UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Transgenic expression of human alpha-L-iduronidase in mouse and characterization of the long term pathophysiology… Russell, Christopher Spencer 2003

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2004-902595.pdf [ 22.93MB ]
Metadata
JSON: 831-1.0099792.json
JSON-LD: 831-1.0099792-ld.json
RDF/XML (Pretty): 831-1.0099792-rdf.xml
RDF/JSON: 831-1.0099792-rdf.json
Turtle: 831-1.0099792-turtle.txt
N-Triples: 831-1.0099792-rdf-ntriples.txt
Original Record: 831-1.0099792-source.json
Full Text
831-1.0099792-fulltext.txt
Citation
831-1.0099792.ris

Full Text

TRANSGENIC EXPRESSION OF H U M A N ALPHA-L-IDURONIDASE IN MOUSE AND CHARACTERIZATION OF THEL O N G T E R M PATHOPHYSIOLOGY OF MURINE ALPHA-L-IDURONIDASE DEFICIENCY By C h r i s t o p h e r Spencer R u s s e l l B . S c , U n i v e r s i t y o f B r i t i s h C o l u m b i a , 1993  A THESIS SUBMITTED IN P A R T I A L F U L F I L L M E N T OF THE REQUIREMENTS F O RT H ED E G R E E OF DOCTOR OF PHILOSOPHY In THE F A C U L T Y OF G R A D U A T E STUDIES Department o f M e d i c a l Genetics W e accept this thesis/^s c o n f o r m i n g toA)(e r e q u i r e d standard  THEU^VERSIT^OFBRITISH COLUMBIA  D e c e m b e r 2003  © C h r i s t o p h e r Spencer R u s s e l l , 2 0 0 3  Abstract M u c o p o l y s a c c h a r i d o s i s type I ( M P S I) is a n a u t o s o m a l recessive genetic disorder resulting from deficiency o f alpha-L-iduronidase ( I D U A ) , a lysosomal hydrolase required i n the c a t a b o l i s m o f heparan a n d dermatan sulfate g l y c o s a m i n o g l y c a n s ( G A G s ) .  MPSI  presents as a c l i n i c a l s p e c t r u m o f disease r a n g i n g f r o m a severe m u l t i s y s t e m disease w i t h associated death i n the first decade ( H u r l e r s y n d r o m e ) to m i l d e r f o r m s o f M P S I w h i c h are c o m p a t i b l e w i t h a n o r m a l lifespan (Scheie s y n d r o m e ) . T o w a r d s a better understanding o f M P S I, I h a v e c h a r a c t e r i z e d the l o n g t e r m p a t h o p h y s i o l o g y o f m u r i n e I D U A d e f i c i e n c y . S k e l e t a l manifestations represent the earliest c l i n i c a l f i n d i n g i n M P S I m i c e w i t h h i s t o l o g i c a n a l y s i s o f g r o w t h plate and c o r t i c a l bone r e v e a l i n g e v i d e n c e that significant early p a t h o l o g y is present. A n a l y s i s o f the central n e r v o u s s y s t e m has r e v e a l e d the n o v e l f i n d i n g o f p r o g r e s s i v e n e u r o n a l degeneration w i t h i n the c e r e b e l l u m . I n a d d i t i o n , b r a i n tissue f r o m M P S I m i c e s h o w increased l e v e l s o f G M 2 and GM3 g a n g l i o s i d e s . W h i l e p e r s i s t i n g to a d u l t h o o d a n d capable o f m a t i n g , the I D U A deficient m o u s e m o s t c l o s e l y resembles severe M P S I i n h u m a n s or H u r l e r s y n d r o m e . W h i l e m a n y efforts are directed t o w a r d s s o l v i n g the p r o b l e m s o f l o n g t e r m therapeutic gene e x p r e s s i o n , it r e m a i n s to be d e t e r m i n e d i f gene therapy w i l l have the desired curative effects o n the host o f M P S I s y m p t o m s , a n d , a d d i t i o n a l l y , whether e x p r e s s i o n o f therapeutic genes i n a n unregulated m a n n e r w i l l disrupt n o r m a l c e l l u l a r m e t a b o l i s m , i.e. i n d u c i n g disease. I have s u c c e s s f u l l y generated m u r i n e strains w h i c h have the potential to express h u m a n I D U A i n a c o n d i t i o n a l transgenic a p p r o a c h . In a d d i t i o n to genetic crosses into the I D U A deficient strain to address the benefit o f I D U A  e x p r e s s i o n i n s p e c i f i c tissues at defined t i m e p o i n t s , these transgenic m i c e lines c a n p r o v i d e a source o f h u m a n I D U A e x p r e s s i n g c e l l s for use i n transplantation studies. F i n a l l y , the p h e n o t y p e o f transgenic h u m a n I D U A e x p r e s s i o n , i f any, c a n be determined. It is h o p e d that these m o u s e strains w i l l be useful i n d e t e r m i n i n g l e v e l s , l o c a t i o n s , and t i m e points important to the efficacy and safety o f gene therapy for M P S I.  Table of Contents Abstract Table of Contents  ,  Table of Figures Table of Tables List of Abbreviations  CHAPTER 1: INTRODUCTION  1  1.1 Thesis Focus and Chapter Overview  1  1.2 MPS 1 1.2.1 Clinical Presentation of MPS 1 1.2.2 Glycosaminoglycans and proteoglycans 1.2.3 Secondary storage in MPS 1 1.2.4 The MPS family of disorders 1.2.5 Genetics 1.2.7 IDUA protein synthesis and transport to the lysosome  21  1.3 Therapies for MPS I 1.3.1 Rationale 1.3.2 MPS animal models 1.3.3 Bone Marrow Transplantation for MPS I in humans 1.3.4 Bone marrow transplantation in MPS animal models 1.3.5 Cellular transplantation in MPS animal models 1.3.6 Gene therapy for MPS 1 1.3.7 Gene therapy in animal models of MPS disorders 1.3.8 Enzyme replacement therapy for human lysosomal disorders 1.3.9 Enzyme replacement in animal models of MPS 1.3.10 Generation of a murine model of MPS 1  23 23 26 29 30 31 32 33 37 38 39  1.4 Thesis objectives and supporting hypotheses  45  CHAPTER 2: MATERIALS AND METHODS  4  4  7 12 13 1  4  46  2.1 Polymerase chain reaction 7 2.2 Preparation of the human IDUA cDNA 7 2.3 Construction of the myeloid-specific transgene constructs. (CD11B-IDUA and CD1 IB-reporter gene) 2.4 Construction of the myeloid-specific transgene constructs with a selection cassette for selection in ES cells. (CD11B-IDUA and CD1 IB-reporter gene) 48 2.5 Construction of a ubiquitous IDUA expressing transgene construct. (CMV-IDUA) 49 2.6 Construction of a ubiquitous IDUA expressing transgene construct with a selection cassette for selection in ES cells. (pFlox-IDUA) 50 2.7 Construction of a ubiquitous IDUA expressing transgene construct with a selection cassette for selection in ES cells. (pCAGGS-IDUA) 50 2.8 Construction of a conditional Cre regulated transgene construct with a selection cassette for selection in ES cells (pCCALL2-IRES-IDUA) 52 2.9 Histopathology 52 4  4  4  8  iv  2.10 2.11 2.12 2.13 2.14 2.15 2.16 2.17 2.18 2.19 2.20 2.21 2.22  Radiography Thin Layer Chromatography of Gangliosides Colorimetric Assay of Glycosaminoglycans Embryonic stem cell growth and electroporation Transfection of ES cells with Cre plasmid IDUA enzyme assay Beta-galactosidase staining of ES cells and tissue fragments Alkaline phosphatase staining of ES cells Alkaline phosphatase staining ear punches and tissue DNA Isolation Transformation Southern blotting Animals  fragments  CHAPTER 3: CHARACTERIZATION OF THE LONG TERM PATHOPHYSIOLOGY OF MURINE MPS 1  53 53 54 54 55 55 56 56 57 58 59 59 59  61  3.1 Abstract  62  3.2 Introduction  62  3.3 Results  64  3.31 3.32 3.33 3.34 3.36 3.37 3.38 3.39  Clinical Features Life span of MPS I mice Growth Profiles Radiographic Examination Glycosaminoglycan Excretion Gangliosides Bone Histopathology Neuropathology  3.4 Discussion  64 66 67 70 72 73 74 77 80  CHAPTER 4: PRONUCLEAR AND EMBRYONIC STEM CELL ATTEMPTS AT GENERATION OF MURINE TRANSGENIC LINES WITH UBIQUITOUS OR MYELOID SPECIFIC EXPRESSION OF HUMAN IDUA 89 4.1. Introduction 4.1.1 A model of in utero bone marrow transplantation 4.1.2 Widespread high level IDUA expression 4.1.3 The use of the human IDUA cDNA 4.1.4 The generation of transgenic mice  90 93 95 97 99  4.2 Results 4.2.1 Pronuclear injection approach for the generation of myeloid specific, and ubiquitous, IDUA expressing transgenic mice 4.2.2 Embryonic stem cell approach for the generation of myeloid specific and ubiquitous IDUA expression  103  4.3 Discussion  120  103 Ill  v  CHAPTER 5: CONDITIONAL TRANSGENIC EXPRESSION OF HUMAN ALPHA-L-IDURONIDASE IN A MURINE MODEL TO ESTABLISH EFFECTIVE AND TOLERABLE LIMITS FOR GENE THERAPY FOR MPS 1 121 5.1 Introduction 5.1.1 Conditional transgene regulation systems 5.1.3 Experimental Approach  122 123 130  5.2 Results  137  5.3 Discussion  151  CHAPTER 6: SUMMARY AND CONCLUSIONS  155  6.1 Characterization of the long term pathophysiology of murine MPS 1  156  6.2 Future work:  157  6.3: Generation of transgenic murine strains expressing human IDUA  157  6.4 Future work  163  REFERENCES  164  vi  Table of Figures F i g u r e 1.1: H e p a r a n sulfate e x o d e g r a d a t i o n  8  F i g u r e 1.2: D e r m a t a n sulfate e x o d e g r a d a t i o n  10  F i g u r e 1.3: O r g a n i z a t i o n o f the h u m a n I D U A gene l o c u s  15  F i g u r e 1.4: T h e h u m a n I D U A c D N A  16  F i g u r e 1.5: E n d o g e n o u s and exogenous p a t h w a y s for transport o f l y s o s o m a l e n z y m e s i n c l u d i n g I D U A to the l y s o s o m e s  22  F i g u r e 1.6: R o u t e s for the i n t r o d u c t i o n o f therapeutic I D U A  24  F i g u r e 1.7: Targeted i n a c t i v a t i o n o f the m u r i n e Idua gene  41  F i g u r e 1.8: C l i n i c a l feature o f Idua -/- m i c e at 12 w e e k s o f age  43  F i g u r e 1.9: E l e c t r o n m i c r o g r a p h s f r o m 8 w e e k o l d Idua -/- and c o n t r o l m i c e  44  F i g u r e 3.1: P h e n o t y p e o f M P S I m i c e  65  F i g u r e 3.2: L i f e span o f affected a n i m a l s  67  F i g u r e 3.3 A : G r o w t h curves o f m a l e Idua -/- m i c e relative to n o r m a l s  68  F i g u r e 3 . 3 B : G r o w t h curves o f female Idua -/- a n d c o n t r o l m i c e  69  F i g u r e 3.4: R a d i o g r a p h i c e x a m i n a t i o n o f I d u a -/- and c o n t r o l m i c e  70  F i g u r e 3.5: S k u l l s o f Idua -/- and n o r m a l m a l e m i c e at 7 0 w e e k s o f age  71  F i g u r e 3.6: G l y c o s a m i n o g l y c a n e x c r e t i o n i n m a l e I d u a -/- and n o r m a l m i c e  73  F i g u r e 3.7: T h i n l a y e r c h r o m a t o g r a m o f b r a i n l i p i d s  74  F i g u r e 3.8: P r o x i m a l t i b i a l g r o w t h plates  76  F i g u r e 3.9: P o l a r i z e d l i g h t m i c r o s c o p y o f c o r t i c a l bone samples  77  F i g u r e 3.10: P A S D s t a i n i n g o f the P u r k i n j e c e l l layer o f c e r e b e l l u m  79  F i g u r e 4 . 1 : Identity b e t w e e n h u m a n a n d m u r i n e I d u a e x o n II F i g u r e 4 . 3 : E m b r y o n i c stem c e l l a p p r o a c h for the generation o f transgenic m i c e  99 101  F i g u r e 4.4 T r a n s g e n i c construct for m y e l o i d s p e c i f i c e x p r e s s i o n 104 F i g u r e 4 . 5 : A m a p o f the b a c k b o n e C D 1 l b - h g h v e c t o r for m y e l o i d transgene e x p r e s s i o n 105 F i g u r e 4 . 7 : T h e p E G F P - C 2 p l a s m i d for e x p r e s s i o n o f enhanced green flourescent p r o t e i n 106 F i g u r e 4.8: A n a l y s i s o f 18 samples f r o m c o - m i c r o i n j e c t i o n o f C D 1 l b - I D U A a n d C D 1 l b L a c Z constructs  107  F i g u r e 4 . 9 : A n a l y s i s o f 11 samples f r o m c o - m i c r o i n j e c t i o n o f C D 1 l b - I D U A and C D 1 l b E G F P contructs F i g u r e 4.10: U b i q u i t o u s Transgene C o n s t r u c t C M V - I D U A  108 109  F i g 4 . 1 1 : A n a l y s i s o f samples f r o m m i c r o i n j e c t i o n o f u b i q u i t o u s I D U A construct C M V IDUA Figure 4.12: p F L O X - C M V - I D U A - E G F P  110 112  F i g u r e 4 . 1 3 : T h e F l o x vector used for E S s e l e c t i o n o f the u b i q u i t o u s I D U A a n d E G F P e x p r e s s i n g construct u s e d p r e v i o u s l y for p r o n u c l e a r i n j e c t i o n  113  F i g u r e 4.14: U b i q u i t o u s Transgene C o n s t r u c t p C A G G s - I D U A  114  F i g u r e 4 . 1 5 : p C A G G s v e c t o r for h i g h l e v e l e u k a r y o t i c e x p r e s s i o n  115  Figure 4.16: The p G T 1 . 8 I r e s B g e o vector  116  F i g u r e 4 . 1 7 : C D 1 l b - L a c Z reporter construct integrates into E S clones after c o e l e c t r o p o r a t i o n w i t h the C D 1 l b - I D U A - N e o construct  117  F i g u r e 4.18: Representation o f E S clones screened for beta-galactosidase staining intensity  118  vii  F i g u r e 5.1: C r e / l o x P r e c o m b i n a t i o n  128  F i g u r e 5.2: S c h e m a t i c o f the s e l e c t i o n a n d screening for desirable E S c l o n e s  132  F i g u r e 5.3: p C C A L L 2 - I R E S - h A P / c g  parent construct  133  F i g u r e 5.4: S c h e m a t i c o f the p C C A L L - I D U A construct  134  F i g u r e 5.5: R e c o m b i n a t i o n and the e x p r e s s i o n o f h u m a n I D U A  136  F i g u r e 5.6: Rearrangement c h e c k o n p C C A L L 2 construct  137  F i g u r e 5.7: P C R detection o f bacterial clones c o n t a i n i n g p C C A L L 2 ligated w i t h the human I D U A c D N A  138  F i g u r e 5.8: Pst I restriction digest o f p l a s m i d f r o m l i g a t i o n o f p C C A L L 2 construct w i t h h u m a n I D U A c D N A to determine orientation  139  F i g u r e 5.9: R e s t r i c t i o n d i g e s t i o n to identify c l o n e s w i t h c o r r e c t l y inserted a n d unrearranged h I D U A c D N A into p C C A L L 2  139  F i g u r e 5.10: A n a l y s i s o f large scale p l a s m i d i s o l a t i o n o f p C C A L L - I D U A  140  F i g u r e 5.11: L a c Z staining o f E S c o l o n i e s demonstrating e x p r e s s i o n v a r i a b i l i t y  141  F i g u r e 5.13: Southern b l o t analysis o f 48 E S c l o n e s w i t h g o o d reporter gene e x p r e s s i o n for single c o p y integrates  143  F i g u r e 5.14: A l k a l i n e phosphatase staining o f E S c e l l s c o n t a i n i n g s i n g l e c o p y integrations of p C C A L L - I D U A  145  F i g u r e 5.15: O v e r a l l Pedigree  150  F i g u r e 5.16: S c h e m a t i c o f the s e l e c t i o n a n d screen for desired E S c l o n e s  152  viii  Table of Tables  T a b l e 1.1: Representative p r o t e o g l y c a n  12  T a b l e 1.2: Strategies for the i n t r o d u c t i o n o f therapeutic I D U A  25  T a b l e 1.3: Therapies for M P S I assessed o n M P S m o d e l  34  Table 2.1: P C R primers  46  Table 4.1: Summary o f Pronuclear Microinjection attempts at generation o f transgenic lines  110  T a b l e 4 . 2 : B l a s t o c y s t i n j e c t i o n o f engineered E S clones produces o n l y l o w l e v e l chimeras  118  T a b l e 5.1: Representative C r e expressing m i c e  124  T a b l e 5.2: S u m m a r y o f E S c l o n e analysis  145  List of Abbreviations  AGU  aspartylgycoasminuria  beta-geo  n e o m y c i n a n d beta-galactosidase f u s i o n gene  BMT  bone m a r r o w transplantation  CD-MPR  c a t i o n dependent mannose-6-phosphate receptor  cDNA  complementary D N A  CHO CI-MPR  Chinese hamster o v a r y c e l l s c a t i o n independent mannose-6-phosphate receptor  CMV  cytomegalivirus  CNS  central nervous s y s t e m causes r e c o m b i n a t i o n r e c o m b i n a s e  Cre CRM  cross reactive m a t e r i a l  CS DMSO  c h o n d r o i t i n sulfate dimethyl sulfoxide  DNA  deoxyribonucleic acid  Dox  doxycycline  DS  dermatan sulfate  EC EE  extracellular space  EGFP  enhanced green flourescent p r o t e i n  ER  endoplasmic reticulum  ERT  e n z y m e replacement therapy  ES  e m b r y o n i c stem c e l l  ES  e m b r y o n i c stem (cell)  G GAG  golgi glycosaminoglycan  GM  ganglioside  GT  gene therapy  early e n d o s o m e  GUS  beta-glucuronidase  H & E hAP  h a e m a t o x y l i n and e o s i n stain  HD  huntington  h u m a n a l k a l i n e phosphatase  HLA  h u m a n l e u c o c y t e antigen  HS  heparan sulfate  HSC  hematopoietic stem c e l l s  i.v.  intra venous  IDUA  a l p h a - L - i d u r o n i d a s e e n z y m e , c D N A , or m R N A  IDUA Idua  a l p h a - L - i d u r o n i d a s e gene, h u m a n  IE  i m m e d i a t e early  IRES  internal r i b o s o m e entry site  kDA  kilo Daltons  KS L  keratan sulfate  a l p h a - L - i d u r o n i d a s e gene, m o u s e  lysosome  X  LacZ  beta-galactosidase  loxP  locus o f crossover  LSD  l y s o s o m a l storage disease  M-6-P  mannose-6-phosphate  MPRs  mannose-6-phosphate  MPS  mucopolysaccharidosis  mRNA  messenger R N A  pA  polyadenylation signal p e r i o d i c - a c i d s c h i f f w i t h diastase stain  PAS PBS PCR  receptors  phosphate buffered saline polymerase chain reaction  PGK  phospho-glycerate kinase  PM  plasma membrane rough endoplasmic reticulum  RER RNA  SAT-1 Sat-1  ribonucleic acid sulfate transporter-1 gene, h u m a n sulfate transporter-1 gene, m o u s e  SAT-1  sulfate transporter-1 p r o t e i n , c D N A , or m R N A  SRP TetR  tetracycline responsive  TSP  tissue s p e c i f i c p r o m o t e r  V  vesicle  s i g n a l r e c o g n i t i o n particle  xi  Chapter 1: Introduction 1.1 Thesis Focus and Chapter Overview T h i s thesis describes the l o n g t e r m c h a r a c t e r i z a t i o n o f m u r i n e I D U A d e f i c i e n c y a n d the generation o f transgenic m u r i n e strains c o n d i t i o n a l l y e x p r e s s i n g h u m a n I D U A . Severe M P S I i n humans is a m u l t i s y s t e m , p r o g r e s s i v e disease w i t h a characteristic p h e n o t y p e , h o w e v e r the p a t h o l o g i c a l and b i o c h e m i c a l alterations w h i c h u n d e r l i e the d e v e l o p m e n t o f overt s y m p t o m s i n M P S I are not w e l l understood a n d d i f f i c u l t to study i n h u m a n s . U s i n g a m o u s e m o d e l o f I D U A d e f i c i e n c y , I h a v e studied s p e c i f i c features o f I D U A d e f i c i e n c y and p r o v i d e n e w observations a n d insights o n the p a t h o p h y s i o l o g i c a l p r o g r e s s i o n o f I D U A d e f i c i e n c y i n m o u s e , and, l i k e l y , h u m a n s . Importantly, I D U A d e f i c i e n c y i n the m o u s e is f o u n d to most c l o s e l y r e s e m b l e severe I D U A d e f i c i e n c y i n h u m a n s , w i t h m u l t i s y s t e m progressive i n v o l v e m e n t o f m o s t tissues i n c l u d i n g skeletal and n e u r o l o g i c systems. T h e s e c o n d o b j e c t i v e o f this w o r k w a s the generation o f m o u s e strains c o n d i t i o n a l l y e x p r e s s i n g h u m a n I D U A for use i n d e t e r m i n i n g the o u t c o m e o f s p e c i f i c therapeutic reconstitution o f I D U A i n a b a c k g r o u n d o f c o m p l e t e I D U A d e f i c i e n c y . T h i s w i l l a l l o w for the assessment o f different therapy approaches for M P S I, w h i c h , a l o n g w i t h a n u m b e r o f other m e m b e r s o f a larger g r o u p o f genetic disorders c a l l e d l y s o s o m a l storage diseases ( L S D s ) , are s o m e o f the o n l y genetic diseases to h a v e reached the p o i n t o f gene p r o d u c t therapy. F o r M P S I, therapy is presently i n the f o r m o f c e l l transplantation u s i n g bone m a r r o w , or e n z y m e replacement u s i n g r e c o m b i n a n t h u m a n I D U A p r o t e i n e n z y m e , h o w e v e r approaches u s i n g gene therapy are also c o n s i d e r e d suitable.  1  T h e structure o f the thesis is as f o l l o w s : C h a p t e r 1 p r o v i d e s b a c k g r o u n d i n f o r m a t i o n relevant to this thesis, describes the objectives o f the thesis, and presents hypotheses e x p l o r e d i n the thesis. T h e current understanding o f h u m a n M P S I i s presented, i n c l u d i n g the b i o c h e m i c a l basis o f M P S , the genetics o f the disease i n c l u d i n g the presence o f a n o v e r l a p p i n g sulphate transporter gene (SAT-1), a n d the n o r m a l p r o d u c t i o n and d e l i v e r y o f I D U A e n z y m e to the l y s o s o m e . T h e p o t e n t i a l for therapy o f M P S I is then d i s c u s s e d , i n c l u d i n g v a r i o u s routes and m e t h o d s for c o r r e c t i o n o f I D U A d e f i c i e n c y . A d i s c u s s i o n o f a n i m a l m o d e l s o f M P S disorders a n d attempts at c o r r e c t i o n o f e n z y m e d e f i c i e n c y p r o v i d e s an u p to date r e v i e w o f therapeutic approaches for the M P S disorders. T h e objectives a n d s u p p o r t i n g hypotheses o f the thesis are then presented. C h a p t e r 2 details the materials and methods u s e d i n this project. C h a p t e r 3 is a n e x a m i n a t i o n o f the l o n g t e r m c l i n i c a l , b i o c h e m i c a l , and p a t h o l o g i c a l course o f m u r i n e I D U A d e f i c i e n c y . O n e o f the major goals o f the c h a r a c t e r i z a t i o n o f m u r i n e I D U A d e f i c i e n c y i s to establish the breadth o f I D U A d e f i c i e n c y i n m o u s e and p l a c e it o n the s p e c t r u m o f h u m a n I D U A d e f i c i e n c y . I n a d d i t i o n , the p r o g r e s s i o n o f I D U A d e f i c i e n c y i n c r i t i c a l tissue systems c a n be d e t e r m i n e d thus l e a d i n g t o w a r d s a better understanding o f the p a t h o p h y s i o l o g y o f I D U A d e f i c i e n c y . F i n a l l y , c h a r a c t e r i z a t i o n o f m u r i n e I D U A d e f i c i e n c y m a y establish markers o f disease useful i n the assessment o f therapies for I D U A d e f i c i e n c y . Important f i n d i n g s i n c l u d e the presence o f early p a t h o l o g y i n the g r o w t h plates o f bones, the presence o f secondary a c c u m u l a t i o n s i n b r a i n s i m i l a r to those d e s c r i b e d i n h u m a n M P S I, a n d the presence o f n e u r o l o g i c disease i n c l u d i n g d y s m o r p h o l o g y o f P u r k i n j e c e l l s i n the c e r e b e l l u m . T h e  2  observations are important as they c o n f i r m the u t i l i t y o f the  Idua -/- m o u s e ,  and provide a  better understanding o f the p a t h o l o g y o c c u r r i n g o v e r t i m e i n tissues not yet r e s p o n s i v e to therapy. C h a p t e r 4 describes the attempted p r o d u c t i o n o f transgenic m o u s e lines e x p r e s s i n g h u m a n I D U A either u b i q u i t o u s l y , or i n the m y e l o i d h e m a t o i p o i e t i c lineage, for use i n transplantation studies as w e l l as genetic crosses into I D U A deficient l i n e . T h e m y e l o i d s p e c i f i c transgenic w o u l d address the m a x i m u m potential o f bone m a r r o w d e r i v e d c e l l s for the c o r r e c t i o n o f I D U A d e f i c i e n c y . U s i n g b o t h a p r o n u c l e a r i n j e c t i o n approach and an e m b r y o n i c stem c e l l approach, attempts at generation o f g e r m l i n e t r a n s m i s s i b l e founders or chimeras were unsuccessful. C h a p t e r 5 documents the successful generation o f transgenic lines e x p r e s s i n g h u m a n I D U A , e m p l o y i n g a c o n d i t i o n a l transgenic a p p r o a c h i n v o l v i n g C r e - m e d i a t e d a c t i v a t i o n o f h u m a n I D U A e x p r e s s i o n . T h i s approach i n c l u d e s a d u a l reporter system i n d i c a t i n g the state o f transgene r e c o m b i n a t i o n . I n i t i a l m a t i n g into a w i d e s p r e a d C r e e x p r e s s i n g l i n e p r o d u c e d d o u b l e transgenic o f f s p r i n g , some o f w h i c h express h u m a n I D U A and the reporter gene a l k a l i n e phosophatase. These m i c e c a n be u s e d to express h u m a n I D U A s p e c i f i c a l l y i n a w i d e v a r i e t y o f tissues and c a n f u l f i l l the d u a l objectives o f chapter 4, n a m e l y m a r r o w d e r i v e d I D U A e x p r e s s i o n to represent bone m a r r o w transplantation, and u b i q u i t o u s I D U A e x p r e s s i o n for transplantation experiments and to determine the phenotype o f I D U A o v e r e x p r e s s i o n . C h a p t e r 6 is a d i s c u s s i o n o f the results f r o m the thesis. B r i e f l y , the observations d e s c r i b e d here o n the l o n g t e r m p a t h o p h y s i o l o g y o f I D U A d e f i c i e n c y i n the m o u s e i m p r o v e o u r understanding o f the c e l l u l a r events u n d e r l y i n g the d e v e l o p m e n t o f overt  3  s y m p t o m s i n h u m a n M P S I. T h e I D U A - d e f i c i e n t m o u s e m o d e l o f M P S I represents a l l major aspects o f h u m a n I D U A d e f i c i e n c y so far e x a m i n e d , i n c l u d i n g s i g n i f i c a n t i n v o l v e m e n t o f the n e u r o l o g i c and skeletal compartments. S e c o n d a r y a c c u m u l a t i o n s o f t o x i c g a n g l i o s i d e s associated w i t h m o r p h o l o g y changes and inappropriate c e l l death are f o u n d i n the I D U A - / - m o u s e as they are i n h u m a n I D U A d e f i c i e n c y . F i n a l l y , the generation o f transgenic m u r i n e lines e x p r e s s i n g h u m a n I D U A w i l l h e l p determine effective therapeutic approaches for M P S I and determine the phenotype o f transgenic expression o f I D U A .  1.2 M P S I 1.2.1 C l i n i c a l P r e s e n t a t i o n o f M P S I D e f i c i e n c y o f the l y s o s o m a l e n z y m e a - L - i d u r o n i d a s e ( I D U A ) underlies m u c o p o l y s a c c h a r d o s i s type I (or M P S I), w h i c h c a n result i n a w i d e range o f c l i n i c a l s y m p t o m s . M P S I represents the m o s t c o m m o n severe M P S subtype, o c c u r r i n g w i t h a frequency o f a p p r o x i m a t e l y 1/100,000 i n m o s t p o p u l a t i o n s ( L o w r y et al,  1990) T h r e e  forms o f M P S I are r e c o g n i z e d , differing i n onset, system i n v o l v e m e n t , a n d o v e r a l l severity, w i t h H u r l e r s y n d r o m e ( M P S I H ) the m o s t severe, S c h e i e s y n d r o m e ( M P S IS) i n v o l v i n g a m u c h m i l d e r course, a n d H u r l e r - S c h e i e s y n d r o m e ( M P S I H / S ) representing a n intermediate phenotype. M P S I therefore presents as a s p e c t r u m o f disease phenotypes ( R o u b i c e k et al,  1985). H i s t o r i c a l l y the differentiation b e t w e e n M P S I  phenotypes w a s based o n c l i n i c a l s y m p t o m criteria, h o w e v e r m o l e c u l a r c h a r a c t e r i z a t i o n o f the IDUA gene e n c o d i n g a - L - i d u r o n i d a s e and its mutations i n c r e a s i n g l y a l l o w s g e n o t y p i n g o f patients, useful i n p r o g n o s i s based o n established genotype-phenotype  correlations. A l l forms o f M P S I share i n c o m m o n e x c e s s i v e u r i n a r y e x c r e t i o n o f heparan and dermatan sulphate a n d absence o f a l p h a - L - i d u r o n i d a s e a c t i v i t y . M o s t often b o r n w i t h no o b v i o u s phenotype, patients w i t h the m o s t severe f o r m o f M P S I ( M P S I H - H u r l e r ) u s u a l l y present c l i n i c a l l y before age 2 w i t h d e v e l o p m e n t a l delay, coarse facial features, enlargement o f the spleen and l i v e r , skeletal deformities, a p r o m i n e n t forehead, and j o i n t stiffness. S y m p t o m s r a p i d l y b e c o m e m o r e severe and d i a g n o s i s o f M P S I H t y p i c a l l y occurs b e t w e e n 6 a n d 30 m o n t h s o f age ( C o l v i l l e and B a x , 1996).  D e v e l o p m e n t a l d e l a y is a precursor to d e v e l o p m e n t a l d e c l i n e , w i t h a m a x i m u m  functional age o f 2 to 4 years obtainable f o l l o w e d b y p r o g r e s s i v e deterioration. L i m i t e d language s k i l l s result f r o m a c o m b i n a t i o n o f m e n t a l h a n d i c a p , tongue enlargement, a i r w a y obstruction, and p o s s i b l e h e a r i n g loss. C o r n e a l c l o u d i n g is p r o g r e s s i v e and m a y result i n b l i n d n e s s . H y d r o c e p h a l u s r e s u l t i n g f r o m increased intracranial pressure i s c o m m o n and, again, progressive. S k e l e t a l deformities are w i d e s p r e a d and p r o g r e s s i v e and i n c l u d e the s k u l l , d e n t i t i o n , vertebrae, phalanges and the l o n g bones a m o n g others, l e a d i n g to the t e r m dysostosis m u l t i p l e x ( F i e l d s et al., 1994). Shortened stature and v e r y coarse features are seen w i t h M P S I H . O b s t r u c t i v e a i r w a y disease, respiratory i n f e c t i o n , and cardiac c o m p l i c a t i o n s are the most c o m m o n causes o f death, w h i c h u s u a l l y occurs before age 10. T h e m i l d f o r m o f M P S I, S c h e i e s y n d r o m e ( M P S I S) presents at a later age than M P S I H w i t h c l i n i c a l l y significant s y m p t o m d e v e l o p m e n t u s u a l l y after 5 years o f age w i t h diagnosis n o r m a l l y b e t w e e n 10 a n d 20 years o f age, d e p e n d i n g o n severity. M P S I S is characterized b y j o i n t stiffness, b a c k p a i n , aortic v a l v e disease, and c o r n e a l c l o u d i n g , w h i l e i n t e l l i g e n c e and stature are n o r m a l . W h i l e progressive, the a c c e l e r a t i o n i n disease  5  severity o b s e r v e d i n M P S I H is not seen i n S c h e i e s y n d r o m e . S u r v i v a l into late a d u l t h o o d is n o r m a l , h o w e v e r cardiac c o m p l i c a t i o n s m a y result i n death before m i d d l e age (Scheie et al,  1962).  Intermediate forms o f M P S I ( H u r l e r - S c h e i e or M P S I H / S ) have a c l i n i c a l phenotype b e t w e e n H u r l e r and S c h e i e s y n d r o m e s . T y p i c a l l y , progressive dysostosis m u l t i p l e x is present, h o w e v e r little or no i n t e l l e c t u a l d y s f u n c t i o n is observed.  Other  s o m a t i c features o f M P S I, i n c l u d i n g c o r n e a l c l o u d i n g , j o i n t stiffness, deafness a n d cardiac disease, are u s u a l l y present. S y m p t o m d e v e l o p m e n t occurs b e t w e e n the ages o f 3 a n d 8 a n d s u r v i v a l into a d u l t h o o d is c o m m o n . C l i n i c a l m o r t a l i t y n o r m a l l y results f r o m cardiac i n v o l v e m e n t and a i r w a y o b s t r u c t i o n ( M c K u s i c k a n d N e u f e l d , 1983). T h e d i a g n o s i s o f M P S I i n patients is c o n f i r m e d b y measurement o f e n z y m e a c t i v i t y i n l e u k o c y t e s , p l a s m a , or fibroblasts. R o u t i n e l y the e n z y m e a c t i v i t y is measured w i t h the use o f a f l u r o g e n i c substrate 4 - m e t h y l u m b e l l i f e r y l - a l p h a - i d u r o n i d e ( H o p w o o d and M u l l e r , 1982). S a m p l e s used i n the d i a g n o s i s o f M P S I i n c l u d e c u l t u r e d fibroblasts, p l a s m a , or serum, and c u l t u r e d c e l l s d e r i v e d f r o m a m n i o t i c f l u i d for prenatal diagnosis. C h o r i o n i c v i l l u s b i o p s i e s are used for d i a g n o s i s for a n u m b e r o f M P S disorders i n c l u d i n g II, III A , III B , III C , a n d I V A , h o w e v e r it has b e e n reported that the l o w l e v e l o f I D U A a c t i v i t y i n v i l l i m a k e s d i a g n o s i s o f M P S I m o r e d i f f i c u l t (Poenaru, 1987). T h e advent o f m o l e c u l a r d i a g n o s i s c o u p l e d w i t h the extensive characterization o f mutations i n the  IDUA gene p l a y a n i n c r e a s i n g r o l e i n d i a g n o s i s as w e l l as w e l l as p r o g n o s i s and w i l l be d i s c u s s e d later.  6  1.2.2 Glycosaminoglycans and proteoglycans D e f i c i e n c y o f I D U A i n M P S I results i n the a c c u m u l a t i o n o f undegraded m u c o p o l y s a c c h a r i d e s , c o m m o n l y c a l l e d g l y c o s a m i n o g l y c a n s ( G A G s ) . G A G s are sulfated, linear carbohydrates c o n s i s t i n g o f repeating sugar groups, a n d i n c l u d e heparan sulphate ( H S ) , dermatan sulphate ( D S ) , keratan sulphate ( K S ) , a n d c h o n d r o i t i n sulfate ( C S ) . G A G s are n o r m a l l y f o u n d l i n k e d to a p r o t e i n core as part o f m a c r o m o l e c u l e s t e r m e d p r o t e o g l y c a n s , to w h i c h they i m p a r t f u n c t i o n a l properties. A s M P S I i n v o l v e s a c c u m u l a t i o n o f H S and D S the role o f these G A G s and their associated p r o t e o g l y c a n s w i l l be d i s c u s s e d here. H S consists o f u r o n i c a c i d residues alternating w i t h a l p h a - l i n k e d g l u c o s a m i n e residues ( H o p w o o d , 1989). T h e u r o n i c a c i d m a y be g l u c u r o n i c or i d u r o n i c a c i d , and m a y be sulphated. T h e g l u c o s a m i n e m a y be N - s u l p h a t e d or N - a c e t y l a t e d , and m a y also be 3- or 6-sulphated. acetylation o n a  D i f f e r e n t permutations o f m o d i f y i n g s u l p h a t i o n and  carbohydrate b a c k b o n e , w h i c h i t s e l f varies i n sugar g r o u p  representation, impart G A G s w i t h their u n i q u e f u n c t i o n a l properties a n d p r o v i d e s for huge c o m p l e x i t y and b i o l o g i c a l d i v e r s i t y w i t h i n e a c h type o f G A G . D e g r a d a t i o n o f H S and other G A G s b e g i n s w i t h p r o t e o l y s i s i n the early e n d o s o m e s p r o d u c i n g liberated chains o f G A G (approx. 3 0 k D a ) . E n d o g l y c o s i d a s e s then cleave G A G chains into o l i g o s a c c h a r i d e s (approx. 5 k D a ) , w h i c h are targeted to the l y s o s o m e for stepwise e x o d e g r a d a t i o n ( r e v i e w e d i n H o p w o o d et al., 1989). T h e structure o f a h y p o t h e t i c a l H S o l i g o s a c c h a r i d e and the e n z y m e s r e q u i r e d for its l y s o s o m a l endodegradation are p i c t u r e d i n F i g u r e 1.1.  7  o® |  I  0(5}  K©  HC0H  COQrt  2  O-L-ldurtiildDW I  IDUA  Mc  H@  HjCO©  0 ®  *Ac  ' 2  |:;::::::s:s::::::, s  ;  lllil;P;ilIf^lpli^§'oil Ijl^v' ;  '  0®  Nty 1  Ufa  iiiifiQ  '  : : : ; :  : : v' r1i^|^^ :  :  ;  COOK  .  HgCO©  I  - Nftt  H:X;.;  Figure 1.1: Heparan sulfate exodegradation I D U A h y d r o l y z e s r e m o v a l o f t e r m i n a l desulfated i d u r o n i c a c i d residues, step 2 above. T h i s produces free i d u r o n i c a c i d and leaves a t e r m i n a l g l u c o s a m i n e for further e x o d e g r a d a t i o n . 9 e n z y m e s are r e q u i r e d for H S degradation. N o t s h o w n : g l u c o s a m i n e - 3 sulphatase. F r o m S c r i v e r e t a l . , 1989.  8  T h e l y s o s o m a l exodegradation o f H S o l i g o s a c c h a r i d e s requires at least n i n e e n z y m e s , w i t h d e f i c i e n c y o f any single e n z y m e r e s u l t i n g i n b l o c k a g e o f the entire p a t h w a y a n d a c c u m u l a t i o n o f p a r t i a l l y degraded H S chains. These e n z y m e s i n c l u d e g l y c o s i d a s e s s u c h as I D U A , sulphatases, and i n c l u d e a b i o s y n t h e t i c e n z y m e that adds an a c e t y l group required for subsequent e n z y m a t i c degradation. A s s h o w n i n F i g u r e 1.1, a l p h a - L i d u r o n i d a s e ( I D U A ) acts o n t e r m i n a l desulfated i d u r o n i c a c i d residues p r o d u c i n g free i d u r o n i c a c i d and a t e r m i n a l g l u c o s a m i n e residue for further degradation. T h e degradation o f G A G s releases m o n o s a c c h a r i d e s and sulfate w h i c h exit f r o m the l y s o s o m e for r e c y c l i n g i n b i o s y n t h e t i c reactions ( H o p w o o d et al,  1989).  D e r m a t a n sulfate ( D S ) consists o f i d u r o n i c a c i d , w h i c h m a y be C - 2 - s u l p h a t e d , and g l u c u r o n i c a c i d residues alternating w i t h b e t a - l i n k e d N - a c e t y l g a l a c t o s a m i n e , w h i c h m a y be sulphated ( R o d e n , 1980). A s for H S , degradation o f D S c o n t a i n i n g proteoglycans includes proteolysis f o l l o w e d by endoglycosidase activity, producing D S o l i g o s a c c h a r i d e s . T h e structure o f a h y p o t h e t i c a l D S o l i g o s a c c h a r i d e and the e n z y m e r e q u i r e d for its exodegradation are s h o w n i n F i g u r e 1.2. A s for H S c a t a b o l i s m , d e f i c i e n c y o f any single e n z y m e i n the p a t h w a y results i n a c c u m u l a t i o n o f undegraded D S o l i g o s a c c h a r i d e s . A s for H S o l i g o s a c c h a r i d e s , I D U A r e c o g n i z e s a n d cleaves t e r m i n a l desulfated i d u r o n i c a c i d residues f r o m D S chains, l e a v i n g o n D S chains t e r m i n a l N acetylgalatosamine residues for further e n z y m a t i c degradation. I n I D U A d e f i c i e n c y , H S a n d D S o l i g o s a c c h a r i d e s w o u l d be expected to a c c u m u l a t e w i t h t e r m i n a l i d u r o n i c a c i d residues. T h e d e m a n d for l y s o s o m a l degradation o f G A G s varies i n tissues a c c o r d i n g to G A G a n d p r o t e o g l y c a n content a n d turnover. P r o t e o g l y c a n s , the f o r m i n w h i c h G A G s are  9  •'•  MCOH  COOH  ?  H.COH  N4c  I, A;  IDUA  * €  ... (SxTUci^  13 0~eic Mel  I *  jS-t)1ijcnwiiJa«  |,JJ  HC0H 2  v.  Figure 1.2: Dermatan sulfate exodegradation I D U A hydrolyzes removal o f terminal desulfated iduronic acid residues, step 2 above. This produces free iduronic acid and leaves a terminal N-acetylgalactosamine for further exodegradation. From Scriver et al., 1989.  10  functional, are proteins c o n t a i n i n g g l y c o s a m i n o g l y c a n carbohydrate chains. T y p i c a l l y , a p r o t e i n core has one to hundreds o f c o v a l e n t l y attached G A G chains. P r o t e o g l y c a n s range greatly i n the ratio o f p r o t e i n to G A G carbohydrate, and i n G A G c o m p o s i t i o n . P r o t e o g l y c a n s are d y n a m i c m o l e c u l e s , w i t h e x p r e s s i o n and c o m p o s i t i o n , i n c l u d i n g G A G content, c h a n g i n g d u r i n g d e v e l o p m e n t . P r o t e o g l y c a n s do not share a u n i f y i n g functional feature, p l a y i n g diverse roles s u c h as f o r m i n g c o m p o n e n t s o f the e x t r a c e l l u l a r m a t r i x , i n c e l l c o m m u n i c a t i o n , and i n ligand-receptor interactions. U n d e r s t a n d i n g the functions o f heparan a n d dermatan sulfate c o n t a i n i n g p r o t e o g l y c a n s , a n d the l o c a t i o n s w h e r e they f u n c t i o n , p r o v i d e s some i n s i g h t into the sites o f G A G a c c u m u l a t i o n i n M P S I. C e l l surface heparan sulfate, attached to transmembrane proteins, modulates the actions o f a large n u m b e r o f e x t r a c e l l u l a r l i g a n d s . T h e structural heterogeneity o f H S chains a l l o w s b i n d i n g o f a diverse repertoire o f proteins under p h y s i o l o g i c a l c o n d i t i o n s ( r e v i e w e d i n B e r n f i e l d e t ah, 1999). T h e H S chains p r o v i d e c e l l s w i t h a m e c h a n i s m to mediate interactions w i t h a w i d e v a r i e t y o f e x t r a c e l l u l a r effectors w i t h o u t r e q u i r i n g m u l t i p l e n o v e l b i n d i n g proteins. W h i l e f o u n d o n a v a r i e t y o f c e l l surface proteins, H S chains are c o n s i s t e n t l y f o u n d o n m e m b e r s o f t w o major f a m i l i e s o f m e m b r a n e - b o u n d p r o t e o g l y c a n s , the syndecans a n d the g l y p i c a n s . These heparan sulfate p r o t e o g l y c a n s i m m o b i l i z e a n d regulate the turnover o f l i g a n d s that act at the c e l l surface, b y b i n d i n g to l i g a n d s and e n h a n c i n g f o r m a t i o n o f their r e c e p t o r - s i g n a l l i n g c o m p l e x e s . T h e e x t r a c e l l u l a r d o m a i n s o f syndecans and g l y p i c a n s c a n be shed f r o m the c e l l surface, p r o d u c i n g s o l u b l e H S p r o t e o g l y c a n s that act as H S p r o t e o g l y c a n antagonists, and c e l l s that are less r e s p o n s i v e to l i g a n d s t i m u l a t i o n . T h e l i g a n d affinities o f the syndecans a n d g l y p i c a n s i n c l u d e l i g a n d s i n v o l v e d i n m o r p h o g e n e s i s and w o u n d repair, consistent w i t h  11  the r e g i o n a l a n d t e m p o r a l e x p r e s s i o n patterns o f s p e c i f i c m e m b e r s o f these H S p r o t e o g l y c a n s . I n t e r n a l i z a t i o n o f basic fibroblast g r o w t h factor at the m o u s e b l o o d - b r a i n barrier i n v o l v e s p e r l e c a n , a heparan sulfate p r o t e o g l y c a n ( D e g u c h i et al,  2002).  D e r m a t a n sulfate ( D S ) p r o t e o g l y c a n s are less w i d e s p r e a d than H S p r o t e o g l y c a n s but l i k e w i s e s h o w r e g i o n a l and t e m p o r a l e x p r e s s i o n patterns consistent w i t h functions i n m o r p h o g e n e s i s . D S p r o t e o g l y c a n s i n the adult are f o u n d i n tissues s u c h as cartilage and b o n e ( R o u g h l e y and L e e , 1994). T a b l e 1.1 describes some c o m m o n p r o t e o g l y c a n s , their f u n c t i o n a l l o c a t i o n , and their G A G content.  Name  Location  Function  GAGs  Reference  perlecan  basement  cell adhesion  HS  G r o f f e n et al., 1999  membrane glypican  c e l l surface  regulate g r o w t h  HS  2002  factors decorin  connective  matrix assembly  DS, CS  cartilage  osmotic compressive  CS, K S  extracellular  matrix assembly  R o u g h l e y and L e e , 1994  properties neurocan  R o u g h l e y and L e e , 1994  tissue, cartilage aggrecan  S o n g and F i l m u s ,  CS  matrix o f C N S  R a u c h et al., 2001  Table 1.1: Representative proteoglycans G A G s = g l y c o s a m i n o g l y c a n s , H S = h e p a r a n sulfate, D S = d e r m a t a n sulfate, C S = c h o n d r o i t i n sulfate, K S = k e r a t a n sulfate, C N S = c e n t r a l nervous system.  1.2.3 Secondary storage in MPS I S o m e w h a t u n i q u e to s o m e o f the l y s o s o m a l storage disorders is the p o t e n t i a l for storage o f c o m p o u n d s not related to the p a t h w a y w h i c h is b i o c h e m i c a l l y deficient. T h i s m a y be attributed to i n h i b i t i o n o f p a t h w a y s b y storage o f p r i m a r y substrates. S e c o n d a r y  12  a c c u m u l a t i o n o f g a n g l i o s i d e s i n c l u d i n g GM2 a n d G M 3 have been noted i n h u m a n , canine, and m u r i n e , I D U A d e f i c i e n c y , as w e l l as other storage disorders unrelated to p r i m a r y defects o f g l y c o s p h i n g o l i p i d m e t a b o l i s m ( C o n s t a n t o p o u l o s & D e k a b a n 1978, C o n s t a n t o p o u l o s et al,  1985). T h e role that g a n g l i o s i d e a c c u m u l a t i o n p l a y s i n the  pathogenesis o f M P S I disorders is u n k n o w n but m a y be important. D e f e c t s i n the c a t a b o l i s m o f GM2 g a n g l i o s i d e i n T a y - S a c h s and S a n d h o f f disease results i n neurodegenerative disease. G a n g l i o s i d e s i n c l u d i n g GM2 have been i m p l i c a t e d i n neuronal apoptosis, a n d GM2 has been postulated to u n d e r l i e the generation o f ectopic dendrites i n p y r a m i d a l neurons i n b o t h T a y - S a c h s as w e l l as other g e n e r a l i z e d l y s o s o m a l storage disorders ( W a l k l e y 1995).  1.2.4 T h e M P S f a m i l y o f d i s o r d e r s A t least 10 e n z y m e s r e q u i r e d for G A G c a t a b o l i s m have been i d e n t i f i e d , p r i m a r i l y as a result o f s t u d y i n g e n z y m e d e f i c i e n c y i n the M P S s y n d r o m e s . A l l o f the M P S associated e n z y m e s are unable to mediate endodegradation; that is, o n l y t e r m i n a l substrates are cleavable. Therefore d e f i c i e n c y o f any single e n z y m e r e q u i r e d for G A G degradation b l o c k s the degradation p a t h w a y , r e s u l t i n g i n storage i n the l y s o s o m e and e x c r e t i o n i n the urine. D i f f e r e n c e s i n the type o f G A G a n d their t e r m i n a l residues a c c u m u l a t e d i n the different M P S s result i n the d i s t i n g u i s h i n g p a t h o p h y s i o l o g y o f the M P S s . M P S I, w i t h a c c u m u l a t i o n o f H S and D S , i n c l u d e s , i n severe forms, v i s c e r a l , skeletal, and n e u r o l o g i c a l i n v o l v e m e n t , consistent w i t h representation o f H S and D S G A G s i n these tissue systems. M P S II, sharing w i t h M P S I a c c u m u l a t i o n o f b o t h H S and D S , has a phenotype s i m i l a r to M P S I, i n v o l v i n g b o t h somatic a n d C N S systems. Interestingly, M P S V I , w i t h a c c u m u l a t i o n o f D S o n l y , i n v o l v e s skeletal disease but  13  n o r m a l n e u r o l o g i c a l f u n c t i o n , w h i l e M P S III A , B , C , and D , w i t h a c c u m u l a t i o n o f H S o n l y , i n v o l v e s severe m e n t a l deterioration, but o n l y m i l d s o m a t i c s y m p t o m s a n d n o skeletal disease. T h i s suggests the skeletal disease o b s e r v e d i n severe M P S I, s i m i l a r to the phenotype o f M P S V I , l i k e l y results f r o m a c c u m u l a t i o n o f D S , w h i l e the n e u r o l o g i c a l degeneration and C N S i n v o l v e m e n t observed i n severe M P S I l i k e l y results p r i m a r i l y f r o m a c c u m u l a t i o n o f H S , as observed w i t h M P S III. T h e role o f K S i n the skeletal system is h i g h l i g h t e d i n M P S I V B , where a c c u m u l a t i o n o f K S is associated w i t h a phenotype o f severe skeletal disease.  1.2.5 Genetics M P S I results f r o m d e f i c i e n c y o f a l p h a - L - i d u r o n i d a s e , e n c o d e d b y the IDUA gene.  I n h u m a n s , the IDUA gene is l o c a t e d o n the short a r m o f c h r o m o s o m e 4 close to  the telomere ( 4 p l 6 . 3 ) i n the same r e g i o n as the H u n t i n g t o n disease (HD) gene (Scott et al., 1990). T h e IDUA gene contains 14 e x o n s spanning 19 k b , o r g a n i z e d as t w o clusters o f exons: e x o n I and II separated b y a n i n t r o n o f 5 6 6 b p , a large i n t r o n II o f 13 k b , a n d r e m a i n i n g e x o n s III to X I V clustered i n a 4.5 k b r e g i o n (Scott et al., 1 9 9 1 , 1992). Intron 2 o f the h u m a n IDUA gene contains an A l u repetitive element a n d a n 86 b p h i g h l y p o l y m o r p h i c V N T R repeat ( D 4 S 1 1 1 ) u s e d i n the d i a g n o s i s o f H D (Scott et al,  1992,  M a c D o n a l d et al., 1991). C o n t a i n e d entirely w i t h i n the IDUA gene, o n the opposite strand to I D U A , is the Sulphate transporter-1 gene, SAT-1 (see F i g u r e 1.3)(Clarke et al.,, u n p u b l i s h e d data). T h e SAT-1 gene w i l l be d i s c u s s e d further later.  14  SAT-1 gene ill  II  I  II  III  IDUA Exons I and II IDUA  exon  SAT-1  exoii^  mi—\  XIV  IDUA Exons III to XIV  •  Figure 1.3: Organization of the human I D U A gene locus  IDUA gene ( w i t h b l a c k exons) a n d the IDUA gene spans 19 k b , i n c l u d i n g i n t r o n 2  A r r o w s indicate the d i r e c t i o n o f t r a n s c r i p t i o n the  SAT-1  gene ( c h e c k e r e d exons). T h e h u m a n  (13 k b ) c o n t a i n i n g m o s t o f the SAT-1 gene, w h i c h is e n c o d e d o n the opposite strand to  IDUA  a n d i n c l u d e s a 3 ' untranslated r e g i o n that overlaps  In h u m a n s the  IDUA  IDUA  e x o n II, a c o d i n g e x o n .  gene produces a p r e d o m i n a n t transcript o f 2.3 k b at a l o w l e v e l o f  t r a n s c r i p t i o n as d e t e r m i n e d b y N o r t h e r n b l o t a n a l y s i s (Scott et al., 1992). A l t e r n a t e spicing o f  IDUA  et  e x o n s II, the o v e r l a p p i n g e x o n , and e x o n I V , has been o b s e r v e d (Scott  al., 1991). A s s h o w n i n figure 1.4, the h u m a n I D U A c D N A i n c l u d e s a n o p e n r e a d i n g frame o f 1959 bp, e n c o d i n g a peptide o f 653 a m i n o acids (Scott et al,  1991). I n a d d i t i o n  to the h u m a n I D U A c D N A , m u r i n e a n d canine I D U A c D N A s have b e e n sequenced (Clarke  et al.,  1994, M e n o n  et al,  1992). T h e architecture o f the  Idua  gene is c o n s e r v e d  i n a l l three species, and the Sat-1 sequence and g e n o m i c o r g a n i z a t i o n has been detailed i n m o u s e a n d f o u n d to be s i m i l a r to the h u m a n  IDUA  l o c u s . T h e entire r e g i o n o f h u m a n  c h r o m o s o m e 4 p l 6 . 3 c o n t a i n i n g IDUA is syntenic w i t h a r e g i o n o f m o u s e c h r o m o s o m e 5  15  1 GTCACATGGG GTGCGCGCCC AGACTCCGAC CCGGAGGCGG AACCGG(lAGT GCAGCCCGAA 6 1 GCCCCGCAGT CCCCGAGCAC GCGTGGCCAT  GCGTCCCCTG  CGCCCCJGCG  CCGCGCTGCT  1 2 1  GGCGCTCCTG  GCCTCGCTCC  TGGCCGCGCC  CCCGGTGGCC  CCGGCCGAGG  CCCCGCACCT  1 8 1  GGTGCAGGTG  GACGCGGCCC  GCGCGCTGTG  GCCCCTGCGG  CGCTTCTGGA  GGAGCACAGG  2 4 1  CTTCTGCCCC  CCGCTGCCAC  ACAGGCAGGC  TGACCAGTAC  GTCCTCAGCT  GGGACCAGCA  3 0 1  GCTCAACCTC  GCCTATGTGG  GCGCCGTCCC  TCACCGCGGC  ATCAAGCAGG  TCCGGACCCA  3 6 1  CTGGCTGCTG  GAGCTTGTCA  CCACCAGGGG  GTCCACTGGA  CGGGGCCTGA  GCTACAACTT  4 2 1  CACCCACCTG  GACGGGTACT  TGGACCTTCT  CAGGGAGAAC  CAGCTCCTCC  CAGGGTTTGA  4 8 1  GCTGATGGGC  AGCGCCTCGG  GCCACTTCAC  TGACTTTGAG  GACAAGCAGC  A G G T G T T T G A  5 4 1  GTGGAAGGAC  TTGGTCTCCA  GCCTGGCCAG  GAGATACATC  GGTAGGTACG  GACTGGCGCA  6 0 1  TGTTTCCAAG  TGGAACTTCG  AGACGTGGAA  TGAGCCAGAC  CACCACGACT  TTGACAACGT  6 6 1  CTCCATGACC  ATGCAAGGCT  TCCTGAACTA  CTACGATGCC  TGCTCGGAGG  GTCTGCGCGC  7 2 1  CGCCAGCCCC  GCCCTGCGGC  TGGGAGGCCC  CGGCGACTCC  TTCCACACCC  CACCGCGATC  7 8 1  CCCGCTGAGC  TGGGGCCTCC  TGCGCCACTG  CCACGACGGT  ACCAACTTCT  TCACTGGGGA  8 4 1  GGCGGGCGTG  CGGCTGGACT  A C A T C T C C C T  CCACAGGAAG  GGTGCGCGCA  GCTCCATCTC  9 0 1  CATCCTGGAG  CAGGAGAAGG  TCGTCGCGCA  GCAGATCCGG  CAGCTCTTCC  CCAAGTTCGC  9 6 1  GGACACCCCC  TGCCACAGCC  A T T T A C A A C G  ACGAGGCGGA  CCCGCTGGTG  GGCTGGTCCC  1 0 2 1  GTGGAGGGCG  GACGTGACCT  ACGCGGCCAT  GGTGGTGAAG  GTCATCGCGC  AGCATCAGAA  1 0 8 1  CCTGCTACTG  GCCAACACCA  CCTCCGCCTT  CCCCTACGCG  CTCCTGAGCA  ACGACAATGC  1 1 4 1  CTTCCTGAGC  TACCACCCGC  ACCCCTTCGC  GCAGCGCACG  CTCACCGCGC  GCTTCCAGGT  1 2 0 1  CAACAACACC  CGCCCGCCGC  ACGTGCAGCT  GTTGCGCAAG  CCGGTGCTCA  CGGCCATGGG  1 2 6 1  GCTGCTGGCG  CTGCTGGATG  AGGAGCAGCT  CTGGGCCGAA  GTGTCGCAGG  CCGGGACCGT  1 3 2 1  CCTGGACAGC  A A C C A C A C G G  TGGGCGTCCT  GGCCAGCGCC  CACCGCCCCC  AGGGCCCGGC  1 3 8 1  CGACGCCTGG  CGCGCCGCGG  TGCTGATCTA  CGCGAGCGAC  GACACCCGCG  CCCACCCCAA  1 4 4 1  CCGCAGCGTC  GCGGTGACCC  TGCGGCTGCG  CGGGGTGCCC  CCCGGCCCGG  GCCTGGTCTA  1 5 0 1  CGTCACGCGC  TACCTGGACA  ACGGGCTCTG  CAGCCCCGAC  GGCGAGTGGC  GGCGCCTGGG  1 5 6 1  CCGGCCCGTC  T T C C C C A C G G  CAGAGCAGTT  CCGGCGCATG  CGCGCGGCTG  AGGACCCGGT  1 6 2 1  GGCCGCGGCG  CCCCGCCCCT  TACCCGCCGG  CGGCCGCCTG  ACCCTGCGCC  CCGCGCTGCG  1 6 8 1  GCTGCCGTCG  CTTTTGCTGG  TGCACGTGTG  TGCGCGCCCC  GAGAAGCCGC  CCGGGCAGGT  1 7 4 1  CACGCGGCTC  CGCGCCCTGC  CCCTGACCCA  AGGGCAGCTG  GTTCTGGTCT  GGTCGGATGA  1 8 0 1  ACACGTGGGC  TCCAAGTGCC  TGTGGACATA  CGAGATCCAG  TTCTCTCAGG  ACGGTAAGGC  1 8 6 1  GTACACCCCG  GTCAGCAGGA  AGCCATCGAC  CTTCAACCTC  TTTGTGTTCA  GCCCAGACAC  1 9 2 1  AGGTGCTGTC  TCTGGCTCCT  ACCGAGTTCG  AGCCCTGGAC  TACTGGGCCC  GACCAGGCCC  1 9 8 1  CTTCTCGGAC  CCTGTGCCGT  ACCTGGAGGT  CCCTGTGCCA  AGAGGGCCCC  CATCCCCGGG  GCCTGTGCTG AGCCCCAGTG GGTTGCACCT CCACCGGCAG TCAGCGAGCT 2101 GGGGCTGCAC TGTGCCCATG CTGCCCTCCC ATCACCCCCT TTGCAATATA TTTTT 2 0 4 1  C A A T C C A T G A  F i g u r e 1.4: T h e h u m a n I D U A c D N A  The 2155 bp cDNA has an open reading frame, bold, of 1959 bp encoding a polypeptide of 653 amino acids. A signal peptide of 26 amino acids, underlined, is cleaved at the site indicated by the arrow, leaving a mature polypeptide of 627 amino acids. Exon II of IDUA, complementary to the 3'UTR of the SAT-1 cDNA, is shaded. (Grosson et al, 1994), including the presence of the HD gene. Comparison of the cDNA across species shows the canine and human cDNA and protein show 82% homology (Stoltzfus et al, 1992), while the murine cDNA and protein show 78% and 77% homology with the human cDNA and protein, respectively (Scott et ah, 1995). Expression of Idua appears to be limited at numerous points during transcription. 16  The postulated p r o m o t e r of the h u m a n  Idua gene has  o n l y a G C b o x - t y p e consensus  sequences, a n d n o o b v i o u s T A T A b o x , consistent w i t h a h o u s e k e e p i n g gene. I n h u m a n , m u r i n e , a n d canine, i n t r o n 11 contains a n apparently c o n s e r v e d G C / A G e x c e p t i o n i n the d o n o r s p l i c e site, w h i c h is associated w i t h r e d u c e d s p l i c i n g e f f i c i e n c y a n d gene e x p r e s s i o n . T h e o v e r l a p p i n g S a t - 1 gene i n h u m a n a n d m o u s e , a n d m o s t l i k e l y the canine  Idua gene l o c u s , encodes further regulate  a n m R N A transcript c o m p l e m e n t a r y to  Idua e x p r e s s i o n v i a antisense  Idua gene contribute to the  Idua, a n d this  could  interactions. Together, these features of the  l o w l e v e l o f e x p r e s s i o n o b s e r v e d f r o m the  W i t h a l m o s t 75 distinct mutations already d e s c r i b e d i n  Idua gene.  IDUA, the  clinical  s p e c t r u m o f M P S I is e x p l a i n e d i n part b y the m y r i a d o f genotypes p o s s i b l e w h i c h c o m b i n e alleles that m a y encode l o w l e v e l s o f I D U A a c t i v i t y , o r , for n u l l alleles, no I D U A at a l l ( H u m a n G e n e M u t a t i o n Database). M u t a t i o n s o c c u r throughout the  IDUA  gene i n c l u d i n g e x o n II, the e x o n o v e r l a p p i n g w i t h a p o r t i o n o f S A T - 1 3 ' untranslated sequence. T h e s e mutations i n c l u d e nonsense, missense, a n d s p l i c e site m u t a t i o n s , m i n o r deletions, insertions, a n d c o m p l e x rearrangements ( r e v i e w e d i n Scott e t a l , 1995). E i g h t nonsense mutations have b e e n d e s c r i b e d , i n c l u d i n g W 4 0 2 X , one o f the m o s t c o m m o n mutations i n C a u c a s i a n s , a n d a l l result i n a total l a c k o f I D U A f u n c t i o n a n d are associated w i t h severe phenotypes w h e n f o u n d i n h o m o z y g o s i t y . Interestingly, s o m e nonsense m u t a t i o n s are associated w i t h l o w e r l e v e l s o f I D U A m R N A transcripts, as d e t e r m i n e d b y N o r t h e r n b l o t a n a l y s i s , i n d i c a t i n g detection a n d d e l e t i o n o f nonsense m u t a t i o n c o n t a i n i n g transcripts (Scott e t a l , 1992, B a c h e t a l , 1993). T w e n t y - o n e missense mutations have been described i n  IDUA. M i s s e n s e mutations  are m o r e l i k e l y than nonsense mutations to  p e r m i t s o m e e n z y m a t i c f u n c t i o n , a n d m a n y missense mutations are associated w i t h m i l d  17  or intermediate phenotypes w h e n f o u n d i n h o m o z y g o s i t y . T h r e e s p l i c e site mutations have been d e s c r i b e d i n IDUA, w i t h t w o o f t h e m r e s u l t i n g i n i n c l u s i o n o f introns i n the I D U A m R N A . S p l i c e site mutations are associated w i t h b o t h m i l d a n d severe phenotypes w h e n f o u n d i n h o m o z y g o s i t y . S e v e n s m a l l deletions (1 to 12 b p ) a n d s i x s m a l l insertions (1 to 12 bp) have been d e s c r i b e d i n the  IDUA gene ( B u n g e et al, 1994, 1995). 3 0 n o n  p a t h o g e n i c p o l y m o r p h i s m s have been detected i n IDUA. S i b l i n g s c a r r y i n g i d e n t i c a l M P S I alleles c a n have s i g n i f i c a n t l y different c l i n i c a l outcomes, i n d i c a t i n g m o d i f i e r genes o r the e n v i r o n m e n t c a n i n f l u e n c e disease p r o g r e s s i o n ( M c D o w e l l et al., 1993, Scott et al, 1993, N e u f e l d , 1991). T h i s i s also seen i n m o u s e m o d e l s o f M P S V I I , w h e r e the p h e n o t y p e o f e n z y m e d e f i c i e n c y v a r i e s w i t h strain i n c l u d i n g v i a b i l i t y , life span, and r e p r o d u c t i v e success ( C a s a l a n d W o l f e , 1998). I n humans, a pseudodeficiency  IDUA allele w i t h e x c e e d i n g l y l o w a c t i v i t y l e v e l s has been  d e s c r i b e d w h i c h produces n o c l i n i c a l p h e n o t y p e i n h o m o z y g o t e s for the a l l e l e , but that encodes s u c h a l o w l e v e l o f I D U A e n z y m a t i c f u n c t i o n that h o m o z y g o t e s appear c o m p l e t e l y I D U A deficient i n standard I D U A e n z y m e assays and heterozygotes appear as M P S I carriers, c o m p l i c a t i n g b i o c h e m i c a l screening for carriers ( W h i t l e y et al, 1996).  1.2.6 The Sat-1 gene D i s c u s s i o n o f the Sat-1 gene is relevant to this thesis as the o v e r l a p r e g i o n shared b y the genes c o u l d i m p a c t disease o r therapy. T h e g e n o m i c architecture o f Sat-1 i s s i m i l a r i n h u m a n and m o u s e , a n d i s s h o w n i n figure 1.3. I n b o t h species, Sat-1 spans a p p r o x i m a t e l y 6 k b and i n c l u d e s 4 exons ( L e e et al, 2 0 0 3 , R e g e e r et al, 2 0 0 3 ) . E x o n s I to III are e m b e d d e d i n i n t r o n 2 o f Idua, w h i l e a 141 b p r e g i o n o f the 3 ' untranslated region o f  Sat-1  overlaps the entirety o f  Idua e x o n II. T h e t w o genes are e n c o d e d o n  opposite strands o f D N A and are t r a n s c r i b e d i n opposite directions. T h e Sat-1 gene encodes a 74 k d p r o t e i n i n c l u d i n g 12 p r e d i c t e d transmembrane d o m a i n s . N o r t h e r n b l o t a n a l y s i s indicates S A T - 1 is w i d e l y expressed i n h u m a n tissues as a 4.4 k b transcript, w i t h p l a c e n t a s h o w i n g a n a d d i t i o n a l , p r e s u m a b l y alternatively s p l i c e d transcript o f 6.0 k b . I n contrast, S A T - 1 m R N A e x p r e s s i o n i n m o u s e is selective w i t h a transcript o f 4.0 k b o b s e r v e d i n l i v e r and k i d n e y , and w e a k e r but detectable signals o b s e r v e d i n l u n g , spleen, and b r a i n . I D U A m R N A e x p r e s s i o n i n b o t h h u m a n a n d m o u s e is w i d e s p r e a d but at l o w l e v e l s ( C l a r k e et ai, u n p u b l i s h e d data). T h e f u n c t i o n o f the S A T - 1 p r o t e i n is o n l y p a r t i a l l y characterized. B i s s i g et al., c l o n e d the S A T - 1 c D N A f r o m rat l i v e r u s i n g a f u n c t i o n a l e x p r e s s i o n assay d e s i g n e d to identify transporters o f sulfate a n d characterized S A T - 1 as the p r i m a r y c a n a l i c u l a r sulfate transporter ( B i s s e g et al., 1994). M a r k o v i c h et al., have s h o w n that S A T - 1 is responsible for the m a j o r i t y o f s o d i u m - i n d e p e n d e n t sulfate transport i n the k i d n e y ( M a r k o v i c h et al., 1994), and S A T - 1 has b e e n l o c a l i z e d to the basolateral m e m b r a n e o f the p r o x i m a l tubule b y i m m u n o h i s t o c h e m i s t r y ( K a r n i s k i et al., 1998). S A T - 1 i s expressed i n b r a i n a n d functions as the m a i n transporter o f sulphate, at least i n rat ( L e e et al., 1999). N o diseases h a v e b e e n m a p p e d to the h u m a n SAT-1  gene. A b n o r m a l i t i e s i n sulfate transporter genes  related to SAT-1 i n h u m a n s have been i m p l i c a t e d i n 5 diseases r e s u l t i n g f r o m mutations i n 3 genes,  DRA  ( C o n g e n i t a l C h l o r i d e D i a r r h e a ) ( M o s e l e y et al., 1999),  DTDST  ( D i a s t r o p h i c D y s p l a s i a ) ( H a s t b a c k a et al., 1996) and PDS ( P e n d r e d S y n d r o m e ) ( E v e r e t t et  al., 1997). DTDST encodes  a sulfate transporter that is deficient i n a n a l l e l i c series o f 3  c l i n i c a l l y distinct c h o n d r o d y s p l a s i a s ; diastrophic d y s p l a s i a , atelosteogenesis type II, and achondrogenesis type I B . A l l 3 disorders result f r o m deficient sulfation o f cartilage  19  p r o t e o g l y c a n s , w h i c h m a y l i m i t b i n d i n g w i t h , a n d a c t i v a t i o n of, s t i m u l a t o r y signals c r u c i a l to c h o n d r o c y t e f u n c t i o n and n o r m a l skeletal d e v e l o p m e n t . M u t a t i o n s i n D R A u n d e r l i e C o n g e n i t a l C h l o r i d e d e f i c i e n c y , a d e b i l i t a t i n g a n d p o t e n t i a l l y fatal disease r e s u l t i n g f r o m d i s r u p t i o n o f c o l o n c h l o r i d e a n i o n homeostasis. P D S encodes a sulfate transporter deficient i n P e n d r e d s y n d r o m e , a f o r m o f n o n s y n d r o m i c deafness w i t h associated goiter. These s e e m i n g l y unrelated disorders share i n c o m m o n mutations i n genes related to  SAT-1.  T o further understand the f u n c t i o n o f  SAT-1, the  C l a r k e group  has generated a m o u s e l i n e w i t h targeted d i s r u p t i o n o f the m u r i n e S a t - 1 gene ( C l a r k e , u n p u b l i s h e d data). H o m o z y g o t e S a t - 1 k n o c k o u t s are v i a b l e and await further characterization. T h e u n u s u a l architecture o f the  Sat-1  and  Idua genes, a n d the  apparent  c o n c o m i t t a n t e x p r e s s i o n o f their m R N A transcripts, indicates antisense m e d i a t e d r e g u l a t i o n o f the genes m a y o c c u r as a result o f the c o m p l e m e n t a r y 141 bp o v e r l a p p i n g r e g i o n . I f the transcripts f r o m the t w o genes interact, mutations that destabilize one transcript m i g h t l e a d to changes i n e x p r e s s i o n o f the other p a r t i a l l y c o m p l e m e n t a r y transcript. F o r e x a m p l e , mutations i n  Idua that destabilize the  I D U A transcript m i g h t  alter S A T - 1 e x p r e s s i o n , w h i c h c o u l d contribute to the disease p h e n o t y p e . A n o t h e r consequence o f the  Sat-1 a n d Idua o v e r l a p is the  potential for altering S A T - 1 e x p r e s s i o n  b y o v e r e x p r e s s i n g c o m p l e m e n t a r y I D U A transgenes. T h i s potential for r e g u l a t i o n o f S A T - 1 e x p r e s s i o n has been r e c o g n i z e d i n efforts to d e v e l o p a m o u s e e x p r e s s i n g h u m a n I D U A , a n d as w i l l be d i s c u s s e d l e d to the use o f the h u m a n , rather than m u r i n e , I D U A cDNA.  1.2.7 I D U A protein synthesis and transport to the lysosome P r o c e s s i n g o f I D U A i n c l u d e s translation, post-translational m o d i f i c a t i o n , and d e l i v e r y to the l y s o s o m e . Transport and p r o c e s s i n g are important to this d i s c u s s i o n as they p l a y a role i n disease but also as these processes are important for the successful therapeutic i n t r o d u c t i o n o f I D U A . F i g u r e 1.5 depicts transport o f l y s o s o m a l e n z y m e s . L y s o s o m a l e n z y m e s , m e m b r a n e proteins, and proteins destined for secretion, are translated o n e n d o p l a s m i c r e t i c u l u m - b o u n d r i b o s o m e s and i n c l u d e a h y d r o p h o b i c s i g n a l sequence w h i c h , via interaction w i t h a s i g n a l r e c o g n i t i o n particle ( S R P ) , mediates translocation o f the d e v e l o p i n g h y d r o p h i l i c protein into the l u m e n o f the e n d o p l a s m i c r e t i c u l u m ( E R ) ( G o r l i c h and R a p o p o r t , 1993).  T h e s i g n a l peptide is not present i n the  mature protein. I n the E R the I D U A p o l y p e p t i d e is f o l d e d and processed, i n c l u d i n g the a d d i t i o n o f h i g h m a n n o s e o l i g o s a c c h a r i d e s c r i t i c a l to targeting the e n z y m e to the l y s o s o m e . A f t e r transfer to the c / s - g o l g i , m a n n o s e o l i g o s a c c h a r i d e s are m o d i f i e d b y the a d d i t i o n o f a mannose-6-phosphate m a r k e r b y the a c t i o n o f t w o e n z y m e s . W i t h the a d d i t i o n o f the mannose-6-phosphate residues, I D U A a n d other proteins targeted for the l y s o s o m e are r e c o g n i z e d b y either o f t w o mannose-6-phosphate receptors ( M P R s ) . T h e first o f these M P R s , the c a t i o n independent M P R ( C I - M P R ) , mediates transfer o f mannose-6-phosphate c o n t a i n i n g proteins that are either n e w l y synthesized, or p r o d u c e d e x o g e n o u s l y and f o u n d i n the extracellular e n v i r o n m e n t , to the l y s o s o m e . T h e c a t i o n dependent M P R ( C D - M P R ) mediates l y s o s o m a l transfer o f n e w l y synthesized e n z y m e o n l y a n d is not i n v o l v e d i n endocytosis o f exogenous proteins. A s w i l l be d i s c u s s e d later, o v e r e x p r e s s i o n o f a p r o t e i n w i t h the mannose-6-phosophate m a r k e r has resulted i n  21  Figure 1.5: Endogenous and exogenous pathways for transport of lysosomal enzymes including I D U A to the lysosomes (1) m R N A trancripts e n c o d i n g l y s o s o m a l e n z y m e s i n c l u d e s i g n a l sequences d i r e c t i n g t r a n s l o c a t i o n o f the s y n t h e s i z e d p r o t e i n into the l u m e n o f the r o u g h e n d o p l a s m i c r e t i c u l u m ( R E R ) , where (2) post-translational m o d i f i c a t i o n s i n c l u d i n g a d d i t i o n o f h i g h mannose o l i g o s a c c h a r i d e s o c c u r s . V e s i c u l a r ( V ) d e l i v e r y to the g o l g i ( G ) i s f o l l o w e d b y (3) p h o s p h o r y l a t i o n o f o l i g o s a c c h a r i d e s (p), w h i c h mediates b i n d i n g to mannose-6-phosphate receptors ( M P R s ) i n the g o l g i . P h o s p h o r y l a t e d e n z y m e s b o u n d to M P R s are then transported to early endososmes ( E E ) , w h e r e (4) a c i d p H dissociates the e n z y m e - r e c e p t o r c o m p l e x w h i c h is then d e l i v e r e d to the l y s o s o m e ( L ) , c o m p l e t i n g the endogenous p a t h w a y for l y s o s o m a l targeting (5). E x o g e n o u s l y p r o d u c e d l y s o s o m a l e n z y m e s are targeted to l y s o s o m e s (6) b y w a y o f c e l l surface M P R s , d e l i v e r e d to the p l a s m a m e m b r a n e ( P M ) f r o m the E E (7). (8) R e c y c l i n g o f M P R s to the g o l g i . N = n u c l e u s , E C = e x t r a c e l l u l a r space. F i g u r e based o n K o r n f e l d 1987.  apparent o v e r w h e l m i n g o f the M P R m e d i a t e d d e l i v e r y o f l y s o s o m a l proteins, r e s u l t i n g i n r e d u c e d l e v e l s o f other l y s o s o m a l proteins i n the l y s o s o m e and increased l e v e l s o f l y s o s o m a l proteins i n the extracellular e n v i r o n m e n t ( A n s o n et al,  1992). P r o t e i n s b e a r i n g  22  the mannose-6-phosphate m a r k e r b i n d M P R s a n d are directed to early e n d o s o m e compartments, w h e r e under the i n f l u e n c e o f l o w p H , the proteins dissociate f r o m the receptors. F r e e d receptors are r e c y c l e d to the g o l g i for reuse. P r o t e i n s destined for the l y s o s o m e , i n c l u d i n g I D U A , are transported i n a n e n d o s o m e l i k e v e s i c l e that fuses w i t h or becomes a lysosome.  1.3 Therapies for MPS I 1.3.1 Rationale M P S I, and other l y s o s o m a l storage disorders, are s o m e w h a t u n i q u e i n that m u l t i p l e strategies for therapeutic reconstitution are p o s s i b l e . T h e rationale for therapy for the M P S disorders is based o n t w o observations. First, cross c o r r e c t i o n o f I D U A deficient fibroblasts o c c u r s w i t h c o - c u l t i v a t i o n o f fibroblasts f r o m patients w i t h other f o r m s o f M P S disorders. T h e corrective factor has been d e t e r m i n e d to be the l y s o s o m a l e n z y m e itself, w h i c h c a n be secreted b y one c e l l for uptake a n d d e l i v e r y to the l y s o s o m e o f another, deficient c e l l ( B a r t o n a n d N e u f e l d , 1971). T h i s means i n contrast w i t h disorders r e q u i r i n g endogenous p r o d u c t i o n o f therapeutic proteins for correct f u n c t i o n , I D U A and other l y s o s o m a l e n z y m e s b e a r i n g the M P R phosphate residue c a n be i n t r o d u c e d i n p r o t e i n f o r m , rather than r e q u i r i n g direct gene therapy approaches.  Second,  patients e x p r e s s i n g o n l y l o w l e v e l I D U A l e v e l s , as l o w as 0 . 1 3 % o f n o r m a l I D U A p r o t e i n levels, undergo a d r a m a t i c a l l y different disease course i n c l u d i n g n o significant central n e r v o u s s y s t e m disease a n d m i l d skeletal disease (Scott et al., 1993).  T h i s suggests that  the successful i n t r o d u c t i o n o f e v e n l o w l e v e l s o f I D U A a c t i v i t y c o u l d i m p r o v e important features o f M P S I currently not f u l l y addressed. F i g u r e 1.6 depicts the routes for d e l i v e r y  23  o f therapeutic e n z y m e to the l y s o s o m e . T r a n s p l a n t e d c e l l s are a source o f e n z y m e w i t h bone m a r r o w transplantation ( B M T ) , w h i c h d e l i v e r s e n z y m e to diseased l y s o s o m e s v i a  Figure 1.6: Routes for the introduction of therapeutic I D U A T h e r a p e u t i c I D U A c a n be p r o d u c e d b y n u m e r o u s strategies. (1) transplanted tissue, e x e m p l i f i e d b y b o n e m a r r o w transplantation ( B M T ) , a n d (2) e n z y m e replacement therapy ( E R T ) , b o t h i n v o l v i n g d e l i v e r y o f e x o g e n o u s l y p r o d u c e d e n z y m e ( s o l i d lines) to l y s o s o m e s v i a c e l l surface M P R s . (3) G e n e therapy ( G T ) , requires d e l i v e r y o f agents to the n u c l e u s (dotted line) resulting i n e n d o g e n o u s l y p r o d u c e d e n z y m e . N = n u c l e u s , R E R = r o u g h endoplasmic reticulum, G=golgi, EE=early endosome, L=lysosome, P M = p l a s m a m e m b r a n e , E C = e x t r a c e l l u l a r space, M P R s = m a n n o s e - 6 - p h o s p h a t e receptors. c e l l surface M P R receptors. U s i n g the same route e n z y m e replacement therapy ( E R T ) c a n l i k e w i s e p r o v i d e therapeutic e n z y m e . G e n e therapy ( G T ) differs f r o m B M T a n d E R T as the therapeutic e n z y m e is p r o d u c e d i n t e r n a l l y a n d is targeted to the l y s o s o m e v i a b o t h  24  Strategy  Target sites  Outcome  Limitations  Species and references  Compatible  Bone marrow transplantation (BMT)  B o n e m a r r o w and  Reduction i n  bone m a r r o w derived cells including  urinary G A G excretion  widespread cells  Somatic  o f the monocyte/macro-  improvement  phage lineage  donors  Human  Transplantion  P e a r s o n , 1986 S h a p i r o et al,  complicatons,  1995  engraftment L i m i t e d benefit  Dog Constantopoulous  Stabilization  to central  etal, 1989  o f neurologic  nervous s y s t e m  complications L i m i t e d benefit to skeletal system  Enzyme replacement therapy (ERT)  Plasma, cells  L i m i t e d benefit  Dog  Reduction in  to central  K a k k i s et al.,  urinary G A G excretion  nervous system  1996  Somatic  L i m i t e d benefit to skeletal  Cat K a k k i s et  improvement  system  2001  Stabilization  Immunologic  Human  o f neurologic  response  K a k k i s et  al,  2001  complications  Gene therapy (GT)  al,  unknown;  Dog  delivery,  S h u l l etal, 1996  S o m a t i c , central  expression,  M e e r t e n s et  nervous system,  persistence,  2002  and skeletal  immunologic  L u t z k o et al.,  system  response  1999  N o t yet d e f i n e d ;  unknown  al,  Table 1.2: Strategies for the introduction of therapeutic I D U A  25  the endogenous route a n d for n e i g h b o r i n g c e l l s , the e x o g e n o u s route. G e n e therapy approaches, i n c l u d i n g  ex vivo gene therapy, have  efficiencies, short-term or s i l e n c e d gene e x p r e s s i o n  suffered f r o m p o o r t r a n s d u c t i o n  in vivo, a n d the  difficulty o f  d e l i v e r i n g therapeutic p r o t e i n to target c e l l s , but have s h o w n some r e m a r k a b l e results i n a n i m a l m o d e l s o f M P S disorders. A s s u m m a r i z e d i n table 1.2, different approaches to therapy offer s p e c i f i c therapeutic benefits, h o w e v e r n o therapy is c o m p l e t e . A u n i q u e therapy m a y be o f benefit to a subset o f MPS I patients w h i c h have premature stop mutations. In this strategy, a m i n o g l y c o s i d e s are u s e d that suppress premature nonsense stop mutations. M P S I fibroblasts heterozygous for  IDUA stop mutations Q 7 0 X  and W 4 0 2 X , c o m m o n  IDUA  mutations, s h o w e d a restoration o f a l m o s t 3 % o f n o r m a l I D U A a c t i v i t y l e v e l s w h e n treated w i t h g e n t a m i c i n . G e n t a m i c i n treatment r e d u c e d G A G a c c u m u l a t i o n i n M P S I c e l l s to a n o r m a l l e v e l f o r at least 2 days after d i s c o n t i n u i n g treatment, a n d p r o d u c e d a r e d u c t i o n i n l y s o s o m a l storage as s h o w n b y flourescent m i c r o s c o p y ( K e e l i n g e t a l . , 2 0 0 1 ) . T h i s treatment c o u l d have a p p l i c a t i o n s for n u m e r o u s disorders r e s u l t i n g f r o m premature stop mutations but the  in vivo effectiveness  a n d tolerance has not yet b e e n  shown.  1.3.2 M P S a n i m a l m o d e l s A n i m a l m o d e l s o f h u m a n disease are useful b o t h i n u n d e r s t a n d i n g disease p a t h o p h y s i o l o g y as w e l l as assessment o f therapies. N a t u r a l l y o c c u r r i n g a n i m a l m o d e l s f o r a n u m b e r o f M P S disorders h a v e been i d e n t i f i e d , i n c l u d i n g a l p h a - L - i d u r o n i d a s e d e f i c i e n c y ( M P S I) i n cat ( H a s k i n s e t a l , 1979) a n d d o g ( S h u l l e t a l , 1982), a r y l  sulfatase d e f i c i e n c y ( M P S V I ) i n cat ( J e z y k e t a l . , 1977), and beta-glucuronidase d e f i c i e n c y ( M P S V I I ) i n d o g ( H a s k i n s e t a l , 1984) a n d m o u s e ( B i r k e n m e i e r e t a l , 1989). E x a m i n a t i o n o f these n a t u r a l l y - o c c u r r i n g m o d e l s indicates they represent w e l l the disease p a t h o l o g y a n d course o b s e r v e d i n the c o r r e s p o n d i n g h u m a n M P S disorder. I n the M P S I cat, a three basepair d e l e t i o n leads to the p r e d i c t e d loss o f a single aspartate residue f r o m the feline I D U A p o l y p e p t i d e ( H e e t a l . , 1999). T h e l e v e l o f r e s i d u a l I D U A a c t i v i t y expressed f r o m the three basepair d e l e t i o n a l l e l e is uncertain, but transient o v e r e x p r e s s i o n o f the c D N A i n c l u d i n g the m u t a t i o n p r o d u c e d no detectable I D U A a c t i v i t y . T h e phenotype o f M P S I i n the cat i n c l u d e s somatic, n e u r o l o g i c a l , a n d skeletal i n v o l v e m e n t s i m i l a r to intermediate or severe M P S I i n humans. T h e M P S I d o g m o d e l shares w i t h the M P S I cat a n intermediate to severe course i n v o l v i n g somatic, n e u r o l o g i c and skeletal systems, a n d has been u s e d e x t e n s i v e l y i n the assessment o f treatment p r o t o c o l s for M P S I. S e c o n d a r y a c c u m u l a t i o n s o f G M 2 , GM3, and g a n g l i o s i d e s have b e e n detected i n canine M P S I as o b s e r v e d i n h u m a n s . T h e o r g a n i z a t i o n o f the canine  Idua gene has  been determined and the c D N A has been  sequenced. T h e basis o f I D U A d e f i c i e n c y i n the M P S I d o g has been f o u n d to result f r o m a G - t o - A t r a n s i t i o n i n the d o n o r s p l i c e site i n i n t r o n 1 o f the canine  Idua gene,  l e a d i n g to i n c l u s i o n o f i n t r o n 1 i n the m R N A and the creation o f a premature t e r m i n a t i o n c o d o n at the e x o n - i n t r o n j u n c t i o n ( M e n o n e t a h , 1992). T h e M P S I d o g is b e l i e v e d to p r o d u c e n o I D U A a c t i v i t y and m a y further have a cross reactive m a t e r i a l ( C R M ) negative status, w h i c h m o d e l s those severe h u m a n M P S I cases w i t h n o generation o f i m m u n o g e n i c protein. T h i s has important i m p l i c a t i o n s for therapies w h i c h introduce p o t e n t i a l l y i m m u n o g e n i c I D U A p r o t e i n or n u c l e i c a c i d e n c o d i n g I D U A to patients that  have not been e x p o s e d to I D U A antigens, and thus the M P S I d o g m o d e l s the challenges encountered i n C R M negative M P S I patients. T h e m o s t dramatic therapeutic success has been demonstrated i n another M P S m o d e l , the M P S V I I m o u s e . A naturally o c c u r r i n g m o u s e m o d e l o f c o m p l e t e betag l u c u r o n i d a s e ( G U S ) d e f i c i e n c y ( M P S V I I , S l y disease) has been i d e n t i f i e d ( B i r k e n m e i e r et al,  1989).  In a d d i t i o n to H S a n d D S stored i n M P S I, M P S V I I i n c l u d e s a c c u m u l a t i o n  o f K S G A G s , and i n h u m a n s complete G U S d e f i c i e n c y results i n a phenotype s i m i l a r to severe M P S I, w i t h i n v o l v e m e n t o f somatic, skeletal and, to a lesser extent than M P S I, n e u r o l o g i c i m p a i r m e n t . A n u m b e r o f factors contribute to the u t i l i t y o f the M P S V I I m o u s e , i n a d d i t i o n to the advantages o f m o u s e m o d e l s i n general discussed, i n c l u d i n g 1) the a v a i l a b i l i t y o f a g e n e t i c a l l y w e l l - d e f i n e d , i n b r e d p o p u l a t i o n o f M P S V I I carrier and affected m i c e , 2) the c l i n i c a l , p a t h o l o g i c , a n d b i o c h e m i c a l characterization o f M P S V I I m i c e , 3) a v a i l a b i l i t y o f r e c o m b i n a n t G U S e n z y m e , 4) a detailed understanding o f the n o r m a l e n z y m e , i n c l u d i n g structure and important m o d i f i c a t o n s relevant to f u n c t i o n has been d e v e l o p e d , and 5) the generation o f h i s t o c h e m i c a l markers to identify in-situ the l o c a t i o n o f functional G U S e n z y m e . Important n o v e l f i n d i n g s h a v e been m a d e w i t h the M P S V I I m o u s e that m a y a p p l y to the M P S disorders i n general. M P S V I I m i c e have defects i n i m m u n e f u n c t i o n i n c l u d i n g a n i m p a i r e d T - c e l l p r o l i f e r a t i o n response and decreased a n t i b o d y p r o d u c t i o n after i m m u n i z a t i o n w i t h f o r e i g n antigens ( D a l y et  al,  2 0 0 0 ) . These defects are thought to result f r o m the i n h i b i t i o n o f proteases r e q u i r e d for antigen p r o c e s s i n g b y l y s o s o m a l G A G s . F e t a l l y s o s o m a l storage i n M P S V I I m i c e is evident v e r y early, b y 15.5 days o f gestation, and c a n be detected i n b r a i n as early as 3 w e e k s o f age ( C a s a l and W o l f e , 2000). T h e phenotype o f M P S V I I is different w h e n the  28  i d e n t i c a l mutant allele is expressed i n different m o u s e strains, i n c l u d i n g differences i n v i g o r , fertility, a n d l o n g e v i t y , i n d i c a t i n g the i m p o r t a n c e o f m o d i f y i n g genes ( C a s a l et  al,  1998).  1.3.3 Bone Marrow Transplantation for M P S I in humans B o n e m a r r o w transplantation is u s e d as a therapy for M P S a n d other l y s o s o m a l storage disorders w i t h l i m i t e d success. B o n e m a r r o w is u s e d as a source o f tissue for transplantation as it undergoes extensive p r o l i f e r a t i o n , offers l o n g t e r m e x p r e s s i o n stability, a n d generates c i r c u l a t i n g effecter c e l l s that permeate the entire b o d y . B o n e m a r r o w transplantation carries a h i g h r i s k o f m o r t a l i t y and m o r b i d i t y f r o m graft versus host disease and other c o m p l i c a t i o n s . I n a g r o u p o f 23 M P S patients treated w i t h B M T , a m o r t a l i t y rate o f 3 0 % w a s o b s e r v e d w h e n H L A - i d e n t i c a l sibs were u s e d as donors a n d e v e n h i g h e r rates o c c u r r e d w i t h n o n c o m p a t i b l e donors (Pearson, 1986). W h i l e effective for the s o m a t i c features o f M P S I s u c h as h e p a t o s p l e n o m e g a l y , c o r n e a l c l o u d i n g , and j o i n t m o b i l i t y , B M T is o f l i m i t e d benefit to the n e u r o l o g i c and skeletal c o m p l i c a t i o n s o f M P S I. S k e l e t a l a b n o r m a l i t i e s do not appear to be reversible, t h o u g h c o m p l i c a t i o n s c a n be p a r t i a l l y prevented i f transplantation o c c u r s v e r y early i n the course o f disease. L i k e w i s e n e u r o l o g i c degeneration m a y be s t a b i l i z e d or p a r t i a l l y prevented w h e n B M T is p e r f o r m e d before significant n e u r o l o g i c d y s f u n c t i o n is present ( S h a p i r o et al., 1995). T h i s h i g h l i g h t s the n e e d for early d i a g n o s i s and i n t e r v e n t i o n for M P S I. T h e l i m i t e d a v a i l a b i l i t y o f suitable m a r r o w donors, the m o r t a l i t y associated w i t h the procedure, and the l i m i t e d effect o n c r i t i c a l n e u r o l o g i c and skeletal features o f M P S I m a k e B M T a less than i d e a l treatment.  1.3.4 Bone marrow transplantation in M P S animal models B o n e m a r r o w transplantation ( B M T ) o f a l l o g e n e i c n o r m a l m a r r o w into m y e l o a b l a t e d M P S I d o g s has been p e r f o r m e d w i t h p a r t i a l success ( B r e i d e r et al., 1989, S h u l l et al., 1987, C o n s t a n t o p o u l o u s et al., 1989). B M T decreases u r i n a r y e x c r e t i o n o f G A G s a n d leads to significant i m p r o v e m e n t o f s o m a t i c tissues i n c l u d i n g l i v e r , spleen, and k i d n e y . M o d e s t i m p r o v e m e n t w a s noted i n the C N S , where l o w l e v e l s o f I D U A a c t i v i t y were detected after transplantation, p r o d u c i n g a decrease i n b r a i n G A G l e v e l s a n d decreased neuronal v a c u l a t i o n ( S h u l l et al., 1987), but considerable C N S p a t h o l o g y persists after B M T . C o r n e a l o p a c i t y w a s l a r g e l y a l l e v i a t e d b y B M T ( C o n t a n t o p o u l o s et al., 1989), h o w e v e r skeletal disease s h o w e d o n l y l i m i t e d i m p r o v e m e n t or w a s d e l a y e d i n p r o g r e s s i o n ( S h u l l et al., 1988). T h i s is s i m i l a r to the l i m i t e d benefit obtained w i t h B M T i n h u m a n s , where s o m a t i c tissues s h o w s i g n i f i c a n t i m p r o v e m e n t w h i l e C N S a n d skeletal features o f M P S I r e m a i n p r o b l e m a t i c , and c o n f i r m s the u t i l i t y o f the M P S I d o g for e v a l u a t i o n and refinement o f B M T for h u m a n M P S I. S i m i l a r to the f i n d i n g s f r o m B M T i n h u m a n and canine M P S I, B M T i n y o u n g adult M P S V I I m i c e is o f l i m i t e d benefit to the skeletal a n d C N S manifestations o f M P S V I I ( B i r k e n m e i e r et al., 1991). T h e l i m i t e d success o f B M T is b e l i e v e d to result f r o m the presence o f i r r e v e r s i b l e features o f disease and the c l o s i n g o f w i n d o w s for therapeutic intervention, s t i m u l a t i n g the i n v e s t i g a t i o n o f therapy earlier i n the course o f m u r i n e M P S VII.  B M T i n n e w b o r n M P S V I I m i c e treated w i t h c o n d i t i o n i n g i r r a d i t i o n s h o w e d  i m p r o v e m e n t i n s o m a t i c systems as expected f r o m p r e v i o u s results but, i m p o r t a n t l y , significant i m p r o v e m e n t w a s s h o w n i n bone g r o w t h a n d structure. N e u r o n a l storage and b e h a v i o u r a l a b n o r m a l i t i e s were not affected. W h i l e p r o m i s i n g , e a r l y B M T w a s not  30  successful i n c o r r e c t i n g storage i n a l l tissues and the i r r a d i a t i o n treatment r e q u i r e d for engraftment i n d u c e d d y s p l a s i a i n b r a i n , bone, and other tissues (Sands et al., 1993, B a s t e d o et al., 1994). T h i s p r o m p t e d i n v e s t i g a t i o n o f early, n o n t o x i c approaches to therapy. W i t h o u t p r e c o n d i t i o n i n g s u c h as m a r r o w ablation, a large dose ( 1 0 ) o f bone 7  m a r r o w c e l l s w a s i n t r o d u c e d b y i.v. i n j e c t i o n to 3 day o l d M P S V I I m i c e , where it is w a s h o p e d they w o u l d engraft resulting i n c h i m e r i c recipients. L o n g - t e r m m u l t i l i n e a g e engraftment w a s established and p o s i t i v e outcomes i n c l u d e d p r o l o n g e d life, i m p r o v e d bone structure, and g e n e r a l l y r e d u c e d storage, but n o r e d u c t i o n i n n e u r o n l y s o s o m a l storage was o b s e r v e d (Soper et al., 2 0 0 1 ) . A s d e s c r i b e d earlier, the fetal e n v i r o n m e n t offers u n i q u e advantages for therapy. T r a n s p l a n a t i o n o f fetal d o n o r tissue into diseased fetal recipients offers further advantages, as graft versus host disease i s l i m i t e d because o f b o t h the i m m u n e tolerance o f the fetal recipient and the i m m u n e i n c o m p e t e n c e o f the fetal d o n o r c e l l s , a n d a d d i t i o n a l l y fetal tissue s h o u l d c o n t a i n a h i g h e r p r o p o r t i o n o f stem c e l l s than older tissues. T r a n s p l a n t a t i o n o f a l l o g e n i c , transgenic fetal l i v e r c e l l s o v e r e x p r e s s i n g h u m a n G U S e n z y m e into fetal recipients s h o w e d early c l i n i c a l i m p r o v e m e n t at 2 m o n t h s o f age but n o i m p r o v e m e n t at 7 m o n t h s ( C a s a l et al., 2 0 0 1 ) . L o w engraftment l e v e l s were a s s u m e d to l i m i t therapeutic benefits, h o w e v e r the n o n t o x i c , early a p p r o a c h c l e a r l y s h o w s p r o m i s e .  1.3.5 Cellular transplantation in M P S animal models S p e c i f i c a l l y targeting the C N S manifestations o f M P S V I I , transplantation o f n e u r o n a l p r o g e n i t o r c e l l s into the cerebral v e n t r i c l e s o f n e w b o r n m i c e resulted i n l o n g t e r m engraftment and increased G U S a c t i v i t y i n the C N S and decreased l y s o s o m a l storage i n neurons and g l i a ( S n y d e r et ah, 1995), a n e n c o u r a g i n g result for C N S therapy.  31  A n o t h e r transplantation a p p r o a c h assessed o n the M P S V I I m o u s e is the i m p l a n t a t i o n o f neo-organs c o n s i s t i n g o f n o r m a l o r o v e r e x p r e s s i n g fibroblasts encapsulated i n a m a t r i x d e s i g n e d to l i m i t i m m u n e destruction o f internal G U S e x p r e s s i n g fibroblasts. I n t r o d u c t i o n o f m i c r o c a p s u l e s o v e r e x p r e s s i n g G U S i n t o the p e r i t i o n e a l c a v i t y o f M P S V I I m i c e r e d u c e d l i v e r , spleen and general v i s c e r a l storage but f a i l e d to increase G U S a c t i v i t y i n the b r a i n , and appeared to i n v o k e a n a n t i - G U S a n t i b o d y response w h i c h l i m i t e d G U S l e v e l ( R o s s e t a l . , 2 0 0 0 ) , w h i l e i n t r o d u c t i o n o f the m i c r o e n c a p s u l e s into the cerebral v e n t r i c l e s reversed l o c a l b r a i n storage and resulted i n increased b r a i n G U S a c t i v i t y and m o r e n o r m a l b e h a v i o r ( R o s s e t a l . , 2 0 0 0 ) .  1.3.6 G e n e t h e r a p y f o r M P S I G e n e therapy for h u m a n M P S I has not yet been attempted. C h a l l e n g e s f a c i n g G T approaches i n c l u d e m a i n t a i n i n g therapeutic l e v e l s o f gene e x p r e s s i o n , d e l i v e r y o f gene constructs to c r i t i c a l tissues l i k e the b r a i n and bone, a n d i m m u n e response to n o v e l proteins or d e l i v e r y agents. T h e attraction o f gene therapy i s the p o s s i b i l i t y o f a u n i v e r s a l treatment, w i t h o u t o n g o i n g i n f u s i o n . A n u m b e r o f groups have investigated the early stage o f autologous m a r r o w transplantation w i t h r e t r o v i r a l l y transduced patient tissue. F a i r b a i r n e t a l . constructed a r e t r o v i r a l v e c t o r w i t h the f u l l length c D N A for I D U A a n d used it to transduce bone m a r r o w f r o m patients w i t h M P S I. T h e y s h o w e d successful gene transfer into desired C D 3 4 + c e l l s and e n z y m e e x p r e s s i o n i n the r e s u l t i n g p r o g e n y c e l l s ( F a i r b a i r n e t a l . , 1996). T h e e n z y m e p r o d u c e d w a s able to correct the l y s o s o m a l d i s t e n t i o n i n M P S macrophages, c o n f i r m i n g that the e n z y m e is f u n c t i o n a l a n d l o c a l i z e s to the l y s o s o m e b y b o t h the endogenous a n d e x o g e n o u s routes as desired. N o h u m a n trials u s i n g this a p p r o a c h have yet been attempted.  32  A n i m a l studies o n m o d e l s o f M P S disorders have s h o w n i m p r o v e m e n t to c r i t i c a l o r g a n systems not addressed i n h u m a n therapy. M o s t i m p r e s s i v e are the results f r o m adeno-associated v i r u s , o r A A V , u s e d to d i r e c t l y transduce diseased tissue in vivo. M o s t i m p o r t a n t l y , it remains to be determined w h a t amount o f c o r r e c t i o n o f skeletal a n d n e u r o l o g i c systems is p o s s i b l e i n M P S I, and h o w to achieve this. S p e c i f i c a l l y , the c e l l u l a r targets, and t i m i n g o f i n t r o d u c t i o n , c r i t i c a l to the successful c o r r e c t i o n o f a l l c o m p l i c a t i o n s o f M P S is not yet k n o w n .  1.3.7 Gene therapy in animal models of M P S disorders T h e M P S disorders are s i n g l e gene disorders w i t h o b v i o u s , e a s i l y detectable p a t h o l o g i c i n v o l v e m e n t and as s u c h are c o n s i d e r e d g o o d m o d e l s for gene therapy.  The  m a i n issues l i m i t i n g i m p r o v e m e n t o f the C N S and skeletal features o f M P S I after B M T or E R T are b e l i e v e d to relate to l i m i t e d d e l i v e r y to these tissues and/or the presence o f i r r e v e r s i b l e p a t h o l o g y before the i n t r o d u c t i o n o f therapy. I d e a l l y , therapies w o u l d correct a l l aspects o f M P S I and be w i d e l y a v a i l a b l e . G e n e therapy offers the p o t e n t i a l for d e l i v e r y to m a n y c e l l types and w i d e spread a v a i l a b i l i t y . N u m e r o u s gene therapies have been assessed o n the M P S I d o g (see table 1.3). D i r e c t i n t r a m u s c u l a r i n j e c t i o n o f p l a s m i d e n c o d i n g the a l p h a - L - i d u r o n i d a s e c D N A resulted i n n o detectable e n z y m e p r o d u c t i o n ( S h u l l et al., 1996). A further attempt at m u s c l e d e r i v e d I D U A e x p r e s s i o n used m y o b l a s t s g r o w n in vitro f r o m m u s c l e b i o p s i e s transduced w i t h a r e t r o v i r a l v e c t o r c o n t a i n i n g the canine gene under c o n t r o l o f the m u s c l e creatine kinase enhancer. W h i l e transduced m y o b l a s t s s h o w e d several h u n d r e d f o l d o v e r e x p r e s s i o n o f I D U A in vitro, e n z y m e  33  Species  Therapy  Outcome  Dog  Bone marrow  B e n e f i t to s o m a t i c storage  transplantation  Improved mobility C o n t i n u e d skeletal disease Some I D U A activity i n brain  Dog  E n z y m e replacement therapy. Intravenous infusion o f human recombinant I D U A  B e n e f i t to s o m a t i c storage  Reference  B r e i d e r et  al,  1989, S h u l l et a/.,1987, Constantopoulous  etal, 1989 K a k k i s et  al,  1996  Some I D U A activity i n brain N o i m p r o v e m e n t to cartilage I m m u n e response  Dog  A d u l t transfer o f retrovirus transfected myoblasts  Dog  In-utero i n j e c t i o n o f I D U A encoding retrovirus  I m m u n e response  S h u l l etal,  1996  N o a m e l i o r a t i o n o f disease Short t e r m e x p r e s s i o n i n  M e e r t e n s L et  al,  2002  m u l t i p l e tissues N o a m e l i o r a t i o n o f disease course  Dog  In-utero transfer o f  I m m u n o t o l e r a n c e to I D U A  iduronidase-transduced  protein  autologous H S C s  L u t z k o et  al,  1999  L o w l e v e l engraftment N o a m e l i o r a t i o n o f disease course  ERT  R e d u c e d l y s o s o m a l distention  Intravenous i n f u s i o n o f  L i m i t e d d e l i v e r y to b r a i n  Cat  human recombinant IDUA ERT  Mouse  Intravenous i n f u s i o n o f human recombinant IDUA  K a k k i s et  al,  2001  I m m u n e response Reduced lysosomal distention C o n t i n u e d skeletal disease  C l a r k e et  al,  unpublished  L i m i t e d d e l i v e r y to b r a i n  Table 1.3: Therapies for M P S I assessed on M P S I models  p r o d u c t i o n d e c l i n e d r a p i d l y f o l l o w i n g r e i n t r o d u c t i o n o f the c u l t u r e d c e l l s i n to M P S I dogs. A n t i b o d i e s s p e c i f i c to I D U A and i n f l a m m a t i o n at sites o f m y o b l a s t i n j e c t i o n were detected ( S h u l l et al,  1996).  34  H o s t i m m u n e response l i k e w i s e appears to l i m i t the benefit o f autologous transplantation o f r e t r o v i r a l l y transduced h e m a t o p o i e t i c stem c e l l s into n o n m y e l o a b l a t e d recipients. E v e n w i t h h i g h l e v e l transduction and o v e r e x p r e s s i o n at 10 to 2 0 0 f o l d n o r m a l l e v e l s i n l o n g - t e r m m a r r o w c e l l cultures, and e v i d e n c e o f engraftment p e r s i s t i n g after 2 to 3 years p o s t - i n f u s i o n , albeit at l o w l e v e l s o f 0.01 to 1% i n b l o o d a n d m a r r o w l e u k o c y t e s , n o I D U A e n z y m e or transcripts e n c o d i n g I D U A were detected i n any recipient d o g ( L u t z k o et al,  1999a). E x a m i n a t i o n o f i m m u n e responses revealed h u m o r a l responses to  I D U A , a n d c e l l u l a r responses were detected against I D U A transduced, but not c o n t r o l , c e l l s ( L u t z k o et al,  1999b).  T h e prenatal e n v i r o n m e n t m a y be i m m u n o g i c a l l y n a i v e and p r o v i d e for the i n t r o d u c t i o n o f therapeutic l e v e l s o f e n z y m e before the f o r m a t i o n i r r e v e r s i b l e features o f M P S I. T o evaluate H S C gene therapy for canine M P S I i n the p r e i m m u n e fetal environement, in utero adoptive transfer o f I D U A transduced M P S I L T M C s w a s p e r f o r m e d o n fetal n o n m y e o l o a b l a t e d M P S I pups. ( L u t z k o et al,  1999) A g a i n , o n l y l o w  l e v e l (1%) engraftement w a s observed, and no I D U A a c t i v i t y or I D U A transcripts were detected i n recipients. A l l recipients d i e d o f M P S disease w i t h n o e v i d e n c e o f i m p r o v e m e n t f r o m the therapy, h o w e v e r , i n contrast w i t h post-natal transplanatation, n o e v i d e n c e o f a h u m o r a l response against I D U A w a s detected. T h e l o w l e v e l s o f engraftment observed, c o u p l e d w i t h p o o r maintenance o f p r o v i r a l I D U A e x p r e s s i o n , at present l i m i t the u t i l i t y o f this a p p r o a c h for M P S I. D i r e c t i n j e c t i o n o f a retrovirus v e c t o r into the d e v e l o p i n g fetus s h o w e d successful transduction o f n u m e r o u s c e l l s types, and, w h i l e gene e x p r e s s i o n and I D U A a c t i v i t y were detected i n the l i v e r a n d k i d n e y o f a deceased p u p , I D U A a c t i v i t y w a s not detected i n adult tissues o f s u r v i v i n g pups  35  (Meertens et ah, 2 0 0 2 ) . T h i s a g a i n m a y be the result o f d e f i c i e n c y i n l o n g t e r m e x p r e s s i o n f r o m p r o v i r a l vectors. N o n e o f the gene therapy approaches yet assessed i n a m o d e l o f M P S I p r o d u c e significant i m p r o v e m e n t to a l l tissue systems a l t h o u g h the benefit o f early i n t e r v e n t i o n is clear. G e n e therapy approaches have also p r o d u c e d s o m e e x c i t i n g results i n the M P S V I I m o u s e . R e v e r s a l o f p r e - e x i s t i n g storage i n neurons and g l i a w a s o b s e r v e d w i t h i m p l a n t a t i o n o f r e t r o v i r a l l y transduced fibroblasts o v e r e x p r e s s i n g G U S into the neocortex o f adult M P S V I I m i c e ( T a y l o r et ah, 1997). H o w e v e r , e x p r e s s i o n o f the transgene w a s lost w i t h t i m e . Stable integration into the host g e n o m e and efficient t r a n s d u c t i o n o f n o n d i v i d i n g cells m a k e s l e n t i v i r u s m e d i a t e d therapy attractive. Intraparenchymal i n j e c t i o n o f l e n t i v i r u s e n c o d i n g G U S into the brains o f adult M P S V I I m i c e p r o d u c e d stable c e l l t r a n s d u c t i o n and G U S e x p r e s s i o n o v e r the 16 w e e k s o f the study, and l e a d to a m a r k e d r e d u c t i o n i n l y s o s o m a l storage i n neurons, g l i a , a n d p e r i v a s c u l a r c e l l s distant f r o m the site o f i n j e c t i o n ( B o s c h et ah, 2 0 0 0 ) . Perhaps the best results o f any a p p r o a c h h a v e c o m e w i t h use o f adeno-associated ( A A V ) v i r u s vectors. A A V vectors c a n infect n o n d i v i d i n g c e l l s and m a y l e a d to integration into the host genome. A single intravenous i n j e c t i o n o f A A V c a r r y i n g the h u m a n G U S c D N A i n n e w b o r n m i c e resulted i n l o n g - t e r m e x p r e s s i o n o f G U S , p e r s i s t i n g at least 4 m o n t h s , i n m u l t i p l e tissues and a dramatic r e d u c t i o n i n l y s o s o m a l storage i n m u l t i p l e o r g a n systems, i n c l u d i n g the b r a i n . A l m o s t c o m p l e t e clearage o f l y s o s o m a l storage w a s o b s e r v e d i n neurons, g l i a , and m e n i n g e s ( D a l y et ah, 1999). F o l l o w - u p a year after the single i n j e c t i o n s h o w e d treated m i c e h a d superior s u r v i v a l rates, bone lengths, and w e i g h t than untreated M P S V I I m i c e ( D a l y et ah, 2 0 0 1 ) . These p r o m i s i n g results  36  indicate the n e u r o l o g i c a n d skeletal features o f M P S disorders c a n be d r a m a t i c a l l y i n f l u e n c e d w i t h therapy, and h i g h l i g h t s the importance o f early i n t e r v e n t i o n .  1.3.8 Enzyme replacement therapy for human lysosomal disorders E n z y m e replacement therapy ( E R T ) is w e l l established for G a u c h e r disease type I, where c l i n i c a l trials have s h o w n reversal o f the l i v e r , spleen, and bone m a r r o w c o m p l i c a t i o n s o f this disorder ( B a r t o n et al., 1991). T h e skeletal p a t h o l o g y that m a y be present i n G a u c h e r type I s h o w e d little i m p r o v e m e n t w i t h E R T . A s bone m a r r o w transplantation does not appear to s i g n i f i c a n t l y alter the course o f central nervous s y s t e m disease observed i n other forms o f G a u c h e r disease w i t h n e u r o l o g i c i n v o l v e m e n t (types II and III), E R T is not c o n s i d e r e d suitable for these forms o f G a u c h e r disease. Important to the success o f E R T for G a u c h e r was m o d i f i c a t i o n o f the e n z y m e to target uptake to c r i t i c a l cells. W i t h G a u c h e r as a m o d e l system, E R T has been d e v e l o p e d for other l y s o s o m a l storage diseases i n c l u d i n g P o m p e disease (Reuser et al., 2 0 0 2 ) and F a b r y disease ( B r e u n i g and W a n n e r , 2 0 0 3 ) . R e c e n t l y , c l i n i c a l trials d e t e r m i n i n g the safety a n d efficacy o f I D U A E R T for M P S I have b e e n p e r f o r m e d . R e c o m b i n a n t I D U A e n z y m e w a s u s e d to treat 10 patients w i t h v a r y i n g severity o f M P S I at a dose o f 125,000 units per k g o f b o d y w e i g h t g i v e n i n t r a v e n o u s l y once w e e k l y for 52 w e e k s ( K a k k i s et al., 2 0 0 1 ) . S i g n i f i c a n t i m p r o v e m e n t w a s noted i n c l u d i n g decreased h e p a t o s p l e n o m e g a l y w i t h n o r m a l i z a t i o n o f the size o f the l i v e r after 26 w e e k s i n eight o f the patients. I m p r o v e d f l e x i b i l i t y and decreases i n u r i n a r y G A G w e r e also f o u n d . I m m u n e reaction to the e n z y m e c a n be p r o b l e m a t i c , and 4 patients h a d detectable s e r u m antibodies to I D U A . It is clear the b l o o d b r a i n barrier  37  l i m i t s the d e l i v e r y o f i n t r a v e n o u s l y injected I D U A to the b r a i n . It is not yet k n o w n what i m p a c t l o n g t e r m E R T w i l l have o n skeletal c o m p l i c a t i o n s o f M P S I, but it i s clear that early i n t e r v e n t i o n has a greater i m p a c t o n disease p r o g r e s s i o n as f o u n d w i t h B M T . E R T has important advantages relative to B M T i n c l u d i n g r e d u c e d m o r t a l i t y and m o r b i d i t y , and is not l i m i t e d b y d o n o r c o m p a t i b i l i t y . W i t h i m p r o v e m e n t s i n d e l i v e r y and o p t i m i z a t i o n o f therapeutic regimes, E R T m a y b e c o m e the preferred therapy for M P S I, as it has for n o n - n e u r o l o g i c forms o f G a u c h e r disease.  1.3.9 Enzyme replacement in animal models of M P S E n z y m e replacement therapy ( E R T ) was attempted i n canine M P S I i n a n t i c i p a t i o n o f h u m a n trials ( K a k k i s et al., 1996, S h u l l et al., 1994). W h i l e the large size o f the d o g m a k e s trials p r o h i b i t i v e , h u m a n r e c o m b i n a n t I D U A w a s p r o d u c e d i n C h i n e s e hamster o v a r y c e l l s a n d p u r i f i e d for intravenous injection. Injected e n z y m e w a s f o u n d to clear f r o m the b l o o d q u i c k l y and w a s taken up p r i m a r i l y b y the l i v e r . D r a m a t i c i m p r o v e m e n t i n l y s o s o m a l storage i n b o t h hepatocytes and K u p f f e r c e l l s w e r e noted after a short trial o f 12 days. M P S I dogs treated for 3 m o n t h s s h o w e d n o r m a l l e v e l s o f I D U A a c t i v i t y i n l i v e r and spleen, l o w e r l e v e l s i n k i d n e y a n d l u n g , a n d b a r e l y detectable (less than 5 % o f n o r m a l ) l e v e l s i n b r a i n , heart v a l v e s , a n d cartilage. P a t h o l o g i c f i n d i n g s m i r r o r e d e n z y m e a c t i v i t y l e v e l s , w i t h i m p r o v e m e n t i n s o m a t i c tissues but no i m p r o v e m e n t noted i n b r a i n or heart v a l v e s ( S h u l l et al,  1994). I n a l o n g t e r m , h i g h e r  dose t r i a l , an M P S I d o g w a s treated for 13 m o n t h s . W h i l e the b r a i n s h o w e d detectable I D U A a c t i v i t y , and decreased l y s o s o m a l G A G storage, h i s t o l o g i c i m p r o v e m e n t o f the b r a i n w a s not evident. I n a d d i t i o n , no i m p r o v e m e n t i n cartilage and heart v a l v e w a s demonstrated w i t h h i g h dose l o n g t e r m E R T ( K a k k i s et al., 1996). T h u s E R T shares w i t h  38  B M T l i m i t a t i o n s i n the therapeutic benefit these options offer to the C N S and skeletal systems, a n d these l i m i t a t i o n s are faithfully r e v i s i t e d i n the M P S I d o g . A s B M T i n v o l v e s replacement o f the r e c i p i e n t ' s i m m u n e system, i m m u n e r e c o g n i t i o n o f f o r e i g n I D U A p r o t e i n is not a n issue w i t h B M T . I n b o t h short t e r m and l o n g term E R T trials, c o m p l e m e n t - a c t i v a t i n g antibodies against h u m a n I D U A were generated, w h i c h m a y be associated w i t h i m m u n e c o m p l e x d e p o s i t i o n o f therapeutic p r o t e i n , disease, and r e d u c e d therapeutic e f f i c i e n c y . These m a y be p a r t i a l l y r e l i e v e d w i t h s l o w i n f u s i o n o f e n z y m e a n d p r e m e d i c a t i o n , as d e s c r i b e d i n the M P S I d o g ( S h u l l et al,  1994).  E R T has been assessed e x t e n s i v e l y i n the m o u s e m o d e l o f M P S V I I . W h e n p e r f o r m e d early as suggested b y p r e v i o u s B M T trials, E R T results i n d e l i v e r y o f detectable G U S a c t i v i t y to c r i t i c a l tissues i n c l u d i n g bone and b r a i n a n d l e a d to a w i d e s p r e a d r e d u c t i o n i n storage ( V o g l e r et al,  1996). I f p e r f o r m e d before 14 d a y s o f age,  E R T p r o d u c e d 3 1 % o f n o r m a l G U S a c t i v i t y i n the b r a i n a n d resulted i n r e d u c e d n e u r o n a l storage ( O ' C o n n o r et al,  1998, V o g l e r et al,  1999). T h i s e a r l y w i n d o w for C N S  i m p r o v e m e n t indicates either the i m m a t u r e b l o o d b r a i n barrier a l l o w s access o f intravenous proteins, or, storage after this t i m e p o i n t is i r r e v e r s i b l e . T h i s w a s the first d e m o n s t r a t i o n o f significant i m p a c t o n the C N S and skeletal disease for an M P S disorder.  1.3.10 Generation of a murine model of M P S I G e n e targeting i n e m b r y o n i c stem c e l l s w a s u s e d to generate a m u r i n e m o d e l for M P S I w i t h c o m p l e t e d e f i c i e n c y o f I D U A (Idua-I-) w h i c h forms the centerpiece o f this thesis ( C l a r k e et al,  1997). A n interruption type k n o c k out construct w a s designed to  introduce the n e o m y c i n a n t i b i o t i c resistance s e l e c t i o n cassette into e x o n V I o f the m u r i n e  Idua l o c u s as  s h o w n i n F i g 1.7. C a r e w a s t a k e n to a v o i d the  Sat-1 gene and  its p o s s i b l e  A . M u r i n e Idua a n d Sat-1 g e n o m i c o r g a n i z a t i o n I  ^  ~15kb  Sat-1 gene III  // I  Yf//v///A  n  m  i  a.  l ^ , ,  II I I I I I I I I III  i M IDUA Exons I and II  XIV  IDUA Exons III to XIV  W i l d type I D U A transcript  11 k b  B . Interruption construct  rmUA*  H  Neo I M - H t i  ii imi un—H II  C . Targeted l o c u s  VI  XIV  Sat-1 transcript  tHCEDH-ttti—\  III  XIV  Targeted I D U A transcript IDUA  exon  SAT-1  exon  Figure 1.7: Targeted inactivation of the murine Idua gene T h e Idua a n d Sat-1 g e n o m i c l o c u s . B ) U s i n g a n interruption type construct e x o n V I o f Idua w a s targeted b y i n t r o d u c t i o n o f a n e o m y c i n s e l e c t i o n cassette. T h e construct w a s d e s i g n e d to m i n i m i z e d i s r u p t i o n to the adjacent Sat-1 gene, regulatory elements for w h i c h l i k e l y are i n i n t r o n 2 o f Idua. C ) T h e targeted l o c u s after h o m o l o g o u s r e c o m b i n a t i o n and the i n t r o d u c t i o n o f N e o . T h e neo cassette is transcribed i n the o r i e n t a t i o n w r i t t e n , i s d r i v e n b y the m o u s e p h o s h o g l y c e r a t e kinase-1 (Pgk-1) p r o m o t e r , a n d i n c l u d e s a p o l y a d e n y l a t i o n sequence.  41  regulatory elements a n d a n interruption construct rather than a d e l e t i o n construct w a s u s e d for I D U A i n a c t i v a t i o n . A n a l y s i s o f Sat-1 e x p r e s s i o n b y N o r t h e r n b l o t analysis i n d i c a t e d S A T - 1 e x p r e s s i o n w a s not altered i n Idua -I- m i c e , w h i l e R T - P C R a n a l y s i s c o n f i r m e d a c o m p l e t e absence o f I D U A m R N A e x p r e s s i o n . H o m o z y g o u s Idua -I- m i c e h a v e n o detectable I D U A e n z y m e a c t i v i t y a n d h a v e increased u r i n a r y G A G s l e v e l s . N o r m a l a p p e a r i n g at b i r t h , M P S I m i c e d e v e l o p a characteristic p h e n o t y p e first discernable at 3 w e e k s o f age and i n c l u d i n g a flattened p r o f i l e , t h i c k e n i n g o f the digits, and coarseness o f the coat as seen i n F i g 1.8. N o o b v i o u s g r o w t h d e f i c i e n c y or m o r t a l i t y is seen w i t h i n the first 2 0 w e e k s o f life, but as d i s c u s s e d i n C h a p t e r 3, M P S I m i c e have a shortened life span. S k e l e t a l disease i n the M P S I m o u s e i n c l u d e s anterior f l a r i n g o f the r i b s and t h i c k e n i n g o f the facial bones as e a r l y as 4 w e e k s o f age. P a t h o l o g i c a l e v i d e n c e o f disease w a s f o u n d at 4 w e e k s o f age as l y s o s o m a l storage o b s e r v e d i n l i m i t e d tissues i n c l u d i n g c e l l s o f the r e t i c u l o e n d o t h e l i a l system s u c h as K u p f f e r cells, s p l e n i c s i n u s o i d a l l i n i n g c e l l s , and g l i a l c e l l s . A t 8 w e e k s o f age, m o r e w i d e s p r e a d l y s o s o m a l storage is n o t e d i n hepatocytes, c h o n d r o c y t e s , and neurons, as seen i n F i g 1.9. W h i l e Idua -I- m i c e l i v e to a d u l t h o o d i n contrast w i t h h u m a n s w i t h c o m p l e t e d e f i c i e n c y o f I D U A , the severe skeletal, n e u r o l o g i c , a n d s o m a t i c disease o b s e r v e d i n the Idua -I- m i c e is representative o f the severe f o r m o f M P S I or H u r l e r s y n d r o m e . C h a p t e r 3 is a study o f the l o n g t e r m p a t h o p h y s i o l o g y o f I D U A d e f i c i e n c y i n this m u r i n e m o d e l o f M P S I. T h e generation o f transgenic m o d e l s o f therapy for use i n c o n j u n c t i o n w i t h the Idua -I- m o u s e strain is the focus o f Chapters 4 a n d 5.  42  F i g u r e 1.8: C l i n i c a l f e a t u r e o f I d u a -/- m i c e at 12 w e e k s o f age  A : Facial dysmorphic features o f Idua -I- mouse (on the right) compared with Idua +/+ mouse (left). Note the shortness to the snout in the Idua -I- mouse with a loss o f the fine taper to the face. B : Photograph o f the hind paws o f the same mice noting the broadness and thickness to the digits o f the Idua -I- mouse, right. A s published Clarke et al, 1997.  43  F i g u r e 1.9: E l e c t r o n m i c r o g r a p h s f r o m 8 w e e k o l d I d u a - / - a n d c o n t r o l m i c e A , B : L i v e r , m a g n i f i c a t i o n 4 1 7 5 X . A : Idua  +/+ m o u s e hepatocyte ( H ) . B : Idua -I- mouse,  note v a c u l a t e d hepatocytes ( H ) , and v a c o u l a t e d central K u p f f e r c e l l ( K ) . C , D : S p l e e n , magnification 5400X. C :  Idua +/+ m o u s e , s i n u s o i d a l c e l l ( S ) . D : Idua -I- m o u s e , note the  h i g h l y v a c o u l a t e d s i n u s o i d a l c e l l ( S ) . E , F : C e r e b r a l c o r t i c a l neuron, m a g n i f i c a t i o n 9000X. E :  Idua +/+ m o u s e . F : Idua -I- m o u s e , note the p r o m i n e n t n e u r o n a l c y t o p l a s m i c  v a c u o l a t i o n ( N C ) . A l l m a g n i f i c a t i o n s are a p p r o x i m a t e . A s p u b l i s h e d C l a r k e et al., 1997.  44  1.4 Thesis objectives and supporting hypotheses Objective: C h a r a c t e r i z a t i o n o f the l o n g t e r m p a t h o p h y s i o l o g y o f the M P S I m o u s e .  Hypothesis: I D U A d e f i c i e n c y i n the m o u s e w i l l result i n a progressive disease course s i m i l a r to severe M P S I i n humans.  Objective: G e n e r a t i o n o f a c o n d i t i o n a l transgenic m o u s e l i n e w i t h the potential to express h u m a n IDUA.  Hypotheses: A b o v e a certain l e v e l , e x p r e s s i o n o f the h u m a n c D N A e n c o d i n g I D U A is t o x i c a n d w i l l p r o d u c e a u n i q u e phenotype, w h i l e l o w l e v e l transgenic e x p r e s s i o n o f I D U A w i l l be tolerated i n a n o r m a l b a c k g r o u n d . L o w l e v e l transgenic e x p r e s s i o n o f h u m a n I D U A w i l l be c o r r e c t i v e for a l l aspects o f m u r i n e M P S I.  45  C h a p t e r 2: M a t e r i a l s a n d M e t h o d s  2.1 Polymerase chain reaction  Primer ID Neo A  Purpose  5 prime to 3 prime E S clone and mouse knockout  Human IDUA detection  HID4R HID3F  Human IDUA detection  HID6R  Conditions  58 c anneal  GGAAGACAATAGCAGGATGCT 1200  35 cycles  62 c anneal  CGCTTCTGGAGGAGCACAGG 340  35 cycles  CTGGAGACCAAGTCCTTCCACTC  2% D M S O  CTGAGCTACAACTTCACCCACCTG  68 c anneal 580  30 cycles  CTCGTCGTTGTAAATGGGGGTGTC  HID7R HID4F  Product size in basepairs  AAGATGGCTTGTCACCTGTCTTCAC  PrimerB HID1F  Primer Sequence  Human IDUA detection  62 c anneal  GACTTTGAGGACAAGCAGCAGGTG 370  35 cycles  CTTCCTGTGGAGGGAGATGTAGTC T a b l e 2.1: P C R p r i m e r s Isolated g e n o m i c D N A w a s used i n P C R reactions. P C R p r i m e r s u s e d i n this  thesis are s h o w n i n table 2 . 1 . T y p i c a l c o n d i t i o n s were I m M M g C b , 0.8 u m each p r i m e r , 0.1 m M d N T P , 0.5 U o f T a q D N A p o l y m e r a s e ( G i b c o B R L ) , and I X P C R buffer i n a f i n a l v o l u m e o f 25 to 50 u l . P C R s were i n i t i a t e d at 94 C for 2 minutes and then c y c l e d t h r o u g h a n n e a l i n g and e l o n g a t i o n for 30 to 4 0 c y c l e s as i n d i c a t e d .  2.2 P r e p a r a t i o n o f the h u m a n I D U A  cDNA  T h e 2 1 0 0 basepair sequence e n o d i n g the h u m a n I D U A c D N A , (a gift f r o m D r . John H o p w o o d , W o m e n ' s and Children's Hospital, Adelaide Australia), was removed  f r o m v e c t o r b a c k b o n e w i t h an with  TspRl, the  EcoRI a n d Hindlll c o - d i g e s t i o n .  U s i n g partial digestion  native I D U A p o l y a d e n y l a t i o n s i g n a l w a s r e m o v e d . I n preparation for  l i g a t i o n into assorted constructs, the  EcoRI/Hindlll fragment  w a s K l e n o w blunted.  2.3 Construction of the myeloid-specific transgene constructs. (CD11B-IDUA and CD1 IB-reporter gene) T h e 6891 b p C D 1 l b . H G H ( D 7 3 6 ) . g c k v e c t o r (a gift f r o m F r a n k J i r i k , p u b l i s h e d in B a c k  et al.,  1995) was o p e n e d at a u n i q u e  BamHI site for i n t r o d u c t i o n of  either the  h u m a n I D U A c D N A or one o f t w o reporter genes, beta-galactosidase or enhanced green fluorescent protein. T h e C D 1 l b vector w a s then b l u n t e d and the 5 ' t e r m i n a l phosphate residues were r e m o v e d to reduce s e l f l i g a t i o n u s i n g c a l f a l k a l i n e phosphatase ( C A I P ) (BPvL). C A F P and r e s i d u a l e n z y m e were r e m o v e d i n preparation for l i g a t i o n . F i n a l l y the h u m a n I D U A c D N A , or one o f the reporter genes, w a s b l u n t e d and ligated w i t h the vector b a c k b o n e . T h e f i n a l constructs were l i n e a r i z e d , and m i x e d for pronuclear c o injection.  2.4 Construction of the myeloid-specific transgene constructs with a selection cassette for selection in E S cells. (CD11B-IDUA and CD1 IB-reporter gene) T o the C D 1 1 B - I D U A construct d e s c r i b e d above, a P G K - N E O s e l e c t i o n cassette w a s added w h i c h a l l o w s for s e l e c t i o n o f E S c l o n e s that have integrated, a n d are capable o f e x p r e s s i n g , the transgene construct.  T h e C D 1 I B - r e p o r t e r gene constructs d i d not  have a s e l e c t i o n cassette added and w o u l d be expected to be f o u n d i n o n l y a subset o f N e o resistant c l o n e s after co-integration o f the constructs f o l l o w i n g electroporation into E S cells.  48  2.5 Construction of a ubiquitous I D U A expressing transgene construct. ( C M V IDUA) T h e p E G F P - C 2 m a m m a l i a n e x p r e s s i o n vector ( C l o n t e c h ) w a s used a source o f a promoter for d r i v i n g h i g h l e v e l , u b i q u i t o u s h u m a n I D U A e x p r e s s i o n , as w e l l as a source o f the enhanced green flourescent p r o t e i n ( E G F P ) gene. T h i s vector i n c l u d e s a 6 0 0 b p h u m a n c y t o m e g a l o v i r u s ( C M V ) i m m e d i a t e early p r o m o t e r w h i c h w a s r e m o v e d w i t h sequential Asel and Nhel digests. T h e promoter w a s then b l u n t e d a n d l i g a t e d w i t h a Clal digested a n d b l u n t e d p B S - I D U A vector, p l a c i n g the p r o m o t e r i n front o f the I D U A c D N A . O r i e n t a t i o n w a s c h e c k e d w i t h restriction digestion. T h e p o l y a d e n y l a t i o n sequence and t e r m i n a l n o n - c o d i n g 3 exons o f the h u m a n g r o w t h h o r m o n e gene ( H G H ) w a s then r e m o v e d f r o m the C D 1 l b parent vector, described earlier, to increase e x p r e s s i o n levels o f I D U A . T h i s 2.2 k b EcoRI/EcoRI  hgh fragment w a s c l o n e d into a n e x i s t i n g EcoRl  site.  T h i s c o m p l e t e d the C M V - I D U A p o r t i o n o f the construct. A reporter construct w a s then isolated f r o m p E G F P - C 2 , c o n s i s t i n g o f the C M V promoter a n d the E G F P gene as w e l l as a p o l y a d e n y l a t i o n sequence. F i r s t , a Bglll and BamHI digest o n p E G F P - C 2 r e m o v e d a m u l t i p l e c l o n i n g site w h i c h i n c l u d e d restriction sites that w o u l d m a k e d o w n s t r e a m i s o l a t i o n o f the final construct difficult. A f t e r r e m o v a l o f the m u l t i p l e c l o n i n g site, the m o d i f i e d p E G F P - C 2 w a s s e l f ligated. T h e C M V - E G F P 1.4 k b fragment w i t h o u t the internal m u l t i p l e c l o n i n g site w a s then isolated u s i n g a n Asel/Mlul  d i g e s t i o n , blunted, a n d  ligated into the C M V - I D U A vector at a n EcoRI site d o w n s t r e a m o f the C M V - I D U A fragment. T h e final construct, c a l l e d C M V - I D U A , w a s prepared for p r o n u c l e a r i n j e c t i o n w i t h anXhol/Bam  ///digest.  49  2.6 Construction of a ubiquitous I D U A expressing transgene construct with a selection cassette for selection in E S cells. (pFlox-IDUA) F o r s e l e c t i o n i n E S c e l l s , the isolated C M V - I D U A construct d e s c r i b e d above, i n c l u d i n g the E G F P reporter, w a s i n t r o d u c e d into p F l o x , a parent v e c t o r i n c l u d i n g b o t h the n e o m y c i n resistance gene a n d the t h y m i d i n e k i n a s e gene ( M a r t h , u n p u b l i s h e d ) . T h e t h y m i d i n e k i n a s e gene w a s not r e q u i r e d for this project but this v e c t o r c o n t a i n e d c o n v e n i e n t c l o n i n g sites relative to other n e o m y c i n e n c o d i n g constructs.  2.7 Construction of a ubiquitous I D U A expressing transgene construct with a selection cassette for selection in E S cells. (pCAGGS-IDUA) A s e c o n d construct intended to d r i v e h i g h l e v e l , u b i q u i t o u s h u m a n I D U A e x p r e s s i o n w a s generated u s i n g a v e c t o r p r o v e n to result i n h i g h l e v e l e x p r e s s i o n i n transgenic m u r i n e lines, p C A G G s (a gift f r o m D r . J u n - i c h i M i y a z a k i , p u b l i s h e d i n N i w a e t al., 1991). p C A G G s features a p r o v e n u b i q u i t o u s l y strong p r o m o t e r based o n the c h i c k e n beta-actin p r o m o t e r as w e l l as the C M V - I E enhancer. O t h e r features o f this vector i n c l u d e the rabbit b e t a - g l o b i n gene p o l y a d e n y l a t i o n sequence for efficient post t r a n s c r i p t i o n a l p r o c e s s i n g , and s p l i c i n g to increase e x p r e s s i o n l e v e l s . I n order to generate a single construct that encodes b o t h h u m a n I D U A as w e l l as a reporter gene, I chose to use a n internal r i b o s o m e entry site ( I R E S ) w h i c h a l l o w s for e x p r e s s i o n o f t w o distinct proteins f r o m a single R N A transcript. B y p h y s i c a l l y l i n k i n g I D U A a n d reporter gene e x p r e s s i o n , c e l l s p o s i t i v e for reporter gene e x p r e s s i o n are l i k e l y to express I D U A . T h e generation o f p C A G G s - I D U A w a s intended to express h u m a n I D U A and the beta-geo f u s i o n p r o t e i n e n c o d i n g n e o m y c i n resistance for selection i n E S c e l l s , as w e l l as the reporter gene beta-galactosidase. A v e c t o r d e s c r i b e d e a r l i e r w a s u s e d w h i c h i n c l u d e d the h u m a n I D U A c D N A w i t h n o p o l y a d e n y l a t i o n site i n a p B S b a c k b o n e . T h i s vector w a s  digested w i t h Xbal, and a 4.5 k b Xbal/Xbal insert c o n t a i n i n g an I R E S site a n d l i n k e d beta-geo f u s i o n gene w e r e then ligated. T h i s l i n k e d the I D U A c D N A to the I R E S betageo sequences. N e x t , the I D U A - I R E S - b e t a - g e o fragment w a s isolated w i t h a partial  Sail and  NotI digest, and the 6.7 k b fragment w a s isolated i n preparation for l i g a t i o n into  the parent p C A G G S vector. H o w e v e r for later i s o l a t i o n o f the c o m p l e t e d construct, a Sail site h a d to be i n t r o d u c e d into p C A G G s , w h i c h w o u l d a l l o w eventual i s o l a t i o n o f the c o m p l e t e d transgenic construct w i t h a single, c o m p l e t e d e s i g n e d w h i c h i n c l u d e s the  Sail digestion. A n o l i g o w a s  Sail site a n d has a f l a n k i n g Hindlll site, a n d w h i c h w o u l d i n  s o l u t i o n f o r m a d u p l e x that w o u l d a l l o w l i g a t i o n w i t h Hindlll sites. T h e sequence for this o l i g o n u c l e o t i d e is 5 ' - A G C T G T C G A C - 3 ' . A f t e r l i g a t i o n o f the  Sail site into Hindlll  digested p C A G G s , the a m p l i f i e d vector w a s EcoRI digested to r e m o v e an undesired E G F P sequence, a n d a l i n k e r a l l o w i n g s t i c k y l i g a t i o n w i t h the 6.7 k b I D U A - I R E S - b e t a geo fragment w a s engineered. T h e l i n k e r w a s generated b y p r o d u c i n g t w o o l i g o n u c l e o t i d e s w h i c h , as a d u p l e x , w o u l d have e x p o s e d EcoRI s t i c k y ends and contain both  NotI and Xhol sites. T h e sequences o f these o l i g o s are: o l i g o #1:  5'-  A A T T C T C G A G G C G G C C G C - 3 ' , o l i g o # 2: 5 ' - A A T T G C G G C C G C C T C G A G - 3 ' . a d d i t i o n o f the  After  NotI a n d Xhol sites, the vector w a s digested w i t h Notl/Xhol, a n d the  Sall/NotI 6.1 k b I D U A - I R E S - b e t a - g e o fragment w o u l d a l l o w s t i c k y l i g a t i o n , a s ^ T z o / a n d  Sail sites are c o m p a t i b l e , h o w e v e r the j u n c t i o n f o r m e d is subsequently not r e c o g n i z e d by Sail. F i n a l l y , a c o m p l e t e Sail digestion a l l o w s for the i s o l a t i o n o f an a p p r o x i m a t e l y 9.4 k b transgene construct for electroporation into E S cells.  51  2.8 Construction of a conditional Cre regulated transgene construct with a selection cassette for selection in E S cells ( p C C A L L 2 - I R E S - I D U A )  T h e p C C A L L 2 - I R E S - h A P / c g p l a s m i d w a s o p e n e d at a u n i q u e  Xhol site, b l u n t e d ,  a n d the t e r m i n a l 5 p r i m e phosphate group w a s r e m o v e d to l i m i t s e l f - l i g a t i o n . T h e b l u n t e d h u m a n I D U A c D N A , w i t h n o p o l y a d e n y l a t i o n s i g n a l , was l i g a t e d w i t h the construct. P l a s m i d clones w i t h the I D U A insert were i d e n t i f i e d b y P C R , and orientation o f the I D U A insert w a s determined b y restriction a n a l y s i s .  2.9 Histopathology A n i m a l s were s a c r i f i c e d b y c e r v i c a l d i s l o c a t i o n and tissues obtained w i t h i n 20 m i n u t e s o f death. T h e c e r e b r u m a n d c e r e b e l l u m o f mutant a n d c o n t r o l m i c e were r e m o v e d at autopsy a n d g r o s s l y e x a m i n e d and w e i g h e d . T h e c e r e b r u m w a s sectioned c o r o n a l l y and the c e r e b e l l u m h o r i z o n t a l l y . Sections were f i x e d i n 1 0 % neutral buffered f o r m a l i n , snap f r o z e n i n l i q u i d n i t r o g e n and f i x e d i n 4 % gluteraldehyde. T h e paraffin e m b e d d e d sections o f c e r e b r u m and c e r e b e l l u m were sectioned at 5 m i c r o n s , stained w i t h h a e m a t o x y l i n a n d e o s i n ( H & E ) , a n d p e r i o d i c - a c i d s c h i f f w i t h diastase ( P A S + diastase). Sections o f the cerebral hemispheres and c e r e b e l l u m were h i s t o l o g i c a l l y e x a m i n e d b y light m i c r o s c o p y . T h e h i n d l i m b s were disarticulated f r o m the h i p s , c l e a r e d o f soft tissue a n d f i x e d o v e r n i g h t i n 1 0 % neutral f o r m a l i n . T h e bones were d e c a l c i f i e d i n 2 2 % f o r m i c a c i d for 18 hours a n d bisected l o n g i t u d i n a l l y . P a r a f f i n e m b e d d e d sections were then cut at 5 m i c r o n s a n d stained w i t h H & E . T h e g r o w t h plate, c o r t i c a l a n d trabecular bone was e x a m i n e d h i s t o l o g i c a l l y w i t h b o t h l i g h t and p o l a r i z i n g m i c r o s c o p y .  52  2.10 Radiography A n i m a l s were anesthetized w i t h m e t h o x y f l u r a n e and X - r a y e d at 2 0 0 M A S and 50 K V P at a distance o f 9 8 0 m m f r o m the source u s i n g a G e n e r a l E l e c t r i c portable X - r a y machine.  2.11 Thin Layer Chromatography of Gangliosides T o t a l l i p i d w a s extracted f r o m b r a i n and partitioned w i t h the m e t h o d o f F o l c h et al., (1957), as m o d i f i e d b y S u z u k i (1965). B r a i n tissue f r o m n o r m a l and mutant m i c e w a s w e i g h e d and then h o m o g e n i z e d for 5 m i n . w i t h 19 v o l . c h l o r o f o r m - m e t h a n o l (2:1, v / v ) . A f t e r filtration, the residue w a s extracted w i t h 10 v o l . c h l o r o f o r m - m e t h a n o l (1:2, v / v ) c o n t a i n i n g 5 % H2O. T h e filtered extracts were c o m b i n e d a n d c h l o r o f o r m w a s added to g i v e a f i n a l concentration o f c h l o r o f o r m - m e t h a n o l o f (2:1, v / v ) . T h e l i p i d s were p a r t i t i o n e d w i t h the a d d i t i o n o f 0.2 v o l . o f 0 . 8 % K C l . T h e upper phase w a s r e m o v e d a n d the l o w e r phase w a s w a s h e d t w i c e . T h e p o o l e d upper phases w e r e then d i a l y z e d i n S p e c t r a / P o r ® t u b i n g ( S p e c t r u m M e d i c a l Industries C o . ) for 2 days at 4 °C against several changes o f d i s t i l l e d H2O a n d then l y o p h i l i z e d . T h e resulting g a n g l i o s i d e s were resuspended w i t h 2 0 0 u.1 o f c h l o r o f o r m - m e t h a n o l - w a t e r (10:10:3, b y v o l u m e ) and c h r o m a t o g r a p h e d o n s i l i c a 60 A plates ( W h a t m a n Inc.) w i t h c h l o r o f o r m , m e t h a n o l 6 0 : 4 0 a n d 0 . 2 % o c a l c i u m c h l o r i d e for 8 hours. T h e v o l u m e l o a d e d o n each lane w a s n o r m a l i z e d for a b r a i n w e i g h t o f 0.3 g m s . T h e g a n g l i o s i d e s were v i s u a l i z e d b y s p r a y i n g w i t h 2 % r e s o r c i n o l , f o l l o w e d b y d r y i n g at 100 °C for 30 m i n .  53  2.12 Colorimetric Assay of Glycosaminoglycans U r i n a r y g l y c o s a m i n o g l y c a n and creatinine e x c r e t i o n w a s m e a s u r e d as described b y W h i t l e y et al. (1989). U r i n e samples f r o m n o r m a l and affected m i c e w e r e c o l l e c t e d a n d stored at -70 °C u n t i l assayed. H e p a r a n sulfate ( S i g m a C h e m i c a l C o m p a n y ) was used to generate a standard curve. U r i n e samples o f 40 u l , d i l u t e d 2.5 times for n o r m a l m i c e a n d 8 t i m e s for mutant m i c e , w e r e m i x e d w i t h 500 p i o f 35 u m o l / L D M B reagent, s o d i u m formate buffer, p H 3.5. A b s o r b a n c y at 535 n m w a s m e a s u r e d w i t h i n 30 m i n . w i t h a B e c k m a n D U 640 spectrophotometer. U r i n a r y creatinine w a s m e a s u r e d b y the m e t h o d o f F o l i n u s i n g creatinine ( S i g m a C h e m i c a l C o m p a n y ) as a standard. 2 u l o f urine w a s m i x e d w i t h 8 u l o f water f o l l o w e d b y 5 0 0 u l o f p i c r i c a c i d s o l u t i o n . A b s o r b a n c y at 535 n m w a s m e a s u r e d after 20 minutes.  Q u a n t i f i c a t i o n o f g l y c o s a m i n o g l y c a n and  creatinine i n the urine samples w a s done b y c o m p a r i n g to the respective standard curves.  2.13 Embryonic stem cell growth and electroporation R l e m b r y o stem c e l l s (a gift f r o m A . N a g y , M o u n t S i n a i H o s p i t a l R e s e a r c h Institute, T o r o n t o ) at passage 13 w e r e c u l t u r e d o n p r i m a r y e m b r y o n i c fibroblasts, a c c o r d i n g to c o n d i t i o n s as described ( W u r s t a n d Joyner, 1993). E S c e l l s w e r e g r o w n i n D u l b e c c o ' s m o d i f i e d E a g l e ' s m e d i u m w i t h h i g h G l u c o s e ( G i b c o ) supplemented w i t h 1 5 % fetal c a l f serum ( H y c l o n e ) , 1 m M nonessential a m i n o acids ( G i b c o ) , 1 m M s o d i u m pyruvate ( G i b c o ) , 2 m M L - g l u t a m i n e , 10-6 B - m e r c a p t o e t h a n o l ( S i g m a ) , a n d 1000 U / m l l e u k e m i a i n h i b i t o r y factor ( G i b c o ) . E S and fibroblasts w e r e c u l t u r e d at 37 C w i t h 5 % C 0 2 i n air w i t h h u m i d i t y . E l e c t r o p o r a t i o n o f E S c e l l s (1 X 10 ) at passage 14 or 15 w a s 7  p e r f o r m e d i n a B i o - R a d G e n e P u l s e r at 2 5 0 V , 5 0 0 u F . I m m e d i a t e l y after electroporation E S c e l l s were p l a t e d o n gelatin ( S i g m a ) coated plates at h i g h d i l u t i o n s to p r o m o t e single  54  c o l o n y d e v e l o p m e n t . T h e next day n e o m y c i n s e l e c t i o n u s i n g G 4 1 8 ( G i b c o ) at 2 0 0 u g / m l w a s c o m m e n c e d . A f t e r 7 to 10 days o f selection i n d i v i d u a l E S c o l o n i e s were p i c k e d , a g g r e s s i v e l y t r y p s i n i z e d ( G i b c o ) , and transferred to 96 w e l l plates w i t h e m b r y o n i c fibroblasts for e x p a n s i o n . E S c e l l s were g r o w n for 2 to 3 days before passaging, i n v o l v i n g t r y p s i n i z a t i o n and transfer to 6 w e l l plates w i t h fibroblasts. E S c e l l s were propagated o n fibroblasts u n t i l sufficient numbers were attained for s c r e e n i n g as desired a n d freezing. F o r freezing, l o g phase g r o w t h E S c e l l s were t r y p s i n i z e d , c o u n t e d a n d f r o z e n i n freezing m e d i a c o n t a i n i n g 5 0 % F e t a l c a l f serum, 1 0 % D M S O , and 4 0 % E S m e d i a (described above) at 5 m i l l i o n c e l l s per m l i n one m l c r y o v i a l s .  2.14 Transfection of E S cells with Cre plasmid T r a n s f e c t i o n o f E S clones w i t h C r e e n c o d i n g p l a s m i d (Joanne F o x , u n p u b l i s h e d ) w a s p e r f o r m e d to identify clones capable o f C r e r e c o m b i n a t i o n and e x p r e s s i o n o f the h u m a n a l k a l i n e phosphatase reporter as w e l l as transgenic I D U A e n z y m e a c t i v i t y . E S c l o n e s were seeded to achieve l o w density, r a p i d l y g r o w i n g c l o n a l r e p l i c a plates. T r a n s f e c t i o n was c a r r i e d out as d e s c r i b e d u s i n g L i p o f e c t a m i n e ( B R L Cat# 10964-013) i n a 96 w e l l plate format u s i n g 0.1 u g o f p l a s m i d D N A per w e l l . E S c l o n e s w e r e i n c u b a t e d w i t h C r e p l a s m i d for 3 hours, and c l o n e s w e r e harvested 3 days later for reporter gene a n a l y s i s and I D U A e n z y m e a c t i v i t y a n a l y s i s .  2.15 IDUA enzyme assay I D U A a c t i v i t y w a s measured u s i n g a sensitive f l u o r o m e t r i c assay ( H o p w o o d et al., 1979). T i s s u e s were h o m o g e n i z e d i n d i s t i l l e d water (25:1 v o l u m e to w e i g h t ratio) u s i n g a m o t o r d r i v e n pestle i n a c h i l l e d 10 m l glass tube. E n z y m e assays w e r e p e r f o r m e d  55  i n buffer c o n s i s t i n g o f 0.01 % f o r m i c a c i d , 77 m M N a C I , 7.7 m M s o d i u m azide, 0.1 % T r i t o n X - 1 0 0 a n d 25 u M 4 - m e t h y l u m b e l l i f e r y l - ( a l p h a - L - i d u r o n i d e ( S i g m a ) p H 3.5 i n a f i n a l v o l u m e o f 50 u l . S a m p l e s were i n c u b a t e d at 3 7 C for 3-4 h for l i v e r homogenates a n d c e l l culture samples, and 16 h for t a i l c l i p p i n g s . T h e r e a c t i o n was stopped w i t h 2 m l o f 1 M g l y c i n e N a O H buffer, p H , 10.5. F l u o r e s c e n c e w a s m e a s u r e d w i t h a H o e f f e r S c i e n t i f i c F l o r o m e t e r ( m o d e l T K O 100) and expressed i n r e l a t i o n to p r o t e i n mass as determined u s i n g the L o w r y assay ( L o w r y et al., 1951). A c t i v i t y w a s expressed as n a n o m o l e s o f 4 - m e t h y l - u m b e l l i f e r o n e released per hour.  2.16 Beta-galactosidase staining of E S cells and tissue fragments E S c e l l s attached to plates were stained for L a c Z b y gentle f i x a t i o n w i t h 0 . 2 % gluteraldehyde i n I X P B S for 5 m i n u t e s o n i c e . C e l l s were w a s h e d three t i m e s i n w a s h buffer (2 m M M g C l , 0 . 0 1 % d e o x y c h o l a t e , 0 . 0 2 % N o n i d e t - P 4 0 , 100 m M N a P 0 , p H 7.3). 2  4  C e l l s were then stained i n w a s h buffer c o n t a i n i n g 1 m g / m l X - g a l , 6 m M p o t a s s i u m ferrocyanide, a n d 5 m M p o t a s s i u m f e r r i c y a n i d e .  S t a i n i n g w a s a l l o w e d to p r o c e e d  o v e r n i g h t at 37 C , w i t h staining often apparent w i t h i n m i n u t e s to hours. E a r punches or sections o f t a i l w e r e stained for L a c Z b y p l a c i n g i n 96 w e l l plates. S a m p l e s were w a s h e d three t i m e s i n I X P B S , then f i x e d for 10 to 3 0 minutes o n i c e i n 0 . 2 % gluteraldehyde i n I X P B S . S a m p l e s w e r e then stained as d e s c r i b e d above, w i t h s t a i n i n g apparent after 10 minutes.  2.17 Alkaline phosphatase staining of E S cells E S c e l l s b o u n d to plates were f i x e d i n 2 % f o r m a l d e h y d e , 0 . 2 % gluteraldehyde, i n I X D u l b e c c o ' s P B S w i t h no C a + or M g 2 + , for 5 to 10 m i n u t e s at 4 C . C e l l s were then  56  w a s h e d t w i c e w i t h I X P B S at r o o m temperature for 5 minutes each. T h e n 100 u l (for 96 w e l l plate) o f I X P B S w a s a d d e d a n d plates w e r e p l a c e d at 70 C for 3 0 m i n u t e s to inactivate endogenous a l k a l i n e phosphatase a c t i v i t y . C e l l s were then w a s h e d t w i c e w i t h I X P B S at r o o m temperature.  C e l l s were then w a s h e d i n a l k a l i n e phosphatase w a s h  buffer, c o n s i s t i n g o f 100 m M T r i s - H C I , p H 9.5, 100 m M N a C I , a n d 10 m M M g C l , for 2  10 m i n u t e s at r o o m temperature.  C e l l s were then stained w i t h a l k a l i n e phosphatase  N B T / B C I P stain (100 m M T r i s - H C I , p H 9.5, 100 m M N a C I , 50 m M M g C I , 0 . 0 1 % 2  s o d i u m d e o x y c h o l a t e , 0 . 0 2 % N P - 4 0 , 3 3 7 u g / m l N B T (nitroblue t e t r a z o l i u m salt; B o e h r i n g e r M a n n h e i m ) , and 175 u g / m l B C I P ( 5 - b r o m o - 4 - c h l o r o - 3 - i n d o l y l phosphate, t o l u i d i n i u m salt; B o e h r i n g e r M a n n h e i m ) , w e l l m i x e d , for 10 to 30 minutes at r o o m temperature.  S t a i n s o l u t i o n was then r e m o v e d , c e l l s w a s h e d gently t w i c e w i t h I X P B S ,  a n d dehydrated w i t h ethanol.  2.18 Alkaline phosphatase staining ear punches and tissue fragments T i s s u e s were f i x e d a g g r e s s i v e l y to a l l o w penetration o f the a l k a l i n e phosphatase substrate i n 2 % f o r m a l d e h y d e , 0 . 2 % gluteraldehyde, 0 . 0 2 % N P - 4 0 , and 0 . 0 1 % s o d i u m d e o x y c h o l a t e , i n I X D u l b e c c o ' s P B S w i t h no C a + or M g 2 + , for 5 to 10 minutes at 4 C . T i s s u e s were then w a s h e d t w i c e i n I X P B S , then a fresh v o l u m e o f I X P B S sufficient to c o m p l e t e l y c o v e r tissues was added a n d endogenous a l k a l i n e phosphatases were heat i n a c t i v a t e d at 70 C for 3 0 minutes. T i s s u e s w e r e a g a i n w a s h e d t w i c e i n I X P B S , then w a s h e d i n a l k a l i n e phosphatase buffer (100 m M T r i s - H C I , p H 9.5, 100 m M N a C I , 10 m M MgCh) for 10 minutes, a n d stained w i t h B M B i g P u r p l e a l k a l i n e phosphatase substrate ( B o e h r i n g e r M a n n h e i m ) at 4 C for 2 to 36 hours i n the dark.  2.19 D N A I s o l a t i o n D N A w a s isolated f r o m tissue ( u s u a l l y tail) o r f r o m c e l l s u s i n g the same b a s i c p r o t o c o l . A suitable v o l u m e o f l y s i s s o l u t i o n , c o n t a i n i n g 100 m M T r i s - H C I p H 8.5, 5 m M E D T A , 0 . 2 % S D S , a n d 2 0 0 m M N a C I , w a s added to samples. F o r a t a i l sample o f 0.5 c m i n length, 4 0 0 u l o f l y s i s s o l u t i o n w a s used. F r e s h proteinase K s o l u t i o n w a s added to a f i n a l c o n c e n t r a t i o n o f 0.2 m g / m l f r o m a l O m g / m l proteinase K stock. S a m p l e s w e r e then i n c u b a t e d o v e r n i g h t at 56 C . A n o r g a n i c solvent e x t r a c t i o n w a s then p e r f o r m e d u s i n g a v o l u m e o f c h l o r o f o r m e q u a l to the v o l u m e o f the digested sample, samples w e r e m i x e d b y i n v e r s i o n , then i n c u b a t e d at r o o m temperature 5 minutes. S a m p l e s w e r e then s p u n for 5 m i n u t e s at 12,000 r p m i n a benchtop m i c r o c e n t r i f u g e a n d the upper aqueous phase c o n t a i n i n g D N A w a s transferred to a n e w m i c r o c e n t r i f u g e tube. A s e c o n d c h o l o r o f o r m e x t r a c t i o n w a s p e r f o r m e d u s i n g 4 0 0 u l c h o l o r o f o r m , samples m i x e d , spun, a n d the aqueous phase transferred to a fresh tube. T h e f i n a l v o l u m e w a s estimated ( u s u a l l y s l i g h t l y less than 4 0 0 u l ) a n d t w i c e the v o l u m e (approx 800 u l ) o f 9 5 % ethanol w a s added to precipitate the D N A fraction. S a m p l e s w e r e m i x e d gently b y i n v e r s i o n a n d t h e n s p u n at 12,000 r p m for 10 minutes. D N A pellets w e r e then n o r m a l l y v i s i b l e . T h e pellet w a s then w a s h e d t w i c e b y r e m o v i n g the aqueous phase, a d d i n g 4 0 0 u l o f 7 0 % ethanol, i n v e r t i n g , a n d s p i n n i n g as above for 5 minutes. T h e ethanol w a s r e m o v e d , the pellet w a s a l l o w e d to air d r y n o m o r e than 5 minutes, a n d then the pellet w a s brought up i n a suitable v o l u m e o f a u t o c l a v e d H2O or T r i s - E D T A , p H 7.5, for at least 3 hours to o v e r n i g h t at r o o m temperature o r 4 C . D N A c o n c e n t r a t i o n w a s d e t e r m i n e d b y gel electrophoresis against standards o f k n o w n c o n c e n t r a t i o n and/or b y spectrophotometry.  58  2.20 Transformation BPvL D H 5 - a l p h a E . c o l i c e l l s were u s e d for a l l transformations. 50 u l o f t h a w e d c e l l s w e r e added to c o o l e d tubes o n ice c o n t a i n i n g 1 to 5 u l o f p l a s m i d D N A (or l i g a t i o n reactions) and m i x e d gently b y s h a k i n g . C e l l s were incubated o n i c e for 30 minutes and then heat s h o c k e d at 4 2 C for 30 seconds. R e a c t i o n s were i n c u b a t e d o n i c e for 2 minutes before a d d i t i o n o f 1 m l o f L B broth. R e a c t i o n s were then incubated at 37 C at 2 0 0 r p m for 1 h o u r before p l a t i n g o n L B plates c o n t a i n i n g 5 0 u g / m l a m p i c i l l i n w i t h or w i t h o u t X - g a l ( 1 % final) d e p e n d i n g i f c o l o r s e l e c t i o n was a p p l i c a b l e . Plates were then i n c u b a t e d o v e r n i g h t at 37 C and i n d i v i d u a l c o l o n i e s a n a l y z e d for p l a s m i d content.  2.21 Southern blotting G e n o m i c D N A w a s i s o l a t e d as d e s c r i b e d and digested u s i n g suitable r e s t r i c t i o n e n z y m e s . D i g e s t e d D N A fragments were separated i n agarose gels a n d the D N A w a s then transferred to H y b o n d - N n u c l e i c a c i d transfer m e m b r a n e ( A m e r s h a m ) o v e r n i g h t u s i n g standard transfer solutions (Southern, 1975). S u i t a b l e probe D N A w a s l a b e l e d w i t h r a d i o a c t i v e a l p h a - 3 2 P - d C T P ( A m e r s h a m ) u s i n g a r a n d o m p r i m e r l a b e l i n g system ( G i b c o B R L ) and p u r i f i e d u s i n g a G - 5 0 sephadex c o l u m n . H y d r i d i z a t i o n w a s p e r f o r m e d at 50 to 65 C i n c o m m e r c i a l l y a v a i l a b l e h y b r i d i z a t i o n buffer ( C l o n e t e c h ) . W a s h e d m e m b r a n e s were e x p o s e d to K o d a k X - O M A T scientific i m a g i n g f i l m at -70 C for p e r i o d s r a n g i n g f r o m h a l f a day to a w e e k .  2.22 Animals A n i m a l s were cared for under the g u i d e l i n e s set up b y the C a n a d i a n C o u n c i l o n A n i m a l C a r e . A l l a n i m a l s used for these studies o r i g i n a t e d f r o m a single founder and  59  w e r e established b y brother-sister m a t i n g . T h e m i c e w e r e fed P M I Feeds a u t o c l a v e d rodent diet 5 0 1 0 .  Chapter 3: Characterization of the long term pathophysiology of murine M P S I  Based on the paper "Murine M P S I: Insights into the pathogenesis of Hurler syndrome" Published in Clinical Genetics, 1998 Volume 53, pages 349-361.  Christopher Russell, Glenda Hendson, Gareth Jevon, Tina Matlock, Jessica Y u , Muktak Aklujkar, K w o k - Y u Ng, and L o m e A Clarke.  61  3.1 Abstract A murine m o d e l w h i c h shows complete deficiency i n alpha-L-iduronidase activity has been d e v e l o p e d and s h o w s p h e n o t y p i c features s i m i l a r to severe M P S I i n h u m a n s . H e r e w e report o n the l o n g - t e r m c l i n i c a l , b i o c h e m i c a l , and p a t h o l o g i c a l course o f M P S I i n m i c e w i t h emphasis o n the skeletal and central n e r v o u s s y s t e m manifestations o f disease. A f f e c t e d m i c e s h o w a p r o g r e s s i v e c l i n i c a l course w i t h the d e v e l o p m e n t o f coarse features, altered g r o w t h characteristics and a shortened life span. P r o g r e s s i v e l y s o s o m a l a c c u m u l a t i o n is seen i n a l l tissues. S k e l e t a l manifestations represent the earliest c l i n i c a l f i n d i n g i n M P S I m i c e w i t h h i s t o l o g i c analysis o f g r o w t h plate and c o r t i c a l bone r e v e a l i n g e v i d e n c e that significant early p a t h o l o g y is present. A n a l y s i s o f the central n e r v o u s s y s t e m has r e v e a l e d the n o v e l f i n d i n g o f p r o g r e s s i v e n e u r o n a l loss w i t h i n the c e r e b e l l u m . I n a d d i t i o n , b r a i n tissue f r o m M P S I m i c e s h o w increased l e v e l s of G M  2  and GM3 gangliosides.  This murine model clearly shows phenotypic and  p a t h o l o g i c features w h i c h m i m i c those seen i n severe h u m a n M P S I a n d s h o u l d be a n i n v a l u a b l e t o o l for the study o f the pathogenesis o f g e n e r a l i z e d storage disorders.  3.2 Introduction T h e phenotype o f I D U A d e f i c i e n c y or M P S I i n h u m a n s is represented b y a s p e c t r u m o f c l i n i c a l severity r a n g i n g f r o m severely affected i n d i v i d u a l s , i.e. H u r l e r s y n d r o m e , to m o r e m i l d l y affected i n d i v i d u a l s i.e. S c h e i e s y n d r o m e . I n the severe f o r m , s y m p t o m s are r e c o g n i z a b l e i n toddlers (age 1 to 3 years), c l i n i c a l features progress r a p i d l y , m e n t a l retardation b e c o m e s p r o n o u n c e d , a n d death o c c u r s i n the first decade. T h e m i l d e r f o r m o f the disease is associated w i t h a later onset o f s y m p t o m s , s l o w e r  62  disease p r o g r e s s i o n , n o m e n t a l degeneration, a n d life into a d u l t h o o d . Features o f M P S I c o m m o n to b o t h ends o f the c l i n i c a l spectrum i n c l u d e c o r n e a l c l o u d i n g , dysostosis m u l t i p l e x , j o i n t i n v o l v e m e n t and v i s c e r a l storage, h o w e v e r , i n severe M P S I, the onset o f these s y m p t o m s occurs earlier a n d b e c o m e m o r e p r o n o u n c e d than i n m i l d e r f o r m s o f M P S I (Scheie etal., 1962). T h i s c l i n i c a l heterogeneity is reflected b y the m a n y mutations that have been i d e n t i f i e d at this l o c u s ( C l a r k e et al., 1993 and 1994, Scott et al., 1993, 1995). M u t a t i o n s that p e r m i t some e n z y m e a c t i v i t y , as l o w as 0 . 1 3 % o f n o r m a l I D U A p r o t e i n , are associated w i t h a m i l d e r phenotype (Scott et al., 1993). T h i s f i n d i n g indicates that s m a l l amounts o f r e s i d u a l a c t i v i t y , p a r t i c u l a r l y w i t h i n the b r a i n , c a n s i g n i f i c a n t l y alter the c l i n i c a l phenotype, thus i n d i c a t i n g the potential o f gene therapy and e n z y m e replacement strategies for this group o f disorders. E n z y m e replacement i n the f o r m o f b o n e m a r r o w transplantation ( B M T ) i n h u m a n s w i t h M P S I, has s h o w n that a l t h o u g h v i s c e r a l storage c a n be s i g n i f i c a n t l y reduced, there is a lesser effect o n the C N S c o m p l i c a t i o n s o f disease and v e r y little effect o n the skeletal manifestations (Peters et al., 1996, F i e l d et al., 1994). In a d d i t i o n , the response to B M T is related to the age o f the patient at the t i m e the procedure is p e r f o r m e d ( S h a p i r o et al,  1995).  W e p r e v i o u s l y reported the generation o f a m u r i n e strain c o m p l e t e l y deficient i n i d u r o n i d a s e b y targeted d i s r u p t i o n o f the m u r i n e Idua gene. E a r l y c h a r a c t e r i z a t i o n r e v e a l e d that these m i c e s h o w e d p h e n o t y p i c , p a t h o l o g i c and b i o c h e m i c a l features w h i c h r e s e m b l e d severe d e f i c i e n c y o f I D U A i n h u m a n M P S I ( C l a r k e et al., 1997). T h i s chapter characterizes the l o n g t e r m c l i n i c a l , p a t h o l o g i c a l and b i o c h e m i c a l features o f this m o d e l w i t h emphasis o n the d e v e l o p m e n t o f C N S and skeletal manifestations o f I D U A  63  d e f i c i e n c y . Together it is h o p e d this w i l l identify p a t h w a y s altered i n I D U A d e f i c i e n c y thereby suggesting targets for therapeutic intervention. A s the I D U A deficient M P S I m o u s e m o d e l w i l l be used i n the assessment o f therapies for M P S I, characterization o f the  Idua -I- m o u s e  m i g h t also p r o v i d e markers o f disease useful i n therapy trials.  3.3 Results 3.31 Clinical Features A t b i r t h , I D U A deficient (-/-) m o u s e p u p s cannot be d i s c e r n e d f r o m controls. B y 4 w e e k s o f age, m a l e  Idua -I- m i c e b e g i n to present w i t h a progressive  f a c i a l phenotype  i n c l u d i n g w i d e set eyes, b r o a d e n i n g o f the c r a n i u m , foreshortening o f the snout, a n d p r o t r u d i n g o f the nasal bridge. T h e f a c i a l features present earlier i n  Idua -I- females.  Idua -I- m a l e s  than i n  B y 8 w e e k s o f age, affected m i c e have t h i c k e n e d digits w i t h p a w s  l a c k i n g i n detailed r e l i e f pattern as c o m p a r e d w i t h controls. There is s l o w p r o g r e s s i o n i n the degree o f facial d y s m o r p h o l o g y w i t h the m i c e appearing quite coarse b y 16 w e e k s o f age, w h e n affected m i c e o f b o t h sexes have f a c i a l coarseness r e m i n i s c e n t o f h u m a n patients w i t h H u r l e r ' s s y n d r o m e .  T h e p r o g r e s s i o n o f these features is detailed i n figure  3.1. T h e coats o f affected m i c e are tattered a n d t h i n relative to n o r m a l m i c e . R e d u n d a n c y o f the s k i n o f the face and t h i c k e n i n g o f the p e r i o c c u l a r tissues results i n partial closure o f the eyes i n some affected m i c e . S l i t l a m p e x a m i n a t i o n does not r e v e a l evidence o f c o r n e a l c l o u d i n g e v e n late i n the p r o g r e s s i o n o f m u r i n e I D U A d e f i c i e n c y . W h i l e the eyes o f some  Idua -I- m i c e b e c o m e  encrusted w i t h m u c o u s , the c h r o n i c r h i n i t i s  often present i n h u m a n M P S I H is not a n o b v i o u s feature o f m u r i n e I D U A d e f i c i e n c y .  3.1A  3.IB F i g u r e 3.1: P h e n o t y p e o f M P S I m i c e 3.1 A : A g e s f r o m left to right; 4, 16, 23, 4 5 , and 54 w e e k s . N o t e the progressive d e v e l o p m e n t o f coarse facial features and coarseness to the coat. I B : N o r m a l (left) and M P S I m i c e (right) at 4 0 w e e k s o f age. M P S I m i c e d e v e l o p severe f o l d i n g o f s k i n as o b s e r v e d o v e r the entire b o d y o f the M P S I m o u s e , and w h i c h c a n obscure v i s i o n . G i b b o u s d e f o r m i t y is present i n the M P S I m o u s e and m o b i l i t y is l i m i t e d . N o t e loss o f h a i r is unrelated to I D U A d e f i c i e n c y .  65  Y o u n g affected m i c e are active a n d appear capable o f a f u l l range o f m o v e m e n t , although, w i t h age age,  Idua -I- m i c e s h o w a p r o g r e s s i v e d e c l i n e i n m o b i l i t y . B y 4 0 w e e k s o f  Idua -I- m i c e do not require anesthesia or restraint d u r i n g e x a m i n a t i o n , i n m a r k e d  contrast w i t h controls. M a n y  Idua -I- m i c e d e v e l o p g i b b o u s d e f o r m i t y w h i c h is resistant  to f l e x i o n d u r i n g e x a m i n a t i o n under anesthesia or after death. S u b l u x a t i o n o f the h i p s i s apparent i n some o l d e r  Idua -I- m i c e a n d m a y further l i m i t m o b i l i t y . W i t h age, m a n y  Idua -I- a n i m a l s have a severely a b n o r m a l gait, w i t h d r a g g i n g o f the hindquarters d u r i n g forward locomotion.  3.32 L i f e s p a n o f M P S I m i c e F i g u r e 3.2 h i g h l i g h t s the life span o f  Idua -I- a n i m a l s w i t h i n this c o l o n y . T h e  average age o f death o f affected m i c e is a p p r o x i m a t e l y 48 w e e k s , w i t h the earliest death o c c u r r i n g at 25 w e e k s o f age. N o affected a n i m a l s have l i v e d past 85 w e e k s o f age. A m o n g s t c o n t r o l litter mates a p p r o x i m a t e l y 5 % die o f natural causes w i t h i n the first 90 w e e k s , a n d m i c e t y p i c a l l y l i v e o v e r 2 years. T h e i m m e d i a t e causes o f death i n affected m i c e are not r e a d i l y apparent, h o w e v e r , autopsy has revealed evidence o f congestive heart failure i n some m i c e .  66  100 90 80 70  Male MPS I percent deaths Female MPS I percent deaths I Cumulative Probability of death  60  50  80  60  90  A G E interval (WKS)  F i g u r e 3 . 2 : L i f e s p a n o f affected a n i m a l s T h e percent o f natural deaths o c c u r r i n g per each w e e k l y t i m e interval was c a l c u l a t e d b y d i v i d i n g natural deaths i n that i n t e r v a l b y the total n u m b e r o f natural deaths (total natural deaths M P S I m a l e m i c e = 2 1 , females=16).  T h e c u m u l a t i v e p r o b a b i l i t y o f death w a s  c a l c u l a t e d t a k i n g into c o n s i d e r a t i o n a l l a n i m a l s that persisted t h r o u g h p r i o r t i m e intervals, and thus i n c l u d e s i n a d d i t i o n to natural deaths, a n i m a l s that were s a c r i f i c e d as w e l l as a n i m a l s that were s t i l l a l i v e at the t i m e o f analysis. A total o f 138 M P S I m i c e were used i n the c a l c u l a t i o n o f c u m u l a t i v e p r o b a b i l i t y o f death.  3.33 G r o w t h P r o f i l e s W e e k l y w e i g h t s were recorded o n a l l m i c e , i n c l u d i n g those w i t h genotypes M P S I  Idua -/-, Idua +/- heterozygotes, a n d Idua +/+ w i l d type h o m o z y g o t e s , to generate w e i g h t curves as an i n d i c a t i o n o f g r o w t h .  Idua +/- and +/+ were used as controls to generate  g r o w t h curves o f n o r m a l m i c e . T h e genetic b a c k g r o u n d o f the  Idua -I- and n o r m a l m i c e  is a m i x o f C 5 7 W / 6 and C B A strains. F i g u r e 3.3 depicts the g r o w t h profiles for both m a l e (a) and female (b) m i c e w i t h i n the c o l o n y .  67  T  6 0  0  -I 0  1  1  1  1  1 0  2 0  3 0  4 0  1 -  5 0  A G E interval (Wks)  Figure 3.3A: Growth curves of male Idua -/- mice relative to normals W e i g h t s were m o n i t o r e d as a n i n d e x o f g r o w t h . 10, 50, a n d 9 0  t h  percentile w e e k l y  i n t e r v a l g r o w t h curves were established for n o r m a l a n i m a l s . T h e m e d i a n w e i g h t o f mutant m i c e at each t i m e i n t e r v a l is plotted against the n o r m a l curves. M . A k l u j k a r gathered a n i m a l w e i g h t s .  68  50 j  40 --  |3  30 --  O)  J  20 -10 --  0 0  F i g u r e 3 . 3 B : G r o w t h curves o f female I d u a -/- a n d c o n t r o l m i c e Female  Idua -I- m i c e have a s i m i l a r pattern o f g r o w t h as Idua -I- males. Y o u n g Idua -I-  females (3-30 w e e k s ) are consistently heavier than n o r m a l s . M . A k l u j k a r gathered a n i m a l weights.  A total o f 1300 separate w e i g h t s w e r e used to p r o f i l e the g r o w t h o f n o r m a l m i c e (757 m a l e , 543 female) and 875 w e i g h t s w e r e u s e d for the mutant data points (494 m a l e s , 381 females). T h e w e i g h t s o f c o n t r o l a n i m a l s are expressed as percentiles for each w e e k l y i n t e r v a l and the w e i g h t s for the same i n t e r v a l o f mutant a n i m a l s are expressed as the m e d i a n (50th percentile). M a l e s and females differ s i g n i f i c a n t l y i n w e i g h t and so are graphed separately; h o w e v e r the general g r o w t h pattern o f  Idua -I- m a l e s a n d females is  s i m i l a r . L a r g e fluctuations i n the c o n t r o l g r o w t h p r o f i l e s o f the n o r m a l a n i m a l s reflect  69  the variation in sample size for each interval. Idua -I- mice o f both sexes consistently grow at or above the 50th percentile from 8 weeks to approximately 25 weeks o f age. However, by 30 weeks growth o f the mutant mice appears to plateau, crossing the 50th percentile curve o f the normal mice. B y 50 weeks, mutant mice have weights well below the 50th percentile o f controls.  3.34 Radiographic Examination Figure 3.4 reveals the radiographic changes discernible at 57 weeks i n Idua -Ianimals.  Figure 3.4: Radiographic examination of Idua -/- and control mice Idua -I- mice on the left, control same sex littermate on the right. M i c e are 57 weeks o f age. The Idua -I- mouse shows evidence o f severe dysostosis multiplex, including widened ribs, vertebral abnormalities, and craniofacial foreshortening and thickening.  A t 4 weeks o f age, Idua -I- mice show evidence o f foreshortening o f the premaxillary bones and enlargement o f the cranium. The squamosal, zygomatic and malar process  70  appear denser and smaller. While control mice have a pronounced tapering of the vertebrae spanning the length of the pelvis, the vertebrae in this region in MPS I mice are wider and do not taper relative to adjacent vertebrae.  Figure 3.5: Skulls of Idua -/- and normal male mice at 70 weeks of age  On left, the Idua -I- skull, on right, normal. The Idua -I- skull has a thickened zygomatic arch, frontal bossing, and widened cranium and nasal bones. This difference in vertebral morphology is evident by 4 weeks and persists for the life span of MPS I mice. The proximal tibial metaphysis of young MPS I mice appear to be less ossified as determined by radiodensity, than noted in control animals. With age, general thickening of the diaphysis of long bones becomes evident and widening of the malar processes and zygomatic arch becomes exaggerated. The ribs of affected mice become wider than in controls and flare at their anterior ends similar to the oar shaped ribs seen in human MPS IH. Late in MPS I (57 weeks) there is evidence of thoracic  71  vertebral k y p h o s i s . F i g u r e 3.5 demonstrates the t h i c k e n e d s k u l l s o f M P S I m i c e relative to n o r m a l controls.  3.36 Glycosaminoglycan Excretion U r i n a r y g l y c o s a m i n o g l y c a n ( G A G ) l e v e l s w e r e a n a l y z e d i n 114 M P S I a n d 112 c o n t r o l m a l e m i c e and plotted i n figure 3.6. M P S I m a l e s excrete 2 to 3 t i m e s the total u r i n a r y G A G o f controls at a l l t i m e points r a n g i n g f r o m 3 w e e k s to 60 w e e k s .  Similarly,  M P S I female m i c e excrete 2 to 3 f o l d greater u r i n a r y G A G l e v e l s than female controls. F e m a l e M P S I m i c e excrete a p p r o x i m a t e l y 60 to 7 0 % o f the u r i n a r y G A G o f m a l e M P S I m i c e , a difference also observed between female and m a l e c o n t r o l m i c e . N o o b v i o u s change i n the l e v e l o f G A G e x c r e t i o n is apparent over the assessed t i m e course (3 w e e k s to 60 w e e k s ) i n either M P S I affected m i c e or c o n t r o l m i c e , t h o u g h t r a c k i n g i n d i v i d u a l m i c e (control or M P S I) over t i m e revealed that i n d i v i d u a l a n i m a l s d i d have w i d e variations i n the e x c r e t i o n o f total G A G s .  72  • IDUA •/-  1600 -r  n Control males A Values greater than 1500  A A  1400 •1200 •-  i: •  1000 •-  SE  800 ••  <  600 --  •  • «..  • •  •  <b  400 -200 •-  • •  • flop ID n  "  •  0 -10  0  ,• •. • • •• • i• •  •  • C P  +  15  +  20  25  30  35  Age in weeks  Figure 3.6: Glycosaminoglycan excretion in male Idua -/- and normal mice Total urinary GAG levels are expressed as a ratio to creatinine excretion. 112 normal and 115 mutant data points are shown. Idua -I- male mice consistently excrete higher levels of urinary GAG than control male mice, with only rare overlaps. M. Aklujkar gathered urine for GAG chemical analysis by J. Yu. 3.37 Gangliosides Figure 3.7 shows a thin-layer chromatogram of gangliosides extracted from the total brain of 4 Idua -I- and 4 control mice. Brain extracts from affected mice contain increased amounts of gangliosides with the mobility of GM2 and GM3 gangliosides.  73  14 weeks  21 weeks  41 weeks  F i g u r e 3.7: T h i n l a y e r c h r o m a t o g r a m o f b r a i n l i p i d s L i p i d s were isolated f r o m equivalent masses o f b r a i n tissue f r o m c o n t r o l and mutant a n i m a l s a n d separated b y t h i n layer c h r o m a t o g r a p h y p o s i t i o n s o f g a n g l i o s i d e standards are listed. N o t e the increase i n g a n g l i o s i d e s w i t h m o b i l i t y o f G M 2 and G M 3 i n mutant m i c e relative to same aged controls. W h i l e attempts were m a d e to l o a d equal sample v o l u m e s , not a l l lanes c o n t a i n equal sample v o l u m e s . K . Y . N g p e r f o r m e d g a n g l i o s i d e chromatography.  3.38 B o n e H i s t o p a t h o l o g y  74  F i g u r e 3.8 s h o w s the h i s t o p a t h o l o g i c changes o f the p r o x i m a l t i b i a l g r o w t h plate at v a r i o u s ages. T h e g r o w t h plate at 6 w e e k s ( f i g . 3.8 a, b) is t h i c k e n e d a n d contains increased numbers o f c h o n d r o c y t e s s h o w i n g n o r m a l resting and p r o l i f e r a t i v e z o n a l o r g a n i z a t i o n . T h e c e l l s are s w o l l e n w i t h increased f i b r i l l a r y or v a c u o l a r contents, e s p e c i a l l y p r o m i n e n t i n the resting z o n e . T h e h y p e r t r o p h i c z o n e , a l t h o u g h h y p e r c e l l u l a r , s h o w s d i s o r g a n i z a t i o n w i t h a h a p h a z a r d h o r i z o n t a l arrangement o f c e l l s . M o s t o f the c h o n d r o c y t e n u c l e i i n the z o n e o f h y p e r t r o p h y appear degenerate. T h e j u n c t i o n b e t w e e n the z o n e o f p r o v i s i o n a l c a l c i f i c a t i o n a n d the p r i m a r y s p o n g i o s a appears i r r e g u l a r a n d d i s o r g a n i z e d w i t h loss o f the n o r m a l h i l l and v a l l e y pattern. T h e p r i m a r y c a l c i f i c a t i o n z o n e i s also increased i n s i z e . T h e l o n g i t u d i n a l arrangement o f the p r i m a r y trabecula is a b n o r m a l w i t h the trabeculae increased i n number, t h i c k , and c o n t a i n i n g a m a r k e d increase o f cartilage surrounded b y w o v e n bone. Osteoblasts appear to be increased i n n u m b e r , e s p e c i a l l y i n the p r o x i m a l intertrabecular spaces, but do not appear s w o l l e n . B l o o d vessels appear n o r m a l h i s t o l o g i c a l l y . T h e g r o w t h plates at 14 and 19 w e e k s s h o w m u c h m o r e d i s o r g a n i z a t i o n o f the g r o w t h plate stacks w i t h a l m o s t c o m p l e t e loss o f the n o r m a l c o l u m n a r arrangement o f c e l l s . T h e r e are irregular p r i m a r y trabecula w i t h s c a l l o p e d m a r g i n s and o b v i o u s retained cartilage w i t h i n the o s s i f i e d bone.  75  F i g u r e 3.8:  P r o x i m a l t i b i a l g r o w t h plates  T i b i a s were f i x e d overnight i n f o r m a l i n , d e c a l c i f i e d , bisected, and e m b e d d e d i n paraffin for e x a m i n a t i o n . A , B : G r o w t h plates at 6 w e e k s , c o n t r o l and mutant. C , D : G r o w t h plates at 14 w e e k s , c o n t r o l and mutant. E , F : G r o w t h plates at 19 w e e k s , c o n t r o l and mutant.  ( H & E staining, o r i g i n a l m a g . 1 0 0 X ) . R e s u l t s based o n observations f r o m 2  mutant and 2 c o n t r o l samples m i n i m u m for each t i m e point. P a t h o l o g y b y G . J e v o n .  76  F i g u r e 3.9: P o l a r i z e d l i g h t m i c r o s c o p y o f c o r t i c a l b o n e s a m p l e s A : C o n t r o l c o r t i c a l bone w i t h l a m e l l a r , p a r a l l e l o r g a n i z a t i o n . B: M P S I c o r t i c a l bone w i t h gross d i s o r g a n i z a t i o n . ( H & E staining, o r i g i n a l m a g . 1 0 0 X ) . P a t h o l o g y b y G . J e v o n .  F i g u r e 3 . 9 represents p o l a r i z e d l i g h t m i c r o s c o p y o f t i b i a l c o r t i c a l bone at 14 w e e k s o f age. T h e p o l a r i z e d l i g h t v i e w s reveal a loss o f the p a r a l l e l order o f the b o n e m a t r i x w i t h loss o f the concentric arrangement o f l a m e l l a e or haversian system formation. T h e cortex is t h i c k e n e d i n affected m i c e and has a heterogeneous appearance c o m p r i s e d o f cartilagestaining (purple) m a t e r i a l i n t e r m i x e d w i t h m i n e r a l i z e d c o m p a c t bone (pink) i n contrast to the h o m o g e n o u s p i n k o f c o n t r o l c o m p a c t bone. T h e osteocytes have c l e a r l y increased cytoplasmic volumes.  3.39  Neuropathology G r o s s e x a m i n a t i o n o f b r a i n tissue revealed no difference i n the c e r e b r u m or  c e r e b e l l u m between c o n t r o l a n d mutant m i c e . F i g u r e 3.10 represents sections t h r o u g h the c e r e b e l l u m r e v e a l i n g evidence o f progressive loss o f P u r k i n j e c e l l s . C o n t r o l s at a l l ages  77  w e r e f o u n d to c o n t a i n w e l l p o p u l a t e d P u r k i n j e c e l l layers. I n contrast, mutant m i c e h a d progressive P u r k i n j e c e l l dropout evident as early as 19 w e e k s . T h e P u r k i n j e c e l l dropout increased w i t h increase i n age i n the mutant m i c e w i t h the distance b e t w e e n P u r k i n j e c e l l s b e c o m i n g greater. P A S staining o f the c e r e b e l l u m revealed increased P A S p o s i t i v e m a t e r i a l i n the P u r k i n j e c e l l s o f mutant m i c e relative to controls. T h i s difference became p r o n o u n c e d w i t h i n c r e a s i n g age a n d w a s noticeable f r o m the age o f 8 w e e k s . P A S + diastase staining o f the c e r e b r u m r e v e a l e d increased amounts o f P A S p o s i t i v e m a t e r i a l a n d increased size o f neurons i n the caudate n u c l e u s i n mutant m i c e relative to controls. T h e amount o f P A S p o s i t i v e material i n the neurons increased w i t h increase i n age and w a s noticeable f r o m the age o f a p p r o x i m a t e l y 18 w e e k s . H & E s t a i n i n g o f c e r e b r u m r e v e a l e d no o b v i o u s differences b e t w e e n c o n t r o l a n d mutant m i c e .  78  A.  E.  F i g u r e 3.10:  B.  F.  P A S D s t a i n i n g o f the P u r k i n j e c e l l l a y e r o f c e r e b e l l u m  A , B : C o n t r o l and M P S I m i c e at 6 w k s , respectively. C , D : C o n t r o l and M P S I m i c e at 19 w k s . E , F : C o n t r o l a n d M P S I m i c e M P S I at 41 w k s . ( P A S and diastase staining, o r i g i n a l m a g . 2 5 0 X ) . T h e r e g i o n c o n t a i n i n g P u r k i n j e cells is identified i n A and B above w i t h the letter P and a n arrow. R e s u l t s based o n observations f r o m 2 mutant and 2 c o n t r o l samples m i n i m u m for each t i m e point. P a t h o l o g y b y G . H e n d s o n .  79  3.4 Discussion T h i s chapter describes the l o n g - t e r m c l i n i c a l , b i o c h e m i c a l , a n d p a t h o l o g i c a l features o f a n iduronidase deficient (-/-) m o u s e strain c o n t a i n i n g n u l l alleleles o f the Idua gene generated b y gene targeting. O n e objective o f this i n v e s t i g a t i o n was the characterization o f m u r i n e iduronidase d e f i c i e n c y relative to h u m a n i d u r o n i d a s e d e f i c i e n c y , w h i c h presents as a spectrum o f disease w i t h v a r i a b l e o r g a n s y s t e m i n v o l v e m e n t and disease course. A n o t h e r objective w a s the use o f the m o u s e m o d e l to better characterize the p r o g r e s s i o n o f iduronidase d e f i c i e n c y i n different o r g a n systems. T h i s m i g h t p r o v i d e a greater understanding o f M P S I s y m p t o m d e v e l o p m e n t , and generate markers o f disease useful i n therapy assessment.  Unexpected findings i n  m u r i n e iduronidase d e f i c i e n c y i n c l u d e life into a d u l t h o o d , a b n o r m a l i t i e s i n the bone g r o w t h plate a n d d i a p h y s i s at a n early age, and p r o g r e s s i v e P u r k i n j e c e l l loss. A t b i r t h , iduronidase-deficient m i c e d o not have a c l i n i c a l l y detectable phenotype, s i m i l a r to a l l forms o f h u m a n M P S I. B y four w e e k s o f age, f a c i a l d y s m o r p h o l o g y is detectable, a n d progressive facial coarseness then d e v e l o p s as a result o f b o t h c r a n i o f a c i a l dysostosis as w e l l as a b n o r m a l i t i e s o f subcutaneous tissues. W e have n o t e d that the c l i n i c a l feature o f c r a n i o f a c i a l d y s m o r p h i s m is detectable earlier a n d is m o r e o b v i o u s i n m a l e c o m p a r e d to female m i c e , but after 16 w e e k s o f age this gender difference is less apparent. A s the early f a c i a l d y s m o r p h i c features l i k e l y relate to c r a n i o f a c i a l dysostosis, these observations m a y indicate that h o r m o n a l influences or different G A G c a t a b o l i c requirements b e t w e e n the sexes m a y m o d u l a t e the c l i n i c a l features o f facial dysostosis. T h i s sex based difference i n the early c l i n i c a l features o f the Idua -I- m o u s e has not been reported i n h u m a n , canine, or feline f o r m s o f the disease, h o w e v e r the m u r i n e M P S V I  80  m o d e l s h o w s gender differences w i t h female m i c e d y i n g r e l a t i v e l y earlier than m a l e s ( B i r k e n m e i e r e t a l . , 1989). R a p i d l y progressive f a c i a l "coarseness" seen i n this m u r i n e M P S I m o d e l is i n k e e p i n g w i t h severe M P S I, H u r l e r s s y n d r o m e , i n h u m a n s . Y o u n g M P S I m i c e are robust w i t h n o m o r t a l i t y o c c u r r i n g u n t i l a p p r o x i m a t e l y 30 w e e k s o f age. M o s t deaths o f affected m i c e o c c u r between 50 a n d 7 0 w e e k s o f age w i t h n o affected a n i m a l s l i v i n g m o r e than 85 w e e k s . M a l e s do not l i v e past 70 w e e k s w i t h females p e r s i s t i n g s l i g h t l y l o n g e r but not l i v i n g past 82 w e e k s . T h i s i s i n contrast to the n o r m a l littermates representative o f the c o l o n y , i n w h i c h o n l y 5 % have d i e d b y 9 0 w e e k s o f age and 9 0 % are s t i l l l i v i n g b y 2 years o f age. T h e n o r m a l life span for unaffected a n i m a l s i n this c o l o n y is l i k e l y to be a p p r o x i m a t e l y 2.5 to 3 years. Therefore the M P S I m i c e have a s i g n i f i c a n t l y shortened life span but d o persist to maturity. T h i s is i n contrast to the M P S V I I m u r i n e m o d e l w h e r e the average life span o f m a l e a n d female m i c e is reported to be 2 4 w e e k s and 2 0 w e e k s r e s p e c t i v e l y ( B i r k e n m e i e r e t a l . , 1989). A l t h o u g h the  Idua -I- m i c e s e e m to d i e at a later p o i n t i n life than h u m a n s  with Hurler  s y n d r o m e , they c l e a r l y have a shortened life span. T h i s attenuation i n the p h e n o t y p e m a y reflect species differences i n rates o f G A G storage i n v a r i o u s tissues, differences i n the secondary effects o f G A G storage or m a y also reflect the l a c k o f s i g n i f i c a n t e n v i r o n m e n t a l exposures e x p e r i e n c e d b y the rodent c o l o n y . A l t e r n a t i v e l y , the d e l a y e d mortality i n  Idua -I- m i c e relative to M P S I H i n h u m a n s m a y i n d i c a t e that it i s the  absolute rate o f substrate a c c u m u l a t i o n relative to c h r o n o l o g i c a l t i m e rather than relative to l i f e parameters s u c h as s e x u a l m a t u r i t y w h i c h i s important. H u r l e r and S c h e i e s y n d r o m e s i n h u m a n s are differentiated o n the basis o f age o f onset and rate o f p r o g r e s s i o n o f disease, w i t h H u r l e r s y n d r o m e s h o w i n g early onset a n d  81  r a p i d p r o g r e s s i o n . W e s h o w early onset o f disease a n d r a p i d p r o g r e s s i o n i n a d d i t i o n to c o m p l e x n e u r o p a t h o l o g y i n m u r i n e M P S I and, therefore, a l t h o u g h  Idua -I- m i c e l i v e  to  ' a d u l t h o o d ' their phenotype resembles m o r e c l o s e l y that o f severe M P S I i n h u m a n s . Persistence to s e x u a l m a t u r i t y is also n o t e d i n the  Idua -I- d o g and cat n a t u r a l l y o c c u r r i n g  m o d e l s , a l t h o u g h the true life span o f the affected a n i m a l s has not been accurately d e t e r m i n e d ( S h u l l e t a l , 1982, H a s k i n s e t a l , 1979). T h e severe dysostosis m u l t i p l e x a n d progressive n e u r o l o g i c a l d y s f u n c t i o n that o c c u r i n M P S I constitute the m o s t d e b i l i t a t i n g aspect o f this g r o u p o f disorders. S k e l e t a l manifestations of disease are apparent b y 4 w e e k s of age i n  Idua -I- m i c e ,  including  r a d i o g r a p h i c e v i d e n c e o f aberrant bone m o d e l i n g i n the c r a n i u m , the vertebrae, a n d the ribs. A s the m i c e age, p r o g r e s s i v e skeletal a b n o r m a l i t i e s are noted w i t h the d e v e l o p m e n t o f k y p h o s i s , w i d e oar shaped ribs, shortened and t h i c k e n e d l o n g bones and severe dysostosis o f the facial bones. H i s t o l o g i c a l a n a l y s i s o f the bone reveals aberrant g r o w t h plate d e v e l o p m e n t and m a t u r a t i o n as w e l l as a b n o r m a l i t i e s o f early c o r t i c a l bone structure. T h e r e are s t r i k i n g differences i n the extent and degree o f g r o w t h plate p a t h o l o g y at different d e v e l o p m e n t a l t i m e points. A t 6 w e e k s o f age the g r o w t h plate is w i d e n e d w i t h increased area o f the resting, p r o l i f e r a t i v e , h y p e r t r o p h i c , and s p o n g i o s a zones. T h i s w i d e n i n g appears to be caused not o n l y b y increases i n the v o l u m e o f the i n d i v i d u a l chondrocytes but b y increased c h o n d r o c y t e n u m b e r s i n the g r o w t h plate stacks. T h e c o l u m n a r o r g a n i z a t i o n o f the g r o w t h plate is still apparent a l t h o u g h elongated. T h e increased area o f the z o n e o f p r o v i s i o n a l c a l c i f i c a t i o n a n d p r i m a r y s p o n g i o s a indicate that at this age the g r o w t h plate m a y be generating cartilage at a n increased rate c o m p a r e d w i t h n o r m a l , or has d i f f i c u l t y d e g r a d i n g the cartilage p r o d u c e d .  82  A t 6 w e e k s o f age the p r i m a r y s p o n g i o s a is increased i n thickness, and there are severe a b n o r m a l i t i e s i n the p r i m a r y o s s i f i c a t i o n o f cartilage i n this layer. T h i s is seen as islands o f u n o s s i f i e d cartilage persisting b e t w e e n osteocytes. There appears to be a n increase i n v o l u m e o f this p a r t i a l l y o s s i f i e d material resulting i n the loss o f w e l l - d e f i n e d n a r r o w trabeculae as is seen i n the c o n t r o l a n i m a l s at this age. These a b n o r m a l i t i e s i n the y o u n g p r o x i m a l t i b i a l g r o w t h plate  of Idua -I- m i c e  suggest p a t h w a y s i n v o l v i n g the f o r m a t i o n and r e m o d e l i n g o f cartilage a n d subsequent o s s i f i c a t i o n are altered as a result o f the a c c u m u l a t i o n o f the substrates o f I D U A , n a m e l y heparan a n d dermatan sulfate. T h e ordered nature o f bone m a t r i x is c r i t i c a l for proper bone g r o w t h and integrity. T h i s is w e l l e x e m p l i f i e d i n osteogenesis imperfecta, where mutations o f type II c o l l a g e n resulting i n either structurally a b n o r m a l collagens or reduced type II c o l l a g e n p r o d u c t i o n have devastating effects o n the strength and shape o f bone ( B y e r s et al., 1995). T h e early f i n d i n g s w i t h i n the g r o w t h plates o f our m i c e are contrasted b y the f i n d i n g s at later ages w h e n the c o l u m n a r o r g a n i z a t i o n o f the plate is disrupted and the trabeculae are t h i n i n c o m p a r i s o n to controls. T h e abnormalities o b s e r v e d i n the g r o w t h plate a n d d i a p h y s i s i n o l d e r  Idua -I- m i c e are s i m i l a r to the f i n d i n g s d e s c r i b e d i n the cat  m o d e l s o f M P S I a n d M P S V I , and the m o u s e m o d e l s o f M P S V I and M P S V I I ( H a s k i n s et al,  1983, A b r e u et al,  1995, E v e r s et al,  1996, B i r k e n m e i e r et al,  1989). R e c e n t l y , a  role for dermatan sulfate i n the r e g u l a t i o n o f elastic fibre a s s e m b l y has been established, w i t h e x c e s s i v e dermatan sulfate i n h i b i t i n g the f o r m a t i o n o f mature e x t r a c e l l u l a r elastin ( H i n e k a n d W i l s o n , 2 0 0 0 ) . F u r t h e r m o r e , it was s h o w n that extracellular elastin regulates the p r o l i f e r a t i o n o f fibroblasts, w i t h excess dermatan sulfate, as o c c u r s w i t h I D U A  d e f i c i e n c y , l e a d i n g to excess fibroblast d i v i s i o n . Together these observations m a y i n part e x p l a i n a b n o r m a l i t i e s o f the bone and c o n n e c t i v e tissue o b s e r v e d w i t h I D U A d e f i c i e n c y , a n d h i g h l i g h t the diverse pathways b y w h i c h a c c u m u l a t i o n o f heparan a n d or dermatan sulfate c a n influence n o r m a l d e v e l o p m e n t . E a r l y i n the disease course P u r k i n j e c e l l n u m b e r s a n d m o r p h o l o g y appear n o r m a l i n the Idua -I- m i c e . O b v i o u s l y s o s o m a l a c c u m u l a t i o n is noted w i t h i n the P u r k i n j e c e l l s b y 8 w e e k s o f age w i t h evidence o f detectable loss o f P u r k i n j e c e l l s b y 19 w e e k s o f age. A l t h o u g h s i m i l a r degrees o f l y s o s o m a l storage w i t h i n c o r t i c a l neurons w a s detected, o b v i o u s neuronal c e l l loss elsewhere w i t h i n the C N S w a s not r e a d i l y apparent, t h o u g h detailed c e l l c o u n t i n g studies have not been undertaken. D e s p i t e the fact that P u r k i n j e c e l l d e p l e t i o n is noted, m i c e s h o w e d no o b v i o u s evidence o f ataxia. T h i s m a y reflect the presence o f severe skeletal disease w h i c h l i m i t s the m o b i l i t y o f the m i c e . N e u r o n a l c e l l d y s m o r p h o l o g y and c e l l loss i n c l u d i n g P u r k i n j e c e l l loss have been noted i n a m o u s e m o d e l for another l y s o s o m a l storage disorder, a s p a r t y l g y c o a s m i n u r i a ( A G U ) , r e s u l t i n g f r o m d e f i c i e n c y o f g l y c o s y l a s p a r a g i n a s e . A t a y o u n g age, m i c e deficient i n g l y c o s y l a s p a r a g i n a s e demonstrate m a n y p a t h o l o g i c a l changes o b s e r v e d i n h u m a n A G U patients ( K a a r t i n e n et al., 1996). A f t e r 10 m o n t h s o f age, the general c o n d i t i o n o f A G U m i c e deteriorates g r a d u a l l y and i n c l u d e s progressive m o t o r i c i m p a i r m e n t , i m p a i r e d bladder function, and early death. P a t h o l o g i c a l a b n o r m a l i t i e s were detected i n the central nervous s y s t e m i n c l u d i n g w i d e s p r e a d l y s o s o m a l h y p e r t r o p h y , w i t h e s p e c i a l l y severe n e u r o n a l v a c o u l a t i o n i n the lateral t h a l a m i c n u c l e i a n d deep cerebellar n u c l e i . M i c e o f 20 m o n t h s o f age demonstrated clear n e u r o n a l loss i n c l u d i n g extensive loss o f P u r k i n j e c e l l s , a n d w i d e s p r e a d g l i o s i s . I m p a i r e d bladder f u n c t i o n w a s noted i n o l d e r m i c e , and is  84  speculated to be secondary to i n v o l v e m e n t o f the central nervous system ( G a n z a l e z G o m e z et al,  1998). I n a d d i t i o n to the w i d e s p r e a d central nervous s y s t e m disease  i n c l u d i n g n e u r o n a l v a c o u l a t i o n , d y s m o r p h o l o g y , a n d c e l l loss o b s e r v e d i n the m o u s e m o d e l s o f b o t h M P S I a n d A G U , adult M P S I m i c e l i k e w i s e d e v e l o p i m p a i r e d bladder function. In the severe f o r m o f h u m a n M P S I, d e v e l o p m e n t a l delay is u s u a l l y n o t e d b y 2 years o f age f o l l o w e d b y progressive deterioration, w i t h patients e v e n t u a l l y p e r f o r m i n g i n the moderate to severely retarded range ( C o l v i l l e and B a x , 1996). T h e m e c h a n i s m s and processes l e a d i n g to m e n t a l deterioration i n h u m a n M P S I are not w e l l understood, h o w e v e r , progressive m o r p h o l o g i c a l neuronal a b n o r m a l i t i e s i n c l u d i n g h i l l c o c k enlargements, ectopic dendritogenesis as w e l l as n e u r o n a l sclerosis have b e e n reported ( W a l k l e y et al,  1988, F e r r e r et al,  1988, D e k a b a n et al,  1976, D e k a b e n et al,  1977).  W e report here e v i d e n c e o f secondary a c c u m u l a t i o n o f b r a i n g a n g l i o s i d e s i n m u r i n e M P S I. T h i s secondary a c c u m u l a t i o n o f g a n g l i o s i d e s has p r e v i o u s l y been noted i n h u m a n and canine i d u r o n i d a s e d e f i c i e n c y as w e l l as other storage disorders unrelated to p r i m a r y defects o f g l y c o s p h i n g o l i p i d m e t a b o l i s m ( C o n s t a n t o p o u l o s and D e k a b a n 1978, C o n s t a n t o p o u l o s et al,  1985). T h e role that g a n g l i o s i d e a c c u m u l a t i o n m a y p l a y i n the  pathogenesis o f M P S disorders is u n k n o w n but m a y a c t u a l l y be a central one. T h e m u r i n e m o d e l s for T a y - S a c h s and S a n d h o f f disease have i n d i c a t e d that G M 2 , a n d l i k e l y other g a n g l i o s i d e s , m a y be c a u s a l l y related to apoptotic neuronal c e l l death ( H u a n g et 1997). I n a d d i t i o n , G M  2  al,  has been postulated to u n d e r l i e the generation o f e c t o p i c  dendrites i n p y r a m i d a l neurons i n b o t h T a y - S a c h s as w e l l as other g e n e r a l i z e d l y s o s o m a l storage ( W a l k l e y , 1995).  85  R e c e n t l y , a n o v e l a p p r o a c h for the therapy o f g a n g l i o s i d o s e s has been d e v e l o p e d w h i c h i n v o l v e s the i n t r o d u c t i o n o f s p e c i f i c i n h i b i t o r s o f g l y c o s p h i n g o l i p i d b i o s y n t h e s i s ( N - B u t y l d e o x y n o j i r i m y c i n ) , thereby l i m i t i n g the a c c u m u l a t i o n o f g a n g l i o s i d e s b y l i m i t i n g their i n i t i a l synthesis. T h i s approach has p r o v e n successful i n l i m i t i n g G M 2 a c c u m u l a t i o n i n a m u r i n e m o d e l o f T a y - S a c h s disease (Piatt et al,  1997). W h a t role this  f o r m o f therapy m a y have i n storage disorders w h i c h result i n secondary a c c u m u l a t i o n o f g l y c o s p h i n g o l i p i d s r e m a i n s to be determined. T h e severe dysostosis m u l t i p l e x and progressive n e u r o l o g i c a l d y s f u n c t i o n that occurs i n M P S I constitute the m o s t d e b i l i t a t i n g features o f this group o f disorders, and b o t h features do not r e s p o n d w e l l to bone m a r r o w transplantation. T h e l i m i t e d response noted for these t w o tissues l i k e l y reflects the presence o f early i r r e v e r s i b l e p a t h o l o g y and/or l a c k o f d e l i v e r y o f adequate e n z y m e l e v e l s to relevant c e l l types. P u r k i n j e c e l l loss represents an o b v i o u s l y i r r e v e r s i b l e feature o f disease p r o g r e s s i o n , h o w e v e r o u r o b s e r v a t i o n that P u r k i n j e c e l l loss as w e l l as other n e u r o l o g i c a l manifestations o f m u r i n e M P S I are d e l a y e d relative to skeletal a n d v i s c e r a l manifestations, a n d are not present u n t i l m u r i n e a d u l t h o o d , suggests that there m a y exist a post-natal w i n d o w o f opportunity for therapeutic i n t e r v e n t i o n t o w a r d s p r e v e n t i o n o f C N S p a t h o l o g y . L o n g t e r m a n a l y s i s o f g e n o t y p i c a l l y defined M P S I H patients has demonstrated that B M T c a n s t a b i l i z e n e u r o n a l degeneration p a r t i c u l a r l y w h e n p e r f o r m e d early i n the course o f disease ( H o p w o o d et al., 1993).  B M T i n h u m a n M P S I results i n transient i m p r o v e m e n t i n g r o w t h o f the  a p p e n d i c u l a r skeleton, but has little effect o n the l o n g t e r m skeletal c o m p l i c a t i o n s o f disease. S i m i l a r l y , e n z y m e replacement therapy ( E R T ) has not p r o v e n effective i n c o r r e c t i n g dysostosis i n the M P S I d o g m o d e l or the M P S V I cat m o d e l a l t h o u g h e a r l y  86  B M T i n the canine m o d e l has s h o w n evidence o f m i l d skeletal i m p r o v e m e n t ( K a k k i s et al., 1995, C r a w l e y et al,  1996, S h u l l et al., 1988). T h e c o m b i n a t i o n o f early e n z y m e  replacement f o l l o w e d b y B M T i n the M P S V I I m o u s e m o d e l has resulted i n a dramatic skeletal response as w e l l as evidence o f effects o n n e u r o n a l storage (Sands et al., 1997). T h e presence o f c o m p l e x skeletal p a t h o l o g y i n  Idua -I- m i c e  as y o u n g as 6 w e e k s o f age  suggests significant skeletal structural a b n o r m a l i t i e s are present before, a n d p r o b a b l y contribute to, the severe dysostosis w h i c h b e c o m e s apparent later i n life.  Irreversible  features o f skeletal p a t h o l o g y m a y i n c l u d e the presence o f aberrant m a t r i x and/or finite w i n d o w s early i n d e v e l o p m e n t for n o r m a l bone g r o w t h . A l t e r n a t i v e l y , the l i m i t e d efficacy o f B M T and E R T m a y be the result o f inadequate d e l i v e r y o f therapeutic e n z y m e to s p e c i f i c , c r u c i a l c e l l u l a r targets. C h o n d r o c y t e s , for e x a m p l e , exist w i t h i n a m a t r i x that is resistant to transport o f large m o l e c u l e s . I n a d d i t i o n , M P S associated a c c u m u l a t i o n o f G A G i n the extracellular space m a y further i m p e d e d e l i v e r y o f c o r r e c t i v e agents through, for e x a m p l e , congested cartilage a n d t h i c k e n e d membranes.  T h u s e a r l y i n t e r v e n t i o n m a y p r e c l u d e the  d e v e l o p m e n t o f i r r e v e r s i b l e features, a n d a d d i t i o n a l l y m a y h a v e greater access to s o m e c e l l u l a r targets as G A G a c c u m u l a t i o n has not yet further l i m i t e d d e l i v e r y o f c o r r e c t i v e agents. C h a r a c t e r i z a t i o n o f m u r i n e M P S I has demonstrated the presence o f e a r l y , w i d e s p r e a d l y s o s o m a l distention, early and severe dysostosis m u l t i p l e x , e x c r e t i o n o f e x c e s s i v e g l y c o s a m i n o g l y c a n s i n urine, a shortened life span, a n d c o m p l e x n e u r o p a t h o l o g y i n c l u d i n g n e u r o n a l and g l i a l c e l l l y s o s o m a l distention, e x c e s s i v e C N S accumulation o f gangliosides G M  2  and G M 3 , and progressive P u r k i n j e c e l l loss i n the  87  c e r e b e l l u m . T h i s phenotype is consistent w i t h severe M P S I, H u r l e r s y n d r o m e , i n a l l respects except that the  Idua -I-  m o u s e l i v e s into a d u l t h o o d w h i l e H u r l e r s y n d r o m e is  t y p i f i e d b y death i n the first decade. A s m e n t i o n e d , the a p p l i c a t i o n o f life span parameters o f h u m a n M P S I for p l a c e m e n t i n the spectrum o f M P S I phenotypes m a y not be a p p l i c a b l e to m u r i n e M P S I. It is clear that the m u r i n e m o d e l o f M P S I is representative o f a l l major features o f H u r l e r s y n d r o m e i n c l u d i n g those for w h i c h current therapies are inadequate. T h e s i m i l a r i t i e s i n the c l i n i c a l course seen i n these m i c e to the severe f o r m o f h u m a n M P S I indicates that this is l i k e l y to be a v e r y p o w e r f u l m o d e l for the study o f disease p a t h o p h y s i o l o g y and therapeutic d e v e l o p m e n t . T h e n e u r o p a t h o l o g y a n d skeletal p a t h o l o g y noted i n this m o d e l indicates that c o m p l e x p r i m a r y and secondary factors are l i k e l y to be i n v o l v e d i n the e v o l v i n g c l i n i c a l phenotype. T h e rodent m o d e l w i l l thus be i n v a l u a b l e i n d e t e r m i n i n g the i m p o r t a n c e o f these secondary factors and what role they m a y p l a y i n the h u m a n disorder.  88  Chapter 4: Pronuclear and embryonic stem cell attempts at generation of murine transgenic lines with ubiquitous or myeloid specific expression of human I D U A  89  4.1. I n t r o d u c t i o n T h i s chapter describes attempts to generate m o d e l s o f therapy for M P S I. W h i l e m a n y approaches to therapy for M P S I have been attempted, n o cure for M P S I exists. O n e o f the m o s t important f i n d i n g s relevant to the d e s i g n o f therapies for M P S i s the f i n d i n g that c o - c u l t u r i n g M P S I c e l l s  in vitro  w i t h c e l l s w i t h a related but c l i n i c a l l y  d i s t i n g u i s h a b l e disease, M P S II, results i n " c o r r e c t i o n " o f the g l y c o s a m i n o g l y c a n a c c u m u l a t i o n (Fratantoni et al,  1968). It w a s further suggested that the a c c u m u l a t e d  G A G resulted f r o m d e f i c i e n c y o f s p e c i f i c factors r e q u i r e d for G A G degradation, and that these factors m o s t l i k e l y were e n z y m e s (Fratantoni et al., 1969). T h i s demonstrated that the l y s o s o m a l a c c u m u l a t i o n o f G A G s c o u l d be reversed once established, a n d suggested the presence o f a transport m e c h a n i s m capable o f i n t e r n a l i z i n g a n d d e l i v e r i n g e x o g e n o u s l y p r o d u c e d e n z y m e to the l y s o s o m e . T h i s is i n contrast w i t h m a n y disorders i n w h i c h c o r r e c t i v e factors m u s t be p r o d u c e d i n t e r n a l l y for p r o p e r s u b c e l l u l a r l o c a l i z a t i o n a n d f u n c t i o n to o c c u r . A l s o relevant is the o b s e r v a t i o n that patients w i t h v e r y s m a l l amounts o f I D U A a c t i v i t y undergo a d r a m a t i c a l l y m i l d e r course o f disease than patients w i t h n o detectable e n z y m e a c t i v i t y (Scott et al., 1993). T h i s indicates that a s m a l l increase i n e n z y m e a c t i v i t y m a y have a large i m p a c t o n disease p r o g r e s s i o n . F i n a l l y , the p r o g r e s s i v e nature o f M P S I favors early i n t e r v e n t i o n as some disease s y m p t o m s m a y not r e s p o n d to therapy i n t r o d u c e d later i n the course o f disease. A l l o g e n e i c bone m a r r o w transplantation ( B M T ) has been u s e d e x t e n s i v e l y w i t h partial success for M P S I and other l y s o s o m a l storage disorders as a source o f corrective e n z y m e a c t i v i t y (Peters et al,  1996, F i e l d e t al,  1994, H o p w o o d et al,  1993). B M T is  effective i n n o r m a l i z i n g serum I D U A a c t i v i t y l e v e l s , r e d u c i n g u r i n a r y e x c r e t i o n o f  90  g l y c o s a m i n o g l y c a n s , decreasing h e p a t o s p l e n o m e g a l y , and results i n a general i m p r o v e m e n t o f somatic features o f M P S I. W h i l e d r a m a t i c a l l y i m p r o v i n g q u a l i t y o f life, B M T has less i m p a c t o n the n e u r o l o g i c a l and skeletal c o m p l i c a t i o n s o f M P S I ( S h a p i r o et al., 1995, F i e l d et al., 1994). E n z y m e replacement therapy ( E R T ) , i n w h i c h patients are infused w i t h p u r i f i e d p r o t e i n e n z y m e , m a y offer a n alternative to B M T for M P S I and, i n early l i m i t e d trials, appears to i m p r o v e m a n y c l i n i c a l manifestations o f the disease, but l i k e B M T is b e l i e v e d to have l i m i t e d potential for i m p r o v i n g n e u r o l o g i c a l a n d skeletal s y m p t o m d e v e l o p m e n t ( K a k k i s et al., 2 0 0 1 , W r a i t h J E , 2 0 0 1 , B r o o k s , 2 0 0 2 ) . T h e restricted benefits obtained w i t h E R T and B M T m o s t l i k e l y result f r o m insufficient d e l i v e r y o f therapeutic e n z y m e to c r i t i c a l tissues or disease i r r e v e r s i b i l i t y . E n t r y t h r o u g h the b l o o d b r a i n barrier requires r e c o g n i t i o n b y a s p e c i f i c transporter; none exists for I D U A . T h i s prevents n e u r o l o g i c a l d e l i v e r y o f I D U A f r o m the c i r c u l a t o r y system to the central nervous system. T h i s barrier results i n m i n i m a l d e l i v e r y o f e n z y m e u p o n s y s t e m i c i n f u s i o n i n E R T , and the l i m i t e d c e l l u l a r interaction that occurs b e t w e e n s o m a t i c tissues i n c l u d i n g d o n o r B M T d e r i v e d c e l l s and the C N S l i m i t s benefits f r o m m a c r o p h a g e a n d other c e l l based d e l i v e r y o f I D U A . B o n e and cartilage c e l l s are entrapped i n a m a t r i x w h i c h w o u l d be p r e d i c t e d to p h y s i c a l l y e x c l u d e e n z y m e f r o m c e l l s w h i c h require e n z y m e a c t i v i t y for n o r m a l d e v e l o p m e n t ( T o r z i l l i et al., 1997). A n a d d i t i o n a l factor l i m i t i n g o r g a n i m p r o v e m e n t m a y be the d e v e l o p m e n t o f i r r e v e r s i b l e c o m p l i c a t i o n s o f M P S I, established before, and n o n r e s p o n s i v e to, therapeutic intervention. F o r e x a m p l e , the recent f i n d i n g that dermatan sulfate, one o f t w o G A G s a c c u m u l a t e d i n M P S I, i n h i b i t s the f o r m a t i o n o f elastic fibers, a v i t a l c o m p o n e n t o f e x t r a c e l l u l a r m a t r i x and bone, illustrates a potential m e c h a n i s m where m a t r i x generated  91  d u r i n g e n z y m e d e f i c i e n c y m a y be f u n d a m e n t a l l y altered s u c h that e v e n after e n z y m e replacement, n o r m a l d e v e l o p m e n t i s i m p a i r e d ( H i n e k a n d W i l s o n , 2 0 0 0 ) . A s d e s c r i b e d i n chapter 3, M P S I m i c e s h o w alterations i n c o r t i c a l bone o r g a n i z a t i o n a n d retention o f cartilage i n g r o w t h plate spongiosa. T h e a b i l i t y f o r c o r r e c t i o n o f these p a t h o l o g i c a l states is u n k n o w n . T h e p u r k i n j e c e l l loss a n d disorder w e have o b s e r v e d i n adult M P S I m i c e w o u l d also be e x a m p l e s o f irreversible damage.  Irreversible s y m p t o m s m i g h t also arise i f  c r u c i a l d e v e l o p m e n t a l milestones pass before c r i t i c a l l e v e l s o f e n z y m e a c t i v i t y are i n t r o d u c e d to r e q u i r e d tissues. It remains to be determined to what degree the n e u r o l o g i c a l a n d skeletal c o m p l i c a t i o n s o f M P S I c a n be i m p r o v e d w i t h therapy, a n d w h a t s p e c i f i c c e l l u l a r targets result i n i m p r o v e m e n t i n these c r i t i c a l systems. It i s evident that therapy offers the m o s t benefit w h e n p e r f o r m e d early i n the p r o g r e s s i o n o f M P S I ( H o p w o o d et ah, 1993). E x a m i n a t i o n o f a M P S I - H fetus, gestational age 2 0 w e e k s , w h o s e s i b l i n g h a d d i e d o f c o n f i r m e d M P S I - H at age 8, r e v e a l e d i n t r a c e l l u l a r v a c o u l a t i o n i n tissues i n c l u d i n g d e r m i s , m i t r a l v a l v e , d u r a mater, l y m p h o i d a n d h a e m o p o i e t i c c e l l s , and c o n n e c t i v e tissue, and z e b r a bodies were detected i n s p i n a l c o r d , w h i l e n o v a c o u l a t i o n w a s detected i n tissues i n c l u d i n g cerebral cortex, a n d c e r e b e l l u m ( C r o w et ah, 1983). These f i n d i n g s , a n d the p o s s i b i l i t y that s o m e p a t h o l o g i c a l features o f M P S I are i r r e v e r s i b l e once established ( R u s s e l l et ah, 1998), h i g h l i g h t the need for early i n t e r v e n t i o n for M P S I, e s p e c i a l l y severe M P S I. T h e e x t e n s i o n o f this f i n d i n g i s interest i n in utero therapy, w h e r e p o s s i b l e , s u c h as in utero bone m a r r o w transplantion for M P S I ( F l a k e a n d Z a n j a n i , 1999). T o address the potential o f therapeutic i n t e r v e n t i o n for p r e v e n t i o n o f M P S I s y m p t o m d e v e l o p m e n t I have sought to generate t w o transgenic m o u s e m o d e l s . O n e  92  m o d e l w o u l d express h u m a n I D U A o n l y i n a subset o f H S C d e r i v e d c e l l s , i n a b a c k g r o u n d o f I D U A d e f i c i e n c y w h e n c r o s s e d i n t o the M P S I m o u s e m o d e l . T h i s genetic m o d e l o f in utero B M T w o u l d a l l o w assessment o f the m a x i m u m benefit o f early B M T directed therapies w h i l e a v o i d i n g the l i m i t a t i o n s a n d barriers to p h y s i c a l B M T transplantation in utero. S e c o n d l y , I w a n t e d to generate a m o u s e l i n e that expresses I D U A i n a l l tissues f r o m a n early stage o f d e v e l o p m e n t . T h i s m o u s e c o u l d be u s e d as a d o n o r source i n transplantation experiments w i t h M P S I m i c e , a n d w o u l d determine i f e x p r e s s i o n o f I D U A d u r i n g d e v e l o p m e n t causes disease.  4.1.1 A model of in utero bone marrow transplantation T h e m y e l o i d specific C D 1 1 B - I D U A transgenic w a s d e s i g n e d to determine the therapeutic benefit o f early bone m a r r o w c e l l d e r i v e d I D U A e x p r e s s i o n o n M P S I. B e c a u s e o f barriers to literal in utero transplantation, a genetic a p p r o a c h w a s e m p l o y e d that w o u l d express I D U A i n a subset o f c e l l s d e r i v e d f r o m m a r r o w c e l l s . T h e C D 1 l b gene encodes the a l p h a c h a i n o f the M a c - 1 i n t e g r i n , w h i c h i s preferentially expressed i n m y e l o i d c e l l s s u c h as n e u t r o p h i l s , m o n o c y t e s a n d macrophages ( S h e l l e y a n d A r n a o u t , 1991, H i c k s t e i n et al., 1992). T h i s e x p r e s s i o n p r o f i l e i s consistent w i t h the desired e x p r e s s i o n o f I D U A i n a m o d e l o f in utero B M T , as m o s t o f the benefit d e r i v e d f r o m B M T for M P S I i s thought to be f r o m m o n o c y t e s a n d macrophages. A n u m b e r o f transgenic m i c e have b e e n generated e x p r e s s i n g reporter genes u s i n g the C D 1 l b promoter. W h i l e a larger 1.7 k b p r o m o t e r r e g i o n w a s s h o w n to d r i v e h i g h l e v e l transgene e x p r e s s i o n preferentially i n mature m o n o c y t e s , macrophages, and n e u t r o p h i l s , but not i n m y e l o i d precursors ( D z i e n n i s et al., 1995), s m a l l e r regions o f the putative C D 1 l b p r o m o t e r (1.5 k b to 0.1 k b ) generated less predictable transgene e x p r e s s i o n , w i t h  93  significant e x p r e s s i o n i n l y m p h o c y t e s or n o transgene e x p r e s s i o n at a l l ( B a c k e t a l . , 1995). E x p r e s s i o n w i t h the 1.7 k b p r o m o t e r r e g i o n w a s d e t e r m i n e d to persist into a d u l t h o o d at h i g h l e v e l s . T h i s construct i n c l u d e d the d i s t a l e x o n s and p o l y a d e n y l a t i o n sequence o f the h u m a n g r o w t h h o r m o n e gene to increase transgene e x p r e s s i o n . I u s e d this p r o v e n C D 1 l b construct to generate the C D 1 l b - I D U A construct p i c t u r e d i n figure 4.4.  A s the o p e n r e a d i n g frame o f the h u m a n  IDUA  gene spans a p p r o x i m a t e l y 2 0  k i l o b a s e s , I chose to use a c D N A e n c o d i n g h u m a n I D U A , a k i n d gift f r o m D r . J o h n H o p w o o d , w h i c h is o n l y 2 k i l o b a s e s i n length therefore f a c i l i t a t i n g c l o n i n g o f the f i n a l C D 1 l b - I D U A construct. I n a d d i t i o n , this I D U A c D N A has been expressed i n c e l l culture a n d c o n f i r m e d to encode f u n c t i o n a l I D U A e n z y m e a c t i v i t y (Scott e t a l . , 1991). C o n s t r u c t s were also generated to express either the beta-galactosidase gene or the enhanced green fluorescent gene a l s o f r o m the C D 1 l b p r o m o t e r construct. It w a s h o p e d that reporter gene e x p r e s s i o n w o u l d a l l o w c e l l s e x p r e s s i n g the transgenes to be identified. It s h o u l d be kept i n m i n d that this p r o p o s e d m o d e l w o u l d differ f r o m actual i n  utero transplantation  i n a n u m b e r o f important w a y s . T h e C D 1 l b p r o m o t e r w o u l d not  direct transgene e x p r e s s i o n i n l y m p h o i d c e l l s , a n d thus not a l l c e l l types that express I D U A i n a transplant r e c i p i e n t r e c e i v i n g B M T w o u l d be e x p r e s s i n g I D U A i n this transgenic m o d e l . A n o t h e r significant difference relates to the t i m i n g and d i s t r i b u t i o n o f c e l l s e x p r e s s i n g I D U A . T h e i n t r o d u c t i o n o f I D U A w o u l d o c c u r later i n d e v e l o p m e n t w i t h  in utero B M T  therapy, as d o n o r c e l l s must engraft, e x p a n d , and c o l o n i z e e x i s t i n g organs  whereas the transgenic m o d e l w o u l d be e x p e c t e d to express I D U A earlier, as mature m y e l o i d c e l l s are generated. A s  in utero transplantation  does not i n v o l v e a b l a t i o n o f host  94  tissues, engraftment l e v e l s are l o w w i t h a l l recipients h a v i n g c h i m e r i c bone m a r r o w . T h u s o n l y a fraction o f m a r r o w d e r i v e d c e l l s w o u l d express the therapeutic e n z y m e , w h i l e the p r o p o s e d transgenic m o d e l w o u l d be expected to s h o w e x p r e s s i o n i n a l l c e l l s i n w h i c h the C D 1 l b p r o m o t e r i s f u n c t i o n a l . F o r e x a m p l e , a n a l y s i s o f m a c r o p h a g e s i n a successfully engrafted patient w h o h a d r e c e i v e d in utero B M T w o u l d c o n t a i n a m i x o f n o r m a l (donor) a n d diseased (recipient) macrophages, w h i l e a l l m a c r o p h a g e s i n the transgenic m o d e l w o u l d be expected to express I D U A . F i n a l l y , the C D 1 l b p r o m o t e r d r i v e s e x p r e s s i o n at a h i g h e r l e v e l than n o r m a l l y o c c u r s f r o m the I D U A gene promoter, w h e r e I D U A e x p r e s s i o n l e v e l s are d i f f i c u l t to detect b y standard northern b l o t a n a l y s i s , w h i l e the C D 1 l b transcript i s r e a d i l y detectable (Scott et al., 1992). T a k e n together these differences suggest the transgenic m o d e l d r i v e n b y the m y e l o i d specific C D 1 l b p r o m o t e r w o u l d be l i k e l y to express h i g h e r l e v e l s o f therapeutic I D U A e n z y m e than w i t h in utero transplantation o f n o r m a l d o n o r c e l l s , thus d e t e r m i n i n g the m a x i m u m potential o f the m y e l o i d c e l l lineages as a v e h i c l e for therapy for M P S I. C o m p l i c a t i o n s o f M P S I not i m p r o v e d despite h i g h l e v e l m y e l o i d e x p r e s s i o n o f I D U A i n this transgenic m o d e l w o u l d suggest autologous H S C a n d other h e m o p o i e t i c targeted approaches w i l l not represent a cure for these features o f M P S I.  4.1.2 W i d e s p r e a d h i g h l e v e l I D U A e x p r e s s i o n T h e g e n e r a t i o n o f a m o u s e l i n e that expresses h i g h l e v e l s o f h u m a n I D U A i n a l l tissues w a s undertaken for t w o reasons. M o s t i m p o r t a n t l y , I w i s h e d to d e v e l o p a strain o f m i c e e x p r e s s i n g active h u m a n I D U A , as w e l l as a reporter gene, for use as a d o n o r strain i n transplantation experiments w i t h M P S I m i c e . T h e s e c o n d objective o f this project w a s to determine the o u t c o m e o f h i g h l e v e l , w i d e s p r e a d I D U A e x p r e s s i o n o n d e v e l o p m e n t .  95  I D U A is n o r m a l l y expressed at v e r y l o w l e v e l s a n d the consequences o f a b n o r m a l l y h i g h l e v e l s o f I D U A a c t i v i t y are u n k n o w n . E x p r e s s i o n o f l y s o s o m a l e n z y m e s c o u l d disrupt d e v e l o p m e n t i n a n u m b e r o f w a y s . Transport o f m a n y l y s o s o m a l e n z y m e s , i n c l u d i n g I D U A , to the l y s o s o m a l c o m p a r t m e n t requires receptor m e d i a t e d r e c o g n i t i o n o f mannose-6-phosphate  residues  f o u n d o n n u m e r o u s l y s o s o m a l proteins ( V o n F i g u r a and H a s i l i k , 1986). O v e r p r o d u c t i o n o f a n y p r o t e i n w h i c h is r e c o g n i z e d b y this receptor m a y disrupt l y s o s o m a l transport, and m i g h t be expected to result i n insufficient d e l i v e r y o f l y s o s o m a l e n z y m e s to the l y s o s o m e , as w e l l as the presence o f l y s o s o m a l proteins i n inappropriate organelles and the e x t r a c e l l u l a r space. S u r p r i s i n g l y , it has been s h o w n that p h e n o t y p i c c o r r e c t i o n i n M P S I fibroblasts, as assayed in vitro b y r e d u c t i o n i n the a c c u m u l a t i o n o f S - l a b e l e d 3 5  g l y c o s a m i n o g l y c a n , occurs to a greater extent w i t h l o w l e v e l o v e r e x p r e s s i o n o f I D U A than w i t h h i g h e r l e v e l s o f o v e r e x p r e s s i o n . In the same study, a r e l a t i o n s h i p w a s f o u n d b e t w e e n the l e v e l o f o v e r e x p r e s s i o n o f I D U A and the secretion o f other l y s o s o m a l e n z y m e s , also r e c o g n i z e d b y the mannose-6-phosphate receptor ( M - 6 - P receptor), to the e x t r a c e l l u l a r space, consistent w i t h altered l y s o s o m a l targeting ( A n s o n et al., 1992). T h i s suggests that a t h r e s h o l d l e v e l for therapeutic e x p r e s s i o n m a y exist and that e x p r e s s i o n above the t h r e s h o l d reduces therapeutic efficacy, r a i s i n g interesting questions r e g a r d i n g o p t i m u m therapy strategies for M P S I. A n u m b e r o f transgenic m o u s e lines o v e r e x p r e s s i n g l y s o s o m a l e n z y m e s that are r e c o g n i z e d b y the M - 6 - P receptor have been reported, w i t h n o o b v i o u s phenotype ( K y l e et al., 1990, K a s e et al., 1998). T h i s indicates o v e r e x p r e s s i o n o f mannose-6-phosphate e x p r e s s i n g p r o t e i n is tolerated. A n o t h e r m e c h a n i s m b y w h i c h o v e r e x p r e s s i o n o f I D U A  96  c o u l d affect d e v e l o p m e n t is the I D U A m e d i a t e d cleavage o f substrates not targeted for l y s o s o m a l destruction. A s heparan a n d dermatan sulfate c o n t a i n i n g G A G s have m a n y functions i n c l u d i n g b e i n g components o f e x t r a c e l l u l a r m a t r i x as w e l l as p l a y i n g a r o l e i n r e c e p t o r - l i g a n d interactions, inappropriate degradation o f these I D U A substrates m i g h t be expected to l e a d to disease. T o generate a m o d e l w i t h w i d e s p r e a d h i g h l e v e l I D U A e x p r e s s i o n constructs w e r e engineered i n c l u d i n g reporter cassettes to p e r m i t i d e n t i f i c a t i o n o f transgene e x p r e s s i n g c e l l s and organs.  4.1.3 T h e use o f the h u m a n I D U A c D N A T o a v o i d p o s s i b l e regulatory alteration o f Sat-1 r e s u l t i n g f r o m antisense interactions o f the c o m p l e m e n t a r y m u r i n e  Idua a n d Sat-1 regions, and to determine i f the  h u m a n f o r m o f I D U A c a n rescue m u r i n e I D U A d e f i c i e n c y , the h u m a n rather than m u r i n e I D U A c D N A w a s used for e x p r e s s i o n o f I D U A e n z y m e . T h e h u m a n I D U A c D N A was p r o v i d e d b y J o h n H o p w o o d , W o m e n ' s and C h i l d r e n ' s H o s p i t a l , A d e l a i d e A u s t r a l i a . T h e h u m a n I D U A c D N A is a c o m p a c t 2155 basepairs l o n g and consists p r i m a r i l y o f o p e n r e a d i n g frame, as s h o w n i n figure 1.4. T h e 141 basepair o v e r l a p r e g i o n b e t w e e n e x o n II o f the h u m a n I D U A c D N A a n d a p o r t i o n o f the 3 ' untranslated r e g i o n o f Sat-1 is s t i l l p a r t i a l l y h o m o l o g o u s , h o w e v e r , as s h o w n i n F i g u r e 4 . 1 , e x o n II o f the h u m a n I D U A c D N A has 26 basepairs o f disparity w i t h m u r i n e  Idua e x o n II. N o stretch o f perfect  h o m o l o g y extends b e y o n d 17 basepairs. It is h o p e d that the differences b e t w e e n the transgenic h u m a n I D U A c D N A , and the endogenous m u r i n e Sat-1 gene, w i l l l i m i t alterations to endogenous Sat-1 e x p r e s s i o n . T r a n s g e n i c e x p r e s s i o n o f a n antisense  mRNA  can d i m i n i s h endogenous gene f u n c t i o n as demonstrated b y a n u m b e r o f groups ( M a n s h o u r i , e t a l , 1997, C h e n e t a l , 1997). T h e h u m a n I D U A c D N A is w e l l c h a r a c t e r i z e d (Scott e t a l , 1991) and has been u s e d i n m a n y studies. T h e h u m a n I D U A c D N A has been overexpressed i n C H O c e l l s ( K a k k i s e t a l , 1993) for E R T trials and X - r a y c r y s t a l l o g r a p h y ( K a k k i s e t a l , 1994, U n g e r e t a l , 1994). It has also b e e n u s e d i n r e t r o v i r a l vectors to correct storage i n M P S - 1 fibroblasts as a prelude to gene therapy experiments ( A n s o n e t a l , 1992). E n z y m e replacement trials u s i n g r e c o m b i n a n t h u m a n I D U A has been p e r f o r m e d i n the canine m o d e l o f M P S I ( S h u l l e t a l , 1994), m o u s e ( C l a r k e , u n p u b l i s h e d results) a n d h u m a n s ( K a k k i s , 2 0 0 1 ) , w i t h e v i d e n c e o f therapeutic i m p r o v e m e n t o f l y s o s o m a l G A G a c c u m u l a t i o n . T h u s this c D N A is w e l l established a n d contains a l l elements r e q u i r e d for the p r o d u c t i o n o f e n z y m a t i c a l l y active and p r o p e r l y targeted therapeutic h u m a n I D U A enzyme.  98  hldua: 1  CCCCCCfJCTGCClCACi^CCAGGCTGACCAGTACGSCCT|AGiTGGGACCAGCAlCT|AA  IIIII | mldua: 1  III |  I •  IIIIIIIIIIIIIII  I I I  I  IIIIIIII  I  I I  CCCCCC|CTGCC|CAC|ICCAGGCTGACCAGTACG|CCT|AG|TGGGACCAGCAiCT|AA  h l d u a : 61 CCTlGCCTATGTGGGiGCCGTCCCTCAClGlGGCAT^AGCAGGTCCGGAil'CACTGGCT mldua: 61  I  • J  I III I M II I T III •  I M I I I I I I fl! I I I I I II  CCT|GCCTACATiGG|GCCGTACCTCAClGlGGCATTGAGCAGGTCCGGAgCACTGGCT  h l d u a : 121 GCTGGAGCTTGTCACCACCAG  IIIII |  •  II •  141  II I  mldua: 121 GCTGGATCTCATCAC||CCAG  141  Figure 4.1: Identity between human and murine Idua exon II. In b o t h species, the 141 basepair e x o n II o f the Idua gene o v e r l a p s w i t h a p o r t i o n o f 3 ' untranslated sequence o f the Sat-1 between  human  and  m u r i n e Idua  gene.  S h a d e d areas i n d i c a t e r e g i o n s o f d i s p a r i t y  sequences,  and  therefore  represent  regions  n o n i d e n t i t y b e t w e e n the endogenous m u r i n e Sat-1 transcript a n d expressed h u m a n transcripts.  A total o f 2 6 basepairs differ b e t w e e n the respective c D N A s ,  of Idua  scattered  throughout the 141 basepair o v e r l a p r e g i o n . T h e largest c o n s e c u t i v e r e g i o n o f identity b e t w e e n the t w o species is 17 nucleotides l o n g , c o n t a i n i n g 11/17 (65%) G C content. T h u s transgenic e x p r e s s i o n o f the h u m a n I D U A  cDNA  i n m o u s e is less l i k e l y to  i n f l u e n c e m u r i n e S A T - 1 e x p r e s s i o n as a result o f antisense interactions c o m p a r e d w i t h e x p r e s s i o n o f the m u r i n e I D U A c D N A . B l a s t 2 f r o m N C B I w a s u s e d to generate this figure.  4.1.4 The generation of transgenic mice T r a n s g e n i c m i c e are u s u a l l y generated b y p r o n u c l e a r i n j e c t i o n o f f e r t i l i z e d eggs as d e p i c t e d i n figure 4.2. Injected eggs are i m p l a n t e d into surrogate mothers for d e l i v e r y o f founder m i c e , w h i c h are then assessed for transgene presence, a n d e x p r e s s i o n pattern. I n t r o d u c t i o n o f D N A b y this route leads to r a n d o m integration o f u s u a l l y m u l t i p l e h e a d to t a i l v e c t o r copies. W h i l e offering r a p i d p r o d u c t i o n o f founder transgenic m i c e , this a p p r o a c h has a n u m b e r o f consequences i n c l u d i n g the i n a b i l i t y to study transgenes w i t h a  99  1 .Microinject the transgene construct into the male pronucleus  Fertilized mouse egg  I  2.Transfer injected eggs into a surrogate female mouse  • • L ^  J^^-v  J ^ X N  J l / ^  •J^.^N  J ^ ^ v  3.Analyse offspring for the presence of transgenic DNA by P C R or Southern blot Figure 4.2: Pronuclear injection approach to the generation of transgenic mice D N A i s injected d i r e c t l y into the p r o n u c l e u s o f a f e r t i l i z e d m o u s e egg. I n contrast w i t h the E S a p p r o a c h , a n a l y s i s for transgene presence and e x p r e s s i o n o c c u r s i n founder m i c e rather than at the l e v e l o f the c e l l .  trans-dominant lethal phenotype, and the cost o f p r o d u c i n g m a n y founder m i c e o f w h i c h a m i n o r i t y c o n t a i n the transgene a n d express the transgene i n a desired pattern. A n alternative a p p r o a c h uses e m b r y o n i c stem ( E S ) c e l l s to generate transgenic  mice,  d e p i c t e d i n figure 4 . 3 . T h i s a p p r o a c h i n v o l v e s i n t r o d u c t i o n o f D N A into E S cells, f o l l o w e d b y s e l e c t i o n for u n i q u e c l o n a l p o p u l a t i o n s e n c o d i n g resistance to an a n t i b i o t i c . T h i s d r a m a t i c a l l y enriches for c l o n e s that h a v e integrated, a n d express, construct e n c o d e d transgenes, a s e l e c t i o n step not a v a i l a b l e w i t h the p r o n u c l e a r approach.  100  ES cells  1.Introduce transgenic DNA into E S cells 129J E S cells - agouti colored coat  2.Amplify in antibiotics until individual antibiotic resistant colonies with integrated transgenes appear  ~8 days  3.Pick colonies and transfer to 96 well plate  4.Split plate and freeze master 5.Analyze, identify desired clone(s)  •*  blastocyst injection or aggegration technique, and transfer to surrogate female  6.Thaw desired E S clone and generate chimeras  blk/6  chimera  7.Breed chimeras, identify transgenic pups  I—I—I I—I—I t, 1. *L 1, %. 1U  I  /4 of the agouti pups should carry transgene  1  Figure 4.3: Embryonic stem cell approach for the generation of transgenic mice T h e major advantage o f the E S a p p r o a c h is step 5 , h a v i n g the o p p o r t u n i t y to a n a l y z e E S clones to identify clones w i t h desired integration events and, w h e r e p o s s i b l e , transgene e x p r e s s i o n . Injection o f desired E S cells into blastocysts generates c h i m e r a s that m a y a l l o w for a n a l y s i s o f otherwise lethal phenotypes, another advantage o f the E S approach.  101  A s E S clones c a n be a m p l i f i e d in vitro, samples c a n be taken for analysis w h i l e v i a b l e c e l l s capable o f g e r m l i n e t r a n s m i s s i o n are m a i n t a i n e d i n culture o r f r o z e n . A n a l y s i s for m o l e c u l a r characteristics o f transgene integration s u c h as c o p y n u m b e r a n d n u m b e r o f independent integration sites c a n be p e r f o r m e d , as w e l l as analysis o f transgene e x p r e s s i o n , i f the p r o m o t e r o f the transgene is active i n E S c e l l s . A further advantage o f the E S a p p r o a c h is the p r o d u c t i o n o f chimeras w h i c h i n c l u d e v a r i a b l e amounts o f transgenic E S c e l l s a n d n o r m a l blastocyst tissue and m a y a l l o w escape f r o m lethal d e v e l o p m e n t a l bottlenecks, a l l o w i n g transgene assessment. T h e L o b e g r o u p has used the E S approach to generate reporter m i c e capable o f u b i q u i t o u s reporter gene e x p r e s s i o n ( L o b e et al., 1999). B y a n a l y z i n g the e x p r e s s i o n o f a reporter gene i n E S c e l l s , c l o n e s were i d e n t i f i e d w i t h superior e x p r e s s i o n characteristics that were used i n the p r o d u c t i o n o f transgenic m i c e m o r e l i k e l y to have the potential for u b i q u i t o u s transgene e x p r e s s i o n i n a d u l t h o o d . In attempts to generate b o t h the m y e l o i d s p e c i f i c a n d the u b i q u i t o u s I D U A e x p r e s s i n g I D U A m o d e l s d e s c r i b e d above, p r o n u c l e a r m i c r o i n j e c t i o n o f D N A transgene constructs, expected to achieve stable c h r o m o s o m a l integration at l e v e l s r a n g i n g f r o m 104 0 % o f the r e s u l t i n g m i c e , was performed. T h e absence o f transgene b e a r i n g o f f s p r i n g for either construct after repeated m i c r o i n j e c t i o n attempts l e d to the use o f the e m b r y o n i c stem c e l l approach to the generation o f transgenic m i c e . T h e E S c e l l a p p r o a c h a l l o w s for s e l e c t i o n o f lines w i t h rare c h r o m o s o m a l integration events and, w h e n p r o m o t e r elements active i n E S c e l l s are i n v o l v e d , p a r t i a l e x p r e s s i o n analysis o f the i n t r o d u c e d transgene construct at the l e v e l o f the E S c e l l , before m i c e are generated. T h i s m a y identify E S lines m o r e l i k e l y to p r o d u c e desired  102  e x p r e s s i o n patterns i n adult m i c e and lines less l i k e l y to suffer transgene s i l e n c i n g . I n a d d i t i o n , i n situations where transgene e x p r e s s i o n results i n e m b r y o n i c lethality, chimeras p r o d u c e d w i t h the E S a p p r o a c h m a y a l l o w d e d u c t i o n o f the effects o f transgene e x p r e s s i o n , whereas m i c r o i n j e c t i o n m a y f a i l to generate any o f f s p r i n g for a n a l y s i s . M a l e R l e m b r y o n i c stem c e l l s d e r i v e d f r o m the a g o u t i 129 J m u r i n e strain, p r o v e n to be capable o f g e r m l i n e t r a n s m i s s i o n o f genetic alterations, w e r e used throughout this w o r k . H o w e v e r , after successful E S c e l l m a n i p u l a t i o n , defined as demonstration o f transgene integration and, where p o s s i b l e , transgene e x p r e s s i o n , no g e r m l i n e chimeras c a r r y i n g the integrated transgene constructs were generated for either m y e l o i d specific or w i d e s p r e a d h u m a n I D U A e x p r e s s i o n . T h i s c o u l d be the result o f chance, or c o u l d result f r o m a dominant-negative effect o f transgene e x p r e s s i o n , i.e. human I D U A .  It w a s then d e c i d e d to e m p l o y the c o n d i t i o n a l I D U A e x p r e s s i o n approach  d e s c r i b e d i n C h a p t e r 5, w h i c h w o u l d a l l o w for c o n t r o l o f tissue s p e c i f i c i t y and the onset o f transgenic I D U A expression.  4.2 Results 4.2.1 Pronuclear injection approach for the generation of myeloid specific, and ubiquitous, I D U A expressing transgenic mice Constructs for m y e l o i d specific transgene e x p r e s s i o n were d e s i g n e d as s h o w n i n f i g 4.4.  103  CDllb  reporter gene  hgh introns  promoter  Figure 4.4 Transgenic construct for myeloid specific expression A . T h e C D l l b - I D U A construct. T h e 1.8 k i l o b a s e upstream r e g i o n o f the C D l l b  gene  c o n t a i n i n g elements to d r i v e m y e l o i d specific e x p r e s s i o n , f o l l o w e d b y the 2.1 k i l o b a s e h u m a n I D U A c D N A , w i t h d i s t a l n o n c o d i n g introns o f the h u m a n g r o w t h h o r m o n e gene to increase e x p r e s s i o n levels. same  e x p r e s s i o n p l a t f o r m as  B . R e p o r t e r construct. R e p o r t e r constructs based o n the CDllb-IDUA  were  generated  galactosidase gene o r the e n h a n c e d green fluorescent gene.  with  either the  beta-  H g h introns are h u m a n  g r o w t h h o r m o n e regions that p r o v i d e s p l i c i n g to the transcript.  104  int {688 f I , ^ o j j l f t 1  t l 1?  _Gtai { 2 6 ) Bgllf ($94)' Pstt. <710)  -•Seal | 5 ? M )  Sac I (10B4) Psti  (1238)  GoRI (1483)  B.maMEcoRV) mm  (1835)  Psfl (18411 Smal (1847)  Sacl C242S) PsU (25883: (2723) Fsli(2756)  flial  Sact (4025|  Figure 4.5: A map of the backbone C D l l b - h g h vector for myeloid transgene expression A 1.8 k b fragment (bp 1 to 1853) o f the C D 1 l b p r o m o t e r is f o l l o w e d b y a u n i q u e B a m H I r e s t r i c t i o n site for i n s e r t i o n o f gene o f interest, f o l l o w e d b y a 2.2 k b g e n o m i c r e g i o n o f h u m a n g r o w t h h o r m o n e gene i n c l u d i n g n o n c o d i n g exons for s p l i c i n g i n d u c e d transcript stability.  R e m o v a l o f n o n desired sequences b y r e s t r i c t i o n w i t h X h o I (at p o s i t i o n 11 bp)  a n d N o t 1 ( p o s i t i o n 4 0 0 7 bp after a d d i t i o n o f h u m a n I D U A c D N A . M a p a n d v e c t o r f r o m Scott P o w n a l l a n d F r a n k J i r i k .  105  F i g u r e 4 . 6 : P l a s m i d c o n t a i n i n g Beta-galactosidase r e p o r t e r gene A 3.5 k b N o t I / N o t I fragment c o n t a i n i n g the beta-galactosidase reporter w a s e x c i s e d for c l o n i n g into the C D 1 I B construct as s h o w n i n F i g X . P l a s m i d a n d m a p f r o m G r a n t McGregor.  food M i l  Stel F i g u r e 4.7: T h e p E G F P - C 2 p l a s m i d f o r e x p r e s s i o n o f e n h a n c e d g r e e n f l o u r e s c e n t protein T h i s v e c t o r w a s u s e d as a source for the C M V p r o m o t e r (fragment A s e I to N h e I, 6 0 0 bp) to d r i v e h i g h l e v e l w i d e s p r e a d e x p r e s s i o n o f the h u m a n I D U A c D N A , as a source o f the E G F P reporter for use i n the C D 1 I B construct (fragment N h e I to B s r G I , 7 2 0 bp) a n d as a source for a h i g h l e v e l w i d e s p r e a d E G F P e x p r e s s i n g reporter gene (fragment A s e I to M l u I, 1600 bp). V e c t o r f r o m C l o n t e c h .  106  Pronuclear microinjection o f both CD1 l b constructs was performed at the Centre for Molecular Medicine and Therapeutics. Microinjection o f 408 fertilized eggs lead to the birth o f 18 mice. Samples o f these mice were taken and P C R and southern analysis were preformed to identify transgene positive founders, as shown in figure 4.8.  F i g u r e 4 . 8 : A n a l y s i s o f 18 s a m p l e s f r o m c o - m i c r o i n j e c t i o n o f C D l l b - I D U A a n d CDllb-LacZ  constructs  A . P C R on D N A extracted from tail. P C R primers specific for the human I D U A gene were used in exon I, H I D IF, and on the opposite strand in exon I V , H I D 4 R , which produces a P C R band o f 341 basepairs. Lanes 1-18, F l tail samples, lane 19 negative control, lane 20 non transgenic tail sample, lane 21 positive control 1/1000 dilution o f human I D U A c D N A (original=0.2 ug/ul). N o transgene positive samples were identified. The band observed in most lanes including the nontransgenic control is a nonspecific amplification product. B . Southern blot analysis o f EcoRI/Not I digests o f the same 11 samples probed with the human I D U A 2.1 kb c D N A . A 1.6 kb band is expected in transgene positve samples. N o positives were identified.  107  Another round o f microinjection was performed with the C D 1 l b - I D U A construct and a C D 1 l b - E G F P construct. The E G F P reporter gene was chosen as it was considered to have some benefits not shared with the beta-galactosidase reporter gene. Injection o f approximately 350 eggs produced 11 mice. Analysis o f D N A samples is shown in figure 4.9.  « 1 2 3 4  5 6 7 8 9  10  "o o £  8  s  =  s  i  8 8 <o g g >  o  1 i r r + + «  •341 bp  F i g u r e 4 . 9 : A n a l y s i s o f 11 s a m p l e s f r o m c o - m i c r o i n j e c t i o n o f C D l l b - I D U A a n d C D l l b - E G F P contructs  P C R using human I D U A c D N A specific primers H I D IF and H I D 4 R designed to generate a 341 basepair P C R product. N o positives were identified while positive control lanes with diluted human I D U A c D N A plasmid are positive.  N o transgene positive founders were identified by either P C R , or Southern blot analysis (data not shown). Simultaneously, I attempted to generate transgenic mice with ubiquitous human I D U A expression. A construct for this purpose is shown in figure 4.10.  108  C  M  V  promoter  EGFP g e n e  hgh introns  CMV promoter  Human IDUA cDNA  hgh introns  Figure 4.10: Ubiquitous Transgene Construct C M V - I D U A  T h i s construct uses the C M V I E p r o m o t e r taken f r o m a C l o n t e c h m a m m a l i a n e x p r e s s i o n p l a t f o r m (figure 4.7) and has been demonstrated to result i n h i g h l e v e l w i d e s p r e a d e x p r e s s i o n i n c l u d i n g v i r t u a l l y a l l m a m m a l i a n c e l l types. B o t h the h u m a n I D U A c D N A a n d the E G F P reporter gene are under the r e g u l a t i o n o f the C M V I E p r o m o t e r a n d b o t h genes i n the construct have distal elements o f the h u m a n g r o w t h h o r m o n e gene to increase e x p r e s s i o n l e v e l s . P r o n u c l e a r i n j e c t i o n o f the isolated construct w a s p e r f o r m e d o n a p p r o x i m a t e l y 3 5 0 eggs, a n d 12 m i c e w e r e p r o d u c e d . P C R a n d S o u t h e r n a n a l y s i s w a s p e r f o r m e d as s h o w n i n figure 4 . 1 1 .  109  B. 1 2  3  4  5  6  7  8  9  10  11 12  — C3  6.4 kb transgene 2.7 kb murine IDUA fragment  F i g 4.11: Analysis of samples f r o m microinjection of ubiquitous I D U A construct CMV-IDUA A . N e s t e d P C R o n 12 samples f r o m C M V - I D U A injection. 1st P C R w i t h h u m a n I D U A c D N A s p e c i f i c p r i m e r s i n e x o n 3 a n d 7 f o l l o w e d b y s e c o n d r o u n d o f P C R u s i n g nested p r i m e r s i n e x o n s 4 and 6. N o p o s i t i v e s identified. P o s i t i v e c o n t r o l sample I D U A c D N A is p o s i t i v e i n b o t h rounds. B . H i n d III digested S o u t h e r n o f D N A samples expected to produce a b a n d o f 6.4 k b i n transgene p o s i t i v e samples. N o t e b a n d i n a l l lanes i n c l u d i n g nontransgenic lane w h i c h is a 2.7 k b H i n d III fragment  f r o m the m u r i n e I D U A l o c u s  w i t h h o m o l o g y to the h u m a n I D U A c D N A probe used and w h i c h represents a n internal probe c o n t r o l . N o transgene p o s i t i v e m i c e were i d e n t i f i e d . T h e cause o f the shift o f the 2.7 k b b a n d i n lane 1 is u n k n o w n .  A s s u m m a r i z e d i n T a b l e 4 . 1 , p r o n u c l e a r i n j e c t i o n o f over 1000 eggs w i t h t w o different constructs p r o d u c e d o n l y 41 m i c e , less than expected. O f these, n o transgene p o s i t i v e m i c e were i d e n t i f i e d .  110  Construct  N u m b e r o f eggs  Number o f mice  Transgene  Expected  microinjected  injected  produced  positive  (10-40%)  408  18  0  1-7  -350  11  0  1-4  CMV-IDUA CMV-EGFP  -350  12  0  1-5  Totals:  -1100  41  0  4-16  CDllb-IDUA CDllb-LacZ CDllb-IDUA CDllb-EGFP  Table 4.1: Summary of Pronuclear Microinjection attempts at generation of transgenic lines Constructs m i c r o i n j e c t e d and r e s u l t i n g m i c e . N o transgene p o s i t i v e w e r e i d e n t i f i e d .  H i s t o r i c a l l y , p r o n u c l e a r m i c r o i n j e c t i o n produces transgene p o s i t i v e o f f s p r i n g i n 1 0 - 4 0 % o f offspring, w h i c h w i t h the 41 m i c e p r o d u c e d here w o u l d be 4-16 p o s i t i v e m i c e .  An  e m b r y o n i c stem c e l l a p p r o a c h w a s then used as it was b e l i e v e d p o s s i b l e barriers to transgene p o s i t i v e o f f s p r i n g m i g h t be o v e r c o m e .  4.2.2 Embryonic stem cell approach for the generation of myeloid specific and ubiquitous I D U A expression T h e E S approach w a s undertaken after the failure to produce transgene p o s i t i v e o f f s p r i n g b y pronuclear m i c r o i n j e c t i o n . T h e C D 1 l b - I D U A construct was c l o n e d into a n e o m y c i n e n c o d i n g cassette to confer a n t i b i o t i c selection after i n t r o d u c t i o n into E S c e l l s . C o - e l e c t r o p o r a t i o n o f D N A constructs l a c k i n g s e l e c t i o n cassettes w i t h selection cassette c o n t a i n i n g constructs has been reported to l e a d to a h i g h l e v e l o f co-integration. It w a s d e c i d e d not to a d d a s e l e c t i o n cassette to the C D 1 l b - L a c Z reporter construct but rather to  ill  screen E S c l o n e s resistant to N e o , a n d p r e s u m e d to c o n t a i n the C D 1 1 B - I D U A construct, for integration o f the L a c Z construct. T h e C M V - I D U A construct p r e v i o u s l y d e s c r i b e d a n d intended for u b i q u i t o u s I D U A e x p r e s s i o n , as w e l l as E G F P reporter e x p r e s s i o n , w a s c l o n e d into the F l o x vector s h o w n i n figure 4.12. T h e F l o x v e c t o r w a s used as it p r o v i d e d c o n v e n i e n t c l o n i n g sites a n d i n c l u d e s a n e o m y c i n resistance cassette.  Flax sites EGFP  SCn bp  Poly A  signa'  hIDUA cDNA 2100 bp  Poly A signal  pa CMV promoter  hgh introns CMV promoter Hind i l l  hgh Introns  m neomycin resistance cassette  thymidine kinase cassette  EcoHI  F i g u r e 4.12: p F L O X - C M V - I D U A - E G F P A construct d e s i g n e d for u b i q u i t o u s e x p r e s s i o n o f h u m a n I D U A and the E G F P reporter, and a l l o w i n g for n e o m y c i n selection i n E S c e l l s .  112  KAHind'MS (39) iSpsI (44) — /stn (50) /•Sacll (52) Mod (67) rfAH.nsJ'.l) (6S1 >P»(I (72) Hlrtclt <7«! Sill {76.._ •Xbal (04) P«if (103) SSul (Z1S) Stul (287) EcoHl (346) Xmni  (5817)  Seal  (S700)  -•EcoRV (783) EcoBV (86?) •! phi '(92b'f  P»t! .(438)* pnl (1061)  H!ncH |461) ::  CgUl  (477)'  Thymidine kinase  Ss'.l (127S)  Flox.gcX {8S«s,'bjs5; :  Phosphoglycerate kinase gene promoter BstXI  (3920}  Neomycin  Hindttt (3899) a«I (3|B«|) . Smoi immf ' (SccRl/BamHl) (3851)  s  4hcl  (20*.  iCoRV (203: fecoHl (2043) SpW (2888) : 5t»1<2296) Stul (2343) !  Psti (2560);  s»ai(38Sif  Refer ©123)  SSpht (3039)  '•"Fall (37S7) BamHI(3744K  s«V {27471  <cot (3130)  (Hirt<liri/B#mHI) <SS73)| (Xba1/Xho1) (3664)'  *£pl (135  teamte)- (ab-.  (Xbo1) (3382) Bell  (3393)  Figure 4.13: The Flox vector used for E S selection of the ubiquitous I D U A and E G F P expressing construct used previously for pronuclear injection T h e l o x sites ( • ) are n o t u t i l i z e d i n this construct. T h i s construct w a s used as a c o n v e n i e n t source o f the N e o m y c i n resistance gene, d r i v e n b y the m o u s e phosphoglycerate k i n a s e gene promoter. V e c t o r f r o m Scott P o w n a l l .  113  A s e c o n d construct intended for u b i q u i t o u s I D U A e x p r e s s i o n ,  pCAGGs-IDUA,  w h i c h w a s c o n s i d e r e d l i k e l y to generate h i g h e r l e v e l s o f transgene e x p r e s s i o n than the p F l o x - C M V - I D U A - E G F P construct, w a s d e s i g n e d as s h o w n i n f i g 4.14.  CMV IE enhancer  beta-actin promoter  human IDUA cDNA  IRES  beta-geo LacZ neo  poly A signal  r  Figure 4.14: Ubiquitous Transgene Construct pCAGGs-IDUA p C A G G s - I D U A based o n the p C A G G s h i g h l e v e l m a m m a l i a n e x p r e s s i o n vector. T h e C M V i m m e d i a t e early enhancer element is u s e d w i t h the c h i c k e n beta-actin p r o m o t e r to direct e x p r e s s i o n o f the h u m a n I D U A c D N A . A n internal r i b o s o s m e entry site ( I R E S ) a l l o w s for e x p r e s s i o n o f a d o w n s t r e a m beta-geo f u s i o n gene e n c o d i n g the beta galactosidase reporter a n d n e o m y c i n resistance genes. A consensus p o l y a d e n y l a t i o n s i g n a l c o m p l e t e s the construct.  T h e p C A G G s v e c t o r (figure 4.15) ( N i w a et al., 1991) w a s c h o s e n as it has been s h o w n to d r i v e h i g h l e v e l e x p r e s s i o n i n e u k a r y o t i c c e l l s . In a d d i t i o n , as this v e c t o r d r i v e s e x p r e s s i o n i n E S c e l l s , r e p l i c a plates o f E S c e l l s c o u l d be a n a l y z e d for reporter gene e x p r e s s i o n ( L a c Z ) as w e l l as I D U A e n z y m e a c t i v i t y .  114  F i g u r e 4.15: p C A G G s vector for h i g h level e u k a r y o t i c expression T h e p i c t u r e d v e c t o r is p C A G G s w i t h the a d d i t i o n o f the E G F P reporter gene.  pCAGGs  features a p r o v e n u b i q u i t o u s l y strong p r o m o t e r based o n the c h i c k e n beta-actin p r o m o t e r demonstrated to d r i v e e x p r e s s i o n i n a w i d e v a r i e t y o f c e l l s , as w e l l as the C M V - I E enhancer. O t h e r features o f this v e c t o r i n c l u d e the rabbit b e t a - g l o b i n gene p o l y a d e n y l a t i o n sequence for efficient post t r a n s c r i p t i o n a l p r o c e s s i n g . V e c t o r a n d m a p f r o m D r . J u n - i c h i M i y a z a k i . ( N i w a et al., 1991).  115  F i g u r e 4.16: T h e p G T 1 . 8 I r e s B g e o v e c t o r T h e p G T 1 . 8 I r e s B g e o p l a s m i d features the beta-geo fusion gene for e x p r e s s i o n o f n e o m y c i n resistance a n d beta-galactosidase, a n d a n upstream I R E S (internal r i b o s o m e entry sequence). T h e 4.5 k b X b a I / X b a I fragment c o n t a i n i n g the I R E S sequence a n d beta-geo w a s r e m o v e d for a d d i t i o n to p C A G G s . Transgenes c l o n e d upstream o f the I R E S are expressed a l o n g w i t h beta-geo as a d i c i s t r o n i c single transcript. V e c t o r f r o m Scott P o w n a l l ( M o u n t f o r d et al,  1994).  4.2.3 E S l i n e s g e n e r a t e d T h e C D 1 l b - I D U A transgene construct w a s s u c c e s s f u l l y i n t r o d u c e d into E S c e l l s and independent c l o n e s w e r e generated after g r o w t h i n selective m e d i a . I n order to  116  identify clones w i t h c o - i n t e g r a t i o n o f the C D 1 l b - L a c Z , w h i c h does not i n c l u d e a selection cassette, S o u t h e r n b l o t analysis w a s p e r f o r m e d as s h o w n i n figure 4.17. 7 o f 14 E S clones that h a d s u r v i v e d a n t i b i o t i c s e l e c t i o n a n d therefore had integrated the C D 1 l b I D U A - N e o construct were f o u n d to have integrated the C D 1 l b - L a c Z reporter construct.  5.7 kb.  F i g u r e 4 . 1 7 : C D l l b - L a c Z r e p o r t e r c o n s t r u c t i n t e g r a t e s i n t o E S c l o n e s after c o e l e c t r o p o r a t i o n w i t h the C D l l b - I D U A - N e o c o n s t r u c t E c o R I Southern b l o t p r o b e d w i t h L a c Z fragment. P o s i t i v e bands expected at 5.7 k b . 5 o f 14 c l o n e s have co-integrated the C D 1 l b - L a c Z construct.  E S c e l l s that had been electroporated w i t h the p C A G G s - I D U A construct were screened i n i t i a l l y for reporter gene e x p r e s s i o n b y staining for beta-galactosidase a c t i v i t y . C l o n e s s h o w e d a w i d e range o f beta-galactosidase intensity s h o w n representatively i n figure 4.18.  117  F i g u r e 4.18: R e p r e s e n t a t i o n o f E S clones screened f o r beta-galactosidase s t a i n i n g intensity E S clones g r o w n to c o n f l u e n c y i n 96 w e l l plates were f i x e d and stained for betagalactosidase a c t i v i t y .  R e p o r t e r gene e x p r e s s i o n , i n d i c a t i v e o f the e x p r e s s i o n o f I D U A expressed o n the same transgene p o l y c i s t r o n i c m R N A , was h i g h l y v a r i a b l e between different E S clones. T h e nature o f this v a r i a b i l i t y i n c l u d e d differences i n staining intensity between different c l o n e s , a n d also differences i n staining intensity amongst c l o n a l c e l l s w i t h i n a single w e l l . C l o n e s w i t h h i g h l e v e l , consistent beta-galactosidase staining were chosen. A second screen w a s p e r f o r m e d d e t e r m i n i n g a p p r o x i m a t e I D U A e n z y m e s p e c i f i c a c t i v i t y l e v e l s , n o r m a l i z e d to total p r o t e i n content.  p C A G G s - I D U A E S clones were determined to s h o w  h i g h l e v e l s over non-transfected c o n t r o l E S c e l l s and E S clones transfected w i t h the C D 1 l b - I D U A construct (data not s h o w n ) . A h i g h degree o f c o r r e l a t i o n was found b e t w e e n the intensity o f beta-galactosidase e x p r e s s i o n and I D U A e n z y m e s p e c i f i c activity level.  Blastocyst injection of engineered E S lines M u l t i p l e blastocyst injections o f v a r i o u s constructs was p e r f o r m e d as s h o w n i n T a b l e 4.2  118  Number of Construct  Clone ID  blastocysts injected  Chimeras produced  Percent c h i m e r s i m  pCAGGs-IDUA 2C  -26  2  5%, 5%  IG  11  0  -  2D  14  0  -  12B  -26  1  6 0 % , but female  2E  -13  1  5%  2H  -13  2  5%, 5%  6  -100  6  low  CD11B-IDUA andCDllb-LacZ  Totals:  Table 4.2: Blastocyst injection of engineered E S clones produces only low level chimeras A total o f 103 blastocysts w e r e injected w i t h 6 different c h a r a c t e r i z e d E S lines transgene p o s i t i v e for the C D 1 l b constructs or the p C A G G s - I D U A construct. 3 c h i m e r a s were p r o d u c e d for each type o f transgene. A l l c h i m e r a s were v e r y l o w l e v e l w i t h the e x c e p t i o n o f a female c h i m e r a generated f r o m l i n e p C A G G s - I D U A 1 2 B . H o w e v e r the R l E S l i n e used is m a l e i n d i c a t i n g this c h i m e r a c o u l d not be capable o f g e r m l i n e transgene t r a n s m i s s i o n .  119  4.3 D i s c u s s i o n N o c h i m e r a s capable o f g e r m l i n e t r a n s m i s s i o n o f either the C D 1 l b - I D U A or the p C A G G s - I D U A transgene constructs were generated after i n j e c t i o n o f 100 blastocysts. O n l y l o w l e v e l (5%) c h i m e r a s w e r e p r o d u c e d i n o n l y 5 c h i m e r a s generated, w i t h the e x c e p t i o n o f a h i g h e r l e v e l ( 6 0 % ) but female c h i m e r a . T h e reason for the l o w n u m b e r o f c h i m e r a s p r o d u c e d , and the l o w l e v e l o f c h i m e r i s m observed, is u n k n o w n . P o s s i b i l i t i e s for this o u t c o m e i n c l u d e alterations to the E S c l o n e s r e n d e r i n g t h e m l i m i t e d i n their a b i l i t y to constitute adult tissues, a constant c o n c e r n w i t h E S c e l l culture. T e c h n i c a l barriers c o u l d also p l a y a part. A l t e r n a t i v e l y , the i n a b i l i t y to generate h i g h l e v e l c h i m e r a s a n d g e r m l i n e t r a n s m i s s i o n after n u m e r o u s attempts c o u l d reflect a b i o l o g i c a l effect o f transgene e x p r e s s i o n . In order to generate m o u s e lines w h i c h c o u l d express transgenic h u m a n I D U A , I chose to use a c o n d i t i o n a l transgene e x p r e s s i o n a p p r o a c h w h i c h w o u l d a l l o w c o n t r o l o f the t i m i n g , and l o c a t i o n , o f transgene e x p r e s s i o n . T h i s is d e s c r i b e d i n chapter 5.  120  Chapter 5: Conditional transgenic expression of human alpha-L-iduronidase in a murine model to establish effective and tolerable limits for gene therapy for M P S I  121  5.1 I n t r o d u c t i o n  T h i s chapter describes the successful generation o f t w o m u r i n e lines o f a c o n d i t i o n a l transgenic m o u s e w i t h the potential for e x p r e s s i o n o f h u m a n I D U A e n z y m e . These lines are d e s i g n e d to m o d e l , i n c o n j u n c t i o n w i t h the I D U A deficient m o u s e l i n e d e s c r i b e d i n C h a p t e r 3, gene therapy approaches for M P S I. A s d e s c r i b e d i n C h a p t e r 4, n u m e r o u s attempts to generate m u r i n e strains o v e r - e x p r e s s i n g I D U A , f r o m the h u m a n I D U A c D N A , w e r e not successful. A s p r o n u c l e a r i n j e c t i o n leads to v a r i a b l e l e v e l s o f transgene p o s i t i v e founder m i c e and is dependant o n operator s k i l l and experience, it is p o s s i b l e that b y chance n o transgene constructs were integrated into injected n u c l e i . It is also p o s s i b l e that screening o f founder m i c e c o u l d have m i s s e d transgene p o s i t i v e founders. A n a p p r o a c h u s i n g e m b r y o n i c stem c e l l s , i n w h i c h engineered, p a r t i a l l y d e f i n e d c e l l s are u s e d i n the generation o f c h i m e r i c m i c e , w a s then e m p l o y e d as this m i g h t a l l o w for d e v e l o p m e n t o f transgene c a r r y i n g c h i m e r a s , a n d a l l o w s for repeated attempts w i t h c l o n a l c e l l s . H o w e v e r o n l y l o w l e v e l chimeras were generated and n o g e r m l i n e transmissable m i c e w e r e i d e n t i f i e d . T h i s suggests that the e x p r e s s i o n o f the transgene, h u m a n I D U A , m i g h t be deleterious to n o r m a l d e v e l o p m e n t . T o e x p l o r e this p o s s i b i l i t y , a n d t o w a r d s generation o f I D U A e x p r e s s i n g m i c e for use i n transplantation a n d as m o d e l s o f gene therapy, a c o n d i t i o n a l transgene system w a s e m p l o y e d . T h i s a p p r o a c h w o u l d a l l o w selective I D U A transgene e x p r e s s i o n a v o i d i n g d e v e l o p m e n t a l transgene i n d u c e d bottlenecks, s h o u l d they exist.  W i t h this c o n d i t i o n a l system, transgenic  e x p r e s s i o n o f I D U A c a n be regulated b o t h spatially and t e m p o r a l l y , and is c o n t r o l l e d b y C r e m e d i a t e d r e c o m b i n a t i o n . T h e therapeutic benefit o f selective I D U A e x p r e s s i o n c o u l d  122  be assessed w i t h strategic b r e e d i n g into the I D U A deficient M P S I m o u s e m o d e l , and a m o u s e l i n e e x p r e s s i n g C r e r e c o m b i n a s e . T h u s the t w o objectives o f C h a p t e r 4, the generation o f a m o d e l o f in utero bone transplantation, and the generation o f a m o d e l w i t h w i d e s p r e a d or u b i q u i t o u s e x p r e s s i o n , c o u l d be a c h i e v e d w i t h a single i n i t i a l transgenic m o u s e . I n a d d i t i o n , the same m o u s e c o u l d be crossed w i t h other C r e e x p r e s s i n g m i c e testing I D U A s p e c i f i c e x p r e s s i o n i n v i r t u a l l y e v e r y tissue i m a g i n a b l e to address the o u t c o m e o f s p e c i f i c r e c o n s t i t u t i o n o n m u r i n e M P S I.  5.1.1 Conditional transgene regulation systems T h e i n a b i l i t y to generate transgenic m i c e lines e x p r e s s i n g h u m a n I D U A , either u b i q u i t o u s l y , or i n m a r r o w d e r i v e d c e l l s , raised the p o s s i b i l i t y that I D U A o v e r e x p r e s s i o n i m p a i r e d d e v e l o p m e n t . I n order to create a m o u s e that h a d the potential for  IDUA  e x p r e s s i o n but was i n i t i a l l y c a r r y i n g a silent v e r s i o n o f the I D U A transgene, a c o n d i t i o n a l transgenic a p p r o a c h w a s u s e d that w o u l d a l l o w r e g u l a t i o n o f the a c t i v a t i o n o f I D U A transgene  expression  and  hopefully  avoid  possible  developmental  bottlenecks.  C o n d i t i o n a l c o n t r o l o f transgene e x p r e s s i o n a l l o w s for r e g u l a t i o n o f the l o c a t i o n and t i m i n g o f transgene e x p r e s s i o n . C o n d i t i o n a l c o n t r o l is r e q u i r e d w h e n one wants to study the f u n c t i o n o f a gene w h i c h is deleterious to n o r m a l d e v e l o p m e n t , as c o u l d be the case w i t h I D U A e x p r e s s i o n , and to address the b i o l o g i c a l functions o f a gene p r o d u c t i n a specific e n v i r o n m e n t , the m a i n objective o f the generation o f transgenic lines e x p r e s s i n g I D U A . S p e c i f i c a l l y , c r o s s i n g o f s e l e c t i v e l y activated I D U A e x p r e s s i n g lines into the Idua -I- deficient b a c k g r o u n d b y transplantation, or m a t i n g , to address the benefit o f c e l l specific I D U A r e c o n s t i t u t i o n o n the phenotype o f m u r i n e M P S I. C o n d i t i o n a l c o n t r o l i d e a l l y i n v o l v e s l o w or zero basal transgene e x p r e s s i o n w h e n " o f f , and h i g h l e v e l s o f  123  gene e x p r e s s i o n w h e n " o n " . T h e c o n d i t i o n a l system s h o u l d be s p e c i f i c to the transgene a n d not alter general m e t a b o l i s m . T w o fundamentally different approaches to c o n d i t i o n a l gene r e g u l a t i o n have been established. B o t h approaches are based o n t w o c o m p o n e n t s : a n effector transgene that acts o n a target transgene, i n a so c a l l e d b i n a r y transgene system. These systems i n v o l v e m a t i n g a n effector l i n e w i t h a l i n e c a r r y i n g the target transgene, p r o d u c i n g d o u b l e transgenic o f f s p r i n g w i t h the potential for target transgene e x p r e s s i o n . In one approach, exemplified  by  transactivator  the  T e t R transactivator  w h i c h transactivates  system,  the  effector  transgene  encodes  a  transcription o f the target transgene ( G o s s e n a n d  B u j a r d , 1992). I n t r o d u c t i o n o f d o x y c y c l i n e (dox) or other i n d u c e r regulates the b i n d i n g o f the  transactivator  to the  operator  o f the  system,  a l l o w i n g for r e g u l a t i o n o f gene  e x p r e s s i o n i n c l u d i n g gene a c t i v a t i o n or repression. T h e T e t R transactivator a p p r o a c h has been u s e d successfully in vivo to regulate genes i n a v a r i e t y o f w a y s . approach, the  effector  transgene encodes  a recombinase  I n the s e c o n d  s u c h as C r e or F L P that  s p e c i f i c a l l y rearranges target sequences to regulate gene e x p r e s s i o n .  The  differences  b e t w e e n these approaches m a k e t h e m suited for different situations. T r a n s c r i p t i o n a l transactivation has t w o m a i n advantages over based r e g u l a t i o n .  recombination  F i r s t , e x p r e s s i o n o f the target gene is reversible, a l l o w i n g for the  transient e x p r e s s i o n o f a transgene. S e c o n d , v a r i a b l e l e v e l s o f target transgene e x p r e s s i o n c a n be obtained b y r e g u l a t i n g i n d u c e r concentration.  H o w e v e r , transactivation  suffers  f r o m v a r i a b l e l e v e l s o f b a c k g r o u n d e x p r e s s i o n , r e d u c i n g their u t i l i t y for the r e g u l a t i o n o f deleterious transgenes. R e c o m b i n a t i o n based r e g u l a t i o n , w i t h its i r r e v e r s i b i l i t y , is suited for tissue s p e c i f i c k n o c k o u t s , for c e l l - l i n e a g e a n a l y s i s , and for permanent gene a c t i v a t i o n .  124  M y objective w a s to generate a m o u s e l i n e i n w h i c h I D U A e x p r e s s i o n c o u l d be i n d u c e d i n s p e c i f i c tissues and at s p e c i f i c times. T h e i r r e v e r s i b i l i t y o f the r e c o m b i n a t i o n approach was acceptable, and a n important benefit o f the r e c o m b i n a t i o n a p p r o a c h is the non-existent basal e x p r e s s i o n before r e c o m b i n a t i o n . M o s t i m p o r t a n t l y , m a n y m i c e strains e x p r e s s i n g tissue  specific C r e r e c o m b i n a s e  have been generated,  providing a wide  s e l e c t i o n o f a c t i v a t i n g m i c e , as s h o w n i n table 5.1.  E x p r e s s i o n pattern  Promoter  Reference  etal,  u b i q u i t o u s early  PGK  Lallemand  myeloid cells  endogenous M l y s o z y m e  Clausen  liver  albumin  Postic  chondrocytes  c o l l a g e n type II  S a k a i e r a l , 2001  smooth muscle  smooth muscle m y o s i n heavy chain  X i n e t a l , 2002  mid/hindbrain  En2  Zinyk  pancreatic beta-cells  Ins2  Herrera e t a l . , 2000  etal,  etal,  etal,  1998  1999  1999  1998  T a b l e 5.1: Representative C r e expressing mice  T h i s a l l o w s for analysis o f e x p r e s s i o n i n m a n y different tissues at v a r i o u s stages of development.  A s s h o w n i n table 5.1, a m o u s e strain e x p r e s s i n g C r e i n m y e l o i d c e l l s ,  s i m i l a r to the e x p r e s s i o n pattern o f the C D 1 l b p r o m o t e r a n d useful for assessment o f the potential o f bone m a r r o w transplantation for M P S I, has been generated and c o n f i r m e d to express  C r e preferentially  characterized  and  in myeloid  potentially  useful  lineage are  mice  cells (Clausen e t a l , strains  expressing  1999). Cre  in  Also liver,  c h o n d r o c y t e s , o r u b i q u i t o u s l y ( P o s t i c et al, 1999, S a k a i et al, 2 0 0 1 , L a l l e m a n d et al, 1998). W i t h suitable r e c o m b i n a t i o n sites a n d other D N A elements, a single transgenic l i n e c o u l d be d e s i g n e d w i t h u b i q u i t o u s potential for e x p r e s s i o n o f h u m a n  IDUA,  regulated b y the e x p r e s s i o n pattern o f C r e . T h i s one l i n e w o u l d t h e n be u s e d to address a n u m b e r o f b i o l o g i c a l questions t h r o u g h differential C r e m e d i a t e d a c t i v a t i o n , i n c l u d i n g a c t i n g as a source o f e x p r e s s i n g c e l l s for transplantation experiments into the Idua -/mouse  l i n e , as a genetic m o d e l o f tissue  specific  IDUA  e x p r e s s i o n for b r e e d i n g  experiments w i t h the Idua -I- l i n e , a n d to determine the phenotype o f I D U A e x p r e s s i o n during development. Two cells,  r e c o m b i n a s e s have been u s e d for g e n o m i c m a n i p u l a t i o n s i n m a m m a l i a n  C r e from  bacteriophage  PI  (Sauer  and  Henderson,  1989)  and  FLP  from  Saccharomyces cerivisiae ( O ' G o r m a n et al, 1991). T h e a v a i l a b i l i t y o f different C r e e x p r e s s i n g m i c e as activators m a k e s the C r e / L o x P s y s t e m o f r e c o m b i n a t i o n m o r e suitable to this project a n d w i l l be d i s c u s s e d further. T h e C r e r e c o m b i n a s e o f P I bacteriophage is a 38 k D p r o t e i n that b e l o n g s to the integrase f a m i l y o f site-specific r e c o m b i n a s e s . A s d e p i c t e d i n figure 5.1, C r e r e c o m b i n a s e mediates r e c o m b i n a t i o n b e t w e e n t w o o f its r e c o g n i t i o n sites, l o x P sites, w h i c h consists o f a 34 basepair (bp) consensus D N A r e c o g n i t i o n sequence c o n s i s t i n g o f a core sequence o f 8 bp a n d t w o 13 b p f l a n k i n g p a l i n d r o m i c sequences ( H a m i l t o n a n d A b r e m s k i , 1984). T h e a s y m m e t r i c core sequence defines a n orientation to the l o x P site, a n d regions f l a n k e d b y t w o l o x P sites w i t h the same  orientation  undergo  deletion  of  the  flanked  region  upon  Cre  mediated  r e c o m b i n a t i o n w h i l e l o x P sites f a c i n g each other l e a d to i n v e r s i o n o f the i n t e r v e n i n g  126  region.  T h e f u n c t i o n o f C r e i n the bacteriophage P I life c y c l e is to ensure the phage  g e n o m e exists as a m o n o m e r i c p l a s m i d w i t h i n the bacteriophage, E . c o l i , as concatomers o f the phage g e n o m e c o u l d result i n loss o f the phage g e n o m e u p o n c e l l r e p l i c a t i o n . T h e C r e r e c o m b i n a s e is also active i n m a m m a l i a n c e l l s (Sauer a n d H e n d e r s o n , 1988), a n d in vivo i n transgenic m i c e ( L a s k o et ah, 1992), i n c l u d i n g i n p o s t m i t o t i c c e l l s l i k e neurons and T cells ( G o r m a n and B u l l o c k , 2000).  It is important that the C r e r e c o m b i n a s e not  result i n l o n g t e r m i n s t a b i l i t y i n the m o u s e g e n o m e for it to be useful i n transgenic 18  studies. A r a n d o m occurrence o f a specific 34 b p sequence requires a 1 X 10  bp length  o f D N A , w h i l e the entire m a m m a l i a n g e n o m e is o n l y 3 X 1 0 b p , m a k i n g it u n l i k e l y the 9  34 bp l o x P site w o u l d be encountered i n the m a m m a l i a n g e n o m e ( N a g y 2 0 0 0 ) .  127  ATAACTTCGTATAATGTATGCTATACGAAGTTAT  Figure 5.1: Cre/loxP recombination A ) T h e 3 4 bp l o x P site ( b l a c k a r r o w , u n d e r l y i n g sequence), consists o f a n 8 bp d i r e c t i o n a l core element (underlined) f l a n k e d b y t w o p a l i n d r o m i c 13 b p sequences. B ) A representative target r e g i o n , w h i c h has b e e n engineered to i n c l u d e t w o l o x P sites ( b l a c k arrows) f l a n k i n g a r e g i o n for potential r e m o v a l . C ) Introduction o f C r e r e c o m b i n a s e w h i c h , as d i m e r s , b i n d s to the l o x P sites and mediates r e c o m b i n a t i o n between t h e m . D ) T h e products o f r e c o m b i n a t i o n are the o r i g i n a l target r e g i o n m i n u s the r e g i o n f l a n k e d b y l o x P sites a n d a n independent D N A element c o n t a i n i n g the f l a n k e d r e g i o n , w h i c h is degraded. F o r tissue s p e c i f i c k n o c k o u t s , r e g i o n B represents an e x o n o f a gene f l a n k e d b y l o x P sites located i n adjacent introns. F o r c o n d i t i o n a l gene a c t i v a t i o n d e s c r i b e d i n this project, r e g i o n B represents a strong transcription stop s i g n a l ( p o l y a d e n y l a t i o n signal) r e m o v a l o f w h i c h a l l o w s e x p r e s s i o n o f r e g i o n C , the h u m a n I D U A c D N A transgene. T h e s p e c i f i c i t y o f the p r o m o t e r d r i v i n g C r e dictates the a c t i v a t i o n o f e x p r e s s i o n o f h u m a n I D U A . T S P = t i s s u e specific promoter.  128  T h e C r e / l o x P system has been used to mediate r e c o m b i n a t i o n in vitro a n d in vivo that i n c l u d e the a c t i v a t i o n o r i n a c t i v a t i o n o f a gene ( L e w a n d o s k i , 2 0 0 1 ) , translocations ( M e d b e r r y et al., 1995), a n d i n v e r s i o n s ( M o l e t e et al., 2 0 0 1 ) . T h i s l e v e l o f r e g u l a t i o n o f c o n t r o l c a n be c o m b i n e d w i t h the transactivator c o n t r o l elements d e s c r i b e d earlier to further c o n t r o l the onset a n d l o c a t i o n o f transgene e x p r e s s i o n . F o r the purpose o f this study, c o n d i t i o n a l gene a c t i v a t i o n w a s desired s u c h that C r e r e c o m b i n a t i o n w o u l d a l l o w e x p r e s s i o n o f h u m a n I D U A . A construct w i t h most o f the desired elements h a d already b e e n described, w h i c h w h e n u s e d w i t h a n E S c e l l approach, generated m o u s e lines suitable for the a n a l y s i s o f C r e e x p r e s s i n g m i c e . These reporter m i c e l i n e s , Z / A P a n d Z / E G , are d e s i g n e d s u c h that C r e m e d i a t e d r e c o m b i n a t i o n causes a s w i t c h f r o m the e x p r e s s i o n o f the l a c Z gene to a l k a l i n e phosphatase or green fluorescent p r o t e i n , r e s p e c t i v e l y ( L o b e et al., 1999, a n d N o v a k et al., 2 0 0 0 ) . These reporter m i c e lines are crossed into lines expressing C r e r e c o m b i n a s e for d e t e r m i n a t i o n o f the C r e p r o m o t e r e x p r e s s i o n pattern. W i t h the a d d i t i o n o f a n internal r i b o s o m e entry site ( I R E S ) a l l o w i n g for the p r o d u c t i o n o f d i c i s t r o n i c transcripts ( M o u n t f o r d et al., 1994), the t r a n s c r i p t i o n o f the I D U A transgene c o u l d be l i n k e d to the e x p r e s s i o n o f a reporter i n a s y s t e m a l l o w i n g for tissue s p e c i f i c e x p r e s s i o n o f h u m a n I D U A a n d m o n i t o r i n g o f the state o f I D U A e x p r e s s i o n w i t h a d u a l reporter s y s t e m i n d i c a t i n g b o t h o n a n d o f f states o f I D U A e x p r e s s i o n . A s d e p i c t e d i n figure 5.1, b y f l a n k i n g a stop s i g n a l , i n the f o r m o f a p o l y a d e n y l a t i o n s i g n a l , w i t h l o x P sites, the e x p r e s s i o n o f d o w n s t r e a m elements c a n be regulated b y the s p e c i f i c e x p r e s s i o n o f C r e r e c o m b i n a s e . T h i s forms the basis o f the successful generation o f a c o n d i t i o n a l transgenic m o u s e l i n e w i t h the potential for tissue specific e x p r e s s i o n o f h u m a n I D U A .  129  5.1.3 E x p e r i m e n t a l A p p r o a c h T h e e m b r y o n i c stem c e l l approach to the generation o f transgenic m i c e offers the advantage o f selecting c e l l c l o n e s w i t h rare, d e s i r e d e x p r e s s i o n characteristics at the l e v e l o f c e l l culture. A s d i s c u s s e d p r e v i o u s l y , the generation o f transgenic m i c e w i t h s p e c i f i c e x p r e s s i o n patterns c a n be p r o b l e m a t i c w i t h the t r a d i t i o n a l p r o n u c l e a r approach.  Critical  to this project w a s the a b i l i t y to express h u m a n I D U A , as w e l l as a reporter gene, i n as m a n y or i d e a l l y a l l tissues o f d e v e l o p i n g and adult m i c e . A s demonstrated b y L o b e et al., e x a m i n a t i o n o f the transgene e x p r e s s i o n characteristics o f e m b r y o n i c stem c e l l s a l l o w s for the i s o l a t i o n o f clones m o r e l i k e l y to g i v e desired l o n g t e r m transgene e x p r e s s i o n w h e n used to p r o d u c e transgenic m o u s e lines ( L o b e et al., 1999). B y u s i n g a p r o m o t e r active i n e m b r y o n i c stem c e l l s , d i r e c t i n g the e x p r e s s i o n o f a reporter gene, i n d i v i d u a l clones w i t h h i g h or l o w l e v e l transgene e x p r e s s i o n c a n be i d e n t i f i e d . F u r t h e r m o r e , c l o n a l p o p u l a t i o n s w i t h consistent e x p r e s s i o n patterns c a n be identified. W h i l e it m i g h t be expected that a l l g e n e t i c a l l y i d e n t i c a l c e l l s i n a c l o n a l p o p u l a t i o n w o u l d express transgenes i n the same manner, i n practice, a n d as d e s c r i b e d i n chapter 4, this is not the case. I n fact i d e n t i c a l insertions c a n l e a d to differences i n transgene e x p r e s s i o n w i t h i n g e n e t i c a l l y i d e n t i c a l , c l o n a l p o p u l a t i o n s o f c e l l s . T h i s c o u l d be due to integration into a r e g i o n subject to v a r i a b l e e x p r e s s i o n , s u c h as a c e l l c y c l e related gene, a n d indicates that the p r o m o t e r elements used i n this study are not sufficient to insulate e x p r e s s i o n o f the transgene construct f r o m r e g i o n a l t r a n s c r i p t i o n influences. G i v e n this, those integrations that g i v e strong, consistent (i.e. a l l c e l l s i n the p o p u l a t i o n ) are c h o s e n for the generation o f m o u s e l i n e s . T h e e m b r y o n i c stem c e l l a p p r o a c h also a l l o w s for the m o l e c u l a r analysis  130  o f c l o n e s ; that is, representative c e l l s c a n be g e n e t i c a l l y a n a l y z e d w h i l e c l o n a l c e l l s are s t i l l a v a i l a b l e for m o u s e generation. R e l e v a n t to the use o f the C r e / L o x s y s t e m is the n u m b e r and pattern o f transgene integrations, as w e l l as the n u m b e r o f integration sites throughout the genome, that are present i n a c l o n e that is transgene p o s i t i v e as i d e n t i f i e d b y a n t i b i o t i c selection and or reporter gene e x p r e s s i o n . A s t a n d e m integrations, or independent integrations i n the same c e l l but o n different c h r o m o s o m e s , c a n result i n u n d e s i r e d r e c o m b i n a t i o n events between l o x sites or b r e e d i n g difficulties, S o u t h e r n b l o t a n a l y s i s o f clones c a n be p e r f o r m e d to identify c l o n e s w i t h single site, single n u m b e r transgene construct integrations. It is also p o s s i b l e to p r e m a t u r e l y r e c o m b i n e representative samples o f c e l l clones to c o n f i r m that a c l o n e has the a b i l i t y to express the r e c o m b i n e d transgenes, i n this case h u m a n I D U A and h u m a n a l k a l i n e phosphatase. F i g u r e 5.2 is a s c h e m a t i c o f the s e l e c t i o n a n d screens that were i n i t i a l l y p l a n n e d for the i d e n t i f i c a t i o n o f desired e m b r y o n i c stem c e l l c l o n e s . A n t i b i o t i c resistance i s e n c o d e d b y the transgene construct, so that huge e n r i c h m e n t for clones w i t h integrated constructs o c c u r s after 8 days o f g r o w t h i n s e l e c t i o n m e d i a . L a c Z e x p r e s s i o n i s a n a l y z e d i n clones for intensity, as w e l l as c o n s i s t e n c y . S i n g l e integrations at a s i n g l e l o c u s are desired, to s i m p l i f y later r e c o m b i n a t i o n a n d t r a n s m i s s i o n . T h e a b i l i t y o f c l o n e s to undergo successful r e c o m b i n a t i o n c a n be assessed v i a transfection o f C r e p l a s m i d , and scored b y s t a i n i n g for a l k phos e x p r e s s i o n and/or I D U A a c t i v i t y . Together, these screens are intended to e n r i c h for rare i n t e g r a t i o n events p r o m o t i n g l o n g t e r m transgene e x p r e s s i o n e v e n i n differentiated c e l l s types.  131  1. Does clone survive antibiotic selection ? YES  NO  Dies  2. Desirable L a c Z expression ? YES  NO  Discard  3. Single copy integration ? YES  NO  Discard  4. Successful recombination ? NO  Discard  YES  1 Desired clones for generation o f transgenic mice  Figure 5.2: Schematic of the selection and screening for desirable ES clones  Rather than c l o n e the desired elements for c o n d i t i o n a l C r e - m e d i a t e d r e g u l a t i o n a n d a reporter system for use i n E S c e l l s , I chose to use the p r o v e n Z / A P based constructs generated b y D r . C o r r i n n e L o b e ( L o b e e t a l . , 1999). T h e parent v e c t o r p C C A L L 2 - I R E S h A P / c g i s d e s c r i b e d i n figure 5.3. T h i s vector uses r e c o m b i n a t i o n to r e m o v e t r a n s c r i p t i o n stop signals that otherwise prevent e x p r e s s i o n o f d o w n s t r e a m genes. D r i v i n g e x p r e s s i o n o f this construct are the same elements f o u n d i n p C C A G , the C M V enhancer  132  SnaBI (!*7|  Figure 5.3: p C C A L L 2 - I R E S - h A P / c g parent construct  The C M V enhancer coupled with the chicken beta-actin promoter drive expression o f downstream elements. Flanked by loxP recombination sites is the beta-geo fusion gene encoding beta-galactosidase reporter expression (LacZ) and neomycin resistance (Neo), allowing for positive selection and transgene expression analysis i n E S culture. A l s o flanked by the loxP sites are 3 strong polyadenylation signals (3pA) which prevent further transcription, preventing expression o f any introduced transgenes and the second reporter gene, human alkaline phosphatase (hAlk phos). Introduction o f Cre removes the loxP flanked beta-geo and the 3 p A , allowing for expression o f introduced transgenes and the h A l k phos reporter. F r o m D r . Corrinne Lobe (Lobe et al., 1999).  and the promoter from the chicken b-actin gene. L o x P sites flank the beta-geo fusion gene, encoding beta-galactosidase and neomycin resistance, and three polyadenylation  133  A. p C C A L L 2 IRES H / A P -12.1 kilobases 3 polyadenylation signals I  LoxP  LoxP  I C  M  b-actin promoter  V  enhancer  alkaline IRES  Phosphatase  l—M  t  1  II Poly A signal  Beta-geo l a c Z and neo resist.  hIDUA cDNA B. p C C A L L - I D U A 14.2 kilobases  LoxP  LoxP  CMV  b-actin promoter  Beta-geo  hIDUA  Poly A  IRES  3 poly A signals  alk phos Cells are neomycin resistant  C. mRNA transcript before recombination  AAA A  LacZ positive No hIDUA or alkaline phosphatase expressed  F i g u r e 5.4: S c h e m a t i c o f the p C C A L L - I D U A c o n s t r u c t T h i s construct is d e s i g n e d to a l l o w c o n d i t i o n a l e x p r e s s i o n o f h u m a n I D U A as w e l l as reporter genes i n d i c a t i n g state o f r e c o m b i n a t i o n . A . E x p r e s s i o n o f the construct is d r i v e n b y the p C C A G promoter, w h i c h consists o f the C M V enhancer and c h i c k e n beta-actin promoter. I m m e d i a t e l y d o w n s t r e a m lies one o f t w o l o x P sites, then a selection and reporter gene cassette f o l l o w e d b y three copies o f the S V 4 0 p o l y a d e n y l a t i o n s i g n a l , and the s e c o n d f l a n k i n g l o x P site. T h e f l a n k i n g l o x P sites are used for C r e m e d i a t e d r e c o m b i n a t i o n , l e a d i n g to r e m o v a l o f the beta-geo selection cassette and the p o l y a d e n y l a t i o n sequences, a l l o w i n g for e x p r e s s i o n o f a transgene and the h u m a n p l a c e n t a l a l k a l i n e phosphatase reporter gene. B . T h e 2.1 k b h u m a n I D U A c D N A w i t h p o l y a d e n y l a t i o n sequence r e m o v e d w a s added to p C C A L L 2 to m a k e p C C A L L - I D U A . C . T h e i n i t i a l m R N A transcript before C r e m e d i a t e d r e c o m b i n a t i o n . N o h u m a n I D U A or a l k a l i n e phosphatase are expressed. L o x P = l o x P 34 bp r e c o m b i n a t i o n site w i t h i n d i c a t e d orientation, beta-geo=beta-galactosidase  and n e o m y c i n f u s i o n gene, a l k p h o s = h u m a n  a l k a l i n e phosphate gene, I R E S = i n t e r n a l r i b o s o m e entry site.  134  signals. A u n i q u e c l o n i n g site f o l l o w s the L o x P site, a l l o w i n g a d d i t i o n o f genes o f interest. N e x t , a n I R E S , or internal r i b o s o m e entry sequence, a l l o w s l i n k e d transcription o f genes o f interest a n d the a l k a l i n e phosphatase reporter gene. A rabbit p o l y a d e n y l a t i o n signal completes the construct. A schematic o f the construct, i n c l u d i n g the a d d i t i o n o f the h u m a n I D U A c D N A , is s h o w n i n figure 5.4. A s s h o w n , the u n r e c o m b i n e d construct p C C A L L - I D U A s h o u l d express beta-geo, a l l o w i n g for L a c Z reporter a n a l y s i s , but n o h u m a n I D U A , as the 3 p o l y a d e n y l a t i o n sites are intact. F i g u r e 5.5 describes the r e c o m b i n e d transgene construct, w i t h r e m o v a l o f the beta-geo cassette and 3 p o l y a d e n y l a t i o n signals, l e a d i n g to loss o f L a c Z e x p r e s s i o n a n d a l l o w i n g for e x p r e s s i o n o f d o w n s t r e a m h u m a n I D U A a n d the h u m a n a l k a l i n e phosphatase reporter gene. U s i n g the p C a l - I D U A construct, I h o p e d to generate a c o n d i t i o n a l C r e - r e g u l a t e d transgenic m o u s e l i n e w i t h the potential to express human I D U A .  135  LoxP  LoxP  hIDUA  Poly A  IRES  A. b-actin  3 poly A signals  CMV promoter enhancer A d d C r e r e c o m b i n a s e b y transfection or transduction o f C r e e n c o d i n g D N A ,  1  or b y b r e e d i n g into C r e e x p r e s s i n g m i c e .  B geo  B.  C.  hIDUA  D.  Alk phos  Poly A  mRNA transcript after Cre mediated recombination A l k phos  hIDUA  IRES  AAAA  Human IDUA and alkaline phosphatase expressed  F i g u r e 5.5: R e c o m b i n a t i o n a n d the e x p r e s s i o n o f h u m a n I D U A A ) the u n r e c o m b i n e d construct e x p r e s s i n g beta geo. B ) W i t h the a d d i t i o n o f C r e r e c o m b i n a s e , r e c o m b i n a t i o n occurs between the t w o l o x P sites and the beta geo cassette and the 3 p o l y a d e n y l a t i o n signals are lost. C ) T h e r e c o m b i n e d allele, w h i c h after r e m o v a l a n d degradation o f the r e g i o n e n c o d i n g the beta-geo f u s i o n gene and 3 strong p o l y a d e n y l a t i o n signals w h i c h functioned as a b l o c k to d o w n s t r e a m transcription. D ) A f t e r r e c o m b i n a t i o n the construct expresses h u m a n I D U A and the a l k a l i n e phosphatase reporter gene f r o m a s i n g l e transcript. L o x P = l o x p 3 4 bp site for r e c o m b i n a t i o n , I R E S = i n t e r n a l r i b o s o m e entry site.  136  5.2 R e s u l t s  T h e p C C A L L 2 - I R E S - h A P / c g parent construct w a s obtained i n p l a s m i d f o r m f r o m D r . C o r r i n n e L o b e ( L o b e et al., 1999). N u m e r o u s i n d i v i d u a l transformed c o l o n i e s were used to seed i n d i v i d u a l large v o l u m e cultures a n d large scale p l a s m i d isolations were p e r f o r m e d . A s s h o w n i n firgure 5.6, r e s t r i c t i o n d i g e s t i o n w i t h Pst 1 and B a m H I e n z y m e s , b o t h m u l t i p l e cutters i n the p C C A L L 2 - I R E S - h A P / c g construct, determined that a l l i n d i v i d u a l clones appeared i d e n t i c a l w i t h n o e v i d e n c e for rearrangement.  M  Pst I 1  2  3  4  Bam HI  -  1  2  3  4 4 —  B &mgmg$r  ZTZ.  •Ifflitil'Mr*'' |1HHJHK  •>* & •szx>m'  $tfitf|p  m^<*m< a—m  S  12 kb  — • ——  —  H H  « M » • — «"•** ^— 1.6 kb  ^— 1.0 kb <«— 0.5 kb  F i g u r e 5.6: R e a r r a n g e m e n t c h e c k o n p C C A L L 2 c o n s t r u c t . P s t I a n d B a m H I r e s t r i c t i o n e n z y m e s w e r e used to c o n f i r m that the a m p l i f i e d p r i m a r y construct w a s not rearranged after transfection a n d large scale p l a s m i d i s o l a t i o n . A l l 4 clones tested p r o d u c e d bands as p r e d i c t e d c o n f i r m i n g no rearrangements h a d o c c u r r e d . L a d d e r sizes are s h o w n o n the far right.  T h e i n t r o d u c t i o n o f the h u m a n I D U A c D N A w a s s i m p l e as a u n i q u e X h o 1 site is present i n the p C C A L L 2 - I R E S - h A P / c g construct d i r e c t l y upstream o f the internal r i b o s o m e entry site ( I R E S ) . A b l u n t e d f o r m o f the h u m a n I D U A c D N A w i t h no p o l y a d e n y l a t i o n s i g n a l  137  w a s i n t r o d u c e d to the X h o 1 opened, b l u n t e d p C C A L L 2 - I R £ S - h A P / c g construct, and transformed cultures w e r e screened for the I D U A c D N A b y P C R as s h o w n i n figure 5.7.  —  c £ C  U  u _>  re 0.  2  600  o  c c0  CM  •z c. u  re  's-  0  Crc C  a; u  Crc C  *Ua  _g o  .2 'C CO  CQ  •I S I P *^ *• »  *3  C c c  _re  tj  Crc C  c  u c  c u >  u  -c -C  c Q.  t i p  1000 500 b p  Figure 5.7: PCR detection of bacterial clones containing pCCALL2 ligated with the human IDUA cDNA. A p o s i t i v e P C R result u s i n g p r i m e r s i n e x o n 3 a n d 7 o f the h u m a n I D U A c D N A is expected to produce a b a n d o f 6 0 0 b p . 3 o f 4 c l o n e s tested were determined to c o n t a i n the I D U A c D N A , h o w e v e r orientation is u n k n o w n .  T o determine the orientation o f the I D U A c D N A , a Pst 1 d i g e s t i o n w a s p e r f o r m e d o n 8 P C R p o s i t i v e clones, as s h o w n i n figure 5.8. C l o n e s 1 and 2 appeared to have the I D U A insert i n the correct orientation. Further r e s t r i c t i o n analysis w a s performed w i t h A p a 1, H i n c II, a n d S p h I, as s h o w n i n figure 5.9. W h i l e clones 1 a n d 2 generate a l l the predicted bands for a p r o p e r l y oriented c l o n e w i t h a h u m a n I D U A c D N A insert u p o n restriction, c l o n e s 3 a n d 4, w i t h incorrect orientation, a n d n o insert, respectively, c l e a r l y d o not.  138  ra  —  ra 7.4 kb  *•  3.0 kb  •  1 2 3 4 5 6 7 8  ~ 12  kb  3kb 2kb  1.7 kb 1.2 kb  • 1 kb  0.63 kb  k-  0.5 kb  ft 1 2 F i g u r e 5.8: P s t I r e s t r i c t i o n d i g e s t o f p l a s m i d f r o m l i g a t i o n o f p C C A L L 2 c o n s t r u c t w i t h h u m a n I D U A c D N A to d e t e r m i n e o r i e n t a t i o n . I D U A c D N A c o n t a i n i n g bacterial clones were i d e n t i f i e d b y P C R specific to the I D U A c D N A . D e s i r e d orientation o f the c D N A w i t h i n the construct w a s predicted based o n sequence i n f o r m a t i o n to produce fragments after Pst I d i g e s t i o n o f 7 4 0 0 b p , 3 0 0 0 b p , 1700 b p , 1200 bp, 6 3 0 b p , a n d 188 bp. R e v e r s e orientation o f the I D U A c D N A was predicted to p r o d u c e fragments o f 7 4 0 0 bp, 2 1 0 0 bp, 2055 bp, 1700bp, 630 bp, and 188 bp. L a n e s 1 and 2 c o n t a i n clones w i t h apparent correct orientation. L a n e s 3 to 8 have inserts i n the incorrect orientation. Apa I L  1  2  Hinc II 3  4  |  l  2  3  Sph I 4  |  4 L •12kb .3kb • 2kb  0.5 kb  tt  tt  F i g u r e 5.9: R e s t r i c t i o n d i g e s t i o n to i d e n t i f y c l o n e s w i t h c o r r e c t l y i n s e r t e d a n d unrearranged h I D U A c D N A into p C C A L L 2 . C l o n e s 1 and 2 s h o w p r e d i c t e d correct r e s t r i c t i o n fragments after A p a I, H i n c II, and S p h I restriction d i g e s t i o n . L = l k b ladder.  139  T h e final p C C A L L - I D U A c l o n e , after restriction analysis w a s a m p l i f i e d a n d a large scale p l a s m i d i s o l a t i o n w a s performed. A final c h e c k o f the p C C A L L - I D U A p l a s m i d was p e r f o r m e d w i t h A p a 1, H i n c II, Pst I, and S p H l , as s h o w n i n figure 5.10, and no rearrangements were detected.  F i g u r e 5 . 1 0 : A n a l y s i s o f l a r g e scale p l a s m i d i s o l a t i o n o f p C C A L L - I D U A . R e s t r i c t i o n d i g e s t i o n was p e r f o r m e d to c o n f i r m the a m p l i f i e d construct contained no rearrangements. D i g e s t i o n w i t h A p a I, H i n c II, Pst I, and S p h I restriction e n z y m e s p r o d u c e d bands o f p r e d i c t e d s i z e .  T h e p C C A L L - I D U A p l a s m i d w a s electroporated into E S cultures, c e l l s w e r e plated at v e r y l o w density to p r o m o t e the f o r m a t i o n o f i n d i v i d u a l clones f r o m single c e l l s , and n e o m y c i n selection w a s c a r r i e d out for 8 days. I n d i v i d u a l c l o n e s were then p i c k e d a n d transferred to 96 w e l l plates for propagation, further analysis, and freezing. A r e p l i c a plate o f the c e l l s w a s analysed for L a c Z e x p r e s s i o n f r o m the beta-geo f u s i o n gene. F i g u r e  140  5.11 represents the variable nature o f L a c Z expression observed between different E S clones.  2-6B F i g u r e 5.11:  4-3E  4-7A  L a c Z staining o f E S colonies demonstrating expression v a r i a b i l i t y .  A s I found with the transgenic E S approach in chapter 4, genetically identical E S cells derived from single, transgene containing cells, and therefore clones, express variable levels o f the beta-galactosidase reporter gene. This is exemplified in figure 5.11. Clone 2 - 6 B shows strong consistent staining. Clone 4-3E is an example o f a clonal population o f cells expressing highly variable staining between individual cells, with some cells showing no or little staining while adjacent cells stain strongly. Clone 4-7A demonstrates a weak, but consistent staining clone. This visual screen allows detection o f clones hopefully more likely to express transgenes in a consistent manner after differentiation into different cell types in adult mice, and may differentiate clones with high (dark) transgene expression from clones with low (light) transgene expression. Note clones contain multiple cells types including persistent E S cells (small and round) and fibroblast type cells (large and flat). Clones with dark, and consistent, staining were identified, consolidated to new 96 well plates, and amplified.  141  N e x t , clones w i t h suitable L a c Z s t a i n i n g characteristics were a n a l y s e d b y S o u t h e r n b l o t t i n g to identify clones w i t h single integrations o f the p C C A L L - I D U A construct.  Eco RV site  probe  adjacent unknown genomic Eco RV site  genomic DNA //  «-/4  genomic DNA  Sea  •  Single Southern restriction band of unknown size  9  F i g u r e 5.12: S o u t h e r n b l o t i d e n t i f i c a t i o n o f E S c l o n e s c o n t a i n i n g s i n g l e c o p y integrations of p C C A L L - I D U A . X or p A = p o l y a d e n y l a t i o n site, P-geo= beta-galactosidase a n d n e o m y c i n f u s i o n protein.  It is important to identify single c o p y integrates as m u l t i p l e adjacent integrations m a y s h o w aberrant C r e m e d i a t e d r e c o m b i n a t i o n events. A s depicted i n figure 5.12, a n e n z y m e ( E c o R V ) cutting once w i t h i n the p C C A L L - I D U A construct w a s u s e d s u c h that single c o p y integrations w o u l d generate a single S o u t h e r n b a n d , o f u n k n o w n size and dependant o n a restriction site i n adjacent g e n o m i c D N A , after p r o b i n g w i t h a p o r t i o n o f the construct as s h o w n . M u l t i p l e t a n d e m c o p y integrations w i l l produce at least 2 bands after S o u t h e r n analysis, i n c l u d i n g one b a n d made up entirely o f repeated construct D N A , expected to be a p p r o x i m a t e l y 14.0 k b i n size for a head to t a i l integration, a n d one t e r m i n a l b a n d i n c l u d i n g adjacent c h r o m o s o m a l D N A . These clones are a v o i d e d . F i g u r e 5.13 s h o w s the results o f S o u t h e r n analysis o f transgene e x p r e s s i n g E S clones.  12kb  gigs  Q  w  _  _  _  _  _  Q<  tt  U  C  tu  C  X  ..  *»  .,.  «.  ,  iHSF  *-  ,  ^  -12kb  T  t  F i g u r e 5.13: S o u t h e r n b l o t a n a l y s i s o f 48 E S c l o n e s w i t h g o o d r e p o r t e r gene expression f o r single copy integrates. A f t e r E c o R V d i g e s t i o n , D N A f r o m E S clones w a s p r o b e d w i t h a fragment o f the p C C A L L - I D U A construct. E S c l o n e s w i t h single c o p y , single l o c u s integrations w i l l p r o d u c e single bands o f u n k n o w n size.  L a n e 1-1F, at the upper left h a n d corner o f figure 5.13, c l e a r l y s h o w s m u l t i p l e bands and is thus to be a v o i d e d . L a n e 1-2H is a n e x a m p l e o f a suitable c l o n e . A r r o w s identify E S clones 3-2F and 3 - 1 2 F , e v e n t u a l l y to b e c o m e m o u s e lines after f u l f i l l i n g further e x p r e s s i o n criteria. A l i n e indicates the a p p r o x i m a t e p o s i t i o n o f the 12 k b b a n d o f the 1 k b ladder. C l o n e s w i t h bands s l i g h t l y larger than the 12 k b size were a v o i d e d e v e n w i t h single bands as a repeat b a n d o f 14 k b size c o u l d be s u p e r i m p o s e d u p o n the unique b a n d . 2 0 o f 48 assessed clones were f o u n d to have m u l t i p l e integrations, partial integrations, or u n e x p l a i n a b l e or a m b i g u o u s integrations, and were d i s c a r d e d . It is clear u p o n e x a m i n a t i o n o f figure 5.13 that the c l o n e s 3 - 2 F and 3 - 1 2 F , w h i c h f i n a l l y p r o d u c e d  143  g e r m l i n e chimeras, are different clones. D u r i n g p i c k i n g o f E S clones, cross c o n t a m i n a t i o n o f clones c a n o c c u r as fragments o f a p i c k e d c l o n e drift and are i n c l u d e d w i t h other clones. D u r i n g propagation, one c l o n e m a y o u t g r o w c o - c u l t u r e d c e l l s l e a d i n g to single clones w i t h m u l t i p l e representation i n final a m p l i f i e d c l o n e l i n e s . I n figure 5.13, c l o n e 3-2F produces a m u c h larger restriction fragment as detected b y S o u t h e r n b l o t analysis than c l o n e 3 - 1 2 F . T h i s indicates that a l t h o u g h the clones w e r e p i c k e d i n c l o s e s u c c e s s i o n a n d p o s s i b l y f r o m the same plate, creating the potential for cross c o n t a m i n a t i o n , these clones sharing e x c e p t i o n a l L a c Z e x p r e s s i o n characteristics represent u n i q u e and distinct clones. A f t e r S o u t h e r n a n a l y s i s , clones that p r o v e d to have suitable L a c Z e x p r e s s i o n and c o n t a i n e d single c o p y integrations were e x p a n d e d for further analysis and to create l o w passage n u m b e r freezes suitable for c h i m e r a p r o d u c t i o n . A f t e r the e x p a n s i o n , samples o f each c l o n e were re-stained for L a c Z to determine the stability o f transgene e x p r e s s i o n o v e r t i m e . O f the top 12 c l o n e s after i n i t i a l L a c Z s t a i n i n g , s i n g l e c o p y a n a l y s i s , a n d e x p a n s i o n , 6 c l o n e s were f o u n d to have c h a n g e d their L a c Z s t a i n i n g properties. C l o n e s were transfected w i t h C r e p l a s m i d u s i n g l i p o f e c t a m i n e to determine i f they c o u l d r e c o m b i n e and express the h u m a n a l k a l i n e phosphatase p o r t i o n o f the construct. F i g u r e 5.14 demonstrates the result o f a partial C r e transfection, and demonstrates the b i n a r y nature o f r e c o m b i n a t i o n a l a c t i v a t i o n . A p p r o x i m a t e l y 8 0 % o f c l o n e s a n a l y z e d s h o w e d e v i d e n c e o f successful r e c o m b i n a t i o n .  144  F i g u r e 5.14: A l k a l i n e p h o s p h a t a s e s t a i n i n g o f ES cells c o n t a i n i n g s i n g l e c o p y integrations of p C C A L L - I D U A . O n the left, E S c e l l s unable to express A l k phos after b e i n g transduced w i t h a c t i v a t i n g C R E p l a s m i d . O n the right, a c l o n e w i t h i n d i v i d u a l a l k phos p o s i t i v e E S c e l l s c a n be seen. T h e absolute nature o f reporter gene expression, either o n or c o m p l e t e l y off, is e x e m p l i f i e d b y the i n d i v i d u a l strongly expressing c e l l s surrounded b y c e l l s that have not undergone C r e m e d i a t e d r e c o m b i n a t i o n .  M o r e than 50 E S clones, i n i t i a l l y identified for h a v i n g superior L a c Z staining, were a n a l y z e d for single c o p y integrations, a l k a l i n e phosphatase e x p r e s s i o n after r e c o m b i n a t i o n , and persistence o f transgene e x p r e s s i o n w i t h L a c Z after a m p l i f i c a t i o n . A f i n a l r a n k i n g o f the top 9 clones w a s generated, s h o w n i n table 5.1. N o t a l l clones w i t h excellent L a c Z staining characteristics were suitable for transgenic m o u s e generation, for e x a m p l e c l o n e 2 - 6 H , w i t h the best o v e r a l l staining, w a s not capable o f r e c o m b i n a t i o n i n the presence o f C r e , and w o u l d therefore never be able to express h u m a n I D U A i n adult m i c e . S h a d e d lanes m a r k the 2 E S clones, 3-2F a n d 3 - 1 2 F , that became m o u s e lines.  145  Clone ID  Percent Confluence  Percent LacZ positive  Consistency LacZ intensity  Southern single copy  A l k phos expression  Percent Persistent LacZ staining, ranking  1-2D  100  95  variable  yes  negative  90,5  1-2D  1-2H  100  92  good  yes  positive  90,6  1-2H  1-3D  75  90  variable  yes  positive  1-3D  1-4H  75  85  variable  yes  positive  1-4H  2-6A  50  90  excellent  unsure  positive  80,8  2-6A  6  2-6B  10  90  excellent  yes  positive  95,2  2-6B  1  2-6H  10  100  excellent  yes  negative  100,1  2-6H  2-8D  100  90  variable  yes  positive  2-12A  20  95  good  yes  positive  3-1H  50  90  good  no  positive  .3-21'  2D  98  excellent  yes  positive  3-8D  10  98  good  no  no cells  3-121  80  90  excellent  3-12G  20  80  good  no  positive  3-12G  3-12H  60  80  excellent  no  positive  3-12H  4-1C  100  90  good  yes  negative  4-1C  4-3D  50  80  good  no  positive  4-3D  4-3E  80  90  excellent  yes  positive  80,9  4-3E  7  4-4B  70  90  excellent  yes  positive  75, 10  4-4B  8  4-4H  20  90  good  yes  negative  70, 11  4-4H  4-5A  80  80  good  no  positive  4-7A  50  85  excellent  yes  positive  >^  positive  Clone ID  Overall rating  4  2-8D 90,4  2-12A  3  3-1H 95.3  3-21'  :  3-8D SO. 7  3-12F  5  4-5A 70, 12  4-7A  9  T a b l e 5.2: S u m m a r y o f E S clone analysis T h e 2 0 m o s t suitable lines as determined b y L a c Z staining w e r e r a n k e d for o v e r a l l suitability. A f i n a l r a n k i n g o f the top 9 c l o n e s f o r the generation o f transgenic m i c e w a s determined, far right. C l o n e s 3 - 2 F , a n d 3 - 1 2 F , successfully u s e d to generate transgenic m o u s e l i n e s , are shaded.  146  T h e p C A L - I D U A mouse lines. T w o distinct E S clones have been u s e d to generate m o u s e l i n e s : l i n e 3 - 1 2 F w a s generated b y blastocyst i n j e c t i o n o f E S c e l l s , and 3-2F generated b y the aggregation technique. B o t h lines were p r o d u c e d u s i n g the R l E S l i n e d e r i v e d f r o m a ( 1 2 9 / S v c p x 1 2 9 / S v J ) F l embryo. F o r the 3 - 2 F line, C D 1 blastocysts w e r e u s e d for the generation o f c h i m e r a s . T h e experiments u s i n g w i t h the 3-2F p C a l - I D U A l i n e were p e r f o r m e d b y D r . C o r r i n n e L o b e a n d staff. T h e C D 1 m o u s e strain is useful as they have red eyes and h i g h l e v e l c h i m e r a s can be i d e n t i f i e d b y their b l a c k eyes, e n c o d e d b y the 1 2 9 J a g o u t i l i n e , and eye c o l o r is evident right f r o m b i r t h i n contrast w i t h coat c o l o r selection used i n the t r a d i t i o n a l 1 2 9 J a g o u t i - C 5 7 B L / 6 b l a c k system. Suitable E S lines w i t h desired e x p r e s s i o n characteristics were t h a w e d and aggregated w i t h e i g h t - c e l l stage C D 1 m o u s e e m b r y o s (2.5 days post coitus), then transferred to pseudo-pregnant recipients to p r o d u c e c h i m e r i c m i c e ( N a g y , 1997). M a l e c h i m e r a s w e r e m a t e d w i t h C D 1 females to identify g e r m - l i n e transmitters. P u p s were g e n o t y p e d b y s t a i n i n g ear c l i p s for l a c Z e x p r e s s i o n ( L o b e et ah, 1999). T h e o f f s p r i n g generated f r o m this m a t i n g are exprected to be 5 0 % C D l / 5 0 % 1 2 9 S v c p / J ( R l E S c e l l s ) . A n i n b r e d l i n e w a s also generated, w h i c h i n v o l v e d b r e e d i n g the 3-2F c h i m e r a s w i t h 129 S V E V l i n e . F i n a l l y , the 3 - 2 F l i n e w a s m a t e d w i t h m i c e e x p r e s s i n g p C X - N L S Cre ( M a r and N a g y , unpublished), a ubiquitously expressing Cre mouse line w i t h zygote expression o f Cre.  T h i s system i n c l u d e s a C r e r e c o m b i n a s e e q u i p p e d w i t h a n u c l e a r  l o c a l i z a t i o n s i g n a l expressed b y the e x c e p t i o n a l l y strong C M V e n h a n c e r / c h i c k e n betaa c t i n p r o m o t e r c o m b i n a t i o n p C A G G ( N i w a et al., 1991).  147  These m i c e generated f r o m the 3 - 2 F E S l i n e a w a i t further characterization, h o w e v e r , n o o b v i o u s p h e n o t y p e w a s o b s e r v e d i n litters e x p e c t e d to c o n t a i n d o u b l e transgenic pups that s h o u l d express h u m a n I D U A . L i n e 3 - 1 2 F w a s p r o d u c e d u s i n g E S c e l l s and 3.5 day p o s t c o i t i s blastocysts f r o m C 5 7 B L / 6 m i c e at the C e n t r e for M o l e c u l a r M e d i c i n e and Therapeutics under the s u p e r v i s i o n o f D i a n a C a r l s o n . C h i m e r a s p o s i t i v e for L a c Z s t a i n i n g were then b r e d w i t h C 5 7 B L / 6 m i c e p r o d u c i n g a F l that i n c l u d e d pups p o s i t i v e for L a c Z s t a i n i n g w h i c h are a c o m b i n a t i o n o f 129J agouti a n d C 5 7 B L / 6 . T h e C r e l i n e u s e d for u b i q u i t o u s a c t i v a t i o n o f the 3 - 1 2 F p C a l I D U A l i n e is J a c k s o n stock # T g N ( h C M V - C r e ) 140 S a u h o m o z y g o t e s . T h i s strain contains a C r e r e c o m b i n a s e gene under the c o n t r o l o f a h u m a n c y t o m e g a l o v i r u s m i n i m a l promoter. T h i s p r o m o t e r directs w i d e s p r e a d t r a n s c r i p t i o n s u c h that C r e r e c o m b i n a s e is expressed i n a l l tissues. T h i s i n c l u d e s the g e r m l i n e tissues a n d gametes, a l l o w i n g for r e c o m b i n a t i o n i n f e r t i l i z e d zygotes s u c h that e v e r y c e l l o f the d e v e l o p i n g m o u s e contains a r e c o m b i n e d , activated c e l l e x p r e s s i n g I D U A . F i g u r e 5.15 s h o w s the generation o f m o u s e lines f r o m the p C a l - I D U A 3 - 1 2 F E S c l o n e . A f t e r E S i n j e c t i o n into blastocyts, a n d i m p l a n t a t i o n into surrogate mothers, 7 pups were b o r n , 4 o f w h i c h h a d a n a g o u t i coat a n d therefore were constituted b y the 129 J E S c e l l s . 3 o f the 4 were m a l e , consistent w i t h the m a l e gender o f the 129 J E S line, w h i l e one o f the c h i m e r a s was female and therefore u n l i k e l y to be capable o f g e r m l i n e t r a n s m i s s i o n o f the transgene. A l l 4 agouti pups were p o s i t i v e for L a c Z e x p r e s s i o n , i n d i c a t i n g the p C a l - I D U A construct w a s s u c c e s s f u l l y expressed. T w o independent c h i m e r a s s u c c e s s f u l l y transmitted the transgene to o f f s p r i n g w h e n b r e d into the b l / 6 strain. Transgene b e a r i n g o f f s p r i n g f r o m the b l / 6 a n d c h i m e r a , i d e n t i f i e d b y L a c Z  148  staining, w e r e then b r e d into the C M V - C r e m o u s e l i n e . A s the C M V - C r e m i c e are h o m o z y g o u s for the C M V - C r e transgene, h a l f the o f f s p r i n g w e r e expected to be d o u b l e transgenic, that is c o n t a i n i n g b o t h the p C a l - I D U A transgene as w e l l as the C M V - C r e transgene. T h e s e d o u b l e transgenic m i c e w e r e expected to express h u m a n I D U A , the h u m a n a l k a l i n e phosphate reporter, a n d to no l o n g e r express the L a c Z reporter gene. I n i t i a l a n a l y s i s o f ear n o t c h samples indicates the r e c o m b i n a t i o n is not c o m p l e t e i n any o f the d o u b l e transgenic pups, w i t h samples staining for b o t h L a c Z a n d a l k phos. T h e s e d o u b l e transgenic m i c e have n o o b v i o u s phenotype a n d a w a i t further characterization.  149  3-12F embryonic stem cell clone  Chimera #  4  1  5  A  A  I X  6  \\  pCal-Idua 3-12F  • CMV-Cre  Female  O  X  CH0  Legend Male  ^  • double transgenic  m  •  F i g u r e 5.15: O v e r a l l P e d i g r e e M o u s e l i n e s generated f r o m the p C a l - I D U A 3 - 1 2 F e m b r y o n i c stem c e l l c l o n e . C h i m e r a s w e r e b r e d w i t h b l / 6 m i c e to p r o d u c e a stable m o u s e strain. O f f s p r i n g o f the b l / 6 a n d c h i m e r a m a t i n g w e r e t h e n b r e d w i t h C M V - C r e m i c e to p r o d u c e d o u b l e transgenic offspring that s h o u l d express h u m a n I D U A a n d a l k a l i n e phosphatase i n a w i d e s p r e a d fashion f r o m an early stage o f d e v e l o p m e n t . T h e s e d o u b l e transgenic o f f s p r i n g are v i a b l e , and express h u m a n I D U A a n d the a l k a l i n e phosphatase reporter gene.  150  5.3 D i s c u s s i o n T h i s chapter describes the successful generation o f the p C a l - I D U A lines, transgenic m o u s e lines w i t h the potential to express h u m a n I D U A . I e m p l o y e d a c o n d i t i o n a l transgenic s y s t e m i n v o l v i n g C r e - m e d i a t e d a c t i v a t i o n , and a n a p p r o a c h i n v o l v i n g e m b r y o n i c stem cells, to generate m i c e i n w h i c h the e x p r e s s i o n o f h u m a n I D U A c o u l d be regulated b o t h spatially and t e m p o r a l l y . T h e C r e - L o x r e c o m b i n a t i o n system has n o w been used successfully for m a n y different m a n i p u l a t i o n s o f the m o u s e genome ( N a g y , 2 0 0 0 ) . T h e absolute nature o f transgene e x p r e s s i o n afforded b y the C r e - L o x system was e s p e c i a l l y useful for this w o r k , where it is important to be able to c o m p l e t e l y regulate I D U A e x p r e s s i o n , e s p e c i a l l y i n the u n - r e c o m b i n e d , " I D U A o f f state. I n a d d i t i o n , the a v a i l a b i l i t y o f w e l l characterized m o u s e strains e x p r e s s i n g tissue s p e c i f i c - C r e w i l l a l l o w m a n y s p e c i f i c questions about therapeutic i n t e r v e n t i o n for M P S I to be addressed w i t h the p C a l - I D U A strains. T h e e m b r y o n i c stem c e l l approach to the generation o f transgenic m i c e p r o v e d useful for this w o r k and p r o d u c e d lines w i t h the potential for adult transgene e x p r e s s i o n . T h e s m a l l n u m b e r o f E S clones d e e m e d suitable for the generation o f transgenic lines after m u l t i p l e screens, less than 5 % o f E S clones, h i g h l i g h t s the advantage o f this approach, w h i c h a l l o w s for the i d e n t i f i c a t i o n o f rare integrates p e r m i s s i v e to l o n g term, u b i q u i t o u s e x p r e s s i o n . I n practice, o n l y 6 o f 4 0 0 E S clones were d e e m e d to be h i g h l y desirable for m o u s e l i n e p r o d u c t i o n after 5 c r i t e r i a were met, as s h o w n i n figure 5.16. A p p r o x i m a t e l y 10 % o f p i c k e d E S clones s h o w e d i n i t i a l desirable L a c Z s t a i n i n g qualities. O f 48 clones assessed for single c o p y integrations, o n l y 50 % s h o w e d a c l e a r l y desired result. Repeated L a c Z s t a i n i n g after 3 further passages ( a p p r o x i m a t e l y 7 to 10  151  1.  Does clone survive antibiotic selection ? NO  YES  f  f  Dies  2. Desirable LacZ expression ? YES  NO ^90%  10%  10 % of picked clones v  3. Single copy integration ?  Discard  NO  60%  vj, 4 0 % Discard  Total: 0.1 X 0.6 = 6% of picked clones  YES v  4. Persistent LacZ expression ? NO  YES  vj, 5 0 %  50%  Total: 0.06 X 0.05 = 3% of picked clones  y  5. Successful recombination ?  Discard  NO  \f/ 20% Discard  YES 80%  A.  Desired clones for the generation of transgenic mice Total: 0.03 X 0.08 = 2.4% of picked clones  Figure 5.16: Schematic of the selection and screen for desired E S clones T h e percentage o f c e l l s d i s c a r d e d a n d saved i s s h o w n for e a c h screening l e v e l . O n the right, the r e m a i n i n g percentage o f E S c l o n e s d e e m e d suitable at that l e v e l o f screening. A f t e r n u m e r o u s screens less than 5 % o f r a n d o m l y p i c k e d E S clones s u r v i v i n g a n t i b i o t i c selection are deemed suitable for the generation o f transgenic m i c e .  152  days o f c o n t i n u o u s culture) s h o w e d 50 % o f c l o n e s under c o n s i d e r a t i o n h a d p r o f o u n d l y c h a n g e d L a c Z s t a i n i n g characteristics. T h e m a j o r i t y o f clones tested, 8 0 % , s h o w e d r e c o m b i n a t i o n potential as determined b y a l k a l i n e phosphatase staining. O v e r a l l , less than 5 % o f c l o n e s s u r v i v i n g antibiotic s e l e c t i o n were d e e m e d suitable for i n j e c t i o n into blastocysts t o w a r d s the generation o f transgenic m o u s e lines. A s p r o n u c l e a r i n j e c t i o n tends to p r o d u c e greater n u m b e r s o f m u l t i p l e integrations, it i s clear that generating m i c e w i t h u b i q u i t o u s e x p r e s s i o n potential b y p r o n u c l e a r i n j e c t i o n m i g h t require the p r o d u c t i o n a n d s c r e e n i n g o f hundreds o f m i c e . C l e a r l y the elements i n c l u d e d i n this transgenic construct are not sufficient to insulate the construct f r o m r e g i o n a l influences. I n fact, c l o n e s w i t h t r u l y s u p e r i o r transgene e x p r e s s i o n m a y not o n l y benefit f r o m integration into a p e r m i s s i v e site but, i n fact, a site subject to r e g i o n a l enhancers. T h u s the a n a l y s i s o f transgene e x p r e s s i o n at b o t h the E S a n d adult tissue l e v e l c o u l d be useful i n the i d e n t i f i c a t i o n o f regions i n the g e n o m e suitable for l o n g term h i g h l e v e l transgene e x p r e s s i o n . These regions c o u l d be useful i n the generation o f transgenic o r g a n i s m s , or i n gene therapy approaches. I n i t i a l results f r o m studies w i t h the p C a l - I D U A l i n e s indicate that, w h e n at least one o f the p C a l - I D U A transgenic lines is b r e d into a u b i q u i t o u s activator C r e l i n e , some o f the d o u b l e transgenic o f f s p r i n g undergo r e c o m b i n a t i o n r e s u l t i n g i n e x p r e s s i o n o f b o t h h u m a n I D U A a n d the reporter a l k a l i n e phosphatase. These p C a l - I D U A lines c a n be u s e d to express h u m a n I D U A s p e c i f i c a l l y i n a w i d e v a r i e t y o f tissues, b y m a t i n g w i t h m i c e e x p r e s s i n g C r e i n a tissue specific manner. T h u s b o t h the objectives o f chapter 4, n a m e l y the generation o f transgenic lines w i t h m a r r o w c e l l d e r i v e d I D U A e x p r e s s i o n , a n d u b i q u i t o u s I D U A e x p r e s s i o n , c a n be r e a l i z e d .  153  T r a n s g e n i c lines e x p r e s s i n g h u m a n I D U A i n m a r r o w d e r i v e d c e l l s , w h e n crossed into the I D U A deficient m o u s e l i n e , w i l l be useful i n d e t e r m i n i n g the m a x i m u m p o s s i b l e therapeutic benefit o f e x p r e s s i o n f r o m this c e l l lineage, a n d this c o m p o u n d transgenick n o c k o u t w i l l represent a genetic m o d e l o f in utero bone m a r r o w transplantation. T h e generation o f a m o u s e l i n e that expresses h i g h l e v e l s o f h u m a n I D U A i n a l l tissues w a s undertaken for t w o reasons. M o s t i m p o r t a n t l y , I w i s h e d to d e v e l o p a strain o f m i c e e x p r e s s i n g active h u m a n I D U A , as w e l l as a reporter gene, for use as a d o n o r strain i n transplantation experiments w i t h M P S I m i c e . T h e s e c o n d objective o f this project w a s to determine the o u t c o m e o f h i g h l e v e l , w i d e s p r e a d I D U A e x p r e s s i o n o n d e v e l o p m e n t . I D U A is n o r m a l l y expressed at v e r y l o w l e v e l s a n d the consequences o f a b n o r m a l l y h i g h l e v e l s o f I D U A a c t i v i t y are u n k n o w n . T h e i n i t i a l results d e s c r i b e d here indicate that at least m o s a i c e x p r e s s i o n o f h u m a n I D U A i s tolerated d u r i n g d e v e l o p m e n t a n d is not associated w i t h a n y o b v i o u s phenotype.  154  C h a p t e r 6 : S u m m a r y a n d conclusions  6.1 Characterization of the long term pathophysiology of murine M P S I C u r r e n t l y , there are no effective therapeutics that alter a l l o f the features o f l y s o s o m a l storage disorders. A s s u c h , severe M P S I is not presently curable, a l t h o u g h bone m a r r o w transplantation and e n z y m e replacement therapy offer p a r t i a l a m e l i o r a t i o n o f some disease s y m p t o m s . T h e means b y w h i c h i d u r o n i d a s e d e f i c i e n c y , a n d the r e s u l t i n g a c c u m u l a t i o n o f heparan and dermatan sulfate, leads to the detectable c l i n i c a l a b n o r m a l i t i e s i n M P S I are not f u l l y understood. It remains to be d e t e r m i n e d w h i c h features o f M P S I are i r r e v e r s i b l e a n d w h i c h features c a n be i m p r o v e d , w i t h therapy. I n a d d i t i o n , the i d e n t i f i c a t i o n o f the s p e c i f i c c e l l u l a r targets and c r i t i c a l t i m e p o i n t s for successful therapeutic i n t e r v e n t i o n are u n k n o w n . T h e generation o f a m o u s e m o d e l o f M P S I has a l l o w e d for s p e c i f i c questions about the p r o g r e s s i o n o f s y m p t o m d e v e l o p m e n t to be addressed i n a m a n n e r not p o s s i b l e i n h u m a n M P S I patients. Important f i n d i n g s d e s c r i b e d i n this thesis i n c l u d e the presence o f early p a t h o l o g y i n r e t i c u l o e n d o t h e l i a l c e l l s , g r o w t h plates o f bones, the presence o f secondary a c c u m u l a t i o n s o f substrates not d i r e c t l y l i n k e d to I D U A d e f i c i e n c y i n b r a i n , and the presence o f n e u r o l o g i c disease i n c l u d i n g d y s m o r p h o l o g y o f P u r k i n j e c e l l s i n the c e r e b e l l u m . L o n g t e r m c h a r a c t e r i z a t i o n o f m u r i n e M P S I suggests this a n i m a l m o d e l represents severe h u m a n M P S I, or H u r l e r s y n d r o m e , as there is o b v i o u s i n v o l v e m e n t o f the n e u r o l o g i c a n d skeletal systems, despite the fact that the m u r i n e m o d e l l i v e s into adulthood. T h e observations i n this rodent m o d e l are important as they c o n f i r m the u t i l i t y o f the I D U A deficient m o u s e , a n d p r o v i d e a better understanding o f the p a t h o l o g y o c c u r r i n g o v e r t i m e i n tissues not yet r e s p o n s i v e to therapy. F i n a l l y , c h a r a c t e r i z a t i o n o f these  156  features o f m u r i n e I D U A d e f i c i e n c y has i d e n t i f i e d n u m e r o u s markers o f M P S I p r o g r e s s i o n that w i l l be useful i n the assessment o f therapies for I D U A d e f i c i e n c y .  6.2 Future work: T h e M P S I m o u s e p r o v i d e s a c o n v e n i e n t m o d e l for the detailed e x a m i n a t i o n o f I D U A d e f i c i e n c y a n d represents a useful m o d e l for g e n e r a l i z e d l y s o s o m a l storage disorders. Future studies o n this m o u s e m o d e l w i l l l i k e l y focus o n further understanding the n e u r o l o g i c and skeletal features o f M P S I. Perhaps m o r e important, e v e n w i t h o u t d e l i n e a t i n g the u n d e r l y i n g causes o f these M P S I features, this a n i m a l m o d e l s h o u l d p r o v e useful i n the assessment o f therapeutics for M P S diseases.  6.3: Generation of transgenic murine strains expressing human IDUA. T h e objective o f this project w a s to generate transgenic m o u s e lines e x p r e s s i n g h u m a n I D U A . A f t e r n u m e r o u s attempts to produce transgenic m i c e e x p r e s s i n g h u m a n I D U A u s i n g b o t h p r o n u c l e a r i n j e c t i o n as w e l l as e m b r y o n i c stem c e l l approaches, w i t h traditional, non-regulated promoters, n o transgenic m i c e were generated. T h i s l e d to the use o f a c o n d i t i o n a l s y s t e m , i n w h i c h the e x p r e s s i o n o f h u m a n I D U A i s regulated b y the i n t r o d u c t i o n o f C r e r e c o m b i n a s e . U s i n g C r e m e d i a t e d r e c o m b i n a t i o n , and a d u a l reporter system, t w o transgenic m o u s e lines have been d e v e l o p e d w h i c h have the p o t e n t i a l to express h u m a n I D U A i n a c e l l s p e c i f i c manner. B y u t i l i z i n g the e v e r e x p a n d i n g l i b r a r y o f m i c e e x p r e s s i n g C r e r e c o m b i n a s e i n s p e c i f i c tissues, the effects o f s p e c i f i c reconstitution o f I D U A , i n a b a c k g r o u n d o f I D U A d e f i c i e n c y , c a n be determined. These m i c e strains w i l l help identify where, and w h e n , therapeutic I D U A is most effective i n p r e v e n t i n g or c o r r e c t i n g s p e c i f i c features o f I D U A d e f i c i e n c y . I n a d d i t i o n , the c o m p a t i b i l i t y o f  expression o f h u m a n I D U A w i t h normal cell metabolism, and animal development, can be determined. T h e r e are m a n y stages i n the c e l l u l a r m a t u r a t i o n o f a l y s o s o m a l e n z y m e that m i g h t be o v e r w h e l m e d d u r i n g h i g h l e v e l transgenic e x p r e s s i o n . C o r r e c t post translational m o d i f i c a t i o n , e n d o s o m a l c o m p a r t m e n t transport, a n d g e n e r a l i z e d l y s o s o m a l f u n c t i o n c o u l d be altered w h e n one l y s o s o m a l e n z y m e is i n a p p r o p r i a t e l y expressed. M a n y transgenic c e l l lines or m o u s e strains have b e e n generated that express p r e d o m i n a n t l y h u m a n l y s o s o m a l e n z y m e s . K y l e et al. generated a m o u s e l i n e e x p r e s s i n g the h u m a n G U S e n z y m e , deficient i n M P S V I I . T h e G U S e n z y m e is targeted to the l y s o s o m e v i a the mannose-6-phosphate ( M 6 P ) receptor, as is I D U A . T h e y demonstrated c o m p l e t e c o r r e c t i o n o f the m u r i n e M P S V I I phenotype w h e n the transgenic l i n e e x p r e s s i n g h u m a n G U S w a s crossed into the G U S -/- M P S V I I m o u s e l i n e ( K y l e et al,  1990).  Mice  h e m i z y g o u s for the h u m a n g e n o m i c transgene expressed 10 f o l d h i g h e r l e v e l s o f G U S a c t i v i t y i n m o s t tissues a n d d i d not p r o d u c e any detectable negative phenotype. T h i s c o n f i r m e d that h u m a n G U S is e n z y m a t i c a l l y f u n c t i o n a l and is p r o p e r l y targeted i n m u r i n e c e l l s , c a n correct m u r i n e M P S V I I , and is w e l l tolerated e v e n at h i g h levels o f e x p r e s s i o n . E x p r e s s i o n o f alpha-galactosidase A at h i g h l e v e l s i n C h i n e s e hamster o v a r y ( C H O ) c e l l s results i n its i n t r a c e l l u l a r aggregation, c r y s t a l l i z a t i o n i n l y s o s o m e s , and selective secretion ( I o a n n o u et al,  1992). It m a y be that certain e n z y m e s have a tendency  for aggregation and that o v e r e x p r e s s i o n o f these e n z y m e s creates an e n v i r o n m e n t for aggregate f o r m a t i o n . A transgenic m o u s e l i n e o v e r e x p r e s s i n g h u m a n alpha-galactosidase b e t w e e n 20 and 10,000 f o l d h a d no o b v i o u s phenotype r e s u l t i n g f r o m o v e r e x p r e s s i o n ( K a s e et al,  1998) and n o detected aggregate f o r m a t i o n .  158  H u m a n I D U A has been overexpressed i n c e l l culture u s i n g C h i n e s e hamster o v a r y ( C H O ) to l e v e l s 3 0 0 0 to 7 0 0 0 f o l d above n o r m a l ( K a k k i s et al,  1993). S u r p r i s i n g l y , the  a c t i v i t y and d i s t r i b u t i o n o f 5 other l y s o s o m a l e n z y m e s were not s i g n i f i c a n t l y affected e v e n at this h i g h l e v e l o f o v e r e x p r e s s i o n . N o aggregations were noted. T h i s a b i l i t y for o v e r e x p r e s s i o n o f an e n z y m e b e a r i n g the M 6 P phosphate residue for l y s o s o m a l targeting w i t h o u t d i s t u r b i n g general l y s o s o m a l targeting m a y be l i m i t e d to certain c e l l types. R e t r o v i r a l transduction o f h u m a n M P S I fibroblasts w i t h 3 constructs e x p r e s s i n g v a r y i n g l e v e l s o f h u m a n I D U A p r o d u c e d s u r p r i s i n g results that are relevant to this current thesis; i n c l u d i n g the i n d u c t i o n o f a n o v e l disease state ( A n s o n et al., 1992). T h e 3 constructs differed i n the regulatory elements d r i v i n g e x p r e s s i o n o f h u m a n I d u a c D N A , w i t h the first, p L I d S N , u s i n g the 5 ' v i r a l l o n g repeat ( L T R ) , the s e c o n d , p L N C I d , uses the c y t o m e g a l o v i r u s ( C M V ) i m m e d i a t e early promoter, w h i l e i n the t h i r d , p L N T i d , the C M V p r o m o t e r is r e p l a c e d w i t h a fragment o f the m o u s e C D 4 5 gene. T h e three constructs, L N C I d , L I d S N , and L N T I d , were f o u n d to express 2 5 0 X , 1 5 0 X , and 1 0 X n o r m a l l e v e l s o f I D U A a c t i v i t y i n M P S I h u m a n fibroblasts. W h i l e a l l three constructs corrected the e n z y m a t i c defect i n M P S I fibroblasts, o n l y the construct w i t h the l o w e s t l e v e l o f e x p r e s s i o n ( 1 0 X , L N T I d ) w a s successful i n f u l l y c o r r e c t i n g the G A G storage o f the M P S I fibroblasts. Increasing o v e r e x p r e s s i o n o f I D U A resulted i n r e d u c e d therapeutic benefit as assessed b y i n t r a c e l l u l a r a c c u m u l a t i o n o f  sulphate l a b e l e d G A G . I n a d d i t i o n ,  the l e v e l s o f other l y s o s o m a l e n z y m e s were d e t e r m i n e d to be l o w e r e d i n l y s o s o m e s , but increased i n the c e l l m e d i a , i n d i c a t i n g the l y s o s o m a l e n z y m e s were secreted rather than d e l i v e r e d to the l y s o s o m e ( A n s o n et al., 1992). T h e pattern o f decreased l y s o s o m a l e n z y m e s i n the l y s o s o m e but increased extracellular concentrations o f l y s o s o m a l  159  e n z y m e s is f o u n d i n I c e l l disease, w h i c h results i n increased secretion o f mannose-6phosphate-dependent l y s o s o m a l e n z y m e s as the e n z y m e m e d i a t i n g a d d i t i o n o f t e r m i n a l mannose phosphate residues is deficient. W i t h o v e r e x p r e s s i o n o f the mannose-6phosphate b e a r i n g I D U A i n this study, the M P R receptor m e d i a t e d d e l i v e r y o f l y s o s o m a l e n z y m e s is thought to be disrupted, l e a d i n g to m i s r o u t i n g o f l y s o s o m a l e n z y m e s to the secretion p a t h w a y and u l t i m a t e l y the e x t r a c e l l u l a r space. T h e consequences o f this m i s r o u t i n g o f l y s o s o m a l e n z y m e s , s h o u l d it o c c u r i n  vivo, are u n k n o w n . T h e catalytic a c t i v i t y o f l y s o s o m a l e n z y m e s at the near neutral p H o f the e x t r a c e l l u l a r space has not been investigated but w i t h sufficient e n z y m e e v e n l o w l e v e l s o f a c t i v i t y m i g h t result i n inappropriate degradation o f e n z y m e substrates. These results indicate the l e v e l o f I D U A e x p r e s s i o n o c c u r r i n g i n gene therapy m a y need to be l i m i t e d for o p t i m a l c o r r e c t i o n o f l y s o s o m a l storage o f G A G s , a n d suggest that e x c e s s i v e l e v e l s o f I D U A e x p r e s s i o n , as c o u l d o c c u r for some c e l l types after gene therapy, m a y not be therapeutic. M a c r o p h a g e s p e c i f i c transgenic o v e r e x p r e s s i o n o f h u m a n protective protein/cathepsin A ( P P C A ) w a s p a r t i a l l y c o r r e c t i v e for a m u r i n e m o d e l o f g a l a c t o s i a l i d o s i s ( P P C A - / - ) , a v i s c e r a l and neurodegenerative disease r e s u l t i n g f r o m d e f i c i e n c y o f P P C A . C o r r e c t i o n o f v i s c e r a l storage and partial c o r r e c t i o n or d e l a y o f onset o f neuronal storage w a s a c h i e v e d w i t h either bone m a r r o w transplantation o f transgenic m a r r o w o v e r e x p r e s s i n g P P C A f r o m a m a c r o p h a g e s p e c i f i c p r o m o t e r element into the P P C A - / - m o u s e , or w i t h b r e e d i n g o f the same m a c r o p h a g e s p e c i f i c P P C A transgenic l i n e into P P C A - / - m i c e ( H a h n et al., 1998). S o m e n e u r o n a l c e l l s , i n c l u d i n g P u r k i n j e cells, c o n t i n u e d to s h o w storage and d i e d w i t h b o t h therapy approaches. T h i s  160  indicates that, at least w i t h the l e v e l s o f transgene e x p r e s s i o n a c h i e v e d i n this study, m a r r o w d e r i v e d c e l l s i n c l u d i n g macrophages m a y not be able to f u l l y correct n e u r o n a l l y s o s o m a l storage and p a t h o l o g y . S o m e c e l l types m a y be better targets for the therapeutic o v e r e x p r e s s i o n o f a l y s o s o m a l e n z y m e than others. P o m p e disease i n c l u d e s severe m e t a b o l i c m y o p a t h y and c a r d i o m y o p a t h y and therefore m u s c l e w o u l d seem a l o g i c a l c h o i c e for e x p r e s s i o n o f the therapeutic l y s o s o m a l e n z y m e alpha-glucosidase ( G A A ) deficient i n this disorder. U s i n g k n o c k o u t m i c e w i t h this disease, and transgenic l i n e s c o n t a i n i n g the c D N A for the h u m a n e n z y m e under m u s c l e or l i v e r s p e c i f i c promoters c o n t r o l l e d b y tetracycline, R a b e n et al. demonstrated that the l i v e r p r o v i d e d e n z y m e far m o r e e f f i c i e n t l y than m u s c l e tissue. T h e a c h i e v e m e n t o f therapeutic l e v e l s w i t h skeletal m u s c l e e x p r e s s i o n r e q u i r e d the entire m u s c l e m a s s to produce h i g h l e v e l s o f e n z y m e o f w h i c h little f o u n d its w a y to the p l a s m a , whereas l i v e r , c o m p r i s i n g less than 5 % o f b o d y w e i g h t , secreted 100 f o l d m o r e e n z y m e , a l l o f w h i c h w a s i n the active 110 k D a precursor f o r m ( R a b e n et al, 2 0 0 1 ) . I n a transgenic l i n e w i t h v e r y h i g h e x p r e s s i o n o f G A A i n skeletal m u s c l e it w a s s h o w n e x c e s s i v e l e v e l s o f G A A are not w e l l tolerated, w i t h v i r t u a l l y e v e r y c e l l c o n t a i n i n g s m a l l l y s o s o m e s w i t h P A S - p o s i t i v e storage m a t e r i a l . It is clear that the transport systems for d e l i v e r y o f exogenous l y s o s o m a l e n z y m e s , u s i n g the mannose-6-phosphate receptors, a l l o w s rescue o f a n i m a l m o d e l s o f l y s o s o m a l storage disease w i t h gene products o f h u m a n v e r s i o n s o f the l y s o s o m a l e n z y m e s . O v e r e x p r e s s i o n o f l y s o s o m a l e n z y m e s has been associated w i t h n u m e r o u s p h e n o m e n o n i n c l u d i n g aggregation o f transgenic proteins, secretion o f transgenic as w e l l  161  as native l y s o s o m a l e n z y m e s , and d e f i c i e n c y o f i n t r a l y s o s o m a l - l y s o s o m a l e n z y m e s l e a d i n g to l y s o s o m a l disease i n c e l l culture. S u r p r i s i n g l y , transgenic m o u s e lines o v e r e x p r e s s i n g l y s o s o m a l e n z y m e s have for the m o s t part not e x h i b i t e d o b v i o u s c l i n i c a l or p a t h o l o g i c a l phenotypes, w i t h the e x c e p t i o n o f l y s o s o m a l storage disease i n m i c e o v e r e x p r e s s i n g G A A e n z y m e i n m u s c l e . T h e phenotype o f the o v e r e x p r e s s i o n o f I D U A o n n o r m a l c e l l m e t a b o l i s m is relevant to gene therapy approaches for M P S I. O n l y b y o v e r e x p r e s s i n g I D U A i n a l l tissues, d u r i n g d e v e l o p m e n t , c a n the safety o f s u c h approaches be d e t e r m i n e d . I n a d d i t i o n , c e l l s p e c i f i c r e c o n s t i t u t i o n o f I D U A a c t i v i t y i n a b a c k g r o u n d o f I D U A d e f i c i e n c y m a y identify c e l l types r e q u i r e d for efficient c o r r e c t i o n o f M P S I c o m p l i c a t i o n s . It has b e e n d e t e r m i n e d that e x p r e s s i o n o f h u m a n I D U A i n n o r m a l m i c e , at the l e v e l s obtained w i t h these transgenic strains, does not i n d u c e o b v i o u s disease. T h e d u a l reporter e x p r e s s i o n s y s t e m w h i c h indicates the state o f C r e m e d i a t e d r e c o m b i n a t i o n , a n d therefore h u m a n I D U A e x p r e s s i o n , has p r o v e n f u n c t i o n a l a n d the e x p r e s s i o n o f h u m a n I D U A has b e e n c o n f i r m e d . T h e generation o f a c o n d i t i o n a l system for the e x p r e s s i o n o f h u m a n I D U A i n m i c e w i l l p r o v i d e a versatile t o o l for the study o f the effects o f gene therapy for M P S I. In a d d i t i o n to genetic crosses into the I D U A deficient strain to address the benefit o f I D U A e x p r e s s i o n i n s p e c i f i c tissues at defined t i m e points, these transgenic m i c e lines can p r o v i d e a source o f h u m a n I D U A expressing c e l l s for use i n transplantation studies. S i n c e these transgenic m i c e express a reporter gene as w e l l as h u m a n I D U A , this system p r o v i d e s ease o f m o n i t o r i n g o f transgene e x p r e s s i o n and the t r a c k i n g o f transgenic c e l l s i n recipients. F i n a l l y , the phenotype o f transgenic h u m a n I D U A e x p r e s s i o n , i f any, c a n  162  be determined. It i s h o p e d that these m o u s e strains w i l l be useful i n d e t e r m i n i n g l e v e l s , l o c a t i o n s , a n d t i m e points important to the e f f i c a c y a n d safety o f gene therapy for M P S I.  6.4 F u t u r e w o r k M u c h remains to be learned f r o m the c o n d i t i o n a l transgenic lines p r o d u c e d d u r i n g this thesis w o r k . M o s t i m p o r t a n t l y ; crosses into the I D U A deficient m u r i n e l i n e and lines e x p r e s s i n g C r e r e c o m b i n a s e need to be c o m p r e h e n s i v e l y a n a l y z e d . I n particular, detailed e v a l u a t i o n o f h u m a n s p e c i f i c I D U A a c t i v i t y after C r e r e c o m b i n a t i o n , i n v a r i o u s m o u s e tissues b y i m m u n o c a p t u r e is c r i t i c a l . T h e c o m p l e x i t y o f this a n a l y s i s and the c o n s i d e r a b l e t i m e r e q u i r e d for b r e e d i n g i n t o v a r i o u s C r e e x p r e s s i n g lines as w e l l as the m u r i n e I D U A deficient l i n e p r e c l u d e d i n c l u s i o n into this thesis project. It i s h o p e d these transgenic m u r i n e lines w i l l l e a d to a better understanding o f the tissue s p e c i f i c elements and e x p r e s s i o n patterns that are r e q u i r e d to effectively cure M P S I.  163  References  A b r e u S, H a y d e n J , B e r t h o l d P , S h a p i r o I M , D e c k e r S, Patterson D , H a s k i n s M (1995) G r o w t h plate p a t h o l o g y i n feline m u c o p o l y s a c c h a r i d o s i s V I . C a l c i f T i s s u e Int 5 7 : 185190. A n s o n D S , B i e l i c k i J , and H o p w o o d J J (1992) C o r r e c t i o n o f M u c o p o l y s a c c h a r i d o s i s T y p e I fibroblasts b y r e t r o v i r a l - m e d i a t e d transfer o f the h u m a n a l p h a - L - i d u r o n i d a s e gene. H u m G e n e T h e r a p y 3: 3 7 1 - 3 7 9 . A r o n o v i c h E L , P a n D , W h i t l e y C B (1996) M o l e c u l a r genetic defect u n d e r l y i n g a l p h a - L iduronidase p s e u d o d e f i c i e n c y . A m J H u m G e n e t 5 8 : 7 5 - 8 5 . B a c k A , E a s t K , H i c k s t e i n D (1995) L e u k o c y t e i n t e g r i n C D 1 l b p r o m o t e r directs e x p r e s s i o n i n l y m p h o c y t e s and granulocytes i n transgenic m i c e . B l o o d 85: 1017-24. Barton N W , Brady R O , Dambrosia J M , D i Bisceglie A M , Doppelt S H , H i l l S C , M a n k i n H J , M u r r a y G J , P a r k e r R l , A r g o f f C E (1991) R e p l a c e m e n t therapy for inherited e n z y m e deficiency—macrophage-targeted glucocerebrosidase for G a u c h e r ' s disease. N E n g l J M e d 3 2 4 : 1464-70. B a r t o n R W , N e u f e l d E F (1971) T h e H u r l e r c o r r e c t i v e factor. P u r i f i c a t i o n and some properties. J B i o l C h e m 2 4 6 : 7 7 7 3 - 9 . B a s t e d o L , Sands M S , L a m b e r t D T , P i s a M A , B i r k e n m e i e r E , C h a n g P L (1994) B e h a v i o r a l consequences o f bone m a r r o w transplantation i n the treatment o f m u r i n e m u c o p o l y s a c c h a r i d o s i s type V I I . J C l i n Invest 9 4 : 1180-6. B e r n f i e l d M , Gotte M , P a r k P W , R e i z e s O , F i t z g e r a l d M L , L i n c e c u m J , Z a k o M (1999) F u n c t i o n s o f c e l l surface heparan sulfate p r o t e o g l y c a n s . A n n u R e v B i o c h e m 68: 7 2 9 - 7 7 . Birkenmeier E H , Barker J E , V o g l e r C A , K y l e J W , S l y W S , G w y n n B , L e v y B , Pegors C (1991) Increased life span and c o r r e c t i o n o f m e t a b o l i c defects i n m u r i n e m u c o p o l y s a c c h a r i d o s i s type V I I after s y n g e n e i c bone m a r r o w transplantation. B l o o d 78: 3081-92. Birkenmeier E H , Davisson M T , Beamer W G , Ganschow R E , Vogler C A , G w y n n B , L y f o r d K A , M a l t a i s L M , W a w r z y n i a k C J ( 1 9 8 9 ) M u r i n e m u c o p o l y s a c c h a r i d o s i s type V I I : c h a r a c t e r i z a t i o n o f a m o u s e w i t h ^ - g l u c u r o n i d a s e d e f i c i e n c y . J C l i n Invest 8 3 : 12581266. B i s s i g M , H a g e n b u c h B , Stieger B , R o l l e r T , M e i e r P J (1994) F u n c t i o n a l e x p r e s s i o n c l o n i n g o f the c a n a l i c u l a r sulfate transport s y s t e m o f rat hepatocytes. J B i o l C h e m 2 6 9 : 3017-21.  164  B o s c h A , Perret E , D e s m a r i s N , T r o n o D , H e a r d J M (2000) R e v e r s a l o f p a t h o l o g y i n the entire b r a i n o f m u c o p o l y s a c c h a r i d o s i s type V I I m i c e after l e n t i v i r u s - m e d i a t e d gene transfer. H u m G e n e T h e r 11: 1139-50. B r e i d e r M A , S h u l l R M , C o n s t a n t o p o u l o s G (1989) L o n g - t e r m effects o f bone m a r r o w transplantation i n dogs w i t h m u c o p o l y s a c c h a r i d o s i s I. A m J P a t h o l 134: 6 7 7 - 9 2 . B r e u n i g F , W a n n e r C (2003) E n z y m e replacement therapy for F a b r y disease: p r o v i n g the c l i n i c a l benefit. N e p h r o l D i a l Transplant 18: 7-9. B r o o k s D A (2002) E n z y m e replacement for M P S I. H u m G e n e T h e r 3: 3 7 1 - 9 . B y e r s P H (1995) D i s o r d e r s o f c o l l a g e n biosynthesis a n d structure. In: S c r i v e r C R , B e a u d e t A L , S l y W S , V a l l e D , eds. T h e m e t a b o l i c and m o l e c u l a r bases o f inherited disease, 7 t h edn. N e w Y o r k : M c G r a w H i l l 2 4 2 7 - 2 8 3 9 . C a s a l M L , W o l f e J H (1998) V a r i a n t c l i n i c a l course o f m u c o p o l y s a c c h a r i d o s i s type V I I i n t w o groups o f m i c e c a r r y i n g the same m u t a t i o n . L a b Invest 7 8 : 1575-81. C a s a l M L , W o l f e J H (2000) M u c o p o l y s a c c h a r i d o s i s type V I I i n the d e v e l o p i n g m o u s e fetus. Pediatr R e s 4 7 : 7 5 0 - 6 . C a s a l M L , W o l f e J H (2001)  In utero transplantation  o f fetal l i v e r c e l l s i n the  m u c o p o l y s a c c h a r i d o s i s type V I I m o u s e results i n l o w - l e v e l c h i m e r i s m , but o v e r e x p r e s s i o n o f beta-glucuronidase c a n d e l a y onset o f c l i n i c a l signs. B l o o d 9 7 : 162534. C h e n H , B e r a r d J , L u o H , L a n d e r s M , V i n e t B , B r a d l e y W E , W u J (1997) C o m p r o m i s e d allograft rejection response i n transgenic m i c e e x p r e s s i n g antisense sequences to r e t i n o i c a c i d receptor beta2. J I m m u n o l 159: 6 2 3 - 3 4 . C l a r k e L A , N e l s o n P V , W a r r i n g t o n C , M o r r i s C P , H o p w o o d J J , Scott H S (1994) M u t a t i o n analysis o f 19 N o r t h A m e r i c a n m u c o p o l y s a c c h a r i d o s i s type I patients: i d e n t i f i c a t i o n o f t w o a d d i t i o n a l frequent mutations. H u m M u t a t 3: 2 7 5 - 2 8 2 . Clarke L A , Nasir J, Zhang H , M c D o n a l d H , Applegarth D A , Hayden M R , Toone J (1994) M u r i n e a l p h a - L - i d u r o n i d a s e : c D N A i s o l a t i o n a n d e x p r e s s i o n . G e n o m i c s 2 4 : 3 1 1 - 6 . C l a r k e L A , R u s s e l l C S , P o w n a l l S, W a r r i n g t o n C L , B o r o w s k i A , D i m m i c k J E , T o o n e J , J i r i k F (1997) M u r i n e m u c o p o l y s a c c h a r i d o s i s type 1: targeted d i s r u p t i o n o f the m u r i n e a L - i d u r o n i d a s e gene. H u m M o l G e n 64: 5 0 3 - 5 1 1 . C l a r k e L A , Scott H S (1993) T w o n o v e l mutations c a u s i n g m u c o p o l y s a c c h a r i d o s i s type I detected b y single strand c o n f o r m a t i o n a l analysis o f the a - L - i d u r o n i d a s e gene. H u m M o l Genet 2 : 1311-1312.  165  C l a u s e n B E , B u r k h a r d t C , R e i t h W , R e n k a w i t z R , Forster I (1999) C o n d i t i o n a l gene targeting i n macrophages a n d granulocytes u s i n g L y s M c r e m i c e . T r a n s g e n i c R e s 8: 2 6 5 77. C l e a r y M A , W r a i t h J E (1995) T h e presenting features o f m u c o p o l y s a c c h a r i d o s i s type I H ( H u r l e r s y n d r o m e ) . A c t a Paediatr 84: 3 3 7 - 3 3 9 . C o l v i l l e G A , B a x M A (1996) E a r l y presentation i n the m u c o p o l y s a c c h a r i d e disorders. C h i l d C a r e H e a l t h D e v 2 2 : 31-6. C o n s t a n t o p o u l o s G , D e k a b a n A S (1978) N e u r o c h e m i s t r y o f the m u c o p o l y s a c c h a r i d o s e s : B r a i n l i p i d s a n d l y s o s o m a l e n z y m e s i n patients w i t h four types o f m u c o p o l y s a c c h a r i d o s i s and i n n o r m a l controls. J N e u r o c h e m 30: 9 6 5 - 9 7 3 . C o n s t a n t o p o u l o s G , S h u l l R M , H a s t i n g s N , N e u f e l d E F (1985) N e u r o c h e m i c a l characterization o f canine a - L - i d u r o n i d a s e d e f i c i e n c y disease ( m o d e l o f h u m a n m u c o p o l y s a c c h a r i d o s i s I). J N e u r o c h e m 4 5 : 1213-1217. C r a w l e y A C , B r o o k s D A , M u l l e r V J , Petersen B A , Isaac E L , B i e l i c k i J , K i n g B M , B o u l t e r C D , M o o r e A J , F a z z a l a r i N L , A n s o n D S , B y e r s S, H o p w o o d J J (1996) E n z y m e replacement therapy i n a feline m o d e l o f M a r o t e a u x - L a m y s y n d r o m e . J C l i n Invest 9 7 : 1864-1873. C r o w J , G i b b s D A , C o z e n s W , S p e l l a c y E , W a t t s R (1983) B i o c h e m i c a l a n d h i s t o p a t h o l o g i c a l studies o n patients w i t h m u c o p o l y s a c c h a r i d o s e s , t w o o f w h o m h a d been treated w i t h fibroblast transplantation. J C l i n P a t h o l 3 6 : 4 1 5 - 4 3 0 . D a l y T M , L o r e n z R G , Sands M S . (2000) A b n o r m a l i m m u n e f u n c t i o n in vivo i n a m u r i n e m o d e l o f l y s o s o m a l storage disease. Pediatr R e s 4 7 : 7 5 7 - 6 2 . D a l y T M , O h l e m i l l e r K K , R o b e r t s M S , V o g l e r C A , Sands M S (2001) P r e v e n t i o n o f s y s t e m i c c l i n i c a l disease i n M P S V I I m i c e f o l l o w i n g A A V - m e d i a t e d neonatal gene transfer. G e n e T h e r 8: 1291-8. D a l y T M , V o g l e r C , L e v y B , H a s k i n s M E , Sands M S (1999) N e o n a t a l gene transfer leads to w i d e s p r e a d c o r r e c t i o n o f p a t h o l o g y i n a m u r i n e m o d e l o f l y s o s o m a l storage disease. P r o c N a t l A c a d S c i U S A 96: 2 2 9 6 - 3 0 0 . D e g u c h i Y , O k u t s u H , O k u r a T , Y a m a d a S, K i m u r a R , Y u g e T , F u r u k a w a A , M o r i m o t o K , T a c h i k a w a M , O h t s u k i S, H o s o y a K , T e r a s a k i T (2002) Internalization o f basic fibroblast g r o w t h factor at the m o u s e b l o o d - b r a i n barrier i n v o l v e s perlecan, a heparan sulfate p r o t e o g l y c a n . J N e u r o c h e m 83: 381-9. D e k a b a n A S , C o n s t a n t o p o u l o s G (1977) M u c o p o l y s a c c h a r i d o s i s types I, II, I I I A a n d V : p a t h o l o g i c a l and b i o c h e m i c a l a b n o r m a l i t i e s i n the neural and m e s e n c h y m a l elements o f the brain. A c t a N e u r o p a t h 39: 1-7.  166  D e k a b a n A S , C o n s t a n t o p o u l o s G , H e r m a n M M , S t e u s i n g J K (1976) M u c o p o l y s a c c h a r i d o s i s type V ( S c h e i e s y n d r o m e ) : a p o s t m o r t e m study b y m u l t i d i s c i p l i n a r y techniques w i t h emphasis o n the b r a i n . A r c h P a t h o l L a b M e d 100: 2 3 7 245. D z i e n n i s S, V a n E t t e n R A , P a h l S (1995) T h e C D 1 l b p r o m o t e r directs h i g h - l e v e l e x p r e s s i o n o f reporter genes i n macrophages i n transgenic m i c e . B l o o d 8 5 : 3 1 9 - 2 9 . E r i c k s o n R P (1999) A n t i s e n s e transgenics i n a n i m a l s . M e t h o d s 18:304-310. Everett L A , G l a s e r B , B e c k J C , I d o l J R , B u c h s A , H e y m a n M , A d a w i F , H a z a n i E , N a s s i r E , B a x e v a n i s A D , S h e f f i e l d V C , G r e e n E D ( 1 9 9 7 ) P e n d r e d s y n d r o m e is c a u s e d b y mutations i n a putative sulphate transporter gene ( P D S ) . N a t Genet 17: 4 1 1 - 2 2 . E v e r s M , S a f t i g P , S c h m i d t P , Hafner A , M c L o g h l i n D B , S c h m a h l W , H e s s B , v o n F i g u r a K , Peters C (1996) Targeted d i s r u p t i o n o f the arylsulfatase B gene results i n m i c e r e s e m b l i n g the phenotype o f m u c o p o l y s a c c h a r i d o s i s V I . P r o c N a t l A c a d S c i 9 3 : 8 2 1 4 8219. Fairbairn L J , Lashford L S , Spooncer E , M c D e r m o t t R H , Lebens G , A r r a n d J E , A r r a n d J R , B e l l a n t u o n o I, H o l t R , H a t t o n C E , C o o p e r A , B e s l e y G T , W r a i t h J E , A n s o n D S , H o p w o o d J J , D e x t e r T M (1996) L o n g - t e r m in vitro c o r r e c t i o n o f a l p h a - L - i d u r o n i d a s e d e f i c i e n c y ( H u r l e r s y n d r o m e ) i n h u m a n bone m a r r o w . P r o c N a t l A c a d S c i U S A 9 3 : 2 0 2 5 30. Ferrer I, C u s i V , P i n e d a M , G a l o f r e E , V i l a J (1988) F o c a l d e n d r i t i c s w e l l i n g s i n P u r k i n j e c e l l s i n m u c o p o l y s a c c h a r i d o s e s types I, II and III: a G o l g i and ultrastructural study. N e u r o p a t h & A p p N e u r o b i o l 14: 3 1 5 - 3 2 3 . F i e l d R E , B u c h a n a n J A F , C o p p l e m a n s M G J , A i c h r o t h P M (1994) B o n e - m a r r o w transplantation i n H u r l e r ' s s y n d r o m e . J B o n e & J o i n t S u r g 7 6 : 9 7 5 - 9 8 1 . F l a k e A W and Z a n j a n i E D (1999)  In utero h e m a t o p o i e t i c  stem c e l l transplantation:  ontogenic opportunities a n d b i o l o g i c barriers. B l o o d 94: 2 1 7 9 - 9 1 . F o l c h J , L e e s M , Stanley, G H (1957) A s i m p l e m e t h o d for the i s o l a t i o n a n d p u r i f i c a t i o n o f total l i p i d s f r o m a n i m a l tissues. J B i o l C h e m 2 2 6 : 4 9 7 - 5 0 9 . Fratantoni J , H a l l C W , N e u f e l d E F (1968) H u r l e r and H u n t e r s y n d r o m e s : m u t u a l c o r r e c t i o n o f the defect i n c u l t u r e d fibroblasts. S c i e n c e 162: 5 7 0 - 5 7 2 . Fratantoni J C , H a l l C W , N e u f e l d E F (1968) T h e defect i n H u r l e r ' s a n d Hunter's syndromes: faulty degradation o f m u c o p o l y s a c c h a r i d e . P r o c N a t A c a d S c i 6 0 : 6 9 9 - 7 0 6 . G o n z a l e z - G o m e z I, M o n o n e n I, H e i s t e r k a m p N , G r o f f e n J , K a a r t i n e n V (1998) P r o g r e s s i v e neurodegeneration i n a s p a r t y l g l y c o s a m i n u r i a m i c e . A m J P a t h o l 153: 1293300.  167  G o r l i c h D , R a p o p o r t T A (1993) P r o t e i n t r a n s l o c a t i o n into p r o t e o l i p o s o m e s reconstituted f r o m p u r i f i e d c o m p o n e n t s o f the e n d o p l a s m i c r e t i c u l u m m e m b r a n e . C e l l 7 5 : 6 1 5 - 3 0 . G o r m a n C , B u l l o c k C (2000) S i t e - s p e c i f i c gene targeting for gene e x p r e s s i o n i n eukaryotes. C u r r O p i n B i o t e c h n o l 11: 4 5 5 - 6 0 . G o s s e n M , B u j a r d H (1992) T i g h t c o n t r o l o f gene e x p r e s s i o n i n m a m m a l i a n c e l l s b y tetracycline-responsive promoters. P r o c N a t l A c a d S c i U S A 89: 5 5 4 7 - 5 1 . G r o f f e n A J , V e e r k a m p J H , M o n n e n s L A , v a n d e n H e u v e l L P (1999) R e c e n t insights into the structure a n d functions o f heparan sulfate p r o t e o g l y c a n s i n the h u m a n g l o m e r u l a r basement m e m b r a n e . N e p h r o l D i a l Transplant 14: 2 1 1 9 - 2 9 . G r o s s o n C L , M a c D o n a l d M E , D u y a o M P , A m b r o s e C M , R o f f l e r - T a r l o v S, G u s e l l a J F (1994) S y n t e n y c o n s e r v a t i o n o f the H u n t i n g t o n ' s disease gene and s u r r o u n d i n g l o c i o n m o u s e C h r o m o s o m e 5. M a m m G e n o m e 5: 4 2 4 - 8 . H a h n C N , del P i l a r M a r t i n M , Z h o u X Y , M a n n L W , d ' A z z o A (1998) C o r r e c t i o n o f m u r i n e g a l a c t o s i a l i d o s i s b y bone m a r r o w - d e r i v e d macrophages o v e r e x p r e s s i n g h u m a n protective protein/cathepsin A under c o n t r o l o f the c o l o n y - s t i m u l a t i n g factor-1 receptor promoter. P r o c N a t l A c a d S c i U S A 9 5 : 14880-5. H a m i l t o n D L , A b r e m s k i K (1984) Site-specific r e c o m b i n a t i o n b y the bacteriophage P I l o x - C r e system. C r e - m e d i a t e d synapsis o f t w o l o x sites. J M o l B i o l 178: 4 8 1 - 6 . H a r d o u i n N , N a g y A (2000) Gene-trap-based target site for cre-mediated transgenic insertion. G e n e s i s 2 6 : 2 4 5 - 5 2 . H a s k i n s M E , A g u i r r e G D , J e z y k P F , D e s n i c k R J , Patterson D F (1983) T h e p a t h o l o g y o f the feline m o d e l o f m u c o p o l y s a c c h a r i d o s i s I. A m J P a t h o l 112: 2 7 - 3 6 . H a s k i n s M E , J e z y k P F , D e s n i c k R J , M c D o n o u g h S K , Patterson D F (1979) A l p h a - L iduronidase d e f i c i e n c y i n a cat: a m o d e l o f m u c o p o l y s a c c h a r i d o s i s I. Pediat R e s 13: 1294-1297. H a s t b a c k a J , S u p e r t i - F u r g a A , W i l c o x W R , R i m o i n D L , C o h n D H , L a n d e r E S (1996) A t e l o s t e o g e n e s i s type II i s caused b y mutations i n the diastrophic d y s p l a s i a sulfatetransporter gene ( D T D S T ) : e v i d e n c e for a p h e n o t y p i c series i n v o l v i n g three c h o n d r o d y s p l a s i a s . A m J H u m G e n e t 58: 2 5 5 - 6 2 . H e X , L i C M , S i m o n a r o C M , W a n Q , H a s k i n s M E , D e s n i c k R J , and S c h u c h m a n E H (1999) I d e n t i f i c a t i o n and characterization o f the m o l e c u l a r l e s i o n c a u s i n g m u c o p o l y s a c c h a r i d o s i s type I i n cats. M o l G e n e t M e t a b 6 7 : 106-12. H e r r e r a P L (2000) A d u l t i n s u l i n - and g l u c a g o n - p r o d u c i n g c e l l s differentiate f r o m t w o independent c e l l lineages. D e v e l 127: 2 3 1 7 - 2 2 .  168  H i c k s t e i n D , B a k e r D , G o l l a h o n K , and B a c k A (1992) Identification o f the p r o m o t e r o f the m y e l o m o n o c y t i c l e u k o c y t e i n t e g r i n C D 1 I B . P r o c N a t l A c a d S c i 89: 2 1 0 5 - 2 1 0 9 . H o g a n B , B e d d i n g t o n R , C o s t a n t i n i F , and L a c y E (1994) M a n i p u l a t i n g the m o u s e e m b r y o . C o l d S p r i n g H a r b o r L a b o r a t o r y Press, C o l d S p r i n g H a r b o r , N Y . H o p w o o d J J a n d M u l l e r V (1982) D i a g n o s t i c e n z y m o l o g y w i t h s p e c i a l reference to a sulfated disaccharide d e r i v e d f r o m heparin. C l i n S c i 6 2 : 1 9 3 - 2 0 1 . H o p w o o d J J , M u l l e r V , S m i t h s o n A , B a g g e t t N (1979) A f l u o r o m e t r i c assay u s i n g 4m e t h y l u m b e l l i f e r y l a l p h a - L - i d u r o n i d e for the e s t i m a t i o n o f a l p h a - L - i d u r o n i d a s e a c t i v i t y a n d the detection o f H u r l e r a n d S c h e i e s y n d r o m e s . C l i n C h i m A c t a 9 2 : 2 5 7 - 6 5 . H o p w o o d J J , V e l l o d i A , Scott H S , M o r r i s C P , L i t j e n s T , C l e m e n t s P R , B r o o k s D A , C o o p e r A , W r a i t h J E (1993) L o n g - t e r m c l i n i c a l progress i n bone m a r r o w transplanted m u c o p o l y s a c c h a r i d o s i s type I patients w i t h a defined genotype. J Inher M e t a b D i s 16: 1024-1033. H u a n g J - Q , T r a s l e r J M , I g d o u r a S, M i c h a u d J , H a n a i N , G r a v e l R A (1997) A p o p t o t i c c e l l death i n m o u s e m o d e l s o f G M 2 g a n g l i o s i d o s i s and observations o n h u m a n T a y - S a c h s a n d S a n d h o f f diseases. H u m M o l G e n 6: 1879-1885. H u m a n G e n e M u t a t i o n Database, h t t p : / / u w c m m l l s . u w c m . a c . U k / u w c m / m g / s e a r c h / l 19327.html I o a n n o u Y A , B i s h o p D F , D e s n i c k R J (1992) O v e r e x p r e s s i o n o f h u m a n a l p h a galactosidase A results i n its i n t r a c e l l u l a r aggregation, c r y s t a l l i z a t i o n i n l y s o s o m e s , and selective secretion. J C e l l B i o l 119: 1137-50. J e z y k P F , H a s k i n s M E , Patterson D F , M e l l m a n W J , G r e e n s t e i n M (1977) M u c o p o l y s a c c h a r i d o s i s i n a cat w i t h arylsulfatase B d e f i c i e n c y : a m o d e l o f M a r o t e a u x L a m y s y n d r o m e . S c i e n c e 198: 834-6. K a a r t i n e n V , N a g y A (2001) R e m o v a l o f the f l o x e d neo gene f r o m a c o n d i t i o n a l k n o c k o u t allele b y the a d e n o v i r a l C r e r e c o m b i n a s e  in vivo. G e n e s i s  3 1 : 126-9.  K a k k i s E D (2002) E n z y m e replacement therapy for the m u c o p o l y s a c c h a r i d e storage disorders. E x p e r t O p i n Investig D r u g s 11: 6 7 5 - 8 5 . K a k k i s E D , M a t y n i a A , Jonas A J , N e u f e l d E F (1994) O v e r e x p r e s s i o n o f the h u m a n l y s o s o m a l e n z y m e a l p h a - L - i d u r o n i d a s e i n C h i n e s e hamster o v a r y c e l l s . P r o t e i n E x p r P u r i f 5: 2 2 5 - 3 2 . K a k k i s E D , M c E n t e e M F , S c h m i d t c h e n A , N e u f e l d E F , W a r d D A , C o m p f R E , K a n i a S, B e d o l l a C , C h i e n S - L , S h u l l R M ( 1 9 9 5 ) L o n g - t e r m a n d h i g h - d o s e trials o f e n z y m e replacement therapy i n the canine m o d e l o f m u c o p o l y s a c c h a r i d o s i s I. B i o c h e m M o l e c u l a r M e d 58: 156-167.  169  K a k k i s E D , M c E n t e e M F , S c h m i d t c h e n A , N e u f e l d E F , W a r d D A , G o m p f R E , K a n i a S, B e d o l l a C , C h i e n S L , S h u l l R M (1996) L o n g - t e r m and high-dose trials o f e n z y m e replacement therapy i n the canine m o d e l o f m u c o p o l y s a c c h a r i d o s i s I. B i o c h e m M o l M e d 58: 156-67. K a k k i s E D , M u e n z e r J , T i l l e r G E , W a b e r L , B e l m o n t J , Passage M , I z y k o w s k i B , P h i l l i p s J , D o r o s h o w R , W a l o t I, H o f t R , N e u f e l d E F (2001) E n z y m e - r e p l a c e m e n t therapy i n m u c o p o l y s a c c h a r i d o s i s I. N e w E n g J M e d 3 4 4 : 182-188. K a k k i s E D , S c h u c h m a n E , H e X , W a n Q , K a n i a S, W i e m e l t S, H a s s o n C W , O ' M a l l e y T , W e i l M A , A g u i r r e G A , B r o w n D E , H a s k i n s M E (2001) E n z y m e replacement therapy i n feline m u c o p o l y s a c c h a r i d o s i s I. M o l G e n e t M e t a b 7 2 : 199-208. K a r n i s k i L P , L o t s c h e r M , Fucentese M , H i l f i k e r H , B i b e r J , M u r e r H (1998) I m m u n o l o c a l i z a t i o n o f sat-1 sulfate/oxalate/bicarbonate a n i o n exchanger i n the rat kidney. A m J Physiol 275: F79-87. K a s e R , S h i m m o t o M , Itoh K , U t s u m i K , K o t a n i M , T a y a C , Y o n e k a w a H , S a k u r a b a H ( 1 9 9 8 ) I m m u n o h i s t o c h e m i c a l characterization o f transgenic m i c e h i g h l y e x p r e s s i n g h u m a n l y s o s o m a l alpha-galactosidase. B i o c h i m B i o p h y s A c t a 1406: 2 6 0 - 6 . K e e l i n g K M , B e d w e l l D M (2002) C l i n i c a l l y relevant a m i n o g l y c o s i d e s c a n suppress disease-associated premature stop mutations i n the I D U A and P 5 3 c D N A s i n a m a m m a l i a n translation system. J M o l M e d 80: 3 6 7 - 7 6 . K o r n f e l d S (1987) T r a f f i c k i n g o f l y s o s o m a l e n z y m e s . F A S E B J 1: 4 6 2 - 8 . K y l e J W , Birkenmeier E H , G w y n n B , Vogler C , Hoppe P C , Hoffmann J W , Sly W S (1990) C o r r e c t i o n o f m u r i n e m u c o p o l y s a c c h a r i d o s i s V I I b y a h u m a n beta-glucuronidase transgene. P r o c N a t l A c a d S c i U S A 8 7 : 3 9 1 4 - 8 . L a k s o M , Sauer B , M o s i n g e r B Jr, L e e E J , M a n n i n g R W , Y u S H , M u l d e r K L , W e s t p h a l H (1992) Targeted oncogene a c t i v a t i o n b y site-specific r e c o m b i n a t i o n i n transgenic m i c e . P r o c N a t l A c a d S c i U S A 89: 6 2 3 2 - 6 . L a l l e m a n d Y , L u r i a V , H a f f h e r - K r a u s z R , L o n a i P (1998) M a t e r n a l l y expressed P G K - C r e transgene as a t o o l for early and u n i f o r m a c t i v a t i o n o f the C r e site-specific r e c o m b i n a s e . T r a n s g e n i c R e s . 7: 105-12. L e e A , B e c k L , B r o w n R J , M a r k o v i c h D (1999) I d e n t i f i c a t i o n o f a m a m m a l i a n b r a i n sulfate transporter. B i o c h e m B i o p h y s R e s C o m m u n 2 6 3 : 123-9. L e e A , B e c k L , M a r k o v i c h D (2003) T h e m o u s e sulfate a n i o n transporter gene S a t l ( S l c 2 6 a l ) : c l o n i n g , tissue d i s t r i b u t i o n , gene structure, functional characterization, and transcriptional r e g u l a t i o n t h y r o i d h o r m o n e . D N A C e l l B i o l 2 2 : 19-31. L e w a n d o s k i M (2001) C o n d i t i o n a l c o n t r o l o f gene e x p r e s s i o n i n the m o u s e . N a t R e v G e n e t 2: 7 4 3 - 5 5 .  170  L o b e C G , K o o p K E , K r e p p n e r W , L o m e l i H , Gertsenstein M , N a g y A (1999) Z / A P , a d o u b l e reporter for cre-mediated r e c o m b i n a t i o n . D e v B i o l 2 0 8 : 2 8 1 - 9 2 . L o w r y O H , R o s e b r o u g h N S , F a i r A L , R a n d a l l R . (1951) P r o t e i n measurement w i t h the f o l i n p h e n o l reagent. J B i o l C h e m 193: 2 6 5 - 2 7 2 . L o w r y R B , A p p l e g a r t h D A , T o o n e J R , M a c D o n a l d E , T h u n e m N Y (1990) A n update o n the frequency o f m u c o p o l y s a c c h a r i d e syndromes i n B r i t i s h C o l u m b i a . H u m Genet 85: 389-90. L u d w i g T , E g g e n s h w i l e r J , F i s h e r P , D ' E r c o l e A J , D a v e n p o r t M L , E f s t a r i a d i s A (1996) M o u s e mutants l a c k i n g the type 2 I G F receptor ( I G F 2 R ) are rescued f r o m perinatal lethality i n Igf2 and I g f l r n u l l b a c k g r o u n d s . D e v e l o p B i o 177: 5 1 7 - 5 3 5 . L u t z k o C , K r u t h S, A b r a m s - O g g A C , L a u K , L i L , C l a r k B R , R u e d y C , N a n j i S, Foster R , K o h n D , S h u l l R , D u b e I D (1999) G e n e t i c a l l y corrected autologous stem c e l l s engraft, but host i m m u n e responses l i m i t their u t i l i t y i n canine a l p h a - L - i d u r o n i d a s e d e f i c i e n c y . B l o o d 9 3 : 1895-905. L u t z k o C , M e e r t e n s L , L i L , Z h a o Y , A b r a m s - O g g A , W o o d s J P , K r u t h S, H o u g h M R , D u b e I D (2002) H u m a n h e m a t o p o i e t i c progenitors engraft i n fetal canine recipients a n d e x p a n d w i t h neonatal i n j e c t i o n o f fibroblasts e x p r e s s i n g h u m a n h e m a t o p o i e t i c c y t o k i n e s . E x p H e m a t o l 3 0 : 801-8. L u t z k o C , O m o r i F , A b r a m s - O g g A C , S h u l l R , L i L , L a u K , R u e d y C , N a n j i S, G a r t l e y C , D o b s o n H , Foster R , K r u t h S, D u b e I D ( 1 9 9 9 ) G e n e therapy for c a n i n e a l p h a - L iduronidase d e f i c i e n c y : in utero adoptive transfer o f g e n e t i c a l l y corrected h e m a t o p o i e t i c progenitors results i n engraftment but not a m e l i o r a t i o n o f disease. H u m G e n e T h e r 10: 1521-32. M a c D o n a l d M E , Scott H S , W h a l e y W L , P o h l T , W a s m u t h J J , L e h r a c h H , M o r r i s C P , F r i s c h a u f A M , H o p w o o d J J , G u s e l l a J F (1991) H u n t i n g t o n d i s e a s e - l i n k e d l o c u s D 4 S 1 1 1 e x p o s e d as the a l p h a - L - i d u r o n i d a s e gene. S o m a t C e l l M o l G e n e t 17: 2 1 - 5 . M a n s h o u r i T , Y a n g Y , L i n H , Stass S A , G l a s s m a n A B , K e a t i n g M J , A l b i t a r M (1997) D o w n r e g u l a t i o n o f R A R a l p h a i n m i c e b y antisense transgene leads to a c o m p e n s a t o r y increase i n R A R beta and R A R g a m m a and d e v e l o p m e n t o f l y m p h o m a . B l o o d 89: 2 5 0 7 15. M a r k o v i c h D , B i s s i g M , Sorribas V , H a g e n b u c h B , M e i e r P J , M u r e r H (1994) E x p r e s s i o n o f rat renal sulfate transport systems i n X e n o p u s l a e v i s oocytes. F u n c t i o n a l characterization and m o l e c u l a r i d e n t i f i c a t i o n . J B i o l C h e m 2 6 9 : 3 0 2 2 - 6 . M c K u s i c k V A , N e u f e l d E F (1983) T h e m u c o p o l y s a c c h a r i d e storage disesases. In.-Stanbury J B . W y n g a a r d e n J B , F r e d r i c k s o n D S , G o l d s t e i n J L , B r o w n M S (eds): T h e M e t a b o l i c basis o f Inherited disease, 5  t h  Edition. N e w Y o r k : M c G r a w - H i l l , pp 751-777.  171  M e d b e r r y S L , D a l e E , Q i n M , O w D W (1995) I n t r a - c h r o m o s o m a l rearrangements generated b y C r e - l o x site-specific r e c o m b i n a t i o n . N u c l e i c A c i d s R e s 2 3 : 4 8 5 - 9 0 . M e e r t e n s L , Z h a o Y , R o s i c - K a b l a r S, L i L , C h a n K , D o b s o n H , G a r t l e y C , L u t z k o C , H o p w o o d J , K o h n D , K r u t h S, H o u g h M R , D u b e I D (2002) In utero i n j e c t i o n o f a l p h a - L i d u r o n i d a s e - c a r r y i n g retrovirus i n canine m u c o p o l y s a c c h a r i d o s i s type I: i n f e c t i o n o f m u l t i p l e tissues and neonatal gene e x p r e s s i o n . H u m G e n e T h e r 13: 1809-20. M o s e l e y R H , H o g l u n d P , W u G D , S i l b e r g D G , H a i l a S, de l a C h a p e l l e A , H o l m b e r g C , K e r e J (1999) D o w n r e g u l a t e d i n a d e n o m a gene encodes a c h l o r i d e transporter defective i n c o n g e n i t a l c h l o r i d e diarrhea. A m J P h y s i o l 2 7 6 : G 1 8 5 - 9 2 . M o u n t f o r d P , Z e v n i k B , D u w e l A , N i c h o l s J , L i M , D a n i C , R o b e r t s o n M , C h a m b e r s I, S m i t h A (1994) D i c i s t r o n i c targeting constructs: Reporters and m o d i f i e r s o f m a m m a l i a n gene expression. P r o c N a t l A c a d S c i U S A 9 1 : 4 3 0 3 - 4 3 0 7 . N a g y A (1997) F o r m a t i o n o f m o u s e c h i m e r i c e m b r y o s f r o m E S c e l l s . In: H o u d e b i n e L M , editor. A m s t e r d a m : H a r w o o d A c a d e m i c P u b l i s h e r s , p 1 6 7 - 1 7 2 . N a g y A ( 2 0 0 0 ) C r e r e c o m b i n a s e : the u n i v e r s a l reagent for g e n o m e t a i l o r i n g . G e n e s i s 2 6 : 99-109. N a g y A , M a r L (2001) C r e a t i o n a n d use o f a C r e r e c o m b i n a s e transgenic database. M e t h o d s M o l B i o l 158: 9 5 - 1 0 6 . N a g y A , R o s s a n t J , N a g y R , A b r a m o w - N e w e r l y W , R o d e r J C (1993) D e r i v a t i o n o f c o m p l e t e l y c e l l c u l t u r e - d e r i v e d m i c e f r o m early-passage e m b r y o n i c stem c e l l s . P r o c N a t l A c a d S c i U S A 90: 8 4 2 4 - 8 4 2 8 . N a g y A . U R L : http://www.msliri.on.ca/develop/nagy/Cre.htm. N e u f e l d E F (1991) L y s o s o m a l storage diseases. A n n R e v B i o c h e m 6 0 : 2 5 7 - 2 8 0 . N e u f e l d E F , M u e n z e r J (1995) T h e m u c o p o l y s a c c h a r i d o s e s . In: S c r i v e r C R , B e a u d e t A L , S l y W S , V a l l e D , eds. T h e m e t a b o l i c and m o l e c u l a r bases o f inherited disease, 7th edn. N e w Y o r k : M c G r a w H i l l : 2427-2839. N i w a H , Y a m a m u r a K , M i y a z a k i J (1991) E f f i c i e n t s e l e c t i o n for h i g h - e x p r e s s i o n transfectants w i t h a n o v e l e u k a r y o t i c vector. G e n e 108: 193-200. N o v a k A , G u o C , Y a n g W , N a g y A , L o b e C G (2000) Z / E G , a d o u b l e reporter m o u s e l i n e that expresses enhanced green fluorescent p r o t e i n u p o n C r e - m e d i a t e d e x c i s i o n . G e n e s i s 28: 147-55. O'Connor L H , Erway L C , Vogler C A , Sly W S , Nicholes A , Grubb J, Holmberg S W , L e v y B , Sands M S (1998) E n z y m e replacement therapy for m u r i n e m u c o p o l y s a c c h a r i d o s i s type V I I leads to i m p r o v e m e n t s i n b e h a v i o r and auditory f u n c t i o n . J C l i n Invest 1 0 1 : 1394-400.  172  O ' G o r m a n S, F o x D T , W a h l G M (1991) R e c o m b i n a s e - m e d i a t e d gene a c t i v a t i o n and sitespecific integration i n m a m m a l i a n c e l l s . S c i e n c e 2 5 1 : 1351-5. P e a r s o n A D (1986) S u r v e y o f preparative r e g i m e n s and c o m p l i c a t i o n s o f bone m a r r o w transplantation i n patients w i t h l y s o s o m a l storage diseases. B i r t h Defects O r i g A r t i e Ser 2 2 : 153-62. Peters C , B a l t h a z o r M , S h a p i r o E G , K i n g R J , K o l l m a n C , H e g l a n d J D , H e n s l e e - D o w n e y H , T r i g g M E , C o w a n M J , Sanders J , B u n i n N , W e i n s t e i n H , L e n a r s k y C , F a l k P , H a r r i s R , B o w e n T , W i l l i a m s T E , G r a y s o n G H , W a r k e n t i n P , Sender L , C o o l , V A , C r i t t e n d e n M , P a c k m a n S, K a p l a n P , L o c k m a n L A , A n d e r s o n J , K r i v i t W , D u n s e n b e r y K , W a g n e r J (1996) O u t c o m e o f U n r e l a t e d d o n o r bone m a r r o w transplantation i n 4 0 c h i l d r e n w i t h H u r l e r s y n d r o m e . B l o o d 87: 4 8 9 4 - 4 9 0 2 . Piatt F M , N e i s e s G R , R e i n k e n s m e i e r G , T o w n s e n d M J , P e r r y V H , P r o i a R L , W i n c h e s t e r B , D w e k R A , Butters T D (1997) P r e v e n t i o n o f l y s o s o m a l storage i n T a y - S a c h s m i c e treated w i t h N - b u t y l d e o x y n o j i r i m y c i n . S c i e n c e 2 7 6 : 4 2 8 - 4 3 1 . P o e n a r u L (1997) F i r s t trimester prenatal d i a g n o s i s o f m e t a b o l i c diseases. Prenat d i a g n 7: 333. P o s t i c C , S h i o t a M , N i s w e n d e r K D , Jetton T L , C h e n Y , M o a t e s J M , S h e l t o n K D , L i n d n e r J , C h e r r i n g t o n A D , M a g n u s o n M A (1999) D u a l roles for g l u c o k i n a s e i n glucose homeostasis as determined b y l i v e r and pancreatic beta c e l l - s p e c i f i c gene k n o c k - o u t s u s i n g C r e recombinase. J B i o l C h e m 2 7 4 : 3 0 5 - 1 5 . Raben N , L u N , Nagaraju K , Rivera Y , Lee A , Y a n B , Byrne B , M e i k l e P J , U m a p a f h y s i v a m K , H o p w o o d J J , P l o t z P H (2001) C o n d i t i o n a l tissue-specific e x p r e s s i o n o f the a c i d alpha-glucosidase ( G A A ) gene i n the G A A k n o c k o u t m i c e : i m p l i c a t i o n s for therapy. H u m M o l G e n e t 10: 2 0 3 9 - 4 7 . R a u c h U , F e n g K , Z h o u X H (2001) N e u r o c a n : a b r a i n c h o n d r o i t i n sulfate p r o t e o g l y c a n . C e l l M o l L i f e S c i 58: 1842-56. R e g e e r R R , L e e A , M a r k o v i c h D (2003) C h a r a c t e r i z a t i o n o f the h u m a n sulfate a n i o n transporter (hsat-1) p r o t e i n and gene ( S A T 1 ; S L C 2 6 A 1 ) . D N A C e l l B i o l 2 2 : 107-17. Reuser A J , V a n D e n Hout H , Bijvoet A G , K r o o s M A , Verbeet M P , V a n D e r P l o e g A T (2002) E n z y m e therapy for P o m p e disease: f r o m science to i n d u s t r i a l enterprise. E u r J P e d i a r 161 S u p p l 1: S 1 0 6 - 1 1 . R o s s C J , Bastedo L , M a i e r S A , Sands M S , C h a n g P L (2000) Treatment o f a l y s o s o m a l storage disease, m u c o p o l y s a c c h a r i d o s i s V I I , w i t h m i c r o e n c a p s u l a t e d r e c o m b i n a n t c e l l s . H u m Gene Ther  11:2117-27.  R o s s C J , R a l p h M , C h a n g P L (2000) S o m a t i c gene therapy for a neurodegenerative disease u s i n g m i c r o e n c a p s u l a t e d r e c o m b i n a n t c e l l s . E x p N e u r o l 166: 2 7 6 - 8 6 .  173  R o u b i c e k M , G e h l e r J , Spranger J (1985) T h e c l i n i c a l spectrum o f a l p h a - L - i d u r o n i d a s e deficiency. A m J M e d Genet 20: 471-481. R o u g h l e y P J , L e e E R (1994) C a r t i l a g e p r o t e o g l y c a n s : structure and potential functions. M i c r o s c Res T e c h 28: 385-97. Russell C , Hendson G , Jevon G , Matlock T, Y u J, Aklujkar M , N g K Y , Clarke L A (1998) M u r i n e M P S I: insights into the pathogenesis o f H u r l e r s y n d r o m e . C l i n Genet 5 3 : 349-61. Sakai K , H i r i p i L , G l u m o f f V , Brandau O , Eerola R , V u o r i o E , B o s z e Z , Fassler R , A s z o d i A (2001) Stage-and tissue-specific e x p r e s s i o n o f a C o l 2 a l - C r e f u s i o n gene i n transgenic m i c e . M a t r i x B i o l 19: 761-7. Sands M S , B a r k e r J E , V o g l e r C , L e v y B , G w y n n B , G a l v i n N , S l y W S , B i r k e n m e i e r E (1993) Treatment o f m u r i n e m u c o p o l y s a c c h a r i d o s i s type V I I b y syngeneic bone m a r r o w transplantation i n neonates. L a b Invest 68: 6 7 6 - 8 6 . Sands M S , V o g l e r C , T o r r e y A , L e v y B , G w y n n B , G r u b b J , S l y W S , B i r k e n m e i e r E H ( 1 9 9 7 ) M u r i n e m u c o p o l y s a c c h a r i d o s i s type V I I : l o n g t e r m therapeutic effects o f e n z y m e replacement a n d e n z y m e replacement f o l l o w e d b y bone m a r r o w transplantation.  J Clin  Invest 99: 1596-1605. S c h e i e H G , H a m b r i c k G W , Barness L A (1962) A n e w l y r e c o g n i s e d forme fruste o f H u r l e r ' s disease ( g a r g o y l i s m ) . A m e r J O p h a t h a l 5 3 : 7 5 3 - 7 6 9 . Scott H S , A n s o n D A , O r s b o r n A M , N e l s o n P V , C l e m e n t s P , M o r r i s C P and H o p w o o d J J (1991) H u m a n a l p h a - L - i d u r o n d i d a s e : c D N A i s o l a t i o n and e x p r e s s i o n . P r o c N a t l A c a d S c i U S A 88: 9695-9699. Scott H S , B u n g e S, G a l A , C l a r k e L A , M o r r i s C P , H o p w o o d J J (1995) M o l e c u l a r genetics o f m u c o p o l y s a c c h a r i d o s i s type I: d i a g n o s t i c , c l i n i c a l , and b i o l o g i c a l i m p l i c a t i o n s . H u m M u t 6: 2 8 8 - 3 0 2 . Scott H S , G u p X - H , H o p w o o d J J , M o r r i s C P (1992) Structure and sequence o f the h u m a n a l p h a - L - i d u r o n i d a s e gene. G e n o m i c s 13: 1 3 1 1 - 1 3 1 3 . Scott H S , L i t j e n s T , N e l s o n P V , T h o m p s o n P R , B r o o k s D A , H o p w o o d J J , M o r r i s C P (1993) I d e n t i f i c a t i o n o f mutations i n the a l p h a - L - i d u r o n i d a s e gene ( I D U A ) that cause H u r l e r and S c h e i e s y n d r o m e s . A m e r J H u m G e n 5 3 : 9 7 3 - 8 6 . S h a p i r o E G , L o c k m a n L A , B a l t h a z o r M , K r i v i t W (1995) N e u r o p s y c h o l o g i c a l o u t c o m e s o f several storage diseases w i t h and w i t h o u t bone m a r r o w transplantation.  J Inner M e t a b  Dis 18:413-429. S h a p i r o E G , L o c k m a n L A , B a l t h a z o r M , K r i v i t W (1995) N e u r o p s y c h o l o g i c a l o u t c o m e s o f several storage diseases w i t h and w i t h o u t bone m a r r o w transplantation. J Inherit M e t a b D i s 18:413-29.  174  S h e l l e y S, and A r n a o u t A (1991) T h e p r o m o t e r o f the C D 1 I B gene directs m y e l o i d specific and d e v e l o p m e n t a l l y regulated e x p r e s s i o n . P r o c N a t l A c a d S c i 88: 1 0 5 2 5 - 1 0 5 2 9 . S h u l l R M , B r e i d e r M A , C o n s t a n t o p o u l o s G (1988) L o n g - t e r m n e u r o l o g i c a l effects o f bone m a r r o w transplantation i n a canine l y s o s o m a l storage disease. P e d i a R e s 24: 3 4 7 352. S h u l l R M , K a k k i s E D , M c E n t e e M F , K a n i a S A , Jonas A J , N e u f e l d E F (1994) E n z y m e replacement i n a canine m o d e l o f H u r l e r s y n d r o m e . P r o c N a t l A c a d S c i U S A 9 1 : 1293741. S h u l l R M , L u X , M c E n t e e M F , B r i g h t R M , P e p p e r K A , K o h n D B (1996) M y o b l a s t gene therapy i n canine m u c o p o l y s a c c h a r i d o s i s . I: A b r o g a t i o n b y a n i m m u n e response to alphaL - i d u r o n i d a s e . H u m G e n e T h e r 7: 1595-603. S h u l l R M , M u n g e r R J , S p e l l a c y E , H a l l C W , C o n s t a n t o p o u l o s G , N e u f e l d E (1982) A n i m a l m o d e l o f h u m a n disease. C a n i n e a - L - i d u r o n i d a s e d e f i c i e n c y : a m o d e l o f m u c o p o l y s a c c h a r i d o s i s I. A m J P a t h o l 2 4 4 - 2 4 8 . S h u l l R M , W a l k e r M A (1988) R a d i o g r a p h i c f i n d i n g s i n a canine m o d e l o f m u c o p o l y s a c c h a r i d o s i s I: changes associated w i t h bone m a r r o w transplantation. Invest R a d i o l 2 3 : 124-130. S n y d e r E Y , T a y l o r R M , W o l f e J H (1995) N e u r a l progenitor c e l l engraftment  corrects  l y s o s o m a l storage throughout the M P S V I I m o u s e b r a i n . N a t u r e 3 7 4 : 3 6 7 - 7 0 . S o n g H H , F i l m u s J (2002) T h e role o f g l y p i c a n s i n m a m m a l i a n d e v e l o p m e n t . B i o c h i m B i o p h y s A c t a 1573: 2 4 1 - 6 . Soper B W , Lessard M D , V o g l e r C A , L e v y B , B e a m e r W G , S l y W S , B a r k e r J E (2001) N o n a b l a t i v e neonatal m a r r o w transplantation attenuates functional a n d p h y s i c a l defects o f beta-glucuronidase d e f i c i e n c y . B l o o d 9 7 : 1498-504. S o u t h e r n E M (1975) D e t e c t i o n o f specific sequences a m o n g D N A fragments separated b y g e l electrophoresis. J M o l B i o l 9 8 : 5 0 3 - 5 1 7 . Stevenson R E , H o w e l l R R , M c K u s i c k V A , Suskind R , H a n s o n J W , Elliott D E , N e u f e l d E F (1976) T h e iduronidase-deficient m u c o p o l y s a c c h a r i d o s e s : c l i n i c a l and roentgenographic features. P e d i a t r i c s 57: 111-122. Stoltzfus L J , S o s a - P i n e d a B , M o s k o w i t z S M , M e n o n K P , D l o t t B , H o o p e r L , T e p l o w D B , S h u l l R M , N e u f e l d E F (1992) C l o n i n g and c h a r a c t e r i z a t i o n o f c D N A e n c o d i n g canine alpha-L-iduronidase. m R N A deficiency i n mucopolysaccharidosis I dog. J B i o l C h e m 267: 6570-5. S u z u k i K (1965) T h e pattern o f m a m m a l i a n b r a i n gangliosides-II. E v a l u a t i o n o f the e x t r a c t i o n procedures, p o s t - m o r t e m changes a n d the effect o f f o r m a l i n preservation. J N e u r o c h e m 12: 6 2 9 - 6 3 8 .  175  T a y l o r R M , W o l f e J H (1997) D e c r e a s e d l y s o s o m a l storage i n the adult M P S V I I m o u s e b r a i n i n the v i c i n i t y o f grafts o f r e t r o v i r a l vector-corrected fibroblasts secreting h i g h levels o f beta-glucuronidase. N a t M e d 3: 771 -4. T o r z i l l i P A , A r d u i n o J M , G r e g o r y J D , B a n s a l M (1997) Effect o f p r o t e o g l y c a n r e m o v a l o n solute m o b i l i t y i n articular cartilage. J B i o m e c h 3 0 : 8 9 5 - 9 0 2 . V o g l e r C , L e v y B , G a l v i n N J , T h o r p e C , Sands M S , B a r k e r J E , B a t y J , B i r k e n m e i e r E H , S l y W S (1999) E n z y m e replacement i n m u r i n e m u c o p o l y s a c c h a r i d o s i s type V I I : n e u r o n a l and g l i a l response to beta-glucuronidase requires early i n i t i a t i o n o f e n z y m e replacement therapy. Pediatr R e s 4 5 : 838-44. V o g l e r C , Sands M S , L e v y B , G a l v i n N , B i r k e n m e i e r E H , S l y W S (1996) E n z y m e replacement w i t h r e c o m b i n a n t beta-glucuronidase i n m u r i n e m u c o p o l y s a c c h a r i d o s i s type V I I : i m p a c t o f therapy d u r i n g the first s i x w e e k s o f life o n subsequent l y s o s o m a l storage, g r o w t h , a n d s u r v i v a l . Pediatr R e s 3 9 : 1050-4. V o n F i g u r a K . , H a s i l i k A (1986) L y s o s o m a l e n z y m e s and their receptors. A n n R e v B i o c h e m 5 5 : 167-93. W a l k l e y S U (1995) P y r a m i d a l neurons w i t h e c t o p i c dendrites i n storage diseases e x h i b i t increased G M 2 g a n g l i o s i d e i m m u n o r e a c t i v i t y . N e u r o s c i e n c e 6 8 : 1 0 2 7 - 1 0 3 5 . W a l k l e y S U , H a s k i n s M E , S h u l l R M (1988) A l t e r a t i o n s i n n e u r o n m o r p h o l o g y i n m u c o p o l y s a c c h a r i d o s i s type I: a G o l g i study. A c t a N e u r o p a t h o l 7 5 : 6 1 1 - 6 2 0 . W a t t s W E , G i b b s D A (1986) L y s o s o m a l storage diseases: b i o c h e m i c a l a n d c l i n i c a l aspects. T a y l a r and F r a n c i s , L o n d o n p u b s 1986. W h i t l e y , B , R i d n o u r , M D , D r a p e r , K A , D u t t o n , C M , N e g l i a , J P (1989) D i a g n o s t i c test for m u c o p o l y s a c c h a r i d o s i s I. D i r e c t m e t h o d for q u a n t i f y i n g excessive u r i n a r y glycosaminoglycan excretion. C l i n C h e m 35: 374-379. W o o d S A , A l l e n N D , Rossant J , A u e r b a c h A , N a g y A (1993) N o n - i n j e c t i o n methods for the p r o d u c t i o n o f e m b r y o n i c stem c e l l - e m b r y o chimeras. N a t u r e 3 6 5 : 8 7 - 8 9 . W r a i t h J E (2001) E n z y m e replacement therapy i n m u c o p o l y s a c c h a r i d o s i s type I: progress and e m e r g i n g d i f f i c u l t i e s . J Inherit M e t a b D i s 2 4 : 2 4 5 - 5 0 . W u r s t W , J o y n e r A (1993) P r o d u c t i o n o f targeted e m b r y o n i c stem c e l l c l o n e s . I n G e n e T a r g e t i n g : A P r a c t i c a l A p p r o a c h . ( E d . A . J o y n e r ) , 3 3 - 6 2 . I R L Press at O x f o r d U n i v e r s i t y Press X i n H B , D e n g K Y , R i s h n i w M , J i G , K o t l i k o f f M I (2002) S m o o t h m u s c l e e x p r e s s i o n o f C r e r e c o m b i n a s e and e G F P i n transgenic m i c e . P h y s i o l G e n o m i c s 10: 2 1 1 - 5 .  176  Z i n y k D L , M e r c e r E H , H a r r i s E , A n d e r s o n D J , J o y n e r A L (1998) Fate m a p p i n g o f the m o u s e m i d b r a i n - h i n d b r a i n c o n s t r i c t i o n u s i n g a site-specific r e c o m b i n a t i o n system. C u r r B i o l 8: 6 6 5 - 8 .  177  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0099792/manifest

Comment

Related Items