{"http:\/\/dx.doi.org\/10.14288\/1.0392684":{"http:\/\/vivoweb.org\/ontology\/core#departmentOrSchool":[{"value":"Medicine, Faculty of","type":"literal","lang":"en"},{"value":"Medicine, Department of","type":"literal","lang":"en"}],"http:\/\/www.europeana.eu\/schemas\/edm\/dataProvider":[{"value":"DSpace","type":"literal","lang":"en"}],"https:\/\/open.library.ubc.ca\/terms#degreeCampus":[{"value":"UBCV","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/creator":[{"value":"Samiea, Abrar","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/issued":[{"value":"2020-08-10T21:05:05Z","type":"literal","lang":"en"},{"value":"2020","type":"literal","lang":"en"}],"http:\/\/vivoweb.org\/ontology\/core#relatedDegree":[{"value":"Doctor of Philosophy - PhD","type":"literal","lang":"en"}],"https:\/\/open.library.ubc.ca\/terms#degreeGrantor":[{"value":"University of British Columbia","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/description":[{"value":"Interleukin-10 (IL10) is best studied for its anti-inflammatory action on immune cells including macrophages, but it also exerts littler known effects on non-immune cells such as prostate cancer (PCa) epithelial cells.  In this thesis I examined the contribution of an IL10-induced protein called EP4 on IL10 inhibition of macrophage activation, as well as the ability of IL10 to stimulate expression of proteins in PCa cells which are associated with tumour progression.  \r\n Macrophages sense molecules on pathogens such as lipopolysaccharide (LPS) and respond by producing inflammatory cytokines including TNF\u03b1 and other mediators which coordinate the host defense against the pathogen.  IL10 is produced as part of the resolution (anti-inflammatory) phase of inflammation.  IL10 receptor (IL10R) signalling in macrophages involves the STAT3 transcription factor and the SHIP1 inositol phosphatase which work together to support the expression of genes involved in the anti-inflammatory response.  I report here that IL10 upregulates the expression of prostaglandin E2 (PGE2) receptor EP4.  The EP4 receptor has previously been shown to mediate PGE2\u2019s anti-inflammatory action.  Knockdown of EP4 impaired IL10\u2019s ability to inhibit LPS-induced signalling events and TNF\u03b1 production.  I propose that part of the IL10 anti-inflammatory effect on macrophages may thus be mediated through LPS-induced, autocrine PGE2, binding to IL10-induced EP4.  \r\nThe direct effect of IL10 on epithelial cancer cells has not been well studied.  Serum levels of IL10 increase in PCa patients as their tumours progress, and this is thought to contribute to the suppressed immune system observed in these patients.  PCa patients are treated with androgen antagonists such as enzalutamide (ENZ) to inhibit androgen receptor dependent PCa cell growth. Development of ENZ resistance is associated with tumour differentiation to a more aggressive neuroendocrine phenotype.  I found that IL10 like ENZ, induce markers of neuroendocrine differentiation and inhibit androgen receptor reporter activity in PCa cells.  Both also upregulated the levels of PDL1 (CD274) which would promote tumour survival in vivo through its interaction with the immune cell inhibitory receptor PD1 to suppress an anti-tumour immunity.  These findings suggest that IL10\u2019s direct action on PCa cells contributes to PCa progression independent of IL10\u2019s suppression of host immune cells.","type":"literal","lang":"en"}],"http:\/\/www.europeana.eu\/schemas\/edm\/aggregatedCHO":[{"value":"https:\/\/circle.library.ubc.ca\/rest\/handle\/2429\/75412?expand=metadata","type":"literal","lang":"en"}],"http:\/\/www.w3.org\/2009\/08\/skos-reference\/skos.html#note":[{"value":"       The effect of Interleukin-10 on macrophage activation and prostate cancer cell phenotype   by  Abrar Samiea  B.Sc, Umm Al-Qura University, 2007 M.Sc, Laurentian University, 2012    A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY  in The Faculty of Graduate and Postdoctoral Studies  (Experimental Medicine)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) July 2020 \u00a9 Abrar Samiea, 2020       ii  The following individuals certify that they have read, and recommend to the Faculty of Graduate and Postdoctoral Studies for acceptance, the dissertation entitled:  The effect of interleukin-10 on macrophage activation and prostate cancer cell phenotype  submitted by Abrar Samiea  in partial fulfillment of the requirements for the degree of Doctor of philosophy  in Experimental Medicine  Examining Committee: Dr. Alice Mui, Associate Professor, Department of Surgery, UBC Supervisor  Dr. Vincent Duronio, Professor, Department of Medicine, UBC Supervisory Committee Member  Dr. Laura Sly, Associate Professor, Department of Pediatrics, UBC University Examiner Dr. Marcel Bally, Professor, Experimental Therapeutics, UBC University Examiner   Additional Supervisory Committee Members: Dr. Neil Reiner, Professor, Department of Medicine, UBC Supervisory Committee Member       iii   Abstract Interleukin-10 (IL10) is best studied for its anti-inflammatory action on immune cells including macrophages, but it also exerts littler known effects on non-immune cells such as prostate cancer (PCa) epithelial cells.  In this thesis I examined the contribution of an IL10-induced protein called EP4 on IL10 inhibition of macrophage activation, as well as the ability of IL10 to stimulate expression of proteins in PCa cells which are associated with tumour progression.    Macrophages sense molecules on pathogens such as lipopolysaccharide (LPS) and respond by producing inflammatory cytokines including TNF\u03b1 and other mediators which coordinate the host defense against the pathogen.  IL10 is produced as part of the resolution (anti-inflammatory) phase of inflammation.  IL10 receptor (IL10R) signalling in macrophages involves the STAT3 transcription factor and the SHIP1 inositol phosphatase which work together to support the expression of genes involved in the anti-inflammatory response.  I report here that IL10 upregulates the expression of prostaglandin E2 (PGE2) receptor EP4.  The EP4 receptor has previously been shown to mediate PGE2\u2019s anti-inflammatory action.  Knockdown of EP4 impaired IL10\u2019s ability to inhibit LPS-induced signalling events and TNF\u03b1 production.  I propose that part of the IL10 anti-inflammatory effect on macrophages may thus be mediated through LPS-induced, autocrine PGE2, binding to IL10-induced EP4.   The direct effect of IL10 on epithelial cancer cells has not been well studied.  Serum levels of IL10 increase in PCa patients as their tumours progress, and this is thought to contribute to the suppressed immune system observed in these patients.  PCa patients are treated with androgen antagonists such as enzalutamide (ENZ) to inhibit androgen receptor dependent PCa cell growth. Development of ENZ resistance is associated with tumour differentiation to a more aggressive    iv neuroendocrine phenotype.  I found that IL10 like ENZ, induce markers of neuroendocrine differentiation and inhibit androgen receptor reporter activity in PCa cells.  Both also upregulated the levels of PDL1 (CD274) which would promote tumour survival in vivo through its interaction with the immune cell inhibitory receptor PD1 to suppress an anti-tumour immunity.  These findings suggest that IL10\u2019s direct action on PCa cells contributes to PCa progression independent of IL10\u2019s suppression of host immune cells.                          v   Lay Summary When we get sick, injured, or even stressed, our body gets inflamed with different white immune cells to protect itself against tissue damage and infection.  Macrophages are one of the important inflammatory immune cells that can protect us from infections but their activation need to be tightly controlled to avoid different inflammatory diseases.  To avoid that, macrophages stop themselves and other inflammatory cells by producing different cytokines or hormones like IL10 and PGE2.  I found that IL10 can increase PGE2 receptor, called EP4.  IL10 upregulation of EP4 is required for PGE2 activation resulting in efficient deactivation of the inflammatory macrophages. I also found that IL10 can act directly on non-immune cells like prostate cancer cells, and can contribute to tumour progression by increasing some proteins that are involved in driving these tumours into a more aggressive lethal form that is very resistant to current treatments.                       vi Preface The data in Chapter 3 were summarized in a manuscript that has been published by PLoSOne. The data in Chapter 4 were summarized in a manuscript that has been published by Prostate Cancer. Contributions: The design of all research, data analysis and manuscript preparation were an original intellectual product of the author, Abrar Samiea, with the guidance and mentorship of Dr. Alice Mui.  All experiments were performed by the author with the following exceptions: \u00a7 Figure 3.1 in chapter 3 was generated by Dr. Tom Chamberlain and Dr. Sylvia Cheung. \u00a7 EP4 sgRNAs Crispr-Cas9 cells were generated by Jeff Yoon and Dr. Alice Mui. List of Publication: \u00a7 The data presented in chapter 3 have been approved for publication: Abrar Samiea, Jeff Yoon, Sylvia T. Cheung, Thomas Chamberlain and Alice L-F Mui.  Interleukin-10 contributes to PGE2 signalling through upregulation of EP4 via SHIP1 and STAT3. I am the first author and was responsible for generating the conception as well as the design of the article and performed the necessary and required literature research to the drafting of the work and performed all the experiments and data analysis and writing the first draft of the paper.  Jeff Yoon was the co-author involved in the generating the constructs of EP4 sgRNAs Crispr-Cas9 cells, helping in collecting the data for Figure 3.1, as well as editing the last draft of the article.  Sylvia T. Cheung was involved in the early stages of developing the concept of this work and helped in generating Figure 3.1. Thomas Chamberlain generated Figure 3.1, helped in reviewing the work critically and writing the last draft of the paper.  Alice Mui is the corresponding author who was the supervisory author on this project, was involved throughout the project in concept formation    vii and she helped in writing the last draft of the paper.  All the authors revised the work critically for important intellectual content, contributed to manuscript revision, and approved the submitted version.  \u00a7 The data presented in chapter 4 have been submitted for publication: Abrar Samiea, Jeff Yoon, Christopher Ong, Amina Zoubedi, Thomas Chamberlain and Alice L-F Mui.  Interleukin-10 induces expression of neuroendocrine markers and PDL1 in prostate cancer cells.  I am the first author and I was responsible for formatting the conception as well as the design of the article and performed the necessary and required literature research to the drafting of the work and performed all the experiments and data analysis and writing the first draft of the paper.  Jeff Yoon was involved in formatting the figures, and reviewing the data analysis. Thomas Chamberlain helped in reviewing the work critically and editing the last draft of the paper.  Christopher Ong and Amina Zoubedi were involved throughout the project in concept formation and provided the cell lines and the reagents used in most of the work.  Alice Mui was the supervisory author on this project, was involved throughout the project in concept formation and she is the corresponding author who also helped writing the paper.  All the authors revised the work critically for important intellectual content, contributed to manuscript revision, and approved the submitted version.  Ethics Approval:  All biohazardous experiments were performed in accordance with the Health Canada, Laboratory Biosafety Guidelines under protocols B16-0206.  All animal experiments were    viii performed in accordance with the UBC Animal Care Committee guidelines under the following protocols:  SHIP1 KO mouse colony: A17-0303 Harvest of tissues and cells:  A17-0302        ix Table of Contents Abstract ......................................................................................................................................... iii Lay Summary ................................................................................................................................ v Preface ........................................................................................................................................... vi List of Tables ............................................................................................................................... xii List of Figures ............................................................................................................................. xiii List of Abbreviations .................................................................................................................. xv Acknowledgements .................................................................................................................. xviii Chapter 1.  Introduction .............................................................................................................. 1 1.1. Thesis theme ............................................................................................................................... 1 1.2. Hypothesis, specific aims, and rationale .................................................................................. 3 1.3. Inflammation .............................................................................................................................. 6 1.4. Macrophages ............................................................................................................................ 10 1.4.1. Origin and development of macrophages ............................................................................................. 10 1.4.2. Classification of macrophages ............................................................................................................. 11 1.5. LPS-induced signaling ............................................................................................................. 13 1.5.1. LPS ....................................................................................................................................................... 13 1.5.2. TLR4 signaling ..................................................................................................................................... 13 1.6. IL10 in disease .......................................................................................................................... 16 1.6.1. IL10 role in inflammation .................................................................................................................... 17 1.6.2. IL10 function in cancer ........................................................................................................................ 18 1.6.3. IL10 signaling ...................................................................................................................................... 21 1.7. The prostate .............................................................................................................................. 25 1.7.1. The biology of the prostate ................................................................................................................... 25 1.7.2. Androgens ............................................................................................................................................ 28 1.7.3. Androgen receptor (AR) ....................................................................................................................... 30 1.8. Prostate cancer (PCa) .............................................................................................................. 33 1.8.1. Prostate carcinogenesis ........................................................................................................................ 33 1.8.2. Prostate cancer diagnosis ..................................................................................................................... 35 1.8.3. Primary prostate cancer ........................................................................................................................ 36    x 1.8.4. Recurrent prostate cancer as a castration resistant stage ...................................................................... 37 1.9. Treatment-induced neuroendocrine prostate cancer (t-NEPC) .......................................... 39 1.9.1. Characteristics of t-NEPC .................................................................................................................... 40 1.9.2. Development of t-NEPC ...................................................................................................................... 41 1.9.3. Induction of t-NEPC vs. NE-like differentiation (NED) ...................................................................... 43 1.10. Prostaglandin (PG) E2 ............................................................................................................. 45 1.10.1. PGE2 production ................................................................................................................................... 45 1.11. Prostaglandin EP4 receptor .................................................................................................... 48 1.11.1. EP4 in disease ....................................................................................................................................... 50 1.11.2. EP4 role in immunity and inflammation .............................................................................................. 50 1.11.3. EP4 in prostate cancer .......................................................................................................................... 52 1.11.1. EP4 signaling ........................................................................................................................................ 53 1.12. Interleukin-6 (IL6) in disease .................................................................................................. 57 1.12.1. IL6\u2019s role in epithelial prostate cancer ................................................................................................. 57 Chapter 2.  Materials and Methods ........................................................................................... 60 2.1. Mouse colonies .......................................................................................................................... 60 2.2. Cells ........................................................................................................................................... 60 2.2.1. Macrophages ........................................................................................................................................ 60 2.2.2. Prostate cancer cells ............................................................................................................................. 61 2.3. Constructs ................................................................................................................................. 62 2.4. Reagents .................................................................................................................................... 63 2.5. Cell Stimulations ...................................................................................................................... 64 2.5.1. Macrophages ........................................................................................................................................ 64 2.5.2. Prostate cancer cells ............................................................................................................................. 64 2.6. Treatment with EP4 antagonist .............................................................................................. 65 2.7. Real-time quantitative PCR .................................................................................................... 65 2.8. Immunoblot analysis ................................................................................................................ 66 2.9. Measurement of TNF\u03b1 production and IL10 IC50 calculations. ........................................ 66 2.10. Flow cytometry analysis. ......................................................................................................... 67 2.11. Statistical Analysis ................................................................................................................... 68 2.12. Ethics Statement ...................................................................................................................... 68    xi Chapter 3.  IL10 contributes to PGE2 signalling through upregulation of EP4 via SHIP1 and STAT3 in activated macrophages ...................................................................................... 69 3.1. Introduction .............................................................................................................................. 69 3.2. Results ....................................................................................................................................... 72 3.2.1. EP4 mRNA is upregulated by IL10 in a SHIP and STAT3 dependent manner ................................... 72 3.2.2. IL10 upregulation of EP4 protein ......................................................................................................... 75 3.2.3.  Kinetics of EP4 upregulation ................................................................................................................... 79 3.2.3. IL10 upregulation of EP4 protein requires SHIP1 and STAT3 ........................................................... 81 3.2.4. Analysis of whether IL10 regulates EP4 expression at the level of transcription or translation ......... 84 3.2.5. EP4 is required to mediate IL10 action in LPS-activated macrophages .............................................. 89 3.3. Discussion ................................................................................................................................. 94 Chapter 4: IL10 induction of neuroendocrine-associated proteins and PDL1 protein in PCa cells ............................................................................................................................................. 100 4.1. Introduction ............................................................................................................................ 100 4.2. Results ..................................................................................................................................... 102 4.2.1. IL10 induction of morphological transformation and NE proteins consistent with NED ................. 102 4.2.2. IL10-induced inhibition of AR activation .......................................................................................... 107 4.2.3. IL10 upregulation of PDL1 in different PCa cells ............................................................................. 107 4.2.4. EP4 is marginally upregulated upon IL10 treatment in different PCa cells ....................................... 112 4.3. Discussion ............................................................................................................................... 113 Chapter 5.  Conclusions ............................................................................................................ 118 5.1. Conclusions ............................................................................................................................. 118 References .................................................................................................................................. 125     xii List of Tables Table 1.1     IL10 regulated, STAT3-dependent genes which have been shown to mediate IL10\u2019s anti-inflammatory response .......................................................................................................... 23 Table 1.2    Phenotypes of EP4 deficient mice ............................................................................. 51 Table 1.3   Single nucleotide polymorphisms (SNP) of Ptger4 and its association to inflammatory bowel disease IBD and\/or Crohn\u2019s disease ................................................................................... 51 Table 1.4  Effects of agonists and antagonists of EP4 actions on inflammatory responses ......... 52 Table 1.5  Reported EP4 receptor signaling pathways in macrophages and monocytes .............. 56           xiii List of Figures Figure 1.1  TLR4 signaling in response to LPS stimulation. ........................................................ 16 Figure 1.2 IL10 signaling in activated macrophages. ................................................................... 25 Figure 1.3  PGE2 biosynthesis and receptors. ............................................................................... 48 Figure 1.4  EP4 Signalling ............................................................................................................ 56 Figure 3.1  EP4 mRNA is upregulated by IL10 in a SHIP and STAT3 dependent manner ......... 74 Figure 3.2 IL10 dose-dependent upregulation of EP4 protein in RAW264.7 cell line ................ 76 Figure 3.3 IL10 dose-dependent upregulation of EP4 protein in J17\/SHIP1 WT cell line .......... 78 Figure 3.4 Kinetics of EP4 protein upregulation in RAW264.7 cell line ..................................... 80 Figure 3.5 Kinetics of EP4 protein upregulation in J17\/SHIP1 WT cell line ............................... 81 Figure 3.6 IL10 upregulation of EP4 protein requires SHIP1 ...................................................... 83 Figure 3.7  IL10 upregulation of EP4 protein requires STAT3 .................................................... 84 Figure 3.8  IL10 regulation of EP4 protein expression at transcription and translational level ... 86 Figure 3.9  IL10 regulation of EP4 expression protein at post-transcription and translational level....................................................................................................................................................... 87 Figure 3.10  Examining the effect of either Act-D or CHX treatments on JAK1 and TYK2    protein levels ................................................................................................................................. 89 Figure 3.11  EP4 antagonist ONO-AE3-208 prevents IL10 inhibition of TNF\u03b1 ......................... 90 Figure 3.12  EP4 is required for IL10 induction of phospho-CREB ............................................ 92 Figure 3.13  EP4 is required for IL10 inhibition of LPS-stimulation of p-p85 and p-p70S6 kinase....................................................................................................................................................... 93 Figure 3.14  EP4 is required for IL10 inhibition of LPS-stimulated TNF\u03b1 production ............... 94    xiv Figure 4.1  IL10 induction of morphological changes and expression of NSE and SYP neuroendocrine markers in LNCaP cells. ................................................................................... 104 Figure 4.2  IL10 induction of morphological changes and expression of NSE and SYP neuroendocrine markers in 16D CRPC cells. ................................................................................. 105 Figure 4.3  IL10 induction of morphological changes and the expression of NSE and SYP neuroendocrine markers in 42DENZR cells. ................................................................................. 106 Figure 4.4  Inhibition of AR transactivation in IL10, IL6 and ENZ treated cells. ..................... 108 Figure 4.5  IL10 and ENZ but not IL6 upregulates PDL1 in LNCaP cells. ............................... 109 Figure 4.6  IL10 and ENZ but not IL6 upregulates PDL1 in 16DCRPC cells. .............................. 110 Figure 4.7  Increased PDL1 expression in IL10, IL6 and ENZ treated 42DENZR cells. .............. 111 Figure 4.8  Slight upregulation of EP4 in IL10, IL6 and ENZ treated PCa cells. ...................... 112      xv List of Abbreviations  AA  Arachidonic acid  AC   Adenylyl cyclase  AD  Adenylate cyclase   AdPC  Adenocarcinoma prostate cancer  ADT   Androgen deprivation therapy  AF1  Activation function 1  AF2   Activation function 2 AMPK  AMP-activated protein kinase  AP-1  Activator protein 1 AR  Androgen receptor  AREs   Androgen response elements  ARPI  Androgen receptor pathway inhibition  AURKA Aurora kinase A  CAG  Glutamine cAMP   Cyclic adenosine monophosphate  CCL2              C-C motif ligand 2 CCL3              C-C motif ligand 3 CgA  Chromogranin CREs  cAMP response elements  CRPC  Castration-resistant prostate cancer  CSF1               Colony stimulating factor-1 COX-1 Cyclooxygenase isoform-1  COX-2  Cyclooxygenase isoform-2 DAMPs Damage-associated molecular patterns  DBD  DNA binding domain  DHEA  Dehydroepiandrosterone DHT  5\u03b1-dihydrotestosterone  DNA  Deoxyribonucleic acid EAU                European Association of Urology  ECM  Extracellular matrix  EGFR  Epidermal growth factor receptor ENZ   Enzalutamide  EP  E-type prostaglandin   EZH2  Histone methyltransferase  Fc\u03b3R  Fc\u03b3-receptors  FSH   Follicle-stimulating hormone  G\u03b1   G alpha subunit  G\u03b1s   G\u03b1 \u2018stimulatory\u2019  G\u03b1i\/o  G\u03b1 \u2018inhibitory\u2019  GDP   Guanosine diphosphate GMP  Granulocyte-macrophage progenitor GnRH   Gonadotropin-releasing hormone   GR   Glucocorticoid receptor  GM-CSF  Granulocyte-macrophage colony stimulating factor  GPCR  G protein-coupled receptor     xvi GRKs   G protein-coupled receptor kinases  GWAS  Genome-wide association studies  HSCs  Hematopoietic stem cells  HP1\u03b1  Heterochromatin protein 1\u03b1  IBD  Inflammatory bowel disease ICAM1 Intracellular adhesion molecule 1  ICLs   Intracellular loops  IFN   Interferon  IFN\u03b1   Interferon-\u03b1 IFN\u03b2   Interferon-\u03b2 IFN\u03b3   Interferon-\u03b3 IL1  Interleukin-1  IL4  Interleukin-4 IL6   Interleukin-6 IL1\u03b2   Interleukin-1\u03b2  IL10   Interleukin-10 IL1Ra  IL1 receptor antagonist      IL10R   IL10 receptor  IL10R1 IL10 receptor 1   IL10R2 IL10 receptor 2  IL6R   IL6\u03b1 receptor  IP3  inositol 1,4,5-trisphosphate  Jak1  Janus kinase  LBD   ligand binding domain LBP   LPS-binding protein LPS   lipopolysaccharide LH   luteinizing hormone  LHRH  luteinizing hormone-releasing hormone  M1   Classically activated type 1 macrophage M2   Alternatively activated type 2 macrophage MCP-1 Monocyte chemotactic protein-1  MHC II  Major histocompatibility complex II MIP1  Macrophage inflammatory protein-1  MMP1  Metalloproteinase-1  MMP2  Metalloproteinase-2 MP   Monocyte progenitor  MPS   Mononuclear phagocyte system  MD2   Membrane-bound glycoprotein mCRPC  Metastatic castration resistant prostate cancer  MAPK  Mitogen-activated protein kinase NE   Neuroendocrine cells  NES   Nuclear export signal  NTD   N-terminal domain NLS   Nuclear localization signal   NEPC   Neuroendocrine prostate cancer t-NEPC Treatment-induced NEPC     xvii NSE   Neuron specific enolase  PAMPs Pathogen-associated molecular patterns  PCa   Prostate cancer  PCA3  Prostate cancer antigen 3 PDX   Patient-derived xenograft  PG   Prostaglandin  PGE2  Prostaglandin E2  PH   Pleckstrin homology  PI3K   Phosphatidylinositol-3\u00b4-kinase  PIP2  Phosphatidylinositol 4,5-bisphosphate  PKA   Protein kinase A PKC   Protein kinase C PLA2  Phospholipase A2  PLC\u03b2   Phospholipase C-\u03b2 PSA   Prostate specific antigen PSCA   Prostate stem cell antigen  PSMA  Prostate membrane-specific antigen  PX   domain or phox homology  RA   Rheumatoid arthritis RANKL  Receptor activator of nuclear factor-\u03baB ligand  RGS   Regulators of G protein signaling RhoGEFs  Rho guanine nucleotide exchange factors  ROS   Reactive oxygen species  RNS                Reactive oxygen species  Runx2  Runt-related transcription factor 2 SCC   Small cell carcinoma  SHIP1  SH2 domain containing inositol 5\u00b4phosphatase-1 sPLA2  Secretory PLA2 STAT3  Signal transducer and activator of transcription 3  stAR   Steroidogenic acute regulatory protein   SYP   Synaptophysin  T2D   Type 2 Diabetes  TAK1  TGF\u03b2-activated protein kinase 1 TGF\u03b2              Transforming growth factor \u03b2 TIMP1  Tissue inhibitor metalloprotease 1  TIR   Toll-interleukin-1 receptor TLR4   Toll-like receptor 4  TLRs   Toll-like receptors  TMPRSS2 Transmembrane protease serine 2 TNF\u03b1   Tumour necrosis factor \u03b1  TNM   Tumor, nodes, metastasis  TRAM  TRIF-related adaptor molecule   TXA2  Thromboxane  Tyk2  Tyrosine kinase 2     xviii Acknowledgements With Faith, blessings and hard work, this dissertation becomes a reality.   Foremost, I would like to express my gratitude to my supervisor Dr. Alice Mui for giving me the opportunity to learn and imparting her knowledge and time.  Her continuous support, patience, guidance helped me in all the time of lab-work and writing of this thesis.  I would also like to thank the past and present members of Mui\u2019s lab, the people who I have worked with day by day, for their invaluable assistance and friendship.   My thanks and appreciation to my supervisory committee members, Dr. Vincent Duronio and Dr. Neil Reiner, for their strong presence, valuable support and insightful recommendations throughout my Ph.D. studies.  I would like to also express my gratitude to my program director, Dr. Tricia Tang for her kindness and support.  I am also grateful for Dr. Devki Nandan because his optimism and encouragement were sometimes, all that kept me going.  Thanks to all the amazing people at the Jack Bell Research Centre and neighboring research institute.   Last but not least, I am forever thankful for my family, my biggest supporters, for believing in me and giving me the strength to keep going.  To my friends who have willingly helped me, my second family, thank you for lighting up my days when I needed it the most.          1 Chapter 1.  Introduction 1.1. Thesis theme  Inflammatory response is a mechanism for the body to fight infection and repair tissue damage therefore it is considered to be a beneficial response (1), and macrophages participate in host defense (2-5) by providing an immediate response to invading pathogens while also contributing to the activation of the adaptive immune system (6-8).  When lipopolysaccharide (LPS) binds to the Toll-like receptor 4 (TLR4) on the macrophage, a cascade of signalling pathways is initiated leading to the production of pro-inflammatory cytokines and other inflammatory mediators (9).  However, this inflammatory response needs to be appropriately terminated or inflammatory disorders can develop (10).  The anti-inflammatory cytokine interleukin-10 (IL10) is a key suppressor of immune cell activation vital to maintaining immune homeostasis (10, 11).  Defects in IL10 signalling are associated with various autoimmune\/inflammatory diseases such as inflammatory bowel disease (IBD) (12-14).  While IL10 administration reverses inflammation in mouse colitis models (15, 16), IL10 treatment was not successful in human IBD patients (17, 18).  This could be due to IL10 stimulatory action on CD8+ T cells (19-21), which was observed in IBD patients (22).  Thus, understanding the precise signaling mechanism of IL10R in activated macrophages may allow us to develop therapeutic approaches that overcome these problems.     Beside IL10 vital inhibitory action on immune cells as an anti-inflammatory, immune suppressive cytokine (23-25),  IL10 contributes to promote cancer aggressiveness by acting on immune cells to suppress the anti-tumour immune response (26).  Increased levels of IL10 have been associated with some types of cancer and chronic infections (27, 28).  Clinical studies have    2 shown that increased IL10 serum levels correlates with poor prognosis in prostate cancer patients (29) and is positively correlated with Gleason scores (30).   However, IL10 also has direct actions on PCa cells (31-33). In the early 2000s, Stearns et al. reported that IL10 treatment of PCa cell lines increased tissue inhibitor of metalloprotease 1 (TIMP1) levels (31) and decreased metalloproteinase-1 and 2 (MMP1, MMP2) synthesis (32).  How the IL10 regulation of TIMP1 and MMP1\/MMP2 expression contributes to PCa progression is not clear, but elevated TIMPs and MMPs are associated with higher grade PCa (34).  Whether IL10 acts directly on prostate tumor cells to promote cancer progression has not been well-studied since the reports published by Stearns group.  Thus, my research focus was extended later, on understanding IL10 direct effects on Epithelial prostate cancer cells. So, the overall objective of my thesis is about understanding IL10 inhibitory action on macrophages, as well as, its stimulatory action on prostate cancer cells.   IL10Macrophages Epithelial prostatecancer cellsImmune cells Non-immune cells   3 1.2. Hypothesis, specific aims, and rationale IL10 is best studied for its anti-inflammatory action on immune cells including macrophages, and ability to suppress an anti-tumour immune response.  But IL10 also exerts direct effects on non-immune cells such as prostate cancer epithelial cells.   IL10 signaling in activated macrophages has been well studied and led to the general agreement that IL10R activation of STAT3 and the expression of STAT3-response genes are sufficient to mediate all the anti-inflammatory actions of IL10 (24, 35, 36).  Previous studies from our lab identified that IL10 treatment on activated macrophages resulted in the formation of STAT3 transcription factor and the SHIP1 inositol phosphatase complex, which work together to support the expression of genes involved in the anti-inflammatory response.  Among these genes, IL10 treatment resulted in a rapid increase of prostaglandin E2 (PGE2) receptor 4 (EP4) mRNA levels.  Previous reports have shown that EP4 receptor mediates PGE2\u2019s anti-inflammatory action in activated macrophages (37).  EP4 is a G\u03b1s-protein coupled receptor that stimulates adenylate cyclase (AC) production of the cyclic adenosine monophosphate (cAMP), leading to downstream activation of protein kinase A (PKA) and phosphorylation of the CREB transcription factor (37).   IL10 has also been described to induce the activation of cAMP regulated PKA (38).  This suggests that EP4 has inhibitory actions on macrophages that are similar to IL10-mediated anti-inflammatory actions.   Thus, I hypothesized that part of IL10\u2019s inhibitory action on macrophage function is mediated through lipopolysaccharide (LPS)-induced PGE2 to IL10-induced EP4.  Therefore, the first aim of my thesis is to characterize IL10\u2019s induction of EP4 protein expression and whether IL10 inhibition of LPS-induced different signalling pathways, including MYD88 and PI3k, is dependent on EP4.  This research will elucidate potential mechanism that can be used as a part of    4 the IL10 signalling pathway to inhibit macrophages and resolve inflammatory responses.  This also will provide a better understanding of how EP4 agonists currently in clinical trials might best be used to treat inflammatory diseases in patients.  The second part of my thesis is focused on IL10\u2019s direct actions on epithelial PCa cells.  The widespread clinical use of more potent ARPI drugs, such as ENZ, to treat CRPC tumors increased the emergence of developing treatment-induced neuroendocrine prostate cancer (t-NEPC) phenotype from pre-existing prostate adenocarcinoma (AdPC).  t-NEPC cells are derived from AdPC cells differentiating into neuroendocrine (NE)-like cells which eventually becomes t-NEPC (39-44).  The rapid occurrence of this aggressive and fatal disease is proposed as a resistant mechanism to avoid ARPI therapy (41, 45-49). ARPI therapy (47) and various microenvironmental factors (50-54) were shown to induce the intermediate NE-like phenotype in PCa cell lines, but does not necessarily drive cells into a complete extremely aggressive t-NEPC phenotype.  The involvement of different microenvironment factors in inducing NED such as PGE2 (55) or IL6 (51, 56) raise the potential of their involvement in the transition phase of t-NEPC development perhaps by modulating the expression of different transcription factors and intracellular molecules needed for initiating t-NEPC development.  For example, IL6 has been reported to induce NE differentiation through different mechanisms including its canonical activation of STAT3 transcription factor (57, 58).  The use of STAT3 inhibitors increased the sensitivity of ENZ-resistant cells (59, 60), and reduced the development of t-NEPC (61).  IL10 also signals through STAT3.  In fact, both IL10 and IL6 serum levels are elevated in PCa patients as their tumors progress to castration resistant prostate cancer (CRPC) and ENZ-resistant stages (62).  Cells from CRPC tumors have been reported to express higher levels of EP4 protein (63).  Treating these cells with an AR antagonist such as ENZ, to inhibit AR-dependent PCa cell growth,    5 showed an upregulation of PDL1 levels associated with cells\u2019 differentiation to a more aggressive NE phenotype (64).  IL10 is known to increase both EP4 and PDL1 proteins in macrophages (65) and myeloid cells (66), respectively.  Thus, I hypothesized that IL10 may have a direct effect on PCa cells by promoting the expression of proteins associated with NED and PDL1.  I examined IL10 induction of these proteins on different derived xenograft LNCaP cell lines, each representing a different stage of PCa progression.  I also assessed whether IL10 treatment altered AR transactivational activity in LNCaP cells.  This research will lead us to a better understanding of IL10\u2019s direct actions on PCa cells and whether it contributes to PCa progression independent of IL10\u2019s suppression of host immune cells.    The specific aims of this thesis are: 1.  Characterizing the contribution of EP4 protein, an IL10-induced G-protein coupled receptor, in IL10 inhibition of macrophage activation.  2. Examining IL10 stimulatory effects on the expression of proteins that are associated with PCa tumour progression including NSE, PDL1, and EP4 proteins. In the next sections of the introduction, I will review recent knowledge involved in developing inflammation and prostate cancer, the direct role of IL10 on immune cells such as macrophages and non-immune cells like epithelial prostatic cells, and provide evidence from literature to strength my hypothesis.     6 1.3. Inflammation In the first century, inflammation was defined as a complex of symptoms that are characterized by pain, redness, heat, and swelling (67).  Many years later, loss of function was added as the fifth symptom (68).   Nowadays, inflammation is known as a biological response which combines both responses of the immune system and circulatory system.  Inflammatory response is a mechanism for the body to fight infection and repair tissue damage therefore it is considered to be a beneficial response (1).   Although inflammation is considered as a protective response, chronic or excessive inflammation can cause various inflammatory\/immune diseases (69-72).  Thus, considerable effort has been put into understanding the process of inflammation and how it is resolved.  One of these diseases is inflammatory bowel disease (IBD) whose prevalence has been rising in the Middle East countries in recent years including Saudi Arabia (73).  Similar observations have been reported in other developing countries (74, 75).  In addition, persistent chronic inflammation has been proposed to increase the risk of cancer development, with an estimation of 20-25% of all human cancers are caused by chronic infection or inflammation (76).  Therefore, understanding the precise molecular mechanisms for initiating and resolving inflammatory responses has become more vital. Inflammatory immune response is initiated as an innate immune response, which is an immediate, non-specific inflammatory response that can be activated in response to many types of potential threats (77-82).  It can be triggered by different stimuli which could be endogenous or exogenous.  Examples of these include pathogen-associated molecular patterns (PAMPs) which are common conserved patterns displayed on the cell membrane of various pathogens (77-79), and damage-associated molecular patterns (DAMPs) that represent a verity of host cytosolic and nuclear proteins which released by injured or expiring cells  (80-82).  Binding of PAMPs\/DAMPs    7 to receptors in immune cells result in the initiation of the innate inflammatory response (83).  Innate immune cells include macrophages, neutrophils and mast cells (83).  When these cells encounter different PAMPs or DAMPs by specific receptors found on their surface, they become activated and start mediating pro-inflammatory mediators.  Examples of pro-inflammatory mediators include cytokines such as interleukin-1 (IL1), IL6, IL8, IL12 and tumour necrosis factor \u03b1 (TNF\u03b1), chemokines such as chemokine (C-C motif) ligand 2 (CCL2), CCL3, monocyte chemotactic protein-1 (MCP-1) and macrophage inflammatory protein-1 (MIP1), as well as other non-protein factors such as histamine, prostaglandins and reactive oxygen and nitrogen species (ROS\/RNS) (83).   These mediators have local effects causing vasodilation and increase permeability of the local blood vessels (84), as well as promoting the activation of surrounding cells, and killing microbial pathogens directly (85-87).  The local effects on the blood vessels in infected or injured sites result in increased blood flow to the inflammatory or infected site (84).  This increase is concurrent with the enhanced expression of adhesion molecules on the luminal surface of the endothelial layer, which in turn promotes the contact between circulating leukocytes such as neutrophils, and endothelial cells causing these leukocytes to slow down their movement and roll along the endothelial wall  (85-87).  When this happens, leukocytes eventually enter the tissue by leaving the blood vessels and transmigrating across the endothelial layer to the affected site following a chemotactic gradient (85-87).  Then, secreted cytokines activate the recruited leukocytes along with other plasma complement proteins and antibodies to kill pathogens, clear damaged cells and debris.  All these events participate in the successful removal of the infection and turns on the tissue repair mechanisms, allowing them to initiate the specific adaptive immune response (88, 89).        8 Although inflammatory responses are beneficial to clear the body of invading microbes\/pathogens and tumour cells, the degree of inflammation must be controlled to avoid pathological consequences.  Excessive inflammation causes activated leukocytes to secrete inflammatory mediators that are harmful to healthy cells and tissues when uninterrupted.  Some of these include proteinases, hydrogen peroxide, reactive oxygen and nitrogen species, and inflammatory cytokines (90).  The presence of reactive oxygen and nitrogen species can induce oxidative damage to cellular DNA, proteins, and lipids (90).  Acute systemic inflammation in the form of sepsis is one example of excessive inflammation and can result in the accumulation of neutrophils and macrophages in organs causing dysfunctionality and even death (69, 70).  Also, IBD is caused by chronic inflammation in the colon (71) while rheumatoid arthritis (RA) is caused by joint inflammation (72).  The role of excessive chronic inflammation in tumour carcinogenesis has been recognized as an important factor in the initiation and progression of some malignancies with an infectious aetiology such as colitis-associated cancer, prostate cancer (PCa), hepatocellular carcinoma, and non-cardia gastric cancer (76, 91).  Genomic DNA damage induced by excessive inflammatory mediators can result in persistent genetic mutations, which can promote oncogene cellular processes and cancer development (92).  Thus, inflammation must be properly restrained to avoid the development of these diseases.   Formerly, the regulation of inflammation was thought to be a passive process that is mainly associated with the removal of inflammatory factors and the termination of chemokines production to prevent leukocyte recruitment to infection sites (90, 93).  Nowadays, it is known that inflammatory resolution is an active process which initiated by the synthesis of active pro-resolving mediators.  These pro-resolving mediators have vital actions on different stages of inflammation to recover homeostasis (25, 94-98).  According to this,  these specific pro-resolving    9 factors have the ability to target specific receptors in order to stop leukocyte recruitment (95), reprogram activated pro-inflammatory cells such as macrophages to become anti-inflammatory macrophages (99),  switch off leukocyte survival signalling pathways to promote apoptosis, initiate the clearance of dead (apoptotic) cells particularly by macrophages (100), and initiate the healing process.  All these events are essential to resolve inflammation and return to homeostasis.  Interestingly, different pro-resolving mediators are involved in controlling different stages of inflammation.  Early stages of inflammation are controlled by lipid pro-resolving mediators such as lipoxins (94) or prostaglandins (98).   Transforming growth factor \u03b2 (TGF\u03b2) and interleukin-10 (IL10) are the main regulators for later stages of inflammation with IL10 being best studied and characterized in inhibiting both early and late phases of inflammation (25, 97, 101, 102).  IL10 plays a key role in inhibiting immune cell activation and restoring homeostasis (25).  For example, IL10 inhibits the production of TNF\u03b1 as a strategy to eliminate inflammatory stimuli from interacting with the receptors (103-107) while it induces expression IL1 receptor antagonist (IL1Ra) to prevent inflammatory cytokines to activate intracellular signalling (108, 109).  Loss of IL10 function is associated with the development of autoimmune or inflammatory diseases (11, 110).  In addition, IL10 is proposed to contribute to cancer aggressiveness through its inhibitory effects on tumour-associated activated immune cells to promote tumor immune evasion (26).  Thus, understanding IL10 and IL10 receptor (IL10R) signalling is critical for our knowledge of inflammatory or autoimmune disease progression, cancer development, and resolution of host inflammatory response.  Work in our is focusing on studying how inflammation can be resolved by understanding IL10 intracellular signalling on immune cells, particularly on activated macrophages.       10 1.4. Macrophages Macrophages are one of the major types of immune cells that are involved in inflammation (2-5).  They are major players in the innate immune system that help to provide an immediate response to invading pathogens, and they also contribute in the activation of the adaptive immune system (6-8).  Macrophages, dendritic cells and neutrophils are phagocytes which phagocytose pathogens to digest them (6-8).  Macrophages also produce pro-inflammatory cytokines and chemokines that can recruit and activate other immune cells to the site of infection (6-8).  Macrophages are not professional antigen presenting cells, but they can present peptides from digested pathogens on cell surface major histocompatibility complex class II (MHC II) molecules to T cells to stimulate their activation and proliferation (6-8).  On the other hand, macrophages are also involved in our body\u2019s homeostasis by resolving inflammatory responses, and removing any debris and apoptotic cells in the tissue and the blood (8).  Understanding the origin of macrophages and factors responsible for their development into different phenotypes is important since macrophages often switch between different activation states depending on their surrounding environment (111).  1.4.1. Origin and development of macrophages Macrophages are a part of the mononuclear phagocyte system which also include circulating monocytes, resident macrophages, and lineage committed bone marrow precursors (6-8).  Traditionally, macrophages were thought to be derived from circulating monocytes that are generated in the bone marrow only.  In the bone marrow, hematopoietic stem cells develop monocytes through sequential differentiation steps including common myeloid progenitor, granulocyte-macrophage progenitor, and finally monocyte progenitor also called committed monocyte progenitor that give rise to macrophages (6-8).      11 However, recent studies have shown that the origin of some resident macrophages is from embryonic progenitors that help seed the tissue before birth and can self-renew resident macrophages by local proliferation in adulthood (99, 112).  Thus, macrophages can be derived from three sources: yolk sac, fetal liver, or the infiltrating bone marrow monocytes.  In the embryo, resident macrophages originate from the yolk sac and later on from the fetal liver.  In the adult, resident macrophages can proliferate during hemostasis except in case of injury or infection, when bone marrow derived macrophages start infiltrating to the inflamed site and replace destroyed resident macrophages.  For example, microglia macrophages in the brain and Langerhans macrophages in the skin were demonstrated to be exclusively derived from yolk sac, while lung and kidney macrophages had a mixed origin from yolk sac and infiltrating bone marrow monocyte-derived origin.  Thus, the origin of macrophages differs depending on tissue site (6-8, 112).   Many factors drive differentiation, proliferation and self-renewal functions in monocytes and resident macrophages including macrophage colony stimulatory factor-1 (M-CSF or CSF1), granulocyte-macrophage colony stimulatory factor (GM-CSF), as well as IL4 (113) and IL34 (114).  CSF1 is mainly responsible for monocyte recruitment (115) and resident macrophage proliferation (116) during homeostasis.  GM-CSF is more involved in monocyte differentiation and development during inflammation (117).    1.4.2. Classification of macrophages The different role of macrophages during inflammation and their involvement in the resolution phase directed scientists to categorize them into different functional subsets.  The old classification of functional macrophages into two types was dependent on their activation states:    12 the \u201cclassically\u201d activated (M1) macrophages and the \u201calternatively\u201d activated (M2) macrophages (8, 118-120). This classification was recognized by finding that interferon-\u03b3 (IFN\u03b3) and IL4 prompted different responses from macrophages in vitro.  M1-type macrophages, referred as inflammatory macrophages, activated by IFN\u03b3 or ligands of Toll-like receptors (TLRs) such as lipopolysaccharide (LPS) result in the expression of pro-inflammatory cytokines including IL1, IL6 and TNF\u03b1, as well as ROS and RNS (121).  These activated macrophages also upregulate the expression of MHC II and co-stimulatory molecules CD80\/CD86 on the surface to enhance antigen presentation resulting the activation of the adaptive immune system.  Unlike M1 macrophages that are responsible for the inflammatory response, M2 type macrophages are another type of macrophage that is derived by IL4, IL13, TGF\u03b2 or glucocorticoid treatment and inhibits inflammation by its expression of higher levels of IL10 (122, 123).  Besides antagonizing inflammation, these cells are also associated with enhancing tissue repair response (122, 123).   However,  M1 and M2 classifications were shown not to be exclusive since macrophages often switch between the different activation or polarized states depending on their phenotypic function (111).  Therefore, M1\/M2 model has been greatly revised (124, 125).  In addition, a recent study showed that macrophages had continuum spectrum activation states with M1 and M2 at the two ends instead of discrete activation states (126).  The current classification of functional macrophages is based on the macrophages\u2019 origin (human or mice), the source of activation (the stimuli) and the expression of different surface markers to mirror the various phenotypes that macrophages can adapt (120).  Other proposals suggested anatomical classification of macrophages based on their cellular ontogeny origin followed by a second classification that depends on the source of activation and the expression of surface markers (127, 128).      13 The pathogenic role of M1 population in autoimmune\/inflammatory diseases such as IBD, or the initiation of neoplasms remains an active area of research, and understanding which defects lead to the failure of resolving pro-inflammatory responses leading to chronic inflammation can help in finding alternative therapeutic options.  In the next section, LPS activation of immune cells such as macrophages will be reviewed.  1.5.  LPS-induced signaling  1.5.1. LPS LPS is a major component of the outer membrane of gram negative bacteria and functions to stabilize and protect the bacteria from certain chemical attacks by increasing the negative charge of the cell envelope which contributes to the membrane structural integrity of the bacteria (129).  Liberated LPS from multiplying bacteria or dying bacteria binds strongly to LPS-binding protein (LBP), a soluble lipid transferase that helps the transfer of LPS from the bacteria to glycoprotein CD14 on the host cell membrane (130).  Then, CD14 facilitates the transfer of LPS into the toll-like receptor 4 (TLR4)\/MD-2 complex (131).  LPS binding to the TLR4 complex on immune cells such as macrophages initiates inflammatory responses (129).  LPS structure consists of three parts including; lipid A, a core oligosaccharide, and an O side chain (129).  Lipid A is the main PAMP of LPS that is highly conserved, which interacts with TLR4 and stimulates the activation of macrophages and other non-immune cells such as epithelial cells (132, 133).    1.5.2. TLR4 signaling TLR4 is the receptor for LPS but it requires other proteins to properly bind its ligand (134).  MD2 is another membrane-bound glycoprotein, which associates with TLR4 and assists in the    14 responsiveness to LPS (131).  The TIR (toll-interleukin-1 receptor) domain of TLR4 then regulates the activation of TLR4 downstream pathways and triggers a cascade of signaling events (132).  TLR4 signaling leads to activation of the MAPK and the NF\u03baB pathways through MyD88-dependent and MyD88-independent mechanisms (9, 135, 136).   In the MyD88-dependent pathway, LPS binding promotes the interaction of the adaptor proteins TIRAP and MyD88 to TLR4, leading to activation of TGF\u03b2-activated protein kinase 1 (TAK1).  TAK1, which is a member of the MAP kinase kinase kinase (MAP3K) family, is involved in the activation of NF\u03baB transcription factor via the induction of I\u03baB kinases (IKKs) (136).  The IKK complex (IKK\u03b1, IKK\u03b2 and IKK\u03b3) is responsible for the phosphorylation of I\u03baB.  Phosphorylated I\u03baB becomes ubiquitinated, leading to proteasome-mediated degradation, which then releases NF\u03baB to translocate to the nucleus to promote transcription of pro-inflammatory cytokines such as TNF\u03b1 (136).  TAK1 also activates kinases upstream of p38, JNK, and ERK, and activates another transcription factor, activator protein 1 (AP-1), through MAPK-JNK dependent manner to upregulate the TNF\u03b1 (137).  MAPK signaling also plays a role in the post-transcriptional regulation of pro-inflammatory cytokines.  For instance, ERK activation is required for the cytoplasmic transport of TNF\u03b1 mRNA (138) while p38 regulates the stability (139) and translation (140) of TNF\u03b1 mRNA.  On the other hand, the MyD88 independent pathway begins with the TIR-domain-containing adapter-inducing interferon \u03b2 (TRIF) recruitment to TLR4 via the adaptor protein TRIF-related adaptor molecule (TRAM) (135), and ends with activation of IRF transcription factors that induce the expression of Type 1 interferon genes such as IFN\u03b1 and IFN\u03b2 (141).  TLR4 signaling also results in the activation of phosphatidylinositol-3\u00b4-kinase (PI3K). Although the details of this mechanism are not well defined, the activation of PI3K leads to    15 elevated levels of cellular phosphatidylinositol-3,4,5-trisphosphate (PIP3), which recruits pleckstrin homology (PH) domain or phox homology (PX) domain-containing proteins such as the kinases ILK and Akt (142).  The physiological role of PI3K-Akt activation in TLR signaling has been controversial.  Some studies suggested PI3K positively regulates the inflammatory response by the activation of NF\u03baB and inducing nitric oxide (143).  Other studies reported that PI3K activation results in the inhibition of pro-inflammatory events such as expression of IL12 and TNF\u03b1 (144, 145).  However, a potential reason for this discrepancy is the effect of autocrine IL10 production, and this could vary depending on cell types and time-points used to assess inflammation.  The activation of these pathways not only leads to gene expression of many pro-inflammatory mediators but also production of anti-inflammatory cytokines such as IL10 and TGF\u03b2 (146).  Thus, it is possible that the effects of autocrine IL10 could inhibit measurements of pro-inflammatory cytokine production or macrophage activation taken past 2 hours of LPS stimulation and mask the positive role of the PI3K pathway in LPS signaling.  Figure 1.1 shows different TLR4 signaling pathways.     16 Figure 1.1  TLR4 signaling in response to LPS stimulation. LPS binding to TLR4 activates both MyD88-dependent and MyD88-independent pathways, leading to the expression of pro-inflammatory cytokines (such as TNF\u03b1 and PGE2), and Type I interferons.    1.6.   IL10 in disease IL10 is expressed by almost all leukocytes, however, IL10 is mainly produced by T helper cells, monocytes, and macrophages in vivo (110).  Its role in resolving inflammation has been well studied (25).  Macrophages are the major target of IL10 as deletion of IL10R1, in myeloid-specific cells but not T or B cells, showed an increased sensitivity to LPS administration (147), and development of colitis  (148, 149).  This finding suggests that IL10 signalling is crucial in controlling LPS response in myeloid cells (including monocytes, macrophages and neutrophils) (147).  However, increased levels of IL10 levels have also been associated with some types of cancer and many chronic infections (27, 28).  Due to IL10\u2019s inhibitory actions on immune cells, some pathogens and tumors enhance their survival through their production of IL10 leading to immunosuppressive effects.  Such an effect was observed in lupus erythematosus (150, 151), Epstein-Barr virus associated lymphomas (152), and metastasis castration resistant prostate cancer (62).  In addition, clinical studies have shown that increased IL10 serum levels correlates with poor prognosis in prostate cancer patients (29, 30), post-surgical colon cancer patients (153), and breast cancer patients (154).  Therefore, IL10 is strictly regulated since it can contribute to either prevention (155-160) or progression (62, 150-152) of a number of diseases.       17 1.6.1. IL10 role in inflammation Since excessive immune responses can lead to inflammatory diseases (10), negative regulation of the immune system is necessary, and IL10 is a key anti-inflammatory cytokine  (10, 11).  Defects in IL10 signaling are associated with many autoimmune or inflammatory diseases   (12-14).  IL10 (161) and IL10R (13, 162) knockout mice develop colitis similar to human inflammatory bowel disease (161, 163) and are hypersensitive to inflammatory stimuli (164, 165).  In humans, deficiencies or mutations in IL10 (166) or IL10R (13, 167)  was found to cause early onset of IBD.  Also, polymorphisms in IL10 genes were found to be associated with other inflammatory diseases such as asthma (160), allergies (155), and RA (159).  Recent studies showed that low production of IL10 is associated with Type 2 Diabetes (T2D), a disease with a chronic inflammation component (156, 157).  Thus, IL10 function is usually beneficial in the body and prevents many inflammatory or autoimmune diseases.    IL10 administration reverses inflammation in mouse colitis models (15, 16).  However, IL10 treatment was not successful in human IBD patients (17, 18).  One possible reason is the fact that systemic administration of IL10 might not be sufficient to deliver IL10 to the inflammatory site in those patients (168).  IL10 has stimulatory action on CD8+ T cells (19-21), and IL10 systemic administration was shown to stimulate CD8+T cells production of pro-inflammatory cytokines such as IFN\u03b3 in patients (22).  Thus, understanding the signaling mechanism of IL10 may allow us to develop therapeutic approaches that overcome these problems.     1.6.1.1. IL10 function in macrophages Upon the activation of macrophages by endogenous molecules such as IFN\u0263 or exogenous molecules such as LPS, many inflammatory mediators are produced.  IL10 suppress these inflammatory mediators including cytokines (e.g. TNF\u03b1, IL1, IL6, and IL12), chemokines (such    18 as CCL3, CCL2 and IL8) (10, 169) and production of reactive oxygen (e.g. hydrogen peroxide; H2O2) (170) and nitrogen intermediates (e.g. nitric oxide; NO) (171).  In addition, IL10 inhibits the expression of different surface proteins including MHCII as well as CD80 and CD86 co-stimulating molecules that are important for macrophages to provide T cell help (172, 173).  IL10 also downregulates the surface expression of intracellular adhesion molecule 1 (ICAM1) resulting in the inhibition of monocyte interaction with endothelial cells (174) which in turn decreases the recruitment of circulating monocytes into infected or injured sites  (174).     However, while IL10 inhibits the expression of some surface proteins that are required to initiate innate or adaptive immune systems, it upregulates the expression of CD16, CD64 and Fc\u03b3-receptors (Fc\u03b3R), which are important in promoting phagocytosis of inflammatory stimuli (175).  Finally, IL10 also upregulates the production of anti-inflammatory molecules such as IL-1Ra (109) and soluble TNF\u03b1 receptor (176), which interferes with IL1 and TNF\u03b1 binding to their target cells.  The net effect of these actions of IL10 on activated macrophages is to inhibit macrophage effector function.  1.6.2. IL10 function in cancer 1.6.2.1. IL10\u2019s role in immune suppression of cancer Tumour derived or elicited IL10 is proposed to contribute to cancer aggressiveness by promoting tumor immune evasion (26).  Clinical studies have shown that increased IL10 serum levels correlates with poor prognosis, including in prostate cancer patients (29, 30), post-surgical colon cancer patients (153), and breast cancer patients (154).  IL10 could be produced either by the tumour cells themselves (177-180) or by tumour elicitation of tumour-infiltrating, IL10 producing immune cells (181, 182).      19   Tumour associated macrophages (TAM) are tumour-infiltrating, IL10 producing, M2 macrophages (181).  TAMs can produce factors that promote various phases of cancer including angiogenesis, immunosuppression, tumor progression, tumor growth, metastasis, and matrix deposition (181).  IL10 immunosuppressive contribution on the tumor environment is mainly promoted by its inhibitory effects on different immune cells.  The high levels of IL10 produced by either TAMs or tumour cells can result in the suppression of different pro-inflammatory mediators produced by antigen presenting cells, which results in the suppression of myeloid (macrophage and dendritic cell) and T effector cell function (182-185).  For example, IL10 reduction of MHCII, CD80, CD86 surface expression on mature dendritic cells inhibit their ability to present antigens required for T helper-1 (Th1) cells activation (186).  In addition, IL10 inhibition of pro-inflammatory cytokines in macrophages impairs Th1 immune responses and T- cell cytotoxic activity through suppression of T effector cell proliferation, cytokine production and migration (181).   IL10 was also reported to upregulate the surface expression of PDL1 (66), a ligand of the programmed death-1 (PD1) receptor (187) on macrophages, to inhibit CD8+ T cells function.  PD1 receptor is a well-known immune check point inhibitor for T cell mediated immunity (188).  The interaction of PDL1 with its receptor, PD1 transmits inhibitory signalling that interferes with T cell receptor (TCR) signal transduction to inhibit the host immune responses and eventually promote tumour survival (189, 190), presenting another mechanism applied by macrophages for tumor immune evasion.  In addition, IL10 production by TAMs has been reported to promote the generation of T regulatory (Treg), which are also IL10 producing cells.  Treg cells are a sub-type of T cells that are specialized in inhibiting other immune cell functions including T effector cells.     20 The expansion of Treg cells by IL10 expressing TAMs facilitates its role in immune escape and tumour growth (184).   1.6.2.2. Direct effects of IL10 on epithelial cancer cells In addition to IL10\u2019s contribution in cancer aggressiveness by promoting tumor immune evasion (26), IL10 also has direct actions on cancer cells.  Stearns et al. reported that IL10 stimulated the expression of a tissue inhibitor of TIMP1 levels (31), and inhibited MMP1 and MMP2 synthesis (32), which may contribute to the degradation of the extracellular matrix (ECM) (33) on prostate cancer (PCa) cells.   ECM degradation allows cancerous cells to grow, aids in metastasis, and is important in angiogenesis (191).  However, TIMPs upregulation levels have been associated with higher tumor grade in both prostate (34) and breast cancer (192).  In fact, TIMPs multifunctional actions on tumor cells have been reported (34, 192), which show stimulatory effects (193) on tumor cell proliferation associated with apoptosis inhibition (34, 192, 194, 195).   In agreement with that, recent studies have reported that IL10 can promote proliferation and metastasis of tumor cells  (196, 197).  IL10 serum was reported to correlate with tumour progression and metastasis in PCa patients (29), and positively correlate with Gleason scores (30). IL10 has been reported to be excessively expressed in metastatic androgen-independent PCa cells (180).  IL10 plasma levels are significantly increased in patients undergoing androgen deprivation therapy (ADT) with higher levels observed in enzalutamide (ENZ)-resistant patients compared to sensitive patients (62).  In fact, IL10 plasma was shown to be upregulated during the treatment of ENZ-sensitive patients (62).  So, IL10 elevation levels could be affected differently by multiple factors in the tumor environment such as chronic inflammation or chemical inducers (30, 62) that results in an initial pro-inflammatory response followed by an increase of IL10 to self-limit    21 inflammation.  IL10 inhibition of pro-inflammatory cytokines leads to lower immune responses and promotes the survival of tumour cells.   Whether IL10 acts directly on prostate tumour cells to promote cancer progression has not been well-studied since the studies published by Stearns et al. in the early 2000s (31-33).  The recent description of IL10 being positively correlated with the fatal neuroendocrine phenotype in ENZ-resistant patients (62) prompted us to look at the potential effect of IL10 on neuroendocrine differentiation of PCa cells.        1.6.3. IL10 signaling 1.6.3.1. IL10 signaling in activated immune cells IL10 interferes with LPS signaling through different mechanisms.  IL10 binds to a receptor complex consisting of two subunits: IL10 receptor 1 (IL10R1) and IL10 receptor 2 (IL10R2) (198).  IL10R2 is constitutively expressed at low levels on most cells (110, 199, 200) and while IL10R1 is expressed mainly on immune cells (201, 202), it can be induced in non-immune cells by stimuli such as LPS (203, 204).  The binding of IL10 to the receptor complex is mediated primarily through IL10R1 since it has higher affinity for IL10 protein than IL10R2 subunit (198) while IL10R2 is mainly required for signal transduction (205).  IL10R2 is also used by other cytokines of the IL10 family to form receptor complexes (206-208).  Upon IL10 binding to IL10R complex, the receptor-bound Janus kinase 1 (Jak1) and tyrosine kinase 2 (Tyk2) are transphosphorylated and activated (209, 210) resulting in phosphorylation of IL10R1 on two tyrosine residues (Y446 and Y496 in human (211), or Y427 and Y477 in mouse (212)) that act as docking sites for Src homology 2 (SH2) domains found on the transcription factor STAT3 (209, 210).  STAT3 then becomes phosphorylated by the receptor-associated Jak1\/Tyk2    22 at Y705 (213) in human and mouse, which facilitates STAT3 dimerization (214) and enhances STAT3 transcriptional activity (215).  Dimeric STAT3 translocates into the nucleus and binds to the promoters of STAT3 response genes and stimulates transcription to mediate an anti-inflammatory response (209).  Also STAT3 can be phosphorylated at S727 (216) by mitogen-activated protein kinase (MAPK) (217) and AMP-activated protein kinase (AMPK) (218) which enhances STAT3 transactivational activity (218).  STAT1 and STAT5 have also been described to be activated in IL10 stimulated cells (219), but their role appears to be dispensable for IL10 signalling in macrophages (220, 221).   IL10 inhibitory effects on TNF\u03b1 production has been well-studied.  IL10  interferes with TNF\u03b1 production at all levels (transcription (222), mRNA stability (223-226), mRNA translation (140) and protein secretion (227)).  IL10 regulation of TNF\u03b1 gene expression at the posttranscriptional level is mediated through different RNA-binding proteins.  For example, some of ARE binding proteins (ARE-BP) regulating TNF\u03b1 mRNA stability include KH-type splicing regulatory protein (KSRP) (228), tristetraprolin (TTP) (229), and HuR (139, 230, 231).  ARE-binding TNF\u03b1 translational silencers include TIA-1 (232) and hnRNP A1 (233).   Studies of intracellular signaling pathways downstream of IL10R has led to the general agreement that activation of the STAT3 and expression of STAT3-response genes are sufficient to mediate all the anti-inflammatory actions of IL10 (24, 35, 36).  Takeda et al. showed that myeloid-specific STAT3 deficient mice were susceptible to LPS-induced endotoxin shock, and produced increased levels of TNF\u03b1, IL-1\u03b2 and IFN\u03b3 (234).  Similar to IL10 knockout mice, LPS administration leads to elevated serum TNF\u03b1 levels 1 hour after injection (235).  Also, different heterologous receptor systems (the EPOR, IL22R, or IL6R engineered to contain the IL10R STAT3 binding tyrosine motif) gained the ability to mediate STAT3-mediated anti-inflammatory    23 actions in a macrophage cell line (36).  Other studies showed that STAT3 supports the expression of specific gene products to mediate IL10 anti-inflammatory response (36, 236-239).  Table 1.1 lists IL10 regulated STAT3-dependent genes that have been shown to participate in an anti-inflammation response.  However, despite statements in the literature saying STAT3 transcription factor is sufficient to mediate all the anti-inflammatory actions of IL10 (24, 36), there is much evidence that STAT3 is not the only regulator of IL10 signaling and support a STAT3-independent mechanism.  O'Farrell et al. reported that a dominant negative STAT3, which lacks the transactivation domain, was still able to suppress LPS-induced expression of IL-1\u03b2 and TNF\u03b1 (212).  Studies using a STAT3 (Y705F) mutant showed that IL10 was able to suppress TNF\u03b1 mRNA in these cells at early time point, while this suppression was reversed at later time points, suggesting that a STAT3 Y705F-independent mechanism is utilized by IL10 to suppress TNF\u03b1 mRNA at early time points (240).  These data suggest that the suppression of TNF\u03b1 mRNA may also be mediated by IL10 through STAT3-independent mechanisms at early time points, indicating that STAT3 phosphorylation on Y705 is not required for IL10\u2019s anti-inflammatory actions in macrophages.  Table 1.1     IL10 regulated, STAT3-dependent genes which have been shown to mediate IL10\u2019s anti-inflammatory response Gene Cell type Proposed function References Bcl-3 Bone marrow-derived macrophages (BMDM) and other cell types Prevents p50 ubiquitination and degradation and inhibits TNF\u03b1 transcription by interfering the binding of NF\u03baB to the TNF\u03b1 promoter (236, 237) ETV3 BMDM and Primary peritoneal macrophages (perimacs) Transcriptional co-repressor, inhibits NF-\u03baB transcriptional activity (236, 238) SBNO2 BMDM Transcriptional co-repressor, inhibits NF-\u03baB (238) TTP Macrophages Binds to AU-rich elements in TNF\u03b1 mRNA and promotes mRNA degradation  (239) NFIL3 BMDM Suppresses IL12\u03b2 expression  (241) Zfp36 perimacs RNA-binding protein against ATTTA elements targets TNF-\u03b1 mRNA. (236)     24  Our lab has identified the SH2 domain containing inositol 5\u00b4phosphatase-1 (SHIP1) as another important signalling molecule in IL10 signaling (107, 242).  SHIP1, expressed predominantly in hematopoietic cells, inhibits the PI3K pathway by hydrolyzing the PI3K product PIP3 into PI-3,4-bisphosphate (PI-3,4-P2) (243-245).  SHIP1 can also serve as an adaptor protein for assembly of protein complexes in signalling pathways (246).  Studies in our lab revealed that SHIIP1 and STAT3 form a complex to induce some of IL10 actions in macrophages (Figure 1.2), an action that is uniquely induced by IL10 but not IL6 (Chamberlain et al., submitted).  SHIP1-deficient macrophage cell lines and primary mouse macrophages showed impaired IL10-mediated inhibition of LPS-induced TNF\u03b1 (107, 242).  Also, IL10 inhibits TNF\u03b1 translation through SHIP1-dependent inhibition of Mnk1 (107, 242).  Another study from our lab has found that both SHIP1 and STAT3 contribute to IL10\u2019s inhibition of LPS-induced miR-155 expression in macrophages (242).  The use of an allosteric molecule activator of SHIP1 called AQX-MN100 (247) was sufficient to mimic some of the beneficial effects of IL10 anti-inflammatory actions in a mouse model of colitis (Chamberlain et al., submitted), suggesting that SHIP1 agonists could be useful for treating conditions resulting from deficiencies in endogenous IL10 or IL10R.  All these results confirm the involvement of SHIP1 as another regulator in IL10 signalling.  Ongoing studies in our lab are directed to understand the detailed mechanism.  1.6.3.2. IL10 signaling in epithelial cancer cells Little has been reported regarding IL10 signalling in epithelial tumour cells.  However, TIMPs upregulation in breast tumor cells required STAT3 phosphorylation (248).  In prostate tumor cells, TIMP1 is upregulated in response to IL10 by activating a LIM protein, termed interleukin 10 enhancer 1 (IL10E1), which is phosphorylated at two specific tyrosine groups, Y57\/Y62, to    25 activate signalling and binding to the TIMP1 promoter (33).  The phosphorylation of two tyrosine residues (Tyr446 and Tyr496) located in the cytoplasmic domain of the IL-10R1 chain is required for the receptor function, and for phosphorylation and activation of IL-10E1 (31).  STAT3 binding to IL10 receptor or phosphorylation was not evaluated in these PCa cells.      Figure 1.2 IL10 signaling in activated macrophages. IL10 binding to IL10R complex activates both SHIP1 and STAT3 dependent pathways, leading to the expression of anti-inflammatory cytokines.  Our data showed that SHIP1 and STAT3 complex formation in the cytoplasm disappears within 20 min of IL10 stimulation (Shakibakho et al. unpublished).  Whether SHIP1 and STAT3 remains a complex in the nucleus still need to be determined.  1.7.   The prostate 1.7.1. The biology of the prostate The prostate is a walnut-sized gland located below the bladder and in front of the rectum.  The main function of the prostate gland is to produce the prostatic fluid which prolong the lifespan of the sperm in the vaginal tract (249).  In addition, there are many enzymes in the prostate fluid    26 to increase the mobility of the sperm.  One of these enzymes is the prostate specific antigen (PSA), which is expressed by both cancerous and noncancerous cells.  Elevated PSA levels can be caused either by benign prostate hyperplasia (BPH) (250) or PCa (251, 252).  The levels of PSA are usually used as a diagnosis marker of prostate cancer progression since PCa cells growth is androgen-dependent (251, 252).  However, recent studies have proposed the use of the ratio between different PSA isoforms, complexed or free PSA\/total PSA,  as a tool to distinguish the cause of PSA elevation between patients with PCa cancer and BPH (253, 254). The development of the human prostate is initiated with the growth of the prostatic buds from the urogenital sinus during the first 10-12 weeks of gestation.  In particular, the cloaca, a swelling of the foregut, develops into the urogenital sinus.  The budding of the urogenital sinus epithelium (UGE) then leads to the formation of the prostate (255, 256).  This process in the early prostate is driven by androgen activation of androgen receptor (AR) signaling in the urogenital sinus mesenchyme (UGM) (255).     The stroma of the prostate gland contains different cells that play structural, supportive and homeostatic roles (257, 258).  These cells include stromal, smooth muscle, endothelial, immune, and nerve cells, as well as pericytes and fibroblasts.  In addition, androgen signaling also leads to extensive interaction between the cells of the mesenchyme and the epithelium, leading to the differentiation of the UGE into several distinct cell lineages including basal, intermediate, and luminal epithelial cells, as wells as neuroendocrine (NE) cells.  The UGM differentiates into prostatic smooth muscle cells and fibroblasts (259).  Because of that, the prostatic parenchyma contains distinct types of epithelial cells accompanied with small percentage of neuroendocrine cells.      27 Different lineages of cells have different morphology, and usually express distinct lineage biomarkers (259).  In fact, luminal epithelial cells take up the majority of the epithelium layer.  These cells support the structural integrity of the epithelium layer and they have low proliferation rates since they are terminally differentiated.  They are also responsible in secreting different proteins that are found in the prostatic fluid such as PSA, and express the AR and cytokeratins 8 and 18 (259).  Underneath the luminal epithelial cells are the basal cells, which are characterized by the expression of cytokeratins 5 and 14.  These cells are localized along the basement membrane providing structural support for the luminal epithelial cells and signalling function, and don\u2019t express the AR (259).  The intermediate cells that reside alongside the luminal cells express both luminal and basal cytokeratins.  These cells are differentiated in a state between the basal and luminal epithelial cells (259).  Finally, neuroendocrine (NE) cells that are dispersed within the basal cells, are mostly non-proliferating and don\u2019t express the AR.  Although the origin of these cells is still controversial (260), NE cells exchange signals with the nerve cells in the stroma.  This results in the release of hormones and peptides including calcitonin, bombesin, serotonin, and growth factors into the prostatic environment to act as paracrine mediators to promote differentiation and proliferation of prostatic cell populations and maintain homeostasis of the epithelial cells (260).   The prostate in the adult male has three zones with different histological characters (249).  These zones include: the peripheral, transition, and central zone.  The peripheral zone is composed of 70% of the prostatic tissue and includes posterior and lateral parts of the prostate.  The central zone accounts for 20-25% of the prostate and is between the peripheral and transition zones.  Lastly, the transition zone surrounds the prostatic urethra, and as men age this area gets bigger which    28 could develop into benign prostatic hyperplasia (BPH) (250).  Among these zones, prostate cancer arises mostly in the peripheral zone (249).  1.7.2. Androgens Androgens are steroid hormones that are required for the development and maintenance of the male reproductive system (261).  The major androgenic steroid in men is testosterone, which is mainly synthesized and secreted by the Leydig cells of the testis (261).  Other endogenous weak androgens such as dehydroepiandrosterone (DHEA) and androstenediones are produced by the outer layer of the adrenal cortex and ovaries (262).  DHEA and androstenediones have a little biological effect on their own but have potent effects when converted to a stronger hormone such as testosterone (262). Testosterone is essential in controlling male sexual characteristics through their lifetime.  Starting during the embryonic development, the formation of fetal testosterone is initiated when fetal testis are differentiated after 8 weeks of gestation (261).  Fetal testosterone has an important role in developing the Wolffian ducts (263), which gets differentiated into the epididymis and seminal vesicles.  Also, fetal testosterone plays a role in the development of the penis and the prostate.  During the next trimester of embryonic gestation, around 11-21 weeks, fetal testosterone levels can help specify gender formation since they can be used as a predictor of sexual childhood behaviors after birth (264).  In adulthood, the production of androgens by the Leydig cells located in the testes and adrenal glands has an essential role in developing the secondary sexual characteristics in male including facial and chest hair growth, penis enlargement, elevated muscle strength and mass, voice deepening, prostate development, and spermatogenic tissue growth (261).    29 Androgen synthesis and regulation in the blood starts from inside the brain, where hypothalamus secretes a hormone called gonadotropin-releasing hormone (GnRH).  Then, GnRH stimulates the anterior pituitary gland to release luteinizing hormone (LH) and follicle-stimulating hormone (FSH) (265).  The released hormones, particularly LH hormone, travels through the blood stream and eventually binds to the LH receptor in the Leydig cells to initiate the synthesis and secretion of testosterone (266).  It does so by elevating steroidogenic acute regulatory protein (stAR) expression levels and cyclic adenosine monophosphate (cAMP) levels (261).  While the activation of kinase-dependent cAMP increases the production of free cholesterol, stAR protein promotes the free cholesterol transfer into the inner mitochondrial membrane to start steroidogenesis by converting cholesterol into pregnenolone (262).  Then, the pregnenolone is converted to DHEA through multiple lysation steps.  Following this, DHEA can be converted into the precursors of testosterone, androstenediol or androstenedione (262).  The resulting testosterone is released in the blood as a fusion protein with sex-hormone transporting protein (267) or albumin (268) to increase its solubility and travels in the blood stream until it reaches the prostate gland.  At the intracellular prostate gland, free testosterone that enters the cell can be converted to its more biologically active form 5\u03b1-dihydrotestosterone (DHT) by 5\u03b1-reductase enzyme or oestradiol by the action of aromatase, which in turn drives the growth and survival of prostate cells (262, 269).   DHT has a strong affinity to AR at low concentrations, being a more potent androgen than testosterone.  The secretion of testosterone or oestradiol results in a negative feedback response and inhibits the secretion of GnRH and FSH\/LH as a way to control the regulation of testosterone levels in the body.    30 1.7.3. Androgen receptor (AR) The AR is a 110 kDa transcription factor that belongs to the steroid and nuclear receptor superfamily 3 (NR3C4, group C, gene 4).  AR regulates the transcription of different genes that promote the expression and maintenance of male sexual characteristics in a ligand-dependent manner and through binding to deoxyribonucleic acid (DNA) consensus sequences.  Other receptors that belong to this nuclear receptor family include glucocorticoid receptor (GR) (270), progesterone (271) and estrogen (272) receptors.  The AR plays very important roles in the development of the normal prostate, maintenance of secondary male characteristics, and sexual function in the adult male.  AR dysregulation is primarily responsible for PCa progression (261, 264, 269, 273).  Because of that, AR signalling and structure has been extensively studied.  The AR is comprised of multiple domains including; the N-terminal domain (NTD) with the activation function 1 (AF1) region, the DNA binding domain (DBD) containing a nuclear localization signal, a hinge region, and a C-terminal ligand binding domain (LBD) containing the activation function 2 (AF2) and binding function 3 (BF3) regions (274).   The NTD of AR is the most variable domain with many observed variations including inserted glutamine (CAG) and glycine (GGC) repeats (275, 276).  The length of these repeats affects the folding and conformational changes of NTD explaining the dependency of AR transcriptional activity on the glutamine repeat length (277, 278).  For example, shorter glutamine repeats are correlated with higher AR transcriptional activity (279), and associated with higher risk of prostate cancer (97).  The deletion of these repeats results in an increased AR activation (a four-fold increase) compared with the wild-type protein (280).  The highly variable repeats (275, 276) gives more structural flexibility to the NTD which allows it to interact with many androgen responsive genes including prostate specific antigen (PSA), and transmembrane protease serine 2    31 (TMPRSS2).  In addition, the NTD contains the AF1 region which has two transcription activation units (Tau-1 and Tau-5) that are required for full activity of the AR (281).  Tau-1 and Tau-5 contain a nuclear receptor box FQNLF or WHTLF motif, respectively, which both are required for mediating the interactions between the AF1 NTD and AF2 LBD domains (referred to as an N\/C interaction) upon ligand-dependent activation (282-284).  This N\/C interaction improves the stability of the AR dimer complex and slows down the dissociation of the ligand (285, 286).  However, N\/C interaction is important for some, but not all, androgen dependent genes (282-284).  Moreover, the NTD domain has been shown to be activated by different protein kinase pathways in the absence of androgenic ligand binding. Unlike the NTD region, the DBD is the most highly conserved region between the members of the steroid hormone receptor family.  The DBD is composed of two zinc fingers motifs each consisting of four cysteine residues (287), which are important in recognizing specific DNA consensus sequences.  The zinc fingers direct the specificity and selectivity of AR-DNA binding to the androgen response elements (AREs) found in the promoter and enhancer regions to mediate the transcription of AR-mediated genes.  The probasin gene is a good example since ARE on its promoter is recognized by AR, but not GR (288, 289).  The LBD also shares a similar structure to different nuclear receptors and primarily mediates the interaction of AR with the heat shock and chaperone proteins while also mediating the N\/C interaction to stabilise the androgen binding to the AR (290).  Also, the LBD contains the hydrophobic pocket where AR ligands can bind.  The LBD has AF2 that mediates the N\/C interaction by acting as a lid to hold the androgen after binding, and forms the co-regulator binding sites (284, 291).  The nuclear localisation signal (NLS), responsible for transporting the AR receptor into the nucleus, is located between the DBD and hinge region.  Recently, the hinge region was found to play a role in DNA binding, coactivator    32 recruitment, and N\/C interaction (292, 293).  In addition, the DBD has the nuclear export signal (NES) to export the receptor back to the cytoplasm upon the withdrawal of the ligand (287).  1.7.3.1. AR signalling In an inactive state, the AR is found in the cytoplasm associated with the heat shock and chaperone proteins (288).   Upon androgen binding to the AR, a conformational change of the LBD in the AR is induced.  It has been reported that the synthetic androgen R1881 binds to LBD and induce conformational changes similar to those induced by DHT and testosterone (287).  This conformational change also results in the dissociation of chaperone proteins allowing NLS to be exposed (287, 288).  The exposure of NLS allows importin-\u03b1 binding and translocation of the androgen\/AR complex into the nucleus (294, 295).  Once in the nucleus, the AR dimerizes, recruits co-activators, RNA polymerase II, and other components of the basal transcriptional complex and binds to the AREs within the target genes in the genomic DNA to modulate gene transcription (296, 297).  The binding of those coregulators to the activated AR in a ligand-dependent manner either enhances (coactivator) or represses (corepressor) AR transactivation of the target genes through chromatin remodelling and histone modifications (290, 297).  In addition, AR cooperates with transcription factors such as STAT3, OCT1, FOXA1, and GATA2 which promote gene transcription through DNA looping and chromatin remodeling (298-301). Even though these extensive studies of AR pathway confirmed that AR dysregulation is primarily responsible for PCa progression (261, 264, 269, 273) and helped in developing the initial treatments for localized and advanced PCa (as discussed in section 1.8.), these treatments are merely palliative as resistance ultimately emerges due to the involvement of multiple environmental and genetic factors.  Thus, understanding the aetiology of PCa and what mechanisms are involved in mediating resistance to the current therapy is important.      33  1.8. Prostate cancer (PCa) 1.8.1. Prostate carcinogenesis  PCa is associated with three major risk factors including age, race, and family history (302, 303).  The most important factor is age as most the cases of PCa are reported in patients over the age of 65 years old (304).  Many genetic factors are disrupted during the aging process and could contribute in increasing the risk of PCa diagnosis, such as gene fusion, stochastic mutations, oncogene amplification, or oncogene rearrangement caused by DNA replication errors.  These factors alongside other environmental factors such as chronic inflammation could result in oncogenic cellular processes (76, 276, 279, 305-307).  In addition, black men were reported to have 60% higher PCa risk (308).  Also, men with a family history of PCa have 6-12 times higher chance to develop PCa, compared to others who don\u2019t have any family history (309).  Other factors such as high fat diets and germline mutations could also increase PCa risk (310-312). The role of chronic prostatic inflammation as a critical contributor in PCa carcinogenesis is becoming more evident.   An inflammatory microenvironment is initiated by TLR4 activation of prostate cells in response to LPS or other endogenous TLR4 ligands such as HSPs, and fibrinogen that are released from injured cells.  TLR4 activation initiates innate immune responses to infected or injured prostate cells, which result in the infiltration of different immune cells including lymphocytes, macrophages, or dendritic cells (313). These infiltrating immune cells can provide a sustained supply of different inflammatory mediators such as the production of pro-inflammatory cytokine (e.g., IL6, TNF\u03b1, TGF\u03b21, IL1\u03b2), ROS\/RNS, chemokines, growth factors and anti-apoptotic protein expression (313) .     34 Recurrent cell injury or cell death to the prostate epithelium occur, which could be a result of ROS\/RNS damage from the infiltrated inflammatory cells in response to pathogens or autoimmune disease, from a direct injury, from circulating dietary toxins, or from refluxed urine into the prostate.  The lesion from the injury is called proliferative inflammatory atrophy or PIA. These areas of PIA have been suggested to be the progenitor to PCa either directly or indirectly by progression to prostatic intraepithelial neoplasia (PIN) (314).  The relationship between prostate cancer and PIN lesions may provide a direct relationship of prostate cancer and inflammation.  Chronic inflammation in the benign prostatic tissue is correlated with high-grade PCa (315). An inflammatory effector Pentraxin 3 has been recognized as a biomarker for predicting tumor progression in response to prostatic inflammation in PCa (314).  PIN is usually characterized by the irregular epithelial cells that develop around all inflammatory cells (76, 305-307).  Morphologic studies have reported transition from PIA to PIN and from PIA to cancer (314).  The role of TAMs in PCa progression is very important.  TAMs cause tumor invasion and increase tumor angiogenesis, tumor metastasis, tumor proliferation and immunosuppression. Higher TAM levels were reported in malignant PCa compared to the benign tissue and higher Gleason score. TAM levels were higher than in prostatic intraepithelial neoplasia (PIN) compared with benign tissue. In addition, higher Gleason score was containing a higher number of TAM compared with the lower Gleason score. Therefore, TAMs play an important role in tumor progression and response to ADT (316).  IL10 immunosuppressive contribution on the tumor environment is thought to be mainly promoted by its inhibitory effects on different immune cells.  The focus of this thesis is determining whether IL10 action is not limited on its inhibitory effect on immune cells, and if IL10\u2019s direct stimulatory actions on epithelial cancer cells can also contribute to PCa progression independently of IL10\u2019s suppression of host immune cells.      35  1.8.2. Prostate cancer diagnosis  There are different guidelines for the prostate cancer diagnosis and prognosis.  So far, the most widely used methods to detect the early stage of PCa are digital rectal examination and serum PSA levels (304, 317, 318).  Invasive and metastatic PCa are characterized by recurrent painful urination, fatigue, weight loss, and lower back or pelvic or pain.  It is known that the increased PSA levels, which is regulated by androgen and AR signalling, are possibly caused by an interruption in the prostate cellular signaling leading to the diffusion of PSA levels into the blood (251).  However, PSA use as a diagnostic marker for prostate cancer has serious limitations and inconsistency since PSA levels correlation with cancer severity and stage is relatively poor, which undermines its use for disease grading  (319).  In addition, PSA is an organ specific marker, and it can be elevated in other conditions such as prostatitis (319).   The European Association of Urology (EAU) has suggested the newest diagnosis guideline, which is performing prostate biopsies that are directed by magnetic resonance imaging (MRI) or ultrasound when PCa is suspected (304, 317), followed up with tissue samples of the biopsies for further histopathological assessment evaluation by pathologists (318).  The most broadly used histopathological classification and grading system of PCa to grade the biopsy samples is the Gleason Grading system.  There are 5 grades in this system based on the tumor differentiation degree.  In 2015, a new Gleason system was suggested to be as a group system ranging from group 1-5 with group 5 being the most aggressive and worst prognosis group (320, 321). Another system that has been used for prostate cancer staging is the tumor, nodes, metastasis (TNM) system.  This staging method stages the tumour depending on their location, spread and invasion degree (322).  For example, T (1-4) indicates the tumor location within or nearby the    36 prostate tissue, N (0-1) refers to metastatic lymph node stage, and M (0-1) describes whether distant metastasis occurred.  Cell Cycle Progression Score and Genomic Prostate Score may also be used in PCa evaluation.   Some biomarkers that were discovered and evaluated to improve the diagnosis of PCa include prostate stem cell antigen (PSCA), TMPRSS2-ERG gene fusion, prostate membrane-specific antigen (PSMA), prostate cancer antigen 3 (PCA3), and circulating tumor cells (320, 323-326).  Finding the best prostate cancer staging and grading system and markers is very important since the treatment options of prostate cancer depend on its grade level as discussed in the next section.  1.8.3. Primary prostate cancer  The most common cancer occurring in Canadian men is prostate adenocarcinoma, and it mostly arises in the peripheral zone of the prostate (249).  The earlier stages of PCa are usually asymptomatic because of its slow growth and small size, unlike the invasive and metastatic PCa (304).  Usually the treatment of prostate cancer depends on its grade level.  For example, localized low grade PCa can be treated with radiation therapy and surgical resection, and the treatment outcome is usually positive.  However, in localized advanced PCa, the cancer is usually spread beyond the capsule of prostate gland into the nearby structures and tubes such as the seminal vesicle.  Thus, more aggressive treatments are taken into consideration such as the combination of radiation therapy with ADT treatments.  A more aggressive PCa phenotype is diagnosed when advanced localized PCa is spread to distant sites and is known as metastatic PCa  (304).  In this case, ADT treatments combined with other treatments such as chemotherapies are recommended (304, 327).    37 Since androgens are critically required for the growth of prostate cells and PCa cells, ADT remains the typical treatment for advanced PCa patients.  90% of the androgens are produced from the testes as a consequence of the stimulatory effects of LH on testes\u2019 Leydig cells.  Therefore, several ways of ADT are designed and used to reduce the levels of testosterone including surgical castration (orchiectomy), luteinizing hormone-releasing hormone (LHRH; GnRH) therapy, or anti-androgen drugs (273, 328-332).  While orchiectomy removes the source of androgen surgically, LHRH agonists can inhibit the production of LH.  Like endogenous LHRH, LHRH agonists stimulate the pituitary gland to produce luteinizing hormone resulting in androgen production from the testes.  However, chronic exposure to LHRH eventually suppresses testosterone production by downregulation of the LHRH receptors in pituitary cells (333).  One side effect of the LHRH initial therapy is the temporary increase of testosterone level (334), which could be countered by the administration of anti-androgens along with LHRH therapy (335).  Also, the use of anti-androgen treatment alone could be used as an ADT method to eliminate androgens\u2019 action.  Some of these anti-androgens include bicalutamide, flutamide, cyproterone acetate, and megestrol acetate (327, 336).  1.8.4. Recurrent prostate cancer as a castration resistant stage The recurrence of PCa is usually defined by either re-rising PSA levels or by metastasis of the disease after medical or surgical castration (337).  Even though the initial treatments with ADT are usually successful, almost all of ADT-treated locally advanced and metastatic PCa patients relapse within 2 years and progress to a more aggressive PCa phenotype termed castration resistant prostate cancer (CRPC) (57, 338-340).    38 1.8.4.1. CRPC development  CRPC is associated with recurring elevation in serum PSA levels and\/or tumor metastasis following surgical or medical castration.  This stage is metastatic, even if not in earlier stages, and is thereby also termed metastatic castration resistant prostate cancer (mCRPC), where sedative treatments are necessary (339).  Although androgen levels are abolished after ADT therapy, CRPC tumor cells can reactivate AR and initiate the progression of CRPC by different mechanisms (336, 341).   Patients diagnosed with mCRPC have a median overall survival of 2-3 years (342).  Even after the development of next generation androgen receptor pathway inhibition (ARPI) therapies such as ENZ and abiraterone that have increased the overall survival of CRPC patients, the beneficial outcome is short-lived since patients eventually develop resistance to these drugs (48, 343).   1.8.4.2. CRPC resistance mechanisms  Three main mechanisms of ARPI in CRPC tumors have been reported including Androgen-independent AR, androgen-dependent AR, and complete independency of AR signalling pathways.  The first pathway includes CRPC tumors that regain AR activity which is androgen independent (AR-dependent only) in response to ARPI therapy.   Mechanisms involved include: splice variation in AR which are constitutively active (344-346), rely on the activation of other steroid receptors such as GR (347, 348), or alter AR action in a receptor-dependent manner (59, 349).    Androgen-dependent AR signaling is the second mechanism observed in tumour cells to reactivate AR signaling pathway.   Tumour cells can do that by increasing AR gene expression, mutations, or amplification which allows AR activation using the low levels of endogenously synthesised adrenal androgens following ADT or ARPI (350-355), or a mechanism involves tumors increasing endogenously synthesised androgens by increasing intratumoral De novo    39 steroidogenesis synthesis (355-357).  These tumors that can retain AR activity and have luminal epithelial cell adenocarcinoma prostate cancer phenotypes.  Therefore, they are referred to as adenocarcinoma CRPC (AdPC).  Most of CRPC cells have this phenotype in response to ADT treatments or first round of ARPI.   However, it has been recently observed that two rounds or more of administration of more potent ARPI drugs is associated with consistent resistance to the drugs through a different mechanism.  This subset of CRPC tumors lose the luminal epithelial phenotype by switching to neuroendocrine (NE) lineage and acquiring NE features (358, 359).   Their ability to show lineage plasticity makes this subset of tumors able to be completely AR-independent by progressing into AR \u201cindifferent\u201d phenotype as a survival mechanism despite the expression of AR in these cells (47, 64).  These tumors are extremely aggressive and metastatic, and no effective treatments are available for this subtype of CRPC.  Another rare subset of CRPC tumors that has been recently recognized is the double-negative tumor.  This subtype of tumor does not show AR expression or NE characteristics (360), and highly activate FGF and MAPK pathways which were reported to promote resistance to ARPI.  It remains unknown how PCa cells develop into different lineages such as AdPC or neuroendocrine prostate cancer (NEPC).  Therefore, it is necessary to understand different mechanisms that confer resistance to ARPI treatment, and whether choice of therapy is mainly what drives PCa resistance.    1.9. Treatment-induced neuroendocrine prostate cancer (t-NEPC)  Neuroendocrine prostate cancer (NEPC), also known as small cell carcinoma (SCC) of the prostate, was first described in 1977 as a lethal subset of PCa (361).  This primary NEPC (de novo)    40 of cancer rarely occurs in prostate cancer patients and comprises only 2% of PCa cases (362).  However, autopsy reports from CRPC patients revealed that NEPC presence is up to 25% (40).  Recent reports suggest that treatment-induced NEPC (t-NEPC) is distinct from primary NEPC since it arises from pre-existing prostate adenocarcinoma, with higher occurrence in CRPC patients who received ARPI (363, 364), radiation therapy (365) or chemotherapy (49).  39% of tumors that are resistant to more potent AR-targeted drugs, such as ENZ and abiraterone, displayed either intermediate or pure NEPC (48).  t-NEPC is considered a clinical challenge for different reasons.  Firstly, this phenotype is under-diagnosed.  Diagnosis of this phenotype requires a tumor biopsy to evaluate NE-clinical features, which are rarely taken from patients with mCRPC.  Also, since it is mostly ARPI treatment-induced and PSA that is used as a biomarker to monitor ARPI efficiency, the low or no levels of PSA in t-NEPC contribute to under-diagnosis until later stages.  In addition, t-NEPC patients no longer benefit from ARPI therapies, and these cells are highly aggressive and metastatic resulting in around 7 months of survival after diagnosis.  t-NEPC has been under-studied until recently (40, 366, 367), and has no effective targeted therapy available in clinical settings so far.  Therefore, more studies are necessary to help distinguish t-NEPC by identifying more molecular biomarkers in hopes to improve the current diagnostic features that mostly depend on morphological characterization.   1.9.1. Characteristics of t-NEPC In comparison to adenocarcinoma, primary (de novo) NEPC is recognized in clinical settings by the presence of small cell carcinoma (SCC) that are associated with morphological features including: a proliferation of small cells with unique and strict morphological features including: finely granular chromatin, a scant cytoplasm, poorly defined borders, absent or abnormal nucleoli,    41 and a high mitotic and apoptotic count (362).  Also, the diagnosis of NE can be confirmed by positive expression of NE differentiation markers in tumor cells such as chromogranin (CgA), synaptophysin (SYP), and neuron specific enolase (NSE) (368).  Another marker that has been identified recently as a sensitive and specific NE marker is Forkhead box A2 (FOXA2) (369) whereas FOXA1 (370), a related transcription factor inhibits NED.  Other known SCC markers include the positive expression of CD56 (362), P53 (362), thyroid transcription factor-1 (TTF-1) (362), and CD44 (371) and negative expression of Rb (372) and cyclin D1 (373).   However, it should be noted that t-NEPC is difficult to define by morphological characters because of the overlap between both AdPC and t-NEPC during the transition process which could include molecular and morphological alterations, resulting in several intermediate transitional phenotypes (299, 374).  For example, AR and PSA can be positive (375) in the transition period from AdPC to NEPC while usually there is low or no PSA \/AR expression in NEPC (376), which could account for the misdiagnosis of ARPI-treated patients developing NEPC. 1.9.2. Development of t-NEPC How t-NEPC develops in response to ARPI is still largely unknown.  Due to the features that were observed in t-NEPC, the origin of NE-like cells is thought to be derived from either the normal NE cells that found scattering in the prostate or existing adenocarcinoma prostate cancer cells.  Since t-NEPC cells express the markers found in normal NE cells, it was originally speculated that these cells were derived from normal NE cells in the prostatic gland (377).  Examples of normal NE markers that were detected in NE-like cells include p63 and high- molecular-weight cytokeratin (377).  In agreement with this theory, since AR-dependent cells require androgens for their survival and ADT is directed to destroy AR-dependent cells, the normal    42 NE cell population that lack AR are able to survive ADT therapy and expand which makes them more persistent (378, 379).  However, this hypothesis was not confirmed (378, 379). Accumulating evidence suggest t-NEPC cells are derived from AdPC differentiating into NE-like cells that eventually becomes NEPC.  In a patient-derived xenograft (PDX) model, it has been observed that castration of the mouse resulted in the cell transformation from adenocarcinoma to NEPC phenotype (39).  Chronic castration resulted in the loss of luminal signature gradually and was associated with an increase in the NE signature.  Similarly, whole-exome sequencing has revealed that both t-NEPC and AdPC cells in patients carry similar gene mutations and genomic changes (40, 41).  For example, REST downregulation, a transcription factor that induces suppression of neuronal differentiation, was observed in NEPC and CRPC patients who later developed NEPC (42).  Also, an identical mutation in the DBD of the tumor-suppressor gene, TP53, has been reported in both NEPC and PCa cells (43).  In addition, Aurora kinase A (AURKA) and N-Myc (MYCN) gene upregulation has been reported in advanced PCa patients who were observed at a higher rate in patients with NEPC, indicating a relationship between PCa and t-NEPC cells (40, 44).   Moreover, xenograft models have reported loss of AR activity, suggestive of NE differentiation to AR-independent state in NEPC, as a mechanism of resistance to ENZ (41, 45-47). These data support the hypothesis that existing AdPC cells may have differentiated into NE phenotype at some point in its progression.  Interestingly, this NEPC progression is uncommon in patients who did not receive any prior ADT while it is increased in CRPC patients with ARPI resistance (41, 46).  One study has reported that an RNA splicing factor, SRRM4, is upregulated in AdPC patients who have received maximal ADT.  This upregulation of SRRM4 resulted in splicing REST to drive NEPC tumor development (310).     43 Consistent with the AdPC origin of t-NEPC cells is the ability of LNCaP cells (that are rich with a luminal adenocarcinoma phenotype and express of AR and PSA) to convert into a NE-like phenotype displaying cell morphology changes and expression of NE markers after androgen removal (380).  Other studies have reported that NE phenotype may also be induced by other stimuli including IL1 (54), IL2 (54), IL6 (51, 56), and IFN\u0264 (53) or growth factors such as fibroblast growth factor receptor 2 (FGFR2IIIb) (50, 52).  Different signaling molecules and pathways have been shown to contribute to the process such as MAPK pathway (381), PGE2 (55), and activated cAMP-dependent PKA (382, 383).  However, it should be noted that the LNCaP model only produces NE-like cells in a non-proliferative state, similar to NE cells in adenocarcinoma but not to those in t-NEPC that are extremely proliferative and aggressive (299, 384, 385).  Due to the ability of different stimuli and signaling pathways to induce a similar NE phenotype, it is possible that this phenotype is a transient default state for the cells to survive under stressful conditions and does not necessarily drive cells into a complete t-NEPC phenotype.   In short, there is no direct evidence so far that t-NEPC result from the expansion of resident NE.  However, ARPI therapy (47) and various microenvironmental factors (50-54) were shown to induce NE-like marker expression in PCa cell lines through an intermediate NE-like state, which increases the possibility of AdPC differentiation into t-NEPC.  1.9.3. Induction of t-NEPC vs. NE-like differentiation (NED) An abundance of evidence shows that factors inducing NE-like differentiation (NED) are not necessarily responsible for driving them into the t-NEPC stage (299, 384, 385).  For example, the canonical effects of TP53\/Rb1 deficiency are important to promote cell survival and proliferation, and is responsible for allowing AdPC to undergo a multi-lineage plasticity state, which could    44 provide AdPC cells with a good chance to differentiate, but is not specifically driving them toward t-NEPC (386, 387).  AdPC cells can also acquire NED by overexpressing BRN2, N-Myc, EZH2, SOX2, and heterochromatin protein 1\u03b1 (HP1\u03b1) or inhibiting the expression of FoxA1, and AR (41, 47, 367, 370, 388).  In addition, AdPC cells can undergo transient NE phenotype, and NE- like morphology by ARPI, IL6, cAMP, hypoxia, and radiation treatments in vitro (51, 365, 385, 389, 390).  Yet, few of these factors allow the establishment of t-NEPC xenografts that is observed in vivo.  These results highlight the fact that AdPC cells can acquire NED through several mechanisms, yet the induction of NE-like morphology and NE markers expression are not sufficient enough for t-NEPC tumor progression (299, 384, 385).  This illustrates that there must be other driver genes that are required to drive the direction of NED toward t-NEPC tumorigenesis.   The function and expression levels of different transcription factors contribute to the establishment of t-NEPC, as the transcriptome of AdPC and t-NEPC are very distinct (40, 42, 310, 366).  In Rb1 and TP53 knockout LNCaP cells, the transcription factor SOX2 is upregulated (388).  This transcription factor is an important development factor that is crucial for pluripotency and self-renewal.  SOX2 deficiency can interfere with ARPI-induced lineage plasticity in Rb1 and TP53 knockout LNCaP cells (388).   In addition, recent reports have shown that BRN2, a POU-domain transcription factor, can significantly promote t-NEPC development and NE-like protein expression along with SOX2 in CRPC cell lines (47).  Also, HP1\u03b1 was reported to promote NED and inhibit AR and REST expression through inhibiting trimethylated histone H3 at Lys9 (H3K9me3) mark on their particular gene promoters (391).  Epigenetic modifiers also play a very important role in lineage plasticity for the development of t-NEPC tumors.  It has been shown that the status of DNA methylation in AdPC and t-NEPC tumors is significantly different.  For example, the histone methyltransferase (EZH2) expression    45 level is enhanced in t-NEPC tumors (40, 366, 392).  Recent reports have demonstrated that elevated EZH2 activity can repress AR signaling and promote an increased PI3K\/AKT pathway activation to develop t-NPEC phenotype (367).  These data suggest a potential pathway by which epigenetic reprogramming and modifications can drive t-NEPC development.  The fact that t-NEPC is mainly driven by epigenetic modifications more than genetic changes (40, 392), indicates that differentiation of NE can be reversible when the driving factors are compromised (367).    In short, NE differentiation is very different from the extremely aggressive t-NEPC tumors and more biological changes are required for AdPC tumors with NED phenotype to progress into t-NEPC tumors.  However, the involvement of different microenvironment factors in inducing NED such as PGE2 (55) or IL6 (51, 56) raise the potential of their involvement in the transition phase of t-NEPC development perhaps by modulating the expression of different transcription factors and intracellular molecules needed for initiating t-NEPC development.   1.10. Prostaglandin (PG) E2  Prostaglandin E2 (PGE2) has been implicated involved with immune responses, tumorigenesis and progression of different types of cancer (393, 394).   PGE2 is known to bind to the sub-group, E-type prostaglandin receptors (EP1-4).  The involvement of PGE2 in different inflammatory and cancer diseases directed more attention to its downstream signalling pathway.  Among EP receptors that mediate PGE2 signalling, EP4 is the one most implicated in inflammatory diseases (395) and cancer (63).   I became interested in EP4 because previous studies in our lab found EP4 to be an IL10-induced gene (396).     1.10.1. PGE2 production Different prostaniods including PGE2, PGI2, PGD2, PGFa2, and thromboxane (TXA2) are    46 produced from the arachidonic acid breakdown through several enzymatic reactions.  At first, the cell membrane releases arachidonic acid; this breakdown is initiated by phospholipase A2 (PLA2), which hydrolyses the arachidonic acid Sn-2 bond, so arachidonic acid is freed from the cell membrane.  Then, a 15-hydroperoxy group is added to arachidonic acid by cyclooxygenase (COX) leading to its cyclization into a PGG2 product.  The resultant hydroperoxy group of PGG2 is then reduced by cyclooxygenase leading to the formation of PGH2.  Next, PGH2 is converted into individual prostanoids by PGE synthases.  One of these prostanoids is PGE2, which binds to and activates the four EP receptor subtypes (EP1-4).  These receptors activate specific signal transduction pathways by coupling to different G proteins.  Along with PGE2 formation, other prostanoids that are also formed from PGH2 are PGI2, TXA2, PGD2 and PGF2\u03b1.  In addition, PGE2 can be also converted to PGA2 (397) (Figure1.3). Regulation of PGE2 production may occur at several stages during arachidonic acid metabolism.  For example, PLA2 activity determines the availability of arachidonic acid for prostanoid synthesis, while transcriptional regulation of COX isoform-2 (COX-2) (or in other cases COX-1) and PGEs by different growth factors and cytokines demonstrate how much enzyme is available (397, 398).  For PLA2 regulation, several pro-inflammatory cytokines can induce PLA2 expression such as LPS, TNF\u03b1, and interleukin-1\u03b2 (IL1\u03b2) (399, 400), indicating its involvement in immune responses.  In addition to its enzymatic activity, secretory PLA2 (sPLA2), whose expression is restricted to the human immune system and gastrointestinal tract tissues, increases prostanoid synthesis by enhancing COX-2 gene expression (401). Interestingly, PGE2 levels increase during inflammation through synthesis by COX-2 (398).  Both COX isoforms synthesize inflammatory and anti-inflammatory prostaglandins (PGE) from arachidonic acid (AA) (Figure 1.3) (397).  While COX-1 expression is constitutively expressed,    47 COX-2 is usually absent from immune cells but its expression can be induced in response to different stimuli such as LPS, similar to sPLA2, indicating their involvement in immune responses (395, 402).  Deletion of COX-2 and COX-2 specific inhibitors exacerbated colitis in mouse models (403), suggesting PGE2 derived from sPLA2 and COX-2 has over-riding anti-inflammatory actions.  Increased PGE2 levels can activate EP4 leading to the inhibition of pro-inflammatory cytokines production and the reduction of colitis (398, 402-405).  Extremely high levels of PGE2 has been reported in prostate cancer (406), and was shown to promote cancer cell proliferation, growth, invasion and metastasis (407).  Moreover, PGE2 was determined to synergistically induce neuroendocrine differentiation in PCa cells (55).  Many reports also indicated the involvement of COX-2 (408), heterotrimeric G-protein subunit alpha (50), cAMP (51), and cAMP-dependent kinase particularly, PKA (382) in promoting NE phenotype in PCa cells.  All these observations indicate a direct association between PGE2 and NED.  Even though COX-2 inhibitors were shown to be effective and reduced the growth of PCa cells, such drugs are avoided for their known side effects as cardiovascular complications (409).    PGE2 activation of EP4 in prostate cancer cells is being an active subject in research since PGE2 has been reported to be involved in promoting mCRPC (63) and NED (55) resulting in more aggressive phenotype in prostate cancer.     48  Figure 1.3  PGE2 biosynthesis and receptors.  Liberated Arachidonic acid from membrane phospholipids by phospholipase A2 enzyme activity is converted to the endoperoxide PGG2 and then reduced to PGH2 by the action of COX- 1 and 2 enzymes.  PGH2 synthases results in the formation of PGE2, which binds to and activates four EP receptor subtypes, EP1-4 receptors.  These receptors are coupled to different G proteins leading to subsequent activation of specific signal transduction pathways. Other prostanoids are also formed from PGH2 including PGI2, TXA2, PGD2 and PGF2\u03b1.   Electronic permission was granted from Springer Nature [Nature Chemical Biology], License number 4725541098950.  Toyoda, Y., et al., Ligand binding to human prostaglandin E receptor EP4 at the lipid-bilayer interface.  Nature Chemical Biology.  Copyright \u00a9 (2019) (410).    1.11. Prostaglandin EP4 receptor The PGE2 receptor EP4 (encoded in mouse by the Ptger4 ) receptor has been reported to elicit anti-inflammatory actions (398, 402, 404).  EP4 is a 513 amino acid protein, which is one of the four surface PGE2 receptors (37).  EP4 is mapped to human chromosome 5p13.1 (411) and the mouse version originally cloned from mouse mastocytoma cells as an EP2 receptor subtype (412), but later on found to have pharmacological activities induced by several ligands that are distinct from EP2 receptor (412, 413).    49 EP4 is a member of G protein-coupled receptor (GPCR) superfamily, also known as the seven-transmembrane receptor family and belong to the prostaniods subfamily (414).  In the human proteome, GPCR comprises the largest family of membrane receptors which respond to diverse stimuli including neurotransmitters, hormones, chemokines, ions and more (415).  Thus, GPCRs have significant functions in a wide range of physiological processes including the sensory receptors that known to mediate vision, taste, and smell.    This family of receptors are drugs target for almost 30% of FDA approved drugs (416, 417), and they have been implicated in different therapeutic therapies including the treatment of inflammatory diseases, cardiovascular diseases, obesity and pain (417, 418).   All GPCRs share similar structural characteristics including a common seven-transmembrane-helical fold.  The structure of the transmembrane domains is highly similar among different members in the same family, which is critical for the transduction of a signal across the cell membrane (415).  The transmembrane domains are connected by three flexible extracellular loops, and three intracellular loops (415).  The extracellular domains are mostly involved in ligand-binding while the intracellular loops and the C-terminal tail are responsible for signaling.  An interesting feature of ligand binding to GPCRs is the ability of different agonists which bind to the same GPCR to induce different conformational changes and signalling  (419, 420).  This \u201cbiased agonist\u201d binding can favour a specific G protein coupling or induce \u03b2-arrestin binding for G\u03b1 protein-independent signalling and internalization or recycling of a receptor (421-431).  Biased ligand binding induction of distinct conformations lead to recruitment of specific G protein-coupled receptor kinases (GRKs) phosphorylation which determine the downstream signaling response (432, 433).  Biased signaling raises the possibility of creating drugs that activate desired    50 signaling pathways without stimulating harmful ones and dramatically reducing drug side effects (419, 420).   1.11.1. EP4 in disease  Activation of EP4 by PGE2 has been implicated to exert anti-inflammatory effects (405, 434) as well as increase the risk of colitis-associated cancer (435), aortic aneurysm (436), RA (437), osteoporosis (438), mCRPC (63), and autoimmune disease (439).  EP4 signalling in the various target cells differs because of different expression of or coupling to downstream signaling molecules (414).  1.11.2. EP4 role in immunity and inflammation The expression of EP4, but not the other PGE2 receptors, is abundantly increased in activated macrophages, which suggest its involvement in regulating immune responses in macrophages (395).  Studies of EP4 knockout mice have confirmed that EP4 is responsible for the anti-inflammatory activity of EP4\u2019s endogenous agonist PGE2 (405, 434) and other exogenous agonists in inhabiting inflammatory responses associated with inflammatory diseases  (398, 404, 405, 440). Targeted disruption of the EP4 gene in decreases PGE2-mediated inhibition of TNF\u03b1, IL6, and IL12 in LPS-activated mouse macrophages (441).  EP4 knockout mice are more susceptible to induced experimental colitis (398, 404).  EP4 mRNA levels are upregulated (with no change of EP1\u20133 mRNA levels) in induced colitis mice (398) and the use of EP4-specifc agonists inhibited the induced severe colitis in wild type mice (398) or rats (404).  EP4 but not EP1-3 mRNA levels rise in colitic mice (398, 404) suggesting an important role for EP4 but not the other PGE2 receptors in colitis. Table 1.2 summarizes studies of EP4 knockout mice.       51 Table 1.2    Phenotypes of EP4 deficient mice Mice knockout  Effect of EP4 knockout  Observation References EP1,2,3,4  Significant increase in inflammatory cell infiltration into the lung tissue only in EP4 knockout mice Endogenous PGE2 is suppressing inflammation via EP4 receptor activation (405) EP4  More susceptible to experimental colitis induction and developed severe colitis EP4 is important to mediate PGE2 inhibitory effects and prevent colitis (398, 404) EP1,2,3,4  Only EP4 knockout mice developed severe colitis with DSS treatment  Reduced expression of genes involved in immunosuppression, tissue defense, and remodeling, tissue defense while increased expression of IFN-\u03b3 \u2013induced genes  Expression of the EP4 gene is significantly induced wild-type mice in association with DSS treatment PGE2 mediates its inhibition of colitis by EP4 receptor (398)  In humans, genome-wide association studies (GWAS) have correlated EP4 polymorphisms with inflammatory diseases including Crohns disease (442-444) (Table 1.3), and allergy (445).  EP4 receptor levels are elevated in the colon during IBD in human (446), suggesting a failed attempt to reduce inflammation.  PGE2 levels also were shown to be increased in inflamed mucosa (447), which may be a result of an physiological attempt to enhance the ability of endogenous PGE2 to reduce exacerbation of IBD.  The protective role of EP4 in inflammation has also been confirmed by characterising EP4-selective agonists in treating inflammatory diseases such as asthma (405), and colitis (398, 404, 440) (summarized in Table 1.4).  The EP4 specific agonist Rivenprost (ONO-4819CD, AE1-734) is being evaluated for treating inflammatory disease in humans, and has shown efficacy in phase II trials in ulcerative colitis (440).    Table 1.3   Single nucleotide polymorphisms (SNP) of Ptger4 and its association to inflammatory bowel disease IBD and\/or Crohn\u2019s disease Polymorphism location Allele Observation Outcome Reference 5p13.1  rs4495224 and rs7720838 Strongly correlated with increased EP4 expression levels contradicting the results in EP4 knock-out mice that are more susceptible to induced colitis  5p13.1 contributes to Crohn\u2019s disease susceptibility  Identified as substantial parts of binding sites for the transcription factors NF-\u03baB and XBPI, which are involved in the transcription of EP4, and showed higher binding scores in the Crohn\u2019s disease risk alleles (443) rs4613763 Not yet fully understood (444)      52 Table 1.4   Effects of agonists and antagonists of EP4 actions on inflammatory responses EP4 Selective Agonists Ligand Effect on inflammatory diseases Observation References PGE2 Inhibits ulcerative colitis   Inhibits MCP-1, TNF\u03b1, JE, RANTES, IP-10, IL12 production  Tested in LPS-induced macrophages  Inhibition of MCP-1, TNF-a, JE, RANTES, IP-10, IL12 production (404)  (395)     ONO-AE1-329  Inhibits ulcerative colitis in DSS-induced rats  Inhibits cytokine release (TNF\u03b1 and IL6) from LPS-stimulated human (THP-1) and mice (J774) macrophages  Retained high subtype selectivity   Tested in LPS-induced macrophage  (404)   (405)  ONO-4819CD (ONO-AE1-734, rivenprost) DSS-induced wild-type mice recovered from severe colitis  Effective in treating patients with mild-to-moderate UC who were resistant to first-line therapy (5-ASA) optimized in terms of stability and agonist activity      In phase II clinical trials for ulcerative colitis  (398)    (440) KAG-308   inhibits TNF\u03b1 secretion in whole blood peripheral cells  suppresses the onset of DSS-induced colitis and promotes mucosal healing   Advantageous when compared with ONO-4819CD owing to its oral bioavailability  lowered risk of colorectal carcinogenesis    Its safety was evaluated in a Phase I clinical trial    (448) EP4 Selective Antagonists L-161982 completely reverses PGE2-mediated suppression of chemokine production in LPS-treated human macrophages  Tested in LPS-induced macrophages  (402) ONO-AE3-208 Inhibits recovery of ulcerative colitis in DSS-induced rats  Impairs the agonist-induced inhibition of cytokine production (TNF\u03b1 and IL6) in LPS-stimulated human (THP-1) mice Used in vivo   Used in vitro, and Co-administered with LPS+\/- agonists with different concentrations of antagonists (398)   (405)     1.11.3. EP4 in prostate cancer EP4 activation by its ligand PGE2 has been reported to promote the proliferation of PCa cells by regulating different kinase pathways such as PI3K\/Akt and PKA (449).   EP4 levels are upregulated in prostate cancer xenografts grown in castrated nude mice compared to xenografts in intact mice, suggesting involvement of EP4 in the development of CRPC phenotype (63).   In human prostate cancer cell lines, EP4 expression levels were higher in PCa cells which represent more aggressive stages of the disease (63, 450).  Elevation of EP4 was also confirmed in prostate cancer specimens compared to benign prostate tissue (450).  Moreover, LNCaP cells which overexpress EP4 were shown to be more invasive than control LNCP cells (451).  In fact,    53 the use of a potent selective EP4 antagonist, ONO-AE3-208, inhibited the progression of metastatic castration-resistant phenotype in vivo and reduced cell proliferation, invasion and migration in vitro, confirming that EP4 is associated with the progression of metastatic phenotype of PCa in cAMP-PKA dependent manner (451).  The EP4 selective antagonist, ONO-AE3-208, also inhibited expression of the metastasis-related gene expression MMP9 and runt-related transcription factor 2 (RUNX2) of human prostate cancer lines  (450).  In addition, EP4 siRNA knockdown inhibited growth of DU145 metastatic androgen-independent cells (450).    Abnormal expression of metastasis-related genes including MMPs, receptor activator of nuclear factor-\u03baB ligand (RANKL) and RUNX2 are involved in cell growth and bone metastasis, and induced through cyclic cAMP-PKA and PI3K-Akt signaling pathways in many types of cancer cells (452).  PGE2 and AC agonists increases the expression of MMP2, MMP9, RANKL and RUNX2 proteins in PCa cells (449).  EP4-upregulated levels of these proteins were impaired in response to AC or PKA (449) and PI3K inhibitors significantly inhibited the EP4 receptor- upregulation of these protein expression as well, indicating that EP4 receptor acts through the cAMP-PKA and PI3K-Akt dependent pathways (449).    1.11.1. EP4 signaling 1.11.1.1. Classical activation Binding PGE2 to a binding pocket formed by the side chains of ECL2 and TMs 1\u20133 and 7 on EP4 (410), induces a structural rearrangement in the transmembrane core region which leads to a conformational change in the transmembrane helix bundle and the intracellular region at the cytoplasmic side (410).  These conformational changes enable interaction with intracellular effectors such as G proteins (453).  Several studies have proposed that ICL2, and the N- and C-   54 terminal regions of ICL3 are G protein interacting sites on GPCRs (453).   In addition, the ICL1 and some residues of C-terminal could contribute to the coupling of G proteins (453).   Binding of an agonist alone may not be sufficient enough to stabilize a full active conformation of GPCRs, and binding of additional intracellular proteins such as a G protein or \u03b2-arrestin, at the cytoplasmic side may stabilize the active state (453).  The GPCR bound G proteins, arrestins and other cytoplasmic proteins can regulate intracellular signaling cascades (453).  G proteins consists of \u03b1, \u03b2 and \u03b3 subunits forming a heterotrimeric complex (454).   The \u03b1, \u03b2 and \u03b3 subunits consists of isoforms each with specific downstream signaling profiles (455).  GPCRs have the ability to interact with multiple G\u03b1 family members.  Thus, the outcome of GPCR signaling depends on the GPCR interaction with G protein subunits and their cytoplasmic effector proteins in response to a stimulus in any given cell (455).  The G\u03b1 proteins are divided into several sub-families depending on sequential and functional similarities, each of which has a characteristic signaling profile.  EP4 can activate and interact with multiple members in the G\u03b1 family including G\u03b1 \u2018stimulatory\u2019 (G\u03b1s) subfamily (37) and G\u03b1 \u2018inhibitory\u2019 (G\u03b1i\/o) subfamily (456, 457) in different cell types.   In the inactive guanosine diphosphate (GDP)-bound state, the heterotrimeric complex is attached to the plasma membrane by acyl chains on the \u03b1 and \u03b3 subunits (454).  Upon ligand binding to the GPCR, the C-terminal tail of the GPCR interacts with the G-protein heterotrimeric complex, causing  a conformational change in the G\u03b1 subunit which stimulates  exchange of GDP for GTP (458).  The GTP-bound G\u03b1 subunit dissociates from the \u03b2\u03b3 dimer and the receptor (Figure 1.5) (459).  Then, the activated G\u03b1 and G\u03b2\u03b3 can regulate downstream signalling pathways.  Intrinsic GTPase activity in the G\u03b1 subunit hydrolyse GTP to GDP to return to the inactive state, terminating signalling.  G\u03b1 and G\u03b2\u03b3 re-associate forming the inactive heterotrimer (460, 461).     55 While G proteins can resume the cycle of GDP\/GTP exchange to continue being activated, the signal is completely stopped when the ligand is unbound from the receptor, the receptor becomes internalized, or the GPCR undergoes desensitisation by multiple mechanisms involving GRKs and arrestins (425-427).  PGE2 activation of EP4 receptor signaling is cell type dependent (455).  Activation of EP4 by PGE2 activate different G\u03b1 in different cells including G\u03b1s (cAMP) in macrophages (405), G\u03b1i (PI3K) (397, 435) and \u03b2-arrestin (462) in cancer cells, and G\u03b1i (PI3K) and G\u03b1s (cAMP)  in T- cells and dendritic cells (439).  In colorectal carcinoma (397, 435) and breast cancer (463), PGE2 activation of EP4 signalling leads to PI3K and Akt activation.  In prostate cancer, both cAMP and PI3K signalling were implicated in promoting survival of metastasis of PCa cells (456).  1.11.1.2. EP4 mediated signaling in macrophages EP4 receptors signal via activation of Gs alpha subunit (G\u03b1s) and adenylyl cyclase (AC) by increasing intracellular cyclic adenosine monophosphate (cAMP) levels in macrophages (405, 464, 465).  cAMP signaling-mediated inhibition of TNF\u03b1  mRNA expression involves activation of protein kinase A (PKA) (405, 466) which phosphorylates and activates the CREB transcription factor (467).  CREB binds to cAMP response elements (CREs) in the promoter of different target genes.  Another signalling pathway mediated by EP4 receptor-associated protein (EPRAP) (395).  When EPRAP interacts with EP4, EPRAP can inhibit LPS-activated NF-kB by inhibiting phosphorylation and degradation of the NF-kB inhibitor protein p105 (395).  Table 1.5 summarizes reported EP4 receptor signalling in macrophages and monocytes. 1.11.1.3. EP4 mediated signaling in epithelial prostate cancer cells EP4 receptors activated G\u03b1s G-proteins leading to cAMP-PKA signalling (449), and stimulated PI3K-AKT pathway through non-canonical mechanism (449) to promote survival and    56 metastasis of PCa cells (456).  Xu et al., proposed that phosphorylation of EP4 receptor can recruit \u03b2-arrestin1, which results in the activation of cellular Src kinase to initiate the transactivation of the epidermal growth factor receptor (EGFR) and the subsequent downstream signaling through PI3K and Akt (449).  A similar EP4 and EP1 pathways were reported in hepatocellular carcinoma cells, where Akt was activated in result of EP4- or EP1-induced EGFR transactivation by forming a complex with EGFR and Src (468).   Figure 1.4  EP4 Signalling Upon ligand binding, G\u03b1 binds to the GPCR and promotes GDP\/GTP exchange.  GDP\/GTP exchange allows the dissociation of the G\u03b1 and G\u03b2\u03b3 subunits and promote G\u03b1 protein- dependent and independent signalling pathways.      Table 1.5  Reported EP4 receptor signaling pathways in macrophages and monocytes Tissues\/Cells Reported Functions  Proposed Effector Pathway(s) References Macrophages, Monocytes Inhibition of TNF\u03b1 production Inhibition of MCP-1 production EPRAP  (402) Monocytes Inhibition of TNF\u03b1 production N\/A (403)  BMDM Inhibition of MCP-1, TNF\u03b1, JE, RANTES, IP-10, IL12 production EPRAP  (395) Macrophages Inhibition of IL6 and TNF\u03b1 production cAMP (PKA) (405) THP-1 monocytes  Increased IL10-mediated STAT1 and STAT3 phosphorylation Increased IL10 SOCS3 Inhibited IL6- mediated STAT1 and STAT3 phosphorylation cAMP (464)  G\u03b2GTP GDPGDPG\u03b1SRC\u03b2-arrestinPI3K\u03b2G\u03b3G\u03b1G\u03b2G\u03b3 G\u03b1GDPG\u03b2GRKG\u03b1PACATPcAMPPKACREBP PG\u03b3GTPG\u03b2\u03b3 -dependentsignallingor\u03b2-arrestin G\u03b2GSk3\u03b2\u03b2catG\u03b3G\u03b1   57 1.12.   Interleukin-6 (IL6) in disease IL6 role in the development of autoimmune\/inflammatory (469, 470) or cancer (471) has been extensively studied.  IL6 has diverse functions on immune and non-immune cell types (472).  IL6 is produced by immune cells, mesenchymal cells, endothelial cells, and fibroblasts (472), and it stimulates pro-inflammatory responses on macrophages (469).  Abnormal upregulation of IL6 expression is associated with different inflammatory diseases including Castleman\u2019s disease (473), multiple myeloma (474), and RA (475), and various other autoimmune and chronic inflammatory diseases.  Studies using antibodies against IL6 or its receptor have confirmed IL6\u2019s role in promoting pro-inflammatory or autoimmune diseases (469, 470). IL6 overexpression has been reported in almost all types of tumours (471).  IL6 promotes tumorigenesis by inducing selective apoptosis, cancer cell survival, proliferation, angiogenesis, invasiveness and metastasis (476).  In prostate cancer, increased levels of IL6 were associated with a poor prognosis  (476).  1.12.1. IL6\u2019s role in epithelial prostate cancer Elevation of IL6 levels is associated with castration resistance, and is used as biomarker for poor prognosis (477).  Similar to IL10, IL6 plasma levels are significantly increased in patients undergoing ADT with higher levels observed in ENZ-resistant patients compared to ENZ-sensitive patients (62).  IL6 stimulation of JAK-STAT3 signaling was reported to modulate AR activity and expression levels (57, 478, 479), which could contribute to tumour progression. 1.12.1.1. IL6\u2019s multiple effects on androgen-sensitive and resistant cells   The NE phenotype can be enhanced by factors in the tumour environment such as IL6 cytokine (51, 56).  The action of IL6 on PCa cells has been extensively studied (480).  Although IL6 was    58 reported to induce pro-proliferative effects on androgen-independent cells (481), contrasting results were reported in LNCaP cells showing either anti- or pro- proliferative (482, 483). LNCaP cells stably transfected with IL6 cDNA showed stimulatory growth effects that were more apparent in the androgen deprived conditions (479, 484).  These observations confirm that cells with endogenous, constitutive IL6 expression are able to upregulate cell growth that is best seen in the absence of androgen.  On the other hand, other reports have shown administration of exogenously IL6 inhibited LNCaP growth and induced NE differentiation.  The growth inhibitory effect of IL6 (482) was STAT3 dependent (57, 58).  Impaired LNCaP growth is associated with a NED and G1 growth arrest associated with higher expression of cell cycle inhibitors such as cyclin dependent kinase inhibitor p27 (485).  These cells also showed high expression levels of neuropeptides, and are known to be associated with potent secretion of neurohormones, including gastrin\/bombesin, calcitonin and parathyroid hormone-related peptide, which in turn induce a paracrine stimulatory prostate growth (368).   The duration of IL6 stimulation is another factor that determine IL6\u2019s effects on LNCaP cells.  IL6-induced NED in short-term treatments (20-40 passages) associated with lower AR expression.  In contrast, with long-term IL6 exposure (41-70 passages (486)) or (42-58 passages (484)), IL6 did not inhibit growth nor induce expression of NE-associated proteins (484, 486).  With respect to signalling mechanisms, cell lines which were exposed to IL6 for a long term showed lower AR expression and were associated with enhanced IL6-induced MAPK activity pathway (and normal STAT3 phosphorylation) (478).  The contrasting effects of IL6 are thought to be due to differences in AR coregulator expression levels rather than the accumulation of different receptor mutations after long treatments (487, 488).  For example, it has been reported that p300 and SRC-1 cofactor expression are required for IL6-induced AR activation (487, 488).  The varying observed effects    59 of IL6, depending on the experimental system and PCa cell stage (484), explains why IL6 may have different roles at different stages in a patient\u2019s PCa course. As mentioned above, in vitro studies suggest that IL6 action on PCa cells change during cancer progression from being a growth inhibitor to growth stimulator (484).  In addition, investigators have reported that IL6 stimulated (476, 478, 479, 489) or inhibited AR transactivation (478, 490, 491).  These discrepancies could be due to transient transfection reporter systems used in these reports differing levels of AR expression (491, 492) which can affect the recruitment of AR co-activators.   In short, IL6 induced NED phenotype, and exogenous IL6 inhibited LNCaP growth and induced NE differentiation.  The growth inhibitory effect of IL6 (482) was STAT3 dependent (57, 58).  The use of STAT3 inhibitors increased the sensitivity of ENZ-resistant cells (59, 60), and reduced the development of t-NEPC (61).  Thus, IL6 was used in PCa cells performed experiments, to directly compare the effect of  both IL10 and IL6 on  PCa cells.      60 Chapter 2.  Materials and Methods 2.1. Mouse colonies BALB\/c mice of SHIP1 wild type (+\/+) or SHIP1 knockout (-\/-) were kindly provided by Dr. Gerald Krystal (BC Cancer Research Centre, Vancouver, BC).  C57BL\/6 STAT3-\/- mice were generated by crossing C57BL\/6 STAT3flox\/flox mice (Dr. Shizuo Akira, Hyogo College of Medicine, Nishinomiya, Japan) with C57BL\/6 LysMCre mice (Jackson Laboratory).  Offspring of these mice were heterozygous on both alleles, and were then crossed with homozygous STAT3flox\/flox mice to generate mice with a genotype of STAT3flox\/flox \/LysMCre+\/-.   Then, STAT3flox\/flox \/LysMCre+\/- mice were crossed with STAT3flox\/flox mice to generate both STAT3flox\/flox \/LysMCre+\/- mice (STAT3-\/- mice) and STAT3flox\/flox mice (STAT3+\/+ mice) in the same litters.  For mRNA analysis and immunoblotting studies, BALB\/c mice +\/+ or -\/- for SHIP1 and C57BL\/6 LysMCre mice +\/+ or -\/- for STAT3 were used.  Both male and female were used, aged between 6-20 weeks old.  All mice were housed and maintained in accordance with the ethic protocols approved by the University of British Columbia Animal Care Committee.  2.2. Cells 2.2.1. Macrophages  RAW264.7 cells were obtained from the American Type Culture Collection and maintained in Roswell Park Memorial Institute medium (RPMI-1640) (HyClone, Logan, Utah) supplemented with 9 % fetal bovine serum (FBS) (HyClone, Logan, Utah).  Perimacs were isolated from mice by peritoneal lavage with 3 ml of sterile Phosphate Buffered Saline (PBS) (HyClone, Logan, Utah).  Perimacs were collected and transferred to Iscove\u2019s Modified Dulbecco\u2019s Medium (IMDM) (HyClone, Logan, Utah) supplemented with 10% (v\/v) FBS, 10 \u00b5M \u03b2-mercaptoethanol, 150 \u00b5M    61 monothioglycolate and 1 mM L-glutamine (referred to here on as Mac media).  BMDM were generated by first collecting femurs and tibias from mice, and then flushing out the bone marrow through a 26-G needle.  Extracted cells were plated, in Mac media supplemented with 5 ng\/ml each of CSF1 and GM-CSF (Stem Cell Technologies, Vancouver, BC), on a 10-cm tissue culture plate for 2 hours at 37\u00b0C.  Non-adherent cells were collected and replated at 9\u00d7106 cells per 10-cm tissue culture plate.  Cells were then cultured in the presence of CSF-1 and GM-CSF.  Differentiated BMDMs were used after 7 to 8 days.  The J17 cell line was derived from SHIP1-\/- BMDM, as previously described and cultured in Mac media (493).  All cells were maintained in a 37\u00b0C, 5% CO2, 95% humidity incubator. J17 SHIP1-\/- cells expressing WT His6-SHIP1 were generated by lentivirus mediated gene transfer as previously described (493).  Transduced cells were selected with 5 \u00b5g\/ml blasticidin. 2.2.2. Prostate cancer cells The LNCaP prostate cancer cell line (494) was maintained in RPMI-1640 (HyClone, Logan, Utah) supplemented with 9% FBS (HyClone, Logan, Utah).  LNCaP cells expressing ARR2PB-eGFP were kindly provided by Dr. Paul Rennie (Vancouver Prostate Centre, Vancouver, British Columbia).  Enzalutamide (ENZ) resistant and ENZ sensitive, 42DENZR and 16DCRPC CRPC cell lines respectively were kindly provided by Dr. Amina Zoubeidi (Vancouver Prostate Centre, Vancouver, British Columbia).  These cells were generated from in vivo LNCaP xenografts described previously (47).  16DCRPC cells were maintained as the LNCaP cells.  42DENZR cells were maintained in 10 \u00b5M ENZ, RPMI-1640, 9% FBS.  All cells were kept in a 37\u00b0C, 5% CO2, 95% humidity incubator.      62 2.3. Constructs Lentiviral expression vectors for the doxycycline (Dox) inducible CRISPR\/Cas9 and sgRNA were purchased from Addgene (Lenti-iCas9-neo #85400; pLX-sgRNA #50662 (495, 496)).  Guide sequences used in the present study to target EP4 gene were designed via CRISPR Gold online tool (497).  Two guide RNA sequences were designed to target different positions of EP4 gene: EP4 KD1 sgRNA (GGCGGCGTAGGCCGTTACGT), EP4 KD2 sgRNA (CGACTTGCACAATACTACGA).  Target sequences were cloned into the pLX-sgRNA vector using overlap-extension PCR to generate sgRNA-specific inserts. In brief, the first PCR amplicons were produced from F1\/R1 and F2\/R2 primers using Phusion polymerase (ThermoFisher Scientific, Nepean, ON).  The first PCR products were then gel purified and extracted using phenol:chloroform:isoamyl (25:24:1) alcohol (ThermoFisher Scientific, Nepean, ON) to remove any template vectors and Phusion polymerases that can interfere with producing correct clones in proceeding steps.  The first PCR products were then used as templates for another PCR reaction with the F1\/R2 primer pair and the same gel purification and phenol-chloroform extraction was performed.  The product of second PCR reaction was digested using NheI and XhoI restriction enzymes, ligated into the empty pLX-sgRNA vector and transformed into chemically competent Stbl3 bacteria.  Ampicillin resistant colonies were selected and the sequences confirmed by sequencing.  The virus containing Lenti-iCas9 neo plasmid was prepared by mixing the packaging plasmid R8.9 and VSVG with Lenti-iCas9 neo plasmid and transfecting into HEK293T cells to produce virus (242).  The lentivirus in the media was collected and concentrated to use to infect RAW264.7 cells in the presence of 8 \u03bcg\/ml protamine sulfate.  The Lenti-iCas9 neo transduced RAW264.7 cells were selected by sorting for GFP fluorescence using FACS.  After sorting, cultures were maintained in 2 mg\/ml neomycin.  Then, pLX-sgRNA vectors with EP4 target    63 sequences were infected into the RAW264.7 cells containing Lenti-iCas9 neo plasmids using the same procedure.  The RAW264.7 cells with pLX-sgRNA vector were selected using 5 \u03bcg\/ml blasticidin.  To induce the expression of Cas9, 2 \u03bcg\/ml doxycycline (Dox) was added to the culture media for 48 hours.  All cell lines were maintained at 37\u00b0C, 5% CO2 and 95% humidity.  2.4. Reagents Antibodies used include SHIP1 (P1C1) mouse antibody (Santa Cruz Biotechnology, Santa Barbara, CA), pSTAT3 Y705 (3E2) mouse antibody (Cell Signaling, Danvers, MA), STAT3 (79D7) rabbit antibody (Cell Signaling, Danvers, MA), EP4 (C-4) mouse antibody (Santa Cruz Biotechnology, Santa Barbara, CA), p-p85 PI3 Kinase (Tyr458) rabbit antibody (Cell Signaling, Danvers, MA), p85 PI3 Kinase rabbit antibody (Cell Signaling, Danvers, MA), p-p70 S6 Kinase (Thr389) rabbit antibody (Cell Signaling, Danvers, MA), p70 S6 Kinase rabbit antibody (Cell Signaling, Danvers, MA), pCREB (Ser133) rabbit antibody (Cell Signaling, Danvers, MA), CREB (48H2) rabbit antibody (Cell Signaling, Danvers, MA), NSE mouse antibody (Santa Cruz Biotechnology, Santa Barbara, CA), SYP mouse antibody (Santa Cruz Biotechnology, Santa Barbara, CA), GAPDH rabbit antibody (Sigma, Oakville, ON), and Actin rabbit antibody (Sigma-Aldrich Canada Co, Oakville, ON).  Transcription inhibitor actinomycin D (Act-D) or translation inhibitor cycloheximide (CHX) (Fluka, Mississauga, ON) are dissolved in dimethylsulfoxide (DMSO).  PDL1 (BD Pharmingen, Canada) and Fc block (BD Pharmingen, Canada) were used.  Human IL10 and IL6 were from StemCell Technologies (Vancouver, Canada).  ENZ (MDV 3100) was from Cayman Chemical Company (Ann Arbor, MI).     64 2.5. Cell Stimulations 2.5.1. Macrophages  Cell lines and BMDMs were seeded at 3 x 105 cells per well on 24-well tissue culture plates 1 day prior to stimulation, followed by replacement with fresh medium for 1 hour prior to stimulation with 10 ng\/ml LPS (Escherichia coli serotype 0111:B4; Sigma) with and without the indicated concentrations of IL10 for the required time points.  Perimacs were seeded at 1 x 106 cells per well in 24-well tissue culture plate and let to adhere for 3 hours before washing with PBS to remove non-adherent cells followed by stimulation with 10 ng\/ml LPS +\/- 10 ng\/ml IL10 in Mac media for 1 hour.  The EP4 Plx-sgRNA transduced cell lines were left untreated or treated with 2 \u00b5g\/ml Dox for 24 hours prior to cell seeding (a total of 48 hours treatment before LPS\/IL10 stimulations) to induce knockdown of EP4.   2.5.2. Prostate cancer cells For western blot studies, cells were seeded at 3 x 104 cells per well on 24-well tissue culture plates 1 day prior to start of treatments growth medium supplemented with a 1% FBS for LNCaP cells or 5% FBS for 16DCRPC or 42DENZR   CRPC cells.   Cells were then treated with 100 ng\/ml IL10, IL6 or 10 \u00b5M ENZ for 7 days.  For the flow cytometry experiments, cells were plated at 1 x 105 cells per well on 6-well tissue culture plates using growth medium supplemented with a 1% FBS for LNCaP cells or 5% FBS for 16DCRPC or 42DENZR   CRPC cells 1 day prior to stimulation.  Next day, cells were treated with 50 ng\/ml IL10, IL6 or 10 \u00b5M ENZ for 7 days.  For 42DENZR cells, ENZ was removed from the cell culture at time of plating to study the direct effect of different stimuli on ENZ resistant cells.  ARR2PB-eGFP cells were seeded in 1% FBS media for one passage to minimize GFP background expression.  Cells were plated in at 8 x 104 cells per well on 24-well in 1% RPMI    65 media overnight.  Next day, cells were stimulated with either 20 ng\/ml IL10, IL6 or 10 \u00b5M ENZ for the required time points.  2.6. Treatment with EP4 antagonist  Cells were seeded at 2.0 x 104 cells per well in a 96-well tissue culture plate and allowed to adhere overnight.  Media was changed the next day 1 hour prior to stimulation.  For cells that need pre-treatment, DMSO (final concentration of 0.05%) or 100 nM ONO-AE3-208 (14522, Cayman Chemical Company, Ann Arbor, MI) prepared in RPMI-9% FBS media was used to pre-treat the cells for 1 hour prior to stimulations.  Cells were then stimulated with 1 ng\/ml LPS +\/- IL10 (0.01 \u2013 30 ng\/ml) for 1 hour.  Triplicates wells were used for each stimulation condition.  Supernatant was collected and secreted TNF\u03b1 protein levels were measured by ELISA as described below.     2.7. Real-time quantitative PCR   Perimacs were seeded at 3 x 106 cells per well in 6-well tissue culture plates and allowed to adhere for 3 hours before washing with PBS to remove non-adherent cells followed by stimulation with 1 ng\/ml LPS +\/- 10 ng\/ml IL10 in Mac media for 1 hour.  BMDM and RAW264.7 cells were seeded at 2 x 106 cells\/well and 1.5 x 106 cells\/well respectively.  Total RNA was extracted using Trizol reagent (ThermoFisher, Nepean, ON) according to manufacturer\u2019s instructions.  3 \u03bcg of RNA were treated with DNAse I (Roche Diagnostics, Laval, QC) according to the product manual. For mRNA expression analysis, 120 ng of RNA were used in the Transcriptor First Strand cDNA synthesis kit (Roche Diagnostics, Laval, QC), and 0.1 \u03bcl to 0.2 \u03bcl of cDNA generated were analyzed by SYBR Green-based real time PCR (real time-PCR) (Roche Diagnostics, Laval, QC) using 300 nM of gene-specific primers \u2013 EP4 Forward (ACCATTCCTAGATCGAACCGT),  EP4    66 Reverse (CACCACCCCGAAGATGAACAT), GAPDH Forward (AATGTGTCCGTCGTGGAT CT), GAPDH Reverse (GCTTCACCACCTTCTTGATGT).  Expression levels of mRNA were measured with the StepOne Plus RT-PCR system (Applied Biosystems, Burlington, ON), and the comparative Ct method was used to quantify mRNA levels using gapdh as the normalization control.  2.8. Immunoblot analysis Cells were rinsed with cold PBS and lysed with hot 2 x Laemmli sample buffer.  Proteins were separated by 12.5 % SDS-PAGE, followed by electroblotting onto polyvinylidene fluoride (PVDF) membrane (Millipore, Etobicoke, ON).  Membranes were blocked with 3% BSA\/\/TrisHCl buffer saline (TBS)\/pH 7.5 (blocking buffer), rinsed with 0.05% Tween 20\/TBS (wash buffer) and probed primary antibodies\/3% blocking buffer at room temperature overnight.  The following day, membranes were washed 3 X 10 min, incubated 1 hour at room temperature w Alexa Fluor\u00ae 660 anti-mouse IgG or Alexa Fluor\u00ae 680 anti-rabbit IgG antibodies in wash buffer (ThermoFisher, Nepean, ON), washed and imaged using a LI-COR Odyssey Imager.  2.9. Measurement of TNF\u03b1 production and IL10 IC50 calculations.  Cells were seeded at 2.0 x 104 cells per well in a 96-well tissue culture plate and allowed to adhere overnight.  Media was changed the next day 1 hour prior to stimulation. Cells were stimulated with 1 ng\/ml LPS +\/- IL10 (0.01 \u2013 30 ng\/ml) for 1 hour.  Triplicates wells were used for each stimulation condition.  Supernatant was collected and secreted TNF\u03b1 protein levels were measured using a BD OptEIA Mouse TNF\u03b1 Enzyme-Linked Immunosorbent Assay (ELISA) kit (BD Biosciences, Mississauga, ON).   The inhibitory concentration (IC50) of IL10 needed to    67 inhibit LPS-stimulated TNF\u03b1 production was calculated using GraphPad (non-linear regression curve fit).  The mean IC50 was determined from three independent IC50 determination experiments.  2.10. Flow cytometry analysis.  For measurement of PDL1 surface expression, cells stimulated with IL10, IL6, ENZ or control buffer as described above were rinsed with cold PBS followed by the addition of 2 mM EDTA\/PBS to each well for 5 min.  200 \u00b5l of FACS buffer (3% FBS in PBS) was added, cells were collected and spun at 1000 x g for 5 min at 4\u02daC.  Cells were resuspended in 25 \u00b5L of 25 \u00b5g\/mL FC block (BD-Pharmingen, Mississauga, Canada) in FACS buffer and transferred to a V-bottom 96-well plate for 15 min at 4\u02daC.  Anti-human PDL1 PE-conjugated antibody (BD-Pharmingen, Mississauga, Canada) was added for 1 hour.  Cells were then washed with FACS buffer 3 times and analyzed (minimum 10K events within the cell gate) on a Canto II (BD-Biosciences, Mississauga, Canada).  The FACS data were analyzed with FlowJo_V10 (BD-Biosciences, Mississauga, Canada).  Cells were gated based on forward scatter height (FSC-H) and side scatter height (SSC-H) pattern (\u201ccell gate\u201d), and the PE (FL2) fluorescence of cells within this cell gate was determined.   For the measurement of GFP positive expressing cells in ARR2PB-eGFP LNCaP, cells were collected at the indicated time points and were rinsed with cold PBS followed by the addition of 200 \u00b5L 2 mM EDTA to each well to lift the cells.  200 \u00b5l of FACS buffer was added and cells were spun at 1000 x g for 10 min at 4\u02daC.  Cell pellets were resuspended in FACS buffer and data were acquired (5000 events within the cell gate) as described above.  16DCRPC cells were used as a negative control to define the GFP negative population in the GFP channel (FL1).    68 2.11. Statistical Analysis Quantification of band intensities in immunoblots was performed using LI-COR Odyssey imaging system and Image StudioTM Lite software (LI-COR Biosciences, Lincoln, NE).  GraphPad Prism 6 (GraphPad Software Inc., La Jolla, CA) was used to perform all statistical analyses.  Statistical details can be found in figure legends.  Values are presented as means \u00b1 standard deviations.  Unpaired t tests were used where appropriate to generate two-tailed P values.  One-way or two-way ANOVA were performed where required with proper multiple comparisons tests.  Differences were considered significant when p\u22640.05.  2.12. Ethics Statement Some of the studies required cells harvested from mice.  The mice were kept, and cells were harvested in compliance with the Canadian Animal Care Committee guidelines.              69 Chapter 3.  IL10 contributes to PGE2 signalling through upregulation of EP4 via SHIP1 and STAT3 in activated macrophages  3.1. Introduction Macrophages are one of the major types of immune cells that are involved in host defense responses (2-5) by providing an immediate response to invading pathogens, while also contributing to the activation of the adaptive immune system (6-8).  Upon LPS binding to TLR4 on the macrophage, a cascade of signalling pathways is initiated leading to the production of proinflammatory cytokines and other inflammatory mediators (9).  Although pro-inflammatory response is initiated as a protective response to remove invading pathogens, this inflammatory response needs to be appropriately terminated to avoid chronic or excessive inflammation  (10).   The anti-inflammatory cytokine IL10, a potent immunosuppressive cytokine of immune cell activation, is essential in maintaining immune homeostasis (10, 11).  Certain defects in IL10 signalling are associated with various autoimmune\/inflammatory diseases (12-14).  IL10 knockout mice develop colitis similar to human inflammatory bowel disease (161, 163), and they are also hypersensitive to inflammatory stimuli (165).  Furthermore, deficiencies or mutations in IL10  (166) or IL10R (13, 167) have been found to cause early onset of IBD in humans.   IL10 signalling is initiated by its binding to its receptor (IL10R) resulting in the activation of receptor associated Jak1 and Tyk2 tyrosine kinases (209, 210).  This in turn would lead to the activation of STAT3 transcription factor (234, 240, 498).  In addition to the STAT3 pathway, studies in our lab have shown that IL10 also signals through SHIP1, which is a cytoplasmic protein expressed predominantly in hematopoietic cells (107, 242).  One important function of SHIP1 is mediating the negative regulation of P13K signalling pathway.  In response to extracellular signals, SHIP1 is recruited to the cell membrane and PI3K signalling is turned off by hydrolyzing the PI3K    70 product PIP3 into PI-3,4-P2 (243-245).  SHIP1 can also act as an adaptor protein to form protein complexes in signalling pathways (246).  Studies in our laboratory have shown that IL10 signalling employs SHIP1 in macrophages to inhibit LPS-induced translation of pre-existing TNF\u03b1 mRNA (107) and the maturation of the microRNA, miR155 (242).  Recently, our lab have reported that SHIP1 and STAT3 can form complexes in response to IL10 in order to mediate some of IL10 actions, and found that a small allosteric activator of SHIP1 can mimic the anti-inflammatory actions of IL10 in vitro and in vivo (Chamberlain et al., submitted).  In studies to define SHIP1 involvement in the global effects of IL10 on gene expression, DNA microarray analysis of SHIP1+\/+ and SHIP1-\/- perimacs treated with LPS +\/- IL10 for 30 minutes was used to screen for mRNAs whose regulation by IL10 involved SHIP1 (396).  By comparing SHIP1+\/+ and -\/- gene expression profiles, over 100 genes were identified to be regulated by IL10 in a SHIP1-dependent manner.  In order to identify IL10 induced genes that may be regulated by both SHIP1 and STAT3, our SHIP1-regulated gene subset were compared with other published data on IL10 regulated genes (396).  Several studies have looked at IL10 regulating global gene expression profiling in macrophages (236, 498-501) but the focus was on the following two studies.  One study used microarray analysis (498), and the other used a combination of ChIP-seq and RNA-seq (236).  Lang et al. examined the gene expression profiles of IL10-\/- BMDMs treated with LPS +\/- IL10 for 3 hours and identified 112 genes that were regulated by IL10 in LPS-activated macrophages (498).  Hutchins et al. identified ~354 genes that were upregulated by IL10 and that have nearby STAT3 binding sites, and ~3180 IL10 upregulated genes by RNA-seq creating a global view of IL10\/STAT3 mediated anti-inflammatory response in mouse macrophages (236).  By comparing our SHIP1-regulated gene subset to the two studies, our data suggest that the mRNA    71 for EP4 is potentially upregulated by IL10 in a SHIP1- and STAT3-dependent manner (396).  Thus, I investigated whether this protein participates in IL10 inhibition of macrophage activation. The Ptger4 gene encodes the 513 amino acid EP4 protein, which is one of the four surface PGE2 receptors that are known as EP receptors 1-4 (37), and has been reported to have anti-inflammatory actions (398, 402, 404).  EP4 is also a G-protein-coupled receptor expressed in different tissues and cells including those of the immune system (402).  The expression of EP4, unlike the other PGE2 receptors, is abundantly expressed in macrophages (395, 402, 464), and its expression is increased in activated macrophages (441, 502, 503), which suggests its involvement in regulating immune responses.   Studies using siRNA targeted EP4 deletion cells (441) and EP4 knockout mice (398, 405) have confirmed that EP4 is responsible for the anti-inflammatory actions of PGE2.  EP4 but not EP1-3 mRNA levels rise in colitic mice and rats (398, 404) suggesting an important role for EP4 but not the other PGE2 receptors in colitis.  In agreement with this, reports have shown that EP4 knockout mice are more susceptible to induced experimental colitis (398), and the use of EP4-specifc agonists inhibited the induced severe colitis in wild type mice (398) or rats (404).  In humans, GWAS have correlated EP4 polymorphisms with inflammatory diseases including Crohn\u2019s disease (442-444), and allergic diseases (445).  These findings are consistent with studies showing elevated EP4 receptor levels during IBDs in humans (446), suggesting a protective effect of EP4 in the colon even under physiological conditions.  Therefore, EP4 expression level might also influence susceptibility to IBD in humans.  Several studies have reported that the use of EP4-selective agonists can inhibit inflammatory phenotypes such as asthma (405), and colitis (398, 404, 440).  One potent EP4 agonist specific agent, Rivenprost (ONO-4819CD; AE1-734), has been developed    72 for treating inflammatory disease in humans, and showed efficacy in phase II trials in ulcerative colitis (440).   In this chapter, I will explore the findings of these observations which suggest a protective role of the EP4 protein that is similar to the IL10-mediated anti-inflammatory action. I will present evidence that EP4 protein is upregulated following IL10 stimulation of macrophages, and that EP4 participates in IL10 inhibition of macrophage activation.  In addition, I will confirm that IL10 utilizes both SHIP1 and STAT3 to upregulate EP4 expression resulting in the subsequent PGE2 activation of EP4 as a part of IL10\u2019s overall anti-inflammatory actions to deactivate macrophages. 3.2.  Results 3.2.1. EP4 mRNA is upregulated by IL10 in a SHIP and STAT3 dependent manner To identify IL10 regulated genes that are dependent on SHIP1 and participate in anti-inflammatory responses, mRNA microarray analysis was performed.  Previous work in our laboratory have examined mRNA expression profiles induced by IL10 in SHIP1+\/+ vs SHIP1-\/- LPS perimacs for 30 minutes and found the levels of 341 genes were altered by IL10 by at least two-fold in SHIP1+\/+ macrophages (396).  Among these, the expression of 124 genes were found to be SHIP1 dependent as IL10 did not significantly change their levels in SHIP-\/- as compared to that in SHIP+\/+ cells (396).  As a first step in narrowing down which of the 124 genes to focus on, published datasets of STAT3 regulated genes were used (236, 498).  The mRNA for EP4, one of the IL10 regulated, SHIP1-dependent genes that was identified from the microarray was found to be in the list of STAT3 regulated genes. Next, the SHIP1 and STAT3 dependence of IL10 upregulation of EP4 mRNA was confirmed by qPCR analysis.  Perimac cells were stimulated with LPS +\/- IL10 for 1 hour from SHIP1+\/+ or STAT3+\/+ and SHIP1-\/- or STAT3-\/- mice prior to RNA extraction.  EP4 and GAPDH    73 mRNA levels were quantified by qPCR (Figure 3.1A).  LPS alone induced a slight increase in EP4 mRNA (~ 0.5 fold more than the unstimulated condition) but it was significantly upregulated in the presence of IL10 by 2.6 and 2.9 fold in SHIP+\/+ (Figure 3.1A, left) and STAT3+\/+ cells (Figure 3.1A, right) respectively, compared to LPS alone.  However, IL10 upregulation of EP4 was impaired in cells deficient of either SHIP1-\/- or STAT3-\/-, by approximately 45% in SHIP1-\/- cells (Figure 3.1A, left) and 30% in STAT3-\/- cells (Figure 3.1A, right).  This data suggests that IL10 regulation of EP4 mRNA requires both SHIP1 and STAT3 for maximal induction.   Since our further biochemical studies will make use of the RAW264.7 cell line and BMDM from SHIP1+\/+ or -\/- and STAT3+\/+ or -\/- mice, EP4 mRNA levels in those cells were also examined.  Similar to that seen in perimacs, IL10+LPS (but not LPS alone) induction of EP4 mRNA is impaired in SHIP1-\/- BMDM (Figure 3.1B, left).  However, unlike that observed in STAT3-\/- perimacs, STAT3 deficiency in BMDM did not affect IL10\u2019s ability to elevate EP4 mRNA (Figure 3.1B, right), even though IL10 inhibition of TNF\u03b1 mRNA was confirmed to be impaired in these STAT3-\/- BMDM (Figure 3.1C) as our lab and others have previously described (107, 242).  Finally, EP4 mRNA levels was examined after 1 hour  LPS +\/- IL10 treatment in the RAW264.7 cell line.  As seen in Figure 3.1D, the pattern of EP4 mRNA expression was similar to SHIP1+\/+ and STAT+\/+ perimacs and BMDM.     74  Figure 3.1  EP4 mRNA is upregulated by IL10 in a SHIP and STAT3 dependent manner Perimacs extracted (A) or BMDM (B, C) derived from SHIP1+\/+ or -\/- mice and STAT3+\/+ or -\/- mice were stimulated with LPS +\/- IL10 for 1 hour prior to total RNA extraction.  Expression level of EP4 (A, B) or TNF\u03b1 (C) mRNA was determined by real-time PCR and normalized to GAPDH mRNA levels.  (Two-Way ANOVA with Tukey\u2019s correction, **** p<0.0001, *** p<0.001, ** p<0.01, * p<0.05, ns = not significant).  RAW264.7 cells (D) were stimulated and subjected to the same mRNA expression analyses.  (One-Way ANOVA with Tukey\u2019s correction, **** p<0.0001, *** p<0.001, ** p<0.01, * p<0.05, ns = not significant).  Data represent expression levels relative to LPS stimulated cells from three independent experiments in each cell type.    75 3.2.2.  IL10 upregulation of EP4 protein  To determine whether IL10 elevation of EP4 mRNA can be mirrored by the upregulation of EP4 protein levels.  I looked at the changes of EP4 protein levels and whether there was dose dependency in response to IL10 treatment in different macrophage cell lines.  Also, I used the same time point that showed IL10-increased EP4 mRNA levels, 1 hour, to minimize IL10 autocrine effects that could mask EP4 dependency on IL10 dose response.  Thus, cells were treated with various IL10 concentrations, 10, 25, 50 or 100 ng\/ml IL10, for 1 hour in the presence or absence of 10 ng\/ml LPS.  3.2.2.1.  IL10-dose dependent upregulation of EP4 protein in RAW264.7 cells  RAW264.7 are macrophage-like Abelson leukemia virus transformed cell line derived from BALB\/c mice (504), and they are commonly used as a model of mouse macrophages for the study of cellular responses to different stimuli and their products.  Our laboratory has generated an inducible CRISPR-Cas9 RAW264.7 cell line, which is used regularly to knockdown different genes of interest by producing stable knockdown cell lines.  Thus, it was important to determine whether EP4 protein is induced in RAW264.7 cells in response to IL10 prior to our use of CRISPR-Cas9 RAW264.7 system to knockdown EP4 gene.     As shown in Figure 3.2, EP4 protein levels were almost undetected in unstimulated RAW264.7 cells.  This agrees with a previous study reporting very low levels of EP4 mRNA levels in unstimulated  RAW264.7 cells in comparison to BMDM (395).  Notably, the addition of IL10 elevated EP4 protein levels in a dose-dependent manner.  The presence or absence of LPS had insignificant effect on the changes of EP4 protein levels in RAW264.7 cells.  The lowest concentration of IL10 tested (10 ng\/ml) was found to produce significant upregulation of EP4, compared to cells treated in the presence or absence of LPS with no further increases with higher    76 IL10 concentrations.  Therefore, this concentration was chosen for use in further experiments.  In addition, pSTAT3-Y705 levels correlated with IL10 concentration dependency of EP4 induction.     Figure 3.2 IL10 dose-dependent upregulation of EP4 protein in RAW264.7 cell line RAW264.7 cells were stimulated with or without LPS with the indicated concentrations of IL10 for 1 hour prior to protein lysate collection.  Expression levels of EP4 and pSTAT3 proteins were determined by immunoblotting.  Data plotted represent EP4 and pSTAT3 band intensities normalized to SHIP1 protein levels from three independent experiments.  Significance was calculated between no IL10 and IL10 treatments (Two-Way ANOVA with Tukey\u2019s correction, **** p<0.0001, *** p<0.001, ** p<0.01, * p<0.05, ns = not significant). IL10 (ng\/ml) 100502510000000SHIP1 EP4pSTAT3-Y70510050251001010101000 10LPS (ng\/ml)\u0004 \u0006\b \b\u0004 \b \u0005\u0004\u0004\u0004\u0002\u0004\u0004\u0002\u0006\u0004\u0002\u0007\u0004\u0002\t\u0004\u0002\u000b\u000e\u000f\u0005\u0004\u0001\u0015\u0012\u0003\u0014\u0013\f\u0010\u0007\u0003\u0011\u000e\u0010\u0005\u0007\b\t\u0001\u0003\u0001\u0006\u0007\u0005\u0004\u0006\u0007\u0005\u0004\u0002\u0002 \u0002\u0002\u0002 \u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002 \u0002\u0002 \u0002\u0002 \u0002\u0002\u00020 25 50 75 1000.00.20.40.60.8IL10 ng\/mlpSTAT3\/SHIP1 \u0007\b\t\u0001\u0003\u0001\u0006\u0007\u0005\u0004\u0006\u0007\u0005\u0004\u0002\u0002\u0002\u0002 \u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002RAW264.7 cellsFigure 3.2   77 3.2.2.2.  IL10-dose dependent upregulation of EP4 protein in J17\/SHIP1 WT cells  Next, EP4 protein levels were evaluated in a J17 SHIP1 -\/- cell line (493) reconstituted with WT SHIP1 (J17\/SHIP1 WT).  The J17 SHIP1-\/- cell line was derived from the bone marrow of C57Bl\/6 SHIP1-\/- mice, and showed expression of surface proteins similar to those in BMDMs (493).  This cell line was used to reintroduce WT SHIP1 or point mutations of various SHIP1 domains in our laboratory to study the relative effects of SHIP1 in IL10 signalling (493).  Therefore, I tested whether the induction of EP4 is IL10-dependent in J17\/SHIP1 WT cells, and determined the optimal concentration that can be used in further experiments.    The increase in EP4 protein levels were IL10 dose dependent.  EP4 induction was found to be slightly greater in cells in which IL10 was added along with LPS but the difference was not significant.  10 ng\/ml of IL10 was shown to produce significant upregulation of EP4 in LPS-activated J17\/SHIP1 WT cells.  Thus, 10 ng\/ml IL10 concentration was chosen for use as a treatment of LPS-activated macrophages in further experiments.  pSTAT3-Y705 levels also reflected IL10 dose-dependent induction of EP4 protein levels in these cells (Figure 3.3).  Unlike RAW264.7 cells, I repeatedly observed a basal EP4 potential band, where EP4 is usually observed, in unstimulated cells which was not induced by LPS alone.  These apparently basal EP4 levels could be due to the fact that these cells were derived from BMDMs that were reported to have higher EP4 mRNA levels compared to RAW264.7 cells (395) (Figure 3.3).       78  Figure 3.3 IL10 dose-dependent upregulation of EP4 protein in J17\/SHIP1 WT cell line J17\/SHIP1 WT cells were stimulated with or without LPS with the indicated concentrations of IL10 for 1 hour prior to protein lysate collection.  Expression levels of EP4 and pSTAT3 proteins were determined by immunoblotting.  Data plotted represent EP4 and pSTAT3 band intensities normalized to SHIP1 protein levels from three independent experiments.  Significance was calculated between no IL10 and IL10 treatments (Two-Way ANOVA with Tukey\u2019s correction, **** p<0.0001, *** p<0.001, ** p<0.01, * p<0.05, ns = not significant).        IL10 (ng\/ml) 1005025100000010050251001010101000 10LPS (ng\/ml)SHIP1 EP4pSTAT3-Y7050\u0003 \u0005\b \b\u0003 \t\b \u0004\u0003\u0003\u0003\u0004\u0005\u0006\f\u0004\u0003\u0001\u0013\u0010\u0002\u0012\u0011\u000e\u0007\u0002\u000f\u000b\f\u000e\u0004\u0007\b\t\u0001\u0003\u0001\u0006\u0007\u0005\u0004\u0006\u0007\u0005\u0004\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002 \u0002\u00020 25 50 75 1000246IL10 ng\/mlpSTAT3\/SHIP1 \u0007\b\t\u0001\u0003\u0001\u0006\u0007\u0005\u0004\u0006\u0007\u0005\u0004\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002 \u0002\u0002\u0002\u0002J17\/SHIP1 WT cells   79 3.2.3.  Kinetics of EP4 upregulation  After determining the appropriate concentration of IL10 to show EP4 protein upregulation levels, I examined the kinetics of IL10 induction of EP4 protein.  The time points 0.5, 1 and 2 hours were tested. 0.5 hour time point was chosen to minimize the effect of LPS-induced autocrine cytokines (including IL10) which could mask the effect of the added IL10 (498).  Thus, I tested the kinetics of EP4 protein in response to 10 ng\/ml IL10 in both LPS-activated RAW264.7 and J17\/SHIP1 WT cell lines.   3.2.3.1.  Kinetics of IL10 upregulation of EP4 in RAW264.7 cells In RAW264.7 cells, IL10 elevated EP4 protein expression as early as 0.5 hour.  This upregulation of EP4 levels peaked and reached its maximum levels at 1 hour lasted up to 2 hours (Figure 3.4).  The kinetics of STAT3-Y705 phosphorylation reflected IL10 induction of EP4 protein.  No induction of EP4 protein was observed without the presence of IL10.  This could suggest the involvement of IL10 in the stability of EP4 protein upregulation levels in macrophages.  Uns.Time(hr)0.5 1 2LPS0.5 1 2LPS + IL100.5 1 2SHIP1 EP4pSTAT3-Y705\u0006\u0004\u0006 \u0006\u0004\u000b \u0007\u0004\u0006 \u0007\u0004\u000b \b\u0004\u0006 \b\u0004\u000b\u0006\u0004\u0006\u0006\u0004\u0007\u0006\u0004\b\u0006\u0004\t\u0006\u0004\u0006\u0004\u000b\u0011\u0014\u0015\u0012\u0001\u0002\u0013\u0016\u0017\u0003\f\u000f\u0005\u0010\u000e\u000f\u0007\u000b\f\u0004\b\t\b\t\u0001\u0003\u0001\u0007\b\u0006\u0005\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u00020.0 0.5 1.0 1.5 2.0 2.50.00.10.20.30.40.5Time (hrs)pSTAT3\/SHIP1\b\t\b\t\u0001\u0003\u0001\u0007\b\u0006\u0005\u000b\f\u0004\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002RAW264.7 cells   80 Figure 3.4 Kinetics of EP4 protein upregulation in RAW264.7 cell line RAW264.7 cells were stimulated with 10 ng\/ml LPS \u00b1 10 ng\/ml IL10, at the indicated time points, prior to protein lysate collection.  Expression levels of EP4 and pSTAT3 proteins were determined by immunoblotting.  Data plotted represent EP4 and pSTAT3 band intensities normalized to SHIP1 protein levels from three independent experiments.  Significance was calculated between LPS and LPS + IL10 treatments (Two-Way ANOVA with Tukey\u2019s correction, **** p<0.0001, *** p<0.001, ** p<0.01, * p<0.05).    3.2.3.2.  IL10 upregulation of EP4 protein in J17\/SHIP1 WT cells  Similar to RAW264.7 cells, J17\/SHIP1 WT showed upregulation of EP4 levels in response to IL10 at 0.5 hour.  EP4 levels peaked at 1 hour and started to decline afterwards, correlating with pSTAT3-Y705 kinetics (Figure 3.5).  Even though there were some detectable levels of EP4 in unstimulated and LPS treated samples, LPS treatment alone did not show any upregulation of EP4 levels, and EP4 induction was only observed in LPS+IL10 samples.  These observations indicate that IL10 may be involved in the increased EP4 protein stability in both J17\/SHIP1 WT (Figure 3.5) and RAW264.7 cells (Figure 3.4).  Uns.Time(hr)0.5 1 2LPS0.5 1 2LPS + IL100.5 1 2SHIP1 pSTAT3-Y705EP4\u0006\u0004\u0006 \u0006\u0004\u000b \u0007\u0004\u0006 \u0007\u0004\u000b \b\u0004\u0006 \b\u0004\u000b\u0006\u0004\u0006\u0006\u0004\u0007\u0006\u0004\b\u0006\u0004\t\u0006\u0004\u0006\u0004\u000b\u0011\u0014\u0015\u0012\u0001\u0002\u0013\u0016\u0017\u0003\f\u000f\u0005\u0010\u000e\u000f\u0007\u000b\f\u0004\b\t\b\t\u0001\u0003\u0001\u0007\b\u0006\u0005\u0002\u0002\u0002\u0002\u0002\u0002 \u0002\u00020.0 0.5 1.0 1.5 2.0 2.50.00.10.20.30.40.5Time (hrs)pSTAT3\/SHIP1\u000b\f\u0004\b\t\b\t\u0001\u0003\u0001\u0007\b\u0006\u0005\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002J17\/SHIP1 WT cells   81  Figure 3.5 Kinetics of EP4 protein upregulation in J17\/SHIP1 WT cell line J17\/SHIP1 WT cells were stimulated with 10 ng\/ml LPS \u00b1 10 ng\/ml IL10, at the indicated time points, prior to protein lysate collection.  Expression levels of EP4 and pSTAT3 proteins were determined by immunoblotting.  Data plotted represent EP4 and pSTAT3 band intensities normalized to SHIP1 protein levels from three independent experiments.  Significance was calculated between LPS and LPS + IL10 treatments (Two-Way ANOVA with Tukey\u2019s correction, **** p<0.0001, *** p<0.001, ** p<0.01, * p<0.05).    3.2.3. IL10 upregulation of EP4 protein requires SHIP1 and STAT3 Next, I looked at the ability of IL10 to increase LPS-induced EP4 protein expression in primary cells that were derived from STAT3-\/- and SHIP1-\/- mice.  As shown earlier in Figure 3.1A, EP4 mRNA was modestly induced by LPS and strongly upregulated by IL10 in SHIP1+\/+ and STAT3+\/+ perimacs but not by SHIP1-\/- or STAT3-\/- cells using qPCR analysis (Figure 3.1A).  Here, I investigated whether IL10 elevated EP4 protein in wild-type, and knockout SHIP1 or STAT3 BMDMs or perimacs.   3.2.3.3.   IL10 upregulation of EP4 protein requires SHIP1  To examine whether EP4 is upregulated in a SHIP1 dependent manner, BMDMs that were derived from SHIP1+\/+ and SHIP1-\/- mice were used.  As shown in Figure 3.6A, IL10 increased EP4 protein levels after an hour treatment in SHIP1+\/+ cells but not SHIP1-\/- cells.  However, high basal levels of EP4 protein in unstimulated and LPS treated BMDM were noted (Figure 3.6A), consistent with previous reports that showed high levels of EP4 mRNA in BMDM (395).  This could be because of the production of IL10 basal levels in BMDM culture.  Studies in our lab and other groups observed higher production of IL10 levels in cultured BMDM compared to more mature macrophages such as perimacs and RAW264.7 cells (498), leading some investigators to use IL10 deficient cells in their studies (498, 505).    82 Changes of EP4 protein levels were also examined in perimacs, a cell which matured in vivo.  SHIP1+\/+ mice perimacs showed low EP4 protein levels when not stimulated with either LPS or IL10 (Figure 3.6B).  After 1 hour treatment, LPS didn\u2019t induce EP4 levels while IL10 increased EP4 protein levels in SHIP+\/+ perimacs (Figure 3.6B).  However, the levels of IL10-elevated EP4 protein were abolished in SHIP1-\/- perimacs.  As I mentioned previously, LPS treated SHIP1+\/+ and STAT3+\/+ perimacs showed low EP4 mRNA levels (Figure 3.1).  Even though there were some detectable levels of EP4 protein in unstimulated and LPS treated samples, LPS treatment alone did not show any upregulation of EP4 protein levels, and EP4 protein induction was only observed in LPS+IL10 samples. These observations indicate that IL10 can be required for the stability of increased EP4 protein expression in macrophages.  Therefore, I concluded that regardless of EP4 basal protein levels, IL10 elevated EP4 protein levels and this upregulation required SHIP1 expression in both BMDM and perimacs.  I also found that the level of STAT3 phosphorylation was significantly lower in perimac and BMDM cells deficient in SHIP1, suggesting a role for SHIP1 in the phosphorylation of STAT3 in response to IL10.    83  Figure 3.6 IL10 upregulation of EP4 protein requires SHIP1 (A) SHIP1+\/+ and -\/- BMDM, (B) SHIP1+\/+ and -\/- perimacs were stimulated with 10 ng\/ml LPS \u00b1 10 ng\/ml IL10 for 1 hour prior to protein lysate collection.  Expression levels of EP4 and pSTAT3 proteins were determined by immunoblotting.  Data plotted represent EP4 and pSTAT3 band intensities normalized to STAT3 protein levels for (A) SHIP1+\/+ and -\/- perimacs and (B) SHIP1+\/+ and -\/- BMDM from three independent experiments.  Significance between treatments was calculated by Two-Way ANOVA with Tukey\u2019s correction, **** p<0.0001, *** p<0.001, ** p<0.01, * p<0.05).    3.2.3.4.   IL10 upregulation of EP4 protein requires STAT3  Next, I determined whether STAT3 is required for IL10 upregulation of EP4 levels.  Only BMDM cells were analyzed in these experiments because it was hard to obtain enough perimacs for biochemical experiments from STAT3-\/- mice which rarely live past 8 weeks of age.  Our studies with SHIP1+\/+ \/SHIP1-\/- BMDMs and perimacs gave similar IL10-induced EP4 protein expression profiles, so I analyzed STAT3+\/+ and STAT3-\/- BMDM.  STAT3+\/+ and STAT3-\/- LPS+ IL10Uns. LPSSHIP1 +\/+ SHIP1 EP4pSTAT3-Y705LPS+ IL10Uns. LPSSHIP1 -\/- LPS+ IL10Uns. LPSSHIP1 +\/+ SHIP1 EP4pSTAT3-Y705LPS+ IL10Uns. LPSSHIP1 -\/- Uns. LPS LPS + IL10Uns. LPS LPS + IL100.00.10.20.30.4EP4\/STAT3\u0007\b\t\u0006 \u0003\u0005\u0003\u0001\t\u0010\u000e\u000f\u000b\f\u0011\u0007\b\t\u0006 \u0004\u0005\u0004\u0001\t\u0010\u000e\u000f\u000b\f\u0011\u0002\u0002\u0002\u0002\u0002\u0002Uns. LPS LPS + IL10Uns. LPS LPS + IL100.00.20.40.60.81.0pSTAT3\/STAT3\u0007\b\t\u0006 \u0003\u0005\u0003\u0001\t\u0010\u000e\u000f\u000b\f\u0011\u0007\b\t\u0006 \u0004\u0005\u0004\u0001\t\u0010\u000e\u000f\u000b\f\u0011\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002Uns. LPS LPS + IL10Uns. LPS LPS + IL100.00.10.20.30.4EP4\/STAT3\t\f\u0006 \u0003\u0005\u0003\u0001\u0007\u000b\b\u000b\t\f\u0006 \u0004\u0005\u0004\u0001\u0007\u000b\b\u000b\u0002\u0002\u0002Uns. LPS LPS + IL10Uns. LPS LPS + IL100.00.10.20.30.4pSTAT3\/STAT3\t\f\u0006 \u0003\u0005\u0003\u0001\u0007\u000b\b\u000b\t\f\u0006 \u0004\u0005\u0004\u0001\u0007\u000b\b\u000b\u0002\u0002\u0002\u0002\u0002(B)(A)SHIP1 +\/+ and -\/- perimacsSHIP1 +\/+ and -\/- BMDMsSTAT3STAT3   84 BMDM were treated with LPS or LPS+IL10 for 1 hour.  As shown in Figure 3.7, IL10 treatment increased EP4 protein levels in STAT3+\/+ but not STAT3-\/- cells.  The impaired IL10 induction of EP4 protein in STAT3-\/- BMDMs contrasts with the lack of effect of STAT3 deficiency on IL10 induction of EP4 mRNA in STAT3-\/- BMDMs.  This result indicates the requirement for STAT3 in IL10 upregulation of EP4 protein.    Figure 3.7  IL10 upregulation of EP4 protein requires STAT3 STAT3+\/+ and STAT3-\/- BMDM were stimulated with 10 ng\/ml LPS \u00b1 10 ng\/ml IL10 for 1 hour prior to protein lysate collection.  Expression levels of EP4 and pSTAT3 proteins were determined by immunoblotting.  Data plotted represent EP4 band intensities normalized to SHIP1 protein levels for STAT3+\/+ and STAT3-\/- BMDM from three independent experiments.  Significance between treatments was calculated by (Two-Way ANOVA with Tukey\u2019s correction, **** p<0.0001, *** p<0.001).     3.2.4. Analysis of whether IL10 regulates EP4 expression at the level of transcription or translation   To determine whether IL10-mediated induction of EP4 protein requires de novo EP4 mRNA synthesis, SHIP1+\/+ BMDM cells were pre-treated with the transcriptional inhibitor, LPS+ IL10Uns. LPSSTAT3 +\/+ SHIP1 EP4pSTAT3-Y705LPS+ IL10Uns. LPSSTAT3 -\/- \u0010\u0011\u0012\u0003 \u000e\u000f \u000e\u000f\u0001\u0002\u0001\f\u0006\u0005\u0010\u0011\u0012\u0003 \u000e\u000f \u000e\u000f\u0001\u0002\u0001\f\u0006\u0005\u0005\u0003\u0005\u0005\u0003\t\u0006\u0003\u0005\u0006\u0003\t\u0007\u0003\u0005\u0007\u0003\t\u000e\b\u0004\u000f\u000b\f\u000e\u0006STAT3 +\/+ BMDMSTAT3 -\/- BMDM*******STAT3 +\/+ and -\/- BMDMsSTAT3   85 Actinomycin D (Act-D) for 0.5 hour prior to 1 hour LPS or LPS + IL10 stimulation.  As shown in Figure 3.8A, EP4 induction was greatly reduced when transcription was blocked by the addition of Act-D.  However, since Act-D inhibited IL10-induced STAT3 phosphorylation (Figure 3.8, lane 11 and 12) I cannot rule out the possibility that Act-D inhibits IL10 induction of EP4 by inhibiting STAT3-dependent processes needed for EP4 protein expression.  Cheon et al. showed that PGE2-upregulation of IL10-induced STAT3 phosphorylation was greatly reversed in cells that were treated with addition of Act-D (464), but also observed that Act-D treatment by itself inhibit IL10-induced STAT3 phosphorylation (464). Then, the possibility that IL10 controls EP4 translation was examined by treating cells with cycloheximide (CHX).  CHX was added for 1 hour prior to 1 hour LPS +\/- IL10 treatment.  As observed in Figure 3.8B, IL10-induced STAT3 phosphorylation was greatly reduced in CHX-treated BMDMs, which is consistent with previous reports showing that CHX itself can inhibit IL6-induced STAT3 phosphorylation (506) and IL10-induced STAT3 phosphorylation (464) in THP-1 cells, and this inhibitory effect of CHX could be dependent on p38 MAP kinase (506).   CHX treatment activated p38 MAP kinase which in turn inhibited STAT3-DNA binding without effecting the expression levels of any IL6R molecules including STAT3, JAK1, TYK2, IL6R, gp130 (506).  Similar to CHX, IL1 treatment activated p38 MAP kinase which in turn inhibited IL6-induced STAT3 phosphorylation (506).  Both IL1 and CHX inhibition of IL6-induced STAT3 phosphorylation was reserved by specific p38 MAPK inhibitors (506).  It has been proposed that protein synthesis inhibitors such as CHX can induce stress cytokines such as IL1 to inhibit IL6 signalling (506) but the exact mechanism has not been resolved (506).  Therefore, it is not possible to confirm whether the reversed IL10-increased EP4 levels were resulted from the inhibition of de novo protein synthesis.    86  Figure 3.8  IL10 regulation of EP4 protein expression at transcription and translational level SHIP1+\/+ BMDMs were either pre-treated with vehicle (0.1% DMSO) or (A) Actinomycin D (Act-D) for 30 minutes or (B) Cycloheximide (CHX) for 1 hour then stimulated with 10 ng\/ml LPS \u00b1 10 ng\/ml IL10 for a further hour prior to protein lysate collection.  Expression levels of EP4 and pSTAT3 proteins were determined by immunoblotting.  Data plotted represent EP4 and pSTAT3 band intensities normalized to SHIP1 protein levels from three independent experiments.  Significance between treatments was calculated by Two-Way ANOVA with Tukey\u2019s correction, **** p<0.0001, *** p<0.001, ** p<0.01, * p<0.05).    To study whether IL10 influences EP4 protein stability, EP4 was induced by IL10 for 1 hour to reach its maximal levels, then any further transcription was blocked by adding Act-D (Figure 3.9A) or the further translation was blocked by adding CHX (Figure 3.9B) for 1 hour.   IL10-increased EP4 levels were inhibited after both treatments, indicating a possible involvement Figure 3.10(A)LPS+ IL10Uns. LPSLPS+ IL10Uns. LPS+ Act-D (pre)SHIP1 EP4ActinpSTAT3-Y705\u0010\u0011\u0012\u0003 \u000e\u000f \u000e\u000f\u0001\u0002\u0001\f\u0006\u0005\u0010\u0011\u0012\u0003 \u000e\u000f \u000e\u000f\u0001\u0002\u0001\f\u0006\u0005\u0005\u0003\u0005\u0005\u0003\t\u0006\u0003\u0005\u0006\u0003\t\u0007\u0003\u0005\u0007\u0003\t\u000e\b\u0004\u000f\u000b\f\u000e\u0006VehAct-D***Uns. LPS LPS + IL10Uns. LPS LPS + IL10012345pSTAT3\/SHIP1VehAct-D********STAT3(B)SHIP1 EP4ActinpSTAT3-Y705Uns.LPS+ IL10LPSLPS+ IL10Uns. LPS+ CHX (pre)\u0010\u0011\u0012\u0003 \u000e\u000f \u000e\u000f\u0001\u0002\u0001\f\u0006\u0005\u0010\u0011\u0012\u0003 \u000e\u000f \u000e\u000f\u0001\u0002\u0001\f\u0006\u0005\u0005\u0006\u0007\b\t\u000e\t\u0004\u000f\u000b\f\u000e\u0006\u0005\u0007\b\u0003\u0004\u0006\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002Uns. LPS LPS + IL10Uns. LPS LPS + IL100246810pSTAT3\/SHIP1\u0005\u0007\b\u0003\u0004\u0006\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002STAT3   87 of IL10 on the regulation of EP4 at transcriptional and translational levels.  However, it should be noted that IL10-induced STAT3 activation was also inhibited.     Figure 3.9  IL10 regulation of EP4 expression protein at post-transcription and translational level SHIP1+\/+ BMDMs cells were either were stimulated first with 10 ng\/ml LPS \u00b1 10 ng\/ml IL10 for 1 hour followed by addition of either vehicle (0.1% DMSO), (A) Act-D or (B) CHX for a further hour before collection of protein lysates.  Expression levels of EP4 and pSTAT3 proteins were determined by immunoblotting.  Data plotted represent EP4 and pSTAT3 band intensities normalized to SHIP1 protein levels from three independent experiments. Significance between treatments was calculated by Two-Way ANOVA with Tukey\u2019s correction, **** p<0.0001, *** p<0.001, ** p<0.01, * p<0.05).    Act-D and CHX treatments had unexpected effects on STAT3 Y705 phosphorylation.  One possibility is that Act-D and CHX might inhibit kinases such as JAK1 or TYK2 which phosphorylate STAT3 Y705.  I looked at expression levels of both JAK1 and TYK2 protein, but I Figure 3.11(A)LPS+ IL10Uns. LPSLPS+ IL10Uns. LPS+ CHX (post)SHIP1 EP4pSTAT3-Y705 \u0010\u0011\u0012\u0003 \u000e\u000f \u000e\u000f\u0001\u0002\u0001\f\u0006\u0005\u0010\u0011\u0012\u0003 \u000e\u000f \u000e\u000f\u0001\u0002\u0001\f\u0006\u0005\u0005\u0006\u0007\b\t\u000e\t\u0004\u000f\u000b\f\u000e\u0006\u0005\u0007\b\u0003\u0004\u0006\u0002\u0002\u0002\u0002\u0002\u0002\u0002Uns. LPS LPS + IL10Uns. LPS LPS + IL1002468pSTAT3\/SHIP1\u0005\u0007\b\u0003\u0004\u0006\u0002\u0002\u0002\u0002\u0002\u0002\u0002(B)LPS+ IL10Uns. LPSLPS+ IL10Uns. LPS+ Act-D (post)SHIP1 EP4pSTAT3-Y705\u0010\u0011\u0012\u0003 \u000e\u000f \u000e\u000f\u0001\u0002\u0001\f\u0006\u0005\u0010\u0011\u0012\u0003 \u000e\u000f \u000e\u000f\u0001\u0002\u0001\f\u0006\u0005\u0005\u0006\u0007\b\u000e\t\u0004\u000f\u000b\f\u000e\u0006VehAct-D********Uns. LPS LPS + IL10Uns. LPS LPS + IL1002468pSTAT3\/SHIP1VehAct-D*******STAT3STAT3   88 could not observe any effects of Act-D or CHX treatments on their expression (Figure 3.10 A and B).  Thus, alternate approaches are needed to determine whether IL10 regulates EP4 mRNA transcription, mRNA stability or protein translation.     Figure 3.10(A)Uns. Uns.+ Act-D (pre)Uns. Uns.+ CHX (pre)(B)(C) (D)Uns. Uns.+ CHX (post)Uns. Uns.+ Act-D(post)Uns. Uns.+ Act-D (pre)Uns. Uns.+ CHX (pre)Uns. Uns.+ Act-D (post)Uns. Uns.+ CHX (post)JAK1TYK2TYK2JAK1ActinActinActinActin   89   Figure 3.10  Examining the effect of either Act-D or CHX treatments on JAK1 and TYK2    protein levels Lysates of unstimulated SHIP1+\/+ BMDMs that were used in figure 3.8 or 3.9 either pre-treated with vehicle (0.1% DMSO) or (A) Actinomycin D (Act-D) for 30 minutes or (B) Cycloheximide (CHX) for 1 hour then kept unstimulated for a further hour prior to protein lysate collection.  Or, cells were kept unstimulated first as control for 1 hour and them were post-treated with either vehicle (0.1% DMSO), (C) Act-D or (D) CHX for a further hour before collection of protein lysates that were analyzed by immunoblotting to determine the expression levels of TYK2 and JAK1 proteins levels in response to those inhibitors.    3.2.5. EP4 is required to mediate IL10 action in LPS-activated macrophages  To investigate the contribution of EP4 to IL10\u2019s anti-inflammatory actions, I first made use of the EP4 antagonist ONO-AE3-208 (395).  RAW264.7 cells were treated with 100 nM ONO-AE3-208 or with DMSO for 1 hour prior to stimulation with 1 ng\/ml LPS with 0 \u2013 30 ng\/ml IL10 for 1 hour.  Culture supernatants were collected and the TNF\u03b1 levels in them determined by ELISA.  As shown in Figure 3.11, IL10 inhibited LPS-stimulated TNF\u03b1 expression in DMSO treated cells.  Figure 3.10(A)Uns. Uns.+ Act-D (pre)Uns. Uns.+ CHX (pre)(B)(C) (D)Uns. Uns.+ CHX (post)Uns. Uns.+ Act-D(post)Uns. Uns.+ Act-D (pre)Uns. Uns.+ CHX (pre)Uns. Uns.+ Act-D (post)Uns. Uns.+ CHX (post)JAK1TYK2TYK2JAK1ActinActinActinActin   90 The ability of IL10 to inhibit TNF\u03b1 expression was significantly impaired at 0.1 and 1 ng\/ml of IL10 (Figure 3.11).  Of note, ONO-AE3-208 had no effect at 30 ng\/ml of IL10.  30 ng\/ml is the concentration at which maximal EP4 protein levels is induced by IL10 (Figure 3.2).  Figure 3.11  EP4 antagonist ONO-AE3-208 prevents IL10 inhibition of TNF\u03b1 RAW264.7 cells were pre-treated with 0.05% DMSO or with 100 nM ONO-AE3-208 for 1 hour prior to stimulation.  RAW264.7 cells were stimulated with 1 ng\/ml LPS +\/- 0.1, 1.0, 30 ng\/ml IL10 for 1 hour.  Supernatants were collected to measure the level of secreted TNF\u03b1.  The significance of the comparison between DMSO treatment and ONO-AE3-208 treatment was calculated by Two-Way ANOVA with Tukey\u2019s correction, **** p<0.0001, *** p<0.001, ** p<0.01 * p<0.05.  The significance of the comparison between LPS and LPS + IL10 treatments was calculated by Two-Way ANOVA with Tukey\u2019s correction, \u2020\u2020\u2020\u2020 p<0.0001, \u2020\u2020\u2020 p<0.001, \u2020\u2020 p<0.01, \u2020 p<0.05.  Data represent the percentage of TNF\u03b1 protein expression levels relative to LPS stimulated cells from three independent experiments.  To complement the chemical inhibitor studies, CRISPR-Cas9 system was used to knockdown EP4 in RAW264.7 cells.  A cell line expressing a doxycycline (Dox) inducible Cas9 protein (RAW264.7-Cas9) was used.  Then, two separate gRNAs were introduced into RAW264.7-Cas9 (KD1 and KD2) targeting two different EP4 exons to generate EP4-Cas9 transduced cells.  Expression of EP4 protein was knocked down in both KD1 and KD2 following    91 induction of Cas9 protein with doxycycline (+ Dox) for 48 hours (Figure 3.12A and B).  Interestingly, knocking down EP4 had a little impact on IL10 phosphorylation of STAT3.  Then, I investigated whether EP4 knockdown had an effect on the phosphorylation of CREB; a transcription factor regulated by PKA in the PGE2 stimulated EP4 signalling pathway (37) and also implicated in IL10R signalling (507).  I found that the addition of LPS and LPS+IL10 induced phosphorylation of CREB in both cell lines, and it was greatly induced in the presence of IL10 (Figure 3.12A and B).  This induction of CREB phosphorylation was abolished in IL10 treated cells when the EP4 protein is knocked down.  These data suggest a possible role for EP4 downstream of IL10R signalling leading to phosphorylation of CREB (Figure 3.12A and B).   EP4pSTAT3pCREBLPS+ IL10Uns. LPSLPS+ IL10Uns. LPS+ Dox(A)LPS+ IL10Uns. LPSLPS+ IL10Uns. LPS+ DoxSHIP1 EP4GAPDHEP4 KD1 EP4 KD2(B)pSTAT3pCREBCREBSTAT3Uns. LPS LPS + IL10Uns. LPS LPS + IL100.000.010.020.03EP4\/GAPDH\u0002\u0002\u0002\u0002\u0002\u0002Uns. LPS LPS + IL10Uns. LPS LPS + IL100.0000.0050.0100.0150.020EP4\/GAPDH\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002Uns. LPS LPS + IL10Uns. LPS LPS + IL100.00.51.01.5pSTAT3-Y705\/STAT3 \u0002 \u0002\u0003\u0004Uns. LPS LPS + IL10Uns. LPS LPS + IL100.00.51.01.52.0pSTAT3\/STAT3 \u0002\u0002\u0003\u0004Uns. LPS LPS + IL10Uns. LPS LPS + IL100.00.51.01.5pCREB \/ CREB****ns****Uns. LPS LPS + IL10Uns. LPS LPS + IL100.00.51.01.5pCREB \/ CREB****ns****   92 Figure 3.12  EP4 is required for IL10 induction of phospho-CREB RAW264.7\/Cas9 cells transduced with EP4 sgRNA KD1(A) or KD2 (B) were treated \u00b1 2 \u03bcg\/ml doxycycline for 48 hours to induce EP4 knockdown followed by stimulation with 10 ng\/ml LPS \u00b1 10 ng\/ml IL10 for 1 hour and collection of protein lysates.  Expression levels of the indicated proteins and phospho-proteins were determined by immunoblotting.  Data were quantified and the significance between treatments was calculated by Two-Way ANOVA with Tukey\u2019s correction, **** p<0.0001, *** p<0.001, ** p<0.01, * p<0.05).  Data plotted represent the indicated proteins and phospho-proteins band intensities normalized to the indicated loading control protein levels from three independent experiments.  Next, I examined whether EP4 is required for IL10 inhibition of PI3K\/Akt\/mTOR pathway (505).  Like SHIP WT perimacs (Figure 3.13 A), LPS induced the phosphorylation of p85 regulatory subunit of PI3K, which is required for the activation of Akt signalling while IL10 addition inhibited LPS-activation of p85 PI3K (Figure 3.13 B and C).  However, IL10 inhibition of LPS-induced p85 PI3K was abolished with the knockdown of EP4 similarly to SHIP1-\/- cells.  In addition, the effect of EP4 knock-down at phosphorylation of the Akt\/mTOR target p70 S6K was observed.  Similar to our observations with p85, LPS induced p70 S6K phosphorylation whereas addition of IL10 reduced phosphorylation to basal levels, and this inhibition was disrupted when EP4 was knocked down (Figure 3.13B and C).  These data indicate the contribution of EP4 to IL10 inhibition of PI3K\/Akt signalling and downstream processes.  Lastly, I determined the effect of EP4 knockdown on IL10\u2019s ability to inhibit production of TNF\u03b1 in LPS stimulated cells.  RAW264.7 KD1\/KD2 cells expressing EP4 (no Dox) or not expressing EP4 (with Dox) were stimulated with LPS and various concentrations of IL10 to determine IC50 value for IL10 inhibition of TNF\u03b1 production.  The knockdown of EP4 resulted in impaired IL10 inhibition of TNF\u03b1 production (Figure 3.14).  The IC50 value of IL10 inhibition of TNF\u03b1 production in EP4 expressing (no Dox) cells are 0.24 \u00b1 0.01 ng\/ml IL10 and 0.21 \u00b1 0.03 ng\/ml IL10, and this value rises to 1.09 \u00b1 0.2 ng\/ml IL10 and 1.56 \u00b1 0.62 ng\/ml IL10 for Dox induced EP4 KD1 and KD2 cells (Figure 3.14).    93  Figure 3.13  EP4 is required for IL10 inhibition of LPS-stimulation of p-p85 and p-p70S6 kinase Perimacs extracted from SHIP1+\/+ or -\/- mice were stimulated with 10 ng\/ml LPS \u00b1 10 ng\/ml IL10 for 1 hour (A), RAW264.7\/Cas9 cells transduced with EP4 sgRNA KD1(B) or KD2 (C) were treated \u00b1 2 \u03bcg\/ml doxycycline for 48 hours to induce EP4 knockdown followed by stimulation with 10 ng\/ml LPS \u00b1 10 ng\/ml IL10 for 1 hour and collection of protein lysates.  Expression levels of EP4 and the indicated proteins and phospho-proteins were determined by immunoblotting.  Data were quantification and significance between treatments was calculated by Two-Way ANOVA with Tukey\u2019s correction, **** p<0.0001, *** p<0.001, ** p<0.01).  Data plotted represent the indicated phospho-proteins band intensities normalized to the indicated loading control protein levels from three independent experiments. p-p85 PI3Kp-p70 S6KLPS+ IL10Uns. LPSLPS+ IL10Uns. LPSSHIP1 p-p85 PI3KGAPDHp-p70 S6KSHIP1 WT SHIP1 KO(A)LPS+ IL10Uns. LPSLPS+ IL10Uns. LPS+ Dox(B)LPS+ IL10Uns. LPSLPS+ IL10Uns. LPS+ DoxGAPDHEP4 KD1 EP4 KD2(C)Uns. LPS LPS + IL10Uns. LPS LPS + IL100.00.10.20.30.4p85 \/ GAPDHSHIP +\/+ perimacsSHIP -\/- perimacs**** ns*******Uns. LPS LPS + IL10Uns. LPS LPS + IL100.000.050.100.15pP70 \/ GAPDHSHIP +\/+ perimacsSHIP -\/- perimacs****ns**p-p70 S6K p-p85 PI3Kp70 S6K p85 PI3KUns. LPS LPS + IL10Uns. LPS LPS + IL100.00.51.01.52.0pP85 \/ P85************ ****Uns. LPS LPS + IL10Uns. LPS LPS + IL100246810pP85 \/ P85************ ****Uns. LPS LPS + IL10Uns. LPS LPS + IL10012345pP70 \/ P70VehDOX***************Uns. LPS LPS + IL10Uns. LPS LPS + IL100246810pP70 \/ P70VehDOX***************   94     Figure 3.14  EP4 is required for IL10 inhibition of LPS-stimulated TNF\u03b1 production RAW264.7\/Cas9 cells transduced with EP4 sgRNA KD1 (A) or KD2 (B) gRNA were treated \u00b1 2 \u03bcg\/ml doxycycline for 48 hours to induce EP4 knockdown 10 ng\/ml LPS \u00b1 different concentrations of IL10 for 1 hour and collection of supernatants.  LPS-stimulated TNF\u03b1 production levels were determined by ELISA in KD1 ELISA (A), and KD2 (B).  Data plotted on the left represent the percentage of TNF\u03b1 expression levels relative to LPS stimulated cells from one of three independent experiments.  Bar graphs on the right represent the mean IC50 for IL10 inhibition of LPS-stimulated TNF\u03b1 production.  ** p<0.01 when compared to cells not exposed to Dox (Unpaired Student\u2019s t-test).   3.3. Discussion Previous studies have reported that EP4 levels is increased in LPS-activated macrophages  (441, 502, 503).  I show in this study that IL10 by itself upregulated EP4 mRNA and protein expression (A) EP4 KD1EP4 KD2(B)0.1 1 10 10000255075100125[IL-10] ng\/mlTNF production [% Max ] EP4 KD1EP4 KD1+Dox0.1 1 10 10000255075100125[IL-10] ng\/mlTNF production [% Max ] EP4 KD2EP4 KD2+Dox\u0013\u0011\u0013 \u0013\u0011\u0018 \u0014\u0011\u0013 \u0014\u0011\u0018(3\u0017\u0003.'\u0014\u0003\u000e\u0003'R[(3\u0017\u0003.'\u0014\u0003>,\/\u0014\u0013@\u0003QHHGHG\u0003WR\u0003LQKLELW\u000371) \u0003SURGXFWLRQ\u000bPHDQ\u0003,&\u0018\u0013\u000f\u0003QJ\u0012PO\f\u0013\u0011\u0013 \u0013\u0011\u0018 \u0014\u0011\u0013 \u0014\u0011\u0018 \u0015\u0011\u0013 \u0015\u0011\u0018(3\u0017\u0003.'\u0015\u0003\u000e\u0003'R[(3\u0017\u0003.'\u0015\u0003>,\/\u0014\u0013@\u0003QHHGHG\u0003WR\u0003LQKLELW\u000371) \u0003SURGXFWLRQ\u000bPHDQ\u0003,&\u0018\u0013\u000f\u0003QJ\u0012PO\f   95 levels.  In previous reports, it was hard to distinguish this direct effect of IL10 on EP4 expression from the effects of LPS activation of TLR4 because of the duration of the LPS treatment (503) (503).  Endogenous IL10 is produced within 30 min of LPS treatment  (508-510).  I found that maximal levels of EP4 is induced in response to IL10 alone by 1 hour, and I used this time point in further experiments.   Hutchins et al., reported EP4 gene as one of the ~3180 genes that were upregulated by IL10 using RNA-seq, but it was not identified as one of the IL10-STAT3 genes that have STAT3 binding sites in their promoters by chromatin immunoprecipitation (236).  However, by using the Eukaryotic Promoter Database (http:\/\/epd.vital-it.ch\/), I confirmed the presence of STAT3 transcription binding factor motif site located at 84 bp upstream the transcription start site of ptger4 mRNA on the mouse genomic sequence, suggesting that EP4 can be regulated by IL10 in a STAT3 dependent manner.  In agreement with this, the results in this chapter showed that EP4 mRNA and protein induction by LPS + IL10 were mediated in a SHIP1 and STAT3 dependent manner perimacs.  The absence of either one resulted in abolishing IL10 upregulation of EP4 mRNA and protein levels in these cells.  In BMDM, IL10 induction of EP4 mRNA was SHIP1 dependent but not STAT3 dependent.  However, IL10R signaling involves both SHIP1 and STAT3, and I found that IL10 upregulation of EP4 protein required both.  Future studies will examine why EP4 mRNA responses with respect to STAT3 are different in BMDM compared to perimacs.   Whether IL10 controls EP4 protein expression post-transcriptionally or translationally needs to be further investigated since CHX and Act-D inhibited IL10 STAT3 phosphorylation, making the CHX and Act-D studies uninformative.  To determine whether IL10 regulation of EP4 is at the transcriptional level, luciferase reporters holding the promoter regions can be examined in response to LPS, IL10 or LPS+IL10.  Other approaches to determine IL10-induced transcription    96 of EP4 mRNA is STAT3 dependent can be examined by STAT3 chromatin immunoprecipitation analysis in response to IL10 or mobility shift gels using probes with the STAT3 predicted binding sites.  For IL10 effect on EP4 protein stability, the use of polysome analysis as was described previously (107) can evaluate IL10 action on the translation of EP4 mRNA.  In addition, IL10 may regulate EP4 gene expression at post-transcriptional or post-translational level through different ARE binding proteins in the 3'UTR (untranslated regions) of EP4 mRNA.  Known transcriptional modifiers include KSRP (228), TTP (229), and HuR (139, 230, 231) while other translational modifiers include TIA-1 (232) and hnRNP A1 (233).  3'UTR analysis of the EP4 mRNA suggests that the stability of this mRNA might be a point of regulation.  Using the transcriptome-wide atlas (http:\/\/ttp-atlas.univie.ac.at) of cis-acting elements controlling mRNA decay in LPS-induced macrophages (511), I found a potential TTP binding site in the EP4 3'UTR.  TTP is an IL10-induced protein (239) and usually recruit decay factors to the mRNA such as mRNA decay enzymes (512, 513) or microRNAs (514) involved in deadenylation, decapping, and 5'- 3' exonucleolytic decay (512) or 3'- 5' exosomal-mediated mRNA decay (513).  The kinetics of EP4 and TNF\u03b1 mRNA decay are similar (511).  However, while TTP is required for EP4 stability, TTP increases TNF\u03b1 decay in LPS-activated BMDMs (511).   Yet, it remains to be determined whether this effect is a direct consequence of TTP binding to EP4 mRNAs, or caused by indirect mechanisms including mRNA stabilization by factors which are themselves controlled by TTP.  Future studies may include examining which mRNAs IL10 regulates through TTP.  Luciferase reporters harbouring the EP4 3'UTR can be used to examine whether IL10 controls EP4 mRNA stability. Validation experiments will be performed by knocking down the chosen ARE-BPs or microRNAs followed by measuring EP4 mRNA and protein stability levels in response to LPS and LPS+IL10 treatments.       97 Previous studies have demonstrated that PGE2 activation of EP4 can mediate its inhibitory actions through stimulating EPRAP (395) or cAMP (398, 405, 464) signalling pathways in activated macrophages.  Whether this inhibitory action of EP4 activation is triggered through PGE2 induction of endogenous IL10 has been controversial.  Studies using neutralizing anti-IL10 antibodies showed that PGE2 reduction of TNF\u03b1 expression was independent of endogenous IL10  (515).  Other studies using anti-IL10 antibodies in mouse perimacs (516), or mouse WT and IL10 knockout BMDM (517) have suggested that PGE2 inhibition of TNF\u03b1 or COX-2 was dependent on PGE2-induced IL10 expression.  The apparent difference in IL10 requirement between the human and mouse studies might be due to differences in the kinetics of LPS-induced IL10 expression in the different cell types or their phenotype\/differentiation state (516).  Regardless of that, EP4 agonist has been shown to be effective in ulcerative colitis treatment and was shown to be successful  in phase 2 of clinical trials (440).    This current study scrutinizes the cooperation and interplay between IL10 and PGE2 actions in controlling macrophage inflammation.  EP4 has been reported to mediate PGE2\u2019s inhibition of inflammatory mediators  (395, 398).  LPS treatment of macrophages results in COX-2-dependent production of PGE2 (518, 519) and IL10 can inhibit COX-2 mRNA levels (240, 520) in a STAT3 (240) and SHIP1 (396) dependent manner.  In fact, EP4 mRNA expression was reported to be inhibited by EP4-mediated cAMP-dependent pathway in LPS-activated macrophages (403), suggesting a negative feedback mechanism of IL10 to reduce EP4 levels after its early upregulation.  This could be a mechanism to self-limit the inflammatory response in macrophages.   Our proposed model for the coordination and interplay between IL10 and PGE2 signalling in controlling macrophage inflammation is initiated with LPS signalling that may initially elevate COX-2 levels (518, 519) and thus production of both pro and anti-inflammatory prostaglandins    98 including PGE2 (518, 519) as well as the production of inflammatory mediators such as TNF\u03b1 (9).  Autocrine PGE2 upregulation in turn will activate EP4 to inhibit inflammation  (398, 405) (398, 405).  EP4 signalling promotes G\u03b1s activation of AC, elevation of cAMP levels and subsequent activation and phosphorylation of the CREB transcription factor (37).  pCREB interferes with LPS-induced NF\u03baB transcription, as well as supports transcription of more IL10 (521).  The appearance of IL10 downregulates COX-2, and upregulates EP4 so the action of the anti-inflammatory PGE2 is favored and cells become more responsive to circulating levels of PGE2. I also asked whether IL10R signalling is involved in the subsequent PGE2 stimulation of EP4 signalling.  I found EP4 protein is expressed within an hour of IL10 addition (Figure 3.4 and 3.5) and that IL10 stimulation of pCREB required the presence of EP4 (Figure 3.11).  PKA activation has indeed been reported in response to IL10 in BMDM, and was shown to peak at 2 - 4 hours after IL10 treatment  (38).  This delay of PKA activation suggests that PKA activation is induced by IL10R indirectly, perhaps through EP4 signalling.  These observations are consistent with reports showing endogenous PGE2 synthesized within an hour of LPS stimulation (522) leading to EP4 activation, cAMP elevation and PKA activation (395, 467).   Since elevation of cAMP levels has been shown to inhibit the activity of LPS-induced, PI3K-dependent signalling (523) in macrophages, I examined whether IL10 inhibition of PI3K signalling required EP4.  I found that IL10 inhibition of LPS-stimulated phosphorylation of p85 subunit of PI3K and the downstream p70 S6 kinase does require the presence of EP4 protein (Figure 3.12).  In addition, our model that IL10 activation of cAMP signalling occurs indirectly through PGE2 stimulation of EP4 protein also provides an explanation for why cAMP elevating agents are synergistic rather than additive with IL10 stimulation for induction of A8 protein expression (465).      99 In summary, IL10 presence or addition is required for EP4 protein expression which results in PGE2 subsequent activation EP4 signalling to inhibit macrophage activation.  PGE2 agonists are currently in clinical trials for treatment of IBD (440).  From our current study, it would be important to keep in mind that PGE2 agonists may not be helpful in patients with impaired EP4 protein expression due to deficiencies in IL10, SHIP1 or STAT3 signalling (13, 166, 167).  Thus, further investigation is needed to determine whether IL10 is the only cytokine which upregulates EP4 protein expression in macrophages and whether other factors can elevate EP4 levels in patients with IL10 signalling deficiencies to better understand what alternative treatments can be applied to inhibit inflammatory diseases.                               100 Chapter 4: IL10 induction of neuroendocrine-associated proteins and PDL1 protein in PCa cells  4.1. Introduction PCa is among the leading causes of cancer mortality worldwide.  At early stages, PCa proliferation is mostly androgen-dependent (273, 524-526) thus, PCa cells are initially treated with ADT (273, 328-332).  Once tumours develop androgen independent growth, patients are treated with ARPI such as ENZ.  While advanced PCa is initially controlled with hormonal therapies targeting the AR pathway, recurrence occurs due to the emergence of lethal CRPC.  Despite the potency of ARPI such as ENZ that prolong survival, these treatments are merely palliative as resistance ultimately emerges.  Autopsy series suggest that up to 25% of CRPC patients that are resistant to ARPI, shed their dependence on the AR, and exhibit a continuum of features associated with the NE lineage (47, 64, 358, 359). Notably, the NE phenotype can be enhanced by factors in the tumour environment such as cytokines like IL6 (51, 56).  The action of IL6 on PCa cells has been extensively studied (480), and IL6 receptor signalling has been reported to induce NE differentiation through different mechanisms including its canonical activation of STAT3 transcription factor (57, 58).  Another cytokine that signals through STAT3 is IL10.  In fact, both IL10 and IL6 have been reported to be excessively expressed in metastatic androgen-independent PCa cells (180) and serum levels of IL10 and IL6 are elevated in patients resistant to ENZ treatment compared to sensitive patients (62).  These observations suggest that both cytokines may be contribute to the development of more aggressive tumours with NE phenotype (47, 64, 358, 359).   IL10 is best studied as an anti-inflammatory, immune suppressive cytokine (10, 11, 24, 25) that contributes to promote cancer aggressiveness by acting on immune cells to suppress the anti-tumour immune response (26).  IL10 serum levels in cancer patients correlates with poor prognosis    101 (29) and is positively correlated with Gleason scores (30).  IL10 could be produced either by the tumour cells themselves (177-180) or by tumour elicitation of tumour-infiltrating, IL10 producing immune cells (181, 182).  IL10 inhibition of the anti-tumour immune response includes suppression of myeloid (macrophage and dendritic cell) and T effector cell function (182-185).  IL10 also upregulates expression of PDL1 (CD274) on myeloid cells (66).  PDL1 binds to the inhibitory receptor, PD1 on T cells resulting in inactivation of the T cell and inhibition of the host T-cell anti-tumour immune response (189, 190).   However, in the early 2000s, Stearns et al. reported that IL10 also has direct actions on PCa cells (31-33).  IL10 treatment of PCa cell lines increased TIMP1 (31) and decreased MMP1 and MMP2 synthesis (32).  How the IL10 regulation of TIMP1 and MMP1\/MMP2 expression contributes to PCa progression is not clear, but elevated TIMPs and MMPs are associated with higher grade PCa (34).  No work has been done regarding the direct effect of IL10 on PCa since the studies published by the Stearns group, but I became interested on the direct actions of IL10 on PCa cells because of the interesting observations reported by Bishop et al. (64) regarding PDL1 expression in cells from patients who are ENZ resistant.   Bishop et al. found that in tumour biopsies from ENZ resistant patients, PDL1 is predominantly increased on the PCa cells rather than in tumour immune infiltrating cells (64).  This prompted us to examine whether IL10 directly induces expression of NE-associated proteins and PDL1 on PCa cells in vitro.  I compared the effect of IL10 with that of IL6 or ENZ treatment on different AR-dependent and independent PCa cells.  I also assessed the ability of both IL10 and IL6 to modulate AR activity in LNCaP cells expressing a stably transduced AR controlled GFP reporter (491).  I found that addition of IL10 to PCa cells in vitro promoted development of NE-like characteristics    102 and enhanced the surface expression of PDL1 protein.  This has implications for potential therapies involving the use of IL10 for the treatment of PCa. 4.2.  Results I examined the effect of IL10 on PCa cell lines representing various stages of cancer development.  LNCaP cells are AR positive, androgen sensitive cell line derived from metastatic lymph node PCa tumours (494).  IL6 induction of LNCaP morphological alternations have been previously reported (51, 56), and ENZ treatment has been shown to induce NED in the cells in vitro and in vivo (47).   The 42DENZR and 16DCRPC cell lines both still express the AR, and were derived from LNCaP xenografts, that had been serially passaged in castrated mice, which were treated or not respectively with ENZ.  The 42DENZR cell line is more resistant to ENZ and expresses more basal PDL1 than LNCaP and 16DCRPC cells, and represents an aggressive neuroendocrine phenotype (47).  The 16DCRPC cell line represents an androgen independent (CRPC), ENZ sensitive cell (47). 4.2.1. IL10 induction of morphological transformation and NE proteins consistent with NED The NED phenotype is characterized by distinct morphological changes (56), and the expression of neuronal markers (368).   Among these markers, the expression of NSE or SYP have been observed to be induced by IL6 or ENZ in PCa cells in vitro (47, 56).  Therefore, I examined the effect of treating PCa cells with IL10, IL6 and ENZ for 7 days on cell morphology and the expression of NSE and SYP proteins.       103 4.2.1.1.   IL10 induction of morphological alterations and NE proteins in LNCaP, androgen dependent cells IL10 treatment of LNCaP cells resulted in distinct morphological changes that appeared after 4 days and these alternations were more pronounced after 7 days treatment (Figure 4.1A).   The IL10 treated cells became long, branched, and had neuritic-like extensions.  These morphological changes were comparable to those induced by IL6 and ENZ.  Next, I tested whether IL10 could induce the expression of the NE markers NSE and SYP.  As shown in Figure 4.1B, NSE and SYP expression levels were significantly increased by IL10 in LNCaP cells compared to untreated cells.  This increase of NSE and SYP levels were comparable to cells treated with IL6 or ENZ.  These results show that both IL10 and IL6 may work similarly in androgen sensitive PCa cells, leading to a NED phenotype associated with the expression NE proteins.       104    Figure 4.1  IL10 induction of morphological changes and expression of NSE and SYP neuroendocrine markers in LNCaP cells. LNCaP cells grown in vitro were stimulated with 100 ng\/ml IL10, 100 ng\/ml IL6 or 10 \u00b5M ENZ for 7 days. The morphlogical changes induced by different treatments were imaged using a light microscope (A).  The expression levels of NSE or SYP were determined by immunoblotting the cell lysates of LNCaP cells (B).  Data plotted represent NSE and SYP band intensities normalized to GAPDH protein levels from three independent experiments.  The statisical significance for the difference beween untreated (Un.) and different treatment was determined by one-way ANOVA test with Tukey\u2019s correction, **** p<0.0001.    4.2.1.2.   IL10 induction of morphological alterations and NE proteins in androgen resistant, AR-dependent 16DCRPC cells Next, I examined the effect of IL10 on the androgen resistant, ENZ sensitive 16DCRPC.  IL10, IL6 and ENZ treatment showed a phenotype similar to that observed in LNCaP cells treatment which resulted in branched and elongated neurite-like extensions compared to untreated cells (Figure 4.2A).  In the case of the expression of the neuronal markers induced by different (A) Untreated IL6 IL10 ENZLNCaPUn. IL6 IL10NSEGAPDHENZ Un. IL6 IL10SYPGAPDHENZ(B)Un. IL10 IL6 ENZ0.00.51.01.5NSE\/GAPDH \u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002Un. IL10 IL6 ENZ0.00.51.01.52.0SYP\/GAPDH \u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002   105 treatments in ENZ sensitive 16DCRPC, IL10 and ENZ induced similar levels of NSE and SYP protein (Figure 4.2B).  In contrast, IL6 treatment significantly upregulated SYP protein but modestly increased NSE protein expression (Figure 4.2B).  The lower ability of IL6 to increase NSE levels has also been described in DU145 and C4-2 PCa cells (527).       Figure 4.2  IL10 induction of morphological changes and expression of NSE and SYP neuroendocrine markers in 16D CRPC cells. 16D CRPC cells grown in vitro were stimulated with 100 ng\/ml IL10, 100 ng\/ml IL6 or 10 \u00b5M ENZ for 7 days. The morphlogical changes induced by different treatments were imaged using a light microscope (A).  The expression levels of NSE or SYP were determined by immunoblotting the cell lysates of 16D CRPC cells (B). Data plotted represent NSE and SYP band intensities normalized to GAPDH protein levels from three independent experiments.  The statisical significance for the difference beween untreated (Un.) and different treatment was determined by one-way ANOVA test with Tukey\u2019s correction, **** p<0.0001, *** p<0.001, * p<0.05.   (A) Untreated IL6 IL10 ENZ16DNSEGAPDHUn. IL6 IL10 ENZSYP(B)Un. IL10 IL6 ENZ01234NSE\/GAPDH \u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002Un. IL10 IL6 ENZ0.00.51.01.52.02.5SYP\/GAPDH\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002   106 4.2.1.3.   IL10 induction of NE-like morphological differentiation and NE proteins in 42DENZR cells Finally, I examined the effect of IL10 on the 42DENZR cell line.  To evaluate the effect of IL10 on these cells, I first removed ENZ from their culture media for a day prior to the experiment.  The following day, cells were treated with media, IL10, IL6 or ENZ.  7 days post-treatment, untreated cells were oblong in shape while the IL10, IL6 and ENZ-treated cells were more planar (Figure 4.3A).  Then, I examined the expression of NSE and SYP protein levels in these ENZ resistant 42DENZR cells in response to different treatments.  As expected, ENZ induction of NSE and SYP protein was weaker than in LNCaP and 16DCRPC cells (Figure 4.3B).  IL10 and IL6 treatment elevated NSE and SYP levels (Figure 4.3B) higher than that seen with ENZ, but lower than that observed in LNCaP and 16DCRPC cells.    Figure 4.3  IL10 induction of morphological changes and the expression of NSE and SYP neuroendocrine markers in 42DENZR cells. (A) Untreated IL6 IL10 ENZ42DNSEGAPDHUn. IL6 IL10SYPENZ(B)Un. IL10 IL6 ENZ0.000.050.100.150.200.25SYP\/GAPDH\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002Un. IL10 IL6 ENZ0.00.20.40.6NSE\/GAPDH\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002   107 42DENZR cells grown in vitro were stimulated with 100 ng\/ml IL10, 100 ng\/ml IL6 or 10 \u00b5M ENZ for 7 days. The morphlogical changes induced by different treatments were imaged using a light microscope (A).  The expression levels of NSE or SYP were determined by immunoblotting the cell lysates of 42DENZR cells (B). Data plotted represent NSE and SYP band intensities normalized to GAPDH protein levels of quadruplicate samples from two independent experiments.  The statisical significance for the difference beween untreated (Un.) and different treatment was determined by one-way ANOVA test with Tukey\u2019s correction, **** p<0.0001, *** p<0.001, * p<0.05.    4.2.2. IL10-induced inhibition of AR activation   I next examined whether IL10 treatment might inhibit AR activity, in a LNCaP cell line stably expressing a GFP reporter under the control of the AR regulated probasin promoter (ARR2PB) (491).  IL10, IL6 and ENZ all inhibited GFP expression with similar kinetics in the LN-ARR2PB-EGFP cells (Figure 4.4A and B).  However, the degree of AR activity inhibition seems to be the greatest by ENZ followed by IL10 and IL6 as shown in Figure 4.4C.  These data show that IL10 and IL6 inhibit AR activation in a comparable manner to ENZ treatment.  Whether IL10 and IL6 inhibition of AR activity are responsible for the acquisition of NE characteristics need to be determined.    4.2.3. IL10 upregulation of PDL1 in different PCa cells  Recently, PDL1 protein levels were reported to be highly elevated in tumour biopsies from ENZ resistant patients, and in ENZ resistant PCa cells that are AR-independent (64).  To determine whether IL10 or IL6 treatment can directly alter PDL1 protein expression in PCa cells, I measured PDL1 expression levels after 7 days of treatment with IL10, IL6 or ENZ using flow cytometry.       108  Figure 4.4  Inhibition of AR transactivation in IL10, IL6 and ENZ treated cells.   LNCaP cells were either untreated (Un) or treated with 100 ng\/ml IL10, IL6 or 10 \u00b5M ENZ.  Cells were collected for flow cytometry analysis at the indicated time points. (A) The gating strategy and how % GFP cells are determined. (B) Histograms are from one of three independent experiments. (C) The % GFP positive cells determined, as shown in panel A, are plotted for the different treatment groups over time. The statisical significance for the difference beween untreated and different treatments was determined by two-way ANOVA test with Tukey\u2019s correction, **** p<0.0001, *** p<0.001, ** p<0.01.       109 4.2.3.1.  Effect of IL10, IL6 and ENZ on PDL1 levels in LNCaP androgen dependent cells I first tested whether IL10 or IL6 treatment can directly alter PDL1 protein expression in LNCaP cells.  As shown in Figure 4.5A and B, IL10 and ENZ treatment of LNCaP cells increased PDL1 surface expression compared to untreated cells.  IL6 treatment showed only a modest induction of PDL1 expression which was confirmed to be statistically insignificant.  Next, I examined the effect of IL10, IL6 and ENZ on PDL1 levels in 16DCRPC AR-sensitive cells, and 42DENZR AR-resistant cells.   Figure 4.5  IL10 and ENZ but not IL6 upregulates PDL1 in LNCaP cells.    Surface expression of PDL1 in after 7 days treatment with 50 ng\/ml IL10 or IL6 and 10 \u00b5M ENZ in LNCaP cells was assessed by flow cytometry.  The fluorescent signal was analyzed by plotting a histogram of all events with the defined FSC\/SSC scatter gate, and unstained cells were used as a negative control.  (A) Histograms are shown here as representative from one of three experiments.  (B) Bar graphs represent the mean of MFI fold changes relative to untreated cells from three independent experiments (MFI of untreated cells were normalized to 1, and MFI of treated cells were normalized to untreated cells).  The statistical (A)CountUn.IL10Un.IL6Un.ENZIL10 IL6 ENZPDL1 (FL2)\u0012\u001a\u0004 \u000e\u0006\u0005 \u000e\t \u000b\u0010\u0013\u0005\u0004\u0005\u0005\u0004\b\u0006\u0004\u0005\u0006\u0004\b\u0007\u0004\u0005\u0007\u0004\b\u0011\u000e\u0006\u000f\f\u0002\u001a\u001b\u001c\u0019\u0014\u0018\u0017\u001f\u0016\u0015\u001d\u001b\u001e\u001a\u001d\u001c\u0016\u0014\u001d\u0016\u0015\u0003\u0002\u0002\u0003\u0004\u0002\u0002(B)   110 significance for the difference between untreated and different treatment was determined by one-way ANOVA with Tukey\u2019s correction, ** p<0.01, ns= not significant.   4.2.3.2.  Effect of IL10, IL6 and ENZ on PDL1 levels in androgen resistant, AR-dependent 16DCRPC cells For 16DCRPC cells, I found that IL10 and ENZ treatment significantly increased PDL1 levels compared to untreated cells (Figure 4.6A and B) similar to that seen in the LNCaP cells.  In addition, like in LNCaP cells, IL6 only showed modest insignificant upregulation of PDL1 in the 16DCRPC cells.      Figure 4.6  IL10 and ENZ but not IL6 upregulates PDL1 in 16DCRPC cells.   Surface expression of PDL1 in after 7 days treatment with 50 ng\/ml IL10 or IL6 and 10 \u00b5M ENZ in 16DCRPC cells was assessed by flow cytometry.  The fluorescent signal was analyzed by plotting a histogram of all events with the defined FSC\/SSC scatter gate, and unstained cells were used as a negative control.  (A) Histograms are shown here as representative from one of three experiments.  (B) Bar graphs represent the mean of MFI fold changes relative to untreated cells from three independent experiments (MFI of untreated cells were normalized to 1, and MFI of treated cells were normalized to untreated cells).  (A)Un.IL10Un.IL6Un.ENZIL10 IL6 ENZPDL1 (FL2)Count\u0012\u001a\u001d\u0004 \u000e\u0006\u0005 \u000e\t \u000b\u0010\u0013\u0005\u0004\u0005\u0005\u0004\b\u0006\u0004\u0005\u0006\u0004\b\u0007\u0004\u0005\u0011\u000e\u0006\u000f\f\u0002\u001a\u001b\u001c\u0019\u0014\u0018\u0017 \u0016\u0015\u001e\u001b\u001f\u001a\u001e\u001c\u0016\u0014\u001e\u0016\u0015\u0003\u0002\u0003\u0004\u0002(B)   111 The statistical significance for the difference between untreated and different treatment was determined by one-way ANOVA with Tukey\u2019s correction, *p>0.05, ns= not significant.  4.2.3.3.   Effect of IL10, IL6 and ENZ on PDL1 levels in 42DENZR cells Finally, I examined the effect of IL10, IL6 and ENZ treatment on 42DENZR cells that had been cultured out of ENZ.  IL10, IL6 and ENZ treatment all significantly upregulated PDL1 expression in 42DENZR cells (Figure 4.7A and B).  However, IL6-treated cells had a modest upregulation of PDL1 compared to that seen in response to IL10 and ENZ treatment but it was significant than that observed with IL6 in LNCaP and 16DCRPC cells (Figure 4.7A and B).  Figure 4.7  Increased PDL1 expression in IL10, IL6 and ENZ treated 42DENZR cells. Surface expression of PDL1 in after 7 days treatment with 50 ng\/ml IL10 or IL6 and 10 \u00b5M ENZ in 42DENZR cells was assessed by flow cytometry.  The fluorescent signal was analyzed by plotting a histogram of all events with the defined FSC\/SSC scatter gate, and unstained cells were used as a negative control.  (A) Histograms are shown here as representative from one of three experiments.  (B) Bar graphs represent the (A)Un.IL10Un.IL6Un.ENZIL10 IL6 ENZPDL1 (FL2)Count\u0012\u001a\u0004 \u000e\u0006\u0005 \u000e\t \u000b\u0010\u0013\u0005\u0004\u0005\u0005\u0004\b\u0006\u0004\u0005\u0006\u0004\b\u0007\u0004\u0005\u0007\u0004\b\u0011\u000e\u0006\u000f\f\u0002\u0010\u001b\u001c\u0019\u0014\u0018\u0017\u001e\u0016\u0015\u001d\u001b\u0012\u001a\u001d\u001c\u0016\u0014\u001d\u0016\u0015\u0003\u0002\u0002\u0002\u0002\u0002\u0002\u0002\u0002(B)   112 mean of MFI fold changes relative to untreated cells from three independent experiments (MFI of untreated cells were normalized to 1, and MFI of treated cells were normalized to untreated cells).  The statistical significance for the difference between untreated and different treatment was determined by one-way ANOVA with Tukey\u2019s correction, **** p<0.0001, *** p<0.001, *p>0.05.  4.2.4. EP4 is marginally upregulated upon IL10 treatment in different PCa cells Autocrine and paracrine produced PGE2 binds to the EP4 receptor (37), and can support proliferation of PCa cells by stimulating PI3K\/Akt and cAMP-dependent PKA pathways (449).  PGE2 has been reported to induce NED phenotype in PCa cells (55), and our recent work with macrophages showed that IL10 induction of EP4 protein is required for IL10 action in these cells (65).  Thus, I examined whether IL10 or IL6 might upregulate EP4 expression to promote PGE2-induced NED.  As shown in Figure 4.8A, both IL10 and IL6 (and ENZ) treatment slightly increased EP4 levels in LNCaP cells.   However, neither IL10, IL6 or ENZ induced EP4 protein levels in 16DCRPC or 42DENZR cells after 7 days of treatment as compared to untreated cells (Figure 4.8B and C).    Figure 4.8  Slight upregulation of EP4 in IL10, IL6 and ENZ treated PCa cells. (B) 16DEP4GAPDHUn. IL10  IL6 ENZUn. IL10 IL6 ENZ0.00.51.01.52.02.5EP4\/GAPDH\u0002\u0003\u0002\u0003\u0002\u0003(C) 42DUn. IL6 IL10 ENZEP4GAPDHUn. IL10 IL6 ENZ0.00.20.40.60.81.0EP4\/GAPDH\u0002\u0003\u0002\u0003\u0002\u0003EP4GAPDHUn. IL10  IL6 ENZ(A) LNCaPUn. IL10 IL6 ENZ0.00.51.01.52.0EP4\/GAPDH \u0002\u0002\u0002\u0002\u0002\u0002   113 (A) LNCaP, (B) 16DCRPC, (C) 46DENZR resistant were stimulated with 100 ng\/ml IL10, 100 ng\/ml IL6 or 10 \u00b5M ENZ for 7 days prior to lysate collection.  Expresstion levels of EP4 were determined by immunoblotting the cell lysates.  Data plotted represent EP4 band intensities normalized to GAPDH protein levels from three independent expermints.  The statistical significance for the difference between untreated and different treatment was determined by one-way ANOVA with Tukey\u2019s corrections, *** p<0.001, ** p<0.01, * p<0.05, ns= not significant.  4.3. Discussion A challenging aspect in treating prostate cancer is that most patients who are treated with the newly AR antagonist drugs such as ENZ, after their successful surgical or medical ADT therapy fails (327, 340), also become resistant to these drugs (343, 528).  Some recurrent and resistant tumours are associated with the development of more aggressive NE phenotype (47, 64, 358, 359) with 39% of tumors classified as either intermediate or pure NEPC (48).  AR antagonist action results in appearance of NEPC tumour cells, but cytokines such as IL6 which are elevated in PCa patients can also directly induce NED (51, 56) in LNCaP cells.  I report here that IL10, another cytokine upregulated in PCa patients, can also induce NE-like characteristics.   The LNCaP cell line and the 16DCRPC or 42DENZR lines derived from castration and ENZ resistant in vivo LNCaP tumours respectively generated by Bishop et al. were chosen to be studied for two reasons (64).  The first reason is that LNCaP cells were used in all the papers in the literature describing the effect of IL6 on prostate cancer cells (51, 54, 56, 57, 485, 529, 530).  The second is that our study is focusing in the potential change in IL10 and IL6 responsiveness of a PCa cell as they become castration or enzalutamide resistant.  Thus, a strength of our study includes the examination of a classic PCa cell and in vivo derived derivatives that represent later stages of PCa, and that this is the first demonstration of IL10 that behaves like IL6 on PCa cells.  But one limitation to our study is that I only used these LNCaP related cells lines.  The generalizability of our observations will require a survey of other PCa cell lines and of PCa tumour biopsies.      114 As shown in the results, IL10 treatment leads to expression of NSE in LNCaP, 16DCRPC and 42DENZR cells to levels similar to that induced by IL6.  IL10, IL6 and ENZ treatment also increased SYP levels in all three cell lines, with IL6 preferably increasing SYP in 16DCRPC cells higher than that seen with either IL10 or ENZ.  Further investigation is needed to determine the mechanisms underlying the increase of these NE markers in different PCa cell lines.  Both IL10R (531) and IL6R (532) signalling involves the use of the STAT3 transcription factor, but pathways unique to each receptor have also been described.  For example, IL6R can also induce higher NE-associated proteins through increasing MAPK activation in PCa cells (51).  Perhaps the MAPK pathway contributes to the increased SYP expression induced by IL6 in the 16DCRPC cells.  On the other hand, IL10R signalling has mostly been studied in immune cells where the SHIP1 inositol phosphatase contributes to IL10 inhibition of macrophage activation (107, 242).  SHIP1 is expressed only in hemopoietic and immune cells so signalling pathways downstream of the IL10R in epithelial cells, other than STAT3, remains to be characterized.   Since there is always an inverse relationship between AR activity and the induction of NE-like characteristics (47, 358, 360, 379, 484), I looked at whether IL10 and IL6 inhibited AR activity.  I tested the effect of IL10 and IL6 on AR activation using LNCaP cells expressing the AR reporter construct, ARR2PB-EGFP (491), and found both inhibited GFP expression within 2 days of treatment.  Notably, the degree of IL6 and IL10 inhibition of AR activity was lower than ENZ treatment.  ENZ directly binds to AR (343) and presumably inhibits AR activation by androgens in the media, this direct action of ENZ on the AR likely explains the more rapid and stronger effect of ENZ on the ARR2PB promoter activity.  The effect of IL6 is in agreement with previous reports showing an inhibition of AR transactivation in response to IL6 (490, 491).  Jia et al. reported that IL6 inhibits AR-dependent expression of the androgen regulated PSA gene by preventing the    115 recruitment of p300 coactivator to the PSA promoter and this inhibition was STAT3 dependent (490).  Whether IL10 signalling can also inhibit AR activity through inhibiting coactivator recruitment remains to be determined. In contrast, other investigators have concluded that IL6 stimulates AR activity in other experimental settings  (476, 478, 479, 489)  where AR transactivation assays were performed as a transient transduction of cell lines with AR expressing vector and a reporter gene construct (476, 478, 479, 489).  However as discussed in (491, 492), these transient transduction approaches may not accurately recapitulate physiological signalling, since they don\u2019t reflect the precise levels of the AR which can affect coactivator recruitment.  Furthermore, AR expression can vary between different replicates of the same assay, depending on the health of the cells and the efficiency of the transduction.  This could be a problematic factor since CRPC tumours have been shown to contain altered levels of AR and AR coactivators which reactivate AR signalling (336, 487, 488).  To avoid these complications, I used the LN-ARR2PB-EGFP cell line that stably expresses an AR-responsive GFP reporter construct (491). I also examined whether IL10 or IL6 might upregulate the PGE2 receptor, EP4, to promote PGE2-induced NED.  In our studies of IL10 action in macrophage cells, I found IL10 induction of EP4 protein expression is needed for IL10 inhibition of macrophage production of inflammatory cytokines (65).  In PCa cells, activation of EP4 by PGE2 has been reported to increase the expression of metastatic-related proteins in PCa cells (449).  EP4 upregulation of these proteins was mediated in a cAMP-dependent PKA dependent manner (449).  EP4 was also shown to be significantly upregulated during progression to castration resistance (63, 450).  Other reports also indicated the involvement of PGE2 (55), cAMP (51), and cAMP-dependent kinase particularly, PKA (382) in promoting NE phenotype in PCa cells which are known to be mediated through EP4    116 receptor activation in PCa cells (449).  However, I found EP4 levels constitutively highly expressed, and IL10, IL6 or ENZ treatment only very slightly increased EP4 protein levels on in LNCaP cells.  No EP4 upregulation occurred in response to these agents in either 16DCRPC or 42DENZR CRPC cells.  These observations suggest that neither IL10 nor IL6 likely enhances NE differentiation through increasing EP4 protein levels.  I found IL10, which is elevated in PCa patients, may directly act on some PCa cells to increase PDL1 expression.  IL10 and ENZ treatment increased PDL1 expression in all three PCa lines I tested in this study.  In contrast, IL6 treatment slightly upregulated PDL1 only in 42DENZR   cells.  The observation that exogenously added IL6 only weakly induces PDL1 in one of the three PCa cell lines that were tested differs from the high expression of PDL1 that Xu et al.  reported in C4-2 IL6 expressing cells (533).   However, Xu et al. had lentivirally transduced their C4-2 cells with IL6 and prolonged exposure to autocrine IL6 likely improves PDL1 expression  (533).  Prolonged exposure to IL6 may be needed to ensure proper glycosylation of PDL1.  Chan et al. showed that in hepatocellular carcinoma cells, IL6-activated JAK1 phosphorylate PDL1 at tyrosine Y112, which enhances the association of PDL1 with endoplasmic reticulum-associated N-glycosyltransferase isoform STT3A (534).  STT3A is a catalytic subunit of the oligosaccharyltransferase complex that is needed for N-glycosylation and stabilization of PDL1 (534).  However, it\u2019s unclear whether N-glycosylation of PDL1 is needed for its expression in PCa cells since IL10 and ENZ can both induce PDL1 levels even though IL6 cannot.   The widespread clinical use of more potent ARPI drugs, such as ENZ, to treat CRPC tumours has increased the emergence of more aggressive tumour types such as NEPC to avoid ARPI therapy (41, 45-47, 49, 64, 358, 359).  Immune checkpoint based immunotherapy approaches including anti-PDL1 therapy have been successful in other cancer types (535).     117 Unfortunately, clinical trials using anti-PDL1 was not successful in prostate cancer (536-538), and this was thought to be due of the lack of PDL1 expression on prostate cancer cells (538-540).  However, Bishop et al. (64) recently showed that ENZ LNCaP resistant tumours do express PDL1.  Further studies are needed to determine if human ENZ resistant tumours upregulate PDL1 and if so, this subset of patients might benefit from anti-PDL1 treatment.  Interestingly, Ihle et al. recently showed in bone metastatic PCa tumours, PDL1 is more highly expressed in PCa cells in blastic type lesions than the lytic lesions (541).   In summary, I demonstrated in this chapter that IL10 might influence PCa progression by interfering with AR activity, inducing expression of proteins associated with NEPC development, and upregulating expression of PDL1.  These findings suggest that IL10\u2019s direct action on PCa cells can contribute to PCa progression independent of IL10\u2019s suppression of the host anti-tumour immune cells.  Thus, potential therapies involving the use of IL10 for the treatment of PCa tumours need to be carefully considered before use.              118 Chapter 5.  Conclusions   5.1.  Conclusions IL10, best studied for its inhibitory action on myeloid cells such as macrophages, also acts on non-immune cell, epithelial cells (31, 133).  The studies described in this thesis demonstrate that IL10 induction of EP4 expression in macrophages contribute to IL10\u2019s inhibition of macrophage production of inflammatory mediators.  IL10 also induced expression of EP4 in PCa cells and, like IL6, stimulated expression of proteins associated with NED.  These data provide new insight into IL10 action and raise new questions for future study. Our lab has shown STAT3 (24, 35, 36) is not the sole mediator of IL10 signalling, and that SHIP1 is also required to mediate some of IL10\u2019s inhibition of LPS-induced translation of TNF\u03b1 mRNA (107) and the maturation of the microRNA, miR155 (242).  I found that IL10 induction of EP4 protein involved both SHIP1 and STAT3.  The fact that SHIP1 expression is restricted to hematopoietic cells raises the question of how EP4 and PDL1 levels are elevated by IL10 in PCa cells that don\u2019t express SHIP1.  One possibility is that the transcription of these proteins is STAT3 dependent while SHIP1 mainly regulates the stability of their mRNA transcription or translation in macrophages.  I used the Eukaryotic Promoter Database to look for STAT3 transcription binding factor motif site in the mouse Ptger4 and human CD274 genes which encode EP4 and PDL1 proteins respectively.  Potential STAT3 transcription factor binding sites are located at 84 bases upstream of the transcription initiation site of mouse Ptger4 gene sequence and at 666, 515, 410, 389, 228, and 169 bases upstream of the transcription start site of human CD274 gene sequence.  These data indicate that EP4 and PDL1 mRNA transcription might be regulated in a STAT3 dependent manner.     119 To determine whether IL10 does use these predicted sites to increase EP4 and PDL1 mRNA transcription levels, promoter analysis can be used to examine the contribution of each potential STAT3 binding site found in PDL1 and EP4 genes\u2019 sequences to IL10 increased transcription of these mRNAs.  This can be tested by performing a deletion region series of EP4 or PDL1 promoters cloned to a luciferase reporter vector, and tested for their response to IL10 in order to identify the critical promoter region to IL10 induction of PDL1 or EP4 genes (542).  Another approach that can be used is cloning an irrelevant linker sequence as a linker scanning series in different positions of PDL1 or EP4 putative promoter regions followed with luciferase reporter analysis in response to IL10 (542).  Other methods to examine whether IL10-induced transcription of PDL1 or EP4 mRNA is mediated by direct STAT3 binding to their promoters can be evaluated by chromatin immunoprecipitation combined with DNA sequencing of STAT3 binding regions and enrichment peaks analysis (236); or electrophoretic mobility shift assay using nuclear protein extracts from cells treated with\/without IL10 and radiolabeled PDL1 or EP4 putative promoter oligos, with\/without STAT3 antibody for supershift analyses (542). IL10 signalling has been reported to regulate the binding of RNA regulatory proteins to the ARE found in the 3' UTR of mRNA which encode pro-inflammatory mediators (140, 239).  To determine whether IL10 is involved in regulating the stability of either EP4 or PDL1 mRNA, I scanned for potential ARE regulatory sites in 3' UTR of each protein using the Scan for Motifs webserver ( http:\/\/bioanalysis.otago.ac.nz\/sfm\/sfm_main.pl).  I found some ARE-BP that may be involved in regulating EP4 mRNA stability or translation, these include TTP, KSRP, SFRS2 and YBX2.  Sedlyarov et al. has already reported that TTP regulates EP4 mRNA expression in LPS activated macrophages (511).  For PDL1, the Scan for Motifs predicted the involvement of TTP, KSRP and YBX2 ARE-BPs.  The Scan for Motifs server also identified some miRNAs that may    120 be involved in regulating the stability of EP4 mRNA including miR23abc\/23b-3p, miR24\/24ab\/24-3p, miR25\/32\/92abc\/363\/363-3p\/367, miR-342-3p, and miR-875-5p.  Some of the miRNAs predicted to regulate PDL1 mRNA stability include miR155, miR377, miR384\/384-3p, miR425\/425-5p\/489, miR431, and miR590-3p.   The regulation of these ARE-BPs or miRNAs could be cell type specific.  For example, miR155 expression was shown to be decreased by IL10 in a SHIP1 and STAT3 dependent manner in LPS-activated macrophages (242), and TTP mRNA was shown to be upregulated by IL10 in LPS-activated macrophages (239).  TTP and miR155 have both been detected in PCa cells as well.  Upregulation of miR155 and inhibition of TTP were reported to inhibit PDL1 mRNA stability translation in tumor infiltrated epithelial cells (543).  TTP (229) modifiers recruit decay factors to the mRNA such as mRNA decay enzymes (512, 513) or microRNA (514) involved in deadenylation, decapping, and 5'- 3' exonucleolytic decay (512) or 3'- 5' exosomal-mediated mRNA decay (513).  Whether IL10 could modulate the expression of different ARE-BPs such as TTP and miRNAs like mir155 in each cell type, and in primary patient PCa cells, needs to be investigated.   To identify proteins that may regulate EP4 or PDL1 mRNA trafficking, stability and translation, pulldown experiments using oligos corresponding to 3' UTR regions of the EP4 or PDL1 mRNA in combination with mass spectrometry analysis will reveal RNA binding proteins that bind to either oligo (544, 545).  Comparing the proteins that bind unstimulated, LPS stimulated, and LPS-\/+IL10 stimulated cells, may reveal the proteins involved in stimulus-dependent regulation of EP4 or PDL1 mRNAs.  After finding out the candidate proteins, validation experiments will be performed by knocking down the chosen proteins and measuring EP4 or PDL1 mRNA and protein levels in response to LPS and LPS+IL10 or untreated and IL10 treatments in macrophages and    121 PCa cells, respectively.  Another approach that could be used to examine whether IL10 controls EP4 or PDL1 mRNA stability is the use of luciferase reporters harbouring EP4 or PDL1 3'UTR regions (545).  These experiments can be done on macrophages and epithelial prostate cancer cells to understand how IL10 can regulate similar proteins in different cells.  In addition,  IL10 effect on the translation of PDL1 or EP4 mRNA can be examined by polysome analysis as described previously (107).  To evaluate whether IL10 might control EP4 and PDL1 protein expression by alternative splicing of their mRNAs, RNA-seq analyses can be used (546).  The action of IL10R signalling has been extensively studied in the myeloid cells such as macrophages, but not in non-immune cell immune cells such as epithelial PCa cells.  IL10R is expressed in normal epithelial cells and IL10 has been shown to cooperate with glucocorticoids to maintain epithelial cells integrity in the colon by stimulating p38 MAPK activation (547).  Low levels of IL10-induced STAT3-Y705 phosphorylation has been reported in lung epithelial cells after 10 min treatment with IL10 (548).  In epithelial prostate cancer, IL10 stimulates TIMP1 expression by phosphorylating IL10E1 and inducing its translocation to the nucleus (31).  However, the involvement of STAT3 was not evaluated in this study (31).  Whether STAT3 contribute with other signalling pathways downstream of the IL10R in epithelial cells remains to be further characterized.     Recent work in our lab showed that IL10 induces association of STAT3 with SHIP1 to mediate some its inhibitory actions on macrophage activation (Chamberlain et al., submitted).  STAT3 might interact with other proteins in epithelial cells.  STAT3 has been reported to interact with various proteins including Src (549, 550) and the EZH2 methyltransferase (551) in non-cancerous or cancerous epithelial cells.  Hsu et al reported that IL10 stimulation recruited Src to the IL10R1 and phosphorylation of Src was critical for inducing EGFR through the activation of    122 the JAK1\/STAT3 pathway and enhance lung cancer formation (549).  EZH2 has been shown to bind to and methylate non-histone proteins such as STAT3, resulting in STAT3 activation which promote growth of glioblastoma cells (551).  EZH2 has been recently reported to methylate STAT3 to promote NED after ENZ treatment (60).  Interestingly, IL6 was reported to promote EZH2 transcription in gastric cancer cells through STAT3 signalling (552).  These results suggest a positive feedback mechanism where STAT3 activation can increase EZH2, which in turn can interact with STAT3 and methylate it to promote tumour progression.  Whether IL10 can induce NED through similar signalling pathway that involves STAT3 methylation via EZH2 need to be investigated. Although our studies have focused on examining STAT3 phosphorylation on Y705 or S727 in response to IL10, STAT3 activity can also be controlled by methylation as described above and by acetylation (553, 554).  Acetylated STAT3 on K685 can regulate DNA methyltransferase 1 (DNMT1) binding to gene promoters to induce methylation and repression of the promoter (553, 554).  STAT3 acetylation results in sustained STAT3 activation.  Whether IL10 can induce STAT3 acetylation or methylation in PCa cells need to be examined.  Further investigation using IL10 siRNA or STAT3 inhibition approaches are needed to confirm the involvement of IL10-induced STAT3 activation in inducing NED.     Both IL10 (25) and PGE2 (405, 434) have been used to inhibit inflammation.  Therefore, understanding the nature of IL10 and PGE2 synergy in macrophages might provide more insight in developing new therapies for inflammatory diseases.  Besides PGE2\u2019s inhibitory actions on TNF\u03b1 production levels and other inflammatory mediators, presence of endogenous PGE2 was reported to be important for promoting anti-inflammatory M2 phenotype differentiation by increasing IL10 expression and other M2 markers including Mrc1, Arg1,Ym1 and Fizzl (555, 556).     123 This effect was reported to be mediated by PGE2-induced EP4 activation of CREB (555, 556).  Inhibition of endogenous PGE2 by COX-2 inhibitor or C\/EBP\u2010\u03b2 siRNA in macrophages was associated with the reduction of IL10 and M2 markers, and the survival of CD4+ T cells co-cultured with these macrophages (556).  Thus, an important outcome of IL10 and PGE2 synergy in macrophages is to propagate the anti-inflammatory M2 phenotype in a positive feedback mechanism.   IL10 is best studied for its inhibitory action on myeloid cells, but IL10 also stimulates CD8+ T cell anti-tumour immunity, and was evaluated in an initial clinical trial of different tumors including renal cell carcinoma patients, pancreatic ductal adenocarcinoma, ovarian cancer, non\u2013small-cell lung cancer, or melanoma (557).  These investigators showed that IL10 treatment increased CD8+ T cell activity and prolonged patient survival in some cancer types in those patients (557).  The combination of IL10 and anti-PD1 also showed good responses (558) in other cancer patients.  However, the use of IL10 needs to be carefully considered before using it on CRPC patients because I have shown that IL10 can increase the NED phenotype in the classic PCa cell line, LNCaP, and in vivo derived derivatives that represent later stages of PCa cell lines.  If future studies as suggested here could delineate differences in the signalling pathways used by IL10 in immune cells vs prostate cancer cells, those differences can be used to develop strategies to activate CD8+ T cells without enhancing the NED phenotype in PCa cells. In summary, I report here that IL10 upregulates the expression of PGE2 receptor EP4 protein, and propose that part of the IL10 anti-inflammatory effect on macrophages may be mediated through LPS-induced, autocrine PGE2, binding to IL10-induced EP4.  Also, I show here that IL10 action is not limited on its inhibitory effect on immune cells and it exerts stimulatory actions on    124 epithelial cancer cells that can contribute to PCa progression independent of IL10\u2019s suppression of host immune cells.                125 References 1. Medzhitov R. Origin and physiological roles of inflammation. Nature. 2008;454(7203):428-35. 2. Ovchinnikov DA. Macrophages in the embryo and beyond: much more than just giant phagocytes. Genesis. 2008;46(9):447-62. 3. Murray PJ, Wynn TA. Protective and pathogenic functions of macrophage subsets. Nature Reviews Immunology. 2011;11(11):723-37. 4. Fujiwara N, Kobayashi K. Macrophages in inflammation. Curr Drug Targets Inflamm Allergy. 2005;4(3):281-6. 5. Lavin Y, Mortha A, Rahman A, Merad M. Regulation of macrophage development and function in peripheral tissues. Nat Rev Immunol. 2015;15(12):731-44. 6. Gordon S. The macrophage: past, present and future. Eur J Immunol. 2007;37 Suppl 1:S9-17. 7. Taylor PR, Martinez-Pomares L, Stacey M, Lin HH, Brown GD, Gordon S. Macrophage receptors and immune recognition. Annu Rev Immunol. 2005;23:901-44. 8. Mosser DM, Edwards JP. Exploring the full spectrum of macrophage activation. Nat Rev Immunol. 2008;8(12):958-69. 9. Lu Y-C, Yeh W-C, Ohashi PS. LPS\/TLR4 signal transduction pathway. Cytokine. 2008;42(2):145-51. 10. Waal Malefijt Rd, Abrams J, Bennett B, Figdor CG, Vries JEd. Interleukin 10 (IL-10) inhibits cytokine synthesis by human monocytes : an autoregulatory role of IL-10 produced by monocytes. Journal of experimental medicine. 1991;174(5):1209-20. 11. Ouyang W, Rutz S, Crellin NK, Valdez PA, Hymowitz SG. Regulation and functions of the IL-10 family of cytokines in inflammation and disease. Annu Rev Immunol. 2011;29:71-109. 12. Engelhardt KR, Grimbacher B. IL-10 in humans: lessons from the gut, IL-10\/IL-10 receptor deficiencies, and IL-10 polymorphisms. Curr Top Microbiol Immunol. 2014;380:1-18. 13. Glocker EO, Kotlarz D, Boztug K, Gertz EM, Schaffer AA, Noyan F, et al. Inflammatory bowel disease and mutations affecting the interleukin-10 receptor. N Engl J Med. 2009;361(21):2033-45. 14. Glocker EO, Kotlarz D, Klein C, Shah N, Grimbacher B. IL-10 and IL-10 receptor defects in humans. Ann N Y Acad Sci. 2011;1246:102-7. 15. M. Tomoyose KMHIATKT. Role of Interleukin-10 in a Murine Model of Dextran Sulfate Sodium-Induced Colitis. Scandinavian Journal of Gastroenterology. 1998;33(4):435-40. 16. Duchmann R, Schmitt E, Knolle P, Meyer zum B\u00fcschenfelde KH, Neurath M. Tolerance towards resident intestinal flora in mice is abrogated in experimental colitis and restored by treatment with interleukin-10 or antibodies to interleukin-12. European journal of immunology. 1996;26(4):934. 17. Braat H, Peppelenbosch MP, Hommes DW. Interleukin-10-based therapy for inflammatory bowel disease. Expert Opinion on Biological Therapy. 2003;3(5):725-31. 18. Marlow GJ, van Gent D, Ferguson LR. Why interleukin-10 supplementation does not work in Crohn's disease patients. World journal of gastroenterology Journal Article. 2013;19(25):3931. 19. Jinquan T, Larsen CG, Gesser B, Matsushima K, Thestrup-Pedersen K. Human IL-10 is a chemoattractant for CD8+ T lymphocytes and an inhibitor of IL-8-induced CD4+ T lymphocyte migration. The Journal of Immunology. 1993;151(9):4545.    126 20. Emmerich J, Mumm JB, Chan IH, LaFace D, Truong H, McClanahan T, et al. IL-10 directly activates and expands tumor-resident CD8(+) T cells without de novo infiltration from secondary lymphoid organs. Cancer research. 2012;72(14):3570-81. 21. Chen WF, Zlotnik A. IL-10: a novel cytotoxic T cell differentiation factor. The Journal of Immunology. 1991;147(2):528. 22. Tilg H, van Montfrans C, van den Ende A, Kaser A, van Deventer SJ, Schreiber S, et al. Treatment of Crohn's disease with recombinant human interleukin 10 induces the proinflammatory cytokine interferon gamma. Gut. 2002;50(2):191-5. 23. Hutchins AP, Diez D, Miranda-Saavedra D. The IL-10\/STAT3-mediated anti-inflammatory response: recent developments and future challenges. BRIEFINGS IN FUNCTIONAL GENOMICS. 2013;12(6):489-98. 24. Murray PJ. Understanding and exploiting the endogenous interleukin-10\/STAT3-mediated anti-inflammatory response. Current Opinion in Pharmacology. 2006;6(4):379-86. 25. Ouyang W, O\u2019Garra A. IL-10 Family Cytokines IL-10 and IL-22: from Basic Science to Clinical Translation. Immunity. 2019;50(4):871-91. 26. Dennis KL, Blatner NR, Gounari F, Khazaie K. Current status of interleukin-10 and regulatory T-cells in cancer. Curr Opin Oncol. 2013;25(6):637-45. 27. Mosser DM, Zhang X. Interleukin-10: new perspectives on an old cytokine. Immunological reviews. 2008;226:205-18. 28. Pestka S, Krause CD, Sarkar D, Walter MR, Shi Y, Fisher PB. Interleukin-10 and related cytokines and receptors. Annu Rev Immunol. 2004;22:929-79. 29. Ugge H, Downer MK, Carlsson J, Bowden M, Davidsson S, Mucci LA, et al. Circulating inflammation markers and prostate cancer. Prostate. 2019;79(11):1338-46. 30. Dwivedi S, Goel A, Natu SM, Mandhani A, Khattri S, Pant KK. Diagnostic and Prognostic Significance of Prostate Specific Antigen and Serum Interleukin 18 and 10 in Patients with Locally Advanced Prostate Cancer: A Prospective Study. ASIAN PACIFIC JOURNAL OF CANCER PREVENTION. 2011;12(7):1843-8. 31. Stearns ME, Hu Y, Wang M. IL-10 signaling via IL-10E1 is dependent on tyrosine phosphorylation in the IL-10R alpha chain in human primary prostate cancer cell lines. Oncogene. 2003;22(24):3781-91. 32. Stearns ME, Wang M, Hu Y, Garcia FU, Rhim J. Interleukin 10 Blocks Matrix Metalloproteinase-2 and Membrane Type 1-Matrix Metalloproteinase Synthesis in Primary Human Prostate Tumor Lines. Clinical Cancer Research. 2003;9(3):1191-9. 33. Wang M, Hu Y, Stearns ME. A novel IL-10 signalling mechanism regulates TIMP-1 expression in human prostate tumour cells. British Journal of Cancer. 2003;88(10):1605-14. 34. Escaff S, Fern\u00e1ndez JM, Gonz\u00e1lez LO, Su\u00e1rez A, Gonz\u00e1lez-Reyes S, Gonz\u00e1lez JM, et al. Study of matrix metalloproteinases and their inhibitors in prostate cancer. British Journal of Cancer. 2010;102(5):922-9. 35. Murray PJ, Unanue ER. The Primary Mechanism of the IL-10-Regulated Antiinflammatory Response Is to Selectively Inhibit Transcription. Proceedings of the National Academy of Sciences of the United States of America. 2005;102(24):8686-91. 36. El Kasmi KC, Holst J, Coffre M, Mielke L, de Pauw A, Lhocine N, et al. General Nature of the STAT3-Activated Anti-Inflammatory Response. The Journal of Immunology. 2006;177(11):7880.    127 37. Fujino H, Salvi S, Regan JW. Differential Regulation of Phosphorylation of the cAMP Response Element-Binding Protein after Activation of EP2 and EP4 Prostanoid Receptors by Prostaglandin E2. Molecular Pharmacology. 2005;68(1):251. 38. Corraliza IM, Modolell M, Ferber E, Soler G. Involvement of protein kinase A in the induction of arginase in murine bone marrow-derived macrophages. Biochimica Et Biophysica Acta-General Subjects. 1997;1334(2-3):123-8. 39. Flores-Morales A, Bergmann TB, Lavallee C, Batth TS, Lin D, Lerdrup M, et al. Proteogenomic Characterization of Patient-Derived Xenografts Highlights the Role of REST in Neuroendocrine Differentiation of Castration-Resistant Prostate Cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 2019;25(2):595-608. 40. Beltran H, Prandi D, Mosquera JM, Benelli M, Puca L, Cyrta J, et al. Divergent clonal evolution of castration-resistant neuroendocrine prostate cancer. Nature medicine. 2016;22(3):298-305. 41. Lin D, Wyatt AW, Xue H, Wang Y, Dong X, Haegert A, et al. High fidelity patient-derived xenografts for accelerating prostate cancer discovery and drug development. Cancer research. 2014;74(4):1272-83. 42. Lapuk AV, Wu C, Wyatt AW, McPherson A, McConeghy BJ, Brahmbhatt S, et al. From sequence to molecular pathology, and a mechanism driving the neuroendocrine phenotype in prostate cancer. The Journal of Pathology. 2012;227(3):286-97. 43. Hansel DE, Nakayama M, Luo J, Abukhdeir AM, Park BH, Bieberich CJ, et al. Shared TP53 gene mutation in morphologically and phenotypically distinct concurrent primary small cell neuroendocrine carcinoma and adenocarcinoma of the prostate. The Prostate. 2009;69(6):603-9. 44. Mosquera JM, Beltran H, Park K, MacDonald TY, Robinson BD, Tagawa ST, et al. Concurrent AURKA and MYCN gene amplifications are harbingers of lethal treatment-related neuroendocrine prostate cancer. Neoplasia (New York, NY) U6 - ctx_ver=Z3988-2004&ctx_enc=info%3Aofi%2Fenc%3AUTF-8&rfr_id=info%3Asid%2Fsummonserialssolutionscom&rft_val_fmt=info%3Aofi%2Ffmt%3Akev%3Amtx%3Ajournal&rftgenre=article&rftatitle=Concurrent+AURKA+and+MYCN+gene+amplifications+are+harbingers+of+lethal+treatment-related+neuroendocrine+prostate+cancer&rftjtitle=Neoplasia+%28New+York%2C+NY%29&rftau=Mosquera%2C+Juan+Miguel&rftau=Beltran%2C+Himisha&rftau=Park%2C+Kyung&rftau=MacDonald%2C+Theresa+Y&rftdate=2013-01-01&rfteissn=1476-5586&rftvolume=15&rftissue=1&rftspage=1&rft_id=info%3Apmid%2F23358695&rftexternalDocID=23358695&paramdict=en-US U7 - Journal Article. 2013;15(1):1. 45. Jongsma J, Oomen MH, Noordzij MA, Van Weerden WM, Martens GJM, van der Kwast TH, et al. Kinetics of Neuroendocrine Differentiation in an Androgen-Dependent Human Prostate Xenograft Model. American Journal of Pathology. 1999;154(2):543-51. 46. Berenguer C, Boudouresque F, Dussert C, Daniel L, Muracciole X, Grino M, et al. Adrenomedullin, an autocrine\/paracrine factor induced by androgen withdrawal, stimulates 'neuroendocrine phenotype' in LNCaP prostate tumor cells. Oncogene. 2008;27(4):506-18. 47. Bishop JL, Thaper D, Vahid S, Davies A, Ketola K, Kuruma H, et al. The Master Neural Transcription Factor BRN2 Is an Androgen Receptor-Suppressed Driver of Neuroendocrine Differentiation in Prostate Cancer. Cancer discovery. 2017;7(1):54-71.    128 48. Small EJ, Huang J, Youngren J, Sokolov A, Aggarwal RR, Thomas G, et al. Characterization of neuroendocrine prostate cancer (NEPC) in patients with metastatic castration resistant prostate cancer (mCRPC) resistant to abiraterone (Abi) or enzalutamide (Enz): Preliminary results from the SU2C\/PCF\/AACR West Coast Prostate Cancer Dream Team (WCDT). Journal of Clinical Oncology. 2015;33(15_suppl):5003-. 49. Terry S, Maill\u00e9 P, Baaddi H, Kheuang L, Soyeux P, Nicolaiew N, et al. Cross Modulation between the Androgen Receptor Axis and Protocadherin-PC in Mediating Neuroendocrine Transdifferentiation and Therapeutic Resistance of Prostate Cancer. Neoplasia. 2013;15(7):761-IN22. 50. Foster BA, Evangelou A, Kaplan PJ, DeMayo F, Greenberg NM, Gingrich JR. Enforced expression of FGF-7 promotes epithelial hyperplasia whereas a dominant negative FGFR2iiib promotes the emergence of neuroendocrine phenotype in prostate glands of transgenic mice. Differentiation. 2002;70(9):624-32. 51. Deeble PD, Murphy DJ, Parsons SJ, Cox ME. Interleukin-6- and Cyclic AMP-Mediated Signaling Potentiates Neuroendocrine Differentiation of LNCaP Prostate Tumor Cells. Molecular and Cellular Biology. 2001;21(24):8471-82. 52. Wilson EM, Oh Y, Hwa V, Rosenfeld RG. Interaction of IGF-Binding Protein-Related Protein 1 with a Novel Protein, Neuroendocrine Differentiation Factor, Results in Neuroendocrine Differentiation of Prostate Cancer Cells. The Journal of Clinical Endocrinology & Metabolism. 2001;86(9):4504-11. 53. Untergasser G, Plas E, Pfister G, Heinrich E, Berger P. Interferon\u2010\u03b3 induces neuroendocrine\u2010like differentiation of human prostate basal\u2010epithelial cells. The Prostate. 2005;64(4):419-29. 54. Diaz M, Abdul M, Hoosein N. Modulation of neuroendocrine differentiation in prostate cancer by interleukin\u20101 and \u20102. The Prostate. 1998;36(S8):32-6. 55. Shimizu T, Ohta Y, Ozawa H, Matsushima H, Takeda K. Papaverine combined with prostaglandin E2 synergistically induces neuron-like morphological changes and decrease of malignancy in human prostatic cancer LNCaP cells. Anticancer research. 2000;20(2A):761. 56. Zhu Y, Liu C, Cui Y, Nadiminty N, Lou W, Gao AC. Interleukin\u20106 induces neuroendocrine differentiation (NED) through suppression of RE\u20101 silencing transcription factor (REST). The Prostate. 2014;74(11):1086-94. 57. Spiotto MT, Chung TDK. STAT3 mediates IL\u20106\u2010induced growth inhibition in the human prostate cancer cell line LNCaP. The Prostate. 2000;42(2):88-98. 58. Spiotto MT, Chung TDK. STAT3 mediates IL\u20106\u2010induced neuroendocrine differentiation in prostate cancer cells. The Prostate. 2000;42(3):186-95. 59. Thaper D, Vahid S, Kaur R, Kumar S, Nouruzi S, Bishop JL, et al. Galiellalactone inhibits the STAT3\/AR signaling axis and suppresses Enzalutamide-resistant Prostate Cancer. Scientific reports. 2018;8(1):17307-9. 60. Luo J, Wang K, Yeh S, Sun Y, Liang L, Xiao Y, et al. LncRNA-p21 alters the antiandrogen enzalutamide-induced prostate cancer neuroendocrine differentiation via modulating the EZH2\/STAT3 signaling. Nature communications. 2019;10(1):2571-17. 61. Sun F, Zhang ZW, Tan EM, Lim ZLR, Li Y, Wang XC, et al. Icaritin suppresses development of neuroendocrine differentiation of prostate cancer through inhibition of IL-6\/STAT3 and Aurora kinase A pathways in TRAMP mice. Carcinogenesis (New York). 2016;37(7):701-11.    129 62. Pal SK, Moreira D, Won H, White SW, Duttagupta P, Lucia M, et al. Reduced T-cell Numbers and Elevated Levels of Immunomodulatory Cytokines in Metastatic Prostate Cancer Patients De Novo Resistant to Abiraterone and\/or Enzalutamide Therapy. INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES. 2019;20(8):1831. 63. Terada N, Shimizu Y, Kamba T, Inoue T, Maeno A, Kobayashi T, et al. Identification of EP4 as a potential target for the treatment of castration-resistant prostate cancer using a novel xenograft model. Cancer research. 2010;70(4):1606-15. 64. Bishop JL, Sio A, Angeles A, Roberts ME, Azad AA, Chi KN, et al. PD-L1 is highly expressed in Enzalutamide resistant prostate cancer. Oncotarget. 2015;6(1). 65. Samiea A, Yoon JSJ, Cheung ST, Chamberlain TC, Mui AL. Interleukin-10 contributes to PGE2 signalling through upregulation of EP4 via SHIP1 and STAT3. PLoS One. 2020;15(4):e0230427. 66. Taube JM, Young GD, McMiller TL, Chen S, Salas JT, Pritchard TS, et al. Differential Expression of Immune-Regulatory Genes Associated with PD-L1 Display in Melanoma: Implications for PD-1 Pathway Blockade. Clinical cancer research : an official journal of the American Association for Cancer Research. 2015;21(17):3969-76. 67. Majno G. The healing hand : man and wound in the ancient world. Cambridge, Mass.: Harvard University Press; 1975. xxiii, 571 p., 6 leaves of plates p. 68. Rather LJ. Disturbance of function (functio laesa): the legendary fifth cardinal sign of inflammation, added by Galen to the four cardinal signs of Celsus. Bull N Y Acad Med. 1971;47(3):303-22. 69. Marshall JC. Inflammation, coagulopathy, and the pathogenesis of multiple organ dysfunction syndrome. Crit Care Med. 2001;29(7 Suppl):S99-106. 70. Bosmann M, Ward PA. The inflammatory response in sepsis. Trends Immunol. 2013;34(3):129-36. 71. Neurath MF. Cytokines in inflammatory bowel disease. Nat Rev Immunol. 2014;14(5):329-42. 72. McInnes IB, Schett G. Cytokines in the pathogenesis of rheumatoid arthritis. Nat Rev Immunol. 2007;7(6):429-42. 73. Al-Mofarreh MA, Al-Mofleh IA. Emerging inflammatory bowel disease in saudi outpatients: a report of 693 cases. Saudi journal of gastroenterology : official journal of the Saudi Gastroenterology Association. 2013;19(1):16-22. 74. Sakamoto N, Kono S, Wakai K, Fukuda Y, Satomi M, Shimoyama T, et al. Dietary risk factors for inflammatory bowel disease: a multicenter case-control study in Japan. Inflamm Bowel Dis. 2005;11(2):154-63. 75. Burisch J, Pedersen N, Cukovic-Cavka S, Turk N, Kaimakliotis I, Duricova D, et al. Environmental factors in a population-based inception cohort of inflammatory bowel disease patients in Europe--an ECCO-EpiCom study. J Crohns Colitis. 2014;8(7):607-16. 76. Elkahwaji JE, Hauke RJ, Brawner CM. Chronic bacterial inflammation induces prostatic intraepithelial neoplasia in mouse prostate. British Journal of Cancer. 2009;101(10):1740-8. 77. Medzhitov R, Janeway C. Innate immunity. N Engl J Med. 2000;343(5):338-44. 78. Medzhitov R, Janeway CA. Innate immune recognition and control of adaptive immune responses. Semin Immunol. 1998;10(5):351-3. 79. Leavy O. Innate immunity: New PAMP discovered. Nat Rev Immunol. 2015;15(7):402-3.    130 80. Gallucci S, Matzinger P. Danger signals: SOS to the immune system. Curr Opin Immunol. 2001;13(1):114-9. 81. Kono H, Rock KL. How dying cells alert the immune system to danger. Nat Rev Immunol. 2008;8(4):279-89. 82. Bianchi ME. DAMPs, PAMPs and alarmins: all we need to know about danger. J Leukoc Biol. 2007;81(1):1-5. 83. Medzhitov R. Inflammation 2010: new adventures of an old flame. Cell. 2010;140(6):771-6. 84. Pober JS, Sessa WC. Inflammation and the blood microvascular system. Cold Spring Harbor perspectives in biology. 2014;7(1):a016345. 85. McEver RP, Zhu C. Rolling cell adhesion. Annu Rev Cell Dev Biol. 2010;26:363-96. 86. Wong CH, Heit B, Kubes P. Molecular regulators of leucocyte chemotaxis during inflammation. Cardiovasc Res. 2010;86(2):183-91. 87. Imhof BA, Aurrand-Lions M. Adhesion mechanisms regulating the migration of monocytes. Nat Rev Immunol. 2004;4(6):432-44. 88. Headland SE, Norling LV. The resolution of inflammation: Principles and challenges. Semin Immunol. 2015;27(3):149-60. 89. Serhan CN, Savill J. Resolution of inflammation: the beginning programs the end. Nat Immunol. 2005;6(12):1191-7. 90. Nathan C. Points of control in inflammation. Nature. 2002;420(6917):846-52. 91. Ames BN, Gold LS, Willett WC. The Causes and Prevention of Cancer. Proceedings of the National Academy of Sciences of the United States of America. 1995;92(12):5258-65. 92. Balkwill F, Mantovani A. Inflammation and cancer: back to Virchow? The Lancet (British edition). 2001;357(9255):539-45. 93. Opie EL. EXPERIMENTAL PLEURISY-RESOLUTION OF A FIBRINOUS EXUDATE. The Journal of experimental medicine. 1907;9(4):391-413. 94. Clish CB, Schmidt B, Gronert K, Serhan CN, Levy BD. Lipid mediator class switching during acute inflammation: signals in resolution. Nature Immunology. 2001;2(7):612-9. 95. Perretti M. Endogenous mediators that inhibit the leukocyte\u2013 endothelium interaction. Trends in Pharmacological Sciences. 1997;18(11):418-25. 96. Hong S, Gronert K, Devchand PR, Moussignac R-L, Serhan CN. Novel docosatrienes and 17S-resolvins generated from docosahexaenoic acid in murine brain, human blood, and glial cells. Autacoids in anti-inflammation. The Journal of biological chemistry. 2003;278(17):14677-87. 97. Fahl\u00e9n L, Read S, Gorelik L, Hurst SD, Coffman RL, Flavell RA, et al. T cells that cannot respond to TGF-beta escape control by CD4(+)CD25(+) regulatory T cells. The Journal of experimental medicine. 2005;201(5):737-46. 98. Scher JU, Pillinger MH. The Anti-Inflammatory Effects of Prostaglandins. Journal of Investigative Medicine. 2009;57(6):703-8. 99. Italiani P, Boraschi D. From Monocytes to M1\/M2 Macrophages: Phenotypical vs. Functional Differentiation. Frontiers in immunology. 2014;5:514. 100. Gordon S, Pl\u00fcddemann A. Macrophage Clearance of Apoptotic Cells: A Critical Assessment. Frontiers in immunology. 2018;9:127. 101. Vignali DA, Collison LW, Workman CJ. How regulatory T cells work. Nat Rev Immunol. 2008;8(7):523-32.    131 102. DiLillo DJ, Matsushita T, Tedder TF. B10 cells and regulatory B cells balance immune responses during inflammation, autoimmunity, and cancer. Annals of the New York Academy of Sciences.1183:38-57. 103. Schottelius AJ, Mayo MW, Sartor RB, Baldwin AS. Interleukin-10 signaling blocks inhibitor of kappaB kinase activity and nuclear factor kappaB DNA binding. J Biol Chem. 1999;274(45):31868-74. 104. Kuwata H, Watanabe Y, Miyoshi H, Yamamoto M, Kaisho T, Takeda K, et al. IL-10-inducible Bcl-3 negatively regulates LPS-induced TNF-alpha production in macrophages. Blood. 2003;102(12):4123-9. 105. Murray PJ. The primary mechanism of the IL-10-regulated antiinflammatory response is to selectively inhibit transcription. Proc Natl Acad Sci U S A. 2005;102(24):8686-91. 106. Schaljo B, Kratochvill F, Gratz N, Sadzak I, Sauer I, Hammer M, et al. Tristetraprolin is required for full anti-inflammatory response of murine macrophages to IL-10. J Immunol. 2009;183(2):1197-206. 107. Chan CS, Ming-Lum A, Golds GB, Lee SJ, Anderson RJ, Mui ALF. Interleukin-10 inhibits lipopolysaccharide-induced tumor necrosis factor-\u03b1 translation through a SHIP1-dependent pathway. The Journal of biological chemistry. 2012;287(45):38020-7. 108. Cassatella MA, Meda L, Gasperini S, Calzetti F, Bonora S. Interleukin 10 (IL-10) upregulates IL-1 receptor antagonist production from lipopolysaccharide-stimulated human polymorphonuclear leukocytes by delaying mRNA degradation. J Exp Med. 1994;179(5):1695-9. 109. Jenkins JK, Malyak M, Arend WP. The effects of interleukin-10 on interleukin-1 receptor antagonist and interleukin-1 beta production in human monocytes and neutrophils. Lymphokine Cytokine Res. 1994;13(1):47-54. 110. Moore KW, de Waal Malefyt R, Coffman RL, O'Garra A. Interleukin-10 and the interleukin-10 receptor. Annu Rev Immunol. 2001;19:683-765. 111. Mantovani A, Biswas SK, Galdiero MR, Sica A, Locati M. Macrophage plasticity and polarization in tissue repair and remodelling. J Pathol. 2013;229(2):176-85. 112. Theret M, Mounier R, Rossi F. The origins and non-canonical functions of macrophages in development and regeneration. Development (Cambridge, England). 2019;146(9):dev156000. 113. Jenkins SJ, Ruckerl D, Cook PC, Jones LH, Finkelman FD, van Rooijen N, et al. Local macrophage proliferation, rather than recruitment from the blood, is a signature of TH2 inflammation. Science (New York, NY). 2011;332(6035):1284-8. 114. Lin H, Lee E, Hestir K, Leo C, Huang M, Bosch E, et al. Discovery of a Cytokine and Its Receptor by Functional Screening of the Extracellular Proteome. Science. 2008;320(5877):807-11. 115. Tagliani E, Shi C, Nancy P, Tay C-S, Pamer EG, Erlebacher A. Coordinate regulation of tissue macrophage and dendritic cell population dynamics by CSF-1. The Journal of experimental medicine. 2011;208(9):1901-16. 116. Hume DA, MacDonald KPA. Therapeutic applications of macrophage colony-stimulating factor-1 (CSF-1) and antagonists of CSF-1 receptor (CSF-1R) signaling. Blood. 2012;119(8):1810-20. 117. Fleetwood AJ, Lawrence T, Hamilton JA, Cook AD. Granulocyte-Macrophage Colony-Stimulating Factor (CSF) and Macrophage CSF-Dependent Macrophage Phenotypes Display Differences in Cytokine Profiles and Transcription Factor Activities: Implications for CSF Blockade in Inflammation. The Journal of Immunology. 2007;178(8):5245-52.    132 118. Gordon S, Taylor PR. Monocyte and macrophage heterogeneity. Nat Rev Immunol. 2005;5(12):953-64. 119. Martinez FO, Gordon S. The M1 and M2 paradigm of macrophage activation: time for reassessment. F1000Prime Rep. 2014;6:13. 120. Murray PJ, Allen JE, Biswas SK, Fisher EA, Gilroy DW, Goerdt S, et al. Macrophage activation and polarization: nomenclature and experimental guidelines. Immunity. 2014;41(1):14-20. 121. Mills CD, Kincaid K, Alt JM, Heilman MJ, Hill AM. M-1\/M-2 macrophages and the Th1\/Th2 paradigm. J Immunol. 2000;164(12):6166-73. 122. Stein M, Keshav S, Harris N, Gordon S. Interleukin 4 potently enhances murine macrophage mannose receptor activity: a marker of alternative immunologic macrophage activation. J Exp Med. 1992;176(1):287-92. 123. Gordon S. Alternative activation of macrophages. Nat Rev Immunol. 2003;3(1):23-35. 124. Mosser DM, Edwards JP. Exploring the full spectrum of macrophage activation. Nature Reviews Immunology. 2010;10(6):460-. 125. Murray PJ, Allen JE, Biswas SK, Fisher EA, Gilroy DW, Goerdt S, et al. Macrophage activation and polarization: nomenclature and experimental guidelines. Immunity. 2014;41(1):14-20. 126. Xue J, Schmidt SV, Sander J, Draffehn A, Krebs W, Quester I, et al. Transcriptome-based network analysis reveals a spectrum model of human macrophage activation. Immunity. 2014;40(2):274-88. 127. Guilliams M, van de Laar L. A Hitchhiker's Guide to Myeloid Cell Subsets: Practical Implementation of a Novel Mononuclear Phagocyte Classification System. Front Immunol. 2015;6:406. 128. Vu Manh TP, Bertho N, Hosmalin A, Schwartz-Cornil I, Dalod M. Investigating Evolutionary Conservation of Dendritic Cell Subset Identity and Functions. Front Immunol. 2015;6:260. 129. Rietschel ET, Kirikae T, Schade FU, Mamat U, Schmidt G, Loppnow H, et al. Bacterial endotoxin: molecular relationships of structure to activity and function. FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 1994;8(2):217. 130. Wright SD, Ramos RA, Tobias PS, Ulevitch RJ, Mathison JC. CD14, a receptor for complexes of lipopolysaccharide (LPS) and LPS binding protein. Science. 1990;249(4975):1431-3. 131. Shimazu R, Akashi S, Ogata H, Nagai Y, Fukudome K, Miyake K, et al. MD-2, a molecule that confers lipopolysaccharide responsiveness on Toll-like receptor 4. The Journal of experimental medicine. 1999;189(11):1777-82. 132. Poltorak A, He X, Smirnova I, Liu MY, Van Huffel C, Du X, et al. Defective LPS signaling in C3H\/HeJ and C57BL\/10ScCr mice: mutations in Tlr4 gene. Science. 1998;282(5396):2085-8. 133. Hyun J, Romero L, Riveron R, Flores C, Kanagavelu S, Chung KD, et al. Human intestinal epithelial cells express IL-10 through Toll-like receptor 4 (TLR4)-mediated epithelial-macrophage crosstalk. Journal of innate immunity. 2015;7(1):87-101. 134. Wright SD, Tobias PS, Ulevitch RJ, Ramos RA. Lipopolysaccharide (LPS) binding protein opsonizes LPS-bearing particles for recognition by a novel receptor on macrophages. The Journal of experimental medicine. 1989;170(4):1231-41.    133 135. Wagner H, H\u00e4cker G, Wang GG, Raz E, Redecke V, Kamps MP, et al. Specificity in Toll-like receptor signalling through distinct effector functions of TRAF3 and TRAF6. Nature. 2006;439(7073):204-7. 136. Chiba T, Yamada M, Hashimoto Y, Sato M, Sasabe J, Kita Y, et al. Development of a Femtomolar-Acting Humanin Derivative Named Colivelin by Attaching Activity-Dependent Neurotrophic Factor to Its N Terminus: Characterization of Colivelin-Mediated Neuroprotection against Alzheimer's Disease-Relevant Insults In Vitro and In Vivo. Journal of Neuroscience. 2005;25(44):10252-61. 137. Karin M, Chang L. Mammalian MAP kinase signalling cascades. Nature. 2001;410(6824):37-40. 138. Dumitru CD, Ceci JD, Tsatsanis C, Kontoyiannis D, Stamatakis K, Lin J-H, et al. TNF-\u03b1 Induction by LPS Is Regulated Posttranscriptionally via a Tpl2\/ERK-Dependent Pathway. Cell. 2000;103(7):1071-83. 139. Hehlgans T, Pfeffer K. The intriguing biology of the tumour necrosis factor\/tumour necrosis factor receptor superfamily: players, rules and the games. Immunology. 2005;115(1):1-20. 140. Kontoyiannis D, Kotlyarov A, Carballo E, Alexopoulou L, Blackshear PJ, Gaestel M, et al. Interleukin-10 targets p38 MAPK to modulate ARE-dependent TNF mRNA translation and limit intestinal pathology. The EMBO Journal. 2001;20(14):3760-70. 141. Moynagh PN. TLR signalling and activation of IRFs: revisiting old friends from the NF-kappaB pathway. Trends in immunology. 2005;26(9):469. 142. Frech M, Andjelkovic M, Ingley E, Reddy KK, Falck JR, Hemmings BA. High Affinity Binding of Inositol Phosphates and Phosphoinositides to the Pleckstrin Homology Domain of RAC\/Protein Kinase B and Their Influence on Kinase Activity. Journal of Biological Chemistry. 1997;272(13):8474-81. 143. Kuroda S, Nishio M, Sasaki T, Horie Y, Kawahara K, Sasaki M, et al. Effective clearance of intracellular Leishmania major in vivo requires Pten in macrophages. European journal of immunology. 2008;38(5):1331. 144. Hazeki K, Nigorikawa K, Hazeki O. Role of phosphoinositide 3-kinase in innate immunity. Biological & pharmaceutical bulletin. 2007;30(9):1617. 145. Koyasu S, Asano T, Ota T, Takeuchi T, Kadowaki T, Tanabe M, et al. PI3K-mediated negative feedback regulation of IL-12 production in DCs. Nature Immunology. 2002;3(9):875-81. 146. Boonstra A, Rajsbaum R, Holman M, Marques R, Asselin-Paturel C, Pereira JP, et al. Macrophages and Myeloid Dendritic Cells, but Not Plasmacytoid Dendritic Cells, Produce IL-10 in Response to MyD88- and TRIF-Dependent TLR Signals, and TLR-Independent Signals. The Journal of Immunology. 2006;177(11):7551. 147. Pils MC, Pisano F, Fasnacht N, Heinrich J-M, Groebe L, Schippers A, et al. Monocytes\/macrophages and\/or neutrophils are the target of IL-10 in the LPS endotoxemia model. European journal of immunology. 2010;40(2):443-8. 148. Zigmond E, Bernshtein B, Friedlander G, Walker Catherine R, Yona S, Kim K-W, et al. Macrophage-Restricted Interleukin-10 Receptor Deficiency, but Not IL-10 Deficiency, Causes Severe Spontaneous Colitis. Immunity. 2014;40(5):720-33. 149. Redhu NS, Bakthavatchalu V, Conaway EA, Shouval DS, Tsou A, Goettel JA, et al. Macrophage dysfunction initiates colitis during weaning of infant mice lacking the interleukin-10 receptor. eLife. 2017;6.    134 150. Llorente L, Zou W, Levy Y, Richaud-Patin Y, Wijdenes J, Alcocer-Varela J, et al. Role of interleukin 10 in the B lymphocyte hyperactivity and autoantibody production of human systemic lupus erythematosus. The Journal of experimental medicine. 1995;181(3):839-44. 151. Lazarus M, Hajeer AH, Turner D, Sinnott P, Worthington J, Ollier WE, et al. Genetic variation in the interleukin 10 gene promoter and systemic lupus erythematosus. The Journal of rheumatology. 1997;24(12):2314. 152. Moore KW, Vieira P, Fiorentino DF, Trounstine ML, Khan TA, Mosmann TR. Homology of cytokine synthesis inhibitory factor (IL-10) to the Epstein-Barr virus gene BCRFI. Science. 1990;248(4960):1230-4. 153. Galizia G, Orditura M, Romano C, Lieto E, Castellano P, Pelosio L, et al. Prognostic Significance of Circulating IL-10 and IL-6 Serum Levels in Colon Cancer Patients Undergoing Surgery. Clinical Immunology. 2002;102(2):169-78. 154. Wang HY, Yang XL. Association between serum cytokines and progression of breast cancer in Chinese population. MEDICINE. 2017;96(49):e8840. 155. Gaddam SL, Priya VH, Babu BM, Joshi L, Venkatasubramanian S, Valluri V. Association of interleukin-10 gene promoter polymorphism in allergic patients. Genet Test Mol Biomarkers. 2012;16(6):632-5. 156. Barry JC, Shakibakho S, Durrer C, Simtchouk S, Jawanda KK, Cheung ST, et al. Hyporesponsiveness to the anti-inflammatory action of interleukin-10 in type 2 diabetes. Scientific reports Journal Article. 2016;6:21244. 157. van Exel E, Gussekloo J, de Craen AJM, Fr\u00f6lich M, Bootsma-Van Der Wiel A, Westendorp RGJ, et al. Low production capacity of interleukin-10 associates with the metabolic syndrome and type 2 diabetes : the Leiden 85-Plus Study. Diabetes. 2002;51(4):1088-92. 158. Asadullah K, Sabat R, Friedrich M, Volk HD, Sterry W. Interleukin-10: an important immunoregulatory cytokine with major impact on psoriasis. Current drug targets Inflammation and allergy. 2004;3(2):185. 159. Ying B, Shi Y, Pan X, Song X, Huang Z, Niu Q, et al. Association of polymorphisms in the human IL-10 and IL-18 genes with rheumatoid arthritis. Molecular Biology Reports. 2011;38(1):379-85. 160. Lyon H, Lange C, Lake S, Silverman EK, Randolph AG, Kwiatkowski D, et al. IL10 gene polymorphisms are associated with asthma phenotypes in children. Genetic Epidemiology. 2004;26(2):155-65. 161. Kuhn R, Lohler J, Rennick D, Rajewsky K, Muller W. Interleukin-10-deficient mice develop chronic enterocolitis. Cell. 1993;75(2):263-74. 162. Spencer SD, Di Marco F, Hooley J, Pitts-Meek S, Bauer M, Ryan AM, et al. The orphan receptor CRF2-4 is an essential subunit of the interleukin 10 receptor. The Journal of experimental medicine. 1998;187(4):571-8. 163. Shouval DS, Ouahed J, Biswas A, Goettel JA, Horwitz BH, Klein C, et al. Chapter Five - Interleukin 10 Receptor Signaling: Master Regulator of Intestinal Mucosal Homeostasis in Mice and Humans. In: Alt FW, editor. Advances in Immunology. 122: Academic Press; 2014. p. 177-210. 164. K\u00fchn R, L\u00f6hler J, Rennick D, Rajewsky K, M\u00fcller W. Interleukin-10-deficient mice develop chronic enterocolitis. Cell. 1993;75(2):263-74. 165. Rennick DM, Fort MM, Davidson NJ. Studies with IL-10-\/- mice: an overview. Journal of Leukocyte Biology. 1997;61(4):389.    135 166. Glocker E-O, Frede N, Perro M, Sebire N, Elawad M, Shah N, et al. Infant colitis\u2014it's in the genes. The Lancet. 2010;376(9748):1272-. 167. Kotlarz D, Beier R, Murugan D, Diestelhorst J, Jensen O, Boztug K, et al. Loss of Interleukin-10 Signaling and Infantile Inflammatory Bowel Disease: Implications for Diagnosis and Therapy. Gastroenterology. 2012;143(2):347-55. 168. Braat H, Peppelenbosch MP, Hommes DW. Interleukin-10-based therapy for inflammatory bowel disease. Expert Opin Biol Ther. 2003;3(5):725-31. 169. Bogdan C, Vodovotz Y, Nathan C. Macrophage deactivation by interleukin 10. The Journal of experimental medicine. 1991;174(6):1549-55. 170. Dokka S, Shi X, Leonard S, Wang L, Castranova V, Rojanasakul Y. Interleukin-10-mediated inhibition of free radical generation in macrophages. AJP - Lung Cellular and Molecular Physiology. 2001;280(6):1196-L202. 171. Huang C-J, Stevens BR, Nielsen RB, Slovin PN, Fang X, Nelson DR, et al. Interleukin-10 Inhibition of Nitric Oxide Biosynthesis Involves Suppression of CAT-2 Transcription. Nitric Oxide. 2002;6(1):79-84. 172. Ding L, Linsley PS, Huang LY, Germain RN, Shevach EM. IL-10 inhibits macrophage costimulatory activity by selectively inhibiting the up-regulation of B7 expression. The Journal of Immunology. 1993;151(3):1224. 173. de Waal Malefyt R, Haanen J, Spits H, Roncarolo MG, te Velde A, Figdor C, et al. Interleukin 10 (IL-10) and viral IL-10 strongly reduce antigen-specific human T cell proliferation by diminishing the antigen-presenting capacity of monocytes via downregulation of class II major histocompatibility complex expression. Journal of experimental medicine. 1991;174(4):915-24. 174. Krakauer T. IL-10 inhibits the adhesion of leukocytic cells to IL-1-activated human endothelial cells. Immunology Letters. 1995;45(1):61-5. 175. Song S, Ling-Hu H, Roebuck KA, Rabbi MF, Donnelly RP, Finnegan A. Interleukin-10 inhibits interferon-gamma-induced intercellular adhesion molecule-1 gene transcription in human monocytes. Blood. 1997;89(12):4461. 176. Dickensheets HL, Freeman SL, Smith MF, Donnelly RP. Interleukin-10 upregulates tumor necrosis factor receptor type-II (p75) gene expression in endotoxin-stimulated human monocytes. Blood. 1997;90(10):4162-71. 177. Chen Q, Daniel V, Maher DW, Hersey P. Production of IL-10 by melanoma cells: examination of its role in immunosuppression mediated by melanoma. International journal of cancer. 1994;56(5):755. 178. Li C, Li H, Jiang K, Li J, Gai X. TLR4 signaling pathway in mouse Lewis lung cancer cells promotes the expression of TGF-\u03b21 and IL-10 and tumor cells migration. Bio-medical materials and engineering. 2014;24(1):869-75. 179. Gastl GA, Abrams JS, Nanus DM, Oosterkamp R, Silver J, Liu F, et al. Interleukin-10 production by human carcinoma cell lines and its relationship to interleukin-6 expression. International journal of cancer. 1993;55(1):96. 180. Bird-Gordon KS. Prostate Cancer Cells differentally express anti-inflmmatory and pro-inflammatory cytokines andchemokines: implications for prostate cancer immunotherapy. ETD Collection for AUC Robert W Woodruff Library. 2007;12. 181. Hao NB, Lu MH, Fan YH, Cao YL, Zhang ZR, Yang SM. Macrophages in Tumor Microenvironments and the Progression of Tumors. CLINICAL & DEVELOPMENTAL IMMUNOLOGY. 2012;2012:948098-11.    136 182. Chen Y, Song Y, Du W, Gong L, Chang H, Zou Z. Tumor-associated macrophages: an accomplice in solid tumor progression. Journal of Biomedical Science. 2019;26(1):1-13. 183. Yue FY, Dummer R, Geertsen R, Hofbauer G, Laine E, Manolio S, et al. Interleukin\u201010 is a growth factor for human melanoma cells and down\u2010regulates HLA class\u2010I, HLA class\u2010II and ICAM\u20101 molecules. International Journal of Cancer. 1997;71(4):630-7. 184. Bolpetti A, Silva JS, Villa LL, Lepique AP. Interleukin-10 production by tumor infiltrating macrophages plays a role in Human Papillomavirus 16 tumor growth. BMC immunology. 2010;11(1):27-. 185. O'Hara RJ, Greenman J, MacDonald AW, Gaskell KM, Topping KP, Duthie GS, et al. Advanced colorectal cancer is associated with impaired interleukin 12 and enhanced interleukin 10 production. Clinical Cancer Research. 1998;4(8):1943. 186. McBride JM, Jung T, de Vries JE, Aversa G. IL-10 alters DC function via modulation of cell surface molecules resulting in impaired T-cell responses. Cellular Immunology. 2002;215(2):162-72. 187. Tseng S-Y, Otsuji M, Gorski K, Huang X, Slansky JE, Pai SI, et al. B7-Dc, a New Dendritic Cell Molecule with Potent Costimulatory Properties for T Cells. The Journal of Experimental Medicine. 2001;193(7):839-46. 188. Agata Y, Kawasaki A, Nishimura H, Ishida Y, Tsubata T, Yagita H, et al. Expression of the PD-1 antigen on the surface of stimulated mouse T and B lymphocytes. International immunology. 1996;8(5):765-72. 189. Butte MJ, Keir ME, Phamduy TB, Freeman GJ, Sharpe AH. PD-L1 interacts specifically with B7-1 to inhibit T cell proliferation. Immunity. 2007;27(1):111-22. 190. Brown JA, Dorfman DM, Ma F-R, Sullivan EL, Munoz O, Wood CR, et al. Blockade of Programmed Death-1 Ligands on Dendritic Cells Enhances T Cell Activation and Cytokine Production. The Journal of Immunology. 2003;170(3):1257-66. 191. Hanahan D, Weinberg RA. The Hallmarks of Cancer. Cell. 2000;100(1):57-70. 192. W\u00fcrtz S\u00d8, Schrohl AS, S\u00f8rensen NM, Lademann U, Christensen IJ, Mouridsen H, et al. Tissue inhibitor of metalloproteinases-1 in breast cancer. Endocrine-Related Cancer. 2005;12(2):215-27. 193. Nemeth JA, Rafe A, Steiner M, Goolsby CL. TIMP-2 Growth-Stimulatory Activity: A Concentration- and Cell Type-Specific Response in the Presence of Insulin. Experimental Cell Research. 1996;224(1):110-5. 194. Jiang Y, Goldberg ID, Shi YE. Complex roles of tissue inhibitors of metalloproteinases in cancer. Oncogene. 2002;21(14):2245-52. 195. Liu X-W, Bernardo MM, Fridman R, Kim H-RC. Tissue Inhibitor of Metalloproteinase-1 Protects Human Breast Epithelial Cells Against Intrinsic Apoptotic Cell Death via the Focal Adhesion Kinase\/Phosphatidylinositol 3-Kinase and MAPK Signaling Pathway. Journal of Biological Chemistry. 2003;278(41):40364-72. 196. Ibrahim ML, Klement JD, Lu C, Redd PS, Xiao W, Yang D, et al. Myeloid-Derived Suppressor Cells Produce IL-10 to Elicit DNMT3b-Dependent IRF8 Silencing to Promote Colitis-Associated Colon Tumorigenesis. Cell Reports. 2018;25(11):3036-46.e6. 197. Chen L, Shi Y, Zhu X, Guo W, Zhang M, Che Y, et al. IL\u201110 secreted by cancer\u2011associated macrophages regulates proliferation and invasion in gastric cancer cells via c\u2011Met\/STAT3 signaling. Oncology reports. 2019;42(2):595-604.    137 198. Donnelly RP, Dickensheets H, Finbloom DS. The interleukin-10 signal transduction pathway and regulation of gene expression in mononuclear phagocytes. J Interferon Cytokine Res. 1999;19(6):563-73. 199. Gibbs VC, Pennica D. CRF2-4: isolation of cDNA clones encoding the human and mouse proteins. Gene. 1997;186(1):97-101. 200. Kotenko SV, Krause CD, Izotova LS, Pollack BP, Wu W, Pestka S. Identification and functional characterization of a second chain of the interleukin\u201010 receptor complex. The EMBO Journal. 1997;16(19):5894-903. 201. Crepaldi L, Gasperini S, Lapinet JA, Calzetti F, Pinardi C, Liu Y, et al. Up-Regulation of IL-10R1 Expression Is Required to Render Human Neutrophils Fully Responsive to IL-10. The Journal of Immunology. 2001;167(4):2312-22. 202. Alice Suk Yue H, Liu Y, Khan TA, Hsu D-H, Bazan JF, Moore KW. A Receptor for Interleukin 10 is Related to Interferon Receptors. Proceedings of the National Academy of Sciences of the United States of America. 1993;90(23):11267-71. 203. Ding Y, Qin L, Zamarin D, Kotenko SV, Pestka S, Moore KW, et al. Differential IL-10R1 Expression Plays a Critical Role in IL-10-Mediated Immune Regulation. The Journal of Immunology. 2001;167(12):6884-92. 204. Weber-Nordt RM, Meraz MA, Schreiber RD. Lipopolysaccharide-dependent induction of IL-10 receptor expression on murine fibroblasts. The Journal of Immunology. 1994;153(8):3734. 205. Kotenko SV, Krause CD, Izotova LS, Pollack BP, Wu W, Pestka S. Identification and functional characterization of a second chain of the interleukin-10 receptor complex. EMBO J. 1997;16(19):5894-903. 206. Sheppard P, Kindsvogel W, Xu W, Henderson K, Schlutsmeyer S, Whitmore TE, et al. IL-28, IL-29 and their class II cytokine receptor IL-28R. Nat Immunol. 2003;4(1):63-8. 207. Donnelly RP, Sheikh F, Kotenko SV, Dickensheets H. The expanded family of class II cytokines that share the IL-10 receptor-2 (IL-10R2) chain. J Leukoc Biol. 2004;76(2):314-21. 208. Sheikh F, Baurin VV, Lewis-Antes A, Shah NK, Smirnov SV, Anantha S, et al. Cutting edge: IL-26 signals through a novel receptor complex composed of IL-20 receptor 1 and IL-10 receptor 2. J Immunol. 2004;172(4):2006-10. 209. Finbloom DS, Winestock KD. IL-10 induces the tyrosine phosphorylation of tyk2 and Jak1 and the differential assembly of STAT1 alpha and STAT3 complexes in human T cells and monocytes. The Journal of Immunology. 1995;155(3):1079. 210. Weber-Nordt RM, Riley JK, Greenlund AC, Moore KW, Darnell JE, Schreiber RD. Stat3 Recruitment by Two Distinct Ligand-induced, Tyrosine-phosphorylated Docking Sites in the Interleukin-10 Receptor Intracellular Domain. Journal of Biological Chemistry. 1996;271(44):27954-61. 211. Riley JK, Takeda K, Akira S, Schreiber RD. Interleukin-10 receptor signaling through the JAK-STAT pathway. Requirement for two distinct receptor-derived signals for anti-inflammatory action. The Journal of biological chemistry. 1999;274(23):16513-21. 212. O'Farrell AM, Liu Y, Moore KW, Mui ALF. IL\u201010 inhibits macrophage activation and proliferation by distinct signaling mechanisms: evidence for Stat3\u2010dependent and \u2010independent pathways. The EMBO Journal. 1998;17(4):1006-18. 213. Pattison MJ, Mackenzie KF, Arthur JSC. Inhibition of JAKs in macrophages increases lipopolysaccharide-induced cytokine production by blocking IL-10-mediated feedback. Journal of immunology (Baltimore, Md : 1950)  2012;189(6):2784. 214. Darnell JE. STATs and Gene Regulation. Science. 1997;277(5332):1630-5.    138 215. Decker T, Kovarik P, Meinke A. GAS elements: a few nucleotides with a major impact on cytokine-induced gene expression. J Interferon Cytokine Res. 1997;17(3):121-34. 216. Decker T, Kovarik P. Serine phosphorylation of STATs. Oncogene. 2000;19(21):2628-37. 217. Park S-Y, Baik YH, Cho JH, Kim S, Lee K-S, Han J-S. Inhibition of lipopolysaccharide-induced nitric oxide synthesis by nicotine through S6K1-p42\/44 MAPK pathway and STAT3 (Ser 727) phosphorylation in Raw 264.7 cells. Cytokine. 2008;44(1):126-34. 218. Zhu YP, Brown JR, Sag D, Zhang L, Suttles J. AMP-activated protein kinase regulates IL-10-mediated antiinflammatory signaling pathways in macrophages(). Journal of immunology (Baltimore, Md : 1950). 2015;194(2):584-94. 219. Wehinger J, Gouilleux F, Groner B, Finke J, Mertelsmann R, Maria Weber-Nordt R. IL-10 induces DNA binding activity of three STAT proteins (Stat1, Stat3, and Stat5) and their distinct combinatorial assembly in the promoters of selected genes. FEBS Letters. 1996;394(3):365-70. 220. Liu Y, Moore KW, Mui ALF, O'Farrell A-M. IL-10 inhibits macrophage activation and proliferation by distinct signaling mechanisms: evidence for Stat3-dependent and -independent pathways. The EMBO Journal. 1998;17(4):1006-18. 221. Meraz MA, White JM, Sheehan KCF, Bach EA, Rodig SJ, Dighe AS, et al. Targeted Disruption of the Stat1 Gene in Mice Reveals Unexpected Physiologic Specificity in the JAK\u2013STAT Signaling Pathway. Cell. 1996;84(3):431-42. 222. Wang P, Wu P, Siegel MI, Egan RW, Billah MM. IL-10 inhibits transcription of cytokine genes in human peripheral blood mononuclear cells. J Immunol. 1994;153(2):811-6. 223. Levitz SM, Tabuni A, Nong SH, Golenbock DT. Effects of interleukin-10 on human peripheral blood mononuclear cell responses to Cryptococcus neoformans, Candida albicans, and lipopolysaccharide. Infect Immun. 1996;64(3):945-51. 224. Bogdan C, Paik J, Vodovotz Y, Nathan C. Contrasting mechanisms for suppression of macrophage cytokine release by transforming growth factor-beta and interleukin-10. J Biol Chem. 1992;267(32):23301-8. 225. Denys A, Udalova IA, Smith C, Williams LM, Ciesielski CJ, Campbell J, et al. Evidence for a dual mechanism for IL-10 suppression of TNF-alpha production that does not involve inhibition of p38 mitogen-activated protein kinase or NF-kappa B in primary human macrophages. J Immunol. 2002;168(10):4837-45. 226. Kishore R, Tebo JM, Kolosov M, Hamilton TA. Cutting edge: clustered AU-rich elements are the target of IL-10-mediated mRNA destabilization in mouse macrophages. J Immunol. 1999;162(5):2457-61. 227. Clarke CJ, Hales A, Hunt A, Foxwell BM. IL-10-mediated suppression of TNF-alpha production is independent of its ability to inhibit NF kappa B activity. European journal of immunology. 1998;28(5):1719-26. 228. Briata P, Chen CY, Giovarelli M, Pasero M, Trabucchi M, Ramos A, et al. KSRP, many functions for a single protein. Front Biosci. 2011;16:1787-96. 229. Hitti E, Iakovleva T, Brook M, Deppenmeier S, Gruber AD, Radzioch D, et al. Mitogen-activated protein kinase-activated protein kinase 2 regulates tumor necrosis factor mRNA stability and translation mainly by altering tristetraprolin expression, stability, and binding to adenine\/uridine-rich element. Mol Cell Biol. 2006;26(6):2399-407.    139 230. Di Marco S, Hel Z, Lachance C, Furneaux H, Radzioch D. Polymorphism in the 3'-untranslated region of TNFalpha mRNA impairs binding of the post-transcriptional regulatory protein HuR to TNFalpha mRNA. Nucleic Acids Res. 2001;29(4):863-71. 231. Dean JL, Wait R, Mahtani KR, Sully G, Clark AR, Saklatvala J. The 3' untranslated region of tumor necrosis factor alpha mRNA is a target of the mRNA-stabilizing factor HuR. Mol Cell Biol. 2001;21(3):721-30. 232. Piecyk M, Wax S, Beck AR, Kedersha N, Gupta M, Maritim B, et al. TIA-1 is a translational silencer that selectively regulates the expression of TNF-alpha. EMBO J. 2000;19(15):4154-63. 233. Buxade M, Parra JL, Rousseau S, Shpiro N, Marquez R, Morrice N, et al. The Mnks are novel components in the control of TNF alpha biosynthesis and phosphorylate and regulate hnRNP A1. Immunity. 2005;23(2):177-89. 234. Takeda K, Clausen BE, Kaisho T, Tsujimura T, Terada N, Forster I, et al. Enhanced Th1 activity and development of chronic enterocolitis in mice devoid of Stat3 in macrophages and neutrophils. Immunity. 1999;10(1):39-49. 235. Berg DJ, Kuhn R, Rajewsky K, Muller W, Menon S, Davidson N, et al. Interlukin-10 is a central regulator of the response to LPS in murine models of endotoxic-shock and the  shwartzman reaction but not endotoxin tolerance. Journal of Clinincal Investigation. 1995;96(5):2339-47. 236. Hutchins AP, Poulain S, Miranda-Saavedra D. Genome-wide analysis of STAT3 binding in vivo predicts effectors of the anti-inflammatory response in macrophages. Blood 2012;119(13):e110. 237. Kuwata H, Watanabe Y, Miyoshi H, Yamamoto M, Kaisho T, Takeda K, et al. IL-10-inducible Bcl-3 negatively regulates LPS-induced TNF-alpha production in macrophages. Blood. 2003;102(12):4123. 238. El Kasmi KC, Smith AM, Williams L, Neale G, Panopolous A, Watowich SS, et al. Cutting Edge: A Transcriptional Repressor and Corepressor Induced by the STAT3-Regulated Anti-Inflammatory Signaling Pathway. The Journal of Immunology. 2007;179(11):7215. 239. Schaljo B, Kratochvill F, Gratz N, Sadzak I, Sauer I, Hammer M, et al. Tristetraprolin Is Required for Full Anti-Inflammatory Response of Murine Macrophages to IL-10. The Journal of Immunology. 2009;183(2):1197. 240. Williams L, Bradley L, Smith A, Foxwell B. Signal Transducer and Activator of Transcription 3 Is the Dominant Mediator of the Anti-Inflammatory Effects of IL-10 in Human Macrophages. The Journal of Immunology. 2004;172(1):567. 241. Smith AM, Qualls JE, O'Brien K, Balouzian L, Johnson PF, Schultz-Cherry S, et al. A Distal Enhancer in Il12b Is the Target of Transcriptional Repression by the STAT3 Pathway and Requires the Basic Leucine Zipper (B-ZIP) Protein NFIL3. The Journal of biological chemistry. 2011;286(26):23582-90. 242. Cheung ST, So EY, Chang D, Ming-Lum A, Mui AL. Interleukin-10 inhibits lipopolysaccharide induced miR-155 precursor stability and maturation. PLoS One. 2013;8(8):e71336. 243. Rauh MJ, Sly LM, Kalesnikoff J, Hughes MR, Cao LP, Lam V, et al. The role of SHIP1 in macrophage programming and activation. BIOCHEMICAL SOCIETY TRANSACTIONS. 2004;32(5):785-8.    140 244. Huber M, Helgason CD, Damen JE, Liu L, Humphries RK, Krystal G. The src homology 2-containing inositol phosphatase (SHIP) is the gatekeeper of mast cell degranulation. Proc Natl Acad Sci U S A. 1998;95(19):11330-5. 245. Krystal G. Lipid phosphatases in the immune system. Semin Immunol. 2000;12(4):397-403. 246. Pauls SD, Marshall AJ. Regulation of immune cell signaling by SHIP1: A phosphatase, scaffold protein, and potential therapeutic target. Eur J Immunol. 2017;47(6):932-45. 247. Ong CJ, Ming-Lum A, Nodwell M, Ghanipour A, Yang L, Williams DE, et al. Small-molecule agonists of SHIP1 inhibit the phosphoinositide 3-kinase pathway in hematopoietic cells. Blood. 2007;110(6):1942-9. 248. Dien J, Amin HM, Chiu N, Chiu B, Wong W, Frantz C, et al. Signal Transducers and Activators of Transcription-3 Up-Regulates Tissue Inhibitor of Metalloproteinase-1 Expression and Decreases Invasiveness of Breast Cancer. The American Journal of Pathology. 2006;169(2):633-42. 249. McNeal JE. The zonal anatomy of the prostate. The Prostate. 1981;2(1):35. 250. Roehrborn CG. Pathology of benign prostatic hyperplasia. International Journal of Impotence Research. 2008;20(S3):S11-S8. 251. Armbruster DA. Prostate-specific antigen: biochemistry, analytical methods, and clinical application. Clinical Chemistry. 1993;39(2):181. 252. Huggins C, Hodges CV. Studies on prostatic cancer: I. The effect of castration, of estrogen and of androgen injection on serum phosphatases in metastatic carcinoma of the prostate. Journal of Urology. 2002;167(2 Part 2):948-51. 253. Froehner M, Hakenberg OW, Koch R, Schmidt U, Meye A, Wirth MP. Comparison of the Clinical Value of Complexed PSA and Total PSA in the Discrimination between Benign Prostatic Hyperplasia and Prostate Cancer. Urologia Internationalis. 2006;76(1):27-30. 254. Jung K, Elgeti U, Lein M, Brux B, Sinha P, Rudolph B, et al. Ratio of Free or Complexed Prostate-specific Antigen (PSA) to Total PSA: Which Ratio Improves Differentiation between Benign Prostatic Hyperplasia and Prostate Cancer? Clinical Chemistry. 2000;46(1):55. 255. Hayward SW, Cunha GR. THE PROSTATE: DEVELOPMENT AND PHYSIOLOGY. Radiologic Clinics of North America. 2000;38(1):1-14. 256. Marker PC, Donjacour AA, Dahiya R, Cunha GR. Hormonal, cellular, and molecular control of prostatic development. United States: Elsevier Inc; 2003. p. 165-74. 257. Slater M, Barden JA, Murphy CR. Changes in Growth Factor Expression in the Ageing Prostate may Disrupt Epithelial\u2013Stromal Homeostasis. The Histochemical Journal. 2000;32(6):357-64. 258. van der Heul\u2010Nieuwenhuijsen L, Dits N, Van Ijcken W, de Lange D, Jenster G. The FOXF2 pathway in the human prostate stroma. The Prostate. 2009;69(14):1538-47. 259. Wang Y, Hayward SW, Cao M, Thayer KA, Cunha GR. Cell differentiation lineage in the prostate. Differentiation. 2001;68(4):270-9. 260. Aum\u00fcller G, Leonhardt M, Renneberg H, von Rahden B, Bjartell A, Abrahamsson PA. Semiquantitative morphology of human prostatic development and regional distribution of prostatic neuroendocrine cells. The Prostate. 2001;46(2):108-15. 261. Word RA, George FW, Wilson JD, Carr BR. TESTOSTERONE SYNTHESIS AND ADENYLATE-CYCLASE ACTIVITY IN THE EARLY HUMAN-FETAL TESTIS APPEAR TO BE INDEPENDENT OF HUMAN CHORIONIC-GONADOTROPIN CONTROL. JOURNAL OF CLINICAL ENDOCRINOLOGY & METABOLISM. 1989;69(1):204-8.    141 262. Luu-The V. Assessment of steroidogenesis and steroidogenic enzyme functions. Journal of Steroid Biochemistry and Molecular Biology. 2013;137:176-82. 263. Hannema SE, Hughes IA. Regulation of wolffian duct development. HORMONE RESEARCH. 2007;67(3):142-51. 264. Auyeung B, Baron-Cohen S, Ashwin E, Knickmeyer R, Taylor K, Hackett G, et al. Fetal Testosterone Predicts Sexually Differentiated Childhood Behavior in Girls and in Boys. Psychological Science. 2009;20(2):144-8. 265. Hall PF, Eik-nes KB. The influence of gonadotropins in vivo upon the biosynthesis of androgens by homogenate of rat testis. BBA - Biochimica et Biophysica Acta. 1963;71:438-47. 266. Migrenne S, Pairault C, Racine C, Livera G, G\u00e9loso A, Habert R. Luteinizing hormone-dependent activity and luteinizing hormone-independent differentiation of rat fetal Leydig cells. Molecular and Cellular Endocrinology. 2001;172(1):193-202. 267. Rosner W, Hryb DJ, Saeed Khan M, Nakhla AM, Romas NA. Sex hormone-binding globulin: Anatomy and physiology of a new regulatory system. Journal of Steroid Biochemistry and Molecular Biology. 1991;40(4):813-20. 268. Baker ME. Albumin, steroid hormones and the origin of vertebrates. Journal of Endocrinology. 2002;175(1):121-7. 269. O'Hara L, McInnes K, Simitsidellis I, Morgan S, Atanassova N, Slowikowska-Hilczer J, et al. Autocrine androgen action is essential for Leydig cell maturation and function, and protects against late-onset Leydig cell apoptosis in both mice and men. FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 2015;29(3):894-910. 270. Weinberger C, Oro A, Evans RM, Hollenberg SM, Cerelli G, Rosenfeld MG, et al. Primary structure and expression of a functional human glucocorticoid receptor cDNA. Nature. 1985;318(6047):635-41. 271. Buttram VC, O'Malley BW, Smith RG, Iramain CA. Purification of human uterine progesterone receptor. Nature. 1975;253(5489):271-2. 272. Greene GL, Gilna P, Waterfield M, Baker A, Hort Y, Shine J. Sequence and Expression of Human Estrogen Receptor Complementary DNA. Science. 1986;231(4742):1150-4. 273. Huggins C, Stevens RE, Hodges CV. STUDIES ON PROSTATIC CANCER: II. THE EFFECTS OF CASTRATION ON ADVANCED CARCINOMA OF THE PROSTATE GLAND. Archives of Surgery. 1941;43(2):209-23. 274. Gao WQ, Bohl CE, Dalton JT. Chemistry and structural biology of androgen receptor. CHEMICAL REVIEWS. 2005;105(9):3352-70. 275. Sasaki M, Kaneuchi M, Sakuragi N, Fujimoto S, Carroll PR, Dahiya R. The polyglycine and polyglutamine repeats in the androgen receptor gene in Japanese and Caucasian populations. Biochemical and Biophysical Research Communications. 2003;312(4):1244-7. 276. Hsing AW, Gao YT, Wu G, Wang X, Deng J, Chen YL, et al. Polymorphic CAG and GGN repeat lengths in the androgen receptor gene and prostate cancer risk: a population-based case-control study in China. Cancer research. 2000;60(18):5111. 277. Davies P, Watt K, Kelly SM, Clark C, Price NC, McEwan IJ. Consequences of poly-glutamine repeat length for the conformation and folding of the androgen receptor amino-terminal domain. Journal of Molecular Endocrinology. 2008;41(5):301-14. 278. Werner R, Holterhus P-M, Binder G, Schwarz H-P, Morlot M, Struve D, et al. The A645D Mutation in the Hinge Region of the Human Androgen Receptor (AR) Gene Modulates    142 AR Activity, Depending on the Context of the Polymorphic Glutamine and Glycine Repeats. The Journal of Clinical Endocrinology & Metabolism. 2006;91(9):3515-20. 279. Beilin J, Ball EM, Favaloro JM, Zajac JD. Effect of the androgen receptor CAG repeat polymorphism on transcriptional activity: specificity in prostate and non-prostate cell lines. Journal of Molecular Endocrinology. 2000;25(1):85-96. 280. Callewaert L, Christiaens V, Haelens A, Verrijdt G, Verhoeven G, Claessens F. Implications of a polyglutamine tract in the function of the human androgen receptor. Biochemical and Biophysical Research Communications. 2003;306(1):46-52. 281. Callewaert L, Van Tilborgh N, Claessens F. Interplay between two hormone-independent activation domains in the androgen receptor. Cancer research. 2006;66(1):543-53. 282. Doesburg P, Kuil CW, Berrevoets CA, Steketee K, Faber PW, Mulder E, et al. Functional in Vivo Interaction between the Amino-Terminal, Transactivation Domain and the Ligand Binding Domain of the Androgen Receptor. Biochemistry. 1997;36(5):1052-64. 283. He B, Kemppainen JA, Wilson EM. FXXLF and WXXLF Sequences Mediate the NH2-terminal Interaction with the Ligand Binding Domain of the Androgen Receptor. Journal of Biological Chemistry. 2000;275(30):22986-94. 284. Wilson EM. Analysis of interdomain interactions of the androgen receptor. Methods in molecular biology (Clifton, NJ). 2011;776:113-29. 285. Langley E, Kemppainen JA, Wilson EM. Intermolecular NH2-\/Carboxyl-terminal Interactions in Androgen Receptor Dimerization Revealed by Mutations That Cause Androgen Insensitivity. Journal of Biological Chemistry. 1998;273(1):92-101. 286. Zhou ZX, Lane MV, Kemppainen JA, French FS, Wilson EM. Specificity of ligand-dependent androgen receptor stabilization: receptor domain interactions influence ligand dissociation and receptor stability. Molecular endocrinology (Baltimore, Md). 1995;9(2):208. 287. YONG MHETJLHEXKME-l. Androgen receptor\uff1a structure, role in prostate cancer and drug discovery. \u4e2d\u56fd\u836f\u7406\u5b66\u62a5\uff1a\u82f1\u6587\u7248. 2015;36(1):3-23. 288. Schoenmakers E, Verrijdt G, Peeters B, Verhoeven G, Rombauts W, Claessens F. Differences in DNA Binding Characteristics of the Androgen and Glucocorticoid Receptors Can Determine Hormone-specific Responses. Journal of Biological Chemistry. 2000;275(16):12290-7. 289. Schoenmakers E, Alen P, Verrijdt G, Peeters B, Verhoeven G, Rombauts W, et al. Differential DNA binding by the androgen and glucocorticoid receptors involves the second Zn-finger and a C-terminal extension of the DNA-binding domains. Biochemical Journal. 1999;341(3):515. 290. Heinlein CA, Chang C. Androgen Receptor (AR) Coregulators: An Overview. Endocrine Reviews. 2002;23(2):175-200. 291. Slagsvold T, Kraus I, Bentzen T, Palvimo J, Saatcioglu F. Mutational Analysis of the Androgen Receptor AF-2 (Activation Function 2) Core Domain Reveals Functional and Mechanistic Differences of Conserved Residues Compared with Other Nuclear Receptors. Molecular Endocrinology. 2000;14(10):1603-17. 292. Clinckemalie L, Vanderschueren D, Boonen S, Claessens F. The hinge region in androgen receptor control. Molecular and Cellular Endocrinology. 2012;358(1):1-8. 293. Haelens A, Tanner T, Denayer S, Callewaert L, Claessens F. The hinge region regulates DNA binding, nuclear translocation, and transactivation of the androgen receptor. Cancer research. 2007;67(9):4514-23.    143 294. Jenster G, Trapman J, Brinkmann AO. Nuclear import of the human androgen receptor. The Biochemical journal. 1993;293 ( Pt 3)(Pt 3):761-8. 295. Zhou ZX, Sar M, Simental JA, Lane MV, Wilson EM. A ligand-dependent bipartite nuclear targeting signal in the human androgen receptor. Requirement for the DNA-binding domain and modulation by NH2-terminal and carboxyl-terminal sequences. Journal of Biological Chemistry. 1994;269(18):13115. 296. Hiipakka RA, Liao S. Molecular Mechanism of Androgen Action. Trends in Endocrinology & Metabolism. 1998;9(8):317-24. 297. Shibata H, Spencer TE, O\u00f1ate SA, Jenster G, Tsai SY, Tsai MJ, et al. Role of co-activators and co-repressors in the mechanism of steroid\/thyroid receptor action. Recent progress in hormone research. 1997;52:141. 298. B\u00f6hm M, Locke WJ, Sutherland RL, Kench JG, Henshall SM. A role for GATA-2 in transition to an aggressive phenotype in prostate cancer through modulation of key androgen-regulated genes. Oncogene. 2009;28(43):3847-56. 299. Wang HT, Yao YH, Li BG, Tang Y, Chang JW, Zhang J. Neuroendocrine Prostate Cancer (NEPC) progressing from conventional prostatic adenocarcinoma: factors associated with time to development of NEPC and survival from NEPC diagnosis-a systematic review and pooled analysis. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2014;32(30):3383-90. 300. Wang Q, Li W, Liu XS, Carroll JS, J\u00e4nne OA, Keeton EK, et al. A Hierarchical Network of Transcription Factors Governs Androgen Receptor-Dependent Prostate Cancer Growth. Molecular Cell. 2007;27(3):380-92. 301. Hua Y, Azeem W, Shen Y, Zhang S, Olsen JR, \u00d8yan AM, et al. Dual androgen receptor (AR) and STAT3 inhibition by a compound targeting the AR amino\u2010terminal domain. Pharmacology Research & Perspectives. 2018;6(6):e00437-n\/a. 302. Giovannucci E, Liu Y, Platz EA, Stampfer MJ, Willett WC. Risk factors for prostate cancer incidence and progression in the health professionals follow\u2010up study. International Journal of Cancer. 2007;121(7):1571-8. 303. Leitzmann M, Rohrmann S. Risk factors for the onset of prostatic cancer: age, location, and behavioral correlates. Clinical Epidemiology. 2012;4:1. 304. Mottet N, Bellmunt J, Bolla M, Briers E, Cumberbatch MG, De Santis M, et al. EAU-ESTRO-SIOG Guidelines on Prostate Cancer. Part 1: Screening, Diagnosis, and Local Treatment with Curative Intent. European Urology. 2016;71(4):618-29. 305. De Marzo AM, Nelson WG, Gr\u00f6nberg H, Nakai Y, Isaacs WB, Xu J, et al. Inflammation in prostate carcinogenesis. Nature Reviews Cancer. 2007;7(4):256-69. 306. Cano P, Godoy A, Escamilla R, Dhir R, Onate SA. Stromal-epithelial cell interactions and androgen receptor-coregulator recruitment is altered in the tissue microenvironment of prostate cancer. Cancer research. 2007;67(2):511-9. 307. Kumar B, Koul S, Khandrika L, Meacham RB, Koul HK. Oxidative stress is inherent in prostate cancer cells and is required for aggressive phenotype. Cancer research. 2008;68(6):1777-85. 308. Kheirandish P, Chinegwundoh F. Ethnic differences in prostate cancer. British Journal of Cancer. 2011;105(4):481-5. 309. Bratt O, Drevin L, Akre O, Garmo H, Stattin P, Medicinska f, et al. Family History and Probability of Prostate Cancer, Differentiated by Risk Category: A Nationwide Population-Based Study. Journal of the National Cancer Institute. 2016;108(10):djw110.    144 310. Li Y, Donmez N, Sahinalp C, Xie N, Wang Y, Xue H, et al. SRRM4 Drives Neuroendocrine Transdifferentiation of Prostate Adenocarcinoma Under Androgen Receptor Pathway Inhibition. European Urology. 2016;71(1):68-78. 311. McMichael AJ. Food, nutrition, physical activity and cancer prevention. Authoritative report from World Cancer Research Fund provides global update. Public Health Nutrition. 2008;11(7):762-3. 312. Eeles R, Goh C, Castro E, Bancroft E, Guy M, Al Olama AA, et al. The genetic epidemiology of prostate cancer and its clinical implications. Nature reviews Urology. 2014;11(1):18-31. 313. Ou T, Lilly M, Jiang W. The Pathologic Role of Toll-Like Receptor 4 in Prostate Cancer. Frontiers in immunology. 2018;9:1188. 314. Sutcliffe S, Pontari M. Inflammation and Infection in the Etiology of Prostate Cancer. 2016. p. 13-20. 315. Gurel B, Lucia MS, Thompson IM, Goodman PJ, Tangen CM, Kristal AR, et al. Chronic Inflammation in Benign Prostate Tissue Is Associated with High-Grade Prostate Cancer in the Placebo Arm of the Prostate Cancer Prevention Trial. Cancer epidemiology, biomarkers & prevention. 2014;23(5):847-56. 316. Yuri P, Shigemura K, Kitagawa K, Hadibrata E, Risan M, Zulfiqqar A, et al. Increased tumor-associated macrophages in the prostate cancer microenvironment predicted patients\u2019 survival and responses to androgen deprivation therapies in Indonesian patients cohort. Prostate International. 2020;8(2):62-9. 317. Stamey TA, Yang N, Hay AR, McNeal JE, Freiha FS, Redwine E. Prostate-specific antigen as a serum marker for adenocarcinoma of the prostate. The New England journal of medicine. 1987;317(15):909. 318. Carter HB, Albertsen PC, Barry MJ, Etzioni R, Freedland SJ, Greene KL, et al. Early Detection of Prostate Cancer: AUA Guideline. Journal of Urology, The. 2013;190(2):419-26. 319. Cooperberg MR, Broering JM, Carroll PR. Time Trends and Local Variation in Primary Treatment of Localized Prostate Cancer. Journal of Clinical Oncology. 2010;28(7):1117-23. 320. Epstein JI, Zelefsky MJ, Sjoberg DD, Nelson JB, Egevad L, Magi-Galluzzi C, et al. A Contemporary Prostate Cancer Grading System: A Validated Alternative to the Gleason Score. European Urology. 2015;69(3):428-35. 321. Epstein JI, Egevad L, Amin MB, Delahunt B, Srigley JR, Humphrey PA, et al. The 2014 International Society of Urological Pathology (ISUP) Consensus Conference on Gleason Grading of Prostatic Carcinoma: Definition of Grading Patterns and Proposal for a New Grading System. The American Journal of Surgical Pathology. 2016;40(2):244-52. 322. Schr\u00f6der FH, Hermanek P, Denis L, Fair WR, Gospodarowicz MK, Pavone-Macaluso M. The TNM classification of prostate cancer. The Prostate Supplement. 1992;4:129. 323. Nguyen HG, Welty CJ, Cooperberg MR. Diagnostic associations of gene expression signatures in prostate cancer tissue. Current Opinion in Urology. 2015;25(1):65-70. 324. Neves AF, Ara\u00fajo TG, Biase WKFS, Meola J, Alc\u00e2ntara TM, Freitas DG, et al. Combined analysis of multiple mRNA markers by RT-PCR assay for prostate cancer diagnosis. Clinical Biochemistry. 2008;41(14-15):1191-8. 325. Knezevic D, Goddard AD, Natraj N, Cherbavaz DB, Clark-Langone KM, Snable J, et al. Analytical validation of the Oncotype DX prostate cancer assay - a clinical RT-PCR assay optimized for prostate needle biopsies. BMC genomics. 2013;14(1):690.    145 326. Ramos CGMD, Valdevenito RMD, Vergara I, Anabalon PMS, Sanchez CPD, Fulla JMDMS. PCA3 sensitivity and specificity for prostate cancer detection in patients with abnormal PSA and\/or suspicious digital rectal examination. First Latin American experience. Urologic Oncology: Seminars and Original Investigations. 2013;31(8):1522-6. 327. Maximum androgen blockade in advanced prostate cancer: an overview of the randomised trials. Prostate Cancer Trialists' Collaborative Group. Lancet (London, England). 2000;355(9214):1491. 328. Perlmutter MA, Lepor H. Androgen deprivation therapy in the treatment of advanced prostate cancer. Reviews in urology. 2007;9 Suppl 1(Suppl 1):S3-S8. 329. Eisenberger MA, Blumenstein BA, Crawford ED, Miller G, McLeod DG, Loehrer PJ, et al. Bilateral Orchiectomy with or without Flutamide for Metastatic Prostate Cancer. The New England Journal of Medicine. 1998;339(15):1036-42. 330. Peeling WB. Phase III studies to compare goserelin (zoladex) with orchiectomy and with diethylstilbestrol in treatment of prostatic carcinoma. Urology. 1989;33(5):45-52. 331. Labrie F, Dupont A, Cusan L, Gomez J, Emond J, Monfette G. Combination therapy with flutamide and medical (LHRH agonist) or surgical castration in advanced prostate cancer: 7-year clinical experience. Journal of Steroid Biochemistry and Molecular Biology. 1990;37(6):943-50. 332. Keyes M, Crook J, Morton G, Vigneault E, Usmani N, Morris WJ. Treatment options for localized prostate cancer. Canadian Family Physician. 2013;59(12):1269-74. 333. Conn PM, Rogers DC, Seay SG. Biphasic regulation of the gonadotropin-releasing hormone receptor by receptor microaggregation and intracellular Ca2+ levels. Molecular Pharmacology. 1984;25(1):51. 334. Waxman J, Man A, Hendry WF, Whitfield HN, Besser GM, Tiptaft RC, et al. Importance of early tumour exacerbation in patients treated with long acting analogues of gonadotrophin releasing hormone for advanced prostatic cancer. British Medical Journal (Clinical research ed). 1985;291(6506):1387-8. 335. Schulze H, Senge T. Influence of different types of antiandrogens on luteinizing hormone-releasing hormone analogue-induced testosterone surge in patients with metastatic carcinoma of the prostate. The Journal of urology. 1990;144(4):934. 336. Chen CD, Welsbie DS, Baek SH, Chen R, Rosenfeld MG, Vessella R, et al. Molecular determinants of resistance to antiandrogen therapy. Nature Medicine. 2004;10(1):33-9. 337. D'Amico AV, Whittington R, Malkowicz SB, Schultz D, Blank K, Broderick GA, et al. Biochemical Outcome After Radical Prostatectomy, External Beam Radiation Therapy, or Interstitial Radiation Therapy for Clinically Localized Prostate Cancer. JAMA. 1998;280(11):969-74. 338. Sharifi N, Gulley JL, Dahut WL. Androgen Deprivation Therapy for Prostate Cancer. JAMA. 2005;294(2):238-44. 339. Cookson MS, Roth BJ, Dahm P, Engstrom C, Freedland SJ, Hussain M, et al. Castration-Resistant Prostate Cancer: AUA Guideline. Journal of Urology, The. 2013;190(2):429-38. 340. Eisenberger MA, Walsh PC. Early Androgen Deprivation for Prostate Cancer? The New England Journal of Medicine. 1999;341(24):1837-8. 341. Nelson PS, Montgomery B, Harris WP, Mostaghel EA. Androgen deprivation therapy: progress in understanding mechanisms of resistance and optimizing androgen depletion. Nature Clinical Practice Urology. 2009;6(2):76-85.    146 342. Karantanos T, Corn PG, Thompson TC. Prostate cancer progression after androgen deprivation therapy: mechanisms of castrate resistance and novel therapeutic approaches. Oncogene. 2013;32(49):5501-11. 343. Tran C, Ouk S, Clegg NJ, Chen Y, Watson PA, Arora V, et al. Development of a Second-Generation Antiandrogen for Treatment of Advanced Prostate Cancer. Science. 2009;324(5928):787-90. 344. Guo Z, Yang X, Sun F, Jiang R, Linn DE, Chen H, et al. A novel androgen receptor splice variant is up-regulated during prostate cancer progression and promotes androgen depletion-resistant growth. Cancer research. 2009;69(6):2305-13. 345. Hu R, Dunn TA, Wei S, Isharwal S, Veltri RW, Humphreys E, et al. Ligand-independent androgen receptor variants derived from splicing of cryptic exons signify hormone-refractory prostate cancer. Cancer research. 2009;69(1):16-22. 346. Sun S, Sprenger CCT, Vessella RL, Haugk K, Soriano K, Mostaghel EA, et al. Castration resistance in human prostate cancer is conferred by a frequently occurring androgen receptor splice variant. The Journal of clinical investigation. 2010;120(8):2715-30. 347. Watson PA, Arora VK, Sawyers CL. Emerging mechanisms of resistance to androgen receptor inhibitors in prostate cancer. Nature reviews Cancer. 2015;15(12):701-11. 348. Arora Vivek K, Schenkein E, Murali R, Subudhi Sumit K, Wongvipat J, Balbas Minna D, et al. Glucocorticoid Receptor Confers Resistance to Antiandrogens by Bypassing Androgen Receptor Blockade. Cell. 2013;155(6):1309-22. 349. Li H, Xie N, Chen R, Verreault M, Fazli L, Gleave ME, et al. UGT2B17 Expedites Progression of Castration-Resistant Prostate Cancers by Promoting Ligand-Independent AR Signaling. Cancer research. 2016;76(22):6701-11. 350. Kallioniemi O-P, Visakorpi T, Tanner M, Kein\u00e4nen R, Isola J, Hyytinen E, et al. In vivo amplification of the androgen receptor gene and progression of human prostate cancer. Nature Genetics. 1995;9(4):401-6. 351. Marcelli M, Ittmann M, Mariani S, Sutherland R, Nigam R, Murthy L, et al. Androgen receptor mutations in prostate cancer. Cancer research. 2000;60(4):944. 352. Linja MJ, Savinainen KJ, Saram\u00e4ki OR, Tammela TL, Vessella RL, Visakorpi T. Amplification and overexpression of androgen receptor gene in hormone-refractory prostate cancer. Cancer research. 2001;61(9):3550. 353. Joseph JD, Lu N, Qian J, Sensintaffar J, Shao G, Brigham D, et al. A clinically relevant androgen receptor mutation confers resistance to second-generation antiandrogens enzalutamide and ARN-509. Cancer discovery. 2013;3(9):1020-9. 354. Korpal M, Korn JM, Gao X, Rakiec DP, Ruddy DA, Doshi S, et al. An F876L mutation in androgen receptor confers genetic and phenotypic resistance to MDV3100 (enzalutamide). Cancer discovery. 2013;3(9):1030-43. 355. Labrie F, B\u00e9langer A, Luu-The V, Labrie C, Simard J, Cusan L, et al. Gonadotropin-Releasing Hormone Agonists in the Treatment of Prostate Cancer. Endocrine Reviews. 2005;26(3):361-79. 356. Locke JA, Guns ES, Lubik AA, Adomat HH, Hendy SC, Wood CA, et al. Androgen levels increase by intratumoral de novo steroidogenesis during progression of castration-resistant prostate cancer. Cancer research. 2008;68(15):6407-15. 357. Montgomery RB, Mostaghel EA, Vessella R, Hess DL, Kalhorn TF, Higano CS, et al. Maintenance of intratumoral androgens in metastatic prostate cancer: a mechanism for castration-resistant tumor growth. Cancer research. 2008;68(11):4447-54.    147 358. Hirano D, Okada Y, Minei S, Takimoto Y, Nemoto N. Neuroendocrine Differentiation in Hormone Refractory Prostate Cancer Following Androgen Deprivation Therapy. European Urology. 2004;45(5):586-92. 359. Aparicio A, Logothetis CJ, Maity SN. Understanding the lethal variant of prostate cancer: power of examining extremes. Cancer discovery. 2011;1(6):466-8. 360. Bluemn EG, Coleman RT, Coleman IM, Lucas JM, Hernandez-Lopez S, Tharakan R, et al. Androgen Receptor Pathway-Independent Prostate Cancer Is Sustained through FGF Signaling. Cancer Cell. 2017;32(4):474-89.e6. 361. Wenk RE, Bhagavan BS, Levy R, Miller D, Weisburger W. Ectopic ACTH, prostatic oat cell carcinoma, and marked hypernatremia. Cancer. 1977;40(2):773. 362. Nadal R, Schweizer M, Kryvenko ON, Epstein JI, Eisenberger MA. Small cell carcinoma of the prostate. Nature Reviews Urology. 2014;11(4):213-9. 363. Conteduca V, Burgio SL, Menna C, Carretta E, Rossi L, Bianchi E, et al. Chromogranin A is a potential prognostic marker in prostate cancer patients treated with enzalutamide. The Prostate. 2014;74(16):1691-6. 364. Epstein JI, Amin MB, Beltran H, Lotan TL, Mosquera J-M, Reuter VE, et al. Proposed Morphologic Classification of Prostate Cancer With Neuroendocrine Differentiation. The American Journal of Surgical Pathology. 2014;38(6):756-67. 365. Deng X, Liu H, Huang J, Cheng L, Keller ET, Parsons SJ, et al. Ionizing radiation induces prostate cancer neuroendocrine differentiation through interplay of CREB and ATF2: implications for disease progression. Cancer research. 2008;68(23):9663-70. 366. Beltran H, Rickman DS, Park K, Chae SS, Sboner A, MacDonald TY, et al. Molecular characterization of neuroendocrine prostate cancer and identification of new drug targets. Cancer discovery. 2011;1(6):487-95. 367. Dardenne E, Beltran H, Benelli M, Gayvert K, Berger A, Puca L, et al. N-Myc Induces an EZH2-Mediated Transcriptional Program Driving Neuroendocrine Prostate Cancer. Cancer Cell. 2016;30(4):563-77. 368. Yuan T-C, Veeramani S, Lin M-F. Neuroendocrine-like prostate cancer cells: neuroendocrine transdifferentiation of prostate adenocarcinoma cells. Endocrine-Related Cancer. 2007;14(3):531-47. 369. Park JW, Lee JK, Witte ON, Huang J. FOXA2 is a sensitive and specific marker for small cell neuroendocrine carcinoma of the prostate. Modern pathology : an official journal of the United States and Canadian Academy of Pathology, Inc. 2017;30(9):1262-72. 370. Kim J, Jin H, Zhao JC, Yang YA, Li Y, Yang X, et al. FOXA1 inhibits prostate cancer neuroendocrine differentiation. Oncogene. 2017;36(28):4072-80. 371. Simon RAMD, di Sant'Agnese PAMD, Huang L-SP, Xu HMDP, Yao JLMD, Yang QBS, et al. CD44 expression is a feature of prostatic small cell Carcinoma and Distinguishes it from its Mimickers. Human Pathology. 2009;40(2):252-8. 372. Tan H-L, Sood A, Rahimi HA, Wang W, Gupta N, Hicks J, et al. Rb loss is characteristic of prostatic small cell neuroendocrine carcinoma. Clinical cancer research : an official journal of the American Association for Cancer Research. 2014;20(4):890-903. 373. Tsai H, Morais CL, Alshalalfa M, Tan H-L, Haddad Z, Hicks J, et al. Cyclin D1 Loss Distinguishes Prostatic Small-Cell Carcinoma from Most Prostatic Adenocarcinomas. Clinical cancer research : an official journal of the American Association for Cancer Research. 2015;21(24):5619-29.    148 374. Clegg N, Ferguson C, True LD, Arnold H, Moorman A, Quinn JE, et al. Molecular characterization of prostatic small\u2010cell neuroendocrine carcinoma. The Prostate. 2003;55(1):55-64. 375. Palmgren JS, Karavadia SS, Wakefield MR. Unusual and Underappreciated: Small Cell Carcinoma of the Prostate. Seminars in Oncology. 2007;34(1):22-9. 376. Tzelepi V, Zhang J, Lu J-F, Kleb B, Wu G, Wan X, et al. Modeling a lethal prostate cancer variant with small-cell carcinoma features. Clinical cancer research : an official journal of the American Association for Cancer Research. 2012;18(3):666-77. 377. Vashchenko N, Abrahamsson P-A, Urologi M, Lund U, Lunds u, Urological research M. Neuroendocrine Differentiation in Prostate Cancer: Implications for New Treatment Modalities. European Urology. 2005;47(2):147-55. 378. Chen H, Sun Y, Wu C, Magyar CE, Li X, Cheng L, et al. Pathogenesis of prostatic small cell carcinoma involves the inactivation of the P53 pathway. Endocrine-related cancer. 2012;19(3):321-31. 379. Aggarwal R, Huang J, Alumkal JJ, Zhang L, Feng FY, Thomas GV, et al. Clinical and Genomic Characterization of Treatment-Emergent Small-Cell Neuroendocrine Prostate Cancer: A Multi-institutional Prospective Study. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2018;36(24):2492-503. 380. Burchardt M, Burchardt T, Chen M-W, Cao Y, De La Taille A, Shabsigh A, et al. TRANSDIFFERENTIATION OF PROSTATE CANCER CELLS TO A NEUROENDOCRINE CELL PHENOTYPE IN VITRO AND IN VIVO. The Journal of Urology. 1999;162(5):1800-5. 381. Kim J, Adam RM, Freeman MR. Activation of the Erk mitogen-activated protein kinase pathway stimulates neuroendocrine differentiation in LNCaP cells independently of cell cycle withdrawal and STAT3 phosphorylation. Cancer research. 2002;62(5):1549. 382. Cox ME, Deeble PD, Bissonette EA, Parsons SJ. Activated 3',5'-cyclic AMP-dependent protein kinase is sufficient to induce neuroendocrine-like differentiation of the LNCaP prostate tumor cell line. The Journal of biological chemistry. 2000;275(18):13812-8. 383. Deeble PD, Cox ME, Frierson JHF, Sikes RA, Palmer JB, Davidson RJ, et al. Androgen-independent growth and tumorigenesis of prostate cancer cells are enhanced by the presence of PKA-differentiated neuroendocrine cells. Cancer research. 2007;67(8):3663-72. 384. Zou M, Toivanen R, Mitrofanova A, Floch N, Hayati S, Sun Y, et al. Transdifferentiation as a Mechanism of Treatment Resistance in a Mouse Model of Castration-Resistant Prostate Cancer. Cancer discovery. 2017;7(7):736-49. 385. Cox ME, Deeble PD, Lakhani S, Parsons SJ. Acquisition of neuroendocrine characteristics by prostate tumor cells is reversible: implications for prostate cancer progression. Cancer research. 1999;59(15):3821. 386. Kaplan\u2010Lefko PJ, Chen TM, Ittmann MM, Barrios RJ, Ayala GE, Huss WJ, et al. Pathobiology of autochthonous prostate cancer in a pre\u2010clinical transgenic mouse model. The Prostate. 2003;55(3):219-37. 387. Garabedian EM, Humphrey PA, Gordon JI. A Transgenic Mouse Model of Metastatic Prostate Cancer Originating from Neuroendocrine Cells. Proceedings of the National Academy of Sciences of the United States of America. 1998;95(26):15382-7. 388. Mu P, Zhang Z, Benelli M, Karthaus WR, Hoover E, Chen C-C, et al. SOX2 promotes lineage plasticity and antiandrogen resistance in TP53- and RB1-deficient prostate cancer. Science (New York, NY). 2017;355(6320):84-8.    149 389. Lin T-P, Chang Y-T, Lee S-Y, Campbell M, Wang T-C, Shen S-H, et al. REST reduction is essential for hypoxia-induced neuroendocrine differentiation of prostate cancer cells by activating autophagy signaling. Oncotarget. 2016;7(18):26137. 390. Shen R, Dorai T, Szaboles M, Katz AE, Olsson CA, Buttyan R. Transdifferentiation of cultured human prostate cancer cells to a neuroendocrine cell phenotype in a hormone-depleted medium. Urologic Oncology: Seminars and Original Investigations. 1997;3(2):67-75. 391. Ci X, Hao J, Dong X, Choi SY, Xue H, Wu R, et al. Heterochromatin Protein 1\u03b1 Mediates Development and Aggressiveness of Neuroendocrine Prostate Cancer. Cancer research. 2018;78(10):2691-704. 392. Clermont P-L, Lin D, Crea F, Wu R, Xue H, Wang Y, et al. Polycomb-mediated silencing in neuroendocrine prostate cancer. Clinical epigenetics. 2015;7(1):40. 393. Sheng H, Shao J, Washington MK, DuBois RN. Prostaglandin E2 Increases Growth and Motility of Colorectal Carcinoma Cells. Journal of Biological Chemistry. 2001;276(21):18075-81. 394. Nakanishi M, Nakanishi M, Rosenberg DW, Rosenberg DW. Multifaceted roles of PGE2 in inflammation and cancer. Seminars in Immunopathology. 2013;35(2):123-37. 395. Minami M, Shimizu K, Okamoto Y, Folco E, Ilasaca ML, Feinberg MW, et al. Prostaglandin E Receptor Type 4-associated Protein Interacts Directly with NF- B1 and Attenuates Macrophage Activation. Journal of Biological Chemistry. 2008;283(15):9692-703. 396. Tsz Ying Sylvia C. The roles of SH2-containing inositol 5'-phosphatase 1 (SHIP1) and signal transducer and activator of transcription 3 (STAT3) in interleukin-10 regulation of activated macrophages: University of British Columbia U6 - ctx_ver=Z39.88-2004&ctx_enc=info%3Aofi%2Fenc%3AUTF-8&rfr_id=info%3Asid%2Fsummon.serialssolutions.com&rft_val_fmt=info%3Aofi%2Ffmt%3Akev%3Amtx%3Adissertation&rft.genre=dissertation&rft.title=The+roles+of+SH2-containing+inositol+5%27-phosphatase+1+%28SHIP1%29+and+signal+transducer+and+activator+of+transcription+3+%28STAT3%29+in+interleukin-10+regulation+of+activated+macrophages&rft.DBID=CJ9&rft.au=Tsz+Ying+Sylvia%2C+Cheung&rft.date=2016&rft.pub=University+of+British+Columbia&rft.externalDBID=n%2Fa&rft.externalDocID=oai_circle_library_ubc_ca_2429_59455&paramdict=en-US U7 - Dissertation; 2016. 397. Konya V, Marsche G, Schuligoi R, Heinemann A. E-type prostanoid receptor 4 (EP4) in disease and therapy. Pharmacology & Therapeutics. 2013;138(3):485-502. 398. Kabashima K, Saji T, Murata T, Nagamachi M, Matsuoka T, Segi E, et al. The prostaglandin receptor EP4 suppresses colitis, mucosal damage and CD4 cell activation in the gut. The Journal of clinical investigation. 2002;109(7):883-93. 399. Sampey AV, Hall PH, Mitchell RA, Metz CN, Morand EF. Regulation of synoviocyte phospholipase A2 and cyclooxygenase 2 by macrophage migration inhibitory factor. Arthritis & Rheumatism. 2001;44(6):1273-80. 400. Ribardo DA, Crowe SE, Kuhl KR, Peterson JW, Chopra AK. Prostaglandin Levels in Stimulated Macrophages Are Controlled by Phospholipase A2-activating Protein and by Activation of Phospholipase C and D. Journal of Biological Chemistry. 2001;276(8):5467-75. 401. Yuan CJ, Mandal AK, Zhang ZJ, Mukherjee AB. Transcriptional regulation of Cyclooxygenase-2 gene expression: Novel effects of nonsteroidal anti-inflammatory drugs. CANCER RESEARCH. 2000;60(4):1084-91.    150 402. Takayama K, Garc\u00c4\u00b1\u00cc\u0000a-Carde\u00c3\u00b1a G, Sukhova GK, Comander J, Michael A. Gimbrone, Jr., Libby P. Prostaglandin E2 Suppresses Chemokine Production in Human Macrophages through the EP4 Receptor. Journal of Biological Chemistry. 2002;277(46):44147-54. 403. Ikegami R, Sugimoto Y, Segi E, Katsuyama M, Karahashi H, Amano F, et al. The Expression of Prostaglandin E Receptors EP2 and EP4 and Their Different Regulation by Lipopolysaccharide in C3H\/HeN Peritoneal Macrophages. The Journal of Immunology. 2001;166(7):4689. 404. Nitta M, Hirata I, Toshina K, Murano M, Maemura K, Hamamoto N, et al. Expression of the EP4 Prostaglandin E2 Receptor Subtype with Rat Dextran Sodium Sulphate Colitis: Colitis Suppression by a Selective Agonist, ONO\u2010AE1\u2010329. Scandinavian Journal of Immunology. 2002;56(1):66-75. 405. Birrell MA, Maher SA, Dekkak B, Jones V, Wong S, Brook P, et al. Anti-inflammatory effects of PGE2 in the lung: role of the EP4 receptor subtype. Thorax. 2015;70(8):740. 406. Lee K-S, Lee H-J, Ahn KS, Kim S-H, Nam D, Kim DK, et al. Cyclooxygenase-2\/prostaglandin E2 pathway mediates icariside II induced apoptosis in human PC-3 prostate cancer cells. Cancer Letters. 2009;280(1):93-100. 407. Takahashi T, Uehara H, Bando Y, Izumi K. Soluble EP2 neutralizes prostaglandin E2\u2013induced cell signaling and inhibits osteolytic tumor growth. Molecular Cancer Therapeutics. 2008;7(9):2807-16. 408. Meyer-Siegler K. COX-2 specific inhibitor, NS-398, increases macrophage migration inhibitory factor expression and induces neuroendocrine differentiation in C4-2b prostate cancer cells. MOLECULAR MEDICINE. 2001;7(12):850-60. 409. Patrono C. Cardiovascular effects of cyclooxygenase\u20102 inhibitors: a mechanistic and clinical perspective. British Journal of Clinical Pharmacology. 2016;82(4):957-64. 410. Toyoda Y, Morimoto K, Suno R, Horita S, Yamashita K, Hirata K, et al. Ligand binding to human prostaglandin E receptor EP4 at the lipid-bilayer interface. Nature Chemical Biology. 2019;15(1):18-26. 411. Narumiya S, Sugimoto Y, Ushikubi F. Prostanoid Receptors: Structures, Properties, and Functions. Physiological Reviews. 1999;79(4):1193-226. 412. Nishigaki N, Negishi M, Honda A, Sugimoto Y, Namba T, Narumiya S, et al. Identification of prostaglandin E receptor \u2018EP2\u2019 cloned from mastocytoma cells as EP4 subtype. FEBS Letters. 1995;364(3):339-41. 413. Coleman RA, Grix SP, Head SA, Louttit JB, Mallett A, Sheldrick RLG. A novel inhibitory prostanoid receptor in piglet saphenous vein. Prostaglandins. 1994;47(2):151-68. 414. Yokoyama U, Iwatsubo K, Umemura M, Fujita T, Ishikawa Y. The prostanoid EP4 receptor and its signaling pathway. Pharmacological reviews. 2013;65(3):1010-52. 415. Katritch V, Cherezov V, Stevens RC. Diversity and modularity of G protein-coupled receptor structures. Trends in Pharmacological Sciences. 2011;33(1):17-27. 416. Overington JP, Al-Lazikani B, Hopkins AL. How many drug targets are there? Nature Reviews Drug Discovery. 2006;5(12):993-6. 417. Garland SL. Are GPCRs still a source of new targets? Journal of biomolecular screening. 2013;18(9):947-66. 418. Sands AT, Zambrowicz BP. Knockouts model the 100 best-selling drugs-will they model the next 100? Nature Reviews Drug Discovery. 2003;2(1):38-51.    151 419. Whalen EJ, Rajagopal S, Lefkowitz RJ. Therapeutic potential of \u03b2-arrestin- and G protein-biased agonists. Trends in Molecular Medicine. 2010;17(3):126-39. 420. Luttrell LM, Maudsley S, Bohn LM. Fulfilling the Promise of \"Biased\" G Protein-Coupled Receptor Agonism. Molecular pharmacology. 2015;88(3):579-88. 421. Maudsley S, Martin B, Luttrell LM. The Origins of Diversity and Specificity in G Protein-Coupled Receptor Signaling. Journal of Pharmacology and Experimental Therapeutics. 2005;314(2):485-94. 422. Gurevich VV, Pals-Rylaarsdam R, Benovic JL, Hosey MM, Onorato JJ. Agonist-Receptor-Arrestin, an Alternative Ternary Complex with High Agonist Affinity. Journal of Biological Chemistry. 1997;272(46):28849-52. 423. Goodman OB, Krupnick JG, Santini F, Gurevich VV, Penn RB, Gagnon AW, et al. \u03b2-Arrestin acts as a clathrin adaptor in endocytosis of the \u03b22-adrenergic receptor. Nature. 1996;383(6599):447-50. 424. Thomsen ARB, Plouffe B, Cahill TJ, Shukla AK, Tarrasch JT, Dosey AM, et al. GPCR-G Protein-\u03b2-Arrestin Super-Complex Mediates Sustained G Protein Signaling. Cell. 2016;166(4):907-19. 425. Benovic JL, K\u00fchn H, Weyand I, Codina J, Caron MG, Lefkowitz RJ. Functional Desensitization of the Isolated \u03b2 -adrenergic Receptor by the \u03b2 -adrenergic Receptor Kinase: Potential Role of an Analog of the Retinal Protein Arrestin (48-kDa Protein). Proceedings of the National Academy of Sciences of the United States of America. 1987;84(24):8879-82. 426. Szczepek M, Beyriere F, Hofmann KP, Elgeti M, Kazmin R, Rose A, et al. Crystal structure of a common GPCR-binding interface for G protein and arrestin. NATURE COMMUNICATIONS. 2014;5(1):4801. 427. Zhang J, Barak LS, Anborgh PH, Laporte SA, Caron MG, Ferguson SSG. Cellular trafficking of G protein-coupled receptor\/beta-arrestin endocytic complexes. JOURNAL OF BIOLOGICAL CHEMISTRY. 1999;274(16):10999-1006. 428. Gimenez LE, Kook S, Vishnivetskiy SA, Ahmed MR, Gurevich EV, Gurevich VV. Role of receptor-attached phosphates in binding of visual and non-visual arrestins to G protein-coupled receptors. The Journal of biological chemistry. 2012;287(12):9028-40. 429. Laporte SA, Oakley RH, Zhang J, Holt JA, Stephen SGF, Caron MG, et al. The \u03b22-adrenergic receptor\/\u03b2 arrestin Complex Recruits the Clathrin Adaptor AP-2 during Endocytosis. Proceedings of the National Academy of Sciences of the United States of America. 1999;96(7):3712-7. 430. Tsvetanova NG, von Zastrow M. Spatial encoding of cyclic AMP signaling specificity by GPCR endocytosis. NATURE CHEMICAL BIOLOGY. 2014;10(12):1061-. 431. Calebiro D, Nikolaev VO, Gagliani MC, de Filippis T, Dees C, Tacchetti C, et al. Persistent cAMP-Signals Triggered by Internalized G-Protein-Coupled Receptors. PLOS BIOLOGY. 2009;7(8):e1000172. 432. Wisler JW, DeWire SM, Whalen EJ, Violin JD, Drake MT, Ahn S, et al. A unique mechanism of beta-blocker action: carvedilol stimulates beta-arrestin signaling. Proceedings of the National Academy of Sciences of the United States of America. 2007;104(42):16657-62. 433. Nobles KN, Xiao KH, Ahn S, Shukla AK, Lam CM, Rajagopal S, et al. Distinct Phosphorylation Sites on the beta(2)-Adrenergic Receptor Establish a Barcode That Encodes Differential Functions of beta-Arrestin. SCIENCE SIGNALING. 2011;4(185):ra51.    152 434. Nataraj C, Thomas DW, Tilley SL, Nguyen M, Mannon R, Koller BH, et al. Receptors for prostaglandin E2 that regulate cellular immune responses in the mouse. Journal of Clinical Investigation. 2001;108(8):1229-35. 435. Chell SD, Witherden IR, Dobson RR, Moorghen M, Herman AA, Qualtrough D, et al. Increased EP4 Receptor Expression in Colorectal Cancer Progression Promotes Cell Growth and Anchorage Independence. Cancer Research. 2006;66(6):3106-13. 436. Cao RY, St Amand T, Li X, Yoon S-H, Wang CP, Song H, et al. Prostaglandin receptor EP4 in abdominal aortic aneurysms. The American journal of pathology. 2012;181(1):313-21. 437. Murase A, Okumura T, Sakakibara A, Tonai-Kachi H, Nakao K, Takada J. Effect of prostanoid EP4 receptor antagonist, CJ-042,794, in rat models of pain and inflammation. European journal of pharmacology. 2008;580(1-2):116-21. 438. Yoshida K, Oida H, Kobayashi T, Maruyama T, Tanaka M, Katayama T, et al. Stimulation of Bone Formation and Prevention of Bone Loss by Prostaglandin E EP4 Receptor Activation. Proceedings of the National Academy of Sciences of the United States of America. 2002;99(7):4580-5. 439. Yao C, Sakata D, Esaki Y, Li Y, Matsuoka T, Kuroiwa K, et al. Prostaglandin E2-EP4 signaling promotes immune inflammation through Th1 cell differentiation and Th17 cell expansion. Nature medicine. 2009;15(6):633. 440. Nakase H, Fujiyama Y, Oshitani N, Oga T, Nonomura K, Matsuoka T, et al. Effect of EP4 agonist (ONO-4819CD) for patients with mild to moderate ulcerative colitis refractory to 5-aminosalicylates: a randomized phase II, placebo-controlled trial. Inflammatory bowel diseases. 2010;16(5):731-3. 441. Kashmiry A, Tate R, Rotondo G, Rotondo D, Davidson J. The prostaglandin EP4 receptor is a master regulator of the expression of PGE2 receptors following inflammatory activation in human monocytic cells. BBA - Molecular and Cell Biology of Lipids. 2018;1863(10):1297-304. 442. Libioulle C, Louis E, Hansoul S, Sandor C, Farnir F, Franchimont D, et al. Novel Crohn disease locus identified by genome-wide association maps to a gene desert on 5p13.1 and modulates expression of PTGER4. PLoS genetics. 2007;3(4):e58. 443. Glas J, Seiderer J, Czamara D, Pasciuto G, Diegelmann J, Wetzke M, et al. PTGER4 expression-modulating polymorphisms in the 5p13.1 region predispose to Crohn's disease and affect NF-\u03baB and XBP1 binding sites. PloS one. 2012;7(12):e52873. 444. Latiano A, Palmieri O, Latiano T, Corritore G, Bossa F, Martino G, et al. Investigation of multiple susceptibility loci for inflammatory bowel disease in an Italian cohort of patients. PloS one. 2011;6(7):e22688. 445. Portelli MA, Hodge E, Sayers I. Genetic risk factors for the development of allergic disease identified by genome\u2010wide association. Clinical & Experimental Allergy. 2015;45(1):21-31. 446. Cosme R, Lublin D, Takafuji V, Lynch K, Roche JK. Prostanoids in human colonic mucosa: effects of inflammation on PGE2 receptor expression. Human Immunology. 2000;61(7):684-96. 447. Sharon P, Ligumsky M, Rachmilewitz D, Zor U. Role of prostaglandins in ulcerative colitis. Enhanced production during active disease and inhibition by sulfasalazine. Gastroenterology. 1978;75(4):638. 448. Watanabe Y, Murata T, Amakawa M, Miyake Y, Handa T, Konishi K, et al. KAG-308, a newly-identified EP4-selective agonist shows efficacy for treating ulcerative colitis and can    153 bring about lower risk of colorectal carcinogenesis by oral administration. European journal of pharmacology. 2015;754:179-89. 449. Xu S, Zhou W, Ge J, Zhang Z. Prostaglandin E2 receptor EP4 is involved in the cell growth and invasion of prostate cancer via the cAMP\u2011PKA\/PI3K\u2011Akt signaling pathway. Molecular Medicine Reports. 2018;17(3):4702-12. 450. Huang HFS, Shu P, Murphy TF, Aisner S, Fitzhugh VA, Jordan ML. Significance of divergent expression of prostaglandin EP4 and EP3 receptors in human prostate cancer. Molecular cancer research : MCR. 2013;11(4):427-39. 451. Xu S, Zhang Z, Ogawa O, Yoshikawa T, Sakamoto H, Shibasaki N, et al. An EP4 Antagonist ONO-AE3-208 Suppresses Cell Invasion, Migration, and Metastasis of Prostate Cancer. Cell Biochemistry and Biophysics. 2014;70(1):521-7. 452. Verma RP, Hansch C. Matrix metalloproteinases (MMPs): Chemical\u2013biological functions and (Q)SARs. Bioorganic & Medicinal Chemistry. 2007;15(6):2223-68. 453. Syrovatkina V, Alegre KO, Dey R, Huang X-Y. Regulation, Signaling, and Physiological Functions of G-Proteins. Journal of Molecular Biology. 2016;428(19):3850-68. 454. V\u00f6gler O, Barcel\u00f3 JM, Ribas C, Escrib\u00e1 PV. Membrane interactions of G proteins and other related proteins. BBA - Biomembranes. 2008;1778(7):1640-52. 455. Wettschureck N, Offermanns S. Mammalian G Proteins and Their Cell Type Specific Functions. Physiological Reviews. 2005;85(4):1159-204. 456. Fujino H, Regan JW. Prostanoid receptors and phosphatidylinositol 3-kinase: a pathway to cancer? Trends in Pharmacological Sciences. 2003;24(7):335-40. 457. Fujino H, Regan JW. EP(4) prostanoid receptor coupling to a pertussis toxin-sensitive inhibitory G protein. Molecular pharmacology. 2006;69(1):5. 458. Rasmussen SGF, Choi H-J, Fung JJ, Pardon E, Casarosa P, Chae PS, et al. Structure of a nanobody-stabilized active state of the \u03b22 adrenoceptor. Nature. 2011;469(7329):175-80. 459. Chung KY, Rasmussen SGF, Liu T, Li S, DeVree BT, Chae PS, et al. Conformational changes in the G protein Gs induced by the \u03b22 adrenergic receptor. Nature. 2011;477(7366):611-5. 460. Higashijima T, Ferguson KM, Sternweis PC, Smigel MD, Gilman AG. Effects of Mg2+ and the beta gamma-subunit complex on the interactions of guanine nucleotides with G proteins. Journal of Biological Chemistry. 1987;262(2):762. 461. Sprang SR, Chen Z, Du X. Structural Basis of Effector Regulation and Signal Termination in Heterotrimeric G\u03b1 Proteins. 74. SAN DIEGO: Elsevier Science & Technology; 2007. p. 1-65. 462. Buchanan FG, Gorden DL, Matta P, Shi Q, Matrisian LM, DuBois RN. Role of \u03b2-Arrestin 1 in the Metastatic Progression of Colorectal Cancer. Proceedings of the National Academy of Sciences of the United States of America. 2006;103(5):1492-7. 463. Xin X, Majumder M, Girish GV, Mohindra V, Maruyama T, Lala PK. Targeting COX-2 and EP4 to control tumor growth, angiogenesis, lymphangiogenesis and metastasis to the lungs and lymph nodes in a breast cancer model. Laboratory investigation; a journal of technical methods and pathology. 2012;92(8):1115. 464. Cheon H, Rho YH, Choi SJ, Lee YH, Song GG, Sohn J, et al. Prostaglandin E2 Augments IL-10 Signaling and Function. The Journal of Immunology. 2006;177(2):1092. 465. Xu K, Yen T, Geczy CL. IL-10 Up-Regulates Macrophage Expression of the S100 Protein S100A8. The Journal of Immunology. 2001;166(10):6358.    154 466. Bryn T, Mahic M, Enserink JM, Schwede F, Aandahl EM, Tasken K. The Cyclic AMP-Epac1-Rap1 Pathway Is Dissociated from Regulation of Effector Functions in Monocytes but Acquires Immunoregulatory Function in Mature Macrophages. The Journal of Immunology. 2006;176(12):7361. 467. Avni D, Ernst O, Philosoph A, Zor T. Role of CREB in modulation of TNF\u03b1 and IL-10 expression in LPS-stimulated RAW264.7 macrophages. Molecular Immunology. 2010;47(7):1396-403. 468. Zhang M, Zhang H, Cheng S, Zhang D, Xu Y, Bai X, et al. Prostaglandin E2 accelerates invasion by upregulating Snail in hepatocellular carcinoma cells. Tumor Biology. 2014;35(7):7135-45. 469. Schaper F, Rose-John S. Interleukin-6: Biology, signaling and strategies of blockade. Cytokine and Growth Factor Reviews. 2015;26(5):475-87. 470. Nowell MA, Richards PJ, Horiuchi S, Yamamoto N, Rose-John S, Topley N, et al. Soluble IL-6 Receptor Governs IL-6 Activity in Experimental Arthritis: Blockade of Arthritis Severity by Soluble Glycoprotein 130. The Journal of Immunology. 2003;171(6):3202-9. 471. Kumari N, Dwarakanath BS, Das A, Bhatt AN. Role of interleukin-6 in cancer progression and therapeutic resistance. Tumor Biology. 2016;37(9):11553-72. 472. Akira S, Taga T, Kishimoto T. Interleukin-6 in biology and medicine. Advances in immunology. 1993;54:1. 473. Yoshizaki K, Matsuda T, Nishimoto N, Kuritani T, Taeho L, Aozasa K, et al. Pathogenic significance of interleukin-6 (IL-6\/BSF-2) in Castleman's disease. Blood. 1989;74(4):1360-7. 474. Harmer D, Falank C, Reagan MR. Interleukin-6 Interweaves the Bone Marrow Microenvironment, Bone Loss, and Multiple Myeloma. Frontiers in endocrinology. 2018;9:788. 475. Hirano T, Matsuda T, Turner M, Miyasaka N, Buchan G, Tang B, et al. Excessive production of interleukin 6\/B cell stimulatory factor-2 in rheumatoid arthritis. European journal of immunology. 1988;18(11):1797. 476. Malinowska K, Neuwirt H, Cavarretta IT, Bektic J, Steiner H, Dietrich H, et al. Interleukin-6 stimulation of growth of prostate cancer in vitro and in vivo through activation of the androgen receptor. Endocrine-Related Cancer. 2009;16(1):155-69. 477. Drachenberg DE, Elgamal AAA, Rowbotham R, Peterson M, Murphy GP. Circulating levels of interleukin\u20106 in patients with hormone refractory prostate cancer. The Prostate. 1999;41(2):127-33. 478. Yang L, Wang L, Wang P-H, Lin H-K, Kan P-Y, Xie S, et al. Interleukin-6 differentially regulates androgen receptor transactivation via PI3K-Akt, STAT3, and MAPK, three distinct signal pathways in prostate cancer cells. Biochemical and Biophysical Research Communications. 2003;305(3):462-9. 479. Lee SO, Lou W, Hou M, Miguel Fd, Gerber L, Gao AC. Interleukin-6 Promotes Androgen-independent Growth in LNCaP Human Prostate Cancer Cells. Clinical Cancer Research. 2003;9(1):370. 480. Culig Z, Puhr M. Interleukin-6 and prostate cancer: Current developments and unsolved questions. Molecular and cellular endocrinology. 2018;462(Pt A):25-30. 481. Chung TDK, Yu JJ, Spiotto MT, Bartkowski M, Simons JW. Characterization of the role of IL\u20106 in the progression of prostate cancer. The Prostate. 1999;38(3):199-207. 482. Degeorges A, Tatoud R, Fauvel\u2010Lafeve F, Podgorniak MP, Millot G, de Cremoux P, et al. Stromal cells from human benign prostate hyperplasia produce a growth\u2010inhibitory factor for    155 LNCaP prostate cancer cells, identified as interleukin\u20106. International Journal of Cancer. 1996;68(2):207-14. 483. Giri D, Ozen M, Ittmann M. Interleukin-6 Is an Autocrine Growth Factor in Human Prostate Cancer. The American Journal of Pathology. 2001;159(6):2159-65. 484. Lee SO, Chun JY, Nadiminty N, Lou W, Gao AC. Interleukin\u20106 undergoes transition from growth inhibitor associated with neuroendocrine differentiation to stimulator accompanied by androgen receptor activation during LNCaP prostate cancer cell progression. The Prostate. 2007;67(7):764-73. 485. Mori S, Murakami-Mori K, Bonavida B. Interleukin-6 induces G1 arrest through induction of p27(Kip1), a cyclin-dependent kinase inhibitor, and neuron-like morphology in LNCaP prostate tumor cells. Biochemical and biophysical research communications. 1999;257(2):609. 486. Hobisch A, Ramoner R, Fuchs D, Godoy-Tundidor S, Bartsch G, Klocker H, et al. Prostate Cancer Cells (LNCaP) Generated after Long-Term Interleukin 6 (IL-6) Treatment Express IL-6 and Acquire an IL-6 Partially Resistant Phenotype. Clinical Cancer Research. 2001;7(9):2941. 487. Ueda T, Mawji NR, Bruchovsky N, Sadar MD. Ligand-independent Activation of the Androgen Receptor by Interleukin-6 and the Role of Steroid Receptor Coactivator-1 in Prostate Cancer Cells. Journal of Biological Chemistry. 2002;277(41):38087-94. 488. Debes JD, Schmidt LJ, Huang HJ, Tindall DJ. p300 mediates androgen-independent transactivation of the androgen receptor by interleukin 6. CANCER RESEARCH. 2002;62(20):5632-6. 489. Jostock T, M\u00fcllberg J, \u00d6zbek S, Atreya R, Blinn G, Voltz N, et al. Soluble gp130 is the natural inhibitor of soluble interleukin\u20106 receptor transsignaling responses. European Journal of Biochemistry. 2001;268(1):160-7. 490. Jia L, Choong CSY, Ricciardelli C, Kim J, Tilley WD, Coetzee GA. Androgen receptor signaling: mechanism of interleukin-6 inhibition. Cancer research. 2004;64(7):2619-26. 491. Tavassoli P, Snoek R, Ray M, Rao LG, Rennie PS. Rapid, non\u2010destructive, cell\u2010based screening assays for agents that modulate growth, death, and androgen receptor activation in prostate cancer cells. The Prostate. 2007;67(4):416-26. 492. Campana C, Rege J, Turcu AF, Pezzi V, Gomez-Sanchez CE, Robins DM, et al. Development of a novel cell based androgen screening model. Journal of Steroid Biochemistry and Molecular Biology. 2016;156:17-22. 493. Ming-Lum A, Shojania S, So E, McCarrell E, Shaw E, Vu D, et al. A pleckstrin homology-related domain in SHIP1 mediates membrane localization during Fcgamma receptor-induced phagocytosis. FASEB J. 2012;26(8):3163-77. 494. Horoszewicz JS, Leong SS, Kawinski E, Karr JP, Rosenthal H, Chu TM, et al. LNCaP model of human prostatic carcinoma. Cancer Res. 1983;43(4):1809-18. 495. Cao J, Wu LZ, Zhang SM, Lu M, Cheung WKC, Cai W, et al. An easy and efficient inducible CRISPR\/Cas9 platform with improved specificity for multiple gene targeting. Nucleic Acids Research. 2016;44(19). 496. Wang T, Wei JJ, Sabatini DM, Lander ES. Genetic Screens in Human Cells Using the CRISPR-Cas9 System. Science. 2014;343(6166):80-4. 497. Chu VT, Graf R, Wirtz T, Weber T, Favret J, Li X, et al. Efficient CRISPR-mediated mutagenesis in primary immune cells using CrispRGold and a C57BL\/6 Cas9 transgenic mouse    156 line. Proceedings of the National Academy of Sciences of the United States of America. 2016;113(44):12514-9. 498. Lang R, Patel D, Morris JJ, Rutschman RL, Murray PJ. Shaping Gene Expression in Activated and Resting Primary Macrophages by IL-10. The Journal of Immunology. 2002;169(5):2253-63. 499. Hutchins AP, Takahashi Y, Miranda-Saavedra D. Genomic analysis of LPS-stimulated myeloid cells identifies a common pro-inflammatory response but divergent IL-10 anti-inflammatory responses. Scientific reports. 2015;5:9100. 500. Williams L, Jarai G, Smith A, Finan P. IL-10 expression profiling in human monocytes. Journal of Leukocyte Biology. 2002;72(4):800. 501. Antoniv TT, Park-Min K-H, Ivashkiv LB. Kinetics of IL-10-induced gene expression in human macrophages. Immunobiology. 2005;210(2):87-95. 502. Tang T, Scambler TE, Smallie T, Cunliffe HE, Ross EA, Rosner DR, et al. Macrophage responses to lipopolysaccharide are modulated by a feedback loop involving prostaglandin E 2 , dual specificity phosphatase 1 and tristetraprolin. Scientific reports U6 - ctx_ver=Z3988-2004&ctx_enc=info%3Aofi%2Fenc%3AUTF-8&rfr_id=info%3Asid%2Fsummonserialssolutionscom&rft_val_fmt=info%3Aofi%2Ffmt%3Akev%3Amtx%3Ajournal&rftgenre=article&rftatitle=Macrophage+responses+to+lipopolysaccharide+are+modulated+by+a+feedback+loop+involving+prostaglandin+E+2+%2C+dual+specificity+phosphatase+1+and+tristetraprolin&rftjtitle=Scientific+reports&rftau=Tang%2C+Tina&rftau=Scambler%2C+Thomas+E&rftau=Smallie%2C+Tim&rftau=Cunliffe%2C+Helen+E&rftdate=2017-06-28&rfteissn=2045-2322&rftvolume=7&rftissue=1&rftspage=4350&rft_id=info%3Apmid%2F28659609&rftexternalDocID=28659609&paramdict=en-US U7 - Journal Article. 2017;7(1):4350. 503. Katsuyama M, Ikegami R, Karahashi H, Amano F, Sugimoto Y, Ichikawa A. Characterization of the LPS-stimulated expression of EP2 and EP4 prostaglandin E receptors in mouse macrophage-like cell line, J774.1. Biochem Biophys Res Commun. 1998;251(3):727-31. 504. Raschke WC, Baird S, Ralph P, Nakoinz I. Functional macrophage cell lines transformed by abelson leukemia virus. Cell. 1978;15(1):261-7. 505. Ip WKE, Hoshi N, Shouval DS, Snapper S, Medzhitov R. Anti-inflammatory effect of IL-10 mediated by metabolic reprogramming of macrophages. Science. 2017;356(6337):513-9. 506. Ahmed ST, Mayer A, Ji JD, Ivashkiv LB. Inhibition of IL-6 signaling by a p38-dependent pathway occurs in the absence of new protein synthesis. JOURNAL OF LEUKOCYTE BIOLOGY. 2002;72(1):154-62. 507. Quiros M, Nishio H, Neumann PA, Siuda D, Brazil JC, Azcutia V, et al. Macrophage-derived IL-10 mediates mucosal repair by epithelial WISP-1 signaling. The Journal of clinical investigation. 2017;127(9):3510-20. 508. Pengal RA, Ganesan LP, Wei G, Fang HQ, Ostrowski MC, Tridandapani S. Lipopolysaccharide-induced production of interleukin-10 is promoted by the serine\/threonine kinase Akt. Molecular Immunology. 2006;43(10):1557-64. 509. Iyer SS, Ghaffari AA, Cheng G. Lipopolysaccharide-Mediated IL-10 Transcriptional Regulation Requires Sequential Induction of Type I IFNs and IL-27 in Macrophages. Journal of Immunology. 2010;185(11):6599-607. 510. Chang EY, Guo B, Doyle SE, Cheng G. Cutting Edge: Involvement of the Type I IFN Production and Signaling Pathway in Lipopolysaccharide-Induced IL-10 Production. The Journal of Immunology. 2007;178(11):6705-9.    157 511. Sedlyarov V, Fallmann J, Ebner F, Huemer J, Sneezum L, Ivin M, et al. Tristetraprolin binding site atlas in the macrophage transcriptome reveals a switch for inflammation resolution. Molecular Systems Biology. 2016;12(5):868-n\/a. 512. Lykke-Andersen J, Wagner E. Recruitment and activation of mRNA decay enzymes by two ARE-mediated decay activation domains in the proteins TTP and BRF-1. Genes & development. 2005;19(3):351-61. 513. Chen CY, Gherzi R, Ong SE, Chan EL, Raijmakers R, Pruijn GJ, et al. AU binding proteins recruit the exosome to degrade ARE-containing mRNAs. Cell. 2001;107(4):451-64. 514. Jing Q, Huang S, Guth S, Zarubin T, Motoyama A, Chen J, et al. Involvement of MicroRNA in AU-Rich Element-Mediated mRNA Instability. Cell. 2005;120(5):623-34. 515. Seldon PM, Barnes PJ, Giembycz MA. Interleukin-10 does not mediate the inhibitory effect of PDE-4 inhibitors and other cAMP-elevating drugs on lipopolysaccharide-induced tumors necrosis factor-\u03b1 generation from human peripheral blood monocytes. Cell Biochemistry and Biophysics. 1998;29(1):179-201. 516. Strassmann G, Patil-Koota V, Finkelman F, Fong M, Kambayashi T. Evidence for the involvement of interleukin 10 in the differential deactivation of murine peritoneal macrophages by prostaglandin E2. The Journal of Experimental Medicine. 1994;180(6):2365-70. 517. MacKenzie KF, Van Den Bosch MWM, Naqvi S, Elcombe SE, McGuire VA, Reith AD, et al. MSK1 and MSK2 Inhibit Lipopolysaccharide-Induced Prostaglandin Production via an Interleukin-10 Feedback Loop. Molecular and Cellular Biology. 2013;33(7):1456-67. 518. Barrios-Rodiles M, Tiraloche G, Chadee K. Lipopolysaccharide modulates cyclooxygenase-2 transcriptionally and posttranscriptionally in human macrophages independently from endogenous IL-1 beta and TNF-alpha. Journal of Immunology. 1999;163(2):963-9. 519. Eliopoulos AG, Dumitru CD, Wang CC, Cho JH, Tsichlis PN. Induction of COX-2 by LPS in macrophages is regulated by Tpl2-dependent CREB activation signals. Embo Journal. 2002;21(18):4831-40. 520. Niiro H, Otsuka T, Tanabe T, Hara S, Kuga S, Nemoto Y, et al. Inhibition by interleukin-10 of inducible cyclooxygenase expression in lipopolysaccharide-stimulated monocytes: its underlying mechanism in comparison with interleukin-4. Blood. 1995;85(12):3736. 521. Wen AY, Sakamoto KM, Miller LS. The Role of the Transcription Factor CREB in Immune Function. The Journal of Immunology. 2010;185(11):6413-9. 522. Bryn T, Yaqub S, Mahic M, Henjum K, Aandahl EM, Task\u00e9n K. LPS-activated monocytes suppress T-cell immune responses and induce FOXP3+ T cells through a COX-2\u2013PGE2-dependent mechanism. International Immunology. 2007;20(2):235-45. 523. Kim S, Jee K, Kim D, Koh H, Chung J. Cyclic AMP inhibits Akt activity by blocking the membrane localization of PDK1. The Journal of biological chemistry. 2001;276(16):12864-70. 524. Feldman BJ, Feldman D. The development of androgen-independent prostate cancer. Nature Reviews Cancer. 2001;1(1):34-45. 525. Denmeade SR, Lin XS, Isaacs JT. Role of programmed (apoptotic) cell death during the progression and therapy for prostate cancer. The Prostate. 1996;28(4):251-65. 526. Isaacs JT. Antagonistic effect of androgen on prostatic cell death. The Prostate. 1984;5(5):545. 527. Lin L-C, Gao AC, Lai C-H, Hsieh J-T, Lin H. Induction of neuroendocrine differentiation in castration resistant prostate cancer cells by adipocyte differentiation-related protein (ADRP) delivered by exosomes. Cancer Letters. 2017;391:74-82.    158 528. Ideyama Y, Kudoh M, Tanimoto K, Susaki Y, Nanya T, Nakahara T, et al. Novel nonsteroidal inhibitor of cytochrome P450(17alpha) (17alpha-hydroxylase\/C17-20 lyase), YM116, decreased prostatic weights by reducing serum concentrations of testosterone and adrenal androgens in rats. The Prostate. 1998;37(1):10. 529. Wang Q, Horiatis D, Pinski J. Inhibitory effect of IL-6-induced neuroendocrine cells on prostate cancer cell proliferation. The Prostate. 2004;61(3):253-9. 530. Zelivianski S, Verni M, Moore C, Kondrikov D, Taylor R, Lin M-F. Multipathways for transdifferentiation of human prostate cancer cells into neuroendocrine-like phenotype. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research. 2001;1539(1):28-43. 531. Mannino MH, Zhu Z, Xiao H, Bai Q, Wakefield MR, Fang Y. The paradoxical role of IL-10 in immunity and cancer. Cancer Letters. 2015;367(2):103-7. 532. Taher MY, Davies DM, Maher J. The role of the interleukin (IL)-6\/IL-6 receptor axis in cancer. Biochemical Society Transactions. 2018;46(6):1449-62. 533. Xu L, Chen X, Shen M, Yang DR, Fang L, Weng G, et al. Inhibition of IL\u20106\u2010JAK\/Stat3 signaling in castration\u2010resistant prostate cancer cells enhances the NK cell\u2010mediated cytotoxicity via alteration of PD\u2010L1\/NKG2D ligand levels. Molecular Oncology. 2018;12(3):269-86. 534. Chan L-C, Li C-W, Xia W, Hsu J-M, Lee H-H, Cha J-H, et al. IL-6\/JAK1 pathway drives PD-L1 Y112 phosphorylation to promote cancer immune evasion. The Journal of clinical investigation. 2019;129(8):3324-38. 535. Chen DS, Mellman I. Oncology meets immunology: the cancer-immunity cycle. Immunity. 2013;39(1):1-10. 536. Kwon EDP, Drake CGMD, Scher HIP, Fizazi KP, Bossi AMD, van den Eertwegh AJMMD, et al. Ipilimumab versus placebo after radiotherapy in patients with metastatic castration-resistant prostate cancer that had progressed after docetaxel chemotherapy (CA184-043): a multicentre, randomised, double-blind, phase 3 trial. Lancet Oncology, The. 2014;15(7):700-12. 537. Slovin SF, Higano CS, Hamid O, Tejwani S, Harzstark A, Alumkal JJ, et al. Ipilimumab alone or in combination with radiotherapy in metastatic castration-resistant prostate cancer: results from an open-label, multicenter phase I\/II study. Annals of oncology : official journal of the European Society for Medical Oncology. 2013;24(7):1813-21. 538. Topalian SL, Hodi FS, Brahmer JR, Gettinger SN, Smith DC, McDermott DF, et al. Safety, Activity, and Immune Correlates of Anti\u2013PD-1 Antibody in Cancer. The New England Journal of Medicine. 2012;366(26):2443-54. 539. Taube JM, Klein A, Brahmer JR, Xu H, Pan X, Kim JH, et al. Association of PD-1, PD-1 ligands, and other features of the tumor immune microenvironment with response to anti-PD-1 therapy. Clinical cancer research : an official journal of the American Association for Cancer Research. 2014;20(19):5064-74. 540. Brahmer JR, Drake CG, Wollner I, Powderly JD, Picus J, Sharfman WH, et al. Phase I Study of Single-Agent Anti\u2013Programmed Death-1 (MDX-1106) in Refractory Solid Tumors: Safety, Clinical Activity, Pharmacodynamics, and Immunologic Correlates. Journal of Clinical Oncology. 2010;28(19):3167-75. 541. Ihle CL, Provera MD, Straign DM, Smith EE, Edgerton SM, Van Bokhoven A, et al. Distinct tumor microenvironments of lytic and blastic bone metastases in prostate cancer patients. Journal for ImmunoTherapy of Cancer. 2019;7(1):293.    159 542. Benkhart EM, Siedlar M, Wedel A, Werner T, Ziegler-Heitbrock HWL. Role of Stat3 in Lipopolysaccharide-Induced IL-10 Gene Expression. The Journal of Immunology. 2000;165(3):1612-7. 543. Jiang X, Wang J, Deng X, Xiong F, Ge J, Xiang B, et al. Role of the tumor microenvironment in PD-L1\/PD-1-mediated tumor immune escape. Molecular cancer. 2019;18(1):10-7. 544. Jazurek M, Ciesiolka A, Starega-Roslan J, Bilinska K, Krzyzosiak WJ. Identifying proteins that bind to specific RNAs - focus on simple repeat expansion diseases. Nucleic acids research. 2016;44(19):9050-70. 545. Li H, Chen W, Zhou Y, Abidi P, Sharpe O, Robinson WH, et al. Identification of mRNA binding proteins that regulate the stability of LDL receptor mRNA through AU-rich elements. Journal of lipid research. 2009;50(5):820-31. 546. Denti L, Rizzi R, Beretta S, Vedova GD, Previtali M, Bonizzoni P. ASGAL: aligning RNA-Seq data to a splicing graph to detect novel alternative splicing events. BMC Bioinformatics. 2018;19(1):1-21. 547. Lor\u00e9n V, Cabr\u00e9 E, Ojanguren I, Dom\u00e8nech E, Pedrosa E, Garc\u00eda-Jaraquemada A, et al. Interleukin-10 Enhances the Intestinal Epithelial Barrier in the Presence of Corticosteroids through p38 MAPK Activity in Caco-2 Monolayers: A Possible Mechanism for Steroid Responsiveness in Ulcerative Colitis. PloS one. 2015;10(6):e0130921. 548. Srisodsai A, Kurotani R, Chiba Y, Sheikh F, Young HA, Donnelly RP, et al. Interleukin-10 Induces Uteroglobin-related Protein (UGRP) 1 Gene Expression in Lung Epithelial Cells through Homeodomain Transcription Factor T\/EBP\/NKX2.1. Journal of Biological Chemistry. 2004;279(52):54358-68. 549. Hsu T-I, Wang Y-C, Hung C-Y, Yu C-H, Su W-C, Chang W-C, et al. Positive feedback regulation between IL10 and EGFR promotes lung cancer formation. Oncotarget. 2016;7(15):20840. 550. Blumert C, Kalkhof S, Brocke-Heidrich K, Kohajda T, von Bergen M, Horn F. Analysis of the STAT3 interactome using in-situ biotinylation and SILAC. Journal of Proteomics. 2013;94:370-86. 551. Kim M, Kim H, Kim E, Woo D-H, Shin J, Shin Y, et al. Phosphorylation of EZH2 Activates STAT3 Signaling via STAT3 Methylation and Promotes Tumorigenicity of Glioblastoma Stem-like Cells. Cancer Cell. 2013;23(6):839-52. 552. Pan Y-M, Wang C-G, Zhu M, Xing R, Cui J-T, Li W-M, et al. STAT3 signaling drives EZH2 transcriptional activation and mediates poor prognosis in gastric cancer. Molecular cancer. 2016;15(1):79. 553. Lee H, Zhang P, Herrmann A, Yang C, Xin H, Wang Z, et al. Acetylated STAT3 is crucial for methylation of tumor-suppressor gene promoters and inhibition by resveratrol results in demethylation. Proc Natl Acad Sci U S A. 2012;109(20):7765-9. 554. Li J, Cui G, Sun L, Wang SJ, Li YL, Meng YG, et al. STAT3 acetylation-induced promoter methylation is associated with downregulation of the ARHI tumor-suppressor gene in ovarian cancer. Oncol Rep. 2013;30(1):165-70. 555. Luan B, Yoon Y-S, Lay JL, Kaestner KH, Hedrick S, Montminy M. CREB pathway links PGE2 signaling with macrophage polarization. Proceedings of the National Academy of Sciences of the United States of America. 2015;112(51):15642-7.    160 556. Na YR, Jung D, Yoon BR, Lee WW, Seok SH. Endogenous prostaglandin E2 potentiates anti\u2010inflammatory phenotype of macrophage through the CREB\u2010C\/EBP\u2010\u03b2 cascade. European Journal of Immunology. 2015;45(9):2661-71. 557. Naing A, Papadopoulos KP, Autio KA, Ott PA, Patel MR, Wong DJ, et al. Safety, Antitumor Activity, and Immune Activation of Pegylated Recombinant Human Interleukin-10 (AM0010) in Patients With Advanced Solid Tumors. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2016;34(29):3562-9. 558. Naing A, Infante JR, Papadopoulos KP, Chan IH, Shen C, Ratti NP, et al. PEGylated IL-10 (Pegilodecakin) Induces Systemic Immune Activation, CD8+ T Cell Invigoration and Polyclonal T Cell Expansion in Cancer Patients. Cancer Cell. 2018;34(5):775-91.e3.                   ","type":"literal","lang":"en"}],"http:\/\/www.europeana.eu\/schemas\/edm\/hasType":[{"value":"Thesis\/Dissertation","type":"literal","lang":"en"}],"http:\/\/vivoweb.org\/ontology\/core#dateIssued":[{"value":"2020-11","type":"literal","lang":"en"}],"http:\/\/www.europeana.eu\/schemas\/edm\/isShownAt":[{"value":"10.14288\/1.0392684","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/language":[{"value":"eng","type":"literal","lang":"en"}],"https:\/\/open.library.ubc.ca\/terms#degreeDiscipline":[{"value":"Experimental Medicine","type":"literal","lang":"en"}],"http:\/\/www.europeana.eu\/schemas\/edm\/provider":[{"value":"Vancouver : University of British Columbia Library","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/publisher":[{"value":"University of British Columbia","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/rights":[{"value":"Attribution-NonCommercial-NoDerivatives 4.0 International","type":"literal","lang":"*"}],"https:\/\/open.library.ubc.ca\/terms#rightsURI":[{"value":"http:\/\/creativecommons.org\/licenses\/by-nc-nd\/4.0\/","type":"literal","lang":"*"}],"https:\/\/open.library.ubc.ca\/terms#scholarLevel":[{"value":"Graduate","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/title":[{"value":"The effect of Interleukin-10 on macrophage activation and prostate cancer cell phenotype","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/type":[{"value":"Text","type":"literal","lang":"en"}],"https:\/\/open.library.ubc.ca\/terms#identifierURI":[{"value":"http:\/\/hdl.handle.net\/2429\/75412","type":"literal","lang":"en"}]}}