Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Analysis of the neuroprotective function and the N-glycosylation progranulin (PGRN) Jia, Ying 2009

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
24-ubc_2009_spring_jia_ying.pdf [ 1.8MB ]
Metadata
JSON: 24-1.0067227.json
JSON-LD: 24-1.0067227-ld.json
RDF/XML (Pretty): 24-1.0067227-rdf.xml
RDF/JSON: 24-1.0067227-rdf.json
Turtle: 24-1.0067227-turtle.txt
N-Triples: 24-1.0067227-rdf-ntriples.txt
Original Record: 24-1.0067227-source.json
Full Text
24-1.0067227-fulltext.txt
Citation
24-1.0067227.ris

Full Text

ANALYSIS OF THE NEUROPROTECTWE FUNCTION AND THE N-GLYCOSYLATION OF PROGRANULIN (PGRN)  by  Ying JIA  B.Sc., Nanjing University, 2006  A THESIS SUBMITTED IN PARTIAL FULFUILLMENT OF THE REQUiREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE  in  THE FACULTY OF GRADUATE STUDIES  (Neuroscience)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  March, 2009  ©YingJIA,2009  ABSTRACT Recent studies have identified null mutations in the progranulin (PGRIV) gene as the cause of pathogenesis of Frontotemporal lobe dementia (FTLD). It was found that PGRN protein levels are reduced in patients due to haploinsufficiency. However, the functions of progranulin in the central nervous system remain poorly characterized. We hypothesized that PGRN plays a role in protecting mouse cortical neurons from aggregated amyloid-beta, NMDA and H 0 toxicity. 2 Neuronal cultures were incubated in conditioned medium containing PGRN protein, or infected with lentivirus carrying PGRN fusion gene, then treated with different toxins. The cell viability was evaluated by MTT assay. The results demonstrated that compared to the control groups without toxins added, restoration of PGRN is not protective from three types of insults in vitro. Another interest of our research is to better understand the N-glycosylation significance of PGRN. It has been demonstrated that PGRN is an N-linked glycoprotein, but the glycosylation status and the importance of such modifications to PGRN are still not clear. To investigate this issue, enzymatic digestion with PNGase F and endo H, and treatment with an N-glycosylation blocker, tunicamycin, were applied to demonstrate the existence of the carbohydrate. To further study the specific N glycosylation sites of PGRN, site-directed mutagenesis was used to construct single and multiple N glycosylation site mutants. The results showed that no single site was crucial for PGRN secretion and that multiple PGRN N-glycosylation mutants were retained and accumulated intracellularly. Additionally, the malfunctioning of N-glycosylation of PGRN leads to ER stress and unfolded/misfolded protein response by up-regulating BiP/GRP78 expression level. Taken together, all the N-glycosylation study results suggest that the N-linked oligosaccharide is very important for PGRN, especially the secretion.  TABLE OF CONTENTS  ABSTRACT  ii  TABLE OF CONTENTS  iii  LIST OF TABLES  vi  LIST OF FIGURES  vii  ACKNOWLEDGEMENTS  viii  CHAPTER 1: INTRODUCTION  1  1.1 Frontotemporal lobar degeneration(FTLD)  1  1.2 Progranulin (PORN)  4  1.3 Aims of the thesis  8  CHAPTER 2: NEUROPROTECTIVE EFFECTS OF PGRN 2.1 Introduction  11 11  2.1.1 Distributions and functions of PGRN  11  2.1.2 Aims of this chapter  12  2.2 Methods  13  2.2.1 Study design  13  2.2.2 Mouse primary cortical neuronal culture  13  2.2.3 Cell culture  14  2.2.4 Western immunoblotting  15  2.2.5 Immunocytochemistry  16  2.2.6MTTassay  17  2.2.7 Transfection with calcium phosphate system  17  2.2.8 Transfection with Lipofectamine 2000 System  17  III  2.2.9 Generation of Progranulin eDNA Into viral FUW vector  18  2.2.10 Construction of Lentivirus (FUW-GFP and FUW-PGRN)  18  2.2.11 Preparation of conditioned medium  19  2.2.12 Cytotoxicity treatments with Amyloid-beta, NMDA and hydrogen peroxide  19  2.2.13 Statistical analysis  20  2.3 Results 2.3.1 Exogenous effect of Progranulin on cell death models  21 21  2.3.2 Overexpressing PGRN in neuronal cells does not protect neurons from oxidative stress  23  2.4 Discussions  24  CHAPTER 3: N-GLYCOSYLATION STUDY OF PGRN 3.1 Introduction  35 35  3.1.1 N-glycosylation introduction  35  3.1.2 Aims of this chapter  39  3.2 Methods  40  3.2.1 Study design  40  3.2.2 Cell cultures  40  3.2.3 Western immunoblotting  41  3.2.4 Immunocytochemistry  41  3.2.5 Transfection: calcium phosphate system; Lipofectamine 2000 system  41  3.2.6 Quantitative RT-PCR (qRT-PCR) for measurement of mRNA  41  3.2.7 Enzymatic deglycosylation of Progranulin  42  3.2.8 Inhibition of glycosylation pathways  43  3.2.9 Site-directed mutagenesis  43  3.2.10 Statistical analysis  43  iv  3.3 Results  44  3.3.1 Expression and secretion of hPGRN  44  3.3.2 Enzymatic digestion of PGRN  44  3.3.3 Blocking N-glycosylation prevents PGRN secretion  45  3.3.4 Each of the single-site N-glycosylation mutants is functionally expressed and Secreted  45  3.3.5 Importance of the carbohydrate chain on efficient secretion of PGRN  46  3.3.6 Secretion pathway of PGRN and the mutant showing the same pattern  47  3.3.7 Increased BiP protein expression when multiple N-glycosylation mutant PGRN are over-expressed  48  3.4 Discussions  49  CHAPTER 4: CONCLUSIONS AND FUTURE PROSPECTS  71  CHAPTER 5: BIBLIOGRAPHY  73  LIST OF TABLES Table 3.1 List of Real-Time PCR primers  55  Table 3.2 List of primers to generate hPGRN mutants by site-directed mutagenesis  56  Table 3.3 List of hPGRN N-glycosylation mutants  57  VI  LIST OF FIGURES Figure 1 .1 PGRN gene schematic representation  10  Figure 2.1 Study design of Chapter 2  27  Figure 2.2 Calibration of progranulin proteins in conditioned medium  28  Figure 2.3 PORN CM does not protect neurons from A-beta toxicity  29  Figure 2.4 PORN CM does not protect neurons from NMDA toxicity  30  Figure 2.5 PORN CM does not protect neurons from 11202 toxicity  31  Figure 2.6 Subcellular localization of PORN  32  Figure 2.7 Overexpression of PORN protein by lentivirus  33  Figure 3.1 Study design of Chapter 3  58  Figure 3.2 Enzymatic digestion of PORN  59  Figure 3.3 Schematic representation of hPGRN and five N-glycosylation sites  60  Figure 3.4 Expression and secretion of PORN after tunicamycin treatment  61  Figure 3.5 Expression of single N-glycosylation site mutant in cell lysate  62  Figure 3.6 Secretion of single N-glycosylation site mutant in culture medium  63  Figure 3.7 Expression of multiple N-glycosylation site mutant in cell lysate  64  Figure 3.8 MRNA analysis of intracellular wild type and mutant PORN  65  Figure 3.9 Secretion of multiple N-glycosylation mutants in culture medium  66  Figure 3.10 Analysis of intracellular N-glycosylation mutants  67  Figure 3.11 Analysis of secreted N-glycosylation mutants  68  Figure 3.12 Subcellular localization of wild type and mutant PORN  69  Figure 3.13 BiP expression level after overexpressing PORN mutants  70  VII  ACKNOWLEDGEMENTS I would like to express my deepest gratitude to my supervisor, Dr. Max Cynader, who inspired, guided, encouraged and supported me throughout my academic program. My special thanks also should be given to Dr. William Jia, who offered me valuable ideas, suggestions and criticisms for my research. My deepest thanks to my committee Dr. Ian Mackenzie and Dr. Neil Cashman for their diligent advice and help. I also would like to give my thanks to Dr. David vacaldo, Dr. Andrew Bateman, Dr. Howard Feldman, and Dr. Shernaz Bamji for their priceless information and suggestion. Many thanks to my colleagues, Guoyu Liu, Wendy Wen, Alan Huang, Luke Bu, Dong Qiang, Guang Yang, Rui Liu, Aobo Guo, Chengyong Liao, Shanshan Zhu, Stephanie Thomason, John Tao, Baojun Liu, etc. for their great help and support during my two years’ study and life in Vancouver. They leave me most precious memory and experience in the beautiful country. Last but not the least, I would love to thank my best friends who encouraged, listened to, and cared about me, and my dearest parents who offer me endless support and unconditional love.  VIII  CHAPTER 1: INTRODUCTION  1.1 Frontotemporal lobar degeneration (FTLD) Frontotemporal lobe degeneration (FTLD) is the second most common type of early-onset neurodegenerative dementia after Alzheimer’ s disease below the age of 65 years old. It accounts for 5% to 10% of all patients with dementia and 10% to 20% of early onset neurodegenerative disease patients (Haugarvoll et al. 2007, Rademakers et al. 2007). A number of different syndromic variants, which are predominantly characterized by the presence of behaviour and personality changes and language impairment, followed by cognitive decline and finally resulting in dementia (Bugiani 2007), are referred to as FTLD, including bvFTD (behavioural variant Frontotemporal dementia), SD (semantic dementia) and PaNFA (progressive nonfluent aphasia) and some other types (Josephs 2008). Clinically, FTLD share common neuropathological features of preferential degeneration of the prefrontal and anterior temporal lobes that may either precede or follow the onset of motor dysfunction signs (Trojanowski & Dickson 2001). In 10%-15% cases, motor neuron disease (MND) or Parkinsonism is present together with clinical features of FTD (Neary et al. 2000b, Neary et al. 2000a, Groups 1994). Among FTLD patients, a family history of similar disease ranges from 25% to 50%, indicating a strong genetic based component of this neurodegenerative disease (Rosso et at 2003, Neary et al. 2005, Chow et a!. 1999, Stevens et al. 1998, Bird et a!. 2003). Two main types of histopathology were revealed based on the biochemical composition of cellular inclusions found in the patient brains with microscopic examination. Thus, FTD can be  1  classified into three categories according to the immunohistochemical properties of the material accumulated inside the neuronal cells: tau-positive inclusions, ubiquitin-positive inclusions and inclusions negative for both classified as dementia lacking distinctive histopathology (DLDH) (Van Deerlin et a!. 2007). Genetically, four genes were identified involved in FTD patient cases so far, including microtubule associated protein tau (MAPT) on chromosome  17,  valosin-containing protein (VCP) on chromosome 9, chromatin modifying protein 2B (CHMP2B) on chromosome 3 and the recently discovered progranulin protein (PGRN) on chromosome 17. Before 2006,  the  knowledge of FTD  molecular property  was  about the  microtubule-associated protein tau (MAPT, tau) encoded by the MAPT gene on chromosome 1 7q2 1 in several FTD families. The deposition of abnormally hyperphosphorylated tau protein (P-tau) in insoluble filaments in the brain was isolated from neuroectodermic cells of many sporadic and familial cases, known collectively as taupathies (Murrell et a?. 1997). Tau is a microtubule-binding protein abundant in normal neurons and glia cells and commonly present in axons, which consists of cellular structures microtubules. Binding to tau protein makes the microtubules stabilized. Since microtubules are involved in axonal transportation, tau protein most likely regulates the axonal transport processes along the microtubules (Rademakers et a?. 2004). To date, 37 pathologic mutations have been identified with MAPT gene (Haugarvoll et a!. 2007). The mutations identified in FTD patients are summarized to lead to dementia through two main mechanisms: the missense and deletion mutations disrupt the binding of tau to microtubules and lead to the aggregation formation of tau protein into filaments (Nacharaju et a?. 1999, Rizzini et a?. 2000); other types of MAPT mutations affects the alternative splicing  2  within exon 10 and influences 3R-tau/4R-tau balance (Wszolek et al. 2003, Pittman et a!. 2006). FTD is also associated with missense mutations in VCP (chromosome 9p13) encoding the valosin-containing protein VCP. The gene belongs to the AAA-ATPase gene superfamily, while the protein participates in several cellular functions including the ubiquitin-proteasome dependent protein degradation, cell cycle control, and membrane fusion. Watts and colleagues have identified six missense mutations in VCP (Watts et a!. 2004). Hereditary FTLD and ALS phenotypes were also found segregating with chromosomes 9q (Hosler et a!. 2000) and 3p (Skibinski et al. 2005). FTD is also linked to chromosome 3 in a large Danish family (Brown 1998). These disorders are caused by mutations in the gene CHMP2B encoding the chromatin-modifying 2B proteins involved in formation of multi-vesicular bodies and degradation of receptors. Five CHMP2B pathogenic mutations are known so far (Blair et a!. 2008). However, several families with FTD were known to show linkage to chromosome 17 but no demonstrable tau mutations had been identified (Rosso et a!. 2001). The composition of inclusions in these tau-negative FTD patient brains were reported ubiquitin positive [15]. In 2006, two research groups described the association of mutations in the gene coding for progranulin (PGRN), which is also located on the chromosome 17, with FTD (Cruts et a!. 2006a, Baker et a!. 2006).  3  1.2 Progranuim (PGRN) Progranulin (PGRN) protein was isolated from several different sources causing various nomenclatures. It was firstly cloned from human leukocytes and identified as an epidermal growth factor, also called proepithelin or epithelin precursor (Shoyab et al. 1990, Bhandari et al. 1992). It was also named as PC cell-derived growth factor (PCDGF/GP88) when purified from the conditioned medium of highly tumorigenic mouse teratoma PC cells; and known as acrogranin originally from guinea pig testes (Zhou et al. 1993, Anakwe & Gerton 1990, Baba et al. 1993). Deduced human progranulin protein predicts 593 amino acid residues showing no obvious transmembrane sequence. The protein consists of a signal peptide extending to residue 17 and seven and a half tandem repeats of 56-57 amino acid consensus motif rich in cysteine (Shoyab et al. 1990, Bateman & Bennett 1998). The cysteinyl repeats was named as granulin!epithelin peptides with 6kDa molecular mass and each of them contains 12 cysteine residues (Plowman et al. 1992). The PGRN protein contains a 68kDa protein core with a 20 kDa carbohydrate moiety. The mature protein undergoes proteolytic processing with the release of granulin peptides possessing different biological activity and regulatory function. The PGRN gene is located on the 21q portion of chromosome 17, approximately 1.7 Mb centromeric of the MI4PT gene (Mackenzie & Rademakers 2007); while the mouse gene was found on chromosome 11 (Bucan et al. 1996). The seven and a half repeats of granulin motif are separated by short intervening spacer sequences (Figure 1.1) (Plowman et al. 1992, Bhandari & Bateman 1992).  4  PGRN mRNA distributes ubiquitously in vivo, especially in tissues rich in epithelial and haematopietic cells (Bhandari et al. 1992, Plowman et al. 1992). In rats it was found of the highest expression levels in placenta, spleen, kidney, several reproductive tissues and some specific neurons in the brain; intermediate levels of expression were found in lungs, colon, ileum and duodenum; the lowest mRNA expression levels were in skeletal muscles (Daniel et al. 2000, Bhandari et al. 1993). In addition, overexpression of PGRN was found in several cancer cell lines and/or tumor tissues including ovarian cancer (Jones et a!. 2003), breast cancer (Lu & Serrero 2000), renal cell carcinoma (Donald et a!. 2001), glioblastoma (Liau et a!. 2000), bladder carcinoma (Monami et a!. 2006) and multiple myeloma (Wang et a!. 2003a). Since PGRN is widely expressed in vivo and in vitro, it is believed that the protein functions as a multipurpose factor. Progranulin is a pluripotent growth factor that is involved in tumor formation, wound repair and developmental events (He & Bateman 2003). Previous studies showed that PGRN regulates multiple steps of tumor progression cascade including cellular proliferation, anchorage independence, invasiveness, resistance to anoikis, and promotion of resistance to select cytotoxic drugs (Bagnato et a!. 1997, Zanocco-Marani et a!. 1999, He & Bateman 2003, Mills & Moolenaar 2003, Kamrava et a!. 2005). Progranulin mRNA levels in dermal wounds are upregulated shortly after transcutaneous puncture injury. The wound turned on the activation of PGRN gene expression in inflammatory cells (mainly neutrophils), dermal fibroblasts and endothelial cells (Zhu et a!. 2002, He et a!. 2003). PGRN regulates and promotes the proliferation and migration of fibroblasts and endothelial cells (Zhu, Nathan et al. 2002). It is believed that progranulin and its smaller peptide products, granulinlepithelin, have different biological even opposite activities in regulating both proliferation and inflammation  5  process. In vivo experiments demonstrated that progranulin is regulatory in the proliferative and developmental process of the epidermis, nervous system, blood vessels and spennatogenesis, which are critical in embryonic and neonatal development (Diaz-Cueto et al. 2000, Daniel et al. 2003). The biological activities of progranulin are mediated through growth factor-related signalling pathways such as mitogen-activated protein kinase (MAPK) in the extracellular regulated kinase signalling pathway, and phosphatidylinositol 3’—kinase (P1-3K), protein kinase B/AKT, and the  S6kinase 70  in the P1-3K cascade pathways (He & Bateman 2003,  Zanocco-Marani et al. 1999, Lu & Serrero 2001). In human breast cancer cells, PGRN was shown to mediate the mitogenic activity of estrogen by inducing cyclin Dl expression, which stimulates proliferation by driving cells from the Gi phase into the S-phase of cell cycle, and inhibition of PGRN expression by antisense transfection resulted in a complete inhibition of tumorigenesis in nude mice, as well as the expression levels of cyclin Dl, CDK4 (Cyclin-dependent kinase-4) and MMP-2 (matrix metallo proteinases-2) Lu  &  Serrero  2000,  Liu  et al.  2007).  Additionally,  ((Lu & Serrero 2001,  progranulin  may  enhance  tyrosine-phosphorylation of focal adhesion kinase (FAK) which mediates signalling to and from integrins and the actin cytoskeleton (Cary & Guan 1999). Overexpression of PGRN in HepG2 cells resulted in an increase p53 expression level which is a tumor suppression gene (Cheung et al. 2006). Under some circumstances, progranulin acts directly in the nucleus, bypassing the kinase transduction cascade. It binds to HIV Tat proteins and to CyclinTi to regulate transcription process (Trinh et a!. 1999, Hoque et a!. 2003).  6  The functional receptor of progranulin has not been identified, however, membrane proteins specifically bind to both progranulin and its proteolytic product, granulin/epithelin was reported. Cross-linking studies suggested a putative progranulin binding protein complex of 140-l45kDa in human breast cancer cell MDA-MB-468 (Culouscou et al. 1993). In CCL64 cells (mink lung epithelial cell line), another putative cell surface binding site for progranulin with molecular weight of about l2OkDa was identified (Xia & Serrero 1998). The biological functions of progranulin may also be mediated by protein-protein interactions between the functional domains of PORN and its binding partners. Several PORN-associated proteins have been reported and found to affect PGRN action in various aspects. The interaction between progranulin and perlecan, a heparin sulphate proteoglycan, was reported. The interaction could contribute to mediating tumor growth (Gonzalez et al. 2003). Recently, another progranulin associated protein, COMP (cartilage oligomeric matrix protein) was identified and acts with PORN together to regulate chondrocyte proliferation (Xu et a!. 2007). In the FTD population, 5-10% of patients were found to have mutations in PGRN in recent works. So far, 62 pathogenic PGRN mutations have been identified in 169 families or individuals (http:www.molgen.ua.ac.be/FTDMutations/). The types of mutations occurred in all regions of the gene, including frameshift, nonsense, splice-site, signal peptide, Kozak sequence disruptions, and missense mutations (Gass et al. 2006, Le Ber et al. 2007). The majority of PGRN mutations introduce premature termination of condons and it has been shown that, in such cases, the mutant mRNA is rapidly degraded through the process of nonsense mediated decay, resulting in a functional null allele (Pickering-Brown et al. 2006, Baker et al. 2006, Cruts et al. 2006b, Gass et al. 2006). Some pathogenic mutations that do not create null alleles, such as missense mutations, are predicted to lead to the production of a non-functional or  7  unstable PGRN protein (van der Zee et al. 2007). These suggest that PGRN haploinsufficiency would be the probable pathogenic mechanism rather than the accumulation of mutant protein (Eriksen & Mackenzie 2008, Pickering-Brown et al. 2006). Soon after the identification of mutations in PGRN, biochemical analysis demonstrated that the major component of the ubiquitin-positive  inclusions was truncated and  hyperphosphorylated isoforms of TDP-43 in FTD and ALS families who have PGRN mutations. TDP-43 is encoded by TARDBP gene on chromosome 1. It is highly conserved and ubiquitously expressed in tissues, including heart, lung, liver, spleen, kidney, muscle and brain (Buratti et al. 2001). It was initially cloned as a human protein capable of binding HIV transactive response DNA (Ou et al. 1995) and subsequently identified as part of a complex involved in the splicing of the cystic fibrosis transmembrane conductance regulator gene (Buratti et al. 2001, Buratti et al. 2004). The proposed functions of TDP-43 include exon skipping, or a scaffold for nuclear bodies through interactions with survival motor neuron protein (Mercado et a!. 2005). Under pathologic conditions, TDP-43 has been shown to relocate from the neuronal nucleus to the cytoplasm and accumulate, a consequence of which may be the loss of TDP-43 nuclear functions (Ahmed et a!. 2007).  1.3 Aims of the thesis  Previous studies have shown that progranulin (PGRN) gene expression was upregulated in amyotrophic lateral sclerosis (ALS), Alzheimer’s disease (AD) and Creutzfeldt-Jakob disease (CJD)(Baker & Manuelidis 2003, Malaspina et a!. 2001). Moreover, an ischemic stroke model in rats provides a theoretical method by which PGRN may be  8  regulated during CNS inflammation (Wang et al. 2003b). However, the functions and mechanisms of PGRN in neurodegenerative disease are still unknown. Here, we hypothesized that PORN may play a neuro-protective role when neurons are dealing with adverse conditions. In Chapter Two, we examined the potential neuro-protective functions of PORN by adding PORN conditioned medium or overexpressing PORN by lentivirus in primary mouse cortical neurons treated with NMDA, beta-amyloid or H . 0 2 Moreover, human progranulin was identified as a heavily glycosylated protein with five potential N-glycosylation sites. It is well known that N-glycosylation will affect the stability, secretion, function of a glycoprotein. In Chapter three, we hypothesized that N-glycosylation is critical for progranulin and indispensable. Site-directed mutagenesis was applied to study the specific site’s influence on progranulin glycosylation.  9  Figure 1.1 Progranulin (PGRN) gene schematic representations. PGRN is located on  chromosome 17q2 1.32, containing 12 exons. It consists of a signal peptide sequence and seven and a half tandem repeats of 56-57 amino acid consensus motif rich in cysteine.  Chromosome l7q 2 1.32 Progranulin gene structures  I. p  1.11111 0  F  B  A  C  D  E  10  CHAPTER 2: NEURO-PROTECTIVE EFFECTS OF PGRN  2.1 Introduction  2.1.1 Distributions and functions of PGRN In human beings, PGRN contains 13 exons that encode an 88 kDa glycoprotein progranulin. Progranulin has been detected in cultured haematopoietic and epithelial cell lines (Bhandari et al. 1992), and highly expressed in gastrointestinal mucosa, spleen, lymphoid tissue and skin epithelium (Daniel et al. 2000). Progranulin acts as a growth factor, and is implicated in wound healing, tumor growth, and inflammation in the periphery (He & Bateman 1999, Zhu et al. 2002). During embryonic development, PGRN mRNA is widely distributed in both central nervous system and the peripheral nervous system (dorsal root ganglia and sympathetic ganglia). In the later stages of development, progranulin was detected in forebrain, olfactory lobes, retinal ganglion cells and the spinal cord (Daniel et al. 2003). Adult rodent brains have shown abundant PGRN mRNA in specific neuronal subsets, including pyramidal cells in the hippocampus, the cerebellar Purkinje cells and cortical pyramidal cells (Daniel et al. 2000, Ahmed et al. 2007). Recent immunohistochemical findings revealed the PGRN expression in microglial cells and some dendrites of cerebral cortical pyramidal cells (Snowden et al. 2006). In contrast, no or very low levels of PGRN was detected in astrocytes and oligodendroglia (Mukherjee et al. 2006).  11  The functions and mechanism of PORN in the CNS is still speculative and based on more established evidence from the periphery. Recombinant progranulin regulates and enhances neuronal survival, and stimulates neuritic outgrowth in cultures of rat motor and cortical neurons (Van Damme et al. 2008). An ischemic stroke model in rats provides a theoretical method by which PORN may be regulated during CNS inflammation (Wang et al. 2003b). Specifically, PORN expression level is up-regulated in activated microglia around amyloid plaques in AD (Baker et al. 2006).  Pieces of evidence also showed significantly increased  levels of gene expression profiling studies in amyotrophic lateral sclerosis (ALS), Alzheimer’ s disease (AD) and Creutzfeldt-Jakob disease (CJD) (Baker & Manuelidis 2003, Malaspina et al. 2001). Together, these observations suggest that PORN functions in CNS diseases are related to neuronal growth support, inflammation, and/or defence responses to neurites degeneration.  2.1.2 Aims of this chapter In FTLD-U patients, most of the PORN mutations apparently cause loss-of-function of PORN, because of nonsense-mediated mRNA decay or non-functional/unstable PORN protein rather than accumulation of mutant protein (Cruts et al. 2006a, van der Zee et a!. 2007). In the periphery, PGRN acts as a trophic growth factor to support and enhance cell growth and survival. Thus, we hypothesized that a modest overexpression of PORN protein levels in cell death models may be sufficient to prevent or reduce cell death under various insults.  12  2.2 Methods  2.2.1 Study design To analyze and study the neuroprotective effects of progranulin, mouse primary cortical neuronal cultures were employed. Conditioned medium containing progranulin protein was collected from the overexpressing (by transfecction) pcDNA 3.1 -PORN plasmid HEK 293T cell cultures. The conditioned medium was then added into mouse cortical neurons and coincubated with two types of toxins: 25uM beta-amyloid and 4OuM H202 for 24 hours, or added into neuronal cultures for 24 hour recovery after 1 hour 5OuM NMDA treatment. Then an MTT assay was performed to evaluate cell death viability. To rule out the possibility that the non-protective effect of progranulin was due to the conditioned medium applied exogenously, we directly overexpressed PGRN in neuronal cultures by lentivirus infection (packed with FUW-PGRN) which would persistently express PGRN protein. The overexpression of PGRN was examined by both immunocytochemistry and western blotting and the PORN effect was tested on 4OuM H202 model, and finally cell viability rate was evaluated by MTT assay (Figure 2.1). 2.2.2 Mouse primary cortical neuronal culture Mouse primary cortical neuronal cultures were prepared from the embryos of El 5 timed pregnant CD1 mouse. After the mother mouse was anesthetised and sacrificed, embryos were kept in cold dissection buffer containing Ranks Balanced solutions (Gibco-BRL, Grand Island, NY) and 10mM HEPES (Sigma, Saint Louis, MO), pH 7.4 and osmolarity 310-320 mOsm. The cortices were separated and peeled off from the meninges of the embryonic brains. 0.25% trypsin (Gibco-BRL, Grand Island, NY) was applied to the tissues at 37°C for 10-20  13  minutes, followed by two washes with DMEM (Gibco-BRL, Grand Island, NY) containing 10% fetal bovine serum (Gibco-BRL, Grand Island, NY) and 1% antibiotics (Gibco-BRL, Grand Island, NY) to remove trypsin. Then the cortical tissues were triturated with 1 OmL pipette and the cells were collected by centrifuging at 1400 rpm for 3 minutes. The supematant was discarded and the cell pellet was resuspended with 5-lOmL planting neurobasal medium containing: Neurobasal (Gibco-BRL, Grand Island, NY), 2% B-27 supplement with AO (Gibco-BRL, Grand Island, NY), 2mM L-glutamine (Sigma, Saint Louis, MO), 25uM glutamic acid (Sigma, Saint Louis, MO), 1% antibiotics (Gibco-BRL, Grand Island, NY) and 10mM 13—mercaptoethanol (Gibco-BRL, Grand Island, NY). Neuronal cells were counted and plated onto poly-D-lysine (Sigma, Saint Louis, MO) coated tissue culture dishes (some containing coverslips for immunocytochemistry purpose) at a density of approximately 1.5x10 5 cells/well for 24-well plates, and 8x 1  cells/well for 6-well plates. 48 hours after plating, total medium  was changed into fresh maintaining medium consisting of Neurobasal medium, 2% B-27 supplement with AU, 2mM L-glutamine, 1% antibiotics and 10mM —mercaptoethanol. Half of the volume of medium was replaced with fresh maintenance medium every 3-4 days thereafter. The cells were maintained in 37°C, 5% C02 humidity conditional incubator (NuAir, Plymouth, MN). Only mature cortical neurons (10-11 days old) were used for all experiments. 2.2.3 Cell cultures One human cell line: embryonic kidney HEK 293T cells, was obtained from the American Type Culture Collection. The cells were cultured following the instructions from the American Type Culture Collection in DMEM containing 10% fetal bovine serum and 1% antibiotics.  14  2.2.4 Western immunoblotting After treatment, cells were washed with cold PBS and lysed with 1 x sample buffer directly on ice. The 2x sample buffer contained: 62.5mM Tris-HC1, pH 6.8, 25% Glycerol, 2% SDS,  0.01% Bromophenol  blue,  and  5%  (or 710mM)  f3-mercaptoethanol.  Protein  concentrations were determined using a modified Bio-Rad DC protein assay protocol using Thiols. 2Oug of protein for each sample was analyzed with 10% SDS-polyacrylamide resolving gels and 5% stacking gels using Bio-Rad Gel electrophoresis system (Bio-Rad, Hercules, CA). Bio-Rad Wet Transfer system (Bio-Rad, Hercules, CA) was then applied to transfer the protein from gels onto Nitrocellulose membranes (Bio-Rad, Hercules, CA) at 4°C. The membrane was blocked with 5% non-fat milk, and probed with diluted primary antibodies overnight at 4°C. The primary antibodies used include: rabbit polyclonal Actin antibody (1:1000, cell signalling, Cat #4967); goat polyclonal human progranulin antibody (1:1000, R&D system, Cat #AF2420); sheep polyclonal mouse progranulin antibody (1:1000, R&D System, Cat #25 57). Membranes were washed with TBST and incubated with HRP-conjugated secondary antibodies at 1:2000 dilutions for one hour at room temperature. The HRP-secondary antibody used included: donkey anti-goat (1:2000, Santa Cruz Biotechnology, Cat #sc-2384); goat anti-rabbit (1:2000, Cell signalling, Cat #7074); anti-sheep (1:2000, R&D Systems, Cat# HAFO16). Membranes were then washed with TBST and visualized with equal volumes of Western lightning chemiluminescence reagent and oxidizing reagent (PerkinElmer, Cat #NEL1O4) using a Bio-Rad Fluor-S Multilmager. Fermentas Pagerulers Prestained Protein Ladder (Cat #SM0671) was used to estimate the protein molecular weight. To normalize and analyze western immunoblotting membrane results, Image J was used to calculate and normalize the average intensity of each protein band against the actin band from cell lysate samples.  15  2.2.5 Immunocytochemistry The cells (primary mouse cortical neurons and cell line cells) were grown on poly-D-lysine coated cover slips and washed with warm PBS and fixed with warm 4% Paraformaldehyde (Sigma, Saint Louis, MO) containing 2% sucrose (Sigma, Saint Louis, MO) in PBS for 15 minutes at room temperature. Then the cells were rinsed with PBS for 3 times and permeabilized with 0.1% Triton X-lOO (Sigma, Saint Louis, MO) in PBS for 2 minutes at room temperature. After washing with PBS 3 times, the cells were blocked with 5% Bovine serum albumin (BSA) in PBS for 1 hour at room temperature, and incubated with primary antibody overnight at 4°C. After washing repeatedly with PBS, cells were incubated with Alexa fluor dyes (Invitrogen, Carlsbad, CA) coupled secondary antibody for 1 hour at 37°C. For the double staining samples, cells were washed with PBS and reblocked with 5% BSA/PBS for 1 hour at room temperature. Another primary antibody was incubated with cells for 1 hour at room temperature and washed repeatedly with PBS. The nucleus was labelled using DAPI (1:10000, Invitrogen, Cat #D3571) for 3 minutes at room temperature. After PBS washes, the coverslips were mounted on glass slides with antifade reagent (Invitrogen, Cat #P36930). Images were obtained using an Olympus Fluoview FV1000 Confocal scanning microscope. The primary antibodies used include: polyclonal anti-human progranulin antibody (1:250); polyclonal anti-mouse progranulin antibody (1:250); mouse monoclonal anti-MAP2 antibody (1:1000, abeam, Cat #ab24645). The Alexa fluor dyes conjugated with secondary antibodies used included: Alexa 546 anti-sheep, Alexa 488 anti-rabbit, Alexa 488 anti-mouse, Alexa 488 anti-goat, Alexa 546 anti-goat.  16  2.2.6 MTT assay Neurons were seeded at a concentration of 1 .5x 1 O in 24-well plates. After treatment, 25 iL MTT ([3 -(4,5-dimethylthiazol-yl)-2,5-diphenyltetrazolium bromide] (Sigma, Saint Louis, MO) stock solution (5mg/mL in PBS) was added to each well and incubated for 5 hours to allow MTT to be metabolized. The medium was removed and formazan (MTT metabolic product) was dissolved in 200 jiL lysis buffer containing SDS 200mg/mL (Bio-Rad, Hercules, CA), 50% N,N-dimethylformaldehyde (Sigma, Saint Louis, MO) and 0.4% glacial acetic acid (Fisher Scientific, PA). The optical density was measured at 560nm and compared to background in a plate reader (Bio tech Instruments INC.). 2.2.7 Transfection with calcium phosphate system (Promega, Madison, MI) The cells were plated the day before the transfection experiment in order to achieve 50%-70% confluence on the day of the transfection. The medium was completely replaced by fresh growth medium three hours before transfection. For each transfection, 3ug DNA/well for 6-well plate and 1 Oug DNA/well for 10mm dish was mixed with sterile deionised water and then mixed with CaCl . The mixture was then added into 2xHBS and coincubated for 30 2 minutes at room temperature to form a fine calcium phosphate-DNA coprecipitate. The transfection solution was then added to the cells, and after 16 hours, the growth medium was totally replaced with the fresh medium. 2.2.8 Transfection with Lipofectamine 2000 System (Invitrogen, Carlsbad, CA) The cells were plated and cultured in the growth medium absent of antibiotics the day before the transfection experiment in order to achieve 40%-60% confluence on the day of the  17  transfection. For each well, Lipofectamine 2000 was diluted and mixed in 5OuL Opti-MEM I (Invitrogen, Carlsbad, CA) Reduced Serum Medium without serum.  0.8ug DNA/well for  24-well plate was diluted in SOuL Opti-MEM I Medium and mixed. After 5 minutes incubation, the diluted DNA and diluted Lipofectamine 2000 were combined, mixed, and coincubated for 20 minutes at room temperature. Then the 1 OOuL mixture was added into cells until they were ready to assay test. 2.2.9 Generation of Progranulin cDNA Into viral FUW vector To overexpress progranulin in mouse cortical neurons which are hard to transfect, progranulin eDNA was subcloned into the viral FUW vector at the 3’ end at BamHI and EcoRI sites from pcDNA 3.1 plasmid (a generous gift from Dr. Andrew Bateman, University of Montreal). The progranulin cDNA in FUW vector was named as FUW-PGRN. 2.2.10 Construction of Lentivirus (FUW-GFP and FUW-PGRN) 293T cells were split the day before transfection (90-95% confluency on the day of transfection) into 10mm plates. On the day of transfection, cells were transfected with DNA vector (bug) (FUW-GFP or FUW-PGRN), Delta 8.9 packaging vector (7.5ug) and envelope VSVG vector (5ug) using Calcium/phosphate transfection according to the manufacturer’s protocol. Medium was changed 16-20 hours after transfection, and supematant was obtained at 48 and 72 hour. To concentrate the virus, cellular debris was first removed by centrifuging at 3krpm for 15mm, followed by ultra-centrifuging at 24-3Okrpm for 2 hour at 4 °C. The virus pellet was dissolved in neuron maintenance medium, aliquot and stored at -80 °C. To titre the virus concentration, a series of dilutions of virus were made and 293T cells were infected.  18  Green cells were counted 48-72 hours after infection and the numbers of virus particles were calculated. 2.2.11 Preparation of conditioned medium 293T cells were plated in 10cm Petri dishes in lOmL DMEM containing 10% FBS and 1% antibiotics. After reaching subconfluence, the cells were transfected with 1 Oug/dish of PGRN-pcDNA3.l DNA plasmid or pcDNA 3.1 empty vector as a negative control via calcium/phosphate transfection. After 16-20 hours, the cells were washed with PBS and cultured in serum free medium (DMEM for cell line experiments and neurobasal for neuron experiments) for another 48 hours. The medium from these cultures was collected and sterilized using a 0.22um pore filter and aliquot and stored at -80 °C until needed.  2.2.12 Cytotoxicity treatments with Amyloid-beta, NMDA and hydrogen peroxide (H ) 0 2 (1) Amyloid-beta cytotoxicity To obtain toxic -amyloid fibrils, Af3 (Sigma, Cat #A98 10) was completely dissolved in double distilled water, and incubated at 37 °C for 1 hour. We mixed the same volume of sterilized PBS into the solution to dilute a stock concentration of 0.5mM. A13 was incubated at 37°C for 4 days to allow the stable growth of Af3 fibrils in water/PBS. 25uM A13 or scramble peptide solution (as a negative control) was coincubated with different concentrations of progranulin conditioned medium for 24 hours in mouse cortical neurons to induce beta-amyloici toxicity. The control groups were neuronal cells without adding both toxin and conditioned medium.  19  (2) Excitotoxicy treatment with NMDA To induce NMDA excitotoxicity, 2OuM Glycine and 5OuM NMDA was added to the mouse cortical neuron maintenance medium for 1 hour at 37°C.  3uM of MK-801, aNMDAR  open channel blocker, was added along with NMDA to prevent NMDAR activation in certain experiments. After the one-hour NMDA treatment, cells were allowed to recover in progranulin conditioned medium for 24 hours at 37°C to analyze with cell death assays. The control groups were cells without adding the toxin and the conditioned medium. (3) Hydrogen peroxide (H ) toxicity 0 2 a. To induce oxidative stress, 4OuM H 0 was coincubated with progranulin 2 conditioned medium or empty vector conditioned medium for 24 hours in mouse neuron culture medium, then MTT assay was performed. b. To induce oxidative stress in PGRN-overexpressed mouse cortical neurons, after 5 days of lentivirus (FUW-PGRN and FUW-GFP) infection, 4OuM H 0 was added into neuronal 2 cells for 24 hours, then MTT assay was applied. 2.2.13 Statistical analysis All data were expressed as Mean +1- SEM, and the Student’s t test was used to examine the statistical significance of the differences between groups of data. Differences were considered significant when p<O.O5. (* indicates p<O.O5, while  **  indicates p<O.Ol) For all  experiments, data was obtained independently at least 3 times.  20  2.3 Results 2.3.1 Exogenous effect of Progranulin on cell death models To investigate if exogenous progranulin could protect mouse cortical neurons from various cytotoxic insults, we added conditioned medium (CM) which was collected from culture medium of pcDNA3.l -progranulin plasmid transfected 293 T cells. After transfection 24 hours, the medium was completely changed into neurobasal for another 48 hours and collected, filtered with 0.22um filter membrane, aliquot, and stored at -80 °C. The collected culture medium was quantified and calibrated with recombinant protein (purified from transfected 293T cell line culture medium by Dr. Chengyong Liao in our lab) via western blotting, then applied to mouse cortical neuron cultures in different concentrations. According to the calibration result (Figure 2.1), Progranulin protein concentration in culture medium is 4.36±0.44ng!uL.  2.3.1.1 PGRN conditioned medium could not protect neurons from aggregated A toxicity. To investigate the role of exogenous progranulin in neuro-protection from 25uM aggregated Amyloid-beta 1-40 cytotoxicity, the A fibrils was coincubated with different concentrations of PGRN conditioned medium for 24 hours and MTT assay was applied to measure cell death (Figure 2.2). In this study, the percentage of neuron viability treated only with A13 fibrils was 61. 8%±3 .9%, and the viabilities of neurons coincubated with different concentrations of progranulin CM from 272.5ng/uL to lO9Ong/uL were 64.7%±3.0%,  21  66.6%±3.7%, 62.O%±6.7%, respectively, showing no significant difference from the no conditioned medium treated group of neurons. The statistics analysis indicated that PGRN CM could not prevent cell death from amyloid-beta toxicity.  2.3.1.2 PGRN conditioned medium was not protective for neurons from NMDA-induced toxicity. To determine if PGRN is able to protect neurons from NMDA induced excitotoxicity, cortical neurons were treated with 2OuM Glycine±5OuM NMDA for 1 hour and the cells were allowed to recover in different concentrations of progranulin conditioned medium for 24 hours, thereafter the cell death was evaluated with the MTT assay. No significant difference was found showed between groups with or without CM (Figure 2.3). According to statistical analysis, the cell viabilities were 45.4%±2.3% for the no CM group, and 45.O%±2.4%, 45.8%±2.4%, 47.7%±2.3%, 55.2%±2.2% for the CM groups, respectively.  2.3.1.3 PGRN conditioned medium was not able to protect against oxidative stress induced 0 in neuron cultures. 2 by H To investigate the function of PGRN in hydrogen peroxide induced cell death, 4OuM 0 was coincubated with various concentrations of progranulin conditioned medium for 24 2 H hours. MTT assay results revealed that the progranulin CM showed a concentration dependent manner of protective effect (Figure 2.4). Without PGRN CM, the cell viability under 4OuM 0 insult was 40.5%±4.8%, while the corresponding cell viabilities to various concentrations 2 H  22  of PORN CM from 272.5ng/mL to 2180ng/mL were 45.8%±O.6%, 54.l%±5.7%, 77.O%±O.l%, 79.5%±4.7%, respectively. However, we found the same protective effect could be induced by the pcDNA3.l empty vector transfected conditioned medium (EV CM), which also showed a concentration dependent protective manner, and there was no significant difference of cell death between the EV conditioned medium and PORN conditioned medium bathed neurons. Thus, we conclude that the protection effect against oxidative stress is not due to progranulin activity, but because of some unknown factors which were secreted by the HEK 293T cells.  2.3.2 Overexpressing PGRN in neuronal cells does not protect neurons from oxidative stress The PORN conditioned medium seemed protective cortical neurons from H202 toxicity in the above experiments. To further clarify if the protection was due to the HEK 293T secreted factors or PORN itself, we overexpressed PORN in mouse cortical neurons which were difficult to transfect, by lentivirus infection. The lentivirus vector carrying PGRN fusion gene was made (FUW-PORN), and the vector carrying GFP gene was applied as negative control (FUW-GFP). The neurons were infected with virus for five days, and the protein levels in cell lysates and culture medium were all dramatically increased from the immunocytochemistry (Figure 2.6) and western blotting analysis results (Figure 2.7). After the five days’ infection, 4OuM H202 was added into neuronal cell cultures for 24 hours and cell viability was evaluated by MTT assay (Figure 2.8). The results showed that the increasing of endogenous PGRN level could not save neurons from oxidative stress, as well as the exogenous PORN from conditioned medium.  23  2.4 Discussions  The present study was designed to determine whether overexpression of Progranulin (PORN) protein levels prevents cell death from different insults. Under different circumstances including 25uM aggregated beta-amyloid, 5OuM NMDA (plus lOuM glycine as coagonist), 4OuM 2 H all of which can lead to a cell death greater than 50%, PORN at several different , 0 concentrations did not show any protective effect. According to other work from our lab (unpublished data), the half life of PORN is around 12 hours at 37 °C. Bateman et al. also indicated that there was no degradation detected in PGRN conditioned medium which was collected over 24-hour period from HEK 293T cells (He & Bateman 1999). The time of PGRN conditioned medium coincubated with cortical neurons was 24 hours maximum in the experiments, thus the non-protective effect of PORN was not likely due to the degradation of the protein. He et al. found that, mM PORN protein was enough to enhance the invasive capacity of SW-13 cells (He et a!. 2002). PGRN concentration in the conditioned medium we utilized ranged from 272.5ng/uL to lO9Ong/uL, much more than mM for biological activity induction, ruling out the possibility that the non-protective effect was due to a sub-threshold dose of progranulin. The biological activities of Progranulin protein in conditioned medium was tested and proved on wound healing experiments, following the experimental design of Zanocco-Marani et al ((Zanocco-Marani et al. 1999).  The PORN mutation was firstly identified in Frontotemporal lobar degeneration (FTLD) (Baker et al. 2006, Mackenzie et a!. 2006), followed by the discoveries of the mutation  24  in some other neurodegenerative diseases, e.g. Alzheimer’s disease (AD) (Brouwers et a!. 2007, Cortini et a!. 2008), and Parkinson’s disease (PD) (Rovelet-Lecrux et al. 2008). The pathological features of the patients were all characterized by reduction level of functional progranulin protein. Moreover, the spinal cord of some patients with Creutzfeldt-Jakob disease (CJD) (Baker & Manuelidis 2003) and ALS (Malaspina et al. 2001) showed a 400% increase of PGRN expression, which was considered to be due to the activated microglia in the region. However, for the in vitro cell death models, that we established and utilized in the experiments, such as aggregated beta-amyloid (AD model), NMDA excitotoxicity (ischemic stroke model) and H 0 (oxidative stress), both adding progranulin protein and overexpressing PGRN had no 2 protective effects against cell programmed cell death. It is possible that progranulin plays a crucial role in the neuro-developmental process since the neurodegenerative diseases are all chronic, which could explain why PGRN protein level enhancement shows no resistance to the acute neuronal injuries in the in vitro cell death models. High PGRN expression was already found during the CNS development in neuroepithelial cells in the embryo (Daniel et al. 2003, Austin & Cepko 1990).  The mechanism by which progranulin works in the cases of  neurodegenerative disease is obviously different from the wound healing response experiments, in which PGRN functioned as a growth factor and the addition of progranulin to the injury zone enhances neovascularisation and prolonged the infiltration of neutrophils and macrophages (He et al. 2003, Zhu et al. 2002).  The normal progranulin distribution in our experiments was found predominantly in the cytosol and dendrites of neurons. These observations are consistent with clinical findings  25  (Eriksen & Mackenzie 2008). The appearance of progranulin in dendrites may suggest a neurotrophic role or a function in cell-cell communication by the neurites, and it has been demonstrated that the neurons lack progranulin show fewer and sparer dendrites and synapses (unpublished data from our lab). Additionally, decreased expression of PORN leads to redistribution of TDP-43 protein from nucleus to cytoplasm, which has been reported in both in vivo and in vitro cases (Neumann et al. 2006, Zhang et a!. 2007, Davidson et a!. 2007). It is still unclear that how PORN and TDP-43 affect each other in the cell, since there is still no clear evidence proving the two proteins interact directly. A recent finding from a large Dutch cohort reported that TDP-43 pathology could be present even without progranulin mutation (Seelaar et a!. 2007), which suggested that PORN mutation may not be completely responsible for FTLD-U neurodegeneration symptoms. However, in all situations, a loss of TDP-43 normal nuclear function might be relevant to the diseases as the protein was found to be a transcription repressor which acts to activate exon skipping at the very beginning (Buratti et al. 2001, Wang et a!. 2004, Mercado et al. 2005).  It is interesting that we found that the HEK 293T cell conditioned medium (even without progranulin) could prevent cell death from oxidative stress caused by H . The 0 2 possible reason could be some other factors secreted by HEK 293T cells under stress. Since it is not relevant to the main topic we study in the whole project, the issue is not considered further here.  26  ______  Figure 2.1 Study design of Chapter 2 (neuroprotective effects of progranulin)  Neuroprotective effects of Progranulin on mouse cortical neurons  Coincubated with CM (collected from PGRN  1 L:::::1— Exogenous PGRN effect:  ium’ 24 hours  4OuM H202 Recovery CM in (collected from PGRN overexpressed HEK  MTT assay  MDA  Endogenously over-expressed PGRN effect:  Mouse cortical neuronal cultures  Infected by FUW-PGRN packed ifl lentivinis  4OuM H202 MTT assay  5 days  27  Figure 2.2 Calibration of progranulin proteins in conditioned medium with recombinant PORN protein. (A) Different concentrations of recombinant PORN protein and PORN conditioned medium were investigated by immunoblotting. Progranulin concentration curve was established as the blue line shows (B), according to the concentration to western blotting intensity. The concentration of progranulin in conditioned medium was calculated from the black trend line in (B) and the value is 4.36±O.44ng/uL.  PORN recombinant pwtern  A  lug  2ug  4ug  ug  PORN CM 25uL  5OuL  .  B  CM PGRN protein calibration curve 8000 7000 6000 V .E 5000 4000 EV 3000 2000 1000 0 0  50  100  150  200  ng  28  Figure 2.3 Progranulin conditioned medium does not protect mouse cortical neurons from 25j.ig Amyloid-beta toxicity. Aggregated amyloid-beta 25 .tM coincubated with different 1 concentrations of Progranulin conditioned medium for 24 hours in mouse cortical neuron culture, and cell death was evaluated by MTT assay. All the treatment groups showed a >35% cell death compared to the control group.  25 jiM amyloid beta treatment 1.2  F  1 0.8 1-  >  • 0.6  -  a) 0  0.4 H 0.2  F L 0 con  0  272.5ng/j.tL  545ng/jiL  lO9Ong/j.tL  0 amyloid beta 1-40 I scramble peptide  29  Figure 2.4 MTT analysis of progranulin conditioned medium effect on NMDA-induced excitotoxicity. MTT assay were performed to determine the cell viability rate following NMDA 5OuM treatment 1 hour, and recovery in progranulin conditioned medium 24 hours. Various concentrations of progranulin conditioned medium did not show any protective effect on cortical neurons from NMDA-induced toxicity, which was able to cause cell death up to 50%. Glycine acted as a co-agonist with NMDA and MK8O1 3uM was able to abolish the NMDA-induced cell death.  50 jiM NMDA treatment  1 p<o.O 1.4  r  1.2  O.8  O.4 0.2 0 con  0  D NMDA 50.tM,Gly 2OjiM  272.5ng/jiL  545ng/j.tL  lO9Ong/jiL  2180ng/j.tL  NMDA 5OiM,G1y 2OiM, MK8O1 3iM 0 Gly 20 .tM 1  30  Figure 2.5 Progranulin conditioned medium was not protecting neurons from hydrogen peroxide (H ) toxicity. To induce oxidative stress, different concentrations of progranulin 0 2 conditioned medium were coincubated with 4OuM H 0 for 24 hours. MTT assay analysis 2 revealed that 4OuM H 0 could lead to 50% cell death, and the cell viability showed a 2 dose-dependent manner with the concentrations of progranulin in culture medium. However, the cell viability also showed the same pattern when H 0 was coincubated with pcDNA 3.1 2 empty vector conditioned medium.  H202 1 40 i M treatment 1.2  p<0.o1  —  l . 0 p< -  p< 0 . 0 5  1—  0.8  -  0.6’ C)  0.4  I  0.2’  0 con  0  272.5ng/j.iL  • PGRN CM  545ng/.tL  1090ngiL  2180ng/iL  • Empty Vector CM  31  Figure 2.6 Immunofluorescence was carried out using mouse cortical neurons expressing endogenous and overexpression progranulin and analyzed with confocal microscopy. DAPI was used to stain the nucleus (blue), MAP2 was used to label the dendrites (green). The expression of PGRN staining was detected with the sheep polyclonal anti-PGRN antibody and stained as red. PGRN in neurons mostly localized in cytoplasm and some appeared in dendrites as the merged image showed (D). After lentivirus infection which persistently expresses progranulin protein in mouse cortical neurons, immunofluorescence was carried out and analyzed with confocal microscopy (E), showing stronger PGRN expression.  E  32  ______  Figure 2.7 Western immunoblotting analysis of progranulin expression after virus infection in mouse cortical neurons. Robust overexpressions of progranulin were shown in both cell lysate (appeared around 7OkDa) and culture medium (around 9OkDa).  Cell lysate +virus  9OkDa  7OkDa  Culture medium +vjnj  —  Mouse cortical neuron  33  Figure 2.8 Overexpressing PGRN in mouse cortical neurons is not protective from 4OuM H202 toxicity. After neuronal cultures were infected by lentivirus carrying PGRN fusion gene for 5 days, cells were treated with H 0 for 24 hours and then MTT assay was performed to 2 evaluated cell death. Neurons infected with lentivirus carrying FUW-GFP was used as a negative control.  H202 4OuM treatnnt (*us infcted)  1.4 1.2 1 0.8 0.6 0.4 0.2 0 blank control  FUW-GFP inicted  FUW-PGRN infected  N/A •H2O2  34  CHAPTER 3: N-GLYCOSYLATION STUDY OF PGRN 3.1 Introduction  3.1.1 N-glycosylation introduction Human progranulin was identified as a heavily glycosylated protein with five potential N-glycosylation sites and no 0-glycosylation sites (Figure 3.3) (Vijaya et al. 1991). The purified  progranulin  (PC  cell-derived  growth  factor,  PCDGF)  obtained  from  PC  cell-conditioned medium appeared as 88 kDa. After digestion with peptide-N-glycosidase F, a 68 kDa PGRN band was identified, indicating that PGR1’ was a glycoprotein containing about 2OkDa of carbohydrate (Zhou et al. 1993). Most eukaryote proteins undergo co- and/or post-translational modifications (PTMs). It is a covalent processing event that changes the protein by either proteolytic cleavage or by adding one or more amino acids as a modifying group. PTMs include phosphorylation, glycosylation, ubiquitination, attachment of fatty acids, and so on. Knowledge of these modifications is extremely important, because PTMs can modulate physical and chemical properties of protein, such as protein folding, conformational distribution, activity state, localization, turnover, and interactions with other proteins (Mann & Jensen 2003). Among the various types of modifications, none is as common and diverse as glycosylation. The glycans attached to the proteins consist of three distinct types: 0-linked glycosylation on serine or threonine (Hounsell et a!. 1996), N-linked glycosylation of asparagines within the consensus sequence Asn-Xaa-Ser/Thr (Herscovics & Orlean 1993), and glycosyiphosphatidyl inositol derivatization of the carboxyl-terminal carboxyl groups (Takeda & Kinoshita 1995).  35  The N-linked glycosylation is by far the most common (Nalivaeva & Turner 2001) and since only N-glycosylation sites exist in the PGRN sequence (Vijaya et al. 1991), the N-glycosylation became our research target. For mature glycoproteins, when initially synthesized in the ER, the core glycans (GlcNAc2Man9Glu3) are homogeneous and relatively simple. All N-linked oligosaccharides originate from a common lipid-linked oligosaccharide (LLO) precursor, synthesized in the endoplasmic reticulum (ER) on a dolichol-phosphate (Dol-P) anchor. The oligosaccharide precursor synthesize begins on the cytosolic side of the ER membrane by adding sugars one by one to the DoI-P. After two N-acetylglucosamines and five mannoses are added, the oligosaccharide flipped to the luminal side of ER membrane, and further seven sugars including 4 mannoses and 3 glucoses are added. After completing of the 14-sugar structure, the oligosaccharyltransferase enzyme complex catalyzes the transfer reaction of the core oligosaccharide to the asparagines residues within the consensus sequence (Asn-Xaa-Ser/Thr) of the nascent, growing polypeptide chains. The three glucoses are then trimmed away by glucosidase I and II. The structure is then subject to the action of a series of mannosidases that remove some or all of the four mannose residues. Processing firstly occurs in the ER and continues in the cis portion of Golgi apparatus. Such glycans containing between five to nine mannose residues, are called high-mannose oligosaccharides while other glycans are further processed to more complicated structures. The 5 Man structure receives a GlcNAc residue, which can be either substituted with Gal and NeuAc and form a hybrid oligosaccharide (one unmodified Man branch and one modified, asymmetric) or continue in the biosynthetic pathway to form complex oligosaccharide. Complex glycans are ultimately built on a core that consists of three mannose residues and two G1cNAc residues and this structure serves as substrate for  36  additional fucosylation, galactosylation and sialylation reactions (Ekiund & Freeze 2005, Yarema & Bertozzi 2001, Helenius & Aebi 2004). Thus, in ER, the trimming and processing are shared by all glycoproteins. The structure diversification is not introduced until the glycoprotein reaches the medial stacks of the Golgi complex (Helenius & Aebi 2001). N-linked glycosylation is often vital for protein folding, oligomerization, stability, quality control, intracellular transport, secretion and functional activity (Branza-Nichita et al. 2004, Groves & Tanner 1994). One of the most important roles of N-linked glycans is the promotion of proper folding of nascent synthesized polypeptides in the endoplasmic reticulum (Paulson 1989, Helenius 1994). This eukaryotic adaptation of glycan function allows cells to produce and secrete larger and more complex proteins at higher levels. It also explains why the addition of N-linked glycans must occur cotranslocationally in the ER (i.e., before the folding process has begun). Inhibition and/or suppression of glycosylation usually lead to the generation of misfolded, aggregated proteins that fail to reach a functional state. The misfolded proteins are retained in the ER due to not passing ER quality control and eventually are degraded (Hurtley & Helenius 1989). Many pieces of evidence have demonstrated that, although N-linked glycans promote proteins folding, removal of the glycan from the folded protein has no effect on its activity but its stability and folding kinetics are changed (Helenius 1994, Mitra et al. 2003). The importance of the added oligosaccharides differs among proteins and relies on the physiological context. Some glycans are crucial for the correct protein folding, whereas many display no dependence on the glycans at all. Studies performed using peptides suggest that although an N-linked glycan does not induce permanent secondary structure, it alters the conformational preferences close to the glycosylation site, resulting in more compact conformations (Wormald & Dwek 1999).  37  Some glycans attached to proteins are important for protein biological activities and functions. For instance, abolishing glycosylation of the heparin sulfate endosulfatases Sulfi, a cell-surface enzyme that controls growth factor signalling, affects its enzymatic activity, membrane targeting and secretion (Ambasta et a!. 2007). N-linked glycan is also reported important in protein intracellular transport. As in the case for the relaxin receptor, RXFP 1, which is a member of the leucine-rich repeat-containing G-protein-coupled receptor family, N-glycosylation is essential for the transport of the receptor to the cell surface and the conformational changes required for G-protein coupling and subsequent cAMP signalling (Yan et a!. 2008). Moreover, N-glycan plays a role in protein oligomerization. For example, the present study has demonstrated that N-linked glycan sites direct heterodimer vs. homodimer assembly in inhibin!activin (TGF43 superfamily) dimmers (Antenos et al. 2007). Since the endoplasmic reticulum is where the N-glycosylation takes place in the first steps, the proteins which are glycosylated improperly are probably misfolded and accumulated, leading to activation of genes responsible for the ER quality control system and ER stress. To overcome ER stress, the unfolded protein responses (UPR) is utilized by mammalian cells. Three pathways are triggered by UPR: inhibiting protein translation to prevent the generation of more unfolded proteins; facilitating of refolding of misfolded proteins by the induction of gene expression of ER chaperone proteins; and activation of ER-associated degradation (ERAD) system to retrotranslocate the misfolded proteins into cytosol for degradation through the ubiquitin-proteasome dependent pathway (Shen et al. 2004). However in the events when UPR strategies are not successful, the persistent ER stress may put cells go into ER stress-induced apoptosis (Kincaid & Cooper 2007, Zinszner et a!. 1998). The UPR induced ER stress signalling pathway involves three important transmembrane receptors: pancreatic ER kinase  38  (PKR)-like kinase (PERK), activating transcription factor 6 (ATF-6) and inositol-requiring enzyme 1 (IRE 1) (Szegezdi et al. 2006).  BiP (immunoglobulin heavy chain binding protein),  [also known as glucose-regulated protein 78 (GRP78)J, a member of the heat shock protein 70 (HSP7O) family that residues in ER lumen as an important chaperone, binds the luminal domains of these receptors to keep them inactivated. But under ER stress, BiP dissociats to help protein folding, followed by the activation of these ER sensors, leading to UPR. Several reports suggest BiP involvement in ER stress under a number of conditions, including ischemia (Paschen 1996, Benavides eta!. 2005, Rissanen et at. 2006), brain trauma (Paschen eta!. 2004), Parkinson’s disease (Imai et a!. 2001, Ryu et a!. 2002) and Alzheimer’s disease (Nakagawa et at. 2000). Pieces of evidence have demonstrated the crucial role of BiP in regulating the ER stress response and measuring the content of unfoldedlmisfolded proteins within ER (Shen et a!. 2002a, Shen et a!. 2002b).  3.1.2 Aims of this chapter: In this chapter, the posttranslational modification, N-glycosylation of progranulin is investigated. The aim of this study is to better understand the N-glycosylation status and significance to pro granulin protein.  39  3.2 Methods  3.2.1 Study design HEK 293T cells were transfected with pcDNA3 .1 -PGRN plasmids to overexpress progranulin protein. To demonstrate the N-linked glycans attached to PGRN, enzymes PNGase F and endo H were applied to digest both cell lysates and culture medium from PGRN overexpressed HEK 293T cells. The N-glycosylation pathway blocker, tunicamycin, was used to abolish the N-glycan attachment. To further study the specific N-glycosylation site occupancy and significance, site-directed mutagenesis was used to generate the single-site mutants and multiple-site mutants, which were then transfected into HEK 293T cells and detected by western blotting. To examine the N-glycosylation secretory pathway and the mutant protein distribution pattern, the four-site N-glycosylation mutant and the wild type were overexpressed in COS-7 cells and inimunocytochemistry was performed. The effects of the mutant protein induced were evaluated by examine the expression of BiP level in PGRN mutant/wild type overexpressed HEK 293T cells. 3.2.2 Cell cultures Four human cell lines: embryonic kidney HEK 293T cells, breast cancer MCF-7 cells, neuroblastoma SHSY-5Y cells and glioblastoma U373 cells, and a monkey cell line: COS-7 cells were obtained from the American Type Culture Collection. The cell lines were cultured following the instructions from the American Type Culture Collection in DMEM containing 10% fetal bovine serum and 1% antibiotics.  40  3.2.3 Western immunoblotting Please refer to Chapter Two Method section for the complete procedures. Human progranulin antibody (1:1000, polyclonal, R&D System), Actin antibody (1:2000, monoclonal, Cell Signalling), Bip antibody (1:1000, polyclonal, abCam, Cat #ab2 1685), and anti-sheep HRP (1:2000, Santa Cruz), anti-rabbit HRP (1:2000, Cell Signalling) were used. 3.2.4 Immunocytochemistry Please refer to Chapter Two Method section for the complete procedures. Anti-calnexin (1:2000, monoclonal, Sigma, Cat#C473 1), anti-hPGRN (1:250, polyclonal, R&D System), and Alexa 488 anti-rabbit, Alexa 546 anti-sheep were applied. 3.2.5 Transfection: calcium phosphate system; Lipofectamine 2000 system Please refer to Chapter Two Method section for the complete procedures. 3.2.6 Quantitative RT-PCR (qRT-PCR) for measurement of mRNA Following treatment, cells in 6-well plate were homogenized in 1 mL Trizol reagent (Invitrogen, Carlsbad, CA) at room temperature for 5 minutes and transferred into 1 .5mL tubes. 0.2mL of chloroform per mL of Trizol was added to each tube and the tubes were hand-shook for 1 5sec.  The aqueous phase (top phase) containing RNA was obtained by centrifuging the  samples at 1 3krpm for 1 5mm at room temperature.  0.5mL of isopropanol alcohol per mL of  Trizol was then added to each tube containing the aqueous phase. hand and incubated at room temperature for 1 0mm. centrifuging at 1 3krpm for 1 0mm at 4°C. 75% ethanol in DEPC-treated water.  Tubes were shook gently by  RNA pellets were obtained by  Supernatant was removed and pellet washed with  Samples were then mixed by vortexing followed by  41  centrifuging at 7500rpm for 5mm at 4°C.  Finally, RNA pellet was air dried and dissolved in  RNase free water by incubating samples at 5 5-60°C for 10mm.  RNA samples were stored at  -80°C. Possible contaminated DNA in the RNA samples were removed by treating with DNase I (Invitrogen, Cat #18068-015) at room temperature for 15mm, followed by the inactivation of DNase I with 2.5mM EDTA at 65°C for 10mm.  One microgram of the  DNA-free RNA RNA was used to synthesize first-strand eDNA using a SuperScript II RT kit (Invitrogen, Cat #11904-018) according to the manufacturer’s protocol. The eDNA samples were stored at -80°C. For real-time PCR analysis, eDNA samples were diluted and 2uL of each dilution was added to 96-well real-time PCR plates along with 23uL of master mix containing 12.5uL SYBR Green (ABM, Richmond, BC), 0.75uL of lOuM mixed primers and 9.75u1 DEPC-treated water. The plates were then read by ABI 7000 Real Time PCR machine.  For a list of real time PCR  primers, see Table 3.1. 3.2.7 Enzymatic deglycosylation of Progranulin To remove the N-linked sugar chain from PORN protein (recombinant protein purified from 293T culture medium), the protein was treated by glycopeptidase F (PNGase F, NEB Cat# P0705S) and endo H (NEB, Cat # P0702S) under denaturing condition. 1 Oug PGRN protein with denaturing buffer was boiled for 10 minutes at 1 OOC, and then NP4O and G7 buffer were added and coincubated with 2uL PNGase F enzyme for 2 hours; or G5 buffer was added and coincubated with 3uL endo H enzyme for 2 hours. The products were analysed by western blotting.  42  3.2.8 Inhibition of glycosylation pathways 293T cells transfected with wild-type progranulin were grown in 6-well plates in DMEM. After transfection 4 hours, tunicamycin (Sigma, 1 mg/mL stock solution in DMSO) was added to a final concentration of 5ug/mL. These cells were incubated for an additional 24 hours and harvested for analysis. 3.2.9 Site-directed mutagenesis For each mutant, the asparagine in the Asn-X-Ser/Thr consensus sequence was changed to glutamine using a GeneTailor Site-Directed Mutagenesis system (Invitrogen, Cat# 12397-014). The pcDNA3.1-PGRN plasmid was used as the template, and nucleotide changes were introduced by two complementary oligonucleotide primers (refer to table 3.2) harbouring a desired mutation. The presence of each mutation was verified by NAPS sequencing (UBC facility). 3.2.10 Statistical analysis All data were expressed as Mean +1- SEM, and the Student’s t test was used to examine the statistical significance of the differences between groups of data. It was considered significant when • 005 <  *  indicates p<0.O5, while  **  indicates p<O.Ol. For all experiments,  data was obtained independently for at least 3 times.  43  3.3 Results  3.3.1 Expression and secretion of hPGRN To define whether hPGRN could be secreted into extracellular medium, recombinant plasmid pcDNA3.1-hPGRN was transiently and stably transfected into HEK 293T cells. Not surprisingly, hPGRN could be detected by western blotting in both cell lysate (CL) and culture medium (CM) (Fig.3.2), demonstrating that hPGRN indeed encodes a secretory protein. However, approximately 20 kDa molecular difference of hPGRN between in CL and CM was shown as previous reported (Zhou et al. 1993), suggesting the posttranslational modification could be pivotal process during the secretion of hPGRN. According to Shankaran et al., (Shankaran et al. 2008), the posttranslational modification is mostly a glycosylation process.  3.3.2 Enzymatic digestion of PGRN According to Bhandari et a!., (Bhandari et a!. 1992), and an online N-glycosylation site prediction  program  (www.cbs.dtu.dk/serviices/NetNGlyc),  there  exist  five  potential  N-glycosylation sites but no 0-linked glycosylation sites within the progranulin protein (Figure 3.3). To define the issue, N-glycosidase F (PNGase F) and endoglycosidase H (endo H), which could cleave all the N-linked oligosaccharide structures from Asn residues, as well as chitobiose core of high mannose and some hybrid oligosaccharides from N-linked glycoproteins, respectively, were employed in the same experiments. Mature wild-type PGRN which was released to the culture medium was detected as a 9OkD protein, while intracellular PGRN was  44  identified as 68kD as previously reported (Zhou et al. 1993). Treatment of PORN from culture medium and cell lysate with PNGase F or endo H all showed a band with smaller molecular weight (Figure 3.2). This change in molecular mass suggests that multiple sites of PORN are glycosylated.  3.3.3 Blocking N-glycosylation prevents PGRN secretion To eliminate PORN glycosylation, after transiently transfection with plasmid pcDNA3.1-hPGRN, HEK 293T cells were grown for 24 hours in the presence of 5ug/mL tunicamycin, a general N-glycosylation inhibitor. After tunicamycin treatment, PORN could not be detected in the culture medium by western blotting. Additionally, in cell lysate, PORN migrated at the same position as it did from samples in which N-linked sugar chains were cleaved by either PNGase F or endo H treatment, the molecular weight appeared to the approximately 6OkD, which indicated the lack of N-glycosylation (Figure 3.4). This observation suggests that N-linked glycosylation of PORN is blocked by tunicamycin, and the presence of the N-linked oligosaccharide chain on PGRN is thus necessary for its efficient secretion, while the nonglycosylated protein is retained intracellularly.  3.3.4 Each of the single-site N-glycosylation mutants is functionally expressed and secreted The non-secretion of PORN in HEK 293T cells after tunicamycin treatment could be caused non-specifically, since tunicamycin is a general N-glycosylation inhibitor. To specifically study the role of individual N-glycosylation sites of PORN and to examine the  45  relative contributions of oligosaccharide chains at these predicted sites to PGRN secretion, five N-glycosylation single-site mutants were constructed (Table 3.3). In each of these mutants, the asparagines residues in the N-glycosylation consensus sequences were replaced by glutamine. The plasmid DNA sequences of all constructs were confirmed by NAPS sequencing (UBC facility). Each of the mutants was transfected into HEK 293T cells for 24 hours, and the cell lysates and culture medium were collected for western blotting. For all the mutants, no molecular mass shift could be observed for the intracellular PGRN compared to the wild type (Figure 3.5), and all of them were efficiently secreted into the medium (Figure 3.6). These results clearly indicate that none of the five individual N-linked oligosaccharide chains is necessary for PORN secretion, and correct overall folding.  3.3.5 Importance of the carbohydrate chain on efficient secretion of PGRN To further study the N-glycosylation status of PORN, one double-site mutant (PGRN5 1), two triple-site mutants (PORN 512, 513), one quadruple-site mutant (PGRN5 123) and a five-site mutant (PGRN5 1232) were constructed by site-direct mutagenesis (Table 3.3). After 24 hours of transient transfecction in HEK 293T cells with these mutants, cell lysates and culture medium were collected for western blotting examination. Elimination of two or more sites showed different decreasing of molecular weight of intracellular PORN, suggesting some lack of N-glycosylation. For the three site and four site mutants, the intracellular PORN which were not glycosylated functionally were retained and accumulated, as the western blotting results showed 1.8 fold, 2.8 fold and 3.1 fold enhancement comparing to wild type for PORN 512, 513, 5123, respectively (Figure 3.7). However, when all the five potential N-glycosylation  46  sites were mutated (PGRN5 1232), no intracellular PGRN protein could be detected by western blotting. To understand if the lack of PGRN protein was due to malfunctioning of mRNA synthesis, real-time PCR was applied to examine the PGRN5 1232 mRNA level. As Figure 3.8 shows, after 24 hour and 48 hours, mRNA levels of the PGRN5 1232 mutant were similar to the wild type PGRN, which indicates that the lack of protein was not an mRNA synthesis issue. In addition, the secretion level of multiple N-glycosylation site PGRN mutants in culture medium were reduced compared to wild type. A clear molecular weight decrease was observed when three sites were mutated. the corresponding progranulin secretion levels were decreased to 50.1%, 59.9%, 34.2%, 1.6% for PGRN 51, 512, 513, 5123, compared to wild type. For the four and five site mutants, nearly no secretion could be detected by western blotting. All the results suggest the carbohydrates are vital for PGRN secretion. Statistical Analysis revealed that when three or more (except for the five-site mutant) N-glycosylation sites were mutated, the mutant PGRN protein was retained intracellularly and accumulated significantly compared to the wild type (Figure 3.10). In culture medium, all the mutants showed a great decrease of PGRN secretion, especially for the four-site mutant PGRN5 123, of which the protein can hardly be detected (Figure 3.11).  3.3.6 Secretion pathway of PGRN and the mutant showing the same pattern Generally, the secreted glycoprotein is transported through the endoplasmic reticulum (ER) to Golgi apparatus, and then secreted extracellularly. To determine whether the mutant PGRN  protein  exhibits  different  subcellular  localization  from  the  wild  type,  47  immunocytochemistry was carried out. Anti-calnexin antibody was applied to mark the ER (green color). The polyclonal anti-human progranulin antibody was used to mark PGRN (red color). Confocal microscopic images revealed that both mutant and wild type PGRN protein were co-localized with calnexin in the ER (Figure 3.12), suggesting a classic secretory pathway. And the mutant protein showed the same distribution pattern as the wild type.  3.3.7 Increased BiP protein expression when multiple N-glycosylation mutant PGRN are over-expressed 24 hours after overexpressing multiple N-glycosylation mutants and wild type PGRN in HEK 293T cell, the BiP/GRP78 (immunoglobulin heavy chain binding protein) expression of PGRN mutants were increased compared to the wild type (Figure 3.13). For PGRN512 and PGRN5 1232, the increase of BiP level was significantly different from the wild type (p<O.O5 for PGRN5 12,  p<O.Ol  for PGRN 51232). Since BiP is an ER stress sensor, the increased level  of BiP, indicates the ER stress induction and possible misfolded/unfolded protein accumulation in endoplasmic reticulum. Taken together, the malfunctioning of N-glycosylation of PGRN results in the accumulated misfolded protein retained in ER, leading to ER stress.  48  3.4 Discussions The aim of this study was to determine the importance of the post-translational  modification, N-linked glycosylation, to progranulin. The evidence that PGRN is a glycoprotein was reported approximately 20 years ago (Vijaya et al. 1991, Zhou et al. 1993). However, the details of how PGRN is glycosylated and the significance of this modification to PORN are still unaddressed. Our results showed a 20 kDa molecular mass increase of secreted progranulin compared to the intracellular species. (68 kDa for PORN in cell lysate; 88 kDa for PGRN in culture medium). The enzymatic digestion of PGRN from cell lysate and culture medium with both PNGase F and Endo H treatments led to a band of identical size, indicating that the 20 kDa molecular weight difference was derived from N-glycosylation. Endo H is an endoglycosidase which is able to hydrolyze high-mannose and hybrid-type of N-glycans, whereas PNGase F is an asparagine amidase that cleaves all types of N-glycans including high-mannose, hybrid-type and complex-type. The identical size of PORN after the enzymatic treatments indicates that the sugars attached to progranulin are high-mannose and/or hybrid-type. The addition of tunicamycin to cultured HEK 293T cells which were transiently transfected with pcDNA 3.1 -PORN plasmids resulted in the PGRN protein being retained intracellularly and completely blocked its secretion. Tunicamycin is a naturally occurring antibiotic that inhibits the enzyme GlcNac phosphotransferase (OPT). Interestingly, the retained PGRN showed a smaller molecular mass compared to the wild type, indicating PGRN is modified by N-glycosylation to some extent intracellularly even before being secreted. The tunicamycin studies demonstrate the essential role of N-glycans to PORN secretion.  49  However, since tunicamycin blocks every glycoprotein in the cellular system, we could not deduce that the PGRN secretion abolishment was due to lack of glycosylation of PGRN itself rather than other proteins. According to the online N-glycosylation site analysis tool and the reported data (Vijaya et al. 1991), five glycosylation modification sites on PGRN were predicted. To investigate the importance of PGRN oligosaceharides and further study its specific N-glycosylation sites, five single site-mutagenesis mutants were made. Mutation from asparagine to glutamine simply replaces the noncharged polar sugars with a smaller noncharged polar glutamine, thus the change is steric in nature. From the results of our experiments, the single N-glycosylation site mutants did not impair expression or secretion. The minor size shifts of the PGRN mutants with different glycosylation status are hard to detect, because the N-linked glycochain on each site only contributes up to 3.5 kDa to a protein (Ambasta et al. 2007, Yan et al. 2008). These data suggest that none of the individual N-glycosylation sites are critical for PGRN secretion and correct overall folding. The accurate occupancy of the individual N-glycosylation site is going to be analyzed by our collaborators in Biological Science Institute in National Research Council, and the results will come out in the near future. To further investigate the combined effects of the mutations of multiple glycosylation sites, multiple N-glycosylation site mutants were constructed by site-direct mutagenesis. For all the multiple-site constructs (except for PGRN5 1232), the intracellular and culture medium PGRN showed a decreased molecular mass, suggesting the existence of N-glycans on these sites. The intracellular PGRN of triple and quadruple-site mutants are retained and accumulated, whereas, the corresponding progranulin secretion levels are decreased compared to wild type. The effect of elimination of four of the N-glycosylation sites led to very low secretion levels of mutant PGRN. Surprisingly, nearly no intracellular progranulin protein could be detected, either  50  intra or extracellularly when all the N-glycosylation sites were mutated. The mRNA expression of the mutant remained the same level as did wild type. It is well-known that the oligosaccharyltransferase is responsible for transferring the 14-sugar core oligosaccharide from the dolichylpyrophosphate carrier to the N-glycosylation sequence of the growing, nascent polypeptide chain emerging from the translocon, so that the sugars can help the polypeptide fold correctly and target the appropriate intracellular location (Silberstein & Gilmore 1996, Bause 1983, Imperiali & Rickert 1995, Helenius & Aebi 2001). In most cases, N-glycosylation does not induce a permanent secondary structural change, but prompts local conformational changes close to the glycosylation sites, often a  13 turn, resulting in more compact conformation  (Helenius & Aebi 2002, O’Connor & Imperiali 1996, Mitra et al. 2006). In the case of the five-site N-glycosylation mutant PGRN5 1232, the absence of the protein could be due to the rapid degradation as lack of N-linked glycans, the protein could not correctly fold and might lose its stability. Since all the five N-glycosylation sites are in or very close to the regions at where elastase cleaves progranulin into granulins (Figure 3.3), the N-linked oligosaccharides of PGRN may play an important role in protecting progranulin from the proteolytic cleavage. The function of the carbohydrate groups protecting proteins against proteolysis is well documented (Lis & Sharon 1993). Although the glycosylation status of the quadruple-site mutant has been greatly changed and not secreted any longer, the protein distribution pattern in the ER is still similar to that of the wild type from the immunocytochemistry results in C057 cells. These data suggest that adding N-glycans to PGRN is not necessarily site-specific. For the mature progranulin protein (88 kDa species), lacking three or more sites of N-glycosylation is enough to affect its correct folding to reach the cellular membrane. Misfolded glycoproteins are retro-translocated  51  to cytoplasm for degradation by ERAD system. But not all misfolded/unfolded proteins are retained in ER. Some exit ER and traffic to the Golgi apparatus, and are efficiently degraded dependent on ER-Golgi trafficking (Le et al. 1990, Caidwell et al. 2001, Zhou et al. 2008). This may also explain the similar pattern of the mutant PGRN showing in the ER. To process correctly folding of glycoproteins, ER requires an efficient system of molecular chaperones. Improperly folded proteins accumulated in ER result in ER stress and eliciting the unfolded protein response (UPR) (Ellgaard & Helenius 2001, Kaufman 1999, Mori 2000). To further investigate whether the retained N-glycosylation mutant PGRN protein in HEK 293T cells triggers the ER stress, we examined an ER chaperone, BiP protein expression level. As an integral component of the ER stress response system, BiP retains unfolded/misfolded proteins in this compartment (Hammond & Helenius 1995, Gulow et al. 2002). This ER-chaperone plays the key role as an ER-stress sensor (Dorner et al. 1992, Leborgne-Castel et a!. 1999, Little & Lee 1995, Morris et a!. 1997).  And it has been reported  that UPR was first characterized as an up-regulation of BiP at the transcriptional level, induced by the accumulation of misfoldedlunfolded proteins in the ER (Kozutsumi et al. 1988, Kohno et a!. 1993). We found that the mutant PGRN512 and PGRN5 1232 protein expression triggered BiP protein up-regulation, suggesting a UPR induction and the presence of misfoldedlunfolded protein. However, while PGRN5 12 protein could be detected intracellularly, PGRN5 1232 was not found. It is possible that the induction of BiP protein expression were regulated by some other down-stream protein activations triggered by the mutant PGRN protein overexpression, and for the two mutants, the up-regulation of BiP went through different pathways. Taken together, these data indicate that lack of N-glycosylation of PGRN will lead to intracellular protein retention and ER stress. Thus, unexpectedly, the ER stress induction provides a novel  52  explanation for gain of function caused by overexpression of the N-glycosylation mutant PGRN protein. The possible biological activities that lack of N-glycosylation of progranulin affects still need further investigation. We have tried several different models to test wild type progranulin functions by using the conditioned medium containing progranulin since we did not have the mutant protein. But the results were disappointing by using the conditioned medium on these models, possibly due to the effects of other unknown factors that were secreted by the cells. In all the PGRN mutations found from the clinical cases, there are no N-glycosylation sites included and matched. However, one signal peptide mutation (PGRN A9D) in FTLD has been demonstrated that failed to undergo N-glycosylation and mislocate in the cytosol (Shankaran et al. 2008). The overexpression of this mutant A9D was found extremely low, similar to the case of PGRN5 1232, and both mutant proteins involved in the problem of attaching the first N-glycan. Moreover, some clinical mutations were located very close to the N-glycosylation site, such as GRN ArgilOX in Exon 4, GRN Glul25X in Exon 5, GRN G1n358X etc ,(Van Deerlin et al. 2007, Le Ber et a?. 2008, Salvatore Spina 2008, Baker et a!. 2006, Cruts et a!. 2006a, Bronner et a?. 2007). The amino acid surroundings changes of N-glycosylation sites may have altered the way in which Asn interacts with the 14-sugar core oligosaccharide, so that the glycosylation status of PGRN is changed. Deeper investigation is still needed on this point. In fact, the malfunctioning of the enzymes involved in N-glycosylation pathways could be lethal or relevant to the neurodegenerative diseases. For example, the enzymatic defect in the  53  first step of protein N-glycosylation, that is synthesis of Glc3Man9GlcNac2-PP-dolichol and transferring it to the nascent polypeptide, leads to the developmental delay, and severe neurologic dysfunctions (Kjaergaard et al. 1999, Freeze & Aebi 1999, Dennis et al. 2001). The etiology of these diseases (especially the neurodegenerative disease) involved in the malfunction of N-glycosylation pathway enzymes, maybe due to incorrect N-glycosylation of PGRN to some extent.  54  Table 3.1: List of Real-time PCR primers.  Sequences Actin  Human PGRN  forward  ACGAGGCCCAGAGCAAGAG  reverse  TCTCCATGTCGTCCCAGTTG  forward  GGACAGTACTGAAGACTCTG  reverse  GGATGGCAGC’FT’GTAATGTG  55  Table 3.2 List of primers used to generate human PGRN mutants by site-directed mutagenesis.  Primers used for PGRN mutagenesis PGRN1 18  Forward: CTTCCAAAGATCAGGTCAGAACTCCGTGGG Reverse: ACCTGATCTTTGGAAGCAGGATCGCCCG  PGRN236  Forward: TGCTGCCCAATGCCCCAGGCCACCTGCTGCT Reverse: GGGCATTGGGCAGCAGCCATACTTCCCACT  PGRN265  Forward: AGTGCCTCTCCAAGGAGCAGGCTACCACGG Reverse: CTCCTTGGAGAGGCACflACTCTGGATC  PGRN3 68  Forward: AGATGTCCCCTGTGATCAGGTCAGCAGCTG Reverse: ATCACAGGGGACATCTCTCTTCAAGGCT  PGRN5 30  Forward: AAGGACACTTCTGCCATGATCAGCAGACCTGCT Reverse: ATCATGGCCAGAAGTGTCCTTCCCCACACTC  56  Table 3.3 hPGRN N-glycosylation single-site and multiple sites mutants generated by direct site-mutagenesis. In these mutants, the asparagines residues in the N-glycosylation consensus sequences were replaced by glutamine. Identities of all constructs were confirmed by NAPS sequencing (UBC facility).  hPGRN mutants  Sites mutated  PGRN 118  N118Q  PGRN 231  N231Q  PGRN 265  N265Q  PGRN 368  N368Q  PGRN 530  N530Q  PGRN 51  N530Q, Ni i8Q  PGRN 512  N530Q, Ni 18Q, N265Q  PGRN 513  N530Q, Ni 18Q, N368Q  PGRN 5123  N530Q, Ni i8Q, N265Q, N368Q  PGRN 51232  N530Q, Ni i8Q, N265Q, N368Q, N231Q  57  Figure 3.1 Study design of Chapter 3 (N-glycosylation study of Progranulin)  N-glycosylation study of Progranulin in HEK 293T cells  Overexpress PGRN1nHEK  Enzymatic  bition of N-  N-glycosylation sites occupancy  1  N-glycosylation  eXaminatIOn  I  Effects induced by PGRN N glycosylation mutants  nicamycin) endoH)  mutagenesis)  (immunocoche mistry)  (BiP level evaluation)  58  Figure 3.2 Western blot analysis of PGRN transiently expressed in HEK-293T cells and effects of glycosidase treatment. PORN protein from culture medium and cell lysate were both examined, and appeared as 9OkD and 7OkD, respectively. Treatment with endoglycosidases, PNGase F and endo H, both induced a sharp decrease in the molecular mass of PORN.  Culture medium +endoH  +PNGase F  cell lysate +endoH  +PNGase F  9OkD 7OkD  59  Figure 3.3: Schematic representation of hPGRN and five N-glycosylation sites.  1  rnRNA 59Saa  17  G  •FIB 101  NAIC 219248  351  DEI 530  60  Figure 3.4 Expression and secretion of progranulin in the presence of 5ug/mL tunicamycin in HEK 293T cells. 24 hours after coincubated with tunicamycin, the cell lysates and culture medium were collected for western blotting. After treated with tunicamycin, no secretion of PGRN was detected in culture medium and in cell lysate, a molecular mass shift of PGRN was observed.  I  CD  2;  (I’  CD  CD  2: C 3  3 -Tu  -Tu  +Tu  +Tu  9OkD 7OkD  61  Figure 3.5 Expression of single N-glycosylation site mutants and wild type PGRN in cell lysate. Each of the expression of the mutants exhibits no molecular mass shift compared to the wild type intracellularly.  —  —  Q  00  c4  r’  ct  c::  —  Cell Lysate  62  Figure 3.6 Secretion of single N-glycosylation site mutants and wild type PGRN in culture medium. Each of the expression of the mutants secreted efficiently compared to the wild type.  -  o  ct  Q  00  N  N  ‘  ct  c  Culture Medium  63  Figure 3.7 Intracellular expressions of multiple N-glycosylation site mutants of PGRN. All the mutants showed molecular mass shift PORN compared to wild type, suggesting lack of N-glycosylation. The two-site and three-site mutants are retained and accumulated intracellularly while the five-site mutant expression could not be detected.  C)  Ci  7OkD  Cell lysate of PGRN  Actin  64  Figure 3.8 Real-time PCR analysis of intracellular wild type PGRN and the five N glycosylation site mutant, PGRN 51232 expression after 24 hour and 48 hour transfected in HEK 293T cells. Both wild type and the mutant PGRN mRNA was shown to be significangly up-regulated at the time points.  PGRN mRNA expression 0)  400 350  c)  300 250 200  150 E 100 50 0  24hour  48hour  rolw.t_LI PGRN5 12  65  Figure 3.9 Secretion of multiple N-glycosylation mutants in culture medium. The mutants were transfected to HEK 293T cells for 24 hours. The secretion of mutants are all reduced greatly, especially for the PGRN 5123 and PGRN 51232, nearly no protein could be detected in culture medium.  C)  9OkD  Culture medium  66  Figure 3.10 Statistical analysis revealed that intracellularly, three or more site mutants accumulate significantly compared to the wild type (not including the five-site mutant).  p<0.01 P<0.05  I  4 :3.3  2.819264  3.069656  :3  z  1.838:307  2.5  -I  0 CD CD 0 CD  0  1.5 0850135 1  . ‘4i  CD  CD  0.5 0  .  0 PGRN  PORN51  PGRN512  PGRN51S  PGRN512S  PGRN51232  67  Figure 3.11 Statistical analysis indicates that all the mutants showed a great reduction of PGRN secretion in culture medium, especially for PGRN5 123 and PGRN5 1232.  1.2  -v  1 1  z 0 CD  *  0.599  0.8  -1•  CD  x  0.6  **  CD  0.342  (J,  0  0.4  CD CD  0.2 **  0.016  0  P0RN5123  P0RN51232  0 PGRN  PGRN51  P0RN512  PGRN513  68  CALNEXN PGRN MERGE  w.t. PGRN  PGRN 5123  Figure 3.12 Subcellular localization of PGRN5 123 mutant and wild type progranulin. Green: Calnexin, endoplasmic reticulum marker. Red: PGRN.  69  Figure 3.13 Increased expression of B1P protein level following over-expressing PGRN multiple N-glycosylation mutants compared to over-expressing wild type PGRN.  PGRN  Bi P  PGRN51  r’  PGRN512  PGRN513  PGRN5123  P6RN51232  :  Actin  --  PIeveI up-requlation 2 a 1.6 01.4  -C  1.2 Cl  0.4 0.2 0 RJ  PSI  F512  F513  F123  P51232  70  CHAPTER 4: CONCLUSIONS AND FUTURE PROSPECTS As described in previous chapters, the neuroprotective effects and the post-translational modification, glycosylation of PGRN were studied in this report. The results are summarized as following: 1) Exogenous PGRN in conditioned medium and overexpression of PGRN by lentivirus do not protect mouse cortical neurons from 25uM aggregated beta-amyloid, 5OuM NMDA, and 4OuM H 0 toxicity. 2 2) PGRN appears mostly in the cytoplasm of both cortical neurons and human cell lines, specifically in the dendrites of neurons. 3) The mature 88 kDa PGRN includes a 20 kDa carbohydrate chain with high-mannose and/or hybrid-type N-glycans. 4) Elimination of the individual N-glycosylation sites of PGRN does not affect PGRN secretion. However, elimination of two or more glycosylation sites increases the accumulation of intracellular PGRN and reduces the secretion. When all the sites are mutated, no protein could be detected intracellularly and extracellularly. Taken together, N-glycosylation is essential for PGRN secretion. 5) Overexpressing multiple N-glycosylation site mutants of PGRN triggers the ER stress  and unfoldedlmisfolded protein response by up-regulating BiP/ GRP78 protein expression, which indicates the significance of N-glycosylation for proper PGRN folding. For the future prospects, the role of PGRN and its downstream regulating mechanism in central nervous system still need to be studied. Additionally, whether the  71  N-glycosylation affects PGRN function or biological activity is worthy of further investigation.  72  CHAPTER 5: BIBLIOGRAPHY  Ahmed, Z., Mackenzie, I. R., Hutton, M. L. and Dickson, D. W. (2007) Progranulin in frontotemporal lobar degeneration and neuroinflammation. J Neuroinflammation, 4, 7. Ambasta, R. K., Ai, X. and Emerson, C. P., Jr. (2007) Quail Sulfl function requires asparagine-linked glycosylation. JBiol Chem, 282, 34492-34499. Anakwe, 0. 0. and Gerton, G. L. (1990) Acrosome biogenesis begins during meiosis: evidence from the synthesis and distribution of an acrosomal glycoprotein, acrogranin, during guinea pig spermatogenesis. Biol Reprod, 42, 317-328. Antenos, M., Stemler, M., Boime, I. and Woodruff, T. K. (2007) N-linked oligosaccharides direct the differential assembly and secretion of inhibin alpha- and betaA-subunit dimers. Mol Endocrinol, 21, 1670-1684. Austin, C. P. and Cepko, C. L. (1990) Cellular migration patterns in the developing mouse cerebral cortex. Development, 110, 713-732. Baba, T., Hoff, H. B., 3rd, Nemoto, H., Lee, H., Orth, J., Arai, Y. and Gerton, G. L. (1993) Acrogranin, an acrosomal cysteine-rich glycoprotein, is the precursor of the growth-modulating peptides, granulins, and epithelins, and is expressed in somatic as well as male germ cells. Mol ReprodDev, 34, 233-243. Bagnato, A., Tecce, R., Di Castro, V. and Catt, K. J. (1997) Activation of mitogenic signaling by endothelin 1 in ovarian carcinoma cells. Cancer Res, 57, 1306-1311. Baker, C. A. and Manuelidis, L. (2003) Unique inflammatory RNA profiles of microglia in Creutzfeldt-Jakob disease. Proc NatlAcadSci USA, 100, 675-679. Baker, M., Mackenzie, I. R., Pickering-Brown, S. M. et al. (2006) Mutations in progranulin cause tau-negative frontotemporal dementia linked to chromosome 17. Nature, 442, 916-919. Bateman, A. and Bennett, H. P. (1998) Granulins: the structure and function of an emerging family of growth factors. JEndocrinol, 158, 145-15 1. Bause, E. (1983) Structural requirements of N-glycosylation of proteins. Studies with proline peptides as conformational probes. Biochem J, 209, 33 1-336. Benavides, A., Pastor, D., Santos, P., Tranque, P. and Calvo, 5. (2005) CHOP plays a pivotal role in the astrocyte death induced by oxygen and glucose deprivation. Glia, 52, 261-275. Bhandari, V. and Bateman, A. (1992) Structure and chromosomal location of the human granulin gene. Biochem Biophys Res Commun, 188, 57-63. Bhandari, V., Giaid, A. and Bateman, A. (1993) The complementary deoxyribonucleic acid sequence, tissue distribution, and cellular localization of the rat granulin precursor. Endocrinology, 133, 2682-2689. Bhandari, V., Palfree, R. G. and Bateman, A. (1992) Isolation and sequence of the granulin precursor cDNA from human bone marrow reveals tandem cysteine-rich granulin domains. Proc NatlAcadSci USA, 89, 1715-1719. Bird, T., Knopman, D., VanSwieten, J. et al. (2003) Epidemiology and genetics of frontotemporal dementia/Pick’s disease. Ann Neurol, 54 Suppl 5, S29-31. Blair, I. P., Vance, C., Durnall, J. C., Williams, K. L., Thoeng, A., Shaw, C. E. and Nicholson, G. A. (2008) CI-IMP2B mutations are not a common cause of familial or sporadic amyotrophic lateral sclerosis. JNeurol Neurosurg Psychiatry, 79, 849-850.  73  Branza-Nichita, N., Lazar, C., Dwek, R. A. and Zitzmann, N. (2004) Role of N-glycan trimming in the folding and secretion of the pestivirus protein E(ms). Biochem Biophys Res Commun, 319, 655-662. Bronner, I. F., Rizzu, P., Seelaar, H. et al. (2007) Progranulin mutations in Dutch familial frontotemporal lobar degeneration. Eur JHum Genet, 15, 369-374. Brouwers, N., Nuytemans, K., van der Zee, J. et al. (2007) Alzheimer and Parkinson diagnoses in progranulin null mutation carriers in an extended founder family. Arch Neurol, 64, 1436-1446. Brown, J. (1998) Chromosome 3-linked frontotemporal dementia. Cell Mol Lfe Sci, 54, 925-927. Bucan, M., Gatalica, B., Baba, T. and Gerton, G. L. (1996) Mapping of Gm, the gene encoding the granulin/epithelin precursor (acrogranin), to mouse chromosome 11. Mamm Genome, 7, 704-705. Bugiani, 0. (2007) The many ways to frontotemporal degeneration and beyond. Neurol ScE, 28, 24 1-244. Buratti, E., Brindisi, A., Pagani, F. and Baralle, F. E. (2004) Nuclear factor TDP-43 binds to the polymorphic TG repeats in CFTR intron 8 and causes skipping of exon 9: a functional link with disease penetrance. Am JHum Genet, 74, 1322-1325. Buratti, E., Dork, T., Zuccato, E., Pagani, F., Romano, M. and Baralle, F. E. (2001) Nuclear factor TDP-43 and SR proteins promote in vitro and in vivo CFTR exon 9 skipping. EMBOJ, 20, 1774-1784. Caldwell, S. R., Hill, K. J. and Cooper, A. A. (2001) Degradation of endoplasmic reticulum (ER) quality control substrates requires transport between the ER and Golgi. J Biol Chem, 276, 23296-23303. Cary, L. A. and Guan, J. L. (1999) Focal adhesion kinase in integrin-mediated signaling. Front Biosci, 4, D102-113. Cheung, S. T., Wong, S. Y., Lee, Y. T. and Fan, S. T. (2006) GEP associates with wild-type p53 in hepatocellular carcinoma. Oncol Rep, 15, 1507-1511. Chow, T. W., Miller, B. L., Hayashi, V. N. and Geschwind, D. H. (1999) Inheritance of frontotemporal dementia. Arch Neurol, 56, 8 17-822. Cortini, F.. Fenoglio, C., Guidi, I. et al. (2008) Novel exon 1 progranulin gene variant in Alzheimer’s disease. Eur JNeurol, 15, 1111-1117. Cruts, M., Gijselinck, I., van der Zee, J. et al. (2006a) Null mutations in progranulin cause ubiquitin-positive frontotemporal dementia linked to chromosome 1 7q2 1. Nature, 442, 920-924. Cruts, M., Kumar-Singh, S. and Van Broeckhoven, C. (2006b) Progranulin mutations in ubiquitin-positive frontotemporal dementia linked to chromosome 1 7q2 1. Curr AlzheimerRes, 3,485-491. Culouscou, J. M., Carlton, G. W. and Shoyab, M. (1993) Biochemical analysis of the epithelin receptor. JBiol Chem, 268, 10458-10462. Daniel, R., Daniels, E., He, Z. and Bateman, A. (2003) Progranulin (acrogranin/PC cell-derived growth factor/granulin-epithelin precursor) is expressed in the placenta, epidermis, microvasculature, and brain during murine development. Dev Dyn, 227, 593-599. Daniel, R., He, Z., Carmichael, K. P., Halper, J. and Bateman, A. (2000) Cellular localization of gene expression for progranulin. J Histochem Cytochem, 48, 999-1009. Davidson, Y., Kelley, T., Mackenzie, I. R., Pickering-Brown, S., Du Plessis, D., Neary, D., Snowden, J. S. and Mann, D. M. (2007) Ubiquitinated pathological lesions in  74  frontotemporal lobar degeneration contain the TAR DNA-binding protein, TDP-43. ActaNeuropathol, 113, 521-533. Dennis, J. W., Warren, C. E., Granovsky, M. and Demetriou, M. (2001) Genetic defects in N-glycosylation and cellular diversity in mammals. Curr Opin Struct Biol, 11, 60 1-607. Diaz-Cueto, L., Stein, P., Jacobs, A., Schultz, R. M. and Gerton, G. L. (2000) Modulation of mouse preimplantation embryo development by acrogranin (epithelin/granulin precursor). Dev Biol, 217, 406-4 18. Donald, C. D., Laddu, A., Chandham, P., Lim, S. D., Cohen, C., Amin, M., Gerton, G. L., Marshall, F. F. and Petros, J. A. (2001) Expression of progranulin and the epithelin/granulin precursor acrogranin correlates with neoplastic state in renal epithelium. Anticancer Res, 21, 3739-3742. Dorner, A. J., Wasley, L. C. and Kaufman, R. J. (1992) Overexpression of GRP78 mitigates stress induction of glucose regulated proteins and blocks secretion of selective proteins in Chinese hamster ovary cells. EMBOJ, 11, 1563-1571. Eklund, E. A. and Freeze, H. H. (2005) Essentials of glycosylation. Semin Pediatr Neurol, 12, 134-143. Ellgaard, L. and Helenius, A. (2001) ER quality control: towards an understanding at the molecular level. Curr Opin Cell Biol, 13, 43 1-437. Eriksen, J. L. and Mackenzie, I. R. (2008) Progranulin: normal function and role in neurodegeneration. JNeurochem, 104, 287-297. Freeze, H. H. and Aebi, M. (1999) Molecular basis of carbohydrate-deficient glycoprotein syndromes type I with normal phosphomannomutase activity. Biochim Biophys Acta, 1455, 167-178. Gass, J., Cannon, A., Mackenzie, I. R. et al. (2006) Mutations in progranulin are a major cause of ubiquitin-positive frontotemporal lobar degeneration. Hum Mo! Genet, 15, 2988-300 1. Gonzalez, E. M., Mongiat, M., Slater, S. J., Baffa, R. and lozzo, R. V. (2003) A novel interaction between perlecan protein core and progranulin: potential effects on tumor growth. JBiol Chem, 278, 38113-38116. Groups, T. L. a. M. (1994) Clinical and neuropathological criteria for frontotemporal dementia. The Lund and Manchester Groups. J Neurol Neurosurg Psychiatry, 57, 416-4 18. Groves, J. D. and Tanner, M. J. (1994) Role of N-glycosylation in the expression of human band 3-mediated anion transport. Mo! Membr Biol, 11, 31-38. Gulow, K., Bienert, D. and Haas, I. G. (2002) BiP is feed-back regulated by control of protein translation efficiency. J Ce!! Sd, 115, 2443-2452. Hammond, C. and Helenius, A. (1995) Quality control in the secretory pathway. Curr Opin Ce!! Biol, 7, 523-529. Haugarvoll, K., Wszolek, Z. K. and Hutton, M. (2007) The genetics of frontotemporal dementia. Neuro! Clin, 25, 697-7 15, vi. He, Z. and Bateman, A. (1999) Progranulin gene expression regulates epithelial cell growth and promotes tumor growth in vivo. Cancer Res, 59, 3222-3229. He, Z. and Bateman, A. (2003) Progranulin (granulin-epithelin precursor, PC-cell-derived growth factor, acrogranin) mediates tissue repair and tumorigenesis. J Mol Med, 81, 600-612. He, Z., Ismail, A., Kriazhev, L., Sadvakassova, G. and Bateman, A. (2002) Progranulin (PC-cell-derived growth factor/acrogranin) regulates invasion and cell survival. Cancer Res, 62, 5590-5596.  75  He, Z., Ong, C. H., Halper, J. and Bateman, A. (2003) Progranulin is a mediator of the wound response. Nat Med, 9, 225-229. Helenius, A. (1994) How N-linked oligosaceharides affect glycoprotein folding in the endoplasmic reticulum. Mo! Biol Cell, 5, 253-265. Helenius, A. and Aebi, M. (2001) Intracellular functions of N-linked glycans. Science, 291, 2364-2369. Helenius, A. and Aebi, M. (2004) Roles of N-linked glycans in the endoplasmic reticulum. Annu Rev Biochem, 73, 10 19-1049. Helenius, J. and Aebi, M. (2002) Transmembrane movement of dolichol linked carbohydrates during N-glycoprotein biosynthesis in the endoplasmic reticulum. SeminCellDevBiol, 13, 171-178. Herscovics, A. and Orlean, P. (1993) Glycoprotein biosynthesis in yeast. FASEB J, 7, 540-550. Hoque, M., Young, T. M., Lee, C. G., Serrero, G., Mathews, M. B. and Pe’ery, T. (2003) The growth factor granulin interacts with cyclin Ti and modulates P-TEFb-dependent transcription. Mo! Cell Rio!, 23, 1688-1702. Hosler, B. A., Siddique, T., Sapp, P. C. et al. (2000) Linkage of familial amyotrophic lateral sclerosis with frontotemporal dementia to chromosome 9q21-q22. JAJYL4, 284, 1664-1669. Hounsell, E. F., Davies, M. J. and Renouf, D. V. (1996) 0-linked protein glycosylation structure and function. Glycoconj J, 13, 19-26. Hurtley, S. M. and Helenius, A. (1989) Protein oligomerization in the endoplasmic reticulum. Annu Rev Cell Biol, 5, 277-3 07. Imai, Y., Soda, M., Inoue, H., Hattori, N., Mizuno, Y. and Takahashi, R. (2001) An unfolded putative transmembrane polypeptide, which can lead to endoplasmic reticulum stress, is a substrate of Parkin. Cell, 105, 89 1-902. Imperiali, B. and Rickert, K. W. (1995) Conformational implications of asparagine-linked glycosylation. Proc NatlAcadSci USA, 92, 97-101. Jones, M. B., Michener, C. M., Blanchette, J. 0. et al. (2003) The granulin-epithelin precursor/PC-cell-derived growth factor is a growth factor for epithelial ovarian cancer. Clin Cancer Res, 9, 44-51. Josephs, K. A. (2008) Frontotemporal dementia and related disorders: deciphering the enigma. Ann Neurol, 64, 4-14. Kamrava, M., Simpkins, F., Alejandro, E., Michener, C., Meltzer, E. and Kohn, E. C. (2005) Lysophosphatidic acid and endothelin-induced proliferation of ovarian cancer cell lines is mitigated by neutralization of granulin-epithelin precursor (GEP), a prosurvival factor for ovarian cancer. Oncogene, 24, 7084-7093. Kaufii-ian, R. J. (1999) Stress signaling from the lumen of the endoplasmie reticulum: coordination of gene transcriptional and translational controls. Genes Dev, 13, 1211-1233. Kincaid, M. M. and Cooper, A. A. (2007) ERADicate ER stress or die trying. Antioxid Redox Signal, 9, 2373-2387. Kjaergaard, S., Skovby, F. and Schwartz, M. (1999) Carbohydrate-deficient glycoprotein syndrome type 1A: expression and characterisation of wild type and mutant PMM2 in E. coli. EurJHum Genet, 7, 884-888. Kohno, K., Normington, K., Sambrook, J., Gething, M. J. and Mori, K. (1993) The promoter region of the yeast KAR2 (BiP) gene contains a regulatory domain that responds to the presence of unfolded proteins in the endoplasmic reticulum. Mol Cell Rio!, 13, 877-890.  76  Kozutsumi, Y., Segal, M., Normington, K., Gething, M. J. and Sambrook, J. (1988) The presence of malfolded proteins in the endoplasmic reticulum signals the induction of glucose-regulated proteins. Nature, 332, 462-464. Le, A., Graham, K. S. and Sifers, R. N. (1990) Intracellular degradation of the transport-impaired human PiZ alpha 1 -antitrypsin variant. Biochemical mapping of the degradative event among compartments of the secretory pathway. J Biol Chem, 265, 14001-14007. Le Ber, I., Camuzat, A., Hannequin, D. et al. (2008) Phenotype variability in progranulin mutation carriers: a clinical, neuropsychological, imaging and genetic study. Brain, 131, 732-746. Le Ber, I., van der Zee, J., Hannequin, D. et al. (2007) Progranulin null mutations in both sporadic and familial frontotemporal dementia. Hum Mutat, 28, 846-855. Leborgne-Castel, N., Jelitto-Van Dooren, E. P., Crofts, A. J. and Denecke, J. (1999) Overexpression of BiP in tobacco alleviates endoplasmic reticulum stress. Plant Cell, 11, 459-470. Liau, L. M., Lallone, R. L., Seitz, R. S., Buznikov, A., Gregg, J. P., Kornblum, H. I., Nelson, S. F. and Bronstein, J. M. (2000) Identification of a human glioma-associated growth factor gene, granulin, using differential immuno-absorption. Cancer Res, 60, 13 53-1360. Lis, H. and Sharon, N. (1993) Protein glycosylation. Structural and functional aspects. Eur J Biochem, 218, 1-27. Little, E. and Lee, A. S. (1995) Generation of a mammalian cell line deficient in glucose-regulated protein stress induction through targeted ribozyme driven by a stress-inducible promoter. JBiol Chem, 270, 9526-95 34. Liu, Y., Xi, L., Liao, G. et al. (2007) Inhibition of PC cell-derived growth factor (PCDGF)/granulin-epithelin precursor (GEP) decreased cell proliferation and invasion through downregulation of cyclin D and CDK4 and inactivation of MMP-2. BMC Cancer, 7, 22. Lu, R. and Serrero, G. (2000) Inhibition of PC cell-derived growth factor (PCDGF, epithelin!granulin precursor) expression by antisense PCDGF cDNA transfection inhibits tumorigenicity of the human breast carcinoma cell line MDA-MB-468. Proc NatlAcadSci USA, 97, 3993-3998. Lu, R. and Serrero, G. (2001) Mediation of estrogen mitogenic effect in human breast cancer MCF-7 cells by PC-cell-derived growth factor (PCDGF/granulin precursor). Proc Nail Acad Sd USA, 98, 142-147. Mackenzie, I. R., Baker, M., Pickering-Brown, S. et al. (2006) The neuropathology of frontotemporal lobar degeneration caused by mutations in the progranulin gene. Brain, 129, 308 1-3090. Mackenzie, I. R. and Rademakers, R. (2007) The molecular genetics and neuropathology of frontotemporal lobar degeneration: recent developments. Neurogenetics, 8, 237-248. Malaspina, A., Kaushik, N. and de Belleroche, J. (2001) Differential expression of 14 genes in amyotrophic lateral sclerosis spinal cord detected using gridded cDNA arrays. J Neurochem, 77, 132-145. Mann, M. and Jensen, 0. N. (2003) Proteomic analysis of post-translational modifications. Nat Biotechnol, 21, 255-261. Mercado, P. A., Ayala, Y. M., Romano, M., Buratti, E. and Baralle, F. E. (2005) Depletion of TDP 43 overrides the need for exonic and intronic splicing enhancers in the human apoA-II gene. Nucleic Acids Res, 33, 6000-60 10.  77  Mills, G. B. and Moolenaar, W. H. (2003) The emerging role of lysophosphatidic acid in cancer. Nat Rev Cancer, 3, 582-591. Mitra, N., Sharon, N. and Surolia, A. (2003) Role of N-linked glycan in the unfolding pathway of Erythrina corallodendron lectin. Biochemistiy, 42, 12208-12216. Mitra, N., Sinha, S., Ramya, T. N. and Surolia, A. (2006) N-linked oligosaccharides as outfitters for glycoprotein folding, form and function. Trends Biochem Sd, 31, 156-163. Monami, G., Gonzalez, E. M., Heliman, M., Gomella, L. G., Baffa, R., lozzo, R. V. and Morrione, A. (2006) Proepithelin promotes migration and invasion of 5637 bladder cancer cells through the activation of ERKI/2 and the formation of a paxillinJFAKIERK complex. Cancer Res, 66, 7103-7110. Mori, K. (2000) Tripartite management of unfolded proteins in the endoplasmic reticulum. Cell, 101,451-454. Morris, J. A., Dorner, A. J., Edwards, C. A., Hendershot, L. M. and Kaufman, R. J. (1997) Immunoglobulin binding protein (BiP) function is required to protect cells from endoplasmic reticulum stress but is not required for the secretion of selective proteins. JBiol Chem, 272, 4327-4334. Mukherjee, 0., Pastor, P., Cairns, N. J. et al. (2006) HDDD2 is a familial frontotemporal lobar degeneration with ubiquitin-positive, tau-negative inclusions caused by a missense mutation in the signal peptide of progranulin. Ann Neurol, 60, 314-322. Murrell, J. R., Koller, D., Foroud, T., Goedert, M., Spillantini, M. G., Edenberg, H. J., Farlow, M. R. and Ghetti, B. (1997) Familial multiple-system tauopathy with presenile dementia is localized to chromosome 17. Am JHum Genet, 61, 1131-1138. Nacharaju, P., Lewis, J., Easson, C., Yen, S., Hackett, J., Hutton, M. and Yen, S. H. (1999) Accelerated filament formation from tau protein with specific FTDP- 17 missense mutations. FEBS Lett, 447, 195-199. Nakagawa, T., Zhu, H., Morishima, N., Li, E., Xu, J., Yankner, B. A. and Yuan, J. (2000) Caspase-12 mediates endoplasmic-reticulum-specific apoptosis and cytotoxicity by amyloid-beta. Nature, 403, 98-103. Nalivaeva, N. N. and Turner, A. J. (2001) Post-translational modifications of proteins: acetylcholinesterase as a model system. Proteomics, 1, 735-747. Neary, D., Snowden, J. and Mann, D. (2005) Frontotemporal dementia. Lancet Neurol, 4, 771-780. Neary, D., Snowden, J. S. and Mann, D. M. (2000a) Classification and description of frontotemporal dementias. Ann N YAcad Sci, 920, 46-51. Neary, D., Snowden, I. S. and Mann, D. M. (2000b) Cognitive change in motor neurone disease/amyotrophic lateral sclerosis (MND/ALS). JNeurol Sci, 180, 15-20. Neumann, M., Sampathu, D. M., Kwong, L. K. et al. (2006) Ubiquitinated TDP-43 in frontotemporal lobar degeneration and amyotrophic lateral sclerosis. Science, 314, 130-133. O’Connor, S. E. and Imperiali, B. (1996) Modulation of protein structure and function by asparagine-linked glycosylation. Chem Rio!, 3, 803-8 12. Ou, S. H., Wu, F., Harrich, D., Garcia-Martinez, L. F. and Gaynor, R. B. (1995) Cloning and characterization of a novel cellular protein, TDP-43, that binds to human immunodeficiency virus type 1 TAR DNA sequence motifs. J Virol, 69, 3584-3596. Paschen, W. (1996) Disturbances of calcium homeostasis within the endoplasmic reticulum may contribute to the development of ischemic-cell damage. Med Hypotheses, 47, 283-288.  78  Paschen, W., Yatsiv, I., Shoham, S. and Shohami, E. (2004) Brain trauma induces X-box protein I processing indicative of activation of the endoplasmic reticulum unfolded protein response. JNeurochem, 88, 983-992. Paulson, J. C. (1989) Glycoproteins: what are the sugar chains for? Trends Biochem Sd, 14, 272-276. Pickering-Brown, S. M., Baker, M., Gass, J. et a!. (2006) Mutations in progranulin explain atypical phenotypes with variants in MAPT. Brain, 129, 3124-3126. Pittman, A. M., Fung, H. C. and de Silva, R. (2006) Untangling the tau gene association with neurodegenerative disorders. Hum Mol Genet, 15 Spec No 2, Ri 88-195. Plowman, G. D., Green, J. M., Neubauer, M. 0., Buckley, S. D., McDonald, V. L., Todaro, G. J. and Shoyab, M. (1992) The epithelin precursor encodes two proteins with opposing activities on epithelial cell growth. JBiol Chem, 267, 13073-13078. Rademakers, R., Baker, M., Gass, J. et al. (2007) Phenotypic variability associated with progranulin haploinsufficiency in patients with the common 1477C-->T (Arg493X) mutation: an international initiative. Lancet Neurol, 6, 857-868. Rademakers, R., Cruts, M. and van Broeckhoven, C. (2004) The role of tau (MAPT) in frontotemporal dementia and related tauopathies. Hum Mutat, 24, 277-295. Rissanen, A., Sivenius, J. and Jolkkonen, J. (2006) Prolonged bihemispheric alterations in unfolded protein response related gene expression after experimental stroke. Brain Res, 1087, 60-66. Rizzini, C., Goedert, M., Hodges, J. R., Smith, M. J., Jakes, R., Hills, R., Xuereb, J. H., Crowther, R. A. and Spillantini, M. G. (2000) Tau gene mutation K257T causes a tauopathy similar to Pick’s disease. J Neuropathol Exp Neurol, 59, 990-1001. Rosso, S. M., Donker Kaat, L., Baks, T. et al. (2003) Frontotemporal dementia in The Netherlands: patient characteristics and prevalence estimates from a population-based study. Brain, 126, 2016-2022. Rosso, S. M., Kamphorst, W., de Graaf, B., Willemsen, R., Ravid, R., Niermeijer, M. F., Spillantini, M. G., Heutink, P. and van Swieten, J. C. (2001) Familial frontotemporal dementia with ubiquitin-positive inclusions is linked to chromosome I 7q2 1-22. Brain, 124, 1948-1957. Rovelet-Lecrux, A., Deramecourt, V., Legallic, S. et al. (2008) Deletion of the progranulin gene in patients with frontotemporal lobar degeneration or Parkinson disease. Neurobiol Dis, 31, 41-45. Ryu, E. J., Harding, H. P., Angelastro, J. M., Vitolo, 0. V., Ron, D. and Greene, L. A. (2002) Endoplasmic reticulum stress and the unfolded protein response in cellular models of Parkinson’s disease. JNeurosci, 22, 10690-10698. Salvatore Spina J. R. M., Ruben Vidala and Bernardino Ghetti (2008) Neuropathologic and genetic characterization of frontotemporal lobar degeneration with ubiquitin- and/or TDP-43 -positive inclusions: A large series Alzheimer’s and Dementia, 4, T431. Seelaar, H., Schelhaas, H. J., Azmani, A. et al. (2007) TDP-43 pathology in familial frontotemporal dementia and motor neuron disease without Progranulin mutations. Brain, 130, 1375-1385. Shankaran, S. S., Capell, A., Hruscha, A. T., Fellerer, K., Neumann, M., Schmid, B. and Haass, C. (2008) Missense mutations in the progranulin gene linked to frontotemporal lobar degeneration with ubiquitin-immunoreactive inclusions reduce progranulin production and secretion. J Biol Chem, 283, 1744-1753. Shen, J., Chen, X., Hendershot, L. and Prywes, R. (2002a) ER stress regulation of ATF6 localization by dissociation of BiP/GRP78 binding and unmasking of Golgi localization signals. Dev Cell, 3, 99-111. ,  79  Shen, X., Zhang, K. and Kaufman, R. J. (2004) The unfolded protein response--a stress signaling pathway of the endoplasmic reticulum. J Chem Neuroanat, 28, 79-92. Shen, Y., Meunier, L. and Hendershot, L. M. (2002b) Identification and characterization of a novel endoplasmic reticulum (ER) DnaJ homologue, which stimulates ATPase activity of BiP in vitro and is induced by ER stress. JBiol Chem, 277, 15947-15956. Shoyab, M., McDonald, V. L., Byles, C., Todaro, G. J. and Plowman, G. D. (1990) Epithelins 1 and 2: isolation and characterization of two cysteine-rich growth-modulating proteins. Proc NatlAcadSci USA, 87, 79 12-7916. Silberstein, S. and Gilmore, R. (1996) Biochemistry, molecular biology, and genetics of the oligosaccharyltransferase. FASEB .1, 10, 849-858. Skibinski, G., Parkinson, N. J., Brown, J. M. et al. (2005) Mutations in the endosomal ESCRTIII-complex subunit CHIvIP2B in frontotemporal dementia. Nat Genet, 37, 806-808. Snowden, J. S., Pickering-Brown, S. M., Mackenzie, I. R., Richardson, A. M., Vanna, A., Neary, D. and Mann, D. M. (2006) Progranulin gene mutations associated with frontotemporal dementia and progressive non-fluent aphasia. Brain, 129, 3091-3102. Stevens, M., van Duijn, C. M., Kamphorst, W. et al. (1998) Familial aggregation in frontotemporal dementia. Neurology, 50, 1541-1545. Szegezdi, E., Logue, S. E., Gorman, A. M. and Samali, A. (2006) Mediators of endoplasmic reticulum stress-induced apoptosis. EMBO Rep, 7, 880-885. Takeda, J. and Kinoshita, T. (1995) GPI-anchor biosynthesis. Trends Biochem Sci, 20, 367-371. Trinh, D. P., Brown, K. M. and Jeang, K. T. (1999) Epithelinlgranulin growth factors: extracellular cofactors for HIV-1 and HIV-2 Tat proteins. Biochem Biophys Res Commun, 256, 299-306. Trojanowski, J. Q. and Dickson, D. (2001) Update on the neuropathological diagnosis of frontotemporal dementias. JNeuropathol Exp Neurol, 60, 1123-1126. Van Damme, P., Van Hoecke, A., Lambrechts, D., Vanacker, P., Bogaert, E., van Swieten, J., Carmeliet, P., Van Den Bosch, L. and Robberecht, W. (2008) Progranulin functions as a neurotrophic factor to regulate neurite outgrowth and enhance neuronal survival. J Cell Biol, 181, 37-41. Van Deerlin, V. M., Wood, E. M., Moore, P. et al. (2007) Clinical, genetic, and pathologic characteristics of patients with frontotemporal dementia and progranulin mutations. ArchNeurol, 64, 1148-1153. van der Zee, J., Le Ber, I., Maurer-Stroh, S. et a!. (2007) Mutations other than null mutations producing a pathogenic loss of progranulin in frontotemporal dementia. Hum Mutat, 28,416. Vijaya, M., Sukanya, N., Savithri, H. S. and Rao, N. A. (1991) Isolation and characterization of a naturally occurring inhibitor from mung bean (Vigna radiata) seedlings for serine hydroxymethyltransferase. Indian J Biochem Biophys, 28, 252-256. Wang, H. Y., Wang, I. F., Bose, J. and Shen, C. K. (2004) Structural diversity and functional implications of the eukaryotic TDP gene family. Genomics, 83, 130-139. Wang, W., Hayashi, J., Kim, W. E. and Serrero, G. (2003a) PC cell-derived growth factor (granulin precursor) expression and action in human multiple myeloma. Clin Cancer Res, 9, 2221-2228. Wang, X., Li, X., Xu, L., Zhan, Y., Yaish-Ohad, S., Erhardt, J. A., Barone, F. C. and Feuerstein, G. Z. (2003b) Up-regulation of secretory leukocyte protease inhibitor  80  (SLPI) in the brain after ischemic stroke: adenoviral expression of SLPI protects brain from ischemic injury. Mol Pharmacol, 64, 833-840. Watts, G. D., Wymer, J., Kovach, M. J., Mehta, S. G., Mumm, S., Darvish, D., Pestronk, A., Whyte, M. P. and Kimonis, V. E. (2004) Inclusion body myopathy associated with Paget disease of bone and frontotemporal dementia is caused by mutant valosin-containing protein. Nat Genet, 36, 377-38 1. Wormald, M. R. and Dwek, R. A. (1999) Glycoproteins: glycan presentation and protein-fold stability. Structure, 7, R155-160. Wszolek, Z. K., Tsuboi, Y., Farrer, M., Uitti, R. J. and Hutton, M. L. (2003) Hereditary tauopathies and parkinsonism. Adv Neurol, 91, 153-163. Xia, X. and Serrero, G. (1998) Identification of cell surface binding sites for PC-cell-derived growth factor, PCDGF, (epithelinlgranulin precursor) on epithelial cells and fibroblasts. Biochem Biophys Res Commun, 245, 539-543. Xu, K., Zhang, Y., Ilalov, K., Carison, C. S., Feng, J. Q., Di Cesare, P. E. and Liu, C. J. (2007) Cartilage oligomeric matrix protein associates with granulin-epithelin precursor (GEP) and potentiates GEP-stimulated chondrocyte proliferation. J Biol Chem, 282, 11347-1 1355. Yan, Y., Scott, D. J., Wilkinson, T. N., Ji, J., Tregear, G. W. and Bathgate, R. A. (2008) Identification of the N-linked glycosylation sites of the human relaxin receptor and effect of glycosylation on receptor function. Biochemistry, 47, 6953-6968. Yarema, K. J. and Bertozzi, C. R. (2001) Characterizing glycosylation pathways. Genome Biol, 2, REVIEWS0004. Zanocco-Marani, T., Bateman, A., Romano, G., Valentinis, B., He, Z. H. and Baserga, R. (1999) Biological activities and signaling pathways of the granulin/epithelin precursor. Cancer Res, 59, 5331-5340. Zhang, Y. J., Xu, Y. F., Dickey, C. A., Buratti, E., Baralle, F., Bailey, R., Pickering-Brown, S., Dickson, D. and Petrucelli, L. (2007) Progranulin mediates caspase-dependent cleavage of TAR DNA binding protein-43. JNeurosci, 27, 10530-10534. Zhou, F., Su, J., Fu, L. et al. (2008) Unglycosylation at Asn-633 made extracellular domain of E-cadherin folded incorrectly and arrested in endoplasmic reticulum, then sequentially degraded by ERAD. Glycoconj J 25, 727-740. Zhou, J., Gao, G., Crabb, J. W. and Serrero, G. (1993) Purification of an autocrine growth factor homologous with mouse epithelin precursor from a highly tumorigenic cell line. JBiol Chem, 268, 10863-10869. Zhu, J., Nathan, C., Jin, W. et a!. (2002) Conversion of proepithelin to epithelins: roles of SLPI and elastase in host defense and wound repair. Cell, 111, 867-878. Zinszner, H., Kuroda, M., Wang, X., Batchvarova, N., Lightfoot, R. T., Remotti, H., Stevens, J. L. and Ron, D. (1998) CHOP is implicated in programmed cell death in response to impaired function of the endoplasmic reticulum. Genes Dev, 12, 982-995.  81  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.24.1-0067227/manifest

Comment

Related Items