. Figure 1.2: Dermatan sulfate exodegradation I D U A hydrolyzes removal of terminal desulfated iduronic acid residues, step 2 above. This produces free iduronic acid and leaves a terminal N-acetylgalactosamine for further exodegradation. From Scriver et al., 1989. 10 functional , are proteins conta ining g lycosaminog lycan carbohydrate chains. T y p i c a l l y , a protein core has one to hundreds o f covalent ly attached G A G chains. Proteoglycans range greatly i n the ratio o f prote in to G A G carbohydrate, and i n G A G compos i t ion . Proteoglycans are dynamic molecules , w i t h expression and compos i t ion , i nc lud ing G A G content, changing dur ing development. Proteoglycans do not share a un i fy ing functional feature, p l ay ing diverse roles such as fo rming components o f the extracellular matr ix , i n c e l l communica t ion , and i n l igand-receptor interactions. Unders tanding the functions o f heparan and dermatan sulfate conta in ing proteoglycans, and the locations where they function, provides some insight into the sites o f G A G accumula t ion i n M P S I. C e l l surface heparan sulfate, attached to transmembrane proteins, modulates the actions o f a large number o f extracellular l igands. The structural heterogeneity o f H S chains a l lows b ind ing o f a diverse repertoire o f proteins under phys io log ica l condi t ions ( reviewed i n Be rn f i e ld e t ah, 1999). The H S chains provide cel ls w i t h a mechanism to mediate interactions w i t h a w i d e variety o f extracellular effectors wi thout requir ing mul t ip le nove l b ind ing proteins. W h i l e found o n a variety o f c e l l surface proteins, H S chains are consistently found on members o f t w o major famil ies o f membrane-bound proteoglycans, the syndecans and the g lypicans . These heparan sulfate proteoglycans i m m o b i l i z e and regulate the turnover o f l igands that act at the ce l l surface, by b i n d i n g to l igands and enhancing format ion o f their receptor-s ignal l ing complexes . The extracellular domains o f syndecans and glypicans can be shed f rom the ce l l surface, p roduc ing soluble H S proteoglycans that act as H S proteoglycan antagonists, and cel ls that are less responsive to l igand s t imulat ion. The l igand affinities o f the syndecans and glypicans include l igands i n v o l v e d i n morphogenesis and w o u n d repair, consistent w i t h 11 the regional and temporal expression patterns o f specific members o f these H S proteoglycans. Internalization o f basic fibroblast g rowth factor at the mouse b lood-bra in barrier invo lves perlecan, a heparan sulfate proteoglycan (Deguch i et al, 2002) . Dermatan sulfate ( D S ) proteoglycans are less widespread than H S proteoglycans but l i kewise show regional and temporal expression patterns consistent w i t h functions i n morphogenesis . D S proteoglycans i n the adult are found i n tissues such as cartilage and bone (Rough ley and L e e , 1994). Table 1.1 describes some c o m m o n proteoglycans, their functional locat ion, and their G A G content. N a m e L o c a t i o n Func t ion G A G s Reference perlecan basement membrane ce l l adhesion H S Grof fen et al., 1999 g lyp i can ce l l surface regulate g rowth factors H S Song and F i l m u s , 2002 decor in connective tissue, cartilage matr ix assembly D S , C S R o u g h l e y and L e e , 1994 aggrecan cartilage osmot ic compressive properties C S , K S R o u g h l e y and L e e , 1994 neurocan extracellular matr ix o f C N S matr ix assembly C S R a u c h et al., 2001 Table 1.1: Representative proteoglycans G A G s = g l y c o s a m i n o g l y c a n s , HS=heparan sulfate, DS=dermatan sulfate, CS=chondro i t i n sulfate, KS=kera tan sulfate, CNS=cen t r a l nervous system. 1.2.3 Secondary storage in MPS I Somewhat unique to some o f the ly sosomal storage disorders is the potential for storage o f compounds not related to the pathway w h i c h is b iochemica l l y deficient. T h i s m a y be attributed to inh ib i t ion o f pathways by storage o f p r imary substrates. Secondary 12 accumula t ion o f gangliosides i nc lud ing GM2 and G M 3 have been noted i n human, canine, and murine , I D U A deficiency, as w e l l as other storage disorders unrelated to p r imary defects o f g lycosph ingo l ip id metabol i sm (Constantopoulos & Dekaban 1978, Constantopoulos et al, 1985). The role that ganglioside accumula t ion p lays i n the pathogenesis o f M P S I disorders is u n k n o w n but may be important. Defects i n the catabol ism o f GM2 gangl ioside i n Tay-Sachs and Sandhoff disease results i n neurodegenerative disease. Gangl ios ides inc lud ing GM2 have been impl ica ted i n neuronal apoptosis, and GM2 has been postulated to underl ie the generation o f ectopic dendrites i n pyramida l neurons i n both Tay-Sachs as w e l l as other general ized ly sosomal storage disorders ( W a l k l e y 1995). 1.2.4 T h e M P S f a m i l y o f d i s o r d e r s A t least 10 enzymes required for G A G catabol ism have been identif ied, p r imar i ly as a result o f s tudying enzyme def ic iency i n the M P S syndromes. A l l o f the M P S associated enzymes are unable to mediate endodegradation; that is , on ly terminal substrates are cleavable. Therefore def ic iency o f any single enzyme required for G A G degradation b locks the degradation pathway, resul t ing i n storage i n the lysosome and excret ion i n the urine. Differences i n the type o f G A G and their terminal residues accumulated i n the different M P S s result i n the dis t inguishing pa thophys io logy o f the M P S s . M P S I, w i t h accumula t ion o f H S and D S , includes, i n severe forms, v iscera l , skeletal , and neuro logica l involvement , consistent w i t h representation o f H S and D S G A G s i n these tissue systems. M P S II, sharing w i t h M P S I accumula t ion o f both H S and D S , has a phenotype s imi la r to M P S I, i n v o l v i n g both somatic and C N S systems. Interestingly, M P S V I , w i t h accumula t ion o f D S on ly , invo lves skeletal disease but 13 normal neurologica l function, w h i l e M P S III A , B , C , and D , w i t h accumula t ion o f H S on ly , invo lves severe mental deterioration, but on ly m i l d somatic symptoms and no skeletal disease. Th i s suggests the skeletal disease observed i n severe M P S I, s imi la r to the phenotype o f M P S V I , l i k e l y results f rom accumula t ion o f D S , w h i l e the neuro log ica l degeneration and C N S involvement observed i n severe M P S I l i k e l y results p r imar i ly f rom accumula t ion o f H S , as observed w i t h M P S III. The role o f K S i n the skeletal system is h ighl ighted i n M P S I V B , where accumula t ion o f K S is associated w i t h a phenotype o f severe skeletal disease. 1.2.5 Genetics M P S I results f rom def ic iency o f a lpha-L-iduronidase , encoded by the IDUA gene. In humans, the IDUA gene is located o n the short a rm o f chromosome 4 close to the telomere (4p l6 .3 ) i n the same reg ion as the Hunt ing ton disease (HD) gene (Scott et al., 1990). The IDUA gene contains 14 exons spanning 19 kb , organized as two clusters o f exons: exon I and II separated by an intron o f 566 bp, a large intron II o f 13 kb , and remain ing exons III to X I V clustered i n a 4.5 k b region (Scott et al., 1991, 1992). Intron 2 o f the human IDUA gene contains an A l u repetitive element and an 86 bp h i g h l y p o l y m o r p h i c V N T R repeat ( D 4 S 1 1 1 ) used i n the diagnosis o f H D (Scott et al, 1992, M a c D o n a l d et al., 1991). Conta ined entirely w i t h i n the IDUA gene, o n the opposite strand to I D U A , is the Sulphate transporter-1 gene, SAT-1 (see F igure 1.3)(Clarke et al.,, unpubl ished data). The SAT-1 gene w i l l be discussed further later. 14 SAT-1 gene ill II I III II mi—\ XIV IDUA Exons I and II IDUA Exons III to XIV IDUA exon • SAT-1 e x o i i ^ Figure 1.3: Organization of the human IDUA gene locus A r r o w s indicate the d i rec t ion o f t ranscript ion the IDUA gene (wi th b lack exons) and the SAT-1 gene (checkered exons). The human IDUA gene spans 19 kb , i nc lud ing intron 2 (13 kb) containing most o f the SAT-1 gene, w h i c h is encoded o n the opposite strand to IDUA and includes a 3 ' untranslated reg ion that overlaps IDUA exon II, a cod ing exon. In humans the IDUA gene produces a predominant transcript o f 2.3 kb at a l o w level o f t ranscript ion as determined by Nor the rn blot analysis (Scott et al., 1992). Alternate sp ic ing o f IDUA exons II, the over lapping exon, and exon I V , has been observed (Scott et al., 1991). A s shown i n figure 1.4, the human I D U A c D N A includes an open reading frame o f 1959 bp, encoding a peptide o f 653 amino acids (Scott et al, 1991). In addi t ion to the human I D U A c D N A , murine and canine I D U A c D N A s have been sequenced (Cla rke et al., 1994, M e n o n et al, 1992). The architecture o f the Idua gene is conserved i n a l l three species, and the Sat-1 sequence and genomic organizat ion has been detailed i n mouse and found to be s imi la r to the human IDUA locus. The entire region o f human chromosome 4 p l 6 . 3 conta ining IDUA is syntenic w i t h a region o f mouse chromosome 5 15 1 GTCACATGGG GTGCGCGCCC AGACTCCGAC CCGGAGGCGG AACCGG(lAGT GCAGCCCGAA 6 1 GCCCCGCAGT CCCCGAGCAC GCGTGGCCAT G C G T C C C C T G C G C C C C J G C G C C G C G C T G C T 1 2 1 G G C G C T C C T G G C C T C G C T C C T G G C C G C G C C C C C G G T G G C C C C G G C C G A G G C C C C G C A C C T 1 8 1 G G T G C A G G T G G A C G C G G C C C G C G C G C T G T G G C C C C T G C G G C G C T T C T G G A G G A G C A C A G G 2 4 1 C T T C T G C C C C C C G C T G C C A C A C A G G C A G G C T G A C C A G T A C G T C C T C A G C T G G G A C C A G C A 3 0 1 G C T C A A C C T C G C C T A T G T G G G C G C C G T C C C T C A C C G C G G C A T C A A G C A G G T C C G G A C C C A 3 6 1 C T G G C T G C T G G A G C T T G T C A C C A C C A G G G G G T C C A C T G G A C G G G G C C T G A G C T A C A A C T T 4 2 1 C A C C C A C C T G G A C G G G T A C T T G G A C C T T C T C A G G G A G A A C C A G C T C C T C C C A G G G T T T G A 4 8 1 G C T G A T G G G C A G C G C C T C G G G C C A C T T C A C T G A C T T T G A G G A C A A G C A G C A G G T G T T T G A 5 4 1 G T G G A A G G A C T T G G T C T C C A G C C T G G C C A G G A G A T A C A T C G G T A G G T A C G G A C T G G C G C A 6 0 1 T G T T T C C A A G T G G A A C T T C G A G A C G T G G A A T G A G C C A G A C C A C C A C G A C T T T G A C A A C G T 6 6 1 C T C C A T G A C C A T G C A A G G C T T C C T G A A C T A C T A C G A T G C C T G C T C G G A G G G T C T G C G C G C 7 2 1 C G C C A G C C C C G C C C T G C G G C T G G G A G G C C C C G G C G A C T C C T T C C A C A C C C C A C C G C G A T C 7 8 1 C C C G C T G A G C T G G G G C C T C C T G C G C C A C T G C C A C G A C G G T A C C A A C T T C T T C A C T G G G G A 8 4 1 G G C G G G C G T G C G G C T G G A C T A C A T C T C C C T C C A C A G G A A G G G T G C G C G C A G C T C C A T C T C 9 0 1 C A T C C T G G A G C A G G A G A A G G T C G T C G C G C A G C A G A T C C G G C A G C T C T T C C C C A A G T T C G C 9 6 1 G G A C A C C C C C A T T T A C A A C G A C G A G G C G G A C C C G C T G G T G G G C T G G T C C C T G C C A C A G C C 1 0 2 1 G T G G A G G G C G G A C G T G A C C T A C G C G G C C A T G G T G G T G A A G G T C A T C G C G C A G C A T C A G A A 1 0 8 1 C C T G C T A C T G G C C A A C A C C A C C T C C G C C T T C C C C T A C G C G C T C C T G A G C A A C G A C A A T G C 1 1 4 1 C T T C C T G A G C T A C C A C C C G C A C C C C T T C G C G C A G C G C A C G C T C A C C G C G C G C T T C C A G G T 1 2 0 1 C A A C A A C A C C C G C C C G C C G C A C G T G C A G C T G T T G C G C A A G C C G G T G C T C A C G G C C A T G G G 1 2 6 1 G C T G C T G G C G C T G C T G G A T G A G G A G C A G C T C T G G G C C G A A G T G T C G C A G G C C G G G A C C G T 1 3 2 1 C C T G G A C A G C A A C C A C A C G G T G G G C G T C C T G G C C A G C G C C C A C C G C C C C C A G G G C C C G G C 1 3 8 1 C G A C G C C T G G C G C G C C G C G G T G C T G A T C T A C G C G A G C G A C G A C A C C C G C G C C C A C C C C A A 1 4 4 1 C C G C A G C G T C G C G G T G A C C C T G C G G C T G C G C G G G G T G C C C C C C G G C C C G G G C C T G G T C T A 1 5 0 1 C G T C A C G C G C T A C C T G G A C A A C G G G C T C T G C A G C C C C G A C G G C G A G T G G C G G C G C C T G G G 1 5 6 1 C C G G C C C G T C T T C C C C A C G G C A G A G C A G T T C C G G C G C A T G C G C G C G G C T G A G G A C C C G G T 1 6 2 1 G G C C G C G G C G C C C C G C C C C T T A C C C G C C G G C G G C C G C C T G A C C C T G C G C C C C G C G C T G C G 1 6 8 1 G C T G C C G T C G C T T T T G C T G G T G C A C G T G T G T G C G C G C C C C G A G A A G C C G C C C G G G C A G G T 1 7 4 1 C A C G C G G C T C C G C G C C C T G C C C C T G A C C C A A G G G C A G C T G G T T C T G G T C T G G T C G G A T G A 1 8 0 1 A C A C G T G G G C T C C A A G T G C C T G T G G A C A T A C G A G A T C C A G T T C T C T C A G G A C G G T A A G G C 1 8 6 1 G T A C A C C C C G G T C A G C A G G A A G C C A T C G A C C T T C A A C C T C T T T G T G T T C A G C C C A G A C A C 1 9 2 1 A G G T G C T G T C T C T G G C T C C T A C C G A G T T C G A G C C C T G G A C T A C T G G G C C C G A C C A G G C C C 1 9 8 1 C T T C T C G G A C C C T G T G C C G T A C C T G G A G G T C C C T G T G C C A A G A G G G C C C C C A T C C C C G G G 2 0 4 1 C A A T C C A T G A GCCTGTGCTG AGCCCCAGTG GGTTGCACCT CCACCGGCAG TCAGCGAGCT 2101 GGGGCTGCAC TGTGCCCATG CTGCCCTCCC ATCACCCCCT TTGCAATATA TTTTT F i g u r e 1.4: T h e h u m a n I D U A c D N A The 2155 bp cDNA has an open reading frame, bold, of 1959 bp encoding a polypeptide of 653 amino acids. A signal peptide of 26 amino acids, underlined, is cleaved at the site indicated by the arrow, leaving a mature polypeptide of 627 amino acids. Exon II of IDUA, complementary to the 3'UTR of the SAT-1 cDNA, is shaded. (Grosson et al, 1994), including the presence of the HD gene. Comparison of the cDNA across species shows the canine and human cDNA and protein show 82% homology (Stoltzfus et al, 1992), while the murine cDNA and protein show 78% and 77% homology with the human cDNA and protein, respectively (Scott et ah, 1995). Expression of Idua appears to be limited at numerous points during transcription. 16 The postulated promoter of the human Idua gene has on ly a G C box-type consensus sequences, and no obvious T A T A box , consistent w i t h a housekeeping gene. In human, murine, and canine, intron 11 contains an apparently conserved G C / A G except ion i n the donor splice site, w h i c h is associated w i t h reduced sp l i c ing eff ic iency and gene expression. The over lapping S a t - 1 gene i n human and mouse, and most l i k e l y the canine Idua gene locus, encodes an m R N A transcript complementary to Idua, and this cou ld further regulate Idua expression v i a antisense interactions. Together, these features of the Idua gene contribute to the l o w leve l o f expression observed f rom the Idua gene. W i t h almost 75 distinct mutations already described i n IDUA, the c l i n i c a l spectrum o f MPS I is expla ined i n part by the m y r i a d o f genotypes possible w h i c h combine alleles that m a y encode l o w levels o f I D U A act ivi ty , or , for n u l l alleles, no I D U A at a l l ( H u m a n Gene M u t a t i o n Database). Muta t ions occur throughout the IDUA gene i n c l u d i n g exon II, the exon over lapping w i t h a por t ion o f S A T - 1 3 ' untranslated sequence. These mutations include nonsense, missense, and spl ice site mutations, m ino r deletions, insertions, and complex rearrangements ( reviewed i n Scott e t a l , 1995). E i g h t nonsense mutations have been described, i nc lud ing W 4 0 2 X , one o f the most c o m m o n mutations i n Caucasians, and a l l result i n a total l ack o f I D U A funct ion and are associated w i t h severe phenotypes when found i n homozygos i ty . Interestingly, some nonsense mutations are associated w i t h l o w e r levels o f I D U A m R N A transcripts, as determined b y Nor the rn blot analysis, indica t ing detection and delet ion o f nonsense mutat ion containing transcripts (Scott e t a l , 1992, B a c h e t a l , 1993). Twenty-one missense mutations have been described i n IDUA. Missense mutations are more l i k e l y than nonsense mutations to permit some enzymat ic function, and many missense mutations are associated w i t h m i l d 17 or intermediate phenotypes w h e n found i n homozygos i ty . Three spl ice site mutations have been described i n IDUA, w i t h two o f them result ing i n inc lu s ion o f introns i n the I D U A m R N A . Sp l ice site mutations are associated w i t h both m i l d and severe phenotypes w h e n found i n homozygos i ty . Seven smal l deletions (1 to 12 bp) and s ix smal l insertions (1 to 12 bp) have been described i n the IDUA gene (Bunge et al, 1994, 1995). 30 non pathogenic po lymorph i sms have been detected i n IDUA. Sib l ings car ry ing ident ical M P S I alleles can have s ignif icant ly different c l i n i c a l outcomes, indicat ing modi f ie r genes or the environment can influence disease progress ion ( M c D o w e l l et al., 1993, Scott et al, 1993, N e u f e l d , 1991). T h i s is also seen i n mouse models o f M P S V I I , where the phenotype o f enzyme def ic iency varies w i t h strain i nc lud ing v iab i l i ty , l i fe span, and reproductive success (Casa l and W o l f e , 1998). In humans, a pseudodeficiency IDUA al lele w i t h exceedingly l o w act ivi ty levels has been described w h i c h produces no c l i n i c a l phenotype i n homozygotes for the al lele , but that encodes such a l o w leve l o f I D U A enzymat ic funct ion that homozygotes appear complete ly I D U A deficient i n standard I D U A enzyme assays and heterozygotes appear as M P S I carriers, compl ica t ing b iochemica l screening for carriers ( W h i t l e y et al, 1996). 1.2.6 The Sat-1 gene Discus s ion o f the Sat-1 gene is relevant to this thesis as the overlap reg ion shared by the genes cou ld impact disease or therapy. The genomic architecture o f Sat-1 is s imi la r i n human and mouse, and is shown i n figure 1.3. In both species, Sat-1 spans approximate ly 6 k b and includes 4 exons (Lee et al, 2003, Regeer et al, 2003) . E x o n s I to III are embedded i n intron 2 o f Idua, w h i l e a 141 bp region o f the 3 ' untranslated reg ion o f Sat-1 overlaps the entirety o f Idua exon II. The two genes are encoded o n opposite strands o f D N A and are transcribed i n opposite directions. The Sat-1 gene encodes a 74 k d protein inc lud ing 12 predicted transmembrane domains . Nor the rn blot analysis indicates S A T - 1 is w i d e l y expressed i n human tissues as a 4.4 kb transcript, w i t h placenta showing an addi t ional , presumably alternatively sp l iced transcript o f 6.0 kb . In contrast, S A T - 1 m R N A expression i n mouse is selective w i t h a transcript o f 4.0 kb observed i n l ive r and k idney, and weaker but detectable signals observed i n lung , spleen, and brain. I D U A m R N A expression i n both human and mouse is widespread but at l o w levels (Clarke et ai, unpubl ished data). The function o f the S A T - 1 protein is on ly par t ia l ly characterized. B i s s i g et al., c loned the S A T - 1 c D N A from rat l ive r us ing a functional expression assay designed to identify transporters o f sulfate and characterized S A T - 1 as the p r imary canal icular sulfate transporter (Bisseg et al., 1994). M a r k o v i c h et al., have shown that S A T - 1 is responsible for the majori ty o f sodium-independent sulfate transport i n the k idney ( M a r k o v i c h et al., 1994), and S A T - 1 has been loca l i zed to the basolateral membrane o f the p r o x i m a l tubule by immunohis tochemis t ry ( K a r n i s k i et al., 1998). S A T - 1 is expressed i n bra in and functions as the m a i n transporter o f sulphate, at least i n rat (Lee et al., 1999). N o diseases have been mapped to the human SAT-1 gene. Abnorma l i t i e s i n sulfate transporter genes related to SAT-1 i n humans have been impl ica ted i n 5 diseases resul t ing f rom mutations i n 3 genes, DRA (Congeni ta l Ch lo r ide Diarrhea) ( M o s e l e y et al., 1999), DTDST (Diast rophic Dysp las ia ) (Hastbacka et al., 1996) and PDS (Pendred Syndrome)(Everet t et al., 1997). DTDST encodes a sulfate transporter that is deficient i n an a l l e l i c series o f 3 c l i n i c a l l y dist inct chondrodysplasias; diastrophic dysplasia , atelosteogenesis type II, and achondrogenesis type I B . A l l 3 disorders result f rom deficient sulfation o f cartilage 19 proteoglycans, w h i c h m a y l i m i t b ind ing w i t h , and act ivat ion of, s t imulatory signals c ruc ia l to chondrocyte funct ion and normal skeletal development. Muta t ions i n D R A underl ie Congeni ta l Ch lo r ide def ic iency, a debi l i ta t ing and potent ial ly fatal disease result ing f rom disrupt ion o f co lon chlor ide an ion homeostasis. P D S encodes a sulfate transporter deficient i n Pendred syndrome, a f o r m o f nonsyndromic deafness w i t h associated goiter. These seemingly unrelated disorders share i n c o m m o n mutations i n genes related to SAT-1. T o further understand the funct ion o f SAT-1, the C l a r k e group has generated a mouse l ine w i t h targeted disrupt ion o f the murine S a t - 1 gene (Cla rke , unpubl ished data). Homozygo te S a t - 1 knockouts are v iable and await further characterization. The unusual architecture o f the Sat-1 and Idua genes, and the apparent concomittant expression o f their m R N A transcripts, indicates antisense mediated regulat ion o f the genes may occur as a result o f the complementary 141 bp over lapping region. I f the transcripts f rom the two genes interact, mutations that destabil ize one transcript might lead to changes i n expression o f the other par t ia l ly complementary transcript. F o r example , mutations i n Idua that destabil ize the I D U A transcript might alter S A T - 1 expression, w h i c h c o u l d contribute to the disease phenotype. A n o t h e r consequence o f the Sat-1 and Idua overlap is the potential for al tering S A T - 1 expression by overexpressing complementary I D U A transgenes. T h i s potential for regulat ion o f S A T - 1 expression has been recognized i n efforts to develop a mouse expressing human I D U A , and as w i l l be discussed led to the use o f the human, rather than mur ine , I D U A c D N A . 1.2.7 IDUA protein synthesis and transport to the lysosome Process ing o f I D U A includes translation, post-translational modi f ica t ion , and de l ivery to the lysosome. Transport and processing are important to this d iscuss ion as they p lay a role i n disease but also as these processes are important for the successful therapeutic in t roduct ion o f I D U A . F igure 1.5 depicts transport o f lysosomal enzymes. L y s o s o m a l enzymes, membrane proteins, and proteins destined for secretion, are translated o n endoplasmic re t iculum-bound r ibosomes and include a hydrophobic signal sequence w h i c h , via interaction w i t h a s ignal recogni t ion particle ( S R P ) , mediates translocation o f the deve lop ing hydroph i l i c protein into the l umen o f the endoplasmic re t i cu lum ( E R ) ( G o r l i c h and Rapoport , 1993). The signal peptide is not present i n the mature protein. In the E R the I D U A polypept ide is folded and processed, i nc lud ing the addi t ion o f h igh mannose ol igosaccharides cr i t ica l to targeting the enzyme to the lysosome. Af te r transfer to the c /s-golgi , mannose ol igosaccharides are modi f i ed by the addi t ion o f a mannose-6-phosphate marker by the act ion o f two enzymes. W i t h the addi t ion o f the mannose-6-phosphate residues, I D U A and other proteins targeted for the lysosome are recognized by either o f two mannose-6-phosphate receptors ( M P R s ) . The first o f these M P R s , the ca t ion independent M P R ( C I - M P R ) , mediates transfer o f mannose-6-phosphate conta ining proteins that are either newly synthesized, or produced exogenously and found i n the extracellular environment, to the lysosome. The cat ion dependent M P R ( C D - M P R ) mediates lysosomal transfer o f n e w l y synthesized enzyme on ly and is not i n v o l v e d i n endocytosis o f exogenous proteins. A s w i l l be discussed later, overexpression o f a prote in w i t h the mannose-6-phosophate marker has resulted i n 21 Figure 1.5: Endogenous and exogenous pathways for transport of lysosomal enzymes including IDUA to the lysosomes (1) m R N A trancripts encoding lysosomal enzymes include s ignal sequences direct ing translocation o f the synthesized protein into the l umen o f the rough endoplasmic-re t icu lum ( R E R ) , where (2) post-translational modif icat ions i nc lud ing addi t ion o f h i g h mannose ol igosaccharides occurs. V e s i c u l a r ( V ) de l ivery to the go lg i (G) is f o l l o w e d by (3) phosphoryla t ion o f ol igosaccharides (p), w h i c h mediates b i n d i n g to mannose-6-phosphate receptors ( M P R s ) i n the go lg i . Phosphoryla ted enzymes bound to M P R s are then transported to early endososmes ( E E ) , where (4) ac id p H dissociates the enzyme-receptor c o m p l e x w h i c h is then del ivered to the lysosome ( L ) , comple t ing the endogenous pathway for lysosomal targeting (5). Exogenous ly produced lysosomal enzymes are targeted to lysosomes (6) by w a y o f c e l l surface M P R s , del ivered to the p lasma membrane ( P M ) f rom the E E (7). (8) R e c y c l i n g o f M P R s to the go lg i . N=nucleus , EC=ext race l lu la r space. F igure based o n K o r n f e l d 1987. apparent ove rwhe lming o f the M P R mediated de l ivery o f l y sosomal proteins, result ing i n reduced levels o f other lysosomal proteins i n the lysosome and increased levels o f lysosomal proteins i n the extracellular environment ( A n s o n et al, 1992). Proteins bearing 22 the mannose-6-phosphate marker b i n d M P R s and are directed to early endosome compartments, where under the influence o f l o w p H , the proteins dissociate f rom the receptors. Freed receptors are recyc led to the go lg i for reuse. Proteins destined for the lysosome, i nc lud ing I D U A , are transported i n an endosome l i ke ves ic le that fuses w i t h or becomes a lysosome. 1.3 Therapies for MPS I 1.3.1 Rationale M P S I, and other lysosomal storage disorders, are somewhat unique i n that mul t ip le strategies for therapeutic reconsti tution are possible . The rationale for therapy for the M P S disorders is based o n two observations. Firs t , cross correct ion o f I D U A deficient fibroblasts occurs w i t h co-cul t iva t ion o f fibroblasts f rom patients w i t h other forms o f M P S disorders. The corrective factor has been determined to be the lysosomal enzyme itself, w h i c h can be secreted by one ce l l for uptake and de l ivery to the lysosome o f another, deficient c e l l (Bar ton and Neufe ld , 1971). Th i s means i n contrast w i t h disorders requir ing endogenous product ion o f therapeutic proteins for correct function, I D U A and other l y sosomal enzymes bear ing the M P R phosphate residue can be introduced i n protein form, rather than requi r ing direct gene therapy approaches. Second, patients expressing on ly l o w level I D U A levels , as l o w as 0 .13% o f normal I D U A protein levels , undergo a dramat ica l ly different disease course inc lud ing no significant central nervous system disease and m i l d skeletal disease (Scott et al., 1993). T h i s suggests that the successful in t roduct ion o f even l o w levels o f I D U A act iv i ty c o u l d improve important features o f M P S I currently not fu l ly addressed. F igure 1.6 depicts the routes for de l ivery 23 o f therapeutic enzyme to the lysosome. Transplanted cel ls are a source o f enzyme w i t h bone mar row transplantation ( B M T ) , w h i c h delivers enzyme to diseased lysosomes v i a Figure 1.6: Routes for the introduction of therapeutic IDUA Therapeutic I D U A can be produced by numerous strategies. (1) transplanted tissue, exempl i f i ed by bone m a r r o w transplantation ( B M T ) , and (2) enzyme replacement therapy ( E R T ) , both i n v o l v i n g de l ivery o f exogenously produced enzyme (so l id l ines) to lysosomes v i a c e l l surface M P R s . (3) Gene therapy ( G T ) , requires de l ivery o f agents to the nucleus (dotted l ine) resulting i n endogenously produced enzyme. N=nucleus , R E R = r o u g h endoplasmic re t iculum, G=go lg i , EE=ear ly endosome, L= lysosome , P M = p l a s m a membrane, EC=ext race l lu la r space, MPRs=mannose-6-phosphate receptors. c e l l surface M P R receptors. U s i n g the same route enzyme replacement therapy ( E R T ) can l ikewise p rov ide therapeutic enzyme. Gene therapy ( G T ) differs f rom B M T and E R T as the therapeutic enzyme is produced internally and is targeted to the lysosome v i a both 24 Strategy Target sites Outcome Limitations Species and references Compat ib le Bone B o n e mar row and Reduc t ion i n donors H u m a n marrow bone mar row urinary G A G Pearson, 1986 trans- der ived cel ls excret ion Transplant ion Shapiro et al, plantation i nc lud ing complicatons , 1995 (BMT) widespread cel ls Somat ic engraftment o f the improvement D o g monocyte /macro- L i m i t e d benefit Constantopoulous phage lineage Stabi l iza t ion to central etal, 1989 o f neurologic nervous system compl ica t ions L i m i t e d benefit to skeletal system L i m i t e d benefit D o g Enzyme Plasma , cel ls Reduc t ion i n to central K a k k i s et al., replacement urinary G A G nervous system 1996 therapy excret ion (ERT) L i m i t e d benefit Ca t Somat ic to skeletal K a k k i s et al, improvement system 2001 Stab i l iza t ion Immuno log ic H u m a n o f neurologic response K a k k i s et al, compl ica t ions 2001 u n k n o w n ; D o g Gene N o t yet defined; u n k n o w n del ivery , S h u l l etal, 1996 therapy Somat ic , central expression, Meertens et al, (GT) nervous system, persistence, 2002 and skeletal i m m u n o l o g i c L u t z k o et al., system response 1999 Table 1.2: Strategies for the introduction of therapeutic IDUA 25 the endogenous route and for ne ighbor ing cel ls , the exogenous route. Gene therapy approaches, i nc lud ing ex vivo gene therapy, have suffered f rom poor transduction efficiencies, short-term or s i lenced gene expression in vivo, and the d i f f icul ty o f de l ive r ing therapeutic protein to target cel ls , but have shown some remarkable results i n an imal models o f M P S disorders. As summar ized i n table 1.2, different approaches to therapy offer specif ic therapeutic benefits, however no therapy is complete. A unique therapy m a y be o f benefit to a subset o f MPS I patients w h i c h have premature stop mutations. In this strategy, aminoglycos ides are used that suppress premature nonsense stop mutations. M P S I fibroblasts heterozygous for IDUA stop mutations Q 7 0 X and W 4 0 2 X , c o m m o n IDUA mutations, showed a restoration o f almost 3 % o f normal I D U A act ivi ty levels w h e n treated w i t h gentamicin. Gen t amic in treatment reduced G A G accumula t ion i n M P S I cel ls to a normal leve l for at least 2 days after d i scont inuing treatment, and produced a reduct ion i n lysosomal storage as shown by flourescent mic roscopy ( K e e l i n g e t a l . , 2001). T h i s treatment cou ld have applications for numerous disorders result ing from premature stop mutations but the in vivo effectiveness and tolerance has not yet been shown. 1.3.2 M P S a n i m a l mode l s A n i m a l models o f human disease are useful both i n understanding disease pa thophys io logy as w e l l as assessment o f therapies. Na tu ra l ly occur r ing an imal models for a number o f MPS disorders have been identif ied, i nc lud ing a lpha-L-iduronidase def ic iency ( M P S I) i n cat (Haskins e t a l , 1979) and dog (Shu l l e t a l , 1982), a ry l sulfatase def ic iency ( M P S V I ) i n cat (Jezyk e t a l . , 1977), and beta-glucuronidase def ic iency ( M P S V I I ) i n dog (Haskins e t a l , 1984) and mouse (Bi rkenmeie r e t a l , 1989). E x a m i n a t i o n o f these natural ly-occurr ing models indicates they represent w e l l the disease pathology and course observed i n the corresponding human M P S disorder. In the M P S I cat, a three basepair delet ion leads to the predicted loss o f a single aspartate residue f rom the feline I D U A polypept ide (He e t a l . , 1999). The leve l o f residual I D U A act ivi ty expressed f rom the three basepair delet ion al lele is uncertain, but transient overexpression o f the c D N A inc lud ing the muta t ion produced no detectable I D U A act ivi ty . The phenotype o f M P S I i n the cat includes somatic, neurologica l , and skeletal invo lvement s imi la r to intermediate or severe M P S I i n humans. T h e M P S I dog m o d e l shares w i t h the M P S I cat an intermediate to severe course i n v o l v i n g somatic, neurologic and skeletal systems, and has been used extensively i n the assessment o f treatment protocols for M P S I. Secondary accumulat ions o f GM2, GM3, and gangliosides have been detected i n canine M P S I as observed i n humans. The organizat ion o f the canine Idua gene has been determined and the c D N A has been sequenced. The basis o f I D U A def ic iency i n the M P S I dog has been found to result f rom a G - t o - A transi t ion i n the donor splice site i n intron 1 o f the canine Idua gene, leading to i n c l u s i o n o f in t ron 1 i n the m R N A and the creation o f a premature terminat ion codon at the exon-intron j unc t i on ( M e n o n e t a h , 1992). The M P S I dog is be l ieved to produce no I D U A act ivi ty and m a y further have a cross reactive material ( C R M ) negative status, w h i c h models those severe human M P S I cases w i t h no generation o f immunogen ic protein. T h i s has important impl ica t ions for therapies w h i c h introduce potent ial ly immunogen ic I D U A protein or nucle ic ac id encoding I D U A to patients that have not been exposed to I D U A antigens, and thus the M P S I dog models the challenges encountered i n C R M negative M P S I patients. The most dramatic therapeutic success has been demonstrated i n another M P S mode l , the M P S V I I mouse. A naturally occur r ing mouse mode l o f complete beta-glucuronidase ( G U S ) def ic iency ( M P S V I I , S l y disease) has been identif ied (Bi rkenmeie r et al, 1989). In addi t ion to H S and D S stored i n M P S I, M P S V I I includes accumula t ion o f K S G A G s , and i n humans complete G U S def ic iency results i n a phenotype s imi la r to severe M P S I, w i t h involvement o f somatic, skeletal and, to a lesser extent than M P S I, neurologic impairment . A number o f factors contribute to the u t i l i ty o f the M P S V I I mouse, i n addi t ion to the advantages o f mouse models i n general discussed, i nc lud ing 1) the ava i lab i l i ty o f a genetically wel l -def ined, inbred popula t ion o f M P S V I I carrier and affected mice , 2) the c l i n i c a l , pathologic , and b iochemica l characterization o f M P S V I I mice , 3) ava i lab i l i ty o f recombinant G U S enzyme, 4) a detailed understanding o f the normal enzyme, i nc lud ing structure and important modif icatons relevant to funct ion has been developed, and 5) the generation o f h is tochemical markers to identify in-situ the loca t ion o f functional G U S enzyme. Important nove l f indings have been made w i t h the M P S V I I mouse that m a y apply to the M P S disorders i n general. M P S V I I m ice have defects i n immune function inc lud ing an impai red T - c e l l prol i ferat ion response and decreased antibody product ion after immun iza t i on w i t h foreign antigens ( D a l y et al, 2000). These defects are thought to result f rom the inh ib i t ion o f proteases required for antigen processing by ly sosomal G A G s . Feta l l y sosomal storage i n M P S V I I m ice is evident very early, by 15.5 days o f gestation, and can be detected i n bra in as early as 3 weeks o f age (Casa l and W o l f e , 2000). The phenotype o f M P S V I I is different w h e n the 28 ident ica l mutant allele is expressed i n different mouse strains, i nc lud ing differences i n v igor , fert i l i ty, and longevi ty , indica t ing the importance o f m o d i f y i n g genes (Casal et al, 1998). 1.3.3 Bone Marrow Transplantation for M P S I in humans B o n e mar row transplantation is used as a therapy for M P S and other lysosomal storage disorders w i t h l im i t ed success. B o n e m a r r o w is used as a source o f tissue for transplantation as it undergoes extensive prol i ferat ion, offers l ong term expression stabil i ty, and generates c i rcula t ing effecter cel ls that permeate the entire body. B o n e mar row transplantation carries a h i g h r i sk o f mortal i ty and morb id i ty f rom graft versus host disease and other compl ica t ions . In a group o f 23 M P S patients treated w i t h B M T , a morta l i ty rate o f 3 0 % was observed w h e n H L A - i d e n t i c a l sibs were used as donors and even higher rates occurred w i t h noncompat ible donors (Pearson, 1986). W h i l e effective for the somatic features o f M P S I such as hepatosplenomegaly, corneal c loud ing , and jo in t mob i l i t y , B M T is o f l im i t ed benefit to the neurologic and skeletal compl ica t ions o f M P S I. Skeleta l abnormali t ies do not appear to be reversible, though compl ica t ions can be par t ia l ly prevented i f transplantation occurs very early i n the course o f disease. L i k e w i s e neurologic degeneration m a y be s tabi l ized or par t ia l ly prevented when B M T is performed before significant neurologic dysfunct ion is present (Shapiro et al., 1995). T h i s highl ights the need for early diagnosis and intervention for M P S I. The l im i t ed ava i lab i l i ty o f suitable mar row donors, the mortal i ty associated w i t h the procedure, and the l im i t ed effect on c r i t i ca l neurologic and skeletal features o f M P S I make B M T a less than ideal treatment. 1.3.4 Bone marrow transplantation in M P S animal models B o n e mar row transplantation ( B M T ) o f al logeneic normal mar row into myeloabla ted M P S I dogs has been performed w i t h part ial success (Bre ider et al., 1989, S h u l l et al., 1987, Constantopoulous et al., 1989). B M T decreases urinary excret ion o f G A G s and leads to significant improvement o f somatic tissues i nc lud ing l iver , spleen, and k idney . M o d e s t improvement was noted i n the C N S , where l o w levels o f I D U A act ivi ty were detected after transplantation, p roduc ing a decrease i n bra in G A G levels and decreased neuronal vacula t ion (Shu l l et al., 1987), but considerable C N S pathology persists after B M T . Cornea l opaci ty was largely al leviated by B M T (Contantopoulos et al., 1989), however skeletal disease showed o n l y l im i t ed improvement or was delayed i n progression (Shu l l et al., 1988). T h i s is s imi la r to the l im i t ed benefit obtained w i t h B M T i n humans, where somatic tissues s h o w significant improvement w h i l e C N S and skeletal features o f M P S I remain problemat ic , and conf i rms the u t i l i ty o f the M P S I dog for evaluat ion and refinement o f B M T for human M P S I. S i m i l a r to the f indings f rom B M T i n human and canine M P S I, B M T i n young adult M P S V I I m ic e is o f l imi t ed benefit to the skeletal and C N S manifestations o f M P S V I I (Bi rkenmeie r et al., 1991). The l imi ted success o f B M T is be l ieved to result f rom the presence o f irreversible features o f disease and the c los ing o f w i n d o w s for therapeutic intervention, s t imulat ing the invest igat ion o f therapy earlier i n the course o f murine M P S V I I . B M T i n newborn M P S V I I mice treated w i t h condi t ion ing i r radi t ion showed improvement i n somatic systems as expected f rom previous results but, important ly, significant improvement was shown i n bone growth and structure. N e u r o n a l storage and behavioural abnormali t ies were not affected. W h i l e p romis ing , early B M T was not 30 successful i n correct ing storage i n a l l tissues and the i r radiat ion treatment required for engraftment induced dysplas ia i n brain , bone, and other tissues (Sands et al., 1993, Bastedo et al., 1994). T h i s prompted invest igat ion o f early, n o n tox ic approaches to therapy. Wi thou t precondi t ioning such as mar row ablation, a large dose (10 7 ) o f bone mar row cel ls was introduced by i.v. inject ion to 3 day o l d M P S V I I mice , where it is was hoped they w o u l d engraft result ing i n ch imer ic recipients. Long- te rm mul t i l ineage engraftment was established and posi t ive outcomes inc luded prolonged l i fe , improved bone structure, and generally reduced storage, but no reduct ion i n neuron ly sosoma l storage was observed (Soper et al., 2001). A s described earlier, the fetal environment offers unique advantages for therapy. Transplanat ion o f fetal donor tissue into diseased fetal recipients offers further advantages, as graft versus host disease is l im i t ed because o f both the immune tolerance o f the fetal recipient and the immune incompetence o f the fetal donor ce l ls , and addi t ional ly fetal tissue should contain a higher propor t ion o f stem cel ls than older tissues. Transplantat ion o f a l logenic , transgenic fetal l ive r cel ls overexpressing human G U S enzyme into fetal recipients showed early c l i n i c a l improvement at 2 months o f age but no improvement at 7 months (Casal et al., 2001). L o w engraftment levels were assumed to l i m i t therapeutic benefits, however the non-tox ic , early approach clear ly shows promise. 1.3.5 Cellular transplantation in M P S animal models Spec i f i ca l ly targeting the C N S manifestations o f M P S V I I , transplantation o f neuronal progenitor cel ls into the cerebral ventricles o f newborn mi ce resulted i n l o n g term engraftment and increased G U S act ivi ty i n the C N S and decreased lysosomal storage i n neurons and g l i a (Snyder et ah, 1995), an encouraging result for C N S therapy. 31 Anothe r transplantation approach assessed o n the M P S V I I mouse is the implanta t ion o f neo-organs consis t ing o f normal or overexpressing fibroblasts encapsulated i n a matr ix designed to l i m i t immune destruction o f internal G U S -expressing fibroblasts. Introduction o f microcapsules overexpressing G U S into the peri t ioneal cavi ty o f M P S V I I mice reduced l iver , spleen and general v iscera l storage but fa i led to increase G U S act iv i ty i n the bra in , and appeared to i nvoke an a n t i - G U S antibody response w h i c h l imi t ed G U S leve l (Ross e t a l . , 2000), w h i l e introduct ion o f the microencapsules into the cerebral ventricles reversed loca l bra in storage and resulted i n increased bra in G U S act ivi ty and more no rma l behavior (Ross e t a l . , 2000) . 1.3.6 G e n e t h e r a p y f o r M P S I Gene therapy for human M P S I has not yet been attempted. Chal lenges facing G T approaches include main ta in ing therapeutic levels o f gene expression, de l ivery o f gene constructs to cr i t ica l tissues l ike the bra in and bone, and immune response to nove l proteins or de l ivery agents. The attraction o f gene therapy is the poss ib i l i ty o f a universal treatment, without ongoing infusion. A number o f groups have investigated the early stage o f autologous mar row transplantation w i t h re t rovira l ly transduced patient tissue. Fa i rba i rn e t a l . constructed a retroviral vector w i t h the fu l l length c D N A for I D U A and used it to transduce bone m a r r o w f rom patients w i t h M P S I. T h e y showed successful gene transfer into desired C D 3 4 + cel ls and enzyme expression i n the result ing progeny ce l l s (Fa i rba i rn e t a l . , 1996). The enzyme produced was able to correct the lysosomal distention i n M P S macrophages, conf i rming that the enzyme is functional and local izes to the lysosome b y both the endogenous and exogenous routes as desired. N o human trials us ing this approach have yet been attempted. 32 A n i m a l studies on models o f M P S disorders have shown improvement to cr i t ica l organ systems not addressed i n human therapy. M o s t impressive are the results f rom adeno-associated vi rus , o r A A V , used to d i rec t ly transduce diseased tissue in vivo. M o s t important ly, it remains to be determined what amount o f correct ion o f skeletal and neurologic systems is possible i n M P S I, and h o w to achieve this. Spec i f ica l ly , the cel lu lar targets, and t i m i n g o f introduct ion, c r i t ica l to the successful correct ion o f a l l compl ica t ions o f M P S is not yet k n o w n . 1.3.7 Gene therapy in animal models of M P S disorders The M P S disorders are s ingle gene disorders w i t h obvious , easi ly detectable pathologic involvement and as such are considered good models for gene therapy. The m a i n issues l i m i t i n g improvement o f the C N S and skeletal features o f M P S I after B M T or E R T are be l ieved to relate to l im i t ed del ivery to these tissues and/or the presence o f i rreversible pathology before the introduct ion o f therapy. Ideal ly, therapies w o u l d correct a l l aspects o f M P S I and be w i d e l y avai lable . Gene therapy offers the potential for de l ivery to many c e l l types and w i d e spread avai labi l i ty . N u m e r o u s gene therapies have been assessed o n the M P S I dog (see table 1.3). Di rec t intramuscular inject ion o f p l a smid encoding the a lpha-L-iduronidase c D N A resulted i n no detectable enzyme product ion (Shu l l et al., 1996). A further attempt at muscle der ived I D U A expression used myoblasts g r o w n in vitro f rom musc le biopsies transduced w i t h a retroviral vector conta ining the canine gene under control o f the muscle creatine kinase enhancer. W h i l e transduced myoblasts showed several hundred fo ld overexpression o f I D U A in vitro, enzyme 33 Species Therapy Outcome Reference D o g B o n e mar row transplantation Benef i t to somatic storage Improved m o b i l i t y Con t inued skeletal disease Some I D U A act ivi ty i n bra in Bre ider et al, 1989, S h u l l et a/.,1987, Constantopoulous etal, 1989 D o g E n z y m e replacement therapy. Intravenous infusion o f human recombinant I D U A Benefi t to somatic storage Some I D U A act ivi ty i n bra in N o improvement to cartilage Immune response K a k k i s et al, 1996 D o g A d u l t transfer o f retrovirus transfected myoblasts Immune response N o amel iora t ion o f disease S h u l l etal, 1996 D o g In-utero inject ion o f I D U A encoding retrovirus Short term expression i n mul t ip le tissues N o amel iora t ion o f disease course Meertens L et al, 2002 D o g In-utero transfer o f iduronidase-transduced autologous H S C s Immunotolerance to I D U A protein L o w leve l engraftment N o amel iora t ion o f disease course L u t z k o et al, 1999 Cat E R T Intravenous infus ion o f human recombinant I D U A Reduced lysosomal distention L i m i t e d de l ivery to bra in Immune response K a k k i s et al, 2001 M o u s e E R T Intravenous infusion o f human recombinant I D U A Reduced lysosomal distention Cont inued skeletal disease L i m i t e d de l ivery to bra in C la rke et al, unpubl ished Table 1.3: Therapies for M P S I assessed on M P S I models product ion dec l ined rap id ly f o l l o w i n g reintroduct ion o f the cul tured cel ls i n to M P S I dogs. An t ibod ie s specific to I D U A and in f lammat ion at sites o f myoblas t inject ion were detected (Shu l l et al, 1996). 34 Host immune response l ikewise appears to l i m i t the benefit o f autologous transplantation o f re t rovira l ly transduced hematopoiet ic stem cel ls into nonmyeloabla ted recipients. E v e n w i t h h i g h l eve l transduction and overexpression at 10 to 200 fo ld normal levels i n long-term mar row ce l l cultures, and evidence o f engraftment persis t ing after 2 to 3 years post- infusion, albeit at l o w levels o f 0.01 to 1% i n b l o o d and mar row leukocytes, no I D U A enzyme or transcripts encoding I D U A were detected i n any recipient dog ( L u t z k o et al, 1999a). E x a m i n a t i o n o f immune responses revealed humora l responses to I D U A , and cel lular responses were detected against I D U A transduced, but not control , cel ls ( L u t z k o et al, 1999b). The prenatal environment may be i m m u n o g i c a l l y naive and provide for the in t roduct ion o f therapeutic levels o f enzyme before the format ion irreversible features o f M P S I. T o evaluate H S C gene therapy for canine M P S I i n the pre immune fetal environement, in utero adoptive transfer o f I D U A transduced M P S I L T M C s was performed o n fetal nonmyeoloabla ted M P S I pups. (Lu tzko et al, 1999) A g a i n , on ly l o w leve l (1%) engraftement was observed, and no I D U A act ivi ty or I D U A transcripts were detected i n recipients. A l l recipients d ied o f M P S disease w i t h no evidence o f improvement f rom the therapy, however , i n contrast w i t h post-natal transplanatation, no evidence o f a humora l response against I D U A was detected. The l o w levels o f engraftment observed, coupled w i t h poor maintenance o f p rov i r a l I D U A expression, at present l i m i t the u t i l i ty o f this approach for M P S I. Di rec t injection o f a retrovirus vector into the developing fetus showed successful transduction o f numerous cel ls types, and, w h i l e gene expression and I D U A act ivi ty were detected i n the l iver and k idney o f a deceased pup, I D U A act ivi ty was not detected i n adult tissues o f su rv iv ing pups 35 (Meertens et ah, 2002). Th i s again m a y be the result o f def ic iency i n l ong term expression f rom provi ra l vectors. N o n e o f the gene therapy approaches yet assessed i n a mode l o f M P S I produce significant improvement to a l l tissue systems al though the benefit o f early intervention is clear. Gene therapy approaches have also produced some exc i t ing results i n the M P S V I I mouse. Reversa l o f pre-exis t ing storage i n neurons and g l i a was observed w i t h implanta t ion o f re t roviral ly transduced fibroblasts overexpressing G U S into the neocortex o f adult M P S V I I m ic e (Tay lor et ah, 1997). H o w e v e r , expression o f the transgene was lost w i t h t ime. Stable integration into the host genome and efficient transduction o f non d i v i d i n g cells makes lent ivirus mediated therapy attractive. Intraparenchymal inject ion o f lent ivirus encoding G U S into the brains o f adult M P S V I I mice produced stable c e l l t ransduction and G U S expression over the 16 weeks o f the study, and lead to a marked reduct ion i n lysosomal storage i n neurons, g l i a , and perivascular cel ls distant f rom the site o f inject ion ( B o s c h et ah, 2000). Perhaps the best results o f any approach have come w i t h use o f adeno-associated ( A A V ) virus vectors. A A V vectors can infect n o n d i v i d i n g cel ls and m a y lead to integration into the host genome. A single intravenous inject ion o f A A V car ry ing the human G U S c D N A i n newborn mice resulted i n long-term expression o f G U S , persist ing at least 4 months, i n mul t ip le tissues and a dramatic reduct ion i n ly sosomal storage i n mul t ip le organ systems, i nc lud ing the bra in . A l m o s t complete clearage o f l y sosomal storage was observed i n neurons, g l i a , and meninges ( D a l y et ah, 1999). F o l l o w - u p a year after the single inject ion showed treated mi ce had superior surv iva l rates, bone lengths, and weight than untreated M P S V I I mice ( D a l y et ah, 2001). These p romis ing results 3 6 indicate the neurologic and skeletal features o f M P S disorders can be dramat ica l ly inf luenced w i t h therapy, and highl ights the importance o f early intervention. 1.3.8 Enzyme replacement therapy for human lysosomal disorders E n z y m e replacement therapy ( E R T ) is w e l l established for Gaucher disease type I, where c l i n i c a l trials have shown reversal o f the l iver , spleen, and bone mar row compl ica t ions o f this disorder (Bar ton et al., 1991). The skeletal pathology that may be present i n Gaucher type I showed little improvement w i t h E R T . A s bone mar row transplantation does not appear to s ignif icant ly alter the course o f central nervous system disease observed i n other forms o f Gaucher disease w i t h neurologic involvement (types II and III), E R T is not considered suitable for these forms o f Gaucher disease. Important to the success o f E R T for Gaucher was modi f ica t ion o f the enzyme to target uptake to cr i t ica l cel ls . W i t h Gaucher as a m o d e l system, E R T has been developed for other ly sosomal storage diseases inc lud ing Pompe disease (Reuser et al., 2002) and Fabry disease (Breun ig and Wanner , 2003). Recent ly , c l i n i c a l trials determining the safety and efficacy o f I D U A E R T for M P S I have been performed. Recombinan t I D U A enzyme was used to treat 10 patients w i t h va ry ing severity o f M P S I at a dose o f 125,000 units per k g o f body weight g iven intravenously once week ly for 52 weeks ( K a k k i s et al., 2001). Signif icant improvement was noted inc lud ing decreased hepatosplenomegaly w i t h normal iza t ion o f the size o f the l ive r after 26 weeks i n eight o f the patients. Improved f l ex ib i l i t y and decreases i n urinary G A G were also found. Immune reaction to the enzyme can be problemat ic , and 4 patients had detectable serum antibodies to I D U A . It is clear the b l o o d bra in barrier 37 l imi t s the del ivery o f intravenously injected I D U A to the brain. It is not yet k n o w n what impact l ong term E R T w i l l have o n skeletal compl ica t ions o f M P S I, but i t i s clear that early intervention has a greater impact o n disease progression as found w i t h B M T . E R T has important advantages relative to B M T inc lud ing reduced morta l i ty and morbid i ty , and is not l imi t ed by donor compat ib i l i ty . W i t h improvements i n de l ivery and op t imiza t ion o f therapeutic regimes, E R T m a y become the preferred therapy for M P S I, as it has for non-neurologic forms o f Gaucher disease. 1.3.9 Enzyme replacement in animal models of M P S E n z y m e replacement therapy ( E R T ) was attempted i n canine M P S I i n ant icipat ion o f human trials ( K a k k i s et al., 1996, S h u l l et al., 1994). W h i l e the large size o f the dog makes trials prohibi t ive , human recombinant I D U A was produced i n Chinese hamster ovary cel ls and pur i f ied for intravenous injection. Injected enzyme was found to clear f rom the b l o o d q u i c k l y and was taken up p r imar i l y by the l iver . Dramat ic improvement i n lysosomal storage i n both hepatocytes and Kupf fe r cel ls were noted after a short t r ia l o f 12 days. M P S I dogs treated for 3 months showed normal levels o f I D U A act ivi ty i n l iver and spleen, lower levels i n k idney and lung , and barely detectable (less than 5 % o f normal) levels i n brain, heart valves , and cartilage. Pa thologic f indings mir rored enzyme act ivi ty levels , w i t h improvement i n somatic tissues but no improvement noted i n bra in or heart valves (Shu l l et al, 1994). In a l o n g term, higher dose t r ia l , an M P S I dog was treated for 13 months. W h i l e the bra in showed detectable I D U A act ivi ty , and decreased lysosomal G A G storage, h is to logic improvement o f the bra in was not evident. In addi t ion, no improvement i n cartilage and heart va lve was demonstrated w i t h h igh dose long term E R T ( K a k k i s et al., 1996). Thus E R T shares w i t h 38 B M T l imita t ions i n the therapeutic benefit these options offer to the C N S and skeletal systems, and these l imitat ions are fai thfully revisi ted i n the M P S I dog. A s B M T invo lves replacement o f the recipient 's immune system, immune recogni t ion o f foreign I D U A protein is not an issue w i t h B M T . In both short term and long term E R T trials, complement-act ivat ing antibodies against human I D U A were generated, w h i c h may be associated w i t h immune complex deposi t ion o f therapeutic protein, disease, and reduced therapeutic eff iciency. These m a y be par t ia l ly re l ieved w i t h s l o w infus ion o f enzyme and premedicat ion, as described i n the M P S I dog (Shu l l et al, 1994). E R T has been assessed extensively i n the mouse mode l o f M P S V I I . W h e n performed early as suggested by previous B M T trials, E R T results i n de l ive ry o f detectable G U S act ivi ty to cr i t ica l tissues i nc lud ing bone and bra in and lead to a widespread reduct ion i n storage ( V o g l e r et al, 1996). I f performed before 14 days o f age, E R T produced 3 1 % o f normal G U S act ivi ty i n the bra in and resulted i n reduced neuronal storage ( O ' C o n n o r et al, 1998, V o g l e r et al, 1999). T h i s early w i n d o w for C N S improvement indicates either the immature b l o o d bra in barrier a l lows access o f intravenous proteins, or, storage after this t ime point is i rreversible. T h i s was the first demonstrat ion o f significant impact o n the C N S and skeletal disease for an M P S disorder. 1.3.10 Generation of a murine model of M P S I Gene targeting i n embryonic stem cel ls was used to generate a murine m o d e l for M P S I w i t h complete def ic iency o f I D U A (Idua-I-) w h i c h forms the centerpiece o f this thesis (C la rke et al, 1997). A n interruption type k n o c k out construct was designed to introduce the n e o m y c i n antibiot ic resistance select ion cassette into exon V I o f the murine Idua locus as shown i n F i g 1.7. Care was taken to avo id the Sat-1 gene and its possible A . M u r i n e Idua and Sat-1 genomic organizat ion I ^ ~ 1 5 k b Sat-1 gene III / / I Yf//v///A n i m a. i M IDUA Exons I and II W i l d type I D U A transcript II I I I I I I II l ^ , , III XIV IDUA Exons III to XIV B . Interruption construct 11 k b rmUA* Neo I M - H t i H ii imi un—H II VI XIV C . Targeted locus Sat-1 transcript IDUA exon SAT-1 exon Targeted I D U A transcript tHCEDH-ttti—\ III XIV Figure 1.7: Targeted inactivation of the murine Idua gene T h e Idua and Sat-1 genomic locus. B ) U s i n g an interruption type construct e x o n V I o f Idua was targeted by introduct ion o f a n e o m y c i n select ion cassette. The construct was designed to m i n i m i z e disrupt ion to the adjacent Sat-1 gene, regulatory elements for w h i c h l i k e l y are i n intron 2 o f Idua. C ) The targeted locus after homologous recombina t ion and the in t roduct ion o f N e o . The neo cassette is transcribed i n the orientat ion wri t ten, is d r iven by the mouse phoshoglycerate kinase-1 (Pgk-1) promoter, and includes a po lyadenyla t ion sequence. 4 1 regulatory elements and an interruption construct rather than a delet ion construct was used for I D U A inact ivat ion. A n a l y s i s o f Sat-1 expression by Nor the rn blot analysis indicated S A T - 1 expression was not altered i n Idua -I- mice , w h i l e R T - P C R analysis conf i rmed a complete absence o f I D U A m R N A expression. H o m o z y g o u s Idua -I- mice have no detectable I D U A enzyme ac t iv i ty and have increased ur inary G A G s levels . N o r m a l appearing at bir th , M P S I m ice develop a characteristic phenotype first discernable at 3 weeks o f age and inc lud ing a flattened profi le , th icken ing o f the digits , and coarseness o f the coat as seen i n F i g 1.8. N o obvious growth def ic iency or mortal i ty is seen w i t h i n the first 20 weeks o f l ife, but as discussed i n Chapter 3, M P S I m ice have a shortened l ife span. Skeletal disease i n the M P S I mouse includes anterior f la r ing o f the r ibs and th ickening o f the facial bones as early as 4 weeks o f age. Pa tho log ica l evidence o f disease was found at 4 weeks o f age as l y sosoma l storage observed i n l imi t ed tissues inc lud ing cel ls o f the ret iculoendothel ial system such as Kupf fe r cel ls , splenic s inusoidal l i n i n g cel ls , and g l i a l cel ls . A t 8 weeks o f age, more widespread lysosomal storage is noted i n hepatocytes, chondrocytes, and neurons, as seen i n F i g 1.9. W h i l e Idua -I- mice l ive to adulthood i n contrast w i t h humans w i t h complete def ic iency o f I D U A , the severe skeletal , neurologic , and somatic disease observed i n the Idua -I- m ice is representative o f the severe form o f M P S I or Hur l e r syndrome. Chapter 3 is a study o f the long term pathophysio logy o f I D U A def ic iency i n this murine mode l o f M P S I. The generation o f transgenic models o f therapy for use i n conjunct ion w i t h the Idua -I- mouse strain is the focus o f Chapters 4 and 5. 42 F i g u r e 1.8: C l i n i c a l fea ture o f I d u a -/- m i c e at 12 weeks o f age A : Facial dysmorphic features of Idua -I- mouse (on the right) compared with Idua +/+ mouse (left). Note the shortness to the snout in the Idua -I- mouse with a loss of the fine taper to the face. B : Photograph of the hind paws of the same mice noting the broadness and thickness to the digits of the Idua -I- mouse, right. A s published Clarke et al, 1997. 43 F i g u r e 1.9: E l e c t r o n m i c r o g r a p h s f r o m 8 w e e k o l d I d u a - / - a n d c o n t r o l m ice A , B : L i v e r , magni f ica t ion 4 1 7 5 X . A : Idua +/+ mouse hepatocyte (H) . B : Idua -I- mouse, note vaculated hepatocytes (H) , and vacoulated central Kupf fe r ce l l ( K ) . C , D : S p l e e n , magnif ica t ion 5 4 0 0 X . C : Idua +/+ mouse, s inusoidal ce l l (S). D : Idua -I- mouse, note the h igh ly vacoulated s inusoidal ce l l (S). E , F : Cerebra l cor t ical neuron, magnif ica t ion 9 0 0 0 X . E : Idua +/+ mouse. F : Idua -I- mouse, note the prominent neuronal cytoplasmic vacuola t ion ( N C ) . A l l magnif icat ions are approximate. A s publ ished C la rke et al., 1997. 44 1.4 Thesis objectives and supporting hypotheses Objective: Character izat ion o f the l ong term pathophysio logy o f the M P S I mouse. Hypothesis: I D U A def ic iency i n the mouse w i l l result i n a progressive disease course s imi la r to severe M P S I i n humans. Objective: Generat ion o f a condi t ional transgenic mouse l ine w i t h the potential to express human I D U A . Hypotheses: A b o v e a certain leve l , expression o f the human c D N A encoding I D U A is t ox ic and w i l l produce a unique phenotype, w h i l e l o w leve l transgenic expression o f I D U A w i l l be tolerated i n a normal background. L o w l eve l transgenic expression o f human I D U A w i l l be correct ive for a l l aspects o f mur ine M P S I. 45 C h a p t e r 2: M a t e r i a l s a n d M e t h o d s 2.1 Polymerase chain reaction Primer ID Purpose Primer Sequence 5 prime to 3 prime Product size in basepairs Conditions Neo A PrimerB E S clone and mouse knockout G G A A G A C A A T A G C A G G A T G C T A A G A T G G C T T G T C A C C T G T C T T C A C 1200 58 c anneal 35 cycles HID1F H I D 4 R Human I D U A detection C G C T T C T G G A G G A G C A C A G G C T G G A G A C C A A G T C C T T C C A C T C 340 62 c anneal 35 cycles 2% D M S O HID3F H I D 7 R Human I D U A detection C T G A G C T A C A A C T T C A C C C A C C T G C T C G T C G T T G T A A A T G G G G G T G T C 580 68 c anneal 30 cycles H I D 4 F H I D 6 R Human I D U A detection G A C T T T G A G G A C A A G C A G C A G G T G C T T C C T G T G G A G G G A G A T G T A G T C 370 62 c anneal 35 cycles T a b l e 2.1: P C R p r i m e r s Isolated genomic D N A was used i n P C R reactions. P C R primers used i n this thesis are shown i n table 2 .1 . T y p i c a l condit ions were I m M M g C b , 0.8 u m each pr imer , 0.1 m M d N T P , 0.5 U o f T a q D N A polymerase ( G i b c o B R L ) , and I X P C R buffer i n a f inal vo lume o f 25 to 50 u l . P C R s were ini t iated at 94 C for 2 minutes and then c y c l e d through anneal ing and elongat ion for 30 to 40 cycles as indicated. 2.2 P r e p a r a t i o n o f the h u m a n I D U A c D N A The 2100 basepair sequence enoding the human I D U A c D N A , (a gift f rom D r . John H o p w o o d , W o m e n ' s and C h i l d r e n ' s Hosp i t a l , A d e l a i d e Aus t ra l i a ) , was removed f rom vector backbone w i t h an EcoRI and Hindlll co-digest ion. U s i n g part ial digest ion w i t h TspRl, the native I D U A polyadenyla t ion s ignal was removed. In preparation for l iga t ion into assorted constructs, the EcoRI/Hindlll fragment was K l e n o w blunted. 2.3 Construction of the myeloid-specific transgene constructs. (CD11B-IDUA and CD1 IB-reporter gene) The 6891 bp C D 1 l b . H G H (D736) .gck vector (a gift f rom Frank J i r ik , publ ished in B a c k et al., 1995) was opened at a unique BamHI site for introduct ion of either the human I D U A c D N A or one o f two reporter genes, beta-galactosidase or enhanced green fluorescent protein. The C D 1 l b vector was then blunted and the 5 ' terminal phosphate residues were removed to reduce se l f l iga t ion us ing c a l f a lkal ine phosphatase ( C A I P ) (BPvL). C A F P and residual enzyme were removed i n preparation for l igat ion. F i n a l l y the human I D U A c D N A , or one o f the reporter genes, was blunted and l igated w i t h the vector backbone. The f inal constructs were l inear ized, and m i x e d for pronuclear co-injection. 2.4 Construction of the myeloid-specific transgene constructs with a selection cassette for selection in ES cells. (CD11B-IDUA and CD1 IB-reporter gene) To the C D 1 1 B - I D U A construct described above, a P G K - N E O select ion cassette was added w h i c h a l lows for select ion o f E S clones that have integrated, and are capable of expressing, the transgene construct. The C D 1 IB-reporter gene constructs d i d not have a select ion cassette added and w o u l d be expected to be found i n on ly a subset o f Neo resistant clones after co-integration of the constructs f o l l o w i n g electroporation into E S cel ls . 48 2.5 Construction of a ubiquitous IDUA expressing transgene construct. ( C M V -IDUA) T h e p E G F P - C 2 m a m m a l i a n expression vector (Clontech) was used a source o f a promoter for d r i v i n g h i g h leve l , ubiquitous human I D U A expression, as w e l l as a source o f the enhanced green flourescent protein ( E G F P ) gene. Th i s vector includes a 600 bp human cytomegalovirus ( C M V ) immediate early promoter w h i c h was removed w i t h sequential Asel and Nhel digests. The promoter was then blunted and l igated w i t h a Clal digested and blunted p B S - I D U A vector, p l ac ing the promoter i n front o f the I D U A c D N A . Orienta t ion was checked w i t h restrict ion digestion. The po lyadenyla t ion sequence and terminal non-coding 3 exons o f the human growth hormone gene ( H G H ) was then removed f rom the C D 1 l b parent vector, described earlier, to increase expression levels o f I D U A . Th i s 2.2 kb EcoRI/EcoRI hgh fragment was c loned into an exis t ing EcoRl site. T h i s comple ted the C M V - I D U A por t ion o f the construct. A reporter construct was then isolated f rom p E G F P - C 2 , consis t ing o f the C M V promoter and the E G F P gene as w e l l as a po lyadenyla t ion sequence. Firs t , a Bglll and BamHI digest o n p E G F P - C 2 removed a mul t ip le c lon ing site w h i c h inc luded restrict ion sites that w o u l d make downstream iso la t ion o f the f inal construct diff icul t . Af ter r emova l o f the mul t ip le c lon ing site, the mod i f i ed p E G F P - C 2 was se l f l igated. The C M V - E G F P 1.4 k b fragment wi thout the internal mul t ip le c lon ing site was then isolated us ing an Asel/Mlul d igest ion, blunted, and ligated into the C M V - I D U A vector at an EcoRI site downstream o f the C M V - I D U A fragment. The f inal construct, ca l led C M V - I D U A , was prepared for pronuclear inject ion w i t h anXhol/Bam / / / d i g e s t . 49 2.6 Construction of a ubiquitous IDUA expressing transgene construct with a selection cassette for selection in ES cells. (pFlox-IDUA) F o r select ion i n E S cel ls , the isolated C M V - I D U A construct described above, i nc lud ing the E G F P reporter, was introduced into p F l o x , a parent vector inc lud ing both the n e o m y c i n resistance gene and the thymid ine kinase gene (Mar th , unpublished). The thymid ine kinase gene was not required for this project but this vector contained convenient c l o n i n g sites relative to other n e o m y c i n encoding constructs. 2.7 Construction of a ubiquitous IDUA expressing transgene construct with a selection cassette for selection in ES cells. (pCAGGS-IDUA) A second construct intended to dr ive h igh leve l , ubiquitous human I D U A expression was generated us ing a vector p roven to result i n h igh leve l expression i n transgenic murine l ines, p C A G G s (a gift f rom D r . Jun- ich i M i y a z a k i , publ i shed i n N i w a e t al., 1991). p C A G G s features a p roven ubiqui tous ly strong promoter based o n the ch icken beta-actin promoter as w e l l as the C M V - I E enhancer. Other features o f this vector inc lude the rabbit beta-globin gene polyadenyla t ion sequence for efficient post transcriptional processing, and sp l i c ing to increase expression levels . In order to generate a single construct that encodes both human I D U A as w e l l as a reporter gene, I chose to use an internal r ibosome entry site ( I R E S ) w h i c h a l lows for expression o f two distinct proteins f rom a single R N A transcript. B y phys ica l ly l i n k i n g I D U A and reporter gene expression, cel ls posi t ive for reporter gene expression are l i k e l y to express I D U A . The generation o f p C A G G s - I D U A was intended to express human I D U A and the beta-geo fusion protein encoding n e o m y c i n resistance for selection i n E S cel ls , as w e l l as the reporter gene beta-galactosidase. A vector described earl ier was used w h i c h inc luded the human I D U A c D N A w i t h no polyadenyla t ion site i n a p B S backbone. T h i s vector was digested w i t h Xbal, and a 4.5 kb Xbal/Xbal insert containing an I R E S site and l i nked beta-geo fusion gene were then ligated. Th i s l i nked the I D U A c D N A to the I R E S beta-geo sequences. N e x t , the I D U A - I R E S - b e t a - g e o fragment was isolated w i t h a Sail and part ial NotI digest, and the 6.7 kb fragment was isolated i n preparation for l iga t ion into the parent p C A G G S vector. H o w e v e r for later i so la t ion o f the completed construct, a Sail site had to be introduced into p C A G G s , w h i c h w o u l d a l l o w eventual i so la t ion o f the completed transgenic construct w i t h a single, complete Sail digest ion. A n o l igo was designed w h i c h includes the Sail site and has a f l ank ing Hindlll site, and w h i c h w o u l d i n solu t ion fo rm a duplex that w o u l d a l l o w l iga t ion w i t h Hindlll sites. The sequence for this o l igonucleot ide is 5 ' - A G C T G T C G A C - 3 ' . A f t e r l iga t ion o f the Sail site into Hindlll digested p C A G G s , the ampl i f i ed vector was EcoRI digested to remove an undesired E G F P sequence, and a l inker a l l o w i n g s t i cky l iga t ion w i t h the 6.7 k b I D U A - I R E S - b e t a -geo fragment was engineered. The l inker was generated by p roduc ing two ol igonucleot ides w h i c h , as a duplex, w o u l d have exposed EcoRI s t i cky ends and contain both NotI and Xhol sites. The sequences o f these o l igos are: o l igo #1: 5 ' -A A T T C T C G A G G C G G C C G C - 3 ' , o l igo # 2: 5 ' - A A T T G C G G C C G C C T C G A G - 3 ' . Af ter addi t ion o f the NotI and Xhol sites, the vector was digested w i t h Notl/Xhol, and the Sall/NotI 6.1 kb I D U A - I R E S - b e t a - g e o fragment w o u l d a l l o w s t icky l iga t ion , a s^Tzo /and Sail sites are compatible , however the junc t ion formed is subsequently not recognized by Sail. F i n a l l y , a complete Sail digest ion a l lows for the i so la t ion o f an approximately 9.4 k b transgene construct for electroporation into E S cel ls . 51 2.8 Construction of a conditional Cre regulated transgene construct with a selection cassette for selection in ES cells (pCCALL2-IRES-IDUA) The p C C A L L 2 - I R E S - h A P / c g p l a smid was opened at a unique Xhol site, blunted, and the terminal 5 pr ime phosphate group was removed to l i m i t self- l igat ion. The blunted human I D U A c D N A , w i t h no po lyadenyla t ion s ignal , was l igated w i t h the construct. P l a s m i d clones w i t h the I D U A insert were identif ied by P C R , and orientation o f the I D U A insert was determined by restrict ion analysis . 2.9 Histopathology A n i m a l s were sacrif iced by ce rv ica l d is locat ion and tissues obtained w i t h i n 20 minutes o f death. The cerebrum and cerebel lum o f mutant and control m i ce were r emoved at autopsy and grossly examined and weighed . The cerebrum was sectioned corona l ly and the cerebe l lum hor izonta l ly . Sections were f ixed i n 10% neutral buffered formal in , snap frozen i n l i q u i d ni trogen and f ixed i n 4 % gluteraldehyde. The paraffin embedded sections o f cerebrum and cerebel lum were sectioned at 5 microns , stained w i t h haematoxy l in and eosin ( H & E ) , and per iod ic -ac id sch i f f w i t h diastase ( P A S + diastase). Sections o f the cerebral hemispheres and cerebel lum were h i s to log ica l ly examined by l ight mic roscopy . The h i n d l imbs were disarticulated f rom the hips , cleared o f soft tissue and f ixed overnight i n 10% neutral formal in . The bones were decalc i f ied i n 2 2 % formic ac id for 18 hours and bisected longi tudina l ly . Paraff in embedded sections were then cut at 5 microns and stained w i t h H & E . The growth plate, cor t ical and trabecular bone was examined h i s to log ica l ly w i t h both l ight and po la r i z ing microscopy . 52 2.10 Radiography A n i m a l s were anesthetized w i t h methoxyflurane and X - r a y e d at 200 M A S and 50 K V P at a distance o f 980 m m f rom the source us ing a Genera l E lec t r i c portable X - r a y machine . 2.11 Thin Layer Chromatography of Gangliosides Tota l l i p i d was extracted f rom bra in and part i t ioned w i t h the method o f F o l c h et al., (1957), as mod i f i ed by S u z u k i (1965). B r a i n tissue f rom normal and mutant m ice was weighed and then homogenized for 5 m i n . w i t h 19 v o l . chloroform-methanol (2:1, v /v ) . Af te r f i l trat ion, the residue was extracted w i t h 10 v o l . chloroform-methanol (1:2, v /v) containing 5% H2O. The filtered extracts were combined and ch lo roform was added to give a f inal concentration o f chloroform-methanol o f (2:1, v /v ) . The l ip ids were part i t ioned w i t h the addi t ion o f 0.2 v o l . o f 0 .8% K C l . The upper phase was removed and the lower phase was washed twice . The poo led upper phases were then d i a lyzed i n S p e c t r a / P o r ® tubing (Spectrum M e d i c a l Industries C o . ) for 2 days at 4 °C against several changes o f d i s t i l l ed H2O and then l yoph i l i z ed . The result ing gangliosides were resuspended w i t h 200 u.1 o f chloroform-methanol-water (10:10:3, by vo lume) and chromatographed o n s i l i c a 60 A plates (Whatman Inc.) w i t h ch loroform, methanol 60:40 and 0 . 2 % o c a l c i u m chlor ide for 8 hours. The v o l u m e loaded o n each lane was no rma l i zed for a bra in weight o f 0.3 gms. The gangliosides were v i sua l i zed b y spraying w i t h 2 % resorc inol , f o l l owed by d ry ing at 100 °C for 30 m i n . 53 2.12 Colorimetric Assay of Glycosaminoglycans U r i n a r y g lycosaminog lycan and creatinine excret ion was measured as described by W h i t l e y et al. (1989). U r i n e samples f rom normal and affected mice were col lected and stored at -70 °C unt i l assayed. Heparan sulfate ( S i g m a C h e m i c a l C o m p a n y ) was used to generate a standard curve. U r i n e samples o f 40 u l , d i lu ted 2.5 t imes for normal m ice and 8 t imes for mutant mice , were m i x e d w i t h 500 p i o f 35 u m o l / L D M B reagent, sod ium formate buffer, p H 3.5. A b s o r b a n c y at 535 n m was measured w i t h i n 30 m i n . w i t h a B e c k m a n D U 640 spectrophotometer. U r i n a r y creatinine was measured by the method o f F o l i n us ing creatinine ( S i g m a C h e m i c a l C o m p a n y ) as a standard. 2 u l o f urine was m i x e d w i t h 8 u l o f water fo l lowed by 500ul o f p ic r ic ac id solut ion. Abso rbancy at 535 n m was measured after 20 minutes. Quant i f ica t ion o f g lycosaminog lycan and creatinine i n the urine samples was done by compar ing to the respective standard curves. 2.13 Embryonic stem cell growth and electroporation R l embryo stem cel ls (a gift f rom A . N a g y , M o u n t S ina i Hosp i t a l Research Institute, Toronto) at passage 13 were cul tured o n pr imary embryonic fibroblasts, accord ing to condit ions as described (Wurs t and Joyner, 1993). E S cel ls were g r o w n i n D u l b e c c o ' s modi f i ed Eag le ' s m e d i u m w i t h h igh Glucose (G ibco ) supplemented w i t h 1 5 % fetal c a l f serum (Hyc lone) , 1 m M nonessential amino acids (G ibco ) , 1 m M sod ium pyruvate (G ibco ) , 2 m M L-g lu tamine , 10-6 B-mercaptoethanol ( S i g m a ) , and 1000 U / m l l eukemia inhib i tory factor (G ibco ) . E S and fibroblasts were cul tured at 37 C w i t h 5 % C 0 2 i n air w i t h humidi ty . Elect roporat ion o f E S cel ls (1 X 10 7 ) at passage 14 or 15 was performed i n a B i o - R a d Gene Pulser at 250 V , 500 u F . Immediate ly after electroporation E S cel ls were plated o n gelat in (Sigma) coated plates at h igh di lut ions to promote single 54 co lony development. The next day n e o m y c i n select ion us ing G 4 1 8 ( G i b c o ) at 200 u g / m l was commenced . Af ter 7 to 10 days o f selection ind iv idua l E S colonies were p icked , aggressively t ryps in ized (Gibco) , and transferred to 96 w e l l plates w i t h embryonic fibroblasts for expansion. E S cel ls were g r o w n for 2 to 3 days before passaging, i n v o l v i n g t ryps in iza t ion and transfer to 6 w e l l plates w i t h fibroblasts. E S cel ls were propagated o n fibroblasts un t i l sufficient numbers were attained for screening as desired and freezing. F o r freezing, l og phase growth E S cel ls were t ryps in ized, counted and frozen i n freezing media containing 5 0 % Feta l c a l f serum, 10% D M S O , and 4 0 % E S med ia (described above) at 5 m i l l i o n cel ls per m l i n one m l c ryovia l s . 2.14 Transfection of E S cells with Cre plasmid Transfect ion o f E S clones w i t h Cre encoding p l a s m i d (Joanne F o x , unpublished) was performed to identify clones capable o f C r e recombinat ion and expression o f the human alkal ine phosphatase reporter as w e l l as transgenic I D U A enzyme act ivi ty . E S clones were seeded to achieve l o w density, rap id ly g r o w i n g c lonal rep l ica plates. Transfect ion was carr ied out as described us ing Lipofec tamine ( B R L Cat# 10964-013) i n a 96 w e l l plate format us ing 0.1 ug o f p l a s m i d D N A per w e l l . E S clones were incubated w i t h C r e p l a s m i d for 3 hours, and clones were harvested 3 days later for reporter gene analysis and I D U A enzyme act ivi ty analysis . 2.15 IDUA enzyme assay I D U A act ivi ty was measured us ing a sensitive f luorometr ic assay ( H o p w o o d et al., 1979). Tissues were homogenized i n d is t i l l ed water (25:1 v o l u m e to weight ratio) us ing a motor d r iven pestle i n a ch i l l ed 10 m l glass tube. E n z y m e assays were performed 55 i n buffer consis t ing o f 0.01 % formic ac id , 77 m M N a C I , 7.7 m M sod ium azide, 0.1 % T r i t o n X - 1 0 0 and 25 u M 4-methylumbel l i fe ry l - (a lpha-L- iduronide (S igma) p H 3.5 i n a f inal v o l u m e o f 50 u l . Samples were incubated at 3 7 C for 3-4 h for l iver homogenates and ce l l culture samples, and 16 h for ta i l c l ipp ings . The react ion was stopped w i t h 2 m l o f 1 M g lyc ine N a O H buffer, p H , 10.5. Fluorescence was measured w i t h a Hoeffer Scient i f ic F lorometer (model T K O 100) and expressed i n relat ion to protein mass as determined us ing the L o w r y assay ( L o w r y et al., 1951). A c t i v i t y was expressed as nanomoles o f 4-methyl-umbel l i ferone released per hour. 2.16 Beta-galactosidase staining of E S cells and tissue fragments E S cel ls attached to plates were stained for L a c Z by gentle f ixa t ion w i t h 0 .2% gluteraldehyde i n I X P B S for 5 minutes o n ice. C e l l s were washed three t imes i n wash buffer (2 m M M g C l 2 , 0 . 01% deoxycholate , 0 .02% Non ide t -P40 , 100 m M N a P 0 4 , p H 7.3). C e l l s were then stained i n wash buffer containing 1 m g / m l X - g a l , 6 m M potassium ferrocyanide, and 5 m M potassium ferricyanide. S ta in ing was a l l owed to proceed overnight at 37 C , w i t h staining often apparent w i t h i n minutes to hours. E a r punches or sections o f ta i l were stained for L a c Z by p l ac ing i n 96 w e l l plates. Samples were washed three t imes i n I X P B S , then f ixed for 10 to 30 minutes o n ice i n 0 .2% gluteraldehyde i n I X P B S . Samples were then stained as described above, w i t h s ta ining apparent after 10 minutes. 2.17 Alkaline phosphatase staining of E S cells E S cel ls bound to plates were f ixed i n 2 % formaldehyde, 0 .2% gluteraldehyde, i n I X D u l b e c c o ' s P B S w i t h no C a + or M g 2 + , for 5 to 10 minutes at 4 C . C e l l s were then 56 washed twice w i t h I X P B S at r o o m temperature for 5 minutes each. T h e n 100 u l (for 96 w e l l plate) o f I X P B S was added and plates were placed at 70 C for 30 minutes to inactivate endogenous a lkal ine phosphatase act ivi ty . C e l l s were then washed twice w i t h I X P B S at r o o m temperature. C e l l s were then washed i n a lka l ine phosphatase wash buffer, consis t ing o f 100 m M T r i s - H C I , p H 9.5, 100 m M N a C I , and 10 m M M g C l 2 , for 10 minutes at r o o m temperature. C e l l s were then stained w i t h a lkal ine phosphatase N B T / B C I P stain (100 m M T r i s - H C I , p H 9.5, 100 m M N a C I , 50 m M M g C I 2 , 0 . 0 1 % sod ium deoxycholate , 0 .02% N P - 4 0 , 337 ug /ml N B T (nitroblue te t razol ium salt; Boehr inger M a n n h e i m ) , and 175 ug /ml B C I P (5-bromo-4-ch loro-3- indoly l phosphate, t o l u i d i n i u m salt; Boehr inger M a n n h e i m ) , w e l l m i x e d , for 10 to 30 minutes at r o o m temperature. Stain solut ion was then removed, cel ls washed gently twice w i t h I X P B S , and dehydrated w i t h ethanol. 2.18 Alkaline phosphatase staining ear punches and tissue fragments Tissues were f ixed aggressively to a l l o w penetration o f the a lkal ine phosphatase substrate i n 2 % formaldehyde, 0 .2% gluteraldehyde, 0 .02% N P - 4 0 , and 0 . 0 1 % sod ium deoxycholate , i n I X D u l b e c c o ' s P B S w i t h no Ca+ or M g 2 + , for 5 to 10 minutes at 4 C . Tissues were then washed twice i n I X P B S , then a fresh v o l u m e o f I X P B S sufficient to complete ly cover tissues was added and endogenous a lkal ine phosphatases were heat inactivated at 70 C for 30 minutes. Tissues were again washed tw ice i n I X P B S , then washed i n a lkal ine phosphatase buffer (100 m M T r i s - H C I , p H 9.5, 100 m M N a C I , 10 m M MgCh) for 10 minutes, and stained w i t h B M B i g Purp le a lka l ine phosphatase substrate (Boehr inger M a n n h e i m ) at 4 C for 2 to 36 hours i n the dark. 2.19 D N A I s o l a t i o n D N A was isolated f rom tissue (usually tail) or f rom cel ls us ing the same basic protocol . A suitable vo lume o f lys is solut ion, containing 100 m M T r i s - H C I p H 8.5, 5 m M E D T A , 0 .2% S D S , and 200 m M N a C I , was added to samples. F o r a ta i l sample o f 0.5 c m i n length, 400 u l o f lys is solut ion was used. Fresh proteinase K solut ion was added to a f inal concentrat ion o f 0.2 m g / m l f rom a l O m g / m l proteinase K stock. Samples were then incubated overnight at 56 C . A n organic solvent extraction was then performed us ing a v o l u m e o f ch loroform equal to the vo lume o f the digested sample, samples were m i x e d by invers ion, then incubated at r o o m temperature 5 minutes. Samples were then spun for 5 minutes at 12,000 r p m i n a benchtop microcentr ifuge and the upper aqueous phase conta ining D N A was transferred to a new microcentr ifuge tube. A second cho loroform extraction was performed us ing 400 u l choloroform, samples m i x e d , spun, and the aqueous phase transferred to a fresh tube. The f inal v o l u m e was estimated (usually s l ight ly less than 400 ul) and twice the v o l u m e (approx 800 ul) o f 9 5 % ethanol was added to precipitate the D N A fraction. Samples were m i x e d gently by invers ion and then spun at 12,000 r p m for 10 minutes. D N A pellets were then no rma l ly v i s ib le . The pellet was then washed twice by r emov ing the aqueous phase, adding 400 u l o f 7 0 % ethanol, inver t ing, and sp inning as above for 5 minutes. The ethanol was removed, the pellet was a l l owed to air dry no more than 5 minutes, and then the pellet was brought up i n a suitable v o l u m e o f autoclaved H2O or T r i s - E D T A , p H 7.5, for at least 3 hours to overnight at r o o m temperature or 4 C . D N A concentration was determined by gel electrophoresis against standards o f k n o w n concentrat ion and/or by spectrophotometry. 58 2.20 Transformation BPvL D H 5 - a l p h a E . c o l i cel ls were used for a l l transformations. 50 u l o f thawed cel ls were added to coo led tubes o n ice containing 1 to 5 u l o f p l a smid D N A (or l iga t ion reactions) and m i x e d gently by shaking. C e l l s were incubated o n ice for 30 minutes and then heat shocked at 42 C for 30 seconds. React ions were incubated o n ice for 2 minutes before addi t ion o f 1ml o f L B broth. React ions were then incubated at 37 C at 200 r p m for 1 hour before plat ing on L B plates containing 50ug /ml a m p i c i l l i n w i t h or wi thout X - g a l ( 1 % final) depending i f co lor select ion was appl icable . Plates were then incubated overnight at 37 C and ind iv idua l colonies analyzed for p l a smid content. 2.21 Southern blotting G e n o m i c D N A was isolated as described and digested us ing suitable restr ict ion enzymes. Diges ted D N A fragments were separated i n agarose gels and the D N A was then transferred to H y b o n d - N nucle ic ac id transfer membrane (Amersham) overnight us ing standard transfer solutions (Southern, 1975). Suitable probe D N A was labeled w i t h radioactive a l p h a - 3 2 P - d C T P (Amersham) us ing a random pr imer labe l ing system ( G i b c o B R L ) and pur i f ied us ing a G - 5 0 sephadex co lumn . H y d r i d i z a t i o n was performed at 50 to 65 C i n commerc i a l l y avai lable hybr id iza t ion buffer (Clonetech) . Washed membranes were exposed to K o d a k X - O M A T scientif ic imag ing f i l m at -70 C for periods ranging from h a l f a day to a week. 2.22 Animals A n i m a l s were cared for under the guidelines set up by the Canad ian C o u n c i l on A n i m a l Care . A l l animals used for these studies originated f rom a single founder and 59 were established by brother-sister mat ing. The mi ce were fed P M I Feeds autoclaved rodent diet 5010. Chapter 3: Characterization of the long term pathophysiology of murine M P S I Based on the paper "Murine M P S I: Insights into the pathogenesis of Hurler syndrome" Published in Clinical Genetics, 1998 Volume 53, pages 349-361. Christopher Russell, Glenda Hendson, Gareth Jevon, Tina Matlock, Jessica Y u , Muktak Aklujkar, Kwok-Yu Ng, and Lome A Clarke. 61 3.1 Abstract A murine mode l w h i c h shows complete def ic iency i n a lpha-L-iduronidase act ivi ty has been developed and shows phenotypic features s imi la r to severe M P S I i n humans. Here we report o n the long-term c l i n i c a l , b iochemica l , and pathologica l course o f M P S I i n m ic e w i t h emphasis on the skeletal and central nervous system manifestations o f disease. Af fec ted mice s h o w a progressive c l i n i c a l course w i t h the development o f coarse features, altered growth characteristics and a shortened l ife span. Progressive ly sosomal accumula t ion is seen i n a l l tissues. Skeletal manifestations represent the earliest c l i n i c a l f ind ing i n M P S I m ice w i t h h is to logic analysis o f growth plate and cor t ica l bone reveal ing evidence that significant early pathology is present. A n a l y s i s o f the central nervous system has revealed the nove l f inding o f progressive neuronal loss w i t h i n the cerebel lum. In addi t ion, bra in tissue f rom M P S I m ice show increased levels o f G M 2 and G M 3 gangliosides. T h i s murine mode l c lear ly shows phenotypic and pathologic features w h i c h m i m i c those seen i n severe human M P S I and should be an invaluable too l for the study o f the pathogenesis o f general ized storage disorders. 3.2 Introduction The phenotype o f I D U A def ic iency or M P S I i n humans is represented by a spectrum o f c l i n i c a l severity ranging f rom severely affected ind iv idua ls , i.e. Hur l e r syndrome, to more m i l d l y affected ind iv idua l s i.e. Scheie syndrome. In the severe fo rm, symptoms are recognizable i n toddlers (age 1 to 3 years), c l i n i c a l features progress rapid ly , mental retardation becomes pronounced, and death occurs i n the first decade. The mi lde r fo rm o f the disease is associated w i t h a later onset o f symptoms, s lower 6 2 disease progression, no mental degeneration, and l ife into adulthood. Features o f M P S I c o m m o n to both ends o f the c l i n i c a l spectrum include corneal c loud ing , dysostosis mul t ip lex , jo in t involvement and viscera l storage, however , i n severe M P S I, the onset o f these symptoms occurs earlier and become more pronounced than i n mi lde r forms o f M P S I (Scheie etal., 1962). T h i s c l i n i c a l heterogeneity is reflected b y the many mutations that have been ident i f ied at this locus (Cla rke et al., 1993 and 1994, Scott et al., 1993, 1995). Muta t ions that permit some enzyme act ivi ty , as l o w as 0 .13% o f normal I D U A protein, are associated w i t h a mi lde r phenotype (Scott et al., 1993). T h i s f inding indicates that smal l amounts o f residual act ivi ty , par t icular ly w i t h i n the brain , can s ignif icant ly alter the c l i n i c a l phenotype, thus indica t ing the potential o f gene therapy and enzyme replacement strategies for this group o f disorders. E n z y m e replacement i n the f o r m o f bone mar row transplantation ( B M T ) i n humans w i t h M P S I, has shown that al though v iscera l storage can be s ignif icant ly reduced, there is a lesser effect o n the C N S compl ica t ions o f disease and very li t t le effect o n the skeletal manifestations (Peters et al., 1996, F i e l d et al., 1994). In addi t ion, the response to B M T is related to the age o f the patient at the t ime the procedure is performed (Shapiro et al, 1995). W e prev ious ly reported the generation o f a mur ine strain comple te ly deficient i n iduronidase by targeted disrupt ion o f the murine Idua gene. E a r l y characterizat ion revealed that these mice showed phenotypic , pathologic and b iochemica l features w h i c h resembled severe def ic iency o f I D U A i n human M P S I (Cla rke et al., 1997). T h i s chapter characterizes the long term c l i n i c a l , pa thologica l and b iochemica l features o f this mode l w i t h emphasis o n the development o f C N S and skeletal manifestations o f I D U A 63 deficiency. Together it is hoped this w i l l identify pathways altered i n I D U A def ic iency thereby suggesting targets for therapeutic intervention. A s the I D U A deficient M P S I mouse mode l w i l l be used i n the assessment o f therapies for M P S I, characterization o f the Idua -I- mouse might also provide markers o f disease useful i n therapy trials. 3.3 Results 3.31 Clinical Features A t bir th, I D U A deficient (-/-) mouse pups cannot be discerned f rom controls. B y 4 weeks o f age, male Idua -I- mice beg in to present w i t h a progressive fac ia l phenotype i nc lud ing w i d e set eyes, broadening o f the c ran ium, foreshortening o f the snout, and protruding o f the nasal bridge. The facia l features present earlier i n Idua -I- males than i n Idua -I- females. B y 8 weeks o f age, affected m ice have th ickened digits w i t h paws l ack ing i n detailed r e l i e f pattern as compared w i t h controls. There is s l o w progression i n the degree o f facial dysmorphology w i t h the m ice appearing quite coarse by 16 weeks o f age, w h e n affected mice o f both sexes have facia l coarseness reminiscent o f human patients w i t h Hur l e r ' s syndrome. The progression o f these features is detailed i n figure 3.1. The coats o f affected mice are tattered and th in relative to no rma l mice . Redundancy o f the sk in o f the face and th ickening o f the per ioccular tissues results i n partial closure o f the eyes i n some affected mice . S l i t l amp examinat ion does not reveal evidence o f corneal c loud ing even late i n the progression o f murine I D U A deficiency. W h i l e the eyes o f some Idua -I- m ice become encrusted w i t h mucous , the chronic rhini t is often present i n human M P S I H is not an obvious feature o f murine I D U A deficiency. 3.1A 3.IB F i g u r e 3 .1: P h e n o t y p e o f M P S I m i c e 3.1 A : A g e s f rom left to right; 4, 16, 23, 45 , and 54 weeks. No te the progressive development o f coarse facial features and coarseness to the coat. I B : N o r m a l (left) and M P S I m ic e (right) at 40 weeks o f age. M P S I mice develop severe fo ld ing o f sk in as observed over the entire body o f the M P S I mouse, and w h i c h can obscure v i s ion . G i b b o u s deformity is present i n the M P S I mouse and m o b i l i t y is l imi ted . N o t e loss o f hair is unrelated to I D U A deficiency. 65 Y o u n g affected mice are active and appear capable o f a fu l l range o f movement , al though, w i t h age Idua -I- m ice show a progressive decl ine i n mob i l i t y . B y 40 weeks o f age, Idua -I- m ice do not require anesthesia or restraint dur ing examinat ion , i n marked contrast w i t h controls. M a n y Idua -I- m ice develop gibbous deformity w h i c h is resistant to f l e x i o n dur ing examinat ion under anesthesia or after death. Sub luxa t ion o f the hips is apparent i n some older Idua -I- mice and m a y further l i m i t mob i l i t y . W i t h age, many Idua -I- animals have a severely abnormal gait, w i t h dragging o f the hindquarters dur ing forward locomot ion . 3.32 L i f e s p a n o f M P S I m i c e Figure 3.2 highl ights the l ife span o f Idua -I- animals w i t h i n this co lony . The average age o f death o f affected mice is approximately 48 weeks, w i t h the earliest death occur r ing at 25 weeks o f age. N o affected animals have l i v e d past 85 weeks o f age. A m o n g s t control litter mates approximately 5% die o f natural causes w i t h i n the first 90 weeks, and mice typ ica l ly l ive over 2 years. The immediate causes o f death i n affected mice are not readi ly apparent, however , autopsy has revealed evidence o f congestive heart failure i n some mice . 66 100 90 80 70 60 Male MPS I percent deaths Female MPS I percent deaths I Cumulative Probability of death 50 60 A G E i n t e r v a l ( W K S ) 80 90 F i g u r e 3.2: L i f e s p a n o f affected a n i m a l s The percent o f natural deaths occur r ing per each week ly t ime interval was calculated by d i v i d i n g natural deaths i n that interval by the total number o f natural deaths (total natural deaths M P S I male mice=21, females=16). The cumulat ive probabi l i ty o f death was calculated taking into considerat ion a l l animals that persisted through pr ior t ime intervals, and thus includes i n addi t ion to natural deaths, animals that were sacrif iced as w e l l as animals that were s t i l l a l ive at the t ime o f analysis. A total o f 138 M P S I mice were used i n the ca lcula t ion o f cumulat ive probabi l i ty o f death. 3.33 G r o w t h P r o f i l e s W e e k l y weights were recorded on a l l mice , i nc lud ing those w i t h genotypes M P S I Idua -/-, Idua +/- heterozygotes, and Idua +/+ w i l d type homozygotes , to generate weight curves as an ind ica t ion o f growth. Idua +/- and +/+ were used as controls to generate growth curves o f normal mice . The genetic background o f the Idua -I- and normal mice is a m i x o f C 5 7 W / 6 and C B A strains. F igure 3.3 depicts the growth profiles for both male (a) and female (b) mice w i t h i n the co lony. 67 6 0 T 0 - I 1 1 1 1 1 -0 1 0 2 0 3 0 4 0 5 0 A G E interval (Wks) Figure 3.3A: Growth curves of male Idua -/- mice relative to normals Weigh ts were moni tored as an index o f growth. 10, 50, and 9 0 t h percentile w e e k l y interval growth curves were established for no rma l animals . The median weight o f mutant mice at each t ime interval is plotted against the normal curves. M . A k l u j k a r gathered an imal weights. 68 50 j 40 --|- 30 --3 O ) J 20 --10 --0 -0 F i g u r e 3 . 3 B : G r o w t h cu rves o f female I d u a - / - a n d c o n t r o l m i c e Female Idua -I- mice have a s imi la r pattern o f growth as Idua -I- males. Y o u n g Idua -I-females (3-30 weeks) are consistently heavier than normals . M . A k l u j k a r gathered an imal weights. A total o f 1300 separate weights were used to profi le the growth o f normal mice (757 male , 543 female) and 875 weights were used for the mutant data points (494 males, 381 females). The weights o f control animals are expressed as percentiles for each w e e k l y interval and the weights for the same interval o f mutant animals are expressed as the median (50th percentile). M a l e s and females differ s ignif icant ly i n weight and so are graphed separately; however the general g rowth pattern o f Idua -I- males and females is s imi lar . Large fluctuations i n the control g rowth profi les o f the normal animals reflect 69 the variation in sample size for each interval. Idua -I- mice of both sexes consistently grow at or above the 50th percentile from 8 weeks to approximately 25 weeks of age. However, by 30 weeks growth of the mutant mice appears to plateau, crossing the 50th percentile curve of the normal mice. B y 50 weeks, mutant mice have weights well below the 50th percentile of controls. 3.34 Radiographic Examination Figure 3.4 reveals the radiographic changes discernible at 57 weeks in Idua -I-animals. Figure 3.4: Radiographic examination of Idua -/- and control mice Idua -I- mice on the left, control same sex littermate on the right. Mice are 57 weeks of age. The Idua -I- mouse shows evidence of severe dysostosis multiplex, including widened ribs, vertebral abnormalities, and craniofacial foreshortening and thickening. A t 4 weeks of age, Idua -I- mice show evidence of foreshortening of the premaxillary bones and enlargement of the cranium. The squamosal, zygomatic and malar process 70 appear denser and smaller. While control mice have a pronounced tapering of the vertebrae spanning the length of the pelvis, the vertebrae in this region in MPS I mice are wider and do not taper relative to adjacent vertebrae. Figure 3.5: Skulls of Idua -/- and normal male mice at 70 weeks of age On left, the Idua -I- skull, on right, normal. The Idua -I- skull has a thickened zygomatic arch, frontal bossing, and widened cranium and nasal bones. This difference in vertebral morphology is evident by 4 weeks and persists for the life span of MPS I mice. The proximal tibial metaphysis of young MPS I mice appear to be less ossified as determined by radiodensity, than noted in control animals. With age, general thickening of the diaphysis of long bones becomes evident and widening of the malar processes and zygomatic arch becomes exaggerated. The ribs of affected mice become wider than in controls and flare at their anterior ends similar to the oar shaped ribs seen in human MPS IH. Late in MPS I (57 weeks) there is evidence of thoracic 71 vertebral kyphosis . F igure 3.5 demonstrates the th ickened skul ls o f M P S I mice relative to normal controls. 3.36 Glycosaminoglycan Excretion U r i n a r y g lycosaminog lycan ( G A G ) levels were ana lyzed i n 114 M P S I and 112 control male mice and plotted i n figure 3.6. M P S I males excrete 2 to 3 t imes the total ur inary G A G o f controls at a l l t ime points ranging f rom 3 weeks to 60 weeks . S i m i l a r l y , M P S I female mice excrete 2 to 3 fo ld greater ur inary G A G levels than female controls. Female M P S I m ice excrete approximately 60 to 7 0 % o f the ur inary G A G o f male M P S I mice , a difference also observed between female and male control mice . N o obvious change i n the l eve l o f G A G excret ion is apparent over the assessed t ime course (3 weeks to 60 weeks) i n either M P S I affected mice or control mice , though t racking ind iv idua l m ice (control or M P S I) over t ime revealed that i nd iv idua l animals d i d have wide variat ions i n the excret ion o f total G A G s . 72 S E < 1600 -r 1400 •-1200 •-1000 •-800 •• 600 --400 --200 •-0 --• IDUA •/-n Control males A Values greater than 1500 • • • • «.. <b • flop I D n " • • . • • • • C P 0 • , • • • i • • A A i : • • • • + + 10 15 20 Age in weeks 25 30 35 Figure 3.6: Glycosaminoglycan excretion in male Idua -/- and normal mice Total urinary GAG levels are expressed as a ratio to creatinine excretion. 112 normal and 115 mutant data points are shown. Idua -I- male mice consistently excrete higher levels of urinary GAG than control male mice, with only rare overlaps. M. Aklujkar gathered urine for GAG chemical analysis by J. Yu. 3.37 Gangliosides Figure 3.7 shows a thin-layer chromatogram of gangliosides extracted from the total brain of 4 Idua -I- and 4 control mice. Brain extracts from affected mice contain increased amounts of gangliosides with the mobility of GM2 and GM3 gangliosides. 73 14 weeks 21 weeks 41 weeks F i g u r e 3.7: T h i n l a y e r c h r o m a t o g r a m o f b r a i n l i p i d s L i p i d s were isolated f rom equivalent masses o f bra in tissue f rom control and mutant animals and separated by th in layer chromatography posit ions o f ganglioside standards are l isted. N o t e the increase i n gangliosides w i t h m o b i l i t y o f G M 2 and GM3 i n mutant m ice relative to same aged controls. W h i l e attempts were made to load equal sample vo lumes , not a l l lanes contain equal sample vo lumes . K . Y . N g performed ganglioside chromatography. 3.38 B o n e H i s t o p a t h o l o g y 74 Figure 3.8 shows the histopathologic changes o f the p r o x i m a l t ib ia l g rowth plate at var ious ages. The growth plate at 6 weeks (f ig. 3.8 a, b) is thickened and contains increased numbers o f chondrocytes showing normal resting and proliferat ive zona l organizat ion. The cel ls are swo l l en w i t h increased f ibr i l la ry or vacuolar contents, especia l ly prominent i n the resting zone. The hypertrophic zone, al though hypercel lular , shows disorganizat ion w i t h a haphazard hor izonta l arrangement o f cel ls . M o s t o f the chondrocyte nuc le i i n the zone o f hypertrophy appear degenerate. The j unc t i on between the zone o f p rov i s iona l ca lc i f ica t ion and the p r imary spongiosa appears irregular and disorganized w i t h loss o f the normal h i l l and va l ley pattern. The p r imary ca lc i f ica t ion zone i s also increased i n size. The longi tudina l arrangement o f the p r imary trabecula is abnormal w i t h the trabeculae increased i n number, th ick, and conta ining a marked increase o f cartilage surrounded by w o v e n bone. Osteoblasts appear to be increased i n number, especial ly i n the p r o x i m a l intertrabecular spaces, but do not appear swol len . B l o o d vessels appear normal h i s to logica l ly . The growth plates at 14 and 19 weeks show m u c h more disorganizat ion o f the growth plate stacks w i t h almost complete loss o f the normal co lumnar arrangement o f cel ls . There are irregular p r imary trabecula w i t h scal loped margins and obvious retained cartilage w i t h i n the ossif ied bone. 75 F i g u r e 3.8: P r o x i m a l t i b i a l g r o w t h plates T ib ias were f ixed overnight i n formal in , decalc i f ied, bisected, and embedded i n paraffin for examinat ion. A , B : G r o w t h plates at 6 weeks, control and mutant. C , D : G r o w t h plates at 14 weeks, control and mutant. E , F : G r o w t h plates at 19 weeks, control and mutant. ( H & E staining, or ig ina l mag . 1 0 0 X ) . Resul ts based o n observations f rom 2 mutant and 2 control samples m i n i m u m for each t ime point. Pathology by G . Jevon. 76 F i g u r e 3.9: P o l a r i z e d l i g h t m i c r o s c o p y o f c o r t i c a l bone samples A : C o n t r o l cor t ical bone w i t h lamellar , paral le l organizat ion. B: M P S I cor t ical bone w i t h gross disorganizat ion. ( H & E staining, o r ig ina l mag. 1 0 0 X ) . Pathology by G . Jevon. F igure 3 .9 represents po la r ized l ight mic roscopy o f t ib ia l cor t ical bone at 14 weeks o f age. The po la r ized l ight v iews reveal a loss o f the paral le l order o f the bone matr ix w i t h loss o f the concentric arrangement o f lamellae or haversian system formation. The cortex is th ickened i n affected mice and has a heterogeneous appearance compr ised o f cartilage-staining (purple) material in te rmixed w i t h minera l ized compact bone (pink) i n contrast to the homogenous p ink o f control compact bone. The osteocytes have c lear ly increased cytoplasmic volumes . 3.39 N e u r o p a t h o l o g y Gross examinat ion o f bra in tissue revealed no difference i n the cerebrum or cerebel lum between control and mutant mice . F igure 3.10 represents sections through the cerebel lum reveal ing evidence o f progressive loss o f Purkinje cel ls . Cont ro ls at a l l ages 77 were found to contain w e l l populated Purkinje c e l l layers. In contrast, mutant m i ce had progressive Purkinje ce l l dropout evident as early as 19 weeks. The Purkinje c e l l dropout increased w i t h increase i n age i n the mutant mice w i t h the distance between Purkinje cel ls becoming greater. P A S staining o f the cerebel lum revealed increased P A S posi t ive material i n the Purkinje cel ls o f mutant mice relative to controls. T h i s difference became pronounced w i t h increasing age and was noticeable f rom the age o f 8 weeks . P A S + diastase staining o f the cerebrum revealed increased amounts o f P A S posi t ive material and increased size o f neurons i n the caudate nucleus i n mutant m i ce relative to controls. The amount o f P A S posi t ive material i n the neurons increased w i t h increase i n age and was noticeable f rom the age o f approximate ly 18 weeks. H & E staining o f cerebrum revealed no obvious differences between control and mutant mice . 78 A . B . E. F. F i g u r e 3.10: P A S D s t a i n i n g o f the P u r k i n j e c e l l l a y e r o f c e r e b e l l u m A , B : C o n t r o l and M P S I mice at 6 w k s , respectively. C , D : Con t ro l and M P S I mice at 19 w k s . E , F : Con t ro l and M P S I mice M P S I at 41 wks . ( P A S and diastase staining, or ig ina l mag. 2 5 0 X ) . The region containing Purkinje cells is identif ied i n A and B above w i t h the letter P and an arrow. Results based on observations from 2 mutant and 2 control samples m i n i m u m for each t ime point. Pathology by G . Hendson . 79 3.4 Discussion T h i s chapter describes the long-term c l i n i c a l , b iochemica l , and pathologica l features o f an iduronidase deficient (-/-) mouse strain containing n u l l al leleles o f the Idua gene generated by gene targeting. One objective o f this invest igat ion was the characterization o f murine iduronidase def ic iency relative to human iduronidase def iciency, w h i c h presents as a spectrum o f disease w i t h variable organ system involvement and disease course. Ano the r objective was the use o f the mouse mode l to better characterize the progression o f iduronidase def ic iency i n different organ systems. T h i s might provide a greater understanding o f M P S I symptom development, and generate markers o f disease useful i n therapy assessment. Unexpec ted f indings i n murine iduronidase def ic iency include l ife into adulthood, abnormali t ies i n the bone growth plate and diaphysis at an early age, and progressive Purkinje c e l l loss. A t bir th, iduronidase-deficient mice do not have a c l i n i c a l l y detectable phenotype, s imi la r to a l l forms o f human M P S I. B y four weeks o f age, facia l dysmorphology is detectable, and progressive facial coarseness then develops as a result o f both craniofacia l dysostosis as w e l l as abnormali t ies o f subcutaneous tissues. W e have noted that the c l i n i c a l feature o f craniofacial dysmorph i sm is detectable earlier and is more obvious i n male compared to female mice , but after 16 weeks o f age this gender difference is less apparent. A s the early facia l dysmorphic features l i k e l y relate to craniofacia l dysostosis, these observations m a y indicate that hormona l influences or different G A G catabolic requirements between the sexes m a y modulate the c l i n i c a l features o f facial dysostosis. T h i s sex based difference i n the early c l i n i c a l features o f the Idua -I- mouse has not been reported i n human, canine, or feline forms o f the disease, however the mur ine M P S V I 80 m o d e l shows gender differences w i t h female mice d y i n g relat ively earlier than males (Bi rkenmeie r e t a l . , 1989). R a p i d l y progressive facia l "coarseness" seen i n this murine MPS I m o d e l is i n keeping w i t h severe M P S I, Hur le rs syndrome, i n humans. Y o u n g M P S I mice are robust w i t h no mortal i ty occur r ing unt i l approximate ly 30 weeks o f age. M o s t deaths o f affected mice occur between 50 and 70 weeks o f age w i t h no affected animals l i v i n g more than 85 weeks. M a l e s do not l i ve past 70 weeks w i t h females persis t ing s l ight ly longer but not l i v i n g past 82 weeks. T h i s is i n contrast to the no rma l littermates representative o f the co lony , i n w h i c h on ly 5% have d ied by 90 weeks of age and 9 0 % are s t i l l l i v i n g by 2 years o f age. The normal l ife span for unaffected animals i n this co lony is l i k e l y to be approximately 2.5 to 3 years. Therefore the M P S I m ice have a s ignif icant ly shortened l ife span but do persist to maturity. T h i s is i n contrast to the M P S V I I murine mode l where the average l ife span o f male and female mice is reported to be 24 weeks and 20 weeks respect ively (Bi rkenmeie r e t a l . , 1989). A l t h o u g h the Idua -I- m i c e seem to die at a later poin t i n l i fe than humans w i t h H u r l e r syndrome, they c lear ly have a shortened l ife span. T h i s attenuation i n the phenotype m a y reflect species differences i n rates o f GAG storage i n various tissues, differences i n the secondary effects o f GAG storage or m a y also reflect the lack o f significant environmental exposures experienced by the rodent co lony. Al te rna t ive ly , the delayed mor ta l i ty i n Idua -I- mice relative to M P S I H i n humans m a y indicate that it is the absolute rate o f substrate accumula t ion relative to chronolog ica l t ime rather than relative to l i fe parameters such as sexual maturi ty w h i c h is important. Hur l e r and Scheie syndromes i n humans are differentiated o n the basis o f age o f onset and rate o f progress ion o f disease, w i t h Hur l e r syndrome showing early onset and 81 rapid progression. W e show early onset o f disease and rapid progression i n addi t ion to complex neuropathology i n murine M P S I and, therefore, al though Idua -I- mice l ive to ' adu l thood ' their phenotype resembles more c lose ly that o f severe M P S I i n humans. Persistence to sexual maturi ty is also noted i n the Idua -I- dog and cat natural ly occur r ing models , al though the true l ife span o f the affected animals has not been accurately determined (Shu l l e t a l , 1982, H a s k i n s e t a l , 1979). The severe dysostosis mu l t ip l ex and progressive neuro logica l dysfunct ion that occur i n M P S I constitute the most debi l i ta t ing aspect o f this group o f disorders. Skeleta l manifestations of disease are apparent by 4 weeks of age i n Idua -I- mice , i nc lud ing radiographic evidence o f aberrant bone mode l ing i n the c ran ium, the vertebrae, and the ribs. A s the mice age, progressive skeletal abnormali t ies are noted w i t h the development of kyphos is , w ide oar shaped ribs, shortened and thickened long bones and severe dysostosis o f the facial bones. H i s to log i ca l analysis o f the bone reveals aberrant growth plate development and maturation as w e l l as abnormali t ies o f early cor t ical bone structure. There are s t r ik ing differences i n the extent and degree o f g rowth plate pathology at different developmental t ime points. A t 6 weeks o f age the growth plate is widened w i t h increased area o f the resting, proliferat ive, hypertrophic, and spongiosa zones. T h i s w i d e n i n g appears to be caused not o n l y by increases i n the v o l u m e o f the i nd iv idua l chondrocytes but by increased chondrocyte numbers i n the growth plate stacks. The co lumnar organizat ion o f the g rowth plate is s t i l l apparent al though elongated. The increased area o f the zone o f p rov i s iona l ca lc i f ica t ion and pr imary spongiosa indicate that at this age the growth plate m a y be generating cartilage at an increased rate compared w i t h normal , or has d i f f icul ty degrading the cartilage produced. 82 A t 6 weeks o f age the pr imary spongiosa is increased i n thickness, and there are severe abnormali t ies i n the p r imary ossi f icat ion o f cartilage i n this layer. T h i s is seen as islands o f unossi f ied cartilage persist ing between osteocytes. There appears to be an increase i n v o l u m e o f this part ia l ly ossi f ied material result ing i n the loss o f wel l -def ined nar row trabeculae as is seen i n the control animals at this age. These abnormali t ies i n the young p r o x i m a l t ib ia l g rowth plate of Idua -I- mice suggest pathways i n v o l v i n g the format ion and remodel ing o f cartilage and subsequent oss i f icat ion are altered as a result o f the accumula t ion o f the substrates o f I D U A , namely heparan and dermatan sulfate. The ordered nature o f bone matr ix is c r i t ica l for proper bone growth and integrity. T h i s is w e l l exempl i f i ed i n osteogenesis imperfecta, where mutations o f type II co l lagen result ing i n either structurally abnormal collagens or reduced type II co l lagen product ion have devastating effects o n the strength and shape o f bone (Byers et al., 1995). The early f indings w i t h i n the growth plates o f our mice are contrasted b y the f indings at later ages w h e n the co lumnar organizat ion o f the plate is disrupted and the trabeculae are th in i n compar i son to controls. The abnormalit ies observed i n the growth plate and diaphysis i n older Idua -I- mice are s imi la r to the f indings described i n the cat models o f M P S I and M P S V I , and the mouse models o f M P S V I and M P S V I I (Hask ins et al, 1983, A b r e u et al, 1995, Evers et al, 1996, B i rkenme ie r et al, 1989). Recent ly , a role for dermatan sulfate i n the regulat ion o f elastic fibre assembly has been established, w i t h excessive dermatan sulfate inh ib i t ing the format ion o f mature extracellular elastin (Hinek and W i l s o n , 2000). Furthermore, it was shown that extracellular elastin regulates the prol i ferat ion o f fibroblasts, w i t h excess dermatan sulfate, as occurs w i t h I D U A deficiency, leading to excess fibroblast d i v i s i o n . Together these observations may i n part exp la in abnormali t ies o f the bone and connective tissue observed w i t h I D U A deficiency, and h ighl ight the diverse pathways by w h i c h accumula t ion o f heparan and or dermatan sulfate can influence normal development. E a r l y i n the disease course Purkinje ce l l numbers and morpho logy appear normal i n the Idua -I- mice . O b v i o u s lysosomal accumula t ion is noted w i t h i n the Purkinje cel ls by 8 weeks o f age w i t h evidence o f detectable loss o f Purkinje cel ls by 19 weeks o f age. A l t h o u g h s imi la r degrees o f lysosomal storage w i t h i n cor t ical neurons was detected, obvious neuronal ce l l loss elsewhere w i t h i n the C N S was not readi ly apparent, though detai led c e l l count ing studies have not been undertaken. Despi te the fact that Purkinje c e l l deplet ion is noted, mice showed no obvious evidence o f ataxia. T h i s m a y reflect the presence o f severe skeletal disease w h i c h l imi t s the m o b i l i t y o f the mice . N e u r o n a l c e l l dysmorphology and ce l l loss i nc lud ing Purkinje c e l l loss have been noted i n a mouse m o d e l for another lysosomal storage disorder, aspar tylgycoasminuria ( A G U ) , resul t ing f rom def ic iency o f glycosylasparaginase. A t a young age, mice deficient i n glycosylasparaginase demonstrate many pa thologica l changes observed i n human A G U patients (Kaar t inen et al., 1996). Af ter 10 months o f age, the general condi t ion o f A G U mice deteriorates gradual ly and includes progressive motor ic impairment , impai red bladder function, and early death. Pa tho logica l abnormali t ies were detected i n the central nervous system inc lud ing widespread lysosomal hypertrophy, w i t h especial ly severe neuronal vacoula t ion i n the lateral thalamic nuc le i and deep cerebellar nuc le i . M i c e o f 20 months o f age demonstrated clear neuronal loss i nc lud ing extensive loss o f Purkinje cel ls , and widespread g l ios is . Impaired bladder function was noted i n older mice , and is 84 speculated to be secondary to involvement o f the central nervous system (Ganza lez-G o m e z et al, 1998). In addi t ion to the widespread central nervous system disease i nc lud ing neuronal vacoula t ion , dysmorphology , and c e l l loss observed i n the mouse models o f both M P S I and A G U , adult M P S I mice l ikewise develop impai red bladder function. In the severe fo rm o f human M P S I, developmental delay is usual ly noted by 2 years o f age fo l l owed by progressive deterioration, w i t h patients eventually performing i n the moderate to severely retarded range ( C o l v i l l e and B a x , 1996). The mechanisms and processes leading to mental deterioration i n human M P S I are not w e l l understood, however , progressive morpho log ica l neuronal abnormali t ies i nc lud ing h i l l c o c k enlargements, ectopic dendritogenesis as w e l l as neuronal sclerosis have been reported ( W a l k l e y et al, 1988, Ferrer et al, 1988, Dekaban et al, 1976, Dekaben et al, 1977). W e report here evidence o f secondary accumula t ion o f bra in gangliosides i n murine M P S I. T h i s secondary accumula t ion o f gangliosides has p rev ious ly been noted i n human and canine iduronidase def ic iency as w e l l as other storage disorders unrelated to pr imary defects o f g lycosph ingo l ip id metabol i sm (Constantopoulos and Dekaban 1978, Constantopoulos et al, 1985). The role that ganglioside accumula t ion may p lay i n the pathogenesis o f M P S disorders is u n k n o w n but m a y actual ly be a central one. The murine models for Tay-Sachs and Sandhoff disease have indicated that G M 2 , and l i ke ly other gangliosides, m a y be causal ly related to apoptotic neuronal ce l l death (Huang et al, 1997). In addi t ion, G M 2 has been postulated to underl ie the generation o f ectopic dendrites i n py ramida l neurons i n both Tay-Sachs as w e l l as other general ized lysosomal storage ( W a l k l e y , 1995). 85 Recent ly , a nove l approach for the therapy o f gangliosidoses has been developed w h i c h involves the introduct ion o f specific inhibi tors o f g lycosph ingo l ip id biosynthesis ( N - B u t y l d e o x y n o j i r i m y c i n ) , thereby l i m i t i n g the accumula t ion o f gangliosides by l i m i t i n g their in i t i a l synthesis. T h i s approach has p roven successful i n l i m i t i n g G M 2 accumula t ion i n a murine mode l o f Tay-Sachs disease (Piatt et al, 1997). Wha t role this fo rm o f therapy m a y have i n storage disorders w h i c h result i n secondary accumula t ion o f g lycosph ingo l ip ids remains to be determined. The severe dysostosis mul t ip lex and progressive neurologica l dysfunct ion that occurs i n M P S I constitute the most debi l i ta t ing features o f this group o f disorders, and both features do not respond w e l l to bone mar row transplantation. The l imi t ed response noted for these two tissues l i k e l y reflects the presence o f early irreversible pathology and/or l ack o f de l ivery o f adequate enzyme levels to relevant c e l l types. Purkinje c e l l loss represents an obv ious ly irreversible feature o f disease progression, however our observat ion that Purkinje ce l l loss as w e l l as other neurologica l manifestations o f murine M P S I are delayed relative to skeletal and viscera l manifestations, and are not present unt i l mur ine adulthood, suggests that there m a y exist a post-natal w i n d o w o f opportunity for therapeutic intervention towards prevent ion o f C N S pathology. L o n g term analysis o f genotypica l ly defined M P S I H patients has demonstrated that B M T can stabil ize neuronal degeneration par t icular ly w h e n performed early i n the course o f disease ( H o p w o o d et al., 1993). B M T i n human M P S I results i n transient improvement i n g rowth o f the appendicular skeleton, but has litt le effect o n the l ong term skeletal compl ica t ions o f disease. S i m i l a r l y , enzyme replacement therapy ( E R T ) has not proven effective i n correct ing dysostosis i n the M P S I dog mode l or the M P S V I cat mode l a l though early 86 B M T i n the canine mode l has shown evidence o f m i l d skeletal improvement ( K a k k i s et al., 1995, C r a w l e y et al, 1996, S h u l l et al., 1988). The combina t ion o f early enzyme replacement fo l lowed by B M T i n the M P S V I I mouse mode l has resulted i n a dramatic skeletal response as w e l l as evidence o f effects o n neuronal storage (Sands et al., 1997). T h e presence o f complex skeletal pathology i n Idua -I- mice as young as 6 weeks o f age suggests significant skeletal structural abnormali t ies are present before, and probably contribute to, the severe dysostosis w h i c h becomes apparent later i n l i fe . Irreversible features o f skeletal pa thology m a y inc lude the presence o f aberrant matr ix and/or finite w i n d o w s early i n development for normal bone growth. Al te rna t ive ly , the l imi t ed efficacy o f B M T and E R T m a y be the result o f inadequate de l ivery o f therapeutic enzyme to specif ic , c ruc ia l cel lular targets. Chondrocytes , for example , exist w i t h i n a matr ix that is resistant to transport o f large molecules . In addi t ion, M P S associated accumula t ion o f G A G i n the extracellular space may further impede de l ivery o f corrective agents through, for example , congested cartilage and thickened membranes. Thus early intervention m a y preclude the development o f i r reversible features, and addi t iona l ly m a y have greater access to some cel lu lar targets as G A G accumula t ion has not yet further l im i t ed de l ivery o f corrective agents. Character izat ion o f mur ine M P S I has demonstrated the presence o f early, widespread lysosomal distention, early and severe dysostosis mul t ip lex , excret ion o f excessive g lycosaminoglycans i n urine, a shortened l ife span, and complex neuropathology inc lud ing neuronal and g l i a l ce l l l y sosomal distention, excessive C N S accumula t ion o f gangliosides G M 2 and G M 3 , and progressive Purkinje c e l l loss i n the 87 cerebel lum. T h i s phenotype is consistent w i t h severe M P S I, Hur l e r syndrome, i n a l l respects except that the Idua -I- mouse l ives into adulthood w h i l e Hur l e r syndrome is typi f ied by death i n the first decade. A s ment ioned, the appl ica t ion o f l ife span parameters o f human M P S I for placement i n the spectrum o f M P S I phenotypes m a y not be appl icable to murine M P S I. It is clear that the murine m o d e l o f M P S I is representative o f a l l major features o f Hur l e r syndrome inc lud ing those for w h i c h current therapies are inadequate. The s imilar i t ies i n the c l i n i c a l course seen i n these m i c e to the severe fo rm o f human M P S I indicates that this is l i k e l y to be a very powerfu l m o d e l for the study o f disease pa thophysio logy and therapeutic development. The neuropathology and skeletal pathology noted i n this m o d e l indicates that complex pr imary and secondary factors are l i k e l y to be i n v o l v e d i n the e v o l v i n g c l i n i c a l phenotype. The rodent mode l w i l l thus be invaluable i n determining the importance o f these secondary factors and what role they m a y p lay i n the human disorder. 88 Chapter 4: Pronuclear and embryonic stem cell attempts at generation of murine transgenic lines with ubiquitous or myeloid specific expression of human IDUA 89 4.1. I n t r o d u c t i o n T h i s chapter describes attempts to generate models o f therapy for M P S I. W h i l e many approaches to therapy for M P S I have been attempted, no cure for M P S I exists. One o f the most important f indings relevant to the design o f therapies for M P S is the f inding that co-cul tur ing M P S I cel ls in vitro w i t h cel ls w i t h a related but c l i n i c a l l y dist inguishable disease, M P S II, results i n "cor rec t ion" o f the g lycosaminog lycan accumula t ion (Fratantoni et al, 1968). It was further suggested that the accumulated G A G resulted f rom def ic iency o f specific factors required for G A G degradation, and that these factors most l i k e l y were enzymes (Fratantoni et al., 1969). T h i s demonstrated that the lysosomal accumula t ion o f G A G s cou ld be reversed once established, and suggested the presence o f a transport mechan i sm capable o f in ternal iz ing and de l iver ing exogenously produced enzyme to the lysosome. T h i s is i n contrast w i t h many disorders i n w h i c h correct ive factors must be produced internal ly for proper subcel lular loca l iza t ion and funct ion to occur. A l s o relevant is the observat ion that patients w i t h very smal l amounts o f I D U A act ivi ty undergo a dramat ica l ly mi lde r course o f disease than patients w i t h no detectable enzyme act ivi ty (Scott et al., 1993). Th i s indicates that a smal l increase i n enzyme act ivi ty may have a large impact o n disease progression. F i n a l l y , the progressive nature o f M P S I favors early intervention as some disease symptoms may not respond to therapy introduced later i n the course o f disease. A l l o g e n e i c bone m a r r o w transplantation ( B M T ) has been used extensively w i t h part ial success for M P S I and other l y sosomal storage disorders as a source o f corrective enzyme act ivi ty (Peters et al, 1996, F i e l d e t al, 1994, H o p w o o d et al, 1993). B M T is effective i n no rma l i z ing serum I D U A act ivi ty levels , reducing ur inary excret ion o f 90 glycosaminoglycans , decreasing hepatosplenomegaly, and results i n a general improvement o f somatic features o f M P S I. W h i l e dramat ical ly i m p r o v i n g qual i ty o f l i fe , B M T has less impact o n the neurologica l and skeletal compl ica t ions o f M P S I (Shapiro et al., 1995, F i e l d et al., 1994). E n z y m e replacement therapy ( E R T ) , i n w h i c h patients are infused w i t h pur i f ied protein enzyme, m a y offer an alternative to B M T for M P S I and, i n early l imi t ed trials, appears to improve many c l i n i c a l manifestations o f the disease, but l i ke B M T is be l ieved to have l imi t ed potential for i m p r o v i n g neurologica l and skeletal s y m p t o m development ( K a k k i s et al., 2001 , W r a i t h J E , 2001 , B r o o k s , 2002) . The restricted benefits obtained w i t h E R T and B M T most l i k e l y result f rom insufficient de l ivery o f therapeutic enzyme to cr i t ica l tissues or disease i r revers ib i l i ty . En t ry through the b l o o d bra in barrier requires recogni t ion by a specif ic transporter; none exists for I D U A . T h i s prevents neuro logica l de l ive ry o f I D U A f rom the c i rcula tory system to the central nervous system. Th i s barrier results i n m i n i m a l de l ivery o f enzyme upon systemic infusion i n E R T , and the l im i t ed cel lular interaction that occurs between somatic tissues inc lud ing donor B M T der ived cel ls and the C N S l imi t s benefits f rom macrophage and other ce l l based de l ivery o f I D U A . B o n e and cartilage cel ls are entrapped i n a matr ix w h i c h w o u l d be predicted to phys ica l ly exclude enzyme f rom cel ls w h i c h require enzyme act ivi ty for normal development ( T o r z i l l i et al., 1997). A n addi t ional factor l i m i t i n g organ improvement m a y be the development o f i rreversible compl ica t ions o f M P S I, established before, and nonresponsive to, therapeutic intervention. F o r example, the recent f inding that dermatan sulfate, one o f two G A G s accumulated i n M P S I, inhibi ts the format ion o f elastic fibers, a v i ta l component o f extracellular matr ix and bone, illustrates a potential mechan i sm where matr ix generated 91 dur ing enzyme def ic iency m a y be fundamentally altered such that even after enzyme replacement, normal development is impai red (H inek and W i l s o n , 2000). A s described i n chapter 3, M P S I mic e show alterations i n cor t ica l bone organizat ion and retention o f cartilage i n growth plate spongiosa. The abi l i ty for correct ion o f these pathologica l states is unknown . The purkinje ce l l loss and disorder w e have observed i n adult M P S I m i ce w o u l d also be examples o f irreversible damage. Irreversible symptoms might also arise i f c ruc ia l developmental milestones pass before c r i t i ca l levels o f enzyme act ivi ty are introduced to required tissues. It remains to be determined to what degree the neurologica l and skeletal compl ica t ions o f M P S I can be improved w i t h therapy, and what specif ic ce l lu lar targets result i n improvement i n these c r i t i ca l systems. It is evident that therapy offers the most benefit w h e n performed early i n the progress ion o f M P S I ( H o p w o o d et ah, 1993). E x a m i n a t i o n o f a M P S I - H fetus, gestational age 20 weeks, whose s ib l ing had d ied o f conf i rmed M P S I - H at age 8, revealed intracellular vacoula t ion i n tissues i nc lud ing dermis, mi t ra l va lve , dura mater, l y m p h o i d and haemopoiet ic cel ls , and connect ive tissue, and zebra bodies were detected i n spinal cord , w h i l e no vacoula t ion was detected i n tissues i nc lud ing cerebral cortex, and cerebel lum ( C r o w et ah, 1983). These f indings, and the poss ib i l i ty that some pathologica l features o f M P S I are irreversible once established (Russe l l et ah, 1998), h ighl ight the need for early intervention for M P S I, especial ly severe M P S I. The extension o f this f inding is interest i n in utero therapy, where possible, such as in utero bone mar row transplantion for M P S I (Flake and Zanjani , 1999). T o address the potential o f therapeutic intervention for prevent ion o f M P S I symptom development I have sought to generate two transgenic mouse models . One 92 mode l w o u l d express human I D U A on ly i n a subset o f H S C der ived cel ls , i n a background o f I D U A def ic iency w h e n crossed into the M P S I mouse m o d e l . T h i s genetic m o d e l o f in utero B M T w o u l d a l l o w assessment o f the m a x i m u m benefit o f early B M T directed therapies w h i l e avo id ing the l imitat ions and barriers to phys i ca l B M T transplantation in utero. Secondly , I wanted to generate a mouse l ine that expresses I D U A i n a l l tissues from an early stage o f development. T h i s mouse cou ld be used as a donor source i n transplantation experiments w i t h M P S I mice , and w o u l d determine i f expression o f I D U A dur ing development causes disease. 4.1.1 A model of in utero bone marrow transplantation The m y e l o i d specific C D 1 1 B - I D U A transgenic was designed to determine the therapeutic benefit o f early bone mar row ce l l der ived I D U A expression o n M P S I. Because o f barriers to l i teral in utero transplantation, a genetic approach was employed that w o u l d express I D U A i n a subset o f cel ls der ived f rom mar row cel ls . The C D 1 l b gene encodes the alpha cha in o f the M a c - 1 integrin, w h i c h is preferentially expressed i n m y e l o i d cel ls such as neutrophils , monocytes and macrophages (Shel ley and Arnaout , 1991, H i c k s t e i n et al., 1992). T h i s expression profi le is consistent w i t h the desired expression o f I D U A i n a mode l o f in utero B M T , as most o f the benefit der ived f rom B M T for M P S I is thought to be f rom monocytes and macrophages. A number o f transgenic mice have been generated expressing reporter genes us ing the C D 1 l b promoter. W h i l e a larger 1.7 kb promoter region was shown to dr ive h igh l eve l transgene expression preferentially i n mature monocytes , macrophages, and neutrophils , but not i n m y e l o i d precursors (Dz ienn i s et al., 1995), smaller regions o f the putative C D 1 l b promoter (1.5 kb to 0.1 kb) generated less predictable transgene expression, w i t h 93 significant expression i n lymphocytes or no transgene expression at a l l ( B a c k e t a l . , 1995). Expres s ion w i t h the 1.7 kb promoter reg ion was determined to persist into adul thood at h igh levels . T h i s construct inc luded the distal exons and polyadenyla t ion sequence o f the human growth hormone gene to increase transgene expression. I used this p roven C D 1 l b construct to generate the C D 1 l b - I D U A construct pictured i n figure 4.4. A s the open reading frame o f the human IDUA gene spans approximately 20 ki lobases , I chose to use a c D N A encoding human I D U A , a k i n d gift f rom D r . John H o p w o o d , w h i c h is on ly 2 ki lobases i n length therefore faci l i ta t ing c l o n i n g o f the f inal C D 1 l b - I D U A construct. In addi t ion, this I D U A c D N A has been expressed i n ce l l culture and conf i rmed to encode functional I D U A enzyme act ivi ty (Scott e t a l . , 1991). Constructs were also generated to express either the beta-galactosidase gene or the enhanced green fluorescent gene also f rom the C D 1 l b promoter construct. It was hoped that reporter gene expression w o u l d a l l o w cel ls expressing the transgenes to be identif ied. It should be kept i n m i n d that this proposed mode l w o u l d differ f rom actual i n utero transplantation i n a number o f important ways . The C D 1 l b promoter w o u l d not direct transgene express ion i n l y m p h o i d ce l ls , and thus not a l l c e l l types that express I D U A i n a transplant recipient rece iv ing B M T w o u l d be expressing I D U A i n this transgenic mode l . Ano the r significant difference relates to the t i m i n g and dis t r ibut ion o f cel ls expressing I D U A . The int roduct ion o f I D U A w o u l d occur later i n development w i t h in utero B M T therapy, as donor cel ls must engraft, expand, and co lon ize exis t ing organs whereas the transgenic mode l w o u l d be expected to express I D U A earlier, as mature m y e l o i d cel ls are generated. A s in utero transplantation does not i nvo lve ablat ion o f host 94 tissues, engraftment levels are l o w w i t h a l l recipients hav ing ch imer ic bone marrow. Thus on ly a fraction o f mar row der ived cel ls w o u l d express the therapeutic enzyme, w h i l e the proposed transgenic mode l w o u l d be expected to show expression i n a l l cel ls i n w h i c h the C D 1 l b promoter is functional . F o r example , analysis o f macrophages i n a successfully engrafted patient who had received in utero B M T w o u l d conta in a m i x o f normal (donor) and diseased (recipient) macrophages, w h i l e a l l macrophages i n the transgenic mode l w o u l d be expected to express I D U A . F i n a l l y , the C D 1 l b promoter drives expression at a higher leve l than no rma l ly occurs f rom the I D U A gene promoter, where I D U A expression levels are dif f icul t to detect by standard northern blot analysis, wh i l e the C D 1 l b transcript is readi ly detectable (Scott et al., 1992). T a k e n together these differences suggest the transgenic mode l d r iven by the m y e l o i d specific C D 1 l b promoter w o u l d be l i k e l y to express higher levels o f therapeutic I D U A enzyme than w i t h in utero transplantation o f normal donor cel ls , thus determining the m a x i m u m potential o f the m y e l o i d ce l l lineages as a vehic le for therapy for M P S I. Compl i ca t ions o f M P S I not improved despite h igh l eve l m y e l o i d expression o f I D U A i n this transgenic mode l w o u l d suggest autologous H S C and other hemopoie t ic targeted approaches w i l l not represent a cure for these features o f M P S I. 4.1.2 W i d e s p r e a d h i g h l eve l I D U A expres s ion The generation o f a mouse l ine that expresses h i g h levels o f human I D U A i n a l l tissues was undertaken for two reasons. M o s t important ly, I w i s h e d to develop a strain o f m ice expressing active human I D U A , as w e l l as a reporter gene, for use as a donor strain i n transplantation experiments w i t h M P S I mice . The second objective o f this project was to determine the outcome o f h igh leve l , widespread I D U A expression on development. 95 I D U A is no rma l ly expressed at very l o w levels and the consequences o f abnormal ly h i g h levels o f I D U A act ivi ty are u n k n o w n . Expres s ion o f lysosomal enzymes cou ld disrupt development i n a number o f ways . Transport o f many lysosomal enzymes, i nc lud ing I D U A , to the lysosomal compartment requires receptor mediated recogni t ion o f mannose-6-phosphate residues found on numerous lysosomal proteins ( V o n F i g u r a and H a s i l i k , 1986). Overproduc t ion o f any protein w h i c h is recognized by this receptor m a y disrupt lysosomal transport, and might be expected to result i n insufficient del ivery o f lysosomal enzymes to the lysosome, as w e l l as the presence o f l y sosomal proteins i n inappropriate organelles and the extracellular space. Surpr is ingly , it has been shown that phenotypic correct ion i n M P S I fibroblasts, as assayed in vitro by reduct ion i n the accumula t ion o f 3 5 S - l a b e l e d g lycosaminog lycan , occurs to a greater extent w i t h l o w leve l overexpression o f I D U A than w i t h higher levels o f overexpression. In the same study, a relat ionship was found between the l eve l o f overexpression o f I D U A and the secretion o f other l y sosomal enzymes, also recognized by the mannose-6-phosphate receptor ( M - 6 - P receptor), to the extracellular space, consistent w i t h altered ly sosomal targeting ( A n s o n et al., 1992). T h i s suggests that a threshold leve l for therapeutic expression may exist and that expression above the threshold reduces therapeutic efficacy, ra is ing interesting questions regarding o p t i m u m therapy strategies for M P S I. A number o f transgenic mouse l ines overexpressing ly sosomal enzymes that are recognized b y the M - 6 - P receptor have been reported, w i t h no obvious phenotype ( K y l e et al., 1990, K a s e et al., 1998). T h i s indicates overexpression o f mannose-6-phosphate expressing protein is tolerated. Ano the r mechan i sm by w h i c h overexpression o f I D U A 96 c o u l d affect development is the I D U A mediated cleavage o f substrates not targeted for lysosomal destruction. A s heparan and dermatan sulfate conta ining G A G s have many functions inc lud ing being components o f extracellular matr ix as w e l l as p l a y i n g a role i n receptor-l igand interactions, inappropriate degradation o f these I D U A substrates might be expected to lead to disease. T o generate a mode l w i t h widespread h igh l eve l I D U A expression constructs were engineered inc lud ing reporter cassettes to permit ident if icat ion o f transgene expressing cel ls and organs. 4.1.3 T h e use o f the h u m a n I D U A c D N A T o avo id possible regulatory alteration o f Sat-1 result ing f rom antisense interactions o f the complementary murine Idua and Sat-1 regions, and to determine i f the human form o f I D U A can rescue murine I D U A deficiency, the human rather than mur ine I D U A c D N A was used for expression o f I D U A enzyme. The human I D U A c D N A was p rov ided by John H o p w o o d , W o m e n ' s and C h i l d r e n ' s Hosp i t a l , A d e l a i d e Aus t ra l i a . The human I D U A c D N A is a compact 2155 basepairs l ong and consists p r imar i ly o f open reading frame, as shown i n figure 1.4. The 141 basepair overlap region between exon II o f the human I D U A c D N A and a por t ion o f the 3 ' untranslated reg ion o f Sat-1 is s t i l l par t ia l ly homologous , however , as shown i n F igure 4 .1 , exon II o f the human I D U A c D N A has 26 basepairs o f dispari ty w i t h murine Idua exon II. N o stretch o f perfect h o m o l o g y extends beyond 17 basepairs. It is hoped that the differences between the transgenic human I D U A c D N A , and the endogenous murine Sat-1 gene, w i l l l i m i t alterations to endogenous Sat-1 expression. Transgenic expression o f an antisense m R N A can d i m i n i s h endogenous gene funct ion as demonstrated by a number o f groups (Manshour i , e t a l , 1997, C h e n e t a l , 1997). The human I D U A c D N A is w e l l characterized (Scott e t a l , 1991) and has been used i n many studies. The human I D U A c D N A has been overexpressed i n C H O cel ls ( K a k k i s e t a l , 1993) for E R T trials and X - r a y crystal lography ( K a k k i s e t a l , 1994, U n g e r e t a l , 1994). It has also been used i n retroviral vectors to correct storage i n M P S - 1 fibroblasts as a prelude to gene therapy experiments ( A n s o n e t a l , 1992). E n z y m e replacement trials us ing recombinant human I D U A has been performed i n the canine mode l o f M P S I (Shu l l e t a l , 1994), mouse (Cla rke , unpubl ished results) and humans ( K a k k i s , 2001), w i t h evidence o f therapeutic improvement o f lysosomal G A G accumulat ion. Thus this c D N A is w e l l established and contains a l l elements required for the product ion o f enzymat ica l ly active and proper ly targeted therapeutic human I D U A enzyme. 98 hldua: 1 CCCCCCfJCTGCClCACi^CCAGGCTGACCAGTACGSCCT|AGiTGGGACCAGCAlCT|AA I I I I I | I I I | I • I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I mldua: 1 CCCCCC|CTGCC|CAC|ICCAGGCTGACCAGTACG|CCT|AG|TGGGACCAGCAiCT|AA hldua: 61 CCTlGCCTATGTGGGiGCCGTCCCTCAClGlGGCAT^AGCAGGTCCGGAil'CACTGGCT I • J I I I I I M I I I T I I I • I M I I I I I I fl! I I I I I II mldua: 61 CCT|GCCTACATiGG|GCCGTACCTCAClGlGGCATTGAGCAGGTCCGGAgCACTGGCT hldua: 121 GCTGGAGCTTGTCACCACCAG 141 I I I I I | • I I • I I I mldua: 121 GCTGGATCTCATCAC||CCAG 141 Figure 4.1: Identity between human and murine Idua exon II. In both species, the 141 basepair exon II o f the Idua gene overlaps w i t h a por t ion o f 3 ' untranslated sequence o f the Sat-1 gene. Shaded areas indicate regions o f dispari ty between human and murine Idua sequences, and therefore represent regions o f nonidenti ty between the endogenous murine Sat-1 transcript and expressed human Idua transcripts. A total o f 26 basepairs differ between the respective c D N A s , scattered throughout the 141 basepair overlap region. The largest consecutive reg ion o f identity between the two species is 17 nucleotides long , containing 11/17 (65%) G C content. Thus transgenic expression o f the human I D U A c D N A i n mouse is less l i k e l y to inf luence mur ine S A T - 1 expression as a result o f antisense interactions compared w i t h expression o f the murine I D U A c D N A . Blas t2 f rom N C B I was used to generate this figure. 4.1.4 The generation of transgenic mice Transgenic mice are usual ly generated by pronuclear injection o f fer t i l ized eggs as depicted i n figure 4.2. Injected eggs are implanted into surrogate mothers for de l ivery o f founder mice , w h i c h are then assessed for transgene presence, and express ion pattern. Introduction o f D N A by this route leads to random integration o f usual ly mul t ip le head to ta i l vector copies. W h i l e offering rap id product ion o f founder transgenic mice , this approach has a number o f consequences inc lud ing the inab i l i ty to study transgenes w i t h a 99 Fertilized mouse egg • • L ^ J ^ ^ - v J ^ X N J l / ^ • J ^ . ^ N J ^ ^ v 3.Analyse offspring for the presence of transgenic DNA by P C R or Southern blot Figure 4.2: Pronuclear injection approach to the generation of transgenic mice D N A is injected di rect ly into the pronucleus o f a fer t i l ized mouse egg. In contrast w i t h the E S approach, analysis for transgene presence and expression occurs i n founder m ice rather than at the leve l o f the ce l l . trans-dominant lethal phenotype, and the cost o f p roduc ing many founder mice o f w h i c h a minor i ty conta in the transgene and express the transgene i n a desired pattern. A n alternative approach uses embryonic stem ( E S ) cel ls to generate transgenic mice , depicted i n figure 4.3. T h i s approach involves introduct ion o f D N A into E S cel ls , f o l l o w e d by select ion for unique c lona l populat ions encoding resistance to an antibiotic. T h i s dramat ica l ly enriches for clones that have integrated, and express, construct encoded transgenes, a select ion step not avai lable w i t h the pronuclear approach. 1 .Microinject the transgene construct into the male pronucleus 2.Transfer injected eggs into a surrogate female mouse I 100 1.Introduce transgenic DNA into ES cells 129J ES cells - agouti colored coat ES cells 2.Amplify in antibiotics until individual antibiotic resistant colonies with integrated transgenes appear ~8 days 3.Pick colonies and transfer to 96 well plate 4.Split plate and freeze master 5.Analyze, identify •* desired clone(s) 6.Thaw desired ES clone and generate chimeras 7.Breed chimeras, identify transgenic pups chimera blastocyst injection or aggegration technique, and transfer to surrogate female blk/6 I—I—I I—I—I t, 1. *L 1, %. 1U I 1/4 of the agouti pups should carry transgene Figure 4.3: Embryonic stem cell approach for the generation of transgenic mice The major advantage o f the E S approach is step 5 , hav ing the opportunity to analyze E S clones to identify clones w i t h desired integration events and, where possible , transgene expression. Injection o f desired E S cel ls into blastocysts generates chimeras that may a l l o w for analysis o f otherwise lethal phenotypes, another advantage o f the E S approach. 101 A s E S clones can be ampl i f i ed in vitro, samples can be taken for analysis w h i l e v iable cel ls capable o f germline t ransmiss ion are maintained i n culture or frozen. A n a l y s i s for molecula r characteristics o f transgene integration such as copy number and number o f independent integration sites can be performed, as w e l l as analysis o f transgene expression, i f the promoter o f the transgene is active i n E S cel ls . A further advantage o f the E S approach is the product ion o f chimeras w h i c h include variable amounts o f transgenic E S cel ls and normal blastocyst tissue and m a y a l l o w escape f rom lethal developmental bottlenecks, a l l o w i n g transgene assessment. The L o b e group has used the E S approach to generate reporter m ice capable o f ubiquitous reporter gene expression (Lobe et al., 1999). B y ana lyz ing the expression o f a reporter gene i n E S cel ls , clones were identif ied w i t h superior expression characteristics that were used i n the product ion o f transgenic mice more l i k e l y to have the potential for ubiquitous transgene expression i n adulthood. In attempts to generate both the m y e l o i d specif ic and the ubiquitous I D U A expressing I D U A models described above, pronuclear micro in jec t ion o f D N A transgene constructs, expected to achieve stable ch romosomal integration at levels ranging f rom 10-4 0 % o f the result ing mice , was performed. The absence o f transgene bearing offspring for either construct after repeated micro in jec t ion attempts led to the use o f the embryonic stem c e l l approach to the generation o f transgenic mice . The E S ce l l approach a l lows for select ion o f l ines w i t h rare ch romosomal integration events and, w h e n promoter elements active i n E S cel ls are i n v o l v e d , part ial express ion analysis o f the introduced transgene construct at the leve l o f the E S ce l l , before m ice are generated. T h i s m a y identify E S l ines more l i k e l y to produce desired 102 expression patterns i n adult mice and l ines less l i k e l y to suffer transgene s i lencing . In addi t ion, i n situations where transgene expression results i n embryonic lethali ty, chimeras produced w i t h the E S approach m a y a l l o w deduct ion o f the effects o f transgene expression, whereas micro in jec t ion may fa i l to generate any offspring for analysis . M a l e R l embryonic stem cel ls der ived f rom the agouti 129 J murine strain, p roven to be capable o f germline t ransmission o f genetic alterations, were used throughout this work . H o w e v e r , after successful E S ce l l manipula t ion , defined as demonstration o f transgene integration and, where possible , transgene expression, no germline chimeras ca r ry ing the integrated transgene constructs were generated for either m y e l o i d specific or widespread human I D U A expression. T h i s c o u l d be the result o f chance, or c o u l d result f rom a dominant-negative effect o f transgene expression, i.e. human I D U A . It was then decided to employ the condi t ional I D U A expression approach described i n Chapter 5, w h i c h w o u l d a l l o w for control o f tissue specif ic i ty and the onset o f transgenic I D U A expression. 4.2 Results 4.2.1 Pronuclear injection approach for the generation of myeloid specific, and ubiquitous, IDUA expressing transgenic mice Constructs for m y e l o i d specific transgene expression were designed as s h o w n i n f ig 4.4. 103 CDllb reporter gene hgh introns promoter Figure 4.4 Transgenic construct for myeloid specific expression A . The C D l l b - I D U A construct. The 1.8 ki lobase upstream region o f the C D l l b gene conta ining elements to dr ive m y e l o i d specific expression, f o l l o w e d by the 2.1 k i lobase human I D U A c D N A , w i t h distal noncoding introns o f the human growth hormone gene to increase expression levels . B . Reporter construct. Reporter constructs based o n the same expression pla t form as C D l l b - I D U A were generated w i t h either the beta-galactosidase gene or the enhanced green fluorescent gene. H g h introns are human growth hormone regions that provide sp l i c ing to the transcript. 104 -•Seal | 5 ? M ) int {688 f I , ^ o j j t 1 l f t 1 ? l _Gtai {26) Bgllf ($94)' Pstt. <710) Sac I (10B4) P s t i (1238) GoRI (1483) B.maMEcoRV) mm (1835) Psfl (18411 Smal (1847) Sacl C242S) PsU (25883: flial (2723) F s l i ( 2 7 5 6 ) Sact (4025| Figure 4.5: A map of the backbone C D l l b - h g h vector for myeloid transgene expression A 1.8 kb fragment (bp 1 to 1853) o f the C D 1 l b promoter is f o l l owed by a unique B a m H I restr ict ion site for insert ion o f gene o f interest, f o l l owed by a 2.2 k b genomic region o f human growth hormone gene inc lud ing n o n cod ing exons for sp l i c ing induced transcript stabil i ty. R e m o v a l o f n o n desired sequences b y restr ict ion w i t h X h o I (at pos i t ion 11 bp) and N o t 1 (posi t ion 4007 bp after addi t ion o f human I D U A c D N A . M a p and vector f rom Scott P o w n a l l and Frank J i r ik . 105 F i g u r e 4 . 6 : P l a s m i d c o n t a i n i n g Be ta -ga lac tos idase r e p o r t e r gene A 3.5 kb N o t I /Not I fragment containing the beta-galactosidase reporter was excised for c lon ing into the C D 1 I B construct as shown i n F i g X . P l a s m i d and map f rom Grant M c G r e g o r . food M i l Stel F i g u r e 4.7: T h e p E G F P - C 2 p l a s m i d f o r expres s ion o f enhanced green f lourescent p r o t e i n T h i s vector was used as a source for the C M V promoter (fragment A s e I to N h e I, 600 bp) to dr ive h igh l eve l widespread expression o f the human I D U A c D N A , as a source o f the E G F P reporter for use i n the C D 1 I B construct (fragment N h e I to B s r G I , 720 bp) and as a source for a h i g h l eve l widespread E G F P expressing reporter gene (fragment A s e I to M l u I, 1600 bp). V e c t o r f rom Clon tech . 1 0 6 Pronuclear microinjection of both CD1 l b constructs was performed at the Centre for Molecular Medicine and Therapeutics. Microinjection of 408 fertilized eggs lead to the birth of 18 mice. Samples of these mice were taken and P C R and southern analysis were preformed to identify transgene positive founders, as shown in figure 4.8. F i g u r e 4.8: A n a l y s i s o f 18 samples f r o m c o - m i c r o i n j e c t i o n o f C D l l b - I D U A a n d C D l l b - L a c Z cons t ruc t s A . P C R on D N A extracted from tail. P C R primers specific for the human I D U A gene were used in exon I, HID IF, and on the opposite strand in exon IV, HID4R, which produces a P C R band of 341 basepairs. Lanes 1-18, F l tail samples, lane 19 negative control, lane 20 non transgenic tail sample, lane 21 positive control 1/1000 dilution of human I D U A c D N A (original=0.2 ug/ul). N o transgene positive samples were identified. The band observed in most lanes including the nontransgenic control is a nonspecific amplification product. B . Southern blot analysis of EcoRI/Not I digests of the same 11 samples probed with the human I D U A 2.1 kb c D N A . A 1.6 kb band is expected in transgene positve samples. N o positives were identified. 107 Another round of microinjection was performed with the CD1 l b - I D U A construct and a CD1 l b - E G F P construct. The E G F P reporter gene was chosen as it was considered to have some benefits not shared with the beta-galactosidase reporter gene. Injection of approximately 350 eggs produced 11 mice. Analysis of D N A samples is shown in figure 4.9. "o o £ 8 s s i = o o « 1 2 3 4 5 6 7 8 9 10 1 i r r + + « 8 8 < g g > •341 bp F i g u r e 4 .9: A n a l y s i s o f 11 samples f r o m c o - m i c r o i n j ec t ion o f C D l l b - I D U A a n d C D l l b - E G F P con t ruc t s P C R using human I D U A c D N A specific primers HID IF and H I D 4 R designed to generate a 341 basepair P C R product. N o positives were identified while positive control lanes with diluted human I D U A c D N A plasmid are positive. N o transgene positive founders were identified by either P C R , or Southern blot analysis (data not shown). Simultaneously, I attempted to generate transgenic mice with ubiquitous human I D U A expression. A construct for this purpose is shown in figure 4.10. 108 C M V EGFP hgh CMV Human hgh promoter g e n e introns promoter IDUA introns cDNA Figure 4.10: Ubiquitous Transgene Construct C M V - I D U A T h i s construct uses the C M V I E promoter taken f rom a C lon t ech m a m m a l i a n expression pla t form (figure 4.7) and has been demonstrated to result i n h i g h leve l widespread expression inc lud ing v i r tua l ly a l l m a m m a l i a n c e l l types. B o t h the human I D U A c D N A and the E G F P reporter gene are under the regulat ion o f the C M V I E promoter and both genes i n the construct have distal elements o f the human growth hormone gene to increase expression levels . Pronuclear inject ion o f the isolated construct was performed o n approximate ly 350 eggs, and 12 m i c e were produced. P C R and Southern analysis was performed as shown i n figure 4 .11. 109 B. 1 2 3 4 5 6 7 8 9 10 11 12 — C3 6.4 kb transgene 2.7 kb murine IDUA fragment F i g 4 .11 : A n a l y s i s o f samples f r o m m i c r o i n j e c t i o n o f u b i q u i t o u s I D U A cons t ruc t C M V - I D U A A . Nes ted P C R on 12 samples f rom C M V - I D U A injection. 1st P C R w i t h human I D U A c D N A specif ic pr imers i n exon 3 and 7 fo l lowed by second round o f P C R us ing nested pr imers i n exons 4 and 6. N o posi t ives identif ied. Pos i t ive control sample I D U A c D N A is posi t ive i n both rounds. B . H i n d III digested Southern o f D N A samples expected to produce a band o f 6.4 kb i n transgene posi t ive samples. N o t e band i n a l l lanes i nc lud ing nontransgenic lane w h i c h is a 2.7 k b H i n d III fragment f rom the murine I D U A locus w i t h homology to the human I D U A c D N A probe used and w h i c h represents an internal probe control . N o transgene posi t ive mi ce were identif ied. The cause o f the shift o f the 2.7 k b band i n lane 1 is unknown . A s summar ized i n Table 4 .1 , pronuclear inject ion o f over 1000 eggs w i t h two different constructs produced on ly 41 mice , less than expected. O f these, no transgene posi t ive mice were identif ied. 110 Construct microinjected N u m b e r o f eggs injected N u m b e r o f mice produced Transgene posi t ive Expec ted (10-40%) C D l l b - I D U A C D l l b - L a c Z 408 18 0 1-7 C D l l b - I D U A C D l l b - E G F P - 3 5 0 11 0 1-4 C M V - I D U A C M V - E G F P - 3 5 0 12 0 1-5 Totals : - 1 1 0 0 41 0 4-16 Table 4.1: Summary of Pronuclear Microinjection attempts at generation of transgenic lines Constructs microinjected and result ing mice . N o transgene posi t ive were identif ied. H i s to r i ca l l y , pronuclear micro in jec t ion produces transgene posi t ive offspring i n 10-40% o f offspring, w h i c h w i t h the 41 mice produced here w o u l d be 4-16 posi t ive mice . A n embryonic stem ce l l approach was then used as it was be l ieved possible barriers to transgene posi t ive offspring might be overcome. 4.2.2 Embryonic stem cell approach for the generation of myeloid specific and ubiquitous IDUA expression The E S approach was undertaken after the failure to produce transgene posi t ive offspring by pronuclear microinjec t ion. The C D 1 l b - I D U A construct was c loned into a n e o m y c i n encoding cassette to confer antibiot ic select ion after in t roduct ion into E S cel ls . Co-elect roporat ion o f D N A constructs l a c k i n g select ion cassettes w i t h select ion cassette conta ining constructs has been reported to lead to a h igh l eve l o f co-integration. It was decided not to add a select ion cassette to the C D 1 l b - L a c Z reporter construct but rather to i l l screen E S clones resistant to N e o , and presumed to contain the C D 1 1 B - I D U A construct, for integration o f the L a c Z construct. The C M V - I D U A construct p rev ious ly described and intended for ubiquitous I D U A expression, as w e l l as E G F P reporter expression, was c loned into the F l o x vector shown i n figure 4.12. The F l o x vector was used as it p rov ided convenient c lon ing sites and includes a n e o m y c i n resistance cassette. EGFP SCn bp p a Poly A signa' hIDUA cDNA 2100 bp Poly A signal m Flax sites CMV hgh introns CMV promoter promoter hgh Introns neomycin thymidine resistance kinase cassette cassette Hind i l l EcoHI F i g u r e 4 .12: p F L O X - C M V - I D U A - E G F P A construct designed for ubiqui tous expression o f human I D U A and the E G F P reporter, and a l l o w i n g for n e o m y c i n selection i n E S cel ls . 112 Xmni (5817) Seal (S700) BstXI (3920} Hindttt (3899) a«I (3|B«|) . Smoi immf ' (SccRl/BamHl) (3851) s»ai(38Sif Refer ©123) '•"Fall (37S7) BamHI(3744K P»t! .(438)* H!ncH::|461) CgUl (477)' Flox.gcX {8S«s,'bjs5:; KAHind'MS (39) iSpsI (44) — /stn (50) /•Sacll (52) Mod (67) rfAH.nsJ'.l) (6S1 >P»(I (72) Hlrtclt <7«! Sill {76.._ •Xbal (04) P«if (103) SSul (Z1S) Stul (287) EcoHl (346) Thymidine kinase (Hirt<liri/B#mHI) <SS73)| (Xba1/Xho1) (3664)' Phosphoglycerate kinase gene promoter Neomycin SSpht (3039) <cot (3130) -•EcoRV (783) EcoBV (86?) •! phi '(92b'f pnl (1061) Ss'.l (127S) *£pl (135 teamte)-s(ab-. 4hcl (20*. iCoRV (203: fecoHl (2043) SpW (2888) : 5t»1<2296) ! Stul (2343) Psti (2560); s«V {27471 (Xbo1) (3382) Bell (3393) Figure 4.13: The Flox vector used for ES selection of the ubiquitous IDUA and E G F P expressing construct used previously for pronuclear injection The l o x sites ( • ) are not u t i l i zed i n this construct. T h i s construct was used as a convenient source o f the N e o m y c i n resistance gene, d r iven by the mouse phosphoglycerate kinase gene promoter. V e c t o r f rom Scott P o w n a l l . 113 A second construct intended for ubiquitous I D U A expression, p C A G G s - I D U A , w h i c h was considered l i k e l y to generate higher levels o f transgene expression than the p F l o x - C M V - I D U A - E G F P construct, was designed as shown i n f ig 4.14. CMV IE beta-actin enhancer promoter human IDUA cDNA IRES beta-geo LacZ neor poly A signal Figure 4.14: Ubiquitous Transgene Construct pCAGGs-IDUA p C A G G s - I D U A based o n the p C A G G s h igh l eve l m a m m a l i a n expression vector. The C M V immediate early enhancer element is used w i t h the ch icken beta-actin promoter to direct expression o f the human I D U A c D N A . A n internal r ibososme entry site ( I R E S ) a l lows for expression o f a downstream beta-geo fusion gene encoding the beta galactosidase reporter and n e o m y c i n resistance genes. A consensus po lyadenyla t ion s ignal completes the construct. The p C A G G s vector (figure 4.15) ( N i w a et al., 1991) was chosen as it has been shown to dr ive h i g h l eve l expression i n eukaryot ic cel ls . In addi t ion, as this vector drives express ion i n E S cel ls , rep l ica plates o f E S cel ls c o u l d be analyzed for reporter gene express ion ( L a c Z ) as w e l l as I D U A enzyme act ivi ty. 114 F i g u r e 4 .15: p C A G G s v e c t o r f o r h i g h l eve l e u k a r y o t i c exp re s s ion The pictured vector is p C A G G s w i t h the addi t ion o f the E G F P reporter gene. p C A G G s features a p roven ubiqui tous ly strong promoter based o n the ch i cken beta-actin promoter demonstrated to dr ive expression i n a w i d e variety o f cel ls , as w e l l as the C M V - I E enhancer. Other features o f this vector inc lude the rabbit beta-globin gene polyadenyla t ion sequence for efficient post t ranscript ional processing. V e c t o r and map f rom D r . Jun- ich i M i y a z a k i . ( N i w a et al., 1991). 115 F i g u r e 4.16: T h e p G T 1 . 8 I r e s B g e o v e c t o r The p G T 1 . 8 I r e s B g e o p l a s m i d features the beta-geo fusion gene for expression o f n e o m y c i n resistance and beta-galactosidase, and an upstream I R E S (internal r ibosome entry sequence). The 4.5 k b X b a I / X b a I fragment conta ining the I R E S sequence and beta-geo was removed for addi t ion to p C A G G s . Transgenes c loned upstream o f the I R E S are expressed a long w i t h beta-geo as a dic is t ronic single transcript. V e c t o r f rom Scott P o w n a l l (Moun t fo rd et al, 1994). 4.2.3 E S l ines genera ted The C D 1 l b - I D U A transgene construct was successfully introduced into E S cel ls and independent clones were generated after growth i n selective media . In order to 116 identify clones w i t h co-integration o f the C D 1 l b - L a c Z , w h i c h does not include a selection cassette, Southern blot analysis was performed as shown i n figure 4.17. 7 o f 14 E S clones that had surv ived antibiot ic select ion and therefore had integrated the C D 1 l b -I D U A - N e o construct were found to have integrated the C D 1 l b - L a c Z reporter construct. F i g u r e 4 .17: C D l l b - L a c Z r e p o r t e r cons t ruc t in tegrates in to E S clones after co-e l e c t r o p o r a t i o n w i t h the C D l l b - I D U A - N e o cons t ruc t E c o R I Southern blot probed w i t h L a c Z fragment. Pos i t ive bands expected at 5.7 kb . 5 o f 14 clones have co-integrated the C D 1 l b - L a c Z construct. E S cel ls that had been electroporated w i t h the p C A G G s - I D U A construct were screened in i t i a l ly for reporter gene expression by staining for beta-galactosidase act ivi ty . C lones showed a wide range o f beta-galactosidase intensity shown representatively i n figure 5.7 kb. 4.18. 117 F i g u r e 4 .18: R e p r e s e n t a t i o n o f E S clones sc reened f o r beta-galactos idase s t a i n i n g in tens i ty E S clones g rown to conf luency i n 96 w e l l plates were f ixed and stained for beta-galactosidase act ivi ty. Reporter gene expression, indicat ive o f the expression o f I D U A expressed on the same transgene polyc is t ronic m R N A , was h igh ly variable between different E S clones. The nature o f this var iab i l i ty inc luded differences i n staining intensity between different clones, and also differences i n staining intensity amongst c lona l cel ls w i t h i n a single w e l l . C lones w i t h h igh leve l , consistent beta-galactosidase staining were chosen. A second screen was performed determining approximate I D U A enzyme specific act ivi ty levels , normal ized to total protein content. p C A G G s - I D U A E S clones were determined to show h igh levels over non-transfected control E S cel ls and E S clones transfected w i t h the C D 1 l b - I D U A construct (data not shown). A h igh degree o f correlat ion was found between the intensity o f beta-galactosidase expression and I D U A enzyme specific act ivi ty leve l . B l a s t o c y s t i n j ec t ion o f eng ineered E S l ines M u l t i p l e blastocyst injections o f various constructs was performed as shown i n Table 4.2 118 Construct C l o n e I D N u m b e r o f blastocysts injected Chimeras produced Percent ch imer s im p C A G G s - I D U A 2 C - 2 6 2 5%, 5% I G 11 0 -2 D 14 0 -12B - 2 6 1 6 0 % , but female C D 1 1 B - I D U A a n d C D l l b - L a c Z 2 E - 1 3 1 5% 2 H - 1 3 2 5%, 5% Totals : 6 - 1 0 0 6 l o w Table 4.2: Blastocyst injection of engineered E S clones produces only low level chimeras A total o f 103 blastocysts were injected w i t h 6 different characterized E S lines transgene posi t ive for the C D 1 l b constructs or the p C A G G s - I D U A construct. 3 chimeras were produced for each type o f transgene. A l l chimeras were very l o w l eve l w i t h the except ion o f a female ch imera generated f rom l ine p C A G G s - I D U A 12B. H o w e v e r the R l E S l ine used is male indica t ing this ch imera c o u l d not be capable o f germline transgene transmission. 119 4.3 D i s c u s s i o n N o chimeras capable o f germline t ransmission o f either the C D 1 l b - I D U A or the p C A G G s - I D U A transgene constructs were generated after inject ion o f 100 blastocysts. O n l y l o w leve l (5%) chimeras were produced i n on ly 5 chimeras generated, w i t h the except ion o f a higher leve l (60%) but female chimera . The reason for the l o w number o f chimeras produced, and the l o w leve l o f ch imer i sm observed, is unknown . Poss ib i l i t ies for this outcome include alterations to the E S clones rendering them l imi t ed i n their ab i l i ty to constitute adult tissues, a constant concern w i t h E S ce l l culture. Techn i ca l barriers c o u l d also play a part. Al te rna t ive ly , the inab i l i ty to generate h i g h leve l chimeras and germl ine t ransmission after numerous attempts c o u l d reflect a b i o l o g i c a l effect o f transgene expression. In order to generate mouse l ines w h i c h c o u l d express transgenic human I D U A , I chose to use a condi t ional transgene expression approach w h i c h w o u l d a l l o w control o f the t im ing , and locat ion, o f transgene expression. T h i s is described i n chapter 5. 120 Chapter 5: Conditional transgenic expression of human alpha-L-iduronidase in a murine model to establish effective and tolerable limits for gene therapy for M P S I 121 5.1 I n t r o d u c t i o n T h i s chapter describes the successful generation o f two murine l ines o f a condi t ional transgenic mouse w i t h the potential for expression o f human I D U A enzyme. These lines are designed to mode l , i n conjunct ion w i t h the I D U A deficient mouse l ine described i n Chapter 3, gene therapy approaches for M P S I. A s described i n Chapter 4, numerous attempts to generate murine strains over-expressing I D U A , f rom the human I D U A c D N A , were not successful. A s pronuclear injection leads to variable levels o f transgene posi t ive founder mice and is dependant o n operator s k i l l and experience, it is possible that by chance no transgene constructs were integrated into injected nuc le i . It is also possible that screening o f founder m i ce cou ld have missed transgene posi t ive founders. A n approach us ing embryonic stem cel ls , i n w h i c h engineered, par t ia l ly defined cel ls are used i n the generation o f ch imer ic mice , was then employed as this might a l l o w for development o f transgene car ry ing chimeras, and a l lows for repeated attempts w i t h c lona l cel ls . H o w e v e r on ly l o w leve l chimeras were generated and no germ l ine transmissable m i c e were identif ied. T h i s suggests that the expression o f the transgene, human I D U A , might be deleterious to normal development. T o explore this poss ib i l i ty , and towards generation o f I D U A expressing m i c e for use i n transplantation and as models o f gene therapy, a condi t ional transgene system was employed . T h i s approach w o u l d a l l o w selective I D U A transgene expression avo id ing developmental transgene induced bottlenecks, should they exist. W i t h this condi t ional system, transgenic expression o f I D U A can be regulated both spatially and temporal ly , and is control led by Cre mediated recombinat ion. The therapeutic benefit o f selective I D U A expression cou ld 122 be assessed w i t h strategic breeding into the I D U A deficient M P S I mouse mode l , and a mouse l ine expressing Cre recombinase. Thus the two objectives o f Chapter 4, the generation o f a mode l o f in utero bone transplantation, and the generation o f a mode l w i t h widespread or ubiquitous expression, cou ld be achieved w i t h a single in i t i a l transgenic mouse. In addi t ion, the same mouse cou ld be crossed w i t h other Cre expressing mice testing I D U A specific expression i n v i r tua l ly every tissue imaginable to address the outcome o f specif ic reconsti tut ion on murine M P S I. 5.1.1 Conditional transgene regulation systems The inabi l i ty to generate transgenic m i ce lines expressing human I D U A , either ubiqui tously , or i n mar row der ived cel ls , raised the poss ib i l i ty that I D U A overexpression impai red development. In order to create a mouse that had the potential for I D U A expression but was in i t i a l ly car ry ing a silent vers ion o f the I D U A transgene, a condi t ional transgenic approach was used that w o u l d a l l o w regulat ion o f the act ivat ion o f I D U A transgene expression and hopeful ly avo id possible developmental bottlenecks. Cond i t i ona l control o f transgene expression a l lows for regulat ion o f the loca t ion and t i m i n g o f transgene expression. Cond i t i ona l control is required when one wants to study the funct ion o f a gene w h i c h is deleterious to normal development, as c o u l d be the case w i t h I D U A expression, and to address the b i o l o g i c a l functions o f a gene product i n a specific environment, the m a i n objective o f the generation o f transgenic l ines expressing I D U A . Spec i f i ca l ly , crossing o f select ively activated I D U A expressing l ines into the Idua -I- deficient background by transplantation, or mat ing, to address the benefit o f ce l l specific I D U A reconsti tut ion o n the phenotype o f murine M P S I. Cond i t i ona l control idea l ly invo lves l o w or zero basal transgene expression w h e n " o f f , and h igh levels o f 123 gene expression w h e n " o n " . The condi t ional system should be specific to the transgene and not alter general metabol i sm. T w o fundamentally different approaches to condi t ional gene regulat ion have been established. B o t h approaches are based on two components: an effector transgene that acts o n a target transgene, i n a so ca l led binary transgene system. These systems i nvo lve mat ing an effector l ine w i t h a l ine car ry ing the target transgene, p roduc ing double transgenic offspring w i t h the potential for target transgene expression. In one approach, exempl i f i ed by the T e t R transactivator system, the effector transgene encodes a transactivator w h i c h transactivates transcription o f the target transgene (Gossen and Bujard , 1992). Introduction o f d o x y c y c l i n e (dox) or other inducer regulates the b ind ing o f the transactivator to the operator o f the system, a l l o w i n g for regulat ion o f gene expression inc lud ing gene act ivat ion or repression. The T e t R transactivator approach has been used successfully in vivo to regulate genes i n a variety o f ways . In the second approach, the effector transgene encodes a recombinase such as Cre or F L P that spec i f ica l ly rearranges target sequences to regulate gene expression. The differences between these approaches make them suited for different situations. Transcr ip t ional transactivation has two m a i n advantages over recombina t ion based regulat ion. Firs t , expression o f the target gene is reversible, a l l o w i n g for the transient expression o f a transgene. Second, var iable levels o f target transgene expression can be obtained by regulat ing inducer concentration. H o w e v e r , transactivation suffers f rom variable levels o f background expression, reducing their u t i l i ty for the regulat ion o f deleterious transgenes. Recombina t i on based regulat ion, w i t h its i r revers ibi l i ty , is suited for tissue specific knockouts , for cel l- l ineage analysis , and for permanent gene act ivat ion. 124 My objective was to generate a mouse l ine i n w h i c h I D U A expression cou ld be induced i n specific tissues and at specific t imes. The i r revers ib i l i ty o f the recombinat ion approach was acceptable, and an important benefit o f the recombinat ion approach is the non-existent basal expression before recombinat ion. M o s t importantly, many mice strains expressing tissue specific Cre recombinase have been generated, p r o v i d i n g a w ide select ion o f act ivat ing mice , as shown i n table 5.1. Expres s ion pattern Promoter Reference ubiquitous early P G K L a l l e m a n d etal, 1998 m y e l o i d cel ls endogenous M ly sozyme Clausen etal, 1999 l ive r a l b u m i n Pos t ic etal, 1999 chondrocytes co l lagen type II S a k a i e r a l , 2001 smooth muscle smooth muscle m y o s i n heavy cha in X i n e t a l , 2002 mid /h indbra in E n 2 Z i n y k etal, 1998 pancreatic beta-cells Ins2 Herrera e t a l . , 2000 T a b l e 5 .1: R e p r e s e n t a t i v e C r e exp re s s ing m i c e T h i s a l lows for analysis o f expression i n many different tissues at var ious stages of development. A s shown i n table 5.1, a mouse strain expressing C r e i n m y e l o i d cel ls , s imi la r to the expression pattern o f the C D 1 l b promoter and useful for assessment o f the potential o f bone mar row transplantation for M P S I, has been generated and conf i rmed to express C r e preferentially i n m y e l o i d l ineage cel ls (Clausen e t a l , 1999). A l s o characterized and potent ial ly useful are m i ce strains expressing Cre i n l iver , chondrocytes, or ubiqui tous ly (Postic et al, 1999, Saka i et al, 2001 , L a l l e m a n d et al, 1998). W i t h suitable recombinat ion sites and other D N A elements, a single transgenic l ine cou ld be designed w i t h ubiquitous potential for expression o f human I D U A , regulated by the expression pattern o f Cre . Th i s one l ine w o u l d then be used to address a number o f b i o l o g i c a l questions through differential C re mediated act ivat ion, i nc lud ing act ing as a source o f expressing cel ls for transplantation experiments into the Idua -/-mouse l ine , as a genetic mode l o f tissue specific I D U A expression for breeding experiments w i t h the Idua -I- l ine , and to determine the phenotype o f I D U A expression dur ing development. T w o recombinases have been used for genomic manipulat ions i n m a m m a l i a n cel ls , C r e f rom bacteriophage P I (Sauer and Henderson, 1989) and F L P f rom Saccharomyces cerivisiae ( O ' G o r m a n et al, 1991). The ava i lab i l i ty o f different Cre expressing mice as activators makes the C r e / L o x P system o f recombinat ion more suitable to this project and w i l l be discussed further. The Cre recombinase o f P I bacteriophage is a 38 k D protein that belongs to the integrase f a m i l y o f site-specific recombinases. A s depicted i n figure 5.1, C r e recombinase mediates recombinat ion between two o f its recogni t ion sites, l o x P sites, w h i c h consists o f a 34 basepair (bp) consensus D N A recogni t ion sequence consis t ing o f a core sequence o f 8 bp and two 13 bp f lanking pa l ind romic sequences ( H a m i l t o n and A b r e m s k i , 1984). The asymmetr ic core sequence defines an orientation to the l o x P site, and regions f lanked by two l o x P sites w i t h the same orientation undergo delet ion o f the f lanked reg ion upon Cre mediated recombina t ion w h i l e l o x P sites facing each other lead to invers ion o f the intervening 126 region. The funct ion o f C r e i n the bacteriophage P I l ife cyc l e is to ensure the phage genome exists as a monomer ic p l a s m i d w i t h i n the bacteriophage, E . c o l i , as concatomers o f the phage genome c o u l d result i n loss o f the phage genome upon c e l l repl icat ion. The Cre recombinase is also active i n m a m m a l i a n cel ls (Sauer and Henderson, 1988), and in vivo i n transgenic m ice (Lasko et ah, 1992), i nc lud ing i n postmitot ic cel ls l ike neurons and T cel ls ( G o r m a n and B u l l o c k , 2000) . It is important that the Cre recombinase not result i n l ong term instabi l i ty i n the mouse genome for it to be useful i n transgenic 18 studies. A random occurrence o f a specific 34 bp sequence requires a 1 X 10 bp length o f D N A , w h i l e the entire m a m m a l i a n genome is on ly 3 X 10 9 bp, m a k i n g it u n l i k e l y the 34 bp l o x P site w o u l d be encountered i n the m a m m a l i a n genome (Nagy 2000) . 127 A T A A C T T C G T A T A A T G T A T G C T A T A C G A A G T T A T Figure 5.1: Cre/loxP recombination A ) The 34 bp l o x P site (black arrow, under ly ing sequence), consists o f an 8 bp di rect ional core element (underlined) f lanked by two pa l indromic 13 bp sequences. B ) A representative target region, w h i c h has been engineered to include two l o x P sites (black arrows) f l ank ing a region for potential removal . C ) Introduction o f C r e recombinase w h i c h , as dimers, binds to the l o x P sites and mediates recombinat ion between them. D ) The products o f recombinat ion are the o r ig ina l target reg ion minus the reg ion f lanked by l o x P sites and an independent D N A element conta ining the f lanked region, w h i c h is degraded. F o r tissue specif ic knockouts , region B represents an exon o f a gene f lanked by l o x P sites located i n adjacent introns. F o r condi t ional gene act ivat ion described i n this project, reg ion B represents a strong transcription stop s ignal (polyadenyla t ion signal) r emova l o f w h i c h a l lows expression o f region C , the human I D U A c D N A transgene. The speci f ic i ty o f the promoter d r i v i n g C r e dictates the act ivat ion o f express ion o f human I D U A . TSP=tissue specific promoter. 128 The C r e / l o x P system has been used to mediate recombinat ion in vitro and in vivo that include the act ivat ion or inact ivat ion o f a gene (Lewandosk i , 2001), translocations (Medber ry et al., 1995), and inversions (Mole te et al., 2001). Th i s l eve l o f regulat ion o f control can be combined w i t h the transactivator control elements described earlier to further control the onset and locat ion o f transgene expression. F o r the purpose o f this study, condi t ional gene act ivat ion was desired such that Cre recombinat ion w o u l d a l l o w expression o f human I D U A . A construct w i t h most o f the desired elements had already been described, w h i c h w h e n used w i t h an E S c e l l approach, generated mouse l ines suitable for the analysis o f C r e expressing mice . These reporter m ic e l ines, Z / A P and Z / E G , are designed such that Cre mediated recombinat ion causes a swi tch f rom the expression o f the l a c Z gene to a lkal ine phosphatase or green fluorescent protein, respect ively ( L o b e et al., 1999, and N o v a k et al., 2000). These reporter m ic e l ines are crossed into l ines expressing C r e recombinase for determination o f the Cre promoter expression pattern. W i t h the addi t ion o f an internal r ibosome entry site ( I R E S ) a l l o w i n g for the product ion o f dic is t ronic transcripts (Moun t fo rd et al., 1994), the transcript ion o f the I D U A transgene c o u l d be l i nked to the expression o f a reporter i n a system a l l o w i n g for tissue specific expression o f human I D U A and moni to r ing o f the state o f I D U A expression w i t h a dual reporter system indica t ing both o n and o f f states o f I D U A expression. A s depicted i n figure 5.1, b y f lank ing a stop s ignal , i n the fo rm o f a polyadenyla t ion s ignal , w i t h l o x P sites, the expression o f downstream elements can be regulated by the specific expression o f Cre recombinase. T h i s forms the basis o f the successful generation o f a condi t ional transgenic mouse l ine w i t h the potential for tissue specific expression o f human I D U A . 129 5.1.3 E x p e r i m e n t a l A p p r o a c h T h e embryonic stem c e l l approach to the generation o f transgenic m ice offers the advantage o f selecting c e l l clones w i t h rare, desired expression characteristics at the leve l o f c e l l culture. A s discussed previous ly , the generation o f transgenic m i c e w i t h specif ic expression patterns can be problemat ic w i t h the tradit ional pronuclear approach. C r i t i c a l to this project was the ab i l i ty to express human I D U A , as w e l l as a reporter gene, i n as many or idea l ly a l l tissues o f developing and adult mice . A s demonstrated by L o b e et al., examina t ion o f the transgene expression characteristics o f embryonic stem cel ls a l lows for the i so la t ion o f clones more l i k e l y to give desired long term transgene expression when used to produce transgenic mouse lines (Lobe et al., 1999). B y us ing a promoter active i n embryonic stem cel ls , d i rect ing the expression o f a reporter gene, i nd iv idua l clones w i t h h i g h or l o w leve l transgene expression can be identif ied. Furthermore, c lona l populat ions w i t h consistent expression patterns can be identif ied. W h i l e it might be expected that a l l genetical ly ident ical cel ls i n a c lona l popula t ion w o u l d express transgenes i n the same manner, i n practice, and as described i n chapter 4, this is not the case. In fact ident ical insertions can lead to differences i n transgene express ion w i t h i n genet ical ly ident ical , c lona l populat ions o f ce l ls . T h i s c o u l d be due to integration into a region subject to var iable expression, such as a c e l l cyc le related gene, and indicates that the promoter elements used i n this study are not sufficient to insulate express ion o f the transgene construct f rom regional t ranscript ion influences. G i v e n this, those integrations that g ive strong, consistent (i.e. a l l cel ls i n the populat ion) are chosen for the generation o f mouse l ines. The embryonic stem c e l l approach also a l lows for the molecula r analysis 130 o f clones; that is , representative cel ls can be genetical ly analyzed w h i l e c lona l cel ls are s t i l l avai lable for mouse generation. Relevant to the use o f the C r e / L o x system is the number and pattern o f transgene integrations, as w e l l as the number o f integration sites throughout the genome, that are present i n a c lone that is transgene posi t ive as ident i f ied by antibiot ic selection and or reporter gene expression. A s tandem integrations, or independent integrations i n the same ce l l but o n different chromosomes, can result i n undesired recombina t ion events between l o x sites or breeding diff icul t ies , Southern blot analysis o f clones can be performed to identify clones w i t h single site, single number transgene construct integrations. It is also possible to prematurely recombine representative samples o f c e l l clones to conf i rm that a clone has the abi l i ty to express the recombined transgenes, i n this case human I D U A and human alkal ine phosphatase. F igure 5.2 is a schematic o f the select ion and screens that were in i t i a l ly p lanned for the ident i f icat ion o f desired embryonic stem c e l l clones. A n t i b i o t i c resistance is encoded by the transgene construct, so that huge enrichment for clones w i t h integrated constructs occurs after 8 days o f growth i n select ion media . L a c Z expression is analyzed i n clones for intensity, as w e l l as consistency. S ingle integrations at a s ingle locus are desired, to s impl i fy later recombinat ion and transmission. The abi l i ty o f clones to undergo successful recombinat ion can be assessed v i a transfection o f C r e p l a smid , and scored by staining for a lk phos expression and/or I D U A act ivi ty . Together, these screens are intended to enr ich for rare integration events p romot ing l o n g term transgene expression even i n differentiated cel ls types. 131 1. Does clone survive antibiotic selection ? NO YES Dies 2. Desirable L a c Z expression ? NO Discard YES 3. Single copy integration ? NO YES Discard 4. Successful recombination ? NO YES 1 Discard Desired clones for generation o f transgenic mice Figure 5.2: Schematic of the selection and screening for desirable ES clones Rather than clone the desired elements for condi t ional Cre-mediated regulat ion and a reporter system for use i n E S cel ls , I chose to use the proven Z / A P based constructs generated by D r . Cor r inne L o b e (Lobe e t a l . , 1999). The parent vector p C C A L L 2 - I R E S -h A P / c g is described i n figure 5.3. T h i s vector uses recombinat ion to remove transcript ion stop signals that otherwise prevent expression o f downstream genes. D r i v i n g expression o f this construct are the same elements found i n p C C A G , the C M V enhancer 132 SnaBI (!*7| Figure 5.3: p C C A L L 2 - I R E S - h A P / c g parent construct The C M V enhancer coupled with the chicken beta-actin promoter drive expression of downstream elements. Flanked by loxP recombination sites is the beta-geo fusion gene encoding beta-galactosidase reporter expression (LacZ) and neomycin resistance (Neo), allowing for positive selection and transgene expression analysis in ES culture. Also flanked by the loxP sites are 3 strong polyadenylation signals (3pA) which prevent further transcription, preventing expression of any introduced transgenes and the second reporter gene, human alkaline phosphatase (hAlk phos). Introduction of Cre removes the loxP flanked beta-geo and the 3pA, allowing for expression of introduced transgenes and the h A l k phos reporter. From Dr. Corrinne Lobe (Lobe et al., 1999). and the promoter from the chicken b-actin gene. L o x P sites flank the beta-geo fusion gene, encoding beta-galactosidase and neomycin resistance, and three polyadenylation 133 A . p C C A L L 2 I R E S H / A P -12.1 kilobases L o x P b-actin C M V promoter Beta-geo enhancer lacZ and neo resist. 3 polyadenylation signals alkaline I L o x P I R E S Phosphatase I l — M 1 I  t h I D U A c D N A Poly A signal B . p C C A L L - I D U A 14.2 kilobases L o x P L o x P h I D U A I R E S Poly A CMV b-actin promoter Beta-geo 3 poly A signals alk phos C. mRNA transcript before recombination A A A A Cells are neomycin resistant LacZ positive No hIDUA or alkaline phosphatase expressed F i g u r e 5.4: S c h e m a t i c o f the p C C A L L - I D U A cons t ruc t T h i s construct is designed to a l l o w condi t ional expression o f human I D U A as w e l l as reporter genes indicat ing state o f recombinat ion. A . Express ion o f the construct is d r iven by the p C C A G promoter, w h i c h consists o f the C M V enhancer and ch icken beta-actin promoter. Immediately downstream lies one o f two l o x P sites, then a selection and reporter gene cassette fo l lowed by three copies o f the S V 4 0 polyadenyla t ion signal , and the second f lank ing l o x P site. The f lanking l o x P sites are used for Cre mediated recombinat ion, leading to removal o f the beta-geo selection cassette and the polyadenyla t ion sequences, a l l o w i n g for expression o f a transgene and the human placental a lkal ine phosphatase reporter gene. B . The 2.1 kb human I D U A c D N A w i t h polyadenyla t ion sequence removed was added to p C C A L L 2 to make p C C A L L - I D U A . C . The in i t i a l m R N A transcript before C r e mediated recombinat ion. N o human I D U A or a lkal ine phosphatase are expressed. L o x P = l o x P 34 bp recombinat ion site w i t h indicated orientation, beta-geo=beta-galactosidase and n e o m y c i n fusion gene, alk phos=human alkal ine phosphate gene, IRES=in te rna l r ibosome entry site. 134 signals. A unique c lon ing site fo l lows the L o x P site, a l l o w i n g addi t ion o f genes o f interest. N e x t , an I R E S , or internal r ibosome entry sequence, a l lows l i n k e d transcription o f genes o f interest and the a lkal ine phosphatase reporter gene. A rabbit po lyadenyla t ion signal completes the construct. A schematic o f the construct, i nc lud ing the addi t ion o f the human I D U A c D N A , is shown i n figure 5.4. A s shown, the unrecombined construct p C C A L L - I D U A should express beta-geo, a l l o w i n g for L a c Z reporter analysis , but no human I D U A , as the 3 po lyadenyla t ion sites are intact. F igure 5.5 describes the recombined transgene construct, w i t h r emova l o f the beta-geo cassette and 3 polyadenyla t ion signals, leading to loss o f L a c Z expression and a l l o w i n g for expression o f downstream human I D U A and the human alkal ine phosphatase reporter gene. U s i n g the p C a l - I D U A construct, I hoped to generate a condi t ional Cre-regulated transgenic mouse l ine w i t h the potential to express human I D U A . 135 L o x P L o x P A . h I D U A IRES Poly A CMV enhancer b-actin promoter 3 poly A signals A d d Cre recombinase by transfection or transduction o f Cre encoding D N A , 1 or by breeding into Cre expressing mice . B geo B. C . hIDUA Alk phos Poly A D . mRNA transcript after Cre mediated recombination hIDUA A l k phos IRES A A A A Human IDUA and alkaline phosphatase expressed F i g u r e 5.5: R e c o m b i n a t i o n a n d the expres s ion o f h u m a n I D U A A ) the unrecombined construct expressing beta geo. B ) W i t h the addi t ion o f Cre recombinase, recombinat ion occurs between the two l o x P sites and the beta geo cassette and the 3 polyadenyla t ion signals are lost. C ) The recombined al lele, w h i c h after r emova l and degradation o f the region encoding the beta-geo fusion gene and 3 strong polyadenyla t ion signals w h i c h functioned as a b l o c k to downstream transcription. D ) Af ter recombinat ion the construct expresses human I D U A and the alkal ine phosphatase reporter gene f rom a single transcript. L o x P = l o x p 3 4 bp site for recombinat ion, IRES=in te rna l r ibosome entry site. 136 5.2 Resu l t s The p C C A L L 2 - I R E S - h A P / c g parent construct was obtained i n p l a smid form from D r . Cor r inne L o b e (Lobe et al., 1999). Numerous ind iv idua l transformed colonies were used to seed ind iv idua l large v o l u m e cultures and large scale p l a smid isolations were performed. A s shown i n firgure 5.6, restrict ion digest ion w i t h Pst 1 and B a m H I enzymes, both mul t ip le cutters i n the p C C A L L 2 - I R E S - h A P / c g construct, determined that a l l i nd iv idua l clones appeared ident ical w i t h no evidence for rearrangement. Pst I M Bam HI 1 2 3 4 - 1 2 3 4 4 — 12 kb B S —• —— &mgmg$r •Ifflitil'Mr*'' |1HHJHK ZTZ. — H H •>* & •szx>m' $ t f i t f | p m^<*m< a — m « M » • — «"•** ^— 1.6 kb ^— 1.0 kb <«— 0.5 kb F i g u r e 5.6: R e a r r a n g e m e n t c h e c k o n p C C A L L 2 cons t ruc t . Pst I and B a m H I restrict ion enzymes were used to conf i rm that the ampl i f ied p r imary construct was not rearranged after transfection and large scale p l a smid isolat ion. A l l 4 clones tested produced bands as predicted conf i rming no rearrangements had occurred. Ladder sizes are shown o n the far right. The introduct ion o f the human I D U A c D N A was s imple as a unique X h o 1 site is present i n the p C C A L L 2 - I R E S - h A P / c g construct direct ly upstream o f the internal r ibosome entry site ( I R E S ) . A blunted form o f the human I D U A c D N A w i t h no polyadenyla t ion signal 137 was introduced to the X h o 1 opened, blunted p C C A L L 2 - I R £ S - h A P / c g construct, and transformed cultures were screened for the I D U A c D N A by P C R as shown i n figure 5.7. 600 c £ C U u _> re 0. 2 — CM *3 * o U c •z a C c c. _g c 0 u o c re .2 _re ' s - 'C a; 0 u tj rc rc CO rc CC CC CQ CC c u c c u u > c Q. * ^  * • » t i p •I S I P -c -C 1000 500 bp Figure 5.7: PCR detection of bacterial clones containing pCCALL2 ligated with the human IDUA cDNA. A posi t ive P C R result us ing pr imers i n exon 3 and 7 o f the human I D U A c D N A is expected to produce a band o f 600 bp. 3 o f 4 clones tested were determined to contain the I D U A c D N A , however orientation is unknown . T o determine the orientation o f the I D U A c D N A , a Pst 1 d igest ion was performed o n 8 P C R posi t ive clones, as shown i n figure 5.8. C lones 1 and 2 appeared to have the I D U A insert i n the correct orientation. Further restr ict ion analysis was performed w i t h A p a 1, H i n c II, and S p h I, as shown i n figure 5.9. W h i l e clones 1 and 2 generate a l l the predicted bands for a properly oriented clone w i t h a human I D U A c D N A insert upon restriction, clones 3 and 4, w i t h incorrect orientation, and no insert, respectively, c lear ly do not. 138 — ra ra - 1 2 3 4 5 6 7 8 ~ 7.4 kb *• 3.0 kb • 1.7 kb 1.2 kb • 0.63 kb 12 k b 3kb 2kb 1 kb k- 0.5 kb f t 1 2 F i g u r e 5.8: Ps t I r e s t r i c t i o n digest o f p l a s m i d f r o m l i g a t i o n o f p C C A L L 2 cons t ruc t w i t h h u m a n I D U A c D N A to d e t e r m i n e o r i e n t a t i o n . I D U A c D N A containing bacterial clones were identif ied by P C R specific to the I D U A c D N A . Des i red orientation o f the c D N A w i t h i n the construct was predicted based on sequence informat ion to produce fragments after Pst I digest ion o f 7400 bp, 3000 bp, 1700 bp, 1200 bp, 630 bp, and 188 bp. Reverse orientation o f the I D U A c D N A was predicted to produce fragments o f 7400 bp, 2100 bp, 2055 bp, 1700bp, 630 bp, and 188 bp. Lanes 1 and 2 contain clones w i t h apparent correct orientation. Lanes 3 to 8 have inserts i n the incorrect orientation. Apa I Hinc II Sph I L 1 2 3 4 | l 2 3 4 | 4 L •12kb .3kb • 2kb tt 0.5 kb tt F i g u r e 5.9: R e s t r i c t i o n d iges t ion to iden t i fy clones w i t h c o r r e c t l y inse r t ed a n d u n r e a r r a n g e d h I D U A c D N A in to p C C A L L 2 . C lones 1 and 2 show predicted correct restr ict ion fragments after A p a I, H i n c II, and S p h I restrict ion digest ion. L = l k b ladder. 139 The f inal p C C A L L - I D U A clone, after restrict ion analysis was ampl i f i ed and a large scale p l a smid isola t ion was performed. A f inal check o f the p C C A L L - I D U A p l a smid was performed w i t h A p a 1, H i n c II, Pst I, and S p H l , as shown i n figure 5.10, and no rearrangements were detected. F i g u r e 5 .10: A n a l y s i s o f l a rge scale p l a s m i d i s o l a t i o n o f p C C A L L - I D U A . Res t r ic t ion digest ion was performed to conf i rm the ampl i f i ed construct contained no rearrangements. D iges t i on w i t h A p a I, H i n c II, Pst I, and S p h I restrict ion enzymes produced bands o f predicted size. The p C C A L L - I D U A p l a s m i d was electroporated into E S cultures, cel ls were plated at very l o w density to promote the format ion o f i nd iv idua l clones f rom single cel ls , and n e o m y c i n selection was carr ied out for 8 days. Ind iv idua l clones were then p icked and transferred to 96 w e l l plates for propagation, further analysis, and freezing. A rep l ica plate o f the cel ls was analysed for L a c Z expression f rom the beta-geo fusion gene. Figure 140 5.11 represents the variable nature of LacZ expression observed between different ES clones. 2 - 6 B 4-3E 4-7A F i g u r e 5.11: L a c Z s t a i n i n g o f E S colonies d e m o n s t r a t i n g express ion v a r i a b i l i t y . A s I found with the transgenic ES approach in chapter 4, genetically identical ES cells derived from single, transgene containing cells, and therefore clones, express variable levels of the beta-galactosidase reporter gene. This is exemplified in figure 5.11. Clone 2 -6B shows strong consistent staining. Clone 4-3E is an example of a clonal population of cells expressing highly variable staining between individual cells, with some cells showing no or little staining while adjacent cells stain strongly. Clone 4-7A demonstrates a weak, but consistent staining clone. This visual screen allows detection of clones hopefully more likely to express transgenes in a consistent manner after differentiation into different cell types in adult mice, and may differentiate clones with high (dark) transgene expression from clones with low (light) transgene expression. Note clones contain multiple cells types including persistent ES cells (small and round) and fibroblast type cells (large and flat). Clones with dark, and consistent, staining were identified, consolidated to new 96 well plates, and amplified. 141 N e x t , clones w i t h suitable L a c Z staining characteristics were analysed by Southern blot t ing to identify clones w i t h single integrations o f the p C C A L L - I D U A construct. Eco RV site probe adjacent unknown genomic Eco RV site genomic DNA // « - / 4 Sea genomic DNA • 9 Single Southern restriction band of unknown size F i g u r e 5.12: S o u t h e r n b lo t i d e n t i f i c a t i o n o f E S clones c o n t a i n i n g s ingle c o p y in t eg ra t ions o f p C C A L L - I D U A . X or pA=polyadeny la t ion site, P-geo= beta-galactosidase and n e o m y c i n fusion protein. It is important to identify single copy integrates as mul t ip le adjacent integrations m a y show aberrant Cre mediated recombinat ion events. A s depicted i n figure 5.12, an enzyme ( E c o R V ) cutt ing once w i t h i n the p C C A L L - I D U A construct was used such that single copy integrations w o u l d generate a single Southern band, o f u n k n o w n size and dependant o n a restrict ion site i n adjacent genomic D N A , after p rob ing w i t h a por t ion o f the construct as shown. M u l t i p l e tandem copy integrations w i l l produce at least 2 bands after Southern analysis, i nc lud ing one band made up entirely o f repeated construct D N A , expected to be approximately 14.0 kb i n size for a head to ta i l integration, and one terminal band inc lud ing adjacent ch romosomal D N A . These clones are avoided. F igure 5.13 shows the results o f Southern analysis o f transgene expressing E S clones. gigs iHSF 12kb Q w _ _ _ _ _ Q< tt U C tu C X . . *» . , . « . , *- , ^ -12kb t T F i g u r e 5.13: S o u t h e r n b lo t ana lys i s o f 48 E S clones w i t h good r e p o r t e r gene expres s ion f o r s ingle c o p y integrates . Af te r E c o R V digest ion, D N A from E S clones was probed w i t h a fragment o f the p C C A L L - I D U A construct. E S clones w i t h single copy, single locus integrations w i l l produce single bands o f u n k n o w n size. Lane 1-1F, at the upper left hand corner o f figure 5.13, c lear ly shows mul t ip le bands and is thus to be avoided. Lane 1-2H is an example o f a suitable clone. A r r o w s identify E S clones 3-2F and 3-12F, eventual ly to become mouse lines after fu l f i l l ing further expression criteria. A l ine indicates the approximate pos i t ion o f the 12 k b band o f the 1 kb ladder. C lones w i t h bands s l ight ly larger than the 12 kb size were avoided even w i t h single bands as a repeat band o f 14 k b size cou ld be superimposed upon the unique band. 20 o f 48 assessed clones were found to have mul t ip le integrations, partial integrations, or unexplainable or ambiguous integrations, and were discarded. It is clear upon examinat ion o f figure 5.13 that the clones 3-2F and 3-12F, w h i c h f ina l ly produced 143 germline chimeras, are different clones. D u r i n g p i c k i n g o f E S clones, cross contaminat ion o f clones can occur as fragments o f a p i c k e d clone drift and are inc luded w i t h other clones. D u r i n g propagation, one clone may outgrow co-cul tured cel ls leading to single clones w i t h mul t ip le representation i n f inal ampl i f i ed clone l ines. In figure 5.13, c lone 3-2F produces a m u c h larger restrict ion fragment as detected by Southern blot analysis than clone 3-12F. T h i s indicates that a l though the clones were p i c k e d i n close succession and poss ib ly f rom the same plate, creating the potential for cross contaminat ion, these clones sharing except ional L a c Z expression characteristics represent unique and distinct clones. Af te r Southern analysis , clones that p roved to have suitable L a c Z expression and contained single copy integrations were expanded for further analysis and to create l o w passage number freezes suitable for ch imera product ion. Af ter the expansion, samples o f each clone were re-stained for L a c Z to determine the stabili ty o f transgene expression over t ime. O f the top 12 clones after in i t i a l L a c Z staining, s ingle c o p y analysis , and expansion, 6 clones were found to have changed their L a c Z staining properties. C lones were transfected w i t h Cre p l a smid us ing l ipofectamine to determine i f they cou ld recombine and express the human alkal ine phosphatase por t ion o f the construct. F igure 5.14 demonstrates the result o f a partial C re transfection, and demonstrates the binary nature o f recombinat ional act ivat ion. A p p r o x i m a t e l y 8 0 % o f clones ana lyzed showed evidence o f successful recombinat ion. 14  F i g u r e 5.14: A l k a l i n e phospha tase s t a i n i n g o f ES cells c o n t a i n i n g s ingle copy in t eg ra t ions o f p C C A L L - I D U A . O n the left, E S cel ls unable to express A l k phos after be ing transduced w i t h act ivat ing C R E p lasmid . O n the right, a c lone w i t h ind iv idua l alk phos posi t ive E S cel ls can be seen. The absolute nature o f reporter gene expression, either o n or complete ly off, is exempl i f i ed by the i nd iv idua l strongly expressing cel ls surrounded by cel ls that have not undergone Cre mediated recombinat ion. M o r e than 50 E S clones, in i t i a l ly identif ied for hav ing superior L a c Z staining, were analyzed for single copy integrations, a lkal ine phosphatase expression after recombinat ion, and persistence o f transgene expression w i t h L a c Z after ampl i f ica t ion . A f inal rank ing o f the top 9 clones was generated, shown i n table 5.1. N o t a l l clones w i t h excellent L a c Z staining characteristics were suitable for transgenic mouse generation, for example clone 2 - 6 H , w i t h the best overa l l staining, was not capable o f recombinat ion i n the presence o f Cre , and w o u l d therefore never be able to express human I D U A i n adult mice . Shaded lanes mark the 2 E S clones, 3-2F and 3-12F, that became mouse l ines. 145 Clone ID Percent Confluence Percent LacZ positive Consistency LacZ intensity Southern single copy Alk phos expression Percent Persistent LacZ staining, ranking Clone ID Overall rating 1-2D 100 95 variable yes negative 90,5 1-2D 1-2H 100 92 good yes positive 90,6 1-2H 4 1-3D 75 90 variable yes positive 1-3D 1-4H 75 85 variable yes positive 1-4H 2-6A 50 90 excellent unsure positive 80,8 2-6A 6 2-6B 10 90 excellent yes positive 95 ,2 2-6B 1 2-6H 10 100 excellent yes negative 100,1 2-6H 2-8D 100 90 variable yes positive 2-8D 2-12A 20 95 good yes positive 90,4 2-12A 3 3-1H 50 90 good no positive 3-1H .3-21' 2D 98 excellent yes positive 95.3 3-21' : 3-8D 10 98 good no no cells 3-8D 3-121 80 90 excellent > ^ positive SO. 7 3-12F 5 3-12G 20 80 good no positive 3-12G 3-12H 60 80 excellent no positive 3-12H 4-1C 100 90 good yes negative 4-1C 4-3D 50 80 good no positive 4-3D 4-3E 80 90 excellent yes positive 80,9 4-3E 7 4-4B 70 90 excellent yes positive 75, 10 4-4B 8 4-4H 20 90 good yes negative 70, 11 4-4H 4-5A 80 80 good no positive 4-5A 4-7A 50 85 excellent yes positive 70, 12 4-7A 9 T a b l e 5.2: S u m m a r y o f E S c lone ana lys i s The 20 most suitable l ines as determined by L a c Z staining were ranked for overa l l suitabil i ty. A f inal ranking o f the top 9 clones for the generation o f transgenic mice was determined, far right. C lones 3-2F, and 3-12F, successfully used to generate transgenic mouse l ines, are shaded. 146 T h e p C A L - I D U A mouse l ines . T w o dist inct E S clones have been used to generate mouse l ines: l ine 3-12F was generated by blastocyst inject ion o f E S cel ls , and 3-2F generated by the aggregation technique. B o t h l ines were produced us ing the R l E S l ine der ived f rom a (129/Svcp x 1 2 9 / S v J ) F l embryo. F o r the 3-2F l ine, C D 1 blastocysts were used for the generation o f chimeras. The experiments us ing w i t h the 3-2F p C a l - I D U A l ine were performed by D r . Cor r inne L o b e and staff. The C D 1 mouse strain is useful as they have red eyes and h igh l eve l chimeras can be identif ied by their b lack eyes, encoded by the 129J agouti l ine , and eye co lor is evident right f rom bir th i n contrast w i t h coat co lor selection used i n the tradit ional 129J a g o u t i - C 5 7 B L / 6 b lack system. Suitable E S l ines w i t h desired expression characteristics were thawed and aggregated w i t h eight-cel l stage C D 1 mouse embryos (2.5 days post coitus), then transferred to pseudo-pregnant recipients to produce ch imer ic m ice (Nagy , 1997). M a l e chimeras were mated w i t h C D 1 females to identify germ-l ine transmitters. Pups were genotyped by staining ear c l ips for l a c Z expression (Lobe et ah, 1999). The offspring generated f rom this mat ing are exprected to be 5 0 % C D l / 5 0 % 129Svcp/J ( R l E S cel ls) . A n inbred l ine was also generated, w h i c h i n v o l v e d breeding the 3-2F chimeras w i t h 129 S V E V l ine . F i n a l l y , the 3-2F l ine was mated w i t h mice expressing p C X - N L S -Cre ( M a r and N a g y , unpublished) , a ubiqui tous ly expressing Cre mouse l ine w i t h zygote expression o f Cre . T h i s system includes a Cre recombinase equipped w i t h a nuclear loca l i za t ion signal expressed by the except ional ly strong C M V enhancer/chicken beta-act in promoter combina t ion p C A G G ( N i w a et al., 1991). 147 These mice generated f rom the 3-2F E S l ine await further characterization, however , no obvious phenotype was observed i n litters expected to conta in double transgenic pups that should express human I D U A . L i n e 3-12F was produced us ing E S cel ls and 3.5 day postcoit is blastocysts f rom C 5 7 B L / 6 mice at the Centre for M o l e c u l a r M e d i c i n e and Therapeutics under the supervis ion o f D i a n a Car l son . Chimeras posi t ive for L a c Z staining were then bred w i t h C 5 7 B L / 6 mice produc ing a F l that inc luded pups posi t ive for L a c Z staining w h i c h are a combina t ion o f 129J agouti and C 5 7 B L / 6 . The C r e l ine used for ubiquitous act ivat ion o f the 3-12F p C a l I D U A l ine is Jackson stock # T g N ( h C M V - C r e ) 140 Sau homozygotes . T h i s strain contains a Cre recombinase gene under the control o f a human cytomegalovirus m i n i m a l promoter. T h i s promoter directs widespread t ranscript ion such that Cre recombinase is expressed i n a l l tissues. Th i s includes the germline tissues and gametes, a l l o w i n g for recombinat ion i n fer t i l ized zygotes such that every c e l l o f the developing mouse contains a recombined, activated ce l l expressing I D U A . F igure 5.15 shows the generation o f mouse l ines f rom the p C a l - I D U A 3-12F E S clone. Af te r E S inject ion into blastocyts, and implantat ion into surrogate mothers, 7 pups were born , 4 o f w h i c h had an agouti coat and therefore were constituted b y the 129 J E S cel ls . 3 o f the 4 were male , consistent w i t h the male gender o f the 129 J E S l ine, w h i l e one o f the chimeras was female and therefore u n l i k e l y to be capable o f germline t ransmission o f the transgene. A l l 4 agouti pups were posi t ive for L a c Z expression, indica t ing the p C a l - I D U A construct was successfully expressed. T w o independent chimeras successfully transmitted the transgene to offspring w h e n bred into the b l /6 strain. Transgene bearing offspring f rom the b l /6 and chimera , ident i f ied by L a c Z 148 staining, were then bred into the C M V - C r e mouse l ine . A s the C M V - C r e mice are homozygous for the C M V - C r e transgene, h a l f the offspr ing were expected to be double transgenic, that is containing both the p C a l - I D U A transgene as w e l l as the C M V - C r e transgene. These double transgenic m i ce were expected to express human I D U A , the human alkal ine phosphate reporter, and to no longer express the L a c Z reporter gene. Ini t ia l analysis o f ear notch samples indicates the recombinat ion is not complete i n any o f the double transgenic pups, w i t h samples staining for both L a c Z and a lk phos. These double transgenic mice have no obvious phenotype and await further characterization. 149 3-12F embryonic stem cell clone Chimera # 1 A 4 I X 5 A 6 \ ^ \ X CH0 Legend m Male • pCal-Idua 3-12F CMV-Cre • Female O double transgenic • F i g u r e 5.15: O v e r a l l P e d i g r e e M o u s e l ines generated f rom the p C a l - I D U A 3-12F embryonic stem ce l l c lone. Ch imeras were bred w i t h bl /6 mice to produce a stable mouse strain. Offspr ing o f the b l /6 and ch imera mat ing were then bred w i t h C M V - C r e m i ce to produce double transgenic offspring that should express human I D U A and a lkal ine phosphatase i n a widespread fashion f rom an early stage o f development. These double transgenic offspr ing are v iab le , and express human I D U A and the a lkal ine phosphatase reporter gene. 150 5.3 D i s c u s s i o n T h i s chapter describes the successful generation o f the p C a l - I D U A lines, transgenic mouse l ines w i t h the potential to express human I D U A . I employed a condi t iona l transgenic system i n v o l v i n g Cre-mediated act ivat ion, and an approach i n v o l v i n g embryonic stem cel ls , to generate mice i n w h i c h the expression o f human I D U A cou ld be regulated both spatially and temporal ly . The C r e - L o x recombinat ion system has n o w been used successfully for many different manipulat ions o f the mouse genome (Nagy , 2000). The absolute nature o f transgene expression afforded by the C r e - L o x system was especia l ly useful for this work , where it is important to be able to complete ly regulate I D U A expression, especia l ly i n the un-recombined, " I D U A o f f state. In addi t ion, the avai labi l i ty o f w e l l characterized mouse strains expressing tissue speci f ic-Cre w i l l a l l o w many specific questions about therapeutic intervention for M P S I to be addressed w i t h the p C a l - I D U A strains. The embryonic stem c e l l approach to the generation o f transgenic m i ce p roved useful for this w o r k and produced l ines w i t h the potential for adult transgene expression. The smal l number o f E S clones deemed suitable for the generation o f transgenic l ines after mul t ip le screens, less than 5 % o f E S clones, h ighl ights the advantage o f this approach, w h i c h a l lows for the ident if icat ion o f rare integrates permiss ive to long term, ubiqui tous expression. In practice, on ly 6 o f 400 E S clones were deemed to be h igh ly desirable for mouse l ine product ion after 5 cri ter ia were met, as shown i n figure 5.16. A p p r o x i m a t e l y 10 % o f p i c k e d E S clones showed in i t i a l desirable L a c Z staining qualit ies. O f 48 clones assessed for single copy integrations, on ly 50 % showed a c lear ly desired result. Repeated L a c Z staining after 3 further passages (approximately 7 to 10 151 1 . Does clone survive antibiotic selection ? N O Y E S f f D i e s 2. Desirable LacZ expression ? N O Y E S ^ 9 0 % 10% v D i s c a r d 3. Single copy integration ? N O Y E S vj, 4 0 % 6 0 % v D i s c a r d 4. Persistent LacZ expression ? N O vj, 50% Y E S 50% y 10 % of picked clones Total: 0.1 X 0.6 = 6% of picked clones Total: 0.06 X 0.05 = 3% of picked clones D i s c a r d 5. Successful recombination ? N O \f/ 20% Y E S 80% A. D i s c a r d Desired clones for the generation of transgenic mice Total: 0.03 X 0.08 = 2.4% of picked clones Figure 5.16: Schematic of the selection and screen for desired ES clones The percentage o f cel ls discarded and saved is shown for each screening leve l . O n the right, the remain ing percentage o f E S clones deemed suitable at that l eve l o f screening. Af te r numerous screens less than 5 % o f randomly p i c k e d E S clones su rv iv ing antibiot ic selection are deemed suitable for the generation o f transgenic mice . 152 days o f continuous culture) showed 50 % o f clones under considerat ion had profoundly changed L a c Z staining characteristics. The majori ty o f clones tested, 80%, showed recombinat ion potential as determined by a lkal ine phosphatase staining. O v e r a l l , less than 5 % o f clones su rv iv ing antibiotic select ion were deemed suitable for inject ion into blastocysts towards the generation o f transgenic mouse l ines. A s pronuclear inject ion tends to produce greater numbers o f mul t ip le integrations, i t is clear that generating mice w i t h ubiquitous expression potential by pronuclear inject ion might require the product ion and screening o f hundreds o f mice . C lea r ly the elements inc luded i n this transgenic construct are not sufficient to insulate the construct f rom regional influences. In fact, clones w i t h t ruly superior transgene expression may not o n l y benefit f rom integration into a permiss ive site but, i n fact, a site subject to regional enhancers. Thus the analysis o f transgene expression at bo th the E S and adult tissue leve l c o u l d be useful i n the ident i f icat ion o f regions i n the genome suitable for l o n g term h igh level transgene expression. These regions c o u l d be useful i n the generation o f transgenic organisms, or i n gene therapy approaches. Ini t ia l results f rom studies w i t h the p C a l - I D U A l ines indicate that, w h e n at least one o f the p C a l - I D U A transgenic l ines is bred into a ubiquitous activator Cre l ine , some o f the double transgenic offspring undergo recombinat ion result ing i n expression o f both human I D U A and the reporter a lkal ine phosphatase. These p C a l - I D U A lines can be used to express human I D U A speci f ica l ly i n a w i d e variety o f tissues, by mat ing w i t h mice expressing Cre i n a tissue specific manner. Thus both the objectives o f chapter 4, namely the generation o f transgenic l ines w i t h mar row ce l l der ived I D U A expression, and ubiqui tous I D U A expression, can be real ized. 153 Transgenic l ines expressing human I D U A i n m a r r o w der ived cel ls , w h e n crossed into the I D U A deficient mouse l ine , w i l l be useful i n determining the m a x i m u m possible therapeutic benefit o f expression f rom this c e l l l ineage, and this compound transgenic-knockout w i l l represent a genetic m o d e l o f in utero bone mar row transplantation. The generation o f a mouse l ine that expresses h igh levels o f human I D U A i n a l l tissues was undertaken for two reasons. M o s t important ly, I w i shed to develop a strain o f mice expressing active human I D U A , as w e l l as a reporter gene, for use as a donor strain i n transplantation experiments w i t h M P S I mice . The second objective o f this project was to determine the outcome o f h i g h l eve l , widespread I D U A expression o n development. I D U A is no rma l ly expressed at very l o w levels and the consequences o f abnormal ly h igh levels o f I D U A act iv i ty are u n k n o w n . The in i t i a l results described here indicate that at least mosaic expression o f human I D U A is tolerated dur ing development and is not associated w i t h any obvious phenotype. 154 C h a p t e r 6 : S u m m a r y a n d conc lus ions 6.1 Characterization of the long term pathophysiology of murine M P S I Current ly , there are no effective therapeutics that alter a l l o f the features o f lysosomal storage disorders. A s such, severe M P S I is not presently curable, a l though bone mar row transplantation and enzyme replacement therapy offer part ial amel iora t ion o f some disease symptoms. The means by w h i c h iduronidase def ic iency, and the result ing accumula t ion o f heparan and dermatan sulfate, leads to the detectable c l i n i c a l abnormali t ies i n M P S I are not fu l ly understood. It remains to be determined w h i c h features o f M P S I are irreversible and w h i c h features can be improved , w i t h therapy. In addi t ion, the identif icat ion o f the specific ce l lu lar targets and cr i t ica l t ime points for successful therapeutic intervention are unknown . The generation o f a mouse mode l o f M P S I has a l l owed for specif ic questions about the progression o f symptom development to be addressed i n a manner not possible i n human M P S I patients. Important f indings described i n this thesis inc lude the presence o f early pathology i n ret iculoendothelial cel ls , g rowth plates o f bones, the presence o f secondary accumulat ions o f substrates not direct ly l i nked to I D U A def ic iency i n bra in , and the presence o f neurologic disease inc lud ing dysmorpho logy o f Purkinje cel ls i n the cerebel lum. L o n g term characterizat ion o f murine M P S I suggests this an ima l m o d e l represents severe human M P S I, or Hur l e r syndrome, as there is obvious involvement o f the neurologic and skeletal systems, despite the fact that the murine m o d e l l ives into adulthood. The observations i n this rodent mode l are important as they conf i rm the u t i l i ty o f the I D U A deficient mouse, and provide a better understanding o f the pathology occur r ing over t ime i n tissues not yet responsive to therapy. F i n a l l y , characterization o f these 156 features o f murine I D U A def ic iency has identif ied numerous markers o f M P S I progression that w i l l be useful i n the assessment o f therapies for I D U A def ic iency. 6.2 Future work: The M P S I mouse provides a convenient mode l for the detailed examinat ion o f I D U A def ic iency and represents a useful mode l for general ized lysosomal storage disorders. Future studies on this mouse mode l w i l l l i k e l y focus o n further understanding the neurologic and skeletal features o f M P S I. Perhaps more important, even wi thout delineating the under ly ing causes o f these M P S I features, this an imal mode l should prove useful i n the assessment o f therapeutics for M P S diseases. 6.3: Generation of transgenic murine strains expressing human IDUA. The objective o f this project was to generate transgenic mouse l ines expressing human I D U A . Af te r numerous attempts to produce transgenic mice expressing human I D U A us ing both pronuclear inject ion as w e l l as embryonic stem ce l l approaches, w i t h tradit ional , non-regulated promoters, no transgenic mice were generated. T h i s led to the use o f a condi t ional system, i n w h i c h the expression o f human I D U A is regulated b y the int roduct ion o f Cre recombinase. U s i n g Cre mediated recombinat ion, and a dual reporter system, two transgenic mouse lines have been developed w h i c h have the potential to express human I D U A i n a c e l l specif ic manner. B y u t i l i z i n g the ever expanding l ibrary o f m ice expressing Cre recombinase i n specific tissues, the effects o f specific reconsti tution o f I D U A , i n a background o f I D U A def ic iency, can be determined. These mi ce strains w i l l help identify where, and when, therapeutic I D U A is most effective i n prevent ing or correct ing specific features o f I D U A deficiency. In addi t ion, the compat ib i l i ty o f expression o f human I D U A w i t h normal c e l l metabol i sm, and an imal development, can be determined. There are many stages i n the cel lu lar maturat ion o f a lysosomal enzyme that might be overwhe lmed dur ing h i g h leve l transgenic expression. Correct post translational modi f ica t ion , endosomal compartment transport, and general ized ly sosomal funct ion c o u l d be altered w h e n one lysosomal enzyme is inappropriately expressed. M a n y transgenic c e l l l ines or mouse strains have been generated that express predominant ly human lysosomal enzymes. K y l e et al. generated a mouse l ine expressing the human G U S enzyme, deficient i n M P S V I I . The G U S enzyme is targeted to the lysosome v i a the mannose-6-phosphate ( M 6 P ) receptor, as is I D U A . T h e y demonstrated complete correct ion o f the murine M P S V I I phenotype w h e n the transgenic l ine expressing human G U S was crossed into the G U S -/- M P S V I I mouse l ine ( K y l e et al, 1990). M i c e hemizygous for the human genomic transgene expressed 10 fo ld higher levels o f G U S act iv i ty i n most tissues and d i d not produce any detectable negative phenotype. T h i s conf i rmed that human G U S is enzymat ica l ly functional and is proper ly targeted i n murine cel ls , can correct mur ine M P S V I I , and is w e l l tolerated even at h i g h levels o f expression. Expre s s ion o f alpha-galactosidase A at h i g h levels i n Chinese hamster ovary ( C H O ) cel ls results i n its intracel lular aggregation, crys ta l l iza t ion i n lysosomes, and selective secretion (Ioannou et al, 1992). It m a y be that certain enzymes have a tendency for aggregation and that overexpression o f these enzymes creates an environment for aggregate format ion. A transgenic mouse l ine overexpressing human alpha-galactosidase between 20 and 10,000 fo ld had no obvious phenotype result ing f rom overexpression (Kase et al, 1998) and no detected aggregate formation. 158 H u m a n I D U A has been overexpressed i n c e l l culture us ing Chinese hamster ovary ( C H O ) to levels 3000 to 7000 fo ld above normal ( K a k k i s et al, 1993). Surpr i s ing ly , the act ivi ty and dis t r ibut ion o f 5 other l y sosomal enzymes were not s ignif icant ly affected even at this h i g h leve l o f overexpression. N o aggregations were noted. Th i s abi l i ty for overexpression o f an enzyme bearing the M 6 P phosphate residue for lysosomal targeting without dis turbing general lysosomal targeting m a y be l imi t ed to certain c e l l types. Re t rov i ra l transduction o f human M P S I fibroblasts w i t h 3 constructs expressing va ry ing levels o f human I D U A produced surprising results that are relevant to this current thesis; i nc lud ing the induct ion o f a nove l disease state ( A n s o n et al., 1992). The 3 constructs differed i n the regulatory elements d r iv ing expression o f human Idua c D N A , w i t h the first, p L I d S N , us ing the 5 ' v i r a l l ong repeat ( L T R ) , the second, p L N C I d , uses the cytomegalovirus ( C M V ) immediate early promoter, w h i l e i n the third, p L N T i d , the C M V promoter is replaced w i t h a fragment o f the mouse C D 4 5 gene. The three constructs, L N C I d , L I d S N , and L N T I d , were found to express 2 5 0 X , 1 5 0 X , and 1 0 X normal levels o f I D U A act ivi ty i n M P S I human fibroblasts. W h i l e a l l three constructs corrected the enzymat ic defect i n M P S I fibroblasts, on ly the construct w i t h the lowest l eve l o f expression ( 1 0 X , L N T I d ) was successful i n fu l ly correct ing the G A G storage o f the M P S I fibroblasts. Increasing overexpression o f I D U A resulted i n reduced therapeutic benefit as assessed by intracel lular accumula t ion o f sulphate labeled G A G . In addi t ion, the levels o f other lysosomal enzymes were determined to be lowered i n lysosomes, but increased i n the ce l l media , indicat ing the lysosomal enzymes were secreted rather than del ivered to the lysosome ( A n s o n et al., 1992). The pattern o f decreased lysosomal enzymes i n the lysosome but increased extracellular concentrations o f l y sosomal 159 enzymes is found i n I c e l l disease, w h i c h results i n increased secretion o f mannose-6-phosphate-dependent lysosomal enzymes as the enzyme media t ing addi t ion o f terminal mannose phosphate residues is deficient. W i t h overexpression o f the mannose-6-phosphate bearing I D U A i n this study, the M P R receptor mediated del ivery o f lysosomal enzymes is thought to be disrupted, leading to mis rout ing o f l y sosomal enzymes to the secretion pathway and ul t imately the extracellular space. The consequences o f this mis rout ing o f l y sosomal enzymes, should it occur i n vivo, are unknown . The catalytic act ivi ty o f l y sosomal enzymes at the near neutral p H o f the extracellular space has not been investigated but w i t h sufficient enzyme even l o w levels o f act ivi ty might result i n inappropriate degradation o f enzyme substrates. These results indicate the leve l o f I D U A expression occur r ing i n gene therapy m a y need to be l im i t ed for op t imal correct ion o f lysosomal storage o f G A G s , and suggest that excessive levels o f I D U A expression, as cou ld occur for some ce l l types after gene therapy, m a y not be therapeutic. Macrophage specif ic transgenic overexpression o f human protective protein/cathepsin A ( P P C A ) was par t ia l ly corrective for a mur ine m o d e l o f galactosial idosis ( P P C A - / - ) , a v iscera l and neurodegenerative disease resul t ing f rom def ic iency o f P P C A . Cor rec t ion o f v iscera l storage and partial correct ion or delay o f onset o f neuronal storage was achieved w i t h either bone mar row transplantation o f transgenic mar row overexpressing P P C A f rom a macrophage specific promoter element into the P P C A - / - mouse, or w i t h breeding o f the same macrophage specif ic P P C A transgenic l ine into P P C A - / - mice ( H a h n et al., 1998). Some neuronal cel ls , i n c lud ing Purkinje cel ls , cont inued to show storage and d ied w i t h both therapy approaches. T h i s 160 indicates that, at least w i t h the levels o f transgene expression achieved i n this study, mar row der ived cel ls i nc lud ing macrophages m a y not be able to fu l ly correct neuronal lysosomal storage and pathology. Some c e l l types m a y be better targets for the therapeutic overexpression o f a ly sosomal enzyme than others. Pompe disease includes severe metabol ic myopathy and cardiomyopathy and therefore musc le w o u l d seem a log ica l choice for expression o f the therapeutic lysosomal enzyme alpha-glucosidase ( G A A ) deficient i n this disorder. U s i n g knockout m ic e w i t h this disease, and transgenic l ines containing the c D N A for the human enzyme under muscle or l iver specific promoters control led by tetracycline, Raben et al. demonstrated that the l iver p rov ided enzyme far more eff iciently than muscle tissue. The achievement o f therapeutic levels w i t h skeletal muscle expression required the entire musc le mass to produce h igh levels o f enzyme o f w h i c h litt le found its way to the p lasma, whereas l iver , compr i s ing less than 5% o f body weight , secreted 100 fo ld more enzyme, a l l o f w h i c h was i n the active 110 k D a precursor fo rm (Raben et al, 2001). In a transgenic l ine w i t h very h igh expression o f G A A i n skeletal muscle it was shown excessive levels o f G A A are not w e l l tolerated, w i t h v i r tua l ly every ce l l containing smal l lysosomes w i t h P A S - p o s i t i v e storage material . It is clear that the transport systems for de l ivery o f exogenous ly sosomal enzymes, us ing the mannose-6-phosphate receptors, a l lows rescue o f an imal models o f lysosomal storage disease w i t h gene products o f human versions o f the ly sosomal enzymes. Overexpress ion o f lysosomal enzymes has been associated w i t h numerous phenomenon inc lud ing aggregation o f transgenic proteins, secretion o f transgenic as w e l l 161 as native lysosomal enzymes, and def ic iency o f in t ra lysosomal- lysosomal enzymes leading to ly sosomal disease i n ce l l culture. Surpr is ingly , transgenic mouse l ines overexpressing lysosomal enzymes have for the most part not exhibi ted obvious c l i n i c a l or pa thologica l phenotypes, w i t h the except ion o f lysosomal storage disease i n m i ce overexpressing G A A enzyme i n muscle . The phenotype o f the overexpression o f I D U A o n normal c e l l metabol i sm is relevant to gene therapy approaches for M P S I. O n l y by overexpressing I D U A i n a l l tissues, dur ing development, can the safety o f such approaches be determined. In addi t ion, ce l l specific reconsti tut ion o f I D U A act iv i ty i n a background o f I D U A def ic iency m a y identify ce l l types required for efficient correct ion o f M P S I compl ica t ions . It has been determined that expression o f human I D U A i n normal mice , at the levels obtained w i t h these transgenic strains, does not induce obvious disease. The dual reporter expression system w h i c h indicates the state o f Cre mediated recombinat ion, and therefore human I D U A expression, has proven functional and the expression o f human I D U A has been conf i rmed. The generation o f a condi t iona l system for the expression o f human I D U A i n mice w i l l p rovide a versatile too l for the study o f the effects o f gene therapy for M P S I. In addi t ion to genetic crosses into the I D U A deficient strain to address the benefit o f I D U A expression i n specific tissues at defined t ime points, these transgenic mice lines can provide a source o f human I D U A expressing cel ls for use i n transplantation studies. Since these transgenic m ic e express a reporter gene as w e l l as human I D U A , this system provides ease o f moni to r ing o f transgene expression and the t racking o f transgenic cel ls i n recipients. F i n a l l y , the phenotype o f transgenic human I D U A expression, i f any, can 162 be determined. It is hoped that these mouse strains w i l l be useful i n determining levels , locat ions, and t ime points important to the eff icacy and safety o f gene therapy for M P S I. 6.4 F u t u r e w o r k M u c h remains to be learned f rom the condi t ional transgenic l ines produced dur ing this thesis work . M o s t important ly; crosses into the I D U A deficient murine l ine and l ines expressing Cre recombinase need to be comprehensively analyzed. In particular, detailed evaluat ion o f human specif ic I D U A ac t iv i ty after C r e recombinat ion , i n var ious mouse tissues by immunocapture is c r i t i ca l . The complex i ty o f this analysis and the considerable t ime required for breeding into var ious C r e expressing l ines as w e l l as the mur ine I D U A deficient l ine precluded inc lus ion into this thesis project. It is hoped these transgenic mur ine l ines w i l l lead to a better understanding o f the tissue specif ic elements and expression patterns that are required to effectively cure M P S I. 163 References A b r e u S, H a y d e n J , Be r tho ld P , Shapiro I M , D e c k e r S, Patterson D , Hask ins M (1995) G r o w t h plate pathology i n feline mucopolysacchar idos is V I . C a l c i f Tissue Int 57: 185-190. A n s o n D S , B i e l i c k i J , and H o p w o o d J J (1992) Cor rec t ion o f Mucopo lysacchar idos i s T y p e I fibroblasts by retroviral-mediated transfer o f the human a lpha-L-iduronidase gene. H u m Gene Therapy 3: 371-379. A r o n o v i c h E L , P a n D , W h i t l e y C B (1996) M o l e c u l a r genetic defect under ly ing a lpha-L-iduronidase pseudodeficiency. A m J H u m Genet 58: 75-85. B a c k A , East K , H i c k s t e i n D (1995) Leukocy t e in tegr in C D 1 l b promoter directs expression i n lymphocytes and granulocytes i n transgenic mice . B l o o d 85: 1017-24. Bar ton N W , B r a d y R O , D a m b r o s i a J M , D i B i sceg l i e A M , Doppe l t S H , H i l l S C , M a n k i n H J , M u r r a y G J , Parker R l , A r g o f f C E (1991) Replacement therapy for inheri ted enzyme deficiency—macrophage-targeted glucocerebrosidase for Gaucher 's disease. N E n g l J M e d 324: 1464-70. Bar ton R W , N e u f e l d E F (1971) The Hur l e r corrective factor. Pur i f ica t ion and some properties. J B i o l C h e m 246: 7773-9. Bastedo L , Sands M S , Lamber t D T , P i s a M A , B i rkenme ie r E , C h a n g P L (1994) Behav io ra l consequences o f bone mar row transplantation i n the treatment o f murine mucopolysacchar idos is type V I I . J C l i n Invest 94: 1180-6. Be rn f i e ld M , Gotte M , Park P W , Re izes O , F i tzgera ld M L , L i n c e c u m J , Z a k o M (1999) Funct ions o f c e l l surface heparan sulfate proteoglycans. A n n u R e v B i o c h e m 68: 729-77. B i rkenme ie r E H , Barke r J E , V o g l e r C A , K y l e J W , S l y W S , G w y n n B , L e v y B , Pegors C (1991) Increased l ife span and correct ion o f metabol ic defects i n murine mucopolysacchar idos is type V I I after syngeneic bone mar row transplantation. B l o o d 78: 3081-92. B i rkenme ie r E H , D a v i s s o n M T , Beamer W G , G a n s c h o w R E , V o g l e r C A , G w y n n B , L y f o r d K A , M a l t a i s L M , W a w r z y n i a k C J (1989) M u r i n e mucopolysacchar idos is type V I I : characterizat ion o f a mouse w i t h ^-glucuronidase def ic iency. J C l i n Invest 83: 1258-1266. B i s s i g M , Hagenbuch B , Stieger B , R o l l e r T , M e i e r P J (1994) Func t iona l expression c l o n i n g o f the canal icular sulfate transport system o f rat hepatocytes. J B i o l C h e m 269: 3017-21. 164 B o s c h A , Perret E , Desmar is N , Trono D , H e a r d J M (2000) Reversa l o f pathology i n the entire bra in o f mucopolysacchar idos is type V I I m ice after lent ivirus-mediated gene transfer. H u m Gene Ther 11: 1139-50. Bre ider M A , S h u l l R M , Constantopoulos G (1989) Long- t e rm effects o f bone mar row transplantation i n dogs w i t h mucopolysacchar idos is I. A m J Pathol 134: 677-92. B r e u n i g F , Wanner C (2003) E n z y m e replacement therapy for Fabry disease: p rov ing the c l i n i c a l benefit. N e p h r o l D i a l Transplant 18: 7-9. B r o o k s D A (2002) E n z y m e replacement for M P S I. H u m Gene Ther 3: 371-9. B y e r s P H (1995) Disorders o f co l lagen biosynthesis and structure. In: Scr ive r C R , Beaudet A L , S l y W S , V a l l e D , eds. The metabol ic and molecula r bases o f inheri ted disease, 7th edn. N e w Y o r k : M c G r a w H i l l 2427-2839. C a s a l M L , W o l f e J H (1998) Var ian t c l i n i c a l course o f mucopolysacchar idos is type V I I i n two groups o f m ice car ry ing the same mutat ion. L a b Invest 78: 1575-81. C a s a l M L , W o l f e J H (2000) Mucopo lysaccha r idos i s type V I I i n the deve lop ing mouse fetus. Pediatr Res 47: 750-6. Casa l M L , W o l f e J H (2001) In utero transplantation o f fetal l i ve r cel ls i n the mucopolysacchar idos is type V I I mouse results i n l o w - l e v e l ch imer i sm, but overexpression o f beta-glucuronidase can delay onset o f c l i n i c a l signs. B l o o d 97: 1625-34. C h e n H , Bera rd J , L u o H , Landers M , V i n e t B , Brad ley W E , W u J (1997) C o m p r o m i s e d allograft rejection response i n transgenic m ice expressing antisense sequences to ret inoic ac id receptor beta2. J I m m u n o l 159: 623-34. C l a r k e L A , N e l s o n P V , War r ing ton C , M o r r i s C P , H o p w o o d J J , Scott H S (1994) M u t a t i o n analysis o f 19 N o r t h A m e r i c a n mucopolysacchar idos is type I patients: ident i f icat ion o f two addi t ional frequent mutations. H u m Muta t 3: 275-282. C la rke L A , N a s i r J , Z h a n g H , M c D o n a l d H , App lega r th D A , H a y d e n M R , Toone J (1994) M u r i n e a lpha-L-iduronidase: c D N A iso la t ion and expression. G e n o m i c s 24:311-6. C la rke L A , Russe l l C S , P o w n a l l S, War r ing ton C L , B o r o w s k i A , D i m m i c k J E , Toone J , J i r i k F (1997) M u r i n e mucopolysacchar idos is type 1: targeted disrupt ion o f the mur ine a -L- iduronidase gene. H u m M o l G e n 64: 503-511. C l a r k e L A , Scott H S (1993) T w o nove l mutations causing mucopolysacchar idos is type I detected by single strand conformational analysis o f the a -L- iduron idase gene. H u m M o l Genet 2: 1311-1312. 165 Clausen B E , Burkhard t C , R e i t h W , R e n k a w i t z R , Forster I (1999) Cond i t i ona l gene targeting i n macrophages and granulocytes us ing L y s M c r e mice . Transgenic Res 8: 265-77. C lea ry M A , W r a i t h J E (1995) The presenting features o f mucopolysacchar idos is type I H (Hur ler syndrome). A c t a Paediatr 84: 337-339. C o l v i l l e G A , B a x M A (1996) E a r l y presentation i n the mucopolysacchar ide disorders. C h i l d Care Hea l th D e v 22: 31-6. Constantopoulos G , Dekaban A S (1978) Neurochemis t ry o f the mucopolysacchar idoses: B r a i n l ip ids and lysosomal enzymes i n patients w i t h four types o f mucopolysacchar idos is and i n normal controls. J N e u r o c h e m 30: 965-973. Constantopoulos G , S h u l l R M , Hast ings N , N e u f e l d E F (1985) N e u r o c h e m i c a l characterization o f canine a -L- iduron idase def ic iency disease (model o f human mucopolysacchar idos is I). J N e u r o c h e m 45 : 1213-1217. C r a w l e y A C , B r o o k s D A , M u l l e r V J , Petersen B A , Isaac E L , B i e l i c k i J , K i n g B M , Boul te r C D , M o o r e A J , Fazza la r i N L , A n s o n D S , Bye r s S, H o p w o o d J J (1996) E n z y m e replacement therapy i n a feline mode l o f M a r o t e a u x - L a m y syndrome. J C l i n Invest 97: 1864-1873. C r o w J , G i b b s D A , Cozens W , Spel lacy E , Watts R (1983) B i o c h e m i c a l and his topathological studies o n patients w i t h mucopolysacchar idoses , two o f w h o m had been treated w i t h fibroblast transplantation. J C l i n Pathol 36:415-430. D a l y T M , L o r e n z R G , Sands M S . (2000) A b n o r m a l immune function in vivo i n a murine m o d e l o f lysosomal storage disease. Pediatr Res 47: 757-62. D a l y T M , O h l e m i l l e r K K , Roberts M S , V o g l e r C A , Sands M S (2001) Prevent ion o f systemic c l i n i c a l disease i n M P S V I I mice f o l l o w i n g A A V - m e d i a t e d neonatal gene transfer. Gene Ther 8: 1291-8. D a l y T M , V o g l e r C , L e v y B , Hask ins M E , Sands M S (1999) Neonata l gene transfer leads to widespread correct ion o f pathology i n a mur ine mode l o f lysosomal storage disease. P roc N a t l A c a d S c i U S A 96: 2296-300. D e g u c h i Y , Oku t su H , O k u r a T , Y a m a d a S, K i m u r a R , Y u g e T , F u r u k a w a A , M o r i m o t o K , T a c h i k a w a M , Oh t suk i S, H o s o y a K , Terasaki T (2002) Internalization o f basic fibroblast g rowth factor at the mouse b lood-bra in barrier invo lves perlecan, a heparan sulfate proteoglycan. J N e u r o c h e m 83: 381-9. Dekaban A S , Constantopoulos G (1977) Mucopo lysaccha r idos i s types I, II, I I I A and V : pathologica l and b iochemica l abnormali t ies i n the neural and mesenchymal elements o f the brain. A c t a Neuropa th 39: 1-7. 166 Dekaban A S , Constantopoulos G , H e r m a n M M , Steusing J K (1976) Mucopo lysaccha r idos i s type V (Scheie syndrome): a postmortem study by mul t id i sc ip l ina ry techniques w i t h emphasis o n the brain. A r c h Pa thol L a b M e d 100: 237-245. D z i e n n i s S, V a n Et ten R A , P a h l S (1995) The C D 1 l b promoter directs h igh- leve l expression o f reporter genes i n macrophages i n transgenic mice . B l o o d 85: 319-29. E r i c k s o n R P (1999) Ant isense transgenics i n animals . Me thods 18:304-310. Everett L A , Glaser B , B e c k J C , Idol J R , B u c h s A , H e y m a n M , A d a w i F , H a z a n i E , Nas s i r E , Baxevan i s A D , Sheff ie ld V C , Green E D (1997) Pendred syndrome is caused by mutations i n a putative sulphate transporter gene ( P D S ) . N a t Genet 17: 411-22. Evers M , Saft ig P , Schmid t P , Hafner A , M c L o g h l i n D B , Schmah l W , Hess B , v o n F i g u r a K , Peters C (1996) Targeted disrupt ion o f the arylsulfatase B gene results i n mice resembl ing the phenotype o f mucopolysacchar idos is V I . P roc N a t l A c a d S c i 93: 8214-8219. Fa i rba i rn L J , Lashford L S , Spooncer E , M c D e r m o t t R H , Lebens G , A r r a n d J E , A r r a n d J R , Bel lan tuono I, H o l t R , Hat ton C E , Cooper A , Bes l ey G T , W r a i t h J E , A n s o n D S , H o p w o o d J J , Dex te r T M (1996) Long- t e rm in vitro correct ion o f a lpha-L- iduronidase def ic iency (Hur le r syndrome) i n human bone marrow. Proc N a t l A c a d S c i U S A 93: 2025-30. Ferrer I, C u s i V , P ineda M , Galofre E , V i l a J (1988) F o c a l dendri t ic swel l ings i n Purkinje cel ls i n mucopolysacchar idoses types I, II and III: a G o l g i and ultrastructural study. Neuropa th & A p p N e u r o b i o l 14: 315-323. F i e l d R E , Buchanan J A F , Copp lemans M G J , A i c h r o t h P M (1994) B o n e - m a r r o w transplantation i n Hur l e r ' s syndrome. J B o n e & Joint Surg 76: 975-981. F l ake A W and Zanjani E D (1999) In utero hematopoiet ic stem c e l l transplantation: ontogenic opportunities and b io log ic barriers. B l o o d 94: 2179-91. F o l c h J , Lees M , Stanley, G H (1957) A s imple method for the i so la t ion and pur i f ica t ion o f total l ip ids f rom an imal tissues. J B i o l C h e m 226: 497-509. Fratantoni J , H a l l C W , Neufe ld E F (1968) Hur l e r and Hunter syndromes: mutual correct ion o f the defect i n cultured fibroblasts. Science 162: 570-572. Fratantoni J C , H a l l C W , N e u f e l d E F (1968) The defect i n Hurler ' s and Hunter 's syndromes: faulty degradation o f mucopolysacchar ide . P roc N a t A c a d S c i 60: 699-706. G o n z a l e z - G o m e z I, M o n o n e n I, Heis te rkamp N , Grof fen J , Kaar t inen V (1998) Progressive neurodegeneration i n aspar ty lg lycosaminur ia mice . A m J Pathol 153: 1293-300. 167 G o r l i c h D , Rapopor t T A (1993) Pro te in translocation into proteol iposomes reconstituted f rom pur i f ied components o f the endoplasmic re t icu lum membrane. C e l l 75: 615-30. G o r m a n C , B u l l o c k C (2000) Site-specif ic gene targeting for gene expression i n eukaryotes. C u r r O p i n B io t echno l 11: 455-60. Gossen M , Buja rd H (1992) T igh t control o f gene expression i n m a m m a l i a n cel ls by tetracycline-responsive promoters. P roc N a t l A c a d S c i U S A 89: 5547-51. Grof fen A J , V e e r k a m p J H , M o n n e n s L A , van den H e u v e l L P (1999) Recent insights into the structure and functions o f heparan sulfate proteoglycans i n the human glomerular basement membrane. N e p h r o l D i a l Transplant 14: 2119-29. G r o s s o n C L , M a c D o n a l d M E , D u y a o M P , A m b r o s e C M , Rof f l e r -Tar lov S, G u s e l l a J F (1994) Synteny conservat ion o f the Huntington's disease gene and surrounding l o c i o n mouse Chr omosome 5. M a m m G e n o m e 5: 424-8. H a h n C N , del P i l a r M a r t i n M , Z h o u X Y , M a n n L W , d ' A z z o A (1998) Cor rec t ion o f murine galactosial idosis by bone marrow-der ived macrophages overexpressing human protective protein/cathepsin A under control o f the co lony-s t imula t ing factor-1 receptor promoter. P roc N a t l A c a d S c i U S A 95: 14880-5. H a m i l t o n D L , A b r e m s k i K (1984) Site-specific recombinat ion by the bacteriophage P I l o x - C r e system. Cre-mediated synapsis o f two l o x sites. J M o l B i o l 178: 481-6. H a r d o u i n N , N a g y A (2000) Gene-trap-based target site for cre-mediated transgenic insert ion. Genesis 26: 245-52. Hask ins M E , A g u i r r e G D , Jezyk P F , D e s n i c k R J , Patterson D F (1983) The pathology o f the feline mode l o f mucopolysacchar idos is I. A m J Pa thol 112: 27-36. Hask ins M E , Jezyk P F , D e s n i c k R J , M c D o n o u g h S K , Patterson D F (1979) A l p h a - L -iduronidase def ic iency i n a cat: a mode l o f mucopolysacchar idos is I. Pediat Res 13: 1294-1297. Has tbacka J , Supert i -Furga A , W i l c o x W R , R i m o i n D L , C o h n D H , Lander E S (1996) Atelosteogenesis type II is caused by mutations i n the diastrophic dysplas ia sulfate-transporter gene ( D T D S T ) : evidence for a phenotypic series i n v o l v i n g three chondrodysplasias . A m J H u m Genet 58: 255-62. H e X , L i C M , S imonaro C M , W a n Q , Hask ins M E , D e s n i c k R J , and Schuchman E H (1999) Identif icat ion and characterization o f the molecula r les ion causing mucopolysacchar idos is type I i n cats. M o l Genet M e t a b 67: 106-12. Herrera P L (2000) A d u l t i n su l in - and glucagon-producing cel ls differentiate f rom two independent c e l l l ineages. D e v e l 127: 2317-22. 168 H i c k s t e i n D , B a k e r D , G o l l a h o n K , and B a c k A (1992) Identif ication o f the promoter o f the mye lomonocy t i c leukocyte integrin C D 1 I B . P roc N a t l A c a d S c i 89: 2105-2109. H o g a n B , Bedd ing ton R , Costant in i F , and L a c y E (1994) M a n i p u l a t i n g the mouse embryo. C o l d Spr ing Harbor Laboratory Press, C o l d Spr ing Harbor , N Y . H o p w o o d J J and M u l l e r V (1982) Diagnos t ic e n z y m o l o g y w i t h special reference to a sulfated disaccharide der ived f rom heparin. C l i n S c i 62: 193-201. H o p w o o d J J , M u l l e r V , Smi thson A , Baggett N (1979) A f luorometr ic assay us ing 4-methy lumbel l i f e ry l a lpha-L- iduronide for the est imation o f a lpha-L-iduronidase act ivi ty and the detection o f Hur l e r and Scheie syndromes. C l i n C h i m A c t a 92: 257-65. H o p w o o d J J , V e l l o d i A , Scott H S , M o r r i s C P , Lit jens T , Clements P R , B r o o k s D A , Cooper A , W r a i t h J E (1993) Long- te rm c l i n i c a l progress i n bone mar row transplanted mucopolysacchar idos is type I patients w i t h a defined genotype. J Inher M e t a b D i s 16: 1024-1033. H u a n g J - Q , Trasler J M , Igdoura S, M i c h a u d J , Hana i N , G r a v e l R A (1997) A p o p t o t i c ce l l death i n mouse models o f G M 2 gangl iosidosis and observations o n human Tay-Sachs and Sandhoff diseases. H u m M o l G e n 6: 1879-1885. H u m a n Gene M u t a t i o n Database, h t t p : / / u w c m m l l s . u w c m . a c . U k / u w c m / m g / s e a r c h / l 19327.html Ioannou Y A , B i s h o p D F , D e s n i c k R J (1992) Overexpress ion o f human alpha-galactosidase A results i n its intracellular aggregation, c rys ta l l iza t ion i n lysosomes, and selective secretion. J C e l l B i o l 119: 1137-50. Jezyk P F , Hask ins M E , Patterson D F , M e l l m a n W J , Greenstein M (1977) Mucopo lysaccha r idos i s i n a cat w i t h arylsulfatase B def ic iency: a m o d e l o f Maroteaux-L a m y syndrome. Science 198: 834-6. Kaar t inen V , N a g y A (2001) R e m o v a l o f the f loxed neo gene f rom a condi t iona l knockout allele by the adenoviral C re recombinase in vivo. Genesis 31 : 126-9. K a k k i s E D (2002) E n z y m e replacement therapy for the mucopolysacchar ide storage disorders. Exper t O p i n Investig Drugs 11: 675-85. K a k k i s E D , M a t y n i a A , Jonas A J , N e u f e l d E F (1994) Overexpress ion o f the human lysosomal enzyme alpha-L-iduronidase i n Chinese hamster ovary cel ls . Pro te in E x p r P u r i f 5: 225-32. K a k k i s E D , M c E n t e e M F , Schmidtchen A , N e u f e l d E F , W a r d D A , C o m p f R E , K a n i a S, B e d o l l a C , C h i e n S - L , S h u l l R M (1995) Long- t e rm and high-dose trials o f enzyme replacement therapy i n the canine m o d e l o f mucopolysacchar idos is I. B i o c h e m M o l e c u l a r M e d 58: 156-167. 169 K a k k i s E D , M c E n t e e M F , Schmid tchen A , N e u f e l d E F , W a r d D A , G o m p f R E , K a n i a S, B e d o l l a C , C h i e n S L , S h u l l R M (1996) Long- t e rm and high-dose trials o f enzyme replacement therapy i n the canine m o d e l o f mucopolysacchar idos is I. B i o c h e m M o l M e d 58: 156-67. K a k k i s E D , M u e n z e r J , T i l l e r G E , Wabe r L , B e l m o n t J , Passage M , I z y k o w s k i B , P h i l l i p s J , D o r o s h o w R , W a l o t I, Hof t R , N e u f e l d E F (2001) Enzyme-replacement therapy i n mucopolysacchar idos is I. N e w E n g J M e d 344: 182-188. K a k k i s E D , Schuchman E , H e X , W a n Q , K a n i a S, W i e m e l t S, Hasson C W , O ' M a l l e y T , W e i l M A , A g u i r r e G A , B r o w n D E , Hask ins M E (2001) E n z y m e replacement therapy i n feline mucopolysacchar idos is I. M o l Genet M e t a b 72: 199-208. K a r n i s k i L P , Lotscher M , Fucentese M , H i l f i k e r H , B i b e r J , M u r e r H (1998) Immunoloca l i za t ion o f sat-1 sulfate/oxalate/bicarbonate an ion exchanger i n the rat k idney . A m J P h y s i o l 275: F79-87 . K a s e R , Sh immoto M , Itoh K , U t s u m i K , K o t a n i M , T a y a C , Y o n e k a w a H , Sakuraba H (1998) Immunohis tochemica l characterization o f transgenic m i c e h igh ly expressing human lysosomal alpha-galactosidase. B i o c h i m B i o p h y s A c t a 1406: 260-6. K e e l i n g K M , B e d w e l l D M (2002) C l i n i c a l l y relevant aminoglycos ides can suppress disease-associated premature stop mutations i n the I D U A and P53 c D N A s i n a m a m m a l i a n translation system. J M o l M e d 80: 367-76. K o r n f e l d S (1987) Tra f f i ck ing o f l y sosomal enzymes. F A S E B J 1: 462-8. K y l e J W , B i rkenme ie r E H , G w y n n B , V o g l e r C , H oppe P C , Hof fmann J W , S l y W S (1990) Cor rec t ion o f murine mucopolysacchar idos is V I I by a human beta-glucuronidase transgene. P roc N a t l A c a d S c i U S A 87: 3914-8. L a k s o M , Sauer B , M o s i n g e r B Jr, L e e E J , M a n n i n g R W , Y u S H , M u l d e r K L , Wes tpha l H (1992) Targeted oncogene act ivat ion by site-specific recombinat ion i n transgenic mice . Proc N a t l A c a d S c i U S A 89: 6232-6. L a l l e m a n d Y , L u r i a V , Haf fher -Krausz R , L o n a i P (1998) Ma te rna l ly expressed P G K - C r e transgene as a tool for early and un i fo rm act ivat ion o f the Cre site-specific recombinase. Transgenic Res . 7: 105-12. L e e A , B e c k L , B r o w n R J , M a r k o v i c h D (1999) Identif icat ion o f a m a m m a l i a n bra in sulfate transporter. B i o c h e m B i o p h y s Res C o m m u n 263: 123-9. L e e A , B e c k L , M a r k o v i c h D (2003) The mouse sulfate an ion transporter gene S a t l ( S l c 2 6 a l ) : c lon ing , tissue dis t r ibut ion, gene structure, functional characterization, and transcriptional regulat ion thyro id hormone. D N A C e l l B i o l 22 : 19-31. L e w a n d o s k i M (2001) Cond i t i ona l control o f gene expression i n the mouse. N a t R e v Genet 2: 743-55. 170 L o b e C G , K o o p K E , Kreppner W , L o m e l i H , Gertsenstein M , N a g y A (1999) Z / A P , a double reporter for cre-mediated recombinat ion. D e v B i o l 208 : 281-92. L o w r y O H , Rosebrough N S , F a i r A L , R a n d a l l R . (1951) Pro te in measurement w i t h the fo l i n phenol reagent. J B i o l C h e m 193: 265-272. L o w r y R B , App lega r th D A , Toone J R , M a c D o n a l d E , T h u n e m N Y (1990) A n update o n the frequency o f mucopolysacchar ide syndromes i n B r i t i s h C o l u m b i a . H u m Genet 85: 389-90. L u d w i g T , Eggenshwi le r J , F isher P , D ' E r c o l e A J , Davenpor t M L , Efstariadis A (1996) M o u s e mutants l ack ing the type 2 I G F receptor ( I G F 2 R ) are rescued f rom perinatal lethali ty i n Igf2 and I g f l r n u l l backgrounds. D e v e l o p B i o 177: 517-535. L u t z k o C , K r u t h S, A b r a m s - O g g A C , L a u K , L i L , C l a r k B R , R u e d y C , N a n j i S, Foster R , K o h n D , S h u l l R , Dube I D (1999) Gene t ica l ly corrected autologous stem cel ls engraft, but host immune responses l i m i t their u t i l i ty i n canine a lpha-L-iduronidase def iciency. B l o o d 93: 1895-905. L u t z k o C , Meertens L , L i L , Zhao Y , A b r a m s - O g g A , W o o d s J P , K r u t h S, H o u g h M R , D u b e I D (2002) H u m a n hematopoiet ic progenitors engraft i n fetal canine recipients and expand w i t h neonatal injection o f fibroblasts expressing human hematopoiet ic cytokines . E x p Hemato l 30: 801-8. L u t z k o C , O m o r i F , A b r a m s - O g g A C , S h u l l R , L i L , L a u K , R u e d y C , N a n j i S, Gar t ley C , D o b s o n H , Foster R , K r u t h S, D u b e I D (1999) Gene therapy for canine a lpha -L-iduronidase def ic iency: in utero adoptive transfer o f genet ical ly corrected hematopoiet ic progenitors results i n engraftment but not amel iora t ion o f disease. H u m Gene Ther 10: 1521-32. M a c D o n a l d M E , Scott H S , W h a l e y W L , P o h l T , W a s m u t h J J , L e h r a c h H , M o r r i s C P , F r i s chau f A M , H o p w o o d J J , G u s e l l a J F (1991) Hunt ing ton disease-l inked locus D 4 S 1 1 1 exposed as the a lpha-L-iduronidase gene. Somat C e l l M o l Genet 17: 21-5. M a n s h o u r i T , Y a n g Y , L i n H , Stass S A , G la s sman A B , K e a t i n g M J , A l b i t a r M (1997) Downregu la t ion o f R A R alpha i n mice by antisense transgene leads to a compensatory increase i n R A R beta and R A R gamma and development o f l y m p h o m a . B l o o d 89: 2507-15. M a r k o v i c h D , B i s s i g M , Sorribas V , Hagenbuch B , M e i e r P J , M u r e r H (1994) Expre s s ion o f rat renal sulfate transport systems i n X e n o p u s laevis oocytes. Func t iona l characterization and molecular identif icat ion. J B i o l C h e m 269: 3022-6. M c K u s i c k V A , N e u f e l d E F (1983) The mucopolysacchar ide storage disesases. In.-Stanbury J B . Wyngaarden J B , F redr i ckson D S , Go lds t e in J L , B r o w n M S (eds): T h e M e t a b o l i c basis o f Inherited disease, 5 t h E d i t i o n . N e w Y o r k : M c G r a w - H i l l , pp 751-777. 171 M e d b e r r y S L , D a l e E , Q i n M , O w D W (1995) Intra-chromosomal rearrangements generated b y C r e - l o x site-specific recombinat ion. N u c l e i c A c i d s Res 2 3 : 485-90. Meertens L , Z h a o Y , R o s i c - K a b l a r S, L i L , C h a n K , D o b s o n H , Gar t ley C , L u t z k o C , H o p w o o d J , K o h n D , K r u t h S, H o u g h M R , D ube I D (2002) In utero inject ion o f a lpha-L-iduronidase-carrying retrovirus i n canine mucopolysacchar idos is type I: infect ion o f mul t ip le tissues and neonatal gene expression. H u m Gene Ther 13: 1809-20. M o s e l e y R H , H o g l u n d P , W u G D , S i lbe rg D G , H a i l a S, de l a Chape l le A , H o l m b e r g C , K e r e J (1999) Downregula ted i n adenoma gene encodes a chlor ide transporter defective i n congeni ta l ch lor ide diarrhea. A m J P h y s i o l 276: G 1 8 5 - 9 2 . M o u n t f o r d P , Z e v n i k B , D u w e l A , N i c h o l s J , L i M , D a n i C , Rober tson M , Chambers I, S m i t h A (1994) D ic i s t ron i c targeting constructs: Reporters and modif iers o f m a m m a l i a n gene expression. Proc N a t l A c a d S c i U S A 91 : 4303-4307. N a g y A (1997) Fo rma t ion o f mouse ch imer ic embryos f rom E S cel ls . In: Houdeb ine L M , editor. A m s t e r d a m : H a r w o o d A c a d e m i c Publishers , p 167-172 . N a g y A (2000) C r e recombinase: the universa l reagent for genome ta i lor ing . Genesis 26 : 99-109. N a g y A , M a r L (2001) Crea t ion and use o f a Cre recombinase transgenic database. Methods M o l B i o l 158: 95-106. N a g y A , Rossant J , N a g y R , A b r a m o w - N e w e r l y W , Roder J C (1993) Der iva t ion o f comple te ly c e l l culture-derived mice f rom early-passage embryonic stem cel ls . P roc N a t l A c a d S c i U S A 90: 8424-8428. N a g y A . U R L : h t tp : / /www.msl i r i .on.ca/develop/nagy/Cre .htm. N e u f e l d E F (1991) L y s o s o m a l storage diseases. A n n R e v B i o c h e m 60: 257-280. N e u f e l d E F , M u e n z e r J (1995) The mucopolysacchar idoses . In: Scr iver C R , Beaudet A L , S l y W S , V a l l e D , eds. The metabol ic and molecula r bases o f inheri ted disease, 7th edn. N e w Y o r k : M c G r a w H i l l : 2427-2839. N i w a H , Y a m a m u r a K , M i y a z a k i J (1991) Eff ic ien t select ion for high-express ion transfectants w i t h a nove l eukaryotic vector. Gene 108: 193-200. N o v a k A , G u o C , Y a n g W , N a g y A , L o b e C G (2000) Z / E G , a double reporter mouse l ine that expresses enhanced green fluorescent protein upon Cre-mediated exc i s ion . Genesis 28: 147-55. O ' C o n n o r L H , E r w a y L C , V o g l e r C A , S l y W S , N i c h o l e s A , G r u b b J , H o l m b e r g S W , L e v y B , Sands M S (1998) E n z y m e replacement therapy for murine mucopolysacchar idos is type V I I leads to improvements i n behavior and auditory function. J C l i n Invest 101: 1394-400. 1 7 2 O ' G o r m a n S, F o x D T , W a h l G M (1991) Recombinase-mediated gene act ivat ion and site-specific integration i n m a m m a l i a n cel ls . Science 251 : 1351-5. Pearson A D (1986) Survey o f preparative regimens and compl ica t ions o f bone mar row transplantation i n patients w i t h lysosomal storage diseases. B i r t h Defects O r i g A r t i e Ser 22 : 153-62. Peters C , Bal thazor M , Shapiro E G , K i n g R J , K o l l m a n C , H e g l a n d J D , Hens l ee -Downey H , T r i g g M E , C o w a n M J , Sanders J , B u n i n N , Weins t e in H , Lenarsky C , F a l k P , Harr i s R , B o w e n T, W i l l i a m s T E , G r a y s o n G H , W a r k e n t i n P , Sender L , C o o l , V A , Cri t tenden M , P a c k m a n S, K a p l a n P , L o c k m a n L A , A n d e r s o n J , K r i v i t W , Dunsenbery K , Wagner J (1996) Outcome o f Unre la ted donor bone mar row transplantation i n 40 ch i ld ren w i t h Hur le r syndrome. B l o o d 87: 4894-4902. Piatt F M , Neises G R , Reinkensmeier G , T o w n s e n d M J , Perry V H , P r o i a R L , Winchester B , D w e k R A , Butters T D (1997) Prevent ion o f l y sosomal storage i n Tay-Sachs mice treated w i t h N - b u t y l d e o x y n o j i r i m y c i n . Science 276: 428-431. Poenaru L (1997) Firs t trimester prenatal diagnosis o f metabol ic diseases. Prenat d iagn 7: 333. Post ic C , Shiota M , N i swende r K D , Jetton T L , C h e n Y , Moates J M , Shel ton K D , L i n d n e r J , Cher r ington A D , M a g n u s o n M A (1999) D u a l roles for glucokinase i n glucose homeostasis as determined by l ive r and pancreatic beta cel l -specif ic gene knock-outs us ing Cre recombinase. J B i o l C h e m 274: 305-15. R a b e n N , L u N , Nagara ju K , R i v e r a Y , L e e A , Y a n B , B y r n e B , M e i k l e P J , Umapafhys ivam K , H o p w o o d J J , P lo t z P H (2001) Cond i t i ona l t issue-specific expression o f the ac id alpha-glucosidase ( G A A ) gene i n the G A A knockout mice : impl ica t ions for therapy. H u m M o l Genet 10: 2039-47. R a u c h U , Feng K , Z h o u X H (2001) Neurocan : a bra in chondroi t in sulfate proteoglycan. C e l l M o l L i f e S c i 58: 1842-56. Regeer R R , L e e A , M a r k o v i c h D (2003) Character izat ion o f the human sulfate an ion transporter (hsat-1) protein and gene ( S A T 1 ; S L C 2 6 A 1 ) . D N A C e l l B i o l 22 : 107-17. Reuser A J , V a n D e n H o u t H , B i jvoe t A G , K r o o s M A , Verbeet M P , V a n D e r P l o e g A T (2002) E n z y m e therapy for Pompe disease: f rom science to industr ial enterprise. E u r J Pediar 161 Supp l 1: S106-11 . Ross C J , Bastedo L , M a i e r S A , Sands M S , C h a n g P L (2000) Treatment o f a lysosomal storage disease, mucopolysacchar idos is V I I , w i t h microencapsulated recombinant cel ls . H u m Gene Ther 11 :2117-27 . Ross C J , R a l p h M , Chang P L (2000) Somat ic gene therapy for a neurodegenerative disease us ing microencapsulated recombinant cel ls . E x p N e u r o l 166: 276-86. 173 R o u b i c e k M , Gehle r J , Spranger J (1985) The c l i n i c a l spectrum o f a lpha-L-iduronidase def ic iency. A m J M e d Genet 20 : 471-481 . R o u g h l e y P J , L e e E R (1994) Cart i lage proteoglycans: structure and potential functions. M i c r o s c Res T e c h 28: 385-97. R u s s e l l C , Hendson G , Jevon G , M a t l o c k T , Y u J , A k l u j k a r M , N g K Y , C l a r k e L A (1998) M u r i n e M P S I: insights into the pathogenesis o f Hur le r syndrome. C l i n Genet 53: 349-61. Saka i K , H i r i p i L , G l u m o f f V , B randau O , E e r o l a R , V u o r i o E , B o s z e Z , Fass ler R , A s z o d i A (2001) Stage-and tissue-specific expression o f a C o l 2 a l - C r e fusion gene i n transgenic mice . M a t r i x B i o l 19: 761-7. Sands M S , Barke r J E , V o g l e r C , L e v y B , G w y n n B , G a l v i n N , S l y W S , B i rkenme ie r E (1993) Treatment o f murine mucopolysacchar idos is type V I I by syngeneic bone mar row transplantation i n neonates. L a b Invest 68: 676-86. Sands M S , V o g l e r C , Tor rey A , L e v y B , G w y n n B , Grubb J , S l y W S , B i rkenme ie r E H (1997) M u r i n e mucopolysacchar idos is type V I I : l ong term therapeutic effects o f enzyme replacement and enzyme replacement fo l l owed by bone mar row transplantation. J C l i n Invest 99: 1596-1605. Scheie H G , H a m b r i c k G W , Barness L A (1962) A newly recognised forme fruste o f Hur l e r ' s disease (gargoyl ism). A m e r J Ophathal 53: 753-769. Scott H S , A n s o n D A , Orsborn A M , N e l s o n P V , Clements P , M o r r i s C P and H o p w o o d J J (1991) H u m a n alpha-L-idurondidase: c D N A iso la t ion and expression. P roc N a t l A c a d S c i U S A 88: 9695-9699. Scott H S , B u n g e S, G a l A , C la rke L A , M o r r i s C P , H o p w o o d JJ (1995) M o l e c u l a r genetics o f mucopolysacchar idos is type I: diagnost ic , c l i n i c a l , and b i o l o g i c a l impl ica t ions . H u m M u t 6: 288-302. Scott H S , G u p X - H , H o p w o o d J J , M o r r i s C P (1992) Structure and sequence o f the human a lpha-L-iduronidase gene. G e n o m i c s 13: 1311-1313. Scott H S , Li t jens T , N e l s o n P V , T h o m p s o n P R , B r o o k s D A , H o p w o o d J J , M o r r i s C P (1993) Identif icat ion o f mutations i n the a lpha-L-iduronidase gene ( I D U A ) that cause Hur l e r and Scheie syndromes. A m e r J H u m G e n 53: 973-86. Shapiro E G , L o c k m a n L A , Ba l thazor M , K r i v i t W (1995) Neuropsycho log ica l outcomes o f several storage diseases w i t h and without bone mar row transplantation. J Inner M e t a b D i s 18 :413-429 . Shapiro E G , L o c k m a n L A , Ba l thazor M , K r i v i t W (1995) Neuropsycho log i ca l outcomes o f several storage diseases w i t h and without bone mar row transplantation. J Inherit Me tab D i s 18:413-29. 174 Shel ley S, and Arnaou t A (1991) The promoter o f the C D 1 I B gene directs m y e l o i d -specific and developmenta l ly regulated expression. Proc N a t l A c a d S c i 88: 10525-10529. S h u l l R M , Bre ider M A , Constantopoulos G (1988) Long- te rm neuro logica l effects o f bone mar row transplantation i n a canine lysosomal storage disease. Ped ia Res 24: 347-352. S h u l l R M , K a k k i s E D , M c E n t e e M F , K a n i a S A , Jonas A J , N e u f e l d E F (1994) E n z y m e replacement i n a canine mode l o f Hur le r syndrome. Proc N a t l A c a d S c i U S A 91 : 12937-4 1 . S h u l l R M , L u X , M c E n t e e M F , Br igh t R M , Pepper K A , K o h n D B (1996) M y o b l a s t gene therapy i n canine mucopolysacchar idos is . I: A b r o g a t i o n by an immune response to alpha-L- iduronidase . H u m Gene Ther 7: 1595-603. S h u l l R M , M u n g e r R J , Spel lacy E , H a l l C W , Constantopoulos G , N e u f e l d E (1982) A n i m a l mode l o f human disease. Canine a -L- iduron idase def ic iency: a mode l o f mucopolysacchar idos is I. A m J Pa thol 244-248. S h u l l R M , W a l k e r M A (1988) Radiographic f indings i n a canine mode l o f mucopolysacchar idos is I: changes associated w i t h bone mar row transplantation. Invest R a d i o l 23 : 124-130. Snyder E Y , T a y l o r R M , W o l f e J H (1995) N eu r a l progenitor ce l l engraftment corrects l y sosomal storage throughout the M P S V I I mouse brain. Nature 374: 367-70. Song H H , F i l m u s J (2002) The role o f g lypicans i n m a m m a l i a n development. B i o c h i m B i o p h y s A c t a 1573: 241-6. Soper B W , Lessard M D , V o g l e r C A , L e v y B , Beamer W G , S l y W S , Ba rke r J E (2001) Nonab la t ive neonatal ma r row transplantation attenuates functional and phys ica l defects o f beta-glucuronidase def iciency. B l o o d 97: 1498-504. Southern E M (1975) Detec t ion o f specific sequences among D N A fragments separated b y gel electrophoresis. J M o l B i o l 98: 503-517. Stevenson R E , H o w e l l R R , M c K u s i c k V A , Susk ind R , H a n s o n J W , E l l i o t t D E , N e u f e l d E F (1976) The iduronidase-deficient mucopolysacchar idoses: c l i n i c a l and roentgenographic features. Pediatr ics 57: 111-122. Stoltzfus L J , Sosa-Pineda B , M o s k o w i t z S M , M e n o n K P , Dlo t t B , Hoope r L , T e p l o w D B , S h u l l R M , N e u f e l d E F (1992) C l o n i n g and characterizat ion o f c D N A encoding canine a lpha-L-iduronidase . m R N A def ic iency i n mucopolysacchar idos is I dog. J B i o l C h e m 267: 6570-5. S u z u k i K (1965) The pattern o f m a m m a l i a n bra in gangliosides-II . E v a l u a t i o n o f the extract ion procedures, post-mortem changes and the effect o f fo rmal in preservation. J N e u r o c h e m 12: 629-638. 175 T a y l o r R M , W o l f e J H (1997) Decreased lysosomal storage i n the adult M P S V I I mouse bra in i n the v i c i n i t y o f grafts o f retroviral vector-corrected fibroblasts secreting h igh levels o f beta-glucuronidase. N a t M e d 3: 771 -4. T o r z i l l i P A , A r d u i n o J M , Gregory J D , Bansa l M (1997) Effect o f proteoglycan r emova l o n solute m o b i l i t y i n articular cartilage. J B i o m e c h 30: 895-902. V o g l e r C , L e v y B , G a l v i n N J , Thorpe C , Sands M S , Barke r J E , B a t y J , B i rkenme ie r E H , S l y W S (1999) E n z y m e replacement i n murine mucopolysacchar idos is type V I I : neuronal and g l i a l response to beta-glucuronidase requires early in i t ia t ion o f enzyme replacement therapy. Pediatr Res 45: 838-44. V o g l e r C , Sands M S , L e v y B , G a l v i n N , B i rkenme ie r E H , S l y W S (1996) E n z y m e replacement w i t h recombinant beta-glucuronidase i n mur ine mucopolysacchar idos is type V I I : impact o f therapy dur ing the first s ix weeks o f l i fe o n subsequent ly sosomal storage, growth, and surv iva l . Pediatr Res 39: 1050-4. V o n F i g u r a K . , H a s i l i k A (1986) L y s o s o m a l enzymes and their receptors. A n n R e v B i o c h e m 55: 167-93. W a l k l e y S U (1995) P y r a m i d a l neurons w i t h ectopic dendrites i n storage diseases exhibi t increased G M 2 ganglioside immunoreact iv i ty . Neurosc ience 68: 1027-1035. W a l k l e y S U , Hask ins M E , S h u l l R M (1988) Al tera t ions i n neuron morpho logy i n mucopolysacchar idos is type I: a G o l g i study. A c t a Neuropa tho l 75: 611-620. Watts W E , G i b b s D A (1986) L y s o s o m a l storage diseases: b iochemica l and c l i n i c a l aspects. Tay la r and Francis , L o n d o n pubs 1986. W h i t l e y , B , R idnour , M D , Draper , K A , Dut ton , C M , N e g l i a , J P (1989) Diagnos t ic test for mucopolysacchar idos is I. D i rec t method for quant i fying excessive ur inary g lycosaminog lycan excret ion. C l i n C h e m 35: 374-379. W o o d S A , A l l e n N D , Rossant J , A u e r b a c h A , N a g y A (1993) Non- in j ec t ion methods for the product ion o f embryonic stem ce l l -embryo chimeras. Nature 365: 87-89. W r a i t h J E (2001) E n z y m e replacement therapy i n mucopolysacchar idos is type I: progress and emerging diff icult ies. J Inherit Me tab D i s 24: 245-50. Wurs t W , Joyner A (1993) Produc t ion o f targeted embryonic stem ce l l c lones. In Gene Target ing: A Prac t ica l A p p r o a c h . ( E d . A . Joyner) , 33-62. I R L Press at O x f o r d U n i v e r s i t y Press X i n H B , D e n g K Y , R i s h n i w M , J i G , K o t l i k o f f M I (2002) Smoo th muscle expression o f Cre recombinase and e G F P i n transgenic mice . P h y s i o l G e n o m i c s 10: 211-5 . 176 Z i n y k D L , M e r c e r E H , Har r i s E , A n d e r s o n D J , Joyner A L (1998) Fate mapp ing o f the mouse midbra in-h indbra in constr ic t ion us ing a site-specific recombinat ion system. C u r r B i o l 8: 665-8. 177 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0099792/manifest

Comment

Related Items