{"http:\/\/dx.doi.org\/10.14288\/1.0167104":{"http:\/\/vivoweb.org\/ontology\/core#departmentOrSchool":[{"value":"Medicine, Faculty of","type":"literal","lang":"en"},{"value":"Medicine, Department of","type":"literal","lang":"en"}],"http:\/\/www.europeana.eu\/schemas\/edm\/dataProvider":[{"value":"DSpace","type":"literal","lang":"en"}],"https:\/\/open.library.ubc.ca\/terms#degreeCampus":[{"value":"UBCV","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/creator":[{"value":"Gold, Matthew Joshua","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/issued":[{"value":"2015-07-31T00:00:00Z","type":"literal","lang":"en"},{"value":"2015","type":"literal","lang":"en"}],"http:\/\/vivoweb.org\/ontology\/core#relatedDegree":[{"value":"Doctor of Philosophy - PhD","type":"literal","lang":"en"}],"https:\/\/open.library.ubc.ca\/terms#degreeGrantor":[{"value":"University of British Columbia","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/description":[{"value":"Mucosal surfaces present an important barrier between the host and environment.  Maintenance of barrier function requires intricate cross-talk between a diverse array of immune cells and the epithelia, acting synergistically to respond to harmful antigens and maintain tolerance to innocuous antigens.  In this thesis I utilized an array of transgenic animals to explore the cellular and molecular mechanisms that initiate adaptive immune responses in the lung and gut mucosa.\n\nRecently, innate lymphoid cells have been characterized for their role in maintaining barrier immunity. Group 2 innate lymphoid cells (ILC2s) colonize the lung and provide a rapid source of IL-5 and IL-13 in a T and B cell independent manner in response to protease antigens.  Using ILC2-deficient mice, I examined the role of these cells in mucosal inflammation using mouse models of allergic asthma and hypersensitivity pneumonitis (HP).  ILC2s were critical in initiation of a Th2 response to locally, but not systemically delivered allergens and were completely dispensable for Th1 and Th17 dependent responses. \n\nThe PI3K pathway plays an important role in regulating leukocyte activation, survival, migration and cytokine release.  It is negatively regulated by the lipid phosphatase Ship1, and Ship1-\/- mice develop a wide array of hematological disorders leading to a reduced lifespan.  The severe phenotype associated with loss of Ship1 throughout the immune systems masks subtler roles it plays in specific leukocyte subsets.  Using a conditional deletion approach, I examined the role of Ship1 in T cells, B cells and dendritic cells (DCs) in mouse models of allergic asthma and helminth infection.  While loss of Ship1 in B cells did not influence susceptibility to a HDM model of allergic asthma, loss of Ship1 in either the T cells or DCs protected from disease development due to an immune skewing to a Th1 response.  Additionally, loss of Ship1 in DCs rendered mice susceptible to infection with the intestinal helminth Trichuris muris, further highlighting this Th1 immune skewing.","type":"literal","lang":"en"}],"http:\/\/www.europeana.eu\/schemas\/edm\/aggregatedCHO":[{"value":"https:\/\/circle.library.ubc.ca\/rest\/handle\/2429\/51891?expand=metadata","type":"literal","lang":"en"}],"http:\/\/www.w3.org\/2009\/08\/skos-reference\/skos.html#note":[{"value":"ROLE OF GROUP 2 INNATE LYMPHOID CELLS AND SHIP-1 IN MUCOSAL IMMUNITY  by Matthew Joshua Gold B.Sc., McGill University, 2007   A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES  (Experimental Medicine)   THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)   January 2015  \u00a9 Matthew Joshua Gold, 2015  ii Abstract Mucosal surfaces present an important barrier between the host and environment.  Maintenance of barrier function requires intricate cross-talk between a diverse array of immune cells and the epithelia, acting synergistically to respond to harmful antigens and maintain tolerance to innocuous antigens.  In this thesis I utilized an array of transgenic animals to explore the cellular and molecular mechanisms that initiate adaptive immune responses in the lung and gut mucosa.  Recently, innate lymphoid cells have been characterized for their role in maintaining barrier immunity. Group 2 innate lymphoid cells (ILC2s) colonize the lung and provide a rapid source of IL-5 and IL-13 in a T and B cell independent manner in response to protease antigens.  Using ILC2-deficient mice, I examined the role of these cells in mucosal inflammation using mouse models of allergic asthma and hypersensitivity pneumonitis (HP).  ILC2s were critical in initiation of a Th2 response to locally, but not systemically delivered allergens and were completely dispensable for Th1 and Th17 dependent responses.   The PI3K pathway plays an important role in regulating leukocyte activation, survival, migration and cytokine release.  It is negatively regulated by the lipid phosphatase Ship1, and Ship1-\/- mice develop a wide array of hematological disorders leading to a reduced lifespan.  The severe phenotype associated with loss of Ship1 throughout the immune systems masks subtler roles it plays in specific leukocyte subsets.  Using a conditional deletion approach, I examined the role of  iii Ship1 in T cells, B cells and dendritic cells (DCs) in mouse models of allergic asthma and helminth infection.  While loss of Ship1 in B cells did not influence susceptibility to a HDM model of allergic asthma, loss of Ship1 in either the T cells or DCs protected from disease development due to an immune skewing to a Th1 response.  Additionally, loss of Ship1 in DCs rendered mice susceptible to infection with the intestinal helminth Trichuris muris, further highlighting this Th1 immune skewing.    iv Preface A version of Chapter 2 has been published: Gold MJ, Antignano F, Halim TY, Hirota JA, Blanchet MR, Zaph C, Takei F, McNagny KM.  Group 2 innate lymphoid cells facilitate sensitization to local, but not systemic, TH2-inducing allergen exposures.  Journal of Allergy and Clinical Immunology. 2014 Apr;133(4):1142-8, with permission from Elsevier.  I designed and conducted 80% of experiments and wrote the manuscript.  Dr. Frann Antignano conducted 10% of the experiments.  Dr. Timotheus Halim conducted 10% of the experiments and provided figures 1A-C and 2G.  Dr. Jeremy Hirota provided intellectual content.  Dr. Marie-Renee Blanchet provided the SR antigen and intellectual content.  Dr. Colby Zaph provided intellectual content.  Dr. Fumio Takei provided intellectual content.  Dr. Kelly McNagny designed experiments and edited the manuscript.  A version of Chapter 3 has been submitted for publication: Gold MJ, Hughes MR, Antignano F, Zaph C and McNagny KM.  Lineage specific role of Ship1 in regulating allergic airway inflammation.  I designed and conducted 90% of experiments and wrote the manuscript.  Dr. Michael Hughes provided intellectual content.  Dr. Frann Antignano designed and conducted 10% of the experiments, provided intellectual content and wrote the manuscript.  Dr. Colby Zaph provided intellectual content.  Dr. Kelly McNagny designed the experiments and wrote the manuscript.  The work presented in this thesis was approved by the UBC Animal Care Committee, certificate numbers; A06-1483, A11-0096 and A13-0010.  v Table of Contents Abstract ............................................................................................................... ii\t \u00a0Preface ................................................................................................................ iv\t \u00a0Table of Contents ................................................................................................ v\t \u00a0List of Tables .................................................................................................... viii\t \u00a0List of Figures .................................................................................................... ix\t \u00a0List of Abbreviations ......................................................................................... xi\t \u00a0Acknowledgements ......................................................................................... xiii\t \u00a0Dedication ......................................................................................................... xiv\t \u00a0Chapter 1.\t \u00a0 Introduction .................................................................................... 1\t \u00a01.1\t \u00a0 The immune system ....................................................................................... 2\t \u00a01.2\t \u00a0 Innate lymphoid cells (ILCs) ........................................................................... 6\t \u00a01.2.1\t \u00a0 Group 2 innate lymphoid cells ....................................................................... 8\t \u00a01.2.2\t \u00a0 ILC2 development ......................................................................................... 9\t \u00a01.2.3\t \u00a0 ROR\u03b1 and ILC2 development ..................................................................... 10\t \u00a01.2.4\t \u00a0 ILC2s in lung immunity ................................................................................ 11\t \u00a01.3\t \u00a0 Dendritic cells in lung immunity .................................................................... 12\t \u00a01.4\t \u00a0 PI3K pathway ............................................................................................... 14\t \u00a01.4.1\t \u00a0 PI3K signaling ............................................................................................. 15\t \u00a01.4.2\t \u00a0 PI3K in inflammation ................................................................................... 18\t \u00a01.4.3\t \u00a0 SHIP-1 and negative regulation of PI3K ...................................................... 19\t \u00a01.4.4\t \u00a0 SHIP-1 in B, T and dendritic cell function .................................................... 22\t \u00a01.5\t \u00a0 Mucosal immunity ......................................................................................... 23\t \u00a01.5.1\t \u00a0 Allergic airway inflammation ........................................................................ 24\t \u00a01.5.2\t \u00a0 Intestinal helminth infection ......................................................................... 27\t \u00a01.6\t \u00a0 Summary ...................................................................................................... 28\t \u00a0Chapter 2.\t \u00a0 Group 2 innate lymphoid cells facilitate sensitization to local but not systemic Th2-inducing allergen exposures ...................................... 30\t \u00a02.1\t \u00a0 Introduction ................................................................................................... 31\t \u00a02.2\t \u00a0 Methods ........................................................................................................ 33\t \u00a02.2.1\t \u00a0 Mice and bone marrow transplantation ....................................................... 33\t \u00a02.2.2\t \u00a0 Antibodies and flow cytometry ..................................................................... 33\t \u00a02.2.3\t \u00a0 In vitro T cell polarization ............................................................................. 34\t \u00a02.2.4\t \u00a0 Lung explant culture .................................................................................... 35\t \u00a02.2.5\t \u00a0 Induction and assessment of allergic airway inflammation .......................... 35\t \u00a02.2.6\t \u00a0 Detection of antigen-specific IgG1, IgG2a and IgE ........................................ 36\t \u00a02.2.7\t \u00a0 Immune analysis .......................................................................................... 37\t \u00a02.2.8\t \u00a0 RNA isolation and quantitative RT-PCR ...................................................... 37\t \u00a02.2.9\t \u00a0 Histology ...................................................................................................... 37\t \u00a02.2.10\t \u00a0 Statistics .................................................................................................... 38\t \u00a02.3\t \u00a0 Results .......................................................................................................... 40\t \u00a0 vi 2.3.1\t \u00a0 HDM induces lung ILC2 activation and IL-5 secretion ................................. 40\t \u00a02.3.2\t \u00a0 ILC2s facilitate HDM-induced allergic airway inflammation ......................... 41\t \u00a02.3.3\t \u00a0 ILC2s are dispensable for the development of Th2 responses to systemically delivered antigens ................................................................................................... 45\t \u00a02.3.4\t \u00a0 Systemic delivery of antigens without adjuvant elicits ILC2-independent Th2-response .................................................................................................................. 46\t \u00a02.3.5\t \u00a0 ILC2s are dispensable for local priming of Th1\/Th17 responses ................ 47\t \u00a02.4\t \u00a0 Discussion .................................................................................................... 49\t \u00a0Chapter 3.\t \u00a0 Lineage-specific regulation of allergic airway inflammation by the lipid phosphatase SHIP-1 .......................................................................... 54\t \u00a03.1\t \u00a0 Introduction ................................................................................................... 55\t \u00a03.2\t \u00a0 Methods ........................................................................................................ 56\t \u00a03.2.1\t \u00a0 Mice ............................................................................................................. 56\t \u00a03.2.2\t \u00a0 Histology ...................................................................................................... 57\t \u00a03.2.3\t \u00a0 HDM-induced allergic airway disease ......................................................... 57\t \u00a03.2.4\t \u00a0 Flow cytometry ............................................................................................ 57\t \u00a03.2.5\t \u00a0 RNA isolation and quantitative RT-PCR ...................................................... 58\t \u00a03.2.6\t \u00a0 Detection of serum IgE, IgG1 and IgG2a ....................................................... 59\t \u00a03.2.7\t \u00a0 Immune analysis .......................................................................................... 59\t \u00a03.2.8\t \u00a0 In vivo DC migration .................................................................................... 59\t \u00a03.2.9\t \u00a0 OT-II adoptive transfer ................................................................................. 60\t \u00a03.2.10\t \u00a0 Measurement of airway resistance ............................................................ 60\t \u00a03.2.11\t \u00a0 DC culture and adoptive transfer ............................................................... 60\t \u00a03.2.12\t \u00a0 Statistics .................................................................................................... 61\t \u00a03.3\t \u00a0 Results .......................................................................................................... 61\t \u00a03.3.1\t \u00a0 Lineage-specific deletion of Ship1 fails to induce spontaneous lung inflammation ............................................................................................................ 61\t \u00a03.3.2\t \u00a0 B cell specific deletion of Ship1 has no effect on progression of AAI .......... 62\t \u00a03.3.3\t \u00a0 T cell specific deletion of Ship1 leads to a Th1-biased response and protection from AAI .................................................................................................. 65\t \u00a03.3.4\t \u00a0 Dendritic cell specific deletion of Ship1 protects from AAI .......................... 68\t \u00a03.3.5\t \u00a0 Ship1-deficient DCs preferentially prime Th1, versus Th2, responses in vivo in response to HDM-exposure ................................................................................. 71\t \u00a03.3.6\t \u00a0 Ship1-deficient DCs induce Th2 polarization in vitro and in vivo ................. 74\t \u00a03.4\t \u00a0 Discussion .................................................................................................... 76\t \u00a0Chapter 4.\t \u00a0 Dendritic cell expression of Ship1 regulates immunity to helminth infection ............................................................................................. 79\t \u00a04.1\t \u00a0 Introduction ................................................................................................... 80\t \u00a04.2\t \u00a0 Methods ........................................................................................................ 82\t \u00a04.2.1\t \u00a0 Mice ............................................................................................................. 82\t \u00a04.2.2\t \u00a0 Spleen and peripheral blood leukocyte analysis ......................................... 82\t \u00a04.2.3\t \u00a0 T. muris infection ......................................................................................... 83\t \u00a04.2.4\t \u00a0 Histology ...................................................................................................... 83\t \u00a04.2.5\t \u00a0 Immune response ........................................................................................ 83\t \u00a04.2.6\t \u00a0 Flow cytometry ............................................................................................ 84\t \u00a04.2.7\t \u00a0 RNA isolation and qPCR ............................................................................. 84\t \u00a04.2.8\t \u00a0 In vivo antibody treatment ........................................................................... 85\t \u00a0 vii 4.2.9\t \u00a0 Statistics ...................................................................................................... 85\t \u00a04.3\t \u00a0 Results .......................................................................................................... 85\t \u00a04.3.1\t \u00a0 DC specific deletion of Ship1 results in splenomegaly and expansion of circulating DCs ........................................................................................................ 85\t \u00a04.3.2\t \u00a0 Ship1\u0394DC mice are susceptible to Trichuris muris infection .......................... 86\t \u00a04.3.3\t \u00a0 DC expression of Ship1 facilitates Th2 dependent immunity following Trichuris infection .................................................................................................... 89\t \u00a04.3.4\t \u00a0 Neutralization of IL-12p40 in Trichuris-infected Ship1\u0394DC mice promotes resistance ................................................................................................................ 91\t \u00a04.4\t \u00a0 Discussion .................................................................................................... 93\t \u00a0Chapter 5.\t \u00a0 Discussion .................................................................................... 96\t \u00a05.1\t \u00a0 Summary ...................................................................................................... 97\t \u00a05.2\t \u00a0 Future directions ......................................................................................... 103\t \u00a0References ...................................................................................................... 106\t \u00a0Appendices ...................................................................................................... 129\t \u00a0Appendix 1 Publications arising from my PhD work ............................................ 130\t \u00a0Appendix 2 Bronchoalveolar lavage leukocyte enumeration and differentiation . 133\t \u00a0\t \u00a0  viii List of Tables Table 2.1. Primer list ....................................................................................................... 39\t \u00a0Table 3.1. Primer list ....................................................................................................... 58\t \u00a0Table 4.1. Primer list ....................................................................................................... 84\t \u00a0 ix List of Figures Figure 1.1. T helper cell differentiation .............................................................................. 6\t \u00a0Figure 1.2. Innate lymphoid cell development ................................................................... 8\t \u00a0Figure 1.3. PI3K pathway ................................................................................................ 17\t \u00a0Figure 1.4. SHIP-1 structure ........................................................................................... 20\t \u00a0Figure 1.5. Cre-loxP system ............................................................................................ 21\t \u00a0Figure 1.6. HDM allergic sensitization ............................................................................. 26\t \u00a0Figure 2.1. HDM induces lung ILC2 production of IL-5 ................................................... 41\t \u00a0Figure 2.2. Reduced lung ILC2s in Rorasg\/sg BMT Mice .................................................. 42\t \u00a0Figure 2.3. ROR\u03b1 expression profile and function in TH2 polarization ............................ 43\t \u00a0Figure 2.4. HDM-induced AAI in WT and ILC2-deficient mice ........................................ 44\t \u00a0Figure 2.5. Airway inflammation in HDM-exposed WT and ILC2-deficient mice ............. 45\t \u00a0Figure 2.6. OVA\/alum-induced AAI in WT and ILC2-deficient mice ................................ 46\t \u00a0Figure 2.7. OVA-induced AAI in WT and ILC2-deficient mice ......................................... 47\t \u00a0Figure 2.8. S rectivirgula (SR)-induced HP in WT and ILC2-deficient mice .................... 48\t \u00a0Figure 2.9. Model for ILC2 function in lung inflammation ................................................ 53\t \u00a0Figure 3.1. Lineage specific deletion of Ship1 does not result in spontaneous lung inflammation .................................................................................................................... 62\t \u00a0Figure 3.2. B cell expression of Ship1 does not influence HDM-induced AAI ................. 65\t \u00a0Figure 3.3. T cell expression of Ship1 restricts Th1 adaptive responses to HDM ........... 68\t \u00a0Figure 3.4. Loss of Ship1 in DCs protects from development of HDM-induced AAI ....... 70\t \u00a0Figure 3.5. DC expressed Ship1 facilitates Th2 sensitization to HDM ............................ 72\t \u00a0Figure 3.6. Lung inflammation and mucus production in Ship1\u0394DC mice ......................... 73\t \u00a0Figure 3.7. Reduced airway hyperresponsiveness in HDM exposed Ship1\u0394DC mice ...... 74\t \u00a0Figure 3.8. Ship1-deficient DCs induce Th1 polarization in vitro and in vivo to HDM ..... 75\t \u00a0Figure 4.1. Ship1\u0394DC mice have enlarged spleens and increased circulating DCs ......... 86\t \u00a0Figure 4.2. Dendritic cell expression of Ship1 is required for immunity to Trichuris infection ........................................................................................................................... 88\t \u00a0Figure 4.3. Dendritic cell expression of Ship1 facilitates Th2 polarization following Trichuris infection ............................................................................................................ 90\t \u00a0Figure 4.4. Neutralization of IL-12 in Trichuris-infected Ship1\u0394DC mice facilitates  x immunity to infection ....................................................................................................... 92\t \u00a0                       xi List of Abbreviations AAI AHR BAL allergic airway inflammation airway hyperresponsiveness bronchoalveolar lavage BCR BMT CHILP CILP CLP DC ELISA FACS FBS fMLP GPCR H&E HDM HSC ICOS Id2 i.n. i.p. i.v. IFN Ig IL ILC Lin LTi MHC MTG NCR OVA PAS PAMP PBS PH PI PI3K PMA PRR PTB PTEN PX qPCR B cell receptor bone marrow transplant common helper-like innate lymphoid progenitor common innate lymphoid progenitor common lymphoid progenitor dendritic cell enzyme linked immunosorbent assay fluorescence activated cell sorting fetal bovine serum formyl-methionyl-leucyl-phenylalanine G protein-coupled receptor hematoxylin and eosin house dust mite hematopoietic stem cell inducible co-stimulatory molecule inhibitor of DNA binding 2 intranasal injection intraperitoneal injection intravenous injection interferon immunoglobulin interleukin innate lymphoid cell lineage lymphoid tissue-inducer major histocompatibility complex monothioglycerol natural cytotoxicity triggering receptor ovalbumin periodic acid-Schiff pathogen associated molecular pattern phosphate buffered saline plekstrin homology phosphatidylinositol phosphatidylinositol-3 kinase phorbol 12-myristate 13-acetate pattern recognition receptor phosphotyrosine-binding domain phosphatase and tensin homolog phox homology quantitative PCR  xii ROR Sca-1 SH2 SHIP\/Inpp5d TCR Th TLR TNF TSLP WT retinoic acid receptor orphan receptor stem cell antigen 1 Src homology 2 domain Src homology 2-containing inositol 5\u2019-phosphatase T cell receptor T helper toll-like receptor tumor necrosis factor thymic stromal lymphopoietin wild-type    xiii Acknowledgements  First and foremost I\u2019d like to thank my supervisor, Dr. Kelly McNagny, for his incredible support and mentorship.  Many thanks to my supervisory committee members, Drs. Darryl Knight, Catherine Pallen, Colby Zaph, for their time, input and support.  I would also like to thank the many members of the McNagny lab, the BRC and the Jack Bell Research Centre for their training support and friendship, especially Dr. Marie-Renee Blanchet, Dr. Michael Hughes, Dr. Frann Antignano, Dr. Jami Bennett, Dr. Jamie Haddon, Dr. Steven Maltby, Dr. Erin Debruin, Kimberly Snyder, Bernard Lo, Dr. Sherie Duncan, Dr. Megan Himmel, Dr. Andrew Ming-Lum, Stef Cheah, Dr. Maziar Riazy and Dr. John Chen.  I would like to thank all of our collaborators, especially Drs. Fumio Takei, Tim Halim and Jeremy Hirota.  I would like to also thank the incredible staff at the BRC, especially Rupi Dhesi, Les Rollins, Taka Murakami, Helen Merkens, Andy Johnson, Justin Wong, Michael Williams, Krista Ranta, Wei Yuan and Mykola Prychyna.  Lastly, but most importantly, I would like to thank my parents and family for their incredible love and support.   xiv Dedication  This thesis is dedicated to my parents.   1 Chapter 1. Introduction                       2 1.1 The immune system  The immune system functions through a tightly orchestrated interactions between the epithelial (barrier), endothelial (vascular) and hematopoietic systems to both protect and elicit inflammatory responses to harmful pathogens, while promoting and maintaining tolerance to innocuous antigens, whether they arise from self antigens or environmental antigens.  Impaired regulation of these responses can result in autoimmune or allergic inflammation.  Vertebrates contain two arms of the immune system, innate and adaptive immunity.  Innate responses are more ancient and act as a first line of defense to an inflammatory insult.  Their recognition of antigens is largely through expression of pattern recognition receptors (PRR) that recognize pathogen associated molecular patterns (PAMPs), and do not require the re-arrangement of genes to form the more antigen specific receptor characteristic of the adaptive immune response[1].  Cellular constituents of the innate immune system include a physical barrier (such as the skin and mucosal surfaces), which acts to compartmentalize and separate the host from the environment, and should that be breached, leukocytes from the hematopoietic system that respond to the breach; macrophages, dendritic cells, neutrophils, basophils, mast cells, eosinophils and innate lymphoid cells (ILCs).  The main function of the innate response is to limit the extent of the inflammatory insult and train and facilitate the development of an adaptive immune response to eventually clear the infection.   3 The adaptive immune system consists predominantly of T and B lymphocytes and these are responsible for antigen-specific responses through unique T cell receptors (TCR) or B cell receptors (BCR), respectively.  The initial receptor repertoire is generated clonally through a variety of somatic combinatorial DNA rearrangements executed by recombination activating genes (RAG).  B cells represent the humoral arm of the adaptive immune response, with their main role being the production of antibodies against various pathogens.  T cells, in contrast, represent the cellular arm of adaptive immunity.  These can be subdivided into two main groups; CD8+ cytotoxic T cells (CTL) that directly kill infected cells and CD4+ helper T cells (Th) that facilitate cytotoxic T cell, B cell and innate immune cell activities through the release of various cytokines.  Cytokine production by these Th cells is not random and it was initially found that specific Th clones, termed T helper type 1 (Th1) and T helper type 2 (Th2), produced distinct cytokines[2].  Th1 clones were found to produce large amounts of the cytokine IFN\u03b3, important for macrophage activation and the clearance of intracellular bacteria, while Th2 clones produce the cytokines IL-4, IL-5 and IL-13, facilitating allergic responses or helminth immunity through increased mucus production, smooth muscle contraction, IgE production and eosinophil expansion[3, 4].  Several more subtypes have since been characterized, and it is unclear whether these cells are terminally differentiated or if there is some plasticity in their phenotype[5, 6].  Unlike the innate immune system, which responds broadly to conserved PAMPs expressed by various pathogens, the adaptive immune response is remarkably specific and permits the detection of antigen (Ag) specific epitopes through the diversity of their TCRs and BCRs.  This poses the challenge, however, of facilitating the exposure of these rare Ag- 4 specific T cells (approximately 5x10-6% of circulating lymphocytes, or 5 Ag-specific cells for every million circulating cells[7]) to the appropriate pathogen or antigen in a way that will facilitate their clonal expansion in time to respond to the invader. To overcome this challenge, the T cells are concentrated in lymphoid structures (such as lymph nodes, Peyer\u2019s patches, spleen), and specialized innate immune cells such as dendritic cells (DCs) are tasked with sampling Ag's from the periphery, processing these antigens for presentation of Ag-derived epitopes by major histocompatibility complex (MHC) cell surface proteins and transporting these cell bound epitopes to the lymphoid organs for presentation to na\u00efve T cells, to facilitate their clonal expansion[7, 8].  MHC proteins come in two forms, MHC class I molecules present peptides originating from intracellular (cytosolic) proteins to CD8+ T cells and MHC class II molecules present exogenous or extracellular proteins to CD4+ T cells[9].    While MHC class I is expressed on a broad array of cells, MHC class II (MHC-II) expression is more restricted, with dendritic cells acting as the predominant MHC-II expressing antigen presenting cell (APC).  A simplified model of DC-T cell interactions has DCs patrolling the periphery, sampling antigens and migrating to regional lymphoid structures, such as lymph nodes, where they can present these antigens to na\u00efve T cells (summarized in figure 1.1).  In addition to the initial signal of MHC-TCR interactions, DCs must also provide a second, co-stimulatory, signal to na\u00efve T cells through the interaction of molecules such as B7.1\/B7.2 (CD80\/CD86) on DCs with CD28 on T cells[10, 11].  Instructional cytokines are also released by DCs or accessory cells that promote the differentiation of na\u00efve CD4+ T cells to various \u201chelper\u201d lineages geared toward an  5 appropriate immune response, such as IL-12 for Th1 differentiation and IL-4 for Th2 differentiation[12].  A paradox is that, while DCs are known to produce IL-12 for Th1 differentiation [13], they are not known to produce IL-4, an important cytokine for Th2 polarization, although IL-4 and STAT6-independent mechanisms for Th2 polarization likely act in a complementary fashion[14-18].  This suggests that either na\u00efve CD4+ T cells can produce IL-4 to act in an autocrine or paracrine role in the absence of other instructional cytokines[19], or that there exists a bystander cell or another APC (other than DCs), can supply the IL-4 required for efficient Th2 polarization.  Candidate cells for such an accessory function include basophils[20-22], natural killer (NK) cells[23], eosinophils[24] or innate lymphoid cells (ILCs)[25, 26].  Despite this speculation, until recently, none of these candidate cell types have consistently proved sufficient to explain Th2 antigen polarization.  A greater understanding of the cell types and signaling pathways involved in the generation of a robust Th2 response is clearly required to facilitate the development of novel therapeutics for the treatment of allergic, or Th2-driven, diseases.   6  Figure 1.1. T helper cell differentiation Schematic of CD4+ T cell differentiation modified from O\u2019Shea JJ et al[5].  Dendritic cells acquire antigens and migrate through the lymphatics to the regional lymph node, where they present antigen epitopes in the context of MHC-II to na\u00efve CD4+ T cells.  MHC-II\/TCR interaction, along with co-stimulation between CD80\/CD86 and CD28 and instructional cytokines drive the differentiation and polarization of na\u00efve CD4+ T cells to various \u201chelper\u201d lineages.  These are associated with increased expression of specific transcription factors (T-bet, GATA-3, ROR\u03b3t) and the secretion of specialized cytokines.  1.2 Innate lymphoid cells (ILCs)  Innate lymphoid cells are a newly identified constellation of differentially regulated cell types arising from a common precursor that are now thought to be involved in the initial innate immune response and in tissue homeostasis.  The cardinal traits of ILC family members are; 1) a lack of lineage markers commonly used to denote committed myeloid and dendritic cell leukocytes (i.e. CD11b, CD11c, Gr-1), 2) an independence of Lymph&Node&CD4+&Tn& Th1&T2bet&IL212&IL24?&GATA23&Th2&IFN\u03b3&TNF\u03b1&IL24&IL25&IL213&ROR\u03b3t&Th17&IL217&IL222&IL26&TGF\u03b2&DendriFc&Cell&intracellular&bacteria&allergy&helminth&extracellular&parasites& 7 recombination activating gene (RAG) function for their development, 3) a lymphoid morphology and 4) a unique ability to produce the same immune-response-polarizing cytokines normally produced by adaptive immune cells.  A common nomenclature has been developed to classify distinct ILC subsets into 3 main groups based on similarity of the cytokine profiles produced by polarized T cells (ILC1s corresponding to Th1 cells, ILC2s corresponding to Th2 cells, etc.).  Specificity for production of these cytokines usually results from specific transcription factors associated with their survival (Figure 1.2)[27].  Group 1 ILCs comprise NK cells and ILC1s and are associated with expression of T-bet.  These cells are potent producers of IFN\u03b3, an important cytokine affecting macrophage activation and phagocytosis, and are associated with protection against intracellular bacteria[28-31].  Group 2 ILCs, or ILC2s, are dependent on the transcription factors GATA-3[32, 33], Gfi1[34], TCF-1[35] and ROR\u03b1[36, 37] and produce high levels of Th2-associated cytokines IL-5 and IL-13 in response to epithelial derived innate cytokines IL-25, IL-33 and TSLP.  These cells are enriched in the lung and intestinal mucosa and facilitate allergic responses and immunity to helminth infections.  Group 3 ILCs contain both lymphoid tissue-inducer cells (LTi) as well as IL-17A, IL-22 and IFN\u03b3 producing ILC3s and depend on the transcription factor ROR\u03b3t and are important for immunity to extracellular bacteria and parasites such as Citrobacter rodentium [38-40].   8  Figure 1.2. Innate lymphoid cell development Schematic of ILC development modified from Klose et al[31].  A common ILC progenitor (CHILP, Lineage-Id2+CD127+\u03b14\u03b27+CD25-) exists in the bone marrow that can give rise to all ILC lineages but not T or B cells or NK cells.  These CHILP can then differentiate into various helper-like ILCs that facilitate immunity to various pathogens.  Mulitpotent progenitor (MPP), common lymphoid progenitor (CLP), common innate lymphoid progenitor (CLP), natural killer cell (NK), common \u201chelper-like\u201d innate lymphoid progenitor (CHILP), inhibitor of DNA binding 2 (Id2).   1.2.1 Group 2 innate lymphoid cells  Innate lymphoid cells that secrete large amounts of cytokines associated with an adaptive Th2 response were initially discovered in the early 2000\u2019s as a lineage negative subset that responded to IL-25 to produce eosinophilia and IL-13[41, 42].  Later, multiple labs independently characterized similar cells in several peripheral tissues; in the mesenteric lymph nodes, spleen and liver they were termed innate helper type 2 cells (Ih2)[43], in fat associated lymphoid clusters (FALC) and lungs they were termed natural MPP#CLP#Ikaros#CILP#Id2.#NK#Id2.Eomes+#CHILP#Id2+#GATA.3+#ILC1#IFN\u03b3#TNF\u03b1#T.bet#ILC2#(IL.4)#IL.5#IL.13#GATA.3+#ROR\u03b1+#Allergy#&#Asthma#Helminth#Intracellular#Pathogens#ILC3#IL.17A#IL.22#IFN\u03b3#TNF\u03b1#ROR\u03b3t#Extracellular#bacteria#IntesQnal#immunity#LN#formaQon# 9 helper cells (NH)[44, 45] and in the lymph nodes, intestines and lungs they were termed nuocytes[46].  Collectively, these cells are now named group 2 innate lymphoid cells (ILC2s) based on their similar surface receptor expression profiles.  ILC2s are identified as lineage negative cells dependent on IL-7 for the development through expression of the IL-7R\u03b1 (CD127).  They express the inducible co-stimulatory molecule (ICOS), Thy1 (CD90), IL-2R\u03b1 (CD25) as well as receptors to IL-25 (IL-17RB), IL-33 (T1\/ST2) and thymic stromal lymphopoietin (TSLP, TSLPR), stimulation of which leads to robust production of IL-5 and IL-13.  1.2.2 ILC2 development  ILC2 progenitors are present in the bone marrow and arise from the common lymphoid progenitor (CLP, lineage-CD127+Flt3+), and require IL-7R\u03b1 signaling for their development[37].  ILC2s can be derived in vitro from CLPs through stimulation with Notch, IL-7 and IL-33[37].  There has been a concerted effort to identify committed ILC and ILC2 progenitors distinct from CLPs.  Development of all ILC lineages, but not T and B cells, was found to be dependent on the transcriptional regulator inhibitor of DNA binding 2 (Id2)[44], and recently a common helper-like innate lymphoid progenitor population (CHILP, lineage-Id2+CD25-\u03b14\u03b27+Flt3-CD127+) has been identified that gives rise to all ILCs, but not T cells, B cells or NK cells[31].  The transcription factor GATA-3 has also been found to be important for development of IL-7R\u03b1+ ILCs[47], and is required for ILC2 development and survival of mature ILC2s[32, 33].  GATA-3 is also expressed in mature Th2 cells, leading to the search for a unique transcription factor specific to ILC2s to distinguish them from Th2 cells.  Two  10 independent studies found the transcription factor RAR-related orphan receptor alpha (ROR\u03b1) to be specifically expressed on ILC2s but not Th2 cells, and disruption of ROR\u03b1 function leads to a selective loss of ILC2s[36, 37].    1.2.3 ROR\u03b1 and ILC2 development  The ROR family of transcription factors are orphan nuclear receptors containing both a ligand binding domain (LBD) and DNA binding domain (DBD) and consist of three family members: ROR\u03b1, ROR\u03b2 and ROR\u03b3[48].  ROR\u03b3 (encoded by Rorc) plays an important role in development of Th17 cells[49] as well as ILC3s and is important for lymph node organogenesis due to the dependence of LTi cells on expression of ROR\u03b3[50].  ROR\u03b1 is expressed in several tissues but its highest expression is in the brain, particularly the cerebellar Purkinje cells[51], where it plays an important role in their maturation.  A natural mutation in the ROR\u03b1 gene found in staggerer mice (Rorasg\/sg) results in deletion of the LBD and a truncated non-functional protein.  These staggerer mice exhibit severe developmental abnormalities and have a shortened life-span, predominantly resulting from a loss of ROR\u03b1 expression in the brain.  ROR\u03b1 expression in the hematopoietic compartment, however, is tightly regulated, with selective expression in Th17 cells, where it synergizes with its family member ROR\u03b3[52], and in ILC2s[36, 37].  Loss of ROR\u03b1 in the hematopoietic system has no effect on normal development and life span but leads to a selective loss of ILC2s and no obvious influence on the development of Th17-mediated inflammatory responses[53].  Thus, this provides a useful strategy for examining the effect of ILC2 deficiency in development of adaptive immune responses.  11  1.2.4 ILC2s in lung immunity  The lung mucosa is regularly exposed to inhaled antigens that stimulate the lung epithelium to produce IL-25, IL-33 and TSLP.  Lung resident ILC2s potently respond to this allergen-induced activation, and serve as an important linkage between the innate and adaptive immune response as they represent an early source of the type 2 cytokines IL-5 and IL-13 prior to the development of adaptive immunity[54].  IL-5 plays an important function in eosinophil biology, enhancing their survival, increasing eosinophilopoiesis in the bone marrow and facilitating their migration[55-57].  In allergic asthma, IL-5 and the resulting eosinophil dominated inflammation facilitate the development of airway hyper-responsiveness and lymphocyte infiltration[58].  Allergic airway inflammation also results in increased production of IL-13.  Although it shares a common receptor with IL-4, IL-13 stimulates mucus production and airway hyper-responsiveness in an IL-4 and IgE independent manner[59, 60].  It is unclear what role ILC2 produced IL-5 or IL-13 has in facilitating the development of Th2 adaptive immune responses.  Recent studies have suggested that IL-13 production by ILC2s is necessary and sufficient for developing a robust Th2 response[25].  This does not rule out a potentially important role for ILC2 produced IL-5, and the resulting influx in eosinophils, in modulating the adaptive immune response as eosinophils have previously been shown to promote dendritic cell maturation and the development of Th2 immunity[61].  There are also reports that ILC3s express MHC-II and can directly present antigen to T cells to influence T cell-mediated immune responses[62, 63].  ILC2s also express MHC-II, but whether these cells contribute to the  12 antigen presentation and adaptive immune response following allergic sensitization has yet to be evaluated[26].   In human subjects, ILC2s have been found in the skin[64], peripheral blood, gut and lungs [65, 66], and are enriched at sites of atopic skin inflammation[64], sputum of asthmatic patients[67] and nasal polyps of patients with rhinosinusitis[65], suggesting an important link between ILC2s and allergic disease, however their specific role in modulating the immune system is still unclear.  Further exploration into how ILC2s promote allergic responses, using mouse models deficient in ILC2s, will hopefully provide insight into the early stages of the development of type-2 adaptive immune response.  It should be noted, however, that while ILC2s may prove to be pathogenic in instances of allergy, they also possess important protective functions as well.  They\u2019re important for immunity from helminth infection, through the production of IL-13[46, 68], as well as from lung tissue injury in influenza viral infections through the production of several factors facilitating wound repair, including amphiregulin[66].  Novel targeting strategies can be imagined that promote or inhibit ILC2 activity for the treatment of a variety of diseases.     1.3 Dendritic cells in lung immunity  Dendritic cells (DCs) are a specialized leukocyte population that serves as the primary antigen presenting cell (APC) of the immune system.  They were originally identified in Nobel prize winning work by the late Dr. Ralph Steinman in both the spleen and lymph nodes in the early 1970\u2019s[69], but have since been found throughout the body, primarily at  13 barrier sites such as the skin and mucosal surfaces, where they constantly sample antigens.  Their ability to phagocytose and transport antigen from peripheral sites to regional lymph nodes is a specialized property not shared, to the same extent, by other innate immune cells, signifying the importance of DCs as vital APCs[70].  Indeed, in the lung, depletion of DCs severely impairs the development of Th2 responses, suggesting that at this mucosal site, DCs are the primary APC for initiating Th2 responses[71].  Additionally, following sensitization, DCs play an important pro-inflammatory role in allergic mice, and again, their depletion results in a reduction of airway hyperresponsiveness, mucus production and eosinophil infiltration, hallmarks of allergic asthma[72].    Dendritic cells exist as a heterogeneous population and are composed of multiple subsets with specialized functions[73].  The lung contains predominantly two distinct subsets at steady state, characterized by their expression of CD11b (integrin \u03b1M) or CD103 (integrin \u03b1E, a component of the E-Cadherin ligand \u03b1E\u03b27), in addition to the pan-DC and hematopoietic markers MHC-II and CD11c (integrin \u03b1X)[74].  These DC subsets are concentrated at distinct locations in the lung and have specialized functions.  CD103+ DCs are able to tightly associate with the lung epithelium through their interactions with E-cadherin and are primarily associated with cross-presentation of viral antigens to CD8+ T cells in the lymph node through MHC-I, as well as promoting T regulatory cell development[75-77].  CD11b+ DCs produce a wide array of pro-inflammatory mediators and specialize in MHC-II presentation to CD4+ T cells and are found in the lamina propria or perivascular regions of the lung[74, 78, 79]. Recent studies, using the physiologically relevant allergen house dust mite (HDM) have found that the CD11b+ DCs and an  14 inflammatory DC population that infiltrates the lung following HDM challenge, marked by the expression of the monocyte marker Ly6C and the high-affinity IgE receptor (Fc\u03b5RI), are the predominant DC subsets for the trafficking of HDM antigen to the draining lymph node and the priming of an adaptive Th2 response associated with allergic asthma[80].  Increasing our understanding of the signaling pathways and proteins involved in the trafficking and migration of DCs will lead to new therapeutic targets to modulate DC function for the treatment of allergic diseases.  1.4 PI3K pathway  Phosphoinositides are ubiquitously present on the inner cell membrane of many cell types and play important roles in numerous cellular functions, such as survival, migration and activation.  Due to this, the generation and hydrolyzation of these phosphoinositides is tightly regulated.  Phosphoinositide 3-kinases (PI3Ks) add a phosphate group to the 3\u2019-hydroxyl position of phosphatidylinositol (PtdIns), phosphatidylinositol(4)monophosphate (PtdIns[4]P1) and phosphatidylinositol(4,5)bisphosphate (PtdIns[4,5]P2), leading to the recruitment of proteins to the cell membrane through interactions with pleckstrin homology (PH)[81] and phox homology (PX)[82] domains, and a subsequent downstream signaling cascade (reviewed in [83-85]).   PI3Ks have been grouped into 3 classes, class I (consisting of IA and IB), class II and class III.  The class I PI3Ks are the most well studied and understood and are the only PI3K class able to produce the important second messenger PtdIns[3,4,5]P3 from the  15 substrate PtdIns[4,5]P2, suggesting a prominent role for this class in regulating cellular survival and activation.  Class II PI3Ks are act downstream of integrin, chemokine and some growth factor receptors and utilize PtdIns as their primary substrate producing PtdIns[3]P1[86] and class III PI3K are involved in protein and vesicle trafficking through the exclusive production of PtdIns[3]P.   Class I PI3Ks form as heterodimers containing a regulatory and catalytic subunit.  Class IA enzymes are activated by receptor tyrosine kinases (RTKs) and contain three different catalytic subunits (p110\u03b1, p110\u03b2 and p110\u03b4) and five different regulatory subunits (p85\u03b1, p55\u03b1, p50\u03b1, p85\u03b2 and p55\u03b3).  While p110\u03b1 and p110\u03b2 are more broadly expressed, p110\u03b4 is enriched in leukocytes[87].  Class IB enzymes associate with G-protein coupled receptors (GPCRs) and contain a single enzyme type consisting of the p110\u03b3 catalytic subunit and either the p101 or recently characterized p87 regulatory subunit[84, 88].  While more broadly distributed than p110\u03b4, p110\u03b3 is enriched in leukocytes[89].  Activation of receptor tyrosine kinases (IA) or through the G\u03b2\u03b3 subunits of GPCRs leads to the membrane accumulation of the cytosolic PI3Ks, resulting in localized accumulation of their main product, PtdIns[3,4,5]P3[90].  1.4.1 PI3K signaling  PI3K-induced production of PtdIns[3,4,5]P3 leads to the recruitment and activation of the Tec kinase family as well as the AGC family of serine\/threonine kinases, consisting of the phosphoinositide dependent kinase-1 (PDK-1), Akt (also referred to as PKB), protein  16 kinase C (PKC) and S6 kinase.  Akt is in part activated by PDK-1 through phosphorylation of its Thr308 site[91], although phosphorylation of Akt\u2019s Ser473 residue by the mammalian target of Rapamycin complex 2 (mTORC2) is required for maximal activity[92].  Activation of Akt results in the phosphorylation of its substrates, typically leading to activation, survival and proliferation (summarized in figure 1.3)[93-96].  Additionally, the accumulation of PI(3,4,5)P3 and PI(3,4)P2 at the leading edge of cells, predominantly through class IB activation of p110\u03b3 through GPCRs, is important for facilitating cytoskeletal reorganization, directional migration and motility[97, 98].   17  Figure 1.3. PI3K pathway Simplified schematic of activation of class IA and IB and generation of PI(3,4,5)P3.  Receptor tyrosine kinase (RTK, class IA) or G protein coupled receptor (GPCR, class IB) activation lead to activation of PI3k, which produce PI(3,4,5)P3 from the substrate PI(4,5)P2.  Newly formed PI(3,4,5)P3 acts as a second messenger, recruiting PH-domain containing proteins, such as Akt, leading to their activation and downstream effects on cellular survival and activation.  Levels of PI(3,4,5)P3, and in turn Akt activation, are tightly regulated by the inositol phosphatases PTEN (which hydrolyzes the 3\u2019-phosphate to generate PI(4,5)P2, and SHIP-1 and SHIP-2 (which hydrolyze the 5\u2019-phosphate to generate PI(3,4)P2.   PPp85%p110\u03b4%p110\u03b2%p110\u03b1%Class%IA%PI3Ks%!\u202f RTKs%!\u202f Immunoreceptors%!\u202f Growth%Factors%%%%%% %%%\u03b2#\u03b3#\u03b1i%%p110\u03b3% p101%Class%IB%PI3Ks%!\u202f GPCRs%!\u202f C5a,%CXCL1\/2\/12%!\u202f LTB4%%PIJ4,5JP2% PIJ3,4,5JP3% PIJ3,4JP2%PTEN% SHIPJ1\/2%Akt%Bcl!2#Bcl!xL#Bad#NF!\u03baB# p70S6#Immune%Cell%AcPvaPon%Survival%DirecPonal%MigraPon\/Phagocytosis% 18 1.4.2 PI3K in inflammation  Understanding the contribution of the PI3K pathway in leukocyte function is hampered by the overlapping expression of the various PI3K isoforms and the embryonic lethality associated with genetic ablation of p110\u03b1 and p110\u03b2[99-101].  While leukocytes express all class I PI3Ks, there is a preferential expression and enrichment of the p110\u03b4 and p110\u03b3 isoforms, leading to the use of genetic models and isoform-specific inhibitors to examine their roles in leukocyte function.  Genetic deletion of p110\u03b4 or the generation of a kinase dead mutant results in an impairment in B cell development and maturation in vivo, reduced serum antibody levels and a severely abrogated T cell-dependent and independent humoral response [102-104].  It is unclear, however, whether or not this observed defect in B cell function and germinal center (GC) development is due to a B cell intrinsic role for p110\u03b4 or an effect of p110\u03b4 loss on supporting leukocyte populations.  Recent reports using a conditional deletion approach have shown that it is p110\u03b4 expression in T cells, and not B cells, that is responsible for the loss of GCs due to a severe impairment of follicular helper T cells (TFH)[105].  TFH are a unique T cell population able to migrate to germinal centers through expression of CXCR5 where they can support the development and provide instructional cues to aid in B cell differentiation[106].  Deletion of p110\u03b3 has revealed important functions in neutrophil and macrophage function, particularly migration[98, 107]. Indeed, p110\u03b3-\/- (Pik3cg-\/-) mouse neutrophils displayed impaired polarization and migration to stimuli such as fMLP (N-formyl-methionyl-leucyl-phenylalanine)[98, 108].    19  The vital role PI3K isoforms play in inflammatory processes has lead to the development of isoform or dual-isoform specific inhibitors targeting p110\u03b4 and p110\u03b3 for the treatment of various diseases.  While these inhibitors have offered promising results in pre-clinical and early clinical trials, there is concern that targeting such a ubiquitous pathway could result in toxic side-effects[109].  1.4.3 SHIP-1 and negative regulation of PI3K  Levels of PI(3,4,5)P3 are tightly regulated and are maintained at low levels in un-stimulated cells.  While PI(3,4,5)P3 levels rise abruptly after stimulation and activation of PI3Ks, they are negatively regulated predominantly by two lipid phosphatases: PTEN (phosphatase and tensin homolog), which removes the 3\u2019-inositol phosphate and converts PI(3,4,5)P3 to PI(4,5)P2; and SHIP (SH2-containing inositol 5\u2019-phosphatase), which removes the 5\u2019-inositol phosphate converting PI(3,4,5)P3 to PI(3,4)P2.  SHIP occurs as two distinct gene products, SHIP-2 is more widely expressed while SHIP-1 expression is enriched in the hematopoietic compartment[110, 111].  Due to its restricted expression in leukocytes, SHIP-1 represents an interesting therapeutic target to regulate the PI3K pathway for the treatment of inflammatory diseases and cancer[112, 113].  Indeed, small molecule activators and inhibitors of SHIP-1 activity have been developed for the treatment of inflammatory diseases and cancer[113-117].   20 SHIP-1 was initially cloned in 1996 as a 145 kDa protein containing an N-terminal SH2 domain, a 5\u2019 phosphatase domain and a C-terminal proline rich region containing two NPXY motifs (figure 1.4)[118, 119].  Targeted disruption of SHIP-1 (Ship1-\/-) leads to mice that are viable, but suffer from severe hematological abnormalities including enhanced myelopoiesis and a myeloid infiltration in the lung that eventually leads to a reduced survival [120, 121].    Figure 1.4. SHIP-1 structure Simplified protein structure of SHIP-1, modified from Rohrschneider LR et al[118].  SHIP-1 contains an N-terminus SH2 domain, for interactions with phosphorylated tyrosine residues, a central phosphatase domain for removal of the 5\u2019 inositol phosphate, two NPXY motifs which may serve as binding sites for proteins containing PTB or SH2 domains, and a proline-rich C-terminus (PxxP motifs) that serve as potential interacting sites with SH3 domain containing proteins.  The reduced life-span of Ship1-\/- mice, and the severe pathologies associated with ubiquitous, constitutive deletion of Ship1 throughout the hematopoietic system likely masks subtle, but important functions of Ship1 in discreet leukocyte subsets and at distinct times in vivo.  To overcome this barrier, researchers have begun using targeted deletion of Ship1 in specific leukocytes via the Cre\/loxP genetic system[122, 123].  Consensus loxP sites were added within the Ship1 allele, and these mice have been crossed to mice expressing the SH2$ 5\u2019'Phosphatase$ Proline'rich$enzyma8c$domain$pY$interac8on$SH3$mo8fs$NPXY$ NPXY$H2N'$ 'COOH$PTB\/SH2$ 21 Cre recombinase under the control of various leukocyte specific promoters, allowing for the examination of the role of Ship1 in various specific leukocyte subsets (figure 1.5).   Figure 1.5. Cre-loxP system Transgenic mice are generated expressing Cre under the control of various inducible (Mx1, interferon inducible) or cell\/tissue specific promoters (i.e. Itgax for CD11c expressing dendritic cells, Cd4 for T cells, Cd19 for B cells).  Consensus loxP sites are added to flank segments of the target gene (\u201cflox\u201d), and are designed not disrupt or alter normal transcription.  Crossing the Cre-expressing (\u201cdeleter\u201d) mouse to mice with a floxed target gene result in the site-specific recombination of the loxP sites in cells or tissues expressing Cre, but untouched and normal target gene of expression in the remaining cell types.     Cre$Promoter$Promoter$specific$Cre$transgene$(i.e.$Itgax,$Cd4,$Cd19\u2026..)$X$ Ship1\/loxP\/ loxP\/\u201cFloxed\u201d$target$gene$F0$Genera?on$F1$Genera?on$Cre$Promoter$loxP\/loxP\/Target$gene$is$disrupted$in$cells$expressing$lineage$specific$promoter$Normal$expression$of$target$gene$in$cells$not$expressing$Cre$Ship1\/loxP\/ loxP\/ 22 1.4.4 SHIP-1 in B, T and dendritic cell function  SHIP-1 plays an important role in regulating B cell function, predominantly through its association with the inhibitory receptor Fc\u03b3RIIB and CD22 on B cells[124-126].  Germline deletion of Ship1 results in reduced frequencies of circulating B cells due to an overproduction of IL-6 by SHIP-1 deficient myeloid cells[127, 128].  Specific deletion of Ship1 in B cells has confirmed some of these phenotypes are due to an intrinsic role for SHIP-1 since these mice also develop increased isotype switching following immunizations but a failure to produce high affinity antibodies, although an influence of these low affinity antibodies in the progression of inflammatory diseases has not been explored[129].  SHIP-1 plays an important role in the negative regulation of T cell receptor (TCR) signaling through its association with downstream of kinase (Dok-1\/2)[130].  While Ship1-\/- mice have reduced circulating T cells, there is an increase in the frequency of T regulatory cells (Tregs) [131-133]. Surprisingly, however, mice with a lineage-specific deletion of Ship1 in T cells found no role for Ship1 in regulating TCR signal strength or the frequency of Tregs[134].  There was, however, an immune skewing towards Th1 responses at the expense of Th2 responses due to increased expression of T-bet in Ship1-deficient T cells[134].  Interestingly, deletion of Ship1 at earlier stages of T cell development, as well as in myeloid cells, does result in an increase in Treg numbers, suggesting both a lineage intrinsic and extrinsic role in controlling Treg numbers[135, 136].   23 Despite its well-known role regulating macrophage growth[137], phagocytosis[138, 139] and cytokine release[140], the role of SHIP-1 in regulating dendritic cell function, and its significance in vivo, has largely been ignored.  SHIP-1 restricts the proliferation or survival of bone marrow derived dendritic cells in response to granulocyte macrophage colony stimulating factor (GM-CSF) or fms-like tyrosine kinase 3 ligand (Flt3L)[141, 142].  SHIP-1 also facilitates the maturation of DCs following stimulation with various TLR ligands, and SHIP-1 deficient DCs have an impaired ability to promote antigen specific T cell proliferation and Th1 responses, due to reduced IL-12 secretion.  The role of SHIP-1 activity in DC function in vivo, however, has yet to be explored.   1.5 Mucosal immunity Mucosal surfaces, predominantly in the lung and gut, represent a large interface site between the host and environment that, while allowing gas and nutrient exchange, are continuously exposed to various bacterial, viral and fungal antigens[143].  To overcome this challenge, the mucosal surfaces play host to a highly specialized and tightly regulated immune system, composed of the epithelial barrier itself, innate lymphoid cells (ILCs), dendritic cells, T and B lymphocytes, mast cells, eosinophils and others.  These  cells must coordinate their functions and maintain a delicate balance between inflammation (responsiveness) and tolerance (non-responsiveness).  Key mediators of these responses are CD4+ T cells, which can differentiate into a wide array of helper subtypes and a plethora of immune-modulatory cytokines.  T-helper 2 cells produce large amounts of IL-4, IL-5 and IL-13, promoting class switching to IgE, eosinophilia, mucus production, epithelial cell turnover and smooth muscle expansion and contraction.  While these responses are  24 beneficial when exposed to harmful pathogens, such as intestinal helminth infections, inappropriate mucosal Th2 responses are associated with allergy and asthma.  A greater understanding of the cell types and mechanisms involved in is needed to facilitate therapeutic manipulation of adaptive immune responses at mucosal sites.  1.5.1 Allergic airway inflammation  Allergic asthma is a chronic inflammatory disease of the lung typically affecting the main conducting airways.  It is characterized immunologically by a Th2 biased immune response, increased mucus production and eosinophil infiltrate into the lung and airways.  Physiologically it is characterized by reversible airflow obstruction, or airway hyperresponsiveness (AHR), caused by an expansion of the airway smooth muscle (ASM) surrounding the bronchi[144].  Allergic asthma represents a large socioeconomic burden, and currently affects approximately 8.5% of the population and up to 13% of children[145].  In the United States, this results in an annual economic burden of up to $56 billion, comprising direct health care costs and costs associated with loss of work and economic activity[146].  Therapeutic options have remained mostly unchanged since the 1970\u2019s, with inhaled corticosteroids, to dampen inflammation, and long-acting \u03b2-agonists, to induce smooth muscle relaxation, being the mainstay drugs used today[147].  There are subsets of patients with severe asthma that do not respond to the current therapeutic options, requiring new research to uncover new therapeutic targets.     25 Mouse models have been key in evaluating the cell types and molecular pathways involved in allergic inflammation.  Early studies used chicken ovalbumin (OVA) as a model antigen, sensitizing animals by adsorbing OVA to the Th2 inducing adjuvant alum and delivering the OVA\/alum complex intraperitoneally.  Mice are then challenged through the intranasal exposure of OVA, eliciting airway eosinophilia, a Th2-biased immune response and airway hyperresponsiveness, all hallmarks of allergic asthma.  This model has uncovered important roles for numerous cell types, such as B and T cells[148], mast cells[149] and eosinophils[150], as well as numerous cytokines, such as IL-4[151] and IL-13[152] in the pathogenesis of allergic asthma.  While the OVA model has been useful for uncovering important therapeutic targets, it does not represent a physiologically relevant model of allergic disease due to the route of administration (intraperitoneal systemic delivery versus inhaled sensitization in the lung) and the requirement for an artificial adjuvant like alum to elicit an inflammatory response.  Up to 85% of asthmatic patients respond to house dust mite (HDM), a common household allergen, and animal models utilizing HDM as the inducing allergen are gaining in popularity as a more physiologically relevant model of allergic asthma.  Intranasal exposure and sensitization results in an epithelial barrier breach and epithelial release of innate cytokines such as IL-25, IL-33 and TSLP in a TLR-4 dependent manner[153-155].  These released cytokines stimulate resident innate immune cells, leading to an inflammatory cascade that primes the lung dendritic cells to transport antigen to the draining lymph node for antigen presentation to na\u00efve CD4+ T cells and development of a Th2 adaptive immune response (figure 1.6).  This HDM model of allergic asthma has replaced the OVA model as the gold  26 standard for uncovering the roles of various cell types and mediators in the pathogenesis of allergic asthma.   Figure 1.6. HDM allergic sensitization Localized delivery of common allergens (derived from house dust mites, cockroaches, cats) results in an epithelial barrier breach and release of innate inflammatory mediators such as IL-25, IL-33 and TSLP.  These act on lung resident innate immune cells, such as ILC2s, to promote DC activation and migration to the draining lymph node, where antigen presentation can efficiently occur leading to the development of an adaptive immune response.   Hypersensitivity pneumonitis (HP) is another chronic inflammatory lung disease, and while it is less prevalent than allergic asthma its incidence is likely underestimated[156].  HP is caused by the repeated inhalation of environmental allergens, typically bacterial derived, and results in a Th1\/Th17-biased inflammatory response characterized by a lymphocyte dominated infiltration, the formation of parenchymal granulomas and antigen-specific IgG2a antibodies, making it a quite distinct disease from allergic asthma[157, 158].  A common mouse model of this disease results from the repeated intranasal exposure of mice to the Airway'Allergen'(house'dust'mite)'IL725,'IL733,'TSLP,'uric'acid,'IL71,'GM7CSF'ILC2'Basophil' DC'Lung'Lymph'Node'CD4+'Tn'Eosinophil'Neutrophils' Mast'Cell'IL74,'IL75,'IL713,'TNF\u2026.'TNF\u03b1'IFN\u03b3'MPO'MMPS'CXCL1'B'cell'Plasma'cell'IgE'IL74' 27 gram-positive thermophile Saccharopolyspora rectivirgula (SR), a bacteria commonly found in moldy hay that causes \u201cfarmers lung\u201d in humans, a type of HP[159].  This model has become very useful modeling the initiation of Th1\/Th17 adaptive immune responses in the lung, and identifying cytokines and cell types that facilitate this unique response.  1.5.2 Intestinal helminth infection  While inappropriate Th2 immune responses are typically associated with allergy, mucosal Th2 responses are indeed needed for protection from helminth infection.  A common helminth infection in humans is the whipworm Trichuris trichuria, with up to a billion people infected worldwide[160].  Mouse models of human whipworm infection have utilized the murine helminth Trichuris muris, with similar life cycle and route and mode of infection to the human parasite[161].  Trichuris eggs are delivered via oral gavage, and they travel down the intestinal tract where they hatch in the cecum, eventually releasing eggs through the feces to continue the infectious cycle.  Clearance of Trichuris infection is critically dependent on the formation of a Th2 response, leading to \u201cresistance\u201d to infection.  This is due to production of the Th2 cytokine IL-4, leading to IgE production, and IL-13, leading to mucus production, epithelial cell turnover and smooth muscle contraction to expel the helminth[162, 163].  Alternatively, if Trichuris infection leads to the formation of a Th1 response, the end result is the inability to clear infection, leading to \u201csusceptibility\u201d to infection[164].  This model has become immensely useful in dissecting the mechanisms involved in initiating Th2 responses that can have broad implications not just for intestinal  28 immunity, but also for the initiation of Th2 responses at other sites, such as the lung environment in understanding the pathogenesis of asthma.  1.6 Summary  The development of adaptive immune responses at mucosal surfaces must be tightly controlled.  While appropriately formed Th2 responses are protective in instances of helminth infection, the inability to initiate tolerance and the aberrant responses to harmless antigens results in allergic diseases, such as asthma.  A greater understanding of the cells involved in this process and the proteins and signaling pathways that regulate their function is needed to identify new therapeutic targets.  ILC2s are enriched at mucosal sites and are an immediate source of inflammatory mediators, but their contribution to adaptive immune responses are unknown.  I hypothesized that, in addition to their role in innate immunity, they would have a significant impact on the development of subsequent adaptive immune responses. Through the use of ILC2-deficient mice, I found that ILC2s play a critical role in priming the adaptive Th2 response following inhaled allergen challenge.  Surprisingly, these cells were dispensable for the development of Th2 responses to systemically delivered antigens, suggesting an important role for ILC2s specifically in the mucosal environment.  Additionally, ILC2s were dispensable for sensitization to Th1\/Th17 responses following inhalation of bacterial antigens, suggesting a specific role in promoting Th2 immunity.  The lipid phosphatase SHIP-1 is an important regulator of the PI3K pathway, and deletion of SHIP-1 throughout the hematopoietic compartment results in increased airway inflammation.  I hypothesized that despite the increased inflammation observed in Ship1-\/-  29 mice, loss of Ship1 in specific leukocyte subsets could in fact have a more subtle and potentially protective effect in allergic responses.  I found that loss of Ship1 in either T cells or DCs results in protection from the development of HDM-induced allergic airway inflammation through a skewing of the immune response to a Th1-dominated response.  This was further confirmed in a Trichuris infection model where loss of Ship1 in DCs resulted in susceptibility to infection through an inappropriate Th1 response.      30  Chapter 2.  Group 2 innate lymphoid cells facilitate sensitization to local but not systemic Th2-inducing allergen exposures                     31 2.1 Introduction Allergic airway inflammation\/asthma, is a chronic inflammatory disease characterized by a Th2-biased immune response, antibody class-switching to IgE and reversible airflow obstruction.  Its prevalence has increased by 12% between 2001-2009, currently affecting 8.2% of the population in the US alone and resulting in an annual economic burden of 56 billion dollars [146].  The most prevalent therapeutic strategies were developed in the 1970\u2019s and include the use of inhaled corticosteroids (ICS) to dampen inflammation and long-acting \u03b2-agonist (LABA) to induce smooth muscle cell relaxation [147]. Though effective, these drugs fail to target the underlying immune deregulation that leads to disease. Similarly, in developing new therapeutics, the current emphasis has been on biologics targeting downstream effectors of allergic responses; primarily antibodies directed at IgE and Th2 cytokines.  These new treatment options have only shown marginal clinical success and the data suggest that targeting the effector response of allergic inflammation may not represent an optimal approach [165]. In summary, there is a current unmet need in the treatment of allergic airway disease.  It is likely that a greater understanding of the mechanisms involved in the initial priming and sensitization phase could unveil novel therapeutic targets.  House dust mite (HDM) is one of the most common indoor allergens and up to 85% of asthmatics respond to this allergen.  Inhaled HDM acts on airway epithelial cells in a TLR4-dependent manner, inducing the release of cytokine danger signals including IL-25, IL-33, thymic stromal lymphopoietin (TSLP) and granulocyte macrophage colony-stimulating factor (GM-CSF) [153-155].  Understanding how allergens are able to promote na\u00efve CD4+  32 T-cell polarization to a Th2 phenotype has been hampered by the lack of a clearly defined innate cell type that produces Th2-associated cytokines (such as IL-4, IL-5 and IL-13) during the sensitization phase.  Studies utilizing Rag2-\/- mice, which lack T-cells and B-cells, identified a novel innate cell type that produced IL-5 and IL-13 in response to IL-25 [41].  Several groups have since characterized populations of innate lymphoid cells that act as robust sources of IL-5 and IL-13, but not IL-4, in various tissues, including spleen, adipose tissue, lymph nodes, lungs and the nasal mucosa [43-46, 54, 65, 166].  While initially referred to as nuocytes, natural helper cells or innate helper type 2 cells, they are now more simply referred to as ILC2s based on their unique expression profile of cell surface antigens (CD45+Lineage-CD127+CD25+CD90.2+ST2+Sca1+) and their production of the type 2 cytokines IL-5 and IL-13 in response to epithelial derived IL-25, IL-33 and TSLP. ILC2s also require the transcription factors, retinoic acid receptor-related orphan receptor-\u03b1 (ROR\u03b1) [36, 37], GATA-binding protein 3 (GATA-3) [32, 33] and T-cell factor 1 (TCF-1)[35] for their specification and maturation.  Previously, we showed that ROR\u03b1-deficient mice have an impaired innate response to protease allergens in the lung [36]. However the selective role of ILC2s in the priming of different CD4+ T helper (Th) subsets and development of adaptive immune responses in the lung has yet to be examined.  We sought to investigate the influence of ILC2s and the route of antigen priming on the development of an adaptive type-2 immune response to lung allergens.  Using distinct models of inducing adaptive immunity, we demonstrate a specific and highly selective role for ILC2s in promoting Th2, but not Th1 or Th17 lung inflammation in response to inhaled antigens.   33 2.2 Methods 2.2.1 Mice and bone marrow transplantation C57BL\/6J, B6.SJL-Ptprca Pepcb\/BoyJ (Ly5.1) and B6.C3(Cg)-Rorasg\/J were purchased from The Jackson Laboratories (Bar Harbor, ME) and were bred and maintained in a specific pathogen-free environment at The Biomedical Research Centre.  Pups from RoraSg\/+ breeders were genotyped using DNA obtained from ear-clips using primer sequences and protocols from the JAX online database.  Bone marrow cells were collected from wild-type and Rorasg\/sg littermates and 1x107 bone marrow cells were injected intravenously into lethally irradiated Ly5.1 recipient mice (900 rads in split doses).  Peripheral blood chimerism was verified 8 weeks after transplantation by saphenous vein bleeds and all mice used had greater than 90% hematopoietic cells originating from the Ly 5.2 donor mice.  All protocols were approved by the animal care committee of the University of British Columbia.  2.2.2 Antibodies and flow cytometry Staining and antibody dilutions were prepared in PBS containing 2% FCS, 2mM EDTA and 0.05% sodium azide.  Samples were first blocked in buffer containing 5\u03bcg\/mL anti-CD16\/32 (2.4G2) to block non-specific antibody binding.  Alexa-450 conjugated CD3e (145-2C11), CD11c (N418) CD11b (M1\/70), CD19 (1D3), CD45R\/B220 (RA3-6B2), NK1.1 (PK136), Gr1 (RB6-8C5) and Ter119 (TER-119), PE Conjugated CD25 (PC61.5), PE-Cy7 conjugated CD3e, B220, Sca-1 (D7), APC conjugated IL-5, APC-efluor780 conjugated B220 and efluor650-conjugated CD90.2 (53-2.1) were purchased from eBioscience (San Diego, CA). PE conjugated Siglec-F (E50-2440), PerCP-Cy5.5 conjugated CD45.2 (104) and V500  34 conjugated CD45 (30-F11) was purchased from BD Biosciences (San Jose, CA).  FITC conjugated anti-Neutrophil (7\/4) was purchased from Abcam (Cambridge, MA).  FITC conjugated ST2 (DJ8) was purchased from MD Bioproducts (St Paul, MN).  Pacific Blue conjugated CD45 (I3\/2) and Alexa-647 conjugated CD11c (N418) and CD45.1 (Ly5.1) was produced in-house.  Intracellular cytokine staining was performed with the Cytofix\/Cytoperm kit (BD Bioscience) and viable cells were identified using the efluor-450, 506 or 780 fixable viability dye (eBioscience).  Samples were acquired on a BD LSRII and data analysis was performed using Flowjo (Treestar, San Carlos, CA).  2.2.3 In vitro T cell polarization CD4+ T-cells were isolated from the spleens and lymph nodes of na\u00efve WT or Rorasg\/sg BMT mice by negative selection using Robosep (StemCell Technologies Inc.).  2.5x105 CD4+ cells were cultured for 6 days in culture media (IMDM supplemented with 10% FBS, 100U\/mL penicillin, 100\u03bcg\/mL streptomycin and150\u03bcM MTG) with 1\u03bcg\/mL each of plate bound anti-CD3 (145-2C11) and anti-CD28 (37.51) in the presence of neutral (10ng\/mL IL-2), Th2 (10ng\/mL IL-2, 10ng\/mL IL-4 and 10ug\/mL anti-IFN\u03b3 [XMG1.2]) or Th17 (10ng\/mL IL-1\u03b2, 20ng\/mL IL-6, 10ng\/mL IL-23, 10ng\/mL TNF-\u03b1, 1ng\/mL TGF-\u03b2, 10ug\/mL anti-IL4 [11B11] and 10ug\/mL anti-IFN\u03b3 [XMG1.2]) conditions.  Cell free supernatants were collected at day 6 for cytokine measurements and total RNA was extracted using Trizol for quantitative RT-PCR.  Immature ILC2s were sort purified from C57Bl\/6 bone marrow (CD45+Lineage-CD127+CD25+ST2+) and cultured for 7 days in media supplemented with 10ng\/mL each of IL-7 and IL-33.     35 2.2.4 Lung explant culture Mice were euthanized by CO2 asphyxiation and lungs were inflated with 1.5mL DMEM containing 10% FCS, 2-ME, Pen\/Strep and 1% low melting point agarose kept at 37\u00b0C and cooled on ice.  Lungs were sliced with a razor into ~0.5mm thick sections placed in 2mL of culture media stimulated with either phosphate buffered saline or 50\u03bcg\/mL house dust mite antigen.  Golgi-Plug (BD Biosciences) was added to the explant cultures 6 hr before collection and a single cell suspension was made by passing the lung slices through a 70\u03bcm cell-strainer.  Lung ILC2s were identified as Lineage-CD45+CD90.2+CD25+Sca1+ST2+ viable cells and gated for IL-5 expression based on FMO controls.  Secreted IL-5 collected in the cell free supernatant was quantified by ELISA using  purified and biotin antibody pairs to IL-5 (TRFK5, TRFK4) from eBioscience.  2.2.5 Induction and assessment of allergic airway inflammation House dust mite (HDM, Dermatophagoides pteronyssinus) extract was obtained from Greer Labs (Lenoir, NC, containing 0.034\u03bcg Der p 1 and 0.095EU per \u03bcg of total protein) and disease was induced as described[167].  Mice were treated intranasally with endotoxin-free phosphate buffered saline (PBS) or HDM on days 0, 1 and 2 with 25\u03bcg of total protein and on days 14, 15, 16 and 17 with 5\u03bcg and mice were euthanized 24 hours after the final challenge.    For Ovalbumin\/Alum induced AAI, mice were injected intraperitoneally with 50\u03bcg chicken ovalbumin (Grade III, Sigma, St Louis, MO) adsorbed to 650\u03bcg aluminum hydroxide (Sigma) on days 0 and 7.  Ovalbumin contained less than 0.125 EU per 100ng of protein as  36 measured by PYROGENTTM Gel Clot assay (Lonza, Walkersville, MD).  Mice were treated intranasally on days 21, 22, 23, 25 and 27 with 50\u03bcg OVA and mice were euthanized on day 28 via intraperitoneal injection of avertin.  Hypersensitivity pneumonitis (HP) was induced as described [168].  S. rectivirgula was obtained from the ATCC (29034).  Bacteria cultures were grown in Trypticase Soy Broth at 55\u00b0C, before being spun down and washed with endotoxin-free water.  Bacterial cells were lysed and lyophilized before being re-suspended to 4mg\/mL in PBS for use.  Mice were exposed intranasally to 40\u03bcl (160\u03bcg) of SR antigen three times a week for 3 weeks.  Mice were euthanized four days after the last intranasal exposure.   Mice were euthanized via intraperitoneal injection of avertin.  Bronchoalveolar lavage (BAL) was collected by three aspirations with 1mL of sterile saline, followed by blood collection via cardiac puncture.  BAL cells were enumerated and differentiated by FACS using antibodies to CD3e, CD11c, CD45, CD45R\/B220, SiglecF and 7\/4.  2.2.6 Detection of antigen-specific IgG1, IgG2a and IgE ELISA for total serum IgE was performed according to the manufacturer\u2019s instructions (BD Bioscience).  For detection of Ag-specific IgG1 and IgG2a, plates were coated with 25\u03bcg\/mL SR or HDM-antigen in carbonate buffer (0.1M sodium carbonate, pH 9.5).  Serum was diluted in assay diluent (PBS with 3% BSA) and added to the plates for 2 hours at 37\u00b0C.  Ag-specific IgG\u2019s were detected with HRP-conjugated antibodies to mouse  37 IgG1 or IgG2a, biotin-conjugated anti-mouse IgE (R35-72),  Streptavidin-HRP and TMB substrate (BD Pharmingen).  2.2.7 Immune analysis Lungs were minced and digested with 200U\/mL collagenase IV (Sigma) for 1 hour at 37\u00b0C and a single cell suspension was obtained by passing the tissue through a 70\u03bcm cell strainer and red blood cells were lysed and leukocytes were enriched by percoll separation.  Leukocytes were counted and stimulated at 4-8x106 cells\/mL in culture media (DMEM with 10% FCS, Pen\/Strep, 50\u03bcM 2-ME and 25mM HEPES) with the indicated concentration of HDM or SR antigens for 72 hours.  Cell-free supernatants were collected and cytokine levels were measured by ELISA using purified and biotin-conjugated antibody pairs to IL-13 (eBio13A, eBio1316H) or IL-17A (eBio17CK15A5, eBio17B7) from eBioscience.   2.2.8 RNA isolation and quantitative RT-PCR Lungs were homogenized in Trizol (Life Technologies, Carlsbad, CA) using a Qiagen TissueLyser II (Valencia, CA).  Total RNA was extracted and reverse transcribed using a high capacity cDNA kit (Life Technologies) and quantitative RT-PCR was performed using Sybr green (KAPA Biosystems, Woburn, MA).  The primers used for qPCR are listed in table 2.1.  Reactions were carried out in an ABI 7900 real-time PCR machine (Life Technologies) and values are expressed relative to Actb.  2.2.9 Histology Lung tissue was fixed in 10% buffered formalin overnight and embedded in paraffin.  Sections (5\u03bcm thick) were stained with hematoxylin and eosin.  A histologic disease score  38 from 0-4 was attributed based on severity for peribronchial, perivascular and parenchymal immune cell infiltration, for a total score of 12.  2.2.10 Statistics Results represent mean\u00b1s.e.m.  Student\u2019s t test was used to determine statistical significance.              39  Primer Sequence (5\u2019-3\u2019) Actb forward GGCTGTATTCCCCTCCATCG Actb reverse CCAGTTGGTAACAATGCCATGT Il4 forward TCGGCATTTTGAACGAGGTC Il4 reverse CAAGCATGGAGTTTTCCCATG Il5 forward GATGAGGCTTCCTGTCCCTACTC Il5 reverse TCGCCACACTTCTCTTTTTGG Il13 forward CCTGGCTCTTGCTTGCCTT Il13 reverse GGTCTTGTGTGATGTTGCTCA Il17a forward AGCAGCGATCATCCCTCAAAG Il17a reverse TCACAGAGGGATATCTATCAGGGTC Prg2 forward ATGGGTGACTCTGGATGCAAG Prg2 reverse GCGGACTGGATTCCGAAGT Rora forward AGACAGCTTGTACGCCGAG  Rora reverse GGTCATCATGCAGTTCCGTCA  Gata3 forward CTCGGCCATTCGTACATGGAA Gata3 reverse GGATACCTCTGCACCGTAGC Table 2.1. Primer list Forward and reverse primer pairs for gene specific detection by quantitative RT-PCR.  Primers were used at a final concentration of 200mM.    40 2.3 Results 2.3.1 HDM induces lung ILC2 activation and IL-5 secretion To test whether HDM could elicit ILC2-dependent production of Th2 cytokines, we utilized lung explant cultures, which maintain the lung microenvironment and epithelial-leukocyte interactions.  Lung explants were stimulated with HDM antigen in vitro and ILC2 production of intracellular IL-5 was measured by flow cytometry.  Lung ILC2s were identified based on their unique expression of cell surface markers: positively reacting with the pan-hematopoeitic marker CD45, the stem cell antigen-1 (Sca-1) and the IL-33 receptor (ST2, Fig 2.1, A) and lack of expression of common leukocyte proteins (CD3, CD11b, B220, Gr1, NK1.1, Ter119).  Gated ILC2s were also found to express IL-2R\u03b1 (CD25, Fig 2.1, B).  HDM treatment of wild type explants led to a rapid induction of IL-5 synthesis compared to saline controls (Fig. 2.1, C-D), suggesting that these cells could serve as downstream effectors in response to a common human allergen.    Lineage!B220!A!ST2!Sca1! APC!B!CD25!CD45+Lin-ST2+Sca1+! C!PBS! HDM!% IL-5 Positive!*!0!10!20!30!D!6! 12! 24! (hours)!0!2.5!5.0!7.5!10.0! PBS!HDM!*!IL-5 (ng\/mL)!ST2!Lung: CD45+! Lung: CD45+Lin-!APC!ST2!HDM \u2013 APC FMO!Lung: CD45+Lin-ST2+Sca1+!HDM \u2013 IL-5 APC!Lung: CD45+Lin-ST2+Sca1+! 41 Figure 2.1. HDM induces lung ILC2 production of IL-5 Lung explants from wild-type mice were stimulated with HDM or PBS for 18 hours, with Golgi-Plug added for the last 6 hours.  Following stimulation, lung explants were dissociated and cells were prepared for flow cytometry (A) with ILC2s identified as Lineage-CD45+ST2+Sca1+ and intracellular staining for IL-5 production by ILC2s, compared to fluorescence minus one (FMO) controls.  (B) Expression of CD25 by lung ILC2s.  (C) Percent IL-5 positive ILC2s from lung explants stimulated with HDM or PBS.  (D) IL-5 released in the supernatant of PBS or HDM stimulated lung explants was measured by ELISA at 6, 12 and 24hrs.  Results are pooled from 3 independent experiments (n=3).  Error bars are means \u00b1 SEMs,  * p<0.05.  2.3.2 ILC2s facilitate HDM-induced allergic airway inflammation To examine the role of ILC2s in the development of allergic asthma, we utilized a HDM mouse model of allergic airway inflammation (AAI, Fig 2.4, A).  In this model, repeated intranasal exposure of HDM antigen induces several hallmark features of clinical asthma, including airway and lung parenchymal eosinophilia, a Th2-biased immune response with high levels of IL-4, IL-5 and IL-13 secretion and antibody class-switching to IgE [153].  While ILC2s are known to produce IL-5 in response to protease antigens in the lung [45], their role in regulating the development of an adaptive immune response to physiologically relevant antigens is still unknown.  To address this issue, we generated mice selectively lacking ILC2s by transplanting wild type mice (CD45.1) with bone marrow from Rorasg\/sg mice (CD45.2) to produce hematopoietic chimeras.  These chimeric mice have a very selective defect in ILC2 production (although rare, residual, radio-resistant CD45.1+ ILC2s can be detected in transplanted chimeras (Fig 2.2, A-B)).    42  Figure 2.2. Reduced lung ILC2s in Rorasg\/sg BMT Mice (A) Flow cytometric analysis of lung ILC2s from WT and Rorasg\/sg BMT mice.  (B) Quantification of lung CD45.2+ ILC2s from donor mice (WT or Rorasg\/sg) or residual radio-resistant ILC2s (CD45.1+).  Data are representative of 2 independent experiments (n=2-3).  Error bars are means \u00b1 SEMs.  Indeed, ROR\u03b1 expression is tightly regulated in the hematopoietic compartment, with high expression found only on ILC2s as well as Th17, but not Th2 cells (Fig 2.3, A).  Additionally, we found that isolated CD4+ T cells from wild type or Rorasg\/sg BMT mice displayed no difference in their ability to polarize to Th2 cells, as marked by equal production of the Th2 cytokines IL-5 and IL-13 as well as equal expression of the transcription factor Gata3 (Fig 2.3, B-C).   Lineage!B220!A!Lung: CD45+! Lung: CD45+Lin-B220-!CD90.2!CD25!ST2!Sca-1!9.8! 1.3!WT BMT! Rorasg\/sg BMT!CD45.1!CD45.2!24! 76!WT BMT ILC2s! Rorasg\/sg BMT ILC2s!72! 26!B! Lung ILC2!0!3!6!9!12!WT BMT! Rorasg\/sg BMT!Total Cells (x102 )!CD45.1+!CD45.2+! 43  Figure 2.3. ROR\u03b1 expression profile and function in TH2 polarization CD4+ T cells isolated from WT or Rorasg\/sg BMT mice were stimulated under neutral, TH2 or TH17-polarizing conditions for 6 days.  (A) Expression of Rora transcript from T cell polarization cultures or purified ILC2s was measured by using quantitative PCR relative to Actb.  (B) Secreted IL-5 and IL-13 from TH2 polarization conditions was quantified by ELISA.  (C) Expression of Gata3 transcript from TH2 polarization conditions was measured by using quantitative PCR relative to Actb.  Data are representative of 2 independent experiments (n=2).  Error bars are means \u00b1 SEMs.  When exposed to a HDM model of AAI, Rorasg\/sg chimeras exhibited a significant impairment in Th2 response induction, with a marked reduction in leukocyte infiltration, particularly eosinophils, into the airways 18 days after initial HDM exposure while challenges with saline (PBS) resulted in very low levels of airway infiltrate comprised almost exclusively of macrophages (Fig 2.4, B-C).  Additionally, HDM exposure resulted in a significant expansion of ILC2s in the lungs of WT BMT mice and a low level expansion in Rorasg\/sg BMT mice (Fig 2.4, D).  ILC2-deficient mice also exhibited significantly reduced levels of both total serum IgE, as well as HDM antigen-specific IgE and IgG1 (Fig 2.4, E), and significantly reduced expression of lung transcripts for the Th2-associated cytokines Il4 B!IL-5!0!5!10!15!ng ml-1!WT! Rorasg\/sg!Gata3!0!1!2!3!4!WT! Rorasg\/sg!relative expression!neutral! Th2! Th17!Rora!0!relative expression!C!A!0!1!2!3!4!5!6!7!ng ml-1!WT! Rorasg\/sg!IL-13!ILC2!4!8!12!16! 44 and Il5 (Fig 2.4, F).  To evaluate the activity of Th2 cells in the inflamed lung tissue, isolated lung leukocytes were re-stimulated ex-vivo with HDM antigen.  ILC2-deficient mice displayed a strikingly reduced recall response as indicated by decreased antigen-induced production of IL-13 (Fig 2.4, G).  Figure 2.4. HDM-induced AAI in WT and ILC2-deficient mice (A) Schematic of HDM disease model. (B) Total cells and (C) eosinophils collected in BAL samples of WT or ILC2-deficient mice. (D) Total CD45.2+ lung ILC2s from PBS and HDM-exposed WT or ILC2-deficient mice. (E) Serum total IgE and HDM-specific IgE and IgG1 levels were quantified by ELISA. (F) Transcript levels of Il4 and Il5 from lung RNA relative to Actb. (G) Lung leukocytes were isolated and restimulated ex vivo with 50\u03bcg\/mL HDM for 72hrs.  IL-13 levels were quantified by ELISA. Data are representative of 3 independent experiments (B, C, E-G; n=4-8) or combined from 2 independent experiments (D; n=4-5).  Error bars are means \u00b1 SEMs.  *p<0.05.  Histologically, we found that loss of ILC2s also resulted in a significant reduction in lung histopathology, with reduced leukocyte infiltration into the lung tissue, particularly in the peribronchiolar and perivascular space (Fig 2.5, A-B).  Consistent with the significant reduction in BAL eosinophils in ILC2-deficient mice, the frequency of tissue infiltrating parenchymal eosinophils was also reduced as quantified by the evaluation of eosinophil specific mRNA Prg2 (encoding major basic protein-1) in the lung (Fig 2.5, C).  Thus, our A!d0-2! d14-17! d18!HDM!(25\u03bcg, i.n.)!HDM!(5\u03bcg, i.n.)!B! Total Cells!0!1!2!3!4!5!E!0!3!6!9!Serum IgE! Il4!0!relative expression!Il5!0!Gng mL-1 !6!IL-13!F!1!2!3!4!0.5!1.0!1.5!2!\u03bcg mL-1 !4!2!0!WT!BMT!Rorasg\/sg!BMT!*!WT BMT!Rorasg\/sg BMT!Eosinophils!Cells (x106 )!0!0.5!1.0!1.5!2.0!C!Cells (x106 )!PBS! HDM!PBS! HDM!*!*!PBS! HDM! PBS! HDM!*!*!PBS! HDM!D!Cells (x103 )!PBS! HDM!0!2!4!6!8!Lung ILC2s!0!0.1!0.2!0.3!0.4!HDM-IgE!WT!BMT!Rorasg\/sg!BMT!OD450!WT!BMT!Rorasg\/sg!BMT!0!0.2!0.4!0.6!HDM-IgG1!OD450!*! *!*!*!*! 45 results suggest that ROR\u03b1-dependent ILC2s facilitate the development of allergic lung inflammation.  Figure 2.5. Airway inflammation in HDM-exposed WT and ILC2-deficient mice (A) Hematoxylin and eosin staining of PBS or HDM-treated WT and ILC2-deficient mice. Scale bar = 100\u03bcm. (B) Lung sections were scored for peribronchial, perivascular and parenchymal infiltration (a score of 0-4 was given for each parameter, for a maximum score of 12). (C) Infiltrating lung eosinophils were quantified by Prg2 transcript levels in total lung RNA.  Data are representative of 3 independent experiments (n=4-8)  Error bars are means \u00b1 SEMs. *p<0.05.  2.3.3 ILC2s are dispensable for the development of Th2 responses to systemically delivered antigens Although these data suggest that ILC2s are important mediators for the induction of Th2 cell responses to physiologically relevant antigens when delivered locally through the natural intranasal route, they do not address whether there is a similar role for these cells in priming the adaptive immune system to systemically administered antigens in the presence of adjuvants.  To test this we utilized the well-described ovalbumin (OVA)\/alum model of AAI Prg2!Crelative expression! 5!4!3!2!1!0!*!WT!BMT!Rorasg\/sg!BMT!B Lung Pathology!0!Score (\/12)!3!6!9!12!WT!BMT!Rorasg\/sg!BMT!*!ARorasg\/sg!BMT!WT!BMT!PBS! HDM! 46 (Fig 2.6, A).  In this model, mice are primed intraperitoneally (systemically) with OVA and alum followed by intranasal challenges (local) with OVA.  In contrast to our results with intranasal HDM antigen, we found that ILC2s were completely dispensable for the induction of AAI in this model.  ILC2-deficient mice had similar numbers of airway infiltrating leukocytes and displayed normal recruitment of eosinophils into the airways and lung tissue (Fig 2.6, B-C, E).  Likewise, we detected no significant differences in serum IgE levels or Il5 expression (Fig 2.6, D-E), suggesting a normal development of an adaptive Th2-response.     Figure 2.6. OVA\/alum-induced AAI in WT and ILC2-deficient mice (A) Schematic of disease model for OVA\/alum-induced AAI. (B) Total cells and (C) eosinophils collected in BAL samples of WT or ILC2-deficient mice. (D) Serum total IgE levels were quantified by ELISA. (E) Transcript levels of Il5 and Prg2 from lung RNA relative to Actb. Data are representative of 2 independent experiments (n=1-7).  Error bars are means \u00b1 SEMs.  2.3.4 Systemic delivery of antigens without adjuvant elicits ILC2-independent Th2-response Alum acts as a strong Th2 inducing adjuvant that causes release of various danger signals, such as uric acid, that could bypass ILC2s and act on resident macrophages and Cells (x105 )!Cells (x106 )!A!d0! d21-23! d25!OVA\/Alum!(50\u03bcg, i.p.)!OVA!(50\u03bcg, i.n.)!d7! d27!  d28!B!D\u03bcg\/mL!0!5!10!15!20!WT!BMT!Rorasg\/sg!BMT!E Il5!0!0.5!1.0!1.5!relative expression! Prg2!0!1!2!3!4!Serum IgE!WT!BMT!Rorasg\/sg!BMT!WT!BMT!Rorasg\/sg!BMT!Total Cells!WT!BMT!Rorasg\/sg!BMT!0!1!2!3!4!Eosinophils!WT!BMT!Rorasg\/sg!BMT!C!0!6!12!18! 47 DCs.  To examine whether ILC2s are required for systemic antigen priming of allergic responses in the absence of external adjuvant, we primed Rorasg\/sg chimeras intraperitoneally with OVA, in the absence of alum, followed by intranasal challenges with OVA (Fig 2.7, A).  Surprisingly, here too, ILC2-deficient mice had equivalent levels of leukocyte and eosinophilic infiltrates into the airways and tissues and exhibited no difference in IgE levels or Il5 expression (Fig 2.7, B-E).  This suggests that systemic antigen delivery, irrespective of the addition of an exogenous adjuvant, is able to induce an ILC2-independent allergic airway inflammatory response.   Figure 2.7. OVA-induced AAI in WT and ILC2-deficient mice (A) Schematic of disease model for OVA-induced AAI. (B) Total cells and (C) eosinophils collected in BAL samples of WT or ILC2-deficient mice. (D) Serum total IgE levels were quantified by ELISA. (E) Transcript levels of Il5 and Prg2 from lung RNA relative to Actb.  Data are representative of 1 independent experiments (n=4).  Error bars are means \u00b1 SEMs.   2.3.5 ILC2s are dispensable for local priming of Th1\/Th17 responses Although we find ILC2s are essential for Th2 sensitization to locally delivered antigens in the lung, it remains unclear whether they play any positive or negative role in the development of Th1\/Th17 responses.  Hypersensitivity pneumonitis (HP) is a chronic lung Cells (x106 )!Cells (x106 )!A!d0! d21-23! d25!OVA!(50\u03bcg, i.p.)!OVA!(50\u03bcg, i.n.)!d7! d27!  d28!B!D\u03bcg\/mL!0!3!6!9!WT!BMT!Rorasg\/sg!BMT!E Il5!0!0.5!1.0!1.5!relative expression! Prg2!0!5!10!20!25!Serum IgE!WT!BMT!Rorasg\/sg!BMT!WT!BMT!Rorasg\/sg!BMT!Total Cells!WT!BMT!Rorasg\/sg!BMT!0!0.5!Eosinophils!WT!BMT!Rorasg\/sg!BMT!C!0!0.5!15!1.0!2.0!2.5!1.5! 1.0!1.5! 48 inflammatory disease caused by repeated airborne exposure to predominantly organic antigens and is characterized by a Th1\/Th17-biased immune response [157, 168, 169].  In humans, exposure to Saccharopolyspora rectivirgula (SR), a bacteria present in moldy hay, leads to Farmer\u2019s lung (a subtype of HP), and this is recapitulated in mice after repeated intranasal exposure to this antigen (Fig 2.8, A). Wild type and ILC2-deficient mice were treated as outlined in Fig 6A and clinical features of HP were assessed on day 20 post-induction.  We found that loss of ILC2s had no effect on the ability to mount an adaptive Th1\/Th17 response to bacterial SR antigens.  ILC2-deficient mice developed similar levels of alveolar infiltrate with no difference in alveolar lymphocyte accumulation (Fig 2.8, B-C).  Unlike allergic asthma, which is characterized by high levels of serum IgE and IgG1 typical of a Th2 immune response, HP induces production of antigen-specific IgG2a.  ILC2-deficient mice had normal levels of SR-specific IgG2a and IgG1 (Fig 2.8, D).  There was also no difference in Th17 responses in the lung, as measured by Il17a transcript levels and IL-17A production from re-stimulated lung cultures (Fig 2.8, E-F).  We conclude that ILC2s are largely dispensable for Th1\/Th17 inflammatory responses.   Figure 2.8. S rectivirgula (SR)-induced HP in WT and ILC2-deficient mice A!d0-2! d7-9! d14-16!SR!(160\u03bcg, i.n.)!d20!B!D0!2!Cells (x106 )!E F!SR-IgG1! SR-IgG2a!00.1!0.2!0.3!0.4!0.5!OD450!00.1!0.2!0.3!0.4!00.5!1.0!Il17a!1.5!2.0!WT!BMT!Rorasg\/sg!BMT!WT!BMT!Rorasg\/sg!BMT!WT!BMT!Rorasg\/sg!BMT!024680! 10! 100!SR (\u03bcg\/mL)!IL-17A (ng ml-1)!WT!BMT!Rorasg\/sg!BMT!Total Cells! Lymphocytes!WT!BMT!Rorasg\/sg!BMT!0!0.5!1.0!2.0!Cells (x106 )!C!Wild-type BMT!relative expression! Rorasg\/sg BMT!4!6!1.5! 49 (A) Schematic of disease model for S. rectivirgula-induced HP. (B) Total cells and (C) lymphocytes collected in BAL samples of WT or ILC2-deficient mice. (D) Serum SR-specific IgG1 and IgG2a levels were quantified by ELISA. (E) Transcript levels of Il17 from lung RNA relative to Actb. (F) Lung leukocytes were isolated and restimulated with the indicated concentration of SR for 72 hours.  Secreted IL-17A was measured by ELISA.  Data are representative of 1 independent experiment (n=4).  Error bars are means \u00b1 SEMs.   2.4 Discussion The initiation of Th2 responses, and the innate cell types responsible for the production of cytokines prior to the polarization of na\u00efve CD4+ T-cells to a Th2 phenotype, is not well understood, and an important area of investigation.  Lung ILC2s represent a recently characterized leukocyte population that reside in the na\u00efve lung and rapidly produce Th2 associated cytokines IL-5 and IL-13 in response to inhaled proteases[36].  Here we have formally examined their role in initiation of an adaptive immune response in the lung to Th1\/Th17 and Th2 antigens (summarized in Fig 2.9).  For these studies we utilized Rorasg\/sg bone marrow chimeras as mice that selectively lack ILC2s.  Rorasg\/sg mice carry a mutation in the ligand-binding domain of ROR\u03b1 that leads to severe neurologic defects but, within the hematopoietic compartment, also results in an extremely selective defect in ILC2 production [36, 37].  Utilizing these ILC2-deficient mice, we have shown that ILC2s represent a critical relay between HDM-induced epithelial barrier damage and the subsequent generation of an adaptive Th2 response.  Interestingly, we found that while allergen exposure elicits a robust expansion of ILC2s in the lungs of wild-type mice, it also induces a modest but significant increase of ILC2s in Rorasg\/sg BMT mice.  This may result from functional compensation by other transcription factors (GATA-3, TCF-1, Gfi1[32-35]) known to be important for ILC2 development in situations where large amounts of factors associated with ILC2 proliferation and survival, such as IL-25, IL-33 and TSLP are  50 produced.  While we have found ILC2s to be important for the formation of an adaptive Th2 response, they do not produce the prototypical Th2-inducing cytokine IL-4, and instead produce large amounts of IL-5 and IL-13, suggesting a role for one or both of these cytokines in the ILC2-mediated Th2 response.  ILC2s have been shown to be potent inducers of eosinophil migration, either through their production of IL-5 or potentially through production of eosinophil chemotactic agents, such as eotaxin-1 or eotaxin-2.  Eosinophils have been found to induce DC maturation through release of their granule protein EDN (eosinophil-derived neurotoxin) that can act as an agonist of DC TLR2 receptors[61].  In addition, ILC2 production of IL-13 could also stimulate lung resident DCs and promote either their migration to the draining lymph node or their ability to promote Th2 differentiation[170]. Human ILC2 equivalent cells have also been identified and while they are found in healthy human lungs, they are enriched in the nasal polyps of patients with rhinosinusitis, suggesting their possible relevance in disease pathology[65].  Indeed, circulating and peripheral CD34+ progenitor cells have also been characterized that share several key features of ILC2s (such as TSLP-mediated release of type 2 cytokines IL-5 and IL-13), and are more abundant in sputum samples from allergic patients, highlighting their clinical importance[67].  Finally, genome-wide association studies have also found polymorphisms in the RORA locus to be associated with greater risk of asthma (along with IL33 and IL13), suggesting a potential link between ILC2s and disease[171].  In summary, our data using Rorasg\/sg bone marrow chimeras now provide a formal link between these previously detected innate cytokine producing cells and the generation of adaptive allergic immune responses to local antigen stimulation.  51 To test whether these cells are also required in models of systemic exposure to allergens we primed mice intraperitoneally with Ova as a model antigen.  Surprisingly, we found that systemic administration of antigen, along with an alum adjuvant, obviated the requirement for ILC2s in the development of a robust Th2 response.  It is possible that the strong immune-stimulatory effects of alum, such as the release of uric acid and stimulation of inflammatory monocytes [172] overcame any requirement for ILC2s in the sensitization phase.  To test this, we repeated the same model of systemic antigen delivery in the absence of adjuvant and again found that this too led to an ILC2-independent Th2 response.  Thus, our data would argue that although ILC2s play a critical role in the initiation of local responses to antigen exposures, they are dispensable in responses to systemically delivered antigens which likely short-circuits the need for DC dependent antigen delivery to the draining lymph nodes.  This finding also highlights the important interplay between lung resident ILC2s and the epithelium in shaping the innate and adaptive immune response to inhaled allergens.  The lung epithelium is a potent producer of ILC2 activating cytokines, such as IL-25, IL-33 and TSLP, and HDM-induced experimental asthma is dependent upon epithelial derived signals[154]. While we found ILC2s to facilitate sensitization to the Th2-inducing antigen HDM, they were completely dispensable for sensitization to Th1\/Th17-inducing antigens in a murine model of hypersensitivity pneumonitis (HP).  This was surprising as ROR\u03b1, as well as its related transcription factor ROR\u03b3 are important for proper Th17 differentiation[52], and mice deficient in IL-17 or its receptor are protected from development of HP[157, 169].  While we found IL-17A production is reduced in Rorasg\/sg BMT mice in both the HDM and OVA models of allergic airway inflammation (data not shown), we found no difference in IL- 52 17A production in the Th17 model of HP.  Thus, it is likely that SR exposure is able to induce a strong Th17-polarizing stimulus and that the ROR\u03b3 expression in ROR\u03b1-deficient T cells is sufficient for Th17 development, whereas HDM and OVA produce a weak Th17 inducing signal that requires synergistic activity of both ROR\u03b1 and ROR\u03b3 for proper Th17 differentiation.  The ability of ILC2-deficient mice to mount a normal response in a Th1\/Th17 model of lung inflammation does not, however, preclude the potential role for other lung resident innate lymphoid cell populations in modifying responses to bacterial antigens.  Our data do, however, rule out a significant role for ILC2s in this process. In summary, our data highlight a pivotal role for ILC2s in the initiation of Th2 responses to natural routes of antigen exposure.  They also highlight these cells as potential targets for therapeutics aimed at blocking the initiation of allergic responses prior to development of adaptive immunity.  53 \t \u00a0\t \u00a0Figure 2.9. Model for ILC2 function in lung inflammation Exposure of the lung epithelium to HDM antigens results in loss of barrier integrity and release of innate danger signals (TSLP, IL-25 and IL-33), which in turn activate lung resident ILC2 release of IL-5 and IL-13. This results in eosinophil recruitment and activation of immature lung resident dendritic cells (iDC). Activated lung DCs pick up antigen for transport to the draining lymph node and activation of a Th2 adaptive response. Systemic immunization with allergen obviates the need to ILC2s to mount an adaptive Th2 response. Local exposure to bacterial Th1\/Th17 inducing antigens (SR) activate a pathway independent of group 2 ILCs, but may rely on other lung resident innate lymphocyte populations, such as the IL-17A and IL-22 producing ILC3s.   54 Chapter 3. Lineage-specific regulation of allergic airway inflammation by the lipid phosphatase SHIP-1                      55 3.1 Introduction Allergic asthma is a chronic inflammatory disease of the airways characterized, immunologically, by a T-helper type 2 (Th2) biased inflammatory response, high levels of IL-4, IL-5 and IL-13, eosinophilic infiltration into the airways and lung tissue, antibody class switching to IgE and increased mucus production.  Despite the ever-increasing incidence of this disease, treatment options have remained stagnant over the years with inhaled corticosteroids remaining the frontline treatment option.  A greater understanding of the mechanisms surrounding allergic sensitization would facilitate the discovery of novel therapeutic targets.   The phosphoinositide 3-kinase (PI3K) pathway[173, 174] is pivotal to the activation, survival and migration of allergy promoting cells, and several studies have shown the therapeutic benefit of targeting this pathway in animal models[175-179].  Unfortunately, the ubiquitous expression of PI3Ks makes them challenging to target clinically and potentially obscures cell type-specific effects of targeting this pathway at different stages of allergic airway inflammation (AAI) pathogenesis.  Additionally, PI3K signaling is negatively regulated by the SH2-containing inositol 5\u2019-phosphatase 1 (Ship1, Inpp5d), which hydrolyzes the 5\u2019 phosphate of PI(3,4,5)P3 generated by PI3K to produce PI(3,4)P2, thereby inhibiting signaling downstream of PI(3,4,5)P3.  Thus, therapies aimed at targeting the PI3K pathway would benefit from a deeper understanding of how perturbing this hematopoietic-restricted negative regulator influences disease.   56 Ship1-deficient mice develop spontaneous airway inflammation[120, 121] as well as a host of other hematological abnormalities including enhanced myelopoiesis and reduced lymphopoiesis and erythropoiesis[120], expansion of myeloid-derived suppressor cells (MDSCs)[180] and regulatory T cells (Tregs)[132], and altered natural killer (NK) cell development[181].  While the diverse immune disorders caused by germline deletion of Ship1 reveal a key role in hematopoietic homeostasis, they likely mask subtle, yet important, functions in specific leukocyte subsets.  We hypothesized that deleting Ship1 expression specifically in lineages known to be crucial for adaptive Th2 responses would uncover distinct roles that could either positively or negatively regulate susceptibility to AAI.  To explore this possibility further, we selectively deleted SHIP-1 in distinct hematopoietic lineages and examined the effects on the development of AAI.  Strikingly, we found that loss of SHIP-1 in either T cells or DCs attenuated the development of the Th2 responses to HDM-induced allergic inflammation while loss in B cells showed no influence on the development of disease.  Our data reveal an unanticipated therapeutic effect of targeting SHIP-1 in T cells and DCs and suggest that targeting this enzyme either temporally or lineage-specifically may offer a novel approach to therapy.  3.2 Methods 3.2.1 Mice Inpp5dF\/F mice (Ship1F\/F) were provided by Dr. W. Kerr[181].  Cd19-Cre (B6.129P2(C)-Cd19tm1(cre)Cgn\/J) , Cd4-Cre (B6.Cg-Tg(Cd4-Cre)1Cwi\/BfluJ), Itgax-Cre (Cd11c-Cre, B6.Cg-Tg(Itgax-cre)1-1Reiz\/J), C57BL\/6J and OT-II (B6.Cg-Tg(TcraTcrb)425Cbn\/J) mice were obtained from the Jackson Laboratories (Bar Harbor,  57 Me).  Animals were bred and maintained in a SPF environment at The Biomedical Research Centre.  All protocols were approved by the Animal Care Committee of the University of British Columbia.  3.2.2 Histology Lungs were fixed in 10% buffered formalin and paraffin embedded.  5\u03bcm thick sections were stained with hematoxylin and eosin (H&E) or periodic acid-Schiff (PAS).  3.2.3 HDM-induced allergic airway disease House dust mite (HDM, Dermatophagoides pteronyssinus) was obtained from Greer Laboratories (Lenoir, NC).  Extracts contained 34 ng of Derp 1 and 0.095 EU\/\u03bcg of total protein and were re-suspended in sterile PBS.  Mice were anesthetized with isoflurane and sensitized with 25\u03bcg of HDM protein intranasally on days 0-2 and challenged with 5\u03bcg of HDM on days 13-17.  Mice were euthanized 24 hours after the last HDM challenge on day 18.   Bronchoalveolar lavage (BAL) fluid was collected by 3 repeated instillations and aspirations of 1mL sterile PBS and blood was collected by cardiac puncture for serum antibody analyses.  BAL cells were enumerated and classified by flow cytometry.  3.2.4 Flow cytometry Samples were first incubated in staining buffer containing 10% goat serum and 5\u03bcg\/mL anti-CD16\/32 to block non-specific binding.  IL-13, IFN\u03b3, CD11c, MHC-II, CD4, CD11b and CD45R\/B220 antibodies were obtained from eBioscience (San Diego, Calif).  CD103, CD40, Siglec-F, FoxP3, CD86 and CD45 antibodies were purchased from BD  58 Biosciences (San Jose, Calif).  anti-neutrophil antibody (7\/4) was purchased from Abcam (Cambridge, Mass).  Intracellular staining was performed using the intracellular fixation and permeabilization buffer set or the FoxP3\/Transcription factor buffer set from eBioscience.  Dead cells were excluded using the eFluor fixable viability dyes (eBioscience).  Samples were acquired on a BD LSRII and data analysis was performed with FlowJo software (TreeStar, San Carlos, Calif).  3.2.5 RNA isolation and quantitative RT-PCR Lungs were homogenized in Trizol (Life Technologies, Carlsbad, Calif) using a TissueLyser II (Qiagen, Valencia, Calif).  Total RNA was extracted and reverse transcribed using a high-capacity cDNA synthesis kit (Life Technologies) and quantitative RT-PCR was performed with Sybr green (KAPA Biosystems, Woburn, Mass).  Reactions were carried out in an ABI 7900 real-time PCR machine (Life Technologies) and values are expressed relative to Actb.  Primer sequences are shown in table 3.1.  Table 3.1. Primer list Forward and reverse primer pairs for gene specific detection by quantitative RT-PCR.  Primers were used at a final concentration of 200mM.  Primer& Forward&(5\u2019\/3\u2019)& Reverse&(5\u2019\/3\u2019)&Actb% GGCTGTATTCCCCTCCATCG% CCAGTTGGTAACAATGCCATGT%Il4% TCGGCATTTTGAACGAGGTC% CAAGCATGGAGTTTTCCCATG%Il5% GATGAGGCTTCCTGTCCCTACTC% TCGCCACACTTCTCTTTTTGG%Il13% CCTGGCTCTTGCTTGCCTT% GGTCTTGTGTGATGTTGCTCA%Ifng% GGATGCATTCATGAGTATTGCC% CCTTTTCCGCTTCCTGAGG%Prg2% ATGGGTGACTCTGGATGCAAG% GCGGACTGGATTCCGAAGT%Muc5ac% CAGGACTCTCTGAAATCGTACCA% GAAGGCTCGTACCACAGGG%Muc5b% GTGGCCTTGCTCATGGTGT% CGCTCATGCTAGGGAAGACAG%% 59 3.2.6 Detection of serum IgE, IgG1 and IgG2a ELISA for total serum IgE was performed according to the manufacturer\u2019s instructions (BD Biosciences).  For detection of HDM-specific IgG1 and IgG2a, plates were coated with 25 \u03bcg\/mL of HDM antigen in carbonate buffer.  Antigen-specific IgG\u2019s were detected with HRP-conjugated antibodies to mouse IgG1 or IgG2a and TMB substrate (BD Pharmingen) and reactions were stopped by the addition of 1N HCl.  3.2.7 Immune analysis Lungs were minced and digested in 200U\/mL collagenase IV (Sigma, St Louis, Mo) for 1 hour at 37\u00b0C and passed though a 70-\u03bcm cell strainer.  RBCs were lysed and leukocytes were enriched using a percoll (Sigma) separation.  mLNs were passed through a 70-\u03bcm cell strainer to form a single cell suspension.  Isolated leukocytes were re-suspended in culture media (IMDM with 10% FBS, penicillin\/streptomycin and 150 \u03bcM monothioglycerol) containing 750ng\/mL ionomycin and 50ng\/mL PMA (Sigma) in the presence of brefeldin A (eBioscience) for 4 hours before intracellular staining for flow cytometry.  BAL fluid cytokine levels were quantified by cytometric bead array (BD Biosciences).  3.2.8 In vivo DC migration Mice were challenged i.n. with 50\u03bcg of DQ-OVA (Molecular Probes, Eugene, OR) and 100\u03bcg of HDM antigen.  Draining mediastinal LNs were collected 24 hours later and analyzed by flow cytometry.   60 3.2.9 OT-II adoptive transfer Mice were sensitized i.n. on days 0-2 with 25\u03bcg HDM and 100\u03bcg OVA (Grade V, Sigma) and again with 5\u03bcg of HDM and 100\u03bcg of OVA on days 13-15.  Na\u00efve CD4+ T cells were isolated from the spleens and LNs of OT-II mice using magnetic separation (StemCell Technologies, Vancouver, Canada) and stained with CFSE (Molecular Probes).  CFSE labeled CD4+ OT-II cells (2.5x106) were injected i.v. on day 13 and mice were sacrificed on day 16.   3.2.10 Measurement of airway resistance Airway hyperresponsiveness was measured on day 18, 24 hours following the final HDM challenge.  Mice were anaesthetized with tribromoethanol (Avertin, Sigma, 250mg\/kg i.p.), tracheotomized with a blunted 18G needle and connected to a FlexiVent small animal ventilator (SCIREQ, Montreal, QC, Canada).  Animals were paralyzed with pancuronium bromide (Sigma, 0.5mg\/kg i.p.) and were administered increasing doses of methacholine (Sigma) through the jugular vein.  Total resistance in response to methacholine was measured using the snapshot perturbation.  3.2.11 DC culture and adoptive transfer Splenic DCs were expanded in vivo by injecting Flt3L expressing B16 melanoma cells subcutaneously (1x107 cells) into the lower back of Ship1F\/F and Ship1\u0394DC mice.  Splenic CD11c+ DCs were purified using magnetic separation (StemCell Technologies).  DCs were stimulated with 100\u03bcg\/mL of HDM antigen or co-cultured with CD4+ OT-II cells in the presence of 100\u03bcg of OVA and 100\u03bcg of HDM for 72hrs and secreted IL-12p40 and  61 IFN\u03b3 was quantified by ELISA (eBioscience).  Adoptive transfer experiments were performed as described previously[80], with some modifications.  DCs were pulsed for 16-24hrs with 100\u03bcg of HDM and 2.5x105 Ag-pulsed DCs were delivered i.n. into na\u00efve C57Bl\/6 mice.  One week later, mice were challenged for five consecutive days with 10\u03bcg of HDM and were sacrificed 24hrs after the final HDM challenge.  3.2.12 Statistics Results are presented as means \u00b1 s.e.m. or means \u00b1 s.d. (Fig 7A-C).  The Student t test was used to determine statistical significance (*: p\u22640.05).  3.3 Results 3.3.1 Lineage-specific deletion of Ship1 fails to induce spontaneous lung inflammation Ubiquitous deletion of Ship1 leads to a myeloproliferative disorder, spontaneous lung inflammatory disease and shortened lifespan that prohibit evaluation of its role in adaptive immune responses to inhaled allergens.  To examine Ship1\u2019s role in specific leukocyte subpopulations, mice carrying a Ship1 gene flanked by LoxP sites were crossed to mice expressing the Cre recombinase under the control of the Cd19, Cd4 and Itgax (Cd11c) promoters.  This lead to selective deletion of Ship1 expression in B cells (Ship1\u0394B cell), T cells (Ship1\u0394T cell) and DCs (Ship1\u0394DC), respectively.  Interestingly, none of these mice developed spontaneous lung inflammation (Fig 3.1), suggesting deletion of Ship1 in another cell type (or a combination of cell types[182]) is required to induce the na\u00efve lung inflammation observed in ubiquitous knockouts.  62  Figure 3.1. Lineage specific deletion of Ship1 does not result in spontaneous lung inflammation H&E and PAS stained lung sections from PBS exposed Ship1F\/F, Ship1\u0394B cell, Ship1\u0394T cell and Ship1\u0394DC mice.  Original magnification is 100X, scale bars = 100\u03bcm, n=3.  3.3.2 B cell specific deletion of Ship1 has no effect on progression of AAI SHIP-1 plays an important role in the negative regulation of BCR signaling through its association with the inhibitory motif of Fc\u03b3RIIB and previously Ship1\u0394B cell mice were reported to have a mildly Th1-biased antibody response and a lower threshold for negative selection, leading to lower titres of antigen-specific antibodies following systemic immunization[129].   Ship1\u0394B cell!Ship1F\/F!H&E\" PAS\"Ship1\u0394T cell!Ship1\u0394DC! 63 We therefore examined whether B cell specific deletion of Ship1 would alter the severity of house dust mite (HDM)-induced allergic airway inflammation (AAI).  Surprisingly, wild-type (WT, Ship1F\/F) and Ship1\u0394B cell mice exhibited similar numbers of total leukocyte and eosinophilic infiltrates into the alveolar space (Fig 3.2A), and into the lung tissue as measured by expression of the eosinophil specific transcript Prg2 (MBP, Fig 3.2B).  Ship1\u0394B cell mice also had no observable defect in their humoral response to HDM challenge and produced WT titres of total IgE and antigen specific IgG1 (Fig 3.2C-D).  There was also no apparent defect in the formation of adaptive Th2 responses, since these mice exhibited WT levels of the transcripts for Th2-associated cytokines Il4, Il5 and Il13 and the Th1-associated cytokine Ifng in total lung RNA (Fig 3.2E).  Correspondingly, they exhibited near-WT cytokine production from CD4+ cells isolated from the draining lymph node as measured by intracellular flow cytometry (Fig 3.2F).  In accordance with WT levels of Th2 cytokines, there was no difference in mucus production in the lungs as measured by expression of Muc5ac and Muc5b genes (Fig 3.2G).  Histological examination of lung sections from HDM- exposed wild-type and Ship1\u0394B cell mice further confirmed equivalent levels of inflammation and mucus production (Fig 3.2H).  In summary, deletion of SHIP-1 in B cells does not alter the development of HDM-induced AAI.   64   Ship1\u0394B cell HDM!Ship1F\/F HDM!Total cells\"Macrophages\"DCs\"T cells\"B cells\"Neutrophils\"Eosinophils\"A\" C0\"Total Cells (x106 )\"\u03bcg\/mL\"0\"0.5\"1.0\"1.5\"PBS\" HDM\"BALF\"E0\"Il4!relative expression\"Serum IgE\"1\"2\"3\"4\"5\"6\"7\"B\"0\"1\"PBS\" HDM\"relative expression\" Lung Prg2\" DOD450\"Ship1F\/F\"HDM\"Ship1\u0394B cell\"HDM\"0\"0.1\"0.2\"0.3\"0.4\"HDM IgG1\"1\"2\"3\"4\"PBS\" HDM\"Il5! Il13!0\"3\"6\"9\"Ifng!GmLN\"0\"2\"4\"6\"% of CD4+\"F2\"3\"4\"PBS\" HDM\"Lung Muc5ac\"0\"1\"2\"3\"relative expression\"Lung Muc5b\"0\"1\"2\"3\"4\"5\"PBS\" HDM\"0\"5\"15\"10\"20\"25\"PBS\" HDM\"12\"PBS\" HDM\"0\"5\"15\"10\"20\"PBS\" HDM\"IL-13\" IFN\u03b3\"HH&E\"PAS\"Ship1F\/F HDM\" Ship1\u0394B cell HDM\" 65 Figure 3.2. B cell expression of Ship1 does not influence HDM-induced AAI (A) BAL leukocyte differentials and cell counts from HDM-exposed mice. (B) Lung eosinophil Prg2 mRNA expression relative to Actb. Levels of serum (C) IgE and (D) HDM-specific IgG1. (E) Lung mRNA expression of Il4, Il5, Il13 and Ifng relative to Actb. (F) Intracellular cytokine expression of mLN CD4+ cells measured by flow cytometry. (G) Lung mRNA expression of mucus associated mRNA Muc5ac and Muc5b relative to Actb.  (H) H&E and PAS stained lung sections from HDM exposed Ship1F\/F and Ship1\u0394B cell mice.  Original magnification is 100X, scale bars = 100\u03bcm.  Data are means\u00b1s.e.m. and are representative of 2 independent experiments, n=3-5 mice per experiment.  3.3.3 T cell specific deletion of Ship1 leads to a Th1-biased response and protection from AAI While conventional SHIP-1 deficient mice (Ship1-\/-) exhibit expansion of the regulatory T cell (Treg) pool and a myeloproliferative disorder, mice with a T cell-specific deletion of SHIP-1 develop normally but have an increase in cytotoxic T cells and a biased polarization towards a Th1 response due to increased levels of T-bet expression[134].  To determine how this influences AAI, Ship1\u0394T cell mice were primed and challenged with HDM antigen.  In contrast to WT mice, Ship1\u0394T cell mice exhibited reduced eosinophilic inflammation in both the airways and lung parenchyma (Fig 3.3A-B).  This reduction was not due to changes in lung Treg frequencies since we found no significant difference between WT and Ship1\u0394T cell mice (Fig 3.3C).  Ship1\u0394T cell mice also failed to develop robust Th2 responses, and we were unable to detect Th2 cytokines IL-4 and IL-13 in the bronchoalveolar lavage fluid (BALF, Fig 3.3D) and observed significantly reduced levels of Th2 cells in the lungs and draining mediastinal lymph nodes of HDM-exposed animals.  These were replaced by a significant increase in Th1 cells in HDM-exposed Ship1\u0394T cell mice as measured by CD4+ IFN\u03b3+ cells in the lung and mLN (Fig 3.3E-F) and in lung tissue RNA (Fig 3.3G).  Consistent with the enhanced IFN\u03b3 expression, Ship1\u0394T cell mice were found to have increased titres of HDM-specific serum IgG2a and reduced titres of IgE (Fig 3.3H-I).   66 Transcription of goblet cell-associated mucus genes was also attenuated in HDM-challenged Ship1\u0394T cell mice due to the significantly attenuated Th2 response and reduced IL-13 expression (Fig 3.3J).  HDM-exposure did lead to significant inflammation in Ship1\u0394T cell mice, as evidenced by inflammatory cell infiltration into the lung at levels comparable to HDM-exposed mice, but this was not accompanied by an increase in mucus production due to the Th1-skewed response (Fig 3.3K).  In summary, the data suggest that Ship1\u0394T cell mice are protected from HDM-induced AAI through a generalized skewing of their adaptive immune response away from a Th2 response towards a Th1-biased response.   67  Ship1\u0394T cell HDM!Ship1F\/F HDM!Total cells\"Macrophages\"DCs\"T cells\"B cells\"Neutrophils\"Eosinophils\"A\"0\"Total Cells (x106 )\"BALF\"H0\"Serum IgE\"\u03bcg\/mL\"2.5\"1\"*\"2\"3\"4\"5\"B\"Total Cells (x106 )\"0\"2\"4\"6\"8\"Total cells\"Macrophages\"DCs\"T cells\"B cells\"Neutrophils\"Eosinophils\"Lung\"*\"5.0\"7.5\"PBS\" HDM\"I\"OD450\"0\"0.2\"0.4\"0.6\"0.8\"HDM-IgG1\"Ship1F\/F\"HDM\"Ship1\u0394T cell\"HDM\"*\"Ship1F\/F\"HDM\"Ship1\u0394T cell\"HDM\"0\"0.2\"0.4\"0.6\"HDM-IgG2a\"*\"C\"PBS\" HDM\"0\"5\"10\"15\"20\"Lung Treg\"% of CD4+\"D\"0\"25\"50\"BALF\"75\"pg\/mL\"IL-13\"IL-4\"IFN\u03b3\"E\" Lung\"IL-13\" IFN\u03b3\"0\"% of CD4+\"5\"10\"15\"20\"25\"*\"IL-13\" IFN\u03b3\"F\" mLN\"0\"4\"8\"12\"16\"n.d.\" n.d.\"J\"0\"2\"4\"5\"relative expression\"PBS\" HDM\"Lung Muc5ac\"*\"% of CD4+\"Lung Muc5b\"PBS\" HDM\"0\"1\"2\"3\"4\"*\"G\" Lung Il13\"0\"3\"6\"9\"12\"relative expression\"PBS\" HDM\"Lung Ifng\"0\"2\"4\"6\"8\"PBS\" HDM\"*\"*\"*\"*\"*\"KH&E\"PAS\"Ship1F\/F HDM\" Ship1\u0394T cell HDM\" 68 Figure 3.3. T cell expression of Ship1 restricts Th1 adaptive responses to HDM (A) BAL and (B) lung leukocyte differentials and cells counts from HDM-exposed mice. (C) Flow cytometry of lung Tregs (FoxP3+CD25+) as a percentage of CD4+CD45+ leukocytes. (D) BALF levels of IL-4, IL-13 and IFN\u03b3 were measured by CBA. (E) Lung and (F) mLN intracellular cytokine expression by CD4+ cells measured by flow cytometry. (G) Lung mRNA expression of Il13 and Ifng relative to Actb.  Serum (H) total IgE and (I) HDM-specific IgG1 and IgG2a was measured by ELISA.  (J) Lung mRNA expression of Muc5ac and Muc5b relative to Actb.  (K) H&E and PAS stained lung sections from HDM exposed Ship1F\/F and Ship1\u0394T cell mice.  Original magnification is 100X, scale bars = 100\u03bcm.  Data are means\u00b1s.e.m. and are representative of 2 independent experiments, n=3-4 mice per experiment, * p<0.05.  3.3.4 Dendritic cell specific deletion of Ship1 protects from AAI While in vitro studies have suggested an important role for SHIP-1 in regulating dendritic cell (DC) activation and maturation[141, 142, 183], the role of SHIP-1 in DC function in vivo has yet to be explored.  Surprisingly, in response to HDM challenge, Ship1\u0394DC mice also displayed reduced eosinophilic infiltration in both the airways and lung parenchyma (Fig 3.4A-B).  This was accompanied by a slight but significant increase in lung macrophage and DC numbers.  Mucus production in the airways, a hallmark of severe allergic lung inflammation, was also reduced in Ship1\u0394DC mice (Fig 3.4C).  Lung DCs serve as important sentinels for inhaled pathogens, and undergo an intricate maturation and migration process in order to efficiently prime an adaptive immune response.  Resident lung DCs first phagocytose and process inhaled antigens, followed by up-regulation of co-stimulatory molecules prior to migration to the draining lymph node where they induce na\u00efve T cell proliferation and activation.  SHIP-1\u2019s ability to regulate PIP3 levels could influence each of these steps since it has been reported to have functions in phagocytosis[138], maturation[141], directional migration[184] and T cell presentation[183].     69 To track the phagocytic and migratory activity of resident WT and Ship1\u0394DC DCs in vivo, mice were exposed intranasally to a mixture of HDM antigen and fluorescently-labeled ovalbumin (DQ-OVA) prior to flow cytometric evaluation of labeled cells in the draining lymph node 24 hours later.  Interestingly, Ship1\u0394DC mice exhibited no defect in the ability to acquire antigen and migrate to the mLN (Fig 3.4D); there was no difference in the relative frequency of antigen positive CD11b+ or CD103+ DC subsets in the mLN (Fig 3.4E) or in the total influx of DCs into the mLN (Fig 3.4F).  Additionally there was no difference in the expression of the surface markers CD40 and CD86 on mLN DCs following HDM exposure (Fig 3.4G).  Thus, we conclude that the protective effect of Ship1 loss was not due to a defect in DC migration or activation.  The ability of DCs to induce antigen specific T cell proliferation was also examined in vivo using adoptively transferred CFSE labeled CD4+ T cells from OT-II transgenic mice.  Labeled OT-II cells were intravenously transferred into WT and Ship1\u0394DC mice sensitized with HDM and OVA antigens, followed by subsequent intranasal challenge with HDM and OVA.  After 72 hours, mLNs were removed and OT-II proliferation was examined by CFSE dye dilution.  There was no detectable difference in T cell proliferation in WT and Ship1\u0394DC mice (Fig 3.4H), which further confirmed similar DC migration and activation following HDM exposure.  70  Figure 3.4. Loss of Ship1 in DCs protects from development of HDM-induced AAI (A) BAL and (B) lung leukocyte differentials and cells counts from HDM-exposed mice. (C) Lung mRNA expression of Muc5ac and Muc5b relative to Actb. (D) Flow cytometry gating strategy for CD11b+ and CD103+ mLN DCs from HDM\/DQ-OVA exposed Ship1F\/F and Ship1\u0394DC mice. (E) Frequency of DQ-OVA+ CD11b+ and CD103+ DCs in the mLN 24hrs after HDM\/DQ-OVA exposure. (F) Total number and expression (MFI) of (G) CD40 and CD86 on mLN DCs (CD11c+MHC-II+) 72hrs after HDM exposure. (H) CFSE dilution of adoptively transferred OT-II CD4+ T cells in the mLN of HDM\/OVA exposed mice.  Data are means\u00b1s.e.m. and are representative of 2 independent experiments, n=3-6 mice per experiment. * p<0.05.  Ship1\u0394DC HDM!Ship1F\/F HDM!Total cells\"Macrophages\"DCs\"T cells\"B cells\"Neutrophils\"Eosinophils\"A\"0\"Total Cells (x106 )\"BALF\"1\"*\"2\"3\"4\"5\"B\"Total Cells (x106 )\"0\"2.5\"5.0\"7.5\"10\"Total cells\"Macrophages\"DCs\"T cells\"B cells\"Neutrophils\"Eosinophils\"Lung\"*\"D\"F\"6\"*\"*\"*\"*\"*\"mLN: CD45+\"MHC-II\"CD11c\"CD103\"CD11b\"mLN DCs\" CD11b+ DCs\" CD103+ DCs\"DQ-OVA\" DQ-OVA\"Ship1\u0394DC!Ship1F\/F\"Ship1F\/F\"HDM\"Ship1\u0394DC\"HDM\"Total Cells (x104 )\"0\"1\"2\"3\"4\"5\"mLN DCs\"E\"mLN CD11b+ DCs\"Ship1F\/F\"HDM\"Ship1\u0394DC\"HDM\"% OVA+ \"0\"5\"10\"15\"20\"mLN CD103+ DCs\"Ship1F\/F\"HDM\"Ship1\u0394DC\"HDM\"0\"10\"20\"30\"% OVA+ \"G\"0\"10\"20\"30\"40\"50\"Ship1F\/F\"HDM\"Ship1\u0394DC\"HDM\"mLN CD40\"Geometric Mean\"mLN CD86\"0\"50\"100\"150\"200\"250\"Ship1F\/F\"HDM\"Ship1\u0394DC\"HDM\"H\"empty\"CFSE\"Ship1F\/F HDM!empty\"CFSE\"Ship1\u0394DC HDM!Generation\"0\" 1\" 2\" 3\" 4\" 5\" 6\"%\"0\"10\"20\"30\"40\"50\"Ship1\u0394DC HDM!Ship1F\/F HDM!mLN\"C\" Muc5b!relative expression\"0\"2.5\"5.0\"7.5\"0\"1\"2\"3\"4\"5\"Muc5ac!PBS\" HDM\"*\"PBS\" HDM\"*\" 71 3.3.5 Ship1-deficient DCs preferentially prime Th1, versus Th2, responses in vivo in response to HDM-exposure Having ruled out a role for SHIP-1 in DC migration and activation, we examined their ability to generate an appropriately polarized adaptive T cell response to HDM antigen.  CD4+ T cells isolated from HDM-exposed Ship1\u0394DC mice exhibited significantly less IL-13 production and instead produced high levels of IFN\u03b3 (Fig 3.5A-B).  These data suggest that Ship1\u0394DC mice have an impaired ability to polarize na\u00efve CD4+ to the Th2 phenotype that is typically elicited in HDM-induced models of AAI and instead promote the formation of a Th1 response.  In further support of this notion we found significantly reduced expression of Il4, Il5, and Il13 transcripts in the lung tissues of HDM exposed Ship1\u0394DC mice (Fig 3.5C).  This immune skewing was also observed in the humoral response, with reduced levels of the Th2-associated IgE and IgG1 and a compensatory increase in Th1-associated IgG2a (Fig 3.5 D-E) in HDM exposed Ship1\u0394DC mice when compared to their WT counterparts.    72  Figure 3.5. DC expressed Ship1 facilitates Th2 sensitization to HDM (A) Gating strategy for intracellular IL-13 and IFN-\u03b3 expression in CD4+ mLN lymphocytes.  (B) Frequency of cytokine expressing CD4+ cells in the lung and mLN of HDM-exposed mice.  (C) Lung mRNA expression of Il4, Il5 and Il13 relative to Actb. Serum (D) total IgE and (E) HDM-specific IgG1 and IgG2a was measured by ELISA.  Data are means\u00b1s.e.m and are representative of 2 independent experiments, n=4-6 mice per experiment (n.d., not detected), * p<0.05.  While the Th1-biased response in Ship1\u0394DC mice led to a reduction in HDM-induced BAL infiltrates (Fig 3.4A), eosinophilic infiltration (Fig 3.4A-B) and mucus production (3.4C), these mice still exhibited similar numbers of total parenchymal infiltrates (Fig 3.4B) and equivalent lung inflammation determined by histologic evaluation of sections from HDM-exposed Ship1F\/F and Ship1\u0394DC mice (Fig 3.6).  This suggests that while Ship1\u0394DC mice are PBS!Ship1\u0394DC HDM!Ship1F\/F HDM!A!C!B!IFN\u03b3!IL-13!IFN\u03b3!IL-13!mLN: CD4+!Ship1F\/F HDM!mLN: CD4+!Ship1\u0394DC HDM!Lung!0!2!4!6!IL-13! IFN\u03b3!% of CD4+!mLN!IL-13! IFN\u03b3!0!5!10!15!% of CD4+!*! *!Lung Il4!relative expression!0!1!2!3!0!1!2!3!4!5!6!7!Lung Il5!PBS! HDM!0!5!10!15!Lung Il13!D! Serum IgE!PBS! HDM!0!2!4!6!\u03bcg\/mL!E!Ship1F\/F!HDM!Ship1\u0394DC!HDM!HDM-IgG1!*!0!0.25!0.50!0.75!OD450!Ship1F\/F!HDM!Ship1\u0394DC!HDM!0!0.05!0.10!0.15!0.20!0.25!HDM-IgG2a!*!*!*!Ship1\u0394DC!Ship1F\/F!HDM!*!n.d.!PBS! HDM!*! 73 protected from HDM-induced eosinophilic infiltration into the airways (Fig 3.4A), they still develop lung inflammation dominated by macrophages and lymphocytes but not eosinophils.  Figure 3.6. Lung inflammation and mucus production in Ship1\u0394DC mice H&E and PAS stained lung sections from HDM exposed Ship1F\/F and Ship1\u0394DC mice.  Original magnification is 100X, scale bars = 100\u03bcm.  Data are representative of 2 independent experiments, n=4-6 mice per experiment.     To evaluate whether there is a physiological benefit in modifying the type of lung inflammation experienced by Ship1\u0394DC mice, we looked at changes in airway resistance following HDM exposure in response to methacholine challenge.  Indeed, Ship1\u0394DC mice were found to have significantly reduced airway resistance compared to Ship1F\/F mice (Fig 3.7).  This suggests that modification of the type of inflammatory response following HDM exposure in Ship1\u0394DC mice to a Th1 dominated response, while resulting in equivalent amounts of lung inflammation (Fig 3.6), significantly reduces the airway hyperresponsiveness typically associated with the Th2-dominated HDM-induced allergic airway inflammation experienced in wild-type mice. A! Ship1F\/F HDM! Ship1\u0394DC HDM!H&E!PAS! 74  Figure 3.7. Reduced airway hyperresponsiveness in HDM exposed Ship1\u0394DC mice Total lung resistance in response to increasing doses of methacholine delivered through the jugular vein was measured in HDM-exposed Ship1F\/F and Ship1\u0394DC mice. Data are means\u00b1s.e.m and are representative of pooled results from 2 independent experiments, n=10-11 mice per group, * p<0.05.   3.3.6 Ship1-deficient DCs induce Th2 polarization in vitro and in vivo Alveolar macrophages (AM\u03a6s) constitutively reside in the lung and are integral to maintaining lung homeostasis.  Since these express high levels of CD11c, it is likely that Ship1\u0394DC mice delete SHIP-1 in this important leukocyte population as well.  To ensure that the Th1 polarization phenotype observed in Ship1\u0394DC mice was due to loss of Ship1 in DCs and not AM\u03a6s, we isolated splenic DCs from Ship1F\/F and Ship1\u0394DC mice and evaluated their response to HDM stimulation in vitro.  Both WT and Ship1-deficient DCs induced equivalent proliferation of antigen-specific T cells (Fig 3.8A), supporting our findings in vivo (Fig 3.4H).  However, Ship1-deficient DCs produced significantly more IL-12p40 than their WT counterparts (Fig 3.8B) and, when co-cultured with na\u00efve CD4+ T cells, produced *\" *\"Resistance0 1000 2000 30000246Ship1F\/F HDMShip1\u0394DC  HDMMCh (\u00b5g\/kg)cmH2OmL-1s-1 75 significantly more IFN\u03b3 (Fig 3.8C), suggesting an increased ability to promote Th1 responses.  Adoptive transfer of in vitro HDM-pulsed Ship1-deficient DCs into na\u00efve C57Bl\/6 recipients resulted in reduced eosinophil infiltrates into the airways and lung parenchyma (Fig 3.8D-E), an increased frequency of CD4+IFN\u03a5+ T cells in the mLNs (Fig 3.8F) and a significant reduction in serum IgE (Fig 3.8G).  Thus, adoptive transfer of Ship1-deficient DCs recapitulates the effects we observe in Ship1\u0394DC mice.   Figure 3.8. Ship1-deficient DCs induce Th1 polarization in vitro and in vivo to HDM (A) Proliferation of CFSE-labeled CD4+ OT-II cells cultured with OVA\/HDM pulsed Ship1F\/F and Ship1\u0394DC DCs.  (B) IL-12p40 production from HDM stimulation Ship1F\/F and Ship1\u0394DC DCs.  (C) IFN\u03b3 production from CD4+ OT-II cells cultured with non-pulsed (media) or OVA\/HDM pulsed Ship1F\/F and Ship1\u0394DC DCs.  (D) BAL and (E) lung leukocyte differentials and cell counts from mice adoptively transferred HDM-pulsed WT or Ship1\u0394DC DCs.   (F) Ship1\u0394DC!Ship1F\/F !A\" Ship1\u0394DC!Ship1F\/F!Generation\"0 1 2 3 4 5 6 7empty\"CFSE\"0\"10\"20\"30\"%\"B\"Ship1\u0394DC!Ship1F\/F !ng\/mL\"0\"20\"40\"60\"80\" IL-12p40\" C\"OVA\/HDM\"media\"0\"5\"10\"15\" IFN\u03b3\"*\" *\"D\"Total cells\"Macrophages\"DCs\"T cells\"B cells\"Neutrophils\"Eosinophils\"Total Cells (x106 )\"BALF\"0\"0.5\"1.0\"1.5\"2.0\"2.5\"ng\/mL\"*\"E\"Total cells\"Macrophages\"DCs\"T cells\"B cells\"Neutrophils\"Eosinophils\"Total Cells (x106 )\"0\"Lung\"*\"*\" *\"2\"4\"6\"8\"F\"% of CD4+\"mLN\"IL-13\"IFN\u03b3\"0\"2\"4\"6\"8\" *\"Ship1\u0394DC DCs!Ship1F\/F DCs !G\"Ship1\u0394DC\"DCs\"Ship1F\/F\"DCs !0\"0.5\"1.0\"1.5\"ng\/mL\"serum IgE\"*\" 76 Frequency of intracellular cytokine expressing CD4+ cells in the mLN of HDM-exposed mice.  (G) Serum IgE levels in Ship1F\/F and Ship1\u0394DC DC transferred animals was quantified by ELISA.  Data are means\u00b1s.d. (A-C) or means\u00b1s.e.m. (D-G) and are representative of 3 independent experiments (A-C) or 1 experiment (D-G, n=5 mice per experiment), * p<0.05.  3.4 Discussion Allergen exposure activates the PI3K pathway and thereby facilitates inflammatory responses[185].  Correspondingly, inhibition of PI3K activity has been found to be effective in treating AAI in animal models[174-179, 185].  In leukocytes, the lipid phosphatase SHIP-1 acts as a key negative regulator of PI3K signaling, and mice lacking this enzyme develop spontaneous airway inflammation and have a reduced lifespan.  These severe hematological defects could serve to obscure its function in specific leukocyte subsets and here we have used lineage-specific deletion to examine its composite role in allergic disease.  We show that while deletion of Ship1 in the B cell lineage has no effect, deletion of Ship1 in either the T cell or DC compartment protects mice from Th2 disease by inducing a Th1-biased adaptive response to the, typically, Th2-inducing HDM allergen.  This correlates well with recent clinical data showing that SHIP-1 is a viable and attractive therapeutic target for treating allergen induced airway inflammation[117].  It is possible that specific targeting of SHIP-1 activity, either positively or negatively, in a lineage specific manner could lead to greater reductions in allergic airway inflammation.  SHIP-1 is known to be a key intermediary of signaling through the inhibitory motif of the Fc\u03b3RIIB receptor[124] and plays an important role in B cell development, survival, isotype class switching and antibody production[128, 129, 186, 187].  Surprisingly, loss of Ship1 in B cells did not affect HDM-induced AAI, as Ship1\u0394B cell mice had similar levels of leukocyte infiltrates, mucus production and Th2-associated cytokines compared to their WT  77 counterparts.  There was also no observable defect in their humoral response, with equal levels of both total serum IgE as well as HDM-specific IgG1. This is in stark contrast to previous findings documenting impaired antibody responses in B cell specific Ship1-deficient mice following infection or immunization[129].  These discrepancies could reflect the types of antigen used and resulting immune response elicited, as well as differences in the route of immunization.  Previously, lineage-specific deletion of Ship1 in T cells has been shown to enhance CD8+ cytotoxic T cell activity, increase T-bet expression and impair the ability to mount an effective Th2 response to helminth infections[134].  In support of these reports, we found that Ship1\u0394T cell mice fail to mount a robust Th2 response to HDM antigen exposure and instead produce a strong Th1 response.  Protection from Th2 disease is likely due to Th1 skewing since we did not observe significant differences in Treg frequencies in Ship1\u0394T cell mice.  This supports previous findings and suggests that while deletion of Ship1 in either the myeloid or early lymphoid lineages leads to increased Treg frequencies, deletion at later stages of lymphocyte development does not affect Treg numbers[134, 135, 188].  While in vitro experiments have suggested a role for SHIP-1 in regulating DC development, maturation and T cell interactions, its role in vivo has not been explored[141, 142, 183].  In this study, we used targeted deletion in dendritic cells to evaluate its function in development of adaptive immune responses.  Ship1\u0394DC mice failed to mount an effective Th2 response to HDM antigen and instead produced an aberrant Th1 response that lead to reduced eosinophilia, mucus production and airway hyperresponsiveness that are hallmarks  78 of HDM-induced AAI.  While Ship1-deficient DCs were able to phagocytose and process antigen, migrate to the lymph node and induce T cell proliferation, they induced Th1 rather than Th2 polarization of na\u00efve CD4+ T cells.  This could be due to alterations in the factors secreted by Ship1-deficient DCs, since previous reports have found that loss of Ship1 in myeloid cells can result in aberrant production of IL-12 and a skewed Th1 response to intestinal helminth infection[189].  It is important to note that using Cre recombinase expressed under the control of the CD11c promoter likely leads to deletion of Ship1 expression in alveolar macrophages (AM\u03a6s) in addition to DCs.  Using in vitro and in vivo assays with DCs obtained from Ship1F\/F and Ship1\u0394DC mice, we showed that loss of Ship1 in DCs alone was sufficient to induce Th1 polarization, as Ship1-deficient DCs produced high levels of IL-12p40 following HDM stimulation and preferentially induced Th1 polarization of wild-type T cells in vitro and in vivo.  This, however, does not rule out a potential role for SHIP-1 in AM\u03a6 development, survival or function as we did see a small but significant increase in AM\u03a6s in the lungs of Ship1\u0394DC mice.  In summary, the severe pathologies found in constitutive Ship1-\/- mice renders them difficult to evaluate in disease models.  Here we have successfully used lineage-specific deletion of Ship1 from either B cells, T cells or DCs to further reveal its functional significance in allergic responses and have uncovered novel roles for T cells and DCs.  In aggregate, our data suggest that the temporal inactivation of Ship1 in these lineages could prove therapeutic in instances of severe Th2-driven lung inflammatory disease and justify further investigation of the efficacy of pharmacological inhibitors of SHIP-1.    79  Chapter 4. Dendritic cell expression of Ship1 regulates immunity to helminth infection                      80 4.1 Introduction Immunity to the intestinal helminth parasite Trichuris muris is critically dependent on the formation of an appropriate adaptive immune response.  If parasite infection leads to a type 2-immune response, characterized by T-helper type 2 (Th2) CD4+ T cells, the outcome is a clearance of worms and \u201cresistance\u201d to infection.  This is accomplished by production of the Th2 cytokines IL-4 and IL-13 that serve to promote isotype class switching and subsequent production of IgE and IgG1 by plasma cells, increase mucus production from goblet cells and increase smooth muscle contractility to facilitate clearance of the infection[162, 163, 190, 191].  Conversely, if infection leads to the formation of a T-helper type 1 (Th1) polarized immune response the end result is \u201csusceptibility\u201d, an inability to clear the parasite and a chronic infection[164, 192].  This is due to production of IL-12, IL-18 and IFN\u03b3, which are ineffective in eliminating the parasite and, in some cases, facilitate the chronic infection.  While it\u2019s clear that a Th2 response is required for development of protective immunity, the events leading to the induction of a Th2 response are still under debate.  Dendritic cells (DCs) are the predominant antigen-presenting cells (APC) of the immune system, responsible for detecting pathogen-associated molecular patterns (PAMPs) from invading species through expression of various pattern recognition receptors (PRRs).  DCs rapidly infiltrate the intestine following Trichuris infection[193], and significantly more DCs are found in the intestines of resistant animals (Balb\/c, C57Bl\/6) compared to susceptible mice that fail to clear the infection (AKR), suggesting an important role for DCs in priming an appropriate adaptive response[194].  While this suggests an important role for DCs in  81 facilitating immunity to Trichuris infection, few studies have examined which DC subsets and which functional molecules are required and how they guide the immune response to be protective or to facilitate chronic infection.  Previously, we examined the response of mice lacking the DC and T cell specific integrin, CD103, which facilitates the trafficking of these cells to mucosal epithelia and is known to be expressed by a subset of T cells that regulate tolerance.  Surprisingly, loss of CD103 from DCs (as well as CD103+ T cells in Itgae-\/- mice) had no effect on the ability to clear the infection[195].  In summary, the role of DCs in resistance or susceptibility to Trichuris infection remains enigmatic.   The phosphoinositide 3-kinase (PI3K) pathway is involved in a number of cellular processes and its activity is typically associated with cellular survival, migration and cytokine production.  Negative regulation of PI3Ks is achieved by the SH2-containing inositol 5\u2019-phosphatase 1 (Ship1, Inpp5d), which serves to hydrolyze the 5\u2019 phosphate of PI(3,4,5)P3 generated by PI3K activity to produce PI(3,4)P2.  Ship1 expression is restricted to the hematopoietic lineages, and Ship1-deficient mice (Ship1-\/-) suffer a host of hematological disorders, including enhanced myelopoeisis, reduced lymphopoiesis and erythropoiesis, Th1-biased lymphocyte responses, lung consolidation and a shortened lifespan[120, 121, 134].  While SHIP-1 is known to influence DC maturation and function in vitro, the role of SHIP-1 in DC function in vivo has yet to be explored[141, 142, 183].  Previous reports have found that Ship1 expression increases dramatically in the intestine following Trichuris infection[189].  Additionally, loss of Ship1 throughout the hematopoietic system, or specifically in myeloid cells (macrophages and neutrophils), leads to aberrant IL-12 production and a chronic infection[189].  Here, we have generated dendritic cell-specific  82 Ship1-deficient mice (Ship1\u0394DC) and show that loss of Ship1 expression specifically in DCs is sufficient to induce increased IL-12 production and susceptibility to Trichuris infection.  Our results indicate that perturbation of DC function through the loss of Ship1 impairs the ability to mount an appropriate Th2 adaptive immune response to Trichuris.  These results argue for a critical role of SHIP-1 in the early phase of DC-dependent T cell polarization and subsequent protective immunity.  4.2 Methods 4.2.1 Mice Inpp5dF\/F (Ship1F\/F) mice were described previously and provided by W. Kerr[181].  Itgax-Cre mice were obtained from the Jackson Laboratory (Bar Harbor, ME).  Animals were bred and maintained in a SPF environment at the Biomedical Research Centre and all animal work was approved by the Animal Care Committee of UBC.  4.2.2 Spleen and peripheral blood leukocyte analysis Peripheral blood was sampled by saphenous vein and collected into microvette EDTA coated tubes (Sarstedt, Montreal, QC).  Mice were euthanized via CO2 exposure and spleens were passed through a 70\u03bcm cell-strainer to obtain a single cell suspension.  Red blood cells were lysed in peripheral blood and splenocyte samples using ammonium chloride buffer (150mM NH4Cl, 1mM KHCO3, pH 7.3).  Total splenocyte cells were enumerated using a hemocytometer.  Leukocyte differentials were obtained using flow cytometry and fluorescently conjugated antibodies to CD3, CD11b and Gr1 (eBioscience,  83 San Diego, CA); CD11c, CD19 and CD45 (in-house).  Samples were collected on BD LSRII (San Jose, CA) and analyzed using FlowJo (TreeStar, San Carlos, CA).  4.2.3 T. muris infection Mice were infected on day 0 with 225-250 embryonated eggs and parasite burdens were quantified on day 21 post-infection.  Trichuris muris excretory-secretory antigens and eggs were collected as described previously[196].  4.2.4 Histology Cecal tissues were fixed overnight in 10% buffered formalin and paraffin-embedded.  5\u03bcm thick tissue sections were stained with periodic acid-Schiff (PAS) for analysis.  4.2.5 Immune response Mesenteric lymph nodes (mLNs) were excised and passed through a 70\u03bcm cell strainer to generate a single cell suspension.  mLN cells (4x106\/mL) were cultured for 72hrs in media containing 1\u03bcg each of antibodies against CD3 (145-2C11) and CD28 (37.51, eBioscience).  Cytokine production from cell free supernatant was quantified by ELISA using commercially available antibodies (eBioscience).  Total serum IgE was quantified by ELISA (BD Biosciences, San Jose, CA).  Trichuris-specific serum IgG\u2019s were determined using Trichuris antigen coated ELISA plates (5\u03bcg\/mL overnight in carbonate buffer) and HRP-conjugated mouse IgG1 and IgG2a antibodies followed by TMB (BD).   84 4.2.6 Flow cytometry Isolated mLN cells were stimulated with 50ng\/mL of PMA and 750ng\/mL of ionomycin (Sigma, St Louis, MO) in the presence of Brefeldin A (eBioscience) for 4 hours.  Intracellular flow cytometry was performed using antibodies to CD4, CD11c, CD45, IL-12p40, IL-13 and IFN\u03b3.  Dead cells were excluded using eFluor fixable viability dyes and fixation and permeabilization was performed using the IC staining kit (eBioscience).  Samples were acquired on a BD LSRII and data analysis was performed with FlowJo software.  4.2.7 RNA isolation and qPCR Proximal colon tissue samples were homogenized with Trizol and RNA was reverse transcribed using a cDNA synthesis kit (Life Technologies, Carlsbad CA).  qPCR was performed with Sybr green (KAPA Biosystems, Woburn, MA) using gene specific primer pairs listed in table 4.1.  Values are expressed relative to Actb.  Table 4.1. Primer list Forward and reverse primer pairs for gene specific detection by quantitative RT-PCR.  Primers were used at a final concentration of 200mM.  Primer& Forward&(5\u2019\/3\u2019)& Reverse&(5\u2019\/3\u2019)&Actb% GGCTGTATTCCCCTCCATCG% CCAGTTGGTAACAATGCCATGT%Il4% TCGGCATTTTGAACGAGGTC% CAAGCATGGAGTTTTCCCATG%Il5% GATGAGGCTTCCTGTCCCTACTC% TCGCCACACTTCTCTTTTTGG%Il12b% TGGTTTGCCATCGTTTTGCTG% ACAGGTGAGGTTCACTGTTTCT%Il13% CCTGGCTCTTGCTTGCCTT% GGTCTTGTGTGATGTTGCTCA%Ifng% GGATGCATTCATGAGTATTGCC% CCTTTTCCGCTTCCTGAGG%Tnfa% CATCTTCTCAAAATTCGAGTGACAA% TGGGAGTAGACAAGGTACAACCC%Relmb% ATGGGTGTCACTGGATGTGCTT% AGCACTGGCAGTGGCAAGTA%% 85 4.2.8 In vivo antibody treatment Isotype and IL-12p40 (clone C17.8) antibodies were purchased from Bio-X-Cell (West Lebanon, NH).  Mice received 1mg of antibody i.p. every four days starting from day 4-20 post infection.  4.2.9 Statistics Results are presented as mean\u00b1SEM.  Statistical significance was determined by the Student\u2019s t-test.  4.3 Results 4.3.1 DC specific deletion of Ship1 results in splenomegaly and expansion of circulating DCs Constitutive deletion of Ship1 leads to a severe myeloproliferative disorder, resulting in lung consolidation and a shortened lifespan due to deregulated PI3K activity in multiple hematopoietic subpopulations[120, 121, 197].  This severe immune deregulation makes it difficult to examine the lineage-specific effects of SHIP-1 activity in vivo.  While SHIP-1 has a well-established role in regulating dendritic cell (DC) function in vitro [141, 142, 183], the in vivo significance of SHIP-1 in DCs has yet to be explored.  By crossing Ship1F\/F (wild-type) mice with Itgax-cre (Cd11c-cre) transgenic mice we were able to generate mice with a specific deletion of Ship1 in DCs (Ship1\u0394DC).   Ship1\u0394DC mice do not develop the spontaneous lung consolidation found in Ship1-\/- mice (Fig 3.1) but do have enlarged spleens compared to wild-type (Ship1F\/F) controls (Fig 4.1A).  Differential leukocyte analyses reveal a moderate, but significant, increase in the frequency of B cells in the  86 spleens of Ship1\u0394DC mice at the expense of T cells and macrophages (Fig 4.1B).  Peripheral blood analyses of na\u00efve Ship1F\/F and Ship1\u0394DC mice reveals a significant increase in circulating CD11c+ DCs in Ship1\u0394DC mice without any significant decrease in peripheral lymphocytes when compared to Ship1F\/F mice (Fig 4.1C-D).   Figure 4.1. Ship1\u0394DC mice have enlarged spleens and increased circulating DCs (A) Total and (B) differential leukocyte analysis from na\u00efve Ship1F\/F and Ship1\u0394DC mice.  Peripheral blood (C) dendritic cell (CD11c+) and (D) lymphocyte (CD3+ and CD19+) frequencies were quantified by flow cytometry.  Data are representative of 2 independent experiments (n=3-6), * p<0.05.  4.3.2 Ship1\u0394DC mice are susceptible to Trichuris muris infection Previously we showed that Ship1 expression increases following helminth infection and that ubiquitous Ship1-\/- (cShip1-\/-) mice and mice lacking Ship1 expression in the myeloid and neutrophil populations (Ship1\u0394LysM) are susceptible to infection with the intestinal helminth, Trichuris muris[189].  Here we sought to examine the influence of DC Spleen CountShip1F\/F Ship1\u0394DC 050100150Total cells (x106)Spleen DifferentialMacrophagesDCsT cellsB cellsNeutrophils020406080Ship1F\/F Ship1\u0394DC % of CD45+LymphocytesShip1F\/FShip1\u0394DC0255075% of CD45+Dendritic CellsShip1F\/FShip1\u0394DC01234567% of CD45+A! B!C! D!*\"*\"*\"*\"*\"*\" 87 expression of Ship1 in response to infection with Trichuris muris.  Ship1F\/F and Ship1\u0394DC mice were infected with 250 embryonated Trichuris eggs and worm burdens were examined 21 days post infection.  Surprisingly, Ship1\u0394DC mice failed to clear the infection (Fig 4.2A) while, as expected, wild-type mice were able to expel worms by day 21.  Although the intestines of na\u00efve Ship1F\/F and Ship1\u0394DC mice were indistinguishable histologically prior to infection, Trichuris-infected Ship1\u0394DC mice displayed increased inflammatory cell infiltration, a reduced frequency of goblet cells, submucosal edema and parasites attached to the epithelium in cecal tissue samples (Fig 4.2B).  From this we conclude that DC expression of Ship1 is required for clearance of Trichuris infection.     88   Figure 4.2. Dendritic cell expression of Ship1 is required for immunity to Trichuris infection (A) Ship1F\/F (wild-type) and Ship1\u0394DC mice were infected with 250 Trichuris muris eggs.  Worm burdens were determined microscopically from cecal contents 21 days post infection.  (B) PAS stained cecal section from na\u00efve and Trichuris infected Ship1F\/F and Ship1\u0394DC mice.  Original magnification 100X.  Data are representative of 1 independent experiment (n=5).   A!B!Worm CountsInpp5dfl\/fl Tm Inpp5d\u0394DC Tm0255075100125150175200225worm #n.d.!T. muris!infected!Ship1\u0394DC!na\u00efve !Ship1F\/F! 89 4.3.3 DC expression of Ship1 facilitates Th2 dependent immunity following Trichuris infection We next sought to evaluate the immune response elicited in Trichuris infected wild-type and Ship1\u0394DC mice.  We found that Ship1\u0394DC mice mounted an aberrant Th1 response following infection, as re-stimulation of the draining mesenteric lymph node (mLN) displayed increased frequency of IFN\u03b3+ CD4+ T cells (Fig 4.3A-B).  In support of this Th1-bias in Trichuris infected Ship1\u0394DC mice, proximal colon RNA samples showed a significant reduction in the expression of the Th2 associated genes Il5 and Il13 and a significant increase in expression of the Th1 associated genes Il12b and Ifng (Fig 4.3C), as well as a significant increase in secreted IFN\u03b3 and IL-12p40 from re-stimulated mLNs (Fig 4.3D).  We also found significantly increased expression of Tnfa and reduced expression of Relmb (resistin-like molecules beta) in RNA samples of Trichuris infected Ship1\u0394DC mice (Fig 4.3C).  In support of this Th1-biased response, infected Ship1\u0394DC mice had significantly reduced serum levels of IgE and Trichuris-specific IgG1 than infected wild-type mice (Fig 4.3E-F).  These data suggest the impaired expulsion of worms in Ship1\u0394DC mice is due to an aberrant Th1-polarized adaptive immune response in lieu of the normal Th2 response elicited in wild-type mice that would normally result in worm expulsion and resistance to chronic infection.   90   Figure 4.3. Dendritic cell expression of Ship1 facilitates Th2 polarization following Trichuris infection (A) Gating strategy for IL-13 and IFN\u03b3 expressing cells from re-stimulated mLNs, gated on CD4+CD45+ cells. (B) Quantification of cytokine expressing CD4+ T cells in the mLNs of Trichuris infected Ship1F\/F and Ship1\u0394DC mice. (C) Quantitative RT-PCR from proximal colon RNA collected from na\u00efve and Trichuris infected mice. (D) Secreted cytokines collected in the A! B!Ship1\u0394DC Tm\"Ship1F\/F Tm\"IL-13\"IFN\u03b3\"mLN CD4 ICIL-13 IFN\u03b30510152025Ship1F\/F TmShip1\u0394DC Tm% of CD4+*\"C!Ship1F\/FShip1\u0394DCIl4naive Tm0.00.20.40.60.81.0relative expressionIl5naive Tm0.00.51.01.5relative expressionIl13naive Tm01234relative expressionIfngnaive Tm02468relative expression*\" *\"*\"Il12bnaive Tm05101520relative expression*\"Tnfanaive Tm0123relative expression*\"Relmbnaive Tm0246810relative expression*\"IFN\u03b3unstim \u03b1CD3\/CD280200400600800ng\/mLIL-12p40unstim \u03b1CD3\/CD280.00.51.01.52.0ng\/mLD!*\" *\"IL-13unstim \u03b1CD3\/CD280.00.20.40.6ng\/mLE!Ship1F\/FShip1\u0394DCSerum IgEnaive Tm012345\u00b5g\/mLF!Tm IgG110 100 1000 100000.00.10.20.30.40.50.60.7Serum Dilution (1\/n)A450*\" *\" *\"*\" *\" *\" *\" *\"Tm IgG2a10 100 1000 100000.00.10.20.30.40.50.60.7Serum Dilution (1\/n)A450Ship1fl\/fl TmShip1\u0394DC Tm*\" 91 supernatant of \u03b1CD3\/CD28 re-stimulated mLN cells were quantified by ELISA. (E) Total serum IgE from na\u00efve and Trichuris infected mice was quantified by ELISA. (F) Trichuris-specific IgG1 and IgG2a levels were quantified by ELISA. Trichuris = Tm, mesenteric lymph node = mLN.  Data are representative of 1 independent experiment (n=5), * p<0.05.     4.3.4 Neutralization of IL-12p40 in Trichuris-infected Ship1\u0394DC mice promotes resistance Previous reports of Trichuris infection in Ship1-\/- mice have implicated deregulated IL-12 production as a factor leading to susceptibility to infection, although a cellular source of IL-12 was not determined.  We have found here that Ship1\u0394DC mice have increased production of IL-12p40 in mLN cultures (Fig 4.3D) and sought to examine whether neutralizing IL-12p40 with an antibody would facilitate clearance of helminth infection in Ship1\u0394DC mice.  Neutralization of IL-12p40 enhanced expulsion of Trichuris in Ship1\u0394DC mice as demonstrated by reduced worm burdens at day 21 when compared to mice that received an isotype-matched control antibody (Rat Ig) (Fig 4.4A).  Treatment with antibodies against IL-12p40 also lead to a reduction in the Th1 response with reduced IFN\u03b3+ CD4+ T cells, Ifng mRNA expression and IFN\u03b3 secretion from re-stimulated mLN cells (Fig 4.4B-D) and increased mRNA expression of the Th2 associated genes Il4, Il5, Il13 (Fig 4.4C).  In addition, neutralization of IL-12p40 also lead to a significant increase in serum Trichuris-specific IgG1 levels, although serum IgE levels were not significantly increased.  From these data we conclude that Ship1 is involved in the negative regulation of IL-12p40 release by dendritic cells, and neutralization of IL-12p40 in Ship1\u0394DC mice facilitates resistance to Trichuris infection by establishing the appropriate Th2 response.   92   Figure 4.4. Neutralization of IL-12 in Trichuris-infected Ship1\u0394DC mice facilitates immunity to infection (A) Day 21 worm counts from Ship1\u0394DC mice treated i.p. with antibodies to IL-12 or an isotype control (Rat Ig). (B) PAS stained cecal sections from Trichuris infected mice.  Original magnification 200X. (C) Intracellular IL-13 and IFN\u03b3 expression in CD4+ T cells isolated from the mLN was measured by flow cytometry. (D) Quantitative RT-PCR from proximal colon RNA collected from Trichuris infected mice. (E) Secreted cytokines collected in the supernatant of Tm-IgG110 100 10000.00.20.40.60.81.0Serum Dilution (1\/n)A450A! C!Worm CountsShip1\u0394DC + Rat Ig Ship1\u0394DC + \u03b1IL-12050100150200250worm #Ship1\u0394DC + Rat IgShip1\u0394DC + \u03b1IL-12IL-13 IFNg05101520% of CD4+*\"F!Serum IgEShip1\u0394DC + Rat Ig Ship1\u0394DC + \u03b1IL-120.00.51.01.5\u00b5g\/mLG!Ship1\u0394DC + Rat IgShip1\u0394DC + \u03b1IL-12Il4Rat Ig \u03b1IL-12 Tm0.00.10.20.30.40.5relative expressionIl5Rat Ig \u03b1IL-12 Tm0.00.51.01.5relative expressionIl13Rat Ig \u03b1IL-12 Tm01234relative expressionIfngRat Ig \u03b1IL-12 Tm020406080100relative expressionD!TnfaRat Ig \u03b1IL-12 Tm0123relative expressionE!Ship1\u0394DC + \u03b1IL-12Ship1\u0394DC + Rat IgmLN IFN\u03b3unstim \u03b1CD3\/CD280100200300400ng\/mLmLN IL-12p40unstim \u03b1CD3\/CD280.00.51.01.52.0ng\/mLmLN IL-13unstim \u03b1CD3\/CD280200400600800pg\/mL*\"*\"*\"*\"*\"*\"*\" *\" *\"*\" *\"*\"*\"*\"*\" *\" *\" *\"B! Ship1\u0394DC\"Rat Ig\"Ship1\u0394DC\"\u03b1IL-12\" 93 \u03b1CD3\/CD28 re-stimulated mLN cells were quantified by ELISA. (F) Total serum was quantified by ELISA. (G) Trichuris-specific IgG1 levels were quantified by ELISA.  Data are representative of 1 independent experiment (n=4-5), * p<0.05.  4.4 Discussion  Here, we demonstrate that the specific loss of SHIP-1 from DCs leads to splenomegaly and increased circulating DCs.  DC-specific SHIP-1 loss also results in enhanced production of IL-12, promoting an adaptive Th1 response and chronic infection following Trichuris infection.  Blockade of IL-12 in Ship1\u0394DC mice with a neutralizing antibody restored the formation of a protective Th2 response and clearance of the infection.  This highlights the important role DCs play in shaping the adaptive immune response to Trichuris, and reveals how a subtle perturbation in the normal dampening of PI3K activity can dramatically alter the development of anti-helminth immune responses.  While the initiation of a normal type 1 immune response is well established, with DCs acting as the dominant APC to na\u00efve CD4+ T cells and producing IL-12 to promote Th1 polarization, the steps involved in the initiation of type 2 responses are still under debate.  This is, in part, due to the fact that DCs do not produce large amounts of IL-4, a key factor required for promoting na\u00efve CD4+ T cell polarization and maturation into a Th2 cell.  DCs clearly have an important role in immunity to helminth infection; in elegant experiments where CD11c+ cells were inducibly-depleted using a diphtheria toxin-dependent ablation system, helminth-induced protective Th2 responses were severely impaired[198, 199].  Our results are consistent with this observation and show that deregulated PI3K signaling activity (through the deletion of Ship1 specifically in DCs, but not in other leukocyte  94 populations) results in increased production of IL-12 and a Th1-biased immune skewing that impaired immunity to Trichuris-infection. Although these results suggest a pivotal role for DCs in helminth immunity, it is also likely that they require the assistance of other innate leukocyte populations in order to prime Th2 responses.  Indeed, experiments aimed at examining the need for MHC class II expression by distinct subsets of APCs have shown that expression of MHC-II by DCs alone, and not by other leukocyte populations, is insufficient to confer resistance to chronic Trichuris-infection[21].  This suggests that other MHC class II positive innate populations (such as mast cells[200], basophils[20, 22], eosinophils[201, 202] and ILC2s[26] macrophages and neutrophils) are required to support DCs in the formation of a protective Th2 response.  The influence of PI3K activity in regulating IL-12 production from DCs is controversial, and could be due to differing effects and expression patterns of the various PI3K isoforms.  PI3K exists as heterodimers containing a regulatory and a catalytic subunit and are grouped into three different classes: class I, class II and class III.  The most widely studied are the class IA PI3Ks, which consist of three different catalytic subunits (p110\u03b1, p110\u03b2 and p110\u03b4) and five distinct regulatory subunits (p85\u03b1, p55\u03b1, p50\u03b1, p85\u03b2 and p55\u03b3).  Consistent with the results presented here, siRNAs targeting p110\u03b1 and p110\u03b2 in human APCs in response to LPS stimulation, p110\u03b2 expression was found to positively correlate with JNK activity and IL-12 production, suggesting enhanced PI3K activity could, indeed, support increased production of IL-12[203].  Surprisingly, however, others have shown that deletion of the regulatory subunit p85\u03b1 in Pik3r1-\/- mice (p85\u03b1-\/-), or pharmacological  95 inhibition of PI3K activity using wortmannin leads to increased production of IL-12, suggesting a negative regulatory role for PI3Ks in IL-12 production[204].  Thus there are data to support both positive and negative roles for PI3K activity in IL-12 production and further studies are warranted to better delineate which PI3K isoforms and cell types regulate the net production of IL-12.  Previously, we reported that Ship1\u0394LysM mice, which lack Ship1 expression in macrophages and neutrophils, also displayed heightened IL-12 production in resting mice and Trichuris-infected mice, suggesting an important role for Ship1 in regulating IL-12 production in multiple leukocyte populations[189].  The current data expand on this observation and suggest that, in addition, DCs too, can regulate expression of this critical effector and tip the balance from Th2 to Th1 dominated immune responses.  In summary, we show that selective deletion of Ship1 expression in DCs (Ship1\u0394DC) renders mice susceptible to infection with Trichuris.  This is the result of increased production of IL-12 in Ship1\u0394DC mice, leading to a reduced Th2 response and instead a Th1-dominated response featuring high levels of IFN\u03b3 and a chronic infection.  Neutralization of IL-12 in Ship1\u0394DC mice enhanced the formation of a Th2 response and facilitated resistance to Trichuris infection.    96 Chapter 5. Discussion       97 5.1 Summary The mucosal barriers of the lung and gut serve as important interfaces between the host and environment and are integral for gas and nutrient exchange.  They are, however, constantly exposed to environmental antigens and must navigate a delicate balance between tolerance and inflammation to appropriately respond to harmless, or harmful antigens, respectively.  This requires the coordinated cross talk between the epithelial barrier and resident leukocytes, including innate lymphoid cells (ILCs), dendritic cells (DCs), T cells and B cells, to integrate the antigenic stimulus and respond with an appropriate response.  Using various transgenic mice, I explored the contributions of a recently characterized innate cell population, ILC2s, and the inositol phosphatase SHIP-1 in the initiation and maintenance of Th2 immunity at mucosal surfaces.  In Chapter 2, I addressed the role of the group 2 innate lymphoid cells (ILC2s) in the regulation of both Th2, and Th1\/Th17 adaptive immune responses in the lung. Using bone marrow chimeras I was able to generate ILC2-deficient mice, and explore the contribution of ILC2s to the formation of adaptive immune responses in the lung.  Interestingly, I found that ILC2s were critical for local sensitization and subsequent robust Th2 immunity in the lung in response to the physiologically relevant antigen HDM.  Surprisingly, and despite their role in local sensitization, systemic deliver of antigen, with or without an additional adjuvant, obviated the requirement of ILC2s for initiating Th2 immune responses in the lung.  This selective role for ILC2s in the lung during local sensitization was specific for the initiation of Th2 adaptive immune responses, as these cells were completely dispensable for local sensitization to the Th1\/Th17-inducing antigen SR.  98  The implication of ILC2s as important facilitators of Th2 adaptive responses has significant clinical relevance due to the finding of increased ILC2s in the lungs of human allergic patients[32, 65].  While ILC2s are potent producers of IL-5 and IL-13 at early stages of the immune response, their contribution is taken over at later timepoints by Th2 cells[25].  This suggests that therapeutic targeting of ILC2s, after sensitization and a robust Th2 response has been initiated, may not yield improved clinical outcomes.  The use of ILC2-deficient mice is hampered by the lack of a true ILC2-specific marker.  Indeed, while Rora is highly expressed by ILC2s it is also expressed by Th17 cells, another cell type associated with allergic asthma, particularly steroid resistant and severe asthma[205].  While typically considered a pro-inflammatory cytokine, IL-17A has been associated with some anti-inflammatory properties, reducing TNF-induced production of some chemokines (CCL5, CCL27, CX3CL1) and vascular cell adhesion molecule-1 (VCAM-1) in mesenchymal cells[206-209].  In the context of allergic inflammation, IL-17-induced signaling is required for the initiation of inflammation, however administration of exogenous IL-17 after allergic sensitization reduces airway hyper-responsiveness and eosinophil infiltration, suggesting a time-dependent anti-inflammatory role of IL-17A[210, 211].  Some reports suggest the anti-inflammatory actions of IL-17A are dose dependent, with a greater inhibitory effect at lower concentrations[209].  Importantly, we did observe reduced IL-17A production in HDM-exposed Rorasg\/sg BMT mice compared to their wild-type controls, which could conceivably have led to an enhanced anti-inflammatory effect leading to the reduced inflammation observed in these mice (Fig. 2.4).  It should be noted, however, that similarly reduced levels of IL-17A were observed in OVA-exposed Rorasg\/sg BMT mice, both with and without alum,  99 and this did not result in any measurable reduction in airway inflammation (Fig. 2.6-7).  In some models of allergic airway inflammation, IL-17 production can promote airway hyper-responsiveness and smooth muscle contraction while having no measurable effect on airway inflammation[212].  It would be worthwhile to evaluate AHR responses in OVA-exposed Rorasg\/sg BMT mice to examine if they have altered airway responsiveness despite comparable levels of airway inflammation.  To further discern whether the protection observed in the ILC2-deficient Rorasg\/sg BMT mice is indeed due to a lack of ILC2s or a reduced Th17 response following HDM challenge, we could attempt an adoptive transfer of ILC2s into Rorasg\/sg BMT mice to rescue the phenotype.  Similar experiments have successfully been performed in papain challenged Rorasg\/sg BMT mice[25], further suggesting that an altered Th17 response does not significantly contribute to allergic sensitization in these mice.  Additionally, there was a small but detectable population of radio-resistant, radiation-insensitive, ILC2s found in Rorasg\/sg BMT mice, identified by their staining for the host marker CD45.1.  Its possible that the low frequency ILC2s found in Rorasg\/sg BMT mice facilitated sensitization to HDM antigen, and the contribution of ILC2s in our model may be undervalued.  Transplantation of Rorasg\/sg bone marrow into hosts already deficient in ILC2s, such as Rag-\/-Il2rg-\/- mice that lack both the RAG gene as well as the IL-2R\u03b3 chain, would likely yield a more robust deficiency in ILC2s.  New ILC2-deficient mouse models have been recently generated that both allow for the temporal ablation of ILC2s via the administration of diphtheria toxin, or allow for the deletion of Rora specifically in lymphocytes by using a \u201cfloxed\u201d Rora gene and an Il7r-Cre expressing mouse[26].  While this eliminates the requirement for bone marrow  100 transplantation, it doesn\u2019t address the issue of Rora expression in Th17 cells.  An improved model would likely consist of Cre expression under control of the Rora gene to delete a gene specific for ILC2s and not Th17 cells, such as Gata3.  The important role of ROR\u03b1 in ILC2 development could be explored as a therapeutic target through the screening and identification of agonists and antagonists.  Natural and synthetic ligands have already been discovered[213, 214], and the development of antagonists, particularly ones that do not cross the blood brain barrier, could prove useful for inhibiting ILC2 development and\/or Th17 responses.  In Chapter 3, I examined the lineage-specific role of the lipid phosphatase SHIP-1, a pan-hematopoietic negative regulator of PI3K signaling, in the initiation of Th2 immune responses in the lung.  Although I was unable to evaluate the importance of this signaling mediator in ILC2s due to a lack of the appropriate Cre strains, I was able to evaluate its significance selectively in T cells, B cells and DCs.  Loss of Ship1 specifically in B cells did not affect allergic sensitization or humoral immune responses to HDM antigen, arguing that it is dispensable in this scenario.  Deletion of Ship1 in T cells, however, resulted in a striking protection from HDM-induced allergic airway inflammation (AAI) due to an immune skewing to a Th1-biased immune response, effectively reducing the influx of eosinophils in the airways and reducing the mucus and IgE production associated with AAI.  Additionally, loss of Ship1 in DCs led to a protection from HDM-induced AAI.  This was not due to a defect in the ability of Ship1-deficient DCs to pick up, process or transport antigen from the lung to the draining lymph nodes, or the ability to induce antigen specific T cell proliferation.  Instead, Ship1-deficient DCs preferentially primed Th1, versus Th2 responses, as Ship1\u0394DC  101 mice had reduced eosinophils, mucus production and IgE production but enhanced IFN\u03b3 production following HDM challenge.  In Chapter 4, I examined the role of Ship1 expression, specifically in DCs, in facilitating Th2 immunity to the intestinal helminth Trichuris muris.  Ship1\u0394DC mice were susceptible to Trichuris infection as they were unable to mount an effective Th2 response to infection.  Instead, Trichuris infection led to a Th1 response likely produced by an overproduction of IL-12 resulting from the loss of Ship1 in DCs.  Systemic neutralization of IL-12 in Trichuris infected Ship1\u0394DC mice resulted in an enhanced Th2 response and a resulting increase in their ability to clear the infection.   With regard to the lineage specific role of SHIP-1 in balancing the immune response, the use of lineage specific, Ship1-deficient mice overcomes some of the previous limitations in analyzing the role for Ship1 in a host with such severe hematological abnormalities, and a host of lineage intrinsic, as well as extrinsic functions.  The use of Cre-mediated deletion comes with its own complications however.  There are several reports of toxicity associated with Cre expression.  Indeed, high level Cre expression, on its own, is sufficient in certain cells such as mast cells and basophils to lead to their ablation[215, 216].  The use of a Ship1F\/+ would allow for Cre expression in wild-type controls to compare with Ship1F\/F knockout animals.  A potential caveat to our findings, given that alveolar macrophages also express CD11c, is that Ship1 will also be deleted in these cells.  Indeed, I did observe an expansion in alveolar macrophages in HDM-exposed Ship1\u0394DC mice (Fig. 3.4A-B).  To overcome this, we utilized in vitro and adoptive transfer experiments of isolated wild-type  102 and Ship1-deficient DCs to confirm our phenotype of enhanced Th1-skewing (Fig 3.8).  Another option would be to utilize other, dendritic cell-specific, Cre expressing strains to selectively delete Ship1 expression[217]. It is important to note that we used over-expression of a naturally occurring DC growth factor expressed by a melanoma cell line, B-16-Flt3L, to expand wild-type and Ship1-deficient DCs in vivo. Interestingly, we found that tumors grew much more rapidly in Ship1\u0394DC mice, compared to their wild-type counterparts, which was surprising as one would imagine the Th1 skewed environment in these mice would likely act to inhibit tumor growth.  This enhanced tumor growth likely leads to a much higher dose of Flt3L during DC expansion, which could influence DC development and function.  The use of more primary DCs, such as those isolated from the lung draining lymph node, for in vitro and adoptive transfer experiments would likely yield more physiologically relevant responses, although their limited number would be restrictive for downstream assays.  Signaling pathways could be examined using flow cytometry and various phosphorylation-specific antibodies, and could be screened with the use of a mass cytometry (CyTOF) approach.  Previous in vitro studies have shown enhanced Akt phosphorylation in Ship1-\/- DCs[142], and more PI3K pathway targets, and proteins associated with IL-12 production such as JNK (c-Jun N-terminal kinases) and NF-\u03baB could be examined.  However, the role of PI3K pathway activity in IL-12 production is controversial, with reported positive and negative regulatory roles in the production of IL-12[203, 204].  While our findings would suggest that the PI3K pathway is a positive regulator, it is also possible that protein-protein interactions with SHIP-1, or production of the SHIP-1 product PI(3,4)P2 have important roles in regulating IL-12 production.   103  5.2 Future directions  The mechanisms involved in the initiation of Th2 adaptive immune responses are still unclear.  Here, we have uncovered a role for ILC2s, a recently characterized leukocyte subtype, in the sensitization to HDM-induced AAI, however the mode in which ILC2s exert their function is still unclear.  While recent reports have suggested ILC2-expression of MHC-II allows them to directly associate with T cells, their scarcity makes this an unlikely physiologically relevant mode of action.  However, ILC2s have been shown to potently recruit eosinophils to sites of mucosal inflammation, and eosinophils have previously been described to promote DC activation towards Th2 immunity[61].   It is possible that ILC2-recruited eosinophils can facilitate DC maturation or potentially on ILC2s themselves, serving as a positive feedback loop.  Using mice that selectively lack IL-5 in ILC2s, and eosinophil-deficient mice (such as the \u0394dblGATA strain), would allow the examination of this possibility.  If ILC2-recruited eosinophils do indeed facilitate a positive feedback effect on their activity or expansion, mice with an enlargement of the eosinophil pool, such as IL-5 transgenic mice, would likely have an expansion in tissue resident ILC2s[218].  Further studies could be imagined looking at eosinophil products, such as eosinophil-derived neurotoxin (EDN), facilitating ILC2 activity and expansion in vitro and in vivo.  EDN has been shown previously to activate TLR2-signal transduction in DCs to enhance Th2 responses.  While the ability of ILC2s to respond to TLR2-stimuli isn\u2019t clear, other ILC populations have displayed responsiveness to TLR2 stimulation[219].    104 While we report here that loss of Ship1 in T cells and DCs leads to a protective Th1 response following HDM challenge, the use of SHIP-1 activators have been proposed and tested in clinical experiments with asthmatic patients, although the therapeutic effect was relatively minor and restricted to a small decrease in the late phase response[117].  Initial allergen stimulation results in a rapid degranulation of mast cells, whose mediators initiate the early phase response and lead to the recruitment of eosinophils, basophils and lymphocytes (Th2 cells) for a more sustained inflammation in the late phase response.  This limited protection observed with SHIP-1 agonists in the late phase could be due to the role of SHIP-1 in leukocyte subsets such as mast cells, basophils or eosinophils, key mediators of the late phase response.  Indeed, transfer of Ship1-\/- mast cells into mast cell deficient mice leads to enhanced allergic inflammation, suggesting that SHIP-1 is an important regulator of mast cell degranulation and activation that results in enhanced asthmatic responses[220].  SHIP-1 also has been shown to be an important negative regulator of IL-4 production from basophils, and pharmacological activation of SHIP-1 could inhibit Th2 polarization and M2 macrophage skewing[221, 222].  Reduced PI3K pathway activity, through the use of pharmacological SHIP-1 agonists, could also prevent the survival and recruitment of eosinophils in the airways[223].  Further examination of the role of SHIP-1 in these specific subsets could be explored with recently generated Cre-deleter strains[224-227], although care must be taken as Cre-mediated toxicity has been observed in some of these strains[215, 216].  The minor clinical benefits associated with SHIP-1 agonists in the treatment of allergic asthma are potentially the result of opposing effects, with a beneficial response on mast cells, basophils and eosinophils and an adverse effect on DCs and T cells as I have shown here.  While the specific targeting of SHIP-1, whether through  105 agonists or antagonists, in restricted leukocyte subsets would be ideal it may be difficult to accomplish.  Instead, identifying unique molecular pathways controlled by SHIP-1 in these various populations could lead to the identification of new therapeutic targets with restricted activities.  The enhanced IL-12 production observed with Ship1\u0394DC mice was also seen with a myeloid-specific Ship1 deficient mouse, suggesting that SHIP-1 plays an important role in multiple lineages in regulating production of this important immunomodulatory cytokine.  Further exploration into the signaling pathway influenced by SHIP-1 will hopefully lead to new therapeutic targets.  106 References 1. Akira, S., K. Takeda, and T. Kaisho, Toll-like receptors: critical proteins linking innate and acquired immunity. Nat Immunol, 2001. 2(8): p. 675-80. 2. Mosmann, T.R., H. Cherwinski, M.W. Bond, M.A. Giedlin, and R.L. Coffman, Two types of murine helper T cell clone. I. Definition according to profiles of lymphokine activities and secreted proteins. J Immunol, 1986. 136(7): p. 2348-57. 3. Abbas, A.K., K.M. Murphy, and A. Sher, Functional diversity of helper T lymphocytes. Nature, 1996. 383(6603): p. 787-93. 4. Mucida, D. and H. Cheroutre, The many face-lifts of CD4 T helper cells. Adv Immunol, 2010. 107: p. 139-52. 5. O'Shea, J.J. and W.E. Paul, Mechanisms underlying lineage commitment and plasticity of helper CD4+ T cells. Science, 2010. 327(5969): p. 1098-102. 6. Zhou, L., M.M. Chong, and D.R. Littman, Plasticity of CD4+ T cell lineage differentiation. Immunity, 2009. 30(5): p. 646-55. 7. Blattman, J.N., R. Antia, D.J. Sourdive, X. Wang, S.M. Kaech, K. Murali-Krishna, J.D. Altman, and R. Ahmed, Estimating the precursor frequency of naive antigen-specific CD8 T cells. J Exp Med, 2002. 195(5): p. 657-64. 8. Itano, A.A. and M.K. Jenkins, Antigen presentation to naive CD4 T cells in the lymph node. Nat Immunol, 2003. 4(8): p. 733-9. 9. Neefjes, J., M.L. Jongsma, P. Paul, and O. Bakke, Towards a systems understanding of MHC class I and MHC class II antigen presentation. Nat Rev Immunol, 2011. 11(12): p. 823-36. 10. Van Gool, S.W., P. Vandenberghe, M. de Boer, and J.L. Ceuppens, CD80, CD86 and CD40 provide accessory signals in a multiple-step T-cell activation model. Immunol Rev, 1996. 153: p. 47-83. 11. Moser, M. and K.M. Murphy, Dendritic cell regulation of TH1-TH2 development. Nat Immunol, 2000. 1(3): p. 199-205. 12. Wurster, A.L., T. Tanaka, and M.J. Grusby, The biology of Stat4 and Stat6. Oncogene, 2000. 19(21): p. 2577-84. 13. Macatonia, S.E., N.A. Hosken, M. Litton, P. Vieira, C.S. Hsieh, J.A. Culpepper, M. Wysocka, G. Trinchieri, K.M. Murphy, and A. O'Garra, Dendritic cells produce  107 IL-12 and direct the development of Th1 cells from naive CD4+ T cells. J Immunol, 1995. 154(10): p. 5071-9. 14. Pasare, C. and R. Medzhitov, Toll-like receptors: linking innate and adaptive immunity. Microbes Infect, 2004. 6(15): p. 1382-7. 15. Ouyang, W., M. Lohning, Z. Gao, M. Assenmacher, S. Ranganath, A. Radbruch, and K.M. Murphy, Stat6-independent GATA-3 autoactivation directs IL-4-independent Th2 development and commitment. Immunity, 2000. 12(1): p. 27-37. 16. van Panhuys, N., S.C. Tang, M. Prout, M. Camberis, D. Scarlett, J. Roberts, J. Hu-Li, W.E. Paul, and G. Le Gros, In vivo studies fail to reveal a role for IL-4 or STAT6 signaling in Th2 lymphocyte differentiation. Proc Natl Acad Sci U S A, 2008. 105(34): p. 12423-8. 17. Yu, Q., A. Sharma, S.Y. Oh, H.G. Moon, M.Z. Hossain, T.M. Salay, K.E. Leeds, H. Du, B. Wu, M.L. Waterman, Z. Zhu, and J.M. Sen, T cell factor 1 initiates the T helper type 2 fate by inducing the transcription factor GATA-3 and repressing interferon-gamma. Nat Immunol, 2009. 10(9): p. 992-9. 18. Fang, T.C., Y. Yashiro-Ohtani, C. Del Bianco, D.M. Knoblock, S.C. Blacklow, and W.S. Pear, Notch directly regulates Gata3 expression during T helper 2 cell differentiation. Immunity, 2007. 27(1): p. 100-10. 19. Schmitz, J., A. Thiel, R. Kuhn, K. Rajewsky, W. Muller, M. Assenmacher, and A. Radbruch, Induction of interleukin 4 (IL-4) expression in T helper (Th) cells is not dependent on IL-4 from non-Th cells. J Exp Med, 1994. 179(4): p. 1349-53. 20. Min, B., M. Prout, J. Hu-Li, J. Zhu, D. Jankovic, E.S. Morgan, J.F. Urban, Jr., A.M. Dvorak, F.D. Finkelman, G. LeGros, and W.E. Paul, Basophils produce IL-4 and accumulate in tissues after infection with a Th2-inducing parasite. J Exp Med, 2004. 200(4): p. 507-17. 21. Perrigoue, J.G., S.A. Saenz, M.C. Siracusa, E.J. Allenspach, B.C. Taylor, P.R. Giacomin, M.G. Nair, Y. Du, C. Zaph, N. van Rooijen, M.R. Comeau, E.J. Pearce, T.M. Laufer, and D. Artis, MHC class II-dependent basophil-CD4+ T cell interactions promote T(H)2 cytokine-dependent immunity. Nat Immunol, 2009. 10(7): p. 697-705. 22. van Panhuys, N., M. Prout, E. Forbes, B. Min, W.E. Paul, and G. Le Gros, Basophils are the major producers of IL-4 during primary helminth infection. J Immunol, 2011. 186(5): p. 2719-28. 23. Yoshimoto, T., A. Bendelac, J. Hu-Li, and W.E. Paul, Defective IgE production by SJL mice is linked to the absence of CD4+, NK1.1+ T cells that promptly produce interleukin 4. Proc Natl Acad Sci U S A, 1995. 92(25): p. 11931-4.  108 24. Bandeira-Melo, C., K. Sugiyama, L.J. Woods, and P.F. Weller, Cutting edge: eotaxin elicits rapid vesicular transport-mediated release of preformed IL-4 from human eosinophils. J Immunol, 2001. 166(8): p. 4813-7. 25. Halim, T.Y., C.A. Steer, L. Matha, M.J. Gold, I. Martinez-Gonzalez, K.M. McNagny, A.N. McKenzie, and F. Takei, Group 2 innate lymphoid cells are critical for the initiation of adaptive T helper 2 cell-mediated allergic lung inflammation. Immunity, 2014. 40(3): p. 425-35. 26. Oliphant, C.J., Y.Y. Hwang, J.A. Walker, M. Salimi, S.H. Wong, J.M. Brewer, A. Englezakis, J.L. Barlow, E. Hams, S.T. Scanlon, G.S. Ogg, P.G. Fallon, and A.N. McKenzie, MHCII-Mediated Dialog between Group 2 Innate Lymphoid Cells and CD4(+) T Cells Potentiates Type 2 Immunity and Promotes Parasitic Helminth Expulsion. Immunity, 2014. 41(2): p. 283-95. 27. Spits, H., D. Artis, M. Colonna, A. Diefenbach, J.P. Di Santo, G. Eberl, S. Koyasu, R.M. Locksley, A.N. McKenzie, R.E. Mebius, F. Powrie, and E. Vivier, Innate lymphoid cells--a proposal for uniform nomenclature. Nat Rev Immunol, 2013. 13(2): p. 145-9. 28. Bernink, J.H., C.P. Peters, M. Munneke, A.A. te Velde, S.L. Meijer, K. Weijer, H.S. Hreggvidsdottir, S.E. Heinsbroek, N. Legrand, C.J. Buskens, W.A. Bemelman, J.M. Mjosberg, and H. Spits, Human type 1 innate lymphoid cells accumulate in inflamed mucosal tissues. Nat Immunol, 2013. 14(3): p. 221-9. 29. Klose, C.S., E.A. Kiss, V. Schwierzeck, K. Ebert, T. Hoyler, Y. d'Hargues, N. Goppert, A.L. Croxford, A. Waisman, Y. Tanriver, and A. Diefenbach, A T-bet gradient controls the fate and function of CCR6-RORgammat+ innate lymphoid cells. Nature, 2013. 494(7436): p. 261-5. 30. Fuchs, A., W. Vermi, J.S. Lee, S. Lonardi, S. Gilfillan, R.D. Newberry, M. Cella, and M. Colonna, Intraepithelial type 1 innate lymphoid cells are a unique subset of IL-12- and IL-15-responsive IFN-gamma-producing cells. Immunity, 2013. 38(4): p. 769-81. 31. Klose, C.S., M. Flach, L. Mohle, L. Rogell, T. Hoyler, K. Ebert, C. Fabiunke, D. Pfeifer, V. Sexl, D. Fonseca-Pereira, R.G. Domingues, H. Veiga-Fernandes, S.J. Arnold, M. Busslinger, I.R. Dunay, Y. Tanriver, and A. Diefenbach, Differentiation of type 1 ILCs from a common progenitor to all helper-like innate lymphoid cell lineages. Cell, 2014. 157(2): p. 340-56. 32. Mjosberg, J., J. Bernink, K. Golebski, J.J. Karrich, C.P. Peters, B. Blom, A.A. te Velde, W.J. Fokkens, C.M. van Drunen, and H. Spits, The transcription factor GATA3 is essential for the function of human type 2 innate lymphoid cells. Immunity, 2012. 37(4): p. 649-59.  109 33. Hoyler, T., C.S. Klose, A. Souabni, A. Turqueti-Neves, D. Pfeifer, E.L. Rawlins, D. Voehringer, M. Busslinger, and A. Diefenbach, The transcription factor GATA-3 controls cell fate and maintenance of type 2 innate lymphoid cells. Immunity, 2012. 37(4): p. 634-48. 34. Spooner, C.J., J. Lesch, D. Yan, A.A. Khan, A. Abbas, V. Ramirez-Carrozzi, M. Zhou, R. Soriano, J. Eastham-Anderson, L. Diehl, W.P. Lee, Z. Modrusan, R. Pappu, M. Xu, J. Devoss, and H. Singh, Specification of type 2 innate lymphocytes by the transcriptional determinant Gfi1. Nat Immunol, 2013. 14(12): p. 1229-36. 35. Yang, Q., L.A. Monticelli, S.A. Saenz, A.W. Chi, G.F. Sonnenberg, J. Tang, M.E. De Obaldia, W. Bailis, J.L. Bryson, K. Toscano, J. Huang, A. Haczku, W.S. Pear, D. Artis, and A. Bhandoola, T cell factor 1 is required for group 2 innate lymphoid cell generation. Immunity, 2013. 38(4): p. 694-704. 36. Halim, T.Y., A. MacLaren, M.T. Romanish, M.J. Gold, K.M. McNagny, and F. Takei, Retinoic-acid-receptor-related orphan nuclear receptor alpha is required for natural helper cell development and allergic inflammation. Immunity, 2012. 37(3): p. 463-74. 37. Wong, S.H., J.A. Walker, H.E. Jolin, L.F. Drynan, E. Hams, A. Camelo, J.L. Barlow, D.R. Neill, V. Panova, U. Koch, F. Radtke, C.S. Hardman, Y.Y. Hwang, P.G. Fallon, and A.N. McKenzie, Transcription factor RORalpha is critical for nuocyte development. Nat Immunol, 2012. 13(3): p. 229-36. 38. Satoh-Takayama, N., C.A. Vosshenrich, S. Lesjean-Pottier, S. Sawa, M. Lochner, F. Rattis, J.J. Mention, K. Thiam, N. Cerf-Bensussan, O. Mandelboim, G. Eberl, and J.P. Di Santo, Microbial flora drives interleukin 22 production in intestinal NKp46+ cells that provide innate mucosal immune defense. Immunity, 2008. 29(6): p. 958-70. 39. Serafini, N., R.G. Klein Wolterink, N. Satoh-Takayama, W. Xu, C.A. Vosshenrich, R.W. Hendriks, and J.P. Di Santo, Gata3 drives development of RORgammat+ group 3 innate lymphoid cells. J Exp Med, 2014. 211(2): p. 199-208. 40. Mielke, L.A., J.R. Groom, L.C. Rankin, C. Seillet, F. Masson, T. Putoczki, and G.T. Belz, TCF-1 controls ILC2 and NKp46+RORgammat+ innate lymphocyte differentiation and protection in intestinal inflammation. J Immunol, 2013. 191(8): p. 4383-91. 41. Fort, M.M., J. Cheung, D. Yen, J. Li, S.M. Zurawski, S. Lo, S. Menon, T. Clifford, B. Hunte, R. Lesley, T. Muchamuel, S.D. Hurst, G. Zurawski, M.W. Leach, D.M. Gorman, and D.M. Rennick, IL-25 induces IL-4, IL-5, and IL-13 and Th2-associated pathologies in vivo. Immunity, 2001. 15(6): p. 985-95.  110 42. Hurst, S.D., T. Muchamuel, D.M. Gorman, J.M. Gilbert, T. Clifford, S. Kwan, S. Menon, B. Seymour, C. Jackson, T.T. Kung, J.K. Brieland, S.M. Zurawski, R.W. Chapman, G. Zurawski, and R.L. Coffman, New IL-17 family members promote Th1 or Th2 responses in the lung: in vivo function of the novel cytokine IL-25. J Immunol, 2002. 169(1): p. 443-53. 43. Price, A.E., H.E. Liang, B.M. Sullivan, R.L. Reinhardt, C.J. Eisley, D.J. Erle, and R.M. Locksley, Systemically dispersed innate IL-13-expressing cells in type 2 immunity. Proc Natl Acad Sci U S A, 2010. 107(25): p. 11489-94. 44. Moro, K., T. Yamada, M. Tanabe, T. Takeuchi, T. Ikawa, H. Kawamoto, J. Furusawa, M. Ohtani, H. Fujii, and S. Koyasu, Innate production of T(H)2 cytokines by adipose tissue-associated c-Kit(+)Sca-1(+) lymphoid cells. Nature, 2010. 463(7280): p. 540-4. 45. Halim, T.Y., R.H. Krauss, A.C. Sun, and F. Takei, Lung natural helper cells are a critical source of Th2 cell-type cytokines in protease allergen-induced airway inflammation. Immunity, 2012. 36(3): p. 451-63. 46. Neill, D.R., S.H. Wong, A. Bellosi, R.J. Flynn, M. Daly, T.K. Langford, C. Bucks, C.M. Kane, P.G. Fallon, R. Pannell, H.E. Jolin, and A.N. McKenzie, Nuocytes represent a new innate effector leukocyte that mediates type-2 immunity. Nature, 2010. 464(7293): p. 1367-70. 47. Yagi, R., C. Zhong, D.L. Northrup, F. Yu, N. Bouladoux, S. Spencer, G. Hu, L. Barron, S. Sharma, T. Nakayama, Y. Belkaid, K. Zhao, and J. Zhu, The transcription factor GATA3 is critical for the development of all IL-7Ralpha-expressing innate lymphoid cells. Immunity, 2014. 40(3): p. 378-88. 48. Jetten, A.M., Retinoid-related orphan receptors (RORs): critical roles in development, immunity, circadian rhythm, and cellular metabolism. Nucl Recept Signal, 2009. 7: p. e003. 49. Ivanov, II, B.S. McKenzie, L. Zhou, C.E. Tadokoro, A. Lepelley, J.J. Lafaille, D.J. Cua, and D.R. Littman, The orphan nuclear receptor RORgammat directs the differentiation program of proinflammatory IL-17+ T helper cells. Cell, 2006. 126(6): p. 1121-33. 50. Eberl, G., S. Marmon, M.J. Sunshine, P.D. Rennert, Y. Choi, and D.R. Littman, An essential function for the nuclear receptor RORgamma(t) in the generation of fetal lymphoid tissue inducer cells. Nat Immunol, 2004. 5(1): p. 64-73. 51. Matsui, T., S. Sashihara, Y. Oh, and S.G. Waxman, An orphan nuclear receptor, mROR alpha, and its spatial expression in adult mouse brain. Brain Res Mol Brain Res, 1995. 33(2): p. 217-26.  111 52. Yang, X.O., B.P. Pappu, R. Nurieva, A. Akimzhanov, H.S. Kang, Y. Chung, L. Ma, B. Shah, A.D. Panopoulos, K.S. Schluns, S.S. Watowich, Q. Tian, A.M. Jetten, and C. Dong, T helper 17 lineage differentiation is programmed by orphan nuclear receptors ROR alpha and ROR gamma. Immunity, 2008. 28(1): p. 29-39. 53. Gold, M.J., F. Antignano, T.Y. Halim, J.A. Hirota, M.R. Blanchet, C. Zaph, F. Takei, and K.M. McNagny, Group 2 innate lymphoid cells facilitate sensitization to local, but not systemic, TH2-inducing allergen exposures. J Allergy Clin Immunol, 2014. 133(4): p. 1142-8. 54. Klein Wolterink, R.G., A. Kleinjan, M. van Nimwegen, I. Bergen, M. de Bruijn, Y. Levani, and R.W. Hendriks, Pulmonary innate lymphoid cells are major producers of IL-5 and IL-13 in murine models of allergic asthma. Eur J Immunol, 2012. 42(5): p. 1106-16. 55. Yang, M., S.P. Hogan, S. Mahalingam, S.M. Pope, N. Zimmermann, P. Fulkerson, L.A. Dent, I.G. Young, K.I. Matthaei, M.E. Rothenberg, and P.S. Foster, Eotaxin-2 and IL-5 cooperate in the lung to regulate IL-13 production and airway eosinophilia and hyperreactivity. J Allergy Clin Immunol, 2003. 112(5): p. 935-43. 56. Tomaki, M., L.L. Zhao, J. Lundahl, M. Sjostrand, M. Jordana, A. Linden, P. O'Byrne, and J. Lotvall, Eosinophilopoiesis in a murine model of allergic airway eosinophilia: involvement of bone marrow IL-5 and IL-5 receptor alpha. J Immunol, 2000. 165(7): p. 4040-50. 57. Nussbaum, J.C., S.J. Van Dyken, J. von Moltke, L.E. Cheng, A. Mohapatra, A.B. Molofsky, E.E. Thornton, M.F. Krummel, A. Chawla, H.E. Liang, and R.M. Locksley, Type 2 innate lymphoid cells control eosinophil homeostasis. Nature, 2013. 502(7470): p. 245-8. 58. Walsh, E.R., N. Sahu, J. Kearley, E. Benjamin, B.H. Kang, A. Humbles, and A. August, Strain-specific requirement for eosinophils in the recruitment of T cells to the lung during the development of allergic asthma. J Exp Med, 2008. 205(6): p. 1285-92. 59. Wills-Karp, M., J. Luyimbazi, X. Xu, B. Schofield, T.Y. Neben, C.L. Karp, and D.D. Donaldson, Interleukin-13: central mediator of allergic asthma. Science, 1998. 282(5397): p. 2258-61. 60. Grunig, G., M. Warnock, A.E. Wakil, R. Venkayya, F. Brombacher, D.M. Rennick, D. Sheppard, M. Mohrs, D.D. Donaldson, R.M. Locksley, and D.B. Corry, Requirement for IL-13 independently of IL-4 in experimental asthma. Science, 1998. 282(5397): p. 2261-3.  112 61. Yang, D., Q. Chen, S.B. Su, P. Zhang, K. Kurosaka, R.R. Caspi, S.M. Michalek, H.F. Rosenberg, N. Zhang, and J.J. Oppenheim, Eosinophil-derived neurotoxin acts as an alarmin to activate the TLR2-MyD88 signal pathway in dendritic cells and enhances Th2 immune responses. J Exp Med, 2008. 205(1): p. 79-90. 62. von Burg, N., S. Chappaz, A. Baerenwaldt, E. Horvath, S. Bose Dasgupta, D. Ashok, J. Pieters, F. Tacchini-Cottier, A. Rolink, H. Acha-Orbea, and D. Finke, Activated group 3 innate lymphoid cells promote T-cell-mediated immune responses. Proc Natl Acad Sci U S A, 2014. 111(35): p. 12835-40. 63. Hepworth, M.R., L.A. Monticelli, T.C. Fung, C.G. Ziegler, S. Grunberg, R. Sinha, A.R. Mantegazza, H.L. Ma, A. Crawford, J.M. Angelosanto, E.J. Wherry, P.A. Koni, F.D. Bushman, C.O. Elson, G. Eberl, D. Artis, and G.F. Sonnenberg, Innate lymphoid cells regulate CD4+ T-cell responses to intestinal commensal bacteria. Nature, 2013. 498(7452): p. 113-7. 64. Salimi, M., J.L. Barlow, S.P. Saunders, L. Xue, D. Gutowska-Owsiak, X. Wang, L.C. Huang, D. Johnson, S.T. Scanlon, A.N. McKenzie, P.G. Fallon, and G.S. Ogg, A role for IL-25 and IL-33-driven type-2 innate lymphoid cells in atopic dermatitis. J Exp Med, 2013. 210(13): p. 2939-50. 65. Mjosberg, J.M., S. Trifari, N.K. Crellin, C.P. Peters, C.M. van Drunen, B. Piet, W.J. Fokkens, T. Cupedo, and H. Spits, Human IL-25- and IL-33-responsive type 2 innate lymphoid cells are defined by expression of CRTH2 and CD161. Nat Immunol, 2011. 12(11): p. 1055-62. 66. Monticelli, L.A., G.F. Sonnenberg, M.C. Abt, T. Alenghat, C.G. Ziegler, T.A. Doering, J.M. Angelosanto, B.J. Laidlaw, C.Y. Yang, T. Sathaliyawala, M. Kubota, D. Turner, J.M. Diamond, A.W. Goldrath, D.L. Farber, R.G. Collman, E.J. Wherry, and D. Artis, Innate lymphoid cells promote lung-tissue homeostasis after infection with influenza virus. Nat Immunol, 2011. 12(11): p. 1045-54. 67. Allakhverdi, Z., M.R. Comeau, D.E. Smith, D. Toy, L.M. Endam, M. Desrosiers, Y.J. Liu, K.J. Howie, J.A. Denburg, G.M. Gauvreau, and G. Delespesse, CD34+ hemopoietic progenitor cells are potent effectors of allergic inflammation. J Allergy Clin Immunol, 2009. 123(2): p. 472-8. 68. Fallon, P.G., S.J. Ballantyne, N.E. Mangan, J.L. Barlow, A. Dasvarma, D.R. Hewett, A. McIlgorm, H.E. Jolin, and A.N. McKenzie, Identification of an interleukin (IL)-25-dependent cell population that provides IL-4, IL-5, and IL-13 at the onset of helminth expulsion. J Exp Med, 2006. 203(4): p. 1105-16. 69. Steinman, R.M. and Z.A. Cohn, Identification of a novel cell type in peripheral lymphoid organs of mice. I. Morphology, quantitation, tissue distribution. J Exp Med, 1973. 137(5): p. 1142-62.  113 70. Kupiec-Weglinski, J.W., J.M. Austyn, and P.J. Morris, Migration patterns of dendritic cells in the mouse. Traffic from the blood, and T cell-dependent and -independent entry to lymphoid tissues. J Exp Med, 1988. 167(2): p. 632-45. 71. Hammad, H., M. Plantinga, K. Deswarte, P. Pouliot, M.A. Willart, M. Kool, F. Muskens, and B.N. Lambrecht, Inflammatory dendritic cells--not basophils--are necessary and sufficient for induction of Th2 immunity to inhaled house dust mite allergen. J Exp Med, 2010. 207(10): p. 2097-111. 72. van Rijt, L.S., S. Jung, A. Kleinjan, N. Vos, M. Willart, C. Duez, H.C. Hoogsteden, and B.N. Lambrecht, In vivo depletion of lung CD11c+ dendritic cells during allergen challenge abrogates the characteristic features of asthma. J Exp Med, 2005. 201(6): p. 981-91. 73. Hashimoto, D., J. Miller, and M. Merad, Dendritic cell and macrophage heterogeneity in vivo. Immunity, 2011. 35(3): p. 323-35. 74. Lambrecht, B.N. and H. Hammad, Biology of lung dendritic cells at the origin of asthma. Immunity, 2009. 31(3): p. 412-24. 75. GeurtsvanKessel, C.H., M.A. Willart, L.S. van Rijt, F. Muskens, M. Kool, C. Baas, K. Thielemans, C. Bennett, B.E. Clausen, H.C. Hoogsteden, A.D. Osterhaus, G.F. Rimmelzwaan, and B.N. Lambrecht, Clearance of influenza virus from the lung depends on migratory langerin+CD11b- but not plasmacytoid dendritic cells. J Exp Med, 2008. 205(7): p. 1621-34. 76. Sun, C.M., J.A. Hall, R.B. Blank, N. Bouladoux, M. Oukka, J.R. Mora, and Y. Belkaid, Small intestine lamina propria dendritic cells promote de novo generation of Foxp3 T reg cells via retinoic acid. J Exp Med, 2007. 204(8): p. 1775-85. 77. Coombes, J.L., K.R. Siddiqui, C.V. Arancibia-Carcamo, J. Hall, C.M. Sun, Y. Belkaid, and F. Powrie, A functionally specialized population of mucosal CD103+ DCs induces Foxp3+ regulatory T cells via a TGF-beta and retinoic acid-dependent mechanism. J Exp Med, 2007. 204(8): p. 1757-64. 78. Sung, S.S., S.M. Fu, C.E. Rose, Jr., F. Gaskin, S.T. Ju, and S.R. Beaty, A major lung CD103 (alphaE)-beta7 integrin-positive epithelial dendritic cell population expressing Langerin and tight junction proteins. J Immunol, 2006. 176(4): p. 2161-72. 79. del Rio, M.L., J.I. Rodriguez-Barbosa, E. Kremmer, and R. Forster, CD103- and CD103+ bronchial lymph node dendritic cells are specialized in presenting and cross-presenting innocuous antigen to CD4+ and CD8+ T cells. J Immunol, 2007. 178(11): p. 6861-6.  114 80. Plantinga, M., M. Guilliams, M. Vanheerswynghels, K. Deswarte, F. Branco-Madeira, W. Toussaint, L. Vanhoutte, K. Neyt, N. Killeen, B. Malissen, H. Hammad, and B.N. Lambrecht, Conventional and monocyte-derived CD11b(+) dendritic cells initiate and maintain T helper 2 cell-mediated immunity to house dust mite allergen. Immunity, 2013. 38(2): p. 322-35. 81. Lemmon, M.A. and K.M. Ferguson, Signal-dependent membrane targeting by pleckstrin homology (PH) domains. Biochem J, 2000. 350 Pt 1: p. 1-18. 82. Sato, T.K., M. Overduin, and S.D. Emr, Location, location, location: membrane targeting directed by PX domains. Science, 2001. 294(5548): p. 1881-5. 83. Koyasu, S., The role of PI3K in immune cells. Nat Immunol, 2003. 4(4): p. 313-9. 84. Stephens, L., C. Ellson, and P. Hawkins, Roles of PI3Ks in leukocyte chemotaxis and phagocytosis. Curr Opin Cell Biol, 2002. 14(2): p. 203-13. 85. Deane, J.A. and D.A. Fruman, Phosphoinositide 3-kinase: diverse roles in immune cell activation. Annu Rev Immunol, 2004. 22: p. 563-98. 86. Domin, J., L. Harper, D. Aubyn, M. Wheeler, O. Florey, D. Haskard, M. Yuan, and D. Zicha, The class II phosphoinositide 3-kinase PI3K-C2beta regulates cell migration by a PtdIns3P dependent mechanism. J Cell Physiol, 2005. 205(3): p. 452-62. 87. Vanhaesebroeck, B., M.J. Welham, K. Kotani, R. Stein, P.H. Warne, M.J. Zvelebil, K. Higashi, S. Volinia, J. Downward, and M.D. Waterfield, P110delta, a novel phosphoinositide 3-kinase in leukocytes. Proc Natl Acad Sci U S A, 1997. 94(9): p. 4330-5. 88. Voigt, P., M.B. Dorner, and M. Schaefer, Characterization of p87PIKAP, a novel regulatory subunit of phosphoinositide 3-kinase gamma that is highly expressed in heart and interacts with PDE3B. J Biol Chem, 2006. 281(15): p. 9977-86. 89. Wymann, M.P., M. Zvelebil, and M. Laffargue, Phosphoinositide 3-kinase signalling--which way to target? Trends Pharmacol Sci, 2003. 24(7): p. 366-76. 90. Gillham, H., M.C. Golding, R. Pepperkok, and W.J. Gullick, Intracellular movement of green fluorescent protein-tagged phosphatidylinositol 3-kinase in response to growth factor receptor signaling. J Cell Biol, 1999. 146(4): p. 869-80. 91. Vanhaesebroeck, B., S.J. Leevers, K. Ahmadi, J. Timms, R. Katso, P.C. Driscoll, R. Woscholski, P.J. Parker, and M.D. Waterfield, Synthesis and function of 3-phosphorylated inositol lipids. Annu Rev Biochem, 2001. 70: p. 535-602.  115 92. Sarbassov, D.D., D.A. Guertin, S.M. Ali, and D.M. Sabatini, Phosphorylation and regulation of Akt\/PKB by the rictor-mTOR complex. Science, 2005. 307(5712): p. 1098-101. 93. Duronio, V., The life of a cell: apoptosis regulation by the PI3K\/PKB pathway. Biochem J, 2008. 415(3): p. 333-44. 94. Fayard, E., L.A. Tintignac, A. Baudry, and B.A. Hemmings, Protein kinase B\/Akt at a glance. J Cell Sci, 2005. 118(Pt 24): p. 5675-8. 95. Franke, T.F., PI3K\/Akt: getting it right matters. Oncogene, 2008. 27(50): p. 6473-88. 96. Wullschleger, S., R. Loewith, and M.N. Hall, TOR signaling in growth and metabolism. Cell, 2006. 124(3): p. 471-84. 97. Ma, A.D., A. Metjian, S. Bagrodia, S. Taylor, and C.S. Abrams, Cytoskeletal reorganization by G protein-coupled receptors is dependent on phosphoinositide 3-kinase gamma, a Rac guanosine exchange factor, and Rac. Mol Cell Biol, 1998. 18(8): p. 4744-51. 98. Hirsch, E., V.L. Katanaev, C. Garlanda, O. Azzolino, L. Pirola, L. Silengo, S. Sozzani, A. Mantovani, F. Altruda, and M.P. Wymann, Central role for G protein-coupled phosphoinositide 3-kinase gamma in inflammation. Science, 2000. 287(5455): p. 1049-53. 99. Bi, L., I. Okabe, D.J. Bernard, A. Wynshaw-Boris, and R.L. Nussbaum, Proliferative defect and embryonic lethality in mice homozygous for a deletion in the p110alpha subunit of phosphoinositide 3-kinase. J Biol Chem, 1999. 274(16): p. 10963-8. 100. Bi, L., I. Okabe, D.J. Bernard, and R.L. Nussbaum, Early embryonic lethality in mice deficient in the p110beta catalytic subunit of PI 3-kinase. Mamm Genome, 2002. 13(3): p. 169-72. 101. Ghigo, A., F. Damilano, L. Braccini, and E. Hirsch, PI3K inhibition in inflammation: Toward tailored therapies for specific diseases. Bioessays, 2010. 32(3): p. 185-96. 102. Jou, S.T., N. Carpino, Y. Takahashi, R. Piekorz, J.R. Chao, N. Carpino, D. Wang, and J.N. Ihle, Essential, nonredundant role for the phosphoinositide 3-kinase p110delta in signaling by the B-cell receptor complex. Mol Cell Biol, 2002. 22(24): p. 8580-91. 103. Okkenhaug, K., A. Bilancio, G. Farjot, H. Priddle, S. Sancho, E. Peskett, W. Pearce, S.E. Meek, A. Salpekar, M.D. Waterfield, A.J. Smith, and B.  116 Vanhaesebroeck, Impaired B and T cell antigen receptor signaling in p110delta PI 3-kinase mutant mice. Science, 2002. 297(5583): p. 1031-4. 104. Clayton, E., G. Bardi, S.E. Bell, D. Chantry, C.P. Downes, A. Gray, L.A. Humphries, D. Rawlings, H. Reynolds, E. Vigorito, and M. Turner, A crucial role for the p110delta subunit of phosphatidylinositol 3-kinase in B cell development and activation. J Exp Med, 2002. 196(6): p. 753-63. 105. Rolf, J., S.E. Bell, D. Kovesdi, M.L. Janas, D.R. Soond, L.M. Webb, S. Santinelli, T. Saunders, B. Hebeis, N. Killeen, K. Okkenhaug, and M. Turner, Phosphoinositide 3-kinase activity in T cells regulates the magnitude of the germinal center reaction. J Immunol, 2010. 185(7): p. 4042-52. 106. King, C., New insights into the differentiation and function of T follicular helper cells. Nat Rev Immunol, 2009. 9(11): p. 757-66. 107. Sasaki, T., J. Irie-Sasaki, R.G. Jones, A.J. Oliveira-dos-Santos, W.L. Stanford, B. Bolon, A. Wakeham, A. Itie, D. Bouchard, I. Kozieradzki, N. Joza, T.W. Mak, P.S. Ohashi, A. Suzuki, and J.M. Penninger, Function of PI3Kgamma in thymocyte development, T cell activation, and neutrophil migration. Science, 2000. 287(5455): p. 1040-6. 108. Ferguson, G.J., L. Milne, S. Kulkarni, T. Sasaki, S. Walker, S. Andrews, T. Crabbe, P. Finan, G. Jones, S. Jackson, M. Camps, C. Rommel, M. Wymann, E. Hirsch, P. Hawkins, and L. Stephens, PI(3)Kgamma has an important context-dependent role in neutrophil chemokinesis. Nat Cell Biol, 2007. 9(1): p. 86-91. 109. Ihle, N.T. and G. Powis, Take your PIK: phosphatidylinositol 3-kinase inhibitors race through the clinic and toward cancer therapy. Mol Cancer Ther, 2009. 8(1): p. 1-9. 110. Pesesse, X., S. Deleu, F. De Smedt, L. Drayer, and C. Erneux, Identification of a second SH2-domain-containing protein closely related to the phosphatidylinositol polyphosphate 5-phosphatase SHIP. Biochem Biophys Res Commun, 1997. 239(3): p. 697-700. 111. Schurmans, S., R. Carrio, J. Behrends, V. Pouillon, J. Merino, and S. Clement, The mouse SHIP2 (Inppl1) gene: complementary DNA, genomic structure, promoter analysis, and gene expression in the embryo and adult mouse. Genomics, 1999. 62(2): p. 260-71. 112. Fernandes, S., S. Iyer, and W.G. Kerr, Role of SHIP1 in cancer and mucosal inflammation. Ann N Y Acad Sci, 2013. 1280: p. 6-10. 113. Fuhler, G.M., R. Brooks, B. Toms, S. Iyer, E.A. Gengo, M.Y. Park, M. Gumbleton, D.R. Viernes, J.D. Chisholm, and W.G. Kerr, Therapeutic potential of SH2  117 domain-containing inositol-5'-phosphatase 1 (SHIP1) and SHIP2 inhibition in cancer. Mol Med, 2012. 18: p. 65-75. 114. Brooks, R., G.M. Fuhler, S. Iyer, M.J. Smith, M.Y. Park, K.H. Paraiso, R.W. Engelman, and W.G. Kerr, SHIP1 inhibition increases immunoregulatory capacity and triggers apoptosis of hematopoietic cancer cells. J Immunol, 2010. 184(7): p. 3582-9. 115. Stenton, G.R., L.F. Mackenzie, P. Tam, J.L. Cross, C. Harwig, J. Raymond, J. Toews, J. Wu, N. Ogden, T. MacRury, and C. Szabo, Characterization of AQX-1125, a small-molecule SHIP1 activator: Part 1. Effects on inflammatory cell activation and chemotaxis in vitro and pharmacokinetic characterization in vivo. Br J Pharmacol, 2013. 168(6): p. 1506-18. 116. Stenton, G.R., L.F. Mackenzie, P. Tam, J.L. Cross, C. Harwig, J. Raymond, J. Toews, D. Chernoff, T. MacRury, and C. Szabo, Characterization of AQX-1125, a small-molecule SHIP1 activator: Part 2. Efficacy studies in allergic and pulmonary inflammation models in vivo. Br J Pharmacol, 2013. 168(6): p. 1519-29. 117. Leaker, B.R., P.J. Barnes, B.J. O'Connor, F.Y. Ali, P. Tam, J. Neville, L.F. Mackenzie, and T. MacRury, The effects of the novel SHIP1 activator AQX-1125 on allergen-induced responses in mild to moderate asthma. Clin Exp Allergy, 2014. 118. Rohrschneider, L.R., J.F. Fuller, I. Wolf, Y. Liu, and D.M. Lucas, Structure, function, and biology of SHIP proteins. Genes Dev, 2000. 14(5): p. 505-20. 119. Damen, J.E., L. Liu, P. Rosten, R.K. Humphries, A.B. Jefferson, P.W. Majerus, and G. Krystal, The 145-kDa protein induced to associate with Shc by multiple cytokines is an inositol tetraphosphate and phosphatidylinositol 3,4,5-triphosphate 5-phosphatase. Proc Natl Acad Sci U S A, 1996. 93(4): p. 1689-93. 120. Helgason, C.D., J.E. Damen, P. Rosten, R. Grewal, P. Sorensen, S.M. Chappel, A. Borowski, F. Jirik, G. Krystal, and R.K. Humphries, Targeted disruption of SHIP leads to hemopoietic perturbations, lung pathology, and a shortened life span. Genes Dev, 1998. 12(11): p. 1610-20. 121. Oh, S.Y., T. Zheng, M.L. Bailey, D.L. Barber, J.T. Schroeder, Y.K. Kim, and Z. Zhu, Src homology 2 domain-containing inositol 5-phosphatase 1 deficiency leads to a spontaneous allergic inflammation in the murine lung. J Allergy Clin Immunol, 2007. 119(1): p. 123-31. 122. Orban, P.C., D. Chui, and J.D. Marth, Tissue- and site-specific DNA recombination in transgenic mice. Proc Natl Acad Sci U S A, 1992. 89(15): p. 6861-5.  118 123. Nagy, A., Cre recombinase: the universal reagent for genome tailoring. Genesis, 2000. 26(2): p. 99-109. 124. Ono, M., S. Bolland, P. Tempst, and J.V. Ravetch, Role of the inositol phosphatase SHIP in negative regulation of the immune system by the receptor Fc(gamma)RIIB. Nature, 1996. 383(6597): p. 263-6. 125. Tridandapani, S., T. Kelley, M. Pradhan, D. Cooney, L.B. Justement, and K.M. Coggeshall, Recruitment and phosphorylation of SH2-containing inositol phosphatase and Shc to the B-cell Fc gamma immunoreceptor tyrosine-based inhibition motif peptide motif. Mol Cell Biol, 1997. 17(8): p. 4305-11. 126. Nitschke, L., R. Carsetti, B. Ocker, G. Kohler, and M.C. Lamers, CD22 is a negative regulator of B-cell receptor signalling. Curr Biol, 1997. 7(2): p. 133-43. 127. Nakamura, K., T. Kouro, P.W. Kincade, A. Malykhin, K. Maeda, and K.M. Coggeshall, Src homology 2-containing 5-inositol phosphatase (SHIP) suppresses an early stage of lymphoid cell development through elevated interleukin-6 production by myeloid cells in bone marrow. J Exp Med, 2004. 199(2): p. 243-54. 128. Helgason, C.D., C.P. Kalberer, J.E. Damen, S.M. Chappel, N. Pineault, G. Krystal, and R.K. Humphries, A dual role for Src homology 2 domain-containing inositol-5-phosphatase (SHIP) in immunity: aberrant development and enhanced function of b lymphocytes in ship -\/- mice. J Exp Med, 2000. 191(5): p. 781-94. 129. Leung, W.H., T. Tarasenko, Z. Biesova, H. Kole, E.R. Walsh, and S. Bolland, Aberrant antibody affinity selection in SHIP-deficient B cells. Eur J Immunol, 2013. 43(2): p. 371-81. 130. Dong, S., B. Corre, E. Foulon, E. Dufour, A. Veillette, O. Acuto, and F. Michel, T cell receptor for antigen induces linker for activation of T cell-dependent activation of a negative signaling complex involving Dok-2, SHIP-1, and Grb-2. J Exp Med, 2006. 203(11): p. 2509-18. 131. Kashiwada, M., G. Cattoretti, L. McKeag, T. Rouse, B.M. Showalter, U. Al-Alem, M. Niki, P.P. Pandolfi, E.H. Field, and P.B. Rothman, Downstream of tyrosine kinases-1 and Src homology 2-containing inositol 5'-phosphatase are required for regulation of CD4+CD25+ T cell development. J Immunol, 2006. 176(7): p. 3958-65. 132. Collazo, M.M., D. Wood, K.H. Paraiso, E. Lund, R.W. Engelman, C.T. Le, D. Stauch, K. Kotsch, and W.G. Kerr, SHIP limits immunoregulatory capacity in the T-cell compartment. Blood, 2009. 113(13): p. 2934-44.  119 133. Locke, N.R., S.J. Patterson, M.J. Hamilton, L.M. Sly, G. Krystal, and M.K. Levings, SHIP regulates the reciprocal development of T regulatory and Th17 cells. J Immunol, 2009. 183(2): p. 975-83. 134. Tarasenko, T., H.K. Kole, A.W. Chi, M.M. Mentink-Kane, T.A. Wynn, and S. Bolland, T cell-specific deletion of the inositol phosphatase SHIP reveals its role in regulating Th1\/Th2 and cytotoxic responses. Proc Natl Acad Sci U S A, 2007. 104(27): p. 11382-7. 135. Collazo, M.M., K.H. Paraiso, M.Y. Park, A.L. Hazen, and W.G. Kerr, Lineage extrinsic and intrinsic control of immunoregulatory cell numbers by SHIP. Eur J Immunol, 2012. 42(7): p. 1785-95. 136. Srivastava, N., R. Sudan, and W.G. Kerr, Role of inositol poly-phosphatases and their targets in T cell biology. Front Immunol, 2013. 4: p. 288. 137. Baran, C.P., S. Tridandapani, C.D. Helgason, R.K. Humphries, G. Krystal, and C.B. Marsh, The inositol 5'-phosphatase SHIP-1 and the Src kinase Lyn negatively regulate macrophage colony-stimulating factor-induced Akt activity. J Biol Chem, 2003. 278(40): p. 38628-36. 138. Cox, D., B.M. Dale, M. Kashiwada, C.D. Helgason, and S. Greenberg, A regulatory role for Src homology 2 domain-containing inositol 5'-phosphatase (SHIP) in phagocytosis mediated by Fc gamma receptors and complement receptor 3 (alpha(M)beta(2); CD11b\/CD18). J Exp Med, 2001. 193(1): p. 61-71. 139. Nakamura, K., A. Malykhin, and K.M. Coggeshall, The Src homology 2 domain-containing inositol 5-phosphatase negatively regulates Fcgamma receptor-mediated phagocytosis through immunoreceptor tyrosine-based activation motif-bearing phagocytic receptors. Blood, 2002. 100(9): p. 3374-82. 140. Ganesan, L.P., T. Joshi, H. Fang, V.K. Kutala, J. Roda, R. Trotta, A. Lehman, P. Kuppusamy, J.C. Byrd, W.E. Carson, M.A. Caligiuri, and S. Tridandapani, FcgammaR-induced production of superoxide and inflammatory cytokines is differentially regulated by SHIP through its influence on PI3K and\/or Ras\/Erk pathways. Blood, 2006. 108(2): p. 718-25. 141. Antignano, F., M. Ibaraki, C. Kim, J. Ruschmann, A. Zhang, C.D. Helgason, and G. Krystal, SHIP is required for dendritic cell maturation. J Immunol, 2010. 184(6): p. 2805-13. 142. Antignano, F., M. Ibaraki, J. Ruschmann, J. Jagdeo, and G. Krystal, SHIP negatively regulates Flt3L-derived dendritic cell generation and positively regulates MyD88-independent TLR-induced maturation. J Leukoc Biol, 2010. 88(5): p. 925-35.  120 143. Neurath, M.F., S. Finotto, and L.H. Glimcher, The role of Th1\/Th2 polarization in mucosal immunity. Nat Med, 2002. 8(6): p. 567-73. 144. Barnes, P.J., Immunology of asthma and chronic obstructive pulmonary disease. Nat Rev Immunol, 2008. 8(3): p. 183-92. 145. Garner, R. and D. Kohen, Changes in the prevalence of asthma among Canadian children. Health Rep, 2008. 19(2): p. 45-50. 146. Barnett, S.B. and T.A. Nurmagambetov, Costs of asthma in the United States: 2002-2007. J Allergy Clin Immunol, 2011. 127(1): p. 145-52. 147. Gibson, P.G., H. Powell, and F.M. Ducharme, Differential effects of maintenance long-acting beta-agonist and inhaled corticosteroid on asthma control and asthma exacerbations. J Allergy Clin Immunol, 2007. 119(2): p. 344-50. 148. Corry, D.B., G. Grunig, H. Hadeiba, V.P. Kurup, M.L. Warnock, D. Sheppard, D.M. Rennick, and R.M. Locksley, Requirements for allergen-induced airway hyperreactivity in T and B cell-deficient mice. Mol Med, 1998. 4(5): p. 344-55. 149. Nakae, S., L.H. Ho, M. Yu, R. Monteforte, M. Iikura, H. Suto, and S.J. Galli, Mast cell-derived TNF contributes to airway hyperreactivity, inflammation, and TH2 cytokine production in an asthma model in mice. J Allergy Clin Immunol, 2007. 120(1): p. 48-55. 150. Lee, J.J., D. Dimina, M.P. Macias, S.I. Ochkur, M.P. McGarry, K.R. O'Neill, C. Protheroe, R. Pero, T. Nguyen, S.A. Cormier, E. Lenkiewicz, D. Colbert, L. Rinaldi, S.J. Ackerman, C.G. Irvin, and N.A. Lee, Defining a link with asthma in mice congenitally deficient in eosinophils. Science, 2004. 305(5691): p. 1773-6. 151. Corry, D.B., H.G. Folkesson, M.L. Warnock, D.J. Erle, M.A. Matthay, J.P. Wiener-Kronish, and R.M. Locksley, Interleukin 4, but not interleukin 5 or eosinophils, is required in a murine model of acute airway hyperreactivity. J Exp Med, 1996. 183(1): p. 109-17. 152. Walter, D.M., J.J. McIntire, G. Berry, A.N. McKenzie, D.D. Donaldson, R.H. DeKruyff, and D.T. Umetsu, Critical role for IL-13 in the development of allergen-induced airway hyperreactivity. J Immunol, 2001. 167(8): p. 4668-75. 153. Phipps, S., C.E. Lam, G.E. Kaiko, S.Y. Foo, A. Collison, J. Mattes, J. Barry, S. Davidson, K. Oreo, L. Smith, A. Mansell, K.I. Matthaei, and P.S. Foster, Toll\/IL-1 signaling is critical for house dust mite-specific helper T cell type 2 and type 17 [corrected] responses. Am J Respir Crit Care Med, 2009. 179(10): p. 883-93.  121 154. Hammad, H., M. Chieppa, F. Perros, M.A. Willart, R.N. Germain, and B.N. Lambrecht, House dust mite allergen induces asthma via Toll-like receptor 4 triggering of airway structural cells. Nat Med, 2009. 15(4): p. 410-6. 155. Post, S., M.C. Nawijn, T.L. Hackett, M. Baranowska, R. Gras, A.J. van Oosterhout, and I.H. Heijink, The composition of house dust mite is critical for mucosal barrier dysfunction and allergic sensitisation. Thorax, 2012. 67(6): p. 488-95. 156. Girard, M., E. Israel-Assayag, and Y. Cormier, Pathogenesis of hypersensitivity pneumonitis. Curr Opin Allergy Clin Immunol, 2004. 4(2): p. 93-8. 157. Joshi, A.D., D.J. Fong, S.R. Oak, G. Trujillo, K.R. Flaherty, F.J. Martinez, and C.M. Hogaboam, Interleukin-17-mediated immunopathogenesis in experimental hypersensitivity pneumonitis. Am J Respir Crit Care Med, 2009. 179(8): p. 705-16. 158. Gudmundsson, G. and G.W. Hunninghake, Interferon-gamma is necessary for the expression of hypersensitivity pneumonitis. J Clin Invest, 1997. 99(10): p. 2386-90. 159. Cormier, Y., E. Israel-Assayag, M. Fournier, and G.M. Tremblay, Modulation of experimental hypersensitivity pneumonitis by Sendai virus. J Lab Clin Med, 1993. 121(5): p. 683-8. 160. de Silva, N.R., S. Brooker, P.J. Hotez, A. Montresor, D. Engels, and L. Savioli, Soil-transmitted helminth infections: updating the global picture. Trends Parasitol, 2003. 19(12): p. 547-51. 161. Hurst, R.J. and K.J. Else, Trichuris muris research revisited: a journey through time. Parasitology, 2013. 140(11): p. 1325-39. 162. Bancroft, A.J., D. Artis, D.D. Donaldson, J.P. Sypek, and R.K. Grencis, Gastrointestinal nematode expulsion in IL-4 knockout mice is IL-13 dependent. Eur J Immunol, 2000. 30(7): p. 2083-91. 163. Bancroft, A.J., A.N. McKenzie, and R.K. Grencis, A critical role for IL-13 in resistance to intestinal nematode infection. J Immunol, 1998. 160(7): p. 3453-61. 164. Bancroft, A.J., K.J. Else, J.P. Sypek, and R.K. Grencis, Interleukin-12 promotes a chronic intestinal nematode infection. Eur J Immunol, 1997. 27(4): p. 866-70. 165. Holgate, S.T., Pathophysiology of asthma: what has our current understanding taught us about new therapeutic approaches? J Allergy Clin Immunol, 2011. 128(3): p. 495-505.  122 166. Saenz, S.A., M.C. Siracusa, J.G. Perrigoue, S.P. Spencer, J.F. Urban, Jr., J.E. Tocker, A.L. Budelsky, M.A. Kleinschek, R.A. Kastelein, T. Kambayashi, A. Bhandoola, and D. Artis, IL25 elicits a multipotent progenitor cell population that promotes T(H)2 cytokine responses. Nature, 2010. 464(7293): p. 1362-6. 167. Collison, A., J. Mattes, M. Plank, and P.S. Foster, Inhibition of house dust mite-induced allergic airways disease by antagonism of microRNA-145 is comparable to glucocorticoid treatment. J Allergy Clin Immunol, 2011. 128(1): p. 160-167 e4. 168. Blanchet, M.R., J.L. Bennett, M.J. Gold, E. Levantini, D.G. Tenen, M. Girard, Y. Cormier, and K.M. McNagny, CD34 is required for dendritic cell trafficking and pathology in murine hypersensitivity pneumonitis. Am J Respir Crit Care Med, 2011. 184(6): p. 687-98. 169. Simonian, P.L., C.L. Roark, F. Wehrmann, A.K. Lanham, F. Diaz del Valle, W.K. Born, R.L. O'Brien, and A.P. Fontenot, Th17-polarized immune response in a murine model of hypersensitivity pneumonitis and lung fibrosis. J Immunol, 2009. 182(1): p. 657-65. 170. Webb, D.C., Y. Cai, K.I. Matthaei, and P.S. Foster, Comparative roles of IL-4, IL-13, and IL-4Ralpha in dendritic cell maturation and CD4+ Th2 cell function. J Immunol, 2007. 178(1): p. 219-27. 171. Moffatt, M.F., I.G. Gut, F. Demenais, D.P. Strachan, E. Bouzigon, S. Heath, E. von Mutius, M. Farrall, M. Lathrop, and W.O. Cookson, A large-scale, consortium-based genomewide association study of asthma. N Engl J Med, 2010. 363(13): p. 1211-21. 172. Kool, M., T. Soullie, M. van Nimwegen, M.A. Willart, F. Muskens, S. Jung, H.C. Hoogsteden, H. Hammad, and B.N. Lambrecht, Alum adjuvant boosts adaptive immunity by inducing uric acid and activating inflammatory dendritic cells. J Exp Med, 2008. 205(4): p. 869-82. 173. Takeda, M., W. Ito, M. Tanabe, S. Ueki, H. Kato, J. Kihara, T. Tanigai, T. Chiba, K. Yamaguchi, H. Kayaba, Y. Imai, K. Okuyama, I. Ohno, T. Sasaki, and J. Chihara, Allergic airway hyperresponsiveness, inflammation, and remodeling do not develop in phosphoinositide 3-kinase gamma-deficient mice. J Allergy Clin Immunol, 2009. 123(4): p. 805-12. 174. Nashed, B.F., T. Zhang, M. Al-Alwan, G. Srinivasan, A.J. Halayko, K. Okkenhaug, B. Vanhaesebroeck, K.T. Hayglass, and A.J. Marshall, Role of the phosphoinositide 3-kinase p110delta in generation of type 2 cytokine responses and allergic airway inflammation. Eur J Immunol, 2007. 37(2): p. 416-24.  123 175. Duan, W., A.M. Aguinaldo Datiles, B.P. Leung, C.J. Vlahos, and W.S. Wong, An anti-inflammatory role for a phosphoinositide 3-kinase inhibitor LY294002 in a mouse asthma model. Int Immunopharmacol, 2005. 5(3): p. 495-502. 176. Myou, S., A.R. Leff, S. Myo, E. Boetticher, J. Tong, A.Y. Meliton, J. Liu, N.M. Munoz, and X. Zhu, Blockade of inflammation and airway hyperresponsiveness in immune-sensitized mice by dominant-negative phosphoinositide 3-kinase-TAT. J Exp Med, 2003. 198(10): p. 1573-82. 177. Lee, K.S., H.K. Lee, J.S. Hayflick, Y.C. Lee, and K.D. Puri, Inhibition of phosphoinositide 3-kinase delta attenuates allergic airway inflammation and hyperresponsiveness in murine asthma model. FASEB J, 2006. 20(3): p. 455-65. 178. Lee, K.S., S.J. Park, S.R. Kim, K.H. Min, S.M. Jin, K.D. Puri, and Y.C. Lee, Phosphoinositide 3-kinase-delta inhibitor reduces vascular permeability in a murine model of asthma. J Allergy Clin Immunol, 2006. 118(2): p. 403-9. 179. Kang, B.N., S.G. Ha, X.N. Ge, M. Reza Hosseinkhani, N.S. Bahaie, Y. Greenberg, M.N. Blumenthal, K.D. Puri, S.P. Rao, and P. Sriramarao, The p110delta subunit of PI3K regulates bone marrow-derived eosinophil trafficking and airway eosinophilia in allergen-challenged mice. Am J Physiol Lung Cell Mol Physiol, 2012. 302(11): p. L1179-91. 180. Ghansah, T., K.H. Paraiso, S. Highfill, C. Desponts, S. May, J.K. McIntosh, J.W. Wang, J. Ninos, J. Brayer, F. Cheng, E. Sotomayor, and W.G. Kerr, Expansion of myeloid suppressor cells in SHIP-deficient mice represses allogeneic T cell responses. J Immunol, 2004. 173(12): p. 7324-30. 181. Wang, J.W., J.M. Howson, T. Ghansah, C. Desponts, J.M. Ninos, S.L. May, K.H. Nguyen, N. Toyama-Sorimachi, and W.G. Kerr, Influence of SHIP on the NK repertoire and allogeneic bone marrow transplantation. Science, 2002. 295(5562): p. 2094-7. 182. Park, M.Y., N. Srivastava, R. Sudan, D.R. Viernes, J.D. Chisholm, R.W. Engelman, and W.G. Kerr, Impaired T-cell survival promotes mucosal inflammatory disease in SHIP1-deficient mice. Mucosal Immunol, 2014. 183. Antignano, F., M. Hamilton, S. Patterson, V. Ho, C. Cohen, M.K. Levings, and G. Krystal, SHIP-deficient dendritic cells, unlike wild type dendritic cells, suppress T cell proliferation via a nitric oxide-independent mechanism. PLoS One, 2011. 6(7): p. e21893. 184. Nishio, M., K. Watanabe, J. Sasaki, C. Taya, S. Takasuga, R. Iizuka, T. Balla, M. Yamazaki, H. Watanabe, R. Itoh, S. Kuroda, Y. Horie, I. Forster, T.W. Mak, H. Yonekawa, J.M. Penninger, Y. Kanaho, A. Suzuki, and T. Sasaki, Control of cell  124 polarity and motility by the PtdIns(3,4,5)P3 phosphatase SHIP1. Nat Cell Biol, 2007. 9(1): p. 36-44. 185. Kwak, Y.G., C.H. Song, H.K. Yi, P.H. Hwang, J.S. Kim, K.S. Lee, and Y.C. Lee, Involvement of PTEN in airway hyperresponsiveness and inflammation in bronchial asthma. J Clin Invest, 2003. 111(7): p. 1083-92. 186. Brauweiler, A., I. Tamir, J. Dal Porto, R.J. Benschop, C.D. Helgason, R.K. Humphries, J.H. Freed, and J.C. Cambier, Differential regulation of B cell development, activation, and death by the src homology 2 domain-containing 5' inositol phosphatase (SHIP). J Exp Med, 2000. 191(9): p. 1545-54. 187. O'Neill, S.K., A. Getahun, S.B. Gauld, K.T. Merrell, I. Tamir, M.J. Smith, J.M. Dal Porto, Q.Z. Li, and J.C. Cambier, Monophosphorylation of CD79a and CD79b ITAM motifs initiates a SHIP-1 phosphatase-mediated inhibitory signaling cascade required for B cell anergy. Immunity, 2011. 35(5): p. 746-56. 188. Corey, S.J., H.M. Mehta, and P.L. Stein, Two SHIPs passing in the middle of the immune system. Eur J Immunol, 2012. 42(7): p. 1681-4. 189. Hadidi, S., F. Antignano, M.R. Hughes, S.K. Wang, K. Snyder, G.M. Sammis, W.G. Kerr, K.M. McNagny, and C. Zaph, Myeloid cell-specific expression of Ship1 regulates IL-12 production and immunity to helminth infection. Mucosal Immunol, 2012. 5(5): p. 535-43. 190. Else, K.J., F.D. Finkelman, C.R. Maliszewski, and R.K. Grencis, Cytokine-mediated regulation of chronic intestinal helminth infection. J Exp Med, 1994. 179(1): p. 347-51. 191. Hasnain, S.Z., C.M. Evans, M. Roy, A.L. Gallagher, K.N. Kindrachuk, L. Barron, B.F. Dickey, M.S. Wilson, T.A. Wynn, R.K. Grencis, and D.J. Thornton, Muc5ac: a critical component mediating the rejection of enteric nematodes. J Exp Med, 2011. 208(5): p. 893-900. 192. Helmby, H., K. Takeda, S. Akira, and R.K. Grencis, Interleukin (IL)-18 promotes the development of chronic gastrointestinal helminth infection by downregulating IL-13. J Exp Med, 2001. 194(3): p. 355-64. 193. Bowcutt, R., M. Bramhall, L. Logunova, J. Wilson, C. Booth, S.R. Carding, R. Grencis, and S. Cruickshank, A role for the pattern recognition receptor Nod2 in promoting recruitment of CD103(+) dendritic cells to the colon in response to Trichuris muris infection. Mucosal Immunol, 2014. 7(5): p. 1094-105. 194. Cruickshank, S.M., M.L. Deschoolmeester, M. Svensson, G. Howell, A. Bazakou, L. Logunova, M.C. Little, N. English, M. Mack, R.K. Grencis, K.J. Else, and S.R. Carding, Rapid dendritic cell mobilization to the large intestinal epithelium is  125 associated with resistance to Trichuris muris infection. J Immunol, 2009. 182(5): p. 3055-62. 195. Mullaly, S.C., K. Burrows, F. Antignano, and C. Zaph, Assessing the role of CD103 in immunity to an intestinal helminth parasite. PLoS One, 2011. 6(5): p. e19580. 196. Antignano, F., S.C. Mullaly, K. Burrows, and C. Zaph, Trichuris muris infection: a model of type 2 immunity and inflammation in the gut. J Vis Exp, 2011(51). 197. Maxwell, M.J., N. Srivastava, M.Y. Park, E. Tsantikos, R.W. Engelman, W.G. Kerr, and M.L. Hibbs, SHIP-1 deficiency in the myeloid compartment is insufficient to induce myeloid expansion or chronic inflammation. Genes Immun, 2014. 15(4): p. 233-40. 198. Smith, K.A., Y. Harcus, N. Garbi, G.J. Hammerling, A.S. MacDonald, and R.M. Maizels, Type 2 innate immunity in helminth infection is induced redundantly and acts autonomously following CD11c(+) cell depletion. Infect Immun, 2012. 80(10): p. 3481-9. 199. Phythian-Adams, A.T., P.C. Cook, R.J. Lundie, L.H. Jones, K.A. Smith, T.A. Barr, K. Hochweller, S.M. Anderton, G.J. Hammerling, R.M. Maizels, and A.S. MacDonald, CD11c depletion severely disrupts Th2 induction and development in vivo. J Exp Med, 2010. 207(10): p. 2089-96. 200. Skokos, D., H.G. Botros, C. Demeure, J. Morin, R. Peronet, G. Birkenmeier, S. Boudaly, and S. Mecheri, Mast cell-derived exosomes induce phenotypic and functional maturation of dendritic cells and elicit specific immune responses in vivo. J Immunol, 2003. 170(6): p. 3037-45. 201. MacKenzie, J.R., J. Mattes, L.A. Dent, and P.S. Foster, Eosinophils promote allergic disease of the lung by regulating CD4(+) Th2 lymphocyte function. J Immunol, 2001. 167(6): p. 3146-55. 202. Padigel, U.M., J.A. Hess, J.J. Lee, J.B. Lok, T.J. Nolan, G.A. Schad, and D. Abraham, Eosinophils act as antigen-presenting cells to induce immunity to Strongyloides stercoralis in mice. J Infect Dis, 2007. 196(12): p. 1844-51. 203. Utsugi, M., K. Dobashi, A. Ono, T. Ishizuka, S. Matsuzaki, T. Hisada, Y. Shimizu, T. Kawata, H. Aoki, Y. Kamide, and M. Mori, PI3K p110beta positively regulates lipopolysaccharide-induced IL-12 production in human macrophages and dendritic cells and JNK1 plays a novel role. J Immunol, 2009. 182(9): p. 5225-31. 204. Fukao, T., M. Tanabe, Y. Terauchi, T. Ota, S. Matsuda, T. Asano, T. Kadowaki, T. Takeuchi, and S. Koyasu, PI3K-mediated negative feedback regulation of IL-12 production in DCs. Nat Immunol, 2002. 3(9): p. 875-81.  126 205. McKinley, L., J.F. Alcorn, A. Peterson, R.B. Dupont, S. Kapadia, A. Logar, A. Henry, C.G. Irvin, J.D. Piganelli, A. Ray, and J.K. Kolls, TH17 cells mediate steroid-resistant airway inflammation and airway hyperresponsiveness in mice. J Immunol, 2008. 181(6): p. 4089-97. 206. Andoh, A., S. Fujino, S. Bamba, Y. Araki, T. Okuno, T. Bamba, and Y. Fujiyama, IL-17 selectively down-regulates TNF-alpha-induced RANTES gene expression in human colonic subepithelial myofibroblasts. J Immunol, 2002. 169(4): p. 1683-7. 207. Kanda, N., S. Koike, and S. Watanabe, IL-17 suppresses TNF-alpha-induced CCL27 production through induction of COX-2 in human keratinocytes. J Allergy Clin Immunol, 2005. 116(5): p. 1144-50. 208. Silverman, M.D., D.O. Zamora, Y. Pan, P.V. Texeira, S.H. Baek, S.R. Planck, and J.T. Rosenbaum, Constitutive and inflammatory mediator-regulated fractalkine expression in human ocular tissues and cultured cells. Invest Ophthalmol Vis Sci, 2003. 44(4): p. 1608-15. 209. Schnyder, B., S. Schnyder-Candrian, A. Pansky, M.L. Schmitz, M. Heim, B. Ryffel, and R. Moser, IL-17 reduces TNF-induced Rantes and VCAM-1 expression. Cytokine, 2005. 31(3): p. 191-202. 210. Schnyder-Candrian, S., D. Togbe, I. Couillin, I. Mercier, F. Brombacher, V. Quesniaux, F. Fossiez, B. Ryffel, and B. Schnyder, Interleukin-17 is a negative regulator of established allergic asthma. J Exp Med, 2006. 203(12): p. 2715-25. 211. Hellings, P.W., A. Kasran, Z. Liu, P. Vandekerckhove, A. Wuyts, L. Overbergh, C. Mathieu, and J.L. Ceuppens, Interleukin-17 orchestrates the granulocyte influx into airways after allergen inhalation in a mouse model of allergic asthma. Am J Respir Cell Mol Biol, 2003. 28(1): p. 42-50. 212. Kudo, M., A.C. Melton, C. Chen, M.B. Engler, K.E. Huang, X. Ren, Y. Wang, X. Bernstein, J.T. Li, K. Atabai, X. Huang, and D. Sheppard, IL-17A produced by alphabeta T cells drives airway hyper-responsiveness in mice and enhances mouse and human airway smooth muscle contraction. Nat Med, 2012. 18(4): p. 547-54. 213. Wiesenberg, I., M. Missbach, J.P. Kahlen, M. Schrader, and C. Carlberg, Transcriptional activation of the nuclear receptor RZR alpha by the pineal gland hormone melatonin and identification of CGP 52608 as a synthetic ligand. Nucleic Acids Res, 1995. 23(3): p. 327-33. 214. Kallen, J., J.M. Schlaeppi, F. Bitsch, I. Delhon, and B. Fournier, Crystal structure of the human RORalpha Ligand binding domain in complex with cholesterol sulfate at 2.2 A. J Biol Chem, 2004. 279(14): p. 14033-8.  127 215. Feyerabend, T.B., A. Weiser, A. Tietz, M. Stassen, N. Harris, M. Kopf, P. Radermacher, P. Moller, C. Benoist, D. Mathis, H.J. Fehling, and H.R. Rodewald, Cre-mediated cell ablation contests mast cell contribution in models of antibody- and T cell-mediated autoimmunity. Immunity, 2011. 35(5): p. 832-44. 216. Ohnmacht, C., C. Schwartz, M. Panzer, I. Schiedewitz, R. Naumann, and D. Voehringer, Basophils orchestrate chronic allergic dermatitis and protective immunity against helminths. Immunity, 2010. 33(3): p. 364-74. 217. Schraml, B.U., J. van Blijswijk, S. Zelenay, P.G. Whitney, A. Filby, S.E. Acton, N.C. Rogers, N. Moncaut, J.J. Carvajal, and C. Reis e Sousa, Genetic tracing via DNGR-1 expression history defines dendritic cells as a hematopoietic lineage. Cell, 2013. 154(4): p. 843-58. 218. Lee, N.A., M.P. McGarry, K.A. Larson, M.A. Horton, A.B. Kristensen, and J.J. Lee, Expression of IL-5 in thymocytes\/T cells leads to the development of a massive eosinophilia, extramedullary eosinophilopoiesis, and unique histopathologies. J Immunol, 1997. 158(3): p. 1332-44. 219. Crellin, N.K., S. Trifari, C.D. Kaplan, N. Satoh-Takayama, J.P. Di Santo, and H. Spits, Regulation of cytokine secretion in human CD127(+) LTi-like innate lymphoid cells by Toll-like receptor 2. Immunity, 2010. 33(5): p. 752-64. 220. Haddon, D.J., F. Antignano, M.R. Hughes, M.R. Blanchet, L. Zbytnuik, G. Krystal, and K.M. McNagny, SHIP1 is a repressor of mast cell hyperplasia, cytokine production, and allergic inflammation in vivo. J Immunol, 2009. 183(1): p. 228-36. 221. Kuroda, E., F. Antignano, V.W. Ho, M.R. Hughes, J. Ruschmann, V. Lam, T. Kawakami, W.G. Kerr, K.M. McNagny, L.M. Sly, and G. Krystal, SHIP represses Th2 skewing by inhibiting IL-4 production from basophils. J Immunol, 2011. 186(1): p. 323-32. 222. Kuroda, E., V. Ho, J. Ruschmann, F. Antignano, M. Hamilton, M.J. Rauh, A. Antov, R.A. Flavell, L.M. Sly, and G. Krystal, SHIP represses the generation of IL-3-induced M2 macrophages by inhibiting IL-4 production from basophils. J Immunol, 2009. 183(6): p. 3652-60. 223. Pinho, V., D.G. Souza, M.M. Barsante, F.P. Hamer, M.S. De Freitas, A.G. Rossi, and M.M. Teixeira, Phosphoinositide-3 kinases critically regulate the recruitment and survival of eosinophils in vivo: importance for the resolution of allergic inflammation. J Leukoc Biol, 2005. 77(5): p. 800-10. 224. Doyle, A.D., E.A. Jacobsen, S.I. Ochkur, L. Willetts, K. Shim, J. Neely, J. Kloeber, W.E. Lesuer, R.S. Pero, P. Lacy, R. Moqbel, N.A. Lee, and J.J. Lee, Homologous recombination into the eosinophil peroxidase locus generates a  128 strain of mice expressing Cre recombinase exclusively in eosinophils. J Leukoc Biol, 2013. 94(1): p. 17-24. 225. Lilla, J.N., C.C. Chen, K. Mukai, M.J. BenBarak, C.B. Franco, J. Kalesnikoff, M. Yu, M. Tsai, A.M. Piliponsky, and S.J. Galli, Reduced mast cell and basophil numbers and function in Cpa3-Cre; Mcl-1fl\/fl mice. Blood, 2011. 118(26): p. 6930-8. 226. Musch, W., A.K. Wege, D.N. Mannel, and T. Hehlgans, Generation and characterization of alpha-chymase-Cre transgenic mice. Genesis, 2008. 46(3): p. 163-6. 227. Sullivan, B.M., H.E. Liang, J.K. Bando, D. Wu, L.E. Cheng, J.K. McKerrow, C.D. Allen, and R.M. Locksley, Genetic analysis of basophil function in vivo. Nat Immunol, 2011. 12(6): p. 527-35.    129 Appendices  130 Appendix 1 Publications arising from my PhD work 1. Zhang P, Riazy M, Gold MJ, Tsai SH, McNagny KM, Proud C, Duronio V.  Impairing Eukaryotic Elongation Factor 2 Kinase (eEF2K) Activity Decreases Atherosclerotic Plaque Formation.  Can J Cardiol (in press).  2. Gold MJ, Marsolais D, Blanchet MR. Mouse models of allergic asthma.  Mast Cells: Methods and Protocols, Methods in Molecular Biology (in press).  3. Gold MJ, Blanchet MR. Methods in assessment of airway reactivity in mice.  Mast Cells: Methods and Protocols, Methods in Molecular Biology (in press).  4. Debruin EJ, Gold MJ, Lo BC, Snyder K, Cait A, Lazic N, Lopez M, McNagny KM, Hughes MR. Mast cells in human health and disease.  Mast Cells: Methods and Protocols, Methods in Molecular Biology (in press).  5. Russell SL*, Gold MJ*, Reynolds LA, Willing BP, Dimitriu P, Thorson L, Redpath SA, Perona-Wright G, Blanchet MR, Mohn WW, Finlay BB, McNagny KM.  Perinatal antibiotic-induced shifts in gut microbiota have differential effects on inflammatory lung disease.  J Allergy Clin Immunol.  2014 Aug 8.  *Both authors contributed equally.  6. Aloyouni SY, Segeritz CP, Sherrid AM, Gold MJ, Loeffler DI, Blanchet MR, Cai B, Hirota J, McNagny KM, Kollmann TR.  Perinatal Immunization With Vaccine-Grade Listeria monocytogenes Provides Protection Against Murine Th2 Airway Inflammation.  Allergy Asthma Immunol Res.  2014 Jul;6(4):341-9.  7. Hirota JA, Gold MJ, Hiebert PR, Parkinson LG, Wee T, Smith D, Hansbro PM, Carlsten C, VanEeden S, Sin DD, McNagny KM, Knight DA.  The NLRP3 Inflammasome\/IL-1RI Axis Mediates Innate Immune but Not Adaptive Immune Responses Following PM10 Exposure.  Am J Respir Cell Mol Biol. 2014 Jul 2.  8. Blanchet MR, Gold MJ, McNagny KM.  Mutant mice and animal models of airway allergic disease.  Methods Mol Biol.  2014;1178:295-308  9. Gold MJ, Antignano F, Halim TY, Hirota JA, Blanchet MR, Zaph C, Takei F, McNagny KM.  Group 2 innate lymphoid cells facilitate sensitization to local, but not systemic, TH2-inducing allergen exposures.  J Allergy Clin Immunol.  2014 Apr;133(4):1142-8.  10. Antignano F, Burrows K, Hughes MR, Han JM, Kron KJ, Penrod NM, Oudhoff MJ, Want SK, Min PH, Gold MJ, Chenery AL, Braam MJ, Fung TC, Rossi FM, McNagny KM, Arrowsmith CH, Lupien M, Levings MK, Zaph C.  Methyltransferase G9A regulates T cell differentiation during murine intestinal inflammation.  J Clin Invest.  2014 May 1;124(5):1945-55.  131 11. Halim TY, Steer CA, Matha L, Gold MJ, Martinez-Gonzalez I, McNagny KM, McKenzie AN, Takei F.  Group 2 innate lymphoid cells are critical for the initiation of adaptive T helper 2 cell-mediated allergic lung inflammation.  Immunity.  2014 Mar 20;40(3):425-35.  12. Hirota JA, Hiebert PR, Gold M, Wu D, Graydon C, Smith JA, Ask K, McNagny K, Granville DJ, Knight DA.  Granzyme B deficiency exacerbates lung inflammation in mice after acute lung injury.  Am J Respir Cell Mol Biol.  2013 Sep;49(3):453-62.  13. Russell SL, Gold MJ, Willing BP, Thorson L, McNagny KM, Finlay BB.  Perinatal antibiotic treatment affects murine microbiota, immune responses and allergic asthma.  Gut Microbes.  2013 Mar-Apr;4(2):158-64.  14. Halim TY. MacLaren A, Romanish MT, Gold MJ, McNagny KM, Takei F.  Retinoic-acid-receptor-related orphan nuclear receptor alpha is required for natural helper cell development and allergic inflammation.  Immunity.  2012 Sep 21;37(3):463-74.  15. Maltby S, Debruin EJ, Bennett J, Gold MJ, Tunis MC, Jian Z, Marshall JS, McNagny KM.  IL-7R\u03b1 and L-selectin, but not CD103 or CD34, are required for murine peanut-induced anaphylaxis.  Allergy Asthma Clin Immunol.  2012 Aug 31;8(1):15.  16. Blanchet MR, Gold MJ, McNagny KM.  Mouse models to evaluate the function of genes associated with allergic airway disease.  Curr Opin Allergy Clin Immunol.  2012 Oct;12(5):467-74.  17. Russell SL, Gold MJ, Hartmann M, Willing BP, Thorson L, Wlodarska M, Gill N, Blanchet MR, Mohn WW, McNagny KM, Finlay BB.  Early life antibiotic-driven changes in microbiota enhance susceptibility to allergic asthma.  EMBO Rep.  2012 May 1;13(5):440-7.  18. Blanchet MR, Bennett JL, Gold MJ, Levantini E, Tenen DG, Girard M, Cormier Y, McNagny KM.  CD34 is required for dendritic cell trafficking and pathology in murine hypersensitivity pneumonitis.  Am J Respir Crit Care Med.  2011 Sep 15;184(6):687-98.  19. Maltby S, Freeman S, Gold MJ, Baker JH, Minchinton AI, Gold MR, Roskelley CD, McNagny KM.  Opposing roles for CD34 in B16 melanoma tumor growth after early stage vasculature and late stage immune cell infiltration.  PLoS One.  2011 Apr 11;6(4):e18160.  20. Maltby S, Wohlfarth C, Gold M, Zbytnuik L, Hughes MR, McNagny KM.  CD34 is required for infiltration of eosinophils into the colon and pathology associated with DSS-induced ulcerative colitis.  Am J Pathol.  2010 Sep;177(3):1244-54.    132 21. Blanchet MR, Gold M, Maltby S, Bennett J, Petri B, Kubes P, Lee DM, McNagny KM.  Loss of CD34 leads to exacerbated autoimmune arthritis through increased vascular permeability.  J Immunol.  2010 Feb 1;184(3):1292-9.  22. Bennett JL, Blanchet MR, Zhao L, Zbytnuik L, Antignano F, Gold M, Kubes P, McNagny KM.  Bone marrow-derived mast cells accumulate in the central nervous system during inflammation but are dispensable for experimental autoimmune encephalomyelitis pathogenesis.  J Immunol.  2009 May 1;182(9):5507-14.     133 Appendix 2 Bronchoalveolar lavage leukocyte enumeration and differentiation   beads!FSC-A!SSC-A!cells!FSC-A!FSC-W!CD45+!CD45-Pacific Blue!AmCyan!Singlets!Alveolar!Macrophages!Dendritic Cells!CD11c-!CD11c-AF647!SiglecF-PE!7\/4-FITC!SiglecF-PE!SiglecF-!7\/4-!Eosinophils! Neutrophils!B220-APCefluor780!CD4-PeCy7!CD4+ T cells! B cells!CD4-B220-!CD8+ T cells!CD8a-PerCP-Cy5.5!CD4-PeCy7!Total cells    =    cells counted  x  (input beads  \/  beads counted) !","type":"literal","lang":"en"}],"http:\/\/www.europeana.eu\/schemas\/edm\/hasType":[{"value":"Thesis\/Dissertation","type":"literal","lang":"en"}],"http:\/\/vivoweb.org\/ontology\/core#dateIssued":[{"value":"2015-02","type":"literal","lang":"en"}],"http:\/\/www.europeana.eu\/schemas\/edm\/isShownAt":[{"value":"10.14288\/1.0167104","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/language":[{"value":"eng","type":"literal","lang":"en"}],"https:\/\/open.library.ubc.ca\/terms#degreeDiscipline":[{"value":"Experimental Medicine","type":"literal","lang":"en"}],"http:\/\/www.europeana.eu\/schemas\/edm\/provider":[{"value":"Vancouver : University of British Columbia Library","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/publisher":[{"value":"University of British Columbia","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/rights":[{"value":"Attribution-NonCommercial-NoDerivs 2.5 Canada","type":"literal","lang":"en"}],"https:\/\/open.library.ubc.ca\/terms#rightsURI":[{"value":"http:\/\/creativecommons.org\/licenses\/by-nc-nd\/2.5\/ca\/","type":"literal","lang":"en"}],"https:\/\/open.library.ubc.ca\/terms#scholarLevel":[{"value":"Graduate","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/title":[{"value":"Role of group 2 innate lymphoid cells and SHIP-1 in mucosal immunity","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/type":[{"value":"Text","type":"literal","lang":"en"}],"https:\/\/open.library.ubc.ca\/terms#identifierURI":[{"value":"http:\/\/hdl.handle.net\/2429\/51891","type":"literal","lang":"en"}]}}