Open Collections

Bioinformatic analysis of neurofibromatosis type 1 on transcriptional regulation

University of British Columbia

The objective of this study was to identify potential transcription factor binding sites in the human NF1 gene through phylogenetic footprinting. The 5 upstream region (5UR) and Exon 1- Intron 1 of the NF1 gene from human, mouse, rat, and pufferfish were compared and analyzed using various bioinformatic tools. Three regions that have equal or higher homology than the coding regions were discovered in the NF1 5UR, and four more very highly homologous regions were found in intron 1. Five of these highly homologous regions had transcription factor binding site predictions that were similar for the two binding site detection programs used in this study. One of the highly homologous regions within intron 1 had no shared predictions between the two transcription binding site detection programs. Another highly homologous region in intron 1 is a tetranucleotide repeated sequence. One of the highly homologous regions in the 5UR that contains several transcription factor binding site predictions spans the transcription start site. This region includes a 24bp sequence acttccggtggggtgtcatggcgg 310-333 bp upstream of the translation start that is identical in human, mouse and rat and differs by onlyl bp in Fugu. This sequence may contain the core promoter responsible for NF1 transcription initiation.

Thesis/Dissertation

application/pdf

2009-11-02

For non-commercial purposes only, such as research, private study and education. Additional conditions apply, see Terms of Use https://open.library.ubc.ca/terms_of_use.

http://hdl.handle.net/2429/14594

Medical Genetics

University of British Columbia

UBCV

DSpace