{"http:\/\/dx.doi.org\/10.14288\/1.0442039":{"http:\/\/vivoweb.org\/ontology\/core#departmentOrSchool":[{"value":"Medicine, Faculty of","type":"literal","lang":"en"},{"value":"Medical Genetics, Department of","type":"literal","lang":"en"}],"http:\/\/www.europeana.eu\/schemas\/edm\/dataProvider":[{"value":"DSpace","type":"literal","lang":"en"}],"https:\/\/open.library.ubc.ca\/terms#degreeCampus":[{"value":"UBCV","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/creator":[{"value":"Fang, Sherry","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/issued":[{"value":"2024-04-29T20:28:22Z","type":"literal","lang":"en"},{"value":"2024","type":"literal","lang":"en"}],"http:\/\/vivoweb.org\/ontology\/core#relatedDegree":[{"value":"Master of Science - MSc","type":"literal","lang":"en"}],"https:\/\/open.library.ubc.ca\/terms#degreeGrantor":[{"value":"University of British Columbia","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/description":[{"value":"Primordial germ cells (PGCs) undergo dynamic epigenetic changes during development, including genome-wide erasure of DNA methylation for the establishment of a clean epigenetic slate in the developing germ cells. While this epigenetic reprogramming is essential for cellular pluripotency and gamete maturation, the underlying mechanisms remain poorly understood. In this study, we explore the developmental mechanism of methylation erasure within PGCs through several models, with our main project investigating whether the reactivation of late demethylating genes in PGCs is influenced by extrinsic signals from the genital ridges or intrinsic signals within the PGCs themselves. To address this, we examined the activation of late demethylating genes utilizing the Bax KO line to bypass apoptosis and investigate extra-gonadal PGCs. Through Oct4-eGFP and Tel7KI-eGFP reporters, we visualize the presence of ectopic PGCs and analyze the reactivation of a late demethylating gene and an imprinted reporter, respectively. Our findings demonstrate that ectopic PGCs undergo epigenetic reprogramming autonomously, independent of signals from the genital ridges. Additionally, we establish two tools for future use in investigating PGC development and imprint erasure including an in vitro PGC-like cell model with cells differentiated from Tel7KI-eGFP ESCs and a red fluorescent reporter of imprint erasure, known as the Tel7KI-mCherry. Together, our study provides insights into intrinsic mechanisms driving methylation erasure in PGCs, advancing understanding of epigenetic reprogramming in germ cell development.","type":"literal","lang":"en"}],"http:\/\/www.europeana.eu\/schemas\/edm\/aggregatedCHO":[{"value":"https:\/\/circle.library.ubc.ca\/rest\/handle\/2429\/88096?expand=metadata","type":"literal","lang":"en"}],"http:\/\/www.w3.org\/2009\/08\/skos-reference\/skos.html#note":[{"value":"i   EPIGENETIC ERASURE IN ECTOPIC PRIMORDIAL GERM CELLS by Sherry Fang B.Sc. University of Toronto 2020  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in  The Faculty of Graduate and Postdoctoral Studies  (Medical Genetics) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) April 2024  \u00a9 Sherry Fang, 2024   ii  The following individuals certify that they have read, and recommend to the Faculty of Graduate and Postdoctoral Studies for acceptance, the thesis entitled:  tee Page Epigenetic erasure in primordial germ cells  submitted by Sherry Fang  in partial fulfilment of the requirements for the degree of Master of Science in Medical Genetics  Examining Committee: Louis Lefebvre, Associate Professor, Medical Genetics, UBC Supervisor  Carolyn Brown, Professor, Medical Genetics, UBC Supervisory Committee Member  Sheila Teves, Assistant Professor, Biochemistry and Molecular Biology, UBC Supervisory Committee Member Calvin Roskelley, Professor, Cellular & Physiological Sciences, UBC Additional Examiner   Additional Supervisory Committee Members: Matthew Lorincz, Professor, Medical Genetics, UBC Supervisory Committee Member     iii   Abstract  Primordial germ cells (PGCs) undergo dynamic epigenetic changes during development, including genome-wide erasure of DNA methylation for the establishment of a clean epigenetic slate in the developing germ cells. While this epigenetic reprogramming is essential for cellular pluripotency and gamete maturation, the underlying mechanisms remain poorly understood. In this study, we explore the developmental mechanism of methylation erasure within PGCs through several models, with our main project investigating whether the reactivation of late demethylating genes in PGCs is influenced by extrinsic signals from the genital ridges or intrinsic signals within the PGCs themselves. To address this, we examined the activation of late demethylating genes utilizing the Bax KO line to bypass apoptosis and investigate extra-gonadal PGCs. Through Oct4-eGFP and Tel7KI-eGFP reporters, we visualize the presence of ectopic PGCs and analyze the reactivation of a late demethylating gene and an imprinted reporter, respectively. Our findings demonstrate that ectopic PGCs undergo epigenetic reprogramming autonomously, independent of signals from the genital ridges. Additionally, we establish two tools for future use in investigating PGC development and imprint erasure including an in vitro PGC-like cell model with cells differentiated from Tel7KI-eGFP ESCs and a red fluorescent reporter of imprint erasure, known as the Tel7KI-mCherry. Together, our study provides insights into intrinsic mechanisms driving methylation erasure in PGCs, advancing understanding of epigenetic reprogramming in germ cell development.   iv  Lay Summary  Our study investigates the development of egg and sperm precursor cells, referred to as primordial germ cells (PGCs), as they undergo the process of targeted removal of chemical tags known as DNA methylation, from specific genes during embryonic development. Initially, we hypothesized that environmental signals surrounding the germ cells\u2019 developmental niche influence this process, thus, to test this hypothesis, we employed various experimental models, including the examination of PGCs that had migrated incorrectly within the mouse embryo. Our findings reveal that PGCs can shed DNA methylation independent of their spatial location within the embryo, suggesting that environmental cues from the developing gonads do not play a significant role in this process. These insights shed light on the internal mechanisms driving genetic alterations in PGCs, enhancing our understanding of germ cell development.   v  Preface  The candidate (S. Fang) performed all experiments, except the cultivation of KIP cells, which was done in collaboration with K. Mochizuki.   The original plasmids used for this study (PGKneolox2DTA and pCX-mCherry) were obtained from L. Lefebvre and A. Bogutz.  Original creation of the Tel7KI-eGFP transgene was done by L. Lefebvre. Derivation and characterization of this transgenic mouse line was done by M. Jones within the Lefebvre lab.  The initial project conceptualization was done by L. Lefebvre, and carried out under the guidance of L. Lefebvre and A. Bogutz.   vi  Table of Contents Abstract ..................................................................................................................................... iii Lay Abstract ............................................................................................................................... iv Preface ........................................................................................................................................ v Table of Contents ........................................................................................................................ vi List of Figures........................................................................................................................... viii Acknowledgments ........................................................................................................................ x Dedication .................................................................................................................................. xi Chapter 1: Introduction ............................................................................................................... 1 1.1 Genomic Imprinting ............................................................................................................ 1 1.1.1 Parental conflict and genomic imprinting ...................................................................... 1 1.1.2 Human imprinted disorders .......................................................................................... 4 1.1.3 DNA methylation .......................................................................................................... 5 1.1.4 Methylation status during development ......................................................................... 6 1.2 Primordial Germ Cells ...................................................................................................... 10 1.2.1 Primordial germ cell development ............................................................................... 10 1.2.2 BAX-dependent apoptosis of ectopic PGCs .................................................................. 12 1.3 Tel7KI Imprinting Reporter .............................................................................................. 13 1.4 Thesis Objective ................................................................................................................ 17 Chapter 2: Materials and Methods ............................................................................................. 18 2.1 Mice ................................................................................................................................. 18 2.1.1 Mouse strains ............................................................................................................. 18 2.1.2 Experimental crosses .................................................................................................. 18 2.1.3 Genotyping ................................................................................................................. 19 2.2 Antibody Staining ............................................................................................................. 19 2.2.1 Cryosections ............................................................................................................... 19 2.2.2 Wholemount Staining ................................................................................................. 20 2.3 Tel7KI-mCherry plasmid construction ............................................................................... 21 2.3.1 Plasmid construction ................................................................................................... 21 2.3.2 DNA extraction and purification ................................................................................. 22 2.3.3 Plasmid verification .................................................................................................... 22 2.4 Cell Culture ...................................................................................................................... 23 2.4.1 Tel7KI-mCherry lipofection ........................................................................................ 23 vii  2.4.2 PGCLC induction ....................................................................................................... 23 2.5 FACS analysis ................................................................................................................... 25 2.6 Primer sequences .............................................................................................................. 26 Chapter 3: Results ..................................................................................................................... 27 3.1 Analysis of Stage II DNA Demethylation in Ectopic PGCs. ........................................... 27 3.1.1 Activation of late-demethylating gene in ectopic PGCs ................................................. 28 3.1.2 Reactivation of an imprinting reporter in ectopic PGCs ............................................... 40 3.1.3 Summary .................................................................................................................... 45 3.2 Tel7KI-mCherry as a New Tool to Investigate Imprint Erasure .................................... 47 3.2.1 Establishment of a red reporter plasmid ...................................................................... 47 3.2.2 ES cell transfection ..................................................................................................... 55 3.2.3 Conclusion .................................................................................................................. 59 3.3 Generation of an in vitro PGCLC system............................................................................ 60 3.3.1 Dedifferentiating ESCs into a na\u00efve state ..................................................................... 62 3.3.2 EpiLC induction ......................................................................................................... 63 3.3.3 PGCLC induction ....................................................................................................... 64 3.3.4 Expansion of PGCLCs ................................................................................................ 65 3.3.5 Summary .................................................................................................................... 66 Chapter 4: Discussion ................................................................................................................ 69 References ................................................................................................................................. 82    viii  List of Figures Figure 1. Methylation status of somatic cells and germ cells in the developing mouse embryo. ........ 9 Figure 2. Primordial germ cell migratory pathway within the mouse embryo. .............................. 11 Figure 3. Models for long-range regulation of Tel7KI. ................................................................. 15 Figure 4. Tel7KI-eGFP expression in embryos. ........................................................................... 16 Figure 5. Generation of E14.5 BaxKO\/KO, Oct4-eGFP+\/tg  embryos. ................................................ 30 Figure 6. Comparative analysis of freshly dissected E14.5 Oct4-eGFP+\/tg, Bax+\/KO  embryos and Oct4-eGFP+\/tg, BaxKO\/KO embryos. ............................................................................................... 31 Figure 7. FACS analyzed PGCs. ................................................................................................. 33 Figure 8. Expression of MVH in ectopic PGCs within cryosections. ............................................. 36 Figure 9. Detection of MVH in ectopic PGCs by whole mount-staining. ....................................... 39 Figure 10. Ectopic PGCs stained in E14.5 Oct4-eGFP+\/tg, BaxKO\/KO embryos. ................................ 40 Figure 11. Generation of E14.5 BaxKO\/KO, Tel7KI-eGFP+\/tg  Embryos. .......................................... 42 Figure 12. Expression of Tel7KI-eGFP in ectopic PGCs............................................................... 44 Figure 13. Cells Stained for E14.5 Tel7KI-eGFP+\/tg, BaxKO\/KO Embryos. ....................................... 45 Figure 14. Average Number of Ectopic Germ Cells Marked by GFP and\/or MVH in E14.5 Embryos. ................................................................................................................................... 46 Figure 15. Structure of the Ins2 arms of homology. ..................................................................... 48 Figure 16. Plasmid pPGKneolox2-Ins2.3-DTA. ........................................................................... 50 Figure 17. Plasmid pIns2.5-CX-mCherry. ................................................................................... 51 Figure 18. Plasmid pIns2.5-CX-mCherry-PGKneolox2-Ins2.3-DTA. ............................................ 52 Figure 19. pPGKneolox2-Ins2.3-DTA digests. ............................................................................. 53 Figure 20. Plasmid pIns2.5-CX-mCherry-DTA digests. ............................................................... 54 Figure 21. Plasmid the pIns2.5-CX-mCherry-PGKneolox2-Ins2.3-DTA digests. ........................... 54 Figure 22. Clone positive for RFP fluorescence............................................................................ 56 Figure 23. PCR screening of G418-resistant colonies RFP-positive ESC clones. ............................ 57 Figure 24. Chromosome count. ................................................................................................... 58 Figure 25. Microscope images of KIP na\u00efve PGC-like cells. ......................................................... 63 Figure 26. Kip C4 PGCLC in vitro growth and corresponding in vivo stage. ................................ 67 Figure 27. Tel7KI-eGFP reactivation in expanded PGCLCs. ....................................................... 68 Figure 28. Changes in gene expression and methylation between embryonic day 9.5 and 13.5 within PGCs. ........................................................................................................................................ 73 ix  List of Abbreviations Amp  Ampicillin  CGI CpG island CpG Cytosine-phosphate-guanine dinucleotide DNMT DNA methyltransferase DTA Diphtheria toxin E Embryonic day EpiLC Epiblast-like cell ESC Embryonic stem cell gDMR  Gametic differentially methylated region GFP Green fluorescent protein IC1 Imprinting Center 1 KI Knock in KIM Tel7KI ES cell line, maternal transmission KIP Tel7KI ES cell line, paternal transmission KO Knock out LIF Leukemia inhibitory factor lncRNA Long non-coding RNA MEG Maternally expressed gene PBS Phosphate buffer saline pCAG or pCX Chicken bet-actin promoter \u2013 CMV enhancer cassette PCR Polymerase chain reaction PEG Paternally expressed gene  PFA Paraformaldehyde PGC Primordial germ cell PGCLC Primordial germ cell-like cell RFP Red fluorescent protein WGBS Whole genome bisulphite sequencing    x  Acknowledgments  Over the years, this project has undergone fluctuations in my feelings towards it, transitioning from something I loved doing to something I hated, and then back to something I loved again. I extend my heartfelt gratitude to my supervisor, Dr. Louis Lefebvre, for his unwavering support, patience, and resilience throughout this journey. His consistent interest and excitement in my work have fueled my own enthusiasm.  I am immensely thankful to Aaron Bogutz for patiently fielding every question I posed to him (and there were many!). He has not only imparted to me numerous complex techniques but has also been a steadfast companion through every stage of the project, for which I am deeply appreciative.  I also express my gratitude to the other scientists who have assisted me along the way, particularly Amanda Ha, a skilled scientist who provided invaluable guidance during my experiments. Special mention goes to Kieran Maheden for generously allowing me to borrow his microscope.  Lastly, I extend my thanks to my friends, my sister, and my parents for consistently being my greatest supporters and cheerleaders.   xi  Dedication       To Kiko, to whom I\u2019m deathly allergic  1   Chapter 1: Introduction  1.1 Genomic Imprinting  In diploid mammalian cells, the genetic content of the offspring is conventionally believed to be contributed equally by both parents, resulting in biallelic expression for most autosomal genes. However, a distinct subset of genes shows parent-of-origin-specific monoallelic or highly biased expression, due to a phenomenon known as genomic imprinting1. Imprinted genes are categorized as either paternally expressed genes (Pegs) or maternally expressed genes (Megs). Some of these genes play essential roles in the developing embryo and the placenta. Consequently, genetic contributions from both the maternal and paternal haploid genomes are required for normal growth and development.   1.1.1 Parental conflict and genomic imprinting Several theories have been proposed for the observed patterns of genomic imprinting, but among these the predominant explanation comes from the parental conflict hypothesis. This model proposes that genomic imprinting evolved as a mechanism to balance parental interest in resource allocation to the offspring growing in utero2. This hypothesis elucidates the evolutionary pressures that may have shaped the imprinting patterns observed today.  According to the parental conflict hypothesis, the discrepancy in genetic investment between mothers and fathers creates a conflict of interests regarding resource allocation to the offspring. In species where polyandry is prevalent, and females may mate with multiple males, the mother 2  contributes genetically equally to each progeny thus she allocates equal resources to all offspring. In contrast, the father only has a genetic stake in his embryo, thus it is in his interest to have their embryo grow faster and maximize the resources allocated to their own progeny. This difference in parental investment gives rise to the conflict where the father benefits from enhanced resource allocation to their offspring, while the mothers are predisposed to equitable distribution3\u20139. Consequently, this suggests that evolution would favor genes promoting rapid embryonic development and resource acquisition from the mother from paternally inherited alleles, while genes restricting growth would be expressed from the maternal alleles, ensuring equitable allocation of resources among siblings. This contrast in silencing\/expression mechanisms balances the parental interests resulting in reproductive success.   Observations from experiments with engineered uniparental mice provide compelling evidence for this theory, as mice derived from animals receiving two female pronuclei (parthenogenetic or gynogenetic) or two paternal pronuclei (androgenetic) fail to develop to term, exhibiting distinct and contrasting phenotypic characteristics. Parthenogenic embryos display reduced extraembryonic tissue, including a smaller yolk sac and ectoplacental cone, but normal embryonic development. Conversely, androgenotes exhibit restricted embryonic growth despite the presence of very well-developed extraembryonic membranes and placental tissue 10\u201312. This contrast highlights the interplay between parental genomes, and their respective contribution to embryonic development. Aligning with expectations, the placenta, a dominant influence in nutrient transport and embryonic support, becomes overgrown when the embryo is made purely from paternal genetic material. This allows for greater resource acquisition and 3  implies a significant role of the paternal genetic material in promoting increased placental development and function 11,13,14.   Of course, several aspects of reported patterns of genomic imprinting also appear to challenge aspects within this theory. For example, the assumption in various models that the mother simultaneously produces numerous offspring who then share resources. However, in many mammals, including humans, gestation typically occurs one offspring at a time, and the production of the next offspring becomes possible only when the mother stops investing in the \u201ccurrent\u201d offspring. This raises doubt about whether the genetic conflict theory remains applicable in such scenarios.   Nevertheless, the sequential care model proposes an alternative perspective, suggesting that the offspring receives maternal care individually, and consequently, the survival chance of each offspring increases with the duration of maternal investment and care. This extended period of care per individual ultimately limits the number of offspring a mother can produce in her lifetime. Thus, the female\u2019s increased investment into their offspring results in the variability of genetic expression, depending on the parental-origin of the allele15.   In the case where both parents have equal investment into their offspring, this theory states that genetic expression is evolutionarily stable, unaffected by natural selection processes guiding imprinted allelic expression. Here, in diploid mammalians, the merit of biallelic expression serves as a safeguard against the expression of recessive deleterious mutations or the 4  underproduction of a genes critical for avoiding dose-sensitive abortion to occur in early gestation15.   Overall, important dynamics exist between parental genomes and their impact on embryonic development, with genomic imprinting playing a pivotal role in shaping phenotypic outcomes. Further exploration of the molecular mechanisms enhances our ability to understand its significance in development, health, and evolutionary biology.  1.1.2 Human imprinted disorders  The effect genomic imprinting has on diploid genes is profound, as it dictates that even if an individual inherits one copy of an allele from each parent, only one allele is expressed. This unique regulatory mechanism means that there is no substitute or backup allele available for imprinted genes. Consequently, imprinted genes are particularly vulnerable to the negative effects of mutations, deletions, or changes in expression if the imprinting process is not set correctly.  This vulnerability is highlighted in various diseases, such as microcephaly, a rare neurodevelopmental syndrome characterized by restricted growth of the baby\u2019s head and often paired with symptoms of learning disabilities, epilepsy, hearing loss, and vision problems16,17. This disease is found to be sometimes associated with mutations in TRAPPC9, a gene responsible for cellular trafficking and predominantly expressed from the maternal allele. In studies with heterozygous mice lacking expression of the maternal TRAPPC9 gene, mice had phenotypic similarities with TRAPPC9 homozygous mutants. In contrast, heterozygous mice 5  lacking expression on the paternal allele were phenotypically normal18,19. These findings show that defects in only the maternal allele will impact regular neurodevelopment despite the presence of a second copy of the allele, demonstrating parental-biased allelic expression.  Another example of this occurrence is the Angelman syndrome, a neurogenetic disorder characterized by developmental disabilities, seizures, speech deficits, and motor oddities. In 70% of Angelman patients, a deletion on chromosome 15 causes the loss of function of an imprinted gene expressed from the maternal allele20. Here, the paternal gene cannot compensate for this loss due to it being epigenetically silenced by imprinting21\u201325. In both cases of Angelman syndrome and microcephaly, the presence of a second functional copy of the gene is futile in correcting the defect, as it remains methylated and transcriptionally inactive. This shows the vulnerability of imprinted genes and shows the unique mode of expression that renders them susceptible to mutations and dysregulations. Understanding the intricacies of imprinting is crucial for characterizing such conditions and developing targeted therapeutic interventions.   1.1.3 DNA methylation   Central to the process of genomic imprinting is DNA methylation, the addition of a methyl group to specific nucleotides within the DNA molecule. In mice and other mammals, DNA methylation primarily occurs at cytosine residues followed by guanine (CpG sites) and are often clustered together to make CpG islands (CGIs)26, which are usually kept unmethylated.  Imprinted genes represent a subset of genes where one parental allele is marked by DNA methylation, leading to parent-of-origin-specific gene expression patterns. These genes tend to 6  aggregate within chromosomal regions known as imprinted domains, tightly regulated by a central element known as gametic differentially methylated regions (gDMRs). Here, the gDMRs can exert their influence either directly, by modulating gene promoters, or indirectly, through mechanisms such as the expression of imprinted long non-coding RNAs (lncRNAs) or the establishment of chromatin boundaries. As a result, around 260 imprinted transcripts found in mice are governed by just 25 gDMRs27\u201329.   The establishment of DNA methylation patterns at gDMRs, primarily occurs during gametogenesis, when the parental genomes are distinct and can be independently modified. This process involves the de novo methyltransferase DNMT3A, assisted by the essential cofactor DNMT3L, although other methyltransferases also play a role. DNMT1, a maintenance methyltransferase, is crucial for propagating methylation patterns to the daughter strand during replication. DNMT1 and its cofactor UHRF1 recognize hemimethylated CpG sites (where only one strand is methylated), and adds methyl groups to the newly synthesized DNA strand, thereby preserving epigenetic marks across cellular divisions30\u201332.   1.1.4 Methylation status during development  Epigenetic reprogramming is essential during gametogenesis to establish uniform methylation patterns across all germ cells, regardless of their parental origins. In mice, the establishment and maintenance of global genome methylation undergo significant changes during their life cycle, with changes occurring differently in both the developing germ cells and somatic cells of the body.  7   Shortly after fertilization, distinct patterns of DNA demethylation emerge within the embryo's separate pronuclei. Paternally inherited alleles undergo rapid active genome-wide demethylation, facilitated by the TET3 enzyme, which initiates oxidation of the methyl group on cytosine residues. Conversely, the maternally inherited genome is initially shielded from demethylation, however, during subsequent cleavage divisions, also undergo demethylation, as exclusion of DNMT1, the methyl maintenance protein, or its cofactor UHRF1 from the nucleus causes passive loss of methyl marks within their genome during preimplantation cleavage divisions. As both parental genomes undergo subsequent divisions, passive loss of methylation ensues due to replication-dependent dilution of proteins such as TET3 and DNMT1. This prevents active demethylation or methylation maintenance from occurring. Consequently, this process leads to an overall decline in the genome-wide DNA methylation status by the blastocyst stage.   Despite this occurrence, it is noteworthy that certain regions, such as maternal and paternal imprinted regions, are shielded from this effect, preserving their methylation status. Here, DNA-binding factors play a pivotal role in safeguarding these imprinted gDMRs from this demethylation process occurring during pre-implantation stages. Notably, ZFP57, a KRAB zinc finger protein, specifically binds to the methylated alleles at imprinted gDMRs and recruits other factors, such as SETDB1, which marks these sequences with H3K9me3. This is thought to lead to preferential recruitment of DNMT1, via its co-factor UHRF1, to maintain DNA methylation at imprinted regions33\u201337 .  8  Global DNA methylation levels are then reestablished following E4.5, once implantation of the embryo occurs. Here, DNA methyltransferases DNMT3A, and DNMT3B perform de novo DNA methylation of the genome, with DNMT1 and UHRF1 playing a crucial role in propagating methylation within newly synthesized DNA strands38.   Following this phase, methylation of somatic cells remains relatively stable. However, a secondary wave of demethylation is observed exclusively within primordial germ cells (PGCs) as they emerge from the proximal epiblast.   This occurs in two different phases during the PGCs maturation between E6.5-13.5. The first phase of demethylation occurs passively between E6.5-10.5 as the PGCs lose 15-70% of global methylation. This occurs due to several different reasons, including the downregulation of methylation maintenance system protein UHRF1, and the loss of de novo methyltransferases DNMT3A and 3B. Despite this occurrence, a small subset of genes is largely protected during this phase, maintaining most of their DNAme within the genome until the second phase of demethylation, occuring between E11.5-13.5. Here, active demethylators such as TET1 cause oxidation of methyl groups located on imprinted genes, X linked genes, and germline genes, which together represent late-demethylating genes39\u201341.  Germline genes refers to genes responsible for the lineage of cells from which both oocytes and sperm cells arise. A key example of such gene is Mvh\/Ddx4. Germ cell-specific in expression, immunohistochemical analysis has shown that expression of the MVH protein is restricted from E10.5 onwards in the PGCs within the developing genital ridges. Homozygous knockouts of 9  Mvh\/Ddx4 within mice create problems with germ cell proliferation and leads to sterile adult males42,43, revealing Mvh as a key player responsible for germ cell determination.  After embryonic day 13.5, methylation is then re-established in a sex-specific manner for the mature gametes. In male germ cells, the somatic cells instruct the PGCs to undergo spermatogenesis and initiate de novo DNA methylation through the reactivation of DNA methylation enzymes DNMT3A and DNMT3L. In contrast, the female oogenesis pathway causes the developing oocytes, maintained in their hypomethylated state, to be held at meiotic arrest at prophase I. De novo methylation is finally reestablished postnatally at P5 where the maternal imprints are set to continue meiosis (Figure 1)38,44\u201348.   Figure 1. Methylation status of somatic cells and germ cells in the developing mouse embryo. Blue lines represent the male germ line, red lines the female germline, grey lines somatic cells, and the black lines the primordial germ cells. During phase I demethylation, PGCs lose 15-70% of methylation while during phase II, the PGCs lose the remaining methylation specifically within imprinted genes, X-linked genes, and a group of late demethylating germline genes.   10  1.2 Primordial Germ Cells  1.2.1 Primordial germ cell development  Primordial germ cells (PGCs) are specialized gamete precursors, which following meiosis, will develop into the mature eggs and sperm1. These cells become the origin of new offspring, passing on genetic and epigenetic information through subsequent generations.  In mice, the germ cell lineage segregates47,49 from the somatic cells of the body early in development at embryonic day 6.5. This divergence is orchestrated through localized determinants within the proximal epiblasts, where BMP-responsive cells expressing Smad1 and Smad5 begin to develop. These cells are then induced from the surrounding cells of the extra-embryonic ectoderm, which secrete the germ cell inducer BMP4. This stimulation causes a small population of cells to repress somatic gene expression and commit to the PGC lineage, by activating genes such as Blimp1\/Prdm1 and Prdm1434,50\u201353  These cells stay localized within the proximal epiblast until embryonic day 7.5, when they emerge from the dorsal wall and begin to actively migrate across the embryo through the hindgut endoderm to reach their site of function within the developing gonads (Figure 2). Controlling these cell\u2019s motility during this process is the Steel factor secreted by somatic cells of the migratory pathway in the hindgut. PGCs express the KIT receptor for this ligand and activating the KIT signaling pathway promotes survival, proliferation and motility of PGCs, as well as preventing their apoptosis54. PGCs lost during this migration no longer receive this survival factor, thus commonly undergo apoptosis with the Bax gene coding for an important regulator of this process34,55,56.  11   Although the Steel factor controls the motility and survival of PGCs, the directionality of their migration is guided by chemoattractant proteins such as SDF1\/CXCL12, secreted from the genital ridges. This protein acts as a chemical signal that guides the PGCs, which express the SDF1 receptor CXCR4, towards the genital ridges57.   By embryonic day 10.5, the PGCs will begin to colonize the genital ridges, the site of the developing gonads, where the somatic cells of the ridges determine the sex of the embryo. Together, the germ cells and the somatic cells at the genital ridge differentiate into the mature male or female gonads, marking a crucial stage in sexual development.     Figure 2. Primordial germ cell migratory pathway within the mouse embryo.   12  1.2.2 BAX-dependent apoptosis of ectopic PGCs  During germ cell migration, cell death becomes a normal feature of PGCs that fail to reach their destination at the genital ridges. As the distance to the genital ridges increases during development, the migratory route expands, resulting in PGCs being distributed over a wide region. In these distant locations, the ectopic PGCs cease their movement towards the genital ridges and instead begin to fragment and disappear due to the lack of the Steel\/Kit survival factor, inducing the Bax-dependent apoptotic pathway.   This apoptotic process acts downstream of Steel, as evidenced by studies of Bax-deficient (Bax-\/-) mice, which continue to have ectopic germ cell survival, despite lacking Steel expression at those extra-gonadal locations. However, even in the absence of apoptosis, these cells do not proliferate and their numbers significantly dwindle by E15.5. As these mice have not been reported to have an increased incidence of germline tumors, the data suggests the existence of a back-up mechanism for removing embryonic migratory germ cells in ectopic locations after E15.558,59.   Postnatally, male Bax knockout mice were found to be infertile with the inability to produce mature sperm60\u201362. However, Bax mutant females can produce viable offspring but are noted to be subfertile, exhibiting unusual atretic follicles with excess granulosa cells63,64. These findings underscore the critical role of apoptosis, mediated by the BAX-dependent pathway, in regulating the population of migratory PGCs and ensuring proper germ cell development and fertility. Additionally, they highlight the complexities of germ cell migration and the mechanisms governing their survival along the normal migratory path within the embryo. 13  1.3 Tel7KI Imprinting Reporter  In the developing PGCs, demethylation occurs in two sequential stages, with passive global demethylation occurring at phase I and active targeted demethylation occurring at phase II.  Using a previously established Tel7KI-eGFP line of mice, the occurrence of the two different phases of demethylation can be visualized in vivo within the PGCs of embryos carrying this transgene.  The Tel7KI-eGFP transgene is a construct consisting of a 1.6kb array of telomere repeats with an eGFP reporter expressed from the ubiquitous pCAG promoter. Inserted on Chr7, the transgene is located upstream of the Ins2 locus, within a large cluster of imprinted genes (Figure 3A). IC2, a gDMR, is an imprinted locus that acts as a promoter for long non-coding RNA, Kcnq1ot1. This lncRNA initiates bidirectional silencing of neighboring regions in a cis-manner65\u201368, including the Tel7KI-eGFP site of insertion. The effect this has on subsequent offspring, is dependent on the parental origin of the Tel7KI-eGFP allele.  During pre-implantation stages, Tel7KI-eGFP is expressed from both maternal and paternal alleles as methylation is shed at fertilization. Once implantation of the blastocyst occurs at E4.5, expression of this allele begins to differ as DNA methylation is acquired de novo in a parental-specific manner. IC2 is methylated on the maternal allele, causing Kcnq1ot1 to be repressed and allowing the fluorescence from the eGFP to be seen within the embryo inheriting the transgene maternally (Figure 4).  Comparably, the paternally inherited allele of IC2 is unmethylated, promoting expression of the Kcnq1ot1 lncRNA and the repression of the paternally inherited Tel7KI-eGFP transgene (Figure 3B and 3C). This state of expression continues throughout the 14  development of the embryo until E11.5 within the PGCs reaching the genital ridges. This is due to phase II of PGC demethylation that allows the cells to actively shed their imprinted marks, therefore allowing the eGFP of Tel7KI to be visualized (Figure 4)68.    Thus, due to the Tel7KI-eGFP nature of expression, this insertion acts a useful tool in the visualization of imprint erasure, showing where and when phase II of demethylation has occurred within the PGCs.    15      Figure 3. Models for long-range regulation of Tel7KI. Black rectangles represent non-imprinted genes, white rectangles represent maternally expressed genes, and grey rectangles represent paternally expressed genes. Circular lollipops atop genes represent their DNA methylation status, with black representing a methylated state and white representing their unmethylated state. A. Diagram of the imprinted domain on Chr7 showing the location of the Tel7KI-eGFP insertion and following structure: telomeric repeats (tel), ubiquitous eGFP reporter (pCAG-EGFP), and active Pgk-loxP-neopA selectable marker. B. On the maternal allele, IC2 is methylated and Kcnq1ot1 is not expressed. The Tel7KI-eGFP transgene is not methylated here and transcriptionally active. C. On the paternal allele, IC2 is unmethylated, Kcnq1ot1 is expressed and exerts long-range silencing effects on adjacent genes, via repressive histone marks within the IC2 cluster (dotted lines), and de novo methylation of DNA at Cdkn1c and Tel7KI-eGFP (solid lines)68.   16    Figure 4. Tel7KI-eGFP expression in embryos. The Tel7KI allele is not imprinted in preimplantation embryos, at E3.5. Tel7KI-eGFP imprinting is established in post implantation embryos, leading to the observed silencing of the paternally inherited Tel7KI-eGFP transgenes, and consistent expression when maternally inherited. By E11.5, embryos with the paternally inherited Tel7KI-eGFP begin to show reactivation of the eGFP in the PGCs within the gonads, indicating that phase II demethylation has occured68.   17  1.4 Thesis Objective  Primordial germ cells (PGCs) represent a unique cellular population undergoing dynamic changes in gene expression, serving as a valuable model for investigating active DNA demethylation and the regulation of cellular pluripotency. Despite their significance, the mechanisms governing their epigenetic reprogramming remain inadequately understood. Therefore, the primary aim of this thesis is to elucidate the developmental process of DNA methylation erasure within PGCs. To achieve this objective, we have devised several investigative approaches, including: 1. Exploring the mechanisms underlying PGC development, with a specific focus on understanding the reactivation of late demethylating genes, such as imprinted and germline genes. This investigation will encompass the examination of ectopic germ cells to understand whether active demethylation can occur regardless of not receiving extrinsic signals from the genital ridges. 2. Developing tools to facilitate future inquiries into the mechanisms of imprint erasure. This includes establishing an in vitro model of PGCs utilizing Tel7KI-eGFP ESCs and generating an mCherry ESC line that acts as an RFP version of the Tel7KI-eGFP ES cell line. By addressing these objectives, this thesis aims to advance our comprehension of active demethylation processes within primordial germ cells, thereby contributing to a deeper understanding of PGC development and epigenetic regulation.  18  Chapter 2: Materials and Methods 2.1 Mice 2.1.1 Mouse strains  The Tel7KI-eGFP and Oct4-eGFP mice used in this study were obtained from the Lefebvre Lab69 and maintained in a heterozygous state with a B6 background for over eight generations. Mice carrying a conditional Bax allele (cKO; allele MGI:3589203, Baxtm2Sjk) were obtain from Dr. Dan Luciani (UBC)70. The Bax knock-out allele (KO) used here was generated by crossing these mice to Zp3-cre transgenic mice, acquired from The Jackson Laboratory (strain number: 006329), expressing the recombinase Cre in oocytes. Bax KO mice were maintaines in the CDM facility at the Life Sciences Institute, UBC. All experiments were conducted in compliance with protocols approved by the University of British Columbia (UBC) Animal Care Committee with guidelines from the national Canadian Council on Animal Care (CCAC) under certificates A19-0213 and A20-0229.  2.1.2 Experimental crosses Vaginal plugs were observed at E0.5 in BaxKO-Oct4-eGFP and BaxKO-Tel7KI-eGFP conceptuses resulting from the cross between female heterozygous Bax mice and male homozygous Oct4-eGFP mice or male heterozygous Tel7KI-eGFP mice. Embryonic dissections were conducted at E14.5 following euthanasia of pregnant females as per UBC Animal Care protocol. Uterine horns were dissected, and conceptuses were suspended in phosphate buffer solutions.  19  2.1.3 Genotyping Genotyping of dissected embryos was performed by extracting small pieces of the yolk sac, which were then incubated in HotSHOT buffer (25 mM NaOH, 0.2 mM EDTA) at 95 degrees for 30 minutes, followed by mixing with 40 mM Tris pH 5.0 buffer, as described71. Yolk sac lysate were used for loading into a PCR mix containing Tsg buffer, Magnesium, dNTPs, Taq polymerase Tsg (BioBasic), and dH2O. PCR reactions underwent 36 cycles of 95\u00b0C for 30s, 58\u00b0C (Tm) for 30s, and 72\u00b0C for 30s. Genotypes were confirmed by running reactions on agarose gel. 2.2 Antibody Staining 2.2.1 Cryosections For cryosectioned antibody-stained embryos, E14.5 mice were first fixed in 4% paraformaldehyde (PFA) immediately following dissection, and held overnight at 4\u00b0C. Following fixation, embryos underwent a sequential dehydration process, transitioning through 10% sucrose, 30% sucrose, and finally 80% octene solutions overnight. Embedding in octene molds in an upright orientation preceded dehydration, with octene blocks being stored at -80\u00b0C until sectioning. Octene sections were cut at 10\u00b5m thickness, and placed on Fisherbrand Superfrost Plus slides to be stored at -20\u00b0C until use.  Before antibody staining occurred, the location of the genital ridge was elucidated using hematoxylin and eosin staining every five slides that was cut within the embryo. Here, frozen sections were removed from storage and dried in a 55\u00b0C incubator for 30 minutes. Following this, the sections underwent rehydration in water for 5 minutes before being immersed in a hematoxylin bath for 7 minutes. Subsequently, the sections were rinsed under running water and 20  then transferred to an eosin bath for 5 minutes. After staining, slides were subjected to dehydration by transitioning through ethanol solutions of increasing concentration: 70%, 95%, and finally 100%, with each step lasting two minutes. The slides were then immersed in xylene for two intervals of 10 minutes each before being mounted with Entellan and coverslips. Subsequent analysis of the tissues was conducted using a light microscope.  Once location of the gonads was determined through the morphology seen on eosin and hematoxylin stained slides, the corresponding unstained gonadal cryosections were baked at 55\u00b0C for 30 minutes before undergoing antigen retrieval via boiling in a citrate buffer solution (pH 6.0) for 30 minutes. After this, rehydration in 1X PBS for 5 minutes occurred before sections were permeabilized with 0.5% Triton-X and 3% donkey serum for 30 minutes. This was  followed by blocking in 0.1% Triton-X and 10% donkey serum for 20 minutes. Overnight incubation followed suit, where goat anti-GFP (1:500) and rabbit anti-MVH (1:500) antibodies in a humidified, light-free chamber was performed, followed by PBS-T washes. Subsequent incubation with secondary antibodies, donkey anti-goat Alexa488 (1:500) and donkey anti-rabbit Alexa586 (1:500), occurred for two hours in darkness. Final washing with PBS-T preceded mounting with Vectashield and sealing with nail polish. Slides were air-dried overnight.  2.2.2 Wholemount Staining  At E14.5, embryos were longitudinally opened at the midline and examined using a green fluorescent microscope. Subsequent removal of organs and guts facilitated visualization of the genital ridge and germ cells.  21  Embryos were then immersed in 4% PFA overnight at 4\u00b0C followed by incubation in phosphate buffer for 4 hours. Subsequently, embryos underwent antigen retrieval in the same procedure as the cryosections, except with each incubation step performed overnight at 4\u00b0C, interspersed with three two-hour washes between each step. After the retrieval process, resulting samples were placed in an 80% glycerol solution before being photographed using a microscope (Nikon Eclipse Ti2e for microscope images and Leica Stellaris for confocal images).    2.3 Tel7KI-mCherry plasmid construction  2.3.1 Plasmid construction  The process of constructing the mCherry plasmid commenced with the generation of two arms of homology using PCR, employing mouse C57BL\/6 genomic DNA as template and primers designed to flank the Ins2 region on both the 3' and 5' sides of the Tel7KI insertion.   Following the successful generation of the arms of homology, the 3' arm underwent digestion using SalI and NheI enzymes to produce sticky ends. Similarly, the previously established PGKneolox2DTA plasmid was digested with the same enzymes. Subsequently, the digested plasmid and the 3' arm of homology were incubated together in a 3:1 ratio with ligate to facilitate annealing, resulting in the formation of the pPGKneolox2-Ins2.3-DTA plasmid.  The 5' arm of homology was treated with SalI and SpeI restriction enzymes to create sticky ends. Concurrently, the pCX-mCherry plasmid underwent a similar digestion process. The 5' arm of 22  homology and the plasmid were then ligated together in a 3:1 ratio at room temperature overnight, yielding the pIns2.5-CX-mCherry plasmid.  These two intermediate plasmids were then digested to create a blunt end and a sticky end in order to be directionally combined. pPGKneolox2-Ins2.3-DTA was digested with PvuI and NotI (blunt end creating enzyme) and pIns2.5-CX-mCherry  was digested with PvuI and HindIII (blunt end creating enzyme).   Purification was achieved through gel extraction on a 0.8% gel. The two plasmids were then combined in a 1:1 ratio and incubated at room temperature overnight.  2.3.2 DNA extraction and purification  Verification of correct insertion was performed through DNA extraction and purification, followed by transformation into E. coli via heat shock. The transformed DNA was plated onto ampicillin resistant agar plates to generate colonies containing ligated plasmids, which were grown for 16 hours at 37\u00b0C before being picked. Plasmid DNA was subsequently extracted by lysing the bacteria and purifying the DNA through ethanol washes.   2.3.3 Plasmid verification  Plasmid verification involved selective enzyme digests to generate specific bands indicative of the correct plasmid. The 3' PGKneolox2DTA plasmid intermediate was digested with AflIII, while the 5' pCX-mCherry intermediate was digested with XbaI. The final plasmid underwent digestion with EagI, PvuI, EcoRI, and a combination of PvuI and EcoRI 23   2.4 Cell Culture  2.4.1 Tel7KI-mCherry lipofection   C2 ES cell lines were grown on an inactivated feeder layer and passaged onto gelatin-coated plates to grow several colonies, following unfreezing from -80 degrees Celsius storage. These wells were then lipofected with the Tel7KI-mCherry plasmid, as well as a CRISPR-Cas9 plasmid expressing a gRNA against Ins2 sequences, according to the Thermofisher Lipofectamine 3000 protocol72, with a 3:1 ratio of the mCherry-PGKneo:Ins2-Puro-Cas9 plasmid to CRISPR-Cas9 plasmid.  After 16 hours of lipofection, the cells were transferred to a plate of drug-resistant feeders for 24 hours. Subsequently, puromycin (4 micrograms\/mL) was added to the media for 48 hours, followed by its removal and replacement with G418 (100 micrograms\/mL) selection for five days. Positive ES cell colonies were verified through red fluorescence from the mCherry plasmid and PCR to ensure correct insertion.  2.4.2 PGCLC induction  Tel7KI-eGFP stem cells were cultured and plated on poly-L-ornithine and laminin coated dishes and grown for several days until colonies formed, within ES cell culture medium. Once established, the ESCs were washed and resuspended in 2iLIF medium, then placed onto the poly-L-ornithine and laminin coated culture plates and incubated for two days at 37\u00b0C.  24  To induce EpiLCs, a 12-well culture plate was coated with human plasma fibronectin. ESCs were dissociated, counted, and resuspended in EpiLC induction medium before being plated onto the fibronectin-coated culture plate. The cells were then incubated for 48 hours at 37\u00b0C.  Following this 48-hour period (day 0 of PGCLC induction) EpiLCs were dissociated, counted, and resuspended in PGCLC induction medium. The cell suspension was then pipetted into a 96-well Low-Binding plate and cultured for 4 days at 37\u00b0C. During this period of time, m220-5 feeders were plated onto a 24-well plate, which had been coated with a 0.1% gelatin solution. The plate was then incubated overnight at 37\u00b0C. On day 4, the feeder medium was replaced with PGCLC expansion medium.  On day 4 of PGCLC induction, aggregates containing d4 PGCLCs were transferred to a conical tube containing DPBS, and then dissociated into single cells. These cells were labeled with antibodies against SSEA1 and CD61, before being sorted using FACS, and collected into Low-Bind tubes.  These cells that were collected, were then resuspended in PGCLC expansion medium, and plated onto the m220-5 feeders. The PGCLCs were then incubated for up to 7 days, with medium changes on days 3 and 5 and 7, with a subsequent FACs sort analysis looking at the GFP percentages during those days of culture. Here, the cells were dissociated, labeled with antibodies against SSEA1 and CD61, and sorted using FAC to analyze the number of germ cells that were GFP+ vs GFP-73.  25  2.5 FACS analysis   For the FACS analysis of ectopic and genital ridge germ cells, the isolation of these regions was performed through dissection. The resulting tissue morphology was carefully collected in tubes containing phosphate buffer solutions to maintain cellular integrity. Subsequently, the collected tissues were drained and underwent successive washes within trypsin to dissociate the cells. The cells were subjected to three washes within trypsin at room temperature, with gentle centrifugation and replacement of media every 5 minutes to ensure thorough dissociation. Following this dissociation process, the resulting lysate of cells was carefully counted to ascertain cell density before further processing.  The dissociated cells were then resuspended in a phosphate buffer solution to maintain their viability and integrity during subsequent procedures. Subsequently, the resuspended cells were sorted based on the presence of GFP+ cells within the cell lysate, indicative of specific cell populations of interest for further analysis. This sorting process facilitated the isolation and enrichment of the desired cell populations for downstream analyses and investigations.   26   2.6 Primer sequences  Purpose Sequence Name Genotyping (Tel7KI insertion forward) CCCTAAGACCTCTCCCATGG Tel7KI F Genotyping (Tel7KI insertion reverse) CGACTGTGCCTTCTAGTTGC Tel7KI R Genotyping (Tel7KI WT forward) CCCTAAGACCTCTCCCATGG Tel7K WT F Genotyping (Tel7KI WT reverse) GTATTGCTGCGATCCTGGGA Tel7KI WT R Genotyping (Bax forward) AACTCTGGGCATCAGTTCGG Bax In1-F1 Genotyping (Bax WT reverse) GAATGCCAAAAGCAAACAGACC Bax In2-R2 Genotyping (Bax KO reverse) GTTTCTCTGGCCCATCTCAA Bax In4-R3 Tel7KI-mCherry plasmid (3\u2019 HA forward) GGCCGCTAGCGGGACCATGGGACAGAGAAT Ins2-3.F-NheI Tel7KI-mCherry plasmid (3\u2019 HA reverse) GGCCGTCGACGGCACTTTTGGAGCTTACAATC Ins2-3.R-SalI Tel7KI-mCherry plasmid (5\u2019 HA forward) GGCCGTCGACAGGGCCTGGTAAGTCCATCT Ins2-5.F-SalI Tel7KI-mCherry plasmid (5\u2019 HA reverse) GGCCGCTAGCCCCAGATTCTTAATGATGTCCA Ins2-5.R-NheI    27   Chapter 3: Results  3.1  Analysis of Stage II DNA Demethylation in Ectopic PGCs.    Primordial germ cells (PGCs) undergo active demethylation upon reaching the genital ridges at E10.5, reactivating a cohort of phase II late demethylating genes. In this study, we investigated whether this reactivation is facilitated by extrinsic signals provided by this somatic niche or intrinsic signals within the PGCs themselves. To do so, we examine hallmarks of DNA methylation erasure in ectopic PGCs\u2014germ cells that fail to reach the gonads\u2014to discern whether active demethylation continues to occur in those PGCs. Given that ectopic germ cells typically undergo apoptosis, we utilized mice with a Bax mutant background, in which apoptosis is perturbed59, to enable the study of such cells. Crossing these mice with a fluorescent PGC reporter line (Oct4-eGFP) or an imprint reporter line (Tel7KI-eGFP) allowed us to visually analyze PGCs within embryos at E14.5. Utilizing antibody staining, we could then observe the activation of imprinted or late-demethylating genes, such as the germ cell gene Mvh, providing insights into DNA methylation loss in cells that did not receive signals from the genital ridge. As a result, we discovered that ectopic germ cells continued to reactivate phase II demethylating genes despite their distance from the genital ridge. This finding suggests that phase II demethylation occurs due to intrinsic signals provided by the PGCs themselves.     28  3.1.1 Activation of late-demethylating gene in ectopic PGCs  To investigate the reactivation of late demethylating genes during phase II reactivation, we focused on the gene Mvh as a candidate representative of this cohort. To do so, we established mouse crosses to obtain a Bax KO\/KO, Oct4-eGFP+\/tg E14.5 embryo, where we were able to perform immunofluorescent antibody staining against GFP and MVH to monitor the localization of the PGCs and activity of this phase II gene, respectively.   MVH proteins have long been recognized for their presence within primordial germ cells following colonization of the embryonic gonads, a phenomenon traditionally attributed to intercellular interactions with gonadal somatic cells74,75.  However, our findings mark the first exploration of Mvh expression within ectopic germ cells. Surprisingly, against the common dogma, our results reveal that the majority of ectopic germ cells, as marked by GFP, also exhibited MVH expression. This suggests that the late demethylating gene Mvh undergoes DNA methylation erasure in PGCs distant to the genital ridge, without extrinsic signals from the gonadal somatic cells. Moreover, our results confirm the utility of MVH as a valuable tool for marking ectopic germ cells in future research endeavors.  3.1.1.1 Ectopic PGCs in Bax KO embryos  A previous publication reported that PGCs can survive and be detected at ectopic locations in homozygous Bax mutants, in which apoptosis is perturbed (Stallock, 2003). We first wanted to confirm those results. We obtained mice carrying a conditional allele of Bax, in which exons 2 to 4 are flanked by loxP sites. First, we generated mice with a constitutive knock-out allele (Bax 29  KO) via crosses with our Zp3-Cre transgenics, expressing the recombinase Cre in oocytes. Bax KO heterozygotes were then crossed to our Oct4-eGFP transgenics, carrying the fluorescent germ cell reporter. In the generation of BaxKO\/KO , Oct4-eGFP+\/tg  mouse embryos, a mating between two heterozygous Bax mice was conducted, with the paternal parent also possessing an Oct4-eGFP  transgene (Figure 5). This breeding strategy resulted in the acquisition of E14.5 embryos, where discernible transmission of the Oct4-eGFP allele was visualized through green fluorescent patterns marking the primordial germ cells located at the genital ridges at this developmental stage (Figure 6). For each embryo, the Bax genotype was determined by genomic PCR on lysates from yolk sac samples. Notably, apart from the genital ridge, ectopic germ cells were observed patterning the hindgut in proximity to the posterior of this region within the embryos. This distinctive pattern was observed exclusively in PGCs within Bax homozygous knockouts, as heterozygous conceptuses did not exhibit ectopic PGCs. Instead, the PGCs were exclusively localized within the gonads at the genital ridges.   This observed pattern aligns with our anticipated outcome, indicating that the presence of Bax homozygous knockouts is imperative for ectopic germ cells to evade apoptosis. Moreover, these cells, expressing the germ cell marker Oct4-eGFP, can be visually identified through green fluorescent proteins. This successful outcome provides the foundation for the subsequent steps of our investigation, involving antibody staining. In this experiment, a GFP antibody will be employed to delineate the localization of PGCs in ectopic regions. 30   Figure 5. Generation of E14.5 BaxKO\/KO, Oct4-eGFP+\/tg  embryos. Schematic illustrating the process of generating E14.5 BaxKO\/KO, Oct4-eGFP+\/tg  embryos. Embryos derived from heterozygous Bax+\/KO  parents and an Oct4-eGFPtg\/tg transgenic father. Only 25% of embryos obtained have our genotype of interest.   31                         Figure 6. Comparative analysis of freshly dissected E14.5 Oct4-eGFP+\/tg, Bax+\/KO  embryos and Oct4-eGFP+\/tg, BaxKO\/KO embryos. A. Comparison of dissected E14.5 embryos with Oct4-eGFP+\/tg expression and different Bax knockout genotypes. Left: Oct4-eGFP+\/tg , Bax+\/KO embryos without ectopic germ cells. B. Close up of female and male Oct4-eGFP+\/tg , BaxKO\/KO embryos. White arrows represent midline of hindgut where ectopic germ cells are observed. Pink arrow represents the gonads.  32  3.1.1.2 Quantification of ectopic germ cells. Next, our aim was to evaluate the quantity of ectopic germ cells within the hindgut region. To achieve this, we conducted a FACS analysis of E14.5 BaxKO\/KO , Oct4-eGFP+\/tg mouse embryos, dissected within the hindgut region. To do so, we separated germ cells at the genital ridge and extraneous tissue beyond the allocation of the PGCs, through dissection. Subsequently, this cell population underwent sorting based on GFP as the primary marker for the PGCs and SSEA-1 as a secondary germ cell marker. This approach provided valuable insight into the abundance of PGCs typically found within the hindgut region.  Through the analysis of three replicates, our findings revealed a range of 200-300 ectopic germ cells within the hindgut region of each BaxKO\/KO , Oct4-eGFP+\/tg embryo. This constituted a mere 0.1% of the cells within the hindgut region. In contrast, we also examined the number of germ cells conventionally situated within the genital ridges. The analysis showed that within the gonads, 8% of cells were identified as primordial germ cells in relation to the surrounding region (Figure 7).   This discrepancy is attributed to the inherent nature of germ cells at the genital ridge, which receive survival signals and chemoattractant proteins to concentrate at a specific location. Consequently, the dissection process involves less somatic tissue unrelated to the PGCs, due to this concentration of cells in the gonads. Conversely, ectopic germ cells are distributed sparsely across a broad expanse of the embryo, thus dissection efforts encompass a significant amount of somatic tissue to capture all ectopic germ cells effectively. 33    Figure 7. FACS analyzed PGCs. Quantification of germ cells marked by GFP from Oct4-eGFP+\/tg  E14.5 embryos of different Bax genotypes. Ectopic germ cells were collected from 8 embryos while gonadal germ cells were collected from 10 embryos.  34  3.1.1.3 MVH expression in ectopic PGCs: cryosections.  To delve into the behavior of ectopic germ cells, we generated cryosections from BaxKO\/KO, Oct4-eGFP+\/tg embryos. This process aimed to capture ectopic germ cells in thin sections, so that subsequent antibody staining can be performed. The staining specifically targeted GFP, as a marker for all primordial germ cells, and MVH to monitor the reactivation of a late demethylating gene.  Initial observations of these stained embryos revealed distinctive patterns of GFP-marked PGC colonies at the genital ridge, with male embryos displaying striped patterns and females exhibiting a scattered arrangement of germ cells within the gonads, as expected. Concurrently, MVH (stained by RFP) demonstrated analogous activity, marking the same regions at the PGCs in the genital ridge, however localized at the cellular membrane, outlining each cell with red fluorescence. The analysis of ectopic PGCs situated beyond the genital ridge revealed a parallel pattern of Mvh gene activation, reactivating Mvh at the identical locations as the ectopic PGCs (Figure 8).  Despite sectioning the entire hindgut region, a typical count of only 3-5 ectopic germ cells per slide was achieved from these cryosections, significantly deviating from the anticipated 200-300 ectopic germ cells obtained during FACS analyses. This discrepancy arises primarily from the limitations in capturing the entire distribution of ectopic germ cells across the embryo on a single slide during the sectioning process. The random spatial dispersion of ectopic germ cells throughout the embryo results in only a small fraction being represented on each slide, constraining our ability to draw definitive conclusions from this method. 35   Despite the limitations of our detection, our observations indicate that a majority of ectopic germ cells continue to reactivate Mvh, with a few outliers showing exclusive reactivation of just the PGCs or Mvh. This suggests the intriguing possibility that ectopic germ cells can undergo demethylation independently of signals from the genital ridge.   36     Figure 8. Expression of MVH in ectopic PGCs within cryosections. Cryosections through the genital ridges and hindgut of female and male BaxKO\/KO, Oct4-eGFP+\/tg embryos. GFP from the Oct4 transgene and MVH were detected by antibody staining. Yellow circles highlight ectopic germ cells showing MVH expression.   37  3.1.1.4 MVH expression in ectopic PGCs: whole-mount antibody staining.  In light of the limitations posed by previous cryosectioning methods in capturing substantial quantities of ectopic germ cells, our investigation transitioned to whole-mount staining to encompass a broader spectrum of available cells. As a result, analysis using fluorescent microscope images showcased a notable surge in the total count of ectopic germ cells, discernible through GFP antibody staining. Each embryo displayed an average of 20-30 ectopic germ cells, distributed across the hindgut region, aligning with the observed pattern in cryosection images. The MVH staining (marked by RFP) exhibited a corresponding expression pattern, staining cells within the hindgut region, and overlapping with many of the same ectopic germ cells stained by GFP (Figure 9).  Seeking a clearer resolution of individual cells, we employed confocal imaging (Figure 9). This approach enabled a more distinct comparison between primordial germ cells capable of reactivating Mvh and those that did not. The outcomes aligned with our earlier findings, reinforcing that a majority of ectopic germ cells continue to reactivate Mvh. Interestingly, the clearer cell population captured also made more evident a number of outliers, with an average of 9 cells per embryo fluorescing GFP for PGCs but lacking MVH fluorescence indicating a lack of demethylation in these few cells. Furthermore, an average of one cell per embryo exhibited the observed MVH staining pattern around the cellular membrane in ectopic germ cells but lacked a positive indicator of PGCs marked by GFP (Figure 10). The origin of these cells remains elusive, possibly arising from errors in antibody staining or clusters of cells attracting primary or secondary stains.   38  Despite these anomalies, the consistent observation was that most, if not all, ectopic germ cells were stained for both the PGC marker Oct4-GFP and MVH, elucidating two key findings. Firstly, distance to the genital ridge does not impede the capacity of germ cells to undergo phase II demethylation in late demethylating genes, particularly at the Mvh locus. Secondly, MVH emerges as a robust candidate for marking the PGCs, whether located at the genital ridge or lost within the hindgut, providing a distinct delineation of the cellular membrane. Despite a few outliers, MVH has consistently stained the PGCs, establishing its utility for antibody staining in future research endeavors.  39   Figure 9. Detection of MVH in ectopic PGCs by whole mount-staining. Antibody-stained images of Oct4-eGFP+\/tg E14.5 embryos with Bax knockout genotype captured under a fluorescent microscope and through confocal images. Yellow circles highlight ectopic PGCs showing MVH expression, red circles highlight cells exclusively activated for Mvh, and green circles highlights PGCs exclusively positive for Oct4-eGFP. 40    Figure 10. Ectopic PGCs stained in E14.5 Oct4-eGFP+\/tg, BaxKO\/KO embryos. Average number of ectopic cells per embryo that had stained positive for ectopic germ cells (GFP) and MVH, GFP only, and MVH only. The majority of ectopic germ cells reactivated late demethylating gene Mvh. A total of 12 embryos were counted for whole-mount stains with a total of 375 cells counted. A total of 16 slides were counted for cryosections, but only 4 embryos were considered, for a total of 52 cells counted.   3.1.2 Reactivation of an imprinting reporter in ectopic PGCs  While the process of DNA methylation erasure for Mvh was determined not to require external signals from the genital ridge, our objective was to broaden the scope of our findings to encompass additional genomic loci within the category of phase II demethylating genes, which includes imprinted genes. To achieve this expansion of our investigation, we utilized the well-established Tel7KI-eGFP mouse line.  In offspring inheriting the Tel7KI-eGFP allele paternally, the transgene is silenced, but primordial germ cells exhibit green fluorescence following imprint erasure in genital ridges, indicating the initiation of phase II demethylation within the embryo. Leveraging this characteristic, we generated BaxKO\/KO, Tel7KI-eGFP+\/tg E14.5 embryos containing ectopic germ cells, that have a visual marker for imprint erasure. Within these embryos, we conducted an antibody stain, employing GFP as a marker targeting the occurrence of phase II demethylation at the Tel7KI transgene, and MVH as a marker encompassing all primordial germ cells. This 41  approach allowed for a direct comparison between all PGCs and those that had undergone DNA methylation erasure at an imprinting reporter.  This method revealed that the majority of ectopic germ cells, marked by MVH, also exhibited green fluorescence, indicating the reactivation of the Tel7KI-eGFP transgene. Consistent with our previous results, this confirmed that DNA methylation erasure can occur within germ cells even without signals from the genital ridge. This erasure was identified at two independent loci within late demethylating genes, leading us to conclude that this pattern of methylation erasure likely occurs throughout the genome. Consequently, our findings suggest that phase II of demethylation erasure is directed by intrinsic mechanisms within primordial germ cells during development.  3.1.2.1 Generation of BaxKO\/KO, Tel7KI-eGFP+\/tg embryos.  BaxKO\/KO, Tel7KI-eGFP+\/tg embryos were produced through mating of two heterozygous Bax knockout mice, with the paternal parent carrying a Tel7KI-eGFP allele (Figure 11). Subsequently, E14.5 embryos were obtained, harboring a Bax double knockout allele in conjunction with the Tel7KI-eGFP line. In these specific embryos, the transmission of the paternal Tel7KI-eGFP allele was evident through distinctive green, fluorescent patterns marking the PGCs. Notably, these PGCs were also visible at the genital ridges during this developmental stage, as expected.  While we successfully captured cells that had undergone imprint erasure, it remains uncertain whether imprint erasure has occurred in all cells undergoing methylation erasure or just a subset. 42  To confidently assert that methylation erasure is an intrinsic property of the cells themselves, we conducted an antibody staining to capture all cells within the embryo for comprehensive comparison.  Figure 11. Generation of E14.5 BaxKO\/KO, Tel7KI-eGFP+\/tg  Embryos. Schematic illustrating the process of generating E14.5 BaxKO\/KO, Tel7KI-eGFP+\/tg  embryos. Embryos derived from heterozygous Bax+\/KO  parents and an Tel7KI-eGFP+\/tg transgenic father. Only 12.5% of the embryos obtained had our genotype of interest.   3.1.2.2 Antibody staining whole-mount  Utilizing MVH antibody staining for PGCs, we discerned a consistent pattern of germ cell clusters at the genital ridge, each cell outlined by MVH staining. This pattern extended into the hindgut, mirroring the observations of ectopic PGCs previously detected in BaxKO\/KO , Oct4-eGFP+\/tg embryos (Figure 12). However, in BaxKO\/KO , Tel7KI-eGFP+\/tg embryos, a reduced number of cells were observed within the hindgut, averaging around 15cells within each embryo, similar to the 20-30 found within BaxKO\/KO , Oct4-eGFP+\/tg embryos (Figure 13).  In the context of antibody staining for GFP activation of Tel7KI-eGFP, our analysis revealed that the majority of GFP-positive cells in BaxKO\/KO , Tel7KI-eGFP+\/tg embryos were concentrated at the same region as those marked by MVH (Figure 12). While a few outliers exhibited the 43  reactivation of only MVH or Tel7KI-eGFP, our findings strongly indicate that most, if not all, ectopic germ cells were stained for both markers. Consistent with the activity of Mvh, the reactivation of Tel7KI-eGFP occurred irrespective of proximity to the genital ridges. Consistent with our previous results, we affirm that phase II demethylation occurs due to intrinsic signals within the primordial germ cells. The consistent reactivation pattern observed in two different loci suggests that this is a phenomenon likely to occur throughout the genome within all phase II genes.  44   Figure 12. Expression of Tel7KI-eGFP in ectopic PGCs. Whole-mount antibody staining of Tel7KI-eGFP+\/tg E14.5 embryos with Bax knockout genotype captured under a fluorescent microscope and through confocal images. Yellow circles highlight ectopic PGCs showing expression of MVH.   45    Figure 13. Cells Stained for E14.5 Tel7KI-eGFP+\/tg, BaxKO\/KO Embryos. Average number of ectopic cells per embryo that had stained positive for ectopic germ cells (MVH) and Tel7KI (GFP), GFP only, and MVH only. The majority of ectopic germ cells reactivated late imprinted transgene gene, Tel7KI-eGFP. A total of 4 embryos were considered with a total of 64 cells counted.  3.1.3 Summary  In summary, our investigations concluded that phase II DNA methylation of primordial germ cell is a cell-autonomous event and does not require physical contact between PGCs and the somatic cells of the genital ridges. Through antibody staining, we observed that the majority of ectopic germ cells undergo reactivation of both MVH and Tel7KI, regardless of their position relative to the genital ridge, throughout the different strategies we employed. Although a few outliers were identified, two distinct phase II demethylating genes, Tel7KI-eGFP and Mvh, underwent demethylation despite being located at different loci, consistently within most primordial germ cells (Figure 14). Importantly, as ectopic PGCs lack signals from the genital ridges in those locations, our results strongly indicate that phase II of PGC demethylation is driven by intrinsic signals within the germ cells, rather than relying on extrinsic contact with somatic cells of the gonads.    46    Figure 14. Average Number of Ectopic Germ Cells Marked by GFP and\/or MVH in E14.5 Embryos.  Quantification of ectopic germ cells marked by GFP and\/or MVH in E14.5 embryos of different genotypes, including BaxKO\/KO, Oct4-eGFP+\/tg, and BaxKO\/KO, Tel7KI-eGFP+\/tg. A total of 76 cells were counted for whole-mount BaxKO\/KO x Tel7KI-eGFP+\/tg  embryos and a total of 375 cells for whole-mount BaxKO\/KO x Oct4-eGFP+\/tg embryos. Boxes represent median percentage of cells, with centre lines representing the mean.  47  3.2 Tel7KI-mCherry as a New Tool to Investigate Imprint Erasure  One of the challenges in our previous experiments stemmed from the difficulty in distinguishing primordial germ cells (PGCs) and those that had undergone imprint erasure in an in vivo setting. Using any of the previously established crosses or mouse lines, we were limited by only having a GFP marker of these features, using the Oct4-GFP and Tel7KI-eGFP transgenic lines, thus making both PGC populations indistinguishable in a comparative analysis. As a result, we resorted to time consuming multiday staining procedures that opens the possibility of a loss of fluorescence and protein activity. Therefore, our goal for the next part of these experiments was to create a dual reporter system that allows us to simultaneously detect all germ cells and those having undergone imprint erasure. Through the establishment of an RFP-based imprint reporter line in mouse ESCs, we wished to create a similar tool as the Tel7KI-eGFP line. These cells have the potential to be injected into mouse embryos blastocysts, where once established through germline chimeras, can be crossed with our Oct4-eGFP transgenic mouse line. Together, this would create our dual reporter line, with a green fluorescent marker of all PGCs and a red fluorescent marker of imprint erasure.  3.2.1 Establishment of a red reporter plasmid  3.2.1.1 Creation of arms of homology  To establish our RFP line of ESCs, our initial objective was to generate a red fluorescent allele, similar to Tel7KI, capable of integration into the mouse genome. This involved utilizing homologous recombination, a natural cellular process facilitating the exchange and recombination of nucleotide sequences that share similarity. By flanking our target DNA with 48  two regions of genomic homology, this approach enables our DNA of interest to piggyback with these sequences and integrate into the designated insertion site.  We began this process by creating arms of homology flanking our site of insertion adjacent to the Ins2 locus.  This location within an imprinted region was the previous site of insertion for the Tel7KI-eGFP line. To do so, we used PCR with mouse gDNA as a template for amplifying the 3\u2019 and 5\u2019 sequences surrounding this niche. Each arm of homology was designed with primers incorporating a unique restriction site at both the 5\u2019 and 3\u2019 ends. These strategically placed sites enabled directional cloning, as specific enzymes could be applied to cleave these PCR-generated fragments, creating cohesive sites for their complementary sequences. Consequently, we successfully generated an 819 bp sequence for our 5\u2019 arm of homology and an 836 bp sequence for our 3\u2019 arm of homology (Figure 15).    Figure 15. Structure of the Ins2 arms of homology. The 819 bp sequence representing the 5\u2019 arm of homology (green) and the 836 bp sequence representing the 3\u2019 arm of homology (pink). Both sequences were strategically designed to incorporate NheI and SalI restriction sites.  49  3.2.1.2 Tel7KI-mCherry plasmid assembly  Next, we combined our arms of homology with sequences intended for inclusion in our red imprint reporter. To achieve this, we employed restriction enzymes to excise these sequences from pre-existing plasmids, within the Lefebvre lab stocks. Subsequently, these excised sequences were assembled with our arms of homology through selective restriction digests, generating complementary sequences for cloning. Together, the components were ligated to form a final plasmid encompassing our red reporter DNA, bordered by the Ins2 5\u2019 and 3\u2019 homology arms. The two plasmids used in this process included the pCX-mCherry plasmid and the pPGKneolox2-DTA plasmid. The pCX-mCherry plasmid harbors an mCherry sequence driven by a chicken beta-actin promoter (B-actin pro) and CMV early enhancer, constituting the red fluorescent reporter essential for the final knock-in construct. The plasmid also includes a transcription termination sequence derived from the rabbit beta-globin gene (rabbit pA) (Figure 17).   The pPGKneolox2-DTA plasmid encodes several key sequences of interest, including a loxP-flanked neomycin resistant gene (neo), an ampicillin resistant gene (AmpR), and the diphtheria toxin subunit A (DTA) (Figure 16). The incorporation of these elements establishes both positive and negative selectable markers for DNA integration. As neomycin is an antibiotic inhibiting protein synthesis, cells cultured in G418-containing medium without the resistant gene will lead to cell death. Thus, the neomycin-resistant gene serves as a positive selectable marker for genomic integration of our construct, whereby cells lacking the transgene experience cell death. Conversely, DTA acts as a negative selector, blocking protein translation and rapidly inducing 50  cell death upon integration. Positioned adjacently to the 3\u2019 arm of homology on the opposite side of integration, this ensures that the inclusion of sequences beyond the arms of homology in the cell\u2019s DNA triggers immediate cell death, thus enriching for transgene integrated by homologous recombination. Using NheI and SalI restriction enzymes, we initiated the digestion of the 3\u2019 arm of homology, followed by utilizing the same enzymes to cut a small region adjacent to the DTA promoter on the pPGKneolox2-DTA plasmid. This cut site creates the site of insertion for the arm of homology to be incorporated into the plasmid, allowing us to create our intermediate pPGKneolox2-Ins2.3-DTA plasmid after being ligated at room temperature (Figure 16).    Figure 16. Plasmid pPGKneolox2-Ins2.3-DTA. Schema illustrating the insertion of the 3' homology arm into the original pPGKneolox2-DTA plasmid, resulting in the intermediate plasmid pPGKneolox2-Ins2.3-DTA. 51   Simultaneously, we conducted restriction digests on the ends of the 5\u2019 arm of homology and within the pCX-mCherry plasmid. With the pCX-mCherry plasmid acting as the vector, and the 5\u2019 arm of homology acting as the insertion, these sequences were ligated together, resulting in a plasmid where the 5\u2019 arm of homology incorporated, with the mCherry reporter, now recognized as the pIns2.5-CX-mCherry plasmid (Figure 17).   Figure 17. Plasmid pIns2.5-CX-mCherry. Schema depicting the insertion site of the 5\u2019 homology arm in the pCX-mCherry plasmid and the subsequent formation of the intermediate plasmid, denoted as pIns2.5-CX-mCherry.   52  Our final objective was to merge the two intermediate plasmids, such that the arms of homology encompassed all sequences of interest. To do so, we utilized restriction digests with sites chosen based on areas of recombination. As a result, certain restriction sites lacked corresponding sequences, thus, to ligate non-complementary sites, we created a blunt end via PCR. This involved taking our cut sequence with our DNA overhang and performing PCR amplification with a proofreading DNA polymerase which effectively chewed back any DNA overhang. This resulted in double stranded DNA ending at the same length. Using blunting and complementary restriction digests, we isolated our sequences of interest, and conducted ligation to create our final pIns2.5-CX-mCherry-PGKneolox2-Ins2.3-DTA plasmid (Figure 18).    Figure 18. Plasmid pIns2.5-CX-mCherry-PGKneolox2-Ins2.3-DTA. 53  3.2.1.3 Plasmid verification  After conducting plasmid transformation in E.coli, we employed two verification methods. The first involved growing E.coli on ampicillin plates, where only cells expressing plasmids with the ampicillin-resistant gene could thrive. As only bacteria with closed, ligated plasmids conveyed ampicillin resistance, this ensured that colonies grown on each plate should only contain colonies with properly ligated and recombinant plasmids.  Subsequently for each colony, we also isolated plasmid DNA and utilized restriction digests as a second method of verification. This involved cleaving DNA at specific recognition sites using chosen enzymes, followed by gel electrophoresis to observe banding patterns reflecting the size of DNA fragments. A comparison of observed and expected patterns based on plasmid map sequences facilitated the verification of each plasmid\u2019s identity (Figures 19, 20, and 21).             Figure 19. pPGKneolox2-Ins2.3-DTA digests.  The identification and verification of the intermediate plasmid pPGKneolox2-Ins2.3-DTA were accomplished through AflIII restriction enzyme digestions. The anticipated banding pattern is illustrated in the schematic on the right and is observed in clone #11. 54   .               Figure 20. Plasmid pIns2.5-CX-mCherry-DTA digests. The identification and verification of the intermediate plasmid pIns2.5-CX-mCherry-DTA were carried out through Xbal restriction enzyme digestions. The anticipated banding pattern is depicted in the schematic on the right.   Figure 21. Plasmid the pIns2.5-CX-mCherry-PGKneolox2-Ins2.3-DTA digests. Verification of the pIns2.5-CX-mCherry-PGKneolox2-Ins2.3-DTA plasmid was conducted through digestion with multiple restriction enzymes (EagI, PvuI, EcoRI, and PvuI + EcoRI). The expected banding pattern is illustrated in the schematic on the right. Number 10 represents the plasmid of interest, and Neo and mCh represents the parental plasmids pPGKneolox2-Ins2.3-DTA and pIns2.5-CX-mCherry-DTA respectively. 55   The results revealed that approximately 1 in 20 colonies exhibited successful integration of the arms of homology into our site of interest. A large portion of these clones contained DNA solely from the parental vectors, suggesting occasional failure of the enzyme to digest the parental vector to completion. Another possible consideration was the potential re-ligation of the plasmid\u2019s designated cut site to itself, hindering successful insertion.   3.2.2 ES cell transfection  Once we successfully created our plasmid with both arms of homology, the subsequent objective in the experiment was to induce homologous recombination within the mouse genome in ESCs. To do so, we utilized a well-established line of C57BL\/6-derived ESCs (C2 cells) for transfection, employing lipofection as the delivery method for introducing our plasmid into the cells. Verification of successful integration and homologous recombination involved multiple checkpoints. The first method relied on DTA negative selection, where cells with random integration of the full construct were expected to undergo immediate cell death. The second method centered on the integration of the Neomycin-resistant gene, with cell recovery post-lipofection occurring within ESC medium supplemented with G418. Consequently, cells lacking the resistance gene were anticipated to undergo death after several days in culture. Next, we checked for red fluorescent colonies under a fluorescent microscope, to confirm that our mCherry reporter conferred red fluorescence (Figure 22). The last step of verification utilized PCR amplification spanning the arm of homology and into the internal DNA sequences of the construct to assess proper integration at the Ins2 locus (Figure 23). These comprehensive methods enabled the identification of six positive colonies. 56   Figure 22. Clone positive for RFP fluorescence. Positive ESC colony grown on feeder cells immediately after antibiotic treatment, and 5 days post treatment. ESCs were analyzed under bright field (BF) and fluorescence microscopy for RFP and GFP.   57      Figure 23. PCR screening of G418-resistant colonies RFP-positive ESC clones. A. Genomic region analyzed, where the PCR primers span the arms of homology, relevant to the CAP-mCherry insertion adjacent to the Ins2 locus. B. Agarose gel electrophoresis of PCR products for six G481-resistant red clones analyzed using primers spanning the 5\u2019 and 3\u2019 arms of homology. The resulting banding pattern from PCR amplification of these primers confirms the accurate insertion at the intended sites. As a negative control, genomic DNA from a colony of cells lacking red fluorescence was used.   58  Considering the significant impact of chromosome numbers on embryonic growth and the success of chimera formation, a subset of ESC clones underwent chromosome counting. To achieve this, we induced mitotic arrest before bursting these cells on a glass slide to expose their chromosomes. Microscopic analysis revealed an average of 40 chromosomes in each cell for clones #1-5, aligning with the expected average for mouse cells (Figure 24).   Figure 24. Chromosome count. Evaluation of the average chromosome number within approximately 20 cells for each clone. Clone #6 was excluded from the analysis due to limited growth ability during expansion.   59   3.2.3 Conclusion  The previous experiments document having successfully used plasmid recombination to generate an RFP mCherry plasmid that was integrated into C2 ESCs via homologous recombination. These modified cells hold the potential to establish an RFP-based imprint reporter line of mice  similar to the Tel7KI-eGFP line previously developed at the Lefebvre lab. In the future, the imprinted mCherry line of mice can be crossed with our Oct4-eGFP transgenic mouse line, yielding a dual reporter system featuring a green fluorescent marker for the PGCs and a red fluorescent marker specifically indicating imprint erasure. Such advancements augment the precision and efficacy of future investigation into germ cell development and epigenetic reprogramming.  Moreover, while our present endeavors have tackled the challenges encountered in our experiments, this dual reporter system harbors the potential for numerous exciting future investigations as well. Subsequent studies could delve into discerning whether distinct cell populations already exist within the gonads, with some cells exhibiting faster maturation and imprint erasure capabilities, while others do not.  Additionally, investigations into whether ectopic germ cells or potential germ cell tumors commonly exhibit failures in epigenetic programming or maturation represent promising avenues for research. By pursuing these future directions, our aim is to deepen our understanding of germ cell biology and epigenetic regulation, ultimately contributing to the development of novel strategies for addressing germ cell tumors or imprint disorders 60  3.3 Generation of an in vitro PGCLC system The emergence of stem cell culture and subsequent development of in vitro systems to model early embryonic development have transformed our understanding of cellular differentiation. and offer significant advantages over traditional animal models, including circumventing the necessity for animal handling and care, eliminating prolonged generational wait times and providing a more efficient means of generating laboratory experiments. Among these systems, the in vitro generation of primordial germ cell-like cells (PGCLCs) from embryonic stem cells (ESCs) holds promise in studying the mechanisms underlying germ cell specification and methylation control.   PGCLCs, representing a pivotal model for studying germ cell development in vitro, are generated through the induction of epiblast-like cells (EpiLCs) from ESCs via BMP4 treatment76. Following four days of BMP4 exposure, these cells exhibit striking similarities in transcriptional and epigenetic profiles to migrating primordial germ cells (PGCs) in E9.5 embryos. Termed d4 PGCLCs, these cells can further mature into d4c7 PGCLCs when cultured on feeder layers expressing the transmembrane form of the Steel factor (Sl\/Sl4-m220 feeders)77,78. During this prolonged culture period of up to 7 days (d4c7 PGCLCs), these cells undergo phase II DNA demethylation and acquire characteristics reminiscent of E13.5 gonadal PGCs79, thus providing a robust model system for studying germ cell development76. However, despite the significant strides in recapitulating germ cell development in vitro, the intricacies of epigenetic reprogramming during PGCLC differentiation remain incompletely elucidated.  61  Motivated by these reasons, we opted to develop a secondary system for delving into imprint erasure within primordial germ cells. This undertaking entailed taking advantage of a culture system that allows the generation of PGC-like cells from embryonic stem cells and leveraging the Tel7KI-eGFP ESC lines previously established in the laboratory, known as KIP cells (for KI paternal). Established from F1 blastocysts derived from crosses between male Tel7KI-eGFP mice (maintained on the 129\/S1 strain background) mated with wild-type C57BL\/6J females, these cells played a crucial role in developing and validating a cell-based system that replicated the in vivo imprinting at the Tel7KI reporter80. Notably, the Tel7KI allele is expressed from both paternal and maternal alleles in E4.5 blastocysts, but in post implantation embryos, is expressed only from maternally inherited alleles81. This suggest that imprinting at this allele is only acquired after implantation and regulated by a somatic DMR. Consequently, ESCS carrying a maternal (KIM cells) or a paternal (KIP cells) Tel7KI allele are both expressing GFP. However, this GFP expression is silenced when KIP ESCs are differentiated into embryoid bodies, due to the gain of DNAme at the promoter that drives GFP80.  Our study aims to verify whether the Tel7KI imprinted reporter could be used to monitor phase II erasure in the PGCLC culture system. Since transgenic ESCs carrying a paternally inherited Tel7KI allele (KIP ESCs) are GFP+, we specifically wanted to see whether GFP expression is first silenced to generate GFP- EpiLCs, as seen in vivo in postimplantation embryos, and whether the GFP is reactivated in expanded PGCLCs undergoing phase II demethylation. By leveraging the unique properties of the Tel7KI reporter system, our study aims to provide novel insights into the dynamics of epigenetic reprogramming during germ cell differentiation in vitro, with potential implications for understanding and treating germ cell-related disorders. 62  The results presented below unveiled that KIP cells manifest a consistent expression pattern, characterized by an initial silencing during early-stage PGCLCs, and subsequent activation of GFP in later-stage cells. These outcomes suggest the potential of this system to accurately emulate our in vivo model of imprint erasure in late PGCs.   3.3.1 Dedifferentiating ESCs into a na\u00efve state  Starting from KIP embryonic stem cells, our objective was to steer their differentiation towards a PGC-like cell state. This process necessitated transitioning these cells into a \u201cna\u00efve state\u201d first, where these cells would mirror the cellular state of preimplantation mouse blastocysts. Here, research findings from various sources highlight that the genomic DNA tend to be hypomethylated in those na\u00efve cells grown with inhibitors (2i+LIF conditions), having widespread loss of DNA methylation. In contrast, the \"primed\" state typifies post-implantation epiblast cells and these mESCs are typically cultured in serum\/LIF medium, where an observable increase in DNA methylation levels exist (Takahashi., et al).   Thus, using our KIP mESCs, we took them into a na\u00efve state through culture in a 2i+LIF medium lacking serum, and cultured them for several days, before subsequently passaging and repeating this process, continuously maintaining them in a 2i+LIF medium through subsequent passages. Here it is believed that only cells that have been able to adapt to the na\u00efve state were able to continue to be cultured and expanded using this method, thus, by the fifth passage, the culture had selected for only cells presumably containing a low methylation state.  63   Through this process, we were able to observe several colonies of na\u00efve KIP cells exhibiting green fluorescence through microscope analysis, indicating the absence of methylation within the na\u00efve PGC-like cells at the imprinted Tel7KI-eGFP transgene (Figure 25). As eGFP was found to be active already in mESCs during establishment of the KIP cells, this followed our expected results.  Figure 25. Microscope images of KIP na\u00efve PGC-like cells.  3.3.2 EpiLC induction  After establishing the na\u00efve mESCs, we directed the stem cell towards the intermediate state known as epiblast-like cells (EpiLCs), with these cells designed to mimic day E5.75 mouse epiblast cells. In line with our in vivo model, our expectation was that cells at this stage would undergo a process of regaining methylation, including at imprinted regions, consequently leading to the silencing of GFP.  64  Contrary to our expectations, the results revealed a spectrum of cells within these stages\u2014some had successfully silenced the Tel7KI, while others retained green fluorescence, indicating an ongoing demethylated state.  This divergence from our anticipated results might be attributed to the relatively short growth time during the differentiation of cells from their na\u00efve state towards EpiLCs, involving only a two-day period after a media change. Consequently, not all cells may have reached the same stage of differentiation at the time of measurement, leading to unresolved fluorescence discrepancies.  3.3.3 PGCLC induction  We continued the differentiation of EpiLCs towards PGC-like cells by activating a number of conserved PGC-inducing signals. In mice, BMP4 is naturally supplied from the extraembryonic ectoderm to induce PGCs from the proximal epiblast, enabling us to utilize this signal for the successful induction of PGC-like cells. Additionally, the cells were supplemented with SCF, LIF, and EGF cytokines to facilitate PGCLC induction and survival.  Following four days of culture, we anticipated that the PGCLCs would exhibit a resemblance to E9.5 PGC in vivo counterparts. Our approach was adapted from a previously established mPGCLC specification protocol, which revealed that transcriptional and methylation patterns resembled those of E9.5 PGCs after 4 days of PGCLC culture73,82. Hence, we expected germ cell specification during this developmental stage to exhibit a similar pattern within the KIP cells. Given this developmental stage, we did not anticipate fluorescence from cells at this point. Subsequently, through FACs sorting using the PGC marker SSEA-1 and CD6173, we verified our 65  assumption, as these markers confirmed germ cell specification and enabled the analysis of the number of cells that displayed fluorescence (Figure 26 \u2013 D4c0). Satisfactorily, no cells were found to still express the Tel7KI-eGFP transgene in d4 PGCLCs, suggesting that the reporter had been successfully silenced in those cells.  After sorting the cells positive for the PGC marker SSEA-1, we replated and expanded the d4 PGCLCs on a Sl\/Sl4-m220 feeder layer. Through this process, we successfully differentiated them into later-stage PGCLCs.  3.3.4 Expansion of PGCLCs  KIP d4 PGCLCs positive for SSEA-1 and CD61were cultured on a layer of Sl\/Sl4-m220 feeder cells for 7 days following the initial FACS sorting. At days 3 (c3), 5 (c5), and 7 (c7) of culture, FACS analysis was conducted to assess the proportion of cells that were GFP positive, indicating the loss of methylation at the imprinted locus of Tel7KI-eGFP (Figure 26).   Beginning on day 4 of PGCLC culture (d4 PGCLCs), also referred to as culture day 0 (c0), FACs analysis revealed that no GFP could be detected within the colonies of the PGCLCs. However, as the cells progressed to later stages such as C3 (corresponding to E10.5 PGCs in vivo) the percentage of GFP+ cells within these colonies gradually increased until day 5 of culture, (corresponding to E12.5 PGCs in vivo) where it peaked (Figure 26). This aligns with the 66  expected stage in in vivo embryos where methylation is shed within gonadal germ cells, leading to the reactivation of the Tel7KI-eGFP.  By day 7 of culture (corresponding day 13.5 PGCs in vivo), the GFP signal began to plateau and slightly decrease as the cells matured. Notably, at this stage, necrosis was observed in some colonies within the PGCLCs, making it challenging to definitively attribute the decrease in fluorescence to either a loss of cells or gain of methylation within the imprinted locus. Despite this complexity, a consistent pattern of GFP expression reflecting DNA methylation gain and loss was observed as the cells matured into post-migratory, gonadal PGC types in vivo.  3.3.5 Summary  Through a series of experiments recapitulating the differentiation process from na\u00efve embryonic stem cells to primordial germ cell-like cells in culture, we explored the dynamic changes in expression state for the imprinted Tel7KI-eGFP transgene using an in vitro differentiation system.  Initially, in the na\u00efve state, the KIP ESCs exhibited a clean epigenetic slate and displayed green fluorescence, indicating activity of the Tel7KI-eGFP transgene. However, as they matured into later stages, mimicking epiblast cells and early-stage primordial germ cells73,82, DNA methylation within the cells of the in vitro system was presumably regained, leading to the shut-off of the Tel7KI-eGFP allele. Finally, as the KIP cells matured into later-stage PGCLCs, akin to 67  E12.5-13.5 PGCs undergoing phase II demethylation, methylation was presumably lost, as the GFP was reactivated, indicating successful shedding of DNA methylation by the Tel7KI-eGFP transgene. This established system effectively mirrors the in vivo processes of the germ cell methylation pattern, offering promising avenues for future research into the demethylation process.   Figure 26. Kip C4 PGCLC in vitro growth and corresponding in vivo stage. Cultured growth representation of the KIP cell line c4, featuring brightfield images. The top line illustrated anticipated fluorescence pattern corresponding to in vivo states 68      Figure 27. Tel7KI-eGFP reactivation in expanded PGCLCs. Quantification of PGCLCs derived from various lines of KIP cells (clone B3 and C4). Cells were collected at different days of expansion cultute (0 to 7) and analyzed by flow cytometry to quantify the percentage of GFP+ cells.   69   Chapter 4: Discussion  The present study investigates the DNA demethylation process within primordial germ cells and assesses the potential influence of extrinsic factors in facilitating this process. By employing antibody staining techniques on ectopic PGCs within BaxKO\/KO mice, we examined their capability to undergo active demethylation and sustain the reactivation of key genes, namely the germ cell gene Mvh\/Ddx4 and the imprinted reporter Tel7KI-eGFP. Contrary to our initial hypothesis that these cells would lose this ability without receiving signals from the genital ridge, our findings suggest that extrinsic factors do not play a significant role in facilitating this process. Instead, our results suggest that an intrinsic mechanism governs the onset of phase II DNA demethylation within PGCs. These results provide novel insights into the mechanisms driving PGC development and have implications for our understanding of epigenetic regulation during embryonic development.   The conventional view regarding active DNA demethylation within PGCs has long attributed this process to extrinsic factors originating from the genital ridge. This perspective is grounded in the acknowledged significance of the genital ridge in embryonic development and the establishment of germ cell identity. It is widely accepted that signals from this structure play a critical role in guiding PGC maturation and determining their fate, including sex determination. Consequently, researchers have naturally extended this line of thinking to hypothesize that these signals may also impact other facets of PGC development, such as the erasure of epigenetic marks like DNA methylation. The understanding of the precise mechanisms involved of this 70  occurrence remain elusive, but nevertheless, multiple lines of evidence have been gathered to bolster this hypothesis.   One such line of evidence is the observed spatial and temporal correlation between genital ridge development and epigenetic changes in PGCs. During a critical window between embryonic days 10.5 and 11.5, PGCs undergo migration into the genital ridges, coinciding with the timing of the initiation of phase II DNA demethylation. This temporal alignment underscores a potential association between signals emanating from the genital ridge and the modulation of epigenetic marks within PGCs. Moreover, studies have unveiled that early PGCs initially harbor DNA methylation at specific germline genes, only to experience rapid erasure of these marks upon ingress into the genital ridge1,2. This effect is also highlighted by the observation of X chromosome inactivation within these cells in female embryos. During the migratory phase of PGCs, XX germ cells undergo random X inactivation, mirroring the pattern observed in somatic tissues. However, upon PGCs' entry into the genital ridge, a notable shift occurs, with the majority of PGCs reactivating the previously inactive X chromosome by embryonic day 13.5 in mice3,4. This reversal underscores the dynamic interplay between PGCs and their environment, suggesting a potential role for signals from the genital ridge in orchestrating epigenetic modifications.  For the first time here, we conducted a detailed examination of germ cells in transit towards the genital ridge to discern whether the observed epigenetic events in the germline are attributable to signals from the genital ridge or to the intrinsic timing of epigenetic modifications within PGCs. 71  Using antibody staining techniques, we observed the expression status of ectopic germ cells across various distances from the genital ridge to reveal that the majority of ectopic germ cells underwent DNA methylation erasure, irrespective of their proximity to the genital ridge, as suggested by the activation of the silent Mvh and Tel7KI alleles. These observations suggest that factors beyond those originating from the genital ridge may contribute to the epigenetic reprogramming of PGCs. However, while our findings suggest that intrinsic mechanisms within the PGCs themselves serve as the primary drivers of this epigenetic process, the exact mechanisms of how this occurs remains to be elicited.  We speculate that one plausible explanation for the initiation of active DNA demethylation is the presence of an intrinsic DNAme threshold within the cells, signaling for phase II demethylation to commence. Specifically, as the cells undergo passive phase I DNA demethylation during this critical period, they may reach a threshold level at which they activate key active demethylators. This activation, in turn, facilitates the onset of phase II DNA demethylation. Consequently, the cells undergo a comprehensive erasure of methylation marks, paving the way for the blank slate prior to the establishment of sex-specific epigenetic patterns in the mature gametes.  An alternative explanation for these findings, is the possibility that phase II DNA demethylation is intricately linked to the age and maturity of PGCs within a defined developmental window, typically spanning from embryonic days 11.5 to 13.5. During this time window, PGCs undergo substantial changes associated with their maturation, altering gene expression patterns which may serve as a trigger for the initiation of Phase II DNA demethylation. 72  For example, by mining published RNA-seq and DNAme  data from E9.5 to E13.5 PGCs83,  different dynamics between DNA methylation and expression emerge. One group of late demethylating germ line genes gain expression as their promoter regions are demethylated during Phase II erasure (Figure 28A). Interestingly, another group of genes are also activated between E11.5 and E13.5 in PGCs while their promoters are constitutively hypomethylated from E9.5 to E13.5 (Figure 28B). During the specified developmental window, the upregulation of these genes orchestrates a network of regulatory pathways governing the maturation and specification of PGCs. This age-dependent hypothesis proposes a direct link between the developmental stage of PGCs and the initiation of phase II demethylation or imprint erasure. Consequently, as PGCs mature within this specified time frame, they may exhibit a heterogeneous mixture of cells that have undergone imprint erasure and those that have not.   73      Figure 28. Changes in gene expression and methylation between embryonic day 9.5 and 13.5 within PGCs. A. Late demethylating germ line genes. B Activated genes between E11.5-13.5 within the PGCs.    74  We recognize that despite our efforts to elucidate the mechanisms underlying phase II demethylation within primordial germ cells, our research encountered several constraints. These constraints, primarily stemming from the challenges associated with obtaining embryos possessing the desired genotype, significantly shaped the extent and depth of our inquiry. Consequently, it is imperative to acknowledge these constraints as we delve into the implications of our findings and delineate avenues for future exploration in this domain.  A notable impediment arose from the inherent infertility or low birth rate typically observed in Bax homozygotes. Consequently, both parents of our experimental crosses necessitated being heterozygotes, resulting in the acquisition of homozygote embryos merely 1 out of 4 times, in accordance with Mendelian statistics.  Furthermore, our investigation into imprint erasure entailed crossing Bax+\/KO mice with a paternally inherited Tel7KI-eGFP transgene. However, our efforts were compounded by another limitation stemming from the lack of homozygous carriers of the Tel7KI-eGFP allele at the time of these studies. Consequently, our chances of procuring embryos suitable for our study were further diminished, culminating in mere 1 out of 8 probabilities of obtaining embryos with the desired genotype carrying the fluorescent reporter.   Because of these limitations, our study was constrained by a smaller number of embryos available for investigation, impacting the reliability and generalizability of our findings. This restricted sample size poses challenges in achieving a sufficient number of replicates, thereby affecting the robustness of our results.  75  Despite encountering challenges, our study provides valuable insights into the mechanisms underlying imprint erasure in primordial germ cells. Here we have independently confirmed the presence of ectopic PGCs in Bax homozygotes59 and introduced a novel methodology for investigating these ectopic PGCs. Conventionally, the isolation of germ cells has been limited to those residing within the genital ridge, however, our study marks a significant advancement as we have successfully collected ectopic germ cells using FACS analysis. Given that the PGCs serve as precursors to potential germ cell tumors and plays49,84,85 a crucial role in maintaining fertility, their isolation offers a unique opportunity to explore aberrant cellular behavior that deviates from the expected developmental trajectory. Consequently, future investigations focused on these cells hold promise for unraveling the underlying mechanisms driving such deviations and elucidating factors contributing to their distinctive phenotypes.  From a practical standpoint, our experimental results suggest a paradigm shift in understanding the signals that trigger phase II demethylation within the PGCs. The absence of external signals from the genital ridge for initiating methylation erasure underscores the likelihood of an intrinsic mechanism operating within the cells themselves. This observation prompts further inquiry into why this mechanism may occasionally malfunction or fail to occur appropriately. By isolating individual cells and scrutinizing their phenotypic traits, future research endeavors may uncover common modifiers responsible for steering germ cells astray during maturation. As genomic imprinting patterns play a pivotal role in orchestrating the establishment of sex-specific and germ cell-specific epigenetic signatures, their deregulation significantly impacts embryonic phenotypes. By shedding light on the mechanisms underlying this process, our study contributes to the broader understanding of germ cell development.  76   In our quest for a more thorough understanding, we recognize the importance of conducting a quantitative analysis of gene expression changes. To address this imperative, we plan to leverage the tools developed in our laboratory. One such tool is the Tel7KI-mCherry ES cell line.  Our intention is to establish these cells as a transgenic mouse line, which will offer a valuable means of marking imprint erasure with red fluorescent protein, akin to the Tel7KI-eGFP mice. Subsequently, by crossbreeding the Tel7KI-mCherry mice with the Oct4-eGFP line, we envision creating a strain that allows simultaneous visualization of imprint erasure with RFP and all migrating germ cells throughout the hindgut using GFP.  By utilizing the dual markers for cell sorting during FACs analysis, the GFP marker could facilitate the sorting of the PGCs, while RFP will enable us to segregate the cells that have undergone imprint erasure. Of particular interest will be exploring potential developmental disparities between cells that have undergone imprint erasure and those that have not, when both cell populations have reached the genital ridge. Subsequently, we could subject these sorted cells to RNA-seq analysis to elucidate the molecular differences between cells that have undergone methylation erasure and those that have not.  Already, we have sorted both ectopic germ cells from the hindgut and the PGCs that have reached the genital ridge, with the aim of subjecting these sorted cell populations to RNA-seq analysis and WGBS. This endeavor promises to yield a detailed comparison of their transcriptomes, thereby expanding our analytical breadth, and providing invaluable insights into 77  the developmental parallels and distinctions between ectopic germ cells and those naturally progressing to the genital ridge stage.   It is our anticipation that both cell populations will exhibit comparable gene activity patterns. This expectation stems from our experimental findings, which suggest that methylation erasure occurs irrespective of proximity to the genital ridge. This does not mean that ectopic PGCs are normal however, and they might mature differentially than those reaching their niche in the developing gonad. In fact, the maturation of PGCs to become meiosis-competent germ cells, a process called licensing, was shown to require interactions with the genital ridge environment86. Given that the sole discernible difference between these two cell populations lies in their spatial location within the embryo, our goal is to procure quantitative data that documents their gene activation patterns compared to gonocytes at the same stage. This approach could provide a robust foundation for affirming the similarity in gene activation profiles between cells situated at varying positions within the embryo.   Moreover, with this data we can analyze and compare this to the transcriptome information of earlier stage PGCs, to identify candidate genes that are significantly upregulated or downregulated during different phases of methylation erasure. From this information, we aim to pinpoint key regulators that could potentially contribute to the PGCs active demethylation. Here our established PGCLC in vitro system provides a significant opportunity to delve deeper into this aspect to elucidate and confirm their roles.   78  By conducting knock-out targeting these candidate genes within the KIP ESCs to differentiate into PGCLCs, we can visualize the Tel7KI-eGFP marker to assess whether imprint erasure continues to occur in the absence of these key regulators. For instance, by using CRISPR technology to generate a Tet1 knockout within KIP ESCs, we could observe whether the erasure and subsequent reactivation of GFP persists within PGCLCs derived from these cells. If Tet1 indeed plays a crucial role in removing DNA methylation marks in gonocytes, we would expect erasure to fail in the absence of this gene. This would support the in vivo data suggesting a role for TET1 in at least some aspects of imprint erasure41,87. Note that Tet1 is already expressed in E9.5 PGCs, so the initiation of Phase II erasure cannot simply be explained by an activation of Tet1 transcription after E11.5 or so. Interestingly, TET1 was recently shown to be stabilized and activated by phosphorylation, raising the possibility that post-translational modification of TET1 could potentially induce the initiation of Phase II DNA demethylation in PGCs88.  Through this approach, we established a useful model for directly testing the functionality of individual genes in a more efficient manner without the need to create new mouse lines. This streamlined method would enable us to gain deeper insights into the mechanisms governing imprint erasure and offer a promising platform for further investigations into the molecular dynamics of PGC development and Phase II erasure.  One notable aspect of the in vitro system is the use of a feeder layer to drive the expansion of these cells into their later PGCLC states. While we maintain that the genital ridge is not necessary for the active demethylation process, we recognize the potential contribution of other 79  extrinsic factors originating from surrounding somatic cells in facilitating this phenomenon. To delve deeper into this aspect, a prospective project could involve culturing these cells onto a non-feeder layer as they advance to later stages of PGC development. Through this approach, we intend to investigate whether imprint erasure persists in the absence of all somatic cells. Although prior studies have shown that these cells can mimic the in vivo system without the presence of genital ridge cells, we cannot overlook the possible contribution of somatic cells to methylation erasure.   Moreover, the PGCLCs were matured on a specialized layer of feeder cells (Sl\/Sl4-m220) expressing a membrane-bound isoform of the Steel factor (the KIT receptor ligand, the m220 variant) which is known for its various roles in cellular processes including proliferation, differentiation, migration, and survival of PGCs in culture89\u201391. However, the specific involvement of the Steel factor in epigenetic erasure remains unclear. Therefore, a potential future direction could also involve utilizing SI\/SI4 fibroblasts, which lack the Steel survival factor, to differentiate the PGCLCs with or without the addition of the soluble Steel factor. This comparative analysis will help elucidate the role of the Steel factor in erasure and address key questions to whether PGCLC expansion on SI\/S14 feeders is achievable. Furthermore, exploring whether Tel7KI-eGFP reactivation occurs in the absence of membrane-bound Steel factor and its role in methylation erasure represents critical avenues for further investigation. These efforts are essential for advancing our understanding of methylation erasure mechanisms and the potential regulation by extrinsic factors originating from somatic cells.  80  Alternatively, we could explore the possibility of creating a line of KIP cells expressing a mutant KIT receptor that is constitutively active, with its tyrosine kinase domain always activated in a Steel-independent manner. Such mutant forms of KIT have been identified in cancer cells92,93. This approach would allow us to investigate whether the PGCLCs can proliferate without a feeder layer and whether they retain the ability to undergo cellular reprogramming. If the KIP cells can differentiate towards the PGCLC stage but fail to undergo active demethylation, it would imply that the feeder cells may facilitate the PGCLCs ability to shed their methylation but does not play a role in their maturation.  Similar dominant mutations have been identified in cancer, particularly in conditions like human mast-cell leukemia cell line, HMC-1, where the KIT receptor and its intracellular tyrosine kinase domain is constitutively activated94. However, the biological significance and biochemical consequences of these activating mutations are not fully understood. Therefore, determining whether KIP PGCLCs expressing the mutant KIT receptor continue to undergo methylation erasure, could provide valuable insights into these mutations and their effects on inducing demethylation or maturation. By elucidating the response of these cells to different growth conditions and their ability to undergo reprogramming, we can gain a deeper understanding of the regulatory pathways involved and their potential roles in disease states such as cancer.  In conclusion, our findings challenge the prevailing notion that extrinsic factors dictate the onset of methylation erasure within PGCs. By looking at the methylation status of ectopic germ cells and their response to the absence of signals from the genital ridge, we have found that active 81  demethylation continues to occur, suggesting that this phenomenon occurs due to intrinsic mechanisms within the cell. This paradigm shift offers new avenues for exploring the dynamics of germ cell development and highlights the need for further investigations into the regulatory pathways governing this process.  Our study introduces innovative new methodologies, such as the Tel7KI- mCherry ES cell line and the in vitro PGCLC model based on KIP ESCs to investigate this, by identifying and targeting candidate genes that could be responsible for the molecular mechanisms underlying this process.  Leveraging these tools in future research can deepen our understanding of genetic and epigenetic factors in germ cell fate determination thus offering insights into potential therapeutic strategies for diseases, reproductive disorders, and the etiology of germ cell tumors.   82  References 1. Bessho, K., Iwasa, Y. & Day, T. The evolutionary advantage of haploid versus diploid microbes in nutrient-poor environments. J Theor Biol 383, 116\u2013129 (2015). 2. Haig, D. Coadaptation and conflict, misconception and muddle, in the evolution of genomic imprinting. Heredity (Edinb) 113, 96\u2013103 (2014). 3. Kono, T. et al. Birth of parthenogenetic mice that can develop to adulthood. Nature 428, 860\u2013864 (2004). 4. Plasschaert, R. N. & Bartolomei, M. S. Genomic imprinting in development, growth, behavior and stem cells. Development 141, 1805\u20131813 (2014). 5. Kono, T., Sotomaru, Y., Katsuzawa, Y. & Dandolo, L. Mouse Parthenogenetic Embryos with Monoallelic H19 Expression Can Develop to Day 17.5 of Gestation. Dev Biol 243, 294\u2013300 (2002). 6. Haig, D. Coadaptation and conflict, misconception and muddle, in the evolution of genomic imprinting. Heredity (Edinb) 113, 96\u2013103 (2014). 7. Wolf, J. B. & Hager, R. A Maternal\u2013Offspring Coadaptation Theory for the Evolution of Genomic Imprinting. PLoS Biol 4, e380 (2006). 8. Moore, T. Genomic imprinting in mammalian development: a parental tug-of-war. Trends in Genetics 7, 45\u201349 (1991). 9. Miyoshi, N., Barton, S. C., Kaneda, M., Hajkova, P. & Surani, M. A. The continuing quest to comprehend genomic imprinting. Cytogenet Genome Res 113, 6\u201311 (2006). 10. Thomson, J. A. & Solter, D. The developmental fate of androgenetic, parthenogenetic, and gynogenetic cells in chimeric gastrulating mouse embryos. Genes Dev 2, 1344\u20131351 (1988). 11. Surani, M. A. H., Barton, S. C. & Norris, M. L. Development of reconstituted mouse eggs suggests imprinting of the genome during gametogenesis. Nature 308, 548\u2013550 (1984). 12. Miyoshi, N., Barton, S. C., Kaneda, M., Hajkova, P. & Surani, M. A. The continuing quest to comprehend genomic imprinting. Cytogenet Genome Res 113, 6\u201311 (2006). 13. Barton, S. C., Surani, M. A. H. & Norris, M. L. Role of paternal and maternal genomes in mouse development. Nature 311, 374\u2013376 (1984). 14. McGrath, J. & Solter, D. Completion of mouse embryogenesis requires both the maternal and paternal genomes. Cell 37, 179\u2013183 (1984). 15. Iwasa, Y. 7 The Conflict Theory of Genomic Imprinting: How Much Can Be Explained? in 255\u2013293 (1998). doi:10.1016\/S0070-2153(08)60369-5. 16. Microcephaly. World Health Organization (2018). 17. Huang, W.-C., Bennett, K. & Gregg, C. Epigenetic and Cellular Diversity in the Brain through Allele-Specific Effects. Trends Neurosci 41, 925\u2013937 (2018). 83  18. Amin, M. et al. A novel homozygous mutation in TRAPPC9 gene causing autosomal recessive non-syndromic intellectual disability. BMC Med Genomics 15, 236 (2022). 19. Liang, Z. S. et al. Trappc9 deficiency causes parent-of-origin dependent microcephaly and obesity. PLoS Genet 16, e1008916 (2020). 20. Adams, J. Imprinting and Genetic Disease: Angelman, Prader-Willi and Beckwith-Weidemann Syndromes. Nature Education 1, 129 (2008). 21. Kishino, T., Lalande, M. & Wagstaff, J. UBE3A\/E6-AP mutations cause Angelman syndrome. Nat Genet 15, 70\u201373 (1997). 22. Nazlican, H. et al. Somatic mosaicism in patients with Angelman syndrome and an imprinting defect. Hum Mol Genet 13, 2547\u20132555 (2004). 23. Eggermann, T. et al. Imprinting disorders. Nat Rev Dis Primers 9, 33 (2023). 24. Eggermann, T. et al. Imprinting disorders: a group of congenital disorders with overlapping patterns of molecular changes affecting imprinted loci. Clin Epigenetics 7, 123 (2015). 25. Grafodatskaya, D., Choufani, S., Basran, R. & Weksberg, R. An Update on Molecular Diagnostic Testing of Human Imprinting Disorders. J Pediatr Genet 06, 003\u2013017 (2016). 26. Saadeh, H. & Schulz, R. Protection of CpG islands against de novo DNA methylation during oogenesis is associated with the recognition site of E2f1 and E2f2. Epigenetics Chromatin 7, 26 (2014). 27. Schulz, R. Chromosome-wide identification of novel imprinted genes using microarrays and uniparental disomies. Nucleic Acids Res 34, e88\u2013e88 (2006). 28. Kobayashi, H. Canonical and Non-canonical Genomic Imprinting in Rodents. Front Cell Dev Biol 9, (2021). 29. Higgs, M. J., Hill, M. J., John, R. M. & Isles, A. R. Systematic investigation of imprinted gene expression and enrichment in the mouse brain explored at single-cell resolution. BMC Genomics 23, 754 (2022). 30. Tucci, V. et al. Genomic Imprinting and Physiological Processes in Mammals. Cell 176, 952\u2013965 (2019). 31. Zhao, L. et al. The dynamics of DNA methylation fidelity during mouse embryonic stem cell self-renewal and differentiation. Genome Res 24, 1296\u20131307 (2014). 32. Thakur, A. et al. Widespread recovery of methylation at gametic imprints in hypomethylated mouse stem cells following rescue with DNMT3A2. Epigenetics Chromatin 9, 53 (2016). 33. Guibert, S., Forn\u00e9, T. & Weber, M. Global profiling of DNA methylation erasure in mouse primordial germ cells. Genome Res 22, 633\u2013641 (2012). 84  34. Wear, H. M., McPike, M. J. & Watanabe, K. H. From primordial germ cells to primordial follicles: a review and visual representation of early ovarian development in mice. J Ovarian Res 9, 36 (2016). 35. Qi, Q. et al. Early Expression of Tet1 and Tet2 in Mouse Zygotes Altered DNA Methylation Status and Affected Embryonic Development. Int J Mol Sci 23, 8495 (2022). 36. Bartolomei, M. S. Genomic imprinting: employing and avoiding epigenetic processes. Genes Dev 23, 2124\u20132133 (2009). 37. Strogantsev, R. et al. Allele-specific binding of ZFP57 in the epigenetic regulation of imprinted and non-imprinted monoallelic expression. Genome Biol 16, 112 (2015). 38. Dahlet, T. et al. Genome-wide analysis in the mouse embryo reveals the importance of DNA methylation for transcription integrity. Nat Commun 11, 3153 (2020). 39. Kohli, R. M. & Zhang, Y. TET enzymes, TDG and the dynamics of DNA demethylation. Nature 502, 472\u2013479 (2013). 40. Yamaguchi, S. et al. Tet1 controls meiosis by regulating meiotic gene expression. Nature 492, 443\u2013447 (2012). 41. Yamaguchi, S., Shen, L., Liu, Y., Sendler, D. & Zhang, Y. Role of Tet1 in erasure of genomic imprinting. Nature 504, 460\u2013464 (2013). 42. Tanaka, S. S. et al. The mouse homolog of Drosophila Vasa is required for the development of male germ cells. Genes Dev 14, 841\u201353 (2000). 43. Hamer, G. & de Rooij, D. G. Mutations causing specific arrests in the development of mouse primordial germ cells and gonocytes. Biol Reprod 99, 75\u201386 (2018). 44. Guibert, S., Forn\u00e9, T. & Weber, M. Global profiling of DNA methylation erasure in mouse primordial germ cells. Genome Res 22, 633\u2013641 (2012). 45. Sanford, J. P., Clark, H. J., Chapman, V. M. & Rossant, J. Differences in DNA methylation during oogenesis and spermatogenesis and their persistence during early embryogenesis in the mouse. Genes Dev 1, 1039\u20131046 (1987). 46. Guibert, S., Forn\u00e9, T. & Weber, M. Global profiling of DNA methylation erasure in mouse primordial germ cells. Genome Res 22, 633\u2013641 (2012). 47. Lee, H. J., Hore, T. A. & Reik, W. Reprogramming the Methylome: Erasing Memory and Creating Diversity. Cell Stem Cell 14, 710\u2013719 (2014). 48. Shirane, K. et al. Mouse Oocyte Methylomes at Base Resolution Reveal Genome-Wide Accumulation of Non-CpG Methylation and Role of DNA Methyltransferases. PLoS Genet 9, e1003439 (2013). 49. Nicholls, P. K. & Page, D. C. Germ cell determination and the developmental origin of germ cell tumors. Development 148, (2021). 85  50. Saitou, M. & Yamaji, M. Primordial Germ Cells in Mice. Cold Spring Harb Perspect Biol 4, a008375\u2013a008375 (2012). 51. Kurimoto, K. et al. Complex genome-wide transcription dynamics orchestrated by Blimp1 for the specification of the germ cell lineage in mice. Genes Dev 22, 1617\u20131635 (2008). 52. Mochizuki, K. et al. Repression of Somatic Genes by Selective Recruitment of HDAC3 by BLIMP1 Is Essential for Mouse Primordial Germ Cell Fate Determination. Cell Rep 24, 2682-2693.e6 (2018). 53. Chen, D. et al. Human Primordial Germ Cells Are Specified from Lineage-Primed Progenitors. Cell Rep 29, 4568-4582.e5 (2019). 54. Gu, Y., Runyan, C., Shoemaker, A., Surani, M. A. & Wylie, C. Membrane-Bound Steel Factor Maintains a High Local Concentration for Mouse Primordial Germ Cell Motility, and Defines the Region of Their Migration. PLoS One 6, e25984 (2011). 55. MATSUI, Y. Regulation of germ cell death in mammalian gonads. APMIS 106, 142\u2013148 (1998). 56. Gu, Y., Runyan, C., Shoemaker, A., Surani, A. & Wylie, C. Steel factor controls primordial germ cell survival and motility from the time of their specification in the allantois, and provides a continuous niche throughout their migration. Development 136, 1295\u20131303 (2009). 57. McCoshen, J. A. & McCallion, D. J. A study of the primordial germ cells during their migratory phase in steel mutant mice. Experientia 31, 589\u2013590 (1975). 58. Rucker, E. B. et al. Bcl-x and Bax Regulate Mouse Primordial Germ Cell Survival and Apoptosis during Embryogenesis. Molecular Endocrinology 14, 1038\u20131052 (2000). 59. Stallock, J., Molyneaux, K., Schaible, K., Knudson, C. M. & Wylie, C. The pro-apoptotic gene Bax is required for the death of ectopic primordial germ cells during their migration in the mouse embryo. Development 130, 6589\u20136597 (2003). 60. Rucker, E. B. et al. Bcl-x and Bax Regulate Mouse Primordial Germ Cell Survival and Apoptosis during Embryogenesis. Molecular Endocrinology 14, 1038\u20131052 (2000). 61. Knudson, C. M., Tung, K. S. K., Tourtellotte, W. G., Brown, G. A. J. & Korsmeyer, S. J. Bax-Deficient Mice with Lymphoid Hyperplasia and Male Germ Cell Death. Science (1979) 270, 96\u201399 (1995). 62. Knudson, C. M., Tung, K. S. K., Tourtellotte, W. G., Brown, G. A. J. & Korsmeyer, S. J. Bax-Deficient Mice with Lymphoid Hyperplasia and Male Germ Cell Death. Science (1979) 270, 96\u201399 (1995). 63. Kujjo, L. L. et al. Enhancing Survival of Mouse Oocytes Following Chemotherapy or Aging by Targeting Bax and Rad51. PLoS One 5, e9204 (2010). 86  64. Perez, G. I. et al. Absence of the proapoptotic Bax protein extends fertility and alleviates age-related health complications in female mice. Proceedings of the National Academy of Sciences 104, 5229\u20135234 (2007). 65. Lewis, A. et al. Imprinting on distal chromosome 7 in the placenta involves repressive histone methylation independent of DNA methylation. Nat Genet 36, 1291\u20131295 (2004). 66. Umlauf, D. et al. Imprinting along the Kcnq1 domain on mouse chromosome 7 involves repressive histone methylation and recruitment of Polycomb group complexes. Nat Genet 36, 1296\u20131300 (2004). 67. Terranova, R. et al. Polycomb Group Proteins Ezh2 and Rnf2 Direct Genomic Contraction and Imprinted Repression in Early Mouse Embryos. Dev Cell 15, 668\u2013679 (2008). 68. Jones, M. J. & Lefebvre, L. An imprinted GFP insertion reveals long-range epigenetic regulation in embryonic lineages. Dev Biol 336, 42\u201352 (2009). 69. Oh, R. et al. Epigenetic and Phenotypic Consequences of a Truncation Disrupting the Imprinted Domain on Distal Mouse Chromosome 7. Mol Cell Biol 28, 1092\u20131103 (2008). 70. Takeuchi, O. et al. Essential role of BAX,BAK in B cell homeostasis and prevention of autoimmune disease. Proceedings of the National Academy of Sciences 102, 11272\u201311277 (2005). 71. Truett, G. E. et al. Preparation of PCR-Quality Mouse Genomic DNA with Hot Sodium Hydroxide and Tris (HotSHOT). Biotechniques 29, 52\u201354 (2000). 72. Invitrogen. LipofectamineTM 3000 Reagent Protocol. (2016). 73. Hayashi, K., Ohta, H., Kurimoto, K., Aramaki, S. & Saitou, M. Reconstitution of the Mouse Germ Cell Specification Pathway in Culture by Pluripotent Stem Cells. Cell 146, 519\u2013532 (2011). 74. Toyooka, Y. et al. Expression and intracellular localization of mouse Vasa-homologue protein during germ cell development. Mech Dev 93, 139\u2013149 (2000). 75. Tanaka, S. S. et al. The mouse homolog of Drosophila Vasa is required for the development of male germ cells. Genes Dev 14, 841\u201353 (2000). 76. Hayashi, K., Ohta, H., Kurimoto, K., Aramaki, S. & Saitou, M. Reconstitution of the Mouse Germ Cell Specification Pathway in Culture by Pluripotent Stem Cells. Cell 146, 519\u2013532 (2011). 77. Takahashi, S., Kobayashi, S. & Hiratani, I. Epigenetic differences between na\u00efve and primed pluripotent stem cells. Cellular and Molecular Life Sciences 75, 1191\u20131203 (2018). 78. Toksoz, D. et al. Support of human hematopoiesis in long-term bone marrow cultures by murine stromal cells selectively expressing the membrane-bound and secreted forms of the human homolog of the steel gene product, stem cell factor. Proceedings of the National Academy of Sciences 89, 7350\u20137354 (1992). 87  79. Ohta, H. et al. In vitro expansion of mouse primordial germ cell\u2010like cells recapitulates an epigenetic blank slate. EMBO J 36, 1888\u20131907 (2017). 80. Jones, M. J., Bogutz, A. B. & Lefebvre, L. An extended domain of Kcnq1ot1 silencing revealed by an imprinted fluorescent reporter. Mol Cell Biol 31, 2827\u201337 (2011). 81. Jones, M. J. & Lefebvre, L. An imprinted GFP insertion reveals long-range epigenetic regulation in embryonic lineages. Dev Biol 336, 42\u201352 (2009). 82. Mochizuki, K. et al. Repression of germline genes by PRC1.6 and SETDB1 in the early embryo precedes DNA methylation-mediated silencing. Nat Commun 12, 7020 (2021). 83. Seisenberger, S. et al. The Dynamics of Genome-wide DNA Methylation Reprogramming in Mouse Primordial Germ Cells. Mol Cell 48, 849\u2013862 (2012). 84. M\u00fcller, M. R., Skowron, M. A., Albers, P. & Nettersheim, D. Molecular and epigenetic pathogenesis of germ cell tumors. Asian J Urol 8, 144\u2013154 (2021). 85. De Felici, M. et al. To Be or Not to Be a Germ Cell: The Extragonadal Germ Cell Tumor Paradigm. Int J Mol Sci 22, 5982 (2021). 86. Hu, Y.-C. et al. Licensing of Primordial Germ Cells for Gametogenesis Depends on Genital Ridge Signaling. PLoS Genet 11, e1005019 (2015). 87. SanMiguel, J. M., Abramowitz, L. K. & Bartolomei, M. S. Imprinted gene dysregulation in a Tet1 null mouse model is stochastic and variable in the germline and offspring. Development (2018) doi:10.1242\/dev.160622. 88. Chen, Z. et al. Phosphorylation stabilized TET1 acts as an oncoprotein and therapeutic target in B cell acute lymphoblastic leukemia. Sci Transl Med 15, (2023). 89. Dolci, S. et al. Requirement for mast cell growth factor for primordial germ cell survival in culture. Nature 352, 809\u2013811 (1991). 90. Godin, I. et al. Effects of the steel gene product on mouse primordial germ cells in culture. Nature 352, 807\u2013809 (1991). 91. Matsui, Y. et al. Effect of Steel factor and leukaemia inhibitory factor on murine primordial germ cells in culture. Nature 353, 750\u2013752 (1991). 92. Piao, X. & Bernstein, A. A point mutation in the catalytic domain of c-kit induces growth factor independence, tumorigenicity, and differentiation of mast cells. Blood 87, 3117\u201323 (1996). 93. Tsujimura, T. et al. Ligand-independent activation of c-kit receptor tyrosine kinase in a murine mastocytoma cell line P-815 generated by a point mutation. Blood 83, 2619\u201326 (1994). 94. Kitayama, H. et al. Constitutively activating mutations of c-kit receptor tyrosine kinase confer factor-independent growth and tumorigenicity of factor-dependent hematopoietic cell lines. Blood 85, 790\u20138 (1995). ","type":"literal","lang":"en"}],"http:\/\/www.europeana.eu\/schemas\/edm\/hasType":[{"value":"Thesis\/Dissertation","type":"literal","lang":"en"}],"http:\/\/vivoweb.org\/ontology\/core#dateIssued":[{"value":"2024-05","type":"literal","lang":"en"}],"http:\/\/www.europeana.eu\/schemas\/edm\/isShownAt":[{"value":"10.14288\/1.0442039","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/language":[{"value":"eng","type":"literal","lang":"en"}],"https:\/\/open.library.ubc.ca\/terms#degreeDiscipline":[{"value":"Medical Genetics","type":"literal","lang":"en"}],"http:\/\/www.europeana.eu\/schemas\/edm\/provider":[{"value":"Vancouver : University of British Columbia Library","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/publisher":[{"value":"University of British Columbia","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/rights":[{"value":"Attribution-NoDerivatives 4.0 International","type":"literal","lang":"*"}],"https:\/\/open.library.ubc.ca\/terms#rightsURI":[{"value":"http:\/\/creativecommons.org\/licenses\/by-nd\/4.0\/","type":"literal","lang":"*"}],"https:\/\/open.library.ubc.ca\/terms#scholarLevel":[{"value":"Graduate","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/contributor":[{"value":"Lefebvre, Louis","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/title":[{"value":"Epigenetic erasure in ectopic primordial germ cells","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/type":[{"value":"Text","type":"literal","lang":"en"}],"https:\/\/open.library.ubc.ca\/terms#identifierURI":[{"value":"http:\/\/hdl.handle.net\/2429\/88096","type":"literal","lang":"en"}]}}