"Medicine, Faculty of"@en . "DSpace"@en . "UBCV"@en . "Ly, Philip T.T."@en . "2012-07-31T23:38:04Z"@en . "2012"@en . "Doctor of Philosophy - PhD"@en . "University of British Columbia"@en . "Glycogen synthase kinase 3 (GSK3) is a serine/threonine kinase that plays a part in a number of physiological processes ranging from glycogen metabolism to gene transcription. Recent studies indicated that GSK3 also involved in the formation of Alzheimer\u00E2\u0080\u0099s disease (AD) pathologies: neurofibrillary tangles and amyloid plaques. Neurofibrillary tangles develop when abnormal tau proteins accumulate inside neurons and form insoluble filaments, and amyloid plaques develop when the amyloid \u00CE\u00B2 protein (A\u00CE\u00B2) accumulates in increasingly insoluble forms. The A\u00CE\u00B2 peptide is generated through sequential cleavages of the \u00CE\u00B2-amyloid precursor protein by \u00CE\u00B2-secretase (BACE1) and \u00CE\u00B3-secretase. Accumulation of insoluble A\u00CE\u00B2 is believed to trigger the initial series of neurodegenerative events leading to AD. Therefore, inhibition of the pathways that lead to A\u00CE\u00B2 generation will have therapeutic implications for AD treatment.\nThe mechanism by which GSK3 affects APP processing and A\u00CE\u00B2 production has been controversial. Previous published reports have found differential effects on GSK3-mediated APP processing. This thesis entails a thorough investigation of GSK3\u00E2\u0080\u0099s role in APP processing and A\u00CE\u00B2 production. First, the therapeutic effects of the anti-convulsant drug, valproic acid (VPA) were tested in AD modeled mice. VPA, a known GSK3 inhibitor could interfere with A\u00CE\u00B2 production, and rescued memory deficits. In addition to inhibiting GSK3 activity, VPA also stimulate a plethora of signaling cascades. To further our understanding of GSK3\u00E2\u0080\u0099s effect on APP processing, a GSK3 specific pharmacological inhibitor (AR-A014418) and siRNA technologies were used in our systems. With specific GSK3\u00CE\u00B2 inhibition, we showed that BACE1-mediated cleavage of APP and A\u00CE\u00B2 production were reduced. Moreover, GSK3\u00CE\u00B2 induced BACE1 gene expression depends on NF\u00CE\u00BAB activity. Additionally, specific inhibition of GSK3 also reduced A\u00CE\u00B2 production and neuritic plaque formation in AD modeled mice, as well as improved memory functions.\nFinally, this thesis examined in detail the role of GSK3 in AD pathogenesis. This study demonstrated for the first time that the GSK3\u00CE\u00B2 signaling pathway regulates BACE1 transcription and facilitates A\u00CE\u00B2 production. These findings reinforced the notion that specific GSK3 inhibition is a safe and effective approach for treating AD."@en . "https://circle.library.ubc.ca/rest/handle/2429/42848?expand=metadata"@en . " GLYCOGEN SYNTHASE KINASE-3 SIGNALING IN ALZHEIMER\u00E2\u0080\u0099S DISEASE REGULATION OF BETA-AMYLOID PRECURSOR PROTEIN PROCESSING AND AMYLOID BETA PROTEIN PRODUCTION by Philip T. T. Ly B.Sc., The University of British Columbia, 2005 M.Sc., The University of British Columbia, 2007 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Neuroscience) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) July 2012 \u00C2\u00A9 Philip T.T. Ly, 2012 ii Abstract Abstract Glycogen synthase kinase 3 (GSK3) is a serine/threonine kinase that plays a part in a number of physiological processes ranging from glycogen metabolism to gene transcription. Recent studies indicated that GSK3 also involved in the formation of Alzheimer\u00E2\u0080\u0099s disease (AD) pathologies: neurofibrillary tangles and amyloid plaques. Neurofibrillary tangles develop when abnormal tau proteins accumulate inside neurons and form insoluble filaments, and amyloid plaques develop when the amyloid \u00CE\u00B2 protein (A\u00CE\u00B2) accumulates in increasingly insoluble forms. The A\u00CE\u00B2 peptide is generated through sequential cleavages of the \u00CE\u00B2-amyloid precursor protein by \u00CE\u00B2-secretase (BACE1) and \u00CE\u00B3-secretase. Accumulation of insoluble A\u00CE\u00B2 is believed to trigger the initial series of neurodegenerative events leading to AD. Therefore, inhibition of the pathways that lead to A\u00CE\u00B2 generation will have therapeutic implications for AD treatment. The mechanism by which GSK3 affects APP processing and A\u00CE\u00B2 production has been controversial. Previous published reports have found differential effects on GSK3-mediated APP processing. This thesis entails a thorough investigation of GSK3\u00E2\u0080\u0099s role in APP processing and A\u00CE\u00B2 production. First, the therapeutic effects of the anti-convulsant drug, valproic acid (VPA) were tested in AD modeled mice. VPA, a known GSK3 inhibitor could interfere with A\u00CE\u00B2 production, and rescued memory deficits. In addition to inhibiting GSK3 activity, VPA also stimulate a plethora of signaling cascades. To further our understanding of GSK3\u00E2\u0080\u0099s effect on APP processing, a GSK3 specific pharmacological inhibitor (AR-A014418) and siRNA technologies were used in our systems. With specific GSK3\u00CE\u00B2 inhibition, we showed that BACE1-mediated cleavage of APP and A\u00CE\u00B2 production were reduced. Moreover, GSK3\u00CE\u00B2 induced BACE1 gene expression depends on NF\u00CE\u00BAB activity. Additionally, specific inhibition of GSK3 also reduced A\u00CE\u00B2 production and neuritic plaque formation in AD modeled mice, as well as improved memory functions. Finally, this thesis examined in detail the role of GSK3 in AD pathogenesis. This study demonstrated for the first time that the GSK3\u00CE\u00B2 signaling pathway regulates BACE1 transcription and facilitates A\u00CE\u00B2 production. These findings reinforced the notion that specific GSK3 inhibition is a safe and effective approach for treating AD. iii Preface Preface Immediately after completing a Master\u00E2\u0080\u0099s of Science degree, I joined Dr. Weihong Song\u00E2\u0080\u0099s research team to study the molecular pathogenesis of Alzheimer\u00E2\u0080\u0099s disease and its drug development. Dr. Song introduced me to a project that involves using the anti-convulsant drug, valproic acid to treat Alzheimer\u00E2\u0080\u0099s disease. Chapter 2 of this thesis was based on the findings from a postdoctoral fellow Dr. Hong Qing and a graduate student Guiqiong He in the laboratory, who showed that valproic acid treatment reduced neuritic plaque formation and rescued memory deficits in transgenic AD modeled mice. In this study, I showed that VPA treatment inhibited \u00CE\u00B3-secretase activity in two stable cells. My predecessors, Drs. Xiulian Sun and Shengcai Wei, as part of their own projects generated the stable cell lines 20E2 and hC99. I also showed that VPA treatment inhibited GSK3\u00CE\u00B2 by increasing phosphorylation at an inhibitory serine site. The Kinetworks\u00E2\u0084\u00A2 KPSS 1.3 phosphosite screen was performed at Kinexus Bioinformatics as a contracted service. In subsequent studies I confirmed that transgenic mice that received VPA had reduced neuritic plaque formation. As a collaborative effort between Drs. Qing and He, and myself, I was listed as a co-first author for a manuscript submitted to the Journal of Experimental Medicine, which was published in August 2008 (Qing H, He G, Ly PTT, Fox C, Staufenbiel M, Cai F, Zhang ZH, Wei SC, Sun X, Chen CH, Zhou WH, Wang K, and Song WH. (2008) Valproic acid inhibits A\u00CE\u00B2 production, neuritic plaque formation and behavioral deficits in Alzheimer\u00E2\u0080\u0099s Disease mouse models. Journal Preface iv of Experimental Medicine. 205:2781-2789). The journal granted permission to include the published materials in this thesis. In Chapter 3, we tested the effects of specific GSK3 inhibition using AR- A014418, a commercially available compound originally developed by AstraZeneca Biotech Lab. AR-A014418 is a highly specific GSK3\u00CE\u00B2 inhibitor (Bhat et al., 2003). I designed and executed the majority of the experiments. While, I was on an exchanged study program, other lab members under my directions confirmed a few experiments. Dr. Yili Wu performed SDS-PAGE on APP23/PS45 mouse cortex samples that I had prepared earlier. She confirmed that p65-NFkB and the BACE1 protein levels were significantly reduced in AR- A014418-treated mice. Ms. Mingming Zhang helped confirmed using ELISA that the A\u00CE\u00B240 levels were significantly reduced in AR-A014418 treated mice. Ms. Yi Yang help confirmed the RT-PCR results on mouse APP and PS1 levels. The in vitro phosphorylation profiling assays were performed as a contracted service at Kinexus Bioinformatics. The BACE1 promoter plasmids were used to study the regulatory role of GSK3\u00CE\u00B2 on BACE1 transcription. The 3.1 kb and all the deletion variants of the human BACE1 promoter, used in chapter 3, were cloned by Dr. Weihui Zhou, a former postdoctoral fellow in the lab. The entire BACE1 promoter collection has been functionally tested by Dr. Zhou and other lab alumni (Chen et al., 2011c; Christensen et al., 2004; Sun et al., 2005). Through various collaborations between my supervisor and other principle investigators, I was fortunate to use GSK3\u00CE\u00B2 KO MEFs from Dr. James Woodgett\u00E2\u0080\u0099s laboratory at the Lunenfeld Research Institute. The S9A-GSK3\u00CE\u00B2 Preface v plasmid and S9A-GSK3\u00CE\u00B2 inducible cell line were generated in Dr. Ayae Kinoshita\u00E2\u0080\u0099s laboratory, at the School of Health Science, Kyoto University. The RelA-KO cell line, derived from E12.5-E14.5 mouse embryo fibroblasts was generated in the Gilmore laboratory (Gapuzan et al., 2005). All animal studies were approved by The University of British Columbia Animal Care Committee (protocol number: A11-0025). Moreover, procedures for obtaining embryonic mouse primary neurons were approved by the University of British Columbia Animal Care Committee (protocol number: A09-0274). The APP23/PS45 mice used in this study were bred and genotyped by the lab technician, Ms. Haiyan Zou. Ms. Zou also assisted me with drug administration, taking body weights, and monitoring food intakes. After the drug treatment regimen, I performed the behavioral analyses, sacrificed the mice, and carried out all the subsequent biochemical analyses. In Chapter 4, human tissues were used to examine the expression/activity pattern of GSK3\u00CE\u00B1 and GSK3\u00CE\u00B2 in Alzheimer\u00E2\u0080\u0099s disease patients. Frozen cortical tissues were obtained from the Department of Pathology at Columbia University. Electrophoresis and immunoblotting experiments were carried out in our laboratory by the author. Our laboratory has devised standardized procedures for the detection of neuritic plaques in brain sections. This information was published as an article entitled Detection of Neuritic Plaque in Alzheimer\u00E2\u0080\u0099s disease in the Journal of Visual Experiments in the October of 2011, for which I am the first author (Ly PTT, Cai F., Song W. (2011) Detection of Neuritic Plaques in Alzheimer's Disease Mouse Model. Journal of Visual Experiment. e2831). Immunohistochemical detection of neuritic plaques as performed in Chapters 2 and 4 followed the steps indicated in Preface vi the above publication. The journal editor granted permission to use the published materials in this thesis. vii Table of contents Table of contents Abstract.................................................................................................................. ii\t\r \u00C2\u00A0 Preface................................................................................................................... iii\t\r \u00C2\u00A0 Table of contents ................................................................................................. vii\t\r \u00C2\u00A0 List of tables......................................................................................................... xii\t\r \u00C2\u00A0 List of figures...................................................................................................... xiii\t\r \u00C2\u00A0 List of abbreviations ............................................................................................xv\t\r \u00C2\u00A0 Acknowledgements ............................................................................................ xix\t\r \u00C2\u00A0 Dedication ........................................................................................................... xxi\t\r \u00C2\u00A0 Chapter 1: General introduction.........................................................................1\t\r \u00C2\u00A0 1.1\t\r \u00C2\u00A0 Alzheimer\u00E2\u0080\u0099s disease ........................................................................................1\t\r \u00C2\u00A0 1.2\t\r \u00C2\u00A0 APP processing pathways ...............................................................................3\t\r \u00C2\u00A0 1.2.1\t\r \u00C2\u00A0 \u00CE\u00B1-secretase mediates non-amyloidogenic pathway .........................5\t\r \u00C2\u00A0 1.2.2\t\r \u00C2\u00A0 \u00CE\u00B2-secretase and its role in A\u00CE\u00B2 production ........................................6\t\r \u00C2\u00A0 1.2.3\t\r \u00C2\u00A0 Presenilins and the \u00CE\u00B3-site cleaving enzyme complex .......................8\t\r \u00C2\u00A0 1.3\t\r \u00C2\u00A0 The \u00E2\u0080\u009Crevised\u00E2\u0080\u009D amyloid hypothesis ................................................................11\t\r \u00C2\u00A0 1.4\t\r \u00C2\u00A0 BACE1 gene expression and its role in Alzheimer\u00E2\u0080\u0099s disease........................14\t\r \u00C2\u00A0 1.4.1\t\r \u00C2\u00A0 Transcription regulation in the BACE1 promoter ..........................14\t\r \u00C2\u00A0 1.4.2\t\r \u00C2\u00A0 Hypoxia facilitates BACE1 transcription .......................................15\t\r \u00C2\u00A0 1.4.3\t\r \u00C2\u00A0 Energy inhibition increase BACE1 expression..............................16\t\r \u00C2\u00A0 1.5\t\r \u00C2\u00A0 Glycogen synthase kinase 3 signaling ..........................................................18\t\r \u00C2\u00A0 Table of contents viii 1.5.1\t\r \u00C2\u00A0 Regulation of GSK3 activity..........................................................20\t\r \u00C2\u00A0 1.5.2\t\r \u00C2\u00A0 Biological functions of GSK3........................................................23\t\r \u00C2\u00A0 1.6\t\r \u00C2\u00A0 Involvement of GSK3 in human diseases.....................................................26\t\r \u00C2\u00A0 1.6.1\t\r \u00C2\u00A0 GSK3 in insulin resistance.............................................................27\t\r \u00C2\u00A0 1.6.2\t\r \u00C2\u00A0 GSK3 signaling in inflammation ...................................................28\t\r \u00C2\u00A0 1.6.3\t\r \u00C2\u00A0 GSK3 signaling in Alzheimer\u00E2\u0080\u0099s disease pathogenesis...................29\t\r \u00C2\u00A0 1.6.4\t\r \u00C2\u00A0 Targeting GSK3 to treat Alzheimer\u00E2\u0080\u0099s disease ...............................35\t\r \u00C2\u00A0 1.7\t\r \u00C2\u00A0 Overall goal of this research .........................................................................38\t\r \u00C2\u00A0 1.7.1\t\r \u00C2\u00A0 Examine the therapeutic effects of valproic acid on AD pathogenesis...............................................................................................39\t\r \u00C2\u00A0 1.7.2\t\r \u00C2\u00A0 A thorough study of specific GSK3 inhibition on A\u00CE\u00B2 production and regulation of BACE1 transcription ......................................................40\t\r \u00C2\u00A0 1.7.3\t\r \u00C2\u00A0 Pharmaceutical potentials of GSK3 inhibition as a strategy to treat Alzheimer' disease..................................................................................... 41\t\r \u00C2\u00A0 Chapter 2: Valproic acid inhibits A\u00CE\u00B2 production, neuritic plaque formation and behavioral deficits in Alzheimer\u00E2\u0080\u0099s disease mouse models.........................43\t\r \u00C2\u00A0 2.1\t\r \u00C2\u00A0 Introduction...................................................................................................43\t\r \u00C2\u00A0 2.2\t\r \u00C2\u00A0 Methods.........................................................................................................44\t\r \u00C2\u00A0 2.2.1\t\r \u00C2\u00A0 Materials ........................................................................................44\t\r \u00C2\u00A0 2.2.2\t\r \u00C2\u00A0 Transgenic animals and VPA treatment ........................................45\t\r \u00C2\u00A0 2.2.3\t\r \u00C2\u00A0 Genotyping.....................................................................................46\t\r \u00C2\u00A0 2.2.4\t\r \u00C2\u00A0 Cell cultures, VPA treatment, luciferase assay..............................46\t\r \u00C2\u00A0 2.2.5\t\r \u00C2\u00A0 Immunoblotting..............................................................................47\t\r \u00C2\u00A0 2.2.6\t\r \u00C2\u00A0 Semi-quantitative reverse transcription PCR.................................48\t\r \u00C2\u00A0 2.2.7\t\r \u00C2\u00A0 Human A\u00CE\u00B240/42 ELISA ................................................................48\t\r \u00C2\u00A0 2.2.8\t\r \u00C2\u00A0 Immunohistochemistry ..................................................................48\t\r \u00C2\u00A0 2.2.9\t\r \u00C2\u00A0 The Morris water maze test............................................................49\t\r \u00C2\u00A0 Table of contents ix 2.2.10\t\r \u00C2\u00A0 Kinetworks\u00E2\u0084\u00A2 KPSS 1.3 phosphosite analysis ..............................49\t\r \u00C2\u00A0 2.3\t\r \u00C2\u00A0 Results...........................................................................................................50\t\r \u00C2\u00A0 2.3.1\t\r \u00C2\u00A0 VPA inhibits A\u00CE\u00B2 deposition and neuritic plaque formation ..........50\t\r \u00C2\u00A0 2.3.2\t\r \u00C2\u00A0 VPA improves memory deficits in mouse model of AD...............53\t\r \u00C2\u00A0 2.3.3\t\r \u00C2\u00A0 VPA inhibits \u00CE\u00B3-secretase activity and inhibits A\u00CE\u00B2 production in vitro and in vivo .........................................................................................55\t\r \u00C2\u00A0 2.3.4\t\r \u00C2\u00A0 VPA treatment inhibits GSK3 activity ..........................................58\t\r \u00C2\u00A0 2.4\t\r \u00C2\u00A0 Discussion .....................................................................................................64\t\r \u00C2\u00A0 2.5\t\r \u00C2\u00A0 Conclusions...................................................................................................66\t\r \u00C2\u00A0 Chapter 3: GSK3\u00CE\u00B2 signaling regulates \u00CE\u00B2-secretase expression and A\u00CE\u00B2 production.............................................................................................................68\t\r \u00C2\u00A0 3.1\t\r \u00C2\u00A0 Introduction...................................................................................................68\t\r \u00C2\u00A0 3.2\t\r \u00C2\u00A0 Methods.........................................................................................................69\t\r \u00C2\u00A0 3.2.1\t\r \u00C2\u00A0 Materials ........................................................................................69\t\r \u00C2\u00A0 3.2.2\t\r \u00C2\u00A0 Cell culture.....................................................................................70\t\r \u00C2\u00A0 3.2.3\t\r \u00C2\u00A0 Transfections and drug treatment...................................................70\t\r \u00C2\u00A0 3.2.4\t\r \u00C2\u00A0 Transgenic APP23/PS45 mice and AR-A014418 treatment .........71\t\r \u00C2\u00A0 3.2.5\t\r \u00C2\u00A0 Luciferase assay .............................................................................71\t\r \u00C2\u00A0 3.2.6\t\r \u00C2\u00A0 Immunoblotting..............................................................................71\t\r \u00C2\u00A0 3.2.7\t\r \u00C2\u00A0 In vitro kinase assay.......................................................................72\t\r \u00C2\u00A0 3.2.8\t\r \u00C2\u00A0 Human A\u00CE\u00B240/42 ELISA ................................................................72\t\r \u00C2\u00A0 3.2.9\t\r \u00C2\u00A0 Electromobility shift assay (EMSA)..............................................73\t\r \u00C2\u00A0 3.2.10\t\r \u00C2\u00A0 Reverse transcription PCR.............................................................73\t\r \u00C2\u00A0 3.3\t\r \u00C2\u00A0 Results...........................................................................................................74\t\r \u00C2\u00A0 3.3.1\t\r \u00C2\u00A0 Regulation of \u00CE\u00B2-secretase cleavage of APP and A\u00CE\u00B2 production by GSK3 signaling..........................................................................................74\t\r \u00C2\u00A0 Table of contents x 3.3.2\t\r \u00C2\u00A0 GSK3\u00CE\u00B2 but not GSK3\u00CE\u00B1 regulates BACE1 gene expression and BACE1-mediated APP processing ............................................................77\t\r \u00C2\u00A0 3.3.3\t\r \u00C2\u00A0 GSK3\u00CE\u00B2 regulates BACE1 gene promoter activity..........................79\t\r \u00C2\u00A0 3.3.4\t\r \u00C2\u00A0 NF\u00CE\u00BAB mediates the transcriptional regulation of BACE1 gene expression by GSK3\u00CE\u00B2 ................................................................................80\t\r \u00C2\u00A0 3.3.5\t\r \u00C2\u00A0 GSK3 regulates BACE1 gene expression, APP processing and A\u00CE\u00B2 production in vivo ......................................................................................84\t\r \u00C2\u00A0 3.4\t\r \u00C2\u00A0 Discussion .....................................................................................................88\t\r \u00C2\u00A0 3.5\t\r \u00C2\u00A0 Conclusions...................................................................................................93\t\r \u00C2\u00A0 Chapter 4: Specific inhibition of GSK3 as a therapeutic strategy for treating Alzheimer\u00E2\u0080\u0099s disease..............................................................................................94\t\r \u00C2\u00A0 4.1\t\r \u00C2\u00A0 Introduction...................................................................................................94\t\r \u00C2\u00A0 4.2\t\r \u00C2\u00A0 Methods.........................................................................................................95\t\r \u00C2\u00A0 4.2.1\t\r \u00C2\u00A0 Materials ........................................................................................95\t\r \u00C2\u00A0 4.2.2\t\r \u00C2\u00A0 Cell culture, preparation of A\u00CE\u00B2 fibrils, and cell viability assay .....96\t\r \u00C2\u00A0 4.2.3\t\r \u00C2\u00A0 Human brain tissues.......................................................................97\t\r \u00C2\u00A0 4.2.4\t\r \u00C2\u00A0 Transgenic APP23/PS45 mice and AR-A014418 treatment .........97\t\r \u00C2\u00A0 4.2.5\t\r \u00C2\u00A0 The Morris water maze test............................................................98\t\r \u00C2\u00A0 4.2.6\t\r \u00C2\u00A0 The open field test..........................................................................98\t\r \u00C2\u00A0 4.2.7\t\r \u00C2\u00A0 Immunohistochemistry ..................................................................98\t\r \u00C2\u00A0 4.2.8\t\r \u00C2\u00A0 Immunoblotting..............................................................................99\t\r \u00C2\u00A0 4.3\t\r \u00C2\u00A0 Results.........................................................................................................100\t\r \u00C2\u00A0 4.3.1\t\r \u00C2\u00A0 Increased GSK3 signaling in AD brains......................................100\t\r \u00C2\u00A0 4.3.2\t\r \u00C2\u00A0 GSK3 inhibition reduces neuritic plaque formation in the AD model mice...............................................................................................101\t\r \u00C2\u00A0 4.3.3\t\r \u00C2\u00A0 Inhibition of GSK3 improves memory deficits in the AD model mice\u00E2\u0080\u00A6\u00E2\u0080\u00A6\u00E2\u0080\u00A6\u00E2\u0080\u00A6\u00E2\u0080\u00A6\u00E2\u0080\u00A6\u00E2\u0080\u00A6\u00E2\u0080\u00A6\u00E2\u0080\u00A6\u00E2\u0080\u00A6\u00E2\u0080\u00A6\u00E2\u0080\u00A6\u00E2\u0080\u00A6\u00E2\u0080\u00A6\u00E2\u0080\u00A6\u00E2\u0080\u00A6\u00E2\u0080\u00A6\u00E2\u0080\u00A6\u00E2\u0080\u00A6\u00E2\u0080\u00A6\u00E2\u0080\u00A6\u00E2\u0080\u00A6\u00E2\u0080\u00A6\u00E2\u0080\u00A6\u00E2\u0080\u00A6\u00E2\u0080\u00A6..104\t\r \u00C2\u00A0 Table of contents xi 4.3.4\t\r \u00C2\u00A0 GSK3 inhibition reduces gliosis in APP23/PS45 mice ...............107\t\r \u00C2\u00A0 4.3.5\t\r \u00C2\u00A0 Inhibition of GSK3 protects against A\u00CE\u00B2-induced neurotoxicity ..109\t\r \u00C2\u00A0 4.4\t\r \u00C2\u00A0 Discussion ...................................................................................................110\t\r \u00C2\u00A0 4.5\t\r \u00C2\u00A0 Conclusions.................................................................................................115\t\r \u00C2\u00A0 Chapter 5: Conclusions and future directions ...............................................116\t\r \u00C2\u00A0 5.1\t\r \u00C2\u00A0 General discussion ......................................................................................116\t\r \u00C2\u00A0 5.1.1\t\r \u00C2\u00A0 New use of an old drug to treat Alzheimer\u00E2\u0080\u0099s disease...................120\t\r \u00C2\u00A0 5.1.2\t\r \u00C2\u00A0 When does GSK3 activity become aberrant? ..............................121\t\r \u00C2\u00A0 5.1.3\t\r \u00C2\u00A0 Inflammatory signals increase GSK3 activity .............................121\t\r \u00C2\u00A0 5.1.4\t\r \u00C2\u00A0 Potential problems with the long term use of GSK3 inhibitors ...123\t\r \u00C2\u00A0 5.2\t\r \u00C2\u00A0 Significance of the research ........................................................................125\t\r \u00C2\u00A0 5.3\t\r \u00C2\u00A0 Potential applications and future research ..................................................126\t\r \u00C2\u00A0 5.3.1\t\r \u00C2\u00A0 Using AR-A014418 in the clinic to treat AD?.............................126\t\r \u00C2\u00A0 5.3.2\t\r \u00C2\u00A0 The cocktail approach ..................................................................126\t\r \u00C2\u00A0 Bibliography .......................................................................................................128\t\r \u00C2\u00A0 xii List of tables List of tables Table 1.1 Genetic factors contributing to Alzheimer's disease pathogenesis. ........ 5\t\r \u00C2\u00A0 Table 1.2 GSK3 substrates and their cellular functions........................................ 24\t\r \u00C2\u00A0 Table 1.3 Pharmacological inhibitors of GSK3.................................................... 37\t\r \u00C2\u00A0 Table 2.1 Kinetworks\u00E2\u0084\u00A2 KPSS1.3 Phosphoprotein profiling in N2a cells treated with VPA. ............................................................................................................. 64\t\r \u00C2\u00A0 Table 3.1 Activity changes of protein kinasese in the presence of 5 \u00C2\u00B5M AR- A014418................................................................................................................ 74\t\r \u00C2\u00A0 Table 4.1 Human brain tissues for analysis of GSK3 activity in Alzheimer's disease. .................................................................................................................. 97\t\r \u00C2\u00A0 xiii List of figures List of figures Figure 1.1 APP processing pathways...................................................................... 6\t\r \u00C2\u00A0 Figure 1.2 The amyloid hypothesis of Alzheimer\u00E2\u0080\u0099s disease. ................................ 13\t\r \u00C2\u00A0 Figure 1.3 Physiological roles of GSK3 signaling................................................ 18\t\r \u00C2\u00A0 Figure 1.4 Tau phosphorylation and formation of neurofibrillary tangles. .......... 31\t\r \u00C2\u00A0 Figure 1.5 Structures of pharmacological inhibitors of GSK3. ............................ 36\t\r \u00C2\u00A0 Figure 2.1 Valproic acid treatment inhibits the formation of neuritic plaques in AD transgenic mice............................................................................................... 51\t\r \u00C2\u00A0 Figure 2.2 Valproic acid treatment has prolonged inhibitory effects on neuritic plaque production.................................................................................................. 53\t\r \u00C2\u00A0 Figure 2.3 VPA improves memory deficits in AD transgenic mice. .................... 55\t\r \u00C2\u00A0 Figure 2.4 VPA inhibits \u00CE\u00B3-secretase cleavage of APP and A\u00CE\u00B2 production........... 57\t\r \u00C2\u00A0 Figure 2.5 VPA inhibits GSK3 activity. ............................................................... 60\t\r \u00C2\u00A0 Figure 2.6 Kinetworks\u00E2\u0084\u00A2 KPSS1.3 Phosphoprotein profiling............................. 61\t\r \u00C2\u00A0 Figure 2.7 Kinetworks\u00E2\u0084\u00A2 KPSS 1.3 Phospho-site screening results. ................... 63\t\r \u00C2\u00A0 Figure 3.1 Specific inhibition of GSK3 reduces BACE1 cleavage of APP.......... 76\t\r \u00C2\u00A0 Figure 3.2 GSK3\u00CE\u00B2, but not GSK3\u00CE\u00B1 regulates BACE1 gene expression and APP processing. ............................................................................................................ 78\t\r \u00C2\u00A0 Figure 3.3 GSK3\u00CE\u00B2 regulates BACE1 promoter activation. ................................... 80\t\r \u00C2\u00A0 Figure 3.4 GSK3\u00CE\u00B2 regulation of BACE1 transcription is dependent on NF\u00CE\u00BAB p65 expression. ............................................................................................................ 83\t\r \u00C2\u00A0 Figure 3.5 AR-A014418 inhibits BACE1 cleavage of APP and A\u00CE\u00B2 production in vivo. ....................................................................................................................... 85\t\r \u00C2\u00A0 Figure 3.6 AR-A014418 reduces tau phosphorylation in AD transgenic mice. ... 87\t\r \u00C2\u00A0 List of figures xiv Figure 3.7 AR-A014418 reduced NF\u00CE\u00BAB binding in APP23/PS45 mouse brains. 88\t\r \u00C2\u00A0 Figure 4.1 Increased GSK3 activity in AD brain................................................ 101\t\r \u00C2\u00A0 Figure 4.2 AR-A014418 treatment significantly reduces neuritic plaque formation in AD transgenic mice. ....................................................................................... 103\t\r \u00C2\u00A0 Figure 4.3 AR-A014418 improves memory deficits in AD transgenic mice. .... 105\t\r \u00C2\u00A0 Figure 4.4 GSK3 inhibition did not affect weight changes and anxiety behaviors in double transgenic mice. .................................................................................. 106\t\r \u00C2\u00A0 Figure 4.5 GSK3 inhibition reduced gliosis in AD model mice......................... 108\t\r \u00C2\u00A0 Figure 4.6 GSK3 inhibition protects against A\u00CE\u00B2-induced cell death. ................. 109\t\r \u00C2\u00A0 Figure 5.1 Aberrant GSK3\u00CE\u00B2 signaling facilitates amyloid peptide production... 123\t\r \u00C2\u00A0 xv List of abbreviations List of abbreviations A\u00CE\u00B2 Amyloid-\u00CE\u00B2 ABC avidin:biotinylated enzyme complex AEBSF 4-(2-Aminoethyl) benzenesulfonyl fluoride hydrochloride; serine protease inhibitor AD Alzheimer\u00E2\u0080\u0099s disease Aph-1 Anterior pharynx factor-1 APLP amyloid precursor like protein AICD APP intracellular domain ANOVA analysis of variance APP amyloid-\u00CE\u00B2 precursor protein APP23 single transgenic mice carrying Swedish APP K670M/N671L mutation APP23/PS45 double transgenic mice for Swedish APP K670M/N671L and PS1 G384A APPSwe Swedish APP mutation ARA AR-A014418; N- (4-Methoxybenzyl) -N\u00E2\u0080\u00B2- (5-nitro-1,3-thiazol-2-yl)urea ARU Animal Research Unit BACE1 \u00CE\u00B2-site APP Cleaving Enzyme 1 BACE2 \u00CE\u00B2-site APP Cleaving Enzyme 2 BBB blood brain barrier bp base pair BSA bovine serum albumin CDK cyclin dependent protein kinase Complete DMEM DMEM with 10% fetal bovine serum, 1% L-glutamine, 1% Penicillin/Streptomycin, and 1% sodium pyruvate. List of abbreviations xvi CTF\u00CE\u00B1 C-terminal fragment \u00CE\u00B1 (C83) CTF\u00CE\u00B2 C-terminal fragment \u00CE\u00B2 (C99 and C89) DAB 3,3'-Diaminobenzidine DEPC diethylpyrocarbonate DMEM Dulbecco\u00E2\u0080\u0099s modified eagles\u00E2\u0080\u0099 medium DMSO dimethyl sulfoximine ELISA enzyme-linked immunosorbent assay EMSA electromobility shift assay FBS fetal bovine serum GFAP glial fibrillary acidic protein GSI \u00CE\u00B3-secretase inhibitor; L685,458 GSK3\u00CE\u00B1 glycogen synthase kinase 3\u00CE\u00B1 GSK3\u00CE\u00B2 glycogen synthase kinase 3\u00CE\u00B2 GS glycogen synthase G2 GSK3 inhibitor II; 2-thio(3-iodobenzyl)-5-(1-pyridyl)-[1,3,4]-oxadiazole HEK293 human embryonic kidney 293 cell line hC99-myc HEK293 cells stably expressing human C99 CTF with myc tag HDAC histone deacetylase Iba-1 ionized calcium binding adaptor molecule 1 IC50 concentration that inhibits 50% KD knockdown KDa kilodalton KO knockout LDH lactate dehydrogenase LTD long term depression LTP long term potentiation LiCl lithium chloride List of abbreviations xvii MAPK mitogen activated protein kinase MEF mouse embryonic fibroblasts mRNA messenger RNA MTT 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide N2a mouse neuroblastoma Nct nicastrin NF\u00CE\u00BAB nuclear factor kappa B NFT neurofibrillary tangles NSAID nonsteroidal anti-inflammatory drug Pen-2 presenilin enhancer 2 pB1A human BACE1 promoter region from -2890 to +292 pB1B human BACE1 promoter region from -9 to +292 PBS phosphate buffered saline PBS-Tx PBS with 0.1% Triton X-100 PBS-T PBS with 0.1% Tween-20 PCR polymerase chain reaction PFA paraformaldehyde PHF paired helical filaments PI3K phosphoinositide 3 kinase PKB protein kinase B, a.k.a Akt PS1 Presenilin 1 PS2 Presenilin 2 PVDF-FL Immobilon\u00C2\u00AE-FL polyvinylidene difluoride RIPA DOC radio-immunoprecipitation assay deoxycholate RT-PCR reverse transcription polymerase chain reaction sAPP\u00CE\u00B1 secretory APP\u00CE\u00B1 sAPP\u00CE\u00B2 secretory APP\u00CE\u00B2 List of abbreviations xviii SDS sodium dodecyl sulfate SDS-PAGE SDS-polyacrylamide gel electrophoresis SH-SY5Y human neuroblastoma siRNA small interference ribonucleic acid VPA valproic acid WT wildtype TNF\u00CE\u00B1 tumor necrosis factor \u00CE\u00B1 20E2 HEK293 cells stably expressing human APP695 with Swedish mutation xix Acknowledgements Acknowledgements During the course of my graduate work, I have been very fortunate to be influenced by many wonderful individuals. First and foremost, I would like to thank my thesis supervisor Dr. Weihong Song. To Dr. Song, I extend profound gratitude for being an excellent mentor and supervisor. I am thankful for your guidance and unwavering support. You have allowed me to work on a topic that I am truly passionate about. During this training period, you provided me with endless opportunities inside and outside the laboratory setting, which I have benefited so much and have grown as a scientist and a person. Thank you for being a great role model. I would like to thank my supervisory committee members, Drs. Katerina Dorovini-Zis, Shernaz Bamji, and Yutian Wang. My supervisory committee members provided wisdom, support, and critical guidance throughout this thesis. In addition to the intellectual contributions, their advices on career planning and achieving work-life balances are highly appreciated. I would like to especially thank Dr. Zis for spending tremendous amount of time going over the human brain sections with me, while educating me on human AD pathology. To the current and past colleagues in the Song lab, you have helped make this experience a positive one. In particular, I would like to thank Dr. Yili Wu, Mingming Zhang, and Yi Yang for helping me carryout some experiments, while I was in Chongqing as an exchange student. I would also like to thank some of the graduate students and post-doctoral fellows who I had benefited from working Acknowledgments xx beside: Dr. Weihui Zhou, Dr. Ruitao Wang, Dr. Fang Cai, Fiona Zhang, Shuting Zhang, Xiaojie Zhang, Juelu Wang, Daochao Huang. Many thanks to Haiyan Zou for her hard work genotyping, breeding and caring of the animals. Many thanks to Rebecca Ko, for taking the time to read through this thesis and provide insightful comments. I would like to acknowledge the financial support during my doctoral training from National Sciences and Engineering Research Council of Canada and the Michael Smith Foundation. I was also awarded the NSERC-Michael Smith Foreign Study prize, which allowed me to visit Chongqing, China as an exchange student. With this award, I was able to get training in the Ministry of Education Key Laboratory for Child Development and Disorder in the Children\u00E2\u0080\u0099s Hospital of Chongqing Medical University. I will not have been able to get this far without the endless support from my family. Many thanks to my parents; they have always been very supportive for any thing I did and any goals that I am trying to achieve. My parents also taught me the basic skills required to function in life. To my wife Carmen, you have always been the source of logic and my voice of reason through this whole experience. I love you and thank you from the bottom of my heart. xxi Dedication To my parents, my sister Jennifer, and my wife Carmen, who make everything possible. 1 Chapter 1: General introduction Chapter 1 General introduction 1.1 Alzheimer\u00E2\u0080\u0099s disease Alzheimer\u00E2\u0080\u0099s disease (AD) is the most common neurodegenerative disorder leading to dementia. Patients with AD typically display with memory loss. As the disease continues to progress other cognitive abilities are lost, including the ability to speak, understand, think, and make decisions. All these cognitive impairments hinder the patients\u00E2\u0080\u0099 ability to carryout daily activities. The German physician Alois Alzheimer reported the first AD case over a century ago. In 2010 the World Alzheimer Report estimated that more than 35.6 million people globally are suffering from Alzheimer\u00E2\u0080\u0099s disease. The trend of global prevalence is projected to double every 20 years, reaching 115.4 million people in 2050 (ADI 2010). On a smaller scale, the Alzheimer\u00E2\u0080\u0099s Association of Canada reported that in 2010 more than 500,000 Canadians were living with Alzheimer\u00E2\u0080\u0099s disease. Of these patients, 85% were over the age of 65 years old. The incidence of AD appears to be increasing\u00E2\u0080\u0094estimated to be over 100,000 new cases in Canada in the year 2008. Within generation\u00E2\u0080\u0099s time, it has been estimated that there will be 250,000 new cases per year, which is equivalent to one case every two minutes (AAC 2010). Despite the tremendous effort invested into studying this disease, there is still no effective treatment for AD. As of 2010 the cost of dementia in Canada was estimated at $22 billion a year. If no changes are implemented, the cost of AD will climb to $153 billion a year within a generation General introduction 2 (ASC 2010). This will impose substantial burden to the family, health care system, and the economy. The main characteristic pathological features of AD brains are formation of intraneuronal neurofibrillary tangles (NFTs), deposition of extraneuronal amyloid plaques, and neuronal loss. NFTs occur in selected neuronal cell bodies and are intraneuronal masses of abnormal, helically wound filaments (Selkoe and Podlisny, 2002). NFTs are largely composed of hyperphosphorylated microtubule-associated tau protein (Grundke-Iqbal et al., 1986; Iqbal et al., 1989; Kosik et al., 1986). The presence of NFTs, however, is not a unique pathology for AD. NFTs could also be detected in other less common dementia cases such as frontotemporal dementia with parkinsonism on chromosome 17 (FTDP-17). On the other hand, amyloid plaques are compacted, spherical deposits of extracellular, ~8 nm fibrils of the A\u00CE\u00B2 protein (Selkoe and Podlisny, 2002). Quite often, amyloid plaques are surrounded by dystrophic neurites. A\u00CE\u00B2 is the central component of neuritic plaques and is unique to AD cases (Glenner and Wong, 1984). A\u00CE\u00B2 is generated from sequential endoproteolytic cleavages of the type 1 transmembrane glycoprotein \u00CE\u00B2-amyloid precursor protein (APP) by \u00CE\u00B2-secretase and \u00CE\u00B3-secretase. In addition to plaques and tangles, AD patients will inevitably manifest cerebral atrophy and neurodegeneration. Interestingly, there are selective populations of neurons such as, CA1 hippocampal neurons and entorhinal cortical neurons, which are more vulnerable in AD brains (West, 1993; Gomez-Isla, et al. 1997). It is unclear why there is region specific susceptibility in AD brains as compared to other neurodegenerative diseases. Although neuronal loss has been documented in AD, the mechanism that leads to the death of the neurons has not been clearly General introduction 3 defined. Amongst all the neuropathological features in AD, synaptic loss is the best correlate for memory dysfunction. Moreover, the concentrations of synaptic proteins such as synaptophysin and synaptobrevin are significantly reduced in AD patients (Heffernan et al., 1998; Lue et al., 1999; Ma and Klann, 2011; Reddy et al., 2005; Reese et al., 2011; Sokolov et al., 2000). The underlying reason for synaptic loss in AD remains controversial. Recent findings have implicated the toxic role of A\u00CE\u00B2 in damaging synapses. In particular, A\u00CE\u00B2 treatment has been shown to alter LTP and calcium signaling, leading to reduced synapse size and abnormal protein compositions of the post synaptic density region (Heffernan et al., 1998; Lue et al., 1999; Ma and Klann, 2011; Reddy et al., 2005; Reese et al., 2011; Sokolov et al., 2000). 1.2 APP processing pathways It has been known for decades that AD can cluster in families and inherited in an autosomal dominant fashion. Early-onset AD cases occurring before the age of 60 year old is less than 5% of all AD cases. Clinical and histopathological manifestations of early-onset familial AD are the same as late-onset sporadic cases. However, the etiology of early-onset AD is purely genetics. The etiology of sporadic late-onset dementia cases is mostly unclear, but often results from vascular issues, glucose dysregulation, amongst other disease risk factors. Late- onset sporadic AD cases contribute to the majority of AD prevalence and typically occur after 60-65 years old. Although familial cases are rare, these cases have allowed researchers to examine the pathomechanism underlying AD. APP is a type I transmembrane protein encoded by a single gene on chromosome 21. There are three major isoforms: APP695 (Kang et al., 1987), APP751 (Buxbaum et al., 1990; Gandy et al., 1988; Ponte et al., 1988; Tanzi et al., 1988), General introduction 4 and APP770 (Kitaguchi et al., 1988). APP695 is the major isoform found in neuronal cells (Kang et al., 1987). APP undergoes a series of post-translation modifications including phosphorylation, sulfation, and glycosylations as it matures through the Golgi apparatus to the cell membrane (Dyrks et al., 1988; Weidemann et al., 1989). Since the APP gene was first cloned in 1987, subsequent studies have provided evidence that dysregulated APP processing contributes to the AD pathologies. Down\u00E2\u0080\u0099s syndrome patients inevitably will develop classical AD pathologies in their middle age (Lemere et al., 1996; Teller et al., 1996; Tokuda et al., 1997). The underlying mechanism may be due to duplication of an extra copy of the APP gene in chromosome 21 (Prasher et al., 1998). It has been hypothesized that a similar set of events occurs in Down\u00E2\u0080\u0099s syndrome and AD resulting in lesion in the brain. Previous linkage studies have identified various mutations in the APP gene that may contribute early-onset AD in several families (see Table 1.1). For example, the first study to identify a mutation in APP within the A\u00CE\u00B2 domain was linked to a Dutch family (APP ductch) (Levy et al., 1990). Here, the patients succumbed to multiple cerebral hemorrhages and amyloidosis around cerebral microvasculatures in the absence of NFTs. Subsequently more mutations were identified in the APP gene that were linked to AD, including mutant genes APP London, APP Flemish, and APP Swedish were later identified and linked to early- onset familial AD cases (Selkoe and Podlisny, 2002). All of these mutations in the APP gene lead to increase amyloid production. General introduction 5 Table 1.1 Genetic factors contributing to Alzheimer's disease pathogenesis. Gene Location Defect Age of onset (y) Phenotype APP 21q13 Missense mutation Trisomy 21 40s - 50s \u00EF\u0083\u00A9 A\u00CE\u00B242 Presenilin 1 14q24 Missense mutations 40s - 50s \u00EF\u0083\u00A9 A\u00CE\u00B242 Presenilin 2 1q42 Missense mutations 50s \u00EF\u0083\u00A9 A\u00CE\u00B242 APOE4\u00CE\u00B5 19q13 Polymorphism >60 \u00EF\u0083\u00A9 A\u00CE\u00B242 APP: amyloid precursor protein; APOE4\u00CE\u00B5, apolipoprotein E4\u00CE\u00B5 isoform. The APP holoprotein undergoes a series of enzymatic cleavages mediated by \u00CE\u00B1- secretase, \u00CE\u00B2-secretases (BACE1 and BACE2), and the \u00CE\u00B3-secretase complex. In the following sections, the APP processing pathways will be described in greater details. 1.2.1 \u00CE\u00B1-secretase mediates non-amyloidogenic pathway Despite the robust expression of APP protein, physiological levels of A\u00CE\u00B2 are barely detectable (Li et al., 2006). A\u00CE\u00B2 production is regulated on several levels. This will be discussed further in the subsequent sections. The majority of APP undergoes the non-amyloidogenic pathway catalyzed by \u00CE\u00B1-secretase (Figure 1). Although the exact identity of \u00CE\u00B1-secretase remains to be revealed, some candidates include A Disintegrin And Metalloprotease domain 9 (ADAM9), ADAM 10, ADAM 17, and tissue necrosis factor-alpha converting enzyme (Hiraoka et al., 2007; Sun et al., 2012). APP processing by \u00CE\u00B1-secretase involves a cut between Lys16 and Leu17 within the A\u00CE\u00B2 domain to generate a secretory APP\u00CE\u00B1 (sAPP\u00CE\u00B1) and a C83 fragment (Esch et al., 1990; Oltersdorf et al., 1990; Sisodia et al., 1990). The C83 fragment can be further cleaved by \u00CE\u00B3-secretase, producing a p3 fragment and the APP intracellular domain (AICD) (Edbauer et al., 2002; Kim et al., 2003). In this pathway, no A\u00CE\u00B2 is generated. General introduction 6 1.2.2 \u00CE\u00B2-secretase and its role in A\u00CE\u00B2 production APP processing at the \u00CE\u00B2 site is mediated by the \u00CE\u00B2-site APP cleaving enzyme 1 (BACE1), which is the \u00CE\u00B2-secretase of 501 amino acids in vivo (Hussain et al., 2000; Sinha et al., 1999; Vassar et al., 1999; Yan et al., 1999). BACE1 cleavage of APP is essential to generate A\u00CE\u00B2. BACE1 cleaves APP at two \u00CE\u00B2-sites, Asp+1 and Glu+11 of the A\u00CE\u00B2 domain, to generate the C99 fragment and C89 fragment, respectively (Li et al., 2006). Subsequently, \u00CE\u00B3-secretase cleaves C99 within its transmembrane domain to release A\u00CE\u00B2 and the APP c-terminal fragment (CTF)-\u00CE\u00B3 (Figure 1). In addition to APP, BACE1 substrates also include other proteins: LRP (von Arnim et al., 2005), amyloid precursor-like protein (APLP)1 (Li and Sudhof, 2004), APLP2 (Pastorino et al., 2004), the sialytransferase ST6Gal I (Kitazume et al., 2001), and the P-selectin glycoprotein ligand (PSGL)1 (Lichtenthaler et al., 2003). Figure 1.1 APP processing pathways. In the amyloidogenic pathway, APP is cleaved \u00CE\u00B2-secretase to generate the C99 fragment, which is then processed by \u00CE\u00B3-secretase to produce A\u00CE\u00B2. Under physiological conditions, the non- amyloidogenic pathway is predominant involving \u00CE\u00B1-secretase cleavage of APP within the A\u00CE\u00B2 General introduction 7 domain. This cleavage precludes A\u00CE\u00B2 production but generates a C83 fragment. The cleavage sites of each \u00CE\u00B1, \u00CE\u00B2, \u00CE\u00B3-secretase are indicated. BACE1 undergoes a complex set of post-translational modifications during its maturation including removal of the pro-peptide (Benjannet et al., 2001; Bennett et al., 2000b; Capell et al., 2000; Creemers et al., 2001; Shi et al., 2001), phosphorylation (Capell et al., 2000; Huse et al., 2000; Walter et al., 2001), and glycosylation (Capell et al., 2000; Charlwood et al., 2001; Haniu et al., 2000; Huse et al., 2000). BACE1 is also ubiquitinated and it is degraded via the ubiquitin proteasome pathway (Qing et al., 2004). Shortly after the BACE1 gene was cloned, a homologue called BACE2 was identified (Acquati et al., 2000; Farzan et al., 2000). The BACE2 gene is located on chromosome 21 at close proximity to the APP gene (Stockley and O'Neill, 2007). Therefore, BACE2 had previously been hypothesized to contribute to AD pathogenesis and APP processing. Unlike BACE1, neuronal expression of BACE2 is low or undetectable (Bennett et al., 2000a). Moreover, genetic analysis of the BACE1 and BACE2 5\u00E2\u0080\u0099UTR show no similarities, indicating differential mechanisms for regulating gene expression. Work from our own laboratory showed that transcriptional regulation of both genes is distinctly regulated (Sun et al., 2005). Although BACE2 is a homologue of BACE1, both proteins seem to distinctly affect APP processing and A\u00CE\u00B2 production. Previous studies have demonstrated that siRNA knockdown of BACE2 increases A\u00CE\u00B2 production, whereas overexpression of exogenous BACE2 reduces the amount of A\u00CE\u00B2 being generated (Sun et al., 2005). This finding was confirmed by overexpressing BACE2 using lentiviral transduction in embryonic primary cortical neurons derived from Swedish mutant APP transgenic mice and showing reduced A\u00CE\u00B2 production (Sun et al., 2006b). Work from our laboratory further demonstrated General introduction 8 that BACE2 mediates a cleavage at the theta site of APP between Phe19 and Phe20 residues within the A\u00CE\u00B2 domain, precluding the formation of A\u00CE\u00B2 (Sun et al., 2006b). Taken together, these data showed that BACE2 is not functionally homologous to BACE1. Instead, BACE2 is primarily a \u00CE\u00B8-secretase and contributes to non-amyloidogenic processing of APP. 1.2.3 Presenilins and the \u00CE\u00B3-site cleaving enzyme complex The \u00CE\u00B3-secretase is a multi-subunit intramembrane protease complex that cleaves single transmembrane precursor proteins at residues within the transmembrane domain (De Strooper and Annaert). The most well known substrates of \u00CE\u00B3- secretase are the c-terminal fragments of APP. In the amyloidogenic pathway, \u00CE\u00B3- secretase cleaves the C99 fragment to release either A\u00CE\u00B240 or A\u00CE\u00B242. It should be noted that it is A\u00CE\u00B242 that easily forms fibrils and may cause AD. The \u00CE\u00B3-secretase is also critical in the processing of the Notch protein in a similar manner (De Strooper et al., 1999; Song et al., 1999). The \u00CE\u00B3-secretase complex has not yet been fully characterized. However known binding partners of the \u00CE\u00B3-secretase complex consist of presenilin (PS) 1 and 2, nicastrin (Nct), APH-1 (anterior pharynx defective 1), and PEN-2 (presenilin enhancer 2) (De Strooper, 2003). PS 1 and PS2 were the first \u00CE\u00B3-secretase subunits identified and were proposed to be the catalytic core. PS1 knockout (KO) mice die at embryonic day 19 and display a Notch null phenotype. Mice KO of both PS1 and PS2 die at embryonic day 9.5 with significant neural defects (Donoviel et al., 1999). APP processing at the \u00CE\u00B3-site and Notch NCID production is diminished in PS1 deficient cells, arguing for PS1 as the \u00CE\u00B3-secretase (De Strooper et al., 1999; Song et al., 1999). More than 100 missense mutations in PS1 and PS2 have been linked to familial, General introduction 9 early-onset AD (Levy-Lahad et al., 1995a; Levy-Lahad et al., 1995b; Mullan et al., 1992; Rogaev et al., 1995; Schellenberg et al., 1992; Sherrington et al., 1995; St George-Hyslop et al., 1992) and these mutations accelerate the production of A\u00CE\u00B2 (Borchelt et al., 1997; Borchelt et al., 1996; Scheuner et al., 1996) . This suggests that presenilin proteins play an important role in APP processing. Previous works have demonstrated that PS1-null cells show decreased A\u00CE\u00B2 production and APP CTF accumulation (De Strooper et al., 1998). Moreover, dominant-negative mutants of PS1 and PS2 inhibited A\u00CE\u00B2 production (Kimberly et al., 2000; Steiner et al., 1999; Wolfe et al., 1999). The use of transitional state inhibitors of the \u00CE\u00B3-secretase complex has been reported to bind to PS1 and inhibit APP CTF processing (Evin et al., 2005). While the presenilin proteins appear to be the catalytic core of the \u00CE\u00B3-secretase complex, overexpression of full length PS1 does not increase \u00CE\u00B3-secretase activity. PS1 and PS2 undergo endoproteolysis to produce N-terminal fragments (NTFs) and CTFs, but do not increase the production of A\u00CE\u00B2 (Kim et al., 2003; Steiner et al., 1999; Thinakaran et al., 1996). This suggests that other factors are required for \u00CE\u00B3-secretase activity. As the \u00CE\u00B3-secretase complex is a multi-subunit intramembrane protease, all members of the subunit are required to interact in certain ways for functional secretase activity. Moreover, these binding partners contribute to the high molecular weight complex for \u00CE\u00B3-secretase activity (Li et al., 2000). The PS1/2 binding partners Nct, Aph-1, and Pen-2 were identified in C. elegans studies. Knockdown or mutation analyses indicated that loss of functions of these binding partners result in a phenotype identical to the Notch-defective phenotype (Francis et al., 2002; Goutte et al., 2002; Yu et al., 2000). Furthermore, siRNA knockdown of these proteins in Drosophila hinders \u00CE\u00B3-secretase activity (Edbauer et al., 2002; General introduction 10 Kimberly et al., 2003; Steiner et al., 2002). Nct was the first binding partner to be identified and functions to stabilize the presenilin complex (Yu et al., 2000). Aph- 1 was later found to interact with Nct and the presenilins and also contributes to the stability of PS1/2. Overexpression of Nct and Aph-1 in cells increased the stable pool of holo-presenilins without affecting the \u00CE\u00B3-secretase activity. Overexpression of Pen-2 resulted in a significant reduction in holo-PS1 protein but the PS1-CTF and PS1-NTFs were increased along with \u00CE\u00B3-secretase activity (Steiner et al., 2002). This latter finding indicates that Pen-2 facilitates the PS1 catalytic functions. Targeting each subunit of the \u00CE\u00B3-secretase complex has therapeutic value for treating Alzheimer\u00E2\u0080\u0099s disease. However, one must be cautious with \u00CE\u00B3-secretase inhibition, since Notch signaling will also be affected. Notch is an integral membrane protein that undergoes intramembranous cleavage by the \u00CE\u00B3-secretase complex to generate Notch intracellular domain (NICD), which can then translocate to the cell nucleus and activate gene transcription (Kopan et al., 1996; Schroeter et al., 1998). Notch signaling is highly important during embryonic and postnatal development as the pathway regulates cell proliferation and differentiation (Donoviel et al., 1999; Maillard et al., 2003; Stanger et al., 2005). Therefore, \u00CE\u00B3-secretase inhibitors have not been successful in treating AD, since these inhibitors typically suppress Notch signaling and unwanted side effects. Previous studies indicated that deletion of the Aph-1B isoform led decreased \u00CE\u00B3- secretase activity and led to improvement in an AD mouse model, but did not affect Notch cleavage. Therefore inactivation of the \u00CE\u00B3-secretase complex containing Aph-1B reduced A\u00CE\u00B2 production without affecting Notch cleavage (Serneels et al., 2009). Future studies will provide insights on designing strategies General introduction 11 that target the \u00CE\u00B3-secretase-dependent APP processing pathway without affecting Notch signaling. 1.3 The \u00E2\u0080\u009Crevised\u00E2\u0080\u009D amyloid hypothesis Discoveries from trisomy 21 cases and AD-linked mutations in the APP gene have led to the formation of the amyloid hypothesis (Lemere et al., 1996; Teller et al., 1996; Tokuda et al., 1997). This hypothesis states that accumulation of the insoluble oliogomeric A\u00CE\u00B2 protein in the brain tissue is the primary factor that drives AD pathogenesis. The other pathological features including tau hyperphosphorylation, NFT formation, neuronal loss, neuroinflammation, and calcium imbalance, are secondary events to A\u00CE\u00B2 toxicity (Hardy and Selkoe, 2002). Subsequent identification of the PS1 and PS2 mutations that enhance APP processing and facilitate AD pathogenesis further supports the amyloid hypothesis (Citron et al., 1997; Scheuner et al., 1996; Thinakaran et al., 1996). Moreover APOE4, the major genetic risk factor for late-onset AD, leads to excess amyloid buildup in the AD brains (Polvikoski et al., 1995). For over 15 years, the amyloid hypothesis offered a broad framework to explain the underlying mechanisms in AD pathogenesis. However, the hypothesis lacks detail and does not necessarily fit with some observations. For example, the most common issue about the amyloid hypothesis is that the number of amyloid plaques does not correlate well with the degree of cognitive impairment (Giannakopoulos et al., 2003). Moreover, there have been reports of AD patients that have cognitive deficits without any amyloid plaques. There have also been documentations of subjects with substantial amyloid plaques that did not present with any clinical signs of AD (Armstrong, 1994, 1995; Armstrong et al., 1996). More recent studies demonstrate with biochemical assays that A\u00CE\u00B2 loads correlate General introduction 12 more closely with cognitive impairment than the histologically-detected plaques (Cairns et al., 2009; Jack et al., 2009; Jack et al., 2010; Morris et al., 2009). Another concern with the amyloid hypothesis is that neurotoxic features of the A\u00CE\u00B2 species have not yet been clearly elucidated. The mixtures of A\u00CE\u00B2 species in AD brains have made it difficult to ascribe which is the main toxic form (Hardy and Selkoe, 2002; Selkoe and Podlisny, 2002). Several lines of evidence have converged to show that soluble A\u00CE\u00B2 oligomers, but not the insoluble A\u00CE\u00B2 fibrils in the form of neuritic plaques or A\u00CE\u00B2 monomers, cause neurotoxicity and synaptic dysfunctions in AD (Kamenetz et al., 2003; Wei et al., 2010). Further confirming this argument is that transgenic mice overexpressing human mutant APP genes have cognitive impairment prior to detectable plaque formation (Games et al., 1995; Hsiao et al., 1996). LTP, a molecular correlate of learning and memory, was inhibited following injection of cell culture medium containing natural oligomeric A\u00CE\u00B2 into the hippocampus. However, this effect could not be achieved by the soluble A\u00CE\u00B2 monomers (Walsh et al., 2002). General introduction 13 Figure 1.2 The amyloid hypothesis of Alzheimer\u00E2\u0080\u0099s disease. The sequence of pathogenic events leading to AD. The arrows indicate that A\u00CE\u00B2 oligomers may directly injure the synapses and neurons of brain neurons, alter kinase activity and induce NFT formation, in addition to activating the immune cells. Diagram adapted from Hardy and Selkoe, 2002. Take together, the data suggest that the role of soluble oligomeric A\u00CE\u00B2 as the toxic agent in AD pathogenesis should be incorporated into a revised amyloid hypothesis (Figure 1.2). Previous works have demonstrated that soluble oligomeric A\u00CE\u00B2 induces neurotoxicity (Yankner et al., 1989), activates inflammatory cells, induces NFT formation (Zheng et al., 2002), and impairs learning and memory in rodent models (Kamenetz et al., 2003; Wei et al., 2010). Moreover, environmental risk factors for AD such as aging, cardiovascular disorders, diabetes mellitus, and smoking, amongst others could enhance A\u00CE\u00B2 production and contribute to neuropathologies observed in late-onset AD. Therefore treatment strategies have focused on ways to interfere with A\u00CE\u00B2 General introduction 14 production and/or facilitate its removal. The main focus of this thesis is on strategies that modulate the APP processing cascade, thereby limiting A\u00CE\u00B2 production and promoting treatment of AD. 1.4 BACE1 gene expression and its role in Alzheimer\u00E2\u0080\u0099s disease BACE1 has a tissue-specific expression pattern. BACE1 is relatively high levels in the brain and pancreas (Hussain et al., 2000; Marcinkiewicz and Seidah, 2000). Moreover, BACE1 can be detected in neurons in all brain regions, but not in glial cells (Marcinkiewicz and Seidah, 2000; Vassar et al., 1999; Yan et al., 1999). The 5\u00E2\u0080\u0099 leader of BACE1 mRNA was shown to affect the translation initiation efficiency of BACE1 protein (Rogers et al., 2004). Moreover, Zhou and Song (2006) found that leaky scanning and reinitiation are involved in inhibition of the physiological AUG-initated BACE1 translation. Such leaky scanning and reinitiation result in weak translation of BACE1 translation under normal conditions (Zhou and Song, 2006). 1.4.1 Transcription regulation in the BACE1 promoter BACE1 gene expression is also tightly regulated at the transcriptional level. In the same year, Dr. Lahiri\u00E2\u0080\u0099s group and our laboratory cloned and functionally characterized the human BACE1 promoter for the first time (Christensen et al., 2004; Ge et al., 2004; Sambamurti et al., 2004). The BACE1 gene has a complex promoter unit that contains many putative transcription factor binding sites such as Sp1, AP2, NF\u00CE\u00BAB, YY1, MZF1, HNF3\u00CE\u00B2, HIF1\u00CE\u00B1, and GC box, just to list a few (Christensen et al., 2004; Ge et al., 2004; Nowak et al., 2006; Rossner et al., 2006). We showed that transcription factor Sp1 is essential for the BACE1 gene expression and APP processing to generate A\u00CE\u00B2 (Christensen et al., 2004). In rat General introduction 15 neurons, the transcription factor YY1 activates BACE1 gene expression through a putative responsive element within the BACE1 promoter (Nowak et al., 2006). Constitutive JAK2/signal transducer and activator of transcription (STAT)1 signaling also contributed to basal expression of BACE1 and subsequent A\u00CE\u00B2 generation in neurons (Cho et al., 2009). Moreover, increases in intracellular calcium levels by A\u00CE\u00B2 or a calcium ionophore could also stimulate BACE1 gene expression through calcineurin-nuclear factor of activated T cells (NFAT) signaling (Cho et al., 2008). Recently, our laboratory found that both BACE1 and NF-\u00CE\u00BAB levels were increased in AD cases as compared to the age-matched controls. Furthermore, the BACE1 promoter harbours four NF-\u00CE\u00BAB cis-elements and NF-\u00CE\u00BAB was found to bind to the BACE1 promoter and facilitate gene expression and APP processing (Chen et al., 2011c) suggesting a novel pathway in which NF-\u00CE\u00BAB regulates BACE1 expression. 1.4.2 Hypoxia facilitates BACE1 transcription Although some gene mutations have been linked to early-onset AD, the majority of the cases are late-onset and sporadic. The etiopathogenesis of sporadic AD is unclear, but shares the same neuropathological features with early-onset AD. Some risk factors include aging, hypertension, cerebral infarct, obesity, diabetes, cigarette smoking, education, and physical activity have been linked to late-onset sporadic AD (Reitz et al., 2011; Sekita and Kiyohara, 2010). Therefore, it is very possible that sporadic AD may be secondary to previous pathological conditions. A history of stroke increases AD prevalence by two-fold (Altieri et al., 2004; Schneider et al., 2003; Snowdon et al., 1997; Vermeer et al., 2003). Hypoxia is a direct consequence of hypoperfusion in the brain, which then leads to neurodegeneration. General introduction 16 Hypoxia has been known to activate the transcription factor hypoxia-inducible factor (HIF). HIF1 is composed of two subunits: HIF1\u00CE\u00B1 and HIF1\u00CE\u00B2. The HIF1\u00CE\u00B2 subunit is constitutively expressed and stable is cells. On the other hand, HIF1\u00CE\u00B1 is the principal molecule regulating oxygen homeostasis (Huang et al., 1999). Under normoxic conditions HIF1\u00CE\u00B1 is readily degraded with a half-life of approximately five minutes (Huang and Bunn, 2003). During hypoxic conditions, however, HIF1\u00CE\u00B1 levels are stabilized and forms a complex with HIF1\u00CE\u00B2, which then translocate to the nucleus and binds to the promoter of target genes. Lu et al. (2004) found that HIF1 levels are upregulated in the human frontal cortex in aged subjects (Lu et al., 2004). Moreover our laboratory found that the human BACE1 promoter contains a functional hypoxia response element (Sun et al., 2006a). Furthermore, hypoxic conditions facilitate BACE1 expression in a HIF1\u00CE\u00B1- dependent manner (Sun et al., 2006a; Xue et al., 2006). Consequently, hypoxia leads to increased A\u00CE\u00B2 deposition and neuritic plaque formation as well as potentiated memory deficit in APP transgenic mice (Sun et al., 2006a; Zhang et al., 2007). These studies clearly demonstrate that hypoxia can facilitate AD pathogenesis via activating BACE1 gene expression and provide a novel molecular link between vascular risks and AD. 1.4.3 Energy inhibition increase BACE1 expression Energy deprivation is another risk factor for AD (Velliquette et al., 2005). In an attempt to address the underlying mechanism, O\u00E2\u0080\u0099Connor et al. (2008) used an in vitro model of energy deficiency by depriving cells of glucose. The authors found that glucose deprivation increased BACE1 expression at the post-transcription level, namely targeting the 5\u00E2\u0080\u0099 UTR of the BACE1 promoter. Glucose deprivation induces a stress response that leads to phosphorylation and activation of the eukaryotic initiation factor 2\u00CE\u00B1 (eIF2\u00CE\u00B1), suggesting that eIF2\u00CE\u00B1 promotes BACE1 General introduction 17 translation under energy-deprived conditions. Taken together, these findings argue for an important role of BACE1 in A\u00CE\u00B2 production and AD pathogenesis. Depending on the type of neurotoxic stimulus, BACE1 expression may be affected at the transcriptional level or at the protein synthesis level or even affecting the stability of the BACE1 protein. Therefore methods of modulating BACE1 expression will have pharmaceutical value in treating AD. To date, there are no known BACE1 gene mutations associated with AD. However, BACE1 expression and activity were found to be elevated in AD brains (Fukumoto et al., 2002; Holsinger et al., 2002). BACE1 expression is tightly regulated at the transcriptional (Christensen et al., 2004; Li et al., 2006; Sun et al., 2005) and translational level (De Pietri Tonelli et al., 2004; Lammich et al., 2004; Rogers et al., 2004; Zhou and Song, 2006). Previous reports indicated that a G/C polymorphism in exon 5 of the BACE1 gene might be associated with some sporadic cases of AD (Clarimon et al., 2003; Kirschling et al., 2003; Shi et al., 2004). Although genetic analysis failed to uncover any mutation within the coding sequence or any single nucleotide polymorphisms (SNP) in the promoter region in AD patients (Cruts et al., 2001; Nicolaou et al., 2001; Zhou et al., 2010), a significant increase in \u00CE\u00B2-secretase level and activity had been reported in AD (Chen et al., 2011c; Fukumoto et al., 2004; Holsinger et al., 2002; Russo et al., 2000; Yang et al., 2003). Wang et al. (2008) found that BACE1 mRNA levels increase as the disease progresses, which was inversely correlated to the levels of the microRNA miR-107 (Wang et al., 2008). Moreover, BACE1 expression was found to be elevated in neurons within close proximity to neuritic plaques (Zhao et al., 2007). This implies BACE1 may play an essential role in the etiopathogenesis of sporadic AD cases, where no clear genetic cause is discernable. General introduction 18 1.5 Glycogen synthase kinase 3 signaling Glycogen synthase kinase (GSK3) is a serine/threonine kinase that was first identified to inhibit glycogen synthase activity (Embi et al., 1980; Hemmings et al., 1981; Woodgett, 1990; Woodgett et al., 1982). However, over the past two decades, there has been much evidence to show that GSK3 has more diverse roles, including gene transcription regulation, inflammatory responses, development, insulin action, cell division cycle, DNA damage responses, and cell survival, amongst others [reviewed in (Meijer et al., 2004)]. Thus GSK3 is central to many different signal transduction pathways and dysregulated GSK3 activity has been implicated in the development of many human diseases such as diabetes mellitus, AD, bipolar disease, and various types of cancers [reviewed in (Doble and Woodgett 2003)]. Given its involvement in the pathophysiology of many human diseases, GSK3 is a major pharmaceutical target for developing therapies. Figure 1.3 Physiological roles of GSK3 signaling. GSK3 is central to many signal transduction cascades. Depending on the stimuli, the activity level of GSK3 changes as indicated by the phosphorylation status of the inhibitory serine 21/9 sites and tyrosine 279/216 residues. The activity level of GSK3 will further affect down stream molecules, General introduction 19 which are essential for regulating cellular processes such as glycogen metabolism, gene transcription, and apoptosis. There are two conserved mammalian GSK3 isoforms encoded by distinct genes: GSK3\u00CE\u00B1 and GSK3\u00CE\u00B2. GSK3\u00CE\u00B1 has a mass of 51 kD, whereas GSK3\u00CE\u00B2 is 47 kDa (Hansen et al., 1997; Woodgett, 1990). The slight difference in size is due to a glycine-rich extension at the amino terminus of GSK3\u00CE\u00B1. GSK3\u00CE\u00B1 and GSK3\u00CE\u00B2 are 97% identical in their catalytic domain, but outside the catalytic core, both GSK3 enzymes are only 36% identical (Woodgett, 1990). Despite the high similarity in the catalytic core, GSK3\u00CE\u00B1 and GSK3\u00CE\u00B2 appear to be functionally distinct. For example, knocking out GSK3\u00CE\u00B2 in mice is embryonically lethal and cannot be rescued by GSK3\u00CE\u00B1 (Hoeflich et al., 2000). Moreover, the GSK3\u00CE\u00B22, an alternative splice variant of GSK3\u00CE\u00B2 was demonstrated to function differently from GSK3\u00CE\u00B2 during tau hyperphosphorylation (Mukai et al., 2002). Conceivably, GSK3\u00CE\u00B1 and GSK3\u00CE\u00B2 are related kinases that may regulate distinct signaling pathways. GSK3 was originally isolated from skeletal muscles, but was later found to be ubiquitously expressed in all tissue. The brain in particular is abundant in GSK3 levels (Leroy and Brion, 1999). Furthermore, Leroy and Brion (1999) found that embryonic rat brains express the most abundant level of GSK3\u00CE\u00B2, which drastically decreases after postnatal day 20. However, the level of GSK3\u00CE\u00B2 in the brain is still relatively higher compared to other tissues (Leroy and Brion, 1999). This suggests that GSK3 may play a fundamental role in neuronal signaling pathways. General introduction 20 1.5.1 Regulation of GSK3 activity The crystal structure of GSK3 has provided the much needed information on GSK3 regulation (Bax et al., 2001; Dajani et al., 2001; ter Haar et al., 2001). GSK3 kinase activity is mainly regulated by protein phosphorylation on conserved amino acid residues (Wang et al., 1994). Phosphorylation on a serine residue results in decreased GSK3 activity. Conversely, phosphorylation on a tyrosine residue enhances GSK3 activity. Abnormal phosphorylation on either residue may have deleterious effects on the cell, since GSK3 is central to many cellular processes. An understanding of the normal regulation of GSK3 will help further our understanding of cellular mechanisms underlying various human diseases where GSK3 activity goes awry. SERINE PHOSPHORYLATION Stimulation of cells with growth factors leads to GSK3 inactivation through a phosphoinositide 3-kinase (PI3K)- dependent signaling pathway. The insulin and IGF-1 effects on GSK3 inactivation have been well-studied (Cross et al., 1995; Cross et al., 1994). Insulin/insulin-like growth factor (IGF)-1 stimulation activates PI3K, which in turn phosphorylates and activates Akt/PKB, a serine/threonine kinase (Alessi et al., 1996). Active Akt/PKB in turn phosphorylates SER21 on GSK3\u00CE\u00B1 and SER9 on GSK3\u00CE\u00B2 and inhibit GSK3 activity (Cross et al., 1995) (Figure 1.3). Other stimuli also triggered mechanisms that lead to GSK3 inhibition. For example, epidermal growth factor and platelet-derived growth factors stimulate p90 ribosomal s6 kinase (RSK), a member of the mitogen activated protein kinase (MAPK) family, which leads to GSK3 phosphorylation at the inhibitory serine residue. The crystal structure of GSK3 provided an explanation for the inhibitory role of serine phosphorylation. The catalytic domain of GSK3 contains many positively General introduction 21 charged amino acids. Phospho-SER21/SER9 becomes a pseudosubstrate that binds to the catalytic domain. This type of self-interaction precludes binding of GSK3 substrates because the catalytic domain is occupied. This observation offers the possibility to design modeled small molecule inhibitors that fit into the positively charged pocket of the GSK3 kinase domain as a way to inhibit GSK3 activity [reviewed in (Doble and Woodgett, 2003)]. Due to the high similarity between the kinase domains of GSK3 with other kinases, such an approach has yet to be successful. TYROSINE PHOSPHORYLATION The crystal structures of GSK3 indicated that this kinase requires phosphorylation in its activation loop as a prerequisite for activity. The activation loop of GSK3 contains a conserved tyrosine residue (TYR279 for GSK3\u00CE\u00B1 and TYR216 for GSK3\u00CE\u00B2), which is phosphorylated by MAPK kinase (a.k.a MEK1/2) (Takahashi-Yanaga et al., 2004) and several non- receptor tyrosine kinases such as src (Kotova et al., 2006). It has been found that the unphosphorylated TYR279/216 functions to block the access of primed substrates with GSK3 (Bax et al., 2001; Dajani et al., 2001). COMPLEX FORMATION AND INTRACELLULAR LOCALIZATION As mentioned above, GSK3 is central to many signaling pathways but exerts distinct effects. However, how signal selectivity is achieved is an issue that remains to be resolved. A hypothesis on the signal specificity involving GSK3 as an intermediary component involves fractionating GSK3 into different signaling component or cellular structures. This way each component will have its own population of GSK3 and at the same time prevents cross talk between different pathways will be prevented. The canonical Wnt signaling pathway is a good example of regulating GSK3 activity through complex formation. In this pathway, General introduction 22 N-terminal serine phosphorylation and/or tyrosine phosphorylation has little effect on GSK3 activity. Instead, GSK3 is regulated through protein-protein interaction by binding to the scaffolding protein Axin. These molecules are joined by others to create a \u00E2\u0080\u009Cdestruction complex\u00E2\u0080\u009D involving adenomatous polyposis coli (APC), casein kinase (CK) 1, GSK3, and \u00CE\u00B2-catenin (Amit et al., 2002; Gao et al., 2002; Korinek et al., 1998; Liu et al., 2002). Under basal conditions, CK1 phosphorylates \u00CE\u00B2-catenin at Ser45 generating a priming site for GSK3 phosphorylation (Amit et al., 2002; Culbert et al., 2001; Hagen et al., 2002; Hagen and Vidal-Puig, 2002; Liu et al., 2002). Phosphorylation of \u00CE\u00B2-catenin signals it to be degraded via the ubiquitin proteosome pathway (Amit et al., 2002; Liu et al., 2002). Upon Wnt stimulation of the Wnt receptor Frizzled and the co-receptor lipoprotein-like receptor (LRP) 5/6, Disheveled is recruited to the cell membrane. Disheveled phosphorylates LRP5/6, which increases the binding affinity for Axin (Bilic et al., 2007). As Axin relocates to the membrane, the \u00E2\u0080\u009Cdestruction complex\u00E2\u0080\u009D dissociates and \u00CE\u00B2-catenin levels are stabilized, allowing \u00CE\u00B2-catenin to accumulate in the nucleus (Bilic et al., 2007; Zeng et al., 2008). Now the stable \u00CE\u00B2-catenin can translocate to the nucleus where it binds with members of the T cell factor/lympoid enhancement factor (TCF/LEF) family of DNA-binding proteins, resulting in increase transcriptional activation of target genes (Korinek et al., 1998)(Figure 1.3). The Wnt signaling pathway is highly important in embryonic patterning, cell proliferation, and cell movement, amongst other developmental processes (MacDonald et al., 2009). Therefore, aberrant GSK3 activity will have detrimental effects on transducing Wnt signaling and lead to defects in embryogenesis. General introduction 23 GSK3 is largely considered as a cytoplasmic protein, but the kinase can also be detected in the nucleus and mitochondria where it is more active compared to in the cytoplasm (Bijur and Jope, 2003; Franca-Koh et al., 2002; Hoshi et al., 1996). The activity of GSK3 is rapidly increased during apoptosis and a significant portion of GSK3 undergoes nuclear localization (Bijur and Jope, 2001; King et al., 2001; Meares and Jope, 2007). The mechanisms regulating intracellular localization of GSK3 are not fully elucidated. Stimulation of the PKB/Akt pathway has been reported to decrease nuclear levels of GSK3 (Bijur and Jope, 2001). Binding of FRAT1 to GSK3 facilitates nuclear export (Franca-Koh et al., 2002). Recently, a study by Azoulay-Alfaguter et al. (2011) found that the extended glycine-rich N-terminal of GSK3\u00CE\u00B1 prevents nuclear translocation of this isoform (Azoulay-Alfaguter et al., 2011). Notably, the N-terminal of GSK3\u00CE\u00B2 contains a potential nuclear localization signal and deletion of the nine amino acids on the N-terminal of GSK3\u00CE\u00B2 reduces accumulation in the nucleus (Meares and Jope, 2007). 1.5.2 Biological functions of GSK3 As discussed above, GSK3 is ubiquitously expressed and lies central to many signaling pathways. Sequestration of GSK3 to different signaling modules and organelles allowed for specificity of the stimulus to the effect. GSK3 is active under basal conditions and is inactivated by protein phosphorylation. This in turn affects the phosphorylation status and activity of downstream enzymes. To date, there are more than 100 proteins that have been suggested as GSK3 substrates. However, only a few have been validated as physiological substrate of GSK3. In order to be confirmed as a physiological target, certain criteria must be met. According to Frame and Cohen (2001), their criteria for validating a physiological GSK3 substrate requires showing that selective reduction of the phosphorylation General introduction 24 site on the substrate be achieved when the kinase activity is ablated by pharmacological agents or siRNA. Moreover, in vivo manipulation of the kinase activity should affect the phosphorylation status of the substrate in a physiological setting. The GSK3 substrates could be categorized according to their biological processes. In the following sections, some known GSK3 substrates are generally grouped into metabolic and signaling proteins, structural proteins, and transcription factors for ease of discussion (Table 1.2). GSK3 REGULATION OF METABOLISM The first substrate of GSK3 identified is glycogen synthase, which becomes inactive when phosphorylated by GSK3 (Embi et al., 1980). Moreover, insulin stimulation leads to inhibition of GSK3 activity (Sutherland et al., 1993). Insulin receptor substrate-1/2 which are major adaptor proteins in insulin signal transduction could be phosphorylated by GSK3. This results in attenuation of signaling by the insulin receptor (Eldar- Finkelman and Krebs, 1997; Liberman and Eldar-Finkelman, 2005). GSK3 also phosphorylates and inhibits the key mitochondrial enzyme pyruvate dehydrogenase (Hoshi et al., 1996). This mitochondrial enzyme is an essential component in Kreb\u00E2\u0080\u0099s cycle (for glycolysis) and modulates the production of coenzyme A, the precursor for neurotransmitter acetylcholine synthesis (reviewed in (Grimes and Jope, 2001b)). Table 1.2 GSK3 substrates and their cellular functions. Substrate Name GSK3\u00E2\u0080\u0099s phosphosite(s) Biological Processes References METABOLIC ENZYMES AND SIGNALING PROTEINS ATP citrate lyase T446/S450 Fatty acid biosynthesis (Benjamin et al., 1994; Hughes et al., 1992) Glycogen synthase S640/S644/S668 Glycogen metabolism, Diabetes (Parker et al., 1983; Rylatt et al., 1980) Axin S322/S32 Wnt signaling (Ikeda et al., 1998; Yamamoto et al., 1999) General introduction 25 Adenomatous polyposis coli (APC) S1501/S1503 Wnt signaling, cancer (Ferrarese et al., 2007; Ikeda et al., 2000; Rubinfeld et al., 1996) Eukaryotic initiation factor (eIF) 2B S535 Growth, cancer (Wang et al., 2001; Welsh et al., 1998; Woods et al., 2001) Amyloid precursor protein (APP) T668 Alzheimer\u00E2\u0080\u0099s disease (Aplin et al., 1996) Presenilin 1 S397/S401 Alzheimer\u00E2\u0080\u0099s disease (Kirschenbaum et al., 2001) p21 CIP1 T57 Cell cycle, apoptosis (Rossig et al., 2002) Insulin receptor substrate 1 S332 Diabetes, growth, cancer (Eldar-Finkelman and Krebs, 1997; Liberman and Eldar-Finkelman, 2005) Insulin receptor substrate 2 S484 Diabetes (Sharfi and Eldar- Finkelman, 2008) STRUCTURAL PROTEINS Microtubule associated protein 1B S1260/T1265/1388 Neurite outgrowth (Lucas et al., 1998; Scales et al., 2009; Trivedi et al., 2005) Microtubule associated protein 2C T1620/T1623 Neuronal functions (Sanchez et al., 2000) Neural cell adhesion protein ? Neurite outgrowth, synaptic plasticity (Mackie et al., 1989) Tau S208/T231/T235 Alzheimer\u00E2\u0080\u0099s disease (Cho and Johnson, 2004b; Hanger et al., 1992; Woods et al., 2001; Yang et al., 1993) von Hippel-Lindau (VHL) S68 Oxygen sensor, CNS tumor (Hergovich et al., 2006) TRANSCRIPTION FACTORS \u00CE\u00B2-catenin S33/S37/T41/S45 Wnt signaling, development (Ikeda et al., 1998; Yost et al., 1996) Cyclic AMP response element binding protein (CREB) S129 Metabolism, diabetes, memory (Bullock and Habener, 1998; Fiol et al., 1994) Hypoxia inducible factor 1 S551/T555 hypoxic response, growth (Flugel et al., 2007; Mottet et al., 2003) Nuclear factor activated T cells (NFAT) ? Immune response (Beals et al., 1997; Neal and Clipstone, 2001) Nuclear factor \u00CE\u00BAB (NF\u00CE\u00BAB) p65 subunit S468 Inflammation, immune response (Demarchi et al., 2003; Hoeflich et al., 2000; Steinbrecher et al., 2005) p53 S33/S315/S376 Cell cycle regulator (Qu et al., 2004; Turenne and Price, 2001) Activator protein (AP1) ? Cell differentiation, proliferation (de Groot et al., 1993) Signal transduction activator of transcription (STAT) 1/3 S701/S703 Inflammation, astrocytosis (Beurel and Jope, 2008, 2009b) General introduction 26 GSK3 REGULATION OF STRUCTURAL PROTEINS GSK3 phosphorylates several proteins that could affect cell structure. The most- studied structural protein targets of GSK3 are microtubule associated protein (MAP) and tau. In particular, GSK3 was found to phosphorylate tau on as many as ten sites (Hanger et al., 1998). Tau hyperphosphorylation was proposed to cause tau aggregation leading to deposition as neurofibrillary tangles in Alzheimer\u00E2\u0080\u0099s disease brains (Lucas et al., 2001; Spittaels et al., 2000). GSK3 phosphorylation of MAP results in destabilizing of microtubule, which may play an important role in synaptic plasticity (Berling et al., 1994; Sanchez et al., 2000). GSK3 REGULATION OF GENE TRANSCRIPTION One of the most surprising roles of GSK3 is that of a key regulator of gene transcription. GSK3 does not bind DNA itself, but it phosphorylates and activates a broad range of transcription factors, thereby extending its regulatory role in gene expression. Transcription factors that are phosphorylated by GSK3 include AP-1, CREB, \u00CE\u00B2- catenin, Hif1, NFAT, STAT, and NF\u00CE\u00BAB, amongst others (Beurel and Jope, 2008; Grimes and Jope, 2001b). Taken together, it is obvious that GSK3 responds to many different stimuli, which in turn drives transcription of genes involved in cell growth, survival, toxin response, stress, and inflammation. 1.6 Involvement of GSK3 in human diseases GSK3\u00CE\u00B2 plays an important regulatory role in many cellular processes. Therefore, it is not surprising that dysregulated GSK3\u00CE\u00B2 activity is associated with many human diseases. For example, GSK3 has an important role in the Wnt and Hedgehog pathways, which induce cell fate determination and morphology changes (Hart et al., 1998; Jia et al., 2002). These pathways are both involved in several types of human cancer (Polakis, 2000; Taipale and Beachy, 2001). There General introduction 27 are also many studies that attempted to link aberrant GSK3 activity to Alzheimer\u00E2\u0080\u0099s disease, namely on the basis of GSK3-mediated tau hyperphosphorylation. The latter is one of the pathological hallmarks of Alzheimer\u00E2\u0080\u0099s disease (reviewed in (Aghdam and Barger, 2007)). The GSK3 inhibitors, lithium and valproate, were used clinically for decades to treat mood disorders implies that GSK3 activity is involved in the pathomechanism of these diseases (Chen et al., 1999; Meijer et al., 2004) (Jope and Roh, 2006). However, lithium and valproate were later found to act on many other cellular mechanisms, such as inositol metabolism, which may also have mood-stabilizing effects (Li et al., 2002). Therefore, the exact role of GSK3 in mood disorder pathogenesis remains controversial. 1.6.1 GSK3 in insulin resistance Apart from its role in the nervous system, GSK3 may also be involved in the development of non-insulin dependent diabetes mellitus. This disease is often associated with insulin resistance in peripheral tissues and chronic inhibition of muscle glycogen synthase (reviewed in (Wagman et al., 2004) and (Lee and Kim, 2007)). Insulin resistance is defined as the inability of the insulin receptor to respond to insulin stimulation, resulting in hyperinsulinemia. Under this condition, insulin signaling is impaired, which will dramatically impact normal tissue function. Insulin signal transduction, via PI3K/Akt activity, phosphorylates and inhibits GSK3 function (Fig. 1.3). Under conditions where insulin signaling is defective, the regulatory signaling that inhibits GSK3 activity cannot be implemented. As a result, GSK3 is constitutively active. Indeed, higher GSK3 activity has been reported in obesity and T2DM cases, as insulin resistance is a pathological feature (Ciaraldi et al., 2002; Eldar-Finkelman et al., 1999; Lee and Kim, 2007; Nikoulina et al., 2002; Wagman et al., 2004). General introduction 28 Over the past decade, there have been extensive clinical and experimental studies that demonstrated common abnormalities between type II diabetes mellitus (T2DM) and AD (Arvanitakis et al., 2004; de la Monte, 2012; de la Monte and Wands, 2008; Haan, 2006; Ho et al., 2004; Janson et al., 2004; Jolivalt et al., 2010; Zhao and Townsend, 2009). For example, elderly T2DM patients develop cognitive difficulties, which is not seen in younger T2DM patients (Arvanitakis et al., 2004). On the other hand, more than 80% of AD patients are co-morbid with T2DM or show abnormal blood glucose levels (Janson et al., 2004). In general, both of these disorders shared common abnormalities including impaired glucose metabolism, increased oxidative stress, insulin resistance, and amyloidogenesis (de la Monte, 2009; de la Monte and Wands, 2008; Janson et al., 2004). It is possible that patients with either disorder succumb to the toxicity that disrupted the same molecular pathways and each disease facilitates the progression of the other. 1.6.2 GSK3 signaling in inflammation A converging theory argues that inflammation is a common component in mood disorders, neurodegenerative diseases, diabetes, and various cancers, amongst other diseases (Beurel et al., 2010; Jope et al., 2007). Whether inflammation occurs to protect or harm the host remains controversial. Nonetheless, the ability to provoke an inflammatory response is crucial to maintaining the general wellness of the organism. A relatively new role of GSK3 is to transduce inflammatory signals (Jope et al., 2007; Martin et al., 2005). Previous reports have provided evidence to show that GSK3 is required for the production of proinflammatory cytokines including interleukin-6 (IL-6), interleukin-1\u00CE\u00B2 (IL-1\u00CE\u00B2), and tumor necrosis factor (TNF) (Beurel and Jope, 2008, 2009a, b; Martin et al., General introduction 29 2005; Yuskaitis and Jope, 2009). Conversely, GSK3 inhibits the production of anti-inflammatory cytokine IL-10. Consequently, pharmacological inhibitors of GSK3 were found to have strong anti-inflammatory effects. Martin et al. (2005) were first to show that GSK3 inhibitors efficiently protect against endotoxin shock in mice (Martin et al., 2005). Subsequent findings confirmed that GSK3 inhibition has anti-inflammatory properties in several systemic inflammation mouse models (Coant et al., 2011; Ko et al., 2010). Suppression of GSK3 ablates Toll-like receptor-induced production of inflammatory cytokines. This effect is due to inhibition of nuclear factor kappa B (NF\u00CE\u00BAB) transcriptional activity, indicating that GSK3 regulates NF\u00CE\u00BAB function (Gotschel et al., 2008; Hoeflich et al., 2000). NF\u00CE\u00BAB is a family of transcription factor that act as a master regulator of inflammatory gene control (Grivennikov et al., 2010). Interestingly GSK3 only affects a subset of NF\u00CE\u00BAB -dependent gene transcription. For example, NF\u00CE\u00BAB-mediated expression of IL-6 and monocyte chemoattractant protein-1 required GSK3\u00CE\u00B2. However GSK3\u00CE\u00B2 activity is negligible in NF\u00CE\u00BAB -dependent expression of macrophage inflammatory protein-2 (MIP-2) (Steinbrecher et al., 2005). The selectivity of GSK3\u00CE\u00B2\u00E2\u0080\u0099s effect on NF\u00CE\u00BAB- induced gene expression will facilitate the anti-inflammatory uses of GSK3 inhibitors. 1.6.3 GSK3 signaling in Alzheimer\u00E2\u0080\u0099s disease pathogenesis There have been epidemiological data to suggest a strong link between aberrant GSK3 activity and neuropathological changes in AD. Several authors have demonstrated that GSK3 activity is elevated in post mortem AD brain (Baum et al., 1996; Leroy et al., 2002; Mateo et al., 2006; Pei et al., 1999). Immunohistochemical analyses indicated that GSK3 co-localizes to neuronal General introduction 30 inclusions caused by neuritic plaques, neurofibrillary tangles, and dysfunctional neurons. These findings imply that GSK3 may be involved in the processes leading to these neuropathological changes. GSK3-MEDIATED TAU HYPERPHOSPHORYLATION Neurofibrillary tangles (NFTs) are one of the neuropathological hallmarks of AD. A central component of NFTs is tau, a microtubule-associated protein abundantly expressed in the brain, which is subjected to extensive phosphorylation. Tau binds to the tubulin protein through three or four repeat sequences in its C-terminal end, which is important for microtubule assembly. The longest human brain tau isoform contains 17 Ser/Thr-Pro sites (Cho and Johnson, 2004b; Morishima- Kawashima et al., 1995), and most are hyperphosphorylated and aggregated into filaments. In search of kinases involved in hyperphosphorylating tau, Ishiguiro et al (1993) identified the tau kinase 1, which was later shown to be identical to GSK3\u00CE\u00B2 (Hoshi et al., 1996; Ishiguro et al., 1993). A spurt of experimental findings following this study confirmed that GSK3 contributes to tau hyperphosphorylation. Spittaaels et al. (2000) provided the first in vivo evidence to show that tau is a target of GSK3. They showed that double transgenic mice carrying GSK3\u00CE\u00B2 and human tau had increased NFT formation (Spittaels et al., 2000). Furthermore, mice conditionally overexpressing GSK3\u00CE\u00B2 had elevated levels of hyperphosphorylated tau and NFT (Lucas et al., 2001). These findings confirmed that GSK3 is the in vivo tau kinase. Consequently, these findings suggest that pharmacological inhibitors of GSK3 could reduce tau hyperphosphorylation. Indeed, exposure to lithium chloride reduced the phosphorylation of tau in both neuronal and non-neuronal cells, as well as in the General introduction 31 brains of newborn rats. Further confirming this study with more specific GSK3 inhibitors in tau-transfected cells indicated that tau is one of the physiological substrates of GSK3. Figure 1.4 Tau phosphorylation and formation of neurofibrillary tangles. The microtubule-associated tau protein is reversibly phosphorylated and de-phosphorylated by kinases and phosphatases, respectively. Under pathological conditions, tau becomes hyperphosphorylated and aggregate to form paired helical filaments, which are then deposited as neurofibrillary tangles. GSK3 AND NEURONAL CELL DEATH Among the known mechanisms that may contribute to loss of neurons in AD, apoptosis has received the most attention. Apoptosis is generally classified as either arising from intracellular damage (intrinsic pathway) or stimulated by cell death receptors (extrinsic pathway). The intrinsic pathway arises from intracellular damages that lead to caspase activation. In the extrinsic pathway, stimulation of plasma membrane death receptors initiates a series of events involving mitochondrial disintegration, which lead to cell death. Of these two pathways, the intrinsic apoptotic pathway has been the main focus in AD research. GSK3 inhibitors have been demonstrated to exert neuroprotective properties following cytotoxic insults (Meijer et al., 2003). This implies that GSK3 may play a role in regulating neuronal cell death, which is one of the pathological features observed in postmortem AD brains. The overexpression of GSK3 was sufficient General introduction 32 to activate apoptosis. Lucas et al. (2001) demonstrated that conditional overexpression of GSK3 in mouse brain triggers signs of neurodegeneration accompanied by spatial learning deficits. In a different model system, overexpression of the Drosophila homolog of GSK3 (known as shaggy) enhances tau-induced neurodegeneration (Jackson et al., 2002). Conversely, expression of a kinase-dead mutant shaggy prevented tau-induced neuronal cell death (Jackson et al., 2002). Previous studies using various A\u00CE\u00B2 peptides, including A\u00CE\u00B21-40, A\u00CE\u00B21-42, and A\u00CE\u00B225-35, show that A\u00CE\u00B2 activates GSK3 by reducing the amount of inhibitory serine phosphorylation (Alvarez et al., 1999; Cedazo-Minguez et al., 2003; Inestrosa et al., 2007). This finding suggests that accumulation of the neurotoxic A\u00CE\u00B2 peptides will trigger GSK3 activation. Takashima and colleagues were the first to demonstrate that inhibition of GSK3 (at that time GSK3 was also known as tau protein kinase I) protected against A\u00CE\u00B2-induced cell death (Takashima et al., 1998). Subsequent reports confirmed that the GSK3 inhibitors AR-A014418 and SB216763 prevented A\u00CE\u00B2-induced caspase 3 activation and prevented neuronal cell loss in A\u00CE\u00B2-treated mice (Hu et al., 2009; Koh et al., 2008). Although different stimuli may be involved, the persistent activation of GSK3 has been shown to promote cell death in AD. Consistent with these findings, reduced PI3K/Akt signaling has been reported in AD brains (Damjanac et al., 2008; Griffin et al., 2005; Lee et al., 2009; Salkovic-Petrisic et al., 2006). Therefore, inadequate PI3K/Akt signaling could partially explain the aberrantly high GSK3 activity in AD brains. General introduction 33 GSK3 AND AMYLOID PRECURSOR PROTEIN PROCESSING The major component of neuritic plaques is the small A\u00CE\u00B2 protein 40 to 42 amino acids in length (4.2 kDa in size). A\u00CE\u00B2 is derived from sequential cleavage of the amyloid precursor protein (APP) via two important enzymes, \u00CE\u00B2-secretase 1 (BACE1) and \u00CE\u00B3-secretase. Thus, modulating the activity and expression level of BACE1 and \u00CE\u00B3- secretase will have a dramatic effect on the APP processing pathway. Several lines of data have implicated the role of GSK3 in APP processing and A\u00CE\u00B2 production. The GSK3 inhibitors lithium chloride and kenpaullone were demonstrated to reduce A\u00CE\u00B2 levels in vitro (Phiel et al., 2003). Since lithium chloride stimulation resulted in accumulation of the CTFs of the APP protein, the authors argued that the effect of lithium chloride treatment resulted in inhibition of the \u00CE\u00B3-secretase complex. However, Phiels et al. (2003) failed to show that kenpaullone, a more specific GSK3 inhibitor, had the same effect on \u00CE\u00B3-secretase inhibition. Thus, the effect of GSK3 inhibition by kenpaullone acting upstream of \u00CE\u00B3-secretase could not be ruled out. The cytoplasmic tail of APP is subjected to phosphorylation at THR668. APP phosphorylation was speculated to regulate APP trafficking and promote association with APP binding proteins. Lee et al., (2003) demonstrated that the THR668 phosphorylation promoted association of APP with BACE1, thereby enhancing APP cleavage. There is also evidence to show that A\u00CE\u00B2 production could induce activation of GSK3 (Cedazo-Minguez et al., 2003; Hu et al., 2008; Takashima et al., 1998). The THR668 site is an in vivo target of many kinases, including GSK3 (Aplin et al., 1996; Sun et al., 2002). Thus GSK3 may play a role in APP metabolism by mediating APP phosphorylation and promoting APP association with BACE1 (Lee and Kim, 2007). General introduction 34 The \u00CE\u00B3-secretase is a multi-protein complex that plays a role in APP cleavage to generate A\u00CE\u00B2. Therefore, this protease is a candidate target for designing inhibitors as an approach to treat AD. However, the \u00CE\u00B3-secretase complex is vital to many signal transduction pathways (eg. Notch signaling), and complete inhibition of \u00CE\u00B3- secretase will have deleterious side effects (reviewed in (Wolfe, 2008)). The discovery of \u00CE\u00B3-secretase modulators provides hope for interfering with A\u00CE\u00B2 production without hindering Notch cleavage. GSK3 is a potential \u00CE\u00B3-secretase modulator. Phiel et al. (2003) demonstrated that lithium treatment inhibited A\u00CE\u00B2 production in a GSK3-dependent manner, but had no effect on Notch cleavage. In a more recent report, Qing and colleagues (2008) demonstrated that inhibition of GSK3 using valproate treatment resulted in suppressed \u00CE\u00B3-secretase activity and prevented neuritic plaque formation (Qing et al., 2008). The mechanism by which GSK3 modulates \u00CE\u00B3-secretase is unclear. In principle, GSK3 could regulate any member of the \u00CE\u00B3-secretase complex (presenilin-1/2, APH-1, PEN-2, nicastrin, TMP21) (De Strooper, 2003). For instance, presenilin-1 (PS1) is known binding partner and target of GSK3 (Kirschenbaum et al., 2001). Interestingly PS1/2 mutations have been strongly linked to familial cases of AD. Phosphorylation of GSK3 may regulate the intracellular trafficking of PS1 or allow proximal interaction with the APP protein. Future experiments will be required to elucidate the interaction between GSK3 and the \u00CE\u00B3-secretase complex. It should be noted that very recently, a study involving GSK3\u00CE\u00B1 or GSK3\u00CE\u00B2 knockout animals showed that neither GSK3\u00CE\u00B1 nor GSK3\u00CE\u00B2 isoforms contribute to APP processing. The researchers reported that GSK3\u00CE\u00B1 or GSK3\u00CE\u00B2 KO animals have no changes in the total APP levels, CTF production, and A\u00CE\u00B2 production (Jaworski et al., 2011). Therefore, they concluded that GSK3 does not contribute to APP processing, but may still be involved in tau phosphorylation (Jaworski et al., 2011). However, this General introduction 35 study failed to address the extensive work published by others who showed that GSK3 inhibitors are effective in reducing A\u00CE\u00B2 production. This may simply be a differential effect depending on whether GSK3 is chronically deleted or acutely inhibited. 1.6.4 Targeting GSK3 to treat Alzheimer\u00E2\u0080\u0099s disease The beneficial effects of lithium chloride to treat bipolar disorder may in part result from GSK3 inhibition, but may also rely on inhibiting/activating different pathways. Lithium chloride inhibits GSK3 at the millimolar range and has side effects. Therefore, a lot of research efforts have focused on developing GSK3- specific inhibitors. At present, more than 30 inhibitors have been described, some with IC50 values in the nanomolar range (Figure 1.5, Table 1.3). The crystallization of GSK3\u00CE\u00B2 and the pharmacological inhibitors provided insights of their mechanism of action. Despite diverse chemical properties, most of the pharmacological inhibitors of GSK3 share common properties. For example, these compounds have low molecular weights and flat, planar structures. Most are hydrophobic and contain cyclic ring moieties. Moreover, most of these inhibitors act by competing with ATP in the catalytic pocket. It should be noted here that lithium chloride and valproic acid do not compete with ATP. Rather, lithium chloride competes with the magnesium ion, while VPA appears to activate PKB and PKC, which in turn phosphorylate and inhibit GSK3 activity. General introduction 36 Figure 1.5 Structures of pharmacological inhibitors of GSK3. Chemical structures of GSK3 inhibitors are typically flat and planar. Most of the inhibitors have hydrophobic, cyclic ring moieties that usually compete with ATP binding. TDZD8 inhibit GSK3 by binding allosterically to inhibit kinase function, whereas the VPA\u00E2\u0080\u0099s mechanism of action remains unclear. The selectivity is a key issue in order to use GSK3 inhibitors in the clinic to treat human diseases. Because the catalytic domain of GSK3\u00CE\u00B1 and GSK3\u00CE\u00B2 are highly homologous, inhibitors that target within this region are unlikely to distinguish between these two isoforms. In order to distinguish between the isoforms, a compound may need to target the kinase at other sites. Most of the commercially available GSK3 inhibitors have unwanted collaterals effects. For examples, lithium chloride has been known to affect the inositol-phosphate signals (Allison et al., 1976; Hirvonen and Savolainen, 1991). Valproic acid was previously found to inhibit the histone deacetylase activity (Gottlicher et al., 2001; Phiel et al., 2001). Other inhibitors also affect the cyclin-dependent kinases (CDK) with various potencies [reviewed in (Meijer et al., 2004)]. Therefore, a good GSK3 inhibitor should be able to target GSK3 at a very low concentration, but target other kinases including CDK at concentrations at least 100 to 1000 times higher. In Chapter 3 of this thesis, we chose to use the AR-A014418 compound in our General introduction 37 study simply because the IC50 of AR-A014418 is 104 nM, but affects CDKs and related kinases at concentrations >100 \u00C2\u00B5M (Table 1.3). Table 1.3 Pharmacological inhibitors of GSK3. Inhibitor Class IC50 (\u00C2\u00B5M) References GSK3\u00CE\u00B2 CDK1/2 Kenpaullone Benzazepinone 0.023 0.4 (Bain et al., 2003; Leost et al., 2000) BIO Bis-Indole 0.022 0.018 (Meijer et al., 2003; Polychronopoulos et al., 2004) TDZD8 Thiadiazolinidone 2.000 >100 (Martinez et al., 2002) CHIR98014 Aminopyrimidine 0.00058 3.7 (Ring et al., 2003) AR-A014418 Thiazole 0.104 >100 (Bhat et al., 2003) SB216763 Arylinodlemaleimide 0.075 0.550 (Coghlan et al., 2000) TWS119 Pyrrolopyrimidine 0.030 ? (Ding et al., 2003) GSK3 inhibitor II Pyridyloxadiazole 0.390 >10 (Naerum et al., 2002) Lithium chloride Atom 2000 No effect (Klein and Melton, 1996; Phiel and Klein, 2001) Valproic acid Fatty acid 600 ? (Chen et al., 1999) GSK3, glycogen synthase kinase 3; CDK, cyclin dependent kinase. As described above, the feature neuropathologies of AD involve tau phosphorylation, A\u00CE\u00B2 production, and neuronal loss. There is ample evidence to show that aberrant GSK3 activity facilitates the progression of these pathological events. A lot of work has demonstrated that GSK3 phosphorylates tau and forming pair-helical filaments leading to neurofibrillary tangle formation. Exposure to lithium chloride reduced the phosphorylation of tau in both neuronal and non-neuronal cells, as well as in the brains of newborn rats (Noble et al., 2005). Subsequent studies showed that AR-A014418 also reduced in tau phosphorylation and NFT formation (Bhat et al., 2003). In 2002, Sun et al. showed that lithium chloride reduces APP processing and A\u00CE\u00B2 production by inhibiting GSK3 activity. Further confirming this finding Phiel et al. (2003) demonstrated that GSK3 inhibition using pharmacological inhibitors and siRNA technology that GSK3 inhibition reduces A\u00CE\u00B2 production. Ryder et al. (2004) further showed that lithium chloride treatment in AD transgenic mice reduced AD neuropathologies. General introduction 38 Several hypotheses have been generated to explain why neurons die in AD. According to the amyloid hypothesis, the presence of the neurotoxic A\u00CE\u00B2 kills neurons by causing oxidative damage and disrupting calcium homeostasis (Hardy and Selkoe, 2002). In another hypothesis, glutamate toxicity mediated by excessive calcium influx through the NMDA receptors leads to GSK3 activation, and neuronal death (Nonaka and Chuang, 1998). Regardless of how the neurons die in AD, the use of GSK3 inhibitors has demonstrated some success in ameliorating neurodegeneration in various models. GSK3 inhibition in cell lines protected against A\u00CE\u00B2-induced cell death (Bhat et al., 2003; Bhat et al., 2002; Bhat et al., 2000). Furthermore, GSK3 inhibition also protected against deprivation of the PI3K survival signaling. The APP transgenic mouse model of AD cannot be used to study neurodegeneration, simply because no neuronal loss is detected in these mice. However, GSK3 inhibition has been shown to protect against excitotoxicty-induced cell death in an ischemic model (King et al., 2001; Nonaka and Chuang, 1998; Nonaka et al., 1998; Ren et al., 2003). Taken together, these findings suggest that GSK3 is a valid drug target and has therapeutic potential for treating AD, or at least delaying disease progression. 1.7 Overall goal of this research Whether it is regulating neuronal apoptosis, tau hyperphosphorylation, or A\u00CE\u00B2 production, GSK3 plays pivotal roles in contributing to Alzheimer\u00E2\u0080\u0099s disease pathology. This makes GSK3 a good target for treating AD. However, the mechanism and effectiveness of GSK3 inhibition in treating AD are still unclear. According to the amyloid hypothesis, excessive production of A\u00CE\u00B2 triggers a series of secondary neurodegenerative events. Conceivably, the ability to prevent A\u00CE\u00B2 production could potentially become a therapeutic strategy for treating AD, or at least delaying disease progression. General introduction 39 Unlike the other two characteristic pathologies in AD, the role of GSK3 in A\u00CE\u00B2 generation has been a controversial subject of in the field. Previous studies have demonstrated that GSK3 could facilitate APP processing and potentiate A\u00CE\u00B2 production. Moreover, Phiel et al. (2003) showed that it is the GSK3\u00CE\u00B1 isoform rather than the GSK3\u00CE\u00B2 isoform that primarily contributes to APP processing by acting on \u00CE\u00B3-secretase activity. Conversely Su et al. (2004) showed that inhibition of GSK3\u00CE\u00B2 could prevent pathologies in a mouse AD model. Adding to the controversy, Jaworski et al. (2011) showed that APP processing is not affected in GSK3\u00CE\u00B1 and GSK3\u00CE\u00B2 knockout mice. This study argues against the notion that GSK3 is involved in APP processing. Without doubt, the role of GSK3 in APP processing and A\u00CE\u00B2 production will require clarification. With these controversies, implementing GSK3 inhibition as a therapeutic strategy for treating AD awaits validation. The overall goal of this thesis is to examine the effect of GSK3 signaling on APP processing and how this contributes to A\u00CE\u00B2 generation. In addition, the efficacy of pharmacological GSK3 inhibition as a treatment strategy for AD will be evaluated. 1.7.1 Examine the therapeutic effects of valproic acid on AD pathogenesis Valproic acid has been used clinically as an anti-convulsant to treat epilepsy for more than 50 years. More recently, VPA has proven efficacious in treating manic depression in controlled studies. Despite the drug\u00E2\u0080\u0099s efficacy in clinical use, its mechanism of action remains elusive. Several hypotheses have been put forward to explain how valproic acid exerts its effects. In the original report, Chen et al. (1999) argued that VPA inhibited GSK3 activity. Following that, a number of General introduction 40 findings have independently shown that VPA could directly or indirectly inhibit GSK3 activity (Hall et al., 2002; Kim et al., 2005; Leng et al., 2008). Similar to other methods of reducing GSK3 activity, VPA treatment leading to GSK3 inhibition stabilizes \u00CE\u00B2-catenin level. Moreover, the work of Phiel et al. (2003) and Ryder et al. (2004) demonstrated that GSK3 could affect APP processing via modulating \u00CE\u00B3-secretase activity. Therefore, we hypothesize that VPA has pharmaceutical potential for treating AD pathology by targeting \u00CE\u00B3- secretase in a GSK3-dependent manner. In this chapter of the thesis, the pharmaceutical effects of VPA on A\u00CE\u00B2 production and AD pathogenesis were examined in in vitro and a transgenic mouse model of AD. 1.7.2 A thorough study of specific GSK3 inhibition on A\u00CE\u00B2 production and regulation of BACE1 transcription Previous published work and the data presented in chapter 2 of this thesis showed that lithium chloride and valproic acid negatively regulated APP processing and prevented A\u00CE\u00B2 production (Phiel et al. 2003; Ryder et al, 2004; Qing et al. 2008). Although lithium chloride and VPA have been shown to inhibit GSK3 activity, neither compound can distinguish between the two GSK3 isoforms. The compounds also stimulate a plethora of signaling cascades. Therefore, it would be hard to extrapolate the therapeutic effects of these mood stabilizers in AD pathogenesis. Moreover, the combinatorial effects of other signaling cascades leading to inhibition of AD pathologies could not be ruled out, simply because neither lithium chloride nor VPA are specific GSK3 inhibitors. As discussed below, in order to achieve specific GSK3 knockdown, a commercially available GSK3 inhibitor and GSK3\u00CE\u00B1/\u00CE\u00B2 specific siRNA has been used. General introduction 41 To evaluate the effects of GSK3-specific inhibition in chapter 3, we decided to use the AR-A014418 compound developed by AstraZeneca in our models. As discussed in greater detail below, AR-A014418 is a potent, highly selective GSK3 inhibitor, as compared to a panel of 26 other related kinases. Since AR-A014418 binds to the ATP catalytic site and both GSK3 isoforms share 98% homology within the catalytic domain, this drug is unable to specifically hinder one isoform over the other. From our pilot study, we found that GSK3-specific inhibition with AR-A014418 reduced BACE1 activity. Moreover, GSK3 inhibition also reduced BACE1 expression. Since BACE1 is the essential protease required for APP processing to generate A\u00CE\u00B2, reducing BACE1 activity will have pharmaceutical value for treating AD. In fact, previous work showed that ablation of BACE1 activity ameliorated A\u00CE\u00B2 production and rescued cognitive dysfunctions in transgenic AD mice (Cai et al., 2001; Hussain et al., 2007; Luo et al., 2001; Ohno et al., 2007; Ohno et al., 2004; Roberds et al., 2001). Taken together, these results suggest that methods of lowering BACE1 activity could be used to treat AD. The working hypothesis is that GSK3 signaling contributes to AD pathogenesis by regulating BACE1 expression and promoting A\u00CE\u00B2 generation. In chapter 3, I will examine the effects of GSK3-specific inhibition on APP processing in in vitro models and in AD double transgenic mice. Furthermore, by using GSK3 isoform specific knockdown, I will examine how each GSK3 isoforms contribute to APP processing and A\u00CE\u00B2 production. 1.7.3 Pharmaceutical potentials of GSK3 inhibition as a strategy to treat Alzheimer\u00E2\u0080\u0099s disease In this chapter, I will examine the pharmaceutical potential of GSK3 inhibition in reducing A\u00CE\u00B2 processing, amyloid plaque formation, and memory functions in a double transgenic mouse model of AD. In addition, collateral effects of GSK3 General introduction 42 inhibition will also be examined. Previous studies have administered lithium chloride and VPA in transgenic mouse models, but the specificity of GSK3 inhibition with these compounds is an issue. GSK3 inhibition with the AR- A014418 compound has been shown to reduce tau phosphorylation. This finding was also confirmed in a frontotemporal dementia transgenic mouse model expressing a human mutant tau gene. However, the effects of specific GSK3 inhibition on neuritic plaque pathology have not yet been studied. In this chapter, GSK3 activity will be assessed in postmortem AD brain tissue, and the efficacy of GSK3 inhibition for treating AD pathogenesis will be evaluated. 43 Chapter 2: Valproic acid inhibits A\u00CE\u00B2 production, neuritic plaque formation and behavioral deficits in Alzheimer\u00E2\u0080\u0099s disease mouse models Chapter 2 Valproic acid inhibits A\u00CE\u00B2 production and neuritic plaque formation, and improves behavioral deficits in Alzheimer\u00E2\u0080\u0099s disease mouse models 2.1 Introduction To date, there has been no effective treatment or prevention of AD. Preclinical studies have alluded to the option of interfering with A\u00CE\u00B2 production as a therapeutic strategy for treating AD. Such a strategy may involve using pharmacological agents to inhibit and/or modulate APP processing at the \u00CE\u00B2- secretase or \u00CE\u00B3-secretase levels. For example, lithium chloride has been shown to have therapeutic value for treating AD pathologies (Alvarez et al., 1999; Phiel et al., 2003; Sastre et al., 2006; Su et al., 2004). VPA had been used clinically as an anti-convulsant to treat epilepsy for more than 50 years. Subsequent studies demonstrated that VPA is effective in treating bipolar disorder. Although VPA had been used clinically for over half a century, its mechanistic actions remain controversial. Past hypotheses have generally focused on its anti-epileptic mechanism by increasing the level of GABA synthesis or increasing sodium channels. VPA has also been found to inhibit histone deacetylase activity, implying that VPA may be involved in epigenetic VPA inhibits AD pathogenesis 44 regulation and gene expression (Phiel et al., 2001). Relatively recent studies showed that VPA has regulatory effects on GSK3 signaling (Chen et al., 1999; Grimes and Jope, 2001a; Hall et al., 2002; Kim et al., 2005). Whether VPA exerts a direct effect GSK3 activity is still a matter of debate, but VPA treatment consistently increases the activity of Akt, which phosphorylates and inhibits GSK3 activity (De Sarno et al., 2002). Similar to lithium chloride, VPA treatment regulates the Wnt signaling pathway leading to elevated \u00CE\u00B2-catenin levels. An increase in \u00CE\u00B2-catenin expression has also been observed after treatment with a chemical HDAC inhibitor Trichostatin A. This mechanism may explain some effects of VPA on gene expression and neurodevelopment (Harwood, 2003). It has been shown that increased histone acetylation by HDAC inhibitors facilitates synaptogenesis and improves learning and memory, suggesting that an inhibitor of HDAC may be a suitable therapeutic avenue for neurodegenerative diseases (Phiel et al., 2001). In this chapter, the potential therapeutic effects of VPA for treating AD were examined. Here we showed that VPA treatment inhibits A\u00CE\u00B2 production, reduces neuritic plaque formation, and rescues memory deficits by modulating \u00CE\u00B3-secretase activity. 2.2 Methods 2.2.1 Materials Dulbecco\u00E2\u0080\u0099s modified eagle medium (DMEM), neurobasal medium, fetal bovine serum, geneticin, zeocin, B27 supplement, and lipofectamine were purchased from Life Sciences Technologies. VPA, thioflavin S, and poly-D-lysine were purchased from Sigma-Aldrich. Rabbit anti-C20 recognizing the last twenty VPA inhibits AD pathogenesis 45 amino acids on the C-terminal end of APP and anti-PS1 N-terminal antibody 231F were made in-house. Rabbit anti-phospho-GSK3\u00CE\u00B2S9 antibody was purchased from Cell Signaling Technologies. Rabbit anti-phospho GSK3\u00CE\u00B1Y279/GSK3\u00CE\u00B2Y216 and mouse anti-GSK3\u00CE\u00B1/\u00CE\u00B2 were purchased from Biosource International Inc. \u00CE\u00B2- actin was detected using monoclonal antibody AC-15 (Sigma). IRDye\u00E2\u0084\u00A2 680- labeled goat anti-rabbit, and IRDye\u00E2\u0084\u00A2 800CW-labeled goat anti-mouse secondary antibodies were obtained from LI-COR Biosciences. Biotinylated monoclonal 4G8 antibody for detection of A\u00CE\u00B2-containing neuritic plaques was purchased from Signet labs. ABC and DAB kits for visualization of neuritic plaques were purchased from 2.2.2 Transgenic animals and VPA treatment APP23 transgenic mice carry human APP751 cDNA with the Swedish double mutation at positions 670/671 (KM\u00EF\u0083\u00A0NL) under control of the murine Thy-1.2 expression cassette (Sturchler-Pierrat et al., 1997; Sturchler-Pierrat and Staufenbiel, 2000). PS45 transgenic mice carry human presenilin-1 cDNA with the G384A mutation (Qing et al., 2008). The APP23/PS45 double transgenic mice were generated through breeding the APP23 and PS45 strains. The genotypes of the mice were confirmed using PCR from DNA extracted from ear tissue. 7 month old APP23 (N=30 each), 9 month old APP23 (N=12 each), and 6 weeks old APP23/PS45 (N=25 control, N=29 VPA) mice were treated with 30 mg/kg VPA or 0.9% saline solution daily via intraperitoneal injection for a total of 4 weeks (Qing et al., 2008). We tabulated daily food consumption and weight for each mouse. VPA inhibits AD pathogenesis 46 2.2.3 Genotyping All transgenic mice were genotyped at the beginning of weaning and at the time of sacrifice. At 3 weeks of age, mice were anesthetized with isoflurane and ear- marked. At the time of sacrifice, a piece of the ear was also harvested. The tissue was digested in 300 \u00C2\u00B5L of lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM EDTA pH 8.0, 150 mM NaCl, 0.5% SDS) with 3 \u00C2\u00B5L of 10 \u00C2\u00B5g/mL Proteinase K (New England Biolabs) at 55\u00C2\u00B0C overnight. The next day, samples were centrifuged and DNA was precipitated with 0.7X volume of isopropanol. DNA was pelleted by centrifugation at 16,000xg for 15 min, washed twice with 70% ethanol, air dried, and re-suspended in sterile de-ionized water. The genomic DNA was subjected to PCR to amplify human APP using Thy1E2F-CACCACAGAATCCAAGTCGG / APP1082R CTTGACGTTCTGGCCTCTTCC and human presenilin 1 with PS1F- CAGGTGCTATAAGGTCAT and PS1R-ATCACAGCCAAGATGAGC. 2.2.4 Cell cultures, VPA treatment, luciferase assay All cells were maintained at 37\u00C2\u00B0C in an incubator containing 5% CO2. The 20E2 cell line, a Swedish mutant APP695 stable HEK293 cell line, was cultured in complete DMEM with 50 \u00C2\u00B5g/ml geneticin. hC99mycHis cells are HEK293 cells stably transfected with APP-C99 fragment, the major \u00CE\u00B2-secretase product after APP cleavage. These cells were selected and maintained using 100 \u00C2\u00B5g/ml of zeocin. The mycHis-tagged C99 protein in hC99mycHis cells could be detected by both anti-myc 9E10 antibody and anti-APP C-terminal antibody C20. For primary neuronal cultures, hippocampal and neocortical tissues were removed from newborn mice at postnatal day 1, and digested with 0.025% trypsin. The cells were suspended in neurobasal medium supplemented with B27 and plated at a density of 2\u00C3\u0097106 cells per 35mm plate coated with PDL. Tails from the newborn mice were used to isolate genomic DNA for genotyping. The primary cultures VPA inhibits AD pathogenesis 47 were maintained at 37 \u00C2\u00B0C in a humidified incubator containing 5% CO2. VPA was prepared in sterile PBS at 200 mM then diluted with culture medium to 0, 1.5, 5, 10 mM and treated for 24 h. For the \u00CE\u00B2-catenin-mediated transcriptional activation assay, pTOPFLASH plasmid was transfected with pcDNA3-Tcf expression plasmids into N2a cells. The Renilla (sea pansy) luciferase vector pCMV-Rluc was also simultaneously transfected to normalize transfection efficiency. Transfection procedures involved using Lipofectamine 2000 and following manufacturer\u00E2\u0080\u0099s instructions. Luciferase assay was performed 48 hours after transfection with Dual-Luciferase Reporter Assay system (Promega). 2.2.5 Immunoblotting Brain tissues or cells were lysed in RIPA lysis buffer (1% Triton X100, 1% sodium deoxycholate, 1% SDS, 0.15M NaCl, 0.05M Tris-HCl, pH 7.2) supplemented with 200 mM sodium orthovanadate, 25 mM \u00CE\u00B2-glycerophosphate, 20 mM sodium pyrophosphate, 30 mM sodium fluoride, 1 mM PMSF, and a complete mini protease inhibitor cocktail tablet (Roche Diagnostics). The samples were diluted in 4X SDS-sample buffer, boiled, and resolved on 12% tris-glycine SDS-PAGE or 16% tris-tricine SDS-PAGE followed by transferring to polyvindylidine fluoride (PVDF-FL) membranes. For immunoblot analysis, membranes were blocked for 1 h in phosphate-buffered saline (PBS) containing 5% non-fat dried milk followed by overnight incubation at 4\u00E2\u0084\u0083 in primary antibodies diluted in the blocking medium. The membranes were rinsed in PBS with 0.1% Tween-20 and incubated with IRDye\u00E2\u0084\u00A2 800CW-labelled goat anti- mouse or IRDye\u00E2\u0084\u00A2 680 goat anti-rabbit antibodies in PBS with 0.1% Tween-20 at 22\u00E2\u0084\u0083 for 1 h, and visualized on the Odyssey system (LI-COR Biosciences). VPA inhibits AD pathogenesis 48 2.2.6 Semi-quantitative reverse transcription PCR RNA was isolated from cells using TRI-Reagent. PowerScriptTM reverse transcriptase (Invitrogen) was used to synthesize the first strand cDNA from an equal amount of the RNA sample following the manufacturer\u00E2\u0080\u0099s instruction. The newly synthesized cDNA templates were further amplified by Platinum Tag DNA polymerase (Invitrogen) in a 25 \u00C2\u00B5l reaction. The following primers were used to specifically amplify APP, PS1 and BACE1 genes: BACE1 forward 5'- ACCGACGAAGAGTCGGAGGAG-3' and BACE1 reverse 5'- CACAATGCTCTTGTCATAG-3'; APP forward 5\u00E2\u0080\u0099- CGGAATTCCCTTGGTGTTCTTTGCAGAAG and APP reverse 5\u00E2\u0080\u0099- CGGAATTCCGTTCTGCATCTCTCAAAG; PS1 forward 5\u00E2\u0080\u0099- GGATCCGCCACCATGGTGTGGTTG GTGAATATGGC and PS1 reverse 5\u00E2\u0080\u0099- CGGGATCCCTAGATATAAAATTGATGG. \u00CE\u00B2-actin levels were used as an internal control. The samples were analyzed on a 1.2% agarose gel. 2.2.7 Human A\u00CE\u00B240/42 ELISA Tissue extracts from transgenic mouse hippocampal and neocortical regions and conditioned cell culture media were collected. Protease inhibitors (AEBSF) were added to prevent degradation of A\u00CE\u00B2 peptides. The concentration of A\u00CE\u00B240/42 was detected by \u00CE\u00B2-amyloid 1-40 or 1-42 Colorimetric ELISA kit (Biosource International, Inc) according to the manufacturer\u00E2\u0080\u0099s instructions. 2.2.8 Immunohistochemistry Mice were sacrificed after behavioral testing and hemi brains were immediately homogenized for protein, RNA, or DNA extraction. The other half of the brains were fixed in 4% paraformaldehyde, followed by 30% sucrose solution, and sectioned with a Leica Cryostat to 30 \u00C2\u00B5m thickness after embedding in O.C.T. VPA inhibits AD pathogenesis 49 solution. Every 12th slice with the same reference position was mounted onto slides for staining. The slices were stained with biotinylated monoclonal 4G8 antibody (Signet labs). Plaques were visualized by the ABC and DAB method and counted under microscopy at 40X magnification as previously described (Ly et al., 2011; Qing et al., 2008). Plaques were quantified and the average plaque count per slice was recorded for each mouse. Quantification of neuritic plaques were only performed on 4G8-stained neuritic plaques. Thioflavin-S staining of plaques was performed with 1% thioflavin-S and the green fluorescence stained plaques were visualized using fluorescence microscopy. 2.2.9 The Morris water maze test The Morris Water Maze test was performed as previously described (Bromley- Brits et al., 2011; Qing et al., 2008). Briefly, the test was performed in a 1.5-meter diameter pool with a 10-cm diameter platform placed in the southeastern quadrant of the pool. The procedure consisted of one day of visible platform tests and 4 days of hidden platform tests, plus a probe trial 24 hr after the last hidden platform test. In the visible platform test, mice were tested for 5 continuous trials with an inter-trial interval of 60 minutes. In the hidden platform tests, mice were trained for 5 trials with an inter-trial interval of 60 min. Mouse behavior including distance traveled and escape latency was automatically video-recorded by automated video tracking (ANY-maze, Stoelting). 2.2.10 Kinetworks\u00E2\u0084\u00A2 KPSS 1.3 phosphosite analysis N2a cells were treated with 5 mM VPA for 12 h, followed by homogenizing in lysis buffer containing 0.5% Triton X-100, 2 mM EGTA, 5 mM EDTA, 20 mM MOPS, 200 mM sodium orthovanadate, 25 mM \u00CE\u00B2-glycerophosphate, 20 mM sodium pyrophosphate, 30 mM sodium fluoride, 1 mM PMSF, and 1 complete VPA inhibits AD pathogenesis 50 mini protease inhibitor cocktail tablet (Roche Diagnostics). The samples were diluted in 4X SDS-sample buffer to give a final protein concentration of 1 \u00C2\u00B5g/\u00C2\u00B5l. The samples were then boiled and sent to Kinexus Bioinformatics Corp., Vancouver, BC, for the Kinetworks\u00E2\u0084\u00A2 KPSS 1.3 Phospho-Site multi- immunoblotting analyses. The KPSS 1.3 screen tracks the phosphorylation levels of more than 35 protein kinases and their substrates. 2.3 Results 2.3.1 VPA inhibits A\u00CE\u00B2 deposition and neuritic plaque formation To assess the effect of VPA treatment on AD neuropathology, APP23 transgenic mice, an AD mouse model, were subjected to VPA treatment. APP23 mice carry the human Swedish mutant APP751 transgene driven by the neuronal-specific Thy1.2 promoter. APP23 mice develop amyloid plaques in the neocortex and hippocampus as early as six months (Sturchler-Pierrat et al., 1997; Van Dam et al., 2003). APP23 mice at 7 months of age were treated with VPA (30 mg/kg) for 1 month. Age-matched control APP23 mice received vehicle solutions only. After 1 month of VPA treatment, the mice were subjected to behavioral analyses followed by sacrifice and extraction of the brain tissues. 4G8 immunostaining was used to detect A\u00CE\u00B2-containing neuritic plaques in the brain (Fig. 2.1A). Neuritic plaque formation was significantly decreased in APP23 mice treated with VPA (Fig. 2.1Ab) relative to controls (Fig. 2.1Aa). Quantification showed that overall VPA treatment reduced plaque number by approximately fourfold (3.5\u00C2\u00B10.79 vs. 14.95\u00C2\u00B12.09 per slice, p<0.0001) (Fig. 2.1B). APP23 mice were also treated with VPA at 9 months of age. Significantly more neuritic plaques were observed in the mice at 9 months compared to 7 months of age; however VPA treatment starting at the age of 9 months could also significantly reduce neuritic plaque formation VPA inhibits AD pathogenesis 51 (Fig. 2.1Ad,c). The number of plaques in VPA-treated and control mice were 11.09\u00C2\u00B10.92 and 25.60\u00C2\u00B13.50, respectively (p<0.005) (Fig. 2.1C) Figure 2.1 Valproic acid treatment inhibits the formation of neuritic plaques in AD transgenic mice. A) Immunohistochemical staining of neuritic plaques using an A\u00CE\u00B2-specific monoclonal antibody 4G8 (Signet) and the DAB method. The plaques were visualized by microscopy with 40X magnification. The number of neuritic plaques was significantly reduced in VPA-treated mice compared to controls. Panels b, d and f are the representative brain section of the 7-month APP23 age group, 9-month APP23 age group, and 6 weeks-old APP23/PS45 mice treated with VPA, and panel a, c and e are their controls, respectively. Black arrows point to plaques. (B) Quantification of neuritic plaques in APP23 mice with treatment starting at the age of 7 months, the number represents mean\u00C2\u00B1SEM, N=30 mice each, * p<0.0001 by student\u00E2\u0080\u0099s t-test. (C) Quantification of neuritic plaques in APP23 mice with treatment starting at the age of 9 months, the number represents mean\u00C2\u00B1SEM, N=12 mice each, * p<0.005 by student\u00E2\u0080\u0099s t-test. (D) Quantification of neuritic plaques in APP23/PS45 mice with treatment starting at the age of 6 weeks, the number represents mean\u00C2\u00B1SEM, N=25 mice for control and 29 mice for VPA, * p<0.0001 by student\u00E2\u0080\u0099s t- test. To further confirm VPA\u00E2\u0080\u0099s effect on AD pathogenesis, APP23 transgenic mice were crossbred with PS45 transgenic mice to generate APP23/PS45 double VPA inhibits AD pathogenesis 52 transgenic mice. PS45 mice have an overexpression of the human familial AD- associated G384A mutant presenilin-1. The double transgenic mice developed severe plaque pathology, which could be detected in the neocortex and hippocampus as early as 1 month of age. Double transgenic mice were treated with 30 mg/kg VPA at six weeks of age for 4 weeks. VPA treatment markedly inhibited neuritic plaque formation (Fig. 2.1 Af and e) and significantly reduced plaque numbers from 14.84\u00C2\u00B11.67 to 2.862\u00C2\u00B10.65 (p<0.0001) (Fig. 2.1 D). The effects were similar among mice sacrificed either immediately, or at 1 month or 2 months after the last treatment and behavioral testing (0.75\u00C2\u00B10.48 vs. 5.50\u00C2\u00B11.32, p<0.001; 2.33\u00C2\u00B10.50 vs. 10.33\u00C2\u00B11.26, p<0.001; 5.30\u00C2\u00B11.33 vs. 21.5\u00C2\u00B102.76, p<0.001, respectively). Alternatively using thioflavin S, a chemical staining method for neuritic plaques, we confirmed that VPA treatment reduced A\u00CE\u00B2-containing neuritic plaque formation in the brains of APP23 single (Fig. 2.2Bb, a) and APP23/PS45 double (Fig. 2.2Bd, c) transgenic mice. We also found that VPA has prolonged inhibitory effects. APP23 mice at 7 months of age were treated with VPA (30 mg/kg) for four weeks and were sacrificed immediately or at 1 month or 2 months after the last treatment. VPA-treated mice consistently had lower numbers of neuritic plaques (0.75\u00C2\u00B10.48 vs. 5.50\u00C2\u00B11.32, p<0.001; 2.33\u00C2\u00B10.50 vs. 10.33\u00C2\u00B11.26, p<0.001; 5.30\u00C2\u00B11.33 vs. 21.5\u00C2\u00B102.76, p<0.001, respectively (Fig 2.2 B)). Over the 4-week injection period, we did not observe any differences in food and water intake or in weight between the treatment and control groups. These data clearly demonstrate that VPA inhibits A\u00CE\u00B2 neuritic plaque formation in vivo. VPA inhibits AD pathogenesis 53 Figure 2.2 Valproic acid treatment has prolonged inhibitory effects on neuritic plaque production. (A) Thioflavin S staining of neuritic plaques and visualization by fluorescent microscopy at 40X magnification. There were fewer neuritic plaques in VPA-treated mice (b and d) as compared to age-matched control mice (a and c). Panels a and b are brain sections of APP23 mice, while panels c and d are the brain sections of APP23/PS45 mice. White arrows point to green fluorescent neuritic plaques. (B) APP23 mice at 7 months of age were treated with VPA (30 mg/kg) for four weeks. The mice were sacrificed immediately (C0 and V0), one month (C1 and V1) or two months (C2 and V2) after the last treatment and neuritic plaques in the brains were detected by A\u00CE\u00B2-specific monoclonal antibody 4G8 (Signet) and the DAB method. The plaques were visualized by microscopy at 40X magnification. p<0.001 by student\u00E2\u0080\u0099s t-test. 2.3.2 VPA improves memory deficits in mouse model of AD To investigate whether VPA treatment affects learning and memory in AD pathogenesis, behavioral tests were performed after APP23 mice received one month of VPA treatment starting at the age of 7 months. The Morris water maze was used to determine the effect of VPA on spatial memory. In the visible platform tests, VPA-treated and control APP23 mice had similar escape latency (53.190\u00C2\u00B11.56s and 49.75\u00C2\u00B12.47 s, p>0.05) (Fig. 2.2A), and path length (7.03\u00C2\u00B11.33m and 6.78\u00C2\u00B11.60 m, p>0.05) (Fig. 2.2B), which indicated that VPA VPA inhibits AD pathogenesis 54 treatment did not affect mouse mobility and vision. In the hidden platform- swimming test, APP23 mice treated with VPA showed significant improvements as compared to the vehicle-treated controls. The escape latency on the third and fourth days of the hidden platform test was shorter for the treated APP23 mice (15.95\u00C2\u00B11.61 and 12.80\u00C2\u00B11.83 s) compared to the non-treated group (29.04\u00C2\u00B12.99 and 24.89\u00C2\u00B13.33 s) (p<0.001, Fig. 2.3C). The VPA-treated mice were able to swim significantly shorter distances to reach the platform (3.88\u00C2\u00B10.91 and 2.68\u00C2\u00B11.02m) as compared to control mice (6.03\u00C2\u00B10.94 and 5.37\u00C2\u00B11.38 m) on the third and fourth days (p<0.01, Fig. 2.3D). In the probe trial on the last day of testing, the platform was removed. The number of times the mice traveled into the third quadrant, where the hidden platform was previously placed, was significantly greater with VPA treatment compared to control (9.56\u00C2\u00B12.62 and 4.18\u00C2\u00B11.06 times, p<0.005) (Fig. 2.3E). These data indicate that VPA treatment significantly improves the spatial memory deficits seen in APP23 mice. Since VPA treatment was terminated prior to behavioral testing, the effect of VPA on the behavioral performance in the mice was not just acute, but also long lasting. Behavioral tests were also performed on the older APP23 mice administered with VPA at the age of 9 months to assess their cognitive function. Despite a significant reduction in plaque formation, there were no significant differences in the escape latency and path length in the hidden platform trial of the Morris water maze test between the treatment and control groups (p>0.05). Although VPA treatment only slightly improved performance in the hidden platform tests of the APP23/PS45 double transgenic mice, VPA treatment significantly improved performance in the probe trial (7.13\u00C2\u00B10.70and 3.43\u00C2\u00B11.13) (p<0.05). VPA inhibits AD pathogenesis 55 Figure 2.3 VPA improves memory deficits in AD transgenic mice. A Morris water maze test consists of one day of visible platform tests and 4 days of hidden platform tests, plus a probe trial 24 hr after the last hidden platform test. The 7-month APP23 age group mice were tested after one month of daily VPA (N=30 mice) or vehicle solution (N=30 mice) injections. (A) During the first day of visible platform tests, the VPA-treated and control APP23 mice exhibited a similar latency to escape onto the visible platform. p>0.05 by student\u00E2\u0080\u0099s t- test. (B) The VPA-treated and control APP23 mice had similar swimming distances before escaping onto the visible platform in the visible platform test. p>0.05 by student\u00E2\u0080\u0099s t-test. (C) In hidden platform tests, mice were trained with 6 trials per day for four days. VPA-treated APP23 mice showed a shorter latency to escape onto the hidden platform on the third and fourth days, p<0.001 by ANOVA. (D) The VPA-treated APP23 mice had a shorter swimming length before escaping onto the hidden platform on the third and fourth days, p< 0.01 by ANOVA. (E) In the probe trial on the sixth day, the VPA-treated APP23 mice traveled into the third quadrant, where the hidden platform was previously placed, significantly more times than controls. * p<0.005 by student\u00E2\u0080\u0099s t-test. 2.3.3 VPA inhibits \u00CE\u00B3-secretase activity and inhibits A\u00CE\u00B2 production in vitro and in vivo Our data clearly demonstrated that VPA treatment inhibited neuritic plaque formation and improved the memory deficits in the AD model mice. To investigate the underlying mechanism, we examined the effect of VPA on APP processing. The level of APP CTFs and A\u00CE\u00B2 in the mouse brain tissues was VPA inhibits AD pathogenesis 56 assayed by Western blot analysis (Fig. 2.4A). VPA treatment significantly increased the levels of APP CTFs. The levels of \u00CE\u00B2-secretase-generated C99 and \u00CE\u00B1- secretase-generated C83 fragments were increased by 227.7\u00C2\u00B136.8% in the brains of VPA-treated mice relative to controls (p<0.05) (Fig. 2.4B). Furthermore, the production of A\u00CE\u00B2 was significantly inhibited by VPA, and the total A\u00CE\u00B2 level was decreased to 18.71\u00C2\u00B16.24% in the brains of VPA-treated mice relative to controls (p<0.05) (Fig. 2.4A and B?). The A\u00CE\u00B2 ELISA assay was also performed to measure A\u00CE\u00B240 and A\u00CE\u00B242 levels in the transgenic brain tissues. The levels of A\u00CE\u00B240 and A\u00CE\u00B242 were reduced to 67.64\u00C2\u00B12.89% and 34.53\u00C2\u00B11.53% in VPA-treated mice relative to controls, respectively (p<0.05). To further confirm VPA\u00E2\u0080\u0099s effect on A\u00CE\u00B2 production, we measured A\u00CE\u00B240 and A\u00CE\u00B242 levels in the conditioned media of cultured primary cortical and hippocampal neurons derived from neonatal APP23/PS45 double transgenic mice. VPA markedly reduced A\u00CE\u00B240 and A\u00CE\u00B242 levels to 48.86\u00C2\u00B11.52% and 58.90\u00C2\u00B13.43%, respectively, relative to controls (p<0.005, Fig. 2.4C and D). VPA treatment had no significant effect on APP and PS1 protein levels (Fig. 2.4A and B). The increased C99 and C83 levels, together with reduced A\u00CE\u00B2 production in the brains of the VPA-treated transgenic mice, indicate that VPA inhibits \u00CE\u00B3-secretase cleavage of APP proteins. To examine the effect of VPA on APP processing in vitro, 20E2 and H99C1 cells were treated with VPA. Consistent with in vivo data from transgenic mouse models, VPA significantly increased APP C99 and C83 generation in 20E2 cells, a HEK293 stable cell line overexpressing the Swedish mutant APP (Qing et al., 2004) (Fig. 2.4E). The levels of total CTFs were increased by 140.58\u00C2\u00B15.5%, 138.3\u00C2\u00B15.58%, 176.7\u00C2\u00B12.73% and 179.64\u00C2\u00B14.10% with 0.5, 1.5, 5 and 10 mM of VPA treatment, respectively (p<0.001) (Fig. 2.4F). To further confirm the VPA inhibits AD pathogenesis 57 inhibitory effect of VPA on \u00CE\u00B3-secretase cleavage of APP, the H99C1 cell line was established to stably overexpress APP C99, a major \u00CE\u00B2-secretase cleavage product of APP (Fig 2.4G). VPA treatment significantly increased the levels of APP CTFs including C99, C89 and C83. The levels of total CTFs were increased by 200.59\u00C2\u00B14.10%, 244.09\u00C2\u00B13.87%, 354.36\u00C2\u00B117.30%, and 400.24\u00C2\u00B117.63% with 0.5, 1.5, 5 and 10 mM of VPA treatment, respectively (p<0.001) (Fig. 2.4H). These data clearly indicated that VPA inhibited \u00CE\u00B3-secretase processing of the APP C99 protein. Figure 2.4 VPA inhibits \u00CE\u00B3-secretase cleavage of APP and A\u00CE\u00B2 production. (A) Immunoblots of protein levels of full length APP, PS1, CTF, A\u00CE\u00B2, and \u00CE\u00B2-actin from VPA or sham-injected APP23 mice. (B) Quantification showed that CTFs were significantly increased while A\u00CE\u00B2 levels were markedly reduced in VPA-treated mice. N=30 each for control and VPA group. *p<0.05 by student\u00E2\u0080\u0099s t-test. ELISA assay was performed to measure A\u00CE\u00B240 (C) and A\u00CE\u00B242 (D) levels in the conditioned media of primary neuronal cultures derived from the brain tissues of newborn APP23/PS45 mice. The cells were cultured for a week prior to VPA treatment for 24 VPA inhibits AD pathogenesis 58 hours. N=3, * p<0.005 by student\u00E2\u0080\u0099s t-test. (E) Swedish mutant APP stable cell line 20E2 was treated with different doses of VPA for 24 hours, and cell lysates applied to immunoblot analysis. (F) Quantification of CTF (C99 and C83) generation in 20E2 cells. VPA treatment significantly increased APP CTF production. N=4, * p<0.001 by ANOVA. (G) APP C99 stable cell line H99C1 was treated with different doses of VPA for 24 hours, and the CTFs (C99, C89, and C83) were detected by 9E10 antibody. \u00CE\u00B2-actin was detected by anti-\u00CE\u00B2-actin antibody AC-15 as the internal control. (H) Quantification of CTFs (C99, 89, and C83) levels in H99C1 cells. VPA treatment significantly increased APP CTF production. N=4, * p<0.001 by ANOVA. 2.3.4 VPA treatment inhibits GSK3 activity Our data demonstrated that VPA significantly decreased A\u00CE\u00B2 production and neuritic plaque formation in AD transgenic mice through inhibition of \u00CE\u00B3-secretase activity. To further investigate the underlying mechanism of VPA\u00E2\u0080\u0099s effect, we first examined its effect on APP, BACE1 and PS1 gene expression. We showed that VPA treatment did not change the mRNA levels of these genes (Fig. 2.5A, B and C). Previous studies found that GSK3\u00CE\u00B2 facilitates A\u00CE\u00B2 formation (Blaheta and Cinatl, 2002; Eickholt et al., 2005; Ryan and Pimplikar, 2005; Su et al., 2004). Interestingly, Chen et al. (1999) demonstrated that VPA inhibits GSK3 activity, which could be the underlying cause of VPA\u00E2\u0080\u0099s inhibitory effect on A\u00CE\u00B2 production. GSK3\u00CE\u00B2 activity is regulated by phosphorylation at the serine 9 (S9) and tyrosine 216 sites (Y216). Phosphorylation at the S9 (pGSK3\u00CE\u00B2S9) inhibits GSK- \u00CE\u00B2 whereas the Y216 phosphorylation (pGSK3\u00CE\u00B2Y216) is required for GSK-3\u00CE\u00B2 activity. To examine whether GSK-3\u00CE\u00B2 mediated VPA\u00E2\u0080\u0099s effect on APP processing in AD transgenic mouse models, brain tissues of the double transgenic mice were subjected to Western blot analysis for total GSK3\u00CE\u00B2 and phospho-GSK3\u00CE\u00B2 levels. We found no differences in total GSK-3\u00CE\u00B2 protein levels between the VPA treatment and control mice groups; however, VPA treatment significantly increased GSK-3\u00CE\u00B2S9 levels in vivo (Fig. 2.5D). Consistent with the transgenic VPA inhibits AD pathogenesis 59 mouse data, VPA treatment in vitro also significantly facilitated the phosphorylation of GSK-3\u00CE\u00B2 at the N-terminal serine 9 site. The level of phospho- GSK-3\u00CE\u00B2S9 in VPA-treated N2a cells was increased to 147.87\u00C2\u00B112.38% and 181.18\u00C2\u00B116.55% after 12 and 24 hr treatment (p<0.001) (Fig. 2.5E), while VPA had little effect on total GSK-3\u00CE\u00B2 level in N2a cells (p>0.05) (Fig. 2.5F). To examine the effect of VPA on GSK3\u00CE\u00B2-mediated biological function, we performed a \u00CE\u00B2-catenin-Tcf reporter gene assay. GSK3 phosphorylates \u00CE\u00B2-catenin and targets it for degradation via the ubiquitin proteasome pathway. Therefore inhibition of GSK-3 stabilizes \u00CE\u00B2-catenin and activates downstream gene transcription. TOPFLASH, containing three copies of the optimal Tcf motif CCTTTGATC upstream of a minimal c-Fos promoter driving luciferase expression (Korinek et al., 1997), was transfected into N2a cells. VPA treatment significantly potentiated \u00CE\u00B2-catenin-mediated transcriptional activation, resulting in higher promoter activity (138.80\u00C2\u00B11.37%) (p<0.005) (Fig. 2.5G). VPA-induced increase in \u00CE\u00B2-catenin reporter activity was abolished in cells transfected with a mutant promoter construct, indicating the specificity of VPA\u00E2\u0080\u0099s negative effect on GSK3\u00CE\u00B2. Taken together, our data indicate that regulation of APP processing and neuritic plaque formation by VPA may be mediated by its effect on the GSK-3\u00CE\u00B2 signaling pathway. VPA inhibits AD pathogenesis 60 Figure 2.5 VPA inhibits GSK3 activity. Total RNA was isolated from N2a cells with or without 5 mM VPA treatment. A set of gene- specific primers was used to amplify APP (A), BACE1 (B) and PS1 (C) genes. \u00CE\u00B2-actin was used as an internal control. There was no difference in endogenous APP, PS1 or BACE1 mRNA levels between VPA-treated cells and controls. (D) Brain tissues from APP23/PS45 double transgenic mice were subjected to Western blot analysis to determine the levels of total GSK-3\u00CE\u00B2 and phospho-GSK-3\u00CE\u00B2S9. VPA increases phospho-GSK-3\u00CE\u00B2S9 levels, but not total GSK-3\u00CE\u00B2 levels in the transgenic mice. (E) N2a cells were treated with 5 mM of VPA for 0, 6, 12, and 24 hours. VPA treatment increased GSK3\u00CE\u00B2S9 levels (N=3, * p<0.001 by ANOVA) but had no significant effects on (F) total GSK3\u00CE\u00B2 level. (G) VPA treatment increased the activity of TOPFLASH promoter assay in N2a cells. This indicates that VPA treatment inhibited GSK3 activity, which stabilized \u00CE\u00B2- catenin levels thereby enhancing pTOPFLASH activity. (N=4, * p<0.005 by student\u00E2\u0080\u0099s t-test). ! VPA inhibits AD pathogenesis 61 The previous section showed that VPA treatment inhibits GSK3\u00CE\u00B2 activity. However previous findings indicated that VPA activates a plethora of signaling cascades that may be independent of GSK3\u00CE\u00B2. The following studies will focus on examination of the influence of VPA treatment on cell signaling pathways in mouse neuroblastoma cells. To this end, we performed extensive immunoblotting studies with a panel of over 30 commercial phospho-site-specific antibodies that have been rigorously validated in-house at Kinexus Bioinformatics Company. Figure 2.6 shows an example of the Kinetworks\u00E2\u0084\u00A2 KPSS 1.3 phospho-site multi- immunoblot screen. Figure 2.6 Kinetworks\u00E2\u0084\u00A2 KPSS1.3 Phosphoprotein profiling. Kinetworks\u00E2\u0084\u00A2 KPSS 1.3 phosphoprotein profiling of mouse N2a cells. The identities of protein targets are indicated by arrows and numbers. VPA inhibits AD pathogenesis 62 N2a cells treated with VPA for 12 hours appeared to produce marked changes in the relative phosphorylation states of many protein as reflected in the intensity of the ECL signals from the Kinetworks\u00E2\u0084\u00A2 immunoblots. These are quantified in Figure 2.7. Changes in phosphorylation greater than 30% are usually highly reproducible in the Kinetworks \u00E2\u0084\u00A2 phospho-site screen. In the present study, at least 18 phospho-sites were enhanced by 30-346%, whereas about 10 phospho- sites were reduced by 30-65%. Phospho-proteins that have previously been associated with GSK3 functions are summarized in table 2.1. In particular, VPA treatment led to enhanced phosphorylation of PKB, ERK1/2, and PKC\u00CE\u00B1, resulting in increased kinase activities. Consequently, these kinases phosphorylate and inhibit GSK3 activity. VPA treatment reduced the phosphorylation of GSK3\u00CE\u00B1/\u00CE\u00B2 at Y279/Y216, which is essential for kinase activity. Consistent with this decrease, MEK1/2, which is known to phosphorylate GSK3 at the tyrosine activation site, is also reduced (Takahashi-Yanaga et al., 2004). The phosphorylation status of CREB1, a transcription factor downstream of GSK3 is also reduced. Taken together, results from the phospho-site screen indicated that VPA treatment inhibits GSK3 activity. However VPA is not a strong inhibitor of GSK3, since VPA activates many collateral pathways independently of GSK3. VPA inhibits AD pathogenesis 63 Figure 2.7 Kinetworks\u00E2\u0084\u00A2 KPSS 1.3 Phospho-site screening results. Protein phosphorylation changes in mouse N2a cells treated with 5 mM VPA for 12 h. The intensities (in arbitrary units) of the immunoblot ECL signals for target phospho-proteins are quantified for N2a cells incubated in the absence (white bars) and presence (black bars) of VPA. Panels A and B show different scales. The data are shown in the figure only for those target phospho-sites where the observed percent change from control (%CFC) was 30% or higher. VPA inhibits AD pathogenesis 64 Table 2.1 Kinetworks\u00E2\u0084\u00A2 KPSS1.3 Phosphoprotein profiling in N2a cells treated with VPA. Phosphoprotein Phosphorylation status Consequence of VPA treatment NMDA Receptor 1\u00CE\u00B6 Decr Prevent inactivation of NMDA receptor p85 S6K\u00CE\u00B1 Incr Increase kinase activity, promoting protein translation cAMP response element binding protein 1 Decr Decrease CREB-mediated gene transcription Cyclin-dependent protein-serine kinase 1/2 Decr Increased kinase activity, facilitate cell for entry into cell cycle Extracellular regulated protein-serine kinase 1/2 Incr Increase kinase activity, regulation of cell proliferation and cell survival Glycogen synthase-serine kinase 3 \u00CE\u00B1/\u00CE\u00B2 Decr Decrease kinase activity, reduced metabolic signaling, increase glycogen synthesis MAPK/ERK protein-serine kinase 1/2 Incr Increase kinase activity, regulation of cell proliferation and cell survival MAPK/ERK protein-serine kinase 3/6 Incr Increase kinase activity, regulation of stress signaling JNK1/2 Incr Increase kinase activity, active stress signaling c-JUN1 Incr Gene transcription in response to stress Adducin\u00CE\u00B1/\u00CE\u00B3 Incr Promote remodeling of microfilament structures B23 (Nucleophosmin) Decr Inhibit normal cell division Protein-serine kinase B Incr Increase kinase activity, regulation of ell survival PKR1 Decr Decrease kinase activity, suppress inflammatory stimulation Rb1 Incr Inhibition of Rb1 activity, promotes cell to enter S-phase Src Incr Decrease kinase activity, Src is involved in cell differentiation, proliferation, and survival Protein-serine kinase C\u00CE\u00B1 Incr Increase kinase activity, regulate cell viability Signal transducer and activator of transcription 3 Incr Decrease kinase activity, suppress inflammation-mediated gene transcription 2.4 Discussion There has been no effective method for treating AD or even preventing the AD progression. Although inhibition of HDAC activity has been reported to increase synaptogenesis and improve cognitive functions, there is limited efficacy with wide margin of side effects in animal models (Fischer et al., 2007). Moreover, there has been no evidence to show that HDAC inhibitors could prevent AD pathologies. On the other hand, there are pre-clinical studies that demonstrated interfering with APP processing at the \u00CE\u00B2- or \u00CE\u00B3-secretase site could prevent A\u00CE\u00B2 production. For example, lithium chloride and NSAIDs have been demonstrated to reduce amyloid pathologies in transgenic mouse models of AD (Li et al., 2006; VPA inhibits AD pathogenesis 65 Phiel et al., 2003; Sastre et al., 2006; Weggen et al., 2001). Here we show that VPA, an antiepileptic drug, can serve as a highly effective anti-amyloid treatment in AD transgenic model mice. We showed that VPA inhibits \u00CE\u00B3-secretase activity, leading to an accumulation of CTF and reduced A\u00CE\u00B2 production. Consistent with previous findings, we also showed that VPA treatment inhibits the activity of GSK-3\u00CE\u00B2, a kinase with prominent roles in AD pathologies. In addition, VPA-mediated inhibition of GSK3\u00CE\u00B2 leads to increased \u00CE\u00B2-catenin protein levels via the Wnt signaling pathway (Chen et al., 1999; Kim et al., 2005). The activity of \u00CE\u00B2-catenin has important biological roles such as development and cell growth. In an attempt to probe the cellular targets of VPA, we employed the Kinetworks\u00E2\u0084\u00A2 multi-immunoblot phospho-site screen. The advantage to this approach is that a wide range of VPA-induced phosphorylation changes could be detected simultaneously. One way to analysis this type of profiling data is to group the phospho-proteins into related pathways. Interestingly, we found that VPA treatment enhanced phosphorylation of PKB, PKC, and ERK1/2, all of which have been shown to phosphorylate and inhibit GSK3 activity (Gotschel et al., 2008). Moreover, the activity of MEK1/2, a kinase known to phosphorylate and activate GSK3 (Takahashi-Yanaga et al., 2004), was reduced as indicated by MEK1/2\u00E2\u0080\u0099s phosphorylation status. The phosphorylation level of a downstream effector, CREB1, was also reduced (Grimes and Jope, 2001a). Together these findings show that VPA inhibits GSK3 activity. It should be noted that phospho- protein profiling also screens phosphorylation changes that are unrelated to GSK3. To date, there are no indications of whether these pathways are involved in AD pathogenesis. VPA inhibits AD pathogenesis 66 There were previous attempts to use VPA in the clinic for AD patients. Profenno et al. (2005) reported that doses of less than 1000 mg/day of divalproex sodium could be tolerated by patients in a Safety and Tolerability trial of 20 outpatients with probable AD (Profenno et al., 2005). In a clinical trial that assessed VPA's effect on agitation and aggression levels of 14 moderate to severe institutionalized AD patients with average age of 85.6 years, VPA treatment was ineffective for the management of agitation and aggression (Herrmann et al., 2007). These reports demonstrated that patients with cognitive dysfunctions tolerate VPA treatment well. However, these clinic trials do not address VPA's effect on AD pathogenesis, neuropathology, and cognitive impairments. There were previous attempts to use VPA in the clinic for AD patients. Profenno et al. (2005) reported that doses of less than 1000 mg/day of divalproex sodium could be tolerated by patients in a Safety and Tolerability trial of 20 outpatients with probable AD (Profenno et al., 2005). In a clinical trial that assessed 14 moderate to severe institutionalized AD patients with average age of 85.6 years, VPA treatment was ineffective for the management of agitation and aggression (Herrmann et al., 2007). These reports demonstrated that patients with cognitive dysfunctions tolerate VPA treatment well. However, these clinical trials do not address VPA's effect on AD pathogenesis, neuropathology, and cognitive impairments. 2.5 Conclusions Our work demonstrated that VPA, which could interfere with GSK3 activity, also has significant beneficial effects on AD pathogenesis. In particular, we found that VPA reduced \u00CE\u00B3-secretase cleavage of APP and A\u00CE\u00B2 production in vitro and in vivo, as well as prevented AD-associated pathological outcomes. However, there is a VPA inhibits AD pathogenesis 67 critical time window in which VPA treatment could rescue memory deficits. We found that VPA treatment before disease onset not only reduced neuritic plaque formation, but also rescued memory deficits in AD transgenic mice. The inhibitory effect of VPA on neuritic plaque formation persisted up to two months after the last drug administration, indicating VPA\u00E2\u0080\u0099s long lasting anti-amyloid treatment potential for AD patients. However, transgenic mice at a more advanced disease state receiving VPA treatment also showed reduced plaque depositions, albeit a lesser effect on improving memory deficits. Our preclinical animal study indicated that VPA is effective when administered at early stages of the disease to improve cognitive deficits, whereas VPA treatment at endstage AD will have minimal beneficial outcomes. 68 Chapter 3: GSK3\u00CE\u00B2 signaling regulates \u00CE\u00B2-secretase expression and A\u00CE\u00B2 production Chapter 3 GSK3\u00CE\u00B2 signaling regulates BACE1 expression and A\u00CE\u00B2 production 3.1 Introduction There has been ample evidence to show that dysregulation of GSK3 activity contributes to AD pathologies. However, there are controversies to how dysregulation of GSK3 activity affects APP processing and A\u00CE\u00B2 production. Previous reports suggested that GSK3 phosphorylates APP in the cytoplasmic domain, which enhances APP cleavage (Su et al., 2004; Sun et al., 2002). Subsequent findings show that GSK3 modulates \u00CE\u00B3-secretase activity, thereby promoting A\u00CE\u00B2 production (Phiel et al. 2003; Ryder et al, 2004; Qing et al. 2008). In particular, Phiel et al. (2003) found that the GSK3\u00CE\u00B1 isoform primarily promoted A\u00CE\u00B2 production, whereas GSK3\u00CE\u00B2 was not involved. Conversely, the reports by Ryder et al. (2004) and Qing et al. (2008) argued that only the GSK3\u00CE\u00B2 isoform is involved APP processing. Further adding to the controversy, Jaworski et al. (2011) showed that APP processing was not affected in GSK3\u00CE\u00B1 and conditional GSK3\u00CE\u00B2 knockout mice. The latter study failed to address the effects of acute versus chronic GSK3 inhibition, which are pertinent as GSK3 knockout animals have inherent biochemical and behavioral problems (Kaidanovich-Beilin and Woodgett, 2011). Without a clear understanding of how GSK3 contributes to APP processing, it will be difficult to devise therapeutic strategies targeting GSK3 to treat AD. The aim of this chapter is to elucidate the effects of GSK3-specific inhibition on APP GSK3\u00CE\u00B2 regulates BACE1 expression 69 processing. To specifically ablate GSK3 activity in our experimental systems, we decided to use the AR-A014418 compound. Although this compound cannot distinguish between the GSK3\u00CE\u00B1 and GSK3\u00CE\u00B2 isoforms, this inhibitor is highly specific to GSK3, as compared to a panel of 26 other related kinases, with an IC50 of 105 nM. In order to address how each isoform contributes to APP processing, we used siRNA to target the GSK3\u00CE\u00B1 and GSK3\u00CE\u00B2 isoforms individually. We found that suppression of GSK3 activity interfered with BACE1-mediated APP processing. Moreover, we found that GSK3\u00CE\u00B2, but not GSK3\u00CE\u00B1, regulates BACE1 transcription. 3.2 Methods 3.2.1 Materials AR-A014418 was purchased from EMD Biosciences. The protease inhibitor cocktail tablet and AEBSF for ELISA was purchased from ROCHE Diagnostics. The dual-Luciferase Reporter Assay system was purchased as a kit from Promega. TNF\u00CE\u00B1 was purchased from Peprotech Inc. Tetracycline was purchased from Sigma-Aldrich. GSK3\u00CE\u00B1, GSK3\u00CE\u00B2, and scrambled siRNA were purchased from Dharmacon. Dulbecco\u00E2\u0080\u0099s modified Eagle\u00E2\u0080\u0099s medium (DMEM), fetal bovine serum, geneticin, zeocin, B27 supplement, Esgro (LIF) and lipofectamine were purchased from Life Sciences Technologies. Rabbit anti-C20 recognizing the last twenty amino acids on the C-terminal end of APP was made in-house. PS1 was detected by anti-PS1 N-terminal antibody 231F, which was also made in- house. Rabbit anti-\u00CE\u00B2-catenin antibody was purchased from Cell Signaling Technologies. Mouse anti-GSK3\u00CE\u00B1/\u00CE\u00B2 was purchased from Biosource International Inc. \u00CE\u00B2-actin was detected using monoclonal antibody AC-15 (Sigma). IRDye\u00E2\u0084\u00A2 680-labeled goat anti-rabbit, and IRDye\u00E2\u0084\u00A2 800CW-labeled goat anti-mouse secondary antibodies were obtained from LI-COR Biosciences. GSK3\u00CE\u00B2 regulates BACE1 expression 70 3.2.2 Cell culture HEK293 cells, N2a cells, SH-SY5Y cells, and wildtype GSK3\u00CE\u00B2 MEFs were maintained in complete DMEM under 5% CO2. GSK3\u00CE\u00B2 knockout (KO) fibroblast cells were derived from E12.5 GSK3\u00CE\u00B2-KO mouse embryos and maintained in complete DMEM (Hoeflich et al., 2000). The RelA-KO fibroblast cell line, derived from E12.5-E14.5 mouse embryo fibroblasts, was maintained in DMEM supplemented with 15% FBS, \u00CE\u00B2-mercaptoethanol and Esgro (LIF) (Gapuzan et al., 2005). S9A-GSK3\u00CE\u00B2 stably transfected SHSY5Y cells, under the control of the tetracycline-regulated mammalian expression T-Rex system, were maintained in complete DMEM (Uemura et al., 2007). S9A-GSK3\u00CE\u00B2 gene induction was achieved by stimulation with 1 \u00C2\u00B5g/ml tetracycline (Uemura et al., 2007). 3.2.3 Transfections and drug treatment Cells were transfected with plasmid DNA using either calcium phosphate transfection or Lipofectamine 2000 (Invitrogen). For GSK3 isoform-specific knockdown, 10 nM of GSK3\u00CE\u00B1, GSK3\u00CE\u00B2, or scrambled siRNA (Dharmacon) was transfected into either SH-SY5Y cells or 20E2 cells. The cells were harvested for analysis 72 h after transfection. Immunoblot analysis or RT-PCR were performed to determined the degree of gene/protein knockdown. The \u00CE\u00B3-secretase specific inhibitor, L685,458 and GSK3 inhibitors G2 and AR-A014418 (EMD Biosciences) were dissolved in dimethyl sulfoximine (DMSO). L685,458 was diluted in complete DMEM to a final concentration of 1 \u00C2\u00B5M and treated for 24 h. In the dose response experiment, AR-A014418 was diluted to 0, 1, 2.5, 5 \u00C2\u00B5M and treated for 24 h. The final concentration of G2 used was 5 \u00C2\u00B5M. The final DMSO concentrations in each experiment were less than 0.5%. GSK3\u00CE\u00B2 regulates BACE1 expression 71 3.2.4 Transgenic APP23/PS45 mice and AR-A014418 treatment The APP23/PS45 mouse model was employed to examine the effect of GSK3 inhibition on the APP processing pathway in vivo. The APP23/PS45 mice is double transgenic for a human APP751 gene with the Swedish mutation at positions 670/671 (KM\u00EF\u0083\u00A0NL) (Sturchler-Pierrat et al., 1997; Sturchler-Pierrat and Staufenbiel, 2000) and human presenilin-1 with a G384A mutation (Qing et al., 2008). The genotypes of the mice were confirmed by PCR using DNA from tail tissues as indicated in section 2.2.3. Both male and female mice were randomly assigned for ARA-treatment (n=14) and sham-treatment (n=12). Mice were injected with 5 mg/kg AR-A014418 diluted in 0.9% saline daily via the intraperitoneal route at the same time each day for a total of 4 weeks. Control mice were injected with DMSO diluted in 0.9% saline as a vehicle. We tabulated daily food consumption and weight for each mouse. 3.2.5 Luciferase assay BACE1 promoter constructs were transfected into N2a cells. The Renilla (sea pansy) luciferase vector pCMV-Rluc was cotransfected to normalize transfection efficiency. The NF\u00CE\u00BAB-luc reporter plasmid and pB1-4NF\u00CE\u00BAB plasmid containing four NF\u00CE\u00BAB putative cis-elements from the BACE1 promoter driving the luciferase protein were transfected into N2a cells, followed by stimulation with 10 ng/ml TNF\u00CE\u00B1 for 24 h. The luciferase assay was performed 48 hours after transfection with Dual-Luciferase Reporter Assay system (Promega) as previously described (Chen et al., 2011c). 3.2.6 Immunoblotting Immunoblotting procedures are carried out as indicated in section 2.2.7. Briefly cell lysates are denatured in 4X sample buffer and resolved in 16% tris-tricine or GSK3\u00CE\u00B2 regulates BACE1 expression 72 12% tris-glycine polyacrylamide gels. The proteins are then transferred onto a PVDF-FL membrane. The membranes are then blocked with 5% milk and incubated with primary antibodies overnight at 4\u00C2\u00B0C. After incubation with fluorophore-conjugated secondary antibodies, the resolved proteins were visualized using the Odyssey system. 3.2.7 In vitro kinase assay The kinase assay was performed at Kinexus Bioinformatics following a well- established protocol. The assay condition for the various protein kinase targets were optimized to give high signal-t-noise ratio. The detailed protocol could be obtained via www.kinexus.ca. Briefly, a radioisotope assay format was used for profiling evaluation of the kinase targets. Protein kinase assays were performed at 30\u00C2\u00B0C for 30 minutes in the presence of 100 \u00C2\u00B5M 33P-ATP with 5 \u00C2\u00B5M AR-A014418 or 10% DMSO. The final volume is 25 \u00C2\u00B5l. After 30 minutes, the assay was halted by spotting 10 \u00C2\u00B5l of the reaction mixture onto Multiscreen phosphocellulose P81 plate. The P81 plates was washed 3 times with phosphoric acid solution followed by counting using a Trilux scintillation counter. 3.2.8 Human A\u00CE\u00B240/42 ELISA 20E2 cells were maintained in cell culture media supplemented with 1% FBS. Following AR-A014418 treatment for 24 h, conditioned media was harvested and Protease inhibitors (ROCHE Diagnostics) were added to prevent degradation of A\u00CE\u00B2 peptides. APP23/PS45 double transgenic mouse cortical tissues were prepared according to manufacturer\u00E2\u0080\u0099s instructions prior to carrying out the ELISA protocol. Briefly, about 50 mg of mouse cortices were homogenized in 5 M guanidine HCl/50 mM Tris HCl (pH 8.0) and allowed to mix at room temperature for 4 h. GSK3\u00CE\u00B2 regulates BACE1 expression 73 The samples were then diluted in ice-cold reaction buffer (PBS with 5% BSA, 0.03% Tween-20, and supplemented with AEBSF and Roche mini protease inhibitor cocktail tablet). The final guanidine HCl concentration was less than 0.1 M. The concentration of A\u00CE\u00B240 and A\u00CE\u00B242 were detected using \u00CE\u00B2-amyloid 1-40 or \u00CE\u00B2- amyloid 1-42 Colorimetric ELISA kit (Invitrogen) according to manufacturer\u00E2\u0080\u0099s instructions. 3.2.9 Electromobility shift assay (EMSA) Whole brain extracts were prepared by homogenizing the tissue in Buffer C (20 mM HEPES pH7.5, 400 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 1 mM PMSF, 10% glycerol) supplemented with protease inhibitor. EMSA was performed as previously described with a few changes (Wang et al., 2011). Briefly, 20-40 \u00C2\u00B5g of protein were incubated with IRDye 700 labeled NF-\u00CE\u00BAB oligonucleotides (5\u00E2\u0080\u0099-agttgaggggactttcccaggc) and the gels were scanned using the Odyssey system (LI-COR Biosciences). In the competition assay, unlabeled wildtype and mutant (5\u00E2\u0080\u0099-agttgaggccactttcccaggc) NF\u00CE\u00BAB oligonucleotides at 10X and 100X molar excess were used to compete for binding. 3.2.10 Reverse transcription PCR RNA was isolated from cells using TRI-Reagent (Sigma-Aldrich). Thermoscript Reverse Transcription kit (Invitrogen) was used to synthesize the first strand of cDNA from an equal amount of RNA following the manufacturer\u00E2\u0080\u0099s instruction. The newly synthesized cDNA templates were further amplified via Platinum Taq DNA polymerase in a 20 \u00C2\u00B5L reaction. The following primers were used to specifically amplify human BACE1, GSK3\u00CE\u00B1, GSK3\u00CE\u00B2, APP, and PS1 genes: BACE1 forward 5'-cccgcagacgctcaacatcc and reverse 5\u00E2\u0080\u0099- gccactgtccacaatgctctt; GSK3\u00CE\u00B1 forward 5\u00E2\u0080\u0099-tgaagctgggccgtgacagcgg and reverse 5\u00E2\u0080\u0099- acatgtacaccttgacatag; GSK3\u00CE\u00B2 forward 5\u00E2\u0080\u0099- tcaggagtgcgggtcttccgac and reverse 5\u00E2\u0080\u0099- GSK3\u00CE\u00B2 regulates BACE1 expression 74 ctccagtattagcatctgacgct; APP forward 5\u00E2\u0080\u0099- gctggcctgctggctgaacc and reverse 5\u00E2\u0080\u0099- ggcgacggtgtgccagtgaa; PS1 forward 5\u00E2\u0080\u0099-gagacacaggacagtggttctgg and reverse 5\u00E2\u0080\u0099- ggccgatcagtatggctacaaa. \u00CE\u00B2-actin was used as an internal control. The samples were resolved and analyzed on a 1.2% agarose gel. 3.3 Results 3.3.1 Regulation of \u00CE\u00B2-secretase cleavage of APP and A\u00CE\u00B2 production by GSK3 signaling Previous studies showed LiCl and VPA modulated GSK3 signaling and reduced A\u00CE\u00B2 production (Phiel et al., 2003; Qing et al., 2008; Su et al., 2004). However, the underlying mechanism is not well defined and these compounds also have many confounding GSK3-independent effects. To examine the specific effect of GSK3 signaling on APP processing, ARA, a highly selective and potent inhibitor of GSK3, was applied to 20E2 cells, a stable cell line expressing human Swedish mutant APP (Li et al., 2006). The specificity of ARA\u00E2\u0080\u0099s effect on GSK3 inhibition was tested against other structurally similar protein kinases. ARA inhibited GSK3\u00CE\u00B1 and GSK3\u00CE\u00B2 activity by 98% and 96%, respectively. ARA did not significantly affect other structurally similar protein kinases (Table 3.1). Table 3.1 Activity changes of protein kinasese in the presence of 5 \u00C2\u00B5M AR-A014418. Kinase activity (%) Kinase Kinase full name Control 5 uM ARA GSK3\u00CE\u00B1 Glycogen synthase kinase 3 \u00CE\u00B1 100.0\u00C2\u00B12.2 2.0\u00C2\u00B10.1 GSK3\u00CE\u00B2 Glycogen synthase kinase 3 \u00CE\u00B2 100.0\u00C2\u00B14.2 4.2\u00C2\u00B10.2 AMPK\u00CE\u00B11 5'-AMP-activated protein kinase \u00CE\u00B1 1 100.0\u00C2\u00B11.4 99.7\u00C2\u00B13.8 AMPK\u00CE\u00B12 5'-AMP-activated protein kinase \u00CE\u00B1 2 100.0\u00C2\u00B10.3 102.8\u00C2\u00B11.0 CDK2/cyclin A1 cyclin dependent protein kinase 2 100.0\u00C2\u00B11.3 94.8\u00C2\u00B10.9 CDK3/cyclin E1 cyclin dependent protein kinase 3 100.0\u00C2\u00B11.3 63.9\u00C2\u00B11.8 CDK4/cyclin E1 cyclin dependent protein kinase 4 100.0\u00C2\u00B15.3 92.9\u00C2\u00B12.1 CDK5/p25 cyclin dependent protein kinase 5 100.0\u00C2\u00B10.8 96.0\u00C2\u00B11.4 DYRK1A Dual-specificity tyrosine- (Y)-phosphorylation regulated kinase 1A 100.0\u00C2\u00B11.4 95.8\u00C2\u00B11.4 HIPK1 Homeodomain- interacting protein kinase 1 100.0\u00C2\u00B12.3 99.2\u00C2\u00B10.8 HIPK3 Homeodomain- interacting protein kinase 3 100.0\u00C2\u00B11.5 94.8\u00C2\u00B13.9 PAK6 Ser/thr-protein kinase PAK 6 100.0\u00C2\u00B122 103.0\u00C2\u00B11.4 PKA\u00CE\u00B1 cAMP-dependent protein kinase, alpha- catalytic subunit 100.0\u00C2\u00B10.3 102.7\u00C2\u00B10.8 PKC\u00CE\u00B6 Protein kinase C, zeta type 100.0\u00C2\u00B10.6 101.0\u00C2\u00B10.9 GSK3\u00CE\u00B2 regulates BACE1 expression 75 ARA treatment to 20E2 cells at 1, 2.5, and 5 \u00C2\u00B5M, significantly decreased the levels of the \u00CE\u00B2-secretase cleavage product APP C99 to 95.7\u00C2\u00B11.6%, 66.4\u00C2\u00B10.7%, and 31.3\u00C2\u00B10.4% respectively (p<0.001) (Fig. 3.1A and B). The treatment had no significant effect on APP expression (Fig. 3.1A). The A\u00CE\u00B2 ELISA was performed to assess the levels of A\u00CE\u00B240 and A\u00CE\u00B242 in the conditioned media of 20E2 cells. ARA markedly reduced A\u00CE\u00B2 generation in a dose-dependent manner. A\u00CE\u00B240 was decreased to 99.2\u00C2\u00B13.8%, 73.2\u00C2\u00B14.6%, and 48.7\u00C2\u00B11.3% with 1, 2.5, and 5\u00C2\u00B5M of ARA treatment, respectively (p<0.05) (Fig. 3.1C); A\u00CE\u00B242 was reduced to 99.2\u00C2\u00B13.1%, 73.2\u00C2\u00B13.5%, and 48.7\u00C2\u00B14.5% with 1, 2.5 and 5 \u00C2\u00B5M of ARA treatment, respectively (p<0.01) (Fig. 3.1D). As expected, inhibition of GSK-3 stabilizes \u00CE\u00B2- catenin (Fig. 3.1A), and ARA treatment resulted in a significant increase in \u00CE\u00B2- catenin levels to 152.7\u00C2\u00B111.1%, 221.3\u00C2\u00B117.0%, and 233.7\u00C2\u00B125.0% with 1, 2.5 and 5 \u00C2\u00B5M, respectively (p<0.05). These data indicate that specifically inhibiting GSK3 reduced BACE1-mediated APP processing and C99 and A\u00CE\u00B2 production. To further examine the effect of GSK3 on \u00CE\u00B2-secretase cleavage of APP and A\u00CE\u00B2 production, we pharmacologically blocked \u00CE\u00B3-secretase activity with the \u00CE\u00B3- secretase specific inhibitor L658,458 in 20E2 cells while co-treating with GSK3 inhibitor ARA and G2. G2 is another structurally distinct GSK3 specific inhibitor. As expected, \u00CE\u00B3-secretase inhibition resulted in markedly accumulation of the APP CTFs, C83 and C99 (Fig. 3.1E). Addition of ARA or G2 reduced C99 levels to 78.2\u00C2\u00B11.1% and 63.9\u00C2\u00B16.6% (Fig. 3.1E and F). These data demonstrated that specific inhibition of GSK3 reduced \u00CE\u00B2-secretase cleavage of APP and decreased C99 and A\u00CE\u00B2 production in cells. GSK3\u00CE\u00B2 regulates BACE1 expression 76 Figure 3.1 Specific inhibition of GSK3 reduces BACE1 cleavage of APP. (A) Swedish mutant APP stable cell line 20E2 was cultured and treated with AR-A014418 for 24 hours, and cell lysates subjected to Western blot analysis. Full length APP and the C-terminal fragments (APP CTFs) were detected with C20 antibody. \u00CE\u00B2-catenin was detected by anti-\u00CE\u00B2-catenin antibody. \u00CE\u00B2-actin was detected by anti-actin antibody AC-15 as the internal control. (B) Quantification of APP C99 generation in 20E2 cells. AR-A014418 treatment significantly increased \u00CE\u00B2-catenin levels in a dose-dependent manner, while APP CTF production decreased with increasing AR-A014418 dosage. N=6, * p<0.05 by ANOVA. A\u00CE\u00B2 ELISA detection of A\u00CE\u00B240 (C) and A\u00CE\u00B242 (D) in conditioned media from 20E2 cells treated with AR-A014418 for 24 hour. AR- A014418 treatment reduced A\u00CE\u00B2 levels in the conditioned media in a dose-dependent manner. The values are expressed as mean\u00C2\u00B1S.E.M. N=4, * p<0.05 by ANOVA. (E) \u00CE\u00B3-secretase activity in 20E2 cells was inhibited by the pharmacological inhibitor, L685,458 (GSI). Co-treatment with specific GSK3 inhibitors ARA and G2, reduced C99. (F) Quantification of C99 levels. N=6, * p<0.05 by ANOVA. GSK3\u00CE\u00B2 regulates BACE1 expression 77 3.3.2 GSK3\u00CE\u00B2 but not GSK3\u00CE\u00B1 regulates BACE1 gene expression and BACE1-mediated APP processing Our study has shown that GSK3 regulated \u00CE\u00B2-secretase processing of APP, an essential step for A\u00CE\u00B2 generation. Since BACE1 is the \u00CE\u00B2-secretase in vivo, we first examined whether GSK3 affects BACE1 gene expression. GSK3 has two highly homologous isoforms, GSK3\u00CE\u00B1 and GSK3\u00CE\u00B2. RNA interference was used to specifically knockdown the expression of either the GSK3\u00CE\u00B1 or the GSK3\u00CE\u00B2 isoform in human neuroblastoma SH-SY5Y cells to determine whether both isoforms or one of the isoforms play a major role in regulating BACE1 gene expression. Specific knockdown of GSK3\u00CE\u00B2 expression by the siRNA significantly reduced BACE1 mRNA levels to 76.0\u00C2\u00B16.6% as compared to control (p<0.05) (Fig. 3.2A and B), whereas knockdown of GSK3\u00CE\u00B1 did not affect BACE1 mRNA expression (p>0.05) (Fig. 3.2A and B). To examine whether specific knockdown of GSK3\u00CE\u00B2 expression also affected \u00CE\u00B2-secretase processing of APP, siRNA specific to GSK3\u00CE\u00B1 or GSK3\u00CE\u00B2 were transfected into 20E2 cells while inhibiting \u00CE\u00B3-secretase activity with L658,458. Western blot showed that GSK3\u00CE\u00B1 or GSK3\u00CE\u00B2 siRNA specifically reduced GSK3\u00CE\u00B1 or GSK3\u00CE\u00B2 expression respectively (Fig. 3.2C). Knockdown of GSK3\u00CE\u00B1 expression did not significantly affect BACE1-mediated APP processing, whereas GSK3\u00CE\u00B2 knockdown reduced the production of BACE1 cleavage products C99 and C89 to 51.9\u00C2\u00B16.4% (p<0.05) (Fig. 3.2C and D). To further confirm that GSK3\u00CE\u00B2 regulates BACE1 gene expression at the transcription level, BACE1 mRNA was assayed in the S9A-GSK3\u00CE\u00B2 inducible SHSY5Y stable cell line. This stable cell line carries the constitutively active mutant GSK3\u00CE\u00B2 under control of a tetracycline-inducible promoter (Uemura et al., 2007). Addition of tetracycline induced the expression of active GSK3\u00CE\u00B2 (Fig. 3.2E) and resulted in significantly increased expression of BACE1 to GSK3\u00CE\u00B2 regulates BACE1 expression 78 251.1\u00C2\u00B170.0% relative to the control (p<0.05) (Fig. 3.2F). These data demonstrated that GSK3\u00CE\u00B2, but not GSK3\u00CE\u00B1, specifically regulates BACE1 gene expression and contributes to APP processing. Figure 3.2 GSK3\u00CE\u00B2 , but not GSK3\u00CE\u00B1 regulates BACE1 gene expression and APP processing. (A) SH-SY5Y human neuroblastoma cells were transfected with scrambled, GSK3\u00CE\u00B1, or GSK3\u00CE\u00B2 isoform- specific siRNA. RNA was extracted and semi-quantitative RT-PCR was performed to measure endogenous human BACE1, GSK3\u00CE\u00B1, GSK3\u00CE\u00B2, and \u00CE\u00B2-actin mRNA levels with specific primers recognizing the coding sequence of each gene. (B) Endogenous BACE1 mRNA was significantly reduced with GSK3\u00CE\u00B2, but not GSK3\u00CE\u00B1 isoform-specific knockdown. The values are expressed as mean\u00C2\u00B1S.E.M. N=3. *p<0.05 with student\u00E2\u0080\u0099s t-test. (C) 20E2 cells were transfected with scrambled, GSK3\u00CE\u00B1, or GSK3\u00CE\u00B2 isoform-specific siRNA while co-treated with L685,458 to block \u00CE\u00B3-secretase activity. Full-length APP and CTF fragments were detected with C20 antibody. GSK3\u00CE\u00B1 and GSK3\u00CE\u00B2 were detected using a monoclonal GSK3\u00CE\u00B1/\u00CE\u00B2 antibody. GSK3\u00CE\u00B1 and GSK3\u00CE\u00B2 isoforms were selectively reduced by the isoform-specific siRNA. \u00CE\u00B2-actin served as an internal control and was detected using a monoclonal anti-\u00CE\u00B2-actin antibody, AC-15. (D) GSK3\u00CE\u00B2-specific knockdown significantly reduced C99 levels. GSK3\u00CE\u00B1-specific knockdown did not have any significant effect. The values are expressed as mean\u00C2\u00B1S.E.M. N=4. *p<0.05 with student\u00E2\u0080\u0099s t-test. (E) Tetracycline-regulated SHSY5Y cells were induced to express constitutively active S9A- GSK3\u00CE\u00B2. Endogenous human BACE1 mRNA levels were assessed as described above. Tetracyline- induced S9A-GSK3\u00CE\u00B2 significantly increased BACE1 expression. (F) Quantification of the endogenous BACE1 mRNA level. The values are expressed as mean\u00C2\u00B1S.E.M. N=4. *p<0.05 with student\u00E2\u0080\u0099s t-test. GSK3\u00CE\u00B2 regulates BACE1 expression 79 3.3.3 GSK3\u00CE\u00B2 regulates BACE1 gene promoter activity To investigate the molecular mechanism underlying the effect of GSK3\u00CE\u00B2 on BACE1 gene expression at the transcription level, a BACE1 gene promoter assay was performed. Two human BACE1 gene promoter deletion plasmids were constructed. Regions of the BACE1 promoter from -2898 to +292 bp (pB1-A) and from -9 to +292 bp (pB1-B) were inserted into promoterless vector pGL3-basic upstream of the firefly luciferase reporter gene (Fig. 3.3A). To examine the effect of GSK3 on BACE1 gene promoter activity, N2a cells were transfected with pB1- A and then treated with ARA. Inhibition of GSK3 signaling by ARA significantly decreased the promoter activity of pB1-A in N2a cells to 54.9\u00C2\u00B16.2% (p<0.005) (Fig. 3.3B). To further investigate the underlying mechanism and determine the BACE1 promoter region that mediates the transcriptional activation by GSK3 signaling, N2a cells were co-transfected with either pB1-A or pB1-B plasmids together with the S9A-GSK3\u00CE\u00B2 plasmid that carries a constitutively active form of GSK3\u00CE\u00B2. Expression of active GSK3\u00CE\u00B2 markedly increased the luciferase activity of pB1-A in the S9A-GSK3\u00CE\u00B2 transfected cells to 144.0\u00C2\u00B12.0% as compared to the control (p<0.05), but had no significant effect on the luciferase activity of pB1-B (p>0.05) (Fig. 3.3C). This result showed that enhancing GSK3\u00CE\u00B2 signaling upregulated BACE1 gene promoter activity, and the promoter region from -2898 to -8 bp is responsible for GSK3\u00CE\u00B2-mediated upregulation of BACE1 transcription. To further confirm this, these two deletion promoter plasmids were transfected into GSK3\u00CE\u00B2-KO cells or wildtype cells. Ablation of GSK3\u00CE\u00B2 expression in the GSK3\u00CE\u00B2-KO cells resulted in significant reduction of luciferase activity of pB1-A to 47.0\u00C2\u00B17.5% as compared to the wildtype control cells (p<0.05) (Fig. 3.3D). However knockout of the GSK3\u00CE\u00B2 gene had no significant effect on the luciferase GSK3\u00CE\u00B2 regulates BACE1 expression 80 activity of pB1-B (Fig. 3.3D). Taken together, these results demonstrated that GSK3\u00CE\u00B2 regulates BACE1 gene expression via its effect on the BACE1 promoter. Figure 3.3 GSK3\u00CE\u00B2 regulates BACE1 promoter activation. (A) Schematic of the 3.1 kb (pB1-A) and 400 bp (pB1-B) human BACE1 promoter/luciferase construct. (B) The 3.1 kb human BACE1 promoter was transfected into N2a cells and treated with 5 \u00C2\u00B5M AR-A014418. GSK3 inhibition with AR-A014418 treatment resulted in a significant decrease in luciferase activity. (C) N2a cells were co-transfected with either promoter constructs and S9A-GSK3\u00CE\u00B2 or a vector control. S9A-GSK3\u00CE\u00B2 significantly increased the luciferase activity of the 3.1 kb BACE1 promoter construct, but did not have any effect on the 400 bp promoter construct. (D) pB1-A or pB1-B constructs were transfected into GSK3\u00CE\u00B2 knockout MEFs. pB1-A had significantly reduced promoter activity. All promoter data shown are an average of at least 4 independent experiments, with each condition performed in triplicates. The numbers are expressed as mean\u00C2\u00B1S.E.M. N=4. *p<0.05 with student\u00E2\u0080\u0099s t-test. 3.3.4 NF\u00CE\u00BAB mediates the transcriptional regulation of BACE1 gene expression by GSK3\u00CE\u00B2 Recently we reported that both BACE1 and NF\u00CE\u00BAB are increased in AD brains, and NF-\u00CE\u00BAB signaling upregulates human BACE1 gene expression by acting on the cis- acting p65 binding element in its promoter (Chen et al., 2011b). Previous studies in GSK3\u00CE\u00B2-KO mice demonstrated that GSK3\u00CE\u00B2 is required for NF\u00CE\u00BAB activity GSK3\u00CE\u00B2 regulates BACE1 expression 81 (Hoeflich et al., 2000). As our data indicate that GSK3\u00CE\u00B2 regulates BACE1 gene transcription, we next examined whether regulation of BACE1 transcription by GSK3\u00CE\u00B2 signaling is dependent on NF\u00CE\u00BAB. The proinflammatory cytokine TNF\u00CE\u00B1 is a strong activator of NF\u00CE\u00BAB p65 expression. In order to examine the specific role of NF\u00CE\u00BAB in GSK3\u00CE\u00B2-regulated BACE1 transcription, N2a cells were transfected with a pBACE1-4\u00CE\u00BAB promoter plasmid that contained only the NF\u00CE\u00BAB binding elements in the human BACE1 promoter (Chen et al., 2011b). After transfection, the cells were co-treated with TNF\u00CE\u00B1 and the GSK3 inhibitor ARA. ARA treatment alone consistently reduced BACE1 promoter activity (Fig. 3.4A). TNF\u00CE\u00B1 stimulation increased pB1A promoter activity to 132.6\u00C2\u00B17.5% of the control (p<0.01). However, ARA treatment reduced the TNF\u00CE\u00B1-induced BACE1 promoter activation to 115.6\u00C2\u00B16.9% as compared to TNF\u00CE\u00B1 treatment alone (p<0.05) (Fig. 3.4A). Overexpression of p65 NF\u00CE\u00BAB significantly increased the BACE1 promoter activity to 487.1\u00C2\u00B1102.2% as compared to the control (p<0.01) (Fig. 3.4B). However, ARA did not affect NF\u00CE\u00BAB p65's upregulation of BACE1 promoter activity (p>0.05), indicating that GSK3 signaling may have its effect upstream of NF\u00CE\u00BAB in the modulation of BACE1 transcription (Fig. 3.4B). To further confirm ARA\u00E2\u0080\u0099s effect on NF\u00CE\u00BAB activity, N2a cells were co-transfected with pNF\u00CE\u00BAB-Luc and NF\u00CE\u00BAB p65 or an empty vector followed by treatment with ARA to inhibit GSK3 signaling. ARA reduced pNF\u00CE\u00BAB-Luc promoter activity to 51.9\u00C2\u00B19.1% as compared to control (p<0.05) (Fig. 3.6C). Overexpression of NF\u00CE\u00BAB p65 significantly increased pNF\u00CE\u00BAB-Luc promoter activity to 203.36\u00C2\u00B187.38 fold (p<0.001) (Fig. 3.4C). Additional ARA treatment did not have any significant effect on the transcriptional activation of pNF\u00CE\u00BAB-Luc by NF\u00CE\u00BAB p65 overexpression (p>0.05) (Fig. 3.4C). These data indicate that the p65 binding GSK3\u00CE\u00B2 regulates BACE1 expression 82 elements in the BACE1 promoter mediated the effect of GSK3\u00CE\u00B2 on BACE1 transcription. To confirm the role of the NF\u00CE\u00BAB signaling pathway in GSK3\u00CE\u00B2-mediated BACE1 transcription, NF\u00CE\u00BAB p65 knockout RelA-KO cells and wildtype control cells were transfected with BACE1 promoter pB1-A and the constitutively active GSK3\u00CE\u00B2 expression plasmid S9A-GSK3\u00CE\u00B2. In wildtype cells, activation of GSK3\u00CE\u00B2 signaling by expression of S9A-GSK3\u00CE\u00B2 markedly increased BACE1 promoter activity to 189.6\u00C2\u00B120.9% as compared to the vector control (p<0.001). In contrast, activation of GSK3\u00CE\u00B2 signaling by expression of S9A-GSK3\u00CE\u00B2 had no effect on BACE1 promoter activity in RelA-KO cells (p>0.05) (Fig. 3.4D), indicating that disruption of NF\u00CE\u00BAB p65 expression in RelA-KO cells abolished GSK3\u00CE\u00B2\u00E2\u0080\u0099s effect on the transcriptional activation of the human BACE1 gene promoter. To further examine the effect of GSK3 inhibition on NF\u00CE\u00BAB p65 expression, N2a cells were treated with ARA and subjected to subcellular fractionation (Fig. 3.4E). ARA treatment significantly reduced nuclear NF\u00CE\u00BAB p65 levels to 46.9\u00C2\u00B19.1% as compared to control (p<0.05) (Fig. 3.4F). Moreover, ARA treatment also reduced cytosolic NF\u00CE\u00BAB p65 levels to 56.1\u00C2\u00B17.1% as compared to control (p<0.0001) (Fig. 3.4G). These data show that GSK3 inhibition with ARA reduced NF\u00CE\u00BAB activity by decreasing NF\u00CE\u00BAB p65 levels. Taken together, our study demonstrates that NF\u00CE\u00BAB signaling mediates the regulatory effect of GSK3\u00CE\u00B2 on BACE1 gene expression. GSK3\u00CE\u00B2 regulates BACE1 expression 83 Figure 3.4 GSK3\u00CE\u00B2 regulation of BACE1 transcription is dependent on NF\u00CE\u00BAB p65 expression. (A) pBACE1-4NF\u00CE\u00BAB plasmid contains the 4 NF\u00CE\u00BAB cis-elements from the human BACE1 promoter upstream of the firefly luciferase reporter gene. N2a cells were co-transfected with pBACE1-4NF\u00CE\u00BAB and pCMV-RLuc. Transfected cells were treated with vehicle solution (control) or 10 ng/ml of TNF\u00CE\u00B1 with/without 5 \u00C2\u00B5M AR-A014418 for 24 hours. (B) N2a cells were co- transfected with pBACE1-4NF\u00CE\u00BAB plasmid and pMTF-p65 or a vector control. Transfected cells were then treated with a vehicle solution or 5 \u00C2\u00B5M of AR-A014418 for 24 hours. (C) pNF\u00CE\u00BAB-Luc was co-transfected with pMTF-p65 or a vector control and treated with a vehicle solution or 5 \u00C2\u00B5M of AR-A014418 for 24 hours. Renilla luciferase was used to normalize for transfection efficiency. The numbers are expressed as mean\u00C2\u00B1S.E.M. N=4. *p<0.05, ** p<0.01, ***p<0.001 with student\u00E2\u0080\u0099s t-test. (D) Wildtype MEFs and RelA-KO MEFs, which are dysfunctional for NF\u00CE\u00BAB activity, were co-transfected with a 3.5 kb human BACE1 promoter and S9A-GSK3\u00CE\u00B2 or a control vector. S9A- GSK3\u00CE\u00B2 overexpression in MEFs significantly increased luciferase activity (*p<0.05 with student\u00E2\u0080\u0099s t-test), whereas RelA-KO MEFs did not have any significant effect. Luciferase activity is indicative of BACE1 promoter activity. All promoter data shown is an average of at least 4 independent experiments, with each condition performed in triplicates. (E) N2a cells were treated with 5 \u00C2\u00B5M AR-A014418 for 24 hours followed by cell fractionation. Cytosolic and nuclear fractions were subjected to SDS-PAGE. AR-A014418 treatment significantly reduced NF\u00CE\u00BAB p65 levels in the (F) nuclear fraction (N=6, *p<0.001 by student\u00E2\u0080\u0099s t-test) and (G) cytosolic fraction. N=6, *p<0.001, by student\u00E2\u0080\u0099s t-test. The numbers are expressed as mean\u00C2\u00B1S.E.M. GSK3\u00CE\u00B2 regulates BACE1 expression 84 3.3.5 GSK3 regulates BACE1 gene expression, APP processing and A\u00CE\u00B2 production in vivo Our data clearly demonstrated that the GSK3\u00CE\u00B2 signaling pathway activated BACE1 gene expression, resulting in enhanced \u00CE\u00B2-secretase processing of APP and A\u00CE\u00B2 production in vitro. To examine the effect of GSK3 signaling on BACE1 gene expression and APP processing in vivo, we first assayed APP CTFs and A\u00CE\u00B2 production in the brains of APP23/PS45 mice by Western blot analysis (Fig. 5A and B). APP23/PS45 double transgenic mice, an AD mouse model, were generated by crossing APP23 mice, carrying the human Swedish mutant APP751 transgene driven by the neuronal specific Thy1.2 promoter, and PS45 mice, carrying the human familial AD-associated G384A mutant presenilin-1 (Qing et al., 2008). The mice were treated with 5 mg/kg of the GSK3 inhibitor ARA at six weeks of age daily for 4 weeks, while age-matched control mice received vehicle solution. ARA treatment significantly decreased the brain levels of the \u00CE\u00B2-secretase generated CTF\u00CE\u00B2 fragments, C99 and C89, to 38.4\u00C2\u00B14.8% relative to controls (p<0.05) (Fig. 5B). The levels of A\u00CE\u00B240 and A\u00CE\u00B242 were reduced to 71.2\u00C2\u00B18.3% and 65.6\u00C2\u00B111.0% in ARA treated mice relative to controls, respectively (p<0.05) (Fig. 5C and D). These data demonstrate that inhibition of GSK3 activity by ARA treatment reduces \u00CE\u00B2-secretase cleavage of APP and A\u00CE\u00B2 production in vivo. GSK3\u00CE\u00B2 regulates BACE1 expression 85 Figure 3.5 AR-A014418 inhibits BACE1 cleavage of APP and A\u00CE\u00B2 production in vivo. (A) Immunoblot analysis of full length APP, APP CTFs, PS1, and BACE1 of cortical tissue from AR-A014418-treated or sham-treated APP23/PS45 mice. \u00CE\u00B2-actin was detected served as the internal control. (B) Quantification showed that CTF\u00CE\u00B2 and BACE1 protein levels were significantly reduced in AR-A014418-treated mice. N=25 mice total. * p<0.05 by student\u00E2\u0080\u0099s t-test. ELISA was performed to measure A\u00CE\u00B240 (C) and A\u00CE\u00B242 (D) levels from the brain tissues of APP23/PS45 mice injected with or without AR-A014418. AR-A014418 treatment reduced A\u00CE\u00B2 levels in vivo. N=8 for each group, * p<0.005 by student\u00E2\u0080\u0099s t-test. (E) Total RNA was isolated from APP23/PS45 mouse cortices. Sets of gene-specific primers were used to amplify BACE1 (E), PS1 (G) and APP (I) genes. \u00CE\u00B2-actin was used as an internal control. BACE1 mRNA levels were significantly reduced (H) while there were no differences in endogenous PS1 (I) or APP (J) mRNA levels between AR-A014418-treated mice and controls. The values are expressed as mean\u00C2\u00B1S.E.M. N=12 total, * p<0.01 by student\u00E2\u0080\u0099s t-test. We then examined whether the level of BACE1 was altered by GSK3 signaling in vivo. The Western blot analysis showed that inhibition of GSK3 signaling significantly reduced the protein level of BACE1 to 64.7\u00C2\u00B17.3% in ARA-treated GSK3\u00CE\u00B2 regulates BACE1 expression 86 mice, as compared to the controls mice (p<0.01), and the treatment had no significant effect on APP and PS1 protein levels (P>0.05) (Fig. 3.5A and B). Our in vitro study has shown that GSK3\u00CE\u00B2 regulates the transcription of the BACE1 gene. To confirm that the decrease in BACE1 protein level seen in the brains of the ARA-treated mice was due to reduced BACE1 gene transcription, the endogenous BACE1 mRNA levels were measured (Fig. 3.5E and H). ARA treatment markedly reduced BACE1 mRNA level to 36.7\u00C2\u00B111.8% (P<0.01) (Fig. 3.5H), but did not significantly change the mRNA levels of APP and PS1 genes (P>0.05) (Fig. 3.5I and J). These data demonstrate that, consistent with the in vitro results, inhibition of GSK3 specifically inhibited BACE1 gene expression and its \u00CE\u00B2-secretase activity in vivo. It is well-known that tau is phosphorylated by GSK3 at various conserved residues. To confirm the effectiveness of GSK3 inhibition with the ARA compound in vivo, we examined the phosphorylation status of the tau protein. Previous studies have identified the T231 residue of tau is only phosphorylated by GSK3\u00CE\u00B2 (Cho and Johnson, 2004b). We found that after ARA treatment, tau expression was not affected, but phosphorylation at the T231 residue was reduced to 40.2\u00C2\u00B15.0% (p<0.05) of the vehicle-treated controls (Fig. 3.6 A and B). These data indicate that ARA treatment reduced GSK3 activity in APP23/PS45 AD mice. GSK3\u00CE\u00B2 regulates BACE1 expression 87 Figure 3.6 AR-A014418 reduces tau phosphorylation in AD transgenic mice. (A) Immunoblot analysis of the phosphorylation status of T231 of the tau protein (a GSK3\u00CE\u00B2 specific phosphorylation site), total tau, and \u00CE\u00B2-catenin in cortical tissue of APP23/PS45 mice treated with or without ARA. \u00CE\u00B2-actin served as the internal control. (B) Quantification showed that tau phosphorylation at the T231 site was significantly reduced in AR-A014418- treated mice, but total tau and \u00CE\u00B2-catenin levels were not affected. N=25 mice total. * p<0.05 by student\u00E2\u0080\u0099s t-test. Our study has demonstrated that NF\u00CE\u00BAB signaling is required for GSK3\u00CE\u00B2\u00E2\u0080\u0099s regulatory effect on the BACE1 gene expression in vitro. To confirm this effect in vivo we examined whether NF\u00CE\u00BAB activity was affected in APP23/PS45 double transgenic mice administered ARA. The electromobility shift assay was used to assess NF\u00CE\u00BAB consensus DNA binding in whole brain lysates. ARA treatment inhibited the binding of NF\u00CE\u00BAB p65 protein to the cis-acting consensus oligonucleotide probe, resulting in a reduction of the intensity of the p65 NF\u00CE\u00BAB shifted bands (Fig. 3.7A). The specificity of the bands was confirmed by the competition assay with addition of 10X and 100X unlabelled wildtype NF\u00CE\u00BAB oligos, while the mutant NF\u00CE\u00BAB oligos did not have any significant effect on the shifted bands (Fig. 3.7B). Consistent with the in vitro experiment, APP23/PS45 mice receiving ARA treatment showed a significant reduction in NF\u00CE\u00BAB levels to 62.9\u00C2\u00B16.9% of the sham-injected controls (p<0.01) (Fig. 3.7C and D). Thus inhibition of GSK3 signaling attenuates NF\u00CE\u00BAB binding to cis-acting p65 binding elements by reducing NF-\u00CE\u00BAB levels in the AD transgenic model mice in vivo. GSK3\u00CE\u00B2 regulates BACE1 expression 88 Figure 3.7 AR-A014418 reduced NF\u00CE\u00BAB binding in APP23/PS45 mouse brains. APP23/PS45 mice were injected daily with AR-A014418 for 4 weeks and whole brain lysates were subjected to EMSA. (A) Mice that received AR-A014418 have reduced intensity of NF\u00CE\u00BAB shifted band. N=3. (B) Whole brain lysates subjected to EMSA was competed with 10 and 100- fold excess of the wildtype and mutant NF\u00CE\u00BAB oligonucleotides to demonstrate the specificity of binding. (C) Daily injections of AR-A014418 to APP23/PS45 mice for 4 weeks reduced NF\u00CE\u00BAB p65 levels in the whole brain lysates. (D) Quantification of the band intensity of NF\u00CE\u00BAB p65 levels. The values are expressed as mean\u00C2\u00B1S.E.M. N= 8-12 animals per group. *p<0.005. 3.4 Discussion It was unknown at the time when GSK3 was first discovered that this protein would be linked to the neuropathological features observed in AD brains. Subsequent studies suggested that GSK3 could be a common molecular link between amyloidogenesis and tau abnormalities in AD pathology. Therefore, GSK3 inhibition is a valid therapeutic target for treating AD. In animal models, inhibition of GSK3 reduced tau hyperphosphorylation and NFT formation (Spittaels et al., 2000). Using cell culture models, ablation of GSK3 activity prevented neuronal apoptosis (Cho and Johnson, 2004a), and preserved the integrity of synapses (Jo et al.). Although previous reports have indicated that GSK3 is involved in A\u00CE\u00B2 production and neuritic plaque formation (Phiel et al., GSK3\u00CE\u00B2 regulates BACE1 expression 89 2003; Qing et al., 2008; Su et al., 2004), the underlying mechanism has yet to be clearly elucidated. The data presented in this chapter clearly indicated that specifically inhibiting GSK3 reduces BACE1-mediated APP processing. Moreover, we observed that only the GSK3\u00CE\u00B2 isoform, but not the GSK3\u00CE\u00B1 isoform, facilitates A\u00CE\u00B2 production by upregulating BACE1 gene expression via NF\u00CE\u00BAB p65 cis-acting elements on the BACE1 gene promoter. Lithium chloride and valproic acid are known to have some inhibitory effects on GSK3 (Chen et al., 1999; Klein and Melton, 1996) and have been used in the clinic for many decades for the treatment of bipolar disorders and epilepsy. Recent work has demonstrated that lithium and valproic acid could reduce A\u00CE\u00B2 levels and improve cognitive performance in mouse models of AD (Qing et al., 2008; Su et al., 2004). While the inhibitory effects of lithium and valproic acid on GSK3 are known, both compounds have also been found to affect signaling cascades independent of GSK3. To further investigate the role of GSK3 on APP processing, we administered AR-A014418, a highly selective and potent inhibitor of GSK3 (IC50=104 nM) (Bhat et al., 2003) to APP Swedish stable cell lines and APP23/PS45 mice. We found that with specific GSK3 inhibition, the BACE1 major product C99 is reduced, accompanied by a significant reduction in A\u00CE\u00B2 levels. The combination of reduced C99 levels and A\u00CE\u00B2 indicates that BACE1 activity is reduced. Previous work by Phiel et al. (2003) demonstrated siRNA knockdown of GSK3\u00CE\u00B1 reduced \u00CE\u00B3-secretase activity, but GSK3\u00CE\u00B2 did not have any effect. In our study, we found that in a system where \u00CE\u00B3-secretase activity was pharmacologically inhibited, GSK3\u00CE\u00B1 knockdown did not have any significant effect on APP processing. On the other hand, GSK3\u00CE\u00B2 knockdown with inhibition of \u00CE\u00B3-secretase activity reduced the GSK3\u00CE\u00B2 regulates BACE1 expression 90 level of the C99 fragment, indicating that BACE1 activity is affected. We further provided evidence that knocking down GSK3\u00CE\u00B2 reduced BACE1 mRNA levels, but knocking down GSK3\u00CE\u00B1 did not affect BACE1 expression. Previous genetic studies have found GSK3\u00CE\u00B1 could not compensate for the loss of GSK3\u00CE\u00B2, as the GSK3\u00CE\u00B2 KO phenotype is embryonically lethal while GSK3\u00CE\u00B1 KO mice are viable (Hoeflich et al., 2000). This argues that GSK3\u00CE\u00B1 and GSK3\u00CE\u00B2 isoforms may have distinct cellular functions with respect to BACE1 expression. Moreover, GSK3\u00CE\u00B2 is the predominant isoform in the brain, and therefore has been implicated in many CNS disorders (Leroy and Brion, 1999). Recently Jaworski et al. (2011) reported no significant effect on A\u00CE\u00B2 production in the tissue-specific GSK3\u00CE\u00B1/\u00CE\u00B2 knockout mice (Jaworski et al., 2011). This could be due to a physiological compensation of BACE1 expression in the KO mice compared to the acute effect of the GSK3 inhibitor. Additionally our data showed that GSK3\u00CE\u00B2 regulated NF\u00CE\u00BAB-mediated BACE1 expression. GSK3\u00CE\u00B1 KO, however, has no effect on NF\u00CE\u00BAB signaling (Hoeflich et al., 2000). Taken together, these studies suggest that GSK3 isoforms have distinct roles in regulating APP processing. Epidemiological and experimental studies have suggested a significant inflammatory component in AD (Akiyama et al., 2000; Eikelenboom et al.; Matsuoka et al., 2001; Szekely et al., 2004). The detrimental role of astrocytes and microglia during neuroinflammation remains controversial. However, the release of cytokines has been shown to contribute to inflammatory responses in the brain and to induce neurodegenerative changes. Several pro-inflammatory cytokines including the interleukins and TNF have been found to activate GSK3\u00CE\u00B2. Moreover, GSK3 inhibitors were also found to have anti-inflammatory effects and prevent inflammation-induced neuronal toxicity (Beurel and Jope, 2008, 2009b; Yuskaitis and Jope, 2009). GSK3\u00CE\u00B2 regulates BACE1 expression 91 The chronic inflammatory response induced by A\u00CE\u00B2 may depend on transcription factors to exert neurodegenerative effects. Regulation of transcription factor NF\u00CE\u00BAB and its transcriptional activity may in part play a role in A\u00CE\u00B2-mediated neurodegeneration (Chen et al., 2011b; Yankner et al., 1990). It has been previously reported that the BACE1 promoter contains NF\u00CE\u00BAB binding elements (Bourne et al., 2007; Chen et al., 2011b), and exacerbated A\u00CE\u00B2 levels modulate the rat BACE1 promoter activity via NF\u00CE\u00BAB-dependent pathways (Buggia-Prevot et al., 2008). More recently, Chen et al. (Chen et al., 2011b) found increased NF\u00CE\u00BAB p65 and BACE1 expression in postmortem AD brains. Furthermore, overexpression of NF\u00CE\u00BAB p65 was found to increase the human BACE1 promoter activity, whereas inhibiting NF\u00CE\u00BAB signaling reduced BACE1 expression (Chen et al., 2011b). In this study, we found that inhibiting GSK3\u00CE\u00B2 activity by using GSK3\u00CE\u00B2-KO cells or AR-A014418 treatment reduced BACE1 promoter activity and gene expression. Moreover, disrupting NF\u00CE\u00BAB expression also blocked GSK3\u00CE\u00B2-induced BACE1 transcription. Exogenous application of A\u00CE\u00B2 has been found to increase GSK3\u00CE\u00B2 activity and NF\u00CE\u00BAB levels (Barger and Mattson, 1996; Koh et al., 2008). There are many reports suggesting that GSK3\u00CE\u00B2 regulates gene transcription in an NF\u00CE\u00BAB-dependent manner (Hoeflich et al., 2000; Steinbrecher et al., 2005; Takada et al., 2004). Moreover NF\u00CE\u00BAB is selective to the set of specific genes that it promotes transcription under inflammatory conditions (Steinbrecher et al. 2005). Mechanistically, we argue that the GSK3\u00CE\u00B2-NF\u00CE\u00BAB signaling pathway is involved in regulating BACE1 gene transcription. Furthermore, NF\u00CE\u00BAB provides the selectivity and specificity of GSK3\u00CE\u00B2\u00E2\u0080\u0099s effect on BACE1 transcription. GSK3\u00CE\u00B2 regulates BACE1 expression 92 BACE1 mediates the first cleavage of APP in the amyloidogeneic pathway, which then allows \u00CE\u00B3-secretase to cleave the CTF to release A\u00CE\u00B2. Therefore, interfering with BACE1 activity will affect APP processing and A\u00CE\u00B2 production. In fact, even a partial reduction of BACE1 can have dramatically beneficial effects on AD pathology (McConlogue et al., 2007), suggesting that inhibition of BACE1 is a valid therapeutic target for AD treatment. Further supporting this argument is that BACE1 knockout mice have abolished A\u00CE\u00B2 generation (Cai et al., 2001; Luo et al., 2001; Roberds et al., 2001). Moreover, suppression of BACE1 by RNA interference reduced APP processing and A\u00CE\u00B2 production in primary cortical neurons derived from both wildtype and the Swedish APP mutant transgenic mice (Kao et al., 2004), and disruption of the BACE1 gene rescued memory deficits and cholinergic dysfunction in the Swedish APP mice (Ohno et al., 2004). Additionally oral administration of a potent and selective BACE1 inhibitor decreased \u00CE\u00B2- cleavage and A\u00CE\u00B2 production in APP transgenic mice in vivo (Hussain et al., 2007). It should be noted that complete ablation of BACE1 activity is not without concerns. Engineered mice with both copies of the BACE1 gene deleted manifest behavioral dysfunctions that mimic some aspects of human neurological problems. For example, BACE1-KO mice were reported to display hypomyelination of peripheral nerves and aberrant axonal segregation (Hu et al., 2006; Willem et al., 2006). Subsequent reports also found that BACE1-KO mice have deficits with the induction of long-term potentiation, but are more prone to seizure attacks due to perturbed sodium channel activity. Seshadri et al. (2010) also reported that BACE1-KO mice possess some schizophrenia-like phenotypes as monitored in a battery of behavioral tests. In sum, complete ablation of \u00CE\u00B2- secretase results in many unwanted collateral effects. However, strategies that modulate BACE1 activity will still be beneficial in situations where BACE1 GSK3\u00CE\u00B2 regulates BACE1 expression 93 activity and expression are abnormally high, as seen in sporadic AD cases. Moreover, the ability to control duration and amount of BACE1 activity suppression may prevent some of the side effects observed in BACE1-KO mice. 3.5 Conclusions In conclusion, we have found that the GSK3\u00CE\u00B2-NF\u00CE\u00BAB signaling pathway regulates BACE1 transcription and thereby facilitates A\u00CE\u00B2 production in AD. Since GSK3\u00CE\u00B2 and NF\u00CE\u00BAB are involved in AD pathogenesis, our results suggest that direct interference of this pathway may be a promising drug target for AD therapy. 94 Chapter 4: Specific inhibition of GSK3 as a therapeutic strategy for treating Alzheimer\u00E2\u0080\u0099s disease Chapter 4 Specific inhibition of GSK3 as a therapeutic strategy for treating Alzheimer\u00E2\u0080\u0099s disease 4.1 Introduction The current therapeutics for AD provided only marginal benefit at attenuating cognitive deficits by increasing acetylcholine levels. Unfortunately, this type of therapy does not stop progressive neuritic dystrophy and neuronal damage. Over time anti-cholinesterase inhibitors become ineffective. Therefore it is imperative to develop agents that would delay or reverse the progression of AD. Until quite recently, strategies to treat AD involved targeting amyloid formation, tau hyperphosphorylation, or maintaining neuronal integrity. There is, however, no direct clinical and experimental evidence to show how all these neuropathologies are interrelated. Recent studies have suggested that GSK3 is a common molecular link between these classic AD pathologies (Hooper et al., 2008). Preclinical studies have demonstrated that GSK3 inhibition alleviated amyloid burden, prevented NFT formation, and protected against neurodegeneration in various animal models of AD (Hu et al., 2009; Noble et al., 2005; Qing et al., 2008; Spittaels et al., 2000; Su et al., 2004). These observations argue for elevated GSK3 activity in AD brains. However, there is no direct evidence to show that GSK3 activity is increased in AD brains, mainly because measuring enzymatic activity in postmortem tissue is technically difficult. The alternative option is to Targeting GSK3 for treating AD 95 indirectly probe for phosphorylation changes, which are indicative of GSK3 activity. From a drug discovery standpoint, it is important to evaluate the clinical benefits of GSK3 inhibition while monitoring potential toxic side effects. Mice with genetic deletion of one or two copies of GSK3\u00CE\u00B1 or GSK3\u00CE\u00B2 have been shown to have locomotor dysfunction, anxiety, and reduced social interaction. In some studies, GSK3\u00CE\u00B1-/- or GSK3\u00CE\u00B2+/- mice have impeded memory functions. Therefore, complete ablation of GSK3 may not be the best approach to therapeutically treat AD. Acute inhibition of GSK3 with the SB216763 compound in normal animals has been shown to trigger neurodegenerative events including memory loss. Several reasons could explain this effect: the dosage was too high, SB216736 is toxic in nature with collateral effects other than inhibiting GSK3, or SB216763 is a relatively non-selective inhibitor of GSK3. In this chapter, we would like to examine whether GSK3 activity is changed in AD patients. We chose to examine GSK3 activity indirectly using a set of antibodies recognizing the phosphorylation sites on GSK3. In order to validate the efficacy of GSK3 inhibition with AR-A014418 on the APP processing cascade in vivo, we performed immunohistochemical staining for detecting plaques and activation of immune cells. Additionally, a battery of behavioral analyses was used to assess cognitive and locomotor activity in AR-A014418-treated mice. 4.2 Methods 4.2.1 Materials Neurobasal medium, fetal bovine serum, zeocin, and B27 supplement were purchased from Life Sciences Technologies. AR-A014418 was purchased from Targeting GSK3 for treating AD 96 EMD Biosciences. Rabbit anti-phospho GSK3\u00CE\u00B2S9 antibody, rabbit anti-phospho GSK3\u00CE\u00B1S21, rabbit anti- GSK3\u00CE\u00B1, and rabbit anti-GSK3\u00CE\u00B2 were purchased from Cell Signaling Technologies. Rabbit anti-phospho GSK3\u00CE\u00B1Y279/GSK3\u00CE\u00B2Y216 was purchased from Biosource International Inc. Mouse anti-\u00CE\u00B2-tubulin II and mouse anti-GSK3\u00CE\u00B1/\u00CE\u00B2 were purchases from Biosource International Inc. Rabbit anti- GFAP was purchased from Chemicon. Rabbit anti-Iba-1 was purchased from DAKO. Swine anti-rabbit biotinylated secondary antibody was purchased from WAKO. DAB and ABC kits were purchased from Vectorlabs. MTT tetrazolium salt was purchased from Sigma. LDH reagents were purchased from Promega. A\u00CE\u00B21-42 peptides were commercially synthesized. 4.2.2 Cell culture, preparation of A\u00CE\u00B2 fibrils, and cell viability assay Primary cortical neurons were extracted from C57/BL6 wildtype mice at embryonic day 14 as indicated in section 2.2.4. At DIV7, the neurons were treated with A\u00CE\u00B2. Synthetic A\u00CE\u00B21-42 was dissolved in sterile deionized water to a final concentration of 1 mM and allowed to incubate at 37\u00C2\u00B0C for 1 hour. The dissolved A\u00CE\u00B2 was then diluted with equal volumes of sterile PBS to 0.5 mM, aliquot and stored at -80\u00C2\u00B0C until use. To age the A\u00CE\u00B21-42 fibrils, an aliquot of 0.5 mM A\u00CE\u00B2 was thawed and placed in the 37\u00C2\u00B0C incubator for 4 days. The A\u00CE\u00B21-42 fibrils could be visualized under 40X magnification. The fibrils were dissociated by vigorously triturating and further diluted with complete DMEM to the appropriate concentration. In this chapter, primary cortical neurons were treated with 50 nM of A\u00CE\u00B2 for 18 h. To assess cell viability, the cells were replenished with new cell culture media with added MTT. The cells were replaced into a 37\u00C2\u00B0C incubator for 4 hours. The media were then removed via aspiration and 100% DMSO was added to dissolve the tetrazolium product. The colorimetric intensity was Targeting GSK3 for treating AD 97 analyzed by a spectrophotometer at a wavelength of 540 nm. The LDH assay was also used to assess the extent of cell death induced by A\u00CE\u00B2 treatment. 4.2.3 Human brain tissues Frozen control and AD human cortices were obtained from the Department of Pathology, Columbia University. These samples were used for immunoblotting experiments to examine the activity levels of GSK3. Table 4.1 Human brain tissues for analysis of GSK3 activity in Alzheimer's disease. Code Group Gender Age (years) Use Brain Area Source 1751 AD M 76 IB Fc Columbia University 1780 AD M 72 IB Fc Columbia University 4512 AD M 77 IB Fc Columbia University 4556 AD F 70 IB Fc Columbia University 4693 AD F 70 IB Fc Columbia University 4759 AD F 77 IB Fc Columbia University 4833 AD F 59 IB Fc Columbia University 4854 AD M 54 IB Fc Columbia University M3652M Control M 66 IB Fc Columbia University 4789 Control F 72 IB Fc Columbia University 1213 Control M 67 IB Fc Columbia University 1170 Control M 58 IB Fc Columbia University 4263 Control M 61 IB Fc Columbia University 1569 Control F 77 IB Fc Columbia University 1452 Control F 71 IB Fc Columbia University Abbreviations: AD, Alzheimer\u00E2\u0080\u0099s disease; M, male; F, female; IHC, immunohistochemistry; IB, Immunoblotting, Ctx, cortex; Fc, frontal cortex 4.2.4 Transgenic APP23/PS45 mice and AR-A014418 treatment In this study, the APP23/PS45 double transgenic AD mouse model was used to study the therapeutic potential of GSK3 inhibition on treating AD pathologies. The genotypes of the mice were confirmed by PCR using DNA from tail tissues as indicated in section 2.2.3. APP23/PS45 mice double transgenic for the human APPSwedish mutant gene (Sturchler-Pierrat et al., 1997; Sturchler-Pierrat and Staufenbiel, 2000) and human presenilin-1gene with the G384A mutation (Qing et al., 2008) mice were injected with 5 mg/kg AR-A014418 diluted in 0.9% saline daily via the intraperitoneal route at the same time each day for a total of 4 weeks. Targeting GSK3 for treating AD 98 Control mice were injected with DMSO diluted in 0.9% saline as a vehicle. Both male and female mice were randomly assigned for ARA-treatment (N=14) and sham-treatment (N=12). We tabulated daily food consumption and weight for each mouse. 4.2.5 The Morris water maze test The Morris water maze test was carried out as previously indicated in 2.2.9. Briefly, 24 h after the last dose of ARA treatment, mice were subjected to the Morris water maze test to assess changes in working memory functions. The first day of the test was a visible platform test, followed by 4 days of hidden platform testing, and a probe trial on the last day. Escape latency, distance traveled, and the number of times passing through the removed platform (probe trial) were recorded. 4.2.6 The open field test The open field test occurred in an empty box arena that is 40 cm x 40 cm x 35 cm. The arena is black colored with infrared-transparent Perplex walls. The apparatus was calibrated to include an inner zone defined as 6 cm from the walls. The mice were placed in a corner of the arena one at a time and were tracked using ANY- Maze Video Tracking Software for 5 minutes each. The distance traveled was analyzed as a measure of motor ability. The number of entries into the inner zone and the time spent in the inner zone were taken as measures of anxiety. 4.2.7 Immunohistochemistry Mouse half brains were fixed in 4% paraformaldehyde followed by 30% sucrose solution. The mouse brains were sectioned in O.C.T.-embedded blocks and collected in D\u00E2\u0080\u0099Olomos solution (1% polyvinylpyrrolidone, 30% ethylene glycol, Targeting GSK3 for treating AD 99 PBS). Neuritic plaques were detected using a biotinylated 4G8 antibody and thioflavin S staining as previously indicated. To determine the extent of astrocytosis, an antibody recognizing GFAP was used to stain the sections. Immunostaining with Iba-1 antibody was used to detect microglia. The number of astrocytes and microglia were quantified manually using 6-8 sections spaced at 100 \u00C2\u00B5m intervals. The number of GFAP- positive and Iba-1-positive cells was counted and an averaged number was calculated per animal. 4.2.8 Immunoblotting Frozen human cortices were obtained from Columbia University. A piece of the cortex about 10 mg was homogenized with RIPA-DOC lysis buffer supplemented with 200 mM sodium orthovanadate, 25 mM \u00CE\u00B2-glycerophosphate, 20 mM sodium pyrophosphate, 30 mM sodium fluoride, 1 mM PMSF, and 1 complete mini protease inhibitor cocktail tablet (Roche Diagnostics). The samples were then centrifuged at 13,200 rpm at 4\u00C2\u00B0C for 30 minutes. The supernatants were removed and added to 4X SDS-PAGE buffer followed by boiling at 100\u00C2\u00B0C for 5 minutes. To detect GSK3 isoforms, the samples were resolved in 12% tris-glycine gels and transferred to PVDF-FL membranes. The membranes were blocked with 5% milk and incubated with GSK3 primary antibodies. To detect total GSK3 \u00CE\u00B1/\u00CE\u00B2, IDye680-labeled goat anti-rabbit antibody was used. To detect the phosphorylated forms of GSK3\u00CE\u00B1/\u00CE\u00B2, goat anti-rabbit secondary antibody conjugated with horseradish peroxidase was used. The blots were either scanned using the Odyssey Imager (LI-COR Biosciences) or developed using enhanced chemiluminescence with film. Targeting GSK3 for treating AD 100 4.3 Results 4.3.1 Increased GSK3 signaling in AD brains Since GSK3 plays important roles in AD pathogenesis, one would expect that GSK3 is aberrantly regulated in AD brains. To examine the possibility of aberrant regulation of GSK3 in AD, we performed immunoblot analyses to detect the phosphorylation status of GSK3. The expression levels of GSK3\u00CE\u00B1 (100.0\u00C2\u00B110.0% vs 94.8\u00C2\u00B111.4%; p>0.05) and GSK3\u00CE\u00B2 (100.0\u00C2\u00B117.6% vs 94.9\u00C2\u00B19.9%; p>0.05) were not significantly different between AD and control cases (Fig 4.2 A,B). Furthermore, phosphorylation of GSK3\u00CE\u00B1-Y279 (100.0\u00C2\u00B147.7% vs 172.3\u00C2\u00B145.5%; p>0.05) and GSK3\u00CE\u00B2-Y216 (100.0\u00C2\u00B120.9% vs 175.9\u00C2\u00B147.5%; p>0.05) (Fig 4.2 E,F) were also not significantly different between the two groups. However, GSK3\u00CE\u00B1 - S21 and GSK3\u00CE\u00B2-S9 phosphorylation were significantly reduced to 35.7\u00C2\u00B17.4% and 37.9\u00C2\u00B17.6%, respectively (Fig 4.2 C,D; p<0.01). These data indicates that a regulatory mechanism that inhibits GSK3\u00CE\u00B1/\u00CE\u00B2 is dysfunctional in AD, which leads to increased GSK3 activity. Targeting GSK3 for treating AD 101 Figure 4.1 Increased GSK3 activity in AD brain. Indirect measure of GSK3 activity in human AD patients using immunoblot analyses. Equal amount of protein were resolved onto a 12% tris-glycine gel. (A) Total expression of GSK3\u00CE\u00B1 and (B) GSK3\u00CE\u00B2 were detected using antibodies recognizing anti-GSK3\u00CE\u00B1/\u00CE\u00B2. The expression levels of GSK3\u00CE\u00B1 and GSK3\u00CE\u00B2 did not differ between the AD and control groups. (C,D) GSK3 activity was indirectly assessed using phospho-serine 21/9- GSK3\u00CE\u00B1/\u00CE\u00B2 and phospho-tyrosine 279/216-GSK3\u00CE\u00B1/\u00CE\u00B2 antibodies. Phosphorylation at the inhibitory serine 21/9 sites on GSK3\u00CE\u00B1/\u00CE\u00B2 was significantly reduced in AD cases, indicating increased GSK3\u00CE\u00B1/\u00CE\u00B2 activity. (E,F) Phosphorylation at the tyrosine sites was not significantly different between the AD and control groups. Immunoblot for \u00CE\u00B2-actin served as the loading control. AD and control groups contain N=5-7. Student\u00E2\u0080\u0099s t-test **p<0.01. 4.3.2 GSK3 inhibition reduces neuritic plaque formation in the AD model mice To examine the specific effect of GSK3 signaling on AD pathogenesis, we treated APP23/PS45 double transgenic mice with ARA. The double transgenic mice develop detectable neuritic plaques in the neocortex and hippocampus as early as 1 month of age. The mice were treated with 5 mg/kg ARA at six weeks of age daily for 4 weeks, while age-matched control mice received vehicle solution. 4G8 immunostaining and thioflavin-S staining were used to detect A\u00CE\u00B2-containing Targeting GSK3 for treating AD 102 neuritic plaques in the brains (Ly et al., 2011) (Fig. 4.3). ARA treatment significantly decreased the number of neuritic plaques in the transgenic mice relative to the vehicle-injected group (Fig. 4.3 Aa and b). Quantification showed that overall ARA treatment reduced plaque number by approximately 50% (23.8\u00C2\u00B14.7 vs. 10.4\u00C2\u00B11.3 per slice, p<0.01) (Fig. 4.3 B). Thioflavin-S staining also confirmed that ARA treatment significantly reduced the A\u00CE\u00B2-containing neuritic plaques in the brains of APP23/PS45 double transgenic mice (Fig. 4.3 Ac and d). The inhibitory effect of ARA was reversible and the treated mice had similar plaque numbers as the control mice when examined 3 months after the end of the drug treatment (36.5\u00C2\u00B15.1 vs. 32.1\u00C2\u00B14.2, p>0.05) (Fig. 4.3 C and D). During the 4 week injection period, ARA treatment did not affect food consumption of the mice and no significant weight changes (Fig 4.4A) were observed between the treatment and control groups. Targeting GSK3 for treating AD 103 Figure 4.2 AR-A014418 treatment significantly reduces neuritic plaque formation in AD transgenic mice. (A) APP23/PS45 double transgenic mice at the age of 6 weeks were treated with AR-A014418 (5 mg/kg) for four weeks, while age-matched control APP23/PS45 mice received the vehicle solution. The mice were sacrificed after behavioral tests and the brains were dissected, fixed and sectioned. Neuritic plaques were detected using an A\u00CE\u00B2-specific monoclonal antibody and the DAB method. The plaques were visualized by microscopy with 40X magnification. The number of neuritic plaques was significantly reduced in AR-A014418 treated mice compared to controls. Panels A,a and A,b are the representative brain sections of the control and AR-A014418-injected APP23/PS45 mice sacrificed immediately after behavioral analysis. Panels C,a and C,b are representative brain sections of APP23/PS45 mice sacrificed three months after the last vehicle solution or AR-A014418 injection. Black arrows point to plaques. Bars: 500 \u00C2\u00B5m. (B) Quantification of neuritic plaques in APP23/PS45 mice with treatment starting at the age of 6 weeks and sacrificed immediately after behavioral analysis. The number represents mean\u00C2\u00B1SEM, N=22 mice total, * p<0.01 by student\u00E2\u0080\u0099s t-test. (D) Quantification of neuritic plaques in APP23/PS45 mice 3 months after the last injection. The number represents mean\u00C2\u00B1SEM, N=12 mice total, p>0.05 by student\u00E2\u0080\u0099s t-test. (A, c and A,d). Neuritic plaques were further confirmed using thioflavin S fluorescent staining and visualized by microscopy with a 40X objective. There were fewer neuritic plaques in AR-A014418-treated mice (d) as compared to age-matched control mice (c) sacrificed immediately after AR-A014418 injection. White arrows point to green fluorescent neuritic plaques. Bar: 500\u00C2\u00B5m. Targeting GSK3 for treating AD 104 4.3.3 Inhibition of GSK3 improves memory deficits in the AD model mice To investigate whether GSK3 inhibition by ARA treatment affects the memory deficit in AD pathogenesis, the Morris water maze was used to test spatial memory after APP23/PS45 mice received one month of ARA treatment (Bromley-Brits et al., 2011). In the visible platform tests, ARA-treated and control APP23/PS45 mice had similar escape latency (42.4\u00C2\u00B14.3 s and 44.8\u00C2\u00B12.7 s, p>0.05) (Fig. 4.4A) and path length (6.6\u00C2\u00B10.7 m and 6.1\u00C2\u00B10.5 m, p >0.05) (Fig. 4.4B), indicating that ARA treatment did not affect mouse mobility or vision. In the hidden platform test, ARA-treated rats showed significant improvements as compared to the vehicle-treated controls. The escape latency on the 3rd and 4th day of the hidden platform test was shorter (12.0\u00C2\u00B11.6 s and 17.4\u00C2\u00B13.1 s) than sham- treated mice (23.8\u00C2\u00B14.0 s and 24.9\u00C2\u00B12.7 s) (p< 0.05, Fig. 4.4C). The ARA-treated mice swam significantly shorter distances to reach the platform (2.9\u00C2\u00B10.7 m and 3.2\u00C2\u00B10.3 m) as compared to control mice (3.7\u00C2\u00B10.6 and 4.2\u00C2\u00B10.5m) on the 3rd and 4th day (p<0.05, Fig. 4.4D). In the probe trial on the last day of testing, the platform was removed. ARA treatment significantly improved the spatial memory in the APP23/PS45 mice. The number of times the mice traveled into the third quadrant, where the hidden platform was previously placed, was significantly greater with ARA treatment as compared to control (6.0\u00C2\u00B11.0 and 2.0\u00C2\u00B11.2 times, p<0.05) (Fig. 4.4E). These data demonstrate that inhibition of GSK3 signaling significantly improves the memory deficits seen in the AD model mice. Targeting GSK3 for treating AD 105 Figure 4.3 AR-A014418 improves memory deficits in AD transgenic mice. The Morris water maze test consists of one day of visible platform trials and 4 days of hidden platform trials, plus a probe trial 24 hr after the last hidden platform trial. Animal movement was tracked and recorded by the ANY-maze tracking software. APP23/PS45 mice at 6 weeks were injected daily for one month with AR-A014418 or a vehicle solution and subjected to the Morris water maze test (N=22 mice total). (A) During the first day of visible platform tests, the AR- A014418-treated and control APP23 mice exhibited a similar latency to escape onto the visible platform. p>0.05 by student\u00E2\u0080\u0099s t-test. (B) The AR-A014418-treated and control APP23/PS45 mice had similar swimming distances before escaping onto the visible platform in the visible platform test. p>0.05 by student\u00E2\u0080\u0099s t-test. (C) In hidden platform tests, mice were trained with 5 trials per day for four days. AR-A014418-treated APP23/PS45 mice showed a shorter latency to escape onto the hidden platform on the 3rd and 4th day, * p<0.05 by Tukey\u00E2\u0080\u0099s Post hoc analysis. (D) The AR-A014418-treated APP23 mice had a shorter swimming length before escaping onto the hidden platform on the 3rd and 4th day, * p< 0.05 by Tukey\u00E2\u0080\u0099s post hoc analysis. (E) In the probe trial on the 6th day, the AR-A014418-treated APP23/PS45 mice traveled into the third quadrant, where the hidden platform was previously placed, significantly more times than controls. The values are expressed as mean\u00C2\u00B1S.E.M.* p<0.05 by student\u00E2\u0080\u0099s t-test. Genetic deletion of either GSK3\u00CE\u00B1 or GSK3\u00CE\u00B2 in mice causes locomotor dysfunction, anxiety, and lack of social interaction. Furthermore, infusion of a solution containing GSK3 inhibitor into the hippocampi of normal, healthy mice triggers neurodegenerative changes (Hu et al., 2009). Therefore, we would like to examine whether GSK3 inhibition with the ARA compounds would induce motor deficits, anxiety, and neurodegeneration. The open field test was used to assess whether GSK3 inhibition with the ARA compound induced locomotor Targeting GSK3 for treating AD 106 dysfunction and anxiety in APP23/PS45 mice. In the open field test, the total distance travelled was 13.9\u00C2\u00B11.8 m and 13.1\u00C2\u00B10.7 m for control and ARA-treated mice, respectively. This indicates that APP23/PS45 mice treated with ARA did not have any locomotor dysfunctions. There was also no difference in the number of entries into the inner zone (18.2\u00C2\u00B13.4 vs. 21.6\u00C2\u00B12.6; p>0.05). Although the time spent inside the inner arena did not reach statistical significance, a trend that ARA-treated mice spent more time in the inner arena was observed (41.8\u00C2\u00B110.6 s vs. 53.2\u00C2\u00B19.99 s; p>0.05). Taken together, our data indicate that GSK3 inhibition with ARA rescued memory deficits, but did not promote locomotion deficits and anxiety behaviors in APP23/PS45 mice. Figure 4.4 GSK3 inhibition did not affect weight changes and anxiety behaviors in double transgenic mice. The weights of each mouse were recorded weekly at roughly the same time. The pharmacological inhibitor was administered on week 1. There were no differences in average weights between the treatment and control group. Anxiety behavior and locomotion were assessed using the open field test. The number of entries and time spent in the inner zone were taken as measures of anxiety. (B) GSK3 inhibition did not affect general mobility of APP23/PS45 mice (p>0.05). (C,D) No significant differences were seen in anxiety behaviors in APP23/PS45 mice with GSK3 inhibition. Student\u00E2\u0080\u0099s t-test p>0.05. n=7 per group for ARA group and N=5 control group. Targeting GSK3 for treating AD 107 4.3.4 GSK3 inhibition reduces gliosis in APP23/PS45 mice Previous findings indicated that GSK3 inhibition protected against A\u00CE\u00B2-induced neuronal loss, NFT formation, and gliosis in rat brains. Conversely, ablation of GSK3 activity in healthy, normal mice triggered neurodegeneration. To assess whether GSK3 inhibition in the ARA-treated APP23/PS45 mice have any cytotoxic features, we performed cresyl violet staining to observe gross morphology and neuronal integrity. The cortex, CA1, and CA3 regions were examined. We did not observe any gross anatomical differences after GSK3 inhibition. Neuroinflammation is one of the pathological events that occur during AD pathogenesis, which usually involves activation and proliferation of microglia and astrocytes. GSK3 inhibition did not change the number of Iba-1-positive cells, a marker of microglia (Fig 4.6 B). The number of microglia in the control group was 32\u00C2\u00B12 cells compared to 29\u00C2\u00B12 cells in the ARA-treated group (Fig 4.6 C). In contrast, with GSK3 inhibition the number of GFAP-positive cells was reduced to 106\u00C2\u00B113.2 cells as compared to 172\u00C2\u00B118.6 cells in the control group (p<0.05) (Fig 4.6 D). Further confirming this finding, using western blot analysis we showed that GFAP, a marker of astrocytes (Fig 4.6 E), was significantly reduced to 57.0\u00C2\u00B14.8% of the control (p<0.05) (Fig 4.6 F). Targeting GSK3 for treating AD 108 Figure 4.5 GSK3 inhibition reduced gliosis in AD model mice. APP23/PS45 double transgenic mice at the age of 6 weeks were treated with AR-A014418 (5 mg/kg) or a vehicle solution for an additional 4 weeks. (A) Cresyl violet staining of brain sections to indicate gross neuronal morphology. GSK3 inhibition did not affect gross anatomy and general neuronal morphology. (B) Representative image of microglia stained with anti-Iba-1 antibody. Iba-1-positive staining were visualized under 40X microscopy and quantified. (C) GSK3 inhibition did not affect the microglial counts in APP23/PS45 mice. (D) Representative image of astrocytes indicated with anti-GFAP staining. Visualization and quantification of GFAP-positive cells were performed under 20X microscopy. (E) GSK3 inhibition reduced the number of GFAP- positive cells. (F,G) GFAP expression in the brains of ARA-treated APP23/PS45 mice was significantly reduced as compared to the vehicle-treated controls. The number of Iba-1 and GFAP positive cells were counted from roughly 6 random areas per slice were sampled with a total of 8- 10 slices per animals. The quantified data represents mean\u00C2\u00B1SEM. Bar indicates 100 \u00C2\u00B5m. There were 5-7 animals per group. *p<0.05; **p<0.01 by Student\u00E2\u0080\u0099s t-test. Targeting GSK3 for treating AD 109 4.3.5 Inhibition of GSK3 protects against A\u00CE\u00B2-induced neurotoxicity The oligomeric A\u00CE\u00B2 peptide has been implicated as the culprit of neurodegeneration in AD. Previous studies have demonstrated that GSK3 inhibition using lithium chloride and SB 216367 prevented A\u00CE\u00B2 toxicity. To further confirm this effect, mouse primary cortical neurons at DIV7 were exposed to 50 nM A\u00CE\u00B2 for 18 h with/without GSK3 inhibition using 5 \u00C2\u00B5M ARA. The cells were then stained with \u00CE\u00B2-tubulin III to mark the neuronal processes, an indicator of neuronal integrity. The control cells received only DMSO (Fig 4.7 Aa). We showed that 50 nM A\u00CE\u00B2 treatment induced cell death and loss of neuronal processes (Fig 4.7Ab). In Fig 4.7 Ac, we show that 30 min ARA pretreatment protected against neuronal loss and process degeneration induced by A\u00CE\u00B2. Figure 4.6 GSK3 inhibition protects against A\u00CE\u00B2-induced cell death. Primary cortical neurons at DIV 7 were treated with 50 nM A\u00CE\u00B2 for 18 h with or without 5 \u00C2\u00B5M ARA. Control cells received DMSO only. (A) \u00CE\u00B2-tubulin III staining to indicate soma and neuronal processes after A\u00CE\u00B2 treatment. Morphologically, control neurons have long, extended processes (a) whereas A\u00CE\u00B2-treatment resulted in shortened, segmented processes in addition to cell loss (b). GSK3 inhibition with ARA partially preserved neuronal integrity as see in the \u00CE\u00B2-tubulin III Targeting GSK3 for treating AD 110 staining (c). (B) MTT assay and (C) LDH assay of primary cortical neurons at DIV7 that were subjected to A\u00CE\u00B2 with or without ARA. Both assays indicate that A\u00CE\u00B2 treatment is neurotoxic to primary neurons, but this effect could be ameliorated with GSK3 inhibition. Bar indicates 100 \u00C2\u00B5m. Data presented as mean\u00C2\u00B1SEM. One-way ANOVA with Tukey\u00E2\u0080\u0099s post hoc test. *p<0.05; ** p<0.01. To further confirm the neurotoxic effects of A\u00CE\u00B2, we use two types of biochemical assays to assess the extent of A\u00CE\u00B2-induced neural cell death. Using the MTT proliferation assay, A\u00CE\u00B2 treatment reduced cell viability to 56.3\u00C2\u00B14.7 % as compared to the control (100\u00C2\u00B16.8%, One-way ANOVA followed by Tukey\u00E2\u0080\u0099s post hoc, p<0.05). GSK3 inhibition rescued the effect of A\u00CE\u00B2 on neuronal cell death to 83.7\u00C2\u00B15.9% of the control group (One-way ANOVA followed by Tukey\u00E2\u0080\u0099s post hoc, p<0.05) (Fig 4.7 B). Using the LDH release assay, we showed that A\u00CE\u00B2 induced cell death, which was arbitrarily normalized to 100% cell death. The control cells have about 20% cell death as compared to the A\u00CE\u00B2-treated group (21.6\u00C2\u00B12.0 vs 100\u00C2\u00B11.5%; one-way ANOVA followed by Tukey\u00E2\u0080\u0099s post hoc, p<0.01). The percentage of cell death with GSK3 inhibition is 67.5\u00C2\u00B11.5% (one- way ANOVA, p<0.05) as assayed for LDH release. In summary, we found that A\u00CE\u00B2-induced cell death in primary cortical neurons can be ameliorated by GSK3 inhibition. 4.4 Discussion To date, there is no satisfactory treatment for patients with AD. Commonly used preventive measures that could delay disease progression include therapy with anti-cholinesterase inhibitors such as donepezil and rivastigmine. More recently, the use of memantine, an N-methyl-D-aspartate (NMDA) receptor antagonist, has been shown efficacious in treating moderate AD. The use of these preventative measures does not treat the pathological events and could not reverse the disease. Moreover, these drugs will typically lose efficacy over a period of several years. Targeting GSK3 for treating AD 111 Therefore, alternative approaches are almost certainly going to be necessary for the effective treatment of this devastating and costly condition. Since aberrant GSK3 signaling has been shown to play pivotal roles in AD pathogenesis, the use of GSK3 inhibitors would open a new avenue for therapeutic intervention of AD. In this chapter, we found that GSK3 inhibition rescued learning and memory deficits, while suppressing neuritic plaque formation and gliosis. Moreover, GSK3 inhibition protected against A\u00CE\u00B2-induced neurotoxicity in primary neuronal cultures. The evidence that GSK3 plays a central role in AD pathology raises a concern of whether GSK3 activity is increased in AD. However, there is no direct data that supports this idea. The main reason could be due to technical difficulties in measuring enzymatic activity in postmortem brain tissues. Conversely, indirect evidence provided support for enhanced GSK3 in AD cases. Immunoblotting data showed that phosphorylation at the tyrosine 216 of GSK3\u00CE\u00B2 in the frontal cortex and hippocampus was significantly increased, indicating elevated GSK3\u00CE\u00B2 activity (Blalock et al., 2004; Leroy et al., 2002; Pei et al., 1999). Moreover, activated GSK3 was found to colocalize to dystrophic neurites and NFTs (Imahori et al., 1998; Yamaguchi et al., 1996). Additionally, higher GSK3 level was reported in circulating peripheral lymphocytes of AD patients compared to control subjects (Hye et al., 2005). Mateo et al. (2006) reported that GSK3\u00CE\u00B2 expression is increased in AD patients, which may be caused by a polymorphism within the promoter region of GSK3 (Mateo et al., 2006). In this chapter, we found that there is no significant change in the expression pattern and level of GSK3\u00CE\u00B1 and GSK3\u00CE\u00B2 isoforms in control and AD subjects. However, the activity of GSK3\u00CE\u00B2, as indicated by the phosphorylation status at the inhibitory serine 9 site, is significantly decreased in AD patients. Hence, less inhibition, and more activity is Targeting GSK3 for treating AD 112 observed in AD brains. This provided indirect evidence that GSK3\u00CE\u00B2 activity is elevated in AD patients. In contrast to Leroy et al. (1999) who reported increased phosphorylation at the activating tyrosine 279/216 sites for GSK3\u00CE\u00B1/\u00CE\u00B2 in AD patients as compared to controls, we did not observe any significant changes between the two groups. The variation could be partly explained by the differing immunoblot conditions between the two research laboratories. Nevertheless, the work by Leroy et al. (1999) agrees with our finding that GSK3 activity is increased in AD cases. As previously discussed in chapter 3, AR-A014418 is a highly potent small molecular GSK3 inhibitor that competes for the ATP binding site. This compound has a half-life of about 8.7 hours and readily crosses the blood brain barrier (Bhat et al., 2003; Gould et al., 2004). Previously studies have estimated that the AR- A014418 concentration in the brain per oral dosing is about 1\u00C2\u00B5mol/kg. The dosage used in our study and others are around 30 mmol/kg, much higher than those used in the pharmacokinetic studies. Therefore, the brain concentration of AR-A014418 is sufficient to inhibit GSK3 activity. However, the IC50 in vivo has not been investigated. The use of AR-A014418 to prevent NFT formation had been demonstrated in a tau transgenic mouse model of AD (Noble et al., 2005). Our study shows that AR-A014418 also reduces plaque pathology and rescues cognitive deficits in an AD mouse model. In agreement with our findings, Rockstein et al. (2004) and Sereno et al. (2009) show that using GSK3-specific inhibitors reduced A\u00CE\u00B2 burden in AD model mice and improved cognitive functions. This indicates that GSK3 inhibition could have anti-amyloid effects. However, we found that continuous AR-A014418 treatment is required to reduce plaque pathology. This may be due to the reversibility of the drug on GSK3 activity, which is an important consideration in designing drug therapy to halt Targeting GSK3 for treating AD 113 unwanted side effects. In contrast to a previous report that showed GSK3 inhibition with SB216763 in rat brains triggered neurodegenerative changes, such as loss of nissl material and formation of pyknotic nuclei (a marker of apoptosis), we did not see any morphological differences between control and treated mice. It is possible that AR-A014418 is a more potent GSK3 inhibitor than SB216763; hence the ARA compound has less toxic side effects. In addition to reduced plaque pathology, we found that GSK3 inhibition significantly improved learning and memory functions in APP23/PS45 mice. Inhibition of GSK3 activity with the ARA compound did not affect locomotion, anxiety, and weight changes. Additionally, Gould et al. (2004) reported that the ARA compound also has anti-depressant effects. In rats, administration of AR- A014418 reduced immobility time in the forced swim tests. Contrary to acute inhibition of GSK3 activity with pharmacological compounds, ablation of the GSK3\u00CE\u00B1 or a copy of the GSK3\u00CE\u00B2 gene produces KO animals with motor deficits, lack of social motivation, and higher levels of anxiety. Therefore, complete ablation would not be a feasible therapeutic strategy despite the strong effects on suppressing AD pathologies. The use of small molecule inhibitors of GSK3 will be a feasible alternative for restoring/lowering GSK3 activity, thus limiting other confounding phenotypes. There is a growing body of evidence that supports the role of inflammation in AD pathogenesis. Elevated levels of proinflammatory cytokines and activation of inflammatory cells such as microglia and astrocytes have been reported in human AD patients (Christie et al., 1996; Grundke-Iqbal et al., 1990; Joshi and Crutcher, 1998; McGeer and McGeer, 2010; Schwab et al., 2009; Stalder et al., 1999). In human AD, both microglia and astrocytes have been found to release cytotoxic Targeting GSK3 for treating AD 114 cytokines that could trigger neurodegeneration. Inflammatory reactions were also reported in swAPP transgenic mice. Massive astrogliosis detected by GFAP staining can be found in the neocortex and hippocampus (Bornemann and Staufenbiel, 2000; Sturchler-Pierrat and Staufenbiel, 2000). Microgliosis has also been observed around amyloid plaques in swAPP AD model mice (Bornemann and Staufenbiel, 2000; Sturchler-Pierrat and Staufenbiel, 2000). In this study, we found that GSK3 inhibition reduced the number of astrocytes, but had no effect on the number of microglia. We also found that GSK3 inhibition reduced GFAP expression in APP23/PS45 mice. Several studies have suggested a role of GSK3 in promoting astrocyte and microglia activation (Beurel and Jope, 2009a, b; Yuskaitis and Jope, 2009). Therefore, it is unclear why GSK3 inhibition reduced astrogliosis, but did not affect microgliosis. Further work will be required to investigate how GSK3 inhibition suppresses astrocyte activation. The A\u00CE\u00B21-42 and its variant forms are clearly neurotoxic in both in vitro and in vivo models. Previous studies have demonstrated a link between A\u00CE\u00B2 and GSK3 signaling (Alvarez et al., 1999; Hu et al., 2009; Koh et al., 2008; Takashima et al., 1998). A\u00CE\u00B2 stimulation was found to dephosphorylate the inhibitory serine residue, thereby activating GSK3 activity. Takashima and colleagues provided the first report that inhibition of GSK3 activity had neuroprotective properties. The authors showed that GSK3 inhibition with lithium chloride protected against A\u00CE\u00B2- induced neurodegeneration in cultured hippocampal neurons. Subsequent studies then demonstrated that inhibition of GSK3 with various small molecule inhibitors prevented A\u00CE\u00B2-induced cell death. By staining for \u00CE\u00B2-tubulin III to indicate the general cell morphology and MTT and LDH biochemical assays for cell viability, we confirmed that GSK3 inhibition with AR-A014418 prevented A\u00CE\u00B2-induced cell death in primary cortical neurons. It remains unclear how A\u00CE\u00B2 stimulation Targeting GSK3 for treating AD 115 triggered neurodegenerative changes and how inhibition of GSK3 could rescue this effect. It is possible that A\u00CE\u00B2 induced cell death by suppressing survival signal transduction cascades such as the PI3K-Akt pathway and/or Wnt signaling (Caricasole et al., 2004; Cedazo-Minguez et al., 2003; Dinamarca et al., 2008; Jimenez et al., 2011; Lee et al., 2009; Shruster et al., 2010; Wei et al., 2002). Both pathways mediate phosphorylation of the inhibitory serine residue of GSK3 (Cross et al., 1995; McManus et al., 2005; Zeng et al., 2005), thereby preventing cell death. In addition, we previously demonstrated that elevated GSK3\u00CE\u00B2 activity enhanced A\u00CE\u00B2 generation by increasing BACE1-mediated processing of APP. It would be interesting to speculate that in addition to acting downstream of A\u00CE\u00B2 neurotoxicity, GSK3 also influences neurodegeneration by facilitating APP processing to increase A\u00CE\u00B2 production in a feed-forward mechanism. 4.5 Conclusions In conclusion, our results indicated that GSK3 is a valid target for designing therapeutic strategies to treat AD. GSK3 activity is elevated in Alzheimer\u00E2\u0080\u0099s disease. Moreover, inhibition of GSK3 reduced amyloid production, while improving memory deficits in AD model mice. GSK3 inhibition also reduced gliosis and protected against A\u00CE\u00B2 toxicity. Taken together, our data suggests reducing GSK3 activity in AD will have beneficial clinical effects. 116 Chapter 5: Conclusions and future directions Chapter 5 Conclusions and future directions 5.1 General discussion The overall goals of this thesis were to decipher the role of GSK3 in APP processing and examine the potential of GSK3 inhibition as a therapeutic strategy for treating AD. We and other reports have demonstrated using an indirect approach that GSK3 activity is increased in AD postmortem brains. Furthermore, GSK3\u00CE\u00B2 is found to co-localize with GVD bodies and NFTs. Leroy et al. (2001) showed that it is the active form of GSK3\u00CE\u00B2 that is localized to the GVD and tangle inclusions, indicating that there is an active fraction of GSK3 with deleterious functions. An interesting question is why GSK3 would be more active in AD brains as compared to normal, healthy controls? Gathering from the data presented in this thesis, I put forward a hypothsis explaining elevated GSK3 activity in AD in section 5.1.2. Since GSK3 is central to AD pathologies, methods of inhibiting GSK3 will open therapeutic avenues for treating AD. Lithium chloride, which is used to treat bipolar disorder, has been shown to inhibit GSK3 activity. Furthermore, preclinical studies have shown that lithium chloride could reduce AD pathologies in AD transgenic mice (Alvarez et al., 1999; Noble et al., 2005; Su et al., 2004). In Chapter 2, we also showed that the anti-convulsant drug VPA could inhibit GSK3 activity and interfere with A\u00CE\u00B2 production. We also found that VPA has long lasting anti-amyloid effects in APP23 mice, which last for more than two months after the last dose of VPA. Furthermore, transgenic mice treated with Conclusions 117 VPA performed better on the Morris water maze. However, VPA treatment must be delivered at early stages of the disease, as VPA treatment in older mice with advanced plaque pathology could not rescue memory deficits. In Chapter 2, we reported data to show that VPA inhibited \u00CE\u00B3-secretase activity, thereby reducing A\u00CE\u00B2 production. Furthermore, we showed that VPA led to increased phosphorylation on the inhibitory serine residue of GSK3\u00CE\u00B2, indicating reduced GSK3\u00CE\u00B2 activity. One limitation from this study is that we could not directly show that VPA inhibition of \u00CE\u00B3-secretase is through GSK3\u00CE\u00B2. A possible strategy is to overexpress a constitutively active S9A-GSK3\u00CE\u00B2 mutant in 20E2 cells followed by VPA treatment. In the likelihood that VPA could not inhibit the activity of S9A-GSK3\u00CE\u00B2, the effect of VPA on APP processing should be blocked. However, a potential pitfall of this experiment is that S9A-GSK3\u00CE\u00B2 may induce some confounding effects masking VPA\u00E2\u0080\u0099s effect on \u00CE\u00B3-secretase. For example, in Chapter 3, S9A-GSK3\u00CE\u00B2 was found to affect C99 levels by regulating BACE1 transcription. Although VPA is effective in reducing plaque pathology in APP23 mice, VPA is a relatively poor GSK3 inhibitor. The IC50 is in the millimolar range and VPA treatment may activate a plethora of cell signaling cascades (Monti et al., 2009; Phiel et al., 2001). Using a phospho-protein screening method in mouse neuroblastoma cells, we found that VPA affects at least 4-5 other signaling pathways, in addition to inhibiting GSK3. In chapter 3, we further evaluated the specific role of GSK3 in APP processing using the potent GSK3 inhibitor, AR- A014418 (Bhat et al., 2003). This compound is highly selective for GSK3 as tested in a panel of 28 related kinases with an IC50 of 104 nM. ARA can easily Conclusions 118 penetrate the blood brain barrier and has a half-life of 8.7 h (Bhat et al., 2003; Gould et al., 2004). We found that specific GSK3 inhibition with ARA reduced BACE1 activity without affecting \u00CE\u00B3-secretase activity. Using siRNA to knockdown the GSK3\u00CE\u00B1 and GSK3\u00CE\u00B2 isoforms, we found that only the latter isoform is responsible for regulating BACE1 expression and activity. Whether ARA could differentially affect GSK3\u00CE\u00B1 and GSK3\u00CE\u00B2 has not been tested. Most of the published work only studied the effect of ARA on GSK3\u00CE\u00B2. Our work shows that ARA treatment has similar effects to GSK3\u00CE\u00B2 knockdown. In Chapter 3, we further showed that GSK3\u00CE\u00B2 regulates BACE1 transcription through NF\u00CE\u00BAB signaling. Suppression of NF\u00CE\u00BAB activity prevented GSK3\u00CE\u00B2- mediated BACE1 transcription. There is a close relationship between GSK3\u00CE\u00B2, NF\u00CE\u00BAB, and BACE1. Previous studies have shown that GSK3\u00CE\u00B2 activity is required for NF\u00CE\u00BAB signaling (Hoeflich et al., 2000; Steinbrecher et al., 2005). Suppression of GSK\u00CE\u00B2 also suppresses NF\u00CE\u00BAB activity. Interestingly, the human BACE1 promoter harbours 4 NF\u00CE\u00BAB binding sites (Chen et al., 2011a). We showed that the 4 NF\u00CE\u00BAB binding sites are responsive to S9A-GSK3\u00CE\u00B2. Furthermore, removal of RelA, an NF\u00CE\u00BAB component, completely abolished the effect of S9A-GSK3\u00CE\u00B2 on BACE1 transcription. Taken together, we put forth a novel signaling cascade, where GSK3\u00CE\u00B2 regulates NF\u00CE\u00BAB activity, which causes it to enter the nucleus and promote BACE1 transcription. In Chapter 4, we verified that GSK3 inhibition has beneficial effects on treating AD. Previous work by Spittaels et al. (2006) showed that ARA treatment reduced NFT formation in a tau transgenic mouse model. In our study, we demonstrated that GSK3 inhibition reduced neuritic plaques and improved memory functions in Conclusions 119 APP23/PS45 mice. However, these mice require continuous GSK3 inhibition to interfere with APP processing. Mice sacrificed two months after the last dose of ARA did not show any improvements in learning and memory function, and neuritic plaque number was not significantly different between the treated and control groups. We also showed that GSK3 inhibition reduced gliosis in APP23/PS45 mice, as well as protected against A\u00CE\u00B2 toxicity. This suggests that administering one drug will have beneficial effects at multiple levels, making GSK3 inhibition a candidate strategy for treating AD. Although we are certain that the brain concentration of the drug is sufficient for GSK3 inhibition, we are uncertain to what extent GSK3 is inhibited. The extent of GSK3 inhibition could only be indirectly assayed by immunoblotting for phospho-T231 tau, which is phosphorylated by GSK3. It is worth noting here that complete gene ablation is not a valid strategy for treating AD. Previous work has demonstrated that GSK3 isoform KO mice have anxiety and locomotor deficits (Kaidanovich-Beilin et al., 2009; O'Brien et al., 2004). Both VPA and ARA treatment in AD model mice effectively reduced A\u00CE\u00B2 production and neuritic plaque formation. Both compounds could inhibit GSK3, but differ in their downstream effects such that VPA affects \u00CE\u00B3-secretase and ARA affects BACE1. A possible explanation is that the compounds inhibit GSK3 activity via different mechanisms. ARA binds to the catalytic domain of GSK3 and competes with ATP. Conversely, VPA stimulates PKB activity, which inhibits GSK3 by phosphorylation at the serine-9 site. Secondly, as mentioned previously, VPA treatment has many collateral effects, which may affect APP processing independent of GSK3 activity. Thirdly, it is possible that VPA and ARA affect GSK3\u00CE\u00B1 and GSK3\u00CE\u00B2 at different pharmacokinetics, which may explain why two GSK3 inhibitors regulate APP processing differently. Conclusions 120 Our work and others clearly demonstrated that GSK3 plays an important role in APP processing and A\u00CE\u00B2 production (Phiel et al., 2003; Qing et al., 2008; Su et al., 2004), in contrast to the work by Jaworski et al. (2011) who argued that APP processing is not affected in GSK3\u00CE\u00B1 KO and GSK3\u00CE\u00B2 conditional KO mice. The use of KO mice is problematic, since compensatory effects could not be controlled nor ruled out. Moreover, there may be different effects when GSK3 activity is acutely suppressed using pharmacological inhibitors as compared to gene deletion. Therefore, we believe that the work of Jaworski et al. (2011) could not entirely rule out GSK3\u00E2\u0080\u0099s function in amyloid production. 5.1.1 New use of an old drug to treat Alzheimer\u00E2\u0080\u0099s disease Finding new uses for existing drugs has been gaining popularity over the last decade. According to Chong and Sullivan (2007) there are 17 existing drugs undergoing preclinical validation and 24 drugs that are ready to be re-marketed by the pharmaceutical companies for new uses (Chong and Sullivan, 2007). For example, the antibiotic ceftriaxone has been tested for treating amyotrophic lateral sclerosis (Sundar et al., 2002). In addition, miltefosine, originally developed for breast cancer treatment, is now used for treating visceral leishmaniasis, an infectious disease affecting 500,000 people each year (Rothstein et al., 2005). Our study on VPA\u00E2\u0080\u0099s beneficial effect for AD is attractive because we explored a new use for an FDA-approved pharmaceutical. Arguably, finding new uses for existing drugs appears to be a direct transition between the lab and the clinic. VPA has been used clinically to treat epilepsy and mood disorders for several decades. Like the drugs used in the clinic, VPA has known pharmacokinetics and safety profiles and has been approved by the FDA for human use. Therefore any discovery of new applications can be readily evaluated in phase II clinical trials, which typically conserves time and money (Chong and Sullivan, 2007). In our Conclusions 121 preclinical study, VPA is only effective for rescuing memory deficits at an early stage of AD. The anti-amyloid effect of VPA lasts for more than 2 months post- treatment. This indicates that there is a critical time window early on in disease progression for VPA treatment to be effective. As most patients with mild cognitive impairment typically progress to full blown AD (Drago et al., 2011), it would be interesting to see whether administration of VPA to this group of subjects could prevent AD, or at least, delay the onset of AD. 5.1.2 When does GSK3 activity become aberrant? The basal activity of GSK3 is relatively high compared to other structurally similar kinases. In order to control the output of GSK3 signaling, this kinase is regulated at multiple levels. Although phosphorylation of GSK3 is the most studied mechanism, protein complex formation and intracellular localization also have regulatory influences on GSK3 activity. The balance between active and inactive GSK3 is highly important for maintaining normal cell function. Perturbation of this equilibrium will inevitably have pathological outcomes. In AD, GSK3 activity is higher than normal. Therefore, the aim is to reduce this activity, but not completely ablate GSK3 function. However, the contributors to constitutive GSK3 activation leading to elevated GSK3 activity in AD remain unidentified. In the next section, an emerging hypothesis involving neuroinflammation and GSK3, and their role in AD pathological conditions will be discussed. 5.1.3 Inflammatory signals increase GSK3 activity It has been well established that inflammation occurs in AD (Eikelenboom et al., 2010; McGeer and McGeer, 2010). As previously discussed, the levels of many cytokines, such as IL-1\u00CE\u00B2 and TNF\u00CE\u00B1, are upregulated in clinical AD cases and Conclusions 122 experimental AD models (Benzing et al., 1999; Matsuoka et al., 2001). Activation of astrocytes and microglia has been found surrounding amyloid plaques in AD brain (Bach et al., 2001; Combs et al., 2001). There is also evidence to show that activation of astrocytes and microglia contribute to neuronal damage by producing neurotoxic nitric oxide, reactive oxygen species, and various cytokines. Blocking components of the inflammatory system in the brain has shown some beneficial effects in animal models. Notably, the use of NSAIDS reduced inflammation in the brain in AD model mice, suggesting that blocking inflammation is a potential treatment for AD. GSK3 activation is necessary for production of pro-inflammatory cytokines in the periphery (Martin et al. 1999). Subsequently, findings by Richard Jope\u00E2\u0080\u0099s group show that GSK3 is necessary for neuroinflammation. Moreover, GSK3 regulates the activity of several transcription factors such as NF\u00CE\u00BAB and STAT3 for the expression of proinflammatory cytokines (Beurel and Jope, 2008, 2009a, b; Martin et al., 2005; Yuskaitis and Jope, 2009). On the other hand, the presence of several proinflammatory cytokines including TNF\u00CE\u00B1 stimulates GSK3 activation in the brain (Beurel and Jope, 2009b; Park et al., 2011; Yuskaitis and Jope, 2009). As a result, GSK3 activation may be a consequence of uncontrolled inflammation in AD brains. Moreover, the presence of A\u00CE\u00B2 activates glial cells, triggering them to release proinflammatory cytokines. This in turn enhances the activity of GSK3 in the brain. Ultimately a vicious cycle results where inflammation feeds into GSK3 activation and GSK3 potentiates plaque and NFT formation thereby triggering more inflammation (Fig 5). Conclusions 123 Figure 5.1 Aberrant GSK3\u00CE\u00B2 signaling facilitates amyloid peptide production. Inflammatory stimuli leads to increase GSK3\u00CE\u00B2 activity through increased phosphorylation of the activating tyrosine 216 residue or reduced phosphorylation of the inhibitory serine 9 residue. The green arrow here indicates that that how inflammatory signals lead to activation of GSK3\u00CE\u00B2 is unclear. GSK3\u00CE\u00B2 regulates BACE1 expression through NF\u00CE\u00BAB activity. However, the mechanism by which GSK3\u00CE\u00B2 activates NF\u00CE\u00BAB is unknown. In BACE1 expression facilitates A\u00CE\u00B2 production, which in turn lead to GSK3 activation\u00E2\u0080\u0094a vicious cycle involving A\u00CE\u00B2 and GSK3. 5.1.4 Potential problems with the long term use of GSK3 inhibitors In Chapter 4, we found that continuous administration of the GSK3 inhibitor is required to achieve the anti-amyloid effect. However, long-term treatment with GSK3 inhibitors is not without concerns. Many of the Wnt signal transduction components are over-expressed or mutated in cancer (Polakis, 2000). For example, the mutations in the APC gene or \u00CE\u00B2-catenin gene render the protein non- degradable (Polakis, 2000). Furthermore, transgenic mice over-expressing a Conclusions 124 mutant \u00CE\u00B2-catenin gene lacking sites for GSK3 phosphorylation develop intestinal polyps (Harada et al., 1999). Consequently, it may be possible that GSK3 inhibitors may mimic Wnt signaling and could potentially be oncogenic. Indeed, GSK3 inhibitors including SB216763, SB415286, Kenpaullone, and lithium chloride have all been shown to elevate the level of \u00CE\u00B2-catenin (Coghlan et al., 2000; Cross et al., 2001; Phiel et al., 2003). Similarly, GSK3 is known to phosphorylate the proto-oncogenic transcription factors c-JUN and c-MYC and inhibit their activities (Gregory et al., 2003; Morton et al., 2003). Therefore, inhibition of GSK3 will release this inhibition and lead to c-JUN and c-MYC accumulation, promoting expression of oncogenic genes. The long-term use of lithium chloride to treat bipolar disorder has not been linked to increased risk of cancer. Interestingly infusing the GSK3 inhibitor CHIR99021 in rats did not changed \u00CE\u00B2-catenin levels. Spittaels et al. (2006) and our work showed that GSK3 inhibition with the ARA compound in mice did not significantly increase \u00CE\u00B2-catenin levels. Moreover, \u00CE\u00B2-catenin levels are largely unaffected in GSK3\u00CE\u00B2 KO embryos (Hoeflich et al., 2000). These findings indicate that the inhibition of GSK3 by itself might not be sufficient to elevate the level of \u00CE\u00B2-catenin. It is possible that there are specific pools of GSK3 that are insensitive to certain GSK3 inhibitors, thereby sparing the effect of increasing \u00CE\u00B2-catenin levels. In order to validate the therapeutic efficacy of GSK3 inhibition, while minimizing oncogenic side effects, long-term treatment studies in cells and animals will be required. Conclusions 125 5.2 Significance of the research In this thesis, I presented several novel findings on GSK3 signaling in AD, which could significantly impact the field of AD research and drug discovery. First of all we discovered that the anti-convulsant drug VPA has anti-amyloid effects and can rescue memory deficits in transgenic AD mice. VPA is an FDA-approved pharmaceutical and we are aware of its safety profile. Therefore, there is hope that VPA could easily be enrolled in phase II trials and eventually be re-packaged to treat AD. Another significant impact of this thesis is that the specific role of GSK3 in APP processing is thoroughly examined. This is the first report to clearly show that GSK3 regulates APP processing at multiple levels. Furthermore, we showed that only the \u00CE\u00B2 isoform of GSK3 regulates BACE1 expression. Furthermore, our work suggests that there are functional differences between the two isoforms in APP processing. A better understanding of GSK3\u00E2\u0080\u0099s effect on APP processing will be necessary to devise new compounds that will target the appropriate isoform with limited side effects, yet at the same time are highly effective in ameliorating AD pathologies. Thirdly, we validated that specific inhibition of GSK3 reduced AD pathology and rescued memory deficits in AD model mice. This approach of GSK3 inhibition did not produce any aversive side effects, such as locomotor dysfunctions. This study laid the foundation for future preclinical studies examining the effects of GSK3-specific inhibitors used therapeutically for treating AD. Finally, we demonstrated that GSK3 inhibition protected against A\u00CE\u00B2-mediated toxicity and reduced gliosis in AD model mice. Conclusions 126 5.3 Potential applications and future research 5.3.1 Using AR-A014418 in the clinic to treat AD? The majority of the marketed drugs and drugs still in development have side effects at high doses. A balance between the doses that provide clinical benefit and the dose having side effects needs to be evaluated thoroughly. In our study, we used a constant 5 mg/ml dose to treat APP23/PS45 mice, since this dose has previously been used in a tau transgenic model of AD (Spittaels et al. 2006). One limitation from our studies is that we lack knowledge of the effects when the drug is administered at lower and higher doses. Future experiments could examine the dosage effect of GSK3 inhibition. This will be important for evaluating the optimal dosage for blocking A\u00CE\u00B2 production, yet having the least side effects. In Chapter 4, we showed that GSK3 inhibition reduced neuritic plaque formation. However, the effect of GSK3 inhibition is reversible, as we did not observe any difference in neuritic plaque number in APP23/PS45 mice sacrificed two months after the last injection. In a future study, we could further examine the time course of GSK3 inhibition. We could design a new treatment paradigm where a group of mice receives ARA for one month, is maintained for another two months, and is then administered ARA for one more month. The mice would then be assessed for changes in learning and memory functions, as well as any effect on neuritic plaque formation. 5.3.2 The cocktail approach The etiopathogenesis of sporadic AD is unclear and appears to be multifactorial. As the disease progresses, the patient develops pathological features unique to AD and some pathologies that are common to other neurodegenerative disorders. Conclusions 127 Early diagnosis of AD and implementing therapy remains the most effective method for treating AD. However, arguably patients with AD symptoms already have substantial neuropathological changes, which limits the effectiveness of various drugs such as the anti-cholinesterase inhibitor Aricept. In this case, these patients may benefit from a cocktail of drugs. Each compound will have its own function at targeting a specific pathological change in AD brains. In previous work by Kris et al. (2003), a three-drug cocktail including an anti-microbial inhibitor (minocycline), glutamate antagonist (riluzole), and voltage-gated calcium channel blocker (nimodipine) was effective in delaying the progression of amyotrophic lateral sclerosis in mice. A cocktail to treat AD could include a combination of anti-cholinesterase inhibitor, NMDA receptor blocker (eg. memantine), anti-inflammatory agents (eg. acetylsalicylic acid), and even GSK3 inhibitors (eg. VPA, lithium chloride, and ARA). Inclusion of GSK3 inhibitors in the cocktail should be considered, since GSK3 inhibition has the potential of alleviating the common AD pathologies. This cocktail approach could be tested in APP23/PS45 mice as well as the tau transgenic mouse model of AD. This will open new avenues for drug therapies to treat AD. In conclusion, there are substantial data that strongly implicate a role for GSK3 in the pathogenesis of AD. Increased GSK3 signaling is observed in AD and from epidemiological studies there is an association between AD and pathological pathways that regulate GSK3. This thesis provided solid evidence that GSK3 regulates APP processing. However, more work is required on characterizing the various potentials of GSK3 inhibition to treat AD while monitoring for toxic side effects. As we continue to validate the role of GSK3, we await the development of novel GSK3 inhibitors that are more potent but with much fewer toxic properties. 128 Bibliography Bibliography Acquati, F., Accarino, M., Nucci, C., Fumagalli, P., Jovine, L., Ottolenghi, S., and Taramelli, R. (2000). The gene encoding DRAP (BACE2), a glycosylated transmembrane protein of the aspartic protease family, maps to the down critical region. FEBS Lett 468, 59-64. Aghdam, S.Y., and Barger, S.W. (2007). Glycogen synthase kinase-3 in neurodegeneration and neuroprotection: lessons from lithium. Curr Alzheimer Res 4, 21-31. Akiyama, H., Barger, S., Barnum, S., Bradt, B., Bauer, J., Cole, G.M., Cooper, N.R., Eikelenboom, P., Emmerling, M., Fiebich, B.L., et al. (2000). Inflammation and Alzheimer's disease. Neurobiol Aging 21, 383-421. Alessi, D.R., Andjelkovic, M., Caudwell, B., Cron, P., Morrice, N., Cohen, P., and Hemmings, B.A. (1996). Mechanism of activation of protein kinase B by insulin and IGF-1. EMBO J 15, 6541-6551. Allison, J.H., Blisner, M.E., Holland, W.H., Hipps, P.P., and Sherman, W.R. (1976). Increased brain myo-inositol 1-phosphate in lithium-treated rats. Biochem Biophys Res Commun 71, 664- 670. Altieri, M., Di Piero, V., Pasquini, M., Gasparini, M., Vanacore, N., Vicenzini, E., and Lenzi, G.L. (2004). Delayed poststroke dementia: a 4-year follow-up study. Neurology 62, 2193-2197. Alvarez, G., Munoz-Montano, J.R., Satrustegui, J., Avila, J., Bogonez, E., and Diaz-Nido, J. (1999). Lithium protects cultured neurons against beta-amyloid-induced neurodegeneration. FEBS Lett 453, 260-264. Amit, S., Hatzubai, A., Birman, Y., Andersen, J.S., Ben-Shushan, E., Mann, M., Ben-Neriah, Y., and Alkalay, I. (2002). Axin-mediated CKI phosphorylation of beta-catenin at Ser 45: a molecular switch for the Wnt pathway. Genes Dev 16, 1066-1076. Aplin, A.E., Gibb, G.M., Jacobsen, J.S., Gallo, J.M., and Anderton, B.H. (1996). In vitro phosphorylation of the cytoplasmic domain of the amyloid precursor protein by glycogen synthase kinase-3beta. J Neurochem 67, 699-707. Armstrong, R.A. (1994). beta-Amyloid (A beta) deposition in elderly non-demented patients and patients with Alzheimer's disease. Neurosci Lett 178, 59-62. Armstrong, R.A. (1995). Beta-amyloid deposition in the medial temporal lobe in elderly non- demented brains and in Alzheimer's disease. Dementia 6, 121-125. Bibliography 129 Armstrong, R.A., Cairns, N.J., Myers, D., Smith, C.U., Lantos, P.L., and Rossor, M.N. (1996). A comparison of beta-amyloid deposition in the medial temporal lobe in sporadic Alzheimer's disease, Down's syndrome and normal elderly brains. Neurodegeneration 5, 35-41. Arvanitakis, Z., Wilson, R.S., Bienias, J.L., Evans, D.A., and Bennett, D.A. (2004). Diabetes mellitus and risk of Alzheimer disease and decline in cognitive function. Arch Neurol 61, 661- 666. Azoulay-Alfaguter, I., Yaffe, Y., Licht-Murava, A., Urbanska, M., Jaworski, J., Pietrokovski, S., Hirschberg, K., and Eldar-Finkelman, H. (2011). Distinct molecular regulation of glycogen synthase kinase-3alpha isozyme controlled by its N-terminal region: functional role in calcium/calpain signaling. J Biol Chem 286, 13470-13480. Bach, J.H., Chae, H.S., Rah, J.C., Lee, M.W., Park, C.H., Choi, S.H., Choi, J.K., Lee, S.H., Kim, Y.S., Kim, K.Y., et al. (2001). C-terminal fragment of amyloid precursor protein induces astrocytosis. J Neurochem 78, 109-120. Bain, J., McLauchlan, H., Elliott, M., and Cohen, P. (2003). The specificities of protein kinase inhibitors: an update. Biochem J 371, 199-204. Barger, S.W., and Mattson, M.P. (1996). Induction of neuroprotective kappa B-dependent transcription by secreted forms of the Alzheimer's beta-amyloid precursor. Brain Res Mol Brain Res 40, 116-126. Baum, L., Hansen, L., Masliah, E., and Saitoh, T. (1996). Glycogen synthase kinase 3 alteration in Alzheimer disease is related to neurofibrillary tangle formation. Mol Chem Neuropathol 29, 253- 261. Bax, B., Carter, P.S., Lewis, C., Guy, A.R., Bridges, A., Tanner, R., Pettman, G., Mannix, C., Culbert, A.A., Brown, M.J., et al. (2001). The structure of phosphorylated GSK-3beta complexed with a peptide, FRATtide, that inhibits beta-catenin phosphorylation. Structure 9, 1143-1152. Beals, C.R., Sheridan, C.M., Turck, C.W., Gardner, P., and Crabtree, G.R. (1997). Nuclear export of NF-ATc enhanced by glycogen synthase kinase-3. Science 275, 1930-1934. Benjamin, W.B., Pentyala, S.N., Woodgett, J.R., Hod, Y., and Marshak, D. (1994). ATP citrate- lyase and glycogen synthase kinase-3 beta in 3T3-L1 cells during differentiation into adipocytes. Biochem J 300 ( Pt 2), 477-482. Benjannet, S., Elagoz, A., Wickham, L., Mamarbachi, M., Munzer, J.S., Basak, A., Lazure, C., Cromlish, J.A., Sisodia, S., Checler, F., et al. (2001). Post-translational Processing of beta - Secretase (beta -Amyloid-converting Enzyme) and Its Ectodomain Shedding. The Pro- and transmembrane/cytosolic domains affect its cellular activity and amyloid-beta production. J. Biol. Chem. 276, 10879-10887. Bennett, B.D., Babu-Khan, S., Loeloff, R., Louis, J.C., Curran, E., Citron, M., and Vassar, R. (2000a). Expression analysis of BACE2 in brain and peripheral tissues. J Biol Chem 275, 20647- 20651. Bibliography 130 Bennett, B.D., Denis, P., Haniu, M., Teplow, D.B., Kahn, S., Louis, J.-C., Citron, M., and Vassar, R. (2000b). A Furin-like Convertase Mediates Propeptide Cleavage of BACE, the Alzheimer's beta -Secretase. J. Biol. Chem. 275, 37712-37717. Benzing, W.C., Wujek, J.R., Ward, E.K., Shaffer, D., Ashe, K.H., Younkin, S.G., and Brunden, K.R. (1999). Evidence for glial-mediated inflammation in aged APP(SW) transgenic mice. Neurobiol Aging 20, 581-589. Berling, B., Wille, H., Roll, B., Mandelkow, E.M., Garner, C., and Mandelkow, E. (1994). Phosphorylation of microtubule-associated proteins MAP2a,b and MAP2c at Ser136 by proline- directed kinases in vivo and in vitro. Eur J Cell Biol 64, 120-130. Beurel, E., and Jope, R.S. (2008). Differential regulation of STAT family members by glycogen synthase kinase-3. J Biol Chem 283, 21934-21944. Beurel, E., and Jope, R.S. (2009a). Glycogen synthase kinase-3 promotes the synergistic action of interferon-gamma on lipopolysaccharide-induced IL-6 production in RAW264.7 cells. Cell Signal 21, 978-985. Beurel, E., and Jope, R.S. (2009b). Lipopolysaccharide-induced interleukin-6 production is controlled by glycogen synthase kinase-3 and STAT3 in the brain. J Neuroinflammation 6, 9. Beurel, E., Michalek, S.M., and Jope, R.S. (2010). Innate and adaptive immune responses regulated by glycogen synthase kinase-3 (GSK3). Trends Immunol 31, 24-31. Bhat, R., Xue, Y., Berg, S., Hellberg, S., Ormo, M., Nilsson, Y., Radesater, A.C., Jerning, E., Markgren, P.O., Borgegard, T., et al. (2003). Structural insights and biological effects of glycogen synthase kinase 3-specific inhibitor AR-A014418. J Biol Chem 278, 45937-45945. Bhat, R.V., Leonov, S., Luthman, J., Scott, C.W., and Lee, C.M. (2002). Interactions between GSK3beta and caspase signalling pathways during NGF deprivation induced cell death. J Alzheimers Dis 4, 291-301. Bhat, R.V., Shanley, J., Correll, M.P., Fieles, W.E., Keith, R.A., Scott, C.W., and Lee, C.M. (2000). Regulation and localization of tyrosine216 phosphorylation of glycogen synthase kinase- 3beta in cellular and animal models of neuronal degeneration. Proc Natl Acad Sci U S A 97, 11074-11079. Bijur, G.N., and Jope, R.S. (2001). Proapoptotic stimuli induce nuclear accumulation of glycogen synthase kinase-3 beta. J Biol Chem 276, 37436-37442. Bijur, G.N., and Jope, R.S. (2003). Glycogen synthase kinase-3 beta is highly activated in nuclei and mitochondria. Neuroreport 14, 2415-2419. Bilic, J., Huang, Y.L., Davidson, G., Zimmermann, T., Cruciat, C.M., Bienz, M., and Niehrs, C. (2007). Wnt induces LRP6 signalosomes and promotes dishevelled-dependent LRP6 phosphorylation. Science 316, 1619-1622. Bibliography 131 Blaheta, R.A., and Cinatl, J., Jr. (2002). Anti-tumor mechanisms of valproate: a novel role for an old drug. Med Res Rev 22, 492-511. Blalock, E.M., Geddes, J.W., Chen, K.C., Porter, N.M., Markesbery, W.R., and Landfield, P.W. (2004). Incipient Alzheimer's disease: microarray correlation analyses reveal major transcriptional and tumor suppressor responses. Proc Natl Acad Sci U S A 101, 2173-2178. Borchelt, D.R., Ratovitski, T., van Lare, J., Lee, M.K., Gonzales, V., Jenkins, N.A., Copeland, N.G., Price, D.L., and Sisodia, S.S. (1997). Accelerated amyloid deposition in the brains of transgenic mice coexpressing mutant presenilin 1 and amyloid precursor proteins. Neuron 19, 939- 945. Borchelt, D.R., Thinakaran, G., Eckman, C.B., Lee, M.K., Davenport, F., Ratovitsky, T., Prada, C.M., Kim, G., Seekins, S., Yager, D., et al. (1996). Familial Alzheimer's disease-linked presenilin 1 variants elevate Abeta1-42/1-40 ratio in vitro and in vivo. Neuron 17, 1005-1013. Bornemann, K.D., and Staufenbiel, M. (2000). Transgenic mouse models of Alzheimer's disease. Ann N Y Acad Sci 908, 260-266. Bourne, K.Z., Ferrari, D.C., Lange-Dohna, C., Rossner, S., Wood, T.G., and Perez-Polo, J.R. (2007). Differential regulation of BACE1 promoter activity by nuclear factor-kappaB in neurons and glia upon exposure to beta-amyloid peptides. J Neurosci Res 85, 1194-1204. Bromley-Brits, K., Deng, Y., and Song, W. (2011). Morris Water Maze Test for Learning and Memory Deficits in Alzheimer's Disease Model Mice. J Vis Exp, e2920. Buggia-Prevot, V., Sevalle, J., Rossner, S., and Checler, F. (2008). NFkappaB-dependent control of BACE1 promoter transactivation by Abeta42. J Biol Chem 283, 10037-10047. Bullock, B.P., and Habener, J.F. (1998). Phosphorylation of the cAMP response element binding protein CREB by cAMP-dependent protein kinase A and glycogen synthase kinase-3 alters DNA- binding affinity, conformation, and increases net charge. Biochemistry 37, 3795-3809. Buxbaum, J.D., Gandy, S.E., Cicchetti, P., Ehrlich, M.E., Czernik, A.J., Fracasso, R.P., Ramabhadran, T.V., Unterbeck, A.J., and Greengard, P. (1990). Processing of Alzheimer beta/A4 amyloid precursor protein: modulation by agents that regulate protein phosphorylation. Proc Natl Acad Sci U S A 87, 6003-6006. Cai, H., Wang, Y., McCarthy, D., Wen, H., Borchelt, D.R., Price, D.L., and Wong, P.C. (2001). BACE1 is the major beta-secretase for generation of Abeta peptides by neurons. Nat Neurosci 4, 233-234. Cairns, N.J., Ikonomovic, M.D., Benzinger, T., Storandt, M., Fagan, A.M., Shah, A.R., Reinwald, L.T., Carter, D., Felton, A., Holtzman, D.M., et al. (2009). Absence of Pittsburgh compound B detection of cerebral amyloid beta in a patient with clinical, cognitive, and cerebrospinal fluid markers of Alzheimer disease: a case report. Arch Neurol 66, 1557-1562. Bibliography 132 Capell, A., Steiner, H., Willem, M., Kaiser, H., Meyer, C., Walter, J., Lammich, S., Multhaup, G., and Haass, C. (2000). Maturation and Pro-peptide Cleavage of beta -Secretase. J. Biol. Chem. 275, 30849-30854. Caricasole, A., Copani, A., Caraci, F., Aronica, E., Rozemuller, A.J., Caruso, A., Storto, M., Gaviraghi, G., Terstappen, G.C., and Nicoletti, F. (2004). Induction of Dickkopf-1, a negative modulator of the Wnt pathway, is associated with neuronal degeneration in Alzheimer's brain. J Neurosci 24, 6021-6027. Cedazo-Minguez, A., Popescu, B.O., Blanco-Millan, J.M., Akterin, S., Pei, J.J., Winblad, B., and Cowburn, R.F. (2003). Apolipoprotein E and beta-amyloid (1-42) regulation of glycogen synthase kinase-3beta. J Neurochem 87, 1152-1164. Charlwood, J., Dingwall, C., Matico, R., Hussain, I., Johanson, K., Moore, S., Powell, D.J., Skehel, J.M., Ratcliffe, S., Clarke, B., et al. (2001). Characterization of the Glycosylation Profiles of Alzheimer's beta -Secretase Protein Asp-2 Expressed in a Variety of Cell Lines. J. Biol. Chem. 276, 16739-16748. Chen, C.H., Zhou, W., Liu, S., Deng, Y., Cai, F., Tone, M., Tone, Y., Tong, Y., and Song, W. (2011a). Increased NF-kappaB signalling up-regulates BACE1 expression and its therapeutic potential in Alzheimer's disease. Int J Neuropsychopharmacol, 1-14. Chen, C.H., Zhou, W., Liu, S., Deng, Y., Cai, F., Tone, M., Tone, Y., Tong, Y., and Song, W. (2011b). Increased NF-kappaB signalling up-regulates BACE1 expression and its therapeutic potential in Alzheimer's disease. Int J Neuropsychopharmacol, 1-14. Chen, C.H., Zhou, W., Liu, S., Deng, Y., Cai, F., Tone, M., Tone, Y., Tong, Y., and Song, W. (2011c). Increased NF-kappaB signalling up-regulates BACE1 expression and its therapeutic potential in Alzheimer's disease. The international journal of neuropsychopharmacology, 1-14. Chen, G., Huang, L.D., Jiang, Y.M., and Manji, H.K. (1999). The mood-stabilizing agent valproate inhibits the activity of glycogen synthase kinase-3. J Neurochem 72, 1327-1330. Cho, H.J., Jin, S.M., Son, S.M., Kim, Y.W., Hwang, J.Y., Hong, H.S., and Mook-Jung, I. (2009). Constitutive JAK2/STAT1 activation regulates endogenous BACE1 expression in neurons. Biochem Biophys Res Commun 386, 175-180. Cho, H.J., Jin, S.M., Youn, H.D., Huh, K., and Mook-Jung, I. (2008). Disrupted intracellular calcium regulates BACE1 gene expression via nuclear factor of activated T cells 1 (NFAT 1) signaling. Aging Cell 7, 137-147. Cho, J.H., and Johnson, G.V. (2004a). Glycogen synthase kinase 3 beta induces caspase-cleaved tau aggregation in situ. J Biol Chem 279, 54716-54723. Cho, J.H., and Johnson, G.V. (2004b). Primed phosphorylation of tau at Thr231 by glycogen synthase kinase 3beta (GSK3beta) plays a critical role in regulating tau's ability to bind and stabilize microtubules. J Neurochem 88, 349-358. Bibliography 133 Chong, C.R., and Sullivan, D.J., Jr. (2007). New uses for old drugs. Nature 448, 645-646. Christensen, M.A., Zhou, W., Qing, H., Lehman, A., Philipsen, S., and Song, W. (2004). Transcriptional regulation of BACE1, the beta-amyloid precursor protein beta-secretase, by Sp1. Mol Cell Biol 24, 865-874. Christie, R.H., Freeman, M., and Hyman, B.T. (1996). Expression of the macrophage scavenger receptor, a multifunctional lipoprotein receptor, in microglia associated with senile plaques in Alzheimer's disease. Am J Pathol 148, 399-403. Ciaraldi, T.P., Nikoulina, S.E., and Henry, R.R. (2002). Role of glycogen synthase kinase-3 in skeletal muscle insulin resistance in Type 2 diabetes. J Diabetes Complications 16, 69-71. Citron, M., Westaway, D., Xia, W., Carlson, G., Diehl, T., Levesque, G., Johnson-Wood, K., Lee, M., Seubert, P., Davis, A., et al. (1997). Mutant presenilins of Alzheimer's disease increase production of 42-residue amyloid beta-protein in both transfected cells and transgenic mice. Nat Med 3, 67-72. Clarimon, J., Bertranpetit, J., Calafell, F., Boada, M., Tarraga, L., and Comas, D. (2003). Association study between Alzheimer's disease and genes involved in Abeta biosynthesis, aggregation and degradation: suggestive results with BACE1. J Neurol 250, 956-961. Coant, N., Simon-Rudler, M., Gustot, T., Fasseu, M., Gandoura, S., Ragot, K., Abdel-Razek, W., Thabut, D., Letteron, P., Ogier-Denis, E., et al. (2011). Glycogen synthase kinase 3 involvement in the excessive proinflammatory response to LPS in patients with decompensated cirrhosis. J Hepatol 55, 784-793. Coghlan, M.P., Culbert, A.A., Cross, D.A., Corcoran, S.L., Yates, J.W., Pearce, N.J., Rausch, O.L., Murphy, G.J., Carter, P.S., Roxbee Cox, L., et al. (2000). Selective small molecule inhibitors of glycogen synthase kinase-3 modulate glycogen metabolism and gene transcription. Chem Biol 7, 793-803. Combs, C.K., Karlo, J.C., Kao, S.C., and Landreth, G.E. (2001). beta-Amyloid stimulation of microglia and monocytes results in TNFalpha-dependent expression of inducible nitric oxide synthase and neuronal apoptosis. J Neurosci 21, 1179-1188. Creemers, J.W.M., Ines Dominguez, D., Plets, E., Serneels, L., Taylor, N.A., Multhaup, G., Craessaerts, K., Annaert, W., and De Strooper, B. (2001). Processing of beta -Secretase by Furin and Other Members of the Proprotein Convertase Family. J. Biol. Chem. 276, 4211-4217. Cross, D.A., Alessi, D.R., Cohen, P., Andjelkovich, M., and Hemmings, B.A. (1995). Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase B. Nature 378, 785-789. Cross, D.A., Alessi, D.R., Vandenheede, J.R., McDowell, H.E., Hundal, H.S., and Cohen, P. (1994). The inhibition of glycogen synthase kinase-3 by insulin or insulin-like growth factor 1 in the rat skeletal muscle cell line L6 is blocked by wortmannin, but not by rapamycin: evidence that wortmannin blocks activation of the mitogen-activated protein kinase pathway in L6 cells between Ras and Raf. Biochem J 303 ( Pt 1), 21-26. Bibliography 134 Cross, D.A., Culbert, A.A., Chalmers, K.A., Facci, L., Skaper, S.D., and Reith, A.D. (2001). Selective small-molecule inhibitors of glycogen synthase kinase-3 activity protect primary neurones from death. J Neurochem 77, 94-102. Cruts, M., Dermaut, B., Rademakers, R., Roks, G., Van den Broeck, M., Munteanu, G., van Duijn, C.M., and Van Broeckhoven, C. (2001). Amyloid beta secretase gene (BACE) is neither mutated in nor associated with early-onset Alzheimer's disease. Neurosci Lett 313, 105-107. Culbert, A.A., Brown, M.J., Frame, S., Hagen, T., Cross, D.A., Bax, B., and Reith, A.D. (2001). GSK-3 inhibition by adenoviral FRAT1 overexpression is neuroprotective and induces Tau dephosphorylation and beta-catenin stabilisation without elevation of glycogen synthase activity. FEBS Lett 507, 288-294. Dajani, R., Fraser, E., Roe, S.M., Young, N., Good, V., Dale, T.C., and Pearl, L.H. (2001). Crystal structure of glycogen synthase kinase 3 beta: structural basis for phosphate-primed substrate specificity and autoinhibition. Cell 105, 721-732. Damjanac, M., Rioux Bilan, A., Paccalin, M., Pontcharraud, R., Fauconneau, B., Hugon, J., and Page, G. (2008). Dissociation of Akt/PKB and ribosomal S6 kinase signaling markers in a transgenic mouse model of Alzheimer's disease. Neurobiol Dis 29, 354-367. de Groot, R.P., Auwerx, J., Bourouis, M., and Sassone-Corsi, P. (1993). Negative regulation of Jun/AP-1: conserved function of glycogen synthase kinase 3 and the Drosophila kinase shaggy. Oncogene 8, 841-847. de la Monte, S.M. (2009). Insulin resistance and Alzheimer's disease. BMB Rep 42, 475-481. de la Monte, S.M. (2012). Brain insulin resistance and deficiency as therapeutic targets in Alzheimer's disease. Curr Alzheimer Res 9, 35-66. de la Monte, S.M., and Wands, J.R. (2008). Alzheimer's disease is type 3 diabetes-evidence reviewed. J Diabetes Sci Technol 2, 1101-1113. De Pietri Tonelli, D., Mihailovich, M., Di Cesare, A., Codazzi, F., Grohovaz, F., and Zacchetti, D. (2004). Translational regulation of BACE-1 expression in neuronal and non-neuronal cells. Nucleic Acids Res 32, 1808-1817. De Sarno, P., Li, X., and Jope, R.S. (2002). Regulation of Akt and glycogen synthase kinase-3 beta phosphorylation by sodium valproate and lithium. Neuropharmacology 43, 1158-1164. De Strooper, B. (2003). Aph-1, Pen-2, and Nicastrin with Presenilin generate an active gamma- Secretase complex. Neuron 38, 9-12. De Strooper, B., and Annaert, W. Novel research horizons for presenilins and gamma-secretases in cell biology and disease. Annu Rev Cell Dev Biol 26, 235-260. Bibliography 135 De Strooper, B., Annaert, W., Cupers, P., Saftig, P., Craessaerts, K., Mumm, J.S., Schroeter, E.H., Schrijvers, V., Wolfe, M.S., Ray, W.J., et al. (1999). A presenilin-1-dependent gamma-secretase- like protease mediates release of Notch intracellular domain. Nature 398, 518-522. De Strooper, B., Saftig, P., Craessaerts, K., Vanderstichele, H., Guhde, G., Annaert, W., Von Figura, K., and Van Leuven, F. (1998). Deficiency of presenilin-1 inhibits the normal cleavage of amyloid precursor protein. Nature 391, 387-390. Demarchi, F., Bertoli, C., Sandy, P., and Schneider, C. (2003). Glycogen synthase kinase-3 beta regulates NF-kappa B1/p105 stability. J Biol Chem 278, 39583-39590. Dinamarca, M.C., Colombres, M., Cerpa, W., Bonansco, C., and Inestrosa, N.C. (2008). Beta- amyloid oligomers affect the structure and function of the postsynaptic region: role of the Wnt signaling pathway. Neurodegener Dis 5, 149-152. Ding, S., Wu, T.Y., Brinker, A., Peters, E.C., Hur, W., Gray, N.S., and Schultz, P.G. (2003). Synthetic small molecules that control stem cell fate. Proc Natl Acad Sci U S A 100, 7632-7637. Doble, B.W., and Woodgett, J.R. (2003). GSK-3: tricks of the trade for a multi-tasking kinase. J Cell Sci 116, 1175-1186. Donoviel, D.B., Hadjantonakis, A.K., Ikeda, M., Zheng, H., Hyslop, P.S., and Bernstein, A. (1999). Mice lacking both presenilin genes exhibit early embryonic patterning defects. Genes Dev 13, 2801-2810. Drago, V., Babiloni, C., Bartres-Faz, D., Caroli, A., Bosch, B., Hensch, T., Didic, M., Klafki, H.W., Pievani, M., Jovicich, J., et al. (2011). Disease tracking markers for Alzheimer's disease at the prodromal (MCI) stage. J Alzheimers Dis 26 Suppl 3, 159-199. Dyrks, T., Weidemann, A., Multhaup, G., Salbaum, J.M., Lemaire, H.G., Kang, J., Muller-Hill, B., Masters, C.L., and Beyreuther, K. (1988). Identification, transmembrane orientation and biogenesis of the amyloid A4 precursor of Alzheimer's disease. EMBO J 7, 949-957. Edbauer, D., Winkler, E., Haass, C., and Steiner, H. (2002). Presenilin and nicastrin regulate each other and determine amyloid beta-peptide production via complex formation. Proc Natl Acad Sci U S A 99, 8666-8671. Eickholt, B.J., Towers, G.J., Ryves, W.J., Eikel, D., Adley, K., Ylinen, L.M., Chadborn, N.H., Harwood, A.J., Nau, H., and Williams, R.S. (2005). Effects of valproic acid derivatives on inositol trisphosphate depletion, teratogenicity, glycogen synthase kinase-3beta inhibition, and viral replication: a screening approach for new bipolar disorder drugs derived from the valproic acid core structure. Mol Pharmacol 67, 1426-1433. Eikelenboom, P., van Exel, E., Hoozemans, J.J., Veerhuis, R., Rozemuller, A.J., and van Gool, W.A. Neuroinflammation - an early event in both the history and pathogenesis of Alzheimer's disease. Neurodegener Dis 7, 38-41. Bibliography 136 Eikelenboom, P., van Exel, E., Hoozemans, J.J., Veerhuis, R., Rozemuller, A.J., and van Gool, W.A. (2010). Neuroinflammation - an early event in both the history and pathogenesis of Alzheimer's disease. Neurodegener Dis 7, 38-41. Eldar-Finkelman, H., and Krebs, E.G. (1997). Phosphorylation of insulin receptor substrate 1 by glycogen synthase kinase 3 impairs insulin action. Proc Natl Acad Sci U S A 94, 9660-9664. Eldar-Finkelman, H., Schreyer, S.A., Shinohara, M.M., LeBoeuf, R.C., and Krebs, E.G. (1999). Increased glycogen synthase kinase-3 activity in diabetes- and obesity-prone C57BL/6J mice. Diabetes 48, 1662-1666. Embi, N., Rylatt, D.B., and Cohen, P. (1980). Glycogen synthase kinase-3 from rabbit skeletal muscle. Separation from cyclic-AMP-dependent protein kinase and phosphorylase kinase. Eur J Biochem 107, 519-527. Esch, F.S., Keim, P.S., Beattie, E.C., Blacher, R.W., Culwell, A.R., Oltersdorf, T., McClure, D., and Ward, P.J. (1990). Cleavage of amyloid beta peptide during constitutive processing of its precursor. Science 248, 1122-1124. Evin, G., Canterford, L.D., Hoke, D.E., Sharples, R.A., Culvenor, J.G., and Masters, C.L. (2005). Transition-state analogue gamma-secretase inhibitors stabilize a 900 kDa presenilin/nicastrin complex. Biochemistry 44, 4332-4341. Farzan, M., Schnitzler, C.E., Vasilieva, N., Leung, D., and Choe, H. (2000). BACE2, a beta - secretase homolog, cleaves at the beta site and within the amyloid-beta region of the amyloid-beta precursor protein. Proc Natl Acad Sci U S A 97, 9712-9717. Ferrarese, A., Marin, O., Bustos, V.H., Venerando, A., Antonelli, M., Allende, J.E., and Pinna, L.A. (2007). Chemical dissection of the APC Repeat 3 multistep phosphorylation by the concerted action of protein kinases CK1 and GSK3. Biochemistry 46, 11902-11910. Fiol, C.J., Williams, J.S., Chou, C.H., Wang, Q.M., Roach, P.J., and Andrisani, O.M. (1994). A secondary phosphorylation of CREB341 at Ser129 is required for the cAMP-mediated control of gene expression. A role for glycogen synthase kinase-3 in the control of gene expression. J Biol Chem 269, 32187-32193. Fischer, A., Sananbenesi, F., Wang, X., Dobbin, M., and Tsai, L.-H. (2007). Recovery of learning and memory is associated with chromatin remodelling. Nature 447, 178-182. Flugel, D., Gorlach, A., Michiels, C., and Kietzmann, T. (2007). Glycogen synthase kinase 3 phosphorylates hypoxia-inducible factor 1alpha and mediates its destabilization in a VHL- independent manner. Mol Cell Biol 27, 3253-3265. Franca-Koh, J., Yeo, M., Fraser, E., Young, N., and Dale, T.C. (2002). The regulation of glycogen synthase kinase-3 nuclear export by Frat/GBP. J Biol Chem 277, 43844-43848. Bibliography 137 Francis, R., McGrath, G., Zhang, J., Ruddy, D.A., Sym, M., Apfeld, J., Nicoll, M., Maxwell, M., Hai, B., Ellis, M.C., et al. (2002). aph-1 and pen-2 are required for Notch pathway signaling, gamma-secretase cleavage of betaAPP, and presenilin protein accumulation. Dev Cell 3, 85-97. Fukumoto, H., Cheung, B.S., Hyman, B.T., and Irizarry, M.C. (2002). Beta-secretase protein and activity are increased in the neocortex in Alzheimer disease. Arch Neurol 59, 1381-1389. Fukumoto, H., Rosene, D.L., Moss, M.B., Raju, S., Hyman, B.T., and Irizarry, M.C. (2004). Beta- secretase activity increases with aging in human, monkey, and mouse brain. Am J Pathol 164, 719-725. Games, D., Adams, D., Alessandrini, R., Barbour, R., Berthelette, P., Blackwell, C., Carr, T., Clemens, J., Donaldson, T., Gillespie, F., and et al. (1995). Alzheimer-type neuropathology in transgenic mice overexpressing V717F beta-amyloid precursor protein. Nature 373, 523-527. Gandy, S., Czernik, A.J., and Greengard, P. (1988). Phosphorylation of Alzheimer disease amyloid precursor peptide by protein kinase C and Ca2+/calmodulin-dependent protein kinase II. Proc Natl Acad Sci U S A 85, 6218-6221. Gao, Z.H., Seeling, J.M., Hill, V., Yochum, A., and Virshup, D.M. (2002). Casein kinase I phosphorylates and destabilizes the beta-catenin degradation complex. Proc Natl Acad Sci U S A 99, 1182-1187. Gapuzan, M.E., Schmah, O., Pollock, A.D., Hoffmann, A., and Gilmore, T.D. (2005). Immortalized fibroblasts from NF-kappaB RelA knockout mice show phenotypic heterogeneity and maintain increased sensitivity to tumor necrosis factor alpha after transformation by v-Ras. Oncogene 24, 6574-6583. Ge, Y.W., Maloney, B., Sambamurti, K., and Lahiri, D.K. (2004). Functional characterization of the 5' flanking region of the BACE gene: identification of a 91 bp fragment involved in basal level of BACE promoter expression. FASEB J 18, 1037-1039. Giannakopoulos, P., Herrmann, F.R., Bussiere, T., Bouras, C., Kovari, E., Perl, D.P., Morrison, J.H., Gold, G., and Hof, P.R. (2003). Tangle and neuron numbers, but not amyloid load, predict cognitive status in Alzheimer's disease. Neurology 60, 1495-1500. Glenner, G.G., and Wong, C.W. (1984). Alzheimer's disease: initial report of the purification and characterization of a novel cerebrovascular amyloid protein. Biochem Biophys Res Commun 120, 885-890. Gotschel, F., Kern, C., Lang, S., Sparna, T., Markmann, C., Schwager, J., McNelly, S., von Weizsacker, F., Laufer, S., Hecht, A., and Merfort, I. (2008). Inhibition of GSK3 differentially modulates NF-kappaB, CREB, AP-1 and beta-catenin signaling in hepatocytes, but fails to promote TNF-alpha-induced apoptosis. Exp Cell Res 314, 1351-1366. Gottlicher, M., Minucci, S., Zhu, P., Kramer, O.H., Schimpf, A., Giavara, S., Sleeman, J.P., Lo Coco, F., Nervi, C., Pelicci, P.G., and Heinzel, T. (2001). Valproic acid defines a novel class of HDAC inhibitors inducing differentiation of transformed cells. EMBO J 20, 6969-6978. Bibliography 138 Gould, T.D., Einat, H., Bhat, R., and Manji, H.K. (2004). AR-A014418, a selective GSK-3 inhibitor, produces antidepressant-like effects in the forced swim test. Int J Neuropsychopharmacol 7, 387-390. Goutte, C., Tsunozaki, M., Hale, V.A., and Priess, J.R. (2002). APH-1 is a multipass membrane protein essential for the Notch signaling pathway in Caenorhabditis elegans embryos. Proc Natl Acad Sci U S A 99, 775-779. Gregory, M.A., Qi, Y., and Hann, S.R. (2003). Phosphorylation by glycogen synthase kinase-3 controls c-myc proteolysis and subnuclear localization. J Biol Chem 278, 51606-51612. Griffin, R.J., Moloney, A., Kelliher, M., Johnston, J.A., Ravid, R., Dockery, P., O'Connor, R., and O'Neill, C. (2005). Activation of Akt/PKB, increased phosphorylation of Akt substrates and loss and altered distribution of Akt and PTEN are features of Alzheimer's disease pathology. J Neurochem 93, 105-117. Grimes, C.A., and Jope, R.S. (2001a). CREB DNA binding activity is inhibited by glycogen synthase kinase-3 beta and facilitated by lithium. J Neurochem 78, 1219-1232. Grimes, C.A., and Jope, R.S. (2001b). The multifaceted roles of glycogen synthase kinase 3beta in cellular signaling. Prog Neurobiol 65, 391-426. Grivennikov, S.I., Greten, F.R., and Karin, M. (2010). Immunity, inflammation, and cancer. Cell 140, 883-899. Grundke-Iqbal, I., Fleming, J., Tung, Y.C., Lassmann, H., Iqbal, K., and Joshi, J.G. (1990). Ferritin is a component of the neuritic (senile) plaque in Alzheimer dementia. Acta Neuropathol 81, 105-110. Grundke-Iqbal, I., Iqbal, K., Quinlan, M., Tung, Y.C., Zaidi, M.S., and Wisniewski, H.M. (1986). Microtubule-associated protein tau. A component of Alzheimer paired helical filaments. J Biol Chem 261, 6084-6089. Haan, M.N. (2006). Therapy Insight: type 2 diabetes mellitus and the risk of late-onset Alzheimer's disease. Nat Clin Pract Neurol 2, 159-166. Hagen, T., Di Daniel, E., Culbert, A.A., and Reith, A.D. (2002). Expression and characterization of GSK-3 mutants and their effect on beta-catenin phosphorylation in intact cells. J Biol Chem 277, 23330-23335. Hagen, T., and Vidal-Puig, A. (2002). Characterisation of the phosphorylation of beta-catenin at the GSK-3 priming site Ser45. Biochem Biophys Res Commun 294, 324-328. Hall, A.C., Brennan, A., Goold, R.G., Cleverley, K., Lucas, F.R., Gordon-Weeks, P.R., and Salinas, P.C. (2002). Valproate regulates GSK-3-mediated axonal remodeling and synapsin I clustering in developing neurons. Mol Cell Neurosci 20, 257-270. Bibliography 139 Hanger, D.P., Betts, J.C., Loviny, T.L., Blackstock, W.P., and Anderton, B.H. (1998). New phosphorylation sites identified in hyperphosphorylated tau (paired helical filament-tau) from Alzheimer's disease brain using nanoelectrospray mass spectrometry. J Neurochem 71, 2465-2476. Hanger, D.P., Hughes, K., Woodgett, J.R., Brion, J.P., and Anderton, B.H. (1992). Glycogen synthase kinase-3 induces Alzheimer's disease-like phosphorylation of tau: generation of paired helical filament epitopes and neuronal localisation of the kinase. Neurosci Lett 147, 58-62. Haniu, M., Denis, P., Young, Y., Mendiaz, E.A., Fuller, J., Hui, J.O., Bennett, B.D., Kahn, S., Ross, S., Burgess, T., et al. (2000). Characterization of Alzheimer's beta -Secretase Protein BACE. A PEPSIN FAMILY MEMBER WITH UNUSUAL PROPERTIES. J. Biol. Chem. 275, 21099- 21106. Hansen, L., Arden, K.C., Rasmussen, S.B., Viars, C.S., Vestergaard, H., Hansen, T., Moller, A.M., Woodgett, J.R., and Pedersen, O. (1997). Chromosomal mapping and mutational analysis of the coding region of the glycogen synthase kinase-3alpha and beta isoforms in patients with NIDDM. Diabetologia 40, 940-946. Harada, N., Tamai, Y., Ishikawa, T., Sauer, B., Takaku, K., Oshima, M., and Taketo, M.M. (1999). Intestinal polyposis in mice with a dominant stable mutation of the beta-catenin gene. EMBO J 18, 5931-5942. Hardy, J., and Selkoe, D.J. (2002). The amyloid hypothesis of Alzheimer's disease: progress and problems on the road to therapeutics. Science 297, 353-356. Hart, M.J., de los Santos, R., Albert, I.N., Rubinfeld, B., and Polakis, P. (1998). Downregulation of beta-catenin by human Axin and its association with the APC tumor suppressor, beta-catenin and GSK3 beta. Curr Biol 8, 573-581. Harwood, A.J. (2003). Neurodevelopment and mood stabilizers. Curr Mol Med 3, 472-482. Heffernan, J.M., Eastwood, S.L., Nagy, Z., Sanders, M.W., McDonald, B., and Harrison, P.J. (1998). Temporal cortex synaptophysin mRNA is reduced in Alzheimer's disease and is negatively correlated with the severity of dementia. Exp Neurol 150, 235-239. Hemmings, B.A., Yellowlees, D., Kernohan, J.C., and Cohen, P. (1981). Purification of glycogen synthase kinase 3 from rabbit skeletal muscle. Copurification with the activating factor (FA) of the (Mg-ATP) dependent protein phosphatase. Eur J Biochem 119, 443-451. Hergovich, A., Lisztwan, J., Thoma, C.R., Wirbelauer, C., Barry, R.E., and Krek, W. (2006). Priming-dependent phosphorylation and regulation of the tumor suppressor pVHL by glycogen synthase kinase 3. Mol Cell Biol 26, 5784-5796. Herrmann, N., Lanctot, K.L., Rothenburg, L.S., and Eryavec, G. (2007). A placebo-controlled trial of valproate for agitation and aggression in Alzheimer's disease. Dement Geriatr Cogn Disord 23, 116-119. Bibliography 140 Hiraoka, Y., Ohno, M., Yoshida, K., Okawa, K., Tomimoto, H., Kita, T., and Nishi, E. (2007). Enhancement of alpha-secretase cleavage of amyloid precursor protein by a metalloendopeptidase nardilysin. J Neurochem 102, 1595-1605. Hirvonen, M.R., and Savolainen, K. (1991). Lithium-induced decrease of brain inositol and increase of brain inositol-1-phosphate is transient. Neurochem Res 16, 905-911. Ho, L., Qin, W., Pompl, P.N., Xiang, Z., Wang, J., Zhao, Z., Peng, Y., Cambareri, G., Rocher, A., Mobbs, C.V., et al. (2004). Diet-induced insulin resistance promotes amyloidosis in a transgenic mouse model of Alzheimer's disease. FASEB J 18, 902-904. Hoeflich, K.P., Luo, J., Rubie, E.A., Tsao, M.S., Jin, O., and Woodgett, J.R. (2000). Requirement for glycogen synthase kinase-3beta in cell survival and NF-kappaB activation. Nature 406, 86-90. Holsinger, R.M., McLean, C.A., Beyreuther, K., Masters, C.L., and Evin, G. (2002). Increased expression of the amyloid precursor beta-secretase in Alzheimer's disease. Ann Neurol 51, 783- 786. Hooper, C., Killick, R., and Lovestone, S. (2008). The GSK3 hypothesis of Alzheimer's disease. J Neurochem 104, 1433-1439. Hoshi, M., Takashima, A., Noguchi, K., Murayama, M., Sato, M., Kondo, S., Saitoh, Y., Ishiguro, K., Hoshino, T., and Imahori, K. (1996). Regulation of mitochondrial pyruvate dehydrogenase activity by tau protein kinase I/glycogen synthase kinase 3beta in brain. Proc Natl Acad Sci U S A 93, 2719-2723. Hsiao, K., Chapman, P., Nilsen, S., Eckman, C., Harigaya, Y., Younkin, S., Yang, F., and Cole, G. (1996). Correlative memory deficits, Abeta elevation, and amyloid plaques in transgenic mice. Science 274, 99-102. Hu, M., Waring, J.F., Gopalakrishnan, M., and Li, J. (2008). Role of GSK-3beta activation and alpha7 nAChRs in Abeta(1-42)-induced tau phosphorylation in PC12 cells. J Neurochem 106, 1371-1377. Hu, S., Begum, A.N., Jones, M.R., Oh, M.S., Beech, W.K., Beech, B.H., Yang, F., Chen, P., Ubeda, O.J., Kim, P.C., et al. (2009). GSK3 inhibitors show benefits in an Alzheimer's disease (AD) model of neurodegeneration but adverse effects in control animals. Neurobiol Dis 33, 193- 206. Hu, X., Hicks, C.W., He, W., Wong, P., Macklin, W.B., Trapp, B.D., and Yan, R. (2006). Bace1 modulates myelination in the central and peripheral nervous system. Nat Neurosci 9, 1520-1525. Huang, L.E., and Bunn, H.F. (2003). Hypoxia-inducible factor and its biomedical relevance. J Biol Chem 278, 19575-19578. Huang, L.E., Willmore, W.G., Gu, J., Goldberg, M.A., and Bunn, H.F. (1999). Inhibition of hypoxia-inducible factor 1 activation by carbon monoxide and nitric oxide. Implications for oxygen sensing and signaling. J Biol Chem 274, 9038-9044. Bibliography 141 Hughes, K., Ramakrishna, S., Benjamin, W.B., and Woodgett, J.R. (1992). Identification of multifunctional ATP-citrate lyase kinase as the alpha-isoform of glycogen synthase kinase-3. Biochem J 288 ( Pt 1), 309-314. Huse, J.T., Pijak, D.S., Leslie, G.J., Lee, V.M.-Y., and Doms, R.W. (2000). Maturation and Endosomal Targeting of beta -Site Amyloid Precursor Protein-cleaving Enzyme. THE ALZHEIMER'S DISEASE beta -SECRETASE. J. Biol. Chem. 275, 33729-33737. Hussain, I., Hawkins, J., Harrison, D., Hille, C., Wayne, G., Cutler, L., Buck, T., Walter, D., Demont, E., Howes, C., et al. (2007). Oral administration of a potent and selective non-peptidic BACE-1 inhibitor decreases beta-cleavage of amyloid precursor protein and amyloid-beta production in vivo. J Neurochem 100, 802-809. Hussain, I., Powell, D.J., Howlett, D.R., Chapman, G.A., Gilmour, L., Murdock, P.R., Tew, D.G., Meek, T.D., Chapman, C., Schneider, K., et al. (2000). ASP1 (BACE2) cleaves the amyloid precursor protein at the beta-secretase site. Mol Cell Neurosci 16, 609-619. Hye, A., Kerr, F., Archer, N., Foy, C., Poppe, M., Brown, R., Hamilton, G., Powell, J., Anderton, B., and Lovestone, S. (2005). Glycogen synthase kinase-3 is increased in white cells early in Alzheimer's disease. Neurosci Lett 373, 1-4. Ikeda, S., Kishida, M., Matsuura, Y., Usui, H., and Kikuchi, A. (2000). GSK-3beta-dependent phosphorylation of adenomatous polyposis coli gene product can be modulated by beta-catenin and protein phosphatase 2A complexed with Axin. Oncogene 19, 537-545. Ikeda, S., Kishida, S., Yamamoto, H., Murai, H., Koyama, S., and Kikuchi, A. (1998). Axin, a negative regulator of the Wnt signaling pathway, forms a complex with GSK-3beta and beta- catenin and promotes GSK-3beta-dependent phosphorylation of beta-catenin. EMBO J 17, 1371- 1384. Imahori, K., Hoshi, M., Ishiguro, K., Sato, K., Takahashi, M., Shiurba, R., Yamaguchi, H., Takashima, A., and Uchida, T. (1998). Possible role of tau protein kinases in pathogenesis of Alzheimer's disease. Neurobiol Aging 19, S93-98. Inestrosa, N.C., Varela-Nallar, L., Grabowski, C.P., and Colombres, M. (2007). Synaptotoxicity in Alzheimer's disease: the Wnt signaling pathway as a molecular target. IUBMB Life 59, 316-321. Iqbal, K., Grundke-Iqbal, I., Smith, A.J., George, L., Tung, Y.C., and Zaidi, T. (1989). Identification and localization of a tau peptide to paired helical filaments of Alzheimer disease. Proc Natl Acad Sci U S A 86, 5646-5650. Ishiguro, K., Shiratsuchi, A., Sato, S., Omori, A., Arioka, M., Kobayashi, S., Uchida, T., and Imahori, K. (1993). Glycogen synthase kinase 3 beta is identical to tau protein kinase I generating several epitopes of paired helical filaments. FEBS Lett 325, 167-172. Jack, C.R., Jr., Lowe, V.J., Weigand, S.D., Wiste, H.J., Senjem, M.L., Knopman, D.S., Shiung, M.M., Gunter, J.L., Boeve, B.F., Kemp, B.J., et al. (2009). Serial PIB and MRI in normal, mild Bibliography 142 cognitive impairment and Alzheimer's disease: implications for sequence of pathological events in Alzheimer's disease. Brain 132, 1355-1365. Jack, C.R., Jr., Wiste, H.J., Vemuri, P., Weigand, S.D., Senjem, M.L., Zeng, G., Bernstein, M.A., Gunter, J.L., Pankratz, V.S., Aisen, P.S., et al. (2010). Brain beta-amyloid measures and magnetic resonance imaging atrophy both predict time-to-progression from mild cognitive impairment to Alzheimer's disease. Brain 133, 3336-3348. Jackson, G.R., Wiedau-Pazos, M., Sang, T.K., Wagle, N., Brown, C.A., Massachi, S., and Geschwind, D.H. (2002). Human wild-type tau interacts with wingless pathway components and produces neurofibrillary pathology in Drosophila. Neuron 34, 509-519. Janson, J., Laedtke, T., Parisi, J.E., O'Brien, P., Petersen, R.C., and Butler, P.C. (2004). Increased risk of type 2 diabetes in Alzheimer disease. Diabetes 53, 474-481. Jaworski, T., Dewachter, I., Lechat, B., Gees, M., Kremer, A., Demedts, D., Borghgraef, P., Devijver, H., Kugler, S., Patel, S., et al. (2011). GSK-3alpha/beta kinases and amyloid production in vivo. Nature 480, E4-5; discussion E6. Jia, J., Amanai, K., Wang, G., Tang, J., Wang, B., and Jiang, J. (2002). Shaggy/GSK3 antagonizes Hedgehog signalling by regulating Cubitus interruptus. Nature 416, 548-552. Jimenez, S., Torres, M., Vizuete, M., Sanchez-Varo, R., Sanchez-Mejias, E., Trujillo-Estrada, L., Carmona-Cuenca, I., Caballero, C., Ruano, D., Gutierrez, A., and Vitorica, J. (2011). Age- dependent accumulation of soluble amyloid beta (Abeta) oligomers reverses the neuroprotective effect of soluble amyloid precursor protein-alpha (sAPP(alpha)) by modulating phosphatidylinositol 3-kinase (PI3K)/Akt-GSK-3beta pathway in Alzheimer mouse model. J Biol Chem 286, 18414-18425. Jo, J., Whitcomb, D.J., Olsen, K.M., Kerrigan, T.L., Lo, S.C., Bru-Mercier, G., Dickinson, B., Scullion, S., Sheng, M., Collingridge, G., and Cho, K. Abeta(1-42) inhibition of LTP is mediated by a signaling pathway involving caspase-3, Akt1 and GSK-3beta. Nat Neurosci 14, 545-547. Jolivalt, C.G., Hurford, R., Lee, C.A., Dumaop, W., Rockenstein, E., and Masliah, E. (2010). Type 1 diabetes exaggerates features of Alzheimer's disease in APP transgenic mice. Exp Neurol 223, 422-431. Jope, R.S., and Roh, M.S. (2006). Glycogen synthase kinase-3 (GSK3) in psychiatric diseases and therapeutic interventions. Curr Drug Targets 7, 1421-1434. Jope, R.S., Yuskaitis, C.J., and Beurel, E. (2007). Glycogen synthase kinase-3 (GSK3): inflammation, diseases, and therapeutics. Neurochem Res 32, 577-595. Joshi, S.N., and Crutcher, K.A. (1998). Rat microglia exhibit increased density on Alzheimer's plaques in vitro. Exp Neurol 149, 42-50. Bibliography 143 Kaidanovich-Beilin, O., Lipina, T.V., Takao, K., van Eede, M., Hattori, S., Laliberte, C., Khan, M., Okamoto, K., Chambers, J.W., Fletcher, P.J., et al. (2009). Abnormalities in brain structure and behavior in GSK-3alpha mutant mice. Mol Brain 2, 35. Kaidanovich-Beilin, O., and Woodgett, J.R. (2011). GSK-3: Functional Insights from Cell Biology and Animal Models. Front Mol Neurosci 4, 40. Kamenetz, F., Tomita, T., Hsieh, H., Seabrook, G., Borchelt, D., Iwatsubo, T., Sisodia, S., and Malinow, R. (2003). APP processing and synaptic function. Neuron 37, 925-937. Kang, J., Lemaire, H.G., Unterbeck, A., Salbaum, J.M., Masters, C.L., Grzeschik, K.H., Multhaup, G., Beyreuther, K., and Muller-Hill, B. (1987). The precursor of Alzheimer's disease amyloid A4 protein resembles a cell-surface receptor. Nature 325, 733-736. Kao, S.-C., Krichevsky, A.M., Kosik, K.S., and Tsai, L.-H. (2004). BACE1 Suppression by RNA Interference in Primary Cortical Neurons. J. Biol. Chem. 279, 1942-1949. Kim, A.J., Shi, Y., Austin, R.C., and Werstuck, G.H. (2005). Valproate protects cells from ER stress-induced lipid accumulation and apoptosis by inhibiting glycogen synthase kinase-3. J Cell Sci 118, 89-99. Kim, S.H., Ikeuchi, T., Yu, C., and Sisodia, S.S. (2003). Regulated hyperaccumulation of presenilin-1 and the \"gamma-secretase\" complex. Evidence for differential intramembranous processing of transmembrane subatrates. J Biol Chem 278, 33992-34002. Kimberly, W.T., LaVoie, M.J., Ostaszewski, B.L., Ye, W., Wolfe, M.S., and Selkoe, D.J. (2003). Gamma-secretase is a membrane protein complex comprised of presenilin, nicastrin, Aph-1, and Pen-2. Proc Natl Acad Sci U S A 100, 6382-6387. Kimberly, W.T., Xia, W., Rahmati, T., Wolfe, M.S., and Selkoe, D.J. (2000). The transmembrane aspartates in presenilin 1 and 2 are obligatory for gamma-secretase activity and amyloid beta- protein generation. J Biol Chem 275, 3173-3178. King, T.D., Bijur, G.N., and Jope, R.S. (2001). Caspase-3 activation induced by inhibition of mitochondrial complex I is facilitated by glycogen synthase kinase-3beta and attenuated by lithium. Brain Res 919, 106-114. Kirschenbaum, F., Hsu, S.C., Cordell, B., and McCarthy, J.V. (2001). Substitution of a glycogen synthase kinase-3beta phosphorylation site in presenilin 1 separates presenilin function from beta- catenin signaling. J Biol Chem 276, 7366-7375. Kirschling, C.M., Kolsch, H., Frahnert, C., Rao, M.L., Maier, W., and Heun, R. (2003). Polymorphism in the BACE gene influences the risk for Alzheimer's disease. Neuroreport 14, 1243-1246. Kitaguchi, N., Takahashi, Y., Tokushima, Y., Shiojiri, S., and Ito, H. (1988). Novel precursor of Alzheimer's disease amyloid protein shows protease inhibitory activity. Nature 331, 530-532. Bibliography 144 Kitazume, S., Tachida, Y., Oka, R., Shirotani, K., Saido, T.C., and Hashimoto, Y. (2001). Alzheimer's beta-secretase, beta-site amyloid precursor protein-cleaving enzyme, is responsible for cleavage secretion of a Golgi-resident sialyltransferase. Proc Natl Acad Sci U S A 98, 13554- 13559. Klein, P.S., and Melton, D.A. (1996). A molecular mechanism for the effect of lithium on development. Proc Natl Acad Sci U S A 93, 8455-8459. Ko, R., Jang, H.D., and Lee, S.Y. (2010). GSK3beta Inhibitor Peptide Protects Mice from LPS- induced Endotoxin Shock. Immune Netw 10, 99-103. Koh, S.H., Noh, M.Y., and Kim, S.H. (2008). Amyloid-beta-induced neurotoxicity is reduced by inhibition of glycogen synthase kinase-3. Brain Res 1188, 254-262. Kopan, R., Schroeter, E.H., Weintraub, H., and Nye, J.S. (1996). Signal transduction by activated mNotch: importance of proteolytic processing and its regulation by the extracellular domain. Proc Natl Acad Sci U S A 93, 1683-1688. Korinek, V., Barker, N., Moerer, P., van Donselaar, E., Huls, G., Peters, P.J., and Clevers, H. (1998). Depletion of epithelial stem-cell compartments in the small intestine of mice lacking Tcf- 4. Nat Genet 19, 379-383. Korinek, V., Barker, N., Morin, P.J., van Wichen, D., de Weger, R., Kinzler, K.W., Vogelstein, B., and Clevers, H. (1997). Constitutive transcriptional activation by a beta-catenin-Tcf complex in APC-/- colon carcinoma. Science 275, 1784-1787. Kosik, K.S., Joachim, C.L., and Selkoe, D.J. (1986). Microtubule-associated protein tau (tau) is a major antigenic component of paired helical filaments in Alzheimer disease. Proc Natl Acad Sci U S A 83, 4044-4048. Kotova, O., Al-Khalili, L., Talia, S., Hooke, C., Fedorova, O.V., Bagrov, A.Y., and Chibalin, A.V. (2006). Cardiotonic steroids stimulate glycogen synthesis in human skeletal muscle cells via a Src- and ERK1/2-dependent mechanism. J Biol Chem 281, 20085-20094. Lammich, S., Schobel, S., Zimmer, A.K., Lichtenthaler, S.F., and Haass, C. (2004). Expression of the Alzheimer protease BACE1 is suppressed via its 5'-untranslated region. EMBO Rep 5, 620- 625. Lee, H.K., Kumar, P., Fu, Q., Rosen, K.M., and Querfurth, H.W. (2009). The insulin/Akt signaling pathway is targeted by intracellular beta-amyloid. Mol Biol Cell 20, 1533-1544. Lee, J., and Kim, M.S. (2007). The role of GSK3 in glucose homeostasis and the development of insulin resistance. Diabetes Res Clin Pract 77 Suppl 1, S49-57. Lemere, C.A., Blusztajn, J.K., Yamaguchi, H., Wisniewski, T., Saido, T.C., and Selkoe, D.J. (1996). Sequence of deposition of heterogeneous amyloid beta-peptides and APO E in Down syndrome: implications for initial events in amyloid plaque formation. Neurobiol Dis 3, 16-32. Bibliography 145 Leng, Y., Liang, M.H., Ren, M., Marinova, Z., Leeds, P., and Chuang, D.M. (2008). Synergistic neuroprotective effects of lithium and valproic acid or other histone deacetylase inhibitors in neurons: roles of glycogen synthase kinase-3 inhibition. J Neurosci 28, 2576-2588. Leost, M., Schultz, C., Link, A., Wu, Y.Z., Biernat, J., Mandelkow, E.M., Bibb, J.A., Snyder, G.L., Greengard, P., Zaharevitz, D.W., et al. (2000). Paullones are potent inhibitors of glycogen synthase kinase-3beta and cyclin-dependent kinase 5/p25. Eur J Biochem 267, 5983-5994. Leroy, K., Boutajangout, A., Authelet, M., Woodgett, J.R., Anderton, B.H., and Brion, J.P. (2002). The active form of glycogen synthase kinase-3beta is associated with granulovacuolar degeneration in neurons in Alzheimer's disease. Acta Neuropathol 103, 91-99. Leroy, K., and Brion, J.P. (1999). Developmental expression and localization of glycogen synthase kinase-3beta in rat brain. J Chem Neuroanat 16, 279-293. Levy, E., Carman, M.D., Fernandez-Madrid, I.J., Power, M.D., Lieberburg, I., van Duinen, S.G., Bots, G.T., Luyendijk, W., and Frangione, B. (1990). Mutation of the Alzheimer's disease amyloid gene in hereditary cerebral hemorrhage, Dutch type. Science 248, 1124-1126. Levy-Lahad, E., Wasco, W., Poorkaj, P., Romano, D.M., Oshima, J., Pettingell, W.H., Yu, C.E., Jondro, P.D., Schmidt, S.D., Wang, K., and et al. (1995a). Candidate gene for the chromosome 1 familial Alzheimer's disease locus. Science 269, 973-977. Levy-Lahad, E., Wijsman, E.M., Nemens, E., Anderson, L., Goddard, K.A., Weber, J.L., Bird, T.D., and Schellenberg, G.D. (1995b). A familial Alzheimer's disease locus on chromosome 1. Science 269, 970-973. Li, Q., and Sudhof, T.C. (2004). Cleavage of amyloid-beta precursor protein and amyloid-beta precursor-like protein by BACE 1. J Biol Chem 279, 10542-10550. Li, X., Bijur, G.N., and Jope, R.S. (2002). Glycogen synthase kinase-3beta, mood stabilizers, and neuroprotection. Bipolar Disord 4, 137-144. Li, Y., Zhou, W., Tong, Y., He, G., and Song, W. (2006). Control of APP processing and Abeta generation level by BACE1 enzymatic activity and transcription. FASEB J 20, 285-292. Li, Y.M., Lai, M.T., Xu, M., Huang, Q., DiMuzio-Mower, J., Sardana, M.K., Shi, X.P., Yin, K.C., Shafer, J.A., and Gardell, S.J. (2000). Presenilin 1 is linked with gamma-secretase activity in the detergent solubilized state. Proc Natl Acad Sci U S A 97, 6138-6143. Liberman, Z., and Eldar-Finkelman, H. (2005). Serine 332 phosphorylation of insulin receptor substrate-1 by glycogen synthase kinase-3 attenuates insulin signaling. J Biol Chem 280, 4422- 4428. Lichtenthaler, S.F., Dominguez, D.I., Westmeyer, G.G., Reiss, K., Haass, C., Saftig, P., De Strooper, B., and Seed, B. (2003). The cell adhesion protein P-selectin glycoprotein ligand-1 is a substrate for the aspartyl protease BACE1. J Biol Chem 278, 48713-48719. Bibliography 146 Liu, C., Li, Y., Semenov, M., Han, C., Baeg, G.H., Tan, Y., Zhang, Z., Lin, X., and He, X. (2002). Control of beta-catenin phosphorylation/degradation by a dual-kinase mechanism. Cell 108, 837- 847. Lu, T., Pan, Y., Kao, S.Y., Li, C., Kohane, I., Chan, J., and Yankner, B.A. (2004). Gene regulation and DNA damage in the ageing human brain. Nature 429, 883-891. Lucas, F.R., Goold, R.G., Gordon-Weeks, P.R., and Salinas, P.C. (1998). Inhibition of GSK-3beta leading to the loss of phosphorylated MAP-1B is an early event in axonal remodelling induced by WNT-7a or lithium. J Cell Sci 111 ( Pt 10), 1351-1361. Lucas, J.J., Hernandez, F., Gomez-Ramos, P., Moran, M.A., Hen, R., and Avila, J. (2001). Decreased nuclear beta-catenin, tau hyperphosphorylation and neurodegeneration in GSK-3beta conditional transgenic mice. EMBO J 20, 27-39. Lue, L.F., Kuo, Y.M., Roher, A.E., Brachova, L., Shen, Y., Sue, L., Beach, T., Kurth, J.H., Rydel, R.E., and Rogers, J. (1999). Soluble amyloid beta peptide concentration as a predictor of synaptic change in Alzheimer's disease. Am J Pathol 155, 853-862. Luo, Y., Bolon, B., Kahn, S., Bennett, B.D., Babu-Khan, S., Denis, P., Fan, W., Kha, H., Zhang, J., Gong, Y., et al. (2001). Mice deficient in BACE1, the Alzheimer's beta-secretase, have normal phenotype and abolished beta-amyloid generation. Nat Neurosci 4, 231-232. Ly, P.T.T., Cai, F., and Song, W. (2011). Detection of Neuritic Plaques in Alzheimer's Disease Mouse Model. J Vis Exp, e2831. Ma, T., and Klann, E. (2011). Amyloid beta: linking synaptic plasticity failure to memory disruption in Alzheimer's disease. J Neurochem 120 Suppl 1, 140-148. MacDonald, B.T., Tamai, K., and He, X. (2009). Wnt/beta-catenin signaling: components, mechanisms, and diseases. Dev Cell 17, 9-26. Mackie, K., Sorkin, B.C., Nairn, A.C., Greengard, P., Edelman, G.M., and Cunningham, B.A. (1989). Identification of two protein kinases that phosphorylate the neural cell-adhesion molecule, N-CAM. J Neurosci 9, 1883-1896. Maillard, I., Adler, S.H., and Pear, W.S. (2003). Notch and the immune system. Immunity 19, 781-791. Marcinkiewicz, M., and Seidah, N.G. (2000). Coordinated expression of beta-amyloid precursor protein and the putative beta-secretase BACE and alpha-secretase ADAM10 in mouse and human brain. J Neurochem 75, 2133-2143. Martin, M., Rehani, K., Jope, R.S., and Michalek, S.M. (2005). Toll-like receptor-mediated cytokine production is differentially regulated by glycogen synthase kinase 3. Nat Immunol 6, 777-784. Bibliography 147 Martinez, A., Alonso, M., Castro, A., Perez, C., and Moreno, F.J. (2002). First non-ATP competitive glycogen synthase kinase 3 beta (GSK-3beta) inhibitors: thiadiazolidinones (TDZD) as potential drugs for the treatment of Alzheimer's disease. J Med Chem 45, 1292-1299. Mateo, I., Infante, J., Llorca, J., Rodriguez, E., Berciano, J., and Combarros, O. (2006). Association between glycogen synthase kinase-3beta genetic polymorphism and late-onset Alzheimer's disease. Dement Geriatr Cogn Disord 21, 228-232. Matsuoka, Y., Picciano, M., Malester, B., LaFrancois, J., Zehr, C., Daeschner, J.M., Olschowka, J.A., Fonseca, M.I., O'Banion, M.K., Tenner, A.J., et al. (2001). Inflammatory responses to amyloidosis in a transgenic mouse model of Alzheimer's disease. Am J Pathol 158, 1345-1354. McConlogue, L., Buttini, M., Anderson, J.P., Brigham, E.F., Chen, K.S., Freedman, S.B., Games, D., Johnson-Wood, K., Lee, M., Zeller, M., et al. (2007). Partial reduction of BACE1 has dramatic effects on Alzheimer plaque and synaptic pathology in APP Transgenic Mice. J Biol Chem 282, 26326-26334. McGeer, E.G., and McGeer, P.L. (2010). Neuroinflammation in Alzheimer's disease and mild cognitive impairment: a field in its infancy. J Alzheimers Dis 19, 355-361. McManus, E.J., Sakamoto, K., Armit, L.J., Ronaldson, L., Shpiro, N., Marquez, R., and Alessi, D.R. (2005). Role that phosphorylation of GSK3 plays in insulin and Wnt signalling defined by knockin analysis. EMBO J 24, 1571-1583. Meares, G.P., and Jope, R.S. (2007). Resolution of the nuclear localization mechanism of glycogen synthase kinase-3: functional effects in apoptosis. J Biol Chem 282, 16989-17001. Meijer, L., Flajolet, M., and Greengard, P. (2004). Pharmacological inhibitors of glycogen synthase kinase 3. Trends Pharmacol Sci 25, 471-480. Meijer, L., Skaltsounis, A.L., Magiatis, P., Polychronopoulos, P., Knockaert, M., Leost, M., Ryan, X.P., Vonica, C.A., Brivanlou, A., Dajani, R., et al. (2003). GSK-3-selective inhibitors derived from Tyrian purple indirubins. Chem Biol 10, 1255-1266. Monti, B., Polazzi, E., and Contestabile, A. (2009). Biochemical, molecular and epigenetic mechanisms of valproic acid neuroprotection. Curr Mol Pharmacol 2, 95-109. Morishima-Kawashima, M., Hasegawa, M., Takio, K., Suzuki, M., Yoshida, H., Titani, K., and Ihara, Y. (1995). Proline-directed and non-proline-directed phosphorylation of PHF-tau. J Biol Chem 270, 823-829. Morris, J.C., Roe, C.M., Grant, E.A., Head, D., Storandt, M., Goate, A.M., Fagan, A.M., Holtzman, D.M., and Mintun, M.A. (2009). Pittsburgh compound B imaging and prediction of progression from cognitive normality to symptomatic Alzheimer disease. Arch Neurol 66, 1469- 1475. Morton, S., Davis, R.J., McLaren, A., and Cohen, P. (2003). A reinvestigation of the multisite phosphorylation of the transcription factor c-Jun. EMBO J 22, 3876-3886. Bibliography 148 Mottet, D., Dumont, V., Deccache, Y., Demazy, C., Ninane, N., Raes, M., and Michiels, C. (2003). Regulation of hypoxia-inducible factor-1alpha protein level during hypoxic conditions by the phosphatidylinositol 3-kinase/Akt/glycogen synthase kinase 3beta pathway in HepG2 cells. J Biol Chem 278, 31277-31285. Mukai, F., Ishiguro, K., Sano, Y., and Fujita, S.C. (2002). Alternative splicing isoform of tau protein kinase I/glycogen synthase kinase 3beta. J Neurochem 81, 1073-1083. Mullan, M., Houlden, H., Windelspecht, M., Fidani, L., Lombardi, C., Diaz, P., Rossor, M., Crook, R., Hardy, J., Duff, K., and et al. (1992). A locus for familial early-onset Alzheimer's disease on the long arm of chromosome 14, proximal to the alpha 1-antichymotrypsin gene. Nat Genet 2, 340-342. Naerum, L., Norskov-Lauritsen, L., and Olesen, P.H. (2002). Scaffold hopping and optimization towards libraries of glycogen synthase kinase-3 inhibitors. Bioorg Med Chem Lett 12, 1525-1528. Neal, J.W., and Clipstone, N.A. (2001). Glycogen synthase kinase-3 inhibits the DNA binding activity of NFATc. J Biol Chem 276, 3666-3673. Nicolaou, M., Song, Y.Q., Sato, C.A., Orlacchio, A., Kawarai, T., Medeiros, H., Liang, Y., Sorbi, S., Richard, E., Rogaev, E.I., et al. (2001). Mutations in the open reading frame of the beta-site APP cleaving enzyme (BACE) locus are not a common cause of Alzheimer's disease. Neurogenetics 3, 203-206. Nikoulina, S.E., Ciaraldi, T.P., Mudaliar, S., Carter, L., Johnson, K., and Henry, R.R. (2002). Inhibition of glycogen synthase kinase 3 improves insulin action and glucose metabolism in human skeletal muscle. Diabetes 51, 2190-2198. Noble, W., Planel, E., Zehr, C., Olm, V., Meyerson, J., Suleman, F., Gaynor, K., Wang, L., LaFrancois, J., Feinstein, B., et al. (2005). Inhibition of glycogen synthase kinase-3 by lithium correlates with reduced tauopathy and degeneration in vivo. Proc Natl Acad Sci U S A 102, 6990- 6995. Nonaka, S., and Chuang, D.M. (1998). Neuroprotective effects of chronic lithium on focal cerebral ischemia in rats. Neuroreport 9, 2081-2084. Nonaka, S., Hough, C.J., and Chuang, D.M. (1998). Chronic lithium treatment robustly protects neurons in the central nervous system against excitotoxicity by inhibiting N-methyl-D-aspartate receptor-mediated calcium influx. Proc Natl Acad Sci U S A 95, 2642-2647. Nowak, K., Lange-Dohna, C., Zeitschel, U., Gunther, A., Luscher, B., Robitzki, A., Perez-Polo, R., and Rossner, S. (2006). The transcription factor Yin Yang 1 is an activator of BACE1 expression. J Neurochem 96, 1696-1707. O'Brien, W.T., Harper, A.D., Jove, F., Woodgett, J.R., Maretto, S., Piccolo, S., and Klein, P.S. (2004). Glycogen synthase kinase-3beta haploinsufficiency mimics the behavioral and molecular effects of lithium. J Neurosci 24, 6791-6798. Bibliography 149 Ohno, M., Cole, S.L., Yasvoina, M., Zhao, J., Citron, M., Berry, R., Disterhoft, J.F., and Vassar, R. (2007). BACE1 gene deletion prevents neuron loss and memory deficits in 5XFAD APP/PS1 transgenic mice. Neurobiol Dis 26, 134-145. Ohno, M., Sametsky, E.A., Younkin, L.H., Oakley, H., Younkin, S.G., Citron, M., Vassar, R., and Disterhoft, J.F. (2004). BACE1 deficiency rescues memory deficits and cholinergic dysfunction in a mouse model of Alzheimer's disease. Neuron 41, 27-33. Oltersdorf, T., Ward, P.J., Henriksson, T., Beattie, E.C., Neve, R., Lieberburg, I., and Fritz, L.C. (1990). The Alzheimer amyloid precursor protein. Identification of a stable intermediate in the biosynthetic/degradative pathway. J Biol Chem 265, 4492-4497. Park, S.H., Park-Min, K.H., Chen, J., Hu, X., and Ivashkiv, L.B. (2011). Tumor necrosis factor induces GSK3 kinase-mediated cross-tolerance to endotoxin in macrophages. Nat Immunol 12, 607-615. Parker, P.J., Caudwell, F.B., and Cohen, P. (1983). Glycogen synthase from rabbit skeletal muscle; effect of insulin on the state of phosphorylation of the seven phosphoserine residues in vivo. Eur J Biochem 130, 227-234. Pastorino, L., Ikin, A.F., Lamprianou, S., Vacaresse, N., Revelli, J.P., Platt, K., Paganetti, P., Mathews, P.M., Harroch, S., and Buxbaum, J.D. (2004). BACE (beta-secretase) modulates the processing of APLP2 in vivo. Mol Cell Neurosci 25, 642-649. Pei, J.J., Braak, E., Braak, H., Grundke-Iqbal, I., Iqbal, K., Winblad, B., and Cowburn, R.F. (1999). Distribution of active glycogen synthase kinase 3beta (GSK-3beta) in brains staged for Alzheimer disease neurofibrillary changes. J Neuropathol Exp Neurol 58, 1010-1019. Phiel, C.J., and Klein, P.S. (2001). Molecular targets of lithium action. Annu Rev Pharmacol Toxicol 41, 789-813. Phiel, C.J., Wilson, C.A., Lee, V.M., and Klein, P.S. (2003). GSK-3alpha regulates production of Alzheimer's disease amyloid-beta peptides. Nature 423, 435-439. Phiel, C.J., Zhang, F., Huang, E.Y., Guenther, M.G., Lazar, M.A., and Klein, P.S. (2001). Histone deacetylase is a direct target of valproic acid, a potent anticonvulsant, mood stabilizer, and teratogen. J Biol Chem 276, 36734-36741. Polakis, P. (2000). Wnt signaling and cancer. Genes Dev 14, 1837-1851. Polvikoski, T., Sulkava, R., Haltia, M., Kainulainen, K., Vuorio, A., Verkkoniemi, A., Niinisto, L., Halonen, P., and Kontula, K. (1995). Apolipoprotein E, dementia, and cortical deposition of beta-amyloid protein. N Engl J Med 333, 1242-1247. Polychronopoulos, P., Magiatis, P., Skaltsounis, A.L., Myrianthopoulos, V., Mikros, E., Tarricone, A., Musacchio, A., Roe, S.M., Pearl, L., Leost, M., et al. (2004). Structural basis for the synthesis of indirubins as potent and selective inhibitors of glycogen synthase kinase-3 and cyclin- dependent kinases. J Med Chem 47, 935-946. Bibliography 150 Ponte, P., Gonzalez-DeWhitt, P., Schilling, J., Miller, J., Hsu, D., Greenberg, B., Davis, K., Wallace, W., Lieberburg, I., and Fuller, F. (1988). A new A4 amyloid mRNA contains a domain homologous to serine proteinase inhibitors. Nature 331, 525-527. Prasher, V.P., Farrer, M.J., Kessling, A.M., Fisher, E.M., West, R.J., Barber, P.C., and Butler, A.C. (1998). Molecular mapping of Alzheimer-type dementia in Down's syndrome. Ann Neurol 43, 380-383. Profenno, L.A., Jakimovich, L., Holt, C.J., Porsteinsson, A., and Tariot, P.N. (2005). A randomized, double-blind, placebo-controlled pilot trial of safety and tolerability of two doses of divalproex sodium in outpatients with probable Alzheimer's disease. Curr Alzheimer Res 2, 553- 558. Qing, H., He, G., Ly, P.T., Fox, C.J., Staufenbiel, M., Cai, F., Zhang, Z., Wei, S., Sun, X., Chen, C.H., et al. (2008). Valproic acid inhibits Abeta production, neuritic plaque formation, and behavioral deficits in Alzheimer's disease mouse models. J Exp Med 205, 2781-2789. Qing, H., Zhou, W., Christensen, M.A., Sun, X., Tong, Y., and Song, W. (2004). Degradation of BACE by the ubiquitin-proteasome pathway. Faseb J 18, 1571-1573. Qu, L., Huang, S., Baltzis, D., Rivas-Estilla, A.M., Pluquet, O., Hatzoglou, M., Koumenis, C., Taya, Y., Yoshimura, A., and Koromilas, A.E. (2004). Endoplasmic reticulum stress induces p53 cytoplasmic localization and prevents p53-dependent apoptosis by a pathway involving glycogen synthase kinase-3beta. Genes Dev 18, 261-277. Reddy, P.H., Mani, G., Park, B.S., Jacques, J., Murdoch, G., Whetsell, W., Jr., Kaye, J., and Manczak, M. (2005). Differential loss of synaptic proteins in Alzheimer's disease: implications for synaptic dysfunction. J Alzheimers Dis 7, 103-117; discussion 173-180. Reese, L.C., Laezza, F., Woltjer, R., and Taglialatela, G. (2011). Dysregulated phosphorylation of Ca(2+) /calmodulin-dependent protein kinase II-alpha in the hippocampus of subjects with mild cognitive impairment and Alzheimer's disease. J Neurochem 119, 791-804. Reitz, C., Brayne, C., and Mayeux, R. (2011). Epidemiology of Alzheimer disease. Nat Rev Neurol 7, 137-152. Ren, M., Senatorov, V.V., Chen, R.W., and Chuang, D.M. (2003). Postinsult treatment with lithium reduces brain damage and facilitates neurological recovery in a rat ischemia/reperfusion model. Proc Natl Acad Sci U S A 100, 6210-6215. Rising Tide: The Impact of Dementia on Canadian Society. (2010). Alzheimer\u00E2\u0080\u0099s Society of Canada. Ring, D.B., Johnson, K.W., Henriksen, E.J., Nuss, J.M., Goff, D., Kinnick, T.R., Ma, S.T., Reeder, J.W., Samuels, I., Slabiak, T., et al. (2003). Selective glycogen synthase kinase 3 inhibitors potentiate insulin activation of glucose transport and utilization in vitro and in vivo. Diabetes 52, 588-595. Bibliography 151 Roberds, S.L., Anderson, J., Basi, G., Bienkowski, M.J., Branstetter, D.G., Chen, K.S., Freedman, S.B., Frigon, N.L., Games, D., Hu, K., et al. (2001). BACE knockout mice are healthy despite lacking the primary beta-secretase activity in brain: implications for Alzheimer's disease therapeutics. Hum Mol Genet 10, 1317-1324. Rogaev, E.I., Sherrington, R., Rogaeva, E.A., Levesque, G., Ikeda, M., Liang, Y., Chi, H., Lin, C., Holman, K., Tsuda, T., and et al. (1995). Familial Alzheimer's disease in kindreds with missense mutations in a gene on chromosome 1 related to the Alzheimer's disease type 3 gene. Nature 376, 775-778. Rogers, G.W., Jr., Edelman, G.M., and Mauro, V.P. (2004). Differential utilization of upstream AUGs in the beta-secretase mRNA suggests that a shunting mechanism regulates translation. Proc Natl Acad Sci U S A 101, 2794-2799. Rossig, L., Badorff, C., Holzmann, Y., Zeiher, A.M., and Dimmeler, S. (2002). Glycogen synthase kinase-3 couples AKT-dependent signaling to the regulation of p21Cip1 degradation. J Biol Chem 277, 9684-9689. Rossner, S., Sastre, M., Bourne, K., and Lichtenthaler, S.F. (2006). Transcriptional and translational regulation of BACE1 expression--implications for Alzheimer's disease. Prog Neurobiol 79, 95-111. Rothstein, J.D., Patel, S., Regan, M.R., Haenggeli, C., Huang, Y.H., Bergles, D.E., Jin, L., Dykes Hoberg, M., Vidensky, S., Chung, D.S., et al. (2005). Beta-lactam antibiotics offer neuroprotection by increasing glutamate transporter expression. Nature 433, 73-77. Rubinfeld, B., Albert, I., Porfiri, E., Fiol, C., Munemitsu, S., and Polakis, P. (1996). Binding of GSK3beta to the APC-beta-catenin complex and regulation of complex assembly. Science 272, 1023-1026. Russo, C., Schettini, G., Saido, T.C., Hulette, C., Lippa, C., Lannfelt, L., Ghetti, B., Gambetti, P., Tabaton, M., and Teller, J.K. (2000). Presenilin-1 mutations in Alzheimer's disease. Nature 405, 531-532. Ryan, K.A., and Pimplikar, S.W. (2005). Activation of GSK-3 and phosphorylation of CRMP2 in transgenic mice expressing APP intracellular domain. J Cell Biol 171, 327-335. Rylatt, D.B., Aitken, A., Bilham, T., Condon, G.D., Embi, N., and Cohen, P. (1980). Glycogen synthase from rabbit skeletal muscle. Amino acid sequence at the sites phosphorylated by glycogen synthase kinase-3, and extension of the N-terminal sequence containing the site phosphorylated by phosphorylase kinase. Eur J Biochem 107, 529-537. Salkovic-Petrisic, M., Tribl, F., Schmidt, M., Hoyer, S., and Riederer, P. (2006). Alzheimer-like changes in protein kinase B and glycogen synthase kinase-3 in rat frontal cortex and hippocampus after damage to the insulin signalling pathway. J Neurochem 96, 1005-1015. Sambamurti, K., Kinsey, R., Maloney, B., Ge, Y.W., and Lahiri, D.K. (2004). Gene structure and organization of the human beta-secretase (BACE) promoter. FASEB J 18, 1034-1036. Bibliography 152 Sanchez, C., Perez, M., and Avila, J. (2000). GSK3beta-mediated phosphorylation of the microtubule-associated protein 2C (MAP2C) prevents microtubule bundling. Eur J Cell Biol 79, 252-260. Sastre, M., Dewachter, I., Rossner, S., Bogdanovic, N., Rosen, E., Borghgraef, P., Evert, B.O., Dumitrescu-Ozimek, L., Thal, D.R., Landreth, G., et al. (2006). Nonsteroidal anti-inflammatory drugs repress beta-secretase gene promoter activity by the activation of PPARgamma. Proc Natl Acad Sci U S A 103, 443-448. Scales, T.M., Lin, S., Kraus, M., Goold, R.G., and Gordon-Weeks, P.R. (2009). Nonprimed and DYRK1A-primed GSK3 beta-phosphorylation sites on MAP1B regulate microtubule dynamics in growing axons. J Cell Sci 122, 2424-2435. Schellenberg, G.D., Bird, T.D., Wijsman, E.M., Orr, H.T., Anderson, L., Nemens, E., White, J.A., Bonnycastle, L., Weber, J.L., Alonso, M.E., and et al. (1992). Genetic linkage evidence for a familial Alzheimer's disease locus on chromosome 14. Science 258, 668-671. Scheuner, D., Eckman, C., Jensen, M., Song, X., Citron, M., Suzuki, N., Bird, T.D., Hardy, J., Hutton, M., Kukull, W., et al. (1996). Secreted amyloid beta-protein similar to that in the senile plaques of Alzheimer's disease is increased in vivo by the presenilin 1 and 2 and APP mutations linked to familial Alzheimer's disease. Nat Med 2, 864-870. Schneider, J.A., Wilson, R.S., Cochran, E.J., Bienias, J.L., Arnold, S.E., Evans, D.A., and Bennett, D.A. (2003). Relation of cerebral infarctions to dementia and cognitive function in older persons. Neurology 60, 1082-1088. Schroeter, E.H., Kisslinger, J.A., and Kopan, R. (1998). Notch-1 signalling requires ligand- induced proteolytic release of intracellular domain. Nature 393, 382-386. Schwab, C., Klegeris, A., and McGeer, P.L. (2009). Inflammation in transgenic mouse models of neurodegenerative disorders. Biochim Biophys Acta 1802, 889-902. Sekita, A., and Kiyohara, Y. (2010). [Lifestyle-related diseases as risk factors for dementia]. Brain Nerve 62, 709-717. Selkoe, D.J., and Podlisny, M.B. (2002). Deciphering the genetic basis of Alzheimer's disease. Annu Rev Genomics Hum Genet 3, 67-99. Serneels, L., Van Biervliet, J., Craessaerts, K., Dejaegere, T., Horre, K., Van Houtvin, T., Esselmann, H., Paul, S., Schafer, M.K., Berezovska, O., et al. (2009). gamma-Secretase heterogeneity in the Aph1 subunit: relevance for Alzheimer's disease. Science 324, 639-642. Sharfi, H., and Eldar-Finkelman, H. (2008). Sequential phosphorylation of insulin receptor substrate-2 by glycogen synthase kinase-3 and c-Jun NH2-terminal kinase plays a role in hepatic insulin signaling. Am J Physiol Endocrinol Metab 294, E307-315. Bibliography 153 Sherrington, R., Rogaev, E.I., Liang, Y., Rogaeva, E.A., Levesque, G., Ikeda, M., Chi, H., Lin, C., Li, G., Holman, K., et al. (1995). Cloning of a gene bearing missense mutations in early-onset familial Alzheimer's disease. Nature 375, 754-760. Shi, J., Zhang, S., Tang, M., Liu, X., Li, T., Wang, Y., Han, H., Guo, Y., Hao, Y., Zheng, K., et al. (2004). The 1239G/C polymorphism in exon 5 of BACE1 gene may be associated with sporadic Alzheimer's disease in Chinese Hans. Am J Med Genet 124B, 54-57. Shi, X.P., Chen, E., Yin, K.C., Na, S., Garsky, V.M., Lai, M.T., Li, Y.M., Platchek, M., Register, R.B., Sardana, M.K., et al. (2001). The pro domain of beta-secretase does not confer strict zymogen-like properties but does assist proper folding of the protease domain. J Biol Chem 276, 10366-10373. Shruster, A., Eldar-Finkelman, H., Melamed, E., and Offen, D. (2010). Wnt signaling pathway overcomes the disruption of neuronal differentiation of neural progenitor cells induced by oligomeric amyloid beta-peptide. J Neurochem 116, 522-529. Sinha, S., Anderson, J.P., Barbour, R., Basi, G.S., Caccavello, R., Davis, D., Doan, M., Dovey, H.F., Frigon, N., Hong, J., et al. (1999). Purification and cloning of amyloid precursor protein beta-secretase from human brain. Nature 402, 537-540. Sisodia, S.S., Koo, E.H., Beyreuther, K., Unterbeck, A., and Price, D.L. (1990). Evidence that beta-amyloid protein in Alzheimer's disease is not derived by normal processing. Science 248, 492-495. Snowdon, D.A., Greiner, L.H., Mortimer, J.A., Riley, K.P., Greiner, P.A., and Markesbery, W.R. (1997). Brain infarction and the clinical expression of Alzheimer disease. The Nun Study. JAMA 277, 813-817. Sokolov, B.P., Tcherepanov, A.A., Haroutunian, V., and Davis, K.L. (2000). Levels of mRNAs encoding synaptic vesicle and synaptic plasma membrane proteins in the temporal cortex of elderly schizophrenic patients. Biol Psychiatry 48, 184-196. Song, W., Nadeau, P., Yuan, M., Yang, X., Shen, J., and Yankner, B.A. (1999). Proteolytic release and nuclear translocation of Notch-1 are induced by presenilin-1 and impaired by pathogenic presenilin-1 mutations. Proc Natl Acad Sci U S A 96, 6959-6963. Spittaels, K., Van den Haute, C., Van Dorpe, J., Geerts, H., Mercken, M., Bruynseels, K., Lasrado, R., Vandezande, K., Laenen, I., Boon, T., et al. (2000). Glycogen synthase kinase-3beta phosphorylates protein tau and rescues the axonopathy in the central nervous system of human four-repeat tau transgenic mice. J Biol Chem 275, 41340-41349. St George-Hyslop, P., Haines, J., Rogaev, E., Mortilla, M., Vaula, G., Pericak-Vance, M., Foncin, J.F., Montesi, M., Bruni, A., Sorbi, S., et al. (1992). Genetic evidence for a novel familial Alzheimer's disease locus on chromosome 14. Nat Genet 2, 330-334. Bibliography 154 Stalder, M., Phinney, A., Probst, A., Sommer, B., Staufenbiel, M., and Jucker, M. (1999). Association of microglia with amyloid plaques in brains of APP23 transgenic mice. Am J Pathol 154, 1673-1684. Stanger, B.Z., Datar, R., Murtaugh, L.C., and Melton, D.A. (2005). Direct regulation of intestinal fate by Notch. Proc Natl Acad Sci U S A 102, 12443-12448. Steinbrecher, K.A., Wilson, W., 3rd, Cogswell, P.C., and Baldwin, A.S. (2005). Glycogen synthase kinase 3beta functions to specify gene-specific, NF-kappaB-dependent transcription. Mol Cell Biol 25, 8444-8455. Steiner, H., Duff, K., Capell, A., Romig, H., Grim, M.G., Lincoln, S., Hardy, J., Yu, X., Picciano, M., Fechteler, K., et al. (1999). A loss of function mutation of presenilin-2 interferes with amyloid beta-peptide production and notch signaling. J Biol Chem 274, 28669-28673. Steiner, H., Winkler, E., Edbauer, D., Prokop, S., Basset, G., Yamasaki, A., Kostka, M., and Haass, C. (2002). PEN-2 is an integral component of the gamma-secretase complex required for coordinated expression of presenilin and nicastrin. J Biol Chem 277, 39062-39065. Stockley, J.H., and O'Neill, C. (2007). The proteins BACE1 and BACE2 and beta-secretase activity in normal and Alzheimer's disease brain. Biochem Soc Trans 35, 574-576. Sturchler-Pierrat, C., Abramowski, D., Duke, M., Wiederhold, K.H., Mistl, C., Rothacher, S., Ledermann, B., Burki, K., Frey, P., Paganetti, P.A., et al. (1997). Two amyloid precursor protein transgenic mouse models with Alzheimer disease-like pathology. Proc Natl Acad Sci U S A 94, 13287-13292. Sturchler-Pierrat, C., and Staufenbiel, M. (2000). Pathogenic mechanisms of Alzheimer's disease analyzed in the APP23 transgenic mouse model. Ann N Y Acad Sci 920, 134-139. Su, Y., Ryder, J., Li, B., Wu, X., Fox, N., Solenberg, P., Brune, K., Paul, S., Zhou, Y., Liu, F., and Ni, B. (2004). Lithium, a common drug for bipolar disorder treatment, regulates amyloid-beta precursor protein processing. Biochemistry 43, 6899-6908. Sun, X., Bromley-Brits, K., and Song, W. (2012). Regulation of beta-site APP-cleaving enzyme 1 gene expression and its role in Alzheimer's Disease. J Neurochem 120 Suppl 1, 62-70. Sun, X., He, G., Qing, H., Zhou, W., Dobie, F., Cai, F., Staufenbiel, M., Huang, L.E., and Song, W. (2006a). Hypoxia facilitates Alzheimer's disease pathogenesis by up-regulating BACE1 gene expression. Proc Natl Acad Sci U S A 103, 18727-18732. Sun, X., He, G., and Song, W. (2006b). BACE2, as a novel APP theta-secretase, is not responsible for the pathogenesis of Alzheimer's disease in Down syndrome. FASEB J 20, 1369-1376. Sun, X., Sato, S., Murayama, O., Murayama, M., Park, J.M., Yamaguchi, H., and Takashima, A. (2002). Lithium inhibits amyloid secretion in COS7 cells transfected with amyloid precursor protein C100. Neurosci Lett 321, 61-64. Bibliography 155 Sun, X., Wang, Y., Qing, H., Christensen, M.A., Liu, Y., Zhou, W., Tong, Y., Xiao, C., Huang, Y., Zhang, S., et al. (2005). Distinct transcriptional regulation and function of the human BACE2 and BACE1 genes. FASEB J 19, 739-749. Sundar, S., Jha, T.K., Thakur, C.P., Engel, J., Sindermann, H., Fischer, C., Junge, K., Bryceson, A., and Berman, J. (2002). Oral miltefosine for Indian visceral leishmaniasis. N Engl J Med 347, 1739-1746. Sutherland, C., Leighton, I.A., and Cohen, P. (1993). Inactivation of glycogen synthase kinase-3 beta by phosphorylation: new kinase connections in insulin and growth-factor signalling. Biochem J 296 ( Pt 1), 15-19. Szekely, C.A., Thorne, J.E., Zandi, P.P., Ek, M., Messias, E., Breitner, J.C., and Goodman, S.N. (2004). Nonsteroidal anti-inflammatory drugs for the prevention of Alzheimer's disease: a systematic review. Neuroepidemiology 23, 159-169. Taipale, J., and Beachy, P.A. (2001). The Hedgehog and Wnt signalling pathways in cancer. Nature 411, 349-354. Takada, Y., Fang, X., Jamaluddin, M.S., Boyd, D.D., and Aggarwal, B.B. (2004). Genetic deletion of glycogen synthase kinase-3beta abrogates activation of IkappaBalpha kinase, JNK, Akt, and p44/p42 MAPK but potentiates apoptosis induced by tumor necrosis factor. J Biol Chem 279, 39541-39554. Takahashi-Yanaga, F., Shiraishi, F., Hirata, M., Miwa, Y., Morimoto, S., and Sasaguri, T. (2004). Glycogen synthase kinase-3beta is tyrosine-phosphorylated by MEK1 in human skin fibroblasts. Biochem Biophys Res Commun 316, 411-415. Takashima, A., Honda, T., Yasutake, K., Michel, G., Murayama, O., Murayama, M., Ishiguro, K., and Yamaguchi, H. (1998). Activation of tau protein kinase I/glycogen synthase kinase-3beta by amyloid beta peptide (25-35) enhances phosphorylation of tau in hippocampal neurons. Neurosci Res 31, 317-323. Tanzi, R.E., McClatchey, A.I., Lamperti, E.D., Villa-Komaroff, L., Gusella, J.F., and Neve, R.L. (1988). Protease inhibitor domain encoded by an amyloid protein precursor mRNA associated with Alzheimer's disease. Nature 331, 528-530. Teller, J.K., Russo, C., DeBusk, L.M., Angelini, G., Zaccheo, D., Dagna-Bricarelli, F., Scartezzini, P., Bertolini, S., Mann, D.M., Tabaton, M., and Gambetti, P. (1996). Presence of soluble amyloid beta-peptide precedes amyloid plaque formation in Down's syndrome. Nat Med 2, 93-95. ter Haar, E., Coll, J.T., Austen, D.A., Hsiao, H.M., Swenson, L., and Jain, J. (2001). Structure of GSK3beta reveals a primed phosphorylation mechanism. Nat Struct Biol 8, 593-596. Thinakaran, G., Borchelt, D.R., Lee, M.K., Slunt, H.H., Spitzer, L., Kim, G., Ratovitsky, T., Davenport, F., Nordstedt, C., Seeger, M., et al. (1996). Endoproteolysis of presenilin 1 and accumulation of processed derivatives in vivo. Neuron 17, 181-190. Bibliography 156 Tokuda, T., Fukushima, T., Ikeda, S., Sekijima, Y., Shoji, S., Yanagisawa, N., and Tamaoka, A. (1997). Plasma levels of amyloid beta proteins Abeta1-40 and Abeta1-42(43) are elevated in Down's syndrome. Ann Neurol 41, 271-273. Trivedi, N., Marsh, P., Goold, R.G., Wood-Kaczmar, A., and Gordon-Weeks, P.R. (2005). Glycogen synthase kinase-3beta phosphorylation of MAP1B at Ser1260 and Thr1265 is spatially restricted to growing axons. J Cell Sci 118, 993-1005. Turenne, G.A., and Price, B.D. (2001). Glycogen synthase kinase3 beta phosphorylates serine 33 of p53 and activates p53's transcriptional activity. BMC Cell Biol 2, 12. Uemura, K., Kuzuya, A., Shimozono, Y., Aoyagi, N., Ando, K., Shimohama, S., and Kinoshita, A. (2007). GSK3beta activity modifies the localization and function of presenilin 1. J Biol Chem 282, 15823-15832. Van Dam, D., D'Hooge, R., Staufenbiel, M., Van Ginneken, C., Van Meir, F., and De Deyn, P.P. (2003). Age-dependent cognitive decline in the APP23 model precedes amyloid deposition. Eur J Neurosci 17, 388-396. Vassar, R., Bennett, B.D., Babu-Khan, S., Kahn, S., Mendiaz, E.A., Denis, P., Teplow, D.B., Ross, S., Amarante, P., Loeloff, R., et al. (1999). Beta-secretase cleavage of Alzheimer's amyloid precursor protein by the transmembrane aspartic protease BACE. Science 286, 735-741. Velliquette, R.A., O'Connor, T., and Vassar, R. (2005). Energy inhibition elevates beta-secretase levels and activity and is potentially amyloidogenic in APP transgenic mice: possible early events in Alzheimer's disease pathogenesis. J Neurosci 25, 10874-10883. Vermeer, S.E., Prins, N.D., den Heijer, T., Hofman, A., Koudstaal, P.J., and Breteler, M.M. (2003). Silent brain infarcts and the risk of dementia and cognitive decline. N Engl J Med 348, 1215-1222. von Arnim, C.A.F., Kinoshita, A., Peltan, I.D., Tangredi, M.M., Herl, L., Lee, B.M., Spoelgen, R., Hshieh, T.T., Ranganathan, S., Battey, F.D., et al. (2005). The Low Density Lipoprotein Receptor- related Protein (LRP) Is a Novel {beta}-Secretase (BACE1) Substrate. J. Biol. Chem. 280, 17777- 17785. Wagman, A.S., Johnson, K.W., and Bussiere, D.E. (2004). Discovery and development of GSK3 inhibitors for the treatment of type 2 diabetes. Curr Pharm Des 10, 1105-1137. Walsh, D.M., Klyubin, I., Fadeeva, J.V., Cullen, W.K., Anwyl, R., Wolfe, M.S., Rowan, M.J., and Selkoe, D.J. (2002). Naturally secreted oligomers of amyloid beta protein potently inhibit hippocampal long-term potentiation in vivo. Nature 416, 535-539. Walter, J., Fluhrer, R., Hartung, B., Willem, M., Kaether, C., Capell, A., Lammich, S., Multhaup, G., and Haass, C. (2001). Phosphorylation Regulates Intracellular Trafficking of beta -Secretase. J. Biol. Chem. 276, 14634-14641. Bibliography 157 Wang, Q.M., Fiol, C.J., DePaoli-Roach, A.A., and Roach, P.J. (1994). Glycogen synthase kinase-3 beta is a dual specificity kinase differentially regulated by tyrosine and serine/threonine phosphorylation. J Biol Chem 269, 14566-14574. Wang, R., Zhang, M., Zhou, W., Ly, P.T., Cai, F., and Song, W. NF-kappaB signaling inhibits ubiquitin carboxyl-terminal hydrolase L1 gene expression. J Neurochem 116, 1160-1170. Wang, R., Zhang, M., Zhou, W., Ly, P.T., Cai, F., and Song, W. (2011). NF-kappaB signaling inhibits ubiquitin carboxyl-terminal hydrolase L1 gene expression. J Neurochem 116, 1160-1170. Wang, W.-X., Rajeev, B.W., Stromberg, A.J., Ren, N., Tang, G., Huang, Q., Rigoutsos, I., and Nelson, P.T. (2008). The Expression of MicroRNA miR-107 Decreases Early in Alzheimer's Disease and May Accelerate Disease Progression through Regulation of {beta}-Site Amyloid Precursor Protein-Cleaving Enzyme 1. J. Neurosci. 28, 1213-1223. Wang, X., Paulin, F.E., Campbell, L.E., Gomez, E., O'Brien, K., Morrice, N., and Proud, C.G. (2001). Eukaryotic initiation factor 2B: identification of multiple phosphorylation sites in the epsilon-subunit and their functions in vivo. EMBO J 20, 4349-4359. Weggen, S., Eriksen, J.L., Das, P., Sagi, S.A., Wang, R., Pietrzik, C.U., Findlay, K.A., Smith, T.E., Murphy, M.P., Bulter, T., et al. (2001). A subset of NSAIDs lower amyloidogenic Abeta42 independently of cyclooxygenase activity. Nature 414, 212-216. Wei, W., Nguyen, L.N., Kessels, H.W., Hagiwara, H., Sisodia, S., and Malinow, R. (2010). Amyloid beta from axons and dendrites reduces local spine number and plasticity. Nat Neurosci 13, 190-196. Wei, W., Wang, X., and Kusiak, J.W. (2002). Signaling events in amyloid beta-peptide-induced neuronal death and insulin-like growth factor I protection. J Biol Chem 277, 17649-17656. Weidemann, A., Konig, G., Bunke, D., Fischer, P., Salbaum, J.M., Masters, C.L., and Beyreuther, K. (1989). Identification, biogenesis, and localization of precursors of Alzheimer's disease A4 amyloid protein. Cell 57, 115-126. Welsh, G.I., Miller, C.M., Loughlin, A.J., Price, N.T., and Proud, C.G. (1998). Regulation of eukaryotic initiation factor eIF2B: glycogen synthase kinase-3 phosphorylates a conserved serine which undergoes dephosphorylation in response to insulin. FEBS Lett 421, 125-130. Willem, M., Garratt, A.N., Novak, B., Citron, M., Kaufmann, S., Rittger, A., DeStrooper, B., Saftig, P., Birchmeier, C., and Haass, C. (2006). Control of Peripheral Nerve Myelination by the {beta}-Secretase BACE1. Science 314, 664-666. Wolfe, M.S. (2008). Gamma-secretase inhibition and modulation for Alzheimer's disease. Curr Alzheimer Res 5, 158-164. Wolfe, M.S., Xia, W., Ostaszewski, B.L., Diehl, T.S., Kimberly, W.T., and Selkoe, D.J. (1999). Two transmembrane aspartates in presenilin-1 required for presenilin endoproteolysis and gamma- secretase activity. Nature 398, 513-517. Bibliography 158 Woodgett, J.R. (1990). Molecular cloning and expression of glycogen synthase kinase-3/factor A. EMBO J 9, 2431-2438. Woodgett, J.R., Tonks, N.K., and Cohen, P. (1982). Identification of a calmodulin-dependent glycogen synthase kinase in rabbit skeletal muscle, distinct from phosphorylase kinase. FEBS Lett 148, 5-11. Woods, Y.L., Cohen, P., Becker, W., Jakes, R., Goedert, M., Wang, X., and Proud, C.G. (2001). The kinase DYRK phosphorylates protein-synthesis initiation factor eIF2Bepsilon at Ser539 and the microtubule-associated protein tau at Thr212: potential role for DYRK as a glycogen synthase kinase 3-priming kinase. Biochem J 355, 609-615. Xue, S., Jia, L., and Jia, J. (2006). Hypoxia and reoxygenation increased BACE1 mRNA and protein levels in human neuroblastoma SH-SY5Y cells. Neurosci Lett 405, 231-235. Yamaguchi, H., Ishiguro, K., Uchida, T., Takashima, A., Lemere, C.A., and Imahori, K. (1996). Preferential labeling of Alzheimer neurofibrillary tangles with antisera for tau protein kinase (TPK) I/glycogen synthase kinase-3 beta and cyclin-dependent kinase 5, a component of TPK II. Acta Neuropathol 92, 232-241. Yamamoto, H., Kishida, S., Kishida, M., Ikeda, S., Takada, S., and Kikuchi, A. (1999). Phosphorylation of axin, a Wnt signal negative regulator, by glycogen synthase kinase-3beta regulates its stability. J Biol Chem 274, 10681-10684. Yan, R., Bienkowski, M.J., Shuck, M.E., Miao, H., Tory, M.C., Pauley, A.M., Brashier, J.R., Stratman, N.C., Mathews, W.R., Buhl, A.E., et al. (1999). Membrane-anchored aspartyl protease with Alzheimer's disease beta-secretase activity. Nature 402, 533-537. Yang, L.B., Lindholm, K., Yan, R., Citron, M., Xia, W., Yang, X.L., Beach, T., Sue, L., Wong, P., Price, D., et al. (2003). Elevated beta-secretase expression and enzymatic activity detected in sporadic Alzheimer disease. Nat Med 9, 3-4. Yang, S.D., Song, J.S., Yu, J.S., and Shiah, S.G. (1993). Protein kinase FA/GSK-3 phosphorylates tau on Ser235-Pro and Ser404-Pro that are abnormally phosphorylated in Alzheimer's disease brain. J Neurochem 61, 1742-1747. Yankner, B.A., Dawes, L.R., Fisher, S., Villa-Komaroff, L., Oster-Granite, M.L., and Neve, R.L. (1989). Neurotoxicity of a fragment of the amyloid precursor associated with Alzheimer's disease. Science 245, 417-420. Yankner, B.A., Duffy, L.K., and Kirschner, D.A. (1990). Neurotrophic and neurotoxic effects of amyloid beta protein: reversal by tachykinin neuropeptides. Science 250, 279-282. Yost, C., Torres, M., Miller, J.R., Huang, E., Kimelman, D., and Moon, R.T. (1996). The axis- inducing activity, stability, and subcellular distribution of beta-catenin is regulated in Xenopus embryos by glycogen synthase kinase 3. Genes Dev 10, 1443-1454. Bibliography 159 Yu, G., Nishimura, M., Arawaka, S., Levitan, D., Zhang, L., Tandon, A., Song, Y.Q., Rogaeva, E., Chen, F., Kawarai, T., et al. (2000). Nicastrin modulates presenilin-mediated notch/glp-1 signal transduction and betaAPP processing. Nature 407, 48-54. Yuskaitis, C.J., and Jope, R.S. (2009). Glycogen synthase kinase-3 regulates microglial migration, inflammation, and inflammation-induced neurotoxicity. Cell Signal 21, 264-273. Zeng, X., Huang, H., Tamai, K., Zhang, X., Harada, Y., Yokota, C., Almeida, K., Wang, J., Doble, B., Woodgett, J., et al. (2008). Initiation of Wnt signaling: control of Wnt coreceptor Lrp6 phosphorylation/activation via frizzled, dishevelled and axin functions. Development 135, 367- 375. Zeng, X., Tamai, K., Doble, B., Li, S., Huang, H., Habas, R., Okamura, H., Woodgett, J., and He, X. (2005). A dual-kinase mechanism for Wnt co-receptor phosphorylation and activation. Nature 438, 873-877. Zhang, X., Zhou, K., Wang, R., Cui, J., Lipton, S.A., Liao, F.F., Xu, H., and Zhang, Y.W. (2007). Hypoxia-inducible factor 1alpha (HIF-1alpha)-mediated hypoxia increases BACE1 expression and beta-amyloid generation. J Biol Chem 282, 10873-10880. Zhao, J., Fu, Y., Yasvoina, M., Shao, P., Hitt, B., O'Connor, T., Logan, S., Maus, E., Citron, M., Berry, R., et al. (2007). Beta-site amyloid precursor protein cleaving enzyme 1 levels become elevated in neurons around amyloid plaques: implications for Alzheimer's disease pathogenesis. J Neurosci 27, 3639-3649. Zhao, W.Q., and Townsend, M. (2009). Insulin resistance and amyloidogenesis as common molecular foundation for type 2 diabetes and Alzheimer's disease. Biochim Biophys Acta 1792, 482-496. Zheng, W.H., Bastianetto, S., Mennicken, F., Ma, W., and Kar, S. (2002). Amyloid beta peptide induces tau phosphorylation and loss of cholinergic neurons in rat primary septal cultures. Neuroscience 115, 201-211. Zhou, W., Cai, F., Li, Y., Yang, G.S., O'Connor, K.D., Holt, R.A., and Song, W. (2010). BACE1 gene promoter single-nucleotide polymorphisms in Alzheimer's disease. Journal of molecular neuroscience : MN 42, 127-133. Zhou, W., and Song, W. (2006). Leaky scanning and reinitiation regulate BACE1 gene expression. Mol Cell Biol 26, 3353-3364. "@en . "Thesis/Dissertation"@en . "2012-11"@en . "10.14288/1.0072944"@en . "eng"@en . "Neuroscience"@en . "Vancouver : University of British Columbia Library"@en . "University of British Columbia"@en . "Attribution-NonCommercial-NoDerivs 3.0 Unported"@en . "http://creativecommons.org/licenses/by-nc-nd/3.0/"@en . "Graduate"@en . "Glycogen synthase kinase-3 signaling in Alzheimer's disease : regulation of beta-amyloid precursor protein processing and amyloid beta protein production"@en . "Text"@en . "http://hdl.handle.net/2429/42848"@en .