UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Cytokine network in the human central nervous system Lee, Yong Beom 1999

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1999-389251.pdf [ 7.35MB ]
Metadata
JSON: 831-1.0099455.json
JSON-LD: 831-1.0099455-ld.json
RDF/XML (Pretty): 831-1.0099455-rdf.xml
RDF/JSON: 831-1.0099455-rdf.json
Turtle: 831-1.0099455-turtle.txt
N-Triples: 831-1.0099455-rdf-ntriples.txt
Original Record: 831-1.0099455-source.json
Full Text
831-1.0099455-fulltext.txt
Citation
831-1.0099455.ris

Full Text

CYTOKINE NETWORK IN THE HUMAN CENTRAL NERVOUS SYSTEM by YONG BEOM LEE B.Sc, Yon Sei University, 1981 M.Sc., Yon Sei University, 1983 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENT FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Department of Medicine, Experimental Medicine Program) We accept this thesis as conforming to the required standard  THE UNIVERSITY OF BRITISH COLUMBIA April 1999 ©YongBeomLee, 1999  In  presenting  degree  at  this  the  thesis  in  partial  fulfilment  of  University  of  British  Columbia,  I agree  freely available for copying  of  department publication  this or of  reference  thesis by  this  for  his  and study. scholarly  or  thesis  for  her  Department  of  Medici  The University of British Vancouver, Canada  Date  DE-6 (2/88)  April  30,  Columbia  W<\  purposes  gain  shall  requirements that  agree  may  representatives.  financial  permission.  I further  the  It not  be is  that  the  permission  granted  allowed  an  advanced  Library shall  by  understood be  for  for  the that  without  make  it  extensive  head  of  my  copying  or  my  written  Abstract  Expression of various cytokines and their receptors in human CNS neurons and glial cells in culture was investigated using RT-PCR, ELISA and immunoblotting. Pure populations of astrocytes, microglia and neurons were prepared from mixed cell cultures isolated from brains of human embryos (12-18 weeks'gestation), and oligodendrocytes were prepared from adult human brain tissues. RT-PCR results of cytokines and their receptors were as follows: (1) Non-stimulated astrocytes expressed transcripts for fL-9, IL-11, EL-15, TGF-a, TGF-pl, CNTF, LIF and SCF. Treatment with IL-1 [3 and IFN-y induced expression of IL-lp, IL-6, IL-8, TNF-a and GMCSF and increased expression of IL-9 and IL-15 in astrocytes. Transcripts for IL-1RI, IL-6R, IL-8R, IL-9Ra, IL-lORa, IL-11R, IL-12Rp2, IL-13Ra, IL-15Ra, TNFRI, SCFR and gpl30 were detected in unstimulated astrocytes, while expression of IL-IRTJ and TNFRII was induced following stimulation with IL-1 (3 and IFN-y. (2) In unstimulated microglia, low levels of transcripts for IL-lp, IL-6, IL-10, IL-15, TNF-a, TGF-a, TGF-pl, and IL-1RI, IL1RH, IL-6R, IL-8R, IL-9Ra, IL-lORa, IL-12Rp2, IL-13Ra, IL-15Ra, TNFRI, TNFRII and gpl30 were detected. Treatment of microglia with LPS and IFN-y induced expression of IL-8 and IL-12 and increased expression of transcripts for IL-ip, IL-6, IL-10, IL-15 and TNF-a. (3) Neurons expressed transcripts for IL-5, TGF-pl, LIE, and IL-8R, IL-9Ra, IL-13Ra, TNFRI and gpl30. (4) Oligodendrocytes expressed transcripts for IL-lp, TGF-a, TGF-pl and CNTF, and for IL-1RI, 1L-6R, IL-8R, IL-9Ra, IL-13Ra, TNFRII, SCFR and gpl30.  ii  Secretion of selected cytokines from astrocytes and microglia was determined by ELISA and immunoblotting. (1) In astrocytes, treatment with IL-ip resulted in increased levels of IL-6, IL-11, IL-15, but not with IFN-y. IL-9 was secreted constitutively, and its protein level was not changed with IL-1 (3 or IFN-y. (2) In microglia, IL-6 secretion was increased by LPS treatment, but not by IFN-y or TNF-a. As well, IL-15 secretion was increased by LPS or IFN-y treatment. TNF-a secretion was increased by treatment with LPS, and demonstrated a synergistic effect with IFN-y for TNF-a production. Effects of selected cytokines were studied on NO and TNF-a production in astrocytes and microglia respectively. IL-10 inhibited the TNF-a production (>90%) in LPS/TEN-y treated microglia. NO production in IL-ip/TFN-y -treated astrocytes was not altered by any of the cytokines examined. In addition, p38 MAP kinase was found to be involved in the upregulation of TNF-a mRNA in microglia, while in IL-1 p -treated astrocytes it was involved in the upregulation of translation of TNF-a mRNA. Selected cytokines including IL-9, IL-11 and IL-15 showed neurotrophic activities such as neuronal differentiation and survival of human embryonic neurons.  iii  Table of Contents  Abstract  ii  Table of Contents  iv  List of Figures  vii  List of Tables  x  List of Abbreviations  xi  Acknowledgments Chapter 1  xiv  General Introduction  1.1  Cytokines  1.2  Cytokines in the central nervous system 1.2.1 Cytokines and inflammatory responses in the CNS 1.2.2 Cytokines and neurological disease Objectives  1.3  Chapter 2 2.1 2.2  2.3  2.4  1 1 2 10 14  Primary cultures of human CNS cells  Introduction Materials and methods 2.2.1 Cell preparation 2.2.2 Immunocytochemistry 2.2.3 RT-PCR analysis Results 2.3.1 Highly enriched cultures of human astrocyes 2.3.2 Highly enriched cultures of human microglia 2.3.3 Highly enriched cultures of human neurons 2.3.4 Highly enriched cultures of human oligodendrocytes Discussion  iv  15 16 16 18 20 22 22 22 23 23 28  Chapter 3 3.1 3.2  3.3  3.4  Introduction Materials and methods 3.2.1 Cytokine mRNA expressions 3.2.2 Cytokine protein expressions Results 3.3.1 Cytokine expressions in human astrocytes 3.3.2 Cytokine expressions in human microglia 3.3.3 Cytokine expressions in human neurons 3.3.4 Cytokine expressions in human oligodendrocytes Discussion 3.4.1 Proinflammatory cytokines in human CNS 3.4.2 Anti-inflammatory cytokines in human CNS 3.4.3 Hematopoietic growth factors in human CNS  Chapter 4 4.1 4.2 4.3  4.4  5.3 5.4  30 43 43 44 47 47 48 49 49 62 63 66 68  Cytokine Receptor Expressions in Human CNS Cells  Introduction Materials and methods 4.2.1 Cytokine receptor mRNA expression Results 4.3.1 Cytokine receptor expressions in human astrocytes 4.3.2 Cytokine receptor expressions in human microglia 4.3.3 Cytokine receptor expressions in human neurons 4.3.4 Cytokine receptor expressions in human oligodendrocytes Discussion 4.4.1 Expression of interleukin-1 receptor (IL-1R) 4.4.2 Expression of tumor necrosis factor receptor (TNFR) 4.4.3 Expression of interleukin-12 receptor (BL-12R) 4.4.4 Expression of receptors for IL- 10,and IL-13 4.4.5 Expression of receptors for IL-2, -3, -4, -5, -7, -8, -9, and IL-15 4.4.6 Expression of receptors for IL-6 family of cytokines  Chapter 5 5.1 5.2  Cytokine Expressions in Human CNS Cells  70 80 80 83 83 84 84 85 91 92 93 96 97 98 100  Neurotrophic Effects of Cytokines on Human Neurons  Introduction Materials and methods 5.2.1 Effect of IL-9, IL-11, and IL-15 on human embryonic neurons 5.2.2 Immunochemistry Results Discussion  v  102 103 103 103 104 107  Chapter 6  6.1 6.2  6.3  6.4  Introduction Materials and methods 6.2.1 Cell culture 6.2.2 Cytokine treatment 6.2.3 Nitrite assay Results 6.3.1 Cytokines as immune-modulators production by astrocytes 6.3.2 Cytokines as immune-modulators by microglia Discussion 6.4.1 Cytokines as immune modulators production by human astrocytes 6.4.2 Cytokines as immune modulators by human microglia  Chapter 7 7.1 7.2  7.3  7.4  Effects of Cytokines on NO and TNF-a production in human glial cells 109 Ill Ill Ill 112 113 of nitric oxide (NO) 113 of TNF-a production 113 118 of nitric oxide (NO) 118 of TNF-a production 120  TNF-a production in human glial cells via p38 MAP kinase  Introduction Materials and methods 7.2.1 Cell culture 7.2.2 Treatment with SB203580, a p38 MAP Kinase inhibitor 7.2.3 Determination of TNF-a mRNA  122 124 124 124 124  7.2.4  125  TNF-a ELISA  Results 7.3.1 Effect of SB203580, a p38 MAP kinase inhibitor, on TNF-a mRNA levels 7.3.2 Inhibition of TNF-a production by SB203580 Discussion  Chapter 8  Conclusions  126 126 126 131 135  References  144  vi  List of Figures Fig. 2.1  A highly enriched culture of human astrocytes  24  Fig. 2.2  A highly enriched culture of human microglia  25  Fig. 2.3  A highly enriched culture of human neurons  26  Fig. 2.4  A highly enriched culture of human oligodendrocytes  27  Fig. 3.1  RT-PCR analysis of mRNA expression for cytokines in human astrocytes culture  Fig. 3.2  50  RT-PCR analysis of mRNA expression for cytokines in human microglia culture  Fig. 3.3  51  RT-PCR analysis of mRNA expression for cytokines in human neuron culture  Fig. 3.4  52  RT-PCR analysis of mRNA expression for cytokines in human oligodendrocytes culture  53  Fig. 3.5  IL-6 production in human astrocyte cultures  54  Fig. 3.6  Immunodetection analysis of IL-9 secretion in cultured human astrocytes  55  Fig. 3.7  IL-11 production in human astrocyte cultures  56  Fig. 3.8  Immunodetection analysis of IL-15 secretion in cultured human astrocytes  57  Fig. 3.9  IL-6 production in human microglia cultures  58  Fig. 3.10  TNF-a production in human microglia cultures  59  vii  Fig. 3.11  Immunodetection analysis of IL-15 secretion in cultured human microglia  Fig. 4.1  60  RT-PCR analysis of mRNA expression for cytokine receptors in human astrocytes culture  Fig. 4.2  86  RT-PCR analysis of mRNA expression for cytokine receptors in human microglia culture  Fig. 4.3  87  RT-PCR analysis of mRNA expression for cytokine receptors in human neuron culture  Fig. 4.4  88  RT-PCR analysis of mRNA expression for cytokine receptors in human oligodendrocytes culture *  Fig. 5.1  89  Effect of IL-9, IL-11 and IL-15 on neuronal differentiation or survival of human embryonic neurons in culture  Fig. 5.2  105  Effect of IL-9, IL-11 and IL-15 on MAP2 cell number in +  human embryonic brain culture  106  Fig. 6.1  Effect of cytokines on nitrite production in human astrocytes  115  Fig. 6.2  Effect of pretreatment with cytokines on nitrite production in human astrocyte cultures  Fig. 6.3  116  Effect of pretreatment with cytokines on TNF-a production in human microglia cultures  Fig. 7.1  117  Effect of SB203580, a p38 MAP kinase inhibitor, on BL-lp-induced TNF-a mRNA expression in human astrocytes  viii  127  Fig. 7.2  Effect of SB203580, a p38 MAP kinase inhibitor, on LPS-induced TNF-a mRNA expression in human microglia  Fig. 7.3  SB203580, a p38 MAP kinase inhibitor, reduces IL-ip-induced TNF-a production in human astrocytes  Fig. 7.4  128  129  SB203580, a p38 MAP kinase inhibitor, reduces LPS-induced TNF-a production in human microglia  130  Fig. 8.1  Pro-inflammatory cytokines in the human CNS  140  Fig. 8.2  Anti-inflammatory cytokines in the human CNS  141  Fig. 8.3  Cytokines as growth factors in the human CNS  142  Fig. 8.4  Cytokine network in the human CNS  143  ix  List of Tables Table 3.1  Primer sequences used for PCR amplification of cytokine cDNA  45  Table 3.2  Cytokine gene expression in human CNS cell culture  61  Table 4.1  Primer sequences used for PCR amplification of cytokine  Table 4.2  receptor cDNA  81  Cytokine receptor gene expression in human CNS cell culture  90  x  List of Abbreviations Amyloid p-peptide ACh  Acetylcholine  AD  Alzheimer's disease  AGPC  Acidguanidinium/phenol/chloroform  AIDS  Aquired immunodeficiency syndrome  APCs  Antigen presenting cells  APP  p-amyloid precursor protein  ARE  AU-rich element  BBB  Blood-brain barrier  BDNF  Brain derived neurotrophic factor  bFGF  basic fibroblast growth factor  CNPase  2',3'-cyclic nucleotide phosphodiesterase  CNS  Central nervous system  CNTF  Ciliary neurotrohic factor  CSAIDs  Cytokine suppressive anti-inflammatory drugs  CSF  Cerebrospinal fluid  CSF  Colony stimulating factor  DMEM  Dulbecco's modified Eagle medium  4E-BPs  eIF4E binding proteins  EAE  Experimental allergic encephalitis  ERK  Exracellular signal-regulated kinase  FdU  5' fluoro-2'-deoxyuridine  GDGF  Glial-derived growth factor  GFAP  Glial fibrillary acidic protein  ICAM-1  Intercellular adhesion molecule 1  TEN  Interferon  Ig  Immunoglobulin  IGF-1  Insuline like growth factor-1  TL-IR  Interleukin-1 receptor xi  TL-lRa  IL-1R antagonist  ILs  Interleukins  iNOS  Inducible nitric oxide synthase  JNK  c-jun N-terminal kinase  LFA-1  Leukocyte function-associated molecule 1  LIF  Leukaemia inhibitory factor  LPS  Lipopolysaccharide  LTP  Long-term potentiation  MAG  myelin-associated glycoprotein  MAP2  Microtuble associated protein 2  MAPK  Mitogen-activated protein kinase  MAPKK  MAP kinase kinase  MBP  Myelin basic protein  MHC  Major histocompatibilly complex  M-MLV  Moloney murine leukemia virus  MS  Multiple sclerosis  NF  Neurofilament  NF-KB  Nuclear factor KB  NGF  Nerve growth factor  NK  Natural killer  NO  Nitric oxide  NT-3  Neurotrophin-3  OSM  Oncostatin M  PBS  Phosphate-buffered saline  PDGF  Platelet derived growth factor  PKC  Protein kinase C  PLP  Proteolipid protein Common (3-chain  Ry  c  RT-PCR  Common y-chain Reverse transcription polymerase chain reaction xii  SAPK  Stress-activated protein kinase  SCF  Stem cell factor  SLF  Steel locus factor  TGFp  Transforming growth factor |3  Thl  Type 1 T-helper cells  Th2  Type 2 T helper cells  TNF  Tumor necrosis factor  TNFR  TNF receptor  3'-UTR  3' untranslated region  xiii  Acknowledgments I am grateful to my supervisor Dr. Seung U. Kim for his time, encouragement and enthusiasm, and for giving me the opportunity to complete this study. I am also grateful to Dr. Nam S. Choi for arranging my position at UBC when I was at the LG Chemical Institute in Korea. I wish to thank my committee members, Dr. Charles Krieger, Dr. James McLarnon and Dr. John Schrader for their guidance and suggestions, and Mohammed Iqbal Hasham, Andrew Yoo and the members of our laboratory for their help and discussions. Finally, I wish to thank my father and mother, without whom I would not be here, and my wife for her patient understanding, her support and encouragement, who has had a difficult time during the last five years while I completed my program. To them, I am eternally grateful for their everlasting love and support. I would like to dedicate this thesis to the memory of my grandfather.  xiv  Chapter 1  1.1  General Introduction  Cytokines Cytokines provide a means for intercellular communication and are essential for the  development and function of multicellular organs such as the immune, hematopoietic and nervous systems. Cytokines including interleukins (ILs), hematopoietic growth factors such as colony stimulating factors (CSFs) and stem cell factor (SCF), interferons (IFNs), tumor necrosis factors (TNFs), chemokines and growth factors, exert their biological effects through specific receptors expressed on the surface of target cells. During the past several years, a number of cytokines and their receptors have been identified and characterized at the molecular level. These studies have indicated that cytokines are pleiotropic, exhibiting a wide range of biological effects depending on the target cells. Conversely, different cytokines often elicit a similar biological effect from the same target cell. This redundancy of actions of cytokines is explained by the nature of the receptor complexes for those ligands; they share common signal transducing receptor subunits. Another characteristic feature of cytokine actions involves a type of network that is tightly regulated by synergism/antagonism, cytokine cascades, and receptor transmodulation (Geoffrey et al., 1994; Kishimoto et al., 1994; Lin etal., 1995).  1.2  Cytokines in the central nervous system The central nervous system (CNS) has been believed to be an immunologically  privileged site, since it lacks a lymphatic system and is separated from the blood by the blood-brain barrier (BBB), a specialized vasculature consisting of endothelial cells with tight 1  junctions preventing the entrance of immunological active substances and leukocytes into the CNS. However, it has been demonstrated that supernatants from activated rat lymphocytes could enhance both RNA and DNA synthesis in rat astrocytes cultures, and upon stimulation with lipopolysaccharide (LPS), cultured murine astrocytes secreted significant amounts of prostaglandin and an IL-1 like factor (Fontana et al., 1982a; 1982b; 1982c). These studies provide evidence that there is a bi-directional communication between the cells of the nervous system and the immune system. A number of experimental studies have also shown that not only immune cells, but also cells of the CNS including neurons, astrocytes, oligodendrocytes and microglia can produce cytokines in the CNS (Benveniste, 1992; Woodroofe, 1995). Their synthesis in the CNS is modulated by invading immune cells or microbe infection resulting in abnormality of cytokine homeostasis and the consequent pathogenesis of inflammatory and degenerative neurological diseases (Dickson et al.,1993; Eng et al., 1996; Griffin et al., 1998). It is also found that cytokines produced by the CNS cells modulate neuronal and glial growth during the development of the CNS and neuronal regeneration (Mehler and Kessler, 1997).  1.2.1  Cytokines and inflammatory responses in the CNS A unique difference between the CNS and other tissues is the existence of a barrier  that separates the CNS tissue from the blood. The blood-brain barrier (BBB) is established by a complex interaction between microvessel endothelial cells and the underlying basement membrane and associated cells including smooth muscle/pericytes and astrocytes. Under normal circumstances, the BBB is impenetrable to most immunological and inflammatory active substances and restricts the migration of leukocytes into the CNS. However, in 2  pathological conditions, the BBB is disrupted permitting cells of the peripheral immune system to enter the CNS as well as allowing hypertrophy and proliferation of astrocytes and microglia. Thus, it has been, suggested that bi-directional communication exists between the CNS and peripheral immune systems (Hart and Fabry, 1995).  Pathway of lymphocytes into the CNS Endothelial cells of the brain express the same adhesion molecules for leukocytes that are found on other endothelia, and use these adhesion molecules to direct leukocyte traffic into the CNS ( Hart and Fabry, 1995). For instance, intercellular adhesion molecule 1 (ICAM-1), a ligand for integrin leukocyte function-associated molecule 1 (LFA-1), was found to be expressed on CNS vessels and its expression coincided with inflammatory-cell infiltration (Cannella et al., 1990). In human brain, ICAM-1 was expressed on vessels in active plaques of multiple sclerosis (MS), and in viral encephalitic lesions (Sobel et al.,1990). ICAM-1 is upregulated by several inflammatory cytokines, such as EL-la, IFN-y and tumor necrosis factor a (TNF-a). (Satoh et al., 1991a; 1991b ;Fabry et al., 1994). The intercellular contacts between lymphoid cells and glial cells through LFA-l/ICAM-1 molecules may be relevant not only to in vitro interactions but also to in vivo cell-mediated immune reactions in the CNS.  Antigen presenting cells in the CNS Activation of T lymphocytes requires interaction with major histocompatibility complex (MHC) antigens, and co-stimulatory factors (B7-1 and B7-2) expressed by antigen presenting cells (APCs) (June et al., 1994; Mondino and Jenkins, 1994). Under pathological 3  conditions, such as experimental allergic encephalitis (EAE), MS, viral encephalitis, neoplasm, and CNS injury, MHC molecules are expressed on cerebral vascular endothelial cells, astrocytes, microglia and pericytes. MS is characterized by T cell and macrophage infiltration into the white matter, and T lymphocytes found in early MS lesions are predominantly positive for CD4, whereas CD8 T cells become more abundant at a later +  stage (Traugott et al., 1983; Cannella and Raine, 1995). A possible target of CD8 T cells is +  oligodendrocytes, myelin-producing cells in the CNS. In most actively demyelinating lesions, T cells are outnumbered by macrophage-type microglia cells which are the strongest candidates for parenchymal APC. Although astrocytes and microglia do not constitutively express class II MHC antigens, it has been found that IFN-y can induce class II MHC molecules in astrocytes and microglia in vitro (Wong et al., 1984; Fierz et al., 1985; Kim et al., 1985; Suzumura et al., 1987). TNF-a has also been reported to increase MHC class II expression on murine astrocytes (Cannella and Raine, 1995). Recent studies have indicated that B7 costimulatory molecules are expressed on human microglia in acute multiple sclerosis lesions and in culture (Williams et al., 1994; De Simone et al., 1995). It has also been shown that both B7-1 and B7-2 are expressed in a cytokine-regulated manner in cultured human microglia, but the expression of B7 was absent in astrocytes (Satoh et al., 1995). From these findings, it appears that astrocytes do not qualify as professional APCs. Human microglia constitutively express a considerable level of B7-2, but the expression of B7-1 was absent. B7-1 was, however, induced when microglia were exposed to IFN-y or granulocyte-macrophage colony stimulating factor (GM-CSF) (Satoh et al., 1995). These studies indicate that microglia but not astrocytes may be the important immunocompetent APC cell type in the CNS. 4  Inflammatory cytokines in the CNS Microglia cells are an important source of various cytokines that can manipulate the immune response in the CNS. The microglia, the resident macrophages of the CNS parenchyma, have immunophenotypes adapted to the specialized microenvironment of the CNS. However, they rapidly alter their cell-surface antigens and morphology in response to even minor pathological changes in the CNS. Activated microglia can destroy invading micro-organisms, remove deleterious debris, release several potentially cytotoxic substances in vitro, such as free oxygen intermediates, nitric oxide (NO), proteases, arachidonic-acid derivatives, excitatory amino acids and cytokines (Kreutzberg, 1996). A number of in vitro studies have demonstrated that activated microglia can produce proinflammatory cytokines such as IL-lp, IL-6, and TNF-a (Giulian, 1986; Frei, 1989; Benveniste et al., 1992; Lee et al., 1993a; Walker et al., 1995). Since one of the characteristics of microglia is their activation at a very early stage in response to injury, these cells may in turn initiate a cascade of cytokinemediated glial responses through induction of cytokines, possibly via IL-1, and cytotoxic substances. IL-1 has been shown to stimulate the production of TNF-a, IL-6, IL-8, TGF-pl, GMCSF, and G-CSF from primary astrocytes or astroglioma cells (Hopkins and Rothwell, 1995). These cytokines have wide ranging effects on glial cells themselves acting as autocrine or paracrine mediators. IL-1 (Giulian et al, 1988a; 1988b), TNF-a (Selmaj et al, 1991b), and IL-6 (Benveniste et al., 1989; Selmaj et al., 1990), have been implicated in stimulating rodent astrocyte proliferation, which is thought to contribute to the reactive astrogliosis associated with various neurological diseases. Furthermore, transgenic expression of IL-6 in the CNS by using the rat neuron-specific enolase promoter or murine GFAP promoter induces 5  astrogliosis (Campbell et al., 1993; Fattori et al., 1995). DL-ip has also been described as a mediator of neuronal death following ischemia, and IL-1 receptor (IL-1R) antagonist markedly inhibits neuronal death after cerebral ischemia (Relton and Roth well, 1992). Recent studies have shown that IL-1 is an inducer of nitric oxide (NO) in rat or human fetal astrocyte cultures when used in combination with IFN-Y (Simmons and Murphy, 1993; Lee et al., 1993b). NO is both neurotoxic (Boje and Arora, 1992; Chao et al., 1992) and gliotoxic (Merrill et al., 1993). On the other hand, IL-1 (3 has been known to induce a neurotrophic factor such as nerve growth factor (NGF) in astrocytes (Gadient et al., 1990; Bandtlow et al., 1990). TNF-a is associated with BBB disruption, as shown by albumin permeability in patients with bacterial meningitis (Sharief et al., 1992a; 1992b). Thus, the glial expression of TNF-a may mediate inflammatory responses by increasing permeability of the BBB and facilitating leukocyte adhesion and migration as well as by increasing astroglial proliferation. In addition, TNF-a has been found to kill oligodendrocytes and induce demyelination of myelinated axons (Selmaj and Raine, 1988) by indirect (Merrill et al., 1993) or direct mechanisms through TNF receptors (TNFRs) (Wilt et al., 1995). These phenomena associated with TNF-a indicate a role for IL-1 as a trigger in the cascade of CNS inflammatory reactions. Primary murine and human astrocytes can produce IL-6 in response to a variety of stimuli including virus, IL-1, TNF-a, IFN-Y plus IL-1, LPS and calcium ionophore (Frei et al., 1989; Lieberman et al., 1989; Benveniste et al., 1990; Aloisi et al., 1992; Lee et al., 1993a). The levels of IL-6 in the CNS are shown to be high in mice suffering acute EAE  (Gijbels et al., 1995), and intraventricular injection of IL-lp in rats induces high circulating levels of IL-6 (de Simoni et al., 1990). Elevated serum levels of IL-6 have also been reported in human CNS diseases (Frei et al., 1988; Hirohata and Miyamoto, 1990) but, as is true for all of the other inflammatory cytokines, the exact role of IL-6 in CNS inflammation and autoimmune disease is not yet known. These findings indicate that it is likely that cytokine cascades exist in the CNS, and that microglia and astrocytes might contribute to the inflammatory response in the CNS as major cellular sources of proinflammatory cytokines such as IL-1, TNF-a, and IL-6.  Anti-inflammatory cytokines in the CNS Microglia activation is under strict control in a normal brain, and resting microglia show a down-regulated immunophenotype adapted to the specialized microenvironment of the CNS. In the peripheral immune system, type 2 T-helper cells (Th2) produce antiinflammatory cytokines such as JL-4, IL-10 and IL-13 to down-regulate the production of proinflammatory cytokine by type 1 T-helper cells (Thl) resulting in optimal balance between these T-cell subsets and their cytokine production (Mosmann and Sad, 1996). In the CNS, a murine EAE model has shown that mRNA levels of IL-1 a, IL-2, EL-4, IL-6 and TGFP were all elevated during the acute phase of the diseases, and a decrease in these levels corresponded with a dramatic rise in the level of IL-10 mRNA (Kennedy et al., 1992). Also, it has been shown that IL-13 prevents EAE in rats (Cash et al., 1994). These observations suggest that the anti-inflammatory cytokines, IL-4, IL-10 and IL-13 act as immunosuppressive cytokines in the CNS. The possible involvement of IL-4 and IL-10 in  7  MS, has been demonstrated by detection of elevated levels of these cytokines-secreting cells in blood from MS patients (Lu et al., 1993; Navikas et al, 1995). Recent studies have demonstrated that IL-10 can be detected in the culture supernatants of mouse microglia and in the cell lysate of mouse astrocytes stimulated by LPS (Mizuno et al., 1994), and that adult human brain-derived microglia synthesize and release IL-10 following LPS and IFN-y stimulation. Also, recombinant human IL-10 downregulates basal HLA-DR expression by microglia (Williams et al., 1996). IL-10 could exert its immunosuppressive properties by down-regulating proinflammatory cytokines such as IL-6, TNF-a, and IL-12 (Lodge and Sriram, 1996). In mouse astrocytes and microglia, IL-10 inhibits the LPS-induced production of DL-6, GM-CSF, and macrophage colony stimulating factor (M-CSF) (Frei et al., 1994), and IL-10 suppresses the LPS-induced production of TNFa and IL-12 in mouse microglia (Lodge and Sriram, 1996). In EAE, IL-10 suppresses TNF-a production by MBP-specific T cells and IFN-y-induced MHC class II upregulation in macrophages, and systemic administration of IL-10 prevents an induction of EAE in rats, supporting an immuno-suppressive role of IL-10 in vivo. Transforming growth factor (31 (TGF-pl) is synthesized by astrocytes, oligodendrocytes and microglia, and IL-1 a stimulates production of TGF-Pl in these cells (da Cunha and Vitkovic, 1992; da Cunha et al., 1993a). TGF-pl and TGF-p2 can inhibit IFN-y-induced expression of class II MHC in rat astrocytes (Schluesener,1990), and also inhibit proliferation of rat astrocytes (Lindholm et al., 1992; Morganti-Kossmann et al., 1992). Upregulation of TGF-Pl mRNA in microglia has been observed accompanying the axonal reaction of motor neurons (Kiefer et al., 1994). TGF-pi is able to inhibit the 8  proliferation of microglia induced by either GM-CSF or M-CSF (Suzumura et al., 1993), and inhibits TNF-a production by microglia (Suzumura et al., 1993), and astrocytes (Benveniste et al., 1994). Thus, TGF-J3 may play a role in CNS tissue repair processes by modifying the extent of astrocyte proliferation, and acts to down-regulate inflammatory processes within the CNS by a feedback inhibition. Other candidates as anti-inflammatory cytokines in the CNS, IL-4 and IL-13, have similar properties as IL-10 and TGF-b\ Pretreatment of a microglial cell culture with recombinant IL-4 inhibits the LPS plus IFN-y-induced production of TNF-a and nitric oxide (NO) from rat microglial cells (Chao et al., 1993). Similarly, IL-4 inhibits the IFN-y-induced expression of HLA-DR in rat microglial cells (Suzumura et al., 1994). Despite these inhibitory effects of IL-4 on microglial cells, TL-4 is reported to enhance Fc receptor expression on rat microglia (Loughlin et al., 1993) and induce proliferation of rat microglial cells (Suzumura et al., 1994). As another effect of IL-4 on glial cells, DL-4 alone and in the presence of TNF-a decreases DNA synthesis and inhibits proliferation of adult human astrocytes (Estes et al., 1993). IL-4 treatment of mice with early EAE resulted in amelioration of clinical EAE, inhibition of proinflammatory cytokines in the CNS, and diminished demyelination (Racke et al., 1994). Similarly, IL-13 might have critical regulatory roles in immune responses, because it strongly affects monocyte/macrophage function. For example, IL-13 downregulates several proinflammatory cytokines, among them, IL-1, IL-12, and TNF-a, and suppresses NO production by activated macrophages (de Waal Malefyt et al., 1993). IL-13 prevents EAE, supporting its anti-inflammatory effects  9  (Cash et al., 1994). It is noteworthy that the source of IL-4 or IL-13 has not yet been determined in the CNS.  1.2.2  Cytokines and neurological disease In recent years, overexpression of cytokines has been observed at sites of pathology in  several neurological diseases, including Alzheimer's disease (AD), multiple sclerosis (MS), and AIDS-related encephalopathy (Griffin et al., 1989, 1995, 1998; Dickson et al., 1993; Cannella and Raine, 1995).  Multiple sclerosis (MS) MS is characterized by infiltration of T-cell and macrophage into the white matter, and is one of the most common autoimmune diseases of human CNS. T lymphocytes found in early MS lesions are predominantly CD4 , whereas CD8 T cells become much more +  +  numerous at a later stage. In most actively demyelinating lesions, the T cells are greatly outnumbered by macrophage-type cells (Traugott et al., 1983; Cannella and Raine, 1995). T cells, particularly CD4 T helper cells, exist as two distinct subsets based on the +  cytokines they produce . Type 1 T-helper (Thl) cells predominantly produce IL-2, IFN-y, IL12, TNF-a, and TNF-p\ Type 2 T-helper (Th2) cells produce mainly IL-4, IL-5, IL-6, IL-10, and IL-13. Thl cells are major players in delayed-type hypersensitivity and proinflammatory responses by activating cytotoxic T cells and macrophages, while Th2 cells induce B-cell growth and differentiation. The anti-inflammatory cytokines produced by the Th2 cells can down-regulate Thl cell function (Mosmann and Sad, 1996).  10  In MS, Th clones change during the cycles of the disease. During acute attacks, T cells that express Thl cytokines would be predicted to be pathogenic in MS. T cells that recognized myelin-protein peptide antigen have been detected in cerebrospinal fluid (CSF) of MS patients, and these T cells produced IFN-y and TNF (Sun et al., 1991; Soderstrom et al., 1995; Olsson et al., 1992). Subsequently, an increase in TNF-a expression has been shown to precede MS attacks (Rieckman et al., 1995). During remission in the same patients, however, there is a very significant upregulation of IL-10, as well as the immunosuppressive cytokine TGF-p (Mokhtarian et al., 1994; Rieckmann et al., 1994; Correale et al., 1995; Olsson, 1995). Thus, immune status is a major factor which controls manifestation of the disease. Immunohistochemical studies have also shown that IL-1, IL-2, IL-4, IL-6, TNF-a, and IFN-y are localized near active plaques in MS brain (Otero and Merrill, 1994; Dickson et al., 1993; Woodroofe and Cuzner, 1993; Cannella and Raine, 1995). Animal studies have also shown that Thl cells from myelin-stimulated donors induce EAE, whereas Th2 clones do not. Anti-IFN-y antibody treatment abrogates T-cell transfer of EAE, whereas injection of TGF-P slows disease progression while injection of anti-TGF-P antibodies exacerbates it (Barten and Ruddle, 1994; Olsson, 1995). In addition, injection of IL-4 or IL-10 ameliorates EAE, and inhibits the production of inflammatory cytokines in the CNS (Racke et al., 1994; Rott et al., 1994). These observations suggest that the cross-regulation of cytokines from Th cell is probably a major factor in the progress of MS disease, activating the endogeneous microglial cell or astrocytes. In CNS autoimmune disease, it is likely that IFN-y produced by T-cell activates resting microglia to become phagocytic or cytotoxic effector cells (Otero and  11  Merrill, 1994). Activated murine microglia are capable of releasing several potentially cytotoxic substances in vitro, such as free oxygen intermediates, nitric oxide (NO), proteases, arachidonic-acid derivatives, excitatory amino acids, quinolinic acid and cytokines (Banati et al., 1993a; Banati et al., 1993b; Kreutzberg, 1996). It should be noted, however, that several studies have shown human microglial cells to be unable to produce NO since they do not express inducible nitric oxide synthase (iNOS) message (Lee et al., 1993b; Walker et al., 1995).  Alzheimer's disease (AD) Alzheimer's disease (AD), a neurodegenerative disorder leading to memory loss and dementia, is characterized by the deposition of amyloid P-peptide (AP) derived from the proteolysis of a transmembrane glycoprotein p-amyloid precursor protein (APP) (Tanzi et al., 1994). The deposits of AP are associated with degenerative changes of neuronal cells and neuronal death. Ap has been demonstrated to be neurotoxic and to trigger apoptosis of neurons in vitro. (Loo et al., 1993). Early immunocytochemical studies have demonstrated that microglia associated with AD senile plaques are immunoreactive for the cytokines IL-1 (Griffin et al., 1989; Dickson et al, 1993), IL-6 (Strauss et al., 1992), and TNF-a (Dickson et al., 1993). A recent study has shown that the induction of proinflammatory cytokines is correlated with changes in APP expression (Brugg et al., 1995). A recent work with primary rat cortical cell culture has shown that IL-ip and IL-6 increase APP mRNA expression in neurons, but not in astrocytes (Del Bo et al., 1995). The promoter for APP contains regulatory elements that are potentially  12  responsive to cytokines (Salbaum et al., 1988) In cells transfected with a reporter gene (lacz) and the APP promoter, it has been demonstrated that IL-1 (3 regulates APP mRNA expression (Donnelly et al., 1990). A(3 peptide itself stimulates glial cells to enhance the production of IL-1 a (Araujo and Cotman, 1992a), IL-6 (Gitter et al., 1995; Walker et al., 1995) and TNF-a (Araujo and Cotman, 1992a; Walker et al., 1995). Thus, these proinflammatory cytokines may activate microglia and astrocytes associated with Ap deposits in senile plaques and amplify additional destruction of neurons. Recently, Griffin et al. (1995,1998) suggested that activated microglia may be involved at the early stages of plaque formation. Most diffuse plaques, which is an early stage of plaque development in AD, contain activated microglia, but the dense-core neuritic plaque contains fewer microglia. These findings support a model in which microglia are activated at the initial stages of APP deposition, and the associated cytokine expression exacerbates a further activation of microglia and astrocytes, leading to plaque maturation (Patterson, 1995). Amyloid deposits contain a variety of brain- and serumderived proteins in addition to AP peptide, including heparan sulfate proteoglycans (Snow et al., 1987), complement protein (Ishii and Haga, 1984; McGeer et al., 1989), serum amyloid P component (Kalaria and Perry, 1993), protease inhibitors (al-anti-chymotrypsin) (Abraham et al., 1988), and apolipoproteins (apo-E and apo-J) (Namba et al., 1991; McGeer et al., 1992). The role of these molecules is in the promoting fibrillogenesis in amyloid deposits, and astrocytes and microglia may be major source of these molecules.  13  1.3  Objectives Previous clinical and pathological studies have shown that overproduction of  proinflammatory cytokines such as IL-1 (3, IL-6 and TNF-a in the area of pathological lesions in the CNS is one of the major features during the course of multiple sclerosis (MS), Alzheimer's disease, ADDS dementia, viral encephalitis, and stroke. A characteristic feature of cytokine actions is that the cytokine network is tightly regulated by synergism/antagonism, cytokine cascades, and receptor transmodulation. As a result, characterization of these diseases has raised questions regarding the relationship between the CNS and peripheral immune system, as well as the cellular source of cytokine production in the CNS. In past years, a number of studies on rodent CNS have reported that not only immune cells but also the CNS cells are capable of producing cytokines, indicating that cytokines can participate in inflammatory responses and developmental process in the CNS. However, the details of such a cytokine network in the human CNS are not known. The present study is designed to test the hypothesis that human CNS cells are capable of expressing specific sets of cytokines and cytokine receptors to establish a cytokine network within the CNS. The objectives of the present study are as follows: (1) To identify the expression sites of cytokines and cytokine receptors expression in human CNS in vitro; (2) To determine the effects of cytokines which can bind receptors on astrocytes or microglia, on the production of NO or TNFa, as these are major effectors of cytotoxicity; (3) To determine the effects of selected cytokines produced by astrocytes on neuronal differentiation and survival in human CNS.  14  Chapter 2  2.1  Primary cultures of human CNS cells  Introduction The study of neural cell function has been enhanced by the development of methods  to produce dissociated cell cultures from CNS tissue (McCarthy and de Vellis, 1980; Kim et al.,1983,1984). Cell type-specific neural markers and their specific antibodies have provided advances in our understanding of the developmental and functional biology of the CNS cell types in dissociated cell cultures of mammalian CNS tissues. As an astrocyte specific intermediate filament protein, glial fibrillary acidic protein (GFAP) is expressed exclusively in astrocytes. The increased expression of GFAP after injury is a hallmark of reactive astrocytes (Eng et al., 1989). In the rodent CNS, two cell types of astrocyte were named type-1 (GFAP A2B5") and type-2 (GFAP A2B5 ) astrocytes. Type-2 astrocytes share a +  +  +  common bipotential glial progenitor cell (0-2A) with oligodendrocytes (Raff et al., 1984). In embryonic human CNS cultures, A2B5 staining is found in 10-20% of GFAP-positive astrocytes, and these A2B5-positive astrocytes are mostly process-bearing type 2 astrocytes (Kim et al., 1986). Microglial cells express some surface markers associated with tissue macrophage, and bind the macrophage-specific lectin Ricinus communis agglutinin 1 (RCA1). For instance, they bear Fc receptors (FcR) and express Mac-1, Mac-3, F4/80 (Perry et al., 1985; Streit et al, 1988), and the leukocyte common antigen CD45 (Sedgwick et al., 1991). As oligodendrocytes specific markers, myelin proteins like myelin basic protein (MBP), proteolipid protein (PLP), 2',3'-cyclic nucleotide phosphodiesterase (CNPase) and myelinassociated glycoprotein (MAG) are expressed in the plasma membrane at the distal end of the oligodendrocyte processes. In myelinating oligodendrocytes, the majority of mRNAs 15  coding for MBP are present in the processes, and the MBP mRNA isoforms are formed by alternative splicing (Campagnoni, 1988; Barbarese et al., 1988).  2.2  Materials and methods  2.2.1  Cell Preparation Astrocytes-, microglia- and neuron-enriched cultures were prepared from embryonic  human brain tissue (12-18 weeks' gestation), as described previously (Lee et al., 1996). The use of embryonic tissues was cleared by the Clinical Screening Committee for Research involving Human Subjects of the University of British Columbia. Briefly, brains were dissected into small cubes, incubated in phosphate-buffered saline (PBS) containing 0.25% trypsin and 40 pig /ml DNase for 30 min at 37 C, and dissociated into single cells by gentle 0  pipetting. Dissociated cells were suspended in Dulbecco's modified Eagle medium (DMEM) (Stem Cell Technologies, Vancouver, BC) containing 5% horse serum, 5 mg /ml glucose, 20 Hg/ml gentamicin, seeded at 10 ~10 cells in 75-cm culture flask , and incubated at 37° C in 7  8  2  an incubator with 5% C O 2 / 95% air atmosphere. After 2-4 weeks of growth in flasks, cells consisted of a confluent basal layer of flat cells consisting of astrocytes, free floating cells of microglia, and small, round or bipolar cells, consisting mostly of neurons on top of the basal astrocyte layer. Since only a small number of oligodendrocytes were found in primary cultures of embryonic human brains, oligodendrocyte-enriched cultures were prepared from adult human brains tissues obtained by epilepsy surgery.  16  Highly enriched cultures of human microglia: After 2-4 weeks of growth in flasks, microglia cells floating in the medium were collected and reseeded at appropriate densities. To remove nonadherent cells, the cultures were washed by medium 1-2 h after seeding.  Highly enriched cultures of human neurons: For isolation of neuron-enriched populations, small round or bipolar cells on top of the basal layer were detached by mechanical shaking on an orbital shaker at 250 rpm overnight and collected. The cells were plated on matrigel (Collaborative Biomedical, Bedford) coated culture dishes and were grown for 2-3 weeks with weekly medium changes. After 4, 7,10 and 14 days in culture, 500 uM of the antimitotic agent, 5' fluoro-2'deoxyuridine (FdU: Sigma, St. Louis, MO), was added in medium (Martin et al., 1990).  Highly enriched cultures of human astrocytes: To obtain astrocytes-enriched cultures, small round or bipolar cells on top of the basal layer were removed from the flasks by vigorous shaking, and then the plastic surfaceadherent astrocytes were isolated by a brief incubation in PBS containing 0.1% trypsin and 1 mM EDTA. These astrocytes-enriched cultures were further subcultured three or four times by trypsinization to enrich the astrocyte population.  17  Highly enriched cultures of human oligodendrocytes: Oligodendrocytes were isolated from adult human brain tissue of epilepsy surgery as described previously (Kim, 1990). Briefly, the brains were dissected into small pieces and incubated at 37°C for 30 min in phosphate-buffered saline (PBS) containing 0.25% trypsin and 40 |J.g/ml DNAse I. The dissociated cells passed through a nylon mesh of pore size 100 um were separated by centrifugation in 30% Percoll (Pharmacia, Piscataway, NJ) for 30 min at 30 000 x g. The cells between an upper myelin layer and a lower erythrocyte layer were collected, suspended in Eagle's minimum essential medium with Earle's salt supplemented with 5% horse serum, 20 (ig/ml gentamicin, plated in 10-cm culture dishes, and incubated at 37°C in 5% CO2. One week later, free floating or loosely attached oligodendrocytes were collected, incubated at 37°C for 10 min in PBS containing 0.1% trypsin and 1 mM EDTA, suspended in feeding medium containing 5% horse serum and replated in separate dishes. These oligodendrocyte-enriched cultures were further subcultured three or four times to obtain pure oligodendrocytes by eliminating non-oligodendrocyte cells consisting of astrocytes, microglia, endothelial cells and fibroblasts which attached to the dishes. Astrocyte-enriched and microglia-enriched cultures were suspended in feeding medium and replated in poly-L-lysine-coated 6 well plates at a density of 10 cells per well for RT-PCR 6  analysis, or plated on poly-L-lysine-coated 9 mm Aclar plastic round coverslips at a density of 2xl0 cells per coverslip for immunocytochemistry.. 4  2.2.2  Immunocytochemistry To confirm the purity of cell preparation, astrocyte-, microglia-, neuron- and  oligodendrocyte-cell preparations were processed for immunolabelling with cell type-specific 18  markers. Cell type-specific markers used in this study were glial fibrillary acidic protein (GFAP) for astrocytes, Ricinus communis agglutinin-1 (RCA-1) for microglia, microtubule associated protein (MAP2) for neurons, and proteolipid protein (PLP) for oligodendrocytes. Rabbit anti-GFAP was obtained from Dako (Santa Barbara, CA). Biotinylated RCA-1 was obtained from Sigma (St. Louis, MO). Monoclonal antibody for MAP2 was obtained from Boehringer Mannheim (Laval, Quebec). The hybridoma cell line producing anti-PLP mAb was provided by Dr. K. Dcenaka (National Institute for Physiological Sciences, Aichi, Japan). Immunocytochemistry was performed according to the methods described previously (Satoh et al., 1994). For identification of astrocytes, cells were fixed in methanol for 10 min at -20°C, and then incubated with rabbit anti-GFAP antiserum (1:100) for 40 min at room temperature , followed by a 30 min incubation with FITC-conjugated anti-rabbit Ig (1:80, Organon Teknika). For identification of microglia, cells were fixed in 4% paraformaldehyde (PFA) in 0.1 M phosphate buffer (pH 7.4) for 5 min at 4°C and incubated with biotinylated RCA-1 (1:40) for 30 min at room temperature, followed by a 30 min incubation with FITCconjugated streptavidin (1:120, Amersham, Piscataway, NJ). After several washes, coverslips mounted on slides with gelvatol were examined under a Zeiss Universal Microscope equipped with fluorescein optics. For identification of neurons and oligodendrocytes, cells were fixed in methanol for 10 min at -20°C, and incubated overnight with primary antibody at 4°C. The following day, incubation with biotinylated secondary antibody was carried out for 1 h at room temperature, and then incubated with ABC reagent (Vector Labs, Mississauga, ON) for 1 h at room temperature . Antibody binding was visualized using diaminobenzidine (DAB). 19  2.2.3  RT-PCR analysis To confirm the purity of cell preparation, the cDNA from astrocytes, microglia,  neurons or oligodendrocytes was amplified for GFAP as a marker gene for astrocytes, B7-2 (CD86) as a marker gene for microglia, neurofilament (NF)-L, -M, -Ff as a marker genes for neurons, and MBP as a marker gene for oligodendrocytes. Total RNA preparation was performed according to the acid guanidinium/phenol/chloroform (AGPC) method described by Chomczynski and Sacchi (1987). Two to 5 pig of total RNA from each sample was subjected to DNase treatment and then processed for the first strand cDNA synthesis using Moloney murine leukemia virus (M-MLV) reverse transcriptase (GIBCO-BRL, Life Technologies). Five ul of each cDNA product was amplified by PCR using the specific sense and antisense primers designed from the cDNA sequence for the each marker gene for human CNS cells. The sense and antisense primers for GFAP, B7-2 , NF-L, NF-M, NF-H and MBP were as follows: GFAP sense: 5 -GCAGAGATGATGGAGCTCAATGACC-3', GFAP antisense: 5 -GTTTCATCCTGGAGCTTCTGCCTCA-3', B7-2 sense: 5 -CTCTTTGTGATGGCCTTCCTG-3', B7-2 antisense: 5 -CTTAGGTTCTGGGTAACCGTG-3', NF-L sense: 5'-TCCTACTACACCAGCCATGT-3', NF-L antisense: 5'-TCCCCAGCACCTTCAACTTT-3', NF-M sense: 5'-TGGGAAATGGCTCGTCATTT-3', NF-M antisense: 5'-CTTCATGGAAGCGGCCAATT-3', NF-H sense: 5'-CTGGACGCTGAGCTGAGGAA-3', NF-H antisense: 5'-CAGTCACTTCTTCAGTCACT-3', 20  MBP sense: 5' - AC ACGGGC ATCCTTGACTCC ATCGG-3', MBP antisense: 5' -TCCGGAACCAGGTGGGTTTTCAGCG-3', Nestin sense: 5'-CTCTGACCTGTCAGAAGAAT-3', Nestin antisense: 5' -GACGCTGACACTTACAGAAT-3'. The amplified DNA fragments for GFAP, B7-2, NF-L, NF-M, NF-H, MBP and Nestin were expected to be 266 b.p , 464 b.p, 284 b.p, 333 b.p, 316 b.p, 510 b.p and 316 b.p respectively. PCR was carried out in a 50 (0,1 of reaction mixture containing Taq DNA polymerase buffer (20 mM Tris-HCL, pH 8.4, 50 mM KCL, 200 uM dNTP, 2.5 mM MgCl 1 uM of each primer) and 2.5 U Taq DNA polymerase (GfBCO-BRL). The main amplification program consisted of a denaturation step at 94°C for 1 min followed by an annealing step at 55° ~ 60°C for 1 min, and a synthesis step at 74°C for 1 min, for 35-40 cycles. For the initial amplification, cDNA samples were denatured at 94°C for 5 min, annealed at 55°~57°C for 1 min, and extended at 74°C for 3 min.  21  2  2.3  Results In order to determine gene expression of various cytokines in human CNS cell types,  pure populations of astrocytes, microglia and neurons were prepared from mixed cell cultures isolated from brains of human embryos (12-18 weeks' gestation), and oligodendrocytes were prepared from adult human brain tissues. Cell preparations were processed for immunolabelling with cell type-specific markers: GFAP for astrocytes, RCA-1 for microglia, MAP2 for neurons and PLP for oligodendrocytes. To confirm the purity of cell preparations, cDNA from the cultures was amplified for GFAP as a marker gene for astrocytes, B7-2 (CD86) as a marker gene for microglia, MBP as a marker gene for oligodendrocytes and nestin as a marker gene for CNS neural stem cells/CNS progenitor cells.  2.3.1  Highly enriched cultures of human astrocytes More than 99% of the cells from astrocyte-enriched cultures expressed GFAP  +  phenotype indicating that these cultures were highly enriched with astrocytes (Fig. 2.1 A). As shown in Fig. 2. IB, results from RT-PCR demonstrated that astrocytes preparations expressed mRNA for GFAP but not B7-2 (CD86) mRNA, MBP mRNA or nestin mRNA.  2.3.2  Highly enriched cultures of human microglia As shown in Fig. 2.2A, microglia-enriched cultures expressed RCA-1 phenotype +  indicating that these cultures were highly enriched with microglia. Results from RT-PCR analysis further confirms that the microglia cell culture was pure since the expression of B7-2 (CD86) mRNA, a cell type specific marker gene for microglia, was demonstrated whereas  22  transcripts for GFAP, MBP or nestin were not detected in the microglia preparation (Fig. 2.2B).  2.3.3  Highly enriched cultures of human neurons The cells from neuron-enriched cultures expressed MAP2 phenotype indicating that +  the neuron cultures were highly enriched with neurons (Fig. 2.3A). The RT-PCR analysis demonstrated that the expressions of NF-L mRNA and NF-M mRNA, cell type specific gene markers for neurons, were detected in these cultures. The expression of gene markers for other cell types including GFAP, B7-2, MBP and nestin were absent in these preparations (Fig. 2.3B)  2.3.4  Highly enriched cultures of human oligodendrocytes As shown in Fig. 2.4A, the cells from oligodendrocyte-enriched cultures expressed  PLP phenotype demonstrating that the cultures were highly enriched with oligodendrocytes. +  Further analysis of cell type specific gene markers demonstrated that the expression of MBP mRNA and GFAP mRNA was detected , while mRNA for B7-2 or nestin were not (Fig. 2.4B).  23  Figure 2.1. A highly enriched culture of human astrocytes A) Astrocytes express GFAP immunoreactivity, an astrocyte cell type-specific marker. B) Astrocyte cultures express message for GFAP, an astrocyte cell type-specific marker.  24  (A)  Figure. 2.2. A highly enriched culture of human microglia. A) Microglial cells express RCA-1 immunoreactivity, an microglial cell type-specific marker. B) Microglia culture expresses message for B7-2, a microglia specific marker gene.  25  (A)  Figure. 2.3. A highly enriched culture of human neurons. A) Neurons express MAP-2 immunoreactivity, a neuronal cell type-specific marker. B) Neuronal culture expresses messsage for NF-L and NF-M, neuronal cell type-specific markers. Note that the message for NF-H is not expressed by the neurons at this stage of development.  26  (A)  Figure. 2.4. A highly enriched culture of human oligodendrocytes. A) Oligodendrocytes express PLP immunoreactivity, an oligodendrocyte cell type-specific marker. B) Oligodendrocyte culture expresses message for MBP, an oligodendrocyte cell type-specific marker. In addition to MBP, oligodendrocytes also express GFAP, an astrocyte marker, in culture conditions.  27  2.4  Discussion  In the present study, cell preparations were processed for immunolabelling with cell type-specific markers: GFAP for astrocytes, RCA-1 for microglia, MAP 2 for neurons and PLP for oligodendrocytes. To confirm the purity of cell preparations, cDNA from the cultures was amplified for GFAP as a marker gene for astrocytes, B7-2 (CD86) as a marker gene for microglia, MBP as a marker gene for oligodendrocytes and nestin as a marker gene for neural stem cells. The results demonstrated that astrocyte- or microglia-enriched cultures were almost pure since astrocyte preparations express mRNA for GFAP which is a highly specific marker for astrocytes but not B7-2 (CD86) mRNA, a cell type specific marker gene for microglia. In contrast, microglia preparations expressed mRNA for B7-2 but not GFAP mRNA. We have demonstrated earlier that B7-2 (CD86), one of the counter-receptors for the T cell antigen CD28/CTLA-4 which is a marker gene for professional antigen-presenting cells, is expressed exclusively and specifically in human microglia but not in astrocytes (Satoh et al., 1995). For pure neuron cell cultures, RT-PCR analysis confirms the purity of neuronal cell preparation demonstrating expression of NF-L mRNA and NF-M mRNA which is highly specific for neuron but not GFAP mRNA, B7-2 mRNA or nestin mRNA, which are specific marker gene for astrocytes, microglia or neural stem cells respectively. In case of oligodendrocytes preparation, RT-PCR analysis detected MBP mRNA as well as GFAP mRNA, a marker gene thought to be expressed transiently in developing oligodendrocytes (Ogawa et al., 1985), and transient of GC /GFAF to GC /GFAP glial cells has also been +  +  +  observed in adult human oligodendrocytes (Kim, 1990). These findings suggest that GFAP mRNA expression in oligodendrocyte-enriched culture which shows PLP phenotype might +  28  not be unexpected. Therefore, all neural cell cultures which were prepared for RT-PCR analysis for cytokine and cytokine receptor expression in the present study were pure.  29  Chapter 3  3.1  Cytokine Expression in Human CNS Cells  Introduction Recent studies have indicated that mammalian neurons and glia produce cytokines,  which play roles in maintaining homeostasis in the central nervous system (CNS) by mediating the interaction between cells via autocrine or paracrine mechanisms (Benveniste, 1992; Hopkins and Rothwell, 1995). Astrocytes and microglia are thought to be the immune surveillant cells of the central nervous system (CNS). Under normal conditions, they provide trophic and survival factors for neurons and oligodendrocytes and maintain homeostasis of the CNS (Eddleston and Mucke, 1993; Ridet et al., 1997). Astrocytes produce basic fibroblast growth factor (bFGF) (Ferrara et al., 1988; Araujo and Cotman, 1992b), glial cell line-derived neurotrophic factor (GDNF) (Schaar et al., 1994), platelet-derived growth factor (PDGF) (Rafff et al., 1988; Silberstein et al., 1996), insulin like growth factor-1 (IGF-1) (Han et al., 1992; Chernausek, 1993), ciliary neurotrophic factor (CNTF) (Rudge et al., 1994; Carroll et al., 1993; Seniuk et al., 1994), and the neurotrophins (Carman-Krzan et al., 1991; Rudge et al., 1994) which include nerve growth factor (NGF), brain derived neurotrophic factor (BDNF) and neurotrophin-3 (NT-3). Astrocytes are also known to release neurotransmitters (Parpura et al., 1994; Jeftinija et al., 1996). Resting microglia cells keep the brain clear of debris by phagocytosis, and produce immunosuppressive molecules such as transforming growth factor P (TGFP) (da Cunha et al., 1993b). TGF P is a strong inhibitor of astrocyte proliferation and acts as a tumor suppressor in certain malignant glioma cells (Lindholm et al., 1992). Thus, microglia may play a role in CNS tissue repair processes by preventing astrocyte proliferation and glial scar formation. However, overproduction of 30  cytokine can occur within the CNS by stresses such as trauma, infection, and inflammation (Farby et al., 1994; Zhao and Schwartz, 1998). Clinical and pathological observations have shown that proinflammatory cytokines such as IL-lp\ IL-6 and tumor necrosis factor-a (TNFa) can be detected in the brain of patients with stroke, viral encephalitis, MS, acquired immunodeficiency syndrome (ADDS), and Alzheimer's disease (Griffin et al., 1989; Shankar et al., 1992; Tyor et al., 1992; Dickson et al., 1993; Fassbender et al., 1994; Cannella and Raine, 1995).  Interleukin-1 (IL-1) IL-1 is a 17 kDa polypeptide produced predominantly by monocytes/macrophages, and other cell types such as mesangial cells, NK cells, B cells, T cells, neutrophils, endothelial cells, smooth muscle cells and fibroblasts. There are two isoforms of IL-1: IL-a and IL-p\ IL-1 is a cytokine responsible for mediating a variety of processes in the host response to microbial and inflammatory diseases. IL-1 is a principal participant in inflammatory reactions through its induction of other inflammatory metabolites, such as prostaglandin, collagenase, and phospholipase A2 (Geoffrey et al., 1994). In the CNS, both rat and mouse microglia produce IL-1 in response to LPS stimulation (Giulian et al., 1986; Righi et al., 1989). In addition, primary cultures of human fetal and adult microglia produce TL-1(3 in response to LPS stimulation (Lee et al., 1993a; Walker et al., 1995). Previous studies have shown that purified IL-1 stimulates the proliferation of cultured astrocytes isolated from fetal rat brain (Giulian et al., 1988a) and that IL-1 injected into rat brain can stimulate the formation of astrogliosis (Giulian et al., 1988b).  31  These authors have proposed that the microglia are the most likely source of IL-1 production during acute phases of CNS injury (Giulian et al., 1986,1988b; Lee et al., 1993a). Since microglia are the first glial cell type to appear at sites of trauma or infection, it has been suggested that IL-1 produced from microglia stimulates the proliferation of astrocytes at the sites of injury. However, this notion of IL-1 as a mitogen for astrocytes has become a matter of debate. A recent study has demonstrated that recombinant IL-1 a and IL-|3 do not induce proliferation of bovine astrocytes or human fetal astrocytes (Selmaj et al., 1990; Lee et al., 1995). Oligodendrocytes also appear to produce IL-1. Oligodendrocytes in diseased brain stain positively for IL-1 (da Cunha et al., 1993b). A variety of CNS cells have been shown to produce cytokines in response to IL-1. When rat astrocytes were stimulated by IL-1, these cells secreted TNF-a (Chung and Benveniste, 1990), IL-6 (Frei et al., 1989; Benveniste et al., 1990), and TGF-p (da Cunha and Vitkovic, 1992). In addition, a recent study has shown that human astrocytes produce IL-6, IL-8, and colony-stimulating factors in response to IL-lfj (Aloisi et al., 1992; Lee et al., 1993a). Also, IL-la stimulates production of TGF-P in microglia and oligodendrocytes (da Cunha et al., 1993a). Overexpression of these cytokines is observed in the brain of patients suffering from brain injury (stroke or trauma), viral infection (AIDS), demyelinating diseases (MS), and chronic neurodegenerative diseases (Alzheimer's disease). Thus, these previous studies suggest that overproduction of inflammatory cytokines including EL-l by resident CNS cells could contribute to the development of CNS pathologies.  32  Interleukin-2 (TL-2) IL-2, a 14 -17 kDa glycoprotein, is understood to be a pivotal cytokine in the immune response especially in clonal expansion of activated, antigen-specific T cells. In the immune system, IL-2 is produced specifically by CD4 T helper cells. IL-2 also stimulates the +  growth of NK cells, activated B cells and macrophages. IL-2 and IL-2 receptors co-localize in the CNS by immunohistochemical and radiolabeled ligand binding analysis (Araujo et al., 1989; Lapchak, 1991). In another study, IL-2 dose-dependently suppressed high-potassiumevoked release of acetylcholine (ACh) in rat hippocampus (Hanisch et al., 1993). In addition, IL-2 inhibits induction of long-term potentiation (LTP) in the hippocampus (Bindoni et al., 1988). Since both ACh release and the induction of LTP in the hippocampus have been suggested to be events closely related to learning and memory, these findings may explain a major side effect of IL-2 immunotherapy, namely memory impairment (Hanisch et al., 1995). At the present time, the cellular source of IL-2 in the CNS is not clear.  Interleukin-3 flL-3") IL-3, a 28 kDa glycoprotein, is produced predominantly by T cells in the immune system . It supports the growth of multipotential stem cells and progenitors of erythroid, monocytoid, and other hematopoietic progenitors as well as pre-B cells (Schrader et al., 1982; Ihle et al., 1983; Rennick et al., 1989). A previous study has shown that mouse astrocytes produce IL-3 -like factors which stimulate the growth and proliferation of microglial cells (Frei et al., 1986; Giulian and Baker, 1986). Another study has shown that recombinant human IL-3 and natural mouse IL-3 promote neurite extension in mouse and rat septal cholinergic neurons (Kamegai et al., 1990). Little is known about the possible endogeneous 33  source or targets of IL-3 in the CNS. Farrar et al. (1989) have shown that IL-3 mRNA is highly expressed in both neurons and glial cells of the adult mouse CNS, especially in the hippocampus and subiculum. In contrast, human astrocytes do not express IL-3 mRNA in response to IL-lp or TNF-a (Aloisi et al., 1992). To explain the role of IL-3 in human CNS, the cellular source of IL-3 and the presence and location of the IL-3 receptor in the human CNS cells should be determined.  Interleukin-4 flL-4) IL-4, a 15 ~ 19 kDa glycoprotein, is an anti-inflammatory cytokine produced by CD4 Th2 lymphocytes and mast cells. IL-4 inhibits the effects of IFN-y, and induces +  secretion of IgGl and IgE by mouse B cells, and IgG4 and IgE by human B cells. Pretreatment of microglia cell culture with recombinant IL-4 resulted in a concentrationdependent inhibition of lipopolysaccharide (LPS)- and IFN-y-induced production of TNF-a and nitric oxide (NO) from microglial cells and prevented NO-induced neuronal cell injury (Chao et al., 1993). Similarly, IL-4 inhibits the IFN-y-induced expression of HLA-DR in microglial cells (Suzumura et al., 1994). On the other hand, IL-4 enhances Fc receptor expression on microglia and induces proliferation of microglial cells (Loughlin et al., 1993; Suzumura et al., 1994). Expression of IL-4 receptor mRNA has been found in mouse microglial cells (Sawada et al., 1993b).  34  Interleukin-5 (IL-5) IL-5, a 40 ~ 45 kDa glycoprotein produced by T cells, is a mitogen and/or a differentiative factor for B and T cells and hematopoietic progenitors in the immune system (Metcalf et al., 1983). In the CNS, IL-5 mRNA and protein have been detected in murine astrocytes and microglia in vitro. IFN-y upregulated the expression of IL-5 in both murine astrocytes and microglia (Sawada et al., 1993a). However, IL-5 receptor has not been found in either neuronal or glial cells (Sawada et al., 1993b). IL-5 has been found to increase NGF production by murine astrocytes in another study suggesting that there is a novel receptor for EL-5 in astrocytes (Awatsuji et al., 1993b).  Interleukin-6 (IL-6) IL-6, a 23 ~ 26 kDa glycoprotein, is produced by T cells, B cells, monocytes, fibroblasts, mesangial cells, keratinocytes, and endothelial cells. IL-6 is a typical pleiotropic cytokine (Kishimoto et al., 1992, 1994), and it acts on B lymphocytes to induce antibody production and on T lymphocytes to proliferate or differentiate into cytotoxic T cells. IL-6 functions as a hepatocyte-stimulating factor, and it induces the expression of various acutephase proteins such as fibrinogen and C-reactive protein. Also, IL-6 acts on hematopoietic progenitor cells to proliferate, and promotes megakaryocyte production. In the CNS, IL-6 is produced by both astrocytes and microglia. Human, mouse and rat astrocytes in culture can secrete IL-6 in response to a number of stimuli, including virus, IL-1, TNF-a, IFN-y plus IL1, LPS, calcium ionophore and norepinephrine (Frei et al., 1989; Lieberman et al., 1989; Benveniste et al., 1990; Aloisi et al., 1992; Norris and Benveniste, 1993). Mouse microglia secrete IL-6 upon infection with virus or stimulation with M-CSF (Frei et al.,1989) and 35  express IL-6 upon stimulation with LPS (Sawada et al., 1992). It appears that these two cell types are responsive to different stimuli for IL-6 production as murine astrocytes produce IL6 in response to IL-1 or TNF-a, whereas murine microglia do not (Frei et al., 1989; Sawada et al., 1992). Previously, IL-6 has been shown to induce differentiation of PC12 rat pheochromocytoma cells (Satoh et al., 1988) and support the growth of rat catecholaminergic and cholinergic neurons in culture (Hama et al., 1989). However, no confirmation of these studies have appeared in the literature as yet. In biological effects on glial cells, IL-6 contributes to morphological changes in rat astrocytes associated with gliosis, including a change in cell shape and GFAP gene expression (Benveniste et al., 1989; Selmaj et al., 1990). IL-6 is present in elevated levels in several CNS diseases such as Alzheimer's diseases (AD), multiple sclerosis (MS) and AIDS-related encephalopathy (Strauss et al., 1992; Dickson et al., 1993). Several studies have shown that chronic overexpression of IL-6 in transgenic mice can lead to significant neuroanatomical and neurophysiological changes in the CNS similar to that commonly observed in various neurological diseases (Campbell et al., 1993; Campbell and Chiang, 1995; Bamum et al., 1996; Heyser et al., 1997).  Interleukin-7 (IL-7) IL-7, a 25 kDa protein derived from stromal cells in the bone marrow, induces proliferation of T cell and B cell progenitors and differentiation of more mature T cells (Grabstein et al., 1990). Previous studies have revealed that IL-7 promotes neuronal differentiation of conditionally immortalized mouse hippocampal progenitor cells (Mehler et al.,1993). Further, IL-7 was shown to have neurotrophic activity in mixed glial-neuronal cultures of rat hippocampus (Araujo and Cotman, 1993). Until recently, the source of this 36  cytokine in the CNS was not known. A recent report has shown that IJL-7 mRNA can be detected in astrocytes and neurons from rat embryonic brain by RT-PCR, and that TL-7 acts directly to promote neuronal survival in culture (Michaelson et al., 1996). Whether neural cells in the human CNS produce and/or respond to IL-7 remains unknown.  Interleukin-8  (JL-S)  IL-8, also known as neutrophil chemotaxic factor and neutrophil activating peptide, is an 8.4 kDa polypeptide, which is a potent chemotactic agent for neutrophils. IL-8 is secreted by numerous types of cells including endothelial cells, fibroblasts, keratinocytes and chondrocytes (Baggiolini, 1993). A previous study has reported that IL-8 is produced by fetal human astrocyte culture following stimulation with IL-lp or TNF-a (Aloisi et al., 1992). These results raise the possibility that astroglia-derived IL-8 might attract neutrophils to inflammatory sites associated with infection or autoimmunity in the CNS. The functional role of IL-8 in the CNS remains to be determined.  Interleukin-9 (IL-9) IL-9, a 30 ~ 40 kDa glycoprotein produced by activated T lymphocytes, was originally identified by its ability to support the growth of helper T cells and mast cells (Uyttenhove et al., 1988; Hiiltner et al.,1989). IL-9 activities were described on normal hematopoietic progenitors, B cells, fetal thymocytes and thymic lymphomas. Production and function of IL9 in the CNS is unknown, but a recent study has shown that IL-9 induces neuronal differentiation in cultured murine embryonic hippocampal progenitor cell lines (Mehler et al.,  37  1993). The cellular source of IL-9 in the CNS needs to be determined to understand the role of this cytokine in CNS development.  faterleukin-10 (IL-10) IL-10, a 18 kDa polypeptide, is produced by Th2 subsets of CD4 T lymphocytes, +  activated monocytes, macrophages, B cells, keratinocytes and neoplastic cells. IL-10 is a negative regulator of the immune response, i.e. IL-10 produced by Th2 cells, inhibits the synthesis of cytokines by Thl cells and suppresses antigen presentation by macrophages. IL10 also enhances proliferation of B cells, thymocytes and mast cells (Howard and O'Garra, 1992). In the CNS, EL-10 can be detected in the culture supematants of mouse microglia and in the cell lysate of mouse astrocytes in response to LPS (Mizuno et al., 1994), and adult human brain-derived microglia produce IL-10 following LPS and IFN-y stimulation (Williams et al., 1996). Recent studies demonstrate that IL-10 down-regulates MHC class U expression and inhibits the ability of fetal rodent or adult human brain-derived microglia to present antigen to T cells (Frei et al., 1994; Williams et al., 1996). IL-10 could exert its immunosuppressive properties by down-regulating the synthesis of proinflammatory cytokines. In mouse astrocytes and microglia, EL-10 inhibits the LPS-induced production of IL-6, GM-CSF and M-CSF (Frei et al., 1994). In addition, EL-10 suppresses the LPS-induced production of TNF-a and IL-12 in mouse microglia (Lodge and Sriram, 1996). In experimental allergic encephalomyelitis (EAE), an animal model of multiple sclerosis, IL-10 mRNA was detected exclusively in the recovery phase, and systemic administration of IL-10 prevents induction of EAE in rats (Kennedy et al., 1992; Rott et al., 1994). Whether human neurons, astrocytes and oligodendrocytes produce and/or respond to IL-10 remains unknown. 38  Interleukin-11 (IL-11) IL-11 (23 kDa) was originally identified and cloned from a primate stromal cell line, PU-34. IL-11 is among several cytokines, including IL-6, leukaemia inhibitory factor (LEF), oncostatin M (OSM) and CNTF that share the common signal transducing protein subunit, gp 130 in their receptor complex. IL-11 shares very similar biological activities with DL-6, such as the induction of acute-phase protein synthesis, stimulation of hematopoietic multipotential and committed megakaryocytic and macrophage progenitor cells, and activation of bone resorption (Paul et al., 1990; Du and Williams, 1994). Production and function of IL-11 in the CNS is not well known. Only a few studies have shown that the human glioblastoma cell lines (U373 and U87) express IL-11 and its encoding mRNA when stimulated with IL-lp, phorbol ester, and calcium ionophore (Murphy et al., 1995b). In mouse brain, the IL-11 message is distributed in the granular layer of the dentate gyrus and the pyramidal cell layers of the hippocampus (Du et al., 1996). These IL-11 expression data correlate with functional data demonstrating that IL-11 stimulates the neuronal differentiation of a murine hippocampal neuronal progenitor cell line (Mehler et al., 1993). The cellular source of IL-11 in the CNS remains to be determined.  Interleukin-12 (IL-12) IL-12 is a 70 kDa heterodimeric protein composed of two subunits, p40 and p35, which are encoded by two distinct genes (Gubler et al., 1991). While expression of the IL-12 p35 gene is mostly constitutive, expression of the IL-12 p40 gene is highly regulated, typically in excess of the p35 gene (Snijders et al., 1996), and both monomeric and dimeric forms of the IL-12 p40 protein may bind to the IL-12 receptor (IL-12R) and antagonize the 39  action of the IL-12 p75 heterodimer (Gillessen et al., 1995; Ling et al., 1995). In general, bioactive IL-12 is produced upon stimulation, by monocytes/macrophages, dendritic cells, neutrophils and B cells (D'Andrea et al., 1995; Heufler et al., 1996). Initially, IL-12 was named as NK cell stimulatory factor, since it is a potent inducer of IFN-y production in NK cells (Kobayashi et al., 1989). In human and mouse, IL-12 promotes the development of Thl lymphocytes and stimulates IFN-y synthesis and proliferation of Thl cells (Hsieh et al., 1993; Manetti et al., 1993). Therefore, IL-12 has been implicated to play a central role in antiviral, antiparasitic, antibacterial and antitumor immunity (Trinchieri, 1995). There have been two reports demonstrating that LPS or LPS plus IFN-y-induced the expression of IL-12 p40 mRNA in cultured murine microglia and astrocytes. However, the two groups presented contradictory results for IL-12 p75 protein expression. One group demonstrated that stimulation with IFN-y plus LPS enhances IL-12 p40 secretion and induces IL-12 p75 secretion by microglia, but not astrocytes (Aloisi et al., 1997), while the other showed that the IL-12 p75 heterodimer can be detected by ELISA in astrocytes treated with LPS and IFN-y (Stadler et al., 1997). Recent evidence suggests that IL-12 may play a key role in regulating inflammatory reactions in the CNS. In EAE animals, the administration of IL-12 enhanced mortality and disease severity, while the administration of anti-IL-12 antibody reduced the severity of the disease, suggesting that endogeneous IL-12 is implicated in EAE pathogenesis (Issazadeh et al., 1995; Leonard et al., 1995, 1996; Santambrogio et al., 1995). Recently, expression of IL-12 mRNA has been detected in acute MS lesions, particularly from early disease cases, suggesting that IL-12 up-regulation may be an important event in disease initiation (Windhagen et al., 1995). To explain the role of IL-12 in MS, a CNS autoimmune  40  disease that is associated with a Thl type immune response, the production and physiological function of IL-12 in human CNS remains to be determined.  Interleukin-13 (IL-13) IL-13 (10 kDa) is a recently described, pleiotrophic cytokine produced primarily by activated mouse and human Th2 cells. It has been demonstrated to have biological activities similar to those of IL-4. IL-13 induces proliferation of B cells, facilitates immunoglobulin E (IgE) and IgG4 production and decreases IgA secretion by B cells (Minty et al., 1993; McKenzie et al., 1993). IL-13, like IL-4 or IL-10, inhibits the production of inflammatory cytokines by activated murine macrophages or human monocytes, and it suppresses NO production by activated murine macrophages (de Waal et al., 1993). IL-13 has been shown to prevent EAE, suggesting its anti-inflammatory effects on inflammatory responses in the CNS. However, whether cells in the CNS produce and/or respond to IL-13 remains unknown.  Interleukin-15 (IL-15) IL-15(14~ 15 kDa) is a novel T cell growth factor that has been recently been cloned from the simian kidney epithelial cell line (Grabstein et al., 1994). It is produced by wide range of cell types including epithelial cells, monocytes, fibroblasts, muscle and placenta. IL15 binds to the (3 and y-chains of IL-2 receptor and shares many activities with DL-2. These activities include stimulation of T-cell, B-cell and NK-cell proliferation as well as activation of cytotoxicity mediated by both T-cells and NK-cells. Because IL-15 activates NK cells to produce IFN-Y and TNF-a, it is expected to play a role in diseases associated with cytokine 41  dysregulation (Carson et al., 1994). Recently, we have shown that a low level of IL-15 was expressed constitutively by unstimulated human astrocytes and microglia, and that treatment of these cells with EL-1(3, IFN-y or TNF-a increased EL-15 mRNA and protein levels (Lee et al., 1996).  CNTF/LEF CNTF was originally identified in chick eye tissues and isolated from rodent sciatic nerve (Lin et al., 1989). The neurotrophic effects of CNTF include cellular actions on dorsal root ganglia, parasympathetic ciliary and sympathetic chloinergic ganglia neurons and on sympathetic ganglia precursors (Patterson, 1992). In concert with bFGF, CNTF can also participate in the early induction of a postmitotic sympathetic neurons, that then become responsive to NGF for further maturation and continued survival (Ip et al., 1994). In contrast to the traditional neurotrophins, CNTF does not function as a target-derived growth factor (Hall and Rao, 1992), and lacks the signal sequence necessary for secretion (Ip et al., 1993). LEF supports the maturation of sensory neurons from cultured embryonic dorsal root ganglia and peripheral nerves as well as the modulation of neuropeptide levels in sensory neurons (Murphy et al., 1991; Korsching, 1993; Bamber et al., 1994; Murphy et al., 1995a). In vivo, LEF appears to mediate injury-induced changes in the sympathetic neuronal expression of receptors and transmitters (Rao et al., 1993).  42  3.2  Materials and methods  3.2.1  Cytokine mRNA expression For RT-PCR analysis, cDNA prepared from purified/enriched populations of  astrocytes, microglia, nerve cells and oligodendrocytes as described in Chapter 2 was used. To examine effects of proinflammatory cytokines on cytokine mRNA expression in astrocytes and microglia, astrocyte-enriched cultures were stimulated with recombinant human IL-lp (10 ng/ml, R&D Systems, Minneapolis, MN) and recombinant human IFN-Y (500 U/ml, LG Chem, Taejon, Korea) for 6 h, and microglia-enriched cultures were stimulated with LPS (2 |ig/ml, Sigma, St. Louis, MO) and recombinant human IFN-Y (500 U/ml, LG Chem, Taejon, Korea) for 6 h. It has been reported that IL-ip and LPS were major stimuli for the production of cytokines such as IL-6 or TNF-a in human astrocytes and microglia respectively (Aloisi et al., 1992; Lee et al., 1993a). Additionally, IFN-Y  W  A  S  implicated as another major stimulus for astrocytes and microglia when CNS was invaded by infiltrating immune cells, including T cells or NK cells (Lewis and Wilson, 1990). In purified populations of nerve cells and oligodendrocytes, RT-PCR analysis for cytokine expression was conducted only under unstimulated conditions. RT-PCR analysis was performed by the method described in Chapter 2. The specific sense and antisense primers which were used are listed in Table 3.1. The location of each primer was chosen between two different exons to eliminate contaminating pseudo PCR bands from genomic DNA. PCR was performed at least three times using different cDNA from different RNA samples.  43  3.2.2  Cytokine protein expression To examine effects of proinflammatory cytokines on cytokine production in astrocytes  and microglia, astrocytes-enriched cultures were treated with recombinant human EL-lp (10 ng/ml, R&D Systems, Minneapolis, MN), IFN-Y (500 U/ml, LG Chem, Taejon, Korea) or recombinant human TNF-a (50 ng/ml, GIBCO-BRL, Gaithersburg, MD), and microgliaenriched cultures were treated with LPS (2 Ug/ml, Sigma, St. Louis, MO), IFN-y (500 U/ml, LG Chem, Taejon, Korea), GM-CSF (500U/ml, LG Chem Taejon, Korea) or TNF-a (50 ng/ml, GIBCO-BRL, Gaithersburg, MD). Culture supernatants from experimental as well as control cultures were removed, centrifuged for 5 min at 10,000 g, and stored at -70° C until the time of assay. The protein levels of cytokines including IL-6, EL-11, EL-15 and TNF-a were determined using ELISA kits (Intergen, Purchase, NY; R&D Systems, Minneapolis, MN) or by immunoblot analysis. By ELISA, a monoclonal antibody specific for each of the cytokines was used for coating and a horseradish peroxidase-conjugated polyclonal antibody specific for the cytokine was used for detection, according to the manufacturer's directions. For immunoblot analysis, astrocyte- or microglia-conditioned culture media were diluted two-fold with medium and filtered through nitrocellulose membranes placed in an 96-well dot filtration manifold (GIBCO-BRL, Gaithersburg, MD). Each cytokine was identified using polyclonal antibody (Pepro-Tech, Rocky Hill, NJ) and the ECL chemiluminescent light detection system (Amersham, Oakville, Ontario). As a standard, known amounts of recombinant human cytokine (Pepro-Tech; R&D) were diluted and run in parallel.  44  Table 3.1 Primer sequences used for PCR amplification of cytokine cDNA Gene  Sequence(5' - 3')  Product Size (base pairs) 179 b.p  EL-IP  AAAAGCTTGGTGATGTCTGG TTTCAACACGCAGGACAGG  IL-2  ATGGTTGCTGTCTCATCAGC CTGGAGCATTTACTGCTGGA  301 b.p  IL-3  ATGAGCCGCCTGCCCGTCCTG AAGATCGCGAGGCTCAAAGTCGTCTGTTG  459 b.p  IL-4  GACACAAGTGCGATATCACC AAGTTTTCCAACGTACTCTG  337 b.p  IL-5  GAGGATGCTTCTGCATTTGAGTTTG GTCAATGTATTTCTTTATTAAGGACAAG  295 b.p  IL-6  GTGTGAAAGCAGCAAAGAGGC CTGGAGGTACTCTAGGTATAC  159 b.p  IL-7  TGTTGAACTGCACTGGCCAG GCAACTGATACCTTACATGG  484 b.p  IL-8  ATGACTTCCAAGCTGGCCGTG TATGAATTCTCAGCCCTCTTCAAAA  301 b.p  IL-9  ATGCTTCTGGCCATGGTCCT TATCTTGCCTCTCATCCCTC  375 b.p  IL-10  AGATCTCCGAGATGCCTTCAGCAGA CCTTGATGTCTGGGTCTTGGTTCTC  194 b.p  IL-11  ACTGCTGCTGCTGAAGACTCGGCTGTGA ATGGGGAAGAGCCAGGGCAGAAGTCTGT  295 b.p  IL-12  TCACAAAGGAGGCGAGGTTCTAAGC  213 b.p  CCTCTGCTGCTTTTGACACTGAATG IL-13  ACCCAGAACCAGAAGGCTCCG TCAGTTGAACCGTCCCTCGCG 45  198 b.p  Gene  IL-15  Sequence (5' - 3')  Product Size (base pairs)  AAACCCCCTGCCATAGCCAACTCTT CTTCTGTTTTAGGGAGCCCTGCACT  202 b.p  CAAAGTAGACCTGCCCAGAC GACCTCTCTCTAATCAGCCC  490 b.p  TGAACCTGAGTAGAGACACTG TCCCTCCAAGATGACCATCCT  374 b.p  TGF-a  GAGCTGAGAGATAACCAGCTGGTG CAGATAGATGGGCTCATACCAGGG  237 b.p  TGF-pl  TTGCAGTGTGTTATCCGTGCTGTC CAGAAATACAGCAACAATTCCTGG  160 b.p  GGCTAGCAAGGAAGATTCGTTCAGA TGAAGGTTCTCTTGGAGTCGCTCTG  168 b.p  LIF  AGCACGTTGCTAAGGAGGCC CAATGGCAGTGCCAATGCCC  291 b.p  SCF  CCCAGGCTCTTTACTCCTGAAG CTGCCCTTGTAAGACTTGGCTG  349 b.p  TNF-a  GM-CSF  CNTF  46  3.3  Results  In the present study, expression of various cytokines which include interleukin-ip (IL-1(3), IL-2 to IL-13, IL-15, TNF-a, GM-CSF, TGF-a, TGF-pl, CNTF, LIP, and SCF was investigated in purified populations of astrocytes, microglia, neurons and oligodendrocytes prepared from mixed cell culture preparation of human CNS tissue as described in Chapter 2.  3.3.1  Cytokine expression in human astrocytes  Cytokine mRNA expression Cytokine mRNA levels in human astrocytes were determined by RT-PCR analysis. The basal level expression of cytokines in unstimulated human astrocytes is shown in Fig. 3.1 A. Unstimulated astrocytes expressed transcripts for IL-9, IL-11, IL-15, TGF-a, TGF-pi, CNTF, LIF and SCF constitutively. Results of cytokine mRNA analysis of human astrocytes after 6 hr exposure to IL-1 P (10 ng/ml) plus IFN-y (500 U/ml) are shown in Fig. 3.IB. Transcripts for IL-lp, IL-6, IL-8, TNF-a, and GM-CSF were strongly induced by IL-lp plus IFN-y, and mRNA levels of IL-9 and IL-15 were slightly increased by IL-1 P plus IFN-y (Fig. 3. IB). In summary, human astrocytes express transcripts for IL-lp, B L - 6 , IL-8, IL-9, IL-11, IL-15, TNF-a, GM-CSF, TGF-a, TGF-pl, CNTF, LIF and SCF, but do not express transcripts for IL-2, IL-3, IL-4, IL-5, IL-7, IL-10, IL-12 or IL-13 (Table 3.2). Cytokine protein expression As shown in Figs. 3.5, 3.7 and 3.8, IL-1 p (10 ng/ml), but not IFN-y (500 U/ml), strongly induced IL-6, IL-11 and IL-15 secretion, with the exception of IFN-y treatment of  47  astrocytes at 48 h. Interestingly, IL-6 protein was detected in unstimulated astrocyte cultures and steadily increased at time points beyond 24 h, even though IL-6 mRNA was not detected in unstimulated astrocytes at 6 h. The lack of IL-6 mRNA induction in unstimulated astrocytes at 6 h could be explained by the delayed kinetics of mRNA induction. Treatment with EL-ip plus IFN-y did not show a synergistic effect for EL-6, IL-11 or EL-15 production. In the case of EL-11 production, treatment with EL-ip plus EFN-y was much less effective when compared with EL-ip treatment alone. These results may indicate IFN-y's possible involvement in inhibition of the EL-11 synthesis mechanism, which is currently unknown. As shown in Fig. 3.6, EL-9 was produced constitutively, and the protein levels of EL-9 were not increased by IL-1 P or EFN-y treatment.  3.3.2  Cytokine expressions in human microglia  Cytokine mRNA expression Basal level expression of cytokines in unstimulated microglia is shown in Fig. 3.2A. The results show that microglia constitutively express low levels but detectable quantities of transcripts for IL-lp, IL-6, IL-10, IL-15, TNF-a, TGF-a, and TGF-pl. Following activation with LPS (2 Ug/ml) plus IFN-y (500 U/ml), additional transcripts for IL-8 and IL-12 were detected as well as an increase in the expression of transcripts for IL-ip, EL-6, EL.-10, EL-15 or TNF-a (Fig. 3.2B). In summary, human microglia, either stimulated or unstimulated, express transcripts for DL-lp, IL-6, IL-8, IL-10, IL-12, IL-15, TNF-a, TGF-a, and TGF-pl, but do not express transcripts for IL-2, IL-3, IL-4, IL-5, EL-7, IL-9, IL-11, IL-13, GM-CSF, CNTF, LIF or SCF (Table 3.2). 48  Cytokine protein expression Microglial IL-6, TNF-a and IL-15 protein production in response to LPS, IFN-y, TNF-a or LPS plus IFN-y is shown in Figs. 3.9, 3.10 and 3.11. LPS (2 |ig/ml) treatment strongly induced IL-6 production, while treatment with IFN-y (500 U/ml) or TNF-a ( 50 ng/ml) did not show IL-6 protein induction. Treatment with LPS plus IFN-Y did not show a synergistic effect for the IL-6 production. As shown in Fig. 3.10, TNF-a protein was induced by treatment with LPS (2 |ig/ml) or IFN-y (500 U/ml), and treatment with LPS plus IFN-y demonstrated a synergistic effect for the TNF-a production which peaked at 12 h. In Fig. 3.11, treatment with LPS (2 jxg/ml) or IFN-Y (500 U/ml) induced a large increase in IL-15 secretion, while GM-CSF (500 U/ml) treatment produced a small increase in IL-15 secretion.  3.3.3  Cytokine expression in human neurons Human nerve cells express transcripts for IL-5, TGF-(3l and LIF, but transcripts for  IL-lp, IL-2, IL-3, IL-4, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-15, TNF-a, GMCSF, TGF-a, CNTF or SCF were not detected (Fig. 3.3).  3.3.4  Cytokine expression in human oligodendrocytes Human oligodendrocytes express transcripts for EL-ip, TGF-a, TGF-pi and CNTF  but do not express detectable levels of transcripts for IL-2, IL-3, IL-4, IL-5, IL-6,IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-15, LIF or SCF (Fig. 3.4).  49  ASTROCYTE (A) M  1 2 3  4  6 7 8 M 9 10 11 12 13 14 M 15 16 1718 19 20 21  5  1718 19 20 21  Figure 3.1. RT-PCR analysis of mRNA expression for cytokines in human astrocyte culture. A) Astrocytes in an unstimulated condition. B) Astrocytes were treated with IL-1 P (10 ng/ml) plus IFN-y (500U/ml) for 6 hours. 1  IL-1  9.  IL-9  17.  TGF-a  2.  IL-2  10  IL-10  IX  TGF-B  3. 4 5.  IL-3 IL-4  11 12  IL-11 IL-12  LIF CNTF  IL-5  6  IL-6  13. 14  IL-13 IL-15  19 20. 21. M.  7.  IL-7  TNF-a  X  IL-8  15. 16.  GM-CSF  50  SCF 100 bp D N A marker  MICROGLIA  Figure 3.2. RT-PCR analysis of mRNA expression for cytokines in human microglia culture. A) Microglia in an unstimulated condition. B) Microglia were treated with LPS (2 ng/ml) plus IFN-y (500U/ml) for 6 hours. 1  IL-1  9.  IL-9  17.  TGF-a  2.  IL-2  10.  IL-10  18.  3. 4  IL-3 IL-4  11.  19. 20.  TGF-p LIF CNTF  5.  IL-5 IL-6  12. 13. 14  IL-11 IL-12 IL-13 IL-15  2.1. M  SCF 100 bp D N A marker  IL-7  15.  TNF-a  IL-8  16  GM-CSF  6. 7. X  51  NEURON M l  2  3 4 5  6 7  8 M 9 10 11 12 13 14 M 15 16 1718 19 20 21  Figure 3.3. RT-PCR analysis of m R N A expression for cytokines in human neurons in culture. 1. 2 3. 4 5  IL-1  9.  IL-9  17  TGF-a  IL-2  K)  IL-10  18  1 1 IL-1 1 12 IL-12 13 IL-13  19 20.  TGF-|^ L1F CNTF  14  IL-15  M.  15  TNF-a  16  GM-CSF  11.-3 IL-4  6. 7.  IL-5 IL-6 IL-7  8.  IL-8  21.  52  SCF 100 bp D N A marker  OLIGODENDROCYTE 12  3 4 5  6 7  8 M 9 10 11 12 13 14 M 1516 1718 19 20  Figure 3.4. R T - P C R analysis of m R N A expression for cytokines in uman oligodendrocytes in culture. IL-1  9  IL-9  17.  TGF-a  IL-2  10.  IL-10  18.  IL-3 IL-4  11. 12.  IL-11  19.  TGF-P LIF  IL-12  20.  IL-5 IL-6 IL-7  13. 14. 15.  IL-13 IL-15  21. M.  IL-X  16  TNF-(x GM-CSF  53  CNTF SCF 100 bp D N A marker  • Control • IL-lb/IFN-g • IL-lb  12h  24h  48h  72h  Fig. 3.5. IL-6 production in human astrocyte cultures. Astrocytes were stimulated with IL-1 beta (10 ng/ml), IFN-gamma (500 U/ml) or IL-1 beta plus IFN-gamma for the indicated times and IL-6 levels in the culture supernatants were measured by ELISA. Values shown are means +/- SD from 3 separate experiments. * p<0.05 (ANOVA)  54  ASTROCYTE  IL-9 Medium  a  c  Figure 3.6. Immunodetection analysis of IL-9 secretion in cultured human astrocytes Astroglial cells were incubated in serum-free medium in the presence or absence of recombinant human cytokines for 24 h , and then processed for immunodetection analysis Astrocytes-conditioned medium (100 ul) was diluted two fold in serum-free medium As a positive control, recombinant human IL-9 (10, 5, 2.5 and 1 25 ng) was spotted (IL-9). Fresh serum-free medium was used as a negative control (Medium) Lanes: (a) Control, (b) IL-ip (10 ng/ml)/IFN-y (500 U/ml), (c) IL-lp (10 ng/ml), (d) IFN-y (500 U/ml)  55  1400 • Control 1200  • IL-lb/IFN-g • IL-lb • IFN-g  1000  800  600  400  200  12h  24h  48h  72h  Fig. 3.7. IL-11 production in human astrocyte cultures. Astrocytes were stimulated with IL-lbeta (10 ng/ml), IFN-gamma (500 U/ml) or IL-1 beta plus IFN-gamma for the indicated times and IL-11 levels in the culture supernatants were measured by ELISA. Values shown are means +/- SD from 3 separate experiments. * p<0.05 (ANOVA)  56  ASTROCYTE  IL-15  #  •  «  Medium a b  Figure 3.8. Immunodetection analysis of IL-15 secretion in human astrocyte cultures Astrocytes were incubated in serum-free medium in the presence or absence of recombinant human cytokines for 24 h., and then processed for immunodetection analysis Astrocytes-conditioned medium (100 ul) was diluted two fold in serum free medium. As a positive control, recombinant human IL-15 (10, 5, 2 5 and 1 25 ng) was spotted (IL-15). Fresh serum-free medium was used as a negative control (Medium). Lanes: (a) IL-lp (10 ng/ml) plus IFN-y (500 U/ml), (b) IL-1 p(10 ng/ml), (c) IFN-y (500 U/ml), (d) TNF-a (50 ng/ml), (e) IL-6 (50 ng/ml), (0 Control  57  • Control • LPS/IFN-g • LPS • TNF-a  12h  24h  48h  72h  Fig. 3.9. IL-6 production in human microglia cultures. Microglia were stimulated with LPS (2 ng/ml), IFN-gamma (500 U/ml) or LPS plus IFNgamma for the indicated times and IL-6 levels in the culture supernatants were measured by ELISA. Values shown are means +/- SD from 3 separate experiments  58  1400 1200 1000 800 600 400 200  12h  24h  48h  72h  Fig. 3.10. TNF-alpha production in human microglia cultures. Microglia were stimulated with LPS (2 ng/ml), IFN-gamma (500 U/ml) or LPS plus IFN-gamma for the indicated times and TNF-alpha levels in the culture supernatants were measured by ELISA. Values shown are means+/-SD from 3 separate experiments.  59  MICROGLIA  IL-15  ft  Medium  a  ft  b  •  •  •  c  «  *  •  d  ft  ft  •  •  Figure 3.11. Immunodetection analysis of IL-15 secretion in human microglia cultures Microglial cells were incubated in serum-free medium in the presence or absence of recombinant human cytokines for 24 h , and then processed for immunodetection analysis Microglia-conditioned medium (100 pi) was diluted two fold in serum -free medium. As a positive control, recombinant human IL-15 (10, 5, 2 5 and 1 25 ng) was spotted (IL-15) Fresh serum-free medium was used as a negative control (Medium) Lanes: (a) LPS (2 pg/ml), (b) IFN-y (500 U/ml), (c) GM-CSF (500 U/ml), (d) Control  60  Table 3.2 Cytokine gene expression in human CNS cell culture Neuron  Oligodendrocyte  Astrocyte (unstimulated)  IL-lp IL-2 1L-3 IL-4 IL-5 IL-6 IL-7 IL-8  -  ++  -  -  -  -  -  IL-9 IL-10 IL-11 IL-12 IL-13 IL-15  -  -  -  -  -  Astrocyte Microglia Microglia (IL-1 p+EFN y (unstimul- (LPS+IFNy stimulated) ated) stimulated) ++ + ++  -  —  —  —  —  —  —  —  —  ++  +  ++  -  —  —  -  ++  +  ++ ++  —  —  -  -  +  ++  ++  ++  -  —  -  -  —  ++  -  —  —  -  -  +  TNF-a GM-CSF  -  -  + +  ++ ++  -  -  -  —  TGF-a TGF-pl CNTF LIF  ++  ++ ++  ++ ++  ++ ++  ++ ++  -  +  —  —  ++  -  —  —  -  -  ++ ++ ++  ++ ++ ++ ++ ++ ++ ++  -  -  SCF  -  +  -  -  -  ++  Summary of RT-PCR analysis of cytokines in human CNS neural cell types. RT-PCR was performed as described in materials and methods ++ = strong positive signal, + = positive signal, - = no signal.  61  3.4  Discussion  It is now generally accepted that cellular elements of the CNS can both produce and respond to various cytokines. Identification of the sites of cytokine production and factors that control the production is an important first step in understanding how these mediators function in the CNS. In the present study, gene expression of cytokines in the cells of human brain was examined by RT-PCR and enzyme immunoassay. The expression profiles of cytokine mRNAs are summarized in Table 3.2. The results of the present study indicate the following: 1) Human astrocytes expressed transcripts for a large array of proinflammatory cytokines including IL-lp, IL-6, IL-8, IL-15 and TNF-a, while microglia also expressed transcripts for IL-12 in addition to the proinflammatory cytokines produced by astrocytes. 2) As for anti-inflammatory cytokines, expression of IL-10 was present only in microglia whereas the expression of transcripts for IL-4 and IL-13 was not detected in any of CNS cell types studied. Another anti-inflammatory cytokine, TGF-pi, was expressed in all CNS cell types. 3) Astrocytes produced hematopoietic growth factors such as IL-9 and IL-11, and human nerve cells expressed transcript for IL-5. 4) Human astrocytes, microglia and oligodendrocytes expressed transcripts for TGF-a, whereas neurons did not. 5) Transcripts for gp 130-associated cytokines, transcripts for CNTF were expressed in both astrocytes and oligodendrocytes. The expression of LIF transcript was detected in astrocytes and nerve cells, but microglia did not express CNTF nor LIF. 6) Transcripts for stem cell growth factor (SCF) were expressed in astrocytes.  62  3.4.1  Proinflammatory cytokines in the human CNS Within the CNS, various cytokines including IL-1, EL-6, TNF -a and TGF-p are  detected following CNS injury (Hopkins and Rothwell, 1995). Previous studies in rodent glial cell cultures have demonstrated that the activated astrocytes and microglia are able to synthesize proinflammatory cytokines such as IL-1, IL-6 and TNFoc (Fontana et al., 1982a, 1982b, 1982c; Giulian et al., 1986; Frei et al., 1988, 1989; Benveniste et al., 1990, 1992; Chung and Benveniste, 1990; da Cunha and Vitkovic, 1992; Aloisi et al., 1992; Lee et al.., 1993). As shown in Table 3.2, both human astrocytes stimulated by IL-fj plus IFN-y and human microglia stimulated by LPS plus EFN-y expressed mRNAs for EL-lp, IL-6, IL-8 and TNF-a. However, mRNAs for these cytokines were not detectable in unstimulated astrocytes, and only minimally detectable in unstimulated microglia. These results are in agreement with the observation reported by other investigators (Aloisi et al, 1992; Lee et al., 1993). Earlier immunocytochemical studies have demonstrated that microglia associated with senile plaques in Alzheimer's disease (AD) are immunoreactive for the cytokines EL-1 (Griffin et al., 1989; Dickson et al., 1993), IL-6 (Strauss et al., 1992), and TNF-a (Dickson et al., 1993). A close correlation has been found between disease progression and TNF-a levels in cerebrospinal fluid (CSF) of multiple sclerosis (MS) patients (Sharief and Thompson, 1992a,1992b). Immunoreactivity for EL-ip, TNF-a and IFN-y has been demonstrated in active chronic inflammatory lesions of acquired immunodeficiency syndrome (AIDS) (Dickson et al., 1993). The present study demonstrates that only microglia expressed EL-12 (p40) transcripts, a proinflammatory cytokine, when stimulated with LPS and IFN-y. Astrocytes and microglia  63  also produced IL-15, either constitutively at a low level or at larger amount after stimulation with IL-lp or LPS respectively. These results suggest that IL-12 and IL-15 are involved closely with inflammatory conditions of the human CNS. Recent studies of immune system have shown that bacterial stimuli activate macrophages to produce IL-12 and drive IFN-y over-production by T cells and natural killer (NK) cells, resulting in lethality of endotoxininduced shock (Heinzel et al., 1994; Wysocka et al., 1995). Another candidate proinflammatory cytokine, IL-15, which is a novel T-cell growth factor, shares many biological activities with IL-2 and leads to the activation of NK cells, as measured by antibody-dependent cellular cytotoxicity (Carson et al., 1994). A previous study has demonstrated that stimulation of murine astrocytes and microglia by LPS and IFN-y induces IL-12 production (Stalder et al., 1997). However, results from the present study showed that only human microglia stimulated by LPS and IFN-y, but not astrocytes, expressed IL-12 (p40 subunit) transcripts, suggesting that within human CNS, microglia are the sole cellular source of IL-12 production. Consistent with this result is the observation by Becher et al. (1996) that human adult microglia, but not astrocytes, expressed IL-12 p40 mRNA and p70 IL-12 protein following activation with LPS. Proinflammatory properties of IL-12 have been demonstrated in EAE, where administration of this cytokine aggravates the disease (Santambrogio et al., 1995), whereas administration of IL-12 antibodies prevents progression of EAE (Leonard et al., 1995). In addition, increased expression of IL-12 in acute MS plaques has been reported (Windhagen et al., 1995), and mRNA for IL-12 (p40 subunit) is up-regulated in both infiltrating macrophages and resident microglia from mice with EAE (Krakowski and Owens, 1997). Thus, our observation that only microglia expressed transcript for IL-12 (p40 subunit)  64  is of particular interest since it implies a specific role of microglia in the production of DFN-y by CD4 T cells that infiltrate the brain of MS patients. +  The present study showed that the IL-8 and IL-15 gene is expressed in human astrocytes and microglia. IL-8 mRNA was only found to be expressed in these cell types following stimulation. Low levels of IL-15 mRNA were detected in both unstimulated astrocytes and microglia. Upregulation of IL-15 mRNA and protein levels in astrocytes was demonstrated following treatment with EL-lp, EFN-y or TNF-a. Similarly, upregulation of DL-15 mRNA and protein levels in microglia was induced by treatment with LPS or EFN-y. EL-8 acts as a chemokine to attract inflammatory cells, and rL-15 activates NK cells to produce DFN-y and TNF-a (Carson et al., 1994). Moreover, DLv-15 has been demonstrated to be a major survival factor for NK cells and CD4+ T Cells (Carson et al., 1997; Dooms et al., 1998), and IL-15Ra null (TL-15Ra -/-) mice have been shown to be deficient in NK cells and T lymphocytes (Lodolce et al., 1998). Additionally, it has recently been proposed that NK cells may play a role in the immunopathogenesis of MS (Kastrukoff et al., 1998). Thus, in this context, the demonstration of increased IL-12 and IL-15 by microglia, as well as IL-15 by astrocytes in the present study could represent a novel role for these cytokines in the pathogenesis of human CNS diseases associated with inflammatory conditions, such as MS. However, since the fundamental roles of IL-8, EL-12 and EL,-15 in the CNS are not well understood specifically with respect to the target CNS cell types, determining the expression of their corresponding receptors on different CNS cells is an important step in identifying the cell types which are closely associated with the pathological mechanisms of neurological disorders.  65  3.4.2  Anti-inflammatory cytokines in human CNS It is generally accepted that the over-production of proinflammatory cytokines by  CNS cells contributes to pathophysiological changes seen in various neurological diseases and brain injury and the major cellular sources of these cytokines are astrocytes and microglia. It is also known that production of proinflammatory cytokines in the CNS is under a strict control to maintain the normal homeostasis of the CNS. In the peripheral immune system, Th2 cells produce anti-inflammatory cytokines including IL-4, IL-10 and IL-13 to down-regulate the production of proinflammatory cytokines by Thl cells. In the CNS, there is accumulating evidence which supports the anti-inflammatory properties of these cytokines. In a rodent EAE model, treatment with IL-4, IL-10 and IL-13 resulted in amelioration of clinical EAE and inhibition of proinflammatory cytokine expression in the CNS (Kennedy et al., 1992; Racke et al., 1994; Cash et al., 1994). The results of the present study showed that transcripts for IL-10 were detected only in microglia and upon LPS and TFN-y stimulation, IL-10 mRNA levels were increased. Transcripts for IL-4 and IL-13 were not detected in any of human CNS cell types studied. These results suggest that IL-10 is the only anti-inflammatory cytokine produced by human CNS cell types and the production of inflammatory cytokines by activated microglia might be tightly controlled via an autocrine negative feedback loop. Furthermore, a recent report using microglia from adult human CNS has shown that IL-10 is produced by microglia with the stimulation with LPS and IFN-y, and externally applied recombinant human IL-10 downregulates the antigen presentation capacity of microglia (Williams et al., 1996). This finding is consistent with the results of the present study." The involvement of IL-4 and IL-13 as antiinflammatory cytokines in human CNS should also be considered. Immunoreactivity for IL-4 66  can be detected in MS brain lesions (Cannella and Raine, 1995), possibly derived from infiltrating leukocytes, and IL-13 down-regulates production of several proinflammatory cytokines including EL-1, EL-12 and TNF-a, and suppresses NO production in activated murine macrophages (de Waal et al., 1993). In order to understand the anti-inflammatory function of these cytokines in human CNS, expression of receptors for these cytokines in human neural cell types should be determined. Another important observation from the present study is that all human CNS cell types expressed TGF-P 1 transcripts. This TGF-P 1 transcript expression in human CNS is consistent with previous studies using rodent CNS tissues. Expression of TGF-pl is found mainly in astrocytes, microglia, and oligodendrocytes, and is rapidly up-regulated in response to neural injury or stimulation with EL-1 (Lindholm et al., 1992; Logan et al., 1992; da Cunha et al., 1993a, 1993b; Morgan et al., 1993). TGF-pl and TGF-p2 inhibit proliferation of rat astrocytes (Lindholm et al., 1992; Morgant-Kossmann et al., 1992), and TNF-a production by microglia and astrocytes (Suzumuru et al., 1993; Benveniste et al., 1994). TGF-pl also inhibits PDGF-driven proliferation of oligodendrocyte-type-2 astrocyte (0-2A) progenitor cells and promotes oligodendrocyte differentiation (McKinnon et al., 1993). In this context, TGF-P produced by human glial cells may exert immunosuppressive effects and promotion of oligodendrocyte differentiation in the human CNS. Another interesting aspect of the present study was that human nerve cells expressed TGF-P transcripts, suggesting some functional roles of TGF-p in neuronal function. From previous observations, TGF-P 1 and TGF-P2 directly potentiate neuronal survival and substance P expression in neonatal mouse  67  dorsal root ganglia (Chalazonitis et al., 1992; Rogister et al., 1993). This further supports the possibility that TGF-(3 might be an important cytokine during neuronal development.  3.4.3  Hematopoietic growth factors in human CNS Hematopoietic growth factors have been reported to be involved in the development  of the nervous system (Mehler and Kessler, 1997). Various cytokines including IL-2, IL-3, IL-4, IL-5, IL-7 and IL-8 have been described as neurotrophic factors in rodent CNS (Kamegai et al., 1990; Araujo and Cotman, 1993; Shimojo et al., 1993; Michaelson et al., 1996). However, the results from the present study indicated that the gene transcripts for IL2, IL-3, IL-4 and IL-7 were not detected in any of the human CNS cell types and it is possible that different kinds of hematopoietic growth factors might be associated with human CNS development. There have been a few studies that suggested gpl30-associated cytokines were involved in human CNS development. The gpl30-associated cytokines such as IL-6, CNTF, and LIF have been described as neurotrophic factors supporting neuronal survival and differentiation (Hama et al., 1989; Ip et al., 1994). In addition, CNTF and LIF potentiate astroglial lineage commitment from early neural progenitor cells and enhance the survival of immature and mature oligodendrocytes (Hughes et al., 1988; Barres et al., 1993; Louis et al., 1993; Kahn and de Vellis, 1994; D'Souza et al., 1996). Thus, the results of the present study which showed the expression of CNTF or LIF in both astrocytes and oligodendrocytes support earlier studies that CNTF and LIF are involved in the differentiation of glial cells and neuronal survival/differentiation during the human CNS development.  68  For the neuronal lineage, EL-5, IL-7, EL-9 and EL-11 have been shown to enhance the neuronal differentiation of murine hippocampal multipotent progenitor cell line (Mehler et al., 1993). The present study found that the cellular source of IL-9 and EL-11 in the human CNS was astrocytes, and human neurons expressed transcripts for IL-5. What exact physiological functions these cytokines (IL-5, DL-9 and IL-11) play in the human CNS development remains unknown. Another recent study has shown the cellular localization of stem cell factor (SCF) in the mouse nervous system (Zhang and Fedoroff, 1998). The expression of mRNA for SCF was detected in cultured neurons, astrocytes and microglia, and the addition of recombinant SCF to astrocytes in culture, up-regulated mRNA expression of NGF, BDNF and CNTF (Zhang and Fedoroff, 1998). However, the present study demonstrated that the only cellular source of SCF mRNA in the human CNS is astrocytes. The expression of TGF-a mRNA was detected in astrocytes, microglia and oligodendrocytes in the present study. From previous study, TGF-a induced proliferation of a multipotent progenitor cell from embryonic mouse striatum (Reynolds et al., 1992), it is possible to postulate that TGF-a may play a role in proliferation and/or differentiation of human CNS cells.  69  Chapter 4  4.1  Cytokine Receptor Expression in Human CNS Cells  Introduction Two fundamental features of cytokines are their functional pleiotrophy and functional  redundancy. Each cytokine interacts with different types of cells and exhibits pleiotrophic functions in different target cells, while several distinct cytokines display similar biologic activities on the same cells (Geoffrey et al., 1994). Recent cloning of cytokine receptor genes has revealed that cytokine receptors usually consist of multiple subunits and share a common subunit. Most of the cytokine receptors do not possess intrinsic protein kinase (PTK) domains, yet stimulation of receptors usually invokes rapid tyrosine phosphorylation of different intracellular proteins in different cell types (Kishimoto et al., 1994).  Interleukin-1 receptor (IL-1R) There are two forms of IL-1R encoded by separate genes, type I (80-kDa) and type II (68-kDa) receptor, which are both members of the immunoglobulin (Ig) superfamily. The type I receptor (IL-1RI) is predominantly expressed on endothelial cells, hepatocytes, fibroblasts, keratinocytes and T lymphocytes whereas the type II receptor (fL-lRH) is found on B lymphocytes, monocytes and neutrophils (Dower et al., 1990; McMahan et al., 1991). The IL-1RI is the primary signal transducing receptor, while there is no evidence as yet that the IL-1RII functions in any signal pathway. Both forms of receptors bind IL-1 a and JL-lp\ and IL-RA, the third ligand, DL-1R antagonist. The type I receptor preferentially binds IL-1 a and the type II receptor preferentially binds IL-ip (Dinarello, 1991). Both DL-1RI and IL1RH have soluble isoforms generated by proteolytic cleavage that can bind and inhibit IL-1 a 70  and EL-lp, respectively (Heaney and Golde, 1996). These findings implicate that response of EL-1 is tightly regulated because soluble DL,-1RI and DL.-1RII can bind IL-1 ligands as antagonists or agonists. In the CNS, radioligand binding studies revealed that IL-1 receptors were present in the hippocampus, the pituitary and choroid plexus of mouse brain (Takao et al., 1990; Ban et al., 1991). TL-1RI gene expression has been shown in mouse astrocytes and rat Schwann cells (Rubio, 1994; Skundric et al., 1997). A recent study has shown that human glioblastoma cells and adult astrocytes expressed the genes for both types of IL-1R, but fetal astrocytes did not express IL-1RII mRNA (Tada et al., 1994).  Interleukin-2 receptor (TL-2R) EL-2R is a complex of three distinct polypeptide chains: a chain (IL-2Ra), P chain (EL-2RP) and y chain (EL-2Ry). Different combinations of the three DL.-2R components give rise to IL-2 binding complexes of different affinities. IL-2RP and EL-2Ry are necessary for signal transduction while the IL-2R with the highest affinity (Kd 10" M ) for IL-2 requires 11  all three chains (Taniguchi and Minami, 1993). In the CNS, IL-2 and DL,-2Rcc positive cells have been detected at the lesion edges of MS brain, while none of the normal brain tissues was positive for IL-2 or DL,-2Roc reactivity (Woodroofe et al., 1986; Otero and Merrill, 1994). On the other hand, other experiments have demonstrated that IL-2RP and EL,-2Ry mRNA can be detected in normal murine and human brains (Petitto and Huang, 1994; Otero and Merrill, 1995; Pettito et al., 1998), and EL-2Ra and IL-2Rp in mouse microglia (Sawada et al., 1995).  71  Interleukin-3 and Interleukin-5 receptors (IL-3R & IL-5F0 In human, a-chains of IL-3 and IL-5 receptors alone express low affinity binding and are specific for each cytokine. The high affinity binding is the result of association of each achain with a common P-chain (AIC 2B) shared by the two receptors, which alone does not bind the cytokines. In the murine system, a second P-chain (AIC 2A) has been identified. Unlike AIC2B, the AIC2A molecule binds IL-3 with low affinity (Miyajima et al., 1993). At the present time, the cellular localization of IL-3R and IL-5R in the CNS is not well characterized. A recent study has demonstrated that IL-3R mRNA expression was observed in mouse microglia and oligodendrocytes, but IL-5R mRNA was not detected in any of the CNS neural cell types examined (Sawada et al., 1993b).  Interleukin-4. 7 and 9 receptors (IL-4R. IL-7R and IL-9R) IL-4, IL-7 and IL-9 are well known to boost growth and differentiation of T cells and B cells at different stages of development. The IL-4R, IL-7R and IL-9R are complexes consisting at least of two chains: a high affinity oc-chain and the IL-2Ry -chain also known as the common y-chain (y ). Although the y-chain does not bind any of these ligands, it c  functions to augment the binding of these ligands by their specific receptors and is required for receptor mediated signaling. However, each cytokine induces a different signaling specificity which may be conferred by each oc-chain (Kondo et al., 1993; Russell et al., 1993). In the CNS, IL-4R mRNA has been detected in mouse brain (Lowenthal et al., 1988), microglia and oligodendrocytes, while DL-7R mRNA has been detected in mouse microglia,  72  astrocytes, oligodendrocytes and rat embryonic neurons (Sawada et al.,1993b; Michaelson et al., 1996). Whether or not the cells of the human CNS express JL-4R, EL-7R or EL-9R remains unknown.  Interleukin-8 receptor (EL-8R) EL-8, a member of the CXC chemokines, is a strong neutrophil chemoattractant, and its specific receptors were identified on neutrophils and the human myelomonocyte cell line, HL60 (Moser et al., 1991; Murphy and Tiffany, 1991). cDNAs encoding two distinct types of human JL-8R have been cloned and were designated type I (type A) (Holmes et al., 1991) and type II (type B) (Murphy and Tiffany, 1991). The deduced amino acid sequences of both receptors predicted that they belong to a G protein-coupled receptor family with seven transmembrane domains, similar to the receptor for other chemotactic factors including formyl Met-Leu-Phe (fMLP), C5a and platelet-activating factor (PAF) (Boulay et al., 1990; Gerard, N.P. and Gerard, C , 1991; Honda et al., 1991). Characterization of the two high affinity human IL-8Rs has demonstrated that type Et receptor, but not type I, could bind the a chemokines GRO and NAP-2 with high affinity in addition to EL-8 (Beckmann et al., 1991; Lee et al., 1992; Cerretti et al., 1993). This receptor subtype specificity is determined by the N terminus of the EL-8R (LaRosa et al., 1992; Gayle et al., 1993). Immunofluorescence analysis of human peripheral blood leukocytes demonstrated that mature granulocytes except eosinophils express both types of EL-8Rs. A majority of monocytes and CD16 NK cells +  were stained with both antibodies to type I and type II DL,-8R, whereas CD3 T , CD20 B +  +  lymphocytes or CD34 cells in cord blood were not stained with either antibody (Morohasi et +  73  al., 1995). At the present time, cellular localization of IL-8R in the CNS is not well characterized.  Interleukin-10 receptor (IL-1 OR) IL-10 inhibits cytokine synthesis by activated T cells, NK cells and monocytes/macrophages. On the other hand, IL-10 costimulates proliferation and differentiation of human B cells, mouse thymocytes and mast cells (Moore et al., 1993). The different activities of IL-10 are likely mediated by IL-lORs expressed at the cell surface. Human and mouse IL-lORs have been cloned (Ho et al., 1993; Liu et al., 1994). One type of IL-1 OR (IL-lORa) is a cell surface receptor with single transmembrane domain and is structurally related to IFNR and thus is a new member of the class II subgroup of the cytokine receptor family. Recently, it was reported that CRFB4, an orphan receptor encoded on human chromosome 21 (Lutfalla et al., 1993), serves as an accessory chain essential for the active IL-10R complex and to initiate IL-10-induced signal transduction (Kotenko et al., 1997).  Interleukin-12 receptor (IL-12R) IL-12 is a powerful inducer of Thl responses, thereby promoting cell-mediated immunity. In addition, IL-12 induces IFN-Y secretion by both T and NK cells, stimulates proliferation of activated T and NK cells, and enhances T and NK cell-mediated cytolytic activity (Trinchieri, 1995). Two subunits of the human and mouse IL-12R, IL-12Rpl and IL12Rp2, have recently been cloned (Chua et al., 1994; Chua et al., 1995; Presky et al., 1996).  74  Both subunits belong to the cytokine receptor superfamily and are homologous to gpl30, a common receptor subunit for EL-6 family cytokines. Human IL-12Rpl and IL-12R|32 each bind JL-12 with low affinity, while co expression of IL-12R(3l and DL,-12Rf32 results in expression of both high and low affinity [ I] IL-12-binding sites, and confers IL-12 125  responsiveness (Presky et al., 1996). TL-12R(3l chain is expressed on T cell, NK cell and B cell lines, but not on non-lymphohematopoietic cell lines (Wu et al., 1996). The expression of DL-12R(32 subunit is more restricted than IL-12Rpl. Expression of the IL-12Rpl is similar in Thl and Th2 cells, while IL-12Rp2 subunit mRNA is detected in Thl but not Th2 cells (Szabo et al., 1997). Expression of the rL-12R(32 subunit is required for recruitment and activation of the STAT proteins involved in IL-12 signaling (Presky et al., 1996). These features of EL-12R expression on T cells help explain the molecular basis of IL-12 responses of developing Th cells.  Interleukin-13 receptor (IL-13R) IL-13 has been shown to share some biologic properties with IL-4 (Minty et al., 1993; Zurawski and de Vries, 1994). Studies have been conducted to examine whether these two cytokines share a receptor (Zurawski et al., 1995; Lefort et al., 1995; Obiri et al., 1995). The IL-4R is composed of two chains, the IL-4Ra chain and the common y chain (y ). The ILc  4Ra chain alone forms a tight complex with its ligand, whereas the y was thought to be c  mainly responsible for signal transduction. However, it was demonstrated that IL-4 could also induce actions on non-hematopoietic cells such as COS-7 cells and renal carcinoma cell lines that expressed DL-4Ra but not y (Lin et al.,1995; Obiri et al., 1995). It has therefore c  75  been proposed that a second form of an IL-4R which would be activated by both IL-4 and IL13 (Callard et al., 1996). Since antibodies to IL-4Ra could block IL-13 action, even though IL-13 could not bind to IL-4Ra (Lin et al., 1995; Zurawski et al., 1995), it was hypothesized that the second form of an IL-4R (type IIIL-4R) is composed of IL-4Ra and IL-13R (Lin et al., 1995). This hypothesis was confirmed with the cloning of murine IL-13Ra (Hilton et al., 1996). Recently, two different human IL-13 binding proteins were cloned (Caput et al., 1996; Aman et al., 1996). The Caput group (1996) have cloned human IL-13R from human renal cell carcinoma (RCC) cell line, Caki-1. The receptor is a -70 kDa protein and has a 50% homology to IL-5Ra chain on the DNA level (IL-13Ra), and this 70 kDa protein did not require IL-4Ra for H-13 binding with a high affinity (Caput et al., 1996). On the other hand, another type of IL-13R (IL-13Ra') which was cloned from HTLV-1 infected MT-2 cell line, has no homology with any other human cytokine receptor, and IL-4Ra is required for high affinity IL-13 binding (Aman et al., 1996). The same group demonstrated that the IL-13Ra' but not the IL-13Ra can substitute for y . Cotransfection of IL-4Ra with y or ILc  c  13Ra' increased IL-4 binding affinity and mediated IL-4 induced activation of STAT6 in Chinese hamster ovary (CHO) cell line (Murata et al., 1998). This alternative form of IL-4R (IL-4Rou/IL-13Ra') is also utilized as a functional component of the IL-13R complex. Expression of a truncated IL-13Ra that lacked the cytoplasmic domain failed to transduce TLB-induced signals and inhibits responses to IL-4 (Orchansky et al., 1997).  76  Interleukin-15 receptor (EL-15R) The overlapping activities of EL-15 and LL-2 suggest that EL-15 might share components of the EL-2R for binding and signal transduction (Grabstein et al., 1994). It has been demonstrated that EL-15 requires the p chain and y chain of the EL-2R for the biological activities, but that the a chain of the EL-2R is not required (Giri et al., 1994; Grabstein et al., 1994). Many non-lymphoid cell types bind IL-15 but not EL-2, while some murine cells with functional IL-2R are not capable of responding to EL-15 (Giri et al., 1994). These observations suggest the existence of a specific EL-15R subunit in addition to DL,-2Rp and y . c  This specific IL-15R subunit was cloned and characterized as a chain of the TL-15R complex (Giri et al., 1995; Anderson et al., 1995). In contrast to the low affinity IL-2Ra, IL-15Ra shows a very high affinity of binding to EL-15, but the cytoplasmic domain of DL,-15Ra, like that of EL-2Roc, is dispensable for mitogenic signaling, and at high concentrations, EL-15, like EL-2, is able to signal through a complex of DL,-2Rp and y in the absence of the a subunit c  (Anderson et al., 1995). Despite the overall similarities of the structures of the receptors for TL-2 and EL-15, the distribution of expression of the EL-15Ra is much wider than that of the IL-2Ra, suggesting that IL-15 has additional biological activities beyond those that it shares with DL-2 (Giri et al., 1995; Anderson et al., 1995).  Tumor necrosis factor receptor (TNF-R) There are two TNF receptors of 55 and 75 kDa, both exhibiting specific and highaffinity binding to either TNF-a or TNF-P (Sprang, 1990; Tartaglia and Geoddel, 1992a, 1992b). Several studies have suggested that the TNF-RI (55 kDa) is responsible for the 77  majority of TNF-induced responses including cytotoxicity and modulation of gene expression (Tartaglia et al., 1993a; Mackay et al., 1994; Smith et al., 1994), whereas TNF-RII (75 kDa) is capable of producing responses in selected cell types including both positive and negative control of cellular proliferation (Tartaglia et al., 1991; Gehr et al., 1992). The intracellular portion of TNF-RI has a unique 80 amino acid residue, termed the death domain with homology to a domain of the Fas antigen which can be responsible for initiating the apoptosis pathway (Tartaglia et al., 1993b; Itoh and Nagata, 1993). In addition, the TNF-RI has been closely linked with the sphingomyelinase pathways. The hydrolysis of sphingomyelin by a membrane associated neutral sphingomyelinase produces ceramide, and apoptosis can be induced by ceramide analogs (Wiegmann et al., 1994). TNF-RII is particularly abundant on myeloid and lymphoid cells where it is involved in cell proliferation but it may also mediate cytotoxic effects through a different mechanism from TNF-RI (Tartaglia et al., 1993c, 1993d; Heller and Kronke, 1994). A recent report has also identified a domain of the TNF-RII that is necessary for binding to TNF receptor associated proteins (TRAF1 and TRAF2). The precise role of these proteins in TNF-RII signaling is unknown (Rothe et al., 1994).  Cytokine receptors sharing gp!30 (IL-6R. IL-11R. LIFR and CNTFR) The functional redundancy of IL-6 family cytokines is now well explained by the feature that they all share gpl30 as a signal transducing receptor component (Kishimoto et al., 1994). IL-6 binds to IL-6R and the IL-6/IL-6R complex then associates with gpl30, allowing it to homodimerize. IL-11/IL-l 1R complex is suggested to induce the same type of homodimer. LIF binds to LIFR, whose structure is similar to that of gpl30, and LIFR then forms a heterodimer with gpl30. Formation of the LIFR-gpl30 heterodimer is also triggered 78  by a complex of CNTF and its receptor (Taga, 1996). Mice lacking EL-6, LEF or CNTF gene have been created, and they express phenotypes that are far less severe than those lacking gpl30. This is explained most probably because the lack of a given cytokine expression has been compensated for by the remaining gpl30-binding cytokines which have overlapping biological functions (Yoshida et al., 1996). Although various biological activities of these gpl30-associated cytokines have been characterized in the CNS, the location of these cytokine receptors in the CNS is not known. A recent study has demonstrated the localization of gpl30 in the rat brain by immunohistochemistry, and the gpl30 immunoreactivity was observed in both glial and neuronal cells. This gpl30 immunoreactivity overlaps well with localization of EL-6 receptor and CNTF receptor achain (Watanabe et al., 1996).  79  4.2  Material and methods  4.2.1  Cytokine receptor mRNA expression For RT-PCR analysis, cDNA was prepared by same method for cytokine mRNA  expression (Chapter 3) and RT-PCR analysis was performed under the same conditions as described in Chapter 2, using the specific sense and antisense primers listed in Table 4.1. The location of each primer was chosen between two different exons to eliminate contaminating pseudo PCR bands from genomic DNA. PCR was performed at least three times using different cDNA for each RNA sample.  80  Table 4.1 Primer sequences used for PCR amplification of cytokine receptor cDNA Gene  Sequence (5' - 3')  Product Size (base pairs) 300 b.p  EL-1RI  ACACATGGTATAGATGCAGC TTCCAAGACCTCAGGCAAGA  EL-1RII  GGAGAAGAAGAGACACGGAT TCAGGACACAGCGGTAATAG  392 b.p  EL-2Roc  TTATCATTTCGTGGTGGGGCAGATGGTTTA TCTACTCTTCCTCTGTCTCCGCTGCCAGGT  450 b.p  EL-3Ra  AACGGATGCTCAGGGAACACG GAGGGATGCGGGGAAAGAGTC  554 b.p  IL-4Ra  AGCAACCCGTATCCCCCTGAC TCCAGAAAACAGGGCAAGAGC  515 b.p  IL-5Ra  CCAAGAATACAGCAAAGACAC GGGCTTGTGTTCATCATTTCC  469 b.p  EL-6R  CATTGCCATTGTTCTGAGGTTC AGTAGTCTGTATTGCTGATGTC  251 b.p  IL-7Ra  TGGAGACTTGGAAGATGCA TTAGTAAGATAGGATCCAT  650 b.p  EL-8R (TypelT)  TGGGCAACAATACAGCAAACT GCACTTAGGCAGGAGGTCTTA  503 b.p  IL-9Ra  GCCTGGGAGCAGGCCCAG C ATCC AAGTCTGGAAGTT  422 b.p  IL-lORa  CTCCATCTCCAACTGTAGCCAGAC GGCAATCTCATACTCTCGGAAGTG  301 b.p  IL-11R  CGCCTGCGAGCCAGCTGGACA GCGGAATTCACACAGAGTCCCTGTGATCA  IL-12R  AGTCTTGGAAGCTCCTCTTCA GGTTTCAGATCCAGCAAATCATG  (P2)  81  396, 491,590 b.p  245 b.p  Gene  Sequence(5' - 3')  Product Size (base pairs)  EL-13Ra  GGAGAATACATCTTGTTTCATGG GCGCTTCTTACCTATACTCATTTCTTGG  IL-15Ra  CACGAATGTCGCCCACTGGAC CTTGACTTGAGGTAGCATGCCAG  358 b.p, 457 b.p  TNFRI  CCTCAATGGGACCGTGCACCTCT AGCCGCAAAGTTGGGACAGTCAC  481 b.p  TNFRH  CTCACTTGCCTGCCGATAAGG CGAAAGGCACATTCCTCCTTG  450 b.p.  SCFR  TTCTTACCAGGTGGCAAAGGGCATGGCTTTCC GTCATACATTTCAGCAGGTGCGTGTTCAGGGC  389 b.p  gpl30  TTGACTAGTGACACATTGTAC TGAAACTTGCTTTGACCTTT  771 b.p  82  148 b.p  4.3  Results In order to determine gene expression of various cytokine receptors in human CNS  cell types, pure populations of astrocytes, microglia and neurons were prepared from mixed cell cultures isolated from brains of human embryos (12-18 weeks' gestation). Oligodendrocytes were prepared from adult human brain tissues. Expression of various cytokine receptors including interleukin (IL)-1 receptor type I (IL-lRl), IL-1RII, IL-2R to IL13R, IL-15R, TNFR, SCFR and gpl30 was investigated by RT-PCR.  4.3.1  Expression of cytokine receptor mRNA in human astrocytes The basal level expression of cytokine receptors in human astrocytes is shown in Fig.  4.1 A. Unstimulated astrocytes expressed transcripts for IL-1RI, IL-6R, IL-8RII, IL-9Ra, ILlORa, IL-11R, IL-12Rp2, IL-13Ra, IL-15Ra, TNFRI, SCFR and gp 130. Astrocytes stimulated by IL-1 (3 (10 ng/ml) plus IFN-Y (500 U/ml) for 6 hr were processed for determination of cytokine receptors by RT-PCR (Fig. 4. IB). Upon stimulation, there was an additional expression of IL-1RII and TNFRII by astrocytes which was not evident in the unstimulated condition. There was an increased expression of transcripts for IL-lORa, IL12R|32 and IL-15Ra in stimulated astrocytes. In summary, human astrocytes express transcripts for IL-1RI, IL-1 RE, IL-6R, IL-8RII, EL-9Ra, IL-lORa, IL-11R, IL-12Rf32, IL13Ra, IL-15Ra, TNFRI, TNFRII, SCFR, and gp 130, but not IL-2Ra, IL-3Ra, IL-4Ra, IL5Ra or IL-7Ra.  83  4.3.2  Expression of cytokine receptor mRNA in human microglia Basal level expression of cytokine receptors in human microglia is shown in Fig.  4.2A. Microglial cells expressed transcripts for LL-1RI, EL-1RH, IL-6R, IL-8RII, LL-9Ra, LLlORa, EL-12Rp2, IL-13Ra, IL-15Ra, TNFRI, TNFRH and gpl30. After stimulation with LPS (2 Ug/ml) plus E F N - Y (500 U/ml) for 6 hr, there was an increased expression of EL-15Ra in microglia (Fig. 4.2B). In summary, human microglia express transcripts for EL-1RI, EL1RH, EL-6R, IL-8RH, EL-9Ra, EL-lORa, EL-12Rp2, IL-13Ra, EL-15Ra, TNFRI, TNFRH, and gp 130, but not EL-2Rcc, EL-3Roc, IL-4Ra, EL-5Ra, EL-7Ra, LL-1 IR and SCFR (Table 4.2).  4.3.3  Expression of cytokine receptor mRNA in human neurons Basal level gene expression of cytokine receptors in human nerve cells was  determined by RT-PCR (Fig. 4.3). Human nerve cells expressed transcripts for EL-8REI, EL9Ra, EL-13Ra, TNFRI and gpl30. Transcripts for EL-1R, IL-2Ra, EL-3Ra, IL-4Ra, IL-5Ra, EL-6R, EL-7Ra, EL-lORa, EL-1 IR, EL-12Rp2, IL-15Ra, TNFRH and SCFR were not detected in human neuronal populations.  84  4.3.4  Expression of cytokine receptor mRNA in human oligodendrocyte tes Human oligodendrocytes expressed transcripts for IL-1RI, IL-6R, IL-8RII, IL-9Ra,  IL-13Ra, TNFRII, SCFR and gpl30, but not transcripts for IL-1RII, IL-2Ra, IL-3Ra, IL4Ra, IL-5Ra, IL-7Ra, IL-lORa, IL-11R, IL-12Rf32, IL-15Ra or TNFRI (Fig. 4.4).  85  ASTROCYTE (A) M l  2 3  4  5  6  7  8 M 9 10 11 12 13 14 15  M 16 1718 19  (B) M l ? 3 4 S t S 7 x M 9  10  1112  1314  15  M  16 17 18 19  Figure 4.1. R T - P C R analysis of m R N A expression for cytokine receptors in human astrocytes in culture. A ) Astrocytes in an unstimulated condition. B) Astrocytes were treated with IL-1 p (10 ng/ml) plus IFN-y (500U/ml) for 6 hours. 1 2 3. 4 5. 6 7. X  IL-1RI IL-1RII IL-2R IL-3R IL-4R IL-5R IL-6R 1L-7R  9. 10 1 1 12 13 14 15 16  17 IX 19 M  1L-XR IL-9R IL-1 OR IL-1IR IL-12R IL-13R IL-15R TNFRI  86  TNFRH SCFR gp 130 100 bp D N A marker  MICROGLIA (A) M l  2 3  4 5 6  7  8 M 9 10 11 12 13 14 15 M 16 17 18 19  (B) M l  2 3  4  5  6  7  8 M 9 10 11 12 13 14 15 M 16 17 18 19  Figure 4.2. R T - P C R analysis of m R N A expression for cytokine receptors human microglia in culture. A ) Microglia in an unstimulated condition. B) Microglia were treated with LPS (2 ug/ml) plus IFN-y (500U/ml) for 6 hours. 1 2. 3. 4 5 6. 7. X  IL-1RI IL-1RII IL-2R  9. 10  IL-XR IL-9R 1L-10R  IL-3R IL-4R IL-5R  1 1 12 13 14  IL-6R IL-7R  15.  IL-11R IL-I2R IL-13R IL-15R  16.  TNFRI  87  17 IX  TNFRII SCFR  19 M.  gp no 100 bp D N A marker  NEURON M  1 2 3  4  5  6  7  8 M  9 10 11 12 13 14 15 M 16 1718 19  P. -  m  m  Figure 4.3. RT-PCR analysis of mRNA expression for cytokine receptors in human neurons in culture. 1, 2. 3. 4 5. 6. 7. X.  IL-1RI IL-1RII IL-2R IL-3R IL-4R IL-5R IL-6R IL-7R  9. 10. 11 12. 13. 14, IS. 16  17 IX. 19. M.  IL-8R IL-9R IL-1 OR IL-1IR IL-12R IL-13R IL-15R TNFRI  88  TNFRI I SCFR gpl30 100 bp D N A marker  OLIGODENDROCYTE M  1 2 3  4  5  6  7  M  8 M  9 10  11 12 13 14 15 M 16 17 18 19  —  **<  r«  w  W  m  " m  §  Figure 4.4. R T - P C R analysis of m R N A expression for cytokine receptors in human oligodendrocytes in culture. 1. 2 3. 4. 5. 6. 7. 8.  IL-1RI IL-1RII IL-2R IL-3R IL-4R IL-5R IL-6R IL-7R  9. 10. 11. 12. 13. 14 15. 16.  17 IX 19. M  IL-8R IL-9R IL-10R IL-1 IR IL-12R IL-13R IL-15R TNFRI  89  TNFRII SCFR gpl30 100 bp D N A marker  Table 4.2 Cytokine receptor gene expression in human brain cell culture. Neuron  Oligodendrocyte  Astrocyte (control)  IL-1RI  -  ++  ++  IL-IRn  -  -  -  Astrocyte (IL-lp + IFN-y stim.) ++ ++  IL-2Ra IL-3Ra  -  -  -  -  -  -  -  -  IL-6R  -  ++  IL-7Ra  -  -  IL-8Rn  ++ ++  ++ ++  -  IL-4Ra IL-5Ra  IL-9Ra IL-lORa IL-11R  ++  Microglia (LPS+ IFN-Y stim.) ++ ++  -  —  —  -  -  —  -  —  —  -  —  —  —  ++  ++  ++  ++  -  -  —  ++ ++ +  ++ ++ ++  ++ ++ ++  + + +++  + ++ +++  -  ++ ++  - •  Microglia (control) ++  ++ ++  IL-12Rp2  -  -  IL-13Ra  +  ++  IL-15Ra TNFRI TNFRII  -  -  +  -  + ++  -  ++  -  ++  + ++ ++  SCFR  -  ++  ++  ++  -  -  gpl30  ++  ++  ++  ++  ++  ++  -  + +++  ++ — •  + +++ ++ ++ ++  Summary of RT-PCR analysis of cytokine receptors in human CNS neural cell types. RTPCR was performed as described in materials and methods. ++ = strong positive signal, + = positive signal, - = no signal.  90  4.4  Discussion  In the previous chapter (Chapter 3), human neuronal cells and glial cells have been shown to express various cytokine genes under unstimulated or stimulated conditions. In order to understand the autocrine and paracrine regulation of cytokine expression in the CNS, it is important to identify which cell types are endowed with receptors that respond to cytokines. One of the aims of the present study was to examine the expression patterns of cytokine receptor genes involved in the complex cytokine network of human CNS. In order to determine gene transcripts for cytokine receptors, we employed RT-PCR to detect the levels of receptor mRNA. As shown in Table 4.2, there is a unique pattern of gene expression of cytokine receptors in human CNS cell types as follows: (1) Human astrocytes and microglia expressed transcripts for both type I and type II EL-1 receptors and TNFRs, and stimulation of human astrocytes by IL-1 (3 and IFN-y resulted in induction of transcripts for EL-IRII and p75 TNFRH. (2) Transcripts for EL-12R were detected in astrocytes and microglia in both unstimulated and stimulated conditions, but not in oligodendrocytes or neurons. (3) IL-10R mRNA expression was observed in astrocytes and microglia, but not in neurons or oligodendrocytes. Interestingly, all human CNS neural cell types expressed the transcripts for DL,-13R, however, transcripts for I L - 4 R a were not detected in any of the human CNS cell types examined. (4) Transcripts for EL-8RH and IL-9R0C were detected in all human CNS cell types, and those for EL-15Ra were found in both human astrocytes and microglia. However, transcripts for IL-2Ra, E L - 3 R a , D L - 4 R a , IL-5Ra and E L - 7 R a which have been  91  reported in rodent CNS (Sawada et al., 1993b, 1995; Michaelson et al., 1996) were not detected in any of the human CNS cell types.  4.4.1  Expression of Interleukin-1 receptor (IL- 1R) Interleukin-1 (IL-1) has been known to be a mediator of the early phase of  inflammatory responses in the central nervous system (CNS). Glial cells including astrocytes, oligodendrocytes and microglia, produce IL-1, upon inflammatory stimulation, which induces fever and slow wave sleep (Blatteis, 1988; Breder et al., 1988). Two forms of IL-1 receptors encoded by separate genes, IL-1R type I (IL-1RD and type II (IL-1 RE), have been previously identified (Sims et al., 1988; Sims et al., 1989). The present study showed that human astrocytes and microglia expressed genes for both types of IL-1 receptors,IL-lRI and II, human oligodendrocytes expressed only IL-1RI, and human neurons did not express IL-lRs. Interestingly, stimulation by IL-lp and IFN-y of human astrocytes resulted in induction of the IL-IRII gene transcript. The two receptor subtypes are differentially expressed on different cell types, and a recent evidence indicates that only the IL-1RI is capable of initiating intracellular signaling pathways (Stylianou et al., 1992; McKean et al., 1993; Sims et al., 1993). Indeed, the TL-1RIJ appears to be a decoy receptor that is capable of binding IL-1R antagonist (IL-1RA) and reduce sensitivity to IL-1 treatment (Colotta et al., 1993; Re et al., 1994). However, the function of IL-1 RE in IL-1 signaling cannot be excluded. A monoclonal antibody against IL-1 RE blocks the thermogenic and pyrogenic effects of IL-lp, but not of IL-loc in rat brain (Luheshi et al., 1993), suggesting the presence of IL-lRE-mediated IL-1 signaling in the brain.  92  A recent study has shown that human glioblastoma cells and human adult astrocytes expressed the genes for both types of EL-1R, but IL-1 RE mRNA was not detected in human embryonic astrocytes (Tada et al., 1994). It is interesting to note that in the human astrocyte preparations studied, mRNA for both EL-1RI and EL-IRE were detected, and EL-IRE mRNA was induced upon treatment with IL-1 (3 and EFN-y. Since EL-IRE. has been postulated to function primarily as a decoy receptor for IL-1 (Colotta et al., 1993), induction of the EL-IRE in activated astrocytes might be a protective mechanism in response to IL-1-mediated inflammatory conditions, possibly by the IL-1RE acting as a soluble form to antagonize the IL-lp action. Previous studies have reported that the main source of DL-1 in the CNS is microglia, and neurons and astrocytes also show EL-1 immunoreactivity (Breder et al., 1988; da Cunha et al., 1993a). In addition, the results from Chapter 3 showed that human microglia, astrocytes and oligodendrocytes expressed the gene transcript for EL-lp. In fact, LPS-stimulated human microglia cells produce IL-ip protein as a cell associated form, and IL-ip is a potent stimulus for astrocytes (Lee et al., 1993a). These previous findings and the results from the present study suggest that human glial cells including astrocytes, microglia and oligodendrocytes, have a capacity for autocrine and paracrine regulation of IL-1 effects by regulating DL-1R expression.  4.4.2  Expression of Tumor necrosis factor receptor (TNFR) The present study showed that 1) human astrocytes only expressed transcripts for p55  TNFRI in unstimulated condition whereas stimulation by DL-1 P and EFN-y induced expression of p75 TNFRE transcript, 2) human microglia expressed transcripts for p55  93  TNFRI and p75 TNFRII in both unstimulated and stimulated conditions, 3) human neurons only expressed transcript for p55 TNFRI in unstimulated conditions, 4) human oligodendrocytes only expressed transcript for p75 TNFRII in unstimulated conditions. Previous studies have led to the belief that the p55 TNFRI was responsible for TNF-ainduced cytotoxicity and induction of mRNAs of different molecules such as IL-6, manganous superoxide dismutase, c-fos, and nuclear factor (NF)-kB (Tartaglia et al., 1991; Tartaglia et al., 1993a, 1993d; Smith et al., 1994). The intracellular domain of p55 TNFRI has a unique death sequence coding for 80 amino acid residues with homology to a domain of the Fas antigen which mediates the apoptosis pathway of T cell suicide (Itoh et al., 1993; Tartaglia et al., 1993a). One of the pathways of TNF-a mediated apoptosis can be led through the ceramide signaling pathway. Activating p55 TNFRI leads to a membrane associated sphingomyelinase and induces hydrolysis of sphingomyelin to ceramide (Wiegmann et al., 1994). Based on the observations of the present study that the induction of p75 TNFRII mRNA in astrocytes by IL-1 P and IFN-y stimulation and the expression of p55 TNFRI or p75 TNFRII in unstimulated neuron or oligodendrocytes respectively, human CNS cells may respond to TNF-a depending on cell culture conditions in vitro or the stage of a disease by regulating the expression of both types of TNF-a receptors. The role of TNF-a in regulating astrocyte proliferation has been examined using various types of astrocyte cultures from rat to human brains. Previous studies have demonstrated that TNF-a induces proliferation of rat C6 glioma cells and human astroglioma cells (Bethea et al., 1990; Merrill, 1991; Barna et al., 1993; Estes et al., 1993). However, TNF-a appears to have no effect on the proliferation of  94  normal astrocytes including human embryonic astrocytes (Moretto et al., 1993) and rat astrocytes (Merrill, 1991). Results from RT-PCR analyses showed that rat (Aranguez et al., 1995) and human astrocytes in culture expressed only p55 TNF-RI transcript while human glioblastoma tissue samples expressed both p55 TNFRI and p75 TNFRII transcripts (Tada et al., 1994). Furthermore, the present study demonstrated that human astrocytes expressed p75 TNFRII transcript following treatment with EL-lp and EFN-Y. The role of endogenous p75 TNFRII in modulating the activity of TNF-a has been less well known compared to p55 TNFRI. p75 TNFRII has been proposed to increase the sensitivity of cells to TNF-a through ligand passing to p55 TNFRI (Tartaglia et al., 1993c). Soluble TNFRs can function as effective TNF antagonists. Administration of a soluble p75 TNFRJI-Ig fusion protein is effective in downregulating TNF-a-driven responses (Mohler et al., 1993; Wooley et al., 1993) as well as in inhibiting the EL-12 production by human microglia (Becher et al., 1996). Additionally, it has recently been observed that mice lacking p75 TNFRII gene expression accumulate increased levels of TNF-a relative to controls following LPS administration, suggesting a dominant role of p75 TNFRII in suppressing TNF-mediated inflammatory responses (Peschon et al., 1998). These findings imply that the induction of p75 TNFRH by stimulation with EL-ip and EFN-Y in human astrocytes may be a protective mechanism in response to TNF-a cytotoxicity. The present study demonstrated that the expression of p75 TNFRII transcript was also detected in human microglia and oligodendrocytes. In this regard, it can be speculated that human microglia and oligodendrocytes could be protected from TNF-a cytotoxicity by expressing p75 TNFRII. In fact, TNF-a produced by microglia does not trigger cell death of microglia. Among the CNS  95  cell types, oligodendrocytes have been known to bear cellular injury in response to TNF-a treatment, leading to altered potassium-channel property and damaged processes (McLarnon et al., 1993), and cell death (Selmaj and Raine, 1988). A recent study using rat brain demonstrated that in vivo, oligodendrocytes expressed p75 TNFRII but not p55 TNFRI, while after 3 days in culture, both types of receptors were expressed by mature oligodendrocytes (Tchelingerian et al., 1995). TNF-a stimulation induced TNFR expression in human oligodendrocytes (Dopp et al., 1997). Moreover, the cytotoxic effects of TNF-a on human oligodendrocytes have been shown to be mediated through apoptotic-like pathways following a prolonged (96 hr) incubation with TNF-a (McLaurin et al., 1995). In this regard, it would be interesting to investigate the specific factors which modulate TNFR expression on human oligodendrocytes and other CNS cells in order to define the TNF-a-mediated cytokine network in the human CNS.  4.4.3  Expression of Interleukin-12 Receptor (EL- 12R) The present study demonstrated that transcript for IL-12R ((32), a signal transducing  component of the IL-12R, was detected in astrocytes and microglia in both unstimulated and stimulated conditions, but not in oligodendrocytes or neurons. In the peripheral immune system, IL-12R (32 subunit is expressed on human Thl but not Th2 clones and is induced during differentiation of human naive cells along the Thl but not the Th2 pathway (Rogge et al., 1997; Szabo et al., 1997). Also IL-4-induced inhibition of IL-12R (32 expression on developing Th cells can be restored and maintained by IFN-Y f o r  t n e  Thl pathway (Szabo et  al., 1997). At present, what exact physiological functions EL-12 plays in the CNS are not 96  clear. Several studies have described that the administration of EL-12 enhanced mortality and disease severity of EAE animals (Issazadeh et al., 1995; Leonard et al., 1995,1996; Santambrogio et al., 1995); furthermore IL-12 mRNA was detected in acute MS lesions (Windhagen et al., 1995). As shown in Chapter 3, only microglial cells stimulated by LPS and IFN-y, but not astrocytes, expressed IL-12 (p40 subunit) mRNA. Thus, human astrocytes and microglia are major target cells of EL-12 produced by microglia, and it will be interesting to investigate the biological effects of EL-12 on human astrocytes and microglia.  4.4.4  Expression of receptors for IL-10 and IL-13 Another important aspect of the present study is that human CNS cell types expressed  gene transcripts for the receptors of the cytokines EL-10 and EL-13. These cytokines are involved mainly in anti-inflammatory effects on peripheral immune system. As shown in Table 4.2, IL-10R mRNA expression was observed in human astrocytes and microglia, but not in neurons or oligodendrocytes. Previously, expression of IL-10R mRNA was reported in mouse astrocytes and microglia (Mizuno et al., 1994). The RT-PCR analysis of cytokine gene expression in the present study (see Chapter 3) has demonstrated that microglia is the only source of EL-10 in human CNS. This expression patterns of IL-10/EL-10R in human CNS suggest that activated astrocytes or microglia are major cellular components to cause inflammatory response in human CNS by producing proinflammatory cytokines such as EL1(3, EL-6, EL-12, EL-15 and TNF-a, but microglia also have an opposite function by producing EL-10 that inhibits the function of microglia and astrocytes in inflammatory response in human CNS via autocrine or paracrine negative feedback loop. A recent report using microglia from adult human brain has shown that EL-10 is produced in microglia by the 97  stimulation with LPS plus IFN-y, and recombinant human IL-10 down-regulates the antigen presentation capacity of the microglia (Williams et al., 1996). In the immune system, EL-4, IL-10 as well as EL-13 have been known to be antiinflammatory cytokines. As discussed previously, transcripts for EL-4 and EL-4Ra were not observed in human CNS cells. Interestingly, the present study demonstrated that all human CNS neural cells expressed the gene transcripts for EL-13Roc at relatively high levels compared to other receptors. However, transcript for EL-13 was not detected in any of human CNS cell types examined in either unstimulated or stimulated conditions. Other studies have indicated that EL-4Ra and EL-13Ra complex is required to form a functional receptor for EL-4 or EL-13 (Lin et al., 1995; Hilton et al., 1996) Thus, although not identified in this study, it would be interesting to determine under what conditions, if any, the human CNS would express the EL-4Ra component.  4.4.5  Expression of receptors for EL-2, -3, -4, -5, -7, -8, -9,-15 The present study demonstrates that the expression of cytokine receptor genes in the  human CNS is different from that in the rodent CNS. As shown in Table 4.2, the gene transcript for EL-8RII and EL-9R0C was detected in all human CNS cell types, and that for EL15Roc was detected in both human astrocytes and microglia. However, transcripts for EL2Roc, EL-3Ra, EL-4Roc, EL-5Ra and EL-7Ra were not detected in any of the human CNS cell types. The band patterns obtained by RT-PCR for EL-9R indicate the possibility for alternative splicing of the gene. A previous study showed that mouse astrocytes expressed transcripts of receptors for EL-6, EL-7, GM-CSF and M-CSF, and mouse microglia expressed  98  transcripts of receptors for IL-3, IL-4,IL-6, IL-7, GM-CSF and M-CSF. Mouse oligodendrocytes expressed transcripts of receptors for IL-3, IL-4, EL-7, GM-CSF and M-CSF (Sawada et al., 1993b). The same authors also demonstrated the expression of IL-2 receptors in primary mouse microglia, but not in astrocytes. The reason for these discrepancies in cytokine receptor expression between human CNS and rodent CNS is not known and could be attributed to the difference in the species. In fact, the RT-PCR analysis in chapter 3 failed to detect the gene transcripts for IL-2, EL-3, IL-4, EL-5 (except for neurons) or EL-7 in any of the human CNS cell types investigated in the present study. At the present time, there is little, if any, report available on gene expression, production, regulation or bioactivity of hematopoietic growth factors mentioned above in human CNS. However, many studies have shown the effects of these cytokines on neurons in rodent CNS. For instance, previous studies have shown that EL-2 enhances viability of cultured rat cortical, striatal and septal neurons (Awatsuji et al., 1993a; Shimojo et al., 1993); selected cytokines such as EL-4, EL-5, EL-7 and EL-8 enhance neuronal survival of rat hippocampal cultures (Araujo and Cotman, 1993); EL-3 is produced in mouse septal and hippocampal neuronal cultures, and acted as a neurotrophic factor for murine cholinergic neurons (Konishi et al., 1994). Expression of mRNA encoding EL-7Ra was detected in vitro in rat neurons as well as in subventricular zone progenitor cells, and direct neurotrophic properties of EL-7 was indicated (Michaelson et al., 1996). Recently, some of these cytokines have been shown to share common receptor subunits such as y chains of the EL-2R (EL-2Ry, y ) or common P-chain (Rp ). EL-2RYhas been shown to be a component of the receptors for c  c  EL-4, EL-7, EL-9 and EL-15 (Kondo et al., 1993; Russell et al., 1993; Giri et al., 1994). Common P-chain is now recognized as a functional element of receptors for EL-3, EL-5 and 99  GM-CSF (Taga and Kishimoto, 1995). These findings suggest that human CNS could use different subsets of cytokines that use rL-2Ry or R p components to compensate the absence c  of cytokine/cytokine receptor expression of rodent CNS. As shown in the chapter 3, IL-9 was produced by human astrocytes, and IL-15 was produced in human astrocytes and microglia. The present study also showed that all human neural cells expressed strong gene transcripts for IL-9Ra, and human astrocytes and microglia expressed gene transcripts for IL-15Ra as well. These expression patterns of cytokine/cytokine receptors in human CNS suggest that most of human CNS cell types can respond to IL-9 produced by astrocytes and that human astrocytes and microglia can respond to IL-15 produced by astrocytes or microglia. Another interesting feature of the present study is that all human neural cells are capable of responding to EL-8, since 1L-8R transcripts were detected on all neural cells.  4.4.6  Expression of receptors for IL-6 family cytokines In the CNS, EL-6 is mainly produced by astrocytes and microglia when stimulated by  IL-1, TNF-a or LPS (Frei et al., 1989; Benveniste et al., 1990; Aloisi et al., 1992; Lee et al., 1993a). The IL-6 family cytokine including CNTF, LIF, IL-11 and oncostatin M (OSM) share same signal transducing receptor component, gpl30 (Gearing et al., 1992; Yawata et al., 1993; Kishimoto et al., 1994; Fourcin et al, 1994). A previous immunohistochemical study has shown that gpl30 immunoreactivity was observed in both glial and neuronal cells in the rat brain (Watanabe et al., 1996). The present study also demonstrated that gpl30 gene expression was very high in all cell types in human CNS.  100  The present study showed that: 1) human astrocytes consistently expressed gene transcripts for EL6R, ELI IR and gpl30, 2) human microglia expressed gene transcripts for DL6R and gpl30, but not IL-1 IR, 3) human oligodendrocytes expressed gene transcripts for DL-6R and gpl30, but not IL-1 IR, and 4) human neurons expressed gene transcripts only for gpl30. This cytokine/cytokine receptor expression in human neurons and glial cells could be explained by pleiotrophic effects of gpl30-associated cytokines in the CNS cells. The gene expression of EL-6R, EL-1 IR and gpl30 in human astrocytes suggests that human astrocytes could respond to EL-6 produced by activated astrocytes or microglia, and to IL-11 produced by astrocytes in an autocrine manner. EL-6 induces proliferation of astrocytes in vitro, and contributes to a phenotypic change in astrocytes that is associated with gliosis and glial fibrillary acidic protein (GFAP) gene expression (Benveniste et al., 1989; Selmaj et al., 1990; Merrill etal., 1991). It is of particular interest that human astrocytes were the sole source of IL-11, and the EL-1 IR transcript was expressed only in human astrocytes. These results suggest that locally produced DL-11 by human astrocytes could have unique biological effects on human astrocytes in an autocrine manner. Recent studies have shown that the IL-11 message is distributed in the granular layer dentate gyrus and pyramidal cell layers of hippocampus in mouse brain (Du et al., 1996), and in a human glioblastoma cell lines (Murphy et al., 1995b). In addition, CNTF and LEF, which are other gpl30-associated cytokines, potentiate astroglial lineage commitment (Hughes et al., 1988; Kahn et al., 1994). Moreover, the present study demonstrated that unstimulated human embryonic astrocytes produced EL-11 constitutively. In this regard, DL-11 may be specifically involved in the differentiation of astrocytes during the human CNS development. 101  Chapter 5  5.1  Neurotrophic Effects of Cytokines on Human Neurons  Introduction It is believed that hematopoietic growth factors also influence the growth and  differentiation of CNS cells during development. Recent studies have demonstrated that cytokines such as IL-2, EL-3, EL-4, U-5, EL-6, BL-7 and EL-8 have neurotrophic activity in cultured rodent neuronal cells. In hippocampal neuronal cell culture, recombinant DL.-2 promotes the cell survival (Awatsuji et al., 1993a), and another study suggests that EL-2, EL-4 and EL-7 also promote the cell viability of rat hippocampal neuron in mixed glial-neuronal cultures (Araujo and Cotman, 1993). For cultured murine septal neurons, EL-3 and GM-CSF increase neurite extension (Kamegai et al., 1990). Recently, application of IL-5, EL-7 or EL-9 in combination with TGF-a to mouse embryonic hippocampal neural progenitor cell line was found to promote differentiation (Mehler et al., 1993). A recent experiment has shown that EL-7 mRNA is detected in astrocytes and neurons from rat embryonic brain, and that EL-7 acts directly on neurons to promote their survival (Michaelson et al., 1996). Astrocytes are a major cellular component producing trophic and survival factors for neurons and oligodendrocytes in normal brain. They produce a range of neurotrophic factors which include CNTF, acidic and basic FGF and the neurotrophins NGF, BDNF and NT-3 (Eddleston and Mucke, 1993; Moretto et al., 1994). However, the cellular source of these neurotrophic cytokines and the location of the receptors are not well studied. In the present study, we investigated the neurotrophic effect of IL-9, EL-11 and EL-15 produced by human astrocytes to understand the role of these cytokines on development of CNS neurons.  102  5.2  Materials and methods  5.2.1  Effects of JL-9, EL-11 and EL-15 on human embryonic neurons: Human embryonic brains were dissociated into single cells by trypsinization as  described in Chapter 2, plated on poly-L-lysine-coated 9 mm Aclar plastic round coverslips at a density of 2 x 10 cells/coverslip, and grown in serum-free medium supplemented with B27 4  (GEBCO-BRL) additives but without insulin. Twenty four hours later, cells on coverslips were treated with 20 ng/ml of human recombinant EL-9, EL-11 and EL-15 (R&D Systems, Minneapolis, MN) added to the serum-free medium described above. After 10 - 14 days in culture, cells were immunostained with an monoclonal antibody specific for microtubule associated protein-2 (MAP2).  5.2.2  Lmmunochemistry For identification of neurons, cells were fixed in methanol for 10 min at -20°C, and  incubated overnight with an monoclonal antibody specific for MAP2 (Boehringer Mannheim, Laval, Quebec) at 4°C. The following day, incubation with biotinylated secondary antibody was carried out for 1 h at room temperature, and then incubated with ABC reagent (Vector Labs, Mississauga, Ontario) for 1 h at room temperature . Immunoreactivity was visualized using diaminobenzidine (DAB) and hydrogen peroxide. The number of MAP2 neurons found in a microscopic field of x200 magnification +  was registered as the number of total neurons. The data for the number of MAP2 neurons +  were from 3 individual experiments, giving a total of 6 different coverslips, and 10 fields were chosen in each coverslip for cell counting. The significance of the results from control 103  cultures and cultures treated with the cytokines, IL-9, IL-11 or IL-15 was analyzed by Analysis of Variance (ANOVA) with p<0.05.  5.3  Results As shown in Fig.5.1, survival of human neurons was markedly enhanced by IL-9, EL-  11 and IL-15. In the control cultures grown in serum-free medium without insulin, approximately 50-60 % of the seeded cells died within 10 days of culture (Fig.5.1). By contrast, addition of human recombinant IL-9, IL-11 or IL-15 markedly enhanced the survival of neurons. Monitoring the morphological properties of the cells with processes in culture revealed that the culture contained enriched population of neurons. Cultures were immunostained with monoclonal antibodies specific for microtubule associated protein (MAP2) 10 days after cytokine treatment (Fig.5.1). In cultures treated with EL-9, EL-11 or IL15, most cell bodies and processes were stained positively for MAP2, and the percentage of process-bearing cells was increased in comparison to the control. As shown in Fig. 5.2, addition of recombinant human IL-9, IL-11 or IL-15 in the medium resulted in a 1.5 to 2.5fold increase in the number of MAP2 cells compared to the basal condition. When statistical +  analysis was performed, significant differences were observed between controls and cultures exposed to EL-9, EL-11 or EL-15.  104  Control  IL-9  IL-11  IL-15  Figure 5.1. Effects of IL-9 (20 ng/ml), LL-11 (20 ng/ml) and LL-15 (20 ng/ml) on neuronal differentiation or survival of human embryonic neurons in culture. Human embryonic CNS cells were cultured in serum-free medium for 10 to 14 days and immunostained with an anti-MAP2 antibody. Bar = 50 um  105  1000 900 800 700 600 o  500  £  400  mm  300 200 100  Control  IL-9  IL-11  IL-15  Fig. 5.2 Effect of IL-9, IL-11 and IL-15 on MAP2+ cell number in human embryonic brain culture. The data represents the number of MAP2 immunolabelled cells expressed as mean +/- SD derived from 3 separate experiments.* p<0.05 (ANOVA)  106  5.4  Discussion The present study has demonstrated that cytokines EL-9, IL-11 and EL-15 have  neurotrophic properties on cultured human neurons. The results indicated that EL-9, EL-11 and EL,-15 increased neuronal survival as well as the population of neurons displaying extended processes. Counting the cells immunostained for MAP2 confirmed that the neuronal population was greater when cells were treated with EL-9, EL-11 or EL-15. In previous studies, cytokines including IL-2, EL-4, DL-5, IL-7 or IL-8 have been found to have neurotrophic property in rodent neuronal cell culture (Araujo and Cotman, 1993; Awatsuji et al., 1993a, 1993b). EL-4, BL-5, EL-7 or DL-8 significantly enhanced neuronal survival of hippocampal cultures, and exposure to IL-4, EL-7 or DL,-8 resulted in a marked increase in the number of astrocytes and microglia (Araujo and Cotman, 1993). In these studies, the cellular source of cytokine production or the location of the respective receptors have not been identified, and thus, the neurotrophic effects of these cytokines could be an indirect influence of non neuronal cells. In chapter 3, human astrocytes were demonstrated to produce DL.-9, IL-11 and EL-15 whereas the expression of IL-2, EL-4, EL-5 and IL-7 was not detected. It was found that in human neurons, IL-9R is the only receptor expressed in respect to the cytokines produced by astrocytes. In contrast, human astrocytes expressed transcripts for EL-9R, EL-1 IR and EL15R. This gene expression feature for cytokine receptor suggests that EL-9 produced by astrocytes might act directly upon neurons which express EL-9R. Since astrocytes are the cellular loci of IL-1 IR and EL-15R, the neurotrophic properties of IL-11 and EL-15 might be due to the astrocytes indirectly promoting neuronal survival following their response to DL,-11 and IL-15 stimulation in an autocrine fashion. Since the starting culture was prepared from 107  embryonic human brain tissue, it is also possible that EL-9, IL-11 or EL-15 might directly influence the differentiation of neuronal precursor cells included in the embryonic brain. The results of cytokine receptor gene expression in human neurons were obtained from culture samples of fully differentiated neurons that were maintained in culture for a period of one month, and thus transcripts for EL-1 IR or EL-15R may not have sustained in the cellular samples. Furthermore, a recent study which has shown the neurotrophic effect of IL-7, demonstrated that neurons cultured from younger embryos generally respond more robustly to EL-7 than those from older embryos (Michaelson et al., 1996). In conclusion, the present study suggests that during the development of human CNS, EL-9 produced by astrocytes directly influence neuronal survival and differentiation in a paracrine manner, and EL-9, EL-11 or IL-15 produced by astrocytes may indirectly produce neurotrophic effects on neurons by acting on astrocytes to produce one or more neurotrophic factors. Based on the results of present study, a caution has to be made that the findings on the effects of cytokines on brain development in non-human animal studies should not be applied to the development of human brain, since human CNS exhibits different patterns of cytokine/cytokine receptor expression from those of non-human mammals.  108  Chapter 6  6.1  Effects of cytokines on NO and TNF-a production in human glial cells  Introduction In the CNS, overproduction of proinflammatory cytokines such as IL-1, IL-6 and  TNF-a by activated glial cells is associated with neurodegenerative conditions, infection or trauma (Dickson et al., 1993; Cannella and Raine, 1995; Griffin et al., 1995, 1998). IL-lp has been described as a mediator of neuronal cell death, and EL-1 receptor antagonist (ELlRa) markedly inhibits neuronal cell injury in cerebral ischemia (Relton and Rothwell, 1992). Recent studies have shown that EL-ip is a nitric oxide (NO) inducer in rat or human astrocytes when used in combination with IFN-Y or TNF-a (Simmons and Murphy, 1993; Lee et al., 1993b). It should be noted that NO is produced by microglia in rat but human microglia are unable to produce NO because they do not carry the transcript for nitric oxide synthase (iNOS); however, human astrocytes are responsible for producing NO (Lee et al., 1993b; Walker et al., 1995). Studies in vitro, have demonstrated that NO is both neurotoxic (Boje and Arora, 1992; Chao et al., 1992) and gliotoxic (Merrill et al., 1993), and NO has been implicated in the pathogenesis of several CNS diseases, including multiple sclerosis, HIV encephalitis and Alzheimer's disease (Bukrinsky et al., 1995). Thus, cytotoxic effects of proinflammatory cytokines such as EL-lp, TNF-a or IFN-Y in the CNS might be accomplished by inducing neurotoxic factors like a NO indirectly. NO mediates functions as diverse as vasodilation, neurotransmission and immunemediated cytotoxicity (Moncada et al., 1991; Bredet and Snyder, 1992). NO is synthesized from the guanidino-nitrogen of L-arginine and molecular oxygen by nitric oxide synthase  109  (NOS) of which there are at least two types (Marietta, 1994). Constitutive NOS isoforms (cNOS) are activated by biologic signals that transiently increase intracellular Ca , and a 2+  Ca independent NOS isoform (iNOS) can be induced by a variety of immunological stimuli 2+  such as IFN-y, TNF-a and LPS. Activation of iNOS results in the production of large amounts of NO, which is cytotoxic for infectious agents and tumors. Since the production of excessive amounts of NO could have pathological outcomes, the expression of iNOS is necessarily under tight regulation. When murine macrophages were preincubated with EL-4 and then stimulated with EFN-y and LPS, both production of NO and expression of NOS were inhibited (Sands et al., 1994; Bogdan et al., 1994) compared to stimulation without prior IL-4 incubation. Since IL-lp and TNF-a have been shown to be mainly produced by activated microglia, it can be speculated that there are cytokine cascades for NO production by astrocytes in response to inflammatory stimuli, and the indirect effect of IL-lp or TNF-a on neuronal cell injury in inflammatory situations in the human CNS can be explained. The cytokine/cytokine receptor gene expression patterns in the previous chapters indicate the existence of a cytokine network between human astrocytes and microglia involved in the NO production in astrocytes and TNF-a production in microglia. In the present study, the effects of the cytokines on the release of NO or TNF-a from human astrocytes or microglia respectively were investigated.  110  6.2  Materials and methods  6.2.1  Cell culture Human astrocytes and microglia were isolated and cultivated as described previously  (see Chapter 2), and replated on 24 well plates at a density of 2 x 10 cells/well for nitrite 5  assay or TNF-a ELISA assay.  6.2.2  Cytokine treatment Astrocyte cultures were stimulated with human rEL-1(3 (10 ng/ml, R&D Systems,  Minneapolis, MN) alone or in combination with human rEFN-y (500 u/ml, L G Chem, Taejon, Korea), human rTNF-a (20 ng/ml, GIBCO-BRL) or human rIL-12 (20 ng/ml, R&D Systems). After 3 days, the nitrite concentrations in the culture supernatants were measured using the Griess reaction . To examine effects of the cytokines on NO production, astrocyte cultures were pretreated with 20 ng/ml each of recombinant human EL-6 (GIBCO-BRL), IL-9 (R&D Systems), EL-10 (R&D Systems), IL-11 (R&D Systems), IL-13 (R&D Systems), IL-15 (R&D Systems), LIF (Amgen), CNTF (Amgen), SCF (R&D Systems) or TGF-(3l (R&D Systems) for 18-24 h, followed by combination of DL,-1(3 and IFN-y to the medium for an additional 3 days. To determine the effect of cytokines on TNF-a production in human microglia, microglia cultures were pretreated with 20 ng/ml each of recombinant human IL-6, IL-9, IL10, IL-12, IL-13, IL-15, LIF, CNTF or TGF-(3l for 12 h, and then stimulated by addition of  111  LPS (2 ug/ml, Sigma, St. Louis, MO) and IFN-y (500 U/ml, LG Chem, Taejon, Korea) to the medium for an additional 24 h.  6.2.3  Nitrite assay The nitrite concentration as a measure of nitric oxide production was determined  using the Griess reaction (Stuehr and Nathan, 1989). Griess reagent consist of one part 0.1% napthylethylenediamine dihydrochloride and one part 1% sulfanilamide (Sigma, St. Louis, MO). The nitrite concentration was determined by mixing 300 [tl of conditioned medium to 300 ul of Griess reagent and measuring the OD at 540 nm.  112  6.3  Results  6.3.1  Cytokines as immune-modulators of nitric oxide (NO) production by astrocytes To elucidate the regulatory mechanisms of proinflammatory and anti-inflammatory  cytokines as immune modulators of the inflammatory situation in the CNS, the efficacy of various cytokines produced by human neurons or human glial cells to modulate nitric oxide (NO) production by astrocytes was investigated. Human astrocytes were treated with EL-lp alone or in combination with IFN-y, TNF-a or DL.-12. As shown in Fig. 6.1, there was a low level of NO (<luM) production by unstimulated astrocytes, while IL-ip stimulation induced a 10-fold increase of NO (-10 uM) production over control cultures. NO production induced by IL-lp (10 ng/ml) was enhanced by IFN-y (500 U/ml) or TNF-a (20 ng/ml). However, IL12 (20 ng/ml) did not enhance the NO production induced by IL-1 p. In order to assess the immunomodulatory effects of cytokines on the NO production, human astrocytes were pretreated with IL-6, IL-9, IL-10, IL-11, IL-13, EL-15, LIF, CNTF, SCF or TGF-P for 18-24 h, followed by addition of IL-1 P (10 ng/ml) and IFN-y (500 U/ml) to the medium for an additional 3 days. The results showed that there was no apparent inhibition or elevation of NO production by any of the cytokines tested (Fig. 6.2).  6.3.2  Cytokines as immune-modulators on TNF-a production by microglia In order to understand the mechanisms for the regulation of TNF-a production by  human microglia in the CNS, effects of selected cytokines (IL-6, IL-9, IL-10, IL-12, IL-13, IL-15, LIF, CNTF or TGF-P) on the TNF-a production upon stimulation with 113  lipopolysaccharide (LPS) plus IFN-y, were investigated. The present study has demonstrated that these cytokines are produced by human astrocytes or microglia (Chapter 3). In order to assess the immunomodulatory effects of cytokines on TNF-a production, human microglia were pretreated with 20 ng/ml each of EL-6, IL-9, IL-10, IL-12, IL-13, IL-15, LIF, CNTF or TGF-(3 for 12 h, and then stimulated by addition of LPS (2 Ug/ml) plus  IFN-Y  (500 U/ml) to  the medium for an additional 24 h. While unstimulated microglia produces a low level of TNF-a (200 pg/ml), treatment with LPS (2 Ug/ml) and IFN-y (500 U/ml) induced a marked increase in TNF-a production (1000 pg/ml), an increase of 5-fold. Pretreatment of microglia cultures with IL-10 (20 ng/ml) resulted in a reduction of TNF-a production by 90% (Fig. 6.3). Other cytokines examined including IL-6, EL-9, EL-12, EL-13, EL-15, LEF, CNTF or TGF-P did not influence the TNF-a production by microglia (Fig. 6.3).  1.14  Control  IL-ip  IL-1/IL-12  IL-1|5/TNF-a  IL-1|3/IFN-Y  Fig. 6.1. Effect of cytokines on nitrite production in human astrocytes. Human embryonic astrocytes cultures were treated with IL-1 beta alone, IL 1 beta plus IL-12 (20 ng/ml), IL-1 beta (10 ng/ml) plus TNF-alpha (20 ng/ml), or IL-1 beta plus IFN-gamma (500 U/ml) for 72 h, and the nitrite concentrations in the culture supernatants were measured using the Griess reaction. These values represent 3 separate experiments. * p<0.05 (ANOVA)  115  25  ^  20  •5  15  Ah  ih  10  9  i  o  o  +  +  +  +  +  LL  c^a  i="  ca  02-  + = co-  fe  tL,  ca  +  <-> +  +  a  ca  $ Z u. — ca  Z li. — ca *-  T  •  H  + •  u. ca  Fig. 6.2. Effects of pretreatment with cytokines on nitrite production in human astrocyte cultures. Cultures were pretreated with 20 ng/ml of indicated cytokines for 24 h prior to stimulation with IL-lbeta (10 ng/ml) plus IFNgamma (500 U/ml) for 72 h.  116  1600  _  1400  E D)  4  1200  Q. o 1000  800 600 u!  400 200  ri vo • c o O  d + CO Q.  CO  a.  i  + co a.  +  -J +  d +  d +  co  CO CL  CO CL  CO CL  CL  & +  u  a +  CO CL  CO CL  +  CO CL  Fig. 6.3. Effects of pretreatment with cytokines on TNF-alpha production in human microglia cultures. Cultures were pretreated with 20 ng/ml of indicated cytokines for 12 h prior to stimulation with LPS (2 ug/ml) plus IFN-gamma (500 U/ml) for 24 h. Values shown represent means +/- SD from 3 separate experiments. *p<0.05 (ANOVA)  117  6.4  Discussion  6.4.1  Cytokines as immune modulators of nitric oxide (NO) production by human  astrocytes In the present study, the ability of the cytokines which act as ligands for each cytokine receptors expressed in human astrocytes to regulate NO production in cultured human astrocytes was investigated. The results showed that NO production in human astrocytes was induced by IL-1 (3 alone and enhanced by the combination of EL-1 P with either EFN-y or TNF-a. This result is in agreement with the previous report which demonstrated the induction of nitric oxide synthase activity in human astrocytes by EL-1 P and EFN-y (Lee et al., 1993b). Since RT-PCR showed that human microglia express EL-12 (p40) mRNA, human astrocytes express EL-12R (P2) mRNA (Chapter 3 and 4), and EL-12 is a modulator of CNS inflammatory reaction, EL-12 was studied for its ability to induce NO production in human astrocytes. However, EL-12 did not induce a significant increase in NO production when astrocytes were treated with a combination of EL-1 p and EL-12, confirming that the proinflammatory cytokines, EL-lp, EFN-y and TNF-a and their combinations, but not EL-12, are the major inducers of NO production in the human CNS. It is possible that EL-12 may be involved in the indirect NO production in human CNS by stimulating NK cells and T cells to produce EFN-y, suggesting a cytokine network between glial cells and inflammatory cells such as NK and T cells for NO production in the human CNS. The resident glial cells and invading inflammatory cells comprise the cellular source of proinflammatory cytokines in the CNS. Microglia cells are a potent source of EL-1 and  118  TNF-a (Lee et al., 1993a), and astrocytes also produce TNF-a after stimulation with EL-1 or EFN-y (Chung and Benveniste, 1990; Chung et al., 1991; Lee et al., 1993a). Identical results were also demonstrated in human microglia and astrocytes as described (Chapter 3). The RT-PCR analysis in the present study (Chapter 4) also showed that human astrocytes expressed IL-1R and TNFR mRNA, and these results indicate the existence of a cytokine network between human astrocytes and microglia involved in the NO production in astrocytes. As shown in Chapter 4, transcripts for EL-6R, EL-9R, EL-10R, EL-1 IR, DL.-12R, JL13R, EL-15R, SCFR and gpl30 were detected in human astrocytes, and the corresponding cytokine gene expressions were observed in human astrocytes and microglia. For that reason, it is possible that NO production in human astrocytes might be regulated by these cytokines in a paracrine or autocrine manner. However, the results showed that NO production in human astrocytes was not altered by treatment with any of the cytokines examined. It has been demonstrated earlier that EL-4, EL-10 and TGF-P inhibit cytokine- and LPS-induced NO production in rodent microglia and astrocytes (Murphy et al., 1993; Simmons and Murphy, 1993; Vodovotz et al., 1993). The results of the present study are in contrast with these studies, demonstrating that EL-10, EL-13 or TGF-P which are known to be anti-inflammatory cytokines in the immune system, failed to inhibit NO production in human astrocytes. This discrepancy might be caused by two factors. First, there is a difference in inducers to initiate NO production in rodent versus human astrocytes. In human astrocytes, EL-lp is the major stimulator whereas in rodent it is LPS, thus activating two different signal transduction cascades (Bogdan et al., 1992; Simmons and Murphy, 1993). Second, the difference in species used in the experiments might account for the discrepancies in the results. For instance, TGF-P markedly reduces type Ef nitric oxide synthase (NOS) 119  expression in mouse cells whereas in rat or human cells, the reduction of type IINOS expression is significantly lower (Nussler et al., 1995). A recent study using human astrocytes also demonstrated that there is little inhibition of IL-lp-plus-EFN-y-induced nitric oxide synthase (NOS) expression by IL-4, IL-10 or TGF-p (Liu et al, 1996). The same authors showed that IL-lRa completely inhibited the iNOS induction in human astrocyte cultures, and suggested a role for factors which regulate the binding of EL-1 P to its receptor in iNOS expression in the human CNS. As mentioned previously, the expression of EL-IRE and TNFRE by astrocytes suggests that the soluble form of this receptor, as well as the soluble form of TNFRE, may play a role in regulating NO production.  6.4.2  Cytokines as immune-modulators of TNF-a production by human microglia TNF-a has been reported to mediate cell injury to neurons or oligodendrocytes (Chao  and Hu, 1994; Selmaj and Raine, 1988). The major source of TNF-a in human CNS was reported to be microglia (Lee et al., 1993a). In the present study, the effects of selected cytokines on TNF-a production in human microglia were investigated. As shown in Fig.6.2, stimulation of human microglia with LPS and EFN-y resulted in approximately 5-fold increase of TNF-a production above that of unstimulated microglia. Treating microglia with EL-10 led to a marked reduction in TNF-a production. RT-PCR analysis (Chapter 4) showed that human microglia express transcripts for EL-6R, EL-9R, EL-1 OR, EL-12R, EL-13R, EL-15R and gpl30, and human microglia expressed transcripts for EL-6, EL-10, EL-12, EL-15 and TGFP (Chapter 3). Human astrocytes were also found to express transcripts for EL-6, EL-9, EL-15, TGF-P, CNTF and LEF. Previous studies have reported inhibitory effects of EL-4, EL-10 and  120  TGF-|3 on TNF-a production in human monocytes/ macrophages (Bogdan et al., 1992; Bogdan and Nathan, 1993). However, except for EL-10, applying all the cytokines respective to the receptors expressed in microglia did not alter the levels of TNF-a production in human microglia. Even EL,-13 or TGF-P, which are known to be anti-inflammatory cytokines in the immune system, did not show any inhibitory effect on the TNF-a production in human microglial cells. Taken together, the present study suggests that EL-10 produced by microglia is the major inhibitory modulator of TNF-a production in microglia as an self-inhibitory regulator. One possibility exists which would explain the lack of effect of EL-13 in decreasing the NO or TNF-a production by microglia or astrocytes, respectively. Recently, it has been shown that the EL-4Ra component protein is required for EL-13 action by a BL-4Ra/EL-13Ra complex (Lin et al., 1995; Hilton et al., 1996). As the BL-4Ra was not detected in any cell type studied, it may not be surprising to observe a lack of action of EL-13, even though the EL13Ra was detected.  121  Chapter 7  7.1  TNF-a production in human glial cells via p38 MAP kinase  Introduction The three mitogen-activated protein (MAP) kinases, namely extracellular signal-  regulated kinase (ERK), p38 MAP kinase, and c-jun N-terminal kinase/ stress-activated protein kinase (JNK/SAPK), differ in their responses to extracellular stimuli. ERKs are most responsive to growth factors and phorbol esters (Cobb and Goldsmith, 1995), while JNK/SAPK and p38 MAP kinase are activated in response to stress signals, including UV irradiation, heat shock and osmotic stress as well as bacterial lipopolysaccharide (LPS), and proinflammatory cytokines such as EL-lp and TNF-a (Kyriakis et al.,1994; Raingeaud et al., 1995). However, recent studies have shown that stimulation of hematopoietic cells with hematopoietic growth factors including interleukin-3 (EL-3), granulocyte/macrophage-colony stimulating factor (GM-CSF) and Steel locus factor (SLF) results in activation of p38 MAP kinase (Foltz et al., 1997) and of JNK/SAPK (Foltz and Schrader,1997) and its upstream activator MAP kinase kinase (MAPKK) (Foltz et al., 1998). Mammalian p38 MAP kinase was originally identified in murine pre-B cells transfected with the LPS-complex receptor CD 14 and in LPS-stimulated murine macrophages (Han et al., 1994), and was also independently identified as the target of certain pyridinyl imidazoles which were originally discovered as a novel class of cytokine suppressive anti-inflammatory drugs (CSAIDs) (Lee et al., 1994). One of these compounds, SB203580, specifically inhibits the activity of p38 MAP kinase without inhibiting that of other MAP kinases, ERKs and JNK/SAP (Cuenda et al., 1995).  122  Tumor necrosis factor -a (TNF-a) has been reported to elicit a large number of biological effects including cytolysis, cytotoxicity, immunoregulation, cellular proliferation and antiviral responses (Vassalli, 1992). In the central nervous system (CNS), TNF-a has been reported to induce apoptotic death of oligodendrocytes (Selmaj and Raine, 1988; Selmaj et al., 1991a). TNF-a, in concert with EL-ip, activates human astrocytes to produce reactive nitrogen intermediates which are cytotoxic to nerve cells and oligodendrocytes (Lee et al., 1993b). Recent studies have shown that EL-ip induces murine astrocytes to produce TNF-a and EL-6 through a mechanism involving protein kinase C (PKC) and increases in transcription (Chung et al., 1992). In human microglia, however, LPS has been shown to induce human microglia to produce EL-ip, TNF-a, and EL-6 (Lee et al., 1993a). In murine monocytes or macrophages, the MAP kinase pathway has been shown to be involved in LPSinduced TNF-a gene expression at the levels of transcription and translation (Geng et al., 1993; Swantek et al., 1997). Likewise, there is evidence for the involvement of MAP kinase family members in the stimulation of TNF-a production in mast cells (Ishizuka et al., 1997; Zhang et al., 1997). Interestingly, there appears to be differences in signal transduction pathway involvement in TNF-a production in different cell types, so that in some cells the ERKs are critical while in others it is JNK/SAPK (Csonga et al., 1998) or p38 MAP kinase (Lee et al., 1994). However, it has not been established whether signal transduction pathway involved in TNF-a production in human glial cells includes members of MAP kinase family or whether the process is dependent on particular MAP kinase family members. The present study shows that the p38 MAP kinase pathway is critical for TNF-a production in human glial cells that include astrocytes and microglia. 123  7.2  Materials and methods  7.2.1  Cell culture Astrocyte- and microglia-enriched cultures were prepared from brains of human  embryo (12-18 weeks' gestation). A pure population of human astrocytes and microglia was isolated and cultivated as described in Chapter 2, and replated on 6 well plates at a density of 10 cells per well for RT-PCR analysis, or plated on 24 well plates at a density of 2 x 10 6  5  cells/well for TNF-a ELISA.  7.2.2  Treatment with SB203580, a p38 MAP kinase inhibitor To examine the effect of the p38 MAP kinase inhibitor , SB203580, on the TNF-a  gene expression, a pure population of astrocytes and microglia were incubated in feeding medium with or without 1 uM SB203580 for 20 min prior to stimulation with recombinant human EL-lp (10 ng/ml, R&D Systems, Minneapolis, MN) or LPS (1 ug/ml, Sigma, St. Louis, MO). For RT-PCR analysis, the cultures were incubated for a further 6 h, and for analysis of TNF-a level by ELISA a further 24 h.  7.2.3  Determination of TNF-a mRNA Total RNA preparation was performed according to the acid  guanidinium/phenol/chloroform (AGPC) method. Two to 5 pg of total RNA from each sample was subjected to DNase treatment and then processed for the first strand cDNA synthesis using Moloney murine leukemia virus (M-MLV) reverse transcriptase (GIBCOBRL). One to 5 ul of each cDNA products was amplified by PCR using specific sense and 124  antisense primers designed from the cDNA sequence for human TNF-a or glyceraldehyde-3phosphate dehyderogenase (G3PDH) as a reaction standard. The sense and anti sense primers for TNF-a and G3PDH are as follows: TNF-a sense: 5' -CAAAGTAGACCTGCCCAGAC-3', TNF-a antisense: 5'-GACCTCTCTCTAATCAGCCC-3' G3PDH sense: 5' -CCATGTTCGTCATGGGTGTGAACCA-3' G3PDH antisense: 5'-GCCAGTAGAGGCAGGGATGATGTTC-3' Amplified DNA fragments for TNF-a and G3PDH were expected to be 490 bp and 251 bp respectively. PCR was carried out in a 50 u.1 of reaction mixture containing Taq DNA polymerase buffer (20 mM Tris-HCL pH 8.4, 50 mM KCL, 200 uM dNTP, 2.5 mM MgCl , 2  1 UM of each primer) and 2.5 U Taq DNA polymerase (GEBCO-BRL). The main amplification program consisted of a denaturation step at 94 C for 1 min followed by an 0  annealing step at 60 C for 1 min, and a synthesis step at 74 C for 1 min, for 27-30 cycles. 0  0  For the initial amplification, cDNA samples were denatured at 94° C for 5 min, annealed at 60°C for 1 min, and extended at 74° C for 3 min.  7.2.4  TNF-a ELISA Culture supernatants from experimental as well as control cultures were removed,  centrifuged for 5 min at 10,000 g, and stored at -70 C until the time of assay. TNF-a ELISA 0  (Intergen) assay was carried out according to the manufacturer's protocol.  125  7.3  Results  7.3.1  Effect of SB203580, a p38 MAP kinase inhibitor, on TNF-a mRNA levels TNF-a mRNA levels were determined in human astrocyte- and microglia -cultures by  RT-PCR analysis. Under non-stimulated conditions, expression of TNF-a mRNA in both astrocytes and microglia was undetectable (Figs. 7.1 and 7.2, lanes 1). Increased levels of TNF-a mRNA were induced in astrocytes by treatment with EL-ip (Fig. 7.1, lanes 2), and in microglia by treatment with LPS (Fig. 7.2, lanes 2). SB203580 at the concentration of 1 uM resulted in decreased levels of TNF mRNA in microglia (Fig. 7.2, lanes 3), but not in astrocytes (Fig. 7.1, lanes 3) These results indicate that p38 MAP kinase activity regulates levels of TNF-a mRNA in LPS-stimulated microglia, but not in IL-lp-stimulated astrocytes.  7.3.2  Inhibition of TNF-a production by SB203580 To determine if SB203580 modulates the release of TNF-a from astrocytes following  treatment with EL-lp, and from microglia following treatment with LPS respectively, the amount of TNF-a in culture supernatants of human astrocytes and microglia was determined by an ELISA (Figs. 7.3 and 7.4). As shown in Fig. 7.3 and Fig. 7.4, presence of SB203580 (1 uM) resulted in a marked inhibition of the secretion of TNF-a by human astrocytes and microglial cells. In EL-lp treated astrocytes, the reduction in TNF-a secretion in the presence of SB203580 was -80%, and in LPS-treated microglia the reduction was -85 %.  126  A  B  C  Figure 7.1. Effect of SB203580, a p38 MAP kinase inhibitor, on IL-lp-induced TNF-a mRNA expression in human astrocytes Human astrocyte cultures were incubated in feeding medium in the presence or absence of SB203580 (1 uM) for 20 min followed by IL-lp (10 ng/ml) for a further 6 h Lanes (1-3) represent as followes: 1. non-stimulated control, 2. treatment with IL-1 P. 3 treatment with IL-ip plus SB203580 cDNA was prepared from each samples as described PCR was carried out using titrated amounts of cDNA. A: 1 25 ul of cDNA, B: 2.5 ul, C: 5 ul. PCR using G3PDH specific primer was carried out in parallel to confirm equvalency of cDNA preparation. PCR reactions were repeated 3 times on each sample of cDNA with the same results M. 100 bp DNA marker.  127  A M  1 2  B 3 M  C 1 2  3 M 1  2  3 M  Figure 7 2 Effect of SB203580, a p38 MAP kinase inhibitor, on LPS-induced TNF-a mRNA expression in human microglia. Human microglia cultures were incubated in feeding medium in the presence or absence of SB203580 (1 u.M) for 20 min followed by LPS (2 pg/ml) for a further 6 h. Lanes (1-3) represent as followes: 1. non-stimulated control, 2. treatment with LPS, 3 treatment with LPS plus SB203580. cDNA was prepared from each samples as described PCR was carried out using titrated amounts of cDNA, A: 1 25 pi of cDNA, B: 2.5 ul, C: 5 ul PCR using G3PDH specific primer was carried out in parallel to confirm equvalency of cDNA preparation. PCR reactions were repeated 3 times on each sample of cDNA with the same results M 100 bp DNA marker  128  Control  IL-lp  IL-lp/SB203580  Fig. 7.3. SB203580, a p38 MAP kinase inhibitor, reduces IL-1 beta induced TNF-alpha production in human astrocytes. Human astrocyte cultures were incubated in feeding medium in the presence or absence of SB203580 (1 uM) for 20 min followed by IL-1 beta (10 ng/ml) for a further 24 h, and then processed for TNF-alpha ELISA. The values shown are mean +/- SD of data from triplicate determinations. *p<0.05 (ANOVA)  129  350 300 250  I 200 3> 8  I 150 100  50 0  Con  LPS  LPS/SB203580  Fig. 7.4. SB203580, a p38 MAP kinase inhibitor, reduces LPS induced TNF-alpha production in human microglia. Human microglia cultures were incubated in feeding medium in the presence or absence of SB203580 (1 uM) for 20 min followed by LPS (lug/ml) for a further 24 h, and then processed for TNF-alpha ELISA. The values shown are mean +/- SD of datafromtriplicate determinations.* p<0.05 (ANOVA)  130  7.4  Discussion The results of the present study showed that human astrocytes and microglia did not  express TNF-a mRNA under non-stimulated conditions, but that levels of TNF-a mRNA were markedly elevated in astrocytes by IL-1 (3 treatment, and in microglia by LPS. These results support the findings by others that IL-lp and LPS are major stimuli for TNF-a production in human astrocytes and microglia respectively (Lee et al., 1993a; Aloisi et al., 1992). They hypothesized that the initial response to LPS in the CNS is elicited in microglia and that these cells then direct the response in astrocytes, primarily through the production of IL-1. The present study has demonstrated here that inhibiting the activity of p38 MAP kinase using SB203580, a specific inhibitor of the kinase, resulted in a significant reduction in the production of TNF-a in both cell types. However, the mechanism differed in these two situations. In human astrocytes stimulated with EL-ip, the levels of TNF-a mRNA were unaffected by SB203580; in contrast, SB203580 resulted in a significant reduction of levels of TNF-a mRNA in LPS stimulated microglia. The findings in astrocytes, where SB203580 reduced the production of TNF-a protein but had no effect on mRNA levels, are consistent with the findings from studies using other cells and stimuli which show that p38 MAP kinase plays an important role in enhancing the efficiency of translation of TNF-a mRNA. A recent study using rat astrocytes and microglia stimulated with LPS or LPS plus IFN-y showed that SB203580 inhibited the production of TNF-a protein (Bhat et al., 1998). Moreover, in LPS treated human monocytes, inhibition of p38 MAP kinase activity resulted in only a minor decrease in levels of TNF-a mRNA but in a near total suppression of TNF-a production (Lee et al., 1994). Other studies have 131  demonstrated that p38 MAP kinase or JNK/SAPK are required for LPS-induced translation of TNF-a mRNA in both monocytes and macrophages (Derijard et al., 1995; Lee and Young, 1996; Swantek et al., 1997). In addition, activation of Ras and Raf, upstream components in the ERK pathway, have been shown to be required for TNF-a production (Geppert et al., 1994). It has also been shown that regulation of translation is mediated through the phosphorylation of initiation factors involved in the binding of mRNA to the 40 S ribosomal subunit (Flynn and Proud, 1996; Pain, 1996). Phosphorylation of initiation factor eEF4E increases its affinity for the 7-methylguanosine triphosphate structure found at the 5'-end of mRNA and facilitates its entry into an initiation complex by interacting with eEF4G (Sonenberg and Gingras, 1998). A role of eIF4E in the translation of TNF-a mRNA can be inferred by the finding that LPS enhanced the phosphorylation of eLF4E in macrophages (Haas et al., 1992). A recent study has reported that cellular stresses such as arsenite or anisomycin, and cytokines TNF-a or EL-lp\ caused an increased phosphorylation of eukaryotic initiation factor eIF4E, which was abolished by SB203580 indicating a role for p38 MAP kinase (Wang et al., 1998). It has also been speculated that inhibition due to a regulatory protein which blocks the translation of cytokine mRNA could be released following its phosphorylation by p38 MAP kinase; p38 MAP kinase inhibitors such as SB203580 would thus inhibit translation by preventing this translational derepression (Lee and Young, 1996). One set of such regulatory proteins are the eEF4E binding proteins (4EBPs) which dissociate from the eukaryotic initiation factor eEF-4E when they are phosphorylated, thus relieving translational inhibition (Pause et al., 1994). A recent study of rat microglia stimulated with LPS showed that SB203580 had no inhibitory effect on levels of TNF-a mRNA (Bhat et al., 1998). The fact that we observed 132  that SB203580 reduced levels of TNF-a mRNA in LPS-stimulated human microglia probably reflects a species difference. Our finding that in LPS-stimulated microglia SB203580 reduced the levels of TNF-a mRNA (Fig. 7.2) could be explained by an effect of the drug on either transcription or mRNA stability. The transcriptional control of TNF-a gene is in part mediated by the transcription factors known as nuclear factor K B  (NFKB)  and  AP-1 (Shakhov et al., 1990; Hunter and Karin, 1992). Previous studies have demonstrated that JNK/SAPK regulates transcription by activating the transcription factor AP-1. Recent study also showed that JNK/SAPK mediates UV-induced AP 1-dependent uPA transcription, but p38 MAPK does not regulate the transcriptional activity (Miralles et al., 1998). It has been shown that SB203580 prevents the expression of a N F K B controlled reporter gene in response to external stimuli. These authors suggest that the role of p38 MAP kinase in NFKB  activation is through activation of co-activators or intermediate kinases (Beyaert et al.,  1996; Wesselborg et al., 1997). Whether activation of members of the MAP kinase family is involved in TNF-a transcription in human glial cells has not yet been determined. There is evidence that SB203580 reduces transcription of other cytokine genes, namely IL-6 and D7Ny in other cells (Beyart et al., 1996; Rincon et al., 1998). In this context, further studies on the activation of  NFKB  by the p38 MAP kinase pathway will help us to understand the role  of p38 MAP kinase in the mechanism of TNF-a gene expression in human microglia. TNF-a expression can also be regulated at the level of mRNA stability through the AU-rich element (ARE) in the 3' untranslated region (3'-UTR) of TNF-a mRNA(Han and Beulter, 1990). At this point, the mechanisms for the regulation of mRNA turnover are not well understood, but there is evidence that members of the MAP kinase family might be 133  involved in the regulation of mRNA stability. Recent studies demonstrated that in adherent monocytes, an accelerated mRNA turn over was induced by the tyrosine kinase inhibitor genistein and the p38 MAP kinase inhibitor, SK&F 86002 (Sirenko et al., 1997). It has also been shown that in activated T cells, the JNK pathway, but not the p38 or ERK MAP kinase cascades, leads to stabilization of EL-2 mRNA (Chen et al., 1998). The involvement of the two other MAP kinase pathways, ERKs and JNK/SAPK, in TNF-a production in human astrocytes or microglia is still to be determined. Further studies utilizing specific inhibitors for ERKs or JNK/SAPK are required to determine the roles of these MAP kinase pathways in TNF-a production in human glial cells. In summary, the results of this study demonstrate that p38 MAP kinase is needed for the increased levels of TNF-a mRNA observed in LPS stimulated human microglia. However, in IL-1 [3 activated human astrocytes, p38 MAP kinase activity enhanced TNF-a production at the translational level.  134  Chapter 8  Conclusions  The present study has shown that human CNS cells can communicate with each other by expressing unique cytokines and their receptors, and that this pattern of cytokine/cytokine receptor expression in the human CNS is different from that in the murine CNS. Thus, the human CNS is capable of establishing a unique cytokine network to maintain CNS homeostasis. Overproduction of proinflammatory cytokines such as EL-1(3, EL-6 and TNF-a in CNS lesions has become apparent in recent years. The results of the present study demonstrate that transcripts for proinflammatory cytokines including TL-1(3, EL-6, EL-8, EL-12, EL-15 and TNF-a can be induced in astrocytes by EL-1 (3 plus EFN-y treatment and in microglia by LPS plus EFN-y treatment. In unstimulated nerve cells, transcripts for these proinflammatory cytokines were not detected, and in oligodendrocytes, only transcripts for EL-1(3 and EL-6 were detected. Results obtained by ELISA and immunoblotting demonstrate that the protein levels of EL-6 and EL-15 are increased in activated astrocytes and EL-6, EL-15 and TNF-a are increased in activated microglia. Transcripts for the receptors of EL-1, EL-6, EL-8, EL-12, EL15 and TNF-a were detected in astrocytes and microglia, while EL-12R and EL-15R were not detected in oligodendrocytes. In neurons, only transcripts for EL-8R and TNFRI were detected. This specific set of cytokine/cytokine receptor expression suggests that astrocytes and microglia are the major cellular source of proinflammatory cytokines in the human CNS. As well, these cells may be the major targets of inflammatory cytokines and may contribute to the propagation of immune and inflammatory responses in the human CNS.  135  Proinflammatory cytokines are likely to be neurotoxic indirectly, via induction of glial cells to produce neurotoxic factors such as reactive oxygen intermediates, eicosanoids, excitatory amino acids and nitric oxide (NO). Previous studies have shown that EL-lp in combination with EFN-y or TNF-a is a major inducer of NO production in human astrocytes (Lee et al., 1993b; Liu et al., 1996). The present study has demonstrated that human astrocytes stimulated with EL-ip produced a 10-fold increase of NO over control cultures, and this NO production was enhanced by addition of EFN-y or TNF-a, while DL-12 did not increase the NO production induced by IL-lp. Although DL.-12 did not directly alter NO production by DL.-1P, it is possible that the mechanism of its action is indirect, involving the activation of NK cells or T cells which infiltrate the CNS and which produce DFN-y. To preserve homeostasis, the ongoing inflammatory cytokine cascades in the CNS should be down-regulated and suppressed so that an optimal balance of pro- and antiinflammatory cytokine levels may be maintained. Expression of the anti-inflammatory cytokines in the human CNS was also investigated in the present study. Transcript for EL,-10 was present only in microglia, whereas the transcripts for IL-4 and IL-13 were not detected in any of the CNS cell types studied. Transcript for TGF-pl, another anti-inflammatory cytokine, was expressed in all CNS cell types. IL-10R mRNA was detected in astrocytes and microglia, but not in neurons or oligodendrocytes. The pattern of expression of the antiinflammatory cytokine/cytokine receptors suggests that EL,-10 which can be produced by microglia, and TGF-pl which can be produced by all CNS cells are the major antiinflammatory cytokines in the human CNS. Ln fact, the present study demonstrated that TNF-a production in LPS plus EFN-y stimulated human microglia was markedly decreased 136  by EL-10 treatment. However, TGF-P 1 did not show any inhibitory effect on the TNF-a production in human microglial cells stimulated with LPS and EFN-y. Taking these studies one step further, it was demonstrated (Chapter 7) that the p38 MAP kinase pathway is involved in TNF-a production in LPS-stimulated human microglia. Together, these findings suggest that EL-10 produced by microglia is the sole endogenous anti-inflammatory cytokine in human CNS, and that TNF-a production in human microglia is regulated in an autocrine manner via feedback-inhibition. In this regard, it will be interesting to determine if the antiinflammatory actions of EL-10 or any effects of TGF-P involve the p38 signal pathways in LPS-stimulated human microglia. In contrast to the inhibitory actions of EL-10 on TNF-a production, EL-10 did not affect the level of NO production in astrocytes stimulated with IL-ip plus IFN-y. Thus, it is likely that the signaling pathways which lead to TNF-a production or NO production are distinct from each other. In addition, IL-13 did not have any inhibitory effect on NO or TNFa production. Recent studies have shown that IL-13Ra together with IL-4Ra form a functional receptor for IL-13 or IL-4. IL-13Ra mRNA was detected in all CNS cell types, while IL-4Ra mRNA was not detected in any of CNS cell types. Thus, the lack of EL,-13 action is not surprising. Since homeostasis must be maintained, the CNS cells likely employ other strategies to control the NO levels, such as those stimulated by IL-ip, DFN-y or TNF-a. These may include expression of cytokine receptor antagonists, such as IL-IRa, or release of soluble forms of pro-inflammatory cytokine receptors, like IL-1RH and TNFRII. Consistent with these strategies is the observation that EL,-IRE and TNFRH were induced by EL-lp plus EFN-y stimulation in astrocytes, and these may play a role in the negative feedback regulation 137  of NO production. Additionally, there may be as yet unknown conditions which result in the induction of the IL-4Ra, which would allow the human CNS to be receptive to IL-4 or EL-13. In recent years, a number of studies have reported that hematopoietic growth factors such as EL-2, EL-3, IL-4, EL-5, EL-7 and EL-8 are involved in promoting various stages of development in the CNS. In the present study, human astrocytes were shown to express transcripts for hematopoietic growth factors such as EL-9 and EL-11, and that these were secreted constitutively. EL-9R mRNA was detected in all CNS cell types whereas EL-11R mRNA was detected only in astrocytes. Therefore, EL-9 and EL-11 produced by astrocytes could act in an autocrine manner, and most human CNS cell types could respond to EL-9. As shown in chapter 5, EL-9, EL-11 and EL-15 promoted neurotrophic effects on the neuronal differentiation and survival of human embryonic neurons in culture, suggesting that EL-9 produced by astrocytes could directly influence neuronal survival and differentiation. EL-11 or EL-15 produced by astrocytes may also indirectly produce neurotrophic effects on neurons by acting in an autocrine manner, causing the astrocytes to produce one or more neurotrophic factors. Finally, it is noteworthy that the human CNS utilizes different patterns of cytokine/cytokine receptor expression from those of non-human mammals during the development of CNS. Another interesting observation of the present study is that gpl30 mRNA was detected in all CNS cell types, indicating that all human CNS cell types can respond to gpl30 associated cytokines. Transcripts for the gpl30-related cytokines, CNTF or LEF, were expressed not only in astrocytes, but also in oligodendrocytes, and LEF mRNA was detected in neurons. However, microglia did not express transcripts for either CNTF or LEF. These  138  results support earlier studies that CNTF or LIF could be involved in astroglial lineage commitment, as well as in the survival of oligodendrocytes via an autocrine manner. Based on the results of present study, several new clues for better understanding of cytokine network in the human CNS were found including: (1) Astrocytes and microglia are the major source and targets of proinflammatory cytokines such as EL-lp\ IL-6, H-8, EL-12, EL-15 and TNF-a, and these cell types propagate the inflammatory response in the human CNS (Fig. 8.1); (2) EL-10 produced by microglia is the major endogenous anti-inflammatory cytokine in human CNS (Fig 8.2); (3) EL-9, EL-11 and EL-15 produced by astrocytes is likely involved in the development of human CNS (Fig 8.3); and (4) The human CNS utilizes different sets of cytokine/cytokine receptor expression from those of non-human mammals during the CNS development. The expression patterns of cytokines and cytokine receptors in the human CNS define a unique network of communication and interaction between the different CNS cell types, as illustrated in Fig. 8.4.  139  AST IL-1 (3 IL-6 IL-8 IL-15 TNF-a  IL-1 RI IL-1RII IL-6R IL-8R IL-12R IL-15R TNFRI TNFRII  M0  NEU  IL-ip IL-6 IL-8 IL-12 IL-15 TNF-a IL-1 RI IL-1RII IL-6R IL-8R IL-12 R IL-15R TNFRI TNFRII  OLG IL-1p  IL-1p, IL-12, TNF-a  AST ) IL-8R TNFRI  IL-1RI IL-6R IL-8R TNFRII  LPS/IFNy  IL-ip, IL-6, IL-8, . „ _ I M0 IL-15, TNF-a  IL-1p, IL-6 IL-8,TNF-a  Fig. 8.1 Pro-inflammatory Cytokines in the Human CNS Possible cell-to-cell interactions shown on the right were based on the expression patterns of the cell-specific cytokine/cytokine receptors as shown on the left of the figure. AST = Astrocytes, M 0 = Microglia, OLG = Oligodendrocytes, NEU = Neurons.  140  Fig. 8.2 Anti-inflammatory Cytokines in the Human CNS Possible cell-to-cell interactions shown on the right were based on the expression patterns of the cell-specific cytokine/cytokine receptors as shown on the left of the figure. AST = Astrocytes, M 0 = Microglia, OLG = Oligodendrocytes, NEU = Neurons.  141  AST IL-9 IL-11 IL-15 GM-CSF TGF-a LIF CNTF SCF  IL-9R IL-11R IL-15R SCFR gp130  M0 IL-15 TGF-a  IL-9R IL-15R gp130  NEU IL-5 LIF  IL-9R gp130  OLG TGF-a CNTF  IL-9, IL-11, IL-15  Neurotrophic effects  IL-9R SCFR gp130  Fig. 8.3 Cytokines as Growth Factors in the Human CNS Possible cell-to-cell interactions shown on the right were based on the expression patterns of the cell-specific cytokine/cytokine receptors as shown on the left of the figure. AST = Astrocytes, M 0 = Microglia, OLG = Oligodendrocytes, NEU = Neurons.  142  Fig. 8.4  Cytokine Network in the Human CNS  Possible cell-to-cell interactions between the various human CNS cell types. AST = Astrocytes, M 0 = Microglia, OLG = Oligodendrocytes, NEU = Neurons.  143  References Abraham C.R., Selkoe D.J. and Potter H . (1988) Immunochemical identification of the serine protease inhibitor alpha 1-antichymotrypsin in the brain amyloid deposits of Alzheimer's disease. Cell 52, 487-501. Aloisi F., Care A . , Borsellino G., Gallo P., Rosa S., Bassani A . , Cabibbo, Testa U., Levi G . and Peschle C . (1992) Production of hemolymphopoietic cytokines (IL-6, IL-8, colony-stimulating factors) by normal human astrocytes in response to IL-1 beta and tumor necrosis factor-alpha. Journal of Immunology 149, 2358-2366. Aloisi F., Penna G., Cerase J., Menendez L B . and Adorini L . (1997) IL-12 production by central nervous system microglia is inhibited by astrocytes. Journal of Immunology 159, 1604-1612. Aman M.J., Tayebi N . , Obiri N.I., Puri R.K., Modi W.S. and Leonard W.J. (1996) c D N A cloning and characterization of the human interleukin 13 receptor alpha chain. J.Biol.Chem. 271, 29265-29270. Anderson D . M . , Kumaki S., Ahdieh M . , Bertles J., Tometsko M . , Loomis A . , Giri J., Copeland N . G . , Gilbert D.J. and Jenkins N . A . (1995) Functional characterization of the human interleukin-15 receptor alpha chain and close linkage of IL15RA and IL2RA genes. J.Biol.Chem. 270, 29862-29869. Aranguez I., Torres C. and Rubio N . (1995) The receptor for tumor necrosis factor on murine astrocytes: characterization, intracellular degradation, and regulation by cytokines and Theiler's murine encephalomyelitis virus. GLIA 13, 185-194. Araujo D . M . , Lapchak P.A., Collier B. and Quirion R. (1989) Localization of interleukin-2 immunoreactivity and interleukin-2 receptors in the rat brain: interaction with the cholinergic system. Brain Research 498, 257-266. Araujo D . M . and Cotman C W . (1992a) Beta-amyloid stimulates glial cells in vitro to produce growth factors that accumulate in senile plaques in Alzheimer's disease. Brain Research 569, 141-145. Araujo D . M . and Cotman C W . (1992b) Basic F G F in astroglial, microglial, and neuronal cultures: characterization of binding sites and modulation of release by lymphokines and trophic factors. J.Neurosci. 12, 1668-1678. Araujo D . M . and Cotman C W . (1993) Trophic effects of interleukin-4, -7 and -8 on hippocampal neuronal cultures: potential involvement of glial-derived factors. Brain Research 600, 49-55. Awatsuji H . , Furukawa Y . , Nakajima M . , Furukawa S. and Hayashi K. (1993a) Interleukin-2 as a neurotrophic factor for supporting the survival of neurons cultured from various regions of fetal rat brain. Journal of Neuroscience Research 35, 305-311. Awatsuji H . , Furukawa Y . , Hirota M . , Murakami Y . , Nii S., Furukawa S. and Hayashi K. (1993b) Interleukin-4 and -5 as modulators of nerve growth factor synthesis/secretion in astrocytes. Journal of Neuroscience Research 34, 539-545. Baggiolini M . (1993) Novel aspects of inflammation: interleukin-8 and related chemotactic cytokines. Clin.Investig. 71, 812-814. Bamber B.A., Masters B.A., Hoyle G.W., Brinster R.L. and Palmiter R.D. (1994) Leukemia inhibitory factor induces neurotransmitter switching in transgenic mice [see comments]. Proc.Natl.Acad.Sci. U.S.A. 91, 7839-7843.  144  Ban E . , Milon G., Prudhomme N., Fillion G. and Haour F. (1991) Receptors for interleukin-1 (alpha and beta) in mouse brain: mapping and neuronal localization in hippocampus. Neuroscience 43, 21-30. Banati R.B., Rothe G., Valet G. and Kreutzberg G.W. (1993a) Detection of lysosomal cysteine proteinases in microglia: flow cytometric measurement and histochemical localization of cathepsin B and L . GLIA 7, 183-191. Banati R.B., Gehrmann J., Schubert P. and Kreutzberg G.W. (1993b) Cytotoxicity of microglia. [Review] [75 refs]. GLIA 7, 111-118. Bandtlow C . E . , Meyer M . , Lindholm D., Spranger M . , Heumann R. and Thoenen H . (1990) Regional and cellular codistribution of interleukin 1 beta and nerve growth factor m R N A in the adult rat brain: possible relationship to the regulation of nerve growth factor synthesis. Journal of Cell Biology 111, 1701-1711. Barbarese E . , Barry C , Chou C . H . , Goldstein D.J., Nakos G.A., Hyde-DeRuyscher R., Scheld K. and Carson J.H. (1988) Expression and localization of myelin basic protein in oligodendrocytes and transfected fibroblasts. Journal of Neurochemistry 51, 1737-1745. Barna B.P., Barnett G.H., Jacobs B.S. and Estes M . L . (1993) Divergent responses of human astrocytoma and non-neoplastic astrocytes to tumor necrosis factor alpha involve the 55 kDa tumor necrosis factor receptor. Journal of Neuroimmunology 43, 185-190. Barnum S.R., Jones J.L., Muller-Ladner U., Samimi A . and Campbell I.L. (1996) Chronic complement C3 gene expression in the CNS of transgenic mice with astrocyte-targeted interleukin-6 expression. GLIA 18, 107-117. Barres B.A., Schmid R., Sendnter M . and Raff M . C . (1993) Multiple extracellular signals are required for longterm oligodendrocyte survival. Development 118, 283-295. Barten D . M . and Ruddle N . H . (1994) Vascular cell adhesion molecule-1 modulation by tumor necrosis factor in experimental allergic encephalomyelitis. Journal of Neuroimmunology 51, 123-133. Becher B., Dodelet V . , Fedorowicz V . and Antel J.P. (1996) Soluble tumor necrosis factor receptor inhibits interleukin 12 production by stimulated human adult microglial cells in vitro. J.Clin.Invest. 98, 15391543. Beckmann M.P., Munger W . E . , Kozlosky C , VandenBos T., Price V . , Lyman S., Gerard N.P., Gerard C . and Cerretti D.P. (1991) Molecular characterization of the interleukin-8 receptor. Biochem.Biophys.Res.Commun. 179, 784-789. Benveniste E . N . , Whitaker J.N., Gibbs D.A., Sparacio S.M. and Butler J.L. (1989) Human B cell growth factor enhances proliferation and glial fibrillary acidic protein gene expression in rat astrocytes [published erratum appears in Int Immunol 1989;1(5):555]. International Immunology 1,219-228. Benveniste E . N . , Sparacio S.M., Norris J.G., Grenett H . E . and Fuller G . M . (1990) Induction and regulation of interleukin-6 gene expression in rat astrocytes. Journal of Neuroimmunology 30, 201-212. Benveniste E . N . (1992) Inflammatory cytokines within the central nervous system: sources, function, and mechanism of action. [Review] [154 refs]. American Journal of Physiology 263, Cl-16. Benveniste E . N . , Kwon J., Chung W.J., Sampson J., Pandya K. and Tang L.P. (1994) Differential modulation of astrocyte cytokine gene expression by TGF-beta [published erratum appears in J Immunol 1995 Feb 1;154(3):1521]. Journal of Immunology 153, 5210-5221.  145  Bethea J.R., Gillespie G . Y . , Chung L Y . and Benveniste E . N . (1990) Tumor necrosis factor production and receptor expression by a human malignant glioma cell line; D54-MG. Journal of Neuroimmunology 30, 1-13. Beyaert R., Cuenda A . , Vanden Berghe W., Plaisance S., Lee J.C., Haegeman, Cohen P. and Fiers W . (1996) The p38/RK mitogen-activated protein kinase pathway regulates interleukin-6 synthesis response to tumor necrosis factor. EMBO Journal 15, 1914-1923. Bhat N.R., Zhang P., Lee J.C. and Hogan E . L . (1998) Extracellular signal-regulated kinase and p38 subgroups of mitogen-activated protein kinases regulate inducible nitric oxide synthase and tumor necrosis factoralpha gene expression in endotoxin-stimulated primary glial cultures. Journal of Neuroscience 18, 1633-1641. Bindoni M . , Perciavalle V . , Berretta S., Belluardo N . and Diamantstein T . (1988) Interleukin 2 modifies the bioelectric activity of some neurosecretory nuclei in the rat hypothalamus. Brain Research 462, 10-14. Blatteis C M . (1988) Neural mechanisms in the pyrogenic and acute-phase responses to interleukin-1. International Journal of Neuroscience 38, 223-232. Bogdan C , Paik J., Vodovotz Y . and Nathan C. (1992) Contrasting mechanisms for suppression of macrophage cytokine release by transforming growth factor-beta and interleukin-10. Journal of Biological Chemistry 267, 23301-23308. Bogdan C . and Nathan C. (1993) Modulation of macrophage function by transforming growth factor beta, interleukin-4, and interleukin-10. Ann.N.Y.Acad.Sci. 685:713-39, 713-739. Bogdan C , Vodovotz Y . , Paik J., Xie Q.W. and Nathan C . (1994) Mechanism of suppression of nitric oxide synthase expression by interleukin-4 in primary mouse macrophages. J.Leukoc.Biol. 55, 227-233. Boje K . M . and Arora P.K. (1992) Microglial-produced nitric oxide and reactive nitrogen oxides mediate neuronal cell death. Brain Research 587, 250-256. Boulay F., Tardif M . , Brouchon L . and Vignais P. (1990) Synthesis and use of a novel N-formyl peptide derivative to isolate a human N-formyl peptide receptor c D N A . Biochem.Biophys.Res.Commun. 168, 1103-1109. Breder C D . , Dinarello C A . and Saper C B . (1988) Interleukin-1 immunoreactive innervation of the human hypothalamus. Science 240, 321-324. Bredt D.S. and Snyder S.H. (1992) Nitric oxide, a novel neuronal messenger. Neuron 8, 3-11. Brugg B., Dubreuil Y . L . , Huber G., Wollman E . E . , Delhaye-Bouchaud N . and Mariani J. (1995) Inflammatory processes induce beta-amyloid precursor protein changes in mouse brain. Proceedings of the National Academy of Sciences of the United States of America 92, 3032-3035. Bukrinsky M . L , Nottet H.S., Schmidtmayerova H . , Dubrovsky L . , Flanagan C.R., Mullins M . E . , Lipton S.A. and Gendelman H . E . (1995) Regulation of nitric oxide synthase activity in human immunodeficiency virus type 1 (HlV-l)-infected monocytes: implications for HIV- associated neurological disease. J.Exp.Med. 181, 735-745. Callard R . E . , Matthews D.J. and Hibbert L . (1996) IL-4 and IL-13 receptors: are they one and the same? Immunol.Today 17, 108-110.  146  Campagnoni A . T . (1988) Molecular biology of myelin proteins from the central nervous system. [Review] [145 refs]. Journal of Neurochemistry 51, 1-14. Campbell I.L., Abraham C.R., Masliah E . , Kemper P., Inglis J.D., Oldstone M . B . and Mucke L . (1993) Neurologic disease induced in transgenic mice by cerebral overexpression of interleukin 6. Proc.Natl.Acad.Sci.U.S.A. 90, 10061-10065. Campbell I.L. and Chiang C S . (1995) Cytokine involvement in central nervous system disease. Implications from transgenic mice. Ann.N.Y.Acad.Sci. 771:301-12, 301-312. Cannella B., Cross A . H . and Raine C S . (1990) Upregulation and coexpression of adhesion molecules correlate with relapsing autoimmune demyelination in the central nervous system. Journal of Experimental Medicine 172, 1521-1524. Cannella B . and Raine C S . (1995) The adhesion molecule and cytokine profile of multiple sclerosis lesions [see comments]. Annals of Neurology 37, 424-435. Caput D., Laurent P., Kaghad M . , Lelias J . M . , Lefort S., Vita N . and Ferrara P. (1996) Cloning and characterization of a specific interleukin (IL)-13 binding protein structurally related to the IL-5 receptor alpha chain. J.Biol.Chem. 271, 16921-16926. Carman-Krzan M . , Vige X . and Wise B . C . (1991) Regulation by interleukin-1 of nerve growth factor secretion and nerve growth factor mRNA expression in rat primary astroglial cultures. J.Neurochem. 56, 636643. Carroll P., Sendtner M . , Meyer M . and Thoenen H . (1993) Rat ciliary neurotrophic factor (CNTF): gene structure and regulation of mRNA levels in glial cell cultures. GLIA 9, 176-187. Carson W . E . , Giri J.G., Lindemann M.J., Linett M . L . , Ahdieh M . , Paxton R., Anderson D., Eisenmann J., Grabstein K. and Caligiuri M . A . (1994) Interleukin (IL) 15 is a novel cytokine that activates human natural killer cells via components of the IL-2 receptor. Journal of Experimental Medicine 180, 13951403. Carson W . E . , Fehniger T . A . , Haldar S., Eckhert K., Lindemann M.J., Lai C.F., Croce C M . , Baumann H . and Caligiuri M . A . (1997) A potential role for interleukin-15 in the regulation of human natural killer cell survival. J.Clin.Invest. 99,937-943. Cash E . , Minty A . , Ferrara P., Caput D., Fradelizi D. and Rott O. (1994) Macrophage-inactivating IL-13 suppresses experimental autoimmune encephalomyelitis in rats. Journal of Immunology 153, 42584267. Cerretti D.P., Kozlosky C.J., Vanden Bos T., Nelson N . , Gearing D.P. and Beckmann M.P. (1993) Molecular characterization of receptors for human interleukin-8, GRO/melanoma growth-stimulatory activity and neutrophil activating peptide-2. Mol.Immunol. 30, 359-367. Chalazonitis A . , Kalberg J., Twardzik D.R., Morrison R.S. and Kessler J.A. (1992) Transforming growth factor beta has neurotrophic actions on sensory neurons in vitro and is synergistic with nerve growth factor. Developmental Biology 152, 121-132. Chao C C , Hu S., Molitor T.W., Shaskan E . G . and Peterson P.K. (1992) Activated microglia mediate neuronal cell injury via a nitric oxide mechanism. Journal of Immunology 149, 2736-2741. Chao C C , Molitor T . W . and Hu S. (1993) Neuroprotective role of IL-4 against activated microglia. Journal of Immunology 151, 1473-1481.  147  Chao C C . and Hu S. (1994) Tumor necrosis factor-alpha potentiates glutamate neurotoxicity in human fetal brain cell cultures. Dev.Neurosci. 16, 172-179. Chen C . Y . , Del Gatto-Konczak F., Wu Z. and Karin M . (1998) Stabilization of interleukin-2 m R N A by the cJun NH2-terminal kinase pathway. Science 280, 1945-1949. Chernausek S.D. (1993) Insulin-like growth factor-I (IGF-I) production by astroglial cells: regulation and importance for epidermal growth factor-induced cell replication. J.Neurosci.Res. 34, 189-197. Chomczynski P. and Sacchi N . (1987) Single-step method of R N A isolation by acid guanidinium thiocyanatephenol-chloroform extraction. Analytical Biochemistry 162, 156-159. Chua A . O . , Chizzonite R., Desai B.B., Truitt T.P., Nunes P., Minetti L.J., Warrier R.R., Presky D . H . , Levine J.F. and Gately M . K . (1994) Expression cloning of a human IL-12 receptor component. A new member of the cytokine receptor superfamily with strong homology to gpl30. J.Immunol. 153, 128-136. Chua A . O . , Wilkinson V . L . , Presky D . H . and Gubler U . (1995) Cloning and characterization of a mouse IL-12 receptor-beta component. J.Immunol. 155, 4286-4294. Chung I.Y. and Benveniste E . N . (1990) Tumor necrosis factor-alpha production by astrocytes. Induction by lipopolysaccharide, IFN-gamma, and IL-1 beta. Journal of Immunology 144, 2999-3007. Chung I.Y., Norris J.G. and Benveniste E . N . (1991) Differential tumor necrosis factor alpha expression by astrocytes from experimental allergic encephalomyelitis-susceptible and -resistant rat strains. Journal of Experimental Medicine 173, 801-811. Chung I.Y., Kwon J. and Benveniste E . N . (1992) Role of protein kinase C activity in tumor necrosis factoralpha gene expression. Involvement at the transcriptional level. Journal of Immunology 149, 38943902. Cobb M . H . and Goldsmith E.J. (1995) How M A P kinases are regulated. [Review] [60 refs]. Journal of Biological Chemistry 270, 14843-14846. Colotta F., Re F., Muzio M . , Bertini R., Polentarutti N . , Sironi M . , Giri, JG, Dower S.K., Sims J.E. and Mantovani A . (1993) Interleukin-1 type II receptor: a decoy target for IL-1 that is regulated by IL-4. Science 261, 472-475. Colton C A . and Gilbert D.L. (1987) Production of superoxide anions by a CNS macrophage, the microglia. FEBS Letters 223, 284-288. Correale J., Gilmore W., McMillan M . , L i S., McCarthy K., Le T., Weiner and L P (1995) Patterns of cytokine secretion by autoreactive proteolipid protein-specific T cell clones during the course of multiple sclerosis. Journal of Immunology 154, 2959-2968. Csonga R., Prieschl E . E . , Jaksche D., Novotny V . and Baumruker T. (1998) Common and distinct signaling pathways mediate the induction of TNF-alpha and IL-5 in IgE plus antigen-stimulated mast cells. Journal of Immunology 160, 273-283. Cuenda A., Rouse J., Doza Y . N . , Meier R„ Cohen P., Gallagher T.F., Young, PR and Lee J.C. (1995) SB 203580 is a specific inhibitor of a M A P kinase homologue which is stimulated by cellular stresses and interleukin-1. FEBS Utters 364, 229-233.  148  D'Andrea A., M a X . , Aste-Amezaga M . , Paganin C and Trinchieri G . (1995) Stimulatory and inhibitory effects of interleukin (IL)-4 and IL-13 on the production of cytokines by human peripheral blood mononuclear cells: priming for IL-12 and tumor necrosis factor alpha production. Journal of Experimental Medicine 181, 537-546. D'Souza S.D., Alinauskas K . A . and Antel J.P. (1996) Ciliary neurotrophic factor selectively protects human oligodendrocytes from tumor necrosis factor-mediated injury. J.Neurosci.Res. 43, 289-298. da Cunha A . and Vitkovic L . (1992) Transforming growth factor-beta 1 (TGF-beta 1) expression and regulation in rat cortical astrocytes. Journal of Neuroimmunology 36, 157-169. da Cunha A., Jefferson J.A., Jackson R.W. and Vitkovic L . (1993a) Glial cell-specific mechanisms of TGF-beta 1 induction by IL-1 in cerebral cortex. Journal of Neuroimmunology 42 , 71-85. da Cunha A . , Jefferson J.J., Tyor W.R., Glass J.D., Jannotta F.S. and Vitkovic L . (1993b) Control of astrocytosis by interleukin-1 and transforming growth factor-beta 1 in human brain. Brain Research 631, 39-45. De Simone R., Giampaolo A . , Giometto B., Gallo P., Levi G., Peschle C . and Aloisi F. (1995) The costimulatory molecule B7 is expressed on human microglia in culture and in multiple sclerosis acute lesions. Journal of Neuropathology & Experimental Neurology 54, 175-187. De Simoni M . G . , Sironi M . , De Luigi A . , Manfridi A . , Mantovani A . and Ghezzi (1990) Intracerebroventricular injection of interleukin 1 induces high circulating levels of interleukin 6. Journal of Experimental Medicine 171, 1773-1778. de Waal M . , Figdor C . G . , Huijbens R., Mohan-Peterson S., Bennett B., Culpepper J., Dang W . , Zurawski G . and de Vries J.E. (1993) Effects of IL-13 on phenotype, cytokine production, and cytotoxic function of human monocytes. Comparison with IL-4 and modulation by IFN-gamma or IL-10. Journal of Immunology 151, 6370-6381. Del Bo R., Angeretti N . , Lucca E . , De Simoni M . G . and Forloni G . (1995) Reciprocal control of inflammatory cytokines, IL-1 and IL-6, and beta-amyloid production in cultures. Neuroscience Letters 188, 70-74. Derijard B., Raingeaud J., Barrett T., Wu I.H., Han J., Ulevitch R.J., Davis and RJ (1995) Independent human MAP-kinase signal transduction pathways defined by M E K and M K K isoforms [published erratum appears in Science 1995 Jul 7;269(5220):17]. Science 267, 682-685. Di Santo E . , Alonzi T., Fattori E . , Poli V . , Ciliberto G., Sironi M . , Gnocchi P., Ricciardi-Castagnoli P. and Ghezzi P. (1996) Overexpression of interleukin-6 in the central nervous system of transgenic mice increases central but not systemic proinflammatory cytokine production. Brain Research 740, 239244. Dickson D.W., Lee S . C , Mattiace L . A . , Yen S.H. and Brosnan C. (1993) Microglia and cytokines in neurological disease, with special reference to AIDS and Alzheimer's disease. [Review] [90 refs]. GLIA 7, 75-83. Dinarello C A . and Thompson R.C. (1991) Blocking IL-1: interleukin 1 receptor antagonist in vivo and in vitro. [Review] [84 refs]. Immunology Today 12, 404-410. Donnelly R.J., Friedhoff A.J., Beer B., Blume A.J. and Vitek M.P. (1990) Interleukin-1 stimulates the betaamyloid precursor protein promoter. Cellular & Molecular Neurobiology 10, 485-495.  149  Dooms H . , Desmedt M . , Vancaeneghem S., Rottiers P., Goossens V . , Fiers W . and Grooten J. (1998) Quiescence-inducing and antiapoptotic activities of IL-15 enhance secondary CD4+ T cell responsiveness to antigen. J.Immunol. 161,2141-2150. Dopp J . M . , Mackenzie-Graham A., Otero G.C. and Merrill J.E. (1997) Differential expression, cytokine modulation, and specific functions of type-1 and type-2 tumor necrosis factor receptors in rat glia. J.Neuroimmunol.lS, 104-112. Dower S.K., Sims J.E., Stanton T . H . , Slack J., McMahan C.J., Valentine M . A . and Bomsztyk K. (1990) Molecular heterogeneity of interleukin-1 receptors. Ann.N.Y.Acad.Sci. 594:231-9, 231-239. Du X . X . and Williams D.A. (1994) Interleukin-11: a multifunctional growth factor derived from the hematopoietic microenvironment. Blood 83, 2023-2030. Du X., Everett E . T . , Wang G., Lee W . H . , Yang Z. and Williams D.A. (1996) Murine interleukin-11 (IL-11) is expressed at high levels in the hippocampus and expression is developmentally regulated in the testis. Journal of Cellular Physiology 168, 362-372. Eddleston M . , de la Torre J.C., Oldstone M . B . , Loskutoff D.J., Edgington T.S. and Mackman N . (1993) Astrocytes are the primary source of tissue factor in the murine central nervous system. A role for astrocytes in cerebral hemostasis. Journal of Clinical Investigation 92, 349-358. Eddleston M . and Mucke L . (1993) Molecular profile of reactive astrocytes—implications for their role in neurologic disease. Neuroscience 54, 15-36. Eng L . F . , D'Amelio F . E . and Smith M . E . (1989) Dissociation of G F A P intermediate filaments in E A E : observations in the lumbar spinal cord. GLIA 2, 308-317. Eng L . F . , Ghirnikar R.S. and Lee Y . L . (1996) Inflammation in E A E : role of chemokine/cytokine expression by resident and infiltrating cells. [Review] [133 refs]. Neurochemical Research 2 1 , 511-525. Estes M . L . , Iwasaki K., Jacobs B.S. and Barna B.P. (1993) Interleukin-4 down-regulates adult human astrocyte D N A synthesis and proliferation. American Journal of Pathology 143, 337-341. Fabry Z., Raine C S . and Hart M . N . (1994) Nervous tissue as an immune compartment: the dialect of the immune response in the CNS. [Review] [59 refs]. Immunology Today 15, 218-224. Farrar W . L . , Vinocour M . and Hill J.M. (1989) In situ hybridization histochemistry localization of interleukin-3 m R N A in mouse brain. Blood 73, 137-140. Fassbender K., Rossol S., Kammer T., Daffertshofer M . , Wirth S., Dollman M . and Hennerici M . (1994) Proinflammatory cytokines in serum of patients with acute cerebral ischemia: kinetics of secretion and relation to the extent of brain damage and outcome of disease. J.Neurol.Sci. 122, 135-139. Fattori E . , Lazzaro D., Musiani P., Modesti A., Alonzi T. and Ciliberto G . (1995) IL-6 expression in neurons of transgenic mice causes reactive astrocytosis and increase in ramified microglial cells but no neuronal damage. Eur.J.Neurosci. 7, 2441-2449. Ferrara N., Ousley F. and Gospodarowicz D. (1988) Bovine brain astrocytes express basic fibroblast growth factor, a neurotropic and angiogenic mitogen. Brain Res. 462, 223-232. Fierz W . , Endler B., Reske K., Wekerle H . and Fontana A . (1985) Astrocytes as antigen-presenting cells. I. Induction of la antigen expression on astrocytes by T cells via immune interferon and its effect on antigen presentation. Journal of Immunology 134, 3785-3793.  150  Flynn A . and Proud C G . (1996) The role o f eIF4 i n cell proliferation. [Review] [71 refs]. Cancer Surveys 27, 293-310. Foltz I.N., Lee J . C , Young P.R. and Schrader J.W. (1997) Hemopoietic growth factors with the exception o f interleukin-4 activate the p38 mitogen-activated protein kinase pathway. Journal of Biological Chemistry 272, 3296-3301. Foltz I.N. and Schrader J.W. (1997) Activation o f the stress-activated protein kinases by multiple hematopoietic growth factors with the exception o f interleukin-4. Blood 89, 3092-3096. Foltz I.N., Gerl R.E., Wieler J.S., Luckach M . , Salmon R.A. and Schrader J.W. (1998) Human mitogenactivated protein kinase kinase 7 ( M K K 7 ) is a highly conserved c-Jun N-terminal kinase/stressactivated protein kinase ( J N K / S A P K ) activated by environmental stresses and physiological stimuli. Journal of Biological Chemistry 273, 9344-9351. Fontana A., Otz U., De Week A . L . and Grob P.J. (1982a) Glia cell stimulating factor (GSF): a new lymphokine. Part 2. Cellular sources and partial purification o f human GSF. Journal of Neuroimmunology 2, 73-81. Fontana A., Dubs R., Merchant R., Balsiger S. and Grob P.J. (1982b) Glia cell stimulating factor (GSF): a new lymphokine. Part 1. Cellular sources and partial purification o f murine GSF, role o f cytoskeleton and protein synthesis in its production. Journal of Neuroimmunology 2, 55-71. Fontana A., Kristensen F., Dubs R., Gemsa D. and Weber E. (1982c) Production o f prostaglandin E and an interleukin-1 like factor by cultured astrocytes and C6 glioma cells. Journal of Immunology 129, 24132419. Fourcin M . , Chevalier S., Lebrun J.J., Kelly P., Pouplard A., Wijdenes J. and Gascan H. (1994) Involvement o f gpl30/interleukin-6 receptor transducing component in interleukin-11 receptor. Eur. J.Immunol. 24, 277-280. Frei K., Bodmer S., Schwerdel C. and Fontana A . (1986) Astrocyte-derived interleukin 3 as a growth factor for microglia cells and peritoneal macrophages. Journal of Immunology 137, 3521-3527. Frei K., Siepl C , Groscurth P., Bodmer S. and Fontana A . (1988) Immunobiology o f microglial cells. [Review] [39 refs]. Annals of the New York Academy of Sciences 540, 218-227. Frei K., Malipiero U.V., Leist T.P., Zinkernagel R.M., Schwab M.E. and Fontana A . (1989) On the cellular source and function o f interleukin 6 produced in the central nervous system in viral diseases. European Journal of Immunology 19, 689-694. Frei K., Lins H., Schwerdel C. and Fontana A . (1994) Antigen presentation in the central nervous system. The inhibitory effect o f I L - 1 0 on M H C class I I expression and production o f cytokines depends on the inducing signals and the type o f cell analyzed. Journal of Immunology 152, 2720-2728. Gadient R.A., Cron K . C and Otten U. (1990) Interleukin-1 beta and tumor necrosis factor-alpha synergistically stimulate nerve growth factor (NGF) release f r o m cultured rat astrocytes. Neuroscience Letters 117, 335-340. Gayle R.B., Sleath P.R., Srinivason S., Birks C.W., Weerawarna K.S., Cerretti D.P., Kozlosky C.J., Nelson N . , Vanden Bos T . and Beckmann M.P. (1993) Importance o f the amino terminus o f the interleukin-8 receptor i n ligand interactions. J.Biol.Chem. 268, 7283-7289.  151  Gearing D.P., Comeau M.R., Friend D.J., Gimpel S.D., Thut C.J., McGourty J., Brasher K . K . , King J.A., Gillis S. and Mosley B. (1992) The IL-6 signal transducer, gpl30: an oncostatin M receptor and affinity converter for the LIF receptor. Science 255, 1434-1437. Gehr G., Gentz R., Brockhaus M . , Loetscher H . and Lesslauer W . (1992) Both tumor necrosis factor receptor types mediate proliferative signals in human mononuclear cell activation. Journal of Immunology 149, 911-917. Geng Y . , Zhang B . and Lotz M . (1993) Protein tyrosine kinase activation is required for lipopolysaccharide induction of cytokines in human blood monocytes. J.Immunol. 151, 6692-6700. Geoffrey R., Pugh-Humphreys P., and Thomson A . W . (1994) Cytokines and their receptors as potential therapeutic targets. In The Cytokine Handbook (ed. A . W . Thomson), Academic Press, San Diego, C A . , pp. 525-566. Geppert T.D., Whitehurst C . E . , Thompson P. and Beutler B. (1994) Lipopolysaccharide signals activation of tumor necrosis factor biosynthesis through the ras/raf-l/MEK/MAPK pathway. Molecular Medicine 1, 93-103. Gerard N.P. and Gerard C. (1991) The chemotactic receptor for human C5a anaphylatoxin. Nature 349 , 614617. Gijbels K., Brocke S., Abrams J.S. and Steinman L . (1995) Administration of neutralizing antibodies to interleukin-6 (IL-6) reduces experimental autoimmune encephalomyelitis and is associated with elevated levels of IL-6 bioactivity in central nervous system and circulation. Molecular Medicine 1, 795-805. Gillessen S., Carvajal D., Ling P., Podlaski F.J., Stremlo D.L., Familletti, PC, Gubler U., Presky D . H . , Stern A.S. and Gately M . K . (1995) Mouse interleukin-12 (IL-12) p40 homodimer: a potent IL-12 antagonist. European Journal of Immunology 25, 200-206. Giri J.G., Ahdieh M . , Eisenman J., Shanebeck K., Grabstein K., Kumaki S., Namen A., Park L.S., Cosman D. and Anderson D. (1994) Utilization of the beta and gamma chains of the IL-2 receptor by the novel cytokine IL-15. EMBO J. 13,2822-2830. Giri J.G., Kumaki S., Ahdieh M . , Friend D.J., Loomis A., Shanebeck K., DuBose R., Cosman D., Park L.S. and Anderson D . M . (1995) Identification and cloning of a novel IL-15 binding protein that is structurally related to the alpha chain of the IL-2 receptor. EMBO J. 14, 3654-3663. Gitter B.D., Cox L . M . , Rydel R.E. and May P.C. (1995) Amyloid beta peptide potentiates cytokine secretion by interleukin-1 beta-activated human astrocytoma cells. Proceedings of the National Academy of Sciences of the United States of America 92, 10738-10741. Giulian D. and Baker T.J. (1986) Characterization of ameboid microglia isolated from developing mammalian brain. Journal of Neuroscience 6, 2163-2178. Giulian D . Woodward J., Young D . G . , Krebs J.F. and Lachman L . B . (1988a) Interleukin-1 injected into mammalian brain stimulates astrogliosis and neovascularization. Journal of Neuroscience 8, 24852490. (  Giulian D., Young D . G . , Woodward J., Brown D.C. and Lachman L . B . (1988b) Interleukin-1 is an astroglial growth factor in the developing brain. Journal of Neuroscience 8, 709-714.  152  Grabstein K . H . , Namen A . E . , Shanebeck K., Voice R.F., Reed S.G. and Widmer M . B . (1990) Regulation of T cell proliferation by IL-7. J.Immunol. 144, 3015-3020. Grabstein K . H . , Eisenman J., Shanebeck K., Rauch C , Srinivasan S., Fung V . , Beers C., Richardson J., Schoenborn M . A . and Ahdieh M . (1994) Cloning of a T cell growth factor that interacts with the beta chain of the interleukin-2 receptor. Science 264, 965-968. Griffin W.S., Stanley L . C . , Ling C , White L . , MacLeod V . , Perrot L.J., White, C L and Araoz C. (1989) Brain interleukin 1 and S-100 immunoreactivity are elevated in Down syndrome and Alzheimer disease. Proceedings of the National Academy of Sciences of the United States of America 86, 7611-7615. Griffin W.S., Sheng J.G., Roberts G.W. and Mrak R.E. (1995) Interleukin-1 expression in different plaque types in Alzheimer's disease: significance in plaque evolution. Journal of Neuropathology & Experimental Neurology 54, 276-281. Griffin W.S., Sheng J.G., Royston M . C . , Gentleman S.M., Mckenzie J.E., Graham, DI, Roberts G.W. and Mrak R.E. (1998) Glial-neuronal interactions in Alzheimer's disease: the potential role of a 'cytokine cycle' in disease progression. [Review] [70 refs]. Brain Pathology 8, 65-72. Gubler U., Chua A . O . , Schoenhaut D.S., Dwyer C M . , McComas W., Motyka R., Nabavi N . , Wolitzky A . G . , Quinn P . M . and Familletti P.C. (1991) Coexpression of two distinct genes is required to generate secreted bioactive cytotoxic lymphocyte maturation factor. Proceedings of the National Academy of Sciences of the United States of America 88, 4143-4147. Haas D.W., Shepherd V . L . and Hagedorn C H . (1992) Lipopolysaccharide stimulates phosphorylation of eukaryotic initiation factor-4F in macrophages and tumor necrosis factor participates in this event. ••Second Messengers & Phosphoproteins 14, 163-171. Hall A . K . and Rao M.S. (1992) Cytokines and neurokines: related ligands and related receptors. Trends Neurosci. 15, 35-37. Hama T., Miyamoto M . , Tsukui H . , Nishio C. and Hatanaka H. (1989) Interleukin-6 as a neurotrophic factor for promoting the survival of cultured basal forebrain cholinergic neurons from postnatal rats. Neuroscience Letters 104, 340-344. Han J. and Beutler B. (1990) The essential role of the UA-rich sequence in endotoxin-induced cachectin/TNF synthesis. European Cytokine Network 1, 71-75. Han J., Lee J.D., Bibbs L . and Ulevitch R.J. (1994) A M A P kinase targeted by endotoxin and hyperosmolarity in mammalian cells. Science 265, 808-811. Han V . K . , Smith A., Myint W., Nygard K. and Bradshaw S. (1992) Mitogenic activity of epidermal growth factor on newborn rat astroglia: interaction with insulin-like growth factors. Endocrinology 131, 11341142. Hanisch U . K . , Seto D. and Quirion R. (1993) Modulation of hippocampal acetylcholine release: a potent central action of interleukin-2. Journal of Neuroscience 13, 3368-3374. Hanisch U . K . and Quirion R. (1995) Interleukin-2 as a neuroregulatory cytokine. Brain Res.Brain Res.Rev. 21, 246-284. Hart M . N . and Fabry Z. (1995) CNS antigen presentation. [Review] [56 refs]. Trends in Neurosciences 18, 475-481.  153  Heaney M . L . and Golde D.W. (1996) Soluble cytokine receptors. Blood 87, 847-857. Heinzel F.P., Rerko R . M . , Ling P., Hakimi J. and Schoenhaut D.S. (1994) Interleukin 12 is produced in vivo during endotoxemia and stimulates synthesis of gamma interferon. Infect.Immun. 62, 4244-4249. Heller R.A., Song K., Fan N . and Chang D.J. (1992) The p70 tumor necrosis factor receptor mediates cytotoxicity. Cell 70, 47-56. Heller R.A. and Kronke M . (1994) Tumor necrosis factor receptor-mediated signaling pathways. [Review] [50 refs]. Journal of Cell Biology 126, 5-9. Heufler C , Koch F., Stanzl U . , Topar G., Wysocka M . , Trinchieri G . , Enk, Steinman R . M . , Romani N . and Schuler G. (1996) Interleukin-12 is produced by dendritic cells and mediates T helper 1 development as well as interferon-gamma production by T helper 1 cells. European Journal of Immunology 26, 659-668. Heyser C.J., Masliah E . , Samimi A . , Campbell I.L. and Gold L . H . (1997) Progressive decline in avoidance learning paralleled by inflammatory neurodegeneration in transgenic mice expressing interleukin 6 in the brain. Proceedings of the National Academy of Sciences of the United States of America 94, 15001505. Hilton D.J., Zhang J.G., Metcalf D., Alexander W.S., Nicola N.A. and Willson T . A . (1996) Cloning and characterization of a binding subunit of the interleukin 13 receptor that is also a component of the interleukin 4 receptor. Proc.Natl.Acad.Sci.U.S.A. 93, 497-501. Hirohata S. and Miyamoto T . (1990) Elevated levels of interleukin-6 in cerebrospinal fluid from patients with systemic lupus erythematosus and central nervous system involvement. Arthritis & Rheumatism 33, 644-649. Ho A.S., Liu Y . , Khan T . A . , Hsu D . H . , Bazan J.F. and Moore K . W . (1993) A receptor for interleukin 10 is related to interferon receptors. Proc.Natl.Acad.Sci.U.S.A. 90, 11267-11271. Holmes W . E . , Lee J., Kuang W.J., Rice G . C . and Wood W.I. (1991) Structure and functional expression of a human interleukin-8 receptor. Science 253, 1278-1280. Honda Z., Nakamura M . , Miki I., Minami M . , Watanabe T., Seyama Y . , Okado H . , Toh H . , Ito K. and Miyamoto T. (1991) Cloning by functional expression of platelet-activating factor receptor from guinea-pig lung. Nature 349, 342-346. Hopkins S.J. and Rothwell N.J. (1995) Cytokines and the nervous system. I: Expression and recognition [see comments]. [Review] [71 refs]. Trends in Neurosciences 18, 83-88. Howard M . and OGarra A. (1992) Biological properties of interleukin 10. [Review] [35 refs].  Immunology  Today 13, 198-200. Hsieh C.S., Macatonia S.E., Tripp C.S., Wolf S.F., OGarra A . and Murphy K . M . (1993) Development of TH1 CD4+ T cells through IL-12 produced by Listeria-induced macrophages [see comments]. Science 260, 547-549. Hughes S.M., Lillien L . E . , Raff M . C , Rohrer H . and Sendtner M . (1988) Ciliary neurotrophic factor induces type-2 astrocyte differentiation in culture. Nature 335, 70-73.  154  Hiiltner L . , Moeller J., Schmitt E . , Jager G., Reisbach G., Ring J. and Dormer (1989) Thiol-sensitive mast cell lines derived from mouse bone marrow respond to a mast cell growth-enhancing activity different from both IL-3 and IL-4. Journal of Immunology 142 , 3440-3446. Hunter T . and Karin M . (1992) The regulation of transcription by phosphorylation. [Review] [132 refs]. Cell 70, 375-387. Ihle J.N., Keller J., Oroszlan S., Henderson L . E . , Copeland T.D., Fitch F., Prystowsky M . B . , Goldwasser E . , Schrader J.W., Palaszynski E . , Dy M . and Lebel (1983) Biologic properties of homogeneous interleukin 3.1. Demonstration of WEHI-3 growth factor activity, mast cell growth factor activity, p cell-stimulating factor activity, colony-stimulating factor activity, and histamine-producing cellstimulating factor activity. Journal of Immunology 131, 282-287. Ip N.Y., McClain J., Barrezueta N.X., Aldrich T . H . , Pan L . , L i Y., Wiegand S.J., Friedman B., Davis S. and Yancopoulos G.D. (1993) The alpha component of the C N T F receptor is required for signaling and defines potential C N T F targets in the adult and during development. Neuron 10, 89-102. Ip N.Y., Boulton T . G . , L i Y . , Verdi J.M., Birren S.J., Anderson D.J. and Yancopoulos G.D. (1994) C N T F , F G F , and N G F collaborate to drive the terminal differentiation of M A H cells into postmitotic neurons. Neuron 13, 443-455. Ishii T . and Haga S. (1984) Immuno-electron-microscopic localization of complements in amyloid fibrils of senile plaques. Acta Neuropathologica 63, 296-300. Ishizuka T., Terada N., Gerwins P., Hamelmann E . , Oshiba A., Fanger G.R., Johnson G . L . and Gelfand E . W . (1997) Mast cell tumor necrosis factor alpha production is regulated by M E K kinases. Proceedings of the National Academy of Sciences of the United States of America 94, 6358-6363. Issazadeh S., Ljungdahl A., Hojeberg B., Mustafa M . and Olsson T. (1995) Cytokine production in the central nervous system of Lewis rats with experimental autoimmune encephalomyelitis: dynamics of m R N A expression for interleukin-10, interleukin-12, cytolysin, tumor necrosis factor alpha and tumor necrosis factor beta. Journal of Neuroimmunology 61, 205-212. Itoh N . and Nagata S. (1993) A novel protein domain required for apoptosis. Mutational analysis of human Fas antigen. Journal of Biological Chemistry 268, 10932-10937. Jeftinija S.D., Jeftinija K . V . , Stefanovic G . and Liu F. (1996) Neuroligand-evoked calcium-dependent release of excitatory amino acids from cultured astrocytes. J.Neurochem. 66, 676-684. June C . H . , Bluestone J.A., Nadler L . M . and Thompson C B . (1994) The B7 and CD28 receptor families. [Review] [93 refs]. Immunology Today 15, 321-331. Kahn M . A . and de Vellis J. (1994) Regulation of an oligodendrocyte progenitor cell line by the interleukin-6 family of cytokines. GLIA 12, 87-98. Kalaria R.N. and Perry G . (1993) Amyloid P component and other acute-phase proteins associated with cerebellar A beta-deposits in Alzheimer's disease. Brain Research 631, 151-155. Kamegai M . , Niijima K., Kunishita T., Nishizawa M . , Ogawa M . , Araki M . , Ueki A., Konishi Y . and Tabira T . (1990) Interleukin 3 as a trophic factor for central cholinergic neurons in vitro and in vivo. Neuron 4, 429-436. Kastrukoff L . F . , Morgan N . G . , Zecchini D., White R., Petkau A.J., Satoh J. and Paty D.W. (1998) A role for natural killer cells in the immunopathogenesis of multiple sclerosis. J.Neuroimmunol. 86, 123-133.  155  Kennedy M . K . , Torrance D.S., Picha K.S. and Mohler K . M . (1992) Analysis of cytokine m R N A expression in the central nervous system of mice with experimental autoimmune encephalomyelitis reveals that IL-10 m R N A expression correlates with recovery. Journal of Immunology 149, 2496-2505. Kiefer R., Supler M . L . , Toyka K . V . and Streit W.J. (1994) In situ detection of transforming growth factor-beta m R N A in experimental rat glioma and reactive glial cells. Neuroscience Letters 166, 161-164. Kim S.U., Sato Y . , Silberberg D.H., Pleasure D . E . and Rorke L . B . (1983) Long-term culture of human oligodendrocytes. Isolation, growth and identification. J.Neurol.Sci. 62, 295-301. Kim S.U., Shin D . H . and Paty D.W. (1984) Long term culture of human oligodendrocytes in serum-free chemically defined medium. Prog.Clin.Biol.Res. 146:207-14, 207-214. Kim S.U. (1985) Antigen expression by glial cells grown in culture. Journal of Neuroimmunology 8, 255-282. Kim S.U., Moretto G., Lee V . and Y u R.K. (1986) Neuroimmunology of gangliosides in human neurons and glial cells in culture. J.Neurosci.Res. 15, 303-321. Kim S.U. (1990) Neurobiology of human oligodendrocytes in culture. Journal of Neuroscience Research 27, 712-728. Kishimoto T., Akira S. and Taga T. (1992) Interleukin-6 and its receptor: a paradigm for cytokines. [Review] [63 refs]. Science 258, 593-597. Kishimoto T., Taga T. and Akira S. (1994) Cytokine signal transduction. [Review] [92 refs]. Cell 76, 253-262. Kobayashi M . , Fitz L . , Ryan M . , Hewick R . M . , Clark S . C , Chan S., Loudon R., Sherman F., Perussia B. and Trinchieri G . (1989) Identification and purification of natural killer cell stimulatory factor (NKSF), a cytokine with multiple biologic effects on human lymphocytes. J.Exp.Med. 170, 827-845. Kondo M . , Takeshita T., Ishii N., Nakamura M . , Watanabe S., Arai K. and Sugamura K. (1993) Sharing of the interleukin-2 (IL-2) receptor gamma chain between receptors for IL-2 and IL-4 [see comments]. Science 262, 1874-1877. Konishi Y . , Kamegai M . , Takahashi K., Kunishita T . and Tabira T . (1994) Production of interleukin-3 by murine central nervous system neurons. Neurdsci.Lett. 182, 271-274. Korsching S. (1993) The neurotrophic factor concept: a reexamination. J.Neurosci. 13, 2739-2748. Kotenko S.V., Krause C D . , Izotova L.S., Pollack B.P., Wu W . and Pestka S. (1997) Identification and functional characterization of a second chain of the interleukin-10 receptor complex. EM BO J. 16, 5894-5903. Krakowski M . L . and Owens T. (1997) The central nervous system environment controls effector CD4+ T cell cytokine profile in experimental allergic encephalomyelitis. European Journal of Immunology 27, 2840-2847. Kreutzberg G.W. (1996) Microglia: a sensor for pathological events in the CNS. [Review] [75 refs]. Trends in Neurosciences 19, 312-318. Kyriakis J . M . , Banerjee P., Nikolakaki E . , Dai T., Rubie E . A . , Ahmad M . F . , Avruch J. and Woodgett J.R. (1994) The stress-activated protein kinase subfamily of c-Jun kinases. Nature 369, 156-160.  156  Lapchak P.A., Araujo D . M . , Quirion R. and Beaudet A. (1991) Immunoautoradiographic localization of interleukin 2-like immunoreactivity and interleukin 2 receptors (Tac antigen-like immunoreactivity) in the rat brain. Neuroscience 44, 173-184. LaRosa G.J., Thomas K . M . , Kaufmann M.E., Mark R., White M . , Taylor L . , Gray G., Witt D. and Navarro J. (1992) Amino terminus of the interleukin-8 receptor is a major determinant of receptor subtype specificity. J.Biol.Chem. 267, 25402-25406. Lee J., Horuk R., Rice G.C., Bennett G.L., Camerato T. and Wood W.I. (1992) Characterization of two high affinity human interleukin-8 receptors. J.Biol.Chem. 267, 16283-16287. Lee J.C., Laydon J.T., McDonnell P.C., Gallagher T.F., Kumar S., Green D., McNulty D., Blumenthal M.J., Heys J.R. and Landvatter S.W. (1994) A protein kinase involved in the regulation of inflammatory cytokine biosynthesis. Nature 372, 739-746. Lee J.C. and Young P.R. (1996) Role of CSB/p38/RK stress response kinase in LPS and cytokine signaling mechanisms. [Review] [62 refs]. Journal of Leukocyte Biology 59, 152-157. Lee S . C , Liu W., Dickson D.W., Brosnan C F . and Berman J.W. (1993a) Cytokine production by human fetal microglia and astrocytes. Differential induction by lipopolysaccharide and IL-1 beta. Journal of Immunology 150, 2659-2667. Lee S . C , Dickson D.W., Liu W . and Brosnan C F . (1993b) Induction of nitric oxide synthase activity in human astrocytes by interleukin-1 beta and interferon-gamma. Journal of Neuroimmunology 46, 19-24. Lee S . C , Liu W., Dickson D.W. and Brosnan C F . (1995) In human fetal astrocytes exposure to interleukin-1 beta stimulates acquisition of the GD3+ phenotype and inhibits cell division. Journal of Neurochemistry 64, 1800-1807. Lee Y . B . , Satoh J., Walker D . G . and Kim S.U. (1996) Interleukin-15 gene expression in human astrocytes and microglia in culture. Neuroreport 1, 1062-1066. Lefort S., Vita N., Reeb R., Caput D. and Ferrara P. (1995) IL-13 and IL-4 share signal transduction elements as well as receptor components in TF-1 cells. FEBS Lett. 366, 122-126. Leonard J.P., Waldburger K.E. and Goldman S.J. (1995) Prevention of experimental autoimmune encephalomyelitis by antibodies against interleukin 12. Journal of Experimental Medicine 181, 381386. Leonard J.P., Waldburger K.E. and Goldman S.J. (1996) Regulation of experimental autoimmune encephalomyelitis by interleukin-12. Annals of the New York Academy of Sciences 795, 216-226. Lewis D . B . and Wilson C B . (1990) Gamma-interferon: an immunoregulatory lymphokine with immunotherapeutic potential. Pediatr.Infect.Dis.J. 9, 642-651. Lieberman A.P., Pitha P.M., Shin H.S. and Shin M . L . (1989) Production of tumor necrosis factor and other cytokines by astrocytes stimulated with lipopolysaccharide or a neurotropic virus. Proceedings of the National Academy of Sciences of the United States of America 86, 6348-6352. Lin J.X., Migone T.S., Tsang M . , Friedmann M . , Weatherbee J.A., Zhou L . , Yamauchi A., Bloom E.T., Mietz J. and John S. (1995) The role of shared receptor motifs and common Stat proteins in the generation of cytokine pleiotropy and redundancy by IL-2, IL-4, IL-7, IL-13, and IL-15. Immunity 2, 331-339.  157  Lin L . F . , Mismer D., Lile J.D., Armes L . G . , Butler E.T., Vannice J.L. and Collins F. (1989) Purification, cloning, and expression of ciliary neurotrophic factor (CNTF). Science 246, 1023-1025. Lindholm D., Castren E . , Kiefer R., Zafra F. and Thoenen H . (1992) Transforming growth factor-beta 1 in the rat brain: increase after injury and inhibition of astrocyte proliferation. Journal of Cell Biology 117, 395-400. Ling P., Gately M . K . , Gubler U., Stern A.S., Lin P., Hollfelder K., Su C , Pan Y . C . and Hakimi J. (1995) Human IL-12 p40 homodimer binds to the IL-12 receptor but does not mediate biologic activity. Journal of Immunology 154, 116-127. Liu J., Zhao M . L . , Brosnan C F . and Lee S.C. (1996) Expression of type II nitric oxide synthase in primary human astrocytes and microglia: role of IL-1 beta and IL-1 receptor antagonist. Journal of Immunology 157, 3569-3576. Liu Y . , Wei S.H., Ho A.S., de Waal M . and Moore K.W. (1994) Expression cloning and characterization of a human IL-10 receptor. J.Immunol. 152, 1821-1829. Lodge P.A. and Sriram S. (1996) Regulation of microglial activation by TGF-beta, IL-10, and CSF-1. Journal of Leukocyte Biology 60, 502-508. Lodolce J.P., Boone D.L., Chai S., Swain R.E., Dassopoulos T., Trettin S. and M a A . (1998) IL-15 receptor maintains lymphoid homeostasis by supporting lymphocyte homing and proliferation. Immunity 9, 669-676. Logan A . , Frautschy S.A., Gonzalez A . M . , Sporn M . B . and Baird A . (1992) Enhanced expression of transforming growth factor beta 1 in the rat brain after a localized cerebral injury. Brain Res. 587, 216225. Loo D.T., Copani A . , Pike C.J., Whittemore E.R., Walencewicz A.J. and Cotman C W . (1993) Apoptosis is induced by beta-amyloid in cultured central nervous system neurons. Proceedings of the National Academy of Sciences of the United States of America 90, 7951-7955. Loughlin A.J., Woodroofe M . N . and Cuzner M . L . (1993) Modulation of interferon-gamma-induced major histocompatibility complex class II and Fc receptor expression on isolated microglia by transforming growth factor-beta 1, interleukin-4, noradrenaline and glucocorticoids. Immunology 79, 125-130. Louis J . C , Magal E . , Takayama S. and Varon S. (1993) C N T F protection of oligodendrocytes against natural and tumor necrosis factor-induced death. Science 259, 689-692. Lowenthal J.W., Castle B.E., Christiansen J., Schreurs J., Rennick D., Arai N . , Hoy P., Takebe Y . and Howard M . (1988) Expression of high affinity receptors for murine interleukin 4 (BSF-1) on hemopoietic and nonhemopoietic cells. J.Immunol. 140,456-464. L u C.Z., Jensen M . A . and Arnason B . G . (1993) Interferon gamma- and interleukin-4-secreting cells in multiple sclerosis. Journal of Neuroimmunology 46, 123-128. Luheshi G . , Hopkins S.J., Lefeuvre R.A., Dascombe M.J., Ghiara P., Rothwell and N J (1993) Importance of brain IL-1 type II receptors in fever and thermogenesis in the rat. American Journal of Physiology 265,E585-E591 Lutfalla G., Gardiner K. and Uze G . (1993) A new member of the cytokine receptor gene family maps on chromosome 21 at less than 35 kb from IFNAR. Genomics 16, 366-373.  158  Mackay F., Rothe J., Bluethmann FL, Loetscher H . and Lesslauer W . (1994) Differential responses of fibroblasts from wild-type and TNF-R55-deficient mice to mouse and human TNF-alpha activation. Journal of Immunology 153, 5274-5284. Manetti R., Parronchi P., Giudizi M . G . , Piccinni M.P., Maggi E . , Trinchieri and Romagnani S. (1993) Natural killer cell stimulatory factor (interleukin 12 [IL-12]) induces T helper type 1 (Thl)-specific immune responses and inhibits the development of IL-4-producing Th cells. Journal of Experimental Medicine 177, 1199-1204. Marietta M . A . (1994) Nitric oxide synthase: aspects concerning structure and catalysis. Cell 78, 927-930. Martin D.P., Wallace T . L . and Johnson E.M.J. (1990) Cytosine arabinoside kills postmitotic neurons in a fashion resembling trophic factor deprivation: evidence that a deoxycytidine-dependent process may be required for nerve growth factor signal transduction. J.Neurosci. 10, 184-193. McCarthy K . D . and de Vellis J. (1980) Preparation of separate astroglial and oligodendroglial cell cultures from rat cerebral tissue. J.Cell Biol. 85, 890-902. McGeer P.L., Akiyama H . , Itagaki S. and McGeer E . G . (1989) Activation of the classical complement pathway in brain tissue of Alzheimer patients. Neuroscience Letters 107, 341-346. McGeer P.L., Akiyama H . , Kawamata T., Yamada T., Walker D.G. and Ishii T . (1992) Immunohistochemical localization of beta-amyloid precursor protein sequences in Alzheimer and normal brain tissue by light and electron microscopy. Journal of Neuroscience Research 31, 428-442. McKean D.J., Podzorski R.P., Bell M.P., Nilson A . E . , Huntoon C.J., Slack J., Dower S.K. and Sims J. (1993) Murine T helper cell-2 lymphocytes express type I and type II IL-1 receptors, but only the type I receptor mediates costimulatory activity. J.Immunol. 151, 3500-3510. McKenzie A . N . , Culpepper J.A., de Waal M . , Briere F., Punnonen J., Aversa G., Sato A . , Dang W., Cocks B . G . and Menon S. (1993) Interleukin 13, a T-cell-derived cytokine that regulates human monocyte and B cell function. Proceedings of the National Academy of Sciences of the United States of America 90, 3735-3739. McKinnon R.D., Piras G., Ida J.A.J, and Dubois-Dalcq M . (1993) A role for TGF-beta in oligodendrocyte differentiation. Journal of Cell Biology 121, 1397-1407. McLarnon J.G., Michikawa M . and Kim S.U. (1993) Effects of tumor necrosis factor on inward potassium current and cell morphology in cultured human oligodendrocytes. GLIA 9, 120-126. McLaurin J., DSouza S., Stewart J., Blain M . , Beaudet A., Nalbantoglu J. and Antel J.P. (1995) Effect of tumor necrosis factor alpha and beta on human oligodendrocytes and neurons in culture. Int.J.Dev.Neurosci. 13, 369-381. McMahan C.J., Slack J.L., Mosley B., Cosman D., Lupton S.D., Brunton L . L . , Grubin C . E . , Wignall J . M . , Jenkins N.A. and Brannan C.I. (1991) A novel IL-1 receptor, cloned from B cells by mammalian expression, is expressed in many cell types. EMBO J. 10, 2821-2832. Mehler M . F . , Rozental R., Dougherty M . , Spray D.C. and Kessler J.A. (1993) Cytokine regulation of neuronal differentiation of hippocampal progenitor cells. Nature 362, 62-65. Mehler M . F . and Kessler J.A. (1997) Hematolymphopoietic and inflammatory cytokines in neural development. Trends Neurosci. 20, 357-365.  159  Merrill J.E. (1991) Effects of interleukin-1 and tumor necrosis factor-alpha on astrocytes, microglia, oligodendrocytes, and glial precursors in vitro. Dev.Neurosci. 13, 130-137. Merrill J.E., Ignarro L.J., Sherman M.P., Melinek J. and Lane T . E . (1993) Microglial cell cytotoxicity of oligodendrocytes is mediated through nitric oxide. Journal of Immunology 151, 2132-2141. Metcalf D., Cutler R.L. and Nicola N . A . (1983) Selective stimulation by mouse spleen cell conditioned medium of human eosinophil colony formation. Blood 61, 999-1005. Michaelson M . D . , Mehler M . F . , X u H . , Gross R.E. and Kessler J.A. (1996) Interleukin-7 is trophic for embryonic neurons and is expressed in developing brain. Developmental Biology 179, 251-263. Minty A., Chalon P., Derocq J . M . , Dumont X., Guillemot J.C., Kaghad M . , Labit C , Leplatois P., Liauzun P. and Miloux B. (1993) Interleukin-13 is a new human lymphokine regulating inflammatory and immune responses. Nature 362, 248-250. Miralles F., Parra M . , Caelles C , Nagamine Y . , Felez J. and Munoz-Canoves P. (1998) U V irradiation induces the murine urokinase-type plasminogen activator gene via the c-Jun N-terminal kinase signaling pathway: requirement of an A P I enhancer element. Molecular & Cellular Biology 18, 4537-4547. Miyajima A., Mui A . L . , Ogorochi T. and Sakamaki K. (1993) Receptors for granulocyte-macrophage colonystimulating factor, interleukin-3, and interleukin-5. [Review] [180 refs]. Blood 82, 1960-1974. Mizuno T., Sawada M . , Marunouchi T . and Suzumura A. (1994) Production of interleukin-10 by mouse glial cells in culture. Biochemical & Biophysical Research Communications 205, 1907-1915. Mohler K . M . , Torrance D.S., Smith C.A., Goodwin R.G., Stremler K . E . , Fung V.P., Madani H . and Widmer M . B . (1993) Soluble tumor necrosis factor (TNF) receptors are effective therapeutic agents in lethal endotoxemia and function simultaneously as both T N F carriers and T N F antagonists. Journal of Immunology 151, 1548-1561. Mokhtarian F., Shi Y . , Shirazian D., Morgante L . , Miller A. and Grob D. (1994) Defective production of antiinflammatory cytokine, TGF-beta by T cell lines of patients with active multiple sclerosis. Journal of Immunology 152, 6003-6010. Moncada S., Palmer R . M . and Higgs E . A . (1991) Nitric oxide: physiology, pathophysiology, and pharmacology. Pharmacol.Rev. 43, 109-142. Mondino A . and Jenkins M . K . (1994) Surface proteins involved in T cell costimulation. [Review] [106 refs]. Journal of Leukocyte Biology 55, 805-815. Moore K . W . , OGarra A., de Waal M . , Vieira P. and Mosmann T.R. (1993) Interleukin-10. Annu.Rev.Immunol. 11:165-90, 165-190. Moretto G., Yoo A . and Kim S.U. (1993) Human astrocytes and cytokines: tumor necrosis factor alpha and interferon gamma do not promote astrocytic proliferation. Neurosci.Lett. 151, 17-20. Moretto G., X u R.Y., Walker D . G . and Kim S.U. (1994) Co-expression of m R N A for neurotrophic factors in human neurons and glial cells in culture. J.Neuropathol.Exp.Neurol. 53, 78-85. Morgan T . E . , Nichols N.R., Pasinetti G . M . and Finch C . E . (1993) TGF-beta 1 m R N A increases in macrophage/microglial cells of the hippocampus in response to deafferentation and kainic acid-induced neurodegeneration. Exp.Neurol. 120,291-301.  160  Morganti-Kossmann M . C , Kossmann T. and Wahl S.M. (1992) Cytokines and neuropathology. [Review] [49 refs]. Trends in Pharmacological Sciences 13, 286-291. Morohashi H . , Miyawaki T., Nomura H . , Kuno K., Murakami S., Matsushima K. and Mukaida N . (1995) Expression of both types of human interleukin-8 receptors on mature neutrophils, monocytes, and natural killer cells. J.Leukoc.Biol. 57, 180-187. Moser B., Schumacher C , von Tscharner V., Clark-Lewis I. and Baggiolini M . (1991) Neutrophil-activating peptide 2 and gro/melanoma growth-stimulatory activity interact with neutrophil-activating peptide 1/interleukin 8 receptors on human neutrophils. J.Biol.Chem. 266, 10666-10671. Mosmann T.R. and Sad S. (1996) The expanding universe of T-cell subsets: T h l , Th2 and more [see comments]. Immunol.Today 17, 138-146. Murata T., Taguchi J. and Puri R.K. (1998) Interleukin-13 receptor alpha' but not alpha chain: a functional component of interleukin-4 receptors. Blood 91, 3884-3891. Murphy G.M.J., Song Y . , Ong E . , Lee Y . L . , Schmidt K . G . , Bocchini V . and Eng L . F . (1995a) Leukemia inhibitory factor m R N A is expressed in cortical astrocyte cultures but not in an immortalized microglial cell line. Neuroscience Letters 184, 48-51. Murphy G.M.J., Bitting L . , Majewska A., Schmidt K., Song Y . and Wood C.R. (1995b) Expression of interleukin-11 and its encoding mRNA by glioblastoma cells. Neuroscience Letters 196, 153-156. Murphy M . , Reid K., Hilton D.J. and Bartlett P.F. (1991) Generation of sensory neurons is stimulated by leukemia inhibitory factor. Proc.Natl.Acad.Sci.U.S.A. 88, 3498-3501. Murphy P . M . and Tiffany H.L. (1991) Cloning of complementary D N A encoding a functional human interleukin-8 receptor. Science 253, 1280-1283. Murphy S., Simmons M . L . , Agullo L . , Garcia A., Feinstein D.L., Galea E . , Reis D.J., Minc-Golomb D. and Schwartz J.P. (1993) Synthesis of nitric oxide in CNS glial cells [see comments]. [Review] [67 refs]. Trends in Neurosciences 16, 323-328. Namba Y . , Tomonaga M . , Kawasaki H . , Otomo E . and Ikeda K. (1991) Apolipoprotein E immunoreactivity in cerebral amyloid deposits and neurofibrillary tangles in Alzheimer's disease and kuru plaque amyloid in Creutzfeldt-Jakob disease. Brain Research 541, 163-166. Navikas V . , Link J., Palasik W., Soderstrom M . , Fredrikson S., Olsson T. and Link H . (1995) Increased mRNA expression of IL-10 in mononuclear cells in multiple sclerosis and optic neuritis. Scandinavian Journal of Immunology Al, 171-178. Norris J.G. and Benveniste E . N . (1993) Interleukin-6 production by astrocytes: induction by the neurotransmitter norepinephrine. Journal of Neuroimmunology 45, 137-145. Nussler A . K . , D i Silvio M . , Liu Z.Z., Geller D.A., Freeswick P., Dorko K., Bartoli F. and Billiar T.R. (1995) Further characterization and comparison of inducible nitric oxide synthase in mouse, rat, and human hepatocytes. Hepatology 21, 1552-1560. Obiri N.I., Debinski W . , Leonard W.J. and Puri R.K. (1995) Receptor for interleukin 13. Interaction with interleukin 4 by a mechanism that does not involve the common gamma chain shared by receptors for interleukins 2, 4, 7, 9, and 15. J.Biol.Chem. 270, 8797-8804.  161  Ogawa H . , Sato Y . , Takeshita I., Tateishi J. and Kitamura K. (1985) Transient expression of glial fibrillary acidic protein in developing oligodendrocytes in vitro. Brain Research 350, 133-141. Olsson T., Sun J., Hillert J., Hojeberg B., Ekre H.P., Andersson G., Olerup and Link H . (1992) Increased numbers of T cells recognizing multiple myelin basic protein epitopes in multiple sclerosis. European Journal of Immunology 22, 1083-1087. Olsson T . (1995) Critical influences of the cytokine orchestration on the outcome of myelin antigen-specific T cell autoimmunity in experimental autoimmune encephalomyelitis and multiple sclerosis. [Review] [169 refs]. Immunological Reviews 144, 245-268. Orchansky P.L., Ayres S.D., Hilton D.J. and Schrader J.W. (1997) A n interleukin (IL)-13 receptor lacking the cytoplasmic domain fails to transduce IL-13-induced signals and inhibits responses to IL-4. J.BiolChem. 272, 22940-22947. Otero G.C. and Merrill J.E. (1994) Cytokine receptors on glial cells. [Review] [130 refs]. GLIA 11, 117-128. Otero G . C . and Merrill J.E. (1995) Molecular cloning of IL-2R alpha, IL-2R beta, and IL-2R gamma cDNAs from a human oligodendroglioma cell line: presence of IL-2R mRNAs in the human central nervous system. GLIA 14, 295-302. Pain V . M . (1996) Initiation of protein synthesis in eukaryotic cells. Eur. J.Biochem. 236, 747-771. Parpura V . , Basarsky T . A . , Liu F., Jeftinija K., Jeftinija S. and Haydon P.G. (1994) Glutamate-mediated astrocyte-neuron signalling [see comments]. Nature 369, 744-747. Patterson P.H. (1992) The emerging neuropoietic cytokine family: first CDF/LIF, C N T F and IL- 6; next O N C , M G F , GCSF? Curr.Opin.Neurobiol. 2, 94-97. Patterson P.H. (1995) Cytokines in Alzheimer's disease and multiple sclerosis. Curr.Opin.Neurobiol. 5, 642646. Paul S.R., Bennett F., Calvetti J.A., Kelleher K., Wood C.R., OHara R . M . , Jr., Leary A . C . , Sibley B., Clark S.C. and Williams D.A. (1990) Molecular cloning of a c D N A encoding interleukin 11, a stromal cellderived lymphopoietic and hematopoietic cytokine. Proceedings of the National Academy of Sciences of the United States of America 87, 7512-7516. Pause A., Belsham G.J., Gingras A . C . , Donze O., Lin T.A., Lawrence J.C., Jr. and Sonenberg N . (1994) Insulindependent stimulation of protein synthesis by phosphorylation of a regulator of 5'-cap function [see comments]. Nature 371, 762-767. Perry V . H . , Hume D.A. and Gordon S. (1985) Immunohistochemical localization of macrophages and microglia in the adult and developing mouse brain. Neuroscience 15, 313-326. Peschon J.J., Torrance D.S., Stocking K . L . , Glaccum M . B . , Otten C , Willis C.R., Charrier K., Morrissey P.J., Ware C B . and Mohler K . M . (1998) T N F receptor-deficient mice reveal divergent roles for p55 and p75 in several models of inflammation. Journal of Immunology 160, 943-952. Petitto J . M . and Huang Z. (1994) Molecular cloning of a partial c D N A of the interleukin-2 receptor-beta in normal mouse brain: in situ localization in the hippocampus and expression by neuroblastoma cells. Brain Research 650, 140-145.  162  Petitto J . M . , Huang Z., Raizada M . K . , Rinker C M . and McCarthy D.B. (1998) Molecular cloning of the c D N A coding sequence of IL-2 receptor-gamma (gammac) from human and murine forebrain: expression in the hippocampus in situ and by brain cells in vitro. Brain Res.Mol.Brain Res. 53, 152-162. Presky D . H . , Yang H . , Minetti L.J., Chua A . O . , Nabavi N . , Wu C . Y . , Gately M . K . and Gubler U . (1996) A functional interleukin 12 receptor complex is composed of two beta- type cytokine receptor subunits. Proc.Natl.Acad.Sci.U.S.A. 93, 14002-14007. Racke M . K . , Bonomo A., Scott D.E., Cannella B., Levine A., Raine C.S., Shevach E . M . and Rocken M . (1994) Cytokine-induced immune deviation as a therapy for inflammatory autoimmune disease. Journal of Experimental Medicine 180, 1961-1966. Raff M . C , Abney E.R. and Miller R.H. (1984) Two glial cell lineages diverge prenatally in rat optic nerve. Developmental Biology 106, 53-60. Raff M . C , Lillien L . E . , Richardson W.D., Burne J.F. and Noble M . D . (1988) Platelet-derived growth factor from astrocytes drives the clock that times oligodendrocyte development in culture. Nature 333, 562565. Raingeaud J., Gupta S., Rogers J.S., Dickens M . , Han J., Ulevitch R.J. and Davis R.J. (1995) Pro-inflammatory cytokines and environmental stress cause p38 mitogen-activated protein kinase activation by dual phosphorylation on tyrosine and threonine. Journal of Biological Chemistry 270, 7420-7426. Rao M.S., Sun Y . , Escary J.L., Perreau J., Tresser S., Patterson P.H., Zigmond R.E., Brulet P. and Landis S.C. (1993) Leukemia inhibitory factor mediates an injury response but not a target- directed developmental transmitter switch in sympathetic neurons. Neuron 11, 1175-1185. Re F., Muzio M . , De Rossi M . , Polentarutti N . , Giri J.G., Mantovani A . and Colotta F. (1994) The type II "receptor" as a decoy target for interleukin 1 in polymorphonuclear leukocytes: characterization of induction by dexamethasone and ligand binding properties of the released decoy receptor. J.Exp.Med. 179, 739-743. Relton J.K. and Rothwell N.J. (1992) Interleukin-1 receptor antagonist inhibits ischaemic and excitotoxic neuronal damage in the rat. Brain Research Bulletin 29, 243-246. Rennick D., Jackson J., Moulds C , Lee F. and Yang G. (1989) IL-3 and stromal cell-derived factor synergistically stimulate the growth of pre-B cell lines cloned from long-term lymphoid bone marrow cultures. Journal of Immunology 142, 161-166. Reynolds B.A., Tetzlaff W . and Weiss S. (1992) A multipotent EGF-responsive striatal embryonic progenitor cell produces neurons and astrocytes. Journal of Neuroscience 12, 4565-4574. Ridet J.L., Malhotra S.K., Privat A . and Gage F . H . (1997) Reactive astrocytes: cellular and molecular cues to biological function [published erratum appears in Trends Neurosci 1998 Feb;21(2):80]. Trends Neurosci. 20, 570-577. Rieckmann P., Albrecht M . , Kitze B., Weber T., Tumani H., Broocks A., Luer and Poser S. (1994) Cytokine m R N A levels in mononuclear blood cells from patients with multiple sclerosis. Neurology 44, 15231526. Rieckmann P., Michel U . , Albrecht M . , Bruck W., Wockel L . and Felgenhauer K. (1995) Soluble forms of intercellular adhesion molecule-1 (ICAM-1) block lymphocyte attachment to cerebral endothelial cells. Journal of Neuroimmunology 60, 9-15.  163  Righi M . , Mori L . , De Libera G., Sironi M . , Biondi A., Mantovani A . , Donini S.D. and Ricciardi-Castagnoli P. (1989) Monokine production by microglial cell clones. European Journal of Immunology 19, 14431448. Rincon M . Enslen H., Raingeaud J., Recht M . , Zapton T., Su M.S., Penix L . A . , Davis R.J. and Flavell R.A. (1998) Interferon-gamma expression by T h l effector T cells mediated by the p38 M A P kinase signaling pathway. EMBO Journal 17, 2817-2829. (  Rogge L . , Barberis-Maino L . , Biffi M . , Passini N . , Presky D.H., Gubler U . and Sinigaglia F. (1997) Selective expression of an interleukin-12 receptor component by human T helper 1 cells. J.Exp.Med. 185, 825831. Rogister B., Delree P., Leprince P., Martin D., Sadzot C., Malgrange B., Munaut C., Rigo J . M . , Lefebvre P.P. and Octave J.N. (1993) Transforming growth factor beta as a neuronoglial signal during peripheral nervous system response to injury. Journal of Neuroscience Research 34, 32-43. Rothe J., Mackay F., Bluethmann H . , Zinkernagel R. and Lesslauer W . (1994) Phenotypic analysis of T N F R 1 deficient mice and characterization of TNFRI-deficient fibroblasts in vitro. Circulatory Shock 44, 5156. Rott O., Fleischer B. and Cash E . (1994) Interleukin-10 prevents experimental allergic encephalomyelitis in rats. European Journal of Immunology 24, 1434-1440. Rubio N . (1994) Demonstration of the presence of an interleukin-1 receptor on the surface of murine astrocytes and its regulation by cytokines and Theiler's virus. Immunology 82 , 178-183. Rudge J.S., Morrissey D., Lindsay R . M . and Pasnikowski E . M . (1994) Regulation of ciliary neurotrophic factor in cultured rat hippocampal astrocytes. Eur.J.Neurosci. 6, 218-229. Russell S.M., Keegan A . D . , Harada N., Nakamura Y . , Noguchi M . , Leland P., Friedmann M . C . , Miyajima A., Puri R.K. and Paul W . E . (1993) Interleukin-2 receptor gamma chain: a functional component of the interleukin-4 receptor [see comments]. Science 262, 1880-1883. Salbaum J . M . , Weidemann A., Lemaire H.G., Masters C L . and Beyreuther K. (1988) The promoter of Alzheimer's disease amyloid A4 precursor gene. EMBO Journal 7, 2807-2813. Sands W . A . , Bulut V . , Severn A., X u D. and Liew F . Y . (1994) Inhibition of nitric oxide synthesis by interleukin-4 may involve inhibiting the activation of protein kinase C epsilon. Eur. J.Immunol. 24, 2345-2350. Santambrogio L . , Hochwald G . M . , Saxena B., Leu C . H . , Martz J.E., Carlino J.A., Ruddle N.H., Palladino M . A . , Gold L.I. and Thorbecke G.J. (1993) Studies on the mechanisms by which transforming growth factorbeta (TGF-beta) protects against allergic encephalomyelitis. Antagonism between TGF-beta and tumor necrosis factor. Journal of Immunology 151, 1116-1127. Santambrogio L . , Crisi G . M . , Leu J., Hochwald G . M . , Ryan T. and Thorbecke G.J. (1995) Tolerogenic forms of auto-antigens and cytokines in the induction of resistance to experimental allergic encephalomyelitis. Journal of Neuroimmunology 58, 211-222. Satoh J., Kastrukoff L . F . and Kim S.U. (1991a) Cytokine-induced expression of intercellular adhesion molecule1 (ICAM-1) in cultured human oligodendrocytes and astrocytes. Journal of Neuropathology & Experimental Neurology 50, 215-226.  164  Satoh J., Kim S.U., Kastrukoff L . F . and Takei F. (1991b) Expression and induction of intercellular adhesion molecules (ICAMs) and major histocompatibility complex (MHC) antigens on cultured murine oligodendrocytes and astrocytes. Journal of Neuroscience Research 29, 1-12. Satoh J. and Kim S.U. (1994) HSP72 induction by heat stress in human neurons and glial cells in culture. Brain Res. 653, 243-250. Satoh J., Lee Y . B . and Kim S.U. (1995) T-cell costimulatory molecules B7-1 (CD80) and B7-2 (CD86) are expressed in human microglia but not in astrocytes in culture. Brain Research 704, 92-96. Satoh T., Nakamura S., Taga T., Matsuda T., Hirano T., Kishimoto T . and Kaziro Y . (1988) Induction of neuronal differentiation in PC12 cells by B-cell stimulatory factor 2/interleukin 6. Molecular & Cellular Biology 8, 3546-3549. Sawada M . , Suzumura A , and Marunouchi T. (1992) T N F alpha induces IL-6 production by astrocytes but not by microglia. Brain Research 583, 296-299. Sawada M . , Suzumura A . , Itoh Y . and Marunouchi T . (1993a) Production of interleukin-5 by mouse astrocytes and microglia in culture. Neuroscience Letters 155, 175-178. Sawada M . , Itoh Y . , Suzumura A . and Marunouchi T. (1993b) Expression of cytokine receptors in cultured neuronal and glial cells. Neuroscience Letters 160, 131-134. Sawada M . , Suzumura A . and Marunouchi T. (1995) Induction of functional interleukin-2 receptor in mouse microglia. Journal of Neurochemistry 64, 1973-1979. Schaar D . G . , Sieber B.A., Sherwood A . C . , Dean D., Mendoza G., Ramakrishnan L . , Dreyfus C.F. and Black L B . (1994) Multiple astrocyte transcripts encode nigral trophic factors in rat and human. Exp.Neurol. 130, 387-393. Schluesener H.J. (1990) Transforming growth factors type beta 1 and beta 2 suppress rat astrocyte autoantigen presentation and antagonize hyperinduction of class II major histocompatibility complex antigen expression by interferon-gamma and tumor necrosis factor-alpha. Journal of Neuroimmunology 27, 41-47. Schrader J.W., Battye F. and Scollay R. (1982) Expression of Thy-1 antigen is not limited to T cells in cultures of mouse hemopoietic cells. Proceedings of the National Academy of Sciences of the United States of America 79, 4161-4165. Sedgwick J.D., Schwender S., Imrich H . , Dorries R., Butcher G.W. and Ter Meulen V . (1991) Isolation and direct characterization of resident microglial cells from the normal and inflamed central nervous system. Proc.Natl.Acad.Sci.U.S.A. 88,7438-7442. Selmaj K. and Raine C.S. (1988) Tumor necrosis factor mediates myelin damage in organotypic cultures of nervous tissue. Annals of the New York Academy of Sciences 540, 568-570. Selmaj K . W . , Farooq M . , Norton W.T., Raine C.S. and Brosnan C.F. (1990) Proliferation of astrocytes in vitro in response to cytokines. A primary role for tumor necrosis factor. Journal of Immunology 144, 129135. Selmaj K., Raine C.S. and Cross A . H . (1991a) Anti-tumor necrosis factor therapy abrogates autoimmune demyelination. Annals of Neurology 30, 694-700.  165  Selmaj K., Shafit-Zagardo B., Aquino D.A., Farooq M . , Raine C.S., Norton W . T . and Brosnan C F . (1991b) Tumor necrosis factor-induced proliferation of astrocytes from mature brain is associated with downregulation of glial fibrillary acidic protein mRNA. Journal of Neurochemistry 57, 823-830. Seniuk N.A., Henderson J.T., Tatton W . G . and Roder J . C (1994) Increased C N T F gene expression in processbearing astrocytes following injury is augmented by R(-)-deprenyl. J.Neurosci.Res. 37, 278-286. Shakhov A . N . , Collart M . A . , Vassalli P., Nedospasov S.A. and Jongeneel C V . (1990) Kappa B-type enhancers are involved in lipopolysaccharide-mediated transcriptional activation of the tumor necrosis factor alpha gene in primary macrophages. Journal of Experimental Medicine 171, 35-47. Shankar V . , Kao M . , Hamir A . N . , Sheng H . , Koprowski H . and Dietzschold B. (1992) Kinetics of virus spread and changes in levels of several cytokine mRNAs in the brain after intranasal infection of rats with Borna disease virus. J.Virol. 66, 992-998. Sharief M . K . and Thompson E.J. (1992a) In vivo relationship of tumor necrosis factor-alpha to blood-brain barrier damage in patients with active multiple sclerosis. Journal of Neuroimmunology 38, 27-33. Sharief M . K . , Ciardi M . and Thompson E.J. (1992b) Blood-brain barrier damage in patients with bacterial meningitis: association with tumor necrosis factor-alpha but not interleukin-1 beta. Journal of Infectious Diseases 166, 350-358. Shimojo M . , Imai Y . , Nakajima K., Mizushima S., Uemura A . and Kohsaka S. (1993) Interleukin-2 enhances the viability of primary cultured rat neocortical neurons. Neurosci.Lett. 151, 170-173. Silberstein F . C , De Simone R., Levi G . and Aloisi F. (1996) Cytokine-regulated expression of platelet-derived growth factor gene and protein in cultured human astrocytes. J.Neurochem. 66, 1409-1417. Simmons M . L . and Murphy S. (1993) Cytokines regulate L-arginine-dependent cyclic G M P production in rat glial cells. European Journal of Neuroscience 5, 825-831. Sims J.E., March C.J., Cosman D., Widmer M . B . , MacDonald H.R., McMahan C.J., Grubin C . E . , Wignall J . M . , Jackson J.L. and Call S.M. (1988) c D N A expression cloning of the IL-1 receptor, a member of the immunoglobulin superfamily. Science 241, 585-589. Sims J.E., Acres R.B., Grubin C . E . , McMahan C.J., Wignall J.M., March C J . and Dower S.K. (1989) Cloning the interleukin 1 receptor from human T cells. Proceedings of the National Academy of Sciences of the United States of America 86, 8946-8950. Sims J.E., Gayle M . A . , Slack J.L., Alderson M.R., Bird T.A., Giri J.G., Colotta, Re F., Mantovani A . and Shanebeck K. (1993) Interleukin 1 signaling occurs exclusively via the type I receptor. Proceedings of the National Academy of Sciences of the United States of America 90, 6155-6159. Sirenko O.I., Lofquist A . K . , DeMaria C.T., Morris J.S., Brewer G . and Haskill J.S. (1997) Adhesion-dependent regulation of an A+U-rich element-binding activity associated with A U F 1 . Molecular & Cellular Biology 17, 3898-3906. Skundric D.S., Bealmear B. and Lisak R.P. (1997) Induced upregulation of IL-1, IL-1RA and IL-1R type I gene expression by Schwann cells. J.Neuroimmunol. 74, 9-18. Smith C.A., Farrah T . and Goodwin R.G. (1994) The T N F receptor superfamily of cellular and viral proteins: activation, costimulation, and death. [Review] [26 refs]. Cell 76, 959-962.  166  Snijders A . , Hilkens C M . , van der Pouw Kraan T C , Engel M . , Aarden L . A . and Kapsenberg M . L . (1996) Regulation of bioactive IL-12 production in lipopolysaccharide-stimulated human monocytes is determined by the expression of the p35 subunit. Journal of Immunology 156, 1207-1212. Snow A . D . , Willmer J. and Kisilevsky R. (1987) Sulfated glycosaminoglycans: a common constituent of all amyloids? Laboratory Investigation 56, 120-123. Sobel R.A., Mitchell M . E . and Fondren G . (1990) Intercellular adhesion molecule-1 (ICAM-1) in cellular immune reactions in the human central nervous system. American Journal of Pathology 136, 13091316. Soderstrom M . , Hillert J., Link J., Navikas V . , Fredrikson S. and Link H . (1995) Expression of IFN-gamma, IL4, and TGF-beta in multiple sclerosis in relation to HLA-Dw2 phenotype and stage of disease. Multiple Sclerosis 1, 173-180. Sonenberg N . and Gingras A . C (1998) The mRNA 5'cap-binding protein eIF4E and control of cell growth. [Review] [75 refs]. Current Opinion in Cell Biology 10, 268-275. Sprang S.R. (1990) The divergent receptors for T N F . [Review] [19 refs]. Trends in Biochemical Sciences 15, 366-368. Stalder A . K . , Pagenstecher A., Y u N.C., Kincaid C , Chiang C.S., Hobbs M . V . , Bloom F . E . and Campbell I.L. (1997) Lipopolysaccharide-induced IL-12 expression in the central nervous system and cultured astrocytes and microglia. Journal of Immunology 159, 1344-1351. Strauss S., Bauer J., Ganter U., Jonas U . , Berger M . and Volk B. (1992) Detection of interleukin-6 and alpha 2macroglobulin immunoreactivity in cortex and hippocampus of Alzheimer's disease patients. Laboratory Investigation 66, 223-230. Streit W.J., Graeber M . B . and Kreutzberg G.W. (1988) Functional plasticity of microglia: a review. [Review] [57 refs]. GLIA 1,301-307. Stuehr D.J. and Nathan C.F. (1989) Nitric oxide. A macrophage product responsible for cytostasis and respiratory inhibition in tumor target cells. J.Exp.Med. 169, 1543-1555. Stylianou E . , O'Neill L . A . , Rawlinson L . , Edbrooke M.R., Woo P. and Saklatvala J. (1992) Interleukin 1 induces NF-kappa B through its type I but not its type II receptor in lymphocytes. J.Biol.Chem. 267, 1583615841. Sun J.B., Olsson T „ Wang W.Z., Xiao B . G . , Kostulas V . , Fredrikson S., Ekre, HP and Link H . (1991) Autoreactive T and B cells responding to myelin proteolipid protein in multiple sclerosis and controls. European Journal of Immunology 21, 1461-1468. Suzumura A., Mezitis S.G., Gonatas N.K. and Silberberg D . H . (1987) M H C antigen expression on bulk isolated macrophage-microglia from newborn mouse brain: induction of la antigen expression by gammainterferon. Journal of Neuroimmunology 15, 263-278. Suzumura A . , Sawada M . , Yamamoto H . and Marunouchi T . (1993) Transforming growth factor-beta suppresses activation and proliferation of microglia in vitro. Journal of Immunology 151, 2150-2158. Suzumura A., Sawada M . , Itoh Y . and Marunouchi T . (1994) Interleukin-4 induces proliferation and activation of microglia but suppresses their induction of class II major histocompatibility complex antigen expression. Journal of Neuroimmunology 53, 209-218.  167  Swantek J.L., Cobb M . H . and Geppert T.D. (1997) Jun N-terminal kinase/stress-activated protein kinase (JNK/SAPK) is required for lipopolysaccharide stimulation of tumor necrosis factor alpha (TNF-alpha) translation: glucocorticoids inhibit TNF-alpha translation by blocking J N K / S A P K . Molecular & Cellular Biology 17, 6274-6282. Szabo S.J., Dighe A.S., Gubler U . and Murphy K . M . (1997) Regulation of the interleukin (IL)-12R beta 2 subunit expression in developing T helper 1 (Thl) and Th2 cells. J.Exp.Med. 185, 817-824. Tada M . , Diserens A . C . , Desbaillets I. and de Tribolet N . (1994) Analysis of cytokine receptor messenger R N A expression in human glioblastoma cells and normal astrocytes by reverse-transcription polymerase chain reaction. Journal of Neurosurgery 80, 1063-1073. Taga T. and Kishimoto T. (1995) Signaling mechanisms through cytokine receptors that share signal transducing receptor components. Curr.Opin.Immunol. 1', 17-23. Taga T . (1996) Gpl30, a shared signal transducing receptor component for hematopoietic and neuropoietic cytokines. [Review] [90 refs]. Journal of Neurochemistry 67', 1-10. Takao T., Tracey D.E., Mitchell W . M . and De Souza E.B. (1990) Interleukin-1 receptors in mouse brain: characterization and neuronal localization. Endocrinology 127, 3070-3078. Taniguchi T. and Minami Y . (1993) The IL-2/TL-2 receptor system: a current overview. [Review] [33 refs]. Cell 73, 5-8. Tanzi R . E . , Bush A.I. and Wasco W . (1994) Genetic studies of Alzheimer's disease: lessons learned and future imperatives. [Review] [28 refs]. Neurobiology of Aging 15 Suppl 2, S145-S148 Tartaglia L . A . , Weber R.F., Figari I.S., Reynolds C , Palladino M . A . , Jr. and Goeddel D . V . (1991) The two different receptors for tumor necrosis factor mediate distinct cellular responses. Proceedings of the National Academy of Sciences of the United States of America 88, 9292-9296. Tartaglia L . A . and Goeddel D . V . (1992a) Two T N F receptors. [Review] [30 refs]. Immunology Today 13 , 151153. Tartaglia L . A . and Goeddel D.V. (1992b) Tumor necrosis factor receptor signaling. A dominant negative mutation suppresses the activation of the 55-kDa tumor necrosis factor receptor. Journal of Biological Chemistry 267, 4304-4307. Tartaglia L . A . , Ayres T . M . , Wong G . H . and Goeddel D.V. (1993a) A novel domain within the 55 kd T N F receptor signals cell death. Cell 74, 845-853. Tartaglia L . A . , Goeddel D.V., Reynolds C , Figari I.S., Weber R.F., Fendly B . M . and Palladino M . A . , Jr. (1993b) Stimulation of human T-cell proliferation by specific activation of the 75-kDa tumor necrosis factor receptor. Journal of Immunology 151, 4637-4641. Tartaglia L . A . , Pennica D. and Goeddel D . V . (1993c) Ligand passing: the 75-kDa tumor necrosis factor (TNF) receptor recruits T N F for signaling by the 55-kDa T N F receptor. Journal of Biological Chemistry 268, 18542-18548. Tartaglia L . A . , Rothe M . , Hu Y . F . and Goeddel D.V. (1993d) Tumor necrosis factor's cytotoxic activity is signaled by the p55 T N F receptor. [Review] [16 refs]. Cell 73, 213-216.  168  Tchelingerian J.L., Monge M . , Le Saux F., Zalc B. and Jacque C. (1995) Differential oligodendroglial expression of the tumor necrosis factor receptors in vivo and in vitro. Journal of Neurochemistry 65, 2377-2380. Traugott U., Reinherz E . L . and Raine C.S. (1983) Multiple sclerosis. Distribution of T cells, T cell subsets and la-positive macrophages in lesions of different ages. Journal of Neuroimmunology 4, 201-221. Trinchieri G . (1995) Interleukin-12: a proinflammatory cytokine with immunoregulatory functions that bridge innate resistance and antigen-specific adaptive immunity. Annu.Rev.Immunol. 13:251-76, 251-276. Tyor W.R., Glass J.D., Griffin J.W., Becker P.S., McArthur J.C., Bezman L . and Griffin D . E . (1992) Cytokine expression in the brain during the acquired immunodeficiency syndrome. Ann.Neurol. 31, 349-360. Uyttenhove C , Simpson R.J. and Van Snick J. (1988) Functional and structural characterization of P40, a mouse glycoprotein with T-cell growth factor activity. Proceedings of the National Academy of Sciences of the United States of America 85, 6934-6938. Vassalli P. (1992) The pathophysiology of tumor necrosis factors. [Review] [218 refs]. Annual Review of Immunology 10, 411-452. Vodovotz Y . , Bogdan C , Paik J., Xie Q.W. and Nathan C. (1993) Mechanisms of suppression of macrophage nitric oxide release by transforming growth factor beta. Journal of Experimental Medicine 178, 605613. Walker D.G., Kim S.U. and McGeer P.L. (1995) Complement and cytokine gene expression in cultured microglial derived from postmortem human brains. Journal of Neuroscience Research 40, 478-493. Wang X . , Flynn A., Waskiewicz A.J., Webb B.L., Vries R.G., Baines I.A., Cooper, JA and Proud C . G . (1998) The phosphorylation of eukaryotic initiation factor eIF4E in response to phorbol esters, cell stresses, and cytokines is mediated by distinct M A P kinase pathways. Journal of Biological Chemistry 273, 9373-9377. Watanabe D., Yoshimura R., Khalil M . , Yoshida K., Kishimoto T., Taga T. and Kiyama H . (1996) Characteristic localization of gpl30 (the signal-transducing receptor component used in common for IL-6/IL-11/CNTF/LIF/OSM) in the rat brain. European Journal of Neuroscience 8, 1630-1640. Wesselborg S., Bauer M . A . , Vogt M . , Schmitz M . L . and Schulze-Osthoff K. (1997) Activation of transcription factor NF-kappaB and p38 mitogen-activated protein kinase is mediated by distinct and separate stress effector pathways. Journal of Biological Chemistry 272, 12422-12429. Wiegmann K., Schutze S., Machleidt T., Witte D. and Kronke M . (1994) Functional dichotomy of neutral and acidic sphingomyelinases in tumor necrosis factor signaling. Cell 78, 1005-1015. Williams K., Ulvestad E . and Antel J.P. (1994) B7/BB-1 antigen expression on adult human microglia studied in vitro and in situ. European Journal of Immunology 24, 3031-3037. Williams K., Dooley N., Ulvestad E . , Becher B. and Antel J.P. (1996) IL-10 production by adult human derived microglial cells. Neurochemistry International 29, 55-64. Wilt S.G., Milward E . , Zhou J . M . , Nagasato K., Patton H . , Rusten R., Griffin, De, O'Connor M . and DuboisDalcq M . (1995) In vitro evidence for a dual role of tumor necrosis factor-alpha in human immunodeficiency virus type 1 encephalopathy [see comments]. Annals of Neurology 37, 381-394.  169  Windhagen A . , Newcombe J., Dangond F., Strand C , Woodroofe M . N . , Cuzner, M L and Hafler D . A . (1995) Expression of costimulatory molecules B7-1 (CD80), B7-2 (CD86), and interleukin 12 cytokine in multiple sclerosis lesions. Journal of Experimental Medicine 182, 1985-1996. Wong G . H . , Bartlett P.F., Clark-Lewis I., Battye F. and Schrader J.W. (1984) Inducible expression of H-2 and la antigens on brain cells. Nature 310, 688-691. Woodroofe M . N . , Bellamy A.S., Feldmann M . , Davison A . N . and Cuzner M . L . (1986) Immunocytochemical characterisation of the immune reaction in the central nervous system in multiple sclerosis. Possible role for microglia in lesion growth. Journal of the Neurological Sciences 74, 135-152. Woodroofe M . N . and Cuzner M . L . (1993) Cytokine mRNA expression in inflammatory multiple sclerosis lesions: detection by non-radioactive in situ hybridization. Cytokine 5, 583-588. Woodroofe M . N . (1995) Cytokine production in the central nervous system. [Review] [20 refs]. Neurology 45, S6-10. Wooley P.H., Dutcher J., Widmer M . B . and Gillis S. (1993) Influence of a recombinant human soluble tumor necrosis factor receptor F C fusion protein on type II collagen-induced arthritis in mice. Journal of Immunology 151, 6602-6607. Wu C . Y . , Warrier R.R., Carvajal D . M . , Chua A . O . , Minetti L.J., Chizzonite R., Mongini P.K., Stern A.S., Gubler U . , Presky D . H . and Gately M . K . (1996) Biological function and distribution of human interleukin-12 receptor beta chain. Eur. J.Immunol. 26, 345-350. Wysocka M . , Kubin M . , Vieira L . Q . , Ozmen L . , Garotta G., Scott P. and Trinchieri G . (1995) Interleukin-12 is required for interferon-gamma production and lethality in lipopolysaccharide-induced shock in mice. Eur.J.Immunol. 25, 672-676. Yawata H . , Yasukawa K., Natsuka S., Murakami M . , Yamasaki K., Hibi M . , Taga T . and Kishimoto T. (1993) Structure-function analysis of human IL-6 receptor: dissociation of amino acid residues required for IL6-binding and for IL-6 signal transduction through gpl30. EMBO J. 12, 1705-1712. Yoshida K., Taga.T., Saito M . , Suematsu S., Kumanogoh A . , Tanaka T., Fujiwara H . , Hirata M . , Yamagami T., Nakahata T., Hirabayashi T., Yoneda, Tanaka K., Wang W.Z., Mori C , Shiota K., Yoshida N . and Kishimoto T . (1996) Targeted disruption of gpl30, a common signal transducer for the interleukin 6 family of cytokines, leads to myocardial and hematological disorders. Proceedings of the National Academy of Sciences of the United States of America 93, 407-411. Zhang C , Baumgartner R.A., Yamada K. and Beaven M . A . (1997) Mitogen-activated protein (MAP) kinase regulates production of tumor necrosis factor-alpha and release of arachidonic acid in mast cells. Indications of communication between p38 and p42 M A P kinases. Journal of Biological Chemistry 272, 13397-13402. Zhang S.C. and Fedoroff S. (1998) Modulation of microglia by stem cell factor. Journal of Neuroscience Research 53, 29-37. Zhao B . and Schwartz J.P. (1998) Involvement of cytokines in normal C N S development and neurological diseases: recent progress and perspectives. J.Neurosci.Res. 52, 7-16. Zurawski G . and de Vries J.E. (1994) Interleukin 13, an interleukin 4-like cytokine that acts on monocytes and B cells, but not on T cells. Immunol.Today 15, 19-26.  170  Zurawski S.M., Chomarat P., Djossou O., Bidaud C , McKenzie A . N . , Miossec P., Banchereau J. and Zurawski G. (1995) The primary binding subunit of the human interleukin-4 receptor is also a component of the interleukin-13 receptor. J.Biol.Chem. 270, 13869-13878.  171  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0099455/manifest

Comment

Related Items