UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Molecular and functional characterization of cardiac Cav3.2 T-type calcium channels David, Laurence Sahagun 2011

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2011_fall_david_laurence.pdf [ 9.18MB ]
Metadata
JSON: 24-1.0072008.json
JSON-LD: 24-1.0072008-ld.json
RDF/XML (Pretty): 24-1.0072008-rdf.xml
RDF/JSON: 24-1.0072008-rdf.json
Turtle: 24-1.0072008-turtle.txt
N-Triples: 24-1.0072008-rdf-ntriples.txt
Original Record: 24-1.0072008-source.json
Full Text
24-1.0072008-fulltext.txt
Citation
24-1.0072008.ris

Full Text

MOLECULAR AND FUNCTIONAL CHARACTERIZATION OF CARDIAC Cav3.2 T-TYPE CALCIUM CHANNELS   by   Laurence Sahagun David   BSc Biology (Magna Cum Laude), Centro Escolar University, 1993  MET, Simon Fraser University, 2003    A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF   DOCTOR OF PHILOSOPHY   in   THE FACULTY OF GRADUATE STUDIES   (NEUROSCIENCE)   THE UNIVERSITY OF BRITISH COLUMBIA  (VANCOUVER)   JULY 2011    © Laurence Sahagun David, 2011 ii  ABSTRACT   T-type calcium (Ca 2+ ) channels contribute to the normal development of the heart and are also implicated in pathophysiological states such as cardiac hypertrophy. Functionally distinct Cav3 T-type Ca 2+  channel isoforms can be generated by alternative splicing from each of three different Cav3 genes (Cav3.1, Cav3.2 and Cav3.3), although it remains to be described whether specific splice variants are associated with developmental stages and pathological conditions. Using full length cDNA generated from rat cardiac tissues, this study identified ten major regions of alternative splicing and systematically identified alternative splice variants of cardiac Cav3.2 channels. Quantitative real-time PCR analysis on the mRNA expression of the most common variants revealed preferential expression of Cav3.2(-25) splice variant channels in the newborn rat heart, whereas in the adult heart approximately equal levels of expression of both (+25) and (- 25) exon variants was observed. In the adult stage of hypertensive rats, an increase in overall Cav3.2 mRNA expression and a shift towards the expression of Cav3.2(+25) containing channels as the predominant form was observed. This is the first evidence to show that cardiac Cav3.2 is subject to considerable splicing. Moreover, this thesis is also the first study to show developmental and pathological changes in expression of specific splice variants of the Cav3.2 channels.  The biophysical characteristics of cloned Cav3.2 splice variants and T-type Ca 2+  currents from dissociated cultured newborn ventricular myocytes were investigated using whole cell patch clamp analysis. This study showed variant-specific voltage-dependent facilitation (VDF) of Cav3.2 channels attributed to the exclusion of exon 25 in Cav3.2 transcripts. Lastly, this thesis is the first to provide evidence on VDF of T-type currents in rat ventricular myocytes. iii   PREFACE   A version of Chapter 2 has been published in the journal Channels (David, L.S., Garcia, E., Cain, S.C., Thau, E.M., Tyson, J.R., Snutch, T.P. 2010. Splice-variant changes of the Cav3.2 T-type calcium channel mediate voltage-dependent facilitation and associate with cardiac hypertrophy and development. Channels (Austin). 4(5):375-389). I designed all experiments and analyzed all results with input and feedback from my collaborators. I performed all screening and cloning of all splice variants in this thesis. Elana Thau helped me in generating cDNA libraries. Dr. Esperanza Garcia and Dr. Stuart Cain contributed to the whole cell recordings; Dr. John Tyson performed qRT-PCR and western blot analysis. I wrote the entire manuscript with subsequent editing from Dr. Terry Snutch and other authors. In Chapter 3, I also designed all experiments and analyzed all experimental results. I performed whole cell recordings and qRT- PCR analysis utilized in this chapter. Dr. Esperanza Garcia and Dr. Anamika Singh contributed to the whole cell recordings of cardiac myocytes. I wrote all of Chapter 3.  I also contributed to the electrophysiology section and cloned the Cav3.2 T-type Ca 2+  channel splice variants used in Appendix 5 (Powell, K.L., Cain, S.M., Ng ,C., Sirdesai, S., David, L.S., Kyi, M, Garcia, E, Tyson, JR, Reid ,C,A,, Bahlo, M., Foote, S,J, Snutch, T.P., O'Brien, T.J. 2009. A Cav3.2 T-type calcium channel point mutation has splice-variant-specific effects on function and segregates with seizure expression in a polygenic rat model of absence epilepsy. The Journal of Neuroscience. 29(2):371-380). In Appendix 3 (Nelson, M.T., Joksovic, P.M., Su, P., Kang, H-W., Van Deusen, A., Baumgart, J.P., David, L.S.,Snutch, T.P., Barrett, P.Q., Lee, J-H., Zorumski, C.F., Perez-Reyes, E., and Todorovic, S.M. 2007. Molecular mechanisms of subtype-specific inhibition of neuronal T-type calcium channels by ascorbate. The Journal of Neuroscience. 27(46), 12577- 12583), I cloned the rat thalamic Cav3.2 utilized in the paper. I participated in the molecular biology section of Appendix 2 (Hildebrand, M.E., David, L.S., Hamid, J., Mulatz, K., iv  Garcia, E., Zamponi, G.W. and Snutch, T.P. 2007. Selective inhibition of Cav3.3 T-type calcium channels by Gq/11-coupled muscarinic acetylcholine receptors. Journal of Biological Chemistry. 282(29), 21043-21055) and Appendix 4 (Adams, P.J., Garcia, E., David, L.S., Mulatz, K.J., Spacey, S.D., Snutch, T.P. 2009. Cav2.1 P/Q-type calcium channel alternative splicing affects the functional impact of familial hemiplegic migraine mutations: Implications for calcium channelopathies. Channels (Austin). 3(2):110-121). I also contributed to writing the review article shown in Appendix 1 (Snutch, T.P. and David, L.S. 2006. T-type calcium channels: An emerging therapeutic target for the treatment of pain. Drug Discovery Research. 67:404-415).  All animal procedures were performed in accordance with Canadian Council on Animal Care guidelines for animal research (UBC Animal Certificate Numbers A04-1003 and A08- 0005). v   TABLE OF CONTENTS  ABSTRACT ................................................................................................................................... ii  PREFACE ..................................................................................................................................... iii  TABLE OF CONTENTS ............................................................................................................. v  LIST OF TABLES ....................................................................................................................... ix  LIST OF FIGURES ...................................................................................................................... x  LIST OF ABBREVIATIONS .................................................................................................... xii  ACKNOWLEDGEMENTS ...................................................................................................... xvi  DEDICATION ........................................................................................................................... xvii  1 INTRODUCTION ...................................................................................................................... 1  1.1 Calcium channels overview ................................................................................................ 1 1.1.1 Classes and nomenclature ........................................................................................... 1 1.1.2 Calcium channel biochemical composition ................................................................ 6  1.2 T-type calcium channels ..................................................................................................... 8 1.2.1 T-type calcium channel expression ............................................................................. 8 1.2.2 Biophysical properties ............................................................................................... 10 1.2.3 T-type channel pharmacology .................................................................................. 11 1.2.4 Modulation of T-type calcium channels ................................................................... 16  1.3 Alternative splicing ........................................................................................................... 22 1.3.1 Overview of calcium channel alternative splicing ................................................... 23 1.3.2 Alternative splicing of T-type calcium channels ..................................................... 31  1.4 T-type calcium channels and the heart ........................................................................... 34 1.4.1 Expression, functional roles and modulation .......................................................... 34 1.4.2 Developmental regulation and association in cardiac diseases .............................. 37  1.5 Voltage-dependent facilitation of calcium channels ...................................................... 41 1.5.1 Voltage-dependent facilitation of high voltage-activated calcium channels ......... 41 1.5.2 Voltage-dependent facilitation of T-type channels ................................................. 43  1.6 Thesis hypotheses and objectives ..................................................................................... 47 1.6.1 Hypothesis 1 ................................................................................................................ 47 1.6.2 Hypothesis 2 ................................................................................................................ 47 vi  1.6.4 Hypothesis 3 ................................................................................................................ 48 1.6.5 Objectives .................................................................................................................... 48  2 SPLICE-VARIANT CHANGES OF THE Cav3.2 T-TYPE CALCIUM CHANNEL MEDIATE VOLTAGE-DEPENDENT FACILITATION AND ASSOCIATE WITH CARDIAC HYPERTROPHY AND DEVELOPMENT .......................................................... 50  2.1 Introduction ....................................................................................................................... 50  2.2 Results ................................................................................................................................ 53 2.2.1 Alternative splicing generates multiple Cav3.2 T-type variants with differential expression across development .......................................................................................... 53 2.2.2 Exclusion of exon 25 confers voltage-dependent facilitation and accelerates recovery from inactivation ................................................................................................. 67 2.2.3 The effect of cAMP and G22 on Cav3.2 voltage-dependent facilitation ............. 77 2.2.4 Differential expression of Cav3.2 exon 25 variants in hypertension-associated cardiac hypertrophy ........................................................................................................... 79  2.3 Discussion ........................................................................................................................... 82 2.3.1 Splice variant specific expression of cardiac Cav3.2 Ca 2+  channels in development and hypertrophy .................................................................................................................. 82 2.3.2 Cav3.2(-25) channels display faster recovery from inactivation and voltage- dependent facilitation ......................................................................................................... 84 2.3.3 The magnitude of VDF of Cav3.2(-25) splice variant currents is reduced by G22  ............................................................................................................................................... 86 2.3.4 Potential relevance to cardiac pathophysiology ...................................................... 87  2.4 Materials and methods ..................................................................................................... 88 2.4.1 Animals and tissue preparation ................................................................................ 88 2.4.2 Histological staining ................................................................................................... 89 2.4.3 RT-PCR and short amplicon scanning .................................................................... 90 2.4.4 Construction of cDNA libraries and full length splice variant screening ............. 93 2.4.5 Cloning of full-length Cav3.2 alternative splice variants ........................................ 93 2.4.6 Western blot analysis ................................................................................................. 94 2.4.7 Quantitative real-time-PCR (qRT-PCR) ................................................................. 95 2.4.8 Whole cell electrophysiology of transfected HEK cells .......................................... 98  3 VOLTAGE-DEPENDENT FACILITATION OF T-TYPE CALCIUM CURRENTS IN NEONATAL RAT VENTRICULAR MYOCYTES.............................................................. 101  3.1 Introduction ..................................................................................................................... 101  3.2 Results .............................................................................................................................. 102 3.2.1 Expression of Ca 2+  channels in neonatal rat ventricular myocytes ..................... 102 3.2.2 Biophysical properties of T-type Ca 2+  currents in isolated ventricular myocytes  ............................................................................................................................................. 104 3.2.3 Voltage-dependent facilitation of T-type Ca 2+  currents in rat ventricular myocytes. ............................................................................................................................ 109 vii   3.3 Discussion ......................................................................................................................... 111 3.3.1 T-type Ca 2+  channels are expressed in neonatal rat ventricular myocytes ........ 111 3.3.2 Voltage-dependent facilitation of NRVM ICaT is correlated with Cav3.2(-25) splice variant expression ............................................................................................................. 112 3.3.3 Potential significance of voltage-dependent facilitation of T-type Ca 2+  currents in neonatal ventricle .............................................................................................................. 113  3.4 Materials and methods ................................................................................................... 117 3.4.1 Animals and reagents .............................................................................................. 117 3.4.2 Isolation of neonatal rat ventricular myocytes ...................................................... 117 3.4.3 RNA extraction and quantitative Real-Time-PCR (qRT-PCR) .......................... 119 3.4.4 Whole cell patch clamp analysis of isolated neonatal ventricular myocytes ...... 120  4 CONCLUSION ...................................................................................................................... 124  4.1 Overall significance ......................................................................................................... 124 4.1.1 Identification and characterization of cardiac Cav3.2 alternative splice variants  ............................................................................................................................................. 124 4.1.2 Developmental and pathological expression of Cav3.2 alternative splice variants  ............................................................................................................................................. 126  4.2 Splice variant specific expression of Cav3.2 T-type Ca 2+  channels during development and hypertrophy .................................................................................................................... 129 4.2.1 Working hypothesis ................................................................................................. 129 4.2.2 Potential limitations ................................................................................................. 136  4.3. Voltage-dependent facilitation of Cav3.2 T-type channels ......................................... 137 4.3.1 Working hypothesis ................................................................................................. 137 4.3.2 Potential limitations ................................................................................................. 139  4.4 Conclusion ....................................................................................................................... 140 4.4.1 General conclusions ................................................................................................. 140 4.4.2 Potential relevance of Cav3.2 alternative splicing in cardiac development and hypertrophy ....................................................................................................................... 141 4.4.3 Future directions ...................................................................................................... 142  REFERENCES .......................................................................................................................... 145  APPENDIX 1: T-TYPE CALCIUM CHANNELS: AN EMERGING THERAPEUTIC TARGET FOR THE TREATMENT OF PAIN ..................................................................... 167  APPENDIX 2: SELECTIVE INHIBITION OF Cav3.3 T-TYPE CALCIUM CHANNELS BY Gq/11-COUPLED MUSCARINIC ACETYLCHOLINE RECEPTORS ..................... 179  APPENDIX 3: MOLECULAR MECHANISMS OF SUBTYPE-SPECIFIC INHIBITION OF NEURONAL T-TYPE CALCIUM CHANNELS BY ASCORBATE ........................... 192  viii  APPENDIX 4: Cav2.1 P/Q-TYPE CALCIUM CHANNEL ALTERNATIVE SPLICING AFFECTS THE FUNCTIONAL IMPACT OF FAMILIAL HEMIPLEGIC MIGRAINE MUTATIONS: IMPLICATIONS FOR CALCIUM CHANNELOPATHIES .................... 199  APPENDIX 5: A Cav3.2 T-TYPE CALCIUM CHANNEL POINT MUTATION HAS SPLICE-VARIANT SPECIFIC EFFECTS ON FUNCTION AND SEGREGATES WITH SEIZURE EXPRESSION IN POLYGENIC RAT MODEL OF ABSENCE EPILEPSY . 211  ix  LIST OF TABLES  Table 1.1. Neurological agents known to inhibit T-type currents. ......................................... 13  Table 2.1. Identified cardiac Cav3.2 T-type Ca 2+  channel variants. ....................................... 61  Table 2.2. Gating properties of Cav3.2 alternative splice variants. ........................................ 71  Table 2.3. Deactivation and recovery from inactivation of Cav3.2 alternative splice variants.  ....................................................................................................................................................... 74  Table 2.4. Primers utilized for exon scanning amplification. ................................................. 92  Table 2.5. Oligonucleotide primers for qRT-PCR. .................................................................. 97  Table 3.1. Biophysical properties of T-type Ca 2+  currents in isolated neonatal rat ventricular myocytes  ................................................................................................................ 105 x  LIST OF FIGURES  Figure 1.1. Calcium channel classifications ................................................................................ 5  Figure 1.2. Topographical illustration of the 1 calcium channel  subunit. ............................ 7  Figure 1.3. Effectors with identified modulation sites in the Cav3.2 T-type channel ........... 21  Figure 1.4 Mechanisms of modulation of Cav3.2 T-type Ca 2+  channels by G protein-coupled receptors (GPCRs). ..................................................................................................................... 22  Figure 1.5. Patterns of alternative splicing in eukaryotic mRNA .......................................... 29  Figure 1.6. Functionally relevant alternative splicing events in HVA channels. .................. 30  Figure 1.7. Functionally relevant alternative splicing events in T-type channels. ................ 33  Figure 1.8. Proposed mechanisms underlying the facilitation of native T-type calcium currents ........................................................................................................................................ 46  Figure 2.1. Ca 2+  channel expression in rat cardiac tissues and identification of Cav3.2 alternative splice variants. .......................................................................................................... 55  Figure 2.2. Topology of Cav3.2 channel showing the location of all in-frame and truncated carboxyl terminal variants. ........................................................................................................ 59  Figure 2.3. Differential expression of Cav3.2 T-type Ca 2+  channel alternative splice variants in newborn and adult cardiac tissues. ....................................................................................... 64  Figure 2.4. Spatial and developmental changes in the expression of Cav3.2(+25) and Cav3.2(-25) exon splice variants. ................................................................................................ 66  Figure 2.5. Representative data on the voltage-dependent properties of Cav3.2 alternative splice variants. ............................................................................................................................. 70  Figure 2.6. Alternative splicing affects the time course of recovery from inactivation and voltage-dependent facilitation of Cav3.2 T-type macroscopic currents. ................................ 72  Figure 2.7. The voltage-dependent facilitation of Cav3.2(-25) T-type Ca 2+  channels does not depend upon Ca 2+ .. ...................................................................................................................... 75  Figure 2.8. Voltage-dependent facilitation differs in T-type Ca 2+  channel isoforms. ........... 76  Figure 2.9. The effect of Gand cAMP on voltage-dependent facilitation (VDF) of cardiac Cav3.2 exon 25 alternative splice variants ................................................................................ 78  Figure 2.10. Alteration of Cav3.2(+25) and (-25) splice variant expression is associated with the hypertrophic SHR pathological phenotype. ....................................................................... 81  xi  Figure 3.1. Expression of HVA and LVA Ca 2+  channels in dissociated neonatal rat ventricular myocytes (NRVM). ................................................................................................ 103  Figure 3.2. Pharmacological and biophysical isolation of T-type Ca 2+  currents in newborn ventricular myocytes. ................................................................................................................ 106  Figure 3.3. The potentiated recovery from inactivation properties of NRVM T-type Ca 2+  currents is comparable to the recombinant Cav3.2(-25) alternative splice variant. ........... 108  Figure 3.4. Neonatal rat ventricular myocytes display VDF properties which is correlated with high level of Cav3.2 minus exon 25 alternative splice variant. ..................................... 110  Figure 3.5. Potential contribution of Cav3.2 T-type Ca 2+  channel VDF in neonatal rat ventricle. ..................................................................................................................................... 116  Figure 4.1. Hypothetical pathway of the signaling mechanism potentially involved in the regulation of expression of  Cav3.2 exon 25 splice variants. .................................................. 135 xii  LIST OF ABBREVIATIONS ANP: atrial natriuretic peptide AOB: aortic banded heart AngII: angiotensin II AP: action potentials AT1: angiotensin II type I receptor AV: atrioventricular Ba 2+ : barium Ca 2+ : calcium CaM: calmodulin CaMKII: calcium/calmodulin-dependent protein kinase II CDF: calcium-dependent facilitation CDI: calcium-dependent inactivation CICR: calcium-induced calcium release C-terminus: carboxyl terminus D: aspartate DADs: delayed afterdepolarizations DHP: dihydropyridines DNA: deoxyribonucleic acid DRG: dorsal root ganglion DTNB: 5, 5’ dithio-bis(2-nitrobenzoic acid) DTT: dithiothreitol E: glutamate EADs: early afterdepolarizations xiii  E-C coupling: excitation-contraction coupling ECG: electrocardiogram ET-1: endothelin 1 FHM-1: familial hemiplegic migraine-1 GPCR: G protein-coupled receptors GST: glutathione S-transferase HCN: hyperpolarization-activated cyclic nucleotide gated channels HDAC: histone deacetylase HVA: high voltage-activated HEK: human embryonic kidney LVA: low voltage-activated Mg: magnesium mg: milligram g: microgram mM: millimolar M: micromolar ms: millisecond mV: millivolt Na: sodium Na/Ca: sodium/calcium exchanger NFAT: nuclear factor of activated T-cells nM: nanomolar NRSE: neuron-restrictive silencer element NRSF: neuron-restrictive silencer factor xiv  ORF: open reading frame P: proline PA: polyadenylation PF: Purkinje fibers PIP2: phosphatidylinositol bisphosphate PIP3: phosphatidylinositol triphosphate PKA: protein kinase A PKC: protein kinase C PMI: post-myocardial infarcted heart R: arginine Redox: reduction – oxidation RT-PCR: reverse transcription polymerase chain reaction RyR: ryanodine receptors s: second SA: sinoatrial SHR: Spontaneously Hypertensive rats Sr: strontium act: time constant of activation TBA: tetrabutylammonium TEA: tetraethylammonium inact: time constant of inactivation UTR: untranslated region V50act: half activation potential V50inact: half inactivation potential xv  VDF: voltage-dependent facilitation VDI: voltage-dependent inactivation WKY: Wistar Kyoto rats xvi  ACKNOWLEDGEMENTS  I would like to express my sincere gratitude to my supervisor, Terry Snutch for his support, understanding, guidance and direction throughout my PhD studies. Special thanks to Esperanza Garcia for teaching me electrophysiology and for her guidance, encouragement and comments in this thesis. Thank you to Dr. John Tyson for his support in molecular biology and feedback on this thesis. I would like to thank my supervisory committee, Vanessa Auld, Edwin Moore, and Brian MacVicar for their direction and advice.  Thank you to all past and present members of Snutch lab. It has been a pleasure collaborating and working with you all. I am also thankful to the Heart and Stroke Foundation of Canada and UBC W.C. Koerner Fellowship for providing me with doctoral research funding during my PhD studies.  To all my friends, thank you for your support and encouragement. I would like to thank my children for inspiring me to finish my PhD. Lastly to my late wife Con, thanks for the support, love and inspiration. This is for you! xvii  DEDICATION     In my wife’s loving memory  To my sons, Tophy and Troy  And To my Saviour, Jesus Christ                                    1  1 INTRODUCTION  Calcium (Ca 2+ ) ions crucially contribute to numerous physiological processes and cells have evolved multiple mechanisms to finely control Ca 2+  transport. Amongst these modes of transport, voltage-gated Ca 2+  channels play a major role in the cellular physiology and pathology of many tissues including the heart. In particular, cardiac T-type Ca 2+ channels are thought to play significant roles during cardiac development and disease. These include contributions to cardiac pacemaking, automaticity, conduction and excitation-contraction (E-C) coupling. This thesis focused on the identification, profiling and functional characterization of alternative splice variants of Cav3.2 T-type channels, one of the two major T-type isoforms expressed in the mammalian heart.  1.1 Calcium channels overview  Voltage-gated Ca 2+  channels are ubiquitously expressed thoughout cells and tissues and are involved in numerous physiological processes including neuronal firing, cardiac excitability, hormone secretion, gene expression, and cell growth and proliferation. They are also implicated in the pathogenesis in over a dozen distinct diseases of the nervous and cardiovascular systems. Phenotypically, Ca 2+  channels are divided into two major classes – the high voltage-activated (HVA) and low voltage-activated (LVA) Ca 2+  channels. Detailed description of various classes and biochemical composition of Ca 2+  channels are discussed in this section.     1.1.1 Classes and nomenclature  There are ten known genes that encode distinct 1 pore-forming subunits in the Ca 2+  channel family (Figure 1.1). Historically, identification of Ca 2+  channels by several laboratories 2  over the years has led to numerous ways of naming the channels. These include; phenomenological nomenclature HVA versus LVA and  consist of the L; T; N; P/Q; and R; types), clone nomenclature (1A,1B, 1C, 1H, etc.), and gene nomenclature (for example CACNA1A, CACNA1G, CACNA1H, CACNA1I) (Lory et al., 1997; Hille, 2001). In 2000, a more systematic nomenclature was adopted based on the well defined potassium channel nomenclature (Chandy and Gutman, 1993; Ertel et al., 2000). Under this naming system, Ca 2+  channels were named using the chemical symbol of the principal permeating ion (Ca) with the principal regulator (voltage) indicated as a subscript (Cav) (Ertel et al., 2000; Catterall et al., 2003). The numerical identifier corresponds to the Cav channel 1 subunit gene family (i.e., 1, 2 and 3) and the order of discovery of the 1 subunit within that family (Figure 1.1).  According to this nomenclature, the Cav1 family includes Cav1.1, Cav1.2, Cav1.3 and Cav1.4 which correspond to 1S, 1C , 1D , and 1F,  respectively. All Cav1 Ca 2+  channels mediate L-type Ca 2+  currents. On the other hand, the Cav2 family (Cav2.1, Cav2.2 and Cav2.3 previously 1A, 1B, and 1E) mediate P/Q-, N- and R-type currents, respectively. Lastly, T-type Ca 2+  channels belong to the Cav3 family which includes Cav3.1, Cav3.2 and Cav3.3 (previously 1G, 1H, and 1I, respectively). Brief descriptions of the expression, functional roles, and biophysical and pharmacological properties of the ten Ca 2+  channel subtypes are discussed in this section.   The Cav1 channel subfamily are generally characterized by large single channel conductances, minimal voltage-dependent inactivation and significant Ca 2+ -dependent inactivation (Hille, 2001; Snutch et al., 2005). Pharmacologically, Cav1 channels are potently blocked by phenylalkylamines, benzothiazapines and dihydropyridines (DHPs) (Fleckenstein, 1983; Fox et al., 1987; Hockerman et al., 1997). Cav1.1 channels are primarily expressed in skeletal muscles where they act as the voltage-sensor for E-C coupling (Rios and Brum, 1987; 3  Tanabe et al., 1988; Bean, 1989a; Tsien et al., 1991; Miller, 1992). Cav1.2 channels are expressed in the nervous system with high level of expression detected in the olfactory bulb, cerebellum, striatum, thalamus, hypothalamus and cortex and low levels in medulla, pons and spinal cord (Snutch et al., 1991; Hell et al., 1993). Cav1.2 channels are the main Ca 2+  channels in the heart and smooth muscles where they are known to define the shape of the action potentials (APs) and to mediate excitation and contraction (Reuter et al., 1988; Tanabe et al., 1990; Bers and Perez-Reyes, 1999; Bers, 2001). Cav1.3 channels are present in the cell bodies and proximal dendrites of the central neurons as well as in endocrine, amacrine and cochlear hair cells (Hell et al., 1993; Ihara et al., 1995; Kollmar et al., 1997; Morgans, 1999; Habermann et al., 2003; Liu et al., 2004). In the heart, Cav1.3 channels are present in atria and sino-atrial (SA) nodes where they are reported to contribute to cardiac pacemaking (Zhang et al., 2002; Mangoni et al., 2003; Mangoni and Nargeot, 2008). Lastly, Cav1.4 channels are known to have important roles in neurotransmitter release in retinal photoreceptors and bipolar cells (Koschak et al., 2003; Baumann et al., 2004; McRory et al., 2004).  Cav2 channels are primarily expressed in the central and peripheral nervous systems. They are primarily involved in the release of neurotransmitters in response to presynaptic APs. These channels are known to bind directly with several proteins of the presynaptic exocytotic machinery and may form part of the docking complex for synaptic vesicles (Catterall, 2000). Pharmacologically, they are relatively insensitive to DHPs but are specifically blocked with high affinity by peptide toxins from spiders and marine snails (Miljanich and Ramachandran, 1995).  Cav2.1 channels are highly expressed in the mammalian brain and peripheral nervous system (Mori et al., 1991; Starr et al., 1991) where they play an important role in neurotransmission. They are known to be potently blocked by the peptide -agatoxin IVA from funnel web spider venom (Randall and Tsien, 1995). The Cav2.2 channels conduct N-type Ca 2+  4  currents and are potently blocked by the peptides -conotoxin GVIA and -conotoxin MVIIA and MVIIC (McCleskey et al., 1987; Catterall et al., 2003). N-type channels play important roles in the sensation and transmission of pain signals (McGivern and McDonough, 2004; Swayne and Bourinet, 2008; Zamponi et al., 2009). Cav2.3 channels conduct R-type currents and are blocked by the synthetic peptide SNX-482 (Newcomb et al., 1998). They are expressed in the nervous, endocrine, male reproductive and gastrointestinal systems (Grabsch et al., 1999; Westenbroek and Babcock, 1999; Lu et al., 2004; Jing et al., 2005; Wakamori and Imoto, 2009). These channels play important roles in neurotransmitter release and synaptic plasticity (Kubota et al., 2001; Breustedt et al., 2003; Dietrich et al., 2003), pain sensing (Saegusa et al., 2000), hormone secretion and glucose homeostasis (Pereverzev et al., 2002).  Cav3 T-type channels are generally insensitive to L-type blockers and to toxins that block Cav2 channels. The three types, Cav3.1, Cav3.2 and Cav3.3, are expressed throughout the body including nervous tissue, heart, kidney, smooth muscle, sperm, uterus and endocrine organs (reviewed in (Perez-Reyes, 2003)). The biophysical properties, functional and pathological roles of T-type Ca 2+  channels are discussed in more detail in subsequent sections. 5   Figure 1.1. Calcium channel classifications. Voltage-gated Ca 2+  channels are divided into major classes – the high voltage-activated (HVA) and low voltage-activated (LVA) channels. HVA channels are further subdivided into Cav1 and Cav2 subfamilies and LVA comprises the Cav3 subfamily. The Cav nomenclature (black) is currently the official naming system for voltage-gated Ca 2+  channels. Voltage-gated Ca 2+  channels are also named according to the type of Ca 2+  currents recorded from native tissues for instance L-, N-, P/Q-, R and T-types. Clone nomenclatures for example 1A or 1E are shown in blue. The official gene names are listed in the right panel of the figure (purple) (Lory et al., 1997; Ertel et al., 2000; Hille, 2001).     6     1.1.2 Calcium channel biochemical composition  Insight into the molecular basis for the differences in the functional properties of Ca 2+  channels initially required the identification of channel protein structure. The protein composition of Ca 2+  channels was first determined from the pioneering studies by Campbell, Catterall, Hoffman and Glossmann laboratories (Striessnig et al., 1987; Takahashi et al., 1987; Ruth et al., 1989; Jay et al., 1990). The transverse tubule membranes of skeletal muscle served as the primary biochemical preparation for studying the Ca 2+  channel structure. Initial purification studies from this preparation revealed that skeletal L-type Ca 2+  channels contain 1,  and   subunits (Curtis and Catterall, 1984). Subsequent studies of these L-type channels revealed a more complex protein and it is now known that they are a large multimeric complex containing an equal stoichiometric ratio of 1 pore-forming subunit and auxiliary subunits 2, , , and (Hosey et al., 1987; Leung et al., 1987; Striessnig et al., 1987; Takahashi et al., 1987; Catterall, 2000).  The amino acid composition of the Ca 2+  channel 1 subunits revealed similarities to the predicted transmembrane structures of the pore-forming 1 subunits of sodium (Na + ) channels (Tanabe et al., 1987). The amino acid sequences are organized into four homologous domains (I – IV) with each domain containing six transmembrane segments (S1 to S6), and a pore-forming loop between transmembrane segments S5 and S6 (Catterall, 2000) (Figure 1.2). The fourth segment (S4) contains five to six positively charged arginine and lysine residues, and serves as the major voltage sensor component. The pore-forming loop is responsible for the selectivity and permeation properties of the channels (Kim et al., 1993). The transmembrane segments and pore regions of all 10 Cav subunits are well conserved. Overall, amino acid sequences of 1 subunits are over 70% identical within a channel subfamily while less than 40% identical between channel subfamilies (reviewed in (Ertel et al., 2000; Catterall et al., 2003). Of Cav members, the 7  T-type channels exhibit the least amount of sequence identity compared to other classes. Analysis of the T-type channel amino acid sequences revealed a lack of the structural motif for the  subunit binding site conserved across HVA Cav I-II linker. Hence, the association of auxiliary subunits typically present among HVA channels is unlikely to play a significant role in native T-type channels (Dolphin et al., 1999; Dubel et al., 2004).    Figure 1.2. Topographical illustration of the 1 calcium channel subunit. All ten Ca 2+  channel 1 subunits have four homologous domains (labeled I to IV). Each domain is composed of six transmembrane segments (labeled 1 to 6 in domain I).  The loop located between segments 5 and 6 forms the channel pore-forming loop.  The 4 th  transmembrane segments (green) are formed by positively charged amino acids and formed the voltage sensor. The amino (NH2), C-terminus (COOH) and interdomain linkers are all intracellular. 8  1.2 T-type calcium channels  The Cav3 T- type channels are widely expressed throughout the body including the heart, nervous tissue, kidney, smooth muscle and many endocrine organs. Some of the important roles that T-type channels contribute are neuronal firing, hormonal secretion and smooth muscle contraction. Importantly, they are also implicated in the pathophysiology of certain diseases such as epilepsy, chronic pain, hypertension and cardiac hypertrophy. In general, the biophysical properties of T- type channels recorded from various cell types are similar although differences have been noted in their kinetic properties, second-messenger-dependent modulation and sensitivity to pharmacological agents (Perez-Reyes, 2003, 2006). These differences can largely be explained by the existence of three main types of T-type channels: Cav3.1, Cav3.2 and Cav3.3 isoforms encoded by CACNA1G, CACNA1H, and CACNA1I, respectively (Figure 1.1). Extensive studies using Northern and dot blots, in situ hybridization and RT-PCR have been used to characterize the expression of the three Cav3 channels in various cells and tissues (Cribbs et al., 1998; Perez-Reyes et al., 1998; Talley et al., 1999; McRory et al., 2001; Perez-Reyes, 2003; Yunker and McEnery, 2003). Discussion in this section focuses on the general tissue expression, biophysical, pharmacological and modulation of T-type channel isoforms. More detailed discussions on the expression, properties, functional and pathological roles of T-type channels in the cardiovascular system are presented in section 1.4.     1.2.1 T-type calcium channel expression   All Cav3 channels are present in the central and peripheral nervous systems. Cav3.1 channels are highly expressed in inferior olivary neurons, thalamic relay neurons, cerebellar Purkinje neurons, subthalamic nucleus, the hippocampus, olfactory bulb, caudal thalamus, amygdala, cerebral cortex, brainstem and spinal cord (Talley et al., 1999; Monteil et al., 2000a; 9  McRory et al., 2001). Cav3.2 channels are reported in thalamic reticular neurons, olfactory tubercles, subthalamic nucleus, basal ganglia, hippocampus, olfactory bulb, caudal thalamus, sympathetic ganglion neurons, and dorsal root ganglia (White et al., 1989; Talley et al., 1999; McRory et al., 2001; Lee et al., 2002). Cav3.3 has been shown to be present in subthalamic nucleus, thalamic reticular neurons, basal ganglia, olfactory tubercles, nucleus accumbens and the striatum (Huguenard, 1999; Lee et al., 1999b; Talley et al., 1999; Monteil et al., 2000b; McRory et al., 2001).  T-type channels have also been found in the reproductive tissues such as the testes (Jagannathan et al., 2002; Son et al., 2002) and the uterus (Ohkubo et al., 2005). They are also reported to be present in adrenal glands (Enyeart et al., 1993; Mlinar et al., 1993; Chen et al., 1999; Schrier et al., 2001), pituitary glands (Talley et al., 1999) and in -cells of the Islets of Langerhans in the pancreas (Ashcroft et al., 1990; Sala and Matteson, 1990; Parsey and Matteson, 1993).  Both Cav3.1 and Cav3.2 channels are expressed in the kidneys with Cav3.2 being predominantly present in renal smooth muscles and Cav3.1 in the renal tubules (Cribbs et al., 1998; Williams et al., 1999; Andreasen et al., 2000; Hansen et al., 2001). T-type Ca 2+  currents (ICaT) have been recorded in embryonic and newborn skeletal muscles (Beam and Knudson, 1988; Gonoi and Hasegawa, 1988; Berthier et al., 2002). ICaT has also been recorded in smooth muscle myocytes cells isolated from the colon (Koh et al., 2001), coronary arteries (Ganitkevich and Isenberg, 1991; Mishra and Hermsmeyer, 1994; Quignard et al., 1997), aortas (Akaike et al., 1989),  cerebral arteries (Hirst et al., 1986) and bronchi (Yamakage et al., 2001). RT-PCR analysis of smooth muscle myocytes has revealed the presence of both Cav3.1 and Cav3.2 channels (Gustafsson et al., 2001). Cardiac T-type channels consist of two main types: Cav3.1 and Cav3.2 (see Section 1.4). 10      1.2.2 Biophysical properties  The differential expression of Cav3 channels in diverse cell types suggests that these Ca 2+  channels perform unique physiological functions. For example, in the nervous system all three T- type isoforms are present whereas in the heart only Cav3.1 and Cav3.2 channels are expressed. This differential expression likely account for differences in the electrophysiological properties observed for native T-type currents recorded from various cell types. T-type channels have single channel conductances ranging between 6 and 8 pS in the presence of isotonic (110 mM) Ca 2+  or barium (Ba 2+ ) (Carbone and Lux, 1984; Droogmans and Nilius, 1989), ~5 pS in 10 mM Ca 2+  (Balke et al., 1992) and 1 pS in 2 mM Ca 2+  (Huguenard, 1996) demonstrating Ca 2+ -concentration-dependent ionic conduction in the T-type channel pore. The conduction of divalent ions differs in all three isoforms. In recombinant Cav3.1 channels, the current amplitude is larger in the presence of Ca 2+ than in Ba 2+ . On the other hand, Ca 2+  currents are smaller than Ba 2+  currents in Cav3.2 channels while for Cav3.3 currents are approximately equal with Ba 2+  and Ca 2+  (McRory et al., 2001; Kaku et al., 2003).  The threshold for activation of T-type channels has been reported to be between -75 and -60 mV with half-maximal activation between -45 and -40 mV (McDonald et al., 1994; Huguenard, 1996; Perez-Reyes et al., 1998; Klockner et al., 1999; Kozlov et al., 1999; Perez- Reyes, 2003; Lacinova, 2005; Talavera and Nilius, 2006). At threshold potentials, T-type currents initially activate and inactivate slowly and then become faster with stronger depolarizations (Randall and Tsien, 1997; Perez-Reyes, 2003). T-type half maximal inactivation is generally between – 80 and -60 mV (Vassort and Alvarez, 1994; Huguenard, 1996; Klockner et al., 1999; Talavera and Nilius, 2006).  The overlapping activation and inactivation potential of T-type channels generates currents at steady state conditions called “window” currents (Vassort 11  and Alvarez, 1994; Chemin et al., 2000; Perez-Reyes, 2003; Talavera and Nilius, 2006). The magnitude of window currents has been estimated in heterologous expression system (Chemin et al., 2000).  In terms of activation and inactivation kinetics, comparison of the three T-type isoforms has revealed that recombinant Cav3.1 and Cav3.2 channels exhibit comparable properties, while the Cav3.3 subtype possesses distinct kinetics (Perez-Reyes et al., 1998; Klockner et al., 1999; Klugbauer et al., 1999; Kozlov et al., 1999; Lee et al., 1999b; Williams et al., 1999; McRory et al., 2001). The Cav3.1 and Cav3.2 isoforms have faster activation and inactivation kinetics, while the Cav3.3 channel activation and inactivation kinetics are both significantly slower. All three T- type isoforms have characteristically slower deactivation kinetics compared to the HVA channels with Cav3.3 being fastest and Cav3.1 the slowest (Klockner et al., 1999; Kozlov et al., 1999; Serrano et al., 1999; Monteil et al., 2000b; Perez-Reyes, 2003; Talavera and Nilius, 2006). The rates of recovery from inactivation of T-type channels are also faster than any of the HVA channels with Cav3.1 possessing the fastest time constants followed by Cav3.3 and slowest for Cav3.2 (Klockner et al., 1999; Chemin et al., 2002). Overall, the unique kinetic properties of T- type channels can serve as a valuable tool in distinguishing T-type isoforms, particularly in native cells and tissues. More importantly, their unique properties are predicted to distinctly affect intracellular Ca 2+  influx and affect Ca 2+  homeostasis and cellular physiology.     1.2.3 T-type channel pharmacology   With the successful cloning of the three Ca 2+  channel genes encoding for T-type isoforms, our knowledge and understanding of the pharmacology of these channels has greatly improved. This section discusses current information concerning the pharmacology of T-type channels in both native and recombinant channels with emphasis given to neurological and 12  cardiovascular agents, toxins and polyvalent ions (for reviews see (Perez-Reyes, 2003; Yunker, 2003; Lacinova, 2005; Snutch and David, 2006) (Appendix 1). Although, these agents selectively target T-type channels for therapeutic purposes, these agents also block other ion channels. An understanding of the pharmacological properties of T-type channels allows the isolation of their relative contribution in native systems from that of other conductances. For example, in the heart the application of a specific blocker for Cav3.1 channels would permit studying the properties of Cav3.2 (and vice versa).  A number of neurological agents have been shown to block T-type channels at therapeutically-relevant levels (Table 1.1). These include antiepileptics ( e.g., zonisamide, ethosuximide, and methyl-phenyl-succinimide(MPS) (Coulter et al., 1990; Kostyuk et al., 1992; Suzuki et al., 1992; Kito et al., 1996; Todorovic et al., 2000; Gomora et al., 2001), anticonvulsant (phenytoin) (Todorovic et al., 2000), diphenylbutylpiperidines neuroleptics (e.g., pimozide, flunarizine and penfluridol) (Enyeart et al., 1990a; Enyeart et al., 1990b; Opler and Feinberg, 1991; Santi et al., 2002), butyrophenone antipsychotic (haloperidol) (Santi et al., 2002) and general anaesthetics (e.g., isoflurane and propofol) (Todorovic and Lingle, 1998; Todorovic et al., 2000; Camara et al., 2001). The efficacy of these agents in blocking T-type channels indicates that T-type channels are important therapeutic targets for the treatment and management of a number of neurological conditions including epilepsy, pain and psychosis and possibly towards the management of cardiovascular disorders. Considering that T-type channels are upregulated in cardiac hypertrophy (Section 1.4.2), it would be relevant to investigate whether these agents affect the activity of T-type channels in the hypertrophic state.    13   Table 1.1. Neurological agents known to inhibit T-type currents. Pharmacological agent Tissue/Cell T-type IC50 (M) Reference Zonisamide cortical neurons neuroblastoma cells ICaT ICaT ~500 ~50 Suzuki et al., 1992 Kito et al., 1996 Ethosuximide ventrobasal thalamic neurons dorsal root ganglia heterologous expression (HEK cells) ICaT ICaT Cav3.1 Cav3.2 200 7 12000 22000 Coulter et al., 1990 Kostyuk et al., 1992 Gomora et al., 2001 Todorovic et al., 2000 MPS ventrobasal thalamic neurons dorsal root ganglia heterologous expression (HEK cells) ICaT ICaT Cav3.1 Cav3.2 Cav3.3 1100 190 1950 3000 1820 Coulter et al., 1990 Todorovic et al., 2000 Gomora et al., 2001 Gomora et al., 2001 Gomora et al., 2001 Phenytoin dorsal root ganglia heterologous expression (HEK cells) ICaT Cav3.1 Cav3.2 8 140 8.3 Todorovic et al., 2000 Todorovic et al., 2000 Todorovic et al., 2000 Pimozide heterologous expression (HEK cells) Cav3.1 Cav3.2 Cav3.3 0.04 0.06 0.04 Santi et al., 2002 Santi et al., 2002 Santi et al., 2002 Penfluridol heterologous expression (HEK cells) Cav3.1 Cav3.2 Cav3.3 0.11 0.07 0.10 Santi et al., 2002 Santi et al., 2002 Santi et al., 2002 Flunarizine heterologous expression (HEK cells) Cav3.1 Cav3.2 Cav3.3 0.53 3.5 0.84 Santi et al., 2002 Santi et al., 2002 Santi et al., 2002 Haloperidol heterologous expression (HEK cells) Cav3.1 Cav3.2 Cav3.3 1.2 1.4 1.3 Santi et al., 2002 Santi et al., 2002 Santi et al.,2002 Isoflurane dorsal root ganglia  atrial myocytes ICaT  ICaT 303  230 Todorovic & Lingle, 1998 Camara et al., 2001 Propofol heterologous expression (HEK cells) Cav3.1 Cav3.2 21 27 Todorovic et al., 2000 Todorovic et al., 2000    In general, T-type channels have been implicated in the pathogenesis of a number of cardiovascular diseases (Vassort and Alvarez, 1994; Vassort et al., 2006). The inhibition of T- type channels has been reported to have clinical importance in the treatment and management of a variety of cardiovascular diseases including hypertension and arrhythmia. Mibefradil is widely used as an antihypertensive drug and chronic stable angina pectoris agent (Perez-Reyes, 2003; Yunker, 2003; Snutch and David, 2006). This drug blocks both HVA and LVA Ca channels with 14  approximate IC50 values between 0.3 M and 20 M for HVA and 1 M for LVA channels (Jimenez et al., 2000). The mechanism of the T-type channel blockade by mibefradil was originally thought to be state-dependent; however, in a study by Martin and co-authors mibefradil was shown to be insensitive to voltage, ruling out state dependence as the mechanism of drug action (Martin et al., 2000). Efonidipine, an orally active antihypertensive and antianginal agent, has also been reported to block both HVA and LVA channels (Masumiya et al., 1997; Masumiya et al., 1998). It inhibits both cloned T-type channels expressed in baby hamster kidney (BHK) cells and in Xenopus oocytes, as well as native ICaT in cardiac myocytes (Furukawa et al., 2004; Tanaka et al., 2004; Tanaka et al., 2008). The R(-)-enantiomer of efonidipine was reported to be more selective to block native myocardial ICaT than ICaL (85% inhibition of ICaT versus no effect on ICaL at 1 M) (Tanaka et al., 2004). Bepridil, another widely used antiarrhythmic and antianginal agent is reported to inhibit cloned Cav3.2 channels with an IC50 of ~400 nM (Uchino et al., 2005). In addition to the above compounds, recent studies have made progress towards the design and synthesis potentially selective T-type channel blockers (Yang et al., 2008; Uebele et al., 2009).  Divalent inorganic ions (e.g., Ni 2+ ,  Zn 2+ , Co 2+ ) were some of the first agents used to inhibit native ICaT (Yunker, 2003). The high sensitivity of ICaT to block by Ni 2+  was considered one of the defining characteristics of these Ca 2+  channels. In confirmation, whole cell patch clamp analysis of cloned Cav3 channel isoforms expressed in both HEK-293 cells and Xenopus oocytes showed sensitivity to inhibition by Ni 2+ with IC50 values ranging from 12 to 250 M in HEK-293 cells and from 5.7 to 167 M in oocytes (Lee et al., 1999a). Among the three T-type isoforms, Cav3.2 is the most sensitive to Ni 2+ . Using chimeric channels and site-directed mutagenesis, the structural determinant for inhibition was identified to be dependent on a histidine residue (H 191 ) in the Cav3.2 S3 and S4 loop of domain I and which is predicted to help 15  form a Ni 2+  binding pocket on the extracellular surface of the channel (Kang et al., 2006; Kang et al., 2010). Both Cav3.1 and Cav3.3 channels have a glutamine residue instead of histidine at this site making them less sensitive to Ni 2+ . Trivalent cations (e.g. Y 3+ , Er 3+ , Gd 3+ ,  La 3+ ) also inhibit Cav3.1 channels with Y 3+  being the most potent blocker when recorded in 2 mM Ba 2+  (IC50 = 28 nM) (Beedle et al., 2002).  While toxins derived from numerous invertebrates have been utilized in the study of various HVA Ca 2+  channels (Doering and Zamponi, 2003) relatively little is known about the sensitivity of T-type channels to peptide toxins. Kurtoxin, a peptide isolated from scorpions (Parabuthus transvaalicus), was reported to block both recombinant Cav3.1 and Cav3.2 channels (Chuang et al., 1998) and ICaT recorded from thalamic neurons (Sidach and Mintz, 2002). In both cases, the kurtoxin effect was voltage-dependent and involved a modification of channel gating. Recently, two independent groups of investigators reported two peptide toxins isolated from the tarantula, Thrixopelma pruriens, to potently inhibit cloned Cav3.1 and Cav3.2 channels (Edgerton et al., 2010; Ohkubo et al., 2010). ProTx-I blocked Cav3.1 and Cav3.2 channels with 160-fold higher potency towards Cav3.1 (IC50 values of approximately 0.2 M for Cav3.1 and 32 M for Cav3.2). Likewise, ProTx-II potently inhibited Cav3.1 channels (IC50 value of 0.8 M) and was found to induce a positive shift in the voltage-dependence of activation and to decrease the maximum macroscopic conductance (Edgerton et al., 2010). In this regard, the application of either ProTx-I or ProTx-II could be used to study Cav3.2 currents in isolation, particularly in cardiac myocytes. Although significant progress has been made concerning the pharmacology of T-type channels, the identification of T-type isoform-specific blocker remains to be described. Eventually, this will allow for the better characterization of T-type channel properties in cells expressing multiple T-type isoforms and their alternative splice variants.  16     1.2.4 Modulation of T-type calcium channels  Besides the effects of pharmacological agents on T-type channel functional states, T-type channels are also regulated by interactions with various signaling molecules. T-type channels are subject to considerable subtype specific regulation by activation of various G-protein coupled receptors (GPCRs) and second messengers. For example, Rho kinase has been shown to inhibit Cav3.1 channels (Iftinca et al., 2007) while the activation of M1 muscarinic acetylcholine receptors selectively inhibits recombinant Cav3.3 T-type channels (Hildebrand et al., 2007) (Appendix 2). The M1 receptor inhibition is mediated by Gq/11-linked pathways independent of the involvement of downstream signaling pathways such as protein kinase C (PKC), serine/threonine kinases, tyrosine kinase, phosphatases, and phosphoinositide-3-kinase. GPCR- mediated regulation effects on T-type channel activity are predicted to alter Ca 2+  entry and cellular excitability. For example, in the nervous and cardiovascular systems the inhibition of T- type channels by GPCRs could potentially reduce neuronal firing or cardiac automaticity. As this thesis focuses on Cav3.2 channels, discussion will mainly focus on the modulation of Cav3.2 by direct effectors with known modulation sites and activators of GPCRs (Figures 1.3 and 1.4).  The contributions of Barrett and colleagues provided an initial understanding of Cav3.2 channel regulation. The G-mediated inhibition of ICaT via activation of dopamine D1 receptors was initially reported in rat adrenal zona glomerulosa (Drolet et al., 1997). This observation was further explored via co-expression of specific G proteins with recombinant T-type isoforms in HEK-293 cells and it was determined that Cav3.2 but not Cav3.1 channels are specifically inhibited by G and only with G dimers containing the G2 subunits (Wolfe et al., 2003; Hu et al., 2009). Experiments using chimeric Cav3.2 - Cav3.1 channels and fusion proteins demonstrated that Gsubunits directly bind to the domain II-III linker of the Cav3.2 subunit (Figure 1.3). The G-mediated inhibition of Cav3.2 was shown to be voltage-independent and to 17  be specific for Gdimers (Wolfe et al., 2003; DePuy et al., 2006). A cluster of 4 amino acids (P140, V178, G179 and A181) within Gwere identified as critical sites for G inhibition and this region has also been shown to underlie the CaMKII-mediated potentiation of Cav3.2 channels (DePuy et al., 2006).  Barrett’s group also showed that the G-dependent inhibition of Cav3.2 could be mediated by activation of the dopamine (D1) receptor (Figure 1.4) (Hu et al., 2009). They also showed that the G inhibition of Cav3.2 channels is dependent on phosphorylation by protein kinase A (PKA) at Ser 1107  in the Cav3.2 II – III cytoplasmic loop. The G-mediated inhibition of recombinant Cav3.2 channels has also been reported via activation of the corticotrophin-releasing factor receptor 1 (CRF-1) (Tao et al., 2008) (Figure 1.4). Protein kinase pathways were shown not to be involved in this regulation but rather were found to be dependent upon the activation of the cholera-toxin sensitive Gs pathway. Together, G regulation of Cav3.2 channels occurs through either direct binding of Gor via activation of certain second messenger cascades.Interestingly, agonists of the CRF receptors are known to regulate sleep rhythms and T-type channels play a key role in generating thalamic oscillations; therefore it is tempting to speculate that the CRF mediated changes on T-type channel gating might play a role in regulating sleep patterns (Zoumakis et al., 2006; Tao et al., 2008; Iftinca and Zamponi, 2009)  Calcium/calmodulin-dependent protein kinase II (CaMKII) has also been implicated in ICaT regulation. In canine Purkinje cells and ventricular myocytes ICaT has been shown to be regulated by intracellular Ca 2+  (Tseng and Boyden, 1991). In bovine adrenal glomerulosa cells ICaT can be potentiated by increases in intracellular Ca 2+  dependent upon CaMKII phosphorylation (Lu et al., 1994). Barrett and colleagues demonstrated that CaMKII activation underlies the Ca 2+ -mediated potentiation of recombinant Cav3.2 currents expressed in HEK-293 cells (Wolfe et al., 2002). Using chimeric Cav3.2 - Cav3.1 channels, site-directed mutagenesis 18  and glutathione S-transferase (GST) fusion proteins, the same group identified the domain II – III linker as a critical region within Cav3.2 for mediating CaMKII modulation (Figure 1.3). An 1193 LRRAESL 1199  recognition motif located in the domain II – III intracellular linker was implicated as the critical site for CaMKII-dependent modulation of Cav3.2 channels (Welsby et al., 2003). Specifically, the authors attributed the phosphorylation of a serine residue (Ser 1198 ) in the domain II – III linker as the site of CaMKII potentiation (Figure 1.3). CaMKII modulation of native Cav3.2 channels was further explored using adrenal glomerulosa cells. Barrett and colleagues demonstrated that activation of the angiotensin II (Ang II) receptor resulted in CaMKII phosphorylation of native Cav3.2 channels (Yao et al., 2006). Ang II receptor activation increases cytosolic Ca 2+  levels to enhance synthesis and secretion of aldosterone, an identified early pathogenic stimulus that adversely influences cardiovascular homeostasis (Yao et al., 2006). In this regard, CaMKII potentiation of Cav3.2 channels is functionally relevant in Ang II mediated increase in aldosterone release which in turn could alter cardiovascular Ca 2+  homeostasis. Hence, disruption of CaMKII signaling complex in the zona glomerulosa may provide a new therapeutic approach to regulating the production of aldosterone and to the control of cardiovascular disease progression (Yao et al., 2006).  PKA has also been demonstrated to potentiate recombinant Cav3.2 channels (Figure 1.3). Macroscopic currents from Cav3.2 channels are augmented by PKA activity when expressed in Xenopus oocytes and the effect can be mimicked by serotonin when co-expressed with the 5HT7 receptor (Kim et al., 2006). Using chimeric Cav3.2 and Nav1.4 subunits, a sodium channel which is not known to be regulated by PKA (Smith and Goldin, 1996), the authors identified the II-III intracellular linker as being required for the PKA-mediated potentiation of the Cav3.2 channels (Kim et al., 2006). In CHO and HEK mammalian cell lines, PKA-mediated potentiation of exogenous Cav3.2 currents has been reported to occur at physiological temperature (~30 – 37ºC) 19  but not at room temperature (~22 – 27ºC)(Chemin et al., 2007). The PKA-mediated potentiation is contrary to the reported PKA-dependent inhibition of Cav3.2 currents in bovine adrenal glomerulosa cells (Hu et al., 2009).   Protein kinase C (PKC) has also been shown to modulate Cav3.2 channels via activation of certain GPCRs (Figures 1.4). For example, activation of the neurokinin I (NK1)  receptor inhibits Cav3.2 currents via the sequential activation of Gq/11, phospholipase C PLC and PKC (Rangel et al., 2010) (Figure 1.4). The NK1-mediated inhibition of Cav3.2 can be occluded by co-expression with either a dominant-negative form of Gq or regulators of G-protein signaling proteins (such as RGS2 and RGS3T), as well as by bath application of inhibitors of PLCU73122) and PKC (bisindolylmaleimide I).  Cav3.2 channels are also regulated by nitrous oxide and redox agents (e.g. L-cysteine, dithiothreitol (DTT), 5,5’ dithio-bis(2-nitrobenzoic acid) (DTNB)) (Todorovic et al., 2001a; Todorovic et al., 2001b; Joksovic et al., 2006; Nelson et al., 2007b; Nelson et al., 2007a; Bartels et al., 2009) (Appendix 3). The putative extracellular loop connecting the third and fourth segments of domain I (IS3-IS4) of Cav3.2 channels is implicated as the site of modulation by nitrous oxide and redox agents (Figure 1.3). In particular, using chimeric channels and site- directed mutagenesis, the structural determinant for redox modulation was identified to be dependent upon a distinct histidine residue (H 191 ). The endogenous redox agent ascorbate (vitamin C) has also been shown to inhibit recombinant Cav3.2 channels in HEK cells and in DRG and nRT neurons, revealing a novel mechanism of the action of vitamin C in the peripheral and central nervous systems and may function as endogenous modulator of neuronal excitability (Nelson et al., 2007b) (Appendix 3). Considering that Cav3.2 channels are upregulated in the adult diseased heart (Section 1.4.2), the effects of vitamin C might have a protective role in cardiac disease progression. 20   While the modulation of Cav3.2 channels by various effectors is starting to be well understood, multiple possible transduction pathways have been proposed (Figure 1.4). Conflicting reports on the modulation of cardiac ICaT (Cav3.1 and Cav3.2) by GPCRs have been communicated by a number of researchers (reviewed in (Chemin et al., 2006; Vassort et al., 2006; Kang et al., 2007; Salazar et al., 2007) and briefly discussed in Section 1.4.1). The variety of reports can possibly be explained by the existence of multiple splice variants of cardiac Cav3.1 and Cav3.2 channels (Section 1.3 and Chapter 2). To date, no study has reported the effect of Cav3.2 splice variation on the modulation of Cav3.2 channels by GPCRs. Exploring the possibility of splice-variant differential modulation by GPCRs and elucidating the potential mechanisms may explain the reported complexity of GPCR-mediated regulation of cardiac ICaT. It is important to note that the expression of both cardiac Cav3.2 alternative splice variants, GPCRs, as well as their downstream effectors are altered in diseased hearts ((Kang et al., 2007; Salazar et al., 2007; Sato and Ishikawa, 2010) and Chapter 2). Thus, studying GPCR modulation of Cav3.2 variants may contribute to uncovering mechanisms underlying cardiovascular disease as well as in the development of novel therapeutic approaches.  21   Figure 1.3. Effectors with identified modulation sites in the Cav3.2 T-type channel. There are critical sites in the Cav3.2 channel known to be directly regulated by various effectors. Redox agents are known to act on H191 of IS3 – IS4 (brown line). The redox agent ascorbate causes inhibition, while reducing agents such as L-cysteine and DTT mediate potentiation. Cav3.2 channels are inhibited by G binding to the II – III linker (red line), while phosphorylation by CaMKII (at Ser1198) at the site within the II-III linker causes potentiation of Cav3.2 T-type channels.     22   Figure 1.4. Mechanisms of modulation of Cav3.2 T-type Ca 2+  channels by G protein- coupled receptors (GPCRs). Cav3.2 channels are modulated by GPCRs activating G-proteins and related second messenger signaling pathways. The neurokinin I receptor inhibits Cav3.2 channel activity via PKC phosphorylation. Dopamine D1 receptor activation (Gq/11) inhibits channel activation via a direct action of G whereas corticotropin-releasing factor 1 (CRF-1) receptor activation inhibits channel activity via Gs but not involving PLC. CRF-1-mediated inhibition is thought to be caused by Gbinding to Cav3.2. The pathways leading to G inhibition of Cav3.2channels generally occur via activation of Gq/11 and Gs proteins.    1.3 Alternative splicing  Alternative splicing of voltage-gated Ca 2+  channels is an important mechanism for increasing the functional repertoire of these channels. In the cardiovascular system, it is known that alternative splicing of various Ca 2+  handling proteins profoundly affects Ca 2+ -mediated signaling processes in both normal and diseased myocytes (Ladd et al., 2005; Liao et al., 2005; Wang et al., 2006; Liao et al., 2009a).  In general, alternative splicing is the major source of protein diversity amongst organisms (Maniatis and Tasic, 2002; Black, 2003; Stamm et al., 2005; Blencowe, 2006). In typical 23  multiexonic mRNA splicing patterns can be altered via several distinct mechanisms (Figure 1.5). Most exons are constitutive; they are always either spliced out or included in the final mRNA. An alternatively spliced exon that is sometimes included or excluded is called a cassette exon (Figure 1.5A). In some cases, multiple cassette exons are mutually exclusive (Figure 1.5B), producing mRNAs that always include one of several possible exons but not all. Altering the position of one of the splice sites leads to shorter or longer exons (Figures 1.5C and 1.5D). Further, terminal exons can also be switched through the use of alternative promoter (5’ end) and alternative polyadenylation (PA) (3’) sites (Figures 1.5E and 1.5F). Overall, alternative splicing leads to three structural changes: introduction of stop codons, changes in the protein structure and/or changes in the 5' and 3' untranslated (UTR) regions (for reviews see (Black, 2003; Stamm et al., 2005; Blencowe, 2006)). This section focuses on the identification and expression of the alternative splice variants of voltage-gated Ca 2+  channels and their relevance to physiology and pathophysiology.       1.3.1 Overview of calcium channel alternative splicing   Alternative splicing is a versatile process and along with transcriptional regulators can generate complex genetic alterations to modulate cellular responses to developmental, physiological and pathological signals (Lopez, 1998; Garcia-Blanco et al., 2004; Gray et al., 2007). In Ca 2+  channels, alternative splicing occurs at sites important for biophysical properties, trafficking, post-translational modification and coupling to downstream signaling pathways (Gray et al., 2007). The expression of alternative splice variants can be highly variable depending on tissue type, cell type, developmental stage and disease state.  The HVA channels are subjected to extensive alternative splicing. Figure 1.6 illustrates some of the more common alternatively spliced regions of the Cav1.2, Cav2.1 and Cav2.2 24  channels. Functionally distinct alternative splice variants of neuronal Cav2.1 P/Q-type channels have been identified (Soong et al., 2002; Chang et al., 2007). Nine exons at seven loci in the CACNA1A gene were found to be alternatively spliced including one pair of mutually exclusive exons (37a and 37b) at the C-terminus which are important for Ca 2+ -dependent modulation mediated by calmodulin (EF hand) (Soong et al., 2002; Chaudhuri et al., 2004). The EF-hand- like domain controls the activity-dependent enhancement of Cav2.1 channel gating mediated by calmodulin, a phenomenon referred to as Ca 2+ -dependent facilitation (CDF). Alternative splicing in the EF-hand-like domain acts as a molecular switch for CDF of Cav2.1 channels and in mammalian brain occurs in an age- and gender-dependent manner (Chaudhuri et al., 2004; Chang et al., 2007). In both humans and rodents the exon 37b variant is predominantly expressed in early brain development and switches to the exon 37a variant in the adult brain. It is hypothesized that the regulation of expression of alternative splice variants of Cav2.1 channels potentially contributes to neurophysiological specialization during brain development.  The use of an alternative 3' acceptor site in a CACNA1A intron upstream of the last exon (exon 47) introduces a stop codon at the beginning of exon 47 (Soong et al., 2002). As a result, the Cav2.1 channel can exist in long (+47) or short (-47) isoforms. The Snutch laboratory explored the biophysical properties of the two C-terminus variants and the effects of introduced FHM-1 mutations and found that FHM-1 mutations have splice-dependent effects on voltage- dependent gating and kinetic properties (Adams et al., 2009) (Appendix 4). This result suggests a potential role of alternative splicing CACNA1A gene in the molecular pathophysiology of FHM- 1.  Alternative splicing of Cav2.2 N-type channels has also been reported by Lipscombe and others (Bell et al., 2004; Thaler et al., 2004; Castiglioni et al., 2006; Lipscombe and Raingo, 2007; Raingo et al., 2007). The CACNA1B gene has at least two sites of alternative splicing, the 25  domain II – III intracellular loop region (exon 18a) and the C-terminus (exons e37a and e37b). Alternative splicing in the domain II – III linker affects sensitivity to inactivation during trains of action potential waveforms. Compared with Cav2.2 channels lacking e18a, the presence of e18a prevents the channel from entering into closed-state inactivation, leading to sustained Ca 2+  influx (Thaler et al., 2004). N-type channels have been shown to play a significant role in pain processing and exon 37a appears preferentially expressed in nociceptive neurons of DRG (Bell et al., 2004). The presence of e37a produces larger whole cell N-type currents in nociceptive neurons, while exon e37b yields smaller currents. Moreover, a tyrosine residue within the alternative exon e37a has been shown to play a role in N-type channel G-protein-dependent inhibition in nociceptive neurons (Raingo et al., 2007). The inclusion of e37a in Cav2.2 appears to create an inhibitory pathway that is voltage-independent and that substantially increases the sensitivity of N-type channels to opiates. It has been suggested that the Cav2.2 exon e37a variant could be used as therapeutic target for pain management (Raingo et al., 2007).  The alternative splicing of Cav1.2 L-type channels has been studied extensively, with reports showing events related to development (Diebold et al., 1992; Tang et al., 2009), disease pathology (Tiwari et al., 2006; Wang et al., 2006; Tang et al., 2008; Liao et al., 2009b) and tissue-specificity (Liao et al., 2004; Tang et al., 2004; Liao et al., 2005; Tang et al., 2007; Tang et al., 2008) expression. Alternative splicing in the CACNA1C exons 31, 32, and 33 encoding for the IVS3 and IVS3 - S4 regions has been shown to be both tissue and developmentally regulated. The predominant splice combination for the fetal heart and brain appears to be the exclusion of exon 31 and the inclusion of exons 32 and 33 (-31, +32, +33). In the adult heart,  the -31, +32, +33 combination decreases while -31, +32, -33 variant channel increase. Thus, overall exon 33 is downregulated in the adult heart. In adult brain, the -31, +32, -33 combination is lower than in adult heart suggesting tissue-specific expression. Relevant to cardiac pathology, aberrant 26  expression of exons 31, 32 and 33 has been reported in infarcted and failing hearts (Gidh-Jain et al., 1995; Yang et al., 2000; Liao et al., 2009b). Alternative splicing in the IVS3-IVS4 region affects the voltage-dependence of channel activation, revealing a positive shift in the voltage- dependence of activation correlated with increasing IVS3-IVS4 linker length (Tang et al., 2004). In the heart, splice variation in the IVS3-IVS4 region could potentially influence the shape and duration of ventricular APs. This suggests that Cav1.2 splice variation may play roles in the maintenance of muscle excitability and contractility and to also contribute to arrhythmogenesis.  Smooth and cardiac muscle specific expression of Cav1.2 variants have also been reported by Soong’s laboratory (Liao et al., 2004; Liao et al., 2005; Tang et al., 2007). Mutually exclusive exons 8a and 8 encoding the Cav1.2 IS6 region are distributed differentially in heart and smooth muscles (Welling et al., 1997; Liao et al., 2005). The L-type IS6 segment determines channel sensitivity to DHPs, widely used Cav1.2 antagonists to treat cardiovascular disorders (Welling et al., 1997). The smooth muscle exon 8 variant was shown to be more sensitive to inhibition by DHPs compared with exon 8a variant channels. The role of exons 8 and 8a in the severity of disorder associated with Timothy syndrome has also been reported (Splawski et al., 2004; Splawski et al., 2005). Timothy syndrome is a congenital disease affecting various organs, and due to severe cardiac arrhythmia patients do not usually reach adulthood (Liao et al., 2009a). Interestingly, CACNA1C mutations in these patients have only been identified in one of the alternatively splice exons allowing the other exon to function normally. Of note, patients with mutation in cardiac exon 8a experience severe cardiac arrhythmia while patients with mutation in smooth muscle exon 8 have a longer life span (Splawski et al., 2004; Splawski et al., 2005; Liao et al., 2009a).  The level of expression of Cav1.2 channels containing exons 9* and 21 was reported to be higher in the aorta than the heart whereas exon 22 was reported to be more common in the heart 27  than in aorta (Liao et al., 2004; Liao et al., 2005; Tang et al., 2007). Exon 9* is highly expressed in the smooth muscle layer of arteries and whole cell recordings of the exon 9* containing Cav1.2 channels revealed a hyperpolarizing shift in the voltage-dependence of activation relative to Cav1.2 lacking exon 9* (Liao et al., 2004). Exon 9* is located in the Cav1.2 I-II linker immediately downstream of the subunit binding site. Alternative splicing in this region could potentially affect  subunit regulation of Cav1.2 channel function and it remains to be tested whether the addition of 25 amino acids encoded by Cav1.2 exon 9* affects the binding and modulation of different  subunits on Cav1.2. Further, a possible role for the high expression of exon 9* in the arteries is to allow the activation of the channels with slight depolarization and to generate sufficient tension for blood vessels to function (Liao et al., 2005). The process would contribute to Ca 2+  influx that presumably triggers greater myogenic tone or more prolonged contraction of the blood vessels (Jaggar et al., 1998).  Exons 21 and 22 are mutually exclusive exons encoding for the Cav1.2 IIIS2 region. The expression of these exons is either included or excluded in the Cav1.2 transcripts. In the aorta, the level of expression of exon 21 is about three-fold higher than exon 22. Interestingly, in human atherosclerotic patients, upregulation of expression of exon 22 was observed (Tiwari et al., 2006). In addition, the expression of exon 22 was found to have potential association with vascular smooth muscle proliferation. Relevant to cardiac hypertrophy, comparative studies of Cav1.2 alternative splicing between hypertrophic Spontaneously Hypertensive Rats (SHR) and normotensive Wistar Kyoto (WKY) rats has revealed significant changes in patterns of expression of alternative spliced variants (Tang et al., 2008; Liao et al., 2009a). The proportion of aberrant Cav1.2 transcript including both exons 21 and 22 (+21/+22) is higher in hypertrophic SHR than in normotensive WKY. Conversely, in WKY the inclusion of either exon 21 or exon 22 forms the IIIS2 transmembrane segment. The presence of both exons 21 and 22 creates 28  dominant negative effect (i.e. unable to conduct currents) on Cav1.2 channels while the presence of either exon 21 or 22 produces different biophysical and pharmacological properties (Soldatov et al., 1995; Zuhlke et al., 1998; Tiwari et al., 2006; Tang et al., 2008). As Cav1.2 exons (+21/+22) containing channels are predominantly expressed in hypertrophic heart perhaps these channels contribute to the altered electrical activity observed in cardiac hypertrophy. Lastly, exon 22 containing channels are reported to be more sensitive to blocking by DHPs than exon 21 containing Cav1.2 channels (Soldatov et al., 1995; Zuhlke et al., 1998). Thus, perhaps DHPs can be effectively used for management and treatment of atherosclerosis as this disorder is associated with an upregulation of exon 22 containing alternative splice variants.  Overall, alternative splicing of the HVA channel genes changes channel protein sequence and generates novel functional and nonfunctional isoforms. The spatial and temporal expression of alternatively spliced variants likely contributes to the physiological specialization of the splice variant isoforms. In certain pathological states the amount and pattern of expression of splice variants are also altered. Questions now remain as to whether these changes in expression are causes or effects of the disease. Understanding splice variant expression changes during the normal course of development and in disease progression is a major goal of future research in defining the contributions of alternative splicing to physiology and pathophysiology.  29   Figure 1.5. Patterns of alternative splicing in eukaryotic mRNA. Patterns of alternative splicing that are responsible for the generation of distinct transcripts. The types of alternative splicing are depicted above each cartoon. Blue boxes represent constitutive exons, yellow boxes denote alternative exons, bent arrows and vertical arrows correspond to alternative promoter and poly (A) sites, respectively.    30   Figure 1.6. Functionally relevant alternative splicing events in HVA channels. The diagram shows functional domains (arrows) that are altered in Cav1.2, Cav2.1 and Cav2.2 channels as a result of alternative splicing events in CACNA1C (blue), CACNA1B (red) and CACNA1A (green) genes, respectively. Alternative splice variants in these regions are reported to contribute to the differential channel biophysical properties and are also implicated in the pathophysiology of cardiovascular and neurological disorders (Chaudhuri et al., 2004; Thaler et al., 2004; Splawski et al., 2005; Tiwari et al., 2006; Chang et al., 2007; Raingo et al., 2007; Tang et al., 2008).       31     1.3.2 Alternative splicing of T-type calcium channels  T-type channel genes are known to be subject to alternative splicing (Figure 1.7). Using short amplicon PCR colony screening, Mittman and colleagues initially identified two and six alternative splice sites for the human Cav3.3 and Cav3.1 channels, respectively. Alternative splicing of the human Cav3.3 channel gene was found to occur at two sites, one being the variable inclusion of exon 9 (35 amino acids) in the domain I – II linker and the other the use of an alternate acceptor in exon 33, leading to variable inclusion of 13 amino acids in the C- terminus (Mittman et al., 1999a; Mittman et al., 1999b). The splicing events affected channel activation and inactivation kinetics interdependently, suggesting a possible direct interaction between the two regions (Murbartian et al., 2004). Rat brain Cav3.3 channels were also reported to be alternatively spliced with all six splice variants located in the C-terminus between exons 33 and 34 (Murbartian et al., 2002). The electrophysiological properties of the variants displayed similar voltage-dependent gating, but differed in their kinetic properties.  Initial study of alternative splicing in the human brain Cav3.1 revealed broad splicing across exons 14, 25, 26, 34, 35 and 38 (Mittman et al., 1999a; Monteil et al., 2000a). Further studies using fetal and adult human brain cDNA libraries revealed nine additional sites of splice variation (Emerick et al., 2006). The majority of functional Cav3.1 channel splicing occurs in cytoplasmic channel regions. The C-terminus variants (exons 34, 35 and 38) were shown to affect channel gating and kinetic properties. Likewise, alternative splicing in exons 25 and 26 that encode for the Cav3.1 domain III – IV linker also affects gating, activation and inactivation kinetics as well as relative expression during development. Fetal brain transcripts predominantly express cassette exon 26 over the alternate donor exon 25C. In contrast, in the adult brain the relative expression of exon 25C is greater than exon 26. Structurally, exon 25C introduces a consensus phosphorylation site for PKA suggesting that variants resulting from alternative 32  splicing in the III – IV linker could be differentially regulated by cAMP-dependent mechanisms. In regards to regulation of expression of splice variants, the reciprocal relationship between cellular and molecular diversity in the developing brain suggests that splicing progresses with cell differentiation from nearly independent (stochastic) and unbiased splicing in fetal transcripts to strongly concerted (deterministic) splicing in adult transcripts (Emerick et al., 2006). Cav3.1 alternative splice variants involving the III – IV linker were also reported in embryonic day 14 mouse heart (Cribbs et al., 2001) and human gliomas (Latour et al., 2004). Latour et al. demonstrated changes in the relative mRNA expression of Cav3.1 transcripts between normal brain tissues and glioma biopsies suggesting potential contribution of alternative splicing to the pathophysiology of tumors (Latour et al., 2004).  Alternative splicing of Cav3.2 T-type channels has thus far been reported in human testes (Jagannathan et al., 2002), uterus (Ohkubo et al., 2005) and fetal brain (Zhong et al., 2006) as well as in rat thalamus (Powell et al., 2009) (Appendix 5). Using a human fetal brain cDNA library, Zhong and co-workers utilized partial length cDNA (from exon 19 to the 3’-UTR) and overlapping short PCR amplicons to screen for alternative splice variants of Cav3.2 channels (Zhong et al., 2006). The authors identified 12 – 14 alternative splice sites within the Cav3.2 open reading frame (ORF), potentially generating both functional and non-functional transcripts. The majority of functional Cav3.2 splicing occurs in cytoplasmic regions and was found to affect both current kinetics and voltage-dependence of gating (Ohkubo et al., 2005; Zhong et al., 2006; Powell et al., 2009) (Appendix 5).  The role of neuronal Cav3.2 T-type channel alternative splice variants in the pathophysiology of epilepsy was investigated by the Snutch and O’Brien groups (Powell et al., 2009) (Appendix 5). The work demonstrated that the functional effects of a Cav3.2 R1584P mutation in genetic absence epilepsy rats from the Strasbourg (GAERS) model are dependent 33  upon alternative splicing of exon 25. To date, Cav3.2 alternative splicing in the heart has not been explored. In part, this thesis studied cardiac Cav3.2 alternative splicing and the differential expression of alternative splice variants during maturation and cardiac hypertrophy (Chapter 2).    Figure 1.7.  Functionally relevant alternative splicing events in T-type channels. The diagram shows functional domains (arrows) that are altered in Cav3.1, Cav3.2 and Cav3.3 channels as a consequence of different splicing events in CACNA1G (blue), CACNA1H (green) and CACNA1I (red) genes, respectively. Alternative splicing in these regions results in differential channel biophysical properties. Importantly, Cav3.2 alternative splice variants in the III – IV linker have been implicated in the pathophysiology of epilepsy (Zhong et al., 2006; Powell et al., 2009).  34  1.4 T-type calcium channels and the heart  Cardiac voltage-gated Ca 2+  channels are known to contribute to the control of electrical activity of normal and diseased myocardium. Critically, the also play important roles in cardiac pacemaking, conduction, E- C coupling and the genesis of arrhythmias. Two distinct Ca 2+  channel families have been identified in the heart: L- and T-type channels. L-type channels are ubiquitously expressed in the heart and are known to play important roles concerning E-C coupling and pacemaking (Bers, 2001; Bers, 2002; Mangoni et al., 2003). On the other hand, the functional role of T-type channels in cardiac physiology is not entirely clear. This section discusses the expression, modulation and physiological roles of cardiac T-type channels.      1.4.1 Expression, functional roles and modulation  There are two major T-type channel isoforms expressed in the heart; the Cav3.1 and Cav3.2 types (Cribbs et al., 1998; Demir et al., 1999; Cribbs et al., 2001; Perez-Reyes, 2003; Mangoni et al., 2006b; Rosati et al., 2007). In the adult heart, the expression of both T-type isoforms appears restricted to the SA node, atrio-ventricular node (AV) and Purkinje fibers (PF) (Hagiwara et al., 1988; Shorofsky and January, 1992; Xu and Best, 1992; Zhou and Lipsius, 1994; Bohn et al., 2000; Leuranguer et al., 2000; Marionneau et al., 2005; Mangoni et al., 2006b; Rosati et al., 2007).  ICaT has been implicated in playing a role in generating pacemaker depolarization and in contributing to automaticity (Nilius, 1986; Hagiwara et al., 1988; Zhou and Lipsius, 1994; Ono and Iijima, 2005). Cardiac automaticity is a complex physiological function requiring the coordinated activity of the primary pacemaker center (SA node) and that of the conduction system (AV node and PF network) (Boyett et al., 2000; Moorman and Christoffels, 2003; Efimov et al., 2004; Mangoni et al., 2006a; Mangoni and Nargeot, 2008). Automaticity is initiated in the 35  SA node by primary pacemaker cells which propagate the impulse to the atria spreading to the AV node and PF enabling contraction of the entire myocardium (Mangoni et al., 2006a). Using pharmacological tools, the contribution of ICaT in cardiac pacemaking was studied in SA node (Protas and Robinson, 2000; Madle et al., 2001). Using mibefradil to block ICaT in the SA node, the authors showed a dose-dependent reduction of pacemaker activity, observed as the reduction in the slope of the later phase of diastolic depolarization. A similar concentration-dependent reduction of pacemaker activity was also observed with efonidipine (Masumiya et al., 1998). Further, Ca 2+  influx through T-type channels in atrial myocytes triggers the release of Ca 2+  from the SR which in turn activates Na/Ca exchanger currents (INa/Ca) leading to increased Na +  influx and therefore promotes automaticity (Huser et al., 2000). Taken together, the results from these studies support the notion that T-type channels play important roles in cardiac pacemaking and automaticity.  L-type Ca 2+  currents (ICaL) are considered to be the primary trigger for SR Ca 2+  release to induce E-C coupling in normal adult hearts. However, the involvement of ICaT in SR Ca 2+  release in amphibian and mammalian hearts was suggested initially by Morad and Cleeman (Morad and Cleemann, 1987) and supported by later studies using adult guinea pig ventricular myocytes (Sipido et al., 1998). The contribution of ICaT to SR Ca 2+  release was shown to be eliminated when 50 M Ni2+ was added to block T-type channels. In another study examining canine cardiac Purkinje cells it was observed that ICaT is capable of initiating contraction via inducing Ca 2+  release from SR (Zhou and January, 1998).  In immature hearts, cardiac contractility has been reported to be dependent mainly on transsarcolemmal Ca 2+  influx contributed by ICaT and ICaL and reversed mode INa/Ca (Nuss and Marban, 1994; Wetzel and Klitzner, 1996; Haddock et al., 1999; Kitchens et al., 2003; Escobar et al., 2004; Tohse et al., 2004). T-tubules and SR are not fully developed in immature hearts and 36  ICaT supplies most of the Ca 2+  that triggers the contraction in the immature myocardium. In support, Ca 2+  flux and contraction were increased in adult mouse ventricular myocytes overexpressing Cav3.1 T-type channels (Jaleel et al., 2008). Collectively, these studies suggest the notion that T-type channels play a role in E-C coupling, particularly in the developing heart.  Cardiac T-type channels have also been reported to play important roles in the secretion of hormones. Atrial natriuretic peptide (ANP) hormone has been shown to be important in the control of blood pressure as well as in salt and water excretion and an increase in intracellular Ca 2+  concentration in atria and ventricles stimulates ANP secretion (Thibault et al., 1999). The role of T-type channels in the secretion of atrial ANP has been described in rabbit and rat hearts wherein an increase in Ca 2+  flux via T-type channels stimulates atrial myocytic ANP release (Leuranguer et al., 2000; Wen et al., 2000).  Cardiac ICaT is also subject to modulation by G-protein-coupled receptors. In frog atrial myocytes, activators of -adrenergic receptors facilitate cardiac ICaT (Alvarez and Vassort, 1992; Alvarez et al., 1996; Alvarez et al., 2000). Further, atrial myocyte ICaT is tonically inhibited by Gi proteins. Several hormones implicated in playing important roles in cardiac remodelling including endothelin-1 (ET-1) (Furukawa et al., 1992; Izumi et al., 2003), Ang II (Ferron et al., 2003), aldosterone (Okoshi et al., 2004; Lalevee et al., 2005) and corticosteroids (Maturana et al., 2009) have been demonstrated to enhance cardiac ICaT and T-type channel mRNA expression. In addition, estrogen and testosterone have been reported to affect cardiac myocyte ICaT and T-type channel mRNA expression as long term pretreatment (24 to 30 hours) with testosterone on cultured ventricular myocytes increased ICaT density attributed to upregulation of Cav3.1 and Cav3.2 mRNA expression and conversely, acute pretreatment (< 10 minutes) of testosterone decreased ICaT (Michels et al., 2006). Contrary to the effect of long term testosterone treatment, 24 hour estrogen pretreatment resulted in decreased cardiac myocyte ICaT and downregulation of 37  Cav3.2 mRNA (Marni et al., 2009). This suggests that chronic treatment of estrogen and testosterone produce differential effects on the heart, and may which have cardiac implications in hormone replacement therapy.      1.4.2 Developmental regulation and association in cardiac diseases  The expression of the two main cardiac T-type isoforms is known to be differentially regulated during development. Cav3.2 mRNA is highly expressed in the prenatal stage and reduced after birth. In the adult ventricle neither Cav3.1 nor Cav3.2 mRNA are detected (Leuranguer et al., 2000; Ferron et al., 2002; Larsen et al., 2002). In rat atria, the level of Cav3.1 mRNA expression is consistently high throughout development while Cav3.2 mRNA is highest in embryonic tissue to 3 weeks postnatal but becomes undetectable after 5 weeks (Larsen et al., 2002; Larsen et al., 2005).  In murine hearts, developmental changes in Cav3.2/Cav3.1 mRNA expression have been shown by several investigators. Using quantitative RT-PCR analysis on mouse cardiac ventricles, predominant Cav3.2 mRNA expression during the whole embryonic stage has been observed while in adults Cav3.1 mRNA expression was shown to be higher than Cav3.2 although regardless there was no detectable ICaT in ventricular myocytes (Niwa et al., 2004; Mizuta et al., 2005; Yasui et al., 2005).  While ICaT has not been recorded in the  human heart, both Cav3.1 (Monteil et al., 2000a) and Cav3.2 (Cribbs et al., 1998) transcripts have been identified. Downregulation of Cav3.2 expression was also reported in human ventricular myocytes (Qu and Boutjdir, 2001). The reduction in expression of Cav3.2 mRNA could be attributed to regulation by the transcriptional repressor neuron-restrictive silencer factor (NRSF), a neuron-restrictive silencer element (NRSE) binding protein. Kuwahara and colleagues demonstrated a negative correlation of expression 38  between NRSF and Cav3.2 in adult and embryonic mouse ventricles (Kuwahara et al., 2003; Kuwahara et al., 2005). The authors reported that the level of NRSF expression was higher in the adult ventricle than in embryonic and fetal ventricles whereas the opposite pattern was observed in Cav3.2 mRNA (Kuwahara et al., 2001; Kuwahara et al., 2003). They also reported that the first intron of the CACNA1H gene contains NRSE-like sequences (93 – 97% identity) and are well conserved among different mammalian species (Kuwahara et al., 2003; Kuwahara et al., 2005). Taken together, the presence of high amount of NRSF in the adult ventricle perhaps represses Cav3.2 channel expression and may be the reason why Cav3.2 is much reduced or absent in adult mammalian ventricles.  T-type channels have been reported to be associated with the pathophysiology of a number of cardiovascular diseases (Lory et al., 2006; Cribbs, 2010; Ono and Iijima, 2010). Even before the cloning of T-type channels, ICaT was recorded in the diseased myocardium and it had been suggested that the re-appearance of ICaT in diseased hearts contributes to Ca 2+  overload and the genesis of arrhythmias (Nuss and Houser, 1993; Sen and Smith, 1994; Bkaily et al., 1997; Cribbs, 2010). ICaT is re-expressed in hypertrophied ventricles and shows relatively high Ni 2+  sensitivity suggesting Cav3.2 as the underlying the re-expressed T-type isoform (Martinez et al., 1999). Further, in post-myocardial infarcted hearts (PMI) upregulation of Cav3.1 and Cav3.2 mRNA is reported (Huang et al., 2000; Yasui et al., 2005) and in the failing heart of Dahl- sensitive (DS) rats both ICaT and Cav3.1 mRNA re-appear (Izumi et al., 2003). Thus, re- expression of T-type channels may contribute to the molecular remodeling of the diseased heart.  Although, T-type channels are implicated in cardiac hypertrophy and the pathogenesis associated with Ca 2+  overload and arrhythmia, the mechanisms involved in the association of T- type channels with cardiac remodeling remains debatable. Ang II treatment has been extensively used to study cardiac hypertrophy in cultured cardiac myocytes. Ang II induces hypertrophy in 39  cardiac myocytes via binding to G-protein-coupled Ang II Type I (AT1) receptors (see (Molkentin and Dorn, 2001; Dorn and Force, 2005; Heineke and Molkentin, 2006) for reviews). In frog atrial myocytes Ang II increases ICaT (Bonvallet and Rougier, 1989) and in rat ventricular myocytes AngII both increases ICaT and Cav3.1 mRNA expression (Ferron et al., 2003). On the other hand, activation of the AT1 receptor by Ang II in neonatal rat ventricular myocytes enhanced ICaT concomitant with increased expression of both Cav3.1 and Cav3.2 mRNA (Morishima et al., 2009). Recently, Chiang et al. have provided strong evidence implicating the involvement of Cav3.2 T-type channels in the pathogenesis of cardiac hypertrophy (Chiang et al., 2009). Pressure-overload cardiac hypertrophy was suppressed in Cav3.2 knockout mice (Cav3.2 -/- ) but not in mice deficient for Cav3.1 (Cav3.1 -/- ).  Importantly, Ang II-induced cardiac hypertrophy was suppressed in Cav3.2 -/-  mice further implicating Cav3.2 channels as a key component in Ang II hypertrophic signaling. The authors also identified calcineurin/NFAT- dependent pathways as signaling mechanisms responsible for the Cav3.2-dependent cardiac hypertrophy (Chiang et al., 2009). However, in another study eaxmining the role of T-type channels in cardiac hypertrophy, an enhancement of cardiac hypertrophy in aortic banded Cav3.1 -/-  mice was reported (Nakayama et al., 2009). The authors also showed that the enhanced hypertrophy in Cav3.1 -/-  was rescued with the Cav3.1 transgene and dependent upon NOS3- mediated signaling mechanisms. Taken together, the results from the T-type channel knockout models suggest that Cav3.1 and Cav3.2 channels contribute differential roles in cardiac hypertrophy.  Mineralocorticoid and glucocorticoid hormones have also been implicated in cardiac hypertrophy and remodeling (Rossier et al., 2010). Interestingly, these hormones induce the expression of Cav3.2 mRNA and mediate positive chronotropic effect in ventricular myocytes (Rossier et al., 2003; Lalevee et al., 2005; Rossier et al., 2008; Maturana et al., 2009). It was 40  suggested that positive chonotropism as a result of increased Cav3.2 channel activity may predispose the ventricle to arrhythmia. In another report, the expression of Cav3.1 mRNA in neonatal rat ventricular myocytes was upregulated by dexamethasone treatment (BenMohamed et al., 2009).  Enhancement of ICaT activity in cultured neonatal ventricular myocytes by ET-1, a vasoactive peptide associated with cardiac hypertrophy has been reported (Furukawa et al., 1992). Additionally, increases in ICaT and Cav3.1 mRNA levels were found to be correlated with upregulated ET-1 in failing rat hearts, an observation implicating T-type channels in ET-1- induced cardiac remodeling (Izumi et al., 2003). Monocrotaline (MCT), a pyrrolizidine alkaloid, induces right ventricular hypertrophy and also upregulates ICaT as well as Cav3.1 and Cav3.2 mRNA expression (Takebayashi et al., 2006). However, in a separate study, MCT-induced cardiac hypertrophy showed no significant changes in expression of Cav3.1 and Cav3.2 mRNA (Koyama et al., 2009). Interestingly, although the mRNA levels were not altered, an increase in ICaT was observed, an indication that altered ICaT may contribute to right atrial electrical remodeling. In chronic hypoxia in neonatal rat ventricular myocytes, downregulation of ICaT and Cav3.1 mRNA expression has been observed; however, upon reoxygenation recorded currents and channel expression are restored (Pluteanu and Cribbs, 2009). The authors suggested that T- type channels play a significant role in cardiac remodeling induced by hypoxia/reoxygenation injury. Overall, alteration in the expression of T-type channels appears to alter Ca 2+ -mediated signaling processes in the diseased heart. These modifications may affect overall cardiac contractility and electrical activity.  Although recent progress has provided insight into the developmental and pathological regulation of expression of T-type channels, there remains much to learn concerning the mechanisms and the role of these channels in the normal and diseased heart. In addition, it also 41  remains to be determined whether alternative splicing of cardiac T-type channels contributes to cardiac development and pathophysiology.  1.5 Voltage-dependent facilitation of calcium channels  The influx of Ca 2+  into cardiac myocytes through the voltage-gated Ca 2+  channels can be influenced by channel modulation, pharmacological agents and voltage-dependent mechanisms. The potentiation of Ca 2+  currents by a prepulse depolarization is known as voltage-dependent facilitation (VDF). Facilitation of Ca 2+  currents has been reported for both HVA and LVA channels. There are several mechanisms suggested to underlie facilitation of voltage-gated Ca 2+  channels and this section focuses on the potentiation of Ca 2+  currents induced by depolarizing prepulses. The first part of this section focuses on VDF of HVA Ca 2+  channels and the second centers on the VDF of T-type channels. The reported VDF mechanisms and potential contribution to normal and diseased cells are also discussed.       1.5.1 Voltage-dependent facilitation of high voltage-activated calcium channels  The Cav2 channels are well known to display VDF through a mechanism involving the voltage-dependent relief of tonic G-protein-dependent inhibition. G-protein-dependent inhibition is characterized by a positive shift in voltage-dependence of activation, the slowing of time courses of activation and inactivation, and a reduction of peak current amplitude (Bean, 1989b; Kasai and Aosaki, 1989; Lipscombe et al., 1989). Inhibited channels are described as being ``reluctant`` to open and converted by strong depolarization into a ``willing`` state, resulting in facilitated currents (Bean, 1989b; Elmslie et al., 1990; Ikeda, 1991; Patil et al., 1996). This type of modulation has shown to be more common to N-type than P/Q-type Ca 2+  channels (Colecraft 42  et al., 2000; Lee and Elmslie, 2000). Reports from various groups have demonstrated that VDF via removal of G-protein-mediated inhibition occurs specifically through G complexes (Bourinet et al., 1996; Herlitze et al., 1996; Ikeda, 1996; Meza and Adams, 1998). In one study, the structural determinants underlying the interaction between G and Ca2+ channels was investigated using chimeric Cav2.2 - Cav2.1 channels and the domain I and the C-terminus proposed to serve as major interaction sites for G(Zhang et al., 1996) Other studies used a combination of electrophysiological, molecular and biochemical techniques and identified the domain I – II linker of the Cav2 subunit as the critical region for G interaction (Pragnell et al., 1994; De Waard et al., 1995; Witcher et al., 1995; De Waard et al., 1997; Herlitze et al., 1997; Zamponi et al., 1997). Whole cell patch clamp analysis of N-type currents and inclusion of purified G in the patch pipette showed direct evidence for the physical dissociation of a single G underlying the prepulse-induced facilitation (Zamponi and Snutch, 1998). In general, the facilitation of N- and P/Q-type currents plays important roles in neurotransmitter release and synaptic plasticity (Brody and Yue, 2000; Colecraft et al., 2000; Currie and Fox, 2002).  VDF of L-type currents has also been described in skeletal muscle (Sculptoreanu et al., 1993a),  chromaffin cells (Artalejo et al., 1992), neurons (Bourinet et al., 1994; Sculptoreanu et al., 1995; Calin-Jageman et al., 2007)  and cardiac cells (Pietrobon and Hess, 1990; Sculptoreanu et al., 1993b; Xiao et al., 1994; Kamp et al., 2000; Blaich et al., 2010). Distinct from Cav2 channels, the VDF observed for L-type currents has been shown to be dependent upon phosphorylation by PKA (Sculptoreanu et al., 1993b; Sculptoreanu et al., 1993a; Xiao et al., 1994; Sculptoreanu et al., 1995) or by CaMKII (Xiao et al., 1994; Blaich et al., 2010). L-type channel VDF is characterized by a negative shift in voltage-dependent activation ascribed to an increase in open probability. Relevant to cardiac physiology, the facilitation of L-type currents has been suggested to contribute to the increase in cardiac muscle contractile force (Lee, 1987; 43  Fedida et al., 1988a, b).  Prolonged APs, such as those observed in patients with bradycardia, could potentially lead to reactivation and facilitation of cardiac L-type Ca 2+  channels. This would in turn result in an increase in myoplasmic Ca 2+  promoting after-depolarizations and associated arrhythmias (January and Riddle, 1989; Kamp et al., 2000). Overall, changes in intracellular Ca 2+  concentration as a result of VDF may lead to alteration in both inotropic and chronotropic properties of the normal and diseased heart.      1.5.2 Voltage-dependent facilitation of T-type channels  Among recombinant T-type channels, VDF has thus far been only shown for Cav3.3 channels (Klockner et al., 1999; Chemin et al., 2002; Gomora et al., 2002). Facilitated human Cav3.3 T-type channels show a significant increase in current amplitude (20 to 25%) after +100 mV prepulse. Conversely, no facilitation was observed for the rat Cav3.1 isoform and only weak facilitation (~5 %) for the human Cav3.2 subtype (Klockner et al., 1999). The structural determinants responsible for the human Cav3.3 VDF were found to be dependent upon the last 214 amino acids of the distal C-terminus (Gomora et al., 2002).  Prepulse-induced facilitation of native ICaT has been observed in guinea pig coronary smooth muscle myocytes (Ganitkevich and Isenberg, 1991), frog atrial cells (Alvarez et al., 1996; Alvarez et al., 2000), rat bone marrow cells (Publicover et al., 1995) and mouse spermatogenic cells (Arnoult et al., 1997). The facilitation of ICaT has variously been proposed to be due to voltage-dependent modulation, tyrosine phosphorylation, the voltage-dependent relief of tonic inhibition by G-proteins or PKA phosphorylation. Figure 1.6 illustrates the proposed underlying mechanisms of native ICaT facilitation.  Facilitation of ICaT involving a pure voltage mechanism has been proposed for guinea-pig coronary smooth muscle myocytes (Ganitkevich and Isenberg, 1991) and cultured rat bone 44  marrow cells (Publicover et al., 1995). ICaT of guinea-pig smooth muscle myocytes was potentiated twofold by 200 ms prepulse to voltages above -30 mV and saturated at -10 mV. Potentiation of ICaT by longer prepulses (10 s) shifted the voltage-dependency of facilitation to a more hyperpolarized potentials such that saturation occurred at -50 mV and varying the duration of the prepulse showed peak facilitation between 160 and 320 ms. Facilitated ICaT inactivated faster than the unfacilitated currents. Facilitation of ICaT in cultured bone cells was approximately 100% by a 750 ms prepulse to +150 mV. Compared with smooth muscle myocytes, stronger depolarizations were required and robust facilitation was only observed from potentials positive to 0 mV. Changing the duration of the prepulse showed that half maximal potentiation occurred at 250 ms and saturated at 1000 ms. The facilitation in these cells has been suggested to be due to both a shift in gating properties and recruitment of a population of quiescent channels (Ganitkevich and Isenberg, 1991; Publicover et al., 1995).  T-type currents from mouse spermatogenic cells are increased by strong depolarizing prepulses and involving removal of a tyrosine kinase tonic inhibition (Arnoult et al., 1997). The robust facilitation of ICaT in spermatocytes was observed at prepulse potentials positive to -30 mV and the authors utilized membrane permeable inhibitors of tyrosine kinases (tryphostins A47 and A25) to explore the mechanism of facilitation in sperm cells. Tyrosine kinase inhibitors increased basal ICaT and had no effect on facilitated currents while application of phenylarsine oxide (protein tyrosine phosphatase inhibitor) resulted in inhibition of the basal current and prevented facilitation. Thus, facilitation in spermatogenic ICaT is dependent upon the voltage- dependent relief of tyrosine kinase-mediated inhibition.  Relevant to the heart, facilitation of ICaT in frog atrial myocytes was shown to be regulated by both Gs and Gi proteins (Alvarez et al., 1996). ICaT was stimulated by -adrenergic agonists to activate Gs increasing adenylyl cyclase activity and leading to cAMP synthesis. This 45  activity leads to activation of PKA and eventually phosphorylates native T-type channels. The cAMP/PKA-dependent phosphorylation leads to facilitation of ICaT in atrial myocytes. The cAMP/PKA -dependent stimulation could be further enhanced by depolarizing prepulses and prevented by the intracellular application of pertussis toxin (a Gi inhibitor). Thus, the facilitation of ICaT  in frog atrial myocytes is a result of voltage-dependent relief of the Gi- protein inhibitory tone (Alvarez et al., 1996). Interestingly, of the two cardiac T-type channel isoforms (Cav3.1 and Cav3.2), recombinant Cav3.2 T-type channels can be inhibited by G- proteins ascribed to the Cav3.2 channel direct interaction with G subunits (Wolfe et al., 2003; DePuy et al., 2006). Thus, the tonic inhibition observed in atrial cardiac myocytes might be due to direct binding of G subunits to native cardiovascular Cav3.2 channels.  Overall, the role of VDF of T-type channels in the cardiovascular system has not been elucidated. Given that cardiac T-type channels are predominantly expressed in the developing and disease hearts (Section 1.4), it is possible that the VDF of T-type channels plays distinct roles at different developmental stages and pathological conditions. For example, in the immature heart VDF may contribute to the contractility and beating frequency whereas in the diseased heart it may participate in sustaining arrhythmic electrical activity.  46      Figure 1.8. Proposed mechanisms underlying the facilitation of native T-type calcium currents. Multiple molecular mechanisms have been suggested to underlie facilitation of native T-type Ca 2+  currents. Facilitation has been proposed to due to (1) voltage-dependent change in gating mode (orange arrow); (2) voltage-dependent relief of G-mediated inhibition (blue arrow), application of strong depolarizing prepulses removes the inhibition by G resulting to enhancement (facilitated) of Ca 2+  currents during the test pulse; (3) removal of tonic inhibition due to tyrosine kinase phosphorylation (green arrow) or (4) increase in intracellular cAMP and phosphorylation by PKA as a result of Gs activation (red arrow). 47  1.6 Thesis hypotheses and objectives     1.6.1 Hypothesis 1  While there are ten genes encoding Ca 2+  channel 1 subunits, it is predicted that there are perhaps 1000 times as many splice variants, likely with their own distinct functional properties and spatial and temporal expression patterns (Lipscombe et al., 2002; Gray et al., 2007). The structural differences resulting from alternative splicing can affect channel biophysics, drug affinity, trafficking, intracellular localization, protein stability, post translational modification, modulation and coupling to downstream signaling pathways (Stamm et al., 2005; Gray et al., 2007). All T-type channel isoforms are subject to alternative splicing with reports showing changes in expression patterns in different developmental stages and disease states. Specifically, alternative splice variants of Cav3.2 T-type channels have been reported in the brain and in reproductive tissues and associated with disorders such as absence epilepsy (Jagannathan et al., 2002; Ohkubo et al., 2005; Zhong et al., 2006; Powell et al., 2009). Currently, there has been no description of Cav3.2 alternative splicing in the heart. In this thesis, I specifically hypothesize: That alternative splicing in rat cardiac Cav3.2 T-type channels is a mechanism to generate functionally distinct Cav3.2 channels.      1.6.2 Hypothesis 2  Recent trends in alternative splicing research have been directed to profiling functionally relevant transcripts and their role in normal physiology and diseases, particularly on how variants are coordinated on a global level to achieve cell- and tissue-specific functions (Blencowe, 2006). Regulation during development, by environmental stimuli or cellular activity has been shown to contribute to changes in splice variant expression patterns (Diebold et al., 1992; Liao et al., 2004; 48  Schultz Jel et al., 2004; Emerick et al., 2006). Such regulation is likely intended to adapt and compensate in response to changes in the gene expression patterns of other proteins during maturation and in pathological states or to refine electrical properties of ion channels in response to the cascade of changes in the cells and tissues. Of note, developmental and pathological regulation of the expression of a number of alternative splice variants of various cardiac Ca 2+  handling proteins such as CaMII, cardiac troponin T and Cav1.2 channels have been reported (Tang et al., 2004; Ladd et al., 2005; Xu et al., 2005; Tiwari et al., 2006; Tang et al., 2008) In this thesis, I specifically hypothesize: That there is a differential expression of Cav3.2 splice variants between neonatal and adult hearts as well as between adult normotensive and hypertensive SHR rats.      1.6.4 Hypothesis 3  Biophysical characterization of native cardiac ICaT has been studied in Purkinje fibers, SA node, atria and ventricle. However, there has been no description on the correlation between the electrophysiological properties of native ICaT and the expression of alternative splice variants of T-type channels in cultured newborn rat ventricular myocytes. In this thesis, I specifically hypothesize: That there is a correlation between the level of expression of T-type channel alternative splice variants and the biophysical properties of newborn rat ventricular myocytes ICaT.      1.6.5 Objectives  The following thesis objectives were formulated to address the above hypotheses: 49  1. To generate both short amplicon and full length Cav3.2 specific cDNA libraries to determine the molecular profile of cardiac Cav3.2 T-type  channel alternative splice variants. 2. To examine the differential expression of splice variants in ventricular tissue from newborn and adult rats and to compare the relative abundance of splice variants between hypertrophic SHR and age- and sex- matched normotensive WKY rats. 3. To generate selected full-length Cav3.2 alternative splice variants and to functionally characterize their biophysical properties after transient expression in HEK- 293 cells. 4. To investigate if the Cav3.2 variants are differentially affected by G-protein subunits co- expression or intracellular cAMP. 5. To characterize native T-type currents in neonatal rat ventricular myocytes.  50  2 SPLICE-VARIANT CHANGES OF THE Cav3.2 T-TYPE CALCIUM CHANNEL MEDIATE VOLTAGE-DEPENDENT FACILITATION AND ASSOCIATE WITH CARDIAC HYPERTROPHY AND DEVELOPMENT 2.1 Introduction  Alternative splicing is a ubiquitous post-transcriptional mechanism for generating diversity from individual genes and significantly expands the functional repertoire of eukaryotic cells (Black, 2003; Stetefeld and Ruegg, 2005). Greater than half of known human genes are subject to alternative splicing (Modrek and Lee, 2002) and splice-variant expression patterns often correlate with specific developmental stages as well as specific physiological and pathophysiological states (Diebold et al., 1992; Lopez, 1998; Chang et al., 2007; Adams et al., 2009) (Appendix 4). Cardiovascular diseases have been associated with altered regulation of alternative splicing and changes in the expression ratio of functionally relevant proteins, including some voltage-activated Ca 2+ channels (Warnecke et al., 1999; Tiwari et al., 2006; Shang et al., 2007; Kong et al., 2010). The expression of distinct Ca 2+  channel subtypes contributes to mechanical and electrophysiological functioning of different regions of the heart (Mangoni et al., 2003; Hatano et al., 2006).  However, the identification and temporal and spatial expression patterns of alternatively spliced variants of most Ca 2+  channel family members expressed in cardiac tissue has yet to be reported. Low voltage-activated T-type currents play a critical role in spontaneous diastolic depolarization (Mangoni et al., 2006b) and have also been  _____________ *A version of this chapter has been published. David, L.S., Garcia, E., Cain, S.C., Thau, E.M., Tyson, J.R., Snutch, T.P. 2010. Splice-variant changes of the Cav3.2 T-type calcium channel mediate voltage-dependent facilitation and associate with cardiac hypertrophy and development. Channels (Austin). 4(5):375-389. 51  suggested to regulate the cell cycle and differentiation of cardiac myocytes (Vassort et al., 2006). Of the three genes encoding T-type channels in mammals, the Cav3.1 and Cav3.2 isoforms have been identified as underlying cardiac ICaT (Perez-Reyes, 2003; Rosati et al., 2007; Mangoni and Nargeot, 2008). Both the Cav3.1 and Cav3.2 T-types are expressed in atrial and ventricular tissues during embryonic and neonatal periods (Cribbs et al., 2001; Ferron et al., 2002; Niwa et al., 2004) but by the adult stage Cav3.2 levels become significantly reduced and Cav3.1 becomes the predominant cardiac isoform, albeit mainly being restricted to pacemaker cells (Qu and Boutjdir, 2001; Mangoni and Nargeot, 2008). In addition to developmental regulation, there is an overall increase in functional ICaT under pathological conditions such as post-myocardial infarction and cardiac hypertrophy and both Cav3.1 and Cav3.2 T-type Ca 2+  channels have been reported to be re-expressed in adult ventricle of diseased hearts (Nuss and Houser, 1993; Martinez et al., 1999; Huang et al., 2000; Yasui et al., 2005; Takebayashi et al., 2006). Specific expression of the Cav3.2 T-type  channel has also been associated with the pathogenesis of pressure overload-induced cardiac hypertrophy in mice (Chiang et al., 2009).  All three T-type Ca 2+  channel genes are known to be subject to alternative splicing (Mittman et al., 1999b; Monteil et al., 2000a; Chemin et al., 2001a; Chemin et al., 2001b; Cribbs et al., 2001; Jagannathan et al., 2002; Murbartian et al., 2002; Ohkubo et al., 2005; Emerick et al., 2006; Zhong et al., 2006). In human fetal and adult brains, Cav3.1 was shown to have 15 sites subject to alternative splicing (Monteil et al., 2000a; Emerick et al., 2006), while two sites of alternative splicing have been reported to date for the human Cav3.3 channel (Mittman et al., 1999b; Chemin et al., 2001b). Examining human fetal brain and partial length splice-variant analysis, Cav3.2 channels were shown to be alternatively spliced at 12 to 14 sites (Zhong et al., 2006). Human uterine and testicular Cav3.2 T- Ca 2+  channels have similarly been found to be alternatively spliced, particularly in the domain III-IV linker region (Jagannathan et al., 2002; 52  Ohkubo et al., 2005). In a number of these instances, alternative splicing has been shown to affect T-type channel biophysical properties (Jagannathan et al., 2002; Ohkubo et al., 2005; Zhong et al., 2006). To date, there has been no report concerning cardiac Cav3.2 T-type channel alternative splicing. A goal of the current study was to describe structural and functional composition of Cav3.2 channel variation in cardiac tissue from newborn rats and to then compare that with the splice-variant profile from adult heart. Additionally, this study hypothesized that under certain pathological conditions there might be changes in Cav3.2 T-type channels in both overall expression and the level of specific splice variants. Profiling of splice variants was performed using both short amplicon scanning and full-length cDNA screening, and combined with quantitative RT-PCR (qRT-PCR) using cardiac samples from newborn and adult male Wistar rats, as well as from hypertrophic SHR and age and sex-matched normotensive WKY animals. The study demonstrates developmental changes in the expression pattern of the most abundant alternatively spliced Cav3.2 transcripts in rat atrial and ventricular tissues. Furthermore, altered transcript ratios of the predominant Cav3.2 isoforms in the left ventricle of adult SHR were found to correlate with histopathological signs and the expression of molecular markers of pathological hypertrophy. In addition to a switch in variants with a distinct recovery from inactivation, this study finds that a major characteristic of Cav3.2 splicing is the generation of T- type Ca 2+  channels that exhibit voltage-dependent facilitation (VDF).  53  2.2 Results     2.2.1 Alternative splicing generates multiple Cav3.2 T-type variants with differential expression across development  Utilizing subtype-specific probes and both qRT-PCR and Western blot analyses, the expression of the Cav3.1, Cav3.2 and Cav3.3 T-type isoforms as well as the high voltage- activated (HVA) Cav1.2 L-type and Cav2.2 N-type Ca 2+  channels was determined in neonatal (P0) and adult atria and ventricle (relative to actin B). Figure 2.1A and 2.1B shows that the Cav3.1 and Cav3.2 T-types and Cav1.2 L-type Ca 2+  channels were robustly expressed at the mRNA and protein levels in both cardiac chambers of neonate heart. Contrastingly, in adult animals the expression of both T-type isoforms was significantly lower in the ventricle while the level of expression of the Cav1.2 L-type remained high in both adult heart chambers. Neither the Cav3.3 T-type nor Cav2.2 N-type channels were expressed at appreciable levels in neonate or adult heart chambers (Figure 2.1A). The rat Cav3.2 genomic locus spans ~110, 000 kb on chromosome 10 (NCBI, NC 005109; Ensembl, ENSRNOT00000048392). In order to identify Cav3.2 splice variants expressed in neonate heart, comprehensive transcript screening was initially performed using short amplicon scanning (Figure 2.1C). The reference Cav3.2 transcript used in this study corresponds to a transcript containing 35 exons across 7862 bp and encoding 2365 amino acids (Ensembl, ENSRNOT00000048392). Distinct from previous reports examining limited portions of the Cav3.2 channel for variability (Jagannathan et al., 2002; Ohkubo et al., 2005; Zhong et al., 2006), the entire open reading frame (ORF) of rat cardiac Cav3.2 transcripts was subject to systematic splice-variant analysis. In the present study, a total of 11 overlapping PCR amplifications each covering at least two exons and generating products between ~450 and ~1070 base pairs were subcloned and between 40 and 203 individual cDNAs from each of the 54  amplicon reactions were subject to DNA sequence analysis (Figure 2.1C). Sequences were searched against available databases and aligned with rat Cav3.2 genomic (NCBI, NC 005109 and Ensembl, ENSRNOT00000048392) and cDNA (NM_153814) sequences. 55   Figure 2.1. Ca 2+  channel expression in rat cardiac tissues and identification of Cav3.2 alternative splice variants. 56  Panel (A) shows the relative mRNA expression of the T-type Cav3, and the high-voltage activated Cav1.2 and Cav2.2 channels obtained using qRT-PCR to compare the overall level of isoform expression between newborn and adult cardiac tissues. Adult thalamic tissue is shown for comparison. Cardiac tissue displays high levels of expression of Cav1.2 and T-type Cav3.1 and Cav3.2, whereas neuronal Cav2.2 is negligible. Both Cav3.1 and Cav3.2 channels are expressed in cardiac tissues but a significant reduction was observed in adult ventricles, compared to newborn cardiac chambers. qRT-PCR reactions were run in triplicate and averages were determined. Relative amounts were compared to actin B and means were calculated. All experiments were done using 3-6 rats. Error bars show mean ± standard error. (B) Western blot analysis showing a significant level of Cav1.2 isoform protein expression at both developmental stages, whereas Cav3.1 and Cav3.2 are prominently expressed only in newborn tissues. In the adult heart T-type channel proteins are moderately expressed in atria and at much lower levels in the ventricle. Panel (C) is a schematic of the Cav3.2 protein sequence to illustrate the strategy used to identify alternative splice variants. Numbers along the peptide sequence indicate the exon number (total of 35), and numbers on filled bars correspond to the short amplicon overlapping PCR reaction sequences used for exon scanning (bottom left). Horizontal arrows at N- and C- terminus of the channel correspond to the full-length amplification (bottom right). See Section 2.4.4 for details.  57   Twenty five in-frame/carboxyl variants occur at 10 distinct sites in the Cav3.2 protein (Figure 2.2 and Table 2.1). Analysis of 392 short amplicon cDNAs generated from neonate atrial RNA identified six in-frame and truncated C-terminus variants compared to the parental Cav3.2 channel: called 8a/9a, 20a, -25, 35a, 35c and 210 (Figure 2.2). Further analysis of 557 short amplicon cDNAs from neonate ventricle identified 14 in-frame variants and truncated C- terminus compared to the parental Cav3.2 channel, ten of which were unique to the neonate ventricular RNA: called variants 1a, 7, 8b, 8c, 28a/29a, 33b/34a, 35b, 35e, 214 and 304, and four of which had also been identified in neonate atria (8a/9a, 20a, -25, 210; Figure 2.2). In order to put the individual amplicon variants into context, full-length Cav3.2 cDNA was amplified from both atria and ventricle neonate RNA and 56 individually isolated full-length ventricle cDNAs and 50 full-length atria cDNAs were subject to complete DNA sequencing. In addition to placing some of the amplicon variants into their larger expression context, the full- length analyses identified a further eight Cav3.2 channel in-frame variants: called 1b, 7a/8d, 9c, 20b, 24a, 33a, 34b and 35d (Figure 2.2).   Alternative splicing mechanisms associated with the identified variants are suggested to include deletion and insertion of cassette exons, alternative donor/splice sites, splicing within exons, and retained introns (Black, 2003). In the amino-terminus, in-frame deletions within exon 1 result in removal of either 16 amino acids (variant 1a) or 8 amino acids (variant 1b). Further downstream, the domain I-II linker region possesses a high degree of variation with five distinct isoforms identified; variants 8b, 8c, 7a/8d, 8a/9a and 9c. An example of a canonical cassette-type exon is the inclusion (+) or exclusion (-) of exon 25 encoding residues in the domain III – IV linker, notable as a site of splice variation previously implicated in regulating voltage-dependent properties of Cav3.2 channels (Jagannathan et al., 2002; Ohkubo et al., 2005; Zhong et al., 2006; 58  Powell et al., 2009) (Appendix 5). In this same region, further neonate cardiac variation results from the partial insertion of 24 nucleotides to the end of exon 24 (called variant 24a).  In domain III, splicing due to an alternate splice acceptor site internal to exon 20 (variant 20a) leads to a 15 amino acid deletion in the cytoplasmic IIIS2 – IIIS3 region and the partial insertion of intron 20 (20b) confers a 7 amino acid insertion (SPLPGCR) in domain IIIS3 (Figure 2.2). In domain IV, the use of alternate donor and acceptor splice sites in exons 28 and 29 respectively results in an in-frame deletion of 39 amino acids in domain IVS4 (called 28a/29a). The most extensively spliced region in Cav3.2 channels expressed in neonate heart occurs at the carboxyl-terminus and including the parental variant could result in up to 12 distinct carboxyl- terminal isoforms. The newly identified variants include 33a, 214, 210, 304, 33b/34a, 34b, 35a, 35b, 35c, 35d and 35e. The first four of these terminate at the same stop codon (last four amino acids, DEPV) whereas the remaining seven result in alternative carboxyl stop sites, all of which except 33a are shorter versions of the canonical C-terminus. The 33a splice variant contains the longest C-terminus due to inclusion of 5 additional amino acids (PPSPQ) at the proximal end. There are several contextually noteworthy aspects evident from the 106 full-length Cav3.2 cDNAs analyzed. Variants 1b, 7a/8d, 9c, 20a, 24a, 33a and 214 always occurred in combination with the (-)25 exon splice variant whereas the 34b isoform occurred in combination with the (+)25 variant. Further, variant 35a was found in combination with either of the (+) or (-) exon 25 splice isoforms. In the full-length Cav3.2 cDNA there were a number of combinations of individual exonic variants: e.g., 20b/-25/33a and 20a/-25/35d. Generally, across both the amplicon and full-length analyses the majority of the Cav3.2 variants were found to be expressed in either atria or ventricle with a smaller portion being expressed in both chambers (8a/9a, 20a, +/-25, 35a and 210). 59   Figure 2.2. Topology of Cav3.2 channel showing the location of all in-frame and truncated carboxyl terminal variants. Twenty five identified in-frame and truncated carboxyl-terminus Cav3.2 variants are located at 10 different sites as indicated in the diagram. The amino acid sequences (single letter code) resulting from each alteration are depicted below. Alternative splice variants are named after the alternatively spliced exons and letters after the exon number correspond to the different variants in that particular exon. (-) and (+) correspond to the absence and the presence of the indicated 60  exon. The symbol  followed by a number (n) refer to a deletion n amino acid. When alternative splicing affects consecutive exons, the variants are named using both exon designations separated by a slash. All sequences were aligned using published rat Cav3.2 genomic and mRNA sequences (NCBI, NC 005109; Ensembl, ENSRNOT00000048392; and NM_153814). Italicized, underlined and bold indicate deletion, insertion and alternative sequences, respectively. A dash (- ) in the peptide sequences correspond to the start and end of deleted amino acids. Out of frame splice variants resulting into premature chain termination, hemichannels or interdomain truncations are not shown. 61   Table 2.1. Identified cardiac Cav3.2 T-type Ca 2+  channel variants. Italicized, underlined and bold indicate deletion, insertion and alternative sequences, respectively. A slash (-) in the peptide sequences correspond to the start and end of deleted amino acids. Sequences were aligned using published rat Cav3.2 genomic and mRNA sequences. The variants reported here are in-frame insertions and deletions as well as in-frame truncations in the carboxyl-terminus. ________________________________________________________________________________________________________________________________________________ ________ Location  Variant  Nucleotide Sequence     Peptide Sequence 1  1a  gccg - ccggcccc.......ctggggcg - ccgg   GASP - PAPA……..SPGA - PGRE   1b  cgcc - ggtgagg........gcgagccc - tggg    PAA – PVRASPAS - PGA  2  7  tcttccag - gtcatcac….tcatcatt - gtgggctc   AIFQ - VITL……..LLII - /VGSF  3  7a/8d   cctcctca - tcattgtg….gctcctca - agtatgta   FILL - IIVG……..EELL - KYVG   8b  aagtatgt - aggccaca..ccatcccc - aggccatg  LKYV - GHIF..…...PPSP - GHGP   8c  aggccatg - ggccacca..cgtggagg - ggccgcag  SPGH - GPPD ………..CHVE - GPQE  4  8a/9a  ccctatga - gaagatcc...ccactgcg -  gaaggcct  RPYE - KIQH …...TPLR - KASQ   9c  agcctcta - gccacctg.........cacaccag - gccacagc  RASS - HLSG………GTPG - HSNE  5  20a  tggtgaag - gtggtagc...acctacag - agcagttg  MMVK - VVAL…….AYLQ - SSWN   20b  ctctgagatcccctctgcctgggtgcagggtcat   LRPLRSPLPGCRVIS  6  24a  gcgcaggagtaaggcggcccccaaggtggaggaggcccag  ERRRRSKAAPKVEEAQR   +25  gcgcaggagcactttccccaacccagaggcccag   ERRRRSTFPNPEAQ   -25  gcgcagga – gcactttccccaacccag - aggcccag  ERRRR – STFPNP - KAQ  7  28a/29a  gccctgcc - catcaatc...gctctgcc - tcaggtag  AALP - INPT…….QALP - QVGN  8  33a  cagcacagcctccctcaccacaggaaagcca   PTAQPPSPQESQG  9  33b/34a  cccactgc - aggaagtg..tcacctctgc - tcactcgcc  SHPLLTRHPWSPAPL…GVHPALstop   34b  ctacacag - gcccggt….ctttccag - gtcccatcagc  ETYTGPISRVLPSQGQstop  10  35a  cctagagtcc - ggggaagt...ctggggcc - aggcctct  HLESRPLAEQSIstop   35b  tcccctcc - gtgctccc....tgccctcc - atagggac  MSTSQASTGAPRSPPstop   35c  ctcgaacc - agctcttg....gaggggacc - ctgtagcc  SELEPCSQGstop   35d  gcatcaac - aggtgccc...tccccaac - tttgcctt   SQASTLPLSLWTWA…TVTKVstop   35e  cagactacacag - agcc...gctggggccag -gcctct  IPDYTGLLPSRASDCPQLCLstop   214  cacgagcc - aggcatca...ctggggcc - aggcctct  MSTS - QAST……ERWG – QASCR….DEPV   210  cagagcct - gctgaaaa...cagagcct -  acagaagg  YTEP - AENMST…CPEP – TEGP……DEPV   304  atgtccac - gagccagg...ccagccac - tcctgccc  ENMST - SQAST…STPAT – PAPDD…DEPV ________________________________________________________________________________________________________________________________________________ 62   From the combined short amplicon scanning and full-length cDNA analyses, six distinct variant regions were chosen for more in-depth expression analysis in newborn and adult heart chambers by qRT-PCR: Cav3.2(8b) in the domain I – II linker, Cav3.2(20a) between domain IIIS2 and IIIS3, Cav3.2(±25)  in the domain III – IV linker and three carboxyl-terminal variants - Cav3.2(33a), Cav3.2(214) and Cav3.2(35a) located at the proximal, middle and distal portions of the C-terminus (Figure 2.3).  In T-type channels the cytoplasmic regions mentioned above have been implicated in gating (Chemin et al., 2001a; Vitko et al., 2007), surface expression (Vitko et al., 2007) and G- protein-dependent regulation (Wolfe et al., 2003; DePuy et al., 2006). For some variant positions the reference isoform predominates in both neonate and adult and in both chambers (Figure 2.3), while in other instances there is clear evidence that both variants are co-expressed at different levels (e.g., +/-25, 35a vs reference). Of the six Cav3.2 variants analyzed by qRT-PCR only the (+/-) exon 25 showed a significant difference in relative abundance across newborn and adult hearts and in both atria and ventricle (Figure 2.3C). In the human brain, testis, and uterus the Cav3.2 exon 26, which is homologous to the exon 25 described here, has been previously implicated in affecting activation, channel availability and recovery from inactivation (Jagannathan et al., 2002; Ohkubo et al., 2005; Zhong et al., 2006). It was therefore of interest to target this variant region for more in-depth transcript copy number analyses in the heart. Figure 2.4 shows the transcript copy numbers of Cav3.2 (+25) and (-25) exon splice variants normalized to rat ActB. In neonate heart the exclusion of exon 25 occurred at a level 7 to 8 fold higher in atria and ventricle tissues compared to (+25) exon variant transcripts. Contrastingly, in adult atria the relative copies of (+25) exon variant transcripts were increased while adult ventricular (-25) transcripts decreased such that overall the ratio of (+25) to (-25) variants in both adult heart chambers was approximately equal (Figure 2.4). Taken 63  together, there appears to be a significant developmental- and chamber-specific mechanism regulating the relative expression of Cav3.2 (+25) and (-25) variant channels. 64    Figure 2.3. Differential expression of Cav3.2 T-type Ca 2+  channel alternative splice variants in newborn and adult cardiac tissues. 65  Relative mRNA levels of Cav3.2 splice variants were obtained by qRT-PCR and compared at two developmental stages. Alternative splice variants 8b (A), 214 (B), -25 (C), 35a (D), 33a (E) and 20a (F) display different levels of expression in neonatal and adult atria and ventricle. The (- 25) variant is the most abundant in neonate while both (+) and (-) exon 25 variants are present in approximately equal amounts in adult heart. Experiments were performed using 3 - 6 rats for each sample and qRT-PCR reactions were performed in triplicate. Error bars correspond to standard error. A schematic representation of each splice variant is shown in each graph. Gray box represents an alternative start to a given exon, gaps represent deletions, and open boxes the reference sequence of each exon. Y axis scale represents relative expression compared to ActB. NeoA (neonatal atria), NeoV (neonatal ventricle), AdA (adult atria), AdV (adult ventricle). Each variant probe was checked for specificity against its parental cDNA before qRT-PCR analysis.  66   Figure 2.4. Spatial and developmental changes in the expression of Cav3.2(+25) and Cav3.2(-25) exon splice variants. Panel (A) shows developmental differences in the relative number of transcript copies of Cav3.2 (+25) and (-25) splice variants. There is preferential expression of (-25) Cav3.2 variant channels compared to (+25) alternative splice variant in newborn ventricle and atria. Approximately the same level of mRNA expression of both exon 25 variants was observed in adult heart. The developmental shift in the proportion of exon 25 variants expressed in cardiac chambers is shown on panel B. (B) A ~7 to 8 fold difference in the ratio of (- 25) over (+ 25) exon variant copy number was obtained using specific qRT-PCR probes and titration against quantified cDNA clones from each respective variant and then normalized relative to rActB levels. Error bars show standard error. T-tests were performed to measure significant differences. ** p<0.01. NeoA(neonatal atria), NeoV(neonatal ventricle), AdA(adult atria), AdV(adult ventricle).  67  2.2.2 Exclusion of exon 25 confers voltage-dependent facilitation and accelerates recovery from inactivation  The full-length cDNA screening revealed that Cav3.2 channel variants in neonate heart predominantly occur in the context of exclusion of exon 25 (also see Figures 2.3 and 2.4). In this regard, several full-length variants in the context of the (-25) isoform were analyzed following heterologous expression in HEK cells using whole-cell patch-clamp. Biophysical characterization was performed on the following variants identified by full-length cDNA screening: Cav3.2(-7/-25),  Cav3.2(20a/-25), Cav3.2(20b/-25), Cav3.2(-25), Cav3.2(+25), Cav3.2(24a/-25), Cav3.2(33a/-25), Cav3.2(214/-25), Cav3.2(35a/-25) and Cav3.2(35a/+25). This research also analyzed the Cav3.2(8b/-25) variant which was identified by short amplicon screening. Cav3.2(8b/-25) splice variant is located at the I - II linker, a region implicated in controlling gating and plasma membrane surface expression (Vitko et al., 2007).  Examination of current densities from macroscopic Ca 2+  currents showed that Cav3.2(+25), Cav3.2(214/-25), Cav3.2(35a/-25) and Cav3.2(8b/-25) variants had significantly higher current densities (30.34 ± 4.13, 31.60 ± 5.95, 38.39 ± 5.70, 66.14 ± 17.45 pA/pF, respectively) compared with the Cav3.2(-25) variant (21.64 ± 1.88 pA/pF). The parameters of voltage-dependent gating properties are summarized in Table 2.2. Overall, exon 25 containing variant channels displayed small but significant differences in the voltage dependence of activation. Cav3.2(8b/-25) and Cav3.2(+25) showed ~10 mV and ~5 mV leftward shifts in the V50act relative to Cav3.2(-25) (Figure 2.5A and Table 2.2). In regards to steady-state inactivation, a 10 mV hyperpolarizing shift was observed when Cav3.2(8b/-25) (V50inact = -75.7 ± 0.3 mV) was compared with Cav3.2(-25) (V50inact = -65.5 ± 0.3 mV)(Figure 2.5C and Table 2.2). The voltage- dependence of deactivation as well as the kinetics of Ca 2+  currents generated by expressing the splice variants was also analyzed. The proximal C-terminus splice variant Cav3.2(33a/-25) and 68  the alternative exon 24 variant Cav3.2(24a/-25) were only the two alternative splice variants showing changes in the kinetics of activation and inactivation compared to Cav3.2(-25) (Table 2.2). Cav3.2(-7/-25) and Cav3.2 (20a/-25) did not yield measurable Ca 2+  currents whereas Cav3.2(20b/-25) showed low level of expression. All eight fully characterized splice variants examined showed similar voltage-dependence of deactivation (Table 2.3).  The recovery from inactivation was investigated using a double pulse protocol (Fig. 2.6A inset) and time constants obtained by fitting a double exponential function are shown in Table 2.3. Cav3.2(-25) channels recovered significantly faster (~ 1 second) from inactivation than Cav3.2(+25) channels (~2.5 seconds; Figure 2.6A and Table 2.3). Interestingly, compared to Cav3.2(+25) channels, Cav3.2(-25) channels recover from inactivation to a level greater than 100%, suggesting facilitation (or potentiation) of this variant. The distal carboxyl-terminus variant Cav3.2(35a) also displayed significant potentiation when expressed in combination with Cav3.2(-25) but not when expressed in a Cav3.2(+25) background (Figure 2.6A), suggesting that exclusion of exon 25 residues located in the domain III – IV linker are a structural determinant for the observed facilitation. Additionally, the relative proportion of the channels recovering from fast (1) and slow (2) inactivation was estimated by obtaining the ratio between the current amplitude of each component and the total current amplitude. The fast inactivation component (relative A1) is predominant in Cav3.2(-25) (Table 2.3). In contrast, the slow inactivation component (relative A2) is higher in Cav3.2(+25) than Cav3.2(-25). Representative current traces of recovery from inactivation for Cav3.2(-25) and Cav3.2(+25) variants are shown in Figures 2.6B and 2.6C, respectively. In order to further investigate if the potentiation observed in Cav3.2(-25) variant could be attributed to VDF, two pulse protocols were used as shown in Figure 2.6D and 2.6F. Percentage of VDF (Figure 2.6E) was measured as the ratio of current magnitude evoked by a test pulse at -30 mV applied after a strong depolarizing prepulse 69  (+120mV) over the current magnitude in the absence of prepulse. The time course was determined by increasing the time intervals (from 300 ms to 1500 ms) between the prepulse and the test pulse (Figure 2.6D). Voltage dependence of facilitation was then explored by applying prepulses from -120 mV to +150 mV with a constant interpulse interval of 1200 ms (Figure 2.6F). The robust VDF displayed by Cav3.2(-25) (50-60%) was absent in the Cav3.2(+25) splice variant (Figure 2.6E). Furthermore, Cav3.2(35a/-25) also showed facilitation properties (50 – 60%) (data not shown), consistent with an increase in fractional recovery (Figure 2.6A) when expressed in the Cav3.2(-25) background, but not when expressed in combination with Cav3.2(+25), suggesting that exclusion of exon 25 in the rat Cav3.2 III-IV linker region is associated with VDF. This property was also observed when Ba 2+  was substituted for Ca 2+  in the external recording solution. The degree of relative facilitation for both the Cav3.2 (-) and (+) exon 25 splice variants showed no significant difference regardless of whether Ca 2+  or Ba 2+  was the charge carrier thereby affirming the facilitation as being voltage-dependent (Figure 2.7). The magnitude of facilitation elicited by strong depolarizing prepulses was also examined in stable cell lines expressing human Cav3.1 and Cav3.3 isoforms and compared with that observed for the Cav3.2(+/-25) splice variant (Figure 2.8). Consistent with previous studies (Klockner et al., 1999; Gomora et al., 2002), Cav3.3 channels display an approximate 20% VDF, significantly smaller than that reported here for Cav3.2(-25) variant channels. Cav3.1 T-type channel examined did not display VDF. 70   Figure 2.5. Representative data on the voltage-dependent properties of Cav3.2 alternative splice variants.  (A) Normalized current-voltage relationships (I- V) of Cav3.2(+25) and Cav3.2(8b/-25) compared with Cav3.2(-25) alternative splice variants. The expression of exon 25 in the III – IV linker showed a 5 mV negative shift in I –V whereas deletion of 99 amino acid in the I – II linker resulted into 10 mV negative shift. (B) Representative traces and waveforms acquired from recording I-V relationships. The current-voltage (I-V) relationships were obtained by depolarizing the membrane with 150 msec test pulses from -90 to +10 mV at 5 mV steps (Vh = –110 mV). Voltage waveforms are shown as an inset. Normalized peak amplitude of Ca2+ currents was plotted against test pulse potential. Averaged values were  fitted using a modified Boltzmann equation: I=(Gmax*(Vm-Er))/(1+exp((Vm-V50)/k)), where Gmax is the maximum value of membrane conductance, Vm is the test potential, Er is the extrapolated reversal potential, V50 is the half-activation potential, and k the slope factor. (C) Steady state inactivation curves for the three variants indicating a 10 mV hyperpolarizing shift for Cav3.2 (8b/-25) and no significant difference for Cav3.2(+25). Example of steady state inactivation recordings and waveforms are shown in (D). Steady state inactivation curves were obtained with a double pulse protocol with 5s conditioning prepulses from -120 to -10 mV in 10 mV increments. Averaged values for the normalized peak currents are plotted as a function of conditioning prepulse potential. *All variants were compared against Cav3.2 (-25) and significant differences were calculated using ANOVA p < 0.05. 71  Table 2.2. Gating properties of Cav3.2 alternative splice variants. ________________________________________________________________________________________________________                         Activation                        Inactivation _____________________________________________________________________________________________________________________           V50act(mV)      k(mV)  act(ms)  n         V50inact (mV)       k(mV)     n          inact(ms)             n _____________________________________________________________________________________________________________________  Cav3.2(-25)         -41.4 ± 0.5              -7.0 ± 0.3 21.8 ± 0.9 34 -65.5 ± 0.3    4.5 ± 0.2    14     5.6 ± 0.5  30 Cav3.2(8b/-25)         -51.7 ± 0.4*      -6.5 ± 0.3   18.3 ± 0.9   9 -75.7 ± 0.3*    3.8 ± 0.2      9     4.5 ± 0.5    8 Cav3.2(24a/-25)        -44.4 ± 0.4  -6.9 ± 0.3 25.0 ± 3.7 10 -69.0 ± 0.2    4.6 ± 0.2      7     8.1 ± 0.7*    8 Cav3.2(33a/-25)        -39.2 ± 0.6        -7.7 ± 0.3 39.6 ± 5.5* 11 -63.9 ± 0.2    4.6 ± 0.2      7     3.8 ± 0.3*    8 Cav3.2(214/-25)     -41.2 ± 0.6        -7.7 ± 0.3 25.5 ± 2.5 12 -63.8 ± 0.3    4.8 ± 0.2      6     8.0 ± 1.1   10 Cav3.2(35a/-25)       -44.4 ± 0.5               -6.2 ± 0.3     21.0 ± 2.5 14 -66.5 ± 0.2    4.2 ± 0.2    11     5.6 ± 0.8   15 Cav3.2(35a/+25)      -46.6 ± 0.4*             -6.0 ± 0.3          19.5 ± 0.6          10         -68.3 ± 0.1            4.9 ± 0.1            10          5.5 ± 0.7          10 Cav3.2(+25)             -45.7 ± 0.7*    -6.6 ± 0.3 19.5 ± 2.2 23 -67.9 ± 0.2    4.1 ± 0.2    13     5.5 ± 0.5   20 ____________________________________________________________________________________________________________________ *All variants were compared against Cav3.2(-25) and significant differences were calculated using ANOVA p < 0.05. act – time constant of activation; inact – time constant of inactivation.          72   Figure 2.6. Alternative splicing affects the time course of recovery from inactivation and voltage-dependent facilitation of Cav3.2 T-type macroscopic currents.  73    (A) The splice variant generated by exclusion of exon 25 (Cav3.2(-25), filled squares) displays a faster recovery from inactivation than the variant Cav3.2(+25) variant (upright triangles) enabling Cav3.2  channels to recover to more than 100% after a prolonged depolarization. The contribution of carboxyl-tail domain on the recovery from inactivation was explored by expressing both the (+) and (-) 25 exon variants in combination with the (35a) variant. Maximal fraction and time course of recovery from inactivation of 35a/+25 (filled circles) and 35a/-25 (open circles) were determined by the exon 25 variant used as background. A significant increase in fractional recovery was observed when the variant 33a (a five amino acid insertion in the proximal C-terminus) was expressed in combination with the (-25) variant (Cav3.2(33a/-25), inverted triangles). Recovery from inactivation was studied with a double-pulse protocol (inset Panel A) using a 400 ms prepulse to -30 mV from a holding potential of -110 mV. After the inactivating prepulse, a 50 ms test pulse to -30 mV was given after a varying time period (interpulse interval) between 5 and 5000 ms. The peak current from the test pulse was plotted as a ratio of maximum pre-pulse current versus interval between pulses. Average data were fitted with a double exponential function to obtain the time constants for the fast (1) and slow (2) components of recovery from inactivation. Representative traces are shown for Cav3.2(+25) (B) and Cav3.2(-25) (C). The time course of VDF was explored with the protocol shown in (D). A strong depolarization to +120 mV was applied from a holding potential of -100 mV and followed by a 200 ms test pulse to -30 mV with interpulse intervals of 300, 600, 900, 1200, 1500 ms. Representative traces illustrate VDF of Cav3.2(-25) variant. (E) The current ratio was determined by dividing the current amplitude of the test pulses preceded by a prepulse by that of the test pulse without a prepulse. Robust voltage-dependent facilitation (VDF) was observed in the Cav3.2(-25) splice variant (filled squares) compared with Cav3.2(+25). VDF was observed with prepulses from 0 mV to +150 mV. Representative traces for Cav3.2(-25) VDF and the protocol used are shown on panel (F). VDF was studied by applying a 200 ms test pulse to -30 mV following a series of depolarizing prepulses from -120 to +150 mV after a time interval of 1.2 sec. 74  Table 2.3. Deactivation and recovery from inactivation of Cav3.2 alternative splice variants. __________________________________________________________________________________________________________________         Deactivation                           Recovery from Inactivation __________________________________________________________________________________________________________________       deact(ms) n          1(ms)                2(ms)             Relative A1       Relative A2  n __________________________________________________________________________________________________________________  Cav3.2(-25)      17.7 ± 1.0 14  36.6 ± 12.3 325.0 ± 33.4  0.74 ± 0.03 0.26 ± 0.04  20 Cav3.2(8b/-25)     22.2 ± 1.5          8  50.2 ± 24.2 306.1 ± 36.9  0.78 ± 0.13 0.22 ± 0.12     7 Cav3.2(24a/-25) 23.9 ± 1.3   5  25.3 ± 13.9 532.2 ± 13.3*  0.07 ± 0.02* 0.93 ± 0.02*  10 Cav3.2(33a/-25)     19.3 ± 1.4    7  47.3 ± 14.9 356.1 ± 33.5  0.75 ± 0.09 0.25 ± 0.09      7 Cav3.2(214/-25)  16.6 ± 0.9   5  36.9 ± 12.8 330.9 ± 30.6  0.76 ± 0.06 0.24 ± 0.06      6 Cav3.2(35a/-25)             20.4 ± 1.1            8             32.5 ± 12.0 295.3 ± 27.9  0.77 ± 0.05 0.23 ± 0.05  15 Cav3.2(35a/+25)            24.2 ± 1.7          10              31.8 ±   2.9        693.8 ±  9.9*                  0.15 ± 0.01* 0.85 ± 0.01*   7 Cav3.2(+25)          20.0 ± 0.8 12              32.3 ±  7.6   629.9 ± 25.0*  0.16 ± 0.01* 0.84 ± 0.01*  14 __________________________________________________________________________________________________________________ *All variants were compared against Cav3.2(-25) and significant differences were calculated using ANOVA p < 0.05. deact – time constant of deactivation, 1 – fast time constant of recovery from inactivation, 2 – slow time constant of recovery from inactivation. Relative A1 –relative  current amplitude at 1. Relative A1 – relative  current amplitude at 2. The recovery from inactivation was determined at Vh = -110 mV. 75   Figure 2.7. The voltage-dependent facilitation of Cav3.2(-25) T-type Ca 2+  channels does not depend upon Ca 2+ . The ionic sensitivity of voltage-dependent facilitation was explored using Ca 2+  or Ba 2+ as charge carriers in both the exon 25 (+) and (-) splice variants. The magnitude of relative facilitation observed in Cav3.2(-25) (Panel A) and Cav3.2(+25) (Panel B) showed no significant difference when currents were recorded in calcium (filled symbols) or barium (open symbols). Data were obtained using the pulse protocol shown in the insets of Figures 2.6D and 2.6F.  76   Figure 2.8. Voltage-dependent facilitation differs in T-type Ca 2+  channel isoforms. Percentage of facilitation as a function of prepulse potential was compared between different T- type channel isoforms. The absence of facilitation was characteristic of the Cav3.1 isoform (filled squares). Ca 2+  currents through recombinant Cav3.2(+25) splice variant (open circles) facilitated approximately 5-7% compared to 20% observed in Cav3.3 isoform (filled triangles). Cav3.2(-25) splice variant (filled circles) displayed a robust facilitation (50 to 60%). VDF was calculated as the ratio of current magnitude evoked by a test pulse at -30 mV applied after strong depolarizing prepulses over the current magnitude in the absence of prepulse (see Figure 2.6 for pulse protocol). Stable cell lines expressing human Cav3.1 and Cav3..3 T-type channels were kindly provided by Neuromed Pharmaceuticals. HEK293 cells expressing Cav3.1 and Cav3.3 channels were maintained in DMEM containing zeocin (25 g/mL) and hygromycin (300 g/mL), respectively.  77  2.2.3 The effect of cAMP and G22 on Cav3.2 voltage-dependent facilitation  The inclusion of exon 25 in the Cav3.2 introduces a consensus phosphorylation site for PKA suggesting the possibility that Cav3.2 (±) exon 25 splice variants could be differentially regulated by cAMP-dependent mechanisms. In this regard, the effect of cAMP on the Cav3.2 VDF was examined. The effect of cAMP on VDF was studied in Cav3.2 (±) exon 25 alternative splice variants via perfusion with 10 M forskolin in combination with 10 mM IBMX (3- isobutyl-1-methylxanthine). Forskolin elevates cAMP via activation of adenylyl cyclase whereas IBMX prevents degradation of cAMP via inhibition of phosphodiesterase. Whole cell patch clamp analysis of HEK-293 cells on VDF of Cav3.2 exon 25 splice variants revealed absence of significant difference between the basal and facilitated currents in treated and control cells (Figures 2.9B and 2.9C). VDF of Cav3.2(-25) variant channel was not affected by the combined perfusion of forskolin and IBMX (Figures 2.9B and 2.9C). Similarly, a lack of VDF of forskolin/IBMX was also observed on Cav3.2(+25) variant channels (Figure 2.9C lower panel), an indication of the absence of regulation by cAMP.  Previous studies showed that Cav3.2 channels are inhibited by G specifically the G22 subunits (Drolet et al., 1997; Wolfe et al., 2003; DePuy et al., 2006). The effect of Gon Cav3.2 VDF was investigated in this study. Figures 2.9D and 2.9E illustrate the effect of co-transfected G2 and G2 on VDF of Cav3.2(-25) and Cav3.2(+25) splice variants, respectively. Co- transfection of G22 with the Cav3.2(-25) variant showed an ~50% reduction of VDF positive to -30 mV (Figure 2.9D). In contrast, Cav3.2(+25) co-transfected with G22 showed neither decreased nor increased VDF (Figure 2.9E). 78   Figure 2.9. The effect of Gand cAMP on voltage-dependent facilitation (VDF) of cardiac Cav3.2 exon 25 alternative splice variants.  (A) Schematic representation of Gi activation and G binding as well as cAMP activation/PKA phosphorylation of Cav3.2 channel. (B) Forskolin treatment showed no effect on the VDF properties of Cav3.2(-25) alternative splice variants. (C) Representative traces for 79  Cav3.2(-25)(top panel) and Cav3.2(+25) (bottom panel) showed lack of effect by forskolin on basal and facilitated T-type Ca 2+  currents. Black traces represent basal currents in control cells; gray traces represent basal current in forskolin treated cells; red traces represent facilitated currents in control cells and blue traces represent facilitated currents in forskolin treated cells. (D) Cav3.2(-25) showed reduction of VDF by G22 from potentials positive to 0 mV. (E) G22 showed no effect on Cav3.2(+25).         2.2.4 Differential expression of Cav3.2 exon 25 variants in hypertension-associated cardiac hypertrophy  Both the altered expression of T-type Ca 2+ channels and electrical properties of cardiomyocytes have been reported to be associated with a number of cardiac disease states (Nuss and Houser, 1993; Martinez et al., 1999; Huang et al., 2000; Yasui et al., 2005; Takebayashi et al., 2006). In order to examine the expression profile of identified cardiac Cav3.2 splice variants in diseased heart, cardiac tissue from adult spontaneously hypertensive rats (SHR) was analyzed as described above. Figures 2.10C and 2.10D show a comparison of the quantitative mRNA analysis of Cav3.2(+/-25) splice isoforms in cardiac tissue from normotensive WKY and SHR rats. The hypertrophic phenotype of the SHR animals was confirmed using the two molecular markers SIAT7 (Cerutti et al., 2006) and Frzb (Zhao et al., 2004), known to be upregulated in pathological cardiac hypertrophy (Figure 2.10B). The pathological phenotype of SHR was further confirmed by the elevation in heart weight/body weight (HW/BW) ratio in SHR animals, compared to age- and sex-matched normotensive WKY rats (data not shown). Also, the occurrence of perivascular and focal interstitial fibrosis, determined using Masson’s trichrome technique, was used as an indicator of pathological hypertrophy in ventricular tissue from SHR hearts (Figure 2.10A). The quantitative mRNA analysis of rat rSIAT7 and rFrzb showed a ~4 -5 fold increase of mRNA levels in hypertrophic 80  SHR compared to normotensive WKY left ventricle (Figure 2.10B). Importantly, a significant increase in the relative amount of Cav3.2(+25) splice isoform compared to Cav3.2(-25) (Figures 2.10C and 2.10D) results in a shift in the predominant exon 25 splice isoform expressed in hypertrophic SHR, suggesting a splice-specific upregulation of Cav3.2 mRNA transcripts during pathological hypertrophic heart remodeling, in addition to an overall increase in total Cav3.2 isoform expression. 81    Figure 2.10. Alteration of Cav3.2(+25) and (-25) splice variant expression is associated with the hypertrophic SHR pathological phenotype.  (A) Histopathological markers in cardiac tissue from hypertrophic SHRs. Photomicrographs of ventricular sections of cardiac tissue stained with Masson’s trichrome show perivascular (c) and interstitial (d) accumulation of fibrillar collagen in SHR heart (lower panels, c and d) compared to the age- and sex-matched normotensive WKY (upper panels, a and b). Leftmost panel calibration bar is 2 mm and a, b, c and d middle and right panels is 200 m. Cardiac tissue was embedded in paraffin, sectioned at 5 m and stained by the Masson’s trichrome technique. (B) Real time PCR revealed the expression of the rat Frzb(rFrzb)  and rat SIAT7(rSIAT7) hypertrophic markers relative to rActB in cDNA samples generated from left ventricle tissue from adult hypertrophic SHR or adult normotensive WKY. Five individual animals were sampled for each group. The same cDNA samples were used to measure expression of the Cav3.2 82  (+25) and (–25) exon splice variants in the SHR and WKY groups. (C) Transcript copies of (+25) and (-25) were calculated from each sample and normalized to rActB. Both variants were upregulated in hypertrophic SHR although the (+25) variant showed more pronounced upregulation indicating the preferential re-expression of (+25) splice variant in cardiac hypertrophy (D).  Error bars indicate standard error. T-tests were performed to measure significant differences. **p<0.01, *p<0.05.  2.3 Discussion  The present study provides evidence for the differential regional and temporal expression of alternatively spliced Cav3.2 T-type Ca 2+  channels in rat heart. Alternative splice variants span the entire Cav3.2 channel with the carboxyl-terminal region being the most extensively spliced domain. Examining cardiac regional and developmental expression patterns by qRT-PCR, the inclusion or exclusion of exon 25 in the domain III-IV linker generates the most distinct splice variant expression profile in cardiac Cav3.2 channels. Further, examining hypertrophic heart from adult SHR animals, a significant overall up-regulation of Cav3.2 expression was observed and occurred in the context of a change in the ratio of the exon (+/-) 25 splice variants. Heterologous expression analysis of predominant splice variants demonstrated distinct recovery from inactivation and VDF properties are associated with the exon (+/-) 25 containing variant channels. This thesis is the first comprehensive study across the full length Cav3.2 channel and which also demonstrates splice variation is correlated with cardiac development and the hypertrophic state.      2.3.1 Splice variant specific expression of cardiac Cav3.2 Ca 2+  channels in development and hypertrophy  Alternative splicing of partial regions of Cav3.2 T-type channels has thus far been reported from human fetal brain, testicular and pregnant uterine tissue (Jagannathan et al., 2002; 83  Ohkubo et al., 2005; Zhong et al., 2006). This thesis examined the entire ORF of rat heart Cav3.2 channels using both short amplicon and full-length cDNA analyses and further examined predominant variants by qRT-PCR and exogenous expression. The results indicate that cardiac Cav3.2 channels are subject to extensive alternative splicing, particularly in predicted cytoplasmic regions where second messenger-dependent modulatory and protein-protein interaction sites are primarily located (e.g.(Wolfe et al., 2003; DePuy et al., 2006)). The cytoplasmic regions of T-type channels are known to affect channel gating (Chemin et al., 2001a; Vitko et al., 2007), trafficking to the membrane,(Vitko et al., 2007), G-protein dependent modulation (Wolfe et al., 2003; DePuy et al., 2006; Hildebrand et al., 2007) (Appendix 2), and regulation by a number of kinases (Arnoult et al., 1997; Welsby et al., 2003; Iftinca and Zamponi, 2009) suggesting that alternative splicing in these regions has the potential for affecting the modulation and functional diversity of cardiac Cav3.2 T-type channels. The inclusion or exclusion of the cassette exon 25 encoding residues in the domain III - IV linker was the most common splicing event in cardiac samples. The exclusion of exon 25 is the predominant splice variant in newborn rat heart, being 7-8 fold higher than Cav3.2(+25) variant channels in newborn cardiac tissue (Figure 2.4B). Contrastingly, in adult rat heart the expression of the two variants was approximately equal. A significant reduction in the expression of ventricular Cav3.2(-25) splice-variant channels reported here might explain the overall down- regulation reported in previous studies for Cav3.2 isoform in the adult (Qu and Boutjdir, 2001; Yasui et al., 2005). However, in the atria, a significant amount of both Cav3.2 (+) or (-) exon 25 variants was detected (Figure 2.4A). In order to determine whether Cav3.2 alternative splicing is altered during cardiac remodeling associated with diseased heart, the hypertrophic SHR model was examined. Previous studies have shown that Cav3.2 T-type channels are generally re-expressed in 84  hypertrophied heart (Nuss and Houser, 1993; Martinez et al., 1999; Takebayashi et al., 2006). The current study addresses for the first time whether there are specific changes in the profile of Cav3.2 splice-variants in cardiac tissue from hypertension-associated hypertrophic heart. Quantitative analysis showed a preferential expression of the inclusion of (+)25 exon containing variants in the adult hypertrophic heart (Figures. 2.10C and 2.10D). Moreover, the combined increase in expression levels of both exon 25 variants in hypertrophic ventricle could account for the disease-associated re-expression of T-type channels previously reported (Nuss and Houser, 1993; Martinez et al., 1999; Huang et al., 2000; Yasui et al., 2005; Takebayashi et al., 2006).      2.3.2 Cav3.2(-25) channels display faster recovery from inactivation and voltage- dependent facilitation  Alternative splicing is known to confer distinct electrophysiological properties to T-type channels (Chemin et al., 2001a; Jagannathan et al., 2002; Ohkubo et al., 2005; Emerick et al., 2006; Zhong et al., 2006). This thesis demonstrated that the cardiac Cav3.2 channel shows significant variant-specific changes in recovery from inactivation and VDF in association with splicing of exon 25. When compared to Cav3.2(+25) variant channels, results showed that both potentiated recovery from inactivation and robust VDF in the rat cardiac Cav3.2 when exon 25 is absent. The splice-variant specific VDF was also observed when macroscopic currents were recorded using Ba 2+  as charge carrier, ruling out a direct Ca 2+ -dependent facilitation process (Figure 2.7). Of note, native ICaT from bullfrog atrial cells and guinea-pig coronary arterial myocytes have both been reported to display VDF properties (Ganitkevich and Isenberg, 1991; Alvarez et al., 1996; Alvarez et al., 2000). Conversely, Zhong and coworkers reported faster recovery kinetics associated with the homologous exon 26 region in the human fetal brain Cav3.2 channel although neither facilitation nor potentiation (>100% fractional recovery) were observed 85  (Zhong et al., 2006). VDF has been previously attributed to the cloned human Cav3.3 (Klockner et al., 1999; Gomora et al., 2002) albeit to a much lower degree (~ 20%) compared to that for the Cav3.2(-25) variant channel described here (Figures 2.6 and 2.8) (Klockner et al., 1999; Gomora et al., 2002). It is well known that the mammalian heart undergoes significant functional and morphological changes during embryonic and postnatal development. The heart rate, configuration of action potential and excitation-contraction (E-C) coupling all differ considerably between postnatal and adult myocardial tissues (Wekstein, 1965; Adolph, 1971; Wahler et al., 1994; Ziman et al., 2010). In this regard, age-related differences in the relative expression of Cav3.2 splice variants displaying significantly different kinetic and gating properties could contribute to the developmental regulation of cardiac Ca 2+  homeostasis. As a consequence, splice-specific T-type channel mediated Ca 2+  entry could participate in the regulation of important processes in the developing heart such as cardiomyocyte growth, proliferation, hormone secretion and spontaneous activity (Leuranguer et al., 2000; Vassort et al., 2006). In neonate cardiomyocytes, the strong VDF and faster recovery from inactivation of Cav3.2(-25) channels may result in increased Ca 2+  influx leading to increased electrical activity. Furthermore, predominant expression of Cav3.2(-25) (Figure 2.4) might be relevant for E-C coupling in immature myocardium which relies mainly on trans-sarcolemmal transport of Ca 2+  for the activation of contractile machinery (Nuss and Marban, 1994; Haddock et al., 1999; Artman et al., 2000; Escobar et al., 2004).  Although the physiological impact of Cav3.2 splice variation in different regions of the mammalian heart remains to be explored, our study demonstrates that alternative splicing can regulate the effect of strong depolarization on T-type Ca 2+  channel gating properties as well as the time course of recovery from inactivation.  86      2.3.3 The magnitude of VDF of Cav3.2(-25) splice variant currents is reduced by G22  This thesis examined the potential cAMP regulation on the VDF of Cav3.2 exon 25 variants. This was undertaken by application of forskolin (an adenylyl cyclase stimulant) in combination with IBMX (a phosphodiesterase inhibitor) in HEK-293 cells transiently transfected with Cav3.2(-25) and Cav3.2(+25) alternative splice variants. Contrary to a previous report on the cAMP modulation of ICaT VDF in atrial myocytes (Alvarez et al., 1996), this study showed lack of effect on VDF by cAMP (Figures 2.9B and 2.9C). In our study, I used a mammalian cell line (HEK cells) and recorded exogenous Cav3.2 currents at room temperature (~21ºC). These experimental conditions may account for the lack of effect of cAMP on Cav3.2 currents as previous reports have shown temperature-dependence of kinase effects (Chemin et al., 2007). On the other hand, consistent with the findings in the current study, a lack of effect by cAMP on native ICaT from various mammalian cardiovascular preparations has also been reported. These include a lack of effect on native ICaT in rabbit SA node (Hagiwara et al., 1988), ear arteries (Benham and Tsien, 1988), guinea pig ventricular myocytes (Tytgat et al., 1988), dog atrial myocytes (Bean, 1985) and canine cardiac PF cells (Hirano et al., 1989; Tseng and Boyden, 1989). Taken together, further studies are necessary to explore the VDF of cardiac Cav3.2 alternative splice variants including whole cell patch clamp recording in a temperature controlled setting.  The VDF of ICaT from frog atrial myocytes was reported to be due to voltage-dependent relief of tonic inhibition by Gi proteins (Alvarez et al., 1996). The activation of Gi proteins results in the release of G subunits allowing them to  interact with ion channels (Logothetis et al., 1987). Among the three T-type isoforms, Cav3.2 channels are reported to be selectively inhibited by G22(Wolfe et al., 2003; DePuy et al., 2006). 87    Since the G-mediated inhibition of Cav3.2 is specific to G22 subunits, the modulation of G to Cav3.2 (±) exon 25 alternative splice variant was investigated in the present study. To test the possibility that Gsubunits regulate Cav3.2 VDF in a splice- dependent manner, co-transfection of GandG with Cav3.2 splice variants in HEK cells was performed. The results showed that there exists a splice-specific regulation of VDF by G22(Figures 2.9D and 2.9E). In the presence of G22, the VDF of Cav3.2(-25) was reduced by approximately 50% (Figure 2.9D), whereas Cav3.2(+25) was not affected (Figure 2.9E). A lack of effect by G by strong depolarizing prepulses was also reported for the human Cav3.2 T-type channel containing exon 26 (Wolfe et al., 2003) which is homologous to the rat exon 25 (the cardiac Cav3.2(+25) variant identified in this thesis). To date, there has been no report of the G-mediated inhibition of VDF of Cav3.2 channels hence this thesis is the first to report this type of modulation and further, that it occurs in splice-variant manner.      2.3.4 Potential relevance to cardiac pathophysiology  Splice variation associated with the cardiac HVA L-type channel encoded by Cav1.2 has been extensively studied. Of note pharmacologically, splice variation in the Cav1.2 IS6 segment accounts for the differential dihydropyridine sensitivity of L-type currents in smooth and cardiac tissues (Welling et al., 1997). Further, distinct Cav1.2 splice variants expressed in cardiac and smooth muscle contributes to the distinct biophysical properties of native L-type currents in these tissues (Liao et al., 2004; Tang et al., 2004; Liao et al., 2005; Tang et al., 2007). Similar to the results presented here for the Cav3.2 T-type channel, alternative splicing of the Cav1.2 L-type channel is also suggested to be involved in molecular remodeling associated with cardiovascular disease (Tiwari et al., 2006; Liao et al., 2009b). 88  It is tempting to speculate that the preferential up-regulation of Cav3.2(+25) channels in the heart of hypertrophic SHRs could potentially contribute to electrical remodeling in the hypertrophic ventricle. A higher level of expression of this particular splice variant with its hyperpolarized activation range and higher current density, could predispose the heart to pro- arrhythmogenic condition, contractile dysfunction and eventually heart failure. Interestingly, a recent study has found evidence implicating Cav3.2 T-type channel involvement in the pathogenesis of cardiac hypertrophy via the activation of calcineurin/nuclear factor of activated T cells (NFAT) pathway (Chiang et al., 2009). The preferential up-regulation of Cav3.2(+25) splice variant channels that I find correlated with cardiac hypertrophy in SHRs supports the notion that an enhanced Ca 2+  flux associated with expression of this T-type variant might contribute to the hypertrophic signaling pathway.  In summary, this thesis finds that alternative splicing of Cav3.2 channel results in spatially and temporally expressed T-type cardiovascular variants and that in at least one instance are also associated with the hypertrophic state. The functional variability and compartmentalization of specific Cav3.2 splice variants potentially make significant contributions towards cardiac physiology and pathophysiology. In a broader context, it is apparent that examination of single splice variants should not be used to universally infer functional outcomes when looking across physiological and pathological conditions.  2.4 Materials and methods      2.4.1 Animals and tissue preparation  All animal procedures were performed in accordance with Canadian Council on Animal Care guidelines for animal research. Newborn (P0), adult male Wistar (Animal Care Center, 89  University of British Columbia, Canada) and four month old male spontaneously hypertensive rats (SHR) and Wistar Kyoto rats (WKY) (Charles River, Montreal, Canada) hearts were utilized in this study. Newborn and adult rats were anaesthesized using halothane (in closed chamber) and inactin (80 mg/kg i.p.), respectively. Rat heart chambers were dissected and washed in Krebs-Ringer solution containing (in mM) 120 NaCl, 4.8 KCl, 1.2 CaCl2, 1.3 MgSO4, 25.2 NaHCO3, 5.8 glucose, 1.2 KH2PO4, 20 HEPES, pH 7.4. Krebs- Ringer solution was prepared in diethylpyrocarbonate(DEPC)-treated deionized water and filtered prior to use. The ratio of the heart weight (HW)/ body weight (BW) from SHR and WKY was calculated by dividing the total body weight (in grams) from the heart wet weight (in milligrams). All chemicals used in the study were purchased from Sigma-Aldrich Canada unless otherwise stated.      2.4.2 Histological staining  Four month old male SHR and WKY rats were anaesthesized using 80 mg/kg body weight inactin (Sigma, St. Louis, Mo.) administered intraperitoneally. Hearts were excised and washed through the aorta with Krebs-Ringer buffer then perfused with 10% cold buffered formalin. Hearts were fixed in formalin for at least 24 hours at 4ºC. Samples were processed by Wax-It Histology Services (University of British Columbia, Vancouver, B.C., Canada). Briefly, cardiac tissues were embedded in paraffin, sectioned at 5 m and stained using Masson’s trichome technique to detect interstitial fibrosis. The technique uses acid fuschin-xylidine ponceau for cytoplasmic staining (red), Weigert’s hematoxylin for nuclear staining (black) and aniline blue for collagen. High resolution images were obtained by digital scanning of whole slides using Aperio’s ScanScope system (Vista, CA).  90      2.4.3 RT-PCR and short amplicon scanning  Total RNA was prepared individually from five newborn, five SHR and five WKY rats. Each heart sample was homogenized in a sterile glass-Teflon homogenizer and 1 ml Trizol (Invitrogen). Homogenized samples were incubated at room temperature for 5 minutes followed by adding 200 μL choloroform and incubated at room temperature for another 3 minutes. Samples were spun in table top centrifuge at 11,000 x g for 15 minutes at 4ºC. The aqueous phase of the centrifugate was immediately transferred to a clean RNAse-free eppendorf tube and 500 μL of isopropanol was added. The centrifugate/isopropanol mixture was incubated at room temperature for 10 minutes to precipitate the RNA. After the incubation, samples were spun at 11,000 x g for 10 minutes at 4ºC. The precipitate was washed with 75% ethanol and spun at 7,500 x g for 5 minutes. The supernatant was removed and the final pellets were dried briefly prior to suspension in DEPC-treated deionized water.  For cDNA synthesis, one microgram total RNA was initially treated with DNAse to avoid genomic DNA contamination during reverse transcription (RT). Superscript II reverse transcriptase (Invitrogen) was used for the RT. A total of 20 ul reaction volume was prepared containing DNAse-treated total RNA, first strand buffer (1X), DTT (10 µM), oligodT (0.5 µg/L), dNTP mix (500 µM), RNAseOUT (40 units) and RT (200 units).  Primer pairs were used to amplify small polymerase chain reaction amplicons covering overlapping regions of the entire Cav3.2 open reading frame. The oligonucleotides used in exon scanning are summarized in Table 2.4. There were 11 overlapping PCR amplifications with each reaction covering at least two exons and generating products of ~450 and ~1070 base pairs. PCR products were sublcloned into the pGEM-T-Easy vector (Promega) and grown on agar plates for blue/white screening. Selected white colonies were grown into LB media and plasmid DNA from each culture was subjected to variant identification by size selection using agarose gel 91  electrophoresis. DNA sequencing was used to confirm variants and exon-exon junctions. DNA sequences were compared with published rat Cav3.2 cDNA sequences (NM_153814) and genomic sequences (ENSRNOT00000048392 and NC_005109). 92   Table 2.4. Primers utilized for exon scanning amplification. Oligonucleotides  Scanning Reaction Exons Spanned Expected Product Size LDH-1, ATGACCGAGGGCACGCTG LDH-2, CCCGCCATGACAATGAAG 1 1, 2, 3 545 bp LDH-3, CCTGGGTGACACCTGGAA LDH-4, CTGGAAGATGGCAATCCAA 2 4, 5, 6 622 bp LDH-5, CTCACAACGGTGCCATCA LDH-6, CTTGTTCTCCCACCACAT 3 7, 8 942 bp LDH-7, CCCAGACCCTATGAGAAGA LDH-8, CTGAAGATGAAGATGAACAG 4 9, 10, 11 821 bp LDH-9, CAACGTGGCCACCTTCTG LDH-10, CAGAGACTTCTGGTCCCC 5 12, 13, 14, 15 625 bp LDH-11, CAAACCTGGACGTGGCCCA LDH-12, CTTCACCATCATCTCCAC 6 16, 17, 18, 19 806 bp LDH-13, CTACATCTTCACAGCCAT LDH-14, CTGCTGGTCGATGCCCAC 7 20, 21, 22, 23 571 bp LDH-15, GGCTGGGTAAACATCATG LDH-16, CTGTCCTTGAAGAACCTC 8 24, 25, 26, 27 509 bp LDH-17, GCTGCACTGAAGCTGGTG LDH-18, TCATAATCCCATTCCAG 9 28, 29, 30, 31 454 bp LDH- 19, CCTCACACTGTTCCGAGT LDH-20, CTGTCTGCAGAGTATCCG 10 32, 33, 34 628 bp LDH- 21, CCGCTCTCTGAGTCTCTC LDH-22, CACAGGCTCATCTCCACTG 11 35 1078 bp   93      2.4.4 Construction of cDNA libraries and full length splice variant screening  Full-length PCR was performed with ELONGASE Enzyme Mix using the oligonucleotides 5’- GATAAGCTTATGACCGAGGGCACG - 3’ and 5’CGCTCTAGACTACACAGGCTCATC – 3’. The reaction volume was 50 µL consisting of 2 µL cDNA, 2 mM magnesium, 200 µM each dNTP, 400 nM each primer, and 1 unit ELONGASE Enzyme Mix. PCR was run using the following cycle: 94.5ºC 45 seconds, 94.5ºC 20 seconds, 55ºC 25 seconds, 68ºC 8 minutes, 35 cycles and a final extension of 68ºC for 15 minutes. The ~7 kb PCR product was purified and subcloned into the pGEM T-Easy vector. Individual splice variants from bacterial colonies obtained from short amplicon PCR products were identified via size differentiation using agarose gel electrophoresis. Between 40 and 200 colonies were screened in each of the 11 PCR reactions. For full length screening, positive full length clones were screened using HindIII and SpeI enzymes to release the ~7kb Cav3.2 fragment. The identification and confirmation of alternatively spliced variants were performed by DNA sequencing 56 atrial and 50 ventricular full length cDNAs. All DNA sequences were aligned against published mRNA and genomic sequences (Ensembl and PubMed).      2.4.5 Cloning of full-length Cav3.2 alternative splice variants  Eleven full-length splice variants were subcloned for subsequent biophysical characterization in HEK cells; Cav3.2(-7/-25), Cav3.2(8b/-25), Cav3.2(20a/-25), Cav3.2(20b/-25), Cav3.2(24a/-25), Cav3.2(-25), Cav3.2(+25),), Cav3.2(33a/-25), Cav3.2(214/-25), Cav3.2(35a/- 25) and Cav3.2(35a/+25). From the error-free full length cDNA subcloned in pGEM T-Easy vector, all Cav3.2 splice variants except Cav3.2(8b/-25) were cloned by cutting the ~7 kb band with HindIII and XbaI restriction enzymes and moved to  pCDNA3.1 zeo(+) (Invitrogen). Using Cav3.2(-25) as template, Cav3.2(8b/-25) was cloned using two-step overlapping PCR techniques. 94  Cav3.2(8b) alternative splice variant is a 99 amino acid deletion located in the I-II linker region within the NheI sites of Cav3.2(-25) in pCDNA3.1 zeo(+). All PCR reactions were done using Phusion Enzyme (Finnzymes, Espoo, Finland). Two overlapping PCR fragments namely NheI – 8b1 and 8b2 – NheI4 were generated.  NheI – 8b1 fragment was amplified with oligonucleotides RA1HLDHNhe1- 5’ ggtctatataagcagagct 3’ and RA1HLDH8b1 – 5’ ctcagagtctggtggcccatggcctacatacttgaggagctcc 3’, whereas, 8b2 – NheI4 fragment with primers RA1HLDH8b2 – 5’ ggagctcctcaagtatgtaggccatgggccaccagactctgag 3’ and RA1HLDHNhe4 – 5’ ttcaggctgaacttacagcc 3’. Products were then run in 0.8% agarose gel, excised and purified for subsequent annealing. The two fragments were annealed using the oligonucleotides RA1HLDHNhe1 – 5’ ggtctatataagcagagct 3’ and RA1HLDHNhe2 – 5’ cgactcactatagggagac 3’ to generate the 2.5 kb fragment possessing NheI sites for cutting. Annealed products were gel purified and the Cav3.2(-25) and the purified 8b NheI  fragment were cut with NheI  restriction enzymes for subsequent cloning. The 8b NheI fragment splice variant was cloned into the NheI cut Cav3.2(-25) in pCDNA3.1 zeo(+). The DNA sequence of each clone was determined prior to patch clamp analysis.      2.4.6 Western blot analysis  Protein sample extraction from heart tissue was performed by grinding frozen tissue in liquid nitrogen in extraction buffer (0.1M Tris pH 6.8, 2% sodium dodecyl sulfate (SDS), 10% Glycerol, 1% -mercaptoethanol, 1x Proteinase inhibitor cocktail (Complete-EDTA free, Roche), 0.004% Bromophenol Blue) and followed by heating to 65 o C for 10 minutes and trituration through a small gauge needle. Western Blot analysis was performed as follows: proteins were separated on NuPAGE Novex 4-12% Bis-Tris Midi gells (Invitrogen), followed by wet electro-transfer (20mmol/L Tris-base, 150mmol/L Glycine, 20% Methanol & 0.1% SDS) 95  onto nitrocellulose membrane (Hybond-ECL, GE Healthcare). Protein transfer was confirmed by Ponceau S staining, followed by membrane blocking with 2% skimmed milk in TBST (136 mM NaCl, 25 mM Tris-HCl (pH7.4), 2.8 mM KCl, 0.1% Tween). Antibody incubations were performed in TBST-2% milk for 1 hour and washed three times (5 minutes each) with Tris Buffered Saline(TBS) prior to incubation with secondary horseradish peroxidase(HRP) conjugated antibody. Final membrane washes were performed twice in TBST and once in TBS for 5 minute each. Proteins were detected using the SuperSignal West Pico Chemiluminescent kit (Thermo Scientific) on Hyperfilm ECL (GE Healthcare). The following antibodies used: Rabbit anti-rat Cav3.1 (1:10,000) (C-terminal region residues 1861-1934 (Q54898)), rabbit anti-rat Cav3.2 (1:5,000) (II-III linker region residues 11195-1273 (Q9EQ60)), rabbit anti-rat Cav1.2 (1:5,000) (C-terminal region residues 1725-11789 (P22002)), and mouse anti-ACTB (1:10,000) (Chemicon, MAB1501)      2.4.7 Quantitative real-time-PCR (qRT-PCR)  Two microgram (µg) of total RNA was used to synthesize cDNA using a High Capacity cDNA Reverse Transcription kit (Applied Biosystems).  Real-time-PCR reactions were performed using Applied Biosystems  reagents, an Applied Biosystems AB 7500 instrument and TaqMan probes generated against the respective cDNA targets. Primer mixes used for  detection of specific splice variants are listed in Table 2.5. Splice-variant specificity was confirmed using full-length cDNAs and titration curves and enabled splice-variant copy number to be calculated. A rat actin B (rActB) primer set (Applied Biosystems  AB 4352340E) was run in parallel with splice-variant specific probes in all samples as a control for total cDNA input to  allow comparison. The rat molecular hypertrophic markers, SIAT7 (Rn01750492_m1) and Frzb (Rn01746979_m1) were obtained from Applied Biosystems. Relative amounts of different splice 96  variants were estimated after actin B normalization. In the case of the exon +/-25 splice variants, copy numbers for each variant in each  sample were calculated and then compared with rActB. Target and control probe reactions  were run in triplicate and averages were determined. 97      Table 2.5. Oligonucleotide primers for qRT-PCR.  Name               Probe                Forward                         Reverse H+8b*       CCTCAAGTATGTAGGCCACATCTTCCG     TCCAACGACAGCACTCT                     GCATAAAGACGCAGGCTA H-8b*       AGCTTCTCAGAGCCCGGCA       TCCAACGACAGCACTCT                     GTGGCCCATGGCCTACATAC H+20a       ATGCCTACCTACAGAGCAGT       TGGAGATGATGGTGAAGGTGGTA    CCCGTCCAGCACATTCCA H-20a       CCAACTGCTCTTCACCATC       CTACATCTTCACAGCCATCTTCGT    AGCCCGTCCAGCACATT H+25       CCAACCCAGAGGCCCAG       GCGCAGGAGCACTTTCC                     GAGTGTGTGAATAGTCTGCGTAGTA H-25       CTGGGCCTTCCTGCGCC        CGCCGGGAGGAGAAACG        GAGTGTGTGAATAGTCTGCGTAGTA H+33a*      AGCACAGCCTCCCTCACCACAGGA      GCCCAGCCCCCACCTA         CATCCTGGACACAGATACTTTTCG H-33a*       AAGGAGGCCCGCGAGGATGC       AAGCACCTGGAGGAGAGCAA        GGTACCTTGGCTTTCCTGTGC H+35a       AAGAGGCCTGGCCCC        GGGACCCTGTAGCCAAGG         CAGAGGCTCAAAGGCAAAGTTG H-35a       ACCTAGAGTCCAGGCCTC       TGGAACTGGATAACGGAGAAAGC    CAGAGGCTCAAAGGCAAAGTTG H+214     CCAGGCCTCTTGCCGAGCA       GGGACCCTGTAGCCAAGG          GGCTCAAAGGCAAAGTTGGG H-214      ACGAGCCAGGCCTCT        CACAGAGCCTGCTGAAAATATGTC    GGCTCAAAGGCAAAGTTGGG *No 3’-MGB; IB-FQ as 3’-Quencher; Source: Integrated DNA technologies (IDT). Rest from Applied Biosystems (AB). All forward oligos have 5`FAM.  98      2.4.8 Whole cell electrophysiology of transfected HEK cells  Human embryonic kidney cells (HEK293; Invitrogen, #11631-017) were grown in standard Dulbecco’s modified Eagle’s medium (DMEM) containing 10% heat inactivated fetal bovine serum, 50 units/ml penicillin and 50 µg/ml streptomycin maintained at 37ºC in a humidified incubator with 95% O2 and 5% CO2. Cav3.2 alternative splice variants were transfected using standard calcium phosphate transfection method and left overnight at 37°C incubator. As a reporter for transfection, CD8 was used at a molar ratio of 3:1. In separate experiments involving G, cloned Cav3.2 (±) 25 variants were co-transfected with and without G22 subunits with a stoichiometric ratio of 3:3:3:1, for channel, G2, G2, and CD8, respectively.   Twelve to 18 hours later, media was replaced with fresh DMEM and cells were transferred to 28°C prior to whole cell patch clamp analysis.  Macroscopic currents were recorded using Axopatch 200B amplifiers (Axon Instruments, Foster City, CA) controlled and monitored with personal computers running with pClamp software version 9 (Axon Instruments). The external recording solution composed of the following (in mM) 2 CaCl2, 1 MgCl2, 92 CsCl, 10 glucose, 40 tetraethylammonium chloride, 10 HEPES, pH 7.4 and the internal pipette solution contained (in mM) 120 Cs-MeSO3, 11 EGTA, 10 HEPES, 2 MgCl2, 5 MgATP, pH 7.2. In some experiments using Ba 2+  as the charge carrier, Ca 2+  was replaced with iso-osmotic external recording solution containing Ba 2+ . In experiments involving testing the effect of cAMP, 10 M forskolin and 10 mM IBMX were added to the external recording solution. Patch pipettes (borosilicate glass BF150-86-10; Sutter instruments, Novato, CA) were pulled using a Sutter P-87 puller and fire polished with a Narashige (Tokyo, Japan) microforge with typical resistances of 3 – 6 MΩ when filled with internal solution. The bath was grounded via a 3 mM KCl bridge. Data were low pass filtered at 2 kHz except for 99  measurement of tail currents that were filtered at 5 kHz with built–in Bessel filter of the amplifier, with a sampling period of 10 kHz.  Voltage dependence of activation was studied by applying 150 ms depolarizing pulses from -90 mV to + 10 mV at 5 mV increments (Vh = -110 mV). Current-voltage (I-V) relationships were fitted with the modified Boltzmann equation : Im = (Gmax X (Vm-Erev)) / (1+ exp((Vm-V50act)/kact)),  where Gmax is the maximum slope conductance; Erev  is the extrapolated reversal potential; Vm is the membrane potential, V50act is the half activation potential;  kact  is the slope factor of activation which reflects the voltage sensitivity. Current values were normalized to the maximum current. Steady-state inactivation was studied by applying 5 second prepulses from -120 mV to -10 mV followed by a test pulse to – 30 mV for 50 ms. The current magnitude obtained during each test pulse was normalized to the maximum current and plotted as a function of the pre-pulse potential. Steady state inactivation normalized data were fitted using Boltzmann equation (I/Imax = (1+exp((V-V50inact)/kinac)) -1 ), where Imax is the maximum current; V50inact is the membrane potential at 50% of the channel are inactivated, kinac is the slope factor of inactivation. The kinetics of activation (act) and inactivation (inact) were analyzed by fitting current recordings obtained from the I-V protocol with a single exponential standard equation I = Ae -t/,  where A is the amplitude of the current at to and  is the time constant. Recovery from inactivation was determined by double pulse protocol, a prepulse to -30 mV for 400 ms was given and allowed to recover at different time intervals (interpulse interval) between 5 ms to 5 seconds before applying a test pulse to -30 mV for 50 ms (Vh = -110 mV). The peak current from the test pulse was plotted as ratio of maximum prepulse current versus interval between pulses. The data were fitted with a double exponential function (I/I max = A0 + A1*exp(-t/) + A2*exp(-t/2)), where A0  is the amplitude for inactivating component, A1 and A2 are the amplitudes for the fast and slow components of the exponential, and 1 and 2 are the time 100  constants for the fast and slow components, respectively. Relative current amplitude for fast component (relative A1) was calculated using the formula A1/ A1 + A2, whereas relative amplitude for slow component was estimated by using the formula A2/ A1 + A2. Deactivation was also investigated by measuring tail currents, using -110 mV as holding potential and depolarizations to -30 mV after which the membrane was repolarized to different levels (-120 mV to -50 mV). The data was fitted with a single exponential function (I = Ae -t/  ), where A is the amplitude of the current, and  is the time constant. Fittings were plotted as a function of the repolarization potential. Voltage-dependent facilitation was studied by applying a 200 ms test pulse to -30 mV following a series of depolarizing prepulses from -120 to + 150 mV after a time interval of 1.2 seconds. The percentage facilitation was obtained by dividing the currents obtained from prepulses to currents recorded at -120 mV. Averaged percentage facilitation was plotted as a function of prepulse depolarization. All recordings were performed at room temperature (~22 - 24ºC).  Data analysis was performed using Clampfit software verion 9.0 (Axon Instruments). All plots and statistical analysis (ANOVA) were performed using the Microcal Origin software version 7.5 (Northampton, MA). Statistical significance was tested with Student’s t-test with significance being determined at confidence interval of p < 0.05 and p < 0.01.  101  3 VOLTAGE-DEPENDENT FACILITATION OF T-TYPE CALCIUM CURRENTS IN NEONATAL RAT VENTRICULAR MYOCYTES  3.1 Introduction  T-type Ca 2+  channels in developing hearts have been reported to contribute to pacemaking, spontaneous contractions and hormone secretion (Section 1.4). The exact contributions of T-type channels in the heart likely relies on the amount of Ca 2+  influx necessary to regulate other myoplasmic proteins and affect the transmembrane potential of cardiac myocytes. Hence, studying the mechanisms underlying the regulation of ICaT in the heart will provide a better understanding of the role of T-type channels in cardiac physiology and pathophysiology.  One mechanism of altering Ca 2+  channel activity in the heart is through the voltage- induced facilitation of Ca 2+  currents. Facilitation of ICaT in the cardiovascular system has thus far been shown only in guinea-pig coronary arteries (Ganitkevich and Isenberg, 1991) and frog atrial cells (Alvarez et al., 1996; Alvarez et al., 2000). Facilitation in guinea-pig coronary myocytes is attributed to changes in voltage-dependent gating properties of ICaT (Ganitkevich and Isenberg, 1991). On the other hand, in frog atrial cells facilitation of ICaT results from voltage-dependent relief of tonic inhibition by tyrosine phosphorylation and Gi proteins (Alvarez et al., 1996; Alvarez et al., 2000).  In Chapter 2, this thesis demonstrated that heterologously expressed cloned cardiac Cav3.2 channel displays VDF and in a splice variant specific manner. Chapter 2 also showed that the Cav3.2(-25) variant is predominantly expressed in the newborn rat ventricle and I hypothesize that the native ventricular ICaT displays VDF. In this chapter, I investigated whether ICaT in 102  newborn rat ventricular myocytes displays VDF and whether VDF is correlated with the expression of the Cav3.2(-25) alternative splice variant.  3.2 Results         3.2.1 Expression of Ca 2+  channels in neonatal rat ventricular myocytes  Newborn rat ventricular myocytes (NRVM) were prepared from newborn (P0) Wistar rats by serial enzymatic digestion and maintained in culture for two days prior to RNA extraction and whole cell patch clamp recordings. Immediately after isolation the cells were spherical in appearance. The cells were allowed to attach overnight. Adherent cells were fusiform or triangular in shape (Figure 3.1A). After 1 to 2 days in culture, NRVMs demonstrated spontaneous contractile activity. Quantitative RT-PCR analysis was used to examine the expression of cardiac Cav1.2, Cav3.1 and Cav3.2 channels (Figure 3.1B). The mRNA expression of Cav3.2 was approximately 35% higher than Cav3.1 channels and approximately 50% higher than Cav1.2 channels. The functional expression of HVA and LVA channels in NRVM was investigated by recording macroscopic Ca 2+  currents via whole cell patch clamp analysis. Figure 3.1C illustrates the I-V relationship for total Ca 2+  currents recorded from a holding potential (Vh) of -90 mV. Figure 3.1E shows the I-V relationship for Ca 2+  currents when T-type channels are inactivated (Vh of -50 mV)(ICaL). Representative current traces for total Ca currents and ICaL are shown in Figures 3.1D and 3.1F, respectively. L-type currents were evidently observed at more depolarized potentials and showed peak currents at 0 mV, consistent with that observed for L- type channels (Figure 3.1E). The I-V curve from a Vh of -90 mV showed a peak current at -30 mV with a second component observed at more positive potentials (Figure 3.1C). Overall, under 103  short term culture conditions, NRVM Ca 2+  currents recorded from Vh of -90 mV appear mostly contributed by T-type channels and likely consisting of both Cav3.1 and Cav3.2 isoforms.   Figure 3.1. Expression of HVA and LVA Ca 2+  channels in short-term cultured neonatal rat ventricular myocytes (NRVM).   104  (A) Neonatal rat ventricular myocytes (NRVM) 48 hours in culture. (B) qRT-PCR analysis for Cav3.1, Cav3.2 and Cav1.2 Ca 2+  channels. The level of mRNA expression was calculated relative to rActB expression. The expression of Cav3.2 mRNA is significantly higher than Cav3.1 T-type and Cav1.2 L-type Ca 2+  channels. Samples were from five individual total RNA preparations from five NRVM isolations. Values shown as mean ± standard error. T-test was performed to measure significant differences. *p ˂ 0.05 and **p ˂ 0.01. NRVM Ca currents were also recorded. (C) and (E) show the current-voltage (I - V) curves for total (L + T-type currents) and L-type Ca 2+  currents recorded from NRVM, respectively. Representative traces for total (D) and L-type (F) macroscopic Ca 2+  currents. Two populations of macroscopic Ca 2+  currents exist in currents recorded from Vh of -90 mV as evidently observed in their kinetics of activation and inactivation (red trace). In Vh of -50 mV, macroscopic Ca 2+  currents with fast activation and inactivation kinetics are eliminated. The I-V relationships of Ca 2+  currents for ventricular myocytes were obtained by depolarizing the myocytes with 200 ms prepulse from -80 mV to + 20 mV at 10 mV increments. A hyperpolarized holding potential of -90 mV recorded both Ca 2+  currents whereas Vh of -50 mV revealed exclusively L-type.         3.2.2 Biophysical properties of T-type Ca 2+  currents in isolated ventricular myocytes  To better isolate ICaT from ICaL, CdCl2 (20 M) was superfused to block ICaL. Figure 3.2A illustrates representative current traces evoked by test pulses to -60 mV (black), -30 mV (red) and 0 mV (blue) and summarizes the subtraction strategy used in studying NRVM ICaT. The top panel in Figure 3.2A shows current traces recorded from Vh = -90 mV -50 mV and the currents remaining after subtraction of the currents recorded from Vh of -90 mV to the currents recorded from Vh = -50 mV (in 2 mM Ca 2+ ).  The kinetics of the subtracted currents in the absence of Cd 2+  showed two distinct components of inactivation while Ca 2+  currents recorded from Vh of - 50 mV showed a single Cd 2+ -sensitive component (Figure 3.2A top middle panel). The addition of Cd 2+  totally eliminated ICaL (Figure 3.2A bottom middle panel) thus the subtracted currents recorded in the presence of Cd 2+  were taken as ICaT.  I-V curves for subtracted currents in NRVM obtained in the presence and absence of Cd 2+  in the external recording solution are shown in Figure 3.2B. Results showed a lack of significant difference between the V50 of activation of subtracted currents recorded in the 105  presence (-43.57 ± 1.06 mV, n = 8) and absence (-42.87 ± 0.68 mV, n = 9) of Cd 2+ . Isolated ICaT recorded with Cd 2+  typically showed a “criss-crossing pattern” of current traces when recorded with the I-V protocol as illustrated in Figure 3.2C. The steady-state inactivation properties of NRVM ICaT was studied by applying 5 second prepulses from -120 mV to -10 mV followed by a test pulse to – 30 mV for 90 ms. Results showed that the V50inact of ICaT = -73.54 ± 0.38 mV (n=7) (Table 3.1). The kinetic properties were also analyzed and are summarized in Table 3.1.  Table 3.1. Biophysical properties of T-type Ca 2+  currents in isolated neonatal rat ventricular myocytes. Parameters Mean ± SE values  Number of cells V50act -43.57 ± 1.06 mV 9 kact -5.90 ± 0.59 mV 9 V50inact  -73.54 ± 0.38 mV 7 kinact 4.47 ± 0.31 mV 7 act 10.36 ± 1.59 ms 9 inact 4.18 ± 0.92 ms 9 Recovery 1 21.81 ± 7.33 ms 6 Recovery 2 137.93 ± 50.62 ms 6   106   Figure 3.2. Pharmacological and biophysical isolation of T-type Ca 2+  currents in newborn ventricular myocytes. T-type Ca 2+  currents (A, right panel) from newborn ventricular myocytes were isolated by subtracting currents recorded from Vh = -90 mV (A, left panel) to currents recorded from Vh = - 50 mV (A, middle panel) in the presence (A, lower panel) and absence (A, top panel) of 20 M CdCl2. Macroscopic Ca 2+  currents recorded without Cd 2+  (Vh of -90 mV)  revealed L- and T-type components as evidently observed in recorded currents at 0 mV (blue traces). L-type current components showed slow kinetics of inactivation (blue traces with asterisk). Typical ICaL 107  was recorded from Vh of -50 mV using Ca 2+  and was blocked when Cd 2+  was added (panel A, lower middle). Pure ICaT was obtained in the presence of 20 M CdCl2 (A, lower right panel). The inactivation kinetics observed in currents recorded at 0 mV in the presence of Cd 2+  is faster than the current inactivation when Cd 2+  is absent (blue traces in panel A, right). Panel B shows the I – V curves for NRVM ICaT in the presence (red circle) and absence (black circle) of Cd 2+ . The inclusion of Cd 2+  reduced the subtracted current density without any significant change in V50 of activation. (C) Representative traces for ICaT obtained from I – V protocol showed a criss- crossing pattern typically observed for whole cell recordings of T-type Ca 2+  currents.    The recovery from inactivation of NRVM ICaT was determined using a double pulse protocol. A prepulse to -30 mV for 400 ms was given and channels allowed to recover from inactivation at different time intervals (varying interpulse interval) between 5 ms to 5 seconds before applying a test pulse to -30 mV for 50 ms from Vh of -90 mV (Figure 3.3A, bottom panel). Fractional recovery was determined by calculating the amplitude ratio between the currents evoked by second pulse and the prepulse (Figure 3.3A top panel). Calculated ratios were plotted versus interval between pulses (Figure 3.3B). Results showed that the time constants of recovery were 21.81 ± 7.33 ms (n=6) and 137.93 ± 50.62 ms for 1 and 2, respectively (Table 3.1). Of note, NRVM ICaT displayed potentiated fractional recovery from inactivation (Figure 3.3B).  In order to examine if the observed potentiation of NRVM ICaT was comparable to that observed in the recovery from inactivation profile for the recombinant Cav3.2(-25) channel (Figure 2.6), an overlay of the NRVM ICaT and Cav3.2 exon 25 splice variant recovery from inactivation data was performed. Results showed that both NRVM ICaT and Cav3.2(-25) currents revealed potentiated recovery from inactivation as well as faster recovery kinetics compared with Cav3.2(+25) (Figure 3.3D). NRVM ICaT and Cav3.2(-25) showed a comparable level of potentiation until 1200 ms; however an interpulse greater than 3000 ms, the ratio of current magnitude reached a value close to that obtained for the Cav3.2(+25) variant. 108   Figure 3.3. The potentiated recovery from inactivation properties of NRVM T-type Ca 2+  currents is comparable to the recombinant Cav3.2(-25) alternative splice variant. (A) Representative currents obtained from the first eight traces (5 ms to 640 ms) showed complete recovery from inactivation (upper panel). The recovery from inactivation was analyzed using double pulse protocol. A -30 mV prepulse was applied for 400 ms and channels were allowed to recover at different time interval before applying a second pulse to -30 mV for 50 ms (bottom panel). (B) ICaT from newborn ventricular myocytes showed potentiated fractional recovery. (C) Overlay of recovery from inactivation profiles for Cav3.2 exon 25 alternative splice variants and NRVM ICaT. Both Cav3.2(-25) (blue circle) and 109  NRVM (red circle) ICaT display potentiated fractional recovery but not Cav3.2(+25) (black circle). The fractional recovery for NRVM at 3000 ms interpulse interval is comparable to Cav3.2(+25). These results show that the potentiated recovery from inactivation property of NRVM ICaT may be attributed to Cav3.2 minus exon 25 splice variant and the overall recovery from inactivation profile of NRVM could be a combination of both Cav3.2( ±) exon 25 splice variants. Fractional recovery was determined by calculating the amplitude ratio between the second pulse and the prepulse. Average data were fitted with a double exponential function to obtain the time constants for the fast (1) and slow (2) components of recovery from inactivation.       3.2.3 Voltage-dependent facilitation of T-type Ca2+ currents in rat ventricular myocytes.  The potentiated recovery from inactivation of ICaT in ventricular myocytes was further explored using the same strategy used in studying the VDF properties of cloned Cav3.2 alternative splice variants. Briefly, the percentage of facilitation was obtained by dividing the currents obtained at test pulses preceded by prepulses by currents recorded from -90 mV (Figure 3.4B bottom panel).  Average percentage NRVM ICaT facilitation was plotted as a function of prepulse potential and VDF of NRVM ICaT was observed from potentials positive to 0 mV (15 to 25%) (Figure 3.4A).  The magnitude of VDF of NRVM ICaT was compared against recombinant Cav3.1 channels and Cav3.2 (±) exon 25 variants (Figure 3.4C). The recombinant Cav3.1 channels do not display VDF whereas Cav3.2(-25) and NRVM ICaT displayed VDF. Additionally, the VDF of NRVM ICaT was greater than that for the VDF of Cav3.2(+25) channel.  To examine the correlation of expression of Cav3.2 exon 25 splice variants to the observed VDF, a qRT-PCR analysis was performed. Consistent with qRT-PCR data on newborn ventricular tissues (Figure 2.4), the level of mRNA expressed in newborn rat ventricular myocytes showed predominant expression of Cav3.2(-25), with 4- to 5-fold higher expression than the Cav3.2(+25) splice variant 110  (Figure 3.4D). This suggests that the observed VDF in newborn ventricular myocytes is predominantly contributed by Cav3.2(-25) splice variant channels.   Figure 3.4. Neonatal rat ventricular myocytes display VDF properties which is correlated with high level of Cav3.2 minus exon 25 alternative splice variant. (A) ICaT in newborn rat ventricular myocytes display significant VDF. Panel B shows the representative current traces obtained from recording VDF from NRVM. The VDF of NRVM ICaT was studied by applying a 200 ms test pulse to -30 mV following a series of depolarizing prepulses from -90 to + 110 mV after a time interval of 1.2 seconds (Vh = -90 mV). The percentage of facilitation was obtained by dividing the currents obtained from prepulses to 111  currents recorded at -90 mV. Averaged percentage of facilitation was plotted as a function of prepulse potential. (C) Comparisons of the percentage VDF obtained from + 30 mV test potential. Both NRVM ICaT and Cav3.2(-25) currents display robust VDF but not Cav3.2(+25) and Cav3.1. Thus, VDF in ventricular myocytes is perhaps contributed by ICaT from Cav3.2 minus 25 containing channels. (D) qRT-PCR of Cav3.2 (±) exon 25 variants. The expression of minus 25 was shown to be 4 to 5 fold higher than Cav3.2(+25) splice variants. Relative mRNA expression is compared against rat actin B (rActB) mRNA.  Error bars represent standard error. T-test was performed to measure significant differences. *p ˂ 0.01.   3.3 Discussion     3.3.1 T-type Ca 2+  channels are expressed in neonatal rat ventricular myocytes  The mRNA expression of Cav1.2 L-type and cardiac T-type isoforms (Cav3.1 and Cav3.2 channels) was determined by qRT-PCR analysis. Consistent with our previous data on Ca 2+  channels mRNA expression in heart tissue (Figures 2.1A and 2.1B), I demonstrated the expression of all three Ca 2+  channels in short-term cultured NRVM (48 hours). The amount of Cav3.2 mRNA expressed in cultured NRVM is significantly greater than Cav3.1 and Cav1.2 channels (Figure 3.1). The expression of Cav3.2 is two-fold higher than Cav1.2, and about one- fold higher than Cav3.1. Collectively, the mRNA expression of both cardiac T-type channels is much greater than Cav1.2 channels. This is consistent with the relative contribution of ICaT to the total Ca 2+  currents recorded from NRVM where ICaL contributed to approximately 35% of the total Ca 2+  currents recorded in newborn ventricular myocytes compared to ~65% for ICaT (Figures 3.1C and 3.1E). Our results are consistent with a previous report on the prominence of ICaT over ICaL in neonatal rat ventricular myocytes (Wang et al., 1991). Even when Cav3.1 and Cav3.2 channels are highly expressed during heart development (Section 1.4), knockout experiments have shown that silencing either of the CACNA1G and CACNA1H genes is not lethal indicating that individually the T-type isoforms are not indispensable or that a compensatory mechanism for T-type function exists in the knockouts (Kim et al., 2001; Chen et 112  al., 2003; Mangoni et al., 2006b). In this regard, it would be interesting to investigate whether a double knockout of Cav3.1 and Cav3.2 significantly alters heart development. ICaT in NRVM appears contributed by the expression of both Cav3.1 and Cav3.2 channels. Alternative splicing of Cav3.1 T-type channels in cultured ventricular myocytes has been reported (Cribbs et al., 2001), however, to our knowledge, alternative splicing of Cav3.2 channels in cultured NRVM has not been explored.  In Chapter 2, I demonstrated the expression of alternative splice variants of Cav3.2 channels in newborn ventricular tissues. The III – IV linker variants encoding for the inclusion and exclusion of exon 25 variants are the most abundant Cav3.2 alternative splice variants in the newborn ventricle. In this chapter, I studied the expression of Cav3.2 (±) exon 25 variants in NRVM. Consistent with our data on neonatal ventricular tissues (Figure 2.4), I observed significant expression of Cav3.2(-25) variants in short- term cultured newborn ventricular myocytes (Figure 3.4D).      3.3.2 Voltage-dependent facilitation of NRVM ICaT is correlated with Cav3.2(-25) splice variant expression  One of the objectives of this work was to examine whether ICaT from newborn rat ventricular myocytes displays VDF. Our results presented in Chapter 2 demonstrated that cloned Cav3.2 channels exhibit both a potentiated fractional recovery from inactivation and VDF in splice variant specific manner (Figures 2.6, 2.7 and 2.8). In this chapter I examined the biophysical and VDF properties of NRVM ICaT as well as correlated the expression profile of Cav3.2(±) exon 25 splice variants to the observed properties.  Recovery from inactivation of NRVM ICaT was investigated and showed a facilitated fractional recovery (Figure 3.3B). The recovery from inactivation of ICaT from NRVM is more similar to the cloned Cav3.2(-25) potentiated fractional recovery compared to cloned Cav3.2(+25) 113  fractional recovery (Figure 3.3C). VDF property was also examined in NRVM ICaT. Comparative analysis of the VDF properties of NRVM ICaT and the magnitude of facilitation of Cav3.1 channels and Cav3.2 (±) exon 25 alternative splice variants showed that both NRVM ICaT and Cav3.2(-25) displayed VDF but not the Cav3.1 or Cav3.2(+25) isoforms (Figure 3.4C). Significantly, among recombinant Cav3.1 III – IV linker variants, a lack of potentiated fractional recovery (Chemin et al., 2001a; Latour et al., 2004) and VDF has also been reported (Klockner et al., 1999; Chemin et al., 2002; Gomora et al., 2002). Thus, the facilitation observed in dissociated NRVM is unlikely contributed by splice variants of Cav3.1 channels.  I also observed that the VDF of ICaT in cultured NRVM is predominantly correlated to Cav3.2(-25) variant expression. Hence, Cav3.2(-25) containing channels likely contributes to the observed VDF of NRVM ICaT. The magnitude of facilitation observed in NRVM is lesser than the recombinant Cav3.2(-25) (Figure 3.4C). One possible explanation might be attributed to inhibition by endogenous regulatory proteins present in ventricular myocytes. For example, G might be tightly bound with Cav3.2 channels potentially leading to a lower relative VDF. In support of this potential mechanism, I demonstrated that the magnitude of VDF of recombinant Cav3.2(-25) channels was reduced by G22 (Figure 2.9D). In the future, it would be interesting to determine whether disrupting the binding of endogenous Gcould increase the magnitude of facilitation of NRVM ICaT.      3.3.3 Potential significance of voltage-dependent facilitation of T-type Ca2+ currents in neonatal ventricle  Prior to this research, VDF among T-type Ca 2+  channels had been shown for recombinant Cav3.3 channels (Klockner et al., 1999; Chemin et al., 2002; Gomora et al., 2002) and native ICaT in bone marrow cells as well in atrial and coronary smooth muscle myocytes (Ganitkevich and 114  Isenberg, 1991; Publicover et al., 1995; Alvarez et al., 1996). Here, I showed that the cloned rat cardiac Cav3.2(-25) splice variant also displays prominent VDF (Chapter 2). Importantly, I also showed that cultured NRVM ICaT exhibit VDF, correlated to the predominant expression of Cav3.2(-25) variant in these cells (Figure 3.4).  The functional implication of ICaT VDF in newborn ventricle remains to be described. In the following discussion, I will examine the potential contributions of Cav3.2 VDF in the neonatal ventricle and suggest potential experiments for future studies. Figure 3.5 illustrates some functional components of a typical neonatal rat ventricular myocytes (Gaughan et al., 1998).  In newborn ventricle, the resting potential is between -70 mV and -60 mV, the AP duration of approximately is 350 ms and peaks at +30 mV. I observed that at + 30 mV prepulse NRVM ICaT display VDF (Figure 3.4). Taking into consideration the previously reported newborn ventricular electrical properties and our current data on ICaT VDF in cultured NRVM, under physiological conditions VDF in newborn ventricle might occur which would potentially lead to an increase in intracellular Ca 2+ .  T-tubules and SR are not fully developed in immature hearts and ICaT supplies most of the Ca 2+  that triggers the contraction in the immature myocardium (Nuss and Marban, 1994; Wetzel and Klitzner, 1996; Haddock et al., 1999; Artman et al., 2000; Escobar et al., 2004; Tohse et al., 2004). It is tempting to speculate that the VDF of Cav3.2 ICaT contributes to the Ca 2+  flux leading to spontaneous beating and contractions of newborn ventricles. First, during the peak of the AP elevated Ca 2+  from the VDF of Cav3.2 ICaT is predicted to directly activate the contractile machinery to induce contraction (Figure 3.5a). Secondly, elevated intracellular Ca 2+  from VDF would directly trigger local Na/Ca exchangers to enter into reverse mode allowing Ca 2+  flux to further increase contraction (Figure 3.5b). Because of their low threshold of activation, Cav3.2 channels activate early during the phase between two contractions and before the onset of the 115  next AP. The AP duration for neonatal rat ventricle is between 200 to 350 ms (Cohen and Lederer, 1988; Gaughan et al., 1998). Current work shows that both VDF and potentiated fractional recovery occurs after ~1000 ms interval, hence facilitation of native ventricular ICaT might occur after at least three APs. The resulting increased in inward ICa would potentially result in an increase in intracellular Ca 2+  concentration sufficient to trigger spontaneous contractions. Lastly, at rest the residual Ca 2+  from the previous VDF would perhaps result in a relatively large inward Na/Ca exchanger component which would depolarize the ventricle to allow generation of the next AP (Figure 3.5c). This perhaps contributes to a more positive resting potential for the neonatal ventricle compared to the adult ventricle (Cohen and Lederer, 1988; Gaughan et al., 1998). Overall, it would be interesting to explore these potential contributions to further elucidate the role of Cav3.2 channels in postnatal heart development. Suggested future experiments include measurement of contractility and intracellular Ca 2+  using a combination of confocal microscopy and patch-clamp techniques on Cav3.2 -/-  ventricular myocytes overexpressing exon 25 splice variants. Such studies may more clearly define the physiological roles of Cav3.2 exon 25 splice variant channels in the heart.  116   Figure 3.5. Potential contribution of Cav3.2 T-type Ca 2+  channel VDF in neonatal rat ventricle. A typical neonatal rat ventricular action potential is shown on the right. The resting potential is between -70 to -60 mV and peak AP is at + 30 mV (Re-drawn from (Gaughan et al., 1998)). Proposed contributions of VDF of Cav3.2 T-type Ca 2+  currents in neonatal ventricular myocytes. Cav3.2 T-type Ca 2+  channels would contribute to activation of contractile machinery to induce spontaneous contraction and beating by (a) VDF of Cav3.2 channels would increase intracellular Ca 2+  levels enough to directly activate myofilaments (red arrows), (b) Elevated Ca 2+  would change the conformation of the local Na/Ca exchanger allowing it to go to reverse mode. This would increase intracellular Ca 2+  enough to activate the contractile machinery (blue arrows) or (c) Residual Ca 2+  from previous VDF would result in large inward Na/Ca exchanger currents. This would allow increase in Na +  influx enough to depolarize the ventricle to generate the next action potential (green arrows). 117   3.4 Materials and methods      3.4.1 Animals and reagents  All animal procedures were performed in accordance with Canadian Council on Animal Care (CCAC) guidelines for animal research. Newborn (P0) Wistar-Kyoto rats were utilized in this research and purchased from University of British Columbia Animal Care Center, Vancouver, B.C., Canada.  All chemicals were purchased from Sigma (St. Louis, Missouri) unless otherwise stated. Culture media components were purchased from Invitrogen (Carlsbad, California).      3.4.2 Isolation of neonatal rat ventricular myocytes  One litter of newborn rats (8- 12 animals) was used per experiment. Ventricular myocytes were dissociated by serial enzymatic digestion as follows: P0 rats were cervically dislocated and then decapitated using a pair of scissors. The thorax of each animal was sterilized with 95% ethanol and an incision was made into the sternum to expose the heart. The beating heart was excised and immersed in sterile ice cold 1X ADS buffer containing (in mM) 116 NaCl, 20 HEPES, 0.5 NaH2PO4·H2O, 5.4 KCl, 0.8 MgSO4 and 5.5 glucose. All hearts were collected in a 60 mm Petri dish and washed.  Ventricles were isolated by removing the atria using curved forceps and a pair of curved small scissors. The isolated ventricles were then transferred into a new Petri dish and chopped into small pieces. Using a sterile 25 mL pipette the tissue pieces were transferred to a 50 mL Falcon tube. The ventricular tissues were allowed to settle at the bottom of the tube. Once settled ADS was removed using a sterile pipette. 118   Ventricular tissues were then subjected to serial enzymatic digestion using collagenase Type 2 (Worthington Biochemical Corporation, Lakewood, New Jersey) and pancreatin (Sigma, St. Louis, Missouri). Initial enzymatic digestion of ventricular tissues was performed by adding 8 mL of pre-warmed enzyme solution (0.6 mg/mL pancreatin and 100 Units/mL collagenase in 1X ADS buffer) and incubated in a shaking water bath at 37ºC with a speed of 65 rpm for 5 minutes. After incubation, tissues were left to settle at the bottom of the tube and the supernatant was discarded using a sterile pipette and vacuumed. Ventricular tissues were then re-digested in enzyme solution and incubated in a shaking water bath at 37ºC. Digested tissues were left to settle at the bottom and supernatant was transferred into a 50 mL Falcon tube containing sterile fetal bovine serum (Sigma, St. Louis, Missouri, 20% final concentration). The supernatant from this step contained the ventricular cell suspension. This supernatant was spun in a Hettich Universal 320R centrifuge at 1200 rpm for 6 minutes at 25ºC. After centrifugation, the supernatant was discarded and the pellet was resuspended in sterile 6 mL pre-plating medium (PPM) containing (in %): 68 DMEM, 17 M199, 10 horse serum, 5 fetal bovine serum. Resuspended pellets were triturated and transferred in a sterile 50 mL falcon tube and equilibrated in the 37ºC incubator aerated with 5 % CO2. Prior to centrifugation ventricular tissues were re-digested with fresh enzyme solution and incubated in a shaking water bath. The digestion and centrifugation were repeated six to eight times. The ventricular cells harvested after centrifugation were pooled in the same 50 mL falcon tube containing PPM.  Immediately after finishing all the digestion steps, cells were spun at 1200 rpm for 6 minutes at 25ºC and the pellet was resuspended in 15 mL PPM. The cell suspension was gently filtered through a sterile 70 m Falcon cell strainer (BD Biosciences, Bedford, Massachusetts). The cell suspension was divided into three 60 mm Petri dishes containing 5 mL each and pre- plated for 60 – 90 minutes in a 37ºC incubator allowing the fibroblast to be attached. After pre- 119  plating, the dishes were transferred to the sterile hood and were tapped on top of the hood bench to dislodge attached ventricular myocytes. Using a 10 ml pipette, the media containing the myocytes were transferred in a new sterile 50 mL falcon tube. Then the Petri dishes were washed with PPM to further harvest the myocytes that remained in the dish. Washing was repeated until there were no myocytes to transfer. The media used for washing was pooled to the original cell suspension. For electrophysiological studies, ventricular myocytes were seeded in 35 mm Petri dishes containing 12 mm glass coverslips coated with 15 g/mL laminin. NRVM were seeded at a density of 7.5 x 10 4  cells/mL. For qRT-PCR analysis, ventricular myocytes were grown in a 1% gelatin coated T25 flask at a density of 1.0 x 10 5 cells/mL. NRVM were incubated overnight at 37ºC. The following day, media was replaced with pre-warmed sterile serum-free maintenance media containing 80% DMEM, 20% M199 and 1% (v/v) penicillin/streptomycin.      3.4.3 RNA extraction and quantitative Real-Time-PCR (qRT-PCR)  After 24 hours of incubation in serum free maintenance media, total RNA from cultured NRVM was prepared. Maintenance media were discarded using a sterile pipette and vacuumed. One mL of Trizol (Invitrogen) was added to the myocytes. Using an RNAse-free plugged tip, myocytes were dislodged by pipetting up and down. NRVM/Trizol mixture was then transferred and homogenized in a sterile glass/Teflon homogenizer. Homogenized samples were incubated at room temperature (RT) for 5 minutes followed by adding 200 μL choloroform and incubated at RT for another 3 minutes. Samples were spun in a table top centrifuge at 11,000 x g for 15 minutes at 4ºC. The aqueous phase of the centrifugate was immediately transferred to a clean RNAse-free eppendorf tube and 500 μL of isopropanol was added. The centrifugate/isopropanol mixture was incubated at RT for 10 minutes to precipitate the RNA. After the incubation, samples were spun at 11,000 x g for 10 minutes at 4ºC. The precipitate was washed with 75% 120  ethanol and spun at 7,500 x g for 5 minutes. The supernatant was removed and final pellets were dried briefly prior to suspension in DEPC-treated deionized water.  Total RNA was used to synthesize cDNA using a High Capacity cDNA Reverse Transcription kit (Applied Biosystems).  Real-time-PCR reactions were performed using Applied Biosystems  reagents; Applied Biosystems AB 7500 instrument and TaqMan probes generated against the respective cDNA targets. Primer mixes used for  qRT-PCR analysis to determine the level of mRNA expression of Ca 2+  channels were purchased from Applied Biosystems (Carlsbad, California). Relative mRNA amounts were estimated after actin B normalization. All qRT-PCR reactions were run in triplicate and averages were determined. A total of five RNA preparations from five NRVM isolations were utilized in determining the level of mRNA expression       3.4.4 Whole cell patch clamp analysis of isolated neonatal ventricular myocytes  Neonatal ventricular myocytes were maintained in serum-free maintenance media at 37ºC in a humidified incubator with 95% O2 and 5% CO2 for 24 hours prior to whole cell patch clamp analysis. When the myocytes started beating which was normally 24 - 48 hours after isolation, NRVM were ready for biophysical characterization.  Macroscopic currents were recorded using Axopatch 200B amplifiers (Axon Instruments, Foster City, CA) controlled and monitored with personal computers running pClamp software version 9 (Axon Instruments). The external recording solution was composed of the following (in mM): 2 CaCl2, 1 MgCl2, 92 CsCl, 10 glucose, 40 tetraethylammonium chloride, 10 HEPES, osmolarity was adjusted to 310 mOsm with D-mannitol and pH to 7.4. The internal pipette solution contained (in mM): 120 Cs-MeSO3, 11 EGTA, 10 HEPES, 2 MgCl2, 5 MgATP, 0.3 NaGTP, osmolarity was adjusted to 290 mOsm with D-mannitol and pH to 7.2. 20 M CdCl2 was added to the external recording solution to eliminate the ICaL component. Patch pipettes 121  (borosilicate glass BF150-86-10; Sutter instruments, Novato, CA) were pulled using a Sutter P- 87 puller and fire polished with a Narashige (Tokyo, Japan) microforge with typical resistances of 3 – 6 MΩ when filled with internal solution. The bath was grounded via a 3 mM KCl bridge. Data were filtered at 2 kHz with the built–in Bessel filter of the amplifier. The amplifier was also used for capacitance and series resistance compensation between 75 to 85% on every cell. Leak subtraction of leakage current was performed during off-line analysis.  I-V relationships of ventricular myocytes were studied using two holding potentials to determine the contribution of T- and L-type Ca 2+  currents in these cells. A hyperpolarized holding potential of -90 mV recorded both Ca 2+  currents whereas Vh of -50 mV revealed exclusively ICaL. The contribution of NRVM ICaT was determined by subtracting recorded Ca 2+  currents obtained from Vh -90 mV to Vh -50 mV both in the presence and absence of 20 M CdCl2 (Figure 3.2). Voltage-dependent activation was studied by applying 200 ms depolarizing pulses from -80 mV to + 20 mV at 10 mV increments. Current densities (in pA/pF) were calculated by dividing the capacitance (in pF) of each myocyte from the current (in pA) obtained in each test potential. The values from the current densities were utilized to analyze the voltage- dependence of ICaT. I-V relationships were fitted with the modified Boltzmann equation : Im = (Gmax X (Vm-Erev)) / (1+ exp((Vm-V50act)/kact)),  where Gmax is the maximum slope conductance; Erev  is the extrapolated reversal potential; Vm is the membrane potential, V50act is the half activation potential;  kact  is the slope factor of activation which reflects the voltage sensitivity.  Steady-state inactivation of NRVM ICaT was studied by applying 5 second prepulses from -120 mV to -10 mV followed by a test pulse to – 30 mV for 90 ms. The current magnitude obtained during each test pulse was normalized to the maximum current and plotted as a function of the pre-pulse potential. Steady state inactivation normalized data were fitted using the Boltzmann equation (I/Imax = (1+exp((V-V50inact)/kinac)) -1 ), where Imax is the maximum current; 122  V50inact is the membrane potential at which 50% of the channels are inactivated, kinac is the slope factor of inactivation.  NRVM ICaT kinetics of activation (act) and inactivation (inact) were analyzed by fitting current recordings obtained from subtracted Ca 2+  currents (Figure 3.2). To obtain the values for the activation and inactivation kinetics, current traces were fitted with a single exponential standard equation I = Ae -t/ , where A is the amplitude of the current at to, and  is the time constant.  Recovery from inactivation was determined by double pulse protocol; a prepulse to -30 mV for 400 ms was given and allowed to recover at different time intervals (interpulse interval) between 5 ms to 5 seconds before applying a test pulse to -30 mV for 50 ms (Vh = -90 mV). The peak current from the test pulse was plotted as ratio of maximum prepulse current versus interval between pulses. The data were fitted with a double exponential function (I/I max = A0 + A1*exp(-t/) + A2*exp(-t/2)), where A0  is the amplitude for inactivating component, A1 and A2 are the amplitudes for the fast and slow components of the exponential, and 1 and 2 are the time constants for the fast and slow components.  The VDF property of NRVM ICaT was studied by applying a 200 ms test pulse to -30 mV following a series of depolarizing prepulses from -90 to + 110 mV after a time interval of 1.2 seconds. The percentage of facilitation was obtained by dividing the currents obtained from prepulses to currents recorded at -90 mV. Averaged percentage of facilitation was plotted as a function of prepulse depolarization. All recordings were performed at room temperature (~22 - 24ºC).  Data analysis was performed using Clampfit software version 9.0 (Axon Instruments). All plots and statistical analysis (T-test and ANOVA) were performed using the Microcal Origin 123  software version 7.5 (Northampton, MA). Statistical significance was tested with Student’s t-test with significance being determined at confidence interval of p < 0.05 and p < 0.01. 124  4 CONCLUSION  4.1 Overall significance     4.1.1 Identification and characterization of cardiac Cav3.2 alternative splice variants   Although Cav3.2 T-type channels had been reported to be expressed in the heart, alternative splicing of cardiac Cav3.2 channels has not yet been explored. Alternative splicing of transcript of the CACNA1H gene which encodes for the Cav3.2 T-type channel has thus far been shown in human fetal whole brain (Zhong et al., 2006), rat thalamus (David et al., 2008; Powell et al., 2009) (Appendix 5), testis (Jagannathan et al., 2002) and uterus (Ohkubo et al., 2005). Alternative splice variants of Cav3.2 channels have been implicated in the pathophysiology of epilepsy and sperm cell differentiation (Jagannathan et al., 2002; Zhong et al., 2006; Powell et al., 2009). However, prior to this research, the relevance of Cav3.2 alternative splicing had not been described for the developing or diseased heart. The elucidation of cardiac Cav3.2 alternative splice variants is predicted to provide important new insights into the contributions of Cav3.2 channels in cardiac development and disease progression.  The first major objective of this thesis was to explore whether cardiac Cav3.2 channels are subject to major alternative splicing. A second major objective was to functionally characterize the full-length splice variants using a heterologous expression system. This thesis utilized an experimental design that allowed comprehensive splice-variant screening via full length cDNA sequencing and colony PCR screening of possible cardiac Cav3.2 alternative splice variants (Chapter 2). Since Cav3.2 is predominantly expressed in the early stages of development, newborn (day 0) rat hearts were utilized for the splice variant screening.  This thesis described 25 in-frame/C-terminal alternative splice variants occurring at 10 distinct sites in the Cav3.2 protein (Figure 2.2 and Table 2.1). Additionally, this research found 125  21 out-of-frame splice variants (data not shown) which resulted in premature truncations (PCTs) predicted to encode in non-functional channels. Out of frame variants are predicted to elicit nonsense–mediated decay (NMD) and/or act as dominant negative regulators of wild type channels (Wielowieyski et al., 2001; Lejeune and Maquat, 2005; Zhong et al., 2006). NMD is an important mechanism to degrade abnormal mRNAs that encode potentially deleterious truncated proteins and to achieve proper levels of gene expression (Lejeune and Maquat, 2005). Truncated Cav3.2 channels have been shown to suppress the expression of wildtype channels suggesting a functional role for PCTs (Heron et al., 2004; Mezghrani et al., 2008). Compared with the previous studies on Cav3.2 alternative splicing which utilized partial length cDNA screening, this study employed full length cardiac Cav3.2 cDNA libraries which allowed analysis of the entire Cav3.2 ORF. Notably, most alternative splicing occurs at the cytoplasmic regions of the channel (8 sites) known to be critical for channel functional properties (Figure 2.2). The cytoplasmic regions of T-type channels are known to be implicated in regulation of channel biophysical properties as well as modulation by certain GPCRs and kinases (Arnoult et al., 1997; Chemin et al., 2001a; Welsby et al., 2003; Wolfe et al., 2003; Hildebrand et al., 2007; Vitko et al., 2007; Iftinca and Zamponi, 2009) (Appendix 2). The splice variants located in six different cytoplasmic regions were subjected to more in-depth analysis via qRT-PCR and whole cell patch clamp analysis.  Among the six distinct variant regions studied, Cav3.2 domain III – IV linker splice variants encoding for the inclusion or exclusion of exon 25 revealed notable expression and biophysical profiles. The level of mRNA expression of Cav3.2(- 25) channels was found to be higher than Cav3.2(+25) channels in the newborn hearts (Figures 2.3, 2.4 and 3.4D). Furthermore, the two variants also showed distinct biophysical properties. Examination of cardiac Cav3.2 (±) exon 25 splice variants demonstrated significant variant-specific changes in 126  recovery from inactivation and VDF. Exclusion of exon 25 resulted in Cav3.2 currents with robust VDF and faster time constants for recovery from inactivation compared with Cav3.2 plus exon 25 containing channels (Figures 2.6, 2.7, 2.8 and Table 2.3). This is the first study to report VDF of recombinant Cav3.2 channels. Another contribution of this research was the description of a differential effect on Cav3.2 VDF by G. Co-transfected G22 reduced the magnitude of VDF of Cav3.2(-25) by approximately 50% (Figure 2.9D). G22 however, did not have any effect on Cav3.2(+25) variant channels (Figure 2.9E). Overall, the study found evidence of extensive splicing in intracellular loops of cardiac Cav3.2 channels correlated with distinct biophysical properties.        4.1.2 Developmental and pathological expression of Cav3.2 alternative splice variants  Cardiovascular T-type Ca 2+  channels have been shown to be prominently expressed during early stages of development, downregulated in the adult ventricles and upregulated or re- expressed in the adult diseased ventricles. The Cav3.1 and Cav3.2 isoforms are highly expressed in immature hearts (Cribbs et al., 2001; Ferron et al., 2002; Niwa et al., 2004) but in adult hearts the expression of Cav3.2 becomes significantly reduced and Cav3.1 becomes the predominant isoform but mainly being restricted to pacemaker cells (Qu and Boutjdir, 2001; Mangoni and Nargeot, 2008). However in the hypertrophic adult ventricle, both the functional ICaT and mRNA expression of Cav3.2 have been shown to be upregulated (Martinez et al., 1999; Yasui et al., 2005). Additionally, specific expression of the Cav3.2 T-type isoform has also been associated with the pathogenesis of pressure overload-induced cardiac hypertrophy (Chiang et al., 2009). Although, regulation of Cav3.2 expression exists during development and disease, changes in the pattern of expression of Cav3.2 alternative splice variants have not been explored. The third 127  major objective of this thesis was to determine whether alteration in the pattern of expression of Cav3.2 alternative splice variants is associated with cardiac development and hypertrophy.  This study explored changes in the relative expression of Cav3.2 alternative splice variants in newborn and adult hearts (Chapter 2). I found that the relative expression of the domain III – IV linker variants (Cav3.2 ± 25) showed significant differences in the pattern of expression in newborn versus adult hearts (Figure 2.3). In the newborn heart the exclusion of exon 25 is predominantly expressed occurring at a level 7 to 8 fold higher than (+) 25 exon variant transcripts. Interestingly, in the adult ventricle the overall ratio of (+25) to (-25) variants was approximately equal attributed to the reduction in the expression of the minus exon 25 variant (Figures 2.3 and 2.4). These findings are the first evidence that Cav3.2 alternative splicing is regulated in developing hearts. Interestingly, developmental regulation of expression of alternative splice variants of other Ca 2+  handling proteins such as CaMKII, cardiac troponin T and Cav1.2 channels have also been reported (Tang et al., 2004; Ladd et al., 2005; Xu et al., 2005). Therefore, understanding the overall functional significance of postnatal changes in cardiac splicing pattern of Ca 2+  handling proteins would provide insight into the contribution of these proteins in postnatal heart development.  Ca 2+  influx via transient receptor potential canonical (TRPC) channels (Wu et al., 2010; Eder and Molkentin, 2011), L-type channels (Chen et al., 2011) and T-type channels (Chiang et al., 2009; Nakayama et al., 2009; Cribbs, 2010) have all been implicated in cardiac hypertrophic responses. Increase of intracellular Ca 2+  is thought to be critically involved in cardiac hypertrophic signalling in part through the Ca 2+ -activated protein phosphatase calcineurin which leads to activation of the transcription factor NFAT (Houser and Molkentin, 2008). Interestingly, the Cav3.2 T-type channels have been shown to be involved in the pathogenesis of cardiac hypertrophy via calcineurin/NFAT pathway (Chiang et al., 2009). Moreover, upregulation of 128  Cav3.2 channels has also been demonstrated in pathological ventricular hypertrophy (Martinez et al., 1999; Yasui et al., 2005). Addtionally, in Chapter 2 I provided evidence on extensive alternative splicing of cardiac Cav3.2 channels. This prompted me to study whether the expression of Cav3.2 alternative splice variants are altered in cardiac hypertrophy. The regulation of expression of Cav3.2 exon 25 splice variants was investigated in ventricular hypertrophic SHR animals. The SHR is a commonly-used model in studying cardiac hypertrophy since this model closely mimics the most common pathophysiological changes in the human cardiovascular system – hypertension, cardiac hypertrophy and heart failure (Doggrell and Brown, 1998; Chen- Izu et al., 2007; Tang et al., 2008). Age- and sex-matched normotensive WKY rats were used as controls. The hypertrophic phenotype of the SHR animals was confirmed using two molecular markers known to be upregulated in pathological hypertrophy (Figure 2.10A). In addition, histological staining indicative of tissue fibrosis resulting from cardiac hypertrophy was also determined (Figure 2.10B). Overall, our data were consistent with the phenotype of pathological ventricular hypertrophy. This thesis next determined if there are splice variant-specific changes in the expression of Cav3.2 exon 25 splice variants. An upregulation of overall expression of Cav3.2 channels was observed in hypertrophic SHR (Figure 2.10C), a result consistent with an increase in expression of Cav3.2 channels observed in the diseased ventricle by other investigators (Martinez et al., 1999; Yasui et al., 2005). More importantly, a significant increase in the relative amount of Cav3.2(+25) variant compared to Cav3.2(-25) was observed in hypertrophic SHR (Figures 2.10C and 2.10D) resulting in a shift in the predominant exon 25 splice isoform. Thus in pathological cardiac hypertrophy there appears to be a splice-specific upregulation of Cav3.2 alternative splice variants. The potential significance of this observation is discussed in subsequent section. Overall, the study provided evidence that splice-variant 129  specific changes in expression of Cav3.2 are associated with cardiac development and hypertrophy.  4.2 Splice variant specific expression of Cav3.2 T-type Ca 2+  channels during development and hypertrophy     4.2.1 Working hypothesis  Several splice variants exist for each of ten Ca 2+  channel genes with evidence showing developmental and pathophysiological changes in expression patterns. Alternative splicing generates isoforms that show significant ion channel properties, localization, enzymatic activity, protein stability and post-translational modification (Stamm et al., 2005) profoundly affecting animal physiology, development and pathophysiology (reviewed in (Lopez, 1998; Grabowski and Black, 2001; Stamm et al., 2005; Blencowe, 2006; Gray et al., 2007; Swayne and Bourinet, 2008). For example, alternative splicing in the CACNA1A genes has been demonstrated to alter the functional properties of Cav2.1 channels. It was reported that the expression of the mutually exclusive exons 37a and 37b (EF hand variants) determines the CDF property of Cav2.1 (Soong et al., 2002; Chaudhuri et al., 2004). The expression of these variants changes the functional properties of Cav2.1 channels by regulating the influx of Ca 2+  to the cell. Interestingly, spatial and temporal regulation of expression EF hand variants was observed in human and rodent brains suggesting regional- and development-specific roles (Chang et al., 2007). Additionally, our laboratory has also shown that FHM-1 mutations introduced to the Cav2.1 (+/-) exon 47 have splice-dependent effects on voltage-dependent gating and kinetic properties suggesting a role of Cav2.1 alternative splicing in the molecular pathophysiology of FHM-1 (Adams et al., 2009) (Appendix 4). 130   Changes in the expression of Cav1.2 alternative splice variants during development and in disease states have been demonstrated by several groups of investigators (Section 1.3.1). For instance, the level of expression of exons 9* and 33 was reported to change during maturation. Compared to the fetal brain, downregulation of exon 9* and upregulation of exon 33 was observed in the adult brain (Tang et al., 2009). Conversely, compared to the fetal heart, higher expression of exon 9* and lower expression of exon 33 were observed in the adult heart (Tang et al., 2004). Relevant to cardiovascular diseases, changes in the level of expression of Cav1.2 of the mutually exclusive exons 21 and 22 have been reported in human atherosclerotic patients and hypertrophic SHR (Tiwari et al., 2006; Tang et al., 2008). Upregulation of exon 22 was observed in atherosclerosis whereas in cardiac hypertrophy the combination of both exons 21 and 22 are significantly expressed.  T-type channels are also subjected to alternative splicing (Section 1.3.2). Developmental regulation of expression of human Cav3.1 channels has been reported by Emerick et al. (Emerick et al., 2006). The authors reported a switch in the predominant expression of exon 25C and 26 variants between fetal and adult brains. Exon 26 is predominantly expressed in the fetal brain whereas exon 25C is preferentially expressed in the adult brain. The neuronal Cav3.2 channels have also been demonstrated to be subjected to alternative splicing (Zhong et al., 2006; David et al., 2008; Powell et al., 2009) (Appendix 5). Thus far, there is no report on developmental and pathological changes in the expression of Cav3.2 alternative splice variants. However, our laboratory demonstrated that the functional effects of introduced GAERS mutations are dependent on Cav3.2 alternative splice variants (Powell et al., 2009) (Appendix 5). Collectively, the results from the above studies provided evidence of alteration in the expression of alternative splice variants during development and disease. To date, alternative splicing in rat cardiac Cav3.2 channels has not been studied. This study worked on the hypothesis that the cardiac Cav3.2 131  channels are subjected to alternative splicing and that patterns of expression of alternative splice variants are altered during development and hypertrophy.  The results in Chapter 2 provided evidence of extensive splicing of cardiac Cav3.2 T-type channels. Importantly, I demonstrated an alteration in the predominant expression of Cav3.2 alternative splice variants during normal cardiac development and in pathophysiological state. I showed that the expression of Cav3.2 minus exon 25 is predominantly expressed in the newborn atria and ventricles. In the adult ventricle, I demonstrated that the expression of Cav3.2 minus exon 25 was significantly reduced resulting in approximately equal levels of both plus and minus exon 25 variants. However, in the adult hypertrophic ventricle from SHR, an overall upregulation of both splice variants was observed. Interestingly, I observed a shift towards the expression of Cav3.2 plus exon 25 variants as the predominant form. Overall, my observations support my hypothesis that changes in the expression of Cav3.2 alternative splice variants are associated with cardiac development and hypertrophy.  In general, the molecular mechanism underlying the downregulation and upregulation of Cav3.2 channel expression in the adult normal and diseased rat ventricles is not clearly understood. I speculate that downregulation of cardiac Cav3.2 expression during maturation could be explained by suppression by the transcriptional suppressor NRSE/NRSF. Previous reports showed that NRSF expression in the fetal heart is barely detectable but in adult heart significant expression was detected (Kuwahara et al., 2001; Kuwahara et al., 2003). With regard to the expression of Cav3.2 channels, significant expression was reported during the early stage of development and much reduced or undetected in the adult heart (Qu and Boutjdir, 2001; Ferron et al., 2002). This shows that the expression of Cav3.2 and NRSF is negatively correlated. This negative correlation was tested in transgenic mice expressed with a dominant negative mutant of NRSF (dnNRSF Tg). Compared with the wild type mice, Cav3.2 mRNA were 132  upregulated in dnNRSF Tg mice, suggesting that the absence of NRSF allowed Cav3.2 expression to proceed (Kuwahara et al., 2003; Kuwahara et al., 2005).  In this study, I also showed an upregulation of expression of Cav3.2 channels in hypertrophic ventricles from SHR. This is consistent with previous reports on upregulation of Cav3.2 expression in other models of cardiac hypertrophy (Martinez et al., 1999; Kuwahara et al., 2003; Yasui et al., 2005). Kuwahara and colleagues have reported negative correlation of expression of mouse cardiac Cav3.2 channels and the transcriptional repressor NRSF (Kuwahara et al., 2003; Kuwahara et al., 2005). In addition, the authors also observed that dnNRSF Tg mice have a cardiac hypertrophic phenotype suggestive of the involvement of NRSE/NRSF transcriptional regulator to the hypertrophic signalling pathways (Kuwahara et al., 2003; Kuwahara et al., 2005). Therefore, it is tempting to speculate that the upregulation of rat cardiac Cav3.2 expression in hypertrophic SHR could also be attributed to downregulation of NRSF.  Based upon my data on the quantitative mRNA expression analysis, I showed splice variant specific changes in the expression of cardiac Cav3.2 during development and pathological hypertrophy. This study provided evidence of changes in the pattern of expression of Cav3.2 exon 25 splice variants in developing and disease states.  However, the pathways leading to the expression of specific splice variants in specific functional states are not explored in this thesis. Using the data obtained in this thesis and information from previous studies, I am proposing hypothetical pathways on the signalling mechanisms involved in the regulation of expression of rat cardiac Cav3.2 exon 25 splice variants (Figure 4.1). These proposed pathways would be potentially good research topics for future studies.  A number of transcription factors and splicing regulators have been reported to be involved in the regulation of expression of cardiac proteins in the developing and diseased heart (Tang et al., 2004; Ladd et al., 2005; Xu et al., 2005; Houser and Molkentin, 2008). Here, I will 133  discuss my suggestions on the potential involvement of a number of transcription and splicing regulators in controlling the preferential expression of a specific Cav3.2 exon 25 splice variant in the developing and diseased heart. One potential candidate is the regulation of expression by the fox family of splicing regulators. These proteins recognize the hexanucleotide TGCATG and bind to the intron adjacent to their target exon where they generally repress splicing when bound upstream of the exon but enhance splicing from a downstream binding site (Underwood et al., 2005; Zhang et al., 2008; Zhou and Lou, 2008; Yeo et al., 2009). Upon inspection of the rat Cav3.2 genomic sequence (ENSRNOT00000048392 and NC_005109), a fox binding site in Cav3.2 intron located and identified 14 base pairs downstream of exon 25 (Figure 4.1A). Based on the presence and location of a fox binding site in the Cav3.2 genomic sequence, I speculate that fox proteins are good candidates as potential regulators of expression of Cav3.2 exon 25 splice variants.  A differential pattern of fox protein expression exists in the developing mouse heart. In the adult mouse heart, the level of expression of fox-1 was shown to be ~10-fold higher than the newborn heart (Kalsotra et al., 2008). The presence of fox protein recognition site downstream of Cav3.2 exon 25 (Figure 4.1A) and the low level of fox protein expression in neonatal heart likely explain the observed low mRNA expression of Cav3.2(+25). Although a higher level of fox protein expression in the adult rat heart potentially increases the expression of the plus exon 25 variant, our data showed lack of increase in the expression of Cav3.2(+25) splice variant in the adult ventricle. This could be explained by an overall downregulation of Cav3.2 expression in the adult ventricle brought about by an increase in expression of NRSF. Taken together, NRSF/fox protein-mediated regulation of expression of Cav3.2 exon 25 splice variants may occur in developing rat hearts (Figure 4.1C). 134   A different signalling mechanism likely exists in pathological cardiac hypertrophy (Figure 4.1B) due to differential activity and expression of fox proteins and other transcription factors such as the class II histone deacetylase (HDAC) transcription factors. Compared to the newborn heart, fox proteins are prominently expressed in the adult heart. Previous studies have reported the involvement of fox proteins in the pathogenesis of human cardiac hypertrophy and failure (Hannenhalli et al., 2006). Thus, in the diseased adult ventricle, fox proteins may play an important role in cardiac disease progression. Additionally, NRSF and HDACs have also been shown to contribute to cardiac hypertrophy (Nakagawa et al., 2006; Bingham et al., 2007). Both groups demonstrated that NRSF-mediated repression has been shown to form a complex with HDAC (Nakagawa et al., 2006; Bingham et al., 2007) thereby repressing the expression of the cardiac fetal genes including the CACNA1H genes. However, in ET-1-induced ventricular hypertrophy this complex is disrupted due to increase in phosphorylation of HDACs (Bingham et al., 2007). Phosphorylation of HDACs leads to translocation of HDACs from the nucleus to the cytoplasm making them unable to form a complex with NRSF (Nakagawa et al., 2006). Once this binding is disrupted, de-repression of NRSF-mediated repression would allow the expression of fetal cardiac genes such as the CACNA1H genes. Therefore, I suggest that in hypertrophic SHR there exists an increase in fox protein and HDAC activities. This might explain why the Cav3.2(+25) alternative splice variant is preferentially expressed in hypertrophic SHR.   The hypothetical signalling mechanism proposed here (Figure 4.1) provides an opening for future studies on elucidating the signalling pathway involved in the splice-specific changes in expression of Cav3.2 alternative splice variants in normal heart development as well as in pathological cardiac hypertrophy. This would also potentially provide an understanding of the contribution of Cav3.2 T-type channels in normal cardiac physiology and remodelling.  135    Figure 4.1. Hypothetical pathways of the signaling mechanism potentially involved in the regulation of expression of Cav3.2 exon 25 splice variants. (A) Sequence analysis on the genomic sequence of Cav3.2 (ENSRNOT00000048392 and NC_005109) showing the presence of fox protein binding element downstream of Cav3.2 exon 25. (red, intron; black, exon). Fox binding element consensus sequence TGCATG was identified 14 base pairs downstream of exon 25. (B) Potential involvement of HDAC, NRSF and fox proteins in the pathological regulation of expression of Cav3.2. (C) Developmental regulation of expression of Cav3.2 channels (red oval, newborn; brown oval, adult). In this hypothetical model, it is suggested that the expression of Cav3.2 exon 25 splice variants is differentially regulated during normal cardiac development and pathological hypertrophy. The transcriptional repressor NRSF would regulate the expression of Cav3.2. Low level of NRSF would allow the expression of Cav3.2 whereas at high amount would repress Cav3.2 expression. Low level of fox proteins would allow the expression of minus exon 25 variants while keeping plus exon 25 variants at minimal. Conversely, in pathological cardiac hypertrophy, HDAC would de-repress NRSF- mediated repression of Cav3.2 allowing Cav3.2 to be upregulated or re-expressed. Fox proteins activity would increase in cardiac hypertrophy thereby increasing the expression of Cav3.2 exon 25 variants.  136      4.2.2 Potential limitations  Alternative splice variants were examined across the entire ORF of neonatal rat cardiac Cav3.2 T-type channels using a combination of overlapping short amplicon PCR screening and full length cDNA sequence analysis (Chapter 2). Approximately 1000 short amplicon and 106 full length cDNAs were utilized for splice variant screening. Although this thesis used a large sample size in the analysis, there remains the possibility that all potential splice variants were not recovered, particularly the less abundant variants. Regan et al. suggested that at least ~2300 clones are required to detect at least one of the lowest frequency splice variants (Regan et al., 2000). To address this, it would be ideal to utilize a large number of full length cDNA clones. In addition, instead of analyzing individual full length cDNA clone, an alternative option would be to perform high through-put sequencing of full length cDNA amplicon generated from RT-PCR. For 2 g total RNA, it was suggested that ~20,000 to 100,000 full length clones could be generated (Regan et al., 2000).  Although this thesis showed extensive alternative splicing in cardiac Cav3.2 T-type channels, analysis of full length screening in this study was focused on newborn (day 0) hearts. In the future, it would be interesting to perform a full inventory of the splice variant profile of Cav3.2 channel in adult normal and hypertrophic hearts. This would determine whether the utilization of Cav3.2 splice variants or their combinations are altered in pathological hypertrophy. In fact, Tang et al. have reported significant differential Cav1.2 splicing patterns in the hearts of 18 week-old hypertrophic SHR and normotensive WKY rats (Tang et al., 2008). While this thesis did not show full length cDNA screening of Cav3.2 splice variants in normotensive and hypertrophic hearts, this work provided strong evidence of changes in Cav3.2 splicing pattern by demonstrating alteration in the level of expression of the predominant exon 25 splice variants in the newborn, adult and hypertrophic ventricle (Chapter 2). 137   Differential expression of Cav3.2 exon 25 variants during development was demonstrated in this thesis. Two developmental stages were utilized i.e. newborn day 0 and four month old adults. In future studies, it will be interesting to characterize changes in Cav3.2 splicing pattern in other developmental stages; perhaps it would be better to include embryonic, fetal (before birth), and juvenile, in splice variant screening. Likewise, in a disease state, profiles of various stages of cardiac diseases (pre-hypertensive, hypertensive, pre-heart failure and heart failure) would be effective ways to determine potential changes in the expression of Cav3.2 splice variants.  4.3. Voltage-dependent facilitation of Cav3.2 T-type channels     4.3.1 Working hypothesis  As described in Chapter 2, I identified several splice variants of Cav3.2 channels. Thus, I further explored the hypothesis that alternative splice variants of Cav3.2 confer functionally distinct channels. I observed that the Cav3.2(-25) splice variant display potentiated recovery from inactivation. Previous reports showed that the recombinant Cav3.3 is the only T-type isoform displaying VDF (Klockner et al., 1999; Gomora et al., 2002). However, in the cardiovascular system VDF of native ICaT has been shown in frog atrial and guinea pig coronary myocytes (Ganitkevich and Isenberg, 1991; Alvarez et al., 1996; Alvarez et al., 2000). Since among the three T-type isoforms the Cav3.1 and Cav3.2 channels are the only two T-type isoforms in the heart (Cribbs et al., 1998; Cribbs et al., 2001; Perez-Reyes, 2003) and I observed that Cav3.2 revealed potentiated recovery from inactivation, I hypothesized that cardiac Cav3.2 T-type channels display VDF.  The results in Chapter 2 showed that full-length cardiac Cav3.2 variants cloned in the minus exon 25 background display VDF and potentiated fractional recovery. The observed 138  magnitude of VDF for Cav3.2 minus exon 25 variant is between 50 and 60% (Figure 2.6). Thus, my data supports our hypothesis that cloned Cav3.2 channels display VDF. Moreover, I also observed significant expression of Cav3.2(-25) in newborn rat ventricular tissues (Figure 2.4). This led me to hypothesize that ICaT in neonatal rat ventricles displays VDF.  In Chapter 3, I worked on the hypothesis that native cardiac ICaT displays VDF and this property is correlated with a high expression of Cav3.2(-25) alternative splice variant. I optimized a protocol design to dissociate NRVM and grow them in culture prior to whole cell patch clamp and qRT-PCR analyses. Indeed, biophysical analysis using prepulse-induced facilitation protocol recorded from NRVM in culture revealed significant VDF of neonatal ventricular ICaT (Figures 3.4A and 3.4C). Importantly, the observed VDF in NRVM ICaT is correlated with predominantly Cav3.2(-25) expression (Figure 3.4D).  VDF of NRVM ICaT was compared with the VDF profiles of recombinant Cav3.1 and Cav3.2 variants. I observed that both NRVM ICaT and Cav3.2(-25) displayed VDF, and lack of facilitation was observed for Cav3.2(+25) and Cav3.1 channels (Figure 3.4C). My observations are consistent with the lack of facilitation in Cav3.1 observed by several investigators (Klockner et al., 1999; Chemin et al., 2001a; Chemin et al., 2002; Gomora et al., 2002; Latour et al., 2004). In addition, preliminary results from our laboratory also showed that homologous exon 25 splice variant of Cav3.1 channels do not display VDF.  However, it remains to be determined whether novel alternative splice variants of cardiac Cav3.1 may display VDF. The fact that I observed VDF of ICaT in NRVM and recombinant Cav3.2(-25) but not in recombinant Cav3.1 affirms my hypothesis that NRVM ICaT display VDF and attributed to the exclusion of exon 25. 139       4.3.2 Potential limitations  This thesis has proven that alternative splicing in Cav3.2 T-type channels confers distinct biophysical properties. This research is the first to demonstrate that the Cav3.2 channels display VDF property, dependent on the inclusion or exclusion of exon 25 in the Cav3.2 channel. Analysis of the Cav3.2 VDF was first undertaken in HEK 293 cells and subsequently determined in dissociated NRVM in culture. In Chapter 2, this work presented compelling evidence of splice-variant specific Cav3.2 VDF in HEK 293 cells. Eleven splice variants were cloned and biophysically characterized. Eight showed measurable Ca 2+  currents. These eight splice variants are in combination with either plus or minus exon 25. This thesis demonstrated that only splice variants with minus exon 25 display VDF but not variants with plus exon 25. Based on significantly high levels of mRNA expression of Cav3.2(-25) in dissociated NRVM (Chapter 3), it is tempting to suggest that the VDF property of NRVM ICaT is contributed to the expression of Cav3.2(-25) splice variant. Although this research demonstrated lack of Cav3.1 VDF, it would be ideal to record purely Cav3.2 ICaT in NRVM. This is important to eliminate the contribution of Cav3.1 channel splice variants potentially displaying VDF. However, unpublished data in our laboratory (Garcia, E.G. personal communication) and reports from other groups (Chemin et al., 2001a; Chemin et al., 2002; Gomora et al., 2002; Latour et al., 2004) showed that Cav3.1 homologous exon 25 splice variants do not display VDF. Hence, it remains to be determined whether unidentified splice variants of Cav3.1 display VDF.  One potential limitation of this research is the analysis of splice-variant specific protein expression of Cav3.2 ± exon 25 variants. This is challenging as there is no available splice- variant specific antibody. It would be better if a target specific antibody could be made. This 140  would allow this research to study the protein expression and localization of specific splice variants not only in the ventricular myocytes but also in other regions of the heart. In Chapter 2, I demonstrated an upregulation of the Cav3.2 channels in hypertrophic SHR.  Although there is a preferential upregulation of Cav3.2(+25) over Cav3.2(-25) in hypertrophic SHR, it would be ideal to investigate whether ICaT from dissociated ventricular myocytes from adult hypertrophic hearts display VDF. The fact that there is also a two-fold increase in Cav3.2(-25) (Figure 2.10C) in hypertrophic SHR makes it a likely candidate to be tested-whether ICaT from diseased ventricular myocytes display VDF.  A further potential limitation relates to the G22-mediated inhibition of Cav3.2(-25) VDF. The last part of Chapter 2 showed that co-transfection with G22 reduces the magnitude of facilitation of Cav3.2(-25). The study did not show whether disrupting the binding of G22 to the Cav3.2(-25) affects its VDF. In the future, it will be interesting to know whether disruption of the G binding sites via site-directed mutagenesis or deletion of the consensus binding sites in the Cav3.2(-25) splice variant have an effect on VDF. In addition, it will be appealing to investigate whether buffering G via co-transfection of rod transducin (GT) reverses G-mediated inhibition of VDF. GT has been reported to buffer G binding (Meza et al., 2007; Rangel et al., 2010). Thus, further studies are needed to explore the effects of G on the facilitation of Cav3.2.  4.4 Conclusion     4.4.1 General conclusions  Overall, this study has shown that cardiac Cav3.2 T-type channels are subjected to considerable splicing with the splice variants in the III – IV linker conferring for the presence or absence of exon 25 demonstrating the most notable molecular and biophysical profile. This work 141  also showed that there is a preferential expression of the Cav3.2(-25) splice variant in the newborn heart with a shift in the adult heart that results in equal levels of expression of both (+) and (-) exon 25 variants. This study also showed that in pathological cardiac hypertrophy the expression of Cav3.2 channels was upregulated with a shift towards the expression of Cav3.2(+25) as the predominant form. This thesis therefore concludes that changes in the pattern of expression of Cav3.2 III – IV linker exon 25 splice variants are associated with development and pathological cardiac hypertrophy.  Moreover, this thesis was the first to report VDF of Cav3.2 channels. This work showed that Cav3.2(-25) channel variant display robust VDF whereas lack of VDF was observed in Cav3.2(+25) channel variant. This current study also demonstrated that the VDF of ICaT in neonatal rat ventricular myocytes was correlated with predominant expression of Cav3.2(-25) splice variant. Together, this thesis concludes that Cav3.2 alternative splicing confers splice variant-specific VDF.  In conclusion, this thesis showed that Cav3.2 alternative splicing generates significant T- type Ca 2+  channel molecular and functional diversity with potential implications for cardiac development, physiology and pathophysiology.      4.4.2 Potential relevance of Cav3.2 alternative splicing in cardiac development and hypertrophy  The precise contribution of Cav3.2 T-type channels to the normal development and pathological hypertrophy of the mammalian hearts remains unresolved. This thesis showed for the first time that there are changes in splice variant patterns associated with ontogenic development and pathological hypertrophy. In one instance, the changes are associated with the expression of splice variants that mediate VDF. VDF of Cav3.2 channels would likely increase 142  intracellular Ca 2+  thereby potentially contributing to the spontaneous contractility and conduction of APs of the newborn ventricle (Figure 3.5).  In hypertrophic hearts, the predominant splice variant was shifted to Cav3.2(+25) although Cav3.2(-25) was also upregulated. The upregulation of expression of Cav3.2 channels in cardiac hypertrophy could potentially contribute to an electrical remodelling in the hypertrophic ventricle. Importantly, the preferential expression of Cav3.2(+25) could play a big role in cardiac remodelling. A higher level expression of this variant combined with its hyperpolarized activation range and higher current density, could predispose the heart to a proarrhythmogenic condition, contractile dysfunction and eventually heart failure. Interestingly, similar predominant expression of specific alternative splice variants was also observed in the Cav1.2 Ca 2+  channels in patients with atherosclerosis (Tiwari et al., 2006).  Taken together, alternative splicing of Cav3.2 T-type channels could potentially play important roles in normal cardiac development and remodelling. The results from this study have proven that there is a differential expression of Cav3.2 alternative splice variants in the diseased heart. This may be important for the development of target specific drugs with the exclusive intention to act on a specific splice variant. This approach is essential for better managing of disease as well as minimizing potentially adverse side effects.      4.4.3 Future directions  An important future direction of this research would be to explore a more extensive developmental profiling of Cav3.2 alternative splice variants. Suggested experiments would include analysis of the splice variant profile in embryonic, fetal (before birth) and juvenile rats. Similar experimental procedures outlined in Chapter 2 would be necessary to determine the splice variant profile present in full length cDNA libraries. In order to increase the chances of 143  recovering rare splice variants, high through-put DNA sequencing is recommended. However, this approach would not give information on splice variant combinations present in the Cav3.2 full length transcripts. Thus, it is suggested that both high through-put DNA sequencing and full length splice variant screening should be undertaken to obtain a more detailed profile of the differential pattern of expression of Cav3.2 alternative splice variants during development.  With regard to pathological cardiac hypertrophy, suggested future experiments should include analysis on pre-hypertensive, hypertensive, pre-heart failure and heart failure disease states. The SHR model should be used in this experiment since this model was proven to have age-specific progression of the disease phenotype (Doggrell and Brown, 1998; Chen-Izu et al., 2007; Tang et al., 2008). As recommended above, high through-put DNA sequencing and full length screening would be interesting to explore differential patterns of alternative splicing in various pathological stages. Relevant to the signalling mechanisms involved in splice variant- specific developmental and pathological regulation of expression in cardiac Cav3.2 channels, an important future research would be to explore this thesis’s proposed hypotheses on variant- specific regulation (Figure 4.1). To investigate this, quantitative RT-PCR analysis of the levels of expression of Cav3.2 (±) exon 25 variants, fox proteins, NRSF and HDAC is necessary in various stages of development and in disease states. In addition, measurement of the activities of the transcriptional regulators, HDAC and fox proteins, and other signalling molecules upstream and downstream of these regulators (Molkentin and Dorn, 2001; Dorn and Force, 2005; Heineke and Molkentin, 2006) would also be helpful to identify the regulation mechanism of cardiac Cav3.2 alternative splice variants.  An important future study will be to perform a biophysical characterization of ICaT in adult hypertrophic SHR and compare with age- and sex matched normotensive WKY rats. Recording ICaT from isolated adult ventricular myocytes would be important to determine the 144  electrophysiological characteristics of ICaT in the hypertrophic heart. It would also be interesting to explore if VDF exists in hypertrophic myocytes as both Cav3.2(-25) and Cav3.2(+25) were found to both upregulated in hypertrophic SHR (Chapter 2). An additional potential future experiment is to explore the contributions of Cav3.2 exon 25 splice variant channels in pacemaker activity and contractility. Reports show that induction of Cav3.2  channels in cultured neonatal cardiomyocytes can lead to increased excitability (Levitsky and Lopez-Barneo, 2009) and accelerated spontaneous contractile activity in myocytes treated with corticosteroids (Lalevee et al., 2005; Maturana et al., 2009). Moreover, it was suggested that T-type channels play a role in E-C coupling in the newborn ventricle (Nuss and Marban, 1994; Wetzel and Klitzner, 1996; Haddock et al., 1999; Escobar et al., 2004; Tohse et al., 2004). Thus, it would be interesting to address whether Cav3.2 exon 25 splice variant channels play similar roles. Potential experiments include measurement of contractility, beating frequency and Ca 2+  transients in Cav3.2 -/-  ventricular myocytes overexpressing exon 25 splice variants.  Relevant to G-protein mediated effects on VDF of Cav3.2 exon 25 variant channels, important future studies are to disrupt the binding site and/or to buffer G binding. These suggested future experiments could include site-directed mutagenesis to eliminate G binding consensus site or co-transfection of rod transducin (GT) which is known to buffer G binding (Meza et al., 2007; Rangel et al., 2010). 145   REFERENCES  Adams PJ, Garcia E, David LS, Mulatz KJ, Spacey SD, Snutch TP (2009) Cav2.1 P/Q-type calcium channel alternative splicing affects the functional impact of familial hemiplegic migraine mutations: implications for calcium channelopathies. Channels (Austin) 3:110- 121. Adolph EF (1971) Ontogeny of heart-rate controls in hamster, rat, and guinea pig. Am J Physiol 220:1896-1902. Akaike N, Kostyuk PG, Osipchuk YV (1989) Dihydropyridine-sensitive low-threshold calcium channels in isolated rat hypothalamic neurones. J Physiol 412:181-195. Alvarez JL, Vassort G (1992) Properties of the low threshold Ca current in single frog atrial cardiomyocytes. A comparison with the high threshold Ca current. J Gen Physiol 100:519-545. Alvarez JL, Rubio LS, Vassort G (1996) Facilitation of T-type calcium current in bullfrog atrial cells: voltage-dependent relief of a G protein inhibitory tone. J Physiol 491 ( Pt 2):321- 334. Alvarez JL, Artiles A, Talavera K, Vassort G (2000) Modulation of voltage-dependent facilitation of the T-type Ca 2+  current by sodium ion in isolated frog atrial cells. Pflugers Arch 441:39-48. Andreasen D, Jensen BL, Hansen PB, Kwon TH, Nielsen S, Skott O (2000) The alpha(1G)- subunit of a voltage-dependent Ca 2+  channel is localized in rat distal nephron and collecting duct. Am J Physiol Renal Physiol 279:F997-1005. Arnoult C, Lemos JR, Florman HM (1997) Voltage-dependent modulation of T-type calcium channels by protein tyrosine phosphorylation. Embo J 16:1593-1599. Artalejo CR, Rossie S, Perlman RL, Fox AP (1992) Voltage-dependent phosphorylation may recruit Ca 2+  current facilitation in chromaffin cells. Nature 358:63-66. Artman M, Henry G, Coetzee WA (2000) Cellular basis for age-related differences in cardiac excitation-contraction coupling. Prog Pediatr Cardiol 11:185-194. Ashcroft FM, Kelly RP, Smith PA (1990) Two types of Ca channel in rat pancreatic beta-cells. Pflugers Arch 415:504-506. Balke CW, Rose WC, Marban E, Wier WG (1992) Macroscopic and unitary properties of physiological ion flux through T-type Ca2+ channels in guinea-pig heart cells. J Physiol 456:247-265. Bartels P, Behnke K, Michels G, Groner F, Schneider T, Henry M, Barrett PQ, Kang HW, Lee JH, Wiesen MH, Matthes J, Herzig S (2009) Structural and biophysical determinants of single Cav3.1 and Cav3.2 T-type calcium channel inhibition by N2O. Cell Calcium 46:293-302. Baumann L, Gerstner A, Zong X, Biel M, Wahl-Schott C (2004) Functional characterization of the L-type Ca 2+  channel Cav1.4alpha1 from mouse retina. Invest Ophthalmol Vis Sci 45:708-713. Beam KG, Knudson CM (1988) Effect of postnatal development on calcium currents and slow charge movement in mammalian skeletal muscle. J Gen Physiol 91:799-815. Bean BP (1985) Two kinds of calcium channels in canine atrial cells. Differences in kinetics, selectivity, and pharmacology. J Gen Physiol 86:1-30. Bean BP (1989a) Classes of calcium channels in vertebrate cells. Annu Rev Physiol 51:367-384. 146  Bean BP (1989b) Neurotransmitter inhibition of neuronal calcium currents by changes in channel voltage dependence. Nature 340:153-156. Beedle AM, Hamid J, Zamponi GW (2002) Inhibition of transiently expressed low- and high- voltage-activated calcium channels by trivalent metal cations. J Membr Biol 187:225- 238. Bell TJ, Thaler C, Castiglioni AJ, Helton TD, Lipscombe D (2004) Cell-specific alternative splicing increases calcium channel current density in the pain pathway. Neuron 41:127- 138. Benham CD, Tsien RW (1988) Noradrenaline modulation of calcium channels in single smooth muscle cells from rabbit ear artery. J Physiol 404:767-784. BenMohamed F, Ferron L, Ruchon Y, Gouadon E, Renaud JF, Capuano V (2009) Regulation of T-type Cav3.1 channels expression by synthetic glucocorticoid dexamethasone in neonatal cardiac myocytes. Mol Cell Biochem 320:173-183. Bers DM (2001) Excitation-contraction coupling and cardiac contractile force, 2nd Edition. Dordrecht, The Netherlands: Kluwer Academic Publishers. Bers DM (2002) Cardiac excitation-contraction coupling. Nature 415:198-205. Bers DM, Perez-Reyes E (1999) Ca channels in cardiac myocytes: structure and function in Ca influx and intracellular Ca release. Cardiovasc Res 42:339-360. Berthier C, Monteil A, Lory P, Strube C (2002) Alpha(1H) mRNA in single skeletal muscle fibres accounts for T-type calcium current transient expression during fetal development in mice. J Physiol 539:681-691. Bingham AJ, Ooi L, Kozera L, White E, Wood IC (2007) The repressor element 1-silencing transcription factor regulates heart-specific gene expression using multiple chromatin- modifying complexes. Mol Cell Biol 27:4082-40892. Bkaily G, Sculptoreanu A, Jacques D, Jasmin G (1997) Increases of T-type Ca 2+  current in heart cells of the cardiomyopathic hamster. Mol Cell Biochem 176:199-204. Black DL (2003) Mechanisms of alternative pre-messenger RNA splicing. Annu Rev Biochem 72:291-336. Blaich A, Welling A, Fischer S, Wegener JW, Kostner K, Hofmann F, Moosmang S (2010) Facilitation of murine cardiac L-type Cav1.2 channel is modulated by calmodulin kinase II-dependent phosphorylation of S1512 and S1570. Proc Natl Acad Sci U S A 107:10285-10289. Blencowe BJ (2006) Alternative splicing: new insights from global analyses. Cell 126:37-47. Bohn G, Moosmang S, Conrad H, Ludwig A, Hofmann F, Klugbauer N (2000) Expression of T- and L-type calcium channel mRNA in murine sinoatrial node. FEBS Lett 481:73-76. Bonvallet R, Rougier O (1989) Existence of two calcium currents recorded at normal calcium concentrations in single frog atrial cells. Cell Calcium 10:499-508. Bourinet E, Soong TW, Stea A, Snutch TP (1996) Determinants of the G protein-dependent opioid modulation of neuronal calcium channels. Proc Natl Acad Sci U S A 93:1486- 1491. Bourinet E, Charnet P, Tomlinson WJ, Stea A, Snutch TP, Nargeot J (1994) Voltage-dependent facilitation of a neuronal alpha 1C L-type calcium channel. Embo J 13:5032-5039. Boyett MR, Honjo H, Kodama I (2000) The sinoatrial node, a heterogeneous pacemaker structure. Cardiovasc Res 47:658-687. Breustedt J, Vogt KE, Miller RJ, Nicoll RA, Schmitz D (2003) Alpha1E-containing Ca2+ channels are involved in synaptic plasticity. Proc Natl Acad Sci U S A 100:12450-12455. Brody DL, Yue DT (2000) Relief of G-protein inhibition of calcium channels and short-term synaptic facilitation in cultured hippocampal neurons. J Neurosci 20:889-898. 147  Calin-Jageman I, Yu K, Hall RA, Mei L, Lee A (2007) Erbin enhances voltage-dependent facilitation of Cav1.3 Ca 2+  channels through relief of an autoinhibitory domain in the Ca(v)1.3 alpha1 subunit. J Neurosci 27:1374-1385. Camara AK, Begic Z, Kwok WM, Bosnjak ZJ (2001) Differential modulation of the cardiac L- and T-type calcium channel currents by isoflurane. Anesthesiology 95:515-524. Carbone E, Lux HD (1984) A low voltage-activated, fully inactivating Ca channel in vertebrate sensory neurones. Nature 310:501-502. Castiglioni AJ, Raingo J, Lipscombe D (2006) Alternative splicing in the C-terminus of CaV2.2 controls expression and gating of N-type calcium channels. J Physiol 576:119-134. Catterall WA (2000) Structure and regulation of voltage-gated Ca2+ channels. Annu Rev Cell Dev Biol 16:521-555. Catterall WA, Striessnig J, Snutch TP, Perez-Reyes E (2003) International Union of Pharmacology. XL. Compendium of voltage-gated ion channels: calcium channels. Pharmacol Rev 55:579-581. Cerutti C, Kurdi M, Bricca G, Hodroj W, Paultre C, Randon J, Gustin MP (2006) Transcriptional alterations in the left ventricle of three hypertensive rat models. Physiol Genomics 27:295-308. Chandy KG, Gutman GA (1993) Nomenclature for mammalian potassium channel genes. Trends Pharmacol Sci 14:434. Chang SY, Yong TF, Yu CY, Liang MC, Pletnikova O, Troncoso J, Burgunder JM, Soong TW (2007) Age and gender-dependent alternative splicing of P/Q-type calcium channel EF- hand. Neurosci 145:1026-1036. Chaudhuri D, Chang SY, DeMaria CD, Alvania RS, Soong TW, Yue DT (2004) Alternative splicing as a molecular switch for Ca2+/calmodulin-dependent facilitation of P/Q-type Ca 2+  channels. J Neurosci 24:6334-6342. Chemin J, Traboulsie A, Lory P (2006) Molecular pathways underlying the modulation of T-type calcium channels by neurotransmitters and hormones. Cell Calcium 40:121-134. Chemin J, Monteil A, Bourinet E, Nargeot J, Lory P (2001a) Alternatively spliced alpha(1G) (Cav3.1) intracellular loops promote specific T-type Ca 2+  channel gating properties. Biophys J 80:1238-1250. Chemin J, Monteil A, Dubel S, Nargeot J, Lory P (2001b) The alpha1I T-type calcium channel exhibits faster gating properties when overexpressed in neuroblastoma/glioma NG 108-15 cells. Eur J Neurosci 14:1678-1686. Chemin J, Monteil A, Perez-Reyes E, Bourinet E, Nargeot J, Lory P (2002) Specific contribution of human T-type calcium channel isotypes (alpha(1G), alpha(1H) and alpha(1I)) to neuronal excitability. J Physiol 540:3-14. Chemin J, Monteil A, Briquaire C, Richard S, Perez-Reyes E, Nargeot J, Lory P (2000) Overexpression of T-type calcium channels in HEK-293 cells increases intracellular calcium without affecting cellular proliferation. FEBS Lett 478:166-172. Chemin J, Mezghrani A, Bidaud I, Dupasquier S, Marger F, Barrere C, Nargeot J, Lory P (2007) Temperature-dependent modulation of CaV3 T-type calcium channels by protein kinases C and A in mammalian cells. J Biol Chem 282:32710-32718. Chen-Izu Y, Chen L, Banyasz T, McCulle SL, Norton B, Scharf SM, Agarwal A, Patwardhan A, Izu LT, Balke CW (2007) Hypertension-induced remodeling of cardiac excitation- contraction coupling in ventricular myocytes occurs prior to hypertrophy development. Am J Physiol Heart Circ Physiol 293:H3301-H3310. Chen CC, Lamping KG, Nuno DW, Barresi R, Prouty SJ, Lavoie JL, Cribbs LL, England SK, Sigmund CD, Weiss RM, Williamson RA, Hill JA, Campbell KP (2003) Abnormal 148  coronary function in mice deficient in alpha1H T-type Ca 2+  channels. Science 302:1416- 1418. Chen X, Nakayama H, Zhang X, Ai X, Harris DM, Tang M, Zhang H, Szeto C, Stockbower K, Berretta RM, Eckhart AD, Koch WJ, Molkentin JD, Houser SR (2011) Calcium influx through Cav1.2 is a proximal signal for pathological cardiomyocyte hypertrophy. J Mol Cell Cardiol 50:460-470. Chen XL, Bayliss DA, Fern RJ, Barrett PQ (1999) A role for T-type Ca 2+  channels in the synergistic control of aldosterone production by ANG II and K+. Am J Physiol 276:F674-F683. Chiang CS, Huang CH, Chieng H, Chang YT, Chang D, Chen JJ, Chen YC, Chen YH, Shin HS, Campbell KP, Chen CC (2009) The Cav3.2 T-type Ca 2+  channel is required for pressure overload-induced cardiac hypertrophy in mice. Circ Res 104:522-530. Chuang RS, Jaffe H, Cribbs L, Perez-Reyes E, Swartz KJ (1998) Inhibition of T-type voltage- gated calcium channels by a new scorpion toxin. Nat Neurosci 1:668-674. Cohen NM, Lederer WJ (1988) Changes in the calcium current of rat heart ventricular myocytes during development. J Physiol 406:115-146. Colecraft HM, Patil PG, Yue DT (2000) Differential occurrence of reluctant openings in G- protein-inhibited N- and P/Q-type calcium channels. J Gen Physiol 115:175-192. Coulter DA, Huguenard JR, Prince DA (1990) Differential effects of petit mal anticonvulsants and convulsants on thalamic neurones: calcium current reduction. Br J Pharmacol 100:800-806. Cribbs L (2010) T-type calcium channel expression and function in the diseased heart. Channels (Austin) 4. Cribbs LL, Martin BL, Schroder EA, Keller BB, Delisle BP, Satin J (2001) Identification of the t-type calcium channel (Cav3.1d) in developing mouse heart. Circ Res 88:403-407. Cribbs LL, Lee JH, Yang J, Satin J, Zhang Y, Daud A, Barclay J, Williamson MP, Fox M, Rees M, Perez-Reyes E (1998) Cloning and characterization of alpha1H from human heart, a member of the T-type Ca 2+  channel gene family. Circ Res 83:103-109. Currie KP, Fox AP (2002) Differential facilitation of N- and P/Q-type calcium channels during trains of action potential-like waveforms. J Physiol 539:419-431. Curtis BM, Catterall WA (1984) Purification of the calcium antagonist receptor of the voltage- sensitive calcium channel from skeletal muscle transverse tubules. Biochemistry 23:2113-2118. David LS, Garcia E, Tyson JR, Thau EM, Cain SM, Snutch TP (2008) Identification and biophysical characterization of rat thalamic Cav3.2 T-type calcium channel alternatively spliced variants. In: Society for Neuroscience Meeting, p 32.33/D46. Washington Convention Center, Washington, D.C., USA. De Waard M, Witcher DR, Pragnell M, Liu H, Campbell KP (1995) Properties of the alpha 1- beta anchoring site in voltage-dependent Ca2+ channels. J Biol Chem 270:12056-12064. De Waard M, Liu H, Walker D, Scott VE, Gurnett CA, Campbell KP (1997) Direct binding of G-protein betagamma complex to voltage-dependent calcium channels. Nature 385:446- 450. Demir SS, Clark JW, Giles WR (1999) Parasympathetic modulation of sinoatrial node pacemaker activity in rabbit heart: a unifying model. Am J Physiol 276:H2221-H2244. DePuy SD, Yao J, Hu C, McIntire W, Bidaud I, Lory P, Rastinejad F, Gonzalez C, Garrison JC, Barrett PQ (2006) The molecular basis for T-type Ca 2+  channel inhibition by G protein beta2gamma2 subunits. Proc Natl Acad Sci U S A 103:14590-14595. 149  Diebold RJ, Koch WJ, Ellinor PT, Wang JJ, Muthuchamy M, Wieczorek DF, Schwartz A (1992) Mutually exclusive exon splicing of the cardiac calcium channel alpha 1 subunit gene generates developmentally regulated isoforms in the rat heart. Proc Natl Acad Sci U S A 89:1497-1501. Dietrich D, Kirschstein T, Kukley M, Pereverzev A, von der Brelie C, Schneider T, Beck H (2003) Functional specialization of presynaptic Cav2.3 Ca2+ channels. Neuron 39:483- 496. Doering CJ, Zamponi GW (2003) Molecular pharmacology of high voltage-activated calcium channels. J Bioenerg Biomembr 35:491-505. Doggrell SA, Brown L (1998) Rat models of hypertension, cardiac hypertrophy and failure. Cardiovasc Res 39:89-105. Dolphin AC, Wyatt CN, Richards J, Beattie RE, Craig P, Lee JH, Cribbs LL, Volsen SG, Perez- Reyes E (1999) The effect of alpha2-delta and other accessory subunits on expression and properties of the calcium channel alpha1G. J Physiol 519 Pt 1:35-45. Dorn GW, 2nd, Force T (2005) Protein kinase cascades in the regulation of cardiac hypertrophy. J Clin Invest 115:527-537. Drolet P, Bilodeau L, Chorvatova A, Laflamme L, Gallo-Payet N, Payet MD (1997) Inhibition of the T-type Ca 2+  current by the dopamine D1 receptor in rat adrenal glomerulosa cells: requirement of the combined action of the G betagamma protein subunit and cyclic adenosine 3',5'-monophosphate. Mol Endocrinol 11:503-514. Droogmans G, Nilius B (1989) Kinetic properties of the cardiac T-type calcium channel in the guinea-pig. J Physiol 419:627-650. Dubel SJ, Altier C, Chaumont S, Lory P, Bourinet E, Nargeot J (2004) Plasma membrane expression of T-type calcium channel alpha(1) subunits is modulated by high voltage- activated auxiliary subunits. J Biol Chem 279:29263-29269. Eder P, Molkentin JD (2011) TRPC channels as effectors of cardiac hypertrophy. Circ Res 108:265-272. Edgerton GB, Blumenthal KM, Hanck DA (2010) Inhibition of the activation pathway of the T- type calcium channel Cav3.1 by ProTxII. Toxicon 56:624-636. Efimov IR, Nikolski VP, Rothenberg F, Greener ID, Li J, Dobrzynski H, Boyett M (2004) Structure-function relationship in the AV junction. Anat Rec A Discov Mol Cell Evol Biol 280:952-965. Elmslie KS, Zhou W, Jones SW (1990) LHRH and GTP-gamma-S modify calcium current activation in bullfrog sympathetic neurons. Neuron 5:75-80. Emerick MC, Stein R, Kunze R, McNulty MM, Regan MR, Hanck DA, Agnew WS (2006) Profiling the array of Cav3.1 variants from the human T-type calcium channel gene CACNA1G: alternative structures, developmental expression, and biophysical variations. Proteins 64:320-342. Enyeart JJ, Mlinar B, Enyeart JA (1993) T-type Ca 2+  channels are required for adrenocorticotropin-stimulated cortisol production by bovine adrenal zona fasciculata cells. Mol Endocrinol 7:1031-1040. Enyeart JJ, Biagi BA, Day RN, Sheu SS, Maurer RA (1990a) Blockade of low and high threshold Ca 2+  channels by diphenylbutylpiperidine antipsychotics linked to inhibition of prolactin gene expression. J Biol Chem 265:16373-16379. Enyeart JJ, Dirksen RT, Sharma VK, Williford DJ, Sheu SS (1990b) Antipsychotic pimozide is a potent Ca 2+  channel blocker in heart. Mol Pharmacol 37:752-757. 150  Ertel EA, Campbell KP, Harpold MM, Hofmann F, Mori Y, Perez-Reyes E, Schwartz A, Snutch TP, Tanabe T, Birnbaumer L, Tsien RW, Catterall WA (2000) Nomenclature of voltage- gated calcium channels. Neuron 25:533-535. Escobar AL, Ribeiro-Costa R, Villalba-Galea C, Zoghbi ME, Perez CG, Mejia-Alvarez R (2004) Developmental changes of intracellular Ca 2+  transients in beating rat hearts. Am J Physiol Heart Circ Physiol 286:H971-978. Fedida D, Noble D, Spindler AJ (1988a) Use-dependent reduction and facilitation of Ca 2+  current in guinea-pig myocytes. J Physiol 405:439-460. Fedida D, Noble D, Spindler AJ (1988b) Mechanism of the use dependence of Ca 2+  current in guinea-pig myocytes. J Physiol 405:461-475. Ferron L, Capuano V, Deroubaix E, Coulombe A, Renaud JF (2002) Functional and molecular characterization of a T-type Ca 2+  channel during fetal and postnatal rat heart development. J Mol Cell Cardiol 34:533-546. Ferron L, Capuano V, Ruchon Y, Deroubaix E, Coulombe A, Renaud JF (2003) Angiotensin II signaling pathways mediate expression of cardiac T-type calcium channels. Circ Res 93:1241-1248. Fleckenstein A (1983) History of calcium antagonists. Circ Res 52:I3-16. Fox AP, Nowycky MC, Tsien RW (1987) Kinetic and pharmacological properties distinguishing three types of calcium currents in chick sensory neurones. J Physiol 394:149-172. Furukawa T, Miura R, Honda M, Kamiya N, Mori Y, Takeshita S, Isshiki T, Nukada T (2004) Identification of R(-)-isomer of efonidipine as a selective blocker of T-type Ca 2+  channels. Br J Pharmacol 143:1050-1057. Furukawa T, Ito H, Nitta J, Tsujino M, Adachi S, Hiroe M, Marumo F, Sawanobori T, Hiraoka M (1992) Endothelin-1 enhances calcium entry through T-type calcium channels in cultured neonatal rat ventricular myocytes. Circ Res 71:1242-1253. Ganitkevich V, Isenberg G (1991) Stimulation-induced potentiation of T-type Ca 2+  channel currents in myocytes from guinea-pig coronary artery. J Physiol 443:703-725. Garcia-Blanco MA, Baraniak AP, Lasda EL (2004) Alternative splicing in disease and therapy. Nat Biotechnol 22:535-546. Gaughan JP, Hefner CA, Houser SR (1998) Electrophysiological properties of neonatal rat ventricular myocytes with alpha1-adrenergic-induced hypertrophy. Am J Physiol 275:H577-590. Gidh-Jain M, Huang B, Jain P, Battula V, el-Sherif N (1995) Reemergence of the fetal pattern of L-type calcium channel gene expression in non infarcted myocardium during left ventricular remodeling. Biochem Biophys Res Commun 216:892-897. Gomora JC, Daud AN, Weiergraber M, Perez-Reyes E (2001) Block of cloned human T-type calcium channels by succinimide antiepileptic drugs. Mol Pharmacol 60:1121-1132. Gomora JC, Murbartian J, Arias JM, Lee JH, Perez-Reyes E (2002) Cloning and expression of the human T-type channel Cav3.3: insights into prepulse facilitation. Biophys J 83:229- 241. Gonoi T, Hasegawa S (1988) Post-natal disappearance of transient calcium channels in mouse skeletal muscle: effects of denervation and culture. J Physiol 401:617-637. Grabowski PJ, Black DL (2001) Alternative RNA splicing in the nervous system. Progress in Neurobiology 65:289-308. Grabsch H, Pereverzev A, Weiergraber M, Schramm M, Henry M, Vajna R, Beattie RE, Volsen SG, Klockner U, Hescheler J, Schneider T (1999) Immunohistochemical detection of alpha1E voltage-gated Ca 2+  channel isoforms in cerebellum, INS-1 cells, and neuroendocrine cells of the digestive system. J Histochem Cytochem 47:981-994. 151  Gray AC, Raingo J, Lipscombe D (2007) Neuronal calcium channels: splicing for optimal performance. Cell Calcium 42:409-417. Gustafsson F, Andreasen D, Salomonsson M, Jensen BL, Holstein-Rathlou N (2001) Conducted vasoconstriction in rat mesenteric arterioles: role for dihydropyridine-insensitive Ca 2+  channels. Am J Physiol Heart Circ Physiol 280:H582-H590. Habermann CJ, O'Brien BJ, Wassle H, Protti DA (2003) AII amacrine cells express L-type calcium channels at their output synapses. J Neurosci 23:6904-6913. Haddock PS, Coetzee WA, Cho E, Porter L, Katoh H, Bers DM, Jafri MS, Artman M (1999) Subcellular [Ca 2+ ]i Gradients During Excitation-Contraction Coupling in Newborn Rabbit Ventricular Myocytes. Circ Res 85:415-427. Hagiwara N, Irisawa H, Kameyama M (1988) Contribution of two types of calcium currents to the pacemaker potentials of rabbit sino-atrial node cells. J Physiol 395:233-253. Hannenhalli S, Putt ME, Gilmore JM, Wang J, Parmacek MS, Epstein JA, Morrisey EE, Margulies KB, Cappola TP (2006) Transcriptional genomics associates FOX transcription factors with human heart failure. Circulation 114:1269-1276. Hansen PB, Jensen BL, Andreasen D, Skott O (2001) Differential expression of T- and L-type voltage-dependent calcium channels in renal resistance vessels. Circ Res 89:630-638. Hatano S, Yamashita T, Sekiguchi A, Iwasaki Y, Nakazawa K, Sagara K, Iinuma H, Aizawa T, Fu LT (2006) Molecular and electrophysiological differences in the L-type Ca 2+  channel of the atrium and ventricle of rat hearts. Circ J 70:610-614. Heineke J, Molkentin JD (2006) Regulation of cardiac hypertrophy by intracellular signalling pathways. Nat Rev Mol Cell Biol 7:589-600. Hell JW, Westenbroek RE, Warner C, Ahlijanian MK, Prystay W, Gilbert MM, Snutch TP, Catterall WA (1993) Identification and differential subcellular localization of the neuronal class C and class D L-type calcium channel alpha 1 subunits. J Cell Biol 123:949-962. Herlitze S, Hockerman GH, Scheuer T, Catterall WA (1997) Molecular determinants of inactivation and G protein modulation in the intracellular loop connecting domains I and II of the calcium channel alpha1A subunit. Proc Natl Acad Sci U S A 94:1512-1516. Herlitze S, Garcia DE, Mackie K, Hille B, Scheuer T, Catterall WA (1996) Modulation of Ca 2+  channels by G-protein beta gamma subunits. Nature 380:258-262. Heron SE, Phillips HA, Mulley JC, Mazarib A, Neufeld MY, Berkovic SF, Scheffer IE (2004) Genetic variation of CACNA1H in idiopathic generalized epilepsy. Ann Neurol 55:595- 596. Hildebrand ME, David LS, Hamid J, Mulatz K, Garcia E, Zamponi GW, Snutch TP (2007) Selective inhibition of Cav3.3 T-type calcium channels by Galphaq/11-coupled muscarinic acetylcholine receptors. J Biol Chem 282:21043-21055. Hille B (2001) Ion Channels of Excitable Membranes, 3rd Edition. Sunderland, MA, U.S.A.: Sinauer Associates, Inc. Hirano Y, Fozzard HA, January CT (1989) Characteristics of L- and T-type Ca 2+  currents in canine cardiac Purkinje cells. Am J Physiol 256:H1478-1492. Hirst GD, Silverberg GD, van Helden DF (1986) The action potential and underlying ionic currents in proximal rat middle cerebral arterioles. J Physiol 371:289-304. Hockerman GH, Peterson BZ, Johnson BD, Catterall WA (1997) Molecular determinants of drug binding and action on L-type calcium channels. Annu Rev Pharmacol Toxicol 37:361- 396. Hosey MM, Barhanin J, Schmid A, Vandaele S, Ptasienski J, O'Callahan C, Cooper C, Lazdunski M (1987) Photoaffinity labelling and phosphorylation of a 165 kilodalton 152  peptide associated with dihydropyridine and phenylalkylamine-sensitive calcium channels. Biochem Biophys Res Commun 147:1137-1145. Houser SR, Molkentin JD (2008) Does contractile Ca2+ control calcineurin-NFAT signaling and pathological hypertrophy in cardiac myocytes? Sci Signal 1:pe31. Hu C, Depuy SD, Yao J, McIntire WE, Barrett PQ (2009) Protein kinase A activity controls the regulation of T-type CaV3.2 channels by Gbetagamma dimers. J Biol Chem 284:7465- 7473. Huang B, Qin D, Deng L, Boutjdir M, N E-S (2000) Reexpression of T-type Ca 2+  channel gene and current in post-infarction remodeled rat left ventricle. Cardiovasc Res 46:442-449. Huguenard JR (1996) Low-threshold calcium currents in central nervous system neurons. Annu Rev Physiol 58:329-348. Huguenard JR (1999) Neuronal circuitry of thalamocortical epilepsy and mechanisms of antiabsence drug action. Adv Neurol 79:991-999. Huser J, Blatter LA, Lipsius SL (2000) Intracellular Ca 2+  release contributes to automaticity in cat atrial pacemaker cells. J Physiol 524 Pt 2:415-422. Iftinca M, Hamid J, Chen L, Varela D, Tadayonnejad R, Altier C, Turner RW, Zamponi GW (2007) Regulation of T-type calcium channels by Rho-associated kinase. Nat Neurosci 10:854-860. Iftinca MC, Zamponi GW (2009) Regulation of neuronal T-type calcium channels. Trends Pharmacol Sci 30:32-40. Ihara Y, Yamada Y, Fujii Y, Gonoi T, Yano H, Yasuda K, Inagaki N, Seino Y, Seino S (1995) Molecular diversity and functional characterization of voltage-dependent calcium channels (CACN4) expressed in pancreatic beta-cells. Mol Endocrinol 9:121-130. Ikeda SR (1991) Double-pulse calcium channel current facilitation in adult rat sympathetic neurones. J Physiol 439:181-214. Ikeda SR (1996) Voltage-dependent modulation of N-type calcium channels by G-protein beta gamma subunits. Nature 380:255-258. Izumi T, Kihara Y, Sarai N, Yoneda T, Iwanaga Y, Inagaki K, Onozawa Y, Takenaka H, Kita T, Noma A (2003) Reinduction of T-type calcium channels by endothelin-1 in failing hearts in vivo and in adult rat ventricular myocytes in vitro. Circulation 108:2530-2535. Jagannathan S, Punt EL, Gu Y, Arnoult C, Sakkas D, Barratt CL, Publicover SJ (2002) Identification and localization of T-type voltage-operated calcium channel subunits in human male germ cells. Expression of multiple isoforms. J Biol Chem 277:8449-8456. Jaggar JH, Wellman GC, Heppner TJ, Porter VA, Perez GJ, Gollasch M, Kleppisch T, Rubart M, Stevenson AS, Lederer WJ, Knot HJ, Bonev AD, Nelson MT (1998) Ca 2+  channels, ryanodine receptors and Ca 2+ -activated K+ channels: a functional unit for regulating arterial tone. Acta Physiol Scand 164:577-587. Jaleel N, Nakayama H, Chen X, Kubo H, MacDonnell S, Zhang H, Berretta R, Robbins J, Cribbs L, Molkentin JD, Houser SR (2008) Ca2+ Influx Through T- and L-Type Ca 2+  Channels Have Different Effects on Myocyte Contractility and Induce Unique Cardiac Phenotypes. Circ Res 103:1109-1119. January CT, Riddle JM (1989) Early afterdepolarizations: mechanism of induction and block. A role for L-type Ca 2+  current. Circ Res 64:977-990. Jay SD, Ellis SB, McCue AF, Williams ME, Vedvick TS, Harpold MM, Campbell KP (1990) Primary structure of the gamma subunit of the DHP-sensitive calcium channel from skeletal muscle. Science 248:490-492. 153  Jimenez C, Bourinet E, Leuranguer V, Richard S, Snutch TP, Nargeot J (2000) Determinants of voltage-dependent inactivation affect Mibefradil block of calcium channels. Neuropharmacology 39:1-10. Jing X, Li DQ, Olofsson CS, Salehi A, Surve VV, Caballero J, Ivarsson R, Lundquist I, Pereverzev A, Schneider T, Rorsman P, Renstrom E (2005) Cav2.3 calcium channels control second-phase insulin release. J Clin Invest 115:146-154. Joksovic PM, Nelson MT, Jevtovic-Todorovic V, Patel MK, Perez-Reyes E, Campbell KP, Chen CC, Todorovic SM (2006) CaV3.2 is the major molecular substrate for redox regulation of T-type Ca 2+  channels in the rat and mouse thalamus. J Physiol 574:415-430. Kaku T, Lee TS, Arita M, Hadama T, Ono K (2003) The gating and conductance properties of Cav3.2 low-voltage-activated T-type calcium channels. Jpn J Physiol 53:165-172. Kalsotra A, Xiao X, Ward AJ, Castle JC, Johnson JM, Burge CB, Cooper TA (2008) A postnatal switch of CELF and MBNL proteins reprograms alternative splicing in the developing heart. Proc Natl Acad Sci U S A 105:20333-20338. Kamp TJ, Hu H, Marban E (2000) Voltage-dependent facilitation of cardiac L-type Ca 2+  channels expressed in HEK-293 cells requires beta-subunit. Am J Physiol Heart Circ Physiol 278:H126-136. Kang HW, Vitko I, Lee SS, Perez-Reyes E, Lee JH (2010) Structural determinants of the high affinity extracellular zinc binding site on Cav3.2 T-type calcium channels. J Biol Chem 285:3271-3281. Kang HW, Park JY, Jeong SW, Kim JA, Moon HJ, Perez-Reyes E, Lee JH (2006) A molecular determinant of nickel inhibition in Cav3.2 T-type calcium channels. J Biol Chem 281:4823-4830. Kang M, Chung KY, Walker JW (2007) G-protein coupled receptor signaling in myocardium: not for the faint of heart. Physiology (Bethesda) 22:174-184. Kasai H, Aosaki T (1989) Modulation of Ca-channel current by an adenosine analog mediated by a GTP-binding protein in chick sensory neurons. Pflugers Arch 414:145-149. Kim D, Song I, Keum S, Lee T, Jeong MJ, Kim SS, McEnery MW, Shin HS (2001) Lack of the burst firing of thalamocortical relay neurons and resistance to absence seizures in mice lacking alpha(1G) T-type Ca 2+  channels. Neuron 31:35-45. Kim JA, Park JY, Kang HW, Huh SU, Jeong SW, Lee JH (2006) Augmentation of Cav3.2 T-type calcium channel activity by cAMP-dependent protein kinase A. J Pharmacol Exp Ther 318:230-237. Kim MS, Morii T, Sun LX, Imoto K, Mori Y (1993) Structural determinants of ion selectivity in brain calcium channel. FEBS Lett 318:145-148. Kitchens SA, Burch J, Creazzo TL (2003) T-type Ca2+ current contribution to Ca 2+ -induced Ca2+ release in developing myocardium. J Mol Cell Cardiol 35:515-523. Kito M, Maehara M, Watanabe K (1996) Mechanisms of T-type calcium channel blockade by zonisamide. Seizure 5:115-119. Klockner U, Lee JH, Cribbs LL, Daud A, Hescheler J, Pereverzev A, Perez-Reyes E, Schneider T (1999) Comparison of the Ca 2+  currents induced by expression of three cloned alpha1 subunits, alpha1G, alpha1H and alpha1I, of low-voltage-activated T-type Ca 2+  channels. Eur J Neurosci 11:4171-4178. Klugbauer N, Lacinova L, Marais E, Hobom M, Hofmann F (1999) Molecular diversity of the calcium channel alpha2delta subunit. J Neurosci 19:684-691. Koh SD, Monaghan K, Ro S, Mason HS, Kenyon JL, Sanders KM (2001) Novel voltage- dependent non-selective cation conductance in murine colonic myocytes. J Physiol 533:341-355. 154  Kollmar R, Montgomery LG, Fak J, Henry LJ, Hudspeth AJ (1997) Predominance of the alpha1D subunit in L-type voltage-gated Ca2+ channels of hair cells in the chicken's cochlea. Proc Natl Acad Sci U S A 94:14883-14888. Kong SW, Hu YW, Ho JW, Ikeda S, Polster S, John R, Hall JL, Bisping E, Pieske B, dos Remedios CG, Pu WT (2010) Heart failure-associated changes in RNA splicing of sarcomere genes. Circ Cardiovasc Genet 3:138-146. Koschak A, Reimer D, Walter D, Hoda JC, Heinzle T, Grabner M, Striessnig J (2003) Cav1.4alpha1 subunits can form slowly inactivating dihydropyridine-sensitive L-type Ca2+ channels lacking Ca 2+ -dependent inactivation. J Neurosci 23:6041-6049. Kostyuk PG, Molokanova EA, Pronchuk NF, Savchenko AN, Verkhratsky AN (1992) Different action of ethosuximide on low- and high-threshold calcium currents in rat sensory neurons. Neuroscience 51:755-758. Koyama T, Ono K, Watanabe H, Ohba T, Murakami M, Iino K, Ito H (2009) Molecular and Electrical Remodeling of L- and T-Type Ca 2+  Channels in Rat Right Atrium With Monocrotaline-Induced Pulmonary Hypertension. Circulation Journal 73:256-263. Kozlov AS, McKenna F, Lee JH, Cribbs LL, Perez-Reyes E, Feltz A, Lambert RC (1999) Distinct kinetics of cloned T-type Ca2 + channels lead to differential Ca 2+  entry and frequency-dependence during mock action potentials. Eur J Neurosci 11:4149-4158. Kubota M, Murakoshi T, Saegusa H, Kazuno A, Zong S, Hu Q, Noda T, Tanabe T (2001) Intact LTP and fear memory but impaired spatial memory in mice lacking Cav2.3 (alpha(IE)) channel. Biochem Biophys Res Commun 282:242-248. Kuwahara K, Takano M, Nakao K (2005) Pathophysiological significance of T-type Ca 2+  channels: transcriptional regulation of T-type Ca 2+  channel--regulation of CACNA1H by neuron-restrictive silencer factor. J Pharmacol Sci 99:211-213. Kuwahara K, Saito Y, Ogawa E, Takahashi N, Nakagawa Y, Naruse Y, Harada M, Hamanaka I, Izumi T, Miyamoto Y, Kishimoto I, Kawakami R, Nakanishi M, Mori N, Nakao K (2001) The neuron-restrictive silencer element-neuron-restrictive silencer factor system regulates basal and endothelin 1-inducible atrial natriuretic peptide gene expression in ventricular myocytes. Mol Cell Biol 21:2085-2097. Kuwahara K et al. (2003) NRSF regulates the fetal cardiac gene program and maintains normal cardiac structure and function. Embo J 22:6310-6321. Lacinova L (2005) Voltage-dependent calcium channels. Gen Physiol Biophys 24 Suppl 1:1-78. Ladd AN, Stenberg MG, Swanson MS, Cooper TA (2005) Dynamic balance between activation and repression regulates pre-mRNA alternative splicing during heart development. Dev Dyn 233:783-793. Lalevee N, Rebsamen MC, Barrere-Lemaire S, Perrier E, Nargeot J, Benitah JP, Rossier MF (2005) Aldosterone increases T-type calcium channel expression and in vitro beating frequency in neonatal rat cardiomyocytes. Cardiovasc Res 67:216-224. Larsen JK, Mitchell JW, Best PM (2002) Quantitative analysis of the expression and distribution of calcium channel alpha 1 subunit mRNA in the atria and ventricles of the rat heart. J Mol Cell Cardiol 34:519-532. Larsen JK, Chen CC, Best PM (2005) Disruption of growth hormone secretion alters Ca 2+  current density and expression of Ca2+ channel and insulin-like growth factor genes in rat atria. Am J Physiol Heart Circ Physiol 288:H829-H838. Latour I, Louw DF, Beedle AM, Hamid J, Sutherland GR, Zamponi GW (2004) Expression of T- type calcium channel splice variants in human glioma. Glia 48:112-119. 155  Lee HK, Elmslie KS (2000) Reluctant gating of single N-type calcium channels during neurotransmitter-induced inhibition in bullfrog sympathetic neurons. J Neurosci 20:3115- 3128. Lee JH, Gomora JC, Cribbs LL, Perez-Reyes E (1999a) Nickel block of three cloned T-type calcium channels: low concentrations selectively block alpha1H. Biophys J 77:3034- 3042. Lee JH, Daud AN, Cribbs LL, Lacerda AE, Pereverzev A, Klockner U, Schneider T, Perez- Reyes E (1999b) Cloning and expression of a novel member of the low voltage-activated T-type calcium channel family. J Neurosci 19:1912-1921. Lee JH, Kim EG, Park BG, Kim KH, Cha SK, Kong ID, Lee JW, Jeong SW (2002) Identification of T-type alpha1H Ca2+ channels (Cav3.2) in major pelvic ganglion neurons. J Neurophysiol 87:2844-2850. Lee KS (1987) Potentiation of the calcium-channel currents of internally perfused mammalian heart cells by repetitive depolarization. Proc Natl Acad Sci U S A 84:3941-3945. Lejeune F, Maquat LE (2005) Mechanistic links between nonsense-mediated mRNA decay and pre-mRNA splicing in mammalian cells. Curr Opin Cell Biol 17:309-315. Leung AT, Imagawa T, Campbell KP (1987) Structural characterization of the 1,4- dihydropyridine receptor of the voltage-dependent Ca 2+  channel from rabbit skeletal muscle. Evidence for two distinct high molecular weight subunits. J Biol Chem 262:7943-7946. Leuranguer V, Monteil A, Bourinet E, Dayanithi G, Nargeot J (2000) T-type calcium currents in rat cardiomyocytes during postnatal development: contribution to hormone secretion. Am J Physiol Heart Circ Physiol 279:H2540-2548. Levitsky KL, Lopez-Barneo J (2009) Developmental change of T-type Ca 2+  channel expression and its role in rat chromaffin cell responsiveness to acute hypoxia. J Physiol 587:1917- 1929. Liao P, Zhang H, Soong T (2009a) Alternative splicing of voltage-gated calcium channels: from molecular biology to disease. Pflügers Archiv European Journal of Physiology 458:481- 487. Liao P, Yong TF, Liang MC, Yue DT, Soong TW (2005) Splicing for alternative structures of Cav1.2 Ca 2+  channels in cardiac and smooth muscles. Cardiovasc Res 68:197-203. Liao P, Li G, Yu de J, Yong TF, Wang JJ, Wang J, Soong TW (2009b) Molecular alteration of Cav1.2 calcium channel in chronic myocardial infarction. Pflugers Arch 458:701-711. Liao P, Yu D, Lu S, Tang Z, Liang MC, Zeng S, Lin W, Soong TW (2004) Smooth muscle- selective alternatively spliced exon generates functional variation in Cav1.2 calcium channels. J Biol Chem 279:50329-50335. Lipscombe D, Raingo J (2007) Alternative splicing matters: N-type calcium channels in nociceptors. Channels (Austin) 1:225-227. Lipscombe D, Kongsamut S, Tsien RW (1989) Alpha-adrenergic inhibition of sympathetic neurotransmitter release mediated by modulation of N-type calcium-channel gating. Nature 340:639-642. Lipscombe D, Pan JQ, Gray AC (2002) Functional diversity in neuronal voltage-gated calcium channels by alternative splicing of Ca(v)alpha1. Mol Neurobiol 26:21-44. Liu G, Hilliard N, Hockerman GH (2004) Cav1.3 is preferentially coupled to glucose-induced [Ca 2+ ]i oscillations in the pancreatic beta cell line INS-1. Mol Pharmacol 65:1269-1277. Logothetis DE, Kurachi Y, Galper J, Neer EJ, Clapham DE (1987) The beta gamma subunits of GTP-binding proteins activate the muscarinic K +  channel in heart. Nature 325:321-326. 156  Lopez AJ (1998) Alternative splicing of pre-mRNA: developmental consequences and mechanisms of regulation. Annu Rev Genet 32:279-305. Lory P, Ophoff RA, Nahmias J (1997) Towards a unified nomenclature describing voltage-gated calcium channel genes. Hum Genet 100:149-150. Lory P, Bidaud I, Chemin J (2006) T-type calcium channels in differentiation and proliferation. Cell Calcium 40:135-146. Lu HK, Fern RJ, Nee JJ, Barrett PQ (1994) Ca(2+)-dependent activation of T-type Ca 2+  channels by calmodulin-dependent protein kinase II. Am J Physiol 267:F183-189. Lu ZJ, Pereverzev A, Liu HL, Weiergraber M, Henry M, Krieger A, Smyth N, Hescheler J, Schneider T (2004) Arrhythmia in isolated prenatal hearts after ablation of the Cav2.3 (alpha1E) subunit of voltage-gated Ca2+ channels. Cell Physiol Biochem 14:11-22. Madle A, Linhartova K, Koza J (2001) Effects of the T-type calcium channel blockade with oral mibefradil on the electrophysiologic properties of the human heart. Med Sci Monit 7:74- 77. Mangoni ME, Nargeot J (2008) Genesis and regulation of the heart automaticity. Physiol Rev 88:919-982. Mangoni ME, Couette B, Marger L, Bourinet E, Striessnig J, Nargeot J (2006a) Voltage- dependent calcium channels and cardiac pacemaker activity: from ionic currents to genes. Prog Biophys Mol Biol 90:38-63. Mangoni ME, Couette B, Bourinet E, Platzer J, Reimer D, Striessnig J, Nargeot J (2003) Functional role of L-type Cav1.3 Ca 2+  channels in cardiac pacemaker activity. Proc Natl Acad Sci U S A 100:5543-5548. Mangoni ME, Traboulsie A, Leoni AL, Couette B, Marger L, Le Quang K, Kupfer E, Cohen- Solal A, Vilar J, Shin HS, Escande D, Charpentier F, Nargeot J, Lory P (2006b) Bradycardia and slowing of the atrioventricular conduction in mice lacking Cav3.1/alpha1G T-type calcium channels. Circ Res 98:1422-1430. Maniatis T, Tasic B (2002) Alternative pre-mRNA splicing and proteome expansion in metazoans. Nature 418:236-243. Marionneau C, Couette B, Liu J, Li H, Mangoni ME, Nargeot J, Lei M, Escande D, Demolombe S (2005) Specific pattern of ionic channel gene expression associated with pacemaker activity in the mouse heart. J Physiol 562:223-234. Marni F, Wang Y, Morishima M, Shimaoka T, Uchino T, Zheng M, Kaku T, Ono K (2009) 17 beta-estradiol modulates expression of low-voltage-activated Ca(V)3.2 T-type calcium channel via extracellularly regulated kinase pathway in cardiomyocytes. Endocrinology 150:879-888. Martin RL, Lee JH, Cribbs LL, Perez-Reyes E, Hanck DA (2000) Mibefradil block of cloned T- type calcium channels. J Pharmacol Exp Ther 295:302-308. Martinez ML, Heredia MP, Delgado C (1999) Expression of T-type Ca 2+  channels in ventricular cells from hypertrophied rat hearts. J Mol Cell Cardiol 31:1617-1625. Masumiya H, Tanaka H, Shigenobu K (1997) Effects of Ca2+ channel antagonists on sinus node: prolongation of late phase 4 depolarization by efonidipine. Eur J Pharmacol 335:15-21. Masumiya H, Shijuku T, Tanaka H, Shigenobu K (1998) Inhibition of myocardial L- and T-type Ca 2+  currents by efonidipine: possible mechanism for its chronotropic effect. Eur J Pharmacol 349:351-357. Maturana A, Lenglet S, Python M, Kuroda SI, Rossier MF (2009) Role of the T-Type Calcium Channel Cav3.2 in the Chronotropic Action of Corticosteroids in Isolated Rat Ventricular Myocytes. Endocrinology 150:3726-3734. 157  McCleskey EW, Fox AP, Feldman DH, Cruz LJ, Olivera BM, Tsien RW, Yoshikami D (1987) Omega-conotoxin: direct and persistent blockade of specific types of calcium channels in neurons but not muscle. Proc Natl Acad Sci U S A 84:4327-4331. McDonald TF, Pelzer S, Trautwein W, Pelzer DJ (1994) Regulation and modulation of calcium channels in cardiac, skeletal, and smooth muscle cells. Physiol Rev 74:365-507. McGivern JG, McDonough SI (2004) Voltage-gated calcium channels as targets for the treatment of chronic pain. Curr Drug Targets CNS Neurol Disord 3:457-478. McRory JE, Santi CM, Hamming KS, Mezeyova J, Sutton KG, Baillie DL, Stea A, Snutch TP (2001) Molecular and functional characterization of a family of rat brain T-type calcium channels. J Biol Chem 276:3999-4011. McRory JE, Hamid J, Doering CJ, Garcia E, Parker R, Hamming K, Chen L, Hildebrand M, Beedle AM, Feldcamp L, Zamponi GW, Snutch TP (2004) The CACNA1F gene encodes an L-type calcium channel with unique biophysical properties and tissue distribution. J Neurosci 24:1707-1718. Meza U, Adams B (1998) G-Protein-dependent facilitation of neuronal alpha1A, alpha1B, and alpha1E Ca channels. J Neurosci 18:5240-5252. Meza U, Thapliyal A, Bannister RA, Adams BA (2007) Neurokinin 1 receptors trigger overlapping stimulation and inhibition of CaV2.3 (R-type) calcium channels. Mol Pharmacol 71:284-293. Mezghrani A, Monteil A, Watschinger K, Sinnegger-Brauns MJ, Barrere C, Bourinet E, Nargeot J, Striessnig J, Lory P (2008) A destructive interaction mechanism accounts for dominant-negative effects of misfolded mutants of voltage-gated calcium channels. J Neurosci 28:4501-4511. Michels G, Er F, Eicks M, Herzig S, Hoppe UC (2006) Long-term and immediate effect of testosterone on single T-type calcium channel in neonatal rat cardiomyocytes. Endocrinology 147:5160-5169. Miljanich GP, Ramachandran J (1995) Antagonists of neuronal calcium channels: structure, function, and therapeutic implications. Annu Rev Pharmacol Toxicol 35:707-734. Miller RJ (1992) Voltage-sensitive Ca 2+  channels. J Biol Chem 267:1403-1406. Mishra SK, Hermsmeyer K (1994) Inhibition of signal Ca2+ in dog coronary arterial vascular muscle cells by Ro 40-5967. J Cardiovasc Pharmacol 24:1-7. Mittman S, Guo J, Agnew WS (1999a) Structure and alternative splicing of the gene encoding alpha1G, a human brain T calcium channel alpha1 subunit. Neurosci Lett 274:143-146. Mittman S, Guo J, Emerick MC, Agnew WS (1999b) Structure and alternative splicing of the gene encoding alpha1I, a human brain T calcium channel alpha1 subunit. Neurosci Lett 269:121-124. Mizuta E, Miake J, Yano S, Furuichi H, Manabe K, Sasaki N, Igawa O, Hoshikawa Y, Shigemasa C, Nanba E, Ninomiya H, Hidaka K, Morisaki T, Tajima F, Hisatome I (2005) Subtype switching of T-type Ca 2+  channels from Cav3.2 to Cav3.1 during differentiation of embryonic stem cells to cardiac cell lineage. Circ J 69:1284-1289. Mlinar B, Biagi BA, Enyeart JJ (1993) Voltage-gated transient currents in bovine adrenal fasciculata cells. I. T-type Ca2+ current. J Gen Physiol 102:217-237. Modrek B, Lee C (2002) A genomic view of alternative splicing. Nat Genet 30:13-19. Molkentin JD, Dorn GW, 2nd (2001) Cytoplasmic signaling pathways that regulate cardiac hypertrophy. Annu Rev Physiol 63:391-426. Monteil A, Chemin J, Bourinet E, Mennessier G, Lory P, Nargeot J (2000a) Molecular and functional properties of the human alpha(1G) subunit that forms T-type calcium channels. J Biol Chem 275:6090-6100. 158  Monteil A, Chemin J, Leuranguer V, Altier C, Mennessier G, Bourinet E, Lory P, Nargeot J (2000b) Specific properties of T-type calcium channels generated by the human alpha 1I subunit. J Biol Chem 275:16530-16535. Moorman AF, Christoffels VM (2003) Cardiac chamber formation: development, genes, and evolution. Physiol Rev 83:1223-1267. Morad M, Cleemann L (1987) Role of Ca 2+  channel in development of tension in heart muscle. J Mol Cell Cardiol 19:527-553. Morgans CW (1999) Calcium channel heterogeneity among cone photoreceptors in the tree shrew retina. Eur J Neurosci 11:2989-2993. Mori Y, Friedrich T, Kim MS, Mikami A, Nakai J, Ruth P, Bosse E, Hofmann F, Flockerzi V, Furuichi T, et al. (1991) Primary structure and functional expression from complementary DNA of a brain calcium channel. Nature 350:398-402. Morishima M, Wang Y, Akiyoshi Y, Miyamoto S, Ono K (2009) Telmisartan, an angiotensin II type 1 receptor antagonist, attenuates T-type Ca 2+  channel expression in neonatal rat cardiomyocytes. Eur J Pharmacol 609:105-112. Murbartian J, Arias JM, Perez-Reyes E (2004) Functional impact of alternative splicing of human T-type Cav3.3 calcium channels. J Neurophysiol 92:3399-3407. Murbartian J, Arias JM, Lee JH, Gomora JC, Perez-Reyes E (2002) Alternative splicing of the rat Cav3.3 T-type calcium channel gene produces variants with distinct functional properties(1). FEBS Lett 528:272-278. Nakagawa Y, Kuwahara K, Harada M, Takahashi N, Yasuno S, Adachi Y, Kawakami R, Nakanishi M, Tanimoto K, Usami S, Kinoshita H, Saito Y, Nakao K (2006) Class II HDACs mediate CaMK-dependent signaling to NRSF in ventricular myocytes. J Mol Cell Cardiol 41:1010-1022. Nakayama H, Bodi I, Correll RN, Chen X, Lorenz J, Houser SR, Robbins J, Schwartz A, Molkentin JD (2009) 1G-dependent T-type Ca2+ current antagonizes cardiac hypertrophy through a NOS3-dependent mechanism in mice. The Journal of Clinical Investigation 119:3787-3796. Nelson MT, Woo J, Kang HW, Vitko I, Barrett PQ, Perez-Reyes E, Lee JH, Shin HS, Todorovic SM (2007a) Reducing agents sensitize C-type nociceptors by relieving high-affinity zinc inhibition of T-type calcium channels. J Neurosci 27:8250-8260. Nelson MT, Joksovic PM, Su P, Kang HW, Van Deusen A, Baumgart JP, David LS, Snutch TP, Barrett PQ, Lee JH, Zorumski CF, Perez-Reyes E, Todorovic SM (2007b) Molecular mechanisms of subtype-specific inhibition of neuronal T-type calcium channels by ascorbate. J Neurosci 27:12577-12583. Newcomb R, Szoke B, Palma A, Wang G, Chen X, Hopkins W, Cong R, Miller J, Urge L, Tarczy-Hornoch K, Loo JA, Dooley DJ, Nadasdi L, Tsien RW, Lemos J, Miljanich G (1998) Selective peptide antagonist of the class E calcium channel from the venom of the tarantula Hysterocrates gigas. Biochemistry 37:15353-15362. Nilius B (1986) Possible functional significance of a novel type of cardiac Ca channel. Biomed Biochim Acta 45:K37-45. Niwa N, Yasui K, Opthof T, Takemura H, Shimizu A, Horiba M, Lee JK, Honjo H, Kamiya K, Kodama I (2004) Cav3.2 subunit underlies the functional T-type Ca 2+  channel in murine hearts during the embryonic period. Am J Physiol Heart Circ Physiol 286:H2257-H2263. Nuss HB, Houser SR (1993) T-type Ca 2+  current is expressed in hypertrophied adult feline left ventricular myocytes. Circ Res 73:777-782. Nuss HB, Marban E (1994) Electrophysiological properties of neonatal mouse cardiac myocytes in primary culture. J Physiol 479 ( Pt 2):265-279. 159  Ohkubo T, Yamazaki J, Kitamura K (2010) Tarantula toxin ProTx-I differentiates between human T-type voltage-gated Ca2+ Channels Cav3.1 and Cav3.2. J Pharmacol Sci 112:452-458. Ohkubo T, Inoue Y, Kawarabayashi T, Kitamura K (2005) Identification and electrophysiological characteristics of isoforms of T-type calcium channel Cav3.2 expressed in pregnant human uterus. Cell Physiol Biochem 16:245-254. Okoshi MP, Yan X, Okoshi K, Nakayama M, Schuldt AJ, O'Connell TD, Simpson PC, Lorell BH (2004) Aldosterone directly stimulates cardiac myocyte hypertrophy. J Card Fail 10:511-518. Ono K, Iijima T (2005) Pathophysiological significance of T-type Ca 2+  channels: properties and functional roles of T-type Ca2+ channels in cardiac pacemaking. J Pharmacol Sci 99:197- 204. Ono K, Iijima T (2010) Cardiac T-type Ca 2+  channels in the heart. J Mol Cell Cardiol 48:65-70. Opler LA, Feinberg SS (1991) The role of pimozide in clinical psychiatry: a review. J Clin Psychiatry 52:221-233. Parsey RV, Matteson DR (1993) Ascorbic acid modulation of calcium channels in pancreatic beta cells. J Gen Physiol 102:503-523. Patil PG, de Leon M, Reed RR, Dubel S, Snutch TP, Yue DT (1996) Elementary events underlying voltage-dependent G-protein inhibition of N-type calcium channels. Biophys J 71:2509-2521. Pereverzev A, Mikhna M, Vajna R, Gissel C, Henry M, Weiergraber M, Hescheler J, Smyth N, Schneider T (2002) Disturbances in glucose-tolerance, insulin-release, and stress-induced hyperglycemia upon disruption of the Ca(v)2.3 (alpha 1E) subunit of voltage-gated Ca(2+) channels. Mol Endocrinol 16:884-895. Perez-Reyes E (2003) Molecular physiology of low-voltage-activated t-type calcium channels. Physiol Rev 83:117-161. Perez-Reyes E (2006) Molecular characterization of T-type calcium channels. Cell Calcium 40:89-96. Perez-Reyes E, Cribbs LL, Daud A, Lacerda AE, Barclay J, Williamson MP, Fox M, Rees M, Lee JH (1998) Molecular characterization of a neuronal low-voltage-activated T-type calcium channel. Nature 391:896-900. Pietrobon D, Hess P (1990) Novel mechanism of voltage-dependent gating in L-type calcium channels. Nature 346:651-655. Pluteanu F, Cribbs LL (2009) T-type calcium channels are regulated by hypoxia/reoxygenation in ventricular myocytes. Am J Physiol Heart Circ Physiol 297:H1304-H1313. Powell KL, Cain SM, Ng C, Sirdesai S, David LS, Kyi M, Garcia E, Tyson JR, Reid CA, Bahlo M, Foote SJ, Snutch TP, O'Brien TJ (2009) A Cav3.2 T-type calcium channel point mutation has splice-variant-specific effects on function and segregates with seizure expression in a polygenic rat model of absence epilepsy. J Neurosci 29:371-380. Pragnell M, De Waard M, Mori Y, Tanabe T, Snutch TP, Campbell KP (1994) Calcium channel beta-subunit binds to a conserved motif in the I-II cytoplasmic linker of the alpha 1- subunit. Nature 368:67-70. Protas L, Robinson RB (2000) Mibefradil, an I(Ca,T) blocker, effectively blocks I(Ca,L) in rabbit sinus node cells. Eur J Pharmacol 401:27-30. Publicover SJ, Preston MR, El Haj AJ (1995) Voltage-dependent potentiation of low-voltage- activated Ca2+ channel currents in cultured rat bone marrow cells. J Physiol 489 ( Pt 3):649-661. 160  Qu Y, Boutjdir M (2001) Gene expression of SERCA2a and L- and T-type Ca channels during human heart development. Pediatr Res 50:569-574. Quignard JF, Frapier JM, Harricane MC, Albat B, Nargeot J, Richard S (1997) Voltage-gated calcium channel currents in human coronary myocytes. Regulation by cyclic GMP and nitric oxide. J Clin Invest 99:185-193. Raingo J, Castiglioni AJ, Lipscombe D (2007) Alternative splicing controls G protein-dependent inhibition of N-type calcium channels in nociceptors. Nat Neurosci 10:285-292. Randall A, Tsien RW (1995) Pharmacological dissection of multiple types of Ca2+ channel currents in rat cerebellar granule neurons. The Journal of Neuroscience 15:2995-3012. Randall AD, Tsien RW (1997) Contrasting biophysical and pharmacological properties of T-type and R-type calcium channels. Neuropharmacology 36:879-893. Rangel A, Sanchez-Armass S, Meza U (2010) Protein kinase C-mediated inhibition of recombinant T-type Cav3.2 channels by neurokinin 1 receptors. Mol Pharmacol 77:202- 210. Regan MR, Emerick MC, Agnew WS (2000) Full-length single-gene cDNA libraries: applications in splice variant analysis. Anal Biochem 286:265-276. Reuter H, Porzig H, Kokubun S, Prod'hom B (1988) Calcium channels in the heart. Properties and modulation by dihydropyridine enantiomers. Ann N Y Acad Sci 522:16-24. Rios E, Brum G (1987) Involvement of dihydropyridine receptors in excitation-contraction coupling in skeletal muscle. Nature 325:717-720. Rosati B, Dun W, Hirose M, Boyden PA, McKinnon D (2007) Molecular basis of the T- and L- type Ca 2+  currents in canine Purkinje fibres. J Physiol 579:465-471. Rossier MF, Python M, Maturana AD (2010) Contribution of mineralocorticoid and glucocorticoid receptors to the chronotropic and hypertrophic actions of aldosterone in neonatal rat ventricular myocytes. Endocrinology 151:2777-2787. Rossier MF, Lenglet S, Vetterli L, Python M, Maturana A (2008) Corticosteroids and redox potential modulate spontaneous contractions in isolated rat ventricular cardiomyocytes. Hypertension 52:721-728. Rossier MF, Lesouhaitier O, Perrier E, Bockhorn L, Chiappe A, Lalevee N (2003) Aldosterone regulation of T-type calcium channels. J Steroid Biochem Mol Biol 85:383-388. Ruth P, Rohrkasten A, Biel M, Bosse E, Regulla S, Meyer HE, Flockerzi V, Hofmann F (1989) Primary structure of the beta subunit of the DHP-sensitive calcium channel from skeletal muscle. Science 245:1115-1118. Saegusa H, Kurihara T, Zong S, Minowa O, Kazuno A, Han W, Matsuda Y, Yamanaka H, Osanai M, Noda T, Tanabe T (2000) Altered pain responses in mice lacking alpha 1E subunit of the voltage-dependent Ca 2+  channel. Proc Natl Acad Sci U S A 97:6132-6137. Sala S, Matteson DR (1990) Single-channel recordings of two types of calcium channels in rat pancreatic beta-cells. Biophys J 58:567-571. Salazar NC, Chen J, Rockman HA (2007) Cardiac GPCRs: GPCR signaling in healthy and failing hearts. Biochim Biophys Acta 1768:1006-1018. Santi CM, Cayabyab FS, Sutton KG, McRory JE, Mezeyova J, Hamming KS, Parker D, Stea A, Snutch TP (2002) Differential inhibition of T-type calcium channels by neuroleptics. J Neurosci 22:396-403. Sato M, Ishikawa Y (2010) Accessory proteins for heterotrimeric G-protein: Implication in the cardiovascular system. Pathophysiology 17:89-99. Schrier AD, Wang H, Talley EM, Perez-Reyes E, Barrett PQ (2001) alpha1H T-type Ca 2+  channel is the predominant subtype expressed in bovine and rat zona glomerulosa. Am J Physiol Cell Physiol 280:C265-272. 161  Schultz Jel J, Glascock BJ, Witt SA, Nieman ML, Nattamai KJ, Liu LH, Lorenz JN, Shull GE, Kimball TR, Periasamy M (2004) Accelerated onset of heart failure in mice during pressure overload with chronically decreased SERCA2 calcium pump activity. Am J Physiol Heart Circ Physiol 286:H1146-H1153. Sculptoreanu A, Scheuer T, Catterall WA (1993a) Voltage-dependent potentiation of L-type Ca 2+  channels due to phosphorylation by cAMP-dependent protein kinase. Nature 364:240- 243. Sculptoreanu A, Figourov A, De Groat WC (1995) Voltage-dependent potentiation of neuronal L-type calcium channels due to state-dependent phosphorylation. Am J Physiol 269:C725-C732. Sculptoreanu A, Rotman E, Takahashi M, Scheuer T, Catterall WA (1993b) Voltage-dependent potentiation of the activity of cardiac L-type calcium channel alpha 1 subunits due to phosphorylation by cAMP-dependent protein kinase. Proc Natl Acad Sci U S A 90:10135-10139. Sen L, Smith TW (1994) T-type Ca 2+  channels are abnormal in genetically determined cardiomyopathic hamster hearts. Circ Res 75:149-155. Serrano JR, Perez-Reyes E, Jones SW (1999) State-dependent inactivation of the alpha1G T-type calcium channel. J Gen Physiol 114:185-201. Shang LL, Pfahnl AE, Sanyal S, Jiao Z, Allen J, Banach K, Fahrenbach J, Weiss D, Taylor WR, Zafari AM, Dudley SC, Jr. (2007) Human heart failure is associated with abnormal C- terminal splicing variants in the cardiac sodium channel. Circ Res 101:1146-1154. Shorofsky SR, January CT (1992) L- and T-type Ca 2+  channels in canine cardiac Purkinje cells. Single-channel demonstration of L-type Ca 2+  window current. Circ Res 70:456-464. Sidach SS, Mintz IM (2002) Kurtoxin, a gating modifier of neuronal high- and low-threshold ca channels. J Neurosci 22:2023-2034. Sipido KR, Carmeliet E, Van de Werf F (1998) T-type Ca 2+  current as a trigger for Ca2+ release from the sarcoplasmic reticulum in guinea-pig ventricular myocytes. J Physiol 508 (Pt 2):439-451. Smith RD, Goldin AL (1996) Phosphorylation of brain sodium channels in the I--II linker modulates channel function in Xenopus oocytes. J Neurosci 16:1965-1974. Snutch TP, David LS (2006) T-type calcium channels: An emerging therapeutic target for the treatment of pain. Drug Dev Res 67:404-415. Snutch TP, Tomlinson WJ, Leonard JP, Gilbert MM (1991) Distinct calcium channels are generated by alternative splicing and are differentially expressed in the mammalian CNS. Neuron 7:45-57. Snutch TP, Peloquin J, Matthews E, McRory JE (2005) Molecular properties of volatage-gated calcium channels. In: Voltage-gated calcium channels (Zamponi GW, ed), pp 61-94. New York: Landes Bioscience. Soldatov NM, Bouron A, Reuter H (1995) Different voltage-dependent inhibition by dihydropyridines of human Ca2+ channel splice variants. J Biol Chem 270:10540-10543. Son WY, Han CT, Lee JH, Jung KY, Lee HM, Choo YK (2002) Developmental expression patterns of alpha1H T-type Ca2+ channels during spermatogenesis and organogenesis in mice. Dev Growth Differ 44:181-190. Soong TW, DeMaria CD, Alvania RS, Zweifel LS, Liang MC, Mittman S, Agnew WS, Yue DT (2002) Systematic identification of splice variants in human P/Q-type channel alpha1(2.1) subunits: implications for current density and Ca 2+ -dependent inactivation. J Neurosci 22:10142-10152. 162  Splawski I, Timothy KW, Decher N, Kumar P, Sachse FB, Beggs AH, Sanguinetti MC, Keating MT (2005) Severe arrhythmia disorder caused by cardiac L-type calcium channel mutations. Proc Natl Acad Sci U S A 102:8089-8096; discussion 8086-8088. Splawski I, Timothy KW, Sharpe LM, Decher N, Kumar P, Bloise R, Napolitano C, Schwartz PJ, Joseph RM, Condouris K, Tager-Flusberg H, Priori SG, Sanguinetti MC, Keating MT (2004) Ca(V)1.2 calcium channel dysfunction causes a multisystem disorder including arrhythmia and autism. Cell 119:19-31. Stamm S, Ben-Ari S, Rafalska I, Tang Y, Zhang Z, Toiber D, Thanaraj TA, Soreq H (2005) Function of alternative splicing. Gene 344:1-20. Starr TV, Prystay W, Snutch TP (1991) Primary structure of a calcium channel that is highly expressed in the rat cerebellum. Proc Natl Acad Sci U S A 88:5621-5625. Stetefeld J, Ruegg MA (2005) Structural and functional diversity generated by alternative mRNA splicing. Trends Biochem Sci 30:515-521. Striessnig J, Knaus HG, Grabner M, Moosburger K, Seitz W, Lietz H, Glossmann H (1987) Photoaffinity labelling of the phenylalkylamine receptor of the skeletal muscle transverse-tubule calcium channel. FEBS Lett 212:247-253. Suzuki S, Kawakami K, Nishimura S, Watanabe Y, Yagi K, Seino M, Miyamoto K (1992) Zonisamide blocks T-type calcium channel in cultured neurons of rat cerebral cortex. Epilepsy Res 12:21-27. Swayne LA, Bourinet E (2008) Voltage-gated calcium channels in chronic pain: emerging role of alternative splicing. Pflugers Arch 456:459-466. Takahashi M, Seagar MJ, Jones JF, Reber BF, Catterall WA (1987) Subunit structure of dihydropyridine-sensitive calcium channels from skeletal muscle. Proc Natl Acad Sci U S A 84:5478-5482. Takebayashi S, Li Y, Kaku T, Inagaki S, Hashimoto Y, Kimura K, Miyamoto S, Hadama T, Ono K (2006) Remodeling excitation-contraction coupling of hypertrophied ventricular myocytes is dependent on T-type calcium channels expression. Biochem Biophys Res Commun 345:766-773. Talavera K, Nilius B (2006) Biophysics and structure-function relationship of T-type Ca2+ channels. Cell Calcium 40:97-114. Talley EM, Cribbs LL, Lee JH, Daud A, Perez-Reyes E, Bayliss DA (1999) Differential distribution of three members of a gene family encoding low voltage-activated (T-type) calcium channels. J Neurosci 19:1895-1911. Tanabe T, Beam KG, Powell JA, Numa S (1988) Restoration of excitation-contraction coupling and slow calcium current in dysgenic muscle by dihydropyridine receptor complementary DNA. Nature 336:134-139. Tanabe T, Mikami A, Numa S, Beam KG (1990) Cardiac-type excitation-contraction coupling in dysgenic skeletal muscle injected with cardiac dihydropyridine receptor cDNA. Nature 344:451-453. Tanabe T, Takeshima H, Mikami A, Flockerzi V, Takahashi H, Kangawa K, Kojima M, Matsuo H, Hirose T, Numa S (1987) Primary structure of the receptor for calcium channel blockers from skeletal muscle. Nature 328:313-318. Tanaka H, Komikado C, Shimada H, Takeda K, Namekata I, Kawanishi T, Shigenobu K (2004) The R(-)-enantiomer of efonidipine blocks T-type but not L-type calcium current in guinea pig ventricular myocardium. J Pharmacol Sci 96:499-501. Tanaka H, Komikado C, Namekata I, Nakamura H, Suzuki M, Tsuneoka Y, Shigenobu K, Takahara A (2008) Species difference in the contribution of T-type calcium current to cardiac pacemaking as revealed by r(-)-efonidipine. J Pharmacol Sci 107:99-102. 163  Tang ZZ, Hong X, Wang J, Soong TW (2007) Signature combinatorial splicing profiles of rat cardiac- and smooth-muscle Cav1.2 channels with distinct biophysical properties. Cell Calcium 41:417-428. Tang ZZ, Zheng S, Nikolic J, Black DL (2009) Developmental control of Cav1.2 L-type calcium channel splicing by Fox proteins. Mol Cell Biol 29:4757-4765. Tang ZZ, Liang MC, Lu S, Yu D, Yu CY, Yue DT, Soong TW (2004) Transcript scanning reveals novel and extensive splice variations in human l-type voltage-gated calcium channel, Cav1.2 alpha1 subunit. J Biol Chem 279:44335-44343. Tang ZZ, Liao P, Li G, Jiang FL, Yu D, Hong X, Yong TF, Tan G, Lu S, Wang J, Soong TW (2008) Differential splicing patterns of L-type calcium channel Cav1.2 subunit in hearts of Spontaneously Hypertensive Rats and Wistar Kyoto Rats. Biochim Biophys Acta 1783:118-130. Tao J, Hildebrand ME, Liao P, Liang MC, Tan G, Li S, Snutch TP, Soong TW (2008) Activation of corticotropin-releasing factor receptor 1 selectively inhibits CaV3.2 T-type calcium channels. Mol Pharmacol 73:1596-1609. Thaler C, Gray AC, Lipscombe D (2004) Cumulative inactivation of N-type Cav2.2 calcium channels modified by alternative splicing. Proc Natl Acad Sci U S A 101:5675-5679. Thibault G, Amiri F, Garcia R (1999) Regulation of natriuretic peptide secretion by the heart. Annu Rev Physiol 61:193-217. Tiwari S, Zhang Y, Heller J, Abernethy DR, Soldatov NM (2006) Atherosclerosis-related molecular alteration of the human Cav1.2 calcium channel alpha1C subunit. Proc Natl Acad Sci U S A 103:17024-17029. Todorovic SM, Lingle CJ (1998) Pharmacological properties of T-type Ca 2+  current in adult rat sensory neurons: effects of anticonvulsant and anesthetic agents. J Neurophysiol 79:240- 252. Todorovic SM, Perez-Reyes E, Lingle CJ (2000) Anticonvulsants but not general anesthetics have differential blocking effects on different T-type current variants. Mol Pharmacol 58:98-108. Todorovic SM, Jevtovic-Todorovic V, Mennerick S, Perez-Reyes E, Zorumski CF (2001a) Ca(v)3.2 channel is a molecular substrate for inhibition of T-type calcium currents in rat sensory neurons by nitrous oxide. Mol Pharmacol 60:603-610. Todorovic SM, Jevtovic-Todorovic V, Meyenburg A, Mennerick S, Perez-Reyes E, Romano C, Olney JW, Zorumski CF (2001b) Redox modulation of T-type calcium channels in rat peripheral nociceptors. Neuron 31:75-85. Tohse N, Seki S, Kobayashi T, Tsutsuura M, Nagashima M, Yamada Y (2004) Development of excitation-contraction coupling in cardiomyocytes. Jpn J Physiol 54:1-6. Tseng GN, Boyden PA (1989) Multiple types of Ca2+ currents in single canine Purkinje cells. Circ Res 65:1735-1750. Tseng GN, Boyden PA (1991) Different effects of intracellular Ca and protein kinase C on cardiac T and L Ca currents. Am J Physiol 261:H364-379. Tsien RW, Ellinor PT, Horne WA (1991) Molecular diversity of voltage-dependent Ca2+ channels. Trends Pharmacol Sci 12:349-354. Tytgat J, Nilius B, Vereecke J, Carmeliet E (1988) The T-type Ca 2+  channel in guinea-pig ventricular myocytes is insensitive to isoproterenol. Pflugers Arch 411:704-706. Uchino T, Lee TS, Kaku T, Yamashita N, Noguchi T, Ono K (2005) Voltage-dependent and frequency-independent inhibition of recombinant Cav3.2 T-type Ca 2+  channel by bepridil. Pharmacology 74:174-181. 164  Uebele VN et al. (2009) Positive allosteric interaction of structurally diverse T-type calcium channel antagonists. Cell Biochem Biophys 55:81-93. Underwood JG, Boutz PL, Dougherty JD, Stoilov P, Black DL (2005) Homologues of the Caenorhabditis elegans Fox-1 protein are neuronal splicing regulators in mammals. Mol Cell Biol 25:10005-10016. Vassort G, Alvarez J (1994) Cardiac T-type calcium current: pharmacology and roles in cardiac tissues. J Cardiovasc Electrophysiol 5:376-393. Vassort G, Talavera K, Alvarez JL (2006) Role of T-type Ca 2+  channels in the heart. Cell Calcium 40:205-220. Vitko I, Bidaud I, Arias JM, Mezghrani A, Lory P, Perez-Reyes E (2007) The I-II loop controls plasma membrane expression and gating of Cav3.2 T-type Ca 2+  channels: a paradigm for childhood absence epilepsy mutations. J Neurosci 27:322-330. Wahler GM, Dollinger SJ, Smith JM, Flemal KL (1994) Time course of postnatal changes in rat heart action potential and in transient outward current is different. Am J Physiol 267:H1157-1166. Wakamori M, Imoto K (2009) Voltage-gated calcium channels. In: Handbook of Neurochemistry and Molecular Neurobiology Neural Signaling Mechanisms (Lajtha A, Mikoshiba K, eds), p 632. New York: Springer Science+Business Media, LLC. Wang D, Papp AC, Binkley PF, Johnson JA, Sadee W (2006) Highly variable mRNA expression and splicing of L-type voltage-dependent calcium channel alpha subunit 1C in human heart tissues. Pharmacogenet Genomics 16:735-745. Wang R, Karpinski E, Pang PK (1991) Two types of voltage-dependent calcium channel currents and their modulation by parathyroid hormone in neonatal rat ventricular cells. J Cardiovasc Pharmacol 17:990-998. Warnecke C, Surder D, Curth R, Fleck E, Regitz-Zagrosek V (1999) Analysis and functional characterization of alternatively spliced angiotensin II type 1 and 2 receptor transcripts in the human heart. J Mol Med 77:718-727. Wekstein DR (1965) Heart Rate of the Preweanling Rat and Its Autonomic Control. Am J Physiol 208:1259-1262. Welling A, Ludwig A, Zimmer S, Klugbauer N, Flockerzi V, Hofmann F (1997) Alternatively spliced IS6 segments of the alpha 1C gene determine the tissue-specific dihydropyridine sensitivity of cardiac and vascular smooth muscle L-type Ca 2+  channels. Circ Res 81:526- 532. Welsby PJ, Wang H, Wolfe JT, Colbran RJ, Johnson ML, Barrett PQ (2003) A mechanism for the direct regulation of T-type calcium channels by Ca 2+ /calmodulin-dependent kinase II. J Neurosci 23:10116-10121. Wen JF, Cui X, Ahn JS, Kim SH, Seul KH, Kim SZ, Park YK, Lee HS, Cho KW (2000) Distinct roles for L- and T-type Ca 2+  channels in regulation of atrial ANP release. Am J Physiol Heart Circ Physiol 279:H2879-2888. Westenbroek RE, Babcock DF (1999) Discrete regional distributions suggest diverse functional roles of calcium channel alpha1 subunits in sperm. Dev Biol 207:457-469. Wetzel GT, Klitzner TS (1996) Developmental cardiac electrophysiology recent advances in cellular physiology. Cardiovasc Res 31 Spec No:E52-60. White G, Lovinger DM, Weight FF (1989) Transient low-threshold Ca2+ current triggers burst firing through an afterdepolarizing potential in an adult mammalian neuron. Proc Natl Acad Sci U S A 86:6802-6806. Wielowieyski PA, Wigle JT, Salih M, Hum P, Tuana BS (2001) Alternative splicing in intracellular loop connecting domains II and III of the alpha 1 subunit of Cav1.2 Ca 2+  165  channels predicts two-domain polypeptides with unique C-terminal tails. J Biol Chem 276:1398-1406. Williams ME, Washburn MS, Hans M, Urrutia A, Brust PF, Prodanovich P, Harpold MM, Stauderman KA (1999) Structure and functional characterization of a novel human low- voltage activated calcium channel. J Neurochem 72:791-799. Witcher DR, De Waard M, Liu H, Pragnell M, Campbell KP (1995) Association of native Ca 2+  channel beta subunits with the alpha 1 subunit interaction domain. J Biol Chem 270:18088-18093. Wolfe JT, Wang H, Perez-Reyes E, Barrett PQ (2002) Stimulation of recombinant Cav3.2, T- type, Ca 2+  channel currents by CaMKIIgamma(C). J Physiol 538:343-355. Wolfe JT, Wang H, Howard J, Garrison JC, Barrett PQ (2003) T-type calcium channel regulation by specific G-protein betagamma subunits. Nature 424:209-213. Wu X, Eder P, Chang B, Molkentin JD (2010) TRPC channels are necessary mediators of pathologic cardiac hypertrophy. Proc Natl Acad Sci U S A 107:7000-7005. Xiao RP, Cheng H, Lederer WJ, Suzuki T, Lakatta EG (1994) Dual regulation of Ca2+/calmodulin-dependent kinase II activity by membrane voltage and by calcium influx. Proc Natl Acad Sci U S A 91:9659-9663. Xu X, Best PM (1992) Postnatal changes in T-type calcium current density in rat atrial myocytes. J Physiol 454:657-672. Xu X, Yang D, Ding JH, Wang W, Chu PH, Dalton ND, Wang HY, Bermingham JR, Jr., Ye Z, Liu F, Rosenfeld MG, Manley JL, Ross J, Jr., Chen J, Xiao RP, Cheng H, Fu XD (2005) ASF/SF2-regulated CaMKIIdelta alternative splicing temporally reprograms excitation- contraction coupling in cardiac muscle. Cell 120:59-72. Yamakage M, Chen X, Tsujiguchi N, Kamada Y, Namiki A (2001) Different inhibitory effects of volatile anesthetics on T- and L-type voltage-dependent Ca2+ channels in porcine tracheal and bronchial smooth muscles. Anesthesiology 94:683-693. Yang Y, Chen X, Margulies K, Jeevanandam V, Pollack P, Bailey BA, Houser SR (2000) L-type Ca 2+  channel alpha 1c subunit isoform switching in failing human ventricular myocardium. J Mol Cell Cardiol 32:973-984. Yang ZQ et al. (2008) Discovery of 1,4-substituted piperidines as potent and selective inhibitors of T-type calcium channels. J Med Chem 51:6471-6477. Yao J, Davies LA, Howard JD, Adney SK, Welsby PJ, Howell N, Carey RM, Colbran RJ, Barrett PQ (2006) Molecular basis for the modulation of native T-type Ca 2+  channels in vivo by Ca 2+ /calmodulin-dependent protein kinase II. J Clin Invest 116:2403-2412. Yasui K, Niwa N, Takemura H, Opthof T, Muto T, Horiba M, Shimizu A, Lee JK, Honjo H, Kamiya K, Kodama I (2005) Pathophysiological significance of T-type Ca 2+  channels: expression of T-type Ca 2+  channels in fetal and diseased heart. J Pharmacol Sci 99:205- 210. Yeo GW, Coufal NG, Liang TY, Peng GE, Fu XD, Gage FH (2009) An RNA code for the FOX2 splicing regulator revealed by mapping RNA-protein interactions in stem cells. Nat Struct Mol Biol 16:130-137. Yunker AM (2003) Modulation and pharmacology of low voltage-activated ("T-Type") calcium channels. J Bioenerg Biomembr 35:577-598. Yunker AM, McEnery MW (2003) Low-voltage-activated ("T-Type") calcium channels in review. J Bioenerg Biomembr 35:533-575. Zamponi GW, Snutch TP (1998) Decay of prepulse facilitation of N type calcium channels during G protein inhibition is consistent with binding of a single Gbeta subunit. Proc Natl Acad Sci U S A 95:4035-4039. 166  Zamponi GW, Bourinet E, Nelson D, Nargeot J, Snutch TP (1997) Crosstalk between G proteins and protein kinase C mediated by the calcium channel alpha1 subunit. Nature 385:442- 446. Zamponi GW, Lewis RJ, Todorovic SM, Arneric SP, Snutch TP (2009) Role of voltage-gated calcium channels in ascending pain pathways. Brain Res Rev 60:84-89. Zhang C, Zhang Z, Castle J, Sun S, Johnson J, Krainer AR, Zhang MQ (2008) Defining the regulatory network of the tissue-specific splicing factors Fox-1 and Fox-2. Genes Dev 22:2550-2563. Zhang JF, Ellinor PT, Aldrich RW, Tsien RW (1996) Multiple structural elements in voltage- dependent Ca2+ channels support their inhibition by G proteins. Neuron 17:991-1003. Zhang Z, Xu Y, Song H, Rodriguez J, Tuteja D, Namkung Y, Shin HS, Chiamvimonvat N (2002) Functional Roles of Cav1.3 (alpha(1D)) calcium channel in sinoatrial nodes: insight gained using gene-targeted null mutant mice. Circ Res 90:981-987. Zhao M, Chow A, Powers J, Fajardo G, Bernstein D (2004) Microarray analysis of gene expression after transverse aortic constriction in mice. Physiol Genomics 19:93-105. Zhong X, Liu JR, Kyle JW, Hanck DA, Agnew WS (2006) A profile of alternative RNA splicing and transcript variation of CACNA1H, a human T-channel gene candidate for idiopathic generalized epilepsies. Hum Mol Genet 15:1497-1512. Zhou HL, Lou H (2008) Repression of prespliceosome complex formation at two distinct steps by Fox-1/Fox-2 proteins. Mol Cell Biol 28:5507-5516. Zhou Z, Lipsius SL (1994) T-type calcium current in latent pacemaker cells isolated from cat right atrium. J Mol Cell Cardiol 26:1211-1219. Zhou Z, January CT (1998) Both T- and L-type Ca 2+  channels can contribute to excitation- contraction coupling in cardiac Purkinje cells. Biophys J 74:1830-1839. Ziman AP, Gomez-Viquez NL, Bloch RJ, Lederer WJ (2010) Excitation-contraction coupling changes during postnatal cardiac development. J Mol Cell Cardiol 48:379-386. Zoumakis E, Rice KC, Gold PW, Chrousos GP (2006) Potential uses of corticotropin-releasing hormone antagonists. Ann N Y Acad Sci 1083:239-251. Zuhlke RD, Bouron A, Soldatov NM, Reuter H (1998) Ca 2+  channel sensitivity towards the blocker isradipine is affected by alternative splicing of the human alpha1C subunit gene. FEBS Lett 427:220-224.   167  APPENDIX 1: T-TYPE CALCIUM CHANNELS: AN EMERGING THERAPEUTIC TARGET FOR THE TREATMENT OF PAIN  ________________ *A version of this appendix has been published. Snutch, T.P. and David, L.S. (2006). T-type calcium channels: An emerging therapeutic target for the treatment of pain. Drug Discovery Research. 67:404-415. Reprinted with kind permission of John Wiley and Sons. All rights reserved. 168      169     170      171    172      173      174     175     176     177    178   179  APPENDIX 2: SELECTIVE INHIBITION OF Cav3.3 T-TYPE CALCIUM CHANNELS BY Gq/11-COUPLED MUSCARINIC ACETYLCHOLINE RECEPTORS    _______________ *A version of this appendix has been originally published in The Journal of Biological Chemistry. Hildebrand, M.E., David, L.S., Hamid, J., Mulatz, K., Garcia, E., Zamponi, G.W. and Snutch, T.P. (2007). Selective inhibition of Cav3.3 T-type calcium channels by Gq/11-coupled muscarinic acetylcholine receptors. Journal of Biological Chemistry. 282(29), 21043-21055. © The American Society for Biochemistry and Molecular Biology. 180        181        182        183        184        185        186        187        188         189        190        191        192  APPENDIX 3: MOLECULAR MECHANISMS OF SUBTYPE-SPECIFIC INHIBITION OF NEURONAL T-TYPE CALCIUM CHANNELS BY ASCORBATE    _______________ *A version of this appendix has been published. Nelson, M.T., Joksovic, P.M., Su, P., Kang, H- W., Van Deusen, A., Baumgart, J.P., David, L.S.,Snutch, T.P., Barrett, P.Q., Lee, J-H., Zorumski, C.F., Perez-Reyes, E., and Todorovic, S.M. (2007). Molecular mechanisms of subtype-specific inhibition of neuronal T-type calcium channels by ascorbate. The Journal of Neuroscience. 27(46), 12577- 12583. Reprinted with kind permission of The Society for Neuroscience. All rights reserved. 193    194    195    196     197   198   199  APPENDIX 4: Cav2.1 P/Q-TYPE CALCIUM CHANNEL ALTERNATIVE SPLICING AFFECTS THE FUNCTIONAL IMPACT OF FAMILIAL HEMIPLEGIC MIGRAINE MUTATIONS: IMPLICATIONS FOR CALCIUM CHANNELOPATHIES    ________________ *A version of this appendix has been published. Adams, P.J., Garcia, E., David, L.S., Mulatz, K.J., Spacey, S.D., Snutch, T.P. (2009). Cav2.1 P/Q-type calcium channel alternative splicing affects the functional impact of familial hemiplegic migraine mutations: Implications for calcium channelopathies. Channels (Austin). 3(2):110-121. Reprinted with kind permission of Landes Biosciences. All rights reserved. 200     201       202       203      204      205       206       207      208      209       210      211  APPENDIX 5: A Cav3.2 T-TYPE CALCIUM CHANNEL POINT MUTATION HAS SPLICE-VARIANT SPECIFIC EFFECTS ON FUNCTION AND SEGREGATES WITH SEIZURE EXPRESSION IN POLYGENIC RAT MODEL OF ABSENCE EPILEPSY   _____________ *A version of this appendix has been published. Powell, K.L., Cain, S.M., Ng ,C., Sirdesai, S., David, L.S., Kyi, M, Garcia, E, Tyson, JR, Reid ,C,A,, Bahlo, M., Foote, S,J, Snutch, T.P., O'Brien, T.J. (2009). A Cav3.2 T-type calcium channel point mutation has splice-variant-specific effects on function and segregates with seizure expression in a polygenic rat model of absence epilepsy. The Journal of Neuroscience. 29(2):371-380. Reprinted with kind permission of The Society for Neuroscience. All rights reserved. 212    213    214    215    216    217   218    219     220  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.24.1-0072008/manifest

Comment

Related Items