@prefix vivo: . @prefix edm: . @prefix ns0: . @prefix dcterms: . @prefix skos: . vivo:departmentOrSchool "Medicine, Faculty of"@en, "Pathology and Laboratory Medicine, Department of"@en ; edm:dataProvider "DSpace"@en ; ns0:degreeCampus "UBCV"@en ; dcterms:creator "Baker, Brett Hugh James"@en ; dcterms:issued "2010-10-01T21:13:36Z"@en, "1989"@en ; vivo:relatedDegree "Master of Science - MSc"@en ; ns0:degreeGrantor "University of British Columbia"@en ; dcterms:description """MALA-2 (Murine Lymphocyte Activated Antigen-2) is a murine cell surface antigen that is detected at high concentration on activated, proliferating lymphocytes, but only weakly on resting lymphocytes. It is thought to play an important role in lymphocyte activation since the rat monoclonal antibody YN1/1.7.4 which recognizes MALA-2 is capable of inhibiting the mixed lymphocyte reaction. Considering the central role of lymphocyte activation to the generation and maintenance of the immune response, I undertook the purification and biochemical characterization of MALA-2. In these studies, MALA-2 was isolated and purified to homogeneity using immobilized YN1/1.7.4 monoclonal antibody and sodium docecylsulphate-polyacrylamide gel electrophoresis. Biochemical characterization studies revealed that MALA-2 is a Mr 95-100 kD glycoprotein containing a protein backbone of approximately 66 kD, and N-linked carbohydrate chains amounting to a Mr of approximately 35 kD. Two dimensional gel electrophoresis suggested that MALA-2 has an isoelectric point of 4.9. Although it was previously suspected that MALA-2 might be associated with the transferrin receptor on the cell surface, this was shown not to be the case on NS-1 cells. Additionally, ³²P-orthophosphate labelling of MALA-2 on NS-1 or MBL-2 cells could not be detected. Finally, the partial amino acid sequence of MALA-2 was determined by sequencing trypsin-generated peptides from purified MALA-2. Computer-assisted homology comparisons of the MALA-2 partial amino acid sequences with other known sequences showed that MALA-2 shared its most consistent homology with a class of proteins known as the immunoglobulin superfamily. Subsequent to this study, the partial amino acid sequences obtained within this study were used to construct oligonucleotide probes. These probes were used for the screening of cDNA libraries, facilitating the successful cloning of the MALA-2 gene. This, in turn, resulted in the identification of MALA-2 as the murine counterpart of the human ICAM-1 molecule, a protein known to play a significant role in intercellular adhesion and lymphocyte activation within the immune system. Significantly, results obtained from the biochemical characterization of MALA-2 carried out in this thesis have been confirmed by the subsequent nucleotide sequence data from the cloning of MALA-2."""@en ; edm:aggregatedCHO "https://circle.library.ubc.ca/rest/handle/2429/28888?expand=metadata"@en ; skos:note "ANALYSIS OF A MURINE LYMPHOCYTE PROLIFERATION-ASSOCIATED ANTIGEN (MALA—2): THE MURINE HOMOLOG OF THE HUMAN ICAM-1 MOLECULE BY BRETT HUGH JAMES BAKER B.Sc, University of B r i t i s h Columbia, 1985 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Department of Pathology) We accept this thesis as conforming to the required standard THE UNIVERSITY OF BRITISH COLUMBIA December, 1989 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Brett Baker, B.Sc. Department, of Pathology The University of British Columbia 1956 Main Mall Vancouver, Canada V6T 1Y3 Date K/ft^ ( i i ) ABSTRACT MALA-2 (Murine Lymphocyte Activated Antigen-2) is a murine c e l l surface antigen that i s detected at high concentration on activated, proliferating lymphocytes, but only weakly on resting lymphocytes. It i s thought to play an important role in lymphocyte activation since the rat monoclonal antibody YN1/1.7.4 which recognizes MALA-2 is capable of inhibiting the mixed lymphocyte reaction. Considering the central role of lymphocyte activation to the generation and maintenance of the immune response, I undertook the purification and biochemical characterization of MALA-2. In these studies, MALA-2 was isolated and purified to homogeneity using immobilized YN1/1.7.4 monoclonal antibody and sodium docecylsulphate-polyacrylamide gel electrophoresis. Biochemical characterization studies revealed that MALA-2 i s a Mj. 95-100 kD glycoprotein containing a protein backbone of approximately 66 kD, and N-linked carbohydrate chains amounting to a Mj. of approximately 35 kD. Two dimensional gel electrophoresis suggested that MALA-2 has an isoelectric point of 4.9. Although i t was previously suspected that MALA-2 might be associated with the transferrin receptor on the c e l l surface, this was shown not to be the case on NS-1 c e l l s . Additionally, •^P-orthophosphate labelling of MALA-2 on NS-1 or MBL-2 cel l s could not be detected. Finally, the partial amino acid sequence of MALA-2 was determined by sequencing trypsin-generated peptides from purified MALA-2. Computer-assisted homology comparisons of the MALA-2 partial amino acid sequences with other known sequences showed that MALA-2 shared i t s most consistent homology with a class of proteins known as the immunoglobulin superfamily. ( i i i ) Subsequent to t h i s study, the p a r t i a l amino acid sequences obtained within t h i s study were used to construct oligonucleotide probes. These probes were used for the screening of cDNA l i b r a r i e s , f a c i l i t a t i n g the successful cloning of the MALA-2 gene. This, i n turn, resulted i n the i d e n t i f i c a t i o n of MALA-2 as the murine counterpart of the human ICAM-1 molecule, a protein known to play a s i g n i f i c a n t role i n i n t e r c e l l u l a r adhesion and lymphocyte ac t i v a t i o n within the immune system. S i g n i f i c a n t l y , results obtained from the biochemical characterization of MALA-2 carried out i n t h i s thesis have been confirmed by the subsequent nucleotide sequence data from the cloning of MALA-2. (iv) TABLE OF CONTENTS Abstract i i Table of Contents i v L i s t of Abbreviations v L i s t of Tables v i L i s t of Figures v i i Dedication v i i i Acknowledgements i x CHAPTER ONE. INTRODUCTION: OVERVIEW OF RELEVANT TOPICS 1.1 General Concepts 2 1.2 The Immunoglobulin Superfamily and T-Cell Activation 7 1.3 Adhesion Molecules Within the Immune System 19 1.4 Thesis objectives 37 1.5 References 39 CHAPTER TWO. MATERIALS AND METHODS 2.1 Sources of Materials 55 2.2 Biochemical Techniques 56 2.3 P u r i f i c a t i o n of MALA-2 62 2.4 P a r t i a l Amino Acid Sequencing 65 2.5 Computer Assisted Homology Studies 67 2.6 References 68 CHAPTER THREE. RESULTS 3.1 P u r i f i c a t i o n of MALA-2 70 3.2 Characterization of the Biochemical Properties of MALA-2 76 3.3 Determination of the P a r t i a l Amino Acid Sequences of MALA-2 85 3.4 Homology Comparisons Using P a r t i a l Amino Acid Sequences of MALA-2 96 3.5 Ref erences 101 CHAPTER FOUR. DISCUSSION 4.1 Homology of MALA-2 to ICAM-1.\" 103 4.2 Role of the YN1/1.7.4 Monoclonal Antibody i n Immunological Research 116 4.3 Summary 117 4.4 References f 118 4.5 Attached publication {Af>p&*diyc) ' > 0 (v) LIST OF ABBREVIATIONS APC Antigen presenting c e l l BAM Binding assay medium bis N, N' -methylene-bis-acrylamide BSA Bovine serum albumin C Constant region CD Cluster of d i f f e r e n t i a t i o n (or clust e r determinant) cDNA Complementary DNA Con A Concanavalin A CPM Counts per minute CTL Cytotoxic T lymphocyte ELAM-1 Endothelial-leukocyte adhesion molecule FCS Fetal c a l f serum HEPES N-2-hydroxyethylpiperazine HEV High endothelial venule HPLC High Performance Liquid Chromatography ICAM-1 I n t e r c e l l u l a r adhesion molecule-1 IEF I s o e l e c t r i c focussing i g Immunoglobulin IL Interleukin kD kil o d a l t o n LFA Lymphocyte (or leukocyte)-function-associated antigen LGL Large granular lymphocyte LPS Lipopolysacharride LT Lymphotoxin MAb Monoclonal antibody MAG Myelin-associated glycoprotein MALA-2 Murine activated lymphocyte antigen-2 MaRIg Mouse an t i r a t immunoglobulin antiserum 2 ME beta-mercaptoethanol MHC Major histocompatibility complex Mr Relative molecular mass MuLV Murine leukemia v i r u s NBRF National Biomedical Research Foundation NCAM Neural c e l l adhesion molecule NK Natural k i l l e r c e l l PBS Phosphate buffered saline P i I s o e l e c t r i c point PTH Phenylthiohydantoin RaMEg Rabbit anti-mouse immunoglobulin antiserum RaRIg Rabbit a n t i - r a t immunoglobulin antiserum RPM Revolutions per minute SDS-PAGE Sodium dodecyl sulphate-polyacrylamide gel electrophoresis TH TQ T helper c e l l T cytotoxic c e l l TCR T c e l l receptor TFA Tri f l o u r o a c e t i c acid TNF Tumor necrosis factor V Variable region (vi) LIST OF TABLES TABLE I. Lymphoid Molecules of the Immunoglobulin Superfamily 15 TABLE I I . Density of MALA-2 on Various Lymphoid C e l l Lines 71 TABLE I I I . Two Classes of Proteins Most Consistently Exhibiting Homology to P a r t i a l Amino Acid Sequences of MALA-2 97 TABLE IV. P a r t i a l Amino Acid Sequences of MALA-2 and Degree of Homology to ICAM-1 106 ( v i i ) LIST OF FIGURES FIGURE 1. Spe c i f i c Immunoprecipitation of MALA-2 from C e l l Line NS-1 73 FIGURE 2. Degree of Purity of MALA-2 after Specific Elution from Antibody A f f i n i t y Column 75 FIGURE 3. Degree of Purity of MALA-2 after Two Consecutive P u r i f i c a t i o n Steps 77 FIGURE 4. Glycoprotein Nature of MALA-2; digestion with Endoglycosidase F 79 FIGURE 5. Two-Dimensional Gel Electrophoresis Analysis of Pu r i f i e d MALA-2 81 FIGURE 6. Metabollic Labelling of MALA-2 83 FIGURE 7. Generation of Polyclonal Serum Against MALA-2 84 FIGURE 8. Western blot of t r a n s f e r r i n receptor immunoprecipitation with anti-MALA-2 polyclonal immune serum . '. 86 FIGURE 9. Phosphorylation Study of MALA-2 87 FIGURE 10. Trypsin Digestion of MALA-2 88 FIGURE 11. Spectrophotometric P r o f i l e of the Separation of Tryptic Peptide Fragments of MALA-2 by HPLC 91 FIGURE 12. Spectrophotometric P r o f i l e of the Separation of Re-Pooled Tryptic Peptide Fragments of MALA-2 by HPLC 92 FIGURE 13. Spectrophotometric P r o f i l e of the Separation of Tryptic Peptide Fragments of MALA-2 from a Second Digestion Experiment 94 FIGURE 14. Spectrophotmetric P r o f i l e of the HPLC Separation of Re-Pooled Tryptic Peptide Fragments of MALA-2 (second digestion) '. 95 FIGURE 15. Examples of Homology Demonstrated between P a r t i a l Amino Acid Sequences of MALA-2 and Proteins i n the NBRF database 99 FIGURE 16. Homology Between ICAM-1 and P a r t i a l Amino Acid Sequences of MALA-2 107 FIGURE 17. Comparison of the P a r t i a l Sequences of MALA-2 with Regions of Conservation i n the Immunoglobulin-Like Domains of ICAM-1 109 ( v i i i ) DEDICATION This thesis i s dedicated to the s p i r i t of Howard Randall (Randy) Baker; my brother, friend, protector, and guide. As you perservered and followed your heart, so did I watch and learn. (ix) ACKNOWLEDGEMENTS I would l i k e to thank my family, epecially my mother, for your everpresent support and encouragement. I would l i k e to thank Georgia, for i n s p i r i n g me, believing i n me, and for giving me the reason to believe i n commitment. I would l i k e to thank a l l those involved with the Terry Fox Laboratory f o r making my time there enjoyable and educational. I would l i k e to thank Dr. Fumio Takei for h i s supervision and and c r i t i c a l analysis, and Dr. Gerald K r y s t a l , for c r i t i c a l reading of the thesis manuscript, and for f i n a l guidance \"onto the runway\". I would also l i k e to thank the members of my thesis committee for your suggestions and guidance throughout t h i s project. Lastly, I would l i k e to thank Dr. Anne Autor, f o r without your energetic involvement and support, the completion of t h i s project would have been impossible. 1 CHAPTER ONE INTRODOCTION: OVERVIEW OF RELEVANT TOPICS 1.1 GENERAL CONCEPTS 1.1.1 The Immune System 2 1.1.2 Monoclonal Antibodies 4 1.2 THE IMMUNOGLOBULIN SUPERFAMILY AND T-CELL ACTIVATION 1.2.1 Molecules with Immunoglobulin Homology 7 1.2.2 Activation through the T Lymphocyte Receptor Complex 8 1.2.3 The Alternative pathway of Activation: the CD2 molecule 11 1.2.4 The Major Histocompatibility Complex 12 1.2.5 Other Activation Antigens within the Immunoglobulin Superf ami l y 14 1.2.6 Neural Molecules with Immunoglobulin Homology 17 1.3 ADHESION MOLECULES WITHIN THE IMMUNE SYSTEM 1.3.1 The Role of Adhesion 19 1.3.2 Endothelial C e l l s 20 1.3.3 Lymphocyte Homing 21 1.3.4 The Integrins 25 1.3.5 The I n t e r c e l l u l a r Adhesion Molecule 1 (ICAM-1) 30 1.4 THESIS OBJECTIVES 37 1.5 REFERENCES 39 2 1.1 GENERAL CONCEPTS 1.1.1 The Immune System The vertebrate immune system i s a v e r s a t i l e organ system involved i n the recognition of ex t r a c e l l u l a r elements throughout the body; i t i s capable of recognizing and distinguishing between normal host tissues, and foreign agents which gain entry to the body. Agents recognized as abnormal or foreign are subject to any of a variety of destructive elements ranging from inflammation and humoral immunity to cell-mediated c y t o t o x i c i t y . Just as importantly, normal host tissue must be recognized as normal to prevent autoimmune a c t i v i t i e s , and to allow processes such as lymphocyte t r a f f i c k i n g , c e l l d i f f e r e n t i a t i o n , and leukocyte interactions to take place. C o l l e c t i v e l y , the immune system ex i s t s i n both s o l i d organ and f l u i d states. Lymphocytes are organized i n a s o l i d fashion during early c e l l development, enter the f l u i d c i r c u l a t i o n upon maturation, and u t i l i z e both s o l i d organ and f l u i d organizational states upon contact with foreign antigens or abnormal tissues. Organization i n lymph nodes, for example, allows a very high number of interactions between leukocytes. This enables an immune response to be mounted very quickly, and pot e n t i a l l y through multiple immune effector mechanisms. The f l u i d environment of the c i r c u l a t i o n allows effector c e l l s and other immunological components ( i . e . immunoglobulins, complement) to reach s p e c i f i c s i t e s and agents throughout the body. In the f l u i d environment, leukocytes are free to migrate throughout the c i r c u l a t o r y system. These c e l l s are also able to migrate out of the blood and into s o l i d tissues at s i t e s of injury and 3 inflammation, and i n s p e c i f i c regions of specialized endothelium associated with lymphoid organs. Lymphocytes compose a class of leukocytes which are agranular and mononucleate. They are derived from hematopoietic stem c e l l s which originate i n the bone marrow, and which may enter organs of maturation such as the thymus, f e t a l l i v e r , gut-associated lymphoid tissue, or the bone marrow i t s e l f . Those that enter the thymus are c a l l e d \"thymus-dependent\", or T-lymphocytes, while those that mature outside of the thymus are cal l e d \"thymus-independent\", or B-lymphocytes (in reference to the Bursa of Fabricus, the organ of B-lymphocyte maturation i n b i r d s ) . Maturation i s the process i n which lymphocytes d i f f e r e n t i a t e into immunocompetent c e l l s which express s p e c i f i c receptors f o r antigens. Having completed the maturation process, mature v i r g i n or \"resting\" lymphocytes migrate from t h e i r organ of maturation and form the lymphocyte f r a c t i o n of peripheral blood leukocytes. T-lymphocytes constitute approximately 70-80% of peripheral blood lymphocytes, while B lymphocytes constitute approximately 10-20%. Secondary lymphoid organs such as lymph nodes are the main s i t e s of i n i t i a t i o n of immune responses, i n part due to the great concentration of lymphocytes and antigen presenting c e l l s i n these locations. Within the lymph nodes, lymphocytes undergo a myriad of interactions, allowing ac t i v a t i o n and p r o l i f e r a t i o n of lymphocytes which s p e c i f i c a l l y recognize stimulating antigens. Thus, events leading to T-lymphocyte dependent humoral resonses, and c e l l mediated c y t o t o x i c i t y are i n i t i a t e d through an e f f i c i e n t communication focus. Activated T-lymphocytes mediate the p r o l i f e r a t i o n of B-lymphocytes and t h e i r d i f f e r e n t i a t i o n to antibody-secreting plasma 4 c e l l s . This subset of T-cells i s additionally capable of inducing p r o l i f e r a t i o n of other activated T-lymphocytes, and so are ca l l e d \"helper\" T-lymphocytes. T-lymphocytes are further able to regulate immune responses by l i m i t i n g immune responses through another subset of c e l l s c a l l e d \"suppressor\" T-lymphocytes. F i n a l l y , T-lymphocytes can d i f f e r e n t i a t e into cytotoxic, or \" k i l l e r \" T-lymphocytes, and are able to induce cytotoxic a c t i v i t i e s i n macrophages through lymphokine stimulation. Functional subsets of T-lymphocytes can be discriminated through c h a r a c t e r i s t i c c e l l surface phenotypes. 1.1.2 Monoclonal Antibodies C o l l e c t i v e l y , microbial organisms compose an extrememly large variety of biochemical structures, and u t i l i z e many pathogenic routes for entry and r e p l i c a t i o n i n hosts. The vertebrate immune system has developed the a b i l i t y to recognize a v i r t u a l l y unlimited number of chemical configurations through a humoral response to antigen. This i s accomplished through rearrangement of B - c e l l DNA encoding various regions of the immunoglobulin molecule, and through somatic mutation mechanisms which increase the s t r u c t u r a l d i v e r s i t y of the immunoglobulin idiotype (Hood et a l . , 1984). Further, there are several d i f f e r e n t classes of antibody which can be synthesized, each having i t s own special properties. IgM i s known to have the greatest a f f i n i t y for complement; IgG i s capable of crossing the placenta, and i s known to be especially e f f e c t i v e against v i r a l and b a c t e r i a l agents; and secretory IgA i s present i n mucous secretions, thereby providing immunity to the respiratory and ga s t r o i n t e s t i n a l t r a c t s . Monoclonal antibodies (MAbs) d i f f e r from 5 antibodies produced i n a polyclonal response i n that they are i d e n t i c a l , both with regard to cla s s , and with regard to the i d i o t y p i c recognition s i t e (the polyclonal recognition of a single antigen r e f l e c t s the response of a heterogeneous group of c e l l s , secreting antibodies of d i s t i n c t classes and idiotypes). Thus, whereas a humoral response r e f l e c t s the involvement of multiple gene rearrangements, MAbs are the product of a single gene rearrangement, propagated i n d e f i n i t e l y . Monoclonal antibodies are secreted by hybridomas, a fusion of immune spleen c e l l s with an immortal (reproduces i t s e l f i n d e f i n i t e l y ) c e l l l i n e such as a myeloma c e l l l i n e . This technology was pioneered by Kohler and M i l s t e i n (1975) and resul t s i n an immortal hybrid c e l l l i n e which i s capable of secreting large amounts of s p e c i f i c , i d e n t i c a l MAbs. The production of human MAbs has been a far mor arduous task than the production of murine MAbs; chromosome i n s t a b i l i t y and lim i t e d sources of appropriate c e l l s are two of the most s i g n i f i c a n t problems. Recently, human MAb technology has become more f e a s i b l e , and prospects f o r more extensive use i n the future are becoming better (for review, see Thompson, 1988). Murine MAbs have been invaluable to the i s o l a t i o n and i d e n t i f i c a t i o n of many c e l l surface antigens, and have been very useful i n the exploration of b i o l o g i c a l function and molecular interaction. Murine MAbs are also of importance to human diagnostics and therapeutics. Because of problems inherent i n the development of r e l i a b l e sources of human MAbs, murine MAbs have played important roles i n cancer therapy (for review, see Catane & Longo, 1988), renal translantation (for review, see Norman, 1988), radioimmunodetection of cancer (for review, see Murray & Unger, 1988), and immunocytochemistry (for review, see Bosman, 1988). MAbs are useful because of t h e i r homogeneity i n recognition of a 6 single epitope ( s p e c i f i c antigenic determinant). Although the degree of s p e c i f i c i t y of t h i s recognition i s functionally very high, there are two types of cr o s s - r e a c t i v i t y which have been observed (Yelton et a l . , 1980). One form i s due to the a b i l i t y of antibody to recognize s i m i l a r or i d e n t i c a l epitopes on d i s t i n c t molecules. A second form of cro s s - r e a c t i v i t y can re s u l t from heterogeneity i n the antibody culture supernatent. This i s caused by the secretion of both antibody i d e n t i c a l to that from the parental speen c e l l , and secretion of hybrid antibody molecules from the fusion of parental spleen c e l l and myeloma c e l l components. Thus, although MAbs can be used to i s o l a t e a p a r t i c u l a r c e l l surface molecule through immunoprecipitation, they can not be depended upon to del i v e r antigen i n pure form; the p o s s i b i l i t y of some degree of s p e c i f i c coprecipitation always e x i s t s . Although one must be aware of these properties when using MAbs, they do not detract s i g n i f i c a n t l y from t h e i r usefulness. Hybridomas are capable of secreting 10-50 ug of MAb per ml of culture supernatent, and 1-10 mg per ml of ascites f l u i d (Kohler et a l . , 1986). Thus, they are capable of supplying a v i r t u a l l y l i m i t l e s s supply of uniform, s p e c i f i c recognition elements. Murine MAbs have been extremely valuable tools i n the recognition and i s o l a t i o n of c e l l surface antigens , iexploration of b i o l o g i c a l functions, and human diagnostics and therapeutics. One further advantage remains; murine MAbs can be used to explore the i n vivo functions of the antigens which they recognize i n appropriate animal models, a function which i s d i f f i c u l t to accomplish with MAbs recognizing human antigens, for e t h i c a l reasons. 7 1.2 THE IMMLTNDGLLOBULIN SUPERFAMILY AND T-CELL ACTIVATION 1.2.1 Molecules with Iinmunoqlobulin Homology Molecules with sequence homology to the variable and/or constant regions of immunoglobulins (Igs) comprise a group ca l l e d the Ig superfamily. C r i t e r i a f o r superfamily membership also stipulates that each member has at least one region of conserved I g - l i k e t e r t i a r y protein structure, c a l l e d a homology unit. The homology unit consists of approximately 110 airard.no acids which form two sheets of a n t i p a r a l l e l beta-strands (for review, see Williams and Barclay, 1988). Members of the Ig superfamily include the immunoglobulins (Edelman, 1970), MHC molecules (Kaufman et a l , 1984; Lew et a l . 1986), B 2 microglobulin (Becker & Reeke, 1985), the TCR alpha/beta (Hood et a l . , 1985; Kronenberg et a l , 1986), the TCR delta/gamma (Hata et a l , 1987), CD3 gamma, delta, epsilon, and zeta subunits (Gold et a l , 1986, 1987) , CD2, CD4, and CD8 (Maddon et a l . , 1985; Sewell et a l . , 1986; Clark et a l . , 1987; Littman et a l . , 1987a; Johnson et a l , 1987), CD28 (Aruffo & Seed, 1987), ICAM-1 (Simmons et a l . , 1988; Staunton et a l . , 1988) expressed on lymphocytes, and Thy-1 (Williams & Gagnon, 1982b; Seki et a l . , 1985) expressed on both T lymphocytes and neural c e l l s . Members of t h i s family which are not expressed on lymphocytes but are instead expressed on neural c e l l s include NCAM (Cunningham et a l . , 1987), myelin-associated glycoprotein (MAG) (Arquint et a l . , 1987; Salzer et a l . , 1987; L a i et a l . , 1987), and the peripheral myelin glycoprotein, Po (Lemke & Axel, 1985; L a i et a l . , 1987). Other members include the poly Ig receptor (Mostov et a l . , 1984), Fc receptor (Ravetch et a l . , 1986), receptors f o r growth factors including p l a t e l e t derived 8 growth factor (PDGF-R) (Yarden et a l . , 1986), colony stimulating factor-1 (CSF-1R) (Sherr et a l . , 1985), and the c-fms oncogene (Coussens et a l . , 1986; L a i et a l . , 1987). The functions of t h i s class of immunoglobulin-like molecules are s i m i l a r ; they are involved i n recognition interactions. The immunoglobulin-like domains that these molecules have i n common provide a framework i n which variations i n the loops of sequence between folds can p o t e n t i a l l y lead to differences i n recognition s p e c i f i c i t y (Williams, 1984). This i s true f o r Igs and the clonotypic TCR (Novotny et a l . , 1986), and may also play a role i n other Ig-related recognition molecules (Williams, 1985). 1.2.2 Activation through the T Lymphocyte Receptor Complex Specific recognition of an antigen, i n combination with recognition of autologous major histocompatibility complex antigens, or simple recognition of allogenic MHC molecules, activates T lymphocytes ( through the T c e l l receptor/CD3 complex. Foreign antigen i s recognized by the clonotypic T c e l l receptor, while MHC molecules are recognized concurrently by the clonotypic T c e l l receptor, and either CD4( or CD8. I t has been demonstrated that i n CD8+ T-c e l l s , recognition of MHC results i n optimal a c t i v a t i o n only when CD8 participates with the T - c e l l receptor complex, and that CD8 involvement i s necessary for 11-2 production (Samstag et a l . , 1988); further, i t i s suggested that the MHC class I molecule acts as the physiological cross-linking ligand for CD8 and the T - c e l l receptor. Emmrich et a l . (1986, 1987) have shown that antibody cross-linking of either CD4 or CD8 with the TCR stimulates IL-2 receptor (IL-2R) expression on T- c e l l s . Kupfer and Singer (1987) and 9 Kupfer et a l . (1988) have shown that CD4 and the TCR cocluster (cap) upon interaction with an antigen presenting c e l l (APC), that t h i s cocapping occurs i n the region of c e l l - c e l l contact, and that i t i s dependent on the presence of both appropriate antigen, and the appropriate MHC class I I molecules on the APC. (CD4 and the TCR are independent of each other i n the resting T - c e l l membrane.) Signal transduction i s also a function of the CD4 receptor, as antibody directed against CD4 i n h i b i t s the mobilization of cytoplasmic free calcium, which occurs i n response to CD3 cross-linking. In contrast, when anti-CD3 and anti-CD4 are cross-linked together, the degree of calcium mobilization i s substantially increased over that of CD3 cross - l i n k i n g alone (Ledbetter et a l . , 1988). Further, i t has been shown that human T4 c e l l s can be activated by cross l i n k i n g of class I MHC molecules alone (Geppert et a l . , 1988), c l e a r l y demonstrating the a b i l i t y of these molecules to transduce signals across the membrane. S i m i l a r l y , CD8 i s also thought to be capable of signal transduction, sending a signal which contributes to IL-2 production and responsiveness to IL-2 (Samstag, 1988). The recognition of foreign antigens i n the context of MHC molecules, as described above, i s referred to as \"MHC r e s t r i c t i o n \" (Klein, 1975). The TCR i s a heterodimer, made up of either an alpha/beta subunit combination, or a gamma/delta subunit combination. The alpha/beta TCR, l i k e immunoglobulin, has a variable antigen-recognizing region, a constant region, and a small hydrophobic region which enables i t to anchor within the membrane (Williams, 1985). V a r i a b i l i t y i n the antigen recognition s i t e arises from rearrangement of a large number of variable (V), d i v e r s i t y (D), and joi n i n g (J) segments, s i m i l a r to the 10 rearrangement of immunoglobulin genes. However, unlike the generation of v a r i a b i l i t y i n the antigen-recognition region of Ig, the T c e l l receptor genes do not gain v a r i a b i l i t y from point mutations (Collins & Owen, 1985). Both the alpha/beta (Reinherz et a l . , 1982; Meuer et a l . , 1983, Reinherz et a l . , 1983a; Kaye & Janeway, 1984; Weiss & Stobo, 1984; Brenner et a l , 1985) and gamma/delta TCRs (Borst et a l . , 1987; F e r r i n i et a l . , 1987; Pantaleo et a l . , 1987a; Faure et a l . , 1988) are non-covalently associated with the CD3 complex. The murine alpha and beta subunits of the TCR have a si m i l a r of 45-50 kD, while the gamma and delta TCR subunits have Mj. of 35 kD and 45 kD respectively. CD3 complex consists of gamma (Mr21=kD), delta (Mf=26kD), epsilon (1^=25 kD) zeta (homodimer of two ^ =16 kD chains), and p21 (1^=21 kD, present i n mice, not present i n human CD3 complex.) (Samelson et a l . , 1985a; Oettgen et a l . , 1986). The CD3 complex chains contain long cytoplasmic t a i l s , while the alpha and beta subunits of the TCR only have very short i n t r a c e l l u l a r regions; for t h i s reason, CD3 i s thought to e f f e c t signal transduction upon stimulation of the TCR/CD3 complex. This i s supported by the fact that signal transduction i s triggered by antibodies directed against the CD3 complex i n the absence of accessory c e l l s (Tsoukas et a l . , 1985; Geppert & Lisky, 1987; Ledbetter et a l . , 1988). GTP dependence of the transduction of the CD3 mediated signal i n f e r s involvement of G—protein a c t i v i t y (Mustelin, 1987). Recent evidence has shown that a GTP binding protein regulates the , K phosphorylation of the CD3 complex i n human T lymphocytes (Davies et a l . 1988), which occurs i n response to lymphocyte activation (Davies et a l , 1987). This phosphorylation has been shown to involve protein kinase C (Fried r i c h et a l , 1988), and i s associated with down-regulation of the 11 T3/TCR complex (Cantrell et a l . , 1985). Only those T3/TCR complexes which are phosphorylated are endocytosed (Krangel, 1987). 1.2.3 The Alternative Pathway of Activation: The CD2 Molecule CD2 i s a glycoprotein with a Mj. of 50 kD. CD2 has also been referred to as T i l (Meuer et a l . , 1984b), LFA-2 (Sanchez-Madrid et a l . , 1982), and the sheep erythrocyte receptor (Kamoun et a l . , 1981). CD2 i s expressed on a l l T lymphocytes, large granular lymphocytes (LGLs) with NK a c t i v i t y , and thymocytes (Sanchez-Madrid et al..,.. 1982; Krensky et a l . , 1983). CD2 i s involved i n both adhesion (Takai et a l . , 1987) and a c t i v a t i o n of T c e l l s (Kamoun et a l . , 1981; Sanchez-Madrid et a l . , 1982; Krensky et a l . , 1983; Meuer et a l . , 1984; Yang et a l . , 1986; Springer et a l . , 1986). The ligand to which CD2 binds i s LFA-3, which has a very wide tissue d i s t r i b u t i o n on both hematopoietic and non-hematopoietic c e l l s (Krensky et a l . , 1983; Plunkett et a l . , 1987; Selvaraj et a l . , 1987; Takai et a l . , 1987). The binding of CD2 to LFA-3 i s independent of divalent cations (Spits et a l . , 1986), and contributes to antigen-independent T c e l l conjugate formation (Shaw et a l . , 1986). The CD2-mediated pathway of T c e l l activation requires the presence of a functional CD3 complex i n the T c e l l leukemic l i n e Jurkat (Bockenstedt et a l . , 1988; Alcover et a l . , 1988), but inte r e s t i n g l y i s independent of c e l l surface expression of CD3 i n LGLs (June et a l . , 1986). Binding of LFA-3 to CD2 leads to an increase i n the i n t r a c e l l u l a r concentration of free Ca + ions through a mechanism involving the hydrolysis of membrane phosphoinositides. The hydrolysis of phosphatidylinositol biphosphate ( P I P 2 ) r e s u l t s i n the formation of i n o s i t o l triphosphate ( I P 3 ) which i s involved i n the release of Ca + from internal stores, and 1,2 1 12 d i a c y l g l y c e r o l (DAG) which i s the physiological activator of protein kinase C (Pantaleo et a l . , 1987). Interestingly, i t has been shown that protein kinase C has d i f f e r e n t regulatory roles with respect to CD3 and CD2. While activation of protein kinase C down-regulates the expression of CD3, i t stimulates increased expression of CD2. Prolonged stimulation of protein kinase C i n h i b i t s c e l l a c t i v a t i o n v i a CD3, and promotes activation v i a CD2 (Cantrell et a l . , 1988). Thus, i t seems reasonable to assume that upon recognition of antigen presented by an APC, a c t i v a t i o n of the T lymphocyte i s enhanced by concurrent binding of CD2 to i t s ligand LFA-3, thus contributing s t a b i l i t y to the antigen-TCR complex interaction (Shaw et a l . , 1986; Spits et a l . , 1986), and setting i n motion the synergistic a c t i v a t i o n pathways of CD3 and CD2 (Yang et a l , 1986, 1988). Activation through the CD2 pathway i s dependent on an intact CD2 cytoplasmic domain, i n f e r r i n g that t h i s domain i s involved i n the genesis of a stimulatory signal (Bierer et a l . , 1988). Cross-linking of CD3 to CD2 results i n a marked enhancement of T c e l l activation (Andereson et a l . , 1988), suggesting that CD2 plays an important role with CD3 i n the a c t i v a t i o n of T c e l l s , i n addition to i t s role i n c e l l u l a r adherence. 1.2.4 The Major Histocompatibility Complex The major histocompatibility complex (MHC) genes encode c e l l surface proteins which f a l l into two classes. Class I MHC antigens are found on the surface of v i r t u a l l y a l l c e l l types, and constitute what are normally considered to be \"transplantation antigens\". The expression of class I I MHC antigens i s primarily r e s t r i c t e d to c e l l s within the lymphoid system, such as macrophages and other 13 antigen-presenting c e l l s (APC), including Langerhans c e l l s of the skin, B - c e l l s , and some activated T - c e l l s . However, under special circumstances, another c e l l type can be recruited to an APC phenotype; gamma interferon induction of class I I MHC i n endothelial c e l l s (Pober et a l . , 1983; Geppert & Lipsky, 1987), s i g n i f i e s a unique, inducible role of endothelium i n antigen presentation. Products of the MHC serve to bind processed foreign antigens to be recognized by the clonotypic T-lymphocyte receptor complex, while the MHC molecules themselves are recognized by s p e c i f i c T-lymphocyte recognition molecules known as CD4 and CD8. CD4 i s known to bind d i r e c t l y to class I I molecules (Doyle & Strominger, 1987; Gay et a l , 1988), and CD8 i s known to bind d i r e c t l y to class I molecules (Norment et a l . , 1988; Rosenstein et a l . , 1989) (both even i n the absence of T-lymphocyte receptor-antigen interactions). Because d i s t r i b u t i o n of CD4 and CD8 are mutually exclusive on mature T-lymphocytes, two functional subsets of T-lymphocytes are distinguished on the basis of t h e i r recognition of MHC molecules (CD4+ & CD8+ subsets of T - c e l l s ) . More generally, CD4+ c e l l s are helper or delayed hypersensitivity associated, whereas CD8+ c e l l s are suppressor or cytotoxic a c t i v i t y associated. Murine class I antigens span the membrane, and comprise a glycoslylated heavy chain of 44-47 kD, that i s non-covalently linked to B 2 microglobulin (11.5 kD), (not encoded by the MHC genes) (Steinmeitz, 1984). Like class I molecules, class I I molecules are encoded by the MHC genes. Class I I molecules also span the membrane, and are composed of two glycosylated proteins, which are strongly associated to form a two-chain structure. The larger chain has a ^ of 32-36 kD and i s termed alpha, while the smaller chain has a Mj. of 14 25-30 kD and i s termed beta. Both class I (Townsend et a l . , 1985, 1986) and class I I molecules (Babbit et a l . , 1985) have been shown to have a f f i n i t y for peptide antigens, and i t has been shown that T c e l l s recognize a complex of MHC class II/antigen. (Ashwell et a l . , 1986; Watts et a l . , 1986). Both MHC class I and I I are highly polymorphic, with 50 di f f e r e n t a l l e l e s i d e n t i f i e d i n class I K and D l o c i alone (Klein, 1979). 1.2.5 Other ac t i v a t i o n antigens within the immunoglobulin superfamily In addition to MHC class I and I I , CD4, CD8, the TCR/CD3 complex, and CD2, there are other molecules within the immunoglobulin superfamily which are involved i n the activation or interactions of T lymphocytes. These include murine Thy-1, human CD28, and ICAM-1. Thy-1 i s a membrane glycoprotein of M^ , 18-25 kD. Thy-1 i s expressed on both lymphoid lineages and neural c e l l s , and i s attached to the membrane through a phosphatidyl i n o s i t o l moiety (Low & Kincade, 1985). As the hydrolysis of phosphatiyl i n o s i t o l i s involved i n several physiological processes, i t i s possible that t h i s anchor confers special properties to those proteins which are anchored by i t i n the membrane (for review, see Low and S a l t i e l , 1988). Thy-1 has been shown to function as a signal transduction molecule i n both T c e l l s and transfected B c e l l s (Kroczek et a l . , 1986), and l i k e CD2, appears to require the coexpression of the CD3/Ti complex i n order to influence activation of T c e l l s (Gunter et a l . , 1987). CD28 i s a homodimer of two glycoproteins of M^ . 44 kD (also known as T44). The homodimer i s disulphide-linked, as i t has an apparent Mj. of 80-85 kD under non-reducing conditions (Moretta et a l . , 15 TABLE I LYMPHOID MOLECULES OF THE IMMUNOGLOBULIN SUPERFAMILY Antigen D i s t r i b u t i o n Functions Immunoglobulin MHC Class I B c e l l s , plasma c e l l s . Most vertebrate c e l l s . Antigen recognition. Transplantation antigens, corecognition marker on v i r a l l y - i n f e c t e d c e l l s for a c t i v a t i o n of TQ c e l l s . MHC Class I I Thymic epithelium, macrophages, dendritic c e l l s , inducible on endothelium, B c e l l s , some activated T c e l l s . Corecognition marker for acti v a t i o n of T H c e l l s and some T 0 c e l l s . TCR alpha/beta TCR gamma/delta CD3 gamma, de l t a , epsilon, zeta subunits. Most mature T c e l l s . CD3+ alpha/beta- T c e l l s Thy-1+ dendritic c e l l s , CD3+ LGL's. Most T c e l l s , some NK c e l l s . Recognition of antigens i n context of MHC. Antigen recognition on some TQ c e l l s , possible regulation of MHC-non-r e s t r i c t e d c y t o t o x i c i t y . Involved i n signal transduction through the TCR/CD3 complex, down-regulated by protein kinase C. CD2 A l l thymocytes, peripheral T c e l l s , some LGL's. Ant igen-independent ac t i v a t i o n molecule. Expression increased by protein kinase C, ligand i s LFA-3. 16 TABLE I (cont.'d) LYMPHOID MOLECULES OF THE IMMUNOGLOBULIN SUPERFAMILY Antigen D i s t r i b u t i o n Functions LFA-3 CD4 Lyrrihoid and non-lymphoid c e l l s . Most helper/inducer & suppressor/inducer T c e l l s . Ligand for CD2, capable of t r i g g e r i n g antigen-independent activation of T c e l l s through CD2. Recognition of MHC class I I molecules. Capable of signal transduction. CD8 Most cytotoxic and suppressor T c e l l s . Recognition of MHC class I molecules. Capable of signal transduction. CD28 Thy-1 Majority of peripheral T c e l l s , some thymocytes, plasma c e l l s . Neural c e l l s , T-cells T c e l l a c t ivation i n the presence of phorbol ester (PMA) or accessory c e l l s , synergism with anti-CD3. Involved i n signal transduction ICAM-1 E p i t h e l i a l c e l l s , macro-phages, dendritic c e l l s , lymphocytes (esp. activated lymphocytes), inducible on Ligand f o r LFA-1; adhesion molecule involved i n lymphoid interactions and fib r o b l a s t s and endothelium, esp. inflammation. 17 1985; Martin et a l . , 1986). I t i s expressed i n humans on resting and activated T lymphocytes, some T c e l l leukemias, and a small population of thymocytes (Hansen et a l . , 1980). Antibodies directed against CD28 are capable of enhancing and sustaining CD3 activated c e l l s for extended periods (Ledbetter et a l . , 1985), without involving i n o s i t o l l i p i d metabolism and resultant mobilization of Ca + from i n t r a c e l l u l a r stores (Pantaleo et a l . , 1986). Recent evidence suggests that the signal transduced through CD28 may play a very important role i n CD3/TCR mediated T - c e l l responses (Damle at a l . , 1988). The l a s t molecule of t h i s immunoglobulin-related family i s also the most recently discovered, ICAM-1; t h i s molecule s h a l l be examined i n d e t a i l i n Section 1.3.5. 1.2.6 Neural Molecules with Immunoglobulin Homology Interestingly, within the immunoglobulin superfamily are several molecules expressed on c e l l s of neural o r i g i n . These molecules include the previously mentioned Thy-1 molecule, which i s also expressed on T lymphocytes, the myelin-associated glycoprotein (MAG) (Salzer et a l . , 1987), and NCAM (Barthels et a l . , 1987; Cunningham et a l . , 1987; Matsunaga & Mori, 1987; Williams, 1987). Of significance to t h i s thesis i s the relationship between MAG, NCAM, and ICAM-1, which share a high degree of homology (Simmons et a l . , 1988). ICAM-1 and NCAM share homology between a l l f i v e of t h e i r e x t r a c e l l u l a r domains (Ibid). NCAM shares a s i m i l a r l y homologous relationship with CD2, yet ICAM-1 and CD2 are not nearly as extensively related (Ibid). Thus, i t has been speculated that some precursor of NCAM has given r i s e to both CD2 and ICAM-1 molecules of the immune system (Ibid). \\ i 18 This i s one of many relationships which unites the immune system with the nervous system. As a discussion of t h i s topic i s beyond the scope of t h i s thesis, the following references are recommended for further information regarding t h i s relationship: (Roszman & Brooks, 1988; Benveniste, 1988; Bost, 1988; Blacock, 1988; Fontana et a l . , 1987). 19 1.3 ADHESION MOLECULES WITHIN THE IMMUNE SYSTEM 1.3.1 The Role of Adhesion C e l l u l a r adhesion i s a necessary attr i b u t e of the c e l l s involved i n immune and inflammatory processes. Adhesion i s re q u i s i t e to leukocyte d i f f e r e n t i a t i o n , t r a f f i c k i n g , a c t i v a t i o n , and p r o l i f e r a t i o n . Examples of immunological mechanisms requiring adhesion are (1) the extravasation of lymphocytes through post c a p i l l a r y high endothelial venules (HEV) enabling the r e c i r c u l a t i o n of these c e l l s between the blood and lymphoid organs (Rasmussen et a l . , 1985), (2) extravasation of leukocytes at s i t e s of inflammation (Freemont & Ford, 1985), (3) interactions between effector and regulatory T c e l l s (Inaba and Steinman, 1985), (4) interactions between T c e l l s and antigen presenting c e l l s (APC), whether they be macrophages, B c e l l s , dendritic c e l l s , or endothelial c e l l s (Hirschberg et a l . , 1980; Chesnut et a l . , 1982; Inaba et a l . , 1984), (5) T c e l l help for B c e l l s (Tedder et a l . , 1985), and (6) cell-mediated l y s i s of virus-infected or tumor target c e l l s (Martz, 1977). Several molecules have been defined which make s p e c i f i c contributions to c e l l adhesion i n the immune system, and which influence the functions of lymphocytes and other leukocytes. The molecules LFA-1, ICAM-1, CD2, LFA-3, CD4 and CD8 are a l l known to enhance antigen s p e c i f i c functions (Springer et a l . , 1987), while LFA-1, ICAM-1, CD2, and LFA-3 are known to contribute additionally to antigen-independent T-lymphocyte adherence. These molecules act as receptor-ligand pairs. The ligands for CD4 and CD8 are MHC class I I and class I molecules respectively. The ligand for CD2 i s LFA-3, and a ligand for LFA-1 i s 20 ICAM-1. A l l of these molecules except LFA-1 are members of the immunoglobulin superfamily, and three of these four pairs of receptor-ligands represent adhesive interactions between members of t h i s superfamily. LFA-1 and ICAM-1 represent the f i r s t known example of natural receptor-ligand adhesive interactions between a member of the i n t e g r i n superfamily (LFA-1) and a member of the immunoglobulin superfamily (ICAM-1) (Staunton et a l . , 1988). Although ICAM-1 does not contain the c l a s s i c i ntegrin recognition sequence (Simmons et a l . , 1988) ARG-GLY-ASP (RGD) (Rouslahti & Pierschbacher, 1986), i t s interaction with LFA-1 may be by v i r t u e of a portion of i t s sequence which i s very s i m i l a r i n sequence and i n biochemical properties, ARG-GLY-GLU (RGE) (Horley et a l . , 1987). 1.3.2 Endothelial C e l l s The endothelium i s now being recognized as playing a very in t e r a c t i v e role i n the immune system. Pober (1988) has reintroduced the term \"endothelial a c t i v a t i o n \" , defining i t s i m i l a r l y to macrophage ac t i v a t i o n (Adams & Hamilton, 1984), as \"quantitative changes i n the l e v e l of expression of s p e c i f i c gene products ( i . e . , proteins) that, i n turn, endow endothelial c e l l s with new capacities that cumulatively allow endothelial c e l l s to perform new functions.\" Endothelial c e l l s thus become activated upon stimulation by cytokines, especially IL-1 (interleukin-1) alpha and beta, TNF (tumor necrosis factor/cachectin), LT (lymphotoxin), and IFN-gamma (interferon-gamma). The cytokine-mediated activation of endothelial c e l l s includes the increased expression of the normal endothelial surface MHC class I molecule and the induced expression of MHC class I I molecules (Pober et a l . , 1983, 21 C o l l i n s et a l . , 1984); reorganization of cytoskeletal elements i n v i t r o (Stolphen et a l . , 1986); increased endothelial adhesiveness i n v i t r o (Yu et a l . , 1985; Masuyama et a l , 1986); f a c i l i t a t i o n of antigen-presentation i n v i t r o (Geppert & Lipsky, 1985); induction of the transient expression of ELAM-1 (endothelial-leukocyte adhesion molecule-1) (Bevilacgua et a l . , 1987); and induction of prolonged and stable expression of ICAM-1 (Pober et a l . , 1987). I t i s beyond the scope of t h i s thesis to cover the range of t h i s topic even b r i e f l y ; the above description i s meant to increase awareness that the endothelium i s not an inert permeability b a r r i e r , but i s instead a c t i v e l y involved i n many physiological processes including adhesion of leukocytes, t r a f f i c k i n g and homing of lymphocytes, and acute and chronic inflammation. 1.3.3 Lymphocyte Homing I t has been postulated that c e l l s w i l l migrate to places favorable for t h e i r adhesion, the operating p r i n c i p l e being that migration i s f a c i l i t a t e d by adhesive interactions which do not immobilize the c e l l , while immobilization occurs only at s i t e s where very strong adhesive interactions (Rouslahti & Pierschbacher, 1987) take place. One of the most important functions of c e l l migration i n vertebrates i s the process of lymphocyte homing and r e c i r c u l a t i o n . Lymphocyte homing refers to the organ- or region-specific adhesion to endothelium by lymphocytes. This f a c i l i t a t e s lymphocyte escape from the vascular compartment (extravasation) which i s known to be involved i n the normal process of lymphocyte r e c i r c u l a t i o n or t r a f f i c k i n g . Recirculation of lymphocytes i s i n i t i a t e d i n s p e c i f i c regions of 22 endothelium associated with lymphoid organs called post capillary high endothelial venules (HEV). The microscopic appearance of HEV were apparently described as early as 1898 by Thome. The endothelium of HEV are modified, composed of polygonal-columnar or -cuboidal c e l l s : \"high\" in comparison to the pavemented endothelium characteristic of most vascular endothelia. Large numbers of lymphocytes can be seen in the lumen and in the various layers of the venule walls. Cahill and coworkers (1976) estimated that 10 4 lymphocytes leave the bloodstream in a single lymph node every second, and may increase by an order of magnitude upon antigen stimulation. The phenomenon of lymphocyte recirculation was f i r s t recognized by Gowans in 1964, and has since been shown to be extremely important in the maintenance of immune surveillance. Lymphocyte extravasation i s promoted by adhesion to endothelia, and this adhesion i s mediated by c e l l surface determinants on both the lymphocyte and the endothelial surface. HEV are normal tissue components of lymphoid organs, but a similar morphology i s also induced at sites of chronic inflammation. Coupled with other information, this suggests that the HEV morpholgy is a product of immune c e l l activity. Firs t , i t has been shown that rat lymph node HEV revert from the cuboid form to the f l a t endothelial form when deprived of afferent lymphatics (Hendricks et a l . , 1980, Hendricks & Eestermans, 1983). Second, lymphocytes are capable of extravasation at sites of acute inflammation outside of lymhoid tissue, before the HEV-like morphology has developed (Freemont & Ford, 1985). Third, the elaborated products of activated lymphocytes, such as interferon-gamma, have been shown to induce the expression of an HEV-specific antigen (Duijvestij et a l . , 1986). It has thus been postulated that the 23 development of the HEV morphology may be linked to persistent stimulation by immune c e l l s (Pals et a l . , 1989). Adhesive interactions between lymphocyes and lymphoid tissue HEV have been shown to be organ-selective; although a l l HEV are capable of promoting extravasation of lymphocytes, d i f f e r e n t lymphocytes exhibit d i s t i n c t preferences for adhesion to, and migration through the HEV of pa r t i c u l a r types of tissues. This s e l e c t i v i t y e x i s t s with regard to at least three di f f e r e n t tissues including peripheral lymph nodes, Peyers's patches, and the synovium of inflamed j o i n t s (Butcher et a l . , 1980; Jalkanen et a l . , 1986a; and Chin et a l . , 1988). S e l e c t i v i t y for s p e c i f i c tissues allows lymphocytes to become segregated on the basis of th e i r t i s s u e preference into d i s t i n c t populations, and helps to explain the prevelence of B c e l l s i n Peyer's patches, T c e l l s i n peripheral lymph nodes, and region-specific l o c a l i z a t i o n of antigen-stimulated effector c e l l s (for review, see Berg et a l . , 1989). Tissue s p e c i f i c i t y of lymphocyte migration through HEV suggests that HEV express a class of lymphocyte-specific adhesion molecules which are not expressed i n t y p i c a l endothelia, and which vary between the HEV of d i f f e r e n t lymphoid or inflammatory tissues. Indeed, t h i s i s the case; the term \"vascular addressins\" has been coined (Butcher et a l . , 1987) to represent t i s s u e - s p e c i f i c endothelial molecules, while the lymphocyte molecules which recognize these endothelial markers are cal l e d \"homing receptors\". A recently described example of an addressin i s the mucosal HEV antigen defined by the MECA-367 and MECA-89 MAbs (Streeter et a l . 1988). These antibodies i n h i b i t the binding of lymphocytes to mucosal lymphoid tissue HEV, but not non-mucosal lymphoid tissue HEV. Known lymphocyte homing receptors are defined by the 24 antibodies anti-gp90, Hermes-1, -2, -3, ( i n humans) and MEL-14 (in mice). These antibodies recognize glycoproteins with a Mj. of 90 kD, and a common ac i d i c i s o e l e c t r i c point (pl=4.2)(Gallatin et a l . , 1983; Jalkanen et a l . , 1986, 1987). Hermes-1 l i k e l y recognizes a constitutive portion of gp90 homing receptor family, i n that i t i s capable of blocking lymphocyte binding i n HEV of a l l tested human tissues. MEL-14 blocks binding of lymphocytes to murine HEV, and cross reacts with Hermes-1, yet i s only capable of blocking adhesion to lymph node HEV, and not mucosal HEV i n humans. The cycle of r e c i r c u l a t i o n of lymphocytes ceases when the lymphocyte becomes activated by s p e c i f i c antigen. Lymphocytes then lose expression of functional homing receptors (Reichert et a l . , 1983), and regain the a b i l i t y to remain fi x e d within the lymphoid tissue. Thus, i t seems l i k e l y that the function of the MEL-14/Hermes-l antigens i s to d i r e c t the r e c i r c u l a t i o n of mature, unstimulated lymphocytes. Another lymphocyte molecule implicated as a homing receptor i s the i n t e g r i n LFA-1. Although LFA-1 i s known to be involved i n the binding of lymphocytes to endothelium (Mentzer et a l . , 1986) and lymphocyte homing (Pals et a l . , 1988; Hamann et a l . , 1988), i t s ro l e i n homing i s l i k e l y to be an accessory one since i n h i b i t i o n of lymphocyte binding to HEV by anti-LFA-1 i s not t i s s u e - s p e c i f i c , and effects are not as pronounced as the MEL-14/Hermes group. Since LFA-1 expression i s co n s t i t u t i v e and widespread on leukocytes, i t seems more l i k e l y that LFA-1 and the other integrins play an important role i n leukocyte migration, and contribute accessory adhesive forces to that of the t i s s u e - s p e c i f i c homing receptors. 25 1.3.4 The Inteqrins The i n t e g r i n superfamily consists of a group of alpha/beta, non-covalently associating hetero-dimeric cell-surface proteins which function as receptors f o r ligands which (usually) contain an RGD recognition sequence (Ruoslahti & Pierschbacher, 1986; Hynes, 1987). Within the integrins, three groups of molecules can be discerned on the basis of t h e i r beta subunits: The very l a t e a c t i v a t i o n (VIA) antigen c l u s t e r , chicken i n t e g r i n complex, and fibronectin receptor share a common beta-^ subunit; LFA-1, Mac-1, and pl50,95 share a common beta2 subunit, while the v i t r o n e c t i n receptor and p l a t e l e t glycoprotein I l b / I I I a share a common beta^ subunit (Hynes, 1987). Within each group, the shared beta subunit i s paired with various alpha subunits which confer unique char a c t e r i s t i c s to each member of the family. The beta-^ subgroup are receptors for e x t r a c e l l u l a r substrates, and have a c i d i c i s o e l e c t r i c points; LFA-1 of the beta 2 subgroup binds to ICAM-1 and may have other ligands as w e l l , while Mac-1 and pi50/95 bind the C3bi component of complement; and i n the beta 3 subgroup, the v i t r o n e c t i n receptor binds v i t r o n e c t i n , while the p l a t e l e t glycoprotein I l b / I I I a binds fibronectin, fibrinogen, v i t r o n e c t i n , von Willebrand factor, and possibly thrombospodin (for review, see Hemler, 1987). As LFA-1 i s the receptor for ICAM-1, t h i s section has i t s main emphasis on t h i s molecule. LFA-1, as mentioned above, i s most closely related to Mac-1 and pl50/95, on the basis of sharing i d e n t i c a l beta subunits which have a Mj. of 95 kD, c o l l e c t i v e l y referred to as CD18. LFA-1 i s di f f e r e n t i a t e d from Mac-1 and pl50/95 by the fact that each of these molecules has a unique alpha subunit: the alpha subunit of LFA-1 26 i s referred to as CDlla, and has a Mj. of 180 kD; the alpha subunit of Mac-1 i s referred to as CDllb, and has a Mj. of 170 kD; and the alpha subunit of pl50/95 i s referred to as CDllc, and has a ^ of 150 kD (Sanchez-Madrid et a l . , 1983). The importance of t h i s subgroup of the integrins i s made very apparent by the presence of a genetically linked immunodeficiency disease which results from the i n a b i l i t y or decreased a b i l t y to synthesize the beta chain common to these three molecules. This disease, leukocyte adhesion deficiency (LAD), i s \"characterized by recurrent b a c t e r i a l infections, impaired pus formation and wound healing, and abnormalities i n a wide spectrum of adherence-dependent functions of granulocytes, monocytes, and lymphoid c e l l s . \" (Anderson & Springer, 1987). Mac-1 and pi50,95 are shown to play very important functional roles i n granulocytes and monocytes (Springer et a l . , 1984, 1986; Springer & Anderson, 1986) as LAD patients have deficent chemotaxis and phagocytosis of C3bi opsonized p a r t i c l e s (Bowen et a l . , 1982). Recurrent b a c t e r i a l i n f e c t i o n i n the absence of recurrent v i r a l or fungal infections suggests that monocytes and granulocytes are most greatly affected by the loss of the CD18 ( common beta subunit) molecule. I t has been hypothesized that lymphocytes are less d r a s t i c a l l y affected by v i r t u e of the fact that they only express, LFA-1, while granulocytes and monocytes express Mac-1, pi50/95, and LFA-1 (Sanchez-Madrid et a l , 1983; Krensky et a l , 1983). This may also be due to other compensatory mechanisms expressed i n lymphocytes, although the r e l a t i v e difference i n effect i s abrogated i f the LFA-1 deficiency i s too severe. In t h i s case, CTL- and NK-mediated c y t o l y s i s i s greatly depressed (Krensky et a l , 1985). The beta chain of the LFA-1 subgroup shares s i g n i f i c a n t homology 27 with the beta chains of the other integrins (Kishimoto et a l . , 1987). As previously mentioned, the integrins as a group recognize t h e i r ligands at regions which contain the sequence RGD (Hynes, 1987), although the only described ligand of LFA-1 i n the human system does not contain t h i s sequence. Binding of LFA-1 to ICAM-1 may be due to the presence of a s i m i l a r sequence (RGE) (Horley et a l . , 1989), or may be due to immunoglobulin-like adhesive properties of ICAM-1 (Simmons et a l , 1988). While the upregulation of expression of Mac-1 and pl50/95 are thought to play an important role i n t h e i r functions ( M i l l e r et a l . , 1987), LFA-1 expression tends to be far less variable. However, i n some cases, LFA-1 expression does change. This has been documented through the increased expression of LFA-1 seen on human memory lymphocytes, which also exhibit an enhanced a b i l i t y to produce interferon-gamma (Sanders et a l . , 1988), and by the demonstration that LFA-1 + c i r c u l a t i n g monocytes can give r i s e to LFA-1 - macrophages after emigration into tissues (Kurzinger et a l . , 1982; Strassman et a l . , 1985), while stimulation of macrophages with interferon-gamma leads to reexpression of LFA-1 (Strassman et a l . , 1985). Homotypic aggregation of resting lymphoid c e l l types has been shown to be LFA-1 dependent (Rothlein & Springer, 1986; Mazerolles et a l . , 1985), and independent of the other antigen-independent adhesion pathway mediated by CD2 and LFA-3, which requires a c t i v a t i o n of T lymphocytes before i t becomes involved (Mazerolles et a l . , 1985). As previously mentioned (Sec. 1.2.3), the CD2/LFA-3 adhesion pathway contributes to activation of T - c e l l s , since MAb to CD2 can activate T c e l l s (Meuer et a l . , 1984), and LFA-3 binding to CD2 can contribute to 28 t h i s a c t i v a t i o n pathway (Bierer et a l . , 1987; Hunig et a l . , 1987). The fact that the contribution of CD2 to T c e l l a c t ivation i s l o s t without an intact CD2 cytoplasmic domain strongly implicates t h i s molecule as being capable of signal transduction, as well as adherence (Bierer et a l . , 1988). The lymphocyte recognition elements CD4 (Ledbetter et a l . , 1988) and CD8 (Samstag et a l , 1988) are also thought to be capable of transducing signals across the c e l l membrane. Recently, evidence provided by Pircher (Pircher et a l , 1986) showed that a MAb to LFA-1 was capable of inducing murine T c e l l p r o l i f e r a t i o n and interferon-gamma production. This has been supported by evidence that MAb to the alpha subunit of LFA-1 i s capable of strongly enhancing the T c e l l p r o l i f e r a t i v e response i n CD3 stimulated c e l l s (van Noesel et a l . , 1988; Carrera et a l . , 1988). Thus, l i k e the other lymphocyte-function associated adhesion molecules, LFA-1 seems capable of delivering a s i g n i f i c a n t transmembrane s i g n a l . LFA-1 i s involved i n a myriad of immunological interactions. For example, T cell-mediated c y t o t o x i c i t y depends on three sequential steps, s t a r t i n g with i n t e r c e l l u l a r conjugate formation between the T effector c e l l and the target c e l l (Martz, 1977). I t has often been supposed that antigen-specific recognition by the TCR i n i t i a t e d t h i s contact, and that accessory adhesion molecules strengthen the bond, but i t now seems l i k e l y that bond formation i s dependent upon antigen-independent conjugate formation (Shaw & Ginther Luce, 1987; Blanchard et a l . , 1987), and that the involvement of the antigen-specific TCR i s related to the delivery of the l e t h a l h i t (Blanchard et a l . , 1987). Both of these studies implicated LFA-1 i n the f i r s t step, antigen-independent conjugate formation. 29 Si m i l a r l y , the conjugation of helper T c e l l s with B c e l l s to provide B c e l l s with p r o l i f e r a t i v e signals was once thought to be mediated by the T4 (CD4) antigen, but has since been shown to be independent of T4, and instead dependent on the presence of LFA-1 on the T c e l l (Tedder et a l . , 1986; Howard et a l . , 1986). Homotypic adhesive interactions between B c e l l s have also been shown to be mediated by the LFA-1 molecule (Mentzer et a l , 1985) and LFA-1 i s even thought to play a ro l e i n the discrimination between s e l f and non-self (Benjamin et a l . , 1988). Antibody to LFA-1 can induce tolerance (Springer et a l . , 1987), patients with LAD accept HLA-mismatched bone marrow grafts from t h e i r parents, and anti-LFA-1 antibodies have been used successfully to mimic t h i s condition, and have resulted i n acceptance of of HLA-mismatched bone marrow grafts (Fischer et a l , 1986). More recently, anti-LFA-1 antibody has been used to prevent, and even reverse graft-vs-host disease (GVHD) i n mice with skin grafts (Shiohara et a l . , 1988). C e l l u l a r interactions between T c e l l s and monocytes have been found to depend on LFA-1, with no dependence on pl50/95 or Mac-1, although a l l three of these molecules ex i s t on the monocyte surface. The T-cell/monocyte interaction could be inhib i t e d by pretreatment of either monocytes or T c e l l s with anti-LFA-1, showing that LFA-1 on both c e l l s i s involved i n the binding of these c e l l types (Dougherty & Hogg, 1987). Monoclonal antibodies directed against LFA-1 have also been found to i n h i b i t the mixed lymphocyte reaction (MLR) (Davignon et a l , 1981; Pierres et a l . , 1982). I t has been suggested that \"LFA-1 mediated contact i s an essential step i n c e l l u l a r interactions i n the immune system i n general.\" (Hamann et a l . , 1986). N The interaction between LFA-1 and i t s ligand has been shown to be heterophilic, since EBV-transformed c e l l l i n e s derived from patients deficient i n LFA-1 f a i l to self-aggregate, yet can aggregate with LFA-1 + c e l l s . Monoclonal /antibodies were thus developed against LFA-1\" c e l l s , and were screened for a b i l i t y to i n h i b i t aggregation of LFA-1 + c e l l s . The res u l t was MAb RR1/1, which recognizes the f i r s t known ligand of LFA-1, i n t e r c e l l u l a r adhesion molecule-1 (ICAM-1) (Rothlein et a l . , 1986). 1.3.5 The i n t e r c e l l u l a r adhesion molecule (ICAM-1) The human i n t e r c e l l u l a r adhesion molecule (ICAM-1) (Rothlein et a l . 1986), was f i r s t discriminated through antibodies raised against LFA-1 de f i c i e n t c e l l s , and screened for the a b i l t y to i n h i b i t phorbol ester induced aggregation of the LFA-1 + EBV-transformed c e l l l i n e JY. This c e l l surface protein was shown to be a single peptide chain with Mj. of 90 kD. I t has a 55 kD protein backbone (Dustin et a l . , 1986), and N-glycosylation s i t e s are predicted by i t s primary sequence (Staunton et a l . , 1988). Also known as CD54 (Knapp et a l . , 1989), ICAM-1 has been shown to be a ligand of LFA-1 (Marlin & Springer, 1987; Simmons et a l . , 1988). Although the hallmark\" of the in t e g r i n superfamily i s the binding of ligands which contain the RGD seguence (Hynes, 1987), ICAM-1 does not contain t h i s sequence. Instead, the ICAM-1 molecule contains a s i m i l a r sequence i n which the l a s t residue, aspartic acid, i s substituted for by glutamic acid, an amino acid which bears the closest resemblence to aspartic acid i n terms of structure and biochemical properties. Thus, the RGE sequence found at position 152 i n the amino acid sequence of ICAM-1 (Simmons et a l , 1988) may be the basis of recognition of ICAM-1 by LFA-1. The binding of 31 been shown to be energy-dependent (binding i s inhib i t e d by the addition of sodium azide plus 2-deoxy-D-glucose), temperature-dependent (reduced binding at 14 degrees centigrade, loss of binding at 4 degrees centigrade), and requires the presence of an intact cytoskeleton (binding inhibited by cytochalasin B) (Marlin & Springer, 1987). The ICAM-1 molecule has been shown to be extremely important i n i t s interaction with LFA-1 i n a variety of leukocyte adhesion functions including T c e l l / T c e l l , T c e l l / B c e l l , T cell/monocyte, B c e l l / B c e l l , and T c e l l / e n d o t h e l i a l c e l l interactions (Boyd et a l . , 1988; Makgoba et a l . , 1988; Dougherty et a l . , 1988; Dustin et a l . , 1988) involved i n regulation of the humoral and cell-mediated immune responses, and i n the process of inflammation. Although i t i s not the only ligand for LFA-1 (Dustin & Springer, 1988; Staunton et a l . , 1989), i t s widespread involvement i n immunological interactions and the process of inflammation underscore the importance of t h i s p a r t i c u l a r ligand of LFA-1. The second known ligand of LFA-1 i s ICAM-2 (Staunton et a l . , 1989), a molecule with a predicted IL of 46 kD. ICAM-2 contains two e x t r a c e l l u l a r domains, which are 34% homologous to the two N-terminal-most domains of ICAM-1 (Ibid). S i g n i f i c a n t l y , these two domains are responsible for the binding properties of ICAM-1 (Ibid). The primary structures of ICAM-1 and ICAM-2 show that they are members of the immunoglobulin superfamily; ICAM-1 having f i v e e x t r a c e l l u l a r immunoglobulin-like domains (Staunton et a l . , 1988), and ICAM-2 having two immunoglobulin-like domains (Staunton et a l . , 1989). Recently, three classes of immunoglobulin-like domains have been distinguished: V, Cj_, and C 2 (Williams & Barclay, 1988). ICAM-1 belongs to the C 2 class which corresponds to proteins involved i n c e l l 32 adhesion (Staunton et a l . , 1988), members of which include CD2, LFA-3, MAG, and NCAM. ICAM-1 also contains conserved amino acid residues c h a r a c t e r i s t i c of the C-^ c l a s s , which corresponds to proteins involved i n antigen recognition, but o v e r a l l homology i s most s i g n i f i c a n t with the immunoglobulin-like domain class (Ibid), and the neural c e l l adhesion molecule (NCAM) (Simmons et a l . , 1988). The homology between NCAM and ICAM-1 allows alignment between a l l f i v e e x t r a c e l l u l a r immunoglobulin-related domains (Ibid) and the binding of NCAM i s s i m i l a r l y dependent on divalent cations, although i t s binding i s homophilic (Brakenbury et a l . , 1977). S i g n i f i c a n t l y , CD2 has been shown to bear a si m i l a r resemblance to NCAM as does ICAM-1, yet CD2 and ICAM-1 exhibit only weak homology. Thus i t seems that a precursor to NCAM has served as ancestor to both CD2 and ICAM-1 (Simmons et a l . , 1988). Other s i m i l a r i t i e s e x i s t between ICAM-1, NCAM, and the other members of the immunoglobulin superfamily (for reviews, refer to Sec. 1.1.5). This s i m i l a r i t y , as well as many other known relationships between the immune and nervous systems, i s unveiling a very complex, yet precisely structured system of what i s now becoming referred to as the neuroendocrine-immune network (Roszman & Brooks, 1988). I t has been suggested that ICAM-1 plays a unique and essential r o l e i n inflammation (Boyd et a l . 1989) since, although i t s expression i s low on a wide variety of hematopoietic and non-hematopoietic tissues, i t s expression i s high on tissues i n areas of inflammation, or i n lymph nodes which drain regions of inflammation (Dustin et a l . , 1986; Cotran et a l . , 1987). The wide d i s t r i b u t i o n of ICAM-1, even at low le v e l s , i s very s i g n i f i c a n t because ICAM-1 expression i s inducible by inflammatory cytokines (see below). In contrast, ICAM-2 has not been found to be 33 inducible on any tissues tested thus fa r (Staunton et a l . , 1989). ICAM-1 expression can be dramatically increased through stimulation by inflammatory cytokines such as interferon-gamma, IL-1, TNF, or lymphotoxin (Dustin et a l . , 1986; Pober et a l . , 1987; Dustin & Springer, 1988). Endothelial c e l l s can be rapidly induced to express, and sustain expression, of high levels of ICAM-1 by IL-1, TNF, and LT (Pober et a l . , 1987). In cultured umbilical vein and saphenous vein endothelial c e l l cultures, ICAM-1 expression was increased rapidly (over a period of one to eight hours), and then more slowly for a period of days, i n agreement with the results of Pober's group (see above). This increased expression was maintained up to seven days, as long as IL-1 or TNF were present, but returned to basal l e v e l s of expression upon removal of inflammatory cytokines. Basal expression on these c e l l s was 5-10 X 10^ s i t e s / c e l l , but after stimulation with TNF, i t s density increased to 3.5 X 10^ s i t e s / c e l l (Dustin & Springer, 1988). Experiments performed with dermal f i b r o b l a s t s and with HL-60 c e l l s suggest that upregulation of ICAM-1 i n response to inflammatory cytokines occurs at the l e v e l of transcr i p t i o n (Dustin et a l . , 1986; Simmons et a l . , 1988). I t i s suggested that t h i s expression promotes homing to and extravasation from the endothelium i n inflammatory regions, where these cytokines are released. Activated lymphocytes i n t h i s area releasing interferon-gamma are then capable of enhancing ICAM-1 expression on the endothelium even further (Dustin et a l . , 1986). In f a c t , i t may be that the r o l e of ICAM-1 i s not only to promote c e l l migration into areas of acute inflammation, i t may also play an important part i n antigen-presentation to those c e l l s which invade the tissue as part of the inflammatory response. \" I t i s s i g n i f i c a n t that expression of ICAM-1 34 appears to be a general response of a l l tissues to cytokine stimulation.\" (Boyd et a l . , 1989). ICAM-1 i s expressed on non-hematopoietic c e l l s such as vascular endothelium (especially HEV), mucosal e p i t h e l i a l c e l l s , dendritic c e l l s , and lymphoid tissues with high T lymphocyte populations (Dustin et a l . , 1986). These c e l l s , including endothelial c e l l s (Geppert & Lipsky) are known to be capable of antigen presentation, while mucosal c e l l s are s i g n i f i c a n t targets f o r invading microorganisms. ICAM-1 i s also expressed on the keratinocytes of a variety of benign cutaneous skin lesions such as a l l e r g i c contact eczema, and the extent of ICAM-1 expression has been p o s i t i v e l y correlated with the extent of mononuclear c e l l i n f i l t r a t i o n of the area (Wantzin et a l . , 1988). Contrastingly, there was no expression of ICAM-1 on normal keratinocytes, or the small number of mononuclear c e l l s which e x i s t i n normal skin. ICAM-1 has been found to be the primary c e l l surface molecule on epidermal keratinocytes mediating the adhesion of these c e l l s to T lymphoblasts, and i t s expression i s induced most s i g n i f i c a n t l y by interferon-gamma (25-fold increase) and TNF (8-fold increase) which are capable of synergy (Dustin et a l . , 1988). This study also c l a r i f i e d the r o l e of MHC class I I expression induced i n the same environment by interferon-gamma. I t has been speculated that MHC class I I i s involved i n a l l o g r a f t rejection (Lampert et a l . , 1982), however HLA-DR was shown to play.no part i n c e l l u l a r contact, although i t i s s t i l l l i k e l y to play a role i n antigen presentation. Expression of ICAM-1 i s highly regulated, being inducible i n a wide v a r i e t y of tissues. I t can be induced i n myelomonocytic c e l l l i n e s by treatment of the c e l l s with phorbol esters, and expression i s 35 concurrent with adoption of the mature macrophage phenotype (Dustin et a l . , 1986). The majority of human monocytes tested have been shown to express high levels of cytoplasmic ICAM-1, and to express variable amounts of ICAM-1 on t h e i r surface, whereas the surface of resting T c e l l s was ICAM-1- (Dougherty et a l . , 1988). I t i s suggested that the i n t r a c e l l u l a r store of ICAM-1 may allow i t s rapid recruitment to the c e l l surface of monocytes, without the delay involved with protein synthesis (Ibid). I t has previoiusly been found that LFA-1 on the surface of both T lymphocytes and monocytes contribute to the adhesive interactions between these two c e l l types (Dougherty & Hogg, 1987). Combining these r e s u l t s , Dougherty et a l . have suggested that induction of monocyte ICAM-1 expression i s l i k e l y to be a s i g n i f i c a n t i n i t i a l event. \"The physiological signals responsible f o r such induction remain to be determined, but include adherence to fibronectin. Interaction between T c e l l LFA-1 and monocyte ICAM-1 could enable these c e l l s to adhere together and allow delivery of activation signals to the T c e l l and the induction of ICAM-1 expression on the T c e l l surface.\" (Ibid). Expression of ICAM-1 on the activated T c e l l surface may then be involved i n interactions between the activated T c e l l , and other LFA-1 + c e l l s such as other T c e l l s and B c e l l s (Boyd et a l . , 1988). Anti-ICAM-1 antibodies have been shown to i n h i b i t the homotypic binding of activated T c e l l s , B c e l l s , aggregation of mixed T c e l l / B c e l l populations, the mixed lymphocyte reaction, and T cell-mediated B - c e l l a c t i v a t i o n (Ibid). The ICAM-l/LFA-1 interaction i s central to immunological function, and i s involved i n most c e l l contact-mediated interactions. I t i s involved i n the events which lead to both humoral and c e l l 36 mediated immunity (Boyd et a l . , 1988; Dougherty et a l . , 1988), and inflammation (Boyd et a l . , 1989). Considering i t s widespread involvement i n immunity, i t seems l i k e l y that abnormalities i n ICAM-1 would be involved i n some pathological states. Not suprisingly, the degree of expression of ICAM-1 on B c e l l tumors has been found to be correlated with the adhesiveness of these c e l l s . Those B c e l l tumors with strong ICAM-1 expression formed large, s o l i t a r y masses, mediated by a high degree of homotypic adhesions; those with low ICAM-1 expression exhibited diffuse, widespread d i s t r i b u t i o n (Boyd et a l . , 1989). Because of the r e l a t i v e l y consistent expression of LFA-1 i n most stages of leukocyte development, and the highly inducible nature of ICAM-1, i t i s also suggested that ICAM-1 expression i s the c o n t r o l l i n g factor i n ICAM-l/LFA-1 interactions involved with homotypic adhesion, and that expression-of ICAM-1 i s increased on activated c e l l s (Ibid). Also with regard to B c e l l tumors, i t has been suggested that down-regulation of ICAM-1 and LFA-3 i s responsible for t h i s tumor's a b i l i t y to evade T c e l l surveillance (Gregory et a l . , 1988). Thus, on hematopietic c e l l s (which normally express LFA-1), increased expression of ICAM-1 can lead to enhancement of homotypic aggregation, while decreased expression i s correlated with escape from T c e l l surveillance. The use of anti-LFA-1 antibodies has been shown to be an ef f e c t i v e therapy i n promoting tolerance of bone marrow grafts i n humans (Fischer et a l . , 1986), and both prevention and reversal of graft-vs-host disease i n murine skin grafts (Shiohara et a l . , 1988). Since ICAM-1 i s strongly expressed on activated endothelial c e l l s and other APCs (which are involved i n the i n i t i a l stages of the immune response), and since i t i s an important ligand of LFA-1, i t has been 37 suggested that ICAM-1 may be an appropriate antigen to d i r e c t therapy toward i n the blocking of graft rejection (Boyd et a l . , 1989). There i s potential that t h i s and other immunological therapies are l i k e l y to be based upon the moderation of ICAM-1 i n the future, but there i s much s t i l l to be resolved regarding the i n vivo function of ICAM-1. The use of animal models and antibodies s p e c i f i c for LFA-1 and ICAM-1 i n vivo has been suggested as the only p r a c t i c a l way to assess the physiological roles that these molecules play (Arfors et a l . , 1987). 1.4 THESIS OBJECTIVES The objective of my thesis was to biochemically characterize a novel murine c e l l surface molecule, detected mainly on the surface of activated lymphocytes. This molecule, MALA-2 (Murine Activated Lymphocyte Antigen-2), i s recognized by the monoclonal antibody YN1/1.7.4. MALA-2 i s a single peptide chain, with a Mj. of 95-100 kD under both reducing and non-reducing conditions. Expression of MALA-2 i s highest on activated lymphocytes, but has been detected at low levels on non-activated lymphocytes and some non-lymphoid c e l l s . Since the YN1/1.7.4 MAb has been shown to be capable of i n h i b i t i n g the mixed lymphocyte reaction, i t was thought to be involved i n lymphocyte ac t i v a t i o n . The objectives of t h i s research were (1) to p u r i f y MALA-2 to homogeneity, (2) to determine the density of MALA-2 on lymphoid c e l l l i n e s , (3) to determine the i s o e l e c t r i c point of MALA-2, (4) to determine i f MALA-2 i s a glycoprotein, (5) to examine a possible realtionship between MALA-2 and the t r a n s f e r r i n receptor, (6) to 38 determine the partial amino acid sequence of MALA-2, and (7) to compare this data with existing information to gain insight into the functional identity of MALA-2. The objectives of this thesis have been achieved, and results presented herein have facilitated further research into MALA-2. 39 1.5 REFERENCES Adam, D.O., & Hamilton, T.A. (1984) The c e l l biology of macrophage acti v a t i o n . Ann. Rev. Immunol. 2:283. Alcover, A., A l b e r i n i , C , Acuto, 0., Clayton, L.K., Transy, C , Spagnoli, G.C, Moingeon, P., Lopez, P., Reinherz, E.L. (1988) Interdependence of CD3-Ti and CD2 activation pathways i n human T lymphocytes. EMBO Journal. 7:1973-7. Anderson, P., Blue, M.L., Morimoto, C., Schlossman, S.F. (1988) Crosslinking CD3 with CD2 using sepharose-immobolized antibodies enhances T lymphocyte p r o l i f e r a t i o n . C e l l u l a r Immunology. 115:246-56. Arfors, K.-E., Lundberg, C , Linbom, L., Lundberg, K., Beatty, P.G., and Harlan, J.M. (1987) A monoclonal antibody to the membrane glycoprotein complex CD18 i n h i b i t s polymorphonuclear accumulation and plasma leakage i n vivo. Blood. 69:338. Arquint, M., Roder, J . , Chua, L.A., Dawn, J . , Wilhenson, D., Braun, P., and Dunn, R. (1987) Molecular cloning and primary structure of myelin-associated glycoprotein. Proc. Natl. Acad. S c i . U.S.A. 82:4225. Aruffo, A., and Seed, B. (1987) Molecular cloning of a CD28 cDNA by a high-efficiency COS c e l l expression system. Proc. Natl. Acad. S c i . U.S.A. 84:8573. Ashwell, J.D., and Schwartz, R.H. (1986) T - c e l l recognition of antigen and the l a molecule as a ternary complex. Nature. 320:176. Babbit, B.P., Alle n , P.M., Matsueda, G., Haber, E., and Unanue, E.R. (1985) Binding of immunogenic peptides to l a histocompatibility molecules. Nature. 317:359. Becker, D. M., Patten, P., Chien, Y., Yokota, T., Eshhar, Z., Gie d l i n , M., Gascoigne, N.R.J., Goodnow, C , Wolf, R., A r a i , K., and Davis, M.M. (1985) V a r i a b i l i t y and repetoire size of T - c e l l receptor V alpha gene segments. Nature. 317:430. Becker, J.W., & Reeke J r . , G.N. (1985) Three-dimensional structure of B2 microglobulin. Proc. Natl. Acad. S c i . U.S.A. 82:4225 Benjamin, R.J., Qin, S., Wise, M., Cobbold, S.P., and Waldmann, H. (1988) Mechanisms of monoclonal antibody-facilitated tolerance induction: a possible role f o r the CD4 (L3T4) and CDlla (LFA-1) molecules i n sel-non-self discrimination. Eur. J. Immunol. 18:1079. Benveniste, E.N. (1988) Lymphokines and monokines i n the\" neuroendocrine system. Progress i n Allergy. 43:84. Bevilacqua, M.P., Pober, J.S., Mendrick, D.L., Cotran, R.S., and Gimbrone J r . , M.A. (1987) I d e n t i f i c a t i o n of an inducible endothelial-leukocyte adhesion molecule. Proc. Natl. Acad. S c i . U.S.A. 84:9233 Bierer, B.E., and Burakoff, S.J. (1988) T c e l l adhesion molecules. FASEB Journal. 2:2584-2590. Bierer, B.E., Peterson, A., Takai, Y., Greenstein, J . , Herrmann, S., Seed, B., and Burakoff, J. (1987) Evidence that LFA-3 activates kT c e l l s v i a the CD2 receptor. Fed. Proc. 46:1498. 40 Birchmeier, C , Birnbaum, D., Waitches, G., Fasano, 0., and Wigler, M. (1986) Characterization of an activated human ros gene. Mol. C e l l . B i o l . 6:3109. Blanchard, D., van E l s , C., Borst, J . , Carrel, S., Boylston, A., de Vries, J.E., & Spits, H- (1987) The role of the T c e l l receptor, CD8, and LFA-1 i n dif f e r e n t stages of the c y t o l y t i c reaction mediated by al l o r e a c t i v e T lymphocyte clones. J . Immunol. 138:2417. Blalock, J.E. (1988) Production of neuroendocrine peptide hormones by the immune system. Progress i n Allergy. 43:1. Bockenstedt, L.K., Goldsmith, M.A., Dustin, M., Olive, D., Springer, T.A., and Weiss, A. (1988) The CD2 ligand LFA-3 activates T c e l l s but depends on the expression and function of the antigen receptor. J. Immunol. 141:1904. Borst, J . , van de Griend, R.J., van Oostveen, J.W., Ang, S.-L., Melief, C.J., Seidman, J.G., and Bolhius, R.L.H. (1987) A T - c e l l receptor gamma/CD3 complex found on cloned functional lymphocytes. Nature. 325:683. Borst, J . , van Dongen, J . J . , Bolhuis, R.L., Peters, P.J., Hafler, D.A., de Vrie s , E., van de Griend, R.J. (1988) D i s t i n c t molecular forms of human T c e l l receptor gamma/delta detected on via b l e T c e l l s by a monoclonal antibody. Journal of Experimental Medicine. 167:1625. Bosman, F.T. (1988) Monoclonal antibodies i n immunocytochemistry. Acta Histochemica - Supplement 35:27. Bost, K.L., (1988) Hormone and neuropeptide receptors on mononuclear leukocytes. Progress i n Allergy. 43:68. Bowen, T.J., Ochs, H.D., Altman, L., Price, C., Van Epps, D.E. (1982) Severe recurrent b a c t e r i a l infections associated with defective adherence and chemotaxis i n two patients with neutrophils deficient i n a cell-associated glycoprotein. J. Pediatr. 101:932. Boyd, A.W., Dunn, S.M., Fecendo, J.V., Culvenor, J.G., Duhrsen, U., Burns, G.F., and Wawryk, W.A. (1989) Regulation of expression of a human i n t e r c e l l u l a r adhesion molecule (ICAM-1) during lymphohematopoietic d i f f e r e n t i a t i o n . Blood. 73:1896. Boyd, A.W., Novotny, J.R., Wicks, I.P., Salvaris, E., Welch, K., and Wawryk, S.O. (1989) The role of accessory molecules i n lymphocyte ac t i v a t i o n . Transplantation Proceedings. 21:38. Boyd, A.W., Wawryk, S.O., Burns, G.F., Fecendo, J.V. (1988) I n t e r c e l l u l a r adhesion molecule 1 (ICAM-1) has a central role i n c e l l - c e l l contact-mediated immune mechanisms. Immunology. 85:3095. Brenner, M.B., Trowbridge, I.S., and Strominger, J.L. (1985) Cross-linking of human T c e l l receptor proteins: association between the T c e l l idiotype beta subunit and the T3 glycoprotein heavy subunit. C e l l . 40:183. Butcher, E.C. (1987) The regulation of lymphocyte t r a f f i c . Curr. Top. Microbiol. Immunol. 128:85. Butcher, E. C., Scollay, R. G. & Weissman, I.L. (1980) Organ s p e c i f i c i t y of lymphocyte interaction with organ-specific determinants on high endothelial venules. Eur. J . Immunol. 10:556. C a h i l l , R.N.P., Frost, H., and Trnka, Z. (1976) The effect of antigen on the migration of r e c i r c u l a t i n g lymphocytes through a single node. J. Exp. Med. 143:870. 41 Catane, R., and Longo, D.L. (1988) Monoclonal antibodies f o r cancer therapy. I s r a e l Journal of Medical Sciences 24:471. C a n t r e l l , D.A., Davies, A.A., & Crumpton, M.J. (!985) Activators of protein kinase C down-regulate and phosphorylate the T3/T-cell antigen receptor complex of human T lymphocytes. Proc. Natl. Acad. S c i . U.S.A. 82:8158. Ca n t r e l l , D.A., Verbi, W., Davies, A., Parker, P., Crumpton, M.J. (1988) Evidence that protein kinase C d i f f e r e n t i a l l y regulates the human T lymphocyte CD2 and CD3 surface antigens. European Journal of Immunology. 18:1391. Carrera, A.C., Rincon, M., Sanchez-Madrid, F., Lopez-Botet, M., and de Landazuri, 0. (1988) Triggering of co-mitogenic signals i n T c e l l p r o l i f e r a t i o n by anti-LFA-1 (CD18, C D l l a ) , LFA-3, and CD7 monoclonal antibodies. J . Immunol. 141:1919. Chesnut, R.W., Colon, S.M., and Grey, H.M. (1982) Antigen presentation by normal B c e l l s , B c e l l tumors, and macrophages': functional and biochemical comparison. J . Immunol. 128:1764. Clark, S.J., J e f f r i e s , W.A., Barclay, A.N., and Gagnon, J. (1987) Peptide and nucleotide sequences of rat CD4 (W3/25) antigen: Evidence for derivation from a structure with four immunoglobulin-related domains. Proc. Natl. Acad. Sci U.S.A. 84:1649. C o l l i n s , M.K.L., & Owen, M.J. (1985) The T c e l l antigen receptor. Biochem. J. 230:281. C o l l i n s , T., Korman, A.J., Wake, C.T., Boss, J.M., Kappes, D.J., Fi e r s , W., Ault, K.A., Gimbrone J r . , M.A., Strominger, J.L., and Pober, J.S. (1984) Immune interferon activates multiple class I I major histocompatibility complex genes and the associated invariant chain gene i n human endothelial c e l l s and dermal f i b r o b l a s t s . Proc. Natl. Acad.Sci. U.S.A. 81:4917 Cotran, R.S., Pober, J.S., Gimbrone J r . , M.A., Springer, T.A., Weibke, E.A., Gaspari, A.A., Rosenberg, S.A., and Lotze, M.T. (1987) Endothelial a c t i v a t i o n during interleukin 2 (IL2) immunotherapy: A possible mechanism for the vascular leakage syndrome. J . Immunol. 140:1883. Coussens, L., Beveren, C.V., Smith, D., Chen, E., Mitchell,R.L., Isacke, CM., Verma, L.M., & U l l r i c h , A. (1986) Structural a l t e r a t i o n of v i r a l homologue of receptor proto-oncogene fms at carboxyl terminus. Nature. 320:277. Cunningham, B.A., Hemperly, J . J . , Murray, B.A., Prediger, E.A., Brackenbury, R., & Edelman, G.M. (1987) Neural c e l l adhesion molecule: Structure, immunoglobulin-like domain, c e l l surface modulation, and alternative RNA s p l i c i n g . Science. 236:799. Damle, N.K., Doyle, L.V., Grosmaire, L.S., and Ledbetter, J.A. (1988) D i f f e r e n t i a l regulatory signals delivered by antibody binding to the CD28 (Tp44) molecule during the a c t i v a t i o i n of human T lymphocytes. J. Immunol. 140:1753. Davies, A.A., Ca n t r e l l , D.A., Hexham, J.M., Parker, P.J., Rothbard, J . , Crumpton, M.J. (1987) The human T3 gamma chain i s phosphorylated at serine 126 i n response to T lymphocyte activation. Journal of B i o l o g i c a l Chemistry. 262:10918. 42 Davies, A.A., Hexham, J.M., C a n t r e l l , D.A., Crumpton, M.J. (1988) Evidence that a GTP binding protein regulates the phosphorylation of the CD3 antigen i n human T lymphocytes. Biochemical & Biophysical Research Communications. 156:328. Davignon, D., Martz, E., Reynolds, T., Kurzinger, K., & Springer, T.A. (1981) Monoclonal antibody to a novel lymphocyte function associated antigen (LFA-1): mechanism of blockade of T lymphocyte-mediated k i l l i n g and effects on other T and B lymphocyte functions. J. Immunol. 127:590. Denning, S.M., Dustin, M.L., Springer, T.A., Singer, K.H., and Haynes, B.F. (1988) P u r i f i e d lymphocyte function-associated antigen-3 (LFA-3) activates human thymocytes v i a the CD2 pathway. J . Immunol. 142:2980. Dougherty, G.J., & Hogg, N. (1987) The role of monocyte lymphocyte function-associated antigen 1 (LFA-1) i n accessory c e l l function. Eur. J . Immunol. 17:943. Dougherty, G.J., Murdoch, S., and Hogg, N. (1988) The function of human i n t e r c e l l u l a r adhesion molecule-1 (ICAM-1) i n the generation of an immune response. Eur. J . Immunol. 18:35. Doyle, C , & Strominger, J.L. (1987) Interaction between CD4 and class I I MHC molecules mediates c e l l adhesion. Nature. 330:256. Dustin, M.L., Rothlein, R., Bhan, A.K., Dinarello, C.A., & Springer, T.A. (1986) Induction by IL-1 and interferon-gamma:tissue d i s t r i b u t i o n , biochemisrty, and function of a natural adherence molecule (ICAM-1). J. Immunol. 137:245. Dustin, M.L., Selvaraj, P., Mattaliano, R.J., and Springer, T.A. Anchoring mechanisms for LFA-3 c e l l adhesion glycoprotein at the membrane surface. Nature. 329:846. Dustin, M.L., Singer, K.H., Tuck, D T., & Springer, T.A. (1988) Adhesion of T lymphoblasts to epidermal keratinocytes i s regulated by interferon gamma and i s mediated by i n t e r c e l l u l a r adhesion molecule 1 (ICAM-1). J. Exp. Med. 167:1323. Dustin, M.L., & Springer, T.A. (1988) Lymphocyte function-associated antigen-1 (LFA-1) interaction with i n t e r c e l l u l a r adhesion molecule-1 i s one of at least three mechanisms for lymphocyte adhesion to cultured endothelial c e l l s . Journal of C e l l Biology. 107:321. D u i j v e s t i j n , A.M., Schreiber, A.B., and Butcher, E.C. (1986) Interferon -gamma regulates an sntigen s p e c i f i c for endothelial c e l l s involved i n lymphocyte t r a f f i c . Proc. N a t l . Acad. S c i . U.S.A. 83:9114. Edelman, G.M. (1987) CAMs and Igs: c e l l adhesioin and the evolutionary ori g i n s of immunity. Immunological Reviews. 100:11. Edelman, G.M. (1970) The covalent structure of a human gamma-G-immunoglobulin. XI. Functional implications. Biochemistry 9:3197. Emmrich, F., Kanz, L., and Eichmann, K. (1987) Cross-linking of the T c e l l receptor complex with the subset-specific d i f f e r e n t i a t i o n antigen stimulates i n t e r l e u k i n 2 receptor complex expression i n human CD4 and CD8 T c e l l s . European Journal of Immunology. 17:529. 43 Emmrich, F., Strittmatter, U., and Eichmann, K. (1986) Synergism i n the act i v a t i o n of human CD8 T c e l l s by cross-linking the T c e l l receptor complex with the CD8 d i f f e r e n t i a t i o n antigen. Proc. Natl. Acad. S c i . U.S.A. 83:8298. Faure, F., Jitsukawa, S., Triebe l . F., and Hercend, T. (1988) CD3/TigammaA: A functional gamma-receptor complex expressed on human peripheral lymphocytes. J . Immunol. 140:1372. F e r r i n i , S., Bottino, C , Biassoni, R., Poggi, A., Sekaly., R.P., Moretta, A. (1987) Characterization of CD3+, CD4-, CD8- clones expressing the putative T c e l l receptor gamma gene product: analysis of the pathways leading to int e r l e u k i n 2 production and triggering of the l y t i c machinery. J . Exp. Med. 166:277. Fischer, A., Blanche, S., Veber, F., Delaage, M., Mawas, C , G r i s c e l l i , C , Le Deist, F., Lopez, M., Olive, D., & Janosy, G. (1986) of graft f a i l u r e by an anti-HLFA-1 monoclonal antibody i n HLA-mismatched bone marrow transplantation. The Lancet. Nov:1058. Fontana, A., F r e i , K., Bodmer, S., Hofer, E. (1987) Immune-mediated encephalitis: on the role of antigen-presenting c e l l s i n brain tissue. Immunological Reviews. 100:185. Fried, V.A., U l l r i c h , A., & Williams, L.T. (1986) Structure of the receptor for platelet-derived growth factor helps define a family of clos e l y related growth receptors. Nature. 323:226. F r i e r i c h , B., Noreus, K., C a n t r e l l , D.A., and Gullberg, M. (1988) Activation-dependent phosphorylation of endogenous protein kinase C substrates i n quiescent human T lymphocytes. Immunobiology. 176:465. Gay, D., Buus, S., Pasternak, J . , Kappler, J . , Marrack, P. (1988) The T- c e l l accessory molecule CD4 recognizes a monomorphic determinant on isolated l a . Proc. Natl. Acad. S c i . U.S.A. 85:5629. Geppert, T.D., Wacholtz, M.C., Davis, L.S., and Lipsky, P.E. (1988) Activ a t i o n of human T4 c e l l s by cross-limking class I MHC molecules. Journal of Immunology. 140:2155-64. Geppert, T.D., and Lipsky, P.E. (1987) Dissection of the antigen presenting function of tissue c e l l s induced to express HLA-DR by gamma interferon. Journal of Rheumatology. 14 supplement:59-62. Geppert, T.D., & Lipsky, P.E. (1987) Accessory c e l l independent p r o l i f e r a t i o n of human T4 c e l l s stimulated by immobilized monoclonal antibodies to CD3. Geppert, T.D., & Lipsky, P.E. (1985) Antigen presentation by interferon-gamma-treated endothelial c e l l s and f i b r o b l a s t s : D i f f e r e n t i a l a b i l i t y to function as antigen presenting c e l l s despite comparable l a expression. Journal of Immunology. 135:3750 Gold, D.P., Clevers, H., Alarcon, B., Dunlap, S., and Novotny, J. (1987) Evolutionary relationship between the T3 chains of the T- c e l l receptor complex and the immunoglobulin supergene family. Proc. Natl. Acad. S c i . U.S.A. 84:7649. Gold, D.P., Puck, J.M., Pettey, CL., Cho, M., Coligan, f J . , Woody, J.N., & Terhorst, C. (1986) Isolation of cDNA clones encoding the 20K non-glycosylated polypeptide chain of the human T - c e l l receptor/T3 complex. Nature. 321:431. Gowans, J. L., Knight, E. J. (1964) The route of re c i r c u l a t i o n of lymphocytes i n the rat . Proc. R. Soc. Lond. Ser B 159:257 44 Gregory, C.D., Murray, R.J., Edwards, C.F., and Rickinson, A.B. (1988) Downregulation of c e l l adhesion molecules LFA-3 and ICAM-1 i n Epstein-Barr v i r u s - p o s i t i v e Burkitt's lymphoma underlies tumor c e l l escape from v i r u s - s p e c i f i c T c e l l surveillance. J . Exp. Med. 167:1811. Gunter, K.C., Germain, R.N., Kroczek, R.A., Saito, T., Yokoyama, W.M., Chan, C , Weiss, A., and Shevach, E.M. (1987) Thy-1-mediated T- c e l l a c t i v a t i o n requires co-expression of the CD3/Ti complex. Nature. 326:505. Hamarm, A., Jablonski-Westrich, D., & Thiele, H.-G. (1986) Contact interaction between lymphocytes i s a general event following activation and i s mediated by LFA-1. Eur. J . Immunol. 16:847. Hamann, A., Jablonski-Westrich, D., D u i j v e s t i j n , A., Butcher, E.C., Baisch, H., Harder, R., & Thiele, H.-G. (1988) Evidence for an accessory role of LFA-1 i n lymphocyte-high endothelium interaction during homing. J.Immunol. 140:693. Hansen, J.A., Martin, P.J., and Nowinski, R.C. (1980) Monoclonal antibodies i d e n t i f y i n g a novel T - c e l l antigen and l a antigens of human lymphocytes. Immunogenetics. 10:247. Hata, S., Brenner, M.B., & Krangel, M.S. (1987) I d e n t i f i c a t i o n of putative human T c e l l receptor delta complimentay DNA clones. Science. 238:678. Hemler, M.E., Huang, C , and Schwarz, L. (1987) The VLA protein family: characterization of f i v e d i s t i n c t c e l l surface heterodimers each with a common 130,000 M r subunit. J . B i o l . Chem. 262:3300. Hemler, M.E., Jacobson, J.G., and Strominger, J.L. (1985) Biochemical cha r a c t e r i z a t i i o n of VLA-1 and VLA-2. J . B i o l . Chem. 260:15246. Hendricks, H.R., & Eestermans, I.L. (1983) Disappearance and reappearance of high endothelial venules and immigrating lymphocytes i n lymph nodes deprived of afferent lymphatic vessels: a possible regulatory r o l e of macrophages i n lymphocyte migration. Eur. J . Immunol. 13:663. Hendricks, H.R., Eestermans, I.L., and Hoefsmit, E.C.M. (1980) Depletion of macrophages and disappearance of high endothelial venules i n lymph nodes deprived of afferent lymphatic vessels. C e l l . Tissue Res. 211:375. Hirschberg, H., Bergh, O.J., and Thorsby, E. (1980) Antigen presenting properties of human vascular endothelial c e l l s . J . Exp. Med. 152:2495. Hoffman, S. and Edelman, G.M. (1983) Kinetics of Homophilic binding by embryonic and adult forms of the neural c e l l adhesion molecule. Proc. Natl. Acad. S c i . USA 80:5762. Holzmann, B., Brocker, E.B., Lehmann, J.M., Ruiter, D.J., Sorg, C , Riethmuller, G., and Johnson, J.P. (1987) Tumor progression i n human malignant melanoma: f i v e stages defined by t h e i r antigenic phenotypes. International Journal of Cancer 39:466 Hood, L., Kronenberg, M., & Hunkapillar, T. (1985) T c e l l antigen receptors and the immunoglobulin superfamily. C e l l . 40:225. Horley, K.J., Carpenito, C , Baker, B., and Takei, F. (1989) Molecular cloning of murine i n t e r c e l l u l a r adhesion molecule (ICAM-1). EMB0 Journal. 8:2889. Howard, D.R., Eaves, A.C., & Takei, F. (1986) Lymphocyte function associated antigen (LFA-1) i s involved i n B c e l l a c t i v a t i o n . J . Immunol. 136:4013. 45 Hunig, T., Tiefenthaler, G., Meyer zum Buschenfelde, K.H., and Meuer, S.C. (1987) Alternative pathway activation of T c e l l s by binding of CD2 to i t s cell-surface ligand. Nature. 326:298. Hynes, R.O. (1987) Integrins: A family of c e l l surface receptors. C e l l . 48:549-554. Inaba, K., and Steinman, R.M. (1984) Resting and sensitized T lymphocytes exhibit d i s t i n c t stimulatory (antigen-presenting c e l l ) requirements for growth and lymphokine release. J . Exp. Med. 141:138. Jalkanen, S. Steere, A., Fox, R., & Butcher, E.C. (1986c) A d i s t i n c t endothelial recognition system that controls lymphocyte t r a f f i c into inflamed synovium. Science 233:556-558. Johnson, J.P., Stade, B.G., Holzmann, B., Schwable, W., and Riethmuller, G. (1989) De novo expression of intercellular-adhesion molecule 1 i n melanomacorrelates with increased r i s k of metastasis. Proc. Natl. Acad. S c i . U.S.A. 86:641. Johnson, P. (1987) A human CD8 (Lyt-3) homologue e x i s t s : genomic sequence and expression. Immunogenetics. 26:174. Joseph, J. (1983) In v i t r o analysis of endothelial antigens. (Ph.D. Dissertation, University of Wisconsin) i n Biology of Endothelial C e l l s (Chapter 40, C e l l surface markers on endothelial c e l l s : a developmental perspective.) (Ed. Ja f f e , E.A.) Martinus Nijhoff Publishers, MA June, C.H., Ledbetter, J.A., Rabinovitch, P.S., Martin, P.J., Beatty, P.G., & Hansen, J.A. (1986) D i s t i n c t patterns of transmembrane calcium f l u x and i n t r a c e l l u l a r calcium mobilization a f t e r d i f f e r e n t i a t i o n antigen c l u s t e r 2 (E rosette receptor) or 3 (T3) stimulation of human lymphocytes. J. C l i n . Invest. 77:1224. Kamoun, M., Martin, P.J., Hansen, J.A., Brown, M.A., Siadak, A.W., & Nowinski, R.C (1981) I d e n t i f i c a t i o n of a human T lymphocyte surface protein associated withe the E-rosette receptor. J . Exp. Med. 153:207. Kaufman, J.F., Auffrey, C , Korman, A.J., Shackelford, D.A., & Strominger, J . (1984) The class I I molecules of the human and murine major histocompatibility complex. C e l l . 36:1. Kaye, J . , & Janeway J r . , C.A. (1984) The Fab fragment of a d i r e c t l y a c t i v a t i n g monoclonal antibody that precipitates a disulphide-linked heterodimer from a helper T c e l l clone blocks a c t i v a t i o n by either allogenic l a or antigen and s e l f - l a . J . Exp. Med. 159:1397. K l e i n , J . (1975) Biology of the Mouse Histo-Compatibility-2 Complex Springer Verlag. New York. K l e i n , J . (1979) The major histocompatibility complex of the mouse. Science. 206:516. Kohler, G. (1986) Derivation and d i v e r s i f i c a t i o n of monoclonal antibodies. Science 223:1281. Kohler, G. and M i l s t e i n , C. (1975) Continuous cultures of fused c e l l s secreting antibody of a predefined s p e c i f i c i t y . Nature 256:495 Krangel, M.S. (1987) Endocytosis and recycling of the T3-T c e l l receptor complex. The role of T3 phosphorylation. Journal of Experimental Medicine. 165:1141. Krensky, A.M., Sanchez-Madrid, F., Robbins, E. Nagy, J . , Springer, T.A., Burakoff, S.J. (1983) The functional significance, d i s t r i b u t i o n , and structure of LFA-1, LFA-2, and LFA-3: c e l l surface antigens associated with CTL-target interactions. J . Immunol. 131:611. 46 Kroczek, R.A., Gunter, K.C., Germain, R.N., & Shevach, E.M. (1986) Thy-1 functions as a signal transduction molecule i n T lymphocytes and transfeeted B lymphocytes. Nature. 322:181-4. Kronenberg, M., Sui, G., Hood, L.E., & Shastri, N. (1986) The molecular genetics of the T - c e l l antigen receptor and T c e l l antigen recognition. Ann. Rev. Immunol. 4:529. Kupfer, A., & Singer, S.J. (1988) Molecular dynamics i n the membrane of helper T c e l l s . Proc. Natl. Acad. S c i . U.S.A. 85:8216. Kupfer, A., Singer, S.J., Janeway J r . , C.A., Swain, S.L. Coclustering of CD4 (L3T4) molecule with the T - c e l l receptor i s induced by s p e c i f i c d i r e c t interaction of helper T c e l l s and antigen-presenting c e l l s . Proc. Natl. Acad. S c i . U.S.A. 84:5888-92. Kurzinger, K., Ho, M.K., & Springer, T.A. (1982) Structural homology of a macrophage d i f f e r e n t i a t i o n antigen and an antigen involved i n T cell-mediated k i l l i n g . Nature. 296:668. L a i , C., Brow, M.A., Nave, K.A., Noronha, A.B., Quarles, R.H., Bloom, F.E., Milner, R.J., & S u t c l i f f e , J.G. (1987) Two forms of iB236/myelin-associated glycoprotein, a c e l l adhesion molecule for postnatal neural development, are produced by alternative s p l i c i n g . Proc. N a t l . Acd S c i . U.S.A. 84:4337. Lampert, I.A., Janossy, G.J., S u i t t e r s , A.J., B o f i l l , M., Palmer, S., Gordon-Smith, E., Prentice, H.F., and Thomas, J.A. (1982) Immunological analysis of the skin i n graft versus host disease. C l i n . Exp. Immunol. 50:123. Ledbetter, J.A., June, C.H., Rabinovitch, P.S., Grossman, A., Tsu, T.T., Imboden, J.B. (1988) Signal transduction through CD4 receptors: stimulatory vs. i n h i b i t o r y a c t i v i t y i s regulated by CD4 proximity to the CD3/Tcell receptor. European Journal of Immunology. 18:525-532. Ledbetter, J.A., Martin, P.J., Spooner, C.E., Wofsy, D., TSu, T.T., Beatty, P.G., Gladstone, P. (1985) Antibodies to Tp67 and Tp44 augment and sustain p r o l i f e r a t i v e responses of activated T c e l l s . J . Immunol. 135:2331. Lemke, G., & Axel, R. (1985) Isolation and sequence of a cDNA encoding the major structural protein of peripheral myelin. C e l l . 40:501. Lew, A.M., L i l l e h o j , E.P., Cowan, E.P., Maloy, W.L., Van Schravendijk, M.R., & Coligan, J.E. (1986) Class I genes and molecules: an update. Immunology. 57:3. Littman, D.R. (1987a) The structure of the CD4 and CD8 genes. Ann. Rev. Immunol. 5:561. Low, M.G., & S a l t i e l , A.R. (1988) Structural and functional roles of glycosyl-phosphatidylinositol i n membranes. Science. 239:268. Maddon, P.J., Littman, D.R., Godfrey, M., Maddon, D.E., Chess. L., & Axel, R. (1985) The isolationm and nucleotide sequence of a cDNA encoding the T c e l l surface protein T4: A new member of the immunoglobulin gene family. C e l l . 42:93. Makgoba, M.W., Sanders, M.E., Ginther Luce, G.E., Dustin, M.L., Springer, T.A., Clark, E.A., Mannoni, P., and Shaw, S. (1988) ICAM-1:' a ligand for LFA-1-dependent adhesion of B, T, and myeloid c e l l s . Nature 331:86 47 Makgoba, M.W., Sanders, M.E., Ginther Luce, G.A., Gugel, E.A., Dustin, M.L., Springer, T.A., and Shaw, S. (1988) Functioal evidence that i n t e r c e l l u l a r adhesion molecule-1 (ICAM-1) i s a ligand for LFA-1-dependent adhesion i n T cell-mediated c y t o t o x i c i t y . Eur.J. Immunol. 18:637-640. Marlin, S.D. and Springer, T.A. (1987) P u r i f i e d i n t e r c e l l u l a r adhesion molecule-1 (ICAM-1) i s a ligand for lymphocyte function-associated antigen-1 (LFA-1). 51:813 Martin, P.J., Ledbetter, J.A., Morishita, Y., June, C.H., and Beatty, P.G. (1986) A 44 kil o d a l t o n c e l l surface homodimer regulates i n t e r l e u k i n 2 production by activated human T lymphocytes. J. Immunol. 136:3282. Martz, E. (1977) Mechanism of s p e c i f i c tumor c e l l l y s i s by alloimmune T-lymphocytes: resolution and characterization of discrete steps i n the c e l l u l a r interaction. Cont. Top. Immunobiol. 7:301. Masuyama, J . I . , Minato, N., Kano, S. (1986) Mechanisms of lymphocyte adhesion to human vascular endothelial c e l l s through endothelial HLA-DR antigens induced by gamma interferon. J C l i n Invest. 77:1596. Mazerolles, F., Lumbroso, C , Lecomte, C , Le Deist, F., & Fischer, A. (1988) The role of lymphocyte function-associated antigen 1 (LFA-1) i n the adherence of T lymphocytes to B lymphocytes. Eur. J . Immunol. 18:1229. Mentzer, S.J., Burakoff, S.J., and F a l l e r , D.V. (1986) Adhesion of T lymphocytes to human endothelial c e l l s i s regulated by the LFA-1 membrane molecule. J. C e l l . Physiol. 126:285. Mentzer, S.J., Gromowski, S.H., Krensky, A.M., Burakoff, S.J., & Martz, E. (1985) LFA-1 membrane molecule i n the regulation of homotypic adhesions of human B lymphocytes. J . Immunol. 135:9. Meuer, S.C., Fitzgerald, K. A., Hussey, R.E., Hodgdon, J. C , Schlossman, S.F., and Reinherz, E.L. (1983) Clonotypic structures involved i n antigen-specific T c e l l function: Relationship to the T3 molecular complex. (1983) J . Exp. Med. 157:705. Meuer, S.C., Hussey, R.E., Fabbi, M., Fox, D., Acuto, 0., Fitzgerald, K.A., Hodgdon, J.C., Protentis, J.P., Schlossman, S.F., and Reinherz, E.L. (1984) An alternative pathway of T- c e l l activation: a functional role for the 50 kD T i l sheep erythrocyte receptor protein. C e l l . 36:897. Moretta, A., Olive, D., Poggi, A., Pantaleo, G., Mawas, C./and Moretta, L. (1986) Modulation of surface T i l molecules induced by monoclonal antibodies: analysis of the functional relationship between, antigen-dependent and antigen-independent pathways of human T c e l l a c t i v a t i o n . Eur. J. Immunol. 16:1427. Moretta, A., Pantaleo, G., Lopez-Botet, M., and Moretta, L. (1985) Involvement of T44 molecules i n an antigen-independent pathway of T c e l l a c t i v a t i o n . Analysis of the correlations to the T c e l l antigen-receptor complex. Journal of Experimental Medicine. 162:823. Moretta, L., Ciccone, E., Mingari, MC, Bottino, C, F e r r i n i , S., Tambussi, G., M e l i o l i , G., Grossi, C.E., & Moretta, A. (1989) Human T lymphocytes expressing gamma/delta T c e l l antigen receptor. C l i n i c a l Immunology & Immunopathology. 50(1 pt 2):S117. Mostov, K.E., Friedlander, M. & Blobel, G. (1984) The receptor for t r a n s e p i t h e l i a l transport of IgA and IgM contains multiple immunoglobulin-like domains. Nature. 308:37. 48 Murray, J.L., and Unger, M.W. (1988) Radioirnmunodetection of cancer with monoclonal antibodies: cuurent status, problems, and future directions. CRC C r i t i c a l Reviews i n Oncology-Hematology 8:227. Mustelin, T. (1987) GTP dependence of the transduction of mitogenic signals through the T3 complex i n T lymphocytes indicates the ^ involvement of a G-protein. Febs l e t t e r s . 213:199. ' Norman, D.J. (1988) An overview of the use of monoclonal antibody 0KT3 i n renal transplantation. Transplantation Proceedings 20:1248. Norment, A.M., Salter, R.D., Parham, P., Engelhard, V.H., and Littman, D.R. (1988) C e l l - c e l l adhesion mediated by CD8 and MHC class I molecules. Nature. 336:79. Novotny, J . , Tonegawa, S., Saito, H., Kranz, D.M., Eisen, H.N. (1986) Secondary, t e r t i a r y , and quaternary structure of T - c e l l - s p e c i f i c immunoglobulin-like polypeptide chains. Proc. Natl. Acad. S c i . U.S.A. 83:742. Oettgen, H.C., Pettey, C.L., Maloy, W.L., and Terhorst, C. (1986) A T3-like protein complex associated withe the antigen receptor on murine T c e l l s . Nature. 320:272. Pantaleo, G., F e r r i n i , S., Zochi, M.R., Bottino, C , Biassoni, R., Moretta, L., and Moretta, A. (1987a) Analysis of signal transducing mechanisms i n CD3+CD4-CD8- c e l l s expressing the putative T c e l l receptor gamma gene product. J . Immunol. 139:3580. Pantaleo, G., Olive, D., Poggi, A., Kozumbo, W.J., Moretta, L., & Moretta, A. (1987) Transmembrane s i g n a l l i n g v i a the Til-dependent pathway of human T c e l l a c t i v a t i o n . Evidence for the involvement of 1,2-diacylglycerol and i n o s i t o l phosphates. European Journal of Immunology. 17:55. Pantaleo, G., Olive, D., Harris, D., Poggi, A., Moretta, L., and Moretta, A. (1986) Signal transducing mechanisms involved i n human T c e l l a c t ivation v i a surface T44 molecules. Comparison with signals transduced v i a the T c e l l receptor complex. European Journal of Immunology. 16:1639. Pierres, M., Goridis, C , & Goldstein, P. (1982) I n h i b i t i o n of murine T cell-mediated c y t o l y s i s and T c e l l p r o l i f e r a t i o n by a rat monoclonal antibody immunoprcipitating two lymphoid c e l l surface polypeptides of 94000 and 180000 molecular weight. Eur. J . Immunol. 12:60. Pircher, H., Groscurth, P., Baunhutter, S., Aaguet, M., Zinkernagel, R.M., and Hengartner, H. (1986) A monoclonal antibody against altered LFA-1 induces p r o l i f e r a t i o n and lymphokine release of cloned T c e l l s . Eur. J . Immunol. 16:172. Plunkett, M.L., Sanders, M.E., Selvaraj, P., Dustin, M.L., & Springer, T.A. (1987) Rosetting of activated human T lymphocytes with autologous erythrocytes: d e f i n i t i o n of the receptor and ligand molecules as CD2 and lymphocyte-function-associated antigen 3 (LFA-3). J . Exp. Med. 165:664. Pober, J.S. (1988) Warner-Lambert/Parke-Davis Award Lecture: Cytokine-Mediated Activation of Vascular Endothelium. American Journal of Pathology. 133:426. Pober, J.S., Gimbrone, M.A., Cotran, K.S., Reiss, L.S., Burakoff, S.I. (1983) l a expression by vascular endothelium i s inducible by activated T c e l l s and by human gamma-interferon. Journal of Experimental Medicine. 157:1339. 49 Pober, J.S., Lappiere, L.A., Stolphen, A.H., Brock, T.A., Springer, T.A., F i e r s , W., Bevilacqua, M.P., Mendrick, D.L., and Gimbrone J r . , M.A. (1987) Activation of human cultured endothelial c e l l s by recombinant lymphotoxin: Comparisons with tumor necrosis factor and int e r l e u k i n 1 species. Journal of Immunology. 138:3319. Rasmussen, R.A., Chin, Y.-H., Woodruff, J. J . , Eastbn, T.G. (1985) Lymphocyte recognition of lymph node high endothelium. VII. C e l l surface proteins involved i n adhesion defined by monoclonal anti-HEBF^ (A.11) antibody. J . Immunol. 135:19. Ravetch, J.V., Luster, A.D., Weinshank, R., Kocchan, J . , Pavlovee, A., Portnoy, D.A., Hulmes, J . , Pan, Y.-C.E., & Unkeless, J.C (1986) Structural heterogeneity and functional domains of murine immunoglobulin G Fc receptors. Science. 234:718. Reichert, R.A., G a l l a t i n , W.M., Weissman, I.L., & Butcher, E.C. f(1983) Germinal center B c e l l s lack homing receptors necessary for normal lymphocyte r e c i r c u l a t i o n . J . Exp. Med. 157:813. Reinherz, E.L., Meuer, S.C., Fitzgerald, K.A., Hussey, R.E., Hodgdon, J.C, Acuto, 0., & Schlossman, S.F. (1983a) Comparison of T3-associated 49- and 43-kilodalton c e l l surface molecules on ind i v i d u a l human T c e l l clones: evidence for peptide v a r i a b i l i t y i n the T c e l l receptor structures. Proc. Natl. Acad. S c i . U.S.A. 80:4104. Reinherz, E.L., Meuer, S.C, Fitzge r a l d , K.A., Hussey, R.E., Levine, H., & Schlossman, S.F. (1982) Antigen recognition by human T lymphocytes i s linked to surface expression of the T3 molecular complex. C e l l . 30:735. Reiser, H., Oettgen, H., Yeh, E.T., Terhorst, C , Low, M.G., Benacerraf, B., & Rock, K.L. (1986) Structural characterization of the TAP molecule: a phosphatidylinositol-linked glycoprotein d i s t i n c t from the T c e l l receptor/T3 complex and Thy-1. C e l l . 47:365. Rock, K.L., Yeh, E.T., Gramm, C.F., Haber, S.I., Reiser, H., Benacerraf, B. (1986) TAP, a novel T c e l l - a c t i v a t i n g protein involved i n the stimulation of MHC-restricted T lymphocytes. J . Exp. Med. 163:315. Rosenstein, Y., Ratnofsky, S., Burakoff, S.J., and Hermann, S.H. (1989) Direct evidence f o r the binding of CD8 to HLA class I antigens. Journal of Experimental Medicine. 169:149. Roszman, T.L. & Brooks, W.H. (1988) Signalling pathways of the neuroendocrine-immune network. Prog. Allergy. 43:140. Rothlein, R., & Springer, T.A. (1986) The requirement for lymphocyte function-associated antigen 1 i n homotypic leukocyte adhesion stimulated by phorbol ester. J . Exp. Med. 163:1132. Rothlein, R., Dustin, M.L., Marlin, S.D., and Springer, T.A. (1986) A human i n t e r c e l l u l a r adhesion molecule (ICAM-1) d i s t i n c t from LFA-1. J. Immunol. 137:1270. Ruoslahti, E., and Pierschbacher, M.D. (1986) Arg-Gly-Asp: a v e r s a t i l e c e l l recognition sig n a l . C e l l . 44:517. Ruoslahti, E., and Pierschbacher, M.D. (1987) New perspectives i n c e l l adhesion: RGD and integrins. Science. 238:491. Salzer, J.L., Holmes, W.P., & Coleman, D.R. (1987) The amino acid sequences of the myelin-associated glycoprotiens: Homology to the immunoglobulin gene superfamily. J . C e l l B i o l . 104:957. Samelson, L.E., Harford, J.B., and Klausner, R.D. (1985a) I d e n t i f i c a t i o n of the components of the murine T c e l l antigen receptor complex. C e l l . 43:223. 50 Samstag, Y., Emmrich, F., Staehelin, T. (1988) Activation of human T lymphocytes: d i f f e r e n t i a l effects of CD3- and CD8-mediated signals. Proc. N a t l . Acad. S c i . U.S.A. 85:9689. Sanchez-Madrid, F., Krensky, A.M., Ware, C.F., Robbins, E., Strominger, J.L., Burakoff, S.J., Springer, T.A. (1982) Three d i s t i n c t antigens associated with human T lymphocyte-mediated c y t o l y s i s : LFA-1, LFA-2, and LFA-3. Proc. Natl. Acad. SCi. U.S.A. 79:7489. Sanchez-Madrid, F., Nagy, J.A., Robbins, E., Simon, P., & Springer, T.A. (1983) Characterization of a human leukocyte d i f f e r e n t i a t i o n antigen family with d i s t i c t alpha subunits and a common beta subunit: the lymphocyte function-associated antigen (LFA-1), the C3bi complement receptor (OKMl/Mac-1), and the pl50,95 molecule. J . Exp. Med. 158:1785. Sanders, M.E., Makgoba, M.W., Sharrow, S.O., Stephany, D., Springer, T.A., Young, H.A., & Dhaw, S. (1988) Human memory T lymphocytes express increased l e v e l s of three c e l l adhesion molecules (LFA-3, CD2, and LFA-1) and three other molecules (UCHL1, CDw29, and Pgp-1) and have enhanced INF-gamma production. J . Immunol. 140:1401. Seki, R., Spurr, N., Obata, F., Goyert, S., Goodfellow, P., and S i l v e r , J . (1985) The human Thy-1 gene: structure and chromosomal location. Proc. N a t l . Acad. S c i . U.S.A. 82:6657. Selvaraj, P., Plunkett, M.L., Dustin, M, Sanders, M.E., Shaw, S., Springer, T.A. (1987) The T lymphocyte glycoprotein CD2 bind the c e l l surface ligand LFA-3. Letters to Nature. 326:400. Sewell, W.A., Brown, M.H., Dunne, J . , Owen, M.J., & Crumpton, M.J. (1986) Molecular cloning of the human T-lymphocyte surface CD2(T11) antigen. Proc. Natl. Acad. S c i . U.S.A. 83:8718. Shaw, S., and Ginther Luce, G.E. (1987) The lymphocyte function associated antigen (LFA)-l and CD2/LFA-3 pathways of antigen-independent human T c e l l adhesion. J . Immunol. 139:1037. Shaw, S., Ginther Luce, G.E., Quinones, R., Gress, R.E., Springer, T.A., & Sanders, M.E. (1986) Two antigen-independent pathways used by human cytotoxic T - c e l l clones. Nature. 323:262. Sherr, C.J., Rettenmier, C.W., Sacca, R., Roussel, M.F., Look, A.T., and Stanley, E.R. (1985) The c-fms proto-oncogene product i s related to the receptor for the mononuclear phagocyte growth factor, CSF-1. C e l l . 41:665. Shiohara, T., Moriya, N., Gotoh, C , Saizawa, K., & Nagashima, M. (1988) Locally administered monoclonal antibodies to lymphocyte function associated antigen 1 and to L3T4 prevent cutaneous graft-vs-host disease. J . Immunol. 141:2261. Simionescu, N. (1983) C e l l u l a r aspects of trans c a p i l l a r y exchange. Physiological Reviews 63:1536-1579 Simmons, D., Malegapuru, M.W., and Seed, B. (1988) ICAM, an adhesion ligand of LFA-1, i s homologous to the neural c e l l adhesion molecule NCAM. Nature. 331:624. Spits, H., van Schooten, W., Keizer, H., van Seventer, G., wan de R i j n , M., Terhorst, C , and de Vries, J . (1986) Alloantigen recognition i s preceded by nonospecific adhesion of cytotoxic T c e l l s and target c e l l s . Science. 232:403. Springer, T.A., & Anderson, D.C. (1986) The importance of the Mac-1, LFA-1 glycoprotein family i n monocyte and granulocyte adherence, chemotaxis, and migration into inflammatory s i t e s : Insight from an experiment of nature. In Biochemistry of Macrophages (Ciba Symposium 118). Pitman; London. 51 Springer, T.A., Dustin, M.L., Kishimoto, T.K., and Marlin, S.D. (1987) The lymphocyte function-associated LFA-1, CD2, and LFA-3 molecules: C e l l Adhesion receptors of the immune system. Ann. Rev. Immunol. 5:223. Springer, T.A., M i l l e r , L.J., Anderson, D.C. (1986) pl50,95, the t h i r d member of the Mac-1, LFA-1 human leukocyte adhesion glycoprotein family. J . Immunol. 136:240. Springer, T.A., Thompson, W.S., M i l l e r , L.J., Schmalstieg, F.C., & Anderson, D.C.(1984) Inherited deficiency of the Mac-1. LFA-1, pl50/95 glycoprotein family and i t s molecular basis. J. Exp. Med. 160:1901. Staunton, D.E., Dustin, M.L., and Springer, T.A. (1989) Functional cloning of ICAM-2, a c e l l adhesion ligand for LFA-1 homologous to ICAM-1. Nature. 339:61. Staunton, D.E., Marlin, S.D., Stratowa, C , Dustin, M.L., & Springer, T.A. (1988) Primary structure of ICAM-1 demonstrates interaction between members of the immunoglobulin and in t e g r i n supergene fam i l i e s . C e l l . 52:925. Staunton, D.E., Marlin, S.D., Dustin, M.L., & Springer, T.A. (1988) Primary structure of ICAM-1 demonstrates interaction between members of the immunoglobulin and integrin supergene fami l i e s . C e l l . 52:925. Steinmetz, M. (1984) Structure, function, and evolution of the major histocompatibility complex of the mouse. TIBS. 9:224. Stolphen, A.H., Guinan, E.C., F i e r s , W, Pober, J.S. (1986) Recombinant TNF and immune interferon act singly and i n combination to reorganize human vascular endothelial c e l l monolayers. American Journal of Pathology. 123:16. Strassmann, G., Springer, T.A., and Adams, D.O. (1985) Studies on antigens associated with the activation of murine mononuclear monocytes: k i n e t i c s of and requirements for induction of lymphocyte function associated (LFA)-l antigen i n v i t r o . J . Immunol. 135:147. Strassmann, G., Springer, T.A., H a s k i l l , S.J., M i r a g l i a , C.G., Lanier, L.L., and Adams, D.O. (1985) Antigens associated with the ac t i v a t i o n of murine mononuclear phagocytes i n vivo: d i f f e r e n t i a l expression of lymphocyte function-associated antigen i n the several stages of development. C e l l . Immunol. 94:265. Takai, Y., Reed, M.L., Burakoff, S.J., & Herman, S.H. (1987) Direct evidence f o r a receptor-ligand interaction between the T - c e l l surface antigen CD2 and lymphocyte-function-associated antigen 3. Proc. N a t l . Acad. S c i . U.S.A. 84:6864. Tedder, T.F., Schmidt, R.E., Rudd, C.E., Kornacki, M.M., R i t z , J . , and Schlossman, S.F. (1986) Function of the LFA-1 and T4 molecules i n the d i r e c t activation of resting B lymphocytes by T lymphocytes. Eur. J . Immunol. 16:1539. Thome, R. (1898) Endothelien a l s phagocyten (aus den Lymphdrussen von Macacus cynomalgus). Arch. Microsk. Anat. 52:820. Thompson, K.M. (1988) Human monoclonal antibodies. Immunology Today. 9:113. 52 Tjandra, J . J . , and McKenzie, I.F. (1988) Murine monoclonal antibodies i n breast cancer: an overview. B r i t i s h Journal of Surgery. 75:1067. Townsend, A.R.M., Gotch, F.M., and Davey, J..(1985) Cytotoxic T c e l l s recognize fragments of the influenza nucleoprotein. C e l l . 42:457. Townsend, A.R.M., Rothbard, J . , Gotch, F.M., Bahadur, G., Wraith, D., and McMichael, A.J. (1986) The epitopes of influenza nucleoprotein recognized by cytotoxic T-lymphocytes can be defined with short peptides. C e l l . 44:959. Tsoukas, CD., Landgraf, B., Bent i n , J . , Valentine, M., Lotz, M., Vaughan, J.H., Carson, D.A. (1985) Activation of resting T lymphocytes by anti-CD3 (T3) antibodies i n the absence of monocytes. Journal of Immunology. 135:1719. van Noesel, C , Miedema, F., Brouwer, M., de Rie, M.A., Aarden, L.A., & van L i e r , R.A.W. (1988) Regulatory properties of LFA-1 alpha and beta chains i n human T-lymphocyte activation. Nature. 333:850. Vollger, L.W., Tuck, D.T., Springer, T.A., Haynes, B.F., and Singer, K.H. (1987) Thymocyte binding to human thymic e p i t h e l i a l c e l l s i s inh i b i t e d by monoclonal antibodies to CD-2, and LFA-3 antigens. J . Immunol. 138:358. Waldmann, H., (1988) Monoclonal antibodies for organ transplantation: prospects for the future. American Journal of Kidney Diseases 11:154. Wantzin, G.L., Ralfkiaer, E., Lisby, S., & Rothlein, R. (1988) The role of i n t e r c e l l u l a r adhesion molecules i n inflammatory skin reactions. Br. J . Dermatol. 119:141. Watts, T.H., Gaub, H.E., and McConnell, H.M. (1986) T-cell-mediated association of peptide antigen and major histocompatibility complex protein detected by energy transfer i n an evanescent wave-field. Nature. 320:179-181. Weiss, A., and Stobo, J.D. (1984) Requirement for the co-expression of T3 and the T c e l l antigen receptor on a malignant human T c e l l l i n e . J . Exp. Med. 160:1284. Williams, A.F. (1985) Immunoglobulin-related domains for c e l l surface recognition. Nature. 314:579. Williams, A.F. (1984) Molecules i n the immunoglobulin superfamily. Immunology Today. 5:219. Williams, A.F., and Gagnon, J. (1982b) Neuronal c e l l Thy-1 glycoprotein: homology with immunoglobulin. Science. 216:696. Williams, A.F., and Barclay, A.N. (1988) The immunoglobulin superfamily-domains for c e l l surface recognition. Ann. Rev. Immunol. 6:381. Yang, S.Y., Chouaib, S., and Dupont, B. (1986) A common pathway for T lymphocyte activation involving both the CD3-Ti complex and CD2 sheep erythrocyte receptor determinants. J . Immunol. 137:1097. Yang, S.Y., Rhee, S., Welte, K., and Dupont, B. (1988) D i f f e r e n t i a l i n v i t r o a ctivation of CD8-CD4+ T lymphocytes by combinations of anti-CD2 and anti-CD3 antibodies. J . Immunol. 140:2115. Yarden, Y., Escobedo, J.A., Kuang, W.-J., Yang-Feng, T.L., Daniel, T.O., Tremble, P.M., Chen, E.Y., ando, M.E., Harkins, R.N., Franke, U. (1986) Structure of the receptor for platelet-derived growth factor helps define a family of cl o s e l y related growth factor receptors. Nature. 323:226. 53 Yelton, D.E., Margulies, D.H., Diamond, B., and Scharff, M.D. (1980) Plasmacytomas and hybridomas. Development and applications. In: Monoclonal antibodies. Hybridomas: a new dimension i n b i o l o g i c a l analysis. Ed. Kennett, R.H., McKearn, T.J., and Bechtol, K.B. Pleneum Press, pp. 3-17. Yu, C.L., Haskgard, D.O., Cavender, D., Johnson, A.R., Z i f f , M. (1985) Human gamma interferon increases the binding of T lymphocytes to endothelial c e l l s . C l i n Exp Immunol. 62:554. 54 CHAPTER TWO MATERIALS AND METHODS 2.1 SOURCES OF MATERIALS 2.1.1 Animals 55 2.1.2 C e l l l i n e s 55 2.1.3 Monoclonal Antibodies 55 2.1.4 Xenoantisera 56 2.2 BIOCHEMICAL TECHNIQUES 2.2.1 C e l l Surface Labelling (Iodination) 56 2.2.2 Immunoprecipitation 56 2.2.3 SDS-PAGE Analysis 57 2.2.4 Direct Binding Assay 58 2.2.5 Chloramine T Iodination of Protein 58 2.2.6 Two-Dimensional Gel Analysis (I s o e l e c t r i c Focussing/SDS-PAGE) 59 2.2.7 Metabolic Labelling of MALA-2 59 2.2.8 Phosphorylation Study 60 2.2.9 Generation of Polyclonal Antiserum 60 2.2.10 Western Blot '. 60 2.2.11 Endoglycosidase F Analysis 61 2.3 PURIFICATION OF THE MALA-2 MOLECULE 2.3.1 Large Scale Preparation of C e l l Lysates 62 2.3.2 A f f i n i t y Chromatography 63 2.3.3 Preparative SDS-PAGE 63 2.3.4 Assessment of Purity and Yi e l d 65 2.4 PARTIAL AMINO ACID SEQUENCE DETERMINATION OF MALA-2 2.4.1 Tryptic Digestion of P u r i f i e d MALA-2 65 2.4.2 HPLC Separation of Trypsin-Generated Peptides 66 2.4.3 Microseguencing of Tryps in-Generated Peptides 67 2.5 COMPUTER-ASSISTED HOMOLOGY STUDIES 2.5.1 Searching the NBRF Protein Sequence Database with P a r t i a l Amino Acid Sequences of MALA-2 and the Wordsearch and Fasta Programs 67 2.6 REFERENCES 68 55 2.1 SOURCES OF MATERIALS 2.1.1 Animals Fisher 344 rats were purchased from Charles River Canada Ltd. (St. Constant, Quebec, Canada). 2.1.2 C e l l Lines The NS-1 c e l l l i n e i s a BALB/c myeloma. The T lymphoma c e l l l i n e s EL-4 and MBL-2 are of C57BL/6 mouse o r i g i n . EL-4 c e l l s were chemically induced while MBL-2 c e l l s were induced by Moloney leukemia v i r u s (Mo-MuLV). A l l three of these c e l l l i n e s were obtained from Dr. E.S. Lennox (MRC Laboratory of Molecular Biology, Cambridge, U.K.) These c e l l l i n e s were grown i n Dulbecco's modified minimum essential medium containing 5% f e t a l c a l f serum (FCS), 50 U/ml p e n i c i l l i n , and 50 ug/ml streptomycin. 2.1.3 Monoclonal Antibodies The YN1/1.7.4 rat monoclonal antibody was generated i n our laboratory from a fusion between rat myeloma Y3 and Fisher 344 rat spleen c e l l s immunized with NS-1 c e l l s , and boosted with additional NS-1 c e l l s four days before s a c r i f i c e . The YE1 series of rat monoclonal antibodies was also generated i n our laboratory from a fusion between the rat myeloma Y3 and Fisher 344 rat spleen c e l l s immunized with ECA17.9.8, a mouse T c e l l hybrid of EL-4BU and Con A activated AKR spleen c e l l s (Takei and Horton, 1981). A l l hybridomas were cloned twice. YE1/48.10.6 recognizes a murine T lymphocyte surface dimer c a l l e d YE1/48 antigen. YE1/9.9.3 recognizes the 56 t r a n s f e r r i n receptor i n a l l p r o l i f e r a t i n g mouse c e l l s (Takei, 1983). YE1/21.2.1 recognizes the CD45 (T200) antigen (Trowbridge, 1978). YE1/30.4.1 recognizes the Thy-1 molecule (Williams and Gagnon, 1982). YE6/26.1.1 was s i m i l a r l y generated, using the MBL-2 c e l l l i n e as immunizing c e l l s (Takei, 1987), and recognizes the Moloney MuLV envelope protein gp70 (Nowinski et a l . , 1972). 2.1.4 Xenoantisera Polyclonal antisera containing rabbit a n t i - r a t Ig (RaRIg), rabbit anti-mouse Ig (RaMIg), and mouse an t i - r a t Ig (MaRIg) antibodies were separately developed and a f f i n i t y p u r i f i e d i n our laboratory. A rat immune antiserum was also developed by immunizing a Fisher 344 rat with p u r i f i e d MALA-2 (see 2.3.4 below). 2.2 BIOCHEMICAL TECHNIQUES 2.2.1 C e l l Surface Labelling (Iodination) Lymphocyte surface proteins were radiolabelled by the iodogen method (Markwell, 1978). In b r i e f , 2-3 X 10 7 cultured c e l l s were agitated i n an iodogen coated (100 ug) v i a l i n 0.5 ml PBS containing 0.5 mCi ^25j (Amersham Corporation, Arlington Height, IL) for one hour at 20 C (room temperature). Radiolabelled c e l l s were then washed i ?s four times i n PBS to remove residual unreacted I. 2.2.2 Immunoprecipitation Radiolabelled c e l l s were lysed i n 2-3 ml of 50 mM Tris-HCl buffer (pH 7.5) containing 1% (w/v) Triton X-100, 0.5% (w/v) bovine 57 serum albumin (BSA), 0.15 M NaCl, and 0.01% (w/v) NaN3- Nuclei and insoluble materials were removed by microfuging for 10 minutes at 4 C. 30 u l of hybridoma culture supernatent was then added to the lysates, which were then incubated on ice for one hour. Agarose beads (30-50 u l of 50% suspension) coupled with RaRIg antibodies (2-4 mg/ml) were then added to the mixture f o r another two hour incubation at 4 C, and mixed slowly on a rotary mixer. After t h i s incubation, the beads were washed with the same l y s i s buffer without BSA, and the bound immune complex was eluted from the beads by b o i l i n g i n 50 u l SDS-PAGE sample buffer (with or without 2% 2-ME) for 5 minutes. 2.2.3 SDS-PAGE Analysis Sodium dodecylsulphate (SDS) polyacrylamide gel electrophoresis (PAGE) analysis (Laemmli, 1970) was performed either using a Protean apparatus (16cm X 18cm X 1.2 mm slab g e l , BIO-RAD Laboratories, Richmond, CA) or Mini-Slab apparatus (8 cm X 10 cm X 1mm, Idea S c i e n t i f i c , C o r v a l l i s , OR). Reduced protein markers were obtained from BIO-RAD Laboratories and include myosin (200 kD Mj.), beta-galactosidase (116.2 kD Mj.), phosphorylase B (92.5 kD Mj.), BSA (66.2 kD Mj.), ovalbumin (45.0 kD Mj.), and carbonic anhydrase (31.0 kD Mj.). These molecular weight standards were v i s u a l i z e d by staining with Coomassie blue, or S i l v e r staining. S p e c i f i c radiolabelled antigens were detected by autoradiography on KODAK XAR films with Dupont Cronex inte n s i f y i n g screens (DuPont, Wilmington, DE). 58 2.2.4 Direct Binding Assay C e l l s were f i r s t washed twice i n binding assay medium (B.A.M.) consisting of Earls medium, 0.5% BSA, 10 mM HEPES, and 0.5% NaNg. 2 10 c e l l s were dispensed per w e l l , and centrifuged at 1800 RPM i n a Beckman TJ-6 centrifuge. 25 u l of non-radiolabelled (blocking) antibody was used to resuspend the c e l l p e l l e t s of control wells, while 25 u l of straight media was used to resuspend p e l l e t s of a l l other wells. To both test and control wells, 25 u l of I-labelled antibody was added from a s e r i a l l y diluted range of 4 X 10^ CPM/25 u l to 4 X 10^ CPM/25 u l . This method was based on determination of the saturating l e v e l of the YN1/1.7.4 antibody on test c e l l s . After adding the r a d i o l a b e l e d antibody, the wells were incubated for one hr. at 4 C. C e l l s were then washed three times i n B.A.M., transferred to gamma counter tubes, and l e v e l s of r a d i o a c t i v i t y determined. 2.2.5 Chloramine T Iodination of Protein 10 u l of 1 M T r i s HC1 (pH 7.4), followed by 10 u l of 1.0 mg/ml of chloramine T solution was added to 20-50 ug of antibody (5-100 ul) sample. 5-10 u l of ±^-Ji were then added, and the mixture held at room temperature for 15 min. At t h i s time, 20 u l of 2 mg/ml sodium metabisulphite (NaS 20 5) was added, followed by 10 u l of 0.1 M KI. This was held at room temperature for 2 min., then loaded onto a P30 (BIO-RAD) column, with a 1.0 ml bed volume. The column was run with PBS, fractions (7 drops/gamma tube) were collected by hand i n a ventilated fume hood, and the radioactive fractions were pooled. 59 2.2.6 Two-Dimensional Gel Analysis ( I s o e l e c t r i c Focussing/SDS-PAGE) Two dimensional gel analysis (IEF versus SDS-PAGE) was performed according to the method of O'Farrell (1975) using ampholines of i s o e l e c t r i c points (pi) 3.5-10.0 (LKB, Bromma, Sweden), an improvised IEF apparatus for tube gels (13 cm long), and the Protean Slab Gel apparatus (BIO-RAD). IEF tube gels were pre-focussed for 1-2 hours before running the g e l . A mixture of proteins with known pi's (BSA, pl=4.9; carbonic anhydrase I I , pl=5.9; horse myoglobin, p i 6.8, 7.2) were included i n each sample along with an aliquot of i ?R -\"-^I-labelled p u r i f i e d MALA-2, and the tube gels were run at 500 V for 22 hrs. Tube gels were loaded onto the SDS-PAGE second dimension by i n s e r t i n g the tube gels h o r i z o n t a l l y within a long- w e l l along the top of the SDS-PAGE g e l , and were set i n place with agarose. The SDS-PAGE second dimension was run at 200 V u n t i l the dye front reached the bottom of the g e l . IEF markers were vi s u a l i z e d by Coomassie staining, while radioactively labelled MALA-2 was v i s u a l i z e d by autoradiography. 2.2.7 Metabolic Labelling 7 3 X 10 NS-1 c e l l s were washed twice i n methionme-free media. C e l l s were then resuspended i n 3 ml of methionine-free medium, or with 10% dialyzed FCS. 1 mCi of S-methionme was added, and the c e l l s were incubated at 37 C f o r 4 hrs. C e l l s were then washed 3 times with ice cold PBS containing 5% FCS and 0.1% NaN3- Cells were then lysed, and the lysate subjected to immunoprecipitation. 60 2.2.8 Phosphorylation Study 7 3 X 10 NS-1 c e l l s were washed twice i n phosphate-free medium. Ce l l s were then resuspended i n 3 ml of phosphate-free DMEM with 10% dialyzed FCS. 1 mCi of ca r r i e r - f r e e 3 2P-orthophosphate was added, and the c e l l s were incubated at 37 C for 4 hrs. C e l l s were washed 3 times with ice cold PBS containing 5% FCS and 0.1% NaN3-Cel l s were then lysed, and the lysate subjected to immunoprecipitation. 2.2.9 Generation of Polyclonal Antiserum A Fisher 344 rat was immunized repeatedly at two week int e r v a l s with 5 ug of p u r i f i e d MALA-2 suspended vigorously i n Freund's complete adjuvant. The rat was bled from i t s t a i l , and serum was tested for immune r e a c t i v i t y by western b l o t . 2.2.10 Western Blot Analyzed material consisted of either an SDS-PAGE separated immunoprecipitation, or SDS-PAGE separated membrane preparation when test i n g f o r i n i t i a l development of polyclonal immune serum. Membrane preparation i s described below; immunoprecipitation has been described previously (Sec. 2.2.2). For the membrane preparation, 2 X 10^ c e l l s were washed three times with PBS, and resuspended i n 10 mM Tris-HCl (pH 8.0). C e l l s were then sheared by force through a 26-gauge needle. Disrupted c e l l s were then centrifuged at 2000 RPM for 5 minutes i n a Beckman TJ-6 centrifuge to remove nu c l e i . Supernatent was recovered, and centrifuged i n a 15 ml corex tube for one hour at 18000 RPM i n a Beckman fixed angle (JA-20) rotor. The 61 p e l l e t was then recovered, and resuspended i n 200 u l of non-reducing sample buffer. The sample was boiled for 5 minutes, and microfuged-at 15000 RPM for 15 min. This yielded approximately 260 u l of dissolved membrane i n sample buffer. B l o t t i n g consisted of running 10-20 u l of membrane sample per lane on an SDS-PAGE minigel system, along with prestained molecular weight standards. The proteins separated on the minigel from either the membrane preparation or a s p e c i f i c immunoprecipitation were blotted onto n i t r o c e l l u l o s e using a transblot (BIO-RAD) apparatus (200 mA overnight, or 220 mA for a minimum of 3 hours). The blotted n i t r o c e l l u l o s e f i l t e r was then transferred to a p e t r i dish containing NET buffer (50 mM Tris-HCl, pH 7.5, 5mM EDTA, 150 mM NaCl, 0.05% NP-40 [Sigma, St. Louis, MO], 5% g e l a t i n , 0.5% BSA, 0.01% NaNg). The n i t r o c e l l u l o s e f i l t e r was stained by incubating the f i l t e r with hybridoma culture supernatent diluted 1:5 i n NET buffer or 1:50 s i m i l a r l y d i l u t e d immune serum. 10 mis of t h i s primary antibody d i l u t i o n and the n i t r o c e l l u l o s e f i l t e r b lot were gently shaken i n a p e t r i dish for 1 hr. at room temperature. The blot was then washed four times i n NET buffer, for 10, 20, 30, and 40 min. i-respectively. The washed bl o t was incubated with gentle shaking i n 10 ml of radiolabelled MaRIg (second antibody) undergoing gamma-decay at 2 X 10^ CPM/ml, washed again four times with NET buffer, and dried. The b l o t was then wrapped i n Saran wrap, and was used to expose KODAK XAR film s with Dupont Cronex intensifying screens (DuPont, Wilmington, DE). 2.2.11 Endoglycosidase F Analysis Endoglycosidase F digestion of MALA-2 was carried out 62 according to the procedure of Mclntyre and A l l i s o n (1984). 100 pg (5 u l of 20 pg/ul) of 1 2 5 I - l a b e l l e d (3.2 X 10 5 CPM/ul) p u r i f i e d MALA-2 was incubated with various concentrations of endoglycosidase F (New England Nuclear, Boston, MA) i n 0.1 M sodium phosphate buffer (pH 6.1) containing 50 mM EDTA, 1% (v/v) Nonidet P-40, and 0.1% SDS. Incubation was carried out at 37 C for various lengths of time up to 12 hrs. The digestion was terminated by transferring the samples to -20 C. Digestion samples were combined with SDS-PAGE sample buffer, and analyzed by SDS-PAGE. 2.3 PURIFICATION OF THE MALA-2 MOLECULE 2.3.1 Large scale preparation of c e l l lysate Spinner f l a s k s were seeded with NS-1 c e l l s at a density of not less than 1 X 10 5 c e l l / m l , and were not f i l l e d past 650 mis. These large scale quantities of NS-1 c e l l s were maintained i n exponential growth i n 1 l i t r e spinner f l a s k s , and c e l l s were harvested at a density of less than 2 X 10 6/ml. Total harvested c e l l number i n large scale preparations averaged 1 X 10 1 0. These c e l l s were harvested by centrifugation, washed three times i n PBS, and lysed i n f i l t e r e d l y s i s buffer containing 1% Triton X-100, lOmM Tris-HCl (pH 7.5), 0.85% NaCl, and 0.01% NaN3 for 15 min. at 4 C. Typic a l l y , 800 Q ml of l y s i s buffer were used for 5 X 10 c e l l s . The lysate was then centrifuged at 18000 RPM for 75 min. i n a Beckman JA-10 rotor. The supernatent was recovered and lysate from 3 X 10 I-labelled NS-1 c e l l s (prepared as above) was added to the batch lysate at t h i s time, allowing MALA-2 to be tracked i n subsequent i s o l a t i o n and p u r i f i c a t i o n steps. 63 2.3.2 A f f i n i t y Chromatography YN1/1.7.4 MAb was p u r i f i e d from ascites f l u i d by (NH^^SO^ p r e c i p i t a t i o n (50% saturation) followed by DEAE A f f i - g e l blue chromatography (BIO-RAD). The column fractions were analyzed f o r IgG purity by SDS-PAGE. P u r i f i e d antibody fractions were pooled, dialysed against 0.1 M NaHC03 (pH 8.0) and coupled to A f f i - g e l 10 agarose beads (BIO-RAD) at 2-4 mg per ml of packed beads. After coupling the beads were thoroughly washed with Earl's balanced s a l t solution containing 0.5% BSA, 10 mM HEPES (pH 7.2) and 0.01% NaNg to saturate the uncoupled s i t e s . The beads were extensively washed with elution buffer followed by l y s i s buffer before each use. The large scale NS-1 c e l l lysate was incubated with approximately 3 ml of YN1/1.7.4 MAb-coupled beads on ic e for 4 hrs. with constant agitation. The beads were then collected by centrifugation at 2000 RPM for 10 min. i n a Beckman TJ-6 centrifuge, and were packed into a column. The column was thoroughly washed overnight with lOmM Tris-HCl buffer (pH 7.5) containing 1% Triton X-100, 0.8% NaCl, and 0.01% NaN3- The bound material was then eluted with 100 mM glycine-HCl buffer (pH 2.9) containing 0.05% Triton X-100, 0.8% NaCl, and 0.01% NaN3- 1 ml fractions were collected, immediately neutralized with 0.5 ml of 1 M Tris-HCl buffer (pH 7.5), and radioactive fractions were pooled and concentrated i n a Centricon 30 microconcentrator (Amicon Corp, Danvers, MS). 2.3.3 Preparative SDS-PAGE Preparative SDS-PAGE was performed using the Protean apparatus from BIO-RAD. Precautions were taken to minimize the destruction of 64 amino ac i d residues on the p u r i f i e d protein within the g e l . The acrylamide gels were polymerized overnight and were pre-run extensively with a pre-clearing protein of low molecular weight ( i . e . lysozyme). Sodium glycothiolate was added at 0.1 mM i n the cathode buffer before electrophoresis of the r e a l sample. A f f i n i t y isolated MALA-2 was concentrated by u l t r a f i l t r a t i o n i n a Centricon 30 microconcentrator (Amicon Corp., Danvers, MS) at 20 C. An equal volume of non-reducing sample buffer was added to the concentrated MALA-2, which was then denatured at 55 C to minimize protein aggregation (Hunkapillar et a l . , 1983). The MALA-2 preparation was then separated on the 7.5% pre-run, pre-cleared preparative SDS-PAGE ge l . After electrophoresis was complete, the gel was sandwiched between two layers of d i a l y s i s membrane and dried by heat and negative pressure. Autoradiography revealed the region of MALA-2 migration. This band was cut out, reconstituted i n 0.5 X f i l t e r e d SDS-PAGE running buffer (25 mM glycine, 12.5 mM Tris-HCl, and 0.05% SDS). MALA-2 was then eluted from the gel s l i c e electrophoretically into a closed d i a l y s i s tube. The eluant was then concentrated i n a Centricon 30 microconcentrator, and resuspended i n an equal volume of 0.2 M Tris-HCl (pH 8.0), 4% SDS, and 100 mM d i t h i o t h r e i t o l (DTT). The MALA-2 preparation was then heated i n a b o i l i n g water bath f o r 10 minutes. Iodoacetamide was added to a concentration of 50 mM subsequent to heating, and was then stored i n the dark at 37 C for 1 hr. The MALA-2 preparation was then run on a second SDS-PAGE preparative g e l , s i m i l a r to i n i t i a l procedure, except that the sample was reduced and akylated (see above). The pu r i f i e d MALA-2 was eluted electrophoretically from t h i s second g e l , and 65 dialysed. The sample was then concentrated i n a Centricon 30 concentrator, and stored at -20 C. 2.3.4 Assessment of Purity and Y i e l d A small quantity of p u r i f i e d MALA-2 was run on a 10% SDS-PAGE ge l . The gel was stained by the s i l v e r staining method using s i l v e r n i t r a t e (AnalaR, BDH, Toronto, ON). Development of the gel was arrested by apiration of the developing solution and replacement of the solution with water. The i n t e n s i t i e s of the resultant s i l v e r stained bands were compared with a range of (0.04, 0.1, 0.2, 0.5, and 1.0 ug) BSA quantitative standards stained i n the same g e l . Typical p u r i f i e d MALA-2 y i e l d from a large batch of 1 X 1 0 ^ c e l l s was approximately 80 ug. Considering the density of MALA-2 on NS-1 c e l l s t h i s amount represents a recovery of approximately 37% (80 ug from 300 ug projected maximum yield) i n p u r i f i e d form. 2.4 PARTIAL AMINO ACID SEQUENCE DETERMINATION OF MALA-2 2.4.1 Tryptic Digestion of P u r i f i e d MALA-2 Methanol p r e c i p i t a t i o n and digestion of the precipitated MALA-2 sample was carried out according to the method used by Stearne et a l . (1985). Between 50-80 ug (500-800 pmol) of p u r i f i e d MALA-2 was transferred to a s i l i c o n i z e d Corex tube to which 9 volumes of high pressure l i q u i d chromatography (HPLC) grade methanol (BDH, Toronto, ON) was added. The methanol had been precooled to -20 C. Addition of methanol was immediately followed by addition of TPCK-treated trypsin (Sigma, St. Louis, MO) at 1% of the weight of the 66 MALA-2 sample. The mixture was held overnight at -20 C, and then centrifuged for 45 minutes at 16000 X G and -5 C i n a Beckman JA-20 rotor (and Beckman J2-21 centrifuge). The supernatent was c a r e f u l l y aspirated, and the sediment (precipitated MALA-2 and 1% trypsin) was vacuum-dried. The dried sediment was resuspended i n lOOul of 0.1 M NH4HC03 (pH 8.0) with 2 mM CaCl 2 and another 1% TPCK-treated tryp s i n , f o r a f i n a l w/w r a t i o of MALA-2:trypsin of 50:1. The digestion sample was then incubated at 37 C for 24 hrs. 2.4.2 HPLC Separation of Trysin-Generated Peptides of MALA-2 Following the trypsin digestion of MALA-2, the sample was made up to 3 M Guanidinium HC1 (ARISTAR, BDH, Poole, England)/0.2% TFA by the addition of an equal volume of 6 M Guanidinium HCL/0.2% TFA. This mixture was incubated at 37 C for 30 min., p r e f i l t e r e d , and then fractionated on a BONDAPAK C-^ g reverse phase HPLC column (Waters Associates, M i l f o r d , MS; 3.9 mm X 30 cm). The column was pre-equilibrated i n 0.1% TFA. The injected sample was separated on the basis of a gradient of p r e f i l t e r e d 0-60% a c e t o n i t r i l e (v/v) i n 0.1% TFA, forming the mobile phase of the column. The gradient was run over a period of 105 minutes at a flow rate of 1 ml/minute. The HPLC system (Waters) u t i l i z e d two model 510 pumps, a 660 automated gradient c o n t r o l l e r , a 490 programmable multi-wavelength detector, and a U6K manual in j e c t o r . Absorbance set at 215 nm was recorded on an SE 120 recorder at a chart speed of 0.5 cm/min, and an absorbance range of 0.0 to 0.2 absorbance un i t s . Fractions of the eluent were collected by hand i n a manner correlating with observed absorbance peaks, and were stored at -20 C. 67 2.4.3 Microsequencinq of Trypsin-Generated Peptides Selected fractions corresponding to the sharpest, most symmetrical absorbance peaks were selected for amino acid sequencing, i n an e f f o r t to select fractions containing only a single peptide. These fractions were sequenced (according to the method of Hunkapillar et a l . , 1983) i n an automated gas phase protein sequenator (Model 470, Applied Biosystems) equipped with an on-line PTH (phenylthiohydantoin) analyzer. Sequencing was performed at the T r i p a r t i t e Microsequencing Centre (University of V i c t o r i a , V i c t o r i a , B.C.). 2.5 CX3MFUTER-ASSISTED HOMOLOGY STUDIES 2.5.1 Searching the NBRF Protein Sequence Database with P a r t i a l Amino Acid Sequences of MALA-2 and the WORDSEARCH and FASTA Programs Each of the trypsin-generated MALA-2 peptides was compared with the l i s t of amino acid sequences i n the NBRF (National Biomedical Research Foundation) database (release 21.0). Amino acid sequence comparisons were carried out with the WORDSEARCH program and with the FASTA program University of Wisconsin, Genetics Computer Group, Madison, WI) based on the algorithms of Wilbur and Lipmah (1983), and of Pearson and Lipman (1988) respectively. 68 2.6 REFERENCES Guellaen, G., Goodhardt, M., and Hanoune, J. (1984) Preparative SDS gel electrophoresis. In: Receptor Biochemistry and Methodology, Vol. 2 (Eds. Venter, J.C, and Harrison, L.C) Man R. L i s s Inc., New York, p.109. Hunkapillar, M.W., Hewick, R.M., Dreyer, W.J., & Hood, L.E. (1983) High-sensitivity sequencing with a gas phase sequenator. Meth. Enzymol. 91:399. Laemmli, U.K. (1970) Cleavage of str u c t u r a l proteins during the assembly of the head of bacteriophage T4. Nature. 227:680. Markwell, M.A.K., and Fox, C.F. (1978) Surface s p e c i f i c iodination of membrane proteins of viruses and eukaryotic c e l l s using 1,3,4,6-tetrachloro-3,6-diphenylglycouil. Biochemistry. 17:4807. Mclntyre, B.W., & A l l i s o n , J.P. (1984) Biosynthesis and processing of the murine T c e l l antigen receptor. C e l l . 38:659. Nowinski, R.C, Fleissner, E., Sarkar, N.H., and Aoki, T. (1972) Chromatographic separation and antigenic analysis of the oncornaviruses. I I . Mammalian leukemia-sarcoma viruses. J . V i r o l . 9:359. O'Farrell, P.H. (1975) High Resolution two-dimensional electrophoresis of proteins. J . B i o l . Chem. 250:4007. Pearson, W.R., and Lipman, D.J. (1988) Improved tools f o r b i o l o g i c a l sequence comparison. Proc. Natl. Acad. S c i . U.S.A. 85:2444. Stearne, P.A., van D r i e l , I.R., Grego, B., Simpson, R.J., and Goding, J.W. (1985) The murine plasma c e l l antigen PC-1: p u r i f i c a t i o n and p a r t i a l amino acid sequence. J. Immunol. 134:443. Takei, F. (1983) Two surface antigens expressed on p r o l i f e r a t i n g mouse T lymphocytes defined by rat monoclonal antibodies. J . Immunol. 130:2794. Takei, F. (1987) Murine T lymphoma c e l l s express a novel membrane associated antigen with unique features. J . Immunol. 139:649. Takei, F., and Horton, M.A. (1981) Ly-6 region regulates expression of multiple a l l o s p e c i f i c i t i e s . Immunogenetics. 13:435. Trowbridge, I.S. (1978) Interspecies spleen-myeloma hybrid producing monoclonal antibodies against mouse lymphocyte surface glycoprotein, T200. J. Exp. Med. 148:313. Wilbur, W.J., and Lipman, D.J. (1983) Rapid s i m i l a r i t y searches of nucleic acid and protein databanks. Proc. Natl. Acad. S c i . U.S.A. 80:726. Williams, A.F., and Gagnon, J. (1982) Neuronal c e l l Thy-1 glycoprotein: homology with immunoglobulin. Nature. 314:579. 69 CHAPTER THREE RESULTS 3.1 PURIFICATION OF MALA-2 3.1.1 Density of MALA-2 on Lymphoid C e l l Lines 70 3.1.2 Specific Immunoprecipitation of MALA-2 from the NS-1 C e l l Line 70 3.1.3 I s o l a t i o n of MALA-2 72 3.1.4 P u r i f i c a t i o n of MALA-2 74 3.2 CHARACTERIZATION OF THE BIOCHEMICAL PROPERTIES OF MALA-2 3.2.1 MALA-2 i s a\\ Glycoprotein 76 3.2.2 I s o e l e c t r i c Point of MALA-2 76 3.2.3 Metabolic Labelling of MALA-2 78 3.2.4 Development of Polyclonal Serum Directed Against MALA-2 80 3.2.5 MALA-2 i s not Associated with the Transferrin Receptor 82 3.2.6 Phosphorylation Study of MALA-2 82 3.3 DETERMINATION OF THE PARTIAL AMINO ACID SEQUENCE OF MALA-2 3.3.1 Trypsin Digestion of MALA-2 ,.85 3.3.2 Separation and Sequences of Trypsin-Generated Peptides 89 3.4 HOMOLOGY COMPARISONS USING PARTIAL AMINO ACID SEQUENCES OF MALA-2 3.4.1 Comparisons of P a r t i a l Amino Acid Sequences within the NBRF Database: Limited Homologies with Immunoglobulins and Kinases 96 3.5 REFERENCES 101 70 3.1 PURIFICATION OF MAIA-2 3.1.1 Density of MALA-2 on Lymphoid C e l l Lines The density of MALA-2 on three c e l l l i n e s was examined using the d i r e c t binding assay. A known quantity of the YN1/1.7.4 MAb was radioactively labelled by protein iodination, and the l e v e l of r a d i o a c t i v i t y per ug of antibody was determined. Incubation of a known quantity of c e l l s with the labelled antibodies f a c i l i t a t e d a sensitive quantification of s p e c i f i c a l l y bound antibodies. A s e r i a l range of labelled antibody was used to determine the l e v e l at which a l l YN1/1.7.4 binding s i t e s were saturated on the various c e l l types. The l e v e l at which cell-bound r a d i o a c t i v i t y could not be increased by increasing concentrations of antibody was considered the l e v e l of saturation. The highest expressing c e l l l i n e was the murine myeloma c e l l l i n e NS-1. (See Table I I for r e s u l t s ) . 3.1.2 S p e c i f i c Immunoprecipitation of MALA-2 from the NS-1 C e l l Line MALA-2 was immunoprecipitated from the surface of 1 2 5 I - l a b e l l e d NS-1 c e l l s , using the YN1/1.7.4 antibody. i Irnmunoprecipitations were carried out coccurrently with YEl/9.9.3 (positive control) s p e c i f i c f o r the t r a n s f e r r i n receptor, and YE1/48 (negative control) s p e c i f i c f o r the YE1/48 antigen, not expressed on NS-1. Immunoprecipitated material was separated by SDS-PAGE under non-reducing conditions, and v i s u a l i z a t i o n was achieved by autoradiography (refer to FIG. 1). Two s p e c i f i c bands could be vi s u a l i z e d , a sharply defined band detecting the t r a n s f e r r i n receptor (lane a) at approximately 200 kD (M^.), and a diffuse band detecting 71 TABLE I I DENSITY OF MALA-2 ON LYMPHOID CELL LINES Cell line Origin Density NS-1 BALB/c myeloma 1.8 X 10 5/cell EL-4 C57BL/6 T lymphoma 3.9 X 10 4/cell MBL-2 C57BL/6 T lymphoma 4.4 X 10 4/cell NOTE: A known quantity of c e l l s of each c e l l . l i n e was washed and distributed among a series of wells. Control well c e l l s were resuspended using 25 ul of culture supernatent of non-radiolabelled antibodies (blocking antibodies), while test c e l l s were resuspended with 25 u l of straight media. Each of the wells then received 25 ul of radiolabelled antibody from a se r i a l l y diluted range (4 X 10° CPM/25 ul to 4 X 10 CPM/25 u l ) . After incubation, the cells were washed, and levels of bound radioactivity measured. Control wells showed that bound radioactivity on the c e l l s was specific, and could be abrogated by the blocking antibody. The level of saturation of antibody binding to ce l l s was determined, and the total number of antibody binding sites calculated. For example, with the level of saturation of binding sites on NS-1 ce l l s being 1.4 X 10 CPM, the calculation was performed in the following manner: 1.4 X 10 5 CPM/105 c e l l s = 4.4 X 10\"3 ug Ab/105 c e l l s 3.2 X 10 7 CPM/ug Ab 6.02 X 10 2 3 Ab .5 X 10 1 1 ug 4.4 X 10\"3 ug Ab/105 c e l l s = 1.8 X 10 5 antibodies/cell 72 MALA-2 at approximately 95-105 kD (Mr). The appearance of the band detecting MALA-2 i s characteristic of immunoprecipitations of this molecule. 3.1.3 Isolation of MALA-2 Large scale NS-1 cell-lysate was incubated with YN1/1.7.4 MAb-coupled agarose beads. The beads were then thoroughly washed, and bound materials were eluted with low pH buffer (see Sec. 2.3.2, Materials and Methods). This resulted in the isolation of MALA-2 from the lysate, although the preparation at this point was s t i l l crude. FIG. 2. shows the degree of purity of the MALA-2 preparation, visualized in this SDS-PAGE gel (non-reducing conditions) by Coomassie blue staining on the l e f t side of the gel, and by silver staining on the right side of the gel. This latter method is approximately 100 times more sensitive in detecting the presence of protein. Lanes h, i , j show that, although the most prominent band exists in the region corresponding to the Mr of MALA-2, there are many other , contaminating proteins present, including l i k e l y transferrin receptor contamination at approximately 200 kD. Lanes h and i contain 5 ul of MALA-2 crude preparation (out of a total sample size of approximately 1800 u l ) , while lanes f and j contain 3 ul of crude MALA-2 preparation. Lanes f,g are stained with Coomassie b r i l l i a n t blue which also detects the presence of proteins, but at a much less sensitive level. Although none of the contaminating proteins are visualized by Coomassie staining, this method does indicate that the major band of protein i s localized within an area which is discrete relative to the corresponding area in the silver stain. Other lanes 73 FIG. 1. Specific innnmoprecipitaion of MALA-2 from c e l l line NS-1. NS-1 c e l l s were c e l l - s u r f a c e iodinated with I, and then subjected to immunoprecipitation by the following monoclonal antibodies: (a) YE1/9.9.3, s p e c i f i c f o r the t r a n s f e r r i n receptor, (b) YN1/1.7.4, s p e c i f i c f o r MALA-2, and (c) YE1/48, s p e c i f i c f o r the antigen of the same name, not expressed on t h i s c e l l l i n e . Immunoprecipitated proteins were analyzed by SDS-PAGE and autoradiography. The arrows and corresponding numbers indi c a t e the positions of pr o t e i n standards ( v i s u a l i z e d at an e a r l i e r stage by Coomassie blue s t a i n i n g of the gel i t s e l f ) . M^ of the protein standards i s as follows: myosin (200 kD), beta-galactosidase (116 kD), phosphorylase B (92.5 kD), BSA (66.2 kD), and ovalbumin (45.0 kD). A d i f f u s e band i n the 90-115 kD range i n lane b i s representative of MALA-2 i n t y p i c a l immunoprecipitations. 74 correspond to the high molecular weight standards (lane a) or various known concentrations of BSA (b-e, k-n) used comparatively to determine the relative quantity of protein present in the test lanes ( f - j ) . 3.1.4 Purification of MALA-2 MALA-2 was purified from the crude preparation by two consecutive steps of SDS-PAGE. The f i r s t preparative gel was run under non-reducing conditions to ensure separation of the transferrin receptor and any other contaminating proteins having a Mj. distinct from MALA-2 under non-reducing conditions. The band corresponding to MALA-2 was then cut from the gel, eluted, concentrated, and run on a second preparative gel under reducing conditions. This second purification step increased purity of the MALA-2 preparation by removing proteins which migrate similarly to MALA-2 under non-reducing conditions, but which may migrate differentially under reducing conditions. The band corresponding to MALA-2 was cut from this second gel, and eluted. FIG. 3. shows the purity of the MALA-2 preparation subsequent to these purification procedures, run under reducing conditions and on an SDS-PAGE gel (10%). In this gel, the l e f t side was stained by Coomassie blue, while the right side was stained with Silver stain. Lanes e , f , i , and j correspond to the purified MALA-2 preparation, and indicate a high degree of purity. BSA quantitative standards are represented by lanes a-d and k-o, while lane h represents high molecular weight standards. Considering the density of MALA-2 on NS-1 c e l l s determined by direct binding assay in this thesis study (1.8 X 10 5/cell), the calculated theoretical yield of MALA-2 from 1 X 10 1 0 NS-1 ce l l s i s 300 ug. After purification, 75 FIG. 2. Degree of purity of MALA-2 after specific elution from antibody a f f i n i t y colunn (and comparison of the relative sensitivities of Coomassie bine staining and Silver staining of proteins). Gel i s stained with Coomassie b r i l l i a n t blue ( l e f t side of gel) and S i l v e r s t a i n ( r i g h t side of g e l ) , (lane a) High M_ pro t e i n standards: myosin (200 kD), beta-galactosidase (116 kD), phosphorylase B (92.5 kD), BSA (66.2 kD), and ovalbumin (45.0 kD). (lanes b,c,d,e) BSA quantitative standards; 1.0, 0.5, 0.2, 0.1 ug respe c t i v e l y ; (lanes f , g , h , i , j ) MALA-2 i s o l a t e d v i a a n t i b o d y - a f f i n i t y column, lanes f and j contain 3 u l , and lanes g/h and i contain 5 u l of MALA-2 crude preparation (after a f f i n i t y column i s o l a t i o n , and before a d d i t i o n a l p u r i f i c a t i o n steps). MALA-2 i s seen as a wide band migrating to approximately 90-95 kD, while several contaminating proteins can also be seen i n the S i l v e r s t a i n , (lanes k,l,m,n) BSA quantitative standards, 0.1, 0.2, 0.5, and 1.0 ug re s p e c t i v e l y . 76 the total yield was found to be approximately 80 ug, or 37% of the total (theoretical) yield. The pure preparation of MALA-2 was used for several subsequent experiments. 3.2 CHARACTERIZATION OF THE BIOCHEMICAL PROPERTIES OF MALA-2 3.2.1 MALA-2 is a Glycoprotein Purified MALA-2 was iodinated using the Chloramine T method (see Sec. 2.2.5, Materials and Methods), and was incubated with various concentrations of endoglycosidase F (FIG. 4, lanes A-D), an enzyme which i s capable of cleaving N-linked carbohydrate chains. At each concentration of enzyme, the preparation was incubated for three different time periods, ranging from 2 hours to 12 hours (lanes 1-3 under each letter corresponding to an enzyme concentration). The three lanes grouped under letter A were devoid of enzyme, and represent the normal state of the purified MALA-2 after iodination. The groups of lanes under B-D show a steadily decreasing Mj-, indicating the cleavage of N-linked carbohydrate chains (this procedure does not remove 0-linked carbohydrate chains). The lowest Mj. species exhibits a Mj. of approximately 66 kD, indicating that the peptide backbone of MALA-2 is approximately 66 kD Mj.. In each group of lanes, lane 3 ran poorly, and seemed to be aggregated near the top of the gel. 3.2.2 Isoelectric Point of MALA-2 Purified MALA-2 was iodinated using the chloramine T method, and was used to determine the isoelectric point (pi) of MALA-2. In 77 FIG. 3. Degree of purity of MALA-2 after two consecutive purification steps (consecutive NR and R SDS-PAGE). The ge l i s stained with S i l v e r s t a i n on the r i g h t , and with Coomassie b r i l l i a n t blue on the l e f t , (lanes a-d) BSA quantitative standards; 1.0, 0.5, 0.2, 0.1 ug respec t i v e l y ; (lanes e,f) p u r i f i e d MALA-2; (lanes g,h) high M r protein standards; (lanes i , j ) p u r i f i e d MALA-2; (lanes k-o) BSA quant i t a t i v e standards, 0.04, 0.1. 0.2, 0.5, 1.0 ug re s p e c t i v e l y . Lanes f and i contain 2 u l of pure MALA-2 preparation, and lanes e and j contain 1 u l of pure MALA-2 preparation (from a t o t a l volume of approximately 800 u l ) . This g e l shows the MALA-2 preparation to be highly p u r i f i e d . 78 this experiment, MALA-2 was subjected to two-dimensional gel electrophoresis. MALA-2 was f i r s t loaded onto an IEF tube-gel along with non-radioactively labelled IEF protein standards (BSA pl=4.9, Mj.=66.2 kD; carbonic anhydrase II pl=5.9, Mr=30.0 kD; horse myoglobin pl=6.8, 7.2, Mr=17.5 kD). The IEF tube gel was pre-focussed, thereby setting up a charge gradient within the gel. Running this gel allowed MALA-2 and the IEF protein standards to migrate to their isoelectric points within a pre-focussed isoelectric gradient (referred to as the f i r s t dimension). The tube gel was then placed along the top of an SDS-PAGE gel (the second dimension) f a c i l i t a t i n g separation of MALA-2 from the IEF standards based on size. FIG. 5. shows the f i r s t dimension represented on the horizontal axis, and the second dimension represented on the vertical axis. The spot on the autoradiograph represents the radiolabelled MALA-2, and corresponds to an acidic isoelectric point of 4.9. 3.2.3 Metabolic Labelling of MALA-2 In this experiment, MALA-2 was immunoprecipitated from the surface of NS-1 ce l l s which had not been cell-surface iodinated. Instead, these c e l l s were incubated with S-labelled methionine, which can be used as a metabolic substrate. FIG. 6. is a gel (run in reducing conditions) showing that the labelled methionine was used as an anabolic substrate in the synthesis of both the transferrin receptor (lane D), and MALA-2 (lane A), while no specific bands could be visualized for either the YE1/48 antigen or T200 (lanes B and C respectively). The transferrin receptor has migrated to approximately 95 kD, which i s normal for this disulphide-bonded protein under 79 ENDOGLYCOSILASE F DIGESTION OF MALA-2 ENDO F (units) A= 0 B=0.5 C= 1.0 D= 1.5 INCUBATION PERIOD (hours) lane 1 = 2 lane 2=4 lane 3=12 A B C D 1 2 3 1 2 ^ 1 2 3 1 2 1 ' •• -92.5 66.5 45.0 32.0 ft FIG. 4. Glycoprotein nature of MALA-2; digestion with endoglycosidase-F. Purified MALA-2 was * ^ I-labelled by the choramine T method. 100 pg (5 u l of 20 pg/ul) of labelled MALA-2 was incubated with 0, 0.5, 1.0, and 1.5 units of endoglycosidase F (represented by the groups of three lanes labelled A-D respectively). Incubation took place at 37 C for 2 hrs (lanes labelled 1), 4 hrs (lanes labelled 2) and 12 hrs (lanes labelled 3). Numbers and arrows correspond to the following ML proteins standards: phosphorylase B (92.5 kD), BSA (66.2 kD), ovalbumin (45.0 kD), and carbonic anhydrase (31.0 kD), visualized by Coomassie blue staining of the gel at an earlier stage. The most completely digested specie of MALA-2 i s seen in lane D2, and corresponds roughly to a M_ of 66 kD. This figure i s an autoradiograph exposed by an SDS-PAGE gel on which the digestion samples were analyzed. 80 reducing conditions. Lane A shows a specific band representing MALA-2 which is characteristic of this molecule under both reducing and non-reducing conditions. The difference in intensity of these bands, detected by autoradiography, may be a reflection of either a difference in the number of methionine residues, or a more substantial rate of synthesis of the transferrin receptor compared to MALA-2. 3.2.4 Development of Polyclonal Serum Directed Against MALA-2 In order to obtain immune serum capable of staining MALA-2 in western blots, polyclonal antiserum raised against MALA-2 was developed by administering intraperitoneal immunizations to a rat. The injected material consisted of purified MALA-2 combined with Freund's complete adjuvant. FIG. 7. shows the results of examination of the immunized rat's serum by western blot. Cell membrane isolated from NS-1 cel l s was run on a gel, transferred to nitrocellulose, and the nitrocellulose stained by normal rat serum (lanes a,b,c) and by immunized rat serum (lanes d,e,f). The serum-stained nitrocellulose was then incubated with a radioactive second antibody (mouse anti-rat Ig) to trace the regions of specific antibody staining. This figure shows that the immunized rat serum could specifically recognize MALA-2 (band at approximately 95 kD Mj.) and another membrane component with a Mj. of approximately 50 kD. This dual specificity of immune serum recognition may be a result of either cross-reactivity of the serum with a lower molecular weight molecule, or may be due to contamination of the injected material with another protein, resulting in an immune response to both MALA-2 and the putative contaminant. The polyclonal immune serum was subsequently used to examine a possible relationship between MALA-2 and the transferrin receptor. 81 pi OF MALA-2 IS< 4.9 t t t t 4.9 5.9 6.8 7.8 pi (pH units) 92.5 6 6 2 kd 45.0 31.0 FIG. 5. Two-dimensional g e l electrophoresis analysis of p u r i f i e d MALA-2. Purified MALA-2 was 1 2 5 I - l a b e l l e d by the chloramine T method. The MALA-2 sample was analyzed in the f i r s t dimension by isoelectric focussing (horizontal axis), and in the second dimension by SDS-PAGE (vertical axis). The following protein standards were used as markers for isoelectric focussing: BSA (pl=4.9), carbonic anhydrase II (pl=5.9), and horse myoglobin (pl=6.8 and 7.2). The following protein standards were used as M^ markers for SDS-PAGE: phosphor lyase B (92.5 kD), BSA (66.2 kD), ovalbumin (45.0 kD), and carbonic anhydrase (31.0 kD). A l l standards were visualized by Coomassie blue staining. The 2-dimensional gel was subjected to autoradiography to detect MALA-2, seen in this figure to localize to a pi of just less than 4.9. 82 3.2.5 MALA-2 Is Not Associated with the Transferrin Receptor Considering the similar pattern of expression of MALA-2 and the transferrin receptor on lymphoid c e l l types, that antibodies against both the MALA-2 and the transferrin receptor are capable of inhibiting mitogen stimulation and the MLR, and that transferrin receptor immunoprecipitations coprecipitate a band of approximately Mj. 95 kD, i t was suspected that a physical relationship existed between the transferrin receptor and MALA-2. Investigation of this relationship was fa c i l i t a t e d by the generation of polyclonal antiserum against MALA-2, capable of staining MALA-2 on western blots. The transferrin receptor was specifically immunoprecipitated and run out on an SDS-PAGE gel. The contents of the entire lane (which would include any coprecipitating materials) was transferred to nitrocellulose, and stained with the MALA-2 polyclonal antiserum. FIG. 8. shows that MALA-2 was not coprecipitated along with the transferrin receptor, as there was no specific band detected by autoradiography in the approriate Mj. range. Similarly, MALA-2 did not coprecipitate with any of the other control immunoprecipitations. 3.2.6 Phosphorylation Study of MALA-2 The possibility that MALA-2 may be phosphorylated was investigated, as there were some indications that peptide fragments of MALA-2 shared slight homology to a group of proteins known as tyrosine kinases, as well as homology to the immunoglobulin superfamily (see section 3.4). In this study, NS-1 and MBL-2 cel l s were incubated with OO -^P-orthophosphate. The c e l l s were subsequently lysed, and 83 35 S METHIONINE LABELLING OF MALA-2 A B C D - H^M^— 200 •116 •92.5 •66.2 K Q •45.0 '31.0 FIG. 6. Metabolic labelling of MALA-2. _NS-1 cells were incubated in methionine-free media, supplemented with S-labelled methionine, for 4 hrs. Cells were then lysed and subjected to immunoprecipitation. Immunoprecipitated samples were subjected to SDS-PAGE analysis, and the gel subjected to autoradiography. Arrows and numbers refer to ^ standards. Immunoprecipitations were carried out by specific monoclonal antibodies, (lane A) YN1/1.7.4, specific for MALA-2; (lane B) YE1/48, specific for the cell-surface molecule of the same name; (lane C) YE1/21, specific for T200 (CD45); and (lane D) YE1/9.9.3, specific for the transferrin receptor. This gel was run under reducing conditions. Lane A shows a faint band (indicated by single arrow) corresponding to MALA-2, while lane D shows a band corresponding to the reduced form of the transferrin receptor. 84 a b c def FIG. 7. Generation of polyclonal serum against MALA-2. A Fisher 344 rat was immunized with MALA-2 suspended in Freund's complete adjuvant. Rat serum was then tested for reactivity against MALA-2 by western blot. Membrane was prepared from 2 X 10 NS-1 ce l l s , separated by SDS-PAGE, and blotted onto nitrocellulose, which was then incubated with serum from the immunized rat, or from a normal rat. The antibody stained blots were then incubated with radioactively labelled secondary antibodies (MaRIg) to detect the presence of specifically bound primary antibodies in the rats' serum. The blot was then dried and subjected to autoradiography. The arrows and numbers correspond to Mj. protein standards. Lanes a,b,c are stained with normal rat serum as source of primary antibody, while lanes d,e,f are stained with immunized rat serum. Lanes a,b,d and e were run with 10 ul of membrane preparation, while lanes c and f were run with 15 ul of membrane preparation. Lanes d-f show the immunized rat serum to contain antibodies to MALA-2 and also to a lower ML molecule. Normal rat serum showed no specific antibody staining. 85 appropriate c e l l surface antigens were immunoprecipitated and analyzed on SDS-PAGE. FIG. 9. shows that a phosphorylated species of MALA-2 could not be detected in either of these c e l l lines (lanes l a , 2a), although phosphorylation of the transferrin receptor could be detected in MBL-2 ce l l s (lane Id). Neither of the negative controls (lanes l b , l c , 2b,2c) exhibited specific banding. 3 . 3 DETERMINATION OF THE PARTIAL AMINO ACID SEQUENCE OF MALA-2 3.3.1 Trypsin Digestion of MALA-2 Digestion of purified MALA-2 was necessary to determine the partial amino acid sequence of this molecule, since an attempt to determine the amino terminal sequence was impossible due to N-terminal blockage. MALA-2 was consequently incubated with trypsin (which specifically cleaves proteins after arginine and lysine residues), in an attempt to determine whether peptide fragments of MALA-2 could be generated by this method. FIG. 10 shows the result of having digested purified, chloramine T-iodinated MALA-2. Autoradiography showed that undigested MALA-2 exhibited characteristic migratory properties (lane A), while MALA-2 incubated with trypsin showed a distinct banding pattern which was indicative of significant digestion (lane B). Lane B shows that two major fragments of MALA-2 were present, migrating to regions corresponding to Mj-'s of 60 kD and 37 kD respectively, and l i k e l y representing incompletely digested fragments. The majority of radioactively labelled MALA-2 was seen to migrate to the bottom of the gel, indicating that a large number of relatively short peptides were present. 86 FIG. 8. Western blot of transferrin receptor imraunoprecipitation with anti-MALA-2 polyclonal immune serum. Specific immunoprecipitations were run on SDS-PAGE, blotted to nitrocellulose, and incubated with normal rat serum (lanes a-d) or immune rat serum (lanes e-h). Immunoprecipitations were carried out by YE1/21 (lanes a,e) specific for T200; YE6/6 (lanes b,f); YE1/9 (lanes eg) specific for the transferrin receptor; YE6/26 (lanes d,h) specific for Moloney MuLV envelope protein gp70. Nitrocellulose blots were stained with radioactively labelled second antibody (MaRIg), dried, and subjected to autoradiography. No specific antibody staining of MALA-2 could be detected in any of the lanes. 37 FIG. 9. Phosphorylation study of MALA-2. NS-1 (lanes la-d) and MBL-2 cells (lanes 2a-d) were incubated in phosphate-free medium supplemented with P-orthophosphate for 4 hrs at 37 C. Cells were washed and lysed, and the lysate subjected to specific immunoprecipitations. (lanes l a , 2a) YN1/1.7.4; (lanes lb, 2b) YE1/30.4.1 specific for the Thy-1 molecule; (lanes l c , 2c) YE1/48; (lanes Id, 2d) YE1/9.9.3. Immunoprecipitations were analyzed by SDS-PAGE and subjected to autoradiography. Lane Id shows phosphorylation of the transferrin receptor, but no phosphorylation of MALA-2 can be detected. 88 TRYPSIN DIGESTION OF MALA-2 FIG. 10. Trypsin digestion of MALA-2. Purified MALA-2 was I-labelled by the chloramine T method, and incubated at 37 C for 12 hrs without trypsin (lane A) or with trypsin (lane B). Arrows and numbers refer to ML protein standards. Samples were analyzed by SDS-PAGE, and the gel subjected to autoradiography. Lane B shows that tryptic digestion of MALA-2 took place. 89 3.3.2 Separation and Sequencing of Tryptic Peptides Tryptic peptides generated from purified MALA-2 were separated by using a C-18 reverse phase column in conjunction with high pressure liquid chromatography. The stationary phase of this column i s hydrophobic, while the mobile phase consisted of an acetonitrile gradient (0-60% acetonitrile in ddH20, 0.1 % TFA) progressing from hydrophilic to hydrophobic conditions. Since the mobile phase was initiated with 0% acetonitrile in ddH20, 0.1 % TFA, and was gradually increased to- 60% acetonitrile, relatively hydrophilic peptides were the f i r s t to be eluted from the column, followed by peptides of increasing hydrophobicity. Absorbance of the eluent was monitored by a spectrophtometer set to detect absorbance at 215 nm, a wavelength known to be absorbed by peptide bonds. Fractions of the eluent were collected by hand corresponding to the observed spectrophotometric peaks. Typical quantities of peptides present ranged from 75-100 pmol, from a starting quantity of approximately 800 pmol in the tryptic digestion mixture. T r i a l runs with radioactively labelled MALA-2 show that approximately 50% of the starting material i s lost in the methanol precipitation step, while further loss takes place after removal of the resuspended digestion mixture from i t s original container, during a pre-filtering step in preparation for HPLC separation, and during the actual loading of the material onto the column. Overall yield of tryptic peptides, therefore, was approximately 10% of the total starting material. 40% of each purified tryptic peptide sample was used for sequencing, resulting in a peptide quantity of 30-40 pmol being sequenced. Since i t i s 90 possible to identify up to 10 consecutive amino acids from just 1 pmol of protein, 30-40 pmol was sufficient for identification of the MALA-2 tryptic peptide sequences (each peptide was f u l l y sequenced, the largest peptide being 15 amino acids long). The separation of the tryptic peptides generated by the f i r s t digestion of MALA-2 i s represented by the spectrophotometric profile in FIG. 11. Peaks of absorbance with the least apparent contamination (by co-eluting peptides) were selected for sequencing. Of several fractions selected from this f i r s t HPLC separation, only fraction 7 yielded a sequence: QPVGGHPK. Several of the fractions selected for sequencing did not yield sequence. I t was suspected that this i n i t i a l digestion of MALA-2 did not contain a high enough quantity of starting material to generate peptides in detectable amounts, or that absence of a reduction and alkylation step resulted in presence of disulphide bonded peptides, which may have perturbed the sequencing process. Thus, a second digestion was performed after purifying another large batch of MALA-2. At this time i t became apparent that an uncalculated length of tubing carrying HPLC eluent was responsible for the problems experienced with the f i r s t separation, resulting in an asynchronous collection of the original HPLC fractions. The asynchronously collected fractions (from the f i r s t tryptic digestion of MALA-2) were pooled together, and reseparated by C-18 reverse phase column and HPLC. This resulted in the separation of peptide fragments represented by the spectrophotometric profile in FIG. 12. Four of these fractions were judged to be relatively pure, and were selected for sequencing. Fraction 14r yielded TLNASSADHK, fraction 18r yielded GOTLELH, fraction 25r yielded DELESGPNWK, and fraction 38r yielded TFDLPATIPK. 9 1 FIG. 11. Spectrophotometric profile of the separation of tryptic peptide fragments of MALA-2 by HPLC. A large quantity (80 ug) of p u r i f i e d MALA-2 was subjected to t r y p t i c digestion. The digestion products were separated by HPLC using a C18 reverse phase column. Absorbance was set at 215 nm to detect peptide bonds. A c e t o n i t r i l e gradient was effected by mixing a c e t o n i t r i l e with ddH 20/0.1% TFA, and i s represented by the l i n e tangent from the h o r i z o n t a l a x i s . Fraction 7 y i e l d e d an amino acid sequence upon microsequencing. 92 FIG. 12. Spectrophotmetric profile of the separation of re-pooled tryptic peptide fragments of MALA-2 by HPLC. (See FIG. 11 f o r o r i g i o n a l separation of fragments) Asynchronously c o l l e c t e d f r a c t i o n s of the f i r s t t r y p t i c peptide separation were repooled and subjected to a second separation by HPLC (using the CI8 reverse phase column). Absorbance was set at 215 nm to detect peptide bonds. A c e t o n i t r i l e gradient i s represented by the l i n e tangent from the h o r i z o n t a l axis. Fractions 14r, 18r, 25r, and 38r yielded amino acid sequences upon microsequencing. 93 FIG. 13. i s the spectrophotometric profile of the separation of peptides generated by the second tryptic digestion of MALA-2. Seven fractions selected for sequencing yielded amino acid sequences. Fraction 18 yielded TLPLR, fraction 20 yielded DQAEGNPSYQG, fraction 28 yielded QMPTQEST, fraction 33 yielded two distinct sequences distinguished quantitatively: 33a yielded ALVEVTEEFDR (approximately 40 pmol level), 33b yielded ETLGAQMFTQEST (approximately 10 pmol level), fraction 49 yielded LPESLEGLFPASEAR, and fraction 62 yielded LELADQILETQ. FIG. 14. i s the spectrophotometric profile of a separation of peptide fragments generated from the second MALA-2 trypsin digestion. Fractions 1-15 were pooled, and re-run on the C-18 reverse phase column using HPLC. A greater degree of discrimination was achieved by slowing the progression of the gradient. Fraction 15 yielded two sequences which were resolved quantitatively; 15a yielded GDHQANFSCR (approximately 25 pmol level), while 15b yielded LKEGLAK (approximately 15 pmol level). Fraction l l r yielded QPVGGHPK. Notable characteristics of these tryptic peptide sequences are several. Fi r s t , of the 128 amino acids of total distinct amino acid sequence obtained, 23 residues are acidic, while 7 are basic. Although these partial MALA-2 sequences are not necessarily representative of the entire molecule, they do agree with the acidic pi of MALA-2 observed within this thesis study. Secondly, three potential N-linked glycosylation sites (N-X-S, or N-X-T) are present within the tryptic peptides, being found in sequences 14r, 15a, and 20. Each of these potential glycosylation sites are the N-X-S type. This finding i s in agreement with the endoglycosidase F study 94 FIG. 13. Spectrophotometric profile of the separation of tryptic peptide fragments of MALA-2 from a second digestion experiment. A second large scale t r y p t i c d i g e s t i o n of MALA-2 was performed. Digestion products were separated by HPLC using a C18 reverse phase column. Absorbance was set at 215 nm. Acetonitrile/ddH 20, 0.1% TFA gradient i s represented by the l i n e tangent to the h o r i z o n t a l axis. Fractions 18, 29, 28, 33, 49, and 62 yielded amino acid sequences. 95 FIG. 14. Spectrophotometric profile of the HPLC separation of repooled tryptic peptide fragments of MALA-2 (2nd digestion). (See FIG. 13 for p r o f i l e of t r y p t i c digestion-2) Fractions 1-17 from the second t r y p t i c digestion were repooled and separated by HPLC using a C18 reverse phase column. Absorbance was set at 215 nm. The a c e t o n i t r i l e gradient was extended to achieve a higher r e s o l u t i o n of the e l u t i n g peptides. The gradient i s represented by the l i n e tangent to the h o r i z o n t a l a x i s . Fractions l l r and 15 yielded amino acid sequences. 96 performed in this thesis study, which shows MALA-2 to be a glycoprotein. Thirdly, peptide seguence 15a contains a cysteine residue, which i s potentially involved in disulphide bonding within the MALA-2 molecule. Additionally, since the f i r s t two amino acids of peptide 15a are GD, and since trypsin i s known to cleave after either arginine (R) or lysine (K), there i s a possibility that these f i r s t two amino acids represent the latter portion of an RGD sequence, known to be the classical binding sit e of the integrins (Hynes, 1987). Table III l i s t s the tryptic peptides of MALA-2. 3.4 HOMOLOGY COMPARISONS USING PARTIAL AMINO ACID SEQUENCES OF MALA-2 3.4.1. Comparisons of Partial Amino Acid Sequences within the NBRF Database: Limited Homologies with Immunoglobulins and Kinases Using the NBRF protein sequence library and the wordsearch comparison function, partial amino acid sequences of MALA-2 were compared with a l l reported protein sequences in the database. As the resulting individual homologies were not convincing, an additional search parameter was added. The additional parameter was a comparison as to which class(es) of proteins in the data base were consistently showing limited homology to the partial MALA-2 sequences. Table III l i s t s the peptide sequences, and shows the two classes of proteins which most consistently exhibited homology: the immunoglobulin superfamily, and tyrosine kinases. The relationship to the immunoglobulin superfamily can be seen to be the most consistent, being li s t e d as homologous to 11 of 14 partial MALA-2 sequences, while tyrosine kinases are lis t e d as homologous to 7 of 14 partial MALA-2 97 TABLE I I I TWO CLASSES OF PROTEINS MOST CONSISTENTLY EXHIBITING HOMOLOGY TO PARTIAL AMINO ACID SEQUENCES OF MALA-2 Partial Amino Homology to Immunoglobulin Homology to Kinases Acid Sequences Superfamily Members 7 , l l r / GPVGGHPK + 14r / TLNASSADHK + -15a / GDHQANFSCR + + 15b / LKEGLAK + + 18 / TLPLR + + 18r / GQTLELH - -20 / DQAEGNPSYQG + -25r / DELESGPNWK + + 28 / QMPTQEST + + 33a / ALVEVTEEFDR + -33b / ETLGAQMPTQEST - -38r / TFDLPATIPK + + 49 / LPESLEGLFPASEAR + -62 / LELADQILETQ + — - : No homologous proteins of this class are present within the 50 most related sequences i n the database. + : Homologous proteins of this class are present within the 50 most related sequences in the NBRF database. 98 sequences. Figure 15 exemplifies homologies seen between the MALA-2 peptide fragments and members of the immunoglobulin superfamily, tyrosine kinase-related proteins, and the endothelial c e l l glycoprotein I l i a , which i s known to exhibit strong homology with the fibronectin receptor, an integrin (Fitzgerald et a l . , 1987). Although the extent of direct homologies ranged from 30-71%, few NBRF proteins showed homology to more than one of the MALA-2 peptides. An interesting example of a single protein showing homology to multiple peptides of MALA-2 i s the endothelial c e l l glycoprotein I l i a , which exhibits homology to peptides 7 (38%), 20 (36%), and 49 (67%). Peptides 7 and 20 align in regions of internal repeat, thought to be important in the adhesive capacities of this protein (Ibid), and which contain an RGE sequence. 99 FIGURE 15 EXAMPLES OF HOMOLOGY DEMONSTRATED BETWEEN PARTIAL AMINO ACID SEQUENCES OF MALA-2 AND PROTEINS IN THE NBRF DATABASE MALA-2 NBRF protein peptide (bottom sequence) (top sequence) Comparison % Homology 14r TCR alpha chain V region 1 37 TLNASSADHK 1 ! 1 • 1 . 1 LLLKSSTDNK 50 15a Ig kappa chain V region 17 GDHQANFSCR ..II..IM LGDQASISCR 50 15b Ig epsilon chain C region LKEGLAK 43 400 IHEALQK 18 TCR alpha chain V region 4 8 TLPLR ! ! : GLPVM 40 28 Ig kappa chain V-I region 3 QMPTQEST ! ! : ! ! QMTQSPST 50 7 Transforming protein (ras)^ 7 QPVGGHPK ! ! ! VIVGGGGV 38 15b Kinase related transforming protein (yes) 350 LKEGLAK ! ! ! ! :'. LKEGEGK 71 25r Kinase related transforming protein (hck) 85 DELESGPNWK ! ! :: :! WLEESGEWW 30 28 Kinase related transforming protein (ros) 73 QMPTQEST • MM TLPTQEEI 50 49 Endothelial c e l l glycoprotein I l i a 1 0 50 LPESLEGLFPASEAR 1 1 1 • 1 ! 1 • ! 1 ! 1 APESIE—FPVSEAR 67 (see over) 100 FIGURE 15 (cxmfd) NOTE: A l l sequences were aligned using the FASTA program based on the aligorithm of Pearson and Lipman (1988). A word size of 1 was used to maximize accuracy. References: 1 Becker et a l . , 1985 2 Caton et a l . , 1986 3 Ishida et a l . , 1982 4 Becker et a l . , 1985 5 Shinoda, 1975 6 Reymond et a l . , 1984 7 Kitamura et a l . , 1982 8 Ziegler et a l . , 1987 9 Birchmeier et a l . , 1986 10 Fitzgerald et a l . , 1987 101 3.5 REFERENCES Becker, D.M., Patten, P., Chien, Y., Yokota, T., Eshhar, Z., Giedlin, M., Gascoigne, N.R.J., Goodnow, C, Wolf, R., Arai, K., and Davis, M.M. (1985) Variability and repetoire size of T-cell receptor V alpha gene segments. Nature. 317:430. Birchmeier, C, Birnbaum, D., Waitches, G., Fasano, 0., and Wigler, M. (1986) Characterization of an activated human ros gene. Mol. Cell. B i o l . 6:3109. Caton, A.J., Brownlee, G.G., Staudt, L.M., and Gerhard, W. (1986) Structural and functional implications of a restricted antibody response to a defined antigenic region on the influenza virus hemagglutinin. EMBO J. 5:1577. Fitzgerald, L.A., Steiner, B., Rai l , S.C., Lo, S., & Ph i l l i p s , D.R. (1987) Protein sequence of endothelial glycoprotein I l i a derived from a cDNA. J. B i o l . Chem. 262:3936. Ishida, N., Ueda, S., Hayashida, H., Miyata, T., and Honjo, T. (1982) The nucleotide sequence of the mouse immunoglobulin epsilon gene: comparison with the human epsilon gene sequence. EMBO J. 1:1117. Kitamura, N., Kitamura, A., Toyoshima, K., Hirayama, Y., and Yoshida, M. (1982) Avian sarcoma virus Y73 genome sequence and structural similarity of i t s transforming gene product to that of rous sarcoma virus. Nature. 297:205. Pearson, W.R., and Lipman, D.J. (1988) Improved tools for biological sequence comparison. Proc. Natl. Acad. Sci. U.S.A. 85:204. Reymond, CD., Gomer, R.H., Mehdy, M.C, and F i r t e l , R.A. (1984) Developmental regulation of a Dictyostelium gene encoding a protein homologous to a mammalian ras protein. Cell. 39:141. Shinoda, T. (1975) Comparative structural studies on the light chains of human immunoglobulins. I. Protein Ka with the Inv(3) allotypic marker. J. Biochem. 77:1277. Wilbur, W.J., & Lipman, D.J. (1983) Rapid s i m i l i l a r i t y searches of nucleic acid and protein databanks. Proc. Natl. Acad. Sci. U.S.A. 80:726. Ziegler, S.F., Marth, J.D., Lewis, D.B., and Perlmutter, R.M. (1987) Novel protein-tyrosine kinase gene (hck) preferentially expressed in c e l l of hematopoietic origin. Mol. Cell. B i o l . 7:2276. 102 CHAPTER POUR DISCUSSION 4.1 HOMOLOGY OF MALA-2 TO ICAM-1 4.1.1 Homology of MALA-2 partial amino acid sequences to ICAM-1 103 4.1.2 Additional similarities between MALA-2 and ICAM-1 110 4.1.3 Comparison with Data Derived from the Nucleotide Sequence of MALA-2 114 4.2 ROLE OF THE YN1/1.7.4 MONOCLONAL ANTIBODY IN IMMUNOLOGICAL RESEARCH 4.2.1 The role of MALA-2 and ICAM-1 in the immune system 115 4.2.2 YN1/1.7.4 monoclonal antibody as an investigative tool 116 4.3 SUMMARY 117 4.4 REFERENCES 118 4.5 ATTACHED PUBLICATION 103 4.1 HOMOLOGY OF MALA-2 TO ICAM-1 4.1.1 Homology of MALA-2 Partial Amino Acid Sequences to ICAM-1 The purpose of this thesis has been to characterize the murine activated lymphocyte antigen-2 (MALA-2). Since MAb specific for MALA-2 has been shown to inhibit the mixed lymphocyte reaction, i t has been suggested that MALA-2 plays a direct role in the activation of T cel l s (Takei, 1985). Research detailed within this thesis has included the investigation of a series of biochemical properties of MALA-2, culminating in the determination of i t s partial amino acid sequence. Data generated subsequent to this thesis study in our laboratory has shown the entire amino acid sequence of MALA-2 to be 512 amino acids long. Thus, having obtained a total of 128 amino acids in distinct partial amino acid sequences, f u l l y one quarter of the entire sequence of this molecule has been revealed in this thesis study. Comparison of the partial amino acid sequences of MALA-2 within the NBRF database revealed only limited homologies. No single protein could be revealed as being homologous to the majority of the partial amino acid sequences of MALA-2. The significance of homology studies was recognized as being very limited, due to limited length of the MALA-2 peptides, the absence of overlap between the MALA-2 peptides (disallowing combination of peptide sequences), and the lack of strong homology between any MALA-2 peptide and the proteins in the NBRF database. At this point, an additional search parameter was applied. This involved searching for homology between the partial amino acid sequences of MALA-2 and any single class of proteins. 104 Interestingly, this strategy revealed limited, but somewhat consistent homology to only two separate classes of proteins, each of which could be seen as being potentially appropriate when compared to the known functional properties of MALA-2. This \"class\" homology was exhibited to both the immunoglobulin superfamily, and to the tyrosine kinases, although the relationship to the immunoglobulin superfamily was more consistent. Subsequent to this thesis study, the primary sequence for the human ICAM-1 molecule was published, and was seen to be the one single protein to which the majority of partial sequences of MALA-2 were homologous. The majority of MALA-2 partial sequences shared direct amino acid homology to ICAM-1 of 35-70%. Since ICAM-1 has been shown to be a member of the immunoglobulin superfamily containing five extracellular immunoglobulin-like domains (Staunton et a l . , 1988; Simmons et a l . , 1988), indications that MALA-2 was most closely related to the immunoglobulin superfamily were confirmed. Thus, this research has shown that even short amino acid sequences (eight to fifteen amino acid length) can be useful in exposing homologous relationships i f a l l sequences are used in conjunction to find the one class of proteins which bears greatest resemblance to the group of short peptides. Studies in our laboratory subsequent to this thesis have identified cDNA clones encoding the MALA-2 molecule, and these studies further confirm the high degree of homology between MALA-2 and ICAM-1 (approximately 50% direct homology) (Horley et a l . , 1989). Data relevant to the homology between MALA-2 peptides and ICAM-1 are seen in Table IV and Figures 16 & 17. Of the 14 partial MALA-2 sequences, 11 showed over 35% identity with ICAM-1 based on direct matches, the most stringent possible parameter for comparison. 105 Of these, 5 sequences were over 50% identical, 4 were over 60% identical, and 2 were 70% identical to the ICAM-1 primary sequence (see Table IV). Sequences were seen as exhibiting even further homology considering additional biochemical similarities between amino acids at positions where direct matches were not present (see FIG. 16). Interestingly, peptide 15a can be seen to contain an N-linked glycosylation site conserved between ICAM-1 and MALA-2 (N-X-S sequence), and additionally contains a cyteine residue followed by an arginine residue, which i s also conserved between MALA-2 and ICAM-1. The positions of this cysteine and the immediately following arginine (positions 159,160 in ICAM-1) have been shown to be conserved between ICAM-1 and the T c e l l receptor alpha subunit V domain (Staunton et a l . , 1988), while the position of the cysteine residue alone i s additionally conserved in NCAM (Simmons et a l . , 1988; Staunton et a l . , 1988). Similarly, four amino acids conserved between ICAM-1 and the constant domain of the heavy chain of IgM (positions 212 [L], 214 [G], 219 [S], and 221 [A]) (Staunton et a l . , 1988), are also conserved in a spatially identical manner in MALA-2, as seen in peptide 49. Another example of conserved amino acid residues between MALA-2, ICAM-1, and other members of the immunoglobulin superfamily include the glutamine residue (position 168 in ICAM-1) conserved between ICAM-1, NCAM, and the variable region of the T c e l l receptor alpha chain (Ibid); this residue i s conserved as well in MALA-2, as seen in peptide 18r. Finally, three partial sequences of MALA-2 exhibit regions of conservation between ICAM-1, MAG, and immunoglobulin-like domain-1 of the T c e l l receptor. Over a region of 29 amino acids in ICAM-1, the 106 TABLE TV PARTIAL AMINO ACID SEQUENCES OF MALA-2 AND DEGREE OF HOMOLOGY TO ICAM-1 Tryptic Fraction # Peptide Sequence Homology to Digestion ICAM-1 1 7 QPVGGHPK + 2 (re-run) l l r QPVGGHPK + 1 (re-run) 14r TLNASSADHK ++ 2 (re-run) 15a GDHQANFSCR +++++ 2 (re-run) 15b LKEGLAK ++ 2 18 TLPLR ++++ 1 (re-run) 18r GQTLELH +++ 2 20 DQAEGNPSYQG -1 (re-run) 25r DELESGPNWK ++ 2 28 QMPTQEST -2 33a ALVEVTEEFDR -2 33b ETLGAQMPTQEST -1 (re-run) 38r TFDLPATIPK +++++ 2 49 LPESLEGLFPASEAR ++++ 2 62 LELADQILETQ + Total number of distinct amino acids sequenced = 128. Homology has been determined by the percent of direct amino acid matches: + : 35-39% ++ : 40-49% +++ : 50-59% ++++ : 60-69% +++++ : 70% 107 FIGURE 16 HOMOLOGY BETWEEN ICAM-1 AND PARTIAL AMINO ACID SEQUENCES OF MALA-2 1 (MAPSSPRPAL PALLVLLGAL FPGPGNA)QTS VSPSKVILPR GGSVLVTCST 24 SCDQPKLLGI ETPLPKKELL LPGNNRKVYE LSNVQEDSQP MCYSNCPDGQ : ! ! ! : ! (2 5 r ) DEL-ESGPNWK 74 STAKTFLTVY WTPERVELAP LPSWQPVGKN LTLRCQVEGG APRANLTVVL I i i LKEGL-AK (15b) 124 LRGEKELKRE PAVGEPAEVT TTVLVRRDHH GANFSCRTEL DLRPQGLELF ! :!!!!!! ! : ! ! ! (15a) GDH-QANFSCR (18r) GQTLELH 174 ENTSAPYQLQ TFVLPATPPQ LVSPRVLEVD TQGTVVCSLD GLFPVSEAQV !!!!!!:! ::!!:!!!!:!!! (38r ) TFDLPATIPK (49) LPESLE-GLFPASEAR 224 HLALGDQRLN PTVTYGNDSF SAKASVSVTA EDEGTQRLTC AVILGNQSQE 274 TLQTVTIYSF PAPNVILTKP EVSEGTEVTV KCEAHPRAKV TLNGVPAQPL ! ! : (7) QPV-324 GPRAQLLLKA TPEDNGRSFS CSATLEVAGO LIHKNQTREL RVLYGPRLDE ! : : ! ! ! ! : ! : ! ! : : : GGHPK TLNA-SSEDHK (33a) ALVEVTEE-FDR 374 RDCPGNWTWP ENSQQTPMCQ AWGNPLPELK CLKDGTFPLP IGESVTVTRD ! : ! ! (18) TLPLR 424 LEGTYLCRAR STQGEVTREV TVNVLSPRYE IVIITVVAAA VIMGTAGLST 474 YLYNRQRKIK KYRLQQAQKG TPMKPNTQAT PP : = s i m i l a r amino a c i d p r o p e r t i e s ! = d i r e c t amino a c i d match (Brackets enclose p u t a t i v e hydrophobic s i g n a l peptide; ICAM-1 sequence from Staunton et a l . , 1988). 108 MALA-2 partial sequence peptides 7, 14r, and 33a, aligned as shown in FIG. 16, contain 8 of 19 amino acids conserved between ICAM-1, MAG, and the TCR. These conserved residues are at the following positions in ICAM-1: 321 [Q], 322 [P], 324 [G], 333 [A], 336 [E], 337 [D], 346 [A], and 349 [E] (Ibid). The consistent homology exhibited between ICAM-1 and the partial amino acid sequences of MALA-2, even in regions of similarity between ICAM-1 and other immunoglobulin superfamily members, i s strongly suggestive that MALA-2 i s a member of the immunoglobulin superfamily, and l i k e l y the murine homolog of ICAM-1. This is supported by the fact that each of the ten partial sequences seen in FIG. 16 contains amino acid residues which are conserved between the immunoglobulin domains of ICAM-1, including one of the conserved cysteine residues which participates in the disulphide bond forming the characteristic loop of immunoglobulin domains, in domain 1 of ICAM-1 (see FIG. 17). The partial amino acid sequences of ICAM-1, seen in FIG. 17, have been aligned with the appropriate sequence corresponding to FIG. 16. Spaces inserted into the MALA-2 sequences correspond to spaces inserted in the exact corresponding sequence of ICAM-1 as seen in FIG. 15, with the exception of one space inserted in peptide 18r. The conserved cysteine residue in peptide 15a i s conserved through four of the five immunoglobulin-like domains of ICAM-1. Thus, a relationship i s seen to exist between a l l ten of the homologous peptides, and the regions of internal repeat within the ICAM-1 molecule (FIG. 17). Significantly, one of the peptide sequences (15a) also contains the last two amino acids of an RGD FIGURE 17 COMPARISON OF THE PARTIAL SEQUENCES OF MALA-2 WITH REGIONS OF CONSERVATION IN THE IMMUNOGLOBULIN-LIKE DOMAINS OF ICAM-1 MALA-2 PARTIAL AMINO ACID SEQUENCES 18 TLPLR 38r TFEJPAfTIPK | 49 7 14r LFK^.T^.F§VSEAR Q§V§GHP@ ij^JASSE^IK ^L^^TEEFDR 15a NWR -0---&NRI]WJSN]V --E& NpflvTY- GM£F3AK^1£ v OA 'QrrQLP g ] - < cfjk- [ • • TR^I QPMOJY^ |Vl—RBjDSiGANFQ-TA^EGTCfeLT 18r NCAM L Q\\@-E E3D0LT5^-@-43-PT—I-W-GR RISV-SN A-SYLTIK-KT^^-Q-QrASN-^-QDS L-0QA--@ Dl-5 refers to domains 1-5 of ICAM-1; figure adapted from Staunton et al., 1988) NOTE: S S refers to disulphide bond formation between conserved cysteine residues in each of the immunoglobulin-like domains. 110 sequence (15a starts with GD..., and trypsin i s known to cleave after R or K). The nucleotide sequence of MALA-2 determined subsequent to this thesis study has since confirmed that peptide 15a does indeed contain the last two residues of an RGD sequence, known to be essential to the binding site recognized by the integrins (Hynes, 1987). Further, the positions of two glycosylation sites are also conserved, as evidenced by the N-X-S sequences seen in peptide sequences 14r and 15a (the glycosylation site can also be N-X-T, as seen in the ICAM-1 glycosylation site corresponding to the similar site in 14r). Also l i k e l y to be significant are the amino acids which can be seen to be conserved between MALA-2 peptide sequences when aligned in this consistent fashion. A serine and a leucine residue are conserved between peptide sequences 14r and 25r, and a consecutive sequence of three amino acids (glutamic acid, glycine, leucine) i s seen to be conserved between peptides 49 and 15b. Thus, this evidence suggests that MALA-2 may be made up of repeating sequences, similar to ICAM-1. This suggestion has been confirmed by subsequent nucleotide sequence information. Collectively, this data suggests that MALA-2 i s a member of the immunoglobulin superfamily; the degree of direct homology between the partial sequences of MALA-2 and ICAM-1 further suggests that MALA-2 may be the murine homolog of ICAM-1. Biochemical evidence presented in this thesis also supports the similarity between MALA-2 and ICAM-1. 4.1.2 Additional Similarities Between MALA-2 and ICAM-1 Complimentary to the sequence homology between partial I l l sequences of MALA-2 and ICAM-1, several other findings exposed in this thesis study reflect similarities between ICAM-1 and MALA-2 (Only peptide 15a showed homology to the predicted primary sequence of ICAM-2). These similarities start with the density of expression on activated and non-activated c e l l s . Basal expression of ICAM-1 on non-activated endothelial c e l l s was seen to be 5-10 X 10 4/cell, while activated endothelial cel l s (endothelial cells stimulated with TNF) were seen to express 3.5 X 10 6/cell (Dustin & Springer, 1988). Similarly, two c e l l lines displaying a non-activated lymphocyte phenotype displayed MALA-2 at a density of approximately 4 X lO'Vcell (MBL-2, EL-4), while another lymphoid c e l l line expressing an activated phenotype (NS-1) expressed MALA-2 at approximately 2 X 10 5/cell. Thus, an increased density of both MALA-2 and ICAM-1 i s seen to occur in activated c e l l s . This increased expression of MALA-2 on activated cells has been previously documented (Takei, 1985). Intimately related to the increased expression of both ICAM-1 and MALA-2 on the surface of activated cells i s the mechanism of upregulation. ICAM-1 expression can be rapidly and dramatically induced by INF-gamma, IL-1, TNF, or lymphotoxin (Dustin et a l . , 1986; Pober et a l . , 1987; Dustin & Springer, 1988). Experiments with dermal fibroblasts and HL-60 cells suggest that upregulation of ICAM-1 occurs at the level of transcription (Dustin et a l . , 1986; Simmons et a l . , 1988). Similarly, i t was found through metabolic labelling with S-methionme that expression of MALA-2 on the surface of NS-1 cells was dependent upon new protein synthesis. This finding suggests that, in NS-1 cells (which diplay an activated phenotype), the expression of MALA-2 involves ongoing transcription. The predicted 112 amino acid sequence of MALA-2 from cDNA data show the presence of only four methionine residues in the native protein, which helps to explain the faintness of the S-methionme labelled MALA-2 band in FIG. 6. More significantly, MALA-2 and ICAM-1 share almost identical Mj.s, single peptide structure, and similar heterogeneity in migration in SDS-PAGE, resulting in a characteristic \"range\" of both molecules of between 90-115 kD Mj. (this thesis; Makgoba et a l . , 1988), the ICAM-1 molecule has been shown to be a glycoprotein with a Mj, 55 kD protein backbone (Dustin et a l . , 1986). Again, the biochemical properties of MALA-2 parallel those of ICAM-1. Endoglycosidase F digestion of MALA-2, performed in this thesis study have shown that MALA-2 is a glycoprotein, containing N-linked carbohydrate moieties. The most highly digested species of MALA-2 migrates to a position corresponding to a Mj. of approximately 66 kD. Considering that cDNA information has shown MALA-2 to be 512 amino acids long, and using 120 kD as the average Mr of typical amino acids, the calculated Mr of MALA-2 i s 61 kD. Thus, the deglycosylation study performed in this thesis was reasonably accurate in i t s assessment of the size of the MALA-2 protein backbone. Discrepancies may have arisen from either incomplete digestion of some of the carbohydrate chains, or from factors inherent in SDS-PAGE analysis of Mr. ICAM-1 and MALA-2 are glycoproteins of similar Mj., and exhibit a relatively similar degree of glycosylation. Finally, in this thesis study, MALA-2 was shown to be neither associated with the transferrin receptor, nor was i t apparently phosphorylated. There has been no mention in the literature that ICAM-1 i s phosphorylated, nor has there been any detection of i t s association with the transferrin receptor. 113 The association between LFA-1 and ICAM-1 i s the f i r s t known example a receptor-ligand relationship between a member of the integrin superfamily and the immunoglobulin superfamily. Two aspects of MALA-2 exposed in this thesis may help to shed light on this interaction. MALA-2 has been shown in this research to have an acidic isoelectric point. Thus, i t s structure, even though related to immunoglobulins, may share certain qualities similar to integrins, whose isoelectric points have been shown to be acidic (Hemler, 1988), as have those of another group of molecules involved in adhesion, the Hermes/MEL-14 group of homing receptors (common pi of 4.2) (Gallatin et a l . , 1983; Jalkanen et a l . , 1986, 1987). In addition to the highly acidic nature of MALA-2, three of the partial sequences of MALA-2 have been shown to exhibit homology to the endothelial glycoprotein I l i a . This molecule has been shown to exhibit homology to the fibronectin receptor, which belongs to the integrin superfamily. Two of the three peptides align in regions thought to be important in the adhesive properties of this molecule. Again, MALA-2 exhibits a similarity to adhesion molecules. An unusual aspect of the relationship between ICAM-1 and LFA-1 i s that ICAM-1 does not contain the classic integrin recognition seguence, RGD. Instead, i t contains a similar seguence, RGE, which has been suggested as an alternative binding site for LFA-1 (Horley et a l . , 1989). Interestingly, MALA-2 also contains an RGE sequence (Ibid), and also interestingly, endothelial glycoprotein I l i a contains an RGE sequence, in the region thought to be involved in i t s adhesive interactions (Fitzgerald et a l . , 1987). 114 4.1.3 Comparison with Data Derived from the Nucleotide Sequence . A l l of the tryptic peptides can be found within the predicted amino acid sequence, with only seven predicted residues differing from the tryptic peptides, out of the 128 amino acids obtained from the tryptic peptide sequencing (5% discrepancy). Discrepant residues include the following tryptic peptide residues as compared to predicted sequence derived from the cloned nucleotide sequence. Peptide 15a, Q instead of (/) G; peptide 49, E/C; peptide 20, D/C, G/W, Y/P, Q/K, and G/M. Twice, cysteine residues were mistaken for acidic residues. Thus, a l l of the partial sequences of MALA-2 have been confirmed as accurate, with the exception of the latter portion of peptide 20. Reciprocally, the partial sequences confirm that the cloned gene i s indeed for MALA-2. The nucleotide sequence data predicts the presence of a potential nine glycosylation sites, thereby confirming research in this thesis that multiple N-glycosylation sites exist, and that the protein backbone of MALA-2 is approximately 60 kD Mj.. Also explained i s the N-terminal blockage of MALA-2, which l i k e l y took place at the N-terminal glutamine residue, which i s capable of cyclysing (thus, the N-terminus may be correspond to position 2 of the sequence shown in Horley et a l . , 1989). Comparison of the nucleotide and predicted amino acid sequence data from MALA-2 with GenBank, and with the NBRF database did not reveal significant homology with any one single protein, but did reveal striking homology to the recently published nucleotide and amino acid sequences of ICAM-1. The amino acid homology to ICAM-1 was found to be 50%, which correlates well with the average homology of the partial amino acid sequences to 115 ICAM-1. Further experiments demonstrated that MALA-2 i s capable of binding to LFA-1. Thus, the evidence in this thesis supports the identification of MALA-2 as the murine homolog of ICAM-1. Subsequent confirmation through cloning of the gene for MALA-2, was facilitated by the partial amino acid sequences revealed in this thesis, which have served as templates in the construction of cDNA probes. The cDNA probe which fac i l i t a t e d cloning was based on the amino acid sequence of peptide 15a. 4.2 ROLE OF THE YN1/1.7.4 ANTIBODY IN IMMDNOLOGICAL RESEARCH 4.2.1 The Role of MALA-2 and ICAM-1 in the Immune System The human ICAM-1 molecule has been far more intensively studied to date than the corresponding murine homolog, MALA-2. MALA-2 was known prior to this thesis study to be involved in some manner in lymphocyte proliferation (Takei, 1985). Since MALA-2 has been shown to be a murine ligand for LFA-1, i t would seem that the a b i l i t y of the YN1/1.7.4 antibody to block lymphocyte proliferation was the result of this antibody's a b i l i t y to block lymphocyte adhesive interactions, as has been shown for ICAM-1 (Boyd et a l . , 1988; Makgoba et a l . , 1988; Dougherty et a l . , 1988; Dustin et a l . , 1988). This role in lymphocyte intercellular adhesion i s antigen-independent, and i s c r i t i c a l to the generation of an immune response, both humoral and cellular (Boyd et a l . , 1988; Dougherty et a l . , 1988). The receptor for ICAM-1 (and MALA-2) i s LFA-1, a molecule which has been studied intensively over the past five years. The central significance of LFA-1 has been 116 vividly demonstrated by the a b i l i t y of anti-LFA-1 antibodies to induce tolerance (Springer et a l . , 1987), and to promote acceptance of HLA-mismatched bone marrow grafts (Fischer et a l . , 1987). The role of ICAM-1 (and MALA-2) as a ligand of LFA-1 i s thus of great importance, although i t must be recognized that ICAM-1 i s not the only ligand for LFA-1 (Rothlein et a l . , 1986; Makgoba et a l . , 1988; Dustin et a l . , 1988). In addition to mediating antigen-independent cellular adherence in the immune system, ICAM-1 has been suggested to be the controlling factor in i t s adhesive interactions with LFA-1 since i t s expression i s much more highly regulated than LFA-1 (Boyd et al.,1989). Because the expression of ICAM-1 i s strongly influenced on a wide variety of cells by inflammatory cytokines, i t has further been suggested that ICAM-1 plays an essential and regulatory role in inflammation reactions (Ibid). Thus, as the murine homolog of ICAM-1, i t i s l i k e l y that MALA-2 functions in a similar manner, although this has yet to be shown. Further research w i l l determine the in vivo functions of MALA-2, which can then be compared to the known properties of ICAM-1, and which may contribute to our knowledge of this LFA-1 ligand in general. 4.2.2 YN1/1.7.4 Monoclonal Antibody as an Investigative Tool The monoclonal antibody YN1/1.7.4 developed in our laboratory specifically recognizes the murine activated lymphocyte antigen-2 (MALA-2). Since this molecule has been shown to be homologous to the human ICAM-1 molecule, this antibody serves as an important tool in 117 the investigation of i t s function. It has been suggested that the use of animal models and MAbs i s the only practical way to assess the physiological roles of LFA-1 and ICAM-1 in vivo (Arfros et a l . , 1987). Since the YN1/1.7.4 antibody i s the only MAb shown to recognize an animal homolog of the ICAM-1 molecule, i t s use in this manner may be invaluable in the exploration of the in vivo significance of the LFA-l/MALA-2 (ICAM-1) interaction. 4.3 SUMMARY In this thesis study, the murine lymphocyte activation antigen MALA-2 has been purified to homogeneity, biochemically characterized, and i t s partial amino acid seguence determined. MALA-2 was shown to share i t s most consistent homology with the immunoglobulin superfamily, to have an acidic isoelectric point, and to be a glycoprotein with a protein backbone of not more than 66 kD Mj.. Subsequent to this study, the partial amino acid sequences of MALA-2 have facilitated the cloning of the gene for MALA-2. The resulting cDNA information has confirmed the research detailed within this thesis, and has identified MALA-2 as the murine homolog of the human ICAM-1 molecule. The YN1/1.7.4 MAb which recognizes MALA-2 should prove to be a significant tool in investigations of the in vivo functions of MALA-2 and ICAM-1. 118 4.4 REFERENCES Arfors, K.-E., Lundberg, C, Linbom, L., Lundberg, K., Beatty, P.G., and Harlan, J.M. (1987) A monoclonal antibody to the membrane glycoprotein complex CD18 inhibits polymorphonuclear accumulation and plasma leakage in vivo. Blood. 69:338. Boyd, A.W., Dunn, S.M., Fecendo, J.V., Culvenor, J.G., Duhrsen, U., Burns, G.F., and Wawryk, W.A. (1989) Regulation of expression of a human intercellular adhesion molecule (ICAM-1) during lymphohematopoietic differentiation. Blood. 73:1896-1903. Boyd, A.W., Novotny, J.R., Wicks, I.P., Salvaris, E., Welch, K., and Wawryk, S.O. (1989) The. role of accessory molecules in lymphocyte activation. Transplantation Proceedings. 21:38-40. Boyd, A.W., Wawryk, S.O., Burns, G.F., Fecendo, J.V. (1988) Intercellular adhesion molecule 1 (ICAM-1) has a central role in c e l l - c e l l contact-mediated immune mechanisms. Immunology. 85:3095-3099. Dougherty, G.J., & Hogg, N. (1987) The role of monocyte lymphocyte function-associated antigen 1 (LFA-1) in accessory c e l l function. Eur. J. Immunol. 17:943. Dougherty, G.J., Murdoch, S., and Hogg, N. (1988) The function of human intercellular adhesion molecule-1 (ICAM-1) in the generation of an immune response. Eur. J. Immunol. 18:35-39. Dustin, M.L., Rothlein, R., Bhan, A.K., Dinarello, C.A., & Springer, T.A. (1986) Induction by IL-1 and interferon-gamma:tissue distribution, biochemistry, and function of a natural adherence molecule (ICAM-1). J. Immunol. 137:245. Dustin, M.L., Singer, K.H., Tuck, D T., & Springer, T.A. (1988) Adhesion of T lymphoblasts to epidermal keratinocytes i s regulated by interferon gamma and i s mediated by intercellular adhesion molecule 1 (ICAM-1). J. Exp. Med. 167:1323. Dustin, M.L., & Springer, T.A. (1988) Lymphocyte function-associated antigen-1 (LFA-1) interaction with intercellular adhesion molecule-1 i s one of at least three mechanisms for lymphocyte adhesion to cultured endothelial c e l l s . Journal of Cell Biology. 107:321-331. Fischer, A., Blanche, S., Veber, F., Delaage, M., Mawas, C, G r i s c e l l i , C, Le Deist, F., Lopez, M., Olive, D., & Janosy, G. (1986) of graft failure by an anti-HLFA-1 monoclonal antibody in HLA-mismatched bone marrow transplantation. The Lancet. Nov: 1058. Fitzgerald, L.A., Steiner, B., Rail Jr., S.C., Lo, S., & P h i l l i p s , D.R. (1987) Protein sequence of endothelial glycoprotein I l i a derived from a cDNA clone. Identity with platelet glycoprotein I l i a and similarity to integrin. J. Bio l . Chem. 262:3936. Hamann, A., Jablonski-Westrich, D., & Thiele, H.-G. (1986) Contact interaction between lymphocytes i s a general event following activation and i s mediated by LFA-1. Eur. J. Immunol. 16:847. Horley, K.J., Carpenito, C, Baker, B., and Takei, F. (1989) Molecular cloning of murine intercellular adhesion molecule (ICAM-1). EMBO Journal. 8:2889-2896. Makgoba, M.W., Sanders, M.E., Ginther Luce, G.A., Gugel, E.A., Dustin, M.L., Springer, T.A., and Shaw, S. (1988) Functional evidence that intercellular adhesion molecule-1 (ICAM-1) i s a ligand for LFA-1-dependent adhesion in T cell-mediated cytotoxicity. Eur.J. Immunol. 18:637-640. 119 Makgoba, M.W., Sanders, M.E., Ginther Luce, G.E., Dustin, M.L., Springer, T.A., Clark, E.A., Mannoni, P., & Shaw, S. (1988) ICAM-1 a ligand for LFA-1-dependent adhesion of B, T, and myeloid ce l l s . Nature. 331:86. Pober, J.S., Lapierre, L.A., Stolphen, A.H., Brock, T.A., Springer, T.A., Fiers, W., Bevilacqua, M.P., Mendrick, D.L., and Gimbrone Jr., M.A. (1987) Activation of cultured human endothelial ce l l s by recombinant lymphotoxin: comparison with tumor necrosis factor and interleukin 1 species. J. Immunol. 138:3319-3324 Rothlein, R., Dustin, M.L., Marlin, S.D., and Springer, T.A. (1986) A human intercellular adhesion molecule (ICAM-1) distinct from LFA-1. J. Immunol. 137:1270-1274. Simmons, D., Malegapuru, M.W., and Seed, B. (1988) ICAM, an adhesion ligand of LFA-1, i s homologous to the neural c e l l adhesion molecule NCAM. Nature. 331:624. Springer, T.A., Dustin, M.L., Kishimoto, T.K., and Marlin, S.D. (1987) The lymphocyte function-associated LFA-1, CD2, and LFA-3 molecules: Cell Adhesion receptors of the immune system. Ann. Rev. Immunol. 5:223. Takei, F. (1985) Inhibition of mixed lymphocyte reaction by a rat monoclonal antibody to a novel murine lymphocyte activation antigen (MALA-2). J. Immunol. 134:1403. The EMBO Journal vol.8 no. 10 pp.2889 - 2896, 1989 f 2-0 Molecular cloning of murine intercellular adhesion molecule (ICAM-1) Kathleen J.Horley, Carmine Carpenito, Brett Baker and Fumio Takei Departments of Microbiology, Medical Genetics and Pathology, University of British Columbia, and Terry Fox Laboratory, BC Cancer Research Centre, Communicated by A.Williams We have previously reported a murine lymphocyte surface antigen MALA-2 of - 95 000 M r which is expressed mainly on activated lymphocytes. The rat monoclonal antibody YN1/1 that detects this antigen profoundly inhibits mixed lymphocyte response. We have now purified MALA-2 and determined its partial amino acid sequence. By using non-redundant synthetic oligonucleotides as probes, based on the amino acid sequence, we have isolated two full length cDNA clones encoding MALA-2. The two clones are identical except for the 5' end sequence. Expression of MALA-2 on transfected COS cells is only achieved with one of the two cDNA clones. The nucleotide sequence as well as the deduced amino acid sequence of MALA-2 display striking homology with those of the recently reported human intercellular adhesion molecule ICAM-1. All the unique features of the human ICAM-1, including its homology with the neural adhesion molecule NCAM, its internal repeat structure and the immunoglobulin-like structure, are found in MALA-2. Furthermore, purified MALA-2 crosslinked to a solid support binds Con A blasts that express LFA-1, the putative receptor for ICAM-1, and the binding can be blocked by YN1/1 antibody or anti-murine LFA-1 antibody indicating a direct interaction of these molecules in cell adhesion. Therefore, we consider MALA-2 to be the murine homolog of human ICAM-1. Since ICAM-1 is known to be of primary importance in immune responses and inflammatory reactions, having a monoclonal antibody and a mouse model will provide the opportunity to study the functional role of ICAM-1 in vivo. Key words: adhesion molecule/lymphocyte adhesion/ immunoglobulin supergene family Introduction Specific cell —cell interactions in embryogenesis, histogenesis, immune responses and inflammatory reactions are thought to be mediated by adhesion molecules expressed on the cell surface. In the immune system adhesion molecules have been shown to be vital proteins in cell—cell interactions essential for a wide range of immune responses. In particular, the lymphocyte-function associated molecule (LFA-1) is involved in many adherence dependent cell functions including T lymphocyte mediated cytolysis and proliferation (Krensky et al., 1983), homotypic aggregation of lympho-cytes (Mentzer et al, 1985; Rothlein and Springer, 1986) and antigen non-specific natural killing (Hildreth et al., 1983). LFA-1 has a broad distribution within the hemopoietic cell types including lymphocytes, natural killer cells, monocytes, macrophages and granulocytes (Springer et al., 1987). It is a heterodimer (a0) sharing its common (3 chain with the receptor for complement component iC3b (Macl) and the pl50/95 protein (Sanchez-Madrid etal, 1983). These antigens are restricted to leukocytes and constitute a subfamily of integrins involved in cell—cell and cell—matrix interactions (Hynes, 1987). The intercellular adhesion molecule (ICAM-1) has recently been identified as the ligand for LFA-1 (Rothlein etal., 1986; Marlin and Springer, 1987; Makgoba et al., 1988a). It has been characterized in the human system as a 90—115 kd glycoprotein, most prominently expressed on activated lymphocytes and at sites of inflammation (Dustin et al., 1986; Simmons et al., 1988). It is a member of the immunoglobulin (Ig) supergene family displaying highest homology with two other cell adhesion molecules, namely neural cell adhesion molecule (NCAM) and myelin associated glycoprotein (MAG) (Simmons etal, 1988; Staunton et al., 1988). The murine homolog of ICAM-1 has not yet been reported. A specific receptor —ligand relationship exists between LFA-1 and ICAM-1 (Marlin and Springer, 1987; Makgoba et al., 1988a). This is the first example of a member of the integrin family interacting with a member of the Ig supergene family (Dustin et al., 1988). Monoclonal antibodies (MAb) to either ICAM-1 or LFA-1 inhibit several T cell dependent responses in vitro, indicating the importance of these molecules in immune responses. However, it has been postulated that ICAM-1 may belong to a family of ligands which bind LFA-1 since some LFA-1 dependent aggregation is unaffected by ICAM-1 MAb (Makgoba etal., 1988b). ICAM-2 has recently been characterized as a second ligand for LFA-1 (Staunton et al., 1989). Its distribution and size is different from ICAM-1, and may account for the ICAM-1 independent binding observed. We have previously described a murine antigen, MALA-2, primarily expressed on activated lymphocytes (Takei, 1985). The MAb YN1/1 that detected MALA-2 profoundly inhibits mixed lymphoycte response, suggesting that MALA-2 is involved in lymphocyte activation. We now report the isolation and sequencing of full length cDNA clones encoding MALA-2 and expression of one of these clones in transfected COS cells. The deduced amino acid sequence of MALA-2 shows significant homology with that of the human ICAM-1 sequence (Simmons et al., 1988; Staunton etal., 1988). Furthermore, purified MALA-2 binds to LFA-1 + cells in a MALA-2/LFA-1 dependent manner supporting the notion that MALA-2 may be the murine homolog of ICAM-1. Although the role of ICAM-1 in immune responses in vitro has been well studied, its in vivo ©IRL Press 2889 r \" i K.J.Horley et al. 1 TIME (minutes) Fig. 1. Purification of MALA-2 and separation of tryptic peptides, (a) MALA-2 was purified from NS-1 cells by the combination of YN1/1 antibody affinity chromatography and preparative SDS-PAGE. The purified protein was analyzed by SDS-PAGE and silver staining. Lane 1 shows the fraction recovered from the antibody affinity column. Lane 2 is the fraction eluted from the preparative non-reducing SDS-PAGE gel. (b) Separation of MALA-2 tryptic peptides on C18 reverse phase HPLC. The numbers on the peaks indicate the three peptides whose sequences were used to synthesize the oligonucleotides for the library screening. role is yet to be established. The monoclonal antibody as well as the cDNA clones will be invaluable tools in the elucidation of the functional significance of this adhesion molecule in vivo. Results Purification and amino acid sequence The MALA-2 protein was purified from NS-1 cells by the combination of YN1/1 antibody affinity chromatography and preparative non-reducing SDS-PAGE. The protein eluted from the gel was re-analyzed by reducing SDS-PAGE. The gel showed the isolated protein to be essentially pure (Figure la). Approximately 50 pmol of the purified protein was subjected to N-terminal sequencing. However, no detectable signal was obtained, suggesting that the purified protein was N-terminal blocked. Therefore, —200 pmol of the purified protein was reduced, alkylated and digested with trypsin. The resulting tryptic peptides were separated by C18 reverse phase HPLC (Figure lb) and sequenced. From two purification and sequencing experiments, a total of 14 peptides were sequenced, four of which were sequenced twice (Table I). Isolation and analysis of MALA-2 cDNA Three tryptic peptide sequences confirmed by repeated purification and amino acid sequencing experiments were used to synthesize oligonucleotides. Due to high redundancies, two non-redundant oligonucleotides were constructed based on the preferred codon usage table (Lathe, 1985). The third oligonucleotide had a redundancy of 64. A XgtlO cDNA library constructed from NS-1 mRNA was initially screened with the short non-redundant probe at low stringency (1 xSSC, 30°C) allowing 25% mismatch. From 105 plaques, 45 positive phage clones were isolated and screened with the other two probes. One phage clone, Kl-8, hybridized with all three probes. The 2.0 kbp cDNA insert was subcloned into pTZ19R plasm id vector and sequenced. Tabic I. MALA-2 tryptic peptides Fraction Peptide sequence Confirmed 1 QPVGGHPK + 2\" SDHQANFSCR -3 TLPLR -4 DQAEGNPSYQG -5b QMPTQEST + 6 ALVEVTEEFDR -T LFESLEGLFPASEAR + 8 LELADQILETQ + 9 TFDLPATIPK -10 DELESGPNWK -11 GQTLELH -12 TLNASSEDHK -13 A Q E E A K 14 FLFK — \"Peptide sequences used for construction of nonredundant probes. bPeptide sequence used to construct redundant probe (17mer mixture). 'Peptide sequences duplicated from independent tryptic digestions. The sequence had a long open reading frame (ORF) and polyadenylation signal but lacked an initiation codon (Figure 2a). Northern blot analysis of NS-1 RNA detected a transcript of >2.4 kbp. Therefore, the Kl-8 cDNA insert was considered incomplete and the library was rescreened, initially using Kl-8 cDNA insert deleted of the poly A tail (PvuW digestion) and subsequently the 5' fflndlll fragment of Kl-8 as probes. The screening identified 41 additional phage clones (16 positive with the 5' Hindltt fragment), all with inserts of 2.2 — 3.0 kbp. Two phage clones, K3-1.1 and K4-1.1 were selected for their long cDNA insert (3.0 and 2.5 kbp, respectively). They were subcloned into plasmids and sequenced. K3-1.1 clone is 3031 bp long and has a long ORF of 1593 nucleotides, a 5' untranslated sequence of 552 nucleotides and a 3' untranslated region of 851 nucleotides (Figure 2a). The 3' untranslated region contains a poly-adenylation signal and a poly A tail. The K4-1.1 clone is 2525 bp long with only 29 bp 5' untranslated sequence and 2 8 9 0 Murine ICAM-1 cloning K l - 8 | , 1 , r - ^ 2.0kb A P H P P A K3-1.1 I ' . 1 1 1 1—H 3.0kb X P H P P A K4-1.1 | ! ! 1 — ! !—U| 2.5kb 5' |— noncoding—j coding 1 — noncoding 13' b K4-1.1 CGCTACCTGCACTTTGCCCTG>iBaaaaaaaa«»BliaaaaaaBaaaaaaaaaaaaaaa*laaa^ AACCGCCAGAGAAAGATCAGGATATACAAGTTACAGAAGGCTCAGGAGGAG V fa V F l u o r e s c e n c e Fig. 7. COS cells were transfected with K3-1.1 cDNA in pAX82 (A), K4-1.1 cDNA in pAX82 (B) pAX82 alone (C) or mock transfected (D). MALA-2 expression on cell surface was analyzed with YN1/1 antibody and goat anti-rat immunoglobulin-FITC by flow cytometry using a FACStar Plus. As controls, cells were incubated with the second antibody alone. Data are plotted with fluorescence intensity versus cell number. Southern and Northern blot analysis In genomic southern blot analysis, C57BL/6 and BALB/c murine DNA digested with BamHl or EcoRl resulted in the detection of a single band (Figure 5a). The Dral digestion displayed two bands, but due to the presence of a Dral site within the cDNA insert this result was expected. Therefore, MALA-2 appears to be a single copy gene. Analysis of the transcripts in normal lymphatic tissues revealed that the expression of MALA-2 in the bone marrow and thymus is very low, while the spleen exhibits readily detectable levels and activated lymphocytes have higher levels. NS-1 cells express the highest level of the transcripts. This is consistent with our previous study demonstrating the expression of MALA-2 protein primarily on activated lymphocytes and lymphoid cell lines (Takei, 1985). Primary transcripts of 2.5 kb were detected by K4-1.1 cDNA; however, another transcript of —3.1 kb was also observed. This 3.1 kb transcript, but not the 2.5 kb transcript, hybridized with the AsplOOl fragment of K3-1.1, consisting of the 5' end 548 bp. Therefore, the K3-1.1 cDNA clone probably represents the 3.1 kb mRNA. Binding assay To determine if MALA-2, like human ICAM-1, could act as a ligand for LFA-1, purified MALA-2 was crosslinked to microwells and the binding of LFA-1 + cells to the immobilized MALA-2 was tested. Con A stimulated spleen cells used as LFA-1 + cells bound to the MALA-2 coupled wells but not to BSA coupled control wells (Figure 6). The 2893 K.J.Horley et al. binding of Con A blasts to MALA-2 was inhibited by YN1/1 antibody, anti-LFA-1 antibody or both together. Two control antibodies with the same isotype (IgG 2b), YE3/19 (Takei, 1984) and YE6/6 (Takei, 1987) reactive with unrelated antigens expressed on Con A stimulated spleen cells, did not significantly inhibit the binding. These results demonstrate that MALA-2 has a similar function as human ICAM-1 and does act as a ligand for murine LFA-1. MALA-2 expression in COS1 cells COS1 cells were transfected with the transient expression vector pAX82 (R.Kay, manuscript in preparation) construct containing either the K3-1.1 or K4-1.1 clone (Figure 7). Of the cells transfected with the K4-1.1 clone, 23% expressed MALA-2 on their surface whereas cells transfected with the K3-1.1 clone were negative for MALA-2 expression. Thus the K3-1.1 clone does not seem to be efficiently processed for cell surface expression. COS cells transfected with the K3-1.1 clone lacking the 5' untranslated region stain negative for surface expression of MALA-2 (data not shown). Mock transfected cells and cells transfected with pAX82 alone were also MALA-2 negative. Discussion MALA-2 is a 95 kd monomer antigen expressed on murine activated lymphocytes and lymphoid cell lines (Takei, 1985). The MAb YN1/1 that detects this antigen inhibits mixed lymphocyte reaction suggesting that it is involved in the activation of T cells. In this study, we have determined partial amino acid sequences of MALA-2, isolated and characterized cDNA clones encoding MALA-2, and expressed MALA-2 in COS cells by transfection. The amino acid sequence deduced from the cDNA clones contains all the tryptic peptide sequences generated from the purified MALA-2 indicating that the isolated cDNA clones indeed code for MALA-2. The nucleotide as well as the deduced amino acid sequence have striking similarities with those of human ICAM-1. The similarity between MALA-2 and ICAM-1 is particularly evident in the overall structures of these two proteins. Both consist of five similar segments, each having a size of —100 amino acid residues and also exhibiting homology with members of the Ig supergene family. The amino acid sequence flanking the first cysteine residue in each repeated segment is particularly well conserved among some members of the Ig supergene family, including murine CD4 (Tourvieille etal, 1986). CD8 (Nakauchi etal, 1985) , T cell receptor Va (Saito etal, 1984) and V/3 (Morinaga et al., 1985), and Ig Vx (Kelley et al., 1982). The MALA-2 structure is also similar to two other cell adhesion molecules, MAG and NCAM. They all consist of multiple repeats, each having homology with other segments. MALA-2 also demonstrates functional similarity with ICAM-1. ICAM-1 has been shown to bind another cell surface molecule, LFA-1 (Marlin and Springer, 1987). In this study, we have also demonstrated that purified MALA-2 immobilized on microtiter plates binds Con A stimulated spleen cells and binding is specifically inhibited by antibody to MALA-2 or murine LFA-1. Thus, both structurally and functionally, MALA-2 is similar to human ICAM-1. The size and distribution of the two proteins is virtually identical (Takei, 1985; Prieto et al., 1989). Although ICAM-2 has recently been identified as another ligand for LFA-1, it is only slightly homologous (21%) to MALA-2, and has a different size and tissue expression from MALA-2. The summation of this evidence strongly supports MALA-2 as the murine homolog of human ICAM-1. We have isolated two full length cDNA clones encoding MALA-2. One (K4-1.1) codes for a typical type I trans-membrane protein whereas the other (K3-1.1) encodes a protein that has an atypical N-terminal sequence for a type 1 transmembrane protein. Its N-terminal sequence lacks obvious hydrophobicity of a leader sequence. The K3-1.1 clone probably represents the mRNA of —3.1 kb detected by Northern blot analysis using K4-1.1 as a probe. The 3.1 kb mRNA is also detected using the 5' AsplOOl fragment of K3-1.1 as a probe, thus proving this 5' region is not a cloning artifact. It is likely that the two transcripts are generated by differential splicing of the same gene. Expression of MALA-2 in COS cells is only detected in those transfected with K4-1.1 clone (Figure.7). Thus, it seems the K3-1.1 clone is not processed to a detectable level of expression in COS cells. Whether it is translated and the protein product is expressed in some cells is currently under investigation. The expression of MALA-2 mRNA in different lymphocyte populations closely parallels our previous studies on cell surface expression of MALA-2 by flow cytometric analysis. Although MALA-2 mRNA and its protein product are primarily expressed in activated T and B cells, they are also detected in spleen cells. The majority of spleen cells are MALA-2\" but a significant portion of them are MALA-2 + (Takei, 1985). It is not known at this time whether the MALA-2 + spleen cells represent functionally distinct lymphocytes such as previously activated memory cells as opposed to virgin lymphocytes. It is also unknown whether enhanced expression of MALA-2 on activated lymphocytes is functionally significant. LFA-1 is constitutively expressed on lymphocytes at a high level, while ICAM-1 expression on resting cells is quite low. However, ICAM-1 is readily detected on activated accessory cells (Dougherty et al., 1988). Therefore, in the course of T cell activation, accessory cells are thought to express ICAM-1 first which interacts with LFA-1 on T cells, thus stabilizing the interaction of T cell—accessory cell contact. Once T cells are activated, this cell—cell contact does not seem to be required for the further proliferation and differentiation of T cells. Nevertheless, activated T cells express high levels of ICAM-1. Whether ICAM-1 is required for T cell — T cell or T cell—B cell interactions are important questions yet to be solved. Our previous studies have shown that YN1/1 antibody almost completely inhibits mixed lymphocyte reaction. However, the antibody only partially inhibits Con A stimulation of spleen cells (up to 35%) and it does not inhibit LPS stimulation of spleen cells (Takei, 1985). In light of the present finding that MALA-2 is a cell adhesion molecule and functions as a ligand for LFA-1, the differences in the degree of sensitivities to YN1/1 antibody in different stimulation pathways may be due to differences in the requirement of cell—cell contact. The activation of T cells by specific antigens is known to require accessory cells that present antigens to T cells, and that process requires direct contact between T cells and macrophages. Although stimulation of T cells by mitogens also requires the presence of accessory cells (Williams etal., 1984), direct T 2894 Murine ICAM-1 cloning cell—accessory cell contact may not be crucial. Further studies are needed to clarify the precise role of accessory cells and adhesion molecule mediated cell—cell contact in different activation pathways. LFA-1 is a member of the integrin family of proteins and most integrin ligands have a core sequence Arg—Gly—Asp (RGD) which act as a binding domain for their receptors (Hynes, 1987; Ruoslahti and Pierschbacher, 1986). Human ICAM-1 lacks an RGD sequence but has an RGE sequence located within the second domain (Staunton et al., 1988). MALA-2 contains an RGE as well as an RGD sequence. The conservation of the RGE between human ICAM-1 and our postulated murine ICAM-1 suggests that it may be important in the folding of the protein or as a binding site for LFA-1. Further studies deleting or modifying these sequences by site directed mutagenesis will give indication of their importance in maintaining the proper protein configuration and acting as binding sites for LFA-1. The importance of the interaction between ICAM-1 and LFA-1 in immune responses in vitro has been well established by the profound inhibitory effects of MAb to these antigens. However, its functional significance in immune responses in vivo is yet to be established. The cDNA and the monoclonal antibody to murine ICAM-1 will be invaluable in the studies of the functional roles of the molecular interaction between ICAM-1 and LFA-1 in immune responses in vivo. Materials and methods Cells and antibodies NS-1 cells (BALB/c myeloma) were maintained in tissue culture in Dulbecco's modified minimum essential media (DMEM) containing 5% fetal calf serum (FCS) and antibiotics. Spleen cells were stimulated with either Con A or Lipopolysaccharide (LPS) as described (Takei, 1985). The rat MAb YN1/1 that recognizes the murine lymphocyte antigen MALA-2, was purified from ascites fluid by (NH 4) 2S0 4 precipitation (50% satura-tion) followed by DEAE affi-gel blue (BioRad, Richmond, CA) chromatography. The rat hybridoma line FD441.8 (TIB 213) producing anti-mouse LFA-1 antibody was obtained from the American Type Culture Collection (Rockville, MD). Purification of MALA-2 and amino acid sequencing The plasma membrane fraction of NS-1 cells was solubilized in 1% Triton X-100. 10 mM Tris-HCl, 0.5 M NaCl, 0.01 % NaN 3, and MALA-2 was purified by affinity chromatography with YN1/1 coupled to Affi-gel 10 (Bio-Rad). In brief, the membrane lysate combined with a cell lysate of 107 iodinatcd cells was incubated with YN1/1 Mab-coupled agarose beads on ice for 4 h with constant agitation. Beads were washed thoroughly overnight with 10 mM Tris-HCl buffer (pH 7.5) containing 1 % Triton X-100, 0.5 M NaCl, 0.01 % NaN3 until no radioactivity was detected in the flow through. The column was briefly washed with the same buffer containing 0.1 % Triton X-100, and MALA-2 was eluted with 0.05 M glycine-HCl (pH 2.9) buffer containing 0.05% Triton X-100, 0.15 M NaCl and 0.01% NaN3. Radio-active fractions were pooled, neutralized, concentrated and loaded on non-reducing preparative SDS-PAGE gels. The major band of 95 kd relative molecular mass (Mr) was electroeluted as described (Chan and Takei, 1988). The purity of the eluted protein was assessed by SDS-PAGE followed by silver staining of the gels. The purified MALA-2 was reduced, alkylated and digested with TPCK treated trypsin, and the resultant peptides were separated on C18 reversed-phase HPLC as described (Chan and Takei, 1988a). The peptides were sequenced by a gas phase sequencer at the Tripartite Microsequencing Center (University of Victoria, BC). Cloning and sequencing of MALA-2 cDNA A cDNA library was constructed according to the method of Gubler and Hoffman (1983) using poly A + RNA from NS-1 cells. Based on tryptic peptide sequences (Table I), three oligonucleotides (antisense) were synthesized in Dr Mike Smith's laboratory (Department of Biochemistry, University of British Columbia). Two non-redundant oligonucleotides (probe I: 5 ' G C G G C A G G A G A A G T T G G C C T G G T G G T C 3 ' ; probe 2: 5'GCGGGCCTCAGAGGCAGGGAACAGGCCCTCCAGGGACTCG-AA3') were based on preferred codon usage table (Lathe, 1985), while the third probe (I7mer mix) (5TCYTGNGTNGGCATYTG3') (Y represents T or C; N represents A, T, G or C) had a redundancy of 64. All of the probes were 5' end-labelled and used to screen the XgtlO library. Positive phages were purified and the cDNA inserts were subcloned into plasmid vectors pTZ19R, pTZ18R or pUC19 (United States Biochemical Corporation, Cleveland, OH). The cDNA inserts were sequenced by the dideoxynucleotide chain termination method (Sanger et al., 1977). Initially, the ends of the cDNA inserts were sequenced and then sequential deletion clones were generated using exonuclease III and both strands were fully sequenced. Southern and Northern blot analyses Genomic DNA was isolated from normal spleen and NS-1 cells. Approximately 10 /ig of DNA was digested with various restriction enzymes, run on 0.8% agarose gel, alkaline blotted onto nylon membranes (BIO-RAD) and probed with random primer labelled cDNA insert as described (Chan and Takei, 1989). the stringency wash was at 0.1 x SSC, 65°C. Total RNA was isolated from various lymphocytes by the acid—phenol extraction method (Chomczynski and Sacchi, 1987). Approximately 10 /tg of RNA was run on a 1.0% agarose gel containing formaldehyde, blotted onto nylon membranes (BIO-RAD). and probed with the MALA-2 cDNA insert or the appropriate fragment. The stringency wash was at 0.1 x SSC, 65°C. Binding assay MALA-2 was purified from the membrane fraction of NS-1 cells by three cycles of antibody affinity chromatography. The first cycle was identical to that described for MALA-2 purification in the previous section. The bound fraction was eluted from the YN1/1 column, applied to the second column of an unrelated antibody (YE1/48) (Chan and Takei, 1988) and the unbound fraction was collected. This unbound fraction was applied to the YN1/1 column again and the MALA-2 fraction was eluted. Purified protein was coupled to microwell plates as described by Magkoba et al. (1988a) with modifications. Wells of micro plates (Falcon 3072, Becton-Dickinson, Oxnard, CA) were treated with 100 /il of 0.2% glutaraldehyde in 0.1 M sodium carbonate—HO (pH 9.0) for 1 h at room temperature. The wells were then washed twice and 50 /d of poly-L-lysine (50 jig/ml) was added. The plates were incubated for 2 h at room temperature and washed. To each well, 50 /d of 0.2% glutaraldehyde in 0.05 M sodium carbonate buffer (pH 9.0) was added and the plates were incubated for 1 h at room temperature. The wells were washed three times and 25 /tl (0.25 /ig) of purified MALA-2 in 0.1 M sodium carbonate buffer (pH 9.0) was added to each well. Control wells received 1 % bovine serum albumin (BSA). After a 1 h incubation at room temperature, the wells were washed and the residual free glutaraldehyde groups were reacted with 1 % BSA. Target cells (Con A blasts) were labelled by 5 l C r , resuspended in RPMI-1640 medium containing 5% FCS and dispensed into the microwells (105 cells/well). Blocking antibodies were added immediately before the addition of the 5lCr-labelled cells. The plates were centrifuged at 300 g for 1 min and then incubated for 20 min at 37°C. After the incubation, the wells were filled with the medium and the plates were inverted for 5 min at room temperature to allow the detachment of unbound cells from the wells. The plates were then flicked to remove the unbound cells. The bound cells were lysed with 100 /d of 2% Triton X-100 and counted on a 7-counter. COS1 cell transfection and FACS analysis COS1 cell expression vector pAX82 (R.Kay, manuscript in preparation) was used. It is similar to the previously described CDM8 (Seed and Aruffo, 1987). Escherichia coli strain MC1061/p3 (Yamasaki et al., 1988) was used for transformation. COS1 cells were transfected with plasmid DNA by DEAE-dextran (Hammarskjold et al, 1986), incubated for 70 h in the presence of DMEM with 5% FCS and harvested with phosphate buffered saline (PBS) containing 2.5 mM EDTA. The cells were then stained with YN1/1 hybridoma supernatant and goat anti-rat Ig-FTTC as a second antibody (Cooper Biomedical, Malvern, PA). Analysis of the COS1 cells was carried out on FACStar Plus (Becton-Dickinson). Acknowledgements This study was supported by a grant from the Medical Research Council of Canada with core support from the Cancer Control Agency of British Columbia and British Columbia Cancer Foundation. K.J.H. and C C . are recipients of studentships from the National Science and Engineering 2895 K.J.Horley et al. Research Council (Canada) and the Medical Research Council (Canada), respectively. We thank Dr R.Kay for providing the pAX82 vector as well as his technical advice, Wieslawa Dragowska for FACStar analysis, and Lesley Reynolds for secretarial assistance over this manuscript. R e f e r e n c e s Chan.P.-Y. and Takei.F. (1988) 7. Immunol., 140, 161-169. Chan,P.-Y. and Takei,F. (1989) 7. Immunol., 142, 1727-1736 Chomczynski,P. and Sacchi.N. (1987) Anal. Biochem., 162, 156-159. Dougherty,G.J., Murdoch.S. and Hogg.N. (1988) Eur. 7. Immunol., 18, 35-39. Dustin,M.L., Rothlein,R., Bhan,A.K., Dinarello.C.A. and Springer,T.A. (1986) 7. Immunol., 137, 245-254. Dustin,M.L., Staunton.D.E. and Springer.T.A. (1988) Immunol. Today, 9, 213-215. Gubler,U. and Hoffman,B.J. (1983) Gene, 25, 263 - 269. Hammarskjold,M.-L., Wang,S.-C. and Klein,G. (1986) Gene, 43, 41 -50. HUdrethJ.E.K., Gotch.F.M., Hildreth,P.D.K. and McMichael,A.J. (1983) Eur. J. Immunol, 13, 202 —205. Hynes.R.O. (1987) Cell, 48, 549-554. Kelley,D.E., Coleclough,C. and Perry,R.P. (1982) Cell, 29, 681-689. Kozak,M. (1986) Cell, 44, 283 -292. Krensky,A.M., Sanchez-Madrid.F., Robbins,E., NagyJ.A., Springer,T.A. and Burakoff.S.J. (1983) 7. Immunol, 131, 611-616. Lathe.R. (1985)7. Mol. Biol, 183, 1-12. Marlin.S.D. and Springer,T.A. (1987) Cell, 51, 813-819. Makgoba,M.W., Sanders,M.E., Ginther Luce.G.E., Dustin,M.L., Springer,!.A., Clark.E.A., Mannoni,P. and Shaw.S. (1988a) Nature, 331, 86-88. Makgoba,M.W., Sanders,M.E., Ginther Luce.G.E., Gubel,E.A., Dustin,M.L., Springer,T.A. andShaw.S. (1988b)Eur. J. Immunol, 18, 637 - 640. Mentzer,S.J., Gromkowski,S.H., Krensky,A.M., Burakoff,S.J. and Martz,E. (1985)7. Immunol, 135, 9-11. Morinaga.T., Fotedar,A., Singh,B., WegmannJ.G. and TamaokiJ. (1985) Proc. Natl. Acad. Sci. USA, 82, 8163-8167. Nakauchi.H., Nolan,G.P., Hsu,C, Huang,H.S., Kavathas,P. and Herzenberg.L.A. (1985) Proc. Natl. Acad. Sci. USA, 82, 5126-5130. Prieto,J., Takei,F., Gendelman,R., Christenson,B., Biberfeld,P. and Patarroyo.M. (1989) Eur. 7. Immunol, 19, in press. Rothlein.R. and Springer.T.A. (1986) 7. Exp. Med., 163, 1132-1149. Rothlein.R., Dustin,M.L., Marlin,S.D. and Springer,!.A. (1986) 7. Immunol, 137, 1270-1274. Ruoslahti.E. and Pierschbacher.M.D. (1986) Cell, 44, 517-518. Saito.H., Kranz,D.M., Takagaki.Y., Hayday,A.C, Eisen.H.N. and Tonegawa.S. (1984) Nature, 312, 36-40. Sanchez-Madrid,F., Nagy.J.A., Robbins,E., Simon,P. and Springer,T.A. (1983) 7. Exp. Med., 158, 1785-1803. Sanger,F., Nicklen,S. and Coulson.A.R. (1977) Proc. Natl. Acad. Sci. USA, 74, 5463 - 5467. Seed.B. and Aruffo.A. (1987) Proc. Natl. Acad. Sci. USA, 84, 3365-3369. Simmons.D., Makgoba.M.W. and Seed.B. (1988) Nature, 331, 624 -627. Springer,T.A., Dustin,M.L., Kishimoto.T.K. and Marlin.S.D. (1987) Annu. Rev. Immunol., 5, 223-252. Staunton,D.E., Marlin.S.D., Stratowa.C, Dustin.M.L. and Springer.T.A. (1988) Cell, 52, 925-933. Staunton,D.E., Dustin.M.L., Springer.T.A. (1989) Nature, 339, 61-64. Takei.F. (1984)7 Immunol, 133, 345-350. Takei,F. (1985) 7. Immunol, 134, 1403-1407. Takei,F. (1987) 7. Immunol, 139, 649 - 654. Tourvieille,B., Gorman,S.D., Field.E.H., Hunkapiller,T. and Parnes,J.R. (1986) Science, 234, 610-614. Williams,J.M., Ransil.B.J., Shapiro,H.M. and Strom.T.B. (1984) 7. Immunol, 133, 2986-2995. Yamasaki,K., Taga,T., Yuuichi,H., Yawata.H., Kawanishi,Y., Seed,B., Taniguchi.T., Hirano.T. and Kishimoto,T. (1988) Science, 241, 825-828. Received on March 9, 1989; revised on June 7, 1989 2896 "@en ; edm:hasType "Thesis/Dissertation"@en ; edm:isShownAt "10.14288/1.0098086"@en ; dcterms:language "eng"@en ; ns0:degreeDiscipline "Pathology"@en ; edm:provider "Vancouver : University of British Columbia Library"@en ; dcterms:publisher "University of British Columbia"@en ; dcterms:rights "For non-commercial purposes only, such as research, private study and education. Additional conditions apply, see Terms of Use https://open.library.ubc.ca/terms_of_use."@en ; ns0:scholarLevel "Graduate"@en ; dcterms:title "Analysis of a murine lymphocyte proliferation-associated antigen (MALA-2) : the murine homolog of the human ICAM-1 molecule"@en ; dcterms:type "Text"@en ; ns0:identifierURI "http://hdl.handle.net/2429/28888"@en .