{"http:\/\/dx.doi.org\/10.14288\/1.0105101":{"http:\/\/vivoweb.org\/ontology\/core#departmentOrSchool":[{"value":"Medicine, Faculty of","type":"literal","lang":"en"},{"value":"Obstetrics and Gynaecology, Department of","type":"literal","lang":"en"}],"http:\/\/www.europeana.eu\/schemas\/edm\/dataProvider":[{"value":"DSpace","type":"literal","lang":"en"}],"https:\/\/open.library.ubc.ca\/terms#degreeCampus":[{"value":"UBCV","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/creator":[{"value":"Hong, Eui-ju","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/issued":[{"value":"2011-07-04T14:59:03Z","type":"literal","lang":"en"},{"value":"2011","type":"literal","lang":"en"}],"http:\/\/vivoweb.org\/ontology\/core#relatedDegree":[{"value":"Doctor of Philosophy - PhD","type":"literal","lang":"en"}],"https:\/\/open.library.ubc.ca\/terms#degreeGrantor":[{"value":"University of British Columbia","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/description":[{"value":"Sex hormone-binding globulin (SHBG) binds androgens and estrogens with high affinity, and regulates the distribution of these sex steroids in the blood and other biological fluids. Liver is the primary site of SHBG production, but the human SHBG transcription unit responsible for this is also expressed in proximal convoluted tubule (PCT) epithelial cells in a transgenic mouse model. Unlike hepatocytes which actively secrete SHBG and retain little immunoreactive SHBG within their cytoplasm, an incompletely glycosylated SHBG isoform has been found to accumulate inside PCT cells. These cells are androgen target cells, and the presence of SHBG within them accentuates androgen-dependent regulation of gene expression mediated by the androgen receptor (AR). The retention and accumulation of SHBG within cells involves an interaction with the intracellular 37-kDa laminin receptor precursor (LRP), which was identified as a SHBG interacting-protein using yeast hybrid screen. This interaction was confirmed by Glutathione S-transferase pull-down assays, and was prevented by mutating the LRP laminin-binding site. Human SHBG was found to co-localize LRP in the peri-nuclear location of renal epithelial cells of transgenic mice and SHBG:LRP complexes were observed within the endoplasmic reticulum of these cells by immunoprecipitation assay. These data suggest that a physical interaction between SHBG and LRP contributes to the intracellular trapping of an incompletely glycosylated SHBG in PCT cells and an increase in AR-mediated androgen action. Since human SHBG transcripts have been reported in prostate cancer cells, we examined whether SHBG in the extracellular environment or the cytoplasm of human LNCaP prostate cancer cells influences their response to androgens. Although human SHBG is cleaved into two laminin G-like (LG) domains by kallikrein-related peptidase 4, this does not change its steroid-binding activity. Furthermore, the amino-terminal SHBG LG domiain induced AR-mediated androgen activity in LNCaP cells in the same way as intact SHBG. Although immunoreactive SHBG was not detected within LNCaP cells, siRNA-mediated knockdown of SHBG transcripts decreased AR-dependent inceases in prostate-specific antigen mRNA levels and androgen-reporter gene activity. These data suggest that while SHBG in LNCaP cell medium limits the metabolic clearance of androgens, SHBG within these cells enhances AR-induced gene expression.","type":"literal","lang":"en"}],"http:\/\/www.europeana.eu\/schemas\/edm\/aggregatedCHO":[{"value":"https:\/\/circle.library.ubc.ca\/rest\/handle\/2429\/35861?expand=metadata","type":"literal","lang":"en"}],"http:\/\/www.w3.org\/2009\/08\/skos-reference\/skos.html#note":[{"value":" REGULATION OF ANDROGEN ACTION BY SEX HORMONE-BINDING GLOBULIN  by  EUI-JU HONG  D.V.M., Chungbuk University, 2002 M.Sc., Chungbuk University, 2004  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY  in  THE FACULTY OF GRADUATE STUDIES  (Reproductive and Developmental Sciences)    THE UNIVERSITY OF BRITISH COLUMBIA  (Vancouver)   June, 2011  \u00a9 Eui-Ju Hong, 2011  ii Abstract Sex hormone-binding globulin (SHBG) binds androgens and estrogens with high affinity, and regulates the distribution of these sex steroids in the blood and other biological fluids. Liver is the primary site of SHBG production, but the human SHBG transcription unit responsible for this is also expressed in proximal convoluted tubule (PCT) epithelial cells in a transgenic mouse model. Unlike hepatocytes which actively secrete SHBG and retain little immunoreactive SHBG within their cytoplasm, an incompletely glycosylated SHBG isoform has been found to accumulate inside PCT cells. These cells are androgen target cells, and the presence of SHBG within them accentuates androgen-dependent regulation of gene expression mediated by the androgen receptor (AR). The retention and accumulation of SHBG within cells involves an interaction with the intracellular 37-kDa laminin receptor precursor (LRP), which was identified as a SHBG interacting-protein using yeast hybrid screen. This interaction was confirmed by Glutathione S-transferase pull-down assays, and was prevented by mutating the LRP laminin-binding site. Human SHBG was found to co-localize LRP in the peri-nuclear location of renal epithelial cells of transgenic mice and SHBG:LRP complexes were observed within the endoplasmic reticulum of these cells by immunoprecipitation assay. These data suggest that a physical interaction between SHBG and LRP contributes to the intracellular trapping of an incompletely glycosylated SHBG in PCT cells and an increase in AR-mediated androgen action. Since human SHBG transcripts have been reported in prostate cancer cells, we examined whether SHBG in the extracellular environment or the cytoplasm of human LNCaP prostate cancer cells influences their response to androgens. Although human SHBG is cleaved into two laminin G-like (LG) domains by kallikrein-related peptidase 4, this does not change its steroid-binding activity.  iii Furthermore, the amino-terminal SHBG LG domiain induced AR-mediated androgen activity in LNCaP cells in the same way as intact SHBG. Although immunoreactive SHBG was not detected within LNCaP cells, siRNA-mediated knockdown of SHBG transcripts decreased AR-dependent inceases in prostate-specific antigen mRNA levels and androgen-reporter gene activity. These data suggest that while SHBG in LNCaP cell medium limits the metabolic clearance of androgens, SHBG within these cells enhances AR-induced gene expression.  iv Preface A version of chapter 2 has been published in \u201cMolecular Endocrinology\u201d. Hong E-J, Sahu B, J\u00e4nne OA and Hammond GL. Cytoplasmic accumulation of incompletely glycosylated sex hormone-binding globulin enhances androgen action in proximal tubule epithelial cells. Mol Endocrinol 2011 Feb 25(2):269-81. The experiments were designed by myself and my supervisor Dr. Hammond. Mr. Sahu performed the microarray analysis using samples that I provided and Dr. J\u00e4nne reviewed the results. I prepared the manuscript and this was reviewed and revised by my supervisor Dr. Hammond and by Dr. J\u00e4nne. All authors read and approved the final manuscript. A version of chapter 3 will be submitted. Hong E-J, Ng K-M and Hammond GL Sex hormone-binding globulin interacts with the laminin receptor precursor in the endoplasmic reticulum of renal epithelial cells, Hong E-J, Ng K-M contributed equally to this work. The experiments were designed and performed by myself and Dr. Ng. Dr. Ng performed the yeast two hybrid assays, some of the GST pull-down assays and immuno-histochemistry. Dr. Hammond supervised of all of the experiments, reviewed the results, and the draft manuscript is prepared by Dr Ng and myself. Some of the experiments described in chapter 4 are included in a manuscript by Sanchez WY, de Veer SJ, Swedberg JE, Hong E-J, Reid JC, Simmer JP, Walsh TP, Hooper JD, Hammond GL, Clements JA and Harris JM. Molecular interaction guides precise processing of sex hormone-binding globulin by kallikrein related peptidase 4 which has been submitted and is currently under consideration. My analyses (Figure 4.2 and 4.3) of the biochemical properties and biological actions of SHBG on androgen-dependent actions in LNCaP cells before and after KLK4 cleavage constitute as Figure 5 and 6 of the results section (all six figures) of the manuscript, which was drafted by Dr. Sanchez, Dr. Veer and Dr. Harris of Queensland University of Technology, with input from myself and my supervisor Dr. Hammond on the description and evaluation of the experiments that I performed. The immuno-histochemical analysis and immuno assays using duodenum (chapter 1) and kidney samples (chapters 2 and 3) of mice expressing human SHBG transgenes were approved by the University of British Columbia Animal Care Committee (Animal Care Certificate number A06-0390).  v Table of contents Abstract .............................................................................................................................. ii Preface............................................................................................................................... iv Table of contents ................................................................................................................ v List of tables...................................................................................................................... ix List of figures..................................................................................................................... x List of abbreviations ........................................................................................................ xii Acknowledgements.......................................................................................................... xv 1. Literature review............................................................................................................ 1 1.1 Overview............................................................................................................... 1 1.2 Sex steroid hormones............................................................................................ 2 1.2.1 Biosynthesis of sex steroid hormones..........................................................2 1.2.2 Genomic versus nongenomic effects ...........................................................3 1.2.3 Bioavailability of sex steroids......................................................................5 1.3 Sex hormone-binding globulin ............................................................................. 6 1.3.1 Sex hormone-binding globulin\/androgen binding protein...........................6 1.3.2 SHBG gene structure and organization ........................................................7 1.3.3 Tissue specific expression of SHBG ............................................................9 1.3.4 Regulation of plasma SHBG levels ...........................................................12 1.4 Biochemical and molecular properties of SHBG................................................ 14 1.4.1 SHBG protein structure..............................................................................14 1.4.2 Steroid-binding site ....................................................................................15 1.4.3 Post-translational modification ..................................................................16 1.5 Functions of SHBG............................................................................................. 17 1.5.1 Plasma steroid transport.............................................................................17 1.5.2 Presence of SHBG within tissues ..............................................................18 1.5.3 Presence of SHBG inside cells ..................................................................18 1.5.4 Putative SHBG receptor.............................................................................19 1.5.5 Endocytosis of SHBG................................................................................20 1.5.6 Interactions between SHBG and other proteins.........................................21 1.6 Androgen regulated genes................................................................................... 22  vi 1.6.1 Androgen receptor......................................................................................22 1.6.2 Androgen target tissues ..............................................................................23 1.6.3 Kidney androgen regulated genes..............................................................24 1.6.4 Prostate-specific antigen (KLK 3, PSA)....................................................25 1.6.5 Kallikrein-related peptidase 4 (KLK4) ......................................................26 1.7 Hypothesis and objectives................................................................................... 26 2. Cytoplasmic accumulation of incompletely glycosylated sex hormone-binding globulin enhances androgen action in proximal tubule epithelial cells ........................... 38 2.1 Introduction......................................................................................................... 38 2.2 Material and methods.......................................................................................... 39 2.2.1 Antibodies ..................................................................................................39 2.2.2 Expression plasmids and reporter gene constructs ....................................40 2.2.3 Cell culture.................................................................................................40 2.2.4 Assay of androgen uptake ..........................................................................41 2.2.5 Androgen response element -luciferase gene assay ...................................41 2.2.6 De-glycosylation of SHBG........................................................................42 2.2.7 Preparation of nuclear and cytoplasmic extracts .......................................42 2.2.8 Western blotting .........................................................................................43 2.2.9 Immuno-histochemistry\/immuno-cytochemistry.......................................43 2.2.10 RNA analysis ...........................................................................................44 2.2.11 Gene expression profiling and data analysis............................................45 2.2.12 Statistical analyses ...................................................................................46 2.3 Results................................................................................................................. 46 2.3.1 Human SHBG co-localizes with KAP within the same proximal convoluted tubule epithelial cells of mice expressing human SHBG transgenes .............................................................................................................................46 2.3.2 Human SHBG within proximal convoluted tubule epithelial cells differs from secreted SHBG in terms of its glycosylation status ...................................47 2.3.3 Intracellular SHBG enhances androgen uptake and accentuates androgen-dependent Kap expression in PCT cells .............................................50 2.3.4 Identification of other androgen-regulated genes whose expression is  vii either enhanced or suppressed by the presence of SHBG in PCT cells..............53 2.3.5 Intracellular SHBG modulates the nuclear retention of the AR in PCT cells .............................................................................................................................54 2.4 Discussion ........................................................................................................... 56 3. Sex hormone-binding globulin interacts with the laminin receptor precursor in the endoplasmic reticulum of renal epithelial cells ............................................................... 88 3.1 Introduction......................................................................................................... 88 3.2 Materials and methods ........................................................................................ 91 3.2.1 Animals ......................................................................................................91 3.2.2 Antibodies ..................................................................................................91 3.2.3 GST pull-down assays ...............................................................................91 3.2.4 Immuno-histochemistry .............................................................................92 3.2.5 Isolation of mouse kidney endoplasmic reticulum protein extracts for co-immunoprecipitation assays...........................................................................92 3.3 Results................................................................................................................. 94 3.3.1 The laminin-binding site of LRP is required for its interaction with SHBG .............................................................................................................................94 3.3.2 SHBG and the LRP co-localize within the rough endoplasmic reticulum of epithelial cells of the renal proximal convoluted tubules ...................................94 3.3.3 Differences in the apparent molecular sizes of SHBG in renal cortex ER extracts and plasma are due to differences in N-glycosylation...........................95 3.3.4 Co-immunoprecipitation of LRP with SHBG from renal cortex ER extracts .............................................................................................................................96 3.4 Discussion ........................................................................................................... 96 4. Sex hormone-binding globulin mediates androgen action in androgen dependent prostate cancer cells ........................................................................................................112 4.1 Introduction........................................................................................................112 4.2 Material and methods.........................................................................................113 4.2.1 Expression plasmids and reporter gene constructs ..................................113 4.2.2 Cell culture...............................................................................................114 4.2.3 RNA analysis ...........................................................................................115  viii 4.2.4 Biochemical analyses of SHBG after proteolytic cleavage by KLK4.....116 4.2.5 Generation of recombinant SHBG LG4 domain .....................................117 4.2.6 Immuno-cytochemistry ............................................................................117 4.2.7 Statistical analyses ...................................................................................118 4.3 Results................................................................................................................118 4.3.1 SHBG modulates androgen-dependent PSA expression in LNCaP cells 118 4.3.2 Biochemical properties human SHBG before and after cleavage by KLK4 ...........................................................................................................................119 4.3.3 Human SHBG in prostate LNCaP cells ...................................................120 4.4 Discussion ......................................................................................................... 121 5. Conclusion ................................................................................................................. 136 5.1 Human SHBG accumulation in the cytoplasm of specific epithelial cell types 137 5.2 In vitro model of intracellular SHBG using renal epithelial cells..................... 138 5.3 The molecular basis of SHBG accumulation in renal tubular cells .................. 138 5.4 The biological significance of SHBG within renal epithelial cells................... 139 5.5 SHBG modulates androgen bioavailability in extracellular or intracellular environment ............................................................................................................ 140 5.6 Concluding remarks .......................................................................................... 141 References...................................................................................................................... 144   ix List of tables Table 2.1 Primers used for RNA analyses ........................................................................ 64 Table 2.2 Androgen regulated genes by microarray analysis ............................................ 65 Table 3.1 List of the ADE2, HIS3 and LacZ positive clones obtained through the yeast two-hybrid screen identified by sequencing ............................................................ 103 Table 4.1 Primers used for RNA analysis ....................................................................... 125   x List of figures Figure 1.1 Overview of the sex steroid hormone biosynthetic pathway......................... 29 Figure 1.2 Classical and nonclassical pathways of sex steroid hormone........................ 30 Figure 1.3 Steroid binding-proteins in human biological fluids ..................................... 31 Figure 1.4 Human SHBG gene and its transcripts........................................................... 32 Figure 1.5 Human SHBG is expressed in the small intestine and accumulates in epithelial cells of duodenal villi............................................................................................... 33 Figure 1.6 Immuno-histochemical analyses in duodenal villi of transgenic mice carrying the 4.3-kb human SHBG transgene.......................................................................... 35 Figure 1.7 Primary structure of human SHBG and ribbon representation of the SHBG N\u2013terminal LG4 domain tertiary structure showing the location of the steroid-binding site................................................................................................... 36 Figure 1.8 Androgen action in target cell........................................................................ 37  Figure 2.1 Presence of immunoreactive human SHBG in kidney of mice expressing human SHBG transgenes and in mouse proximal convoluted tubule (PCT) cells after transfection with a full-length human SHBG cDNA............................................... 67 Figure 2.2 Electrophoretic characteristics and glycosylation status of human SHBG in the medium and extracts of mouse proximal convoluted tubule (PCT) cells transfected with human SHBG cDNA expression vectors ......................................................... 69 Figure 2.3 Influence of intracellular SHBG on cellular androgen uptake and response .... 71 Figure 2.4 Influence of intracellular SHBG on murine Kap gene expression after sex steroid treatment and withdrawal.......................................................................................... 73 Figure 2.5 Influence of wild-type human SHBG and SHBG variants with reduced affinities for steroids on murine Kap gene expression in PCT cells ......................................... 75 Figure 2.6 Up-regulation and down-regulation of androgen-responsive genes is accentuated by the presence of functional SHBG in PCT cells after treatment with testosterone (A) or DHT (B) .................................................................................... 77 Figure 2.7 Effect of intracellular SHBG on the cellular localization of the AR over time after steroid removal from the medium ............................................................................. 79 Figure 2.8 Intracellular SHBG influences the cellular localization of the AR................... 81  xi Figure 2.9 Impact of siRNA-mediated knockdown of SHBG on the cellular localization of the AR....................................................................................................................... 83 Figure 2.10 Nuclear localization of the AR is enhanced in PCT cells by the presence of functional SHBG in the cytoplasm .......................................................................... 85 Figure 2.11 The cellular localization of the SHBG within PCT cells over time after incubation with SHBG-conditioned media from CHO cells ...................................... 86 Figure 2.12 Western blot of human SHBG in various mammalian cells that express human SHBG transgenes ..................................................................................................... 87  Figure 3.1 Yeast two-hybrid identification of the LRP as a human SHBG binding protein ............................................................................................................................... 105 Figure 3.2 The LRP laminin-binding site is required for the interaction with SHBG in vitro ................................................................................................................................ 106 Figure 3.3 Immuno-histochemical localization of human SHBG, LRP, and megalin in the renal cortex of mice expressing a human SHBG transgene ................................... 107 Figure 3.4 Electrophoretic micro-heterogeneity of human SHBG in ER extracts of mouse kidney and plasma reflect differences in glycosylation......................................... 109 Figure 3.5 Co-immunoprecipitation of LRP with SHBG from an ER extract of the kidney from a mouse expressing a human SHBG transgene ..............................................111  Figure 4.1 Influence of extracellular SHBG on PSA gene expression after androgen treatment................................................................................................................. 127 Figure 4.2 Steroid-binding properties of human SHBG before and after cleavage by KLK4 ..................................................................................................................... 129 Figure 4.3 Influence of intact human SHBG and of recombinant SHBG LG4 domain on androgen induced expression of PSA in LNCaP cells.............................................. 131 Figure 4.4 SHBG expression in human LNCaP cells ................................................... 133 Figure 4.5 Androgen activities in wild-type LNCaP cells after SHBG depletion............ 135  Figure 5.1 The role of SHBG in extracellular and intracellular compartments of human LNCaP prostate cancer cells ...................................................................................143  xii List of abbreviations ABP   Androgen binding protein Adh7   Alcohol dehydrogenase 7 AF-1   Activation function-1 AR    Androgen receptor ARE   Androgen response element Areg   Amphiregulin \u03b2-gal   \u03b2-galactosidase bp    Base pair BSA   Bovine serum albumin CARM1  Co-activator-associated arginine methyltransferase 1 CBG   Corticosteroid-binding globulin CBP   cAMP-response-element-binding protein-binding protein CHO   Chinese hamster ovary Cldn2   Claudin2 COUP-TF  Chicken ovalbumin upsteam promoter transcription factor DAG   Diacylglycerol DBD   DNA binding domain DCC   Destran-coated charcoal DHT   5\u03b1-dihydrotestosterone DNA   Deoxyribonucleic acid EDTA   Ethylenediamineteraacetic acid EGF   Epidermal growth factor E2    Estradiol ER    Estrogen receptor ERE   Estrogen response element FABP   Fatty acid-binding protein FAS   Fatty acid synthase FBS   Fetal bovine serum FP    DNaseI footprnting region FPLC   Fast protein liquid chromatography  xiii FSH   Follicle stimulating hormone Gapdh   Glyceraldehyde-3-phosphate dehydrogenase Gas6   Growth arrest specific gene 6 GnRH   Gonadotropin releasing hormone GST   Glutathione S-transferase HepG2   Human hepatoblastoma HDACs   Histone deacetylases HNF-4\u03b1   Hepatocytes nuclear factor-4\u03b1 HSD   Dehydrogenase IRMA   Immunoradiometric assay KAP   Kidney androgen responsive protein kd    Dissociation constant kD    Kilo dalton KLK   Kallikrein-related peptidase LH    Luteinizing hormone LNCaP   Lymph node of prostatic cancer LBD   Ligand-binding domain LG    Laminin globular-like LRP   37-kDa laminin receptor precursor ODC   Ornithine decarboxylase Osr2   Odd-skipped related 2 MAPK   Mitogen-activated protein kinase mRNA   Messenger ribonucleic acid NcoR   Nuclear receptor corepressor PAGE    Polyacrylamide gel electrophoresis pARE-luc  Androgen response element-luciferase reporter gene PBS   Phosphate-buffered saline PCR   Polymerase chain reaction PCT   Proximal convoluted tubule PLC   Phospholipase PPAR   Peroxisome proliferator-activated receptor  xiv PR    Progesterone receptor PRE   Progesterone respone element PSA   Prostate-specific antigen RT    Reverse-transcription SD    Standard deviation(s) SDS   Sodium dodecylsulphate SHBG   Sex hormone-binding globulin SRC   Steroid receptor c-activator TBP    TATA binding protein Tnfaip2   Tumor necrosis factor alpha-induced protein 2 Vcam1   Vascular cell adhesion molecule-1 USF   Upstream stimulatory factor  xv Acknowledgements I would like to thank the members of my supervisory committee, Dr. Anthony Cheung, Dr. Raja Rajamahendran, Dr. Calvin Roskelly and Dr. Kiran Soma for their guidance, direction and criticisms. I also thank Mrs. Roshini Nair for her support and assistance in matter of my course program.  I thank all lab members at the Dr. Hammond laboratory. In particular, I wish to express my thanks to Caroline for great support over the past five years. I also thank Dr. David Selva for his friendship and thoughtful discussions. I am thankful Solange and Hai-Yan for their friendship. I would also like to thank Hwa-Yong, JP (Popesku Jason) and John for their friendship and interesting conversations beyond the study of SHBG and CBG. I would like to thank Dr. Mark Carey for his collaboration and discussion of LRP story. And I thank Dr. Ng for his contribution to studies.  I am deeply indebted to my mentor Dr. Geoff Hammond, for giving me the opportunity to learn the true meaning of \u201cResearch\u201d. I would like to thank him for guidance and constant encouragement of my study. I am proud being a member of Dr. Geoff Hammond laboratory.  Most importantly, I would like to thank my parents, Deokhui Han and Seongyong Hong, my unqualified supporters. And I would like to thank my brothers for their support, for encouraging me to never give up. In particular, I would also like to thank my new parents, Sunki Park and Boojue Cho, for believing in me.  And last but not least, I would like to thank my wife, Hyunjeong for her unwavering love and patience and for making the past five years much happier.     1  1. Literature review 1.1 Overview Sex hormone-binding globulin (SHBG) is a dimeric glycoprotein that binds biologically active androgens (testosterone and 5\u03b1-dihydrotestosterone) and estrogens (estradiol and 2-methoxy-estradiol) with high affinity in human blood. Plasma SHBG originates from hepatocytes (1), while its testicular homologue, androgen-binding protein (ABP), is produced by Sertoli cells of most mammals (2-4): their roles are to transport sex steroids in the blood and the male reproductive tract, respectively, and to regulate the \u201cbioavailability\u201d of their steroid ligands (5). Fluctuations in SHBG concentrations influence the distribution of sex-steroid hormones between protein-bound and free fractions in the blood (6, 7), while ABP is believed to maintain the high androgen levels between the testis and epididymis that are considered important for sperm maturation (8, 9). Plasma SHBG levels change normally during development and pregnancy (10-13) and abnormal levels in disease states contribute to their underlying pathologies. For instance, abnormally low plasma concentration of SHBG are often found in patients with androgen (14) and estrogen (15) dependent diseases that are generally associated with a concomitant increase in the amount of free steroid in the blood (7). There have also been numerous reports that SHBG concentrates within many sex steroid target tissues, including prostate (16), placenta (17), uterus (18), fallopian tube (19) and brain (20), but the biological significance of SHBG in these tissues is not well understood. In addition, human SHBG has been located inside several specific cell types (21-23), and has been identified in the cytoplasm of androgen sensitive epithelial cells within the renal 2  proximal tubules of transgenic mice (24, 25). These observations are important because together they suggest a novel role for SHBG beyond that of a plasma steroid binding protein.  1.2 Sex steroid hormones 1.2.1 Biosynthesis of sex steroid hormones Sex steroid hormones, produced mainly by the gonads or adrenal gland, are responsible for the differentiation and development of reproductive organs, and the secondary sex characteristics that distinguish males from females. Androgens and estrogens are two classes of sex steroid hormones, and they are generally referred to as the \u201cmale\u201d and \u201cfemale\u201d sex hormones, respectively. Testosterone, which accounts for over 95% of the serum androgens, is derived from testicular secretion in male, while most of the estrogen in females is synthesized as estradiol by the granulosa cells of the ovary. Gonadal steroidogenesis is controlled by gonadotropin-releasing hormone (GnRH), which is released from hypothalamus to activate the secretion of gonadotropins, luteinizing hormone (LH) and follicular-stimulating hormone (FSH) by the anterior pituitary. The gonadotropins, act via their receptors on specific cell types within the gonads to enhance steroidogenesis (26). This constitutes the hypothalamic\/pituitary-gonadal axis, and the whole cascade of hormone secretion within this axis is tightly controlled by feedback mechanisms involving changes in the plasma levels of the sex steroid hormones. For example, androgens exert a negative feedback in both the hypothalamus and pituitary on the release of GnRH and LH, respectively (27), while estrogen inhibits the production of GnRH, causing the pituitary to make less FSH (28). 3  Steroid biosynthesis is initiated by the removal of a 6-carbon residue from the side chain of cholesterol. The cleavage reaction converts C27 cholesterol to C21 pregnenolone and involves a side chain cleavage enzyme (desmolase, CYP11A1) in the mitochondria of steroid-producing cells of gonads and adrenal gland. Steroid hormones are classified into five groups; glucocorticoid, mineralocorticoid, progestogen, estrogen and androgen. The steroidogenic pathways leading to the production of androgens and estrogens in the testes and ovaries require a number of oxidative enzymes (Figure 1.1). Unlike the adrenal gland, steroid producing cells of gonads contain a 17\u03b2-hydroxysteroid dehydrogenase that enables dehydroepiandrosterone and androstenedione to be converted to testosterone. Testosterone biosynthesis takes place in the Leydig cells located in the interstitial compartment between the seminiferous tubules in the testis (29), and is stimulated by luteinizing hormone (LH) derived from the anterior pituitary. Although testosterone itself is responsible for androgen effects, its 5\u03b1-reduced metabolite, 5\u03b1-dihydrotestosterone (DHT), is significantly more potent in most target organs (30). According to the two-cell\/two-gonadotropin hypothesis of ovarian steroidogenesis, LH acts on the theca cells to stimulate the production of androgens, which serve as substrates for FSH-inducible aromatase in granulosa cells that are the source of ovarian estrogens (31). In the ovary, estradiol and estrone are derived from their immediate androgen precursors, testosterone and androstenedione, respectively (32). 1.2.2 Genomic versus nongenomic effects It is generally accepted that steroids enter target cells by passive diffusion, but there is evidence that this might be enhanced by facilitated transport across the plasma membrane (33). Steroids play crucial roles in regulating numerous physiological processes, such as 4  proliferation, differentiation, and morphogenesis and homeostasis (34, 35). In addition to their role as regulators of reproductive functions, sex steroid hormones exert effects on various tissues such as bone, kidney, muscle and cardiovascular system. The classical mechanism of steroid hormone action (Figure 1.2) involves the binding of steroids to specific intracellular receptors that are located in either the cytoplasm or nucleus (36). The steroid-bound receptor undergoes conformational changes, which allows it to dissociate from chaperone proteins (heat shock proteins) in the cytoplasm and to translocate to the nucleus, where it can then bind to specific DNA elements or \u201ccis-elements\u201d and act as a transcription factor (36). Nuclear hormone receptors can interact directly with the general transcription machinery, but they usually also interact with other sequence-specific transcription factors in the nucleus, as well as with an increasing list of co-activators and co-repressors (37, 38). Thus, the interaction between sex steroid hormones and their cognate receptors in the classical pathway is the key element of the \u201cgenomic\u201d transcriptional mechanism of steroid-dependent gene expression (39). In contrast to this classical pathway (Figure 1.2), steroid hormones also work via membrane receptors that mediate intracellular signaling pathways, and the outcome usually involves modifications of intracellular proteins that subsequently activate or repress target genes, rather than any direct effect on gene transcription (40). For instance, estrogen-induced increases in intracellular calcium are resistant to transcription and translation inhibitors, actinomycin and cycloheximide, both of which block steroid effects at the genomic level (41), and this non-classical mechanism of steroid hormone action leads to the activation of a reporter gene that contains a cAMP response element rather than an estrogen response element (42). However, none of these mechanisms function in isolation, and it is important to 5  consider the integrated effects of classical and non-classical actions when studying the overall physiological effects of steroid hormones (Figure 1.2). 1.2.3 Bioavailability of sex steroids After their production and secretion from endocrine tissues, sex steroids circulate in the bloodstream through a dynamic association with various plasma proteins, the concentrations of which play a key role in determining the overall \u201cbioavailability\u201d of steroid hormones (5, 6). When plasma steroid-binding proteins are ranked in order of their affinities for specific ligands, SHBG has the greatest affinity for steroids, followed closely by corticosteroid-binding globulin, and it is important to note that these two proteins bind steroids with affinities that are several orders of magnitude greater that those of albumin and orosomucoid (Figure 1.3A). However, albumin still contributes significantly to the binding and transport of steroids in the blood because it is by far the most abundant plasma protein. Moreover, despite its low affinity for sex steroids, albumin also exhibits some specificity for sex hormones; for instance, it has a preference for estradiol over testosterone (43). While the steroid-binding specificity of orosomucoid is more restricted than that of albumin, its affinity for sex steroids is only marginally greater than that of albumin, and its physiological impact is limited because its concentration is much lower than that of albumin (5). In early studies (44), it was shown that only 1~5% of the sex steroids in the plasma circulate freely, and that in women 65% of the testosterone and 35% of the estradiol is bound to plasma SHBG (Figure 1.3B). Unlike albumin, which has a high capacity and low affinity for a wide variety of steroids and other lipophilic molecules, SHBG only binds steroid hormones with high affinity if they have a hydroxyl group at C17 and either keto or hydroxyl 6  groups at C3 of the steroid A ring (45). Although SHBG is present in very small amounts in plasma, it plays a very significant role in sex steroid binding and transportation due to its very high affinity for these ligands (43). In human plasma, SHBG is mostly occupied by testosterone and androstenediol (androst-5-ene-3\u03b2, 17\u03b2-diol), but it also binds the biologically most active androgen, DHT with an affinity (Kd=0.67 nM) that is about 5 and 10 times greater than its affinity from testosterone and estradiol, respectively (6). Although the affinity of SHBG for testosterone and DHT is similar to that of the intracellular androgen receptor (AR), the dissociation-rate of these androgens from SHBG is much faster than from the AR, and SHBG does not bind synthetic androgens or synthetic estrogens that have been designed to bind with high affinity to their intracellular receptors (46). Since unbound steroids in the blood are freely accessible to target tissues (47), high affinity plasma steroid-binding proteins, like SHBG, therefore play key roles in modulating the bioavailability of the most active steroid hormones (48, 49).  1.3 Sex hormone-binding globulin 1.3.1 Sex hormone-binding globulin\/androgen binding protein The first description of SHBG as an estrogen-binding \u03b2-globulin in human serum was published in 1966 (50), and one month later another group described a specific testosterone-binding protein (51). Several years later, a specific androgen binding protein (ABP) was identified in rat testis and epididymis (52). After cloning of the cDNAs encoding human SHBG and rat ABP, it became obvious that they encode proteins with very high sequence similarity (53-60). The general physicochemical properties and binding specificities 7  of plasma SHBG and testicular ABP have been documented and summarized extensively (61), and it is now known that these proteins are encoded by a single gene (62-64) that is expressed in different tissues under the control of cell specific regulatory mechanisms (4, 65). While rodent ABP is produced by Sertoli cells and is secreted into the seminiferous tubules (66), human SHBG is expressed only in the germ cells of the testis and the SHBG isoform produced by developing spermatids and spematocytes appears to accumulate in the acrosome of immature sperm (23). 1.3.2 SHBG gene structure and organization The human SHBG gene is located on the short arm (p12-p13) of chromosome 17 (63, 67), and the coding sequences span ~3.2 kb of genomic DNA (68). This SHBG transcription unit consists of 8 exons flanked by a proximal promoter in the liver (Figure 1.4), which regulates its expression in the liver (69) and kidney (70). Its promoter lacks a traditional TATA-box and consists of six cis-acting elements defined by DNase I footprinting using liver nuclear protein extracts (69). Footprinted region 1 (FP1, -41\/-18) contains a hepatocytes nuclear factor-4\u03b1 (HNF-4\u03b1) or chicken ovalbumin upstream promoter-transcription factor (COUP-TF) binding site, which appears to replace the need for a TATA-box (69), and the binding of HNF-4\u03b1 to this cis-element represents the key control factor for hepatic SHBG expression (71), and this is reviewed in more detail below. The other DNase 1 protected regions within the human SHBG proximal promoter include at FP2 (-61\/-52), FP3 (-88\/-66), and FP4 (-114\/-96), FP5 (-152\/-134) and FP6 (-200\/-177) (69). It has also been shown that a (TAAAA)n repeat element on 5\u2032 region of proximal promoter influences its transcriptional activity (72). Interestingly, this polymorphismic (TAAAA)n repeat element has been linked to polycystic ovarian syndrome (73), the timing of menarche (74) and bone density in elderly men (75) . 8  Human SHBG transcripts containing an alternative exon 1 are present in testicular germ cells (23) and their production appears to be under the control of a testis specific promoter flanking this alternative exon 1 sequence (65), which is located about 2 kb upstream from exon 1 of the transcription unit that is expressed in the liver (63), as shown as Figure 1.4 (23, 63, 76). Alternative exon 1 sequences have been identified in human testis (63), as well as fetal rat liver (64), and they replace the exon 1 sequence coding found in liver and kidney SHBG mRNA (8, 77). When human sperm and plasma are treated with N-glycosidase F to remove N-linked oligosaccharides from SHBG, the apparent size of the sperm SHBG isoform appears to be about 5 kDa smaller than the human SHBG in blood, most likely because it lacks amino-terminal residues (23, 54). The explanation for this is that the alternative exon 1 sequence contains very short an open reading frame that is not flanked by a strong kozak translation initiation sequence (78) and does appear to be transcribed. However, the AUG codon for Met30 in the mature SHBG sequence, which is encoded in the exon 2 sequence, is flanked by a near perfect kozak sequence (63), and can be translated to yield an aminoterminally truncated SHBG, which lacks a secretion polypeptide sequence (65). While numerous alternatively spliced SHBG transcripts have been defined in liver and testis of rodent (23, 64), SHBG mRNA has also been detected in the rat brain (20), and its transcript consisted of alternative exon 1 and 2-8 exon sequences that could also encode a protein without a secretory signal peptide (79). Human SHBG transcripts lacking the exon 7 sequence have been detected in breast tumors (80, 81) and cervical cancers (18). In addition, SHBG mRNA has been reported to be present in human prostate epithelial and stromal cells (21, 82) and in LNCaP cells (83), and various spliced SHBG transcripts have been detected in LNCaP cells (84). Although the molecular mechanisms that give rise to the various 9  alternative transcripts of the human SHBG and rat Shbg, which lack exon 1, exon 7 sequence and exon 6 sequences, are unknown (63, 64), it has been noted that these alternatively spliced exons are flanked by repetitive DNA sequences (63). Moreover, with the exception of the human sperm SHBG isoform (23), it has never been formally demonstrated that SHBG-like proteins are actually produced from these variant transcripts. 1.3.3 Tissue specific expression of SHBG The liver is the major site of plasma SHBG production in all species studied to date (85-88), but rats and mice only produce SHBG in the liver during the fetal period (25, 64). Furthermore, it is important to note that SHBG mRNA is not present in rodent livers, after birth, and SHBG is undetectable in the blood of adult mice or rats (25). This species-specific difference in the expression of genes encoding SHBG is most likely due to differences in their regulatory sequences (25, 69).  Production of mRNA encoding plasma SHBG is regulated by the proximal promoter sequence which includes 800 bp upstream of transcription start site. As a mentioned above, this promoter lacks the traditional TATA or CAAT-box elements (63), and the FP1 region (-41bp to -18bp relative to the transcript start site) of the promoter replaces the biding site of the TATA-binding protein, and contains specific HNF-4\u03b1 and COUP-TF binding site which are the key transcription factors responsible for basal transcriptional activity (69). In this regard, HNF-4\u03b1 acts an inducer of hepatic SHBG transcriptional activation by interacting with FP1, while the binding of COUP-TF on FP1 antagonizes this activation (69). Recent studies have demonstrated that the hepatic SHBG gene expression is regulated by HNF-4\u03b1 binding to FP1, which is influence to a large extent by metabolic status and is very sensitive to monosaccharide-induced lipogenesis (71). In addition to FP1, FP3 of the SHBG promoter 10  includes a second a binding site for HNF-4\u03b1 \/COUP-TF, it relates with additional regulation of SHBG expression in response to up- or down-regulation of HNF-4\u03b1 (69, 71). However, FP3 is also a binding site for peroxisome proliferator-activated receptors (PPARs), and PPAR\u03b3-2 directly reduces hepatic expression of the human SHBG gene (89). The FP4 of SHBG promoter appears to be the binding site for upstream stimulatory factors (USFs), but hepatic SHBG transcription is not affected by the presence or absence of FP4 (77). Although FP2 clearly represents a binding site for a hepatic nuclear protein, its identity remains obscure (69).  In addition to the liver, the testis is a major site of SHBG production in humans and rodents (63, 90). In the testes of rodents (4, 91) and several other mammals (92, 93), SHBG (also known as ABP) is produced by Sertoli cell and is secreted into the seminiferous tubules, while human testicular SHBG expression is confined to germ cells and an SHBG isoform accumulates in the sperm acrosome (23, 65). It is evident that human SHBG expression in germ cells is under the control of a distal promoter because these cells contain SHBG transcripts comprising the upstream alternative 1 exon sequence in mice that harbor an 11-kb human SHBG transgene, while mice that express a 4.3-kb human SHBG transgene that lacks this distal promoter and alternative exon 1 sequence have no human SHBG transcripts in their testes (23). Moreover, subsequent studies in transgenic mice have indicated that the USF binding site within FP4 of SHBG proximal promoter suppresses its expression in the Sertoli cells (77). This FP4 sequence is not present in the Shbg genes of rodents or other subprimate species, and this explains why human SHBG expression is not expressed in Sertoli cells (23). The kidney is also a site for human SHBG expression in transgenic mice, and human SHBG transcripts in the kidney of these animals are largely confined to the epithelial cells of 11  the proximal convoluted tubules: immunoreactive human SHBG is also detected in same the cell types, but is also present in the urine (70). As in the liver, the human SHBG proximal promoter directly regulates its expression in the kidney (70). In transgenic mice, the expression of human SHBG transgenes in the mouse kidney is sexually dimorphic, and low levels of SHBG mRNA are present in this tissue prior to puberty, and then marked increase in parallel with increase in testicular androgen production during sexual maturation (25). The androgen dependence of human SHBG expression in the kidney of these transgenic mice was confirmed by to a decrease in human SHBG mRNA levels in the kidney of male mice after orchiectomy, while treatment of female mice with DHT had the opposite effect (25). In an earlier study, it was observed that human SHBG transcripts are particularly abundant in the duodenum of fetal mice expressing human SHBG transgenes (25). In pilot studies, we also found that human SHBG transcripts are also present within the duodenum of adult transgenic mice and that immunoreactive SHBG accumulates in specific population of duodenal epithelial cells (94). These new finding was unexpected and is potentially important because estrogen influences the vitamin D dependent uptake of calcium by these cells. Although, parallel RT-PCR based analyses of mouse Shbg transcripts in the duodenum proved negative (Figure 1.5A), our preliminary studies of human tissues have indicated that SHBG is expressed in this region of the intestine (Figure 1.5B), as predicted by our transgenic mouse model. A preliminary immuno-histochemical study also showed that SHBG and CaBP-9k are located in the same region of the duodenum (Figure 1.5C), but that they accumulate in different populations of epithelial cells within the same villous structure. Although it has recently become apparent that CaBP-9k is not required for the vitamin D-dependent uptake of calcium absorption using a knockout mouse model (95, 96), the link 12  between estrogen and the vitamin D-dependent uptake of calcium is strong (97). The observation that SHBG accumulates within specialized epithelial cells of the duodenum therefore represents a novel site in which SHBG could control the actions of sex steroids. In intestinal epithelium, three differentiated cell types are organized along the villus, such as enterocytes, goblet cells and enteroendocrine cells (98). To further define what epithelial cell types within the duodenum express human SHBG, we examined the duodenum of mice expressing human SHBG transgenes by double-label immuno-histochemical studies with anti-human SHBG antibodies and antibodies directed against cell specific maker proteins. Several selected examples of the staining pattern are shown in Figure 1.6, and chromogranin A (enteroendocrine cell marker), fatty acid synthase (FAS), fatty acid-binding protein (FABP, enterocyte marker), Ki 67 (proliferation maker), E-cadhedrin (epithelial cell maker) and HNF-4\u03b1 (nuclear protein maker) were used in an attempt to identify the human SHBG expressing cells. Interestingly, immune-reactive SHBG was co-located with all chromogranin A and fatty acid synthase positive cells in the duodenal epithelium of mice expressing human SHBG transgenes, and this suggest that human SHBG in the duodenum is confined to enteroendocrine cells. 1.3.4 Regulation of plasma SHBG levels Since the liver is generally regarded as the source of plasma SHBG, variations in plasma SHBG levels are thought to directly reflect changes in SHBG gene expression in hepatocytes. Early studies showed that plasma SHBG levels can be increased by several factors, including sex steroids, thyroxin, insulin, and differences in nutritional status as reflected by body weight in particular (14, 99, 100). Studies using human hepatoblastoma cells (HepG2), which 13  produce and secrete SHBG into the culture medium (24), argue against the direct role of sex steroids in SHBG production by the liver because the results indicated that androgens and estrogens either marginally increase (101), or have no effect on SHBG production (102). In humans, plasma SHBG levels are very low in both sexes at birth. During the first week of life, the progressive increase of plasma SHBG levels has been attributed to a thyroid hormone-dependent induction of human SHBG expression in the liver (103). It was confirmed that thyroid hormone stimulates SHBG production in cultured HepG2 cells by increasing the steady state of its mRNA concentrations (99, 102), and it is now known that this is an indirect effect mediated by a thyroid hormone-induced increase in hepatic HNF-4\u03b1 levels (104). Plasma SHBG levels remain relatively high until puberty and may serve to restrict the actions of adrenal androgens during infancy (105, 106); they then decrease markedly during puberty in males and to a lesser extent in females, which may reflect sex differences in androgen exposure and changes in the metabolic state (107-109). Using an immunoradiometric assay (IRMA), the plasma levels of SHBG are much greater in the women (18-110 nM) than in men (11-44 nM), and even higher (247-668 nM) is observed in pregnant women (110). During gestation, the very significant increase in plasma SHBG levels has been attributed to a estrogen dependent induction, which is also observed when women are treated with synthetic estrogens (14, 111). Oral administration of steroids (ethinyl-estradiol) leads to significantly increased plasma SHBG levels, which return to the basal state after the treatment is stopped (111-113). By contrast, androgens and androgenic progestins reduce plasma SHBG levels in adults (114, 115). Although Plasma SHBG levels are determined by age, gender and various physiological states, it is also known that SHBG levels are determined by genetic factors (116). For example, genetic deficiencies in plasma 14  SHBG levels are associated with hyperandrogenism and ovarian dysfunction in young women (117). Moreover, low plasma SHBG has been shown to be predictive of the incidence of type II diabetes in women but not in men, and of subsequent development of cardiovascular disease (118, 119).  1.4 Biochemical and molecular properties of SHBG 1.4.1 SHBG protein structure The SHBG precursor consists of a 29 amino acid hydrophobic leader sequence followed by 373 residues that include two disulfide bridges linking Cys164-Cys 188 and Cys 333-Cys 361, as shown in Figure 1.7A (54, 60, 63). The amino acid sequence of human SHBG was first obtained by direct sequencing of the isolated plasma protein (60, 120), and was verified by the nucleotide sequence from SHBG cDNA and genomic DNA (54, 63). A mature SHBG polypeptide has one site for O-glycosylation and two sites for N-glycosylation (54, 121). Although the molecular weight of the SHBG polypeptide is 40.5 kDa, plasma SHBG has an apparent molecular size of about 90 kDa because it exists as homodimer with three carbohydrate branches attached to each subunit (60). The SHBG structure comprises two laminin globular-like (LG) domains (LG 4 and LG 5), and this tandem LG repeat, which essentially represent the entire SHBG structure, is also found in laminin, argin, merosin, Protein S and growth arrest specific gene 6 (Gas6) (122-125). The LG4-LG5 domains of SHBG closely-resembles the C-terminal region of Gas6 and protein S (122), and this observation raises the intriguing possibility that SHBG is a ligand for the C4b-binding protein or members of Axl\/Tyro-3 receptor tyrosine kinase family 15  of cell surface proteins because the C-terminal \u201cSHBG-like\u201d region of protein S has been reported to interact with the tyrosine-protein kinase receptor, Tyro-3 (126), and C4b-binding protein (127), and the corresponding C-terminal region of Gas6 binds to the Axl receptor (124). 1.4.2 Steroid-binding site Under physiological conditions, SHBG comprises with two 40.5 kDa monomers, and each monomer contains a functional steroid-binding site within the LG 4 domain (Figure 1.7A) (128). Biologically active sex steroids bind to the amino-terminal LG 4 domain, which also includes the dimerization interface (122, 129, 130). The highly potent ligand 5\u03b1-DHT intercalates between two \u03b2-sheets in jellyroll motif of LG4 domain, and the ligand-binding site of SHBG is different from nuclear receptors in which the interior of the ligand binding domain consists of three \u03b1-helices (131, 132). When the hydrophobic 5\u03b1-DHT inserts into the steroid-binding pocket of LG 4 domain (Figure 1.7B), its oxygen atom at C3 makes contact with Ser42 and the hydroxyl group at C17 hydrogen-bonds with Asp65 and Asn82 (122). The latter study also demonstrated that the steroid-binding affinity was greatly diminished by substitution of Ser42 with leucine without any disruption of dimerization (76, 130, 133). These crystal structure experiments also explain why Met139 and Lys134 were found to contact with C6 and C17 of steroid ligands in earlier photolabelling experiments (134, 135). Before the SHBG crystal structure was available, the steroid ligands were all thought to be oriented with same way within the biding site, but this is not the case because the preferred orientations of C18 estrogens and C19 androgens are completely reversed, and this is important because it results in subtle differences in the positioning of amino acid residues on 16  the surface of the protein that could influence possible interactions between SHBG and other proteins (45). Crystal structure studies have also demonstrated that the SHBG dimmer interface between the LG 4 domains of each monomer is located between \u03b2-sheet 7 of one monomer and the \u03b2-sheet 10 of the other monomer and consists of eight chain hydrogen bonds (122). Each monomer has two zinc-binding site and a calcium-binding sites within the LG 4 domain, and these divalent cations stabilize SHBG dimerization and can influence the specificity of steroid binding (129, 136) These metal ions bound SHBG are not located within the dimmer interface (122), but their occupancy probably exerts long range effects on the positioning of those structural elements that constitute the dimer interface. Most importantly, occupancy of a zinc-binding site in an unstructured loop that covers the steroid-binding site of human SHBG has a very direct effect on the relative affinities of androgens versus estrogens (137). 1.4.3 Post-translational modification Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis revealed that SHBG comprises heavy (52 kDa) and light (48 kDa) subunits in an approximate 10 to 1 ratio in plasma (3, 120). This electrophoretic micro-heterogeneity is due to differences in the utilization of the two biantennary oligosaccharides at Asn 351 and 367, as shown as Figure 1.7A (60, 120, 121), and is eliminated by treatment with N-deglycosylation enzymes or substitution of glycosylation sites by site-directed mutagenesis (138, 139). Interestingly, the most C-terminal N-glycosylation site within the LG 5 domain is highly conserved in mammalian species, and has been considered to be functionally important (140). This has never been formally proven but, like other plasma glycoproteins, the biological 17  half-life (metabolic clearance) and intracellular tracking\/secretion of plasma SHBG is influenced by its carbohydrate composition (138, 141, 142). However, it should be noted that while the presence of carbohydrate chains are not essential for the steroid-binding or the dimerization (133, 143), they could influence interactions between SHBG and other proteins including those within cell membranes (144).  1.5 Functions of SHBG 1.5.1 Plasma steroid transport Sex steroids are synthesized mainly in endocrine organs, but the actions of sex steroids extend to all target tissues, and the transport of sex steroids to these sites is a key element of their action. The primary function of SHBG is to transport biologically active sex steroids in the plasma and to regulate the fractions of its steroid-ligands that are accessible to target cells (5, 47). By virtue of its very high affinity for sex steroids, SHBG is thought to regulate the bioavailability and metabolic clearance of its steroid ligands in plasma (7, 145), and this is supported by the fact that free and albumin bound sex steroids undergo rapid metabolic clearance as compared to the SHBG-bound fraction (7, 145). These functions are influenced mainly by fluctuations in plasma SHBG levels that occur during normal physiologic or pathologic conditions. In essence, it has been proposed that the SHBG functions as both a reservoir and a buffer to modulate pulsatile or cyclic fluctuations in steroid concentrations (43). For example, low level of plasma SHBG results in an increase of free estrogen in menopausal women, which causes diseases, such as endometrial cancer, that are related to 18  excess unopposed estrogen (7, 15), as well as symptoms of androgen excess in younger women (117). 1.5.2 Presence of SHBG within tissues There is evidence that SHBG accumulates within the stromal compartment of the uterine endometrium (146) and fallopian tubes (19), as well as tissues like the breast and prostate that are far less vascularized (147, 148). In addition, substantial amounts of SHBG remain associated within the stroma isolated from human benign prostatic tissue (16). Interestingly, the concentration of sex steroids is increased in normal breast tissue when compared with peripheral blood (149), and a similar observation was also noticed in rat uterus when [3H]estradiol was co-administered with human SHBG (150). Recently, it has been shown that SHBG accumulates in sex steroid sensitive tissues, such as the uterus and the epididymis, and that this process involves the ligand-dependent binding of SHBG to members of the fibulin family of matrix-associated proteins (146). The dynamic nature of SHBG:fibulin interactions in vivo was demonstrated in the same transgenic mouse model in which human SHBG was specifically sequestered by the endometrial stroma in animals treated with exogenous estrogens, or during proestrus in untreated animals when plasma estradiol concentrations are at their highest (146). 1.5.3 Presence of SHBG inside cells Production of the antibodies against human SHBG provided the early evidence that this protein could localize in male reproductive tissues of monkey (147), rat (151) and human (152) and could interact with sex response cells. In rodents, testicular ABP is produced and secreted by Sertoli cells (90, 91), and the protein remains confined within male reproductive 19  tract, where it is thought to sustain a high androgenic environment for maturing spermatocytes and sperm as they migrate from the seminiferous tubules towards the epididymis (151, 153). In our previous study, the human testicular SHBG was detected in developing spermatocytes, it was also located between the outer membrane of the acrosome and the sperm plasma membrane (8). Thus, it may influence the physiological actions of sex steroids on sperm function because it appears to have the same steroid-binding properties as plasma SHBG (23).  In addition to male reproductive tissues, we also observed that SHBG is present in the cytoplasm of specific epithelial cells within the kidney (24) and small intestine (94) of human transgenic mice, and we considered this remarkable because the human SHBG transcripts in these cells comprise the same exon sequences as the SHBG mRNA in the liver. Although the physiological role of SHBG in these epithelial cells is not clear, an intracellular accumulation of SHBG might sequester free sex steroids from the renal and gastrointestinal fluids to regulate their actions locally in a cell specific manner. In rat brain, immunoreactive ABP was detected in specific region such as supraoptic and paraventricular nuclei (20). In transgenic mice expressing rat ABP transgene, the immunoreactive ABP are detected in the uterus and ovary (154). 1.5.4 Putative SHBG receptor Interactions between SHBG and plasma membrane components were first investigated in human decidual endometrium (155), and in these studies interactions were observed with estradiol-bound SHBG but not with unliganded SHBG or SHBG in complex with androgens (156). Subsequently, numerous studies reported that the SHBG binding sites are present in cell membranes of various human tissues such as the prostate (157), placenta (158) and 20  epididymis (159). In contrast to the endometrium, placental plasma membranes were found to interact with SHBG in complex with androgen (160), while human SHBG has been reported to interact with membranes of estrogen-dependent MCF-7 breast cancer cells (22) and in normal breast tissue (161). Putative \u201cSHBG receptors\u201d have been characterized in plasma membrane extracts from prostate tissues, and SHBG was reported to only bind with this receptor in the absence of ligands, while the addition of sex steroids resulted in a dissociation of the SHBG-receptor interaction and an increase cAMP-mediated second messenger mediated signal transduction events (162). The same group also obtained evidence that a synthetic peptide spanning residues 48-57 (TWDPEGVIFY) within the LG4 domain of SHBG represents part of the binding domain of SHBG that interacts with this receptor in prostate cells (163). Although others have reported that the O-glycosylation of SHBG at Thr7 in the LG4 domain seemed to be essential for interaction with this putative receptor (164), the identity of a plasma membrane SHBG receptor remains unknown and its existence is controversial. 1.5.5 Endocytosis of SHBG Early studies indicated that SHBG is internalized by MCF-7 cells (147, 165) and in the rat caput epididymis the epididymal cells were seen to interact with rat ABP and appear to internalize it as assessed by immuno-histochemistry and electron microscopy (151, 166). The latter studies also found that SHBG is internalized by spermatogenic cells (153) and sex steroid magnifies the rate of SHBG internalization (167). Recently, the non-specific endocytotic receptor megalin has been reported to internalize SHBG-DHT complex in BN16 cells (168), and the SHBG-megalin interaction may be of relevance in mouse kidney where 21  these proteins are expressed (70, 169). It is known that megalin mediates the recycling of vitamin D in complex with its high-affinity binding protein in the renal tubule and if this function is knocked out mice become severely vitamin D deficient (170). However, it is questionable whether megalin-mediated uptake of SHBG is physiologically important, and a functional role for megalin in the endocytosis of steroids has been hotly debated (171), and remains to be confirmed in a physiological context. 1.5.6 Interactions between SHBG and other proteins In attempts to discover SHBG interacting proteins, and especially the putative SHBG receptor, several independent yeast two-hybrid screens have been performed using SHBG sequences (146, 172). In one of these previous studies, filamin and metallothionein-II were identified as interacting with human SHBG as well as fibulin-1D and fibulin-2 (146). Metallothionein, the major intracellular zinc-binding protein, was identified as an SHBG interacting protein in both of these studies, and this is interesting not only because zinc is important for SHBG structure\/function, but because metallothionein levels are increased in various tumors (173) and related to cell proliferation of breast cancer (174). Based on report by others (172), one of the potential SHBG interacting proteins was flotillin-1, which is a component of lipid rafts that are tightly packed with fatty-acid chains of lipids on cell membrane. The flotillin-1 is the integral protein in plasma membrane (175), thus it may interact with plasma SHBG on cell membrane. Other SHBG target proteins include proteinases such as cathepsin D and kallikrein related peptidase 4 (see 1.6.5), both of which are expressed in sex steroid target tissues, and are also used as breast and prostate tumor markers (176-178). However, it should be noted that interactions involving proteins identified using this method are often produce false positive results and need to be verified 22  biochemically and tested to confirm that interactions actually occur in mammalian cell systems. 1.6 Androgen regulated genes 1.6.1 Androgen receptor On the basis of its structure, the AR is divided into three major domains, the N-terminal transcription-activation function-1 region (AF-1), the central DNA binding domain (DBD) and the C-terminal ligand-binding domain (LBD) (36). After binding a ligand, the AR undergoes a conformational change, allowing its dissociation from heat shock proteins, and its nuclear translocation and dimerization (Figure 1.9) (179). In the nucleus, the androgen receptor dimer binds to a specific sequence known as an androgen response element (ARE), which is often located within the promoter regions of androgen-responsive target genes (36), and thereby acts to either promote or reduce their transcriptional activity (180). Like other steroid hormone-mediated gene activation, chromatin modification is an essential step for androgen response gene transcription. Androgen-bound AR recruits several coactivators such as P160, P300, cAMP-response-element-binding protein-binding protein (CBP), steroid receptor c-activator (SRC) and co-activator-associated arginine methyltransferase 1 (CARM1), but antagonist-bound AR results in the recruitment of corepressors like nuclear receptor corepressor (NcoR), and histone deacetylases (HDACs) which act to modify chromatin structure (181-184). It is also important to note that although the two most biologically active androgens, testosterone and DHT, bind with almost identical affinities, the dissociation rate of testosterone from the AR is faster than that of DHT. This loss of ligand from the receptor 23  results in a more rapid turnover of the receptor in the nucleus (185) because in its unliganded state the AR is degradated rapidly, and its half-life is about 6 times shorter than when it is bound by androgen (186). Thus, even though androgenic ligands have different dissociation kinetics from AR and metabolic rates, they are also essential factors for receptor stabilization (187). 1.6.2 Androgen target tissues Androgens play a crucial role in the development and differentiation of primary and secondary male sexual organs, where their effects are most apparent in the male reproductive tract, but their anabolic effects are also seen in non-reproductive tissues including kidney and muscle (188). For instance, androgens increase both cell number and size in the prostate (189), but their anabolic effects are manifest in terms hypertrophy of cell size without cell proliferation in the kidney and muscle, even though these organs do not require androgen for normal function (190, 191). Although the primary target of androgens is the sex organs of the male sex reproductive tract, the effects of androgen vary in different androgen-responsive tissues. For example, androgens increase the life span of osteoblasts by affecting apoptosis or proliferation (192, 193), and induce DNA synthesis in the submandibular salivary gland (194). The hypothalamus and pituitary are target tissues for the negative feedback of androgens (27, 28), and androgens influence sexual differentiation and behavior (195). Androgen also induces the anti-apoptotic action in bone cells via the AR (196), and this effect is inhibited by antiandrogens (197). Although the role of androgens in the liver is obscure, they have been implicated in several liver diseases (198). 24  1.6.3 Kidney androgen regulated genes The murine kidney is well recognized as an androgen target organ, in which a number of specific genes have been identified after androgen induction (199), and among these the gene coding, kidney androgen-regulated protein (KAP) is one of the most abundant androgen-regulated gene in the mouse kidney (200). In mouse kidney, Kap gene expression is restricted to the proximal convoluted tubule cells where it is more sensitive to androgen induction than other androgen-regulated genes, such as those encoding \u03b2-glucuronidase and ornithine decarboxylase (190, 201-203). When Kap gene expression was compared with other androgen responsive genes after withdrawal of testosterone in vivo, it was noted that the synthesis rate of Kap mRNA was maintained by small amounts of residual testosterone for a while (2-3 days) but that of other genes declined rapidly (203). In the renal proximal convoluted tubules, cortical S1 and S2 segments are under the control of androgens acting through the AR, and this is very clear because testosterone fails to induce Kap expression in Tfm\/y AR-deficient mice (204, 205). In the medullar S3 segment of the renal proximal tubules, Kap expression is also under the control of thyroid hormone (206). The levels of \u03b2-glucuronisase mRNA and its protein are also dramatically induced in the PCT of mice treated with androgens (207, 208). In addition, ornithine decarboxylase mRNA (201) and alcohol dehydrogenase mRNA (209) are increased by androgen in the mouse kidney. Although it was originally identified from kidney cDNA library, the RP2 gene is expressed in all tissues like a \u201chousekeeping gene\u201d, but it is only androgen inducible in the kidney (210, 211). 25  1.6.4 Prostate-specific antigen (KLK 3, PSA) Kallikreins were originally identified as enzymes that are released as vasoactive kinin peptides from kininogen (212). Human kallikrein-related peptidases are encoded by a family of 15 genes located on chromosome 19q13.3\u201313.4 (213, 214), and all kallikrein gene family members have five coding exons, but some of them have one or two additional 5\u2019 untranslated exons (215). All kallikreins are secreted as preproenzymes, and cleaved at Arg16 (Lyn16 or Gln16) for enzyme activation (216). The proteolytic activity of kallikreins depends on the catalytic amino acids, histidine, aspartate and serine residues encoded by exon 2, 3 and 5 (217, 218). The prostate specific antigen, which is commonly known as PSA (kallikrein-related peptidases 3), is well known as a prostate-specific tumor marker (219), and its expression is regulated by two AREs in the proximal promoter and an additional ARE positioned at about 4 kb from the transcription start site (220, 221). The AREs within proximal promoter have higher activity than that of the more distal ARE which probably acts as an enhancer element (220, 221) together with several other AREs in the same region (222). AR coactivators bind to both the PSA promoter and enhancer regions, while AR corepressors are only involved within the AREs in the promoter region, and not the enhancer AREs (183, 184). In addition to androgen, progesterone and dexamethasone are both known to stimulate PSA expression, and PR or GR effects on PSA transcriptional activity were restricted to their interactions with the AREs within promoter, while the AREs in PSA enhancer are only activated by AR (223-225). Although estrogens fail to stimulate the PSA expression, they inhibit the androgen-stimulated PSA expression in T-47D breast carcinoma cell (226). 26  1.6.5 Kallikrein-related peptidase 4 (KLK4) Human KLK4 was first identified as tooth-specific serine proteinase (227, 228), and it was realized that the KLK4 gene comprises the five exon and four intron structure that characterizes the kallikrein gene family (178, 229, 230). Like kallikrein 2 and PSA, KLK4 is highly expressed in prostate tissue (178, 229). There are two major isoforms in prostate cancer; one of them is the full-length KLK4 isoform located in the cytoplasm, and the other is an N-terminal truncated isoform accumulated in the nucleus (231, 232). The KLK4 gene has both an ARE and a progesterone response element (PRE) in the promoter region, and it is regulated by both progesterone and androgens in breast and prostate cancers expressing progesterone receptor (PR) and AR (233). The PR is recruited to the PRE site with or without progesterone, but AR only interacts with the ARE site under the presence of androgen (233). Moreover, estrogen induces KLK4 expression in human endometrium cancer cells and human ovarian cancer cells that express the sex steroid hormone receptors (234, 235). Interestingly, estrogen also increases KLK4 expression in a number of endometrial cancer cell types (235), and the explanation for this is that the expression of PR is up-regulated by estrogen induced stimulation via the estrogen receptor (ER) acting on estrogen response element (ERE) site in the PR promoter (236). 1.7 Hypothesis and objectives Hepatocytes are the primary source of plasma SHBG but there is considerable evidence that SHBG is present in the extravascular compartments of many tissues, and immunoreactive SHBG has even been identified within the cytoplasm of some specific cell types. The functional significance of SHBG outside the blood vasculature is poorly 27  understood, and my research projects have been designed to test the hypothesis that \u201cCell-type specific expression of the human SHBG gene not only influences the access of sex steroids to target tissues but functions more directly to control their actions within specific cell types\u201d. I have employed a variety of experimental approaches to test this hypothesis, including the use of mice that express human SHBG transgenes together with variety of cellular and molecular biology approaches and biochemical methods. In a preliminary study of mice expressing human SHBG transgenes, we observed that immuno-reactive human SHBG accumulates within the cytoplasm of the epithelial cells in same region of the duodenal villi in which we could detect human SHBG mRNA. This extended an earlier observation that human SHBG expression in the proximal convoluted tubules of transgenic mice is accompanied by an accumulation of human SHBG in the epithelial cells of the S1 and S2 segments of the proximal convoluted tubule (PCT). To gain insight into how human SHBG is retained by these epithelial cells, my objectives were of follows: 1. I performed a comprehensive series of studies to define the biochemical characteristics of the SHBG that accumulates within PCT cell, and to determine how the presence of SHBG within the cytoplasm of these cells influences the androgen-receptor dependent regulation of androgen-responsive genes (Chapter 2). 2. I then set out to extend and complete studies of SHBG interactions with the laminin receptor precursor and to define how this interaction might explain the molecular mechanisms responsible for SHBG accumulation within the cytoplasm of PCT cells (Chapter 3). 28  3. Because others have reported that human SHBG is expressed by prostate cancer cells and that SHBG can be detected within these cells, I first examined how the SHBG in the extracellular environment influences androgen-dependent gene expression in the LNCaP prostate cancer epithelial cell line, and how this is effected by Kallikrein-related peptidase 4 (KLK4), which is an androgen-regulated serine protease (kallikrein) that has recently been identified as a SHBG interacting protein (Chapter 4). 4. I then examined how SHBG in the cytoplasm of LNCaP cells might influence androgen receptor-mediated gene expression in these cells (Chapter 4). These experiments provide new information about how SHBG acts directly to control androgen action locally at the target cells level, by either modulating androgen uptake by cells or altering the availability of androgens for binding to the androgen receptor within the cytoplasmic compartment, and together they support the hypothesis that the functions of SHBG extend beyond that of a simple plasma steroid transport protein. 29        Figure 1.1 Overview of the sex steroid hormone biosynthetic pathway The dashed boxes divide C21 progestogens (white), C19 androgens (dark gray) and C18 estrogens (light gray). Arrows are the following steroidogenic enzymes: CYP11A1 (20,22-desmolase), CYP17, (17,22-desmolase), 17\u03b2-HSD (17\u03b2-hydroxysteroid dehydrogenase), 3\u03b2-HSD (3\u03b2-hydroxysteroid dehydrogenase), CYP19 (Aromatase), 5\u03b1-R (5\u03b1- reductase). 30        Figure 1.2 Classical and nonclassical pathways of sex steroid hormone acitivities In the classical pathway, sex steroid hormone binds to cytosolic\/nuclear receptor (R), which dissociates from heat-shock proteins (HSPs). The ligand-bound receptor dimerizes, translocates into the nucleus, and binds to the hormone-response element (HRE) in the promoter regions of target genes. In the nongenomic pathway, sex steroid hormone binds to plasma membrane receptor (MR), stimulates membrane phospholipase C (PLC), and increases the production of IP3 and diacylglycerol (DAG), leading to increase in the intracellular Ca+2 concentration. The ligand-bound receptor may also stimulate the MAPK (mitogen-activated protein kinase) or AKT (serine\/threonine protein kinase) pathways. Modified from Orshal and Khalil (237). 31          Figure 1.3 Steroid binding-proteins in human biological fluids A, concentration and steroid-binding proteins in human plasma (43). CBG (corticosteroid-binding globulin), SHBG (sex hormone-binding globulin), DHT (5\u03b1-dihydrotestosterone). B, binding distribution of testosterone and estrogen in human plasma among albumin (white wedge), SHBG (dark gray wedge) and nonprotein-bound (black wedge). Modified from Dunn et al. (6).    32        Figure 1.4 Human SHBG gene and its transcripts Hepatic SHBG mRNA contains sequence corresponding to exon 1 to exon 8 following the proximal promoter. The testicular alternative SHBG mRNA that contains an alternative exon 1 sequence located about 2 kb upstream from transcription start site for the hepatic SHBG mRNA. Thus, these different SHBG transcripts contain alternative exon 1 sequences followed by exons 2 to exon 8.    33    Figure 1.5 Human SHBG is expressed in the small intestine and accumulates in epithelial cells of duodenal villi A, human SHBG is expressed specifically in the small intestine while the endogenous murine shbg gene is not expressed at all in the intestine of mice expressing a human SHBG transgene. B, RT-PCR amplification of human SHBG mRNA from total RNA extracts of adult human duodenum and kidney. C, immuno-histochemical localization of immunoreactive human SHBG (brown stain) and mouse CaBP-9k (brown stain) appear in the cytoplasm of specific populations of epithelial cells within the duodenal villi of mice expressing human SHBG transgenes. 34    35  Figure 1.6 Immuno-histochemical analyses in duodenal villi of transgenic mice carrying the 4.3-kb human SHBG transgene A to F, immunoreactive SHBG appears in cytoplasm of specific populations of epithelial cells within the duodenal villi (A-D, green; E-F, red). To identify the co-localization between SHBG and other proteins, the specific antibodies for chromogranin A (A, red), FAS (B, red), Fatty acid-binding protein (C, red), Ki 67 (D, red), E-cadhedrin (E, green) or HNF-4\u03b1 (F, green) were co-incubated with anti-human SHBG antibodies using corresponding Alexa-Fluor conjugated secondary antibodies. Co-localization (yellow\/orange) of human SHBG and each protein is evident by superimposition of the green and red signals, respectively. DAPI (blue) was used for nuclei staining. Arrows are indicators of co-localization between SHBG and chromogranin A or FAS, respectively. Scale bar = 10\u00b5m. 36       Figure 1.7 Primary structure of human SHBG and ribbon representation of the SHBG N\u2013terminal LG4 domain tertiary structure showing the location of the steroid-binding site A, mature human SHBG contains two LG domains (1-373 residues) following removal of a 29 amino acid hydrophobic leader sequence. The amino-terminal LG4 domain has one O-linked glycosylation site (Thr 7), while the LG5 domain contains the two N-linked glycosylation sites (Asp 351 and Asp 367). B, the \u03b2-strands of the two sheets forming a \u03b2-sandwich are visible in the electron density. Molecules of the steroid ligand (DHT) are shown as a ball and stick model, whereas the calcium-binding site (site I), and the zinc-bindings sites (sites II and III), are shown by white and black spheres, respectively. Modified from Avvakumov et al (136). 37      Figure 1.8 Androgen action in target cell Estradiol (E) and testosterone (T) circulates in the blood bound to SHBG, and exchanges with free testosterone. When the androgen receprtor (AR) is inactive, it is bound to heat shock proteins (HSPs) in the cytoplasm of target cells. Binding of testosterone or its 5\u03b1-reduced metabolite (DHT) to the AR induces dissociation from heat-shock proteins, and then the ligand-bound AR translocates into the nucleus, dimerizes, and binds to the androgen-response elements in the promoter regions of target genes. General transcriptional factor (RNA polymerase II) is recruited, and co-activators (SRC-steroid receptor co-activator, CBP- cAMP-response-element-binding protein-binding protein) or co-repressors facilitate or prevent this, respectively. Modified from Feldman and Feldman (238). 38  2. Cytoplasmic accumulation of incompletely glycosylated sex hormone-binding globulin enhances androgen action in proximal tubule epithelial cells 2.1 Introduction Sex hormone-binding globulin is the high-affinity plasma transport protein for androgens and estrogens, and it modulates the amounts of \u201cfree\u201d or nonprotein-bound sex steroids that can access their target tissues (67). In addition to hepatocytes, which are the primary source of plasma SHBG, the single gene encoding SHBG is expressed in several other cell types (17, 18, 63), including epithelial cells lining the renal proximal convoluted tubules of mice that express human SHBG transgenes (70). Some of the human SHBG produced by these kidney cells is most likely secreted into the renal tubule because it is also present at low levels in the urine, but substantial amounts of immuno-reactive human SHBG are retained within these cells (70). This is remarkable because the human SHBG transcripts in kidney cells encode the SHBG precursor polypetide that includes the signal polypeptide necessary for secretion, and they are identical in sequence to the SHBG mRNA in hepatocytes that very actively secrete almost all the SHBG they produce, and retain very little intracellular SHBG (70). Since the mouse kidney is a well known site of androgen action, we set out to characterize the SHBG that accumulates within the cytoplasm of kidney epithelial cells, and determine how the presence of SHBG within these cells might modulate androgen action. In the mouse kidney, the androgen-regulated protein (Kap) gene is one of the most well studied targets of androgen action (199, 200), and its up-regulation by androgens in S1-S2 segments of the proximal convoluted tubule requires the presence of a functional androgen 39  receptor (AR) (203, 205, 206). In female mice, the Kap gene is also expressed under the influence of estrogens in the same segments (S1 and S2) of the proximal convoluted tubule (239), while thyroid hormone up-regulates the Kap gene in the S3 cells of the proximal convoluted tubules of both sexes (204). Our previous studies have shown that human SHBG is both expressed and accumulates within the epithelial cells of specific segments (S1\/S2) of the renal proximal convoluted tubules of mice expressing human SHBG transgenes (25). The presence of human SHBG within cells raises the obvious question of whether it promotes the internalization and actions of sex steroids, or dampens their effects by restricting steroid access to their nuclear receptors. We have explored these questions in a series of experiments that lead us to conclude that the presence of human SHBG within specific cell types, such as proximal convoluted tubule epithelial cells, accentuates the uptake of androgens and serves as a reservoir for androgens that can be accessed by the AR, and that this may be especially important under conditions where the supply of androgens is limited.  2.2 Material and methods 2.2.1 Antibodies Antibodies specific for human SHBG included rabbit anti-human SHBG antibodies (110) and a monoclonal anti-human SHBG antibody (7H9) kindly provided by Dr. J. Lewis (Christchurch, New Zealand). A rabbit anti-mouse KAP antiserum was a gift from Dr. J. F. Catterall (Population council center for biomedical research, Rockefeller University, NY). Rabbit anti- androgen receptor (C-19, sc-815), goat anti-\u03b2-actin antibody (C-11, sc-1615), rabbit anti-histone H4 (sc-8660) and goat anti-Gapdh (V-18, sc-20357) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). 40  2.2.2 Expression plasmids and reporter gene constructs We used the pRC\/CMV mammalian expression vector (Life Technologies Corp., Carlsbad, CA) to express cDNAs encoding wild-type human SHBG (143), various glycosylation deficient mutants (138), or mutants lacking steroid binding activity (45). An pARE-luc constructed in the pGL3-basic vector (Promega Biosciences Inc., San Luis Obispo, CA) and a pSG5 eukaryotic expression vector encoding the human AR have been described previously (240). The small interfering RNA (siRNA) experiments were performed using Lipofectamine RNAi MAX Transfection Reagent (Life Technologies) together with a control siRNA (D-001810-10) or a SHBG siRNA (On-TARGET plus SMARTpool L-014191-00-0005) obtained from Dharmacon (Thermo Fisher Scientific Inc., Waltham, MA). 2.2.3 Cell culture All cell culture reagents were from Life Technologies. Wild-type and mutated SHBG cDNAs cloned within the pRC\/CMV mammalian expression vector (see above) were used to stably-transfect Chinese hamster ovary (CHO) cells, as described previously (143). At near confluence, transfected cells were washed with phosphate buffered saline (PBS) and cultured for a further 2 days in serum-free \u03b1MEM (Life Technologies) to obtain recombinant SHBG proteins for analysis. The PKSV-PCT cell line was kindly provided by Dr. A. Vandewalle (INSERM U478, Paris, France) and grown at 37 C in a 5% CO2 atmosphere in DMEM\/F12 medium supplemented with 2% fetal bovine serum, insulin (5 \u00b5g\/ml), dexamethasone (5 x 10-8M), selenium (60nM), transferrin (5 \u00b5g\/ml), triiodothyronine (5 x 10-8M), EGF (10 ng\/ml), 41  D-glucose (20 mM), penicillin (100 U\/mol), and streptomycin (100 \u00b5g\/ml). To generate PCT cells that constitutively express wild-type human SHBG or human SHBG mutants deficient in steroid-binding, we transfected PKSV-PCT cells with various cDNA constructs within pRC\/CMV, as previously reported for CHO cells (45, 138, 143). Cell lines expressing human SHBG (PCT-SHBG) or human SHBG mutants with reduced (PCT-SHBG S42A) or no detectable (PCT-SHBG S42L) steroid-binding activity were obtained by limiting dilution cloning and screening the culture medium for secreted SHBG using an ultra-sensitive time-resolved fluorescence immunoassay (241). In parallel, cloned parental PCT cells that contain a non-functional pRC\/CMV expression plasmid were used as negative controls. 2.2.4 Assay of androgen uptake The abilities of PCT and PCT-SHBG cells to uptake androgens were compared using [3H]5\u03b1-dihydrotestosterone ([3H]DHT) because it is the preferred ligand of SHBG. To accomplish this, cell lines were incubated with 3 nM [3H]DHT (GE Healthcare Life Sciences, Baie d\u2019Urfe, Quebec; specific activity 133.4 Ci\/mmol) in serum free DMEM\/F12 medium at 37 C in a 5% CO2 atmosphere. Cells were washed twice with Hank's balanced salt solution and harvested with 0.25% trypsin. The cell pellet was re-suspended in 0.2 ml ice-cold buffer (0.25 M Tris-HC1, pH 7.5) and mixed with 4 ml scintillation cocktail for radioactivity measurements in a liquid scintillation counter. The nonspecific binding was determined in the presence of 1 \u00b5M unlabeled DHT. All experiments were performed at least in quadruplicate. 2.2.5 Androgen response element -luciferase gene assay Briefly, 4 x 105 PCT cells or PCT-SHBG cells were seeded into six-well tissue culture plates 1 day before transfection in 2 ml phenol red-free DMEM\/F12 medium (Life 42  Technologies) containing 2% dextran charcoal-treated fetal bovine serum (Thermo Fisher Scientific Inc., Waltham, MA). Transient co-transfection of pARE-luc with an AR expression vector, and a pCMV\/lacZ control plasmid expressing \u03b2-galactosidase (\u03b2-gal) was performed using lipofectamine reagent according to the protocol recommended by Life Technologies. For each transfection, the DNA mixture comprised 1 \u00b5g of pARE-luc, 0.2 \u00b5g of pSG5-AR and 0.2 \u00b5g of pCMV\/lacZ was incubated for 30 min at room temperature and then applied to the cells. At 24 h after transfection, the cells were treated with 0.1 nM DHT for 18 h and re-treated for a further 6 h. After treatment, the cells were washed twice with PBS and harvested by scraping. After centrifugation, cell pellets were re-suspended in 100 \u00b5l 0.25 M Tris-Cl, pH 7.8, and cells were lysed by 3 freeze-thaw cycles. Appropriate aliquots of cell extracts were used for measurements of luciferase and \u03b2-gal activity. To correct for transfection efficiency, light units from the luciferase assay were divided by the OD reading from the \u03b2-gal assay. 2.2.6 De-glycosylation of SHBG A confluent culture of PCT-SHBG cells was subjected to a single freeze\/thaw cycle to release SHBG into 50 \u00b5l of 0.25 M Tris-HCl (pH 8.0). The cell extracts and medium harvested from the same cells were then treated with N-glycosidase F (Roche Diagnostics, Laval, Quebec, Canada) at 37 C for 1 h. 2.2.7 Preparation of nuclear and cytoplasmic extracts Cells were washed twice with ice-cold PBS and solubilized in hypotonic lysis buffer (10 mM HEPES, pH 7.9, 1.5 mM MgCl2, 10 mM KCl, 1 mM DTT, and 1 \u00b5g\/ml protease inhibitor cocktail) at 4 C for 15 min, followed by addition of 10% Nonidet P-40 solution to a 43  final concentration of 0.6%, and vortex mixing for 10 sec. Samples were then centrifuged for 30 sec at 10,000 x g, and supernatants were transferred to fresh tubes (cytoplasmic fraction). The pellets were washed twice with hypotonic lysis buffer and re-suspended in nuclear extraction buffer (20 mM HEPES, pH 7.9, 1.5 mM MgCl2, 0.42 M NaCl, 0.2 mM EDTA, 1 mM DTT, 1 \u00b5g\/ml protease inhibitor cocktail, and 25% glycerol), and vortex mixed for 15 min. After centrifugation for 5 min at 20,000 x g, supernatants were transferred to fresh tubes (nuclear fraction). 2.2.8 Western blotting Cells were washed twice with ice-cold PBS and solubilized in lysis buffer (10 mM Tris, pH 7.5, 150 mM NaCl, 1% Triton X-100, 1 mM phenylmethylsulfonyl fluoride, 0.2 mM sodium orthovanadate, 0.5% Nonidet P-40) at 4 C for 30 min. Samples were heat-denatured in loading buffer and subjected to discontinuous SDS-PAGE with 4 and 10% polyacrylamide in the stacking and resolving gels, respectively. Proteins in the gel were electro-transferred to Hybond ECL nitrocellulose membranes (GE Healthcare Life Sciences). The membranes were blocked for 1 h in PBS containing 0.01% tween 20 and 5% skim milk, and incubated overnight at 4 C with a primary antibody in the same buffer. The blots were then washed three times in PBS containing 0.01% tween 20 for 15 min to remove excess antibody, and specific antibody-antigen complexes were identified using horseradish peroxidase-labeled secondary antibody. The ECL (GE Healthcare Life Sciences) was used for detection, and signals were recorded by exposure to X-ray film. 2.2.9 Immuno-histochemistry\/immuno-cytochemistry Paraffin embedded tissue sections from mice expressing human SHBG transgenes, were 44  de-waxed and re-hydrated, followed by incubation with 10% normal donkey serum at room temperature for 2 h. After blocking, slides were incubated with primary antibodies (see 2.2.1) at 4\u00b0C overnight. Following this, slides were washed and incubated simultaneously with corresponding Alexa-Fluor conjugated secondary antibodies from Life Technologies diluted in PBS with 1 % donkey serum at room temperature for 1 h. After washing, slides were mounted in ProLong Gold antifade reagent and examined using a Leica DM4000B fluorescence microscope (Leica Microsystems Inc., Richmond Hill, Ontario, Canada). Monolayer PCT, PCT-SHBG or PCT-SHBG S42L cells were grown in standard culture medium as described above and cultured in 8 well chambers on tissue culture glass slides (BD Bioscience, Mississauga, Ontario, Canada). When the cells reached 70% confluence, the cells were washed in PBS and fixed in 100% methanol at -20 C for 20 min. Slides were air-dried and then re-hydrated in PBS. The fixed cells were blocked with 10% goat serum at room temperature for 30 min and incubated overnight with primary antibodies at 4 C. Following this, slides were washed and incubated with Alexa-Fluor conjugated secondary antibodies (Life Technologies) diluted 1:1000 in PBS with 1% normal goat serum at room temperature for 1 h. After washing, slides were mounted in ProLong Gold antifade reagent and examined using a Leica DM4000B fluorescence microscope (Leica Microsystems Inc.). 2.2.10 RNA analysis Total RNA extracts from cells were used to determine human SHBG and AR mRNA levels, and mRNAs of various murine androgen responsive genes. For semi-quantitative analyses of human SHBG and AR mRNA, reverse transcription (RT) was performed at 42 C for 50 min using 3 \u00b5g of total RNA and 200 units of Superscript II together with an oligo(dT) primers and reagents provided by Life Technologies. An aliquot of the RT product was 45  amplified in a 20-\u00b5l reaction using PCR SuperMix (Life Technologies) with oligonucleotide primer pairs corresponding to target mRNA and Gapdh mRNA sequences (Table 2.1). The PCR was performed for 25 cycles at 94 C for 15 sec, 60\u201365 C for 30 sec, and 72 C for 1 min, and PCR products were resolved by electrophoresis in a 2% agarose gel. For mouse androgen responsive gene products (see Table 2.1 for oligonucleotide primer sequences), quantitative RT-PCR was carried out in 25 \u00b5l containing 12.5 \u00b5l of 2 x SYBR Green PCR master mix (Life Technologies), 1 \u00b5l of each of forward and reverse primers, 2.5 \u00b5l of 1:5 diluted RT product, and 8 \u00b5l distilled water, and was performed using an ABI Prism 7000 Sequence 10 detection system (Life Technologies) equipped with a 96-well optical reaction plate. Negative controls, containing water instead of sample cDNA, were used in each plate. All experiments were run in triplicate and mRNA values were calculated based on the cycle threshold and monitored for an amplification curve. 2.2.11 Gene expression profiling and data analysis RNA was extracted for gene expression profiling from PCT-SHBG and PCT-SHBG S42L cells using a Nucleospin RNA II kit (Macherey-Nagel GmbH & Co, D\u00fcren, Germany). Total RNA (250 ng) was used for in vitro transcription-amplification using the Illumina RNA amplification kit (Ambion) and 1.5 \u00b5g of cRNA was hybridized to whole-genome expression array (Mouse WG-6 v2.0 expression bead chip, Illumina). Statistical analyses were performed by using \u201cR\u201d software (http:\/\/www.r-project.org\/) and \u201cbeadarray\u201d software (www.bioconductor.org). Raw intensity values were normalized independently between arrays for each cell type using quantile normalization. The median value of three sample replicates was used to calculate differentially expressed genes. Fold change 1.7 was set as a cut-off value for the differentially expressed genes. P values were 46  produced by t test and are false discovery rate adjusted (q values). 2.2.12 Statistical analyses Data are reported as mean \u00b1 S.D. of at least three independent experiments for all measurements. Differences between means were obtained by one-way ANOVA and the Tukey\u2019s post hoc test using Graph Pad Software (GraphPad Inc., San Diego, CA).  2.3 Results 2.3.1 Human SHBG co-localizes with KAP within the same proximal convoluted tubule epithelial cells of mice expressing human SHBG transgenes An immuno-histochemical study of the kidney cortex of a male mouse expressing a 4.3 kb human SHBG transgene re-affirmed that human SHBG (Figure 2.1A, green) accumulates within the cytoplasm of epithelial cells populations lining S1 and S2 segments of the proximal convoluted tubules, and demonstrated that murine KAP is also present in the same cells (Figure 2.1A, yellow indicating co-localization with SHBG), as well as in epithelial cells in other regions of the proximal tubules (Figure 2.1A, red). It is therefore of interest to note that, while Kap expression is more widely distributed in epithelial cells throughout the proximal convoluted tubules of the mouse kidney including the S3 segment (205), its expression in S1\/S2 segments of the proximal convoluted tubules is androgen-dependent (242). The levels of murine Kap mRNA are enhanced by testosterone (40 mg\/kg) of gonadectomized male for 3 days with daily treatments (Figure 2.1B). Although the Kap mRNA levels in the kidneys of SHBG transgenic mice are similar to those of wild-type mice, even after castration and subsequent androgen treatment (Figure 2.1B), this type of in vivo 47  experiment is complicated by the fact that Kap is abundantly expressed in the non-androgen responsive S3 cells under the control of thyroid hormone. To circumvent this problem, we have used an immortalized PKSV-PCT mouse proximal convoluted tubule epithelial cell line that retains the characteristics of epithelial cells in the S1-S2 region of the proximal convoluted tubule (243, 244), and expresses the Kap gene in response to androgen (245). It also appears that these cells recapitulate the way that human SHBG transgenes are expressed in the proximal convoluted tubules of the mouse kidney. Protein extracts of tissues, such as the kidney, are invariably contaminated by plasma proteins, and it is therefore virtually impossible to study the biochemical properties of the human SHBG that accumulates within the proximal convoluted tubule epithelial cells of our transgenic mice (Figure 2.1A), without contamination of human SHBG from the blood of these animals. Stable transformants of these cells (PCT-SHBG) that constitutively express human SHBG were cultured on glass microscope slides and fixed for immuno-fluorescence (Figure 2.1C). When the fixed PCT-SHBG cells were probed with a monoclonal anti-human SHBG antibody and an Alexa-Fluor conjugated secondary antibody, we observed SHBG immuno-reactivity in sub-populations of the cells (Figure 2.1C). The vector we used to express the human SHBG cDNA in PCT cells relies on the use of a CMV promoter, the activation of which is cell cycle and serum dependent (246), and this explains why we observe large cell to cell variations in the amounts of intracellular SHBG by immuno-cytochemistry. 2.3.2 Human SHBG within proximal convoluted tubule epithelial cells differs from secreted SHBG in terms of its glycosylation status Stable transformants of PCT cells that constitutively express human SHBG or human 48  SHBG glycosylation mutants (Figure 2.2A), were used to study the biochemical properties of the human SHBG that accumulates within these cells. When examined by Western blotting (Figure 2.2B), we noticed that the apparent molecular size of the SHBG extracted from PCT-SHBG cells was smaller than the human SHBG in the culture medium harvested from these cells, or medium from CHO cells stably-transfected with the same wild-type human SHBG cDNA expression vector. However, it was slightly larger than the SHBG mutant (SHBG +OG\/-NG) produced by CHO cells that is O-glycosylated at Thr7 but lacks both N-glycosylation sequences within the carboxy-terminus of the protein (Figure 2.2B). By comparison, and as observed previously (117), only trace amounts of immuno-reactive SHBG were observed in cell extracts of CHO cells expressing SHBG (Figure 2.2B). The sizes and electrophoretic micro-heterogeneity of the wild type SHBG in PCT and CHO cell culture medium were similar (Figure 2.2B), while the sizes and relative abundance of the electrophoretic isoforms of SHBG in the PCT cell extracts were quite distinct (Figure 2.2B). This suggested that the SHBG in PCT cell extracts is either incompletely or differentially glycosylated as compared with the secreted protein. We know that SHBG secreted by CHO cells is differentially glycosylated (143) and this is largely attributed to the differential utilization of the two N-glycosylation sites (at Asn351 and Asn367) in the carboxy-terminus of the protein (138). This is also apparent in the Western blot of wild-type SHBG in PCT cell medium (Figure 2.2B), were the larger glycoform of about 50 kDa predominates over the smaller glycoform, which is seen as a faint immunoreactive band below. When the N-glycosylation sites of human SHBG are both disrupted, the mutant protein (SHBG +OG\/-NG) expressed in CHO cells appears its electrophoretic micro-heterogeneity and migrates in a manner consistent with the loss of the 49  two N-linked oligosaccharide chains (Figure 2.2B). We therefore re-examined the electrophoretic mobilities of SHBG in the PCT cell medium and cell extracts before and after treatment with N-glycosidase F to remove any N-linked oligosaccharides (Figure 2.2C). This clearly demonstrated that, when the N-linked oligosaccharides were removed from the SHBG in the PCT culture medium, the protein migrated in the same way the SHBG+OG\/-NG mutant in CHO cell medium either before or after it was treated in the same way with N-glycosidase F (Figure 2.2C). By contrast, although treatment of the SHBG in the PCT cell extract with N-glycosidase F clearly reduced its electrophoretic micro-heterogeneity and apparent molecular size, it was also clear that the latter was slightly smaller than that of either the SHBG+OG\/-NG mutant of the N-glycosidase F treated SHBG from PCT cell medium (Figure 2.2C). This suggests that, unlike the SHBG in either CHO or PCT cell medium, the SHBG in PCT cell extracts lacks the O-linked oligosaccharide at Thr7. To test this, we stably-transfected PCT cells with expression vectors that constitutively express either a SHBG mutant lacking the two N-glycosylation sites (SHBG +OG\/\u2013NG) or a mutant in which all three glycosylation site were disrupted (SHBG \u2013OG\/\u2013NG), as shown in (Figure 2.2A), and then compared the electrophoretic properties of the SHBG in cell culture medium and in the cell extracts (Figure 2.2D). The difference in apparent molecular sizes of the two mutant proteins in the culture medium is consistent with the presence of an O-linked oligosaccharide at Thr7, and a molecular size of 40 kDa for the SHBG polypeptide (60). Moreover, while the SHBG +OG\/\u2013NG mutant appears to be O-glycosylated in the culture medium, most of the SHBG +OG\/\u2013NG mutant in the corresponding PCT cell extract appears to be un-glycosylated because it migrates with the same electrophoretic mobility as the SHBG \u2013OG\/\u2013NG mutant which lacks all three glycosylation sites (Figure 2.2D). 50  2.3.3 Intracellular SHBG enhances androgen uptake and accentuates androgen-dependent Kap expression in PCT cells The SHBG that accumulates within the epithelial cells of the proximal convoluted tubules could sequester free steroids from the glomerular filtrate, and either enhance or block their actions at the nuclear hormone receptor level. To measure the cellular uptake of an SHBG steroid ligand, similar numbers (2 x 105) of parental PCT and PCT-SHBG cells were incubated with [3H]DHT for increasing time points up to 6 h after a change of culture medium (Figure 2.3A). The change of medium just prior to the experiment was done to minimize any effect that secreted SHBG in the medium might have on steroid uptake. In this experiment, the accumulation of [3H]DHT by PCT-SHBG cells already exceeded that observed in PCT cells by 30 min (1.5-fold vs. PCT) and increased progressively at 1 h (1.6-fold vs. PCT), 3 h (1.8-fold vs. PCT) and 6 h (1.9-fold vs. PCT). Moreover, while the relative amount (%) of [3H]DHT that accumulated within the PCT cells from the culture medium did not increase over time, the relative amounts of [3H]DHT sequestered by PCT-SHBG cells increased progressively at each time point (Figure 2.3A). To assess whether enhanced DHT uptake by PCT-SHBG cells influences AR-mediated actions, we first transiently introduced a pARE-luc into PCT and PCT-SHBG cells, and then treated them with 0.1 nM DHT or vehicle control for 24 h. We observed robust (5.4-fold and 8.1-fold) increases (P<0.001) in pARE-luc reporter gene activity in the DHT-treated PCT and PCT-SHBG cells, respectively, as compared to the corresponding vehicle-treated control cells (Figure 2.3B), and the response was significantly (P<0.001) greater (1.5-fold,) in the PCT-SHBG cells than in PCT cells (Figure 2.3B). As PCT cells express the endogenous murine Kap gene, and because human SHBG 51  transgenes are expressed in the same cell types within the proximal convoluted tubules (70), we assessed how the presence of human SHBG within PCT cells might influence the basal expression of Kap in these cells. To accomplish this, we first cultured PCT and PCT-SHBG cells in medium depleted of steroids (i.e., containing 2 % dextran charcoal-treated FBS), and then treated them for 5 days in the same medium with or without 10 nM DHT or estradiol (E2), as shown in (Figure 2.4A). The Kap mRNA levels were determined in the cells after this treatment, in relation to mouse glyceraldehyde-3-phosphate dehydrogenase (Gapdh) mRNA levels, and it was apparent that the basal expression of Kap in the absence of steroids was already very much higher (22.1-fold) in the PCT-SHBG vs. PCT cells after vehicle-alone (control) treatments. The Kap gene responded robustly to the DHT treatment in both cell types, as assessed by an increase in the relative abundance of Kap mRNA, but responded only in the PCT-SHBG cells after treatment with E2 (Figure 2.4A). It should also be noted that the magnitude of the response to DHT in terms of the actual increase in Kap mRNA level was much greater in the PCT-SHBG cells than in the PCT cells (Figure 2.4A). To examine whether the induction of Kap gene expression in the PCT-SHBG cells is due to higher AR activity or an AR-independent effect of intracellular SHBG, we conducted a separate set of experiments in which PCT and PCT-SHBG cells were incubated in medium containing 10 nM DHT or E2 with or without 10 \u00b5M Casodex (bicalutamide); an AR antagonist for 5 days with daily treatments. The results revealed that increased Kap mRNA levels in PCT-SHBG cells were no longer observed after treatment with Casodex alone (Figure 2.4B), and that DHT-stimulated increases in Kap mRNA levels in PCT and PCT-SHBG cells was almost completely inhibited by Casodex (Figure 2.4B). In addition, co-treatment with Casodex also blocks the E2-stimulated increases in Kap mRNA level in 52  PCT-SHBG cells, indicating that this stimulation must also be mediated by the AR (Figure 2.4B), and this is consistent with reports that E2 is capable of activating the AR in mouse kidney (247) and prostate cancer cells (248). The enhanced ability of PCT-SHBG to sequester DHT from the culture medium, and the substantial difference in the relative abundance of Kap mRNA between the PCT and PCT-SHBG cells after 5 days of culture in the absence of steroid, together suggested that the SHBG within the PCT cells retains steroids for a prolonged period of time. To test this, we compared the Kap mRNA levels in PCT and PCT-SHBG cells over time (0-28 days) after transferring them from culture medium containing 2% FBS (i.e., in the presence of steroid hormones and their precursors) to culture medium containing 2% dextran charcoal-treated FBS (i.e., in the absence of steroids). When the cells were grown in the presence of steroids (i.e., at the zero time point), this again demonstrated that Kap expression in PCT-SHBG cells is very much greater (~19 fold) than in PCT cells based on quantitative RT-PCR measurements of Kap mRNA levels, in relation to the Gapdh mRNA control (Figure 2.4C). More importantly, the Kap mRNA levels in the PCT cells dropped to base line levels within 2 days of culture in steroid-free medium (Figure 2.4C), while the Kap mRNA levels in PCT-SHBG cells decrease by about 50% within 24 h after steroids were withdrawn, and remained at approximately the same level for about 1 week before slowly decreasing to levels approaching those in PCT cells by 4 weeks of culture in steroid-free medium (Figure 2.4C). To further demonstrate that the steroid-binding properties of the intra-cellular SHBG in PCT-SHBG cells are responsible for the increase in endogenous Kap gene expression we produced two other PCT cell lines that over-expressed human SHBG mutants with either 53  reduced (PCT-SHBG S42A) or negligible (PCT-SHBG S42L) steroid-binding activity (45). While these SHBG mutants are expressed at similar levels as the fully-functional wild-type SHBG in PCT cells (Figure 2.5A and B), the Kap mRNA levels in PCT cells expressing the SHBG S42A mutant were 60% of those in cells expressing the wild-type SHBG (P<0.05) and in cells expressing SHBG S42L they were the same as in the parental PCT cells, and only 6% of those in cells expressing the wild-type SHBG (Figure 2.5C). 2.3.4 Identification of other androgen-regulated genes whose expression is either enhanced or suppressed by the presence of SHBG in PCT cells To identify other androgen-responsive genes that are influenced by the presence of SHBG in PCT cells, we performed gene expression profiling using total RNA from PCT-SHBG and PCT-SHBG S42L cells, which had been cultured in phenol red-free DMEM\/F12 medium supplemented with 2% charcoal-treated FBS for 72 h after exposure to testosterone (100 nM) or DHT (100 nM) for 24 h. This microarray analysis defined 125 transcripts whose levels were increased and 277 transcripts whose levels were reduced by exposure to testosterone by >1.7-fold (Table 2.2). In addition, we also identified 176 transcripts whose levels were increased and 231 transcripts whose levels were decreased after DHT treatment by >1.7-fold (Table 2.2). Among these androgen-regulated genes, 95 were up-regulated and 175 were down-regulated by >1.7-fold by both testosterone and DHT. Four up-regulated and two down-regulated genes were selected for further analysis in PCT, PCT-SHBG and PCT-SHBG S42L cells pre-treated with testosterone and DHT, and then cultured for 3 days in the absence of steroid, as described above. When quantitative RT-PCR measurements of specific transcripts in PCT-SHBG cells were compared to those in PCT or PCT-SHBG S42L cells, four (Adh7, alcohol dehydrogenase 7; Vcam1, vascular cell adhesion 54  molecule-1; Areg, amphiregulin; Tnfaip2, tumor necrosis factor alpha-induced protein 2) genes were highly induced in the PCT-SHBG cells (P<0.001 vs. either PCT or PCT-SHBG S42L cells), irrespective of their treatment with testosterone or DHT (Figure 6A and B). Although the relative levels of Tnfaip2 mRNA were higher (2-fold) in testosterone-treated PCT-SHBG S42L cells than in PCT cells (Figure 2.6A), this was not observed in the DHT-treated cells (Figure 2.6B). Interestingly, the two androgen down-regulated genes we studied further, the claudin2 (Cldn2) and odd-skipped related 2 (Osr2) genes were significantly down-regulated (P<0.05 \u2013 P<0.001) by testosterone or DHT pre-treatment in PCT-SHBG cells, when compared to PCT or PCT-SHBG S42L cells, and these androgens did not significantly decrease Cldn2 or Osr2 mRNA levels in SHBG S42L cells, when compared to the parental PCT cells (Figure 2.6A and B). 2.3.5 Intracellular SHBG modulates the nuclear retention of the AR in PCT cells Since the levels of the AR in PCT cells are not easily measured using Western blotting methods, we first transiently introduced a human AR into PCT and PCT-SHBG cells, and then treated them with 10 nM DHT for 24 h, in order to monitor whether the sequestration of DHT by intracellular SHBG alters the stability and\/or nuclear retention of the AR. To do this the levels of nuclear AR in both cell types were examined in a time-dependent manner following exchange with medium depleted of steroids (i.e., containing 2 % dextran charcoal-treated FBS). Although the levels of AR in the cytoplasm and nucleus of the PCT-SHBG were both higher than in the PCT cells at the start of the experiment, when steroid was still present, the cytoplasmic : nuclear AR ratio was similar in both cell types (Figure 2.7). While there was no obvious change in the relative levels of the AR in the 55  cytoplasm or nucleus of PCT-SHBG cells at 9 h after steroid withdrawal, there was already some indication that the AR levels was decreased in both locations at this time point, and this was most obvious in the PCT cells. At 18 h and 24 h after steroid withdrawal, the AR levels in both cell types were lower in both sub-cellular compartments. However, at these time points, there was a clear reduction in the nuclear: cytoplasmic AR ratio in the PCT cells, which was not seen in the PCT SHBG cells (Figure 2.7). Thus, while the relative amounts of AR in the cytoplasm of PCT-SHBG were similar to those of the PCT cells at 18-24h after steroid withdrawal, the concentrations of the AR in the nuclei of PCT-SHBG were higher (Figure 2.7). To determine whether the sequestration of androgen by intracellular SHBG alters the stability and\/or nuclear retention of the AR, we performed an experiment in which the nuclear: cytoplasmic AR ratio was determined in PCT, PCT-SHBG and PCT-SHBG S42L cells. To accomplish this, the cells were transfected with a human AR expression vector and maintained for 6 h in the presence of 10 nM DHT, and then cultured for 24 h in medium containing 2% dextran charcoal-treated FBS (Figure 2.8). This was done because endogenous levels of the murine AR in PCT cells are too low to be reliably detected by immuno-histochemistry. While these cells all contain similar amounts of human AR mRNA (Figure 2.8A), the relative amounts of the AR were consistently higher in PCT-SHBG cells when compared to either PCT or PCT-SHBG S42L cells, and the nuclear: cytoplasmic AR ratio in PCT-SHBG was significantly (P<0.001) higher than in either parental PCT or PCT-SHBG S42L cells, when cultured for 24h in steroid-free medium (Figure 2.8B). To examine whether the presence of a functional SHBG within the PCT cells is directly responsible for enhancing the nuclear retention of the AR, we depleted SHBG levels in 56  PCT-SHBG cells by treating them with a siRNA specific for SHBG mRNA (Figure 2.9A). In addition to reducing the SHBG mRNA and intracellular SHBG levels, the SHBG siRNA treatment also reduced androgen-stimulated increases in Kap mRNA levels in these cells (Figure 2.9A), consistent with the involvement of SHBG in this response, and the maintenance of higher basal Kap mRNA levels in PCT-SHBG cells as compared to PCT cells (Figure 2.4A). Most importantly, when PCT-SHBG cells were transfected with a human AR expression vector together with the SHBG siRNA or a control siRNA, the nuclear: cytoplasmic AR ratio in the SHBG siRNA treated PCT-SHBG cells was significantly reduced when compared to that in PCT-SHBG cells treated with a control siRNA, and was also not different from that in control siRNA treated parental PCT cells (Figure 2.9B). The relationship between the nuclear localization of the AR and the presence of SHBG within PCT cells was further evaluated after a more prolonged withdrawal of steroids. To accomplish this, we first cultured PCT cells, PCT-SHBG cells and PCT-SHBG S42L cells in medium containing 2% FBS for several days before transfecting them with the AR expression plasmid, and we then incubated them with medium containing 2% dextran charcoal-treated FBS for 2 days. We then compared the percentage of cells in which the AR was predominantly in the nucleus versus the cytoplasm across the three different cell types (Figure 2.10), and this revealed that ~ 40% the PCT-SHBG cells have the AR in the nucleus while only ~ 12% of the PCT and PCT-SHBG S42L cells have AR in their nuclei (Figure 2.10), and this difference was significant (P<0.001).  2.4 Discussion In mice that express human SHBG transgenes, we have observed immuno-reactive human 57  SHBG within several steroid target tissues and specific cell types (23, 70, 146). We have shown previously that human SHBG can be sequestered from the blood into the stromal matrix of the uterine endometrium, and that this is mediated via a steroid ligand dependent interaction between SHBG and the C-terminal domains of two members of fibulin family (fibulin1D and fibulin2) of matrix-associated proteins (146). In contrast to the uterus, which does not express human SHBG transgenes in these mice (146), we have found that some specific epithelial cell types, including those in specific segments of proximal convoluted renal tubules (70) retain human SHBG within their cytoplasm. This is remarkable because the human SHBG mRNA in these cell types comprises the same complement of exonic sequences encoding the SHBG precursor polypeptide, which is normally destined for processing into the mature form of SHBG secreted into the blood plasma. The intracellular accumulation of SHBG within specific epithelial cells is not unprecedented because others have noted that SHBG accumulates within some human epithelial cell types, including a very early observation in human MCF7 breast cancer cells (147), and the more recent report that human prostate epithelial cells and several human prostate cancer cell lines contain SHBG transcripts and immuno-reactive SHBG in their cytoplasm (21). While these latter observations are interesting, they fail to address the obvious questions of whether the presence of SHBG within cells reflects its endocytotic uptake, as reported in early studies of MCF7 cells (22) or more recently via an interaction with the endocytotic receptor, megalin (168), or whether the SHBG within the cells restricts or enhances the actions of its natural steroid ligands. We have sought to address these questions in the studies described here. We confirmed the presence of human SHBG within the epithelial cells of the S1\/S2 58  segments of the proximal convoluted tubules, and further demonstrated that the same cell types express high levels of the Kap gene in mice. Our transgenic mice are ideal for the latter studies because there is no question that the immuno-reactive human SHBG in the transgenic mouse tissues is specific because tissues from the corresponding tissues from wild-type littermates are uniformly negative (70). However, because of the potential contamination of tissues with SHBG from the blood circulation, and because the mouse kap gene is also expressed in the S3 segment of the proximal tubules under the control of thyroid hormone, we have used a murine cell line that retains the characteristics of the same S1\/S2 proximal convoluted tubule epithelial cell types in which the human SHBG accumulates in vivo. As in our transgenic mice, a proportion of the SHBG produced by these cells is secreted but a significant amount is retained within the cytoplasm of the cells. The immediate question was whether these cells first secrete human SHBG and then re-internalize it via some type of endocytotic receptor mediated event. We tested this by growing un-transfected PCT cells in conditioned medium from CHO cells that express high levels of SHBG, then harvested them for analysis of SHBG in cytosolic extracts, and failed to find any evidence of a cell uptake of SHBG (Figure 2.11). This is not surprising because the cells were grown in the presence of 2% FBS, and the levels of SHBG the medium are very much lower than those of other plasma proteins, many of which are ligands for endocytotic receptors, such as megalin (249). We therefore conclude that re-internalization of secreted SHBG does not occur in PCT cells, and our biochemical characterization of the human SHBG extracted from PCT cells support this assumption. In particular, the glycosylation status of the SHBG retained by the PCT cells is quite different from that associated with the SHBG secreted by the cells, and is indicative of incomplete or stalled 59  glycosylation of the protein within the endoplasmic reticulum. In support of this, the intracellular SHBG extracted from the PCT cells is abnormally N-glycosylated, and does not appear to be O-linked glycosylated at Thr7. The latter is important because O-linked glycosylation occurs during the final stages of glycoprotein modification within the Golgi, and is a hallmark of the secreted from of SHBG (76). It is therefore likely that SHBG produced in PCT cells is trapped or held up within the Golgi apparatus, and incomplete glycosylation and a failure to add an O-linked carbohydrate at Thr7 may interfere with the proper intracellular sorting of the protein, as reported for the interleukin-2 receptor (250), and\/or possible interactions with putative cargo receptors (251) or proteins important for vesicular trafficking. This does not appear to be a cell-specific phenomenon because we have observed intracellular accumulations of the same type of incompletely glycosylated human SHBG after over-expression in other cell lines including Hutu 80 cells and LNCaP cells (Figure 2.12). The observation that SHBG accumulates within specialized epithelial cells of the kidney that are targets of androgen action suggests a novel function of SHBG that extends well beyond its role as a plasma steroid transport protein. Although our studies have relied primarily on the use of a murine kidney cell line for studies of human SHBG expression and function, the SHBG gene is also expressed in the human fetal kidney and small intestine (Figure 1.4B). Thus, the production and accumulation of SHBG within proximal convoluted tubule epithelial cells could serve to sequester small amounts of free steroids within the glomerular filtrate rather than from the blood circulation, and control the access of these active androgens to the AR. Intuitively, one might suspect that the SHBG within these cells would limit the actions of androgens, because this is generally considered to be the main 60  function of SHBG within the blood circulation, but our data all suggest that SHBG within these kidney cell types acts to enhance and prolong the actions of androgens, especially under conditions where the supply of androgens is limited. In our experiments, the SHBG within the PCT cells not only promotes a net influx of androgen from the culture medium but it also accentuates the acute activation of an ectopically expressed pARE-luc reporter gene, as well as the sustained and very marked activation of the endogenous androgen-responsive Kap gene. The latter is blocked by the highly-specific AR antagonist, Casodex, and the AR must therefore be the key mediator of this effect. Moreover, these actions are clearly dependent on the ability of the intracellular SHBG to bind steroid because they are abrogated in the presence of an SHBG mutant with reduced steroid-binding, and are completely lost in PCT cells that express an SHBG with no measurable affinity for androgens. Gene expression profiles were assessed in an additional experiment in which PCT cells that contain wild-type SHBG, or a steroid-binding deficient (SHBG S42L) SHBG, were pre-treated with 100 nM testosterone or DHT, and then withdrawn from steroid for 3 days. This time point was chosen because it represents the point at which the androgen-response of the Kap gene is lost after hormone withdrawal in PCT cells that lack SHBG. In this experiment, we observed a remarkable convergence in the degree of up-regulation or down-regulation of most androgen-responsive genes after the PCT cells containing the wild-type SHBG were treated with either testosterone or DHT. Further confirmation of changes in gene expression profiles was made using quantitative RT-PCR in which we found that a functional SHBG within PCT cells is able to markedly increase or decrease in relative abundance of androgen-responsive genes over that seen in 61  PCT cells lacking SHBG or containing a steroid-binding deficient SHBG. These murine androgen-responsive genes include Areg, which is a heparin-binding epidermal growth factor (EGF) family member that binds to the EGF receptor with high affinity (252). Whether this is a direct effect of androgens on Areg expression is debatable because others have suggested that androgen-induction of AREG expression in human LNCaP cells is due to an indirect effect of androgen on EGF-receptor pathways (253). Another gene that was highly induced by androgens in PCT-SHBG cells is Vcam-1, which is expressed in endothelial cells (254), as well as other cell types including renal epithelial cells (255). There is no ARE within the VCAM-1 promoter, and DHT is thought to enhance VCAM-1 expression via nuclear factor-\u03baB activation (256, 257). Like VCAM-1, TNFAIP2 transcripts were also originally identified in human endothelial cells (258) and TNFAIP2 is highly expressed in human fetal kidney tissue (259). Moreover, our studies show that Tnfaip2 is one of the most highly induced androgen-responsive genes in PCT cells that contain functional SHBG. Although it has not previously been reported that Adh7 responds to androgen in the mouse kidney, the mouse Adh1 gene responds to androgens by increased mRNA accumulation and increased catalytic enzyme activity in the kidney (209). In our experiments, Adh7 expression in PCT cells treated with testosterone or DHT was very significantly enhanced by the presence of SHBG in these cells. The presence of functional SHBG in PCT cells also accentuates the repressive effects of androgens on many genes in these mouse kidney epithelial cells, for example Cldn2 and Osr2. Cldn2 is a member of the tight junction protein family that is highly expressed in S2-S3 segments of the proximal tubule (260, 261), and it is involved in trans-epithelial re-absorption of Na+, Cl\u2013 and water in these segments (262). Osr2 transcripts are highly 62  expressed during embryo developmental stage, and encodes a zinc-finger containing transcription factor (263). Interestingly, in these and other cases, the effects of both testosterone and DHT were quite similar, and the presence of SHBG influenced their actions similarly as either positive or negative regulators of gene expression, presumably via their actions as ligands of the AR. We also demonstrate that the enhanced and sustained actions of androgens in PCT cells expressing SHBG can be explained by retention of the AR in the nucleus. These observations are consistent with the concept that intracellular SHBG provides a reservoir of androgen that is available for the AR, and that this acts to promote the nuclear retention and prolonged activation of the AR. This effect could be attributed to a reduced rate of degradation of AR in SHBG expressing cells grown in the absence of androgens, because the presence of androgens is known to stabilize the AR both in vivo and in vitro (185, 186), and degradation of the AR is related to its relative affinity for different ligands (187). In summary, our experiments suggest that the presence of an incompletely glycosylated isoform of human SHBG within an androgen-responsive epithelial cell type not only increases the cellular uptake of steroids but effectively enhances the activity of the AR by promoting its retention in the nucleus. Most importantly, the stimulation or repression of androgen responsive genes is enhanced by the presence of intracellular SHBG after steroid withdrawal over prolonged periods of time, and likely up to several weeks. These findings are particularly interesting in light of reports that human prostate epithelial cells express and contain immuno-reactive SHBG (21), and recent evidence that prostate cancer cells have the capacity to produce small mounts of androgens locally (264). This therefore raises the obvious question of whether the expression of SHBG in prostate cancer cells could 63  contribute to the castration resistant phenotype by accentuating the actions of small amounts of locally produced androgens.   64  Table 2.1 Primers used for RNA analyses     Gene name Gene symbol Forward primer Reverse primer Sex hormone-binding globulin SHBG GTTGCTACTACTGCGTCACAC GCCATCTCCCATCATCCAGCCG Glyceraldehyde-3-phosphate dehydrogenase GAPDH GCTGAGTATGTCGTGGAGTC TTGGTGGTGCAGGATGCATT Androgen-regulated protein KAP TTCTGTGGTCTGACTGTGGC CGTGAAGTCCATGATCTGCT Androgen receptor AR AGAGGTTGCGTCCCAGAG GATGAGTTTGGACAAACCAC Alcohol dehydrogenase 7 ADH7 ATGGGCACCGCTGGAAAAG TAACACGGACTTCCTTAGCCT Vascular cell adhesion molecule-1 VCAM1 CCAAATCCACGCTTGTGTTGA GGAATGAGTAGACCTCCACCT Amphiregulin AREG GGGGACTACGACTACTCAGAG TCTTGGGCTTAATCACCTGTTC Tumor necrosis factor, alpha-induced protein 2 TNFAIP2 AGGAGGAGTCTGCGAAGAAGA GGCAGTGGACCATCTAACTCG Claudin 2 CLDN2 CAACTGGTGGGCTACATCCTA CCCTTGGAAAAGCCAACCG Odd-skipped related 2 OSR2 ACAATTTGCTCATTCACGAGAGG TGATGTCTGTATGGGTGAGAAGG 65  Table 2.2 Androgen regulated genes by microarray analysis   Up-regulated genes by androgen  Accession No. Gene symbol Gene name DHT Testosterone NM_009626.3 ADH7 Alcohol dehydrogenase 7 3.98 4.44 NM_011693.2 VCAM1 Vascular cell adhesion molecule-1 4.43 4.20 NM_009704.3 AREG Amphiregulin  6.15 3.82 NM_008081.3 B4GALNT2 \u03b2-1,4-N-acetyl-galactosaminyl transferase 2  3.08 3.51 NM_009396.1 TNFAIP2 Tumor necrosis factor, alpha-induced protein 2 3.68 3.50 NM_010442.1 HMOX1 Heme oxygenase-1  4.02 3.38 NM_009264.2 SPRR1A Small proline-rich protein 1A 2.09 3.27 NM_009396.1 TNFAIP2 Tumor necrosis factor, alpha-induced protein 2  3.50 3.13 NM_134248.1 HAVCR1 Hepatitis A virus cellular receptor 1 3.34 3.05 NM_009807.2 CASP1 Caspase 1 2.97 2.87 NM_053095.1 IL24 Interleukin 24 3.86 2.85 NM_175093.2 TRIB3 Mouse homolog of tribble 2.61 2.46 NM_007786.1 CSNK Casein kappa 2.68 2.46 NM_008181.3 GSTA1 Glutathione S-transferase, alpha 1 2.42 2.36 NM_007786.2 CSN3 Casein kappa3 2.82 2.34 NM_009017.1 RAET1B Retinoic acid early transcript beta 2.39 2.26 NM_010415.1 HBEGF Heparin-binding EGF-like growth factor 2.39 2.25 NM_013473.3 ANXA8 Annexin A8 2.14 2.23 NM_022019.2 DUSP10 Dual specificity phosphatase 10 2.04 2.23 NM_145953.2 CTH Cystathionase 2.33 2.21 NM_175096.3 STBD1 Starch binding domain 1 2.20 2.17     Down-regulated gene by androgen  Accession No. Gene symbol Gene name DHT Testosterone NM_139200.4 CYTIP Cytohesin 1 interacting protein -3.62 -2.97 NM_029239.2 PRKD3 Protein kinase D3 -3.12 -3.17 NM_008034.2 FOLR1 Folate receptor 1 -3.53 -3.60 NM_029239.2 PRKD3 Protein kinase D3 -3.51 -3.93 NM_009394.2 TNNC2 Troponin C2 -4.25 -4.15 NM_080637.3 NME5 Non-metastatic cells 5 -5.12 -4.77 NM_201601.2 FGFR2 Fibroblast growth factor receptor 2 -5.16 -5.14 NM_054049.1 OSR2 Odd-skipped related 2 -6.11 -5.93 NM_016675.3 CLDN2 Claudin 2 -6.13 -6.85 NM_008908.1 PPIC Peptidylprolyl isomerase C -7.22 -7.18 NM_054049.2 OSR2 Odd-skipped related 2  -9.07 -8.10 NM_028064.2 SLC39A4 Solute carrier family 39 -10.06 -9.29 NM_029341.1 CAPSL Calcyphosine-like -11.26 -10.03 NM_007833.4 DCN Decorin -12.37 -11.08  66     67  Figure 2.1 Presence of immunoreactive human SHBG in kidney of mice expressing human SHBG transgenes and in mouse proximal convoluted tubule (PCT) cells after transfection with a full-length human SHBG cDNA A, kidneys from male transgenic mice expressing human SHBG transgenes were paraformaldehyde-fixed and paraffin-embedded. The presence of human SHBG and KAP was detected within the proximal convoluted tubules within the renal cortex at 100 x magnification by immunofluorescence detection of antibodies that recognize human SHBG (green) and KAP (red) using corresponding Alexa-Fluor conjugated secondary antibodies. Co-localization (yellow) of human SHBG and murine KAP is evident by superimposition of the green and red signals, respectively. DAPI (blue) was used for nuclei staining. Segment 1\/2 of the renal proximal convoluted tubules (S1\/S2) and a glomerulus (g) are indicated. Scale bar = 10\u00b5m. B, after orchiectomy and recovery of mice for 1 week, wild type or transgenic mice expressing human SHBG transgenes were treated with vehicle alone (control) or with testosterone (40mg\/kg\/day) for 3 days, and Kap mRNA levels were determined by quantitative RT-PCR. Gapdh mRNA was used as in internal control. The values represent means \u00b1 SD of three separate experiments. The testosterone treatment significantly increased Kap mRNA in both wild-type and transgenic mice when compared to vehicle-treated mice (+, P<0.05). C, accumulation of human SHBG in mouse proximal tubule epithelial cells (PCT) following transfection with an SHBG cDNA expression vector. Immunofluorescence detection of human SHBG in the PCT cell cytoplasm at 400 x magnification after incubation with Alexa-Fluor conjugated secondary antibodies to detect monoclonal antibodies against human SHBG (red), and nuclei stained with DAPI (Blue). Scale bar = 5\u00b5m 68     69  Figure 2.2 Electrophoretic characteristics and glycosylation status of human SHBG in the medium and extracts of mouse proximal convoluted tubule (PCT) cells transfected with human SHBG cDNA expression vectors A, human SHBG contains two consensus sites for N-linked oligosaccharides at Asn351 and Asn367, and an O-linked carbohydrate chain a Thr7. B, the human SHBG in PCT-SHBG cell medium or cell extracts detected by Western blotting, differ in terms of their electrophoretic mobilities. To evaluate the apparent molecular sizes of SHBG from PCT cells, human SHBG glycosylation variant was produced in which the N-glycosylation sites at Asn351 and Asn367 were disrupted by mutagenesis (SHBG +OG\/-NG) from template of wild-type human SHBG (SHBG), and introduced into CHO cells. C, Western blot shows differences in the electrophoretic mobilities of SHBG from cell culture medium and cytosol protein extract before (-) and after (+) treatment of N-glycosidase F. The electrophoretic micro-heterogeneity of the extracellular and intracellular SHBG is presented after removal of N-linked oligosaccharides. D, to identify the differences in the apparent molecular sizes of SHBG from PCT cells, SHBG +OG\/-NG and SHBG -OG\/-NG were introduced to the PCT cells and the electrophoretic mobility of SHBG from culture medium or cell extract was analyzed by Western blot. The positions of protein size markers are shown on the left.  70   71  Figure 2.3 Influence of intracellular SHBG on cellular androgen uptake and response A, to measure the intracellular uptake of sex steroid hormone, PCT and PCT-SHBG cells were incubated with 3 nM [3H]DHT for increasing times. The intracellular accumulation of [3H]DHT in these cells was measured and compared with the relative amounts (%) of [3H]DHT in cell culture medium. The values represent means \u00b1 SD of four separate experiments. ***, P<0.001 at each time point. B, PCT and PCT-SHBG cells were transfected with ARE reporter gene construct, and then treated with 0.1 nM DHT for 18 h and re-treated for a further 6 h. Cell lysates were collected for luciferase activity and \u03b2-galactosidase activity as a control for transfection efficiency. The values represent means \u00b1 SD of four separate experiments. The DHT treatment significantly increased ARE reporter gene activity in both PCT and PCT-SHBG cells when compared to vehicle-treated cells (+++, P<0.001), and the ARE reporter gene activity was also significantly higher in the PCT-SHBG cells than the PCT cells after DHT treatment (***, P<0.001).     72   73  Figure 2.4 Influence of intracellular SHBG on murine Kap gene expression after sex steroid treatment and withdrawal A, PCT or PCT-SHBG cells were treated with vehicle alone (control) or with DHT or E2, and Kap mRNA levels were determined by quantitative RT-PCR. Cells were grown in phenol red free DMEM\/F12 medium supplemented with 2% charcoal-treated FBS for 5 days before daily treatments with steroids at 10 nM. Gapdh mRNA was used as in internal control. The values represent means \u00b1 SD of four separate experiments. +++, P<0.001 vs. PCT vehicle-alone (control) treated cells. ***, P<0.001; *, P<0.05 vs. PCT-SHBG vehicle-alone (control) treated cells. B, PCT or PCT-SHBG cells were incubated in medium containing 10 nM DHT or E2 with or without 10 \u00b5M Casodex (bicalutamide) for 5 days, and Kap mRNA levels were determined by quantitative RT-PCR. Gapdh mRNA was used as in internal control. The values represent means \u00b1 SD of three separate experiments. Significant difference is ***, P<0.001 when PCT or PCT-SHBG cells are compared to antiandrogen (Casodex) plus hormone vs. hormone alone. C, PCT and PCT-SHBG cells were cultured in DMEM\/F12 medium supplemented with 2% FBS for 24 h before substitution with phenol red free DMEM\/F12 medium supplemented with 2% charcoal-treated FBS for up to 28 days. Kap mRNA levels of PCT or PCT-SHBG cells were determined by quantitative RT-PCR, and Gapdh mRNA was used as an internal control. The values represent means \u00b1 SD.   74     75  Figure 2.5 Influence of wild-type human SHBG and SHBG variants with reduced affinities for steroids on murine Kap gene expression in PCT cells A, human SHBG mRNA is detected by RT-PCR in PCT cells following transfection with expression constructs for wild-type SHBG or SHBG mutants with reduced (SHBG S42A) or no detectable (SHBG S42L) steroid-binding affinity, and Gapdh mRNA was measured as an internal control. B, presence of human SHBG in PCT cell extracts was assessed by Western blotting using a monoclonal anti-human SHBG antibody vs \u03b2-actin as an internal control. C, Kap mRNA levels of PCT cells grown in DMEM\/F12 medium supplemented with 2% FBS were evaluated by quantitative RT-PCR, and Gapdh mRNA was used as an internal control. The values represent means \u00b1 SD of four separate experiments. ***, P<0.001; *, P<0.05 vs. PCT-SHBG cells.   76    77  Figure 2.6 Up-regulation and down-regulation of androgen-responsive genes is accentuated by the presence of functional SHBG in PCT cells after treatment with testosterone (A) or DHT (B) PCT, PCT-SHBG and PCT SHBG S42L cells were treated with testosterone (100 nM) or DHT (100 nM) for 24 h before substitution with phenol red free DMEM\/F12 medium supplemented with 2% charcoal-treated FBS for 72 h. The gene expression profiles were assessed in the androgen treated PCT-SHBG vs PCT-S42L cells using an Illumina MouseWG-6, v2.0 expression bead chip. (Table 2.2), and examples of the most highly up-regulated (Adh7, alcohol dehydrogenase 7; Vcam1, vascular cell adhesion molecule-1; Areg, amphiregulin; Tnfaip2, tumor necrosis factor alpha-induced protein 2) and down-regulated (Cldn2, claudin 2; Osr2, odd-skipped related 2) genes, were selected for analysis of changes in their mRNA levels by quantitative RT-PCR, using Gapdh mRNA as an internal control. The values of gene specific mRNA: Gapdh mRNA ratios are shown as fold changes when compared to the mean values in parental PCT cells which were assigned a value of 1. Significant differences are ***, P<0.001; **, P<0.01; *, P<0.05 when PCT-SHBG cells are compared to parental PCT cells, and PCT-SHBG cells are compared to PCT-SHBG S42L cells. Note that the values in parental PCT and PCT-SHBG S42L cells are not different, apart from the significantly higher Tnfaip2 to Gapdh mRNA ratio in PCT-SHBG S42L cells (#, P<0.05). 78   79  Figure 2.7 Effect of intracellular SHBG on the cellular localization of the AR over time after steroid removal from the medium PCT cells were transiently transfected with a human AR expression construct, and then treated with 10 nM DHT for 24 h. Following exchange with medium depleted of steroids, the amounts of AR in nuclear and cytoplasmic extracts were assessed in a time-dependent manner by Western blotting using polyclonal anti-AR antibody (upper panel). Histone H4 (nuclear protein) and \u03b2-actin (cytoplasmic protein) were used internal controls, respectively. The relative amounts of AR in nuclear and cytoplasmic protein extracts were compared in a histogram (bottom panel) based on the Western blot results.  80     81  Figure 2.8 Intracellular SHBG influences the cellular localization of the AR PCT cells and PCT cells expressing either wild-type SHBG or SHBG S42L were transiently transfected with a human AR expression vector and treated with 10 nM DHT for 6 h, and then cultured in medium containing 2% the dextran charcoal-treated FBS for a further 24 h. In panel A, RT-PCR was used to detect the wild-type or mutant human SHBG mRNAs, the human AR mRNA, and mouse Gapdh mRNA as an internal control. In panel B, the levels of human AR in the corresponding nuclear and cytoplasmic extracts were assessed by Western blotting. For these experiments, 40 \u00b5g samples of nuclear and cytoplasmic protein extracts were analyzed, and histone H4 (nuclear protein) and GAPDH (cytoplasmic protein) were also examined as internal sub-cellular controls. Relative amounts of AR in nuclear vs cytoplasmic extracts was evaluated based on quadruplicate Western blot analysis, as illustrated in above. The values represent means \u00b1 SD of three separate experiments. ***, P<0.001 vs. PCT or PCT SHBG S42L. 82     83  Figure 2.9 Impact of siRNA-mediated knockdown of SHBG on the cellular localization of the AR PCT cells and PCT-SHBG cells were transfected with either 100 nM control siRNA (si-control) or SHBG siRNA (si-SHBG); treated with 10 nM DHT for 6 h, and then cultured in medium containing 2% the dextran charcoal-treated FBS for a further 24 h. In panel A, SHBG and Kap mRNA levels were determined by quantitative RT-PCR, using Gapdh mRNA as an internal control. The values represent means \u00b1 SD of four experiments. ***, P<0.001 when SHBG siRNA treated PCT-SHBG cells are compared to control siRNA treated PCT-SHBG cells. In panel B, PCT or PCT-SHBG cells were transiently transfected with a human AR expression vector together with a si-control or si-SHBG and treated with 10 nM DHT for 6 h, before being cultured in medium containing 2% the dextran charcoal-treated FBS for a further 24 h. The levels of AR in samples (40 \u00b5g) of the corresponding nuclear and cytoplasmic extracts were assessed by Western blotting, as in A above. In addition, a Western blot of SHBG in the same cell extract extracts was performed to assess the extent of SHBG depletion. The relative amounts of AR in nuclear vs cytoplasmic extracts were evaluated by Western blot analysis of four similar experiments. The values represent means \u00b1 SD of four separate experiments. ***, P<0.001 in control siRNA treated PCT-SHBG cells vs. control siRNA treated PCT cells or SHBG siRNA treated PCT-SHBG cells.  84     85  Figure 2.10 Nuclear localization of the AR is enhanced in PCT cells by the presence of functional SHBG in the cytoplasm A, PCT cells were transiently transfected with a human AR expression vector, and incubated with medium depleted of steroids for 48 h. Cellular localizations of human AR and SHBG were identified at 400 x magnification by immuno-fluorescent staining with rabbit anti-human AR (red) antibody and mouse anti-human SHBG (green) antibody, respectively. The cell nuclei were identified by DAPI staining (blue). The nuclear-localization of the AR was evaluated by merging the individual images. B, the number of cells containing nuclei that were AR positive was counted within multiple fields, and compared as a percentage with corresponding numbers of AR positive cells (nuclear and\/or cytoplasmic staining). The values represent means \u00b1 SD of three separate experiments. ***, P<0.001 vs. PCT or PCT SHBG S42L. Scale bar = 10 \u00b5m. 86    Figure 2.11 The cellular localization of the SHBG within PCT cells over time after incubation with SHBG-conditioned media from CHO cells PCT cells incubated with medium containing 2% the dextran charcoal-treated FBS for a further 24, and then treated with SHBG conditional media during 18 h. The SHBG from conditioned culture media (upper panel) and PCT cell extracts (lower panel) were assessed in a time-dependent manner by Western blotting using polyclonal anti-SHBG antibody. \u03b2-actin was used as an internal control s to confirm that similar amounts of PCT cell extracts were analyzed. 87     Figure 2.12 Western blot of human SHBG in various mammalian cells that express human SHBG transgenes Human SHBG in the culture medium and extracts of mouse (PCT) and human (Hutu 80 and LNCaP) cells following over-expression of a human SHBG cDNA using a pLenti6\/UbC\/V5-DEST Gateway\u00ae vector under the control of the ubiquitin C promoter were analyzed with or without treatment of N-glycosidase F to remove N-linked oligosaccharides. The apparent size of the immunoreactive human SHBG in all three cells extracts are identical and ~3 kDa smaller that the SHBG in culture medium after removal of N-linked oligosaccharides. The position of 37 kDa protein size marker is shown on the left.  88   3. Sex hormone-binding globulin interacts with the laminin receptor precursor in the endoplasmic reticulum of renal epithelial cells 3.1 Introduction Plasma sex hormone-binding globulin is produced in the liver and regulates the access of sex-steroid hormones, testosterone and estradiol, to target tissues (7). The human SHBG gene is also expressed in several other tissues (24) and cell types (21, 265, 266), and interactions between SHBG and components within plasma membranes of cells (22, 156, 163, 267) have been reported to mediate the endocytosis of steroid-bound SHBG complexes (151, 165), or trigger intracellular signaling events involving cAMP as the second messenger (22, 268). In this context, the non-specific endocytotic receptor, megalin, has been reported to internalize SHBG in vitro (168), but direct evidence that this occurs in vivo is lacking. Moreover, the identity of the proposed plasma membrane receptor for SHBG remains illusive, and its physiological significance remains to be defined. Our studies in transgenic mice have indicated that human SHBG accumulates within the extra-vascular compartments of some tissues, and is even located within cells that are not in immediate contact with blood vessels (146). We have shown in some tissues that SHBG enters the stromal compartments via a ligand-dependent interaction with members of the fibulin family of extra-cellular matrix proteins, and this led us to propose that SHBG sequestered from the blood could act locally within a given tissue to modify the access of sex steroids to specific cell types (146). This may also represent the initial and critical step in allowing SHBG to gain access to the membranes of cells that are not in direct contact with blood vessels. 89  Apart from the liver, the only tissues that definitively produce and secrete SHBG include the testis and kidney. In the human testis, the SHBG gene is expressed only in germ cells (65, 77). By contrast, the Sertoli cells of sub-primate species produce and secrete an SHBG homologue that is often referred to as the testicular androgen-binding protein into the seminiferous tubules, and it appears to be sequestered by the epithelial cells lining the caput epididymis (66). In the kidneys of mice that express human SHBG transgenes, the epithelial cells of the proximal tubule contain human SHBG mRNA, and appear to accumulate significant amounts of immuno-reactive human SHBG (24). While some of the SHBG produced by these renal epithelial cells appears in the urine (24), it is unclear whether the SHBG that remains within the cells is simply retained by them or is re-internalized after secretion, via for instance megalin; which is known to endocytose the vitamin-binding protein in proximal tubular epithelial cells (170). The SHBG monomer is made up of a tandem arrangement of LG4 and LG5 domains, which is a common feature of the carboxy-terminal region of several larger proteins (123); some of which (e.g. protein S and Gas6) interact with plasma membrane receptors through their carboxy-terminal \u201cSHBG-like\u201d domains (269). Although structurally related to the amino-terminal LG4 domain that contains the SHBG steroid-binding site (122) and a fibulin-binding site (146), the functional significance of the LG5 domain of SHBG is less clear: it does not participate in steroid binding or homodimer formation (128) and is distinguished only by several sites for N-glycosylation (138, 270). To further identify proteins that might bind SHBG on the surface of cells, and promote its cellular internalization or accumulation, a previous Ph.D. student (Ng KM) used the C-terminal LG-like domain (LG5) of human SHBG as the bait in a yeast two-hybrid screen 90  for interacting proteins (Table 3.1). Amongst the cDNAs identified in his yeast two-hybrid screen of expressed polypeptide sequences that could potentially interact with the SHBG LG5 domain, the carboxy-terminal region (Figure 3.1A) of the 37-kDa Laminin Receptor Precursor (LRP) which dimerizes to form the 67-kDa laminin receptor (271). This was of particular interest because the region of LRP identified in this screen included the extra-cellular domain of the LR, which acts as an endocytotic receptor (272), and also contained the laminin-binding site (273). The carboxy-terminal region (amino acid residues 113-295) of LRP was therefore selected for further evaluation as an SHBG-interacting partner because one of its known ligands, laminin, shares structural similarity with SHBG (271). To verify the specificity of the interaction between SHBG and LRP, additional yeast two-hybrid assays were performed by Dr. Ng. As shown in Figure 3.1B, no activation of the HIS3 or LacZ reporter genes was observed in yeast cells co-transformed with the cDNA for the 182 carboxy-terminal residues of LRP in the \u201cprey\u201d vector and an empty \u201cbait\u201d vector or a \u201cbait\u201d vector that expresses the human SHBG LG-4 domain. By contrast, both HIS3 and LacZ genes were activated in yeast co-transformed with the same \u201cprey\u201d vector together with \u201cbait\u201d vectors expressing the LG-5 domains of human or mouse SHBG (Figure 3.1B). My goal was to define how the carboxy-terminal LG5 domain of SHBG isoform interacts with LRP in vitro and in vivo, because this could provide an explanation for the accumulation of immuno-reactive SHBG within the endoplasmic reticulum of epithelial cells lining the proximal convoluted tubules of the kidney.  91  3.2 Materials and methods 3.2.1 Animals Mice expressing human SHBG transgenes and their wild type (C57BL\/6 x DBA2) littermates (70) were maintained under standard conditions with food and water provided ad libitum. Kidneys from three month-old male mice for immuno-histochemistry were obtained under a protocol approved by the University of British Columbia Animal Care Committee. 3.2.2 Antibodies Rabbit anti-human SHBG antibodies were isolated from an antiserum (110) by protein A-Sepharose affinity chromatography, and a monoclonal anti-human SHBG antibody (7H9) was kindly provided by Dr. John Lewis (Christchurch, New Zealand). Antibodies specific for the LRP included a rabbit anti-human Laminin R antibody (H-141, sc-20979) and a goat anti-human Laminin R antibody (F-18, sc-21534) were purchased from Santa Cruz Biotechnology (SantaCruz, CA, USA). 3.2.3 GST pull-down assays A cDNA encoding the 182 carboxy-terminal residues of human LRP was recovered from a pACT-2 clone that showed a positive interaction with the human SHBG LG-5 domain bait sequence in the yeast two-hybrid screen, and was sub-cloned in-frame into the EcoRI\u2013XhoI sites of a pGex-KGK expression vector (146). The GST\/LRP fusion was expressed in E.coli (strain BL21), and purified by affinity chromatography on a glutathione-Sepharose 4B affinity column, as recommended by GE Healthcare Bio-Science (Baie d\u2019Urf\u00e9, Qu\u00e9bec), and the GST pull-down assays were performed as described previously using SHBG in diluted (1:100) serum as the 92  target. In addition, a GST pull-down assay was performed to assess how the palindromic laminin-binding site of the LRP might influence its ability to interact with the SHBG. To accomplish this, the palindromic laminin-binding site had been disrupted or changed by site-directed mutagenesis, and then were wild-type or mutants GST\/LRP fusion protein incubated with the serum of mice expressing human SHBG transgene. In these experiments, the SHBG recovered from the GST pull-down was detected by Western blotting using the rabbit polyclonal anti-SHBG antibody. 3.2.4 Immuno-histochemistry Paraffin embedded tissue sections from mice expressing human SHBG transgenes or their wild type controls, were de-waxed and re-hydrated as described (70), followed by incubation with 10% normal donkey serum at room temperature for 2 h. After blocking, slides were incubated with primary antibodies (see 3.2.2) at 4\u00b0C overnight. Following this, slides were washed and incubated simultaneously with corresponding Alexa-Fluor conjugated secondary antibodies from Invitrogen (Carlsbad, CA) diluted 1:200 to 1:1000 in PBS with 1 % normal goat or donkey serum at room temperature for 1 h. After washing, slides were mounted in ProLong Gold antifade reagent and examined using a Leica DM4000B fluorescence microscope (Leica Microsystems Inc.) and a Biorad inverted confocal laser microscope (Biorad). 3.2.5 Isolation of mouse kidney endoplasmic reticulum protein extracts for co-immunoprecipitation assays Kidneys from mice expressing a 4.3 kb human SHBG transgene were cut in half longitudinally and the renal cortex was separated for isolation of ER protein extracts. In brief, 93  kidney samples were washed twice with ice-cold PBS, and then homogenized in extraction buffer (10 mM HEPES, pH 7.8, 250 mM sucrose and 25 mM potassium chloride). Cell debris was removed by centrifugation for 10 min at 1000 x g to remove nuclei, and the supernatant was centrifuged again for 15 min at 12,000 x g to remove mitochondria. To enrich for ER microsomes, a 7.5 fold volume of 8 mM calcium chloride was added to the supernatant and stirred for 30 min at 4\u00b0C; the mixture was then centrifuged at 8,000 x g for 10 min. The pellet was re-suspended in extraction buffer and homogenized to obtain soluble ER proteins for Western blotting and co-immunoprecipitation experiments. To determine whether SHBG interacts with LRP in the soluble ER protein extracts, we used donkey anti-rabbit IgG antibody conjugated kaolin reagent (Orion Diagnostica OY, Oulu, Finland) as the immuno-affinity matrix. This was prepared by incubating 1ml of the kaolin immuno-affinity matrix with a 10 \u00b5l rabbit anti-human SHBG antiserum (110), or non-specific rabbit IgG (0.5 \u00b5g) at 4 \u00b0C for 4 h. The rabbit antibody bound kaolin immuno-affinity matrix was washed twice with ice-cold TBS; ER protein extracts (100 \u00b5g) were added, and the reactions were further rocked at 4 \u00b0C overnight to allow antibody-protein complexes to form. Protein complexes bound to the immuno-affinity matrix were recovered after centrifugation and washing the pellets three times with ice-cold TBS. The kaolin pellets were then re-suspended in SDS sample buffer, and the immuno-affinity purified protein complexes were recovered and resolved by 12% SDS-PAGE, followed by Western blot analysis for human SHBG using a mouse monoclonal antibody and the rabbit anti- human Laminin R antibody that detects the LRP. 94  3.3 Results 3.3.1 The laminin-binding site of LRP is required for its interaction with SHBG The palindromic laminin-binding site (LMWWML) of the LRP is perfectly conserved in all invertebrate and vertebrate species, but is not conserved in the otherwise well conserved laminin-receptor orthologs of lower eukaryotes, such as yeast and arabidopsis, which do not bind laminin (274). When we substituted the LMWWML sequence with the corresponding sequence found in Saccharomyces (LIWYLL) or Arabidopsis (CLFWLL), within the context of the same GST\/LRP fusion protein used for the pull-down assays, the mutant proteins failed to interact with human SHBG a diluted serum sample, unlike the wild-type LRP sequence (Figure 3.3). Thus, we demonstrate that a functional laminin-binding site within the LRP sequence is required for interaction with SHBG. 3.3.2 SHBG and the LRP co-localize within the rough endoplasmic reticulum of epithelial cells of the renal proximal convoluted tubules Immuno-reactive human SHBG has been reported to accumulate in the epithelial cells of specific segments of the proximal convoluted tubules in the kidneys of mice expressing human SHBG transgenes (70), while the LRP appears to be more widely distributed in the different cell-types and regions of the kidney (275). Our current immuno-histochemical analyses of the antigens on the same histology section of the renal cortex of a male mouse expressing a human SHBG transgene confirm this, and demonstrate that immuno-reactive human SHBG (red) is restricted to the epithelial cells lining a subpopulation of proximal convoluted tubules (brush border positive), while the LRP (green) was observed in both 95  proximal and distal convoluted tubules (Figure 3.4). More importantly, when the two images are superimposed, SHBG and LRP appear to co-localize in the cytoplasmic compartment of these cells (orange yellow) (Figure 3.4). By contrast, no immuno-reactive human SHBG was observed in the kidney of a wild-type mouse, while the same distribution of LRP was observed (Figure 3.4). Since megalin has been reported to be an endocytotic receptor in the mouse kidney (168), we also compared the localization of human SHBG and megalin in sections of kidney from mice expressing a human SHBG transgene (Figure 3.4). As expected, immuno-reactive megalin (green) was mainly confined to the luminal surface of both proximal and distal proximal tubules, but co-localization between SHBG and megalin was not apparent at these locations. 3.3.3 Differences in the apparent molecular sizes of SHBG in renal cortex ER extracts and plasma are due to differences in N-glycosylation Since the immuno-reactive SHBG within the proximal epithelial cells appears to be concentrated in the rough ER, we isolated ER proteins from the renal cortex of mice that express a human SHBG transgene for Western blot analyses, and took care to minimize any plasma contamination in this preparation (see Experiment Procedures for details). As expected, immuno-reactive human SHBG is present in the renal cortex ER extract of transgenic mice, but is undetectable in kidneys of wild-type mice (Figure 3.5A, upper panel). By contrast, LRP is present in the renal cortex ER extracts of both transgenic and wild-type mice (Figure 3.5A, middle panel). We then used Western blotting to compare the human SHBG in renal cortex ER extracts with SHBG purified from the blood of mice 96  expressing the same human SHBG transgene, and found that the apparent molecular size of the SHBG in the ER extract, as defined by its electrophoretic mobility on an SDS-PAGE gel, is about 2~3 kDa smaller than the major SHBG glycoform purified from serum, and does not exhibit the typical 5:1 ratio of heavy (50 kDa) and light (48 kDa) glycoforms (76) that characterize SHBG purified from blood samples (Figure 3.5B). However, when these proteins were treated with N-glycosidase F (Roche Diagnostics, Laval, Quebec, Canada) at 37 \u00baC overnight and then examined by Western blotting alongside the untreated proteins, their apparent molecular sizes are essentially identical (Figure 3.5B). 3.3.4 Co-immunoprecipitation of LRP with SHBG from renal cortex ER extracts To assess whether SHBG and LRP might interact within ER extracts of the renal cortex in vivo, we performed a co-immunoprecipitation experiment using an immobilized SHBG antibody. As expected, almost all the SHBG in the ER protein extract was immunoprecipitated using the immobilized rabbit anti-human SHBG antibodies (Figure 3.6A). Moreover, most of the LRP specifically immunoprecipitates with SHBG, as evidenced by substantial amounts recovered from immobilized rabbit anti-human SHBG antibody complexes when compared with the immobilized rabbit IgG control immuno-affinity matrix (Figure 3.6B, upper panel). This was also apparent because most of the LRP was specifically removed together with SHBG from the reaction supernatant after incubation with the anti-human SHBG immuno-affinity matrix (Figure 3.6B, lower panel). 3.4 Discussion Reports that SHBG binds to the plasma membranes of androgen and estrogen responsive cell types (22, 156, 276) support the concept that it influences the actions of these sex 97  steroids more directly than by simply transporting them and regulating their access to target tissues (277). Although the physiological significance of these findings remains obscure, it has been reported that SHBG acts via a cell surface receptor to influence estrogen-induced proliferation of breast cancer cells (267) and the androgen-responsiveness of prostate cancer cells (278). However, these cell types are generally epithelial in origin, and are separated from the blood supply within tissues by the basal lamina of a stromal compartment. This raises the obvious question of how SHBG comes into contact with these cells, because it must either exit the blood vessels or be produced and act locally in a paracrine or autocrine manner (21). Several human cancers and cell lines (18, 21) and normal tissues other than the liver (19, 279) contain SHBG transcripts, but the majority of these transcripts are alternatively spliced and do not encode the full-length SHBG precursor polypeptide, which includes the leader sequence required for secretion. In our own unpublished studies, we have not been able to detect the expression of the human SHBG gene in these tissues from several transgenic mouse lines (280) or the secretion of SHBG by human cancer cells even when employing a very sensitive time-resolved immuno-fluorometric assay (8). By contrast, epithelial cells within specific segments of the proximal convoluted tubules in the kidneys of these transgenic mice contain an impressive amount of immuno-reactive human SHBG that is clearly produced within the same cell types (24). The SHBG produced in this location does not contribute to the blood levels of SHBG but at least some of it is secreted luminally into the renal tubule and can be detected in urine samples (24). We therefore focused our attention on this particular extra-hepatic site of SHBG synthesis in order to understand how it might accumulate within renal epithelial cells. 98  To identify interacting proteins that might bind SHBG within or on the surface of cells we performed yeast two-hybrid experiments using a human prostate cDNA \u201cprey\u201d library, and chose this library because the human prostate is the tissue in which SHBG membrane receptors has been studied most extensively (162, 276). Our initial screen involved the use of the amino-terminal LG4 domain of human SHBG as the \u201cbait\u201d sequence (146) because it contains the steroid-binding site, and the interactions between SHBG and cell surface \u201creceptors\u201d have most frequently been reported to be steroid-ligand dependent. Although none of the peptide sequences identified in this way represented proteins that might exist within cell membranes, we found that members of the fibulin family of extra-cellular matrix-associated proteins interact in a ligand-dependent manner with SHBG, and appear to participate in the extra-vascular sequestration of plasma SHBG in some tissues, such as the uterus (146). To extend our search for SHBG interacting proteins, we have now used the carboxy-terminal LG5 domain of human SHBG as the \u201cbait\u201d sequence in the same screening strategy, and we identified the carboxy-terminal region of the LRP, amongst a group of cancer-related proteins (Table 3.1), as a potential SHBG interacting protein that satisfied the criteria we were searching for. Confirmation of the specificity of the interaction was obtained in a GST pull-down assay in which we found that the LRP sequence is able to recognize human SHBG. Furthermore, the interaction between the SHBG and the LRP appears to be remarkably specific, and we base this on our observation that the carboxy-terminal region of the LRP is capable of selecting SHBG out of a complex biological mixture of protein. To our knowledge, although the laminin binding of the LRP is well established (274), the precise laminin structural motif that it recognizes has not been identified. It was therefore of interest to find that LRP specifically 99  recognizes the SHBG LG5 domain rather than the LG4 domain, and that this requires the presence of a function laminin binding site in the LRP molecule. Since both of these LG domains within SHBG share the basic laminin-fold, structure structural comparisons and may reveal the structural motif within the LG5 domain that facilitates this interaction. The expression of the human SHBG gene within the proximal renal tubules of transgenic mice is perhaps the clearest example that human SHBG is produced and secreted by an epithelial cell type. The immuno-fluorescence labeling was used in our histological studies, shows that almost all of the human SHBG is present within the cytoplasm of these cells in proximal convoluted tubules, and the LRP also appeared to concentrate in the cytoplasm of the same epithelial cells that contain human SHBG and to be much more widely distributed within the epithelial cells of the renal tubule compared to human SHBG. The presence of immuno-reactive LRP at the cell surface likely reflects the homodimeric complex that constitutes the plasma membrane 67-kDa LR, which has an endocytotic function (281). However, despite the fact that it is the carboxy-terminal, extracellular domain of the LRP that interacts with SHBG, little if any SHBG could not be detected at the plasma membranes of renal epithelial cells, and it is therefore unlikely that the 67-kDa LR functions to re-internalize the SHBG secreted into the lumen of the renal tubules (24). When we compared the localization of human SHBG and the endocytotic receptor megalin in the tubules of the renal cortex of our transgenic mice, it was apparent that the most intense immuno-staining for megalin was not associated with tubules that were positive for SHBG, and there was little if any co-localization of SHBG and megalin on the surface of cells that produce human SHBG. Thus, although the endogenous mouse shbg gene is also expressed in the kidney (25), it is unlikely the physiological role of SHBG within the renal 100  tubule is analogous to that of the vitamin D binding protein, which is expressed in the proximal convoluted tubules and plays an essential role in recycling vitamin D lost during glomerular filtration via its endocytosis by megalin (170). Moreover, there is probably no reason for this as the gonads provide a virtually unlimited supply of sex steroids and the renal recovery of excreted steroids is not critical. The LRP is an evolutionarily conserved protein that appears to have multiple functions within cells and at the cell surface (281), as well as within the extracellular matrix (282). Within eukaryotic cells, the LRP associates strongly with histones in the nucleus and appears to be an integral part of the ribosome where it plays a role in translation initiation, and is otherwise known as the p40 protein that is highly conserved ribosome structures from yeast to mammals (281). At the cell surface, post-translational modifications of the LRP permit the assembly of a dimer as the 67-kDa LR, which binds laminin and also functions as an endocytotic receptor from viruses and the prion protein (281). The laminin-binding functions of the 67-kDa LR were initially considered to simply facilitate cell adhesion, but there is also evidence that the 67-kDa LR plays a role in laminin-induced mitogen-activated protein kinase (MAPK) signal transduction pathways, especially in cancer cells (281). The latter may be of particular interest not only in light of reports that the LRP expression in cancer cells is correlated with tumor progression (271, 283), but because treatment of human MCF-7 breast cancer cells with SHBG blunts estrogen-induced increases in MAPK signaling via the extracellular-signal-related kinases (284). Despite the fact that the LRP lacks a secretion signal polypeptide sequence, it appears to be secreted relatively actively by some cell types, such as vascular smooth muscle cells and mesangial cells, and accumulates in the extracellular matrix between endothelial and smooth muscle cells. This is interesting because LRP in this 101  context may function in some way like the fibulin family members that bind SHBG in the extracellular matrix of stromal cells (146), and represent the first step in facilitating the movement of SHBG out of the vasculature in specific tissues. The presence of the LRP with SHBG in ER extracts by immuno-blotting was not only a striking observation but it was also unexpected. To explore this further, we isolated soluble ER proteins and performed a co-immunoprecipitation experiment using an immobilized anti-human SHBG antiserum. This not only demonstrated that SHBG and LRP interact in this extract but it appears that most of the LRP in the extract is bound to SHBG. This does not rule out the possibility that SHBG and the LRP interact only after the ER extract was prepared, it does suggest that our extracts were not contaminated by ribosomes that contain a significant amount of LRP in complex with other ribosomal proteins. It is also significant that the SHBG that was immunoprecipitated from the ER extract differed in terms of its electrophoretic mobility from the mature SHBG glycoforms present in serum, and this is consistent with the presence of an incompletely glycosylated SHBG that would be expected to be found within the ER. We therefore conclude that the SHBG within the ER of the epithelial cells of the proximal convoluted tubules of our transgenic mouse model accumulates there as a result of an interaction with free LRP, which stalls its processing within the ER and\/or translocation to the Golgi for secretion. The fact that the expression of human SHBG transgenes within renal epithelial cells within specific segments of the proximal convoluted tubule is of interest because these cells are also androgen responsive (245). We also know that the endogenous mouse shbg gene is expressed in the mouse kidney and is likely expressed in the same cell types as the human SHBG transgenes. It is therefore possible that the intracellular accumulation of SHBG in these cells 102  might provide a mechanism to enhance or modulate androgen action by regulating its access to the intracellular androgen receptor. Moreover, if LRP within the ER acts to trap SHBG in this intracellular compartment it may somehow provide a means of concentrating androgens in a location where the androgen receptor is synthesized within these cells, and may thereby contribute to the enhanced actions of androgens described in Chapter 2 of this thesis. By analogy, over-expression of the LRP in cancer cells that also express SHBG at low levels, such as prostate cancer cells (21), could also trap SHBG within the ER in this way, and make these cells supersensitive to androgens even after treatments to reduce testicular androgen production. 103  Table 3.1 List of the ADE2, HIS3 and LacZ positive clones obtained through the yeast two-hybrid screen identified by sequencing    Category  Clone ID  Identity retrieved from databases   K8  Glandular kallikrein (Kallikrein 2)  3-1  Cathepsin D  5-4  Prostate specific antigen (Kallikrein 3)  6-13  67 kDa Laminin-1 receptor  9-10  Glandular kallikrein (Kallikrein 2)  13-2  Kallikrein 4  14-3  Kallikrein 4  Cancer related  16-12  Von Hippel-Lindau syndrome (tumor supressor)   K6  Homo sapiens serine\/threonine kinase 16  Cell Signaling related  5-14  28kD interferon responsive protein   K2  Ribosomal protein, large, P0  K7  Homo sapiens porcupine isoform A  K9  cAMP responsive element binding protein 3  3-3  Metallothionein 2A  4-3  Actin, alpha sarcomeric\/cardiac  6-1  SCO cytochrome oxidase deficient homolog 1  13-1  Metallothionein 2A  14-16  Guanine nucleotide binding protein (G protein), beta polypeptide 2  19-5  Metallothionein 1G  19-6  Cysteine and glycine-rich protein 1  24-11  Cystathionase isoform  28-4  Ribosomal protein, large, P0  28-6  Homo sapiens similar to guanine nucleotide binding protein No implication in known or proposed SHBG functions  30-3  Methylenetetrahydrofolate dehydrogenase   3-7  Homo sapiens mRNA for KIAA1887 protein (brain)  9-5  Clone MGC: 29782 IMAGE: 4642600 (skin)  14-7  Chromosome 21 clone  16-11  Chromosome 1 clone  18-3  Chromosome 17 clone  23-4  KIAA0376 protein  24-12  Homo sapiens MYLE protein  27-2  KIAA1442 protein  27-5  RIKEN cDNA for 2810403L02 gene  27-7  Chromosome 6 clone  28-1  Chromosome 19 clone Unknown genes or functionally uncharacterized proteins  28-8  Chromosome 19 clone 104  105  Figure 3.1 Yeast two-hybrid identification of the LRP as a human SHBG binding protein A, yeast two-hybrid screening of a prostate cDNA library using the human SHBG laminin G5-like (LG-5) domain as bait identified a region spanning the carboxy-terminal domain (183 residues) of LRP (shaded) as a putative SHBG-interacting protein. Within this extra-cellular domain, a 20 amino acid residue region (underlined) has been identified as a binding site for laminin, and this includes a palindromic sequence (lmwwml) that is essential for laminin recognition. B, interaction between the LRP carboxy-terminal region identified in the initial screening, was analyzed in additional yeast two-hybrid assays. Yeast cells co-transformed with pACT-2 fused LRP (residues 113-295) and empty pAS-1 vector, or pAS-1 vectors fused with the human SHBG LG-4 domain (residues 1-205), human SHBG LG-5 domain (residues 205-373) and mouse SHBG LG-5 domain (residues 205-373). Colonies were selected on synthetic drop-out (SD) medium lacking leucine and tryptophan (SD\/-Trp\/-Leu). Protein-protein interactions were monitored by the activation of the HIS3 (growth on SD\/-Trp\/-Leu\/-His, 25 mM 3AT) and LacZ genes (blue staining in the colony-lift \u03b2-galactosidase assay).  106     Figure 3.2 The LRP laminin-binding site is required for the interaction with SHBG in vitro Wild-type GST\/LRP and GST\/LRP mutants in which the palindomic (LMWWML) laminin-binding site was disrupted were used in a GST-pull down assay to assess their ability to recognize and bind SHBG in a complex biological sample (i.e., 1:100 diluted serum). Amino acid substitutions in the wild-type LRP laminin-binding site were made to correspond to the sequences in the non-laminin-binding LRP orthologs in the lower eukaryotes: Saccharomyces (LIWYLL) and Arabidopsis (CLFWLL). Proteins not bound to the GST or the GST\/fusion proteins immobilized on the glutathione-sepharose affinity matrix were removed by extensive washing of the affinity matrix pellets obtained by centrifugation, and the amounts of SHBG in the recovered protein complexes were evaluated by Western blotting using a monoclonal antibody specific to human SHBG. The amounts of GST and GST\/fusion proteins recovered from the pull-down complexes were assessed by staining the SDS-PAGE gels used for the Western blot with coomassie blue. 107     Figure 3.3 Immuno-histochemical localization of human SHBG, LRP, and megalin in the renal cortex of mice expressing a human SHBG transgene Kidneys from male transgenic mice expressing a human SHBG transgene were paraformaldehyde-fixed and paraffin-embedded. The presence of human SHBG, mouse LRP was detected within the proximal convoluted tubules within the renal cortex at 100 x magnification by immuno-fluorescence detection of antibodies that recognizes human SHBG and mouse LRP using corresponding Alexa-Fluor conjugated secondary antibodies. Co-localization of these proteins was evaluated by superimposing individual images (Merged).   108    109  Figure 3.4 Electrophoretic micro-heterogeneity of human SHBG in ER extracts of mouse kidney and plasma reflect differences in glycosylation A, in Western blotting experiments, human SHBG is present in similar amounts (50\u00b5g) of ER protein extracts of the renal cortex from human SHBG transgenic (Tg) mice but not from wild-type (Wt) mice (top panel). By contrast, similar amounts of LRP are present in the renal ER extracts from both Wt and Tg mice (middle panel). As a loading and transfer control for proteins in the ER extracts, the Western blot was probed with a \u03b2-actin specific antibody (bottom panel). B, the electrophoretic micro-heterogeneity of SHBG in the renal ER extracts and plasma of human SHBG transgenic mice is eliminated by removal of N-linked oligosaccharides. The Western blot shows differences in the electrophoretic mobilities of SHBG purified from plasma and in an ER protein extract before (-) and after (+) treatment of N-glycosidase F. The positions of protein size markers are shown on the left. 110     111  Figure 3.5 Co-immunoprecipitation of LRP with SHBG from an ER extract of the kidney from a mouse expressing a human SHBG transgene Donkey anti-rabbit IgG antibody conjugated kaolin was pre-incubated with rabbit antibodies against human SHBG or non-immune rabbit IgG, and the immobilized IgG complexes were then incubated with an ER extract of the renal cortex from a mouse expressing a human SHBG transgene. The immuno-precipitated protein complexes (upper panels) and the resulting supernatants (lower panels) were subjected to 12% SDS PAGE for Western blotting, alongside samples (10 \u00b5g) of the ER protein extracts (10% input), as an input control. A, the human SHBG on the Western blots was detected using a monoclonal antibody. B, the same blots were re-probed with rabbit antibodies specific for LRP, and in this case the goat anti-rabbit IgG used to detect the rabbit anti-LRP recognizes the rabbit IgG and rabbit anti-human SHBG antibodies (heavy chains at ~ 50 kDa) used for the immuno-precipitation. The positions of protein size markers are shown on the left.  112  4. Sex hormone-binding globulin mediates androgen action in androgen dependent prostate cancer cells 4.1 Introduction Androgens play key roles in the proliferation and differentiated functions of the normal prostate gland (285), and are implicated in prostate carcinogenesis (286). Since human prostate cancer is generally considered to be an androgen dependent disease, androgen deprivation therapy is considered the first line of treatment for these tumors (286, 287). Over 95% of testosterone, the principal androgen in the male circulation, is synthesized by the testes, while most androgen precursors, such as dehydroepiandrosterone, androstenediol and androstenedione, are produced by the adrenal cortex (288). In the male reproductive tissues, testosterone is usually converted into DHT by 5\u03b1-reductase (289), and this potent androgen metabolite is the primary trophic hormone of prostate tissues (288). After a series of AR translocalization from cytoplasm to nucleus, the ligand activated AR complex interacts with ARE and regulates to induce or to repress their target gene expression (183, 290), and interactions between the AR and its coregulators (coactivators or corepressors) are intimately involve in this process (36, 179). For instance, PSA is a prototypical AR target gene that has been frequently used to investigate androgen effects on prostate cancer cells (291) because the PSA promoter sequence contains no less than three ARE sites (220, 221). Antiandrogens also bind AR like active androgens, and it competitively inhibits their binding to the AR (238, 292). In human blood and other biological fluids, SHBG is the principal sex steroid carrier protein (5); it exist as homodimer in plasma (129) and transports sex steroids to target tissues 113  (293). In previous studies, human SHBG has been found to interact with fibulin1D and fibulin2 in stromal tissues (146) and with the LRP (see Chapter 3) within the endoplasmic reticulum of epithelial cells of the renal proximal convoluted tubule. In addition, the non-specific endocytotic receptor, megalin, has been reported to bind and internalize steroid bound SHBG (168). In several yeast two hybrid experiments, human SHBG has been found to interact with KLK4 (172) and see above Table 3.1), the expression of which is androgen-dependent kallikrein proteinase that is associated with cancers of the prostate (172, 233), breast (233), uterus (235) and ovary (234). The interaction between SHBG and KLK4 has been demonstrated in GST pull down assays, and it has been found that SHBG is a specific substrate of KLK4 (unpublished data from our collaborators). Moreover, the later group had shown that, while SHBG has two KLK4 cleavage sites (Arg186 and Arg209), its Arg209 residue is major target for KLK4, and that SHBG proteolysis at this site produces a product spanning residues 1-209, which encompasses the entire LG4 domain of SHBG that contains its steroid-binding site (122). The questions remain therefore whether KLK4-cleaved SHBG retains steroid-binding activity and, if so, does its binding affinity is differ from intact SHBG. In addition to these biochemical analyses, I set out to define whether cleavage of SHBG by KLK4 outside of LNCaP prostate cancer cells modulates androgen bioavailability and action. 4.2 Material and methods 4.2.1 Expression plasmids and reporter gene constructs The pLenti6\/UbC\/V5-DEST vector (Life Technologies Corp., Carlsbad, CA) was used to 114  express a cDNA encoding wild-type human SHBG (143). A pARE-luc was constructed in the pGL3-basic vector (Promega Biosciences Inc., San Luis Obispo, CA). The small interfering RNA (siRNA) experiments were performed using Lipofectamine RNAi MAX Transfection Reagent (Life Technologies) together with a control siRNA (D-001810-10) or a SHBG siRNA (On-TARGET plus SMART pool L-014191-00-0005) obtained from Dharmacon (Thermo Fisher Scientific Inc., Waltham, MA). 4.2.2 Cell culture All cell culture reagents were from Life Technologies. The LNCaP cell line was kindly provided by Dr. Olli A. J\u00e4nne (University of Helsinki, Helsinki, Finland) and grown at 37 C in a 5% CO2 atmosphere in RPMI 1640 medium supplemented with 10% fetal bovine serum, penicillin (100 U\/mol) and streptomycin (100 \u00b5g\/ml). To assess how the presence of extracellular SHBG might influence androgen availability, the response of an endogenous androgen-responsive gene (PSA) was monitored in LNCaP cells were grown in phenol red free RPMI 1640 medium supplemented with 2% charcoal-treated FBS (Thermo Fisher Scientific Inc., Waltham, MA), and then treated for 24 h in the same medium containing vehicle, 5 nM DHT or 5 nM DHT plus 5 nM SHBG. To determine whether changes in PSA gene expression in the LNCaP cells were AR dependent, LNCaP cells were incubated in medium containing DHT or DHT plus SHBG in the presence or absence of 10 \u00b5M Casodex (bicalutamide). To generate LNCaP cells that constitutively over-express human SHBG, LNCaP cells were stably transfected with pLenti6\/UbC\/V5-DEST containing a full-length human SHBG cDNA, and then grown in selection medium containing zeocin. Human SHBG transcripts in LNCaP cells over-expressing human SHBG cDNA (LNCaP-SHBG) was evaluated in parallel with 115  wild-type LNCaP cells by RT-PCR (see 4.2.3). The presence of SHBG in LNCaP and LNCaP-SHBG cells was assessed by immuno-fluorescence staining (see 4.2.6) or Western blotting (see 2.2.8), respectively. For androgen reporter gene assays, LNCaP and LNCaP-SHBG cells were transfected with 1 \u00b5g of pARE-luc and 0.2 \u00b5g of pCMV\/lacZ using lipofectamine 2000 reagent, and then treated with 0.1 nM DHT in phenol red-free RPMI 1640 media containing 2% dextran charcoal-treated fetal bovine serum for 18 h and re-treated for a further 6 h. Cell lysates were collected for luciferase activity and \u03b2-galactosidase activity, as described previously (see 2.2.5). To investigate androgen activities in wild-type LNCaP cells after SHBG depletion, wild-type LNCaP cells were seeded into six-well tissue culture plates 1 day in 2 ml phenol red-free RPMI 1640, and then treated with a control siRNA (50 nM) or SHBG siRNA (50 nM) using lipofectamine RNAiMAX reagent. After 48 h, the knockdown of SHBG transcript was confirmed by RT-PCR, and the PSA mRNA was monitored by quantitative RT-PCR (see 4.2.3). For additional androgen reporter gene assays, LNCaP cells were transfected with 1 \u00b5g of pARE-luc and 0.2 \u00b5g of pCMV\/lacZ using lipofectamine 2000 reagent in the presence of control siRNA or SHBG siRNA. After 48 h, cell lysates were collected for luciferase activity and \u03b2-galactosidase activity, as described previously (see 2.2.5). 4.2.3 RNA analysis RNA was isolated with the TRIzol (Life Technologies) according to manufacturer's instructions. For quantitative analyses of human SHBG and PSA mRNA, reverse transcription (RT) was performed at 42 C for 50 min using 3 \u00b5g of total RNA and 200 units of Superscript II together with an oligo(dT) primers and reagents provided by Life Technologies. An aliquot of the RT product was amplified in a 20-\u00b5l reaction using PCR supermix (Life Technologies) with 116  oligonucleotide primer pairs corresponding to target mRNA and 18S rRNA sequences (Table 4.1). The PCR was performed for 25 cycles at 94 C for 15 sec, 60\u201365 C for 30 sec, and 72 C for 1 min, and PCR products were resolved by electrophoresis in a 1~2% agarose gel. For human SHBG and PSA genes (see Table 4.1 for oligonucleotide primer sequences), quantitative RT-PCR was carried out in 25 \u00b5l containing 12.5 \u00b5l of 2 x SYBR Green PCR master mix (Life Technologies), 1 \u00b5l of each of forward and reverse primers, 2.5 \u00b5l of 1:5 diluted RT product, and 8 \u00b5l distilled water, and was performed using an ABI Prism 7000 Sequence 10 detection system (Life Technologies) equipped with a 96-well optical reaction plate. Negative controls, containing water instead of sample cDNA, were used in each plate. All experiments were run in triplicate and mRNA values were calculated based on the cycle threshold and monitored for an amplification curve. 4.2.4 Biochemical analyses of SHBG after proteolytic cleavage by KLK4 Purified human SHBG (100 ng) was incubated with thermolysin-activated KLK4 (3 ng) for 16 hours at 37 \u02daC in proteolysis buffer (0.1M Tris-HCL pH 7.5, 0.1M NaCl, 1.5 mM EDTA and 0.02% tween 20). Samples were then heat-denatured in loading buffer and subjected to discontinuous SDS-PAGE or native PAGE, and Western blotting using a primary antibody, which is rabbit anti-human SHBG antibody (110). A ligand-saturation assay was also used to determine the SHBG ligand-binding properties of intact and KLK4-cleaved human SHBG. This assay relies on the use of [3H] 5\u03b1-dihydrotestosterone as radio-labelled ligand and dextran-coated charcoal (DCC) to separate bound and free steroids (13). The equilibrium dissociation constants were determine by Scatchard analysis of measurements of SHBG bound and free [3H] 5\u03b1-dihydrotestosterone (294). 117  4.2.5 Generation of recombinant SHBG LG4 domain A cDNA encoding the 205 N-terminal residues (LG4) of human SHBG was cloned in pGex2 expression vector (GE Healthcare Life Sciences). The recombinant GST\/LG4 fusion proteins were expressed in E.coli (strain BL21), and purified by affinity chromatography on a glutathione-sepharose 4B affinity column, as recommended by GE Healthcare Bio-Science. The fusion protein was cleaved by thrombin (10 ul\/ml), and purified by fast protein liquid chromatography (FPLC, Amersham Pharmacia Biotech) to separate the GST from LG4 SHBG. For final analysis, samples were loaded onto a 1 x 30 cm superdex 200 column equilibrated with 20 mM Tris-HCl (pH 8.0), 150 mM NaCl, and calibrated using gel filtration marker proteins (GE Healthcare Bio-Sciences). Elution was performed with the same buffer, and fractions were collected and analyzed for steroid-binding activity. 4.2.6 Immuno-cytochemistry Monolayer LNCaP or LNCaP-SHBG S42L cells were grown in standard culture medium as described above and cultured in 8 well chambers on tissue culture glass slides (BD Bioscience, Mississauga, Ontario, Canada). When the cells reached 70% confluence, the cells were washed in PBS and fixed in 100% methanol at -20 C for 20 min. Slides were air-dried and then re-hydrated in PBS. The fixed cells were blocked with 10% goat serum at room temperature for 30 min and incubated overnight with primary antibodies at 4 C. Following this, slides were washed and incubated with Alexa-Fluor conjugated secondary antibodies (Life Technologies) diluted 1:1000 in PBS with 1% normal goat serum at room temperature for 1 h. After washing, slides were mounted in ProLong Gold antifade reagent and examined using a Leica DM4000B fluorescence microscope (Leica Microsystems Inc.). 118  4.2.7 Statistical analyses Data are reported as mean \u00b1 S.D. of at least three independent experiments for all measurements. Differences between means were obtained by one-way ANOVA and the Tukey\u2019s post hoc test using Graph Pad Software (GraphPad Inc., San Diego, CA).  4.3 Results 4.3.1 SHBG modulates androgen-dependent PSA expression in LNCaP cells As human LNCaP prostate cancer cells express the androgen responsive PSA gene, we first assessed how the presence of human SHBG in LNCaP cell culture medium might influence the PSA gene expression in these cells. To accomplish this, we cultured LNCaP cells in medium depleted of steroids (i.e., containing 2 % dextran charcoal-treated FBS), and then treated them for 24 h in the same medium containing 5 nM DHT with or without SHBG (5 nM). The PSA mRNA levels were determined in the cells after this treatment, in relation to 18S rRNA (18S) levels. We observed significant increases in PSA mRNA levels in the DHT-treated LNCaP cells (1.5-fold, P<0.05) and this increase was even greater in the DHT plus SHBG-treated LNCaP cells (2.4-fold, P<0.001), as compared to the corresponding vehicle-treated control cells (Figure 4.1A). Moreover, the response was significantly (P<0.001) greater (1.6-fold,) in the DHT plus SHBG-treated LNCaP cells than in DHT-treated LNCaP cells (Figure 4.1A). It should also be noted that the magnitude of the response to DHT in terms of the actual increase in PSA mRNA level was also much greater in the presence of SHBG. To examine whether the androgen stimulation of PSA gene expression in the LNCaP cell is 119  due to an AR-dependent effect or an AR-independent effect, a separate set of experiments was conducted in which LNCaP cells were incubated in medium containing DHT or DHT plus SHBG with or without 10 \u00b5M Casodex (bicalutamide, AR antagonist) for 24 h. The results revealed that increased PSA mRNA levels in LNCaP cells were no longer observed after treatment with Casodex, and that the relative abundance of PSA mRNA in cells grown in the presence of SHBG was also inhibited by Casodex (Figure 4.1B). 4.3.2 Biochemical properties human SHBG before and after cleavage by KLK4 To determine whether KLK4-digested SHBG retains steroid-binding activity, intact SHBG and digested SHBG samples were tested in a ligand-binding assay following verification of proteolytic cleavage using SDS-PAGE and Western blotting. Most of SHBG were cleaved by active KLK4 for 16 h at 37 \u02daC in proteolysis buffer, and a 24 kDa immunoreactive proteolytic fragment of human SHBG after KLK4 digestion was observed by Western blotting (Figure 4.2A). In addition, saturation binding curves obtained with intact SHBG and KLK4-digested SHBG using [3H]DHT as labeled ligand showed that the steroid-binding capacity of the KLK4-digested SHBG was very similar to intact SHBG (Figure 4.2B). Scatchard plots transformed from saturation binding curve data indicated that the steroid-binding affinities of intact SHBG (Kd = 1.92 nM) and KLK4-digested SHBG (Kd = 1.92 nM) are identical (Figure 4.2C). These data indicate that the steroid-binding affinity of the KLK4-digested SHBG is essentially the same as intact SHBG. To examine whether KLK4-digested SHBG acts in the same way as un-cleaved human SHBG in term of modulating androgen-regulated PSA gene expression in LNCaP cells, a recombinant SHBG LG4 domain that encodes the N-terminal polypeptide (1-205) of human SHBG that binds DHT with similar affinity as native full-length SHBG was used in the LNCaP 120  cell culture assays. The full-length SHBG (5 nM) and recombinant SHBG LG4 domain (5 nM) were added together with DHT (5 nM) to LNCaP cells grown in phenol red free RPMI 1640 medium supplemented with 2% charcoal-treated FBS. The levels of PSA mRNA were significantly increased in all DHT treated cells (P<0.05 in DHT or DHT plus full-length SHBG in LNCaP cells, P<0.01 in DHT plus SHBG LG4 domain in LNCaP), and significant induction (P<0.05) of PSA mRNA was observed in DHT plus full-length SHBG and recombinant SHBG LG4 domain treated cells, as compared to the corresponding DHT-treated LNCaP cells (Figure 4.3A). However, the difference between full length SHBG and the LG4 SHBG domain in terms of DHT-induced PSA expression are not significant (Figure 4.3A). After this experiment, we measured the DHT binding-capacity in the medium containing full-length SHBG and the LG4 SHBG domain to confirm that they were present in approximately equal amounts. As expected, the steroid-binding capacity of the LG4 SHBG domain was similar to that of the full-length SHBG (Figure 4.3B). Furthermore, their steroid-binding affinity was retested and the affinity constant of the recombinant SHBG LG4 domain (Kd = 1.23 nM) was again found to be similar to full-length SHBG (Kd = 0.97 nM) as shown as Figure 4.3 B and C. 4.3.3 Human SHBG in prostate LNCaP cells To establish cell lines that contain inducible human SHBG, LNCaP cells were transfected with a full-length SHBG cDNA using pLenti6\/UbC\/V5-DEST vector, and I confirmed that the transfected cells secreted human SHBG to medium but also retained SHBG within their cytoplasm (Figure 2.12). As expected, human SHBG mRNA is clearly detectable in LNCaP cells following transfection with the SHBG cDNA, and while SHBG transcripts were also 121  detectable in wild-type LNCaP cells they could only be amplified in a PCR with exon2-exon7 and exon2-exon8 primers (Figure 4.4A). Immuno-reactive SHBG inside the LNCaP cells transfected with the SHBG cDNA expression construct could also be detected using a monoclonal anti-human SHBG antibody (Figure 4.4B), and this was confirmed by Western blotting of cell extracts using rabbit polyclonal anti-human SHBG antibody (Figure 4.4B). Although SHBG transcripts containing exon2-exon 8 sequences were detected in wild-type LNCaP cells, we were unable to detect SHBG in wild-type LNCaP cells using the various rabbit polyclonal anti-human SHBG. However, this might reflect low levels of SHBG in the wild-type LNCaP cells when compared with the cells that were engineered to overexpress SHBG, or the loss of epitopes for instance from the amino-terminus of the protein due to a lack of exon 1 sequences. Therefore, to determine whether the SHBG transcripts in the wild-type LNCaP cells might make a protein that could alter an androgen-dependent response, we treated wild-type LNCaP cells with an SHBG siRNA and examined the PSA response to androgen treatment. The SHBG siRNA treatment reduced SHBG transcript levels (Figure 4.5A), and also significantly (P<0.05) reduced the androgen-induced increases in PSA mRNA levels in LNCaP cells (Figure 4.5B). Furthermore, when LNCaP cells were transfected with a pARE-luc together with the SHBG siRNA or a control siRNA, pARE-luc reporter gene activity in the SHBG siRNA treated LNCaP cells was significantly (P<0.05) reduced when compared to that in LNCaP cells treated with a control siRNA (Figure 4.5C).  4.4 Discussion The development and progression of prostate cancer is androgen-dependent (295, 296). 122  Given the role SHBG appears to have in restricting the bioavailability of sex-steroids in the blood (7, 48), we might have expected that the presence of SHBG in the culture medium of human LNCaP cells would limit androgen action mediated via the AR in these cells. In fact, in early studies of LNCaP cells, the presence of human SHBG in the extracellular environment dampens androgen effects by restricting access to their target cells, and inhibits the DHT-induced cell proliferation (297). As reported in several previous studies, LNCaP cell levels of PSA mRNA increased significantly in response to DHT treatment, as compared to vehicle control (291, 298, 299). However, we also unexpectedly observed a significant increase of androgen response PSA mRNA in treatment containing DHT-bound SHBG compared to DHT alone treatment. This amplified androgen response may be due to the ability of SHBG to sequester and limit the bioavailability and metabolic clearance of the DHT that was added to the cells during the incubation time period that was used in our experiments (7, 145). Moreover, it is clear that the androgen actions that are enhanced by the presence of SHBG in the cell culture medium are AR-dependent because the androgen-induced PSA expression is blocked by the highly-specific AR antagonist Casodex. Interestingly, the prostate-expressed KLK4 has been identified as SHBG interacting protein in several yeast two hybrid experiments (172), and KLK4 appears to have the unique proteolytic property that is cleaves SHBG in between its two laminin G\u2013like domains. In this study, the impact of KLK4-mediated proteolysis of SHBG was therefore investigated in terms of its steroid-binding properties, and the effect this might have on androgen response genes in human LNCaP prostate cancer cells. The major KLK4 cleavage site (Arg209) of SHBG is located within the loop that connects the LG4 and LG5 domains, and the amino-terminal LG4 domain of SHBG spanning residues 123  1-209 includes the steroid-binding site (122, 128). When we compared the steroid-binding properties of intact SHBG with those of KLK4-digested SHBG or the recombinant LG4 SHBG domain, it was obvious that their affinities for [3H]DHT are very similar. We also found that the LG4 SHBG domain, which is released after KLK4-digestion of SHBG, acts in the same way as full-length SHBG to enhance androgen dependent PSA gene expression. Our interpretation of these results is that intact SHBG and truncated SHBG (KLK4-digested SHBG or LG4 SHBG domain) acts similarly to reduce the metabolism of DHT and enhance its activity in culture. Nevertheless, it remains to be determined whether KLK4 cleavage of SHBG occurs in human prostate cancer tissues or the truncated SHBG exerts different effects compared with full-length SHBG in vivo. If so, SHBG proteolysis might represent as a new biological marker for sex steroid hormone-dependent KLK4 expression in cancers including prostate and breast (233). Others have reported that SHBG mRNA is present in human prostate epithelial and stromal cells (21, 82), and we also found evidence for low levels of SHBG transcripts in LNCaP cell line. However, the SHBG transcripts of wild-type LNCaP cells appear to be alternatively spliced and do not appear to include the exon 1 sequence that contains the start codon for translation of the SHBG precursor polypeptide. Recently, several alternatively spliced SHBG transcripts containing different alternative exon 1 sequences were identified by others in LNCaP cells (84, 300). All the alternative exon 1 sequences of these SHBG transcripts lack do not contain an open reading frame for an SHBG protein, there is evidence that they may initiate translation from the AUG encoding Met30 that is present in exon 2 (83). However, although we were only able to detect an immunoreactive SHBG in LNCaP cells that over express the full-length SHBG cDNA construct, it is possible that very low levels of 124  an amino-terminally truncated SHBG lacking the first 29 amino-terminal residues of mature SHBG are produced from the alternative SHBG transcripts in prostate cancer (83, 84), and are not recognized well by our antibodies due to a lack of epitopes. In addition, it is possible that interactions between SHBG and intracellular proteins may obscure epitopes during immuno-histochemistry. To explore the possibility that wild-type LNCaP cells might produce low levels of a poorly immunogenic amino-terminally truncated SHBG, we treated them with SHBG siRNA, and then examined two indicators of androgen-dependent effects through measurements of PSA mRNA and pARE-luc reporter gene activity. This treatment clearly reduced the levels of SHBG transcripts in the LNCaP cells, and we assume that this would reduce the levels of any intracellular forms of SHBG. In support of this, and in line with our studies in PCT cells (Chapter 2), we observed reductions in androgen-stimulated expression of the endogenous PSA gene and pARE-luc reporter gene activities in LNCaP cells. 125  Table 4.1 Primers used for RNA analysis   Primer Sequence PSA-forward CAACCCTGGACCTCACACCTA PSA-reverse GGAAATGACCAGGCCAAGAC  18S rRNA-forward CGCCGCTAGAGGTGAAATTCT 18S rRNA-reverse CGAACCTCCGACTTTCGTTCT  SHBG Exon1-forward ATGGAGAGCAGAGGCCCAC SHBG Exon2-forward GCCCAGGACAAGAGCCTATC  SHBG Exon7-reverse CTTGGCCCAGAGGTTAAGGA SHBG Exon8-reverse AGCGTCAGTGCCATTGCC  126   127  Figure 4.1 Influence of extracellular SHBG on PSA gene expression after androgen treatment A, LNCaP cells were treated with vehicle alone (control) or with DHT or DHT plus SHBG, and PSA mRNA levels were determined by quantitative RT-PCR. Cells were grown in phenol red free RPMI 1640 medium supplemented with 2% charcoal-treated FBS for 24 h. 18S rRNA was used as in internal control. The values represent means \u00b1 SD of four separate experiments. ***, P<0.001; *, P<0.05 vs. vehicle-alone (control) treated cells. ###, P<0.001 vs. DHT treated cells. B, DHT or DHT plus SHBG treated LNCaP cells were incubated with or without 10 \u00b5M Casodex (bicalutamide) for 24 h, and PSA mRNA levels were determined by quantitative RT-PCR. 18S rRNA was used as in internal control. The values represent means \u00b1 SD of four separate experiments. Significant difference is ***, P<0.001 when DHT or DHT plus SHBG treated LNCaP cells are compared to antiandrogen (Casodex).   128       129  Figure 4.2 Steroid-binding properties of human SHBG before and after cleavage by KLK4 A, purified SHBG was incubated with thermolysin-activated KLK4 for 16 h at 37 \u02daC in proteolysis buffer, and proteolytic cleavage of SHBG proteolysis was verified by SDS-PAGE or native PAGE and Western blotting using a polyclonal anti-human SHBG antibody. B, saturation binding curves obtained with intact SHBG (closed circles) and KLK4-digested SHBG (open circles), using [3H]DHT as labeled ligand. C, Scatchard plots transformed from the saturation binding data indicate that the steroid-binding affinities of intact SHBG (Kd = 1.92 nM) and KLK4-digested SHBG (Kd = 1.92 nM) are identical.  130     131  Figure 4.3 Influence of intact human SHBG and of recombinant SHBG LG4 domain on androgen induced expression of PSA in LNCaP cells A, human PSA mRNA was measured by quantitative RT-PCR in LNCaP cells grown in phenol red free RPMI 1640 medium supplemented with 2% charcoal-treated FBS, following treatments with DHT (5 nM) in the absence or presence of SHBG (5 nM) or LG4 (5 nM) for 24 h. 18S rRNA was also measured as an internal control. The values represent means \u00b1 SD of 3 separate experiments. Significant differences are **, P<0.01; *, P<0.05 when DHT, SHBG plus DHT and LG4 plus DHT treated cells compared to vehicle-treated cells. #, P<0.05 vs. DHT-treated cells. B and C, the amounts and steroid-binding properties of SHBG (open circles) and LG4 (closed circles) were assessed in the cell culture medium taken after incubations with the cells in panel A. B, saturation binding curves obtained with intact SHBG (closed circles) and SHBG LG4 domain (open circles) in culture medium, using [3H]DHT as labeled ligand. C. Scatchard plots showing the concentration and steroid-binding affinities of SHBG (Kd = 0.97 nM) and LG4 (Kd = 1.23 nM) in the culture medium are similar. 132   133  Figure 4.4 SHBG expression in human LNCaP cells The human SHBG is introduced in LNCaP cell following transfection with a SHBG cDNA expression vector. A, RT-PCR was used to detect in wild-type LNCaP (L) and LNCaP-SHBG (S), using primers that amplify a several regions of human SHBG mRNA. B, immuno-fluorescence staining of human SHBG was also assessed at 400 x magnification of a proximal convoluted tubule stained Alexa-Fluor conjugated secondary antibodies to detect monoclonal antibodies against human SHBG (green) with nuclei stained with DAPI (Blue). Presence of human SHBG in LNCaP cell extracts was assessed by Western blotting using a polyclonal anti-human SHBG antibody. C, LNCaP and LNCaP-SHBG cells were transfected with ARE reporter gene construct, and then treated with 0.1 nM DHT for 18 h and re-treated for a further 6 h. Cell lysates were collected for luciferase activity and \u03b2-galactosidase activity as a control for transfection efficiency. The values represent means \u00b1 SD of three separate experiments. The DHT treatment significantly increased ARE reporter gene activity in both LNCaP and LNCaP-SHBG cells when compared to vehicle-treated cells (+, P<0.01), and the ARE reporter gene activity was also significantly higher in the LNCaP-SHBG cells than the LNCaP cells after DHT treatment (*, P<0.05).   134     135  Figure 4.5 Androgen activities in wild-type LNCaP cells after SHBG depletion A, LNCaP cells were transfected with either 100 nM control siRNA or SHBG siRNA for 48 h, and then RT-PCT analysis of SHBG was performed to assess the extent of SHBG mRNA depletion. B, PSA mRNA level was determined by quantitative RT-PCR, using 18S rRNA as an internal control. The values represent means \u00b1 SD of four experiments. *, P<0.05 when SHBG siRNA treated LNCaP cells are compared to control siRNA treated LNCaP cells. C, LNCaP cells were transiently transfected with a pARE-luc together with a control siRNA or SHBG siRNA, and then incubated in phenol red free RPMI 1640 medium supplemented with 2% charcoal-treated FBS for 48 h. Cell lysates were collected for luciferase activity and \u03b2-galactosidase activity as a control for transfection efficiency. The values represent means \u00b1 SD of three separate experiments. The SHBG siRNA treatment significantly decreased ARE reporter gene activity when compared to control siRNA treated cells (*, P<0.05).  136  5. Conclusion It is well established that SHBG is responsible for the transport of sex steroid hormones in the blood (7), and that it regulates the amount of free sex steroids that can gain access to target tissues (47). However, there is also considerable evidence that plasma SHBG can leave the blood vasculature and enter some target tissues (43), and that this may be mediated in part by interactions between SHBG and proteins, such as specific members of the fibulin family of matrix-associated proteins (146). It has also been reported that SHBG is produced by some sex steroid sensitive cell types, including prostate cancer cells (21), and that it interacts directly with plasma membrane receptors on the surface of cells to evoke a direct biological response (162). In addition, there is evidence that SHBG accumulates in the cytoplasm of specific cell types (24, 94) where it may influence the intracellular actions of androgens or estrogens. To expand our knowledge of the biological functions of SHBG, my research has focused on defining the molecular characteristics and biological significance of intracellular SHBG. The new information I have obtained supports the concept that intracellular SHBG can sequester androgens from the extracellular environment and modulate their access to their receptors in the cytoplasm. Furthermore, our experiments provide evidence that SHBG accumulates in the cytoplasm of renal epithelial cells through an interaction with LRP in the endoplasmic reticulum. Based on this new information, the presence of SHBG transcripts in human prostate cancer cells is of interest because low levels of intracellular SHBG may amplify the biological activities of low concentrations of androgens, and this may be particularly important under conditions of androgen withdrawal. The following summarizes the significance of each of my main observations and the future directions this field of research may take. 137  5.1 Human SHBG accumulation in the cytoplasm of specific epithelial cell types Our recent finding that the immunoreactive SHBG is confined within the epithelial cells of the intestine (94) and kidney (24) is remarkable because the SHBG transcripts of these epithelial cells comprise the identical sequence of SHBG mRNA in hepatocytes, which readily secrete SHBG after it is produced. In my preliminary studies, I confirmed that SHBG accumulates in sub-populations of intestinal epithelial cells, which probably reflects that epithelial cells of intestinal villi are highly differentiated and heterogeneous (98), and I obtained evidence that the cells that express SHBG are enteroendocrine cells. However, I was unable to isolate these cells or obtain a cell line to extend these observations. Instead, I focused my attention on the proximal tubule epithelial cells, and I used a variety of in vitro cell biology methods as well as transgenic mouse model to define how human SHBG accumulates within an epithelial cell type. Because of reports that the endocytotic receptor, megalin, which is also produced by the same proximal convoluted tubule cells in mice (170), acts to internalize SHBG (168), I first tested whether these cells can sequester SHBG from the extracellular environment. I found no evidence for this and in parallel studies we also found that megalin does not co-localize with the renal epithelial cells that accumulate SHBG. Thus, it was important to resolve the question of how SHBG accumulates in these cell types, and to do this we established an in vitro cell culture model to more easily manipulate the expression of SHBG in order to study its biochemical properties and function within these cells, without the problems associated with plasma contamination of cells isolated from tissues. 138  5.2 In vitro model of intracellular SHBG using renal epithelial cells In order to study the intracellular SHBG in kidney epithelial cells, we introduced a human SHBG cDNA expression construct into PCT cells (243), because they retain the characteristics of the epithelial cell types that accumulate immunoreactive human SHBG in the kidneys of our transgenic mice. As expected, these stable transfective cells were found to accumulate SHBG immuno-reactivity in their cytoplasm, unlike SHBG over-expressing CHO or HepG2 cells, which synthesize and rapidly secrete SHBG. I also found that the apparent size of the SHBG inside these cells is smaller than the human SHBG in medium, and using the several PCT cells expressing various SHBG mutant proteins lacking specific glycosylation sites, I confirmed that the SHBG accumulation is related to differences in incomplete glycosylation. I also demonstrated that the lack of an O-linked carbohydrate is a common feature of intracellular SHBG in PCT cell as well as several other cell lines that over-express human SHBG, including human LNCaP prostate cancer cells, and this incomplete glycosylation of SHBG suggest defect in the post-translational modification of SHBG within the endoplasm reticulum. 5.3 The molecular basis of SHBG accumulation in renal tubular cells As mention above, I demonstrated that the immunoreactive SHBG within renal epithelial cells likely results from its sequestration within the cytoplasm, and our attention focused on trying to identify the mechanism for this. Based on the results of a yeast two hybrid screen, we knew that LRP represented a promising candidate as an intracellular SHBG-binding protein, which is expressed in most cells and is over-expressed in many cancer cells (271). We knew that the C-terminal LG5 domain of SHBG interacts biochemically with the 139  extracellular region of LRP that contains its laminin-binding site, and I formally proved this by mutating the palindromic LMWWML motif that serves as the laminin-receptor binding site of LRP, and showing that this blocks its interaction with SHBG. Moreover, SHBG and LRP were observed to co-localize in the renal epithelial cells of our human SHBG transgenic mice. The immuno-histochemical images we obtained also suggested that this co-localization of SHBG and LRP was most intense in the peri-nuclear region where the endoplasmic reticulum is positioned. I therefore explored this further, and demonstrated that LRP and human SHBG physically interact within the endoplasmic reticulum extracted from kidneys of our transgenic mice, and concluded that this is probably the site at which most of the incompletely glycosylated SHBG accumulates within the cytoplasm of the proximal convoluted tubular epithelial cells. This site of SHBG accumulation is interesting because it coincides with the site where the androgen receptor can first interact with biologically active androgens, and this would provide an explanation for how SHBG acts to enhance the activities of androgens in cells, especially under conditions of androgen withdrawal (Figure 5.1), as described in Chapter 2. 5.4 The biological significance of SHBG within renal epithelial cells The renal epithelial cells of the kidney are well known androgen target cells and represent a novel location in which SHBG could more directly control the actions of sex steroids. Using the in vitro system that I developed, I was able to demonstrate that SHBG within renal epithelial cells sequesters androgens from the extracellular environment and enhances and prolongs their actions at the androgen receptor level (Figure 5.1). In addition to providing new information about androgen response genes within the renal tubules based on the microarray data, the present studies provided evidence that SHBG might serve a novel function by acting as an intracellular reservoir of biologically active androgens. The presence 140  of SHBG within other cell types poses the interesting question of whether it may also influence sex steroid hormone action under different physiological and pathophysiological states, such as in the duodenum and in hormone dependent cancers in which LRP is over-expressed. 5.5 Human SHBG modulates androgen bioavailability in both extracellular and intracellular environments It is widely accepted that steroid hormones enter target cells by passive diffusion (47), and I also evaluated the ability of SHBG in the extracellular environment to influence the actions of androgens on the androgen-dependent LNCaP human prostate cancer cell line. My results indicated that SHBG added to the cell culture medium prolongs and increases androgen activity in these cells by controlling the bioavailability and metabolic clearance of AR ligands. Moreover, I demonstrated that the amplification of PSA mRNA levels induced by the presence of extracellular SHBG was mediated by AR acting at the genomic level. I also studied how the prostate cancer-associated KLK4 serine protease, which was identified as an SHBG interacting protein (172), might influence this effects of SHBG on androgen actions in LNCaP cells. I confirmed that KLK4 cleaves and separates the amino-terminal SHBG LG4 and carboxy-terminal SHBG LG5 domains, and demonstrated that the steroid-binding properties of the KLK4 cleaved SHBG has the same steroid-binding affinity properties as intact SHBG. Most importantly, I found that the amino-terminal SHBG LG4 domain has same biological activities as native SHBG in LNCaP cells in culture. However, it remains to be determined if KLK4 specifically cleaves SHBG in human prostate tissues in vivo, and if so whether this can be monitored by assessments of the molecular integrity of SHBG in peripheral blood. If this occurs it raises the possibility that detection and measurement of the 141  amino-terminal SHBG LG4 domain might represent a biomarker of androgen-induced KLK4 production and activity in patients with prostate cancer, and could conceivably serve as an adjunct to serum PSA measurements for the identification and follow-up of men who suffer from prostate cancer. There is now little doubt that LNCaP cells have the alternatively spliced SHBG transcripts, but SHBG is not detected within these cells by immunological methods due to either low levels of alternatively spliced SHBG transcripts or because our SHBG antibodies fail to detect intracellular SHBG isoforms that lack the first 29 amino-terminal residues, which are present in the secreted mature SHBG polypeptide. Nevertheless, my results from the SHBG gene transduction and transcript siRNA knockdown experiments support the concept that an intracellular SHBG isoform might exist in LNCaP cells, which could act as a potential modulator of androgen responsive genes. 5.6 Concluding remarks  These studies have increased our understanding of how SHBG acts to regulate androgen action and its relevance in relation to its intracellular presence in some cell types including androgen-sensitive kidney cells and androgen-responsive human prostate cancer cells. They have also provided new information about the properties of SHBG in the context of its possible actions in the immediate extracellular environment of prostate cancer cells. Thus, my research has provided answers to some of the unresolved issues concerning SHBG function, and these studies might provide a framework for studies to determine how SHBG might function within other specific epithelial cell-types, such as those enteroendocrine cells within the duodenum. This is a particularly interesting site of SHBG production that seems to be conserved in species from fish (301) to mammals (25), and it occurs in a location where 142  sex steroids, and estrogens in particular could act in concert with vitamin D to influence important physiological events such as calcium uptake (97). These types of studies could extend our understanding of how SHBG functions in a cellular context that is unrelated to its actions within the blood system.   143        Figure 5.1 The role of SHBG in extracellular and intracellular compartments of human LNCaP prostate cancer cells Estradiol (E), testosterone (T), 5\u03b1-reduced metabolite (DHT), sex hormone binding-globulin (SHBG), kallikrein related peptidase 4 (KLK4), 37-kDa LRP (LRP), androgen receptor (AR), heat shock proteins (HSPs), RNA polymerase II (RNA Pole II), steroid receptor co-activator (SRC), cAMP-response-element-binding protein-binding protein (CBP).   144  References 1. Khan MS, Knowles BB, Aden DP, Rosner W 1981 Secretion of testosterone-estradiol-binding globulin by a human hepatoma-derived cell line. J Clin Endocrinol Metab 53:448-449 2. Cheng CY, Frick J, Gunsalus GL, Musto NA, Bardin CW 1984 Human testicular androgen-binding protein shares immunodeterminants with serum testosterone-estradiol-binding globulin. Endocrinology 114:1395-1401 3. Cheng CY, Musto NA, Gunsalus GL, Frick J, Bardin CW 1985 There are two forms of androgen binding protein in human testes. Comparison of their protomeric variants with serum testosterone-estradiol binding globulin. J Biol Chem 260:5631-5640 4. Joseph DR, Hall SH, Conti M, French FS 1988 The gene structure of rat androgen-binding protein: identification of potential regulatory deoxyribonucleic acid elements of a follicle-stimulating hormone-regulated protein. Mol Endocrinol 2:3-13 5. Westphal U 1986 Steroid-protein interactions II. Monogr Endocrinol 27:1-603 6. Dunn JF, Nisula BC, Rodbard D 1981 Transport of steroid hormones: binding of 21 endogenous steroids to both testosterone-binding globulin and corticosteroid-binding globulin in human plasma. J Clin Endocrinol Metab 53:58-68 7. Siiteri PK, Murai JT, Hammond GL, Nisker JA, Raymoure WJ, Kuhn RW 1982 The serum transport of steroid hormones. Recent Prog Horm Res 38:457-510 8. Selva DM, Bassas L, Munell F, Mata A, Tekpetey F, Lewis JG, Hammond GL 2005 Human sperm sex hormone-binding globulin isoform: characterization and measurement by time-resolved fluorescence immunoassay. J Clin Endocrinol Metab 90:6275-6282 9. Tindall DJ, Vitale R, Means AR 1975 Androgen binding protein as a biochemical marker of formation of the blood-testis barrier. Endocrinology 97:636-648 10. Abramovich DR, Towler CM, Bohn H 1978 The binding of sex steroids in human maternal and fetal blood at different stages of gestation. J Steroid Biochem 9:791-794 11. Bolton NJ, Tapanainen J, Koivisto M, Vihko R 1989 Circulating sex hormone-binding globulin and testosterone in newborns and infants. Clin Endocrinol (Oxf) 31:201-207 12. Duncan AM, Underhill KE, Xu X, Lavalleur J, Phipps WR, Kurzer MS 1999 Modest hormonal effects of soy isoflavones in postmenopausal women. J Clin Endocrinol 145  Metab 84:3479-3484 13. Hammond GL, Lahteenmaki PL 1983 A versatile method for the determination of serum cortisol binding globulin and sex hormone binding globulin binding capacities. Clin Chim Acta 132:101-110 14. Anderson DC 1974 Sex-hormone-binding globulin. Clin Endocrinol (Oxf) 3:69-96 15. Nisker JA, Hammond GL, Davidson BJ, Frumar AM, Takaki NK, Judd HL, Siiteri PK 1980 Serum sex hormone-binding globulin capacity and the percentage of free estradiol in postmenopausal women with and without endometrial carcinoma. A new biochemical basis for the association between obesity and endometrial carcinoma. Am J Obstet Gynecol 138:637-642 16. Cowan RA, Cowan SK, Giles CA, Grant JK 1976 Prostatic distribution of sex hormone-binding globulin and cortisol-binding globulin in benign hyperplasia. J Endocrinol 71:121-131 17. Larrea F, Diaz L, Carino C, Larriva-Sahd J, Carrillo L, Orozco H, Ulloa-Aguirre A 1993 Evidence that human placenta is a site of sex hormone-binding globulin gene expression. J Steroid Biochem Mol Biol 46:497-505 18. Misao R, Nakanishi Y, Fujimoto J, Tamaya T 1997 Expression of sex hormone-binding globulin exon VII splicing variant messenger RNA in human uterine endometrial cancers. Cancer Res 57:5579-5583 19. Noe G 1999 Sex hormone binding globulin expression and colocalization with estrogen receptor in the human Fallopian tube. J Steroid Biochem Mol Biol 68:111-117 20. Wang YM, Bayliss DA, Millhorn DE, Petrusz P, Joseph DR 1990 The androgen-binding protein gene is expressed in male and female rat brain. Endocrinology 127:3124-3130 21. Hryb DJ, Nakhla AM, Kahn SM, St George J, Levy NC, Romas NA, Rosner W 2002 Sex hormone-binding globulin in the human prostate is locally synthesized and may act as an autocrine\/paracrine effector. J Biol Chem 277:26618-26622 22. Porto CS, Musto NA, Bardin CW, Gunsalus GL 1992 Binding of an extracellular steroid-binding globulin to membranes and soluble receptors from human breast cancer cells (MCF-7 cells). Endocrinology 130:2931-2936 146  23. Selva DM, Hogeveen KN, Seguchi K, Tekpetey F, Hammond GL 2002 A human sex hormone-binding globulin isoform accumulates in the acrosome during spermatogenesis. J Biol Chem 277:45291-45298 24. Janne M, Deol HK, Power SG, Yee SP, Hammond GL 1998 Human sex hormone-binding globulin gene expression in transgenic mice. Mol Endocrinol 12:123-136 25. J\u00e4nne M, Hogeveen KN, Deol HK, Hammond GL 1999 Expression and regulation of human sex hormone-binding globulin transgenes in mice during development. Endocrinology 140:4166-4174 26. Hsueh AJ, Lapolt PS 1992 Molecular basis of gonadotropin receptor regulation. Trends Endocrinol Metab 3:164-170 27. Veldhuis JD, Urban RJ, Dufau ML 1992 Evidence that androgen negative feedback regulates hypothalamic gonadotropin-releasing hormone impulse strength and the burst-like secretion of biologically active luteinizing hormone in men. J Clin Endocrinol Metab 74:1227-1235 28. Gooren L 1989 Androgens and estrogens in their negative feedback action in the hypothalamo-pituitary-testis axis: site of action and evidence of their interaction. J Steroid Biochem 33:757-761 29. Franchimont P 1983 Regulation of gonadal androgen secretion. Horm Res 18:7-17 30. Berry PA, Maitland NJ, Collins AT 2008 Androgen receptor signalling in prostate: effects of stromal factors on normal and cancer stem cells. Mol Cell Endocrinol 288:30-37 31. Ryan KJ 1979 Granulosa-thecal cell interaction in ovarian steroidogenesis. J Steroid Biochem 11:799-800 32. Adashi EY 1994 Endocrinology of the ovary. Hum Reprod 9:815-827 33. Rao GS 1981 MOde of entry of steroid and thyroid hormones into cells. Mol Cell Endocrinol 21:97-108 34. Evans RM 1988 The steroid and thyroid hormone receptor superfamily. Science 240:889-895 35. Hess RA, Bunick D, Lee KH, Bahr J, Taylor JA, Korach KS, Lubahn DB 1997 A role for oestrogens in the male reproductive system. Nature 390:509-512 147  36. Tsai MJ, O'Malley BW 1994 Molecular mechanisms of action of steroid\/thyroid receptor superfamily members. Annu Rev Biochem 63:451-486 37. Felsenfeld G 1992 Chromatin as an essential part of the transcriptional mechanism. Nature 355:219-224 38. McKenna NJ, Xu J, Nawaz Z, Tsai SY, Tsai MJ, O'Malley BW 1999 Nuclear receptor coactivators: multiple enzymes, multiple complexes, multiple functions. J Steroid Biochem Mol Biol 69:3-12 39. Falkenstein E, Tillmann HC, Christ M, Feuring M, Wehling M 2000 Multiple actions of steroid hormones--a focus on rapid, nongenomic effects. Pharmacol Rev 52:513-556 40. Han HJ, Lee YH, Park SH 2000 Estradiol-17beta-BSA stimulates Ca(2+) uptake through nongenomic pathways in primary rabbit kidney proximal tubule cells: involvement of cAMP and PKC. J Cell Physiol 183:37-44 41. Morley P, Whitfield JF, Vanderhyden BC, Tsang BK, Schwartz JL 1992 A new, nongenomic estrogen action: the rapid release of intracellular calcium. Endocrinology 131:1305-1312 42. Aronica SM, Kraus WL, Katzenellenbogen BS 1994 Estrogen action via the cAMP signaling pathway: stimulation of adenylate cyclase and cAMP-regulated gene transcription. Proc Natl Acad Sci U S A 91:8517-8521 43. Hammond GL 2002 Access of reproductive steroids to target tissues. Obstet Gynecol Clin North Am 29:411-423 44. Dunn JF, Merriam GR, Eil C, Kono S, Loriaux DL, Nisula BC 1980 Testosterone-estradiol binding globulin binds to 2-methoxyestradiol with greater affinity than to testosterone. J Clin Endocrinol Metab 51:404-406 45. Grishkovskaya I, Avvakumov GV, Hammond GL, Catalano MG, Muller YA 2002 Steroid ligands bind human sex hormone-binding globulin in specific orientations and produce distinct changes in protein conformation. J Biol Chem 277:32086-32093 46. Danzo BJ, Eller BC 1975 Steroid-binding proteins in rabbit plasma: Separation of testosterone-binding globulin (TeBG) from corticosteroid-binding globulin (CBG), preliminary characterization of TeBG, and changes in TeBG concentration during sexual maturation. Mol Cell Endocrinol 2:351-368 148  47. Mendel CM 1989 The free hormone hypothesis: a physiologically based mathematical model. Endocr Rev 10:232-274 48. Pardridge WM 1981 Transport of protein-bound hormones into tissues in vivo. Endocr Rev 2:103-123 49. Siiteri PK 1981 Extraglandular oestrogen formation and serum binding of oestradiol: relationship to cancer. J Endocrinol 89 Suppl:119P-129P 50. Rosenbaum W, Christy NP, Kelly WG 1966 Electrophoretic evidence for the presence of an estrogen-binding beta-globulin in human plasma. J Clin Endocrinol Metab 26:1399-1403 51. Mercier C, Alfsen A, Baulieu EE 1967 [Proteins binding testosterone in the blood of pregnant women]. C R Acad Sci Hebd Seances Acad Sci D 264:122-124 52. Ritzen EM, Dobbins MC, Tindall DJ, French FS, Nayfeh SN 1973 Characterization of an androgen binding protein (ABP) in rat testis and epididymis. Steroids 21:593-608 53. Cheng SL, Musto NA 1982 Purification and characterization of androgen binding protein from rabbit epididymis. Biochemistry 21:2400-2405 54. Hammond GL, Underhill DA, Smith CL, Goping IS, Harley MJ, Musto NA, Cheng CY, Bardin CW 1987 The cDNA-deduced primary structure of human sex hormone-binding globulin and location of its steroid-binding domain. FEBS Lett 215:100-104 55. Joseph DR, Hall SH, French FS 1987 Rat androgen-binding protein: evidence for identical subunits and amino acid sequence homology with human sex hormone-binding globulin. Proc Natl Acad Sci U S A 84:339-343 56. Kotite NJ, Cheng SL, Musto NA, Gunsalus GL 1986 Comparison of rabbit epididymal androgen binding protein and serum testosterone estradiol binding globulin--II. Immunological properties. J Steroid Biochem 25:171-176 57. Musto N, Gunsalus GL, Bardin CW 1980 Purification and characterization of androgen binding protein from the rat epididymis. Biochemistry 19:2853-2860 58. Que BG, Petra PH 1987 Characterization of a cDNA coding for sex steroid-binding protein of human plasma. FEBS Lett 219:405-409 59. Reventos J, Hammond GL, Crozat A, Brooks DE, Gunsalus GL, Bardin CW, Musto 149  NA 1988 Hormonal regulation of rat androgen-binding protein (ABP) messenger ribonucleic acid and homology of human testosterone-estradiol-binding globulin and ABP complementary deoxyribonucleic acids. Mol Endocrinol 2:125-132 60. Walsh KA, Titani K, Takio K, Kumar S, Hayes R, Petra PH 1986 Amino acid sequence of the sex steroid binding protein of human blood plasma. Biochemistry 25:7584-7590 61. Bardin CW, Musto N, Gunsalus G, Kotite N, Cheng SL, Larrea F, Becker R 1981 Extracellular androgen binding proteins. Annu Rev Physiol 43:189-198 62. Gershagen S, Lundwall A, Fernlund P 1989 Characterization of the human sex hormone binding globulin (SHBG) gene and demonstration of two transcripts in both liver and testis. Nucleic Acids Res 17:9245-9258 63. Hammond GL, Underhill DA, Rykse HM, Smith CL 1989 The human sex hormone-binding globulin gene contains exons for androgen-binding protein and two other testicular messenger RNAs. Mol Endocrinol 3:1869-1876 64. Sullivan PM, Petrusz P, Szpirer C, Joseph DR 1991 Alternative processing of androgen-binding protein RNA transcripts in fetal rat liver. Identification of a transcript formed by trans splicing. J Biol Chem 266:143-154 65. Selva DM, Hammond GL 2006 Human sex hormone-binding globulin is expressed in testicular germ cells and not in sertoli cells. Horm Metab Res 38:230-235 66. Joseph DR 1994 Structure, function, and regulation of androgen-binding protein\/sex hormone-binding globulin. Vitam Horm 49:197-280 67. Hammond GL 1990 Molecular properties of corticosteroid binding globulin and the sex-steroid binding proteins. Endocr Rev 11:65-79 68. Berube D, Seralini GE, Gagne R, Hammond GL 1990 Localization of the human sex hormone-binding globulin gene (SHBG) to the short arm of chromosome 17 (17p12----p13). Cytogenet Cell Genet 54:65-67 69. J\u00e4nne M, Hammond GL 1998 Hepatocyte nuclear factor-4 controls transcription from a TATA-less human sex hormone-binding globulin gene promoter. J Biol Chem 273:34105-34114 70. J\u00e4nne M, Deol HK, Power SG, Yee SP, Hammond GL 1998 Human sex hormone-binding globulin gene expression in transgenic mice. Mol Endocrinol 150  12:123-136 71. Selva DM, Hogeveen KN, Innis SM, Hammond GL 2007 Monosaccharide-induced lipogenesis regulates the human hepatic sex hormone-binding globulin gene. J Clin Invest 117:3979-3987 72. Hogeveen KN, Talikka M, Hammond GL 2001 Human sex hormone-binding globulin promoter activity is influenced by a (TAAAA)n repeat element within an Alu sequence. J Biol Chem 276:36383-36390 73. Xita N, Tsatsoulis A, Chatzikyriakidou A, Georgiou I 2003 Association of the (TAAAA)n repeat polymorphism in the sex hormone-binding globulin (SHBG) gene with polycystic ovary syndrome and relation to SHBG serum levels. J Clin Endocrinol Metab 88:5976-5980 74. Xita N, Tsatsoulis A, Stavrou I, Georgiou I 2005 Association of SHBG gene polymorphism with menarche. Mol Hum Reprod 11:459-462 75. Eriksson AL, Lorentzon M, Mellstrom D, Vandenput L, Swanson C, Andersson N, Hammond GL, Jakobsson J, Rane A, Orwoll ES, Ljunggren O, Johnell O, Labrie F, Windahl SH, Ohlsson C 2006 SHBG gene promoter polymorphisms in men are associated with serum sex hormone-binding globulin, androgen and androgen metabolite levels, and hip bone mineral density. J Clin Endocrinol Metab 91:5029-5037 76. Hammond GL, Bocchinfuso WP 1996 Sex hormone-binding globulin: gene organization and structure\/function analyses. Horm Res 45:197-201 77. Selva DM, Hogeveen KN, Hammond GL 2005 Repression of the human sex hormone-binding globulin gene in Sertoli cells by upstream stimulatory transcription factors. J Biol Chem 280:4462-4468 78. Kozak M 1987 An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Res 15:8125-8148 79. Sullivan PM, Wang YM, Joseph DR 1993 Identification of an alternate promoter in the rat androgen-binding protein\/sex hormone-binding globulin gene that regulates synthesis of a messenger RNA encoding a protein with altered function. Mol Endocrinol 7:702-715 80. Moore KH, Bertram KA, Gomez RR, Styner MJ, Matej LA 1996 Sex hormone 151  binding globulin mRNA in human breast cancer: detection in cell lines and tumor samples. J Steroid Biochem Mol Biol 59:297-304 81. Murayama Y, Hammond GL, Sugihara K 1999 The shbg Gene and Hormone Dependence of Breast Cancer: A Novel Mechanism of Hormone Dependence of MCF-7 Human Breast Cancer Cells Based upon SHBG. Breast Cancer 6:338-343 82. Kahn SM, Hryb DJ, Nakhla AM, Romas NA, Rosner W 2002 Sex hormone-binding globulin is synthesized in target cells. J Endocrinol 175:113-120 83. Nakhla AM, Hryb DJ, Rosner W, Romas NA, Xiang Z, Kahn SM 2009 Human sex hormone-binding globulin gene expression- multiple promoters and complex alternative splicing. BMC Mol Biol 10:37 84. Pinos T, Barbosa-Desongles A, Hurtado A, Santamaria-Martinez A, de Torres I, Morote J, Reventos J, Munell F 2009 Identification, characterization and expression of novel Sex Hormone Binding Globulin alternative first exons in the human prostate. BMC Mol Biol 10:59 85. Cheng CY, Gunsalus GL, Musto NA, Bardin CW 1984 The heterogeneity of rat androgen-binding protein in serum differs from that in testis and epididymis. Endocrinology 114:1386-1394 86. Danzo BJ, Eller BC, Bell BW 1987 The apparent molecular weight of androgen-binding protein (ABP) in the blood of immature rats differs from that of ABP in the epididymis. J Steroid Biochem 28:411-419 87. Danzo BJ, Taylor CA, Jr., Eller BC 1982 Some physicochemical characteristics of photoaffinity-labeled rabbit testosterone-binding globulin. Endocrinology 111:1278-1285 88. Pugeat M, Nader N, Hogeveen K, Raverot G, Dechaud H, Grenot C 2010 Sex hormone-binding globulin gene expression in the liver: drugs and the metabolic syndrome. Mol Cell Endocrinol 316:53-59 89. Selva DM, Hammond GL 2009 Peroxisome-proliferator receptor gamma represses hepatic sex hormone-binding globulin expression. Endocrinology 150:2183-2189 90. Wang YM, Sullivan PM, Petrusz P, Yarbrough W, Joseph DR 1989 The androgen-binding protein gene is expressed in CD1 mouse testis. Mol Cell Endocrinol 63:85-92 152  91. Hagenas L, Ritzen EM, Plooen L, Hansson V, French FS, Nayfeh SN 1975 Sertoli cell origin of testicular androgen-binding protein (ABP). Mol Cell Endocrinol 2:339-350 92. Voglmayr JK, Musto NA, Saksena SK, Brown-Woodman DC, Marley PB, White IG 1977 Characteristics of semen collected from the cauda epididymis of conscious rams. J Reprod Fertil 49:245-251 93. Weddington SC, Brandtzaeg P, Hansson V, French FS, Petrusz P, Ritzen EM 1975 Immunological cross reactivity between testicular androgen-binding protein and serum testosterone-binding globulin. Nature 258:257-259 94. Selva DM, Hong E-J, Hammond GL 2007 Expression and Accumulation of Sex Hormone-binding Globulin in Specific Regions and Cell Types of the Intestine. 89th Annual Meeting of the Endocrine Society 95. Akhter S, Kutuzova GD, Christakos S, DeLuca HF 2007 Calbindin D9k is not required for 1,25-dihydroxyvitamin D3-mediated Ca2+ absorption in small intestine. Arch Biochem Biophys 460:227-232 96. Lee GS, Lee KY, Choi KC, Ryu YH, Paik SG, Oh GT, Jeung EB 2007 A Phenotype of a Calbindin-D9k Gene-Knockout is Compensated for by the Induction of Other Calcium-Transporter Genes in a Mouse Model. J Bone Miner Res 97. Van Cromphaut SJ, Rummens K, Stockmans I, Van Herck E, Dijcks FA, Ederveen AG, Carmeliet P, Verhaeghe J, Bouillon R, Carmeliet G 2003 Intestinal calcium transporter genes are upregulated by estrogens and the reproductive cycle through vitamin D receptor-independent mechanisms. J Bone Miner Res 18:1725-1736 98. Crosnier C, Stamataki D, Lewis J 2006 Organizing cell renewal in the intestine: stem cells, signals and combinatorial control. Nat Rev Genet 7:349-359 99. Loukovaara M, Carson M, Adlercreutz H 1995 Regulation of production and secretion of sex hormone-binding globulin in HepG2 cell cultures by hormones and growth factors. J Clin Endocrinol Metab 80:160-164 100. Peiris AN, Sothmann MS, Aiman EJ, Kissebah AH 1989 The relationship of insulin to sex hormone-binding globulin: role of adiposity. Fertil Steril 52:69-72 101. Loukovaara M, Carson M, Adlercreutz H 1995 Regulation of sex-hormone-binding globulin production by endogenous estrogens in vitro. Biochem Biophys Res 153  Commun 206:895-901 102. Rosner W, Aden DP, Khan MS 1984 Hormonal influences on the secretion of steroid-binding proteins by a human hepatoma-derived cell line. J Clin Endocrinol Metab 59:806-808 103. Leger J, Forest MG, Czernichow P 1990 Thyroid hormones influences sex steroid binding protein levels in infancy: study in congenital hypothyroidism. J Clin Endocrinol Metab 71:1147-1150 104. Selva DM, Hammond GL 2009 Thyroid hormones act indirectly to increase sex hormone-binding globulin production by liver via hepatocyte nuclear factor-4alpha. J Mol Endocrinol 43:19-27 105. Dunger DB, Ahmed ML, Ong KK 2006 Early and late weight gain and the timing of puberty. Mol Cell Endocrinol 254-255:140-145 106. Elmlinger MW, Kuhnel W, Ranke MB 2002 Reference ranges for serum concentrations of lutropin (LH), follitropin (FSH), estradiol (E2), prolactin, progesterone, sex hormone-binding globulin (SHBG), dehydroepiandrosterone sulfate (DHEAS), cortisol and ferritin in neonates, children and young adults. Clin Chem Lab Med 40:1151-1160 107. Apter D, Bolton NJ, Hammond GL, Vihko R 1984 Serum sex hormone-binding globulin during puberty in girls and in different types of adolescent menstrual cycles. Acta Endocrinol (Copenh) 107:413-419 108. de Ridder CM, Bruning PF, Zonderland ML, Thijssen JH, Bonfrer JM, Blankenstein MA, Huisveld IA, Erich WB 1990 Body fat mass, body fat distribution, and plasma hormones in early puberty in females. J Clin Endocrinol Metab 70:888-893 109. De Sanctis V, Vullo C, Katz M, Wonke B, Nannetti C, Bagni B 1988 Induction of spermatogenesis in thalassaemia. Fertil Steril 50:969-975 110. Hammond GL, Langley MS, Robinson PA 1985 A liquid-phase immunoradiometric assay (IRMA) for human sex hormone binding globulin (SHBG). J Steroid Biochem 23:451-460 111. Toscano V, Balducci R, Bianchi P, Guglielmi R, Mangiantini A, Sciarra F 1992 Steroidal and non-steroidal factors in plasma sex hormone binding globulin regulation. J Steroid Biochem Mol Biol 43:431-437 154  112. Thijssen JH 1988 Hormonal and nonhormonal factors affecting sex hormone-binding globulin levels in blood. Ann N Y Acad Sci 538:280-286 113. Vermeulen A, Rubens R 1988 Effects of cyproterone acetate plus ethinylestradiol low dose on plasma androgens and lipids in mildly hirsute or acneic young women. Contraception 38:419-428 114. Dowsett M, Forbes KL, Rose GL, Mudge JE, Jeffcoate SL 1986 A comparison of the effects of danazol and gestrinone on testosterone binding to sex hormone binding globulin in vitro and in vivo. Clin Endocrinol (Oxf) 24:555-563 115. Hammond GL, Rabe T, Wagner JD 2001 Preclinical profiles of progestins used in formulations of oral contraceptives and hormone replacement therapy. Am J Obstet Gynecol 185:S24-31 116. Hammond GL, Bocchinfuso WP, Orava M, Smith CL, van den Ende A, van Enk A 1994 Serum distribution of two contraceptive progestins: 3-ketodesogestrel and gestodene. Contraception 50:301-318 117. Hogeveen KN, Cousin P, Pugeat M, Dewailly D, Soudan B, Hammond GL 2002 Human sex hormone-binding globulin variants associated with hyperandrogenism and ovarian dysfunction. J Clin Invest 109:973-981 118. Haffner SM, Shaten J, Stern MP, Smith GD, Kuller L 1996 Low levels of sex hormone-binding globulin and testosterone predict the development of non-insulin-dependent diabetes mellitus in men. MRFIT Research Group. Multiple Risk Factor Intervention Trial. Am J Epidemiol 143:889-897 119. Pugeat M, Cousin P, Baret C, Lejeune H, Forest MG 2000 Sex hormone-binding globulin during puberty in normal and hyperandrogenic girls. J Pediatr Endocrinol Metab 13 Suppl 5:1277-1279 120. Hammond GL, Robinson PA, Sugino H, Ward DN, Finne J 1986 Physicochemical characteristics of human sex hormone binding globulin: evidence for two identical subunits. J Steroid Biochem 24:815-824 121. Avvakumov GV, Matveentseva IV, Akhrem LV, Strel'chyonok OA, Akhrem AA 1983 Study of the carbohydrate moiety of human serum sex hormone-binding globulin. Biochim Biophys Acta 760:104-110 122. Grishkovskaya I, Avvakumov GV, Sklenar G, Dales D, Hammond GL, Muller YA 155  2000 Crystal structure of human sex hormone-binding globulin: steroid transport by a laminin G-like domain. Embo J 19:504-512 123. Joseph DR, Baker ME 1992 Sex hormone-binding globulin, androgen-binding protein, and vitamin K-dependent protein S are homologous to laminin A, merosin, and Drosophila crumbs protein. Faseb J 6:2477-2481 124. Sasaki T, Knyazev PG, Clout NJ, Cheburkin Y, Gohring W, Ullrich A, Timpl R, Hohenester E 2006 Structural basis for Gas6-Axl signalling. Embo J 25:80-87 125. Villoutreix BO, Dahlback B, Borgel D, Gandrille S, Muller YA 2001 Three-dimensional model of the SHBG-like region of anticoagulant protein S: new structure-function insights. Proteins 43:203-216 126. Evenas P, Garcia de Frutos P, Nicolaes GA, Dahlback B 2000 The second laminin G-type domain of protein S is indispensable for expression of full cofactor activity in activated protein C-catalysed inactivation of factor Va and factor VIIIa. Thromb Haemost 84:271-277 127. Nelson RM, Long GL 1992 Binding of protein S to C4b-binding protein. Mutagenesis of protein S. J Biol Chem 267:8140-8145 128. Avvakumov GV, Grishkovskaya I, Muller YA, Hammond GL 2001 Resolution of the human sex hormone-binding globulin dimer interface and evidence for two steroid-binding sites per homodimer. J Biol Chem 276:34453-34457 129. Bocchinfuso WP, Hammond GL 1994 Steroid-binding and dimerization domains of human sex hormone-binding globulin partially overlap: steroids and Ca2+ stabilize dimer formation. Biochemistry 33:10622-10629 130. Hildebrand C, Bocchinfuso WP, Dales D, Hammond GL 1995 Resolution of the steroid-binding and dimerization domains of human sex hormone-binding globulin by expression in Escherichia coli. Biochemistry 34:3231-3238 131. Shiau AK, Barstad D, Loria PM, Cheng L, Kushner PJ, Agard DA, Greene GL 1998 The structural basis of estrogen receptor\/coactivator recognition and the antagonism of this interaction by tamoxifen. Cell 95:927-937 132. Tanenbaum DM, Wang Y, Williams SP, Sigler PB 1998 Crystallographic comparison of the estrogen and progesterone receptor's ligand binding domains. Proc Natl Acad Sci U S A 95:5998-6003 156  133. Hammond GL, Bocchinfuso WP 1995 Sex hormone-binding globulin\/androgen-binding protein: steroid-binding and dimerization domains. J Steroid Biochem Mol Biol 53:543-552 134. Grenot C, de Montard A, Blachere T, de Ravel MR, Mappus E, Cuilleron CY 1992 Characterization of Met-139 as the photolabeled amino acid residue in the steroid binding site of sex hormone binding globulin using delta 6 derivatives of either testosterone or estradiol as unsubstituted photoaffinity labeling reagents. Biochemistry 31:7609-7621 135. Namkung PC, Kumar S, Walsh KA, Petra PH 1990 Identification of lysine 134 in the steroid-binding site of the sex steroid-binding protein of human plasma. J Biol Chem 265:18345-18350 136. Avvakumov GV, Muller YA, Hammond GL 2000 Steroid-binding specificity of human sex hormone-binding globulin is influenced by occupancy of a zinc-binding site. J Biol Chem 275:25920-25925 137. Hammond GL, Avvakumov GV, Muller YA 2003 Structure\/function analyses of human sex hormone-binding globulin: effects of zinc on steroid-binding specificity. J Steroid Biochem Mol Biol 85:195-200 138. Bocchinfuso WP, Ma KL, Lee WM, Warmels-Rodenhiser S, Hammond GL 1992 Selective removal of glycosylation sites from sex hormone-binding globulin by site-directed mutagenesis. Endocrinology 131:2331-2336 139. Danzo BJ, Bell BW, Black JH 1989 Human testosterone-binding globulin is a dimer composed of two identical protomers that are differentially glycosylated. Endocrinology 124:2809-2817 140. Avvakumov GV, Cherkasov A, Muller YA, Hammond GL 2010 Structural analyses of sex hormone-binding globulin reveal novel ligands and function. Mol Cell Endocrinol 316:13-23 141. Cousin P, Dechaud H, Grenot C, Lejeune H, Hammond GL, Pugeat M 1999 Influence of glycosylation on the clearance of recombinant human sex hormone-binding globulin from rabbit blood. J Steroid Biochem Mol Biol 70:115-121 142. Cousin P, Dechaud H, Grenot C, Lejeune H, Pugeat M 1998 Human variant sex hormone-binding globulin (SHBG) with an additional carbohydrate chain has a 157  reduced clearance rate in rabbit. J Clin Endocrinol Metab 83:235-240 143. Bocchinfuso WP, Warmels-Rodenhiser S, Hammond GL 1991 Expression and differential glycosylation of human sex hormone-binding globulin by mammalian cell lines. Mol Endocrinol 5:1723-1729 144. Strel'chyonok OA, Avvakumov GV 1990 Specific steroid-binding glycoproteins of human blood plasma: novel data on their structure and function. J Steroid Biochem 35:519-534 145. Petra PH, Stanczyk FZ, Namkung PC, Fritz MA, Novy MJ 1985 Direct effect of sex steroid-binding protein (SBP) of plasma on the metabolic clearance rate of testosterone in the rhesus macaque. J Steroid Biochem 22:739-746 146. Ng KM, Catalano MG, Pinos T, Selva DM, Avvakumov GV, Munell F, Hammond GL 2006 Evidence that fibulin family members contribute to the steroid-dependent extravascular sequestration of sex hormone-binding globulin. J Biol Chem 281:15853-15861 147. Bordin S, Petra PH 1980 Immunocytochemical localization of the sex steroid-binding protein of plasma in tissues of the adult monkey Macaca nemestrina. Proc Natl Acad Sci U S A 77:5678-5682 148. Sinnecker G, Hiort O, Mitze M, Donn F, Neumann S 1988 Immunohistochemical detection of a sex hormone binding globulin like antigen in tissue sections of normal human prostate, benign prostatic hypertrophy and normal human endometrium. Steroids 52:335-336 149. Santen RJ 1986 Determinants of tissue oestradiol levels in human breast cancer. Cancer Surv 5:597-616 150. Noe G, Cheng YC, Dabike M, Croxatto HB 1992 Tissue uptake of human sex hormone-binding globulin and its influence on ligand kinetics in the adult female rat. Biol Reprod 47:970-976 151. Pelliniemi LJ, Dym M, Gunsalus GL, Musto NA, Bardin CW, Fawcett DW 1981 Immunocytochemical localization of androgen-binding protein in the male rat reproductive tract. Endocrinology 108:925-931 152. Egloff M, Vendrely E, Tardivel-Lacombe J, Dadoune JP, Degrelle H 1982 [Immunohistochemical study of the human testis and epididymis with a monospecific 158  antiserum against the sex-steroid-binding plasma protein]. C R Seances Acad Sci III 295:107-111 153. Gerard H, Gerard A, En Nya A, Felden F, Gueant JL 1994 Spermatogenic cells do internalize Sertoli androgen-binding protein: a transmission electron microscopy autoradiographic study in the rat. Endocrinology 134:1515-1527 154. Joseph DR, Power SG, Petrusz P 1997 Expression and distribution of androgen-binding protein\/sex hormone-binding globulin in the female rodent reproductive system. Biol Reprod 56:14-20 155. Strel'chyonok OA, Avvakumov GV, Survilo LI 1984 A recognition system for sex-hormone-binding protein-estradiol complex in human decidual endometrium plasma membranes. Biochim Biophys Acta 802:459-466 156. Avvakumov GV, Zhuk NI, Strel'chyonok OA 1986 Subcellular distribution and selectivity of the protein-binding component of the recognition system for sex-hormone-binding protein-estradiol complex in human decidual endometrium. Biochim Biophys Acta 881:489-498 157. Hryb DJ, Khan MS, Rosner W 1985 Testosterone-estradiol-binding globulin binds to human prostatic cell membranes. Biochem Biophys Res Commun 128:432-440 158. Avvakumov GV, Survilo LI, Strel'chenok OA 1985 [Interaction of blood sex steroid-binding globulin with cell membranes of human decidual tissue]. Biokhimiia 50:1155-1161 159. Gueant JL, Fremont S, Felden F, Nicolas JP, Gerard A, Leheup B, Gerard H, Grignon G 1991 Evidence that androgen-binding protein endocytosis in vitro is receptor mediated in principal cells of the rat epididymis. J Mol Endocrinol 7:113-122 160. Krupenko NI, Avvakumov GV, Strel'chyonok OA 1990 Binding of human sex hormone-binding globulin-androgen complexes to the placental syncytiotrophoblast membrane. Biochem Biophys Res Commun 171:1279-1283 161. Frairia R, Fortunati N, Berta L, Fazzari A, Fissore F, Gaidano G 1991 Sex steroid binding protein (SBP) receptors in estrogen sensitive tissues. J Steroid Biochem Mol Biol 40:805-812 162. Hryb DJ, Khan MS, Romas NA, Rosner W 1990 The control of the interaction of sex hormone-binding globulin with its receptor by steroid hormones. J Biol Chem 159  265:6048-6054 163. Khan MS, Hryb DJ, Hashim GA, Romas NA, Rosner W 1990 Delineation and synthesis of the membrane receptor-binding domain of sex hormone-binding globulin. J Biol Chem 265:18362-18365 164. Rudenko G, Hohenester E, Muller YA 2001 LG\/LNS domains: multiple functions -- one business end? Trends Biochem Sci 26:363-368 165. Porto CS, Gunsalus GL, Bardin CW, Phillips DM, Musto NA 1991 Receptor-mediated endocytosis of an extracellular steroid-binding protein (TeBG) in MCF-7 human breast cancer cells. Endocrinology 129:436-445 166. Gerard H, Gueant JL, Gerard A, Fremont S, el Harate A, Nicolas JP, Grignon G 1988 [Endocytosis of the androgen-binding-protein (ABP) by the principal cells of rat epididymis]. Reprod Nutr Dev 28:1257-1266 167. Gerard A 1995 Endocytosis of androgen-binding protein (ABP) by spermatogenic cells. J Steroid Biochem Mol Biol 53:533-542 168. Hammes A, Andreassen TK, Spoelgen R, Raila J, Hubner N, Schulz H, Metzger J, Schweigert FJ, Luppa PB, Nykjaer A, Willnow TE 2005 Role of endocytosis in cellular uptake of sex steroids. Cell 122:751-762 169. Saito A, Pietromonaco S, Loo AK, Farquhar MG 1994 Complete cloning and sequencing of rat gp330\/\"megalin,\" a distinctive member of the low density lipoprotein receptor gene family. Proc Natl Acad Sci U S A 91:9725-9729 170. Nykjaer A, Dragun D, Walther D, Vorum H, Jacobsen C, Herz J, Melsen F, Christensen EI, Willnow TE 1999 An endocytic pathway essential for renal uptake and activation of the steroid 25-(OH) vitamin D3. Cell 96:507-515 171. Rosner W 2006 Sex steroids and the free hormone hypothesis. Cell 124:455-456; author reply 456-457 172. Pope SN, Lee IR 2005 Yeast two-hybrid identification of prostatic proteins interacting with human sex hormone-binding globulin. J Steroid Biochem Mol Biol 94:203-208 173. Theocharis SE, Margeli AP, Klijanienko JT, Kouraklis GP 2004 Metallothionein expression in human neoplasia. Histopathology 45:103-118 174. Jin R, Chow VT, Tan PH, Dheen ST, Duan W, Bay BH 2002 Metallothionein 2A expression is associated with cell proliferation in breast cancer. Carcinogenesis 160  23:81-86 175. Salzer U, Prohaska R 2001 Stomatin, flotillin-1, and flotillin-2 are major integral proteins of erythrocyte lipid rafts. Blood 97:1141-1143 176. Foekens JA, Look MP, Bolt-de Vries J, Meijer-van Gelder ME, van Putten WL, Klijn JG 1999 Cathepsin-D in primary breast cancer: prognostic evaluation involving 2810 patients. Br J Cancer 79:300-307 177. Miyake H, Hara I, Eto H 2003 Prediction of the extent of prostate cancer by the combined use of systematic biopsy and serum level of cathepsin D. Int J Urol 10:196-200 178. Yousef GM, Obiezu CV, Luo LY, Black MH, Diamandis EP 1999 Prostase\/KLK-L1 is a new member of the human kallikrein gene family, is expressed in prostate and breast tissues, and is hormonally regulated. Cancer Res 59:4252-4256 179. Heemers HV, Tindall DJ 2007 Androgen receptor (AR) coregulators: a diversity of functions converging on and regulating the AR transcriptional complex. Endocr Rev 28:778-808 180. Heinlein CA, Chang C 2002 Androgen receptor (AR) coregulators: an overview. Endocr Rev 23:175-200 181. Kang Z, Janne OA, Palvimo JJ 2004 Coregulator recruitment and histone modifications in transcriptional regulation by the androgen receptor. Mol Endocrinol 18:2633-2648 182. Kang Z, Pirskanen A, Janne OA, Palvimo JJ 2002 Involvement of proteasome in the dynamic assembly of the androgen receptor transcription complex. J Biol Chem 277:48366-48371 183. Shang Y, Myers M, Brown M 2002 Formation of the androgen receptor transcription complex. Mol Cell 9:601-610 184. Wang Q, Carroll JS, Brown M 2005 Spatial and temporal recruitment of androgen receptor and its coactivators involves chromosomal looping and polymerase tracking. Mol Cell 19:631-642 185. Wilson EM, French FS 1976 Binding properties of androgen receptors. Evidence for identical receptors in rat testis, epididymis, and prostate. J Biol Chem 251:5620-5629 186. Kemppainen JA, Lane MV, Sar M, Wilson EM 1992 Androgen receptor 161  phosphorylation, turnover, nuclear transport, and transcriptional activation. Specificity for steroids and antihormones. J Biol Chem 267:968-974 187. Zhou ZX, Lane MV, Kemppainen JA, French FS, Wilson EM 1995 Specificity of ligand-dependent androgen receptor stabilization: receptor domain interactions influence ligand dissociation and receptor stability. Mol Endocrinol 9:208-218 188. Bardin CW, Catterall JF 1981 Testosterone: a major determinant of extragenital sexual dimorphism. Science 211:1285-1294 189. Cunha GR, Donjacour AA, Cooke PS, Mee S, Bigsby RM, Higgins SJ, Sugimura Y 1987 The endocrinology and developmental biology of the prostate. Endocr Rev 8:338-362 190. Catterall JF, Kontula KK, Watson CS, Seppanen PJ, Funkenstein B, Melanitou E, Hickok NJ, Bardin CW, Janne OA 1986 Regulation of gene expression by androgens in murine kidney. Recent Prog Horm Res 42:71-109 191. Sinha-Hikim I, Artaza J, Woodhouse L, Gonzalez-Cadavid N, Singh AB, Lee MI, Storer TW, Casaburi R, Shen R, Bhasin S 2002 Testosterone-induced increase in muscle size in healthy young men is associated with muscle fiber hypertrophy. Am J Physiol Endocrinol Metab 283:E154-164 192. Kasperk CH, Wergedal JE, Farley JR, Linkhart TA, Turner RT, Baylink DJ 1989 Androgens directly stimulate proliferation of bone cells in vitro. Endocrinology 124:1576-1578 193. Manolagas SC 2000 Birth and death of bone cells: basic regulatory mechanisms and implications for the pathogenesis and treatment of osteoporosis. Endocr Rev 21:115-137 194. Gresik EW 1980 Postnatal developmental changes in submandibular glands of rats and mice. J Histochem Cytochem 28:860-870 195. Mooradian AD, Morley JE, Korenman SG 1987 Biological actions of androgens. Endocr Rev 8:1-28 196. Kousteni S, Bellido T, Plotkin LI, O'Brien CA, Bodenner DL, Han L, Han K, DiGregorio GB, Katzenellenbogen JA, Katzenellenbogen BS, Roberson PK, Weinstein RS, Jilka RL, Manolagas SC 2001 Nongenotropic, sex-nonspecific signaling through the estrogen or androgen receptors: dissociation from 162  transcriptional activity. Cell 104:719-730 197. Berrevoets CA, Umar A, Brinkmann AO 2002 Antiandrogens: selective androgen receptor modulators. Mol Cell Endocrinol 198:97-103 198. Eagon PK, Elm MS, Stafford EA, Porter LE 1994 Androgen receptor in human liver: characterization and quantitation in normal and diseased liver. Hepatology 19:92-100 199. Berger FG, Watson G 1989 Androgen-regulated gene expression. Annu Rev Physiol 51:51-65 200. Toole JJ, Hastie ND, Held WA 1979 An abundant androgen-regulated mRNA in the mouse kidney. Cell 17:441-448 201. Crozat A, Palvimo JJ, Julkunen M, Janne OA 1992 Comparison of androgen regulation of ornithine decarboxylase and S-adenosylmethionine decarboxylase gene expression in rodent kidney and accessory sex organs. Endocrinology 130:1131-1144 202. El-Meanawy MA, Schelling JR, Pozuelo F, Churpek MM, Ficker EK, Iyengar S, Sedor JR 2000 Use of serial analysis of gene expression to generate kidney expression libraries. Am J Physiol Renal Physiol 279:F383-392 203. Watson G, Paigen K 1988 mRNA synthesis rates in vivo for androgen-inducible sequences in mouse kidney. Mol Cell Biol 8:2117-2124 204. Meseguer A, Catterall JF 1990 Cell-specific expression of kidney androgen-regulated protein messenger RNA is under multihormonal control. Mol Endocrinol 4:1240-1248 205. Meseguer A, Watson CS, Catterall JF 1989 Nucleotide sequence of kidney androgen-regulated protein mRNA and its cell-specific expression in Tfm\/Y mice. Mol Endocrinol 3:962-967 206. Meseguer A, Catterall JF 1987 Mouse kidney androgen-regulated protein messenger ribonucleic acid is expressed in the proximal convoluted tubules. Mol Endocrinol 1:535-541 207. Paigen K, Labarca C, Watson G 1979 A regulatory locus for mouse beta-glucuronidase induction, Gur, controls messenger RNA activity. Science 203:554-556 208. Swank RT, Paigen K, Davey R, Chapman V, Labarca C, Watson G, Ganschow R, Brandt EJ, Novak E 1978 Genetic regulation of mammalian glucuronidase. Recent 163  Prog Horm Res 34:401-436 209. Felder MR, Watson G, Huff MO, Ceci JD 1988 Mechanism of induction of mouse kidney alcohol dehydrogenase by androgen. Androgen-induced stimulation of transcription of the Adh-1 gene. J Biol Chem 263:14531-14537 210. Berger FG, Gross KW, Watson G 1981 Isolation and characterization of a DNA sequence complementary to an androgen-inducible messenger RNA from mouse kidney. J Biol Chem 256:7006-7013 211. Tseng-Crank J, Berger FG 1987 Evolution of steroid-inducible RP2 mRNA expression in the mouse kidney. Genetics 116:593-599 212. Muller-Esterl W 1989 Kininogens, kinins and kinships. Thromb Haemost 61:2-6 213. Gan L, Lee I, Smith R, Argonza-Barrett R, Lei H, McCuaig J, Moss P, Paeper B, Wang K 2000 Sequencing and expression analysis of the serine protease gene cluster located in chromosome 19q13 region. Gene 257:119-130 214. Harvey TJ, Hooper JD, Myers SA, Stephenson SA, Ashworth LK, Clements JA 2000 Tissue-specific expression patterns and fine mapping of the human kallikrein (KLK) locus on proximal 19q13.4. J Biol Chem 275:37397-37406 215. Lawrence MG, Lai J, Clements JA 2010 Kallikreins on steroids: structure, function, and hormonal regulation of prostate-specific antigen and the extended kallikrein locus. Endocr Rev 31:407-446 216. Yoon H, Laxmikanthan G, Lee J, Blaber SI, Rodriguez A, Kogot JM, Scarisbrick IA, Blaber M 2007 Activation profiles and regulatory cascades of the human kallikrein-related peptidases. J Biol Chem 282:31852-31864 217. Hedstrom L 2002 Serine protease mechanism and specificity. Chem Rev 102:4501-4524 218. Yousef GM, Diamandis EP 2001 The new human tissue kallikrein gene family: structure, function, and association to disease. Endocr Rev 22:184-204 219. Catalona WJ, Smith DS, Ratliff TL, Dodds KM, Coplen DE, Yuan JJ, Petros JA, Andriole GL 1991 Measurement of prostate-specific antigen in serum as a screening test for prostate cancer. N Engl J Med 324:1156-1161 220. Cleutjens KB, van Eekelen CC, van der Korput HA, Brinkmann AO, Trapman J 1996 Two androgen response regions cooperate in steroid hormone regulated activity of the 164  prostate-specific antigen promoter. J Biol Chem 271:6379-6388 221. Schuur ER, Henderson GA, Kmetec LA, Miller JD, Lamparski HG, Henderson DR 1996 Prostate-specific antigen expression is regulated by an upstream enhancer. J Biol Chem 271:7043-7051 222. Huang W, Shostak Y, Tarr P, Sawyers C, Carey M 1999 Cooperative assembly of androgen receptor into a nucleoprotein complex that regulates the prostate-specific antigen enhancer. J Biol Chem 274:25756-25768 223. Cleutjens KB, van der Korput HA, van Eekelen CC, van Rooij HC, Faber PW, Trapman J 1997 An androgen response element in a far upstream enhancer region is essential for high, androgen-regulated activity of the prostate-specific antigen promoter. Mol Endocrinol 11:148-161 224. Magklara A, Grass L, Diamandis EP 2000 Differential steroid hormone regulation of human glandular kallikrein (hK2) and prostate-specific antigen (PSA) in breast cancer cell lines. Breast Cancer Res Treat 59:263-270 225. Shan JD, Porvari K, Ruokonen M, Karhu A, Launonen V, Hedberg P, Oikarinen J, Vihko P 1997 Steroid-involved transcriptional regulation of human genes encoding prostatic acid phosphatase, prostate-specific antigen, and prostate-specific glandular kallikrein. Endocrinology 138:3764-3770 226. Yu H, Diamandis EP, Zarghami N, Grass L 1994 Induction of prostate specific antigen production by steroids and tamoxifen in breast cancer cell lines. Breast Cancer Res Treat 32:291-300 227. Scully JL, Bartlett JD, Chaparian MG, Fukae M, Uchida T, Xue J, Hu CC, Simmer JP 1998 Enamel matrix serine proteinase 1: stage-specific expression and molecular modeling. Connect Tissue Res 39:111-122; discussion 141-119 228. Simmer JP, Fukae M, Tanabe T, Yamakoshi Y, Uchida T, Xue J, Margolis HC, Shimizu M, DeHart BC, Hu CC, Bartlett JD 1998 Purification, characterization, and cloning of enamel matrix serine proteinase 1. J Dent Res 77:377-386 229. Nelson PS, Gan L, Ferguson C, Moss P, Gelinas R, Hood L, Wang K 1999 Molecular cloning and characterization of prostase, an androgen-regulated serine protease with prostate-restricted expression. Proc Natl Acad Sci U S A 96:3114-3119 230. Stephenson SA, Verity K, Ashworth LK, Clements JA 1999 Localization of a new 165  prostate-specific antigen-related serine protease gene, KLK4, is evidence for an expanded human kallikrein gene family cluster on chromosome 19q13.3-13.4. J Biol Chem 274:23210-23214 231. Hu JC, Zhang C, Sun X, Yang Y, Cao X, Ryu O, Simmer JP 2000 Characterization of the mouse and human PRSS17 genes, their relationship to other serine proteases, and the expression of PRSS17 in developing mouse incisors. Gene 251:1-8 232. Korkmaz KS, Korkmaz CG, Pretlow TG, Saatcioglu F 2001 Distinctly different gene structure of KLK4\/KLK-L1\/prostase\/ARM1 compared with other members of the kallikrein family: intracellular localization, alternative cDNA forms, and Regulation by multiple hormones. DNA Cell Biol 20:435-445 233. Lai J, Myers SA, Lawrence MG, Odorico DM, Clements JA 2009 Direct progesterone receptor and indirect androgen receptor interactions with the kallikrein-related peptidase 4 gene promoter in breast and prostate cancer. Mol Cancer Res 7:129-141 234. Dong Y, Kaushal A, Bui L, Chu S, Fuller PJ, Nicklin J, Samaratunga H, Clements JA 2001 Human kallikrein 4 (KLK4) is highly expressed in serous ovarian carcinomas. Clin Cancer Res 7:2363-2371 235. Myers SA, Clements JA 2001 Kallikrein 4 (KLK4), a new member of the human kallikrein gene family is up-regulated by estrogen and progesterone in the human endometrial cancer cell line, KLE. J Clin Endocrinol Metab 86:2323-2326 236. Scott RE, Wu-Peng XS, Yen PM, Chin WW, Pfaff DW 1997 Interactions of estrogen- and thyroid hormone receptors on a progesterone receptor estrogen response element (ERE) sequence: a comparison with the vitellogenin A2 consensus ERE. Mol Endocrinol 11:1581-1592 237. Orshal JM, Khalil RA 2004 Gender, sex hormones, and vascular tone. Am J Physiol Regul Integr Comp Physiol 286:R233-249 238. Feldman BJ, Feldman D 2001 The development of androgen-independent prostate cancer. Nat Rev Cancer 1:34-45 239. Meseguer A, Catterall JF 1992 Effects of pituitary hormones on the cell-specific expression of the KAP gene. Mol Cell Endocrinol 89:153-162 240. Palvimo JJ, Reinikainen P, Ikonen T, Kallio PJ, Moilanen A, J\u00e4nne OA 1996 Mutual transcriptional interference between RelA and androgen receptor. J Biol Chem 166  271:24151-24156 241. Niemi S, M\u00e4entausta O, Bolton NJ, Hammond GL 1988 Time-resolved immunofluorometric assay of sex-hormone binding globulin. Clin Chem 34:63-66 242. Cebrian C, Areste C, Nicolas A, Olive P, Carceller A, Piulats J, Meseguer A 2001 Kidney androgen-regulated protein interacts with cyclophilin B and reduces cyclosporine A-mediated toxicity in proximal tubule cells. J Biol Chem 276:29410-29419 243. Cartier N, Lacave R, Vallet V, Hagege J, Hellio R, Robine S, Pringault E, Cluzeaud F, Briand P, Kahn A, A. V 1993 Establishment of renal proximal tubule cell lines by targeted oncogenesis in transgenic mice using the L-pyruvate kinase-SV40 (T) antigen hybrid gene. J Cell Sci 104 ( Pt 3):695-704 244. Lacave R, Bens M, Cartier N, Vallet V, Robine S, Pringault E, Kahn A, Vandewalle A 1993 Functional properties of proximal tubule cell lines derived from transgenic mice harboring L-pyruvate kinase-SV40 (T) antigen hybrid gene. J Cell Sci 104 ( Pt 3):705-712 245. Soler M, Tornavaca O, Sole E, Menoyo A, Hardy D, Catterall JF, Vandewalle A, Meseguer A 2002 Hormone-specific regulation of the kidney androgen-regulated gene promoter in cultured mouse renal proximal-tubule cells. Biochem J 366:757-766 246. Brightwell G, Poirier V, Cole E, Ivins S, Brown KW 1997 Serum-dependent and cell cycle-dependent expression from a cytomegalovirus-based mammalian expression vector. Gene 194:115-123 247. Isomaa V, Pajunen AE, Bardin CW, J\u00e4nne OA 1982 Nuclear androgen receptors in the mouse kidney: validation of a new assay. Endocrinology 111:833-843 248. Yeh S, Miyamoto H, Shima H, Chang C 1998 From estrogen to androgen receptor: a new pathway for sex hormones in prostate. Proc Natl Acad Sci U S A 95:5527-5532 249. Christensen EI, Birn H 2002 Megalin and cubilin: multifunctional endocytic receptors. Nat Rev Mol Cell Biol 3:256-266 250. Kozarsky KF, Call SM, Dower SK, Krieger M 1988 Abnormal intracellular sorting of O-linked carbohydrate-deficient interleukin-2 receptors. Mol Cell Biol 8:3357-3363 251. Muniz M, Nuoffer C, Hauri HP, Riezman H 2000 The Emp24 complex recruits a specific cargo molecule into endoplasmic reticulum-derived vesicles. J Cell Biol 167  148:925-930 252. Shoyab M, Plowman GD, McDonald VL, Bradley JG, Todaro GJ 1989 Structure and function of human amphiregulin: a member of the epidermal growth factor family. Science 243:1074-1076 253. Sehgal I, Bailey J, Hitzemann K, Pittelkow MR, Maihle NJ 1994 Epidermal growth factor receptor-dependent stimulation of amphiregulin expression in androgen-stimulated human prostate cancer cells. Mol Biol Cell 5:339-347 254. Osborn L, Hession C, Tizard R, Vassallo C, Luhowskyj S, Chi-Rosso G, Lobb R 1989 Direct expression cloning of vascular cell adhesion molecule 1, a cytokine-induced endothelial protein that binds to lymphocytes. Cell 59:1203-1211 255. Wuthrich RP, Jenkins TA, Snyder TL 1993 Regulation of cytokine-stimulated vascular cell adhesion molecule-1 expression in renal tubular epithelial cells. Transplantation 55:172-177 256. Death AK, McGrath KC, Sader MA, Nakhla S, Jessup W, Handelsman DJ, Celermajer DS 2004 Dihydrotestosterone promotes vascular cell adhesion molecule-1 expression in male human endothelial cells via a nuclear factor-kappaB-dependent pathway. Endocrinology 145:1889-1897 257. Tu Z, Kelley VR, Collins T, Lee FS 2001 I kappa B kinase is critical for TNF-alpha-induced VCAM1 gene expression in renal tubular epithelial cells. J Immunol 166:6839-6846 258. Sarma V, Wolf FW, Marks RM, Shows TB, Dixit VM 1992 Cloning of a novel tumor necrosis factor-alpha-inducible primary response gene that is differentially expressed in development and capillary tube-like formation in vitro. J Immunol 148:3302-3312 259. Rusiniak ME, Yu M, Ross DT, Tolhurst EC, Slack JL 2000 Identification of B94 (TNFAIP2) as a potential retinoic acid target gene in acute promyelocytic leukemia. Cancer Res 60:1824-1829 260. Enck AH, Berger UV, Yu AS 2001 Claudin-2 is selectively expressed in proximal nephron in mouse kidney. Am J Physiol Renal Physiol 281:F966-974 261. Kiuchi-Saishin Y, Gotoh S, Furuse M, Takasuga A, Tano Y, Tsukita S 2002 Differential expression patterns of claudins, tight junction membrane proteins, in mouse nephron segments. J Am Soc Nephrol 13:875-886 168  262. Muto S, Hata M, Taniguchi J, Tsuruoka S, Moriwaki K, Saitou M, Furuse K, Sasaki H, Fujimura A, Imai M, Kusano E, Tsukita S, Furuse M 2010 Claudin-2-deficient mice are defective in the leaky and cation-selective paracellular permeability properties of renal proximal tubules. Proc Natl Acad Sci U S A 107:8011-8016 263. Lan Y, Kingsley PD, Cho ES, Jiang R 2001 Osr2, a new mouse gene related to Drosophila odd-skipped, exhibits dynamic expression patterns during craniofacial, limb, and kidney development. Mech Dev 107:175-179 264. Dillard PR, Lin MF, Khan SA 2008 Androgen-independent prostate cancer cells acquire the complete steroidogenic potential of synthesizing testosterone from cholesterol. Mol Cell Endocrinol 295:115-120 265. Misao R, Nakanishi Y, Fujimoto J, Iwagaki S, Tamaya T 1998 Dominant expression of sex-hormone-binding-globulin exon-7 splicing variant over wild-type mRNA in human ovarian cancers. Int J Cancer 77:828-832 266. Misao R, Nakanishi Y, Fujimoto J, Tamaya T 1998 Effect of medroxyprogesterone acetate on sex hormone-binding globulin mRNA expression in the human endometrial cancer cell line Ishikawa. Eur J Endocrinol 138:574-582 267. Fortunati N, Fissore F, Fazzari A, Berta L, Benedusi-Pagliano E, Frairia R 1993 Biological relevance of the interaction between sex steroid binding protein and its specific receptor of MCF-7 cells: effect on the estradiol-induced cell proliferation. J Steroid Biochem Mol Biol 45:435-444 268. Nakhla AM, Khan MS, Rosner W 1990 Biologically active steroids activate receptor-bound human sex hormone-binding globulin to cause LNCaP cells to accumulate adenosine 3',5'-monophosphate. J Clin Endocrinol Metab 71:398-404 269. Mark MR, Chen J, Hammonds RG, Sadick M, Godowsk PJ 1996 Characterization of Gas6, a member of the superfamily of G domain-containing proteins, as a ligand for Rse and Axl. J Biol Chem 271:9785-9789 270. Power SG, Bocchinfuso WP, Pallesen M, Warmels-Rodenhiser S, Van Baelen H, Hammond GL 1992 Molecular analyses of a human sex hormone-binding globulin variant: evidence for an additional carbohydrate chain. J Clin Endocrinol Metab 75:1066-1070 271. Menard S, Castronovo V, Tagliabue E, Sobel ME 1997 New insights into the 169  metastasis-associated 67 kD laminin receptor. J Cell Biochem 67:155-165 272. Kim KJ, Chung JW, Kim KS 2005 67-kDa laminin receptor promotes internalization of cytotoxic necrotizing factor 1-expressing Escherichia coli K1 into human brain microvascular endothelial cells. J Biol Chem 280:1360-1368 273. Jaseja M, Mergen L, Gillette K, Forbes K, Sehgal I, Copie V 2005 Structure-function studies of the functional and binding epitope of the human 37 kDa laminin receptor precursor protein. J Pept Res 66:9-18 274. Ardini E, Pesole G, Tagliabue E, Magnifico A, Castronovo V, Sobel ME, Colnaghi MI, Menard S 1998 The 67-kDa laminin receptor originated from a ribosomal protein that acquired a dual function during evolution. Mol Biol Evol 15:1017-1025 275. Simon EE, McDonald JA 1990 Extracellular matrix receptors in the kidney cortex. Am J Physiol 259:F783-792 276. Hryb DJ, Khan MS, Romas NA, Rosner W 1989 Solubilization and partial characterization of the sex hormone-binding globulin receptor from human prostate. J Biol Chem 264:5378-5383 277. Rosner W 1990 The functions of corticosteroid-binding globulin and sex hormone-binding globulin: recent advances. Endocr Rev 11:80-91 278. Nakhla AM, Rosner W 1996 Stimulation of prostate cancer growth by androgens and estrogens through the intermediacy of sex hormone-binding globulin. Endocrinology 137:4126-4129 279. Misao R, Itoh N, Mori H, Fujimoto J, Tamaya T 1994 Sex hormone-binding globulin mRNA levels in human uterine endometrium. Eur J Endocrinol 131:623-629 280. Akache B, Grimm D, Pandey K, Yant SR, Xu H, Kay MA 2006 The 37\/67-kilodalton laminin receptor is a receptor for adeno-associated virus serotypes 8, 2, 3, and 9. J Virol 80:9831-9836 281. Nelson J, McFerran NV, Pivato G, Chambers E, Doherty C, Steele D, Timson DJ 2008 The 67 kDa laminin receptor: structure, function and role in disease. Biosci Rep 28:33-48 282. Hu C, Oliver JA, Goldberg MR, Al-Awqati Q 2001 LRP: a new adhesion molecule for endothelial and smooth muscle cells. Am J Physiol Renal Physiol 281:F739-750 283. Givant-Horwitz V, Davidson B, Reich R 2004 Laminin-induced signaling in tumor 170  cells: the role of the M(r) 67,000 laminin receptor. Cancer Res 64:3572-3579 284. Fortunati N, Catalano MG 2006 Sex hormone-binding globulin (SHBG) and estradiol cross-talk in breast cancer cells. Horm Metab Res 38:236-240 285. Tenniswood M 1986 Role of epithelial-stromal interactions in the control of gene expression in the prostate: an hypothesis. Prostate 9:375-385 286. Gittes RF 1991 Carcinoma of the prostate. N Engl J Med 324:236-245 287. Grayhack JT, Keeler TC, Kozlowski JM 1987 Carcinoma of the prostate. Hormonal therapy. Cancer 60:589-601 288. Rainey WE, Carr BR, Sasano H, Suzuki T, Mason JI 2002 Dissecting human adrenal androgen production. Trends Endocrinol Metab 13:234-239 289. Bruchovsky N, Wilson JD 1968 The conversion of testosterone to 5-alpha-androstan-17-beta-ol-3-one by rat prostate in vivo and in vitro. J Biol Chem 243:2012-2021 290. Dehm SM, Tindall DJ 2006 Molecular regulation of androgen action in prostate cancer. J Cell Biochem 99:333-344 291. Young CY, Montgomery BT, Andrews PE, Qui SD, Bilhartz DL, Tindall DJ 1991 Hormonal regulation of prostate-specific antigen messenger RNA in human prostatic adenocarcinoma cell line LNCaP. Cancer Res 51:3748-3752 292. Dehm SM, Tindall DJ 2006 Ligand-independent androgen receptor activity is activation function-2-independent and resistant to antiandrogens in androgen refractory prostate cancer cells. J Biol Chem 281:27882-27893 293. Hammond GL 1995 Potential functions of plasma steroid-binding proteins. Trends Endocrinol Metab 6:298-304 294. Scatchard G 1942 Equilibrium Thermodynamics and Biological Chemistry. Science 95:27-32 295. Dehm SM, Tindall DJ 2007 Androgen receptor structural and functional elements: role and regulation in prostate cancer. Mol Endocrinol 21:2855-2863 296. Heinlein CA, Chang C 2004 Androgen receptor in prostate cancer. Endocr Rev 25:276-308 297. Damassa DA, Lin TM, Sonnenschein C, Soto AM 1991 Biological effects of sex hormone-binding globulin on androgen-induced proliferation and androgen 171  metabolism in LNCaP prostate cells. Endocrinology 129:75-84 298. Henttu P, Liao SS, Vihko P 1992 Androgens up-regulate the human prostate-specific antigen messenger ribonucleic acid (mRNA), but down-regulate the prostatic acid phosphatase mRNA in the LNCaP cell line. Endocrinology 130:766-772 299. Wolf DA, Schulz P, Fittler F 1992 Transcriptional regulation of prostate kallikrein-like genes by androgen. Mol Endocrinol 6:753-762 300. Pinos T, Barbosa-Desongles A, Hurtado A, Santamaria-Martinez A, de Torres I, Reventos J, Munell F 2010 Human SHBG mRNA translation is modulated by alternative 5'-non-coding exons 1A and 1B. PLoS One 5:e13844 301. Miguel-Queralt S, Knowlton M, Avvakumov GV, Al-Nouno R, Kelly GM, Hammond GL 2004 Molecular and functional characterization of sex hormone binding globulin in zebrafish. Endocrinology 145:5221-5230  ","type":"literal","lang":"en"}],"http:\/\/www.europeana.eu\/schemas\/edm\/hasType":[{"value":"Thesis\/Dissertation","type":"literal","lang":"en"}],"http:\/\/vivoweb.org\/ontology\/core#dateIssued":[{"value":"2011-11","type":"literal","lang":"en"}],"http:\/\/www.europeana.eu\/schemas\/edm\/isShownAt":[{"value":"10.14288\/1.0105101","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/language":[{"value":"eng","type":"literal","lang":"en"}],"https:\/\/open.library.ubc.ca\/terms#degreeDiscipline":[{"value":"Reproductive and Developmental Sciences","type":"literal","lang":"en"}],"http:\/\/www.europeana.eu\/schemas\/edm\/provider":[{"value":"Vancouver : University of British Columbia Library","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/publisher":[{"value":"University of British Columbia","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/rights":[{"value":"Attribution-NonCommercial-NoDerivatives 4.0 International","type":"literal","lang":"en"}],"https:\/\/open.library.ubc.ca\/terms#rightsURI":[{"value":"http:\/\/creativecommons.org\/licenses\/by-nc-nd\/4.0\/","type":"literal","lang":"en"}],"https:\/\/open.library.ubc.ca\/terms#scholarLevel":[{"value":"Graduate","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/title":[{"value":"Regulation of androgen action by sex hormone-binding globulin","type":"literal","lang":"en"}],"http:\/\/purl.org\/dc\/terms\/type":[{"value":"Text","type":"literal","lang":"en"}],"https:\/\/open.library.ubc.ca\/terms#identifierURI":[{"value":"http:\/\/hdl.handle.net\/2429\/35861","type":"literal","lang":"en"}]}}