Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Adamts expression in the human decidua of early pregnancy Ng, York Hunt 2004

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2004-0580.pdf [ 6.19MB ]
Metadata
JSON: 831-1.0091530.json
JSON-LD: 831-1.0091530-ld.json
RDF/XML (Pretty): 831-1.0091530-rdf.xml
RDF/JSON: 831-1.0091530-rdf.json
Turtle: 831-1.0091530-turtle.txt
N-Triples: 831-1.0091530-rdf-ntriples.txt
Original Record: 831-1.0091530-source.json
Full Text
831-1.0091530-fulltext.txt
Citation
831-1.0091530.ris

Full Text

A D A M T S EXPRESSION IN THE H U M A N DECIDUA OF E A R L Y PREGNANCY B Y Y O R K HUNT N G B.S., O K L A H O M A CITY UNIVERSITY, USA, 2001 A THESIS SUBMITTED TN PARTIAL F U L F I L M E N T OF THE REQUIRMENTS FOR THE DEGREE OF M A S T E R OF SCIENCE IN THE F A C U L T Y OF G R A D U A T E STUDIES THE F A C U L T Y OF MEDICINE DEPARTMENT OF OBSTETRICS A N D G Y N A E C O L O G Y P R O G R A M OF REPRODUCTIVE A N D D E V E L O P M E N T A L SCIENCES WE ACCEPT THIS THESIS AS CONFIRMING TO THE REQUIRED STANDARD THE UNIVERSITY OF BRITISH C O L U M B I A AUGUST 2004 ® Y O R K HUNT N G , 2004 A D A M T S EXPRESSION IN THE H U M A N DECIDUA OF E A R L Y PREGNANCY BY YORK HUNT NG B.S., OKLAHOMA CITY UNIVERSITY, USA, 2001 A THESIS SUBMITTED TN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE IN THE FACULTY OF GRADUATE STUDIES THE FACULTY OF MEDICINE DEPARTMENT OF OBSTETRICS AND GYNAECOLOGY PROGRAM OF REPRODUCTIVE AND DEVELOPMENTAL SCIENCES WE ACCEPT THIS THESIS AS CONFORMING TO THE REQUIRED STANDARD THE UNIVERSITY OF BRITISH COLUMBIA JULY 2004 ® YORK HUNT NG, 2004 JUBCl THE UNIVERSITY OF BRITISH COLUMBIA FACULTY OF G R A D U A T E STUDIES Library Authorization In presenting this thesis in partial fulfillment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. ZLOOL) Name of Author (please print) Date (dd/mm/yyyy) Title of Thesis: ftP*yrvST£ -p_)( pKgSS\OtO IKS T U E HVJAAftN) P&UIPUft QP BWlM PRfcglNftJKbV' Degree: < M ^ * f CcVuc^ ^ d ^ a w i ^ ^ ^ ^ ^ Q Q ^ •itish Columbia 1-J Department of The University of British Vancouver, BC Canada grad.ubc.ca/forms/?formlD=THS page 1 of 1 last updated: 31-Aug-04 ABSTRACT The spatio-temporal expression of interleukin (IL)-1B and transforming growth factor (TGF)-pi in the human endometrium suggests that these two cytokines act in concert with gonadal steroids to create a uterine environment that is capable of supporting a viable pregnancy. The highly regulated series of developmental events that culminates in the terminal differentiation of the stromal cells into deciduas in preparation for implantation is mediated by alterations in the composition of the endometrial extracellular matrix (ECM). Consequently, matrix metalloproteinases have been assigned central roles in implantation and placentation. I hypothesized that members of a novel family of metalloproteinases, the A D A M T S , may mediate certain proteolytic events that are operative at the maternal-fetal interface. A comprehensive survey of the A D A M T S subtypes present in first trimester human decidual tissue was performed. In addition, I have examined the ability of IL- ip and TGF-pi to regulate the mRNA and protein levels of one of these endometrial A D A M T S subtypes, A D A M T S - 1 , in primary cultures of stromal cells isolated from first trimester decidua. The mRNA transcripts encoding ADAMTS-1 , -2, -3, -4, -5 (-11), -6, -7, -8, -9, -10 and -12 are present in first trimester human deciduas. ADAMTS-1 mRNA transcript and protein expression were detected in all of the decidual stromal cell cultures using quantitative-competitive-polymerase chain reaction (QC-PCR) and Western blotting strategies. IL-p l (0-1000 IU) increased ADAMTS-1 mRNA and protein levels in decidual stromal cell cultures in a dose-dependent manner. Significantly increased ADAMTS-1 mRNA and protein levels were also detected in cells cultured for 24 hours in the presence of a fixed amount of IL- ip i i (100 IU), with maximum levels being observed after 48 hours. In contrast, increasing concentrations of TGF-pi (0-10 ng) decreased ADAMTS-1 mRNA and protein levels in these cells in a dose-dependent manner. Furthermore, a fixed concentration of TGF-pi (5 ng) effected a significant time-dependent decrease in ADAMTS-1 mRNA and protein levels in decidual stromal cells that was readily apparent at 24 hours and continued to decline until the study was terminated at 48 hours. Collectively, these studies indicate that IL-1B and TGF-pi have differential effects on ADAMTS-1 mRNA and protein levels in decidual stromal cells in vitro. These results suggest that cytokine-mediated regulation of ADAMTS-1 expression, and potentially of other A D A M T S family members, may be important in stromal cell differentiation that is essential for decidual function during early pregnancy. i n T A B L E O F C O N T E N T S ABSTRACT ii TABLE OF CONTENTS iv LIST OF TABLES vii LIST OF FIGURES viii LIST OF ABBREVIATIONS ix ACKNOWLEDGEMENTS x P A R T I. O V E R V I E W 1 1.1 Background 1 1.2 Cyclic remodeling of the human endometrium 4 1.3 Cellular mechanisms underlying implantation 7 1.3.1 Extracellular matrix deposition 7 1.3.2 ECM-degradation-proteinases and their inhibitors 10 1.3.2-A: Plasminogen activators and their inhibitors 10 1.3.2-B: Matrix metalloproteinases and their endogenous inhibitors 11 1.4 ADAM 15 1.5 Regulation of human implantation and placentation 17 1.6 ADAMTS 19 1.6.1 Structural and functional organization of ADAMTS subtypes 19 iv 1.6.2 Tissue distribution of the ADAMTS subtypes 23 1.6.3 The cell biology of the ADAMTS 26 1.6.4 Regulation of ADAMTS expression 29 1.6.5 Regulation of ADAMTS activity 29 1.6 Hypothesis 31 1.7 Specific aims 32 PART II. GENERAL MATERIALS AND METHODS 34 2.1 Tissues '. -.34 2.1.1 Cell isolation and culture 34 2.2 Experimental culture conditions 35 2.3 RNA preparation and synthesis of first strand cDNA 36 2.3.1 Design of oligonucleotide primers 37 2.3.2 Semiquantitative RT-PCR 42 2.4 Quantitative competitive-polymerase chain reaction (QC-PCR) 42 2.5 Western blot analysis 45 2.6 Statistical analysis 46 PART III. RESULTS 48 3.1 Multiple ADAMTS subtypes are present in first trimester decidual tissues 48 v 3.2 Dose-dependent effects of IL-lp and TGF-pl on ADAMTS-1 mRNA and protein levels in human decidual stromal cells 48 3.3 Time-dependent effects of IL-1 p and TGF-p 1 on ADAMTS-1 mRNA and protein levels in human decidual stromal cells 58 3.4 Attenuation of cytokine-modulated ADAMTS-1 mRNA levels in human decidual stromal cells using monoclonal antibodies directed against IL-ipand TGF-pl 63 PART IV. DISCISSION, SUMMARY, AND CONCLUSION 68 4.1 Discussion 68 4.2 Conclusions 73 4.3 Future studies 74 REFERENCES: 76 v i LIST OF TABLES Table 1 Distribution of the ADAMTS subtypes in adult human tissues 24 Table 2 Distribution of the ADAMTS subtypes in human fetal tissues 25 Table 3 ADAMTS mRNA levels in the developing mouse fetus 25 Table 4 Primer sequences for the QC-PCR analysis of ADAMTS-1 mRNA levels in decidual stromal cells 39 Table 5 Primer sequences and PCR conditions for the semi-quantitative analysis of ADAMTS subtype mRNA levels 40 vii LIST OF FIGURES Fig. 1 Schematic representation of the basic structure of A D A M T S subtypes 22 Fig. 2 Representative schematic diagram of the construction of a competitive PCR primer for ADAMTS-1 38 Fig. 3 Characterization of the A D A M T S subtypes mRNA transcripts present in human decidual tissues 49 Fig. 4 Quantification of ADAMTS-1 mRNA in human endometrial decidual stromal cells 51 Fig.5 Generation of a standard curve for ADAMTS-1 mRNA in human endometrial deciduals tromal cells 52 Fig.6 Expression of ADAMTS-1 in decidual cells cultured in the presence of increasing concentrations of IL- lp 54 Fig.7 Expression of ADAMTS-1 in decidual cells cultured in the presence of increasing concentrations of TGF-pi 57 Fig. 8 Time- dependent effects of IL- ip on ADAMTS-1 in decidual stromal cells....60 Fig. 9 Time- dependent effects of TGF-pi on ADAMTS-1 expression in decidual Stromal cells 62 Fig. 10 Effects of anti-IL-ip neutralizing monoclonal antibody on ADAMTS-1 and mRNA protein levels in decidual stromal cells cultured in the presence of IL- ip 65 Fig. 11 Effects of anti-TGF-pi neutralizing monoclonal antibody on ADAMTS-1 mRNA and protein levels in decidual stromal cells cultured in the presence of TGF-pi 67 viii LIST OF ABBREVIATIONS A D A M A Disintegrin and Metalloproteinase A D A M T S A Disintegrin and Metalloproteinase with ThromboSpondin repeats Bp °C Base pairs Degree Celsius cDNA Complementary deoxyribonucleic acid D M E M Dulbecco's Modified Eagle Medium dNTP Deoxynucleoside triphosphate D N A Deoxyribonucleic acid DNase Deoxyribonuclease E2 17 p-estradiol ER Endoplasmic reticulum EVT Extravillous cytotrophoblast FBS Fetal bovine serum hCG Human chorionic gonadotropin HIP Heparin/ heparan sulfate-interacting protein HS Heparin/ heparan sulfate HSPG Heparan sulfate proteoglycan IL Interleukin IU International unit TvT-ET In vitro fertilization-embryo transfer KDa Kilodaltons L H Luteinizating hormone Micro M A P K Mitogen-activated protein kinase M E K 1/2 MAPK7ERK kinase lA ml Milliliter M M P Matrix metalloproteinases M T - M M P Membrane-type metalloproteinases M R N A Messenger ribonucleic acid P4 Pogesterone PAI Pasminogen activator inhibitor P A G E Polyacrylamide gel electrophoresis PBS Phosphate buffered saline PCR Polymerase chain reaction TGF Transforming growth factor QC-PCR Quantitative competitive polymerase chain reaction RT Room temperature RT-PCR Reverse transcription polymerase chain reaction SD Standard deviation SE Standard error SDS Sodium dodecyl sulphate ix ACKNOWLEDGEMENTS First of all, I would like to express my deepest gratitude to Dr. Colin D. MacCalman, my supervisor, who has guided my research with understandable and clear direction throughout the various stages of this work. Truly speaking, without his brilliant ideas, personal guidance and patient instruction, it never would have been possible to complete these projects in the first place. Secondly, I am indebted to Dr. Peter C. K. Leung, the Director of Reproductive and Developmental Sciences, who has always offered the most valuable and professional advice to me. I also, truly appreciate his support throughout these studies. I wish to express my most sincere appreciation to my supervisory committee members: Dr. Dan Rurak (chairman), Dr. Basil Ho Yuen, and Dr. Sandra E. Dunn for contributing their most valuable time in keeping these studies on track, and for their critical reviews and comments on this thesis. I would like to thank Dr Catherine J. Pallen for being my external examiner. I would also like to thank Dr. Ellen Zhu in Dr. MacCalman's lab for her most valuable technical skills, support, advice, comments and friendship. As well I would like to take this opportunity to express my appreciation to my collegues: Alex, Gloria, Hai Ying and Jeniffer, for their constant support and friendship during the time we have spent x together. I would also like to express my thanks to the Canadian Institutes of Health Research (CIHR) for supporting this research. Finally, I wish to thank my parents and my sister for their unconditional support and encouragement throughout my studies. Here, I dedicate this thesis to both my parents and my sister, by expressing my deepest appreciation to them. xi PART I. OVERVIEW 1.1: Background The establishment of a successful pregnancy is dependent upon the coordinated development of the implanting embryo and the maternal endometrium (Tabibzadeh et al., 1995; Paria et al., 2002). In particular, the endometrium must have undergone a highly regulated series of morphogenetic events in preparation for pregnancy. The blastocyst, in turn, must have attained the ability to interact with the diverse cell types that constitute the endometrium and subsequently form a functional placenta (Graham et al., 1992; Paradinas et a l , 1995). The endometrium is only receptive to the implanting embryo during a defined period of the menstrual cycle, known as the "window of implantation" (Hertig et al., 1956; Nikas et al, 1999; Wilcox et al., 1988). Desynchrony in the spatial or molecular development of the maternal and/or the fetal compartment often results in spontaneous abortion, or in less severe cases, defects in the formation and organization of the placenta that often compromise continuation of pregnancy to term (Paria et al., 2000, 2002; Kao et al., 2002). A better understanding of the cellular mechanisms underlying the tissue remodeling events that occur in the endometrium in preparation for the implanting embryo will allow us to delineate the events involved in the successful establishment and maintenance of pregnancy. 1 The A D A M T S (A Disintegrin And Metalloproteinase with ThromboSpondin repeats) are a novel family of extracellular proteases found in both mammals and invertebrates (Tang et al., 2001). One of the best characterized members of this gene family is ADAMTS-1 , initially identified as an inflammation-associated gene. Gene knockout studies have subsequently highlighted the important roles that ADAMTS-1 play in tissue morphogenesis and fetal growth. In addition, adult female mice that are null-mutant for this gene exhibited reduced fertility owing to diminished ovarian and/or uterine function (Shindo et a l , 2000). The proteolytic degradation and/or activation of distinct extracellular matrix (ECM) components of the decidua are essential for the establishment and maintenance of human pregnancy (Graham et al., 1992). This progressive developmental process is mediated by the spatio-temporal expression of several cytokines, growth factors and their mutual receptors in decidual cells and/or the trophoblast cells of the implanting embryo (Graham et a l , 1992), which in turn, regulate the localized activity of matrix metalloproteinase (MMP) and the urokinase plasminogen activator (uPA) systems at the maternal-fetal interface (Huang et al., 1998; Karmakar et al., 2002). Collectively, these observations have led to embryonic implantation being described as an inflammatory-type response. Interleukin (IL-1B) is a major pro-inflammatory cytokine that has been associated with the development of an uterine environment that is capable of supporting pregnancy (Simon et al., 1994). In particular, the endometrial expression levels of this cytokine increase during the secretory phase of the menstrual cycle (Huang et al., 1998). This is the time 2 period when decidualisation and embryonic implantation is initiated. IL-1B level peaks during the first trimester of pregnancy when E C M remodeling of the decidua is at its greatest, until a subsequent decrease as gestation proceeds (Simon et al., 1994). Furthermore, decreased expression levels of IL-1B and its receptor in the secretory endometrium have been associated with unexplained fertility and habitual abortion (Wolff et al., 2000). The biological actions of Il-P on the endometrium are believed to be mediated, at least in part, via its ability to increase the proteolytic activities of the MMP/TIMP and/or uPA/PA-1 systems expressed in the endometrial stroma and/or in the invading trophoblasts, both of which contribute to the remodeling of this dynamic tissue (Shimonovitz et al., 1996; Huang et al., 1998; Chung et al., 2001). Similarly, the anti-inflammatory growth factor, TGF-pi is a potent regulator of the M M P and uPA-mediated endometrial tissue remodeling events underlying pregnancy (Huang et al., 1998). In particular, TGF-pi has been shown to play a key role in the morphological and functional differentiation of the decidua and in reducing the invasive capacity of extravillous cytotrophoblasts, particularly during the first trimester of pregnancy when maximum levels of this growth factor are expressed in both the maternal and fetal cellular compartments (Lala et al., 1990; Graham et al., 1991). In contrast to IL-lp , TGF-pl has been shown to decrease M M P and uPA activity in primary cultures of human endometrial stromal cells and extravillous cytotrophoblasts (Roberts et al., 1988; Lala et al., 1990; Graham et al., 1997; Huang et al., 1998). Taken together, these observations suggest that IL-1 p and TGF-pi balance the interplay between the proteolytic mechanisms operative at the maternal-fetal interface. 3 1.2: Cyclic Remodelling of the Human Endometrium The stromal and epithelial cells of the human endometrium undergo cyclic proliferation, differentiation and shedding in response to the gonadal steroids, progesterone (P4) and 17(3-estradiol (E2) (Noyes et al., 1950). Following menstruation, the endometrium regenerates under the influence of E2 to produce a dense cellular stroma containing narrow tubular glands and small blood vessels. Instantaneously after ovulation, the effects of P4 on epithelial cell morphology can be observed with larger gland profiles and the emergence of basal glycogen masses in these endometrial cells. In contrast, there is little alteration in the histology of the endometrial stromal or vascular cells at this stage of the menstrual cycle. If fertilization occurs, embryonic implantation occurs in the midsecretory phase of the cycle. This phase is therefore a critical nodal point which demonstrates that when an embryo is present, P4 levels will continue to rise, leading to decidualisation of the stroma. On the other hand, in the absence of pregnancy, P4 levels will drop to produce a late secretory phenotype, followed by menstrual shedding. The putative "window of implantation" in the human is believed to span cycle days 20-24 and involves the luminal epithelium and subsequently endometrial stroma (Hertig et al., 1956; Nikas et al., 1999; Wilcox et al., 1988). This receptive period is associated with distinct molecular and morphological changes in the luminal epithelium of the endometrium. In particular, epithelial dome-like structures (pinopodes), that are believed to mediate the attachment of the embryo to the luminal epithelium, emerge at the implantation site (Lindenberg et al., 1991). 4 The expression of a number of molecules in this endometrial cell layer including H -type 1 antigen, mucins, heparan sulfate proteoglycan, carbohydrate epitopes, integrin subunits (particulary ocvp3 and a4pi) and the trophin-bystin/tastin complex has also been found to be temporally regulated in this endometrial cell layer within and framing the "window of implantation" (Aplin et al., 1995; Suzuki et al., 1999; Lessey et al., 2000., Kao et al., 2002). The mid secretory stroma also demonstrates histological alterations that characterize the initial cascade of differentiative events leading to decidualisation (Noyes et al., 1950). Focal areas of edema become visible in which the density of stromal cells is reduced. As a consequence, blood vessels in these areas are more apparent, even though no overt vascular differentiation is yet evident. Other areas of the stroma remain densely populated with elongated mesenchymal cells. As in other phases of the menstrual cycle, but now more obvious, the periglandular stroma contains a layer of flattened cells in close apposition to the epithelial basement membrane. In the late secretory phase, the areas of edematous stroma become more widespread, though more densely cellular areas also occur. At this time, vascular differentiation occurs to produce prominent spiral arterioles surrounded by a cuff of pseudo-decidual cells, which are enlarged stromal cells that bear a resemblance to the decidual cells of pregnancy. Decidualisation, which begins in the secretory phase and continues into early pregnancy in humans, incorporates the morphological and biochemical differentiation of the endometrial stroma. Decidualisation is believed to be a critical event in the development of an uterine environment that is capable of fulfilling regulating embryonic 5 implantation (Noyes et al., 1950; Kearns et a l , 1983). This highly regulated series of developmental events involves the remodeling of the stromal/ decidual cell E C M . Morphological decidualisation is expressed histologically by a change to a polyhedral cell shape with an increase in cell size, and ultrastructurally by an extensive development of the organelles involved in protein synthesis and secretion, and by the appearance of gap junctions and desmosomes (Kearns et al., 1983; Wynn et a l , 1974; Lawn 1971). Functionally, decidualisation precedes the onset of insulin-like growth factor binding protein-1 (IGFBP-1) and prolactin (PRL) secretions (Kearns et al., 1983; Lala et a l , 1984). A significant population of bone-marrow derived cells amounting to over 40% of the total and comprising large granular lymphocytes (LGLs), macrophages and to a lesser extent, T cells also now present (Starkey et al., 1988; Bulmer et al., 1990). The LGLs are believed to develop from a smaller population of precursor cells present in the endometrial stroma during the secretory phase of the menstrual cycle. Close intercellular associations are often seen between these bone marrow-derived cells and resident decidual cells (Aplin et al., 1988). Mast cells have also been detected in the human decidua (Marx et al., 1999). The diverse populations of cells that compose the decidua allow this dynamic tissue to fulfill paracrine, nutritional, immunoregulatory functions throughout pregnancy (Kearns et al., 1983). Additionally, the decidua is believed to play a central role in the regulation of embryo implantation and in the maintenance of pregnancy through control of trophoblast invasion into the underlying maternal tissues and vasculature throughout early pregnancy (Pijnenborg et al., 1980). The depth of trophoblast invasion is correctly controlled by the 6 decidua. Errors have extreme consequences on the health of both fetus and the mother (Cross et al., 1994; Paria et al., 2000;). 1.3: Cellular mechanisms underlying Implantation The highly regulated series of developmental processes that occur in the endometrium in preparation for pregnancy are believed to be mediated, at least in part, by alterations in the composition of the endometrial extracellular matrix (ECM) during the menstrual cycle, the breakdown of these matrices during implantation, and the spatiotemporal expression of cell surface receptors that modulate cell-cell or cell-matrix interactions (Tabibzadeh et al., 1995; MacCalman et al., 1998). 1.3.1: Extracellular matrix deposition The E C M is a complex cellular product comprising glycoproteins, collagens, glycosaminoglycans and proteoglycans as major structural and functional components. The proteoglycan superfamily consists of three families: the basement membrane proteoglycans perlecan and agrin; the bamacanhe hyalectans comprising versican, aggrecan, neurocan and brevican; and the leucine-rich proteoglycans comprising decorin, and biglycan. Collectively, proteoglycans are involved in tissue arrangement and organization, with individual proteoglycan molecules performing distinct functions in these processes. For example, versican has been implicated in the regulation of cell migration and developing tissue pattern formation (Perissinotto et al., 2000; Iozzo et al., 2001). 7 Regeneration of the endometrium during the proliferative phase of the menstrual cycle involves the deposition of a scaffolding of E C M (Aplin et al., 1988; Mylona et al., 1995; Church et al., 1995). The undifferentiated stroma produces an E C M of classic mesenchymal composition. Collagens I, III, V , and VI and fibronectin (Fn) have all been shown to be present. Also, there are periglandular deposits of tenascin that emerge to reflect the proliferative state of the epithelial compartment (Vollmer et al., 1990). The epithelium and blood vessels are surrounded by basement membranes containing laminin, collagen type IV and heparan sulfate proteoglycan (HSPG). Ovulation has little effect on the composition of the stromal or vascular E C M although collagen deposited into the E C M is organized into fibril bundles that form an anatomising network in the intercellular spaces. However, changes in the E C M occur with the transition from undifferentiated stroma to decidua (Wynn et al., 1974; Wewer et al., 1985; Kislaus et al., 1987; Ruck et al., 1994). The decidual E C M lacks the bundles of uniform-diameter parallel fibrils found in the intercellular spaces of the endometrial stroma. Fibril diameters and orientations are variable and fibrils are sparsely distributed, though the major collagen types I, III, and V and fibronectin are still present. Type VI collagen is now absent. The decidual cells encapsulate themselves in a pericellular basal lamina through which pedicels protrude. The pedicels contain secretory granules that are probably involved in the secretion of basement membrane components (Kislaus et al., 1986). 8 The decidual cell basement membrane is composed of laminins 2 and 4, type IV collagen, heparan sulpahte proteoglycan (HSPG), and BM-40 (Wewer et al., 1985; Faber et al., 1986; Church et al., 1996). Therefore, the differentiation of endometrial stromal E C M presents two contrasting molecular paradigms. The first is the selective removal during decidualisation of collagen VI, a structural component that plays a key role in the integration and structural stabilisation of tissue architecture, perhaps by cross-linking the major scaffolding elements of the endometrial E C M during the proliferative phase. The focal loss of collagen VI in the endometrial stroma during the mid-secretory phase may mediate, at least in part, the reduction in cellular density and increased edema associated with this stage of the menstrual cycle (Aplin et al., 1988). In addition, the loss of collagen VI during decidualisation may help promote cellular interaction and/or create an uterine environment into which trophoblast invasion may arise more readily occur (Aplin et al., 1991). The second paradigm is the appearance of laminins (Ln) 2 and 4 in alliance with the differentiating stromal cells (Church et al., 1996). As previous studies have demonstrated that laminin 2 is competent to mediate cell attachment and spreading (Brown et al., 1994), it is tempting to speculate that it may play a role in trophoblast adhesion, migration and/or differentiation during early pregnancy. Similar speculations pertain to the migratory bone marrow-derived cells which are often observed to be attached to the pericellular basal lamina. It is also believed that the decidual basement membrane plays a role in the structural organization and integration of decidual E C M that is required to maintain the developing conceptus, expand as the feto-placental compartment grows and be permeable to macromolecules, such as prolactin, secreted by the decidua and destined for the fetal compartment (Aplin et al., 1988; Ruck et al., 1994). 9 In addition, large amounts of hyaluronan (HA) are found in the human decidual cell layers (Meinert et al., 2001). Versican, a member of a large aggregating chondroitin sulfate proteoglycan family contains a H A binding region suggesting the possibility of versican present in decidua. However, its presence in the deciduas has not yet been identified. 1.3.2: ECM-degradation-proteinases and their inhibitors A large part of endometrial remodelling seen in both the proliferative and secretory phases of the menstrual cycle involves the degradation of E C M components, particularly interstitial collagens and basement membranes (Fata et al., 2000; Curry et al., 2001). It is a prerequisite for the gradual remodelling during pregnancy to generate a matrix with suitable mechanical properties (Granstrom et al., 1989, 1991). The decidua of early pregnancy is also subject to further degradation by the invading trophoblasts that have been shown to utilize similar cellular mechanisms for E C M degradation to those observed during tumour cell invasion (Yagel et al., 1988; Strickland et a l , 1992; Lala et al., 1996; Bischof et al., 2000). Therefore, proteinases and their associated inhibitors are believed to play a key role in human implantation. Two major classes of proteinases that have been studied in human trophoblast and endometrial cells are plasminogen activators and matrix metalloproteinases. 1.3.2-A: Plasminogen activators and their inhibitors Plasminogen activators (PA) are substrate-specific serine proteinases that mediate cleavage of plasminogen to plasmin. They exhibit a broad range of serine protease activity 10 (Vasseli et al., 1991; Andreasen et al., 2000). The proteinase activator system includes the urokinase-type plasminogen activator (uPA), the tissue-type P A (tPA), the P A inhibitor-1 and -2 (PAI-1 and PAI-2, respectively) and the uPA receptor. The expression of uPA and tPA in the human endometrium is temporally regulated during the menstrual cycle with maximum levels being detected during the secretory phase and early pregnancy (Casslen et al., 1983; Koh et a l , 1992). Similarly, PAI-1 expression is high during the secretory phase and then declines with the onset of menstruation (Koh et al., 1992). The withdrawal of P4 from the culture medium of endometrial stromal cells increases uPA activity and concomitantly decreases PAI-1 expression levels in these cultures (Schatz et al., 1999). These observations suggest that the uPA system plays key roles in the highly regulated series of remodeling events that occur in the endometrium in preparation for pregnancy. 1.3.2-B: Matrix metalloproteinases and their endogenous inhibitors The matrix metalloproteinases (MMPs) are a large gene family of zinc-dependent proteinases that mediate a range of tissue remodelling processes (Woessner et al., 1991; Fata et a l , 2000). To date, 24 distinct members of the M M P gene family been identified. These distinct M M P subtypes can be further divided into several subgroups based upon their substrate specificities and/or structural similarities: collagenases (MMP-1, MMP-8, MMP-13); gelatinases (MMP-2, MMP-9), stromelysins (MMP-3, MMP-7 , MMP-10, MMP-11); membrane-type MMPs (MT-MMP1 though MT-MMP6); and a miscellaneous group that contains MMP-12, and MMP-19 through MMP-26. In additionally to the 11 hydrolysis of distinct E C M components, MMPs have been shown to be capable of cleaving cytokines, chemokines, and cytokine/ chemokines ligands (either in soluble form or bound to the cell surface); cell adhesion molecules (cadherins and integrins), their own zymogen forms; and other MMPs and proteinases inhibitors such as serpins (Egebald et al., 2002). Generally, MMPs are synthesized as latent zymogens that must be cleaved in order to become activated. The activity of MMPs can be further regulated by the secretion of specific tissue inhibitors of MMPs (TEVIPs). TIMPs are the major endogenous regulators of M M P proteolytic activity in vivo (Woessner et a l , 1991). To date, four homologous TEMP subtypes, TIMP-1, -2, -3, and -4, have been identified. TIMPs are small secreted proteins (21-28 kDa) that form tight, non-covalent bonds with the proteolytic domain of the M M P subtypes with a stoichiometry of 1:1 (Woessner et al., 1991; Egebald et al., 2002). The unique structural properties of TIMP-3 allow it to bind to heparan-sulphate-containing proteoglycans and possibly chondroitin-sulphate-containing proteoglycans in the E C M (Yu et al., 2000). TEVIPs also exhibit other biological functions that are independent of their ability to inhibit the proteolytic activity of MMPs. For example, TIMP-1 and -2 have mitogenic effects on a number of cell types (Wang et al., 2002) whereas overexpression of these proteins reduces tumor cell growth (Ikenaka et al., 2003). TIMP-3 has been shown to promote apoptosis in human melanoma and colon carcinoma cells (Smith et al., 1997; Ahonen et al 2003). To date, 13 M M P subtypes have been detected in the human endometrium during the menstrual cycle (Fata et al., 2000; Curry et al., 2001; Goffin et al., 2003). The complex 12 expression patterns observed for each of these endometrial M M P subtypes suggests distinct roles in the development, maintenance and regression of this dynamic tissue. In particular, MMP-7, MMP-11, MMP-26, and MT3-MMP expression levels are high during the proliferative phase in the menstrual cycle and then decrease in the secretory phase. In contrast, MMP-2, MMP-19, MT1-MMP and MT2-MMP are constitutively expressed in the endometrium throughout the menstrual cycle whereas MMP-1 , MMP-3 , MMP-8, MMP-9, and MMP-12 are only detected in the endometrium during menstruation. MMP-2, MMP-3, and MMP-9 (but not MMP-1 or MMP-7) have been detected in the decidua of early pregnancy, whereas there is only MMP-2 and MMP-9 are expresssed in this dynamic tissue at term (Xu et al., 2002). To date, the cellular localization of only some of these M M P subtypes in the human endometrium has been determined. During the follicular phase, MMP-1 , MMP-2, and MMP-3 have been detected in the stroma, MMP-7 and MMP-9 are expressed in glandular epithelium, and MMP-9 is also present in neutrophils and monocytes (Rodgers et al., 1993, 1994; Hampton et al., 1995; Irwin et al., 1996; Jeziorska et al., 1996). In the luteal phase, MMP-3, MMP-10 and MMP-11 are present in the stroma, MMP-7 is present in the glandular epithelium, and MMP-9 is expressed in the glandular epithelium and neutrophils (Rodgers et al., 1994; Irwin et al., 1996; Jeziorska et al., 1996). Within menstrual tissue, MMP-1 and MMP-3 have been detected in stromal cells near blood vessels, MMP-2, MMP-9, MMP-10 and MMP-11 are present in the stroma, MMP-7 is in the glandular epithelium and MMP-9 is detectable in monocytes, neutrophils and macrophages (Rodgers et al., 1993, 1994; Hampton et al., 1995; Marbaix et al., 1995; Kokorine et al., 1996). 13 The human endometrium has also been shown to constitutively express TIMP-1, TTJVlP-2, and TIMP-3 whereas the expression of TIMP-4 has not been examined (Fata et al., 2000; Curry et a l , 2001; Goffin et al., 2003). In contrast to the MMPs, there appears to be only small fluctuations in the overall expression levels of TIMP-1, TIMP-2 and TIMP-3 in the endometrium during the menstrual cycle. However, a localized increase in TIMP-1 mRNA and protein expression has been detected near small arterioles and capillaries in the secretory endometrium and menstrual tissue suggesting that it may be locally regulated in the endometrial vasculature (Rodgers et a l , 1993; Hampton et a l , 1994; Salamonsen et al., 1995). Similarly, TIMP-2 mRNA and protein expression levels are higher in the vasculature than in glandular epithelium, stroma or decidua of early pregnancy (Hampton et al., 1994; Zhang et al., 1999). TIMP-3 expression levels also increase in the predecidual cells of the secretory phase, suggesting that it may serve as a cellular marker of decidualisation and/or play a critical role in regulating trophoblast invasion (Goffin et al., 2003; Zhang et al., 1999). Thus, it appears that the regulation of M M P expression levels in the human endometrium involves large cyclic fluctuations in the epithelial and/or stromal cells of the endometrium and at small localised foci within these cellular compartments which occur thought the menstrual cycle. The activity of endometrial MMPs is counterbalanced by the spatial expression of TIMP levels within the two cellular compartments of this dynamic tissue. The roles of MMPs and TIMPs in the cyclic remodeling events that occur in the endometrium during each menstrual cycle have been extended to primary cultures of 14 human endometrial cells. Conditioned media from stromal cells isolated from human endometrial tissues have been shown to contain the latent forms of MMP-1 , MMP-2, MMP-3, MMP-9 and MMP-11 and TIMP-1, TIMP-2 and TIMP-3 using zymography and reverse zymography, respectively (Salamonsen et al., 1997). The addition of P4, but not E2, to the culture medium of these primary cell cultures is capable of causing a significant decrease in the levels of these M M P subtypes and concomitant increase in TEvIP expression levels (Martelli et al., 1993; Osteen et al., 1994; Higuchi et al., 1995; Marbaix et al., 1996; Schatz et al., 1999). In contrast, the withdrawal of gonadal steroids from the culture medium of endometrial stromal cells allowed to undergo steroid-mediated decidualisation, a culture model system believed to mimic the cellular mechanisms underlying menstruation, resulted in a marked increase in all of the M M P subtypes expressed by endometrial stromal cells, but had no effect on TIMP mRNA or protein expression levels in these primary cultures (Salamonsen et al., 1997). Although M M P and TEVIPs have been assigned key roles in implantation and placentation, mice null-mutant for genes encoding MMPs or TEVIPs are fertile (Brown et al., 1994; Fata et al., 2000; Nothnick et al., 2000). These observations suggest that other proteinases mediate or suggest overlapping functions of certain MMPs or TIMPs or compensation, at least in part, the highly regulated series of E C M remodeling events that occur in the endometrium in preparation for the implanting embryo. 1.4: A D A M S 15 The A D A M s (A Disintegrin And Metalloproteinase) are a gene family of transmembrane proteins that contain a disintegrin and a metalloprotease domain (Graham et al., 1993). Thus, the A D A M s have the potential to act as adhesion molecules and/or proteinases. Two generic functions have been proposed for the A D A M proteases: (1) local activation of signaling pathways by the shedding of cell surface cytokines and growth factors and (2) cell migration/ invasion by the degradation of the E C M (Wolfsberg et al., 1995; Black et al., 1998). Although five A D A M subtypes (ADAMs-9, -10, 12, 17, and -28) have been shown to act as metalloproteases in vitro, only ADAMS-9 , -10, and -17 are known to be catalytically active in vivo. In particular, A D A M - 9 is responsible for the shedding of HB-EGF (Heparin Binding Epidermal Growth Factor) from cultured cells (Sclondorff et al., 1999), ADAM-10 acts as a sheddase in the Notch signaling pathway (Blobel et al., 1997; Pan et al., 1997; Izumi et al., 1998; Artavanis et al., 1999) and ADAM-17 is involved in multiple ectodomain-shedding events, most notably the release of Tumor Necrosis Factor (TNF)cc (Black et al., 1997; Qi et al., 1999). Several observations also suggest that A D A M s may be involved in cell migration. For example, ADAM-10 and snake venom metalloproteases (SVMPs), the closest relatives of A D A M s , have been shown to cleave purified E C M components (Black et al., 1997; Moss et a l , 1997) and/or their receptors (Jeon et al., 1999). A D A M - 9 has been shown to promote the migration of fibroblasts in vitro (Millichip et al., 1998) whereas ADAM-13 expression has been detected in cranial neural-crest cells, a highly migratory population of cells in the Xenopus embryo (Kamiguti et al., 1996). 16 However, there is currently no direct evidence linking A D A M protease activity with the adhesive and migratory behaviour of specific cell populations in vivo. 1.5: Regulation of Human Implantation and Placentation Although it has been well established that E2 and P4 are key regulators of the morphological changes that occur in the human endometrium during the menstrual cycle and pregnancy, there is increasing evidence to suggest that other factors are involved in creating an environment that promotes and/or supports a viable pregnancy. For example, prostaglandins (PGs) are believed to be involved in the initiation and maintenance of stromal cell decidualisation in the rodent and human endometrium in vitro and in vivo (Kennedy et al., 1982; Frank et al., 1994). In particular, prostaglandin E2 (PGE2) has been shown to potentiate the stimulatory effects of E2 and P4 on prolactin (PRL) secretion of cultured human endometrial stromal cells. As the glandular epithelium of the human endometrium secretes high levels of PGE2 during the secretory phase of the menstrual cycle, it has been suggested that this hormone also plays a key role in the differentiation and/or permeability of the vasculature (Psychoyos et al., 1995; Kao et a l , 2002). The spatiotemporal expression of several growth factors and their receptors including epidermal growth factor (EGF), insulin-like growth factor (IGF)-II, interleukin (IL)-1 p and transforming growth factor (TGF)- (31 in the human endometrium and placenta (Giudice et al., 1994) suggests that they play a central role in human implantation by regulating the decidualisation of the endometrial stroma and/or the differentiation of trophoblasts along 17 the invasive or non-invasive pathways in an autocrine and/or paracrine manner. For example, the complete interleukin-1 (IL-1) system, including IL-1 B messenger ribonucleic acid (mRNA) expression, IL-1 receptor (IL-1R) type I, and intracellular cell IL-1 receptor antagonist, has been detected in the human endometrium (Huang et al., 1998), with maximum levels being detected in the secretory endometrium and decidua of early pregnancy (Simon et al., 1994). Other evidence also supports a role for the IL-1 system in the morphological and biochemical differentiation of human trophoblasts. In particular, IL-1 secreted by human trophoblasts in vivo and in vitro regulate human Chorionic Gonadotropin (hCG) and P G E 2 secretion in these primary cultures (Yagel et al., 1989; Shimonovitz et al., 1994). IL-1 may also play an intermediary role in trophoblast invasion by regulating trophoblast expression of 92-kDa type IV collagenase (Graham et al., 1991). Similarly, transforming growth factor-pi (TGF-pi), which is produced by the placenta and decidua in vivo (Graham et al., 1991, 1992, 1993) is capable of reducing proliferation and promoting the aggregation, differentiation, and fusion of these isolated extravillous cytotrophoblasts in vitro (Graham et al., 1992, 1993). Collectively, these observations not only suggest that multiple factors act in concert to coordinate the morphological and molecular development of the decidua and/or the differentiation of trophoblasts along the invasive or non-invasive pathway, but also that a genetic hierarchy which is capable of controlling the progression of these two inter-related attachment must be operative at the maternal-fetal interface. The identification of one or more key elements involved in the early stages of this regulatory cascade will provide opportunities to develop diagnostic tests for patients with infertility and endometrial 18 disorders. Understanding these key elements could also lead to the development of targeted drug for treating implantation-based infertility, other endometrial disorders involving altered cellular proliferation and/or differentiation such as cancer, and endometrial-based contraception. 1.6: ADAMTS Recent cloning studies have identified new members of the A D A M family, known as A D A M T S (A Disintegrin And Metalloprotease with ThromboSpondin motifs-1), in C. elegans, Drosophila and mammals (Kaushal et al., 2000; Tang et al., 2001). A D A M T S are secreted proteins which do not contain the EGF-like, transmembrane and cytoplasmic domains characteristic of other members of the A D A M gene family (Kaushal et al., 2000; Tang et al., 2001). To date, 20 members of the A D A M T S family have been identified in vertebrates (Alfandari et al., 1997; Kuno et al., 1997; Abbaszade et a l , 1999; Hurskainen et al., 1999; Tang et al., 1999 Vazquez et al., 1999; Nath et al., 2000). 1.6.1: Structural and Functional Organisation of ADAMTS Subtypes Members of the A D A M T S gene family are characterized by four . structural and functional subunits: an amino terminal pro-domain, a catalytic domain, a disintegrin-like domain, and an E C M binding domain (which is composed of a central thrombospondin (TSP) type 1 motif, a spacer region and a variable number of TSP-like motifs) at the carboxy terminal end of the protein (Alfandari et al., 1997; Kuno et al., 1997; Abbaszade et al., 1999; Hurskainen et al., 1999; Vazquez et al., 1999; Nath et al., 2000; Kaushal et al., 19 2000; Tang et al., 1999, 2001) (Fig. 1). Overall, the predicted mature forms of the A D A M T S proteins are closely similar to one another. The prodomain of the distinct A D A M T S subtypes varies in length, but exhibits short stretches of homology that correspond to potentially important consensus sequences. In particular, the prodomains of the A D A M T S subtypes contain a Cys-switch motif, found in MMPs and SVMPs, that is involved in maintaining the enzyme in its latent form (Clark et al., 2000). A conserved furin activation site has also been identified in the prodomains of the A D A M T S . This putative cleavage site is located immediately prior to the amino terminal sequence of the mature protein suggesting that unlike MMPs, the prodomains of the A D A M T S subtypes are proteolytically cleaved by the endopeptidases in the Golgi apparatus and the proteins secreted in their active form. There is increasing experimental evidence to support this hypothesis (Tang et al.,1999; Cal et al., 2001; Fujikawa et al., 2001). The catalytic domain of the A D A M T S contains consensus sequences also found in the proteolytic domains of SVMPs, A D A M s and/or MMPs (Rawlings et a l , 1995). To date, the specific substrate(s) of many A D A M T S subtypes have not been identified. However, ADAMTS-4 and ADAMTS-8 have been shown to degrade aggrecan, a large chondroitin sulphate (Kuno et al., 1999; Rodriguez et a l , 2000). ADAMTS-4 is also capable of degrading versican and the brain-specific E C M protein, B E H A B (Stacker et al., 1995; Tortorella et al., 2000). Procollagens-I and -II have been identified as substrates for ADAMTS-1 , -2 and -3 (Nakamura et al., 2000; Tortorella et a l , 2001). Although the 20 substrates of ADAMTS-10 and -12 have not been identified, the metalloprotease domains of these A D A M T S subtype have been shown to be proteolytically active using the a2-macroglobulin complex formation assay (Tang et al., 1999; Sandy et a l , 2001). The disinteerin domain is located immediately after the catalytic domain of the A D A M T S . This region shows limited homology to the disintegrin domains of A D A M s and SVMPs (Alfandari et al., 1997; Kuno et al., 1997; Abbaszade et al., 1999; Hurskainen et al., 1999; Tang et al., 1999; Vazquez et al., 1999; Nath et al., 2000). The disintegrin-like adhesion domain of this protein might interact with integrin-like receptors on cells to promote cell-matrix attachment or disrupt interaction between integrin receptors and the extracellular matrix (Miles et al., 2000). The ECM Binding Domain contains an internal thrombospondin type 1 (TSP-1) motif that has two conserved regions, one of which is involved in binding sulphated glycosaminoglycan chains of heparin, heparan sulfate and chondroitin sulphate and the other in the binding of the thrombospondin receptor, CD36 (Prockop et al., 1998; Matthew et al., 2000). A spacer region of variable length separates this internal TSP motif from the TSP-1 repeats located at the carboxyl end of the protein. The spacer region exhibits the least sequence homology between the distinct members of the A D A M T S subfamily. The number of TSP-1 motifs at the carboxy terminal of the protein is also highly variable among the A D A M T S subtypes (Alfandari et al., 1997; Kuno et a l , 1997; Abbaszade et al., 1999; Hurskainen et al., 1999; Tang et a l , 1999; Vazquez et a l , 1999; Nath et al., 2000) (Fig. 1). The biological significance of these structural variations remains to be elucidated. 21 act ADAMTS-2 ADAMTS-3 ADAMTS-4 ADAMTS-5 ADAMTS-6 ADAMTS-7 ADAMTS-8 ADAMTS-9 I S C Q Q ADAMTS -10 C^Z-^OZ^  ADAI\^TS~12 Signal sequence Prodomain Catalytic domain Disintegrin-like domain TSP-1 motif Cysteine-rich domain Spacer region Spacer region-2 Figure 1. Diagram of ADAMTS subtype structures. Conserved structural motifs are shown. Despite motif conservation, amino acid sequences differ among A D A M T S subtypes. 22 The TSP-1 motifs and the spacer region are required for A D A M T S - E C M interactions. For example, the deletion of the central or the two carboxy terminal TSP motifs of ADAMTS-1 has been shown to inhibit its binding to E C M (Cal et al., 2001). The truncation of the spacer region also significantly reduced the ability of the mature protein to interact with the E C M . In contrast, deletion mutants corresponding to either the carboxy terminal TSP-1 or spacer region of ADAMTS-1 were capable of forming tight interactions with the E C M . These observations have led to the proposal that the spacer region of the A D A M T S may mediate specific interactions with distinct structural component(s) of the E C M . Interactions between the A D A M T S subtypes and the E C M appear to be critical for their proteolytic activity. For example, truncated forms of ADAMTS-4 lacking the spacer region and/or TSP-1 motifs did not exhibit any protease activity in vitro (Rodriguez et al., 2000). Similarly, peptides corresponding to different regions of the TSP-1 motif and/or spacer region of ADAMTS-4 reduced the cleavage of its substrate, aggrecan, in a dose-dependent manner. 1.6.2: Tissue Distribution of the ADAMTS subtypes A D A M T S subtypes have been detected in human adult and fetal tissues (Bornstein et al., 1994; Gantt et al., 1997; Magnetto et al., 1998; Zimmermann et al., 2001) (Tables 1 and 2, respectively). In addition, ADAMTS-1 , -2, -3 and -8 mRNA levels have been shown to 23 A D A M T S Heart Brain T E R M Lung Liver Skeletal Kidney Pancreas Placenta muscle 1 +++ • ++ - + + . 2 + - ++ +++ 3 + + . + . . • + 4 + - + ++ - - + 5 - + - - - -6 - - + - . . . . 7 + + . . . + + + + 8 + +++ 9 + . + + . . ++ +++ 10 - - • _ _ + _ + . 12 . . . . . . . Table 1. Distribution of the ADAMTS subtypes in adult human tissues. The relative mRNA expression levels of ADAMTS-1 to -12 are shown. +++ represents highest expression, and - represents no detectable mRNA (Reproduced from Bomstein et al., 1994; Gantt et al., 1997; Magnetto et al., 1998; Zimmermann et al., 2001). 24 A D A M T S Brain Heart Kidney Lung Skeletal Spleen Thymus muscle 9 + + + + + + + + + + + + + + 12 . . . + + + - - -Table 2. Distribution of the ADAMTS subtypes in human fetal tissues. The relative mRNA expression levels of ADAMTS-9 and -12 are shown. +++ represents highest expression, and - represents no detectable mRNA (Reproduced from Bornstein et al., 1994; Gantt et al., 1997; Magnetto et al., 1998; Zimmermann et al., 2001). Days of gestation A D A M T S 7 11 15 17 1 • ++ 2 ++ - + + 3 ++ - + + 8 . . . . Table 3. ADAMTS mRNA levels in the developing mouse fetus. The relative mRNA expression levels of ADAMTS-1 , -2, -3 and -8 are shown. ++ represents highest expression, and - represents no detectable mRNA (Reproduced from Fernandes et al., 2001). 25 be highly regulated during the early stages of embryonic development in the mouse (Fernandes et al., 2001) (Table 3). 1.6.3: The Cell Biology of the A D A M T S To date, the majority of the distinct A D A M T S subtypes have only been characterized at the structural level. Consequently, the biological functions of many of these novel proteases under normal and pathological conditions has not been determined. However, recent gene knockout studies have highlighted the important biological roles that members of the A D A M T S gene family play in embryonic development and tissue morphogenesis (Shindo et al., 2000; L i et a l , 2001). ADAMTS-1 is a new member protein of the A D A M family. It was, identified by differential display analysis as a gene highly expressed in the murine colon 26 cachexigenic tumor (Kuno et al., 1997). ADAMTS-1 gene knockout mice exhibit growth retardation and aberrant development of the kidneys, adrenal glands and urogenital tract (Shindo et al., 2000). Abnormalities in the ovaries and uterine tissues of female mice null mutant for ADAMTS-1 were also observed. In particular, the ovaries of these mice contained fewer mature follicles, supporting previous observations suggesting a role for ADAMTS-1 in folliculogenesis (Espey et al., 2000). The large cysts present in the endometrial cell layers of these mice are also likely to contribute to the reduced number of implantation sites observed at day 10 of pregnancy. 26 Site directed mutagenesis of ADAMTS-1 revealed that the thrombospondin type I motifs, together with the carboxyl-terminal spacing region, are responsible for anchoring to sulfated glycosaminoglycans such as heparan sulfate of the extracellular matrix (Kuno et al., 1998). Because ADAMTS-1 has a potential zinc-binding motif in the metalloproteinase domain, recent studies using a proteinase trapping mechanism with oc2-macroglobulin as a substrate demonstrated that the metalloproteinase domain of ADAMTS-1 is a secreted active A D A M protease that is closely associated with the extracellular matrix through the complex formation with a2-macroglobulin (Kuno et al., 1999). A point mutation within the Zn-binding motif abolished complex formation. Thus, ADAMTS-1 is involved in proteolytic modification of cell-surface proteins and extracellular matrices. Electron microscopy showing the accumulation of collagen fibers suggest that processing of collagen and related matrix substances may be impaired in ADAMTS-Y 1 ' mice (Colige et al., 1997). In addition, ADAMTS-1 degrades to different extents the cartilage proteoglycans aggrecan and lectican, or aggrecan-like proteins such as brevican and versican (Jean et al., 2004). However, it is difficult to assign the molecular substrate(s) of ADAMTS-1 because the characteristics of histological changes seem to be different among organs. The discovery of physiologically relevant substrate(s) of ADAMTS-1 would be likely to pave the way for further understanding of growth, fertility, and organ morphogenesis (Shindo et al., 2000). ADAMTS-1 is synthesized as a zymogen, which requires activation via proteolytic removal of a pro-domain. Furin, which is concentrated in the trans-Golgi network (TNG) has been demonstrated to be the convertase that is most efficient at cleaving 27 proADAMTS-1 (Jean et al., 2004). A previous study also showed that removal of the pro-domain from the ADAMTS-1 precursor is impaired in the furin-deficient cell line, LoVo, and the processing ability of the cells is restored by co-expression of furin cDNA (Kuno et al., 1998). The cysteine switch model predicts that metalloproteinases are kept latent by the interaction of a conserved Cys residue of the prodomain and a zinc atom in the catalytic domain that blocks the active site. Disruption of this interaction leads to removal of the prodomain and activation of the enzyme (Van et al., 1990). Mice null mutant for the ADAMTS-2 gene did not exhibit any abnormal phenotype at birth. However, as these mice matured, their skin became fragile (Li et al., 2001). At the structural level, the skin of these mice mimicked the defects described for the connective tissue disorder known as dermatosparaxis in animals and Ehlers-Danlos syndrome in humans (Colige et al., 1997; Giunta et al., 1999). Furthermore, male mice null mutant for ADAMTS-2 were infertile. Infertility in these mice was attributed to a reduced number of sperm in the seminiferous tubules suggesting that ADAMTS-2 plays a key role in spermatogenesis. Aberrant expression of A D A M T S subtypes has also been associated with the pathogenesis of disease. For example, ADAMTS-12 mRNA levels were found to be significantly higher in colorectal, renal and pancreatic carcinomas than in matched normal tissues (Cal et al., 2001). Similarly, increased ADAMTS-4 expression and proteolytic activity have been detected in gliomas of the CNS (Bayliss et al., 2001). ADAMTS-4 and -5 have also been shown to play key roles in the degradation of cartilage during the 28 progression of arthritic diseases (Tortorella et al., 2000). Finally, it has been proposed that ADAMTS-4 is involved in the degradation of the E C M in the brains of patients diagnosed with Alzheimer's disease (Satoh et al., 2000). Collectively, these observations suggest that the A D A M T S play key role(s) in tissue morphogenesis during embryonic development and maintain the integrity of tissues in the adult. 1.6.4: Regulation of ADAMTS Expression The factors capable of regulating A D A M T S expression remain poorly characterized. TGF- lp , but not TGF-oc, IL-a, IL- lp , aFGF or EGF increased ADAMTS-12 mRNA levels in human fetal fibroblasts (Cal et al., 2001). The inflammatory cytokine, interleukin-1, could induce the mouse ADAMTS-1 transcript in colon 26 cells. Lipopolysaccharides increase ADAMTS-1 mRNA levels in renal and cardiac tissues of adult mice whereas P4 appears to be a key regulator of this A D A M T S subtype in the rat ovary (Kuno et al., 1997; Robker et al., 2000). 1.6.5: Regulation of ADAMTS Activity Proteolytic Modification: Recent studies indicate that ADAMTS-1 , -4 and -12 undergo a second proteolytic cleavage, resulting in the formation of an amino terminal fragment containing the metalloproteinase, disintegrin-like and the central TSP-1 domains of the mature proteins (Kuno et al., 1999; Tang et a l , 1999; Cal et al., 2001). The truncated 29 forms of these proteins have modified adhesion properties and therefore, are likely to have different biological functions. For example, the amino terminal fragment of ADAMTS-1 binds to the E C M with a lower affinity and is less effective at regulating the proliferation of endothelial cells than the mature form (Cal et al., 2001). Thus, the removal of the TSP motifs may serve as endogenous mechanism that regulates the catalytic activity of this A D A M T S subtype. It has also been proposed that the carboxy terminal fragments of ADAMTS-4 and -12, which are also capable of binding to the E C M , may function as competitive inhibitors of the enzymatic activity of the mature proteins (Tang et al., 1999; Kuno et a l , 1999). Endogenous Regulatory Factors: TIMP-3, but not TIMPs-1, -2, or -4, has been shown to be a potent inhibitor of recombinant ADAMTS-4 and ADAMTS-5 in vitro (Kashiwagi et al.,2001). To date, the molecular mechanism(s) by which TIMP-3 inhibit these two A D A M T S subtypes have not been characterized. However, the unique structural properties (see Section 1.2.3-B) of TIMP-3 that allows it to bind to the E C M (Yu et al., 2000) may be important in the localized regulation of ADAMTS-4 and ADAMTS-5 proteolytic activity. Papilin is an E C M glycoprotein, identified in Drosophila, C. elegans and mammals, which inhibits the proteolytic activity of ADAMTS-1 in vitro. Papilin shares a set of protein domains (the papilin cassette) with the A D A M T S (Kramerova et al., 2000). In particular, the papilin cassette contains a complete TSP type 1 repeat, a spacer region, and six incomplete TSP type 1 domains. In binding assays, papilin was capable of interacting with ADAMTS-1 and the enzyme-substrate complex, but did not compete with procollagen 30 for the catalytic site of this proteinase. In view of these observations, it has been proposed that papilin regulates the proteolytic activity of A D A M T S subtype(s) by binding to its spacer region and/or TSP-1 motifs, thereby preventing interaction(s) with the E C M . Alterations in the expression levels of papilin have a profound effect on the development of the Drosophila embryo (Kramerova et al., 2000). For example, over-expression of papilin resulted in the aberrant development of the Malphigian tubules, muscle, trachea, CNS, and death of these embryos. Similarly, inhibition of papilin expression in adult C. elegans markedly reduced brood sizes and often caused the death of the parental animal (Kramerova et al., 2000). The few offspring which survived were infertile. The mechanisms by which papilin modulates these morphogenetic events have yet to be elucidated. Furthermore, the biological role(s) of papilin in mammalian tissue morphogenesis has not been determined. 1.6: Hypothesis In view of these observations, we have hypothesized that member(s) of the A D A M T S gene family mediate, at least in part, the endometrial E C M remodeling events during early pregnancy. This hypothesis is supported by aberrant endometrial development of mice null-mutant for the ADAMTS-1 gene, which in turn, likely contributes to the sub fertility of these animals. Since the structures of A D A M T S subtypes are highly conserved, it is likely, that other A D A M T S family members may play similar or related roles. In these studies, we have undertaken a comprehensive survey of the A D A M T S subtypes present in the human 31 endometrial decidua tissue during early pregnancy. In addition, we have examined the ability of IL- ip and TGF-p i , two cytokines that play key regulatory roles during early pregnancy, to regulate ADAMTS-1 mRNA and protein expression levels in primary cultures of stromal cells isolated from first trimester human decidual tissues. 1.7: Specific Aims Specific Aim 1: To perform a comprehensive survey of the ADAMTS subtypes present in first trimester human decidual tissues. ( A comprehensive survey of the A D A M T S subtypes present in first trimester human decidual tissues will be carried out using a reverse transcription-polymerase chain reaction (RT-PCR) strategy. Total R N A extracts prepared from first trimester tissues will be prepared and used to synthesize cDNA. This will be utilized for RT-PCR with primers specific for ADAMTS-1 through 12. PCR reaction mixtures containing non-reverse transcribed R N A or water will be used as negative controls and placenta cDNA will be used as a positive control. The PCR cycles will be repeated 20-40 times to determine a linear relationship between the yield of PCR products and number of cycles. Specific Aim 2: To determine whether IL-1 and/or TGF-pi are capable of regulating ADAMTS-1 mRNA and protein expression levels in primary cultures of human decidual stromal cells in a dose- and time-dependent manner. 32 The regulated expression of the ADAMTS-1 is believed to play key roles in the highly regulated series of remodeling events that occur in the endometrium in preparation for pregnancy. To gain a better understanding of the role(s) of IL-1 (3 and TGF-pi in this developmental process, we will examine the abilities of IL- ip and TGF-pi to regulate ADAMTS-1 mRNA and protein expression levels in a dose- and time-dependent manner in primary cultures of stromal cells isolated from first trimester decidual tissue using QC-PCR and Western blotting respectively. 33 PART II. GENERAL MATERIALS AND METHODS 2.1: Tissues Tissue samples of first trimester decidua parietalis were obtained from women undergoing elective termination of pregnancy (gestation ages ranging from 6-12 weeks). The use of these tissues was approved by the Committee for Ethical Review of Research on the Use of Human Subjects, University of British Columbia. A l l patients provided informed written consent. 2.1.1: Cell Isolation and Culture Stromal cells were isolated from the decidual tissue samples by enzymatic digestion and mechanical dissociation using a protocol modified from that reported by Shiokawa et al. (1996). Briefly, the decidual tissue samples were minced and subjected to 0.1% collagenase (type IV) (Sigma Chemical Co, St Louis, MO) and 0.1% hyaluronidase (type I-S) (Sigma Chemical Co, St Louis, MO) digestion in a shaking water bath at 37 °C for 60 minutes. The cell digest was then passed through a nylon sieve (38 um) (Becton Dickinson and Co, Franklin Lakes, NJ). The isolated glands and any undigested tissue fragments were retained on the sieve, and the eluate containing the stromal cells was collected in a 50 ml tube. The stromal cells were then pelleted by centrifugation at 800 x g for 10 minutes at room temperature. The cell pellet was washed once with D M E M containing 10% fetal bovine serum (FBS) before being resuspended and plated in D M E M containing 25mM glucose, L-glutamine, antibiotics (100 U/ml penicillin, 100 |J.g/ml streptomycin) and 34 supplemented with 10% FBS, 17(3-estradiol (10 nM; Sigma Chemical Co) and progesterone (1 uM, Sigma Chemical Co). The culture medium was replaced 30 minutes after plating to reduce epithelial cell contamination. This protocol was previously demonstrated to result in pure' decidual stromal cells through the absence of immunocytochemical staining for the markers vimentin (fibroblast), cytokeratin (epithelial), muscle actin (muscle cells), and factor VIII (endothelial) (chou et al., 2002). 2.2: Experimental Culture Conditions Decidual stromal cells (passage 2) were plated in 35 mm 2 tissue culture dishes (Becton Dickinson and Co, Franklin Lakes, NJ) at a density of 1 x 105 cells/dish and grown to 80%> confluence. The cells were starved for 24 hours before cultured in the presence of increasing concentrations of IL-ip (0, 1, 10, 100 or 1000 IU/ml), or TGF-p l (0, 0.1, 1, 5, or 10 ng/ml) for 24 hours or a fixed concentration of IL- lp (100 IU/ml) or TGF-pl (5 ng/ml) for 0, 6, 12, 24 or 48 hours. The concentrations of cytokines used in these studies are based upon previous studies (Huang et al., 1998). To block the regulatory effects of IL- lp and TGF-pl on ADAMTS-1 mRNA and protein expression levels in these primary cell cultures, decidual stromal cells were cultured in the presence of either IL- ip (100 JJJ) in combination with a monoclonal antibody directed against human IL-ip (1 ug/ml or 2 ug/ml; Sigma Aldrich) for 24 hours, or with TGF-pi (5 ng/ml) alone, or in combination with a monoclonal antibody directed against human TGF-pi (10 ug/ml; Sigma Aldrich, St Louis, MO). 35 A l l of the primary cultures of decidual cells were harvested for either total R N A or protein extraction. 2.3: RNA Preparation and Synthesis of First Strand cDNA Total R N A was prepared from decidual tissues cell cultures using the Tri-Reagent (Bio/Can, Mississauga, Canada) using a protocol recommended by the manufacturer. The concentration of total R N A present in each of the extracts was quantified by optical densitometry (260/280nm) using a DU-64 UV-spectrophotometer (Beckman Coulter). R N A prepared from the decidual stromal cells was reverse-transcribed into cDNA using a First Strand cDNA Synthesis Kit according to the manufacturer's protocol (Amersham Pharmacia Biotech, Oakville, Canada). A n aliquot (1 jag) of the total R N A dissolved in DNase/ RNase-free water (8 u.1 in total) was heated at 65 °C for 10 minutes and cooled on ice for 5 minutes. Dithiothreitol (DTT) (1 ul), oligo-dT (1 ul) and bulk mixture (dATP, dCTP, dGTP, dTTP) (5 ul) was added to the sample, and the mixture was incubated at 37 °C for 1 hour. After incubation, the sample was boiled for 10 minutes to inactivate reverse transcriptase and subsequently stored at -20 °C until use. Several controls were included to determine the accuracy of the PCR. Firstly, PCR amplification was performed in both the absence of cDNA and reverse transcription reaction to examine the cross-contamination of samples. Secondly, the integrity of the RNA samples was confirmed by gel electrophoresis. In addition, the parallel PCR 36 amplification of G A P D H was performed to determine the quality of the isolated R N A and rule out the possibility of R N A degradation. Lastly, since all primer pairs spanned at least one intron, the size of the predicted PCR products ruled out the presence of contaminating genomic D N A in the R N A sample. 2.3.1: Design of Oligonucleotide Primers Nucleotide sequences specific for human ADAMTS-1 through -12 cDNAs were identified in the Genebank database using the B L A S T (Basic Local Alignment Search Tool) computer program (NCBI, Bethesda, MD). Forward and reverse oligonucleotide primers corresponding to these D N A sequences and primers specific for GAPDH, which served as an internal control for these studies, were synthesized at the NAPS Unit, University of British Columbia. In addition, a competitive forward primer for ADAMTS-1 was designed through the incorporation of an additional 10 base pairs into 3' end of original forward primer (Fig. 2). The specific nucleotide sequences of these primers, PCR product sizes and corresponding position in cDNA are listed in Table 4. The specific nucleotide sequences of the primers, the optimized PCR conditions for each of these primer sets, and the expected sizes of the PCR products for the semi-quantitative analysis of A D A M T S subtypes mRNA levels are listed in Table 5. 37 620 bp wild type cDNA r 5-CGAGTGTGCAAAGGAAGTGA -3' 5' 2931 5-TCCCAACCCCCATGATACTA-3' 3231 3240 3' 5' 2931 3231 3240 3' L 5-CGAGTGTGCAAAGGAAGTGAGCGTATCTTG-3' 5-TCCCAACCCCCATGATACTA-3' I 321 bp competitive cDNA Figure 2. Representative schematic diagrams summarizing construction of a competitive PCR primer for ADAMTS-1. An internal standard fragment (321 bp) was constructed by deletion of a 299 bp fragment from the target cDNA (620 bp). 38 mRNA Primers 5*-3' Size(bp) Position cDNA ADAMTS-1 Forward (5' end) Reverse (3'end) CGAGTGTGCAAAGGAAGTGA ATCATAGTACCCCCAACCCT 620 2912-2931 3530-3511 ADAMTS-1 Competitive(5' end) Reverse (3'end) CGAGTGTGCAAAGGAAGTGAGCGTATCTTG ATCATAGTACCCCCAACCCT 321 2912-2931,3231-3240 3530-3511 Table 4. Primer sequences, and their corresponding position in cDNA for the QC-PCR analysis of ADAMTS-1 mRNA levels in decidual stromal cells. A forward and a reverse primers produce a 620 bp target cDNA and a competitive forward primer and a reverse primer produce a 321 bp internal standard cDNA. 39 Table 5. Primer sequences and PCR conditions for the semi-quantitative analysis of ADAMTS subtype mRNA levels. Primer Sequence Estimated PCR Condition PCR Product Size ADAMTS-1 Forward: 5' - C G A G T G T G C A A A G G A A G T G A - 3 ' Reverse: 5'- C T A C C C C C A T A A T C C C A C C T - 3 ' 399bp Denaturing: 94°C 30s Annealing: 65 °C 30s Extension: 72 °C 60s 35 cycles ADAMTS-2 Forward: 5 ' -CCTATGACTGGCTGCTGGAT-3 ' Reverse: 5 ' - C T C C C A A A G T G C T G G G A T A A - 3 ' 310bp Denaturing: 94°C 30s Annealing: 65 °C 30s Extension: 72 °C 60s 35 cycles ADAMTS-3 Forward: 5 ' -CTGTGGTGGAGGTTTCCAGT-3 ' Reverse: 5 ' -CTGACCGACTCAGGCTTTTC-3 ' 444bp Denaturing: 94°C 30s Annealing: 65 °C 30s Extension: 72 °C 60s 35 cycles ADAMTS-4 Forward: 5'- A A T C C A G G G T G G T G G T G A T A - 3 ' Reverse: 5'- T A C T C A G G A G G C T G A G G C A T - 3 ' 349bp Denaturing: 94°C 30s Annealing: 60 °C 30s Extension: 72 °C 60s 35 cycles ADAMTS-5 Forward: 5'- GGCCATGGTAACTGTTTGCT-3 ' Reverse: 5'- CCTCTTCCCTGTGCAGTAGC-3 ' 444bp Denaturing: 94°C 30s Annealing: 65 °C 30s Extension: 72 °C 60s 35 cycles ADAMTS-6 Forward: 5'- T G A C A G T C C A G C A C C T T C A G - 3 ' Reverse: 5'- CTACGTGCTTGCATTCTCCA-3 ' 340bp Denaturing: 94°C 30s Annealing: 60 °C 30s Extension: 72 °C 60s 35 cycles ADAMTS-7 Forward: 5'- C C A T G T G G T G T A C A A G C G T C - 3 ' Reverse: 5'- GGTCCTCCTCCTCATCTTCC-3 ' 389bp Denaturing: 94°C 30s Annealing: 55 °C 30s Extension: 72 °C 60s 35 cycles 40 Table 5. Cont'd ADAMTS-8 Forward: 5'- A A G A A G A G G A G G C A G A A G G C - 3 ' Reverse: 5'- T C T G T C T G G T G A G C A G G A T G - 3 ' 380bp Denaturing: 94°C 30s Annealing: 65 °C 30s Extension: 72 °C 60s 35 cycles ADAMTS-9 Forward: 5'- C C C A G C C T G G A C A C A T T A C T - 3 ' Reverse: 5'- C A T T A G C C T G G A C T C C C A C A - 3 ' 428bp Denaturing: 94°C 30s Annealing: 65 °C 30s Extension: 72 °C 60s 35 cycles ADAMTS-10 Forward: 5'- C A A T G T C C T C A T T G A C G C T G - 3 ' Reverse: 5'- C T G G G A A G C A C C G T T A A C A T - 3 ' 360bp Denaturing: 94°C 30s Annealing: 65 °C 30s Extension: 72°C60s 35 cycles ADAMTS-12 Forward: 5'- G T G C A G C G A G G A G T A C A T C A - 3 ' Reverse: 5'- GCGTTTTCTTTCTCCAGTGC-3 ' 488bp Denaturing: 94°C 30s Annealing: 65 °C 30s Extension: 72 °C 60s 35 cycles G A P D H Forward: 5 ' -ATGTTCGTCATGGGTGTGAACCA-3 Reverse: 5 ' -TGGCAGGTTTTTCTAGACGGCAG-3 : 373bp Denaturing: 94°C 30s Annealing: 55 °C 30s Extension: 72 °C 90s 25 cycles 41 To confirm the specificity of the primers, the amplified PCR products were sub-cloned into the PCR II vector (Invitrogen, Carlsbad, CA) by blunt-end ligation and subjected to nucleotide sequence analysis using an automated DNA sequence analyzer (Applied Biosystems, Foster City, CA) employing Taq DiDeoxy reagents (Performed by DNA Sequencing Core Facility, CMMT, University of British Columbia). 2.32: Semiquantitative RT-PCR PCR was performed using the primer sets specific for ADAMTS-1 through -12, and template cDNA generated from the total RNA extracts prepared from the first trimester decidua or stromal cells isolated from these tissues. PCR reaction mixtures containing non-reverse transcribed RNA or water will be used as negative controls and placenta cDNA as positive control. The PCR cycles were carried out 20-40 times to determine a linear relationship between the yield of PCR products and cycle number. 2.4: Quantitative Competitive-Polymerase Chain Reaction (QC-PCR) c The QC-PCR strategy employed in these studies was based upon the competitive co-amplification of known amounts of a competitive ADAMTS-1 PCR product added to the aliquots of first strand cDNA prepared from the primary cultures of decidual stromal cells cultured in the presence or absence of IL-1 p or TGF-P1. Semi-quantitative PCR was also performed using template cDNA generated from the 42 total RNA extracts prepared from cultures of untreated decidual stromal cells and the primers specific for ADAMTS-1. The PCR conditions were as follows: 1 min at 94 °C, 1 min at 58.5 °C and 1.5 mins at 72 °C followed by a final extension at 72 °C for 15 min. The cycles were repeated 28 times. The 620 bp ADAMTS-1 PCR product was resolved using gel (2%) electrophoresis and visualized by ethidium bromide staining. An aliquot of the eluted 620 bp fragment was then subcloned into the PCR U vector (Invitrogen, Carlsbad, CA) and subjected to DNA sequence analysis to confirm the specificity of the primers. Similarly, PCR amplification template cDNA generated from the decidual stromal cell cultures using a combination of the reverse primer specific for ADAMTS-1 and the corresponding competitive primer yielded a truncated cDNA fragment of the expected size of 321 bp. This PCR product was also subcloned into the PCR JJ vector and subjected to DNA sequence analysis to confirm the specificity of these primer sets. To determine the ideal amounts of each template to be added to the reaction mixtures, PCR was performed using fixed amounts of the target ADAMTS-1 cDNA (lpl) and decreasing concentrations of the corresponding internal standard cDNA obtained by serial dilution of the first strand cDNA preparations (1- 0.003907 pg/pl for ADAMTS-1). One microliter each of the mutant and native cDNA mix were added to 23 ul PCR-Mastermix containing 1.5 mmol/liter MgCl2 solution, 10X PCR buffer minus Mg 2 +, 0.2 mmol/liter of each deoxy-nucleoside 5'-triphosphate, 2.5 U Taq polymerase (all from Life Technologies, 43 Inc.), and their corresponding paired primers (2 umol/liter) to give a total volume of 25 ul. The PCR conditions and number of cycles were performed for the ADAMTS-1 primer sets as described above. An aliquot (lOul) of the PCR reaction mixture containing the two distinct ADAMTS-1 PCR products was subjected to electrophoresis in a 1% agarose gel and visualised by ethidium bromide stainining (Refer to Figure 4 at Part HI. Results). The intensity of the eithidium bromide staining of the PCR products was analysed using UV densitometry (Biometra, Whiteman Co., Gottigen, German). Volume counts (mm2) of the PCR products were then determined using the Scion Image computer software (Scion Image Co, Frederick, Maryland). The absorbance values obtained for each of the target and corresponding internal standard were plotted against the amount of internal standard added to the initial reaction mixtures, with the point of interception on these line graphs being taken as the optimal amount of internal standard to be used in the QC-PCR analysis. The intensity of the ethidium bromide staining of an aliquot (10 ul) of a 100-bp DNA ladder (Life Technologies Inc, Mississauga, Ontario, Canada) served as an internal standard. PCR was also used to co-amplify the optimized amounts of the ADAMTS-1 internal standard cDNA and increasing amounts of the corresponding target cDNA (1-0.003907 pg/ul). The ratios of the intensitity of the eithidium bromide staining of the resultant target: internal standard PCR product generated in each tube were logarithmically transformed and plotted against the log amount of target cDNA initially added to the PCR reaction (Refer to Figure 5 at Part III. Results). This standard curve was highly reproducible and linear. The 44 values obtained from this regression curve (y = b+mx) was subsequently used to quantify the levels of the ADAMTS-1 mRNA transcript present in the decidual stromal cell cultures. Based upon these initial observations, an aliquot containing 0.0625 pg of the competitive ADAMTS-1 cDNA was subsequently added to each aliquot of the first strand cDNA generated from our human decidual stromal cell cultures and subjected to QC-PCR. QC-PCR was performed using ADAMTS-1 primer sets and the PCR conditions described above, with 1 ul of the first strand cDNA synthesized from each of the decidual stromal cell cultures. The ratios of native:competitive ADAMTS-1 cDNAs were determined as described above, logarithmically transformed and compared with the values obtained from the standard curve. 2.5: Western Blot Analysis Decidual stromal cell cultures were treated with IL-1B and TGF-pl in the presence or absence of their neutralizing inhibitor for 2 hours were washed three times in cold 1% PBS and incubated in 100 pi of cell lysis buffer (25 mM Tris HC1, pH 7.6 containing 2% Nonidet P-40, 50 mM NaCl, 0.5% sodium deoxycholate, 0.2% SDS, 1 mM phenylmethylsulfonyl fluoride, 50 pg/ml aprotinin, and 50 uM leupeptin) at 4 °C for 30 minutes on a rocking platform. The cell lysates were clarified by centrifugation in an Eppendorf microcentrifuge for 20 minutes. The concentration of protein in the supernatants was determined using the BCA kit (Pierce Chemicals, Rockford, IL). The supernatants (20 pg protein) were mixed with 4X Laemmli sample buffer and boiled for 5 min. Western 45 blots were prepared and immunoblotted as previously described (MacCalman et al., 1996). Prepared samples were electrophoresed through a 12% SDS-polyacrylamide gel and the separated proteins were then electrophoretically transferred onto nitrocellulose membrane (Hybond-C, Amersham-Pharmacia Biotech, Morgan, Canada). Membranes were incubated in blocking buffer (TTBS; 25mM Tris-HCl, pH 8.0, 125 mM NaCl, 0.1% Tween 20) (containing 5% skim milk) for 90 minutes at room temperature; then a polyclonal rabbit antibody directed against the carboxyl terminus of human ADAMTS-1 (Biodesign International, Saco, ME) (1:1000) was added to the blocking buffer (IX TTBS with 5% skim milk) (lOml/membrane), and blots were incubated overnight at 4°C. The blots were rinsed and washed three times (10 min each) in IX TTBS without skim milk and incubated with Horseradish Peroxidase (HRP)-conjugated anti-rabbit Ig (Amersham; 1:3000 inIX TTBS with 5% skim milk) (lOml/membrane) for lhour at room temperature on a rocking platform. The Amersham ECL system was used to detect antibody bound to antigen. Membranes were visualized by exposure to Kodak X-Omat film Eastman Kodak Co., Rochester, NY) at -70 C. The resultant autoradiograms were then scanned using a laser densitometer. 2.6: Statistical Analysis Results from the densitometric quantification of DNA or protein bands respectively detected on ethidium bromide stained gels or autoradiograms obtained from Western 46 blotting were subjected to statistical analysis using GraphPad Prism 4 computer software (San Diego, CA, USA). Statistical differences were assessed using analysis of variance (ANOVA). Differences were considered significant at p < 0.05. Significant differences between the means were determined using Tukey's test. The results are presented as the mean relative absorbance (+ S.E.M), in arbitrary units, obtained from 3 independent experiments. 47 PART III. RESULTS 3.1: Multiple ADAMTS subtypes are present in first trimester decidual tissues To date, there is nothing known of the expression of any ADAMTS family members in decidual tissue. To establish which ADAMTS subtypes are expressed in early stage deciduas, primers specific for selected ADAMTS members (ADAMTS-1 through -12) were designed and utilized in a RT-PCR strategy (refer to Materials and Methods, sections 2.3.1 and 2.3.2). This revealed that mRNA transcripts encoding ADAMTS-1, -2, -3, -4, -5 (-11), -6, -7, -8, -9, -10 and -12 family members were present in first trimester decidual tissue (Fig. 3). 3.2: Dose-dependent effects of IL-lp and TGF-pl on ADAMTS-1 mRNA and protein levels in human decidual stromal cells If ADAMTS proteins play important roles in the extensive tissue remodeling that occurs during embryo implantation and through pregnancy, it is likely that their expression is dynamically and tightly regulated throughout these processes. As the gene-targeted disruption of ADAMTS-1 in mouse was shown to reduce pregnancy rates (Shindo et al., 2000), I focused on investigating the regulated expression of this ADAMTS subtype in human decidua, using a model system of cultured decidual stromal cells. IL-1 [3 and TGF-(51 were chosen as modulators because these cytokines are highly expressed during the first trimester of pregnancy (Lala et al., 1990; Graham et al., 1991; Simon et al., 1994). In addition, these cytokines are able to regulate the expression of 48 ADAMTS-1 -ve (total RNA) -ve(H20) ADAMTS-7 -ve (total RNA) -ve(H20) 3P 389bp ADAMTS-4 ADAMTS-5 ADAMTS-6 310 bp 444 bp 349 bp 444 bp 340 bp ADAMTS-8 ADAMTS-9 ADAMTS-10 ADAMTS-12 380 bp 428 bp 360 bp 488 bp Figure 3. Characterization of the ADAMTS mRNA transcripts present in human decidual tissue. RT-PCR was performed using template cDNA, synthesized from total R N A extracted from first trimester decidual tissue, and primers specific for ADAMTS -1 through-12. Total R N A and DNase/ RNase free water (H20) served as negative controls for the present studies. The sizes of the distinct PCR products are shown below each photomicrograph, bp, base pairs. 49 other proteases such as matrix metalloproteinase (MMP) and urokinase plasminogen activator (uPA) at the maternal-fetal interface (Robert et al., 1988; Lala et al., 1990; Graham et al., 1997; Huang et al., 1998). In order to quantitate ADAMTS-1 mRNA in the decidual stromal cells, (QC)-PCR was performed using a fixed amount of cDNA (1 ul) from an untreated decidual stromal cell culture, co-amplified with a serial diluted competitive c D N A (refer to Materials and Methods, section 2.4). This co-amplification determined that 0.0625 pg/ul (internal standard) ADAMTS-1 mRNA transcript was present in these cells (Fig. 4). A standard curve was then generated by co-amplifying a fixed concentration of competitive cDNA (0.0625 pg/ul) and a decreasing concentration of target cDNA (Fig. 5). This standard curve was highly reproductive and linear. The values obtained from a regression curve (y= b+mx) was subsequently used to quantify the levels of the ADAMTS-1 mRNA transcript present in the decidual stromal cultures. Similarly, a protein species of approximately 110 kDa corresponding to the proform of ADAMTS-1 was detected in the primary decidual stromal cell cultures by Western blotting of cell lysates with ADAMTS-1 antibody (Figs. 6-9). Increasing concentrations of IL-1B increased the levels of the ADAMTS-1 mRNA transcript present in these cells in a dose-dependent manner (Fig. 6A). However, significant increases in ADAMTS-1 mRNA levels were only observed in decidual stromal cells treated with the higher concentrations of IL-1B (100 and 1000 IU/ml) used in these studies. 50 1 2 3 4 5 6 7 8 9 620 bp 321 bp target internal standard (0.0625 pg/Ml> (PQ/MD 1 0.5 0.25 0.125 0.063 0.031 0.016 0.008 0.004 Figure 4. Quantification of ADAMTS-1 mRNA in human endometrial decidual stromal cells. Photomicrograph representing an ethidium bromide stained gel containing PCR products generated using a fixed amount of target cDNA (1 pi) and serial dilutions of concentrations of competitive cDNA ( 1, 0.5, 0.25, 0.125, 0.063, 0.031, 0.016, 0.008, 0.004 pg/ul). (upper panel). The two lines in the range of 0.125-0.063 pg/ul internal standard cDNA, indicating that approximately 0.0625 pg ADAMTS-1 cDNA could be detected by RT of 1 ug total R N A (lower panel). 51 Figure 5. Generation of a standard curve for ADAMTS-1 mRNA in human endometrial decidual stromal cells. Photomicrograph of an ethidium bromide stained gel containing PCR products generated using a decreasing amount of taget cDNA co-amplified with 0.0625 pg/|xl competitive cDNA using the primer set specific for A D A M T S - 1 . The resultant sizes of the PCR products were compared to a 100-bp ladder (marked M , on the left side of the photomicrograph). The densities of the ethidium bromide staining of the ratio of target and competitive cDNA produced from these reaction mixtures were determined using U V densitometry (upper panel). The log amount of target cDNA (pg) is shown in the graph. 52 Figure 6. Expression of ADAMTS-1 in decidual cells cultured in the presence of increasing concentrations of IL-ip. A , Representative photomicrograph of an ethidium-stained gel containing QC-PCR products generated by using template cDNA produced from endometrial decidual stromal cells cultured in the presence of increasing concentrations of IL-ip. QC-PCR analysis of ADAMTS-1 mRNA levels in decidual cells cultured in the presence of 0, 1, 10, 100, 1000 IU of IL-ip. The sizes of the resultant target (620 bp) and internal standard (321 bp) co-amplification PCR products relative to a 100-bp ladder (M) are marked on the right of the photomicrograph. The results derived from this analysis as well as the other two studies are represented (mean + SEM, n=3) in the bar graphs (*, PO.001 vs. untreated control). B, Western blot analysis of ADAMTS-1 expression in protein extracts (20(j,g) prepared from decidual stromal cells cultured in the presence of 0, 1, 10, 100, 1000 IU of IL- lp for 24 hours (lanes 1-5 respectively). The results derived from this analysis and two other studies are represented (mean + SEM, n=3) in the bar graphs (*, PO.001 vs. untreated control). 53 M 1 2 3 4 5 0 1 10 100 1000 IL-1p (lU/ml) 1 2 3 4 5 0 1 10 100 1000 IL-1p (Ill/ml) 54 IL-lp at 100 IU/ml induced approximately a 2.1-fold increase in ADAMTS-1 mRNA, while 1000 IU/ml induced an approximate 3-fold increase. In agreement with the results obtained using QC-PCR, JL-ip increased ADAMTS-1 protein expression levels in decidual stromal cells cultures in a dose-dependent manner (Fig. 6B). In excellent correspondence with the fold-increases in mRNA, ADAMTS-1 protein expression was increased 2.4-fold by 100 IU/ml of IL-ip, and 2.8-fold by 100 IU/ml of IL-lp. In contrast, TGF-pl decreased ADAMTS-1 mRNA levels in a dose-dependent manner. A significant decrease in ADAMTS-1 mRNA was observed only in primary cultures of decidual stromal cells treated with the higher concentrations of TGF-pi (5 ng and 10 ng/ml) used in these studies (Fig. 7A). TGF-pi at 5 ng/ml induced a 2.6-fold decrease in ADAMTS-1 mRNA, while treatment with 10 ng/ml TGF-pi resulted in a 5-fold decrease in ADAMTS-1 mRNA expression. TGF-pl treatment also reduced ADAMTS-1 protein expression levels in primary cultures of decidual stromal cells in a dose-dependent manner (Fig. 7B). In accord with the fold-decreases in mRNA, ADAMTS-1 protein expression was decreased 2.8-fold and 5-fold by 5 and 10 ng/ml of TGF-pi, respectively. 55 Figure 7. Expression of A D A M T S - 1 in decidual cells cultured in the presence of increasing concentrations of TGF-pi. A , Representative photomicrograph of an ethidium-stained gel containing QC-PCR products generated by using template cDNA produced from endometrial decidual stromal cells cultured in the presence of increasing concentrations of TGF-p l . QC-PCR analysis of ADAMTS-1 mRNA levels in decidual cells cultured in the presence of 0, 0.1, 1, 5, or 10 ng of TGF-pi for 24 hours (lanes 1-5 respectively). The sizes of the resultant target (620 bp) and internal standard (321 bp) co-amplification PCR products relative to a 100-bp ladder (M) are marked on the right of the photomicrograph. The data derived from this analysis as well as those from 2 other studies were standardized to the mean obtained from the untreated control and are represented (mean + SEM, n=3) in the bar graphs (*, P<0.001 vs. untreated control). B, Western blot analysis of ADAMTS-1 expression in protein extracts (20ug) prepared from decidual stromal cell cultures. Decidual cells were cultured in the presence of 0, 0.1, 1, 5, or 10 ng of TGF-pi for 24 hours (lanes 1-5 respectively). The data derived from this analysis and two other studies are represented (mean + SEM, n=3) in the bar graphs (*, .PO.001 vs. untreated control). 56 A 0 0.1 1 5 10 TGF-B1 (ng/ml) 1 2 3 4 5 4 - 1 1 0 kDa 0 0.1 1 5 10 TGF-p1 (ng/ml) 57 3.3: Time-dependent effects of IL-lp and TGF-pl on ADAMTS-1 mRNA and protein levels in human decidual stromal cells JJL-pi (100 IU/ml) caused a significant increase in ADAMTS-1 mRNA transcription levels after 24 hours of culture with maximum levels being detected in cells cultured in the presence of this cytokine for 48 hours (Fig. 8A). Treatment with IL-pl (100 IU/ml) for 24 hours induced approximately a 2.6-fold decrease in ADAMTS-1 mRNA, while the same treatment for 48 hours induced approximately a 2.9-fold increase. In excellent correspondence with the fold-increases in mRNA, ADAMTS-1 protein expression in decidual stromal cell cultures was increased 2.4-fold by treatment with DL-pi (100 IU/ml) for 24 hours, and increased 2.5-fold upon treatment for 48 hours (Fig. 8B). In contrast, a significant decrease in ADAMTS-1 mRNA transcription levels was detected in decidual stromal cells cultured in the presence of TGF-pi (5 ng/ml) for 24 and 48 hours (Fig. 9A). Treatment with TGF-pi (5 ng/ml) for 24 hours induced approximately a 2.4-fold decrease in ADAMTS-1 mRNA, while the same treatment for 48 hours induced approximately a 5.4-fold in these primary cell cultures. In agreement with the results obtained using QC-PCR, ADAMTS-1 protein expression level decreased 2.2-fold upon treatment with 5 ng/ml TGF-pi for 24 hours, and 4-fold after the same treatment for 48 hours (Fig. 9B). 58 Figure 8. Time-dependent effects of IL-lp on ADAMTS-1 in decidual stromal cells. A , QC-PCR analysis of ADAMTS-1 mRNA levels in decidual cells cultured in the presence of IL- ip (100 IU) for 0, 6, 12, 24, or 48 hours (lanes 1-5, respectively). The sizes of the resultant target and internal standard PCR products relative to a 100-bp ladder (lane M) are marked to the right of the photomicrograph. The absorbance values obtained from three independent studies are represented (mean + SEM, n=3) in the bar graphs below (*, PO.001 vs. untreated control). B, Western blot analysis of ADAMTS-1 expression in protein extracts (20p,g) prepared from decidual stromal cells cultured in the presence of IL-1 P (100 IU) for 0, 6, 12, 24, or 48 hours (lanes 1-5, respectively). The data derived from this analysis as well as those from two other studies were standardized to the mean obtained from the untreated control and are represented (mean + SEM, n=3) in the bar graphs (*, PO.001 vs. 0 hours control). 59 60 Figure 9. Time-dependent effects of TGF- pi on ADAMTS-1 expression in decidual stromal cells. A , QC-PCR analysis of ADAMTS-1 mRNA levels in decidual cells cultured in the presence of TGF- pi (5 ng) for 0, 6, 12, 24, or 48 hours (lanes 1-5, respectively). The sizes of the resultant target and internal standard PCR products relative to a 100-bp ladder (lane M) are marked to the right of the photomicrograph. The absorbance values obtained from three independent studies are represented (mean + SEM, n=3) in the bar graphs below (*, PO.001 vs. untreated control). B, Western blot analysis of ADAMTS-1 expression in protein extracts (20ug) prepared from decidual stromal cells cultured in the presence of TGF-pi (5ng) for 0, 6, 12, 24, or 48 hours (lanes 1-5, respectively). The data derived from this analysis as well as from two other studies were standardized to the mean obtained from the untreated control and are represented (mean + SEM, n=3) in the bar graphs (*, PO.001 vs. 0 hours control). 61 TGF-(31 5 ng (h) 1 2 3 4 5 0 6 12 24 48 TGF-p1 5 ng (h) 62 3.4: Attenuation of cytokine-modulated ADAMTS-1 mRNA and protein levels in human decidual stromal cells using monoclonal antibodies directed against IL~pi or TGF-pi The IL-ip-mediated increase in ADAMTS-1 mRNA levels in human decidual stromal cells was abolished by the addition to the culture medium of a monoclonal antibody directed against this cytokine. IL-ip at 100 IU/ml together with anti-IL-ip antibody at 1 ug/ml induced approximately a 1.8-fold decrease in ADAMTS-1 mRNA compared to the control treatment (IL-lp at 100 IU/ml), while IL-ip at 100 IU/ml together with anti-IL-ip antibody at 2 ug/ml induced approximately a 2.1-fold decrease in ADAMTS-1 mRNA compared to the control treatment (IL-ip at 100 IU/ml) (Fig. 10A). In accord with these fold-decreases in mRNA, ADAMTS-1 protein expression was decreased 1.6-fold by 100 IU/ml of IL-lp together with anti-IL-lp antibody at 1 ug/ml, and 1.8-fold by 100 IU/ml of IL-1 p together with anti-IL-1 p antibody at 2 ug/ml (Fig. 10B). The decrease in ADAMTS-1 mRNA transcription levels observed in decidual stromal cells cultured in the presence of TGF-pl alone was inhibited by the simultaneous addition of antibody directed against this growth factor. TGF-pl at 5 ng/ml together with anti-TGF-pi antibody at 10 ug/ml induced approximately a 2.1-fold increase in ADAMTS-1 mRNA compared to the control (TGF-pi at 5 ng/ml) (Fig. 11 A). A similar fold-increase (1.8-fold) in ADAMTS-1 protein expression was observed under these conditions (Fig. 1 IB). 63 Figure 10. Effects of anti- IL-ip neutralizing monoclonal antibody on ADAMTS-1 mRNA and protein levels in decidual stromal cells cultured in the presence of IL-ip. A , QC-PCR analysis of ADAMTS-1 mRNA levels in untreated decidual cells (lane 1) or cells cultured in the presence of a fixed amount of IL-1 P (100 IU) and increasing amounts (0, 1 p.g or 2p.g) of the anti- IL-1 P antibody for 24 hours (lanes 2-4). The sizes of the resultant target and internal standard PCR products relative to a 100-bp ladder (lane M) are marked to the right of the photomicrograph. The absorbance values obtained from three independent studies are presented (mean + SEM) in the bar graphs below. **, P<0.01; *, P< 0.001 (vs. treatment with of IL-1 p alone). B, Western blot analysis of ADAMTS-1 expression levels in protein extracts (20ixg) prepared from untreated decidual stromal cells (lane 1) or cells cultured in the presence of a fixed amount of IL-1 P (100 IU) and increasing amounts (0, 1 p,g or 2fj.g) of the anti- IL-1 P antibody for 24 hours (lanes 2-4). Data are shown as the mean of three independent studies + S E M in the bar graphs. **, P<0.01; *, P< 0.001 (vs. treatment with IL-lp alone). 64 65 Figure 11. Effects of anti-TGF-pi neutralizing monoclonal antibody on ADAMTS-1 mRNA and protein levels in decidual stromal cells cultured in the presence of TGF-pl. A , QC-PCR analysis of ADAMTS-1 mRNA levels in untreated decidual cells (lane 1) or cells cultured in the presence of a fixed amount of TGF-(31 (5 ng) and increasing amounts (0 or 10 pg) of the anti- TGF-pi antibody for 24 hours (lanes 2-3). The sizes of the resultant target and internal standard PCR products relative to a 100-bp ladder (lane M) are marked to the right of the photomicrograph. The absorbance values obtained from three independent studies are presented (mean + SEM) in the bar graphs below. ***, P<0.05 (vs. treatment with of TGF- pi alone). B, Western blot analysis of ADAMTS-1 expression levels in protein extracts (20 ug) prepared from untreated decidual stromal cells (lane 1) or cells cultured in the presence of a fixed amount of TGF-pi (5 ng) and increasing amounts (0 or 10 pg) of the anti- TGF-pi antibody for 24 hours (lanes 2-3). Data are shown as the mean of three independent studies mean + S E M in the bar graphs. ***, PO.05 (vs. treatment with of TGF- pi alone). 66 67 PART IV. DISCUSSION AND CONCLUSION 4.1: Discussion: Multiple ADAMTS subtypes were detected in first trimester human decidual tissues. To date, the biological significance of ADAMTS-1 to -12 expression in this dynamic tissue remains to be elucidated. Here, I report that ADAMTS-1 is expressed in primary cultures of stromal cells isolated from first trimester human decidual tissues. I have also determined that IL-ip increased ADAMTS-1 mRNA and protein levels, whereas TGF-pi decreased ADAMTS-1 mRNA and protein levels in these primary cell cultures in both a dose- and time-dependent manner. ADAMTS-1 mRNA transcripts are present, albeit at low levels, in a wide variety of adult human tissues including term placenta and non-pregnant uterine tissues (Bornstein et al., 1994; Gantt et al., 1997; Magnetto et al., 1998; Zimmermann et al., 2001). ADAMTS-1 expression has been detected in uterine tissues of pregnant mice (Shindo et al., 2000). The present study is the first demonstration that ADAMTS-1 is expressed in the human endometrium during early pregnancy. However, the role of this novel metalloproteinase in the morphological and functional differentiation of the mouse uterus remains unclear. Endometrial tissues of ADAMTS-1-null mice have been shown to develop large cysts and are capable of undergoing decidualisation (Shindo et al., 2000; Mittaz et al., 2004). 68 However, both studies reported reduced pregnancy rates in these gene-knockout mice, suggesting that ADAMTS-1 plays a critical role during early pregnancy. Although it is still not known whether ADAMTS-1 expression is spatiotemporally regulated in the human endometrium during the menstrual cycle, its expression in both the human placenta and decidua strengthen my hypothesis that this novel metalloproteinase mediates, at least in part, the tissue remodeling events that occur at the maternal-fetal interface during pregnancy. ADAMTS-1 is a secreted, multifunctional protein with a multidomain structure. It possesses an amino terminal prodomain, a catalytic domain, a disintegrin-like domain, and an E C M binding domain composed of a central thrombospondin (TSP) type 1 motif, a spacer region and 3 TSP-like motifs (Tang et al., 2000) (refer to overview, sections 1.6.1). The proteolytic (catalytic) domain of ADAMTS-1 has been associated with the selective degradation of the E C M under normal and pathological conditions. For example, in the ovary, ADAMTS-1 has been shown to have a non-redundant role in the degradation of the follicle wall during ovulation and it facilitates the transport of the oocyte through the oviduct by mediating, at least in part, the expansion of the cumulus-oocyte complex (Russell et al., 2003). Similarly, the proteolytic activity of ADAMTS-1 has been associated with local tissue invasion in cancer (Masui et al., 2001), and with the degradation of cartilage in osteoarthritis (Kuno et al., 2000). The development of inflammation associated with these two diseases or in response to trauma has also been linked to the enzymatic capacity of this 69 protein (Kuno et al., 1997). ADAMTS-1 has also been shown to have potent angio-inhibitory properties in vitro (Vazquez et al.,1999). However, increased ADAMTS-1 expression had no significant effect on the vascularisation of colon carcinomas in vivo (Masui et al., 2001). Furthermore, ADAMTS-1 appears to be necessary for the formation of the adrenomedullary capillary network during embryonic development (Mittaz et al., 2004). Collectively, these observations suggest that the angio-inhibitory/angiogenic activities of ADAMTS-1 are dependent upon the tissue, developmental stage, or the disease state. To date, the biological significance of ADAMTS-1 in the human decidua remains unclear although remodeling of the ECM and maternal vasculature are both key developmental events underlying the establishment and maintenance of pregnancy in humans. Consistent with our observations, IL-1 has been shown to increase ADAMTS-1 in mouse colon carcinoma cells (Kuno et al., 1997) and in rat motor neurons (Sasaki et al., 2001). In contrast, the presence of this cytokine has been shown to significantly reduce ADAMTS-1 mRNA levels in human articular chondrocytes (Wachsmuth et al., 2004). In the present study, I have demonstrated that IL-1 P increases and TGF-pi decreases ADAMTS-1 mRNA and protein expression in human decidual stromal cells. It is not clear whether the regulatory actions of IL-lp and TGF-pi on ADAMTS-1 mRNA and protein levels in human decidual cells are mediated directly or indirectly, possibly via alterations in the expression of other cytokines. For example, JX-1 has been shown to increase the expression of IL-6 and IL-10 in human endometrium stromal cells in vitro (Tabibzadeh et al., 1989), suggesting that IL-1 regulates a pro-inflammatory cascade in the human decidua 70 that results in the activation of proteolytic mechanisms operating at the maternal interface. Similarly, TGF-pi has been shown to decrease mRNA and protein expression levels of IL-8 in human endometrial stromal cells in vitro (Arici et al., 1996). EL-8 is a potent angiogenic factor that has reduced immunoreactivity in the human decidua during early pregnancy (Lockwood et al., 2004). Progesterone (P4) is a key regulator of decidualisation (Irwan et al., 1989). This gonadal steroid has also been shown to regulate ADAMTS-1 in the rodent ovary (Robker et al., 2000). Mice null-mutant for the P4 receptor or those treated with the P4-antagonist, epostane (Espey et al., 2000), fail to express this ADAMTS subtype in the preovulatory follicle. However, computer-based searches have failed to detect a P4 response element in the putative promoter region of the ADAMTS-1 gene (Mittaz et al., 2004) suggesting that the regulatory effects of this gonadal steroid on ADAMTS-1 expression are not mediated through direct interaction. IL-1 and TGF-pi have been shown to both promote and inhibit the biological actions of P4 on the human endometrium. For example, TGF-pi has been shown to act in concert with P4 to promote decidualisation but it opposes the stimulatory actions of this gonadal steroid on the expression of enkephalinase in endometrial stromal cells in vitro (Casey et al., 1996). Likewise, IL-lp has been shown to inhibit decidualisation (Kariya et al., 1991), but promotes secretion of the biochemical marker of decidualisation, insulin-like growth factor binding protein (Frost et al., 2000). In this study, a single ADAMTS-1 protein species of approximately 110 kDa was observed corresponding to the preform of ADAMTS-1 which was consistently expressed in 71 all of the decidual stromal cell cultures examined and was differentially regulated by IL-ip and TGF-pi in a dose- and time-dependent manner. Biochemical studies indicate that the ADAMTS-1 protein is subject to one distinct post-translational cleavage event which results in the generation of a distinct bioactive fragment of approximately 87 kDa (Longpre et al., 2004). In support of my findings, only the proform of ADAMTS-1 was detected in cultures of human chondrocytes (Wachsmuth et al., 2004). Differences in the detection of the distinct forms of ADAMTS-1 may be attributed to variations in the epitope recognized by the distinct ADAMTS-1 antibodies available or the protein extraction methods used in these studies. Alternatively, the generation of these distinct fragments, which appear to have distinct biological functions, may be cell/tissue specific and/or be dependent upon the presence of other proteolytic factors, particularly MMP-2, MMP-8 or MMP-15, which have shown to be capable of cleaving ADAMTS-1 in vitro (Rodriguez et al., 2000). 72 4.2: Conclusions In this study, I have shown that ADAMTS-1 to -12 subtypes are expressed in human decidua. Furthermore, I have demonstrated that ADAMTS-1 mRNA expression is differentially regulated by the cytokines IL-ip which induces ADAMTS-1 expression, and TGF- pi which inhibits ADAMTS-1 expression. In view of the expression of ADAMTS subtypes in human decidua and the regulatory effect of IL-lp and TGF-pi on ADAMTS-1, it is possible that other ADAMTS subtypes may also be regulated by IL-lp and TGF-pi in primary cultures of human decidual stromal cells, and play key roles in the endometrial ECM remodeling events that occur at the maternal-fetal interface during early pregnancy. The studies described in this thesis contribute to our understanding of the basic cell biology of the ADAMTS gene family. In addition, my findings provide some initial insight into the cellular mechanisms underlying the ECM remodeling events that occur in the human endometrium in preparation for pregnancy. 73 4.3: Future studies Identification of the regulatory effects of IL-ip and TGF-fll on ADAMTS-2 to -12 mRNA and protein levels in human decidual stromal cells. To determine whether other members of ADAMTS family (ADAMTS-2 to -12) are regulated by IL-ip and TGF-pi, QC-PCR and Western blotting analyses could be used to determine their mRNA and protein levels in decidual stromal cells from first trimester human decidual tissues. Cellular localization of the multiple ADAMTS subtypes present in human first trimester decidua In the present study, I examined the repertoire of ADAMTS present in the decidual tissues using a semiquantitative RT-PCR strategy. The RT-PCR approach was chosen because there are currently a limited number of antibodies available for the direct detection of members of the ADAMTS gene family. As antibodies specific for the ADAMTS subtypes identified in human decidual tissues and cells become available, the present study can be extended to determine ADAMTS protein expression and cellular localisation using Western blot and immunohistochemistry analysis. 74 Identification of the ADAMTS substrates present in human decidual tissues. To better understand the functional and molecular actions of the different ADAMTS subtypes, it is necessary to identify the various ADAMTS substrates present in the extracellular matrix of human decidua during early pregnancy. 75 REFERENCES: Abbaszade I, Liu RQ, Yang F, Rosenfeld SA, Ross OH, Link JR, Ellis DM, Tortorella MD, Pratta MA, Hollis JM, Wynn R, Duke JL, George HJ, Hillman MC, Murphy K, Wiswall BH, Copeland RA, Decicco CP, Bruckner R, Nagase H, Ito Y, Newton RC, Magdola RL, Trazskos JM, Hollis GF, Arner EC, Burn TC (1999) Cloning and characterization of ADAMTS11, an aggrecanase from the ADAMTS family. JBiol Chem 274:23442-23450. Ahonen M, Poukkula M, Baker AH, Kashiwagi M, Nagase H, Eriksson JE, Kaharvi VM (2003) Tissue inhibitor of metalloproteinases-3 induces apoptosis in melanoma cells by stabilization of death receptors. Oncogene 22:2121-2134. Alfandari D, Wolfsberg TG, White JM, DeSimone DW (1997) ADAM 13: a novel ADAM expressed in somitic mesoderm and neural crest cells during Xenopus laevis development. Dev Biol 182:314-330. Andreasen PA, Egelund R, Petersen HH (2000) The plasminogen activation system in tumor growth, invasion, and metastasis. Cell Mol Life Sci 57:25-40. Aplin JD, Charlton AK, Ayad S (1988) An immunohistochemical study of human endometrial extracellular matrix during the menstrual cycle and first trimester of pregnancy. Cell Tissue Res 253:231-240. Aplin JD (1991) Implantation, trophoblast differentiation and haemochorial placentation: mechanism evidence in vivo and in vitro. / Cell Sci 99:681-692. Aplin JD, Mylona P, Kielty CM, Ball S, Church HJ, Williams JDL, Jones CJP (1995) Collagen TV and laminin as markers of decidualisation in human endometrial stroma: In: Molecular and cellular aspects of peri-implantation processes. Ed. Dey SK 331-351. Arici A, MacDonald PC, Casey ML (1996) Modulation of the levels of interleukin-8 messenger ribonucleic acid and interleukin-8 protein synthesis in human endometrial stromal cells by transforming growth factor-beta 1. J Clin Endocrinol Metab. 81:3004-9. Artavanis-Tsakonas S, R, MD, Lake RJ (1999) Notch signaling: cell fate control and signal integration in development. Science 284:770-776. Bayliss MT, Hutton S, Hayward J, Maciewicz RA (2001) Distribution of aggrecanase (ADAMts 4/5) cleavage products in normal and osteoarthritic human articular cartilage: the influence of age, topography and zone of tissue. Osteoaerthritis Cartilage 6:553-560. Bischof P, Meisser A, Campana A (2000) Mechanisms of endometrial control of trophoblast invasion. JReprod Fertil Suppl 55:65-71. 76 Black RA, Rauch CT, Kozlosky CJ, Peschon JJ, Slack JL, Wolfson MF (1997) A metalloproteinase disintegrin that releases tumour-necrosis factor-alpha from cells. Nature 385:729-733. Black RA, White JM (1998) ADAMs: focus on the protease domain. Curr opin Cell Biol 10:654-659. Blobel CP (1997) Metalloprotease-disintegrins: links to cell adhesion and cleavage of TNF alpha and Notch. Cell 90:589-592. Bornstein P, Sage EH (1994) Thrombospondins. Methods Enzymol 245:62-85. Brown J, Wiedemann H, Timpl C (1994) Protein binding and cell adhesion properties of two laminin isoforms (AmBleB2e, AmBlsB2e) from human placenta. J Cell Sci 107:329-338. Bulmer JN, Riston A, Pace D (1990) Endometrial leucocytes in human pregnancy. TrophRes 4:431-451. Cal S, Arguelles JM, Fernandez PL, Lopes-Otin C (2001) Identification, characterization, and intracellular processing of ADAM-TS12, a novel human disintegrin with a complex structural organization involving multiple thrombospondin-1 repeats. JBiol Chem 276:17932-17940. Casey ML, MacDonald PC (1996) Transforming growth factor-beta inhibits progesterone-induced enkephalinase expression in human endometrial stromal cells. J Clin Endocrinol Metab 81:4022-7. Casslen B, Astedgt B (1983) Occurrence of both urokinase and tissue plasminogen activator in the human endometrium. Contraception 28:553-564. Chou CS, Zhu H, Shalev E, MacCalman CD, Leung PCK (2002) The effects of gonadotropin-releasing hormone (GnRH) I and GnRH II on the urokinase-type plasminogen activator/plasminogen activator inhibitor system in human extravillous cytotrophoblasts in vitro. J Clin Endocrinol Metab 87:5594-5603. Chung HY, Wen Y, Ahn JJ, Moon HS, Polan ML (2001) Interleukin-lbeta regulates urokinase plasminogen activator (u-PA), u-PA receptor, soluble u-PA receptor, and plaminogen activator inhibitor-1 messenger ribonucleic acid expression in cultured human endometrial stromal cells. J Clin Endocrinol Metab 86:1332-1340. Church HJ, Vicovac LM, Williams JD, Hey NA, Aplin JD (1996) Laminins 2 and 4 are expressed by human decidual cells. Lab Invest 74:21-32. 77 Clark ME, Kelner GS, Turbeville LA, Boyer A, Arden KC, Maki RA (2000) ADAMTS9, a novel member of the ADAM-TS/ metallospondin gene family. Genomics 67:343-350. Colige A (1997) cDNA cloning and expression of bovine procollagen I N-proteinase: a new member of the superfamily of zinc-metalloproteinases with binding sites for cells and other matrix components. Proc Natl Acad Sci 94:2374-2379. Cross JC, Werb Z, Fisher SJ (1994) Implantation and placentation: key pieces to the developmental puzzle. Science 266:1508-1518. Curry TE, Osteen KG (2001) Cyclic changes in the matrix metalloproteinase system in the ovary and uterus. Biol Reprod 64:1285-1296. Egebald M, Werb Z (2002) New function of matrix metalloproteinases in cancer progression. Nat Rev Cancer 2:161-174. Espey LL, Yoshioka S, Russell DL, Fuji S, Richards JS (2000) Ovarian expression of a disintegrin and metalloproteinase with thrombospondin motifs during ovulation in the gonadotropin-primed immature rat. Biol Reprod 62:1090-1095. Faber M, Wewer UM, Berthelsen JG, Liotta LA, Albrechsten R (1986) Laminin production by human endometrial stromal cells relates to the cyclic and pathologic state of the endometrium. Am J Pathol 124:384-391. Fata JE, Ho AT, Leco KJ, Moorehead RA, Khokha R (2000) Cellular turnover and extracellular matrix remodeling in female reproductive tissues: functions of metalloproteinases and their inhibitors. Cell Mol Life Sci 57:77-95. Fernandes RJ, Hirohata S, Engle JM, Colige A, Cohn DH, Eyre DR, Apte SS (2001) Procollagen Et amino propeptide processing by ADAMTS-3. Insights on dermatosparaxis. JBiol Chem 276:31502-31509. Frank GR, Brar AK, Cedars MI, Handwerger S (1994) Prostaglandin E2 enhances human endometrial stromal cell differentiation. Endocrinology 134:258-263. Frost RA, Nystrom GJ, Lang CH (2000) Stimulation of insulin-like growth factor binding protein-1 synthesis by interleukin-lbeta: requirement of the mitogen-activated protein kinase pathway. Endocrinology 141:3156-64. Fujikawa K, Suzuki H, McMullen B, Chung D (2001) Purification of human von Willebrand factor-cleaving protease and its identification as a new member of the metalloproteinase family. Blood 98:1662-1666. 78 Gantt SM, Clavijo P, Bai X, Esko JD, Sinnis P (1997) Cell adhesion to a motif shared by the malaria circumsporozoite protein and thrombospondin is mediated by its glycosaminoglycan-binding region and not by CSVTCG. JBiol Chem 272:19205-19213. Giudice LC (1994) Growth factors and growth modulators in human uterine endometrium: their potential relevance to reproductive medicine. Fertil Steril 61:1-17. Giunta C, Seperti-Furga A, Spranger S, Cole WG, Steinmann B (1999) Ehlers-Danlos syndrome type VII: clinical features and molecular defects. J Bone Jt Surg Am Vol 81:225-238. Goffin F, Munaut C, Frankenne F, Perrier D'Hauterive S, Beliard A, Fridman V, Nervo P, Colige A, Foidart JM (2003) Expression pattern of metalloproteinases and tissue inhibitors of matrix-metalloproteinases in cycling human endometrium. Biol Reprod 69:976-84. Graham CH, Lala PK (1991) Mechanism of control of trophoblast invasion in situ. J Cell Physiol 148:228-234. Graham CH, Lysiak JJ, McCraeKR, LalaPK (1992) Localization of transforming growth factor-beta at the human fetal-maternal interface: role in trophoblast growth and differentiation. Biol Reprod 46:561-572. Graham CH, Lala PK (1992) Mechanisms of placental invasion of the uterus and their control. Biochem Cell Biol 70:867-74. Graham CH, McCrae KR, Lala PK (1993) Molecular mechanisms controlling trophoblast invasion of the uterus. Trophoblast Res 7:237-250. Graham CH (1997) Effect of transforming growth factor-beta on the plasminogen activator system in cultured first trimester human cytotrophoblasts. Placenta 18:137-43. Granstrom L, Ekman G, Ulmsten U (1989) Changes in the connective tissue of corpus and cervix uteri during ripening and labour in term pregnancy. Br J Obstet Gynaecol 96:1198-202. Granstrom L,Ekman G, Malmstrom A (1991) Insufficient remodelling of the uterine connective tissue in women with protracted labour. Br J Obstet Gynaecol 98:1212-16. Hampton AL, Salamonsen LA (1994) Expression of messenger ribonucleic acid encoding matrix metalloproteinases and their tissue inhibitors is related to menstruation. J Endocrinol 141:R1-R3. 79 Hampton AL, Butt AR, Riley SC, Salamonsen LA (1995) Tissue inhibitors of metalloproteinases in endometrium of ovariectomized steroid-treated ewes and during the estrous cycle and early pregnancy. Biol Reprod 53:302-311. Hertig AT, Rock J, Adams EC (1956) A description of 34 human ova within the first 17 days of development. Am JAnat 98:297-328. Higuchi T, Kanzki H, Nakayama H, Fujimoto M, Hatayama H, Kojima K (1995) Induction of tissue inhibitor of metalloproteinase 3 gene expression during in vitro decidualization of human endometrial stromal cells. Endocrinology 136:4973-4981. Huang HY, Wen Y, Irwin JC, Kruessel JS, Soong YK, Polan ML (1998) Cytokine-mediated regulation of 92-kilodalton type IV collagenase, tissue inhibitor or metalloproteinase-1 (TIMP-1), and TIMP-3 messenger ribonucleic acid expression in human endometrial stromal cells. J Clin Endocrinol Metab 83:1721-1729. Hurskainen TL, Hirohata S, Seldin MF, Apte SS (1999) ADAM-TS5, ADAM-TS6, and ADAM-TS7, novel members of a new family of zinc metalloproteases. General features and genomic distribution of the ADAM-TS family. JBiol Chem 274:25555-25563. Ikenaka Y, Yoshiji H, Kuriyama S, Yoshii J, Noguchi R, Tsujinoue H, Yanase K, Namisaki T, hnazu H, Masaki T, Fukui H (2003) Tissue inhibitor of metalloproteinases-1 (TIMP-1) inhibits tumor growth and angiogenesis in the TIMP-1 transgenic mouse model. Int J Cancer 105:340-346. Irwin JC, Kirk D, Gwatkin RBL (1996) Human endometrial matrix metalloproteinase-2, a putative menstrual proteinase. Hormonal regulation in cultured stromal cells and messenger RNA expression during the menstrual cycle. J Clin Invest 97:438-447. Irwin JC, Kirk D, King RJ Quigley MM, Gwatkin RB (1989) Hormonal regulation of human endometrial stromal cells in culture: an in vitro model for decidualization. Fertil Steril 52:761-768. Izumi Y, Hirata M, Hasuwa H, Iwamoto R, Umata T, Miyakato K (1998) A metalloprotease-disintegrin, MDC9/meltrin-gamma/ADAM9 and PKCdelta are involved in TPA-induced ectodomain shedding of membrane-anchored heparin-binding EGF-like growth factor. EMBO J17: 7260-7272. Jean ML, Richard L (2004) JBiol chem (Paper in press). Jeon OH, Kim DS (1999) Molecular cloning and functional characterization of a snake venom metalloprotease. Eur J Biochem 263:526-533. 80 Jeziorska M , Nagase H , Salamonsen L A , Wooley D E (1996) Irnrnunolocalization of the matrix metalloproteinases gelatinase B and stromelysin 1 in human endometrium throughout the menstrual cycle. J Reprod Fertil 107:43-51. Kao L C , Tulac S, Lobo S, Imani B , Yang JP, Germeyer A , Osteen K , Taylor R N , Lessey B A , Giudice L C (2002) Global gene profiling in human endometrium during the window of implantation. Endocrinology 143:2119-38. Kamiguti AS , Hay CR, Zuzel M (1996) Inhibition of collagen-induced platelet aggregation as the result of cleavage of alpha 2 beta 1-integrin by the snake venom metalloproteinase jararhagin. Biochem .7320:635-641. Kariya M , Kanzaki H , Takakura K , Imai K , Okamoto N , Emi N , Kayiya Y , Mori T (1991) Interleukin-1 inhibits in vitro decidualization of human endometrial stromal cells. J Clin Endocrinol Metab 73:1170-4. Karrriakar S, Das (2002) Regulation of trophoblast invasion by IL-1 beta and TGF-betal. Am J Reprod Immunol 48:210-9. Kashiwagi M , Tortorella M , Nagase H , Brew K (2001) TIMP-3 is a potent inhibitor of aggrecanase 1 (ADAM-TS4) and aggrecanase 2 (ADAM-TS5). JBiol Chem 276:12501-12504. Kaushal GP, Shah VS (2000) The new kids on the block: ADAMTSs , potentially multifunctional metalloproteinases of the A D A M family. J Clin Invest 105:1335-1337. Kearns M , Lala PK.(1983) Life history of decidual cells. Am J Reprod Immunol Microbiol 3:78-82. Kennedy TG, Lukash L A (1982) Induction of decidualization in rats by the intrauterine infusion of prostaglandins. Biol Reprod 27:250-260. Kislaus L L , Herr JC, Little CD (1987) Immunolocalisation of extracellular matrix proteins and collagen synthesis in first trimester human deciduas. Anat Rec 218:402-415. Kislaus L L , Herr (1988) Immunolocalisation of heparin sulphate proteoglycan in human decidual secretory bodies and placental fibrinoid. Biol Reprod 39:419-430. Koh SC, Wong PC, Yuen R, Chua SE, Ng B L , Ratnam SS (1992) Concentration of plasminogen activators and inhibitor in the human endometrium at different phases of the menstrual cycle. J Reprod Fertil 96:407-413. 81 Kokorine I, Marbaix E, Henriet P. (1996) Focal cellular origin and regulation of interstitial collagenase (matrix metalloproteinase-1) are related to menstrual breakdown in the human endometrium. J Cell Sci 109:2151-2160. Kramerova IA, Kawaguchi N, Fessler LI, Nelson RE, Chen Y, Kramerov AA, Kusche-Gullberg M, Kramer JM, Ackley BD, Sieron AL, Prockop DJ, Fessler JH (2000) Papilin in development; a pericellular protein with a homology to the ADAMTS metalloproteinases. Development 127:5475-5485. Kuno K, Kanada N, Nakashima E, Fujiki F, Ichimura F, Matsushima K (1997) Molecular cloning of a gene encoding a new type of metalloproteinase-disintegrin family protein with thrombospondin motifs as an inflammation associated gene. J Biol Chem 272:556-562. Kuno K, Matsushima K (1998) ADAMTS-1 protein anchors at the extracellular matrix through the thrombospondin type I motifs and its spacing region. J Biol Chem 273:13912-13917. Kuno K, Terashima Y, Matsushima K (1999) ADAMTS-1 is an active metalloproteinase associated with the extracellular matrix. JBiol Chem 274:18821-18826. Kuno K, Okada Y, Kawashima H, Nakamura H, Miyasaka M, Ohno H, Matsushima K (2000) ADAMTS-1 cleaves a cartilage proteoglycan, aggrecan. FEBSLett 478:241-5. Lala PK, Keams M, Colavincenzo V (1984) Cells of the fetomaternal interface: their role in the maintenance of viviparous pregnancy. Am JAnat 170:501-517. Lala PK, Graham CH (1990) Mechanisms of trophoblast invasiveness and their control: the role of proteases and protease inhibitors. Cancer Metastasis Rev 9:369-379. Lala PK, Hamilton GS (1996) Growth factors, proteases and protease inhibitors in the maternal-fetal dialogue. Placenta 17:545-555. Lawn AM, Wilson EW, Finn CA (1971) The ultrastructure of human decidual and predecidual cells. J Reprod Fertil 26:85-90. Lessey BA (2000) The role of the endometrium during embryo implantation. Hum Reprod 15:39-50. Li SW, Arita M, Fertala A, Bao Y, Kopen GC, Langsjo TK, Hyttinen MM, Helminen HJ, Prockop DJ (2001) Biochem .7355:271-278. 82 Lindenberg S (1991) Experimental studies on the initial trophoblast endometrial interaction. Danish Med Bull 38:371-380. Longpre JM, Leduc R. (2004) Identification of prodomain determinants involved in ADAMTS-1 biosynthesis. JBiol Chem 279:33237-45. MacCalman CD, Furth EE, Omigbodun A, Bronner M, Coutifaris C, Strauss JF HI. (1996) Regulated expression of cadherin-11 in human epithelial cells: a role for cadherin-11 in trophoblast-endometrium interactions? Dev Dynam 206:201-211. MacCalman CD, Getsios S, Chen GTC (1998) Type 2 cadherins in the human endometrium and placenta: their putative roles in human implantation and placentation. Am J Reprod Immunol 39:96-107. Magnetto S, Bruno-Bossio G, Voland C, Lecerf J, Lawler J, delmas P, Siverstein R, Clezardin P (1998) CD36 mediates binding of soluble thrombospondin-1 but not cell adhesion and haptotaxis on immobilized thrombospondin-1. Cell Biochem Funct 16:211-221. Marbaix E, Kokorine I, Henriet P, Donnez J, Courtoy PJ, Eeckhout Y (1995) The expression of interstitial collagenase in human endometrium is controlled by progesterone and by oestradiol and is related to menstruation. J Biochem 305:1027-1030. Marbaix E, Kokorine I, Moulin P, Donnez J, Eeckhout Y, Courtoy PJ (1996) Menstrual breakdown of human endometrium can be mimicked in vitro and is selectively and reversibly blocked by inhibitors of matrix metalloproteinases. Proc Natl Acad Sci USA 93:9120-9125. Martelli M, Campan A, Bischof P (1993) Secretion of matrix metalloproteinases by human endometrial cells in vitro. J Reprod Fertil 98:67-76. Marx L, Ark P, Kieslich C, Mitterlechner S, Kapp M, Dietl J (1999) Decidual mast cells might be involved in the onset of human first-trimester abortion. Am J Reprod Immunol 41:34-40. Masui T, Hosatani R, Tsuji S, Miyamoto Y, Yasuda S, Ida J, Nakajima S , Kawaguchi M, Kobayashi H, Koizumi M, Toyoda E, Tulachan S, Arii S, Doi R, Imamura M (2001) Expression of METH-1 and METH-2 in pancreatic cancer. Clin Cancer Res 7:3437-43. Matthews RT, Gary SC, Zerillo C, Pratta M, Solomon K, Arner EC, Hockfield S (2000) Brain-enriched hyaluronan binding (BEHAB)/brevican cleavage in a glioma cell line is mediated by a disintegrin and metalloproteinase with thrombospondin motifs (ADAMTS) family member. JBiol Chem 275:22695-22703. 83 Metnert M, Eriksen G, Petersen A, Helmig R, Laurent C, Uldbjerg N, Malmstrom A (2001) Am JObstet Gynecol 184:679-85. Miles RR, Sluka JP, Halladay DL, Santerre RF, Hale LV, Bloem L, Thirunavukkarasu K, Galvin RJ, Hock JM, Onyia JE. (2000) ADAMTS-1: A cellular disintegrin and metalloprotease with thrombospondin motifs is a target for parathyroid hormone in bone. Endocrinology 141:4533-42 Millichip MI, Dallas DJ, Wu E, Dale S, McKie N (1998) The metallo-disintegrin AD AMI 0 (MADM) from bovine kidney has type IV collagenase activity in vitro. Biochem Biophys Res Commun 245:594-598. Mittaz L, Russell DL, Wilson T, Brasted M, Tkalcevic J, Salamonsen LA, Hertzog PJ, Pritchard MA (2004) Adamts-1 is essential for the development and function of the urogenital system. Biol Reprod 70:1096-105. Moss ML, Jin SL, Milla ME, Burkhart W, Carter HL, Chen WJ (1997) Cloning of a disintegrin metalloproteinase that processes precursor tumour-necrosis factor-alpha. Nature 385:733736. Mylona P, Kielty CM, Hoyland JA, Aplin JD (1995) Expression of type VI collagen mRNAs in human endometrium during the menstrual cycle and first trimester of pregnancy. J Reprod Fertil 103:159-167. Nakamura H, Fujii Y, Inoki I, Sugimoto K, Tanzawa K, Matsuki H, Miura R, Yamaguchi Y, Okada Y (2000) Brevican is degraded by matrix metalloproteinases and aggrecanase-1 (ADAMTS4) at different sites. JBiol Chem 275:38885-38890. Nath D, Slocombe PM, Webster A, Stephens PE, Docherty AJ, Murphy G (2000) Meltrin gamma(ADAM-9) mediates cellular adhesion through alpha(6)beta(l )integrin, leading to a marked induction of fibroblast cell motility. J Cell Sci 113:2319-2328. Nikas. G (1999) Cell-surface morphological events relevant to human implantation. Hum Reprod 14 Suppl 2: 37-44. Nothnick WB (2000) Disruption of the tissue inhibitor of metalloproteinase-1 gene results in altered reproductive cyclicity and uterine morphology in reproductive-age female mice. Biol Reprod 63:905-912. Noyes RW, Hertig Al, Rock J (1950) DAtingthe endometrial biopsy. Fertil Steril 1:3-25. Osteen KG, Rodegrs WH, Gaire M (1994) Stromal-epithelial interaction mediates steroidal regulation of metalloproteinase expression in human endometrium. Proc Natl Acad Sci USA 91:10129-110133. 84 Pan D, Rubin GM (1997) Kuzbanian controls proteolytic processing of Notch and mediates lateral inhibition during Drosophila and vertebrate neurogenesis. Cell 90:271-280. Paria BC, Lim H, Das SK, Reese J, Dey SK (2000) Molecular signaling in uterine receptivity for implantation. Semin Cell Dev Biol 11:67-76. Paria BC, Reese J, Das SK, Dey SK (2002) Deciphering the cross-talk of implantation: advances and challenges. Science 296:2185-2188. Perissinotto D, Lacopetti P, Bellina I (2000) Avian neural crest cell migration is diversely regulated by the two major hyaluronan-binding proteoglycans PG-M/versican and aggrecan. Development 127:2823-2842. Prockop DJ, Sieron AL, Li SW (1998) Procollagen N-proteinase and procollagen C-proteinase. Two unusual metalloproteinases that are essential for procollagen processing probably have important roles in development and cell signaling. Matrix Biol 16:399-408. Psychoyos A, Nikas G, Gravanis A (1995) The role of prostaglandins in blastocyst implantation. Hum Reprod 10 (Suppl 2) 30-42. Qi H, R, MD, Wu X, Sestan N, Wang W, Rakic P (1999) Processing of the notch ligand delta by the metalloprotease Kuzbanian. Science 283:91-94. Raga F, Casan EM, Wen Y, Huang HY, Bonilla-Musoles F, Polan ML (1999) Independent regulation of matrix metalloproteinase-9, tissue inhibitor of metalloproteinase-1 (TIMP-1), and TIMP-3 in human endometrial stromal cells by gonadotropin-releasing hormone: implications in early human implantation. J Clin Endocrinol Metab 84:636-642. Rawlings ND, Barrett AJ (1995) Evolutionary families of mefallopeptidases. Methods Enzymol 248:183-228. Roberts AB, Sporn MB (1988) Transforming growth factor beta. Adv Cancer Res 51:107-45. Robker RL, Russell DL, Espey LL, Lydon JP, O'Malley BW, Richards, JS (2000) Progesterone-regulated genes in the ovulation process: ADAMTS-1 and cathepsin L proteases. Proc Natl Acad Sci USA 97:4689-4694. Rodgers WH, Osteen KG, Matrisian LM (1993) Expression and localization of matrilysin, a matrix metalloproteinase, in human endometrium during the reproductive cycle. Am J Obstet Gynecol 168:253-260. 85 Rodgers WH, Matrisian LM, Giudice LC, Dsupin B, Cannon P, Sviteck C (1994) Patterns of matrix metalloproteinase expression in cycling endometrium imply differential functions and regulation by steroid hormones./ Clin Invest 94:946-953. Rodriguez-Manzaneque JC, Milchanowski AB, Dufour EK, Leduc R, Iruela-Arispe ML (2000) Characterization of METH- 1/ADAMTS1 processing reveals two distinct active forms. JBiol Chem 275:33471-9. Ruck P, Marzusch K, Kaiserling E, Horny HP, Diet JL, Gieselhart A, Handgretinger R, Redman CWG (1994) Distribution of cell adhesion molecules in decidua of early human pregnancy. An immunohistochemical study. Lab Invest 71:94-101. Russell DL, Doyle KM, Ochsner SA, Sandy JD, Richards JS (2003) Processing and localization of ADAMTS-1 and proteolytic cleavage of versican during cumulus matrix expansion and ovulation. JBiol Chem 278:42330-9. Salamonsen LA, Wooley DE (1995) Human Reprod. 11 suppl 2 150-164. Salamonsen LA, Butt AR, Hammond FR, Garcia S, Zhang J (1997) Production of endometrial matrix metalloproteinases, but not their tissue inhibitors, is modulated by progesterone withdrawal in an in vitro model for menstruation. J Clin Endocrinol Metab 82:1409-1415. Sandy JD, Westling J, Kenagy RD, Iruela-Arispe ML, Verscharen C, Rodriguez-Mazaneque JC, Zimmermann DR, Lemire JM, Fischer JW, Wight TN, Clowes AW (2001) Versican VI proteolysis in human aorta in vivo occurs at the Glu441-Ala442 bond, a site that is cleaved by recombinant ADAMTS-1 and ADAMTS-4. JBiol C/re/w 276:13372-13378. Sasaki M, Seo KS, Kato R, Kita S, Kiyama H (2001) A disintegrin and metalloprotease with thrombospondin typel motifs (ADAMTS-1) and IL-1 receptor type 1 mRNAs are simultaneously induced in nerve injured motor neurons. Mol Brain res 89:158-63. Satoh K, Suzuki N, Yokota H (2000) ADAMTS-4 (a disintegrin and metalloproteinase with thrombospondin motifs) is transcriptionally induced in beta-amyloid treated rat astrocytes. Neurosci Lett 289:177-180. Schatz F, Krikun G, Runic R, Wang EY, Hausknecht V, Lockwood CJ (1999) Implications of decidualization-associated protease expression in implantation and menstruation. Semin Reprod Endocrinol 17:3-12. Sclondorff J, Blobel CP (1999) J Cell Sci 112:36063-36017. Shimonovitz S, Hurwitz A, Dushnik M, Anteby E, Geva-Eldar T, Yagel S (1994) 86 Developmental regulation of the expression of 72 and 92 kd type IV collagenases in human trophoblasts: a possible mechanism for control of trophoblast invasion. Am J Obstet Gynecol 171:832-838. Shimonovitz S, Hurwitz A, Barak V, Dushnik M, Adashi EY, Anteby E, Yagel S (1996) Cytokine-mediated regulation of type IV collagenase expression and production in human trophoblast cells. J Clin Endocrinol Metab 81: 3091-3096. Shindo T, Kurihara H, Kuno K, Yokoyama H, Wada T, Kurihara Y, Imai T, Wang Y, Ogata M, Nishimatsu H, Moriyama N, Oh-hashi Y, Morita H, Ishikawa T, Nagai R, Yazaki Y, Matsushiman K (2000) ADAMTS-1: a metalloproteinase-disintegrin essential for normal growth, fertility, and organ morphology and function. J Clin Invest 105:1345-1352. Shiokawa S, Yoshimura Y, Nagamatsu S, Sawa H, Hanashi H, Oda T, Katsumata Y, Koyama N, Nakamura Y (1996) Expression of beta 1 integrins in human endometrial stromal and decidual cells. J Clin Endocrinol Metab 81: 1533-1540. Smith MR, Kung H, Durum SK, Colburn NH, Sun Y (1997) TIMP-3 induces cell death by stabilizing TNF-alpha receptors on the surface of human colon carcinoma cells. Cytokine 9:770-780. Starkey PM, Sargent IL, Redman CWG (1988) Cell populations in human early pregnancy decidua: characterization and isolation of large granular lymphocytes by flow cytometry .Immunology 65:129-134. Stocker W, Grams F, Baumann U, Reinemer P, Gomis-Ruth FX, Mackay DB, Bode W (1995) The metzincins—topological and sequential relations between the astacins, adamalysins, serralysins, and matrixins (collagenases) define a superfamily of zinc-peptidases. Protein Sci 4:823-840. Strickland S, Richards WG (1992) Invasion of the trophoblasts. Cell 71:355-357. Suzuki N, Nakayama J, Shih JM, Aoki D, Nozawa S, Fukada MN (1999) Expression of trophinin, tastin, and bystin by trophoblast and endometrial cells in human placenta.5z'o/ Reprod 60:621 -617. Tabibzadeh S, Santhanam U, Sehgal P, May L (1989) Cytokine-induced production of IFN-beta 2/IL-6 by freshly explanted human endometrial stromal cells. Modulation by estradiol-17 beta. The Journal of Immunology 142: 3134-3139. Tabibzadeh S, Babaknia A (1995) The signals and molecular pathways involved in implantation, a symbiotic interaction between blastocyst and endometrium involving adhesion and tissue invasion. Hum Reprod 10:1579-15602. 87 Tang BL, Hong W (1999) ADAMTS: a novel family of proteases with an ADAM protease domain and thrombospondin 1 repeats. FEBS Lett 445:223-225. Tang BL (2001) ADAMTS: a novel family of extracellular matrix proteasesJor J Biochem Cell Biol 33:33-44. Tortorella M, Pratta M, Rui-Qin L, Abbaszade I, Ross H, Burn T, Arner E (2000) The thrombospondin motif of aggrecanase-1 (ADAMTS-4) is critical for aggrecan substrate recognition and cleavage. JBiol Chem 275:25791-25797'. Tortorella M, Malfait A, Deccico C, Arner E, Nagase H. (2001) The role of ADAM-TS4 (aggrecanase-1) and ADAM-TS5 (aggrecanase-2) in a model of cartilage degradation. Osteoarthritis Cartilage 6:539-552. Van W, Birkedal H (1990) The cysteine switch: a principle of regulation of metalloproteinase activity with potential applicability to the entire matrix metalloproteinase gene family. Proc Natl Acad Sci 87:5578-5582. Vasselli JD, Sappino AP, Belin D (1991) The plasminogen activator/plasmin system. J Clin Invest 88:1067-1072. Vazquez F, Hastings G, Ortega MA, Lane TF, Oikemus S, Lombardo M, Iruela-Arispe ML (1999) METH-1, a human ortholog of ADAMTS-1, and METH-2 are members of a new family of proteins with angio-inhibitory activity. JBiol Chem 274:23349-23357. Vollmer G, Siegal GP, Chiquet-Ehrismann R, Lightner VA, Arnholdt H, Knuppen R (1990) Tenascin expression in the human endometrium and in endometrial adehocarcinomas.Z,a& Invest 62:725-730. Wachsmuth L, Bau B, Fan Z, Pecht A, Gerwin N, Aigner T (2004) ADAMTS-1, a gene product of articular chondrocytes in vivo and in vitro, is downregulated by interleukin lbeta. J Rheumatol 31:315-20. Wewer UM, Faber M, Liotta LA, Albrechtsen R (1985) Immunochemical and ultrastructural assessment of the nature of the pericellular basement membrane of human decidual cells. Lab Invest 53:624-633. Woessner JF (1991) Matrix metalloproteinases and their inhibitors in connective tissue remodeling FASEB J5:2145-2154. Wolff MV, Thaler CJ, Strowitzki T, Broome J, Stolz W, Tabibzadeh (2000) Dissecting the behaviour of transgenic mice: is it the mutation, the genetic background, or the environment? Molecular Human Reproductive 6:627-634. 88 Yagel S, Parhar RS, Jeffery JJ, Lala PK (1988) Normal nonmetastatic human trophoblast cells share in vitro invasive properties of malignant cells. J Cell Physiol 136:455-462. Yagel S, Lala PK, Powell WA, Casper RF (1989) Interleukin-1 stimulates human chorionic gonadotropin secretion by first trimester human trophoblast. Clin Endocrinol Metab 68: 992-5. Yu W, Yu S, Meng Q, Brew K, Woessner J (2000) TIMP-3 binds to sulfated glycosaminoglycans of the extracellular matrix. J Biol.Chem. 275: 31226-31232. Wang T, Yamashita K, Iwata K, Hayakawa T (2002) Both tissue inhibitors of metalloproteinases-1 (TIMP-1) and TJMP-2 activate Ras but through different pathways. Biochem Biophys Res Commun 296:201-205. Wilcox AJ, Weinberg CR, O'Connor JF, Baird DD, Schlatterer JP, Canfield RE, Armstrong EG, Nisula BC (1988) Incidence of early loss of pregnancy. NEngl JMed 319:189-194. Wolfsberg TG, Primakoff P, Myles DG, White JM (1995) ADAM, a novel family of membrane proteins containing A Disintegrin And Metalloprotease domain: multipotential functions in cell-cell and cell-matrix interactions. J Cell Biol 131:275-278. Wynn RM (1974) Ultrastructural development of the human decidua. Am J Obstet Gynecol 118:652-670. Xu P, Alfaidy N, Challis JR (2002) Expression of matrix metalloproteinase (MMP)-2 and MMP-9 in human placenta and fetal membranes in relation to preterm and term labor. J Clin Endocrinol Metab 87:1353-1361. Zhang J, Salamonsen LA (1999) Tissue inhibitor of metalloproteinases (TIMP)-l, -2 and -3 in-human endometrium during the menstrual cycle. Mol Hum Reprod'3:735-741. Zimmermann DR, Ruoslahti E (1989) Multiple domains of the large fibroblast proteoglycan, vevsicm.EMBO Journal 8:2975-2981. Zimmermann DR, Lemire JM, Fischer JW, Wight TN, Clowes AW (2001) Versican VI proteolysis in human aorta in vivo occurs at the Glu441-Ala442 bond, a site that is cleaved by recombinant ADAMTS-1 and ADAMTS-4. JBiol Chem 276:13372-13378. 89 N O T E S : 90 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0091530/manifest

Comment

Related Items