UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Enhancement of specialized metabolism, regeneration efficiency and biological activity in lavandin (Lavandula… Erland, Lauren Alexandra Elizabeth 2015

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2015_may_erland_lauren.pdf [ 4.07MB ]
Metadata
JSON: 24-1.0074431.json
JSON-LD: 24-1.0074431-ld.json
RDF/XML (Pretty): 24-1.0074431-rdf.xml
RDF/JSON: 24-1.0074431-rdf.json
Turtle: 24-1.0074431-turtle.txt
N-Triples: 24-1.0074431-rdf-ntriples.txt
Original Record: 24-1.0074431-source.json
Full Text
24-1.0074431-fulltext.txt
Citation
24-1.0074431.ris

Full Text

	  ENHANCEMENT	  OF	  SPECIALIZED	  METABOLISM,	  REGENERATION	  EFFICIENCY	  AND	  BIOLOGICAL	  ACTIVITY	  IN	  LAVANDIN	  (LAVANDULA	  X	  INTERMEDIA	  CV	  ‘GROSSO’)	  by	  Lauren	  Alexandra	  Elizabeth	  Erland	  	  B.Sc.,	  University	  of	  British	  Columbia,	  2012	  A	  THESIS	  SUBMITTED	  IN	  PARTIAL	  FULFILLMENT	  OF	  THE	  REQUIREMENTS	  FOR	  THE	  DEGREE	  OF	  	  MASTER	  OF	  SCIENCE	  in	  THE	  COLLEGE	  OF	  GRADUATE	  STUDIES	  	  (Biochemistry	  and	  Molecular	  Biology)	  	  THE	  UNIVERSITY	  OF	  BRITISH	  COLUMBIA	  	  (Okanagan)	  	  March	  2015	  	  ©Lauren	  Alexandra	  Elizabeth	  Erland,	  2015	  	  	   ii	  Abstract	  	  This	  study	  aimed	  to	  improve	  essential	  oil	  composition	  by	  modifying	  terpene	  production	  in	  Lavandula	  x	  intermedia	  cv	  Grosso	  via	  mutagenesis	  to	  more	  closely	  resemble	  the	  oil	  of	  the	  commercially	  valuable	  essential	  oil	  from	  L.	  angustifolia	  or	  the	  medicinally	  active	  essential	  oil	  from	  L.	  latifolia.	  Additionally	  this	  study	  aimed	  to	  identify	  genes	  that	  control	  essential	  oil	  production	  in	  lavenders,	  and	  to	  determine	  the	  effect	  of	  essential	  oil	  composition	  on	  biological	  activity,	  specifically	  insecticidal	  and	  insect	  repellent	  properties.	  	  This	  study	  resulted	  in	  an	  improved	  method	  for	  the	  efficient	  regeneration	  of	  Grosso	  lavender,	  and	  applied	  this	  method	  to	  generate	  ten	  unique	  mutants.	  The	  transcriptomes	  of	  some	  mutants	  were	  sequenced,	  and	  thirty	  seven	  differentially	  expressed	  transcripts	  were	  identified	  as	  being	  involved	  in	  the	  biosynthesis	  and	  production	  of	  essential	  oil	  terpenes.	  The	  transcript	  expression	  results	  were	  confirmed	  by	  real-­‐time	  quantitative	  polymerase	  chain	  reaction	  analysis.	  The	  lavender	  essential	  oil	  showing	  greatest	  biological	  activity	  against	  an	  invasive	  pest,	  spotted	  wing	  drosophila,	  was	  identified	  as	  Lavandula	  latifolia	  cv	  Medikus	  and	  the	  active	  constituents	  were	  identified	  through	  fumigation	  and	  spray	  toxicity	  assays	  as	  the	  monoterpenes	  1,8-­‐cineole	  and	  linalool.	  These	  oils	  showed	  strong	  fumigation	  and	  contact	  toxicity.	  In	  all,	  this	  thesis	  presents	  the	  generation,	  screening	  and	  analysis	  of	  unique	  L.	  x	  intermedia	  essential	  oil	  mutants,	  which	  represent	  both	  potential	  new	  commercial	  cultivars	  and	  model	  organisms	  for	  the	  investigation	  of	  the	  regulation	  and	  biosynthesis	  of	  essential	  oil	  terpenes.	  	  	  	  	  	  	   iii	  Preface	  	  A	  version	  of	  a	  portions	  of	  Chapter	  1	  has	  been	  accepted	  for	  publication	  as	  the	  following	  book	  chapter,	  while	  a	  version	  of	  a	  separate	  portion	  has	  been	  submitted	  for	  publication	  in	  the	  below	  review:	  Erland	  LAE,	  Mahmoud	  SS.	  2013.	  Lavender	  (Lavandula	  angustifolia).	  In:	  Essential	  oils	  in	  food	  flavour,	  preservation	  and	  safety.	  Elsevier.	  Invited	  review	  –	  accepted	  	  A	  version	  of	  Chapter	  2	  has	  been	  published	  in	  the	  following	  manuscript:	  Erland,	  L.A.E.,	  Mahmoud,	  S.S.,	  2014.	  An	  efficient	  method	  for	  regeneration	  of	  lavandin	  (Lavandula	  x	  intermedia	  cv.	  'Grosso').	  In	  vitro	  cellular	  and	  developmental	  biology	  -­	  plant.	  50(5)	  646-­‐654.	  	  	  Chapter	  3	  is	  based	  on	  work	  I	  conducted	  in	  Dr.	  Soheil	  Mahmoud’s	  lab	  at	  UBC	  Okanagan.	  NMR	  analysis	  was	  performed	  independently	  by	  Dr.	  Paul	  Shipley	  at	  the	  University	  of	  British	  Columbia,	  Okanagan	  and	  by	  Dr.	  Andrew	  Lewis	  at	  Simon	  Fraser	  University.	  I	  completed	  all	  other	  experimental	  work	  and	  data	  analysis.	  	  	  Chapter	  4	  is	  based	  on	  work	  I	  conducted	  in	  Dr.	  Soheil	  Mahmoud’s	  lab	  at	  UBC	  Okanagan.	  Preparation	  of	  cDNA	  libraries	  for	  Illumina©	  sequencing	  (performed	  by	  Dr.	  Andrey	  Golubov),	  and	  Illumina©	  sequencing,	  quality	  control,	  trimming,	  transcriptome	  assembly,	  differential	  expression	  analysis,	  hierarchial	  clustering	  and	  single	  nucleotide	  variant	  analysis	  for	  the	  transcriptome	  assembled	  by	  alignment	  to	  the	  expressed	  sequence	  tag	  libraries	  (performed	  by	  Dr.	  Yaroslav	  Illnysky)	  were	  done	  at	  PlantBiosis	  (Lethbridge,	  	   iv	  Albetra,	  Canada)	  through	  a	  paid	  service.	  I	  performed	  all	  other	  experimental	  work	  and	  data	  analysis.	  	  Chapter	  5	  is	  based	  on	  work	  I	  conducted	  in	  Dr.	  Soheil	  Mahmoud’s	  lab	  at	  UBC	  Okanagan.	  Initial	  mixed	  fly	  cultures	  were	  provided	  by	  Dr.	  Susanna	  Acheampong	  at	  the	  Canadian	  Food	  Inspection	  Agency.	  I	  completed	  all	  experimental	  work	  and	  data	  analysis.	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	   v	  Acknowledgments	  	  This	  thesis	  would	  not	  have	  been	  possible	  without	  the	  support	  and	  assistance	  of	  many	  mentors,	  colleagues	  and	  advisors.	  I	  would	  first	  and	  most	  sincerely	  like	  to	  thank	  my	  supervisor	  Dr.	  Soheil	  Mahmoud	  for	  his	  continued	  support,	  guidance	  and	  most	  of	  all	  optimism	  for	  the	  success	  of	  this	  project.	  I	  would	  also	  like	  to	  thank	  my	  past	  and	  present	  committee	  members	  Dr.	  Deanna	  Gibson,	  Dr.	  Paul	  Shipley	  and	  Dr.	  Cedric	  Saucier	  for	  their	  feedback,	  insights	  and	  direction.	  I	  must	  acknowledge	  my	  collaborators	  across	  the	  country	  without	  whose	  expertise,	  and	  hardwork	  this	  project	  could	  never	  have	  succeded:	  Dr.	  Andrey	  Golubov	  and	  Dr.	  Yaroslav	  Illnystkyy	  at	  the	  University	  of	  Lethbridge	  who	  performed	  and	  assisted	  in	  analysis	  of	  Illumina	  sequencing,	  Dr.	  Sanjoy	  Ghosh	  for	  use	  of	  his	  equipment,	  Ms.	  Amy	  Botta	  for	  her	  limitless	  experience	  in	  design	  and	  analysis	  of	  qPCR	  experiments,	  Dr.	  Paul	  Shipley	  for	  NMR	  analysis,	  Dr.	  Andrew	  Lewis	  and	  Mr.	  Colin	  Zhang	  for	  additional	  NMR	  analysis	  at	  Simon	  Fraser	  University,	  Dr.	  Mark	  Rheault	  for	  his	  assistance	  in	  rearing	  and	  testing	  of	  spotted	  wing	  drosophila	  cultures,	  Dr.	  Susanna	  Acheampong	  for	  supplying	  the	  source	  cultures	  for	  the	  spotted	  wing	  drosophila	  colony	  and	  lastly	  but	  certainly	  not	  least	  Dr.	  Susan	  Murch	  for	  her	  advice	  in	  the	  treatment	  of	  cultures	  and	  sharing	  of	  supplies.	  I	  would	  also	  like	  to	  thank	  my	  fellow	  lab	  members,	  research	  assistants	  and	  volunteers	  who	  provided	  support,	  assistance	  and	  advice:	  Dr.	  Zerihun	  Demissie,	  Mr.	  Lukman	  Sarker,	  Ms.	  Mariana	  Galata,	  Mr.	  Ayelign	  Mengesha,	  Ms.	  Brooke	  Finney,	  Ms.	  Ashley	  Lemke	  and	  Ms.	  Katie	  Del	  Buono.	  I	  am	  also	  grateful	  to	  my	  past	  mentors	  who	  are	  the	  reason	  I	  was	  inspired	  to	  pursue	  a	  graduate	  degree,	  in	  particular	  Dr.	  Tom	  Lowery,	  Ms.	  Naomi	  DeLury	  and	  Dr.	  Howard	  Thistlewood.	  Funding	  for	  this	  research	  was	  provided	  through	  grants	  to	  Dr.	  Soheil	  Mahmoud	  and	  Lauren	  Erland	  by	  Natural	  Sciences	  and	  Engineering	  Research	  Council	  of	  Canada,	  and	  to	  Dr.	  Soheil	  Mahmoud	  by	  Canada	  Foundation	  for	  Innovation,	  University	  of	  	   vi	  British	  Columbia,	  industrial	  collaborators,	  and	  by	  Agriculture	  and	  Agri-­‐Food	  Canada	  and	  the	  BC	  Ministry	  of	  Agriculture	  through	  programs	  delivered	  by	  the	  Investment	  Agriculture	  Foundation	  of	  BC.	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	   vii	  Table	  of	  Contents	  Abstract ...................................................................................................................................................ii	  Preface ................................................................................................................................................... iii	  Acknowledgments................................................................................................................................ v	  Table	  of	  Contents................................................................................................................................vii	  List	  of	  Tables .......................................................................................................................................... x	  List	  of	  Figures .................................................................................................................................... xiii	  Table	  of	  Symbols	  and	  Abbreviations ........................................................................................ xxii	  Chapter	  1.	  Introduction......................................................................................................................1	  1.1.	   Lavender ..................................................................................................................................................1	  1.2.	   Essential	  Oils.........................................................................................................................................3	  1.3.	   Biosynthesis	  of	  essential	  oils ..........................................................................................................6	  1.3.1.	   Regulation	  of	  essential	  oil	  biosynthesis.............................................................................................10	  1.4.	   Plant	  Tissue	  Culture ........................................................................................................................ 14	  1.5.	   In	  vitro	  mutagenesis	  of	  plants	  and	  determination	  of	  gene	  targets ................................. 19	  1.6.	   Biological	  activity	  screening ........................................................................................................ 21	  1.7.	   Research	  Objectives	  and	  Hypotheses........................................................................................ 22	  Chapter	  2.	  Development	  of	  a	  protocol	  for	  regeneration	  of	  L.	  x	  intermedia	  cv	  Grosso 24	  2.1.	   Abstract ............................................................................................................................................... 24	  2.2.	   Materials	  and	  Methods................................................................................................................... 24	  2.3.	   Results.................................................................................................................................................. 26	  2.3.1.	   Organogenesis	  from	  leaf	  callus ..............................................................................................................26	  2.3.2.	   Addition	  of	  phenolic	  inhibitors,	  adsorbents	  and	  reducing	  agents .........................................28	  2.3.3.	   Effect	  of	  light	  and	  media	  conditions	  on	  rooting .............................................................................30	  	   viii	  2.3.4.	   Effect	  of	  polyamines ...................................................................................................................................33	  2.4.	   Discussion........................................................................................................................................... 36	  Chapter	  3.	  Modification	  of	  Essential	  Oil	  Composition	  in	  L.	  x	  intermedia	  cv	  Grosso.... 40	  3.1.	   Abstract ............................................................................................................................................... 40	  3.2.	   Methods ............................................................................................................................................... 40	  3.2.1.	   Induction	  of	  point	  mutations	  in	  L.	  x	  intermedia	  cv	  Grosso ........................................................40	  3.2.2.	   Screening	  of	  essential	  oil	  for	  modified	  composition ....................................................................41	  3.2.3.	   Isolation	  of	  α-­‐cadinol .................................................................................................................................46	  3.2.4.	   Confirmation	  of	  essential	  oil	  screening	  method.............................................................................47	  3.3.	   Results.................................................................................................................................................. 47	  3.3.1.	   Production	  of	  lavender	  essential	  oil	  for	  essential	  oil	  mutants.................................................47	  3.3.2.	   Identified	  novel	  leaf	  EO	  mutants...........................................................................................................48	  3.3.3.	   Mutants	  with	  novel	  growth	  patterns ..................................................................................................54	  3.3.4.	   Lavender	  leaf	  essential	  oil	  composition	  at	  different	  leaf	  ages .................................................54	  3.3.5.	   Purification	  of	  unknown	  from	  wild-­‐type	  leaf	  essential	  oil ........................................................56	  3.3.6.	   Confirmation	  of	  accuracy	  of	  relative	  percent	  composition	  calculations .............................57	  3.4.	   Discussion........................................................................................................................................... 58	  Chapter	  4.	  Identification	  of	  mutation	  targets	  in	  novel	  essential	  oil	  mutants ............... 63	  4.1.	   Abstract ............................................................................................................................................... 63	  4.2.	   Methods ............................................................................................................................................... 63	  4.2.1.	   Identification	  of	  gene	  targets	  through	  next-­‐generation	  transcriptome	  sequencing ......63	  4.2.2.	   Differential	  Expression	  Analysis ...........................................................................................................66	  4.3.	   Results.................................................................................................................................................. 73	  4.3.1.	   Transcriptome	  assembly ..........................................................................................................................73	  4.3.2.	   Annotation	  and	  functional	  classification ...........................................................................................74	  4.3.3.	   Differential	  expression	  analysis ............................................................................................................75	  	   ix	  4.4.	   Discussion........................................................................................................................................... 92	  Chapter	  5.	  Screening	  of	  lavender	  and	  mutant	  essential	  oil	  for	  modified	  biological	  activity ................................................................................................................................................103	  5.1.	   Abstract .............................................................................................................................................103	  5.2.	   Methods .............................................................................................................................................103	  5.2.4.	   Rearing .......................................................................................................................................................... 103	  5.2.5.	   Optimization	  of	  a	  method	  for	  testing	  fumigation	  toxicity	  and	  fumigation	  toxicity	  testing	   104	  5.2.6.	   Contact	  toxicity .......................................................................................................................................... 105	  5.2.7.	   Oviposition	  deterrent	  activity ............................................................................................................. 107	  5.3.	   Results................................................................................................................................................108	  5.4.	   Discussion.........................................................................................................................................114	  Chapter	  6.	  Conclusion ....................................................................................................................117	  References .........................................................................................................................................121	  Appendices ........................................................................................................................................133	  Appendix	  A	  –	  Structure	  and	  main	  biological	  activities	  of	  the	  major	  essential	  oil	  constituents	  of	  lavender	  (subsection	  Lavandula)	  floral	  essential	  oil. .....................................133	  Appendix	  B	  –	  Interactions	  plots	  for	  polyamine	  treatments ........................................................136	  Appendix	  C	  –	  Standard	  curves	  for	  absolute	  quantification	  of	  essential	  oil	  samples...........139	  Appendix	  D	  –	  Primer	  Efficiencies .........................................................................................................146	  Appendix	  E	  –	  Selection	  of	  qPCR	  reference	  genes.............................................................................147	  Appendix	  F	  –	  Plots	  of	  qPCR	  data............................................................................................................149	  	  	  	  	  	   x	  List	  of	  Tables	  	  Table	  1.1	  	  The	  major	  essential	  oil	  constituents	  of	  L.	  latifolia,	  L.	  x	  intermedia	  and	  L.	  angustifolia..............................................................................................................................................1	  Table	  1.2.	  	  Examples	  of	  some	  transcription	  factor	  families	  identified	  in	  plants	  and	  their	  functions. ..............................................................................................................................................12	  Table	  1.3.	  	  Examples	  of	  some	  common	  plant	  growth	  regulators .......................................................18	  Table	  2.1.	  	  Average	  vigor	  of	  lavandin	  cultures	  after	  exposure	  to	  various	  treatments,	  where	  1	  indicates	  a	  dead	  explant	  and	  4	  a	  healthy	  mature	  explant	  with	  no	  browning.z ............................................................................................................................................27	  Table	  3.1.	  	  Quantification	  ions	  for	  terpene	  constituents	  included	  in	  analysis	  of	  leaf	  and	  bud	  essential	  oils...............................................................................................................................44	  Table	  3.2.	  	  Quantification	  ions	  for	  terpene	  consituents	  included	  in	  analysis	  of	  floral	  essential	  oils. .......................................................................................................................................44	  Table	  3.3.	  	  Summary	  of	  explants,	  shoots	  and	  mature	  plants	  surviving	  the	  culture	  process	  after	  treatment	  with	  EMS.............................................................................................48	  Table	  3.4.	  	  Mutants	  identified	  by	  oil	  screening	  -­‐	  time	  for	  regeneration	  from	  initial	  explant	  to	  soil,	  proportions	  of	  major	  leaf	  oil	  constituents	  and	  oil	  yield,	  where	  yield	  is	  the	  averaged	  across	  all	  ages	  of	  leaf. ............................................................51	  Table	  3.5.	  	  Mutants	  flowering	  in	  spring	  2014	  identified	  by	  oil	  screening	  -­‐	  time	  for	  regeneration	  from	  initial	  explant	  to	  soil	  and	  proportions	  of	  major	  bud	  oil	  constituents. ........................................................................................................................................52	  Table	  3.6.	  	  Mutants	  flowering	  in	  Spring	  2014	  identified	  by	  oil	  screening	  -­‐	  time	  for	  regeneration	  from	  initial	  explant	  to	  soil,	  proportions	  of	  major	  30%	  flower	  oil	  constituents	  and	  oil	  yield. .......................................................................................................53	  	   xi	  Table	  3.7.	  	  Comparison	  of	  composition	  as	  determined	  by	  relative	  percent	  composition	  and	  absolute	  quantification	  from	  standard	  curves ............................................................57	  Table	  4.1.	  	  qPCR	  primer	  sequences,	  amplicon	  length	  and	  melting	  temperature	  used	  in	  qPCR	  experiments. ...........................................................................................................................70	  Table	  4.2.	  	  Contig	  measurements	  for	  de	  novo	  assembly.........................................................................73	  Table	  4.3.	  	  Summary	  statistics	  for	  de	  novo	  assembly...............................................................................73	  Table	  4.4.	  	  Summary	  statistics	  for	  read	  mapping	  	  to	  L.	  angustifolia	  EST	  library	  (Lane	  et	  al.	  2010)	  and	  de	  novo	  assembled	  library ................................................................................73	  Table	  4.5.	  	  Genes	  identified	  as	  showing	  differential	  expression	  during	  expression	  analysis	  in	  CLC,	  normalized	  expression	  values	  are	  given	  as	  reads	  per	  kilobase	  of	  target	  per	  million	  mapped	  reads	  (RPKM).	  Samples	  for	  which	  there	  is	  no	  RNA-­‐Seq	  data	  but	  expression	  was	  still	  studied	  by	  qPCR	  are	  noted	  by	  “qPCR”	  and	  results	  that	  are	  supported	  by	  significant	  qPCR	  results	  are	  given	  in	  bold ................................................................................................................................83	  Table	  4.6.	  Expression	  levels	  of	  genes	  identified	  as	  differentially	  expressed	  candidates	  in	  wild-­‐type	  plants	  expressed	  as	  mean	  fold	  change	  as	  determined	  by	  qPCR	  analysis.	  Different	  letters	  indicate	  statistical	  significance	  by	  ANOVA	  with	  alpha	  =	  0.05.	  Results	  that	  significantly	  support	  results	  obtained	  from	  transcriptome	  profiling	  are	  bolded...........................................................................................86	  Table	  4.7.	  Expression	  levels	  of	  genes	  identified	  as	  differentially	  expressed	  candidates	  in	  leaves	  of	  mutant	  plants	  expressed	  as	  mean	  fold	  change	  normalized	  to	  wild-­‐type	  Grosso	  leaf	  as	  determined	  by	  qPCR	  analysis.	  Statistical	  significance	  as	  compared	  to	  wild-­‐type	  Grosso	  leaf	  by	  ANOVA	  is	  indicated	  by	  	   xii	  *	  (p	  <	  0.05)/**	  (p	  <	  0.01).	  Results	  that	  significantly	  support	  results	  obtained	  from	  transcriptome	  profiling	  are	  bolded. ..............................................................................88	  Table	  4.8.	  Expression	  levels	  of	  genes	  identified	  as	  differentially	  expressed	  candidates	  in	  tissues/plants	  for	  which	  there	  is	  no	  RNA-­‐Seq	  data	  available	  expressed	  as	  mean	  fold	  change	  normalized	  to	  wild-­‐type	  Grosso	  leaf	  as	  determined	  by	  qPCR	  analysis.	  Statistical	  significance	  as	  compared	  to	  wild-­‐type	  Grosso	  leaf	  by	  ANOVA	  is	  indicated	  by	  *	  (p	  <	  0.05)/**	  (p	  <	  0.01).	  Results	  that	  significantly	  support	  results	  obtained	  from	  transcriptome	  profiling	  are	  bolded. ...................................................................................................................................................90	  Table	  5.1.	  	  Oils	  used	  for	  testing,	  source	  tissue	  and	  company. ........................................................... 105	  Table	  2.	  	   Relative	  percent	  composition	  lavender	  essential	  oils	  tested	  (ISO)	  (Woronuk	  et	  al.	  2010) ........................................................................................................................................ 110	  Table	  5.3.	  	  Fumigation	  toxicity	  of	  lavender	  essential	  oils	  against	  4-­‐7	  day	  old	  D.	  suzukii	  adults,	  half	  lethal	  concentrations	  (LC50)	  and	  confidence	  intervals	  (CI)	  calculated	  by	  probit	  analysis	  (alpha	  =	  0.05) ...................................................................... 112	  Table	  5.4.	  	  Contact	  toxicity	  of	  lavender	  essential	  oils	  against	  4-­‐7	  day	  old	  D.	  suzukii	  adults,	  half	  lethal	  concentrations	  (LC50)	  and	  confidence	  intervals	  (CI)	  calculated	  by	  probit	  analysis	  (alpha	  =	  0.05) ...................................................................... 112	  Table	  A1.	  	  Structure	  and	  biological	  activity	  of	  the	  major	  floral	  essential	  oil	  constituents	  of	  lavender	  (subsection	  Lavandula),	  LAT	  =	  Lavandula	  latifolia,	  INT	  =	  Lavandula	  x	  intermedia,	  ANG	  =	  Lavandula	  angustifolia. ............................................... 133	  Table	  D1.	  	  Mean	  primer	  efficiency	  across	  all	  tissue	  types	  as	  calculated	  by	  linreg	  analysis ............................................................................................................................................... 146	  	   xiii	  List	  of	  Figures	  	  Figure	  1.1	  	   Scanning	  electron	  microscope	  photographs	  of	  (from	  left	  to	  right)	  the	  front	  and	  back	  view	  of	  a	  glandular	  trichome.	  (Erland	  and	  Mahmoud,	  2013a). .......................................4	  Figure	  1.2.	  	  Overview	  of	  the	  terpenoid	  biosynthetic	  pathway,	  where:	  AA-­‐CoA	  –	  acetoacetyl-­‐CoA;	  CDP-­‐	  ME	  –	  4-­‐(cytidine	  5’-­‐diphospho)-­‐2-­‐C-­‐methyl-­‐D-­‐erythritol;	  CDP-­‐ME2PP	  –	  2-­‐phospho-­‐4-­‐(cytidine	  5’	  di-­‐phospho)-­‐2-­‐C-­‐methyl-­‐D-­‐erythritol;	  DXP	  –	  1-­‐deoxy-­‐D-­‐xylulose-­‐5-­‐phosphate;	  FPP	  –	  farnesyl	  disphosphate;	  GAP	  –	  glyceraldehyde-­‐3-­‐phosphate;	  GPP	  –	  geranyl	  diphosphate;	  GGPP	  –	  geranylgeranyl	  diphosphate;	  HMBPP	  1-­‐hydroxy-­‐2-­‐methyl-­‐2-­‐butenyl	  4-­‐disphosphate;	  HMG-­‐CoA	  –	  3-­‐hydroxy-­‐3-­‐methylglutaryl-­‐CoA;	  	  LPP	  –	  lavandulyl	  diphosphate;	  ME-­‐2,4-­‐cPP	  –	  2-­‐C-­‐methyl-­‐D-­‐erythritol-­‐2,4-­‐cyclodiphosphate;	  MEP	  –	  2-­‐C-­‐methyl-­‐D-­‐erythritol-­‐4-­‐phosphate;	  MVA	  –	  mevalonate;	  MVAP	  –	  mevanolate-­‐5-­‐phosphate;	  MVAPP	  –	  mevalonate-­‐5-­‐diphosphate.......................................................................................................................................................8	  Figure	  1.3.	  	  Examples	  of	  some	  specific	  terpene	  synthase	  pathways	  leading	  to	  production	  of	  common	  constituents	  of	  lavender	  essential	  oil. .............................................................................10	  Figure	  1.4.	  	  Transcription	  factor	  families	  putatively	  identified	  by	  a	  BLAST	  search	  of	  a	  L.	  x	  intermedia	  cv	  Grosso	  floral	  glandular	  trichome	  EST	  library,	  given	  as	  total	  number	  of	  contigs	  identified	  within	  each	  family	  as	  a	  proportion	  of	  all	  transcription	  factors	  putatively	  identified.	  Lighter	  coloured	  bars	  represent	  families	  that	  have	  been	  implicated	  in	  the	  regulation	  of	  terpene	  biosynthesis. ......................................................13	  Figure	  1.5.	  	  Indirect	  organogenesis	  in	  L.	  x	  intermedia	  cv	  Grosso:	  callus	  induction	  (top	  left),	  shoot	  initiation	  (bottom	  left),	  root	  induction	  (centre)	  and	  acclimatization	  (right)	  (Erland	  and	  Mahmoud,	  2013b) .............................................................................................................16	  	   xiv	  Figure	  1.6.	  	  Indirect	  somatic	  embryogenesis	  in	  Coriandrum	  sativum:	  callus	  induction	  (far	  left),	  somatic	  embryo	  production	  (centre	  left),	  embryo	  development	  (centre	  right),	  acclimatization	  (far	  right). .........................................................................................................16	  Figure	  2.1.	  	  Regeneration	  of	  lavandin	  from	  leaf	  cuttings	  where:	  (a)	  callus	  induction,	  (b)	  shoot	  initiation,	  (c)	  shoot	  multiplication........................................................................................................27	  Figure	  2.3.	  	  Contingency	  analysis	  of	  explant	  vigor	  after	  exposure	  to	  various	  treatments,	  n=12	  for	  all	  treatments,	  colour	  blocks	  represent	  proportional	  distribution	  of	  explants	  by	  health. .........................................................................................................................................................30	  Figure	  2.4.	  	  Boxplot	  for	  rooting	  efficiency	  observed	  after	  four	  weeks	  on	  light,	  media	  type	  and	  media	  strength	  treatments	  where	  solid	  bars	  represent	  the	  mean,	  boxes	  encompass	  the	  first	  and	  third	  quartiles	  and	  whiskers	  extend	  to	  range	  of	  data	  with	  experiments	  performed	  in	  triplicate	  and	  n	  =	  4	  for	  all	  treatments.	  Letters	  are	  assigned	  based	  using	  Tukey’s	  HSD	  (α	  =	  0.05)	  with	  treatments	  are	  significantly	  different	  assigned	  different	  letters.......................................................................................................31	  Figure	  2.5.	  	  Explants	  after	  four	  weeks	  on	  light,	  media	  type	  and	  media	  strength	  treatments	  where	  treatments	  are	  as	  follows:	  (a)	  red	  light,	  half	  MS	  (b)	  red	  light,	  full	  MS	  (c)	  white	  light,	  half	  MS	  (d)	  white	  light,	  full	  MS	  (e)	  red	  light,	  half	  WPM	  (f)	  red	  light,	  full	  WPM	  (g)	  white	  light,	  half	  WPM	  (h)	  white	  light,	  full	  WPM..................................................32	  Figure	  2.6.	  	  Boxplot	  of	  rooting	  efficiency	  observed	  after	  four	  weeks	  on	  10,	  100	  and	  1000	  µM	  polyamine	  treatments	  (Spd,	  Spm	  or	  Put	  on	  either	  MS	  or	  WPM)	  where	  solid	  bars	  represent	  the	  mean,	  boxes	  encompass	  the	  first	  and	  third	  quartiles	  and	  whiskers	  extend	  to	  range	  of	  data	  with	  experiments	  performed	  in	  triplicate	  and	  n	  =	  6	  for	  all	  treatments.	  Letters	  are	  assigned	  based	  using	  Tukey’s	  HSD	  (a	  =	  0.05),	  with	  	   xv	  treatments	  that	  are	  significantly	  different	  assigned	  different	  letters.	  From	  top	  to	  bottom	  treatment	  plots	  are:	  Spd,	  Put,	  Spm.......................................................................................34	  Figure	  2.7.	  	  Explants	  after	  four	  weeks	  on	  polyamine	  treatments	  (Spd,	  Spm	  or	  Put	  on	  either	  MS	  or	  WPM)	  where	  treatments	  are	  from	  left	  to	  right	  as	  follows:	  a-­‐c	  10,	  100	  and	  1000	  µM	  Spm	  on	  MS;	  d-­‐f	  10,	  100	  and	  1000	  µM	  Spm	  on	  WPM;	  g-­‐i	  10,	  100	  and	  1000	  µM	  Spd	  on	  MS;	  j-­‐l	  10,	  100	  and	  1000	  µM	  Spd	  on	  WPM;	  m-­‐o	  10,	  100	  and	  1000	  mM	  Put	  on	  MS;	  p-­‐r	  10,	  100	  and	  1000	  µM	  Put	  on	  WPM...................................................35	  Figure	  3.1.	  	  Stages	  of	  lavender	  flowering	  (a)	  bud,	  (b)	  antethesis,	  (c)	  10%	  flower	  and	  (d)	  30%	  flower. ...............................................................................................................................................................43	  Figure	  3.2.	  	  Sample	  chromatograms	  with	  (top	  three	  panes)	  and	  without	  (bottom	  three	  panes)	  labels	  of	  leaf	  (top),	  bud	  (middle)	  and	  flower	  (bottom)	  chromatograms	  from	  wild-­‐type	  Grosso	  leaf	  samples	  extracted	  by	  sonication...................................................45	  Figure	  3.3.	  	  Stages	  of	  lavender	  leaves:	  (a)	  young,	  (b)	  medium	  and	  (c)	  old	  leaf. .......................................46	  Figure	  3.4.	  	  Overview	  of	  identified	  mutants	  by	  phenotype................................................................................49	  Figure	  3.5.	  	  EG	  108	  (a)	  showing	  light	  coloured	  flower	  and	  trailing	  flower	  morphology	  and	  wild-­‐type	  (b)	  showing	  typical	  upright	  flower	  colour	  and	  morphology. ..............................54	  Figure	  3.6.	  	  Average	  percent	  composition	  of	  major	  essential	  oil	  constituents	  across	  young,	  medium	  and	  old	  leaves	  from	  wild-­‐type	  and	  mutant	  Grosso	  plants,	  as	  calculated	  by	  equation	  1,	  error	  bars	  represent	  standard	  error.....................................................................55	  Figure	  3.7.	  	  Average	  total	  essential	  oil	  yield	  from	  young,	  medium	  and	  old	  leaves	  from	  mutant	  and	  wild-­‐type	  Grosso	  plants	  as	  calculated	  using	  equation	  2,	  error	  bars	  represent	  standard	  error. ..............................................................................................................................................56	  Figure	  3.8.	  	  Fraction	  10	  (10:90	  pentane:chloroform)	  containing	  primarily	  α-­‐cadinol. ........................57	  Figure	  4.1	  	   Overview	  of	  RNA-­‐Seq	  Analysis	  Pipeline	  (Wolf	  2013)..................................................................64	  	   xvi	  Figure	  4.2.	  	  Percentage	  distribution	  of	  gene	  sequences	  after	  GO	  mapping	  for	  GO	  cellular	  components,	  biological	  processes	  and	  molecular	  function	  at	  GO	  level	  2	  and	  top	  metabolic	  pathways	  with	  sequences	  representing	  enzymes	  from	  the	  KEGG	  database. ..........................................................................................................................................................75	  Figure	  4.3.	  	  qPCR	  Fold-­‐changes	  normalized	  to	  wild-­‐type	  expression	  levels	  for	  differentially	  expressed	  the	  gene	  candidates	  3-­‐hydroxy-­‐3-­‐methylglutaryl	  CoA	  reductase	  (HMGR),	  3-­‐hydroxy-­‐3-­‐methylglutaryl	  CoA	  synthase	  (HMGS),	  unknown	  terpene	  synthase	  (UTPS)	  1-­‐4	  and	  cadinol	  synthase	  (CADS),	  selected	  from	  alignment	  to	  the	  EST	  database,	  in	  the	  leaves	  of	  mutants	  e123-­‐3,	  e47-­‐5,	  e47-­‐3	  and	  28,	  as	  well	  as	  wild-­‐type	  Grosso	  leaf.	  Values	  are	  compared	  to	  wild-­‐type	  using	  Student’s	  t-­‐test	  where	  significance	  values	  are	  as	  follows	  *	  alpha	  =	  0.05,	  **	  alpha	  =	  0.01,	  ***	  alpha	  =	  0.001	  and	  ns	  =	  no	  significant	  difference. .......................................................................................77	  Figure	  4.4.	  	  Heatmap	  of	  comparisons	  between	  differentially	  expressed	  genes	  in	  mutants	  as	  compared	  to	  wild-­‐type	  expressed	  as	  fold	  change.	  Comparisons	  were	  performed	  using	  the	  Wilcoxon	  test	  and	  FDR	  corrected	  z	  values	  plotted.	  Red	  indicates	  under	  represented	  groups,	  while	  blue	  indicates	  over	  represented	  groups.....................................78	  Figure	  5.1.	  	  Experimental	  set-­‐up	  for	  optimization	  and	  testing	  fumigation	  toxicity	  of	  essential	  oils	  against	  adult	  D.	  suzukii. .................................................................................................................. 105	  Figure	  5.2.	  	  Exposure	  chambers	  used	  for	  contact	  toxicity	  testing	  of	  lavender	  essential	  oils	  against	  adult	  D.	  suzukii. .......................................................................................................................... 106	  Figure	  5.3.	  	  Experimental	  set-­‐up	  for	  testing	  oviposition	  deterrent	  activity	  of	  lavender	  essential	  oils. ............................................................................................................................................... 108	  	   xvii	  Figure	  5.4.	  	  Percent	  survival	  of	  SWD	  under	  control	  conditions	  (nothing	  added),	  with	  Drosophila	  medium	  added	  (control	  with	  food)	  and	  with	  damp	  filter	  paper	  added	  (control	  with	  humidity). ........................................................................................................................ 109	  Figure	  5.5.	  	  SWD	  larvae	  (a),	  oviposition	  marks	  (b)	  and	  egg	  (c)	  viewed	  under	  50x	  magnification. ............................................................................................................................................. 113	  Figure	  5.6.	  	  Oviposition	  deterrent	  activity	  of	  lavender	  essential	  oils	  against	  4-­‐7	  day	  old	  D.	  suzukii	  adults	  after	  48	  hours. ............................................................................................................... 114	  Figure	  C1.	  	   Standard	  curve	  for	  alpha-­‐bisabolol	  standard. .............................................................................. 139	  Figure	  C2.	  	   Standard	  curve	  for	  borneol	  standard............................................................................................... 140	  Figure	  C3.	  	   Standard	  curve	  for	  α-­‐cadinol	  	  standard. ......................................................................................... 141	  Figure	  C4.	  	   Standard	  curve	  for	  camphor	  standard. ........................................................................................... 142	  Figure	  C5.	  	   Standard	  curve	  for	  carene	  standard. ................................................................................................ 143	  Figure	  C6.	  	   Standard	  curve	  for	  caryophyllene	  standard. ................................................................................ 144	  Figure	  C7.	  	   Standard	  curve	  for	  1,8-­‐cineole	  standard ........................................................................................ 145	  Figure	  E1.	  	   Expression	  levels	  of	  candidate	  reference	  genes:	  ubiquitin,	  actin,	  18S	  rRNA	  and	  26S	  rRNA	  across	  all	  tissue	  samples	  including	  both	  mutant	  and	  wild-­‐type	  calculated	  by	  global	  normalization.	  Actin	  and	  18S	  rRNA	  were	  selected	  as	  reference	  genes	  for	  further	  analysis	  due	  to	  lower	  Cq	  values	  and	  decreased	  variability	  across	  samples..................................................................................................................... 147	  Figure	  E2.	  	   Amplification	  plots	  of	  candidate	  reference	  genes:	  (a)	  18s	  rRNA,	  (b)	  26S	  rRNA,	  (c)	  actin,	  (d)	  ubiquitin.................................................................................................................................... 148	  Figure	  F1.	  	   Differential	  expression	  analysis	  by	  qPCR	  of	  wild-­‐type	  plants	  against	  terpene	  synthase	  genes,	  significant	  differences	  between	  groups	  was	  determined	  by	  ANOVA	  analysis	  and	  multiple	  comparisons	  model	  with	  significant	  differences	  	   xviii	  indicated	  by	  different	  letters.	  Mean	  fold	  change	  values	  are	  plotted	  with	  error	  bars	  representing	  standard	  error	  of	  the	  mean.	  MTPS	  –	  monoterpene	  synthase;	  TPS	  –	  terpene	  synthase. ......................................................................................................................... 149	  Figure	  F2.	  	   Differential	  expression	  analysis	  by	  qPCR	  of	  terpene	  synthase	  genes	  in	  wild-­‐type	  plants.	  Significant	  differences	  between	  groups	  were	  determined	  by	  ANOVA	  analysis	  and	  multiple	  comparisons	  model	  with	  significant	  differences	  indicated	  by	  different	  letters.	  Mean	  fold	  change	  values	  are	  plotted	  with	  error	  bars	  representing	  standard	  error	  of	  the	  mean.	  TPS	  –	  terpene	  synthase. ................................... 150	  Figure	  F3.	  	   Differential	  expression	  analysis	  by	  qPCR	  of	  terpene	  synthase	  genes	  in	  wild-­‐type	  plants.	  Significant	  difference	  between	  groups	  was	  determined	  by	  ANOVA	  analysis	  and	  multiple	  comparisons	  model	  with	  significant	  differences	  indicated	  by	  different	  letters.	  Mean	  fold	  change	  values	  are	  plotted	  with	  error	  bars	  representing	  standard	  error	  of	  the	  mean.	  BDH	  –	  borneol	  dehydrogenase;	  CINS	  –	  cineole	  synthase;	  CADS	  –	  cadinol	  synthase;	  TPS	  –	  terpene	  synthase. ............................... 151	  Figure	  F4.	  	   Differential	  expression	  analysis	  of	  by	  qPCR	  tested	  against	  genes	  involved	  in	  isoprenoid	  precursor	  biosynthesis	  in	  wild-­‐type	  plants.	  Significant	  difference	  between	  groups	  was	  determined	  by	  ANOVA	  analysis	  and	  multiple	  comparisons	  model	  with	  significant	  differences	  indicated	  by	  different	  letters.	  Mean	  fold	  change	  values	  are	  plotted	  with	  error	  bars	  representing	  standard	  error	  of	  the	  mean.	  HMGR	  –	  3-­‐hydroxy-­‐3-­‐methylglutaryl	  coA	  reductase;	  MVAPP	  –	  mevalonate	  diphosphate................................................................................................................................................. 152	  Figure	  F5.	  	   Differential	  expression	  analysis	  by	  qPCR	  tested	  against	  transcription	  factor	  genes	  involved	  in	  regulation	  of	  isoprenoid	  biosynthesis	  in	  wild-­‐type	  plants.	  Significant	  difference	  between	  groups	  was	  determined	  by	  ANOVA	  analysis	  and	  	   xix	  multiple	  comparisons	  model	  with	  significant	  differences	  indicated	  by	  different	  letters.	  Mean	  fold	  change	  values	  are	  plotted	  with	  error	  bars	  representing	  standard	  error	  of	  the	  mean. ................................................................................................................. 153	  Figure	  F6.	  	   Differential	  expression	  analysis	  by	  qPCR	  of	  mutant	  leaf	  samples	  against	  terpene	  synthase	  genes,	  significant	  difference	  between	  groups	  was	  determined	  by	  ANOVA	  analysis	  and	  multiple	  comparisons	  model	  compared	  to	  wild-­‐type	  Grosso	  leaf	  samples	  with	  significant	  differences	  indicated	  by	  different	  letters.	  Mean	  fold	  change	  values	  are	  plotted	  with	  error	  bars	  representing	  standard	  error	  of	  the	  mean.	  All	  mutants	  are	  normalized	  against	  the	  average	  of	  the	  wild-­‐type	  sample.	  MTPS	  –	  monoterpene	  synthase .......................................................................................................... 154	  Figure	  F7.	  	   Differential	  expression	  analysis	  by	  qPCR	  of	  mutant	  leaf	  samples	  against	  terpene	  synthase	  genes,	  significant	  difference	  between	  groups	  was	  determined	  by	  ANOVA	  analysis	  and	  multiple	  comparisons	  model	  compared	  to	  wild-­‐type	  Grosso	  leaf	  samples	  with	  significant	  differences	  indicated	  by	  *	  (p	  <	  0.05)/**	  (p	  <	  0.01).	  Mean	  fold	  change	  values	  are	  plotted	  with	  error	  bars	  representing	  standard	  error	  of	  the	  mean.	  All	  mutants	  are	  normalized	  against	  the	  average	  of	  the	  wild-­‐type	  sample.	  	  BDH	  –	  borneol	  dehydrogenase;	  CADS	  –	  cadinol	  synthase. ................................... 155	  Figure	  F8.	  	   Differential	  expression	  analysis	  by	  qPCR	  of	  mutant	  leaf	  samples	  against	  genes	  involved	  in	  isoprenoid	  precursor	  biosynthesis.	  Significant	  difference	  between	  groups	  was	  determined	  by	  ANOVA	  analysis	  and	  multiple	  comparisons	  model	  compared	  to	  wild-­‐type	  Grosso	  leaf	  samples	  with	  significant	  differences	  indicated	  by	  *	  (p	  <	  0.05)/**	  (p	  <	  0.01).	  Mean	  fold	  change	  values	  are	  plotted	  with	  error	  bars	  representing	  standard	  error	  of	  the	  mean.	  All	  mutants	  are	  normalized	  against	  the	  	   xx	  average	  of	  the	  wild-­‐type	  sample.	  	  HMGR	  –	  3-­‐hydroxy-­‐3-­‐methylglutaryl	  coA	  reductase;	  MVAPP	  –	  mevalonate	  diphosphate............................................................................. 156	  Figure	  F9.	  	   Differential	  expression	  analysis	  by	  qPCR	  of	  mutant	  leaf	  samples	  against	  transcription	  factor	  genes	  involved	  in	  regulation	  of	  isoprenoid	  biosynthesis.	  Significant	  difference	  between	  groups	  was	  determined	  by	  ANOVA	  analysis	  and	  multiple	  comparisons	  model	  compared	  to	  wild-­‐type	  Grosso	  leaf	  samples	  with	  significant	  differences	  indicated	  by	  *	  (p	  <	  0.05)/**	  (p	  <	  0.01).	  Mean	  fold	  change	  values	  are	  plotted	  with	  error	  bars	  representing	  standard	  error	  of	  the	  mean.	  All	  mutants	  are	  normalized	  against	  the	  average	  of	  the	  wild-­‐type	  sample. ............................ 157	  Figure	  F10.	  Differential	  expression	  analysis	  by	  qPCR	  of	  mutant	  flower	  samples	  against	  terpene	  synthase	  genes,	  significant	  difference	  between	  groups	  was	  determined	  by	  ANOVA	  analysis	  and	  multiple	  comparisons	  model	  compared	  to	  wild-­‐type	  Grosso	  flower	  samples	  with	  significant	  differences	  indicated	  by	  different	  letters.	  Mean	  fold	  change	  values	  are	  plotted	  with	  error	  bars	  representing	  standard	  error	  of	  the	  mean.	  All	  mutants	  are	  normalized	  against	  the	  average	  of	  the	  wild-­‐type	  sample.	  MTPS	  –	  monoterpene	  synthase ......................................................................................... 158	  Figure	  F11.	  Differential	  expression	  analysis	  by	  qPCR	  of	  mutant	  flower	  samples	  against	  genes	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  involved	  in	  isoprenoid	  precursor	  biosynthesis.	  Significant	  difference	  between	  groups	  was	  determined	  by	  ANOVA	  analysis	  and	  multiple	  comparisons	  model	  compared	  to	  wild-­‐type	  Grosso	  leaf	  samples	  with	  significant	  differences	  indicated	  by	  *	  (p	  <	  0.05)/**	  (p	  <	  0.01).	  Mean	  fold	  change	  values	  are	  plotted	  with	  error	  bars	  representing	  standard	  error	  of	  the	  mean.	  All	  mutants	  are	  normalized	  against	  the	  average	  of	  the	  wild-­‐type	  sample.	  	  HMGR	  –	  3-­‐hydroxy-­‐3-­‐methylglutaryl	  coA	  reductase;	  MVAPP	  –	  mevalonate	  diphosphate. ........................................................................... 159	  	   xxi	  Figure	  F12.	  	  Differential	  expression	  analysis	  by	  qPCR	  of	  mutant	  flower	  samples	  against	  transcription	  factor	  genes	  involved	  in	  regulation	  of	  isoprenoid	  biosynthesis.	  Significant	  difference	  between	  groups	  was	  determined	  by	  ANOVA	  analysis	  and	  multiple	  comparisons	  model	  compared	  to	  wild-­‐type	  Grosso	  leaf	  samples	  with	  significant	  differences	  indicated	  by	  *	  (p	  <	  0.05)/**	  (p	  <	  0.01).	  Mean	  fold	  change	  values	  are	  plotted	  with	  error	  bars	  representing	  standard	  error	  of	  the	  mean.	  All	  mutants	  are	  normalized	  against	  the	  average	  of	  the	  wild-­‐type	  sample.............................. 160	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	   xxii	  Table	  of	  Symbols	  and	  Abbreviations	  	  AA	  –	  L-­‐ascorbic	  acid	  AACT	  -­‐	  acetoacetly-­‐CoA	  thiolase	  AC	  –	  activated	  charcoal	  AIP	  –	  2	  aminoindane-­‐2-­‐phosphonic	  acid	  ANOVA	  –	  analysis	  of	  variance	  BDH	  –	  borneol	  dehydrogenase	  BLAST	  –	  basic	  local	  alignment	  search	  tool	  CADS	  –	  cadinol	  synthase	  cDNA	  –	  copy	  deoxyribonucleic	  acid	  CDP-­‐ME	  -­‐	  4-­‐(cytidine	  5’-­‐diphospho)-­‐2-­‐C-­‐methyl-­‐D-­‐erythritol	  CI	  –	  confidence	  interval	  CINS	  –	  cineole	  synthase	  CMK	  -­‐	  4-­‐(cytidine	  5’-­‐diphospho)-­‐2-­‐C-­‐methyl-­‐D-­‐erythritol	  kinase	  DMAPP	  –	  dimethylallyl	  diphosphate	  DNA	  –	  deoxyribonucleic	  acid	  DNAse	  –	  deoxyribonuclease	  DXP	  –	  deoxy-­‐D-­‐xylulose-­‐5-­‐phosphate	  DXR	  –	  deoxy-­‐D-­‐xylulose-­‐5-­‐phosphate	  reductase	  DXS	  –	  deoxy-­‐D-­‐xylulose-­‐5-­‐phosphate	  synthase	  EMS	  –	  ethylmethane	  sulfonate	  EST	  –	  expressed	  sequence	  tag	  F	  –	  fraction	  FDR	  –	  Benjamin-­‐Hochberg	  false	  discovery	  rate	  	   xxiii	  GA3	  –	  gibberellic	  acid	  GABA	  -­‐	  gamma	  aminobutyric	  acid	  GAP	  –	  glyceraldehyde-­‐3-­‐phosphate	  GC	  –	  MS	  –	  gas	  chromatography	  mass	  spectrometry	  GO	  –	  gene	  ontology	  GPP	  –	  geranyl	  diphosphate	  GPPS	  –	  geranyl	  diphosphate	  synthase	  GrL	  –	  Lavandula	  x	  intermedia	  cv	  Grosso	  leaf	  GrF	  –	  Lavandula	  x	  intermedia	  cv	  Grosso	  flower	  HDR	  –	  1-­‐hydroxy-­‐2-­‐methyl-­‐2-­‐butenyl	  4-­‐disphosphate	  reductase	  HDS	  -­‐	  1-­‐hydroxy-­‐2-­‐methyl-­‐2-­‐butenyl	  4-­‐diphosphate	  synthase	  HMBPP	  -­‐	  1-­‐hydroxy-­‐2-­‐methyl-­‐2-­‐butenyl	  4-­‐diphosphate	  HMG-­‐CoA	  -­‐	  3-­‐hydroxy-­‐3-­‐methylglutaryl-­‐CoA	  HMGR	  -­‐	  3-­‐hydroxy-­‐3-­‐methylglutaryl-­‐CoA	  reductase	  HMGS	  -­‐	  3-­‐hydroxy-­‐3-­‐methylglutaryl	  Co-­‐A	  synthase	  HSD	  –	  Tukey’s	  honestly	  significant	  difference	  IAA	  –	  indole-­‐3-­‐acetic	  acid	  IBA	  –	  indolebutyric	  acid	  IPP	  –	  isopentenyl	  diphosphate	  IPPI	  –	  isopentenyl	  disphosphate	  isomerase	  KEGG	  –	  Kyoto	  encyclopedia	  of	  genes	  and	  genomes	  LaL	  –	  Lavandula	  angustifolia	  cv	  Lady	  leaf	  LaF	  –	  Lavandula	  angustifolia	  cv	  Lady	  flower	  LC50	  –	  half	  lethal	  concentration	  	   xxiv	  LPP	  –	  lavadulyl	  diphosphate	  LPPS	  –	  lavandulyl	  diphosphate	  synthase	  MCS	  -­‐	  	  2-­‐C-­‐methyl-­‐D-­‐erythritol	  2,4-­‐cyclodiphosphate	  synthase	  MCT	  -­‐	  2-­‐C-­‐methyl-­‐D-­‐erythritol-­‐4-­‐phosphate	  cytidyltransferase	  ME-­‐2,4cPP	  -­‐	  2-­‐C-­‐methyl-­‐D-­‐erythritol	  2,4-­‐cyclodiphosphate	  MEP	  -­‐	  2-­‐C-­‐methyl-­‐D-­‐erythritol-­‐4-­‐phosphate	  MIQE	  –	  minimum	  information	  for	  publication	  of	  quantitative	  real-­‐time	  polymerase	  chain	  reaction	  experiments	  MK	  –	  mevalonate	  kinase	  MS	  –	  Murashige	  and	  Skoog	  MTPS	  –	  monoterpene	  synthase	  MVA	  –	  mevalonate	  MVAP	  –	  mevalonate	  5-­‐phosphate	  MVAPP	  –	  mevalonate	  5-­‐disphosphate	  NAA	  –	  naphthylacetic	  acid	  NMDA	  -­‐	  N-­‐methyl-­‐D-­‐aspartate	  NMR	  –	  nuclear	  magnetic	  resonance	  spectroscopy	  NR	  –	  non-­‐redundant	  ns	  –	  no	  significant	  difference	  PCR	  –	  polymerase	  chain	  reaction	  PMK	  –	  phosphomevalonate	  kinase	  Put	  –	  putrescine	  PVP	  -­‐	  polyvinylpyrrolidone	  RNA	  –	  ribonucleic	  acid	  	   xxv	  RNAse	  –	  ribonuclease	  RPKM	  –	  reads	  per	  kilobase	  of	  transcript	  per	  million	  reads	  mapped	  qPCR	  –	  real-­‐time	  quantitative	  polymerase	  chain	  reaction	  SNV	  –	  single	  nucleotide	  variant	  Spd	  –	  spermidine	  Spm	  –	  spermine	  SWD	  –	  spotted	  wing	  drosophila	  TDZ	  –	  thiadiazuron	  TPS	  –	  terpene	  synthase	  UTPS	  –	  unknown	  monoterpene	  synthase	  WPM	  –	  Llyod	  and	  McCown	  woody	  plant	  mediu	   1	  Chapter	  1.	  Introduction	  	  1.1. 	  Lavender	  Lavenders	  are	  a	  diverse	  group	  of	  essential	  oil	  producing	  perennial	  shrubs	  in	  the	  genus	  Lavandula,	  in	  the	  Lamiaceae	  family.	  Comprised	  of	  more	  than	  40	  species	  and	  more	  than	  100	  cultivars	  and	  hybrid	  varieties,	  only	  three	  are	  grown	  commercially	  for	  their	  essential	  oil:	  English	  lavender	  (Lavandula	  angustifolia	  Mill.),	  spike	  lavender	  (L.	  latifolia)	  and	  their	  hybrid	  lavandin	  (L.	  x	  intermedia)	  (Upson	  and	  Andrews	  2004a).	  English	  lavender	  is	  considered	  to	  have	  the	  highest	  quality	  oil	  in	  the	  fragrance	  industry	  with	  very	  little	  camphor	  and	  high	  levels	  of	  linalool	  and	  linalyl	  acetate.	  Spike	  lavenders	  have	  significantly	  higher	  amounts	  of	  camphor,	  1,8-­‐cineole	  and	  borneol,	  which,	  although	  contributing	  a	  less	  pleasing	  odour	  to	  their	  oil,	  have	  significant	  bioactivity	  and	  are	  therefore	  of	  interest	  to	  the	  alternative	  medicine	  industry	  (Harborne	  and	  Williams	  2004).	  Lavandin	  exhibits	  traits	  of	  both	  parents	  with	  intermediate	  levels	  of	  the	  major	  constituents	  of	  English	  and	  spike	  lavender	  (Table	  1).	  Of	  the	  commercially	  grown	  lavenders	  Grosso	  lavandin	  (L.	  x	  intermedia)	  shows	  characteristic	  hybrid	  vigor	  and	  is	  the	  most	  widely	  grown	  for	  its	  essential	  oil,	  producing	  up	  to	  ten	  times	  more	  oil	  than	  English	  lavender	  (Upson	  and	  Andrews	  2004b).	  	  Table	  1.1	  The	  major	  essential	  oil	  constituents	  of	  L.	  latifolia,	  L.	  x	  intermedia	  and	  L.	  angustifolia.	  	   L.	  latifolia	   L.	  x	  intermedia	   L.	  angustifolia	  1,8	  -­‐	  Cineole	   25-­‐36%	   4-­‐10%	   -­‐	  Camphor	   5.3-­‐15.3%	   6-­‐12%	   -­‐	  Borneol	   0.8-­‐4.9%	   1.5-­‐3.7%	   -­‐	  Linalool	   26-­‐44%	   20-­‐35%	   10-­‐50%	  Linalyl	  acetate	   0-­‐1.5%	   19-­‐38%	   12-­‐54%	  Lavandulyl	  acetate	   0.2-­‐1.5%	   0.5-­‐3%	   0.1-­‐14%	  	  Although	  they	  are	  now	  grown	  worldwide,	  all	  lavenders	  originate	  from	  the	  Mediterranean	  region	  where	  they	  have	  been	  used	  for	  their	  pleasant	  scent	  in	  strewing	  herbs,	  	   2	  aromatherapy,	  traditional	  medicine	  and	  washing	  since	  Greek	  and	  Roman	  times.	  The	  genus	  name	  itself	  originates	  from	  its	  original	  use	  in	  washing	  water	  with	  Lavandula	  being	  derived	  from	  the	  Latin	  “lavare”	  meaning	  to	  wash.	  In	  more	  recent	  history	  lavender	  essential	  oil	  has	  been	  used	  in	  the	  flavour	  and	  fragrance	  industries	  as	  well	  as	  in	  traditional	  and	  alternative	  medicine	  (Castle	  and	  Lis-­‐Balchin	  2004).	  Lavender	  essential	  oil	  has	  been	  reported	  to	  have	  insect	  repellent,	  insecticidal,	  anti-­‐inflammatory,	  antioxidant,	  pro-­‐apoptotic,	  anti-­‐tumor,	  anti-­‐depressant,	  anti-­‐spasmolytic,	  anxiolytic,	  antifungal,	  antibacterial,	  antiparasitic,	  carminative,	  sedative,	  immunomodulatory	  and	  analgesic	  properties	  (Cavanagh	  and	  Wilkinson	  2002;	  Moon	  et	  al.	  2006;	  Woronuk	  et	  al.	  2010;	  Baker	  et	  al.	  2012).	  This	  diverse	  activity	  has	  made	  it	  an	  appealing	  candidate	  for	  both	  medicinal	  and	  agricultural	  applications.	  	  The	  neurological	  activity,	  particularly	  the	  effect	  of	  lavender	  on	  the	  limbic	  system,	  has	  been	  reported	  to	  be	  due	  to	  its	  interaction	  with	  serotonergic,	  N-­‐methyl-­‐D-­‐aspartate	  (NMDA)	  and	  gamma	  aminobutyric	  acid	  (GABA)	  A	  receptors.	  In	  particular	  linalool	  and	  linalyl	  acetate	  have	  been	  found	  to	  be	  able	  to	  enter	  the	  blood	  stream	  through	  ingestion	  across	  the	  skin	  during	  applications	  such	  as	  massage	  and	  also	  via	  inhalation	  and	  have	  an	  effect	  on	  these	  receptors	  (Lis-­‐Balchin	  2004;	  Landelle	  et	  al.	  2008;	  Chioca	  et	  al.	  2013).	  Lavandula	  essential	  oils	  and	  particularly	  camphor	  has	  also	  been	  shown	  to	  block	  sodium	  and	  calcium	  channels	  leading	  to	  anti-­‐muscarinic	  effects	  and	  inhibition	  of	  acetylcholinesterase	  has	  also	  been	  reported	  in	  both	  insect	  and	  mammalian	  models	  (El-­‐Sheikh	  et	  al.	  2005;	  Acikalin	  et	  al.	  2012).	  Immunomodulatory	  and	  anti-­‐inflammatory	  properties	  have	  been	  reported	  to	  be	  due	  to	  the	  activity	  of	  1,8-­‐cineole	  and	  borneol	  through	  their	  interaction	  with	  intestinal	  microbiota	  and	  suppression	  of	  tumor	  necrosis	  factor	  alpha	  (Abe	  et	  al.	  2003;	  Baker	  et	  al.	  2012).	  Many	  of	  the	  mono-­‐	  and	  sesquiterpenes	  making	  up	  lavender	  essential	  oils	  have	  been	  tested	  for	  	   3	  bioactivity	  and	  in	  many	  cases	  the	  activity	  of	  the	  individual	  constituents	  does	  not	  match	  that	  of	  the	  overall	  activity	  of	  the	  essential	  oil	  indicating	  that	  bioactivity	  is	  a	  result	  of	  synergistic	  activity	  of	  all	  the	  constituents	  including	  diverse	  minor	  components	  found	  as	  less	  than	  1%	  of	  overall	  oil	  composition.	  The	  mode	  of	  action	  of	  lavender	  essential	  oil	  as	  an	  antimicrobial	  agent	  has	  been	  related	  to	  its	  solvent	  like	  qualities	  which	  leads	  to	  disruption	  of	  cell	  membranes	  as	  well	  as	  hyphal	  degradation	  and	  cytoplasmic	  coagulation	  in	  fungi	  among	  other	  effects	  (Soylu	  et	  al.	  2010).	  Appendix	  1	  details	  reported	  bioactivities	  of	  the	  major	  constituents	  of	  L.	  angustifolia,	  L.	  latifolia	  and	  L.	  intermedia.	  	  1.2. Essential	  Oils	  Essential	  oils	  are	  volatile	  oils	  comprised	  primarily	  of	  isoprenoids,	  in	  particular	  the	  mono-­‐	  and	  sesquiterpenes,	  and	  in	  plants	  are	  involved	  in	  allelopathy,	  plant	  defense	  and	  pollinator	  attraction.	  The	  isoprenoids	  are	  a	  diverse	  class	  of	  compounds,	  which	  encompasses	  not	  only	  the	  C10	  monoterpenes	  and	  C15	  sesquiterpenes	  but	  also	  hemi-­‐	  (C5),	  di-­‐	  (C20),	  tri-­‐	  (C30),	  and	  poly-­‐	  (>C30)	  terpenes.	  These	  constituents	  may	  be	  produced	  in	  any	  number	  of	  specialized	  structures	  in	  plants,	  but	  are	  generally	  secreted	  and	  stored	  in	  specialized	  cavities	  and	  structures	  as	  they	  are	  highly	  insoluble	  in	  water	  and	  have	  solvent	  like	  properties	  making	  them	  difficult	  and	  sometimes	  toxic	  to	  store	  within	  a	  plant	  cell.	  These	  specialized	  structures	  include	  resin	  ducts	  and	  glandular	  trichomes.	  In	  lavender,	  essential	  oils	  are	  produced	  in	  glandular	  trichomes	  present	  on	  stem,	  leaf	  and	  particularly	  flower	  surfaces	  and	  in	  general	  they	  are	  composed	  of	  three	  main	  part:	  a	  secretory	  cell,	  a	  stalk	  and	  a	  storage	  cavity	  (1,	  2	  and	  3	  respectively	  in	  Figure	  1)(Huang	  et	  al.	  2008).	  Essential	  oils	  are	  commercially	  valuable	  due	  to	  both	  their	  pleasant	  scent	  and	  their	  bioactivity.	  	  ! ^!!J/O&'(!A4A!56%))/)O!(+(61';)!>/6';:6;V(!V2;1;O'%V2:!;<!N<';>!+(<1!1;!'/O21P!12(!<';)1!%)-!"%6S!9/(X!;<!%!O+%)-&+%'!1'/62;>(4!N.'+%)-!%)-!E%2>;&-7!?@A[%P4!!!B2(!/)-&:1'/%+!%VV+/6%1/;):!%)-!"/;+;O/6%+!%61/9/1/(:!;<!(::()1/%+!;/+:!%)-!12(/'!6;):1/1&()1:!6%)!"(!V'(-/61(-!"#!12(/'!)%1&'%+!<&)61/;):!/)!V+%)1:4!J;'!(,%>V+(!>%)#!>;);1('V()(:!%'(!(+/6/1(-!/)!'(:V;):(!1;!V%12;O()!%11%6S7!:&62!%: %+V2%YV/)()(!NE('6/('!(1!%+4!?@@mP4!B2/:!%61/9/1#!/:!&:(<&+!/)!";12!>(-/6/)%+!%)-!/)-&:1'/%+!%VV+/6%1/;):!%:!>;);1('V()(:!;'!X2;+(!(::()1/%+!;/+:!6%)!"(!&:(-!<;'!1'(%1>()1!;<!<&)O%+!%)-!"%61('/%+!/)<(61/;):!;'!1;!/)2/"/1!O';X12!;<!<;;-!:V;/+%O(!V%12;O():4!*--/1/;)%++#!>%)#!>;);1('V()(:!%'(!%61&%++#!/):(61!V2(';>;)(:7!:&62!%:!+/)%+;;+7!X2/62!/:!%!>%1/)O!V2(';>;)(!/)!"((:4!D)!V+%)1:!12(:(!6;>V;&)-:!%'(!;<1()!:(6'(1(-!/)!<+;'%+!1'/62;>(:!1;!%11'%61!V;++/)%1;':!NE%)1!(1!%+4!?@@TP4!B2(:(!:%>(!;'!:/>/+%'!6;>V;&)-:!>%#!%+:;!"(!:(6'(1(-!/)!+(%<7!:1(>!;'!';;1!1'/62;>(:!1;!%11'%61!V'(-%1;':!;<!/):(61:!<((-/)O!;)!12(!V+%)1!N*"'%>:;)!(1!%+4!?@@eP4!B2(!6;):/:1()6#!;<!12(:(!6;>V;&)-:!%6';::!+/<(!<;'>:!!/:!%!V;X('<&+!1;;+!<;'!V+%)1:!%++;X/)O!12(>!1;!6;>>&)/6%1(!X/12!12(/'!:&'';&)-/)O:4!$(%<!(::()1/%+!;/+:!%'(!%+:;!2/O2!/)!:(:W&/1('V()(:7!X2/62!%'(!X(++!S);X)!1;!2%9(!/):(61/6/-%+!V';V('1/(:!%)-!%'(!V';-&6(-!"#!>%)#!/):(61:!%:!-(<():(!6;>V;&)-:!N$sV(0!(1!%+4!?@A[P4!K)(!:&62!(,%>V+(!/:!(>/::/;)!;<!12(!<%')(:()(!"#!12(!V(%!%V2/-!A58-+>31*6>3$(6*1&.!C%''/:!N*V2/-/-%(P!X2/62!/:!V';-&6(-!%:!%!S%/';>;)(!/)!'(:V;):(!1;!%11%6S!"#!V'(-%1;':!:&62!%:!+%6(X/)O:!%)-!+%-#"/'-!"((1+(:!Nt;%62/>!(1!%+4!?@A[P4!D)!12/:!6%V%6/1#!<%')(:()(!<&)61/;)!/)!%V2/-!-(<():(!"#!%11'%61/)O!V'(-%1;':!;'!	   5	  parasitoids	  of	  these	  aphid	  predators.	  In	  plants	  farnesene	  is	  also	  a	  minor	  but	  common	  constituent	  of	  plant	  essential	  oils.	  Although	  these	  constituents	  often	  have	  multiple	  biological	  activities,	  their	  in	  planta	  activity	  provides	  important	  clues	  on	  potential	  new	  applications.	  	  	  In	  addition	  to	  their	  medicinal	  applications	  essential	  oils	  are	  used	  extensively	  in	  the	  food	  and	  fragrance	  industries.	  Monoterpenes	  such	  as	  1,8-­‐cineole	  and	  menthol	  are	  well-­‐recognized	  active	  ingredients	  in	  many	  cough	  and	  cold	  products	  as	  they	  possess	  soothing	  and	  cough	  suppressant	  activities.	  Additionally	  if	  you	  look	  at	  many	  scented	  products	  it	  is	  likely	  that	  one	  or	  more	  of	  the	  listed	  ingredients	  will	  be	  a	  mono-­‐	  or	  sesquiterpene,	  with	  one	  of	  the	  most	  common	  being	  linalool.	  The	  most	  commonly	  associated	  industrial	  application	  with	  essential	  oils	  is	  its	  use	  in	  the	  flavour	  and	  fragrance	  industries,	  which	  makes	  up	  the	  majority	  of	  the	  demand	  for	  lavender	  essential	  oils,	  however,	  it	  is	  becoming	  increasingly	  important	  in	  other	  industries	  as	  well.	  Essential	  oils	  have	  found	  applications	  in	  the	  food	  industry	  as	  inhibitors	  of	  both	  fungal	  and	  bacterial	  food	  spoilage	  microorganisms	  both	  in	  the	  field	  and	  in	  post-­‐harvest	  applications	  as	  well	  as	  in	  meat	  and	  seafood	  (Zambonelli	  et	  al.	  1996;	  Moon	  et	  al.	  2007;	  Lodhia	  et	  al.	  2009;	  Imelouane	  et	  al.	  2009;	  Gómez-­‐Estaca	  et	  al.	  2010;	  Soylu	  et	  al.	  2010;	  Djenane	  et	  al.	  2012).	  Essential	  oils,	  such	  as	  lavender	  essential	  oils	  have	  also	  been	  found	  to	  have	  preservative	  properties	  due	  to	  their	  antioxidant	  potential,	  acting	  as	  stabilizers	  to	  preserve	  the	  quality	  of	  food	  during	  storage,	  heating	  or	  cooking	  (Da	  Porto	  et	  al.	  2009;	  Rodrigues	  et	  al.	  2012)	  .	  In	  one	  study	  it	  was	  found	  that	  addition	  of	  lavender	  essential	  oils	  to	  soybean	  oil	  during	  microwaving	  preserved	  the	  quality	  of	  the	  oil	  by	  stabilizing	  the	  lipid	  fraction,	  preventing	  its	  oxidation	  (Rodrigues	  et	  al.	  2012).	  The	  use	  of	  essential	  oils	  as	  natural	  insect	  repellents	  and	  insecticides	  in	  one	  of	  the	  most	  promising	  industrial	  applications	  of	  lavender	  essential	  oils	  with	  products	  using	  lavender	  essential	  oil	  	   6	  already	  having	  been	  developed	  (van	  Tol	  et	  al.	  2007).	  	  EOs	  have	  been	  found	  to	  possess	  both	  repellency	  and	  toxic	  activity	  towards	  a	  variety	  of	  insects	  that	  are	  pests	  in	  field,	  and	  during	  food	  storage	  and	  are	  generally	  active	  due	  to	  their	  solvent-­‐like	  activity,	  damaging	  the	  insect	  cuticle	  on	  contact	  as	  well	  as	  disrupting	  insect	  metabolism	  (El-­‐Sheikh	  et	  al.	  2005;	  Rozman	  et	  al.	  2007).	  Some	  well-­‐known	  already	  registered	  essential	  oils	  based	  insecticides	  include	  pyrethrum	  and	  neem	  oil.	  1.3. 	  Biosynthesis	  of	  essential	  oils	  All	  isoprenoids	  are	  built	  from	  five	  carbon	  isoprene	  units,	  isopentenyl	  diphosphate	  (IPP)	  and	  dimethylallyl	  disphosphate	  (DMAPP),	  which	  are	  produced	  by	  two	  distinct	  but	  interactive	  pathways	  in	  plants,	  the	  cytosolic	  mevalonate	  (MVA)	  pathway	  and	  the	  plastidial	  1-­‐deoxy-­‐D-­‐xylulose-­‐5-­‐phosphate	  (DXP)	  pathway.	  	  The	  MVA	  pathway	  leads	  primarily	  to	  sesqui-­‐	  and	  triterpenes	  and	  the	  DXP	  pathway	  gives	  rise	  to	  the	  mono-­‐,	  di-­‐	  and	  polyterpenes,	  though	  both	  pathways	  have	  been	  found	  to	  contribute	  to	  some	  members	  of	  all	  classes	  (Eisenreich	  et	  al.	  1998;	  Hemmerlin	  et	  al.	  2003;	  Vranova	  et	  al.	  2012)(Figure	  2).	  The	  DXP	  pathway	  starts	  with	  the	  addition	  of	  glyceraldehyde-­‐3-­‐phosphate	  (GAP)	  and	  pyruvate,	  which	  are	  derived	  from	  glycolytic	  reactions,	  to	  form	  DXP	  by	  DXP	  synthase	  (DXS),	  the	  enzyme	  catalyzing	  the	  first	  committed	  step	  in	  the	  DXP	  pathway.	  DXP	  reductase	  (DXR)	  then	  reduces	  DXP	  to	  form	  2-­‐C-­‐methyl-­‐D-­‐erythritol-­‐4-­‐phosphate	  (MEP),	  which	  is	  then	  phosphorylated	  and	  a	  cytidine	  added	  by	  MEP	  cytidyltransferase	  (MCT)	  to	  form	  4-­‐(cytidine	  5’-­‐diphospho)-­‐2-­‐C-­‐methyl-­‐D-­‐erythritol	  (CDP-­‐ME).	  Another	  phosphate	  is	  then	  added	  to	  CDP-­‐ME	  by	  CDP-­‐ME	  kinase	  (CMK)	  and	  is	  then	  cyclized	  by	  2-­‐C-­‐methyl-­‐D-­‐erythritol	  2,4-­‐cyclodiphosphate	  synthase	  (MCS)	  form	  2-­‐C-­‐methyl-­‐D-­‐erythritol	  2,4-­‐cyclodiphosphate	  (ME-­‐2,4cPP).	  The	  cyclic	  group	  is	  then	  oxidized	  by	  1-­‐hydroxy-­‐2-­‐methyl-­‐2-­‐butenyl	  4-­‐diphosphate	  synthase	  (HDS)	  to	  form	  1-­‐hydroxy-­‐2-­‐methyl-­‐2-­‐butenyl	  4-­‐diphosphate	  (HMBPP),	  which	  can	  	   7	  then	  be	  reduced	  to	  form	  IPP	  and	  DMAPP	  (Eisenreich	  et	  al.	  1998;	  Vranova	  et	  al.	  2012;	  Xiang	  et	  al.	  2012).	  In	  the	  MVA	  pathway	  three	  acetyl	  Co-­‐A	  molecules	  derived	  from	  the	  citrate	  cycle	  are	  added	  by	  acetoacetly-­‐CoA	  thiolase	  (AACT)	  and	  3-­‐hydroxy-­‐3-­‐methylglutaryl	  Co-­‐A	  synthase	  (HMGS)	  to	  form	  3-­‐hydroxy-­‐3-­‐methylglutaryl-­‐CoA	  (HMG-­‐CoA)	  via	  acetoacetyl-­‐CoA.	  HMG-­‐CoA	  is	  then	  reduced	  by	  HMG-­‐CoA	  reductase	  (HMGR)	  in	  the	  first	  committed	  and	  the	  rate	  limiting	  step	  in	  this	  pathway	  to	  form	  MVA.	  MVA	  is	  then	  phosphorylated	  twice,	  first	  by	  mevalonate	  kinase	  (MK)	  to	  form	  MVA	  5-­‐phosphate	  (MVAP)	  then	  by	  phosphomevalonate	  kinase	  (PMK)	  to	  form	  MVA	  5-­‐diphosphate	  (MVAPP),	  which	  is	  then	  decarboxylated	  to	  form	  IPP.	  In	  the	  MVA	  pathway	  IPP	  can	  then	  be	  isomerized	  by	  isopentenyl	  diphosphate	  isomerase	  	  	  	  	  	  	  	  ! Z!!!J/O&'(!A4?4!K9('9/(X!;<!12(!1('V();/-!"/;:#)12(1/6!V%12X%#7!X2('(\!**Y=;*!]!%6(1;%6(1#+Y=;*o!=FHY!E.!]!^YN6#1/-/)(!TpY-/V2;:V2;PY?Y=Y>(12#+YFY('#12'/1;+o!=FHYE.?HH!]!?YV2;:V2;Y^YN6#1/-/)(!Tp!-/YV2;:V2;PY?Y=Y>(12#+YFY('#12'/1;+o!FqH!]!AY-(;,#YFY,#+&+;:(YTYV2;:V2%1(o!JHH!]!<%')(:#+!-/:V2;:V2%1(o!M*H!]!O+#6('%+-(2#-(Y[YV2;:V2%1(o!MHH!]!O('%)#+!-/V2;:V2%1(o!MMHH!]!O('%)#+O('%)#+!-/V2;:V2%1(o!CE3HH!AY2#-';,#Y?Y>(12#+Y?Y"&1()#+!^Y-/:V2;:V2%1(o!CEMY=;*!]![Y2#-';,#Y[Y>(12#+O+&1%'#+Y=;*o!!$HH!]!+%9%)-&+#+!-/V2;:V2%1(o!E.Y?7^Y6HH!]!?Y=Y>(12#+YFY('#12'/1;+Y?7^Y6#6+;-/V2;:V2%1(o!E.H!]!?Y=Y>(12#+YFY('#12'/1;+Y^YV2;:V2%1(o!EQ*!]!>(9%+;)%1(o!EQ*H!]!>(9%);+%1(YTYV2;:V2%1(o!EQ*HH!]!>(9%+;)%1(YTY-/V2;:V2%1(4!!NDHHDP!1;!<;'>!FE*HH!N=';1(%&!%)-!$;;>/:!Ame?o!E%2>;&-!%)-!=';1(%&!?@@?P4!B;!<;'>!12(!6%'";)!62%/)!"%6S";)(!DHH!%)-!FE*HH!%'(!6;)-():(-!"#!V'()#+1'%):<('%:(:7!%)-!-(V()-/)O!;)!12(!1('V()(!1;!"(!:#)12(:/0(-7!-/<<('()1!V'()#+1'%):<('%:(:!%'(!&:(-!NJ/O&'(![P!N3&'S(!?@@Ao!Q'%);9%!(1!%+4!?@A?P4!D)!12(!6%:(!;<!>;);1('V()(!"/;:#)12(:/:!/)!+%9()-('7!	   9	  two	  prenyltransferases	  are	  involved,	  geranyl	  diphosphate	  synthase	  (GPPS)	  which	  synthesizes	  geranyl	  diphosphate	  (GPP),	  the	  precursor	  for	  regular	  monoterpenes	  or	  lavandulyl	  diphosphate	  synthase	  (LPPS),	  which	  synthesizes	  lavandulyl	  diphosphate	  (LPP),	  the	  precursor	  for	  irregular	  monoterpenes	  (Figure	  4)	  (Burke	  2001;	  Demissie	  et	  al.	  2013).	  	  Regular	  or	  irregular	  monoterpenes	  are	  defined	  by	  the	  manner	  in	  which	  the	  isoprene	  units	  are	  joined;	  in	  the	  former	  they	  are	  joined	  in	  a	  head	  to	  tail	  manner	  whereas	  irregular	  monoterpenes	  involve	  joining	  in	  different	  configurations	  (Demissie	  et	  al.	  2013).	  Once	  LPP	  or	  GPP	  has	  been	  synthesized	  they	  are	  then	  modified	  to	  produce	  unique	  monoterpene	  end-­‐products	  by	  individual	  monoterpene	  synthases	  (TPS)	  (Figure	  3).	  These	  chemical	  modifications	  include	  reduction,	  oxidation	  and	  cyclization	  reactions	  among	  others	  and	  the	  diversity	  of	  the	  activity,	  function	  and	  substrate	  specificity	  of	  terpene	  synthases	  is	  the	  mechanism	  behind	  the	  vast	  biodiversity	  of	  terpenes	  (Mahmoud	  and	  Croteau	  2002).	  	  	  ! A@!!J/O&'(!A4[4!.,%>V+(:!;<!:;>(!:V(6/</6!1('V()(!:#)12%:(!V%12X%#:!+(%-/)O!1;!V';-&61/;)!;<!6;>>;)!6;):1/1&()1:!;<!+%9()-('!(::()1/%+!;/+4!!ITSTIT 3ANKL?=DEF(EB(A<<AF=D?L(EDL(;DE<YF=HA<D<(5;>(!1('V()(:!V+%#!9('#!:V(6/%+/0(-!';+(:!/)!%!V+%)1:!+/<(7!%)-!%:!:&62!12(/'!"/;:#)12(:/:!%)-!%66&>&+%1/;)!/:!);1!'(W&/'(-!%1!%++!1/>(:7!"&1!'%12('!;)+#!/)!'(:V;):(!1;!:V(6/</6!"/;1/67!%"/;1/6!%)-!-(9(+;V>()1%+!1'/OO(':!X/12/)!12(!V+%)1!NL&%O+/%!(1!%+4!?@A?o!Q'%);9%!(1!%+4!?@A?o!H%1'%!(1!%+4!?@A[P4!B2/:!+(%-:!1;!%!'(W&/'(>()1!<;'!:1'/61!'(O&+%1/;)!;<!1('V()(!V';-&61/;)!1;!V'(9()1!X%:1/)O!9%+&%"+(!'(:;&'6(:4!D)!%--/1/;)!1;!12(!';+(!6;>V%'1>()1%+/0%1/;)!V+%#:!/)!>;-&+%1/)O!6%'";)!<+&,!12';&O2!12(!/:;V'();/-:!V%12X%#:7!12('(!%'(!1X;!>%/)!V;/)1:!%1!X2/62!1('V()(!V';-&61/;)!6%)!"(!'(O&+%1(-\!1'%):6'/V1/;)%+!'(O&+%1/;)!%)-!-/'(61!/)2/"/1/;)!;<!()0#>(:!X/12/)!%!"/;:#)12(1/6!V%12X%#!NQ'%);9%!(1!%+4!?@A?P4!	   11	  Transcriptional	  regulation	  occurs	  due	  to	  the	  action	  of	  transcription	  factors,	  deoxy-­‐ribonucleic	  acid	  (DNA)	  binding	  proteins	  or	  protein	  complexes	  which	  interact	  with	  the	  promoter	  region	  of	  particular	  genes	  to	  activate	  or	  deactivate	  gene	  expression	  (Patra	  et	  al.	  2013).	  Transcription	  factors	  have	  diverse	  roles,	  and	  participate	  in	  the	  regulation	  of	  virtually	  every	  process	  occurring	  within	  a	  plant.	  Although	  the	  amount	  of	  information	  known	  about	  transcriptional	  regulation	  of	  some	  secondary	  metabolites,	  such	  as	  the	  phenolics	  and	  the	  alkaloids	  is	  increasing	  steadily,	  little	  is	  still	  known	  about	  the	  transcription	  factors	  regulating	  terpene	  biosynthesis	  (Patra	  et	  al.	  2013).	  Of	  the	  84	  gene	  families	  of	  transcription	  factors	  identified	  in	  plants	  to	  date,	  only	  three	  have	  been	  found	  to	  play	  an	  active	  role	  in	  regulation	  of	  terpene	  biosynthesis:	  WRKY,	  bHLH	  and	  AP2-­‐EREBP	  (Pérez-­‐Rodríguez	  et	  al.	  2010;	  Hong	  et	  al.	  2012;	  Yang	  et	  al.	  2012;	  Patra	  et	  al.	  2013).	  A	  BLAST	  (basic	  local	  alignment	  search	  tool)	  search	  of	  an	  expressed	  sequence	  tag	  (EST)	  library	  created	  from	  L.	  x	  intermedia	  cv	  Grosso	  putatively	  identified	  20	  families	  of	  transcription	  factors	  in	  lavender	  which	  included	  76	  individual	  contigs,	  Figure	  1.4	  summarizes	  these	  results.	  	  	  	  	  	  	  	  	  	  	  	   12	  Table	  1.2.	  Examples	  of	  some	  transcription	  factor	  families	  identified	  in	  plants	  and	  their	  functions.	  Gene	  Family	   Processes	  regulated	  in	  plants	   Reference	  AP2-­‐EREBP	   Flower	  development,	  cell	  proliferation,	  secondary	  metabolism,	  absisic	  acid	  and	  ethylene	  response	  modulator,	  abiotic	  and	  biotic	  stress	  responses,	  terpenoid	  biosynthesis	  	  (Riechmann	  and	  Ratcliffe	  2000;	  Dietz	  et	  al.	  2010;	  Patra	  et	  al.	  2013)	  ARF	   Auxin	  primary	  response,	  	  development,	  floral	  meristem	  patterning	  	  (Guilfoyle	  et	  al.	  1998)	  AUX/IAA	   Repression	  auxin	  response	   (Tiwari	  et	  al.	  2004;	  Pérez-­‐Rodríguez	  et	  al.	  2010)}	  bHLH	   Anthocyanin	  biosynthesis,	  sesquiterpene	  biosynthesis,	  phytochrome	  signaling,	  globulin	  expression,	  fruit	  dehiscence,	  carpel	  and	  epidermal	  development	  (Buck	  and	  Atchley	  2003;	  Hong	  et	  al.	  2012;	  Yang	  et	  al.	  2012)	  bZIP	   Pathogen	  defense,	  light	  and	  stress	  signaling,	  seed	  maturation,	  flower	  development,	  seed-­‐storage	  gene	  expression,	  leaf	  development,	  absisic	  acid	  response,	  gibberellin	  biosynthesis	  	  (Riechmann	  and	  Ratcliffe	  2000;	  Jakoby	  et	  al.	  2002)	  C2C2-­‐Dof	   Seed	  germination,	  endosperm-­‐specific	  expression,	  carbon	  metabolism,	  plant	  growth	  and	  development	  (Riechmann	  and	  Ratcliffe	  2000;	  Yanagisawa	  2004)	  C2C2-­‐GATA	   Light	  and	  nitrogen	  dependent	  control	  	  (Reyes	  et	  al.	  2004)	  GRAS	   Gibberellin	  signal	  transduction,	  root	  radial	  patterning,	  axillary	  meristem	  formation,	  phytochrome	  A	  signal	  transduction,	  gametogenesis	  	  (Tian	  et	  al.	  2004;	  Pérez-­‐Rodríguez	  et	  al.	  2010)	  MADS	   Flower	  development,	  floral	  meristem	  and	  organ	  identity	   (Ng	  and	  Yanofsky	  2001)	  MYB	  and	  MYB	  related	  Plant	  development,	  defense	  response,	  anthocyanin	  biosynthesis,	  secondary	  metabolism,	  cell	  morphogenesis,	  meristem	  formation,	  floral	  and	  seed	  development,	  cell	  cycle	  control,	  light	  and	  hormone	  signaling	  pathways,	  abiotic	  and	  biotic	  stress	  response	  	  (Riechmann	  and	  Ratcliffe	  2000;	  Yanhui	  et	  al.	  2006)	  NAC	   Embryonic,	  floral	  and	  vegetative	  development,	  pattern	  formation,	  defense	  and	  abiotic	  stress	  response	  (Riechmann	  and	  Ratcliffe	  2000;	  Olsen	  et	  al.	  2005)	  SBP	   Floral	  timing,	  fetility,	  plant	  defense,	  development,	  shoot	  maturation	  (Unte	  et	  al.	  2003;	  Birkenbihl	  et	  al.	  2005;	  Stone	  et	  al.	  2005;	  Schwarz	  et	  al.	  2008)	  ! A[!M()(!J%>/+#! H';6(::(:!'(O&+%1(-!/)!V+%)1:! I(<('()6(!B=H! M';X12!%)-!-(9(+;V>()1!!N=&"%:!(1!%+4!AmmmP!nIcR! B('V();/-!"/;:#)12(:/:7!V+%)1!-(<():(7!1'/62;>(!-(9(+;V>()17!:()(:6()6(7!"/;1/6!%)-!%"/;1/6!:1'(::!'(:V;):(!N.&+O(>!?@@@o!Hu'(0YI;-'vO&(0!(1!%+4!?@A@o!H%1'%!(1!%+4!?@A[Pw!!!J/O&'(!A4^4!B'%):6'/V1/;)!<%61;'!<%>/+/(:!V&1%1/9(+#!/-()1/</(-!"#!%!3$*5B!:(%'62!;<!%!!/()(*$+,-.,%*"!69!M';::;!<+;'%+!O+%)-&+%'!1'/62;>(!.5B!+/"'%'#7!O/9()!%:!1;1%+!)&>"('!;<!6;)1/O:!/-()1/</(-!X/12/)!(%62!<%>/+#!%:!%!V';V;'1/;)!;<!%++!1'%):6'/V1/;)!<%61;':!V&1%1/9(+#!/-()1/</(-4!$/O21('!6;+;&'(-!"%':!'(V'(:()1!<%>/+/(:!12%1!2%9(!"(()!/>V+/6%1(-!/)!12(!'(O&+%1/;)!;<!1('V()(!"/;:#)12(:/:4!(B('V()(!"/;:#)12(:/:!/:!%+:;!'(O&+%1(-!%1!12(!>(1%";+/6!+(9(+7!%)-!12(!>(62%)/:>:!"(2/)-!12/:!'(O&+%1/;)!2%9(!"(()!>&62!>;'(!6+(%'+#!-(</)(-!12%)!12;:(!/)9;+9(-!/)!1'%):6'/V1/;)%+!'(O&+%1/;)7!X/12!<((-"%6S!/)2/"/1/;)!V+%#/)O!%!>%a;'!';+(!/)!12(!%++;6%1/;)!;<!6%'";)!<+;X!N51('>('!(1!%+4!AmmAo!I;-'/O&(0Y=;)6(V6/;)!?@@`P4!B2(!</':1!>%/)!V;/)1!<;'!'(O&+%1/;)!/:!/)!12(!:#)12(:/:!;<!DHH!%)-!FE*HH!9/%!12(!EQ*!%)-!FqH!V%12X%#:4!B2/:!-(1('>/)(:!12(!	   14	  amount	  of	  carbon	  that	  is	  being	  diverted	  from	  other	  processes	  towards	  terpene	  biosynthesis,	  and	  as	  such	  has	  been	  a	  major	  point	  of	  focus	  for	  efforts	  in	  metabolic	  engineering	  (Mahmoud	  and	  Croteau	  2002;	  Botella-­‐Pavía	  et	  al.	  2004;	  Vranova	  et	  al.	  2012;	  Kampranis	  and	  Makris	  2012).	  In	  the	  MVA	  pathway	  HMGR	  catalyzes	  the	  rate	  limiting	  step	  in	  the	  pathway	  and	  is	  the	  main	  regulatory	  enzyme.	  This	  enzyme	  is	  subject	  to	  regulation	  by	  phosphorylation	  as	  well	  as	  hormone	  and	  sterol	  mediated	  feedback	  inhibition	  (stermer	  et	  al.	  1994;	  Newman	  and	  Chappell	  1999;	  Goldstein	  et	  al.	  2006;	  Burg	  and	  Espenshade	  2011).	  Other	  enzymes	  in	  the	  MVA	  pathway	  have	  been	  found	  to	  play	  more	  minor	  but	  still	  important	  roles	  in	  regulation	  of	  the	  MVA	  pathway,	  for	  example	  AACT,	  which	  catalyzes	  the	  first	  committed	  step	  in	  the	  pathway	  is	  under	  feedback	  inhibition	  in	  response	  to	  abiotic	  stresses	  (Soto	  et	  al.	  2011).	  In	  contrast	  the	  DXP	  pathway	  has	  been	  found	  to	  be	  regulated	  at	  multiple	  points:	  the	  main	  regulatory	  enzyme	  is	  DXS	  which	  catalyzes	  the	  rate	  limiting	  reaction	  and	  is	  subject	  to	  feedback	  inhibition	  as	  well	  as	  transcriptional	  regulation,	  the	  last	  enzyme	  in	  the	  pathway	  HDR	  which	  synthesizes	  IPP	  and	  DMAPP	  is	  also	  involved	  in	  modulating	  carbon	  flux,	  though	  the	  mechanisms	  are	  more	  poorly	  understood	  (Botella-­‐Pavía	  et	  al.	  2004;	  Rodriguez-­‐Concepcion	  2006;	  Vranova	  et	  al.	  2012;	  Xiang	  et	  al.	  2012).	  	  1.4. 	  Plant	  Tissue	  Culture	  Plant	  tissue	  culture	  and	  particularly	  regeneration	  is	  based	  on	  the	  concept	  of	  totipotency,	  the	  potential	  for	  individual	  plant	  cells	  to	  give	  rise	  to	  a	  new	  plant,	  and	  plant	  tissue	  culture	  is	  the	  process	  through	  with	  this	  occurs	  in	  vitro	  (Krikorian	  2004).	  Plant	  tissue	  culture,	  broadly,	  can	  be	  grouped	  into	  three	  classes,	  indirect	  morphogenesis,	  direct	  morphogenesis	  and	  cuttings.	  The	  latter	  of	  these	  techniques	  is	  not	  commonly	  used	  in	  biotechnology	  but	  is	  very	  common	  in	  commercial	  nurseries.	  Cuttings	  are	  generally	  taken	  at	  meristems	  or	  nodes	  where	  the	  plant	  is	  already	  actively	  dividing	  and	  are	  then	  placed	  on	  media	  or	  in	  soil	  to	  	   15	  promote	  root	  formation	  and	  continued	  plant	  growth,	  this	  allows	  for	  direct	  clonal	  propagation	  of	  a	  specific	  plant	  (Cassells	  2004).	  Although	  there	  are	  many	  variations	  in	  cultures	  techniques	  depending	  on	  the	  aims	  of	  a	  project,	  generally	  it	  can	  be	  simplified	  to	  three	  steps	  (Figure	  1.5,	  1.6).	  	  In	  indirect	  morphogenesis	  the	  first	  step	  is	  callus	  induction.	  Mature	  tissue	  such	  as	  leaf,	  stem	  or	  floral	  tissue	  is	  excised	  from	  a	  parent	  plant,	  often	  injured,	  and	  then	  placed	  in	  liquid,	  solid	  or	  semi-­‐solid	  medium	  containing	  plant	  growth	  regulators	  which	  induce	  essentially	  a	  cancerous	  state	  in	  which	  the	  plant	  cells	  at	  the	  injury	  sites	  start	  to	  divide	  rapidly	  without	  differentiation.	  This	  callus	  can	  then	  be	  induced	  to	  go	  through	  organogenesis	  or	  in	  some	  conditions	  to	  produce	  somatic	  embryos	  (Cassells	  2004).	  In	  the	  case	  of	  direct	  morphogenesis	  callus	  production	  is	  not	  observed	  and	  instead	  plant	  cells	  at	  the	  injury	  site	  directly	  differentiate	  and	  undergo	  organogenesis	  or	  embryogenesis.	  Organogenesis	  is	  the	  production	  of	  specific	  plant	  organs	  such	  as	  roots	  or	  shoots,	  whereas	  somatic	  embryogenesis	  is	  the	  process	  by	  which	  the	  callus	  cells	  are	  stimulated	  to	  form	  a	  plant	  embryo	  which	  is	  essentially	  identical	  to	  a	  zygotic	  embryo	  produced	  through	  sexual	  reproduction	  but	  is	  produced	  from	  somatic	  cells	  (Arnold	  2008;	  Raghavan	  2004).	  Organogenesis	  is	  generally	  easier	  to	  attain	  and	  is	  therefore	  often	  the	  preferred	  technique	  when	  tissue	  culture	  is	  applied	  in	  biotechnology	  (Cassells	  2004;	  George	  et	  al.	  2008).	  	  	  	  	  ! A`!!J/O&'(!A4T4!D)-/'(61!;'O%);O()(:/:!/)!!/()(*$+,-.,%*"!69!M';::;\!6%++&:!/)-&61/;)!N1;V!+(<1P7!:2;;1!/)/1/%1/;)!N";11;>!+(<1P7!';;1!/)-&61/;)!N6()1'(P!%)-!%66+/>%1/0%1/;)!N'/O21P!N.'+%)-!%)-!E%2>;&-7!?@A["P!!J/O&'(!A4`4!D)-/'(61!:;>%1/6!(>"'#;O()(:/:!/)!=3-*"$%-&.(1"+*#&.\!6%++&:!/)-&61/;)!N<%'!+(<1P7!:;>%1/6!(>"'#;!V';-&61/;)!N6()1'(!+(<1P7!(>"'#;!-(9(+;V>()1!N6()1'(!'/O21P7!%66+/>%1/0%1/;)!N<%'!'/O21P4!!H+%)1!1/::&(!6&+1&'(!1%S(:!%-9%)1%O(!;<!";12!()-;O();&:!V+%)1!2;'>;)(:!%)-!:#)12(1/6%++#!V';-&6(-!V+%)1!O';X12!'(O&+%1;':4!D)!O()('%+!X2()!(/12('!;<!12(:(!:&":1%)6(:!/:!%VV+/(-!(,;O();&:+#7!%:!/)!1/::&(!6&+1&'(7!12(#!%'(!'(<(''(-!1;!%:!V+%)1!O';X12!'(O&+%1;':7!;<!X2/62!12('(!%'(!</9(!>%/)!O';&V:\!%&,/):7!6#1;S/)/):7!O/""('(++/):7!(12#+()(!%)-!%":6/:/6!%6/-!NB%"+(![P4!3#!<%'!12(!>;:1!6;>>;)+#!&1/+/0(-!;<!12(:(!O';&V:!%'(!12(!%&,/):!%)-!12(!6#1;S/)/):7!";12!;<!X2/62!6;)1%/)!>%)#!(,%>V+(:!;<!";12!)%1&'%++#!%)-!:#)12(1/6%++#!V';-&6(-!62(>/6%+:!NE&'62!%)-!5%,()%!?@@^o!E%62%S;9%!(1!%+!?@@Zo!9%)!51%-()!(1!%+!?@@Zo!E;:2S;9!(1!%+!?@@ZP4!*1!%!V+%)1p:!6(++&+%'!+(9(+!()-;O();&:!%&,/):!%'(!/)9;+9(-!/)!6(++!-/9/:/;)!%)-!(+;)O%1/;)!%)-!%'(!%+:;!/)9;+9(-!/)!12(!<;'>%1/;)!%)-!>%/)1()%)6(!;<!>('/:1(>:7!V;+%'/1#7!%V/6%+!-;>/)%)6(!%)-!>(-/%1/;)!;<!1';V/:>:4!D)!6(++!6&+1&'(!	   17	  techniques,	  auxins	  are	  generally	  used	  to	  induce	  rooting.	  Chemically,	  auxins	  are	  characterized	  by	  the	  presence	  of	  either	  an	  indole	  or	  an	  aromatic	  ring	  in	  their	  structure.	  In	  culture	  they	  are	  useful	  in	  inducing	  callus	  formation	  and	  organogenesis,	  with	  their	  most	  common	  application	  being	  rooting	  induction	  (Machakova	  et	  al	  2008).	  A	  good	  example	  is	  the	  use	  of	  the	  auxin	  indolebutyric	  acid	  (IBA)	  in	  commercially	  available	  rooting	  powder	  rooting	  powders	  are	  commonly	  used	  in	  both	  home	  and	  commercial	  situations	  to	  induce	  rooting	  of	  cuttings.	  When	  used	  in	  combination	  with	  cytokinins	  the	  second	  class	  of	  plant	  growth	  regulator	  auxins	  lead	  to	  callus	  formation	  and	  bud	  and	  growth	  initiation	  (Murch	  and	  Saxena	  2008).	  Cytokinins,	  like	  auxins,	  have	  diverse	  effects	  with	  the	  ability	  to	  modulate	  plant	  growth	  and	  behavior	  in	  conjunction	  with	  or	  contrary	  to	  other	  plant	  growth	  regulators	  that	  are	  present	  and	  with	  differing	  effects	  depending	  on	  species	  and	  tissue	  type.	  Generally,	  however,	  cytokinins	  stimulate	  protein	  synthesis	  and	  are	  involved	  in	  cell	  cycle	  control	  in	  whole	  plants	  and	  are	  particularly	  involved	  in	  chloroplast	  maturation	  and	  senescence.	  In	  culture,	  cytokinins	  are	  able	  to	  overcome	  apical	  dominance	  allowing	  for	  shoot	  multiplication	  by	  releasing	  lateral	  buds	  from	  dormancy	  (van	  Staden	  et	  al.	  2008).	  The	  first	  cytokinin	  to	  be	  discovered	  was	  the	  synthetic	  cytokinin	  kinetin,	  discovered	  to	  be	  a	  product	  of	  the	  breakdown	  of	  herring	  sperm	  that	  was	  used	  in	  cell	  culture	  (Amasino	  2005).	  Most	  cytokinins	  are	  purines	  with	  the	  class	  comprising	  all	  chemicals	  that	  showed	  activity	  similar	  to	  that	  of	  kinetin,	  essentially	  the	  ability	  to	  stimulate	  cell	  division.	  Since	  then	  many	  more	  cytokinins,	  including	  naturally	  produced	  examples	  have	  been	  discovered,	  however,	  in	  general	  the	  natural	  cytokinins,	  such	  as	  zeatin,	  are	  significantly	  more	  expensive	  as	  compared	  with	  synthetic	  alternatives,	  with	  the	  synthetic	  cytokinin	  benzylaminopurine	  being	  one	  of	  the	  most	  common	  (van	  Staden	  et	  al.	  2008).	  	  	  ! AZ!B%"+(!A4[4!.,%>V+(:!;<!:;>(!6;>>;)!V+%)1!O';X12!'(O&+%1;':!G%>(! 51'&61&'(! =+%::! B#V(!`Y3()0#+%>/);V&'/)(!N3*P!=#1;S/)/)! 5#)12(1/6!G`Y<&'<&'#+%>/);V&'/)(!NS/)(1/)P!!=#1;S/)/)! 5#)12(1/6!b(%1/)!!=#1;S/)/)! G%1&'%+!B2/%-/%0&';)!NBFbP!!=#1;S/)/)l!%&,/)!/)-&6('!5#)12(1/6!D)-;+("&1#'/6!%6/-!ND3*P!!*&,/)! G%1&'%+l!5#)12(1/6j!jV';-&6(-!/)!9('#!+;X!+(9(+:!)%1&'%++#!D)-;+(Y[Y%6(1/6!%6/-!ND**P!!*&,/)! G%1&'%+!G%V212#+%6(1/6!%6/-!NG**P!!*&,/)! 5#)12(1/6!M/""('(++/6!%6/-!NM*[P!!M/""('(++/)! G%1&'%+!*":/:/6!%6/-!!*":/6/6!%6/-! G%1&'%+!.12#+()(! .12#+()(!!G%1&'%+!	   19	  The	  applications	  for	  plant	  tissue	  culture	  are	  multifaceted	  ranging	  from	  plant	  conservation	  to	  biotechnology	  and	  bioreactors.	  Regardless	  of	  the	  application,	  however,	  an	  optimal	  protocol	  for	  regeneration	  of	  the	  species	  of	  interest	  is	  first	  required.	  This	  is	  frequently	  a	  time	  consuming	  and	  often	  complex	  process	  which	  is	  effected	  not	  only	  by	  the	  growth	  factors	  present	  in	  the	  media	  but	  also	  media	  type	  and	  composition,	  i.e.	  micro	  and	  macronutrient	  content,	  light	  conditions,	  amount	  and	  type	  of	  gelling	  agent,	  type	  of	  tissue	  used	  and	  the	  presence	  or	  absence	  of	  many	  different	  additives.	  The	  choice	  of	  all	  these	  conditions	  can	  be	  governed	  by	  protocols	  in	  similar	  species	  and	  regeneration	  type	  desired	  and	  must	  be	  modified	  through	  experimental	  analysis	  to	  determine	  optimum	  conditions	  (George	  and	  Davies	  2008;	  George	  and	  de	  Klerk	  2008;	  Thorpe	  et	  al	  2008).	  	  1.5. 	  In	  vitro	  mutagenesis	  of	  plants	  and	  determination	  of	  gene	  targets	  Induction	  of	  mutations	  in	  plants	  has	  allowed	  for	  not	  only	  the	  evolution	  of	  plant	  species	  in	  nature,	  but	  has	  become	  an	  important	  laboratory	  technique.	  There	  are	  diverse	  techniques	  by	  which	  this	  can	  be	  accomplished	  but	  they	  can	  be	  broadly	  grouped	  into	  two	  categories:	  those	  induced	  by	  physical	  agents	  and	  those	  induced	  by	  chemical	  agents.	  Physical	  treatments	  include	  x-­‐rays,	  gamma	  radiation	  and	  ultraviolet	  radiation,	  while	  chemical	  agents	  include	  alkylating,	  intercalating	  and	  base	  analogues	  (Mba	  et	  al.	  2010).	  	  These	  techniques	  lead	  to	  changes	  in	  appearance,	  traits	  or	  characteristics	  of	  the	  organism	  of	  interest	  due	  to	  DNA	  modification.	  These	  DNA	  modifications	  may	  be	  minor	  such	  as	  the	  point	  mutations	  induced	  by	  the	  alkylating	  agent	  ethyl	  methane	  sulfonate	  (EMS)	  or	  may	  result	  in	  changes	  to	  entire	  chromosomes	  (Mba	  et	  al.	  2010).	  In	  plants	  mutagenesis	  is	  most	  often	  induced	  at	  the	  single	  cell	  stage,	  generally	  in	  the	  form	  of	  callus,	  though	  embryos	  and	  whole	  plants	  have	  also	  been	  used.	  The	  application	  of	  a	  chemical	  or	  physical	  mutagen	  to	  the	  callus	  stage	  has	  the	  advantage	  of	  being	  able	  to	  reliably	  produce	  entire	  plants	  containing	  a	  	   20	  particular	  mutation,	  however,	  these	  techniques	  do	  require	  broad	  scale	  screening	  to	  determing	  those	  individuals	  producing	  the	  desired	  traits	  as	  they	  are	  non-­‐specific	  in	  their	  activity.	  Tissue	  culture	  techniques	  allow	  for	  these	  single	  callus	  cells	  to	  be	  grown	  into	  shoots	  and	  then	  whole	  organisms	  that	  can	  be	  moved	  to	  the	  field,	  subcultured	  and	  multiplied	  (Mba	  et	  al.	  2010).	  	  Once	  individuals	  with	  desired	  mutations	  have	  been	  identified	  the	  mutated	  gene	  can	  be	  identified	  using	  various	  molecular	  techniques.	  Primarily	  sequencing,	  both	  of	  the	  genome	  and	  transcriptome,	  have	  been	  used	  to	  compare	  mutated	  individuals	  to	  wild-­‐type	  individuals	  and	  in	  particular,	  next-­‐generation	  sequencing	  techniques	  such	  as	  Illumina©	  sequencing,	  which	  provide	  large	  numbers	  of	  reads,	  thereby	  increasing	  accuracy	  of	  sequencing,	  are	  being	  used	  (Blumenstiel	  et	  al.	  2009;	  Uchida	  et	  al.	  2011;	  Uchida	  et	  al.	  2014).	  Other	  techniques	  such	  as	  polymerase	  chain	  reaction	  (PCR),	  gene	  cloning	  and	  	  target	  sequencing	  can	  also	  be	  used	  on	  a	  smaller	  scale	  to	  target	  and	  examine	  specific	  genes	  instead	  of	  the	  whole	  genome	  or	  transcriptome	  (Lis	  et	  al.	  2008).	  	  To	  identify	  gene	  targets	  for	  EMS	  mutation	  in	  plants	  expressing	  a	  unique	  and	  desirable	  essential	  oil	  composition	  next-­‐generation	  sequencing	  techniques	  will	  be	  used.	  Illumina©	  is	  a	  next-­‐generation	  sequencing	  technique	  that	  can	  be	  used	  to	  sequence	  either	  the	  genome	  or	  transcriptome	  of	  a	  plant	  and	  will	  be	  used	  to	  perform	  both	  on	  wild-­‐type	  and	  mutant	  plants,	  as	  has	  been	  previously	  reported	  (Uchida	  et	  al.	  2014).	  Illumina©	  	  sequencing	  is	  a	  fluorescence	  based	  sequencing-­‐by-­‐synthesis	  technology	  that	  is	  more	  cost	  effective	  than	  other	  sequencing	  technologies,	  allows	  for	  high	  throughput	  analysis	  and	  produces	  large	  numbers	  of	  20-­‐150	  bp	  reads	  for	  every	  sequence.	  This	  greater	  read	  number	  allows	  for	  more	  accurate	  identification	  of	  single	  base	  pair	  mutations.	  	  	   21	  1.6. 	  Biological	  activity	  screening	  	  Drosophila	  suzukii	  or	  spotted	  wing	  drosophila	  (SWD)	  is	  a	  vinegar	  fly	  species	  native	  to	  Japan.	  It	  has	  recently	  become	  an	  invasive	  pest	  in	  North	  America.	  Reported	  as	  far	  back	  as	  the	  1930’s	  in	  Japan,	  first	  reports	  of	  SWD	  in	  North	  America	  came	  from	  berry	  growers	  in	  California	  in	  2008	  (Hauser	  2011).	  Spotted	  wing	  drosophila	  quickly	  moved	  up	  the	  west	  coast	  of	  North	  America	  and	  the	  first	  reports	  of	  SWD	  in	  British	  Columbia	  came	  from	  a	  cherry	  orchard	  near	  Kelowna	  in	  2009	  (Acheampong	  and	  Thistlewood	  2011;	  Lee	  et	  al.	  2011b;	  Thistlewood	  et	  al.	  2012).	  Since	  this	  first	  report,	  SWD	  has	  become	  a	  major	  invasive	  pest	  in	  British	  Columbia	  and	  the	  Pacific	  Northwest	  (Washington	  and	  Oregon)	  and	  has	  spread	  as	  far	  as	  Europe,	  having	  been	  able	  to	  colonize	  diverse	  stone	  fruits	  and	  berry	  crops	  in	  the	  regions	  including:	  blueberry,	  raspberry,	  strawberry,	  cherry	  and	  blackberry	  (Lee	  et	  al.	  2011b;	  Lee	  et	  al.	  2011a).	  Unlike	  related	  Drosophila	  species	  that	  oviposite	  only	  in	  decaying	  or	  damaged	  fruit,	  SWD	  posses	  a	  unique	  serrated	  ovipositor	  that	  is	  capable	  of	  piercing	  the	  skin	  of	  unripe	  and	  ripening	  fruit	  (Atallah	  et	  al.	  2014).	  	  Due	  to	  the	  speed	  and	  efficiency	  with	  which	  the	  pest	  has	  spread	  integrated	  pest	  management	  programs	  continue	  to	  develop	  and	  evolve	  as	  both	  growers,	  food	  inspectors	  and	  scientists	  try	  to	  develop	  effective	  pest	  management	  protocols	  (Dreves	  2011;	  Lee	  et	  al.	  2011b).	  Current	  control	  methods	  for	  SWD	  management	  rely	  on	  frequent	  application	  of	  traditional	  pesticides,	  SWD	  is	  able	  to	  go	  through	  numerous	  life	  cycles	  in	  a	  single	  growing	  season	  due	  to	  its	  relatively	  short	  life	  cycle.	  	  Fruit	  processors	  often	  have	  zero	  tolerance	  policies	  for	  infested	  fruit	  (Beers	  and	  Van	  Steenwyk	  2011;	  Bruck	  et	  al.	  2011).	  Unfortunately	  frequent	  application	  of	  insecticides	  are	  raising	  alarm	  due	  to	  their	  damaging	  effects	  on	  beneficial	  insects,	  such	  as	  pollinators	  and	  predacious	  insects	  as	  well	  as	  contamination	  of	  local	  ecosystems	  and	  water	  sources	  (Lin	  et	  al.	  2011;	  Tan	  et	  al.	  2014).	  As	  a	  result	  of	  this,	  	   22	  there	  is	  a	  growing	  interest	  in	  less	  ecologically	  damaging	  control	  methods	  and	  a	  strong	  push	  to	  develop	  new,	  organic	  and	  ecologically	  sustainable	  methods,	  which	  are	  still	  effective	  in	  controlling	  this	  economically	  devastating	  pest	  (Cleveland	  et	  al.	  2002;	  Ioriatti	  et	  al.	  2011;	  Lee	  et	  al.	  2011b).	  	  Essential	  oils	  are	  produced	  by	  many	  plant	  species	  and	  serve	  many	  important	  commercial	  purposes	  including	  use	  in	  cooking,	  medicine	  and	  agriculture.	  Plants	  produce	  these	  important	  compounds	  in	  nature	  for	  many	  purposes	  including	  allelopathy,	  pollinator	  attraction	  and	  plant	  defense	  (Mahmoud	  and	  Croteau	  2002).	  From	  an	  agricultural	  perspective	  their	  functions	  in	  insect	  attraction	  and	  plant	  defense	  are	  of	  greatest	  interest.	  Some	  essential	  oil	  constituents,	  such	  as	  linalool,	  are	  also	  insect	  pheromones,	  while	  many	  others	  both	  alone	  and	  as	  whole	  oils	  such	  as	  have	  shown	  strong	  activity	  as	  repellents,	  feeding	  and	  oviposition	  deterrents	  and	  insecticides	  in	  diverse	  genera	  of	  insects	  (Mant	  et	  al.	  2005;	  Sfara	  et	  al.	  2009;	  Regnault-­‐Roger	  et	  al.	  2012).	  One	  such	  commercial	  example	  is	  the	  impregnation	  of	  grafting	  strips	  with	  lavender	  essential	  oil	  for	  the	  repellency	  of	  the	  red	  bud	  borer,	  which	  show	  95%	  efficacy	  (van	  Tol	  et	  al.	  2007).	  1.7. 	  Research	  Objectives	  and	  Hypotheses	  	  Essential	  oils	  and	  their	  individual	  components	  are	  important	  plant	  natural	  products	  exploited	  by	  humans	  for	  many	  diverse	  purposes	  and	  industries	  including	  cosmetics	  and	  perfumery,	  medicine,	  insect	  control	  and	  biofuels	  among	  others	  (Woronuk	  et	  al.	  2010;	  Reinsvold	  et	  al.	  2011;	  Regnault-­‐Roger	  et	  al.	  2012).	  Though	  the	  composition	  of	  lavender	  essential	  oils	  is	  well	  defined	  the	  mechanisms	  by	  which	  they	  are	  produced	  and	  through	  which	  this	  process	  is	  regulated	  is	  as	  yet	  to	  be	  fully	  defined.	  In	  particular	  there	  is	  a	  lack	  of	  literature	  on	  transcriptional	  and	  post-­‐transcriptional	  regulatory	  mechisms	  in	  essential	  oil	  producing	  plants.	  The	  production	  of	  essential	  oil	  mutants	  will	  provide	  a	  model	  system	  in	  	   23	  which	  to	  study	  the	  contribution	  of	  differential	  biosynthetic	  and	  regulatory	  mechanisms	  in	  producing	  specific	  phenotypes.	  Additionally	  these	  plants	  may	  represent	  new	  and	  valuable	  commercial	  cultivars	  which	  provide	  higher	  yield	  per	  acre	  while	  also	  producing	  an	  oil	  of	  improved	  quality.	  The	  last	  objective	  of	  this	  hypothesis	  was	  to	  examine	  the	  effect	  of	  different	  essential	  oils	  on	  an	  invasive	  pest	  Drosophila	  suzukii	  for	  which	  the	  effect	  of	  essential	  oils	  and	  in	  particular	  lavender	  essential	  oils	  has	  yet	  to	  be	  reported.	  This	  thesis	  will	  address	  these	  concerns	  via	  four	  hypotheses:	  (1)	  regeneration	  efficiency	  of	  L.	  x	  intermedia	  cv	  Grosso	  can	  be	  improved	  through	  adjustment	  of	  culture	  conditions(2)	  cultures	  treated	  with	  the	  chemical	  mutagen	  ethyl	  methanesulfonate	  will	  yield	  genetically	  distinct	  mutants	  with	  an	  altered	  essential	  oil	  profile	  due	  to	  mutations	  of	  structural	  and/or	  regulatory	  genes	  (3)	  EMS-­‐induced	  mutations	  in	  regenerated	  plants	  can	  be	  identified	  using	  molecular	  techniques	  such	  as	  sequencing	  and	  qPCR	  and,	  (4)	  essential	  oils	  with	  different	  compositions	  will	  have	  varying	  activities	  against	  the	  invasive	  pest	  Drosophila	  suzukii.	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	   24	  Chapter	  2.	  Development	  of	  a	  protocol	  for	  regeneration	  of	  L.	  x	  intermedia	  cv	  Grosso	  	  	  2.1. 	  Abstract	  	  An	  improved	  protocol	  for	  the	  regeneration	  of	  lavandin	  (Lavandula	  x	  intermedia	  cv	  Grosso)	  is	  reported.	  Thiadazuron	  (9	  µM),	  a	  plant	  growth	  modulating	  phenylurea,	  was	  used	  to	  induce	  callus	  formation	  and	  shoot	  initiation	  from	  cultured	  leaf	  explants.	  	  Newly	  emerged	  shoots	  were	  maintained	  on	  media	  containing	  0.05	  µM	  NAA	  to	  allow	  maturation,	  and	  then	  transferred	  to	  media	  containing	  2.9	  µM	  IAA	  to	  allow	  root	  formation.	  	  The	  phenolic	  control	  agents	  polyvinylpyrrolidone	  (PVP),	  ascorbic	  acid	  (AA),	  2-­‐aminoindane-­‐2-­‐phosphonic	  acid	  (AIP)	  and	  activated	  charcoal	  (AC)	  were	  tested	  for	  their	  ability	  to	  prevent	  shoot	  browning	  and	  death	  in	  culture.	  All	  agents	  except	  PVP	  were	  found	  to	  be	  effective,	  with	  ascorbic	  acid	  being	  most	  consistent	  in	  promoting	  development	  of	  healthy	  mature	  shoots.	  The	  effect	  of	  light	  type	  (red	  light	  vs.	  white	  light)	  and	  culture	  medium	  composition	  (full	  and	  half	  strength	  Murashige	  and	  Skoog	  (MS)	  medium,	  and	  Llyod	  and	  McCown’s	  woody	  plant	  medium	  (WPM))	  on	  rooting	  efficiency	  was	  also	  evaluated.	  Cultures	  on	  half	  strength	  WPM	  in	  white	  light	  were	  found	  to	  have	  the	  highest	  rooting	  efficiency.	  Additionally	  application	  of	  the	  polyamines	  putrescine	  (Put),	  spermine	  (Spm)	  and	  spermidine	  (Spd)	  were	  tested	  for	  their	  effect	  on	  rooting.	  While	  rooting	  efficiency	  was	  not	  improved	  with	  any	  of	  the	  polyamine	  treatments,	  Spm	  and	  Spd	  were	  found	  to	  have	  an	  inhibitory	  effect	  at	  concentrations	  greater	  than	  10	  µM.	  	  	  2.2. 	  Materials	  and	  Methods	  	  Mature	  Lavandula	  x	  intermedia	  var	  Grosso	  plants	  were	  obtained	  from	  Okanagan	  Lavender	  Herb	  Farm,	  Kelowna,	  BC,	  Canada.	  Leaf	  or	  node	  cuttings	  were	  removed	  and	  surface	  	   25	  sterilized	  by	  immersion	  in	  20%	  sodium	  hypochlorite	  with	  0.1%	  Triton-­‐X100	  (Fisher	  Scientific,	  Canada)	  for	  20	  minutes	  with	  stirring.	  Explants	  were	  then	  washed	  three	  times	  with	  sterile	  water	  for	  5	  minutes	  each.	  To	  propagate	  shoots	  for	  shoot	  survival	  trials	  a	  previously	  reported	  method,	  used	  for	  propagating	  L.	  angustifolia,	  was	  used	  with	  minor	  modifications.	  Briefly	  leaf	  explants	  were	  lacerated	  along	  the	  edges	  then	  plated	  abaxial	  side	  down	  on	  MS	  media	  including	  vitamins	  (Murashige	  and	  Skoog	  1962)	  (PhytoTechnology	  Laboratories,	  USA)	  containing	  3%	  (w/v)	  sucrose	  (Fisher	  Scientific,	  Canada),	  2.35	  %	  (w/v)	  gellan	  gum	  (PhytoTechnology	  Laboraties,	  USA)	  and	  9	  µM	  TDZ	  (PhytoTechnology	  Laboratories,	  USA),	  pH	  was	  adjusted	  to	  5.8	  prior	  to	  autoclaving.	  Cultures	  were	  kept	  in	  the	  dark	  at	  25oC	  for	  approximately	  three	  weeks	  until	  shoot	  production	  was	  observed	  (Falk	  et	  al.	  2009).	  Shoots	  were	  then	  excised	  from	  the	  callus	  and	  moved	  to	  a	  16-­‐hour	  photoperiod	  and	  allowed	  to	  multiply.	  Newly	  emerged	  shoots	  were	  sub-­‐cultured	  every	  14	  days	  for	  a	  month	  to	  establish	  sufficient	  number	  of	  shoots.	  These	  shoots	  (n=12	  for	  each	  treatment	  group)	  were	  then	  placed	  one	  per	  culture	  box	  on	  MS	  medium	  (as	  described	  above)	  containing	  0.05	  µM	  NAA	  and	  one	  of	  each	  of	  the	  following	  treatments:	  10	  mg/L	  AA	  (Acros	  Organics,	  Canada),	  250	  g/mL	  PVP	  (Sigma-­‐Aldrich,	  Canada),	  0.21	  mg/L	  AIP	  (sv	  Chembiotech	  Inc.	  Edmonton,	  Canada),	  0.5	  g/L	  AC	  (EMD	  Millipore,	  USA),	  1	  g/L	  AC	  or	  no	  treatment.	  AA	  and	  PVP	  were	  filter-­‐sterilized	  (0.22	  µm,	  EMD	  Millipore,	  USA)	  and	  added	  after	  autoclaving,	  while	  AIP	  and	  AC	  were	  added	  prior	  to	  autoclaving.	  Cultures	  were	  kept	  at	  25oC,	  16-­‐hour	  photoperiod	  for	  4	  weeks	  and	  browning	  and	  leaf	  morphology	  changes	  recorded.	  At	  the	  end	  of	  four	  weeks,	  shoot	  vigor	  was	  recorded	  on	  a	  scale	  of	  zero	  to	  four	  with	  categories	  defined	  as	  follows:	  0	  –	  brown	  and	  dead;	  1	  –	  brown,	  immature;	  2	  –	  brown,	  mature;	  3	  –	  green,	  immature;	  4	  –	  green,	  mature.	  	  	   26	  For	  rooting	  trials	  node	  cuttings	  were	  placed	  on	  either	  MS	  media	  or	  WPM	  (Lloyd	  and	  McCown	  1980)(PhytoTechnology	  Laboratories,	  USA)	  at	  full	  or	  half	  strength	  with	  3%	  (w/v)	  sucrose,	  2.5%	  (w/v)	  gellan	  gum	  and	  2.9	  µM	  IAA	  (Sigma-­‐Aldrich,	  Canada)	  with	  pH	  adjusted	  to	  5.8.	  Nodes	  cultured	  on	  each	  of	  the	  four	  media	  types	  were	  then	  kept	  on	  a	  16-­‐hour	  photoperiod	  under	  either	  white	  fluorescent	  or	  red	  light	  emitting	  diode	  (LED)	  light.	  Cultures	  were	  maintained	  for	  4	  weeks	  and	  root	  formation	  was	  recorded.	  For	  each	  treatment	  group	  n	  =	  4,	  experiments	  were	  performed	  in	  triplicate.	  	  The	  effect	  of	  the	  polyamines	  Put	  (PhytoTechnology	  Laboratories,	  USA),	  Spm	  (Sigma-­‐Aldrich,	  Canada)	  and	  Spd	  (PhytoTechnology	  Laboratories,	  USA)	  on	  rooting	  efficiency	  was	  examined	  on	  plants	  that	  were	  grown	  on	  half-­‐strength	  MS	  or	  half-­‐strength	  WPM	  media	  in	  white	  light	  as	  described	  above.	  Polyamines	  were	  filter	  sterilized	  and	  added	  to	  the	  medium	  after	  autoclaving	  to	  obtain	  final	  concentrations	  of	  10,	  100	  or	  1000	  µM.	  Cultures	  were	  maintained	  for	  4	  weeks	  and	  root	  formation	  was	  recorded.	  For	  each	  treatment	  n	  =	  6,	  experiments	  were	  performed	  in	  triplicate.	  Statistical	  analysis	  was	  carried	  out	  by	  analysis	  of	  variance	  (ANOVA)	  and	  Tukey’s	  honestly	  significant	  difference	  (HSD)	  multiple	  comparisons	  model	  using	  R	  with	  α	  =	  0.05.	  Contingency	  analysis	  was	  performed	  on	  shooting	  data	  using	  JMP	  v.	  4.0.	  	  	  In	  all	  cases	  a	  full	  factorial	  design	  was	  used,	  with	  treatments	  randomly	  assigned	  to	  cultures.	  	  2.3. 	  Results	  2.3.1. Organogenesis	  from	  leaf	  callus	  A	  procedure	  previously	  developed	  for	  the	  regeneration	  of	  L.	  angustifolia	  plants	  (Falk	  et	  al.	  2009)	  was	  used	  to	  regenerate	  Grosso	  plants	  from	  leaf	  segments.	  Noticeable	  callus	  was	  observed	  at	  injury	  sites	  on	  leaf	  tissue	  within	  two	  weeks	  of	  culture	  start	  date,	  and	  after	  three	  weeks	  calli	  readily	  produced	  viable	  shoots	  Approximately	  5-­‐10	  shoots	  were	  ! ?e!V';-&6(-!V('!6%++&:7!X2/62!6;&+-!12()!"(!(,6/:(-!%)-!:&"Y6&+1&'(-!;)!E5!>(-/%!6;)1%/)/)O!m!xE!BFb!NJ/O&'(!?4AP4!52;;1:!X('(!1'%):<(''(-!1;!>(-/%!6;)1%/)/)O!G**!1;!%++;X!<&'12('!-(9(+;V>()17!%)-!12()!1;!>(-/%!6;)1%/)/)O!D**!1;!V';>;1(!';;1/)O7!2;X(9('7!>;:1!:2;;1:!-/-!);1!:&'9/9(!12/:!V';6(::!-&(!1;!"';X)/)O!%)-!);)(!;<!12;:(!12%1!:&'9/9(-!V';-&6(-!9/%"+(!';;1:!NB%"+(!?4AP4!!J/O&'(!?4A4!I(O()('%1/;)!;<!+%9%)-/)!<';>!+(%<!6&11/)O:!X2('(\!N%P!6%++&:!/)-&61/;)7!N"P!:2;;1!/)/1/%1/;)7!N6P!:2;;1!>&+1/V+/6%1/;)4!!B%"+(!?4A4!*9('%O(!9/O;'!;<!+%9%)-/)!6&+1&'(:!%<1('!(,V;:&'(!1;!9%'/;&:!1'(%1>()1:7!X2('(!A!/)-/6%1(:!%!-(%-!(,V+%)1!%)-!^!%!2(%+12#!>%1&'(!(,V+%)1!X/12!);!"';X)/)O40!B'(%1>()1! *9('%O(!Q/O;'0! 51%)-%'-!F(9/%1/;)! mTf!=;)</-()6(!D)1('9%+!G;)(! @4^?"! @4TA! N@4@m7!@4e^P!@4T!Ol$!*=! ?4TZ%! A4[Z! NA4eA7![4^`P!A!Ol$!*=! ?4T@%! A4e[! NA4^@7![4`@P!@4?A!>Ol$!*DH! ?4`e%! A4^m! NA4e?7![4`?P!A@!>Ol$!**! [4`e%! @4ZZ! N[4A@7!^4?[P!?T@!>Ol$!HQH! @4T@"! @4T?! N@4Ae7!@4Z[P!0B&S(#p:!C5F!N%!i!@4@T7!)!i!A?P!X%:!&:(-!1;!-(1('>/)(!:/O)/</6%)1!-/<<('()6(:!X/12!1'(%1>()1:!"(/)O!:/O)/</6%)1+#!-/<<('()1!%::/O)(-!-/<<('()1!+(11(':7!%)-!12;:(!12%1!%'(!);1!:/O)/</6%)1+#!-/<<('()1!%::/O)(-!12(!:%>(!+(11('4!!!	   28	  2.3.2. Addition	  of	  phenolic	  inhibitors,	  adsorbents	  and	  reducing	  agents	  Phenolic	  compounds	  secreted	  by	  cultured	  plants	  are	  a	  well-­‐known	  cause	  of	  culture	  browning	  so	  in	  an	  attempt	  to	  reduce	  this	  phenomenon,	  the	  phenolic	  control	  agents	  AA,	  AC,	  AIP	  and	  PVP	  were	  added	  to	  the	  culture	  media.	  On	  a	  ranking	  scale	  where	  a	  dead	  explant	  was	  assigned	  a	  score	  of	  zero	  and	  a	  healthy	  mature	  shoot	  scored	  a	  four	  (Figure	  2.2),	  the	  control	  group	  ranked	  at	  0.42;	  treatment	  with	  PVP	  was	  not	  significantly	  better.	  AA,	  AC	  and	  AIP	  treatments	  all	  showed	  a	  significant	  improvement	  in	  shoot	  vigor,	  with	  AA	  being	  the	  highest	  at	  3.67.	  All	  additives	  except	  PVP	  showed	  a	  significant	  improvement	  in	  shoot	  vigor	  as	  compared	  to	  the	  control,	  although	  AA	  was	  the	  most	  effective	  agent	  with	  very	  little	  variability	  in	  results	  (Table	  2.1).	  	  Both	  the	  control	  and	  PVP	  treatment	  also	  showed	  very	  low	  variability,	  however,	  AC	  and	  AIP	  treatments	  were	  less	  consistent	  with	  large	  variability	  (Table	  6).	  Only	  42%	  of	  cultures	  in	  the	  control	  survived,	  and	  those	  that	  did	  were	  of	  poor	  quality.	  In	  comparison	  83%	  of	  all	  cultures	  started	  on	  AA	  treatment	  were	  of	  good	  quality	  and	  reached	  maturity	  with	  100%	  surviving	  the	  culture	  process.	  In	  comparison,	  AC	  (0.5	  g/L	  and	  1	  g/L)	  and	  AIP	  treatments	  had	  92,	  75	  and	  92	  %	  survival,	  respectively,	  with	  42,	  50	  and	  50%	  being	  of	  good	  quality	  and	  reaching	  maturity,	  respectively.	  Only	  50%	  of	  shoots	  treated	  with	  PVP	  survived,	  with	  none	  reaching	  maturity	  (Figure	  2.3).	  	  ! ?m!!J/O&'(!?4?4!.,%>V+(:!;<!:2;;1:!6+%::/</(-!%:!N%P!2(%+12#7!>%1&'(!:2;;17!2(%+12!i!^!N"P!>%1&'(!:2;;1!X/12!"';X)/)O7!2(%+12!i!?!N6P!2(%+12#7!/>>%1&'(!:2;;17!2(%+12!i[!N-P!/>>%1&'(!:2;;1!X/12!"';X)/)O7!2(%+12!i!A4!!!!!! [@!!J/O&'(!?4[4!=;)1/)O()6#!%)%+#:/:!;<!(,V+%)1!9/O;'!%<1('!(,V;:&'(!1;!9%'/;&:!1'(%1>()1:7!)iA?!<;'!%++!1'(%1>()1:7!6;+;&'!"+;6S:!'(V'(:()1!V';V;'1/;)%+!-/:1'/"&1/;)!;<!(,V+%)1:!"#!2(%+124!!RTSTST !BBA@=(EB(LDNH=(?FJ(PAJD?(@EFJD=DEF<(EF(>EE=DFN(!B;!-(1('>/)(!12(!(<<(61:!;<!+/O21!W&%+/1#!%)-!>(-/&>!:1'()O127!);-%+!6&11/)O:!<';>!M';::;!V+%)1:!X('(!O';X)!;)!<&++!;'!2%+<!:1'()O12!E5!;'!nHE!>(-/%!&)-('!X2/1(!<+&;'(:6()1!;'!'(-!$.F!+/O214!!D)1('%61/;)!V+;1:!X('(!6;):1'&61(-!<;'!%++!1'(%1>()1!6;>"/)%1/;):!"(<;'(!*GKQ*!%)%+#:/:!X%:!V('<;'>(-!N-%1%!);1!:2;X)P!1;!-(1('>/)(!/<!:/O)/</6%)1!/)1('%61/;):!X('(!;66&''/)O4!*+12;&O2!);!/)1('%61/;)!X%:!:(()!X/12!>(-/%!1#V(7!%!:/O)/</6%)1!/)1('%61/;)!X%:!:(()!"(1X(()!+/O21!1#V(!%)-!>(-/%!:1'()O127!X/12!'(-!+/O21!2%9/)O!%!:/O)/</6%)1!(<<(61!;)+#!;)!6&+1&'(:!;)!<&++!:1'()O12!>(-/&>!NV!i!@4@AP4!E(-/%!1#V(!2%-!12(!:1';)O(:1!(<<(61!;)!';;1/)O!(<</6/()6#!X/12!:/O)/</6%)1+#!>;'(!:2;;1:!O';X)!;)!nHE!:2;X/)O!';;1/)O!NV!k!@4@@AP7!+/O21!W&%+/1#!2%-!%!>/)/>%+!(<<(61!NV!i!@4@AP4!*!>&+1/V+(!6;>V%'/:;):!>;-(+!X%:!V('<;'>(-!;)!%++!1'(%1>()1!6;>"/)%1/;):!%)-!<;&)-!12(!(<<(61:!;<!+/O21!1;!"(!-/>/)/:2(-7!X/12!1'(%1>()1!O';&V:!"(1X(()!'(-!%)-!X2/1(!+/O21!;<1()!);1!:2;X/)O!%)#!:/O)/</6%)1!	   31	  difference	  (Figure	  2.4).	  Although	  cultures	  under	  red	  light	  on	  full	  or	  half	  strength	  WPM	  had	  the	  best	  rooting	  efficiency,	  these	  treatments	  were	  not	  significantly	  better	  than	  cultures	  (at	  either	  strength)	  on	  WPM	  or	  half	  strength	  MS	  under	  white	  light.	  Red	  light	  treatments	  under	  WPM	  did	  induce	  a	  higher	  rooting	  efficiency	  than	  white	  light	  treatments,	  however,	  cultures	  under	  red	  light	  showed	  some	  etiolation,	  and	  increased	  callus	  production,	  while	  explants	  under	  white	  light	  showed	  no	  etiolation	  and	  generally	  had	  less	  callus	  production	  and	  more	  robust	  roots	  (Figure	  2.5).	  	  	  	  	  Figure	  2.4.	  Boxplot	  for	  rooting	  efficiency	  observed	  after	  four	  weeks	  on	  light,	  media	  type	  and	  media	  strength	  treatments	  where	  solid	  bars	  represent	  the	  mean,	  boxes	  encompass	  the	  first	  and	  third	  quartiles	  and	  whiskers	  extend	  to	  range	  of	  data	  with	  experiments	  performed	  in	  triplicate	  and	  n	  =	  4	  for	  all	  treatments.	  Letters	  are	  assigned	  based	  using	  Tukey’s	  HSD	  (α	  =	  0.05)	  with	  treatments	  are	  significantly	  different	  assigned	  different	  letters.	  	  	  	  	  	  ! [?!!J/O&'(!?4T4!.,V+%)1:!%<1('!<;&'!X((S:!;)!+/O217!>(-/%!1#V(!%)-!>(-/%!:1'()O12!1'(%1>()1:!X2('(!1'(%1>()1:!%'(!%:!<;++;X:\!N%P!'(-!+/O217!2%+<!E5!N"P!'(-!+/O217!<&++!E5!N6P!X2/1(!+/O217!2%+<!E5!N-P!X2/1(!+/O217!<&++!E5!N(P!'(-!+/O217!2%+<!nHE!N<P!'(-!+/O217!<&++!nHE!NOP!X2/1(!+/O217!2%+<!nHE!N2P!X2/1(!+/O217!<&++!nHE!!!!!!!!!!!!!!!!!!!!!	   33	  2.3.4. Effect	  of	  polyamines	  	  Putrescine	  treatment	  did	  not	  have	  a	  significant	  effect	  on	  rooting	  efficiency	  at	  any	  level	  (p	  =	  0.35)	  while	  spermine	  (p	  <0.001)	  and	  spermidine	  (P	  <	  0.001)	  treatments	  showed	  significant	  inhibition	  of	  rooting.	  No	  significant	  interactions	  were	  found	  between	  media	  type	  and	  polyamine	  treatment,	  with	  the	  exception	  of	  spermine	  at	  the	  10	  μM	  level	  (Appendix	  II).	  Both	  spermine	  and	  spermidine	  showed	  significant	  rooting	  inhibition	  on	  both	  WPM	  and	  MS	  at	  concentrations	  greater	  than	  10	  μM	  with	  50	  %	  inhibition	  at	  100	  μM	  on	  MS	  for	  both	  Spd	  and	  Spm,	  and	  38	  %	  inhibition	  on	  WPM	  for	  Spd	  and	  36	  %	  for	  Spm.	  Complete	  inhibition	  occurred	  for	  Spm	  at	  1	  mM	  on	  both	  media	  types	  while	  the	  effect	  of	  Spd	  was	  slightly	  weaker,	  with	  83%	  inhibition	  occurring	  on	  both	  WPM	  and	  MS	  media.	  Multiple	  comparison’s	  analysis	  found	  a	  significant	  difference	  in	  rooting	  efficiency	  at	  the	  10	  μM	  level	  for	  spermine	  treatment	  on	  WPM,	  and	  a	  significant	  difference	  at	  the	  1	  mM	  level	  for	  spermidine	  treatments,	  and	  spermine	  on	  MS	  media	  (Figure	  2.6).	  Furthermore,	  explants	  on	  higher	  polyamine	  levels	  showed	  significant	  browning	  and	  tissue	  death	  while	  explants	  at	  lower	  concentrations	  were	  of	  higher	  quality	  (Figure	  2.7).	  	   34	  	  Figure	  2.6.	  Boxplot	  of	  rooting	  efficiency	  observed	  after	  four	  weeks	  on	  10,	  100	  and	  1000	  µM	  polyamine	  treatments	  (Spd,	  Spm	  or	  Put	  on	  either	  MS	  or	  WPM)	  where	  solid	  bars	  represent	  the	  mean,	  boxes	  encompass	  the	  first	  and	  third	  quartiles	  and	  whiskers	  extend	  to	  range	  of	  data	  with	  experiments	  performed	  in	  triplicate	  and	  n	  =	  6	  for	  all	  treatments.	  Letters	  are	  assigned	  based	  using	  Tukey’s	  HSD	  (a	  =	  0.05),	  with	  treatments	  that	  are	  significantly	  different	  assigned	  different	  letters.	  From	  top	  to	  bottom	  treatment	  plots	  are:	  Spd,	  Put,	  Spm.	  	   35	  	   	  Figure	  2.7.	  Explants	  after	  four	  weeks	  on	  polyamine	  treatments	  (Spd,	  Spm	  or	  Put	  on	  either	  MS	  or	  WPM)	  where	  treatments	  are	  from	  left	  to	  right	  as	  follows:	  a-­‐c	  10,	  100	  and	  1000	  µM	  Spm	  on	  MS;	  d-­‐f	  10,	  100	  and	  1000	  µM	  Spm	  on	  WPM;	  g-­‐i	  10,	  100	  and	  1000	  µM	  Spd	  on	  MS;	  j-­‐l	  10,	  100	  and	  1000	  µM	  Spd	  on	  WPM;	  m-­‐o	  10,	  100	  and	  1000	  mM	  Put	  on	  MS;	  p-­‐r	  10,	  100	  and	  1000	  µM	  Put	  on	  WPM.	  	  	  	  	   36	  2.4. 	  Discussion	  	  A	  method	  for	  the	  regeneration	  of	  L.	  angustifolia	  plants	  from	  leaf	  tissue	  was	  recently	  reported	  (Falk	  et	  al.	  2009).	  Although	  callus	  production	  and	  shoot	  initiation	  was	  highly	  successful	  from	  Grosso	  leaf	  tissue	  (with	  up	  to	  15	  shoots	  per	  explant),	  shoot	  maturation	  and	  root	  induction	  were	  problematic	  as	  most	  shoots	  did	  not	  survive	  due	  to	  browning	  and	  none	  of	  those	  that	  did	  produced	  roots.	  	  After	  shoot	  initiation	  and	  elongation,	  maturation	  must	  occur	  before	  shoots	  are	  able	  to	  produce	  viable	  roots.	  A	  major	  obstacle	  in	  this	  process,	  browning,	  can	  occur	  while	  shoots	  are	  still	  in	  an	  immature	  state.	  Though	  in	  nature	  phenolic	  compounds	  such	  as	  trans-­‐cinnamic	  acid	  act	  as	  allelochemicals	  improving	  plant	  survival	  by	  reducing	  competition,	  in	  culture	  the	  build	  up	  of	  phenolic	  compounds	  in	  media	  during	  the	  regeneration	  process	  	  may	  lead	  to	  tissue	  browning,	  which	  in	  many	  cases	  is	  lethal	  to	  the	  explant	  (Laukkanen	  et	  al.	  1999;	  Tang	  and	  Newton	  2004;	  Jones	  and	  Saxena	  2013).	  Several	  classes	  of	  additives	  were	  used	  in	  this	  study	  to	  reduce	  browning	  and	  improve	  regeneration	  efficiency	  of	  Grosso	  plants.	  Polyvinylpyyrolidone	  and	  AC	  adsorb	  free	  phenolics	  in	  culture	  medium	  to	  decrease	  the	  phenolic	  compounds	  that	  are	  in	  contact	  with	  the	  explant	  (Weatherhead	  et	  al.	  1978;	  Weatherhead	  et	  al.	  1979;	  Pan	  and	  Staden	  1998).	  Ascorbic	  acid	  accomplishes	  the	  same	  by	  acting	  as	  a	  reducing	  agent	  and	  has	  previously	  been	  reported	  to	  have	  been	  used	  in	  the	  culture	  of	  Lavandula	  pedunculata	  (Zuzarte	  et	  al.	  2010).	  2-­‐Aminoindane-­‐2-­‐phosphonic	  acid	  (AIP)	  is	  a	  relatively	  novel	  reversible	  competitive	  inhibitor	  of	  the	  first	  regulatory	  step	  in	  the	  phenylpropanoid	  pathway,	  PAL.	  By	  inhibiting	  this	  step	  the	  overall	  carbon	  flow	  into	  the	  pathway	  is	  reduced	  and	  the	  quantity	  of	  phenolics	  produced	  is	  limited.	  Though	  this	  reduces	  the	  risk	  of	  browning	  due	  to	  phenolic	  build-­‐up	  in	  species	  which	  require	  phenylpropanoids	  for	  structural	  components	  such	  as	  the	  ferulic	  acid	  in	  the	  cell	  wall	  of	  Zea	  mays	  (L.)	  it	  can	  have	  a	  negative	  effect	  on	  growth	  (Jones	  et	  al.).	  To	  date	  the	  use	  of	  AIP	  	   37	  in	  culture	  has	  had	  varying	  effebeen	  reported	  only	  in	  limited	  species	  which	  include:	  St.	  John’s	  wort,	  duckweed,	  bay	  willow,	  wormwood,	  sugar	  maple	  and	  elm(Weatherhead	  et	  al.	  1978;	  Weatherhead	  et	  al.	  1979;	  Ruuhola	  and	  Julkunen-­‐Titto	  2003;	  Gitz	  et	  al.	  2004;	  Hu	  et	  al.	  2011;	  Jones	  et	  al.	  2012;	  Jones	  et	  al.	  2013;	  Jones	  and	  Saxena	  2013;	  Klejdus	  et	  al.	  2013).	  In	  Grosso	  lavender,	  which	  shows	  poor	  growth	  with	  no	  additivies,	  addition	  of	  the	  adsorbant	  AC	  at	  both	  concentrations	  variably	  reduced	  browning,	  however	  the	  addition	  of	  PVP,	  the	  second	  adsorbing	  agent	  had	  no	  effect.	  This	  could	  be	  due	  to	  efficacy	  of	  these	  compounds	  as	  adsorbants	  with	  either	  insufficient	  adsorption	  of	  phenolics	  or	  excessive	  adsorbtion	  of	  growth	  regulators,	  minerals	  or	  other	  compounds	  vital	  to	  plant	  growth	  that	  are	  present	  in	  media	  (Toth	  et	  al.	  1994;	  Pan	  and	  Staden	  1998).	  Treatment	  with	  AIP	  showed	  a	  strong	  improvement	  in	  shoot	  quality	  and	  survival,	  however,	  the	  effect	  seen	  from	  AIP	  was	  highly	  variable.	  Although	  AIP	  inhibits	  production	  of	  phenolics,	  some	  of	  these	  products	  of	  the	  phenylpropanoid	  pathway	  may	  be	  required	  in	  higher	  amounts	  than	  are	  able	  to	  be	  produced	  in	  the	  presence	  of	  AIP	  and	  therefore	  lead	  to	  plant	  death	  (Klejdus	  et	  al.	  2013).	  Additionally	  flavonoids,	  though	  not	  considered	  to	  be	  a	  main	  player	  in	  the	  regulation	  of	  plant	  growth	  and	  development	  have	  been	  found	  to	  be	  involved	  in	  finer	  regulation	  of	  the	  auxin,	  cytokinin	  system	  in	  plants	  and	  modification	  of	  downstream	  compounds	  via	  the	  main	  entry	  point	  at	  PAL,	  may	  have	  inadvertently	  had	  effects	  on	  the	  growth	  hormone	  balance	  in	  the	  plant	  and	  addition	  of	  AIP	  in	  downstream	  regeneration	  may	  have	  a	  significant	  effect	  on	  rooting	  capacity	  of	  the	  plant	  (Peer	  and	  Murphy	  2007).	  Ascorbic	  acid	  which	  is	  a	  reducing	  agent	  which	  prevents	  and	  reverse	  oxidation	  of	  phenolics	  in	  media	  had	  the	  highest	  efficacy	  in	  preventing	  browning	  and	  promoting	  maturation	  in	  Grosso.	  Though	  this	  effect	  is	  likely	  only	  due	  to	  the	  direct	  effects	  on	  phenolics	  in	  media,	  its	  reducing	  effect	  on	  reactive	  oxygen	  species,	  which	  have	  been	  found	  to	  interact	  extensively	  with	  plant	  signaling	  cascades,	  has	  	   38	  been	  reported	  to	  also	  have	  plant	  growth	  regulatory	  effects,	  thus	  the	  effect	  seen	  may	  be	  due	  to	  either	  or	  both	  of	  these	  mechanisms	  (Mittler	  et	  al.	  2011;	  Suzuki	  and	  Mittler	  2012;	  Gallie	  2013).	  	  These	  results	  suggest	  regeneration	  efficiency	  of	  Grosso	  can	  be	  improved	  by	  addition	  of	  any	  of	  the	  additives	  with	  the	  exception	  of	  PVP	  which	  had	  no	  effect,	  however	  the	  low	  variability	  and	  high	  response	  obtained	  from	  ascorbic	  acid	  makes	  it	  the	  most	  reproducible	  additive.	  The	  positive	  effect	  of	  the	  polyamines	  Spd,	  Spm	  and	  Put	  have	  been	  previously	  reported	  to	  have	  a	  positive	  effect	  on	  plant	  rooting,	  however,	  in	  Grosso	  lavender	  they	  were	  found	  to	  inhibit	  rooting.	  Though	  the	  mechanism	  for	  this	  inhibition	  was	  not	  investigated	  all	  three	  polyamines	  Spm,	  Spd	  and	  Put	  have	  been	  reported	  to	  have	  similar	  browning	  effects	  in	  cultures	  as	  has	  been	  reported	  for	  phenolic	  compounds	  (Tang	  and	  Newton	  2004).	  In	  particular	  it	  appears	  that	  in	  lavender	  addition	  of	  Spd	  and	  Spm	  in	  particular	  and	  to	  a	  lesser	  extent	  Put	  lead	  to	  tissue	  browning,	  necrosis	  and	  growth	  inhibition.	  Interestingly,	  although	  there	  was	  no	  significant	  interaction	  between	  polyamine	  treatment	  and	  media	  type	  in	  terms	  of	  rooting	  efficiency,	  there	  does	  seem	  to	  be	  a	  difference	  in	  overall	  shoot	  health	  and	  callus	  production	  between	  media	  types	  as	  shoots	  treated	  with	  polyamines	  on	  MS	  media	  were	  generally	  healthier	  in	  appearance	  than	  those	  grown	  on	  WPM	  media.	  Further	  studies	  are	  required	  to	  determine	  the	  mechanism	  of	  this	  interaction.	  	  In	  summary	  we	  have	  developed	  an	  efficient	  method	  for	  the	  regeneration	  of	  L.	  x	  intermedia	  cv	  Grosso	  from	  leaf	  tissue.	  The	  plant	  growth	  regulator	  TDZ	  efficiently	  induces	  callus	  formation	  and	  shoot	  initiation.	  Although	  rooting,	  induced	  by	  IAA,	  has	  highest	  efficiency	  under	  red	  light	  when	  full-­‐strength	  media	  is	  used,	  shoots	  grown	  on	  half	  strength	  MS	  and	  WPM	  media	  efficiently	  produce	  roots.	  Further,	  white	  light	  promotes	  healthier	  (non-­‐etiolated,	  more	  robust)	  shoots	  with	  less	  callus	  production,	  and	  is	  thus	  preferred.	  The	  	   39	  inclusion	  of	  AA	  minimizes	  browning	  through	  the	  culture	  process,	  leading	  to	  improved	  shoot	  quality	  and	  survival.	  In	  contrast,	  application	  of	  the	  polyamines	  Spd	  and	  Spm	  promotes	  browning	  and	  inhibits	  root	  formation	  in	  Grosso	  cultures	  and	  as	  the	  mechanism	  of	  this	  response	  are	  unknown	  further	  studies	  are	  required	  to	  investigate	  this	  inhibition.	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	   40	  Chapter	  3.	  Modification	  of	  Essential	  Oil	  Composition	  in	  L.	  x	  intermedia	  cv	  Grosso	  	  	  3.1. 	  Abstract	  	  	  Once	  a	  regeneration	  protocol	  was	  established	  EMS,	  a	  powerful	  alkylating	  agent	  was	  used	  to	  induce	  point	  mutations	  and	  the	  protocol	  was	  used	  to	  regenerate	  viable	  mutants.	  EMS	  was	  used	  to	  make	  mutations	  in	  callus	  cells,	  which	  then	  have	  the	  potential	  to	  differentiate	  into	  full,	  mature	  plants.	  Using	  this	  method	  plant	  cells	  can	  be	  mutated	  at	  the	  single	  cell	  level	  and	  give	  rise	  to	  a	  plant	  within	  which	  every	  cell	  contains	  this	  mutation.	  Due	  to	  the	  non-­‐specificity	  of	  the	  mutations,	  and	  possibility	  of	  fatal	  mutations,	  large	  numbers	  of	  explants	  were	  regenerated	  to	  increase	  the	  odds	  of	  obtaining	  a	  plant	  with	  a	  desirable	  mutation,	  such	  as	  one	  affecting	  the	  essential	  oil	  phenotype.	  Although	  the	  leaf	  essential	  oil	  from	  lavender	  is	  not	  of	  significant	  medicinal	  or	  commercial	  value	  it	  was	  used	  as	  a	  pre-­‐screening	  method	  to	  identify	  plants	  that	  show	  potentially	  valuable	  mutations	  in	  regions	  of	  the	  genome	  influencing	  the	  essential	  oil	  composition.	  Once	  plants	  flowered,	  floral	  oil	  was	  also	  screened,	  with	  emphasis	  on	  those	  identified	  during	  pre-­‐screening.	  3.2. Methods	  3.2.1. Induction	  of	  point	  mutations	  in	  L.	  x	  intermedia	  cv	  Grosso	  	  Using	  the	  protocol	  for	  regeneration	  of	  L.	  x	  intermedia	  cv	  Grosso	  from	  leaf	  tissue	  described	  in	  Chapter	  2	  wild-­‐type	  Grosso	  cells	  were	  exposed	  to	  the	  chemical	  mutagen	  EMS	  with	  the	  intention	  of	  inducing	  point	  mutations	  which	  resulted	  in	  unique	  oil	  chemotypes.	  Briefly	  leaves	  were	  excised	  from	  mature	  wild-­‐type	  Grosso	  plants	  and	  sterilized	  for	  20	  minutes	  in	  20%	  bleach	  with	  0.1%	  Triton-­‐X	  and	  washed	  three	  times	  with	  sterile	  distilled	  water.	  Leaves	  were	  lacerated	  at	  the	  petiole,	  and	  along	  both	  edges	  and	  placed	  abaxial	  side	  down	  on	  MS	  	   41	  media	  with	  3%	  sucrose,	  2.35%	  gellan	  gum	  and	  9	   µM	  TDZ,	  cultures	  were	  incubated	  at	  25oC	  in	  the	  dark	  and	  moved	  to	  new	  media	  every	  two	  weeks.	  After	  first	  callus	  production	  (approximately	  three	  weeks)	  explants	  were	  removed	  from	  MS	  medium	  and	  incubated	  for	  60	  minutes	  in	  0.01M	  EMS	  in	  1%	  dimethyl	  sulfoxide	  for	  one	  hour	  with	  stirring.	  Explants	  were	  then	  rinsed	  three	  times,	  for	  five	  minutes	  each	  in	  liquid	  MS	  medium	  (as	  described	  above,	  less	  gellan	  gum),	  blotted	  dry	  and	  re-­‐plated	  on	  MS	  medium	  (as	  described)	  and	  incubated	  at	  25oC,	  in	  the	  dark	  until	  shoot	  formation	  was	  observed.	  Shoots	  were	  then	  excised	  and	  moved	  to	  MS	  medium	  with	  3%	  sucrose,	  2.35%	  gellan	  gum,	  2.9	  μMNAA	  and	  10	  mg/L	  AA.	  Shoots	  were	  incubated	  at	  25oC	  under	  a	  16-­‐hour	  photoperiod	  on	  this	  medium	  until	  mature	  morphology	  was	  observed,	  at	  which	  point	  they	  were	  moved	  to	  half	  strength	  WPM	  medium	  with	  2.9	  μM	  IAA,	  3%	  sucrose,	  2.5%	  gellan	  gum	  and	  10	  mg/L	  AA.	  Once	  shoots	  were	  rooted	  they	  were	  potted	  in	  pro-­‐mix	  hp	  potting	  soil	  and	  kept	  under	  a	  humidity	  cover	  under	  a	  16-­‐hour	  photoperiod	  for	  3	  days,	  the	  cover	  was	  then	  removed	  and	  plants	  were	  maintained	  in	  the	  greenhouse	  then	  the	  field	  until	  they	  reached	  maturity.	  	  3.2.2. Screening	  of	  essential	  oil	  for	  modified	  composition	  	  Leaf,	  bud	  and	  30%	  flower	  essential	  oil	  was	  extracted	  by	  either	  steam	  distillation,	  or	  	  sonication	  into	  5	  mL	  pentane	  (Figure	  3.1).	  The	  former	  was	  used	  first;	  however,	  because	  the	  procedure	  is	  time-­‐consuming	  and	  not	  suitable	  for	  large	  numbers	  of	  samples,	  sonication	  was	  used	  for	  the	  remaining	  samples.	  Oil	  composition	  from	  both	  extraction	  methods	  has	  been	  shown	  to	  be	  equivalent	  (Schaneberg	  and	  Khan	  2002).	  In	  both	  cases	  approximately	  0.4	  g	  of	  tissue	  of	  approximately	  evenly	  distributed	  age	  was	  weighed	  on	  an	  analytical	  balance	  and	  extracted	  into	  5	  mL	  pentane,	  with	  100	  µL	  20	  mg/mL	  menthol	  for	  leaf	  and	  bud	  samples	  and	  thymol	  for	  flower	  samples	  added	  as	  internal	  standard	  to	  allow	  for	  determination	  of	  yield.	  In	  the	  case	  of	  steam	  distillation	  samples	  were	  brought	  to	  a	  boil	  then	  distilled	  for	  45	  	   42	  minutes	  in	  a	  steam-­‐distillation/liquid-­‐liquid	  extraction	  set-­‐up,	  apparatus	  was	  then	  allowed	  to	  cool	  and	  pentane-­‐containing	  oil	  was	  collected.	  For	  sonication	  tissues	  were	  sonicated	  on	  ice	  for	  30	  minutes,	  pentane-­‐containing	  oil	  was	  then	  collected.	  Samples	  were	  diluted	  10	  times	  and	  run	  on	  a	  Varian	  CP	  3800	  GC	  coupled	  to	  a	  Varian	  Saturn	  2200	  MS/MS.	  Peak	  areas	  for	  major	  constituents	  and	  internal	  standard	  (menthol	  for	  leaves,	  and	  bud	  and	  thymol	  for	  30%	  flower)	  were	  used	  to	  calculate	  relative	  percent	  composition	  and	  yield	  using	  the	  below	  formulae	  (1	  &	  2).	  Leaf	  and	  bud	  samples	  were	  analyzed	  using	  the	  following	  GC	  method:	  Sample	  injection	  volume,	  1	  	  μL;	  column	  flow	  rate,	  1	  mL/min;	  injector	  temperature,	  40	  oC	  held	  for	  0.1	  min	  then	  increased	  to	  100	  oC	  at	  20	  oC/min	  and	  held	  16.5	  min;	  column	  oven	  temperature,	  40	  oC	  held	  for	  5	  min	  ramp	  to	  170	  oC	  at	  6	  oC/min	  and	  held	  for	  4	  min	  then	  ramp	  to	  230	  oC	  at	  30	  oC/min	  and	  held	  5	  min.	  Solvent	  delay	  for	  MS	  detection	  was	  3.0	  min	  and	  m/z	  values	  from	  39-­‐300	  were	  monitored.	  Flower	  samples	  were	  analyzed	  using	  the	  following	  GC	  method:	  1	  	  μL	  of	  sample	  injected	  on,	  column	  flow	  rate,	  1	  mL/min,	  injector	  temperature,	  	  40oC	  held	  for	  0.1	  min	  then	  increased	  to	  100oC	  at	  20oC/min	  and	  held	  16.5	  min;	  column	  oven	  temperature,	  40	  oC	  held	  for	  2	  min,	  ramp	  to	  100	  oC	  at	  20	  oC/min	  held	  for	  5	  min,	  ramp	  to	  220	  oC	  at	  10	  oC/min	  held	  for	  1	  min	  then	  ramp	  to	  300	  oC	  at	  40	  oC/min	  and	  held	  for	  0.75	  min.	  Solvent	  delay	  for	  MS	  detection	  3.6	  min	  and	  data	  collected	  from	  39	  –	  300	  m/z	  values.	  Quantification	  ions	  for	  terpene	  constituents	  included	  in	  analysis	  are	  given	  in	  Tables	  3.1	  and	  3.2.	  Constituents	  were	  identified	  by	  comparison	  of	  mass	  spectra	  to	  the	  NIST	  database	  and	  those	  of	  authentic	  standards.	  Sample	  chromatograms	  for	  leaf,	  bud	  and	  flower	  samples	  are	  given	  in	  Figure	  3.3.	  	  	  	  	  ! ^[!!!! ! ! z!NAP!! ! ! ! ! z!N?P!!!!!J/O&'(![4A4!51%O(:!;<!+%9()-('!<+;X('/)O!N%P!"&-7!N"P!%)1(12(:/:7!N6P!A@f!<+;X('!%)-!N-P![@f!<+;X('4!!!!!!!	   44	  Table	  3.1.	  Quantification	  ions	  for	  terpene	  constituents	  included	  in	  analysis	  of	  leaf	  and	  bud	  essential	  oils.	  Compound	   Quantification	  Ion	  (m/z)	  Terpinene	   93.0	  Camphene	   93.0	  Sabinene	   93.0	  Carene	   93.0	  Cineole	   93.0	  Camphor	   95.0	  Menthol	   81.0	  Borneol	   95.0	  Cadinene	   161.0	  Cadinol	   161.2	  Bisabolol	   119.0	  Caryophyllene	   91.0	  	  	  Table	  3.2.	  Quantification	  ions	  for	  terpene	  consituents	  included	  in	  analysis	  of	  floral	  essential	  oils.	  	  Compound	   Quantification	  ion	  (m/z)	  Bisabolol	   161.0	  Cadinol	   160.9	  Carene	   135.8	  Caryophyllene	   133.0	  Linalool	   92.8	  Linalyl	  acetate	   92.8	  Menthol	   81.0	  Sabinene	   120.8	  Terpinene	   90.9	  Borneol	   95.0	  Camphor	   95.0	  Phellandrene	   92.8	  Cineole	   43.0	  Lavandulyl	  acetate	   92.8	  	  	  	  	  	  	  	   45	  	  	  Figure	  3.2.	  Sample	  chromatograms	  with	  (top	  three	  panes)	  and	  without	  (bottom	  three	  panes)	  labels	  of	  leaf	  (top),	  bud	  (middle)	  and	  flower	  (bottom)	  chromatograms	  from	  wild-­‐type	  Grosso	  leaf	  samples	  extracted	  by	  sonication.	  	  	  To	  ensure	  variation	  in	  leaf	  oil	  phenotype	  was	  not	  due	  to	  age	  of	  tissue	  selected	  oil	  samples	  were	  then	  taken	  from	  young,	  medium	  and	  old	  leaf	  tissue	  from	  each	  suspected	  mutant	  (Figure	  3.3)	  .	  Young	  tissue	  was	  considered	  to	  be	  leaves	  found	  within	  4	  nodes	  of	  the	  apical	  ! ^`!>('/:1(>7!;+-!1/::&(!X%:!6;):/-('(-!1;!"(!+(%9(:!<';>!12(!";11;>!?!);-(:!<';>!12(!"%:(!;<!12(!:1(>7!%)-!>(-/&>!%O(!1/::&(!X%:!6;):/-('(-!1;!"(!12(!+(%9(:!/)!"(1X(()!12(:(!'(O/;):4!*++!:%>V+(:!X('(!(,1'%61(-!/)!-&V+/6%1(!"#!:;)/6%1/;)!%:!-(:6'/"(-!%";9(4!I(+%1/9(!V('6()1!6;>V;:/1/;)!%)-!#/(+-!X%:!12()!6%+6&+%1(-!<;'!-&V+/6%1(!(,1'%61/;):!&:/)O!<;'>&+%(!A!y!?4!!E(%):!%)-!:1%)-%'-!('';'!>%'O/):!X('(!6%+6&+%1(-!%)-!V+;11(-!/)!M'%V2H%-!H'/:>!Q`!NM'%V2H%-!H'/:>!D)647!?@A^P4!!J/O&'(![4[4!51%O(:!;<!+%9()-('!+(%9(:\!N%P!#;&)O7!N"P!>(-/&>!%)-!N6P!;+-!+(%<4!!!!STRTST -<EL?=DEF(EB(bc@?JDFEL((!.::()1/%+!;/+!<';>!`@!O!O';::;!+(%<!1/::&(!X%:!-/:1/++(-!/)1;!A@!>$!V()1%)(4!F/:1/++%1/;)!V';-&61!X%:!12()!+;%-(-!;)1;!A@!O!:/+/6%!/)!%!O+%::!<+%:2!62';>%1;O'%V2#!6;+&>)!%)-!12()!X%:2(-!X/12!(+(9()!6;):(6&1/9(!:;+9()1!'/):(:!NV()1%)(\62+;';<;'>P\!J'%61/;)!NJPA!]!A@@\@7!J?!Y!m@\A@7!J[!]!Z@\?@7!J^!]!e@\[@7!JT!]!`@\^@7!J`!]!T@\T@7!Je!]!^@\`@7!JZ!]![@\e@7!Jm!]!?@\Z@7!JA@!]!A@\m@7!JAA!]!@\A@@4!!J'%61/;):!X('(!12()!-'/(-!-;X)!%)-!"';&O21!&V!/)!A!>$!V()1%)(!12()!'&)!;)!%!Q%'/%)!5%1&')!M=YE5!%1!%!1()!1/>(:!-/+&1/;)!<;++;X/)O!12(!>(12;-!V'(9/;&:+#!-(:6'/"(-!<;'!+(%<!(::()1/%+!;/+!%)%+#:/:4!!	   47	  The	  purified	  unknown	  was	  then	  send	  to	  two	  independent	  facilities	  for	  structural	  determination	  by	  nuclear	  magnetic	  resonance	  spectroscopy	  (NMR)	  –	  Dr.	  Paul	  Shipley	  at	  the	  University	  of	  British	  Columbia,	  Okanagan	  and	  Dr.	  Andrew	  Lewis	  at	  A.R.	  Lewis	  and	  Associated,	  Simon	  Fraser	  University.	  Both	  analyses	  identified	  the	  compound	  as	  α-­‐cadinol	  .	  	  3.2.4. Confirmation	  of	  essential	  oil	  screening	  method	  To	  confirm	  the	  accuracy	  of	  the	  relative	  percent	  composition	  method	  for	  determining	  essential	  oil	  composition	  standard	  curves	  were	  created	  for	  the	  following	  mono-­‐	  and	  sesquiterpene	  standards:	  camphor,	  ∂-­‐carene,	  1,8-­‐cineole,	  borneol,	  β-­‐caryophyllene	  and	  a α-­‐bisabolol.	  As	  α-­‐cadinol	  standard	  is	  unavailable	  for	  purchase	  α-­‐cadinol	  	  was	  purified	  as	  described	  in	  section	  3.2.3.	  This	  was	  done	  by	  creating	  eight	  dilutions	  from	  0.5	  mg/mL	  to	  0.002	  mg/mL	  at	  increments	  of	  two	  times	  dilution.	  All	  dilutions	  were	  run	  in	  triplicate.	  Samples	  were	  then	  analyzed	  using	  a	  Varian	  Saturn	  GC-­‐MS	  following	  the	  method	  described	  for	  leaf	  essential	  oil	  analysis	  above.	  Peak	  in	  the	  extracted	  ion	  chromatograms	  were	  integrated,	  and	  selected	  characteristic	  ions	  used	  for	  quantification	  as	  given	  in	  Table	  3.1.	  Peak	  areas	  were	  then	  plotted	  against	  concentration	  in	  Microsoft	  Excel	  and	  a	  line	  of	  best	  fit	  was	  plotted	  through	  the	  linear	  range.	  Essential	  oil	  composition	  for	  wild-­‐type	  Grosso	  plant	  was	  then	  determined	  by	  both	  relative	  percent	  composition	  and	  using	  the	  standard	  curves.	  	  	  3.3. 	  Results	  3.3.1. 	  Production	  of	  lavender	  essential	  oil	  for	  essential	  oil	  mutants	  A	  total	  of	  313	  EMS-­‐treated	  explants	  produced	  1,	  591	  shoots	  of	  which	  259	  survived	  to	  be	  rooted.	  154	  plants	  were	  successfully	  rooted	  and	  of	  those	  117	  survived	  acclimatization	  in	  the	  greenhouse	  and	  were	  moved	  to	  the	  field	  (Table	  3.3),	  though	  not	  all	  regenerants	  were	  moved	  to	  the	  field	  in	  the	  same	  growing	  season.	  Approximately	  two	  thirds	  of	  all	  explants	  were	  moved	  to	  the	  field	  in	  the	  summer	  of	  2013,	  while	  the	  remaining	  plants	  were	  planted	  in	  	   48	  the	  field	  in	  the	  summer	  of	  2014.	  Only	  those	  transferred	  to	  the	  field	  in	  2013	  bloomed	  in	  the	  spring	  of	  2014.	  	  Table	  3.3.	  Summary	  of	  explants,	  shoots	  and	  mature	  plants	  surviving	  the	  culture	  process	  after	  treatment	  with	  EMS	  Total	  explants	  treated	  with	  EMS	   313	  Shoots	  regenerated	   1,591	  Plants	  moved	  to	  rooting	  medium	   259	  Plants	  successfully	  rooted	  and	  moved	  to	  soil	  154	  Plants	  surviving	  acclimatization	   117	  	  3.3.2. 	  Identified	  novel	  leaf	  EO	  mutants	  A	  screening	  of	  leaf,	  bud	  and	  flower	  essential	  oil	  revealed	  that	  eight	  plants	  produce	  novel	  essential	  oil	  composition,	  as	  compared	  with	  a	  wild-­‐type	  plant.	  Though	  there	  are	  eight	  mutants,	  they	  can	  be	  grouped	  into	  three	  general	  categories:	  mutants	  with	  modified	  camphor	  composition,	  mutants	  with	  modified	  cineole	  composition	  and	  mutants	  with	  modified	  linalool	  composition.	  Though	  leaves	  were	  readily	  available	  from	  all	  plants,	  only	  plants	  that	  were	  planted	  in	  the	  summer	  of	  2013	  bloomed.	  Mutants	  2-­‐6	  completed	  regeneration	  after	  this	  time	  period	  and	  were	  not	  able	  to	  overwinter	  (Tables	  3.4	  –	  3.6).	  As	  Grosso	  requires	  a	  dormancy	  period	  before	  flowering,	  flower	  and	  bud	  oil	  data	  was	  not	  collected	  for	  these	  mutants.	  	  An	  overview	  of	  classes	  of	  mutants	  is	  given	  in	  Figure	  3.4.	  	  	   49	  	  Figure	  3.4.	  Overview	  of	  identified	  mutants	  by	  phenotype.	  3.3.2.1. Mutants	  with	  modified	  camphor	  composition	  Mutants	  1,	  3-­‐6	  lack	  or	  have	  greatly	  reduced	  levels	  of	  the	  monoterpene	  camphor	  and	  significantly	  more	  borneol	  in	  leaves,	  flowers	  and	  bud,	  though	  the	  latter	  two	  stages	  were	  only	  available	  for	  mutant	  1.	  This	  mutant	  also	  has	  a	  decreased	  amount	  of	  the	  sesquiterpene	  α-­‐cadinol	  ,	  and	  has	  an	  additional	  sesquiterpene,	  alpha-­‐bisabolol	  present	  in	  the	  leaves.	  Both	  α-­‐cadinol	  	  and	  alpha-­‐bisabolol	  have	  demonstrated	  biological	  activity	  including	  anti-­‐inflammatory	  and	  anti-­‐fungal	  activity,	  additionally	  alpha-­‐bisabolol	  has	  been	  used	  in	  commercial	  applications	  making	  it	  a	  potentially	  valuable	  addition	  to	  the	  oil	  (Chang	  et	  al.	  2008;	  Kamatou	  and	  Viljoen	  2009).	  	  Leaves	  of	  mutants	  1,	  5	  and	  6	  also	  show	  significantly	  lower	  cineole	  content.	  Bud	  and	  30%	  flower	  oil	  are	  not	  significantly	  different	  from	  wild-­‐type	  except	  in	  their	  camphor	  and	  borneol	  compositions	  as	  stated	  above	  (Tables	  3.4	  –	  3.6).	  3.3.2.2. Mutants	  with	  modified	  cineole	  composition	  Mutants	  2	  and	  7	  show	  significantly	  lower	  concentrations	  or	  complete	  lack	  of	  cineole,	  however	  this	  expression	  varies	  with	  tissue	  in	  the	  case	  of	  mutant	  7.	  Unfortunately,	  as	  noted	  above	  mutant	  2	  did	  not	  overwinter	  in	  the	  field	  and	  as	  such	  did	  not	  produce	  flowers	  in	  the	  modified cineole contentmodified camphor contentmodified linalool contentmodified growth patternEG e28-8EG 417EG e47-3EG 123-3EG 123-1EG e47-5EG 28EG 254EG 108modified essential oil	   50	  Spring	  of	  2014.	  Mutant	  7,	  interestingly	  showed	  close	  to	  a	  complete	  lack	  of	  cineole	  in	  30%	  flower	  and	  bud,	  but	  cineole	  concentrations	  were	  the	  same	  as	  wild-­‐type	  in	  the	  leaves,	  while	  mutant	  2	  shows	  decreased	  cineole	  concentrations	  in	  the	  leaves.	  In	  both	  cases	  no	  other	  essential	  oil	  constituents	  were	  significantly	  affected	  (Tables	  3.4	  -­‐3.6)	  3.3.2.3. Mutants	  with	  modified	  linalool	  composition	  Only	  one	  mutant,	  mutant	  8,	  showed	  a	  change	  in	  linalool	  concentration.	  This	  plant	  had	  wild-­‐type	  leaf	  oil,	  however,	  bud	  and	  flower	  showed	  significant	  decreases	  in	  the	  linalool	  content	  without	  any	  effects	  on	  other	  essential	  oil	  constituents	  (Tables	  3.4	  –	  3.6)	  	  	  	  	  	   51	  	  Table	  3.4.	  Mutants	  identified	  by	  oil	  screening	  -­‐	  time	  for	  regeneration	  from	  initial	  explant	  to	  soil,	  proportions	  of	  major	  leaf	  oil	  constituents	  and	  oil	  yield,	  where	  yield	  is	  the	  averaged	  across	  all	  ages	  of	  leaf.	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  Relative	  percent	  composition	  of	  major	  oil	  constituents	  in	  leaf	  (standard	  deviation)	  ID	   Mutant	  #	   Time	  for	  full	  regeneration	  (days)	  1,8-­‐Cineole	   Camphor	   Borneol	   Cadinol	   Bisabolol	  EG	  28	   1	   154	   4.3	  (3.7)	   0.8	  (0.03)	   59.0	  (3.4)	   12.1	  (0.9)	   3.7	  (0.7)	  EG	  e28-­‐8	   2	   221	   1.5	  (0.5)	   40.6	  (1.7)	   29.7	  (2.5)	   22.4	  (2.1)	   nd	  EG	  e47-­‐3	   3	   251	   16.1	  (2.5)	   1.2	  (0.5)	   53.0	  (4.9)	   15.7	  (0.6)	   9.2	  (0.3)	  EG	  e47-­‐5	   4	   235	   12.6	  (1.2)	   0.28	  (0.4)	   52.5	  (4.0)	   16.3	  (2.1)	   10.1	  (1.2)	  EG	  e123-­‐3	   5	   224	   2.4	  (0.3)	   nd	   89.7	  (0.4)	   2.3	  (0.4)	   3.8	  (0.4)	  EG	  e123-­‐1	   6	   224	   1.3	  (0.2)	   1.2	  (1.0)	   89.2	  (0.6)	   1.2	  (0.2)	   2.8	  (0.7)	  EG	  417	   7	   169	   4.29	   10.68	   23.71	   26.19	   nd	  EG	  254	   8	   141	   9.16	  (4.26)	   17.93	  (1.72)	   31.49	  (6.85)	   26.14	  (5.24)	   nd	  Wild-­‐type	  Grosso	  n/a	   119	   12.7	  (0.5)	   21.9	  (0.1)	   18.1	  (0.7)	   28.9	  (0.1)	   nd	  	  	   52	  Table	  3.5.	  Mutants	  flowering	  in	  spring	  2014	  identified	  by	  oil	  screening	  -­‐	  time	  for	  regeneration	  from	  initial	  explant	  to	  soil	  and	  proportions	  of	  major	  bud	  oil	  constituents.	  	  	  	  	  	  	  	  	  	  	  	  Relative	  percent	  composition	  of	  major	  oil	  constituents	  in	  bud	  (standard	  deviation)	  ID	   Mutant	  #	  Time	  for	  full	  regeneration	  (days)	   1,8-­‐Cineole	   Camphor	   Borneol	   Cadinol	   Linalool	   Linalyl	  acetate	  Phellandrene	   Lavandulyl	  acetate	  Terpineol	  EG	  28	   1	   154	   14.6	  (0.4)	   1.0	  (0.1)	   57.3	  (1.6)	   5.8	  	  (0.2)	   8.3	  (0.9)	   8.1	  (0.5)	   3.7	  (0.8)	   -­‐	   -­‐	  EG	  417	   7	   169	   2.0	  (1.2)	   30.1	  (0.7)	   14.0	  (0.3)	   13.0	  (1.2)	   25.1	  (3.2)	   11.4	  (1.9)	   1.9	  (0.2)	   1.6	  (0.2)	   -­‐	  EG	  254	   8	   141	   29.6	   32.7	   11.3	   8.4	   5.3	   4.5	   3.7	   1.2	   2.1	  Wild-­‐type	  Grosso	  n/a	   119	  23.0	  (0.1)	   29.7	  (0.1)	   10.1	  (0.3)	   8.4	  (0.2)	   15.5	  (0.2)	   9.4	  (0.1)	   2.7	  	  (0.04)	   -­‐	   -­‐	  	  	   53	  	  Table	  3.6.	  Mutants	  flowering	  in	  Spring	  2014	  identified	  by	  oil	  screening	  -­‐	  time	  for	  regeneration	  from	  initial	  explant	  to	  soil,	  proportions	  of	  major	  30%	  flower	  oil	  constituents	  and	  oil	  yield.	  	  	  	  Relative percent composition of major oil constituents in 30% flower (standard deviation) ID Mutant # Time for full regeneration (days) 1,8-Cineole Camphor Borneol Cadinol Linalool Linalyl acetate Phellandrene Lavandulyl acetate Terpineol Oil Yield (mg oil/g bud) EG 28 1 154 8.4 (1.0) 1.1 (0.1) 51.2 (5.4) 3.3 (0.4) 11.3 (1.1) 16.5 (2.7) 3.7 (0.7) 4.0 (0.3) 1.8 (0.2) 6.1 (3.5) EG 417 7 169 0.92 (0.5) 4.4 (0.3) 16.7 (1.2) 7.6 (2.0) 13.5 (2.8) 32.7 (2.3) 2.4 (1.8) 5.9 (0.9) 2.2 (0.7) 9.4  (1.2) EG 254 8 141 11.3 (3.0) 24.43(6.2) 17.9 (5.3) 2.9 (0.7) 11.3 (5.0) 18.3 (6.3) 3.8 (0.4) 4.7 (0.6) 2.7 (0.5) 10.4 (1.8) Wild-type Grosso n/a 119 8.1 (1.6) 18.0 (5.8) 15.5 (6.7) 1.9 (1.3) 22.7 (7.9) 22.9 (11.8) 3.1 (2.3) 3.9 (2.3) 2.5 (0.7) 11.1 (4.1) !! "#!!"!"!" #$%&'%()*+%,)'-./0)12-*%,)3&%%/2'()!#$ %&'!()*&+,!-.!/01!234567'!8$"9!:*;!4<'&+4=4'<!*;!>*?4&5!*!6&4@6'!=)A7*)!57A:+>!(*++'7&$!B>4;!()*&+!;>A:;!*!C7''(4&5!(*++'7&!=A7!+>'!=)A:'7;!*;!A((A;'<!+A!+>'!+D(4C*)!6(745>+!A74'&+*+4A&!A=!=)A:'7;$!B>4;!()*&+!*);A!>*;!)45>+'7!CA)A67'<!=)A:'7;!*;!CAE(*7'<!+A!:4)<F+D('!()*&+;$!!))34567'!8$"$!-.!/01!2*9!;>A:4&5!)45>+!CA)A67'<!=)A:'7!*&<!+7*4)4&5!=)A:'7!EA7(>A)A5D!*&<!:4)<F+D('!2G9!;>A:4&5!+D(4C*)!6(745>+!=)A:'7!CA)A67!*&<!EA7(>A)A5D$!!!"!"4" 5&./'6/2)0/&7)/((/'%+&0)-+0)8-93-(+%+-')&%)6+77/2/'%)0/&7)&1/()H'*=!A4)!CAE(A;4+4A&!=7AE!*))!E6+*&+;!:*;!=A6&<!+A!G'!CA&;4;+'&+!*C7A;;!*))!*5';,!CA&=47E4&5!+>*+!*))!4<'&+4=4'<!E6+*&+;!:'7'!<6'!+A!EA<4=4'<!C>'EA+D('!*&<!&A+!I6;+!*!7';6)+!A=!<'?')A(E'&+*)!;+*5'!A=!+>'!)'*?';!234567'!8$J9$!K4')<!:*;!*);A!<'+'7E4&'<!=A7!+>';'!()*&+;!*&<!4+!:*;!=A6&<!*;!'L('C+'<!+>*+!DA6&5!)'*?';!>*<!+>'!>45>';+!';;'&+4*)!A4)!D4')<,!:>4)'!A)<!)'*?';!>*<!+>'!)A:';+$!-.!M1!*&<!-.!'#NF8!:'7'!=A6&<!+A!>*?'!;45&4=4C*&+)D!>45>'7!A4)!D4')<;!*;!CAE(*7'<!+A!:4)<F+D('!*&<!*))!A+>'7!E6+*&+;!234567'!8$N9$!!	  	   55	  	  Figure	  3.6.	  Average	  percent	  composition	  of	  major	  essential	  oil	  constituents	  across	  young,	  medium	  and	  old	  leaves	  from	  wild-­‐type	  and	  mutant	  Grosso	  plants,	  as	  calculated	  by	  equation	  1,	  error	  bars	  represent	  standard	  error.	  	  	   56	  	  Figure	  3.7.	  Average	  total	  essential	  oil	  yield	  from	  young,	  medium	  and	  old	  leaves	  from	  mutant	  and	  wild-­‐type	  Grosso	  plants	  as	  calculated	  using	  equation	  2,	  error	  bars	  represent	  standard	  error.	  	  3.3.5. Purification	  of	  unknown	  from	  wild-­type	  leaf	  essential	  oil	  	  	  The	  unknown	  was	  not	  found	  in	  any	  of	  fractions	  1-­‐8	  resulting	  from	  subsequent	  elutions	  with	  0	  –	  70%	  pentane,	  with	  different	  combinations	  of	  other	  mono-­‐	  and	  sesquiterpenes	  that	  are	  normally	  found	  in	  the	  oil	  being	  present	  in	  these	  fractions.	  Although	  the	  unknown	  was	  found	  to	  be	  present	  in	  fractions	  9-­‐11,	  only	  fraction	  10	  showed	  high	  purity,	  while	  Fractions	  9	  and	  11	  had	  high	  levels	  of	  other	  mono-­‐	  and	  sesquiterpenes	  present.	  Fraction	  10	  yielded	  21	  mg	  of	  unknown	  with	  ≥	  90%	  purity	  (Figure	  3.8).	  	  	  	  	   57	  	  Figure	  3.8.	  Fraction	  10	  (10:90	  pentane:chloroform)	  containing	  primarily	  α-­‐cadinol.	  	  3.3.6. Confirmation	  of	  accuracy	  of	  relative	  percent	  composition	  calculations	  	  Calculation	  of	  absolute	  percent	  composition	  from	  standard	  curves	  (Appendix	  III)	  was	  found	  to	  yield	  a	  percent	  composition	  that	  was	  close	  to	  or	  within	  the	  range	  of	  standard	  error	  for	  all	  essential	  oil	  constituents	  with	  none	  differening	  by	  more	  than	  3%	  (Table	  3.7).	  	  	  Table	  3.7.	  Comparison	  of	  composition	  as	  determined	  by	  relative	  percent	  composition	  and	  absolute	  quantification	  from	  standard	  curves	  	   Relative	  percent	  composition	   Absolute	  percent	  composition	  Constituent	   Average	   Standard	  Error	   Average	   Standard	  Error	  ∂-­‐carene	   3.91	   0.39	   6.66	   0.04	  1,8-­‐Cineole	   14.75	   0.37	   16.36	   0.11	  Camphor	   25.52	   0.02	   26.06	   0.79	  Borneol	   21.07	   0.52	   22.03	   0.08	  α-­‐cadinol	  	   33.69	   0.23	   33.41	   1.39	  β-­‐caryophyllene	  	   1.05	   0.25	   4.09	   0.23	  	  	   58	  3.4. 	  Discussion	  Regeneration	  efficiency	  for	  EMS-­‐treated	  plants	  was	  poorer	  than	  is	  seen	  in	  wild-­‐type	  grosso	  cultures.	  This	  could	  be	  a	  result	  of	  lethal	  mutations	  induced	  by	  EMS	  treatment	  (Erland	  and	  Mahmoud	  2014).	  Lavandula	  floral	  oils	  are	  commercially	  harvested	  and	  used	  in	  all	  applications,	  while	  leaf	  oil	  has	  yet	  to	  see	  a	  demand.	  Screening	  of	  mutants	  was	  limited,	  however,	  due	  to	  Grosso’s	  requirement	  of	  vernalization	  for	  flowering	  and	  only	  plants	  which	  were	  planted	  in	  the	  spring	  of	  2013	  flowered	  the	  following	  summer	  limiting	  the	  number	  of	  plants	  that	  could	  be	  screened	  for	  floral	  oil	  composition.	  To	  allow	  for	  screening	  of	  plants	  at	  an	  earlier	  stage	  leaf	  essential	  oil	  pre-­‐screening	  was	  performed.	  Although	  EO	  composition	  is	  different	  in	  leaves	  and	  flowers	  -­‐	  as	  mechanisms	  regulating	  production	  of	  essential	  oil	  constituents	  in	  various	  plant	  tissues	  may	  differ	  along	  with	  oil	  composition	  itself	  -­‐	  some	  of	  the	  main	  constituents	  are	  shared	  between	  leaves	  and	  flowers,	  including	  camphor,	  cineole	  and	  borneol.	  This	  screening,	  therefore,	  provided	  an	  indication	  of	  potential	  changes	  in	  EO	  composition,	  and	  allowed	  for	  investigation	  of	  these	  plants	  by	  molecular	  techniques	  and	  minimized	  loss	  of	  time	  while	  waiting	  for	  the	  vernalization	  period.	  	  	  Several	  mutants	  were	  identified	  by	  leaf	  essential	  oil	  screening	  and	  a	  further	  two	  were	  identified	  by	  floral	  essential	  oil	  screening	  from	  the	  first	  group	  of	  plants	  to	  flower.	  These	  mutants	  were	  then	  grouped	  into	  four	  categories:	  those	  with	  modified	  camphor	  composition,	  those	  with	  modified	  cineole	  composition,	  those	  with	  modified	  linalool	  composition	  and	  those	  with	  modified	  growth	  patterns.	  	  	  Five	  mutants	  were	  found	  to	  have	  modified	  camphor	  composition,	  these	  five	  plants	  showed	  roughly	  the	  same	  chemotype	  in	  the	  leaves	  with	  all	  having	  little	  to	  no	  camphor,	  greatly	  	  	   59	  increased	  borneol,	  slightly	  decreased	  cineole,	  decreased	  α-­‐cadinol	  and	  increased	  alpha-­‐bisabolol	  though	  exact	  composition	  varied	  slightly	  in	  each	  mutant.	  Only	  one	  of	  these	  mutants	  was	  in	  the	  first	  group	  of	  plants	  that	  was	  planted	  and	  flowered	  in	  the	  summer	  of	  2014.	  This	  mutant	  (EG	  28),	  also	  showed	  decreased	  camphor	  and	  increased	  borneol	  in	  the	  bud	  and	  flower	  oil	  as	  well	  as	  increased.	  It	  is	  of	  interest	  that	  such	  a	  high	  proportion	  of	  the	  mutants	  identified	  were	  found	  to	  have	  a	  similar	  chemotype	  with	  decreased	  camphor	  production.	  The	  mechanisms	  behind	  this	  are	  yet	  unknown,	  and	  they	  merit	  further	  investigation.	  The	  increase	  in	  borneol	  in	  conjunction	  with	  decreased	  camphor	  production	  supports	  the	  postulate	  that	  camphor	  is	  produced	  in	  lavender	  from	  the	  dehydrogenation	  of	  borneol	  and	  indicates	  that	  the	  the	  expression	  or	  activity	  of	  the	  gene	  responsible	  for	  this	  step	  (borneol	  dehydrogenase)	  has	  been	  affected	  in	  this	  plant.	  To	  date	  a	  borneol	  dehydrogenase	  gene	  has	  been	  cloned	  and	  characterized,	  however,	  this	  enzyme	  had	  very	  slow	  reaction	  rates,	  suggesting	  that	  this	  may	  not	  be	  the	  primary	  enzyme	  responsible	  for	  this	  conversion	  (Sarker	  et	  al.	  2012).	  These	  mutants	  represent	  a	  resource	  for	  identifying	  the	  gene	  and	  enzyme	  that	  is	  primarily	  responsible	  for	  this	  conversion.	  Further	  investigation	  of	  these	  mutants	  using	  RNA-­‐seq,	  differential	  expression	  analyis,	  single	  nucleotide	  variant	  (SNV)	  identification	  and	  knock-­‐out	  or	  recovery	  experiments	  could	  confirm	  the	  identity	  of	  this	  enzyme.	  	  	  These	  plants	  are	  also	  potentially	  of	  significant	  economic	  value	  as	  new	  commercial	  lavender	  cultivars.	  The	  presence	  of	  camphor	  in	  lavender	  and	  lavandin	  oils	  is	  generally	  considered	  to	  decrease	  the	  value	  of	  the	  oil	  for	  aromatherapy,	  cosmetic	  and	  fragrance	  applications.	  A	  result	  English	  lavender	  oil,	  which	  contains	  the	  lowest	  levels	  of	  camphor	  of	  the	  commercially	  grown	  species	  is	  of	  highest	  value.	  English	  lavender,	  however,	  is	  a	  relatively	  	  	   60	  low	  yielding	  species	  as	  compared	  to	  hybrid	  cultivars,	  in	  particular	  Grosso,	  which	  yields	  up	  to	  ten	  times	  more	  oil	  than	  English	  lavender.	  	  A	  Grosso	  plant,	  with	  reduced	  camphor	  content	  has	  the	  potential	  to	  be	  commercially	  valuable,	  yielding	  large	  amounts	  of	  fine	  quality	  oil	  for	  growers.	  	  	  Two	  mutants	  were	  found	  to	  have	  modified	  cineole	  production;	  one	  with	  decreased	  cineole	  production	  in	  the	  leaves	  and	  the	  other	  with	  decreased	  cineole	  production	  in	  the	  flowers.	  This	  is	  of	  interest	  from	  a	  scientific	  point	  of	  view	  as	  cineole	  is	  found	  in	  both	  leaves	  and	  flowers	  of	  the	  wild-­‐type	  plant	  and	  the	  enzyme	  which	  produces	  this	  monoterpene	  is	  well	  characterized	  (Demissie	  et	  al.	  2012).	  As	  the	  most	  likely	  reason	  for	  this	  modification	  would	  be	  a	  mutation	  effecting	  the	  cineole	  synthase	  gene	  there	  are	  several	  ways	  in	  which	  this	  may	  be	  possible.	  The	  first	  would	  be	  through	  a	  mutation	  in	  the	  enzyme	  itself,	  which	  would	  effect	  all	  copies	  of	  this	  gene	  in	  the	  plant.	  If	  this	  was	  the	  case,	  Grosso	  would	  need	  to	  have	  at	  least	  two	  variants	  of	  this	  enzyme,	  one	  highly	  expressed	  in	  the	  leaves,	  and	  the	  other	  that	  is	  highly	  expressed	  in	  the	  flowers.	  The	  more	  likely	  situation	  is	  that	  the	  mutation	  is	  in	  a	  regulatory	  region,	  which	  differs	  between	  tissue	  types	  and	  not	  the	  enzyme	  itself.	  	  	  Linalool	  is	  a	  highly	  desired	  monoterpene,	  with	  powerful	  medicinal	  properties	  as	  well	  as	  high	  economic	  value,	  due	  to	  its	  frequent	  use	  in	  the	  fragrance	  and	  cosmetics	  industries.	  One	  mutant	  showed	  increased	  levels	  of	  linalool	  in	  both	  bud	  and	  flowers.	  As	  linalool	  is	  considered	  to	  improve	  the	  quality	  of	  oil	  due	  to	  its	  pleasant	  scent	  this	  plant	  may	  also	  be	  of	  potential	  commercial	  value	  as	  a	  new	  cultivar.	  Very	  little	  work	  has	  been	  done	  with	  this	  mutant	  to	  date,	  however,	  and	  before	  it	  could	  be	  considered	  as	  such,	  additional	  screening	  and	  sampling	  would	  need	  to	  occur.	  	  	  	   61	  	  Only	  one	  mutant	  showed	  a	  modified	  floral	  growth	  pattern,	  though	  the	  essential	  oil	  of	  this	  mutant	  showed	  no	  difference	  from	  wild-­‐type	  oil.	  	  This	  creeping	  morphology	  is	  unique	  among	  lavenders	  and	  may	  represent	  commercial	  potential	  as	  a	  new	  ornamental.	  New	  and	  desirable	  growth	  patterns	  are	  valued	  by	  the	  ornamental	  industries	  and	  the	  production	  of	  this	  trailing	  lavender	  has	  already	  invited	  interest	  from	  lavender	  breeders	  for	  its	  use	  in	  hanging	  baskets	  and	  other	  floral	  displays	  (personal	  communication).	  	  	  Lavender	  essential	  oil	  composition	  varies	  significantly	  with	  both	  age	  and	  tissue,	  and	  as	  leaf	  essential	  oil	  was	  distilled	  from	  all	  ages	  of	  leaves	  it	  was	  desirable	  to	  confirm	  these	  unique	  chemotypes	  were	  not	  merely	  the	  result	  of	  developmental	  stage.	  This	  was	  done	  by	  screening	  the	  oil	  of	  all	  mutants	  at	  young,	  medium	  and	  old	  leaf	  ages	  and	  in	  all	  cases	  the	  mutant	  oil	  composition	  was	  found	  to	  be	  consistent	  across	  all	  samples	  (Figure	  3.6).	  	  	  Yield	  is	  another	  important	  characteristic	  in	  determining	  the	  value	  of	  new	  cultivars,	  increased	  yield	  is	  equal	  to	  increased	  profit	  for	  the	  lavender	  grower.	  Although	  yield	  of	  the	  commercially	  used	  floral	  oil	  is	  of	  greatest	  interest,	  yield	  was	  also	  determined	  for	  leaves	  as	  this	  is	  a	  poorly	  documented	  oil	  source.	  Leaf	  oil	  was	  found,	  as	  is	  the	  case	  in	  flowers,	  to	  vary	  with	  age,	  however,	  while	  oil	  yield	  is	  highest	  in	  flower	  at	  antethesis	  to	  30%	  flower,	  oil	  yield	  in	  leaves	  was	  found	  to	  be	  highest	  in	  young	  leaves.	  Four	  mutants	  were	  found	  to	  have	  increased	  oil	  yield	  in	  leaves	  (e47-­‐3,	  e123-­‐1,	  417	  and	  254),	  however,	  of	  the	  two	  of	  these	  mutants	  from	  which	  flowers	  were	  able	  to	  be	  harvested	  neither	  showed	  increased	  oil	  yield.	  No	  mutants	  have	  been	  identified	  as	  high	  yielding	  individuals	  to	  date,	  though	  screening	  of	  mutants	  that	  have	  yet	  to	  flower	  is	  still	  required.	  	  	  	   62	  The	  accuracy	  of	  relative	  percent	  composition	  calculations	  is	  	  dependent	  on	  similar	  fragmentation	  of	  all	  constituents	  in	  the	  mixture	  during	  ionization	  in	  the	  MS.	  To	  confirm	  that	  the	  relative	  percent	  compositions	  calculated	  in	  this	  thesis	  were	  accuracte,	  and	  not	  the	  result	  of	  differential	  fragmentation	  of	  particular	  constituents	  standard	  curves	  were	  constructed	  for	  all	  major	  leaf	  essential	  oil	  constituents.	  This	  allowed	  for	  the	  determination	  of	  the	  absolute	  percent	  composition	  of	  these	  oil	  samples.	  It	  was	  found	  that	  both	  calculations	  produced	  percent	  oil	  compositions	  that	  were	  not	  significantly	  different	  from	  each	  other	  and	  confirmed	  that	  relative	  percent	  composition	  is	  a	  valid	  method	  for	  determining	  lavender	  essential	  oil	  composition.	  	  	  One	  of	  the	  sesquiterpene	  constituents	  found	  in	  both	  leaf	  and	  floral	  oil	  of	  Grosso	  could	  not	  be	  identified	  due	  to	  poor	  matching	  to	  the	  NIST	  database	  and	  lack	  of	  an	  authentic	  standard	  for	  purchase.	  This	  constituent	  could,	  however,	  be	  purified	  with	  relative	  ease	  and	  was	  therefore	  sent	  for	  identification	  by	  NMR	  by	  two	  independent	  sources	  which	  both	  confirmed	  this	  constituent	  to	  be	  the	  sesquiterpene	  α-­‐cadinol	  .	  This	  purified	  sample	  was	  then	  used	  as	  a	  standard	  for	  future	  analysis.	  	  	  	  	  	  	  	  	  	   63	  Chapter	  4.	  Identification	  of	  mutation	  targets	  in	  novel	  essential	  oil	  mutants	  4.1. 	  Abstract	  	  A	  draft	  transcriptome	  for	  lavender	  was	  assembled	  from	  wild-­‐type	  Grosso	  and	  Lady	  leaves	  and	  flowers,	  mutant	  Grosso	  and	  ESTs	  from	  L.	  angustifolia	  and	  L.	  x	  intermedia	  cDNA	  libraries	  to	  yield	  with	  17,003	  contigs	  with	  an	  average	  length	  of	  804	  bp.	  As	  a	  parallel	  sequencing	  strategy	  Illumina	  reads	  for	  each	  individual	  sample	  were	  separately	  aligned	  to	  the	  pre-­‐existing	  cDNA	  library.	  Mutant	  and	  wild-­‐type	  samples	  were	  then	  mapped	  back	  to	  this	  transcriptome	  and	  these	  individual	  transcriptomes	  were	  screened	  for	  differentially	  expressed	  transcripts	  that	  may	  be	  responsible	  for	  observed	  variations	  in	  essential	  oil	  composition	  between	  wild-­‐type	  species	  and	  mutants.	  Several	  promising	  transcription	  factor,	  terpene	  synthase	  and	  3-­‐hydroxy-­‐3-­‐methylglutaryl	  co-­‐A	  reductase	  proteins	  were	  identified	  as	  showing	  unique	  expression	  patterns	  between	  species	  and	  tissues	  and	  in	  mutant	  plants	  as	  compared	  to	  wild-­‐type.	  These	  candidates	  are	  valuable	  lead	  genes	  in	  identifying	  new	  terpene	  synthase	  enzymes	  and	  in	  studies	  investigating	  the	  as	  yet	  poorly	  understood	  regulation	  of	  terpene	  biosynthesis	  in	  plants.	  	  4.2. 	  Methods	  4.2.1. Identification	  of	  gene	  targets	  through	  next-­generation	  transcriptome	  sequencing	  	  Putative	  mutants	  (based	  on	  leaf	  EO	  profile)	  identified	  in	  the	  previous	  section	  were	  selected	  for	  further	  analysis.	  	  In	  all	  cases	  four	  biological	  replicates	  and	  two	  technical	  replicates	  were	  used	  for	  qPCR	  experiments.	  RNA	  was	  extracted	  from	  the	  following	  mutants:	  EG	  28,	  EG	  e123-­‐1,	  EG	  e123-­‐3,	  EG	  e47-­‐5	  and	  EG	  e47-­‐3.	  RNA	  was	  extracted	  using	  the	  Qiagen	  RNeasy	  Plant	  Mini	  Kit	  (Qiagen,	  USA)	  and	  treated	  with	  the	  Qiagen	  RNAse-­‐free	  DNAse	  I	  (Qiagen,	  USA)	  !! J#!+A!<'57*<'!CA&+*E4&*&+!5'&AE4C!daO$!Y74'=)D!/00!E5!A=!DA6&5!)'*=!+4;;6'!:*;!CA))'C+'<!*&<!4EE'<4*+')D!57A6&<!6&<'7!)4@64<!&4+7A5'&!+A!AG+*4&!*!=4&'!(A:<'7,!:>4C>!:*;!4EE'<4*+')D!;6;('&<'<!4&!)D;4;!G6=='7!*&<!4&C6G*+'<!=A7!8!E4&6+';!*+!"JAV$!\aO!:*;!'L+7*C+'<!*CCA7<4&5!+A!E*&6=*C+67'7!564<')4&';,!*&<!')6+'<!4&!80!iH!\aO;'F=7''!:*+'7$!O))!;*E()';!:'7'!'L+7*C+'<!4&!<6()4C*+'!*&<!(AA)'<!*=+'7!@6*&+4=4C*+4A&!A=!\aO!CA&C'&+7*+4A&!*&<!@6*)4+D!2(7';'&C'!A=!;*)+!A7!(7A+'4&!CA&+*E4&*&+;!*;!<'=4&'<!GD!+>'!M80UMJ0!&E!7*+4A!*&<!M10UMJ0!&E!7*+4A9!GD!;('C+7*)!*&*)D;4;!6;4&5!*!a*&A<7A(!ad!F M000!^('C+7A(>A+AE'+'7$!!^*E()';!:'7'!+>'&!;'&+!=A7!W))6E4&*j!+7*&;C74(+AE'!;'@6'&C4&5!e)*&+!Y4A;4;!!2H'+>G74<5',!O)G'7+*,!V*&*<*9$!!!34567'!#$/!%?'7?4':!A=!\aOF^'@!O&*)D;4;!e4(')4&'!2kA)=!M0/89!	  	   65	  4.2.1.1. Transcriptome	  Assembly	  	  Transcriptome	  assembly	  was	  performed	  in	  two	  ways,	  first	  by	  alignment	  to	  an	  existing	  EST	  library,	  performed	  by	  the	  staff	  at	  Plant	  Biosis,	  and	  second	  by	  de	  novo	  assembly	  in	  the	  CLC	  Genomics	  workbench	  (Qiagen,	  USA).	  4.2.1.2. Transcriptome	  alignment	  to	  existing	  Lavandula	  EST	  library	  	  Transcriptome	  alignment	  to	  the	  L.	  angustifolia	  EST	  library	  was	  performed	  at	  Plant	  Biosis.	  In	  summary,	  base	  calling	  and	  demultiplexing	  was	  performed	  using	  Illumina©	  CASAVA	  1.8.1	  with	  default	  parameters	  and	  according	  to	  the	  manufacturer’s	  manual.	  Adapter	  and	  base	  quality	  trimming	  were	  performed	  using	  cutadapt	  software	  with	  options	  specified	  to	  search	  for	  Illumina©	  RNA	  PCR	  primers	  and	  adapter	  sequences	  anywhere	  in	  the	  reads,	  trim	  detected	  adapters	  and	  low	  quality	  bases.	  Quality	  of	  the	  sequencing	  reads	  was	  assessed	  before	  and	  after	  trimming	  using	  FastQC	  software.	  Bowtie	  aligner	  was	  then	  used	  to	  match	  short	  sequencing	  reads	  to	  lavender	  ESTs	  collections:	  Lavandula	  x	  intermedia	  and	  Lavandula	  angustifolia.	  Preliminary	  alignment	  results	  showed	  that	  in	  case	  of	  L.	  x	  intermedia	  only	  6%	  of	  sequences	  could	  be	  aligned	  to	  ESTs,	  while	  in	  case	  of	  L.	  angustifolia	  about	  13%	  of	  reads	  could	  be	  aligned,	  therefore	  the	  L.	  angustifolia	  library	  was	  used	  for	  further	  analysis.	  Bowtie	  alignment	  files	  were	  then	  parsed	  using	  an	  ad	  hoc	  Perl	  script	  to	  determine	  number	  of	  reads	  aligning	  to	  each	  EST.	  	  4.2.1.3. De	  novo	  transcriptome	  assembly	  	  Illumina©	  reads	  (27	  bp)	  from	  RNA	  sequencing	  were	  quality	  checked	  and	  trimmed	  to	  remove	  adapter	  regions	  and	  low	  quality	  sequence	  reads	  (limit	  0.05	  and	  length	  >20bp)	  in	  the	  CLC	  genomics	  workbench	  prior	  to	  assembly.	  Sequences	  from	  all	  EST	  libraries	  (L.	  angustifolia	  flower	  and	  leaf	  and	  L.	  x	  intermedia	  cv	  Grosso	  glandular	  trichomes)	  and	  the	  46,153,023	  Illumina©	  reads	  were	  assembled	  in	  the	  CLC	  genomics	  workbench	  multiple	  	  	   66	  times	  to	  attain	  largest	  possible	  contigs	  with	  a	  word	  sizes	  of	  16	  and	  18	  and	  minimum	  contig	  size	  of	  300	  bp.	  Reads	  were	  mapped	  back	  to	  contigs	  with:	  mismatch	  cost	  =	  2,	  insertion	  cost	  =	  3,	  deletion	  cost	  =	  3,	  length	  fraction	  =	  0.5	  and	  similarity	  fraction	  =0.8.	  	  4.2.1.3.1. BLAST	  annotation	  and	  GO	  mapping	  	  Sequences	  were	  then	  annotated	  using	  blastx	  part	  of	  the	  BLAST+	  command	  line	  program	  (NCBI,	  USA)	  on	  the	  Jasper	  facility	  of	  Compute	  Canada’s	  Westgrid	  Network.	  Gene	  ontology	  (GO)	  mapping,	  Interpro	  scan,	  annotation	  and	  ANNEX	  annotation	  augmentation	  was	  then	  performed	  in	  Blast2Go	  (Myhre	  et	  al.	  2006).	  	  4.2.2. Differential	  Expression	  Analysis	  	  Differential	  expression	  analysis	  was	  performed	  on	  both	  the	  contigs	  aligned	  to	  the	  EST	  library	  and	  those	  assembled	  de	  novo.	  The	  former	  was	  done	  using	  the	  bioconductor	  package	  in	  Degseq	  and	  statistical	  analysis	  and	  normalization	  were	  performed	  according	  to	  developer	  guidelines,	  with	  contigs	  with	  less	  than	  five	  reads	  aligned	  to	  them	  being	  excluded	  from	  the	  analysis.	  For	  de	  novo	  assembled	  data	  reads	  from	  each	  individual	  plant	  were	  mapped	  against	  the	  newly	  assembly	  de	  novo	  trasncriptome	  library	  and	  differential	  expression	  analysis	  was	  performed	  in	  the	  CLC	  Genomics	  Workbench	  (Qiagen)	  using	  reads	  per	  kilobase	  of	  transcript	  per	  million	  reads	  mapped	  (RPKM)	  and	  Benjamin-­‐Hochberg	  false	  discovery	  rate	  (FDR)	  corrected	  p-­‐values.	  	  The	  de	  novo	  assembled	  library	  was	  run	  through	  the	  Mercator	  pipeline	  to	  create	  a	  mapping	  file	  with	  all	  sequences	  binned	  by	  function	  using	  comparison	  against:	  3	  BLAST,	  2	  RPSBLAST	  and	  Interproscan	  and	  databases	  (Lohse	  et	  al.	  2013).	  Heatmaps	  of	  differentially	  expressed	  genes	  were	  generated	  and	  overlayed	  on	  metabolic	  pathways	  in	  Mapman	  software	  and	  comparisons	  between	  groups	  were	  performed	  using	  the	  Wilcoxon	  test,	  with	  an	  e-­‐value	  	  	   67	  cutoff	  of	  1	  and	  using	  FDR	  corrected	  p-­‐values	  using	  the	  Pageman	  function	  of	  Mapman	  to	  identify	  groups	  overrepresented	  in	  the	  differential	  expression	  analyis.	  	  Expression	  levels	  of	  gene	  targets	  identified	  as	  being	  differentially	  regulated	  in	  RNA-­‐seq	  results	  were	  then	  confirmed	  by	  real-­‐time	  quantitative	  PCR	  (qPCR)	  by	  the	  “delta	  delta”	  CT	  method	  using	  the	  BioRad	  CFX96	  Platform	  in	  the	  Ghosh	  Lab	  (UBC,	  Okanagan)	  for	  candidates	  identified	  by	  comparison	  to	  the	  EST	  library	  and	  using	  the	  Applied	  Biosystems	  StepOne	  Plus	  system	  for	  all	  remaining	  samples.	  RNA	  was	  extracted	  as	  described	  in	  section	  5.2.1	  in	  quadruplicate	  and	  biological	  replicates	  were	  run	  in	  duplicate	  during	  qPCR	  analysis.	  cDNA	  (comlementary	  DNA)	  was	  synthesized	  using	  the	  iScript	  cDNA	  Synthesis	  Kit	  (BioRad)	  following	  manufacturer’s	  recommended	  instructions.	  Quantitative	  real-­‐time	  PCR	  reactions	  were	  performed	  using	  Sso	  Fast	  Eva	  Green	  Supermix	  (BioRad)	  for	  the	  Bio-­‐Rad	  CFX	  Manager	  2.0	  and	  Syber	  Select	  MasterMix	  (Life	  Technologies,	  Canada).	  All	  primers	  were	  synthesized	  by	  Life	  Technologies,	  Canada.	  Primer	  efficiencies	  were	  calculated	  using	  LinReg	  PCR	  verified	  according	  to	  the	  minimum	  information	  for	  publication	  of	  quantitative	  real-­‐time	  PCR	  experiments	  (MIQE)	  guidelines	  (Bustin	  et	  al.	  2009;	  Ruijter	  et	  al.	  2009)	  (Appendix	  IV).	  Primer	  sequences	  are	  given	  in	  Table	  4.1.	  Expression	  of	  the	  beta-­‐actin	  gene	  was	  used	  to	  normalize	  gene	  expression	  and	  quantification	  of	  gene	  expression	  was	  carried	  out	  using	  the	  CFX	  manager	  software	  version	  1.6.541.1028	  (Bio-­‐Rad)	  for	  data	  collected	  on	  the	  BioRad	  CFX96	  platform.	  	   For	  data	  acquired	  with	  the	  Applied	  Biosystems	  instrument	  data	  collection,	  reference	  genes	  were	  chosen	  from	  four	  previously	  reported	  reference	  genes.	  These	  reference	  candidates	  were	  screened	  for	  expression	  levels	  and	  stability	  across	  tissue	  types	  and	  samples	  by	  visual	  inspection	  of	  amplification	  plots	  (Appendix	  V).	  Additionally	  Life	  Technologies	  Data	  Assist	  	  	   68	  software	  was	  used	  to	  score	  candidate	  reference	  genes	  and	  the	  top	  two	  genes	  were	  selected	  as	  reference	  genes.	  In	  all	  cases	  the	  two	  reference	  genes	  used	  were	  18S	  rRNA	  and	  beta-­‐actin	  (Table	  4.1)	  (Soto	  et	  al.	  2011;	  Wu	  et	  al.	  2012;	  Demissie	  et	  al.	  2012;	  Julio	  et	  al.	  2014).	   All	  samples	  were	  run	  with	  four	  biological	  replicates	  and	  two	  technical	  replicates	  on	  an	  Applied	  Biosystems	  StepOnePlus	  System	  using	  Life	  Technologies	  Sybr	  Select	  Mastermix.	  Complementary	  DNA	  was	  synthesized	  from	  RNA	  extracted	  from	  four	  individual	  tissue	  samples	  from	  a	  single	  plant	  using	  the	  BioRad	  iScript	  cDNA	  synthesis	  kit.	   Relative	  quantitative	  expression	  was	  determined	  by	  the	  delta	  delta	  Cq	  method	  in	  Data	  Assist.	  Due	  to	  quantity	  of	  samples	  references	  were	  run	  separately	  from	  genes	  of	  interest	  and	  interrun	  calibrators	  were	  included	  on	  all	  plates	  along	  with	  ‘no	  template	  controls’	  for	  quality	  control.	  As	  Grosso	  leaf	  samples	  were	  present	  on	  all	  plates	  grosso	  leaf	  biological	  replicate	  three	  was	  used	  as	  the	  calibrator	  in	  the	  delta	  delta	  Cq	  calculation.	   For	  mutant	  samples	  all	  samples	  were	  manually	  normalized	  to	  the	  average	  of	  the	  wild-­‐type	  samples	  either	  leaf	  or	  flower	  depending	  on	  tissue	  to	  give	  expression	  relative	  to	  wild-­‐type	  in	  Microsoft	  Excel.	  For	  wild-­‐type	  comparisons	  no	  further	  normalization	  was	  undertaken	  and	  relative	  expression	  values	  calculated	  using	  Data	  Assist.	  Plots	  were	  generated	  and	  means	  and	  standard	  error	  were	  calculated	  in	  GraphPad	  Prism,	  and	  all	  further	  statistical	  analysis	  for	  difference	  expression	  studies	  was	  performed	  in	  GraphPad	  Prism.	   An	  ANOVA	  was	  run	  to	  compare	  all	  wild-­‐type	  samples	  (Grosso	  leaf	  (GrL),	  Grosso	  flower	  (GrF),	  L.	  angustifolia	  cv	  Lady	  (Lady)	  leaf	  (LaL)	  and	  Lady	  flower	  (LaF))	  using	  a	  full	  factorial	  design.	  In	  cases	  where	  variance	  was	  significantly	  different	  in	  groups	  the	  Kruskal-­‐Wallis	  nonparametric	  test	  was	  used.	  Significant	  difference	  is	  indicated	  by	  different	  letters	  using	  alpha	  =	  0.05. 	  	   69	  An	  ANOVA	  was	  again	  used	  to	  determine	  significant	  changes	  in	  relative	  expression	  values	  between	  mutant	  samples	  (28	  flower	  (28F),	  28	  leaf	  (28L),	  e47-­‐3	  leaf	  (e47-­‐3L),	  e47-­‐5	  leaf	  (e47-­‐5L),	  e123-­‐1	  leaf	  (e123-­‐1L),	  e	  123-­‐3	  leaf	  (e123-­‐	  3L),	  417	  leaf	  (417L),	  and	  417	  flower	  (417F))	  and	  wild-­‐type,	  however,	  the	  multiple	  comparisons	  model	  quantified	  difference	  between	  each	  mutant	  and	  wild-­‐type	  only	  .	  Significance	  level	  is	  indicated	  by	  ns	  –	  no	  significant	  difference/	  *	  p	  0.05/	  **	  p	  0.01/***	  p	  0.001.	  For	  wild-­‐type	  comparisons	  where	  variance	  was	  significantly	  different	  the	  non-­‐parametric	  Kruskal-­‐Wallis	  test	  was	  used.	  All	  statistical	  analyses	  were	  performed	  in	  GraphPad	  Prism.	   In	  all	  cases	  where	  there	  were	  only	  two	  groups	  being	  compared	  a	  student’s	  t-­‐test	  was	  used	  with	  significance	  levels	  as	  stated	  for	  comparisons	  between	  wild-­‐type	  and	  mutants.	  The Mann-­‐Whitley	  non-­‐parametric	  test	  was	  used	  in	  cases	  where	  groups	  showed	  significantly	  different	  variance.	  	  	   70	  Table	  4.1.	  qPCR	  primer	  sequences,	  amplicon	  length	  and	  melting	  temperature	  used	  in	  qPCR	  experiments.	  Gene	  Function	  Database/	  Contig	  ID	   Putative	  ID	   Forward	  Primer	  (5’	  -­>	  3’)	   Reverse	  Primer	  (5’	  -­>	  3’)	  transcription	  factor	   17057	  transcriptional	  factor	  wrky	  i	   CTCCCTTTGGCTTTGTGAGG	   GTTCGGTTTTAGGGACCACG	  	  transcription	  factor	   14504	  ethylene	  response	  factor	  erf6	   GAAAGTGGAGCAGAACCCAC	   CATTTCCCCCATTTCCGCTG	  transcription	  factor	   10411	   ap2-­‐like	  protein	   TTAACTTGCTGCCGCTTCTG	   GCAACTGCGATTACGAGGAG	  transcription	  factor	   17452	  ap2-­‐type	  transcription	  factor	   CTTCCTTCGATTGGCCTTCC	   TGGCTGCATTGAAGTATTGGG	  transcription	  factor	   5015	  transcription	  factor	  bhlh71	   AAGGACGGTGAGGAAGACAG	   TATCCGAATCCTCTCACGGC	  transcription	  factor	   4954	   WRKY14	   CGACCCGACAATGCTAATCG	   GATGGCGTGATTGTGGTCTC	  transcription	  factor	   6102	  wrky	  transcription	  factor	   ATCGATCGTTTTCCGTTGGG	   TCACTTTCTTCACGCGCTTC	  	  	   	  	   	  	   	  	   	  	  isoprenoid	  biosynthesis	   10341	  3-­‐hydroxy-­‐3-­‐methylglutaryl-­‐coenzyme	  a	  reductase	   TACAACCGATCAAGCAGGGA	   CCAGCGTGGTTGTGATCTTC	  isoprenoid	  biosynthesis	   10355	  3-­‐hydroxy-­‐3-­‐methylglutaryl-­‐coenzyme	  a	  reductase	   GTACAACCGATCAAGCAGGG	   CCAGCGTGGTTGTGATCTTC	  isoprenoid	  biosynthesis	   15232	  3-­‐hydroxy-­‐3-­‐methylglutaryl-­‐coenzyme	  a	  reductase	  1	   ATGCCCTCTACCTCACCAAC	   GATCTTCTCTCGCCATCGGA	  isoprenoid	  biosynthesis	   2579	  mevalonate	  diphosphate	  decarboxylase	   TTCAACCGTGTCACGCATTC	   TCGCTGATGAAAAGCACTGG	  isoprenoid	  biosynthesis	   2580	  mevalonate	  diphosphate	  decarboxylase	   TACCTCCTTTCCGTTGAGCC	  	   GGGGGAAGAGGGATGAAGAC	  	  	  	  	  	   71	  Table	  4.1.	  qPCR	  primer	  sequences,	  amplicon	  length	  and	  melting	  temperature	  used	  in	  qPCR	  experiments.	  isoprenoid	  biosynthesis	   9781	  3-­‐hydroxy-­‐3-­‐methylglutaryl-­‐coenzyme	  a	  reductase	   GGTTCTTCCCAGCAATAGCG	   TTGTGAGGTTTTCGTCTGCG	  isoprenoid	  biosynthesis	  Primary	  assembly	  HMGS	   TGGACAGGCTGAATGGATGT	   TGTTCTCGTATGGCAGTGGT	  isoprenoid	  biosynthesis	  Primary	  assembly	  HMGR	   AGCTCGTCTGAGGATGATGG	   TCCCCTTCTTCTCATGCTCG	  	  	   	  	  	  	   	  	   	  	  terpene	  synthase	   1894	  terpene	  synthase	  6	   CATCGGAGCTCACGGAAATC	  	   CGTTGGATTGCATCGACGAG	  	  terpene	  synthase	   2929	  linalool	  synthase	   GCGATATGAACCGTGTCTCG	   TCTCTCCACCTCAGCCAATG	  terpene	  synthase	   2521	  linalool	  synthase	   CCGCTTCCATTTCTTCCTCC	  	   GTACTCGACAAGACACGCTG	  	  terpene	  synthase	   7138	  bicyclogermacrene	  synthase	  GGGGCTCAACAAACACCATC	   ACCGGAGACGATTGGTATGG	  terpene	  synthase	  3866/EST	  library	  linalool	  synthase	   TAACCCAGGGCATGACCAAC	   TTGCTCCCAACCTAGTCAGAG	  terpene	  synthase	   7139	  bicyclogermacrene	  synthase	  TAACATAGAGCCCCCGATGG	   ATGACCTAGTGGGCGATGAG	  terpene	  synthase	   7765	  copalyl	  diphosphate	  synthase	  partial	  ACAAGTCATGTGAGCATCGC	   AACGTGGAATGTTGATGGCG	  terpene	  synthase	   1895	  terpene	  synthase	  6	   GATGCCATGGATCAGTTGCC	  	   TCGACGGCGTATGACTTTCT	  	  terpene	  synthase	  2279/EST	  library	  Cadinol	  Synthase	   AGATTATGAACGCGACGCAG	   TAAGCCCTCGCAAGTTGTTG	  terpene	  synthase	   2520	  monoterpene	  synthase-­‐like	  protein	  AGTTTCCGGAGCGTCGAATA	   CTACAACAACATCCGCCACT	  terpene	  synthase	  2522/EST	  library	  linalool	  synthase	   CGATTCCGACTCCTCAGACA	   ATCGTCAGCAAGGTTAGGCT	  terpene	  synthase	   4905	  limonene	  synthase	   AACGTCATTCGAAATGGGGC	   GTAACACTCAACCGCCTTCG	  terpene	  synthase	   1742	  linalool	  synthase	   GCAAATCCACCCACGATCTC	   AACTTTGTTTCCGAGGTGGC	  	  	  	   72	  Table	  4.1.	  qPCR	  primer	  sequences,	  amplicon	  length	  and	  melting	  temperature	  used	  in	  qPCR	  experiments.	  terpene	  synthase	   7411	  linalool	  synthase	   AGCTTGCGATAGTACCGGAG	   CGAGGTGGCTTACGACATTC	  terpene	  synthase	   1740	  monoterpene	  synthase-­‐like	  protein	  TTAATGTGTTCGCGTGCCTC	   GCTGTTAAGGCTTCCCGATG	  terpene	  synthase	   1741	  monoterpene	  synthase-­‐like	  protein	  AGTTGCAATCATCGGGAAGC	   TCTTGACAACGGGCAGATTTC	  terpene	  synthase	  Cloned	  gene	  	  borneol	  dehydrogenase	  CCTACCCCTACATCTGCTCG	   GTCCCTCGTCATCGGAGTAG	  terpene	  synthase	  Cloned	  gene	  Cineole	  synthase	  (CINS)a	  CCAAGCCTCAGCCATGATAGA	   TTGCACATCGATGCTTATCGTA	  terpene	  synthase	  EST	  library	  Unknown	  monoterpene	  synthase	  1	  (UTPS1)	  TACTCAACAAGGCCCGACAT	   AAATTGGGCTTCAACGACCC	  terpene	  synthase	  EST	  library	  Unknown	  monoterpene	  synthase	  3	  (UTPS3)	  CGGTGTTCATCTGCATCGAC	   AGGTGATGTGCCAAAAGCAG	  reference	  gene	   	  Actinb	   TGTGGATTGCCAAGGCAGAGT	   AATGAGCAGGCAGCAACAGCA	  reference	  gene	   	  18S	  rRNAc	   GTGACGGGTGACGGAGAATT	  	  	  GACTCAATGAGCCCGGTATTG	  	  	  candidate	  reference	  gene	   	  26S	  rRNAd	   GTCCTAAGATGAGTCCAA	  	  	  GTCCTAAGATGAGTCCAA	  	  	  candidate	  reference	  gene	   	  Ubiquitine	   CTCTTCATTTGGTGTTGAGGCTTC	  	  	  TGCCTTCACATTATCGATGGTGTC	  aAs	  described	  by	  Demissie	  et	  al.	  2012	  bAs	  described	  by	  Soto	  et	  al.	  2011	  cAs	  described	  by	  Lane	  et	  al.	  2010	  dAs	  described	  by	  Julio	  et	  al.	  2014	  eAs	  described	  by	  Wu	  et	  al.	  20124.3. Results	  4.3.1. Transcriptome	  assembly	  	  Two	  to	  eight	  million	  27	  bp	  reads	  were	  obtained	  per	  sample,	  and	  total	  assembly	  of	  all	  samples	  lead	  to	  10%	  of	  reads	  being	  assembled	  into	  contigs,	  minimum	  contig	  length	  was	  15	  bp	  and	  maximum	  contig	  length	  was	  8,455	  for	  a	  total	  of	  17,671	  contigs.	  All	  contigs	  less	  than	  300	  bp	  in	  length	  were	  then	  removed	  to	  give	  a	  total	  of	  17,003	  contigs	  (Table	  4.2	  -­‐	  4.3).	  	  After	  read	  mapping	  to	  de	  novo	  assembly	  (with	  minimum	  contig	  length	  of	  300)	  68-­‐75%	  of	  reads	  per	  sample	  were	  able	  to	  be	  mapped	  back	  to	  the	  de	  novo	  library	  while	  approximately	  12%	  of	  reads	  per	  sample	  could	  be	  mapped	  back	  to	  the	  EST	  library	  (Table	  4.4.)	  	  Table	  4.2.	  Contig	  measurements	  for	  de	  novo	  assembly	  	   Length	  N75	   575	  N50	   804	  N25	   1,088	  Minimum	   15	  Maximum	   8,455	  Average	   699	  Count	   17,671	  	  Table	  4.3.	  Summary	  statistics	  for	  de	  novo	  assembly	  	  	   Count	   Average	  length	  (bp)	   Total	  bases	  Reads	   41,287,265	   29.47	   1,216,742,275	  Matched	   10,576,177	   30.86	   326,377,646	  Not	  matched	   30,711,088	   28.99	   890,364,629	  Contigs	   17,671	   699	   12,353,273	  	  	  	  	  	  	  	  	  	   74	  	  Table	  4.4.	  Summary	  statistics	  for	  read	  mapping	  	  to	  L.	  angustifolia	  EST	  library	  (Lane	  et	  al.	  2010)	  and	  de	  novo	  assembled	  library	  ID	  Source	  Tissue	   Total	  reads	  Percent	  Reads	  Mapped	  to	  EST	  Library	  Percent	  Reads	  Mapped	  to	  de	  novo	  Library	  e47-­‐5	   Leaf	   4958018	   12.63	   71.53	  e47-­‐3	   Leaf	   3557352	   12.57	   71.03	  wild-­‐type	  Grosso	   Leaf	   8392462	   12.44	   70.59	  Provence	   Leaf	   6660845	   12.3	   69.77	  Lady	   Leaf	   6284997	   14	   75.79	  28	   Leaf	   3242039	   12.16	   75.25	  Lady	   Flower	   4877352	   13.26	   67.97	  e123-­‐3	   Leaf	   2548990	   12.44	   71.69	  wild-­‐type	  Grosso	   Flower	   2226272	   12.67	   68.36	  e123-­‐1	   Leaf	   3404696	   12.86	   71.84	  	  4.3.2. Annotation	  and	  functional	  classification	  	  Functional	  annotation	  was	  assigned	  using	  blastx	  search	  against	  the	  NCBI	  NR	  (non-­‐redundant)	  database	  with	  an	  e-­‐value	  cutoff	  of	  1e-­‐10	  followed	  by	  KEGG	  (Kyoto	  encyclopedia	  of	  genes	  and	  genomes)	  analysis	  and	  Interproscan,	  functional	  annotations	  and	  after	  ANNEX	  augmentation.	  Putative	  functional	  annotations	  were	  assigned	  to	  60%.	  Distribution	  of	  GO	  annotations	  and	  KEGG	  pathways	  is	  given	  in	  Figure	  4.2.	  	  	  	   75	  	  	  Figure	  4.2.	  Percentage	  distribution	  of	  gene	  sequences	  after	  GO	  mapping	  for	  GO	  cellular	  components,	  biological	  processes	  and	  molecular	  function	  at	  GO	  level	  2	  and	  top	  metabolic	  pathways	  with	  sequences	  representing	  enzymes	  from	  the	  KEGG	  database.	  	  	  4.3.3. Differential	  expression	  analysis	  	  Differential	  expression	  analysis	  was	  performed	  with	  three	  different	  platforms:	  Mapman,	  the	  CLC	  Genomics	  Workbench	  and	  Degseq,	  with	  the	  latter	  being	  applied	  only	  to	  the	  alignment	  to	  the	  EST	  library	  while	  the	  former	  two	  were	  applied	  only	  to	  the	  de	  novo	  assembled	  library.	  The	  top	  100	  differentially	  expressed	  genes	  were	  mapped	  and	  analyzed	  by	  hierarchial	  clustering	  to	  show	  the	  relationship	  between	  all	  plants	  sequence.	  Alignment	  	  	   76	  to	  the	  EST	  library	  gave	  seven	  genes	  putatively	  involved	  in	  terpene	  biosynthesis	  that	  were	  differentially	  expressed.	  This	  expression	  was	  then	  confirmed	  by	  real	  time	  PCR	  analysis	  with	  all	  candidates	  showing	  significantly	  different	  expression	  as	  compared	  to	  wild-­‐type	  in	  at	  least	  one	  mutant	  with	  the	  exception	  of	  HMGR	  and	  HMGS,	  however	  all	  genes	  showed	  a	  trend	  towards	  differential	  expression	  (Figure	  4.3).	  Of	  particular	  interest	  is	  that	  UTPS1	  was	  not	  expressed	  in	  e123-­‐3	  as	  well	  as	  CADS	  showing	  very	  minimal	  expression	  in	  this	  same	  plant,	  while	  all	  other	  mutants	  showed	  the	  opposite	  trend.	  UTPS	  2-­‐4	  showed	  significant	  trends	  towards	  increased	  expression.	  HMGR	  and	  HMGS	  both	  showed	  a	  trend	  towards	  increased	  expression	  in	  all	  mutants.	  	  !! ..!!V'(<1&!@BDB![TLQ!V$+3G;)2,(&4!,$1*2+'\&3!%$!#'+3G%60&!&>01&44'$,!+&E&+4!7$1!3'77&1&,%'2++6!&>01&44&3!%)&!(&,&!;2,3'32%&4!DG)631$>6GDG*&%)6+(+<%216+!L$C!1&3<;%24&!F_OUQH5!DG)631$>6GDG*&%)6+(+<%216+!L$C!46,%)24&!F_OUKH5!<,I,$#,!%&10&,&!46,%)24&!F`"TKH!8G@!2,3!;23',$+!46,%)24&!FLCSKH5!4&+&;%&3!71$*!2+'(,*&,%!%$!%)&!JK"!32%2/24&5!',!%)&!+&2E&4!$7!*<%2,%4!&8-DGD5!&@.G=5!&@.GD!2,3!-?5!24!#&++!24!#'+3G%60&!U1$44$!+&27B!a2+<&4!21&!;$*021&3!%$!#'+3G%60&!<4',(!K%<3&,%b4!%G%&4%!#)&1&!4'(,'7';2,;&!E2+<&4!21&!24!7$++$#4!c!2+0)2!d!9B9=5!cc!2+0)2!d!9B985!ccc!2+0)2!d!9B998!2,3!,4!d!,$!4'(,'7';2,%!3'77&1&,;&B!!!!! .?!V$+3!;)2,(&4!2;[<'1&3!71$*!3'77&1&,%'2+!&>01&44'$,!2,2+64'4!0&17$1*&3!',!LML!#&1&!E'4<2+'\&3!',!%)&!O20*2,!01$(12*B!C7%&1!;$*021'4$,!<4',(!%)&!^'+;$>$,!%&4%!2,3!VSQ!;$11&;%&3!\GE2+<&4!1&E&2+&3!=9!(&,&!72*'+'&4!4)$#',(!$E&1!$1!<,3&1!1&01&4&,%2%'$,!',!3'77&1&,%'2+!&>01&44'$,!1&4<+%4!FV'(<1&!@B@H!2,3!$7!021%';<+21!',%&1&4%!#&1&!4&E&,!$7!%)&4&!(&,&!;2%&($1'&4!#)';)!#&1&!',E$+E&3!3'1&;%+6!',!%&10&,&!/'$46,%)&4'45!#&1&!',E$+E&3!',!;$G72;%$1!01$3<;%'$,!$1!#&1&!'3&,%'7'&3!24!%12,4;1'0%'$,!72;%$14!F',3';2%&3!/6!;$+$<1!211$#4!',!V'(<1&!@B@HB!V'(<1&!@B@B!_&2%*20!$7!;$*021'4$,4!/&%#&&,!3'77&1&,%'2++6!&>01&44&3!(&,&4!',!*<%2,%4!24!;$*021&3!%$!#'+3G%60&!&>01&44&3!24!7$+3!;)2,(&B!L$*021'4$,4!#&1&!0&17$1*&3!<4',(!%)&!^'+;$>$,!%&4%!2,3!VSQ!;$11&;%&3!\!E2+<&4!0+$%%&3B!Q&3!',3';2%&4!<,3&1!1&01&4&,%&3!(1$<045!#)'+&!/+<&!',3';2%&4!$E&1!1&01&4&,%&3!(1$<04B!!!	  	   79	  The	  normalized	  expression	  values	  for	  the	  de	  novo	  assembled	  transcriptome	  calculated	  in	  the	  CLC	  Genomics	  Workbench	  as	  reads	  per	  kilobase	  of	  target	  per	  million	  mapped	  reads	  (RPKM)	  are	  given	  in	  Table	  4.5	  for	  genes	  from	  three	  groups	  of	  interest:	  (1)	  transcription	  factor	  families	  implicated	  in	  the	  regulation	  of	  isoprenoid	  biosynthesis	  including	  the	  AP2-­‐EREBP	  family,	  ethylene	  response	  factors	  (ERF),	  WRKY	  family	  and	  bHLH	  family,	  (2)	  isoprenoid	  biosynthetic	  genes	  and	  (3)	  terpene	  synthases.	  To	  identify	  candidate	  genes	  which	  may	  be	  responsible	  for	  unique	  chemotypes	  in	  two	  wild-­‐type	  plants	  (Grosso	  and	  L.	  angustifolia	  cv	  Lady)	  and	  among	  mutants	  differential	  expression	  analysis	  by	  proportions	  analysis	  in	  CLC	  Genomics	  Workbench	  then	  yielded	  candidates	  for	  which	  expression	  values	  were	  then	  confirmed	  by	  qPCR.	  These	  candidates	  are	  those	  with	  RPKM	  values	  provided	  in	  Table	  4.5.	  Five	  transcription	  factors	  were	  identified	  as	  having	  expression	  values	  that	  were	  significantly	  different	  by	  proportions	  analysis,	  though	  a	  proper	  statistical	  analysis	  could	  not	  be	  performed	  due	  to	  lack	  of	  replication	  in	  RNA	  –	  Seq	  samples	  sent,	  in	  the	  mutants	  as	  compared	  to	  wild-­‐type	  while	  there	  were	  six	  that	  showed	  different	  expression	  in	  wild-­‐type	  samples.	  Two	  genes	  involved	  in	  the	  pathways	  producing	  IPP	  and	  DMAPP	  were	  identified	  –	  HMGR	  and	  MVAPP	  decarboxylase.	  Both	  these	  genes	  appeared	  to	  show	  differential	  expression	  patterns	  between	  species	  and	  tissue	  types	  and	  all	  but	  one	  isoform	  of	  MVAPP	  decarboxylase	  were	  found	  to	  have	  differential	  expression	  in	  mutants	  as	  compared	  to	  wild-­‐type.	  Terpene	  synthases	  were	  by	  far	  the	  best	  represented	  in	  this	  analysis	  with	  sixteen	  contigs	  putatively	  identified	  as	  terpene	  synthases.	  All	  candidates	  were	  found	  to	  show	  differential	  expression	  in	  wild-­‐type	  samples	  while	  all	  but	  three	  appeared	  to	  have	  differential	  expression	  in	  at	  least	  one	  of	  the	  mutants.	  	  Expression	  values	  results	  of	  qPCR	  of	  leaf	  and	  flower	  of	  both	  wild-­‐type	  species	  are	  given	  in	  Table	  4.6.	  No	  transcription	  factor	  candidate	  was	  found	  to	  have	  significant	  results	  which	  	  	   80	  matched	  the	  trends	  observed	  in	  the	  RPKM	  expression	  results	  in	  fact	  for	  some	  of	  the	  significant	  qPCR	  results	  the	  observed	  expression	  values	  are	  opposite	  to	  what	  is	  expected,	  as	  is	  the	  case	  for	  contig	  17057,	  a	  putative	  member	  of	  the	  WRKY	  transcription	  factor	  family	  where	  RPKM	  expression	  values	  show	  no	  expression	  in	  Lady	  and	  high	  expression	  in	  Grosso	  while	  qPCR	  results	  show	  low	  expression	  in	  Grosso	  and	  higher	  expression	  in	  Lady.	  Both	  contigs	  17452	  (AP2),	  and	  5015	  (bHLH)	  show	  significantly	  higher	  expression	  in	  Grosso	  leaf	  than	  in	  Lady	  leaf	  while	  there	  is	  no	  difference	  in	  either	  contig	  14504	  a	  putative	  ethylene	  response	  factor	  or	  10411	  a	  putative	  member	  of	  the	  AP2	  transcription	  factor	  family.	  	  Two	  isoforms	  of	  HMGR	  were	  found	  to	  be	  differentially	  expressed.	  The	  first	  –	  contig	  10341	  -­‐	  was	  differentially	  expressed	  between	  tissue	  types:	  leaf	  and	  flower	  while	  the	  second,	  contig	  9781	  was	  found	  to	  be	  differentially	  expressed	  between	  species.	  One	  isoform	  of	  MVAPP	  decarboxylase	  was	  found	  to	  have	  differential	  expression	  between	  leaves	  of	  Grosso	  and	  Lady.	  	  The	  majority	  of	  terpene	  synthase	  candidates	  tested	  showed	  differential	  expression	  in	  wild-­‐type	  tissues.	  Nine	  of	  these	  candidate	  genes	  had	  significant	  results	  which	  agreed	  with	  the	  results	  obtained	  from	  transcriptome	  analysis:	  contig	  7138	  and	  contig	  7139	  which	  are	  both	  putative	  bicyclogermacrene	  candidates,	  contigs	  1895,	  2520,	  1740	  and	  1741	  unidentified	  terpene	  synthases,	  contig	  2279	  which	  is	  an	  already	  characterized	  cadinol	  synthase	  from	  Lavandula	  angustifolia	  (Jullien	  et	  al.	  2013),	  and	  three	  linalool	  synthase	  candidates;	  contigs	  2521,	  7411	  and	  1742.	  Contigs	  2520,	  2521	  and	  2522,	  contigs	  7138	  and	  7139,	  and	  contigs	  1740,	  1741,	  1742	  &	  7411	  showed	  very	  similar	  expression	  patterns	  and	  so	  an	  additional	  assembly	  and	  alignment	  of	  these	  contigs	  was	  performed	  and	  it	  was	  found	  that	  these	  contigs	  assembled	  to	  form	  three	  individual	  contigs	  that	  were	  putatively	  identified	  as	  a	  linalool	  synthase,	  a	  germacrene	  synthase	  and	  another	  linalool	  synthase	  respectively.	  In	  the	  case	  of	  	  	   81	  all	  members	  of	  the	  two	  linalool	  synthase	  meta	  contigs	  differential	  expression	  was	  seen	  between	  tissues	  with	  flowers	  having	  significantly	  higher	  expression	  values	  than	  leaves	  for	  all	  gene	  candidates.	  Both	  germacrene	  synthase	  members	  showed	  significant	  difference	  between	  grosso	  flower	  and	  lady	  leaf.	  Contig	  2929	  which	  is	  homologous	  to	  the	  EST	  library	  member	  UTPS4	  was	  found	  to	  show	  differential	  expression	  between	  tissues,	  with	  expression	  levels	  being	  highest	  in	  lady	  flower.	  	  Results	  from	  qPCR	  of	  gene	  candidates	  in	  the	  leaves	  and	  flower	  of	  mutants	  are	  given	  in	  Tables	  4.7	  and	  4.8	  respectively.	  Only	  one	  transcription	  factor	  showed	  significant	  differential	  expression	  in	  leaves	  of	  mutants	  –	  an	  AP2	  type	  transcription	  factor	  candidate,	  contig	  10411,	  which	  had	  significantly	  higher	  expression	  levels	  in	  mutant	  e47-­‐5	  leaf	  (e47-­‐5L),	  however,	  this	  was	  the	  opposite	  of	  what	  was	  predicted	  by	  transcriptome	  analysis	  which	  gave	  an	  RPKM	  value	  of	  zero	  for	  this	  mutant.	  The	  flowers	  of	  the	  cineole	  mutant	  EG	  417,	  for	  which	  no	  RNA-­‐Seq	  data	  was	  available,	  had	  two	  transcription	  factors	  which	  showed	  significantly	  increased	  expression	  levels	  –	  the	  first	  a	  WRKY	  family	  transcription	  factor	  candidate	  (contig	  17057)	  and	  the	  second	  another	  AP2	  family	  transcription	  factor	  family	  candidate	  (contig	  17452).	  	  One	  HMGR	  isoform	  candidate	  was	  found	  to	  have	  significant	  differential	  expression	  in	  mutant	  leaf	  samples	  with	  the	  leaves	  of	  e47-­‐3	  showing	  no	  expression	  of	  contig	  15232.	  Another	  HMGR	  isoform	  candidate	  contig	  10341	  was	  shown	  to	  have	  half	  the	  expression	  of	  wild-­‐type	  plants	  in	  the	  flowers	  of	  EG	  28.	  No	  other	  isoprenoid	  precursor	  genes	  showed	  significant	  differential	  expression	  in	  mutant	  leaves	  or	  flowers	  as	  compared	  to	  wild-­‐type	  tissues.	  	  Though	  there	  were	  no	  tepene	  synthase	  candidate	  genes	  with	  significant	  differential	  expression	  in	  any	  of	  the	  mutant	  flower	  samples	  tested,	  in	  leaves	  the	  terpene	  synthases,	  as	  	  	   82	  was	  observed	  in	  wild-­‐type	  samples,	  had	  the	  greatest	  number	  of	  differentially	  expressed	  candidates.	  Two	  linalool	  synthase	  candidates	  were	  found	  to	  be	  upregulated	  in	  mutant	  leaves,	  contig	  2929	  (UTPS4)	  in	  e123-­‐1	  and	  contig	  2521	  in	  e123-­‐3	  with	  UTPS4	  showing	  8	  times	  the	  expression	  level	  of	  wild-­‐type	  plants	  and	  contig	  2521	  having	  almost	  three	  times	  the	  expression	  levels.	  One	  bicyclogermacrene	  synthase	  candidate	  was	  found	  to	  be	  expressed	  at	  eight	  times	  wild-­‐type	  expression	  levels	  in	  the	  leaves	  of	  28,	  although	  no	  difference	  in	  expression	  was	  seen	  in	  the	  flowers.	  Three	  unknown	  (mono)terpene	  synthases	  	  were	  found	  to	  be	  significantly	  differentially	  expressed	  in	  mutants:	  contigs	  3866	  and	  1895	  in	  e123-­‐3,	  and	  contig	  2520	  in	  e123-­‐1.	  A	  copalyl	  diphosphate	  synthase	  candidate	  was	  found	  to	  be	  differentially	  expressed	  in	  e47-­‐5.	  	  The	  last	  group	  of	  genes	  screened	  were	  two	  genes	  that	  	  have	  been	  previously	  cloned	  and	  the	  enzymes	  functionally	  characterized:	  cineole	  synthase	  and	  borneol	  dehydrogenase,	  both	  from	  Lavandula	  angustifolia	  (Demissie	  et	  al.	  2012;	  Sarker	  et	  al.	  2012)	  (Tables	  4.7	  –	  4.8).	  Borneol	  dehydrogenase	  expression	  levels	  were	  assayed	  only	  in	  plants	  with	  modified	  camphor	  levels.	  Expression	  was	  not	  found	  to	  be	  downregulated	  in	  any	  mutants	  and	  was	  only	  found	  to	  have	  significantly	  different	  expression	  in	  mutant	  e47-­‐5	  in	  which	  was	  upregulated	  four	  fold.	  Cineole	  synthase	  was	  tested	  only	  in	  plants	  with	  modified	  cineole	  levels	  and	  was	  found	  to	  be	  significantly	  decreased	  in	  flowers	  with	  almost	  no	  expression	  as	  compared	  to	  wild-­‐type.	  	  	   83	  Table	  4.5.	  	  Genes	  identified	  as	  showing	  differential	  expression	  during	  expression	  analysis	  in	  CLC,	  normalized	  expression	  values	  are	  given	  as	  reads	  per	  kilobase	  of	  target	  per	  million	  mapped	  reads	  (RPKM).	  Samples	  for	  which	  there	  is	  no	  RNA-­‐Seq	  data	  but	  expression	  was	  still	  studied	  by	  qPCR	  are	  noted	  by	  “qPCR”	  and	  results	  that	  are	  supported	  by	  significant	  qPCR	  results	  are	  given	  in	  bold	  	  Gene	  Function	   Contig	   Putative	  ID	  Lady	  leaf	  Lady	  flower	  Grosso	  leaf	  Grosso	  flower	  e123-­‐1	  leaf	  e123-­‐3	  leaf	  e47-­‐3	  leaf	  e47-­‐5	  leaf	   28	  leaf	  28	  flower	  417	  leaf	  417	  flower	  transcription	  factor	  contig	  17057	  transcriptional	  factor	  wrky	  i	   0	   0	   187.59	   341.37	   0	   0	   	   	   	  	   	  	   qPCR	   qPCR	  transcription	  factor	  contig	  14504	  ethylene	  response	  factor	  erf6	   275.12	   275.12	   208.31	   379.06	   	   	   0	   	   0	   qPCR	   qPCR	   qPCR	  transcription	  factor	  contig	  10411	   ap2-­‐like	  protein	   0	   0	   83.8	   0	   0	   0	   0	   0	   0	   qPCR	   qPCR	   qPCR	  transcription	  factor	  contig	  17452	  ap2-­‐type	  transcription	  factor	   0	   0	   220.11	   400.54	   	   	   	   	   0	   qPCR	   qPCR	   qPCR	  transcription	  factor	  contig	  5015	  transcription	  factor	  bhlh71	   97.45	   0	   73.78	   0	   	   	   	   	   	  	   	  	   qPCR	   qPCR	  transcription	  factor	  contig	  4954	   WRKY14	   	  	   	   135.04	   245.73	   0	   	   	   	   	  	   	  	   qPCR	   qPCR	  transcription	  factor	  contig	  6102	  wrky	  transcription	  factor	   	  	   	   0	   0	   	   	   	   101.89	   	  	   	  	   qPCR	   qPCR	  	  	   	  	   	  	   	  	   	  	   	  	   	  	   	  	   	  	   	  	   	  	   	  	   	  	   	  	   	  	  isoprenoid	  biosynthesis	  contig	  10341	  3-­‐hydroxy-­‐3-­‐methylglutaryl-­‐coenzyme	  a	  reductase	   0	   90	   79.18	   0	   0	   0	   0	   0	   0	   qPCR	   	   	  	  isoprenoid	  biosynthesis	  contig	  10355	  3-­‐hydroxy-­‐3-­‐methylglutaryl-­‐coenzyme	  a	  reductase	   0	   104.1	   91.58	   0	   0	   0	   0	   0	   0	   qPCR	   	   	  	  isoprenoid	  biosynthesis	  contig	  15232	  3-­‐hydroxy-­‐3-­‐methylglutaryl-­‐coenzyme	  a	  reductase	  1	   0	   127.22	   111.92	   0	   0	   0	   0	   0	   0	   qPCR	   	   	  	  isoprenoid	  biosynthesis	  contig	  2579	  mevalonate	  diphosphate	  decarboxylase	   	  	   130.54	   114.84	   0	   	   0	   0	   	   	  	   	  	   	   	  	  	  	  	  	   84	  Table	  4.5.	  	  Genes	  identified	  as	  showing	  differential	  expression	  during	  expression	  analysis	  in	  CLC,	  normalized	  expression	  values	  are	  given	  as	  reads	  per	  kilobase	  of	  target	  per	  million	  mapped	  reads	  (RPKM).	  Samples	  for	  which	  there	  is	  no	  RNA-­‐Seq	  data	  but	  expression	  was	  still	  studied	  by	  qPCR	  are	  noted	  by	  “qPCR”	  and	  results	  that	  are	  supported	  by	  significant	  qPCR	  results	  are	  given	  in	  bold	  	  Gene	  Function	   Contig	   Putative	  ID	  Lady	  leaf	  Lady	  flower	  Grosso	  leaf	  Grosso	  flower	  e123-­‐1	  leaf	  e123-­‐3	  leaf	  e47-­‐3	  leaf	  e47-­‐5	  leaf	   28	  leaf	  28	  flower	  417	  leaf	  417	  flower	  isoprenoid	  biosynthesis	  contig	  2580	  mevalonate	  diphosphate	  decarboxylase	   170.01	   146.31	   128.72	   0	   	   	   	   	   	   	   	   	  isoprenoid	  biosynthesis	  contig	  9781	  3-­‐hydroxy-­‐3-­‐methylglutaryl-­‐coenzyme	  a	  reductase	   0	   	   101.9	   	   0	   0	   	   	   0	   qPCR	   	   	  	  	  	   	  	   	  	   	  	   	  	   	  	   	  	   	  	   	  	   	  	   	  	   	  	   	  	   	  	   	  	  terpene	  synthases	  contig	  1894	  terpene	  synthase	  6	   0	   170.98	   150.42	   273.72	   	   	   	   	   	  	   	  	   	   	  	  terpene	  synthases	  contig	  2929	  linalool	  synthase	  (UTPS4)	   0	   0	   136.43	   0	   0	   0	   	   	   	  	   	  	   	   	  	  terpene	  synthases	  contig	  2521	   linalool	  synthase	   0	   0	   131.54	   0	   	   0	   	   	   	  	   	  	   	   	  	  terpene	  synthases	  contig	  7138	  bicyclogermacrene	  synthase	   0	   0	   119.62	   217.69	   0	   0	   0	   0	   0	   qPCR	   	   	  	  terpene	  synthases	  contig	  3866	  terpene	  synthase	  3	   0	   0	   111.35	   0	   	   0	   	   	   	  	   	  	   	   	  	  terpene	  synthases	  contig	  7139	  bicyclogermacrene	  synthase	   0	   0	   107.55	   0	   0	   0	   0	   0	   0	   qPCR	   	   	  	  terpene	  synthases	  contig	  7765	  copalyl	  diphosphate	  synthase	  partial	   0	   0	   89.48	   0	   0	   0	   0	   0	   0	   qPCR	   	   	  	  terpene	  synthases	  contig	  1895	  terpene	  synthase	  6	   0	   47	   41.35	   75.24	   	   0	   	   	   	  	   	  	   	   	  	  terpene	  synthases	  contig	  2279	  Cadinol	  Synthase	  (CADS)	   0	   38.89	   34.21	   62.26	   	   0	   	   	   	  	   	  	   	   	  	  terpene	  synthases	  contig	  2520	  monoterpene	  synthase-­‐like	  protein	   220.24	   189.54	   0	   303.44	   241.74	   0	   230.22	   199.4	   275.29	   qPCR	   	   	  	  terpene	  synthases	  contig	  2522	  linalool	  synthase	  (UTPS2)	   204.25	   0	   154.64	   0	   	   	   	   	   	  	   	  	   	   	  	  terpene	  synthases	  contig	  4905	  limonene	  synthase	   143.68	   0	   108.79	   0	   	   0	   	   	   	  	   	  	   	   	  	  	  	   85	  Table	  4.5.	  	  Genes	  identified	  as	  showing	  differential	  expression	  during	  expression	  analysis	  in	  CLC,	  normalized	  expression	  values	  are	  given	  as	  reads	  per	  kilobase	  of	  target	  per	  million	  mapped	  reads	  (RPKM).	  Samples	  for	  which	  there	  is	  no	  RNA-­‐Seq	  data	  but	  expression	  was	  still	  studied	  by	  qPCR	  are	  noted	  by	  “qPCR”	  and	  results	  that	  are	  supported	  by	  significant	  qPCR	  results	  are	  given	  in	  bold	  	  Gene	  Function	   Contig	   Putative	  ID	  Lady	  leaf	  Lady	  flower	  Grosso	  leaf	  Grosso	  flower	  e123-­‐1	  leaf	  e123-­‐3	  leaf	  e47-­‐3	  leaf	  e47-­‐5	  leaf	   28	  leaf	  28	  flower	  417	  leaf	  417	  flower	  terpene	  synthases	  contig	  7411	   linalool	  synthase	   0	   78.35	   0	   125.44	   	   	   	   	   	   	   	   	  terpene	  synthases	  contig	  1740	  monoterpene	  synthase-­‐like	  protein	   0	   79.01	   0	   126.49	   100.77	   	   95.96	   83.12	   114.75	   qPCR	   	   	  	  terpene	  synthases	  contig	  1741	  monoterpene	  synthase-­‐like	  protein	   0	   197.52	   0	   316.23	   	   	   239.91	   207.81	   	  	   	  	   	   	  	  terpene	  synthases	  contig	  1742	   linalool	  synthase	   0	   41.86	   0	   346.29	   	  	   	  	   	  	   	  	   	  	   	  	   	   	  	  Cloned	  genes	   	  	   Cineole	  synthase	   	  	   	  	   qPCR	   qPCR	   	  	   	  	   	  	   	  	   qPCR	   qPCR	   qPCR	   qPCR	  	   	  	  Borneol	  dehydrogenase	   	  	   	  	   qPCR	   qPCR	   qPCR	   qPCR	   qPCR	   qPCR	   qPCR	   qPCR	   	  	   	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	   86	  Table	  4.6.	  Expression	  levels	  of	  genes	  identified	  as	  differentially	  expressed	  candidates	  in	  wild-­‐type	  plants	  expressed	  as	  mean	  fold	  change	  as	  determined	  by	  qPCR	  analysis.	  Different	  letters	  indicate	  statistical	  significance	  by	  ANOVA	  with	  alpha	  =	  0.05.	  Results	  that	  significantly	  support	  results	  obtained	  from	  transcriptome	  profiling	  are	  bolded.	  	  	  Gene Function Contig Putative ID Grosso Flower Grosso Leaf Lady Flower Lady Leaf transcription factor contig 17057 transcriptional factor wrky i   1.93a 7.60b 8.24b transcription factor contig 14504 ethylene response factor erf6 0.08a 0.39a 0.04a 0.36a transcription factor contig 10411 ap2-like protein 0.29a 0.57a 0.27a 0.62a transcription factor contig 17452 ap2-type transcription factor   1.10a 0.60ab 0.10b transcription factor contig 5015 transcription factor bhlh71 0.20ab 0.94a 0.20b 0.28b               isoprenoid biosynthesis contig 10341 3-hydroxy-3-methylglutaryl-coenzyme a reductase 9.11b 2.62a 8.80b 1.53a isoprenoid biosynthesis contig 10355 3-hydroxy-3-methylglutaryl-coenzyme a reductase 3.41a 1.82a 5.14a 1.28a isoprenoid biosynthesis contig 15232 3-hydroxy-3-methylglutaryl-coenzyme a reductase 1 0.59a 2.41a 0.77a 0.70a isoprenoid biosynthesis contig 2579 mevalonate diphosphate decarboxylase 0.49a 1.27a 0.97a   isoprenoid biosynthesis contig 2580 mevalonate diphosphate decarboxylase 0.54ab 2.01a 1.32ab 0.28b isoprenoid biosynthesis contig 9781 3-hydroxy-3-methylglutaryl-coenzyme a reductase   2.04a  0.20b               terpene synthases contig 1894 terpene synthase 6 263.81a 28.56a 2492.21b 186.33a terpene synthases contig 2929 linalool synthase (UTPS4) 2.88b 3.16b 23.54a 0.12b 	  	  	   87	  Table	  4.6.	  Expression	  levels	  of	  genes	  identified	  as	  differentially	  expressed	  candidates	  in	  wild-­‐type	  plants	  expressed	  as	  mean	  fold	  change	  as	  determined	  by	  qPCR	  analysis.	  Different	  letters	  indicate	  statistical	  significance	  by	  ANOVA	  with	  alpha	  =	  0.05.	  Results	  that	  significantly	  support	  results	  obtained	  from	  transcriptome	  profiling	  are	  bolded.	  	  	  Gene Function Contig Putative ID Grosso Flower Grosso Leaf Lady Flower Lady Leaf terpene synthases contig 2521 linalool synthase 0.55a 1.42b 0.30a 0.03a terpene synthases contig 7138 bicyclogermacrene synthase 34.50ab 1.21a 1.94ab 0.48b terpene synthases contig 3866 terpene synthase 3 5.43a 1.18ab 0.93ab 0.13b terpene synthases contig 7139 bicyclogermacrene synthase 55.52a 1.28ab 3.26ab 0.88b terpene synthases contig 7765 copalyl diphosphate synthase partial 10.89a 0.54b 1.53b 0.26b terpene synthases contig 1895 terpene synthase 6 1.38a 0.37ab 0.21ab 0.01b terpene synthases contig 2279 cadinol synthase (CADS) 0.34ab 0.69a 0.16ab 0.02b terpene synthases contig 2520 monoterpene synthase-like protein 128.0b 2.04a 57.89a 2.61a terpene synthases contig 2522 linalool synthase (UTPS2) 0.79a 1.16a 0.05b 0.03b terpene synthases contig 4905 limonene synthase 0.28b 1.61a 0.77ab 0.00b terpene synthases contig 7411 linalool synthase 437.71a 1.56b 519.02a 0.99b terpene synthases contig 1740 monoterpene synthase-like protein 487.27a 0.79b 102.20a 0.05c terpene synthases contig 1741 monoterpene synthase-like protein 2294.02a 3.00b 0.37b 0.02b terpene synthases contig 1742 linalool synthase 202.10a 0.62b 123.70a 0.26b 	  	  	  	   88	  Table	  4.7.	  Expression	  levels	  of	  genes	  identified	  as	  differentially	  expressed	  candidates	  in	  leaves	  of	  mutant	  plants	  expressed	  as	  mean	  fold	  change	  normalized	  to	  wild-­‐type	  Grosso	  leaf	  as	  determined	  by	  qPCR	  analysis.	  Statistical	  significance	  as	  compared	  to	  wild-­‐type	  Grosso	  leaf	  by	  ANOVA	  is	  indicated	  by	  *	  (p	  <	  0.05)/**	  (p	  <	  0.01).	  Results	  that	  significantly	  support	  results	  obtained	  from	  transcriptome	  profiling	  are	  bolded.	  	  Gene Function Contig Putative ID e123-1 leaf e123-3 leaf e47-3 leaf e47-5 leaf 28 leaf transcription factor contig 17057 transcriptional factor wrky i 1.68 2.99     transcription factor contig 14504 ethylene response factor erf6   3.63  0.95 transcription factor contig 10411 ap2-like protein 1.80 1.83 1.40 8.60* 0.48 transcription factor contig 17452 ap2-type transcription factor     1.85 transcription factor contig 4954 WRKY14 0.26      transcription factor contig 6102 wrky transcription factor    2.27                   isoprenoid biosynthesis contig 10341 3-hydroxy-3-methylglutaryl-coenzyme a reductase 0.64 0.42 0.64 0.99 0.76 isoprenoid biosynthesis contig 10355 3-hydroxy-3-methylglutaryl-coenzyme a reductase 0.93 0.86 1.39 1.64 1.14 isoprenoid biosynthesis contig 15232 3-hydroxy-3-methylglutaryl-coenzyme a reductase 1 0.20 0.73 0.00* 0.46 1.14 isoprenoid biosynthesis contig 2579 mevalonate diphosphate decarboxylase 0.44 0.70     isoprenoid biosynthesis contig 2580 mevalonate diphosphate decarboxylase 0.26      isoprenoid biosynthesis contig 9781 3-hydroxy-3-methylglutaryl-coenzyme a reductase 0.08 1.83   1.02                 terpene synthases contig 2929 linalool synthase (UTPS4) 8.02* 4.62     terpene synthases contig 2521 linalool synthase  2.67*     terpene synthases contig 7138 bicyclogermacrene synthase 0.40 1.13 2.09 3.23 7.94** 	  	   89	  Table	  4.7.	  Expression	  levels	  of	  genes	  identified	  as	  differentially	  expressed	  candidates	  in	  leaves	  of	  mutant	  plants	  expressed	  as	  mean	  fold	  change	  normalized	  to	  wild-­‐type	  Grosso	  leaf	  as	  determined	  by	  qPCR	  analysis.	  Statistical	  significance	  as	  compared	  to	  wild-­‐type	  Grosso	  leaf	  by	  ANOVA	  is	  indicated	  by	  *	  (p	  <	  0.05)/**	  (p	  <	  0.01).	  Results	  that	  significantly	  support	  results	  obtained	  from	  transcriptome	  profiling	  are	  bolded.	  	  Gene Function Contig Putative ID e123-1 leaf e123-3 leaf e47-3 leaf e47-5 leaf 28 leaf terpene synthases contig 3866 terpene synthase 3  2.12**    terpene synthases contig 7139 bicyclogermacrene synthase 0.52 1.07 2.24 4.51 0.86 terpene synthases contig 7765 copalyl diphosphate synthase partial 0.71 2.11 1.50 3.06* 2.40 terpene synthases contig 1895 terpene synthase 6  3.31*     terpene synthases contig 2279 Cadinol Synthase (CADS)  0.45     terpene synthases contig 2520 monoterpene synthase-like protein 8.39* 4.73 4.17 3.34 1.52 terpene synthases contig 4905 limonene synthase  1.33     terpene synthases contig 1740 monoterpene synthase-like protein 142.30 49.49 51.26 69.71 18.02 terpene synthases contig 1741 monoterpene synthase-like protein   5.94 8.64   Cloned genes   Cineole synthase         12.75    Borneol dehydrogenase 1.54 2.18 1.63 4.32* 1.86 	  	  	  	  	  	  	  	  	  	   90	  Table	  4.8.	  Expression	  levels	  of	  genes	  identified	  as	  differentially	  expressed	  candidates	  in	  tissues/plants	  for	  which	  there	  is	  no	  RNA-­‐Seq	  data	  available	  expressed	  as	  mean	  fold	  change	  normalized	  to	  wild-­‐type	  Grosso	  leaf	  as	  determined	  by	  qPCR	  analysis.	  Statistical	  significance	  as	  compared	  to	  wild-­‐type	  Grosso	  leaf	  by	  ANOVA	  is	  indicated	  by	  *	  (p	  <	  0.05)/**	  (p	  <	  0.01).	  Results	  that	  significantly	  support	  results	  obtained	  from	  transcriptome	  profiling	  are	  bolded.	  	  Gene Function Contig Putative ID 28 flower 417 leaf 417 flower transcription factor contig 17057 transcriptional factor wrky i   2.28 2.28* transcription factor contig 14504 ethylene response factor erf6 1.45 0.58 4.20 transcription factor contig 10411 ap2-like protein 1.17 0.89 0.34 transcription factor contig 17452 ap2-type transcription factor 1.55 1.34 2.62* transcription factor contig 5015 transcription factor bhlh71   1.05 1.73 transcription factor contig 4954 WRKY14   1.39 2.93 transcription factor contig 6102 wrky transcription factor   1.61 3.98             isoprenoid biosynthesis contig 10341 3-hydroxy-3-methylglutaryl-coenzyme a reductase 0.47**    isoprenoid biosynthesis contig 10355 3-hydroxy-3-methylglutaryl-coenzyme a reductase 0.72    isoprenoid biosynthesis contig 15232 3-hydroxy-3-methylglutaryl-coenzyme a reductase 1 1.63    isoprenoid biosynthesis contig 9781 3-hydroxy-3-methylglutaryl-coenzyme a reductase 0.91                terpene synthases contig 7138 bicyclogermacrene synthase 0.02    terpene synthases contig 7139 bicyclogermacrene synthase 0.33    	  	  	   91	  	  Table	  4.8.	  Expression	  levels	  of	  genes	  identified	  as	  differentially	  expressed	  candidates	  in	  tissues/plants	  for	  which	  there	  is	  no	  RNA-­‐Seq	  data	  available	  expressed	  as	  mean	  fold	  change	  normalized	  to	  wild-­‐type	  Grosso	  leaf	  as	  determined	  by	  qPCR	  analysis.	  Statistical	  significance	  as	  compared	  to	  wild-­‐type	  Grosso	  leaf	  by	  ANOVA	  is	  indicated	  by	  *	  (p	  <	  0.05)/**	  (p	  <	  0.01).	  Results	  that	  significantly	  support	  results	  obtained	  from	  transcriptome	  profiling	  are	  bolded.	  Gene Function Contig Putative ID 28 flower 417 leaf 417 flower terpene synthases contig 7765 copalyl diphosphate synthase partial 1.18   terpene synthases contig 2520 monoterpene synthase-like protein 0.53    terpene synthases contig 1740 monoterpene synthase-like protein 0.79      Cineole synthase 1.12 0.10 0.02* Cloned genes   Borneol dehydrogenase 0.64     	  	   92	  4.4. 	  Discussion	  	  5. To	  date	  the	  mechanisms	  governing	  regulation	  and	  biosynthesis	  of	  the	  mono-­‐	  and	  sesquiterpenes,	  which	  comprise	  the	  majority	  of	  plant	  essential	  oils,	  are	  still	  not	  fully	  understood.	  Though	  many	  terpene	  synthases	  have	  been	  identified	  across	  essential	  oil	  producing	  species	  and	  in	  lavender,	  there	  still	  remain	  unanswered	  questions	  in	  their	  biosynthetic	  pathways.	  In	  some	  cases	  the	  enzymes	  leading	  to	  production	  of	  specific	  compounds	  are	  not	  yet	  known,	  as	  is	  the	  case	  for	  linalyl	  acetate,	  which	  is	  hypothesized	  to	  be	  produced	  from	  linalool	  using	  a	  linalool	  acetyl	  transferase	  though	  this	  gene	  is	  yet	  to	  be	  identified.	  In	  other	  cases	  an	  enzyme	  has	  been	  cloned	  and	  functionally	  characterized	  which	  performs	  a	  specific	  conversion	  but	  has	  low	  efficiency	  or	  poor	  specificity	  suggesting	  that	  there	  may	  be	  another	  version	  of	  this	  enzyme	  which	  is	  primarily	  responsible	  for	  the	  conversion	  and	  the	  identified	  gene	  is	  only	  a	  minor	  contributor.	  This	  is	  thought	  to	  be	  the	  case	  for	  the	  dehydrogenation	  of	  boreol	  to	  camphor,	  which	  is	  hypothesized	  to	  be	  catalyzed	  by	  a	  borneol	  dehydrogenase	  in	  lavender,	  however,	  the	  only	  gene	  cloned	  to	  date	  was	  slow	  indicating	  that	  other	  borneol	  dehydrogenases	  may	  also	  be	  present	  in	  lavenders	  (Sarker	  et	  al.	  2012).	  	  6. There	  is	  very	  little	  known	  about	  the	  mechanisms	  which	  regulate	  the	  production	  of	  mono-­‐	  and	  sesquiterpenes.	  In	  fact	  regulation	  of	  the	  terpenes	  is	  the	  most	  poorly	  studied	  of	  all	  the	  secondary	  metabolites,	  though	  it	  is	  well	  known	  that	  this	  is	  a	  highly	  controlled	  process	  as	  they	  are	  produced	  only	  in	  very	  specific	  tissues	  and	  in	  response	  to	  specific	  triggers	  which	  include	  developmental,	  abiotic	  and	  biotic	  cues	  (Quaglia	  et	  al.	  2012;	  Vranova	  et	  al.	  2012;	  Patra	  et	  al.	  2013).	  As	  yet	  	  	   93	  three	  families	  of	  transcription	  factors	  have	  been	  implicated	  in	  transcriptional	  regulation	  of	  terpene	  biosynthesis:	  WRKY,	  bHLH	  and	  AP2-­‐EREBP/AP2-­‐ERF	  (Pérez-­‐Rodríguez	  et	  al.	  2010;	  Hong	  et	  al.	  2012;	  Yang	  et	  al.	  2012;	  Patra	  et	  al.	  2013).	  The	  majority	  of	  the	  work	  done	  has	  focused	  on	  the	  transcription	  factor	  families	  involved	  in	  production	  of	  larger	  terpenes	  with	  even	  less	  known	  about	  regulation	  of	  monoterpene	  production.	  These	  include	  studies	  which	  have	  elucidated	  some	  of	  the	  mechanisms	  regulating	  the	  production	  of	  the	  anti-­‐malarial	  artemisinin,	  an	  important	  medicinal	  sesquiterpene	  in	  sweet	  wormwood	  (Artemisia	  annua),	  which	  involve	  the	  AP2	  family,	  and	  the	  production	  of	  paclitaxel	  	  in	  Taxus	  species	  by	  WRKY	  and	  AP2-­‐EREBP	  family	  transcription	  factors	  for	  latex	  in	  the	  rubber	  tree	  (Hevea	  brasiliensis)	  	  (Patra	  et	  al.	  2013).	  This	  leaves	  a	  gap	  in	  knowledge	  that	  is	  important	  to	  investigate	  as	  a	  greater	  understanding	  of	  regulation	  of	  biosynthesis	  of	  important	  medicinal,	  commercial	  and	  ecologically	  valuable	  compounds	  such	  as	  the	  monoterpenes	  hold	  the	  potential	  to	  improve	  efforts	  for	  commercial	  production	  of	  compounds,	  for	  production	  of	  improved	  commercial	  cultivars,	  and	  for	  species	  conservation.	  	  	  7. There	  were	  three	  main	  objectives	  for	  this	  chapter,	  (1)	  create	  a	  draft	  transcriptome	  for	  lavender,	  (2)	  to	  perform	  RNA	  sequencing	  on	  wild-­‐type	  and	  mutant	  lavender	  plants,	  and	  (3)	  to	  use	  the	  results	  from	  objectives	  one	  and	  two	  to	  identify	  gene	  candidates	  which	  may	  be	  responsible	  for	  the	  different	  essential	  oil	  chemotypes	  seen	  between	  two	  wild-­‐type	  lavender	  species	  and	  mutants	  of	  Grosso	  lavandin.	  The	  gene	  candidates	  identified	  in	  objective	  three	  can	  then	  be	  	  	   94	  used	  in	  future	  studies	  to	  examine	  their	  potential	  roles	  as	  novel	  terpene	  synthases	  or	  as	  regulatory	  elements	  implicated	  in	  the	  resultant	  chemotype.	  	  8. 	  9. Despite	  short	  (27	  bp)	  Illumina©	  reads,	  de	  novo	  assembly	  showed	  adequate	  assembly	  with	  10%	  of	  reads	  assembled	  into	  contigs,	  to	  give	  a	  total	  of	  17,003	  contigs	  After	  read	  mapping	  to	  de	  novo	  assembly	  (with	  minimum	  contig	  length	  of	  300)	  the	  de	  novo	  library	  was	  found	  to	  give	  much	  better	  mapping	  with	  approximately	  60%	  more	  reads	  mapped	  than	  was	  seen	  in	  the	  EST	  library	  (Table	  4.4).	  This	  suggests	  that	  this	  a	  good	  quality	  draft	  transcriptome	  but	  the	  low	  number	  of	  reads	  assembled	  indicates	  that	  there	  is	  still	  room	  for	  improvement.	  This	  could	  be	  accomplished	  by	  additional	  sequencing	  of	  samples	  using	  longer	  reads	  and	  acquiring	  paired	  end	  data,	  which	  have	  both	  been	  shown	  to	  improve	  assembly.	  The	  read	  length	  used	  in	  these	  experiments	  for	  sequencing	  is	  exceptionally	  short,	  due	  to	  restrictions	  in	  available	  resources,	  with	  Illumina	  sequencing	  being	  capable	  of	  acquiring	  reads	  as	  long	  as	  1	  kb.	  The	  assembly	  of	  a	  lavender	  genome	  would	  also	  significantly	  improve	  assembly	  allowing	  for	  its	  use	  as	  a	  scaffold	  against	  which	  to	  assemble	  the	  transcriptome.	  GO	  mapping	  was	  used	  to	  visualize	  distribution	  of	  gene	  families	  (Figure	  4.2)	  to	  ensure	  no	  gene	  families	  showed	  unexpectedly	  high	  representation.	  GO	  mapping	  by	  cellular	  component,	  biological	  process	  and	  molecular	  function	  as	  well	  as	  KEGG	  pathways	  showed	  that	  the	  functions	  with	  greatest	  representation	  had	  essential	  roles	  such	  as	  structural	  and	  energy	  acquisition	  and	  utilization.	  	  	  	   95	  10. Annotation	  with	  blastx	  was	  successful	  in	  annotating	  60%	  of	  the	  sequences	  in	  the	  draft	  transcriptome.	  	  11. Differential	  expression	  analysis	  performed	  for	  camphor	  mutants	  on	  the	  transcriptome	  data	  of	  individual	  mutant	  samples	  aligned	  to	  the	  EST	  library	  yielded	  seven	  differentially	  expressed	  candidates,	  which	  were	  relevant	  to	  terpene	  biosynthesis	  including	  two	  precursor	  enzymes	  –	  HMGR	  and	  HMGS,	  CADS	  and	  four	  unknown	  terpene	  synthases	  (UTPS	  1-­‐4)	  for	  which	  no	  cloning	  and	  functional	  characterization	  has	  been	  performed.	  	  UTPS1	  was	  found	  not	  to	  be	  expressed	  in	  e123-­‐3	  but	  to	  have	  increased	  expression	  in	  e47-­‐3	  and	  28	  suggesting	  that	  it	  may	  not	  be	  a	  gene	  primarily	  responsible	  for	  the	  chemotypes	  shown	  as	  all	  three	  of	  these	  plants	  have	  the	  same	  oil	  profile	  and	  it	  is	  unlikely	  that	  one	  gene	  acts	  differently	  in	  these	  closely	  related	  plants.	  UTPS2,	  a	  linalool	  synthase	  candidate	  was	  found	  to	  have	  significantly	  increased	  expression	  levels	  in	  leaves	  of	  e47-­‐5	  and	  e47-­‐3	  and	  therefore	  may	  be	  a	  gene	  that	  merits	  further	  investigation	  to	  determine	  the	  identity	  of	  this	  EST	  library	  member.	  Increased	  expression	  of	  UTPS3	  and	  UTPS	  4	  was	  also	  seen	  in	  e47-­‐5	  and	  e123-­‐3	  respectively.	  Cadinol	  synthase	  (CADS)	  expression	  was	  found	  to	  be	  decreased	  in	  e123-­‐3	  but	  again	  was	  found	  to	  be	  upregulated	  in	  e47-­‐3,	  e47-­‐5,	  and	  28,	  which	  is	  unexpected	  as	  cadinol	  levels	  are	  the	  same	  in	  all	  of	  these	  plants.	  	  12. Differential	  expression	  proportions	  analysis	  performed	  in	  CLC	  Genomics	  Workbench	  using	  the	  de	  novo	  assembled	  draft	  transcriptome	  yielded	  several	  very	  promising	  candidates	  for	  future	  investigation	  as	  both	  terpene	  synthases	  and	  transcription	  factors	  that	  may	  be	  responsible	  for	  the	  varying	  chemotypes	  	  	   96	  seen	  in	  the	  mutant	  plants	  as	  well	  as	  several	  terpene	  synthase	  candidates	  that	  are	  as	  yet	  uncharacterized	  in	  wild-­‐type	  plants.	  Unfortunately,	  due	  to	  lack	  of	  replication	  this	  data	  cannot	  stand	  alone,	  and	  in	  fact	  some	  of	  the	  results	  from	  this	  proportions	  analysis	  contradict	  the	  qPCR	  data.	  This	  thesis	  will	  accept	  the	  qPCR	  data,	  which	  was	  performed	  with	  proper	  replication	  as	  more	  accurate	  than	  transcriptome	  analysis,	  which	  had	  no	  replication	  in	  all	  cases.	  In	  addition	  to	  determine	  if	  certain	  groups	  had	  unusually	  high	  numbers	  of	  members	  with	  differential	  expression	  in	  mutants	  a	  test	  for	  over-­‐	  or	  under-­‐representation	  of	  groups	  was	  performed	  in	  MapMan.	  All	  mutants	  for	  which	  differential	  expression	  analysis	  was	  performed	  were	  those	  possessing	  the	  camphor	  reduced	  phenotype,	  with	  one	  exception	  –	  EG	  417	  the	  mutant	  which	  possessed	  decreased	  cineole	  content	  in	  the	  floral	  oil.	  The	  Mapman	  analysis	  revealed	  50	  gene	  categories	  which	  were	  under	  or	  over	  represented.	  Of	  particular	  interest	  were	  seven	  of	  which	  were	  implicated	  in	  secondary	  metabolism	  or	  regulation.	  Genes	  in	  the	  secondary	  metabolism	  and	  isoprenoids	  bins	  were	  both	  found	  to	  be	  over	  represented	  in	  mutant	  28	  along	  with	  bZIP	  family	  transcription	  factors	  in	  e47-­‐5.	  Genes	  in	  co-­‐factor	  and	  vitamin	  metabolism	  and	  MYB	  transcription	  factor	  bins	  were	  found	  to	  be	  under-­‐represented	  in	  e123-­‐1.	  C3H	  family	  transcription	  factors	  were	  found	  to	  be	  underrepresented	  in	  e123-­‐3	  as	  well	  as	  Pseudo	  ARR	  family	  transcription	  factor	  families	  in	  e47-­‐3.	  The	  overrepresentation	  of	  differentially	  expressed	  secondary	  metabolism	  and	  isoprenoid	  bins	  in	  mutants	  is	  expected	  due	  to	  the	  observed	  modification	  in	  chemotype.	  The	  overrepresentation	  of	  bZIP	  family	  transcription	  factors	  suggests	  that	  members	  of	  this	  family	  may	  be	  associated	  	  	   97	  with	  this	  modification	  in	  metabolism,	  which	  decreases	  in	  other	  bins	  may	  be	  due	  to	  a	  lack	  of	  effect	  on	  these	  groups	  due	  to	  mutagenesis.	  	  Two	  transcription	  factors	  one	  WRKY	  and	  one	  bHLH	  family	  member	  showed	  decreased	  expression	  in	  the	  leaves	  of	  grosso	  as	  compared	  to	  lady,	  while	  one	  AP2-­‐type	  transcription	  factor	  showed	  the	  opposite	  trend,	  however,	  this	  trend	  was	  not	  seen	  in	  flowers.	  This	  suggests	  that	  these	  transcription	  factors,	  if	  they	  are	  in	  fact	  responsible	  for	  the	  different	  oil	  composition,	  may	  be	  involved	  in	  sesquiterpene	  production	  as	  the	  primary	  compounds	  found	  in	  the	  leaf	  oil	  versus	  the	  flower	  oil	  are	  sesquiterpenes	  such	  as	  cadinol.	  The	  trend	  of	  differential	  expression	  of	  sesquiterpene	  related	  genes	  between	  leaf	  samples	  in	  Lady	  as	  compared	  to	  Grosso	  is	  also	  reflected	  in	  two	  enzymes	  in	  the	  MVA	  pathway	  –	  HMGR	  and	  MVAPP	  decarboxylase	  (contig	  9781	  and	  2520	  respectively),	  suggesting	  that	  different	  isoforms	  of	  these	  enzymes	  may	  be	  used	  in	  different	  species.	  One	  HMGR	  candidate,	  contig	  10341	  shows	  significantly	  different	  expression	  between	  leaves	  and	  flowers,	  with	  significantly	  higher	  expression	  in	  flowers	  versus	  leaves,	  since	  sesquiterpenes	  are	  generally	  more	  abudndant	  in	  leaves	  this	  also	  suggests	  perhaps	  different	  isoforms	  are	  active	  in	  different	  tissues.	  	  The	  leaves	  and	  flowers	  of	  mutant	  plants	  showed	  the	  most	  promising	  transcription	  factor	  candidates.	  In	  particular	  the	  cineole	  deficient	  mutant	  EG	  417,	  which	  has	  significantly	  reduced	  expression	  of	  cineole	  synthase	  in	  the	  flowers	  and	  corresponding	  decreased	  cineole	  levels	  in	  the	  flower	  essential	  oil	  shows	  two	  transcription	  factors	  with	  increased	  expression	  in	  the	  flowers.	  In	  contrast	  significant	  differences	  in	  expression	  of	  transcription	  factors	  and	  cineole	  	  	   98	  synthase	  was	  not	  observed	  in	  the	  leaves	  of	  417.	  This	  is	  as	  expected	  as	  the	  leaf	  essential	  oil	  of	  this	  plant	  does	  not	  differ	  from	  wild-­‐type	  oil	  composition.	  Contig	  17057	  a	  WRKY	  types	  transcription	  factor	  and	  contig	  17452	  an	  AP2	  type	  protein	  are	  both	  expressed	  at	  more	  than	  double	  the	  levels	  found	  in	  wild-­‐type	  Grosso.	  As	  both	  cineole	  synthase	  and	  these	  transcription	  factors	  are	  differentially	  expressed,	  these	  transcription	  factors	  are	  good	  candidates	  to	  investigate	  possible	  interaction	  between	  them	  and	  the	  promoter	  region	  of	  cineole	  synthase.	  If	  these	  proteins	  were	  to	  function	  as	  suppressors	  of	  cineole	  synthase	  transcription	  this	  could	  explain	  the	  difference	  in	  cineole	  expression	  in	  the	  flowers	  as	  opposed	  to	  leaves	  in	  this	  mutant.	  One	  transcription	  factor	  was	  found	  to	  be	  upregulated	  in	  the	  leaves	  of	  e47-­‐5,	  a	  camphor	  leaf	  oil	  mutant	  which	  has	  very	  little	  camphor	  content	  in	  the	  leaves,	  as	  well	  as	  have	  increased	  expression	  of	  two	  terpene	  synthases	  in	  the	  leaves,	  copalyl	  diphosphate	  synthase	  (contig	  7765)	  a	  diterpene	  synthase	  and	  cineole	  synthase.	  Cineole	  content,	  however,	  is	  not	  significantly	  modified	  in	  this	  mutant	  suggesting	  that	  perhaps	  carbon	  supply	  is	  limiting	  cineole	  production,	  that	  cineole	  is	  being	  broken	  down	  or	  that	  some	  other	  mechanism	  is	  responsible	  for	  this	  lack	  of	  difference	  in	  cineole	  content.	  No	  diterpenes	  were	  identified	  in	  the	  leaf	  oil,	  therefore	  it	  is	  likely	  the	  enzyme	  encoded	  by	  contig	  7765	  catalyzes	  a	  different	  reaction.	  Mutant	  e47-­‐5	  also	  shows	  no	  expression	  of	  one	  HMGR	  candidate	  (contig	  15232)	  which	  may	  be	  related	  modified	  sesquiterpene	  content	  in	  the	  leaves,	  with	  decreased	  cadinol	  and	  increased	  bisabolol,	  though	  overall	  content	  is	  still	  less	  than	  the	  total	  amount	  in	  the	  wild-­‐type	  plant.	  	  	  	   99	  	  13. Of	  greatest	  interest	  is	  the	  differential	  expression	  patterns	  of	  genes	  identified	  as	  assembling	  into	  two	  linalool	  synthase	  contigs	  which	  show	  differential	  expression	  in	  leaves	  and	  flowers	  in	  both	  species,	  with	  high	  expression	  in	  flowers	  and	  almost	  no	  expression	  in	  leaves.	  As	  linalool	  concentrations	  are	  very	  high	  in	  flowers,	  being	  one	  of	  the	  major	  flower	  oil	  constituents	  and	  is	  generally	  absent	  in	  leaves	  this	  is	  strong	  evidence	  for	  these	  genes	  (contigs	  2520,	  2521,	  2522	  and	  contigs	  1740,	  1741,	  1742)	  encoding	  linalool	  synthase	  genes	  though	  BLAST	  homology	  shows	  only	  94%	  and	  86%	  homology	  to	  linalool	  synthases	  in	  L.	  latifolia	  and	  L.	  angustifolia	  (Landmann	  et	  al.	  2007).	  These	  genes	  may	  therefore	  represent	  new	  isoforms	  of	  linalool	  synthase	  in	  lavender,	  however,	  identity	  can	  only	  be	  confirmed	  by	  cloning,	  expression	  and	  functional	  characerization	  of	  the	  proteins	  encoded	  by	  these	  genes.	  Two	  contigs	  (7138	  and	  7139),	  which	  assembled	  into	  a	  putative	  germacrene	  synthase	  were	  differentially	  expressed	  between	  leaves	  of	  Grosso	  and	  Lady.	  As	  germacrene	  is	  a	  minor	  sesquiterpene	  constituent	  of	  Grosso	  leaves	  this	  is	  not	  unexpected	  and	  though	  this	  compound	  is	  not	  of	  great	  interest	  in	  lavender	  functional	  characterization	  of	  this	  candidate	  is	  likely	  to	  confirm	  this	  identity	  or	  to	  identify	  this	  gene	  as	  a	  related	  sesquiterpene	  synthase.	  Cadinol	  synthase	  was	  found	  to	  have	  highest	  expression	  in	  Grosso	  leaves,	  which	  is	  again	  as	  expected	  as	  it	  is	  found	  in	  high	  quantities	  in	  Grosso	  leaves	  but	  is	  not	  documented	  to	  be	  present	  at	  high	  levels	  in	  any	  other	  tissue.	  	  14. 	  	  	   100	  15. Only	  one	  terpene	  synthase	  was	  found	  to	  be	  differentially	  expressed	  in	  leaves	  of	  mutant	  28,	  the	  putative	  germacrene	  synthase	  in	  contig	  7138.	  This	  is	  in	  combination	  with	  decreased	  expression	  of	  only	  one	  gene	  in	  the	  flowers,	  an	  HMGR	  candidate	  (contig	  10341).	  As	  these	  are	  both	  related	  to	  sesquiterpene	  biosynthesis	  one	  or	  both	  may	  be	  responsible	  for	  the	  decreased	  sesquiterpene	  content	  in	  this	  mutant.	  Though	  germacrene	  synthase	  expression	  is	  not	  effected	  in	  any	  of	  the	  mutants,	  the	  sesquiterpene	  bisabolol	  shows	  increased	  expression	  –	  it	  is	  therefore	  possible	  that	  this	  enzyme	  may	  be	  a	  related	  sesquiterpene	  synthase	  	  that	  catalyzes	  the	  production	  of	  bisabolol	  instead	  of	  germacrene.	  16. Interestingly	  though	  camphor	  has	  been	  reduced	  in	  five	  of	  the	  mutant:	  e123-­‐1,	  e123-­‐3.	  E47-­‐3,	  e47-­‐5	  and	  28	  expression	  of	  the	  known	  borneol	  dehydrogenase,	  previously	  reported	  from	  L.	  angustifolia,	  was	  not	  effected	  except	  in	  e47-­‐5	  in	  which	  it	  was	  upregulated	  by	  more	  than	  four	  fold.	  Coupled	  with	  the	  high	  borneol	  content	  in	  these	  mutants,	  these	  results	  strongly	  implicate	  an	  alternative	  borneol	  dehydrogenase	  being	  present	  in	  these	  plants,	  which	  is	  primarily	  responsible	  for	  the	  reduction	  of	  borneol	  to	  camphor,	  though	  a	  differentially	  expressed	  dehydrogenase	  enzyme	  was	  not	  identified	  in	  this	  study,	  improvement	  of	  the	  draft	  transcriptome	  may	  lead	  to	  identification	  of	  this	  enzyme.	  	  17. Mutant	  e123-­‐3	  had	  the	  greatest	  number	  of	  differentially	  expressed	  terpene	  synthases	  with	  contig	  2521	  (linalool	  synthase),	  3866	  (TPS)	  and	  1895	  (TPS)	  all	  showing	  significantly	  increased	  expression.	  As	  neither	  of	  the	  latter	  candidates	  have	  good	  homology	  to	  known	  terpene	  synthases	  these	  contigs	  would	  be	  good	  candidates	  to	  explore	  as	  novel	  enzymes	  contributing	  to	  the	  unique	  oil	  	  	   101	  composition	  of	  this	  plant.	  Interestingly	  though	  this	  set	  of	  experiments	  did	  not	  find	  statistically	  significant	  overexpression	  of	  contig	  2929	  (UTPS4)	  in	  this	  mutant,	  the	  expression	  levels	  are	  approximately	  five	  times	  that	  of	  wild-­‐type	  and	  further	  experiments	  to	  decrease	  variability	  in	  replicates	  may	  lead	  to	  significant	  results	  as	  was	  seen	  in	  previous	  experiments	  (Figure	  4.3),	  this	  gene	  may	  therefore	  also	  be	  a	  good	  candidate	  for	  a	  causal	  mutation	  site.	  Mutant	  e123-­‐1	  also	  showed	  differential	  expression	  of	  two	  linalool	  synthase-­‐like	  candidates	  (contig	  2929	  and	  2520),	  however,	  since	  linalool	  is	  not	  present	  in	  the	  leaf	  oil	  of	  either	  of	  these	  mutants	  it	  is	  more	  likely	  that	  these	  enzymes	  are	  catalyzing	  the	  biosynthesis	  of	  a	  related	  monoterpene.	  No	  terpene	  synthase	  or	  transcription	  factor	  candidates	  were	  found	  to	  be	  differentially	  expressed	  in	  e47-­‐3.	  Though	  CADS	  expression	  levels	  were	  not	  found	  to	  be	  significantly	  different	  from	  wild-­‐type	  in	  e123-­‐3	  in	  these	  experiments,	  it	  was	  found	  to	  have	  a	  fold	  change	  of	  0.45,	  which	  is	  in	  agreement	  from	  the	  previous	  set	  of	  qPCR	  experiments	  on	  EST	  members	  which	  found	  CADS	  to	  be	  significantly	  decreased	  in	  this	  same	  mutant.	  This	  makes	  sense	  as	  cadinol	  content	  is	  decreased	  in	  this	  plant	  but	  is	  not	  in	  agreement	  with	  what	  is	  seen	  in	  mutants	  e47-­‐3,	  e47-­‐5	  and	  28	  which	  all	  also	  show	  decreased	  cadinol	  content	  but	  have	  increased	  cadinol	  synthase	  expression.	  It	  is	  possible	  that	  these	  mutants,	  though	  having	  increased	  cadinol	  synthase	  expression	  may	  have	  a	  mutation	  present	  in	  an	  important	  structural	  motif	  or	  the	  active	  site	  of	  an	  enzyme	  which	  reduces	  its	  efficacy.	  	  18. 	  	  	   102	  19. These	  results	  provide	  a	  good	  starting	  point	  for	  further	  exploration	  of	  the	  molecular	  mechanisms	  dictating	  the	  chemotypes	  of	  these	  mutants,	  however,	  much	  work	  has	  yet	  to	  be	  done	  before	  the	  oil	  composition	  of	  wild-­‐type	  plants	  or	  mutants	  can	  be	  explained.	  In	  particular	  cloning	  and	  functional	  characterization	  of	  candidate	  terpene	  synthases	  is	  required	  as	  well	  as	  investigation	  of	  interaction	  of	  the	  differentially	  expressed	  transcription	  factors	  with	  the	  promoter	  regions	  of	  differentially	  expression	  terpene	  synthases	  or	  precursor	  pathway	  enzymes.	  After	  identification	  of	  these	  enzymes	  the	  next	  step	  is	  to	  confirm	  that	  these	  specific	  proteins	  are	  responsible	  for	  the	  observed	  chemotype,	  which	  would	  require	  either	  knock-­‐down	  by	  RNAi	  or	  rescue	  by	  viral	  induced	  or	  Agrobacterium	  transformation	  of	  wild-­‐type	  or	  mutant	  plants.	  As	  not	  all	  mutations	  will	  be	  due	  to	  a	  difference	  in	  expression	  levels,	  single	  nucleotide	  variant	  (SNV)	  analysis	  will	  also	  need	  to	  be	  performed	  on	  mutant	  plants	  as	  difference	  in	  essential	  oil	  composition	  could	  equally	  be	  due	  to	  a	  mutation	  effecting	  structure,	  folding	  or	  active	  site	  chemistry	  of	  the	  enzyme.	  Identification	  of	  genes	  harbouring	  high	  numbers	  of	  SNVs	  will	  help	  identify	  candidate	  genes,	  which	  may	  have	  been	  effected	  in	  this	  way.	  	  	  	  	  	  	  	  	   103	  Chapter	  5.	  Screening	  of	  lavender	  and	  mutant	  essential	  oil	  for	  modified	  biological	  activity	  	  5.1. 	  Abstract	  Commonly	  known	  as	  spotted	  wing	  Drosophila	  (SWD)	  Drosophila	  suzukii	  was	  first	  found	  in	  the	  North	  Okanagan	  in	  2009,	  and	  in	  the	  past	  5	  years	  has	  spread	  rapidly	  throughout	  the	  valley	  and	  is	  now	  a	  serious	  pest	  of	  tree	  fruit	  and	  berry	  crops	  in	  British	  Columbia	  (Thistlewood	  et	  al.	  2012).	  With	  currently	  available	  prevention	  protocols	  requiring	  significant	  and	  costly	  application	  of	  pesticides	  the	  potential	  activity	  of	  Grosso	  oils	  may	  have	  significant	  commercial	  and	  agricultural	  importance	  (Beers	  and	  Van	  Steenwyk	  2011).	  	  The	  biological	  activity	  of	  lavenders	  are	  most	  commonly	  attributed	  to	  their	  essential	  oils,	  therefore	  any	  modifications	  to	  the	  oil	  composition	  of	  a	  particular	  plant	  has	  the	  potential	  to	  have	  a	  significant	  impact	  on	  its	  biological	  activity.	  Three	  different	  cultivars	  of	  lavender	  and	  two	  different	  tissue	  sources	  with	  differing	  oil	  composition	  as	  well	  as	  different	  commercially	  available	  essential	  oils	  were	  tested.	  For	  insecticidal	  activity,	  both	  fumigant	  and	  contact	  toxicity	  at	  concentrations	  ranging	  from	  0	  -­‐25	  %	  will	  be	  tested	  against	  the	  invasive	  agriculture	  pest	  Drosophila	  suzukii.	  	  5.2. 	  Methods	  5.2.4. Rearing	  Field	  collected	  adult	  D.	  suzukii	  were	  received	  in	  mixed	  culture	  from	  Susanna	  Acheampong	  at	  the	  Canadian	  Food	  Insepction	  Agency,	  Kelowna,	  British	  Columbia,	  in	  August	  of	  2013.	  Adult	  D.	  suzukii	  were	  identified,	  sexed	  and	  moved	  to	  vials	  containing	  a	  yeast	  based	  fly	  media	  containing	  10	  %	  sucrose,	  5	  %	  baker’s	  yeast,	  2	  %	  	  	   104	  agar,	  0.8	  %	  potassium	  sodium	  tartarate,	  0.1	  %	  potassium	  phosphate	  monobasic,	  0.05	  %	  sodium	  chloride,	  0.05	  %	  iron	  (III)	  sulfate,	  0.05	  %	  magnesium	  chloride,	  0.05	  %	  calcium	  chloride,	  0.07	  %	  methylparaben,	  0.45	  %	  propionic	  acid	  and	  0.03	  %	  o-­‐phosphoric	  acid.	  Flies	  were	  kept	  at	  ambient	  temperature	  under	  a	  16-­‐hour	  photoperiod	  and	  after	  an	  initial	  population	  was	  established	  at	  sufficient	  density	  (approx.	  40	  flies/vial)	  flies	  were	  moved	  every	  three	  days	  to	  new	  medium.	  	  	  5.2.5. Optimization	  of	  a	  method	  for	  testing	  fumigation	  toxicity	  and	  fumigation	  toxicity	  testing	  To	  test	  the	  susceptibility	  of	  D.	  suzukii	  adults	  to	  lavender	  essential	  oils	  in	  the	  volatile	  state	  thirty,	  four	  to	  seven	  day	  old	  adult	  flies	  were	  chilled	  at	  4oC	  and	  counted	  on	  ice	  then	  added	  to	  500	  mL	  canning	  jars	  along	  with	  either:	  (a)	  a	  35	  mm	  petri	  plate	  containing	  approximately	  2	  mL	  of	  Drosophila	  medium,	  (b)	  a	  filter	  paper	  circle	  moistened	  with	  deionized	  water	  or	  (c)	  nothing	  and	  covered	  by	  organza	  mesh	  and	  allowed	  to	  recover	  for	  approximately	  20	  minutes.	  Mortality	  was	  then	  recorded	  after	  24	  hours.	  	  	  For	  essential	  oil	  testing	  the	  above	  method	  was	  used	  with	  addition	  of	  a	  35	  mm	  petri	  plate	  containing	  approximately	  2	  mL	  of	  Drosophila	  medium.	  Oil	  was	  then	  directly	  applied	  to	  a	  25	  mm	  square	  of	  Whattman	  filter	  paper	  in	  a	  35	  mm	  petri	  plate	  affixed	  to	  the	  lid	  of	  the	  canning	  jar	  and	  which	  was	  placed	  on	  top	  of	  the	  mesh	  (Figure	  5.1).	  	  Oils	  tested	  are	  given	  in	  Table	  5.1.	  Eight	  concentration	  levels	  were	  tested:	  0,	  1,	  2,	  3,	  4,	  5,	  7.5	  and	  15	  μLoil/L	  air	  in	  triplicate.	  Mortality	  was	  then	  recorded	  at	  24	  hours.	  	  Half	  FE$!6+*,)6!.'/.+/*4)*0'/!CUh$EG!3)65+1!>+4+!.)6.56)*+(!78!<4'70*!4+24+110'/!)/)68101!510/2!DLDD!3##!C@Wg=!iDNG%!Y0254+!$%F%!V\<+40-+/*)6!1+*:5<!9'4!'<*0-0A)*0'/!)/(!*+1*0/2!95-02)*0'/!*'\0.0*8!'9!+11+/*0)6!'061!)2)0/1*!)(56*!95)'+<+=&&%!!&)76+!$%F%!e061!51+(!9'4!*+1*0/2=!1'54.+!*0115+!)/(!.'-<)/8%!e06Xh'/1*0*5+/*! &0115+!D'54.+! g)/59).*54+4XW4)/(!N3'.)('!Y450*! h,'1+/!Y''(1!@/.%!CD)/!b0+2'=!hNG!h0/+'6+! D*)/()4(! D02-):N6(40.,!Ch)/)()G!m:.)4+/+! D*)/()4(! D02-):N6(40.,!Ch)/)()G!U0/)6''6! D*)/()4(! D02-):N6(40.,!Ch)/)()G!R5B50!/5*! ^5*! V11+/*0)6!e061!&4)(0/2!L'1*!CiDNG!4(/(*2+1()(*7+'#&631&()Y6'>+4! eB)/)2)/!U)3+/(+4!T+47!Y)4-!CR+6'>/)=!WhG!4(/(*2+1()1(#&631&(!.3!g+(0B51! Y6'>+4! Y%!L%!@%!D)6+1!Cb+6*)=!WhG!4(/(*2+1(!\!&*#$"%$2&(!.3!_4'11'! Y6'>+4! Y%!L%!@%!D)6+1!Cb+6*)=!WhG!4(/(*2+1(!\!&*#$"%$2&(!.3!_4'11') U+)9! b01*066+(!4(/(*2+1(!\!&*#$"%$2&(!.3!L4'3+/.+) Y6'>+4! b01*066+(!4(/(*2+1(!\!&*#$"%$2&(!.3!L4'3+/.+) U+)9! b01*066+(!g).)()-0)!/5*! ^5*! U09+:96'!CiDNG!^++-! R+4/+6! +7)8!CiDNG!2">"D" +)*/-'/#/)C%'%/;#&'!*+1*!*,+!151.+<*07060*8!'9!95)'+<+=&&)*'!(04+.*!+\<'154+!*'!6)3+/(+4!+11+/*0)6!'061!*,04*8=!9'54!*'!1+3+/!()8!'6(!)(56*!960+1!>+4+!.,066+(!)*!`'h!)/(!.'5/*+(!'5*!'/!0.+!	  	   106	  and	  transferred	  to	  oil	  exposure	  chambers	  (250	  mL	  baby	  food	  jars	  lined	  with	  blotting	  paper	  to	  create	  an	  ~100	  mL	  exposure	  chamber)	  (Figure	  5.2).	  Oil	  was	  diluted	  to	  the	  8	  test	  concentrations:	  0,	  0.5,	  1,	  2.5,	  5,	  10,	  20	  and	  40%	  oil	  in	  acetone	  and	  0.5	  mL	  of	  each	  solution	  was	  applied	  to	  flies	  in	  exposure	  chambers	  using	  a	  piston	  style	  manual	  pump	  sprayer	  (modified	  from	  Beers	  et	  al.	  2011).	  Flies	  were	  then	  transferred	  to	  vials	  with	  approximately	  15	  mL	  of	  fly	  media	  and	  mortality	  was	  recorded	  after	  24	  hours.	  Each	  treatment	  was	  repeated	  in	  triplicate.	  Oils	  tested	  were	  the	  same	  as	  for	  fumigation	  toxicity	  assays	  (Table	  5.1).	  Half	  lethal	  concentration	  (LC50)	  values	  were	  calculated	  by	  probit	  regression	  analysis	  using	  SPSS	  v22	  (IBM,	  USA)	   	  	  Figure	  5.2.	  Exposure	  chambers	  used	  for	  contact	  toxicity	  testing	  of	  lavender	  essential	  oils	  against	  adult	  D.	  suzukii.	  	  	  	   107	  5.2.7. Oviposition	  deterrent	  activity	  	  The	  ability	  of	  lavender	  essential	  oils	  to	  prevent	  oviposition	  of	  D.	  suzukii	  in	  blueberries	  was	  determined	  by	  the	  following	  procedure	  (adapted	  from	  Beers	  et	  al.	  2011).	  Cotton	  balls	  were	  dipped	  in	  sterile	  5%	  sucrose	  solution	  and	  then	  placed	  in	  the	  bottom	  of	  Drosophila	  vials.	  Blueberries	  (store	  bought,	  organic)	  were	  then	  washed,	  allowed	  to	  dry	  and	  then	  dipped	  for	  3s	  into	  3	  mL	  of	  oil	  solutions	  of	  0,	  1,	  5,	  10	  or	  20%,	  using	  acetone	  as	  a	  solvent.	  Blueberries	  were	  then	  allowed	  to	  dry	  on	  blotting	  paper	  and	  once	  dry	  were	  placed	  in	  tubes	  (1	  berry/vial).	  All	  oil	  concentrations	  were	  performed	  with	  five	  replicates.	  Five	  female	  and	  three	  male	  four	  to	  seven	  day	  old	  D.	  suzukii	  adults	  were	  then	  added	  to	  each	  vial	  which	  was	  sealed	  with	  mesh	  using	  an	  elastic	  band.	  Vials	  were	  then	  kept	  in	  a	  controlled	  environment	  chamber	  at	  25oC,	  16	  hour	  photoperiod	  for	  48	  hours.	  Flies	  were	  then	  chilled	  and	  berries	  were	  removed	  from	  vials.	  The	  number	  of	  oviposition	  marks	  on	  each	  berry	  was	  counted	  under	  a	  dissecting	  microscope	  and	  recorded.	  Oils	  tested	  were	  the	  same	  as	  for	  toxicity	  assays	  (Table	  5.1).	  Average	  number	  of	  oviposition	  marks	  and	  standard	  error	  was	  plotted	  and	  calculated	  in	  GraphPad	  Prism	  6	  (USA)	  (Figure	  5.6). 	   	  	   108	  	  Figure	  5.3.	  Experimental	  set-­‐up	  for	  testing	  oviposition	  deterrent	  activity	  of	  lavender	  essential	  oils.	  	  	  5.3. 	  Results	  	  	  To	  optimize	  survival	  of	  flies	  under	  control	  conditions	  three	  possible	  experimental	  apparatuses	  were	  tested	  –	  control	  with	  no	  additions,	  control	  with	  Drosophila	  medium	  added	  and	  control	  with	  increased	  humidity,	  accomplished	  by	  added	  a	  moistened	  filter	  paper	  to	  the	  bottom	  of	  the	  jar.	  While	  the	  control	  jar	  with	  no	  additions	  showed	  poor	  survival	  both	  of	  the	  modified	  controls	  showed	  close	  to	  100%	  survival	  (Figure	  5.4).	  	  	  FE"!Y0254+!$%`%!L+4.+/*!154303)6!'9!DPb!5/(+4!.'/*4'6!.'/(0*0'/1!C/'*,0/2!)((+(G=!>0*,!9"3'3:;&1(!-+(05-!)((+(!C.'/*4'6!>0*,!9''(G!)/(!>0*,!()-<!906*+4!<)<+4!)((+(!C.'/*4'6!>0*,!,5-0(0*8G%!e06!>)1!(01*066+(!94'-!*,+!96'>+41!)/(!'9!4(/(*2+1(!\!&*#$"%$2&(!.3!L4'3+/.+!)/(!6+)3+1!'9!4(/(*2+1(!\!&*#$"%$2&(!.3!_4'11'!78!1*+)-!(01*066)*0'/!)/(!)/)68A+(!78!_h:gD!)/(!4+6)*03+!<+4.+/*!.'-<'10*0'/!>)1!.)6.56)*+(!C&)76+!#G%!&,+!'06!.'-<'10*0'/!9'4!)66!'*,+4!'061!01!4+)(068!)3)06)76+!+0*,+4!0/!*,+!60*+4)*54+!'4!'/!*,+!<).B)20/2!'9!*,+!'06!CP'4'/5B!+*!)6%!#EFEJ!b4+,+4!)/(!b)3+/<'4*!#EFMG%!N1!*,+!.'-<'10*0'/!'9!*,+!6+)9!+11+/*0)6!'06!94'-!*,+!*>'!0/*+4-+(0)!1<+.0+1!51+(!0/!*,01!1*5(8!,)3+!/'*!7++/!<4+30'5168!4+<'4*+(!*,+!+11+/*0)6!'06!<4'906+!>)1!(+*+4-0/+(!78!_h:gD!)/)68101%!&,+1+!4+156*1!1,'>+(!*,)*!*,+!'06!94'-!_4'11'!6+)9!>)1!,02,!0/!*,+!-'/'*+4<+/+1!7'4/+'6!Ca:Fa!dG=!.)-<,'4!C#E:##!dG!)/(!F=a:.0/+'6+!CFM:#]!dG!)1!>+66!)1!*,+!1+1;50*+4<+/+!.)(0/'6!C#F:#"!dG%!&,+!<4'906+!'9!L4'3+/.+!6+)9!+11+/*0)6!'06!>)1!10-06)4!75*!,)(!-5.,!6'>+4!1+1;50*+4<+/+!.'/*+/*%!&,+!-)?'4!.'/1*0*5+/*1!0/!L4'3+/.+!+11+/*0)6!'06!>+4+!7'4/+'6=!.)-<,'4!)/(!F=a:.0/+'6+%!	  	   110	  Table	  2.	  Relative	  percent	  composition	  lavender	  essential	  oils	  tested	  (ISO)	  (Woronuk	  et	  al.	  2010)	  	  	   Lavandula	  angustifolia	  Lavandula	  latifolia	  Lavandula	  x	  intermedia	  cv	  Grosso	  Lavandula	  	  x	  intermedia	  cv	  Grosso	  Lavandula	  x	  intermedia	  cv	  Provence	  Lavandula	  x	  intermedia	  cv	  Provence	  	   Flower	   Flower	   Flower	   Leaf	   Leaf	   Flower	  Borneol	   1.0-­‐4.0	   -­‐	   1.5-­‐3	   8-­‐18	   24.1	   -­‐	  Cadinene	   -­‐	   -­‐	   -­‐	   1-­‐5	   -­‐	   -­‐	  Cadinol	   -­‐	   -­‐	   -­‐	   21	  -­‐	  29	   0.9	   -­‐	  Camphor	   trace	   12-­‐16	   6-­‐8	   20	  -­‐	  22	   9.22	   6-­‐8	  Carene	   -­‐	   -­‐	   -­‐	   1-­‐3	   1.5	   -­‐	  Caryophyllene	   -­‐	   -­‐	   -­‐	   0-­‐2	   -­‐	   -­‐	  1,8-­‐Cineole	   trace	   22-­‐27	   4-­‐7	   13-­‐27	   53.3	   4-­‐7	  Linalool	   25-­‐38	   27-­‐41	   24-­‐35	   -­‐	   trace	   25-­‐35	  Linalyl	  acetate	  25-­‐45	   trace	   28-­‐38	   -­‐	   -­‐	   26-­‐38	  Ocimene	   3-­‐4	   trace	   0.5-­‐1.5	   -­‐	   trace	   trace	  Sabinene	   -­‐	   -­‐	   -­‐	   0-­‐2	   trace	   -­‐	  Terpinene	   -­‐	   -­‐	   -­‐	   0-­‐2	   -­‐	   -­‐	  Terpineol	   4-­‐5	   trace	   1.5-­‐5	   -­‐	   -­‐	   trace	  	  	  The	  most	  active	  compounds	  for	  fumigation	  assays	  were	  linalool	  (LC	  50	  1.85)	  and	  cineole	  (LC50	  10.71)	  while	  the	  most	  active	  whole	  oils	  were	  Lavandula	  latifolia	  (LC50	  3.79)	  and	  Lavandula	  x	  intermedia	  cv	  Provence	  (6.71).	  Macadamia	  nut,	  neem,	  avocado	  and	  kukui	  nut	  oils	  had	  no	  activity	  (Table	  5.3).	  	  	  Cineole	  (LC50	  0.54%)	  and	  ∂-­‐carene	  (LC50	  2.38%)	  were	  the	  most	  effective	  individual	  constituents	  in	  contact	  toxicity	  assays,	  and	  avocado	  (LC	  50	  0.54%),	  L.	  latifolia	  (LC50	  0.69%)	  and	  L.	  x	  intermedia	  cv	  Provence	  (LC50	  1.23%)	  were	  the	  most	  effective	  whole	  oils	  (Table	  5.4).	  Kukui	  nut	  oil	  showed	  no	  activity.	  	  	  	  	   111	  	  Oviposition	  repellency	  was	  determined	  by	  counting	  the	  number	  of	  oviposition	  (Figure	  5.5)	  marks	  on	  blueberries	  that	  had	  been	  dipped	  in	  either	  acetone	  or	  oil	  made	  up	  to	  desired	  concentrations	  in	  acetone.	  Blueberries	  were	  allowed	  to	  dry	  before	  being	  placed	  in	  vials	  with	  flies.	  No	  compounds	  tested	  showed	  complete	  repellency	  at	  low	  concentrations;	  however,	  many	  of	  the	  oils	  assayed	  showed	  a	  decreasing	  trend	  in	  oviposition	  with	  increasing	  oil	  concentration	  (Figure	  5.6).	  	  Macadamia	  nut	  oil	  had	  the	  strongest	  repellent	  effect	  with	  total	  repellence	  at	  5%	  oil	  and	  whole	  oils	  generally	  showed	  a	  stronger	  repellent	  effect	  than	  individual	  constituents	  lone	  and	  avocado,	  neem,	  provence	  and	  Grosso	  all	  showing	  significant	  reductions	  in	  oviposition	  (Figure	  5.6)	  	  	  Table	  5.3.	  Fumigation	  toxicity	  of	  lavender	  essential	  oils	  against	  4-­‐7	  day	  old	  D.	  suzukii	  adults,	  half	  lethal	  concentrations	  (LC50)	  and	  confidence	  intervals	  (CI)	  calculated	  by	  probit	  analysis	  (alpha	  =	  0.05)	  Oil	   Source	  LC50	  (uL	  oil/L	  air)	  	  (95%	  Confidence	  Interval)	  Avocado	   commercial	   no	  activity	  Cineole	   standard	   10.71	  (8.44,	  13.01)	  ∂-­‐carene	   standard	   9.47	  (8.36,	  10.58)	  Linalool	   standard	   1.85	  (1.48,	  2.12)	  Kukui	  nut	   commercial	   no	  activity	  Lavandula	  angustifolia	   flower	   8.14	  (7.65,	  8.59)	  Lavandula	  latifolia	   flower	   3.79	  (3.28,	  4.21)	  Lavandula	  x	  intermedia	  cv	  Grosso	   leaf	   8.22	  (7.40,	  9.01)	  Lavandula	  x	  intermedia	  cv	  Provence	   flower	   6.71	  (6.14,	  7.26)	  Lavandula	  x	  intermedia	  cv	  Provence	   leaf	   5.68	  (5.22,	  6.14)	  Macadamia	  nut	   commercial	   no	  activity	  Neem	   commercial	   no	  activity	  	  Table	  5.4.	  Contact	  toxicity	  of	  lavender	  essential	  oils	  against	  4-­‐7	  day	  old	  D.	  suzukii	  adults,	  half	  lethal	  concentrations	  (LC50)	  and	  confidence	  intervals	  (CI)	  calculated	  by	  probit	  analysis	  (alpha	  =	  0.05)	  Oil	   Source	  LC50	  (%)	  	  (95%	  Confidence	  Interval)	  Avocado	   commercial	   0.54	  (0.03,	  1.40)	  Cineole	   standard	   0.67	  (0.13,	  1.41)	  ∂-­‐carene	   standard	   2.38	  (1.57,	  3.43)	  Linalool	   standard	   9.85	  (6.56,	  17.83)	  Kukui	  nut	   commercial	   no	  activity	  Lavandula	  angustifolia	   flower	   2.10	  (1.55,	  2.69)	  Lavandula	  latifolia	   flower	   0.69	  (0.29,	  1.12)	  Lavandula	  x	  intermedia	  cv	  Grosso	   flower	   7.21	  (4.22,	  12.58)	  Lavandula	  x	  intermedia	  cv	  Provence	   flower	   1.23	  (0.86,	  1.64)	  Macadamia	  nut	   commercial	   11.17	  (7.67,	  19.39)	  Neem	   commercial	   14.83	  (10.08,	  21.49)	  	  !! HH)!!*-.+8&!'('(!UVW!%#86#&!?#C=!06-E09-/-01!,#8O9!?$C!#17!&..!?3C!6-&P&7!+17&8!'B2!,#.1-5-3#/-01(!!!	  	   114	  	  Figure	  5.6.	  Oviposition	  deterrent	  activity	  of	  lavender	  essential	  oils	  against	  4-­‐7	  day	  old	  D.	  suzukii	  adults	  after	  48	  hours.	  	  	  5.4. 	  Discussion	  	  As	  would	  be	  expected	  oils	  containing	  high	  amounts	  of	  volatile	  compounds,	  including	  the	  monoterpenes,	  showed	  the	  greatest	  effect	  against	  SWD.	  Lavandula	  latifolia	  (spike	  lavender)	  showed	  the	  strongest	  effect	  of	  all	  oils	  tested	  (LC50	  3.79	  	  μLoil/L	  air),	  while	  the	  floral	  essential	  oil	  constituent	  linalool	  showed	  the	  greatest	  activity	  of	  all	  samples	  tested	  (LC50	  1.85	  uL/L	  air).	  Spike	  lavender	  oil	  is	  high	  in	  linalool	  and	  1,8-­‐cineole.	  The	  presence	  of	  linalool	  but	  also	  of	  the	  less	  potent,	  but	  still	  effective	  monoterpene	  1,8-­‐cineole,	  could	  explain	  the	  increased	  activity	  of	  this	  oil	  as	  compared	  with	  other	  oils.	  As	  would	  be	  expected	  the	  aromatic	  lavender	  essential	  oils	  and	  their	  constituents	  showed	  the	  highest	  activity	  as	  the	  volatility	  of	  these	  compounds	  facilitates	  	  	   115	  fumigation.	  	  The	  primary	  hindrance	  to	  the	  use	  of	  essential	  oils	  as	  pest	  control	  agents	  has	  been	  their	  cost,	  however,	  at	  the	  levels	  reported	  here	  this	  would	  likely	  not	  be	  a	  significant	  factor	  limiting	  their	  use	  for	  the	  control	  of	  SWD.	  Additionally	  the	  volatility	  of	  these	  essential	  oils	  means	  that	  they	  will	  not	  persist	  in	  the	  environment	  or	  on	  food	  crops,	  minimizing	  the	  concern	  of	  pesticide	  residues	  for	  human	  consumption	  and	  their	  impact	  on	  the	  surrounding	  environment	  making	  them	  safer	  alternatives	  to	  the	  existing	  pesticides	  available.	  The	  trend	  observed	  in	  the	  fumigation	  toxicity	  assays	  in	  which	  volatile	  oils	  showed	  strongest	  activity	  was	  not	  observed	  in	  contact	  toxicity	  assays	  further	  confirming	  that	  the	  difference	  in	  activity	  is	  most	  likely	  due	  to	  the	  ability	  of	  those	  oils	  to	  volatilize.	  The	  commercially	  available	  avocado	  oil	  showed	  the	  greatest	  activity	  with	  LC50	  of	  0.54%,	  though	  this	  is	  still	  greater	  than	  the	  reported	  active	  concentrations	  for	  commercially	  available	  control	  agents	  such	  as	  spinosad	  which	  is	  active	  at	  concentrations	  of	  0.01%	  (Beers	  and	  Van	  Steenwyk	  2011).	  Significant	  activity	  was	  also	  seen	  from	  1,8-­‐cineole	  (0.67	  %)	  and	  spike	  lavender	  essential	  oil	  (0.69%),	  which	  in	  combination	  with	  the	  potent	  activity	  of	  spike	  lavender	  essential	  oil	  in	  the	  fumigation	  assays	  suggest	  the	  combine	  activity	  of	  spike	  lavender	  could	  hold	  good	  potential	  for	  control	  of	  SWD	  in	  a	  field	  setting.	  It	  is	  also	  of	  interest	  to	  note	  that	  the	  presence	  of	  a	  different	  primary	  active	  constituent	  in	  L.	  latifolia	  oils	  for	  each	  mode	  of	  toxicity	  indicates	  that	  these	  monoterpenes	  have	  different	  mechanisms	  for	  toxicity.	  Additionally	  the	  combined	  use	  of	  the	  non-­‐volatile	  avocado	  oil	  with	  the	  highly	  effect	  whole	  oil	  of	  L.	  latifolia	  could	  significantly	  improve	  each	  of	  the	  individual	  activities.	  Additionally	  as	  current	  control	  methods	  for	  stone	  fruits	  such	  as	  cherries	  recommended	  by	  Agriculture	  Canada	  requires	  the	  use	  of	  harsh	  insecticides	  such	  as	  diazanon	  or	  malathion	  the	  use	  of	  these	  oils	  as	  part	  of	  an	  integrated	  pest	  management	  program	  could	  reduce	  the	  environmental	  impact	  of	  using	  exclusively	  synthetic	  pesticides	  while	  still	  maintaining	  effective	  control.	  Extensive	  field	  trials	  are	  	  	   116	  required,	  however,	  before	  these	  products	  would	  be	  ready	  for	  application	  in	  this	  environment.	  Leaf	  essential	  oils	  were	  not	  tested	  in	  the	  contact	  bioassay	  due	  to	  difficulty	  in	  obtaining	  sufficiently	  large	  amounts	  and	  due	  to	  the	  poor	  activity	  in	  the	  fumigation	  toxicity	  assays	  they	  were	  deemed	  unlikely	  to	  be	  feasible	  control	  agents.	  	  Lastly	  the	  oviposition	  deterrent	  activity	  of	  these	  oils	  was	  tested	  in	  an	  assay	  adapted	  from	  Beers	  et	  al.	  2011.	  Though	  none	  of	  the	  oils	  showed	  powerful	  repellent	  activities,	  some	  repellency	  is	  suggested	  based	  on	  the	  results	  from	  all	  four	  floral	  essential	  oils	  tested	  as	  well	  as	  the	  commercial	  oils	  (Figure	  5.1).	  Though	  these	  activities	  are	  not	  significant,	  in	  conjunction	  with	  the	  reported	  toxicities	  this	  may	  augment	  the	  efficacy	  of	  oils	  such	  as	  spike	  lavender	  oil.	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	   117	  Chapter	  6.	  Conclusion	  	  	  The	  objectives	  of	  this	  research	  were	  to	  (1)	  develop	  an	  efficient	  protocol	  for	  regeneration	  and	  mutagenesis	  of	  L.	  x	  intermedia	  cv	  Grosso	  (2)	  generate	  unique	  essential	  oil	  mutants	  using	  this	  protocol	  (3)	  identify	  candidate	  genes	  effected	  by	  mutagenesis	  that	  lead	  to	  the	  unique	  chemotypes	  observed	  and	  (4)	  evaluate	  the	  biological	  activities	  (as	  related	  to	  insect	  control)	  of	  essential	  oils	  from	  wild	  type	  and	  improved	  lavender	  plants.	  	  	  Objective	  one	  was	  met	  through	  exploration	  of	  different	  growth	  parameters	  for	  tissue	  culture	  conditions	  including:	  light	  conditions,	  media	  type	  and	  concentration,	  growth	  regulators	  present,	  and	  reduction	  of	  explant	  browning.	  I	  hypothesized	  that	  by	  modifying	  these	  conditions	  regeneration	  efficiency	  of	  Grosso	  could	  be	  significantly	  improved.	  Chapter	  two	  identifies	  ideal	  culture	  conditions	  as	  using	  half	  strength	  WPM	  medium	  for	  rooting,	  and	  full	  strength	  MS	  for	  all	  other	  conditions,	  under	  white	  light.	  Addition	  of	  ascorbic	  acid	  a	  powerful	  antioxidant	  to	  all	  media	  types	  was	  found	  to	  significantly	  decrease	  browning.	  Other	  conditions	  tested	  such	  as	  addition	  of	  PVP	  or	  polyamines	  were	  found	  to	  decrease	  regeneration	  efficiency	  of	  Grosso.	  Objective	  one	  was	  therefore	  met	  and	  could	  be	  applied	  to	  achieve	  success	  in	  objective	  two.	  	  	  Using	  the	  protocol	  described	  in	  Chapter	  Three	  ten	  unique	  mutants	  were	  identified	  –	  nine	  essential	  oil	  mutants,	  and	  one	  with	  a	  unique	  growth	  pattern.	  RNA	  Sequencing	  performed	  in	  Chapter	  Four	  identified	  numerous	  candidate	  genes	  in	  mutants	  which	  showed	  unique	  expression	  patterns,	  indicating	  that	  the	  observed	  chemotypes	  were	  likely	  the	  result	  of	  mutations	  that	  affected	  the	  expression	  of	  these	  genes.	  There	  is	  much	  research	  that	  needs	  to	  be	  done	  to	  follow	  up	  with	  these	  	  	   118	  results.	  The	  work	  that	  has	  been	  done	  thus	  far	  has	  merely	  identified	  candidate	  genes	  for	  which	  only	  putative	  identifications	  are	  available	  based	  on	  closest	  homology	  to	  already	  known	  proteins.	  Follow	  up	  experiments	  are	  required	  to	  (1)	  confirm	  the	  identity	  of	  these	  proteins	  (2)	  confirm	  whether	  these	  differentially	  expressed	  genes	  do	  in	  fact	  cause	  the	  observed	  chemotype	  and	  (3)	  to	  explore	  other	  mutation	  types	  and	  targets.	  To	  address	  the	  first	  of	  these	  concerns,	  these	  genes	  must	  be	  cloned,	  expressed	  and	  functionally	  characterized	  using	  a	  microbial	  system	  such	  as	  E.	  coli	  or	  yeast.	  Purification	  and	  protein	  assays	  of	  these	  expressed	  genes	  can	  confirm	  the	  identity	  of	  the	  encoded	  proteins,	  and	  potentially	  identify	  new	  terpene	  synthase	  enzymes	  or	  transcription	  factors.	  Use	  of	  the	  yeast	  one-­‐hybrid	  system	  would	  allow	  investigation	  of	  potential	  interactions	  between	  transcription	  factors	  or	  interest	  and	  the	  differentially	  expressed	  terpene	  synthase	  enzymes.	  To	  confirm	  whether	  these	  identified	  candidates	  are	  responsible	  for	  the	  in	  vivo	  observed	  changes,	  an	  in	  vivo	  system	  must	  be	  used	  for	  confirmation.	  In	  the	  case	  of	  genes	  that	  have	  been	  knocked	  down	  RNAi	  silencing	  experiments	  could	  be	  used	  to	  knock	  these	  genes	  down	  in	  wild-­‐type	  plants	  and	  if	  the	  plant	  assumes	  the	  mutant	  chemotype	  then	  this	  causal	  mutation	  could	  be	  confirmed.	  In	  the	  case	  of	  over	  expressed	  genes	  Agrobacterium	  mediated	  or	  viral	  induced	  transformation	  to	  increase	  copy	  number	  of	  the	  gene	  of	  interest	  in	  wild-­‐type	  could	  mimick	  this	  situation	  and	  again	  allow	  for	  confirmation.	  Although	  differential	  expression	  analysis	  gives	  one	  tier	  at	  which	  to	  observe	  possible	  differences	  in	  the	  transcriptome,	  mutant	  chemotypes	  could	  also	  be	  due	  to	  a	  mutation	  at	  the	  protein	  or	  enzyme	  level.	  If	  the	  amino	  acid	  sequence	  of	  a	  protein	  is	  modified	  this	  may	  not	  effect	  expression	  of	  the	  transcript	  but	  could	  lead	  to	  an	  inactive	  (or	  a	  less	  active)	  version	  of	  the	  enzyme	  if	  the	  mutation	  is	  in	  an	  important	  structural	  region	  effecting	  folding	  or	  at	  the	  active	  site	  of	  the	  enzyme.	  One	  way	  to	  explore	  this	  possibility	  would	  be	  to	  do	  SNV	  analysis	  of	  the	  mutant	  transcriptome	  and	  look	  for	  genes	  with	  high	  incidence	  of	  SNV	  sites	  in	  and	  apply	  analysis	  to	  	  	   119	  determine	  which	  of	  these	  SNVs	  are	  more	  likely	  to	  be	  chemically	  induced	  versus	  those	  seen	  naturally.	  	  	  The	  last	  objective	  of	  this	  experiment	  aimed	  to	  look	  at	  the	  effect	  of	  essential	  oil	  composition	  on	  insect	  repellence	  and	  insecticidal	  properties	  of	  the	  oils.	  I	  hypothesized	  that	  as	  essential	  oil	  composition	  changes,	  there	  will	  be	  associated	  changes	  in	  biological	  activity	  with	  certain	  key	  constituents	  being	  responsible	  for	  greater	  activity.	  Chapter	  Five	  outlines	  these	  results,	  it	  was	  discovered	  that	  the	  essential	  oil	  constituents	  linalool	  and	  cineole	  are	  potential	  insecticidal	  agents	  and	  that	  oils	  high	  in	  these	  constituents	  have	  greater	  activity	  than	  those	  with	  lower	  levels.	  In	  general	  the	  whole	  oils	  had	  lower	  activity,	  whether	  this	  is	  due	  to	  dilution	  of	  the	  active	  constituents	  or	  is	  due	  to	  antagonistic	  interactions	  with	  other	  essential	  oil	  constituents	  could	  be	  determined	  through	  further	  experimentation	  testing	  combinations	  of	  several	  individual	  constituents	  present	  in	  an	  oil	  and	  comparing	  these	  to	  the	  activity	  of	  the	  whole	  oil	  and	  of	  the	  individual	  constituents.	  Some	  complex	  oils	  such	  as	  avocado	  oil	  were	  identified	  as	  potent	  insecticidal	  agents.	  Though	  the	  composition	  of	  avocado	  oil	  is	  quantified	  as	  it	  is	  consumed	  in	  food	  products,	  the	  exact	  composition	  is	  not	  well	  known	  and	  further	  investigation	  is	  required	  to	  determine	  the	  active	  constituents	  in	  this	  oil.	  No	  significant	  repellency	  was	  observed	  from	  the	  oils	  tested.	  	  	  In	  conclusion	  all	  four	  objectives	  of	  this	  study	  were	  met.	  However,	  much	  work	  has	  yet	  to	  be	  done	  to	  follow	  up	  on	  the	  results	  obtained	  from	  the	  generation	  and	  sequencing	  of	  the	  essential	  oil	  mutants.	  This	  study	  represents	  a	  starting	  point	  for	  the	  improvement	  of	  the	  draft	  transcriptome	  assembled	  in	  Chapter	  Four	  and	  for	  the	  investigation	  of	  the	  regulation	  of	  terpene	  biosynthesis	  in	  lavender	  by	  	  	   120	  the	  differentially	  expressed	  transcription	  factors	  identified	  in	  Chapter	  Four	  and	  well	  as	  identifying	  several	  likely	  candidates	  for	  new	  terpene	  synthase	  enzymes.	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	   121	  References	  	  Abe	  S,	  Maruyama	  N,	  Hayama	  K,	  et	  al.	  (2003)	  Suppression	  of	  tumor	  necrosis	  factor-­‐alpha-­‐induced	  neutrophil	  adherence	  responses	  by	  essential	  oils.	  Mediators	  Inflamm	  12:323–328.	  	  Abramson	  CI,	  Wanderley	  PA,	  Wanderley	  MJA,	  et	  al.	  (2007)	  Effect	  of	  Essential	  Oil	  from	  Citronella	  and	  Alfazema	  on	  Fennel	  Aphids	  Hyadaphis	  foeniculi	  Passerini	  (Hemiptera:	  Aphididae)	  and	  its	  Predator	  Cycloneda	  sanguinea	  L.	  (Coleoptera:	  Coccinelidae).	  American	  J	  Environmental	  Sciences	  3:9–10.	  	  Acheampong	  S,	  Thistlewood	  H	  (2011)	  Spotted	  wing	  Drosophila	  in	  the	  southern	  interior	  valleys	  of	  British	  Columbia,	  2010-­‐2011.	  J	  Entomol	  Soc	  Brit	  Columbia.	  108:43.	  Acikalin	  A,	  Gulen	  M,	  Kara	  B,	  et	  al.	  (2012)	  Anticholinergic	  syndrome	  and	  supraventricular	  tachycardia	  caused	  by	  lavender	  tea	  toxicity.	  Keio	  J	  Med	  61:66–68.	  Aggarwal	  KK,	  Khanuja	  SPS,	  Ahmad	  A,	  et	  al.	  (2001)	  Antimicrobial	  activity	  profiles	  of	  the	  two	  enantiomers	  of	  limonene	  and	  carvone	  isolated	  from	  the	  oils	  of	  Mentha	  spicata	  and	  Anethum	  sowa.	  Flavour	  Fragr	  J	  17:59–63.	  	  Alviano	  WS,	  Mendonça-­‐Filho	  RR,	  Alviano	  DS,	  et	  al.	  (2005)	  Antimicrobial	  activity	  of	  Croton	  cajucara	  Benth	  linalool-­‐rich	  essential	  oil	  on	  artificial	  biofilms	  and	  planktonic	  microorganisms.	  Oral	  Microbiol	  Immunol	  20:101–105.	  	  Amasino	  R	  (2005)	  1955:	  Kinetin	  Arrives.	  The	  50th	  Anniversary	  of	  a	  New	  Plant	  Hormone.	  Plant	  Physiology	  138:1177–1184.	  	  Atallah	  J,	  Teixeira	  L,	  Salazar	  R,	  et	  al.	  (2014)	  The	  making	  of	  a	  pest:	  the	  evolution	  of	  a	  fruit-­‐penetrating	  ovipositor	  in	  Drosophila	  suzukii	  and	  related	  species.	  Proc	  Biol	  Sci	  281:20132840.	  	  Baker	  J,	  Brown	  K,	  Rajendiran	  E,	  et	  al.	  (2012)	  Medicinal	  lavender	  modulates	  the	  enteric	  microbiota	  to	  protect	  against	  Citrobacter	  rodentium-­‐induced	  colitis.	  Am	  J	  Physiol	  Gastrointest	  Liver	  Physiol	  303:G825–36.	  	  Beers	  EH,	  Van	  Steenwyk	  RA	  (2011)	  Developing	  Drosophila	  suzukii	  management	  programs	  for	  sweet	  cherry	  in	  the	  western	  United	  States.	  Pest	  Manag	  Sci.	  67:1386-­‐1395.	  Birkenbihl	  RP,	  Jach	  G,	  Saedler	  H,	  Huijser	  P	  (2005)	  Functional	  Dissection	  of	  the	  Plant-­‐specific	  SBP-­‐Domain:	  Overlap	  of	  the	  DNA-­‐binding	  and	  Nuclear	  Localization	  Domains.	  J	  Mol	  Bio.	  352:585-­‐596.	  Blumenstiel	  JP,	  Noll	  AC,	  Griffiths	  JA,	  et	  al.	  (2009)	  Identification	  of	  EMS-­‐Induced	  Mutations	  in	  Drosophila	  melanogaster	  by	  Whole-­‐Genome	  Sequencing.	  Genetics	  182:25–32.	  	  Botella-­‐Pavía	  P,	  Besumbes	  O,	  Phillips	  MA,	  et	  al.	  (2004)	  Regulation	  of	  carotenoid	  biosynthesis	  in	  plants:	  evidence	  for	  a	  key	  role	  of	  hydroxymethylbutenyl	  diphosphate	  reductase	  in	  controlling	  the	  supply	  of	  plastidial	  isoprenoid	  precursors.	  Plant	  J	  40:188–199.	  	  	  	   122	  Bruck	  DJ,	  Bolda	  M,	  Tanigoshi	  L,	  et	  al.	  (2011)	  Laboratory	  and	  field	  comparisons	  of	  insecticides	  to	  reduce	  infestation	  of	  Drosophila	  suzukii	  in	  berry	  crops.	  Pest	  Manag	  Sci	  67:1375–1385.	  	  Buck	  MJ,	  Atchley	  WR	  (2003)	  Phylogenetic	  analysis	  of	  plant	  basic	  helix-­‐loop-­‐helix	  proteins.	  J	  Mol	  Evol	  56:742–750.	  	  Burg	  JS,	  Espenshade	  PJ	  (2011)	  Regulation	  of	  HMG-­‐CoA	  reductase	  in	  mammals	  and	  yeast.	  Prog	  Lipid	  Res	  50:403–410.	  	  Burke	  C	  (2001)	  Interaction	  with	  the	  Small	  Subunit	  of	  Geranyl	  Diphosphate	  Synthase	  Modifies	  the	  Chain	  Length	  Specificity	  of	  Geranylgeranyl	  Diphosphate	  Synthase	  to	  Produce	  Geranyl	  Diphosphate.	  Journal	  of	  Biological	  Chemistry	  277:3141–3149.	  	  Bustin	  SA,	  Benes	  V,	  Garson	  JA,	  et	  al.	  (2009)	  The	  MIQE	  guidelines:	  minimum	  information	  for	  publication	  of	  quantitative	  real-­‐time	  PCR	  experiments.	  Clin	  Chem	  55:611–622.	  	  Caballero-­‐Gallardo	  K,	  Olivero-­‐Verbel	  J,	  Stashenko	  EE	  (2011)	  Repellent	  activity	  of	  essential	  oils	  and	  some	  of	  their	  individual	  constituents	  against	  Tribolium	  castaneum	  herbst.	  J	  Agric	  Food	  Chem	  59:1690–1696.	  	  Carson	  CF,	  Riley	  TV	  (1995)	  Antimicrobial	  activity	  of	  the	  major	  components	  of	  the	  essential	  oil	  of	  Melaleuca	  alternifolia.	  J	  Appl	  Bacteriol	  78:264–269.	  Cavanagh	  HMA,	  Wilkinson	  JM	  (2002)	  Biological	  activities	  of	  lavender	  essential	  oil.	  Phytother	  Res	  16:301–308.	  	  Chang	  H-­‐T,	  Cheng	  Y-­‐H,	  Wu	  C-­‐L,	  et	  al.	  (2008)	  Antifungal	  activity	  of	  essential	  oil	  and	  its	  constituents	  from	  Calocedrus	  macrolepis	  var.	  formosana	  Florin	  leaf	  against	  plant	  pathogenic	  fungi.	  Bioresour	  Technol	  99:6266–6270.	  	  Chen	  W,	  Vermaak	  I,	  Viljoen	  A	  (2013)	  Camphor-­‐-­‐a	  fumigant	  during	  the	  Black	  Death	  and	  a	  coveted	  fragrant	  wood	  in	  ancient	  Egypt	  and	  Babylon-­‐-­‐a	  review.	  Molecules	  18:5434–5454.	  	  Chioca	  LR,	  Ferro	  MM,	  Baretta	  IP,	  et	  al.	  (2013)	  Anxiolytic-­‐like	  effect	  of	  lavender	  essential	  oil	  inhalation	  in	  mice:	  Participation	  of	  serotonergic	  but	  not	  GABAA/benzodiazepine	  neurotransmission.	  J	  Ethnopharmacol.	  Christensson	  JB,	  Matura	  M,	  Gruvberger	  B,	  et	  al.	  (2010)	  Linalool	  -­‐	  a	  significant	  contact	  sensitizer	  after	  air	  exposure.	  Contact	  Dermatitis	  62:32–41.	  	  Cleveland	  CB,	  Mayes	  MA,	  Cryer	  SA	  (2002)	  An	  ecological	  risk	  assessment	  for	  spinosad	  use	  on	  cotton.	  Pest	  Manag	  Sci	  58:70–84.	  	  Cloyd	  RA,	  Marley	  KA,	  Larson	  RA,	  Dickinson	  A	  (2011)	  Repellency	  of	  Naturally	  Occurring	  Volatile	  Alcohols	  to	  Fungus	  Gnat	  Bradysia	  sp.	  nr.	  coprophila	  (Diptera:	  Sciaridae)	  Adults	  Under	  Laboratory	  Conditions.	  J	  Econ	  Entomol.	  104(5):1633-­‐1639.	  	  	   123	  Croteau	  R,	  Loomis	  WD	  (1972)	  Biosynthesis	  of	  mono-­‐and	  sesquiterpenes	  in	  peppermint	  from	  mevalonate-­‐2-­‐	  14	  C.	  Phytochemistry	  11:1055–1066.	  Cubas	  P,	  Lauter	  N,	  Doebley	  J,	  Coen	  E	  (1999)	  The	  TCP	  domain:	  a	  motif	  found	  in	  proteins	  regulating	  plant	  growth	  and	  development.	  Plant	  J	  18:215–222.	  Da	  Porto	  C,	  Decorti	  D,	  Kikic	  I	  (2009)	  Flavour	  compounds	  of	  Lavandula	  angustifolia	  L.	  to	  use	  in	  food	  manufacturing:	  Comparison	  of	  three	  different	  extraction	  methods.	  Food	  Chemistry	  112:1072–1078.	  doi:	  10.1016/j.foodchem.2008.07.015	  da	  Silva	  EBP,	  Matsuo	  AL,	  Figueiredo	  CR,	  et	  al.	  (2013)	  Chemical	  constituents	  and	  cytotoxic	  evaluation	  of	  essential	  oils	  from	  leaves	  of	  Porcelia	  macrocarpa	  (Annonaceae).	  Nat	  Prod	  Commun	  8:277–279.	  Dekker	  T,	  Ignell	  R,	  Ghebru	  M,	  et	  al.	  (2011)	  Identification	  of	  mosquito	  repellent	  odours	  from	  Ocimum	  forskolei.	  Parasit	  Vectors	  4:183.	  doi:	  10.1186/1756-­‐3305-­‐4-­‐183	  Demissie	  ZA,	  Cella	  MA,	  Sarker	  LS,	  et	  al.	  (2012)	  Cloning,	  functional	  characterization	  and	  genomic	  organization	  of	  1,8-­‐cineole	  synthases	  from	  Lavandula.	  Plant	  Mol	  Biol	  79:393–411.	  	  Demissie	  ZA,	  Erland	  LAE,	  Rheault	  MR,	  Mahmoud	  SS	  (2013)	  The	  Biosynthetic	  Origin	  of	  Irregular	  Monoterpenes	  in	  Lavandula:	  Isolationg	  and	  biochemical	  characterization	  of	  a	  novel	  cis-­‐prenyl	  diphosphate	  synthase	  gene,	  lavandulyl	  diphosphate	  synthase.	  J	  Biol	  Chem	  288:6333–6341.	  	  Dietz	  K-­‐J,	  Vogel	  MO,	  Viehhauser	  A	  (2010)	  AP2/EREBP	  transcription	  factors	  are	  part	  of	  gene	  regulatory	  networks	  and	  integrate	  metabolic,	  hormonal	  and	  environmental	  signals	  in	  stress	  acclimation	  and	  retrograde	  signalling.	  Protoplasma	  245:3–14.	  	  Djenane	  D,	  Aïder	  M,	  Yangüela	  J,	  et	  al.	  (2012)	  Antioxidant	  and	  antibacterial	  effects	  of	  Lavandula	  and	  Mentha	  essential	  oils	  in	  minced	  beef	  inoculated	  with	  E.	  coli	  O157:H7	  and	  S.	  aureus	  during	  storage	  at	  abuse	  refrigeration	  temperature.	  MESC	  92:667–674.	  Dreher	  ML,	  Davenport	  AJ	  (2013)	  Hass	  avocado	  composition	  and	  potential	  health	  effects.	  Crit	  Rev	  Food	  Sci	  Nutr	  53:738–750.	  	  Dreves	  AJ	  (2011)	  IPM	  program	  development	  for	  an	  invasive	  pest:	  coordination,	  outreach	  and	  evaluation.	  Pest	  Manag	  Sci	  67:1403–1410.	  	  Eisenreich	  W,	  Schwarz	  M,	  Cartayrade	  A,	  et	  al.	  (1998)	  The	  deoxyxylulose	  phosphate	  pathway	  of	  terpenoid	  biosynthesis	  in	  plants	  and	  microorganisms.	  Chem	  Biol	  5:R221–R233.	  El-­‐Sheikh	  TAA,	  Hassanein	  AA,	  Radwan	  EMM,	  Abo-­‐Yousef	  HM	  (2005)	  Biochemical	  effects	  of	  certain	  plant	  oils	  on	  the	  lesser	  grain	  borer,	  Rhyzopertha	  dominica	  (F.).	  Annal	  Ag	  Sci	  (Cairo)	  50:729–737.	  Elaissi	  A,	  Rouis	  Z,	  Mabrouk	  S,	  et	  al.	  (2012)	  Correlation	  between	  chemical	  composition	  and	  antibacterial	  activity	  of	  essential	  oils	  from	  fifteen	  Eucalyptus	  species	  growing	  in	  the	  Korbous	  	  	   124	  and	  Jbel	  Abderrahman	  arboreta	  (North	  East	  Tunisia).	  Molecules	  17:3044–3057.	  	  Erland	  LAE,	  Mahmoud	  SS	  (2014)	  An	  efficient	  method	  for	  regeneration	  of	  lavandin	  (Lavandula	  x	  intermedia	  cv.	  'Grosso').	  In	  Vitro	  Cell	  Dev	  Biol	  -­‐	  plant.	  50(5):646-­‐654.	  Eulgem	  T	  (2000)	  The	  WRKY	  superfamily	  of	  plant	  transcription	  factors.	  Trends	  Plant	  Sci	  5:199–206.	  	  Falk	  L,	  Biswas	  K,	  Boeckelmann	  A,	  et	  al.	  (2009)	  An	  Effcient	  Method	  for	  the	  Micropropagation	  of	  Lavenders:	  Regeneration	  of	  a	  Unique	  Mutant.	  J	  Essential	  Oil	  Res	  21:225–228.	  	  Gallie	  DR	  (2013)	  The	  role	  of	  L-­‐ascorbic	  acid	  recycling	  in	  responding	  to	  environmental	  stress	  and	  in	  promoting	  plant	  growth.	  J	  Exp	  Bot	  64:433–443.	  	  Gitz	  DC,	  Liu-­‐Gitz	  L,	  McClure	  JW,	  Huerta	  AJ	  (2004)	  Effects	  of	  a	  PAL	  inhibitor	  on	  phenolic	  accumulation	  and	  UV-­‐B	  tolerance	  in	  Spirodela	  intermedia	  (Koch.).	  J	  Exp	  Bot	  55:919–927.	  	  Glamoclija	  J,	  Sokovic	  M,	  Grubisic	  D,	  et	  al.	  (2009)	  Antifungal	  activity	  of	  Critmum	  maritimum	  essential	  oil	  and	  its	  components	  against	  mushroom	  pathogen	  Mycogone	  perniciosa.	  Chem	  Nat	  Compd	  45:96–97.	  	  Goldstein	  JL,	  DeBose-­‐Boyd	  RA,	  Brown	  MS	  (2006)	  Protein	  Sensors	  for	  Membrane	  Sterols.	  Cell	  124:35–46.	  	  Gómez-­‐Estaca	  J,	  López	  de	  Lacey	  A,	  López-­‐Caballero	  ME,	  et	  al.	  (2010)	  Biodegradable	  gelatin-­‐chitosan	  films	  incorporated	  with	  essential	  oils	  as	  antimicrobial	  agents	  for	  fish	  preservation.	  Food	  Microbiol	  27:889–896.	  Guilfoyle	  TJ,	  Ulmasov	  T,	  Hagen	  G	  (1998)	  The	  ARF	  family	  of	  transcription	  factors	  and	  their	  role	  in	  plant	  hormone-­‐responsive	  transcription.	  Cell	  Mol	  Life	  Sci	  54:619–627.	  Gurgel	  do	  Vale	  T,	  Couto	  Furtado	  E,	  Santos	  JG	  Jr.,	  Viana	  GSB	  (2002)	  Central	  effects	  of	  citral,	  myrcene	  and	  limonene,	  constituents	  of	  essential	  oil	  chemotypes	  from	  Lippia	  alba	  (Mill.)	  N.E.	  Brown.	  Phytomedicine	  9:709–714.	  	  Hammer	  KA,	  Heel	  KA	  (2012)	  Use	  of	  multiparameter	  flow	  cytometry	  to	  determine	  the	  effects	  of	  monoterpenoids	  and	  phenylpropanoids	  on	  membrane	  polarity	  and	  permeability	  in	  staphylococci	  and	  enterococci.	  Int	  J	  Antimicrob	  Agents	  40:239–245.	  	  Hauser	  M	  (2011)	  A	  historic	  account	  of	  the	  invasion	  of	  Drosophila	  suzukii	  (Matsumura)	  (Diptera:	  Drosophilidae)	  in	  the	  continental	  United	  States,	  with	  remarks	  on	  their	  identification.	  Pest	  Manag	  Sci	  67:1352–1357.	  	  Hemmerlin	  A,	  Hoeffler	  J-­‐F,	  Meyer	  O,	  et	  al.	  (2003)	  Cross-­‐talk	  between	  the	  Cytosolic	  Mevalonate	  and	  the	  Plastidial	  Methylerythritol	  Phosphate	  Pathways	  in	  Tobacco	  Bright	  Yellow-­‐2	  Cells.	  J	  Biol	  Chem	  278:26666–26676.	  	  	  	   125	  Hong	  G-­‐J,	  Xue	  X-­‐Y,	  Mao	  Y-­‐B,	  et	  al.	  (2012)	  Arabidopsis	  MYC2	  Interacts	  with	  DELLA	  Proteins	  in	  Regulating	  Sesquiterpene	  Synthase	  Gene	  Expression.	  The	  Plant	  Cell	  24:2635-­‐2648.	  Hu	  GS,	  Hur	  YJ,	  Jia	  JM,	  et	  al.	  (2011)	  Effects	  of	  2-­‐aminoindan-­‐2-­‐phosphonic	  acid	  treatment	  on	  the	  accumulation	  of	  salidroside	  and	  four	  phenylethanoid	  glycosides	  in	  suspension	  cell	  culture	  of	  Cistanche	  deserticola.	  Plant	  Cell	  Rep	  30:665–674.	  	  Huang	  SS,	  Kirchoff	  BK,	  Liao	  JP	  (2008)	  The	  capitate	  and	  peltate	  glandular	  trichomes	  of	  Lavandula	  pinnata	  L.	  (Lamiaceae):	  histochemistry,	  ultrastructure,	  and	  secretion	  1.	  J	  Torrey	  Bot	  Soc	  135:155–167.	  	  Hwang	  Y-­‐S,	  Wu	  K-­‐H,	  Kumamoto	  J,	  et	  al.	  (1985)	  Isolation	  and	  identification	  of	  mosquito	  repellents	  in	  Artemisia	  vulgaris.	  J	  Chem	  Ecol	  11:1297–1306.	  	  Imelouane	  B,	  Elbachiri	  A,	  Ankit	  M,	  et	  al.	  (2009)	  Physico-­‐Chemical	  Compositions	  and	  Antimicrobial	  Activity	  of	  Essential	  Oil	  of	  Eastern	  Moroccan	  Lavandula	  dentata.	  Int	  J	  Ag	  Biol	  11:113–118.	  Ioriatti	  C,	  Agnello	  AM,	  Martini	  F,	  Kovach	  J	  (2011)	  Evaluation	  of	  the	  environmental	  impact	  of	  apple	  pest	  control	  strategies	  using	  pesticide	  risk	  indicators.	  Integr	  Environ	  Assess	  Manag	  7:542–549.	  	  Jakoby	  M,	  Weisshaar	  B,	  Dröge-­‐Laser	  W,	  et	  al.	  (2002)	  bZIP	  transcription	  factors	  in	  Arabidopsis.	  Trends	  in	  Plant	  Science	  7:106–111.	  Joachim	  C,	  Hatano	  E,	  David	  A,	  et	  al.	  (2013)	  Modulation	  of	  aphid	  alarm	  pheromone	  emission	  of	  pea	  aphid	  prey	  by	  predators.	  J	  Chem	  Ecol	  39:773–782.	  	  Jones	  A,	  Shukla	  MR,	  Chattopadhyay	  A	  (2013)	  Investigating	  the	  roles	  of	  phenylpropanoids	  in	  the	  growth	  and	  development	  of	  Zea	  mays	  L.	  In	  Vitro	  Cell	  Dev	  -­‐	  Plant.	  49:765-­‐772.	  Jones	  AMP,	  Chattopadhyay	  A,	  Shukla	  M,	  et	  al.	  (2012)	  Inhibition	  of	  phenylpropanoid	  biosynthesis	  increases	  cell	  wall	  digestibility,	  protoplast	  isolation,	  and	  facilitates	  sustained	  cell	  division	  in	  American	  elm	  (Ulmus	  americana).	  BMC	  Plant	  Biology	  12:75.	  	  Jones	  AMP,	  Saxena	  PK	  (2013)	  Inhibition	  of	  phenylpropanoid	  biosynthesis	  in	  Artemisia	  annua	  L.:	  a	  novel	  approach	  to	  reduce	  oxidative	  browning	  in	  plant	  tissue	  culture.	  PLoS	  ONE	  8:e76802.	  	  Juliani	  HR	  Jr,	  Biurrun	  F,	  Koroch	  AR,	  et	  al.	  (2002)	  Chemical	  Constituents	  and	  Antimicrobial	  Activity	  of	  the	  Essential	  Oil	  of	  Lantana	  xenica.	  Planta	  Med	  68:762–764.	  	  Julio	  E,	  Cotucheau	  J,	  Decorps	  C,	  et	  al.	  (2014)	  A	  Eukaryotic	  Translation	  Initiation	  Factor	  4E	  (eIF4E)	  is	  Responsible	  for	  the	  “va”	  Tobacco	  Recessive	  Resistance	  to	  Potyviruses.	  Plant	  Mol	  Biol	  Rep	  1–15.	  	  Jullien	  F,	  Moja	  S,	  Bony	  A,	  et	  al.	  (2013)	  Isolation	  and	  functional	  characterization	  of	  a	  τ-­‐cadinol	  synthase,	  a	  new	  sesquiterpene	  synthase	  from	  Lavandula	  angustifolia.	  Plant	  Mol	  Biol	  84:227–241.	  	  	  	   126	  Kamatou	  GPP,	  Viljoen	  AM	  (2009)	  A	  Review	  of	  the	  Application	  and	  Pharmacological	  Properties	  of	  α-­‐Bisabolol	  and	  α-­‐Bisabolol-­‐Rich	  Oils.	  J	  Am	  Oil	  Chem	  Soc	  87:1–7.	  	  Kampranis	  SC,	  Makris	  AM	  (2012)	  Developing	  a	  yeast	  cell	  factory	  for	  the	  production	  of	  terpenoids.	  CSBJ.	  	  Klejdus	  B,	  Kováčik	  J,	  Babula	  P	  (2013)	  PAL	  inhibitor	  evokes	  different	  responses	  in	  two	  Hypericum	  species.	  Plant	  Physiol	  Biochem	  63:82–88.	  	  Landelle	  C,	  Francony	  G,	  Sam-­‐Laï	  NF,	  et	  al.	  (2008)	  Poisoning	  by	  lavandin	  extract	  in	  a	  18-­‐month-­‐old	  boy.	  Clin	  Toxicol	  (Phila)	  46:279–281.	  	  Landmann	  C,	  Fink	  B,	  Festner	  M,	  et	  al.	  (2007)	  Cloning	  and	  functional	  characterization	  of	  three	  terpene	  synthases	  from	  lavender	  (Lavandula	  angustifolia).	  Arch	  Biochem	  Biophys.	  465:417–429.	  	  Lane	  A,	  Boecklemann	  A,	  Woronuk	  GN,	  Sarker	  L	  (2010)	  A	  genomics	  resource	  for	  investigating	  regulation	  of	  essential	  oil	  production	  in	  Lavandula	  angustifolia.	  Planta.	  231:835-­‐845.	  Laukkanen	  H,	  Haggman	  H,	  Kontunen-­‐Soppela	  S,	  Hohtola	  A	  (1999)	  Tissue	  browning	  of	  in	  vitro	  cultures	  of	  Scots	  pine:	  Role	  of	  peroxidase	  and	  polyphenol	  oxidase.	  Physiol	  Plant	  106:337–343.	  	  Lee	  JC,	  Bruck	  DJ,	  Curry	  H,	  et	  al.	  (2011a)	  The	  susceptibility	  of	  small	  fruits	  and	  cherries	  to	  the	  spotted-­‐wing	  drosophila,	  Drosophila	  suzukii.	  Pest	  Manag	  Sci	  67:1358–1367.	  	  Lee	  JC,	  Bruck	  DJ,	  Dreves	  AJ,	  et	  al.	  (2011b)	  In	  Focus:	  Spotted	  wing	  drosophila,	  Drosophila	  suzukii,	  across	  perspectives.	  Pest	  Manag	  Sci	  67:1349–1351.	  	  Lin	  T,	  Qin	  Y-­‐W,	  Zhang	  L,	  et	  al.	  (2011)	  [Distribution,	  sources	  and	  ecological	  risk	  assessment	  of	  organochlorine	  pesticides	  and	  polychlorinated	  biphenyl	  residues	  in	  surface	  sediment	  from	  Dahuofang	  Reservoir,	  Liaoning].	  Huan	  Jing	  Ke	  Xue	  32:3294–3299.	  Lis	  ET,	  O'Neill	  BM,	  Gil-­‐Lamaignere	  C,	  et	  al.	  (2008)	  Identification	  of	  pathways	  controlling	  DNA	  damage	  induced	  mutation	  in	  Saccharomyces	  cerevisiae.	  DNA	  Repair	  (Amst)	  7:801–810.	  	  Lis-­‐Balchin	  M	  (2004)	  Lavender.	  CRC	  Press	  Lodhia	  MH,	  Bhatt	  KR,	  Thaker	  VS	  (2009)	  Antibacterial	  activity	  of	  essential	  oils	  from	  palmarosa,	  evening	  primrose,	  lavender	  and	  tuberose.	  Indian	  J	  Pharm	  Sci.	  71:134–136.	  Lorenzetti	  BB,	  Souza	  GEP,	  Sarti	  SJ,	  et	  al.	  (1991)	  Myrcene	  mimics	  the	  peripheral	  analgesic	  activity	  of	  lemongrass	  tea.	  J	  Ethnopharmacol.	  34:43–48.	  	  López	  S,	  Quero	  C,	  Iturrondobeitia	  JC,	  et	  al.	  (2013)	  Electrophysiological	  and	  behavioural	  responses	  of	  Pityophthorus	  pubescens	  (Coleoptera:	  Scolytinae)	  to	  (E,E)-­‐α-­‐farnesene,	  (R)-­‐(+)-­‐limonene	  and	  (S)-­‐(-­‐)-­‐verbenone	  in	  Pinus	  radiata	  (Pinaceae)	  stands	  in	  northern	  Spain.	  Pest	  Manag	  Sci	  69:40–47.	  	  	  	   127	  Mahmoud	  SS,	  Croteau	  RB	  (2002)	  Strategies	  for	  transgenic	  manipulation	  of	  monoterpene	  biosynthesis	  in	  plants.	  Trend	  Plant	  Sci.	  7:366–373.	  Mant	  J,	  Brändli	  C,	  Vereecken	  NJ,	  et	  al.	  (2005)	  Cuticular	  hydrocarbons	  as	  sex	  pheromone	  of	  the	  bee	  Colletes	  cunicularius	  and	  the	  key	  to	  its	  mimicry	  by	  the	  sexually	  deceptive	  orchid,	  Ophrys	  exaltata.	  J	  Chem	  Ecol	  31:1765–1787.	  Mba	  C,	  Afza	  R,	  Bado	  S,	  Jain	  SM	  (2010)	  Induced	  mutagenesis	  in	  plants	  using	  physical	  and	  chemical	  agents.	  Plant	  Cell	  Culture:	  Essential	  Methods	  111.	  Mercier	  B,	  Prost	  J,	  Prost	  M	  (2009)	  The	  essential	  oil	  of	  turpentine	  and	  its	  major	  volatile	  fraction	  (α-­‐	  and	  β-­‐pinenes):	  a	  review	  :	  IJOMEH.	  22(4):331-­‐342.	  Mitić-­‐Ćulafić	  D,	  Žegura	  B,	  Nikolić	  B,	  et	  al.	  (2009)	  Protective	  effect	  of	  linalool,	  myrcene	  and	  eucalyptol	  against	  t-­‐butyl	  hydroperoxide	  induced	  genotoxicity	  in	  bacteria	  and	  cultured	  human	  cells.	  Food	  Chem	  Toxicol.	  47:260–266.	  	  Mittler	  R,	  Vanderauwera	  S,	  Suzuki	  N,	  et	  al.	  (2011)	  ROS	  signaling:	  the	  new	  wave?	  Trend	  Plant	  Sci.	  16:300–309.	  	  Moon	  T,	  Cavanagh	  HMA,	  Wilkinson	  JM	  (2007)	  Antifungal	  activity	  of	  Australian	  grown	  Lavandula	  spp.	  essential	  oils	  against	  Aspergillus	  nidulans,	  Trichophyton	  mentagrophytes,	  Leptosphaeria	  maculans	  and	  Sclerotinia	  sclerotiorum.	  J	  Essent	  Oil	  Res.	  19:171–175.	  Moon	  T,	  Wilkinson	  JM,	  Cavanagh	  HMA	  (2006)	  Antiparasitic	  activity	  of	  two	  Lavandula	  essential	  oils	  against	  Giardia	  duodenalis,	  Trichomonas	  vaginalis	  and	  Hexamita	  inflata.	  Parasitol	  Res	  99:722–728.	  	  Mora	  FD,	  Alpan	  L,	  De	  Tommasi	  N,	  et	  al.	  (2013)	  New	  antibacterial	  germacrene	  from	  Verbesina	  negrensis.	  Planta	  Med	  79:707–710.	  	  Morcia	  C,	  Malnati	  M,	  Terzi	  V	  (2012)	  In	  vitro	  antifungal	  activity	  of	  terpinen-­‐4-­‐ol,	  eugenol,	  carvone,	  1,8-­‐cineole	  (eucalyptol)	  and	  thymol	  against	  mycotoxigenic	  plant	  pathogens.	  Food	  Addit	  Contam	  Part	  A	  Chem	  Anal	  Control	  Expo	  Risk	  Assess	  29:415–422.	  	  Moro	  A,	  Librán	  CM,	  Berruga	  MI,	  et	  al.	  (2013)	  Mycotoxicogenic	  fungal	  inhibition	  by	  innovative	  cheese	  cover	  with	  aromatic	  plants.	  J	  Sci	  Food	  Agric	  93:1112–1118.	  	  Mourey	  A,	  Canillac	  N	  (2002)	  Anti-­‐	  Listeria	  monocytogenes	  activity	  of	  essential	  oils	  components	  of	  conifers.	  Food	  Control	  13:289–292.	  Myhre	  S,	  Tveit	  H,	  Mollestad	  T,	  Laegreid	  A	  (2006)	  Additional	  gene	  ontology	  structure	  for	  improved	  biological	  reasoning.	  Bioinformatics	  22:2020–2027.	  	  Newman	  JD,	  Chappell	  J	  (1999)	  Isoprenoid	  Biosynthesis	  in	  Plants:	  Carbon	  Partitioning	  Within	  the	  Cytoplasmic	  Pathway.	  Crit	  Rev	  Biochem	  Mol	  Biol.	  34(2):95-­‐106.	  	  	   128	  Ng	  M,	  Yanofsky	  MF	  (2001)	  Function	  and	  evolution	  of	  the	  plant	  MADS-­‐box	  gene	  family.	  Nat	  Rev	  Genet	  2:186–195.	  	  Ngan	  LTM,	  Moon	  J-­‐K,	  Kim	  J-­‐H,	  et	  al.	  (2012)	  Growth-­‐inhibiting	  effects	  of	  Paeonia	  lactiflora	  root	  steam	  distillate	  constituents	  and	  structurally	  related	  compounds	  on	  human	  intestinal	  bacteria.	  World	  J	  Microbiol	  Biotechnol	  28:1575–1583.	  	  Oh	  J,	  Bowling	  JJ,	  Carroll	  JF,	  et	  al.	  (2012)	  Natural	  product	  studies	  of	  U.S.	  endangered	  plants:	  volatile	  components	  of	  Lindera	  melissifolia	  (Lauraceae)	  repel	  mosquitoes	  and	  ticks.	  Phytochemistry	  80:28–36.	  	  Olsen	  AN,	  Ernst	  HA,	  Leggio	  LL,	  Skriver	  K	  (2005)	  NAC	  transcription	  factors:	  structurally	  distinct,	  functionally	  diverse.	  Trend	  Plant	  Sci.	  10:79–87.	  	  Pan	  MJ,	  Staden	  JV	  (1998)	  The	  use	  of	  charcoal	  in	  in	  vitro	  culture–A	  review.	  Plant	  Growth	  Regulation	  26:155–163.	  	  Patra	  B,	  Schluttenhofer	  C,	  Wu	  Y,	  et	  al.	  (2013)	  Transcriptional	  regulation	  of	  secondary	  metabolite	  biosynthesis	  in	  plants.	  Biochim	  Biophys	  Acta	  1829:1236–1247.	  	  Paula-­‐Freire	  LIG,	  Andersen	  ML,	  Molska	  GR,	  et	  al.	  (2013)	  Evaluation	  of	  the	  antinociceptive	  activity	  of	  Ocimum	  gratissimum	  L.	  (Lamiaceae)	  essential	  oil	  and	  its	  isolated	  active	  principles	  in	  mice.	  Phytother	  Res	  27:1220–1224.	  	  Peana	  AT,	  De	  Montis	  MG,	  Sechi	  S,	  et	  al.	  (2004)	  Effects	  of	  (-­‐)-­‐linalool	  in	  the	  acute	  hyperalgesia	  induced	  by	  carrageenan,	  L-­‐glutamate	  and	  prostaglandin	  E2.	  Eur	  J	  Pharmacol	  497:279–284.	  	  Peana	  AT,	  Rubattu	  P,	  Piga	  GG,	  et	  al.	  (2006)	  Involvement	  of	  adenosine	  A1	  and	  A2A	  receptors	  in	  (−)-­‐linalool-­‐induced	  antinociception.	  Life	  Sciences	  78:2471–2474.	  	  Peer	  WA,	  Murphy	  AS	  (2007)	  Flavonoids	  and	  auxin	  transport:	  modulators	  or	  regulators?	  Trends	  Plant	  Sci	  12:556–563.	  	  Pérez-­‐Rodríguez	  P,	  Riaño-­‐Pachón	  DM,	  Corrêa	  LGG,	  et	  al.	  (2010)	  PlnTFDB:	  updated	  content	  and	  new	  features	  of	  the	  plant	  transcription	  factor	  database.	  Nucleic	  Acids	  Res	  38:D822–7.	  	  Quaglia	  M,	  Fabrizi	  M,	  Zazzerini	  A,	  Zadra	  C	  (2012)	  Role	  of	  pathogen-­‐induced	  volatiles	  in	  the	  Nicotiana	  tabacum-­Golovinomyces	  cichoracearum	  interaction.	  Plant	  Physiol	  Biochem	  52:9–20.	  	  Regnault-­‐Roger	  C,	  Vincent	  C,	  Arnason	  JT	  (2012)	  Essential	  Oils	  in	  Insect	  Control:	  Low-­‐Risk	  Products	  in	  a	  High-­‐Stakes	  World.	  Annu	  Rev	  Entomol	  57:405–424.	  	  Reinsvold	  RE,	  Jinkerson	  RE,	  Radakovits	  R,	  et	  al.	  (2011)	  The	  production	  of	  the	  sesquiterpene	  β-­‐caryophyllene	  in	  a	  transgenic	  strain	  of	  the	  cyanobacterium	  Synechocystis.	  J	  Plant	  Physiol	  168:848–852.	  	  Reyes	  JC,	  Muro-­‐Pastor	  MI,	  Florencio	  FJ	  (2004)	  The	  GATA	  family	  of	  transcription	  factors	  in	  	  	   129	  Arabidopsis	  and	  rice.	  Plant	  Physiol.	  134:1718–1732.	  	  Riechmann	  JL,	  Ratcliffe	  OJ	  (2000)	  A	  genomic	  perspective	  on	  plant	  transcription	  factors.	  Current	  Opinion	  Plant	  Biol	  3:423–434.	  	  Rodrigues	  N,	  Malheiro	  R,	  Casal	  S,	  et	  al.	  (2012)	  Influence	  of	  spike	  lavender	  (Lavandula	  latifolia	  Med.)	  essential	  oil	  in	  the	  quality,	  stability	  and	  composition	  of	  soybean	  oil	  during	  microwave	  heating.	  Food	  Chem	  Toxicol.	  50:2894–2901.	  	  Rodriguez-­‐Concepcion	  M	  (2006)	  Early	  steps	  in	  isoprenoid	  biosynthesis:	  multilevel	  regulation	  of	  the	  supply	  of	  common	  precursors	  in	  plant	  cells.	  Phytochem	  Rev.	  5:1-­‐15	  Rozman	  V,	  Kalinovic	  I,	  Korunic	  Z	  (2007)	  Toxicity	  of	  naturally	  occurring	  compounds	  of	  Lamiaceae	  and	  Lauraceae	  to	  three	  stored-­‐product	  insects.	  J	  Stored	  Prod	  Res	  43:349–355.	  	  Rozman	  V,	  Kalinovic	  I,	  Liska	  A	  (2006)	  Bioactivity	  of	  1,	  8-­‐cineole,	  camphor	  and	  carvacrol	  against	  rusty	  grain	  beetle	  (Cryptolestes	  ferrugineus	  Steph.)	  on	  stored	  wheat.	  Alt	  Method	  Chem	  Control.	  9th	  International	  Conference	  on	  Stored	  Product	  Protection.	  	  Ruijter	  JM,	  Ramakers	  C,	  Hoogaars	  WMH,	  et	  al.	  (2009)	  Amplification	  efficiency:	  linking	  baseline	  and	  bias	  in	  the	  analysis	  of	  quantitative	  PCR	  data.	  Nucleic	  Acids	  Res	  37:e45.	  	  Ruuhola	  T,	  Julkunen-­‐Titto	  R	  (2003)	  Trade-­‐off	  between	  synthesis	  of	  salicylates	  and	  growth	  of	  micropropagated	  Salix	  pentandra.	  	  Sarker	  LS,	  Galata	  M,	  Demissie	  ZA,	  Mahmoud	  SS	  (2012)	  Molecular	  cloning	  and	  functional	  characterization	  of	  borneol	  dehydrogenase	  from	  the	  glandular	  trichomes	  of	  Lavandula	  x	  intermedia.	  Arch	  Biochem	  Biophys.	  528:163–170.	  	  Schaneberg	  BT,	  Khan	  IA	  (2002)	  Comparison	  of	  extraction	  methods	  for	  marker	  compounds	  in	  the	  essential	  oil	  of	  lemon	  grass	  by	  GC.	  J	  Agric	  Food	  Chem	  50:1345–1349.	  Schwarz	  S,	  Grande	  AV,	  Bujdoso	  N,	  et	  al.	  (2008)	  The	  microRNA	  regulated	  SBP-­‐box	  genes	  SPL9	  and	  SPL15	  control	  shoot	  maturation	  in	  Arabidopsis.	  Plant	  Mol	  Biol	  67:183–195.	  d	  Sfara	  V,	  Zerba	  EN,	  Alzogaray	  RA	  (2009)	  Fumigant	  insecticidal	  activity	  and	  repellent	  effect	  of	  five	  essential	  oils	  and	  seven	  monoterpenes	  on	  first-­‐instar	  nymphs	  of	  Rhodnius	  prolixus.	  J.	  Med.	  Entomol.	  46(3):511-­‐515.	  Slamenová	  D,	  Horváthová	  E,	  Wsólová	  L,	  et	  al.	  (2009)	  Investigation	  of	  anti-­‐oxidative,	  cytotoxic,	  DNA-­‐damaging	  and	  DNA-­‐protective	  effects	  of	  plant	  volatiles	  eugenol	  and	  borneol	  in	  human-­‐derived	  HepG2,	  Caco-­‐2	  and	  VH10	  cell	  lines.	  Mutat	  Res	  677:46–52.	  	  Sokovic	  M,	  van	  Griensven	  LJLD	  (2006)	  Antimicrobial	  activity	  of	  essential	  oils	  and	  their	  components	  against	  the	  three	  major	  pathogens	  of	  the	  cultivated	  button	  mushroom,	  Agaricus	  bisporus.	  European	  J	  Plant	  Path	  116:211–224.	  	  	  	   130	  Soto	  G,	  Stritzler	  M,	  Lisi	  C,	  et	  al.	  (2011)	  Acetoacetyl-­‐CoA	  thiolase	  regulates	  the	  mevalonate	  pathway	  during	  abiotic	  stress	  adaptation.	  J	  Exp	  Bot	  62:5699–5711.	  	  Soylu	  EM,	  Kurt	  S,	  Soylu	  S	  (2010)	  In	  vitro	  and	  in	  vivo	  antifungal	  activities	  of	  the	  essential	  oils	  of	  various	  plants	  against	  tomato	  grey	  mould	  disease	  agent	  Botrytis	  cinerea.	  Int	  J	  Food	  Microbiol	  143:183–189.	  	  Stelinski	  LL,	  Gut	  LJ,	  Miller	  JR	  (2013)	  An	  attempt	  to	  increase	  efficacy	  of	  moth	  mating	  disruption	  by	  co-­‐releasing	  pheromones	  with	  kairomones	  and	  to	  understand	  possible	  underlying	  mechanisms	  of	  this	  technique.	  Environ	  Entomol	  42:158–166.	  	  Stermer	  BA,	  Bianchini	  GM,	  Korth	  KL	  (1994)	  Regulation	  of	  HMG-­‐CoA	  reductase	  activity	  in	  plants.	  J	  Lipid	  Res	  35:1133–1140.	  Stermer	  BA,	  Edwards	  LA,	  Edington	  BV,	  Dixon	  RA	  (1991)	  Analysis	  of	  elicitor-­‐inducible	  transcripts	  encoding	  3-­‐hydroxy-­‐3-­‐methylglutaryl	  coenzyme	  A	  reductase	  in	  potato.	  Physiol	  Mol	  Plant	  Path	  39:135–145.	  	  Stone	  JM,	  Liang	  X,	  Nekl	  ER,	  Stiers	  JJ	  (2005)	  Arabidopsis	  AtSPL14,	  a	  plant-­‐specific	  SBP-­‐domain	  transcription	  factor,	  participates	  in	  plant	  development	  and	  sensitivity	  to	  fumonisin	  B1.	  The	  Plant	  Journal	  41:744–754.	  	  Suckling	  DM,	  Stringer	  LD,	  Corn	  JE,	  et	  al.	  (2012)	  Aerosol	  delivery	  of	  trail	  pheromone	  disrupts	  the	  foraging	  of	  the	  red	  imported	  fire	  ant,	  Solenopsis	  invicta.	  Pest	  Manag	  Sci	  68:1572–1578.	  	  Suzuki	  N,	  Mittler	  R	  (2012)	  Reactive	  oxygen	  species-­‐dependent	  wound	  responses	  in	  animals	  and	  plants.	  Free	  Radic	  Biol	  Med	  53:2269–2276.	  	  Tan	  K,	  Chen	  W,	  Dong	  S,	  et	  al.	  (2014)	  Imidacloprid	  alters	  foraging	  and	  decreases	  bee	  avoidance	  of	  predators.	  PLoS	  ONE	  9:e102725.	  	  Tang	  W,	  Newton	  RJ	  (2004)	  Increase	  of	  polyphenol	  oxidase	  and	  decrease	  of	  polyamines	  correlate	  with	  tissue	  browning	  in	  Virginia	  pine	  (Pinus	  virginiana	  Mill.).	  Plant	  Science	  167:621–628.	  	  Thistlewood	  H,	  Shearer	  PW,	  Steenwyk	  BV,	  et	  al.	  (2012)	  Drosophila	  suzukii	  (Matsumura)	  (Diptera:	  Drosophilidae),	  a	  new	  pest	  of	  stone	  fruits	  in	  western	  North	  America.	  IOBC/WPRS	  Bulletin	  74:133–137.	  Tian	  C,	  Wan	  P,	  Sun	  S,	  et	  al.	  (2004)	  Genome-­‐wide	  analysis	  of	  the	  GRAS	  gene	  family	  in	  rice	  and	  Arabidopsis.	  Plant	  Mol	  Biol	  54:519–532.	  	  Tiwari	  SB,	  Hagen	  G,	  Guilfoyle	  TJ	  (2004)	  Aux/IAA	  proteins	  contain	  a	  potent	  transcriptional	  repression	  domain.	  Plant	  Cell	  16:533–543.	  	  Toth	  K,	  Haapala	  T,	  Hohtola	  A	  (1994)	  Alleviation	  of	  browning	  in	  oak	  explants	  by	  chemical	  pretreatments.	  Biol	  Plant	  36:511–517.	  	  	  	   131	  Trombetta	  D,	  Castelli	  F,	  Sarpietro	  MG,	  et	  al.	  (2005)	  Mechanisms	  of	  Antibacterial	  Action	  of	  Three	  Monoterpenes.	  Antimicrob	  Agent	  Chemother	  49:2474–2478.	  	  Uchida	  N,	  Sakamoto	  T,	  Kurata	  T,	  Tasaka	  M	  (2011)	  Identification	  of	  EMS-­‐Induced	  Causal	  Mutations	  in	  a	  Non-­‐Reference	  Arabidopsis	  thaliana	  Accession	  by	  Whole	  Genome	  Sequencing.	  Plant	  Cell	  Physiol	  52:716–722.	  	  Uchida	  N,	  Sakamoto	  T,	  Tasaka	  M,	  Kurata	  T	  (2014)	  Identification	  of	  EMS-­‐induced	  causal	  mutations	  in	  Arabidopsis	  thaliana	  by	  next-­‐generation	  sequencing.	  Methods	  Mol	  Biol	  1062:259–270.	  Unte	  US,	  Sorensen	  A-­‐M,	  Pesaresi	  P,	  et	  al.	  (2003)	  SPL8,	  an	  SBP-­‐Box	  Gene	  That	  Affects	  Pollen	  Sac	  Development	  in	  Arabidopsis.	  The	  Plant	  Cell.	  15:1009-­‐1019.	  van	  Tol	  RWHM,	  Swarts	  HJ,	  van	  der	  Linden	  A,	  Visser	  JH	  (2007)	  Repellence	  of	  the	  red	  bud	  borer	  Resseliella	  oculiperda	  from	  grafted	  apple	  trees	  by	  impregnation	  of	  rubber	  budding	  strips	  with	  essential	  oils.	  Pest	  Manag	  Sci	  63:483–490.	  	  Vranova	  E,	  Coman	  D,	  Gruissem	  W	  (2012)	  Structure	  and	  Dynamics	  of	  the	  Isoprenoid	  Pathway	  Network.	  Molecular	  Plant	  5:318–333.	  	  Weatherhead	  MA,	  Burdon	  J,	  Henshaw	  GG	  (1979)	  Effects	  of	  activated	  charcoal	  as	  an	  additive	  plant	  tissue	  culture	  media:	  part	  2.	  Zeitschrift	  für	  Pflanzenphysiologie.	  94(5):399-­‐405.	  	  Weatherhead	  MA,	  Burdon	  J,	  Henshaw	  GG	  (1978)	  Some	  effects	  of	  activated	  charcoal	  as	  an	  additive	  to	  plant	  tissue	  culture	  media.	  Zeitschrift	  für	  Pflanzenphysiologie.	  89(2):141-­‐147.	  Wolf	  JBW	  (2013)	  Principles	  of	  transcriptome	  analysis	  and	  gene	  expression	  quantification:	  an	  RNA-­‐seq	  tutorial.	  Mol	  Ecol	  Resour	  13:559–572.	  	  Woronuk	  G,	  Demissie	  Z,	  Rheault	  M,	  Mahmoud	  S	  (2010)	  Biosynthesis	  and	  Therapeutic	  Properties	  of	  Lavandula	  Essential	  Oil	  Constituents.	  Planta	  Med	  77:7–15.	  	  Wu	  B,	  Li	  Y,	  Yan	  H,	  et	  al.	  (2012)	  Comprehensive	  transcriptome	  analysis	  reveals	  novel	  genes	  involved	  in	  cardiac	  glycoside	  biosynthesis	  and	  mlncRNAs	  associated	  with	  secondary	  metabolism	  and	  stress	  response	  in	  Digitalis	  purpurea.	  BMC	  Genomics	  13:15.	  	  Xiang	  S,	  Usunow	  G,	  Lange	  G,	  et	  al.	  (2012)	  1-­‐Deoxy-­‐d-­‐Xylulose	  5-­‐Phosphate	  Synthase	  (DXS),	  a	  Crucial	  Enzyme	  for	  Isoprenoids	  Biosynthesis.	  In:	  Isoprenoid	  Synthesis	  in	  Plants	  and	  Microorganisms:	  New	  Concepts	  and	  Experimental	  Approaches.	  Springer	  New	  York,	  New	  York,	  NY,	  pp	  17–28	  Yanagisawa	  S	  (2004)	  Dof	  domain	  proteins:	  plant-­‐specific	  transcription	  factors	  associated	  with	  diverse	  phenomena	  unique	  to	  plants.	  Plant	  Cell	  Physiol	  45:386–391.	  Yang	  CQ,	  Fang	  X,	  Wu	  XM,	  Mao	  YB	  (2012)	  Transcriptional	  Regulation	  of	  Plant	  Secondary	  Metabolism.	  J	  Integrative	  Plant	  Biol.	  54(10):703-­‐712.	  	  	   132	  Yanhui	  C,	  Xiaoyuan	  Y,	  Kun	  H,	  et	  al.	  (2006)	  The	  MYB	  transcription	  factor	  superfamily	  of	  Arabidopsis:	  expression	  analysis	  and	  phylogenetic	  comparison	  with	  the	  rice	  MYB	  family.	  Plant	  Mol	  Biol	  60:107–124.	  	  Zambonelli	  A,	  D'Aulerio	  AZ,	  Bianchi	  A,	  Albasini	  A	  (1996)	  Effects	  of	  Essential	  Oils	  on	  Phytopathogenic	  Fungi	  In	  Vitro.	  J	  Phytopathol	  144:491–494.	  	  Zore	  GB,	  Thakre	  AD,	  Jadhav	  S,	  Karuppayil	  SM	  (2011)	  Terpenoids	  inhibit	  Candida	  albicans	  growth	  by	  affecting	  membrane	  integrity	  and	  arrest	  of	  cell	  cycle.	  Phytomedicine	  18:1181–1190.	  	  Zuzarte	  MR,	  Dinis	  AM,	  Cavaleiro	  C,	  et	  al.	  (2010)	  Trichomes,	  essential	  oils	  and	  in	  vitro	  propagation	  of	  Lavandula	  pedunculata	  (Lamiaceae).	  Industrial	  Crops	  and	  Products	  32:580–587.	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  !! H))!C@@*57")*>$C@@*57"D$C$E$%9(')9'(*$157$F1"5$G"&#&H")1#$1)9":"9"*>$&6$9?*$F1I&($*>>*59"1#$&"#$)&5>9"9'*59>$&6$#1:*57*($/>'G>*)9"&5$!"#"$%&'"2$6#&(1#$*>>*59"1#$&"#;$!"#$%&!GH(!U/8+3/+8&!#17!$-0%0.-3#%!#3/-6-/4!05!/>&!,#a08!5%08#%!&99&1/-#%!0-%!3019/-/+&1/9!05!%#6&17&8!?9+$9&3/-01!@#6#17+%#C=!@G"!F!)*+*,-%.*#.*0(12.(*=!DT"!F!)*+*,-%.*#6#(,03453-(*=!GTQ!F!)*+*,-%.*#*,/%$0(12.(*(!S010/&8E&1&! U/8+3/+8&! UE&3-&9!E8&9&1/!#9!#!,#a08!3019/-/+&1/!]-0#3/-6-/4! e&5&8&13&!@-1#%00%!!@G"=!DT"=!GTQ!-19&3/!8&E&%%&1/=$-19&3/-3-7#%=$#1/-5+1.#%=!#1/-$#3/&8-#%=!#1/-103-03&E/-6&=!#12-0%4/-3=!9&7#/-6&=!#1/-02-7#1/!?A#8901!#17!e-%&4!HKK'†!R&#1#!&/!#%(!MBB:†!G%6-#10!&/!#%(!MBB'†!R&#1#!&/!#%(!MBBL†!U5#8#!&/!#%(!MBBK†!S-/-~;+%#5-~!&/!#%(!MBBK†!A>8-9/&19901!&/!#%(!MBHB†!W&OO&8!&/!#%(!MBHH†!l08&!&/!#%(!MBHHC!@-1#%4%!#3&/#/&!!DT"=!GTQ!!#1/-5+1.#%=!#1/-$#3/&8-#%=!-19&3/-3-7#%=!9&7#/-6&!?"80,$&//#!&/!#%(!MBB'†!e0[,#1!&/!#%(!MBB<†!l08&!&/!#%(!MBHHC!H=I;A-1&0%&!!@G"=!DT"=!GTQ!D19&3/!8&E&%%&1/=!-19&3/-3-7&=$#1/-$#3/&8-#%=$#1/-5+1.#%=$E80;!#E0E/0/-3=!-,,+10,07+%#/084=!#1/-;-15%#,,#/084=!#1/-02-7#1/!?G$&!&/!#%(!MBB)†!e0[,#1!&/!#%(!MBBL†!e0[,#1!&/!#%(!MBB<†!S-/-~;+%#5-~!&/!#%(!MBBK†!`%#-99-!&/!#%(!MBHM†!S083-#!&/!#%(!MBHM†!T.#1!&/!#%(!MBHM†!f#,,&8!#17!f&&%!MBHM†!]#O&8!&/!#%(!MBHMC!A#,E>08!!@G"=!DT"!D19&3/!8&E&%%&1/=!-19&3/-3-7#%=$#1/-$#3/&8-#%=!#1/-5+1.#%=#1/-;,+93#8-1-3=!?`%;U>&-O>!&/!#%(!MBB'†!e0[,#1!&/!#%(!MBBL†!e0[,#1!&/!#%(!MBB<†!G3-O#%-1!&/!#%(!MBHM†!A>&1!&/!#%(!MBH)C!!! H):!S010/&8E&1&! U/8+3/+8&! UE&3-&9!E8&9&1/!#9!#!,#a08!3019/-/+&1/!]-0#3/-6-/4! e&5&8&13&!#1/-;3>0%-1&8.-3=!#1/-;103-03&E/-6&=!#1/-/+99-/-6&=!#1/-6-8#%!]081&0%!!@G"=!DT"=!GTQ!D19&3/!8&E&%%&1/=$-19&3/-3-7&=$-,,+10,07+%#/084=!#1/-;-15%#,,#/084=!#1/-$#3/&8-#%=!WTG;E80/&3/-6&!?G$&!&/!#%(!MBB)†!e0[,#1!&/!#%(!MBB<†!U%#,&106w!&/!#%(!MBBK†!A%047!&/!#%(!MBHH†!T.#1!&/!#%(!MBHM†!]#O&8!&/!#%(!MBHMC!@#6#17+%4%!#3&/#/&!!GTQ=!@G"=!DT"!]#3/&8-09/#/-3! ?U0O06-3!#17!6#1!Q8-&196&1!MBBLC!`Zl!X3-,&1&!!GTQ=!DT"!D19&3/!8&E&%%&1/!?W&OO&8!&/!#%(!MBHHC!!;Z!";R-1&1&!!@G"! G1/-$#3/&8-#%=!#1/-5+1.#%=!-19&3/!8&E&%%&1/!?fP#1.!&/!#%(!HKI'†!S0+8&4!#17!A#1-%%#3!MBBM†!Q%#,03%-a#!&/!#%(!MBBKC!";A#840E>4%%&1&!!GTQ=!DT"!D19&3/!8&E&%%&1/=!#1/-$#3/&8-#%!?g+%-#1-!&/!#%(!MBBM†!W&OO&8!&/!#%(!MBHH†!X>!&/!#%(!MBHMC!!! H)'!S010/&8E&1&! U/8+3/+8&! UE&3-&9!E8&9&1/!#9!#!,#a08!3019/-/+&1/!]-0#3/-6-/4! e&5&8&13&!S483&1&!!DT"! D19&3/!8&E&%%&1/=!#1/-;103-03&E/-6&=!9&7#/-6&=!#1#%.&9-3=!#1/-02-7#1/!?@08&1[&//-!&/!#%(!HKKH†!Q+8.&%!70!^#%&!&/!#%(!MBBM†!S-/-~;+%#5-~!&/!#%(!MBBK†!A#$#%%&80;Q#%%#870!&/!#%(!MBHH†!R#+%#;*8&-8&!&/!#%(!MBH)C!*#81&9&1&!!DT"! D19&3/!8&E&%%&1/=!7-98+E/-01!05!-19&3/!#3/-6-/4!?5&&7-1.=!508#.-1.=!,#/-1.C!?U+3O%-1.!&/!#%(!MBHM†!@pE&[!&/!#%(!MBH)†!U/&%-19O-!&/!#%(!MBH)†!g0#3>-,!&/!#%(!MBH)C!Q&8,#38&1&!!DT"! G1/-$#3/&8-#%=!G1/-;3#13&8=!-19&3/!8&E&%%&1/!?X>!&/!#%(!MBHM†!7#!U-%6#!&/!#%(!MBH)†!S08#!&/!#%(!MBH)C!A#,E>&1&!!@G"! G1/-5+1.#%! ?S080!&/!#%(!MBH)C!@-,01&1&!!@G"! D19&3/-3-7&=!#1/-$#3/&8-#%=!#1/-5+1.#%=!,+93%&!8&%#2#1/=!9&7#/-6&!?G..#8P#%!&/!#%(!MBBH†!Q+8.&%!70!^#%&!&/!#%(!MBBM†!U5#8#!&/!#%(!MBBK†!Q%#,03%-a#!&/!#%(!MBBKC!!$$$$$$$$!! H)L!C@@*57"D$J$E$859*(1)9"&5>$@#&9>$6&($@&#K1F"5*$9(*19F*59>$$$*-.+8&!]H(!D1/&8#3/-019!E%0/!508!9E&8,-1&!/8&#/,&1/!#/!50+8!3013&1/8#/-019!B=!HB=!HBB!#17!HBBB!+S!#17!/P0!,&7-#!/4E&9=!SU!#17!VRS(!R#8#%%&%!%-1&9!-17-3#/&!10!9-.1-5-3#1/!-1/&8#3/-01=!P>-%&!#!9>-5/!-1!9%0E&!-17-3#/&9!#1!-1/&8#3/-01!-9!E8&9&1/(!!!020406080Mediamean of  Rooting.EfficiencyMS WPM   Concentration0100101000!! H)<!!*-.+8&!]M(!D1/&8#3/-019!E%0/!508!9E&8,-7-1&!/8&#/,&1/!#/!50+8!3013&1/8#/-019!B=!HB=!HBB!#17!HBBB!+S!#17!/P0!,&7-#!/4E&9=!SU!#17!VRS(!R#8#%%&%!%-1&9!-17-3#/&!10!9-.1-5-3#1/!-1/&8#3/-01=!P>-%&!#!9>-5/!-1!9%0E&!-17-3#/&9!#1!-1/&8#3/-01!-9!E8&9&1/(!!!!1020304050607080Mediamean of  Rooting.EfficiencyMS WPM   Concentration0101001000!! H)I!!*-.+8&!])(!D1/&8#3/-019!E%0/!508!E+/8&93-1&!/8&#/,&1/!#/!50+8!3013&1/8#/-019!B=!HB=!HBB!#17!HBBB!+S!#17!/P0!,&7-#!/4E&9=!SU!#17!VRS(!R#8#%%&%!%-1&9!-17-3#/&!10!9-.1-5-3#1/!-1/&8#3/-01=!P>-%&!#!9>-5/!-1!9%0E&!-17-3#/&9!#1!-1/&8#3/-01!-9!E8&9&1/(!50556065707580Mediamean of  Rooting.EfficiencyMS WPM   Concentration0101000100!! H)K!C@@*57"D$,$E$%91571(7$)'(:*>$6&($1G>&#'9*$L'159"6")19"&5$&6$*>>*59"1#$&"#$>1F@#*>$$!*-.+8&!AH(!U/#17#87!3+86&!508!#%E>#;$-9#$0%0%!9/#17#87(!!!! H:B!!*-.+8&!AM(!U/#17#87!3+86&!508!$081&0%!9/#17#87(!!!! H:H!!*-.+8&!A)(!U/#17#87!3+86&!508!v;3#7-10%!!9/#17#87(!!!! H:M!!*-.+8&!A:(!U/#17#87!3+86&!508!3#,E>08!9/#17#87(!!!! H:)!!*-.+8&!A'(!U/#17#87!3+86&!508!3#8&1&!9/#17#87(!!!! H::!!*-.+8&!AL(!U/#17#87!3+86&!508!3#840E>4%%&1&!9/#17#87(!!!! H:'!!*-.+8&!A<(!U/#17#87!3+86&!508!H=I;3-1&0%&!9/#17#87	  	   146	  Appendix	  D	  –	  Primer	  Efficiencies	  	  Table	  D1.	  Mean	  primer	  efficiency	  across	  all	  tissue	  types	  as	  calculated	  by	  linreg	  analysis	  Gene Function Contig ID Mean Efficiency (% )  transcription factor 17057 91 transcription factor 14504 72 transcription factor 10411 71 transcription factor 17452 89 transcription factor 5015 90 transcription factor 4954 89 transcription factor 6102 80 isoprenoid biosynthesis 10341 84 isoprenoid biosynthesis 10355 88 isoprenoid biosynthesis 15232 88 isoprenoid biosynthesis 2579 83 isoprenoid biosynthesis 2580 85 isoprenoid biosynthesis 9781 83 isoprenoid biosynthesis HMGS  99 isoprenoid biosynthesis HMGR  99 terpene synthase 1894 78 terpene synthase 2929 89 terpene synthase 2521 89 terpene synthase 7138 90 terpene synthase 3866 93 terpene synthase 7139 93 terpene synthase 7765 89 terpene synthase 1895 90 terpene synthase 2279 90 terpene synthase 2520 84 terpene synthase 2522 94 terpene synthase 4905 88 terpene synthase 1742 89 terpene synthase 7411 89 terpene synthase 1740 81 terpene synthase 1741 81 terpene synthase CINS  86 terpene synthase BDH  89 terpene synthase UTPS1 99 terpene synthase UTPS3 99 reference gene actin 80 reference gene 18SrRNA  87 !! H:<!$C@@*57"D$N$E$%*#*)9"&5$&6$LM,B$(*6*(*5)*$H*5*>$!!!*-.+8&!`H!`2E8&99-01!%&6&%9!05!3#17-7#/&!8&5&8&13&!.&1&9b!+$-_+-/-1=!#3/-1=!HIU!8eTG!#17!MLU!8eTG!#38099!#%%!/-99+&!9#,E%&9!-13%+7-1.!$0/>!,+/#1/!#17!P-%7;/4E&!3#%3+%#/&7!$4!.%0$#%!108,#%-[#/-01(!G3/-1!#17!HIU!8eTG!P&8&!9&%&3/&7!#9!8&5&8&13&!.&1&9!508!5+8/>&8!#1#%49-9!7+&!/0!%0P&8!A_!6#%+&9!#17!7&38&#9&7!6#8-#$-%-/4!#38099!9#,E%&9(!!!	  	   148	  	  Figure	  E2	  Amplification	  plots	  of	  candidate	  reference	  genes:	  (a)	  18s	  rRNA,	  (b)	  26S	  rRNA,	  (c)	  actin,	  (d)	  ubiquitin.	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  	  a bc d!! H:K!C@@*57"D$O$E$M#&9>$&6$LM,B$7191$$!!*-.+8&!*H(!W-55&8&1/-#%!&2E8&99-01!#1#%49-9!$4!_RAe!05!P-%7;/4E&!E%#1/9!#.#-19/!/&8E&1&!941/>#9&!.&1&9=!9-.1-5-3#1/!7-55&8&13&9!$&/P&&1!.80+E9!P#9!7&/&8,-1&7!$4!GTX^G!#1#%49-9!#17!,+%/-E%&!30,E#8-9019!,07&%!P-/>!9-.1-5-3#1/!7-55&8&13&9!-17-3#/&7!$4!7-55&8&1/!%&//&89(!S&#1!50%7!3>#1.&!6#%+&9!#8&!E%0//&7!P-/>!&8808!$#89!8&E8&9&1/-1.!9/#17#87!&8808!05!/>&!,&#1(!S"RU!d!,010/&8E&1&!941/>#9&†!"RU!d!/&8E&1&!941/>#9&(!!!!! H'B!!*-.+8&!*M(!W-55&8&1/-#%!&2E8&99-01!#1#%49-9!$4!_RAe!05!/&8E&1&!941/>#9&!.&1&9!-1!P-%7;/4E&!E%#1/9(!U-.1-5-3#1/!7-55&8&13&9!$&/P&&1!.80+E9!P&8&!7&/&8,-1&7!$4!GTX^G!#1#%49-9!#17!,+%/-E%&!30,E#8-9019!,07&%!P-/>!9-.1-5-3#1/!7-55&8&13&9!-17-3#/&7!$4!7-55&8&1/!%&//&89(!S&#1!50%7!3>#1.&!6#%+&9!#8&!E%0//&7!P-/>!&8808!$#89!8&E8&9&1/-1.!9/#17#87!&8808!05!/>&!,&#1(!"RU!d!/&8E&1&!941/>#9&(!!! H'H!!*-.+8&!*)(!W-55&8&1/-#%!&2E8&99-01!#1#%49-9!$4!_RAe!05!/&8E&1&!941/>#9&!.&1&9!-1!P-%7;/4E&!E%#1/9(!U-.1-5-3#1/!7-55&8&13&!$&/P&&1!.80+E9!P#9!7&/&8,-1&7!$4!GTX^G!#1#%49-9!#17!,+%/-E%&!30,E#8-9019!,07&%!P-/>!9-.1-5-3#1/!7-55&8&13&9!-17-3#/&7!$4!7-55&8&1/!%&//&89(!S&#1!50%7!3>#1.&!6#%+&9!#8&!E%0//&7!P-/>!&8808!$#89!8&E8&9&1/-1.!9/#17#87!&8808!05!/>&!,&#1(!]Wf!d!$081&0%!7&>4780.&1#9&†!ADTU!d!3-1&0%&!941/>#9&†!AGWU!d!3#7-10%!941/>#9&†!"RU!d!/&8E&1&!941/>#9&(!!!! H'M!!*-.+8&!*:(!W-55&8&1/-#%!&2E8&99-01!#1#%49-9!05!$4!_RAe!/&9/&7!#.#-19/!.&1&9!-160%6&7!-1!-90E8&10-7!E8&3+8908!$-0941/>&9-9!-1!P-%7;/4E&!E%#1/9(!U-.1-5-3#1/!7-55&8&13&!$&/P&&1!.80+E9!P#9!7&/&8,-1&7!$4!GTX^G!#1#%49-9!#17!,+%/-E%&!30,E#8-9019!,07&%!P-/>!9-.1-5-3#1/!7-55&8&13&9!-17-3#/&7!$4!7-55&8&1/!%&//&89(!S&#1!50%7!3>#1.&!6#%+&9!#8&!E%0//&7!P-/>!&8808!$#89!8&E8&9&1/-1.!9/#17#87!&8808!05!/>&!,&#1(!fSQe!d!);>478024;);,&/>4%.%+/#84%!30G!8&7+3/#9&†!S^GRR!d!,&6#%01#/&!7-E>09E>#/&(!!!! H')!!*-.+8&!*'(!W-55&8&1/-#%!&2E8&99-01!#1#%49-9!$4!_RAe!/&9/&7!#.#-19/!/8#1938-E/-01!5#3/08!.&1&9!-160%6&7!-1!8&.+%#/-01!05!-90E8&10-7!$-0941/>&9-9!-1!P-%7;/4E&!E%#1/9(!U-.1-5-3#1/!7-55&8&13&!$&/P&&1!.80+E9!P#9!7&/&8,-1&7!$4!GTX^G!#1#%49-9!#17!,+%/-E%&!30,E#8-9019!,07&%!P-/>!9-.1-5-3#1/!7-55&8&13&9!-17-3#/&7!$4!7-55&8&1/!%&//&89(!S&#1!50%7!3>#1.&!6#%+&9!#8&!E%0//&7!P-/>!&8808!$#89!8&E8&9&1/-1.!9/#17#87!&8808!05!/>&!,&#1(!!!! H':!!*-.+8&!*L(!W-55&8&1/-#%!&2E8&99-01!#1#%49-9!$4!_RAe!05!,+/#1/!%&#5!9#,E%&9!#.#-19/!/&8E&1&!941/>#9&!.&1&9=!9-.1-5-3#1/!7-55&8&13&!$&/P&&1!.80+E9!P#9!7&/&8,-1&7!$4!GTX^G!#1#%49-9!#17!,+%/-E%&!30,E#8-9019!,07&%!30,E#8&7!/0!P-%7;/4E&!Q80990!%&#5!9#,E%&9!P-/>!9-.1-5-3#1/!7-55&8&13&9!-17-3#/&7!$4!7-55&8&1/!%&//&89(!S&#1!50%7!3>#1.&!6#%+&9!#8&!E%0//&7!P-/>!&8808!$#89!8&E8&9&1/-1.!9/#17#87!&8808!05!/>&!,&#1(!G%%!,+/#1/9!#8&!108,#%-[&7!#.#-19/!/>&!#6&8#.&!05!/>&!P-%7;/4E&!9#,E%&(!S"RU!d!,010/&8E&1&!941/>#9&!!! H''!!*-.+8&!*<(!W-55&8&1/-#%!&2E8&99-01!#1#%49-9!$4!_RAe!05!,+/#1/!%&#5!9#,E%&9!#.#-19/!/&8E&1&!941/>#9&!.&1&9=!9-.1-5-3#1/!7-55&8&13&!$&/P&&1!.80+E9!P#9!7&/&8,-1&7!$4!GTX^G!#1#%49-9!#17!,+%/-E%&!30,E#8-9019!,07&%!30,E#8&7!/0!P-%7;/4E&!Q80990!%&#5!9#,E%&9!P-/>!9-.1-5-3#1/!7-55&8&13&9!-17-3#/&7!$4!‡!?E!ˆ!B(B'CZ‡‡!?E!ˆ!B(BHC(!S&#1!50%7!3>#1.&!6#%+&9!#8&!E%0//&7!P-/>!&8808!$#89!8&E8&9&1/-1.!9/#17#87!&8808!05!/>&!,&#1(!G%%!,+/#1/9!#8&!108,#%-[&7!#.#-19/!/>&!#6&8#.&!05!/>&!P-%7;/4E&!9#,E%&(!!]Wf!d!$081&0%!7&>4780.&1#9&†!AGWU!d!3#7-10%!941/>#9&(!!! H'L!!*-.+8&!*I(!W-55&8&1/-#%!&2E8&99-01!#1#%49-9!$4!_RAe!05!,+/#1/!%&#5!9#,E%&9!#.#-19/!.&1&9!-160%6&7!-1!-90E8&10-7!E8&3+8908!$-0941/>&9-9(!U-.1-5-3#1/!7-55&8&13&!$&/P&&1!.80+E9!P#9!7&/&8,-1&7!$4!GTX^G!#1#%49-9!#17!,+%/-E%&!30,E#8-9019!,07&%!30,E#8&7!/0!P-%7;/4E&!Q80990!%&#5!9#,E%&9!P-/>!9-.1-5-3#1/!7-55&8&13&9!-17-3#/&7!$4!‡!?E!ˆ!B(B'CZ‡‡!?E!ˆ!B(BHC(!S&#1!50%7!3>#1.&!6#%+&9!#8&!E%0//&7!P-/>!&8808!$#89!8&E8&9&1/-1.!9/#17#87!&8808!05!/>&!,&#1(!G%%!,+/#1/9!#8&!108,#%-[&7!#.#-19/!/>&!#6&8#.&!05!/>&!P-%7;/4E&!9#,E%&(!!fSQe!d!);>478024;);,&/>4%.%+/#84%!30G!8&7+3/#9&†!S^GRR!d!,&6#%01#/&!7-E>09E>#/&(!!! H'<!!*-.+8&!*K(!W-55&8&1/-#%!&2E8&99-01!#1#%49-9!$4!_RAe!05!,+/#1/!%&#5!9#,E%&9!#.#-19/!/8#1938-E/-01!5#3/08!.&1&9!-160%6&7!-1!8&.+%#/-01!05!-90E8&10-7!$-0941/>&9-9(!U-.1-5-3#1/!7-55&8&13&!$&/P&&1!.80+E9!P#9!7&/&8,-1&7!$4!GTX^G!#1#%49-9!#17!,+%/-E%&!30,E#8-9019!,07&%!30,E#8&7!/0!P-%7;/4E&!Q80990!%&#5!9#,E%&9!P-/>!9-.1-5-3#1/!7-55&8&13&9!-17-3#/&7!$4!‡!?E!ˆ!B(B'CZ‡‡!?E!ˆ!B(BHC(!S&#1!50%7!3>#1.&!6#%+&9!#8&!E%0//&7!P-/>!&8808!$#89!8&E8&9&1/-1.!9/#17#87!&8808!05!/>&!,&#1(!G%%!,+/#1/9!#8&!108,#%-[&7!#.#-19/!/>&!#6&8#.&!05!/>&!P-%7;/4E&!9#,E%&(!!!!!! H'I!!!*-.+8&!*HB(!W-55&8&1/-#%!&2E8&99-01!#1#%49-9!$4!_RAe!05!,+/#1/!5%0P&8!9#,E%&9!#.#-19/!/&8E&1&!941/>#9&!.&1&9=!9-.1-5-3#1/!7-55&8&13&!$&/P&&1!.80+E9!P#9!7&/&8,-1&7!$4!GTX^G!#1#%49-9!#17!,+%/-E%&!30,E#8-9019!,07&%!30,E#8&7!/0!P-%7;/4E&!Q80990!5%0P&8!9#,E%&9!P-/>!9-.1-5-3#1/!7-55&8&13&9!-17-3#/&7!$4!7-55&8&1/!%&//&89(!S&#1!50%7!3>#1.&!6#%+&9!#8&!E%0//&7!P-/>!&8808!$#89!8&E8&9&1/-1.!9/#17#87!&8808!05!/>&!,&#1(!G%%!,+/#1/9!#8&!108,#%-[&7!#.#-19/!/>&!#6&8#.&!05!/>&!P-%7;/4E&!9#,E%&(!S"RU!d!,010/&8E&1&!941/>#9&!!! H'K!!*-.+8&!*HH(!W-55&8&1/-#%!&2E8&99-01!#1#%49-9!$4!_RAe!05!,+/#1/!5%0P&8!9#,E%&9!#.#-19/!.&1&9!-160%6&7!-1!-90E8&10-7!E8&3+8908!$-0941/>&9-9(!U-.1-5-3#1/!7-55&8&13&!$&/P&&1!.80+E9!P#9!7&/&8,-1&7!$4!GTX^G!#1#%49-9!#17!,+%/-E%&!30,E#8-9019!,07&%!30,E#8&7!/0!P-%7;/4E&!Q80990!%&#5!9#,E%&9!P-/>!9-.1-5-3#1/!7-55&8&13&9!-17-3#/&7!$4!‡!?E!ˆ!B(B'CZ‡‡!?E!ˆ!B(BHC(!S&#1!50%7!3>#1.&!6#%+&9!#8&!E%0//&7!P-/>!&8808!$#89!8&E8&9&1/-1.!9/#17#87!&8808!05!/>&!,&#1(!G%%!,+/#1/9!#8&!108,#%-[&7!#.#-19/!/>&!#6&8#.&!05!/>&!P-%7;/4E&!9#,E%&(!!fSQe!d!);>478024;);,&/>4%.%+/#84%!30G!8&7+3/#9&†!S^GRR!d!,&6#%01#/&!7-E>09E>#/&(!!! HLB!!*-.+8&!*HM(!W-55&8&1/-#%!&2E8&99-01!#1#%49-9!$4!_RAe!05!,+/#1/!5%0P&8!9#,E%&9!#.#-19/!/8#1938-E/-01!5#3/08!.&1&9!-160%6&7!-1!8&.+%#/-01!05!-90E8&10-7!$-0941/>&9-9(!U-.1-5-3#1/!7-55&8&13&!$&/P&&1!.80+E9!P#9!7&/&8,-1&7!$4!GTX^G!#1#%49-9!#17!,+%/-E%&!30,E#8-9019!,07&%!30,E#8&7!/0!P-%7;/4E&!Q80990!%&#5!9#,E%&9!P-/>!9-.1-5-3#1/!7-55&8&13&9!-17-3#/&7!$4!‡!?E!ˆ!B(B'CZ‡‡!?E!ˆ!B(BHC(!S&#1!50%7!3>#1.&!6#%+&9!#8&!E%0//&7!P-/>!&8808!$#89!8&E8&9&1/-1.!9/#17#87!&8808!05!/>&!,&#1(!G%%!,+/#1/9!#8&!108,#%-[&7!#.#-19/!/>&!#6&8#.&!05!/>&!P-%7;/4E&!9#,E%&(!!!

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0074431/manifest

Comment

Related Items