{"http:\/\/dx.doi.org\/10.14288\/1.0441427":{"http:\/\/vivoweb.org\/ontology\/core#departmentOrSchool":[{"value":"Science, Faculty of","type":"literal","lang":"en"},{"value":"Zoology, Department of","type":"literal","lang":"en"}],"http:\/\/www.europeana.eu\/schemas\/edm\/dataProvider":[{"value":"DSpace","type":"literal","lang":"en"}],"https:\/\/open.library.ubc.ca\/terms#degreeCampus":[{"value":"UBCV","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/creator":[{"value":"Lo, Ivan Hok Yin","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/issued":[{"value":"2024-04-18T16:57:01Z","type":"literal","lang":"en"},{"value":"2024","type":"literal","lang":"en"}],"http:\/\/vivoweb.org\/ontology\/core#relatedDegree":[{"value":"Master of Science - MSc","type":"literal","lang":"en"}],"https:\/\/open.library.ubc.ca\/terms#degreeGrantor":[{"value":"University of British Columbia","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/description":[{"value":"The yellow fever mosquito, Aedes aegypti, is a prevalent vector that spreads transmissible diseases in human populations. In the past few decades, increasing effort have been made to study these fascinating animals. The rising research in CRISPR\/Cas9 technology has allowed the potential for gene editing to be done in Ae. aegypti. This thesis focuses on three novel applications of CRISPR\/Cas9 in Ae. aegypti that focus on improving gene editing efficiency and expanding the mosquito genetic toolbox.\r\nIn the first chapter, germline gene promoters (zpg and nanos) are used to promote the expression of Cas9 proteins. We hypothesized that germline gene promoters can bias Cas9 expression in space and time to favor Homology Directed Repair (HDR). We discovered that transient tail expression of fluorescence markers in injected mosquitoes successfully predicted integration of transgene into the germline. This transgene was able to be passed on to the next generation. The use of germline gene promoters can reduce efforts in creating transgenic mosquitoes, as it increases mosquito survival rate and reduce time needed to screen fluorescence.\r\nIn the second chapter, a sgRNA and donor template cassette was inserted into the mosquito genome through piggyBac transposon integration to create a split CRISPR system. We hypothesized that the endogenous expression of CRISPR components in a split system can favor HDR. We found no offspring that had a stable integration of transgene through HDR, while most strains exhibited Mendelian inheritance of\r\nfluorescence genes. Our results show that split systems in gene editing should test multiple candidates to ensure Cas9 activity.\r\nIn the third chapter, we aimed to create a novel balancer chromosome in Ae. aegypti through utilizing CRISPR\/Cas9 to generate a large chromosomal inversion. We applied methods of CRISPR gene editing at two target sites simultaneously, which has the potential for HDR repair to invert the chromosome segment between these sites. Future work will validate the sequences of putative G0 founders. These are the first steps towards creating a novel balancer chromosome.","type":"literal","lang":"en"}],"http:\/\/www.europeana.eu\/schemas\/edm\/aggregatedCHO":[{"value":"https:\/\/circle.library.ubc.ca\/rest\/handle\/2429\/87868?expand=metadata","type":"literal","lang":"en"}],"http:\/\/www.w3.org\/2009\/08\/skos-reference\/skos.html#note":[{"value":" Strategies for improving the genetic toolbox in Aedes aegypti mosquito  by  Ivan Hok Yin Lo  B,Sc. Hons (Animal Biology), University of British Columbia, 2021  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF   MASTER OF SCIENCE  in  The Faculty of Graduate and Postdoctoral Studies  (Zoology)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  April 2024  \u00a9 Ivan Hok Yin Lo, 2024 ii  The following individuals certify that they have read, and recommend to the Faculty of Graduate and Postdoctoral Studies for acceptance, the thesis entitled:  Strategies for improving the genetic toolbox in Aedes aegypti mosquito  submitted by  Ivan Hok Yin Lo  in partial fulfilment of the requirements for the degree of  Master of Science         in Zoology            Examining Committee: Ben Matthews, Assistant Professor, Zoology, UBC          Supervisor  Kota Mizumoto, Associate Professor, Zoology, UBC       Supervisory Committee Member  Kevin Wei, Assistant Professor, Zoology, UBC       Additional Examiner  Additional Supervisory Committee Member: Nozomu Yachie, Professor, School of Biomedical Engineering, UBC    Supervisory Committee Member    iii  Abstract The yellow fever mosquito, Aedes aegypti, is a prevalent vector that spreads transmissible diseases in human populations. In the past few decades, increasing effort have been made to study these fascinating animals. The rising research in CRISPR\/Cas9 technology has allowed the potential for gene editing to be done in Ae. aegypti. This thesis focuses on three novel applications of CRISPR\/Cas9 in Ae. aegypti that focus on improving gene editing efficiency and expanding the mosquito genetic toolbox. In the first chapter, germline gene promoters (zpg and nanos) are used to promote the expression of Cas9 proteins. We hypothesized that germline gene promoters can bias Cas9 expression in space and time to favor Homology Directed Repair (HDR). We discovered that transient tail expression of fluorescence markers in injected mosquitoes successfully predicted integration of transgene into the germline. This transgene was able to be passed on to the next generation. The use of germline gene promoters can reduce efforts in creating transgenic mosquitoes, as it increases mosquito survival rate and reduce time needed to screen fluorescence.  In the second chapter, a sgRNA and donor template cassette was inserted into the mosquito genome through piggyBac transposon integration to create a split CRISPR system. We hypothesized that the endogenous expression of CRISPR components in a split system can favor HDR. We found no offspring that had a stable integration of transgene through HDR, while most strains exhibited Mendelian inheritance of iv  fluorescence genes. Our results show that split systems in gene editing should test multiple candidates to ensure Cas9 activity. In the third chapter, we aimed to create a novel balancer chromosome in Ae. aegypti through utilizing CRISPR\/Cas9 to generate a large chromosomal inversion. We applied methods of CRISPR gene editing at two target sites simultaneously, which has the potential for HDR repair to invert the chromosome segment between these sites. Future work will validate the sequences of putative G0 founders. These are the first steps towards creating a novel balancer chromosome.                   v  Lay Summary Yellow fever mosquitoes are dangerous vectors that take bloodmeals from humans. Many attempts have been made to control their population worldwide, with some using the power of genetics. To create a genetically modified mosquito, a long time and a lot of effort must be invested by researchers. The work done in this thesis presents various attempts to improve what we can do in mosquito genetics. We used different strategies to tackle current problems with CRISPR gene editing in mosquitoes. We also plan to create a new tool that can help reduce the effort needed to breed mosquitoes. Some of my results show that certain strategies fail to work due to mosquitoes being weaker when genetically modified. We provide some suggestions for future work in this field, as well as present evidence for exciting first steps in generating a novel tool.  vi  Preface The work completed in this thesis is primarily done by the author, Ivan Lo. All experiments were completed by Ivan Lo at the Ben Matthews Lab. The work done to validate sgRNA activity was previously published by me and Dr. Benjamin Matthews. This thesis is an extension of a previous thesis done during my Honors work as a B.Sc. student in UBC.  In Chapter 2 \u2013 Helper Plasmid, embryo microinjections and the initial screening of helper plasmid strains were completed by our collaborators, the members of the McMeniman Lab. The idea behind Chapter 2 and Chapter 3 were conceived through collaboration of Dr. Ben Matthews, Dr. Conor McMeniman, Dr. Andrew Hammond and me. In Chapter 4, the strategy for creation of a novel balancer chromosome was suggested by one of my committee members, Dr. Kota Mizumoto.  The illustration of Aedes aegypti was done by a fellow graduate student in the Ben Matthews Lab, Leisl Brewster. All figures and data analysis were completed by Ivan Lo with the use of Microsoft Excel, GraphPad Prism, R studios and Adobe Illustrator. The embryo microinjection set up was done with the help of Cassidy Mark and Nicholas Tochor. The creation of helper plasmid was done with the help of Jonathan Chiang and the validation of gene targets for balancer chromosome was done with the help of Dania Samara. Both students completed their work under the direct supervision of Ivan Lo.  All transgenic mosquito strains were kindly provided to us by the McMeniman Lab, Johns Hopkins University.  vii  Table of Contents Abstract  ..................................................................................................................... iii Lay Summary ................................................................................................................. v Preface  ..................................................................................................................... vi Table of Contents ........................................................................................................ vii List of Tables ................................................................................................................ xi List of Figures ............................................................................................................. xii List of Abbreviations .................................................................................................. xiii Acknowledgements .................................................................................................... xiv 1 Introduction ................................................................................................................ 1 1.1 Introduction to CRISPR\/Cas9 and Aedes aegypti ............................................ 1 1.1.1  Introduction to Aedes aegypti mosquito ........................................................... 1 1.1.2  Methods in traditional mosquito population control .......................................... 1 1.1.3  Summary of genetic manipulation techniques .................................................. 2 1.1.4  Introduction to CRISPR\/Cas9 .......................................................................... 3 1.1.5  CRISPR\/Cas9 in organisms ............................................................................. 4 1.1.6  Overall project approach and chapter summaries ............................................ 5 2 The use of germline gene promoters to express Cas9 in helper plasmids ...... 7 2.1 Introduction ......................................................................................................... 7 2.1.1  Developmental Timing and Efforts in Improving HDR Repair ........................... 7 2.1.2  Introduction to gene drives ............................................................................... 8 2.1.3  Previous methods in optimising CRISPR\/Cas9 in Ae.aegypti .......................... 9 2.1.4  Helper Plasmid Project Approach and Significance ....................................... 10 2.2 Methods ............................................................................................................. 12 2.2.1  Mosquito Rearing and Maintenance .............................................................. 12 2.2.2  Establishment of Helper Plasmid ................................................................... 12 viii  2.2.3  Embryo Microinjection of Helper Plasmids ..................................................... 13 2.2.4  Fluorescence screening ................................................................................. 13 2.2.5  Pooled and Individual Egg laying of Transgenic Mosquitoes ......................... 13 2.2.6  Statistical Analysis ......................................................................................... 14 2.2.7  Software Availability and Data Availability ...................................................... 14 2.3 Results .............................................................................................................. 15 2.3.1  Design of Helper plasmids and generation of G0s ......................................... 15 2.3.2  ExuCas9 strain and nanos-Cas9 helper promoted tail transience despite similar hatch rates of injected G0s ............................................................................. 18 2.3.3  ExuCas9 male G0s with transient marker expression were most likely to give rise to transgenic progeny .................................................................................. 21 2.3.4  At least three exuCas9 founders identified with successful HDR repair events ........................................................................................................................ 24 2.4 Discussion ........................................................................................................ 25 2.4.1  Improvements in survival rate of injected G0s ................................................ 25 2.4.2  Discussion of nanos helper design ................................................................ 26 2.4.3   Discussion of zpg helper design .................................................................... 27 2.4.4  Advantages of exuCas9 strain ....................................................................... 28 2.4.6  Males gave rise to more transgenic offspring than females ........................... 30 2.4.7  Fitness and Cas9 toxicity ............................................................................... 31 2.4.8  Future work and limitations ............................................................................ 32 2.4.9  Conclusions ................................................................................................... 33 3 Use of transposon mediated integration to create a split CRISPR\/Cas9 system  .................................................................................................................... 34 3.1 Introduction to transposon transgene ............................................................ 34 3.1.1  Transposon mediated transfer of genetic material ......................................... 34 3.1.2  Background of HACK system and split gene drives ....................................... 35 3.1.3  Project approach and significance ................................................................. 36 3.2 Methods ............................................................................................................. 38 3.2.1  Design of Transposon Transgene Cassette ................................................... 38 3.2.2  Hifi Assembly and Cloning ............................................................................. 38 3.2.3  Generation of PiggyBac Transposase mRNA ................................................ 39 3.2.4  Gel Electrophoresis ........................................................................................ 39 3.2.5  Mosquito Rearing and Maintenance .............................................................. 39 3.2.6  Embryo Microinjection .................................................................................... 40 3.2.7  Fluorescence Screening and Crossing scheme ............................................. 40 ix  3.2.8  Genomic DNA extraction ................................................................................ 41 3.2.9  PCR and Sequencing .................................................................................... 41 3.2.10  Splinkerette PCR ........................................................................................... 42 3.2.11  PCR Identification of NHEJ activity ................................................................ 42 3.2.12  Data Analysis ................................................................................................. 43 3.2.13  Software Availability and Data Availability ...................................................... 43 3.3 Results .............................................................................................................. 44 3.3.1  Design of Transposon Cassette (TC) and fluorescence expression in larvae  ........................................................................................................................ 45 3.3.2  Generation of TC carriers ............................................................................... 47 3.2.3  Crossing scheme for TC and Cas9 in the G3 cross ........................................ 47 3.3.3  7 G4 strains were recovered from G3 x exuCas9 ............................................ 49 3.3.4  53 G5 strains were screened for HDR but none were successfully identified .................................................................................................................... 51 3.3.5  Two G6s showed possible HDR events but not in G7s ................................... 52 3.3.6  Mapping location of TC insertion .................................................................... 54 3.3.7  Check for NHEJ showed no Cas9 activity in G4s ........................................... 55 3.4 Discussion ........................................................................................................ 56 3.4.1  Design of TC and use of the ExuCas9 strain ................................................. 56 3.4.2  Genome of Ae. aegypti and the location of TC .............................................. 56 3.4.3  HDR is affected by the proximity of the donor template ................................. 57 3.4.4  Maternal deposition of Cas9 in G4 offspring ................................................... 58 3.4.5  Toxicity of Cas9 and lowered fitness .............................................................. 60 3.4.6  Cas9 activity and possible HDR event in G6s ................................................ 61 3.4.7  Limitations and Future Directions ................................................................... 62 3.4.8  Conclusion ..................................................................................................... 62 4 Generation of a novel balancer chromosome ................................................... 64 4.1 Introduction ....................................................................................................... 64 4.1.1  Introduction to balancer chromosomes .......................................................... 64 4.1.2  Project approach and significance ................................................................. 65 4.2 Methods ............................................................................................................. 68 4.2.1  Mosquito Strains ............................................................................................ 68 4.2.2  Identification of Possible Targets to Chromosomal Inversions ....................... 68 4.2.3  sgRNA Design and Transcription ................................................................... 69 4.2.4  Embryo Microinjection with sgRNA injection mix ............................................ 69 4.2.5  Testing sgRNA Activity \u2013 ICE ......................................................................... 70 x  4.2.7  Embryo Microinjection of ssORNs to Generate Chromosomal Inversion ....... 71 4.2.8  Screening of Transgenic Mosquito and Outcross to Yellow ........................... 71 4.2.9  Data Analysis ................................................................................................. 71 4.3 Results .............................................................................................................. 72 4.3.1  Identification of possible targets to generate chromosomal inversions .......... 73 4.3.2  Validation of sgRNA designs .......................................................................... 75 4.3.3  Design of bi-genic ssODNs ............................................................................ 76 4.3.4  Screening eggs laid by G0 x Yellow crosses to determine possible chromosomal inversion events .................................................................................. 78 4.4 Discussion ........................................................................................................ 80 4.4.1  Yellow phenotype restricted to egg development only ................................... 80 4.4.2   All possible G0 founders were males, majority of females did not give offspring ..................................................................................................................... 81 5 Overall conclusions ............................................................................................. 83 5.1.1  Conclusions for the genetic toolbox of Ae. aegypti ..................................... 83 5.1.2  Future work in Ae. aegypti genetics .............................................................. 84 Bibliography ................................................................................................................ 86     xi  List of Tables Table 2.1 Number of Transgenic G1s generated (3xP3 dsRed +) in zpg-Cas9, nos-Cas9 helper plasmid injections compared to exuCas9 strain in the first pooled egg laying cycle. ................................................................................................................... 20 Table 4.1 Total count for G0s injected with bi-genic ssODNs targeting V and yellow. ...................................................................................................................................... 78 Table 4.2 Total counts for G0s x yellow cross that gave eggs between female and male G0s. ...................................................................................................................... 78 Supp. Table 1 Primer sequences used in Chapter 2, 3 and 4. ........................... 101 Supp. Table 2 Number of hatched G0s and Number of transient larvae in Chapter 2 Helper Plasmid. ........................................................................................................ 103 Supp. Table 3 Count for larval expression pattern in generation of transgenic G1s from exuCas9 G0 founders.  ........................................................................................ 104 Supp. Table 4 Identity of parental crosses in Supplementary Table 3. ............... 105 Supp. Table 5 Larval expression pattern and number of hatch in G4s. .............. 105 Supp. Table 6 Larval expression pattern in G5s. ................................................ 106 Supp. Table 7 Larval expression pattern of G6s. ................................................ 107 Supp. Table 8 Injection of mix of sgRNA in exuCas9 to validate their activity. ... 108 Supp. Table 9 Number of eggs hatched and subsequently gave yellow eggs during outcross for injection of bi-genic templates to generate chromosomal inversion.  .................................................................................................................................... 108 Supp. Table 10 ssODN template sequences used for yellow and V2 .................. 108   xii  List of Figures Figure 2.1 Helper Plasmid Design Schematic. .......................................................... 15 Figure 2.2 Hatch rate and transient tail expression rate of helper plasmids and exuCas9 G0s. ............................................................................................................... 17 Figure 2.3 Schematic representation of exuCas9 G0 cross that gave rise to transgenic G1s. .............................................................................................................. 19 Figure 2.4 Identification of the number of founders in the second egg laying cycle through positive fluorescence rate and hatch rate of 63 outcrosses. ............................ 23 Figure 3.1 Transposon Cassette (TC) design.  ......................................................... 44 Figure 3.2 Overview of Ae. aegypti crosses to generate HDR events in after G4s. ... 46 Figure 3.3 Scatterpie graph showing number of larvae in 9 G4 strains and the proportion of fluorescence expression patterns in larvae. ............................................. 48 Figure 3.4 Scatterpie graph showing number of larvae in 53 G5 strains and the proportion of fluorescence expression patterns in larvae. ............................................. 50 Figure 3.5 Pie chart showing distribution of larval expression where two larvae with red eyes only were identified in G6s  ............................................................................. 52 Figure 3.6 Schematic of Splinkerette PCR and check for NHEJ activity at the ppk301 cut site, using G4 genomic DNA. ................................................................................... 53 Figure 4.1 Schematic of four genic targets in Chr. 1 of Ae. aegypti to generate chromosomal inversions. ............................................................................................... 72 Figure 4.2 Percentage of reads containing indels for all sgRNA designs across four genic targets. ................................................................................................................. 74 Figure 4.3 Schematic representation of chromosomal inversions generated by two DSBs, and repaired according to two \u201cbi-genic\u201d ssODN templates. .............................. 76 Figure 4.4 Schematic of crossing scheme for G0s to identify possible chromosomal inversion. ....................................................................................................................... 77 Figure 4.5 Schematic representation of primary and secondary inversions to generate a balancer....................................................................................................... 82 Supp. Fig. 1 Scatterpie chart showing distribution of larval expression in G6s.. ......... 100 xiii  List of Abbreviations Ae. aegypti: Aedes aegypti An. gambiae: Anopheles gambiae C. elegans: Caenorhabditis elegans CRISPR: Clustered Regularly Interspaced Short Palindromic Repeats D. melanogaster: Drosophila melanogaster DIPA-CRISPR: Direct Parental CRISPR HDR: Homology Directed Repair ITR: Inverted terminal repeat LVP: Liverpool  NHEJ: Non-Homologous End Joining PCR: Polymerase Chain Reaction ReMOT Control: Receptor-Mediated Ovary Transduction of Cargo RIDL: Release of Insects Carrying a Dominant Lethal Gene RNP: Ribonucleoprotein sGD: split Gene Drive sgRNA: single-guide RNA SIT: Sterile Insect Technique ssODN: single-stranded oligodeoxynucleotide  TC: Transposon Transgene Cassette  TE: transposable elements  WT: Wildtype     xiv  Acknowledgements  I offer my gratitude to Dr. Benjamin Matthews and the members of the lab at UBC, who have helped me achieve my goals to study gene editing and push the frontiers of CRISPR. I owe my gratitude to my fellow lab members, Orna, Leisl, Elsa, Jonathan, Nick, Cassidy and Bridget who have all contributed to my academic career. Special thanks to members of the McMeniman Lab for allowing me to collaborate with them on studying the fascinating mosquitoes. Thank you to Dr. Conor McMeniman, Dr. Margaret Wohl and Dr. Andrew Hammond for taking time to teach me the basics of embryo microinjection.  I am inspired to continue contributing to the world of science.      1  1 Introduction 1.1 Introduction to CRISPR\/Cas9 and Aedes aegypti 1.1.1  Introduction to Aedes aegypti mosquito  The yellow fever mosquitoes Aedes aegypti cause significant mortality in humans annually by the transmission of pathogens (Dong et al., 2015; Scott & Takken, 2012). When infected by arboviruses, these mosquitoes become vectors that can carry yellow fever, dengue, chikungunya and zika (Barrett & Higgs, 2007; S. B., 2008). Specifically, Ae. aegypti are anthropophilic mosquitoes that prefer human as blood source, as females require nutrients from blood meals for energy and egg development (Scott & Takken, 2012). Once females bite an infected human, arboviruses can stably infect and harbor in the mosquito. These females can spread viruses when they take subsequent bloodmeals, thereby spreading throughout a human population. (Fuller, 1961; McBride et al., 2014). Combined with their ability to lay large numbers of eggs in small bodies of fresh water (Fuller, 1961; Matthews, Younger & Vosshall, 2019), this makes yellow fever mosquitoes dangerous organisms that must be carefully controlled and studied.  1.1.2  Methods in traditional mosquito population control   Mosquito population control has traditionally relied on chemical insecticides, but the effectiveness of pesticides has waned due the development of resistance to chemicals. As an improvement to traditional strategies, genetic controls have been steadily implemented worldwide in the last decade. These genetic controls can prevent viral infections, cause mosquito sterility, or introduce genetic disruptions (Alphey, L., 2014). To control the spread of arboviruses by Ae. aegypti, strains of mosquito with a 2  stable infection of intracellular bacteria Wolbachia pipientis has been deployed in the field to limit viral infections (Moreira et al., 2009; Tantowijoyo et al., 2022). To reduce Ae. aegypti populations, Sterile Insect Technique (SIT) makes use of the mass release of sterile male mosquitoes. If effective, female mosquitoes that mate with sterile males will fail to develop viable offspring (Phuc et al., 2007; Krafsur, 1998). The male determining factor Nix in Ae. aegypti can also be expressed to convert females into males, or even cause females to die off. This creates a male bias in the population and reduces the overall population (Adelman & Tu, 2016). SIT has been further developed into the Release of Insects Carrying a Dominant Lethal Gene (RIDL) system, which is a cassette carrying dominant lethal genes, causing the population to crash when males mate and spread this transgene to the offspring (Labbe et al., 2012). Traditional SIT uses irradiation to sterilise males but induce high fitness costs and require separating males from females; the RIDL system uses genetic insertion of a lethal cassette that can sometimes help differentiate male and female phenotypes (Labbe et al.,2012; Wang et al., 2021). These traditional methods suppress mosquito populations through the mass release of lab mosquito strains, without causing genetic modifications to wild populations. 1.1.3  Summary of genetic manipulation techniques  Targeting genetic factors in the mosquito requires molecular techniques that have been developed in recent years. Using in vivo genetic manipulation, gene editing has been introduced to help alter mosquito populations. Genetic manipulation of Ae. aegypti aims to introduce transgenic elements into the mosquito to alter their genotypes and phenotypes. Transposable elements (TE) like Mariner (Coates et all., 1998), Hermes 3  (Jasinskiene et al., 1998) and piggyBac transposons (Kokoza et al., 2001; Lobo et al., 2006) were used to insert transgenes at random into the Ae. aegypti genome. These inserted elements can range from visual markers to lethal constructs. Manipulation later involved the cleavage of DNA using Homing Endonuclease Genes (HEG) and synthetic Medea element to bias inheritance of genes of interest (Alphey, 2014; Burt, 2003; Hay et al., 2010). These methods then further developed into targeted gene knockout using Zing Finger Nucleases (ZFN) (DeGennaro et al., 2013; McMeniman et al., 2014) or Transcription Activator-Like Effector Nucleases (TALEN) (Aryan et al., 2013; Aryan, Myles & Adelman, 2014), which gave researchers the opportunity to accurately disrupt target genes. These methods make use of multiple DNA-binding domains to target a specific target site, which require careful design and lengthy cloning processes before their implementation (Dong et al., 2015; Sentmanat et al., 2018). With the establishment of Clustered Regularly Interspaced Palindromic Repeats (CRISPR) systems as a staple in the field of biology, CRISPR\/Cas9 has been adapted by researchers in Ae. aegypti to great success.  1.1.4  Introduction to CRISPR\/Cas9  CRISPR\/Cas9 system provides a relatively straightforward process from designing to implementing genetic disruption in organisms. Originally discovered in the Streptococcus pyogenes bacterial immune system, it serves as an RNA-guided nuclease that cleaves viral DNA and plasmids (Barrangou et al., 2007; Barrangou & Pijkeren, 2016; Doudna & Charpentier, 2014). Previous work has established a chimeric single-guide RNA (sgRNA), which combines the trans-activating crRNA (tracrRNA) with the precursor crRNA (pre-crRNA) to direct the Cas9 nuclease protein (Cong et al., 2013; 4  Jinek et al., 2012; Ren et al., 2013; Wang et al., 2013). The sgRNA can be designed as a 20 - 23 bp sequence that includes and recognizes the Protospacer Adjacent Motif (PAM) sequence in the target (5\u2019-NGG-3\u2019). Combined with homology sequence binding to another ten to twelve nucleotides through Watson-Crick base pairing, the sgRNA can easily target most genetic sequences in a genome (Li et al., 2017a; Ma et al., 2016; Sternberg et al., 2014). The Cas9-sgRNA complex then cleaves the DNA on both strands and create a Double-Strand Break (DSB).  This DSB is repaired by two distinct and conserved pathways in the eukaryotic cell machinery (Tang et al., 2019). The more frequent pathway is Non-Homologous End Joining (NHEJ), which ligates the DSB ends with the use of DNA Ligase IV and other protein complexes. This process is error-prone and can generate insertion\/deletion (indel) mutations. The less frequent pathway is Homology Directed Repair (HDR), which is a faithful repair of the DSB according to any homologous DNA sequence present (Chen et al., 2021b; Nambiar et al., 2022; Paix et al., 2017; Sekelsky, 2017). Genetic manipulation in organisms can be done using the HDR pathway. An exogenous source of DNA with homology sequence to the DSB is provided to the cell, so that HDR repair can alter the genic sequence according to this donor template (Chang et al., 2013; Richardson et al., 2016; Song & Stieger, 2017). The activity of the two pathways during the cell cycle and efforts in optimising CRISPR\/Cas9 HDR repair is further discussed in Chapter 1 Helper Plasmid \u2013 Introduction.  1.1.5  CRISPR\/Cas9 in organisms  The utilization of CRISPR\/Cas9 for precise genetic editing has been widely adapted to model and non-model organisms. HDR editing was first adapted to 5  traditional model organisms including mice (Xue et al., 2014), zebrafish (Chang et al., 2013) and Caenorhabditis elegans (Friedland et al., 2013). In arthropods, HDR editing was first shown to be successful in Drosophila melanogaster (Bassett et al., 2013; Gratz et al., 2013; Ren et al., 2013). Mosquito gene editing was later developed in Anopheles gambiae (Hammond et al., 2016) and Aedes aegypti (Kistler, Vosshall & Matthews, 2015), and has moved on to be adapted in many insects (Sun et al., 2017; Taning et al., 2017; Yan et al., 2023). Application of CRISPR\/Cas9 in Ae. aegypti is wide ranging and can create transgenic lines for many purposes. To study mosquito physiology and attraction to humans, mutants have been created using CRISPR\/Cas9 to target key genes. Some notable examples include Op1 and Op2 mutations to study vision during host seeking (Zhan et al, 2021) and ppk301 mutation to study egg laying in fresh water (Matthews, Younger and Vosshall, 2019). Others have created novel genetic tools in Ae. aegypti using precise CRISPR genetic knock-in, like the creation of strains that allow pan-neuronal calcium imaging (GCaMP) and the Q binary expression system to study neurons (QF2\/QUAS) (Zhao, Tian and McBride, 2021).  1.1.6  Overall project approach and chapter summaries  Although CRISPR\/Cas9 is a widely adaptable system to be used in Ae. aegypti, much effort is still needed to further optimize the mosquito genetic toolbox. This thesis aims to improve genetic manipulation in Ae. aegypti using three strategies. In Chapter 2, helper plasmids were designed with germline gene promoters to express the Cas9 protein during developmentally optimal timing, which can bias DSB repair to HDR.  In Chapter 3, the sgRNA and donor template were integrated into the Ae. aegypti genome using efficient but random transposase-mediated mutagenesis to create a 6  transgenic line, which can be later crossed with a Cas9 transgenic line. The meeting of the CRSPR\/Cas9 components could lead to HDR repair according to an endogenous donor template. This can hopefully reduce the number of mosquitoes needed to establish a stable edited line as compared with direct embryo microinjection of Cas9 components.   Finally in Chapter 4, we made use of CRISPR\/Cas9 to make DSBs at two locations of the chromosome. These DSBs can be repaired by HDR through a \u201cbi-genic\u201d donor template, which induces the chromosomal inversion across the two DSB junctions. Once a chromosomal inversion occurs, it can be the first step towards creating a valid balancer chromosome for Ae. aegypti. The ability of balancer chromosomes to prevent gene recombination is further discussed in Chapter 3 Balancer Chromosome \u2013 Introduction.   Not only is Ae. aegypti a potent vector, it is also a growingly popular non-model organism in the fields of neurobiology and physiology. The improvement to CRISPR\/Cas9 gene editing and creation of novel genetic tools can help reduce efforts in mosquito rearing and research. The result of this work can be widely adaptable from the genetic manipulation of Ae. aegypti to creating transgenic lines for reverse genetics.      7  2 The use of germline gene promoters to express Cas9 in helper plasmids  2.1 Introduction 2.1.1  Developmental Timing and Efforts in Improving HDR Repair   CRISPR\/Cas9 generated DSBs are repaired by NHEJ and HDR pathways in the cell. Although the choice between pathways is currently an active area of research, it is known that NHEJ happens predominantly compared to HDR in mammalian cells (Savic et al., 2018). In NHEJ, the activity of various recruited protein complex restricts the DSB and ligate the ends together (Chen et al., 2021b; Liu et al., 2019). This creates mutations and errors in repairing DSBs. In HDR, the Rad51 protein searches for homologous sequences to the DSB, which is usually the sister chromatid. This allows the repair to be \u201cerror-free\u201d and faithful to the original sequence before DSB (Krejci et al., 2012; Liu et al., 2019). While NHEJ is active during all parts of the cell cycle (Iyama & Wilson, 2013), HDR is mainly active during the S- and G2- phase (Gutschner et al., 2016; Howden et al,, 2016). This cell machinery is conserved in Drosophila melanogaster (Sekelsky, 2017) and Ae. aegypti (Mota et al., 2019). When an exogenous donor template is provided to the cell, HDR can repair DSBs according to this donor and edit the gene of interest.  As gene editing relies on HDR, previous work has sought to bias the HDR pathway through various approaches (Liu et al., 2019). One approach is to target the NHEJ pathway and reduce its efficiency, which includes DNA Ligase IV inhibition 8  (Srivastava et al., 2012) and small interfering RNA (siRNA) inhibition of NHEJ protein expression (Li et al., 2018). Others have shown that Cas9 delivery during cell cycle arrest in the S and G2 phase can bias HDR in mammalian cells (Lin et al., 2014 ; Yang et al., 2016). While these methods can successfully bias HDR, most of these methods have yet to be explored in vivo in Ae. aegypti. In other mosquito systems, it has been shown that Cas9 maternal deposition is a main source of NEHJ mutations. Cas9 protein deposited into germline cells of Anopheles gambiae\/coluzzi females cause DSBs and NHEJ repair in the offspring (Gantz et al., 2015; Hammond et al., 2017; Hammond et al., 2020). The higher efficiency of NHEJ lowers the possibility of HDR events, and thus decrease efficiency of gene editing. To overcome maternal Cas9 effects, the use of germline gene promoter to express Cas9 can restrict the timing of DSB repairs to bias HDR. The avoidance of maternal Cas9 and NHEJ effects is specifically important in gene drive settings.  2.1.2  Introduction to gene drives  CRPSR gene drive is one of the most actively researched areas in mosquito genetics, due to its potential to use HDR editing to affect mosquito populations. This technology relies on the homing of selfish genetic elements that can copy itself into the genome and allows it to be passed on throughout a population (Burt, 2003). These genetic elements spread by integrating their copies into the genome, which can spread in subsequent offspring and alter an entire population. With the rise of CRISPR\/Cas9 systems, homing based gene drives have been developed in Drosophila melanogaster (Champer et al., 2017; Marshall et al., 2017), Anopheles stephensi (Gantz et al., 2015), Anopheles gambiae (Hammond et al., 2016) and Aedes aegypti (Anderson et al., 2023; 9  Reid et al., 2022; Li et al., 2020). Through the inheritance of a CRISPR\/Cas9 construct, transgenes are passed on a higher rate than the expected Mendelian inheritance of alleles (Champer, Buchamn & Akbari, 2016). This spread of transgenes relies on HDR editing to continuously introduce transgenic elements into the parental germline cells. NHEJ mutations to the target site can cause mutations and make the target unavailable for gene drive, which is known as gene drive resistance (Champer, Buchamn & Akbari, 2016; Hammond et al., 2020). Therefore, it is beneficial for gene editing to not only increase HDR rate, but also decrease NHEJ events.   2.1.3  Previous methods in optimising CRISPR\/Cas9 in Ae.aegypti  Delivery of CRISPR\/Cas9 into the mosquito system relies on the direct microinjection of various forms of Cas9 and CRISPR components into the pre-blastoderm embryo of Ae. aegypti (Wohl & McMeniman, 2023). Cas9 can be injected in the forms of recombinant Cas9 protein (Kistler, Vosshall & Matthews, 2015), Cas9 mRNA (Dong et al., 2015) or Cas9 plasmids (Reid et al., 2022). Direct injection of recombinant Cas9 protein, along with sgRNA and Donor DNA plasmid resulted in a G0 survival of 9.6% and HDR repair rate of 0.71% (Kistler, Vosshall & Matthews, 2015). Cas9 protein can also be delivered into adult mosquitoes. Receptor-Mediated Ovary Transduction of Cargo (ReMOT Control) involves the direct delivery of Cas9 ribonucleoportein (RNP) into the adult female ovaries to carry out germline gene editing (Chaverra-Rodriguez et al., 2018). Most recently, direct parental-CRISPR (DIPA-CRISPR) has been shown to be effective via injection of Cas9 sgRNA RNP into the haemocoel of blood fed Ae. aegypti females (Shira et al., 2023).  10  Although both methods show great promise in reducing the time and effort required for embryo microinjection, they are currently restricted to generating NHEJ mutations only. Without the co-delivery of donor template, HDR editing have not been adapted in both ReMOT control and DIPA-CRISPR. Components of CRISPR\/Cas9 can also be endogenously expressed, as previously mentioned in gene drive scenarios. Transgenic, endogenous expression of Cas9 has previously been created in Li et al. (2017). This approach allows Cas9 to be expressed in transgenic mosquitoes that can then be injected with sgRNA or crossed with other transgenic strains (Sun et al., 2022). (Use of transgenic strains for CRISPR\/Cas9 system components is further discussed in Chapter 3 Transposon Transgene \u2013 Introduction). Our approach to improve HDR editing in Ae. aegypti will be to focus on increasing HDR editing rate and increasing the survival rate for embryo microinjection.  2.1.4  Helper Plasmid Project Approach and Significance As previously discussed in Lo (2021), this project builds upon the work done by Hammond et al. (2021) to improve HDR editing in An. gambiae. In summary, they investigated three germline genes to promote Cas9 activity and found up to 99.6% transmission in some gene drive constructs. We used gene orthologs of the germline genes zpg (AGAP007365 in An. gambiae; AAEL006726 in Ae. aegypti) and nos (AGAP006098 in An. gambiae; AAEL012107 in Ae. aegypti), and constructed Cas9 expression plasmids with the proposed regulatory regions of each gene. We compared HDR rates from the plasmid injections with an established transgenic strain Exu-Cas9, which expresses Cas9 with an exuperentia (AAEL010097) promoter and is integrated stably into the genome (Li et al., 2017). These embryos were provided via direct 11  microinjection with a separate source of sgRNA and donor template encoding a fluorescent marker to test for HDR integration efficiency (hereby known as HDR rate). We hypothesized that if germline gene promoters express Cas9 in developmentally optimal timing, more Ae. aegypti larvae will gain eye fluorescence through HDR. The results generated in this study can help reduce the time needed to generate a novel targeted transgenic line, which often requires lengthy screening and microinjection processes. If survival rate of G0s increase, less efforts can be invested in multiple rounds of embryo microinjections. Improvement towards HDR can also help elucidate the mechanism of DSB repair within Ae. aegypti, which could have implications for future gene editing work. As gene drive is increasingly contemplated as key mosquito control strategies across the world, improvement to HDR can improve fundamental mechanisms behind these genetic manipulation strategies.    12  2.2 Methods  2.2.1  Mosquito Rearing and Maintenance Aedes aegypti mosquitoes were maintained according to standard protocol as described (Sun et al., 2022; Wohl & McMeniman, 2023). Mosquito eggs were hatched in a vacuum chamber (20 \u2013 25 Psi) and kept in containers of dechlorinated water until pupation. All adult mosquito strains were kept at 25 \u2013 28 \u00b0C in mesh cages (Bugdorm, 4M3030), with constant relative humidity of 70-80% and 12 : 12 light : dark photoperiod. 10% sucrose solution was provided in the mesh cages of mixed sex for strain maintenance. All females were blood fed on defibrillated sheep blood (Cedarlane Labs, DSB250) via a glass mosquito feeder (Chemglass, Cat# CG1836) with a layer of parafilm spread across the feeder. Blood inside the feeder was warmed to 37.5\u00b0C. Blood fed mosquito cages were given 30% sucrose solution to minimize egg laying on 10% sucrose solution sugar wicks.  I utilised two different strains in this chapter. Wild-type laboratory Liverpool strain (LVP) was reared and maintained at the McMeniman Lab. Exu-Cas9 strain had a stable integration of Exuprentia promoter region expressing Cas9 sequence and a DsRed fluorescence body marker (Li et al., 2017). Both strains were kindly provided and reared by Dr. Connor McMeniman and colleagues (Johns Hopkins Malaria Research Institute). 2.2.2  Establishment of Helper Plasmid  All cloning and Hifi assembly procedures were previously described in (Lo, I. 2021).  13  2.2.3  Embryo Microinjection of Helper Plasmids   Two helper plasmids expressing Cas9 (nanos and zpg) were previously created via commercial HiFi assembly kit (Lo, I. 2021). Helper plasmids were injected into Wildtype Liverpool (LVP) strain mosquito embryos with sgRNA targeting Ir8a and Ir8a3xP3 dsRed donor template at the McMeniman Lab, as described in (Raji et al., 2019). Ir8a sgRNA and Ir8a3xP3 dsRed donor template were also injected into ExuCas9 strain. Embryo microinjection procedures were done according to Sun et al. (2022).  2.2.4  Fluorescence screening  Injected embryos were hatched and screened under a fluorescence microscope at the 3rd-4th instar stage. Larvae were separated individually on an 8-well glass slide. Small droplets of water were provided to prevent larval desiccation during fluorescence imaging. 2.2.5  Pooled and Individual Egg laying of Transgenic Mosquitoes  Injected embryos were raised to adulthood and kept as virgins. To find individuals that carry the IR8a3xP3 dsRed transgene, G0 adult mosquitoes were crossed to the opposite sex. G0 Males were mated individually with multiple WT females (>2), while G0 females were group mated with WT males. Crosses were done in small mosquito mesh cages (Bugdorm, 4M1515). Details of mating scheme were previously described (Sun et al., 2022). Pooled egg laying refers to a batch of blood fed females that are given wet filter paper to lay eggs, which allows screening for founding individuals within the pool of adults. Individual egg laying refers to blood fed females that were separated 14  into individual vials to ensure parentage of eggs. Individual egg laying allows identification of parental genotypes through fluorescence screening of larvae. 2.2.6  Statistical Analysis  R studio (Version 4.1.1) was used to analyze data in this chapter. Scatterplot was generated with the ggplot() function. All comparisons of hatch rate, transient rate and pooled G1 transgenic rates were made with \uab532 test. GraphPad Prism 10 was used to plot bar graphs for hatch rate and transient rate. One-way ANOVA was done in Prism.  2.2.7  Software Availability and Data Availability  DNA sequences were obtained from Vectorbase v. 66 (https:\/\/vectorbase.org\/vectorbase\/app\/), Ensembl Metazoa v. 58 (https:\/\/metazoa.ensembl.org\/index.html) and FlyBase FB2023_06 (https:\/\/flybase.org\/). Genome Assembly AaegL5.0 was the reference genome for all analysis in this thesis (Matthews et al., 2018). All genic components were manually annotated on Benchling Vol. 12 (http:\/\/benchling.com).   Data is available upon request, contact: Benjamin Matthews (ben.matthews@zoology.ubc.ca)  15  2.3 Results   Figure 1. Helper Plasmid Design Schematic Schematic representation of helper plasmid designs, as shown in Lo (2021). Zpg-Cas9 and nanos-Cas9 plasmids were co-injected into Ae. aegypti embryos with pBB-IR8a-sgRNA3xP3 dsRed  (Shankar et al., 2020). Donor template carried left and right homology arms with IR8a, where 3xP3 dsRed served as the marker for HDR repair. sgRNA was expressed by a U6 promoter, and a 3xP3 ECFP served as a transformation marker for unsuccessful HDR repair. T2A is the ribosomal skip sequence, while QF2 is a transcription factor that is a remnant of the previously generated donor template.   2.3.1  Design of Helper plasmids and generation of G0s To compare the efficacy of germline gene promoters to express Cas9, zpg-Cas9 and nanos-Cas9 were designed as helper plasmids. For zpg, the 5\u2019 and 3\u2019 untranslated regions (UTR) were captured by our design as regions with possible gene promoter activity. This design also included exon 1 to exon 3, but with a 78 amino acid deletion to render the gene non-functional. We hypothesised that promoter activity is likely to be found in the non-repetitive sequences in the genome, which was present in the 5\u2019UTR   Nanos 5 UTR Cas9 Nanos 3 UTRZpg 5 UTRCas9 Zpg 3 UTR  Zpg geneT2A2000bp 1974bp256bp 253bpHelperPlasmidDonor sgRNA3xP3 dsRedIR8a Left HR arm2159bpIR8a Right HR arm1964bp3xP3 ECFPT2ApBB-IR8a-sgRNA3xP3 dsRedQF216  and the introns included in this design. For nanos, 2000bp upstream and downstream of the gene was captured as the 5\u2019 and 3\u2019UTR respectively as they included non-repetitive sequences. The nanos 3\u2019UTR has been shown to form a mRNA structural element that is essential for their germline activity in flies and mice embryos (Crucs, Chatterjee & Gavis, 2000; Suzuki et al., 2010).  Both helper plasmid designs were assembled via Hifi assembly kit and sequence verified via Sanger sequencing (further discussed in Lo, 2021). These designs were compared to exuCas9 (Li et al., 2017), which was created using piggyBac transposon mediated insertion of this Cas9 cassette. They included only the 2132 bp sequence upstream (5\u2019) of exu and did not include any downstream (3\u2019) sequence. The IR8a-sgRNA3xP3 dsRed   was injected with the helped plasmids, which carries a donor template for IR8a and a sgRNA targeting this gene (Fig 1a). IR8a is involved in human odour detection and was chosen as the target of integration based on the work by Shakar et al. (2020). The use of IR8a-sgRNA3xP3 dsRed  was shown to be successful in generating 3xP3 dsRed integration into IR8a. We made use of a previously validated donor and sgRNA plasmid for our work. 3xP3 is a widely used promoter that restricts fluorescence in the eye (Kokoza et al., 2001) (Fig 2b). A 3xP3 eCFP marker carried by the plasmid backbone served as a transformation marker. Expression of both 3xP3 eCFP with dsRed suggests plasmid expression instead of HDR repair, while successful HDR repair of 3xP3 dsRed should exclude the eCFP sequence. No G1 offsprings were observed to have eCFP expression throughout the following experiments. Both helper plasmids were co-injected with IR8a-sgRNA3xP3 dsRed   in embryos. For exuCas9, embryos were collected from a single generation outcross to LVP strain and injected with IR8a-sgRNA3xP3 dsRed  only. 17             Figure 2. Hatch rate and transient tail expression rate of helper plasmids and exuCas9 G0s. (a) Hatch rate of injected G0s across all three strains. Hatch rate was measured by the number of surviving larvae over total number of eggs laid. Error bars represent standard deviation. (b) Transient tail expression rate of G0s over total hatched larvae. Transient rate was measured by the number of larvae with fluorescence in the tail out of the overall number of larvae. Error bars represent standard deviation. The letters A and B on the bar graph represent the Tukey post-hoc test, with difference in letters showing statistically significant difference in comparison. (c) Representative Ae. aegypti larvae showing dsRed fluorescence in the eye (arrow) and a tail transient pattern of dsRed. (d) Representative Ae. aegypti larvae in the exu-Cas9 strain showing body dsRed fluorescence pattern.    a b  c  d            A                  AB                  B  18  2.3.2  ExuCas9 strain and nanos-Cas9 helper promoted tail transience despite similar hatch rates of injected G0s  Injected G0s were hatched five days post injection and counted for larval hatch rates. In ExuCas9 strain, 160 larvae hatched from 683 eggs in six rounds of injection, which gave a hatch rate of 23.43%; For nanos helper, 129 larvae hatched from 492 eggs in four rounds of injections, which gave a hatch rate of 26.22%; For zpg helper, 119 larvae hatched from 443 eggs in four rounds of injections, which gave a hatch rate of 26.86%. A \uab532 test was done to test for association between hatch rate in all three strains, with a \uab532 value of 2.0598 (p = 0.357). The hatch rate was not associated to G0 strain used. An ANOVA was done to test for differences between the mean hatch rate of all three strains, which also found no statistically significant difference (F = 0.06970, p = 0.933). The hatch rate between the three strains was not statistically significantly different (Fig. 2a; Supp. Table 2).   Tail transient rate was counted in hatched G0 larvae, where the tail of larvae shows red fluorescence marker from expressing dsRed template (Fig. 2c; Supp. Table 2). In ExuCas9, 82 out of 160 larvae had positive fluorescence, which gave a transient rate of 51%; in nanos helper, 60 out of 129 larvae had positive fluorescence, which gave a transient rate of 47%; in zpg helper, 24 out of 119 larvae had positive fluorescence, which gave a transient rate of 20%. A \uab532 test was done to compare the average transient rates from all three strains, with a \uab532 value of 29.972 (p <0.001). This shows that transient rates were associated with the strains used for G0. An ANOVA was done to compare the mean transient rate of all three strains (F = 5.485, p < 0.05), which was statistically significant. The transient rate between strains is significantly different, with 19  exu and nanos giving more tail transient larvae than zpg. A Tukey post-hoc test was done for pairwise comparisons between the mean transient rate of each strain. Only the comparison between exu and zpg was statistically significantly different (p <0.05) (Fig. 2b).      Figure 3. Schematic representation of exuCas9 G0 cross that gave rise to transgenic G1s. ExuCas9 adults were outcrossed to LVP WT adults prior to egg laying. G0 embryos were injected with IR8a donor template and sgRNA plasmids. Larvae could either be body dsRed due to inheritance of exuCas9 transgene, or body non-dsRed with the possibility of maternal deposition of Cas9 protein from their parents. All injected larvae were screened for tail transient expression of the donor template. Larvae were either marker transient or non-transient. G0 adults were outcrossed to LVP WT to screen for transgenic G1s. Only marker transient parents were able to give rise to transgenic G1s, regardless of Cas9 transgene inheritance from their parents.  20  Table 1. Number of Transgenic G1s generated (3xP3 dsRed +) in zpg-Cas9, nos-Cas9 helper plasmid injections compared to exuCas9 strain in the first pooled egg laying cycle. Transient refers to positive expression for tail fluorescence in G0 parent, while Transgenic refers to positive expression of 3xP3 dsRed from integration of the donor template in G1 larvae. (n) refers to number of mosquitoes in each cross.       exuCas9 G1 G1 Transgenic G1 Non Transgenic Percent Transgenic (%)non-dsRed , Non Transient G0 female (5) x WT male (50) 0 228 0.00non-dsRed, Transient G0 female (9) x WT male (50) 3 351 0.85dsRed , Non Transient G0 female (16) x WT male (50) 0 409 0.00dsRed , Transient G0 female (22) x WT male (50) 7 1189 0.59non-dsRed, Non Transient G0 male (2)  x WT female (30) 0 704 0.00non-dsRed, Transient G0 male (4) x WT female (20) 47 145 24.48dsRed , Non Transient G0 male (26) x WT female (50) 0 1173 0.00dsRed , Transient G0 male (27) x WT female (50) 28 1376 1.99TOTAL 85 5575 1.50nanos-Cas9 helper G1 G1 Transgenic G1 Non Transgenic Percent Transgenic (%)Transient G0 male (25) x WT female (50) 1 450 0.22Transient G0 female (18) x WT male (50) 0 600 0.00TOTAL 1 1050 0.10zpg-Cas9 helper G1 G1 Transgenic G1 Non Transgenic Percent Transgenic (%)Transient G0 male (7) x WT female (50) 0 330 0.00Transient G0 female (10) x WT male (50) 0 720 0.00TOTAL 0 1050 0.0021  2.3.3  ExuCas9 male G0s with transient marker expression were most likely to give rise to transgenic progeny  All G0s from exuCas9, zpg and nanos helper were raised to adulthood and outcrossed to LVP WT mosquitoes of the opposite sex. These G0s were batch mated (pooled egg laying), and G1s were scored for inheritance of 3xP3 dsRed. The presence of 3xP3 dsRed eye marker expression indicates successful integration of the marker via HDR repair. Transgenic G1s would indicate the presence of founders in the parental pool, but not the individual identities of the founders.   Before injection of donor and sgRNA plasmid into the exuCas9 strain, adults were outcrossed to LVP WT mosquitoes to produce eggs. The expression of the dsRed marker in the body of the larvae indicates the inheritance of the exuCas9 transgene, while those that do not have body dsRed expression could have inherited Cas9 protein maternally. These injected G0s were further screened for a transient expression of the donor template in their tails (Fig. 2d; Fig. 3). This created four possible phenotypes of exuCas9 G0s, which were \u201cnon-dsRed, non transient\u201d, \u201cdsRed, transient\u201d, \u201cnon-dsRed, transient\u201d and \u201cdsRed, non-transient\u201d (Table 1).   G1s were counted as transgenic with the eye expression of the 3xP3 dsRed marker. In exuCas9, 85 out of 5674 G1s were transgenic, which gave a 0.015% HDR rate in the pooled egg laying. This indicates that there were founders in the G0s, but the actual HDR rate would be higher if founders were counted individually. Regardless of parental expression of body dsRed, transgenic G1s were found if their parents had transient expression of the marker. Specifically, male exuCas9 parents gave rise to 22  more transgenic G1s than females. Transient males gave rise to 75 transgenic G1s out of 1596 larvae (4.70%) while transient females gave rise to 10 transgenic G1s out of 647 larvae (1.55%). A \uab532 test was done to compare the G1 transgenic rates between male and female parents, which had a \uab532 value of 11.708 (p < 0.001). ExuCas9 male G0s were significantly more likely to give rise to transgenic G1s compared to females. It should be noted that the cross that generated the most transgenic G1s was from a \u201cnon-dsRed\u201d, transient male. The transgenic rate was 24.48% despite a lower number of G1s compared to exuCas9 crosses with other sgRNA \/ donor template (Table 1).  For nanos, 1 out of 1051 larvae (>0.001%) gave rise to transgenic G1 to a male parent G0. For zpg, no G1 larvae were observed to be transgenic (Table 1). As exuCas9 was the only strain successful in producing transgenic G1s with potential improvements in HDR rate, the following work was done only in this strain.  23   Cross Identity Eggs Hatched DsRed + Hatch rate (%) Positive rate (%) 3 98 11 5 11.22 45.5 6 92 17 6 18.48 35.3 8 21 3 2 14.29 66.7    Figure 4. Identification of the number of founders in the second egg laying cycle through positive fluorescence rate and hatch rate of 63 outcrosses. Crosses are labelled from 1 to 63. G1 3xP3 dsRed-positive rate were counted against hatch rate of each individual outcross. Table provided for 3 crosses with positive transgenic G1s. DsRed+ represents larvae with positive expression for 3xP3 dsRed.      24  2.3.4  At least three exuCas9 founders identified with successful HDR repair events  A second outcross was done by separating each individual G0 to identify the total number of founders. ExuCas9 G0 parents were crossed again with LVP WT mosquitoes of the opposite sex and allowed to lay eggs individually. Lineage of G1s were tracked to identify the number of founders with HDR repair of 3xP3 dsRed (Supp. Table 3; Supp. Table 4). Out of 63 crosses, three G0s gave rise to transgenic G1s. The overall HDR rate of G0s was counted as the number of founders divided by total number of crosses, which was 4.7%. All three G0s were \u201cnon-dsRed, transient\u201d G0 exuCas9 males that were crossed to LVP females. The G1 transgenic rates in these three crosses labelled 3, 6 and 8 were 45.5%, 35.3% and 66.7% respectively (Fig. 4). It should be noted that 19 of the G0 crosses did not have any eggs laid or did not have any larvae hatch from eggs (Supp. Table 3; Supp. Table 4). It is possible that some founders were unable to lay eggs again in the second outcross, so we conclude that the number of founders in G0 was more than or equal to three.   25  2.4 Discussion 2.4.1  Improvements in survival rate of injected G0s  The result of using helper plasmid and exuCas9 shows improvement to both the survival and HDR rates, compared to the work that this project is built upon (Kistler, Vosshall and Matthews, 2015). Previous recommendations for generating HDR transgenic mosquito relies on injection of Cas9 recombinant protein with sgRNA and donor DNA plasmid, which resulted in a hatch rate of 9.6% G0 embryos and 0.71% HDR rate. Both helper plasmid strains and exuCas9 tested here resulted in higher survival rates (23.43% - 26.86%), which could reduce the amount of embryo microinjections needed to generate a stable transgenic line. It is possible that an endogenous source of Cas9, including those expressed from injected plasmid, is relatively less toxic to the mosquito than Cas9 protein (toxicity of Cas9 is further discussed below in 2.4.8).  Of these three strains, the transgenic strain containing an exuCas9 cassette showed the most promise in improving HDR rates and generating transgenic offspring. 4.7% of G0s from exuCas9 successfully generated transgenic G1s through HDR. This number is likely an underestimate due to the low number of eggs laid by each female and poor hatch rates. All three identified founders had a less than 20% hatch rate of eggs but with high positive transgenic rates. Pooled egg laying was used to search for presence of any G0 founders, while a second round of individual outcross allowed specific founders to be identified. Founders identified during pooled egg laying of G0s were not found in individual egg laying, suggesting that some founders were not able to lay eggs during their second outcross. As 19 individual outcrosses did not give progeny, 26  we were not able to identify all G0 founders. Although the rate of founders cannot be directly compared to the HDR rate of 0.71% in Kistler, Vosshall and Matthews (2015), exuCas9 showed the highest rate of HDR across all three strains.  2.4.2  Discussion of nanos helper design  At the time of completing this project, Reid et al. (2022) tackled helper plasmid designs in Ae. aegypti for both nanos and zpg. Surprisingly, they found relatively high HDR transmission rates for their homing constructs. The following sections will compare the differences between our designs and possible explanations as to why our helper plasmids did not result in improvements to HDR.  Our nanos helper was designed to restrict expression of Cas9 to early embryonic development of the mosquito. It was previously shown that nanos function in female ovaries, where it localizes to the oocytes and posterior pole of early embryos across mosquito species (Adelman et al., 2007; Calvo et al., 2005). In An. gambiae, nanos driving Cas9 expression was able to promote HDR in up to 99% of G1s (Hammond et al., 2021).   In our work, nanos helper had a HDR rate of less than 0.1% (only one G1 was found to be transgenic out of 1051 total G1s). Our design of nanos helper was an indiscriminate 2kb region up and down stream of the genic regions, in hopes of capturing nanos promoter activity. Reid et al. (2022) designed a 1.1kb 5\u2019 promoter and 594bp 3\u2019UTR, which is smaller than our design. However, they reported a 16% HDR rate of their gene drive construct. The design of our nanos helper should have captured this proposed promoter regions, but failed to produce similar results. During embryo 27  microinjection of helper plasmids, Reid et al. co-injected recombinant Cas9 protein and sgRNA for editing activity. Therefore, HDR activity could have been driven not only by the helper plasmid, but the Cas9 protein in the injection mix. They further noted a strong gene drive transmission of the nanos construct in subsequent generations, which suggests that HDR repair was still active for their gene promoter design. As nanos should be active during germline cell development, one possibility is to test for Cas9 expression in embryos to ensure nanos promotes gene expression in the embryos. Our result could not rule out nanos as a possible candidate for improving HDR rates. 2.4.3   Discussion of zpg helper design Both helper plasmids were designed to capture the germline promoter regions of these genes and restrict expression of Cas9 to germline cell development. In Drosophila, zpg (also known as innexin 4) is a gap junction gene that has been shown to be function in early germ cell differentiation and localizes in the surface of germ cells (Tazuke et al., 2002). Hammond et al. (2021) tested this approach of zpg Cas9 expression in An. gambiae and found remarkable HDR rates (> 93.5% HDR in G1s). HDR repair in An. gambiae has been found to be much more efficient than Ae. aegypti (Hammond et al., 2016), so HDR rates are not directly comparable across mosquito systems.  In our work, zpg helper produced no transgenic G1s. The design of our zpg helper was relatively small, and only included around 250 base pairs of the 5\u2019 and 3\u2019 UTR. We also included part of a truncated zpg gene, including the first intron, that should render it non-functional. This design included non-repetitive sequences that could have regulatory activity, which was found only in the small UTR regions and the 28  first intron. It is possible that this design did not capture the promoter region of zpg, so Cas9 was not expressed appropriately in the germline cells. Reid et al. (2022) included 1.7kb upstream of zpg (5\u2019 promoter) and 1.3kb downstream (3\u2019 UTR) for their version of zpg helper. They found a 7.9% transmission rate of a homing construct that includes Cas9 and sgRNA in the G1s. Our zpg helper design could have failed to include enough of the sequences that leads to promoter activity of Cas9. Similar to nanos, the co-injection of recombinant Cas9 protein and sgRNA could have improved their reported HDR rate.  One limitation of our study is that NHEJ mutations were not accounted for, which can act as a proxy for Cas9 activity. The number of mutations at the target site can show the active cutting of Cas9 and creation of DSBs. Our result could not definitively rule out zpg as a possible candidate for germline promotion of Cas9.  2.4.4  Advantages of exuCas9 strain  The generation of exuCas9 strain by Li et al. (2017) allowed for an Ae. aegypti strain with stable integration of Cas9. In summary, the exuperentia gene was shown to have increased transcript expression when the female blood feeds, particularly in the ovary. Out of six promoter Cas9 cassettes generated through piggyBac random insertion, exuCas9 resulted in the highest survival and mutation rates. Therefore, it is likely that exu promoter activity can most effectively restrict Cas9 expression to germline cell development. Another possibility for testing zpg and nanos is to use similar methods as Li et al. (2017) and insert these Cas9 promoter cassettes into the genome. We further hypothesized that a source of CRISPR\/Cas9 components integrated into the 29  genome can increase HDR rates, which is further explored in the following chapter (Chapter 3).  2.4.5  Transient tail expressions of fluorescence marker in larvae can act as an indicator of HDR events All transgenic G1 offspring came from G0s with transgenic tail expression of the donor template, which has not been reported in other studies. While both exuCas9 and nanos showed similar transient rates, exuCas9 had a higher HDR rate of at least 4.7%. During embryo microinjection, a mix of sgRNA and donor template were injected into the posterior pole of the pre-blastoderm embryo. There are two possible explanations for this transient tail expression. One possibility is that donor template concentrations were sequestered at high enough levels in the posterior cells of the embryo, which later gave rise to the cells in the tail. In other words, dsRed fluorescence could be expressed through the leftover plasmid that persist into larval development. Another possibility was the stable integration of donor template due to HDR in the tail. G0 mosaicism can be observed in adults (Li et al., 2017; Hammond et al., 2021), where only parts of the cells in the organisms had successful edits. However, this explanation is unlikely the case for exuCas9 as the tail transient pattern was repeated across many G0s without other mosaic patterns. Therefore, transient tail expression is likely the result of a high concentration of donor template within the tail cells. This could indicate a particularly successful injection event in which a higher dose of injection mix was directed to the appropriate compartments within the developing embryo. With only three founding exuCas9 individuals captured, we cannot definitively conclude that transient expression of the donor template leads to HDR repair. However, 30  screening of larvae can prioritize these transient larvae which can be an improvement to current research protocols. To reduce the time and effort needed to sort through G0s in the creation of a transgenic line, we recommend future work to only select G0s with transient tail expression as possible founders. This could help alleviate the time needed to outcross all G0s regardless of phenotype. 2.4.6  Males gave rise to more transgenic offspring than females Our results showed that male exuCas9 G0s were significantly more likely to give rise to transgenic G1s compared to female parents. Specifically, \u201cnon-dsRed\u201d males had the highest G1 transgenic rate. This result was surprising as previous work done with exuCas9 did not report this degree of male bias, including the work that characterized this strain (Li et al., 2017; Li et al., 2020). In our work, exuCas9 was outcrossed to wildtype before egg laying for G0 injections. Maternally inherited Cas9 protein is highly effective in generating mutations with sgRNA presence in the exuCas9 strain (Li et al., 2020). As parental genotypes were not considered, we could not establish the inheritance of Cas9 proteins in male and female G0s. Thus, we cannot definitively conclude that this male bias for transgenic rate is due to maternal deposition of Cas9.  It is well established by previous work that maternal deposition of Cas9 is a major source of NHEJ mutations for gene drives (Champer et al., 2017; Kandul et al., 2019; Li et al., 2017; Lopez Del Amo et al., 2020). Cas9 protein deposited in germline cells can make DSBs with the presence of sgRNAs. Subsequent repair of DSBs in the early stages of embryo development favors NHEJ over HDR pathway, resulting in mutations instead of donor template repair (Kandul et al., 2019). Thus, gene drive components in males are not affected by Cas9 deposited in the female germline cells. However, 31  maternal Cas9 deposition does not fully explain the results observed in our work. As our focus is on the HDR events in the G0 germline cells, successful HDR editing would have happened in the G0s with their Cas9 activity. Transgenic G1s are the result of HDR editing in G0s before maternal deposition of Cas9 could be accounted for.  In the search for G0 founders, it is possible that the few male founders gave rise to more offspring. This could lead to an over representation of transgenic G1s in the data, despite being from a small number of founders. While male transgenic rates were normalized to the total number of offspring, this is only one measure of transgenic rates for individual founders. We cannot definitively conclude whether male exuCas9 have higher HDR rate and are more likely to give rise to transgenic G1s. As Cas9 expression is toxic to the organism, one possibility is that \u201cnon-dsRed\u201d males simply had higher fecundity and male founders gave rise to more transgenic G1s. Specifically, only 9 out of 38 G0 males failed to give offspring (24%) when compared to 10 out of 25 G0 females that failed to lay eggs (40%). This suggests that fecundity of G0 females could have been heavily impacted by Cas9 toxicity, resulting in less offspring and less possibilities of transgenic of G1s. Overall, males could have given rise to a higher proportion of offspring due to batch mating of G0 males with wildtype females.  2.4.7  Fitness and Cas9 toxicity The gene target Ir8a and sgRNA donor template design chosen for HDR repair was previously validated by our collaborators in Raji et al., (2019). The sgRNA targets exon 2 of Ir8a and inserts a 3xP3 dsRed into this target site. Disruption to this gene caused a lack of attraction to human odor, which is essential for host seeking behavior for females during blood feeding (Raji et al., 2019). As the target site for HDR editing 32  had biological relevance to blood feeding, G0 females with disruption to Ir8a could have lowered fitness. It is also established in previous work that Cas9 expression can be toxic. Cas9 expression and activity causes lethality in bacterial and algal systems (Cobb et al., 2015; Jiang et al., 2014; Wendt et al., 2016). In the exuCas9 strain, Li et al. also noted lowered fecundity in females (Li et al., 2020). This could explain the high number of G0 crosses in the second gonotrophic cycle that did not lay eggs. Cas9 toxicity could impact future work done in Ae. aegypti, as transgenic G0s could simply be unable to pass on transgenes to G1s. This is especially relevant in the work done in the following chapters, where Cas9 expression and editing seemed to cause lowered survival in progeny.  2.4.8  Future work and limitations As noted above, germline gene promoter designs can vary greatly depending on the regions of interest. Both zpg and nanos genes could have promoter activity that was not captured in our plasmid design, which led to lowered expression of Cas9. Possible ways to identify activity of Cas9 in the embryo include in situ hybridization for Cas9 mRNA in the G0 embryos and checking NHEJ mutations at the target site as a proxy for Cas9 activity. Due to the toxicity of Cas9 and lowered fecundity, we were unable to conclude the actual number of founders in the G0s. Another improvement for our work could be to target more than one gene, which could elucidate if the low activity of helper plasmids was target specific. Building upon these results, we hypothesized that endogenous expression of components in the CRISPR\/Cas9 system is beneficial for increased HDR rate. In the next chapter (Chapter 3), we created a transgenic strain 33  expressing sgRNA and donor template. This strain is then crossed to exuCas9 to allow HDR editing to happen.  2.4.9  Conclusions  In this chapter, we established that exuCas9 shows the most promise in generating transgenic Ae. aegypti when compared to Cas9 expression driven by two germline gene promoters. To improve current standards to generating transgenic strains, we seek to improve the survival rate and HDR rate of G0s. Embryo microinjection of zpg helper, nanos helper and exuCas9 all improved the survival rate of G0s compared to injection of recombinant Cas9 protein. Specifically, screening transient tail expression of the donor transgene can reduce time and effort required to outcross all surviving G0s. Due to possible flaws in the design of helper plasmids, Cas9 expression could have been restricted. Overall, we cannot conclusively reject our hypothesis that germline gene promoters can express Cas9 in developmentally optimal timing in Ae. aegypti, which in turn could lead to more HDR events. We noted the advantages of using exuCas9 due to the ease of generating transgenic G1s. This strain improved on HDR rates compared to other strategies. We also recommend using male exuCas9 as the prime candidate for passing on stable integration of donors and selecting G0 individuals with transient expression of the transformation marker in their tails for further outcrossing efforts.    34  3 Use of transposon mediated integration to create a split CRISPR\/Cas9 system   3.1 Introduction to transposon transgene 3.1.1  Transposon mediated transfer of genetic material  Aside from CRISPR\/Cas9, genetic sequences can also be randomly inserted into the Ae. aegypti genome using transposons. The piggyBac transposon genetic element was first identified in cabbage looper moth Trichoplusia ni, and subsequently used to transform D. melanogaster (Handler and Harrell, 1999). It was then shown to be effective in Ae. aegypti germline transformations, creating transgenic mosquitoes via embryo microinjections (Kokoza et al., 2001; Lobo et al., 2002). The piggyBac transposase recognizes genomic TTAA sequences as insertion sites. It then recognizes inverted terminal repeats (ITR) from an exogenous plasmid and inserts a copy of the genetic sequences between ITRs into the host genome. Transformation of Ae. aegypti can be done successfully by allowing piggyBac to randomly insert transgenes into the genome (Lobo et al., 2002; Kokoza and Raikhel, 2011). A key difference between transposon mediated gene editing and CRISPR\/Cas9 is the target specificity. While CRISPR\/Cas9 inserts via HDR only at the target gene, transposons insert transgenes in random locations and can also result in multiple insertions.   35  3.1.2  Background of HACK system and split gene drives  Aside from integrating Cas9 into the genome, other components of the CRISPR\/Cas9 systems can also be stably integrated to provide an endogenous source of sgRNA and donor templates. The sgRNA is often expressed by U6 promoter (U6 is a RNA polymerase III promoter) which was first used to express RNA in Drosophila cells ubiquitously at high levels (Wakiyama, Matsumoto and Yokoyama, 2005). The U6 promoter regions have been utilized to express sgRNA for creating transgenic D. melanogaster strains, from germline Cas9 systems (Kondo and Ueda, 2013) to tissue specific Gal4 lines (Koreman et al., 2021). Various versions of U6 promoter have been adopted in An. gambiae (Hammond et al., 2016) and Ae. aegypti (Li et al., 2020), becoming a staple in the insect genetic toolbox as a means of expressing sgRNAs at high levels.  Our approach to creating a split CRISPR\/Cas9 transgenic system was first used in D. melanogaster in the Homology Assisted CRISPR Knock-in (HACK) system by Lin and Potter (2016). In summary, HACK used random insertion of a donor template and sgRNA to create a donor stock. This line is crossed to a line expressing Cas9, which allows for all components of CRISPR\/Cas9 system to meet in the offspring generation. HDR repair can then convert the target gene without the need for further efforts in embryo microinjection. Thus, HDR repair was shown to be able to knock-in gene of interest in as few as two genetic crosses (Lin and Potter, 2016).    This system of split CRISPR\/Cas9 was then further developed into split gene drive (sGD) systems, which can pass on a sgRNA cassette as a donor template. By 36  crossing this line to a Cas9 line, a sgRNA cassette is able to be passed on by HDR repair and propagate through a population. sGD has been shown to be effective in D. melanogaster (Lopez Del Amo et al., 2020; Terradas et al., 2021) and Ae. aegypti (Anderson et al., 2024; Kandul et al., 2020; Li et al., 2020). This system is less likely to spread in a population than a full gene drive, as both lines need to be active for gene drive components to propagate. Escape of only one sGD line should, in theory, be able to limit the possible ecological impact of gene drive research (Champer et al., 2019; Lopez Del Amo et al., 2020).  By combining previous research on germline expression of Cas9 and transposon mediated transgenesis, a split system has the potential of generating HDR repairs in higher efficiency compared to current systems. Donor template designs can vary greatly depending on the needs of the researcher, while sgRNAs can be multiplexed in the genome to allow simultaneously editing in multiple target genes.  3.1.3  Project approach and significance  Building upon our results from Chapter 2 Helper Plasmid, we adapted the HACK system and sGD approach for Ae. aegyti in a transgenic context. Instead of the spread of sGD elements, we tested if this strategy can improve HDR editing. The Transposon Transgene strategy makes use of piggyBac transposon to randomly insert a Transposon Transgene Cassette (TC) that carries sgRNA and donor template with a fluorescent transformation marker. A TC-carrying transgenic line is first established and outcrossed for three generations. This line is then crossed with exuCas9 strain, which we previously showed had great promise for high HDR repair efficiency. We hypothesized that if an endogenous, genomic source of sgRNA and donor template are 37  present in developmentally optimal timing, more HDR will occur in Ae. aegypti larvae. While Cas9 will be expressed in the germline with the exu promoter, sgRNA and donor template are ubiquitously present in the cell. We utilized the U6 promoter to drive a strong expression of sgRNA, while insertion of donor template ensured its presence early in the development of the germline cells (albeit at single copy insertion instead of high concentration of DNA templates in embryo microinjections). With the co-expression of exuCas9, this created a possible window in development that could favor HDR over NHEJ. In comparison, injection of Cas9 protein or Cas9 expression plasmids would result in these components meeting later in the germline cells, which could favor NHEJ instead. The cross between exuCas9 and TC carrier allows the split components to meet in the organism, and repair target gene with HDR. This strategy can reduce the time and effort spent in creating transgenic lines by taking advantage of transposon mediated transgenesis, compared to the high number of embryos needed for CRISPR\/Cas9 mediated gene integration. Results from this work can help elucidate if the source of CRISPR\/Cas9 components can help bias HDR in Ae. aegypti.    38  3.2 Methods  3.2.1  Design of Transposon Transgene Cassette  The Transposon Transgene Cassette (TC) contained (1) an integration marker, (2) sgRNA sequence and (3) a HDR donor template, in between two piggyBac inverted terminal repeats (ITR). The overall design of TC included pBAC-ECFP-U6sgRNA- ppk3013xP3 dsRed. Sequences between ITR were randomly inserted into the genome in the presence of the piggyBac transposase.  3.2.2  Hifi Assembly and Cloning pBAC-ECFP-15xQUAS_TATA-SV40 (Addgene #104875) was used as a backbone to create TC, which includes a 3xP3 eCFP as the integration marker. This plasmid contained a 15x QUAS sequence, which was cut out using Mlul and BsmFI double restriction enzyme digestion in 37\u00b0C for 1 hour. The backbone was re-ligated using HiFi Assembly kit, following recommendations from the NEBuilder Assebmly Tool.    Other components of TC, including (2) sgRNA targeting exon 2 of ppk301 and (3) 3xP3 dsRed donor template, were previously designed (Kistler et al., 2015). (2) U6 promoter driving ppk301 sgRNA was synthesized using ThermoFisher GeneArt custom DNA synthesis service. (3) ppk3013xP3 dsRed donor (4.6kb) was PCR amplified from ppk301-T2A-QF2 HDR plasmid (Matthews et al., 2019). All three TC components were assembled according to NEBuilder Assembly Tool, which provided primer designs for appropriate ligation of fragments.   39  All products of the HiFi Assembly reaction were transformed in bacterial colonies and subsequently verified using Colony PCR. DNA extraction was done via Miniprep for verification or Midiprep for embryo microinjection. Details of each method were done according to commercial protocol, as listed previously in Lo, I. 2020.   3.2.3  Generation of PiggyBac Transposase mRNA  PiggyBac Transposase mRNA were generated and subsequently injected into Ae. aegypti embryos along with the TC. mRNA was made according to previously established protocol (Matthews, B. 2019) (https:\/\/www.protocols.io\/view\/transposase-injection-mix-protocol-e6nvw6772gmk\/v1). 3.2.4  Gel Electrophoresis  All DNA samples were run in 1 \u2013 2% agarose gel to ensure appropriate band size. HiFi Assembly samples were subsequently cleaned up using PCR Clean-up kit (New England Bio, T1030L).  3.2.5  Mosquito Rearing and Maintenance Aedes aegypti mosquitoes were maintained according to standard protocol as described (Sun et al., 2022 ; Wohl & McMeniman, 2023). Mosquito eggs were hatched in a vacuum chamber (20 \u2013 25 Psi) and kept in containers of dechlorinated water until pupation. All adult mosquito strains were kept at 25 \u2013 28 \u00b0C in mesh cages (Bugdorm, 4M3030), with constant relative humidity of 70-80% and 12 : 12 light : dark photoperiod. 10% sucrose solution was provided in the mesh cages of mixed sex for strain maintenance. All females were blood fed on defibrillated sheep blood (Cedarlane Labs, DSB250) via a glass mosquito feeder (Chemglass, Cat# CG1836) with a layer of 40  parafilm spread across the feeder. Blood inside the feeder was warmed to 37.5\u00b0C. Blood fed mosquito cages were given 30% sucrose solution to minimize egg laying on 10% sucrose solution sugar wicks.  I utilised Exu-Cas9 strain, which had a stable integration of Exuprentia promoter region expressing Cas9 sequence and a DsRed fluorescence body marker (Li et al., 2017). This strain was kindly provided and reared by Dr. Connor McMeniman and colleagues (Johns Hopkins Malaria Research Institute). 3.2.6  Embryo Microinjection   TC and piggyBac Transposase mRNA were co-injected into Ae.aegypti embryos. Injection was done according to Sun et al. (2022). All injections were done in the embryo injection station in Matthews Lab, UBC. 200 embryos were injected with 58 G0s surviving to adulthood.  3.2.7  Fluorescence Screening and Crossing scheme  G0 larvae were screened for expression of both 3xP3 eye marker for eCFP and dsRed. Positive G0s were kept and outcrossed to LVP strain mosquitoes of the opposite sex for three generations. All pupae were allowed to emerge individually in plastic cups covered in mesh to ensure females and males were not mated before outcrossing. G3s were crossed to ExuCas9 individually and established as individual strains. ExuCas9 larvae were sorted for bright dsRed expression in the body to ensure high levels of Cas9 expression.   G4 larvae and subsequent offspring were screened for expression of (i) Wildtype without fluorescence expression, (ii) eye fluorescence of dsRed only, (iii) eye 41  fluorescence of dsRed and eCFP, (iv) body fluorescence of dsRed only, (v) all fluorescence of eye and body markers and (vi) other expression patterns that did not fit these categories. Offspring with (v) all fluorescence expression were kept and outcrossed with LVP strain again. Outcrossing was done for three more generations.  3.2.8  Genomic DNA extraction   Genomic DNA of transgenic mosquitoes was individually extracted from G4 adult tissue. Adults were collected after death and frozen in -74\u00b0C.Up to three females and three males were extracted for each individual strain. gDNA extraction was done using commercial gDNA kit and following their protocol (New England Bio, T3010L). 3.2.9  PCR and Sequencing  PCR amplification was done on ppk301 to test for successful insertion of donor template ppk3013xP3 dsRed from TC. Size of PCR amplicons were verified using gel electrophoresis. Insertion of ppk3013xP3 dsRed would result in 5kb sequence, as oppose to 2.6kb in the unedited sequence. Primers for PCR amplification of the overhang region between ppk301 and ppk3013xP3 dsRed insert was designed to result in 1.37 kb and 1.8kb sequences. Insertion was considered successful if all three PCR amplicons were amplified and sequenced.   Sequencing primers were designed to target the ppk301 gene, including upstream and downstream of the donor homology arms. Primers also targeted the 200 base pair area around the Cas9 cut site. Sequencing was done through the GENEWIZ Sanger Sequencing (https:\/\/www.genewiz.com\/Public\/Services\/Sanger-Sequencing\/) or 42  the UBC Sequencing + Bioinformatics Consortium (https:\/\/sequencing.ubc.ca\/our-services-equipment\/sanger-sequencing).   3.2.10  Splinkerette PCR  Splinkerette PCR was done to map the location of piggyBac mediated insertion of TC into the genome. Genomic DNA of G6 larvae was digested using BamHI, BgIII or BstYI restriction enzymes. DNA fragments are ligated to the splinkerette oligo, and then PCR amplified for two rounds. Primers are designed to amplify the 5\u2019 or 3\u2019 region of the piggyBac insertion site. All PCR amplification was done using Q5 DNA Polymerase (New England Bio, Cat #M0491L) and purified with PCR clean-up. Amplicons were sent for sequencing and BLAST for matching nucleotide sequence in the Ae.aegypti genome. Detailed protocol was previously established by Potter and Luo (2010).  3.2.11  PCR Identification of NHEJ activity   Primers were designed 100 base pairs upstream and downstream of the proposed ppk301 cut site with G4 genomic DNA. Mutations to the sequence act as a proxy to Non-Homologous End Joining activity. Sequences were PCR amplified, cleaned up and sent for Sanger sequencing. Synthego ICE analysis was used to compare edited sequences from wildtype sequence from LVP strain (https:\/\/ice.synthego.com\/). Genetic sequences were compared at the proposed Cas9 cut site to check for percentages of reads containing insertion or deletion mutations, which acts as a proxy for NHEJ and Cas9 activity.   43  3.2.12  Data Analysis  R studio (Version 4.1.1) was used to analyze data in this chapter. Scatterpie plots and pie charts were generated with the ggplot() function. Scatterpie package was created by Yu, G. (2023). Schematics were created using Adobe Illustrator (2022).  3.2.13  Software Availability and Data Availability  DNA sequences were obtained from Vectorbase v. 66 (https:\/\/vectorbase.org\/vectorbase\/app\/), Ensembl Metazoa v. 58 (https:\/\/metazoa.ensembl.org\/index.html) and FlyBase FB2023_06 (https:\/\/flybase.org\/). Genome Assembly AaegL5.0 was the reference genome for all analysis in this thesis (Matthews et al., 2018). All genic components were manually annotated on Benchling Vol. 12 (http:\/\/benchling.com).   Data is available upon request, contact: Benjamin Matthews (ben.matthews@zoology.ubc.ca)       44  3.3 Results      Figure 1. Transposon Cassette (TC) design (a) Schematic representation of Transposon Cassette (TC) design that was injected to G0 embryos. pBac ITR stands for piggyBac inverted terminal repeats. TC contains 3xP3 eCFP which is the integration marker for successful piggyBac mediated integration. sgRNA targeting ppk301 is expressed by a U6 promoter. Donor template includes 1Kb of homology arms flanking 3xP3 dsRed, which is the marker for successful HDR integration. T2A is the ribosomal skip sequence. Successful HDR repair will integrate 3xP3 dsRed but not 3xP3 eCFP in the genome.  (b) Representation of Ae. aegypti larvae with dsRed expression of both body (exuCas9) and eye (3xP3 dsRed; arrow). (c) Repsentation of Ae. aegypti larvae with 3xP3 dsRed (top right) and 3xP3 eCFP (top left and bottom) expression.    AAEL000582 ppk301pBac ITR 3xP3 eCFP U6 sgRNA L HR arm 3xP3 dsRed R HR arm pBac ITR3xP3 dsRedHDR984bp 202bp 1001bpT2A953bp 1001bpa b  c 45  3.3.1  Design of Transposon Cassette (TC) and fluorescence expression in larvae   To generate transgenic line that carries sgRNA and donor template, we designed a Transposon Cassette (TC) in between piggyBac inverted terminal repeats (ITR). PiggyBac transposase mRNA is co-injected into LVP embryos to generate random insertions of TC into the genome. Expression of the integration marker, 3xP3 eCFP is inherited by Mendelian inheritance and signifies successful integration of TC into the genome. A sgRNA targeting ppk301 expressed by a U6 promoter is adapted from Kistler, Vosshall and Matthews (2015), which has been used multiple times to generate ppk301 mutants (Matthews, Younger and Vosshall, 2019). Finally, the donor template carries two1Kb homology arms for the ppk301 cut site, as well as the 3xP3 dsRed marker (Fig. 1a). The 3xP3 promoter restrict fluorescence expression in the eyes (Kokoza et al., 2001), which served as the indicator for successful integration or successful HDR repair. While both markers are expressed in a TC carrier, HDR events would lead to the inheritance of only the red but not blue eye marker (Fig. 1c). The separation of fluorescence marker expression allows HDR events to be identified through larval screening before the use of PCR and sequencing to validate successful HDR integration.  46     Figure 2. Overview of Ae. aegypti crosses to generate HDR events in after G4s. G0 LVP mosquitoes were injected with piggyBac transposase mRNA, which mediates the integration of TC into the genome. Founders were identified and outcrossed for 3 generations to WT LVP mosquitoes. In the G3s, adults carrying TC were crossed to exuCas9 adults. G4 larvae were outcrossed again to LVP mosquitoes to separate TC carriers from transgenic larvae due to HDR repair. Larvae in the next 3 generations (G5 \u2013 G7) were sorted for their fluorescence expression. Successful HDR events could lead to Super-Mendelian like inheritance pattern of the red eye marker, as more larvae would express red eye marker only due to HDR repair. Lack of HDR events will lead to expected, Mendelian inheritance of markers, with larval inheritance and expression of both blue and red eye markers.    47  3.3.2  Generation of TC carriers   Of the 200 LVP embryos injected with TC plasmid and piggyBac transposase mRNA, 58 survived to adulthood (29% survival rate). 29 of these G0 survivors gave offspring when outcrossed to LVP adults. A single transgenic strain was collected from the hatch of two possible founders (< 3.4% transgenic out of G0 survivors), which resulted in 9 out of 27 larvae with expression of both blue and red eye marker (33% G1 transgenic rate). A second strain resulted in 1 out of 59 with red eye marker expression only but failed to give further offspring when outcrossed. The following work was done with the single TC founding strain (Fig. 2).  3.2.3  Crossing scheme for TC and Cas9 in the G3 cross  After three outcrosses of the TC carrier strain, G3s were crossed to the exuCas9 adults. G4s should inherit all components of the split CRISPR\/Cas9 system, including Cas9, sgRNA and donor template targeting ppk301. G4s were screened for expression of all markers including the red body fluorescence from exuCas9 (Fig. 1b). Offspring with positive expression of all markers were outcrossed again to separate inheritance of TC with HDR events that integrate the red eye marker only. We propagated each of these strains individually and outcrossed only those with eye marker expression only or expression of all markers. Larvae were continued to be screened for three more generations while outcrossed to LVP strain (Fig. 3).    48     Figure 3. Scatterpie graph showing number of larvae in 9 G4 strains and the proportion of fluorescence expression patterns in larvae 9 G4 strains were recovered after crossing TC carriers (G3) to exuCas9 adults. \u201cType\u201d refers to the fluorescence expression of larvae: \u201call\u201d stands for red body, red eye and blue eye fluorescence; \u201cbody\u201d stands for red body fluorescence from exuCas9 only; \u201ceye\u201d stands for red and blue eye fluorescence from TC integration only; \u201cwt\u201d stands for wildtype without any fluorescence.        49  3.3.3  7 G4 strains were recovered from G3 x exuCas9  All components of the split system (TC and exuCas9) met in the G4 generation. Nine G4 strains were established in the G3 cross to exuCas9, which should generate DSBs and allow HDR or NHEJ to happen. G3 strains with less than 30 G4 larvae hatched were discarded from further parental analysis, as the genotypes of these strains are unlikely to be a true representation of gene inheritance from their G3 parental crosses. Two strains were discarded from analysis due to the low number of larvae hatched, with two and fourteen larvae respectively. We were unable to predict the genotype of their parental crosses. Out of nine G3 crosses, seven of these G4 strains had more than 30 larvae. We did not observe a super Mendelian inheritance like pattern of red eye markers in any of the G4s. Red eye markers were not more represented in the G4 larvae, which would be indicative of HDR events. In terms of inheritance patterns, two strains were inferred to be the offspring of heterozygous parents (\ud835\udc38\ud835\udc65\ud835\udc62\ud835\udc36\ud835\udc4e\ud835\udc609+ \ud835\udc65 +\ud835\udc36\ud835\udc4e\ud835\udc60\ud835\udc52\ud835\udc61\ud835\udc61\ud835\udc52 (3\ud835\udc65\ud835\udc433)), due to a 25% inheritance of all possible marker phenotypes; Two strains were inferred to be from homozygous parents (\ud835\udc38\ud835\udc65\ud835\udc62\ud835\udc36\ud835\udc4e\ud835\udc609\ud835\udc38\ud835\udc65\ud835\udc62\ud835\udc36\ud835\udc4e\ud835\udc609 \ud835\udc65+\ud835\udc36\ud835\udc4e\ud835\udc60\ud835\udc52\ud835\udc61\ud835\udc61\ud835\udc52 (3\ud835\udc65\ud835\udc433)), due to 50% inheritance of red body fluorescence only or all fluorescence markers; The remaining three strains did not follow these inheritance patterns and showed more than 50% of red body fluorescence inheritance. This signified that HDR events might not have occurred within the germline cells of the G4s. We further outcrossed G4s to clarify if HDR events and stable integration of red eye marker was masked by the expression of the TC cassette (Fig. 3; Supp. Table 5).    50     Figure 4. Scatterpie graph showing number of larvae in 53 G5 strains and the proportion of fluorescence expression patterns in larvae 53 G5 strains were recovered after outcross to LVP WT mosquitoes. \u201cType\u201d refers to the fluorescence expression of larvae: \u201call\u201d stands for red body, red eye and blue eye fluorescence; \u201cbody\u201d stands for red body fluorescence from exuCas9 only; \u201ceye\u201d stands for red and blue eye fluorescence from TC integration only; \u201cwt\u201d stands for wildtype without any fluorescence.       51  3.3.4  53 G5 strains were screened for HDR but none were successfully identified  G4s were separated where only those individuals carrying eye markers were further outcrossed to generate individual strains. HDR events would generate a red eye marker phenotype (which could be masked by TC expression). By outcrossing to LVP, we sought to separate these phenotypes by screening for offspring that showed inheritance of only red eye but not the other marker. 53 G5 strains were established in this cross, while those with less than 30 larvae hatched were discarded from further analysis. 29 strains remained but did not result in any larvae with red eye marker only, indicating that HDR did not happen. Five of the G5 strains had no larvae hatched, which accounted for 9.4% of the total number of G5 strains. On average, 60% of larvae inherited both eye markers which could signify super Mendelian inheritance. We further outcrossed this strain to look for repeatable result and patterns of inheritance (Fig 4; Supp. Table 6).   52      Figure 5. Pie chart showing distribution of larval expression where two larvae with red eyes only were identified in G6s. Naming of strains are as follows: \u201cR6M4\u201d for initial G4 strain founder of this strain, \u201call+ female\u201d for female parent that had all fluorescence positive (\u201call\u201d phenotype). Hatch rate and number of each phenotype are shown in the table. \u201cType\u201d refers to the fluorescence expression of larvae: \u201call\u201d stands for red body, red eye and blue eye fluorescence; \u201cbody\u201d stands for red body fluorescence from exuCas9 only; \u201ceye\u201d stands for red and blue eye fluorescence from TC integration only; \u201cred eye only\u201d stands for red eye fluorescence from possible HDR event only; \u201cwt\u201d stands for wildtype without any fluorescence.   3.3.5  Two G6s showed possible HDR events but not in G7s Through continued outcrossing of G5s, we found two possible larvae in G6 with red eye marker only out of 25 strains (Supp Fig. 1; Fig. 5; Supp. Table 7). Five of the G6 strains did not have any larvae hatched, which accounted for 17.9% of the total number of G6 strains. \u201cG6 R6M2 all+ female\u201d strain had a low hatch rate and low number for each phenotype. Further outcross with the red eye only individual resulted in two larvae in the G7s, with neither of them passing on red eyes only. Across all generations after G4s, we observed delays in larval hatching of up to one month.   red eye only eye all wt body hatch rate G6 R6M4  all+ female 1 27 12 35 12 0.44G6 R6M2 all+ female 1 1 4 4 5 0.1353     Figure 6. Schematic of Splinkerette PCR and check for NHEJ activity at the ppk301 cut site, using G4 genomic DNA. (a) Splinkerette PCR design and result from the (5\u2019) splinkerette. Orange sequence refers to sequence found in G4 larvae showing 5\u2019 inverted repeat of the piggyBac transposon. Grey sequence refers to genomic DNA sequence upstream of the proposed TC integration site, that showed alignment to Ae.aegypti genome (AaegL_5). (b) Schematic for the PCR done to check for donor template integration at the ppk301 cut site. Single headed arrows represent primer designs used for PCR and NHEJ check. PCR for successful integration results in 3Kb band while no integration shows 2Kb band. (c) NHEJ was checked via small PCR amplification at the proposed target site. PAM sequence is shown (GGC) on the reverse strand of ppk301, while primer pair (cutcheck Fwd and Rev) were used to amplify the cut site.      catgcgtcaattttacgcagactatctttctagggpiggyBac Left (5 ) inverted repeatAAGGACTGTTCATTTTATAAAGTGGACACTTTGTTTATGCTATATCTTTTTTATTTATTGATAAAATCGGAATCGGTTTTCTGTGCATCGTTCAACTATAATTCTACAATGCTATGAAA   ATATAAGATC> 100 BLAST matchesTransposon Casette (TC)Splinkerette PCR5 3  3xP3 dsRedPCR and Check for NHEJ activity ppk301 ppk301ppk301 cut siteGGCcutcheck Fwdcutcheck RevL arm FwdL arm RevR arm FwdR arm RevSuccessful donor insertion = 3KbWithout donor insertion = 2KbL arm Fwd + R arm Reva b  54  3.3.6  Mapping location of TC insertion  Since TC was integrated via piggyBac transposon, the location of integration can be mapped by using techniques such as inverse PCR (iPCR) or Splinkerette PCR (Potter and Luo, 2010). A total of 48 G4 larvae had genomic DNA extracted, which represented all 7 G4 strains established for analysis. After two rounds of nested PCRs, only the 5\u2019 inverted repeat resulted in successful sanger sequencing results. A BLAST search for this sequence in the Ae. aegypti genome returned more than 100 matches, suggesting that at least the 5\u2019 end of the TC landed in a highly repetitive sequence within the genome. The 3\u2019 inverted repeat did not result in informative sanger sequencing results, due to failure for PCR amplification in the second round of Splinkerette PCR. Thus, the site of TC insertion cannot be precisely located, nor can we confirm if there was more than one insertion of TC in the G4s (Fig. 5a).    55  3.3.7  Check for NHEJ showed no Cas9 activity in G4s  To further test for HDR activity in the G4s, we used PCR to check for successful integration of donor template in the ppk301 gene using genomic DNA from G4s. Two sets of primers targeted part of ppk301 and part of the donor template, which should only amplify where there is successful insertion. Both PCRs generated no amplicons, as confirmed by negative results in gel electrophoresis. Another round of PCR of the entire ppk301 insertion region was around 2Kb instead of 3Kb, which confirmed that 3xP3 dsRed was not inserted in this target site. This shows that HDR events did not occur in the G4s (Fig. 5b). Without HDR activity, we further tested if Cas9 was active in the G4s by measuring NHEJ activity. As DSBs are repaired by either repair pathway, NHEJ should act as a proxy for Cas9 activity at ppk301 (Kistler, Vosshall and Matthews, 2015). Upon sequencing and comparison of sequences using ICE, we observed no insertion or deletion mutations at the proposed cut site (Fig. 5c). This indicates that Cas9 might not be actively cutting at ppk301. It is unlikely that all sequences were perfectly repaired by NHEJ, based on previous observations in Chapter 2.  56  3.4 Discussion  3.4.1  Design of TC and use of the ExuCas9 strain The design of TC and the use of piggyBac transposon mediated integration was built on the HACK system strategy by Lin and Potter (2016). The TC cassette carries two fluorescence markers, each indicating a different version of gene integration. The use of exuCas9 adds an extra layer of visual marker to be screened for. Our results for checking NHEJ activity suggests that Cas9 did not actively make DSBs, at least in the G4 cross. This is surprising as exuCas9 has been shown to be highly active in generating mutations (Li et al., 2017; Li et al., 2022). Specifically, exuCas9 strain injected with a version of the U6 sgRNA promoter showed high rates of mutations (>90%) and super-Mendelian inheritance (>70%). As shown in the previous chapter, exuCas9 was reliable in creating DSBs with the sgRNA targeting a different gene. Therefore, it is likely that sgRNA expression in this context was the reason for the lack of Cas9 activity. In future work, injection of sgRNAs in embryos can validate if Cas9 is active before attempting the G4 crosses. The location of TC insertion could also affect the expression of the sgRNA, which could lead to the absence of Cas9 activity.  3.4.2  Genome of Ae. aegypti and the location of TC The genome of Ae. aegypti could be another hurdle in the successful use of the TC strategy. The Ae. aegypti genome is approximately 1.22Gb (Matthews et al., 2018), and is about 5-fold larger than An. gambiae (Nene et al., 2017; Daron et al., 2024). When compared to other mosquitoes and D. melanogaster, Ae. aegypti genome is highly repetitive and compose of almost 40% Transposable elements (Arensburger et 57  al., 2011; De Melo and Wallau, 2020). This highly repetitive nature of the genome could be a possible reason for the failure to pinpoint the TC insertion through Splinkerette PCR. BLAST search revealed that the sequences upstream of the TC location is highly repetitive, with more than 100 matches to the Ae. aegypti genome.  3.4.3  HDR is affected by the proximity of the donor template   The exact location of TC has been shown to be important for successful HDR repair. Previous work in the HACK system showed that gene conversion is highly dependent on the position and proximity of the donor template in relation to the target (Lin and Potter, 2016). They mapped donor templates across the genome by using transposon mediated integration to map conversion efficiency. In summary, donor template insertion close to the target shows a 50-fold increase in conversion rates, but cold spots on the genome could reduce gene conversion activity. Thus, gene conversion by HDR depends on the distance of the donor from the target sequence (Chen et al., 2007). One limitation to our work was the lack of diversity in TC insertion outcomes. During the creation of G0 founders, only one line was successful in carrying TC (3.4% G0 transgenic rate). We cannot conclusively determine if the lack of Cas9 activity is due to the design of TC, or that the location of TC was not ideal for HDR repair. A possible improvement to our strategy would be to use hyperactive piggyBac, which can mediate integration in higher efficiency (Otte et al., 2018). The creation of multiple founder lines could benefit the conclusions we can draw from our work and has been shown to be successful in Anderson et al. (2024). The generation of TC strains was the major limiting step to our results.  58  The lack of HDR repair in out results could be further explained by the lack of localization of donor templates at the DSBs. In our work, we inserted TC to a random location of the genome and relied on homologous pairing between the donor template and DSB target. We predicted that donor template and sgRNAs should be present in the cell ubiquitously, and the expression of Cas9 would later induce DSB repair. However, it has been shown that DSB repair is highly dependent on the proximity of the donor template. When DSBs are repaired faithfully, homologous chromosomes can make contact at the site of DSBs which favors HDR repair (Lee et al., 2016; Lieber, M. R., 2010; Gandhi et al., 2012). If donor template was not localized at the site of DSB, it could decrease the efficiency of gene insertion through HDR. Although it is possible to link the donor template to the Cas9 protein (Savic et al., 2018) or use DNA in chromatin form as the donor template (Cruz-Becerra and Kadonaga, 2020), these strategies have not been attempted in systems other than mammalian cell lines. Future work in split systems like this could benefit from confirming location and proximity of donor templates before crossing to the Cas9 strain.  3.4.4  Maternal deposition of Cas9 in G4 offspring As noted in the previous chapter (Chapter 2 \u2013 Discussion 2.4.6), maternal deposition of Cas9 favors NHEJ and is a source of resistance to gene drives. Even in a split gene drive system, maternal inheritance of Cas9 induces mutations to the target site with sgRNA deposition. All embryos from the Cas9 strain would likely inherit Cas9 protein from their mother, which makes it more likely for NHEJ mutagenesis to disrupt HDR insertion (Champer et al., 2019; Kandul et al., 2020). The offspring after G4s likely have Cas9 protein deposited in their germline cells, which makes it possible but 59  unfavorable for further HDR repair in subsequent generations. One strategy that might be able to bypass maternal deposition is \u201cmultiplexing\u201d, which is the use of multiple sgRNAs targeting the same gene to achieve HDR repair in one of these sites. Multiple sgRNAs can target adjacent target sites so that NHEJ mutations generated at one target does not disrupt the overall possibility of HDR repair for that gene. This could possibly increase HDR efficiency at one target site, as shown by the recent sGD work in Anderson et al. (2024). One key advantage of the split system is the separation of sgRNA and donor from the Cas9 strain. Future work can separate Cas9 strains based on sex before crossing to TC, which should restrict deposition of Cas9 to only mothers and not fathers.  At the time of completing this work, a similar strategy of sGD homing system was attempted in Ae. aegypti with greater gene conversion rate by Anderson et al. (2024). They also utilized piggyBac insertions to generate five Cas9 strains. Combined with a previously characterized sgRNA\/donor template carrying strain, this created a split system similar to our work. Their sGD utilized a new Cas9 driver from the Drosophila bgcn gene which is predicted to express in the germline and showed high HDR efficiency (>75%). In comparison, we relied on the exuCas9 strain as the only source of Cas9. The difference of the Cas9 gene promoters could have resulted in differences between HDR repair rates.  Another key difference is their use of a homing donor template at the target site. This strategy converted the target gene to carry a donor template, which is subsequently used to convert future target genes in the offspring at much higher efficiency. This avoided the effect of template location, as donor template will always be 60  present on the other allele of the target site. Although our work did not involve the creation of a gene drive, it proposed a possible challenge for location specific activity that could be missed by gene drive studies. To study the location effect of the genome, more target sites will need to be compared for their HDR repair efficiency. The use of transposon mediated integration has the potential to create multiple transgenic lines before genetic cross for HDR integration at the gene of interest. Although our work does not involve self homing donor templates in gene drives, it showed the potential of using a split system to increase HDR efficiency.  3.4.5  Toxicity of Cas9 and lowered fitness   In the TC strategy, individuals in later generations (G4 to G7)s appeared to have lower fitness. One possibility is that this fitness cost was due to toxicity of Cas9 expression. As discussed in the previous chapter (Chapter 2 \u2013 Discussion 2.4.7), we observed similar trends in lowered fitness of transgenic mosquitoes. The elongated and high level of Cas9 endonuclease expression in the cell comes with possible negative impacts to the organism, even if the endonuclease is inactive (Jiang et al., 2014). We also observed heavily delayed hatching of eggs, which could be a previously not discussed sign of lowered fitness. Mosquitoes go through a process called diapause, which is a delay in development of the egg and larval stage due to environmental conditions (Lacour et al., 2015; Vinogradova, E. B., 2007). Diapause is a genetic process that alters expression of certain transcripts to help mosquitoes tolerate unfavorable conditions (Diniz et al., 2017). While it is unlikely that the (G4 \u2013 G7)s transgenic mosquitoes in our work was induced to dormancy during egg stage, we observed larvae that hatch from eggs up to one month after the initial hatching event. 61  This significant delay in egg hatch was unexpected and was not previously reported by work generating transgenic mosquitoes with integrated CRISPR\/Cas9 components. We also noted that up to five strains failed to hatch in the G5s and G6s. The reason behind this hatch delay is currently unknown. This affected the rearing time needed to raise transgenic mosquitoes, especially if larvae could hatch after eggs are already discarded by researchers. Overall, we recommend counting the number of eggs before each hatch to account for hatch rate over each generation.  3.4.6  Cas9 activity and possible HDR event in G6s While initial screening and G4 genomic DNA sequence analysis failed to recover successful NHEJ or HDR events, two possible HDR events could have happened in the G6s. Since offspring after G4s inherit the Cas9 cassette with TC, it is possible for HDR events to happen in any of the offspring germline cells. However, we expect that NHEJ mutations would be favored due to maternal deposition of Cas9. The two possibly transgenic G6 larvae carried only the 3xP3 dsRed marker without eCFP, which could indicate HDR repair. If HDR repair was successful, we would expect only the 3xP3 dsRed marker to be passed on. However, both G6s failed to give offspring with the same eye phenotype. As the G7 larvae did not match this phenotype, we cannot conclude that HDR repair events led to 3xP3 dsRed insertion. It is currently unclear as to why these two G6s exhibited phenotypes resembling HDR repair events. Further sequencing and PCR validation can be done to genotype these two G6s with red eye marker only phenotypes.   62  3.4.7  Limitations and Future Directions  The Transposon Transgene strategy aimed to induce HDR repair using a split system, which should reduce the time and effort required for G0 embryo microinjection. Several improvements can be made to our current approach. First, the use of a hyperactive piggyBac transposon could increase the number of TC insertion events (Anderson et al., 2024; Otte et al., 2018). Having a TC insertion at different locations can help us identify expression cold spots in the genome. Second, other Cas9 strains in Ae. aegypti should be utilized to generate transgenic lines. As noted in the previous chapter and most gene drive work, germline gene promoter regions could impact Cas9 activity and HDR repair efficiency (Anderson et al., 2024; Li et al., 2017).  We recommend testing multiple Cas9 strains with different gene promoter expression to generate transgenic strains.  3.4.8  Conclusion To summarize, our transposon transgene strategy did not successfully produce stable HDR integration in the transgenic strain. While it is possible that HDR repair could be masked by TC expression, we did not observe any inheritable changes in the transgenic larvae. We cannot conclude that an endogenous, genomic source of sgRNA and donor template could promote HDR repair in Ae. aegypti. We cannot support nor reject our initial hypothesis. Multiple factors in our current system could limit HDR repair, including the lack of DSB generation, the location of TC insertions and the lowered fitness of transgenic offspring. While the lack of DSBs generated by exuCas9 is the primary reason for the lack of transgenic offspring, DSBs could be made in the generations after G4s. If HDR repair were to happen in these subsequent generations, 63  the location of TC insertion and lowered fitness of offspring would likely come into play. We also cannot conclude if sgRNA and donor template were present and localized during germline development, which could hinder the ability for Cas9 to make DSBs. The use of transposon mediated gene integration can still reduce the time and effort needed for generating transgenic strains. We recommend the use of multiple Cas9 promoters and multiple sgRNAs to ensure that HDR activity is not limited by the combination of each of these CRISPR components. Moreover, future efforts can be done to optimize expression of sgRNA and localize donor template to match the location of the target site.    64  4 Generation of a novel balancer chromosome 4.1 Introduction  4.1.1  Introduction to balancer chromosomes   Balancer chromosomes have long been used in model organisms to balance deleterious mutations, and acts as a vital part for the field of genetics. The idea of balancing lethal alleles was first proposed by Muller, H. J., (1918), where inversions in chromosomes were noted to enforce heterozygosity in D. melanogaster and limit homozygous offspring. A balancer chromosome is a region of inversion that suppresses recombination events, allowing mutations to be sustained in heterozygous individuals (Kaufman, T. C. 2017). During crossover events, chromosomal inversions have been shown to suppress recombination (Crown et al., 2018; Miller et al., 2016b). Balancers used in D. melanogaster have traditionally been created through ionizing radiation to generate multiple chromosome inversions randomly (Miller, Cook and Hawley, 2019; Miller et al., 2016a). Chromosomal breaks are sometimes repaired incorrectly, giving rise to inverted segments of the chromosome. Mutated organisms are then screened for changes in phenotype that could suggest possible inversion events. Not only is this method of non-selective mutagenesis random and unpredictable, but it also requires tremendous effort for researchers to create exact inversions (Stern, D. L., 2022). With the rising popularity of precise genetic editing, tailor designed balancer chromosomes have been generated in the past decade to balance specific mutations of interest.    65  4.1.2  Project approach and significance CRISPR\/Cas9 mediated genetic editing has the potential to generate precise inversions to the chromosome in Ae. aegypti. Previous work has used this transgenic tool to generate novel balancers in D. melanogaster (Muron et al., 2022; Stern, D. L., 2022) and Caenorhabditis elegans (Dejima et al., 2018; Iwata et al., 2016). Using simultaneous injection of two sgRNAs targeting separate genes on a chromosome, Cas9 can generate two DSBs and create junction points. With the addition of donor templates resembling both genes at the junction points, HDR repair has the potential to invert the region between DSBs. Serial inversions of these chromosomes can provide a strong balancer that suppress recombination of lethal or sterile mutations. Finally, visible phenotypes can be created through HDR insertion of fluorescent markers or disruption to certain genes. This allows researchers to maintain stocks of model organisms with relative ease. Moreover, the precise creation of balancers has the potential to cover regions that were previously missed by standard balancers, thereby maintaining more deleterious mutations (Iwata et al., 2016; Stern, D. L., 2022).  As Ae. aegypti has only peaked research interest as a non-traditional model organism as of the past few decades, balancer chromosomes are currently not a part of their genetic toolkit. Transgenic strains of Ae. aegypti are maintained through selecting positive individuals every few months and continued outcrossing. Many of these transgenes or mutations disrupt the function of the mosquito physiology and incur fitness costs. For example, mutants to CO2 detection (McMeniman et al., 2014), odor attraction (DeGennaro et al., 2013), vision (Zhan et al., 2021) and egg laying (Matthews, Younger & Vosshall, 2019) have all been created. These mutations are considered 66  deleterious and rely on the efforts of researchers maintain their stock. Other than the low efficiency of generating precise editing in Ae. aegypti, maintenance of transgenic strains is one of the biggest hurdles in mosquito genetics. Therefore, we proposed to adopt methods in precise balancer generation in Ae. aegypti.  We hypothesize that if \u201cbi-genic\u201d donor templates are present during DSBs, large chromosomal inversions can be generated via HDR in Ae. aegypti.  (Fig. 3) \u201cBi-genic\u201d refers to single-stranded oligodeoxynucleotides (ssODNs) that combines the sequence of two genes across the chromosome as a template for HDR repair to invert the chromosome. While ssODNs have been shown to be an effective donor template in Ae. aegypti (Kister, Voshall and Matthews, 2015), the efficiency of bi-genic ssODNs have not been attempted. We also made use of the visible phenotype generated by disruption to the yellow gene (Li et al., 2017), which can act as an indicator of possible novel balancers. It should be noted that the Ae. aegypti genome includes vast areas with low recombination rates, with up to 47% of the chromosome mapped in these recombination deserts. The most prominent area of extremely low recombination rate resides in the first chromosome, near the male-determining locus (Chen et al., 2022). Our choice of inversion at the distal part of the p arm of chromosome 1 should cover areas that avoid this recombination desert (Fig 1).  Not only will balancers be a much-needed addition to the Ae. aegypti genetic toolbox, this would also be the first instance of large-scale genetic engineering of structural variation in mosquitoes. Results generated from our work could have implications for mosquito genetics and gene drive applications, where large 67  chromosomal inversions could be implemented as an alternative to current standards of genetic manipulation.    68  4.2 Methods  4.2.1  Mosquito Strains  Aedes aegypti mosquitoes were maintained according to standard protocol as described (Sun et al., 2022; Wohl & McMeniman, 2023). Mosquito eggs were hatched in a vacuum chamber (20 \u2013 25 Psi) and kept in containers of dechlorinated water until pupation. All adult mosquito strains were kept at 25 \u2013 28 \u00b0C in mesh cages (Bugdorm, 4M3030), with constant relative humidity of 70-80% and 12 : 12 light : dark photoperiod. 10% sucrose solution was provided in the mesh cages of mixed sex for strain maintenance. All females were blood fed on defibrillated sheep blood (Cedarlane Labs, DSB250) via a glass mosquito feeder (Chemglass, Cat# CG1836) with a layer of parafilm spread across the feeder. Blood inside the feeder was warmed to 37.5\u00b0C. Blood fed mosquito cages were given 30% sucrose solution to minimize egg laying on 10% sucrose solution sugar wicks.  Exu-Cas9 strain had a stable integration of Cas9 sequence and an expression of dsRed in the body. Yellow strain was also created by mutation of the exon 2 of the yellow gene (AAEL016999) and has a visible yellow body phenotype (Li et al., 2017). 4.2.2  Identification of Possible Targets to Chromosomal Inversions   Chromosome arms in Ae. aegypti are denoted by \u201cp\u201d and \u201cq\u201d for the shorter and longer arms respectively. Seven candidate genes on the distal p arm on Chromosome 1 were identified to be possible targets for chromosomal inversion with yellow. These candidates have similar genic size with yellow. Gene sequences were exported from Vectorbase and approximate locations were mapped manually on a cytogenetic map 69  from Ensembl Metazoa. Information about the size, exon and intron number and possible phenotypes were collected. Previous mutations of gene orthologs in Drosophila melanogaster were collected from Flybase, as a possible indicator of mutation phenotypes. Of the seven candidate genes, three were selected for sgRNA activity validation which includes AAEL004193 (R), AAEL013840 (V) and AAEL012549 (F).  4.2.3  sgRNA Design and Transcription  CHOPCHOP v.3 was utilized to create sgRNA designs for the three candidates genes and yellow. For the three candidates, the top three sgRNA designs and their associated primers were used for validation. For yellow, sgRNA design from Li et al., 2017 was utilized as well as the top two designs from CHOPCHOP. sgRNA templates were produced using the HiScribe Quick T7 kit (New England Bio, Cat# E2050S). All procedures followed previously described protocol (Lo & Matthews, 2023). All sgRNA sequences are listed in Supp. Table 1.  4.2.4  Embryo Microinjection with sgRNA injection mix One sgRNA of each of the targets and yellow were injected together as a single injection mix. Transcribed sgRNAs were purified and eluted in water separately, then combined in the same 1.5mL Microcentrifuge Tube. Injection mix was filtered through a SpinX centrifuge tube filter (CoStar, 8160) one minute in max speed in a centrifuge. 50 Exu-Cas9 embryos were injected for each sgRNA mix, for a total of 200 Exu-Cas9 embryos injected for sgRNA validation.  All injections were done in the embryo injection station in Matthews Lab, UBC. Injection was done according to Sun et al. (2022).  70   4.2.5  Testing sgRNA Activity \u2013 ICE Genomic DNA of injected Exu-Cas9 embryos was extracted in pools of three pupae and repeated for three samples. All pupae were frozen in -74\u00b0C before DNA extraction. DNA was sequenced at the cut site for all four targets. Gene sequences were compared to Exu-Cas9 sequence using Synthego ICE analysis. Mutations generated by NHEJ was used as a proxy for sgRNA activity. Of the pooled genomic DNA sequence, mismatch between AaegL5.0 genome used by CHOPCHOP and the Exu-Cas9 sequence caused some sgRNAs to have no activity at the cut site. Details for validation of sgRNA activity can be found in Lo and Matthews, 2023.  4.2.6  ssODN Repair Template Design   Chromosomal inversions are generated through simultaneous Homology Directed Repair events across two Double-strand breaks on the same chromosome. I designed two single-stranded oligodeoxynucleotides (ssODNs) as repair templates that have homology with both gene targets, following the design of Dejima et al. (2018).  For ssODN 1, 100 base pairs upstream of the yellow cut site was combined with the reverse compliment of 100 base pairs upstream of AAEL013840 (V) cut site. For ssODN 2, the reverse compliment of 100 base pairs downstream of the yellow cut site was combined with 100 base pairs downstream of AAEL013840 (V) cut site. ssODN 1 and 2 serve as the repair template of the inverted chromosome 1. ssODNs were synthesized commercially using the Integrated DNA Technologies Donor Oligos Synthesis service.  71  4.2.7  Embryo Microinjection of ssORNs to Generate Chromosomal Inversion  To generate chromosomal inversion, 559 Exu-Cas9 embryos were injected with sgRNA targeting AAEL013840 (V), sgRNA targeting yellow (40 ng\/\u00b5L each) and the two ssODN repair templates (10.9 ng\/\u00b5L each). Injection mix was combined and filtered as stated in Embryo Microinjection with sgRNA injection mix. All injections were done in the embryo injection station in Matthews Lab, UBC. Injection was done according to Sun et al. (2022). 4.2.8  Screening of Transgenic Mosquito and Outcross to Yellow  Injected Exu-Cas9 embryos were hatched and reared to adulthood. Male G0s were mated with a yellow virgin female; Female G0s were batch mated with yellow males. Five days post bloodmeal, females were separated into individual egg laying vials. G1 embryos are scored for their color during melanisation, at least one hour after they are laid. Embryos with yellow phenotype are noted and dried for one week before hatching.  4.2.9  Data Analysis  R studio (Version 4.1.1) was used to analyze data in this chapter. Bar graph was generated with the ggplot() function. Schematics were created using Adobe Illustrator (2022).    72  4.3 Results      Figure 1. Schematic of four genic targets in Chr. 1 of Ae. aegypti to generate chromosomal inversions. (a) Schematic of the entire chromosome 1 with AAEL006830 (yellow) and AAEL022912 (Nix) mapped. Part of the distal p arm chromosome 1 enlarged showing the location of the four genic targets chosen for sgRNA testing. Physical genome map recreated from Timoshevskiy et al. (2014). AAEL004193, AAEL013840, AAEL012549 and AAEL006830 (yellow) are mapped from distal to proximal to the centromere of Chr. 1. (b) Schematic representation of testing four sgRNAs for each genic target during testing for sgRNA efficiency. Single headed arrow represent sgRNAs.   a b  Chromosome 1 p armAAEL012549 (F)AAEL013840 (V)AAEL004193 (R)YellowM Locus (Nix)AAEL022912152,616,641..152,718,167YellowAAEL00683083,180,924-83,208,379p armq armChr. 1310MbAAEL004193 (R) 15,307,766..15,659,703AAEL013840 (V) 17,928,464..18,003,673AAEL012549 (F)  29,540,728..29,641,111 73  4.3.1  Identification of possible targets to generate chromosomal inversions  We identified four genic targets that can act as possible sites for chromosomal inversions. AAEL006830 yellow was chosen, as disruption of this gene causes a recessive, visible yellow phenotype in eggs and adults (Li et al., 2017). Genes on the p arm of chromosome 1 were screened to pair with yellow during inversions. 14 gene targets were identified by manually scanning Ensembl Metazoa gene map of chromosome 1. We then searched for possible phenotypes if genes were mutated on VectorBase and associated research on their orthologs in D. melanogaster on FlyBase. Three genes from the distal to proximal end of p arm were picked: AAEL004193, AAEL013840 and AAEL012549. AAEL004193 (R) is Rhophilin and has an ortholog in D. melanogaster involved in stress fiber regulation; AAEL013840 (V) has an ortholog in D. melanogaster called VEGF-related factor 1 and is involved in cell migration; AAEL012549 (F) is an ATPase and orthologs in D. melanogaster regulate flippase activity. All gene targets were mapped onto a physical genome map from Timoshevskiy et al. (2014) to recreate approximate distances between targets (Fig. 1a).   Using CHOPCHOP design tool, we designed three sgRNAs for each genic target to validate their activity. As seen in Kistler, Vosshall and Matthews (2015), the activity of sgRNAs can vary greatly within the same target site area. We injected an injection mix of four sgRNAs, one for each target, into exuCas9 embryos. Genomic DNA was extracted from a pool of three pupae for three replicates. At least 50 exuCas9 eggs were injected for each sgRNA injection mix with an average hatch rate of 22% (Supp. Table 8).   74   sgRNA F1 F2 F3 R1 R2 R3 V1 V2 V3 Y1 Y2 Y98 Length (bp) 23 23 23 23 23 23 23 23 23 23 23 23 Indels (%) 0,0,0 0,0,0 0,0,0 0,0,3 0,0,0 0,0,0 0,0,0 0,4,0 27,0,2 5,3,4 0,0,0 0,0,7 Target Exon 7 Exon 8 Exon 1 Exon 2   Figure 2. Percentage of reads containing indels for all sgRNA designs across four genic targets. Each bar represents an average of sequence data from three G0 pupae for a total of three replicates. Error bar represents standard error. Length of each sgRNA and percent indels across reads are shown in the table. All three sgRNAs targets the same approximate location on the gene within 200bp of each design.     75  4.3.2  Validation of sgRNA designs  sgRNA designs were validated by ICE analysis, which compared sequences at the target site to determine the percentage of reads that contain insertion or deletion (indel) mutations. ExuCas9 expresses Cas9 endogenously, which can interact with injected sgRNAs to generate mutations. All sgRNAs were 23 bp in length. For F, all three sgRNA designs did not result in mutations and was not chosen as the inversion target. For R, only one sgRNA design resulted in 3% of mutation in one pooled sample (three pupae genomic DNA). We also did not choose R as an inversion target. All V sgRNA designs target exon 1 of the V gene, with V3 showing the highest sgRNA activity of 27%. We chose V3 as the sgRNA for generating DSB at the V gene. Upon comparisons between ExuCas9 sequences with sequence from R3 and V1, we found that target sites were not identified. As the LVP genome (AaegL_5) was used to design sgRNAs, single nucleotide polymorphism in the exuCas9 likely affected target site sequences. Thus, both designs of sgRNA were unable to bind to the target site and resulted in no mutations and no Cas9 activity. As the four genic targets were spread across the p arm, it is possible for deletions between two DSBs to occur that are missed by our sequencing analysis. However, the distance between these targets render it unlikely for large scale deletions to occur.  For yellow, we compared two sgRNA designs (Y1 and Y2) with the original sgRNA sequence Y98 used in Li et al. (2017). While Y98 did have the highest percentage of indels in one of the samples, Y1 showed activity across all three replicates. We chose V and yellow as our gene targets to generate inversion, with V3 and Y1 as the sgRNAs used for this work.  76   Figure 3. Schematic representation of chromosomal inversions generated by two DSBs, and repaired according to two \u201cbi-genic\u201d ssODN templates. All genes in the gradient regions are inverted and considered balanced.    4.3.3  Design of bi-genic ssODNs  HDR templates were created according to Iwata et al. (2016) and Dejima et al. (2018). ssODNs were created by combining the two ends of V and yellow together, creating a bi-genic ssODN (Supp. Table 10). The 100bp upstream region of both genes were combined into ssODN 1, while the 100bp downstream region of both genes were combined into ssODN 2. When a DSB is generated at both cut sites, HDR repair can use ssODNs as templates and repair these sites with the inverted chromosome (Fig. 3). All genes in between the two inverted sites are considered balanced, as recombination of any these genes will cause inviable offspring. The inversion between V and yellow is 65 Mb in size.    77   Figure 4. Schematic of crossing scheme for G0s to identify possible chromosomal inversion. G0 adults were crossed with yellow adults individually to lay eggs. Disruption to yellow gene due to NHEJ or HDR results in heterozygous G0s. Eggs carrying possible inversion will be yellow in the first 30 minutes to 3 hours within egg laying, before melanization to black. Yellow eggs were screened at this time window for possible transgenic G1s.    78  Table 1. Total count for G0s injected with bi-genic ssODNs targeting V and yellow. \u201cYellow eggs\u201d refer to number of G0 crosses that laid yellow eggs before melanization. Transgenic rate is the number of G0s that laid yellow eggs against total number of G0s that survived to adulthood. All crosses that laid yellow eggs were from male G0s.     Table 2. Total counts for G0s x yellow cross that gave eggs between female and male G0s. \u201cLaid eggs\u201d refer to G0 females that laid eggs individually, or yellow females that mated with G0 males to lay eggs. \u201cYellow eggs\u201d refers to the number of individuals that gave yellow eggs during melanization. \u201cYellow (%)\u201d is the percentage of egg papers collected that had yellow eggs compared to total number of egg papers.      4.3.4  Screening eggs laid by G0 x Yellow crosses to determine possible chromosomal inversion events   559 ExuCas9 embryos were injected with V3 sgRNA, Y1 sgRNA and ssODN repair templates, across seven injections. Of note, only 58 embryos hatched successfully and 45 of which survived to adulthood (Table 1). All adult G0s were treated as possible carriers of the balancer and crossed to yellow adults of the opposite sex. As the balancer should disrupt the copy of yellow, offspring carrying chromosomal G0Total numberLaid eggsLaid eggs (%)Yellow eggsYellow (%)Females 31 8 25.81 0 0.00Males 14 12 85.71 11 91.67Eggs injectedTotal HatchSurvive to adulthoodHatch Rate (%)Yellow EggsTransgenic Rate (%)Total 559 58 45 0.10 11 0.2479  inversion should be recessive for yellow mutations and show a yellow phenotype. Mosaicism is possible as some G0s might not have germline cells disrupted by chromosomal inversions. Those that laid yellow eggs were counted as possible inversion events. The yellow phenotype was only present during the first 30 minutes to 3 hours of eggs being laid (Fig. 4).  Of the 45 G0s that were crossed to yellow and allowed to lay eggs, only 20 G0s gave offspring. 25.81% of female G0s laid eggs, where none of which were yellow. Surprisingly, 85.71% of yellow females crossed to G0 males laid eggs, where 91.67% of egg laying events had yellow eggs during melanization. All eggs were observed to be yellow within the first 30 minutes of egg laying. We identified these 11 G0 males as those carrying possible chromosomal inversions (Table 2; Supp. Table 9).    80  4.4 Discussion  4.4.1  Yellow phenotype restricted to egg development only   Our results shown here are promising first steps in generating possible balancers in Ae. aegypti, which to our knowledge is the first attempt for this type of work in mosquito genetics. Our work modeled the protocol by Dejima et al. (2018) in C. elegans and optimised the system for Ae. aegypti. We generated a 200bp ssODN template, as opposed to the 66bp template in C. elegans, to promote homology of the donor to the target site. The generation of a chromosomal inversion simultaneously disrupted yellow, which led to visible phenotypes that allowed effective screening. It should be noted that yellow phenotype was only observed in the eggs during melanization and not in adulthood. This differed from the generation of the original yellow mutants, which made use of NHEJ mutations at the yellow target site (Li et al., 2017). Egg melanization in Ae. aegypti is a complex process orchestrated by multiple proteins to ensure egg viability and prevent desiccation (Isoe et al., 2023). The possible inversion generated in our work could be a different mutation than the original yellow mutants, which explains the varying patterns of adult expression. Future work will make use of sequencing analysis at the target site to validate the types of mutations at yellow. Nonetheless, the generation of yellow eggs in the G0 outcross still showed promise in creating chromosomal inversions.    81  4.4.2   All possible G0 founders were males, majority of females did not give offspring All yellow eggs were laid by outcrosses with G0 males. This indicates that the possible inversion events that disrupted yellow likely happened in males only. It should be noted that the male determining region Nix and the M locus are also located near the centromere of Chromosome 1 (Turner et al., 2018), which is on the same chromosomal arm as yellow. It has been shown that disruption to Nix create male like offspring (Hall et al., 2015), and the positions near the centromere has lowered recombination rate (Juneja et al., 2014). In our work, we proposed to create chromosomal inversion in the p arm of Chromosome 1. These inversions are unlikely to be linked and inherited with Nix, due to a 69Mb distance between yellow and Nix. Thus, the explanation of this strong male bias could lie with the lowered fitness of females.   As noted in Chapter 2, we observed a strong male bias partly due to an overrepresentation of viable male founders. Cas9 toxicity could have affected the fecundity of female G0s but not males. While only 26% of females laid eggs, 86% of males gave offspring with the majority being yellow. Possible chromosomal inversion could have strongly impacted female fitness, leaving them unable to past on mutations to their offspring. This observation is supported by the sGD system that noted a disproportionate representation of males with less transgene expression (Anderson et al., 2024). Although the reason for a fitness cost to transgenic female remain unknown, it could affect how genetics work in Ae. aegypti. Further confirmation is needed to see if this male bias is inherited past G1s, and how this relates to chromosomal inversions.    82   Figure 5. Schematic representation of primary and secondary inversions to generate a balancer. The first inversion involved the purple and yellow genes, while the second inversion involved the blue and pink genes. Note that one of the secondary inversion targets should be in between the primary inversions. All genes in the gradient regions are inverted and considered balanced.   4.4.3  Current work and future directions  At the time of completing this thesis, we have only collected the G0 eggs and are outcrossing G1s. To validate chromosomal inversions, we plan to use PCR to confirm bi-genic target sites. Sanger sequencing will then be done to ensure that HDR repair created inversions as expected by our design. We will be able to confirm our hypothesis for this work, which is that bi-genic donor template allows chromosomes to be inverted by HDR in Ae. aegypti. Once a primary inversion is sustained, a secondary inversion that inverts one of the target sites will be created (Fig 5). Visual fluorescence markers can then be integrated into the balancer to allow ease of screening by researchers. It is our hope that a balancer chromosome with double inversions can be created for Ae. aegypti and effectively balance mutations in Chromosome 1.  83  5 Overall conclusions  5.1.1 Conclusions for the genetic toolbox of Ae. aegypti  Our work in this thesis seek to expand the genetic toolbox of Ae. aegypti, which could benefit researchers studying these fascinating and potentially dangerous organisms. Across our results, we noticed a strong male bias in founders that led to the successful creation of transgenic strains. It is currently unknown whether males simply had a higher fitness, or if maternal deposition of Cas9 could potentially impact transgenes inheritance. Male mosquitoes are able to be batch mated with a pool of females, which provides an advantage over the number of offspring a male founder can give rise to in comparison to female founders. While female founders can be blood-fed multiple times, this is time- and effort- prohibitive and proved difficult in practise.  Across our work, we can now highlight a few key improvements that can be made to current workflow for transgenic mosquito generation. First, the screening of transient expression of the donor template in larvae can significantly reduce screening effort. This initial screening step can help discard individuals that are not likely to be founders, which reduces subsequent rearing effort and time. Second, we recommend separating transgenic crosses between males and female in the case of strong sex bias. We suggest focusing screening efforts on crosses with male founders that have given rise to offspring by outcrossing to multiple females. This can lower the risk of a transgene being lost if females with lowered fitness do not lay eggs. Third, advancements in endogenous Cas9 promoters should be used to maximize the chances of generating transgenic G0s. The bgcn-Cas9 transgenic strain (Anderson et 84  al., 2024) could be a promising successor to exuCas9 (Li et al., 2017) in generating transgenic Ae. aegypti strains. Our work in the generation of a novel balancer chromosome shows great promise. A balancer chromosome can provide a new genetic tool with great ease of use to researchers generating and maintaining deleterious mutations in the mosquito. This can not only benefit the field, but also demonstrate the power of CRISPR\/Cas9 in Ae. aegypti for large scale genome engineering.  5.1.2 Future work in Ae. aegypti genetics Ae. aegypti has been an increasingly popular non-model organism in the past decade. While some work aimed to understand and alter the behavior of these mosquitoes, other effort has been made to improve gene drive systems and control their population. The history of precise CRISPR gene editing in Ae. aegypti ranges from the first instance of CRISPR\/Cas9 adaptation in Ae. aegypti (Kistler, Vosshall and Matthews, 2015), the first effective gene drive system (Li et al., 2020) to the latest improvements to a split gene drive (Anderson et al., 2024). Gene drive work has also recently been an active area of development in the private, biotechnology sector with the emergence of Biocentis and continued efforts of Oxitec Ltd. These works have shown that CRISPR\/Cas9 gene editing for Ae. aegypti remains a hugely complex area of active research. While some novel techniques like ReMOT control (Chaverra-Rodriguez et al., 2018) and DIPA-CRISPR (Shira et al., 2023) are proving to be potential contenders to traditional methods of gene editing, much work is still needed for their HDR repair to be optimised.   85  While the creation of robust gene drives has been successful in Drosophila and Anopheles, Ae. aegypti gene drive research is still restricted by their low HDR efficiency. Our results also show that strategies to improve gene drive in other systems do not directly translate to Ae. aegypti. This could be due to the unique nature of the Ae. aegypti genome. Not only is the Ae. aegypti genome is much larger than other Diptera, a recent study has shown that this large genome size is due to a high rate of propagation and low rate of elimination of TEs (Daron et al., 2024). It is unclear why Ae. aegypti has accumulated these excess copies of TEs in their genome. There are also vast areas of recombination deserts observed in the Ae. aegypti genome, where regions in all three chromosomes display a much lower recombination rate than expected (Chen et al., 2022). This large genome is filled with TEs but restrictive to recombination events, which could be a hurdle to gene editing and gene drive optimization. While some of these features might go under-appreciated in most gene drive work, they could have far-reaching consequences to how DNA damage can be repaired by Ae. aegypti. We believe that future work in gene drive application can uncover what makes the Ae. aegypti genome particularly challenging for HDR repair during DNA damage. While the yellow fever mosquitoes remain one of the most challenging non-model organisms to study, gene editing and gene drive applications is increasingly feasible.   86  Bibliography Adelman, Z. N., Jasinskiene, N., Onal, S., Juhn, J., Ashikyan, A., Salampessy, M., MacCauley, T., & James, A. A. (2007). Nanos gene control DNA mediates developmentally regulated transposition in the yellow fever mosquito Aedes aegypti. Proceedings of the National Academy of Sciences of the United States of America, 104(24), 9970\u20139975. https:\/\/doi.org\/10.1073\/pnas.0701515104 Alphey, L. (2014). Genetic control of mosquitoes. Annual Review of Entomology, 59, 205\u2013224. https:\/\/doi.org\/10.1146\/annurev-ento-011613-162002 Anderson, M. A. E., Gonzalez, E., Ang, J. X. D., Shackleford, L., Nevard, K., Verkuijl, S. A. N., Edgington, M. P., Harvey-Samuel, T., & Alphey, L. (2023). Closing the gap to effective gene drive in Aedes aegypti by exploiting germline regulatory elements. Nature Communications, 14(1). https:\/\/doi.org\/10.1038\/s41467-023-36029-7 Anderson, M. A. E., Gonzalez, E., Edgington, M. P., Ang, J. X. D., Purusothaman, D. K., Shackleford, L., Nevard, K., Verkuijl, S. A. N., Harvey-Samuel, T., Leftwich, P. T., Esvelt, K., & Alphey, L. (2024). A multiplexed, confinable CRISPR\/Cas9 gene drive can propagate in caged Aedes aegypti populations. Nature Communications, 15(1). https:\/\/doi.org\/10.1038\/s41467-024-44956-2 Arensburger, P., Hice, R. H., Wright, J. A., Craig, N. L., & Atkinson, P. W. (2011). The mosquito Aedes aegypti has a large genome size and high transposable element load but contains a low proportion of transposon-specific piRNAs. BMC Genomics, 12(1), 606. https:\/\/doi.org\/10.1186\/1471-2164-12-606 Aryan, A., Anderson, M. A. E., Myles, K. M., & Adelman, Z. N. (2013). TALEN-Based Gene Disruption in the Dengue Vector Aedes aegypti. PLoS ONE, 8(3). https:\/\/doi.org\/10.1371\/journal.pone.0060082 Aryan, A., Myles, K. M., & Adelman, Z. N. (2014). Targeted genome editing in Aedes aegypti using TALENs. Methods, 69(1), 38\u201345. https:\/\/doi.org\/10.1016\/j.ymeth.2014.02.008 Barrangou, R., & van Pijkeren, J. P. (2016). Exploiting CRISPR-Cas immune systems for genome editing in bacteria. Current Opinion in Biotechnology, 37, 61\u201368. https:\/\/doi.org\/10.1016\/j.copbio.2015.10.003 Barrett, A. D. T., & Higgs, S. (2007). Yellow fever: A disease that has yet to be conquered. Annual Review of Entomology, 52, 209\u2013229. https:\/\/doi.org\/10.1146\/annurev.ento.52.110405.091454 87  Bassett, A. R., Tibbit, C., Ponting, C. P., & Liu, J. L. (2013). Highly Efficient Targeted Mutagenesis of Drosophila with the CRISPR\/Cas9 System. Cell Reports, 4(1), 220\u2013228. https:\/\/doi.org\/10.1016\/j.celrep.2013.06.020 Burt, A. (2003). Site-specific selfish genes as tools for the control and genetic engineering of natural populations. Proceedings of the Royal Society B: Biological Sciences, 270(1518), 921\u2013928. https:\/\/doi.org\/10.1098\/rspb.2002.2319 Calvo, E., Walter, M., Adelman, Z. N., Jimenez, A., Onal, S., Marinotti, O., & James, A. A. (2005). Nanos (nos) genes of the vector mosquitoes, Anopheles gambiae, Anopheles stephensi and Aedes aegypti. Insect Biochemistry and Molecular Biology, 35(7), 789\u2013798. https:\/\/doi.org\/10.1016\/j.ibmb.2005.02.007 Champer, J., Buchman, A., & Akbari, O. S. (2016). Cheating evolution: Engineering gene drives to manipulate the fate of wild populations. Nature Reviews Genetics, 17(3), 146\u2013159. https:\/\/doi.org\/10.1038\/nrg.2015.34 Champer, J., Chung, J., Lee, Y. L., Liu, C., Yang, E., Wen, Z., Clark, A. G., & Messer, P. W. (2019). Molecular safeguarding of CRISPR gene drive experiments. ELife, 8, 1\u201310. https:\/\/doi.org\/10.7554\/ELIFE.41439 Champer, J., Reeves, R., Oh, S. Y., Liu, C., Liu, J., Clark, A. G., & Messer, P. W. (2017). Novel CRISPR\/Cas9 gene drive constructs reveal insights into mechanisms of resistance allele formation and drive efficiency in genetically diverse populations. PLoS Genetics, 13(7), 1\u201318. https:\/\/doi.org\/10.1371\/journal.pgen.1006796 Chang, N., Sun, C., Gao, L., Zhu, D., Xu, X., Zhu, X., Xiong, J. W., & Xi, J. J. (2013). Genome editing with RNA-guided Cas9 nuclease in Zebrafish embryos. Cell Research, 23(4), 465\u2013472. https:\/\/doi.org\/10.1038\/cr.2013.45 Chaverra-Rodriguez, D., Macias, V. M., Hughes, G. L., Pujhari, S., Suzuki, Y., Peterson, D. R., Kim, D., McKeand, S., & Rasgon, J. L. (2018). Targeted delivery of CRISPR-Cas9 ribonucleoprotein into arthropod ovaries for heritable germline gene editing. Nature Communications, 9(1), 1\u201311. https:\/\/doi.org\/10.1038\/s41467-018-05425-9 Chen, J. M., Cooper, D. N., Chuzhanova, N., F\u00e9rec, C., & Patrinos, G. P. (2007). Gene conversion: Mechanisms, evolution and human disease. Nature Reviews Genetics, 8(10), 762\u2013775. https:\/\/doi.org\/10.1038\/nrg2193 Chen, S., Lee, L., Naila, T., Fishbain, S., Wang, A., Tomkinson, A. E., Lees-Miller, S. P., & He, Y. (2021). Structural basis of long-range to short-range synaptic transition in NHEJ. Nature, 593(7858), 294\u2013298. https:\/\/doi.org\/10.1038\/s41586-021-03458-7 Coates, C. J., Jasinskiene, N., Miyashiro, L., & James, A. A. (1998). Mariner transposition and transformation of the yellow fever mosquito, Aedes aegypti. 88  Proceedings of the National Academy of Sciences of the United States of America, 95(7), 3748\u20133751. https:\/\/doi.org\/10.1073\/pnas.95.7.3748 Cobb, R. E., Wang, Y., & Zhao, H. (2015). High-Efficiency Multiplex Genome Editing of Streptomyces Species Using an Engineered CRISPR\/Cas System. ACS Synthetic Biology, 4(6), 723\u2013728. https:\/\/doi.org\/10.1021\/sb500351f Cong, L., Ran, F. A., Cox, D., Lin, S., Bareetto, R., Habib, N., \u2026 Zhang, F. (2013). Multiplex Genome Engineering Using CRISPR\/Cas Systems. Science, 286(5446 (Dec.), 1893\u20131897. Crown, K. N., Miller, D. E., Sekelsky, J., & Hawley, R. S. (2018). Local Inversion Heterozygosity Alters Recombination throughout the Genome. Current Biology, 28(18), 2984-2990.e3. https:\/\/doi.org\/10.1016\/j.cub.2018.07.004 Crucs, S., Chatterjee, S. & Gavis, E. G. (2000). Overlapping but Distinct RNA Elements Control Repression and Activation of nanos Translation. Cell, 5(3), 457-467. https:\/\/doi.org\/10.1016\/S1097-2765(00)80440-2 Daron, J., Bergman, A., Lpez-Maestre, H. & Lambrechts, L. (2024) Atypical Landscape of Transposable Elements in the Large Genome of Aedes aegypti. bioRxiv. https:\/\/doi.org\/10.1101\/2024.02.07.579293 de Melo, E. S., & Wallau, G. L. (2020). Mosquito genomes are frequently invaded by transposable elements through horizontal transfer. PLoS Genetics, 16(11), 1\u201326. https:\/\/doi.org\/10.1371\/journal.pgen.1008946 Degennaro, M., Mcbride, C. S., Seeholzer, L., Nakagawa, T., Dennis, J., Goldman, C., Jasinskiene, N., James, A. A. & Leslie, B.,Genetics, M. (2013). HHS Public Access. 498(7455), 487\u2013491. https:\/\/doi.org\/10.1038\/nature12206.orco Dejima, K., Hori, S., Iwata, S., Suehiro, Y., Yoshina, S., Motohashi, T., & Mitani, S. (2018). An Aneuploidy-Free and Structurally Defined Balancer Chromosome Toolkit for Caenorhabditis elegans. Cell Reports, 22(1), 232\u2013241. https:\/\/doi.org\/10.1016\/j.celrep.2017.12.024 Diniz, D. F. A., De Albuquerque, C. M. R., Oliva, L. O., De Melo-Santos, M. A. V., & Ayres, C. F. J. (2017). Diapause and quiescence: Dormancy mechanisms that contribute to the geographical expansion of mosquitoes and their evolutionary success. Parasites and Vectors, 10(1), 1\u201313. https:\/\/doi.org\/10.1186\/s13071-017-2235-0 Dong, S., Lin, J., Held, N. L., Clem, R. J., Passarelli, A. L., & Franz, A. W. E. (2015). Heritable CRISPR\/Cas9-mediated genome editing in the yellow fever mosquito, 89  Aedes aegypti. PLoS ONE, 10(3), 1\u201313. https:\/\/doi.org\/10.1371\/journal.pone.0122353 Doudna, J. A., & Charpentier, E. (2014). The new frontier of genome engineering with CRISPR-Cas9. Science, 346(6213). https:\/\/doi.org\/10.1126\/science.1258096 Fuller, H. S. (1961). Aedes Aegypti: The Yellow Fever Mosquito. The American Journal of Tropical Medicine and Hygiene, 10(1), 112\u2013113. https:\/\/doi.org\/10.4269\/ajtmh.1961.10.112 Gandhi, M., Evdokimova, V. N., Cuenco, K. T., Nikiforova, M. N., Kelly, L. M., Stringer, J. R., Bakkenist, C. J., & Nikiforov, Y. E. (2012). Homologous chromosomes make contact at the sites of double-strand breaks in genes in somatic G 0\/G 1-phase human cells. Proceedings of the National Academy of Sciences of the United States of America, 109(24), 9454\u20139459. https:\/\/doi.org\/10.1073\/pnas.1205759109 Gantz, V. M., Jasinskiene, N., Tatarenkova, O., Fazekas, A., Macias, V. M., Bier, E., & James, A. A. (2015). Highly efficient Cas9-mediated gene drive for population modification of the malaria vector mosquito Anopheles stephensi. Proceedings of the National Academy of Sciences of the United States of America, 112(49), E6736\u2013E6743. https:\/\/doi.org\/10.1073\/pnas.1521077112 Gratz, S. J., Cummings, A. M., Nguyen, J. N., Hamm, D. C., Donohue, L. K., Harrison, M. M., Wildonger, J., & O\u2019connor-Giles, K. M. (2013). Genome engineering of Drosophila with the CRISPR RNA-guided Cas9 nuclease. Genetics, 194(4), 1029\u20131035. https:\/\/doi.org\/10.1534\/genetics.113.152710 Gutschner, T., Haemmerle, M., Genovese, G., Draetta, G. F., & Chin, L. (2016). Post-translational Regulation of Cas9 during G1 Enhances Homology-Directed Repair. Cell Reports, 14(6), 1555\u20131566. https:\/\/doi.org\/10.1016\/j.celrep.2016.01.019 Halstead, S. B. (2008). Dengue virus-mosquito interactions. Annual Review of Entomology, 53, 273\u2013291. https:\/\/doi.org\/10.1146\/annurev.ento.53.103106.093326 Hammond, A., Galizi, R., Kyrou, K., Simoni, A., Siniscalchi, C., Katsanos, D., Gribble, M., Baker, D., Marois, E., Russell, S., Burt, A., Windbichler, N., Crisanti, A., & Nolan, T. (2016). A CRISPR-Cas9 gene drive system targeting female reproduction in the malaria mosquito vector Anopheles gambiae. Nature Biotechnology, 34(1), 78\u201383. https:\/\/doi.org\/10.1038\/nbt.3439 Hammond, A., Karlsson, X., Morianou, I., Kyrou, K., Beaghton, A., Gribble, M., Kranjc, N., Galizi, R., Burt, A., Crisanti, A., Nolan, T. (2021) Regulating the expression of gene drives is key to increasing their invasive potential and the mitigation of resistance. PLoS Genet,17(1):e1009321. https:\/\/doi.org\/10.1371\/journal.pgen.1009321 90  Handler, A. M., & Harrell, R. A. (1999). Germline transformation of Drosophila melanogaster with the piggyBac transposon vector. Insect Molecular Biology, 8(4), 449\u2013457. https:\/\/doi.org\/10.1046\/j.1365-2583.1999.00139.x Hay, B. A., Chen, C. H., Ward, C. M., Huang, H., Su, J. T., & Guo, M. (2010). Engineering the genomes of wild insect populations: Challenges, and opportunities provided by synthetic Medea selfish genetic elements. Journal of Insect Physiology, 56(10), 1402\u20131413. https:\/\/doi.org\/10.1016\/j.jinsphys.2010.05.022 Howden, S. E., McColl, B., Glaser, A., Vadolas, J., Petrou, S., Little, M. H., Elefanty, A. G., & Stanley, E. G. (2016). A Cas9 Variant for Efficient Generation of Indel-Free Knockin or Gene-Corrected Human Pluripotent Stem Cells. Stem Cell Reports, 7(3), 508\u2013517. https:\/\/doi.org\/10.1016\/j.stemcr.2016.07.001 Isoe, J., Simington, C. J., Oscherwitz, M. E., Peterson, A. J., Rasc\u00f3n, A. A., Massani, B. B., Miesfeld, R. L., & Riehle, M. A. (2023). Characterization of essential eggshell proteins from Aedes aegypti mosquitoes. BMC Biology, 21(1), 1\u201324. https:\/\/doi.org\/10.1186\/s12915-023-01721-z Iwata, S., Yoshina, S., Suehiro, Y., Hori, S., & Mitani, S. (2016). Engineering new balancer chromosomes in C. Elegans via CRISPR\/Cas9. Scientific Reports, 6, 1\u20138. https:\/\/doi.org\/10.1038\/srep33840 Jasinskiene, N., Coates, C. J., Benedict, M. Q., Cornel, A. J., Rafferty, C. S., James, A. A., & Collins, F. H. (1998). Stable transformation of the yellow fever mosquito, Aedes aegypti, with the Hermes element from the housefly. Proceedings of the National Academy of Sciences of the United States of America, 95(7), 3743\u20133747. https:\/\/doi.org\/10.1073\/pnas.95.7.3743 Jiang, W., Brueggeman, A. J., Horken, K. M., Plucinak, T. M., & Weeks, D. P. (2014). Successful transient expression of Cas9 and single guide RNA genes in Chlamydomonas reinhardtii. Eukaryotic Cell, 13(11), 1465\u20131469. https:\/\/doi.org\/10.1128\/EC.00213-14 Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., & Charpentier, E. (2012). A Programmable Dual-RNA \u2013 Guided. 337(August), 816\u2013821. Juneja, P., Osei-Poku, J., Ho, Y. S., Ariani, C. V., Palmer, W. J., Pain, A., & Jiggins, F. M. (2014). Assembly of the Genome of the Disease Vector Aedes aegypti onto a Genetic Linkage Map Allows Mapping of Genes Affecting Disease Transmission. PLoS Neglected Tropical Diseases, 8(1), 8. https:\/\/doi.org\/10.1371\/journal.pntd.0002652 91  Kandul, N. P., Liu, J., Bennett, J. B., Marshall, J. M., & Akbari, O. S. (2021). A confinable home-and-rescue gene drive for population modification. ELife, 10, 1\u201325. https:\/\/doi.org\/10.7554\/eLife.65939 Kandul, N. P., Liu, J., Buchman, A., Gantz, V. M., Bier, E., & Akbari, O. S. (2020). Assessment of a split homing based gene drive for efficient knockout of multiple genes. G3: Genes, Genomes, Genetics, 10(2), 827\u2013837. https:\/\/doi.org\/10.1534\/g3.119.400985 Kaufman, T. C. (2017). A short history and description of Drosophila melanogaster classical genetics: Chromosome aberrations, forward genetic screens, and the nature of mutations. Genetics, 206(2), 665\u2013689. https:\/\/doi.org\/10.1534\/genetics.117.199950 Kistler, K. E., Vosshall, L. B., & Benjamin J M. (2017). Genome-engineering with CRISPR-Cas9 in the mosquito Aedes aegypti. Physiology & Behavior, 176(12), 139\u2013148. https:\/\/doi.org\/10.1016\/j.physbeh.2017.03.040 Kokoza, V., Ahmed, A., Wimmer, E. A., & Raikhel, A. S. (2001). Efficient transformation of the yellow fever mosquito Aedes aegypti using the piggyBac transposable element vector pBac[3xP3-EGFP afm]. Insect Biochemistry and Molecular Biology, 31(12), 1137\u20131143. https:\/\/doi.org\/10.1016\/S0965-1748(01)00120-5 Koreman, G. T., Xu, Y., Hu, Q., Zhang, Z., Allen, S. E., Wolfner, M. F., Wang, B. & Han, C. (2021) Upgraded CRISPR\/Cas9 Tools for Tissue-Specific Mutagenesis in Drosophila. Proc Natl Acad Sci U S A, 118(14). https\/\/doi.org\/10.1073\/pnas.2014255118 Krafsur, E. S. (1998). Sterile insect technique for suppressing and eradicating insect population: 55 years and counting. Journal of Agricultural and Urban Entomology, 15(4), 303\u2013317. Krejci, L., Altmannova, V., Spirek, M., & Zhao, X. (2012). Homologous recombination and its regulation. Nucleic Acids Research, 40(13), 5795\u20135818. https:\/\/doi.org\/10.1093\/nar\/gks270 Kyrou, K., Hammond, A. M., Galizi, R., Kranjc, N., Burt, A., Beaghton, A. K., Nolan, T., & Crisanti, A. (2018). A CRISPR\u2013Cas9 gene drive targeting doublesex causes complete population suppression in caged Anopheles gambiae mosquitoes. Nature Biotechnology, 36(11), 1062\u20131071. https:\/\/doi.org\/10.1038\/nbt.4245 Labbe, G. M.C., Scaife, S., Morgan, S. A., Curtis, Z. H. and Alphey, L. (2012) Female-Specific Flightless (fsRIDL) Phenotype for Ctonrol of Aedes albopictus. PLoS Nehl Top Dis, 6(7): e1724. http:\/\/doi.org\/10.1371\/journal.pntd.0001724 92  Lacour, G., Chanaud, L., L\u2019Ambert, G., & Hance, T. (2015). Seasonal Synchronization of Diapause Phases in Aedes albopictus (Diptera: Culicidae). PLoS ONE, 10(12), 1\u201316. https:\/\/doi.org\/10.1371\/journal.pone.0145311 Lee, C. S., Wang, R. W., Chang, H. H., Capurso, D., Segal, M. R., & Haber, J. E. (2016). Chromosome position determines the success of double-strand break repair. Proceedings of the National Academy of Sciences of the United States of America, 113(2), E146\u2013E154. https:\/\/doi.org\/10.1073\/pnas.1523660113 Li, G., Liu, D., Zhang, X., Quan, R., Zhong, C., Mo, J., Huang, Y., Wang, H., Ruan, X., Xu, Z., Zheng, E., Gu, T., Hong, L., Li, Z., Wu, Z., & Yang, H. (2018). Suppressing Ku70\/Ku80 expression elevates homology-directed repair efficiency in primary fibroblasts. International Journal of Biochemistry and Cell Biology, 99(January), 154\u2013160. https:\/\/doi.org\/10.1016\/j.biocel.2018.04.011 Li, M., Bui, M., Yang, T., Bowman, C. S., White, B. J., & Akbari, O. S. (2017). Germline Cas9 expression yields highly efficient genome engineering in a major worldwide disease vector, Aedes aegypti. Proceedings of the National Academy of Sciences of the United States of America, 114(49), E10540\u2013E10549. https:\/\/doi.org\/10.1073\/pnas.1711538114 Li, M., Yang, T., Kandul, N. P., Bui, M., Gamez, S., Raban, R., Bennett, J., S\u00e1nchez C, H. M., Lanzaro, G. C., Schmidt, H., Lee, Y., Marshall, J. M., & Akbari, O. S. (2020). Development of a confinable gene drive system in the human disease vector aedes aegypti. ELife, 9, 1\u201322. https:\/\/doi.org\/10.7554\/eLife.51701 Lieber, M. R. (2011). The mechanism of DSB repair by the NHEJ. Annual Review of Biochemistry, 79(3), 181\u2013211. https:\/\/doi.org\/10.1146\/annurev.biochem.052308.093131.The Liesch, J., Bellani, L. L., & Vosshall, L. B. (2013). Functional and Genetic Characterization of Neuropeptide Y-Like Receptors in Aedes aegypti. PLoS Neglected Tropical Diseases, 7(10). https:\/\/doi.org\/10.1371\/journal.pntd.0002486 Lin, C. C., & Potter, C. J. (2016). Editing transgenic DNA components by inducible gene replacement in Drosophila melanogaster. Genetics, 203(4), 1613\u20131628. https:\/\/doi.org\/10.1534\/genetics.116.191783 Lin, S., Staahl, B. T., Alla, R. K., & Doudna, J. A. (2014). Enhanced homology-directed human genome engineering by controlled timing of CRISPR\/Cas9 delivery. ELife, 3, e04766. https:\/\/doi.org\/10.7554\/eLife.04766 Liu, M., Rehman, S., Tang, X., Gu, K., Fan, Q., Chen, D., & Ma, W. (2019). Methodologies for improving HDR efficiency. Frontiers in Genetics, 10(JAN), 1\u20139. https:\/\/doi.org\/10.3389\/fgene.2018.00691 93  Lo, I. (2021). Improving genetic efficiency in Aedes aegypti mosquitoes via germline Cas9. UBC Honors Animal Biology. http:\/\/mosquitolab.zoology.ubc.ca\/assets\/pdf\/IvanLo-Honours-2021.pdf Lo, I. H. Y. and Matthews, B. J. Design and validation of guide RNAs for CRISPR-Cas9 genome editing in mosquitoes. Cold Spring Harb Protoc. http:\/\/doi.org\/10.1101\/pdb.top107688 Lobo, N. F., Hua-Van, A., Li, X., Nolen, B. M., & Fraser, M. J. (2002). Germ line transformation of the yellow fever mosquito, Aedes aegypti, mediated by transpositional insertion of a piggyBac vector. Insect Molecular Biology, 11(2), 133\u2013139. https:\/\/doi.org\/10.1046\/j.1365-2583.2002.00317.x L\u00f3pez Del Amo, V., Bishop, A. L., S\u00e1nchez C, H. M., Bennett, J. B., Feng, X., Marshall, J. M., Bier, E., & Gantz, V. M. (2020). A transcomplementing gene drive provides a flexible platform for laboratory investigation and potential field deployment. Nature Communications, 11(1). https:\/\/doi.org\/10.1038\/s41467-019-13977-7 Ma, H., Tu, L.-C., Naseri, A., Huisman, M., Zhang, S., Grunwald, D., & Pederson, T. (2016). CRISPR-Cas9 nuclear dynamics and target recognition in living cells. J Cell Biol, 214(5), 529\u2013537. https:\/\/doi.org\/10.1083\/JCB.201604115 Marshall, J. M., Buchman, A., S\u00e1nchez, C. H. M., & Akbari, O. S. (2017). Overcoming evolved resistance to population-suppressing homing-based gene drives. Scientific Reports, 7(1), 1\u201312. https:\/\/doi.org\/10.1038\/s41598-017-02744-7 Marshall, J. M., Raban, R. R., Kandul, N. P., Edula, J. R., Le\u00f3n, T. M., & Akbari, O. S. (2019). Winning the tug-of-war between effector gene design and pathogen evolution in vector population replacement strategies. Frontiers in Genetics, 10(OCT), 1\u201312. https:\/\/doi.org\/10.3389\/fgene.2019.01072 Matthews, B. J., Dudchenko, O., Kingan, S. B., Koren, S., Antoshechkin, I., Crawford, J. E., Glassford, W. J., Herre, M., Redmond, S. N., Rose, N. H., Weedall, G. D., Wu, Y., Batra, S. S., Brito-Sierra, C. A., Buckingham, S. D., Campbell, C. L., Chan, S., Cox, E., Evans, B. R., \u2026 Vosshall, L. B. (2018). Improved reference genome of Aedes aegypti informs arbovirus vector control. Nature, 563(7732), 501\u2013507. https:\/\/doi.org\/10.1038\/s41586-018-0692-z McBride, C. S., Baier, F., Omondi, A. B., Spitzer, S. A., Lutomiah, J., Sang, R., Ignell, R. and Vosshall, L. B. (2014) Evolution of mosquito preference for humans linked to an odorant receptor. Nature, 515(7526): 222 \u2013 7. https:\/\/doi.org\/10.1038\/nature13964 McMeniman, C. J., Corfas, R. A., Matthews, B. J., Ritchie, S. A., & Vosshall, L. B. (2014). Multimodal integration of carbon dioxide and other sensory cues drives 94  mosquito attraction to humans. Cell, 156(5), 1060\u20131071. https:\/\/doi.org\/10.1016\/j.cell.2013.12.044 Miller, D. E., Cook, K. R., Arvanitakis, A. V., & Hawley, R. S. (2016a). Third chromosome balancer inversions disrupt protein-coding genes and influence distal recombination events in Drosophila melanogaster. G3: Genes, Genomes, Genetics, 6(7), 1959\u20131967. https:\/\/doi.org\/10.1534\/g3.116.029330 Miller, D. E., Cook, K. R., Kazemi, N. Y., Smith, C. B., Cockrell, A. J., Hawley, R. S., & Bergman, C. M. (2016b). Rare recombination events generate sequence diversity among balancer chromosomes in Drosophila melanogaster. Proceedings of the National Academy of Sciences of the United States of America, 113(10), E1352\u2013E1361. https:\/\/doi.org\/10.1073\/pnas.1601232113 Miller, D. E., Cook, K. R., & Scott Hawley, R. (2019). The joy of balancers. PLoS Genetics, 15(11), 1\u20138. https:\/\/doi.org\/10.1371\/journal.pgen.1008421 Moreira, L. A., Iturbe-Ormaetxe, I., Jeffery, J. A., Lu, G., Pyke, A. T., Hedges, L. M., Rocha, B. C., Hall-Mendelin, S., Day, A., Riegler, M., Hugo, L. E., Johnson, K. N., Kay, B. H., McGraw, E. A., van den Hurk, A. F., Ryan, P. A., & O\u2019Neill, S. L. (2009). A Wolbachia Symbiont in Aedes aegypti Limits Infection with Dengue, Chikungunya, and Plasmodium. Cell, 139(7), 1268\u20131278. https:\/\/doi.org\/10.1016\/j.cell.2009.11.042 Mota, M. B. S., Carvalho, M. A., Monteiro, A. N. A., & Mesquita, R. D. (2019). DNA damage response and repair in perspective: Aedes aegypti, Drosophila melanogaster and Homo sapiens. Parasites and Vectors, 12(1), 1\u201320. https:\/\/doi.org\/10.1186\/s13071-019-3792-1 Muller, H. J. (1918). Genetic Variability, Twin Hybrids and Constant Hybrids, in a Case of Balanced Lethal Factors. Genetics, 3(5), 422\u2013499. https:\/\/doi.org\/10.1093\/genetics\/3.5.422 Muron, S., Kucera, S., Oliver, B., & Benner, L. (2022). Creation of a new Drosophila melanogaster X chromosome balancer, First Multiple 8 (FM8), using the CRISPR\/Cas9 gene-editing system. MicroPublication Biology, 8(Muller 1918), 9\u201312. http:\/\/hpc.nih.gov Nambiar, T. S., Baudrier, L., Billon, P., & Ciccia, A. (2022). CRISPR-based genome editing through the lens of DNA repair. Molecular Cell, 82(2), 348\u2013388. https:\/\/doi.org\/10.1016\/j.molcel.2021.12.026 Nene, V., Wortman, J. R., Lawson, D., Haas, B., Kodira, C., Tu, Z., Loftus, B., Xi, Z., Megy, K., Grabherr, M., Ren, Q., Zdobnov, E. M., Lobo, N. F., Campbell, K. S., Brown, S. E., Bonaldo, M. F., Zhu, J., Sinkins, S. P., Hogenkamp, D. G., \u2026 95  Severson, D. W. (2007). Genome sequence of Aedes aegypti, a major arbovirus vector. Science, 316(5832), 1718\u20131723. https:\/\/doi.org\/10.1126\/science.1138878 Otte, M., Netschitailo, O., Kaftanoglu, O., Wang, Y., Page, R. E., & Beye, M. (2018). Improving genetic transformation rates in honeybees. Scientific Reports, 8(1), 1\u20136. https:\/\/doi.org\/10.1038\/s41598-018-34724-w Paix, A., Folkmann, A., Goldman, D. H., Kulaga, H., Grzelak, M. J., Rasoloson, D., \u2026 Seydoux, G. (2017). Precision genome editing using synthesis-dependent repair of Cas9-induced DNA breaks. Proceedings of the National Academy of Sciences of the United States of America, 114(50), E10745\u2013E10754. https:\/\/doi.org\/10.1073\/pnas.1711979114 Phuc, H., Andreasen, M. H., Burton, R. S., Vass, C., Epton, M. J., Pape, G., Fu, G., Condon, K. C., Scaife, S., Donnelly, C. A., Coleman, P. G., White-Cooper, H., & Alphey, L. (2007). Late-acting dominant lethal genetic systems and mosquito control. BMC Biology, 5, 1\u201311. https:\/\/doi.org\/10.1186\/1741-7007-5-11 Reid, W., Williams, A. E., Sanchez-Varga, I., Lin, J., Juncu, R., Olson, K. E., & Franz, A. W. E. (2022). Assessing single-locus CRISPR\/Cas9-based gene drive variants in the mosquito Aedes aegypti via single-generation crosses and modeling. G3: Genes, Genomes, Genetics, 12(12). https:\/\/doi.org\/10.1093\/g3journal\/jkac280 Ren, X., Sun, J., Housden, B. E., Hu, Y., Roesel, C., Lin, S., Liu, L. P., Yang, Z., Mao, D., Sun, L., Wu, Q., Ji, J. Y., Xi, J., Mohr, S. E., Xu, J., Perrimon, N., & Ni, J. Q. (2013). Optimized gene editing technology for Drosophila melanogaster using germ line-specific Cas9. Proceedings of the National Academy of Sciences of the United States of America, 110(47), 19012\u201319017. https:\/\/doi.org\/10.1073\/pnas.1318481110 Richardson, C. D., Ray, G. J., DeWitt, M. A., Curie, G. L., & Corn, J. E. (2016). Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA. Nature Biotechnology, 34(3), 339\u2013344. https:\/\/doi.org\/10.1038\/nbt.3481 Rozen-Gagnon, K., Yi, S., Jacobson, E., Novack, S., & Rice, C. M. (2021). A selectable, plasmid-based system to generate CRISPR\/Cas9 gene edited and knock-in mosquito cell lines. Scientific Reports, 11(1), 1\u201314. https:\/\/doi.org\/10.1038\/s41598-020-80436-5 Ryazansky, S.S., Chen, C., Potters, M., Naumenko, A. N., Lukyanchikova, V., Masri, R. A., Brusentosov, I. I., Karagodin, D. A., Yuchenko, A. A., dos Anjos, V. L., Haba, Y., Rose, N. H., Hoffman, J., Guo, R., Menna, T., Kelley, M., Ferrill, E., Schultz, K. E., Qi, Y., Sharma, A., Deschamps, S., Llaca, V., Mao, C., Murphy, T. D. \u2026 96  Sharakhova, M.V. (2024) The chromosome-scale genome assembly for the West Nile vector Culex quinquefasciatus uncovers patterns of genome evolution in mosquitoes. BMC Biol, 22, 16. https:\/\/doi.org\/10.1186\/s12915-024-01825-0 Savic, N., Ringnalda, F. C. A. S., Lindsay, H., Berk, C., Bargsten, K., Li, Y., Neri, D., Robinson, M. D., Ciaudo, C., Hall, J., Jinek, M., & Schwank, G. (2018). Covalent linkage of the DNA repair template to the CRISPR-Cas9 nuclease enhances homology-directed repair. ELife, 7, 1\u201318. https:\/\/doi.org\/10.7554\/eLife.33761 Scott, T. W., & Takken, W. (2012). Feeding strategies of anthropophilic mosquitoes result in increased risk of pathogen transmission. Trends in Parasitology, 28(3), 114\u2013121. https:\/\/doi.org\/10.1016\/j.pt.2012.01.001 Sekelsky, J. (2017). DNA repair in Drosophila: Mutagens, models, and missing genes. Genetics, 205(2), 471\u2013490. https:\/\/doi.org\/10.1534\/genetics.116.186759 Sentmanat, M. F., Peters, S. T., Florian, C. P., Connelly, J. P., & Pruett-Miller, S. M. (2018). A Survey of Validation Strategies for CRISPR-Cas9 Editing. Scientific Reports, 8(1), 1\u20138. https:\/\/doi.org\/10.1038\/s41598-018-19441-8 Shankar, S., Tauxe, G. M., Spikol, E. D., Li, M., Akbari, O. S., Giraldo, D., & McMeniman, C. J. (2021). Synergistic Coding of Carbon Dioxide and a Human Sweat Odorant in the Mosquito Brain. BioRxiv, 2020.11.02.365916. https:\/\/www.biorxiv.org\/content\/10.1101\/2020.11.02.365916v2%0Ahttps:\/\/www.biorxiv.org\/content\/10.1101\/2020.11.02.365916v2.abstract Shirai, Y., Piulachs, M. D., Belles, X., & Daimon, T. (2022). DIPA-CRISPR is a simple and accessible method for insect gene editing. Cell Reports Methods, 2(5), 100215. https:\/\/doi.org\/10.1016\/j.crmeth.2022.100215 Shirai, Y., Takahashi, M., Ote, M., Kanuka, H., & Daimon, T. (2023). DIPA-CRISPR gene editing in the yellow fever mosquito Aedes aegypti (Diptera: Culicidae). Applied Entomology and Zoology, 58(3), 273\u2013278. https:\/\/doi.org\/10.1007\/s13355-023-00831-y Song, F., & Stieger, K. (2017). Optimizing the DNA Donor Template for Homology-Directed Repair of Double-Strand Breaks. Molecular Therapy Nucleic Acids, 7(June), 53\u201360. https:\/\/doi.org\/10.1016\/j.omtn.2017.02.006 Srivastava, M., Nambiar, M., Sharma, S., Karki, S. S., Goldsmith, G., Hegde, M., Kumar, S., Pandey, M., Singh, R. K., Ray, P., Natarajan, R., Kelkar, M., De, A., Choudhary, B., & Raghavan, S. C. (2012). An inhibitor of nonhomologous end-joining abrogates double-strand break repair and impedes cancer progression. Cell, 151(7), 1474\u20131487. https:\/\/doi.org\/10.1016\/j.cell.2012.11.054 97  Stern, D. L. (2022). Transgenic tools for targeted chromosome rearrangements allow construction of balancer chromosomes in non-melanogaster Drosophila species. G3: Genes, Genomes, Genetics, 12(4). https:\/\/doi.org\/10.1093\/g3journal\/jkac030 Sternberg, S. H., Redding, S., Jinek, M., Greene, E. C., & Doudna, J. A. (2014). DNA interrogation by the CRISPR RNA-guided endonuclease Cas9. Nature, 507: 62-67. https:\/\/doi.org\/ 10.1038\/nature13011 Sun, D., Guo, Z., Liu, Y., & Zhang, Y. (2017). Progress and prospects of CRISPR\/Cas systems in insects and other arthropods. Frontiers in Physiology, 8(SEP), 1\u201322. https:\/\/doi.org\/10.3389\/fphys.2017.00608 Sun, P., Nie, K., Zhu, Y., Liu, Y., Wu, P., Liu, Z., Du, S., Fan, H., Chen, C. H., Zhang, R., Wang, P., & Cheng, G. (2020). A mosquito salivary protein promotes flavivirus transmission by activation of autophagy. Nature Communications, 11(1), 1\u201315. https:\/\/doi.org\/10.1038\/s41467-019-14115-z Suzuki, H., Saba, R., Sada, A. & Saga, Y. (2010). The Nanos3-3'UTR is required for germ cell specific NANOS3 expression in mouse embryos. PLoS One, 18, 5(2):e9300. https:\/\/doi.org\/10.1371\/journal.pone.0009300 Tang, X. D., Gao, F., Liu, M. J., Fan, Q. L., Chen, D. K., & Ma, W. T. (2019). Methods for enhancing clustered regularly interspaced short palindromic repeats\/Cas9-mediated homology-directed repair efficiency. Frontiers in Genetics, 10(JUN). https:\/\/doi.org\/10.3389\/fgene.2019.00551 Taning, C. N. T., Van Eynde, B., Yu, N., Ma, S., & Smagghe, G. (2017). CRISPR\/Cas9 in insects: Applications, best practices and biosafety concerns. Journal of Insect Physiology, 98, 245\u2013257. https:\/\/doi.org\/10.1016\/j.jinsphys.2017.01.007 Tantowijoyo, W., Tanamas, S. K., Nurhayati, I., Setyawan, S., Budiwati, N., Fitriana, I., Ernesia, I., Wardana, D. S., Supriyati, E., Arguni, E., Meitika, Y., Prabowo, E., Andari, B., Green, B. R., Hodgson, L., Ranc\u00e8s, E., Ryan, P. A., O\u2019neill, S. L., Anders, K. L., \u2026 Simmons, C. P. (2022). Aedes aegypti abundance and insecticide resistance profiles in the Applying Wolbachia to Eliminate Dengue trial. PLoS Neglected Tropical Diseases, 16(4), 1\u201316. https:\/\/doi.org\/10.1371\/journal.pntd.0010284 Tazuke, S. I., Schulz, C., Gilboa, L., Fogarty, M., Mahowald, A. P., Guichet, A., Ephrussi, A., Wood, C. G., Lehmann, R., Fuller, M. T., Biologie, L. De, & Monod, I. J. (2002). 2002Cancer Y Cx43. 2539, 2529\u20132539. Terradas, G., Buchman, A. B., Bennett, J. B., Shriner, I., Marshall, J. M., Akbari, O. S., & Bier, E. (2021). Inherently confinable split-drive systems in Drosophila. Nature Communications, 12(1). https:\/\/doi.org\/10.1038\/s41467-021-21771-7 98  Timoshevskiy, V. A., Kinney, N. A., deBruyn, B. S., Mao, C., Tu, Z., Severson, D. W., Sharakhov, I. V., & Sharakhova, M. V. (2014). Genomic composition and evolution of Aedes aegypti chromosomes revealed by the analysis of physically mapped supercontigs. BMC Biology, 12, 1\u201313. https:\/\/doi.org\/10.1186\/1741-7007-12-27 Timoshevskiy, V. A., Severson, D. W., deBruyn, B. S., Black, W. C., Sharakhov, I. V., & Sharakhova, M. V. (2013). An Integrated Linkage, Chromosome, and Genome Map for the Yellow Fever Mosquito Aedes aegypti. PLoS Neglected Tropical Diseases, 7(2). https:\/\/doi.org\/10.1371\/journal.pntd.0002052 Turner, J., Krishna, R., Van\u2019T Hof, A. E., Sutton, E. R., Matzen, K., & Darby, A. C. (2018). The sequence of a male-specific genome region containing the sex determination switch in Aedes aegypti. Parasites and Vectors, 11(1), 3\u20137. https:\/\/doi.org\/10.1186\/s13071-018-3090-3 Vinogradova, E. B. (2007). Diapause in Aquatic Insects, with Emphasis on Mosquitoes. Diapause in Aquatic Invertebrates Theory and Human Use, 1987, 83\u2013113. https:\/\/doi.org\/10.1007\/978-1-4020-5680-2_5 Wakiyama, M., Matsumoto, T. & Yokoyama, S. (2005) Drosophila U6 Promoter-driven Short Hairpin RNAs Effectively Induce RNA Interference in Shneider 2 Cells, Biochemical and Biophysical Research Communications, 331(4), 1163-1170. https:\/\/doi.org\/10.1016\/j.bbrc.2005.03.240 Wang, G., Gamez, S., Raban, R. R., Marshall, J. M., Alphey, L., Li, M., Rasgon, J.L.  Akbari, O. S. (2021) Combating Mosquito-borne Diseases Using Genetic Control Technologies. Nature Communications, 12(4388). https:\/\/doi.org\/10.1038\/s41467-021-24654-z Wang, H., Yang, H., Shivalila, C. S., Dawlaty, M. M., Cheng, A. W., & Zhang, F. (2013). Resource One-Step Generation of Mice Carrying Mutations in Multiple Genes by CRISPR \/ Cas-Mediated Genome Engineering. https:\/\/doi.org\/10.1016\/j.cell.2013.04.025 Wendt, K. E., Ungerer, J., Cobb, R. E., Zhao, H., & Pakrasi, H. B. (2016). CRISPR\/Cas9 mediated targeted mutagenesis of the fast growing cyanobacterium Synechococcus elongatus UTEX 2973. Microbial Cell Factories, 15(1), 1\u20138. https:\/\/doi.org\/10.1186\/s12934-016-0514-7 Wohl, M. P., & McMeniman, C. J. (2023). Batch Rearing Aedes aegypti. Cold Spring Harbor Protocols, 2023(3), 172\u2013181. https:\/\/doi.org\/10.1101\/pdb.prot108017 Xue, W., Chen, S., Yin, H., Tammela, T., Papagiannakopoulos, T., Joshi, N. S., \u2026 Jacks, T. (2014). CRISPR-mediated direct mutation of cancer genes in the mouse liver. Nature, 514(7522), 380\u2013384. https:\/\/doi.org\/10.1038\/nature13589 99  Yang, D., Scavuzzo, M. A., Chmielowiec, J., Sharp, R., Bajic, A., & Borowiak, M. (2016). Enrichment of G2\/M cell cycle phase in human pluripotent stem cells enhances HDR-mediated gene repair with customizable endonucleases. Scientific Reports, 6(January), 1\u201315. https:\/\/doi.org\/10.1038\/srep21264 Yu, Guangchuang, (2023). Scatterpie. GitHub repository. https:\/\/github.com\/GuangchuangYu\/scatterpie Zhan, Y., Alberto, D. A. S., Rush, C., Riffell, J. A. and Montell, C. (2021) Elimination of vision-guided target attraction in Aedes aegypti using CRISPR. Current Biology, (31), 4180 \u2013 4187. https:\/\/doi.org\/10.1016\/j.cub.2021.07.003 Zhao, Z., Tian, D. & McBride, C. S. (2021) Development of a Pan-neuronal Genetic Driver in Aedes aegypti mosquitoes. Cell Reports Methods, 1(100042). https:\/\/doi.org\/10.1016\/j.crmeth.2021.100042     100  Appendix  Supplementary Figure 1. Scatterpie chart showing distribution of larval expression in G6s. \u201cType\u201d refers to the fluorescence expression of larvae: \u201call\u201d stands for red body, red eye and blue eye fluorescence; \u201cbody\u201d stands for red body fluorescence from exuCas9 only; \u201ceye\u201d stands for red and blue eye fluorescence from TC integration only; \u201cred eye\u201d stands for red eye fluorescence from possible HDR event only; \u201cwt\u201d stands for wildtype without any fluorescence.    101  Supplementary Table 1. Primer sequences used in Chapter 2, 3 and 4 Chapter 2 primers Sequence (5\u2019-3\u2019) sgRNAw (IR8a) GGTGCGATCTTGACCCCCGGAGG   Chapter 3 primers Sequence (5\u2019-3\u2019) Gibson U6 sgRNA fwd GATCAATTCGTTAACAGATCGAATGAAATCGCCCATCG Gibson U6 sgRNA rev GACGAACACAAAAAAAGCACCGACTCGG Gibson donor fwd GTGCTTTTTTTGTGTTCGTCGGATTTCG Gibson donor rev GCCGCAGATCAGTGTCGATCCCGTATGAAATTATC Gibson pBAC fwd GATCGACACTGATCTGCGGCCGCGGCTC Gibson pBAC rev GATCTGTTAACGAATTGATCCCCCGATCTGTTAAC Ppk301 Larm Fwd GTGAGGGTGGTGTCGAATTAACTCTT Ppk301 Rarm Rev CCAGCTCAAAGTCCAAAAACGAAACC Cutcheck Fwd TCACAGTATGGTGGAAGCTTGT Cutcheck Rev CTAGAACGACCGTGAGACCC L arm Fwd CTGGACATCACCTCCCACAAC L arm Rev CCTGTTTCTGGCGTCCATTC R arm Fwd GCTACTCAACCGTGTCACAG R arm Rev GCTGTATTCCGTCGCATTTCTC Ppk301 sgRNA GGTTGGCAGTTGAGTCCCGG   Chapter 4 primers Sequence (5\u2019-3\u2019) F1 sgRNA AACGTGTACAGATCCGTTCG F2 sgRNA CAGGCACGAGATGACCAGCG F3 sgRNA GGATCTGGAGCTGTACGACG R1 sgRNA CGTGTGCAACATCTCCGATG R2 sgRNA TTCTGCAGACGGATACACCG R3 sgRNA ACCCCAACCAGAGATGTCCA V1 sgRNA TGCGAACACGAAACGCACCT V2 sgRNA CAGTAAGGACGTGAAACGGG V3 sgRNA TAGTAGGCGTTGCCTTCCAG Y1 sgRNA GTACCCGACTGGGAGCAGGGTGG Y2 sgRNA TGTGTACCCGACTGGGAGCA 102  Y98 sgRNA GGCCAGTCACCGTGAATTCA F1 seq Fwd CGGAGGATAAGCTGCATACTTT F1 seq Rev TCATTTTGTTGCTCACCATCTT F2 seq fwd GAACGGATCTGTACACGTTCAA F2 seq Rev TCATTTTGTTGCTCACCATCTT F3 seq Fwd TACAACGATCGCTACAATCAGG F3 seq Rev TCCTCGTTAATATCCGAGGTGT R1 seq Fwd CCAGTGCAACAAGACCAACTAC R1 seq Rev AACCGTCCTACTTCAAGGAACA R2 seq Fwd CCAAGTTTACGATCTCCCTGAC R2 seq Rev TTCCGTTCTGTTCGCTATTGTA R3 seq Fwd CATCACCGATACGAGACAGGTA R3 seq Rev AAGTAGACCCCCAGACTTCGAT V1 seq Fwd GCATGGCTAATTGGTTCAAGAT V1 seq Rev CTTGCTTTGTGCACTTGAAATC V2 seq Fwd GCTGGTCCTGATCAGTGTTTTT V2 seq Rev CTTAGGTTGAAGCGAAGGTCTC V3 seq Fwd GATTTCAAGTGCACAAAGCAAG V3 seq Rev CCTTACTGATGACGTTGTAGCG Y1 seq Fwd TGGACTACAGCGATGTCAACTT Y1 seq Rev CTGTGTACTTGGTGACAGGGG Y2 seq Fwd TGGACTACAGCGATGTCAACTT Y2 seq Rev CTGTGTACTTGGTGACAGGGG Y98 seq Fwd CGGTTCGAGCATAGTTTCTTCT Y98 seq Rev GGTGAACTTGTGGAAGCTCTCT    103  Supplementary Table 2. Number of hatched G0s and Number of transient larvae in Chapter 2 Helper Plasmid. Egg and larvae counted over multiple injection events for helper strain and exuCas9 strain. Number of transients refers to larvae with tail transient expression. Rates were counted as hatched larvae or transient expression larvae over total number of larvae.     IR8a sg1w gRNA\/Donor > exu-Cas9 strainNumber of eggsNumber of LarvaeHatch rate (%)Number of transientNumer of non-transientTransient rate (%)1 127 36 28% 14 22 39%2 111 17 15% 15 2 88%3 127 44 35% 15 29 34%4 137 37 27% 26 11 70%5 98 7 7% 3 4 43%6 83 19 23% 9 10 47%Total 683 160 23.43% 82 78 51%IR8a sg1w gRNA\/Donor + Nos helper > LVPib12Number of eggsNumber of LarvaeHatch rate (%)Number of transientNumer of non-transientTransient rate (%)1 100 25 25% 12 13 48%2 119 25 21% 13 12 52%3 169 62 37% 31 31 50%4 104 17 16% 4 13 24%Total 492 129 26.22% 60 69 47%IR8a sg1w gRNA\/Donor + Zpg helper > LVPib12Number of eggsNumber of LarvaeHatch rate (%)Number of transientNumer of non-transientTransient rate (%)1 101 24 24% 8 16 33%2 113 40 35% 7 33 18%3 204 54 26% 9 45 17%4 25 1 4% 0 1 0%Total 443 119 26.86% 24 95 20%104  Supplementary Table 3. Count for larval expression pattern in generation of transgenic G1s from exuCas9 G0 founders.   Cross Eggs Hatched DsRed + CFP - DsRed + CFP + Tail DsRed Body DsRed hatch rate (%)positive rate (%)1 62 15 0 0 0 0 24.19 0.02 117 24 0 0 0 0 20.51 0.03 98 11 5 0 0 4 11.22 45.54 112 4 0 0 0 0 3.57 0.05 N\/A N\/A N\/A N\/A N\/A N\/A N\/A N\/A6 92 17 6 0 4 3 18.48 35.37 N\/A N\/A N\/A N\/A N\/A N\/A N\/A N\/A8 21 3 2 0 2 0 14.29 66.79 N\/A N\/A N\/A N\/A N\/A N\/A N\/A N\/A10 78 2 0 0 0 0 2.56 0.011 57 0 0 0 0 0 0.00 N\/A12 114 35 0 0 0 33 30.70 0.013 117 10 0 0 0 5 8.55 0.014 111 2 0 0 0 0 1.80 0.015 44 1 0 0 0 0 2.27 0.016 116 7 0 0 0 4 6.03 0.017 114 4 0 0 0 2 3.51 0.018 118 33 0 0 0 28 27.97 0.019 137 65 0 0 0 65 47.45 0.020 103 5 0 0 0 2 4.85 0.021 122 7 0 0 0 7 5.74 0.022 127 1 0 0 0 1 0.79 0.023 13 0 0 0 0 0 0.00 N\/A24 117 6 0 0 0 4 5.13 0.025 111 1 0 0 0 0 0.90 0.026 78 4 0 0 0 2 5.13 0.027 N\/A N\/A N\/A N\/A N\/A N\/A N\/A N\/A28 109 27 0 0 0 18 24.77 0.029 130 7 0 0 0 3 5.38 0.030 125 15 0 0 0 10 12.00 0.031 143 24 0 0 0 24 16.78 0.032 N\/A N\/A N\/A N\/A N\/A N\/A N\/A N\/A33 73 0 0 0 0 0 0.00 N\/A34 70 1 0 0 0 1 1.43 0.035 85 6 0 0 0 6 7.06 0.036 102 1 0 0 0 1 0.98 0.037 76 0 0 0 0 0 0.00 N\/A38 91 16 0 0 0 15 17.58 0.039 146 10 0 0 0 10 6.85 0.040 140 21 0 0 0 21 15.00 0.041 N\/A N\/A N\/A N\/A N\/A N\/A N\/A N\/A42 N\/A N\/A N\/A N\/A N\/A N\/A N\/A N\/A43 N\/A N\/A N\/A N\/A N\/A N\/A N\/A N\/A44 N\/A N\/A N\/A N\/A N\/A N\/A N\/A N\/A45 65 14 0 0 0 14 21.54 0.046 91 25 0 0 0 25 27.47 0.047 140 18 0 0 0 17 12.86 0.048 N\/A N\/A N\/A N\/A N\/A N\/A N\/A N\/A49 130 12 0 0 0 12 9.23 0.050 124 1 0 0 0 0 0.81 0.051 136 6 0 0 0 1 4.41 0.052 108 3 0 0 0 0 2.78 0.053 78 0 0 0 0 0 0.00 0.054 104 17 0 0 0 13 16.35 0.055 N\/A N\/A N\/A N\/A N\/A N\/A N\/A N\/A56 151 11 0 0 0 11 7.28 0.057 N\/A N\/A N\/A N\/A N\/A N\/A N\/A N\/A58 100 36 0 0 0 33 36.00 0.059 N\/A N\/A N\/A N\/A N\/A N\/A N\/A N\/A60 N\/A N\/A N\/A N\/A N\/A N\/A N\/A N\/A61 139 28 0 0 0 24 20.14 0.062 N\/A N\/A N\/A N\/A N\/A N\/A N\/A N\/A63 111 4 0 0 0 2 3.60 0.0105  Supplementary Table 4. Identity of parental crosses in Supplementary Table 3.   Supplementary Table 5. Larval expression pattern and number of hatch in G4s. G4s are named as follows: G4, Female\/Male which is the sex of the G3 parent and  F\/M which is the sex of the G2 parent, followed by the number of this offspring           G0 parent identity Crossnon dsRed , Transient G0 male (4) x WT female (20) 1-10dsRed , Transient G0 male (27) x WT female (50) 11-38dsRed , Transient G0 female (22) x WT male (50) 39-57non dsRed , Transient G0 female (9) x WT male (50) 58-63G4 identity all + body eye WT Number of hatchG4 Male F1 8 7 6 9 30G4 Male F2 9 16 7 1 33G4 Female F5 44 39 0 0 83G4 Male M13 6 24 4 0 34G4 Male M2 2 1 7 4 14G4 Male M1 17 18 0 0 35G4 Female M5 1 1 0 0 2G4 Female M4 18 28 4 4 54G4 Female F7 7 18 12 9 46106  Supplementary Table 6. Larval expression pattern in G5s. Besides phenotypes previously mentioned,\u201d adults\u201d refer to larvae that have already emerged as adult and di not show specific fluorescence pattern; \u201cthorax green\u201d refers to green fluorescence patterns in the thorax of larvae; \u201cblue tail\u201d refers to blue fluorescence in the tail area of larvae; hatch rate was calculated by total number of larvae divided by number of eggs. Naming of G5 identity include name of G5 and parent identity shown in brackets.   G5 identity eye all + WT body + adults thorax green blue tail special total # of eggs hatch rate R1M5 (G4mF2all+) 5 5 7 3 0 0 0 0 20 31 0.65R1F7 (G4mF2all+) 12 11 21 13 0 0 0 0 57 106 0.54R1F14 (G4fF5all+) 5 5 3 10 0 0 0 0 23 32 0.72R2F3 (G4fF5all+) 8 8 7 12 0 0 0 0 35 42 0.83R2M11 (G4mM1 all+) 0 7 2 3 0 0 0 0 12 32 0.38R2F21 (G4mM1all+) 5 15 9 23 0 0 0 0 52 54 0.96R1F3 (EG4MF1) 30 0 11 0 0 17 0 0 58 66 0.88R1F17 (G4mM2all+) 10 19 17 18 0 1 0 0 65 115 0.57R2F7 (G4mM2all+) 10 8 8 12 0 6 0 0 44 83 0.53R2M2 (EG4mF2) 3 0 7 0 0 0 0 1 11 31 0.35R2F9 (EG4mM2) 7 0 10 0 0 0 0 0 17 30 0.57R3F1 (G4mF1) 6 11 1 10 0 1 0 0 29 71 0.41R3M4 (G4fM5) 3 5 3 4 0 0 0 0 15 31 0.48R3F2 (G4mM13) 20 11 10 10 0 1 0 0 52 65 0.80R2M1 (G4mF2) 2 2 0 0 0 0 0 0 4 40 0.10R2M18 (G4mF2) 5 8 0 12 0 1 0 1 27 37 0.73R2F4 (G4fF5) 0 0 0 0 0 0 0 0 0 13 0.00R2M19 (G4mF2) 3 6 1 7 1 0 0 0 18 30 0.60R2F13 (G4mM1) 0 2 0 2 2 0 0 0 6 11 0.55R2F14 (G4mM1) 2 10 0 8 1 0 0 0 21 57 0.37R2F15 (G4mM1) 4 15 1 18 0 0 0 0 38 42 0.90R2F8 (G4mM2) 18 23 13 6 0 0 0 0 60 94 0.64R4F14 (G4fM4) 0 0 0 0 0 0 0 0 0 71 0.00R4F15 (G4fM4) 0 0 0 0 0 0 0 0 0 96 0.00R4F17 (G4fF7) 12 17 8 8 3 2 0 0 50 76 0.66R4F20 (EG4fF7) 30 0 12 0 0 15 0 0 57 142 0.40R2F17 (G4mM1) 6 24 3 25 3 9 0 0 70 93 0.75R3F3 (EG4M13) 21 6 5 20 0 12 3 0 67 88 0.76R4M11 (EG4M13) 11 3 4 2 7 0 0 0 27 35 0.77R5F3 (EG4M4) 27 0 10 0 0 14 0 0 51 91 0.56R7M5 (EG4M4) 9 0 11 0 0 0 2 0 22 66 0.33R4F2 (EG4F1) 8 0 1 0 5 0 0 0 14 19 0.74R4F3 (EG4F1) 0 0 17 0 0 7 0 0 24 51 0.47R4F19 (G4mF2) 7 7 6 9 0 3 0 0 32 63 0.51R4F4 (G4fF5) 0 0 0 0 0 0 0 0 0 35 0.00R4F6 (G4fF5) 0 0 0 0 0 0 0 0 0 70 0.00R4F18 (G4fF7) 17 11 12 18 0 12 0 0 70 86 0.81R5M4 (EG4fF7) 14 0 20 0 0 7 0 2 43 47 0.91R5M6 (EG4fF7) 17 0 3 0 0 5 2 0 27 46 0.59R4F7 (G4fF5) 0 2 9 1 0 3 0 0 15 33 0.45R4F8 (G4fF5) 7 6 6 13 0 1 0 1 34 56 0.61R4F10 (G4fF5) 2 7 7 8 0 0 0 0 24 62 0.39R5F2 (G4fM4) 9 2 10 1 0 0 0 0 22 36 0.61R5M7 (EG4fF7) 20 0 15 0 0 0 0 0 35 43 0.81R7M1 (G4fM4) 8 13 14 5 0 0 0 0 40 96 0.42R7M2 (G4fM4) 11 13 16 14 0 0 0 0 54 90 0.60R6M2 (G4fF7) 11 6 6 11 0 0 0 0 34 62 0.55R6M3 (G4fF7) 8 4 12 10 0 2 0 0 36 40 0.90R6M4 (G4fF7) 22 12 17 14 0 0 0 0 65 87 0.75R5F8 (EG4fF7) 22 14 23 9 0 2 0 0 70 93 0.75R5F9 (EG4fF7) 4 20 11 25 0 4 0 0 64 131 0.49R6F5 (EG4fF7) 26 0 23 0 0 3 0 0 52 152 0.34R7M4 (EG4fF7) 27 1 22 0 0 0 0 0 50 89 0.56107  Supplementary Table 7. Larval expression pattern of G6s. Explanation of the phenotypes can be referred to Supp. Table 6.    G6 identity red eyes eyes all + WT body + adult (N\/A) thorax green blue tail special total # of eggs hatch rate R3F1 all+ M 0 12 13 9 13 0 3 0 0 48 88 0.55R2F3 all+ F 0 0 0 0 0 0 0 0 0 0 45 0.00R1F14 all+ F 0 0 0 0 0 0 0 0 0 0 40 0.00R1M5 all+ F 0 4 11 8 3 0 0 0 0 26 26 1.00R2F17 all+ F 0 1 8 1 5 0 0 0 1 16 66 0.24R3F3 all+ M 0 21 21 14 10 0 9 0 0 75 136 0.55R5F2 all+ F 0 5 2 3 4 0 3 0 0 16 161 0.10R4F17 all+ M 0 0 0 0 0 0 0 0 0 0 37 0.00R4F8 all+ M 0 6 10 6 15 0 3 0 0 40 91 0.44R3F13 all+ F 0 4 18 2 4 0 1 0 0 29 117 0.25R4F18 all+ F 0 3 0 1 4 0 2 1 0 12 14 0.86R7M1 all+ inbred 0 3 12 0 5 0 1 0 0 21 272 0.08R7M1 all+ M 0 20 2 14 3 0 0 0 0 39 47 0.83R7M1 all+ F 0 28 16 21 17 0 1 0 0 83 174 0.48R2F13 all+ F 0 4 12 4 11 0 0 0 0 29 43 0.67R3M4 all+ F 0 9 11 28 24 0 1 0 0 73 197 0.37R3M4 all+ M 0 16 13 11 8 0 0 0 0 48 48 1.00R1F7 all+ F 0 0 0 1 0 0 0 0 0 1 25 0.04R1F7 all+ M 0 0 0 16 12 0 0 0 0 28 28 1.00R2M18 all+ F 0 0 0 0 0 0 0 0 0 0 32 0.00R3F2 all+ F 0 9 9 7 9 0 2 0 0 36 135 0.27R3F2 all+ M 0 10 12 4 16 0 6 0 0 48 72 0.67R1F14 all+ M 0 0 0 27 0 0 0 0 0 0 37 0.00R6M4 all+ F 1 27 12 35 12 0 3 0 0 86 196 0.44R6M4 all+ M 0 7 7 8 2 0 3 0 0 27 138 0.20R6M2 all+ F 1 1 4 4 5 0 0 0 0 15 120 0.13R7M2 all+ F 0 3 7 4 7 0 1 0 0 22 146 0.15R7M2 all+ M 0 6 4 4 5 0 0 0 0 19 125 0.15108  Supplementary Table 8. Injection of mix of sgRNA in exuCas9 to validate their activity.   Supplementary Table 9. Number of eggs hatched and subsequently gave yellow eggs during outcross for injection of bi-genic templates to generate chromosomal inversion.    Supplementary Table 10. ssODN template sequences used for yellow and V2 ssODN Sequence (5\u2019-3\u2019) ssODN1 TACGCTGGAGCGGCTGTGTACTTGGTGACAGGGGCAACGGTTGGGGCGTACGAGGACGGGGTATAGCTGATGGGTTGTGTGTACCCGACTGGGAGCAGGGCTGGAAGGCAACGCCTACTATGGGCGACGCATCCGTGGTGGCGGTAACAGTGCCAACCGCATGGTATACCCCAACGAAAATGAACGCTACAACGTCATCA ssODN2 TACGCTGGAGCGGCTGTGTACTTGGTGACAGGGGCAACGGTTGGGGCGTACGAGGACGGGGTATAGCTGATGGGTTGTGTGTACCCGACTGGGAGCAGGGCTGGAAGGCAACGCCTACTATGGGCGACGCATCCGTGGTGGCGGTAACAGTGCCAACCGCATGGTATACCCCAACGAAAATGAACGCTACAACGTCATCA  ExuCas9Eggs injectedLarvae hatchedPupae collectedHatch rate (%)IdentitysgRNA mix 1 50 11 9 22 Y98 R1 F1 V1sgRNA mix 2 50 21 18 42 Y1 R2 F2 V2sgNRA mix 3 50 19 15 38 Y2 R3 F3 V3sgRNA mix 2 repeat 50 4 0 8 Y1 R2 F2 V2sgNRNA mix 3 repeat 25 0 0 0 Y2 R3 F3 V3Total 225 55 42Average 22Injection Number Eggs injected Hatch Survive to adulthood Hatch Rate (%) Yellow Eggs Transgenic Rate (%)1 100 14 14 14.00 4 0.292 50 1 1 2.00 0 03 56 1 1 1.79 1 14 47 1 0 2.13 0 N\/A5 100 2 0 2.00 0 N\/A6 100 29 29 29.00 6 0.217 106 10 0 9.43 0 N\/ATotal 559 58 45 11 0.24","type":"literal","lang":"en"}],"http:\/\/www.europeana.eu\/schemas\/edm\/hasType":[{"value":"Thesis\/Dissertation","type":"literal","lang":"en"}],"http:\/\/vivoweb.org\/ontology\/core#dateIssued":[{"value":"2024-05","type":"literal","lang":"en"}],"http:\/\/www.europeana.eu\/schemas\/edm\/isShownAt":[{"value":"10.14288\/1.0441427","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/language":[{"value":"eng","type":"literal","lang":"en"}],"https:\/\/open.library.ubc.ca\/terms#degreeDiscipline":[{"value":"Zoology","type":"literal","lang":"en"}],"http:\/\/www.europeana.eu\/schemas\/edm\/provider":[{"value":"Vancouver : University of British Columbia Library","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/publisher":[{"value":"University of British Columbia","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/rights":[{"value":"Attribution-NonCommercial-NoDerivatives 4.0 International","type":"literal","lang":"*"}],"https:\/\/open.library.ubc.ca\/terms#rightsURI":[{"value":"http:\/\/creativecommons.org\/licenses\/by-nc-nd\/4.0\/","type":"literal","lang":"*"}],"https:\/\/open.library.ubc.ca\/terms#scholarLevel":[{"value":"Graduate","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/contributor":[{"value":"Matthews, Benjamin J., 1983-","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/title":[{"value":"Strategies for improving the genetic toolbox in Aedes aegypti mosquito","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/type":[{"value":"Text","type":"literal","lang":"en"}],"https:\/\/open.library.ubc.ca\/terms#identifierURI":[{"value":"http:\/\/hdl.handle.net\/2429\/87868","type":"literal","lang":"en"}]}}