Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The effect of FAD-associated mutations in amyloid-beta precursor protein and presenilin-1 genes on Alzheimer’s… Zhang, Shuting 2013

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2013_fall_zhang_shuting.pdf [ 8.87MB ]
Metadata
JSON: 24-1.0074224.json
JSON-LD: 24-1.0074224-ld.json
RDF/XML (Pretty): 24-1.0074224-rdf.xml
RDF/JSON: 24-1.0074224-rdf.json
Turtle: 24-1.0074224-turtle.txt
N-Triples: 24-1.0074224-rdf-ntriples.txt
Original Record: 24-1.0074224-source.json
Full Text
24-1.0074224-fulltext.txt
Citation
24-1.0074224.ris

Full Text

   THE EFFECT OF FAD-ASSOCIATED MUTATIONS IN AMYLOID-BETA PRECURSOR PROTEIN  AND PRESENILIN-1 GENES ON ALZHEIMER?S DISEASE PATHOGENESIS   by   Shuting Zhang   M.D., West China Medical School, Sichuan University, 2005 M.Sc., West China Medical School, Sichuan University, 2008   A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF  THE REQUIREMENTS FOR THE DEGREE OF   DOCTOR OF PHILOSOPHY   in  THE FACULTY OF GRADUATE STUDIES  (Neuroscience)   THE UNIVERSITY OF BRITISH COLUMBIA  (Vancouver)    April 2013  ? Shuting Zhang, 2013       ii      Abstract   Pathogenic mutations in amyloid-? precursor protein (APP) and presenilins (PS) genes cause familial Alzheimer?s disease (FAD). FAD is an uncommon form of Alzheimer?s disease (AD) with early onset (before age 65) and a rapid progression but its neuropathology is indistinguishable from the sporadic AD. Amyloid plaque is the unique hallmark of AD, which consists primarily of 40- and 42-residue amyloid ? protein (A?40 and A?42) with the more hydrophobic A?42 as its major component. A? is derived from APP through sequential cleavages by ?-secretase and ?-secretase. According to the ?Amyloid hypothesis?, A? accumulation initiates the pathogenic cascades leading to AD, including the formation of neurofibrillary tangles, activation of astrocytes and neuronal loss. It has been well established that pathogenic mutations in both APP and PS genes contribute to AD pathogenesis via impaired generation of A?. This powerful genetic discovery lends great credence to the ?Amyloid hypothesis?, given that APP is the precursor of A? and PS acts as the enzyme to generate A?. The thorough understanding of the mechanism of these pathogenic mutations could lead to decipher the AD conundrum.  Until now, all pathogenic APP mutations are autosomal dominant mutations except for APPA673V. We discovered that APPA673V structurally facilitates ?-cleavage at Asp-1 site while inhibited the general APP processing including all ?-/?-/?-cleavages possibly due to the intensified lysosome-dependent degradation. The overall effect of APPA673V on the production of A? makes the homozygous state necessary for APPA673V to produce enough A? to initiate AD pathogenesis. Mutations in PS genes are another major cause of FAD. As another substrate of ?-secretase apart from APP, Notch plays a fundamental role in neurodevelopment and neurodegeneration. It has been well established that        iii      pathogenic PS mutations impaired Notch signaling. PS1?S169 is a recently discovered PS1 mutation in a Chinese FAD family. We extensively characterized the function of PS1?S169 in mammalian cells and transgenic mice and found that PS1?S169 promoted AD pathogenesis via altering ?-cleavage of APP without impairing Notch processing, excluding the contribution of Notch signaling to AD pathogenesis. Our study highlights the possibility of developing specific ?-secretase inhibitors, which may spare Notch signaling in AD therapy.   iii  Preface  Immediately after completing a postgraduate training with Master degree in Neurology, I joined Dr. Weihong Song?s research team to study the molecular pathogenesis of Alzheimer?s disease. I was fortunate to be introduced to a project to study a novel pathological Presenilin 1 (PS1) mutation ? PS1?S169 identified in a Chinese AD family. From January of 2008, Dr. Fang Cai, a post doctorate and lab manager, and I worked on reexamining all the sequences of gDNA samples from this family and confirmed the segregation of PS1?S169 with the early-onset of AD in this FAD family with FAD. In chapter 3, with the assistance of Dr. Cai, I generated a construct harboring PS1?S169 and started the characterization of this novel mutation in vitro. I generated the stable cell lines expressing different PS1 variants, including PS1?S169. The cell lines 20E2 and HAW, the plasmids pcDNA4-PS1WT, pcDNA4-PS1Y115H, and pcDNA4-PS1C410Y as well as Notch constructs were previously generated in Dr. Song?s laboratories. Shortly after the confirmation of the effect of PS1?S169 on APP processing in vitro, Dr. Cai and I started establishing transgenic mice that overexpressed PS1?S169 in 2008. Working together with Dr. Cai, we generated a construct expressing PS1?S169 under the mouse neuron specific promoter Thy1. The construct was sent to British Columbia Preclinical Research Consortium for pronuclear microinjection to generate transgenic mice. Dr. Cai designed the primers to genotype the first generation of founder of the heterozygous PS1?S169 transgenic founder mice. Then, PS1?S169 transgenic mice were bred and crossed with APP23 mice and Ms. Haiyan Zou, a former technician in our laboratory, did most of the genotyping work. Dr. Cai did most work in copy number determination.  In chapter 4, I    Preface       iv      assisted the work of genotyping and copy number determination and did more than 70% of the behavior tests. Dr. Cai, Daochao Huang and Yi Yang performed the remaining 30% behavior tests. Daochao Huang was a former visiting scholar and Yi Yang is the graduate student in our laboratory. Dr. Cai and I also carried out all the mice tissue collection work. Dr. Cai trained me on how to perform a histopathological analysis of mice brain under standardized procedures for the detection of neuritic plaques in brain sections (Ly PPT, Cai F., Song W. (2011) Detection of Neuritic plaques in Alzheimer?s disease mouse model. Journal of Visual Experiment. E2831).    Since my project was mainly focusing on FAD-associated mutations, in the middle of my PhD training (in April of 2011) , Dr. Song gave me another project on the recessive APP mutation ? APPA673V (Chapter 2). Under the supervision of Dr. Song I worked on this project, which included the generation and characterization of constructs and stable cell lines. Dr. Zhe Wang, a postdoctorate in our laboratory, and I worked together in studying the maturation and degradation of APP in chapter 2.  Mingming Zhang, a graduate student in our research team, and I performed toxicity assays of A?A2V in primary neurons.   In Chapter 1, a large proportion of Section 1.4 concerning ?-secretase has been submitted for review for publication. I wrote the first draft and am the first-author on the manuscript. Mingming Zhang and Dr. Cai provided the assistance and co-write the final version of manuscript. All procedures in Chapter 4 were approved by the University of British Columbia Animal Care Committee (Protocols A05-1888, A10-0040, and A06-0007). v  Table of contents   Abstract .............................................................................................................. ii!Preface ............................................................................................................... iii!Table of contents ............................................................................................... v!List of tables ...................................................................................................... xi!List of figures ................................................................................................... xii!List of abbreviations ...................................................................................... xiv!Acknowledgements ........................................................................................ xvii!Dedication ....................................................................................................... xix!Chapter 1   General introduction .................................................................... 1!1.1! Dementia and Alzheimer?s disease. ........................................................... 1!1.1.1  Pathological features of AD. ............................................................ 3!1.1.2  Mutations in APP, PS1&PS2 genes and FAD. ................................ 5 1.1.3  Genetic risk factors and sporadic AD. ............................................. 6 1.2! Amyloid hypothesis. .................................................................................. 8!1.2.1  Amyloid-beta precursor protein (APP). ......................................... 12 1.2.2  APP processing and A? generation. .............................................. 16 1.2.3  A? ? A two-edged sword: physiological and pathological roles. 19 1.2.4  A? oligomer and the toxicity. ........................................................ 21 1.3! BACE1 and ?-secretase in Alzheimer?s disease. ..................................... 22!1.3.1  Tight regulation of BACE1 gene expression. ................................ 23 1.3.2  BACE1 processes APP at major Glu-11 and minor Asp-1 sites. .. 25   Table of contents      vi      1.3.3  BACE1 and AD therapy. ............................................................... 26 1.4! ?-secretase complex. ................................................................................. 27!1.4.1  Presenilins. ..................................................................................... 28 1.4.2  ?-Secretase complex assembly. ...................................................... 30 1.4.3  Structure of ?-Secretase complex. ................................................. 32 1.4.4  APP and Notch as classical substrates. .......................................... 34 1.4.5  ?-secretase cleavages at ?-site and ?-site. ...................................... 35 1.4.6  ?-secretase inhibitors (GSIs) and modulators (GSMs). ................. 36 1.5! Familial Alzheimer?s disease (FAD)-associated mutations. .................... 37!1.5.1  FAD-associated APP mutations. ................................................... 38 1.5.2  FAD-associated PS1 mutations. .................................................... 40 1.6! Overall goal of this research .................................................................... 41!1.6.1  Examine the pathogenic effect of APPA673V  on AD pathogenesis. ................................................................................ 41 1.6.2  Study of the effects of PS1?S169 on APP and Notch processing. 42 1.6.3  Examining the effect of PS1?S169 on plaque formation  and memory deficits in vivo. ................................................................... 43 Chapter 2   APP A673V recessive mutation promotes A? generation by promoting ?-cleavage at Asp-1 site and enhancing lysosomal degradation of APP ............................................................................................................... 44!2.1! Introduction. ............................................................................................. 44!2.2! Methods. ................................................................................................... 46!2.2.1  Materials. ....................................................................................... 46 2.2.2  cDNA constructs. ........................................................................... 47 2.2.3  Cell lines, cell culture and transfection. ......................................... 48 2.2.4  APP-inducible expression and Ponasterone A treatment. ............. 48 2.2.5  Immunoblot analysis. ..................................................................... 49 2.2.6  A?40/42 enzyme linked-immunosorbent assay (ELISA). ............. 49   Table of contents      vii      2.2.7  L-685,458, Monensin, cycloheximide (CHX), chloroquine (CHL) and MG132 treatment. ............................................................................. 50 2.2.8  Primary neuronal culture, A? toxicity treatment and LDH assay. 50 2.3! Results. ..................................................................................................... 51!2.3.1  APPA673V recessive mutation moderately  increased A? generation. ......................................................................... 51 2.3.2  APPA673V recessive mutation promoted C99 production by shifting the major ?-secretase site from Glu-11 to Asp-1 site. ................ 52 2.3.3  APPA673V recessive mutation modulated ?-secretase activity. ... 55 2.3.4  APPA673V demonstrated a higher C99/C89 ratio than Swedish APP independently of its expression level. ............................................. 58 2.3.5  APPA673V structurally facilitated ?-secretase cleavage at Asp-1 site in both the endoplasmic reticulum and trans Golgi network. ........... 60 2.3.6  Modified APPA673V underwent faster  lysosome-dependent degradation than APPWT. ..................................... 61 2.3.7  The toxicity of A?A2V on primary neurons. ................................ 65 2.4! Discussion. ............................................................................................... 66!2.5! Conclusion. ............................................................................................... 70!Chapter 3   PS1?S169 impairs ?-cleavage of APP but reserves functional ?-cleavage of Notch ......................................................................................... 71!3.1! Introduction. ............................................................................................. 71!3.2! Methods. ................................................................................................... 73!3.2.1  Materials. ....................................................................................... 73 3.2.2  cDNA constructs. ........................................................................... 74 3.2.3  Cell culture and transfection. ......................................................... 74 3.2.4  Immunoblot analysis. ..................................................................... 75 3.2.5  A?40/42 Enzyme linked-immunosorbent assay (ELISA). ............ 76   Table of contents      viii      3.3! Results. ..................................................................................................... 76!3.3.1  Generation of PS1?S169 and other PS1 mutants. ......................... 76 3.3.2  PS1?S169 underwent normal endoproteolysis. ............................. 79 3.3.3  PS1?S169 demonstrated impaired APP cleavage activity and an increased A?42/40 ratio. .......................................................................... 81 3.3.4  PS1?S169 cleaved Notch with normal enzymatic efficiency. ...... 84 3.4! Discussion. ............................................................................................... 86!3.5! Conclusion. ............................................................................................... 89!Chapter 4   PS1?S169 promotes AD pathogenesis  in vivo .......................... 90!4.1! Introduction. ............................................................................................. 90!4.2! Methods. ................................................................................................... 93!4.2.1  Genomic DNA isolation ................................................................ 93 4.2.2  Transgenic mouse generation. ....................................................... 93 4.2.3. Real-time PCR and copy number estimation. ................................ 94 4.2.4  Body weight measurement and Rotorad test. ................................ 95 4.2.5  Neuritic Plaque Staining. ............................................................... 95 4.2.6  Morris Water Maze. ....................................................................... 96 4.2.7  Contextual fear conditioning. ........................................................ 96 4.3! Results. ..................................................................................................... 97!4.3.1  Generation and characterization of APP23/PS1?S169 double transgenic mice. ....................................................................................... 97 4.3.2  APP23/PS1?S169 mice carry two copies of  the human PS1?S169. ............................................................................. 99 4.3.3  APP processing and A? generation in APP23/ PS1?S169 double transgenic mice. ..................................................................................... 100 4.3.4  PS1?S169 promoted neuritic plaque formation in  the transgenic mice. ............................................................................... 101   Table of contents      ix      4.3.5  APP23/PS1?S169 double transgenic mice exhibited age-dependent memory impairment at 3 months of age. ............................................... 104 4.4! Discussion. ............................................................................................. 107!4.5! Conclusion. ............................................................................................. 111!Chapter 5   Discussions and future directions ............................................ 112!5.1! Revisiting the ?Amyloid hypothesis?. .................................................... 112!5.1.1  Possible explanations to the paradox in  the  ?Amyloid hypothesis?. .................................................................... 113 5.1.2  ?Amyloid hypothesis? and novel risk factors in l ate-onset sporadic AD. ........................................................................... 114 5.1.3  Linking early-onset FAD with late-onset sporadic AD. .............. 115 5.2! The significance of the research. ............................................................ 116!5.2.1  The comprehensive effect of APPA673V on  the metabolism of APP. ......................................................................... 117 5.2.2  The effect of PS1?S169 on APP processing and  Notch signaling. ..................................................................................... 118 5.3! Limitations of the research. .................................................................... 120!5.3.1  Lack of strong genetic evidence for APPA673V   being as the recessive mutation. ............................................................ 120 5.3.3  Lack of evidence of APP trafficking in neuronal model. ............ 120 5.3.4  Limitations in the investigation of the effect of PS1?S169 on ?-cleavage. ......... 121 5.3.5  Development of PS1?S169 knock-in transgenic mice. ............... 122 5.4! Potential application and future research. .............................................. 122!5.4.1  Linkage disequilibrium analysis of the family carrying APP A673V mutation and PCR-restriction endonuclease length polymorphism analysis (PCR-RLFP) of normal controls. ............................................. 123 5.4.2  Alanine at APP 673 as the potential therapeutic target. .............. 123   Table of contents      x      5.4.3  Analyzing the ?-cleavage of PS1?S169 on APP and other ?-secretase substrate in cell-free system. .................................................. 124 5.4.4  To determine the effect of PS1?S169 on  Notch processing in C. elegans. ............................................................. 125 5.4.5  TM3-targeted ?-secretase inhibitor. ............................................. 127 Bibliography .................................................................................................. 129!  xi  List of tables  Table 1.1 Genetic factors contributing to Alzheimer?s disease. ............................. 6!Table 1.2 Summary of FAD-associated mutations in APP gene. ......................... 39 Table 4.1 Summary of AD transgenic mouse models. .......................................... 92!Table 4.2 Original Ct values for Copy number estimation. ................................ 100!   xii  List of figures !Figure 1.1 The amyloid hypothesis of Alzheimer?s disease. ................................ 11!Figure 1. 3 The intracellular APP Trafficking. ..................................................... 14!Figure 1.4 APP processing pathways. ................................................................... 17!Figure 1.5 Amyloid beta protein (A?). ................................................................. 18!Figure 1. 6 A? in Synaptic modulation. ................................................................ 21!Figure 1.7 Presenilin 1 structure. .......................................................................... 29!Figure 1.8 ?-secretase complex and formation of the catalytic pore of PS1. ........ 33!Figure 2.1 Schematic diagram of APP Swedish mutation and A673V mutation. 45!Figure 2.2 Effects of APP A763V mutation on APP processing and A? generation. ............................................................................................................................... 52!Figure 2.3 APPA673V shifted the major ?-secretase product from C89 to C99 in 293B2 cells with BACE1 overexpression. ............................................................ 55!Figure 2.4 Effects of A673V mutant C99 (C99A2V) on ?-secretase activity. ........ 57!Figure 2.5 Dose-dependent inducible expression of APP variants in 293B2 cells. ............................................................................................................................... 59!Figure 2.6 APPA763V promoted the production of C99 in both ER and TGN. ...... 61!Figure 2.7 APPA763V underwent stronger lysosome-dependent degradation. ....... 64!Figure 2.8 A?42A2V was more cytotoxic than A?42WT. ........................................ 66!Figure 3.1 Sequential cleavages of ?-secretase. .................................................... 73!Figure 3.2 Presenilin 1 structure and the locus of PS1?S169. ................................. 78!Figure 3.3 Generation of PS1mutants constructs. ................................................. 79!Figure 3.4 PS1?S169 undergoes normal endoproteolysis. ....................................... 81!  List of figures      xiii      Figure 3.5 PS1?S169 promoted accumulation of APP CTFs and increased A?42/40 ratio via impaired ??secretase activity in PS1 stable cell lines. ............................ 83!Figure 3.6 PS1?S169 retained its enzymatic activity in Notch signaling. ............... 85!Figure 4.1 Establishment and characterization of APP23/PS1?S169 double transgenic mice. ..................................................................................................... 98!Figure 4.2 Standard curves for absolute quantitation of PS1?S169 copy number in APP23/PS1?S169 mice. ........................................................................................... 99!Figure 4.3 APP processing and A? generation in APP23/PS1?S169 and APP23 mice. .................................................................................................................... 101!Figure 4.4 PS1?S169 significantly promoted amyloid plaque formation in the transgenic mice. ................................................................................................... 103!Figure 4.5 PS1?S169 negatively affects fear conditioning, but not water maze performance of APP23 mice at 3 months of age. ................................................ 105!Figure 4.6 PS1?S169 exacerbates memory deficits in APP23 mice at 6 months of age. ...................................................................................................................... 107!   xiv  List of abbreviations  A? Amyloid-? ABC avidin:biotinylated enzyme complex AEBSF 4-(2-Aminoethyl) benzenesulfonyl fluoride hydrochloride; serine   protease inhibitor AD Alzheimer?s disease  Aph-1 Anterior pharynx factor-1  APLP amyloid precursor like protein  AICD APP intracellular domain ANOVA analysis of variance APP amyloid-? precursor protein APP23 single transgenic mice carrying Swedish APPKM670/671NL mutation APP23/PS45 double transgenic mice for Swedish APPKM670/671NL and PS1G384A  APPSwe Swedish APP mutation  ARU Animal Research Unit BACE1 ?-site APP Cleaving Enzyme 1 BACE2 ?-site APP Cleaving Enzyme 2  BBB blood brain barrier bp base pair BSA bovine serum albumin CDK cyclin dependent protein kinase Complete DMEM DMEM with 10% fetal bovine serum, 1% L-glutamine,  1% Penicillin/Streptomycin, and 1% sodium pyruvate.  CTF? C-terminal fragment ? (C83) CTF? C-terminal fragment ? (C99 and C89) DAB 3,3'-Diaminobenzidine DEPC diethylpyrocarbonate   List of abbreviations      xv      DMEM Dulbecco?s modified eagles? medium DMSO dimethyl sulfoximine ELISA enzyme-linked immunosorbent assay  FBS fetal bovine serum GSI ?-secretase inhibitor; L685,458  HEK293 human embryonic kidney 293 cell line hC99-myc HEK293 cells stably expressing human C99 CTF with myc tag  KD knockdown KDa kilodalton KO knockout  LTD long term depression LTP long term potentiation  MEF mouse embryonic fibroblasts mRNA messenger RNA MTT 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide  N2a mouse neuroblastoma  Nct nicastrin NF?B nuclear factor kappa B NFT neurofibrillary tangles NSAID nonsteroidal anti-inflammatory drug Pen-2 presenilin enhancer 2  PBS phosphate buffered saline PBS-Tx PBS with 0.1% Triton X-100 PBS-T PBS with 0.1% Tween-20 PCR polymerase chain reaction PFA paraformaldehyde PHF paired helical filaments PI3K phosphoinositide 3 kinase PKB protein kinase B, a.k.a Akt PS1 Presenilin 1   List of abbreviations      xvi      PS2 Presenilin 2 PVDF-FL Immobilon?-FL polyvinylidene difluoride RIPA DOC radio-immunoprecipitation assay deoxycholate  RT-PCR reverse transcription polymerase chain reaction sAPP? secretory APP? sAPP? secretory APP?  SDS sodium dodecyl sulfate SDS-PAGE SDS-polyacrylamide gel electrophoresis WT wildtype TNF? tumor necrosis factor ? 20E2 HEK293 cells stably expressing human APP695 with Swedish mutation     xvii  Acknowledgements  The first person I would like to thank during my PhD training is Dr. Weihong Song, who is my PhD supervisor and introduced me to the field of neuroscience.  Research was new and foreign to me, but Dr. Song has always patiently guided me and provided me with thoughtful questions to investigate. I am blessed to have Dr.Song?s support during graduate school and it has definitely made my journey in research much more enjoyable. Through the opportunities that Dr. Song provided me, I have come to meet many wonderful people.   I also would like to thank all my committee-meeting members: Drs. Paul Pavlidis, Shernaz Bamji, Catherine Rankin and Yutian Wang. You have given me lots of enlightening suggestion on my PhD project in the annual committee meeting. Special thanks to Drs. Catherine Rankin and Yutian Wang, who send me their own CIHR proposal drafts as reference and even taught me in person how to effectively write good proposals. It was such a wonderful experience to learn from all of you. Many thanks.  To the current and past colleagues in the Song lab, your support and therapeutic talks were highly appreciated. In particular, Dr. Fang Cai and Dr. Weihui Zhou, they were my first teachers in the Song lab to help a novice like me to quickly pick up good laboratory techniques. Your experiences saved me a lot of time and set a good example for me. And also thanks so much Haiyan Zhou, Yi Yang and Daochao Huang, for the heavy workload in the transgenic mice experiment. During my pregnancy, all the lab members helped me a lot, especially Fiona Zhang, Mingming Zhang and Zhe Wang.    Acknowledgements      xviii      The PhD journey was long and tedious sometimes; however, because of that I had chance to know some wonderful people. We were not just colleagues but also friends. It was you that make my lonely study life more colorful and studying abroad more bearable.  Mingming, Fiona, Phillip and Derek, thanks for the listening and the accompaniment.  Words cannot express my gratitude and it was my honor to have such friends in my life.   Last but not the least, I would like to thank my family. First and foremost are my parents, who were always by my side no matter what happened. Thanks Mama for coming to Vancouver for 3 months to take care of your pregnant and grumpy daughter, please forgive my ill temper due to stress and hormones. At last, I would like to apologize to my husband Wenxiao Yang; I am so sorry for my absence of more than 5 years; I thank you for all your patience and understanding; I thank you for your forever forgiveness for my ill temper in times of stress and I love you.  To my daughter, Anna Yang, even you are too small to understand, mama would like to say sorry to you. In order to finish my PhD in Canada, I am sorry to leave you when you were just one month old and I am sorry to have breast-fed you for only one month. You are and will always be the most precious gift to me and I love you, sweetheart.    xix  Dedication      To  my  family.       1        Chapter 1   General introduction    1.1 Dementia and Alzheimer?s disease.  The world?s population has been ageing rapidly in the past century due to significant improvements on health care and nutrition. Dementia is a global cognitive dysfunction syndrome due to brain disease, with the aging as its well-established risk factor. In 2010, the worldwide population with dementia was estimated at 35.6 million and is projected to double every 20 years, to 65.7 million in 2030 and 115.4 million in 2050, equivalent to one new case every four seconds (International, 2012). Worldwide dementia cost in 2010 was estimated to have been US$604 billion and its burden was not only on the economy but also had dramatic impact on the patients and their families?medically, psychologically and emotionally (London, 2010). The behavioral and psychological symptoms of dementia profoundly affect the quality of life of dementia patients and of their families.   The commonest subtypes of dementia in the order of frequency are Alzheimer?s disease (AD), vascular dementia (VaD), dementia with Levy bodies (DLB), dementia in Parkinson?s disease and frontotemporal dementia (FTD) (London, 2009). The population prevalence of different subtypes of dementia differs among studies, given the different recruitment criteria. A recent community-based study provided information on the relative prevalence of a wider range of  General introduction 2       subtypes: AD (41%), VaD (32%), DLB (8%), dementia in Parkinson?s Disease (3%) and FTD (3%) (Stevens et al., 2002).  The boundaries between these dementia subtypes have been promiscuous and the mixed forms often co-exist, although each subtype is characterized by their own pathological features: the amyloid plaques and neurofibrillary tangles and brain atrophy in AD; the multi-infarct evidence in VaD, Lewy bodies in DLB and the early involvement of the frontal temporal lobe in FTD. Apart from pathological features, different dementia subtypes are also characterized by their own set of clinical symptoms: AD is featured by difficulty in remembering names and recent events clinically; DLB is featured by initial symptoms such as sleep disturbances, visual hallucinations and muscle rigidity; FTD is featured by changes in personality, behavior and language problems; and dementia in Parkinson?s Disease (PD) is featured by typical PD symptoms meeting the diagnosis of PD (Alzheimer's, 2012).    Alzheimer?s disease (AD) is the most common type of dementia. On November 4, 1906, Dr. Alois Alzheimer described Alzheimer?s disease publicly for the first time using the case of his patient, Auguste Deter, who had extensive atrophy of cortex and two unique brain deposits ? one located in the nerve cells (?neurofilbrillary tangles? in modern terminology) and the other was located extracellularly (now known as ?amyloid plaque?). Emil Kraepelin, a German psychiatrist, suggested naming the syndrome of ?presenile dementia? as Alzheimer Disease. In 1911, Dr. Alzheimer published an article that was more detailed, describing cases of Johann F. and a number of other patients with ?Alzheimer?s disease?. The patients usually began with difficulty in forming new memory, accompanied by apathy or depression; in later stages,  General introduction 3       disorientation, behavior change, impairment on judgment and language, and deficits in motor system were observed.    Alzheimer?s disease (AD) is a heterogeneous clinico-pathogogical entity. The diagnosis of AD is classified into four categories: definite AD, probably AD, possible AD and unlikely AD (McKhann et al., 2011). Because of the limited application of autopsy and biopsy, most AD patients actually are possible AD patients, if typical, progressive cognitive impairment and the absence of other dementia diseases are established clinically. Definite AD requires meeting the probably AD criteria while having neuropathological evidence via autopsy or biopsy. The presence of both neuritic plaques and neurofibrillary tangles in the neocortex is the typical neuropathological evidence, suggesting high likelihood of Alzheimer?s disease. In addition to plaques and tangles, neuron degeneration and synaptic loss are also characteristic neuropathology of AD.    1.1.1  Pathological features of AD.  Amyloid plaques, neurofibrillary tangles, neuronal loss and brain atrophy are the main pathological features of AD.  Among them, amyloid plaques are unique for AD, whereas neuronal loss or synaptic loss is best correlated with the severity of clinical symptoms. According to the classical ?amyloid hypothesis?, the temporal sequence of these pathological features is the deposition of A?, and then the increased tau phosphorylation and tangles formation, both of which are toxic and induce synaptic loss and neuron death (Hardy and Selkoe, 2002). However, the temporal sequence of these pathological features is still controversial. Synaptic pathologies were reported in AD transgenic mice before plaque formation, indicating that the A? oligomers or the intracellular A? might have already induced synaptic toxicity before the plaque formation. Back in  General introduction 4       early 1990s, Braak et al. defined the progression stages of plaques and tangles according to their spatiotemporal pattern in AD patients.  Compared with plaques, the spatiotemporal progression of tangles is stereotypical and predictable: tangles appear firstly in the transentorhinal region (stage I); then CA1 region of the hippocampus (stage II); then limbic structure like subiculum of the hippocampal formation (stage III); next the amygdala, thalamus and claustrum (stage IV); finally spread to all isocortical areas (stage V). Despite being less predictable, the spatiotemporal progression of plaques still could be divided into 3 stages: the isocortical stage, the limbic stage and the subcortical stage (Braak and Braak, 1991). Clinicopathological studies indicated that the amount and distribution of tangles correlate better with the severity and the duration of AD than the plaques (Arriagada et al., 1992, Bierer et al., 1995, Giannakopoulos et al., 2003).   Amyloid plaque is the unique pathological feature for AD, which is defined as the extracellular deposits of amyloid ?. It should be of note that amyloid plaques are heterogeneous in terms of either the microscopic morphology or the composition. The amyloid plaques meeting the diagnosis criteria of AD are dense-core plaques or neuritic plaques. The dense-core plaques are amyloid deposits with compact core positive for Thioflavin-S or Congo-Red staining, which are typically surrounded by dystrophic neuritis as well as the activated astrocytes and microglial cells; whereas the so-called ?diffuse plaques? are amyloid deposits with ill-defined contours and negative for Thioflavin-S or Congo-Red staining (Serrano-Pozo et al., 2011). Diffuse plaques are often found in the general elderly population, while the dense-core plaques are usually exclusively present in AD population. The composition of amyloid plaques is also heterogeneous. Apart from various other non-amyloid  General introduction 5       components in amyloid plaques (proteoglycans, inflammatory molecules, metal ions, APOE, low density lipoprotein receptor-related protein, see review (Atwood et al., 2002), a spectrum of A? peptides has been isolated from the brains of AD patients. This large spectrum of A? peptides can be resulted from heterogeneous ?-cleavages as well as the multiple modification and proteolysis during the many years when A? peptides reside in these extracellular amyloid plaques. The neuropathologies are undistinguishable between FAD and sporadic AD. Of note, cotton wool plaques (CWP) are more frequently observed in presenilin mutations-associated FAD patients and firstly reported in FAD-associated PS1 deletion mutation of exon 9 (Crook et al., 1998a). CWPs are characterized by large size (up to 100?m), high immunoactivity for A?42, eosinophilic, lack of thioflavin-S positive dense cores, poor neuritic response and the displace of surrounding tissues; however, CWPs are not diffuse plaques and the underlying mechanism is not clear.   1.1.2  Mutations in APP, PS1&PS2 genes and FAD. Although more than 95% AD are sporadic with onset after age 65, dramatic progress in the field has come from a number of genetic studies on familial Alzheimer?s disease (FAD) (Campion et al., 1999). FAD is defined as an uncommon form of Alzheimer?s disease that usually strikes before the age of 65 and is inherited in an autosomal dominant manner. Mutations in three genes account for the early onset of FAD ? Amyloid-? precursor protein (APP), Prensenilin 1 (PS1) and Presenilin 2 (PS2) (Table 1.1). (http://www.molgen.ua.ac.be/admutations/Default.cfm?MT=1&ML=1&Page=MutByQuery&Query=tblContexts.ID=3&Selection=Gene%20=%20APP).   General introduction 6        Table 1.1 Genetic factors contributing to Alzheimer?s disease.  1.1.3  Genetic risk factors and sporadic AD. The rare mutations in APP and PS genes are causing the early-onset of FAD. Is there any established genetic factors contributing to the high risk of late-onset of sporadic AD? Genes involved in the formation of plaques and tangles (APP,  General introduction 7       PS1/PS2 and MAPT), have therefore long been considered as putative candidates for higher susceptibility of sporadic AD. The contribution of APP, PS1/PS2 and MAPT in sporadic AD remains questionable, although MAPT is established as a risk factor in Parkinson?s disease (PD) (Simon-Sanchez et al., 2009), progressive supranuclear palsy (PSP) and corticobasal degeneration (CBD) (Houlden et al., 2001a, Pittman et al., 2005). In PD, SNCA and LRRK2 genes not only contribute to dominant familial PD, but also impose higher risk to sporadic PD (Ross and Farrer, 2010). However, it lacks strong evidence to support that common variations in APP and PS1/PS2 genes contribute to higher risk in sporadic AD (Guyant-Marechal et al., 2007, Reiman et al., 2007, Gerrish et al., 2012).  One possible explanation is that the function of APP and Presenilins is so essential for the normal processing of APP that single nucleotides polymorphism (SNP) has dramatic effect on their functional performance.    Until recently, apolipoprotein E4? isoform (APOE4?) is the only established genetic risk factor for the sporadic form of AD (Corder et al., 1993, Saunders et al., 1993, Strittmatter et al., 1993). APOE is the major apolipoprotein and cholesterol carrier in the brain and synthesized predominantly by astrocytes and to some extend by microglia (Pitas et al., 1987, Uchihara et al., 1995). The frequency of APOE4? is about 15% in general population but is about 40% in sporadic AD patients. Compared with those without APOE4? alleles, individual with one APOE4? allele are 3 to 4 times more likely to develop AD (Corder et al., 1993, Strittmatter et al., 1993). With the advances in microarray technology, numerous genome-wild association studies (GWAS) are undergoing in a non-hypothesis-biased manner, aiming at identifying additional AD susceptibility loci that are common in the general population. It has been implicated that the  General introduction 8       following loci are low-risk factors in sporadic AD: CLU, PICALM, CR1, BIN1, MS4A, CD2AP, CD33, EPHA1, and ABCA7 (Harold et al., 2009, Lambert et al., 2009, Hollingworth et al., 2011, Naj et al., 2011) (Table 1.1).  Recently, two groups independently report heterozygous rare variants in TREM2 associated with high risk of sporadic AD (Guerreiro et al., 2013, Jonsson et al., 2013). The frequency of the variants in TREM2 is 1~2% in sporadic AD patients but only 0.05% in general population. TREM2 encodes a single-pass type I membrane Ig super family protein, which is involved in activating immune responses in macrophages and dendritic cells in central nervous system. The increased predisposition of AD in TREM2 variants implicates the inflammation does play an essential role in AD pathogenesis, probably via influencing the clearance of A? and its deposits or modulating the neuronal toxicity of A?.  1.2 Amyloid hypothesis. Neuritic plaques and neurofibrillary tangles (NTFs) are two hallmarks of AD (Katzman, 1986).  Neuritic plaques are also known as senile plaques or amyloid plaques, which are mainly extracellular deposits of amyloid beta protein (A?). Neuritic plaques consist primarily of 42-residue amyloid proteins (A?42), which are derived from proteolytic processing of beta amyloid precursor protein (APP) (Glenner and Wong, 1984b, Iwatsubo et al., 1994).  Neurofibrillary tangles (NFTs) are intraneuronal inclusions composed of hyperphosphorylated forms of the microtubule-associated protein ? Tau (Grundke-Iqbal et al., 1986, Kosik et al., 1986, Goedert et al., 1988, Iqbal et al., 1989). Unlike neuritic plaques, which is the unique pathological feature of AD, NFTs are detected in a whole spectrum of neurodegenerative tauopathies including Pick?s disease, progressive supranuclear palsy, corticobasal degeneration, Parkinson?s disease, frontotemporal dementia and frontotemporal dementia with Parkinsonism on  General introduction 9       chromosome 17 (FTDP-17) (De Strooper, 2010). For instance, FTDP-17 is caused by mutations in the MAPT gene, which encodes a microtubule-binding protein ? Tau (Hutton et al., 1998). The formation of NTFs is promoted by the hyper-phosphorylation of tau, which could be influenced by multiple factors such as the A?-induced hyper-phosphorylation of tau (Ittner and Gotz, 2011). Several parallel studies have suggested that neurofibrillary tangles of wild-type tau found in AD brains are likely to form after changes in A? metabolism and initial extracellular amyloid plaque formation (Hardy et al., 1998, Lewis et al., 2001), indicating the primary role of A? in AD.   The amyloid hypothesis was first proposed since it was discovered that patients with Trisomy 21 (Down Syndrome) have inevitably developed AD neuropathology (Olson and Shaw, 1969). Subsequent identification of AD-associated mutations in APP gene further bolsters the notion that APP plays a central role in AD pathogenesis (Goate et al., 1991, Hardy, 1992, Hendriks et al., 1992, Mullan et al., 1992a, Prasher et al., 1998). In addition to the effect of APP mutations on the production of A?, mutations in Presenilin 1/Presenilin 2 genes and the polymorphism on APOE4 also contribute to abnormal A? metabolism. The mutual target of all established AD genetic factors strongly suggest that the abnormal accumulation of A?, particularly the more hydrophobic and aggregation-prone A?42, initiates neuronal dysfunction and death, neurofibrillary degeneration and microglial activation, leading to neurodegeneration in AD (Fig 1.1) (Hardy and Selkoe, 2002).   Although the amyloid hypothesis offered a comprehensive framework to elucidate AD pathogenesis, the exact underlying mechanism is still lacking and  General introduction 10       several research results argue against this theory. For instance, amyloid plaques are also present in normal seniors and the severity of AD symptoms is correlated better with neurofibrillary tangles but not the amyloid burden (Terry et al., 1991, Arriagada et al., 1992, Gomez-Isla et al., 1997). Recent studies also indicate that AD symptoms have a correlation with soluble A? oligomers and the classical amyloid plaques appear to be reservoirs for the toxic, smaller, metastable A? species (Lue et al., 1999, McLean et al., 1999, Wang et al., 1999, Naslund et al., 2000).   The causative role of A? and amyloid plaques in AD pathogenesis is arguable. Given the large number of pathogenic mutations in presenilin and its abundant substrates, the ?presenilin hypothesis? was proposed (Shen and Kelleher, 2007). This theory emphasized the importance of presenilins in AD pathogenesis, based on the obvious neurodegeneration deficit in presenilins conditional- knockout mice. Nevertheless, as A? is the sole target of all genetic factors (Table 1.1), the amyloid hypothesis is still dominating the studies on AD pathogenesis (Fig 1.1). This dissertation explores how amyloid cascades have been affected by mutations in APP or Presenilin 1 genes.   General introduction 11        Figure 1.1 The amyloid hypothesis of Alzheimer?s disease.  The genetic factors of early onset FAD and risk factors of sporadic AD converge to an increase in A?42 production, which induces sequential pathogenic events leading to AD. A? oligomers could directly initiate a toxic cascade rather than being deposited as plaques. Adapted from Hardy and Selkoe, 2002.   General introduction 12       1.2.1  Amyloid-beta precursor protein (APP).  Amyloid beta protein (A?), the core component of neuritic plaque, is derived from amyloid-beta precursor protein (APP) by sequential cleavages of ?- and ?-secretase (Glenner and Wong, 1984b, a, Goldgaber et al., 1987, Kang et al., 1987, Robakis et al., 1987, Tanzi et al., 1987, Weidemann et al., 1989, Sun et al., 2012). The APP gene is located on Chromosome 21, coding for a ubiquitously expressed type I transmembrane protein, for which several isoforms can be derived from alternative splicing of mRNA (Fig 1.2). APP770/751 (containing 770/751 amino acids) are mainly expressed in non-neuronal cells, whereas APP695, lacking the Kunitz protease inhibitor (KPI) region, is dominant in neurons (Kitaguchi et al., 1988, de Sauvage and Octave, 1989) (Bendotti et al., 1988, Arai et al., 1991, Konig et al., 1992, Sandbrink et al., 1994). APP and APP-like proteins (APL1 and APL2) belong to the same protein family (Wasco et al., 1992, Sprecher et al., 1993, Wasco et al., 1993) and conserved homologs of APP have been found in C. elegans (Daigle and Li, 1993) and Drosophila (Luo et al., 1992).   General introduction 13        Figure 1.2 The structure of amyloid-beta precursor protein (APP).   This diagram shows the amino acid sequence of APP and the distribution of FAD-associated mutations. The smaller blue circles represent abridged sequence between E1 (exon1) and E16 (exon16). All bigger colored circles not yellow represent the FAD-associated mutations and purple circles represent only one mutation identified at this locus and orange circles represent more than one mutations identified at this locus. Green triangles and green bars represent secretase cleavage sites as indicated in this diagram. The following legends elaborate all APP mutations with their names and the original papers.   General introduction 14       APP is a type I transmembrane protein with a relatively large extracellular/luminal domain at the NH2 terminus and a short cytoplasmic domain at the COOH terminus (Fig 1.2).  During its transport from ER to plasma membrane, APP undergoes N- and O- glycosylation (Weidemann et al., 1989). Further sulfation and phosphorylation take place at the late Golgi apparatus and at the plasma membrane (Hung and Selkoe, 1994, Suzuki et al., 1994, Walter et al., 1997).  The majority of APP is detected in the Golgi, whereas the plasma membrane associated APP accounts for only 10% of the total APP protein (estimation based on overexpression experiment in cell culture); and from the plasma membrane, APP is rapidly undergoes internalized for following recycling and degradation (Sisodia, 1992) (Fig 1.3).    Figure 1. 3 The intracellular APP Trafficking.  Nascent wild type APP (black bars) undergoes multiple modifications in classical secretory pathway from ER to Golgi. Only a small proportion of APP is delivered to the plasma membrane to be processed by ?-secretase. Some plasma membrane APP undergoes endocytosis where the ?-cleavages occur. A? generation is believed to occur in endocytic organelles such as endosomes. Adapted from Thinakaran, 2006.  General introduction 15       Since its discovery, multiple physiological functions have been linked to APP (Mattson, 1997); however, its specific role remains to be elucidated. We introduce three well-explored functions of APP here. Firstly, APP has been proposed to be a trophic molecule. Dating back to 1989, know-down of APP was linked to the slow growth of fibroblast induced by an antisense APP construct, which could be reversed by APP treatment (Saitoh et al., 1989).  Later it was reported that APP promoted neuronal maturation (Hung et al., 1992) as the memory-enhancing effect of APP could be blocked by intracerebroventribular injection of anti-APP antibody in adult rats (Meziane et al., 1998). Subsequently, N-terminal residues 28-123 of APP were reported to display a similar structure as that of well-known cysteine-rich growth factors (Rossjohn et al., 1999).  The following studies specified that the trophic effect of APP was due to one of its secreted derivative?sAPP?. sAPP? was reported to have the ability to induce neuronal stem cells into astrocytes in vitro (Kwak et al., 2006). In the subventricular zone of adult mice brains, sAPP?, together with EGF, promoted the proliferation of EGF-responsive neural stem cells (Caille et al., 2004). Secondly, APP has been proposed to be a cell adhesion factor, which is reasonable since substrate adhesion has been involved in neurotrophic proliferation. A RHDS motif within the C-terminal of sAPP was found to contribute to cell adhesion function via integrin-like receptors and APP was required for the migration of neuronal precursors to the cortical plate (Ghiso et al., 1992, Yamazaki et al., 1997, Young-Pearse et al., 2007). Last but not least, APP has been proposed to be a cell-surface receptor. Both APP and Notch undergo the same ?-cleavage at the transmembrane domain to generate the APP intracellular domain (AICD) and the Notch intracellular domain (NICD), respectively. Considering the role of NICD in fundamental cell signaling, the function of AICD in cell signaling pathways has been well  General introduction 16       explored but still lacks convincing support. Since AICD was found to form a transcriptionally active complex with Fe65 and Tip60 (Cao and Sudhof, 2001), several downstream candidate genes have been proposed: KAI1 (a tumor suppressor gene), neprilysin (a neutral endopeptidase with A?-degrading activity), LRP1, and the EGF receptor (Baek et al., 2002, Pardossi-Piquard et al., 2005, Liu et al., 2007, Zhang et al., 2007b). Considering the various phenotypes of presenilin activity, it would be very interesting if AICD were really as transcriptionally active as NICD. However, all of these pathways still lack in vivo evidence.   APP-deficient animals lack typical phenotype, unlike presenilin-deficient or Notch-deficient animals. APP-deficient mice only exhibited reactive gliosis and decreased locomotor activity (Zheng et al., 1995). The mild phonotype might be due to an overlapping effect of other two APP protein family members ? APLP1 and APLP2. Aplp2-/Aplp1-, App- /Aplp2- double mutants and App- / Aplp1-/Aplp2- exhibited early postnatal lethality (Herms et al., 2004, Anliker and Muller, 2006). Further studies of these animals revealed that APP/APLP was specifically involved in synapse formation ? reduction in apposition of pre- and postsynaptic elements of the junctional synapses; effect on active zone size, synaptic vesicle density, and number of docked vesicles per active zone; aberrant localization of the choline transporter at neuromuscular junctions (Wang et al., 2005, Yang et al., 2005, Wang et al., 2007).   1.2.2  APP processing and A? generation. APP undergoes posttranslational proteolytic processing by ?-, ?- and ?-secretases (Fig 1.4). The majority of APP is constitutively processed in  General introduction 17       the non-amyloidogenic pathway via ?-secretase cleavage, which occurs inside the A? sequence to yield a secretory product, thereby precluding A? production (Esch et al., 1990).  In the amyloidogenic pathway, APP undergoes sequential cleavage by ?- and ?-secretases to generate A?.    Figure 1.4 APP processing pathways.  Under physiological conditions, the majority of APP undergoes the non-amyloidogenic pathway. ?-secretase processes APP within the A? domain. This cleavage abolishes A? generation and produces C83 fragments. Predominant ?-scretase processes APP at the Glu-11 site to generate C89 fragments as the major product.  In the amyloidogenic pathway, ?-scretase processes APP at the Asp-1 site to generate C99 fragments, which become the substrate to ?-scretase for A? generation. The cleavage sites for each ?-, ?- and ?-secretase are indicated.   A transmembrane aspartic protease BACE1 was identified as ?-secretase (Hussain et al., 1999, Sinha et al., 1999, Vassar et al., 1999, Yan et al., 1999), which processes APP at Asp+1 and Glu+11 of the A? domain, to generate a major product C89 and a minor product C99 fragment (Vassar et al., 1999, Li et al., 2006). The C99 fragment is further processed by ?-secretase at the  General introduction 18       intramembrane Val-40 and Ala-42 sites to generate A?40 and A?42 (De Strooper et al., 1998, Yu et al., 2000b, Francis et al., 2002a, Goutte et al., 2002a, Edbauer et al., 2003b, Kimberly et al., 2003b, Takasugi et al., 2003) (Fig 1.5).   Figure 1.5 Amyloid beta protein (A?).  Amyloid beta protein (A?) is a peptide of 36?43 amino acids that has been processed from APP. The most common forms of A? are A?40 and A?42, both of which are the ?-cleavage product of APP C99 fragment. A?40 is the major ?-secretase product of C99, whereas A?42 is the predominant component of neuritic plaques. Numerous mutations in APP and PS genes contribute to AD pathogenesis by affecting the production of A? or the aggregation property of A?.  Amyloid plaques consist of insoluble fibrous A? aggregates characterized by a cross-beta sheet quaternary structure and typically identified histologically by a change in the fluorescence intensity of planar aromatic dyes such as thioflavin T or Congo red. A? was a typical amyloid protein and was first purified from  General introduction 19       twisted beta-pleated sheet fibrils in cerebrovascular amyloidosis in AD-associated amyloid plaques (Glenner and Wong, 1984a,b); and this 4.2-kDa peptide, 40 or 42 amino acids in length, was speculated to have come from a larger precursor. In 1987, a full length APP with 695 residues was cloned, containing the amyloid ? sequence, which encompassed 28 amino acids of the ectodomain and 11 to 14 amino acids of the transmembrane domain of APP (Kang et al., 1987, Podlisny et al., 1987, Robakis et al., 1987, Tanzi et al., 1987) A? is the direct product of C99 fragment of APP derived from a sequential proteolytic cleavage of APP in the amyloidogenic pathway (Fig 1.4 and Fig 1.5). A? can exist in various assembly states, including monomers, dimers, trimers, tetramers, dodecamers, higher-order oligomers and protofibrils, as well as mature fibrils, which can form microscopically-visible amyloid plaques in brain tissues (Glabe, 2008). Recent studies suggest that it is A? oligomers rather than fibrils or deposits that initiate the abnormalities in synaptic functions and neural network activity (Cleary et al., 2005a, Lesne et al., 2006, Cheng et al., 2007, Shankar et al., 2007, Selkoe, 2008, Shankar et al., 2008b, Tomiyama et al., 2010). Even though the preparations of A? in these studies were not strictly comparable, the essential role of A? oligomers in the amyloid cascade hypothesis could be implicated.  1.2.3  A? ? A two-edged sword: physiological and pathological roles. A? could be detected in the CSF of normal individuals and in neuron culture media (Haass et al., 1992, Tamaoka et al., 1997), indicating a physiological role of A? in the central nervous system. Studies on primary neurons suggested that the inhibition of endogenous A? production increases neuronal cell death, which could be mitigated by the addition of physiological level (pM) of A?40  General introduction 20       but not other forms of A? (Plant et al., 2003).  Moreover, the production of A? and its extracellular secretion are strictly regulated by neuronal activity both in vitro and in vivo (Kamenetz et al., 2003, Cirrito et al., 2005).  Increased neuronal activity promotes A? generation and A? in turn negatively regulates neuronal activity to stabilize hyperactive neurons (Kamenetz et al., 2003). This synaptic activity-dependent modulation of A? production was mediated by clathrin-dependent endocytosis of surface APP at presynaptic terminals, endosomal proteolytic cleavage of APP, and A? release at synaptic terminals (Cirrito et al., 2005). These findings supported the notion that A? physiologically takes part in the neuronal function.   Another edge of the ?A? sword? is the contribution of A? to AD pathogenesis. As discussed in the last section, A? oligomers, but not amyloid plaques, are believed to be the culprit in AD. Excessive A? production promotes LTD-induced postsynaptic depression and loss of dendritic spines (Snyder et al., 2005, Shankar et al., 2007, Li et al., 2009), induces glutamatergic synaptic transmission and causes synaptic loss (Hsia et al., 1999, Mucke et al., 2000, Walsh et al., 2002). Considering that synaptic loss is one of pathological features of AD and is well correlated with cognitive decline (DeKosky and Scheff, 1990), the toxic effect of A? oligomers on synapse could be the fundamental basis of AD pathogenesis. A working model to fit both physiological and pathological roles of A? was proposed by Palop &Mucke (Palop and Mucke, 2010) (Fig 1.6). This model elaborated on how A? directly elicited synaptic damage downstream of the amyloid cascade hypothesis, and emphasized that maintaining a delicate balance of A? is crucial in having  General introduction 21       functional neural network.  Figure 1. 6 A?  in Synaptic modulation.  Hypothetical relationship between A? level and synaptic activity. Intermediate levels of A? enhance synaptic activity presynaptically, whereas abnormally high or low levels of A? impair synaptic activity by inducing postsynaptic depression or reducing presynaptic efficacy, respectively. Adapted from Palop and Mucke, 2010.  1.2.4  A? oligomer and the toxicity. The central role of A? in AD pathogenesis is unequivocal, however, the mechanism underlying the toxicity of A? is still in debate. First and foremost, what is the real toxic substance: the plaques or other substance undiscovered? Given the poor correlation of plaques and the cognitive impairment in AD patients, researchers propose that the A? oligomers may be the long-term-searching toxic substance of A?. Back in 1991, it had been found that in vitro A? monomer could be converted into toxic oligomers in buffer (Pike et al., 1991). However, until now, the terminology of the toxic A? oligomer has been still ambiguous and lack of accurate definition.  The A? oligomers are prepared either in in vitro buffer or derived directly from brain extract via various  General introduction 22       methods. The various procedures in the preparation or extraction result in various forms of A? oligomers: A?-derived diffusible ligands (ADDL), A?*56, A?O, annular protofibrils (APF), SDS-stable dimers and trimers, SDS-stable amylospheroid (ASPD) (Lambert et al., 1998, Walsh et al., 2002, Kayed et al., 2003, Cleary et al., 2005b, Lesne et al., 2006, Shankar et al., 2008a, Noguchi et al., 2009, Lasagna-Reeves et al., 2011). The biological effects of these oligomers include LTP impairment, NMDAR-dependent synaptotoxicity, increased tau phosphorylation, disturbance in Ca2+ hemostasis, NMDAR-independent cytotoxicity in primary neurons and cognitive impairment in mice (Walsh et al., 2002, Hoshi et al., 2003, Cleary et al., 2005b, Demuro et al., 2005, Lesne et al., 2006, Shankar et al., 2008a, Zempel et al., 2010).  It should be clarified that the so-named SDS-resistant A? oligomers, which are frequently used in most of related literature, are quite confusing. It has been proven that SDS itself could induce the formation of oligomers, thus SDS-involved method is not reliable to distinguish and analyze different forms of oligomers (Bitan et al., 2005, Hepler et al., 2006). Last but not the least, it should be bear in mind that a dynamic equilibrium is eternal between the amyloid plaques and A? oligomers. With the deep exploration, it would be more clear about the relationship between these two and which is the real toxic substance or the toxic group in AD pathogenesis (Benilova et al., 2012).   1.3 BACE1 and ?-secretase in Alzheimer?s disease. Beta-site APP-cleaving enzyme 1 (BACE1) has been identified as the ?-secretase that produces C99, the direct precursor of A? (Hussain et al., 1999, Sinha et al., 1999, Vassar et al., 1999, Yan et al., 1999). BACE2 is the homolog of BACE1 (Saunders et al., 1999, Yan et al., 1999, Sun et al., 2005). Despite  General introduction 23       about 45% homologous sequence, BACE2 has distinct transcriptional regulation and functions compared with BACE1. BACE2 is not ?-secretase; rather, it is a novel ?-secretase that cleaves APP within the A? sequence at Phe20 ? site, further downstream of the Leu17 ?-secretase cleavage site and thus precludes the amyloid pathway (Sun et al., 2006b). BACE1 gene is located on chromosome 11q23.3, and codes for a type I membrane-associated aspartyl protease with 501 amino acids. As a low abundance protein, BACE1 is expressed in relatively high levels in the brain and pancreas (Vassar et al., 1999, Marcinkiewicz and Seidah, 2000). BACE1 pre-mRNA undergoes complex alternative splicing, resulting in various isoforms that contribute to the different BACE1 activities in the brain and pancreas (Mowrer and Wolfe, 2008). BACE1-501 is the major isoform with the highest ?-secretase activity and mainly localizes in the endosome and the Golgi network (Vassar et al., 1999, Bodendorf et al., 2001, Tanahashi and Tabira, 2001, Ehehalt et al., 2002). Post-translational modifications are necessary for BACE1 protein maturation and activity.  After removal of the N-terminal pro-peptide in the trans-Golgi network, which is the hallmark of BACE1 maturation (Bennett et al., 2000, Capell et al., 2000, Creemers et al., 2001), BACE1 is further glycosylated at Asn -153, -172, -223 and -354 (Capell et al., 2000, Haniu et al., 2000, Huse and Doms, 2000).   1.3.1  Tight regulation of BACE1 gene expression.  Tightly controlled BACE1 gene expression plays an essential role in regulating APP processing pathways. Under physiological conditions, only a minority of APP undergoes ?-secretase cleavage and a very small amount of A? is produced. Unlike the robust expression of APP and Presenilin in neuronal and  General introduction 24       non-neuronal cells driven by a strong housekeeping gene-like promoter (Song and Lahiri, 1998a, b), BACE1 gene transcription was markedly lower, resulting from weak BACE1 promoter activity (Li et al., 2006). In addition, at the translation initiation level, multiple ATGs in the 5?untranslated region (UTR) of BACE1 gene are shown to suppress its translation initiation (Rogers et al., 2004).  As well leaky scanning and reinitiating mechanism are found to be involved in the inhibition of the physiological fourth AUG-initiated BACE1 translation (Zhou and Song, 2006). Taken together, a weak promoter and suppression of translation initiation synergistically result in weak BACE1 protein expression in normal conditions. Considering the relatively robust APP and Presenilin expression, BACE1 could be viewed as a rate-limiting enzyme in the APP amyloidogenic pathway and limited BACE gene expression is responsible for the small amount of A? production under physiological conditions.   BACE1 gene expression is up-regulated in AD. The human BACE1 gene promoter region contains a set of putative transcription factor-binding sites, including GC box, HSF-1, PU-box, AP1, AP2, lymphokine response element, nuclear factor-kappa B (NF-?B) p65 and hypoxia-inducible factor 1 (Hif-1) (Christensen et al., 2004, Ge et al., 2004, Sun et al., 2006a, Chen et al., 2011). Later in vitro and in vivo studies validate that hypoxia could up-regulate BACE1 expression by acting on the Hif-1 response element in its promoter region (Sun et al., 2006a, Xue et al., 2006, Zhang et al., 2007a), and hypoxia treatment significantly promoted neuritic plaque formation as well as memory impairment in APP transgenic mice (Sun et al., 2006a). In summary, mounting evidence points to BACE1 being the rate-limiting factor in the A? production  General introduction 25       pathway, including the tight control of BACE1 gene expression on different levels and the existence of multiple influencing factors like Hif-1 in hypoxia. As a ?-secretase product and the immediate substrate of A?, the yield of C99 was strictly regulated to prevent A? generation and the resulting AD pathogenesis under normal conditions.  1.3.2  BACE1 processes APP at major Glu-11 and minor Asp-1 sites.  BACE1 processes APP at two sites ? Glu-11 and Asp-1 (numbering according to the A? sequence), to generate C89 and C99 respectively (Vassar et al., 1999, Li et al., 2006).  Further processing of C89 in the transmembrane region by ?-secretase leads to a truncated A? with 30-32 amino acids; whereas C99 is the immediate substrate for A? generation. Any factors, facilitating C99 production, will promote A? generation and promote amyloidogenic pathogenesis, according to the ?Amyloid hypothesis? (Fig 1.5).   Any factor that increases general BACE1 activity or shifts cleavage from Glu-11 to Asp-1 site could contribute to A? generation and amyloid pathogenesis (Deng et al., 2013). As discussed in the last section, the expression of BACE1 is under strict regulation at both the transcriptional and translational levels, which results in the majority of APP being processed by ?-secretase in the non-amyloidogenic pathway under normal conditions (Esch et al., 1990, Oltersdorf et al., 1990, Sisodia et al., 1990). Under pathogenic conditions where the expression of BACE1 is up-regulated even slightly, a significant proportion of APP processing will be shifted to the amyloidogenic pathway.  It was  General introduction 26       documented that the activity of BACE1 increased with aging (Russo et al., 2000, Fukumoto et al., 2002, Holsinger et al., 2002, Yang et al., 2003, Fukumoto et al., 2004). Previous studies of our laboratories demonstrated that BACE1 expression could be modulated by hypoxia, consistent with the observation of the increased BACE1 levels in sporadic AD (Sun et al., 2006a). In the case of Down syndrome, BACE1 level is up-regulated by abnormal trafficking and maturation (Sun et al., 2006c).  In another scenario, any factors shifting the ?-cleavage site from Glu-11 to Asp-1 would also contribute to AD pathogenesis. Recently our laboratories demonstrated that Glu-11 was the major cleavage site of BACE1 in wild type APP with C89 as the predominant product, whereas the major cleavage site of BACE1 in Swedish APP mutant was Asp-1 with C99 as the predominant product (Deng et al., 2013). Clearly, Swedish APP contributed to AD pathogenesis by shifting the ?-cleavage site from Glu-11 to Asp-1. The underlying mechanism of the shift in cleavage sites was unknown.   1.3.3  BACE1 and AD therapy. BACE1 has been the therapeutic target of AD since its discovery. Unlike the embryonic lethal phenotype of Presenilin -/- mice, BACE1-/- mice were viable and fertile (Luo et al., 2001, Roberds et al., 2001); however, knocking out BACE1 induces hypomyelination in both of the central and peripheral nervous systems (Willem et al., 2006, Hu et al., 2008). Apart from APP, BACE1 has other substrates with important functions, including Neuregulin1/3(Willem et al., 2006, Hu et al., 2008), sodium channel Nav1.1 b2 subunit (Wong et al., 2005, Kim et al., 2007), low density lipoprotein receptor related protein (LRP) (von Arnim et al., 2005), interleukin-1 receptor II (Kuhn et al., 2007) and APP-like proteins 1 and 2 (APLP1/APLP2) (Eggert et al., 2004, Li and Sudhof, 2004,  General introduction 27       Pastorino et al., 2004). A? is produced under normal conditions at low amounts (Haass et al., 1992, Tamaoka et al., 1997), indicating a physiological role of A? in the central nervous system. Thereby, the application of BACE1 inhibitor to treat AD could have side effects, including hypomyelination, behavioral abnormalities and others. Another alternative for BACE1 manipulation is to regulate its preferential cleavage site. Since the Swedish APP mutation changes the major ?-cleavage site in APP from Glu-11 to Asp-1 with predominant C99 fragment generation, it is possible to regulate the major cleavage site of BACE1. In chapter 2, we will determine the effect of a recessive APP mutation on the preferential cleavage of ?-secretase and explore the underlying mechanism.   1.4 ?-secretase complex.  ?-secretase originally is known as the enzyme responsible for the last step of A? generation (Selkoe et al., 1996). ?-cleavage takes place within the hydrophobic transmembrane domain (TMD), and this process is termed regulated intramembrane proteolysis (RIP) (Brown et al., 2000). The first molecule, which was discovered to possess ?-secretase activity, was presenilin (PS1 and PS2), first cloned in 1995 through positional cloning strategies in FAD kindred (Levy-Lahad et al., 1995a, Rogaev et al., 1995, Sherrington et al., 1995). In 1998, De Strooper and colleagues discovered that PS1 knockout mice showed a markedly reduced activity in ?-secretase cleavage of APP (De Strooper et al., 1998) and parallel studies confirmed a complete elimination of ?-secretase activity in PS1/PS2 knockout cell (Herreman et al., 2000, Zhang et al., 2000a), establishing the ?-secretase activity of presenilins.   General introduction 28       1.4.1  Presenilins. Presenilins have two homologs, PS1 and PS2, with 67% identical sequences (Levy-Lahad et al., 1995a). mRNA of both presenilins is ubiquitously detected in many human and mouse tissues, including brain, heart, kidney and muscle (Lee et al., 1996). PS1 and PS2 are highly conserved and functionally redundant with SEL-12 as their homolog in Caenorhabditis elegans (Levitan and Greenwald, 1995).  PS1 is a multi-transmembrane protein with a nine-transmembrane topology (Fig.1.7) (Laudon et al., 2005, Spasic et al., 2006), and is abundantly present in the ER and trans-Golgi network (Walter et al., 1996, Culvenor et al., 1997, Annaert et al., 1999, Kim et al., 2000). Under physiological conditions, the majority of PS1 undergoes endoproteolysis within a large hydrophobic loop on the cytoplasmic side to generate a N-terminal fragment (NTF) and a C-terminal fragment (CTF) (Thinakaran et al., 1996a).  The endoproteolytic cleavage takes place at heterogeneous sites from amino acids 292 to 299 (Podlisny et al., 1997, Shirotani et al., 1997, Jacobsen et al., 1999). While some studies reported that the cleavage is performed by an independent protease known as the ?presenilinase? (Campbell et al., 2003, Nyabi et al., 2003), growing evidence supports the hypothesis that presenilin undergoes autoendoproteolysis (Wolfe et al., 1999b, Edbauer et al., 2003a, Xia, 2003, 2008, Ahn et al., 2010b, Fukumori et al., 2010). Endoproteolysis might be important to activate ?-secretase by converting it to a presenilin NTF/CTF heterodimer via removing the auto-inhibitory effect of the large hydrophobic loop (Knappenberger et al., 2004, Fukumori et al., 2010). However, it is not clear whether endoproteolysis is an absolute requirement for presenilins maturation since some presenilin mutants  General introduction 29       were enzymatically active in the absence of endoproteolysis, as are the cases in FAD-associated PS1?E9 and PS2 M292D (Jacobsen et al., 1999, Steiner et al., 1999).   Figure 1.7 Presenilin 1 structure.  This diagram shows the amino acid sequence of PS1 and the distribution of FAD-associated mutations. Blue circles represent the FAD-associated mutations and red circles represent the two catalytic active aspartates.  The most outstanding function of presenilins is the processing of numerous type I transmembrane proteins within the intramembrane domain as a component of ?-secretase (Wakabayashi and De Strooper, 2008).  Corresponding to its ?-secretase function, most FAD-associated PS mutations have been reported to result in increased level of the more hydrophobic A? species ? A? 42 either in patients? plasma samples or the fibroblasts derived from FAD patients (Scheuner et al., 1996). Besides, substantiating evidence suggested that presenilins were involved in multiple functions independent of its ?-secretase  General introduction 30       activity: presenilins were involved in ?-catenin regulation via interacting with and stabilizing ?-catenin (Zhang et al., 1998, Yu et al., 2000a, Meredith et al., 2002); presenilins regulated protein trafficking and turnover by targeting proteins such as ?1-integrins (Zou et al., 2008),  telencephalin (Esselens et al., 2004), epidermal growth factor receptor (Repetto et al., 2007), via defective protein-degradation organelles like endosomes or via the lysosome-autophagy pathway(Lee et al., 2010, Jang et al., 2011, Zhang et al., 2012); presenilins took part in calcium homeostasis of ER via debatable mechanisms such as regulating the ER calcium release channels like inositol 1,4,5-trisphosphate receptor (IP3R) (Kasri et al., 2006, Cheung et al., 2008) and ryanodine receptor (RyR) (Chan et al., 2000), stimulating the sarcoendoplasmic reticulum calcium APTase (SERCA) and acting as ER low-conductance calcium leaking channels for ER to maintain the normal function of ER (Tu et al., 2006, Nelson et al., 2007); last but not least, presenilins were recently found to regulate neurotransmitter release via a proposed effect on calcium homeostasis (Zhang et al., 2009, Pratt et al., 2011).  1.4.2  ?-Secretase complex assembly. ?-secretase is essential for the cleavage of APP C99 to generate A? (Scheuner et al., 1996). ?-secretase is a multi-unit enzymatic complex, including presenilin NTF/CTF heterodimer, nicastrin, Aph-1 and Pen-2 (Yu et al., 2000b, Francis et al., 2002b, Goutte et al., 2002b, Edbauer et al., 2003a, Kimberly et al., 2003a, Takasugi et al., 2003). Presenilin was the first molecule identified to be associated with ?-secretase in vivo and in vitro. PS1 knockout-out mice displayed a markedly reduced amount of ?-cleavage of APP (De Strooper et al., 1998) and double knockout of PS1 and PS2 in mice completely abolished ?- General introduction 31       secretase activity (Herreman et al., 2000, Zhang et al., 2000a). Using anti-PS antibody, Yu et al identified nicastrin, an integral transmembrane protein with a large N-terminal domain, as the second ?-secretase component (Yu et al., 2000b). However, the expression of both presenilins and nicastrin does not suffice to restore ?-secretase activity, indicating the existence of other components. Further gene-screening studies on the glp-1 (Notch homolog) deficient phenotype of C.elegans discovered Aph-1 and Pen-2 as the third and fourth components of ?-secretase (Francis et al., 2002a, Goutte et al., 2002a). Mammalian Aph-1 is a 30kDa multi-transmembrane protein similar to presenilin, whereas mammalian Pen-2 is a 12kDa hairpin-like transmembrane protein. Co-expression of presenilin, Aph-1, Pen-2 and nicastrin increases ?-secretase activity in transfected cells and the four proteins together are sufficient to reconstitute ?-secretase activity in yeast (Kimberly et al., 2003b, Luo et al., 2003).   Previous studies demonstrated that the minimal molecular weight of the ?-secretase complex was around 200-250 kDa, implying that a 1:1:1:1 stoichiometry of PS/Nicastrin/Aph-1/Pen-2 is present in the ?-secretase complex (Kimberly et al., 2003b). Though it is widely accepted that all four molecules form the minimal ?-secretase complex assembly, a recent report suggested that a PS/Pen-2/Aph-1 complex is sufficient for the catalytic activity in the absence of Nicastrin (Zhao et al., 2010). Another study demonstrated that PS1?E9 alone had partial ?-secretase activity and PS1?E9/Pen-2 was sufficient to restore full ?-secretase activity (Ahn et al., 2010a). These studies highlight the complexity of ?-secretase complex assembly. Given the stoichiometry of the  General introduction 32       ?-secretase complex and the existence of PS and Aph-1 homologs, there are at least six different forms of the ?-secretase complex that could be assembled (Shirotani et al., 2004, Shirotani et al., 2007). PS1-involved complex or PS2-involved complex processed APP C99 differentially and showed distinct susceptibility to certain ?-secretase inhibitors (Mastrangelo et al., 2005, Bentahir et al., 2006), indicating that different ?-secretase complexes could possibly have very distinct functions.   1.4.3  Structure of ?-Secretase complex. Presenilins form the catalytic core of the ?-secretase complex. Presenilins and signal peptides peptidases (SPPs), both belong to aspartyl intramembrane cleaving proteases (I-CLiPs) (Wolfe and Kopan, 2004). The two catalytic aspartate residues (Asp257 in transmembrane 6 (TM6) and Asp385 in TM7) are located at NTF and CTF of presenilins, respectively. Mutations in either two aspartates could abolish the enzymatic activity of the ?-secretase complex (Wolfe et al., 1999b). With a large and highly glycosylated ectodomain, nicastrin has been implicated as a site for the initial recognition of substrates (Shah et al., 2005). Electronic microscopic analysis and single particle imaging of ?-secretase revealed the existence of an intramembrane water-accessible cylindrical chamber in ?-secretase with a low-density cavity on the extracellular side (Lazarov et al., 2006, Osenkowski et al., 2009). Parallel substituted cysteine accessible method (SCAM) and cross-link experiments confirmed that TM6, TM7 and TM9 of PS formed the intramembrane chamber with two catalytic aspartates residing oppositely on TM6 and TM7, respectively (Fig.1.8) (Sato et al., 2006b, Tolia et al., 2006b, Sato et al., 2008b, Takagi et al., 2010, Watanabe et al., 2010). Constitutive autoendoproteolysis of PS removes the  General introduction 33       inhibitory allosteric effect of the large hydrophobic loop in the catalytic chamber of PS, thereby eliminating the loop?s inhibitory allosteric effect (Knappenberger et al., 2004, Fukumori et al., 2010). ?-secretase components directly interacted with one another (Kaether et al., 2004, Steiner et al., 2008), where Nct/Aph-1 subunits and Pen-2 tightened the relatively loose PS TM6/TM7/TM9 intramembrane cavity, and rearrange the PALP motif of TM9 such that it is closer to the catalytic center to render the enzyme activity to the ?-secretase (Takeo et al., 2012) (Fig.1.8).   Figure 1.8 ?-secretase complex and formation of the catalytic pore of PS1. PS1 TMDs were shown as columns with numbers. Without any subunits, PS forms a relatively open pore structure within the membrane. Upon the binding of other subunits, the catalytic structure is activated by the structural changes of PS TMDs, and the PALP motif moves to the proximity to the catalytic center. Two stars represent the two catalytic aspartate residues: Asp257 and Asp385.  Recently, Shi and coworkers reported the crystal structure of a presenilin/SPP homologue (PSH) from the archaeon Methanoculleus marisnigri JR1 and predicted the structure of presenilin based on the conserved sequence between the two homologues (Li et al., 2013). They confirmed the existence of the water permissible cavity but also revealed some differences in TM7 and TM9 compared with the NMR structure of PS1 CTF. The elegant work by Shi and  General introduction 34       his team has shed light on the elucidation of the crystal structure of presenilins.    1.4.4  APP and Notch as classical substrates. ?-secretase preferentially processes the type I integral membrane protein after  the shedding of the ectodomain (Struhl and Adachi, 2000). It is intriguing that many of ?-secretase?s classical substrates also participate in multiple signaling pathways, such as cell adhesion and migration, neuritis outgrowth and synapse formation, and many of these events are often disrupted during AD pathogenesis (Bossy-Wetzel et al., 2004).  Over 80 substrates have been linked to ?-secretase, including APP, Notch, neuregulin, ErbB4, E-cadherins and N-cadherins, CD44 and growth hormone receptor (Song et al., 1999b, Zhang et al., 2000b, Ni et al., 2001, Kim et al., 2002, Lammich et al., 2002, Marambaud et al., 2002, May et al., 2002, Marambaud et al., 2003, Haapasalo and Kovacs, 2011).   APP and Notch are the two most well known ?-secretase substrates. ?-secretase was named for its ability to process APP at the ?-cleavage site to generate A?, which is currently believed to play an essential role in the ?amyloid cascades? during AD pathogenesis. Notch is a type I transmembrane cell surface receptor that mediates cell fate decisions in both vertebrates and invertebrates (Artavanis-Tsakonas et al., 1995, Kopan et al., 1996). After being cleaved by furin, cell surface Notch receptors bind to the DSL (Delta/Serrate/LAG-2) family ligands on the surface of neighboring cells, and the transmembrane-intracellular fragment of Notch undergoes further proteolysis to release the  General introduction 35       Notch intracellular domain (NICD) from the membrane to the nucleus to activate target genes (Struhl et al., 1993, Kidd et al., 1998). Presenilin has been shown to play an important role in Notch signaling. PS-deficient mice with a disruption of PS genes exhibit Notch-knockout phenotype (Shen et al., 1997, Wong et al., 1997). Knocking-out of PS abolishes intramembrane ?-secretase cleavage of Notch to release NICD (De Strooper et al., 1999, Song et al., 1999a, Zhang et al., 2000a) and FAD-associated PS mutations impair NICD generation (Song et al., 1999a). Although impaired Notch-signaling is involved in synaptic plasticity and late-onset cognitive decline (Sestan et al., 1999, Presente et al., 2001, Presente et al., 2002, Wang et al., 2004, Salama-Cohen et al., 2006), the contribution of Notch signaling to AD pathogenesis remain to be elucidated.   1.4.5  ?-secretase cleavages at ?-site and ?-site. ?-secretase can process substrates at multiple cleavage sites.  ?-secretase cleaves the transmembrane domain of APP at two positions: the ?-site to generate A? and the downstream ?-site to produce the APP intracellular domain (AICD) (Weidemann et al., 2002) . Cleavage at the ?-site is heterogeneous, producing A? of 39-43 residues, whereas cutting at the ?-site produces almost exclusively a 50-residue AICD. The same phenomenon occurs in Notch processing, involving heterogeneous cleavages at the S4 site (?-site) to generate N?, and homogeneous cleavage at the S3 site (?-site) to generate NICD (Okochi et al., 2002).  Recent studies supported that ?-cleavage occurs prior to ?-cleavage (Qi-Takahara et al., 2005a, Sato et al., 2005, Kakuda et al., 2006). Qi-Takahara and colleagues were the first to detect the A?49, the proteolytic counterpart to AICD50-99 (Qi-Takahara et al., 2005a). Subsequently, the same group demonstrated that ?-cleavage occurs first to produce A?48 and A?49 for ?- General introduction 36       cleavage later, based on the presence of the induction period for the generation of tripeptides/tetrapeptides detected by liquid chromatography tandem mass spectrometry (LC-MS/MS) in a cell-free ?-secretase system (Takami et al., 2009). Meanwhile, various A? species (ranging from 49- to 40-amino acids) and corresponding tripeptides released from the trimming procedure have been identified using LC-MS/MS, confirming the sequential cleavage by ?-secretase at the ?-site then the ?-site (Funamoto et al., 2004, Qi-Takahara et al., 2005a, Takami et al., 2009).   1.4.6  ?-secretase inhibitors (GSIs) and modulators (GSMs).  As ?-secretase is the essential enzyme to generate A?, ?-secretase inhibitors has always been a popular research target for the potential treatment of AD. The development of ?-secretase inhibitor had started before the discovery of ?-secretase, and the first inhibitor turned out to be the aspartyl protease inhibitor (Higaki et al., 1995, Wolfe et al., 1998, Wolfe et al., 1999a). Since then several classes of ?-secretase inhibitors have been developed: the transition-stage analog inhibitor of aspartyl proteases with L-685,458 as representative (Li et al., 2000, Shearman et al., 2000); a substrate-based helical peptide GSI with D-peptide and L-peptide as representative (Das et al., 2003, Bihel et al., 2004); helical peptide type ?-secretase inhibitors with DAPT and Compound E as representatives (Seiffert et al., 2000, Dovey et al., 2001). The major challenge faced in the development of ?-secretase inhibitors is how to circumvent its inhibitory effect on the Notch signaling pathway.  In vivo studies have demonstrated that GSIs lead to toxicity due to impairment in Notch signaling, including gastrointestinal bleeding and immunosuppression (Searfoss et al., 2003, Wong et al., 2004). Semigacestat (LY-450,139), which was a compound  General introduction 37       modified from compound E, had failed in Phase III clinical trials because of causing severe gastrointestinal toxicity, immunnomodulation and skin cancer.    Thus, ?-secretase modulators (GSMs) have attracted interest due to its Notch-sparing ability. One typical category is a subset of NSAIDs (non-steroid anti-inflammatory drug), including ibuprofen, sulindac sulfide and indomethacin. They selectively lower A?42 without affecting the ?-cleavage, in other words, sparing the NICD generation (Weggen et al., 2001). However, not all NSAIDs could be pharmaceutically categorized as GSMs because their GSM functions do not appear to be relevant to cyclooxygenase property (Peretto et al., 2005) and the underlying mechanism remains unclear. Another category of potential GSMs, specifically regulating APP processing but not Notch (Gleeve), is ATP and other nucleotides and ?-secretase activating protein (GSAP) (Netzer et al., 2003, Fraering et al., 2005, He et al., 2010). These studies point to the possible existence of an allosteric site in ?-secretase that allows small molecules to regulate substrate selectivity. However, no ?-secretase inhibitors have been proven safe for clinical use so far. The essential issue is the lack of a precise structure of the ?-secretase complex and a precise working model that can determine substrate selectivity.   1.5 Familial Alzheimer?s disease (FAD)-associated mutations. Genetically, there are four known genes associated with AD pathogenesis: APP, PS1, PS2 and APOE. Apart from APOE, whose polymorphism (APOE ?4) is established as a genetic risk factor for sporadic late-onset AD, mutations in the  General introduction 38       other three genes are linked to early-onset FAD with an autosomal-dominant inheritance pattern. Although more than 95% of AD cases are sporadic form, progress on AD etiology has mainly come from the genetic studies of FAD- associated mutations. 1.5.1  FAD-associated APP mutations. APP was first linked to familial Alzheimer?s disease (FAD) via Down Syndrome (DS), because APP was located in chromosome 21 and the genetic deficit of Down syndrome, also known as Trisomy 21, was due to the presence of an extra copy of chromosome 21(Glenner and Wong, 1984a).  DS patients often develop characteristic AD symptoms and neuropathological features later in life.  Although changes such as enhanced BACE1 maturation (Podlisny et al., 1987, Sun et al., 2006c) have been found in DS and may have contributed to amyloid pathogenesis in Down syndrome, the presence of an extra copy of APP gene per se may be the biggest risk factor for DS. Later studies verified that APP gene locus duplication and missense mutation resulted in an autosomal-dominant form of FAD (Podlisny et al., 1987, Goate et al., 1991, Rovelet-Lecrux et al., 2006b, Sleegers et al., 2006b). To date, there are more than 30 APP point mutations discovered on 17 amino acid sites (Fig 1.2). APP mutations promote AD pathogenesis via affecting APP processing or altering the aggregation property of A?  (AD Mutations Database, Table 1.2).    General introduction 39        Table 1.2 Summary of FAD-associated mutations in APP gene.  The age of onset of FAD-associated APP mutations varies from early 40s to early 60s (Roks et al., 2000, Grabowski et al., 2001). It was reported that the polymorphism on the APOE gene contributed to the variation of age of onset in FAD (St George-Hyslop et al., 1994). Cerebral amyloid angiopathy and seizure are the two most varied features of FAD-associated APP mutations. The most remarkable clinical feature of APP mutations is the high incidence of cerebral amyloid angiopathy (CAA) (Van Broeckhoven et al., 1990, Rovelet-Lecrux et al., 2006a). CAA is often correlated with cerebral hemorrhage, stroke-like events, seizure and leukoencephalopathy, which are the cardinal clinical phenotypes of FAD caused by APP mutation (Van Broeckhoven et al., 1990, Grabowski et al., 2001, Sleegers et al., 2006a, Basun et al., 2008).    General introduction 40       1.5.2  FAD-associated PS1 mutations. Linkage studies indicated that FAD also segregated with chromosome 14 (Mullan et al., 1992b, Schellenberg et al., 1992, St George-Hyslop et al., 1992, Van Broeckhoven et al., 1992) and chromosome 1 (Levy-Lahad et al., 1995b). PS1 and PS2 are identified as the causative genes, which are located in chromosome 14 and chromosome 1, respectively (Levy-Lahad et al, 1995; Rogaev et al, 1995; Sherrington et al, 1995).  Since then, more than 170 familial AD-related mutations in PS1 and 14 mutations in PS2 genes have been identified (AD Mutations Database).   FAD-associated presenilin mutations result in typical AD, where the clinical and pathological features are indistinguishable from the sporadic AD. The age of onset for FAD caused by PS1 mutations ranges from 24 to 65 years old, with an average age of onset of 41.7 years, about 10 years earlier than that by APP mutations (51.2 years) (Raux et al., 2005). The unique clinical and histopathological features of PS1 mutations include spastic pareparesis, myoclonus, extrapyramidal signs, Levy body and cotton wool plaques (CWP) (Kwok et al., 1997, Lopera et al., 1997, Crook et al., 1998a, Houlden et al., 2001b). CWP is described as large, non-cored, diffuse amyloid plaques, which is composed primarily of A?42 with a lack of surrounding neuritic dystrophy and glial activation (Tabira et al., 2002). CWP is often associated with spastic pareparesis (SP) (Karlstrom et al., 2008), both of which are reported in a subset of PS1 mutants like PS1 M233T, PS1 R278T and PS1 ?E9 (Kwok et al., 1997, Crook et al., 1998b). The mechanism underlying these unique clinical and pathological phenotypes is unknown.   General introduction 41       Increased A?42/40 ratio is a common feature in PS1 mutations but the underlying mechanism is equivocal. By both in vitro (Borchelt et al., 1996, Scheuner et al., 1996) and in vivo transgenic mice (Jankowsky et al., 2004a) assays, A?42 is found to be the preferred product of PS1 mutants. However, given the wide spread of these known mutations throughout the whole coding sequence of PS1 gene, how these mutations shifts the ?-cleavage site is still elusive.  1.6 Overall goal of this research APP and PS mutations are helpful tools for researchers to elucidate the AD etiology. In sporadic AD, there are too many uncertainties that make the already intricate AD pathogenesis more complex, for instance, aging, hypoxia, inflammatory disease, hypertension, diabetes, cerebral vascular disease, etc.; whereas FAD, with early-onset, provides informative clues to disentangle the conundrum in specific scenarios, like FAD-associated mutations in APP or PS genes. The overall goal of my dissertation is to dissect two recently discovered mutations ? APPA673V and PS1?S169, by characterizing these two mutations and exploring how they affect A? generation and their contribution to cognitive impairment and memory deficit using transgenic mice models.   1.6.1  Examine the pathogenic effect of APPA673V on AD pathogenesis.  In 2009, Di Fede and colleagues reported the first recessive FAD-associated APP mutation ? APPA673V (Di Fede et al., 2009), intensively challenging the hypothesis that all APP point mutations are inherited in an autosomal-dominant pattern. They demonstrated that the A673V mutation promoted A? generation  General introduction 42       and A?A673V in the homozygous state was more amyloidogenic than its heterozygous state with A?WT, both of which contributed to the recessive inheritance pattern in this APP-mutated FAD family. Considering that the A673V mutation site is only one amino acid away from the APP Swedish mutation (KM670/671NL) but has a distinct inheritance pattern, we are interested in how this A673V mutation would influence APP processing compared with Swedish mutation. We hypothesize that APPA673V contributes to its recessive inheritance via affecting APP processing, especially at the ?-secretase cleavage site. In my dissertation, we examine the effect of APPA673V mutation on APP processing and A? production, as well as the underlying mechanisms. We find that APPA673V contributed to AD pathogenesis via comprehensive effect on APP processing, especially the ?-secretase and ?-secretase cleavages.   1.6.2  Study of the effects of PS1?S169 on APP and Notch processing.  Mutations in the PS1 gene are accounting for the majority of FAD cases. APP and Notch are the most important substrates of ?-secretase with PS as the catalytic subunit. APP is the precursor of A?, while Notch signaling is involved in fundamental neurodevelopment and neurodegeneration. Since most FAD-associated PS mutations impair both APP and Notch processing, the contribution of Notch signaling to AD pathogenesis has always been in debate. Most recently, a new PS1 deletion mutation of locus 169 serine was identified in a Chinese FAD family with typical AD symptoms developed in their early 40s (Guo et al., 2010a). In my dissertation, we thoroughly examine the effect of PS1?S169 on APP and Notch processing. We hypothesize that PS1?S169 specifically promotes indicative A?42/40 ratio via affecting the ?-cleavage of  General introduction 43       APP and retains its enzymatic activity on ?-cleavage for NICD (Notch Intracellular Domain) production. In chapter 3 of this thesis, the effect of PS1?S169 on APP and Notch processing will be explored in vitro under different scenarios.   1.6.3  Examining the effect of PS1?S169 on plaque formation and memory deficits in vivo. Pathogenic PS1 mutations are not only affect APP processing by increasing A?42/40 ratio in vitro (Borchelt et al., 1996, Scheuner et al., 1996), but also advance neuritic plaque formation and increase the plaque load in bigenic APP/PS1 mice (Jankowsky et al., 2004a). We investigate the effect of PS?S169 on APP processing in vitro and determine the effect of PS?S169 on amyloid plaque formation and cognitive functions. We hypothesize that PS1?S169 could promote neuritic plaque formation, and progressively exacerbate cognitive impairment in APP23 mice. In chapter 4 of this thesis, APP23/PS1?S169 transgenic mice will be studied histopathologically and behaviorally.      44        Chapter 2   APP A673V recessive mutation promotes A? generation by promoting ?-cleavage at Asp-1 site and enhancing lysosomal degradation of APP    2.1 Introduction. The mutation in the APP gene was the first genetic factor identified to cause autosomal dominant FAD (Goate et al., 1991). Recently, the first recessive APP mutation (A673V) has been reported in an Italian family, intensively challenging the conception that all APP mutations are inherited in an autosomal-dominant pattern (Di Fede et al., 2009). Genetic studies have revealed that both parental linkages of the homozygous proband were A673V heterozygous carriers. The heterozygous carriers with the A673V mutation did not have any AD symptoms between the ages of 21 and 88; whereas the homozygous proband developed dementia symptoms at the age of 36 and his homozygous sister also showed multi-domain mild cognitive impairment (MCI). The proband died at age 46 and the following neuropathological study detected both neuritic plaques and neurofibrillary tangles and confirmed the diagnosis of AD (Giaccone et al., 2010). The neuropathological study also revealed some distinct features of this APP recessive mutation. The diameter of neuritic plaque was up to 120uM with a high content of A?40 and cerebral amyloid angiopathy (CAA) was present and   Chapter 2  45       striking. APP A673V mutation stood out from numerous other APP dominant mutations for its unique recessive inheritance pattern and distinct neuropathology.   Figure 2.1 Schematic diagram of APP Swedish mutation and A673V mutation. Red bar represents the A? region. Big green arrow represents the major ?-cleavage at Asp-1 site (A? numbering). Small red arrow represents the minor ?-cleavage at Glu-11 site. Swedish mutation (yellow letters) occurs just before the Asp-1 site of ?-secretase but outside of the A? sequence. APP A673V mutation occurs at one amino acid after the Asp-1 site of ?-secretase and within the A? sequence.  The small peach bar represents the last two amino acids of A?42, indicating the heterogeneous ?-cleavages at the C-terminal of APP with A?40 or A?42 as alternative products.    APP Swedish mutation (KM670/671NL) is a well investigated and a typically dominant APP mutation with full penetrance in the heterozygous state (Mullan et al., 1992a, Felsenstein et al., 1994a). Swedish mutation has also been established as an example to show the effect of APP mutation on ?-cleavage. Swedish mutation (KM670/671NL) contains two amino acids alteration juxtaposed to the BACE1 Asp-1 cleavage site, promoting BACE1 to process APP at this site to generate more APP C-terminal fragment 99 (C99), which is the immediate precursor of A? (Citron et al., 1992, Felsenstein et al., 1994b, Lo et al., 1994, Haass et al., 1995, Thinakaran et al., 1996b) (Fig 2.1). Given that a higher level of C99 is directly correlated with an increase in the more hydrophobic A?42   Chapter 2  46       production (Yin et al., 2007), an up-regulation of C99 production in Swedish mutation provides for an abundance of precursors for A?42 generation. Transgenic mice expressing an APP Swedish mutation are widely used in AD research as animal models, e.g. APP23 (Tg.AD147.71H). APP23 mice specifically express human APP751 bearing Swedish mutation in neurons under the control of mouse Thy1.2 promoter and would develop amyloid plaques in the neocortex and hippocampus as early as 6 months old (Sun et al., 2006a).   APPA673V mutation occurs one amino acid after the Asp-1 site of A? sequence (Fig 2.1). Although APPA673V mutation and Swedish mutation (KM670/671NL) are very close to each other, being only one amino acid apart, they show distinct inheritance patterns. It is intriguing how this A673V mutation influences APP processing differently from the Swedish mutation. In this chapter, we examined the effect of APPA673V mutation on APP processing and A? production and further explore the underlying mechanism. We found that APPA673V contributed to AD pathogenesis by comprehensively influencing on the metabolism of APP.   2.2 Methods. 2.2.1  Materials. Dulbeccoo?s modified eagle medium (DMEM), fetal bovine serum (FBS), sodium pyruvate, L-glutamine, Penicillin-Streptomycin, geneticin, zeocin and lipofectamin 2000 were purchased from Life Sciences Technologies. Rabbit anti-C20 recognized the last twenty amino acids on the C-terminal end of APP were made in-house. ?-actin was detected using monoclonal antibody AC-15 (Sigma). IRDyeTM 680- labeled goat anti-rabbit and IRDyeTM 800CM-labeled goat anti-mouse secondary antibodies were obtained from LI-COR Biosciences.    Chapter 2  47       2.2.2  cDNA constructs. With pcDNA4-APP695WT (wild type) as template, pcDNA4-APPA673V was generated via site-directed mutagenesis. Using customary T7 (Invitrogen) as forward primer and a designed primer containing a A673V mutation  (5?-TCGGAATTCTACATCCATCTTCAC) as reverse primer, an APP fragment containing A673V mutation was generated and cloned back between the HindIII and EcoRI sites in pcDNA4-APPWT. To generate inducible plasmids pIND-APPWT, pIND-APPA673V and pIND-APPSWE, full length APP variants were cut from pcDNA4-APPWT, pcDNA4-APPA673V and pcDNA4-APPSWE with HindIII and XbaI and cloned into pIND (SP1)/Hygro mammalian expression vector (Invitrogen) between the HindIII and XbaI sites, respectively. Plasmid pVgRXR expresses the heterodimeric ecdysone receptor (VgEcR) and the retinoid X receptor (RXR) (Invitrogen). It is documented that KK sequence in extreme C-terminal tail can act as endoplasmic reticulum (ER) retention signal in transmembrane protein (Nilsson et al., 1989). APPWT-ER and APPA673V-ER were generated with pcDNA4 forward primer T7 and a reverse primer coding KKQN instead of QMQN in the C-terminal tail of APP  (5?-GCCTCTAGACTAGTTCTGCTTCTTCTCAAAGAACTTGTAGGTTGG), with pcDNA4-APPWT and pcDNA4-APPA673V as template, respectively. APPWT/F615P and APPA673V/F615P were generated with a pair of primers containing F615P mutation  (5?-GTTCATCATCAAAAATTGGTGCCCTTTGCAGAAGATGTGGGTTC and  5?-GAACCCACATCTTCTGCAAAGGGCACCAATTTTTGATGATGAAC), with pcDNA4-APPWT and pcDNA4-APPA673V as template, respectively.  The N-terminal 19 peptides (MLPGLALLLLAAWTARALE) of APP serve as signal sequence. With pcDNA4-APP695WT as template, a fragment containing the signal peptide was amplified with forward T7 primer and reverse primer coding the C-terminal sequence of signal peptide and the N-terminal sequence of C99 (5?- GTCGGAATTCTGCATCCTCCAGCGCCCGAGCCGTCC). The amplified   Chapter 2  48       fragment was cloned back between the HindIII and EcoRI sites in pcDNA4-C99WT or pcDNA4-C99A2V to generate C99Sig-WT and C99Sig-A2V, respectively.   2.2.3  Cell lines, cell culture and transfection. HEK293 cells were cultured in Dulbecco?s modified Eagle?s medium (DMEM) containing 10% fetal bovine serum (FBS), 1mM sodium pyruvate, 2 mM  L-glutamine, 50U/mL penicillin G sodium and 50?g/mL streptomycin sulfate (Invitrogen). NN cells are PS1-/-/PS2-/- mouse embryonic fibroblast (MEF) and N2A cells are mouse neuroblastoma cell line. Stable cell lines were maintained in media containing zeocin (50?g/mL). All cells were maintained at 37?C in an incubator containing 5% CO2. For transfection, cells were grown to 70% confluence and transfected with 2?g plasmid DNA/35 mm plate using 4uL of Lipofectamine 2000 Reagent (Invitrogen) according to the manufacturer's instructions.   2.2.4  APP-inducible expression and Ponasterone A treatment. To establish APP-inducible cell lines using the ecdysone-inducible mammalian expression system, the cDNA of human APPWT, APPA673V or APPSWE, were cloned into an inducible vector pIND (SP1)/Hygro to generate pIND-APPWT,  pIND-APPSWE and pIND-APPA673V, respectively. pIND (SP1)/Hygro contains modified ecdysone response elements and SP1 enhancers, and activation of the APP gene transcription is dependent on the binding of a heterodimer of VgEcR and RXR receptors in the presence of a ligand such as ecdysone analog ponasterone A. HEK293 cells were transfected with pVgRXR and pIND-APP then treated with inducer Ponasterone A or vehicle control. Under different dosages of Ponasterone A treatment, the full length of APP variants could be expressed at different levels under control in HEK293 cells. The basal levels of the APP holo-protein were very low in the absence of Ponasterone A. Ponasterone   Chapter 2  49       A, an ecdysone analog, was obtained from Invitrogen and dissolved in ethanol. HEK293 cells with transient overexpression of APP variants were treated with inducer Ponasterone A to induce APP expression at 0, 0.5?M, 1.0?M, or 3.0?M for 24 h.   2.2.5  Immunoblot analysis. Cells were lysed in RIPA lysis buffer (1% Triton X100, 1% sodium deoxycholate, 4% SDS, 0.15M NaCl, 0.05M Tris-HCl, pH 7.2) supplemented with 200 mM sodium orthovanadate, 25 mM ?-glycerophosphate, 20 mM sodium pyrophosphate, 30 mM sodium fluoride, 1 mM phenylmethanesulfonyl fluoride (PMSF), and a complete mini protease inhibitor cocktail tablet (Roche Diagnostics). The samples were diluted in 4?SDS-sample buffer, boiled, resolved by SDS-PAGE on 8% tris-glycine or 16% tris-tricine gels, then transferred to ImmobilonTM ?FL phlyvnylidene fluoride (PVDF) membranes (Millipore). For immunoblot analysis, membranes were blocked for 1h in phosphate-buffered saline (PBS) containing 5% non-fat dried milk followed by overnight incubation at 4?C in primary antibodies diluted in the blocking medium. Rabbit antibody C20 (1:2000) was used to detect APP and its C-terminal fragment (CTF) products. Internal control ?-actin was detected using monoclonal antibody AC-15 (Sigma). The membranes were rinsed in PBS with 0.1% Tween-20 and incubated with IRDye 800CW-labelled goat anti-mouse or anti-rabbit antibodies in PBS with 0.1% Tween-20 at 22?C for 1 h, and visualized on the Odyssey system (LI-COR Biosciences). All quantification was performed using LI-COR Odyssey system and Image J.   2.2.6  A?40/42 enzyme linked-immunosorbent assay (ELISA). HEK293 cells expressing the human wild type APP, Swedish mutant and A673V mutant were maintained in cell culture media supplemented with 5% FBS. After 24h, conditioned medium was collected and protease inhibitors and AEBSF   Chapter 2  50       (ROCHE Diagnostics) were added to prevent degradation of A? peptides. The concentration of A?40 and A?42 were detected using ?-amyloid 1-40 or ?-amyloid 1-42 Colorimetric ELISA kit (Invitrogen) according to manufacturer?s instructions.  2.2.7  L-685,458, Monensin, cycloheximide (CHX), chloroquine (CHL) and MG132 treatment. L-685,458 (Sigma) is a potent, structurally novel ?-secretase inhibitor, equipotent inhibitor of both A?40 and A?42 production. L-685,458 was dissolved in DMSO and applied to cell culture medium at 1?M final concentration for 3h. Monensin (Sigma) is a drug known to block the transport from the medial to the trans cisternae of the Golgi stacks. To block APP in TGN, HEK293 were treated with monensin at 1?M overnight. Cycloheximide (CHX, from Sigma) is an antibiotic produced by S. griseus. Its main biological activity is translation inhibition in eukaryotes, resulting in cell growth arrest and cell death. To determine the APP degradation rate, HEK293 were treated with CHX at 100?g/ml for different time course. Chloroquine (CHL, from Sigma) is lysosomal degradation inhibitor and MG132 (from Millipore) is a potent, reversible, and cell-permeable proteasome inhibitor. To determine the effect of APP mutations on APP degradation, HEK293 were treated with CHL at 10?M and MG132 at 1?M overnight, respectively.   2.2.8  Primary neuronal culture, A? toxicity treatment and LDH assay.  Hippocampal and neocortical tissues for primary cultures originating from C57BL/6J mice embryos at 14 days of gestation were dissected and gently digested with trypsin (0.025% EDTA; Invitrogen). The cells were suspended in neurobasal medium supplemented with B27 (Invitrogen) and plated at a density of 1?2 ?105 cells/well onto poly-D-lysine (0.01 mg/ml; Sigma)-coated 24-well plates. The cultures were maintained at 37 ?C in a humidified atmosphere containing 5% CO2 and used for experiments after 10 days. A?42WT and A?42A2V   Chapter 2  51       are synthesized in EZBiolab company. A?42WT and A?42A2V were prepared in  37?C water bath for 96 hours for aging before treatment. Lactate dehydrogenase (LDH) was used to evaluate the viability of the cells according to the instructions (Sigma). Trypan blue solution was used to stain the dead cells according to the instructions (Sigma).   2.3 Results. 2.3.1  APPA673V recessive mutation moderately increased A?  generation. We introduced the A673V mutation into human wild type APP695 isoform by site directed mutagenesis and expressed wild type or mutant APP in transiently transfected HEK293 cells. The expression levels of wild type and mutant full length APP were determined by Western blotting, and HEK293 cells expressing similar amounts of APP were subjected to further analysis. Conditioned media were analyzed using A? ELISA assay. Compared to APPWT, APPA673V and APPSWE increased the C99 levels to 155.6%?8.9% and 244.2%?22.8%, respectively (p<0.05) (Fig 2.2 A, B). The following A? ELISA assay demonstrated that APPA673V and APPSWE increased the A?40 levels to 4.48?0.03 folds and 34.8?9.5 folds as compared with APPWT, respectively (p<0.05) (Fig 2.2 C). Compared to APPSWE, the lower levels of C99 and A? in APPA673V suggested that APPA673V was not as malignant as APPSWE; however, on the other hand, APPA673V did increase C99 and A? levels compared to APPWT, indicating the amyloidogenic property of APPA673V. It seems like that A? has to be high enough to meet the threshold in order to trigger AD pathogenesis. In the heterozygous state with only one copy of A673V, there is not sufficient A? to initiate AD pathogenesis, which accounts for the recessive inheritance pattern of this mutation.    Chapter 2  52        Figure 2.2 Effects of APP A763V mutation on APP processing and A?  generation.  (A) APPWT, APPA673V or APPSWE were introduced into HEK293; the holo APP protein and its CTFs in cell lysate were detected by rabbit polyclonal antibody C20 that recognized the last 20 residues of APP C-terminals. (B) The levels of C99 were quantified and normalized to that in APPWT. (C) A? ELISA (Invitrogen) assay was performed to measure A?40 levels in the conditioned cell culture medium. The levels of A?40 in APPA673V and APPSWE were normalized to that in APPWT. Values represent mean?SEM, n=6, *p<0.05, **p<0.01 by one-way ANOVA with post-hoc tests.   2.3.2  APPA673V recessive mutation promoted C99 production by shifting the major ?-secretase site from Glu-11 to Asp-1 site. ?-secretase cleaved APP at two sites ? Asp-1 and Glu-11 ? to generate the corresponding products: sAPP?606 (numbered according to APP695 isoform) and C89 at Glu-11 site and sAPP?596 and C99 at Asp-1 site (Vassar et al., 1999, Deng et al., 2013). In HEK293 cells with low BACE1 activity, the majority of APP undergoes ?-secretase pathway with C83 being predominant from of APP CTFs; in 293B2 cells that stably overexpress BACE1, the majority of APP undergoes ?-secretase pathway with C89 and C99 being predominant forms of APP CTFs, which makes the effect of APP mutants on ?-cleavage easier to be detected. Whether C89 or C99 being the predominant form is dependent on different APP   Chapter 2  53       mutants. In wild type APP, the predominant ?-secretase product is C89, whereas in the Swedish APP the predominant ?-secretase product is C99 (Fig 2.3 A, lane 1 and 3) (Deng et al., 2013). Since APPA673V mutation is close to the ??secretase Asp-1 site (APP D672) like the Swedish mutation (KM670/671NL, APPSWE), we investigated the effect of APPA673V mutation on the ?-secretase cleavage of APP and compared it with APPWT and APPSWE. To determine the predominant ?-secretase product in different APP variants, we transiently expressed APPWT, APPA673V and APPSWE in 293B2 cells (Fig 2.3 A). In 293B2 cells with overexpression of BACE1, the predominant APP CTFs were ?-secretase product ? C99 or C89 ? in all APPWT, APPA673V and APPSWE, not C83 (Fig 2.3 A, D). Compared to C99 levels in APPWT, APPA673V and APPSWE increased the levels of C99 to 2.37?0.39 and 2.04?0.51 folds, respectively (p<0.05). The levels of C89 in APPWT, APPA673V and APPSWE were 2.23?0.44, 0.71?0.11 and 1.41?0.32 folds, as compared with the C99 levels in APPWT, respectively (p<0.05); and the levels of C83 in APPWT, APPA673V and APPSWE were 1.39?0.17, 0.47?0.11 and 0.94?0.20 folds, as compared with the C99 levels in APPWT, respectively (p<0.05) (Fig 2.3 D). It is noteworthy that APPA673V did not shed more C99 than APPSWE in the presence of BACE1 overexpression, which we will discuss in detail in Discussion section. To determine the shifting effect of APP mutants on ?-cleavage, we specifically evaluated the C99/C89 ratio in different APP variants. The C99/C89 in both APPA673V and APPSWE were normalized to that in APPWT. APPA673V significantly increased C99/C89 to 7.51?0.17 folds whereas APPSWE increased C99/C89 to 3.15?0.06 folds (p<0.05), indicating that APPA673V had stronger effect on the preferential cleavage of ?-secretase at Asp-1 site (Fig 2.3 E).   293B2 cells are stably overexpressing BACE1 with high ?-secretase activity. We next investigated whether the effect of A673V mutation on ?-cleavage was dependent of ?-secretase activity. We expressed APPWT, APPA673V and APPSWE in   Chapter 2  54       transiently transfected HEK293 cells to investigate the effect of A673V mutation on ?-cleavage under conditions with much lower ?-secretase activity. In HEK293 cells, the predominant APP CTFs were ?-secretase product ? C83 ? in all APPWT, APPA673V and APPSWE (Fig 2.3 B, F). Compared to C99 levels in APPWT, APPA673V and APPSWE increased the levels of C99 to 1.55?0.39 and 2.37?0.71 folds, respectively (p<0.05) (Fig 2.3 F). The C99/C89 in both APPA673V and APPSWE were normalized to that in APPWT. APPA673V significantly increased C99/C89 to 6.15?0.55 folds whereas APPSWE increased C99/C89 to 2.02?0.09 folds (p<0.05) (Fig 2.3 G). These data indicated that the effect of A673V mutation on CTF? production is independent of ?-secretase activity.   APP CTFs can be further processed by ?-secretase. To eliminate the effect of ?-secretase, we expressed APPWT, APPA673V and APPSWE in transiently transfected NN cells, which are PS1-/-PS2-/- mouse embryonic fibroblast cells (Fig 2.3 C, H). Without the effect of ?-secretase, APPA673V consistently increased C99/C89 to 4.38?0.75 folds whereas APPSWE increased C99/C89 to 2.15?0.58 folds, with normalization to that in APPWT (p<0.05) (Fig 2.3 I). Taken together, the A673V mutation demonstrated stronger effect than Swedish mutation to shift major ?-secretase cleavage site from Glu-11 to Asp-1 site independent of the ?-secretase activity and ?-secretase cleavage. It is noteworthy that APPA673V generated significantly less ?-secretase product C83, compared with wild type APP and Swedish APP in all three 293B2, HEK293 and NN cells (Fig 2.3 D, E, F), which we will discuss in detail in discussion section.   Chapter 2  55        Figure 2.3 APPA673V shifted the major ?-secretase product from C89 to C99 in 293B2 cells with BACE1 overexpression.  (A) 293B2 cells were transiently transfected with pcDNA4-APPWT, pcDNA4-APPA673V or pcDNA4-APPSWE. The holo APP and CTFs in cell lysate were detected by C20 antibody.  (D, E) Quantification of (A) by Image J and C83, C89 and C99 levels were normalized to C99 levels in APPWT; C99/C89 ratio was normalized with that in APPWT. (B) HEK293 cells were transiently transfected with pcDNA4-APPWT, pcDNA4-APPA673V or pcDNA4-APPSWE. (F, G) Quantification of (B) by Image J and C83, C89 and C99 levels were normalized to C99 levels in APPWT; C99/C89 ratio was normalized with that in APPWT. (C) NN (PS1-/-PS2-/-) cells were transiently transfected with pcDNA4-APPWT, pcDNA4-APPA673V or pcDNA4-APPSWE. (H, I) Quantification of (C). C83, C89 and C99 levels were normalized to C99 level in APPWT; C99/C89 ratio was normalized with that in APPWT. Values represent mean?SEM, n=6, *p<0.05, by one-way ANOVA with post-hoc tests.   2.3.3  APPA673V recessive mutation modulated ?-secretase activity.   The recessive A673V mutation is located within the A? region (A2V) (Fig 2.1). Therefore, C99 derived from APPA673V is designated as C99A2V (numbered   Chapter 2  56       according to the A? sequence). It is well established that APP mutations close to active sites of ?-cleavage in the C-terminal of the A? region can modulate ?-cleavage. However, the ?Flemish? mutation (A692G), which is located in the middle of A?, has an unexpected effect on ?-cleavage (Tian et al., 2010), suggesting that the interaction between ?-secretase and C99 may also occur at sites far from the active sites of ?-secretase. To investigate the effect of A673V mutation on ?-cleavage, C99A2V and C99WT were each overexpressed in HEK293 cells and the cells were treated with the ?-secretase inhibitor L-685, 458 (Sigma) or a vehicle control (see Methods). C99 variants and their proteolytic product C83 by endogenous ?-secretase were detected by Western blotting with C20 antibody. As expected, the pharmaceutical blocking of ?-secretase activity resulted in a significant increase of C99 in both C99WT and C99A2V, but the increase in C99A2V (171.8%?12.8%) was significantly less than C99WT (303.6%?31.7%) (p<0.05; Fig 2.4 A, B). Meanwhile, A? ELISA assay was performed to determine any secreted A? production in cell culture medium. Consistent with the increase of C99 levels, the A?40 levels in C99A2V was only 36.0%?3.5% of that in C99WT (p<0.05; Fig 2.4 C).   APP is a type I transmembrane protein with a signal peptide and both APP and C99 have the transmembrane domain. To ensure the correct insertion of C99 into the membrane of the endoplasmic reticulum and the similar secretary pathway like endogenous C99, the signal peptide of APP was fused to the N-terminus of C99WT and C99A2V (C99Sig-WT and C99Sig-A2V), which was cleaved during membrane insertion by signal peptidase (Dyrks et al., 1992, Dyrks et al., 1993, Lichtenthaler et al., 1999). Our preliminary data indicated that, with the signal peptide, the expression levels of C99Sig were greatly increased, likely due to the reduced degradation of incorrectly inserted proportion of C99 (data not shown). Thus, C99Sig was transiently transfected into HEK293 cells in the reduced amount   Chapter 2  57       of plasmid DNA (0.1 and 0.25?g), not the routine 2?g plasmid DNA/35 mm plate. Consistent with result in C99 without signal peptide, inhibition of ?-secretase greatly increased the accumulation of both C99Sig-WT and C99Sig-A2V in cell lysate, and the increase in C99Sig-A2V (129.3%?19.3%) was still significantly less than C99Sig-WT (285.4%?36.9%) (p<0.05; Fig 2.4 D, E). These data demonstrated that both C99A2V and C99Sig-A2V are less efficiently processed by ?-secretase.    Figure 2.4 Effects of A673V mutant C99 (C99A2V) on ?-secretase activity.  (A) C99WT or C99A2V were co-transfected with EGFP into HEK293 with treatment of ?-secretase inhibitor L-685,458 (Sigma) or vehicle control. EGFP was used as internal control to ensure the same transfection efficiency, which was detected via anti-GFP antibody. ?-Actin was used as internal control to ensure the same amount of cell lysate applied for analysis. Cell lysate was harvested to determine the accumulation of C99 via Western blotting. Because C99 was substrate of ?-secretase as well as ?-secretase (Lichtenthaler et al., 1997, Lichtenthaler et al., 1999), both C99 and C83 can be detected in cell lysate by C20 antibody. (B) The increased folds of C99 levels after L-685,458 treatment in (A) were quantified and compared between C99WT and C99A2V. (C) Conditioned cell culture medium was collected to determine the amount of A?40 in HEK293 with C99WT and C99A2V overexpression via A? ELISA assay (Invitrogen). The amount of A?40 in   Chapter 2  58       C99A2V was normalized to that in C99WT. (D) Different amount of C99Sig-WT and C99Sig-A2V were co-transfected with equal amount of EGFP into HEK293 with treatment of ?-secretase inhibitor L-685,458 or vehicle control. EGFP and ?-Actin were used as internal control to ensure the same transfection efficiency and the same amount of cell lysate in analysis, respectively. (E) The increased folds of C99Sig levels after L-685,458 treatment in (A) were quantified and compared between C99Sig-WT and C99Sig-A2V. Values represent mean?SEM, n=3, *p<0.05, by student t-test. A  2.3.4  APPA673V demonstrated a higher C99/C89 ratio than Swedish APP independently of its expression level. APPA673V is a recessive mutation that requires two mutated alleles to initiate AD pathogenesis, whereas in the case of Swedish APP one allele is sufficient to lead to AD when patients are in their early 50s. There is a possibility that the expression level of APPA673V could affect ?-secretase processing. We found that APPA673V  robustly shifted the major ?-cleavage site, resulting in a high C99/C89 ratio. To investigate whether different APPA673V expression levels could affect the ?-secretase processing, we used an inducible APP expression system under the control of ponasterone A to achieve the expression of APP expression at different amounts. To assess inducible APP processing, APPWT, APPA673V or APPSWE were introduced to 293B2 cells that strongly express BACE1, and the expression of APP variants was triggered by ponasterone A at 0.5, 1.0, or 3.0 ?M for 24 hours. Ponasterone A, an ecdysone analog, would bind to the ecdysone receptor and activate APP gene transcription. While holo APP expression was barely detectable in 293B2cells treated with the vehicle control, ponasterone A treatment resulted in a linear increase of holo APP expression in a similar way among APPWT, APPA673V and APPSWE (p>0.05) (Fig 2.5 A, B, C, D). Ponasterone A treatment had no effect on ?-actin protein levels, indicating a specific effect of Ponasterone A on inducible expression of APP. After 24h of ponasterone A treatment, cell lysates were examined by Western blotting to determine the amount of APP CTFs by C20 antibody. Despite of the increasing holo-APP and total CTFs corresponding to the increasing concentration of ponasterone A (Fig   Chapter 2  59       2.5 A, B, C), APPA673V consistently displayed the highest C99/C89 ratio (3.41?0.33) as compared to APPWT (0.45?0.03) and APPSWE (1.42?0.09) (p<0.05)  (Fig 2.5 E), indicating that the effect of A673V mutation on ?-cleavage shift from Glu-11 to Asp-1 was independent of the expression levels of APP.    Figure 2.5 Dose-dependent inducible expression of APP variants in 293B2 cells.  293B2 cells were transfected with pIND-APPWT (A), pIND-APPA673V  (B) or pIND-APPSWE (C), respectively, then treated with vehicle solution control or ponasterone A at 0, 0.5, 1.0 or 3.0 ?M for 24h. Cells were collected at the same endpoint and were lysed in RIPA-DOC buffer. Cell lysates were analyzed by 9% Tris-glycine to detect for full length APP or 16%Tris-tricine to detect for APP CTFs by C20 antibody. BACE1 was detected by 9E10 that would recognize the MycHis tag. Monoclonal anti-?-actin antibody (AC-15) was used to detect ?-actin. (D) Full length APP expression levels were quantified and plotted to represent Ponasterone A dosage-dependent expression of APP (Quantification by Image J). (E) C99/C89 ratio under different APP expression levels was quantified and plotted (Quantification by Image J). Values represent mean?SEM, n=3, *p<0.05, by two-way ANOVA and one-way ANOVA with post-hoc tests. All experiments were at least triplicated.    Chapter 2  60       2.3.5  APPA673V structurally facilitated ?-secretase cleavage at Asp-1 site in both the endoplasmic reticulum and trans Golgi network. APP is preliminarily glycosylated in the endoplasmic reticulum (ER) upon synthesis then anterograde transported to the Golgi apparatus for further modification such as sulfation and phosphorylation. A proportion of the fully modified APP (or mature APP, mAPP) is subsequently delivered to the cell surface where the ?-cleavages occur (Parvathy et al., 1999); whereas ?-secretase mediated cleavages appear to occur in the trans Golgi network or in the endosomal/lysosomal system following the endocytosis of APP from the plasma membrane (Koo and Squazzo, 1994, Tienari et al., 1997). Therefore, it is conceivable that BACE1 mostly, if not exclusively, cleaves mAPP; and nascent APP or immature APP (imAPP) is not a substrate of BACE1. According to this hypothesis, APP with an ER retention signal fused to the COOH-terminus (APPER) cannot be processed by BACE1; in other words, APPER does not produce C89 or C99. However, we found that both APPA673V and APPSWE with the ER retention signal can be cleaved into C99, whereas APPWT with the ER retention signal cannot (Fig 2.6 A). Given that all APP variants are synthesized in the ER, imAPP in the ER represents the default forms and structures of APP proteins. Our results indicated that both APPA673V and APPSWE are structurally favored by BACE1 cleavage at the Asp-1 site. We also compared the processing of APPWT and APPA673V in trans Golgi network (TGN) with monensin treatment (see Methods). When the downstream metabolism of APP was blocked and trapped in TGN, APPA673V markedly increased C99 production whereas the C99 in APPWT was barely detected under low exposure conditions (Fig 2.6 B).  When APP is trapped in specific organelles such as ER and TGN, the effect of altered trafficking of APP mutations on APP processing is excluded and the abnormal APP processing results from the altered structure imposed by the mutations. The enhanced production of C99 in APPA673V in both ER and TGN implicated that   Chapter 2  61       APPA673V structurally, highly facilitated ?-cleavage at Asp-1 site and enhanced the production of C99, resulting in high C99/C89 ratio.    Figure 2.6 APPA763V promoted the production of C99 in both ER and TGN. (A) APPWT, APPA673V or APPSWE with ER retentional signal (APPWT-ER, APPA673V-ER or  APPSWE-ER) were introduced into HEK293 with BACE1 overexpression; the holo APP protein and its CTFs in cell lysate were detected by antibody C20. BACE1 was detected by 9E10 that would recognize the MycHis tag. C99 was produced in both APPSWE-ER and APPA673V-ER by BACE1, whereas C99 was not detected in APPWT. (B) APPWT or APPA673V were introduced into HEK293 cells and treated with 10?M monensin or vehicle control overnight. Cell lysate was harvested to determine the APP CTFs by C20 antibody. After treatment of monensin, C99 production in APPA673V was great increased whereas the C99 in APPWT was barely detected under low exposure conditions. All experiments were at least triplicated.    2.3.6  Modified APPA673V underwent faster lysosome-dependent degradation than APPWT.  It is documented that the half-life of APP is about 60min and the majority of APP is processed by ?-secretase or undergoes lysosomal degradation (Caporaso et al., 1994). While we were investigating the processing of APPA673V, we found that APPA673V produced far less ?-secretase product (C83) than APPWT (Fig 2.3). This raised the possibility that there is not enough fully modified APP (or mature APP, mAPP) for ?-cleavages, as we mentioned that mAPP is the substrate of ?-secretase. Consistent with this finding, APPA673V displayed significantly less modified form (53%?5%; p<0.05), which is supposed to be the form of APP on the plasma membrane, as compared with APPWT; whereas the modified form of   Chapter 2  62       APPSWE was not significantly affected (p>0.05) (Fig 2.7 A, B). The lower levels of the modified from of APPA673V (mAPPA673V) was not likely due to slower ER exiting rate of nascent APPA673V, because the reduction of nascent APPA673V in ER (imAPPA673V), resulting from the protein translation inhibition by cycloheximide (CHX), was indistinguishable from that of APPWT (p>0.05) (Fig 2.7 C, D), indicating that nascent APPA673V exited ER normally. Thus the reduced modified form of APPA673V (mAPPA673V) was possibly caused by alterations in downstream APP metabolism like faster degradation.   A large proportion of mAPP was processed by ?-secretase at plasma membrane. The F615P mutation was documented to increase the levels of the mAPP by inhibiting ?-secretase cleavage, increasing mAPP to 356.3%?12.1%, as compared to APPWT (p<0.05) (Fig 2.7 E), which thus greatly increased the sensitivity to detect any alteration in mAPP (Jager et al., 2009). We introduced F615P mutation in both APPWT and APPA673V (APPWT/F615P and APPA673V/F615P) and repeated the CHX experiment. As expected, upon CHX treatment, modified APPWT (mAPPWT) kept increasing to 315.3%?3.7% until 40 minute then decreased to 231.6%?8.1% at 60 minute; whereas modified APPA673V (mAPPA673V) kept increasing to 211.2%?4.7% until 20 minute then quickly decreased to 117.3%?7.3% at 60 minute, as compared with the levels of their each mAPP at 0 minute (p<0.05) (Fig 2.7 F, G), suggesting a stronger non-secretase degradation pathway of modified APPA673V. To determine the affected degradation pathway of mAPPA673V, we treated cells expressing either APPWT/F615P or APPA673V/F615P with proteasome inhibitor (MG132) or lysosome inhibitor (CHL), respectively. While MG132 had little effect on both APPWT and APPA673V (p>0.05), CHL dramatically enhanced mAPP in both APPWT and APPA673V (Fig 2.7 H, I). Upon CHL treatment, mAPPWT increased to 1.4?0.09% folds whereas mAPPA673V increased to 3.57?0.19 folds (p<0.05), as compared with vehicle control, indicating that both   Chapter 2  63       mAPPWT and mAPPA673V undergo lysosome?dependent degradation but the degradation of mAPPA673V is faster (Fig 2.7 H, I). Given that both ?- and ?-secretase mainly cleave the modified APP (but not exclusively in the case of APPA673V and APPSWE, see Fig 2.6 A), the faster lysosome-dependent degradation of modified APPA673V results in less substrate for ?- and ?-cleavages and less accumulation of overall CTFs. These data demonstrated that APPA673V altered the metabolism of APP such as lysosome-dependent degradation and the faster degradation of APPA673V resulted in less APPA673V for other metabolism pathway, such as ?- and ?-secretase pathways.      Chapter 2  64        Figure 2.7 APPA763V underwent stronger lysosome-dependent degradation. (A) APPWT and APPA673V were introduced into HEK293 cells. The nascent APP (imAPP) and modified APP (mAPP) in cell lysate were resolved in 8% glycine SDS-PAGE gel and detected via C20 antibody. (B) The ratio of imAPP/mAPP in (A) was quantified and normalized to that in APPWT. (C, D) APPER, APPWT or APPA673V were introduced into HEK293 with CHX treatment for 15, 30 or 45 minutes. Both nascent APP (imAPP) and modified APP (mAPP) were resolved in 8% glycine SDS-PAGE gel and detected via C20 antibody. With ER retention signal, APPER exhibited no modified APP; upon CHX treatment, imAPP in APPWT-ER (gray line) underwent significant slower degradation compared with APPWT (black line) and APPA673V (green line). Upon CHX treatment, both APPWT and APPA673V underwent degradation at similar rate. (E) APPWT-ER, APPWT/F615P or APPWT were introduced into HEK293 to determine the accumulation of modified APP. APPER was APP with additional ER retentional signal and did not undergo normal modification. APPWT/F615P demonstrated greatly increased accumulation of modified APP compared with APPWT. (F, G) APPWT/F615P and APPA673V/F615P were introduced into HEK293 cells with CHX treatment for 20, 40 or 60 minutes. The nascent APP (imAPP) and modified APP (mAPP) in cell lysate were resolved in 8% glycine SDS-PAGE gel and detected via C20 antibody.   Chapter 2  65       Upon CHX treatment, imAPPWT/F615P and imAPPA673V/F615P demonstrated a similar degradation rate; whereas mAPPA673V/F615P displayed faster degradation compared with mAPPWT/F615P; (H, I) APPWT/F615P and APPA673V/F615P were introduced into HEK293 cells with MG132 or CHL treatment overnight. The nascent APP (imAPP) and modified APP (mAPP) in cell lysate were resolved in 8% glycine SDS-PAGE gel and detected via C20 antibody. MG132 treatment did not induced significant accumulation of mAPP in APPWT/F615P and APPA673V/F615P; with treatment of CHL, APPA673V/F615P displayed more accumulation of mAPP compared to APPWT/F615P. Values represent mean?SEM, n=3, *p<0.05, by two-way ANOVA and one-way ANOVA with post-hoc tests.   2.3.7  The toxicity of A?A2V on primary neurons.   Unlike APPSWE that produces A?WT, APPA673V has an alanine to valine mutation within the A? domain (Di Fede et al., 2009), which may affect the toxicity of A?. To assess the toxicity of A?42A2V, we treated E14 primary neurons with either A?42WT or A?42A2V. Vehicle control, soluble A?42WT, aged A?42WT or aged A?42A2V were applied to primary neurons in 96-well plates at 1?M. After 24 hours of treatment, living cells were labeled by trypan blue and counted (Fig 2.8 A). Both aged A?42WT or aged A?42A2V induced more neuronal death (61%?2% and 74% ? 1%, respectively) than soluble A?42WT (41%?2%; p<0.05); however, aged A?42A2V appeared to be even more toxic than A?42WT, because cells challenged with A?42 A2V displayed the lowest viability (Fig 2.8 B). To further confirm these results, we treated the primary neurons with vehicle control, soluble A?42WT, aged A?42WT or aged A?42A2V at much higher concentrations (100uM and 500uM) for 24h, and then performed LDH leakage assay to evaluate cell damage. As compared with 1% triton-100 positive control, A?42A2V induced LDH levels to 82%?2% and 68%?3% at both concentrations, respectively; whereas A?42WT only increased LDH levels to 52%?1% and 45%?1% respectively, indicating that A?42A2V was more toxic to primary neurons (p<0.05) (Fig 2.8 C, D).     Chapter 2  66        Figure 2.8 A?42A2V was more cytotoxic than A?42WT.  Primary neurons (E14) were cultured for 10 days before A? application. (A) Cells were treated with vehicle control, soluble A?42WT, aged A?42WT or aged A?42A2V at 1?M for 24 hrs. 10% trypan blue were then added. The number of living cells and dead cells were manually counted. (B) Quantification of (A).  (C, D) Primary neurons were treated with vehicle control, soluble A?42WT, aged A?42WT or aged A?42A2V at 100?M (C) or 500?M (D) for 24 hrs. LDH kit (Promega) was used to detect cell membrane breakage. Cells treated with 1% triton-100 were positive control. LDH leakage of all four groups was normalized with 1% triton-100 positive control. Values represent mean?SEM, n=6, *p<0.05, by two-way ANOVA and one-way ANOVA with post-hoc tests.  2.4 Discussion. Due to the complexity of sporadic AD pathogenesis, it is difficult to explore the underlying mechanism. FAD-associated APP mutants have provided great insights into AD pathogenesis and have served as powerful tools for AD researchers. C99 is the precursor of A? and a ?-secretase product. It has been well established that Swedish APP contributes to AD pathogenesis via promoting C99 generation (Deng et al., 2013). In the cases of the Swedish mutation and APPA673V,   Chapter 2  67       C99/C83 ratio does not accurately define the effect of APP mutants to shift APP processing from non-amyloidogenic pathway to an amyloidogenic pathway (Di Fede et al., 2009). C99/C83 defines the competition between ?- and ?-secretase. The increase of C99/C83 can be interpreted as the result of increased ?-secretase activity at the expense of the ?-secretase activity. However, the Swedish mutation increases the production of C99 and decreases C89, another ?-secretase product; whereas the levels of C83 of Swedish mutation are comparable with that of the wild type APP. The pathogenic effect of APP mutants, like the Swedish on the ?-secretase, should be determined and quantified using C99/C89 as an indicator (Fig 2.3).   We found that APPA673V robustly shifted the major ?-cleavage site from Glu-11 to Asp-1, with an even higher C99/C89 than Swedish APP. It seems like that APPA673V had a stronger amyloidogenic effect than the Swedish mutation, which was paradoxical concerning the recessive inheritance pattern of APPA673V. However, only when the overall ?-cleavage is a constant, C99/C89 is proportional to the severity of amyloidogenesis. In other words, the production of C99 was not only determined by the ?-cleavage preference but also by the overall ?-cleavage efficiency (or the activity of ?-secretase). Our data demonstrated that the C99 production in APPA673V was not more than Swedish mutation even in 293B2 cells with robust overexpression of BACE1, and in HEK293 and in NN cells with endogenous levels of BACE1, the C99 production in APPA673V was less than Swedish mutation (Fig 2.2 and Fig 2.3). BACE1 is highly expressed in pancreases and cortex but is still tightly regulated at both transcriptional and translational levels (Vassar et al., 1999, Li et al., 2006, Zhou and Song, 2006, Sun et al., 2012). We do not know the exact level of ?-secretase activity in brain relative to in vitro cell lines but we estimate that ?-secretase activity in brain falls between that of   Chapter 2  68       HEK293 and 293B2 cells. Thus, we conclude that the production of C99 of APPA673V in brain is less than Swedish but more than wild type APP.   We further explored why ?-secretase highly preferentially cleaved APPA673V at Asp-1 site. APP mutations affect its processing via either structural transformation of the active cleavage sites (Sauder et al., 2000) or altering the intracellular trafficking (Felsenstein et al., 1994b, Haass et al., 1995, Thinakaran et al., 1996b). To eliminate the trafficking factors, we trapped APP in particular organelles thus any altered processing of APP should result from the structural effect. We used ER retention signal or monensin treatment to trap APP in ER or TGN and found that both APPA673V and APPSWE can be processed to C99 in ER and TGN, whereas APPWT cannot (Fig 2.6). Our data demonstrated that, at least with respect to the increased C99/C89 in APPA673V and APPSWE, the structural transformation around the Asp-1 ?-cleavage site is responsible for shifting the prime ?-secretase site of BACE1 from Glu-11 to Asp-1 site, with C99 as predominant ?-secretase product in APPA673V and APPSWE. Sauder et al. reported that several hydrophobic residues in BACE1 formed an active pocket with the residues around Asp-1 site, like Leu671 in APPSWE, which affected the preference cleavage of BACE1 in APP (Sauder et al., 2000). Consistent with this study, our data supports that both APPA673V and APPSWE facilitate ?-cleavage at Asp-1 site via structural transformation but APPA673V exhibited stronger facilitating effect than APPSWE.   In addition, as reported in section 2.3.2, we also noticed that both the ?-secretase (C83) and the overall ?-secretase product (C89 and C99) of APPA673V were significantly less than APPWT and APPSWE (Fig 2.3). We explored the underlying mechanism and found that APPA673V underwent faster lysosomal-dependent degradation, resulting that the remaining APPA673V does not suffice for all other metabolism pathways, which nicely explains why there was a general inhibitory   Chapter 2  69       effect on APP processing ? the markedly reduced ?- and total ?-products in APPA673V. Though ?-secretase preferentially cleaves APPA673V at Asp-1 site via structural facilitation, the faster lysosome-dependent degradation of APPA673V reduces the substrate for ?-cleavages, which results in mild increase in C99 production and contributes the recessive inheritance of APPA673V.   Compared with Swedish mutation, APPA673V is not only located closely to the Glu-11 ?-secretase cleavage site but also within the C99 region (C99A2V). APP mutations located within the C99 region can affect ?-cleavage via enhancing A?42 generation and are usually located around the ?-secretase cleavage site, like APPV717I (London mutation) (Goate et al., 1991, De Jonghe et al., 2001). Though C99A2V occurred far from the ?-cleavage site, C99A2V demonstrated a significant inhibitory effect on ?-cleavage with a reduced A?40 generation (Fig 2.4). It should be noted that we also determined the amount of A?42 in C99A2V. According to our preliminary data, the generation of A?42A2V was also decreased as compared with A?42WT and the A?42/40 in C99A2V ratio was not higher than that in C99WT (data not shown). Nevertheless, in addition to the effect on ?-cleavages, the inhibitory effect of APPA673V on ?-cleavage makes another contribution to the recessive inheritance of APPA673V, both of which makes APPA673V require another mutated allele to produce enough A? to initiate AD pathogenesis.   APPA673V is also located within the A? domain--A?A2V. Di Fede et al. reported that A?A2V in the homozygous state was more amyloidogenic than the equimolar mixture of A?WT and A?A2V, which contributed to the recessive inheritance pattern in this recessive FAD family (Di Fede et al., 2009). The aggregation tendency of   Chapter 2  70       A?40A2V was explored by CD Spectrum (Circular Dichroism Spectrum) and atomic force microscopy analysis. Both indicated that A? mixture (A?40WT/A?40A2V) prevented aggregate formation but pure A?A2V promoted the formation. It is reported that the aggregation of A?42 plays a essential role in plaque formation and A?40 had a protective role in AD pathogenesis (Yankner et al., 1990, Yang et al., 1995, Zou et al., 2003). Thus the aggregation tendency of A?40 may be not appropriately correlated with AD pathogenesis as A?42. That is why A?42 was applied in primary neurons treatment in our study. We found that A?42A2V was more toxic to primary neurons compared to A?42WT (Fig 2.8), but the data of A?42 mixture (A?42/A?42A2V) was not less toxic than A?WT (data not shown). Nonetheless, no matter the aggregation tendency of A? or the toxicity of A?, both are highly dependent on the physiological microenvironment in the brain. The A? experiments from our laboratory and Di Fide?s , which were performed in vitro, might not reflect the real conditions in the brain.   2.5 Conclusion. In conclusion, APPA673V facilitates ?-cleavage at Asp-1 site while inhibited the general APP processing including all ?-/?-/?-cleavages, due to the intensified lysosome-dependent degradation. The overall effect of APPA673V on the production of A? necessitates the homozygous state of APPA673V to produce enough A? to initiate AD pathogenesis.           71         Chapter 3   PS1?S169 impairs ?-cleavage of APP but reserves functional ?-cleavage of Notch   3.1 Introduction. Mutations in Presenilin1 (PS1) are major causes of Familial Alzheimer?s Disease (FAD). Unlike FAD-associated APP mutations, which usually cluster around the A? domain, PS1 mutations are scattered throughout the entire sequence of this multiple transmembrane protein, including the cytoplasmic domain, luminal domain, and the transmembrane domain. A central and unresolved conundrum in the AD field is how these variously located PS1 mutations lead to the same physiological consequence ? initiating AD pathogenesis via altered ?-secretase activity. Given that ?-secretase is the necessary enzyme for A? generation, understanding how these PS1 mutations lead to similar consequences could have important implications in AD therapy.     As mentioned above, ?-secretase is the enzyme responsible for the transmembrane cleavage of C-terminal fragments derived from APP, and A? is produced from APP by sequential cleavage of ?- and ?-secretase. ?-secretase is a protein complex   Chapter 3  72       with presenilin as its catalytic core and Nicastrin, Aph-1 and Pen-2 as assistant subunits.  ?-secretase processes its substrates via several sequential cleavages  (Fig 3.1); the transmembrane domain of APP is cleaved at two positions: the ?-site, which liberates the N-terminus of A?, and the ?-site, which liberates the C-terminus of the APP intracellular domain (AICD) and is located C-terminally to the ?-site (Weidemann et al., 2002). The site of ?-cleavage within the C-terminal fragments of APP is not exact, resulting in a heterogeneous collection of A? peptides ranging in size from 39 to 43 residues. Contrarily, cleavage at the ?-site almost exclusively produces a 50-residue AICD. Although the underlying mechanism remains unknown, all clinical PS1 mutations increase the relative amount of A?42 versus A?40, both in vitro and in vivo (Borchelt et al., 1996, Duff et al., 1996, Scheuner et al., 1996, Murayama et al., 1998). Thus, the A?42/A?40 ratio is now widely used as a pathogenic indicator of PS mutations.  A similar ?-cleavage pattern is also observed for Notch, including heterogeneous cleavage within the transmembrane domain at the S3 site (?-site) to generate N?, and homogeneous cleavage further downstream at the S4 site (?-site) to generate NICD (Okochi et al., 2002). Some PS1 mutations can inhibit cleavage at ?-site of Notch, as seen in certain FAD-associated PS1 mutations, which impair NICD generation in Notch signaling (Song et al., 1999a). While the central role of APP cleavage by ?-secretase has been well established in AD pathogenesis, the impaired Notch signaling seen in FAD-associated PS mutations is still in doubt.   Recently, a novel PS1 deletion, PS1?S169, was discovered in a Chinese family; patients with this mutation developed FAD in their early 40s (Guo et al., 2010b). In Chapter 3, we examine the effect of PS1?S169 on APP and Notch processing. We found that PS1?S169 impairs APP processing but does not affect Notch   Chapter 3  73       proteolysis or signaling, suggesting a mechanism by which PS1?S169 contributes to the early on-set of AD in affected members of this family.    Figure 3.1 Sequential cleavages of ?-secretase.  Top: APP cleavage. ?-secretase first cleaves APP C99 at the ?-site to release AICD, which exists as a 50-residue exclusively. Heterogeneous cleavage at the ?-site generates an A? peptide ranging from 39 to 43 residues. Bottom: the same working model occurs in Notch processing at the S3 and S4 sites. Adapted from Wolfe, 2007.  3.2 Methods. 3.2.1  Materials.  Dulbeccoo?s modified eagle medium (DMEM), fetal bovine serum (FBS), sodium pyruvate, L-glutamine, Penicillin-Streptomycin, geneticin, zeocin and lipofectamin 2000 were purchased from Life Sciences Technologies. Rabbit anti-  Chapter 3  74       C20 antibody, which recognizes the last twenty amino acids of the C-terminal end of APP and rabbit anti-PS1 N-terminal antibody PS1N, were both made in-house. ?-actin was detected using monoclonal antibody AC-15 (Sigma). IRDyeTM 680 labeled goat anti-rabbit and IRDyeTM 800CM labeled goat anti-mouse secondary antibodies were obtained from LI-COR Biosciences. pcDNA4-Myc-His(A) expression vector was obtained from Invitrogen.  3.2.2  cDNA constructs.  PS1WT, PS1C410Y, and PS1Y115H were cut at HindIII and XbaI sites from  pRK7-PS1WT, PS1C410Y, or PS1Y115H, respectively; and cloned into pcDNA4-MycHis (A) (Invitrogen) (Song et al., 1999a). PS1?S169 was also cloned into pcDNA4-Myc-His (A) expression vector, using a PCR site-directed mutagenesis approach with a pair of complementary primers containing the 3bp deletion coding serine (5?- GCCTGGCTTATTATATCT CTATTG as the forward primer and 5?-GAA CAGCAACAATAGAGATATAAT as the reverse primer). The sequence of PS1?S169 was confirmed by Bigdye? Terminator v3.1 Cycle sequencing kit in both directions. Notch cleavage was examined using mNotch1?E m/v (N?E), which expressed a truncated form of mouse Notch1, and undergoes constitutive ?-secretase proteolysis in the absence of ligand (Song et al., 1999a). Expression plasmid ICV, which expresses the truncated form of N?E from the cleavage site (1744) to the Myc-tag end, was used as a fragment marker corresponding to the Notch-1 intracellular domain (NICD) (Schroeter et al., 1998, Song et al., 1999a).   !3.2.3  Cell culture and transfection.  HEK293 cells were cultured in DMEM containing 10% FBS, 1mM sodium pyruvate, 2 mM L-glutamine, 50 U/mL penicillin G sodium, and 50 ?g/mL streptomycin sulfate (Invitrogen). NN (PS1-/-/PS2-/-) cells were cultured in   Chapter 3  75       HEK293 media supplemented with 1mM MEM non-essential amino acids solution, and 1?M ?-mecapitolethenol (Invitrogen).  Stable cell lines were maintained in media containing Zeocin or G418 (Geneticin). The HAW cell line stably expressed a wild type APP695 in HEK293 cells (Qing et al., 2004b). All cells were maintained at 37?C in an incubator containing 5% CO2. For transfection, cells were grown in 35mm plates to 70% confluence and transfected with 2?g plasmid DNA using 4?L of Lipofectamine 2000 Reagent (Invitrogen) according to the manufacturer's instructions. !3.2.4  Immunoblot analysis.  Cells were lysed in RIPA lysis buffer (1% Triton X100, 1% sodium deoxycholate, 4% SDS, 0.15M NaCl, 0.05M Tris-HCl, pH 7.2) supplemented with 200 mM sodium orthovanadate, 25 mM ?-glycerophosphate, 20 mM sodium pyrophosphate, 30 mM sodium fluoride, 1 mM phenylmethanesulfonyl fluoride (PMSF), and a complete mini protease inhibitor cocktail tablet (Roche Diagnostics). The samples were diluted in 4? SDS-sample buffers, resolved by SDS-PAGE on 9% tris-glycine or 16% tris-tricine gels, and transferred to ImmobilonTM ?FL phlyvnylidene fluoride (PVDF) membranes (Millipore). For immunoblot analysis, membranes were blocked for 1 h in phosphate-buffered saline (PBS) containing 5% non-fat dried milk followed by overnight incubation at 4?C in primary antibodies diluted in the blocking medium. Rabbit antibody C20 (1:2000) was used to detect APP and its C-terminal fragment (CTF) products. Rabbit anti-PS1 loop antibody PS1N (1:2000) was used to detect full length PS1 and its N-terminal fragment (NTF). Internal control ?-actin was detected using monoclonal antibody AC-15 (Sigma). The membranes were rinsed in PBS with 0.1% Tween-20 and incubated with IRDye 800CW-labelled goat anti-mouse or anti-rabbit antibodies in PBS with 0.1% Tween-20 at 22?C for 1 h, and visualized   Chapter 3  76       on the Odyssey system (LI-COR Biosciences). All quantification was performed suing LI-COR Odyssey system and Image J.   3.2.5  A?40/42 Enzyme linked-immunosorbent assay (ELISA). Stable cells lines were maintained in cell culture media supplemented with 5% FBS. After 24h, conditioned medium was collected and protease inhibitors and AEBSF (ROCHE Diagnostics) were added to prevent degradation of A? peptides. The concentration of A?40 and A?42 were detected using ?-amyloid 1-40 or ?-amyloid 1-42 Colorimetric ELISA kit (Invitrogen) according to manufacturer?s instructions.  3.3 Results. 3.3.1  Generation of PS1?S169 and other PS1 mutants.  Although PS1 mutations can be scattered throughout its amino acid sequence, most mutations are in the transmembrane domains and hydrophobic loops. PS1?S169 resides in transmembrane domain 3 (TM3) (Fig 3.2). pcDNA4-PS1WT, pcDNA4-PS1Y115H and pcDNA4-PS1 C410Y have previously been generated in our laboratory. To compare PS1?S169 with other PS1 mutations, we generated PS1?S169 and 9 other representative PS1 mutations via site-directed mutagenesis (PS1L85P, PS1M139V, PS1S169P, PS1S170F, PS1G206S, PS1M233T, PS1Y256S, PS1T291P, PS1T354I) (Fig 3.2). To generate PS1?S169, we used PS1WT as a template and primers containing the 3bp deletion coding serine to generate a full length PS1?S169 PCR product, which was then cloned into pcDNA4 between the HindIII and XbalI sites. PS1?S169 was generated with  5?- GCCTGGCTTATTATATCTCTATTG and  5?-GAA CAGCAACAATAGAGATATAAT as forward and reverse primers. Following the same strategy, PS1L85P was generated with  5?-AAGCATGTGATCATGCCCTTTGTC and    Chapter 3  77       5?- GTCACAGGGACAAAGGGCATGA as forward and reverse primers; PS1M139V was generated with 5?- CTGAATGCTGCCATCGTGATCAGT and 5?- AACAATGACACTGATCACGATGGC as forward and reverse primers; PS1S169P was generated with 5?- GCCTGGCTTATTATACCATCTC and  5?- CAGCAACAATAGAGATGGTATAAT as forward and reverse primers; PS1S170F was generated with 5?- TGGCTTATTATATCATTTCTATTG and  5?- GAACAGCAACAATAGAAATGATAT as forward and reverse primers; PS1G206S was generated with 5?- CTGATCTGGAATTTTAGTGTGGTG and  5?- TCATTCCCACCACACTAAAATTCC as forward and reverse primers; PS1M233T was generated with 5?- ATGATTAGTGCCCTCACGGCCCT and  5?- ATAAACACCAGGGCCGTGAGGG as forward and reverse primers; PS1Y256S was generated with 5?-GGCTGTGATTTCAGTATCTGATTTAG and  5?- CAGCCACTAAATCAGATACTG as forward and reverse primers;  PS1T291P was generated with 5?- CTCATTTACTCCTCACCAATGGTG and  5?- CCAACCACACCATTGGTGAGG as forward and reverse primers;  PS1T354I was generated with 5?- GCCTCATCGCTCTATACCTGAG and  5?- GCTCGTGACTCAGGTATAGAGC as forward and reverse primers. The coding sequence of these PS1 mutants was confirmed via BigDye 3.1 sequencing (Fig 3.3).   Chapter 3  78        Figure 3.2 Presenilin 1 structure and the locus of PS1?S169.  This diagram shows the amino acid sequence of PS1 and the distribution of the FAD-associated mutations (blue and red circles). Green circles indicate the two aspartates residues, which are essential for catalytic activity. Red circles indicate the representative PS1 mutations, which were selected for comparison with PS1?S169 in this dissertation.  Chapter 3  79         Figure 3.3 Generation of PS1mutants constructs.  (A) Strategy for the generation of PS1 mutants via site-directed mutagenesis: using the cloning of PS1?S169 as an example, primers PS1-E6-del-F and PS1-E6-del-R were designed to create the PS1?S169 deletion mutation. Primers T7 and primer BGHR were the customized primers used for pcDNA4-mycHis (A). Site-directed mutagenesis PCR was performed as indicated in the schematic diagram with pcDNA4-PS1WT used as the template. (B-K) Sequencing results of the PS1 mutants constructs: PS1?S169, PS1L85P, PS1M139V, PS1S169P, PS1S170F, PS1G206S, PS1M233T, PS1L271V, PS1T291P, PS1T354I (r.m., reverse complementary sequence).   3.3.2  PS1?S169 underwent normal endoproteolysis.  Under physiological conditions, presenilin undergoes endoproteolysis to generate N-terminal fragment (NTF) and C-terminal fragment (CTF). Presenilin holo-protein has a short half-life of about 30 minutes and is therefore barely detectable; after endoproteolysis, the NTF and CTF moieties constitute the functional   Chapter 3  80       catalytic core of ?-secretase, with the half-life of 12h (Thinakaran, 2001). During endoproteolysis, the hydrophobic loop between exon8 and exon9 is removed, a necessary step required to activate wild type PS (Thinakaran et al., 1996a). Consequently, PS1?E9, a PS1 mutant that lacks the hydrophobic loop, is active even in the holo protein form (Wolfe et al., 1999b). Intriguingly, some FAD-associated PS1 mutations exhibit impaired endoproteolysis, resulting in an accumulation of holo-PS1 protein and a reduction in active NTF/CTF derivatives (Thinakaran et al., 1996a). These observations point to a role of the hydrophobic loop in determining the ?-secretase activity. To investigate the endoproteolysis of PS1?S169, expression plasmids, containing PS1WT, PS1?S169, PS1L85P, PS1Y115H, PS1M139V, PS1S169P, PS1S170F, PS1G206S, PS1M233T, PS1Y256S, PS1T291P, PS1T354I, PS1C410Y, were transiently transfected into the NN cells, which is PS1-/-/PS2-/- cell line lacking endogenous wild type PS1.   The 50kDa holo PS protein and its 30 kDa NTF were detected via PS1N antibody (Fig 3.4 A). Only PS1T291P and PS1C410Y displayed impaired endoproteolysis, reducing NTF levels to 45.5%?4.1% and 34.5%?5.2% (p<0.05) of that seen in PS1WT, respectively. In contrast, PS1Y115H and PS1M139V increased the endoproteolysis levels to 133.3%?8.4% and 130.5%?6.2% (p<0.05) as compared with wild type PS1, respectively (Fig 3.4 B). PS1?S169 and other PS1 mutants underwent normal endoproteolysis without significantly affecting NTF generation. These results demonstrated that the S169 deletion did not affect the endoproteolysis of PS1.   Chapter 3  81         Figure 3.4 PS1?S169 undergoes normal endoproteolysis.  NN cells was transiently transfected with pcDNA4-PS1WT, PS1?S169, PS1L85P, PS1Y115H,  PS1M139V, PS1S169P, PS1S170F, PS1G206S, PS1M233T, PS1Y256S, PS1T291P, PS1T354I and PS1C410Y. PS1 in cell lysate was detected by rabbit anti-PS1 antibody PS1N. (A) In NN cells transfected with empty vector, both full length PS1 and its NTF could not be detected. With the introduction of PS1 variants, there was an accumulation of full length, holo PS1 at 50kD. PS1 variants underwent varying degrees of endoproteolysis to generate different level of NTF at 30kDa. (B) Quantification of (A) by Image J. The NTFs level in each of the PS1 mutants were normalized to that in PS1WT. The values represent mean?SEM. n=3, *p<0.05 by one-way ANOVA with post-hoc tests.   3.3.3  PS1?S169 demonstrated impaired APP cleavage activity and an increased A?42/40 ratio.  A?42, a polypeptide derived from APP by sequential ?- and ?- cleavages, is proposed to initiate the amyloid pathogenic cascade. It has been reported that the most investigated FAD-associated PS mutations increase the A?42/40 ratio, either by promoting A?42 production or reducing A?40 generation. To explore the effect of PS1?S169 on APP processing, we generated PS-stable cell lines in HAW and NN cells. HAW is a HEK293 cell line, which stably expresses wild type APP, and can be used to investigate APP processing and A? generation (Sun et al., 2006a, Deng et al., 2013). NN is the PS1-/-/PS2-/-mouse embryonic fibroblast cell   Chapter 3  82       line, which has the unique advantage of having no endogenous PS (Song et al., 1999a). PS1WT, PS1?S169, PS1C410Y or PS1Y115H were transiently introduced into HAW and NN cell line and stable cell lines were selected using Zeocin (800?g/ml) (Invitrogen). HAWPS was HAW cell line stably expressing PS1 variants, while NNPS referred to NN cells expressing stably PS1 variants. As most endogenous PS undergoes endoproteolysis, the holo-protein of PS can barely be detected in HAW cells. After the stable introduction of exogenous PS1, holo-PS1 variants were detected at 50 kDa in HAWPS cells (Fig 3.5 A). In NNPS cells, the introduction of PS1 variants rescued the PS deficiency in NN cells, and the PS1 NTFs were clearly detected at 30kDa by antibody PS1N. In both HAWPS and NNPS cells, PS1?S169 underwent normal endoproteolysis similar to wild type PS1 (Fig 3.5 A, E), supporting our previous finding in section 3.3.2.   The conditioned media of HAWPSs cells was collected after 24h of culture and A? was measured by ELISA assay. Compared with PS1WT, PS1C410Y and PS1Y115H reduced the production of A?40 to 32.1%?4.6% and 30.6%?5.2% (p<0.01), respectively; however A?42 production of PS1C410Y and PS1Y115H appeared unaffected. In contrast, PS1?S169 decreased the production of both A?40 and A?42 to 24.7%?3.8% and 67.1%?4.2% (p<0.01), respectively (Fig 3.5B, C). Despite this, the overall effect on A?42/40 ratio was the same, PS1?S169, PS1C410Y and PS1Y115H all increased A?42/40 ratio over that seen in PS1WT to 280.3%?26.2%, 274.1%?14.1% and 286.1%?25.5% (p<0.01), respectively (Fig 3.5 D). We further investigated APP processing in NNPSs cell lines, in which the effect of endogenous wild type presenilins was eliminated. APPWT was transiently introduced into NNPS cells to examine APP processing. Without endogenous PS1, APP CTFs were accumulated in NN cells (Fig 3.5 F, lane 1); when introduced wild type PS1, APP CTFs levels were reduced to 31.6%?2.8% (p<0.01) in NNPSWT cells as compared with NN cells, indicating that PS1WT   Chapter 3  83       greatly rescued the ?-secretase processing of APP in NN cells. In NNPS?S169 and NNPSC410Y cells, APP CTFs levels were reduced to 74.3%?4.5% and 71.4%?4.2% (p<0.05) (Fig 3.5 F, G) as compared with the CTFs levels in NN cells, but the rescuing effect was weaker than PS1WT. The combined analysis of the A? and APP CTF assays indicate that PS1?S169 impairs ?-cleavage of APP, particularly at the A?40 generation site.    Figure 3.5 PS1?S169 promoted accumulation of APP CTFs and increased A?42/40 ratio via impaired ??secretase activity in PS1 stable cell lines.  HAW cells are HEK293 cells which stably overexpress human APPWT (Qing et al., 2004a), and NN cells are PS1/PS2 double-knockout (PS1?/?/PS2?/?) mice embryonic fibroblast cells (MEF) (Song et al., 1999b). PS1 stable cell lines were generated by introducing pcDNA4-PS1WT, pcDNA4-PS1?S169, pcDNA4-PS1C410Y or pcDNA4-PSY115H into HAW or NN cells and selecting the positive, stably transfected cells with Zeocin (Invitrogen). PS1 was detected by rabbit anti-PS1 antibody PS1N (Song et al., 1999a). APP was detected by rabbit anti-APP antibody C20 (Qing et al., 2004a). Monoclonal anti-?-actin antibody (AC-15) was used to detect ??actin. (A) In HAWPSWT, HAWPS ?S169, HAWPSC410Y, HAWPS Y115H cell lines, accumulation of full length PS1 was robustly increased compared with HAW. PS1?S169 underwent endoproteolysis similar to PS1WT. (B, C, D) Conditioned media from HAWPS cell lines were collected to determine A? production. PS1?S169, PS1C410Y and PS1Y115H produced significantly less A?40 than PS1WT. PS1?S169 also generated significantly less A?42 than PS1WT. When the A?42/40 ratio was examined, all PS1 mutations lead to a significant increase in the A?42/40 ratio. (E) In NNPSWT, NNPS?S169, NNPSC410Y cells, full length PS1 and PS1 NTFs were robustly detected at 50kDa and   Chapter 3  84       30kDa separately. (F) In NNPSWT, NNPS?S169, NNPSC410Y cells with wild type APP overexpression, APP CTFs were detected via C20 antibody. (G) The levels of APP CTFs were quantified using Image J. Compared with NNPSWT, NNPS?S169 and NNPSC410Y exhibited less effect on rescuing the accumulation of APP CTFs in NN. Values represent mean?SEM, n=5, *p<0.05, **p<0.01, ***p<0.001 by one-way ANOVA with post-hoc tests.  3.3.4  PS1?S169 cleaved Notch with normal enzymatic efficiency. APP and Notch were first two identified substrates cleaved by ?-secretase. While A?42, generated from APP by ?-secretase, is believed to initiate the amyloid pathogenic cascade; whether altered Notch cleavage also contributes to AD pathogenesis is still not clear. Notch was first implicated in AD in several studies of PS-deficient mice and stem cells. PS-deficient mice were embryonic lethal and displayed CNS and skeletal defects reminiscent of the Notch-knock out phenotype (Shen et al., 1997, Wong et al., 1997). Later studies confirmed that Notch was a substrate of presenilins (De Strooper et al., 1999, Song et al., 1999a) and FAD-associated PS mutations inhibited NICD production(Song et al., 1999a). Notch signaling is one of the most conserved cell signaling pathways in metazoans, and is fundamental in neuroproliferation and differentiation in both embryonic development and adult brain; it still remains elusive how the impairment in Notch processing caused by FAD-PS mutations contributes to AD pathogenesis. Furthermore, as PS is a pharmaceutical target for AD therapy, a major obstacle for ?-secretase inhibitor development is how to avoid inhibition of Notch cleavage.   In 1999, Song et al. discovered that FAD-associated PS1 mutations reduced proteolysis of a truncated form of Notch1, mNotch1?E m/v (N?E), which undergoes proteolysis constitutively in the absence of receptors (Song et al., 1999a). Here, I employed N?E to assess the effect of PS1?S169 on Notch processing by transiently co-overexpressing PS1?S169 and N?E in HEK293 cells. 48h post transfection, cell lysates were resolved by 10% SDS?PAGE and immunoblotted with 9E10 antibody against the C-terminal Myc-tag of N?E. The cleaved form of N?E (NICD) was analyzed in different PS1 variants (PS1WT,   Chapter 3  85       PS1?S169 and PS1C410Y). Quantification of the results showed that compared with PS1WT, PS1C410Y only produced 36.6% ? 1.3% NICD (p<0.001); whereas PS1?S169 and PS1WT were indistinguishable in terms of NICD generation (Fig 3.6 A, B). To confirm these findings, a stable N?E stable expressing cell line in HEK293, designated V2, was created in HEK293 cells. PS1WT, PS1?S169, PS1 Y115H and PS1C410Y were introduced into V2 cells to determine the NICD generation in different PS1 variants. Consistent with the transient overexpression results, no significant differences were seen in the amount of NICD generated by overexpression of PS1?S169 and PS1WT in V2 cells; whereas PS1 Y115H and PS1C410Y significantly reduced NICD levels to 67.6% ? 7.4% and 52.7% ? 5.2%  (p<0.05) (Fig 3.6 C, D).  These data indicate that S169 deletion in PS does not affect ?-cleavage of Notch.   Figure 3.6 PS1?S169 retained its enzymatic activity in Notch signaling.  (A) pcDNA4-PS1WT, pcDNA4-PS1?S169 or pcDNA4-PS1C410Ywere transiently introduced into HEK293 cells with pcDNA3-mNotch1?E m/v (N?E). pcDNA3-ICV1744 was introduced into HEK293 as gel marker for NICD. Cell lysates were analyzed by Western Blot. N?E and ICD (NICD) were detected by anti-mouse antibody 9E10. (B) Quantification from (A) by Image J. In comparison with PS1WT, PS1C410Y generated significantly less NICD. The levels of NICD in PS1?S169 was similar to that in PS1WT. (C) N?E stable cell line (V2) was generated by introducing pcDNA3-N?E into HEK293 cells and selecting positive colonies with G418 (Sigma). pcDNA4-PS1WT, pcDNA4-PS1?S169, pcDNA4-PS1C410Y or pcDNA4-PS1Y115Hwere transiently introduced   Chapter 3  86       into V2 cells to analyze the Notch processing efficiency of PS1. Empty vehicle was used as a negative control. (D) Quantification from (C) by Image J.  PS1?S169 had no effect on NICD (ICV) production, whereas PS1 C410Y produced significantly less NICD than PS1WT. Values represent mean?SEM, n=5, *p<0.05, **p<0.01, ***p<0.001 by one-way ANOVA with post-hoc tests.  3.4 Discussion. It has been almost two decades since presenilin was found to linked to early-onset of AD, yet the underlying mechanism of action is still unknown. PS1?S169 is a PS1 deletion mutation newly discovered in a Chinese family.  PS1?S169 is located in TM3, and two missense mutations are also known to occur at this location ? PS1S169P and PS1S169L (Taddei et al., 1998, Ezquerra et al., 1999). Both PS1S169P and PS1S169L are characterized with very early-onset AD (mean age of onset is 32 years), rapid progressiveness (mean age of death is 38 years) and the presence of generalized myoclonic jerks and seizures. Except for the early age of onset  (as early as 43 in PS1?S169 family), other phenotypes of PS1?S169 were not distinguishable from typical sporadic AD (Guo et al., 2010a). The serine at the site 169 of PS1 showed high phylogenetic conservation across different species, suggesting that the position is highly conserved and functionally important.   During normal maturation, presenilin undergoes endoproteolysis to generate NTFs and CTFs (Thinakaran et al., 1996a). Although it is difficult to study the crystallization structure of presenilin and the ?-secretase complex, it is proposed that endoproteolysis confers ?-secretase activity to presenilin by removing the cytoplasmic hydrophobic loop (Knappenberger et al., 2004, Fukumori et al., 2010). While mutations like PS1?E9, PS1M146L and PS1A246E fail to undergo endoproteolysis, mutations like PS1H163R undergoes endoproteolysis normally (Okochi et al., 1997). Thus, the current consensus is that not all clinical PS mutations impair endoproteolysis, but mutations with significant endoproteolysis deficits usually demonstrate more severe impairments of ?-secretase activity. To investigate the effect of PS1?S169 on its endoproteolysis, we compare PS1?S169   Chapter 3  87       with 12 other pathogenic PS1 mutations occurring within the transmembrane domain or specific locus near the functional site, such as PS1T291P near the endoproteolysis site. Consistent with previous studies, deficits in endoproteolysis were not an obligatory phenomenon in clinical PS1 mutations, and PS1?S169 underwent normal endoproteolysis.   APP is the most important substrate of PS1. The effect of PS1?S169 on APP processing was investigated in different scenarios. A?42/40 ratio was analyzed in cell lines that stably expressed of both wild type APP and different PS1 variants.  As mentioned in 3.3.3, an increased A?42/40 ratio is a pathogenic indicator of clinical PS mutations. While we found that an overall increase in A?42/40, this resulted from various mechanisms, depending on the PS1 mutations studied. Some mutations, like PS1C410Y, specifically impaired the production of A?40 without significantly affecting on A?42 generation; other mutations produced more A?42, with or without an accompanying reduction in A?40; while others impaired production of both A?40 and A?42, but reduced A?42 to a lesser degree. We found that PS1?S169 had a significantly increased A?42/40 ratio compared with wild type PS1, due to deficits in the generation of both A?40 and A?42. The impaired ?-secretase activity of PS1?S169 was also verified using NNPS stable cell lines, the PS1-/-/PS2-/- mouse fibroblast cells lacking endogenous wild type PS but overexpressing the mutant PSs of interest. We transiently introduced wild type APP into NNPSs stable cell lines and investigated the effect of PS1?S169 on the accumulation of APP CTFs.  Consistent with the A? generation, PS1?S169 demonstrated impaired ?-secretase activity as indicated by an increased accumulation of APP CTFs compared with wild type PS1 (Fig 3.5).   ?-Secretase processes its substrates at two distinct sites: the ?-site generates ICDs (like NICD), and the ?-site generates A?, for example. It has recently been   Chapter 3  88       reported that ?-secretase complex cleavage at the ?- and ?-sites seem to be independently regulated under different pH, temperature, and salt concentration condition (Quintero-Monzon et al., 2011). A kinetic study on ICD-production of FAD-associated PS1 mutants also demonstrated that cleavage efficiency at the ?-site varies among PS1 mutants, and PS1M139V even displays normal ?-cleavage of APP, Notch, and Erb4. This suggests that inefficient processing at the ?-site is not an essential contributor to AD pathogenesis (Chavez-Gutierrez et al., 2012). These studies are consistent with our finding that PS1?S169 specifically affected enzymatic activity at the ?-site.   Although several FAD-associated PS1 mutations demonstrate impaired Notch processing, it is hotly debate whether Notch contributes to AD pathogenesis, and if it does, how much. Two recent studies on Notch conditional knock-out mice drew distinct conclusions concerning the contribution of Notch signaling to adult brain function. One suggested that Notch signaling was involved in synaptic plasticity via the Arc pathway (Alberi et al., 2011), while the another suggested that Notch signaling could be absent at least in excitable glutamate neurons (Zheng et al., 2012). Our study demonstrated that pathogenic PS1?S169 could process Notch normally, suggesting that aberrations in Notch signaling are not essential in AD pathogenesis. However, we could not exclude the role of Notch signaling in AD, or explain how Notch signaling contributes to the clinical variety of FAD-associated PS1 mutations.   Various PS1 mutations could have differential effects pathologically and clinically. Pathologically, PS1 mutations demonstrate atypical histopathological features, such as cotton wool plaque (CWP) and spastic paralysis (Rogaeva et al., 2003). Clinically, patients with some PS1 mutations suffer from myoclonic jerks, like PS1S169L and PS1S169P. The molecular mechanisms underlying these processes are unknown, however, it is possible that variously affected Notch signaling is one   Chapter 3  89       of the reasons. Moreover, PS1 mutations increased A?42/40 through different mechanisms (such as PS1?S169 promoting A?42/40 via disproportionally inhibiting both A?; see above for details). The differing amount of A?40 may also contribute to the variable consequences of PS1 mutations.   3.5 Conclusion. PS1?S169 was a recently discovered pathogenic PS1 mutation in a Chinese family with an average age of AD on-set of 45 years. We studied the effect of PS1?S169 on APP and Notch processing in vitro. With respect to APP processing, PS1?S169 increased A?42/40 via disproportionally impaired ?-cleavage. In the case of Notch processing, PS1?S169 retained its enzymatic activity, resulting in normal NICD generation. Our in vitro study suggested that PS1?S169 contributed AD pathogenesis via its impaired ?-secretase processing of APP.         90        Chapter 4   PS1?S169 promotes AD pathogenesis  in vivo   4.1  Introduction. Animal models are valuable tools to validate the pathogenic mechanism seen in in vitro studies, and to evaluate potential therapeutic interventions. The best animal models have pathogenic process and progression similar to the human disease. In the case of AD, transgenic mice should develop amyloid plaques and neurofibrillary tangles, as well as functional cognitive deficits. Moreover, both the neuropathological and behavioral features should progress with aging.   APP protein is highly conserved across species; the human APP sequence is approximately 96% identical to murine APP. Despite this, rats and mice do not develop amyloid pathology with age and the underlying mechanism for this still unclear. It is hypothesized that the three amino acids difference in the rodent A? sequence (Selkoe, 1989), the short lifespan of rodents relative to humans (Jankowsky et al., 2004b), and the differences in ?-secretase processing of mouse APP (Cai et al., 2001), may be involved. Thus, to create an animal model that mimics the amyloid pathology seen in human AD, transgenic mice were developed which express human APP (Table 4.1).  Unfortunately, neurofibrillary tangles are still absent in APP or APP/PS transgenic mice. This obstacle was   Chapter 4 91       overcome by introducing MAPT (microtubule-associated protein tau) mutants into the APP/PS transgenic mouse background (Table 4.1). These triple transgenic mice develop both amyloid plaques and neurofibrillary tangles (Oddo et al., 2003). Although APP/PS/MAPT triple transgenic mice fully recapitulate plaques and tangles, it should be of note that MAPT mutations have never been found in AD patients. There are still no transgenic mice that fully and precisely mimic the comprehensive feature of AD.   In regards to cognitive deficits, most AD transgenic mice display impaired cognitive function with age. The severity and progression of cognitive decline is dependent on multiple factors, including the different transgenes introduced, the expression level of those transgenes, the promoter used, the background strain of the mouse, the transgenic method used, and so on. Our lab maintains APP23 transgenic mice, which are C57BL/6J mice carrying human APP751 cDNA with the Swedish double mutation at positions 670/671 (KM>NL) under control of the murine Thy-1.2 expression cassette (Sturchler-Pierrat et al., 1997, Sun et al., 2006a). To further confirm the pathological effect of PS1?S169 on APP processing in an animal model, we generated APP23/ PS1?S169 double transgenic mice and examined the pathogenic effect of PS1?S169 on APP processing and the cognitive function. Chapter 4  92         Table 4.1 Summary of AD transgenic mouse models. APP: amyloid precursor protein; A?: amyloid beta; EC: extracellular; IN: intracellular; NR: not reported; PDGF: platelet-derived growth factor; PrP: prion protein; PS: presenilin. Adapted from (Morrissette et al., 2009)Chapter 4  93       4.2 Methods. 4.2.1  Genomic DNA isolation  Mouse genomic DNA was extracted from ear punch biopsies by overnight digestion in 300?L of proteinase K lysis buffer. The next day, 300?L of 1:1 phenol: chloroform was added, followed by vortex. Samples were centrifuged to separate the aqueous and organic layers, and the aqueous layer was carefully removed to a fresh 1.5 mL eppendorf tube. DNA was precipitated with isopropanol, and the pellet was washed twice with 70% ethanol, dried, and dissolved in 50?L TE buffer (pH 7.4). The quality and quantity of mouse genomic DNA was determined by spectrophotometry at OD260.   4.2.2  Transgenic mouse generation.  All animal experiment protocols were approved by the University of British Columbia Animal Care and Use committee. All transgenic mice used in this study were of the C57BL/6J genetic background, and as stated previously, APP23 transgenic mice carried human Swedish mutant APP 751 (see section 4.1). PS1?S169 was cloned into neuron-specific Thy1-promotor-containing vector and the resulting plasmids were confirmed by sequencing. Linearized mini-gene constructs were purified using a Gel Extraction Kit (QIAEX). Prepared DNA was microinjected into fertilized oocytes (CBA X C57Bl/6 F2) and survivors were transferred into pseudo-pregnant recipient female mice (CD-1/ICR). We analyzed 36 pups and identified 3 positive founder mice via PCR. APP23/PS1?S169 mice were generated by crossing heterozygous APP23 mice with heterozygous Thy1-PS1?S169 mice. The presence of both APP23 and PS1?S169 was confirmed by genotyping with primers. Genotyping PCR primers for PS1 were 5?-CACCACAGAATCCAAGTCGG (Thy1-E2 forward) and 5?-Chapter 4  94       GGTATCTTCTGTGAATGGGG (PS1-D-Tg reverse), with the target band being 420bp. Genotyping PCR primers for APP gene were 5?-CACCACAGAATCCAAGTCGG (Thy1-E2 forward) and 5?-CTTGACGTTCTGCCTCTTCC (App1082 reverse), with the target band being around 1.3kb.   4.2.3. Real-time PCR and copy number estimation.  Thy1-PS1?S169 plasmid DNA was extracted by Qiagen Hispeed plasmid midi kit (CAT#12643), linearized and quantified by gel electrophoresis. Then a series of 10-fold dilutions of Thy1-PS1?S169 plasmid DNA were mixed into  10 ng/?L of genomic DNA from non-transgenic mice to create a standard curve of real-time PCR data from known amounts of DNA template. Custom TaqMan Assays (ABI) were used to generate primers and probes for the mouse ?-actin and human PS1 genes. The following primer pairs and probes were used: for the mouse ?-actin assay: forward primer:  (5?- AGCAAGACAAGATGGTGAATGGT); reverse primer:  (5?- CCCTGTGGTTGTCAGAGCAA); probe:  (5?-FAM-GAGCTCTCTGGGTGCTGGGATTCCC-NFQ). For human PS1 assay: forward primer: (5?- CACCACAGAATCCAAGTCGG); reverse primer: (5?-CCGTCTGTCGTTGTGCTCC); probe:  (5?-FAM-GGATCTCGAGGCCACCATGACAGAG- NFQ). Real-time PCR was performed on ABI PRISM 7000. Ct values were generated from an assay specific to the human PS1 and mouse ?-actin genes. Genomic DNA samples from Thy1-PS1?S169 transgenic mice or copy number standards were analyzed in a 25?L reaction volume; all reactions were performed in triplicate. Copy number estimates were derived from Ct values of the standard curve samples. The standard curve was created by drawing a scatter plot chart with Ct values Chapter 4  95       for each standard on the X axis, and the known logarithmic copy number of each standard on the Y axis (see Figure 4.2). Three genomic DNA samples from different Thy1-PS1?S169 transgenic mice, which shared a common founder, were used to determine the copy number of the human PS1 gene in these mice.   4.2.4  Body weight measurement and Rotorad test.  Mice were transferred via a specified transferring box from their home cage to a plastic box that was previously zeroed on the weighing scale. Body weight was recorded manually when the value on the scale stabilized. Mice were placed on a standard mouse rotarod with single station (ENV-576M, Med Associates Inc., USA). The shaft diameter was 3.2cm, lane width of 5.7cm, fall height of 16.5 cm, and divider diameter of 24.8cm. The rod was accelerated from 20 to 20,000 rpm over a 300 sec period. Latency to fall was measured manually. Mice were returned to their home cage and the second round test was repeated approximately 30min later. The average of two trials was taken as a measure of balance and motor coordination.   4.2.5  Neuritic Plaque Staining.  Mice were euthanized after the behavioral tests, and half of the brain was fixed and sectioned with a Leica cryostat (Deerfield, IL) to 30 ?m thickness. Every sixth slice with the same reference position was mounted onto slides for staining. Slices were immunostained with biotinylated mono- clonal 4G8 antibody (Signet Laboratories, Dedham, MA) at 1:1000 dilutions. Approximately 24 slices were stained for each mouse. Plaques were visualized by the avidin-biotin-peroxidase complex (ABC) and diaminobenzidine (DAB) method, and counted under microscopy with 40?magnification. Plaques were Chapter 4  96       quantitated by average plaque count per slice for each mouse, and the data were analyzed by student t-test. Thioflavin S staining of plaques was performed with 1% thioflavin S, and the green fluorescence- stained plaques were visualized with fluorescent microscopy (Ly et al., 2011).  4.2.6  Morris Water Maze.  The water maze test was performed in a pool 1.5 m in diameter; the platform was 10 cm in diameter. The procedure consists of 1 day of visible platform tests and 4 days of hidden platform tests, plus a probe trial 24 h after the last hidden platform test. In visible platform tests, mice were tested for five contiguous trials, with an intertrial interval of 30 min; both the position of the platform and the start position varied with each trial.  In hidden platform tests, mice were trained for six trials, with an inter-trial interval of 1 h; the platform was placed in the southeastern quadrant of the pool, and the start position varied with each trial. Tracking of animal movement was achieved with an HVS 2020 Plus image analyzer (HVS Image). In the probe trial, the platform was removed and mice were allowed to swim for 60 sec in the pool. The percentage of time spent in the third quadrant was analyzed. Escape latency and path length to reach the platform were analyzed as a measure of spatial learning and memory (Bromley-Brits et al., 2011).   4.2.7  Contextual fear conditioning.  We used a simplified contextual fear conditioning paradigm in our study. On day1, mice were placed in the conditioning chamber for 5min. The walls of the chamber were made of plexiglass and steel. The floor of the chamber was made of stainless steel rods, which were 2mm in diameter, spaced 5mm apart, and Chapter 4  97       connected to a shock generator. From the beginning of the 3rd min, mice received an unconditioned foot-shock stimulus (1mA, 50Hz) for 3s.  24h later, mice were placed into the same chamber for 4min without the foot-shock. In both trails, freezing behavior was recorded on a second-by-second basis Freeze FrameTM (ActiMetrics Software). Freezing was defined a stereotypical crouching posture combined with the absence of all movements, excluding respiratory-related movements (Blanchard and Blanchard, 1969). Total test time was divided into 60 sec bins. The conditioned response was measured by analyzing the fold-increase in the percentage of time spent freezing on Day2 and dividing by the average of the first 3 bins (0-120 sec, pre-shock) of Day1.   4.3 Results. 4.3.1  Generation and characterization of APP23/PS1?S169 double transgenic mice.  To investigate the effect of PS1?S169 on AD pathogenesis in vivo, we first generated heterozygous PS1?S169 mice in a C57BL/6J background strain via pronuclear injection method. Transgenic mice were identified by PCR with primers targeting the human PS1?S169, which was expressing under the control of the neuron-specific Thy-1 promoter (see methods). APP23/PS1?S169 double transgenic mice were established by crossing APP23 and PS1?S169 transgenic mice.  PCR was performed to target the cDNA of the human APP Swedish mutant and human PS1?S169 genes. In APP23/PS1?S169 mice, both human APP fragment (655bp) and PS1 fragment (305bp) were detected in cortical brain tissue (Fig 4.1 A). Furthermore, immunoblot analysis showed that APP23/PS1?S169 mice expressed far more PS1 NTF than APP23 mice, which only had endogenous mouse PS expression, confirming the expression of Chapter 4  98       PS1?S169 (Fig 4.1 B). We also determined the difference in body weight and motor ability between APP23 mice and APP23/PS1?S169 mice. APP23 mice and APP23/PS1?S169 mice displayed similar body weight at 3 months (23.45?0.97 and 25.38?0.98g, respectively, p>0.05) and 6 months (28.93?1.04 and 29.63?1.22g, respectively, p>0.05) (Fig 4.1 C, D). APP23 mice and APP23/PS1?S169 mice also displayed similar performance in the rotorad test at 3 months (223.1?14.5 and 204.3?15.6s, respectively, p>0.05) and 6 months (220.8?15.4 and 210.3?15.3s, respectively, p>0.05) of age (Fig 4.1 E, F). These data demonstrated that APP23 mice and APP23/PS1?S169 mice are generally comparable and can be trained and tested in later cognitive behavior tests.    Figure 4.1 Establishment and characterization of APP23/PS1?S169 double transgenic mice.  (A) Tail tips from APP23/PS1?S169 transgenic mice were collected under anesthesia (see Methods) and DNA was extracted via the phenol-chloroform method. Equal amounts of genomic DNA were used as template in a PCR reaction system with human APP or human PS primers (see Methods). (A) The targeted fragment sizes were 655bp for human APP human APP and 305bp for PSEN1?S169. (B) PS1?S169 expression was detected in the cortex of  APP23/ PS1?S169 transgenic mice compared to APP23 control, as shown by an accumulation of PS1 NTF at 30kDa. (C, D) APP23/PS1?S169 and APP23 mice had similar body weights at 3 months of age. (E, F) APP23/PS1?S169 and APP23 mice showed similar performance in the rotorad test at 3months and 6 months of age.  Chapter 4  99       4.3.2  APP23/PS1?S169 mice carry two copies of the human PS1?S169. The effect of the transgene in transgenic mice is not only decided by the transgene itself but also by the levels of its expression. In PS1 transgenic mice, it is not optimal to have very high copy number of PS1 gene since the extra copies of PS1 gene might compensate or conceal some pathogenic effect of PS1 mutant. It is also a concern that high expression of PS1 gene would greatly accelerate the originally slow pathogenic progression. Thus, it is important to determine the copy number of PS1?S169 in APP23/PS1?S169 mice. Copy number was determined by real-time PCR on samples taken from three PS1?S169 transgenic mice, which were from the same founder (see Methods). We plotted the standard curve to determine the copy numbers of ?-actin gene and PS1?S169 gene with the real-time PCR results from standard curve samples, respectively (Fig 4.2 and Table 4.2). According to the standard curve of PS1?S169, we evaluated that APP23/PS1?S169 mice carried 2 copies of the human PS1?S169 gene (Table 4.2).    Figure 4.2 Standard curves for absolute quantitation of PS1?S169 copy number in APP23/PS1?S169 mice.  (A) Scatterplot chart for the mouse ?-actin gene, which was used as an internal control. (B) Scatterplot chart for the human PS1 gene. Triplicate experiments provided copy number standards with high reproducibility (R2 = 0.9999, R2 = 0.9965) for estimating the copy number of samples.  Y=-3.281X+26.052R2=0.9999403530251-1 0 2-2A 353025201 3-1 0 2Y=-3.741X+27.522R2=0.9965BChapter 4  100        Table 4.2 Original Ct values for Copy number estimation.   4.3.3  APP processing and A?  generation in APP23/ PS1?S169 double transgenic mice. We first analyzed the APP processing and A? generation in APP23/PS1?S169 mice and APP23 mice. The cortical tissue of APP23/PS1?S169 mice was homogenized in lysis buffer and APP CTFs were determined by Western blotting. We found that APP23/PS1?S169 mice did significantly reduce the accumulation of APP CTFs under equal human APP expression levels, compared with APP23 mice (Fig 4.3 A). This is not conflict with our in vitro data, showing that PS1?S169 exhibited impaired ?-secretase activity. Because of the dosage effect, the extra 2 copy of PS1?S169 in APP23/PS1?S169 mice might compensate its deficits, although PS1?S169 is a pathogenic mutation with impaired APP processing. A?42 is proposed to initiate the aggregation of A?, Chapter 4  101       all pathogenic PS1 mutations demonstrated increased A?42/40 ratio. Brain cortical tissue of APP23 and APP23/PS1?S169 mice was prepared according to A? ELLISA Kit instructions (Invitrogen). APP23/PS1?S169 mice had significantly increased A?42/40 ratio to 2.43 ? 0.61 folds (p < 0.05), as compared with APP23 mice (Fig 4.3 B). These date demonstrated that APP23/PS1?S169 promoted the generation of the more hydrophobic A?42 peptide in vivo.     Figure 4.3 APP processing and A?  generation in APP23/PS1?S169 and APP23 mice. (A) Brain cortical tissue was collected from APP23 and APP23/PS1?S169 mice and homogenized in RIPA-DOC lysis buffer. APP CTFs and full length APP were detected with C20 antibody; human PS1 NTF was detected with PS1N antibody. (B) Brain cortical tissue of APP23 and APP23/PS1?S169 mice was prepared according to A? ELISA Kit instructions (Invitrogen), and the A? level was determined. The values represent mean?SEM. N=6, *p<0.05, by student t-test.    4.3.4  PS1?S169 promoted neuritic plaque formation in the transgenic mice. Although endogenous APP is expressed in mouse brain, the lack of a critical A? region in murine APP prevents amyloid plaque formation in mice. To mimic the most characteristic pathology of human AD, human APP is introduced into mouse brain to initiate plaque deposition. APP23 transgenic mice specifically express human Swedish mutant APP in neurons. Although APP23 mice develop amyloid plaques in the hippocampus and neocortex as early as 6 months of age, Chapter 4  102       significant plaque deposition is not observed until 12 months of age (Sturchler-Pierrat et al., 1997, Sun et al., 2006a).  To test whether PS1?S169 could promote plaque deposition, APP23/PS1?S169 and age-matched control APP23 mice were sacrificed after behavioral tests at 3 and 6 months.   Amyloid plaques were detected by 4G8 immunostaining and confirmed by staining with thioflavin S (Fig 4.4). From 3 months to 5 months, no plaques were detectable in either APP23/PS1?S169 or APP23 mice (data not shown). At 6 months, amyloid plaques were detected in APP23/PS1?S169 mice, but not in APP23 mice (Fig 4.4 A, B). APP23/PS1?S169 mice had an average plaque number per slice of 9.45 (9.45?1.09 per slice, p<0.05; Fig 4.4 C), compared to the 0 plaque per slice seen in APP23 mice, suggesting that PS1?S169 significantly accelerated plaque formation in the APP23/PS1?S169 mice from 6 months. At 12 months, amyloid plaques could be detected in APP23 mice; however, APP23/PS1?S169 mice exhibited significantly more plaque formation in the same hippocampal region (Fig 4.4). APP23/PS1?S169 mice had 2.64 fold more plaques than APP23 mice  (36.5 ? 4.79 vs. 14.55 ? 2.29 per slice; p < 0.001; Fig 4.4 D), indicating that PS1?S169 continued to promote the plaque formation at 12 months of age. Thioflavin S staining method also confirmed that PS1?S169 accelerated plaque formation and increased plaque number in APP23/PS1?S169 mice (Fig 4.4 B). Chapter 4  103        Figure 4.4 PS1?S169 significantly promoted amyloid plaque formation in the transgenic mice.  (A) APP23/PS1?S169 and APP23 transgenic mice at 6 and 12 months of age were euthanized after behavioral tests, and the brains were dissected, fixed, and sectioned. Amyloid plaques were detected with A?-specific monoclonal antibody 4G8 via the DAB method. Plaques were visualized by microscopy with 40?magnification. a and c showed representative brain sections from APP23 mice at 6 and 12 months of age, respectively; b and d showed representative brain sections from APP23/PS1?S169  mice in 6 and 12 months of age, respectively. Black arrows point to plaques. (B) Amyloid plaques were further confirmed using thioflavin S fluorescent staining and visualized by microscopy at 40?magnifications.  There were more amyloid plaques in APP23/PS1?S169 mice (b and d) compared with age-matched APP23 mice (a and c). White arrows point to green fluorescent neuritic plaques. (C) Quantification of amyloid plaques in APP23 and APP23/ PS1?S169 mice at 6 months of age. Numbers represented mean ? SEM; n = 10 each; **, p < 0.005 by Student?s t-test. (D) Quantification of amyloid plaques in APP23 and APP23/ PS1?S169 mice at 12 months of age. Numbers represented mean ? SEM; n = 10 each; *, p < 0.01 by Student?s t-test.   Chapter 4  104       4.3.5  APP23/PS1?S169 double transgenic mice exhibited age-dependent memory impairment at 3 months of age.  To investigate whether PS1?S169 affected learning and memory in AD pathogenesis in an age-dependent manner, Morris water maze and fear conditioning tests were performed at 3 months and 6 months of age.  At 3 months, APP23 controls and APP23/PS1?S169 mice had a similar escape latency (30.46 ? 2.11s, n=21 and 31.51 ? 2.18s, n=15, respectively; p > 0.05; Fig 4.5 A) and path length (6.02 ? 0.58s, n=2 and 6.53 ? 0.45, n =15, respectively; p> 0.05; Fig 4.5 B) in the visible platform tests of the Morris water maze, indicating that both groups of mice had similar motility and vision. In the hidden platform and probe trials which followed, no significant differences were seen in escape latency, path length, and number of times the mouse crossed the hidden platform area (Fig 4.5 C, D, E; p > 0.05). However, in the contextual fear conditioning test, the APP23/PS1?S169 mice froze significantly less on Day 2 (14.8 ? 3.45%) compared with APP23 mice (23.7 ? 3.26%) (p<0.05; Fig 4.5 F), suggesting that PS1?S169 promoted the memory deficits in APP23 mice at 3 months of age.  Chapter 4  105        Figure 4.5 PS1?S169 negatively affects fear conditioning, but not water maze performance of APP23 mice at 3 months of age.  A Morris water maze test consists of 1 day of visible platform tests and 4 day of hidden platform tests, plus a probe trial 24 h after the last hidden platform test. Animal movement was tracked and recorded by a HVS 2020 Plus image analyzer. APP23/PS1?S169 (n=15) and APP23 transgenic mice (n=21) were tested at 3 months of age. (A) During the first day of visible platform tests, APP23/PS1?S169 and APP23 mice exhibited a similar latency to escape onto the visible platform. p > 0.05 by Student?s t test. (B) APP23/PS1?S169 and APP23 mice had similar swimming distances before escaping onto the visible platform in the visible platform test.  p > 0.05 by Student?s t test. (C) In hidden platform tests, mice were trained with 5 trials per day for 4 days. APP23/PS1?S169 and APP23 mice showed a similar latency to escape onto the hidden platform, p > 0.05 by two-way ANOVA; (D) APP23/PS1?S169 and APP23 mice had a similar swimming length to escape onto the hidden platform. p> 0.05 by two-way ANOVA. (E) In the probe trial on the 6th day, APP23/PS1?S169 and APP23 mice traveled similar times into the third quadrant, where the hidden platform was previously placed. p> 0.05 by Student?s t-test. (F) In the contextual fear conditioning test (see Methods), on day1, APP23/PS1?S169 and APP23 mice demonstrated indistinguishable freezing level immediately after foot shock; p > 0.05 by Student?s t-test. On day 2 (24 h later), APP23/PS1?S169 mice demonstrated significantly reduced freezing levels compared with APP23 mice in the same contextual cage without shock; p < 0.05 by Student?s t-test.   Chapter 4  106       APP23 and APP23/PS1?S169 mice were also subjected to the Morris water maze and contextual fear conditioning tests at 6 months of age. On day1 of the visible platform test, APP23 and APP23/PS1?S169 mice had a similar escape latency (27.81 ? 1.86 s, n =14 and 32.47 ? 2.90s, n =12, respectively; p > 0.05)  (Fig 4.6 A) and path length (5.94? 0.39s, n =14 and 6.38 ? 0.57s, n =12, respectively; p > 0.05) (Fig 4.6 B), suggesting normal motility and vision. In the hidden platform tests on day 2-5, APP23/PS1?S169 mice showed significant deficits compared with APP23 controls. The escape latency on the third and fourth days of APP23/PS1?S169 mice (38.01 ? 2.75 s and 36.07 ? 2.96s, n =12, respectively; p < 0.05) was longer than APP23 mice (29.69 ? 2.44 s and 22.85 ? 2.13s, n =14, respectively; p < 0.05) (Fig 4.6 C). APP23/PS1?S169 mice also swam significantly longer distances (6.44 ? 0.65s and 5.49? 0.37s, n =12, respectively; p < 0.05) to reach the platform as compared with APP23 mice (5.43 ? 0.4s and 4.16 ? 0.36s, n =14, respectively; p < 0.05) (Fig 4.6 D). In the probe trial on the last day of testing, the platform was removed and the number of times the mice passed the platform?s previous position was measured. APP23/PS1?S169 mice made significantly fewer passes compared with controls (1.45 ? 0.15 and 3.63 ? 0.37, respectively; p < 0.005; Fig 4.6 E). These data indicated that APP23/PS1?S169 mice have significantly worse memory deficits compared with APP23 mice. In the contextual fear conditioning test, the APP23/PS1?S169 mice froze significantly less on Day 2 (13.4 ? 2.91%) compared with APP23 mice (27.9 ? 3.8%) (Fig 4.6 F). Together with the behavioral performance of 3 months old mice, the impaired performance of 6 months old APP23/PS1?S169 mice in the Water maze and fear conditioning tasks indicated that PS1?S169 continues to exacerbate memory deficits of 6 months old APP23 mice in an age-dependent manner.  Chapter 4  107        Figure 4.6 PS1?S169 exacerbates memory deficits in APP23 mice at 6 months of age.  APP23 transgenic mice (n=14) and APP23/PS1?S169 (n=12) were tested at 6 months of age. (A, B) On day 1, APP23/ PS1?S169 and APP23 mice exhibited a similar escape latency and swimming path length to escape onto the visible platform. p > 0.05 by Student?s t-test. (C, D) In hidden platform tests on day 2 to 5, APP23/PS1?S169 mice showed a longer escape latency and swimming path length to escape onto the hidden platform. p < 0.01 by ANOVA. (E) In the probe trial on the sixth day, APP23/PS1?S169 mice traveled into the third quadrant, where the hidden platform was previously placed, significantly less times than controls. *, p < 0.01 by Student?s t-test. (F) On day1 of the contextual fear conditioning test, APP23/PS1?S169 and APP23 mice demonstrated indistinguishable freezing levels immediately after foot shock. p > 0.05 by Student?s t-test. 24h later, APP23/ PS1?S169 mice demonstrated significantly reduced freezing level compare with APP23 mice in the same contextual cage without shock at Day2. p < 0.05 by Student?s t-test.    4.4 Discussion. To investigate the effect of PS1?S169 on AD pathogenesis in vivo, we generated PS1?S169 transgenic mice and crossed them with APP23 transgenic mice. The APP23 mice overexpress human APP-751 cDNA harboring the human Swedish Chapter 4  108       mutation (KM670/671NL) under control of a neuron-specific mouse Thy-1 promoter. In APP23 mice, Swedish APP is expressed 7-fold higher than endogenous mouse APP, with higher levels obtained in the deep cortical layers and the hippocampus, and lower in other brain regions such as the thalamus (Sturchler-Pierrat et al., 1997). From 6 months of age, small amounts of amyloid plaques can be detected in the cerebral cortex of APP23 mice, and the size and number of plaques progresses with age (Sturchler-Pierrat et al., 1997).    Pathogenic PS1 mutants have enhanced A? deposition and plaque formation in APP23 mice due to increased A?42 production, like PS1M146L. This effect was not the result of elevated PS levels, because introduction of wild type PS would not alter the A?42/40 ratio or promote plaque formation (Duff et al., 1996). It has been reported that, compared with APP transgenic mice, APP/PS1mutant mice have an increased A? 42/40 ratio, earlier plaque formation, and more rapid progression of memory deficits (Borchelt et al., 1997, Citron et al., 1997, Holcomb et al., 1998, Lamb et al., 1999). In chapter 4, we found that as compared with APP23 littermates, APP23/PS1?S169 mice developed plaques sooner (6 months) and displayed a more severe plaque load by 12 months of age. Using Morris water maze and contextual fear conditioning tests, we found that PS1?S169 promoted the memory impairment of APP23 mice starting from 3 months of age. The time interval between plaque detection and abnormal performance in behavioral tests could be interpreted as the toxicity of soluble or oligomerized A? prior to plaque formation (Haass and Selkoe, 2007).    A good animal model should be able to mimic the onset and progression of the disease. Taking C57BL/6J as an example, 6 months old mice are equivalent to 30 years old humans, and 12 months equivalent to 42.5 years old humans (Fox, Chapter 4  109       2006). APP23/PS45 double transgenic mice overexpress both Swedish APP and PS1G384A. The APP23/PS45 transgenic mice maintained in our laboratories develop plaque pathology in the neocortex and hippocampus as early as 1 month of age, equivalent to 12.5 years in a human. A human-equivalent age of onset of 12.5 years is too young even for FAD, and this discrepancy in age of onset may not accurately characterize the real picture of AD pathogenesis, which often occurs in an aging body. APP23/PS45 mice develop plaques at 1 month of age because the PS1G384A transgene is artificially overexpressed at a very high level, which could give rise to false results due to the robust overexpression.  APP23/PS1?S169 mice showed plaques development from 6 months of age (no plaque detection in 4 and 5 months of age, data not shown), equal to approximately 30 of human years; this is much closer to findings in human PS1 mutations. Moreover, animal models such as APP23/PS45 are not suitable for testing therapeutics testing due to the rapid development of plaques. Because APP23/PS1?S169 mice develop plaques at a much slower rate, these mice would be better animal model to observe the slow effect of drug treatments.    One potential pitfall in our study was that we used transgenic mice instead of knock-in (KI) mice.  To make our mice comparable to APP23/PS45 mice and to shorten the research time, we utilized pronuclear injection method to overexpress human PS1?S169 gene in brain. It was previously shown that overexpressed human PS1 could replace endogenous murine PS1 and act as the predominant ?-secretase, resulting from competition for limiting cellular factors (Thinakaran et al., 1997). Although APP23/PS1?S169 mice carried only 2 copies of the human PS1?S169 gene, the effect of the endogenous wild type mouse PS1 could not be excluded. The virtue of KI mice is the elimination of endogenous Chapter 4  110       target genes and the similar transgene expression level, as compared with physiological levels. Thus, KI mice could reflect the effect of PS1?S169 on APP processing and plaque pathology more accurately.   The limitations in relating the animal studies to the human disease need specific attention. According to the European statistical report on the (2010), mouse is accounting for 59% of the total number of animals used for experimental and other scientific purpose. However, mouse is not an appropriate model for neurodegenerative model, strictly. First and foremost, the short lifespan of mice is around 2 years, which is quite short relative to humans (Jankowsky et al., 2004b); whereas aging is the well-established risk factor for most neurodegenerative disease.  Second, it is very hard to mimic the pathogenesis of complex disease (e.g. AD) in mice model with such short lifespan in the simplified experimental conditions. Third, the pure genetic ground of transgenic mice simplifies experimental conditions but poses the obstacle to apply the results to the following clinical trials in human patients. Taken AD as an example, it is currently accepted that FAD and sporadic AD are the same disease in different forms. While FAD is considered as Mendelian, the late-onset sporadic AD is non-mendelian Alzheimer?s disease. Sporadic AD is classified as a complex disease, resulting from the comprehensive effect of multiple factors, such as complex genetic background and environment. However, the majority of AD transgenic mice are established based on the FAD studies, like our APP23/PS1?S169 mice. A therapeutics, which is significant efficient in APP23/PS1?S169 mice, might has insignificant effect in AD patients, such as semagascestat (Lanz et al., 2006, Bateman et al., 2009).   Chapter 4  111       4.5 Conclusion. In chapter 4, we confirmed the impaired processing of APP by PS1?S169 in APP23/PS1?S169 transgenic mice. Compared with APP23 mice, APP23/PS1?S169 mice have an advanced plaque formation time and increased plaque load. Behaviorally, PS1?S169 mice displayed enhanced memory deficits in fear conditioning at 3 months of age, and impaired performance in Morris water maze at 6 months of age, indicating that PS1?S169 also promotes the cognitive impairment seen in aging APP23 mice.        112        Chapter 5   Discussions and future directions   5.1 Revisiting the ?Amyloid hypothesis?. The ?amyloid hypothesis? is the central dogma in current AD field (Hardy and Selkoe, 2002). Despite the debate on whether its steady-state form (plaque) or its metastable form (oligomers) is the real toxic species, A? itself is established as the culprit of AD pathogenesis (Haass and Selkoe, 2007). However, since it was proposed, ?amyloid hypothesis? has been strongly challenged by several lines of evidence. First, if A? is the cause of AD, why is amyloid plaques/amyloid load poorly correlated with cognitive function decline in AD patients? Second, how should we explain the substantial amyloid deposition in approximately 20%-30% of cognitively normal elderly (Aizenstein et al., 2008)? Third, what mechanism underlies the reduced A?42 in the cerebrospinal fluid (CSF), which has been established as a biomarker for AD diagnosis (Motter et al., 1995, Galasko et al., 1998)? Last but not the least, how should we interpret the failure in all of the amyloid-?-centric therapeutic approaches that reached Phase III clinical trials? For instance, Eli Lilly and Company had recently announced to discontinue the phase III trial of semagascestat (LY450139), the first blood-brain barrier permeable ?-secretase inhibitor.  In phase III, semagascestat displayed worse cognitive performance as well as daily activities  Chapter 5  113       compared with the placebo controls; moreover, semagascestat also brought intolerable side effects like skin cancer (Cummings, 2010).   5.1.1  Possible explanations to the paradox in the  ?Amyloid hypothesis?.  The aggregation of A? is a dynamic procedure, progressively going from monomers to dimers/trimers, and then through oligomers and protofibrils to the final formation of plaques. Given the mounting evidence in support of the toxicity of soluble amyloid oligomers, it is proposed that the amyloid plaques act as the inert reservoir, whereas the oligomers are the real culprit that initiates AD pathogenesis. Moreover, some studies demonstrated that the intracellular A? accumulation precedes its extracellular deposition (Oddo et al., 2003, LaFerla et al., 2007), indicating the contribution of  ?the toxicity of intracellular A?? in AD pathogenesis. If  ?amyloid oligomers? and ?intracellular A?? are the actual toxic amyloids, it explains why the number of amyloid plaques is poorly correlated with the cognitive impairment in AD patients.   Besides, recent therapeutic studies shed some light on the exact role of A? in the complex pathogenesis of AD. It was reported that the cognitive decline continues in the A? vaccination despite the effective clearance of plaques (Holmes et al., 2008). Similarly, amyloid imaging via Pittsburgh compound B (PIB) binding PET scan confirmed that the amyloid burden changed little once significant cognitive impairment occurred (Wang et al., 2002, Sojkova et al., 2011, Villemagne et al., 2011). The reduction of A?42 in cerebrospinal fluid (CSF) is widely used as a biomarker in AD diagnosis, which is inversed related with the increased PIB bind (Fagan et al., 2006). Further studies find similar amyloid load between MCI (mild cognitive impairment) and AD, and thus  Chapter 5  114       postulated that the majority amyloid deposition occurred before significant cognitive decline (Shaw et al., 2009, De Meyer et al., 2010, Jack et al., 2010). These clinical findings indicated that A? is more likely to act as a trigger than a driver, which is not consistently required throughout the whole AD pathogenesis. Again, the ?amyloid-trigger? scenario also explains the poor correlation of amyloid load and cognitive decline in AD patients, as mentioned above.   5.1.2  ?Amyloid hypothesis? and novel risk factors in late-onset sporadic AD.  While FAD is considered as Mendelian, the late-onset sporadic AD is non-mendelian Alzheimer?s disease. Sporadic AD is classified as a complex disease, resulting from the comprehensive effect of multiple factors, such as complex genetic background and environment.  The advances in GWAS in sporadic AD postulate an alternate hypothesis to the amyloid-centric dogma. The SORL1, also known as a neuronal apolipoprotein E receptor, was reported to be associated with both familial and sporadic AD (Rogaeva et al., 2007). Earlier studies implicated that SORL1 was involved in the regulation of the endocytosis of APP.  Meanwhile, PICALM, coding a protein involved in clathrin-mediated endocytosis, was found as a risk factor for sporadic AD (Harold et al., 2009). As mentioned in chapter 1, the classical theory on APP trafficking proposed that the majority of A? was produced in the endocytosis pathway (Andersen et al., 2005). Taken together, it is possible that the abnormal endocytosis of APP plays a role in AD pathogenesis. Besides, the new findings on TREM2 emphasized the role of inflammation in AD pathogenesis (Guerreiro et al., 2013, Jonsson et al., 2013). All these novel discoveries in sporadic AD  Chapter 5  115       support AD as a complex disease and also provide a new therapeutic target for AD treatment.   5.1.3  Linking early-onset FAD with late-onset sporadic AD.  One of the conundrums in AD field is connecting the findings in FAD with sporadic AD cases. FAD-associated mutations are the most powerful evidence in support of the ?amyloid hypothesis?. APP is the precursor of A?, whereas PS is the enzyme responsible for the generation of the more hydrophobic A?42. In early-onset FAD, mutations on APP and Presenilins, both of which synergistically promotes the production of the more aggregation-prone A?42, building a full ?amyloid story? that embraces both the substrate (APP) and the enzyme (?-secretase) in amyloid pathway. Although patients with FAD-associated mutations develop AD symptoms around 10 years earlier than sporadic AD, FAD and sporadic AD are undistinguishable both clinically pathologically. It is currently accepted that FAD and sporadic AD are the same disease in different forms.    But strikingly, as is mentioned above, there is no successful case in the clinical trials based on the discoveries from the studies of FAD. Taking semagascestat as an example, it was reported a significant reduced amyloid deposition in PDAPP transgenic mice and lower level of newly synthesized A? in human volunteers (Lanz et al., 2006, Bateman et al., 2009). However, the phase III clinical trial of semagascestat demonstrated worse cognitive performance than controls. Using stable isotope labeled kinetic (SILK) techniques, the clearance of A? was reduced in sporadic AD, which is a distinguishable mechanism compared with the abnormal production of A? in FAD. Thus, it is proposed that  Chapter 5  116       abnormal A? generation is the culprit in FAD, whereas in sporadic AD it is the disturbed clearance of A?.   According to the ?amyloid-trigger? scenario mentioned in 5.1.1, once the pathogenesis is initiated by A?, it is hard to reverse the whole progression. Thus the most important thing in AD therapeutics is timing, timing and timing. The best timing is probably before the amyloid deposition or the development of MCI clinically. Maybe that is why there has been no successful amyloid-centric therapeutics and the ideal subjects should be the populations with higher risk but no signs of MCI. With the appropriate subjects, the therapeutics based on FAD studies, like robust ?-secretase inhibitor, should take effect in treating the sporadic cases.   5.2  The significance of the research. The overall goal of the studies on AD is to find the approaches to prevent the onset of this disease or ameliorate the symptoms. Why millions of funding investments on the studies of the only 5% FAD cases? The first reason is that there are too many contributors in sporadic AD, although it is accounting for 95% of AD cases. From the pharmaceutical perspective, it is very hard to develop an effective drug only targeting a small piece of the disease pathogenesis. The second reason is that the limited established genetic factors in FAD greatly narrow down the drug targets to several potential ones ? APP (substrate) and Presenilins (enzyme). To meet the demands, this dissertation aims to elucidate how mutations in the APP and PS genes affect APP processing and the resulting amyloidogenesis in vitro and in vivo as well as the potential to develop the effective therapeutics for AD.   Chapter 5  117       5.2.1  The comprehensive effect of APPA673V on the metabolism of APP.  APP is synthesized in ER and delivered through the classical secretory pathway. Along its trafficking pathway, APP undergoes serial modifications including N- and O-glycosylation in the ER and Golgi compartments respectively (Weidemann et al., 1989, Suzuki et al., 2006). This process is also called APP maturation; the N-glycosylated APP in ER is defined as immature APP (imAPP), whereas the O-glycosylated APP in the Golgi is mature APP (mAPP). It has been documented that only mature APP is a substrate for later secretase cleavages (Tomita et al., 1998).   It has been established that the Swedish APP mutation contributes to AD pathogenesis by promoting ?-cleavage at the Asp-1 site, predominantly producing C99 production, as opposed to the C89 production seen in wild type APP (Deng et al., 2013). However, the underlying mechanism of this shift is not clarified. There are two plausible working mechanisms. First, the trafficking pathway of APP might be altered by the Swedish mutation. For decades, it has been proposed that the trafficking of APPSWE and APPWT are distinguishable. In wild type APP, ?-cleavages occur on the plasma membrane and ?-cleavages and A? generation occur in the endocytic organelles such as endosomes; whereas in the Swedish mutation, APP can be processed by ?-secretase and generates A? in the medial Golgi and compartments close to the plasma membrane in the secretory pathway of delivering APP to the plasma membrane (Lo et al., 1994, Haass et al., 1995, Thinakaran et al., 1996b). Second, the structure of APP might be altered by the Swedish mutation. Given that the locus the Swedish mutation (KM670/671NL) is near the Asp-1 site of ?-cleavage, another possibility is that the two mutated residues (NL) confer structural transformation to APP, which facilitate the ?-secretase cleavage at Asp-1 site.  Chapter 5  118       Sauder et al. reported that several hydrophobic residues in BACE1 form an active pocket with the residues around Asp-1 site, like Leu671 in APPSWE, which contributes to the preference cleavage of BACE1 in the Swedish APP (Sauder et al., 2000). Antibodies against the region around Glu-11 site have been shown to block ?-cleavage at this site without significantly affecting its trafficking (Arbel et al., 2005, Paganetti et al., 2005, Thomas et al., 2006, Boddapati et al., 2011, Thomas et al., 2011). These studies imply that the structure of APP plays an important role in determining the processing.   Although we are still in need of the stronger genetic evidence, APPA673V is the first recessive APP mutation to be proposed, based on current available genetic and molecular evidence. Our study confirms the possibility that APPA673V is a recessive mutation but in a novel working mechanism: firstly, the immature APPA673V in ER as well as the mature (modified) APPA673V in TGN can be processed to C99, whereas APPWT cannot, indicating that the structure of APPA673V facilitates the ?-secretase cleavage regardless of the maturation. Secondly, APPA673V undergoes faster lysosome-dependent degradation, possibly because the structural transformation makes APPA673V a better substrate for lysosome-dependent degradation. The two findings not only support that APPA673V is a recessive mutation, but also provide potential the potential pharmaceutical strategy. More specifically, an antibody against alanine at APP 673 could be developed to regulate amyloidogenesis.   5.2.2  The effect of PS1?S169 on APP processing and Notch signaling.  PS1?S169 was a recently discovered pathogenic PS1 mutation in a Chinese FAD family, and this thesis thoroughly studied and confirmed the amyloidogenic effect of PS1?S169 both in vitro and in vivo in chapter 3 and chapter4. Our study  Chapter 5  119       confirmed the pathogenic effect of PS1?S169 on APP processing, and mimicked its amyloidogenic effect in transgenic mice, establishing a potential AD animal model for later studies on AD pathogenesis. Furthermore, we demonstrated that PS1?S169 preserved the processing of Notch, indicating that the structural alteration imposed by PS1?S169 specifically affected A? generation. This not only excluded the arguable contribution of impaired Notch signaling to AD pathogenesis, but also offered the potential for researchers to develop specific ?-secretase inhibitors that spare Notch signaling in future.   In the development of ?-secretase inhibitors, the biggest obstacle is to circumvent their side effects on Notch-signaling.  As we discussed in chapter 1, it was a technological challenge to decipher its crystal structure using traditional methods, because PS1 is a multiple transmembrane protein that requires assistant subunits to assemble the ?-secretase complex. The current understanding of the structure of presenilins comes from indirect methods such as cysteine mutagenesis with cross-linking of chemical probes, which proposed that the PS1 transmembrane domain was important in constituting the catalytic pore of ?-secretase in the hydrophobic environment (Sato et al., 2006a, Tolia et al., 2006a, Sato et al., 2008a, Tolia et al., 2008). PS1?S169 is located in the transmembrane domain and demonstrated reserved processing of Notch, and thus the clarification of the structure of PS1?S169 shed light on developing specific ?-secretase inhibitors that spare Notch signaling.      Chapter 5  120       5.3 Limitations of the research. 5.3.1  Lack of strong genetic evidence for APPA673V  being as the recessive mutation.  Di Fede et al. discovered the homozygous APPA673V mutation in an Italian family by the analyzing the entire coding sequence of PSEN1, PSEN2, and the genes encoding the microtubule-associated protein tau, progranulin, prion protein and huntingtin (Di Fede et al., 2009). However, it lacks the linkage disequilibrium study in this family and the SNP analysis in normal controls. Back in 1993, Peacock et al. reported that heterozygous APPA673V was a novel polymorphism in APP gene in a patient who had ischemic cerebrovascular disease but on no evidence of AD (Peacock et al., 1993). Recently, a novel mutation on the same locus of APPA673V was reported ? APPA673T (Jonsson et al., 2012). This group analyzed the whole genome sequence of 1775 Icelanders and found that APPA673T protected against AD pathogenesis. Given such multifaceted behavior of the polymorphism in this locus, the genetic evidence is quite weak based on a single consanguineous sib-pair that shares much of the genome ?identical-by-decent?, not only the APP gene. Further analysis such as linkage disequilibrium and exclusion of SNPs should be included as we discussed in 5.3.1.   5.3.3  Lack of evidence of APP trafficking in neuronal model.   Neuron is a highly polarized and specialized cell type, characterized with multiple specialized structures (dendrites and axons) and microdomains (presynaptic and postsynaptic region) with distinguishable functions. It is no exaggeration to say that neurons are the most complicated and also most powerful cells in nature.  For our concerns, simple delivery of protein from  Chapter 5  121       somite to the presynaptic region of the long axon is unbelievably complicated. APP was reported to be involved in anterograde axon transport as a kinesin-1 receptor(Lazarov et al., 2005). All the molecular studies we have done are based on non-neuronal cell types like HEK293. The caveats are that the ?behaviors? of APP is different between HEK293 cells and neurons. Earlier studies indicated that Madi-Darby canine kidney (MDCK) cells, a prototypical epithelial cell line, shared similar mechanism to sort the surface protein, in a polarized fashion (Dotti and Simons, 1990, Lo et al., 1994). Thus, the trafficking of APP could be analyzed in MDCK cells. Indeed, the best way should be generating knock-in transgenic mice of APP A673V, and the primary neurons could be extracted to see the difference.   5.3.4  Limitations in the investigation of the effect of PS1?S169 on ?-cleavage.  In chapter 2, we investigated the effect of PS1?S169 on ?-cleavage on Notch. In addition to APP and Notch, PS has numerous other substrates, such as N-cadherin and Erb4. Previous work had found that FAD- associated PS1 mutations have various effects on the ?-cleavage of different substrates, despite displaying consistently impaired ?-cleavage (Chavez-Gutierrez et al., 2012). For example, PS1?E9 demonstrated significantly impaired APP, Notch and E-cadherin ICDs generation in in vitro ?-secretase activity assays, but displayed increased Erb4 ICDs generation, indicating that the effect of FAD-associated PS1 mutations on ?-cleavage are quite heterogeneous and substrate-dependent. To compile an integrated story of the effect of PS1?S169 on ?-secretase, it would be beneficial to investigate the effect of PS1?S169 on other substrates in addition to APP and Notch.    Chapter 5  122       5.3.5  Development of PS1?S169 knock-in transgenic mice.  In Chapter 4, we generated transgenic mice that overexpress PS1?S169 with copy number of approximately 2. One limitation of PS1?S169 overexpressing transgenic mice is that the effect of wild type mouse PS1 and the second copy of PS1?S169 could not be excluded, especially when exploring the effect of PS1?S169 on Notch signaling. The best solution to this problem is to generate PS1?S169 knock-in transgenic mice. The gene knock-in method is defined as insertion of cDNA encoding for a specific protein back to its original locus on the genome chromosome. This method is superior to other methods, because the protein expression level is comparable with the endogenous protein, and substitution of the endogenous protein excludes the confounding effect of the endogenous protein. Those superior qualities of the knock-in method greatly reduce the false-positive errors seen in the traditional transgenic method.    5.4 Potential application and future research. The ultimate goal in studies of AD is to prevent the onset of AD or to treat the disease. In the study of APPA673V, apart from further genetically characterizing of APPA673V, therapeutic strategy could be developed based on the unique features of APPA673V. In the study of PS1?S169, the effect of PS1?S169 on Notch should be tested in animal model, to further confirm the normal Notch signaling and following behavior in vivo. Moreover, the therapeutic strategy could be developed based on the effect of PS1?S169 on structure of presenilin.    Chapter 5  123       5.4.1  Linkage disequilibrium analysis of the family carrying APP A673V mutation and PCR-restriction endonuclease length polymorphism analysis (PCR-RLFP) of normal controls.  To exclude A673V as a polymorphism, PCR-restriction endonuclease length polymorphism analysis (PCR-RLFP) using a mismatch primer pair will be used. In brief, DNA samples are amplified using a pair of the forward primer: 5-GAAGTGAAGATGGATGTAGAATTC -3 (underline: mismatch position) and reverse primer: 5-GTCATGTCGGAATTCTACATCCAT -3), followed by PCR-RLFP using HpyCH4V. The allele of the A673V variant gains an artificial HpyCH4V site. In the PCR-RLFP using Bgl II, if the A673V variant is not be found in 200 normal Italian control subjects (400 normal alleles), we could exclude the possibility of A673V being as a SNP.   5.4.2  Alanine at APP 673 as the potential therapeutic target.  Recently, a novel mutation on the same locus of APPA673V have been reported ? APPA673T (Jonsson et al., 2012). This group analyzed the whole genome sequence of 1775 Icelanders and found that APPA673T protected against AD pathogenesis. It is a very intriguing phenomenon that mutations at the same locus can exhibit completely opposite effects on disease pathogenesis, and furthermore that one of them on this locus was the only recessive FAD-associated mutation.   The alanine (A) at APP 673 is replaced with valine (V) in APPA673V, whereas with threonine (T) in APPA673T. Both alanine and valine are hydrophobic amino acids with side chains, but the side chain of valine is bigger; threonine is a hydrophilic amino acid with a polar uncharged side chain. Jonsson et al. (2012)  Chapter 5  124       reported that sAPP? and A? generation were reduced in APPA673T. It may be that the more hydrophilic residue at this locus makes APP undergo the less amyloidogenic pathway. We hypothesize that alanine in locus APP 673 was important for the regulation of APP processing, possibly by altering the structure of APP at functional sites. Next, the effect of APPA673T on APP metabolism needs to be confirmed and if possible, the structural differences between APPA673T and APPA673V should be analyzed. These findings could be used to develop a small peptide, which could specifically bind to the alanine at APP 673 to prevent A? generation by affecting its processing and metabolism.   5.4.3  Analyzing the ?-cleavage of PS1?S169 on APP and other ?-secretase substrate in cell-free system. Our present study on PS1?S169 examined the two most interesting ?-secretase substrates: APP and Notch. We found that A? generation and NICD production are differentially regulated by PS1?S169. In chapter 1.4, we noted that Ihara and colleagues (2008) have provided compelling evidence for the sequential cleavages in the transmembrane domain of ?-secretase substrates, namely, ?-cleavage and subsequent ?-cleavage (Sato et al., 2003, Qi-Takahara et al., 2005b, Kakuda et al., 2006, Yagishita et al., 2008). The transmembrane cleavage by ?-secretase is actually an enzyme catalysis event, which can be achieved in an in vitro assay with both enzyme and substrate in solution (PS1?S169 and APP or Notch in our case). It was reported that the intrinsic pathogenic properties of PS1 mutations are retained in the cell-free ?-secretase activity assay (Ahn et al., 2010b). Characterizing the enzyme kinetics of PS1?S169 could yield robust mechanistic insights into how this mutation affects the basic function of PS1.   Chapter 5  125       In future research, we would like to analyze the catalytic efficiency of PS1?S169 for ?-cleavages on Notch and ?-cleavage of APP. Due to the quantification needs of this assay and the relatively large size of APP and Notch, APP-C99 and truncated Notch (which is similar in size to APP-C99) will be used in this assay. The PS1?S169 -comprising ?-secretase extract and the substrates (APP-C99 and truncated Notch) will be incubated in optimized conditions, and the resulting products will be assessed by SDS-PAGE as well as Coomassie staining. The characterization of the catalytic efficiency of PS1?S169 on ?-cleavage will give further compelling evidence to support the reserved ?-cleavage in PS1?S169.   5.4.4  To determine the effect of PS1?S169 on Notch processing in C. elegans.    Presenilins are crucial for Notch signaling. However, knock-out of PS2 was not sufficient to induce the typical Notch deficient phenotype in PS2 knock-out transgenic mice (Herreman et al., 1999), indicating that Notch signaling is highly redundant to meet its fundamental developmental requirements. Most FAD-associated PS mutations still only partially impair Notch processing activity. Thus it has been difficult to define and evaluate impaired Notch signaling in AD pathogenesis in human and transgenic mice. Alternatively, since both Notch and PS are conserved in metazoans, researchers turned to simpler organisms such as Drosophila and Caenorhabditis elegans (C.elegans) to investigate the effect of FAD-associated PS1 mutations on Notch signaling in vivo.   In collaboration with Dr. Catherine Rankins?s lab, we chose C.elegans as an animal model to investigate the effect of PS1?S169 on Notch signaling. C.elegans  Chapter 5  126       is an excellent model system due to its short generation time, clear genetic map and well-established genetic manipulation approaches. LIN-12 is the C.elegans Notch homolog, while SEL-12 (suppressor/enhancer of LIN-12) is the PS homolog. A SEL-12 defective strain reduced LIN-12 activity with an egg-laying defective (Egl) phenotype (Levitan and Greenwald, 1995), which could be rescued by expression of wild-type human presenilins; in contrast, six different FAD-linked mutations reduced this rescuing ability to various degrees. Since our in vitro results indicated normal Notch proteolysis in PS1?S169, we predict that expression of PS1?S169 in a SEL-12 defective strain could rescue the Egl phenotype in a similar manner as wild type human PS1.  In C.elegans, pathogenic PS1 mutants exhibit an impaired ability to rescue the Egl phenotype when compared with wild type PS1. Notably, some PS1 mutants showed a dose-dependent rescuing ability, such as PS1?E9, which exhibited almost full rescuing (similar to wild type PS1) with high dosages and significant impairments with low dosages (Levitan and Greenwald, 1995). Thus, we will choose different microinjection dosage to distinguish the dosage effect (20?g/ml & 2?g/ml). Based on our in vitro study that PS1?S169 retains its Notch cleavage activity in mammalian cells, we anticipate that PS1?S169 could rescue the Egl phenotype even at low dosages (2?g/ml). This finding would fully support the hypothesis that PS1?S169 functions normally in Notch processing in vitro and in vivo. Since our in vitro study used a constitutively active form of Notch (N?E) to investigate the effect of PS1?S169 rather than Notch itself, it is possible that we may not see normal Notch processing in PS1?S169 in C.elegans. Nevertheless, if PS1?S169 does function normally in Notch signaling in C.elegans, we still need to take into consideration that C.elegans is less complex than mammals, and all results should be critically examined.   Chapter 5  127       5.4.5  TM3-targeted ?-secretase inhibitor.    Most ?-secretase inhibitors target presenilins. Inhibition of Notch signaling by nonselective ?-secretase inhibitors has been a potential limiting issue for the clinical development of ?-secretase inhibitors as an AD treatment. Hence, a major issue for ?-secretase inhibitors is the development of selective inhibitors , which could reduce A? peptide production without significantly interfering with the processing of other substrates of ?-secretase, especially Notch.  Our present study demonstrated that PS1?S169 displays separate catalytic efficiencies at the ?- and ?-sites, with normal Notch signaling. The serine 169 residue is located in the third transmembrane domain (TM3) of PS1, and our findings are in agreement with a report that TM3 is involved in the determination of a selective ?-secretase inhibitor (Zhao et al., 2008). Utilizing an alanine scanning mutagenesis method, Zhao and colleagues found that PS1S169A specifically affected some class of ?-secretase inhibitors, such as ELN318463. They found that PS1S169A significantly increased the potency of this inhibitor, indicating that the serine 169 residue was important in the inhibitor/PS interaction. Thus, it would be informative to elucidate the structural differences between PS1?S169 and wild type PS1, to clarify the working mechanism of PS1 mutations, and to aid development of Notch-sparing ?-secretase inhibitor. The ideal approach would be to analyze the crystal structure of PS1?S169, however, given its multi-transmembrane structure and the multi-subunits of ?-secretase, it has been difficult to analyze the crystal structure of presenilin. Recently, the Shi laboratories reported the crystal structure of a presenilin/SPP homologue (PSH) from the archaeon Methanoculleus marisnigri JR1, and made predictions of presenilin?s structure based on the conserved  Chapter 5  128       sequence between the two homologues (Li et al., 2012). Since serine 169 was one of the conserved residues between human PS1 and PSH (corresponding to alanine 80 on PSH), we could design a PSH?A80 mutation corresponding to the PS1?S169 mutation and analyze the crystal structure of PSH?A80 instead. The structural difference between PSH?A80 and wild type PSH would give direct clues to help develop specific ?-secretase inhibitors.        129         Bibliography   Ahn CK, Woo SH, Park JM (2010a) Surface solubilization of phenanthrene by surfactant sorbed on soils with different organic matter contents. J Hazard Mater 177:799-806. Ahn K, Shelton CC, Tian Y, Zhang X, Gilchrist ML, Sisodia SS, Li YM (2010b) Activation and intrinsic gamma-secretase activity of presenilin 1. Proceedings of the National Academy of Sciences of the United States of America 107:21435-21440. Aizenstein HJ, Nebes RD, Saxton JA, Price JC, Mathis CA, Tsopelas ND, Ziolko SK, James JA, Snitz BE, Houck PR, Bi W, Cohen AD, Lopresti BJ, DeKosky ST, Halligan EM, Klunk WE (2008) Frequent amyloid deposition without significant cognitive impairment among the elderly. Arch Neurol 65:1509-1517. Alberi L, Liu S, Wang Y, Badie R, Smith-Hicks C, Wu J, Pierfelice TJ, Abazyan B, Mattson MP, Kuhl D, Pletnikov M, Worley PF, Gaiano N (2011) Activity-induced Notch signaling in neurons requires Arc/Arg3.1 and is essential for synaptic plasticity in hippocampal networks. Neuron 69:437-444. Alzheimer's A (2012) 2012 Alzheimer's disease facts and figures. Alzheimers Dement 8:131-168. Andersen OM, Reiche J, Schmidt V, Gotthardt M, Spoelgen R, Behlke J, von Arnim CA, Breiderhoff T, Jansen P, Wu X, Bales KR, Cappai R, Masters CL, Gliemann J, Mufson EJ, Hyman BT, Paul SM, Nykjaer A, Willnow TE (2005) Neuronal sorting protein-related receptor sorLA/LR11 regulates processing of the amyloid precursor protein. Proc Natl Acad Sci U S A 102:13461-13466. Anliker B, Muller U (2006) The functions of mammalian amyloid precursor protein and related amyloid precursor-like proteins. Neurodegener Dis 3:239-246. Annaert WG, Levesque L, Craessaerts K, Dierinck I, Snellings G, Westaway D, George-Hyslop PS, Cordell B, Fraser P, De Strooper B (1999) Presenilin 1 controls gamma-secretase processing of amyloid precursor protein in pre-golgi compartments of hippocampal neurons. J Cell Biol 147:277-294. Arai H, Lee VM, Messinger ML, Greenberg BD, Lowery DE, Trojanowski JQ (1991) Expression patterns of beta-amyloid precursor protein (beta-APP) in neural and nonneural human tissues from Alzheimer's disease and control subjects. Ann Neurol 30:686-693. Arbel M, Yacoby I, Solomon B (2005) Inhibition of amyloid precursor protein processing by beta-  Bibliography  130       secretase through site-directed antibodies. Proc Natl Acad Sci U S A 102:7718-7723. Arriagada PV, Growdon JH, Hedley-Whyte ET, Hyman BT (1992) Neurofibrillary tangles but not senile plaques parallel duration and severity of Alzheimer's disease. Neurology 42:631-639. Artavanis-Tsakonas S, Matsuno K, Fortini ME (1995) Notch signaling. Science 268:225-232. Atwood CS, Martins RN, Smith MA, Perry G (2002) Senile plaque composition and posttranslational modification of amyloid-beta peptide and associated proteins. Peptides 23:1343-1350. Baek SH, Ohgi KA, Rose DW, Koo EH, Glass CK, Rosenfeld MG (2002) Exchange of N-CoR corepressor and Tip60 coactivator complexes links gene expression by NF-kappaB and beta-amyloid precursor protein. Cell 110:55-67. Basun H, Bogdanovic N, Ingelsson M, Almkvist O, Naslund J, Axelman K, Bird TD, Nochlin D, Schellenberg GD, Wahlund LO, Lannfelt L (2008) Clinical and neuropathological features of the arctic APP gene mutation causing early-onset Alzheimer disease. Arch Neurol 65:499-505. Bateman RJ, Siemers ER, Mawuenyega KG, Wen G, Browning KR, Sigurdson WC, Yarasheski KE, Friedrich SW, Demattos RB, May PC, Paul SM, Holtzman DM (2009) A gamma-secretase inhibitor decreases amyloid-beta production in the central nervous system. Ann Neurol 66:48-54. Bendotti C, Forloni GL, Morgan RA, O'Hara BF, Oster-Granite ML, Reeves RH, Gearhart JD, Coyle JT (1988) Neuroanatomical localization and quantification of amyloid precursor protein mRNA by in situ hybridization in the brains of normal, aneuploid, and lesioned mice. Proceedings of the National Academy of Sciences of the United States of America 85:3628-3632. Bennett BD, Denis P, Haniu M, Teplow DB, Kahn S, Louis JC, Citron M, Vassar R (2000) A furin-like convertase mediates propeptide cleavage of BACE, the Alzheimer's beta -secretase. J Biol Chem 275:37712-37717. Bentahir M, Nyabi O, Verhamme J, Tolia A, Horre K, Wiltfang J, Esselmann H, De Strooper B (2006) Presenilin clinical mutations can affect gamma-secretase activity by different mechanisms. J Neurochem 96:732-742. Bierer LM, Hof PR, Purohit DP, Carlin L, Schmeidler J, Davis KL, Perl DP (1995) Neocortical neurofibrillary tangles correlate with dementia severity in Alzheimer's disease. Arch Neurol 52:81-88. Bihel F, Das C, Bowman MJ, Wolfe MS (2004) Discovery of a Subnanomolar helical D-tridecapeptide inhibitor of gamma-secretase. J Med Chem 47:3931-3933. Bitan G, Fradinger EA, Spring SM, Teplow DB (2005) Neurotoxic protein oligomers--what you see is not always what you get. Amyloid : the international journal of experimental and clinical investigation : the official journal of the International Society of Amyloidosis 12:88-95. Blanchard RJ, Blanchard DC (1969) Crouching as an index of fear. Journal of comparative and physiological psychology 67:370-375.   Bibliography  131       Boddapati S, Levites Y, Sierks MR (2011) Inhibiting beta-secretase activity in Alzheimer's disease cell models with single-chain antibodies specifically targeting APP. Journal of molecular biology 405:436-447. Bodendorf U, Fischer F, Bodian D, Multhaup G, Paganetti P (2001) A splice variant of beta-secretase deficient in the amyloidogenic processing of the amyloid precursor protein. J Biol Chem 276:12019-12023. Borchelt DR, Ratovitski T, van Lare J, Lee MK, Gonzales V, Jenkins NA, Copeland NG, Price DL, Sisodia SS (1997) Accelerated amyloid deposition in the brains of transgenic mice coexpressing mutant presenilin 1 and amyloid precursor proteins. Neuron 19:939-945. Borchelt DR, Thinakaran G, Eckman CB, Lee MK, Davenport F, Ratovitsky T, Prada CM, Kim G, Seekins S, Yager D, Slunt HH, Wang R, Seeger M, Levey AI, Gandy SE, Copeland NG, Jenkins NA, Price DL, Younkin SG, Sisodia SS (1996) Familial Alzheimer's disease-linked presenilin 1 variants elevate Abeta1-42/1-40 ratio in vitro and in vivo. Neuron 17:1005-1013. Bossy-Wetzel E, Schwarzenbacher R, Lipton SA (2004) Molecular pathways to neurodegeneration. Nat Med 10 Suppl:S2-9. Braak H, Braak E (1991) Neuropathological stageing of Alzheimer-related changes. Acta Neuropathol 82:239-259. Bromley-Brits K, Deng Y, Song W (2011) Morris water maze test for learning and memory deficits in Alzheimer's disease model mice. Journal of visualized experiments : JoVE. Brown MS, Ye J, Rawson RB, Goldstein JL (2000) Regulated intramembrane proteolysis: a control mechanism conserved from bacteria to humans. Cell 100:391-398. Cai H, Wang Y, McCarthy D, Wen H, Borchelt DR, Price DL, Wong PC (2001) BACE1 is the major beta-secretase for generation of Abeta peptides by neurons. Nat Neurosci 4:233-234. Caille I, Allinquant B, Dupont E, Bouillot C, Langer A, Muller U, Prochiantz A (2004) Soluble form of amyloid precursor protein regulates proliferation of progenitors in the adult subventricular zone. Development 131:2173-2181. Campbell WA, Reed ML, Strahle J, Wolfe MS, Xia W (2003) Presenilin endoproteolysis mediated by an aspartyl protease activity pharmacologically distinct from gamma-secretase. J Neurochem 85:1563-1574. Campion D, Dumanchin C, Hannequin D, Dubois B, Belliard S, Puel M, Thomas-Anterion C, Michon A, Martin C, Charbonnier F, Raux G, Camuzat A, Penet C, Mesnage V, Martinez M, Clerget-Darpoux F, Brice A, Frebourg T (1999) Early-onset autosomal dominant Alzheimer disease: prevalence, genetic heterogeneity, and mutation spectrum. Am J Hum Genet 65:664-670. Cao X, Sudhof TC (2001) A transcriptionally [correction of transcriptively] active complex of APP with Fe65 and histone acetyltransferase Tip60. Science 293:115-120. Capell A, Steiner H, Willem M, Kaiser H, Meyer C, Walter J, Lammich S, Multhaup G, Haass C (2000) Maturation and pro-peptide cleavage of beta-secretase. J Biol Chem 275:30849-30854.   Bibliography  132       Caporaso GL, Takei K, Gandy SE, Matteoli M, Mundigl O, Greengard P, De Camilli P (1994) Morphologic and biochemical analysis of the intracellular trafficking of the Alzheimer beta/A4 amyloid precursor protein. J Neurosci 14:3122-3138. Chan SL, Mayne M, Holden CP, Geiger JD, Mattson MP (2000) Presenilin-1 mutations increase levels of ryanodine receptors and calcium release in PC12 cells and cortical neurons. J Biol Chem 275:18195-18200. Chavez-Gutierrez L, Bammens L, Benilova I, Vandersteen A, Benurwar M, Borgers M, Lismont S, Zhou L, Van Cleynenbreugel S, Esselmann H, Wiltfang J, Serneels L, Karran E, Gijsen H, Schymkowitz J, Rousseau F, Broersen K, De Strooper B (2012) The mechanism of gamma-Secretase dysfunction in familial Alzheimer disease. Embo J 31:2261-2274. Chen CH, Zhou W, Liu S, Deng Y, Cai F, Tone M, Tone Y, Tong Y, Song W (2011) Increased NF-kappaB signalling up-regulates BACE1 expression and its therapeutic potential in Alzheimer's disease. Int J Neuropsychopharmacol 1-14. Cheng IH, Scearce-Levie K, Legleiter J, Palop JJ, Gerstein H, Bien-Ly N, Puolivali J, Lesne S, Ashe KH, Muchowski PJ, Mucke L (2007) Accelerating amyloid-beta fibrillization reduces oligomer levels and functional deficits in Alzheimer disease mouse models. J Biol Chem 282:23818-23828. Cheung KH, Shineman D, Muller M, Cardenas C, Mei L, Yang J, Tomita T, Iwatsubo T, Lee VM, Foskett JK (2008) Mechanism of Ca2+ disruption in Alzheimer's disease by presenilin regulation of InsP3 receptor channel gating. Neuron 58:871-883. Christensen MA, Zhou W, Qing H, Lehman A, Philipsen S, Song W (2004) Transcriptional regulation of BACE1, the beta-amyloid precursor protein beta-secretase, by Sp1. Mol Cell Biol 24:865-874. Cirrito JR, Yamada KA, Finn MB, Sloviter RS, Bales KR, May PC, Schoepp DD, Paul SM, Mennerick S, Holtzman DM (2005) Synaptic activity regulates interstitial fluid amyloid-beta levels in vivo. Neuron 48:913-922. Citron M, Oltersdorf T, Haass C, McConlogue L, Hung AY, Seubert P, Vigo-Pelfrey C, Lieberburg I, Selkoe DJ (1992) Mutation of the beta-amyloid precursor protein in familial Alzheimer's disease increases beta-protein production. Nature 360:672-674. Citron M, Westaway D, Xia W, Carlson G, Diehl T, Levesque G, Johnson-Wood K, Lee M, Seubert P, Davis A, Kholodenko D, Motter R, Sherrington R, Perry B, Yao H, Strome R, Lieberburg I, Rommens J, Kim S, Schenk D, Fraser P, St George Hyslop P, Selkoe DJ (1997) Mutant presenilins of Alzheimer's disease increase production of 42-residue amyloid beta-protein in both transfected cells and transgenic mice. Nat Med 3:67-72. Cleary JP, Walsh DM, Hofmeister JJ, Shankar GM, Kuskowski MA, Selkoe DJ, Ashe KH (2005a) Natural oligomers of the amyloid-beta protein specifically disrupt cognitive function. Nature neuroscience 8:79-84. Cleary JP, Walsh DM, Hofmeister JJ, Shankar GM, Kuskowski MA, Selkoe DJ, Ashe KH (2005b) Natural oligomers of the amyloid-beta protein specifically disrupt cognitive function. Nat Neurosci 8:79-84.   Bibliography  133       Corder EH, Saunders AM, Strittmatter WJ, Schmechel DE, Gaskell PC, Small GW, Roses AD, Haines JL, Pericak-Vance MA (1993) Gene dose of apolipoprotein E type 4 allele and the risk of Alzheimer's disease in late onset families. Science 261:921-923. Creemers JW, Ines Dominguez D, Plets E, Serneels L, Taylor NA, Multhaup G, Craessaerts K, Annaert W, De Strooper B (2001) Processing of beta-secretase by furin and other members of the proprotein convertase family. J Biol Chem 276:4211-4217. Crook R, Verkkoniemi A, Perez-Tur J, Mehta N, Baker M, Houlden H, Farrer M, Hutton M, Lincoln S, Hardy J, Gwinn K, Somer M, Paetau A, Kalimo H, Ylikoski R, Poyhonen M, Kucera S, Haltia M (1998a) A variant of Alzheimer's disease with spastic paraparesis and unusual plaques due to deletion of exon 9 of presenilin 1. Nat Med 4:452-455. Crook R, Verkkoniemi A, Perez-Tur J, Mehta N, Baker M, Houlden H, Farrer M, Hutton M, Lincoln S, Hardy J, Gwinn K, Somer M, Paetau A, Kalimo H, Ylikoski R, Poyhonen M, Kucera S, Haltia M (1998b) A variant of Alzheimer's disease with spastic paraparesis and unusual plaques due to deletion of exon 9 of presenilin 1. Nat Med 4:452-455. Culvenor JG, Maher F, Evin G, Malchiodi-Albedi F, Cappai R, Underwood JR, Davis JB, Karran EH, Roberts GW, Beyreuther K, Masters CL (1997) Alzheimer's disease-associated presenilin 1 in neuronal cells: evidence for localization to the endoplasmic reticulum-Golgi intermediate compartment. J Neurosci Res 49:719-731. Cummings J (2010) What can be inferred from the interruption of the semagacestat trial for treatment of Alzheimer's disease? Biological psychiatry 68:876-878. Daigle I, Li C (1993) apl-1, a Caenorhabditis elegans gene encoding a protein related to the human beta-amyloid protein precursor. Proceedings of the National Academy of Sciences of the United States of America 90:12045-12049. Das C, Berezovska O, Diehl TS, Genet C, Buldyrev I, Tsai JY, Hyman BT, Wolfe MS (2003) Designed helical peptides inhibit an intramembrane protease. J Am Chem Soc 125:11794-11795. De Jonghe C, Esselens C, Kumar-Singh S, Craessaerts K, Serneels S, Checler F, Annaert W, Van Broeckhoven C, De Strooper B (2001) Pathogenic APP mutations near the gamma-secretase cleavage site differentially affect Abeta secretion and APP C-terminal fragment stability. Hum Mol Genet 10:1665-1671. De Meyer G, Shapiro F, Vanderstichele H, Vanmechelen E, Engelborghs S, De Deyn PP, Coart E, Hansson O, Minthon L, Zetterberg H, Blennow K, Shaw L, Trojanowski JQ, Alzheimer's Disease Neuroimaging I (2010) Diagnosis-independent Alzheimer disease biomarker signature in cognitively normal elderly people. Arch Neurol 67:949-956. de Sauvage F, Octave JN (1989) A novel mRNA of the A4 amyloid precursor gene coding for a possibly secreted protein. Science 245:651-653. De Strooper B (2010) Proteases and proteolysis in Alzheimer disease: a multifactorial view on the disease process. Physiol Rev 90:465-494. De Strooper B, Annaert W, Cupers P, Saftig P, Craessaerts K, Mumm JS, Schroeter EH, Schrijvers V, Wolfe MS, Ray WJ, Goate A, Kopan R (1999) A presenilin-1-dependent gamma-secretase-like protease mediates release of Notch intracellular domain. Nature 398:518-522.   Bibliography  134       De Strooper B, Saftig P, Craessaerts K, Vanderstichele H, Guhde G, Annaert W, Von Figura K, Van Leuven F (1998) Deficiency of presenilin-1 inhibits the normal cleavage of amyloid precursor protein. Nature 391:387-390. DeKosky ST, Scheff SW (1990) Synapse loss in frontal cortex biopsies in Alzheimer's disease: correlation with cognitive severity. Ann Neurol 27:457-464. Demuro A, Mina E, Kayed R, Milton SC, Parker I, Glabe CG (2005) Calcium dysregulation and membrane disruption as a ubiquitous neurotoxic mechanism of soluble amyloid oligomers. J Biol Chem 280:17294-17300. Deng Y, Wang Z, Wang R, Zhang X, Zhang S, Wu Y, Staufenbiel M, Cai F, Song W (2013) A? Glu11  is the prime ?-secretase site of BACE1 and alteration of ?-secretase cleavage of APP by BACE1 contributes to Alzheimer pathogenesis. . European Journal of Neuroscience (In publication). Di Fede G, Catania M, Morbin M, Rossi G, Suardi S, Mazzoleni G, Merlin M, Giovagnoli AR, Prioni S, Erbetta A, Falcone C, Gobbi M, Colombo L, Bastone A, Beeg M, Manzoni C, Francescucci B, Spagnoli A, Cantu L, Del Favero E, Levy E, Salmona M, Tagliavini F (2009) A recessive mutation in the APP gene with dominant-negative effect on amyloidogenesis. Science 323:1473-1477. Dotti CG, Simons K (1990) Polarized sorting of viral glycoproteins to the axon and dendrites of hippocampal neurons in culture. Cell 62:63-72. Dovey HF, John V, Anderson JP, Chen LZ, de Saint Andrieu P, Fang LY, Freedman SB, Folmer B, Goldbach E, Holsztynska EJ, Hu KL, Johnson-Wood KL, Kennedy SL, Kholodenko D, Knops JE, Latimer LH, Lee M, Liao Z, Lieberburg IM, Motter RN, Mutter LC, Nietz J, Quinn KP, Sacchi KL, Seubert PA, Shopp GM, Thorsett ED, Tung JS, Wu J, Yang S, Yin CT, Schenk DB, May PC, Altstiel LD, Bender MH, Boggs LN, Britton TC, Clemens JC, Czilli DL, Dieckman-McGinty DK, Droste JJ, Fuson KS, Gitter BD, Hyslop PA, Johnstone EM, Li WY, Little SP, Mabry TE, Miller FD, Audia JE (2001) Functional gamma-secretase inhibitors reduce beta-amyloid peptide levels in brain. J Neurochem 76:173-181. Duff K, Eckman C, Zehr C, Yu X, Prada CM, Perez-tur J, Hutton M, Buee L, Harigaya Y, Yager D, Morgan D, Gordon MN, Holcomb L, Refolo L, Zenk B, Hardy J, Younkin S (1996) Increased amyloid-beta42(43) in brains of mice expressing mutant presenilin 1. Nature 383:710-713. Dyrks T, Dyrks E, Masters C, Beyreuther K (1992) Membrane inserted APP fragments containing the beta A4 sequence of Alzheimer's disease do not aggregate. FEBS Lett 309:20-24. Dyrks T, Dyrks E, Monning U, Urmoneit B, Turner J, Beyreuther K (1993) Generation of beta A4 from the amyloid protein precursor and fragments thereof. FEBS Lett 335:89-93. Edbauer D, Winkler E, Regula JT, Pesold B, Steiner H, Haass C (2003a) Reconstitution of gamma-secretase activity. Nature cell biology 5:486-488. Edbauer D, Winkler E, Regula JT, Pesold B, Steiner H, Haass C (2003b) Reconstitution of gamma-secretase activity. Nat Cell Biol 5:486-488. Eggert S, Paliga K, Soba P, Evin G, Masters CL, Weidemann A, Beyreuther K (2004) The proteolytic processing of the amyloid precursor protein gene family members APLP-1 and APLP-  Bibliography  135       2 involves alpha-, beta-, gamma-, and epsilon-like cleavages: modulation of APLP-1 processing by n-glycosylation. J Biol Chem 279:18146-18156. Ehehalt R, Michel B, De Pietri Tonelli D, Zacchetti D, Simons K, Keller P (2002) Splice variants of the beta-site APP-cleaving enzyme BACE1 in human brain and pancreas. Biochem Biophys Res Commun 293:30-37. Esch FS, Keim PS, Beattie EC, Blacher RW, Culwell AR, Oltersdorf T, McClure D, Ward PJ (1990) Cleavage of amyloid beta peptide during constitutive processing of its precursor. Science 248:1122-1124. Esselens C, Oorschot V, Baert V, Raemaekers T, Spittaels K, Serneels L, Zheng H, Saftig P, De Strooper B, Klumperman J, Annaert W (2004) Presenilin 1 mediates the turnover of telencephalin in hippocampal neurons via an autophagic degradative pathway. J Cell Biol 166:1041-1054. Ezquerra M, Carnero C, Blesa R, Gelpi JL, Ballesta F, Oliva R (1999) A presenilin 1 mutation (Ser169Pro) associated with early-onset AD and myoclonic seizures. Neurology 52:566-570. Fagan AM, Mintun MA, Mach RH, Lee SY, Dence CS, Shah AR, LaRossa GN, Spinner ML, Klunk WE, Mathis CA, DeKosky ST, Morris JC, Holtzman DM (2006) Inverse relation between in vivo amyloid imaging load and cerebrospinal fluid Abeta42 in humans. Ann Neurol 59:512-519. Felsenstein KM, Hunihan LW, Roberts SB (1994a) Altered cleavage and secretion of a recombinant beta-APP bearing the Swedish familial Alzheimer's disease mutation. Nat Genet 6:251-255. Felsenstein KM, Hunihan LW, Roberts SB (1994b) Altered cleavage and secretion of a recombinant beta-APP bearing the Swedish familial Alzheimer's disease mutation. Nat Genet 6:251-255. Fox JG (2006) The Mouse in Biomedical Research: Normative Biology, Husbandry. Fraering PC, Ye W, LaVoie MJ, Ostaszewski BL, Selkoe DJ, Wolfe MS (2005) gamma-Secretase substrate selectivity can be modulated directly via interaction with a nucleotide-binding site. J Biol Chem 280:41987-41996. Francis R, McGrath G, Zhang J, Ruddy DA, Sym M, Apfeld J, Nicoll M, Maxwell M, Hai B, Ellis MC, Parks AL, Xu W, Li J, Gurney M, Myers RL, Himes CS, Hiebsch R, Ruble C, Nye JS, Curtis D (2002a) aph-1 and pen-2 are required for Notch pathway signaling, gamma-secretase cleavage of betaAPP, and presenilin protein accumulation. Dev Cell 3:85-97. Francis R, McGrath G, Zhang J, Ruddy DA, Sym M, Apfeld J, Nicoll M, Maxwell M, Hai B, Ellis MC, Parks AL, Xu W, Li J, Gurney M, Myers RL, Himes CS, Hiebsch R, Ruble C, Nye JS, Curtis D (2002b) aph-1 and pen-2 are required for Notch pathway signaling, gamma-secretase cleavage of betaAPP, and presenilin protein accumulation. Dev Cell 3:85-97. Fukumori A, Fluhrer R, Steiner H, Haass C (2010) Three-amino acid spacing of presenilin endoproteolysis suggests a general stepwise cleavage of gamma-secretase-mediated intramembrane proteolysis. J Neurosci 30:7853-7862.   Bibliography  136       Fukumoto H, Cheung BS, Hyman BT, Irizarry MC (2002) Beta-secretase protein and activity are increased in the neocortex in Alzheimer disease. Arch Neurol 59:1381-1389. Fukumoto H, Rosene DL, Moss MB, Raju S, Hyman BT, Irizarry MC (2004) Beta-secretase activity increases with aging in human, monkey, and mouse brain. Am J Pathol 164:719-725. Funamoto S, Morishima-Kawashima M, Tanimura Y, Hirotani N, Saido TC, Ihara Y (2004) Truncated carboxyl-terminal fragments of beta-amyloid precursor protein are processed to amyloid beta-proteins 40 and 42. Biochemistry 43:13532-13540. Galasko D, Chang L, Motter R, Clark CM, Kaye J, Knopman D, Thomas R, Kholodenko D, Schenk D, Lieberburg I, Miller B, Green R, Basherad R, Kertiles L, Boss MA, Seubert P (1998) High cerebrospinal fluid tau and low amyloid beta42 levels in the clinical diagnosis of Alzheimer disease and relation to apolipoprotein E genotype. Arch Neurol 55:937-945. Ge YW, Maloney B, Sambamurti K, Lahiri DK (2004) Functional characterization of the 5' flanking region of the BACE gene: identification of a 91 bp fragment involved in basal level of BACE promoter expression. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 18:1037-1039. Gerrish A, Russo G, Richards A, Moskvina V, Ivanov D, Harold D, Sims R, Abraham R, Hollingworth P, Chapman J, Hamshere M, Pahwa JS, Dowzell K, Williams A, Jones N, Thomas C, Stretton A, Morgan AR, Lovestone S, Powell J, Proitsi P, Lupton MK, Brayne C, Rubinsztein DC, Gill M, Lawlor B, Lynch A, Morgan K, Brown KS, Passmore PA, Craig D, McGuinness B, Todd S, Johnston JA, Holmes C, Mann D, Smith AD, Love S, Kehoe PG, Hardy J, Mead S, Fox N, Rossor M, Collinge J, Maier W, Jessen F, Kolsch H, Heun R, Schurmann B, van den Bussche H, Heuser I, Kornhuber J, Wiltfang J, Dichgans M, Frolich L, Hampel H, Hull M, Rujescu D, Goate AM, Kauwe JS, Cruchaga C, Nowotny P, Morris JC, Mayo K, Livingston G, Bass NJ, Gurling H, McQuillin A, Gwilliam R, Deloukas P, Davies G, Harris SE, Starr JM, Deary IJ, Al-Chalabi A, Shaw CE, Tsolaki M, Singleton AB, Guerreiro R, Muhleisen TW, Nothen MM, Moebus S, Jockel KH, Klopp N, Wichmann HE, Carrasquillo MM, Pankratz VS, Younkin SG, Jones L, Holmans PA, O'Donovan MC, Owen MJ, Williams J (2012) The role of variation at AbetaPP, PSEN1, PSEN2, and MAPT in late onset Alzheimer's disease. J Alzheimers Dis 28:377-387. Ghiso J, Rostagno A, Gardella JE, Liem L, Gorevic PD, Frangione B (1992) A 109-amino-acid C-terminal fragment of Alzheimer's-disease amyloid precursor protein contains a sequence, -RHDS-, that promotes cell adhesion. Biochem J 288 ( Pt 3):1053-1059. Giaccone G, Morbin M, Moda F, Botta M, Mazzoleni G, Uggetti A, Catania M, Moro ML, Redaelli V, Spagnoli A, Rossi RS, Salmona M, Di Fede G, Tagliavini F (2010) Neuropathology of the recessive A673V APP mutation: Alzheimer disease with distinctive features. Acta Neuropathol 120:803-812. Giannakopoulos P, Herrmann FR, Bussiere T, Bouras C, Kovari E, Perl DP, Morrison JH, Gold G, Hof PR (2003) Tangle and neuron numbers, but not amyloid load, predict cognitive status in Alzheimer's disease. Neurology 60:1495-1500. Glabe CG (2008) Structural classification of toxic amyloid oligomers. J Biol Chem 283:29639-29643.   Bibliography  137       Glenner GG, Wong CW (1984a) Alzheimer's disease and Down's syndrome: sharing of a unique cerebrovascular amyloid fibril protein. Biochem Biophys Res Commun 122:1131-1135. Glenner GG, Wong CW (1984b) Alzheimer's disease: initial report of the purification and characterization of a novel cerebrovascular amyloid protein. Biochem Biophys Res Commun 120:885-890. Goate A, Chartier-Harlin MC, Mullan M, Brown J, Crawford F, Fidani L, Giuffra L, Haynes A, Irving N, James L, et al. (1991) Segregation of a missense mutation in the amyloid precursor protein gene with familial Alzheimer's disease. Nature 349:704-706. Goedert M, Wischik CM, Crowther RA, Walker JE, Klug A (1988) Cloning and sequencing of the cDNA encoding a core protein of the paired helical filament of Alzheimer disease: identification as the microtubule-associated protein tau. Proceedings of the National Academy of Sciences of the United States of America 85:4051-4055. Goldgaber D, Lerman MI, McBride OW, Saffiotti U, Gajdusek DC (1987) Characterization and chromosomal localization of a cDNA encoding brain amyloid of Alzheimer's disease. Science 235:877-880. Gomez-Isla T, Hollister R, West H, Mui S, Growdon JH, Petersen RC, Parisi JE, Hyman BT (1997) Neuronal loss correlates with but exceeds neurofibrillary tangles in Alzheimer's disease. Ann Neurol 41:17-24. Goutte C, Tsunozaki M, Hale VA, Priess JR (2002a) APH-1 is a multipass membrane protein essential for the Notch signaling pathway in Caenorhabditis elegans embryos. Proc Natl Acad Sci U S A 99:775-779. Goutte C, Tsunozaki M, Hale VA, Priess JR (2002b) APH-1 is a multipass membrane protein essential for the Notch signaling pathway in Caenorhabditis elegans embryos. Proc Natl Acad Sci U S A 99:775-779. Grabowski TJ, Cho HS, Vonsattel JP, Rebeck GW, Greenberg SM (2001) Novel amyloid precursor protein mutation in an Iowa family with dementia and severe cerebral amyloid angiopathy. Ann Neurol 49:697-705. Grundke-Iqbal I, Iqbal K, Quinlan M, Tung YC, Zaidi MS, Wisniewski HM (1986) Microtubule-associated protein tau. A component of Alzheimer paired helical filaments. J Biol Chem 261:6084-6089. Guerreiro R, Wojtas A, Bras J, Carrasquillo M, Rogaeva E, Majounie E, Cruchaga C, Sassi C, Kauwe JS, Younkin S, Hazrati L, Collinge J, Pocock J, Lashley T, Williams J, Lambert JC, Amouyel P, Goate A, Rademakers R, Morgan K, Powell J, St George-Hyslop P, Singleton A, Hardy J, Alzheimer Genetic Analysis G (2013) TREM2 variants in Alzheimer's disease. N Engl J Med 368:117-127. Guo J, Wei J, Liao S, Wang L, Jiang H, Tang B (2010a) A novel presenilin 1 mutation (Ser169del) in a Chinese family with early-onset Alzheimer's disease. Neurosci Lett 468:34-37. Guo J, Wei J, Liao S, Wang L, Jiang H, Tang B (2010b) A novel presenilin 1 mutation (Ser169del) in a Chinese family with early-onset Alzheimer's disease. Neurosci Lett 468:34-37.   Bibliography  138       Guyant-Marechal L, Rovelet-Lecrux A, Goumidi L, Cousin E, Hannequin D, Raux G, Penet C, Ricard S, Mace S, Amouyel P, Deleuze JF, Frebourg T, Brice A, Lambert JC, Campion D (2007) Variations in the APP gene promoter region and risk of Alzheimer disease. Neurology 68:684-687. Haapasalo A, Kovacs DM (2011) The many substrates of presenilin/gamma-secretase. J Alzheimers Dis 25:3-28. Haass C, Lemere CA, Capell A, Citron M, Seubert P, Schenk D, Lannfelt L, Selkoe DJ (1995) The Swedish mutation causes early-onset Alzheimer's disease by beta-secretase cleavage within the secretory pathway. Nat Med 1:1291-1296. Haass C, Schlossmacher MG, Hung AY, Vigo-Pelfrey C, Mellon A, Ostaszewski BL, Lieberburg I, Koo EH, Schenk D, Teplow DB, et al. (1992) Amyloid beta-peptide is produced by cultured cells during normal metabolism. Nature 359:322-325. Haass C, Selkoe DJ (2007) Soluble protein oligomers in neurodegeneration: lessons from the Alzheimer's amyloid beta-peptide. Nature reviews Molecular cell biology 8:101-112. Haniu M, Denis P, Young Y, Mendiaz EA, Fuller J, Hui JO, Bennett BD, Kahn S, Ross S, Burgess T, Katta V, Rogers G, Vassar R, Citron M (2000) Characterization of Alzheimer's beta -secretase protein BACE. A pepsin family member with unusual properties. J Biol Chem 275:21099-21106. Hardy J (1992) Framing beta-amyloid. Nat Genet 1:233-234. Hardy J, Duff K, Hardy KG, Perez-Tur J, Hutton M (1998) Genetic dissection of Alzheimer's disease and related dementias: amyloid and its relationship to tau. Nat Neurosci 1:355-358. Hardy J, Selkoe DJ (2002) The amyloid hypothesis of Alzheimer's disease: progress and problems on the road to therapeutics. Science 297:353-356. Harold D, Abraham R, Hollingworth P, Sims R, Gerrish A, Hamshere ML, Pahwa JS, Moskvina V, Dowzell K, Williams A, Jones N, Thomas C, Stretton A, Morgan AR, Lovestone S, Powell J, Proitsi P, Lupton MK, Brayne C, Rubinsztein DC, Gill M, Lawlor B, Lynch A, Morgan K, Brown KS, Passmore PA, Craig D, McGuinness B, Todd S, Holmes C, Mann D, Smith AD, Love S, Kehoe PG, Hardy J, Mead S, Fox N, Rossor M, Collinge J, Maier W, Jessen F, Schurmann B, van den Bussche H, Heuser I, Kornhuber J, Wiltfang J, Dichgans M, Frolich L, Hampel H, Hull M, Rujescu D, Goate AM, Kauwe JS, Cruchaga C, Nowotny P, Morris JC, Mayo K, Sleegers K, Bettens K, Engelborghs S, De Deyn PP, Van Broeckhoven C, Livingston G, Bass NJ, Gurling H, McQuillin A, Gwilliam R, Deloukas P, Al-Chalabi A, Shaw CE, Tsolaki M, Singleton AB, Guerreiro R, Muhleisen TW, Nothen MM, Moebus S, Jockel KH, Klopp N, Wichmann HE, Carrasquillo MM, Pankratz VS, Younkin SG, Holmans PA, O'Donovan M, Owen MJ, Williams J (2009) Genome-wide association study identifies variants at CLU and PICALM associated with Alzheimer's disease. Nat Genet 41:1088-1093. He G, Luo W, Li P, Remmers C, Netzer WJ, Hendrick J, Bettayeb K, Flajolet M, Gorelick F, Wennogle LP, Greengard P (2010) Gamma-secretase activating protein is a therapeutic target for Alzheimer's disease. Nature 467:95-98. Hendriks L, van Duijn CM, Cras P, Cruts M, Van Hul W, van Harskamp F, Warren A, McInnis MG, Antonarakis SE, Martin JJ, et al. (1992) Presenile dementia and cerebral haemorrhage linked to a mutation at codon 692 of the beta-amyloid precursor protein gene. Nat Genet 1:218-221.   Bibliography  139       Hepler RW, Grimm KM, Nahas DD, Breese R, Dodson EC, Acton P, Keller PM, Yeager M, Wang H, Shughrue P, Kinney G, Joyce JG (2006) Solution state characterization of amyloid beta-derived diffusible ligands. Biochemistry 45:15157-15167. Herms J, Anliker B, Heber S, Ring S, Fuhrmann M, Kretzschmar H, Sisodia S, Muller U (2004) Cortical dysplasia resembling human type 2 lissencephaly in mice lacking all three APP family members. Embo J 23:4106-4115. Herreman A, Hartmann D, Annaert W, Saftig P, Craessaerts K, Serneels L, Umans L, Schrijvers V, Checler F, Vanderstichele H, Baekelandt V, Dressel R, Cupers P, Huylebroeck D, Zwijsen A, Van Leuven F, De Strooper B (1999) Presenilin 2 deficiency causes a mild pulmonary phenotype and no changes in amyloid precursor protein processing but enhances the embryonic lethal phenotype of presenilin 1 deficiency. Proc Natl Acad Sci U S A 96:11872-11877. Herreman A, Serneels L, Annaert W, Collen D, Schoonjans L, De Strooper B (2000) Total inactivation of gamma-secretase activity in presenilin-deficient embryonic stem cells. Nature cell biology 2:461-462. Higaki J, Quon D, Zhong Z, Cordell B (1995) Inhibition of beta-amyloid formation identifies proteolytic precursors and subcellular site of catabolism. Neuron 14:651-659. Holcomb L, Gordon MN, McGowan E, Yu X, Benkovic S, Jantzen P, Wright K, Saad I, Mueller R, Morgan D, Sanders S, Zehr C, O'Campo K, Hardy J, Prada CM, Eckman C, Younkin S, Hsiao K, Duff K (1998) Accelerated Alzheimer-type phenotype in transgenic mice carrying both mutant amyloid precursor protein and presenilin 1 transgenes. Nat Med 4:97-100. Hollingworth P, Harold D, Sims R, Gerrish A, Lambert JC, Carrasquillo MM, Abraham R, Hamshere ML, Pahwa JS, Moskvina V, Dowzell K, Jones N, Stretton A, Thomas C, Richards A, Ivanov D, Widdowson C, Chapman J, Lovestone S, Powell J, Proitsi P, Lupton MK, Brayne C, Rubinsztein DC, Gill M, Lawlor B, Lynch A, Brown KS, Passmore PA, Craig D, McGuinness B, Todd S, Holmes C, Mann D, Smith AD, Beaumont H, Warden D, Wilcock G, Love S, Kehoe PG, Hooper NM, Vardy ER, Hardy J, Mead S, Fox NC, Rossor M, Collinge J, Maier W, Jessen F, Ruther E, Schurmann B, Heun R, Kolsch H, van den Bussche H, Heuser I, Kornhuber J, Wiltfang J, Dichgans M, Frolich L, Hampel H, Gallacher J, Hull M, Rujescu D, Giegling I, Goate AM, Kauwe JS, Cruchaga C, Nowotny P, Morris JC, Mayo K, Sleegers K, Bettens K, Engelborghs S, De Deyn PP, Van Broeckhoven C, Livingston G, Bass NJ, Gurling H, McQuillin A, Gwilliam R, Deloukas P, Al-Chalabi A, Shaw CE, Tsolaki M, Singleton AB, Guerreiro R, Muhleisen TW, Nothen MM, Moebus S, Jockel KH, Klopp N, Wichmann HE, Pankratz VS, Sando SB, Aasly JO, Barcikowska M, Wszolek ZK, Dickson DW, Graff-Radford NR, Petersen RC, Alzheimer's Disease Neuroimaging I, van Duijn CM, Breteler MM, Ikram MA, DeStefano AL, Fitzpatrick AL, Lopez O, Launer LJ, Seshadri S, consortium C, Berr C, Campion D, Epelbaum J, Dartigues JF, Tzourio C, Alperovitch A, Lathrop M, consortium E, Feulner TM, Friedrich P, Riehle C, Krawczak M, Schreiber S, Mayhaus M, Nicolhaus S, Wagenpfeil S, Steinberg S, Stefansson H, Stefansson K, Snaedal J, Bjornsson S, Jonsson PV, Chouraki V, Genier-Boley B, Hiltunen M, Soininen H, Combarros O, Zelenika D, Delepine M, Bullido MJ, Pasquier F, Mateo I, Frank-Garcia A, Porcellini E, Hanon O, Coto E, Alvarez V, Bosco P, Siciliano G, Mancuso M, Panza F, Solfrizzi V, Nacmias B, Sorbi S, Bossu P, Piccardi P, Arosio B, Annoni G, Seripa D, Pilotto A, Scarpini E, Galimberti D, Brice A, Hannequin D, Licastro F, Jones L, Holmans PA, Jonsson T, Riemenschneider M, Morgan K, Younkin SG, Owen MJ, O'Donovan M, Amouyel P, Williams J (2011) Common variants at ABCA7, MS4A6A/MS4A4E, EPHA1, CD33 and CD2AP are associated with Alzheimer's disease. Nat Genet 43:429-435.   Bibliography  140       Holmes C, Boche D, Wilkinson D, Yadegarfar G, Hopkins V, Bayer A, Jones RW, Bullock R, Love S, Neal JW, Zotova E, Nicoll JA (2008) Long-term effects of Abeta42 immunisation in Alzheimer's disease: follow-up of a randomised, placebo-controlled phase I trial. Lancet 372:216-223. Holsinger RM, McLean CA, Beyreuther K, Masters CL, Evin G (2002) Increased expression of the amyloid precursor beta-secretase in Alzheimer's disease. Ann Neurol 51:783-786. Hoshi M, Sato M, Matsumoto S, Noguchi A, Yasutake K, Yoshida N, Sato K (2003) Spherical aggregates of beta-amyloid (amylospheroid) show high neurotoxicity and activate tau protein kinase I/glycogen synthase kinase-3beta. Proc Natl Acad Sci U S A 100:6370-6375. Houlden H, Baker M, Morris HR, MacDonald N, Pickering-Brown S, Adamson J, Lees AJ, Rossor MN, Quinn NP, Kertesz A, Khan MN, Hardy J, Lantos PL, St George-Hyslop P, Munoz DG, Mann D, Lang AE, Bergeron C, Bigio EH, Litvan I, Bhatia KP, Dickson D, Wood NW, Hutton M (2001a) Corticobasal degeneration and progressive supranuclear palsy share a common tau haplotype. Neurology 56:1702-1706. Houlden H, Crook R, Dolan RJ, McLaughlin J, Revesz T, Hardy J (2001b) A novel presenilin mutation (M233V) causing very early onset Alzheimer's disease with Lewy bodies. Neurosci Lett 313:93-95. Hsia AY, Masliah E, McConlogue L, Yu GQ, Tatsuno G, Hu K, Kholodenko D, Malenka RC, Nicoll RA, Mucke L (1999) Plaque-independent disruption of neural circuits in Alzheimer's disease mouse models. Proceedings of the National Academy of Sciences of the United States of America 96:3228-3233. Hu X, He W, Diaconu C, Tang X, Kidd GJ, Macklin WB, Trapp BD, Yan R (2008) Genetic deletion of BACE1 in mice affects remyelination of sciatic nerves. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 22:2970-2980. Hung AY, Koo EH, Haass C, Selkoe DJ (1992) Increased expression of beta-amyloid precursor protein during neuronal differentiation is not accompanied by secretory cleavage. Proceedings of the National Academy of Sciences of the United States of America 89:9439-9443. Hung AY, Selkoe DJ (1994) Selective ectodomain phosphorylation and regulated cleavage of beta-amyloid precursor protein. Embo J 13:534-542. Huse JT, Doms RW (2000) Closing in on the amyloid cascade: recent insights into the cell biology of Alzheimer's disease. Mol Neurobiol 22:81-98. Hussain I, Powell D, Howlett DR, Tew DG, Meek TD, Chapman C, Gloger IS, Murphy KE, Southan CD, Ryan DM, Smith TS, Simmons DL, Walsh FS, Dingwall C, Christie G (1999) Identification of a novel aspartic protease (Asp 2) as beta-secretase. Mol Cell Neurosci 14:419-427. Hutton M, Lendon CL, Rizzu P, Baker M, Froelich S, Houlden H, Pickering-Brown S, Chakraverty S, Isaacs A, Grover A, Hackett J, Adamson J, Lincoln S, Dickson D, Davies P, Petersen RC, Stevens M, de Graaff E, Wauters E, van Baren J, Hillebrand M, Joosse M, Kwon JM, Nowotny P, Che LK, Norton J, Morris JC, Reed LA, Trojanowski J, Basun H, Lannfelt L, Neystat M, Fahn S, Dark F, Tannenberg T, Dodd PR, Hayward N, Kwok JB, Schofield PR, Andreadis A, Snowden J, Craufurd D, Neary D, Owen F, Oostra BA, Hardy J, Goate A, van   Bibliography  141       Swieten J, Mann D, Lynch T, Heutink P (1998) Association of missense and 5'-splice-site mutations in tau with the inherited dementia FTDP-17. Nature 393:702-705. International WHOaAsD (2012) Dementia: a public health priority. Iqbal K, Grundke-Iqbal I, Smith AJ, George L, Tung YC, Zaidi T (1989) Identification and localization of a tau peptide to paired helical filaments of Alzheimer disease. Proceedings of the National Academy of Sciences of the United States of America 86:5646-5650. Ittner LM, Gotz J (2011) Amyloid-beta and tau--a toxic pas de deux in Alzheimer's disease. Nature reviews Neuroscience 12:65-72. Iwatsubo T, Odaka A, Suzuki N, Mizusawa H, Nukina N, Ihara Y (1994) Visualization of A beta 42(43) and A beta 40 in senile plaques with end-specific A beta monoclonals: evidence that an initially deposited species is A beta 42(43). Neuron 13:45-53. Jack CR, Jr., Knopman DS, Jagust WJ, Shaw LM, Aisen PS, Weiner MW, Petersen RC, Trojanowski JQ (2010) Hypothetical model of dynamic biomarkers of the Alzheimer's pathological cascade. Lancet Neurol 9:119-128. Jacobsen H, Reinhardt D, Brockhaus M, Bur D, Kocyba C, Kurt H, Grim MG, Baumeister R, Loetscher H (1999) The influence of endoproteolytic processing of familial Alzheimer's disease presenilin 2 on abeta42 amyloid peptide formation. J Biol Chem 274:35233-35239. Jager S, Leuchtenberger S, Martin A, Czirr E, Wesselowski J, Dieckmann M, Waldron E, Korth C, Koo EH, Heneka M, Weggen S, Pietrzik CU (2009) alpha-secretase mediated conversion of the amyloid precursor protein derived membrane stub C99 to C83 limits Abeta generation. J Neurochem 111:1369-1382. Jang C, Choi JK, Na YJ, Jang B, Wasco W, Buxbaum JD, Kim YS, Choi EK (2011) Calsenilin regulates presenilin 1/gamma-secretase-mediated N-cadherin epsilon-cleavage and beta-catenin signaling. Faseb J 25:4174-4183. Jankowsky JL, Fadale DJ, Anderson J, Xu GM, Gonzales V, Jenkins NA, Copeland NG, Lee MK, Younkin LH, Wagner SL, Younkin SG, Borchelt DR (2004a) Mutant presenilins specifically elevate the levels of the 42 residue beta-amyloid peptide in vivo: evidence for augmentation of a 42-specific gamma secretase. Hum Mol Genet 13:159-170. Jankowsky JL, Fadale DJ, Anderson J, Xu GM, Gonzales V, Jenkins NA, Copeland NG, Lee MK, Younkin LH, Wagner SL, Younkin SG, Borchelt DR (2004b) Mutant presenilins specifically elevate the levels of the 42 residue beta-amyloid peptide in vivo: evidence for augmentation of a 42-specific gamma secretase. Hum Mol Genet 13:159-170. Jonsson T, Atwal JK, Steinberg S, Snaedal J, Jonsson PV, Bjornsson S, Stefansson H, Sulem P, Gudbjartsson D, Maloney J, Hoyte K, Gustafson A, Liu Y, Lu Y, Bhangale T, Graham RR, Huttenlocher J, Bjornsdottir G, Andreassen OA, Jonsson EG, Palotie A, Behrens TW, Magnusson OT, Kong A, Thorsteinsdottir U, Watts RJ, Stefansson K (2012) A mutation in APP protects against Alzheimer's disease and age-related cognitive decline. Nature 488:96-99. Jonsson T, Stefansson H, Steinberg S, Jonsdottir I, Jonsson PV, Snaedal J, Bjornsson S, Huttenlocher J, Levey AI, Lah JJ, Rujescu D, Hampel H, Giegling I, Andreassen OA, Engedal K, Ulstein I, Djurovic S, Ibrahim-Verbaas C, Hofman A, Ikram MA, van Duijn CM, Thorsteinsdottir   Bibliography  142       U, Kong A, Stefansson K (2013) Variant of TREM2 associated with the risk of Alzheimer's disease. N Engl J Med 368:107-116. Kaether C, Capell A, Edbauer D, Winkler E, Novak B, Steiner H, Haass C (2004) The presenilin C-terminus is required for ER-retention, nicastrin-binding and gamma-secretase activity. Embo J 23:4738-4748. Kakuda N, Funamoto S, Yagishita S, Takami M, Osawa S, Dohmae N, Ihara Y (2006) Equimolar production of amyloid beta-protein and amyloid precursor protein intracellular domain from beta-carboxyl-terminal fragment by gamma-secretase. J Biol Chem 281:14776-14786. Kamenetz F, Tomita T, Hsieh H, Seabrook G, Borchelt D, Iwatsubo T, Sisodia S, Malinow R (2003) APP processing and synaptic function. Neuron 37:925-937. Kang J, Lemaire HG, Unterbeck A, Salbaum JM, Masters CL, Grzeschik KH, Multhaup G, Beyreuther K, Muller-Hill B (1987) The precursor of Alzheimer's disease amyloid A4 protein resembles a cell-surface receptor. Nature 325:733-736. Karlstrom H, Brooks WS, Kwok JB, Broe GA, Kril JJ, McCann H, Halliday GM, Schofield PR (2008) Variable phenotype of Alzheimer's disease with spastic paraparesis. J Neurochem 104:573-583. Kasri NN, Kocks SL, Verbert L, Hebert SS, Callewaert G, Parys JB, Missiaen L, De Smedt H (2006) Up-regulation of inositol 1,4,5-trisphosphate receptor type 1 is responsible for a decreased endoplasmic-reticulum Ca2+ content in presenilin double knock-out cells. Cell Calcium 40:41-51. Katzman R (1986) Alzheimer's disease. N Engl J Med 314:964-973. Kayed R, Head E, Thompson JL, McIntire TM, Milton SC, Cotman CW, Glabe CG (2003) Common structure of soluble amyloid oligomers implies common mechanism of pathogenesis. Science 300:486-489. Kidd S, Lieber T, Young MW (1998) Ligand-induced cleavage and regulation of nuclear entry of Notch in Drosophila melanogaster embryos. Genes Dev 12:3728-3740. Kim DY, Carey BW, Wang H, Ingano LA, Binshtok AM, Wertz MH, Pettingell WH, He P, Lee VM, Woolf CJ, Kovacs DM (2007) BACE1 regulates voltage-gated sodium channels and neuronal activity. Nature cell biology 9:755-764. Kim DY, Ingano LA, Kovacs DM (2002) Nectin-1alpha, an immunoglobulin-like receptor involved in the formation of synapses, is a substrate for presenilin/gamma-secretase-like cleavage. J Biol Chem 277:49976-49981. Kim SH, Lah JJ, Thinakaran G, Levey A, Sisodia SS (2000) Subcellular localization of presenilins: association with a unique membrane pool in cultured cells. Neurobiol Dis 7:99-117. Kimberly WT, LaVoie MJ, Ostaszewski BL, Ye W, Wolfe MS, Selkoe DJ (2003a) Gamma-secretase is a membrane protein complex comprised of presenilin, nicastrin, Aph-1, and Pen-2. Proc Natl Acad Sci U S A 100:6382-6387.   Bibliography  143       Kimberly WT, LaVoie MJ, Ostaszewski BL, Ye W, Wolfe MS, Selkoe DJ (2003b) Gamma-secretase is a membrane protein complex comprised of presenilin, nicastrin, Aph-1, and Pen-2. Proc Natl Acad Sci U S A 100:6382-6387. Kitaguchi N, Takahashi Y, Tokushima Y, Shiojiri S, Ito H (1988) Novel precursor of Alzheimer's disease amyloid protein shows protease inhibitory activity. Nature 331:530-532. Knappenberger KS, Tian G, Ye X, Sobotka-Briner C, Ghanekar SV, Greenberg BD, Scott CW (2004) Mechanism of gamma-secretase cleavage activation: is gamma-secretase regulated through autoinhibition involving the presenilin-1 exon 9 loop? Biochemistry 43:6208-6218. Konig G, Monning U, Czech C, Prior R, Banati R, Schreiter-Gasser U, Bauer J, Masters CL, Beyreuther K (1992) Identification and differential expression of a novel alternative splice isoform of the beta A4 amyloid precursor protein (APP) mRNA in leukocytes and brain microglial cells. J Biol Chem 267:10804-10809. Koo EH, Squazzo SL (1994) Evidence that production and release of amyloid beta-protein involves the endocytic pathway. J Biol Chem 269:17386-17389. Kopan R, Schroeter EH, Weintraub H, Nye JS (1996) Signal transduction by activated mNotch: importance of proteolytic processing and its regulation by the extracellular domain. Proc Natl Acad Sci U S A 93:1683--1688. Kosik KS, Joachim CL, Selkoe DJ (1986) Microtubule-associated protein tau (tau) is a major antigenic component of paired helical filaments in Alzheimer disease. Proceedings of the National Academy of Sciences of the United States of America 83:4044-4048. Kuhn PH, Marjaux E, Imhof A, De Strooper B, Haass C, Lichtenthaler SF (2007) Regulated intramembrane proteolysis of the interleukin-1 receptor II by alpha-, beta-, and gamma-secretase. J Biol Chem 282:11982-11995. Kwak YD, Brannen CL, Qu T, Kim HM, Dong X, Soba P, Majumdar A, Kaplan A, Beyreuther K, Sugaya K (2006) Amyloid precursor protein regulates differentiation of human neural stem cells. Stem Cells Dev 15:381-389. Kwok JB, Taddei K, Hallupp M, Fisher C, Brooks WS, Broe GA, Hardy J, Fulham MJ, Nicholson GA, Stell R, St George Hyslop PH, Fraser PE, Kakulas B, Clarnette R, Relkin N, Gandy SE, Schofield PR, Martins RN (1997) Two novel (M233T and R278T) presenilin-1 mutations in early-onset Alzheimer's disease pedigrees and preliminary evidence for association of presenilin-1 mutations with a novel phenotype. Neuroreport 8:1537-1542. LaFerla FM, Green KN, Oddo S (2007) Intracellular amyloid-beta in Alzheimer's disease. Nature reviews Neuroscience 8:499-509. Lamb BT, Bardel KA, Kulnane LS, Anderson JJ, Holtz G, Wagner SL, Sisodia SS, Hoeger EJ (1999) Amyloid production and deposition in mutant amyloid precursor protein and presenilin-1 yeast artificial chromosome transgenic mice. Nat Neurosci 2:695-697. Lambert JC, Heath S, Even G, Campion D, Sleegers K, Hiltunen M, Combarros O, Zelenika D, Bullido MJ, Tavernier B, Letenneur L, Bettens K, Berr C, Pasquier F, Fievet N, Barberger-Gateau P, Engelborghs S, De Deyn P, Mateo I, Franck A, Helisalmi S, Porcellini E, Hanon O, European Alzheimer's Disease Initiative I, de Pancorbo MM, Lendon C, Dufouil C, Jaillard C, Leveillard T,   Bibliography  144       Alvarez V, Bosco P, Mancuso M, Panza F, Nacmias B, Bossu P, Piccardi P, Annoni G, Seripa D, Galimberti D, Hannequin D, Licastro F, Soininen H, Ritchie K, Blanche H, Dartigues JF, Tzourio C, Gut I, Van Broeckhoven C, Alperovitch A, Lathrop M, Amouyel P (2009) Genome-wide association study identifies variants at CLU and CR1 associated with Alzheimer's disease. Nat Genet 41:1094-1099. Lambert MP, Barlow AK, Chromy BA, Edwards C, Freed R, Liosatos M, Morgan TE, Rozovsky I, Trommer B, Viola KL, Wals P, Zhang C, Finch CE, Krafft GA, Klein WL (1998) Diffusible, nonfibrillar ligands derived from Abeta1-42 are potent central nervous system neurotoxins. Proc Natl Acad Sci U S A 95:6448-6453. Lammich S, Okochi M, Takeda M, Kaether C, Capell A, Zimmer AK, Edbauer D, Walter J, Steiner H, Haass C (2002) Presenilin-dependent intramembrane proteolysis of CD44 leads to the liberation of its intracellular domain and the secretion of an Abeta-like peptide. J Biol Chem 277:44754-44759. Lanz TA, Karmilowicz MJ, Wood KM, Pozdnyakov N, Du P, Piotrowski MA, Brown TM, Nolan CE, Richter KE, Finley JE, Fei Q, Ebbinghaus CF, Chen YL, Spracklin DK, Tate B, Geoghegan KF, Lau LF, Auperin DD, Schachter JB (2006) Concentration-dependent modulation of amyloid-beta in vivo and in vitro using the gamma-secretase inhibitor, LY-450139. The Journal of pharmacology and experimental therapeutics 319:924-933. Lasagna-Reeves CA, Glabe CG, Kayed R (2011) Amyloid-beta annular protofibrils evade fibrillar fate in Alzheimer disease brain. J Biol Chem 286:22122-22130. Laudon H, Hansson EM, Melen K, Bergman A, Farmery MR, Winblad B, Lendahl U, von Heijne G, Naslund J (2005) A nine-transmembrane domain topology for presenilin 1. J Biol Chem 280:35352-35360. Lazarov O, Morfini GA, Lee EB, Farah MH, Szodorai A, DeBoer SR, Koliatsos VE, Kins S, Lee VM, Wong PC, Price DL, Brady ST, Sisodia SS (2005) Axonal transport, amyloid precursor protein, kinesin-1, and the processing apparatus: revisited. J Neurosci 25:2386-2395. Lazarov VK, Fraering PC, Ye W, Wolfe MS, Selkoe DJ, Li H (2006) Electron microscopic structure of purified, active gamma-secretase reveals an aqueous intramembrane chamber and two pores. Proceedings of the National Academy of Sciences of the United States of America 103:6889-6894. Lee JH, Yu WH, Kumar A, Lee S, Mohan PS, Peterhoff CM, Wolfe DM, Martinez-Vicente M, Massey AC, Sovak G, Uchiyama Y, Westaway D, Cuervo AM, Nixon RA (2010) Lysosomal proteolysis and autophagy require presenilin 1 and are disrupted by Alzheimer-related PS1 mutations. Cell 141:1146-1158. Lee MK, Slunt HH, Martin LJ, Thinakaran G, Kim G, Gandy SE, Seeger M, Koo E, Price DL, Sisodia SS (1996) Expression of presenilin 1 and 2 (PS1 and PS2) in human and murine tissues. J Neurosci 16:7513-7525. Lesne S, Koh MT, Kotilinek L, Kayed R, Glabe CG, Yang A, Gallagher M, Ashe KH (2006) A specific amyloid-beta protein assembly in the brain impairs memory. Nature 440:352-357. Levitan D, Greenwald I (1995) Facilitation of lin-12-mediated signalling by sel-12, a Caenorhabditis elegans S182 Alzheimer's disease gene. Nature 377:351-354.   Bibliography  145       Levy-Lahad E, Wasco W, Poorkaj P, Romano DM, Oshima J, Pettingell WH, Yu CE, Jondro PD, Schmidt SD, Wang K, et al. (1995a) Candidate gene for the chromosome 1 familial Alzheimer's disease locus. Science 269:973-977. Levy-Lahad E, Wijsman EM, Nemens E, Anderson L, Goddard KA, Weber JL, Bird TD, Schellenberg GD (1995b) A familial Alzheimer's disease locus on chromosome 1. Science 269:970-973. Lewis J, Dickson DW, Lin WL, Chisholm L, Corral A, Jones G, Yen SH, Sahara N, Skipper L, Yager D, Eckman C, Hardy J, Hutton M, McGowan E (2001) Enhanced neurofibrillary degeneration in transgenic mice expressing mutant tau and APP. Science 293:1487-1491. Li Q, Sudhof TC (2004) Cleavage of amyloid-beta precursor protein and amyloid-beta precursor-like protein by BACE 1. J Biol Chem 279:10542-10550. Li S, Hong S, Shepardson NE, Walsh DM, Shankar GM, Selkoe D (2009) Soluble oligomers of amyloid Beta protein facilitate hippocampal long-term depression by disrupting neuronal glutamate uptake. Neuron 62:788-801. Li X, Dang S, Yan C, Gong X, Wang J, Shi Y (2012) Structure of a presenilin family intramembrane aspartate protease. Nature. Li X, Dang S, Yan C, Gong X, Wang J, Shi Y (2013) Structure of a presenilin family intramembrane aspartate protease. Nature 493:56-61. Li Y, Zhou W, Tong Y, He G, Song W (2006) Control of APP processing and Abeta generation level by BACE1 enzymatic activity and transcription. Faseb J 20:285-292. Li YM, Lai MT, Xu M, Huang Q, DiMuzio-Mower J, Sardana MK, Shi XP, Yin KC, Shafer JA, Gardell SJ (2000) Presenilin 1 is linked with gamma-secretase activity in the detergent solubilized state. Proceedings of the National Academy of Sciences of the United States of America 97:6138-6143. Lichtenthaler SF, Ida N, Multhaup G, Masters CL, Beyreuther K (1997) Mutations in the transmembrane domain of APP altering gamma-secretase specificity. Biochemistry 36:15396-15403. Lichtenthaler SF, Multhaup G, Masters CL, Beyreuther K (1999) A novel substrate for analyzing Alzheimer's disease gamma-secretase. FEBS Lett 453:288-292. Liu Q, Zerbinatti CV, Zhang J, Hoe HS, Wang B, Cole SL, Herz J, Muglia L, Bu G (2007) Amyloid precursor protein regulates brain apolipoprotein E and cholesterol metabolism through lipoprotein receptor LRP1. Neuron 56:66-78. Lo AC, Haass C, Wagner SL, Teplow DB, Sisodia SS (1994) Metabolism of the "Swedish" amyloid precursor protein variant in Madin-Darby canine kidney cells. J Biol Chem 269:30966-30973. London AsDI (2009) World Alzheimer?s Report 2009. London, Alzheimer?s Disease International, 2009.   Bibliography  146       London AsDI (2010) World Alzheimer?s Report 2010: the global economic impact of dementia. London, Alzheimer?s Disease International, 2010. Lopera F, Ardilla A, Martinez A, Madrigal L, Arango-Viana JC, Lemere CA, Arango-Lasprilla JC, Hincapie L, Arcos-Burgos M, Ossa JE, Behrens IM, Norton J, Lendon C, Goate AM, Ruiz-Linares A, Rosselli M, Kosik KS (1997) Clinical features of early-onset Alzheimer disease in a large kindred with an E280A presenilin-1 mutation. Jama 277:793-799. Lue LF, Kuo YM, Roher AE, Brachova L, Shen Y, Sue L, Beach T, Kurth JH, Rydel RE, Rogers J (1999) Soluble amyloid beta peptide concentration as a predictor of synaptic change in Alzheimer's disease. Am J Pathol 155:853-862. Luo L, Tully T, White K (1992) Human amyloid precursor protein ameliorates behavioral deficit of flies deleted for Appl gene. Neuron 9:595-605. Luo WJ, Wang H, Li H, Kim BS, Shah S, Lee HJ, Thinakaran G, Kim TW, Yu G, Xu H (2003) PEN-2 and APH-1 coordinately regulate proteolytic processing of presenilin 1. J Biol Chem 278:7850-7854. Luo Y, Bolon B, Kahn S, Bennett BD, Babu-Khan S, Denis P, Fan W, Kha H, Zhang J, Gong Y, Martin L, Louis JC, Yan Q, Richards WG, Citron M, Vassar R (2001) Mice deficient in BACE1, the Alzheimer's beta-secretase, have normal phenotype and abolished beta-amyloid generation. Nature neuroscience 4:231-232. Ly PT, Cai F, Song W (2011) Detection of neuritic plaques in Alzheimer's disease mouse model. Journal of visualized experiments : JoVE. Marambaud P, Shioi J, Serban G, Georgakopoulos A, Sarner S, Nagy V, Baki L, Wen P, Efthimiopoulos S, Shao Z, Wisniewski T, Robakis NK (2002) A presenilin-1/gamma-secretase cleavage releases the E-cadherin intracellular domain and regulates disassembly of adherens junctions. Embo J 21:1948-1956. Marambaud P, Wen PH, Dutt A, Shioi J, Takashima A, Siman R, Robakis NK (2003) A CBP binding transcriptional repressor produced by the PS1/epsilon-cleavage of N-cadherin is inhibited by PS1 FAD mutations. Cell 114:635-645. Marcinkiewicz M, Seidah NG (2000) Coordinated expression of beta-amyloid precursor protein and the putative beta-secretase BACE and alpha-secretase ADAM10 in mouse and human brain. J Neurochem 75:2133-2143. Mastrangelo P, Mathews PM, Chishti MA, Schmidt SD, Gu Y, Yang J, Mazzella MJ, Coomaraswamy J, Horne P, Strome B, Pelly H, Levesque G, Ebeling C, Jiang Y, Nixon RA, Rozmahel R, Fraser PE, St George-Hyslop P, Carlson GA, Westaway D (2005) Dissociated phenotypes in presenilin transgenic mice define functionally distinct gamma-secretases. Proceedings of the National Academy of Sciences of the United States of America 102:8972-8977. Mattson MP (1997) Cellular actions of beta-amyloid precursor protein and its soluble and fibrillogenic derivatives. Physiol Rev 77:1081-1132. May P, Reddy YK, Herz J (2002) Proteolytic processing of low density lipoprotein receptor-related protein mediates regulated release of its intracellular domain. J Biol Chem 277:18736-18743.   Bibliography  147       McKhann GM, Knopman DS, Chertkow H, Hyman BT, Jack CR, Jr., Kawas CH, Klunk WE, Koroshetz WJ, Manly JJ, Mayeux R, Mohs RC, Morris JC, Rossor MN, Scheltens P, Carrillo MC, Thies B, Weintraub S, Phelps CH (2011) The diagnosis of dementia due to Alzheimer's disease: recommendations from the National Institute on Aging-Alzheimer's Association workgroups on diagnostic guidelines for Alzheimer's disease. Alzheimers Dement 7:263-269. McLean CA, Cherny RA, Fraser FW, Fuller SJ, Smith MJ, Beyreuther K, Bush AI, Masters CL (1999) Soluble pool of Abeta amyloid as a determinant of severity of neurodegeneration in Alzheimer's disease. Ann Neurol 46:860-866. Meredith JE, Jr., Wang Q, Mitchell TJ, Olson RE, Zaczek R, Stern AM, Seiffert D (2002) Gamma-secretase activity is not involved in presenilin-mediated regulation of beta-catenin. Biochem Biophys Res Commun 299:744-750. Meziane H, Dodart JC, Mathis C, Little S, Clemens J, Paul SM, Ungerer A (1998) Memory-enhancing effects of secreted forms of the beta-amyloid precursor protein in normal and amnestic mice. Proceedings of the National Academy of Sciences of the United States of America 95:12683-12688. Morrissette DA, Parachikova A, Green KN, LaFerla FM (2009) Relevance of transgenic mouse models to human Alzheimer disease. J Biol Chem 284:6033-6037. Motter R, Vigo-Pelfrey C, Kholodenko D, Barbour R, Johnson-Wood K, Galasko D, Chang L, Miller B, Clark C, Green R, et al. (1995) Reduction of beta-amyloid peptide42 in the cerebrospinal fluid of patients with Alzheimer's disease. Ann Neurol 38:643-648. Mowrer KR, Wolfe MS (2008) Promotion of BACE1 mRNA alternative splicing reduces amyloid beta-peptide production. J Biol Chem 283:18694-18701. Mucke L, Masliah E, Yu GQ, Mallory M, Rockenstein EM, Tatsuno G, Hu K, Kholodenko D, Johnson-Wood K, McConlogue L (2000) High-level neuronal expression of abeta 1-42 in wild-type human amyloid protein precursor transgenic mice: synaptotoxicity without plaque formation. J Neurosci 20:4050-4058. Mullan M, Crawford F, Axelman K, Houlden H, Lilius L, Winblad B, Lannfelt L (1992a) A pathogenic mutation for probable Alzheimer's disease in the APP gene at the N-terminus of beta-amyloid. Nat Genet 1:345-347. Mullan M, Houlden H, Windelspecht M, Fidani L, Lombardi C, Diaz P, Rossor M, Crook R, Hardy J, Duff K, et al. (1992b) A locus for familial early-onset Alzheimer's disease on the long arm of chromosome 14, proximal to the alpha 1-antichymotrypsin gene. Nat Genet 2:340-342. Murayama M, Tanaka S, Palacino J, Murayama O, Honda T, Sun X, Yasutake K, Nihonmatsu N, Wolozin B, Takashima A (1998) Direct association of presenilin-1 with beta-catenin. FEBS Lett 433:73-77. Naj AC, Jun G, Beecham GW, Wang LS, Vardarajan BN, Buros J, Gallins PJ, Buxbaum JD, Jarvik GP, Crane PK, Larson EB, Bird TD, Boeve BF, Graff-Radford NR, De Jager PL, Evans D, Schneider JA, Carrasquillo MM, Ertekin-Taner N, Younkin SG, Cruchaga C, Kauwe JS, Nowotny P, Kramer P, Hardy J, Huentelman MJ, Myers AJ, Barmada MM, Demirci FY, Baldwin CT, Green RC, Rogaeva E, St George-Hyslop P, Arnold SE, Barber R, Beach T, Bigio EH, Bowen JD, Boxer A, Burke JR, Cairns NJ, Carlson CS, Carney RM, Carroll SL, Chui HC, Clark DG,   Bibliography  148       Corneveaux J, Cotman CW, Cummings JL, DeCarli C, DeKosky ST, Diaz-Arrastia R, Dick M, Dickson DW, Ellis WG, Faber KM, Fallon KB, Farlow MR, Ferris S, Frosch MP, Galasko DR, Ganguli M, Gearing M, Geschwind DH, Ghetti B, Gilbert JR, Gilman S, Giordani B, Glass JD, Growdon JH, Hamilton RL, Harrell LE, Head E, Honig LS, Hulette CM, Hyman BT, Jicha GA, Jin LW, Johnson N, Karlawish J, Karydas A, Kaye JA, Kim R, Koo EH, Kowall NW, Lah JJ, Levey AI, Lieberman AP, Lopez OL, Mack WJ, Marson DC, Martiniuk F, Mash DC, Masliah E, McCormick WC, McCurry SM, McDavid AN, McKee AC, Mesulam M, Miller BL, Miller CA, Miller JW, Parisi JE, Perl DP, Peskind E, Petersen RC, Poon WW, Quinn JF, Rajbhandary RA, Raskind M, Reisberg B, Ringman JM, Roberson ED, Rosenberg RN, Sano M, Schneider LS, Seeley W, Shelanski ML, Slifer MA, Smith CD, Sonnen JA, Spina S, Stern RA, Tanzi RE, Trojanowski JQ, Troncoso JC, Van Deerlin VM, Vinters HV, Vonsattel JP, Weintraub S, Welsh-Bohmer KA, Williamson J, Woltjer RL, Cantwell LB, Dombroski BA, Beekly D, Lunetta KL, Martin ER, Kamboh MI, Saykin AJ, Reiman EM, Bennett DA, Morris JC, Montine TJ, Goate AM, Blacker D, Tsuang DW, Hakonarson H, Kukull WA, Foroud TM, Haines JL, Mayeux R, Pericak-Vance MA, Farrer LA, Schellenberg GD (2011) Common variants at MS4A4/MS4A6E, CD2AP, CD33 and EPHA1 are associated with late-onset Alzheimer's disease. Nat Genet 43:436-441. Naslund J, Haroutunian V, Mohs R, Davis KL, Davies P, Greengard P, Buxbaum JD (2000) Correlation between elevated levels of amyloid beta-peptide in the brain and cognitive decline. Jama 283:1571-1577. Nelson O, Tu H, Lei T, Bentahir M, de Strooper B, Bezprozvanny I (2007) Familial Alzheimer disease-linked mutations specifically disrupt Ca2+ leak function of presenilin 1. J Clin Invest 117:1230-1239. Netzer WJ, Dou F, Cai D, Veach D, Jean S, Li Y, Bornmann WG, Clarkson B, Xu H, Greengard P (2003) Gleevec inhibits beta-amyloid production but not Notch cleavage. Proceedings of the National Academy of Sciences of the United States of America 100:12444-12449. Ni CY, Murphy MP, Golde TE, Carpenter G (2001) gamma -Secretase cleavage and nuclear localization of ErbB-4 receptor tyrosine kinase. Science 294:2179-2181. Nilsson T, Jackson M, Peterson PA (1989) Short cytoplasmic sequences serve as retention signals for transmembrane proteins in the endoplasmic reticulum. Cell 58:707-718. Noguchi A, Matsumura S, Dezawa M, Tada M, Yanazawa M, Ito A, Akioka M, Kikuchi S, Sato M, Ideno S, Noda M, Fukunari A, Muramatsu S, Itokazu Y, Sato K, Takahashi H, Teplow DB, Nabeshima Y, Kakita A, Imahori K, Hoshi M (2009) Isolation and characterization of patient-derived, toxic, high mass amyloid beta-protein (Abeta) assembly from Alzheimer disease brains. J Biol Chem 284:32895-32905. Nyabi O, Bentahir M, Horre K, Herreman A, Gottardi-Littell N, Van Broeckhoven C, Merchiers P, Spittaels K, Annaert W, De Strooper B (2003) Presenilins mutated at Asp-257 or Asp-385 restore Pen-2 expression and Nicastrin glycosylation but remain catalytically inactive in the absence of wild type Presenilin. J Biol Chem 278:43430-43436. Oddo S, Caccamo A, Shepherd JD, Murphy MP, Golde TE, Kayed R, Metherate R, Mattson MP, Akbari Y, LaFerla FM (2003) Triple-transgenic model of Alzheimer's disease with plaques and tangles: intracellular Abeta and synaptic dysfunction. Neuron 39:409-421. Okochi M, Ishii K, Usami M, Sahara N, Kametani F, Tanaka K, Fraser PE, Ikeda M, Saunders AM, Hendriks L, Shoji SI, Nee LE, Martin JJ, Van Broeckhoven C, St George-Hyslop PH, Roses   Bibliography  149       AD, Mori H (1997) Proteolytic processing of presenilin-1 (PS-1) is not associated with Alzheimer's disease with or without PS-1 mutations. FEBS Lett 418:162-166. Okochi M, Steiner H, Fukumori A, Tanii H, Tomita T, Tanaka T, Iwatsubo T, Kudo T, Takeda M, Haass C (2002) Presenilins mediate a dual intramembranous gamma-secretase cleavage of Notch-1. Embo J 21:5408-5416. Olson MI, Shaw CM (1969) Presenile dementia and Alzheimer's disease in mongolism. Brain 92:147-156. Oltersdorf T, Ward PJ, Henriksson T, Beattie EC, Neve R, Lieberburg I, Fritz LC (1990) The Alzheimer amyloid precursor protein. Identification of a stable intermediate in the biosynthetic/degradative pathway. J Biol Chem 265:4492-4497. Osenkowski P, Li H, Ye W, Li D, Aeschbach L, Fraering PC, Wolfe MS, Selkoe DJ (2009) Cryoelectron microscopy structure of purified gamma-secretase at 12 A resolution. J Mol Biol 385:642-652. Paganetti P, Calanca V, Galli C, Stefani M, Molinari M (2005) beta-site specific intrabodies to decrease and prevent generation of Alzheimer's Abeta peptide. J Cell Biol 168:863-868. Palop JJ, Mucke L (2010) Amyloid-beta-induced neuronal dysfunction in Alzheimer's disease: from synapses toward neural networks. Nature neuroscience 13:812-818. Pardossi-Piquard R, Petit A, Kawarai T, Sunyach C, Alves da Costa C, Vincent B, Ring S, D'Adamio L, Shen J, Muller U, St George Hyslop P, Checler F (2005) Presenilin-dependent transcriptional control of the Abeta-degrading enzyme neprilysin by intracellular domains of betaAPP and APLP. Neuron 46:541-554. Parvathy S, Hussain I, Karran EH, Turner AJ, Hooper NM (1999) Cleavage of Alzheimer's amyloid precursor protein by alpha-secretase occurs at the surface of neuronal cells. Biochemistry 38:9728-9734. Pastorino L, Ikin AF, Lamprianou S, Vacaresse N, Revelli JP, Platt K, Paganetti P, Mathews PM, Harroch S, Buxbaum JD (2004) BACE (beta-secretase) modulates the processing of APLP2 in vivo. Mol Cell Neurosci 25:642-649. Peacock ML, Warren JT, Jr., Roses AD, Fink JK (1993) Novel polymorphism in the A4 region of the amyloid precursor protein gene in a patient without Alzheimer's disease. Neurology 43:1254-1256. Peretto I, Radaelli S, Parini C, Zandi M, Raveglia LF, Dondio G, Fontanella L, Misiano P, Bigogno C, Rizzi A, Riccardi B, Biscaioli M, Marchetti S, Puccini P, Catinella S, Rondelli I, Cenacchi V, Bolzoni PT, Caruso P, Villetti G, Facchinetti F, Del Giudice E, Moretto N, Imbimbo BP (2005) Synthesis and biological activity of flurbiprofen analogues as selective inhibitors of beta-amyloid(1)(-)(42) secretion. J Med Chem 48:5705-5720. Pike CJ, Walencewicz AJ, Glabe CG, Cotman CW (1991) In vitro aging of beta-amyloid protein causes peptide aggregation and neurotoxicity. Brain Res 563:311-314.   Bibliography  150       Pitas RE, Boyles JK, Lee SH, Foss D, Mahley RW (1987) Astrocytes synthesize apolipoprotein E and metabolize apolipoprotein E-containing lipoproteins. Biochimica et biophysica acta 917:148-161. Pittman AM, Myers AJ, Abou-Sleiman P, Fung HC, Kaleem M, Marlowe L, Duckworth J, Leung D, Williams D, Kilford L, Thomas N, Morris CM, Dickson D, Wood NW, Hardy J, Lees AJ, de Silva R (2005) Linkage disequilibrium fine mapping and haplotype association analysis of the tau gene in progressive supranuclear palsy and corticobasal degeneration. Journal of medical genetics 42:837-846. Plant LD, Boyle JP, Smith IF, Peers C, Pearson HA (2003) The production of amyloid beta peptide is a critical requirement for the viability of central neurons. J Neurosci 23:5531-5535. Podlisny MB, Citron M, Amarante P, Sherrington R, Xia W, Zhang J, Diehl T, Levesque G, Fraser P, Haass C, Koo EH, Seubert P, St George-Hyslop P, Teplow DB, Selkoe DJ (1997) Presenilin proteins undergo heterogeneous endoproteolysis between Thr291 and Ala299 and occur as stable N- and C-terminal fragments in normal and Alzheimer brain tissue. Neurobiol Dis 3:325-337. Podlisny MB, Lee G, Selkoe DJ (1987) Gene dosage of the amyloid beta precursor protein in Alzheimer's disease. Science 238:669-671. Prasher VP, Farrer MJ, Kessling AM, Fisher EM, West RJ, Barber PC, Butler AC (1998) Molecular mapping of Alzheimer-type dementia in Down's syndrome. Ann Neurol 43:380-383. Pratt KG, Zhu P, Watari H, Cook DG, Sullivan JM (2011) A novel role for {gamma}-secretase: selective regulation of spontaneous neurotransmitter release from hippocampal neurons. J Neurosci 31:899-906. Presente A, Andres A, Nye JS (2001) Requirement of Notch in adulthood for neurological function and longevity. Neuroreport 12:3321-3325. Presente A, Shaw S, Nye JS, Andres AJ (2002) Transgene-mediated RNA interference defines a novel role for notch in chemosensory startle behavior. Genesis 34:165-169. Qi-Takahara Y, Morishima-Kawashima M, Tanimura Y, Dolios G, Hirotani N, Horikoshi Y, Kametani F, Maeda M, Saido TC, Wang R, Ihara Y (2005a) Longer forms of amyloid beta protein: implications for the mechanism of intramembrane cleavage by gamma-secretase. J Neurosci 25:436-445. Qi-Takahara Y, Morishima-Kawashima M, Tanimura Y, Dolios G, Hirotani N, Horikoshi Y, Kametani F, Maeda M, Saido TC, Wang R, Ihara Y (2005b) Longer forms of amyloid beta protein: implications for the mechanism of intramembrane cleavage by gamma-secretase. J Neurosci 25:436-445. Qing H, Zhou W, Christensen MA, Sun X, Tong Y, Song W (2004a) Degradation of BACE by the ubiquitin-proteasome pathway. FASEB J 18:1571-1573. Qing H, Zhou W, Christensen MA, Sun X, Tong Y, Song W (2004b) Degradation of BACE by the ubiquitin-proteasome pathway. Faseb J 18:1571-1573. Quintero-Monzon O, Martin MM, Fernandez MA, Cappello CA, Krzysiak AJ, Osenkowski P, Wolfe MS (2011) Dissociation between the processivity and total activity of gamma-secretase:   Bibliography  151       implications for the mechanism of Alzheimer's disease-causing presenilin mutations. Biochemistry 50:9023-9035. Raux G, Guyant-Marechal L, Martin C, Bou J, Penet C, Brice A, Hannequin D, Frebourg T, Campion D (2005) Molecular diagnosis of autosomal dominant early onset Alzheimer's disease: an update. J Med Genet 42:793-795. Reiman EM, Webster JA, Myers AJ, Hardy J, Dunckley T, Zismann VL, Joshipura KD, Pearson JV, Hu-Lince D, Huentelman MJ, Craig DW, Coon KD, Liang WS, Herbert RH, Beach T, Rohrer KC, Zhao AS, Leung D, Bryden L, Marlowe L, Kaleem M, Mastroeni D, Grover A, Heward CB, Ravid R, Rogers J, Hutton ML, Melquist S, Petersen RC, Alexander GE, Caselli RJ, Kukull W, Papassotiropoulos A, Stephan DA (2007) GAB2 alleles modify Alzheimer's risk in APOE epsilon4 carriers. Neuron 54:713-720. Repetto E, Yoon IS, Zheng H, Kang DE (2007) Presenilin 1 regulates epidermal growth factor receptor turnover and signaling in the endosomal-lysosomal pathway. J Biol Chem 282:31504-31516. Robakis NK, Ramakrishna N, Wolfe G, Wisniewski HM (1987) Molecular cloning and characterization of a cDNA encoding the cerebrovascular and the neuritic plaque amyloid peptides. Proceedings of the National Academy of Sciences of the United States of America 84:4190-4194. Roberds SL, Anderson J, Basi G, Bienkowski MJ, Branstetter DG, Chen KS, Freedman SB, Frigon NL, Games D, Hu K, Johnson-Wood K, Kappenman KE, Kawabe TT, Kola I, Kuehn R, Lee M, Liu W, Motter R, Nichols NF, Power M, Robertson DW, Schenk D, Schoor M, Shopp GM, Shuck ME, Sinha S, Svensson KA, Tatsuno G, Tintrup H, Wijsman J, Wright S, McConlogue L (2001) BACE knockout mice are healthy despite lacking the primary beta-secretase activity in brain: implications for Alzheimer's disease therapeutics. Hum Mol Genet 10:1317-1324. Rogaev EI, Sherrington R, Rogaeva EA, Levesque G, Ikeda M, Liang Y, Chi H, Lin C, Holman K, Tsuda T, et al. (1995) Familial Alzheimer's disease in kindreds with missense mutations in a gene on chromosome 1 related to the Alzheimer's disease type 3 gene. Nature 376:775-778. Rogaeva E, Bergeron C, Sato C, Moliaka I, Kawarai T, Toulina A, Song YQ, Kolesnikova T, Orlacchio A, Bernardi G, St George-Hyslop PH (2003) PS1 Alzheimer's disease family with spastic paraplegia: the search for a gene modifier. Neurology 61:1005-1007. Rogaeva E, Meng Y, Lee JH, Gu Y, Kawarai T, Zou F, Katayama T, Baldwin CT, Cheng R, Hasegawa H, Chen F, Shibata N, Lunetta KL, Pardossi-Piquard R, Bohm C, Wakutani Y, Cupples LA, Cuenco KT, Green RC, Pinessi L, Rainero I, Sorbi S, Bruni A, Duara R, Friedland RP, Inzelberg R, Hampe W, Bujo H, Song YQ, Andersen OM, Willnow TE, Graff-Radford N, Petersen RC, Dickson D, Der SD, Fraser PE, Schmitt-Ulms G, Younkin S, Mayeux R, Farrer LA, St George-Hyslop P (2007) The neuronal sortilin-related receptor SORL1 is genetically associated with Alzheimer disease. Nat Genet 39:168-177. Rogers GW, Jr., Edelman GM, Mauro VP (2004) Differential utilization of upstream AUGs in the beta-secretase mRNA suggests that a shunting mechanism regulates translation. Proceedings of the National Academy of Sciences of the United States of America 101:2794-2799.   Bibliography  152       Roks G, Van Harskamp F, De Koning I, Cruts M, De Jonghe C, Kumar-Singh S, Tibben A, Tanghe H, Niermeijer MF, Hofman A, Van Swieten JC, Van Broeckhoven C, Van Duijn CM (2000) Presentation of amyloidosis in carriers of the codon 692 mutation in the amyloid precursor protein gene (APP692). Brain 123 ( Pt 10):2130-2140. Ross OA, Farrer MJ (2010) Parkinson disease: Parkinson disease-moving beyond association. Nature reviews Neurology 6:305-307. Rossjohn J, Cappai R, Feil SC, Henry A, McKinstry WJ, Galatis D, Hesse L, Multhaup G, Beyreuther K, Masters CL, Parker MW (1999) Crystal structure of the N-terminal, growth factor-like domain of Alzheimer amyloid precursor protein. Nat Struct Biol 6:327-331. Rovelet-Lecrux A, Hannequin D, Raux G, Le Meur N, Laquerriere A, Vital A, Dumanchin C, Feuillette S, Brice A, Vercelletto M, Dubas F, Frebourg T, Campion D (2006a) APP locus duplication causes autosomal dominant early-onset Alzheimer disease with cerebral amyloid angiopathy. Nat Genet 38:24-26. Rovelet-Lecrux A, Hannequin D, Raux G, Le Meur N, Laquerriere A, Vital A, Dumanchin C, Feuillette S, Brice A, Vercelletto M, Dubas F, Frebourg T, Campion D (2006b) APP locus duplication causes autosomal dominant early-onset Alzheimer disease with cerebral amyloid angiopathy. Nat Genet 38:24-26. Russo C, Schettini G, Saido TC, Hulette C, Lippa C, Lannfelt L, Ghetti B, Gambetti P, Tabaton M, Teller JK (2000) Presenilin-1 mutations in Alzheimer's disease. Nature 405:531-532. Saitoh T, Sundsmo M, Roch JM, Kimura N, Cole G, Schubert D, Oltersdorf T, Schenk DB (1989) Secreted form of amyloid beta protein precursor is involved in the growth regulation of fibroblasts. Cell 58:615-622. Salama-Cohen P, Arevalo MA, Grantyn R, Rodriguez-Tebar A (2006) Notch and NGF/p75NTR control dendrite morphology and the balance of excitatory/inhibitory synaptic input to hippocampal neurones through Neurogenin 3. J Neurochem 97:1269-1278. Sandbrink R, Masters CL, Beyreuther K (1994) Beta A4-amyloid protein precursor mRNA isoforms without exon 15 are ubiquitously expressed in rat tissues including brain, but not in neurons. J Biol Chem 269:1510-1517. Sato C, Morohashi Y, Tomita T, Iwatsubo T (2006a) Structure of the catalytic pore of gamma-secretase probed by the accessibility of substituted cysteines. J Neurosci 26:12081-12088. Sato C, Morohashi Y, Tomita T, Iwatsubo T (2006b) Structure of the catalytic pore of gamma-secretase probed by the accessibility of substituted cysteines. J Neurosci 26:12081-12088. Sato C, Takagi S, Tomita T, Iwatsubo T (2008a) The C-terminal PAL motif and transmembrane domain 9 of presenilin 1 are involved in the formation of the catalytic pore of the gamma-secretase. J Neurosci 28:6264-6271. Sato C, Takagi S, Tomita T, Iwatsubo T (2008b) The C-terminal PAL motif and transmembrane domain 9 of presenilin 1 are involved in the formation of the catalytic pore of the gamma-secretase. J Neurosci 28:6264-6271.   Bibliography  153       Sato T, Dohmae N, Qi Y, Kakuda N, Misonou H, Mitsumori R, Maruyama H, Koo EH, Haass C, Takio K, Morishima-Kawashima M, Ishiura S, Ihara Y (2003) Potential link between amyloid beta-protein 42 and C-terminal fragment gamma 49-99 of beta-amyloid precursor protein. J Biol Chem 278:24294-24301. Sato T, Tanimura Y, Hirotani N, Saido TC, Morishima-Kawashima M, Ihara Y (2005) Blocking the cleavage at midportion between gamma- and epsilon-sites remarkably suppresses the generation of amyloid beta-protein. FEBS Lett 579:2907-2912. Sauder JM, Arthur JW, Dunbrack RL, Jr. (2000) Modeling of substrate specificity of the Alzheimer's disease amyloid precursor protein beta-secretase. Journal of molecular biology 300:241-248. Saunders AJ, Kim TW, Tanzi RE (1999) BACE maps to chromosome 11 and a BACE homolog, BACE2, reside in the obligate Down syndrome region of chromosome 21. Science 286: 1255A only, 1999. Science 286:: 1255A only. Saunders AM, Strittmatter WJ, Schmechel D, George-Hyslop PH, Pericak-Vance MA, Joo SH, Rosi BL, Gusella JF, Crapper-MacLachlan DR, Alberts MJ, et al. (1993) Association of apolipoprotein E allele epsilon 4 with late-onset familial and sporadic Alzheimer's disease. Neurology 43:1467-1472. Schellenberg GD, Bird TD, Wijsman EM, Orr HT, Anderson L, Nemens E, White JA, Bonnycastle L, Weber JL, Alonso ME, et al. (1992) Genetic linkage evidence for a familial Alzheimer's disease locus on chromosome 14. Science 258:668-671. Scheuner D, Eckman C, Jensen M, Song X, Citron M, Suzuki N, Bird TD, Hardy J, Hutton M, Kukull W, Larson E, Levy-Lahad E, Viitanen M, Peskind E, Poorkaj P, Schellenberg G, Tanzi R, Wasco W, Lannfelt L, Selkoe D, Younkin S (1996) Secreted amyloid beta-protein similar to that in the senile plaques of Alzheimer's disease is increased in vivo by the presenilin 1 and 2 and APP mutations linked to familial Alzheimer's disease. Nat Med 2:864-870. Schroeter EH, Kisslinger JA, Kopan R (1998) Notch-1 signalling requires ligand-induced proteolytic release of intracellular domain. Nature 393:382-386. Searfoss GH, Jordan WH, Calligaro DO, Galbreath EJ, Schirtzinger LM, Berridge BR, Gao H, Higgins MA, May PC, Ryan TP (2003) Adipsin, a biomarker of gastrointestinal toxicity mediated by a functional gamma-secretase inhibitor. J Biol Chem 278:46107-46116. Seiffert D, Bradley JD, Rominger CM, Rominger DH, Yang F, Meredith JE, Jr., Wang Q, Roach AH, Thompson LA, Spitz SM, Higaki JN, Prakash SR, Combs AP, Copeland RA, Arneric SP, Hartig PR, Robertson DW, Cordell B, Stern AM, Olson RE, Zaczek R (2000) Presenilin-1 and -2 are molecular targets for gamma-secretase inhibitors. J Biol Chem 275:34086-34091. Selkoe DJ (1989) Biochemistry of altered brain proteins in Alzheimer's disease. Annual review of neuroscience 12:463-490. Selkoe DJ (2008) Soluble oligomers of the amyloid beta-protein impair synaptic plasticity and behavior. Behav Brain Res 192:106-113.   Bibliography  154       Selkoe DJ, Yamazaki T, Citron M, Podlisny MB, Koo EH, Teplow DB, Haass C (1996) The role of APP processing and trafficking pathways in the formation of amyloid beta-protein. Ann N Y Acad Sci 777:57-64. Serrano-Pozo A, Frosch MP, Masliah E, Hyman BT (2011) Neuropathological alterations in Alzheimer disease. Cold Spring Harbor perspectives in medicine 1:a006189. Sestan N, Artavanis-Tsakonas S, Rakic P (1999) Contact-dependent inhibition of cortical neurite growth mediated by notch signaling. Science 286:741-746. Shah S, Lee SF, Tabuchi K, Hao YH, Yu C, LaPlant Q, Ball H, Dann CE, 3rd, Sudhof T, Yu G (2005) Nicastrin functions as a gamma-secretase-substrate receptor. Cell 122:435-447. Shankar GM, Bloodgood BL, Townsend M, Walsh DM, Selkoe DJ, Sabatini BL (2007) Natural oligomers of the Alzheimer amyloid-beta protein induce reversible synapse loss by modulating an NMDA-type glutamate receptor-dependent signaling pathway. J Neurosci 27:2866-2875. Shankar GM, Li S, Mehta TH, Garcia-Munoz A, Shepardson NE, Smith I, Brett FM, Farrell MA, Rowan MJ, Lemere CA, Regan CM, Walsh DM, Sabatini BL, Selkoe DJ (2008a) Amyloid-beta protein dimers isolated directly from Alzheimer's brains impair synaptic plasticity and memory. Nat Med 14:837-842. Shankar GM, Li S, Mehta TH, Garcia-Munoz A, Shepardson NE, Smith I, Brett FM, Farrell MA, Rowan MJ, Lemere CA, Regan CM, Walsh DM, Sabatini BL, Selkoe DJ (2008b) Amyloid-beta protein dimers isolated directly from Alzheimer's brains impair synaptic plasticity and memory. Nat Med 14:837-842. Shaw LM, Vanderstichele H, Knapik-Czajka M, Clark CM, Aisen PS, Petersen RC, Blennow K, Soares H, Simon A, Lewczuk P, Dean R, Siemers E, Potter W, Lee VM, Trojanowski JQ, Alzheimer's Disease Neuroimaging I (2009) Cerebrospinal fluid biomarker signature in Alzheimer's disease neuroimaging initiative subjects. Ann Neurol 65:403-413. Shearman MS, Beher D, Clarke EE, Lewis HD, Harrison T, Hunt P, Nadin A, Smith AL, Stevenson G, Castro JL (2000) L-685,458, an aspartyl protease transition state mimic, is a potent inhibitor of amyloid beta-protein precursor gamma-secretase activity. Biochemistry 39:8698-8704. Shen J, Bronson RT, Chen DF, Xia W, Selkoe DJ, Tonegawa S (1997) Skeletal and CNS defects in Presenilin-1-deficient mice. Cell 89:629-639. Shen J, Kelleher RJ, 3rd (2007) The presenilin hypothesis of Alzheimer's disease: evidence for a loss-of-function pathogenic mechanism. Proceedings of the National Academy of Sciences of the United States of America 104:403-409. Sherrington R, Rogaev EI, Liang Y, Rogaeva EA, Levesque G, Ikeda M, Chi H, Lin C, Li G, Holman K, Tsuda T, Mar L, Foncin JF, Bruni AC, Montesi MP, Sorbi S, Rainero I, Pinessi L, Nee L, Chumakov I, Pollen D, Brookes A, Sanseau P, Polinsky RJ, Wasco W, Da Silva HA, Haines JL, Perkicak-Vance MA, Tanzi RE, Roses AD, Fraser PE, Rommens JM, St George-Hyslop PH (1995) Cloning of a gene bearing missense mutations in early-onset familial Alzheimer's disease. Nature 375:754-760. Shirotani K, Edbauer D, Prokop S, Haass C, Steiner H (2004) Identification of distinct gamma-secretase complexes with different APH-1 variants. J Biol Chem 279:41340-41345.   Bibliography  155       Shirotani K, Takahashi K, Ozawa K, Kunishita T, Tabira T (1997) Determination of a cleavage site of presenilin 2 protein in stably transfected SH-SY5Y human neuroblastoma cell lines. Biochem Biophys Res Commun 240:728-731. Shirotani K, Tomioka M, Kremmer E, Haass C, Steiner H (2007) Pathological activity of familial Alzheimer's disease-associated mutant presenilin can be executed by six different gamma-secretase complexes. Neurobiol Dis 27:102-107. Simon-Sanchez J, Schulte C, Bras JM, Sharma M, Gibbs JR, Berg D, Paisan-Ruiz C, Lichtner P, Scholz SW, Hernandez DG, Kruger R, Federoff M, Klein C, Goate A, Perlmutter J, Bonin M, Nalls MA, Illig T, Gieger C, Houlden H, Steffens M, Okun MS, Racette BA, Cookson MR, Foote KD, Fernandez HH, Traynor BJ, Schreiber S, Arepalli S, Zonozi R, Gwinn K, van der Brug M, Lopez G, Chanock SJ, Schatzkin A, Park Y, Hollenbeck A, Gao J, Huang X, Wood NW, Lorenz D, Deuschl G, Chen H, Riess O, Hardy JA, Singleton AB, Gasser T (2009) Genome-wide association study reveals genetic risk underlying Parkinson's disease. Nat Genet 41:1308-1312. Sinha S, Anderson JP, Barbour R, Basi GS, Caccavello R, Davis D, Doan M, Dovey HF, Frigon N, Hong J, Jacobson-Croak K, Jewett N, Keim P, Knops J, Lieberburg I, Power M, Tan H, Tatsuno G, Tung J, Schenk D, Seubert P, Suomensaari SM, Wang S, Walker D, Zhao J, McConlogue L, John V (1999) Purification and cloning of amyloid precursor protein beta-secretase from human brain. Nature 402:537-540. Sisodia SS (1992) Beta-amyloid precursor protein cleavage by a membrane-bound protease. Proc Natl Acad Sci U S A 89:6075-6079. Sisodia SS, Koo EH, Beyreuther K, Unterbeck A, Price DL (1990) Evidence that beta-amyloid protein in Alzheimer's disease is not derived by normal processing. Science 248:492-495. Sleegers K, Brouwers N, Gijselinck I, Theuns J, Goossens D, Wauters J, Del-Favero J, Cruts M, van Duijn CM, Van Broeckhoven C (2006a) APP duplication is sufficient to cause early onset Alzheimer's dementia with cerebral amyloid angiopathy. Brain 129:2977-2983. Sleegers K, Brouwers N, Gijselinck I, Theuns J, Goossens D, Wauters J, Del-Favero J, Cruts M, van Duijn CM, Van Broeckhoven C (2006b) APP duplication is sufficient to cause early onset Alzheimer's dementia with cerebral amyloid angiopathy. Brain 129:2977-2983. Snyder EM, Nong Y, Almeida CG, Paul S, Moran T, Choi EY, Nairn AC, Salter MW, Lombroso PJ, Gouras GK, Greengard P (2005) Regulation of NMDA receptor trafficking by amyloid-beta. Nature neuroscience 8:1051-1058. Sojkova J, Zhou Y, An Y, Kraut MA, Ferrucci L, Wong DF, Resnick SM (2011) Longitudinal patterns of beta-amyloid deposition in nondemented older adults. Arch Neurol 68:644-649. Song W, Lahiri DK (1998a) Functional identification of the promoter of the gene encoding the Rhesus monkey beta-amyloid precursor protein. Gene 217:165-176. Song W, Lahiri DK (1998b) Molecular cloning of the promoter of the gene encoding the Rhesus monkey beta-amyloid precursor protein: structural characterization and a comparative study with other species. Gene 217:151-164. Song W, Nadeau P, Yuan M, Yang X, Shen J, Yankner BA (1999a) Proteolytic release and nuclear translocation of Notch-1 are induced by presenilin-1 and impaired by pathogenic   Bibliography  156       presenilin-1 mutations. Proceedings of the National Academy of Sciences of the United States of America 96:6959-6963. Song W, Nadeau P, Yuan M, Yang X, Shen J, Yankner BA (1999b) Proteolytic release and nuclear translocation of Notch-1 are induced by presenilin-1 and impaired by pathogenic presenilin-1 mutations. Proc Natl Acad Sci U S A 96:6959-6963. Spasic D, Tolia A, Dillen K, Baert V, De Strooper B, Vrijens S, Annaert W (2006) Presenilin-1 maintains a nine-transmembrane topology throughout the secretory pathway. J Biol Chem 281:26569-26577. Sprecher CA, Grant FJ, Grimm G, O'Hara PJ, Norris F, Norris K, Foster DC (1993) Molecular cloning of the cDNA for a human amyloid precursor protein homolog: evidence for a multigene family. Biochemistry 32:4481-4486. St George-Hyslop P, Haines J, Rogaev E, Mortilla M, Vaula G, Pericak-Vance M, Foncin JF, Montesi M, Bruni A, Sorbi S, Rainero I, Pinessi L, Pollen D, Polinsky R, Nee L, Kennedy J, Macciardi F, Rogaeva E, Liang Y, Alexandrova N, Lukiw W, Schlumpf K, Tanzi R, Tsuda T, Farrer L, Cantu JM, Duara R, Amaducci L, Bergamini L, Gusella J, Roses A, Crapper McLachlan D, et al. (1992) Genetic evidence for a novel familial Alzheimer's disease locus on chromosome 14. Nat Genet 2:330-334. St George-Hyslop P, McLachlan DC, Tsuda T, Rogaev E, Karlinsky H, Lippa CF, Pollen D (1994) Alzheimer's disease and possible gene interaction. Science 263:537. Steiner H, Romig H, Grim MG, Philipp U, Pesold B, Citron M, Baumeister R, Haass C (1999) The biological and pathological function of the presenilin-1 Deltaexon 9 mutation is independent of its defect to undergo proteolytic processing. J Biol Chem 274:7615-7618. Steiner H, Winkler E, Haass C (2008) Chemical cross-linking provides a model of the gamma-secretase complex subunit architecture and evidence for close proximity of the C-terminal fragment of presenilin with APH-1. J Biol Chem 283:34677-34686. Stevens T, Livingston G, Kitchen G, Manela M, Walker Z, Katona C (2002) Islington study of dementia subtypes in the community. The British journal of psychiatry : the journal of mental science 180:270-276. Strittmatter WJ, Saunders AM, Schmechel D, Pericak-Vance M, Enghild J, Salvesen GS, Roses AD (1993) Apolipoprotein E: high-avidity binding to beta-amyloid and increased frequency of type 4 allele in late-onset familial Alzheimer disease. Proc Natl Acad Sci U S A 90:1977-1981. Struhl G, Adachi A (2000) Requirements for presenilin-dependent cleavage of notch and other transmembrane proteins. Mol Cell 6:625-636. Struhl G, Fitzgerald K, Greenwald I (1993) Intrinsic activity of the Lin-12 and Notch intracellular domains in vivo. Cell 74:331-345. Sturchler-Pierrat C, Abramowski D, Duke M, Wiederhold KH, Mistl C, Rothacher S, Ledermann B, Burki K, Frey P, Paganetti PA, Waridel C, Calhoun ME, Jucker M, Probst A, Staufenbiel M, Sommer B (1997) Two amyloid precursor protein transgenic mouse models with Alzheimer disease-like pathology. Proc Natl Acad Sci U S A 94:13287-13292.   Bibliography  157       Sun X, Bromley-Brits K, Song W (2012) Regulation of beta-site APP-cleaving enzyme 1 gene expression and its role in Alzheimer's disease. J Neurochem 120 Suppl 1:62-70. Sun X, He G, Qing H, Zhou W, Dobie F, Cai F, Staufenbiel M, Huang LE, Song W (2006a) Hypoxia facilitates Alzheimer's disease pathogenesis by up-regulating BACE1 gene expression. Proceedings of the National Academy of Sciences of the United States of America 103:18727-18732. Sun X, He G, Song W (2006b) BACE2, as a novel APP theta-secretase, is not responsible for the pathogenesis of Alzheimer's disease in Down syndrome. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 20:1369-1376. Sun X, Tong Y, Qing H, Chen CH, Song W (2006c) Increased BACE1 maturation contributes to the pathogenesis of Alzheimer's disease in Down syndrome. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 20:1361-1368. Sun X, Wang Y, Qing H, Christensen MA, Liu Y, Zhou W, Tong Y, Xiao C, Huang Y, Zhang S, Liu X, Song W (2005) Distinct transcriptional regulation and function of the human BACE2 and BACE1 genes. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 19:739-749. Suzuki T, Araki Y, Yamamoto T, Nakaya T (2006) Trafficking of Alzheimer's disease-related membrane proteins and its participation in disease pathogenesis. Journal of biochemistry 139:949-955. Suzuki T, Oishi M, Marshak DR, Czernik AJ, Nairn AC, Greengard P (1994) Cell cycle-dependent regulation of the phosphorylation and metabolism of the Alzheimer amyloid precursor protein. Embo J 13:1114-1122. Tabira T, Chui DH, Nakayama H, Kuroda S, Shibuya M (2002) Alzheimer's disease with spastic paresis and cotton wool type plaques. J Neurosci Res 70:367-372. Taddei K, Kwok JB, Kril JJ, Halliday GM, Creasey H, Hallupp M, Fisher C, Brooks WS, Chung C, Andrews C, Masters CL, Schofield PR, Martins RN (1998) Two novel presenilin-1 mutations (Ser169Leu and Pro436Gln) associated with very early onset Alzheimer's disease. Neuroreport 9:3335-3339. Takagi S, Tominaga A, Sato C, Tomita T, Iwatsubo T (2010) Participation of transmembrane domain 1 of presenilin 1 in the catalytic pore structure of the gamma-secretase. J Neurosci 30:15943-15950. Takami M, Nagashima Y, Sano Y, Ishihara S, Morishima-Kawashima M, Funamoto S, Ihara Y (2009) gamma-Secretase: successive tripeptide and tetrapeptide release from the transmembrane domain of beta-carboxyl terminal fragment. J Neurosci 29:13042-13052. Takasugi N, Tomita T, Hayashi I, Tsuruoka M, Niimura M, Takahashi Y, Thinakaran G, Iwatsubo T (2003) The role of presenilin cofactors in the gamma-secretase complex. Nature 422:438-441. Takeo K, Watanabe N, Tomita T, Iwatsubo T (2012) Contribution of the gamma-Secretase Subunits to the Formation of Catalytic Pore of Presenilin 1 Protein. J Biol Chem 287:25834-25843.   Bibliography  158       Tamaoka A, Sawamura N, Fukushima T, Shoji S, Matsubara E, Shoji M, Hirai S, Furiya Y, Endoh R, Mori H (1997) Amyloid beta protein 42(43) in cerebrospinal fluid of patients with Alzheimer's disease. J Neurol Sci 148:41-45. Tanahashi H, Tabira T (2001) Three novel alternatively spliced isoforms of the human beta-site amyloid precursor protein cleaving enzyme (BACE) and their effect on amyloid beta-peptide production. Neurosci Lett 307:9-12. Tanzi RE, Gusella JF, Watkins PC, Bruns GA, St George-Hyslop P, Van Keuren ML, Patterson D, Pagan S, Kurnit DM, Neve RL (1987) Amyloid beta protein gene: cDNA, mRNA distribution, and genetic linkage near the Alzheimer locus. Science 235:880-884. Terry RD, Masliah E, Salmon DP, Butters N, DeTeresa R, Hill R, Hansen LA, Katzman R (1991) Physical basis of cognitive alterations in Alzheimer's disease: synapse loss is the major correlate of cognitive impairment. Ann Neurol 30:572-580. Thinakaran G (2001) Metabolism of presenilins. J Mol Neurosci 17:183-192. Thinakaran G, Borchelt DR, Lee MK, Slunt HH, Spitzer L, Kim G, Ratovitsky T, Davenport F, Nordstedt C, Seeger M, Hardy J, Levey AI, Gandy SE, Jenkins NA, Copeland NG, Price DL, Sisodia SS (1996a) Endoproteolysis of presenilin 1 and accumulation of processed derivatives in vivo. Neuron 17:181-190. Thinakaran G, Harris CL, Ratovitski T, Davenport F, Slunt HH, Price DL, Borchelt DR, Sisodia SS (1997) Evidence that levels of presenilins (PS1 and PS2) are coordinately regulated by competition for limiting cellular factors. J Biol Chem 272:28415-28422. Thinakaran G, Teplow DB, Siman R, Greenberg B, Sisodia SS (1996b) Metabolism of the "Swedish" amyloid precursor protein variant in neuro2a (N2a) cells. Evidence that cleavage at the "beta-secretase" site occurs in the golgi apparatus. J Biol Chem 271:9390-9397. Thomas RS, Liddell JE, Kidd EJ (2011) Anti-amyloid precursor protein immunoglobulins inhibit amyloid-beta production by steric hindrance. The FEBS journal 278:167-178. Thomas RS, Liddell JE, Murphy LS, Pache DM, Kidd EJ (2006) An antibody to the beta-secretase cleavage site on amyloid-beta-protein precursor inhibits amyloid-beta production. J Alzheimers Dis 10:379-390. Tian Y, Bassit B, Chau D, Li YM (2010) An APP inhibitory domain containing the Flemish mutation residue modulates gamma-secretase activity for Abeta production. Nature structural & molecular biology 17:151-158. Tienari PJ, Ida N, Ikonen E, Simons M, Weidemann A, Multhaup G, Masters CL, Dotti CG, Beyreuther K (1997) Intracellular and secreted Alzheimer beta-amyloid species are generated by distinct mechanisms in cultured hippocampal neurons. Proc Natl Acad Sci U S A 94:4125-4130. Tolia A, Chavez-Gutierrez L, De Strooper B (2006a) Contribution of presenilin transmembrane domains 6 and 7 to a water-containing cavity in the gamma-secretase complex. J Biol Chem 281:27633-27642.   Bibliography  159       Tolia A, Chavez-Gutierrez L, De Strooper B (2006b) Contribution of presenilin transmembrane domains 6 and 7 to a water-containing cavity in the gamma-secretase complex. J Biol Chem 281:27633-27642. Tolia A, Horre K, De Strooper B (2008) Transmembrane domain 9 of presenilin determines the dynamic conformation of the catalytic site of gamma-secretase. J Biol Chem 283:19793-19803. Tomita S, Kirino Y, Suzuki T (1998) Cleavage of Alzheimer's amyloid precursor protein (APP) by secretases occurs after O-glycosylation of APP in the protein secretory pathway. Identification of intracellular compartments in which APP cleavage occurs without using toxic agents that interfere with protein metabolism. J Biol Chem 273:6277-6284. Tomiyama T, Matsuyama S, Iso H, Umeda T, Takuma H, Ohnishi K, Ishibashi K, Teraoka R, Sakama N, Yamashita T, Nishitsuji K, Ito K, Shimada H, Lambert MP, Klein WL, Mori H (2010) A mouse model of amyloid beta oligomers: their contribution to synaptic alteration, abnormal tau phosphorylation, glial activation, and neuronal loss in vivo. J Neurosci 30:4845-4856. Tu H, Nelson O, Bezprozvanny A, Wang Z, Lee SF, Hao YH, Serneels L, De Strooper B, Yu G, Bezprozvanny I (2006) Presenilins form ER Ca2+ leak channels, a function disrupted by familial Alzheimer's disease-linked mutations. Cell 126:981-993. Uchihara T, Duyckaerts C, He Y, Kobayashi K, Seilhean D, Amouyel P, Hauw JJ (1995) ApoE immunoreactivity and microglial cells in Alzheimer's disease brain. Neurosci Lett 195:5-8. Van Broeckhoven C, Backhovens H, Cruts M, De Winter G, Bruyland M, Cras P, Martin JJ (1992) Mapping of a gene predisposing to early-onset Alzheimer's disease to chromosome 14q24.3. Nat Genet 2:335-339. Van Broeckhoven C, Haan J, Bakker E, Hardy JA, Van Hul W, Wehnert A, Vegter-Van der Vlis M, Roos RA (1990) Amyloid beta protein precursor gene and hereditary cerebral hemorrhage with amyloidosis (Dutch). Science 248:1120-1122. Vassar R, Bennett BD, Babu-Khan S, Kahn S, Mendiaz EA, Denis P, Teplow DB, Ross S, Amarante P, Loeloff R, Luo Y, Fisher S, Fuller J, Edenson S, Lile J, Jarosinski MA, Biere AL, Curran E, Burgess T, Louis JC, Collins F, Treanor J, Rogers G, Citron M (1999) Beta-secretase cleavage of Alzheimer's amyloid precursor protein by the transmembrane aspartic protease BACE. Science 286:735-741. Villemagne VL, Pike KE, Chetelat G, Ellis KA, Mulligan RS, Bourgeat P, Ackermann U, Jones G, Szoeke C, Salvado O, Martins R, O'Keefe G, Mathis CA, Klunk WE, Ames D, Masters CL, Rowe CC (2011) Longitudinal assessment of Abeta and cognition in aging and Alzheimer disease. Ann Neurol 69:181-192. von Arnim CA, Kinoshita A, Peltan ID, Tangredi MM, Herl L, Lee BM, Spoelgen R, Hshieh TT, Ranganathan S, Battey FD, Liu CX, Bacskai BJ, Sever S, Irizarry MC, Strickland DK, Hyman BT (2005) The low density lipoprotein receptor-related protein (LRP) is a novel beta-secretase (BACE1) substrate. J Biol Chem 280:17777-17785. Wakabayashi T, De Strooper B (2008) Presenilins: members of the gamma-secretase quartets, but part-time soloists too. Physiology (Bethesda) 23:194-204.   Bibliography  160       Walsh DM, Klyubin I, Fadeeva JV, Cullen WK, Anwyl R, Wolfe MS, Rowan MJ, Selkoe DJ (2002) Naturally secreted oligomers of amyloid beta protein potently inhibit hippocampal long-term potentiation in vivo. Nature 416:535-539. Walter J, Capell A, Grunberg J, Pesold B, Schindzielorz A, Prior R, Podlisny MB, Fraser P, Hyslop PS, Selkoe DJ, Haass C (1996) The Alzheimer's disease-associated presenilins are differentially phosphorylated proteins located predominantly within the endoplasmic reticulum. Mol Med 2:673-691. Walter J, Capell A, Hung AY, Langen H, Schnolzer M, Thinakaran G, Sisodia SS, Selkoe DJ, Haass C (1997) Ectodomain phosphorylation of beta-amyloid precursor protein at two distinct cellular locations. J Biol Chem 272:1896-1903. Wang B, Yang L, Wang Z, Zheng H (2007) Amyolid precursor protein mediates presynaptic localization and activity of the high-affinity choline transporter. Proceedings of the National Academy of Sciences of the United States of America 104:14140-14145. Wang J, Dickson DW, Trojanowski JQ, Lee VM (1999) The levels of soluble versus insoluble brain Abeta distinguish Alzheimer's disease from normal and pathologic aging. Exp Neurol 158:328-337. Wang P, Yang G, Mosier DR, Chang P, Zaidi T, Gong YD, Zhao NM, Dominguez B, Lee KF, Gan WB, Zheng H (2005) Defective neuromuscular synapses in mice lacking amyloid precursor protein (APP) and APP-Like protein 2. J Neurosci 25:1219-1225. Wang Y, Chan SL, Miele L, Yao PJ, Mackes J, Ingram DK, Mattson MP, Furukawa K (2004) Involvement of Notch signaling in hippocampal synaptic plasticity. Proceedings of the National Academy of Sciences of the United States of America 101:9458-9462. Wang Y, Klunk WE, Huang GF, Debnath ML, Holt DP, Mathis CA (2002) Synthesis and evaluation of 2-(3'-iodo-4'-aminophenyl)-6-hydroxybenzothiazole for in vivo quantitation of amyloid deposits in Alzheimer's disease. J Mol Neurosci 19:11-16. Wasco W, Bupp K, Magendantz M, Gusella JF, Tanzi RE, Solomon F (1992) Identification of a mouse brain cDNA that encodes a protein related to the Alzheimer disease-associated amyloid beta protein precursor. Proceedings of the National Academy of Sciences of the United States of America 89:10758-10762. Wasco W, Gurubhagavatula S, Paradis MD, Romano DM, Sisodia SS, Hyman BT, Neve RL, Tanzi RE (1993) Isolation and characterization of APLP2 encoding a homologue of the Alzheimer's associated amyloid beta protein precursor. Nat Genet 5:95-100. Watanabe N, Image I, II, Takagi S, Tominaga A, Image Image I, Tomita T, Iwatsubo T (2010) Functional analysis of the transmembrane domains of presenilin 1: participation of transmembrane domains 2 and 6 in the formation of initial substrate-binding site of gamma-secretase. J Biol Chem 285:19738-19746. Weggen S, Eriksen JL, Das P, Sagi SA, Wang R, Pietrzik CU, Findlay KA, Smith TE, Murphy MP, Bulter T, Kang DE, Marquez-Sterling N, Golde TE, Koo EH (2001) A subset of NSAIDs lower amyloidogenic Abeta42 independently of cyclooxygenase activity. Nature 414:212-216.   Bibliography  161       Weidemann A, Eggert S, Reinhard FB, Vogel M, Paliga K, Baier G, Masters CL, Beyreuther K, Evin G (2002) A novel epsilon-cleavage within the transmembrane domain of the Alzheimer amyloid precursor protein demonstrates homology with Notch processing. Biochemistry 41:2825-2835. Weidemann A, Konig G, Bunke D, Fischer P, Salbaum JM, Masters CL, Beyreuther K (1989) Identification, biogenesis, and localization of precursors of Alzheimer's disease A4 amyloid protein. Cell 57:115-126. Willem M, Garratt AN, Novak B, Citron M, Kaufmann S, Rittger A, DeStrooper B, Saftig P, Birchmeier C, Haass C (2006) Control of peripheral nerve myelination by the beta-secretase BACE1. Science 314:664-666. Wolfe MS, Citron M, Diehl TS, Xia W, Donkor IO, Selkoe DJ (1998) A substrate-based difluoro ketone selectively inhibits Alzheimer's gamma-secretase activity. J Med Chem 41:6-9. Wolfe MS, Kopan R (2004) Intramembrane proteolysis: theme and variations. Science 305:1119-1123. Wolfe MS, Xia W, Moore CL, Leatherwood DD, Ostaszewski B, Rahmati T, Donkor IO, Selkoe DJ (1999a) Peptidomimetic probes and molecular modeling suggest that Alzheimer's gamma-secretase is an intramembrane-cleaving aspartyl protease. Biochemistry 38:4720-4727. Wolfe MS, Xia W, Ostaszewski BL, Diehl TS, Kimberly WT, Selkoe DJ (1999b) Two transmembrane aspartates in presenilin-1 required for presenilin endoproteolysis and gamma-secretase activity. Nature 398:513-517. Wong GT, Manfra D, Poulet FM, Zhang Q, Josien H, Bara T, Engstrom L, Pinzon-Ortiz M, Fine JS, Lee HJ, Zhang L, Higgins GA, Parker EM (2004) Chronic treatment with the gamma-secretase inhibitor LY-411,575 inhibits beta-amyloid peptide production and alters lymphopoiesis and intestinal cell differentiation. J Biol Chem 279:12876-12882. Wong HK, Sakurai T, Oyama F, Kaneko K, Wada K, Miyazaki H, Kurosawa M, De Strooper B, Saftig P, Nukina N (2005) beta Subunits of voltage-gated sodium channels are novel substrates of beta-site amyloid precursor protein-cleaving enzyme (BACE1) and gamma-secretase. J Biol Chem 280:23009-23017. Wong PC, Zheng H, Chen H, Becher MW, Sirinathsinghji DJ, Trumbauer ME, Chen HY, Price DL, Van der Ploeg LH, Sisodia SS (1997) Presenilin 1 is required for Notch1 and DII1 expression in the paraxial mesoderm. Nature 387:288-292. Xia W (2003) Relationship between presenilinase and gamma-secretase. Drug News Perspect 16:69-74. Xia W (2008) From presenilinase to gamma-secretase, cleave to capacitate. Curr Alzheimer Res 5:172-178. Xue S, Jia L, Jia J (2006) Hypoxia and reoxygenation increased BACE1 mRNA and protein levels in human neuroblastoma SH-SY5Y cells. Neurosci Lett 405:231-235.   Bibliography  162       Yagishita S, Morishima-Kawashima M, Ishiura S, Ihara Y (2008) Abeta46 is processed to Abeta40 and Abeta43, but not to Abeta42, in the low density membrane domains. J Biol Chem 283:733-738. Yamazaki T, Koo EH, Selkoe DJ (1997) Cell surface amyloid beta-protein precursor colocalizes with beta 1 integrins at substrate contact sites in neural cells. J Neurosci 17:1004-1010. Yan R, Bienkowski MJ, Shuck ME, Miao H, Tory MC, Pauley AM, Brashier JR, Stratman NC, Mathews WR, Buhl AE, Carter DB, Tomasselli AG, Parodi LA, Heinrikson RL, Gurney ME (1999) Membrane-anchored aspartyl protease with Alzheimer's disease beta-secretase activity. Nature 402:533-537. Yang AJ, Knauer M, Burdick DA, Glabe C (1995) Intracellular A beta 1-42 aggregates stimulate the accumulation of stable, insoluble amyloidogenic fragments of the amyloid precursor protein in transfected cells. J Biol Chem 270:14786-14792. Yang G, Gong YD, Gong K, Jiang WL, Kwon E, Wang P, Zheng H, Zhang XF, Gan WB, Zhao NM (2005) Reduced synaptic vesicle density and active zone size in mice lacking amyloid precursor protein (APP) and APP-like protein 2. Neurosci Lett 384:66-71. Yang LB, Lindholm K, Yan R, Citron M, Xia W, Yang XL, Beach T, Sue L, Wong P, Price D, Li R, Shen Y (2003) Elevated beta-secretase expression and enzymatic activity detected in sporadic Alzheimer disease. Nat Med 9:3-4. Yankner BA, Duffy LK, Kirschner DA (1990) Neurotrophic and neurotoxic effects of amyloid beta protein: reversal by tachykinin neuropeptides. Science 250:279-282. Yin YI, Bassit B, Zhu L, Yang X, Wang C, Li YM (2007) {gamma}-Secretase Substrate Concentration Modulates the Abeta42/Abeta40 Ratio: IMPLICATIONS FOR ALZHEIMER DISEASE. J Biol Chem 282:23639-23644. Young-Pearse TL, Bai J, Chang R, Zheng JB, LoTurco JJ, Selkoe DJ (2007) A critical function for beta-amyloid precursor protein in neuronal migration revealed by in utero RNA interference. J Neurosci 27:14459-14469. Yu G, Chen F, Nishimura M, Steiner H, Tandon A, Kawarai T, Arawaka S, Supala A, Song YQ, Rogaeva E, Holmes E, Zhang DM, Milman P, Fraser PE, Haass C, George-Hyslop PS (2000a) Mutation of conserved aspartates affects maturation of both aspartate mutant and endogenous presenilin 1 and presenilin 2 complexes. J Biol Chem 275:27348-27353. Yu G, Nishimura M, Arawaka S, Levitan D, Zhang L, Tandon A, Song YQ, Rogaeva E, Chen F, Kawarai T, Supala A, Levesque L, Yu H, Yang DS, Holmes E, Milman P, Liang Y, Zhang DM, Xu DH, Sato C, Rogaev E, Smith M, Janus C, Zhang Y, Aebersold R, Farrer LS, Sorbi S, Bruni A, Fraser P, St George-Hyslop P (2000b) Nicastrin modulates presenilin-mediated notch/glp-1 signal transduction and betaAPP processing. Nature 407:48-54. Zempel H, Thies E, Mandelkow E, Mandelkow EM (2010) Abeta oligomers cause localized Ca(2+) elevation, missorting of endogenous Tau into dendrites, Tau phosphorylation, and destruction of microtubules and spines. J Neurosci 30:11938-11950. Zhang C, Wu B, Beglopoulos V, Wines-Samuelson M, Zhang D, Dragatsis I, Sudhof TC, Shen J (2009) Presenilins are essential for regulating neurotransmitter release. Nature 460:632-636.   Bibliography  163       Zhang X, Garbett K, Veeraraghavalu K, Wilburn B, Gilmore R, Mirnics K, Sisodia SS (2012) A role for presenilins in autophagy revisited: normal acidification of lysosomes in cells lacking PSEN1 and PSEN2. J Neurosci 32:8633-8648. Zhang X, Zhou K, Wang R, Cui J, Lipton SA, Liao FF, Xu H, Zhang YW (2007a) Hypoxia-inducible factor 1alpha (HIF-1alpha)-mediated hypoxia increases BACE1 expression and beta-amyloid generation. J Biol Chem 282:10873-10880. Zhang YW, Wang R, Liu Q, Zhang H, Liao FF, Xu H (2007b) Presenilin/gamma-secretase-dependent processing of beta-amyloid precursor protein regulates EGF receptor expression. Proceedings of the National Academy of Sciences of the United States of America 104:10613-10618. Zhang Z, Hartmann H, Do VM, Abramowski D, Sturchler-Pierrat C, Staufenbiel M, Sommer B, van de Wetering M, Clevers H, Saftig P, De Strooper B, He X, Yankner BA (1998) Destabilization of beta-catenin by mutations in presenilin-1 potentiates neuronal apoptosis. Nature 395:698-702. Zhang Z, Nadeau P, Song W, Donoviel D, Yuan M, Bernstein A, Yankner BA (2000a) Presenilins are required for gamma-secretase cleavage of beta-APP and transmembrane cleavage of Notch-1. Nature cell biology 2:463-465. Zhang Z, Nadeau P, Song W, Donoviel D, Yuan M, Bernstein A, Yankner BA (2000b) Presenilins are required for gamma-secretase cleavage of beta-APP and transmembrane cleavage of Notch-1. Nat Cell Biol 2:463-465. Zhao B, Yu M, Neitzel M, Marugg J, Jagodzinski J, Lee M, Hu K, Schenk D, Yednock T, Basi G (2008) Identification of gamma-secretase inhibitor potency determinants on presenilin. J Biol Chem 283:2927-2938. Zhao G, Liu Z, Ilagan MX, Kopan R (2010) Gamma-secretase composed of PS1/Pen2/Aph1a can cleave notch and amyloid precursor protein in the absence of nicastrin. J Neurosci 30:1648-1656. Zheng H, Jiang M, Trumbauer ME, Sirinathsinghji DJ, Hopkins R, Smith DW, Heavens RP, Dawson GR, Boyce S, Conner MW, Stevens KA, Slunt HH, Sisoda SS, Chen HY, Van der Ploeg LH (1995) beta-Amyloid precursor protein-deficient mice show reactive gliosis and decreased locomotor activity. Cell 81:525-531. Zheng J, Watanabe H, Wines-Samuelson M, Zhao H, Gridley T, Kopan R, Shen J (2012) Conditional deletion of Notch1 and Notch2 genes in excitatory neurons of postnatal forebrain does not cause neurodegeneration or reduction of Notch mRNAs and proteins. J Biol Chem 287:20356-20368. Zhou W, Song W (2006) Leaky scanning and reinitiation regulate BACE1 gene expression. Mol Cell Biol 26:3353-3364. Zou K, Hosono T, Nakamura T, Shiraishi H, Maeda T, Komano H, Yanagisawa K, Michikawa M (2008) Novel role of presenilins in maturation and transport of integrin beta 1. Biochemistry 47:3370-3378.   Bibliography  164       Zou K, Kim D, Kakio A, Byun K, Gong JS, Kim J, Kim M, Sawamura N, Nishimoto S, Matsuzaki K, Lee B, Yanagisawa K, Michikawa M (2003) Amyloid beta-protein (Abeta)1-40 protects neurons from damage induced by Abeta1-42 in culture and in rat brain. J Neurochem 87:609-619.   

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0074224/manifest

Comment

Related Items