@prefix vivo: . @prefix edm: . @prefix ns0: . @prefix dcterms: . @prefix dc: . @prefix skos: . vivo:departmentOrSchool "Medicine, Faculty of"@en, "Obstetrics and Gynaecology, Department of"@en ; edm:dataProvider "DSpace"@en ; ns0:degreeCampus "UBCV"@en ; dcterms:creator "Väänänen, Céline Claire Magali"@en ; dcterms:issued "2009-03-27T22:32:59Z"@en, "1997"@en ; vivo:relatedDegree "Doctor of Philosophy - PhD"@en ; ns0:degreeGrantor "University of British Columbia"@en ; dcterms:description """The studies undertaken herewithin sought to characterize the pattern of regulation of the gonadotrophin-releasing hormone receptor (GnRH-R) mRNA levels in the rat ovary. The demonstration of gonadotrophin-releasing hormone (GnRH) transcripts in steroidproducing and steroid-dependent tissues suggests that GnRH may be implicated in the modulation of steroid action in those target tissues. Expression of GnRH-R mRNA increases in gonadal tissues and the pituitary with age, supporting the concept of GnRH as a local regulator in the developing rat as well as in the adult. During the peri-ovulatory period, stimulation of the ovarian luteinizing hormone receptor (LH-R) by an ovulatory dose of human chorionic gonadotrophin (hCG) is capable of inducing a transient and pronounced decrease in GnRH-R mRNA levels, thus bringing more evidence to the role of GnRH in the regulation of ovarian function during ovulation. The gene encoding GnRH-R was found to be expressed in granulosa cells. In a follicle stimulating hormone (FSH) pre-treated granulosa cell model, GnRH-R gene transcript levels were negatively influenced by LH, but not FSH, in a time- and concentration-dependent manner. Autostimulation of GnRH-R by GnRH was also seen. In a second granulosa cell model obtained from pregnant mare serum gonadotrophin (PMSG) synchronized immature rats, the levels of GnRH-R transcripts were found to be positively regulated by hCG and GnRH, while prostaglandin F2a (PGF20;) inhibited GnRH-R mRNA levels in a bell curve-like fashion. However, combinations of these treatments canceled each other's effects. In this model, GnRH stimulated progesterone (P4) production and only slightly inhibited hCG-stimulated progesterone production. This modulation in the responses to GnRH and in the levels of GnRH-R mRNA suggest that GnRH may have different actions at different times of follicular development. In conclusion, the findings of the present study demonstrate wide spread expression of the GnRH-R gene in steroidogenic or steroid-dependent tissues. Gonadotrophin-releasing hormone receptor mRNA levels were shown to be regulated by gonadotrophins, PGF2a and GnRH in the whole ovary and in granulosa cells, strongly supporting the postulated role of GnRH-R in the local modulations of ovarian function mediated by GnRH."""@en ; edm:aggregatedCHO "https://circle.library.ubc.ca/rest/handle/2429/6615?expand=metadata"@en ; dcterms:extent "15192899 bytes"@en ; dc:format "application/pdf"@en ; skos:note "Regulation of Rat Ovarian Gonadotropin Releasing Hormone Receptor mRNA Levels by Celine Claire Magali Vaananen Maitrise de Biologie Cellulaire, Universite Jussieu-PARIS VII, Paris, France, 1991 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Department of Obstetrics and Gynaecology, Reproductive and Developmental Sciences Program) We accept this thesis as conforming to the required standard THE UNIVERSITY OF BRITISH COLUMBIA March 1997 © Celine Claire Magali Vaananen, 1997 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department of {j&STcTrglCZ + CH*3Pr£C&CC>-( The University of British Columbia Vancouver, Canada Date fWHiC lP\\f DE-6 (2/88) ABSTRACT The studies undertaken herewithin sought to characterize the pattern of regulation of the gonadotrophin-releasing hormone receptor (GnRH-R) mRNA levels in the rat ovary. The demonstration of gonadotrophin-releasing hormone (GnRH) transcripts in steroid-producing and steroid-dependent tissues suggests that GnRH may be implicated in the modulation of steroid action in those target tissues. Expression of GnRH-R mRNA increases in gonadal tissues and the pituitary with age, supporting the concept of GnRH as a local regulator in the developing rat as well as in the adult. During the peri-ovulatory period, stimulation of the ovarian luteinizing hormone receptor (LH-R) by an ovulatory dose of human chorionic gonadotrophin (hCG) is capable of inducing a transient and pronounced decrease in GnRH-R mRNA levels, thus bringing more evidence to the role of GnRH in the regulation of ovarian function during ovulation. The gene encoding GnRH-R was found to be expressed in granulosa cells. In a follicle stimulating hormone (FSH) pre-treated granulosa cell model, GnRH-R gene transcript levels were negatively influenced by L H , but not FSH, in a time- and concentration-dependent manner. Auto-stimulation of GnRH-R by GnRH was also seen. In a second granulosa cell model obtained from pregnant mare serum gonadotrophin (PMSG) synchronized immature rats, the levels of GnRH-R transcripts were found to be positively regulated by hCG and GnRH, while prostaglandin F 2 a (PGF20;) inhibited GnRH-R mRNA levels in a bell curve-like fashion. However, combinations of these treatments canceled each other's effects. In this model, GnRH stimulated progesterone (P4) production and only slightly inhibited hCG-stimulated progesterone production. This modulation in the responses to GnRH and in the levels of GnRH-R mRNA suggest that GnRH may have different actions at different times of follicular development. In conclusion, the findings of the present study demonstrate wide spread expression of the GnRH-R gene in steroidogenic or steroid-dependent tissues. Gonadotrophin-releasing hormone receptor mRNA levels were shown to be regulated by gonadotrophins, PGF2 a and GnRH in the whole ovary and in granulosa cells, strongly supporting the postulated role of GnRH-R in the local modulations of ovarian function mediated by GnRH. TABLE CONTENTS page ABSTRACT ii LIST OF TABLE xi LIST OF FIGURES xii LIST OF ABBREVIATIONS xvi ACKNOWLEDGMENTS xxi BACKGROUND 1 I. The hypothalami)-pituitary-gonadal axis 1 A. Hypothalamic GnRH 1 B. Pituitary L H and FSH 3 C. Ovarian function 3 C . l . The follicular phase 4 C. 1. a. The dominant follicle 4 C.l.b. Morphology of the pre-ovulatory follicle 4 C.2. The process of ovulation 7 C 3 . Luteinization 7 II The uterine cycle 8 A. Uterus, and other targets of ovarian steroids 8 B. Endometrial changes 8 B. 1. The proliferative phase 8 B.2. The secretory phase 9 B.3. Menstruation 9 III. Gonadal control of the gonadal functions 9 A. Paracrine/autocrine factors 9 B. GnRH as an ovarian modulator 10 IV. The hormones of the endocrine reproductive syst A. The gonadotrophins A.l. L H and FSH A .2. hCG A. 3. PMSG B. GnRH and its receptor B. l . GnRH B. 2. GnRH-receptor C. Prostaglandin F2a a\"d its receptor C. l. Prostaglandin F2 a C.2. PGF2a-receptor D. Steroid hormones V. The rat model A. General characteristics A.l. Origin and development A. 2. Characteristics B. Biology of reproduction B. l. Maturation and sexing B.2. Estrous cycle B.3. Pregnancy B.4. Persistent estrus HYPOTHESIS SPECIFIC OBJECTIVES RATIONALE Tissue localization and ontogeny Cycling rat Periovulatory PMSGIhCG induced ovulation Granulosa cell models MATERIALS AND METHODS 32 I. Steroid assays 32 A . Progesterone RIA 32 B. Estradiol RIA 32 II. Molecular biology tools 34 A. RNA extraction 34 A . l . Extraction by cesium chloride / chloroform:butanol protocol 34 A . 2. Extraction with RNaid kit 34 B. Reverse transcription/polymerase chain reaction 35 B. l . RT reaction 35 B.2. PCR reactions 35 B.2.a.ColdPCR 35 B . 2. b. Incorporation of32P-dCTP during PCR amplification 40 B. 3. RT/PCR Combination Experiments 40 B.3.a. RT experiment/hot PCR 40 B.3.b. PCR cycle experiments 40 C. Cloning and sequencing of a portion of the rat GnRH-receptor cDNA 41 D. Northern and Southern blot analysis 41 D . l . Northern and Southern blotting 41 D.2. Generation of an oligonucleoprobe 42 D.3. Generation of a cDNA Probe for the rat GnRH-receptor Gene 42 III Quantification protocols 43 A . Visualization methods 43 A . l . Electrophoresis 43 A . l . a . RNA gels 43 A . l . b . DNA gels 43 A.2. Polaroid photography 43 A.3. measurements of dCTP incorporation in B-counter 44 VI A.4. Autoradiography A . 5. Tansluminescence video densitometry B. Evaluation of the visualization methods B. l . Northern versus Southern B.2. Quantification by transluminescence densitometry B.2. Hot versus cold RT/PCR III. Animal protocols A . Tissue collection B. PMSG/hCG synchronized ovaries C. Granulosa cells model I D. Granulosa cells model II IV. Statistical analysis and graphing 44 44 44 44 44 45 46 46 48 50 53 58 RESULTS - CHAPTER I Preliminary studies I. Setting up the methodology parameters A . RNA gel and reverse transcription B. PCR cycle experiments II Comparison of the different quantification protocols A. Quantification by transluminescence densitometry B. Northern versus Southern C. Hot vervus cold PCR III. Sequencing of a portion of the ovarian GnRH-R 59 59 59 59 67 67 69 69 71 Vll RESULTS - CHAPTER II Detection of GnRH-R mRNA 73 I. Tissue localization of GnRH-receptor expression 73 II. Ontogeny of GnRH-R expression 73 RESULTS - CHAPTER III Quantification of GnRH-R mRNA in vivo 77 I. Cycling female Sprague Dawley (SD) rat 77 A . GnRH-receptor mRNA expression in the ovary and pituitary 77 B. Serum progesterone and estradiol measurements 77 II. In vivo studies in the PMSG/hCG synchronized model 80 A . Ovarian and pituitary GnRH-receptor mRNA levels 80 B. Serum steroid levels 80 RESULTS - CHAPTER VI Quantification of GnRH-receptor mRNA In vitro 83 I. Studies in the granulosa cell model I 83 A . Effects of L H , FSH and GnRH on progesterone production 83 B Time- and concentration-dependent effects of L H 85 C. Effects of FSH 85 D. Effects of GnRH 90 II. Studies in the granulosa cell model II 93 A. Effects of culture time on granulosa cells differentiation 93 B. Time-course effects of experimental treatments on mRNA levels 98 C. Effects of GnRH, P G F 2 a and hCG 100 D. Effects of hCG 106 E. Effects of GnRH 106 F. Effects of PGF 2 « 114 DISCUSSION I. About the studies A . Project B. Models and techniques B . l . The animal models B. 2. The techniques C. Problems and problem solving C. l. The animal models C. 2. The techniques II. Tissue specificity A . Synopsis B. General implications C. GnRH-receptor mRNA in the central nervous system D. GnRH-receptor mRNA in the reproductive organs D. 1. In the female reproductive organs D.2. In the male reproductive organs D.3. Reproductive related organs where GnRH-R mRNA was not detected E. GnRH-receptor mRNA in the non-reproductive organs III. Ontogeny A . Synopsis B. General implications C. GnRH-receptor mRNA in the ovary D. GnRH-receptor mRNA in the testis E. GnRH-receptor mRNA in the pituitary IV. Cycling rat A . Synopsis B. GnRH-receptor mRNA in the pituitary C. GnRH-receptor mRNA in the ovary D. Steroid levels during the estrous cycle V. PMSG/hCG synchronized model A. Synopsis B. GnRH-receptor mRNA in the pituitary C. GnRH-receptor mRNA in the ovary D. Steroid levels E. General implications VI. Granulosa cell - Model I A . Synopsis B. L H effects C. GnRH effects D. General implications VII. Granulosa cell - Model II A . Synopsis B. Preliminary results B . l . Culture time B.2. Time-course C. hCG effects D. GnRH effects E. P G F 2 a effects F. General implications VII. Comparison between Model I and Model II 146 A . Implications for differential findings 146 B. Gonadotrophin effects 147 C . GnRH effects 147 D. Difference in hormonal environment 150 E. Suggested studies to clarify the issue of dual responses 152 SUMMARY 153 REFERENCES 158 LIST OF TABLES xi page Table I. Rat characteristics. 24 Table II. Histological changes associated with the estrous cycle. 25 Table III. G E N B A N K sequences for GnRH gene, GnRH-R and P G F 2 a - R - 37 Table IV. Primers designed for PCR. 38 Table V . Treatments applied to granulosa cell culture - Model I. 52 Table VI. Time-course experiments on granulosa cell culture - Model II. 55 Table VII. hCG, GnRH, P G F 2 a interactions - Model II. 56 Table VIII. Concentration-response experiments - Model II. 57 Table IX. PCR conditions for different cDNAs with different primer combinations. 60 Table X. Recapitulative table of the studies on model I and model II. 149 LIST OF FIGURES Xll page BACKGROUND Figure 1. Hypothalamo-pituitary-ovary axis. 3 Figure 2. Follicular maturation process. 5 Figure 3. Compartmentalization of steroidogenesis. 6 Figure 4. Schematic representation of GnRH gene structure. 15 Figure 5. Differential GnRH gene expression. 16 Figure 6. GnRH and GnRH-receptor structure. 17 Figure 7. P G F 2 a molecular structure. 19 Figure 8. Progesterone and estradiol structure. 21 Figure 9. Hormonal levels in the female rat. 26 METHODS Figure 10. Progesterone standard curve. 33 Figure 11. Size of expected PCR products. 39 Figure 12. General protocol for in situ, in vivo and in vitro studies. 47 Figure 13. Protocol for peri-ovulatory period experiments. 49 Figure 14. Protocol for granulosa cell experiments - Model I. 51 Figure 15. Protocol for granulosa cell experiments - Model II. 54 xiii page RESULTS - CHAPTER I Preliminary studies Figure 16. Integrity of total RNA. 61 Figure 17. Reverse transcription experiment. 62 Figure 18. Schematic representation of PCR products showing sizes of amplified segments. 63 Figure 19. PCR cycle experiments (GnRH, GnRH-R). 64 Figure 20. PCR cycle experiments (PGF2 a -R). 65 Figure 21. PCR cycle experiments (Actin, G3PDH). 66 Figure 22. Densitometer standardization. 68 Figure 23. Northern versus Southern. 70 RESULTS - CHAPTER II Detection of GnRH-receptor mRNA Figure 24. GnRH-receptor partial cDNA sequence: rat versus mouse. 72 Figure 25. GnRH-receptor tissue localization in the rat. 74 Figure 26. GnRH-receptor ontogeny - Southern blot of pituitary, testis and ovaries. 75 Figure 27. GnRH-receptor ontogeny - Graph of scanned autoradiogram. 76 XIV page RESULTS - CHAPTER III Quantification of GnRH-receptor mRNA in vivo Figure 28. GnRH-receptor mRNA expression in the ovary, and the pituitary of the cycling rat. 78 Figure 29. Steroidogenesis in the cycling rat. 79 Figure 30. Peri-ovulatory expression of GnRH-receptor. 81 Figure 31. Peri-ovulatory steroid levels. 82 RESULTS - CHAPTER VI Quantification of GnRH-receptor mRNA In vitro Figure 32. Progesterone output in FSH pre-treated cultured granulosa cells. 84 Figure 33. L H time-course effects on GnRH-R mRNA levels. 86 Figure 34. L H time-course effects on steroidogenesis. 87 Figure 35. Effects of increasing concentration of L H on GnRH-R mRNA levels. 88 Figure 36. Effects of increasing concentration of L H on steroidogenesis. 89 Figure 37. Effects of increasing concentration of GnRH on GnRH-R mRNA levels. 91 Figure 38. Effects of increasing concentration of GnRH on steroidogenesis. 92 Figure 39. Ovaries of control (immature) and PMSG treated rats. 94 Figure 40. Granulosa cell culture 95 Figure 41. RNA quantification after 1 to 4 days of culture. 96 Figure 42. Basal and hCG-stimulated P4 production after 1 to 4 days of culture. 97 Figure 43. GnRH time-course effects on GnRH mRNA levels. 99 XV page Figure 44. Effects of GnRH, P G F 2 a and hCG on GnRH-R mRNA levels. 101 Figure 45. Effects of GnRH, P G F 2 a and hCG on PGF 2 c rR mRNA levels. 102 Figure 46. Effects of GnRH, P G F 2 a and hCG on p-actin mRNA levels. 103 Figure 47. Effects of GnRH, P G F 2 a and hCG on progesterone production. 104 Figure 48. Effects of GnRH, PGF 2 ( X and hCG on estradiol production. 105 Figure 49. Effects of increasing concentration of hCG on GnRH-R mRNA levels. 107 Figure 50. Effects of increasing concentration of hCG on PGF 2 a-R mRNA and p-actin mRNA levels. 108 Figure 51. Effects of increasing concentration of hCG on steroidogenesis. 109 Figure 52. Effects of increasing concentration of GnRH on GnRH-R mRNA levels. 110 Figure 53. Effects of increasing concentration of GnRH on GnRH mRNA levels. I l l Figure 54. Effects of increasing concentration of GnRH on PGF 2 c rR mRNA and p-actin mRNA levels. 112 Figure 55. Effects of increasing concentration of GnRH on steroidogenesis. 113 Figure 56. Effects of increasing concentration of P G F 2 a on GnRH-R mRNA levels. 115 Figure 57. Effects of increasing concentration of P G F 2 a on PGF 2 a-R mRNA and p-actin mRNA levels. 116 Figure 58. Effects of increasing concentration of P G F 2 a on steroidogenesis. 117 Figure 59. Tissue localization of GnRH-receptor mRNA in the rat. 129 Figure 60. Extrapolated GnRH-receptor, gonadotrophins and steroid level in the cycling rat. 135 Figure 61. Extrapolated GnRH-receptor, gonadotrophins and steroid level in the PMSG/hCG primed rat. 139 Figure 62. Extrapolated GnRH-receptor, gonadotrophins and steroid level in the cycling or PMSG/hCG primed rat. 140 Figure 63. Comparison between Model I and Model II, and their outcome. 151 LIST OF ABBREVIATIONS Standard Abbreviations A A Arachidonic acid ATP Adenosine triphosphate bp Base pairs C Celcius Ca2+ Calcium cAMP Cyclic adenosine monophosphate CAT Chloramphenicol Acetyl Transferase cDNA Complementary D N A Ci Currie C R E cAMP response element DI Diestrus day I DII Diestrus day II ddH 2 0 Double distilled water dCTP Deoxycytosine-triphosphate dNTPs Deoxynucleotide-triphosphate(s) D A G Diacyl glycerol DEPC Diethylpyrocarbonate DMEM Dulbecco's modified eagles medium DNA Deoxyribonucleic acid DTT Dithiothrietol e (as in eLH) equine E Estrus E2 Estradiol XVII EDTA Estradiol ERE FBS F S H FSH-R g G3PDH G L B GnRH GnRH-R GTP G-protein GRB GTC h (as in hCG) hCG HRE IPs Ethylenediaminetetraaceticacid 17B-estradiol Estradiol response element Foetal bovine serum Follicle stimulating hormone Follicle stimulating hormone receptor Grams Glucose-3 phosphate dehydrogenase Gel loading buffer Gonadotrophin-releasing hormone Gonadotrophin-releasing hormone receptor Guanosine triphosphate GTP binding protein Gel running buffer Guanosine thiocyanate homogenizing buffer Hours Human Human chorionic gonadotrophin Hormone response element Inositol triphosphate or inositol trisphosphate IU IVF K d KDa I L L H LH-R m (as in mGnRH-R) ml min mRNA m.w. M n (as in nM) P P 4 PBS PCR PE P G P G E 2 P G F 2 a P G F 2 a - R P G I 2 PI International unit In vitro fertilization Equilibrium dissociation constant kilodaltons Litre Lactating Luteinizing hormone Luteinizing hormone receptor Mouse Milliliters Minutes messenger RNA Molecular weight Moles/Liter Nano(10-9) Pregnant Progesterone Phosphate-buffered saline Polymerase chain reaction Proestrus Prostaglandin Prostaglandin E 2 Prostaglandin F 2 a Prostaglandin F 2 a receptor Prostaglandin I 2 Phosphatidiyl inositide or phosphoinositide P K A Protein kinase A P K C Protein kinase C PLA2 Phospholipase A2 PLC Phospholipase C PLD Phospholipase D pM Picomolar pmole Pico moles P M S G Pregnant mare serum gonadotrophin r (as in rGnRH) Rat RIA Radioimmunoassay RNA Ribonucleic acid RT Reverse transcription s Seconds SDS Sodium dodecyl sulfate SSC Sodium chloride and Sodium citrate buffer TBE Tris borate EDTA TRIS Tris(hydroxymethyl)aminomethane Tx Thromboxanes TxA2 Thromboxane A2 U V Ultraviolet v/v Volume per volume w/v Weight per volume X Times (or multiplied by) x g Times gravity Abbreviations Starting with Greek Characters a Alpha 13 Beta Y Gamma X.260 wave length at 260 mm pi (as in pig) Micro (IO\"6) List of suppliers Amersham Beckman Bio 101 Bio/Can Bio-Rad Boehringer Mannheim BRL Canlab Pharmacia Sigma Amersham Ltd., Oakville, ON Beckman, Mississauga, ON Bio 101,LaJolla,CA Bio/Can Scientific, Mississauga, ON Bio-Rad, Mississauga, ON Boehringer Mannheim, Laval, QU Gibco BRL, Gaithersburg, MD VWR/CANLAB, Toronto, ON Pharmacia, Upsala, Sweden Sigma Chemical Company, St. Louis, MO ACKNOWLEDGMENTS xxi I would like to express my gratitude to everyone who contributed to the achievement of this thesis. The constant support of my family in undertaking such an adventure, so far from home, was of immense help. I found here another family who provided me with more support and purpose. I would like to thank Dr. Leung for opening new doors, and being so supportive in the compromises of dealing with a new family and pursuing my studies. The two years spent under the co-supervision of Dr. Olofsson brought me organization and technical skills in the laboratory. I would also like to thank Dr. Krisinger for taking part in the supervision of my work over great distances. Finally, very special thanks must be addressed to Jeff a wonderful husband, who developed in me a sense of independence and confidence, and provided me with a great deal of support, help, friendship, and also with two lovely daugthers. BACKGROUND I. The hypothalamo-pituitary-gonadal axis In the human, the term menstrual cycle describes the monthly cycle of physiological events which prepare the female for pregnancy. In non-primate mammals, the cycles, varying in duration and frequency from one species to the other, are called the estrous cycle. The endocrinology of the menstrual and estrous cycle are comprised of three levels, known as the hypothalamo-pituitary-ovarian axis (H-P-O axis). Hormones are produced at each level, and controlled by positive and negative feedback mechanisms from the pituitary and the ovary (Figure 1). A. Hypothalamic GnRH Gonadotrophin-Releasing Hormone is a decapeptide produced primarily by the hypothalamus. It is secreted in rapid pulses of varied amplitude and frequency during the cycle [Smith et al., 1985]. GnRH exerts its actions on the gonadotrophs of the anterior pituitary. The half-life for GnRH is only a few minutes, and in that time, it must travel to the pituitary via the hypothalamo-pituitary portal vein, and bind to GnRH-receptors present on the surface of the gonadotrophs [Eidne et al., 1992; Fan et al., 1994; Crumeyrolle et al., 1994], and exert its actions. G n R H is responsible for increasing synthesis, storage, activation and secretion of luteinizing hormone (LH) and follicle stimulating hormone (FSH), from the gonadotropes [Joshi et al., 1993, Baldwin et al., 1984; Rommler et al., 1979]. GnRH secretion is under the influence of cathecolaminergic neurons, such as noradrenaline, or dopamine [Sawyer, 1975; Rotsztejn et al., 1976; Yen et al., 1977; Advis et al., 1978; Balthazart et al., 1982; Dufour et al., 1988; Laatikainen, 1991; Donham; 1993]. Its activity is modulated, partly by auto-stimulation of its own receptor, and partly by short feedback loops from the pituitary, but mainly the ovarian steroids, progesterone: P4 and estradiol: E2 [Gregg et al, 1990; Ortmann et al, 1995]. Hypothalamic Figure I. Hypothalamo-pituitary-ovary axis. (Green arrows represent stimulatory actions, while red arrows indicate inhibitory effects). The pulsatile release of GnRH stimulates the production of the gonadotrophins (LH and FSH) by the anterior pituitary. Acting on the ovary, FSH stimulates steroidogenesis (P 4 and E 2) and follicular development. The rising levels of E 2 first feedback negatively on the pituitary productions, but when E 2 reaches a threshold, E2 stimulates an LH surge that provokes ovulation. The subsequent steroidogenesis also targets the uterus, preparing it for an eventual implantation. Thus, depending on the stage and the levels of steroids, P4 and E 2 can either have stimulatory or inhibitory effects. B. Pituitary LH and FSH L H and FSH are secreted by the gonadotrophic cells of the anterior pituitary in response to GnRH stimuli. In turn, L H and FSH act on the ovary to stimulate steroidogenesis [Hillier et al., 1995]. L H and FSH pulsatile secretion is modulated by GnRH secretion and ovarian steroids [Hsueh et al., 1980; Fink, 1988]. During the first half of the cycle (known as the follicular phase) E 2 exerts a negative feedback on the hypothalamo-pituitary unit by inhibiting FSH secretion [McNeilly, 1988]. At midcycle, high levels of E 2 induce the L H surge responsible for ovulation [Suzuki et al., 1974; Wu et al., 1974; Yen et al., 1977; Haour et al., 1978; Channing et al., 1980; Turgeon et al., 1980; Leung et al., 1992]. P4 enhances the midcycle L H surge [Lee et al., 1990], and is mainly responsible for the FSH surge. During the second phase of the cycle (luteal phase), high levels of P4 act with E 2 to inhibit gonadotrophin secretion. C. Ovarian function The ovarian cycle is divided into three phases: Follicular development, ovulation, and luteal phase. Under appropriate gonadotrophic stimulation, primordial follicles are recruited to undergo further maturation. At the beginning of a cycle, rising levels of F S H stimulate follicular development and E 2 synthesis [Hillier etal., 1995]. Negative feedback from E 2 causes FSH levels to decline, withdrawing support to the less developed follicles, while the dominant follicle(s) still develops due to the greater number of FSH receptors they carry. At mid cycle, high levels of E 2 , positively feeding back on the pituitary, cause the midcycle surge of L H and FSH [Suzuki et al., 1974; Wu et al., 1974; Yen, 1977; Haour et al., 1978; Channing et al., 1980; Turgeon, 1980; Leung et al., 1992]. The gonadotrophin surge is responsible for the final follicular maturation and ovulation. Ovulated follicles become corpora lutea, secreting both E 2 and P4. A feedback loop from E 2 and P4 inhibits gonadotrophins, which causes them to decline, allowing the rise of FSH of the next cycle. C.l . The follicular phase C.l.a. The dominant follicle F S H which is responsible for follicular recruitment, rapidly diminishes under E2 negative feedback. Because of the decreasing FSH stimulation, only the dominant follicle, which, having more granulosa cells, carries more FSH receptors, continues to be stimulated. Progesterone production by the dominant follicle increases in response to L H due to the newly acquired L H receptors. C.l.b. Morphology of the pre-ovulatory follicle During follicular maturation, accumulation of follicular fluid within the proliferative granulosa cell mass forms the antrum. Maturation is accompanied by enlargement of the oocyte, and formation of the zona pellucida, a mucopolysaccharide layer surrounding the oocyte. The cumulus oophorus is composed of a dense layer of granulosa cells surrounding the zona pellucida. The stroma in contact with the granulosa cells differentiates into the theca layer, with a well vascularized internal layer and a fibrous external layer (Figure 2). FSH receptors are carried by the granulosa cells only, while the theca interna contains L H receptors. Granulosa cells also express L H receptors in response to F S H stimulation. L H stimulation causes theca cells to produce androstenedione (an androgen) which is a substrate for the aromatase enzyme produced under FSH stimulation by the granulosa cells. The aromatase is a key enzyme for E2 production (Figure 3). 5 Primordial Follicle Preantral Follicle Antral Follicle 0=5O//m * > m : —\" 0=200/7 m Preovulatory Follicle Follicular fluid Antrum Theca interna Theca externa 0=5OOj/m Zona Cumulus oophorus pellucida Oocyte Theca cells Granulosa cells 0=2Omm Figure 2. Follicular maturation process. The main morphological stages of the human follicle are depicted here. The diameters of the follicles at different stages of maturity are indicated. Under FSH stimulation, primordial follicles are recruited to undergo maturation. Only the dominant follicle will reach the pre-ovulatory stage, and complete the cycle. Theca cell 1 Granulosa cell 1 Cholesterol L-CAMPI T Androstenedione! 4 Androstenedione j | cAMP -*J Estradiol FSH Figure 3 . Compartmentalization of steroidogenesis. Also known as the two cells theory, steroidogenesis is assured by the two cell types of the follicle, the theca cells and the granulosa cells. The theca cell responds to L H by producing androstenedione. Androstenedione is transported to the granulosa cell where, following FSH activation of the aromatase enzyme, it can be transformed into estradiol. C.2. The process of ovulation The L H surge is triggered by the high, plateauing levels of E2, and synergistic action of increasing levels of P4. After initiation of the surge, E2 levels drop dramatically, due to down-regulation of L H receptors on the theca cells by L H , depriving the granulosa cells of androgen substrate. Further granulosa cell proliferation is also inhibited by P4 [Channing et al., 1978]. In response to the L H surge, synthesis of proteolytic enzymes, involved in the lysis of the follicular wall, increases. PGF2 a levels in the follicular fluid also increase. E 2 levels drop while P4 production by the granulosa cells increase. Further nuclear maturation occurs, as the first meiotic division resumes, only to be arrested again at the metaphase of the second meiotic division [Channing et al., 1978]. The loss of positive feedback from E 2 > combined with the increasing negative feedback from P 4 ( leads to down-regulation of GnRH receptors in the pituitary. These events, combined with the exhaustion of L H stores, terminate the L H surge. P G F 2 c t increases intra-follicular pressure by increasing ovarian contractions and activates the proteolytic enzymes. Rupture of the follicular wall and expulsion of the egg constitute the ovulation per se [Dennefors et al., 1983]. C.3. Luteinization Luteinization starts in response to the L H surge by a significant rise in P4 prior to ovulation. After ovulation, the follicle becomes the corpus luteum. The granulosa cells enlarge and become luteal cells. Vascularization invades the granulosa layer, bringing cholesterol, carried by L D L (low density lipoproteins), as a substrate for P4 synthesis in response to gonadotrophin stimulation. Although circulating levels of FSH are low, significant quantities still reach the granulosa-luteal cells through the increased vascularization, and E 2 is still synthesized. The peak activity of the corpus luteum coincides with peak vascularization and P 4 and E2 levels in the luteal phase. Unless pregnancy rescues the corpus luteum [Stouffer et al., 1989], luteal regression is inevitable, resulting in P4 decline and death of the corpus luteum. II The uterine cycle A. Uterus, and other targets of ovarian steroids The cycling hormonal patterns, determined by the ovarian cycle, fulfill different functions throughout the body, with the purpose of preparing the uterus for pregnancy [Yen, 1978; McCarty, 1983]. The functions of the ovarian steroids include: -Increased ciliation and secretory activity by the fallopian tube in response to E2, while P4 has opposite effects. -Increased mitotic activity and keratinazation of the epithelium of the vagina under E2 influence, and opposite effects of P4. -Breast enlargement prior to menstruation. -Increase in skin pigmentation, and sometimes, acne, due to P4. -Small rise in temperature due to P4 effects on thyroid function leading to a slight increase in metabolic rate. -Symptomatic changes including bloatedness, breast tenderness, and what is generally described as PMS (pre-menstrual syndrome). B. Endometrial changes The uterus is affected at several levels. The myometrium, the uterine blood flow, the endometrium and the cervix are all influenced by P4 and E2 [Jaffe, 1974]. The endometrial changes can be divided into three phases: B.l. The proliferative phase The proliferative phase coincides with the follicular phase. Under E 2 stimulation, the endometrium grows and rich vascularization invades the thickening tissues. The effects of E2 are enhanced by up-regulation of its own receptor. Priming with P4 receptors is also under the control of E2. B.2. The secretory phase After ovulation, P4 becomes the dominant hormone. P4 causes endometrial growth to cease, and prepares the tissues for implantation by stimulating secretion. The secretions are composed of glycogen, sugar, amino-acids, mucus and enzymes. If implantation occurs, the secretory activity is maintained, and the superficial stroma cells differentiate in a strong compact layer. However, if implantation does not occur, the absence of gonadotrophic support causes a reduction in tissue weight. Prostaglandins (PGE2, PGF2a> PGI2) and trombaxane (TXA2), vasodilatation and vasoconstriction effects cause blood to leak into the interstitial space, eventually leading to haemorrhage, known as menstruation. B.3. Menstruation The non-viable tissues formed as a result of cell and vascular necrosis is extruded into the endometrial cavity and contributes to the menstrual flow. Menstrual flow is limited, and eventually stops. Secretion of E2 by the developing follicles resumes, inducing healing and new tissue growth. III. Gonadal control of the gonadal functions A. Paracrine/autocrine factors An intricate interplay takes place between endocrine and other cell types within the ovary. Paracrine/autocrine factors may act on neighboring cells as intercellular modulators [Tsafriri, 1988]. Paracrine control mechanisms involve local diffusion of hormones to their neighboring cells without entering the circulatory system. Autocrine regulation occurs when the target of a hormone is the producing cell itself. Local steroids, eicosanoids, and peptide hormones are suspected to play a role in the regulation of ovarian function, affecting steroidogenesis, oocyte maturation and ovulation through paracrine and autocrine mechanisms. These regulators include P4 and E2, prostaglandins (PGF2a> PGE2, PGl2-.-)> gonadotrophins, GnRH, inhibin and activin, growth factors, insulin and insulin-like growth factors, angiogenic factors, angiotensin, neurotransmitters, OMI (oocyte maturation inhibitor) [Ling et al., 1990; Leung et al., 1992; Chun et al., 1994]. B. GnRH as an ovarian modulator GnRH is also thought to be an important paracrine/autocrine regulator in the gonads [Hsueh et al., 1981; Tsafriri, 1988; Leung et al., 1992]. GnRH and its receptor mRNA have recently been characterized in the human granulosa cell [Peng et al., 1994]. In the ovary, GnRH is considered to act differentially during follicular maturation, and has been shown to be both steroidogenic and antisteroidogenic [Clayton et al., 1979; Leung, 1985]. It is shown to stimulate basal steroidogenesis, but attenuate gonadotrophin induced c A M P and P4 production. There is a multitude array of reports demonstrating the effects of this peptide on ovarian steroidogenesis [Hsueh et al., 1984; Leung et al., 1989; Sridaran et al., 1988; Clayton, 1988]. Acute stimulatory effects on P4 production are seen in both cultured rat and human granulosa and luteal cells [Massicotte et al., 1984; Srivastava et al., 1994]. However, an inhibitory effect of LH-stimulated P4 production has also been demonstrated [Smith et al., 1991; Srivastava et al., 1994]. Furthermore, GnRH has been shown to be luteolytic under in vivo and in vitro conditions [Massicotteetal., 1984]. The importance of GnRH is further illustrated by the GnRH-induced appearance of P4 receptor mRNA and protein [Natraj et al., 1993] in rat granulosa cells. Furthermore, GnRH has the capability to induce oocyte release [Ekholm et al., 1981; Koos et al., 1985], oocyte maturation [Hillensjo et al., 1980] and luteinization [Morris et al., 1993]. IV. The hormones of the endocrine reproductive system A. The gonadotrophins A.l . LH and FSH Luteinizing hormone (LH) and follicle stimulating hormone (FSH) are both glycoproteins composed of two non-covalently bound subunits [Ryan et al., 1987; Combarnous, 1988; Gray, 1988; Wierman et al., 1988]. While the 96-amino acid-long a-subunit is common to the two hormones, they have different B-subunits. The carbohydrate moieties of those glycoproteins contribute to 15% of their molecular weight and are contributing to the conformation of the molecule, forming the epitope that will bind to the receptor [Ryan et al., 1987; Combarnous et al., 1988; Gray et al., 1988; Wierman et al., 1988]. L H and FSH releases are pulsatile. The periods between peaks of L H during the menstrual cycle is 1 to 7 hours, and the amplitude of FSH release is lower than L H [Filicori et al., 1979]. Both are under GnRH control, although FSH is less sensitive to GnRH and also regulated by E 2 [Hall et al., 1992]. A.2. hCG Human Chorionic Gonadotrophin is a glycoprotein composed of an a-subunit identical to the hLH/hFSH a-subunit. The beta-subunits of hCG and hLH share 85% sequence identity in their first 114 amino acids but differ in the carboxy-terminal peptide because hCG beta contains a 31-amino acid extension (beta-CTP) [Yoshimura et al., 1995]. Human C G is the hormone of pregnancy of chorionic origin in the human female. It binds to the L H receptor [Ziecik et al., 1992] and its effects are very similar [Yoshimura et al., 1995]. It is used clinically, in place of L H , for, triggering ovulation in patients undergoing in vitro fertilization [Tarin et al., 1992], and in animal reproduction [Shel ton etal., 1990]. A3. PMSG Pregnant Mare Serum Gonadotrophin (PMSG) is a glycoprotein hormone similar in structure to L H , FSH and hCG. Like the other gonadotrophins, it is composed of two non-covalently bound subunits (a and p\"). The alpha-subunit contains 96 amino acids and is identical to the a-subunit of the equine pituitary hormones eLH, eFSH and eTSH. The beta-subunit is composed of 149 amino acids. Its primary structure is identical to that of beta-eLH, and it shares similarities with beta-hCG, as both possess a C-terminal extension. PMSG is, in fact, of chorionic origin. Thus, it should be more rightfully named equine Chorionic Gonadotrophin (eCG) [Hoppen, 1994]. P M S G , together with other progestagens, are widely used in animal reproductive technology with the goal of increasing productivity of farm animals through enhanced control of reproductive function [Shelton, 1990]. It is also used on laboratory animals for synchronization of the estrous cycle and the study of reproductive function. P M S G is predominantly follicle-stimulating: Its effect closely resemble those of the follicle-stimulating hormone (FSH) of the anterior pituitary. B. GnRH and its receptor B.l. GnRH Gonadotrophin-releasing hormone (GnRH) is a decapeptide derived from a larger preprohormone [Nillius et al., 1974; Hsueh et al., 1983]. It is found in the hypothalamus of all mammalian species studied so far [Illing et al., 1993], and is also present in non-mammalian species [Battisti et al., 1994; Grober et al., 1995]. Active transcription of the gene encoding GnRH has been confirmed in the hypothalamus of mammalian species, (Figure 4), and also the rat ovaries [Oikawa et al., 1990; Clayton et al., 1992; Goubau et al., 1992], the rat testis and the human placenta [Sherwood et al., 1993] (Figure 5). The gene encoding GnRH is composed of four exons and three introns. The detailed sequence with the position of the exonic and intronic portions is shown in Figure 4. In the hypothalamus, the mature transcript is spliced of all three intronic sequences. The resulting 0.6 Kb mRNA is composed of a 3' and a 5' untranslated region; the start codon is located at the beginning of the second exon, and translation begins with the signal peptide. GnRH follows, within the second exon, and is followed by G A P (GnRH associated peptide) which has its stop codon in the fourth exon (Figure 5). The gene encoding for GnRH has multiple transcription initiation start sites that are differentially used in various tissues. The mRNA species found in other tissues, although derived from the same gene, are also much longer as they retain some intronic regions. In the ovary, the main transcript is a 3.3 Kb mRNA with a transcription start located in the first intron and with conserved intronic sequences 2 and 3. The placental mRNA is 1.47 Kb: Transcription starts upstream of the first exon and the first intron is not spliced. The mRNA species found in the testis is 1.4 Kb, has an identical transcription start as the hypothalamic transcript, and, as the placental transcript, retains the first intron. Although the non-hypothalamic transcripts have different transcription start sites, the presence of immunoreactive GnRH in those tissues suggest that the non-hypothalamic transcripts also have an open reading frame encoding for this peptide. B.2. GnRH-receptor There exists extensive evidence that all hormones and other local regulators relay their information through receptors. Some are membrane bound, expressed on the cell surface or the nucleus. Others are soluble receptors present within the cytosol or the nucleus. The receptors for GnRH are membrane bound. GnRH-R immunoreactivity and mRNA have been found in the brain, [Jennes et al., 1994 ] the anterior pituitary, [Reinhart et al., 1992], ovary, [Moumni et al., 1994; Whitelaw et al., 1995] and Leydig cells [Reinhart et al., 1992]. In the ovary, another important piece of evidence for GnRH action as a paracrine factor is the finding of high affinity binding sites (Kd = 0.5 nM) for GnRH in ovarian cells [Huckle et al., 1988] and the demonstration of the expression of specific mRNA encoding the receptor for GnRH in the different ovarian cells during ovulation and luteolysis [Olofsson et al., 1994; Peng et al., 1994; Latouche et al., 1989]. This evidence lends strong support to the concept of GnRH as a significant intra-ovarian hormone. The first report of the cloning of a cDNA-sequence for the murine receptor for GnRH [Reinhart et al., 1992] revealed that the transcript encodes for a 327 amino acids protein, organized in seven trans-membrane domains characteristic of G-Protein coupled receptors [Probst et al., 1992] (Figure 6). Since then, several groups have characterized cDNA sequences encoding functional GnRH-R in the mouse [Tsutsumi et al., 1992], rat [Eidne et al., 1992; Kaiser et al., 1992; Kakar et al., 1994; Perrin et al., 1993], sheep [Brooks et al., 1993] and human [Kakar et al., 1992; Chi etal., 1993]. The binding of GnRH to a G-Protein coupled receptor results in the initiation of two possible transduction pathways - P K A , P K C [Leung et al., 1992]. In the pituitary, the cellular response initiated by the binding of GnRH on its membrane receptor results in activation of adenylate cyclase by the a-subunit of a Gs protein followed by P K A activation by cAMP. Upon dissociation of P K A into the regulatory and the catalytic unit, the catalytic unit is phosphorylated by A T P and, in turn, phosphorylated membrane proteins allowing calcium to enter the cell [Kiesel et al., 1986]. C a 2 + movement leads to the excretion of L H and FSH granules [Huckle et al., 1987]. Binding of GnRH on its receptor also activates PLC which hydrolyses phosphatidyinositol to generate IP3. IP3 binds on the endoplasmic reticulum and opens calcium channels. The other product of PLC hydrolytic activity is D A G . D A G remains in the membrane and, with calcium, activates PKC. In the ovary, GnRH transduction involves three pathways: P L A 2 , PLC, and P L D [Leung etal., 1992]. The stimulation of PLC activity results in the hydrolysis of polyphosphoinositides, generating IP3 and D A G . IP3 is responsible for the release of C a 2 + from intracellular stores, while D A G stimulates P K C . The stimulation of P L D also contributes to P K C activation and C a 2 + regulation (from extracellular stores). The stimulation of P L A 2 results in the generation of A A , which is a substrate for lipoxygenase metabolites, also mediating GnRH actions. 15 GnRH Gene E l E2 E3 E4 0.6Kb •* • » ~ i ' mR NA transcript 5\" Untranslated 3\" Untranslated region GnRH region Signal GnRH Associated Peptide Peptide (GAP) Preprohormone Figure 4. Schematic representation of GnRH gene structure, (not to scale). The gene encoding for GnRH in the hypothalamus is composed of 4 exons and three introns. During the process of transcription, the introns are spliced from the hypothalamic transcript, leaving a 0.6 Kb mRNA transcript. The translated region starts at the second exon and ends in the fourth exon. The decapeptide GnRH is encoded in the second exon, preceded by the signal peptide and followed by GnRH associated peptide (GAP). GnRH Gene Hypothalamus Ovary 5 J. JL transcript transcript E l [1 E2 12 K3 • E4 0.6Kb 3 3 K b II I Placenta 1 47Kb Testis transcript R transcript t .4Kb Figure 5. Differential GnRH expression. GnRH is expressed in the hypothalamus, the ovary, placenta and testis of the rat. For each tissue, the left transcript is the precursor mRNA and the right transcript is the spliced mature mRNA. Boxes (El, E2, E3 and E4) are the exonic sequences of the gene, lines (Il,I2and 13) are the intronic sequences. Thin lines are the intronic sequences spliced in the final mRNA, while thick lines are the conserved intronic regions.The transcripts expressed in these different tissues have different transcription starts and ends, and different splicing patterns. Thus, while the hypothalamic transcript is spliced of all intronic regions, the main ovarian transcript starts in the first intron and retains introns 2 and 3. The placenta transcript starts upstream of the first exon and retains the first intron. The testicular transcript is similar to the placenta transcript, but starts closer to the first exon. 17 Figure 6. GnRH and GnRH-receptor structure. GnRH is primarily a hypothalamic decapeptide with an aminated C-terminus and a cyclized N-terminus. The hypothalamic form of GnRH has a short half-life of 2-4 minutes only. It reaches its receptor, a seven trans-membrane serpentine-G protein coupled receptor, via the portal vein of the pituitary. GnRH-like peptides are also produced locally in the ovary, testis, and placenta of mammalian species. There, they also find a locally expressed, similar GnRH-R. 18 C. Prostaglandin F2a and its receptor C.l . Prostaglandin F2 a *. Prostaglandin F 2 alpha (PGF2 a ) is an eicosanoid derived from arachidonic acid (Figure 7). Prostaglandins and their receptors are present in practically all tissues where they exert various local effects. The reproductive tissues where P G F 2 a has been detected include the human decidua, amnion, pregnant myometrium and ovary [Aksel et al., 1977; Satoh et al., 1981]. PGF2a has been localized to the follicle, theca-, granulosa- and luteal-cell of the human ovary [Plunkett et al., 1975; Aksel et al., 1977; Patwardhan et al., 1981]. Prostaglandin F2 alpha is believed to regulate the life span of the corpus luteum. Various studies suggest that prostaglandin F2 alpha (PGF20O is a luteolytic factor in the mammalian ovary [Korda et al., 1975; Grinwich et al., 1976; Richardson et al., 1980; Hanzen et al., 1984; Moon et al., 1986; Jalkanen et al., 1987; Michael et al., 1991] and the rat corpus luteum [Hall et al., 1979; Luborsky et al., 1984; Bjurulf et al., 1994]. It is most abundant in corpora lutea of pseudopregnant rats, [Olofsson et al., 1992] where it exerts auto/paracrine modulation of luteal steroidogenesis [Olofsson et al., 1994]. Prostaglandin synthesis is stimulated by L H or hCG in pre-ovulatory follicles [Larson et al., 1991; Tsafriri, 1995]. In turn, P G F 2 a inhibits L H - , hCG- and P G E 2 -stimulated P4 production, through inhibition of LH/hCG receptor mRNA levels and the alpha -mRNA subunit of inhibin [Luborsky et al., 1984; Bjurulf et al., 1994; Fraser et al., 1995] and/or reduction in adenylate cyclase activation [Dorflinger et al., 1984], increased P4 catabolism [Moon et al., 1986], and increased cAMP phosphodiesterase activity through P K C [Lahav et al., 1989]. PGF2a also appears to be luteotrophic under certain conditions depending on the time and concentration. During the mid-luteal phase and pregnancy, PGF2a was found to exhibit strong luteotrophic effects [Suginami et al., 1976; Khan et al., 1989; Webley et al., 1989; Michael et al., 1993]. 19 arachidonic acid Prostaglandin F2ct OH Figure 7. PGF2 ( X molecular structure. PGF2 a (bottom) is a cyclo-oxygenase product derived from arachidonic-acid (top). It is synthesized in most tissues, including the ovary, uterus, placenta, testis and other tissues where it exerts local actions. The receptor for P G F 2 a is a seven transmembrane serpentine receptor of the G-coupled receptor family. C.2. PGF2a -receptor Numerous prostanoid receptors have been identified in mammals. Amoung these is the PGF2a-R> recently cloned [Lake etal., 1994; Abramovitz et al., 1994]. Sequence analysis of this receptor suggests that it belongs to the family of G-protein coupled receptor. Transduction is linked to intracellular calcium and c A M P production [Leung, 1985; Rodway et al., 1991 et al., 1992; Currie et al., 1992; Steele et al., 1992; Lopez et al., 1995]. In non-pregnant rats, corpora lutea, thecal cells, primary and secondary interstitial cells were found to contain immunoreactive PGF2a-R. During luteolysis, cells undergoing apoptosis stained for the presence of PGF2 a -R [Orlicky et al., 1992]. The physiologically induced changes occurring during the life span of the corpus luteum are believed to be regulated by PGF2a could be related to the binding properties of PGF2a-D. Steroid hormones The two main steroids involved in the regulation of the female reproductive function are progesterone (P4) and 17B-estradiol, usually referred to as estradiol (E2). Steroids are derived from cholesterol (Figure 8). They are insoluble in water, and are transported into the circulation by proteins. The functions of P4 and E2 have been described in previous paragraphs. They mediate their actions via cytoplasmic receptors migrating directly to the nucleus and binding to regulatory elements of the targeted genes. 21 Figure 8. Progesterone and estradiol structure. Progesterone and estradiol (176-estradiol) are sex steroid hormones derived from cholesterol. V. The rat model The in vivo and in vitro models studied here were derived from the Sprague Dawley rat. General information on characteristics and biology of reproduction of the rat model are developed here. [Baker, 1979 etal., 1990; C C A C , 1984; Fox et al., 1984]. A. General characteristics A . l . Origin and development The wild brown rat (Rattus norvegicus), originating from the borders of the Caspian sea, spread with the movements of modern civilization over the Old World during the 18 m century, but did not reach North America until 1775. Laboratory rat breeding experiments were first reported from Germany (Circa 1880), and soon laboratory bred rats were brought to North America where they were first established at a Chicago laboratory for neurological studies. In 1906, some of this stock was transferred to the Wistar Institute in Philadelphia, giving rise to the present strain of Wistar rats. Nowadays, next to the laboratory mouse, the rat is the most commonly used laboratory animal, accounting for 20% of the total number of mammals used for scientific purpose. Like mice, several varieties of rats are available. The two most common are Wistar and Sprague-Dawley, both originating from US colonies and spreading world wide over the past half century. The model used in these studies was the Sprague-Dawley rat. Upon arrival, the rats are normally given one to four days for recovery, as transit, especially transport by air, is very stressful to them. [CCAC, 1984]. A. 2. Characteristics Laboratory rats, unlike wild ones, are year round breeders. Pups weigh around 5 g at birth, adult males weigh 400 to 500 g, and females 100 g less, but size and weight will vary between strains. Healthy rats will live for 2.5-3 years, depending on strains. For the purpose of these studies, Sprague-Dawley rats will be used. Their characteristics lay on the lower end of the range (Table I). B. Biology of reproduction B. l . Maturation and sexing Laboratory rats breed year round, without appreciable seasonality. Sexing pups is easily achieved by comparing the ano-genital distances between litter mates. This distance in the male is about twice that of the female. Litters are weaned at three weeks and should be segregated by sex by about seven weeks to avoid precocious breeding. Sexual maturity occurs between 6 and 8 weeks for both sexes, although the onset of the first estrus in females occurs at about 5 weeks while the vagina opens between 34 and 109 days. In the male testes descend between 15 and 51 days; however, they remain fully retractable in the adult [CCAC, 1984; Laboratory Animal Medicine, 1984]. B.2. Estrous cycle Rats are polyestrous, and will accept the male and ovulate every four or five days for a 12-14 hour period. Because vaginal changes in the rat are closely related to the estrous cycle, examination of vaginal fluid and cells provides a valuable method for determining its stages. Table II summarizes the criteria used to classify the different stages of the estrous cycle. During the estrous cycle, as for the human menstrual cycle, the rat estrous cycle is coordinated by hormonal fluctuations within the classical hypothalamo-pituitary-gonadal axis (Figure 9). However, the luteal phase of the rat is shortened unless (pseudo-)pregnancy occurs. Table I. Rat characteristics. Adult Weight Male Female 300-400 gm 250-300 gm Life span 2.5-3 years Body temperature 37.5 C Chromosome number 42 (diploid) Puberty 50 +/- 10 days Gestation 21-23 days Litter size 8-14 pups Birth weight 5-6 gm Weaning 21 days Blood volume 6 ml/100 gm body weight adapted from: Laboratory Animal Medicine, 1984] Table II . Histological changes associated with the estrous cycle. Stage Vaginal Fluids Uterus Ovary DI cornified cells and leukocytes • • regeneration of epithelium egg in oviduct DM epithelial cells and leukocytes • • e • ^ • • • • . lumen to 25mm diameter formation of corpora lutea PE small, round nucleated cells and up to 25% cornified cells <4 ® ® distention by fluid and vascilar engorgement follicle enlargement E cornified, denucleated cells c °- epithelial degeneration egg maturation; ovulation 26 CNS Ovulation Stimulus Figure 9. Hormonal levels in the female rat. During the estrous cycle, the hormonal patterns vary with the different stages of the cycle: Stimuli from the central nervous system (CNS) cause hypothalamic GnRH pulses to release LH and FSH from the anterior pituitary. Starting at the end of diestrus II, gonadotrophins induce a progressive increase in E 2 levels which, in turn, down regulate the gonadotrophins. The elevation of E 2 eventually provokes an LH peak, and the elevated LH stimulate further P4 production. Ovulation and receptivity are coincident with the peak of P4. If mating does not occur, a new cycle starts on the morning of estrus. 27 B.3. Pregnancy Fertility in both sexes is considered maximal between 100-300 days of age. Polygamous mating is commonly used and may involve from two to six females caged with one male. Males will mount estrous females numerous times in a 15 to 20 minute period, and the ejaculated semen from one to two ejaculations forms a copulatory plug that remains in the distal vagina for a few hours. Gestation length varies with strain, age, litter size (6 to 14), and ranges from 19 to 23 days (21 days on average for Sprague-Dawley) [Laboratory Animal Medicine, 1984 ]. B.4. Persistent estrus Persistent estrus describes the end of the cycling in an old female rat. Anovulation begins around 450-540 days of age, when efficient breeding life already ceased long before the onset of persistent estrus. HYPOTHESIS 28 Gonadotrophin-releasing hormone (GnRH) and its receptor (GnRH-R) are expressed in the rat ovary, where the local actions of GnRH are modulated, in part, by regulation of GnRH-R mRNA levels. SPECIFIC OBJECTIVES 1. To characterize GnRH-R mRNA expression in respect to tissue localization. 2. To define the onset of GnRH-R mRNA expression during ontogeny in the rat. 3. To reveal any variation in GnRH-R mRNA levels, in the ovary of cycling adult female. 4. To detect potential ovarian GnRH-R mRNA responses to PMSG/hCG priming treatment of immature rats. 5. To examine the in vitro effects of L H , FSH, hCG, GnRH and P G F 2 a on the levels of GnRH-R mRNA expression in granulosa cells. RATIONALE 29 Gonadotrophin-Releasing Hormone (GnRH) is primarily known as a hypothalamic hormone controlling the synthesis and release of luteinizing hormone (LH) and follicle stimulating hormone (FSH) from the anterior pituitary. Receptors for GnRH are expressed on the surface of anterior pituitary gonadotrophs. Although not totally elucidated, regulation of hypothalamic GnRH and its pituitary receptor is already well defined. Short feedback loops from the pituitary gonadotrophins, as well as auto-regulation of GnRH-receptor (GnRH-R) by GnRH, and most importantly, positive and negative feedback by ovarian steroids, regulate GnRH/GnRH-R pattern of expression and activity. With the sequencing of the mouse and human pituitary GnRH-R cDNA, and, later, the rat GnRH-R cDNA, it became possible to study the regulation of the rat GnRH-R mRNA, thus adding support to GnRH-R binding studies already performed on the pituitary receptor. However, these studies focused on the regulation of the ovarian GnRH-R mRNA. GnRH is also expressed locally in the ovary of some (but not all, e,g not in cow ovary, [Kakar et al, 1993]) mammalian species, including human and rat. The more recent concept of GnRH as an autocrine regulator of the ovarian function, and the less explored field of investigation offered by the ovarian system seemed to be able to reveal new insight in the complex mechanisms regulating the reproductive function. It is now accepted that GnRH is a local regulator of ovarian function [Massicotte et al., 1984; Clayton et al., 1988; Tsatriri et al., 1988; Sridaran et al., 1988; Leung et al., 1989; Smith et al., 1991; Srivastava et al., 1994], and is itself subjected to control from within the ovary and from the pituitary gonadotrophins. GnRH-R and its mRNA were found to be expressed locally in the ovary of the human and the rat [Huckle et al., 1988; Goubau et al., 1992; Crumeyrolle-Arias et al., 1994; Moumni et al., 1994; Kogo et al., 1995; Whitelaw et al., 1995], thus supporting the role of GnRH as a paracrine factor. Whatever levels of GnRH may be present in the ovary, a hormone requires a receptor to exert its actions. As GnRH and its receptor are coupled, the regulation of one can affect the activity of the other. Therefore, it is of great interest to study the regulation of GnRH-R expression, to more comprehensively understand the regulatory processes of regulation of the reproductive endocrine system. Thus, these studies aimed to examine the regulation of GnRH-R mRNA in the ovary of the rat, chosen for its similarity with the human ovary concerning the presence of GnRH/GnRH-R and its ease of experimentation. Tissue localization and ontogeny Although there have been numerous studies showing G n R H binding in various reproductive tissues, there is little information on the exact distribution of GnRH-R mRNA. Therefore, it is of great interest to study the synthesis, occurrence and cell-specific distribution of this receptor molecule. In these studies, GnRH-R mRNA expression was localized to various tissues, and ontogeny of this mRNA was established in the rat pituitary and gonads. Cycling rat In the ovary, local production of GnRH is considered to act differentially during follicular maturation, stimulating basal steroidogenesis but inhibiting gonadotrophin-induced P4 production. Moreover, GnRH induces the expression of P4 receptors in rat granulosa cells [Natraj et al., 1993] and is capable of inducing oocyte release [Ekholm et al., 1981], oocyte maturation [Hillensjo et al., 1980] and luteinization [Massicotte et al., 1984]. GnRH is primarily known to exerts its effects through a specific receptor, present in the pituitary [Eidne et al., 1992], where GnRH of hypothalamic origin exerts its primary effects. However, receptors are also present in the ovary [Latouche et al., 1989] where their expression, as it is the case in the pituitary, might be affected and regulated by different factors such as E2 levels [Gregg et al., 1989] or its own ligand, GnRH. Since it is not known whether GnRH-R mRNA levels are actually similarly regulated at different stages of the estrous cycle, it is important to demonstrate any differential regulation during the adult female rat reproductive cycle. Peri-ovulatory PMSG/hCG induced ovulation 31 In several species including the rat, the number of pituitary GnRH binding sites have been observed to increase during the proestrous period immediately prior to the ovulatory surge [Bauer-Dantoin et al., 1993]. Since it is not known whether GnRH-R mRNA levels are similarly regulated prior to, during or following ovulation in the rat ovary, the study of in vivo expression of the ovarian GnRH-R was undertaken. Although the normal adult female is physiologically unaltered, detection of variations in GnRH-R mRNA levels in the whole ovary at a particular stage of follicular development may be masked by the presence of other follicles at different developmental stages. Thus, a synchronized model for follicular development, ovulation and luteinization (the PMSG/hCG immature rat model) is more likely to reveal alterations in mRNA levels. Granulosa cell models Based on the previous findings that GnRH-R mRNA is actually dramatically and transiently down-regulated after an ovulatory dose of hCG in PMSG primed immature rats, in vitro studies were designed to determine the influence of potential regulators of GnRH-R gene expression in pre-ovulatory rat granulosa cells. In a first series of experiments, FSH/androstenedione pre-treatment was applied to granulosa cell culture with the belief that it would promote further cellular development in vitro and still maintain the cells in a pre-ovulatory state. In a second series of experiments, the granulosa cell cultures did not receive FSH/androstenedione pre-treatment and were obtained 56 hours after P M S G treatment instead of 48 hours. This model is less manipulated than the first one and may be more representative of an ovulatory state. MATERIALS AND METHODS 32 I. Steroid assays A. Progesterone RIA Serum steroids were measured using a 1 2 5 I - R I A kit. (Diagnostic Systems Laboratory), while media from cultured granulosa cells were assayed by a specific [ 3H]RIA as described below. Progesterone-RIA was performed as previously outlined [Leung et al., 1979]. Briefly, the assay used rabbit P4 antisera (P4-2; Kindly provided by D.T. Armstrong, University of Western Ontario) raised against 4-pregnen-6B-ol-3, 20-dione hemisuccinate: bovine serum albumin conjugate (Steraloids, Wilton, NH). The final antisera concentration was 50 pig/ml. A standard competition method was employed, utilizing P4 (Sigma) standards, and 3 H -P4 at 10,000 cpm/tube (Amersham). The range of the assay standards was from 0.5 to 128 ng/ml. A 0.04 M phosphate buffer (pH 7.4) was used for diluting samples and controls with a final assay volume of 600 / b 0i s-125 - s T00H c I |S CO Sj i 5 •I- o e > o 75 4 50 H 25 H a a RT-PCR / Southern blot HI Northern blot • ab T ab T b b T -T T Control PMSG PMSG PMSG +hCG,12h +hCG,48h Figure 2 3 . Northern versus Southern. Northern blotting and RT-PCR/Southern hybridization were used to confirm the presence of GnRH-R in the rat ovary and pituitary (A 1. and A 2.) and quantify variations between different stages or treatments of a tissue, such as ovary in the present experiment (B). Both techniques were equally efficient in detecting GnRH-R transcript or quantifying them, although Northern blotting required higher yields of RNA. Thus, when hybrydization was necessary, Southern blotting was preferred over Northern because RNA yields obtained from the samples studied were often low. III. Sequencing of a portion of the ovarian GnRH-R 71 The cDNA sequence for the rat GnRH-R being unknown at the beginning of this study, in 1992, the primers used to amplify a portion of the rat GnRH-R cDNA were derived from the murine cDNA sequence [Reinhart et al., 1992]. TM1+ (5' CTGCCTTCAATGCTTCCTTC 3') and TM6- (5' ACATAGTAGGGAGTCCAGCA 3') The PCR amplification generated a 703 bp product. Sequencing revealed a 663 bp (703-[2x20]) cDNA sharing 9 3 % of homology with the reported sequence from the mouse pituitary GnRH-R (Figure 24). Since then, it was verified to be identical to the published rat pituitary GnRH-R sequence [Kakar et al., 1994]. •Rof 24 TTGGTAAAGCTGCAGAGGTGGACCCAGAAGAGGAAGAAAGGAAAAAAGCT 73 rf III i i l i u m 1 1 i n i I I i i i i i i i i i i i i i i i i i i i n i i . . . MOUSe 211 TTGTTGAAGCTGCAGAAGTGGACTCAGAAGAGGAAGAAAGGAAAAAAGCT 260 74 CTCAAGGATGAAGGTGCTTTTAAAGCATTTGACCTTAGCCAACCTCCTTG 123 l l l l l l l l l l l l l l l l l I I I I I I I I I I I I M l l l l l l l l l l l l l l II 261 CTCAAGGATGAAGCTIXKTTITAAAGCATTTGACCTTAGCCAACCTGCTGG 310 124 AGACTCTAATCGTCATGCCGCIXWATGGGATGTGGAATATCACTGTTCAG 173 I l l l l l l l l l l l l l l l l l l l l l l l l l l l i l i l l l l l l l l l l l l l l l ! 311 AGACTCT^TCGTCATGCCACTGGATGGGATGTGGAATATTACTGTTCAG 360 174 TGGTATGCTGGAGAGTTCCTTTGCAAAGTTCTCAGCTATCTGAAGCTCTT 223 l l l l l l l l l l l l l l l l l l l II l l l l l l l l l l l l l l l l I I l l l l l l l l 361 TX^TATGCTGGGGAGTTCCTCTGCAAAGTTCTCAGOTATCTGAAGO^r^ 410 224 CTCTATGTATGCCCCAGCCTTCATGATGGTGGTGATTAGCCTX3GATCGCT 273 I I l l l l l l l l l l l l l l l l IIIIIIIIIIIIIIIIIIIIIIIIII Mil 411 CTCTATGTATGCCCCAGCTTTCATGATGGTGGTGATTAGCCTGGACCGCT 460 274 CCCTGGCCGTCACTCAGCCCTTAGCTGTCCAAAGCAACAGCRAGCTTGAA 323 l l l l l l l l l l l l l l l l l l l I l l l l l l l l l l l l l l l l l l l l l l l l 4 61 CCCTGGCCATCACTCAGCCCCTKKTTGTACAAAGCAACAGCAAGCTTGAA 510 324 CGGTCTATGACCAGCCTAGCCTrGGATTCTCAGCATTGTCTTTGCXjGGACC 373 I l l l l l l l l l l l l l l IIIIIIIIIIIIIIIIIIIIIIIIII l l l l 511 CAGTCTATGATCAGCCTGGCCTGGATTCTCAGCATTGTCTTTC 560 374 ACAGTTATATAACTTCAGGATGATCTACCTAGCAGACGGCTCTGGGCCAG 423 . l l l l l l l l l l l l l l l l I I I l l l l l l l l l l l l l l l l l l l l l I I I II II 561 ACAGTTATATATCTn^GGATGATCTACCTAGCAGACGGCTCTGGGCCCA 610 424 CAGTTTTCTCGCRATGTGTGACCCACTGCAGCTTTCCtSCAATGGT^ 473 l i l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l II l l l l l l l l l 611 CAGTCTTCTCGCAATGTGTGACCCACTWIAGCTTTCCA^ 660 474 GAAGCCTTCTAOU^CTTTTTCACCTTCAGCTGCCTGTTC^TCATCCCTCT 523 I l l l l l l l l l l l l l l l l l I H U H I l l l l l l l l l l l l l l l l l II 661 CAGGCCTTCTACAACTTTTTCACCTraXSCTGC 710 524 TCTCATCATGCTAATCTGCAATX^CAAAATXIATCTTCGCCCTCACACGAG 573 l l l l l l l l l l l l l l l l l I I I IIIIIIIIIMIII I II l l l l l l l l l 711 CCTCATCATGCTAATCTGCAATGCCATVAATCATCTTTGCIXnXlACGCGAG 760 574 TCCTTCATCAGGACCCACGCAAACTACAGCTGAATCAATCCAAGAATAAT 623 l l l l l l l l l l II III I I I I I I I l l l l l l I l l l l l l l l l l l l l l l l l l 761 TCCTTCATCAAGACCCACGCAAACTACAGATGAATCAGTCCAAGAATAAT 810 624 ATCCCAAGACGACGGCTGAGAACTCTAAAGATGACA^^^XX1ATTTGCCAC 673 l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l : : l l l l l II II 811 ATCCOUIGAGCTCGGCTGAGAACGCTAAAGATGACAGTCGCATTCGCTAC 860 674 CTCCTTTGTCATC 686 l l l l l l l l l l II 861 CTCCTTTGTCGTC 873 Figure 24. GnRH-receptor partial cDNA sequence: rat versus mouse. The high degree of homology expected between those two species was confirmed after the sequencing of a partial GnRH-R cDNA sequence. The cDNA obtained was used for Southern and Northern blottings. RESULTS - CHAPTER II Detection of GnRH-receptor mRNA 73 I. Tissue localization of GnRH-receptor expression Amplification of GnRH-R transcripts, from two sets of rat cDNA, generated fragments corresponding to the expected product (703 bp) in the following tissues (Figure 25): Total brain, pituitary of cycling rats, lung, kidney, adrenals, uterus of cycling rats, ovary, corpus luteum, oviduct, testis, ventral prostate, and epidydimis. However, no expression of GnRH-R mRNA was detected, even after a 2 week exposure of the autoradiograms, in the following tissues: cerebellum, whole hypothalamus, pituitary of pregnant animals, heart, iliopsoas (muscle of the leg), mammary gland, duodenum, ileum, colon, spleen, liver, pancreas, placenta, or the uterus (of pregnant or lactating animals), p-actin PCR amplified a product in all samples. II. Ontogeny of GnRH-R expression In the rat pituitary (Figure 26-27), the transcript appeared to be present, as early as 8 days old, with a progressive increase in transcripts with age (5-fold increase by adulthood). In the female gonads (Figure 26-27), the GnRH-R transcript was hardly detectable in the early neonatal animal (day 6). In the gonads, a rapid increase in GnRH-R transcripts occurred, with testicular and ovarian transcripts increasing 2- and 20-fold, respectively, by puberty. Both pituitary and gonadal GnRH-R mRNA seem to follow a similar pattern. 74 Figure 25. GnRH-receptor tissue localization in the rat. Cycling (C); pregnant (P), days of pregnancy 16 or 18 (P16, P18); lactating (L). GnRH-R was found to be expressed in different reproductive tissues of the male and female rat, as well as other steroidogenic or steroid-sensitive tissues, as revealed by Southern blottings. 75 Pituitary 8 22 30 40 A B Ovary 6 8 11 15 19 22 30 40 A Testis 6 8 19 A Figure 26. GnRH-receptor ontogeny - Southern blot of pituitary, testis and ovaries. Southern blots of pituitary, ovary and testis samples from rats of different ages (in days; A = adult) showed a progressive increase in GnRH-R expression in the pituitary, ovary and testis. 76 Figure 27. GnRH-receptor ontogeny - Graph of scanned autoradiogram. Graphed scan of the autoradiographed Southern blots of pituitary, ovary and testis samples from rats of different ages (in days) showed a progressive increase in GnRH-R expression in the pituitary, ovary and testis. RESULTS - CHAPTER III Quantification of GnRH-receptor mRNA in vivo 11 I. Cycling female Sprague Dawley (SD) rat A. GnRH-receptor mRNA expression in the ovary and pituitary The results from 7 different animals per stage (mornings of each day of the cycle) showed that during the estrous cycle, levels of GnRH-R mRNA in the pituitary were found to be at their lowest on the morning of the estrus. Levels rose thereafter, until the morning of the second day of diestrus, up to almost 2 times that of the estrus, and declined again towards the next estrus (Figure 28). In the ovary, no significant changes in GnRH-R mRNA levels could be detected with the sampling of stages studied (Figure 28). P-actin mRNA did not display any variations for at any stage in the tissues examined. B. Serum progesterone and estradiol measurements Serum P4 and E 2 levels were determined by radioimmunoassays. Serum P4 levels were increased by 2.2 to 3 fold between diestrus I and proestrus, and fell down to the level of diestrus 1 by the morning of estrus. Serum E 2 levels were at their highest on the morning of proestrus and dropped by 2 times by the next diestrus period (Figure 29). 78 0 a. V- g e 01 o CD < _^ z ° o c ^ 150 100H B i a> o cn al cu > cx — c < CD Z c c o E (0 o a 150 100' 50 -\\ T 0-^— r * a n=7 1 1 f T DI Dll PE E Stages of the estrus cycle Figure 28. GnRH-receptor mRNA expression in the ovary and the pituitary of the cycling rat. RNA from pituitaries and ovaries was obtained from cycling adult rats at different stages of the estrous cycle, and subjected to RT/PCR and Southern blotting. GnRH-R mRNA levels were quantified from the autoradiograms of the pituitary (A) and the ovary (B) samples. Diestrus I was arbitrary chosen as the 100% control level. In the pituitary, GnRH-R exhibit lower levels during estrus, but no significant changes were observed in the ovary. (p<0.05; a*b*c) 79 cu c o *J o to L. p O cu CD 400 300 H 200 H iooH Dll T PE n=7 B o o LU O CU cn 200 150H 100 H Stages of the estrus cycle Figure 29. Steroidogenesis in the cycling rat. Normal, cycling adult rats were sacrificed in the morning of each day of the estrous cycle, as determined by vaginal smears. Serum P4 (A) and E 2 (B) were measured with a [ 1 2 5 I]RIA kit. Diestrus I was arbitrary chosen as the 100% control level. Variations in the serum steroid levels reflect the normal profile of adult cycling rats for the morning of each day, although the P4 surge was not detected due to the time-points assayed (p<0.05; a*b). II. In vivo studies in the PMSG/hCG synchronized model 80 A. Ovarian and pituitary GnRH-receptor mRNA levels In the pre-ovulatory ovary following P M S G induced follicular differentiation, no statistically significant changes in the levels of GnRH-R mRNA levels occurred when compared to saline-treated controls. However, in the ovulatory group (12 hours after hCG administration), a dramatic reduction to levels down to 30 % of those seen in control animals was detected. In the post-ovulatory ovary, GnRH-R mRNA levels rose again to two-fold higher than those seen during ovulation (Figure 30). In pituitaries of pre-ovulatory animals, levels of GnRH-R mRNA were considerably reduced when compared to controls. hCG treatment did not affect GnRH-R mRNA abundance at 12 hours after hCG injection. However, by 48 hours after hCG injection, the levels returned to those seen in the controls (Figure 30). B. Serum steroid levels In order to correlate changes in GnRH-R expression with circulating steroid levels, serum concentrations of P4 and E2 were measured (Figure 31). The decrease in pituitary GnRH-R mRNA levels in the pre-ovulatory group occurred despite a significant increase in serum E2, whereas ovarian GnRH-R expression pattern was found to be inversely related to serum P4 levels (Figure 31). 81 125 B < z O E -t-j £Z L. O O o V-Cl O CD o &€ a to i - or 3 CD Q. 150 1004 50 H n=8 b b I ts to Z CM C9 (J + ts to r CO ts u + to Figure 30. peri-ovulatory expression of GnRH-receptor. Ovarian (A) and pituitary (B) expression of GnRH-R mRNA during the peri-ovulatory period was studied by RT-PCR/Southern blotting. Groups were obtained as described in materials and methods and summarized in Figure. 13. In the ovary, PMSG/hCG treatment lowered the levels of GnRH-R mRNA down to 30% after 12 hours. After 48 hours following hCG injection, GnRH-R mRNA levels gradually returned to levels closer to the control. In the pituitary, PMSG alone down-regulated GnRH-R mRNA levels to the same degree of PMSG/hCG treatment and GnRH-R returned to control levels by 48 hours after hCG injection. (p<0.05; a*b*c) 82 B Figure 31. Peri-ovulatory steroid levels. Serum concentrations of P4 (A) and E 2 (B) were measured using [ 1 2 5I] RIA kits (Diagnostic Systems Laboratory Inc. Webster, TX) . Groups are as in Figure 13. Treatments cause P4 to rise with a maximum level 12 hours after hCG injection (corresponding to a stimulated ovulation) while E 2 levels peak 48 hours after P M S G injection (corresponding to a proestrus stage). (p<0.05; a*b*c) RESULTS - CHAPTER VI Quantification of GnRH-receptor mRNA In vitro I. Studies in the granulosa cell model I A. Effects of LH, FSH and GnRH on progesterone production To verify that the in vitro culture system of rat granulosa cells is sensitive to treatment with FSH (ovine), L H (ovine), and GnRH, cells were isolated from PMSG-primed immature rats and cultured with a low concentration of FSH (50 ng/ml) and androstenedione (10~7M) to stimulate a pre-ovulatory phenotype. Under these conditions, the cell viability routinely assessed by exclusion of trypan blue exceeds 90% in plated and washed cells after a 24 hour pre-incubation period. As expected, these cells responded to treatments with L H and FSH with a 10-fold increase in P4 output, while GnRH inhibited P4 production compared to the control. The assumption that GnRH-R is also expressed by those cells is corroborated by the finding that GnRH, when added in conjunction to L H or FSH, completely abolished the response of P 4 synthesis to gonadotrophins. (Figure 32). 84 Figure 32. Progesterone output in FSH pre-treated cultured granulosa cells. This graph shows the effects of a 24-hour treatment period with LH, FSH, or GnRH alone or in combination, on P4 production (measured by [3H] RIA) by FSH-pretreated pre-ovulatory granulosa cells. The gonadotrophins cause a significant increase in P4 production while GnRH inhibits basal production and gonadotrophin-stimulated production. (p<0.05; a*b*c) B Time- and concentration-dependent effects of LH To assess the time-course effect of a high concentration (1 pig) of L H , mimicking the situation seen after an endogenous L H peak, total RNA from granulosa cells cultured for periods of 3, 5, 9, 12, 24 and 48 hours were isolated and assayed for abundance of GnRH-R mRNA. The levels of GnRH-R mRNA did not change significantly until 12 hours after stimulation with L H , when they dropped to 25% of the levels seen at 0 hour. The levels of GnRH-R mRNA remained low at 24 hours, and returned to the levels seen at 0 hour by 48 hours after application of the L H treatment (Figure 33). The decrease in GnRH-R mRNA levels correlated with drastic increases in P4 output, but preceded the increase in E 2 synthesis occurring at 24 hours (Figure 34). The levels of GnRH-R mRNA were found to decrease with increasing concentrations of L H , reaching their minimum of 40 % compared to the untreated control for a L H concentration of 100 ng/ml (Figure 35). This down-regulation of GnRH-R occurred concomitantly with increases in P4 and E 2 (Figure 36). C. Effects of FSH The possibility of a more general gonadotrophin-induced regulation of GnRH-R mRNA levels was further tested by 24 hour treatments with increasing concentrations of FSH. However, in repeated experiments, no change was seen in GnRH-R transcripts abundance compared to the expression of G3PDH (data not shown), while both P 4 and E 2 responded to F S H treatment with an increase in production, as is it the case with L H treatment (data not shown). Figure 33. L H time-course effects on GnRH-R mRNA levels. Time dependent effects of L H on GnRH-R mRNA levels, quantified by RT-PCR/Southern blot hybridization. Cells were exposed to L H (lOOOng/ml/well) for up to 48 hours. GnRH-R mRNA levels were plotted as a function of time. L H down-regulated the mRNA with a maximum efficacy after 12 hours of treatment. After 48 hours, GnRH-R mRNA returned to control levels. (p<0.05; a*b*c) 87 Time (hour) Figure 34. L H time-course effects on steroidogenesis. Time dependent effects of lOOOng of L H on P4 (A) and E 2 (B) show a progressive accumulation of both steroids (measured by [ 3H] RIA). P4 seems to plateau after 24 hours, and even be partially metabolized or degraded by 48 hours. (p<0.05; a*b*c) 88 A LH (ng/ml) M 0 0.1 1 10 100 1000 G3PDH GnRH-R B 125 < z 1 0 0 -E -u o 75-; o •*-> a. O o 5 0 -u < » — • a> o L. 1 &€ c CD 0 J T a T Contro l 0.1 a 1 o n=5 T 100 1000 LH (ng/ml) F igu re 35. Effects of increasing concentration of L H on GnRH-R m R N A levels. Concentration dependent effects of L H on GnRH-R mRNA level were quantified by RT-PCR/Southern blotting. Cells were exposed to L H (0.1 to lOOOng) for 24 hours. GnRH-R mRNA levels were measured. A shows the gel of one representative experiment (GnRH-R and the control gene G3PDH run together on the same gel) and B is a graph of the relative quantities of GnRH-R product for the pooled experiments (n=5). Both show a concentration dependent decrease in the levels of GnRH-R. G3PDH does not show any significant variation from one treatment to another. (p<0.05; a*b*c) 89 B CD ^ * J o CO U O) o 1000H • o L. o o o CO o ioo -d 400 300 H 200 H 100 H Control 0.1 1000 LH (ng/ml) Figure 36 . Effects of increasing concentration of L H on steroidogenesis. Cells were exposed to L H (0.1 to 1000ng) for 24 hours and P 4 (A) and E 2 (B) levels were measured by [ 3H] RIA. Both P 4 and E 2 exhibited a concentration dependent increase up to 3 times control values for E 2 and 20 times for P4. (p<0.05; a*b*c*d) D. Effects of GnRH GnRH has been postulated to directly influence the synthesis of its own receptor in the pituitary. The possibility of this phenomenon occurring in the ovarian cell was, therefore, also assessed. With increasing concentrations of GnRH, ranging from 10 p M to 10 }AM, a concentration dependent up-regulation of GnRH-R gene expression was seen, with a maximal stimulation of 2.4-fold occurring at 1 JAM (Figure 37). GnRH-induced changes in GnRH-R mRNA levels were inversely related to R4 output for GnRH concentrations up to 10-^M (Figure 38). Estradiol levels were not measured as androstenedione was not provided with the treatments. 91 300 n=5 250 H c DC E ~ 200 4 2 c 150H a. o Q) U cu o 100H I c CO 50 H a Control 1 1 a 1 o ab b 9 8 GnRH TO' XM 6 b Figure 37. Effects of increasing concentration of GnRH on GnRH-R mRNA levels. GnRH (10- 1 1 to 10\"5M) effects on GnRH-R mRNA expression were quantified by RT-PCR/Southern blotting after a 24 hour treatment period. GnRH increased the mRNA levels of its own receptor at concentrations from 1 0 7 M . (p<0.05; a*b;*c) 92 Figure 38. Effects of increasing concentration of GnRH on steroidogenesis. GnRH effects on P4 production (measured by [3H] RIA) after a 24 hour treatment period are shown. GnRH inhibited basal P4 production down to 50% of the control. (p<0.05; a*b*c*d) II. Studies in the granulosa cell model II The effects of different hormonal treatments on rat granulosa cells were further investigated in a slightly different cell model. Details of the protocol used for this granulosa cell model are described in the methodology section. Briefly, PMSG primed immature female rats were sacrificed 54 hours after injection (prior to ovulation). Cells were recovered from the ovaries and pre-incubated for 24 hours in the presence of FBS (10%), and antibiotics (Penicillin and streptomycin, 1%) before receiving treatments. Figure 39 shows the ovaries of control, immature animals compared to the ovaries of a PMSG treated animal. Figure 40 shows the appearance of granulosa cells (derived from Model II) in culture. A. Effects of culture time on granulosa cells differentiation To investigate the effects of time on granulosa cell differentiation, cultures were carried out for 1, 2, 3 or 4 days before receiving treatment for a 24 hour period. The medium was changed daily with DMEM:F12 containing 2% FBS (and antibiotics) for the rest of the pre-culture period. Samples were treated as usual, and R N A extraction was carried out simultaneously. Overall RNA concentrations, as determined by spectrophotometry, were compared between the four days (Figure 41). Over the course of the four days, total RNA levels increased by 33%. Progesterone output was assayed following a 24 hour treatment period with hCG (1 IU/ml), GnRH (IO - 9 M) or hCG plus GnRH. The cells pre-cultured for one day only responded to all treatments with dramatic increase in P4 secretion. The cells for which a longer recovery time was allowed did not respond to any of the test treatments (Figure 42). Hence, for further studies, the cells were only allowed a 24 hour recovery period before receiving treatments. 94 Figure 3 9 . Ovaries of control (immature) and PMSG treated rats. Immature Sprague-Dawley female rats (25 days old) were sacrificed and the genital tract removed for comparison with animals treated with 10 IU PMSG, and sacrificed after 48-54 hours. Pictures show: ( A . l ) the whole genital tract of the control female and (A . 2) one of her ovaries at higher magnification; (B. 1) the whole genital tract of the treated female and (B. 2) one of her ovaries at higher magnification. 95 Figure 40. Granulosa cell culture. Granulosa cells were obtained as described in figure 15 (Model II). The appearance of those cells after a 24 hour recovery period is shown here. (Note the presence of an oocyte). 96 • o cu t-l < 12.5 10.0H 7.5H 5.0 H 2 . 5 H 0.0 Days of culture before treatment Figure 41. RNA quantification after 1 to 4 days of culture. Granulosa cell cultures were undertaken for different periods of time (1, 2, 3 or 4 days before treatment). Total RNA was extracted and quantified by spectrophotometry. The total amount of RNA extracted increased over the period of culture time for the same cell density initially plated. (p<0.05; a*b*c) 97 100 -T i i i i c o n t r o l h C G G n R H h C G / G n R H Figure 42. Basal and hCG-stimulated P4 production after 1 to 4 days of culture. Basal P4 production, as well as P4 output from hCG and/or GnRH treated granulosa cells was measured after 1 to 4 days of pre-culture followed by 24 hours of treatment. Progesterone production was stimulated by all treatments only in DI cultures, while D2 to D4 cultures did not respond to any treatments, and the basal levels of P4 production even decreased over time. B. Time-course effects of experimental treatments on mRNA levels In order to choose the length of treatment that would show when regulation of the mRNA of interest occurs, time-courses of hCG and GnRH treatments were performed. Treatments with hCG were prepared at the concentrations of 0.1,1 and 10 IU/ml, and GnRH was made up at 10\" n , IO - 9 and IO - 6 M. Treatments were applied for 3,6,18 or 36 hours, after which samples were processed as before. Figure 43 shows the time-course effects of GnRH on its own mRNA. No effect was seen after 3, or 6 hours, but 18 hours of treatment displayed a strong response in the variation of GnRH mRNA levels, with a maximal increase in expression at IO - 9 M of GnRH. A treatment period of 18 hours seemed appropriate for the different mRNA investigated and for the different treatments applied, and was therefore chosen for the rest of the study (other time-course data showed the same tendency). Control 11 9 6 GnRH 10\" X M Figure 43. GnRH time-course effects on GnRH mRNA levels. To determine the optimum length of treatment showing the maximum effect on mRNA levels, time-course experiments were undertaken with different concentrations of different treatments over a period of time ranging from 3 to 36 hours. This representative experiment (out of 3) shows that the effects of GnRH on its own mRNA as quantified by RT-PCR are maximum after 18 hours when GnRH mRNA levels increase in a bell curve-like fashion in response to GnRH, with maximum stimulation at lfJ-^M. After 3 or 6 hours of treatment, no effect could be detected, and by 36 hours of treatment the response had disappeared. For subsequent cultures, 18 hours was chosen as a treatment period. C. Effects of GnRH, PGF 2 a and hCG 100 When cells were exposed to GnRH, PGF2 a and hCG, alone or in combination, GnRH-R and PGF2 a -R mRNA, as well as steroidogenic activity were found to be altered differentially: Both concentrations of GnRH tested (IO\"9 and IO\"6 M) increased GnRH-R mRNA levels up to 170% compared to the untreated control. The lower concentration of P G F 2 a ( IO - 9 M) , but not the highest (10\"6 M), inhibited GnRH-R mRNA expression, while the combination of GnRH and P G F 2 a did not alter control levels. Treatment with hCG (1 IU/ml) greatly increased GnRH-R mRNA levels (by 2.5-fold), but when in combination with GnRH, PGF2 a o r both, levels returned to those of the control (Figure 44). The mRNA levels of P G F 2 a - R were unaltered by the lower concentrations of GnRH and P G F 2 a > alone or in combinations. Higher concentrations of GnRH or PGF2a> however, increased PGF2 a -R mRNA levels by 3.2- and 1.6-fold, respectively (Figure 45). None of the treatments affected p-actin mRNA levels, suggesting that the variations observed for GnRH-R and P G F 2 a - R mRNAs are specific (Figure 46). Progesterone production was found to be stimulated by GnRH (up to 2.6-fold), but not P G F 2 a - In combination with GnRH, PGF2 a did not alter P4 response to GnRH. hCG, alone or in combination with GnRH and/or PGF2 a, increased P4 production (by almost 2.5-fold by itself), although combined treatments were less effective than hCG alone (Figure 47). Estradiol production was unaffected by single treatments of GnRH or PGF2 a , but was stimulated equally by all combinations of treatments (Figure 48). 101 B 300' (A > L. !! Q£ o c CD n=4 250 H 200 H 150 H 100 Hi 50-J T Control l T1-\" 0\"9M T1— GnRH Lv LD Q. x * e u (J flu n=4 T Control a a 10-9M e LP Ik QL n=4 = J QE U -C LP U CL h C G , 1 I U / m l T Control I 10\"6M at LD CL Figure 44. Effects of GnRH, P G F 2 a and hCG on GnRH-R mRNA levels. Cells were exposed to hCG, GnRH and P G F 2 a , alone or in combination and the effects on GnRH-R mRNA levels were measured by RT/PCR. hCG, GnRH or PGF2a (10' 9M) increased the levels of GnRH-R mRNA while a lower concentration of P G F 2 a had no effect. In combination with hCG, GnRH and/or P G F 2 a down regulated hCG-stimulated GnRH-R mRNA levels (for each separate graph, p<0.05; a*b*c). 102 B 200 • cn > — 03 O Z O U o < n=4 150 H 100 H, 5 0 - H a T i Contro l ! a T i r IO-9M OC e Ts ts n=4 T Control 5? a T 1 • a T I n=4 10-9M I GnRH LL. LP CL X * QC L_ e ta ts CL h C G , 1 I U / m l a T i Control I OC c 19 1Q-6M u . U CL Figure 45. Effects of GnRH, P G F 2 a and hCG on P G F 2 a - R mRNA levels. Cells were exposed to hCG, GnRH and PGF2a» alone or in combination and the effects on P G F ^ R mRNA levels were measured by RT/PCR. High concentrations ( lO^M) of GnRH or PGF2a increased the mRNA levels of P G F 2 a - R while hCG, alone or in combination with GnRH and/or PGF20: had no effect on mRNA levels, (for each separate graph, p<0.05; a*b*c). 103 B CO > CO E CJ < 200 • 150 H g ioo H © 50 H 0 n=4 T Control a T a T l(r9M oe e CS Jl cs O. r ° ks Q-n=4 Control a T a T I i r — r 10\"9M n=4 r Control I a T K i r-10\"6M Of c CS tS CL C tS ts L> ts CL h C G , 1 I U / m l Figure 46. Effects of GnRH, PGF2 a and hCG on p-actin mRNA levels. Cells were exposed to hCG, GnRH and PGF2a, alone or in combination and the effects on p-actin mRNA levels were measured by RT/PCR. Treatments had no effect on p-actin mRNA levels. 104 h C G , 1 I U / m l Figure 47. Effects of GnRH, P G F 2 a and hCG on progesterone production. Cells were treated as in Figure. 44 and the effects on P4 were measured by RIA. hCG and GnRH, but not PGF2 a increased P4 production while GnRH and/or P G F 2 a in combination with hCG decreased stimulated P4 output to levels higher than basal (for each separate figure, p<0.05; a*b;*c). 105 B _ o 250 200 H 150 H lOOHpJL Figure 48. Effects of GnRH, PGF2 a and hCG on estradiol production. Cells were treated as in Figure 44 and the effects on E 2 were measured by RIA. Estradiol production was stimulated by hCG, alone or in combination with GnRH and/or PGF 2 c t, but GnRH and/or PGF2 a had no effect on their own. (for each separate figure, p<0.05; a*b). D. Effects of hCG Treatments with hCG increased GnRH-R and PGF2 a-R mRNA levels, with rises of 3.4 and 2.3 times the control, respectively (Figure 49-50). The levels of p-actin were unaffected by the treatments (Figure 50). Progesterone and estradiol output rose in response to hCG treatments (Figure 51). E. Effects of GnRH When cells were treated with GnRH, stimulation of GnRH-R mRNA was observed. Levels rose up to 160 % in a concentration-related manner (Figure 52). In this set of experiment, the variability of the response to hCG was high, thus not showing the stimulation observed in other experiments because of the large error bar. Levels of GnRH mRNA were reduced to half the control levels at higher concentrations of GnRH (IO - 6 M) , while mid-range concentration (IO - 9 M) slightly simulated them (1.35-fold) (Figure 53). The mRNA levels of PGF2 a-R were increased by GnRH treatment up to more than 3-fold at 10\"6 M (Figure 53). p-actin mRNA levels were unaltered by the treatments (Figure 54). GnRH was found to stimulate P4 (Figure 55) up to levels comparable to hCG-stimulated production (close to 3-fold), but not E2 production (Figure 55). 107 w * \"5 L. o c CD 400-300 H 200 • 100 H n=4 1 r Control .001 .01 b i hCG, IU/ml be 10 Figure 49 Effects of increasing concentration of hCG on GnRH-R mRNA levels. Cells were treated with increasing concentrations of hCG and effects on GnRH-R mRNA level were quantified by RT-PCR. GnRH-R mRNA levels were increased by increasing concentrations of hCG, with a maximum stimulation at 0.1 IU/ml (p<0.05; a*b*c). 108 to > 0) 250 H n=3 200 H ab E u CM CD CL B 150 H ioo H i 50 H T Control m , s s S • s , \\ \\ s s s \\ \\ s s s , \\ \\ / / / , \\ \\ / / / \\ \\ , \\ X / / s V .001 .01 hCG, IU/ml 10 > c CJ ^ < 200 • 150 H a ioo H 50 H n=4 a a a r ' \" i Control .001 .01 .1 hCG, IU/ml 10 Figure 50. Effects of increasing concentration of hCG on PGF2 a -R mRNA and p-actin mRNA levels. Cells were treated with increasing concentrations of hCG and effects on PGF2 a -R (A) and p-actin (B) mRNA level were quantified by RT-PCR. PGF2 a -R mRNA levels were increased by increasing concentrations of hCG, while treatments had no effect on p-actin mRNA (p<0.05; a*b). 300 • B _ o to o n=4 250 H ^ 2 0 0 H 150 H loo H 50 H control .001 hCG, IU/ml Figure 51. Effects of increasing concentration of hCG on steroidogenesis. Granulosa cells were exposed to hCG (10 /dU/ml to 10 IU/ml) for 18 hours. Concentration dependent effects of hCG on P4 (A), and E 2 (B) were quantified by pH]RIA. hCG increased both P4 and E 2 in a concentration dependent manner, with stimulations close to 300% for both steroids (p<0.05; a*b*c*d). 110 (ft > 0) a E a i z oi c CD 225 200 -175-£ 150 • 5 125' u ^_ 100-1 o W 75 50 -| 2 5 -0 n=4 ab ab i 1 r control hCG 11 h b b 3 b u T b GnRH, 10\" X M Figure 52. Effects of increasing concentration of GnRH on GnRH-R mRNA levels. Cells were exposed to hCG (1 IU/ml) or GnRH (10\"1 1 to lO^M) and concentration dependent effects of G n R H on GnRH-R mRNA levels were measured by RT/PCR. GnRH increased the expression of its own receptor by more than 50% over the control levels. In this experiment, hCG did not significantly stimulate GnRH-R (p<0.05; a*b). I l l > 01 c CD 175-150 H ~ 1 2 5 1 z ° s « E o IOO H 75' 50> 25 0 n=3 be T T be control hCG 11 10 ab G n R H , 10 \" X M Figure 53. Effects of increasing concentration of GnRH on GnRH mRNA levels. Cells were exposed to hCG (1 IU/ml) or GnRH ( I O 1 1 to 10-°M) and concentration dependent effects of GnRH on GnRH mRNA levels were measured by RT/PCR. GnRH inhibited its own mRNA. hCG was found to inhibit GnRH mRNA (p<0.05; a*b*c). 112 to > 350 -300 -250 -O Di E Di 8 OJ Li. LD CL. O CJ o B to > co < c Di E < o o <«-o 200-150-100-50-0 n=3 be b T ab T ^ 1 control hCG 11 10 be GnRH, 10- XM 200-j 175-150 -125-100-75-50-25-0 -n=3 T a de-control hCG 11 10 GnRH, 10\" XM X X ' • -X X X X f X J X x ' S 4 X X • * 4 X X ' S 4 x X ' • 4 X X ' X J X X • X J X s i i a F igure 54. Effects of increasing concentration of GnRH on P G F 2 a - R mRNA and p-actin mRNA levels. Cells were exposed to hCG (1 IU/ml) or GnRH ( I O 1 1 to lO^M) and concentration dependent effects of GnRH on PGF2 a -R mRNA levels (A) were measured by RT/PCR. p-actin (B) was measured as a control for the different genes quantified. GnRH increased PGF2 a -R mRNA levels in a concentration dependent fashion while no effect on p-actin mRNA was observed (p<0.05; a*b*c). 113 control hCG 11 10 9 8 7 6 G n R H , 10\" X M B CO ° L. O CO o 250 200 H 150 H 100-Figure 55. Effects of increasing concentration of GnRH on steroidogenesis. Cells were exposed to hCG (1 IU/ml) or GnRH (10\"11 to lO^M) and concentration dependent effects of GnRH on P4 (A) and E2 (B) production were measured by [3H]RIA. GnRH stimulated P4, but notE2 production (p<0.05; a*b*c). F. Effects of P G F 2 a Treatments with P G F 2 a exhibited a concentration-dependent inverse bell curve-like inhibition of GnRH-R mRNA levels, with mid-range concentration of IO - 9 M inhibiting mRNA levels by more than 2-fold (Figure 56). A n inverse bell curve-like response of P G F 2 a - R mRNA was also observed in response to PGF2a» but in this case, I O 9 M had no effect while lower and higher concentrations were stimulatory by 2-fold (Figure 57). Once again, p-actin mRNA levels did not show any variations (Figure 57). Progesterone and estradiol were not affected by P G F 2 a treatments (Figure 58). 115 co > CD E I X Oi C CD O 150 • 125 H \" o 100H L. J < -Li 5 75-« 50 H 25 -\\ n=4 T control h C G C a - i n 11 10 PGF 2a Figure 56. Effects of increasing concentration of P G F 2 a on GnRH-R mRNA levels. Cells were exposed to PGF2a ( 1 0 1 0 to lO^M) and concentration dependent effects on GnRH-R mRNA levels were measured by RT/PCR. GnRH-R was inhibited at 1 0 9 M of P G F 2 a reducing the levels of mRNA to half the one of the control (p<0.05; a*b*c). 116 to > cu E I o u 8 « CM w CD 0_ B (0 < c Z O £ « O < 300 • 250 4 200 H 150 H 100 H 50 H n=4 be p i - be control hCG i i 10 PGF 2 a 200 • » ^-s 150-1 cu o ioo H 50 H n=4 l r control hCG 11 10 PGF 2 a Figure 57. Effects of increasing concentration of P G F 2 a on P G F 2 a - R mRNA and p-actin mRNA levels. Cells were exposed to PGF201 (10\"1 0 to lO^M) and concentration dependent effects on PGF2«-R (A) and p-actin (B) mRNA levels were measured by RT/PCR. PGF201-R exhibited a bimodal stimulation with 10\"9M of PGF2a having no effects, while lower or higher concentrations increased the levels of P G F 2 a - R mRNA by up to two times. Treatments had no effect on p-actin mRNA (p<0.05; a*b*c*d). 117 B o •a CO L. CO o L. c o u o 2 0 0 150 H 100 H Figure 58. Effects of increasing concentration of PGF2a on steroidogenesis. Cells were exposed to hCG (1 IU/ml) or P G F 2 a (10\" 1 1 to lO^M) and concentration dependent effects of PGF2« on P4 (A), E2 (B) production were measured by [ 3H]RIA. While the cells were responsive to hCG, PGF20C had no, or little effect on steroidogenesis (p<0.05; a*b*c). DISCUSSION I. About the studies A. Project GnRH is an important regulator of the reproductive function in humans, other mammals, and even lower organisms. Its actions are mediated by a membrane-bound receptor susceptible to regulation as GnRH itself. In this study, the regulation of GnRH-R mRNA was under investigation. Localization and ontogeny of GnRH-R mRNA were first defined in the rat. The in vivo levels of GnRH-R mRNA were then determined in the pituitary and the ovary of the mature cycling female and the PMSG/hCG primed immature rat. Further in vitro studies on granulosa cell cultures intended to define the regulators of GnRH-R mRNA expression. B. Models and techniques B.l. The animal models The ideal subject for relating any study to the human would be the human, but in vitro studies are limited by the availability of human tissues (for example, human granulosa cells that could be obtained from IVF centres), and invasive in vivo studies are practically impossible to conduct. For these reasons, an animal model was chosen for in vivo, as well as in vitro investigations. The rat presents several advantages that make it a model of choice: 1) in situ, in vivo and in vitro studies can be undertaken, offering a large array of models. 2) The laboratory rat is readily available, easy to breed, rapidly mature, and has a short cycle. Hence, studies can be designed and executed relatively rapidly, without having to wait for seasonal breeding periods. Moreover, immature rats can be stimulated and synchronized to yield large numbers of animals at the same stage of sexual maturation. The models designed for the present studies are as follows: 1) Adult male and female rats were used for tissue localization. GnRH-R mRNA detection was important to assess its distribution and localize the potential targets for GnRH. When GnRH analogues are used clinically, they primarily were intended to target the pituitary and alter the reproductive function. GnRH and its analogues are now also known to target the reproductive organs directly, and may be used to achieve this purpose. But the effects of GnRH on the rest of the body are largely overlooked. Thus, determining the potential targets of GnRH, through the presence of GnRH-R, is a starting point for other studies aiming at defining the actions of GnRH on non-reproductive tissues, and the potential secondary effects of a GnRH analogue treatment on the body. 2) Neonatal rats obtained from litters allowed a temporal determination of GnRH-R distribution in the male and female gonads and in the female pituitary. GnRH is known to play a role in the regulation of the reproductive cycle, but what may be its fate in the sexually immature animal ? If the receptor for GnRH is present before puberty, then a role for GnRH can be postulated, and further studies designed to examine this possibility are discussed further. 3) Mature cycling females seemed an obvious choice for detecting potential physiological alterations in GnRH-R mRNA levels during the estrous cycle, in the pituitary and possibly in the ovary. Although variations were not detectable in the ovary, this model was expected to reflect true physiological phenomenon, being that it was not altered by any exogenous treatments. 4) The immature PMSG/hCG primed in vivo model was chosen to substitute for the mature cycling female because of the synchronized properties of the follicles. In this model, all the recruited follicles are maturing at the same rate, and during the first cycle induced by PMSG/hCG treatment, all recruited follicles are at the same stage of development. The detection of GnRH-R mRNA 120 variations in the ovary was made possible in this model, providing answers that the normal cycling rat was masking. 5) in vitro granulosa cell models were designed to detect regulations of GnRH-R mRNA by various endogenous or exogenous candidates at the cellular level. A first model, referred up to now as model I and described in details in the methodology section, received FSH and androstenedione pre-treatment with the belief that this would promote and maintain a pre-ovulatory differentiation state. It is difficult to judge and estimate what state these cells are at, as various further treatments might also differentiate the cells further. In this model, GnRH is displaying anti-steroidogenic effects. A second model was developed in an attempt to simplify the procedure employed in obtaining these cells, and avoid the use of a pre-treatment that renders interpretation of the results more difficult. Since a pre-ovulatory state was sought, it seemed more logical to let the cells differentiate further in vivo, rather than pushing maturation in vitro. At the time of collection, it is safe to assume that the cells were indeed in a pre-ovulatory state, since they were collected very shortly before ovulation. At the time of treatment, and after treatment, it is again difficult to pretend that the cells are at a particular state. In this case, the steroid response to GnRH displayed luteotrophic actions on basal R4 production. B.2. The techniques For the purpose of these studies, detection of mRNA species and measurement of steroid levels were required. To measure these different parameters, several cellular and molecular biology tools were used: 1) Radioimmunoassay, or RIA, was the technique of choice for the measurement of steroids, both from serum and culture media. 2) RNA extractions were performed to isolate total RNA that were to be further assayed for the mRNA(s) of interest. 121 3) These studies required the use of several detection and quantification methods: -For detection and verification only, Northern or Southern blots hybridization was performed. These techniques are specific, and the product detected is likely to be the one of interest. -For quantification, RT/PCR followed by Southern blotting, hot PCR, or simply cold PCR followed by counts or densitometry were used. Southern blotting was not necessary when the product looked at was already shown to be correct. Any other technique listed above was expected to be equally satisfactory. C. Problems and problem solving During the course of these studies, a few problems were encountered with the models and the techniques, but could often be overcome. C.l . The animal models 1) The normal cycling female failed to show if there was any variation in the ovary, because of the multi-stage nature of the ovarian follicles. Another in vivo model, the immature PMSG/hCG primed rat, was substituted to overcome this problem, and successfully showed regulation of GnRH-R mRNA levels between different stages of follicular development. 2) The first granulosa cell model received a pre-treatment that rendered dating (i.e. determining the state of development) and interpretation of the results more difficult. A second model, with no FSH pre-treatment, was less manipulated and yielded more cells. Although it turned out to be quite different from the first model, it gave rise to more results per animal and was accepted as a different model. C.2. The techniques 1) Two RIA techniques had to be used to measure P4 and E 2 from serum, or from medium. A relatively easy and inexpensive RIA using tritium-labeled P4 and E 2 was employed for assaying steroids in medium. This assay was not effective for serum, most certainly due to the interactions between serum and buffer, affecting the buffer properties, found to be very important for the quality of this assay. Thus, a different RIA, using 1 2 5 I label, was commercially purchased as a kit, and reserved for serum. 2) For large amounts of tissues, a cesium-chloride / butanolxhloroform extraction method was used. This extraction protocol is rather long, although not very labor intensive as a 12 hour centrifugation step is responsible for most of the time required for the extraction. But when expected R N A yields were low, this technique was not efficient enough and could not be performed. A kit, although more expensive and more labor intensive, even if it was less time consuming, was used for those samples, as it could yield sufficient amounts of total RNA to work with (0.5 to 5 fAg per sample). 3) Several detection and quantification methods were used, each of them presenting advantages and drawbacks: -a. Northern blotting would have been the technique of choice, both for verification of the nature of the mRNA and for quantification, as the number of intermediate steps is limited, thus reducing the chance of experimental error or assay variability. Furthermore, Northern blot provides a direct mean of quantification. But in most cases, the RNA yield was limited, and not sufficient for Northern blots. Moreover, the level of expression of the gene of interest, GnRH-R, was low in the ovarian granulosa cells, and may not always be detectable by Northern blot analysis. -b. Southern blot hybridization was preferred over Northern to remedy the problem of the low R N A yields. Although more time consuming because of the added RT/PCR step, the amplification process will detect even the weakest signal. However, it has the potential of introducing intra- and inter-assay variations from one sample to the other, and measurements are only semi-quantitative, due to the non-linear nature of the PCR step. -c. PCR is a good amplifying tool, but over-amplification will lead to a plateau effect. This is why cycle experiments were performed to determine the optimal cycle number for a given cDNA species, at the quantities examined. Although not always perfectly linear, PCR amplification reflects relative variations with enough accuracy for a restricted range. Measurements of the genes of interest were tested against a housekeeping gene (P-actin or G3PDH) chosen according to the more constant expression for each cDNA source. -d. Hot PCR is easier and faster than Southern, but is not necessarily as specific. Cold PCR is in all respects as good as hot PCR without the inconvenience of the isotope, and only the potential of not detecting weak products as well as a labeled method. However, as long as the PCR product was shown to be correct, PCR is a reliable method. As all techniques yield similar results, PCR was utilized, as it avoids unjustified use and exposure to isotopes, and reduced the number of steps (hence, reducing potential experimental errors) for quantification compared to a Southern blot hybridization. Furthermore, PCR still maintained the amplification advantage. For all of the techniques mentioned above, the limiting parameter is the accuracy of the counts (for the methods using isotopes) or the densitometry readings. These quantifications methods are not linear (see profile of standard curves, on Figure 10 and 22) and would all require the use of standard curves specific to each assay. However, for relatively small variations (up to 2-3 times), direct readings can be considered accurate enough for relative quantification, even though standard curves were not used. 124 II. Tissue specificity A. Synopsis The mRNA for GnRH-R was detected in the brain, pituitary of the cycling female, lung, kidney, adrenals, uterus of the cycling female, ovary, corpus luteum, testis, ventral prostate, epidydimis, peri-ovarian fat, and oviduct (Figure 59). It was not detected in the pituitary of the pregnant female, uterus of the pregnant or lactating female, cerebellum, hypothalamus, heart, mammary gland, duodenum, ileum, colon, spleen, liver, placenta, pancreas and iliopsoas (muscle). A l l samples were positive for p-actin mRNA. This study did not atempt to quantify GnRH-R in the different tissues, since tissues were not all proccessed simultaneously. B. General implications The presence of GnRH-R and GnRH among a wide variety of tissues and species suggests that it is ancient and ubiquitous [King et al., 1995]. GnRH is present in multiple isoforms in the vertebrate [White et al., 1994]. Multiple variants of GnRH derived from alternate splicing and/or post-transcriptional modifications are identified, including the two forms encoded by two different genes and found in vertebrates (mammalian GnRH and chicken GnRH II). The large number of isoforms suggests that GnRH is an ancient gene, and that during evolution, the peptide was subjected to structural changes and gene duplication. GnRH was first recruited as a neurotransmitter in the CNS, and with evolution, as a paracrine modulator of gonadal function, and an autocrine regulator in tumor cells. In most species, the ancient chicken GnRH II acts as a neurotransmitter, while the second form which varies across classes is responsible for the physiological regulation of gonadotrophins [King et al., 1995 (review)]. C. GnRH-receptor mRNA in the central nervous system 125 As expected, the GnRH-R was found in the pituitary of the cycling female rat. The gonadotropes, which represent 5 to 10% of the cell population in the pituitary, are the cell type expressing GnRH-R. Multiple reports exist, demonstrating the presence and regulation of GnRH-R in the mouse and rat pituitary [Naik et al., 1985; Ban et al., 1990; Laws et al., 1990a, 1990b; Eidne et al., 1992; Perrin et al., 1993; Kakar et al., 1992, 1993]. Pituitary GnRH-R levels are under gonadal control, and auto-regulation. GnRH-R mRNA was not detected in the pituitary gland of the pregnant rat, suggesting a down-regulation of the mRNA during this period. Furthermore, GnRH-R gene expression was also found in the brain outside of the pituitary, confirming earlier reports [Crumeyrolle et al., 1994; Jennes et al., 1994]. Other studies also localized GnRH-R binding sites in the rat dorsal hippocampus [Leblanc et al., 1988; Ban et al., 1990], amygdala, septum and subiculum [Badr et al., 1987]. This study did not detect GnRH-R mRNA in the preoptic area of the hypothalamus, while the same samples were positive for GnRH mRNA. The presence of GnRH-R mRNA in the arcuate nucleus and the ventromedial hypothalamus was however reported by Jennes (1994), and binding studies detected very low amounts of the receptor in the hypothalamus [Badr et al., 1987]. In the brain, G n R H acts as a neurotransmitter and is, possibly, involved in the expression of reproductive behaviors [Jennes, 1994]. The reason for this discrepancy is unclear, but it may be that the tissue isolated as the hypothalamus did not contain the proper nuclei. Furthermore, the number of binding sites are reported to be low [Badr et al., 1987]. Thus it could also be that the levels of mRNA in the samples used for this study were under the detection limit. GnRH and GnRH-R have been shown to be colocalized in different areas of the brain. The finding of GnRH-R mRNA being expressed in several areas of the brain strongly suggest that GnRH has multiple sites of action and acts as a neurotransmitter/neuromodulator in the central nervous system. As for the pituitary receptors, hippocampus GnRH-R appears to be under sex steroid modulation [Badr et al., 1988]. In the brain, GnRH-R is under more complex regulatory systems involving other neurotransmitters of the POMC, G A B A , opioids [Seong et al., 1995] D. GnRH-receptor mRNA in the reproductive organs 126 The finding of GnRH-R transcripts in the rat ovary, and testis lend support to previous binding [Pieper et al., 1981], and autoradiographic studies [Latouche et al., 1989, Millar et al., 1982]. D.l. In the female reproductive organs While these previous autoradiographic studies suggested that GnRH binding sites were on the surface of the ovarian granulosa cell [Latouche et al., 1989], this present study did not attempt, at this point, to isolate and examine this cell type. However, the presence and regulation of GnRH-R mRNA in cultured granulosa cells was also demonstrated in subsequent in vitro (model I) experiments [Olofsson et al, 1995]. This study also detected the presence of GnRH-R mRNA in the oviduct and in the peri-ovarian fat. No previous report of these occurrences were found in the literature, although GnRH has been detected in the porcine oviduct [Li et al., 1993]. The role of GnRH, if it is colocalized with its receptor in these tissues, is not clear. Among the possibilities, GnRH could also affect steroid metabolism in peri-ovarian fat, since it contains all the necessary precursors for steroid production. However, GnRH has not been reported to be present in fat, although it could come from the ovary itself. Another distinct possibility is that the fatty cushioning tissue, certainly acting as a mechanical barrier, could also act as a biochemical barrier, binding any GnRH or GnRH-like material that could escape the ovary in an active form, preventing any effects on other potential targets. In the reproductive tissues, GnRH-R presence suggest that GnRH (also expressed) exerts local actions that are not restricted to the gonads. D.2. In the male reproductive organs The presence of GnRH-R was detected in the testis, but also the ventral prostate and the epididymis of adult male rats. Although there are other reports demonstrating the presence and/or regulation of GnRH-R in the testis [Pieper et al., 1981; Ban et al., 1990], or on the testicular Leydigcell [Millar etal., 1982], there are few reports of GnRH-R on accessory male sex organs. GnRH-R presence was detected on the prostate by Kakar (1992), but no binding sites on normal prostates were found by other authors [Hierowski et al., 1983; Srkalovic et al., 1990]. However, these authors reported binding sites on prostate tumors. Regulation studies demonstrated effects of GnRH on the epididymis [Hatier et al., 1994] and the prostate [van Minnen, 1988], but there are no other report of GnRH-R presence (or absence) in the epididymis. As it is the case in the ovary, GnRH affects steroidogenesis in the testis. GnRH is produced by Sertoli cells and spermatogenic cells, and acts in a paracrine fashion on the neighboring GnRH-R located on the interstitial and Leydig cells [Bahk et al., 1995]. Testicular GnRH regulates its own binding sites, a sub-population of FSH-induced prolactin receptors, and testosterone production. GnRH also indirectly regulates L H and FSH serum levels [Clayton et al., 1986]. In the testis, GnRH production is also regulated by testicular opioids, synthesized by the Leydig cell, and acting on the Sertoli cells which carry receptors for them [Saint et al., 1988]. D.3. Reproductive related organs where GnRH-receptor mRNA was not detected It is interesting to notice that GnRH-R expression may be altered in tissues when a tumor develops (e.g. mammary gland or prostate carcinomas). These tumors are often found to be steroid sensitive, and GnRH analogues are often considered as a treatment of choice, because it controls the steroid levels, hence controlling the development of such tumors [Auclair et al., 1981; Corbin, 1982; Sandow, 1983] Although this study did not demonstrate the presence of GnRH-R mRNA in the mammary gland of the cycling rat, other studies reported that GnRH-R mRNA was present in the mammary gland of virgin, pregnant and lactating animals [Palmonetal., 1994; Levi et al., 1996]. However, Levi reported that GnRH mRNA was not expressed in the mammary gland of virgin animals, while it was expressed in that of pregnant and lactating ones. GnRH-R was also reported in the breast of the human [Kakar et al., 1994]. The absence of GnRH-R mRNA where binding may have been reported may be due to down-regulation of mRNA expression. E. GnRH-receptor mRNA in the non-reproductive organs 128 The finding of GnRH-R mRNA expression in tissues other than the central nervous system and the reproductive tissues is not too surprising, if those tissues are categorized by their function. Lung, kidney and adrenals are all steroid sensitive and/or steroid producing organs, just as the pituitary and the gonads. GnRH binding sites have been reported in liver, spleen, renal cortex, lung and cardiac muscle [Heber et al., 1978], and also adrenals [Pieper et al., 1981]. These findings differ from the present molecular study in that GnRH-R mRNA was not detected in the heart, spleen and liver, while other Northern blot and RT/PCR studies did not detect GnRH-R mRNA in liver and spleen [Kakaretal., 1992]. In another binding study on mice, liver, kidneys, heart, lungs, spleen, gastrointestinal tract, adrenal glands, thymus, thyroid gland, muscle, and adipose were found to be unreactive [Murdoch, 1995]. Thus, there appear to be a number of contradictions that could be attributed to the techniques used to detect GnRH-R, the species studied, the stage of the organ looked at, or maybe the GnRH-R isoform that might be different in different tissues. It is interesting to note that, all tissues where GnRH-R was found were either steroidogenic or steroid dependent. Thus, GnRH appears to be important not only in the regulation of steroid secretion, but also at the site of steroid action. Therefore, it can be postulated that in these organs, GnRH may act as a local regulator of steroidogenesis, and/or steroids can regulate the expression of GnRH-R, as is the case in the pituitary [Gregg et al., 1989]. A role of the adrenal in the regulation of gonadal steroid regulation has been advanced [Kalra et al., 1977; Jayatilak et al., 1980]. Anti-steroidal effects of GnRH were reported in the kidney [Prasad et al., 1985]. Other possibilities explaining the presence of GnRH-R in these tissues could be that they are involved in the metabolic clearance and/or the degradation of GnRH. Lung, liver and kidney are indeed known to be active sites of catabolism. This hypothesis is supported by several reports investigating this possibility [Heber et al., 1978; Carone et al., 1987; Berger et al., 1993]. 129 Brain F i g u r e 59. Tissue localization of GnRH-receptor mRNA in the rat. GnRH-R mRNA was detected by RT/PCR in the brain, pituitary of the cycling female, lung, kidney, adrenals, uterus of cycling female, ovary, corpus luteum, testis, ventral prostate, epidydimis, peri-ovarian fat, and oviduct. It was not detected in cerebellum, hypothalamus, heart, mammary gland, duodenum, ileum, colon, spleen, liver, placenta, pancreas and muscle. 130 III. Ontogeny A. Synopsis In the pituitary and the gonads, the expression of GnRH-R mRNA was found to vary with age. Hardly detectable in the ovary before the sixth day of life, GnRH-R transcripts increased until puberty, and then, drop slightly in adulthood. The expression of the GnRH-R transcript in the testis appears to follow a similar pattern to that of the ovary, increasing with age. The pituitary GnRH-R mRNA was also detectable at an early age, and progressively increased with age. B. General implications The role of GnRH and its receptor is more or less established in the adult, but the period of sexual maturation before and at puberty is critical for the establishment of a normal reproductive function. GnRH has been found to modulate P R L and G H release in vitro in neonatal pituitaries [Andries et al., 1995], and stimulate lactotrophe differentiation in explanted fetal pituitaries [Begeot et al., 1983]. In neonatal rats, GnRH is also suspected to play a role in the differentiation of the immune functions [Morale et al., 1991]. The differentiation of GnRH neurons, earlier in fetal development, is under the influence of such factors as bFGF, T G F [Voigt et al., 1996], and the proopiomelanocortin (POMC) may be responsible for the pulsatility of GnRH secretion [Wiemann et al., 1989]. C. GnRH-receptor mRNA in the ovary In the ovary, GnRH-R mRNA levels were found to rise with age, and drop slightly at the onset of puberty, when a reduction in GnRH binding sites has been reported to occur [Smith-White etal., 1981]. In the ovary, L H receptors are induced by GnRH-stimulated L H production, whereas FSH receptor appearance is not dependent of GnRH-stimulated FSH [Sokka et al., 1990]. Although ovarian GnRH biosynthesis does not begin before 2 weeks of postnatal life [Lamprecht et al., 1976], GnRH-R is already present, and GnRH can be provided to developing pups through the mother's milk [Smith, 1984, 1986]. Later during development, the drop in GnRH-R during the first proestrus following puberty has been correlated to a reduction in GnRH inhibitory function, thus enhancing ovarian steroid secretion [Smith etal., 1980; White et al., 1981]. GnRH itself has been reported to drop on the morning of the first estrus [Ojeda et al., 1976]. Thus, the pattern of GnRH-R expression detected during ontogeny in the ovary supports the postulated roles of GnRH in the establishment of a functional reproductive system in the rat. D. GnRH-receptor mRNA in the testis The presence of GnRH-R mRNA was demonstrated here in the testis of immature rats. Previous binding studies also found GnRH-R in the testis of newborn and immature rats [Huhtaniemi et al., 1985]. Testicular GnRH-R mRNA increased with age, a trend which also parallels previously reported binding studies [Dalkin et al., 1981]. GnRH binding sites were not detectable prenatally in the testis [Nemeskeri et al., 1986], but appeared in culture where they were responsive to GnRH analogues. GnRH-R presence in cultured fetal and neonatal Leydig cells support the role of GnRH or GnRH-related peptides in the modulation of gonadotrophin actions in these cells [Dufau et al., 1985]. Other indirect evidence suggest a role of GnRH in testicular growth and Sertoli cell maturation [Vogel et al., 1983]. E. GnRH-receptor mRNA in the pituitary In the pituitary, the age groups studied revealed an increase in the expression of GnRH-R mRNA, finding supporting by earlier GnRH binding studies reporting an increase in binding sites, after birth [Dalkin et al., 1981; Aubert et al., 1985]. Binding studies previously reported that the number of pituitary GnRH-R increased during sexual maturation. In the female, this number rises to a plateau between 15 and 30 days of age, and increase further to roughly double by 50 days. In males, the number rises gradually until 35 days (reaching levels comparable to those seen at day 50 in the female) and remains constant until 60 days [Duncan et al., 1983]. The rise observed in the present study did not reveal a plateau between day 15 and 30, but it is a strong possibility that GnRH-R mRNA and GnRH-R protein do not follow exactly identical patterns, as it has been demonstrated in the case of the male hypothalamic GnRH mRNA, GnRH precursor and GnRH. During fetal development in the male rat, GnRH mRNA increased and remained elevated, while GnRH continued to increase and GnRH precursor decreased after an initial increase [Dutlow et al., 1992]. GnRH binding sites have been reported in the fetal pituitary as early as day 12, although high affinity sites do not appear before day 17 of gestation, coinciding with the start of L H release [Aubert et al., 1985]. At this time, it is certainly GnRH of amniotic origin, capable of reaching the fetal pituitary, that is responsible for the first release of L H [Jennes, 1990]. GnRH takes part in the differentiation and maturation of the pituitary. Its presence, and that of its receptor, can be expected during ontogeny. During fetal development, GnRH has been reported to induce pituitary differentiation of L H and TSH cells [Heritier et al., 1994], and induce L H production and release after 17 days [Aubert et al., 1985]. GnRH was first detected in rat brain at day 15 of fetal life, and by day 19, GnRH neuronal connections are established with most of the target areas in the brain [Jennes, 1989]. 133 IV. Cycling rat A. Synopsis GnRH-R mRNA levels were found to be regulated in the pituitary of the cycling female rat, but no detectable changes were observed at the level of the whole ovary on the different days of the estrous cycle. B. GnRH-receptor mRNA in the pituitary The maximum levels found in the pituitary were observed on the morning of diestrus II. However, previous studies reported maximum binding sites during the proestrus period, prior to the ovulatory surge. This is a time point that was not assayed in the study undertaken here, and the apparent temporal shift in these results may be due to the fact that the present study missed this particular point in time. Another possibility is that the expression of the protein receptor is delayed compared to the expression of the mRNA, since protein and mRNA patterns can be quite different [Dutlow et al., 1992]. Pituitary GnRH-R is under the direct control of endogenous GnRH [Naik et al., 1985]. There also appears to be a close correlation between E 2 and GnRH-R mRNA, rising and declining simultaneously (Figure 60). The initial slow rise in E 2 could increase the release of hypothalamic GnRH, in turn increasing the expression of its own receptor. This mechanism is supported by previous binding studies [Clayton et al., 1980, Lloyd et al., 1988]. C. GnRH-receptor mRNA in the ovary The fact that the ovarian stages did not display any variation in the levels of GnRH-R mRNA is not surprising, since the number of agonist sites as determined from radioreceptor assays do not change during the estrous cycle when related to whole ovaries [Pieper et al., 1981; Marchetti et al., 1988], or exhibit only a slight increase on proestrus when expressed as binding sites per ovary [Koves et al., 1989]. In the ovary of the adult cycling female, follicles at all different phases of development are present at any stage of the estrous cycle. These include immature follicles of all sizes (i.e. advancement in maturation), and also luteolytic corpora lutea from a previous cycle. Since the presence of GnRH binding sites has been shown to be differentially localized in the whole ovary [Latouche et al., 1989], an assay at the level of the whole ovary is likely to represent only average levels of the GnRH-R mRNA. Thus, visualizing GnRH-R mRNA variations between different stages of the estrous cycle would be possible using in situ hybridization. D. Steroid levels during the estrous cycle As for the steroid levels measured for this study, the variations in E 2 levels are in accordance with the expected fluctuations, with levels rising during the proestrus period, until they reach a threshold responsible for initiating the ovulatory peak of LH, at which point they decline again. The frequency of sampling was not appropriate to detect the peak of P4 , which is supposed to happen at the precise time of ovulation, shortly after midnight on the day of estrus. The levels observed before estrus were on the rise (on diestrus II and proestrus), but they already fell by the morning of estrus. 1 3 5 Figure 60. Extrapolated GnRH-receptor, gonadotrophins and steroid levels in the cycling rat. Levels of the different hormones and receptors were extrapolated from the present studies and/or the known hormonal patterns. The horizontal axis correspond to the days (~) and nights (•) of the estrous cycle. The vertical lines or the curves represent levels and fluctuations of corresponding hormones or receptors: — ovarian GnRH-R mRNA; — pituitary GnRH-R mRNA;l levels of pituitary GnRH-R mRNA in the cycling rat at a particular point in time; — predicted LH; — predicted FSH; _ P4 levels in the cycling rat; — E 2 levels in the cycling rat. V. PMSG/hCG synchronized model 136 A. Synopsis In view of seemingly unchanged expression of the GnRH-R gene during the estrous cycle in whole ovaries, where follicles at various stages of maturity and corpora lutea from previous ovulations are present, the immature rat model was chosen to more precisely examine the period prior to, during and following the first ovulation. Pituitary and ovarian GnRH-R mRNA were found to be transiently down-regulated by PMSG/hCG treatment. B. GnRH-receptor mRNA in the pituitary The finding of a significant decrease in pituitary GnRH-R mRNA expression prior to hCG injection, or the endogenous L H surge, which occurs at 56-60 hours after P M S G injection in this model [Hillensjo et al., 1974], can be compared to the decreased GnRH-R mRNA levels seen prior to the onset of L H surge in the early morning of proestrus [Bauer-Dantoin et al., 1993]. hCG injection does not affect GnRH-R mRNA levels further after 12 hours. The rebound in GnRH-R mRNA observed after 48 hours is more likely due to a return to control levels rather than a direct effect of hCG treatment. C. GnRH-receptor mRNA in the ovary A striking feature in the present finding of ovarian peri-ovulatory GnRH-R mRNA expression pattern is the close correlation to the reported decline in numbers of GnRH ligand-binding sites 3 days after PMSG injection and also hCG treatment in gonadotrophin-primed immature rats [Harwood et al., 1980 a,b]. In keeping with the known down-regulation of both L H and FSH receptor mRNAs following an ovulatory dose of hCG [LaPolt et al., 1990, 1992], findings herein provide preliminary evidence for yet another member of the G-coupled receptor family which is down-regulated at both the mRNA and protein level by LH/hCG [Piquette et al., 137 1991]. Interestingly, this down-regulation is transient, since increased mRNA levels of GnRH-R were detected in the early luteal phase of immature rats (Figure 61). D. Steroid levels The P4 levels were found to be higher in the PMSG/hCG group, corresponding to the time of ovulation. This increase matches perfectly the situation seen in cycling animals, displaying a P4 peak that coincides with ovulation. Estradiol levels were maximum in the PMSG group, correlating to the high levels observed during proestrus. E. General implications GnRH-R mRNA levels were found to be highly regulated in the PMSG/hCG synchronized immature rat, underlying the importance of gonadotrophins in the modulation of GnRH/GnRH-R function in the ovary. The levels of GnRH-R mRNA observed in the pituitary of the PMSG/hCG model seemed to correlate well with those observed in the cycling animal at comparable points in time. Thus, a general pattern for pituitary GnRH-R throughout the estrous cycle could be extrapolated from the data generated by those two series of experiments. This pattern is shown in Figure 62. The increase in pituitary GnRH-R parallels the increase in E2, suggesting that E2 might be indirectly responsible for this rise. The biphasic effect of E2 suggested by Naik (1985) can also be observed here with a decline of pituitary GnRH-R mRNA at the time when E2 reaches a plateau. This point in time, before the night of estrus, also correspond to the initiation of the L H and FSH surge, and the rise in serum P4. However, the normal cycling rat and the PMSG/hCG model differ greatly in one respect: The E2 levels in the PMSG/hCG synchronized model drop earlier than in the normal rat, but to a lesser extent. After ovulation, the steroid levels in the primed immature rat remain elevated, while those of the normal rat decrease to basal levels. The elevated steroid levels of the PMSG/hCG model suggest that luteinization follows ovulation, which is certainely induced by the prolonged effects of hCG. The pattern of ovarian GnRH-R mRNA could not be detected in the ovary of the normal cycling rat, for reasons already described, but a profile could be established in the PMSG/hCG model, whose follicles are all at the same stage of development. As mentioned above, the decrease in GnRH-R coincides with the hCG treatment, leading to the suggestion that ovarian GnRH-R may be down-regulated by LH/hCG. In the normal cycling rat, if such a drop occurs in the recruited follicles ready for ovulation, it may be attributed to the rising levels of L H and/or FSH. From in vitro studies presented below, it is likely that L H is responsible for the down-regulation of GnRH-R mRNA in granulosa/luteal cells, but FSH has no effect on GnRH-R mRNA levels [Olofsson et al., 1995]. Another feature of GnRH-R profiles is the apparent parallel, although shifted, patterns between the pituitary and the ovarian mRNA levels. The time lapse between the decline of those to mRNA populations roughly equals the time laps between the E 2 plateau (responsible for the pituitary GnRH-R decline) and the onset of the L H surge (responsible for the ovarian GnRH-R decline). In summary, there are two GnRH/GnRH-R systems modulating the reproductive function. The hypothalamo-pituitary system controls gonadotrophins and is controlled by steroids (E 2 ) , while the gonadal system controls steroid production and is under gonadotrophin control (LH). 139 DH PE E DI Dll PE E DI Figure 61. Extrapolated GnRH-receptor, gonadotrophins and steroid levels in the PMSG/hCG primed rat. Levels of the different hormones and receptors were extrapolated from the present studies and/or the known hormonal patterns. The horizontal axis correspond to the days (LZ) and nights (•) of the estrous cycle. The vertical lines or the curves represent levels and fluctuations of corresponding hormones or receptors: — ovarian GnRH-R mRNA; — pituitary GnRH-R mRNA; — progestrone levels in the PMSG/hCG rat; — E 2 levels in the PMSG/hCG rat. 140 Figure 62. Extrapolated GnRH-receptor, gonadotrophins and steroid levels in the cycling or PMSG/hCG primed rat. Levels of the different hormones and receptors were extrapolated from the present studies and/or the known hormonal patterns. The horizontal axis correspond to the days (ZL\") and nights (•) of the estrous cycle. The vertical lines or the curves represent levels and fluctuations of corresponding hormones or receptors: — ovarian GnRH-R mRNA; — pituitary GnRH-R mRNA;l levels of pituitary GnRH-R mRNA in the cycling rat at a particular point in time; — predicted LH; — predicted FSH; — P4 levels in the cycling rat; — progestrone levels in the PMSG/hCG rat; — E-> levels in the cycling rat; — Eo levels in the PMSG/hCG rat. 141 VI. Granulosa cell - Model I In vitro studies were conducted in two different granulosa/luteal cell models. Pre-ovulatory granulosa cells were obtained from PMSG primed immature rats, and pre-cultured for 24 hours before receiving treatments. In the first model, granulosa cells received FSH/androstenedione during the pre-culture period, while the second model did not. A. Synopsis The studies undertaken in this model demonstrated that GnRH-R mRNA is detectable in pre-ovulatory rat granulosa cells and that the levels of transcripts are hormonally regulated by L H and GnRH. These findings add further support to the hypothesis of a potential role for GnRH as a local factor involved in the regulation of ovarian function. B. LH effects Treatment with exogenous L H , mimicking the endogenous L H surge, induced a down-regulation of GnRH-R transcripts which was time and concentration dependent. Not surprisingly, the down-regulation of GnRH-R transcripts in the in vitro system is similar both in magnitude and temporal occurrence to an in vivo ovulatory dose of hCG which decreases ovarian GnRH-R mRNA levels, 12 hours after hCG injection [Olofsson et al., 1994]. The decrease in GnRH-R transcripts is transient, as transcripts return to pre-treated levels after another 36 hours, corresponding roughly to the time required for luteinization. This in vitro experiment correlates well with the in vivo experiment described previously. In the cultured pre-ovulatory cells, L H displays identical effects to those exerted by hCG on the in vivo ovary, with a down-regulation of GnRH-R mRNA, also reported in binding studies [Harwood et al., 1980]. As could be expected, levels of P4 and E 2 rose in response to L H treatments. On the other hand, FSH did not elicit any response in GnRH-R mRNA levels in those cells, although there is a report of FSH altering the distribution of GnRH-R mRNA in hypophysectomized rats in vivo [Whitelaw et al., 1995]. FSH was biologically active, since P4 production increased following FSH treatment. It is possible that the FSH pre-treatment applied to the granulosa cell culture somehow played a role in 'desensitizing' GnRH-R mRNA response, although levels could still be altered in a negative fashion by L H . Since the receptors for FSH were not down-regulated by FSH, and were still present and functional, as shown by the steroid response, it is more likely that the state of differentiation, at which these granulosa cells culture are at, is not permissive for responding to FSH. C . G n R H effects It is well documented that the number of GnRH-R is both up- and down-regulated by GnRH in the pituitary of many mammalian species [Conn et al., 1986]. The situation in the gonads, however, is still largely unclear. In the present study, a 24 hour treatment with GnRH, concentration-dependently increased GnRH-R mRNA levels. This is in accordance with the report that the GnRH-R binding capacity increased in the ovary after stimulation by GnRH [Pieper et al., 1981]. This up-regulation mechanism may serve to amplify and accelerate the effects of GnRH; for example, inhibition of basal P4 production in response to increasing GnRH concentrations was observed, and supports the anti-steroidogenic function of GnRH previously reported [Massicotte et al., 1984]. In this system, GnRH also inhibited gonadotrophin-stimulated P4 production, exhibiting anti-steroidogenic effects on both basal and stimulated P4 production. D. General implications The in vitro FSH-pretreated granulosa cell model closely resemble the in vivo PMSG/hCG model described above. In this model, GnRH-R mRNA was found to be transiently down-regulated by L H and up-regulated by GnRH. These findings were similar to the reported regulation in human granulosa-luteal cells by these hormones [Peng et al., 1994]. In this study, GnRH appeared to be primarily anti-gonadotrophic, inhibiting both basal and gonadotrophin stimulated P 4 production. VII. Granulosa cell - Model II A. Synopsis These studies demonstrate the ability of hCG, GnRH and PGF2 a> alone or in combination, to regulate GnRH-R mRNA transcripts in the rat granulosa/luteal cell. These results support the concept of GnRH as a local regulator in the ovary. In this granulosa/luteal cell model, GnRH-R mRNA levels were found to be up-regulated by hCG and GnRH, and down-regulated by mid-range doses of P G F 2 a (10\" 9M). In contrast, GnRH mRNA levels were down-regulated by GnRH. More like GnRH-R mRNA, PGF2«-R mRNA levels were up-regulated by hCG, GnRH and P G F 2 a . B. Preliminary results B.l. Culture time It was observed that total RNA increased by close to 30% over a period of four days of culture. On the other hand, progesterone profiles were not affected by hormonal treatment after day 1 of culture. Thus, it appears that the increase in RNA combined with the loss of responsiveness over time may reflect dedifferentiation of the cells, under these culture conditions. 144 B.2. Time-course The greater variations in mRNA levels were seen after 18 hours of treatment. Shorter and longer treatment periods resulted in lesser or no effect on mRNA levels. The time dependent response to treatments reflect transient effects, with a maximal regulation around 18 hours and a return to basal levels by 36 hours. C. hCG effects Although previous studies showed a down-regulation of GnRH-R mRNA levels in response to hCG in vivo, and L H in vitro [Harwood et al., 1980], interestingly, up-regulation in response to hCG was demonstrated in this system. This discrepancy is likely attributable to the state of differentiation of these cells. Unlike the model I cells, these cultures have not received F S H pre-treatment, but instead, have been carried to a further state of differentiation in vivo. Being collected shortly before ovulation, these cells have probably been subjected to the endogenous surge of L H preceding ovulation [Hillensjo et al., 1974]. Human C G was also found to increase P G F 2 a - R mRNA levels. In vivo reports demonstrated an increase in P G F 2 a binding for 7 days after hCG administration in PMSG/hCG primed rats, and a decrease until day 21 [Brambaifa et al., 1984]. These results correlate with the present finding. However in luteal cells of the pregnant rat, it was reported that treatment with hCG did not produce changes in receptor concentration [Bussmann et al., 1989]. Thus, it could be postulated that the cultured cells of this model do not correspond to a differentiated state equivalent to a corpus luteum of pregnancy. Another possibility could be that during pregnancy, P G F 2 a - R are somehow maintained at high levels and cannot be further stimulated by hCG. In that case, the up-regulation observed presently could bring the cultured cell to this state, and the cells could be induced to differentiate into luteal cells of pregnancy, after hCG treatment. 145 D. GnRH effects GnRH had a stimulatory effect on its own receptor mRNA levels, an effect comparable to the up-regulation that can be observed in the pituitary [Conn et al., 1994], and also observed in the previous model studied [Olofsson et al., 1995]. On the other hand, G n R H negatively auto-regulates GnRH transcripts levels, possibly as part of a negative feedback system. Elevation of PGF2 a -R mRNA in response to GnRH treatment was also seen. To the best of the author's knowledge, there have been no previous reports of PGF2 a -R mRNA regulation by G n R H . GnRH also increased P4 production on its own, while only slightly inhibiting hCG-stimulated P4 production. These findings support the idea that GnRH can be steroidogenic [Massicotte et al., 1984, Srivastava et al., 1994], as well as anti-steroidogenic [Massicotte et al., 1984], as shown in the previous study ('model I'). E. PGF20; effects The effects of P G F 2 a °n GnRH-R mRNA abundance were inhibitory at 10 _ 9 M, although other concentrations had no effect. Mid-range concentration (10 _ 9M) was without effect on PGF2 a -R mRNA levels, but lower or higher concentrations stimulated PGF2 a -R transcripts levels. The regulation of PGF2 a -R transcripts levels is very comparable to the regulation of GnRH-R. Both GnRH- and PGF2 a -R mRNA levels were stimulated by hCG and their respective ligand, while co-treatment with any combination of hCG with GnRH and/or P G F 2 a reduced hCG-stimulated mRNA down to untreated control levels. In the present study, PGF2 a did not display any steroidogenic [Suginami et al., 1976; Khan et al., 1989; Webley et al., 1989; Michael et al., 1993] nor significant anti-steroidogenic actions that it is known to have [Korda et al., 1975; Grinwich et al., 1976; Richardson et al., 1980; Hanzen et al., 1984; Moon et al., 1986; Jalkanen et al., 1987; Michael et al., 1991], exept for a 146 slight inhibition at l O ^ M . In this model, this lack of response occurred although the cells were shown to be responsive to hCG, as both P4 and E 2 production were stimulated. F. General implications If the GnRH-R mRNA levels reflect the binding capacity for GnRH, gonadotrophin seems to be conducive to stronger effects for GnRH, since GnRH-R should be more abundant in their presence. Thus, the presence of GnRH seems to lead to an amplification of its effects through stimulation of its own receptor. In this case, both gonadotrophin and GnRH up-regulate GnRH-R mRNA. With the steroidogenic effects of GnRH, if GnRH and its receptor are present at this stage, they are likely promoting further maturation, rather than preventing it. A negative feedback system in this model is the inhibitory action of GnRH on its own synthesis, for concentrations greater than 10 ' 9 M. Hence, dual regulation of GnRH and GnRH-R mRNA constitute a balanced system that may allow a fine-tuned regulation that maintains homeostatic GnRH effects. Likewise, P G F 2 c r R mRNA varies in the same manner as GnRH-R mRNA, in response to the same stimuli. The presence of GnRH or P G F 2 o c is thus conducive for a potential amplification of P G F 2 a effects though increased receptor availability. However, in the combined presence of h C G , G n R H and P G F 2 a (in any possible combination), P G F 2 a - R mRNA levels were unstimulated as opposed to any of these treatments alone. This absence of effect could represent a normal physiological state as GnRH and P G F 2 a are more likely to be both present than alone. However, i f one of these hormones happened to be lacking, the other one could compensate by increasing its own receptor mRNA, thus possibly increasing its effects. VIII. Comparison between Model I and Model II A. Implications for differential findings GnRH-R transcripts were found to be differentially regulated in the rat granulosa/luteal cells, depending on the model examined. The granulosa cell models studied here are likely representative of different levels of differentiation, since different steroidogenic and molecular responses were observed in the two models, and different yields were obtained. As a reminder, results of the two sets of in vitro studies are summarized in Table X and Figure 63. Although the cells obtained by the two protocoles appeared morphologicaly similar, the yields obtained from the second model were in average higher. The ovaries, after treatment, appeared larger, and carried more follicles, also bigger than in model I. The extra time allowed for follicular maturation in model II is likely to be responsible for this difference. B. Gonadotrophin effects The effects of hCG and L H on GnRH-R mRNA receptor were found to be different in the two granulosa/luteal cell models, with down-regulation by L H in the first model while hCG, sharing the L H receptor, consistently up-regulated GnRH-R mRNA levels in the second. These findings represent the most striking difference between these two models. To attempt to explain this difference, it should be considered that the hormonal environment seen by those two populations of cells before treatment was quite different: The granulosa cells of the first model (I) did not see the elevated El levels preceding the ovulatory signal, but instead, were under continuous gonadotrophin environment. In vivo P M S G treatment (with FSH activity) was directly followed by in vitro FSH pre-treatment. Thus, treatment with a high dose of L H is comparable to the endogenous L H surge that the cells would see in vivo. The GnRH-R mRNA response is in accordance with this hypothesis, since the levels dropped transiently in response to L H , as they did in vivo in response to hCG in the PMSG/hCG primed model described earlier. The cells obtained from the second protocol (model II) were also exposed to P M S G in vivo, but since the cells were collected only shortly before ovulation, they certainly have been exposed to higher and more sustained levels of E2, due to the F S H activity of the P M S G environment. Furthermore, after collection, the cells were not exposed to any gonadotrophin environment for the 24 hours of the recovery period. 148 C . G n R H effects The effects of GnRH on its receptor mRNA were found to be identical in the two models, with a positive auto-regulation by GnRH. Thus, unlike what was observed (and described earlier) in the pituitary [Conn et al., 1994], auto-regulation of GnRH-R by GnRH did not seem to depend on the stage of the cycle, at least not for the two present stages. However, the two models differed again by their steroidogenic response to GnRH. In the first model, GnRH was found to have anti-steroidogenic properties on both basal and stimulated P4 production, while in the second model, GnRH demonstrated steroidogenic effects on basal P4 production. This again reflects the different levels of cell differentiation, and the precarious balance between stimulatory or inhibitory effects. Table X. Recapitulative table of the studies on model I and model II. Effects on: Progesterone Estradiol GnRH-R GnRH PGF 2 a-R Treatment LH MI / Mil + + / NA MI / Mil + / NA Ml / MH _ / NA MH Mil FSH hCG + + / NA NA / + + + / NA NA / + none / NA NA / + + + GnRH - / + NA / ( + ) + / + + - + P G F 2 a GnRH+PGF2a LH/FSH+GnRH hCG + GnRH hCG+PGF2« hCG+Gn+PG NA / (-) NA / + none / NA NA / + NA / + NA / + NA / none NA / none NA / + NA / + NA / + NA / _ NA / none NA / none NA / none NA / none + none + none none none none Shaded areas or 'NA1: Non Applicable;'+ ': stimulation over the untreated control levels;'-' : inhibition over the untreated control levels; 'none': no effect compared to the basal levels. D. Difference in hormonal environment: 150 In the PMSG primed immature rat, PMSG is responsible for inducing follicular maturation, as would be FSH during a normal cycle. Concomitant with follicular development, estradiol levels rise (as observed in the in vivo PMSG/hCG model (Figure 61). In the immature rat, however, E 2 does not get a chance to down-regulate FSH, since stimulation is achieved by PMSG. The second granulosa cell model was matured in vivo for a longer period, giving E 2 the opportunity to raise further, and even reach the plateau phase before declining by the time of autopsy. E 2 is known for its positive, as well as its negative feedback effect on the pituitary. It could be that E 2 has a similar dual function on GnRH/GnRH-R in the ovary, which could lead to a difference in the number of basal GnRH-R at the time of treatment of the cultured granulosa cells. The basal levels of GnRH-R could be conducive to a difference in response to GnRH and how the cells respond to gonadotrophin in regard to GnRH-R mRNA variations. In conclusion, the differential effects observed in these two models illustrate the importance of maintaining awareness of the ability of subtle differences in models to result in profound changes in culture differentiation and cellular responses. Thus, the multitude of different models presented in the literature constitutes a barrier for the interpretation of the results, but may also provide a valuable pool of unexploited information. 151 MODEL I PMSG HC PMSG MODEL II Ovar ies ( f DMEM:F12 X +fBS(1%) \\ +Pen/Strep (1%) I .^ +Andro +FSH / P 48 h Granu losa Ce l ls P re -cu l tu re 2 4 Treatment I I T 5 4 h Granu losa Ce l l s Ovar ies ( DMEM:F12 +Andro +Treatment ) 2 4 h Recovery / DMEM:FI2 \\ P J I +FBS (10%) I \\+Pen/Strep (1%)/ +LH — P 4 / E 2 RIA 2 4 R N A e x t r a c t i o n I 1 8 h GnRH-** LH GnRH-R GnRH-R Treatment ( DMEM:F12 \\ +Andro 1 +Treatment J +hCG P 4 / E 2 RIA R N A e x t r a c t i o n g hCG ^ - G n R H GnRH-R GnRH-R P 4 P 4 Figure 63. Comparison between Model I and Model II, and their outcome. (Red is for inhibition; green is for stimulation; — indicates the approximate time of ovulation). Subtle differences in the protocol used to obtain granulosa cells from PMSG primed immature rats resulted in significant differences in the outcome of the treatments. The major differences were seen in the effects of GnRH on steroidogenesis and the GnRH-R mRNA response to gonadotrophins. E. Suggested studies to clarify the issue of dual responses 152 The present study revealed a number of differential responses to some treatments depending on the initial conditions. These dual responses were discussed earlier. To better understand the number of dual effects observed during the course of these studies, deeper regulation studies at the level of the gene would be necessary. A system involving regulatory elements in the regulatory region of the GnRH-R gene would certainly be able to explain the complexity of the patterns observed. Regulatory elements that could be expected to be found include different hormone response elements (HRE) such as estrogen response element (ERE) and c A M P response element (CRE). Transfection of the promoter region of the GnRH-R gene in a C A T (Chloramphenicol Acetyl Transferase) system, and directed deletions and mutations would certainly yield some answers in the regulation of the GnRH-R gene expression. In short, in a C A T assay, a putative regulatory sequence is cloned into a plasmid containing CAT. Different regulatory elements can be tested, and the presence of a response element is revealed and measured by expression of CAT. Directed deletion suppresses the response. Regulatory regions can be complex, and the level of complexity could explain the multiple outcomes in cellular responses. 153 SUMMARY The effects of luteinizing hormone (LH), follicle stimulating hormone (FSH), human chorionic gonadotrophin (hCG), gonadotrophin-releasing hormone (GnRH) and prostaglandin F 2 alpha ( P G F 2 a ) on the regulation of GnRH-R mRNA levels were investigated in vivo and in vitro. Progesterone (P4) and estradiol (E 2) production were measured routinely. The rat models used in these studies included mature cycling female Sprague Dawley rats, as well as immature rats primed with pregnant mare serum gonadotrophin (PMSG) alone, or PMSG followed by hCG. Animals primed with PMSG/hCG were used as an in vivo model for the peri-ovulatory period. Animals primed with P M S G alone were used to obtain granulosa cells. Cells were cultured in vitro, subjected to experimental treatments and assayed for the mRNA of interest and steroids. GnRH-R mRNA expression was localized by Southern blotting to the reproductive tissues of both male and female Sprague Dawley rat, as well as in steroidogenic and steroid sensitive tissues. GnRH-R mRNA could be detected in the gonads of both male and female shortly after birth. The intensity of the signal detected by Southern blotting increased progressively towards adult life. In the pituitary, the signal was already present in young animals (D8), and increased with increasing maturity. In the cycling adult female, pituitary GnRH-R mRNA levels were found to be at their highest levels on the morning of the second day of diestrus. Levels declined towards estrus, reaching lows up to 2-fold below the diestrus II levels by the morning of the estrus, and rising again to 75% of the diestrus II levels by the morning of diestrus I. In the ovary, no apparent changes could be detected between the mornings of each day of the cycle. Serum P4 and E 2 levels followed previously reported profiles, thus validating the model. Since GnRH-R mRNA variations were not detectable in the ovary of the cycling adult, a second in vivo model was chosen to represent the peri-ovulatory period. Briefly, 28-day old female Sprague Dawley rats were injected subcutaneously (s.c.) with saline (group 1) or 10 IU P M S G (groups 2 to 4). After 48 hours, groups 3 and 4 received 10 IU hCG s.c. Group 1 (control) and two (pre-ovulatory) were sacrificed 48 hours after the first injection. Group 3 (ovulatory) was sacrificed 12 hours after the second injection, and group 4 (post-ovulatory) was sacrificed 48 hours after the second injection. Ovarian and pituitary GnRH-R mRNA levels were measured by Northern blots and/or RT/PCR followed by Southern blots. In the pituitary, GnRH-R mRNA levels were reduced by 2-fold in the pre-ovulatory and the ovulatory group compared to control and the post-ovulatory group. In the ovary, GnRH-R mRNA levels decreased by 75% in the ovulatory group compared to the control, and were 50% of the control in the post-ovulatory group. Serum P4 levels increased over the course of the treatment, to reach a high 30 times the control levels at ovulation, followed by a relatively slight decrease to 10 times the control levels for the post-ovulatory group. Estradiol levels were found to be raised only in the pre-ovulatory group, where they were twice that of the control. Another series of experiments examined the effects of experimental treatments of cultured granulosa cells on GnRH-R mRNA expression. Cells were obtained from the ovaries of P M S G primed immature rats, and plated in the presence of androstenedione and FSH. Following the 24 hours pre-culture period, cells were treated with various concentrations of L H , FSH and GnRH, alone or in combination, in time courses or 24h concentration responses experiments. Progesterone profiles, measured by RIA showed a steroidogenic effect of high concentrations (1000 ng) of L H and FSH, with 5- to 6-fold stimulation over basal P4 production. GnRH (IO\" 6 M) inhibited basal P4 production by 30%, and inhibited gonadotrophin-stimulated P4 output down to basal levels. Time course effects of L H (1000 ng), as revealed by RT/PCR followed by Southern blotting, demonstrated a strong reduction of GnRH-R mRNA levels 12 hours after application of L H , with levels returning to control by 48 hours. L H concentration response exhibited the same down-regulation of GnRH-R mRNA levels by more than two times. GnRH was shown to stimulate its own receptor mRNA for concentrations ranging from IO\"7 to l O ^ M . FSH had no effect on GnRH-R mRNA levels. In a last series of experiments, the effects of hCG, GnRH and P G F 2 a on GnRH-R mRNA levels were investigated. GnRH and PGF2 a -R mRNA levels were also measured. Granulosa cells obtained as previously described, were plated in plain medium for 24 hours, and exposed to various combinations of treatments for 18 hours. In this model, hCG was found to elevate GnRH-R and PGF2 a -R mRNA levels in a concentration response manner, as demonstrated by RT/PCR. Progesterone and estradiol, measured by RIA, also increased (up to 3 times) in response to hCG treatment. A concentration related increase of GnRH-R and P G F 2 a - R mRNA levels could be observed in response to GnRH treatment, while GnRH mRNA was inhibited by higher concentrations of GnRH ( IO - 6 M) , and stimulated in the mid-range concentrations ( I O 9 M). Progesterone production, but not estradiol, was stimulated by GnRH at the higher concentrations (10-8 to I O 6 M). Finally, P G F 2 a was found to inhibit GnRH-R mRNA levels in a bimodal fashion, with IO - 9 M lowering the mRNA levels by half, while lower and higher concentrations were without effect. The response of PGF2crR mRNA to P G F 2 a treatment was also bimodal, with an increase in mRNA levels at the low and high concentrations, while the mid-range concentration (IO' 9 M) had no effect on mRNA levels. 156 The present study demonstrated that: 1. GnRH-R mRNA expression was localized to steroidogenic or steroid-dependent tissues, supporting a general role of GnRH as a modulator of steroidogenesis. 2. GnRH-R mRNA expression was found to increase in the ovary, the testis and the pituitary during ontogeny of the neonatal to pre-pubertal rat, suggesting that GnRH is implied in the sexual maturation, as well as the adult reproductive functions of the rat 3. The ovary of the cycling adult female did not display any variation in GnRH-R mRNA levels, possibly because of the multi-stage nature of the follicles. 4. A . Ovarian and pituitary GnRH-R mRNA variations were detected in response to PMSG/hCG treatment of immature rats. B. Together with the pituitary pattern observed in the adult female, these results outline the dual role of GnRH as a hypothalamic regulator of gonadotrophin secretion, controlled by steroids, and a gonadal regulator of steroidogenesis, controlled by gonadotrophins. 5. LH/hCG and GnRH were found to have dual effects on GnRH-R and steroidogenesis, depending on the in vitro granulosa/luteal cell studied. Subtle differences in models result in profound changes in cellular differentiation and response to stimuli. Multitude of different models presented in the literature constitutes a barrier for the interpretation of the results, but may also provide a valuable pool of unexploited information. 157 In conclusion, GnRH-R mRNA levels were found to be altered by a number of experimental treatments, suggesting that the control of GnRH actions in the ovary can also be exerted through control of its receptor mRNA levels. REFERENCES 158 Abramovitz M , Boie Y , Nguyen T, Rushmore T H , Bayne M A , Metters K M , Slipetz D M , Grygorczyk R. Cloning and expression of a cDNA for the human prostanoid FP receptor. J Biol Chem 1994; 269:2632-6. Advis J, Simpkins J, Chen H , Meites J. Relation of biogenic amines to onset of puberty in the female rat. Endocrinology 1978; 103:11-6. Aksel S, Schomberg DW , Hammond CB. Prostaglandin F 2 alpha production by the human ovary. Obstet Gynecol 1977; 50:347-50. Andries M , Denef C. Gonadotrophin-releasing hormone influences the release of prolactin and growth hormone from intact rat pituitary in vitro during a limited period in neonatal life. Peptides 1995; 16:527-32. Aubert M L , Begeot M , Winiger BP, Morel G, Sizonenko PC , Dubois P M . Ontogeny of hypothalamic luteinizing hormone-releasing hormone (GnRH) and pituitary GnRH receptors in fetal and neonatal rats. Endocrinology 1985; 116:1565-76. Auclair C, Stern M , Givner M L . L H R H and analogues as potential therapy for benign prostatic hyperplasia and hormone-dependent cancers. Arch Androl 1981; 7:237-44. Badr M , Pelletier G. Characterization and autoradiographic localization of L H R H receptors in the rat brain. Synapse 1987; 1:567-71. 159 Badr M , Marchetti B , Pelletier G. Modulation of hippocampal L H R H receptors by sex steroids in the rat. Peptides 1988; 9:441-2. Bahk JY, Hyun JS, Chung SH, Lee H , Kim MO, Lee B H , Choi WS. Stage specific identification of the expression of GnRH mRNA and localization of the GnRH receptor in mature rat and adult human testis. J Urol 1995; 154:1958-61. Baker HJ. Essential functions of Animal Care and Use Committees. Lab Anim Sci 1987; Baker HJ. Laboratory animal science: future [letter]. Lab Anim Sci 1990; 40:597-8. Baldwin D M , Bourne GA , Marshall JC. Pituitary L H responsiveness to GnRH in vitro as related to GnRH receptor number. A m J Physiol 1984; 247(5.1):E651-6. Balthazart J, Balthazart R , Cheng MF. Hormonal control of the gonadal regression and recovery observed in short days in male and female doves. Journal of Endocrinology 1981; 89:79-89. Ban E, Crumeyrolle A M , Latouche J, Leblanc P, Heurtier JF, Drieu K , Fillion G , Haour F. GnRH receptors in rat brain, pituitary and testis; modulation following surgical and gonadotrophin-releasing hormone agonist-induced castration. Mol Cell Endocrinol 1990; 70:99-107. Battisti A , Vallarino M , Carnevali O, Fasano S, Polzonetti M A , Pierantoni R. Detection and localization of gonadotrophin-releasing hormone (GnRH)-like material in the frog, Rana esculenta, ovary. Comp Biochem Physiol A Physiol 1994; 109:1097-103. Bauer D A , Knox K L , Schwartz NB , Levine JE. Estrous cycle stage-dependent effects of neuropeptide-Y on luteinizing hormone (LH)-releasing hormone-stimulated L H and follicle-160 stimulating hormone secretion from anterior pituitary fragments in vitro. Endocrinology 1993; 133:2413-7. Begeot M, Hemming FJ, Martinat N, Dubois MP, Dubois PM. Gonadotropin releasing hormone (GnRH) stimulates immunoreactive lactotrope differentiation. Endocrinology 1983; 112:2224-6. Berger H, Sandow J, Heinrich N, Albrecht E, Kertscher U , Oehlke J. Disposition of the 3H-labeled gonadotropin-releasing hormone analog buserelin in rats. Drug Metab Dispos 1993; 21:818-22. Bjurulf E, Selstam G , Olofsson JI. Increased LH receptor mRNA and extended corpus luteum function induced by prolactin and indomethacin treatment in vivo in hysterectomized pseudopregnant rats. J Reprod Fertil 1994; 102:139-45. Brambaifa N , Schillinger E. Binding of prostaglandin F2 alpha and 20 alpha-hydroxysteroid-dehydrogenase activity of immature rat ovaries throughout pseudopregnancy. Prostaglandins LeukotMed 1984; 14:225-34. Brooks J, Taylor PL, Saunders PT, Eidne KA, Struthers WJ , McNeilly AS. Cloning and sequencing of the sheep pituitary gonadotropin-releasing hormone receptor and changes in expression of its mRNA during the estrous cycle. Mol Cell Endocrinol 1993; 94. Bussmann LE. Prostaglandin F-2 alpha receptors in corpora lutea of pregnant rats and relationship with induction of 20 alpha-hydroxysteroid dehydrogenase. J Reprod Fertil 1989; 85:331-41. Carone FA, Stetler SM, May V, LaBarbera A , Flouret G. Differences between in vitro and in vivo degradation of LHRH by rat brain and other organs. Am J Physiol 1987; 253(3.1):E317-21. CCoAC: Canadian Council on Animal Care. Guide to the Care and Use of Experimental Animals. 1984; 175-89. Channing CP, Hillensjo T , Schaerf FW. Hormonal control of oocyte meiosis, ovulation and luteinization in mammals. [Review]. Clin Endocrinol Metab 1978; 7:601-24. Channing C, Schaerf FW, Anderson L , Tsafriri A . Ovarian follicular and luteal physiology. [Review]. Int Rev Physiol 1980; 22:117-121. Chi L , Zhou W, Prikhozhan A, Flanagan C, Davidson JS, Golembo M , Illing N , Millar R P , Sealfon SC. Cloning and characterization of the human GnRH receptor. Mol Cell Endocrinol 1993; 91. Chun SY, Bill ig H, Tilly JL, Furuta I, Tsafriri A , Hsueh AJ. Gonadotropin suppression of apoptosis in cultured preovulatory follicles: mediatory role of endogenous insulin-like growth factor I. Endocrinology 1994; 135:1845-53. Clayton R N , Harwood J P , Catt KJ . Gonadotropin-releasing hormone analogue binds to luteal cells and inhibits progesterone production. Nature 1979; 282:90-2. Clayton RN, Solano AR, Garcia V A , Dufau M L , Catt KJ . Regulation of pituitary receptors for gonadotropin-releasing hormone during the rat estrous cycle. Endocrinology 1980; 107:699-706. Clayton RN, Detta A , Nikula H , Huhtaniemi IT. Physiological role of putative testicular gonadotrophin releasing hormone (GnRH). Med Biol 1986; 63:201-9. Clayton RN. Mechanism of GnRH action in gonadotrophs. [Review]. Hum Reprod 1988; 3:479-83. 162 Clayton R N , Eccleston L , Gossard F, Thalbard JC , Morel G. Rat granulosa cells express the gonadotrophin-releasing hormone gene: evidence from in-situ hybridization histochemistry. J Mol Endocrinol 1992;9:189-95. Combarnous Y . Structure and structure-function relationships in gonadotropins. Reproduction, Nutrition, Developement 1988; 28:211-18. Conn P M , Staley D, Harris C, Andrews WV, Gorospe WC, McArdle C A , Huckle WR , Hansen J. Mechanism of action of gonadotropin releasing hormone. [Review]. Annu Rev Physiol 1986; 48:495-513. Conn P M , Crowley WJ. Gonadotropin-releasing hormone and its analogs. [Review]. Annu Rev Med 1994; 45:391-405. Corbin A. From contraception to cancer a review of the therapeutic applications of L H R H analogues as antitumor agents. Yale J Biol Med 1982; 55:27-47. Crumeyrolle A M , Latouche J, Laniece P, Charon Y , Tricoire H, Valentin L , Roux P, Mirambeau G, Leblanc P, Fillion G. \"In situ\" characterization of GnRH receptors: use of two radioimagers and comparison with quantitative autoradiography. J Recept Res 1994; 14:251-65. Currie WD, L i W, Baimbridge K G , Yuen B H , Leung PC. Cytosolic free calcium increased by prostaglandin F2 alpha (PGF2 alpha), gonadotropin-releasing hormone, and angiotensin II in rat granulosa cells and PGF2 alpha in human granulosa cells. Endocrinology 1992; 130:1837-43. Dalkin A C , Bourne G A , Pieper DR, Regiani S , Marshall JC. Pituitary and gonadal gonadotropin-releasing hormone receptors during sexual maturation in the rat. Endocrinology 1981; 108:1658-64. 163 Dennefors B , Hamberger L , Hillensjo T, Holmes P, Janson PO, Magnusson C , Nilsson L. Aspects concerning the role of prostaglandins for ovarian function. [Review]. Acta Obstet Gynecol Scand Suppl 1983; 113:31-41. Donham R, Champney T, Kerner T , Stetson M . Temporary anestrus induced by injection of luteinizing hormone-releasing hormone in hamsters. Biol Reprod 1993; 48:1135-40. Dorflinger LJ , Albert PJ, Williams A T , Behrman HR. Calcium is an inhibitor of luteinizing hormone-sensitive adenylate cyclase in the luteal cell. Endocrinology 1984; 114:1208-15. Dufau M L , Knox GF. Fetal Leydig cell culture—an in vitro system for the study of trophic hormone and GnRH receptors and actions. [Review]. J Steroid Biochem 1985; 23:743-55. Dufour S, Lopez E, Le M , Le B, Baloche S , Fontaine Y . Stimulation of gonadotropin release and of ovarian development, by the administration of a gonadoliberin agonist and of dopamine antagonists, in female silver eel pretreated with estradiol. General & Comparative Endocrinology 1988; 70:20-30. Duncan JA, Dalkin A C , Barkan A , Regiani S , Marshall JC. Gonadal regulation of pituitary gonadotropin-releasing hormone receptors during sexual maturation in the rat. Endocrinology 1983;113:2238-46. Dutlow C M , Rachman J, Jacobs T W , Millar RP. Prepubertal increases in gonadotropin-releasing hormone mRNA, gonadotropin-releasing hormone precursor, and subsequent maturation of precursor processing in male rats. J Clin Invest 1992; 90:2496-501. Eidne K A , Sellar RE, Couper G, Anderson L , Taylor PL. Molecular cloning and characterisation of the rat pituitary gonadotropin-releasing hormone (GnRH) receptor. Mol Cell Endocrinol 1992; 90(1): R5-9. 164 Ekholm C, Hillensjo T , Isaksson O. Gonadotropin releasing hormone agonists stimulate oocyte meiosis and ovulation in hypophysectomized rats. Endocrinology 1981; 108:2022-4. Fan NC, Jeung EB, Peng C, Olofsson JI, Krisinger J , Leung PC. The human gonadotropin-releasing hormone (GnRH) receptor gene: cloning, genomic organization and chromosomal assignment. Mol Cell Endocrinol 1994; 103(1-2): R l -6 Filicori M , Bolelli G, Franceschetti F , Lafisca S. The ultradian pulsatile release of gonadotropins in normal female subjects. Acta Europaea Fertilitatis 1979; 10:29-33. Fink G. Oestrogen and progesterone interactions in the control of gonadotrophin and prolactin secretion. [Review]. J Steroid Biochem 1988; 30:169-78. Fox J, Cohen B , Loew F. Laboratory Animal Medicine. Academic press, inc. 1984; 95-99. Fraser H M , Lunn SF, Whitelaw P F , Hillier SG. Induced luteal regression: differential effects on follicular and luteal inhibin/activin subunit mRNAs in the marmoset monkey. J Endocrinol 1995; 144:201-8. Glisin V , Crkvenjakov R , Byus C. Ribonucleic acid isolated by cesium chloride centrifugation. Biochemistry 1974; 13:2633-7. Goubau S, Bond CT, Adelman JP, Misra V , Hynes MF, Schultz GA , Murphy BD. Partial characterization of the gonadotropin-releasing hormone (GnRH) gene transcript in the rat ovary. Endocrinology 1992; 130:3098-100. Gray C. Glycoprotein gonadotropins. Structure and synthesis. Acta Endocrinologica, Supplement 1988; 288:20-7. 165 Gregg DW, Allen M C , Nett T M . Estradiol-induced increase in number of gonadotropin-releasing hormone receptors in cultured ovine pituitary cells. Biol Reprod 1990; 43(6): 1032-6. Gregg DW , Nett T M . Direct effects of estradiol-17 beta on the number of gonadotropin-releasing hormone receptors in the ovine pituitary. Biol Reprod 1989; 40:288-93. Grinwich D, Ham E, Hichens M , Behrman H. Binding of human chorionic gonadotrophin and response of cyclic nucleotides to luteinizing hormone in luteal tissue from rats treated with prostaglandin F2alpha. Endocrinology 1976; 98:146-50. Grober MS, Myers TR, Marchaterre M A , Bass A H , Myers DA. Structure, localization, and molecular phylogeny of a GnRH cDNA from a paracanthopterygian fish, the plainfin midshipman (Porichthys notatus). Gen Comp Endocrinol 1995; 99:85-99. Hall A K , Robinson J. Functional luteolysis in the pseudopregnant rat: effects of prostaglandin F2 alpha and 16-aryloxy prostaglandin F2 alpha in vitro. J Endocrinol 1979; 81:157-65. Hanzen C. Prostaglandins and the physiology of human and animal reproduction. J Gynecol Obstet Biol Reprod (Paris) 1984; 13:351-61. Haour F , Lang B. Role of hormonal receptors in the regulation of the corpus luteum (author's transl). [French]. Semaine Des Hopitaux De Paris 1978; 54:1063-70. Harwood JP, Clayton RN , Catt KJ . Ovarian gonadotropin-releasing hormone receptors. I. Properties and inhibition of luteal cell function. Endocrinology 1980; 107:407-13. Harwood JP, Clayton RN, Chen TT, Knox G , Catt KJ . Ovarian gonadotropin-releasing hormone receptors. II. Regulation and effects on ovarian development. Endocrinology 1980; 107:414-21. 166 Heber D, Marshall JC , Odell WD. GnRH membrane binding: identification, specificity, and quantification in nonpituitary tissues. Am J Physiol 1978; 235(2): E227-30. Heritier A G , Dubois PM. Re-evaluation of gonadotropin-releasing hormone (GnRH) action on pituitary cell differentiation with special regard to its effect on L H and TSH cell types. J Neuroendocrinol 1994; 6:33-7. Hierowski MT, Altamirano P, Redding TW , Schally A V . The presence of LHRH-like receptors in Dunning R3327H prostate tumors. Febs Lett 1983; 154:92-6. Hillensjo T, Barnea A , Nilsson L , Herlitz H , Ahren K. Temporal relationship between serum L H levels and oocyte maturation in prepubertal rats injected with pregnant mare's serum gonadotropin. Endocrinology 1974; 95:1762-6. Hillensjo T , LeMaire WJ. Gonadotropin releasing hormone agonists stimulate meiotic maturation of follicle-enclosed rat oocytes in vitro. Nature 1980; 287:145-6. Hillier SG, Smyth CD, Whitelaw PF, Miro F , Howies C M . Gonadotrophin control of follicular function. Horm Res 1995; 43:216-23. Hoppen HO. The equine placenta and equine chorionic gonadotrophin—an overview. [Review]. Exp Clin Endocrinol 1994; 102:235-43. Hsueh AJ , Wang C , Erickson GF. Direct inhibitory effect of gonadotropin-releasing hormone upon follicle-stimulating hormone induction of luteinizing hormone receptor and aromatase activity in rat granulosa cells. Endocrinology 1980; 106:1697-705. Hsueh AJ , Jones PB. Extrapituitary actions of gonadotropin-releasing hormone. [Review]. Endocr Rev 1981; 2:437-61. Hsueh M , Adashi E, Tucker E, Valk C , Ling NC. Relative potencies of gonadotrophin-releasing hormone agonists and antagonists on ovarian and pituitary functions. Endocrinology 1983; 112:689-95. Hsueh A J , Adashi E Y , Jones PB , Welsh TJ. Hormonal regulation of the differentiation of cultured ovarian granulosa cells. [Review]. Endocr Rev 1984; 5:76-127. Huckle W R , Conn PM. The relationship between gonadotropin-releasing hormone-stimulated luteinizing hormone release and inositol phosphate production: studies with calcium antagonists and protein kinase C activators. Endocrinology 1987; 120:160-9. Huckle W R , Conn P M . Molecular mechanism of gonadotropin releasing hormone action. II. The effector system. [Review]. Endocr Rev 1988;9:387-95. Huhtaniemi IT, Catt K J , Clayton RN. Newborn and immature rat testes contain gonadotropin-releasing hormone (GnRH) receptors, and their testosterone production is stimulated by a GnRH agonist in vitro. Mol Cell Endocrinol 1985; 40:41-4. Illing N , Jacobs GF, Becker II, Flanagan CA, Davidson JS, Eales A , Zhou W, Sealfon SC , Millar RP. Comparative sequence analysis and functional characterization of the cloned sheep gonadotropin-releasing hormone receptor reveal differences in primary structure and ligand specificity among mammalian receptors. Biochem Biophys Res Commun 1993; 196:745-51. Jaffe RB. Regulation of the human menstrual cycle. Basic Life Sciences 1974: 4(A):371-83. 168 Jalkanen J, Ritvos O, Huhtaniemi I, Stenman U , Laatikainen T , Ranta T. Phorbol ester stimulates human granulosa-luteal cell cyclic adenosine 3', 5-monophosphate and progesterone production. Mol Cell Endocrinol 1987; 51:273-6. Jayatilak PG, Shah PG , Sheth AR. Role of adrenals on the 24-hour periodicity in hypothalamo-pituitary axis in male rat. Endokrinologie 1980; 76:137-42. Jennes L. Prenatal development of the gonadotropin-releasing hormone-containing systems in rat brain. Brain Res 1989; 482:97-108. Jennes L. Prenatal development of gonadotropin-releasing hormone receptors in the rat anterior pituitary. Endocrinology 1990; 126:942-7. Jennes L , Conn PM. Gonadotropin-releasing hormone and its receptors in rat brain. [Review]. Front Neuroendocrinol 1994; 15:51-77. Joshi D, Lekhtman I, Billiar RB , Miller M M . Gonadotropin hormone-releasing hormone induced luteinizing hormone responses in young and old female C57BL/6J mice. Proc Soc Exp Biol Med 1993;204:191-4. Kaiser U B , Zhao D, Cardona GR , Chin WW. Isolation and characterization of cDNAs encoding the rat pituitary gonadotropin-releasing hormone receptor. Biochem Biophys Res Commun 1992; 189:1645-52. Kakar SS, Grizzle W E , Neill JD. (a) The nucleotide sequences of human GnRH receptors in breast and ovarian tumors are identical with that found in pituitary. Mol Cell Endocrinol 1994; 106:145-9. 169 Kakar SS, Grantham K , Musgrove L C , Devor DC, Sellers JC , Neill JD. (b) Rat gonadotrophin-releasing hormone (GnRH) receptor: tissue expression and hormonal regulation of its mRNA. Mol. Cell Endocrinol 1994; 101:151-157. Kakar SS, Rahe C , Neill J. Molecular cloning, sequencing, and characterizing the bovine receptor for gonadotropin releasing hormone (GnRH). Domest Anim Endocrinol 1993; 10:335-42. Kakar SS, Musgrove L C , Devor DC, Sellers JC , Neill JD. Cloning, sequencing, and expression of human gonadotropin releasing hormone (GnRH) receptor. Biochem Biophys Res Commun 1992; 189:289-95. Kalra PS , Kalra SP. Circadian periodicities of serum androgens, progesterone, gonadotropins and luteinizing hormone-releasing hormone in male rats: the effects of hypothalamic deafferentation, castration and adrenalectomy. Endocrinology 1977; 101:1821-7. Khan DF, Huang JC , Dawood M Y . Effect of human chorionic gonadotropin and prostaglandin F2a on progesterone production by human luteal cells. J Steroid Biochem 1989; 33:941-7. Kiesel L , Bertges K , Rabe T , Runnebaum B. Gonadotropin releasing hormone enhances polyphosphoinositide hydrolysis in rat pituitary cells. Biochem Biophys Res Commun 1986; 134:861-7. King JA, Millar RP, Vallarino M , Pierantoni R. Localization and characterization of gonadotropin-releasing hormones in the brain, gonads, and plasma of a dipnoi (lungfish, Protopterus annectens). Regul Pept 1995; 57:163-74. Kogo H , Kudo A , Park M K , Mori T , Kawashima S. In situ detection of gonadotropin-releasing hormone (GnRH) receptor mRNA expression in the rat ovarian follicles. J Exp Zool 1995; 272:62-8. 170 Koos RD , LeMaire WJ. The effects of a gonadotropin-releasing hormone agonist on ovulation and steroidogenesis during perfusion of rabbit and rat ovaries in vitro. Endocrinology 1985; 116:628-32. Korda A , Shutt D, Smith I, Shearman R , Lyneham R. Assessment of possible luteolytic effect on intra-ovarian injection of prostaglandin F2a in the human. Prostaglandins 1975; 9:443-9. Koves K , Gottschall P E , Arimura A. Gonadotropin-releasing hormone binding sites in ovaries of normal cycling and persistent-estrus rats. Biol Reprod 1989; 41:505-11. Laatikainen T. Corticotropin-releasing hormone and opioid peptides in reproduction and stress. 1991;23:489-96. Lahav M , Davis JS , Rennert H. Mechanism of the luteolytic action of prostaglandin F-2 alpha in the rat. J Reprod Fertil Suppl 1989; 37:233-40. Lake S, Gullberg H , Wahlqvist J, Sjogren A M , Kinhult A , Lind P, Hellstrom L E , Stjernschantz J. Cloning of the rat and human prostaglandin F2 alpha receptors and the expression of the rat prostaglandin F2 alpha receptor. Febs Lett 1994; 355:317-25. Lamprecht SA, Kohen F, Ausher J, Zor U , Lindner HR. Hormonal stimulation of oestradiol-17 beta release from the rat ovary during early postnatal development. J Endocrinol 1976; 68:343-4. LaPolt PS, Oikawa M , Jia X C , Dargan C , Hsueh AJ. Gonadotropin-induced up- and down-regulation of rat ovarian L H receptor message levels during follicular growth, ovulation and luteinization. Endocrinology 1990; 126:3277-9. 171 LaPolt PS, Tilly JL, Aihara T, Nishimori K , Hsueh AJ. Gonadotropin-induced up- and down-regulation of ovarian follicle-stimulating hormone (FSH) receptor gene expression in immature rats: effects of pregnant mare's serum gonadotropin, human chorionic gonadotropin, and recombinant FSH. Endocrinology 1992; 130:1289-95. Larson L , Olofsson J, Hellberg P, Brannstrom M , Selstam G , Hedin L . Regulation of prostaglandin biosynthesis by luteinizing hormone and bradykinin in rat preovulatory follicles in vitro. Prostaglandins 1991;41:111-21. Latouche J, Crumeyrolle A M , Jordan D, Kopp N , Augendre FB, Cedard L , Haour F. GnRH receptors in human granulosa cells: anatomical localization and characterization by autoradiographic study. Endocrinology 1989; 125:1739-41. Laws SC, Webster JC , Miller WL. Estradiol alters the effectiveness of gonadotropin-releasing hormone (GnRH) in ovine pituitary cultures: GnRH receptors versus responsiveness to GnRH. Endocrinology 1990; 127:381-6. Laws SC, Beggs MJ, Webster JC , Miller WL. Inhibin increases and progesterone decreases receptors for gonadotropin-releasing hormone in ovine pituitary culture. Endocrinology 1990; 127:373-80. Leblanc P, Crumeyrolle M , Latouche J, Jordan D, Fillion G, L'Heritier A , Kordon C, Dussaillant M , Rostene W , Haour F. Characterization and distribution of receptors for gonadotropin-releasing hormone in the rat hippocampus. Neuroendocrinology 1988; 48:482-8. Lee WS, Smith MS , Hoffman GE. Progesterone enhances the surge of luteinizing hormone by increasing the activation of luteinizing hormone-releasing hormone neurons. Endocrinology 1990; 127:2604-6. 172 Leung PC , Steele GL. Intracellular signaling in the gonads. [Review]. Endocr Rev 1992; 13:476-98. Leung PC, Wang J , Baimbridge K G . Mechanism of action of luteinizing hormone-releasing hormone in rat ovarian cells. [Review]. Can J Physiol Pharmacol 1989; 67:962-7. Leung PC. Mechanisms of gonadotropin-releasing hormone and prostaglandin action on luteal cells. [Review]. Can J Physiol Pharmacol 1985; 63:249-56. Leung PC , Armstrong DT. Estrogen treatment of immature rats inhibits ovarian androgen production in vitro. Endocrinology 1979; 104:1411-7. Levi L N , Ben A N , Tel OS, Palmon A , Burstein Y , Koch Y . Expression of the gene for the receptor of gonadotropin-releasing hormone in the rat mammary gland. Febs Lett 1996; 379:186-90. L i WI, Jiao S , Chin PP. Immunoreactive gonadotropin-releasing hormone in porcine reproductive tissues. Peptides 1993; 14:543-9. Ling N , DePaolo L V , Bicsak TA , Shimasaki S. Novel ovarian regulatory peptides: inhibin, activin, and follistatin. [Review]. Clin Obstet Gynecol 1990;33:690-702. Lloyd J M , Childs GV. Changes in the number of GnRH-receptive cells during the rat estrous cycle: biphasic effects of estradiol. Neuroendocrinology 1988; 48:138-46. Lopez B A , Bellinger J, Marshall JM, Phaneuf S, Europe FG, Asboth G , Barlow DH. G protein expression and second messenger formation in human granulosa cells. J Reprod Fertil 1995; 104:77-83. Luborsky JL, Dorflinger LJ , Wright K , Behrman HR. Prostaglandin F2 alpha inhibits luteinizing hormone (LH)-induced increase in L H receptor binding to isolated rat luteal cells. Endocrinology 1984; 115:2210-6. Marchetti B , Cioni M . Opposite changes of pituitary and ovarian receptors for L H R H in ageing rats: further evidence for a direct neural control of ovarian L H R H receptor activity. Neuroendocrinology 1988;48:242-51. Massicotte J, Lachance R , Labrie F. Modulation of cyclic A M P formation and progesterone secretion by human chorionic gonadotropin, epinephrine, buserelin and prostaglandins in normal or human chorionic gonadotropin desensitized rat immature luteal cells in monolayer culture. J Steroid Biochem 1984; 21:217-26. McCarty K . Oestrogen and progesterone receptors: physiological and pathological considerations. J. Clin. Endocrinol. Metab 1983; 12:133,. McNeilly AS. The control of FSH secretion. [Review]. Acta Endocrinol Suppl (Copenh) 1988; 288:31-40. Michael A E , Abayasekara D R , Webley GE. The luteotrophic actions of prostaglandins E2 and F2 alpha on dispersed marmoset luteal cells are differentially mediated via cyclic A M P and protein kinase C. J Endocrinol 1993; 138:291-8. Michael A E , Webley GE. Roles of cyclic A M P and inositol phosphates in the luteolytic action of cloprostenol, a prostaglandin F2 alpha'analogue, in marmoset monkeys (Callithrix jacchus). J Reprod Fertil 1993; 97:425-31. Michael A E , Webley GE. Prostaglandin F2a stimulates cAMP phosphodiesterase via protein kinase C in cultured human granulosa cells. Mol Cell Endocrinol 1991; 82:207-14. 174 Millar RP, Garritsen A , Hazum E. Characterization of Leydig cell gonadotropin-releasing hormone binding sites utilizing radiolabeled agonist and antagonist. Peptides 1982; 3:789-92. Moon Y S , Duleba AJ , K im KS , Yuen BH. Effects of prostaglandins E2 and F2 alpha on progesterone metabolism by rat granulosa cells. Biochem Biophys Res Commun 1986; 135:764-9. Morale M C , Batticane N , Bartoloni G, Guarcello V, Farinella Z, Galasso M G , Marchetti B. Blockade of central and peripheral luteinizing hormone-releasing hormone (LHRH) receptors in neonatal rats with a potent LHRH-antagonist inhibits the morphofunctional development of the thymus and maturation of the cell-mediated and humoral immune responses. Endocrinology 1991; 128:1073-85. Morris JK , Richards JS. Hormone induction of luteinization and prostaglandin endoperoxide synthase-2 involves multiple cellular signaling pathways. Endocrinology 1993; 133:770-9. Moumni M , Kottler M , Counis R. Nucleotide sequence analysis of mRNAs predicts that rat pituitary and gonadal gonadotropin-releasing hormone receptor proteins have identical primary structure. Biochem Biophys Res Commun 1994; 200:1359-66. Murdoch WJ. Immunolocalization of a gonadotropin-releasing hormone receptor site in murine endometrium that mediates apoptosis. Cell Tissue Res 1995; 282:527-9. Naik SI, Saade G, Delta A , Clayton RN. Homologous ligand regulation of gonadotrophin-releasing hormone receptors in vivo: relationship to gonadotrophin secretion and gonadal steroids. J Endocrinol 1985; 107:41-7. Naik SI, Young LS, Saade G, Kujore A , Charlton H M , Clayton RN. Role of GnRH in the regulation of pituitary GnRH receptors in female mice. J Reprod Fertil 1985; 74:605-14. 175 Natraj U , Richards JS. Hormonal regulation, localization, and functional activity of the progesterone receptor in granulosa cells of rat preovulatory follicles. Endocrinology 1993; 133:761-9. Nemeskeri A , Detta A , Clayton RN. Hypothalamic GnRH and pituitary gonadotroph relationships during rat fetal life. Exp Clin Endocrinol 1986; 88:275-84. Nillius S, Gemzell C, Johansson E , Wide L. Monitoring treatment with human gonadotrophins or the synthetic decapeptide LH-releasing hormone. Crosignani Pg, James Vh, ed. Recent progress in reproductive endocrinology. London, Academic Press 1974; 753-75. Oikawa M , Dargan C, Ny T , Hsueh AJ . Expression of gonadotropin-releasing hormone and prothymosin-alpha messenger ribonucleic acid in the ovary. Endocrinology 1990; 127:2350-6. Ojeda SR, Wheaton JE, Jameson H E , McCann SM. The onset of puberty in the female rat: changes in plasma prolactin, gonadotropins, luteinizing hormone-releasing hormone (LHRH), and hypothalamic L H R H content. Endocrinology 1976; 98:630-8. Olofsson JI, Conti CC , Leung PC. Homologous and heterologous regulation of gonadotropin-releasing hormone receptor gene expression in preovulatory rat granulosa cells. Endocrinology 1995; 136:974-80. Olofsson JI, Conti CC , Leung PC. Tissue-specific regulation of gonadotropin-releasing hormone (GnRH) receptor gene expression during the periovulatory period. Endocrine 1994; 2:471-476. Olofsson J, Norjavaara E , Selstam G. Synthesis of prostaglandin F2 alpha, E2 and prostacyclin in isolated corpora lutea of adult pseudopregnant rats throughout the luteal life-span. Prostaglandins Leukot Essent Fatty Acids 1992; 46:151-61. 176 Orlicky DJ, Fisher L , Dunscomb N , Miller GJ. Immunohistochemical localization of PGF2 alpha receptor in the rat ovary. Prostaglandins Leukot Essent Fatty Acids 1992; 46:223-9. Orlicky D J , Williams SC. Immunohistochemical localization of PGF2 alpha receptor in the mouse testis. Prostaglandins Leukot Essent Fatty Acids 1992; 47:247-52. Ortmann O, Bakhit M , Bloh P, Schulz K D , Emons G. Ovarian steroids modulate gonadotropin-releasing hormone-induced biphasic luteinizing hormone secretory responses and inositol phosphate accumulation in rat anterior pituitary cells and alpha T3-1 gonadotrophs. J Steroid Biochem Mol Biol 1995; 54(3-4): 101-9. Palmon A , Ben A N , Tel OS, Burstein Y , Fridkin M , Koch Y . The gene for the neuropeptide gonadotropin-releasing hormone is expressed in the mammary gland of lactating rats. Proc Natl Acad Sci U S A 1994; 91:4994-6. Patwardhan V , Lanthier A. Prostaglandins PGE and PGF in human ovarian follicles: endogenous contents and in vitro formation by theca and granulosa cells. Acta Endocrinol (Copenh) 1981; 97:543-50. Peng C, Fan NC, Ligier M , Vaananen J , Leung PC. Expression and regulation of gonadotropin-releasing hormone (GnRH) and GnRH receptor messenger ribonucleic acids in human granulosa-luteal cells. Endocrinology 1994; 135:1740-6. Perrin M H , Bilezikjian L M , Hoeger C, Donaldson CJ, Rivier J, Haas Y , Vale WW. Molecular and functional characterization of GnRH receptors cloned from rat pituitary and a mouse pituitary tumor cell line. Biochem Biophys Res Commun 1993; 191:1139-44. Pieper DR, Richards JS , Marshall JC. Ovarian gonadotropin-releasing hormone (GnRH) receptors: characterization, distribution, and induction by GnRH. Endocrinology 1981; 108:1148-55. Piquette G N , LaPolt PS, Oikawa M , Hsueh AJ . Regulation of luteinizing hormone receptor messenger ribonucleic acid levels by gonadotropins, growth factors, and gonadotropin-releasing hormone in cultured rat granulosa cells. Endocrinology 1991; 128:2449-56. Plunkett E, Moon Y , Zamecnik J , Armstrong D. Preliminary evidence of a role for prostaglandin F in human follicular function. Am J Obstet Gynecol 1975; 123:391-7. Prasad MS, Vani V V , Raju VS , Reddy PR. Inhibition of sex-steroid hormone induced ornithine decarboxylase and poly(A)-polymerase activities by a GnRH agonist in the rat kidney. J Steroid Biochem 1985; 23:793-4. Probst WC, Snyder L A , Schuster DI, Brosius J , Sealfon SC. Sequence alignment of the G-protein coupled receptor superfamily. [Review]. Dna Cell Biol 1992; 11:1-20. Reinhart J, Mertz L M , Catt KJ. Molecular cloning and expression of cDNA encoding the murine gonadotropin-releasing hormone receptor. J Biol Chem 1992; 267:21281-4. Richardson M , Masson G. Progesterone production by dispersed cells from human corpus luteum: stimulation by gonadotrophins and prostaglandin F 2a; lack of response to adrenaline and isoprenaline. J Endocrinol 1980; 87:247-54. Rodway MR, Baimbridge K G , Yuen B H , Leung PC. Effect of prostaglandin F2 alpha on cytosolic free calcium ion concentrations in rat luteal cells. Endocrinology 1991; 129:889-95. 178 Rodway MR, Steele GL, Baimbridge K G , Leung PC. Prostaglandin F2 alpha and gonadotropin-releasing hormone increase intracellular free calcium in rat granulosa cells. Mol Cell Endocrinol 1992;84:137-43. Rommler A , Viebahn C, Schwartz U , Hammerstein J. Short-term regulation of L H and FSH secretion in cyclic women. III. Effects of varying doses of two consecutive L H - R H injections on pituitary and ovarian response. Acta Endocrinol (Copenh) 1979; 90:394-402. Rotsztejn W, Charli J, Pattou E, Epelbaum J , Kordon C. In vitro release of luteinizing hormone-releasing hormone (LHRH) from rat mediobasal hypothalamus: effects of potassium, calcium and dopamine. Endocrinology 1976;99:1663-6. Ryan R, Keutmann H , Charlesworth M , McCormick D, Milius R, Calvo F , Vutyavanich T. Structure-function relationships of gonadotropins. [Review]. Recent Progress in Hormone Research 1987; 43:383-429. Saint PP, Hermand E , Tramu G. Paracrine factors in adult rat testis gonadotrophin control of opioids and L H R H like peptide. Andrologia 1988; 20:173-81. Sandow J. Clinical applications of L H R H and its analogues. [Review]. Clin Endocrinol (Oxf) 1983; 18:571-92. Satoh K , Yasumizu T, Kawai Y , Ozaki A , Wu T, Kinoshita K , Sakamoto S. In vitro production of prostaglandins E, F, and 6-keto prostaglandin F l alpha by human pregnant uterus, decidua and amnion. Prostaglandins Med 1981; 6:359-68. Sawyer C. First Geoffrey Harris Memorial lecture. Some recent developments in brain-pituitary-ovarian physiology. [Review]. Neuroendocrinology 1975; 17:97-124. 179 Seong JY, Jarry H , Kuhnemuth S, Leonhardt S, Wuttke W , Kim K . Effect of GABAergic compounds on gonadotropin-releasing hormone receptor gene expression in the rat. Endocrinology 1995; 136:2587-93. Shelton JN. Reproductive technology in animal production. [Review]. Rev Sci Tech 1990; 9:825-45. Sherwood N M , Lovejoy DA , Coe IR. Origin of mammalian gonadotropin-releasing hormones. [Review]. Endocr Rev 1993; 14:241-54. Smith CJ, Richards JS, Yasin K , Sangster JN , Sridaran R. Changes in rat luteal ultrastructure and P450scc mRNA and protein content after in vivo treatment with a gonadotropin-releasing hormone agonist. Biol Reprod 1991;44:382-91. Smith MS. Release of luteinizing hormone and follicle-stimulating hormone from pituitaries of lactating rats by gonadotropin-releasing hormone and high potassium concentration. Endocrinology 1985; 116:1826-34. Smith MS , Fox SR. Regulation of gonadotropin secretion during lactation. Arch Biol Med Exp (Santiago) 1984; 17:231-8. Smith MS. Effects of the intensity of the suckling stimulus and ovarian steroids on pituitary gonadotropin-releasing hormone receptors during lactation. Biol Reprod 1984; 31:548-55. Sokka T , Huhtaniemi I. Ontogeny of gonadotrophin receptors and gonadotrophin-stimulated cyclic A M P production in the neonatal rat ovary. J Endocrinol 1990; 127:297-303. 180 Sridaran R, Ghose M , Mahesh V B . Inhibitory effects of a gonadotropin-releasing hormone agonist on the luteal synthesis of progesterone, estradiol receptors, and prolactin surges during early pregnancy. Endocrinology 1988; 123:1740-6. Srivastava RK, Luu T V , Marrone B L , Harris HS , Sridaran R. Inhibition of steroidogenesis by luteal cells of early pregnancy in the rat in response to in vitro administration of a gonadotropin-releasing hormone agonist. J Steroid Biochem Mol Biol 1994; 49:73-9. Srkalovic G, Bokser L , Radulovic S, Korkut E , Schally A V . Receptors for luteinizing hormone-releasing hormone (LHRH) in Dunning R3327 prostate cancers and rat anterior pituitaries after treatment with a sustained delivery system of L H R H antagonist SB-75. Endocrinology 1990; 127:3052-60. Steele G L , Leung PC. Intragonadal signalling mechanisms in the control of steroid hormone production. [Review]. J Steroid Biochem Mol Biol 1992;41:515-22. Stouffer RL, Ottobre JS, Molskness TA , Zelinski W M . The function and regulation of the primate corpus luteum during the fertile menstrual cycle. [Review]. Prog Clin Biol Res 1989; 294:129-42. Suginami H , Okamura H , Yogo I. In vitro steroidogenesis by human corpora lutea of pregnancy. Effects of human chorionic gonadotropin and prostaglandin F2alpha. Obstet Gynecol 1976; 47:177-82. Suzuki M , Takahashi K . Hypothalamo-hypophyseal control of ovulation [Review]. Hatotani N , ed. Psychoneuroendocrinology; Basel, Karger 1974; 114-21. Tarin J J , Pellicer A . Oocyte maturation in human in vitro fertilisation programmes. [Review]. Ann Acad Med Singapore 1992; 21:492-7. 181 Tsafriri A . Local nonsteroidal regulators of ovarian function. The physiology of reproduction 1988; 14:527-565. Tsafriri A . Ovulation as a tissue remodelling process. Proteolysis and cumulus expansion. [Review]. Adv Exp Med Biol 1995; 377:121-40. Tsutsumi M , Zhou W, Millar RP, Mellon PL, Roberts JL, Flanagan C A , Dong K , Gillo B , Sealfon SC. Cloning and functional expression of a mouse gonadotropin-releasing hormone receptor. Mol Endocrinol 1992;6:1163-9. Turgeon J. Neural control of ovulation. [Review]. Physiologist 1980; 23:56-62. van Minnen J. Production and exocrine secretion of LHRH-like material by the male rat reproductive tract. Peptides 1988; 9:515-8. Vogel D L , Gunsalus G L , Bercu BB, Musto NA , Bardin CW. Sertoli cell maturation is impaired by neonatal passive immunization with antiserum to luteinizing hormone-releasing hormone. Endocrinology 1983; 112:1115-21. Voigt P, Ma Y J , Gonzalez D, Fahrenbach WH, Wetsel WC, Berg, von dEK, Hil l DF, Taylor K G , Costa M E , Seidah NG. Neural and glial-mediated effects of growth factors acting via tyrosine kinase receptors on luteinizing hormone-releasing hormone neurons. Endocrinology 1996; 137:2593-605. Webley GE, Richardson M C , Summers P M , Given A , Hearn JP. Changing responsiveness of luteal cells of the marmoset monkey (Callithrix jacchus) to luteotrophic and luteolytic agents during normal and conception cycles. J Reprod Fertil 1989; 87:301-10. 182 White SS , Ojeda SR. Changes in ovarian L H R H receptor content during the onset of puberty in the female rat. Endocrinology 1981; 108:347-9. White SA, Bond CT, Francis RC, Kasten TL, Fernald RD , Adelman JP. A second gene for gonadotropin-releasing hormone: cDNA and expression pattern in the brain. Proc Natl Acad Sci U S A 1994;91:1423-7. Whitelaw PF, Eidne K A , Sellar R, Smyth CD , Hillier SG. Gonadotropin-releasing hormone receptor messenger ribonucleic acid expression in rat ovary. Endocrinology 1995; 136:172-9. Wiemann JN, Clifton D K , Steiner RA. Pubertal changes in gonadotropin-releasing hormone and proopiomelanocortin gene expression in the brain of the male rat. Endocrinology 1989; 124:1760-7. Wierman M , Gharib S , Chin W. The structure and regulation of the pituitary gonadotrophin subunit genes. [Review]. Baillieres Clinical Endocrinology & Metabolism 1988; 2:869-89. Wu C , Prazak L. Endocrine basis for ovulation induction [Review]. Clin Obstet & Gyneco 1974; 17:65-78. Yen S. Regulation of the hypothalamic-pituitary-ovarian axis in women. J. of Repro & Fertil 1977; 51:181-91. Yoshimura M , Hershman JM. Thyrotropic action of human chorionic gonadotropin. [Review]. Thyroid 1995; 5:425-34. Ziecik A J , Derecka-Reszka K , Rzucidlo SJ. Extragonadal gonadotropin receptors, their distribution and function. [Review]. J Physiol Pharmacol 1992; 43(4.1):33-49. "@en ; edm:hasType "Thesis/Dissertation"@en ; vivo:dateIssued "1997-05"@en ; edm:isShownAt "10.14288/1.0088002"@en ; dcterms:language "eng"@en ; ns0:degreeDiscipline "Reproductive and Developmental Sciences"@en ; edm:provider "Vancouver : University of British Columbia Library"@en ; dcterms:publisher "University of British Columbia"@en ; dcterms:rights "For non-commercial purposes only, such as research, private study and education. Additional conditions apply, see Terms of Use https://open.library.ubc.ca/terms_of_use."@en ; ns0:scholarLevel "Graduate"@en ; dcterms:title "Regulation of rat ovarian gonadotropin Releasing hormone receptor mRNA levels"@en ; dcterms:type "Text"@en ; ns0:identifierURI "http://hdl.handle.net/2429/6615"@en .