{"@context":{"@language":"en","Affiliation":"http:\/\/vivoweb.org\/ontology\/core#departmentOrSchool","AggregatedSourceRepository":"http:\/\/www.europeana.eu\/schemas\/edm\/dataProvider","Campus":"https:\/\/open.library.ubc.ca\/terms#degreeCampus","Creator":"http:\/\/purl.org\/dc\/terms\/creator","DateAvailable":"http:\/\/purl.org\/dc\/terms\/issued","DateIssued":"http:\/\/purl.org\/dc\/terms\/issued","Degree":"http:\/\/vivoweb.org\/ontology\/core#relatedDegree","DegreeGrantor":"https:\/\/open.library.ubc.ca\/terms#degreeGrantor","Description":"http:\/\/purl.org\/dc\/terms\/description","DigitalResourceOriginalRecord":"http:\/\/www.europeana.eu\/schemas\/edm\/aggregatedCHO","FullText":"http:\/\/www.w3.org\/2009\/08\/skos-reference\/skos.html#note","Genre":"http:\/\/www.europeana.eu\/schemas\/edm\/hasType","GraduationDate":"http:\/\/vivoweb.org\/ontology\/core#dateIssued","IsShownAt":"http:\/\/www.europeana.eu\/schemas\/edm\/isShownAt","Language":"http:\/\/purl.org\/dc\/terms\/language","Program":"https:\/\/open.library.ubc.ca\/terms#degreeDiscipline","Provider":"http:\/\/www.europeana.eu\/schemas\/edm\/provider","Publisher":"http:\/\/purl.org\/dc\/terms\/publisher","Rights":"http:\/\/purl.org\/dc\/terms\/rights","ScholarlyLevel":"https:\/\/open.library.ubc.ca\/terms#scholarLevel","Title":"http:\/\/purl.org\/dc\/terms\/title","Type":"http:\/\/purl.org\/dc\/terms\/type","URI":"https:\/\/open.library.ubc.ca\/terms#identifierURI","SortDate":"http:\/\/purl.org\/dc\/terms\/date"},"Affiliation":[{"@value":"Medicine, Faculty of","@language":"en"},{"@value":"Medical Genetics, Department of","@language":"en"}],"AggregatedSourceRepository":[{"@value":"DSpace","@language":"en"}],"Campus":[{"@value":"UBCV","@language":"en"}],"Creator":[{"@value":"Kuo, Byron Yu-Lin","@language":"en"}],"DateAvailable":[{"@value":"2009-12-11T22:59:32Z","@language":"en"}],"DateIssued":[{"@value":"2005","@language":"en"}],"Degree":[{"@value":"Master of Science - MSc","@language":"en"}],"DegreeGrantor":[{"@value":"University of British Columbia","@language":"en"}],"Description":[{"@value":"Serial analysis of gene expression (SAGE) not only is a method for profiling the\r\nglobal expression of genes, but also offers the opportunity for the discovery of novel\r\ntranscripts. SAGE tags are mapped to known transcripts to determine the source of tags.\r\nWe hypothesized that tags that map neither to a known transcript nor to the genome span\r\na splice junction, for which the exon combination or exon(s) are unknown. Splice\r\njunctions are typically recognized by the pair of highly conserved dinucleotides at each\r\nedge of an intron, GT at the 5' end and AG at the 3' end, as well as by other less\r\nconserved nucleotides flanking the junctions. In the known transcriptome, between 1.6 to\r\n6.2% of predicted tags span a splice junction. We have developed an algorithm,\r\nSAGE2Splice, to efficiently map these unmapped SAGE tags to potential splice junctions\r\nin a genome. An evaluation scheme was designed based on position weight matrices to t\r\nassess the quality of candidates. Candidates were classified into three types of spliced\r\ntags, reflecting the previous annotations of the putative splice junctions. A Type I tag\r\nspans a novel junction where the exons are known; a Type 2 tag spans a previously\r\nknown and an unknown exon; and a Type 3 tag spans two previously unknown exons.\r\nAnalysis of predicted tags extracted from EST sequences demonstrated that candidate\r\njunctions having the splice junction located closer to the centre of the tags are more\r\nreliable. Using high sensitivity and high specificity parameters, 7,757 candidates were\r\npredicted from 1,639 of 20,000 unmapped tags by SAGE2Splice. We selected 12\r\nr\r\ncandidates splice junctions and tested them using RT-PCR. Nine of these twelve\r\ncandidates were validated by RT-PCR and sequencing, and among these, four revealed\r\npreviously uncharacterized exons. To screen more unmapped SAGE tags, we proposed\r\n\r\n\r\nmethods to improve SAGE2Splice in engineering efficiency, program usability, and\r\ncandidate evaluation methods, as well as to include a high throughput laboratory\r\nprocedure for testing the predicted candidates. We expect that many more novel\r\ntranscripts can be discovered using SAGE2Splice. SAGE2Splice is available online at\r\nhttp:\/\/www.bcgsc.ca\/sage2splice\/.","@language":"en"}],"DigitalResourceOriginalRecord":[{"@value":"https:\/\/circle.library.ubc.ca\/rest\/handle\/2429\/16587?expand=metadata","@language":"en"}],"FullText":[{"@value":"SAQE2SPLICE: U N M A P P E D S A G E T A G S R E V E A L N O V E L SPLICE JUNCTIONS by BYRON YU-LIN KUO B.Sc, University of British Columbia, 2002 B.Sc., University of British Columbia, 1999 A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Genetics) THE UNIVERSITY OF BRITISH COLUMBIA September 2005 \u00a9 Byron Yu-Lin Kuo, 2005 Abstract Serial analysis of gene expression (SAGE) not only is a method for profiling the global expression of genes, but also offers the opportunity for the discovery of novel transcripts. SAGE tags are mapped to known transcripts to determine the source of tags. We hypothesized that tags that map neither to a known transcript nor to the genome span a splice junction, for which the exon combination or exon(s) are unknown. Splice junctions are typically recognized by the pair of highly conserved dinucleotides at each edge of an intron, GT at the 5' end and AG at the 3' end, as well as by other less conserved nucleotides flanking the junctions. In the known transcriptome, between 1.6 to 6.2% of predicted tags span a splice junction. We have developed an algorithm, SAGE2Splice, to efficiently map these unmapped SAGE tags to potential splice junctions in a genome. An evaluation scheme was designed based on position weight matrices to t assess the quality of candidates. Candidates were classified into three types of spliced tags, reflecting the previous annotations of the putative splice junctions. A Type I tag spans a novel junction where the exons are known; a Type 2 tag spans a previously known and an unknown exon; and a Type 3 tag spans two previously unknown exons. Analysis of predicted tags extracted from EST sequences demonstrated that candidate junctions having the splice junction located closer to the centre of the tags are more reliable. Using high sensitivity and high specificity parameters, 7,757 candidates were predicted from 1,639 of 20,000 unmapped tags by SAGE2Splice. We selected 12 r candidates splice junctions and tested them using RT-PCR. Nine of these twelve candidates were validated by RT-PCR and sequencing, and among these, four revealed previously uncharacterized exons. To screen more unmapped SAGE tags, we proposed ii methods to improve SAGE2Splice in engineering efficiency, program usability, and candidate evaluation methods, as well as to include a high throughput laboratory procedure for testing the predicted candidates. We expect that many more novel transcripts can be discovered using SAGE2Splice. SAGE2Splice is available online at http:\/\/www.bcgsc.ca\/sage2splice\/. iii Table of Contents A B S T R A C T II T A B L E O F C O N T E N T S IV L I S T O F T A B L E S . V I I L I S T O F F I G U R E S VIII L I S T O F A B B R E V I A T I O N S X A C K N O W L E D G E M E N T XI C O - A U T H O R S H I P S T A T E M E N T XIII C H A P T E R 1 I N T R O D U C T I O N 1 1.1 GENE EXPRESSION 1 1.1.1 Current Technologies of Gene Expression 1 1.1.2 Serial Analysis of Gene Expression 2 1.2 THE MOUSE ATLAS OF GENE EXPRESSION PROJECT 2 1.3 SAGETAG-TO-GENE MAPPING 3 1.3.1 Methods and Problems 3 1.3.2 Tags Spanning a Splice Junction 4 1.4 SPLICE JUNCTION PROPERTIES 4 1.4.1 Introns and Exons 4 1.4.2 The Splicing Reaction 5 1.5 COMPUTATIONAL GENE PREDICTION 6 1.5.1 Current Approaches for Gene Prediction 6 1.5.2 Splice Junction Prediction 7 1.5.3 Position Weight Matrix 8 1.6 OVERVIEW OF THE PROJECT 9 ' 1.7 REFERENCES 10 C H A P T E R 2 S A G E 2 S P L I C E : U N M A P P E D S A G E T A G S R E V E A L N O V E L S P L I C E J U N C T I O N S 13 iv 2.1 INTRODUCTION 13 2.2 RESULTS 16 2.2.1 Some Predicted SA GE Tags Span a Splice Junction 16 2.2.2 Intron Properties 18 2.2.3 TheSA GE2Splice A Igor ithm 19 2.2.3.1 Pre-processing the Input SAGE Tags 19 2.2.3.2 Search Level 1: Matching Halftags 22 2.2.3.3 Search Level 2: Extending Halftags 22 2.2.3.4 Search Level 3: Searching Remaining Portions 23 2.2.4 Scoring Candidate Splice Junctions 23 2.2.5 Efficiency Tuning ofSA GE2Splice 24 2.2.6 Sensitivity and Specificity 25 2.2.7 Edge Length and Rank Analysis 26 2.2.8 Unmapped Tag Search Results 28 2.2.9 Candidate Validation v. 29 2.3 DISCUSSION 33 2.4 MATERIALS AND METHODS 36 2.4.1 Source of Transcripts and Known Splice Junctions 36 2.4.2 Extraction of Predicted SA GE Tags 36 2.4.3 Scoring Splice Junctions 37 2.4.4 SAGE2Splice Implementation and Features 37 2.4.5 Efficiency Tuning of SAGE2Splice 38 2.4.6 Sensitivity and Specificity 38 2.4.7 Source ofSA GE Tags 39 2.4.8 Searching Unmapped SA GE Tags 39 2.4.9 Categorization of Splice Junction Candidates 40 2.4.10 RNA Extraction 41 2.4.11 RT-PCR 42 2.5 REFERENCES 43 C H A P T E R 3 C O N C L U S I O N A N D F U T U R E D I R E C T I O N S . . . . . 46 3.1 EXPANSION OF IMPORTANT OBSERVATIONS 46 V 3.1.1 Unmapped SAGE Tags are a Source for Novel Transcript Discovery 46 3.1.2 Edge Length is an Important Factor for Reliability 47 3.1.3 Quality of Input Tags and Exhaustive Mapping are Required Prior to Performing SAGE2Splice Searches 47 3.1.4 Functions of the Predicted Candidates are Unknown 48 3.2 FUTURE DIRECTIONS 48 3.2.1 Improvements in Computational Efficiency -. 48 3.2.2 Improvements in Usability 48 3.2.3 Improvements in Candidate Evaluation 49 3.2.4 Improvement to Search Non-canonical Splice Junctions 50 3.2.5 Screen More Unmapped Tags Can Lead to the Discovery of More Transcripts 50 3.2.6 High Throughput Laboratory Processes Will be Required 50 3.3 CONCLUSION 51 3.4 REFERENCES 52 APPENDIX: NOVEL TRANSCRIPT SEQUENCE INFORMATION 53 vi List of Tables T A B L E 2-1:6.2% OF PREDICTED TAGS FROM ALL NLA\\11 RESTRICTION SITES, AND 1.6% FROM 3'-MOST SITES WERE FOUND TO SPAN A KNOWN SPLICE JUNCTION (TYPE 0 TAGS). 17 T A B L E 2-2: TWELVE CANDIDATES WERE SELECTED FOR R T - P C R VALIDATION 29 T A B L E 2-3: R T - P C R PRIMERS WERE DESIGNED FOR THE SELECTED CANDIDATES BASED ON SEQUENCESOFTHETWO PREDICTED EXONS 30 T A B L E 2-4: OPEN READING FRAME AND B L A S T P ANALYSES OF THE R T - P C R AND SEQUENCING VALIDATED CANDIDATES 32 vii List of Figures FIGURE 2-1: T A G S THAT SPAN A SPLICE JUNCTION MAY REVEAL NOVEL GENES OR NOVEL TRANSCRIPTS. THISSCHEMATIC DEMONSTRATES FOUR KNOWN EXONS (1,2, 3, AND 4, BOX ESIN SOL ID LIN ES). T H E 3'-M OST NLA 111 ENZYM E RESTRICTI ON SI TE (REPRESENTED AS ~) LIES NEAR THE 3' EDGE OF EX ON 2 AND A KNOWN PREDICTED S A G E TAG (mm) SPANS EXONS 2 AND 3 (TYPE 0 TAG). PREDICTED EXONS (BOXES I N DASHED LINE) 3A AND 3B ARE EXAMPLES OF EXONS PREDICTED BY SAGE2SPLICE. THREE OTHER TYPES OF TAGS (TYPES 1 TO 3) HAVE BEEN DEFINED AS POTENTIAL CANDIDATES IN SAGE2SPLICE PREDICTIONS. T A G PORTIONSARISING FROM KNOWN EXONS ( \u2022 ) , WHEREAS TAG PORTIONS ARISING FROM NOVEL EXONS ( ). SOLID LINES CONNECTING EXONS INDICATE KNOWN COMBINATIONS, WHEREAS DASHED LINES INDICATE UNKNOWN COMBINATIONS 16 FIGURE 2-2: LENGTH AND BOUNDARY NUCLEOTIDES OF INTRONSARE IMPORTANT PROPERTI ES FOR DETECTING A SPLI CE JU NCTI ON. (A) L ESS THAN 10% OF INTRONSIN REFGENE ANNOTATION WERE GREATER THAN 10,000 BP IN LENGTH. ( B ) A N D ( C ) A POSI TL ON WEI GHT M ATRIX (PWM ) FOR SPL I CE JU NCTI ONS WAS APPLI ED TO TRU E SPLICE JUNCTIONS DEFINED BY REFGENE ANNOTATIONS AND TO RANDOMLY SELECTED GENOME SEQUENCES CONTAINING THE CANONICAL DL NUCLEOTIDE PAIR AT THE APPROPRIATE POSITION. T H E SCORES, WHICH WERE COMPUTED BASED ON THE PROFILE MODEL, FOR DONORS AND ACCEPTORS WERE PLOTTED AND SHOWED THAT TRUE SPLICE JUNCTIONS ACQUIRED HIGH SCORES. T H E INFORMATION CONTENT AND THE RELATIVE FREQUENCY OF NUCLEOTIDES AT EACH POSITION ARE MEASURED IN BITS (VERTICAL AXIS OF THE SEQUENCE LOGO DIAGRAMS) TO INDICATE THE STRENGTH OF SIGNALS. TWO BITS OF INFORMATION ARE REQUIRED TO DETERMINE THE CONTENT OF A D N A SEQUENCE. A U : ARBITRARY UNITS 18 FIGURE 2-3: SAGE2SPLICE ALGORITHM SEARCHES THE GENOME FOR NOVEL SPLICE JUNCTIONS. BY SPLITTING EACH TAG INTO 2 HALFTAGSAND MAKING COMPLEMENTARY COPIES, THE ALGORITHM SEARCHES FOR CANDIDATE SPLICE JUNCTI ONS AGAINST CONTINUOUS SEGMENTS OF THE GENOME IN THREE PROGRESSIVE STEPS. A F T E R EACH LEVEL, IFTHE MATCHING CRITERIA WERE FULFILLED, THE ALGORITHM WOULD GO ON TO THE NEXT LEVEL. IF CRITERIA WERE NOT FULFILLED, THE ALGORITHM WOULD ANALYZE THE NEXT TAG. ONCE ALL TAGS HAVE BEEN ANALYZED, THE NEXT GENOMIC SEGMENT IS READ AND THE ALGORITHM RETURNS TO THE FIRST LEVEL 21 FL GURE 2-4: SAGE2SPLI CE WAS OPTIMIZED FOR PROCESSI NG TIME BY USING DL FFERENT GENOMIC SEGMENT LENGTHS (RANGING FROM 10 KB TO 1000 KB). FOR SAGE2SPLICE PERFORMANCE, 100 KB WAS DETERMINED A S T H E OPTIMAL SIZE 24 FIGURE 2-5: SAGE2SPLICE ACHIEVES HIGH SENSITIVITY BUT RELATIVELY LOW SPECIFICITY. (A) T H E AREA UNDER THE RECEIVER OPERATING CHARACTERISTICS (ROC) CURVE IS 0.9232, INDICATING A CANDIDATE FOUND BY SAGE2SPLICE WAS MUCH BETTER THAN Vi i i EXPECTED BY RANDOM CHANCE. CONVERSELY, TO ACHIEVE HIGH SPECIFICITY, THE SENSITIVITY (TRUE POSITIVE RATE) WAS SIGNIFICANTLY COMPROMISED. T H E TANGENT POINT OF THE DASHED LINE IS THE OPTIMAL POINT WHEN THE COSTS OF MISCLASSIFYING POSITIVE AND NEGATIVE CANDIDATES ARE EQUAL. THISPOINT CORRESPONDS TO A P-VALUE CUTOFF OF 0.0025. (B) ANALYSIS OF THE R O C CURVE FOR THE DONOR SPLICE JUNCTIONS INDICATES A CUTOFF P-VALUE OF 0.06 AS THE ' OPTIMAL POINT. (C) FOR THE ACCEPTOR SPLICE JUNCTIONS, THE OPTIMAL CUTOFF P-V A L U E IS DETERMINED TO BE 0.15. (D) T H E POSITIVE PREDICTIVE V A L U E INDICATES THAT A HIGH PROBABILITY (GREATER THAN 0.9) OF CORRECT PREDICTIONS REQUIRES A RESTRICTIVE P-VALUE (LESSTHAN 0.0001) 26 FIGURE 2-6: T H E PROBABILITY OF FINDING THE TRUE SPLICE JUNCTION IS LOWER IF THE SPLICE JUNCTION ISLOCATED CLOSER TO THE EDGE O F A T A G . BY USING THE UNMAPPED TAGS IN THE MOUSE A T L A S PROJECT THAT MAP TO SPLICED TAGS PREDICTED FROM EST TRANSCRIPTS, THE PERCENTAGE OF TRUE SPLICE JUNCTIONS FOUND WASANALYZED FOR EACH SHORT EDGE LENGTH. (A) BY USING HIGH SPECIFICITY PARAMETERS (CUTOFFSOF 0.06, 0.15, AND 0.25 FOR DONOR, ACCEPTOR, AND COMPOSITE P-VALUES, RESPECTIVELY), 93% OF THE TRUE SPLICE JUNCTIONS ' WERE FOUND WHEN THE SHORTER EDGE IS>5 BP IN LENGTH. (B) WITH NO P-VALUE CUTOFFS, 90% OF THE TRUE SPLICE JUNCTIONS WERE FOUND WITH THE TOP-RANKED RE-V A L U E WHEN THE SHORTER EDGE IS 5 BP IN LENGTH 27 FIGURE 2-7: NINE OF TWELVE SELECTED CANDIDATES REVEALED NOVEL SPLICE JUNCTIONS BY R T - P C R AND SEQUENCING. (A) PREDICTED SPLICE JUNCTIONS OF THE 12 SELECTED CANDIDATES. FIRST DIGIT OF THE CANDIDATE ID INDICATES THE TAG TYPE; THE SECOND DIGIT IS ARBITRARILY ASSIGNED. (B) EXCEPT FOR CANDIDATES 1-1,1-2, AND 1-6, ALL CANDI DATES SHOW THE CORRECT PRODUCT SIZE AND WERE SEQUENCE VALIDATED. A LARGER BAND FROM AN UNPREDICTED NOVEL SPLICE JUNCTION WAS ALSO OBSERVED FOR CANDIDATE 1-4. LARGER BANDS WERE ALSO OBSERVED FOR CANDIDATES 1-7 AND 1-8, BUT WERE SHOWN TO BE KNOWN SPLICE VARIANTS. CANDIDATES THAT WERE VALIDATED BY R T - P C R AND BY SEQUENCING ARE INDICATED IN V UNDER THE RESPECTIVE LANE; CANDIDATES NOT VALIDATED, BY X . NT: NEGATIVE CONTROL WITH NO R N A TEMPLATE; -RT: NEGATIVE CONTROL WITH NO REVERSE TRANSCRIPTASE 31 ix List of Abbreviations ^ cDNA complementary DNA CGAP Cancer Genome Anatomy Project DG dependency graph EST expressed sequence tag GLGI generating longer cDNA fragments from SAGE tags for gene identification H M M hidden Markov model MDD maximal dependence decomposition M G C Mammalian Genome Collection NCBI National Center for Biotechnology Information PHP PHP Hypertext Processor; a widely-used general-purpose scripting language for web development. P W M position weight matrix RefSeq Reference Sequence Project ROC Receiver Operating Characteristics RT-PCR Reverse Transcription Polymerase Chain Reaction SAGE serial analysis of gene expression snRNP small nuclear ribonucleoprotein TFBS Transcription Factor Binding Sites UCSC University of California Santa Cruz x Acknowledgement I would like to thank my academic supervisors, Drs. Elizabeth M. Simpson and Wyeth W. Wasserman, for providing the opportunity and guidance to work on this interesting project throughout my Masters. Under their guidance, I have learned how to conduct and present research, and learned to be self-motivated. I would also like to thank Drs. Steven J. Jones, Ojvind Johansson, and Asim Siddiqui for their helpful scientific discussions; Miss Ying Chen and Miss Slavita Bohacec for their assistance in the preparation and the execution of wet laboratory experiments; and Miss Tracey D. Weir and Miss Veronica Yakoleff for helpful comments on the manuscript. I would like to thank the members of the Simpson Laboratory: Kathleen Banks, Slavita Bohacec, Ying Chen, Rhonda Ellwyn, Candace E. Hofmann, Ravinesh A. Kumar, Lisa Lee, Catherine Van Raamsdonk, Tracey D. Weir, and Bibiana Wong; and the members of the Wasserman Laboratory: David Arenillas, Jochen Brumm, Alice Chou, Debra Fulton, Shannan J. Ho Sui, Carol Huang, Danielle Kemmer, Andrew Kwon, Jonathan Lim, Wynne Locke, Dora Pak, Elodie Portales-Casamar, Peter Sudmant, and Dimas Yusuf, for creating a friendly research environment. I would also like to thank the teams in the Mouse Atlas of Gene Expression Project for their support and encouragement. I greatly appreciate the financial support that was provided by the Canadian Institutes of Health Research (CIHR) and the Michael Smith Foundation for Health Research (MSFHR) Strategic Training Program in Bioinformatics. The Mouse Atlas of Gene Expression was sponsored by Genome Canada. Without these supports, this work would not have been possible. xi Finally, I would especially like to thank my family for their support and encouragement throughout my years of schooling, and church friends for their motivations. xii Co-Authorship Statement Miss Ying Chen performed RT-PCR and sequencing validations, and co-authored Section 2.4.11 RT-PCR and helped in the preparation of Figure 2-7 (B). Miss Slavita Bohacec assisted in the preparations of tissue samples for RT-PCR, and co-authored Section 2.4.10 RNA Extraction. Dr. Ojvind Johansson made intellectual contribution to the algorithm design. Drs. Elizabeth M. Simpson and Wyeth W. Wasserman supervised the project. xiii Chapter 1 Introduction 1.1 Gene Expression The focus of this thesis is on the exploration of the transcriptome. Understanding how genes are regulated and how they are expressed is a critical step toward comprehending the transcriptome. In a typical gene expression study, one often compares different tissues or cell types, either between the same tissues under different physiological conditions or time points, or between a diseased tissue and a normal tissue. In such studies, statistical and computational methods are used to extract a set of genes that are differentially expressed or that form interesting patterns for further biological investigations. 1 . 1 . 1 C u r r e n t T e c h n o l o g i e s o f G e n e E x p r e s s i o n Several technologies and their variants have been developed for gene expression experiments, including hybridization-based methods, such as microarrays, and sequencing-based methods, such as serial analysis of gene expression (SAGE) [1]. Technology based on hybridization methods, while often low in cost, requires prior knowledge of the genes being studied and the data are presented as relative levels of hybridization. In contrast, though often more expensive, sequencing-based methods, because they do not require prior knowledge of the genes being studied, offer the opportunity for the discovery of unknown transcripts. In addition, the expression levels are presented in absolute quantities. Both technologies have been intensively applied to the field of molecular biology, genomics, and medical studies, and have produced fruitful V 1 results in these fields. However, the advantage of SAGE for transcript discovery has made it the focus of this thesis. 1.1.2 S e r i a l A n a l y s i s o f G e n e E x p r e s s i o n SAGE offers high-throughput quantification and analysis of global gene expression patterns of a particular tissue. In this technology, a short nucleotide sequence, called a tag, is extracted from the 3' end of a transcript adjacent to the poly-A tail [1]. Due to modifications in SAGE protocols, a SAGE tag extracted in the original protocol is 14 bp; in LongSAGE [2], 21 bp; and in SuperSAGE [3], 26 bp. The SAGE technology relies on two basic principles. First, a short oligonucleotide sequence extracted from a position defined by a specific restriction endonuclease, the anchoring enzyme, typically Mal l l , uniquely identifies the specific mRNA transcript of origin. Second, the concatenation of each of these oligonucleotide sequences allows the tags to be detected during a sequencing process in an efficient manner [4, 5]. The SAGE tags analyzed in this project were collected by the Mouse Atlas of Gene Expression Project [6] and were extracted using the LongSAGE protocol. 1.2 The Mouse Atlas of Gene Expression Project Because of the high degree of genetic similarity to human, the mouse has emerged as a model organism for studying development and disease [7]. The Mouse Atlas of Gene Expression Project, funded by Genome Canada, aims to construct a comprehensive atlas of gene expression by using the SAGE method to explore the different stages of mouse development, from the single cell zygote to the adult. In the project, SAGE libraries are constructed for 200 tissues, often those enriched for specific cell types. In addition to 2 these SAGE libraries, the Atlas Project has developed an open source software, DiscoverySpace [8], to provide statistical and annotation tools for manipulating gene expression datasets, especially SAGE. The Mouse Atlas Project is a public resource for basic and clinical researches for the study of genetic pathways controlling development and disease. 1.3 SAGE Tag-to-Gene Mapping 1 . 3 . 1 M e t h o d s a n d P r o b l e m s For a particular tissue under a specific condition, the collection of SAGE tags and their frequencies is called.a SAGE library. The frequency of each tag reflects the abundance of its respective transcript. To analyze SAGE data, the transcript from which each tag is derived is identified, a process termed tag-to-gene mapping [9]. Technical details of tag-to-gene mapping are described in Chapter 2. As a sequencing-based method, SAGE is prone to sequencing errors and these errors affect the accuracy of tag-to-gene mapping. Furthermore, ambiguities also arise when a tag maps to multiple transcripts and when multiple tags map to the same transcript. Often assumptions have to be made and data cleaning is required to cope with such sequencing errors and ambiguities [10]. Tags are mapped to two types of resources, transcriptome databases and the genome. A tag that does not map to a known transcript but does map to the genome may indicate a potential novel transcript [2, 11]. Chen et al. [12] suggested that, in their study, 67% of tags that did not map to a transcript originated from novel transcripts. 3 1 . 3 . 2 T a g s S p a n n i n g a S p l i c e J u n c t i o n As a general rule, a tag that maps to a transcript will find a corresponding match in the genome of the respective organism. However, as will be described in Chapter 2, between 1.6 to 6.2% of tags span a splice junction, hence no match in the genome is observed. While the tags that map neither to the transcriptome nor to the genome may be artifacts, we hypothesize that these tags span previously uncharacterized splice junctions and represent a rich source for the discovery of novel transcripts. 1.4 Splice Junction Properties 1 . 4 . 1 I n t r o n s a n d E x o n s One of the major differences between eukaryotic and prokaryotic genes is the presence of introns and exons. Discovered by Sambrook in 1977 [13], eukaryotic genes consist of expressed sequences, the exons, and intervening sequences, the introns. During the transcription process, both the exons and the introns are transcribed to RNA. Through a processed called RNA splicing, the intron sequences are removed from the recently transcribed RNA sequence. The consequence of splicing produces a continuous sequence, which is consisted of only the exons and contains information for the translation of proteins. At the junction of exons and introns where the splicing reactions occur, a conservation of sequence pattern is observed. These patterns surrounding the splice junctions, which at the 5' end of the intron is called the donor and at the 3' end is called the acceptor, are conserved across genes and across species. The most invariant bases are the dinucleotides on each end of an intron flanking the splice junction. At the donor end, the bases are GU, and at the acceptor end AG (the GU-AG rule). An additional invariant 4 base is an A nucleotide situated in the central region of an intron. Other bases flanking the splice junctions are less conserved, but high frequencies are observed for certain nucleotides [14, 15]. 1 . 4 . 2 T h e S p l i c i n g R e a c t i o n Small ribonucleoprotein particles (snRNP), which are formed by complexes of protein and small nuclear R N A (snRNA), recognize the regions surrounding these invariant nucleotides. A group of snRNPs form the spliceosome, a functional unit that binds to the intron and subsequently catalyzes the splicing reaction and removes the intron. Through a transesterification reaction, one end of the intron is released from the junction and attaches to the invariant adenine nucleotide to form a lariat-like configuration. Subsequently, the lariat is released from the R N A and another transesterification reaction joins the two exons together. The splicing reactions take place in the nucleus and yield mRNA molecules from the precursor R N A [14, 15]. To ensure the accuracy of splicing, the sequences of the splice sites and the branch point are checked several times before the transesterification reactions are allowed to proceed. Nevertheless, splicing is a complex process. Stochastic events in splicing can result in unexpected forms of mRNA that serve no biological function. Furthermore, splicing errors, such as exon skipping and the use of splice sites that closely resemble true splice junctions, are often observed. [15]. These transcripts are produced sufficiently often to be detected by sensitive gene expression profiling techniques such as S A G E , and cannot be distinguished from functional transcripts based on sequence analysis. 5 1.5 Computational Gene Prediction 1 . 5 . 1 C u r r e n t A p p r o a c h e s f o r G e n e P r e d i c t i o n With the ever increasing availability of genomic sequences, computational approaches have been developed for predicting potential genes. Current approaches of in silico gene prediction use two methods: ab initio and homology-based [16, 17]. Ab initio gene predictions rely on DNA sequence signals and nucleotide composition. This is possible because signals such as transcription factor binding sites, promoters, and translation start and stop codons typically show a certain degree of sequence conservation. Moreover, certain base combinations are usually used more frequently in coding regions. A common step in ab initio prediction is the use of Hidden Markov Model (HMM) to assesses the probability of the observed nucleotide usage in an exon [16, 18]. Several tools have been developed based on ab initio search, including GENSCAN [19], GRAIL [20], GenelD [21, 22], and FGENES [23]. Conversely, homology-based methods use known sequences as a template and make predictions for sequences that are homologous to a known gene in another organism. It is assumed that sequences that are conserved have similarly conserved function, thereby similarity to known sequences may be strong evidence of functional sequences. Programs that are based on the similarity-based method have been developed, including TWINSCAN [24], an extension of GENSCAN; SGP-2 [25], which extends from GenelD; and SLAM [26]. Predictionsbased solely on signal and pattern recognitions have improved over the last decade, although the accuracy varies among algorithms and organisms. Conversely, although the use of known transcripts to annotate the genomic sequence may provide higher confidence, this technique can be limiting because it is possible that genes may not have a homologous sequence known in 6 other organisms. In this thesis, we developed an algorithm that combines the detection of sequence signals and the evidence offered by SAGE tags for the prediction of novel splice junctions. 1.5.2 Splice Junction Prediction Gene prediction in eukaryotic organism is more complicated than in prokaryotic organisms because of the presence of introns and exons. Therefore, the identification of signals that indicate candidate splice sites, exons, and introns is, a crucial element in the approach. An ab initio approach to predict exons generally attempts to detect four types of signals: the translation start site, the donor splice site, the acceptor splice site, and the translation stop codon [16]. For internal exons, certain nucleotides that code for specific amino acids are also used as a measure of evaluation. One of the earliest method for splice site prediction and evaluation was the use of position weight matrices (PWM), which evaluates splice site signals by detecting nucleotide usage at specific positions [27]. Statistical models that describe the dependencies between base positions have also been studied. The gene prediction software, GENSCAN, uses a decision tree method, maximal dependence decomposition (MDD), to predict splice junctions [28]. Cai et al. [29] applied Baysian networks to model splice sites. A recent study predicts splice sites with dependency graphs (DG) and their expanded Baysian networks [30]. The DG model was able to achieve >90% for both sensitivity and specificity. Because nucleotides flanking the splice junctions are conserved for spliceosome recognition, in this project we adopted the PWM method to assess the quality of predicted splice junctions. 7 1 . 5 . 3 P o s i t i o n W e i g h t M a t r i x For the detection of regulatory elements, such as transcription factor binding sites (TFBS), along a stretch of DNA sequences, a commonly applied method is the use of a motif model [31]. A consensus sequence pattern is often observed for a common family of TFBS. Each category of binding sites often has a fixed length and specific nucleotides are used at every position. In the motif model, by using a list of transcription factor binding sites, a matrix is built to indicate the frequency of nucleotide usage at every position. The frequency matrix is then converted to a PWM for evaluating the DNA sequence of interest. During the evaluation, the weights of nucleotides, according to the weight matrix, at each position of the sequence are summed. A pre-determined threshold value is used to decide whether or not the sequence under evaluation is a consensus binding site. The PWM method for identification of DNA binding sites is generally reliable and is able to detect more binding sites than is sequence alignment methods [31]. This prediction method, however, does suffer from a high number of false positives. The PWM evaluation method has been adopted for the detection of splice site signals [27, 32] because, similar to TFBS, the sequences flanking the donor and the acceptor splice junctions are specifically recognized and bound by spliceosomes that control the splicing reactions. As suggested by Burset et al, [32], the PWM method can be used to predict splice junctions and can be incorporated into gene prediction programs. For my project, I have chosen to use the PWM method to evaluate tags.that are predicted to span a splice junction because of its sensitivity to predict DNA binding sites. Tag sequences are additional evidence to support the splice junction predictions. 8 1.6 Overview of the Project Motivated by the the potential of transcript discovery, in this thesis project, we have mapped SAGE tags that were unassigned to a known transcript or to the genome. The frequency of SAGE tags that span a splice junction in a transcriptome database was investigated. An algorithm, SAGE2Splice, was developed to identify candidate splice junctions covered by SAGE tags. Tags are split into two portions, which we termed the edges, and mapped to the genome within a confined distance and satisfying splice junction sequence patterns. A web interface was developed to offer this new functionality to the online community (http:\/\/www.bcgsc.ca\/sage2splice). We tested the program with spliced tags, tags known to span a splice junction, to assess the sensitivity and the specificity, and to choose the parameters and parameter optimums for predicting candidate splice junctions. In addition, by using a different set of spliced tags, we determined that candidate tags having their predicted splice junction closer to the centre of the tag are more likely to be validated in an experiment. Using 20,000 unmapped tags taken from the Mouse Atlas of Gene Expression Project, SAGE2Splice predicted that 6% span a candidate splice junction. Twelve candidate junctions were selected, based on evidence of previously characterized exons (Type l) and computer predicted exons (Types 2 and 3), for laboratory testing using RT-PCR and sequencing, of which nine revealed novel transcripts. The results demonstrate that SAGE tags that map to neither the transcriptome nor to the genome are a rich source for the identification of novel transcripts. j 9 \/ 1.7 References 1. Velculescu VE, Zhang L, Vogelstein B, Kinzler KW: Serial analysis of gene expression. Science 1995, 270:484-487. 2. Saha S, Sparks AB, Rago C, Akmaev V, Wang CJ, Vogelstein B, Kinzler KW, Velculescu VE: Using the transcriptome to annotate the genome. Nat Biotechnol 2002, 20:508-512. 3. Matsumura H, Reich S, Ito A, Saitoh H, Kamoun S, Winter P, Kahl G, Reuter M, Kruger DH, Terauchi R: Gene expression analysis of plant host-pathogen interactions by SuperSAGE. Proc Natl Acad Sci USA 2003,100:15718-15723. 4. Madden SL, Wang CJ, Landes G: Serial analysis of gene expression: from gene discovery to target identification. Drug Discov Today 2000, 5:415-425. 5. Patino WD, Mian OY, Hwang PM: Serial analysis of gene expression: technical considerations and applications to cardiovascular biology. Circ Res 2002, 91:565-569. 6. Siddiqui AS, Khattra J, Delaney A, Zhao Y, Astell C, Asano J, Babakaiff R, Barber S, Beland J, Bohacec S, Brown-John M, Chand S, Chaters A M , Cullum R, Dhalla N, Featherstone R, Hirst M, Hoffman B, Holt R, Hou J, Kuo BY-L, Lee LLC, Lee S, Leung D, Ma K, Matsuno C, Mayo M, McDonald M, Prabhu A, Pandoh P, Ruis de Algara T, Rupert JL, Smailus D, Stott J, Tsai M, Varhol R, Vrljicak P, Wong D, Wu MK, Xie Y-Y, Yang G, Zhang I, Hirst M, Jones S, . Helgason CD, Simpson EM, Hoodless PA, Marra M: A Mouse Atlas of Gene Expression: Large-scale, digital gene expression profiles from precisely defined developing C57BL\/6J mouse tissues and cells. Submitted to Proceedings of the National Academy of Sciences. 7. Gregory SG, Sekhon M, Schein J, Zhao S, Osoegawa K, Scott CE, Evans RS, Burridge PW, Cox TV, Fox CA, Hutton RD, Mullenger IR, Phillips KJ, Smith J, Stalker J, Threadgold GJ, Birney E, Wylie K, Chinwalla A, Wallis J, Hillier L, Carter J, Gaige T, Jaeger S, Kremitzki C, Layman D, Maas J, McGrane R, Mead K, Walker R, Jones S, Smith M, Asano J, Bosdet'I, Chan S, Chittaranjan S, Chiu R, Fjell C, Fuhrmann D, Girn N, Gray C, Guin R, Hsiao L, Krzywinski M, Kutsche R, Lee SS, Mathewson C, McLeavy C, Messervier S, Ness S, Pandoh P, Prabhu AL, Saeedi P, Smailus D, Spence L, Stott J, Taylor S, Terpstra W, Tsai M, Vardy J, Wye N, Yang G, Shatsman S, Ayodeji B, Geer K, Tsegaye G, Shvartsbeyn A, Gebregeorgis E, Krol M, Russell D, Overton L, Malek JA, Holmes M, Heaney M, Shetty J, Feldblyum T, Nierman WC, Catanese JJ, Hubbard T, Waterston RH, Rogers J, de Jong PJ, Fraser CM, Marra M, McPherson JD, Bentley DR: A physical map of the mouse genome. Nature 2002, 418:743-750. 10 8. Varhol R, Robertson N, Oveisi-Fordorei M, Fiell C, Leung D, Siddiqui AS, Marra M, Jone S: DiscoverySpace: A tool for gene expression analysis and biological discovery. Poster 2005. 9. Pleasance ED, Marra MA, Jones SJ: Assessment of SAGE in transcript identification. Genome Res 2003,13:1203-1215. 10. Ng RT, Sander J, Sleumer MC: Hierarchical Cluster Analysis of SAGE Data for Cancer Profiling. BIOKDD01: Workshop on Data Mining in Bioinformatics (with SIGKDD01 conference) 2001:65-72. 11. Gorski SM, Chittaranjan S, Pleasance ED, Freeman JD, Anderson CL, Varhol RJ, Coughlin SM, Zuyderduyn SD, Jones SJ, Marra MA: A SAGE approach to discovery of genes involved in autophagic cell death. Curr Biol 2003,13:358-363. 12. Chen J, Sun M, Lee S, Zhou G, Rowley JD, Wang SM: Identifying novel transcripts and novel genes in the human genome by using novel SAGE tags. Proc Natl Acad Sci USA 2002, 99:12257-12262. 13. Sam brook J: Adenovirus amazes at Cold Spring Harbor. Nature 1977, 268:101-104. 14. Griffiths AJF: Modern genetic analysis : integrating genes and genomes, 2nd edn. New York: W.H. Freeman; 2002. 15. Alberts B: Molecular biology of the cell, 4th edn. New York: Garland Science; 2002. 16. Baxevanis AD, Ouellette BFF: Bioinformatics : a practical guide to the analysis of genes and proteins, 3rd edn. Hoboken, N.J.: John Wiley; 2005. 17. Guigo R: Computational gene identification. J Mol Med 1997, 75:389-393. 18. Durbin R: Biological sequence analysis : probalistic models of proteins and nucleic acids. Cambridge, UK New York: Cambridge University Press; 1998. 19. Burge C, Karlin S: Prediction of complete gene structures in human genomic DNA. J Mol Biol 1997, 268:78-94. 20. Uberbacher EC, Mural RJ: Locating protein-coding regions in human DNA sequences by a multiple sensor-neural network approach. Proc Natl Acad Sci USA 1991,88:11261-11265. 21. Parra G, Blanco E, Guigo R: GenelD in Drosophila. Genome Res 2000, 10:511 -515. 11 22. Guigo R, Knudsen S, Drake N, Smith T: Predict ion of gene structure. J Mol 5\/0\/ 1992,226:141-157. 23. Solovyev VV, Salamov AA, Lawrence CB: Identification of human gene structure using linear discriminant functions and dynamic programming . Proc Int Conflntell Syst Mol Biol 1995, 3:367-375. 24. Korf I, Flicek P, Duan D, Brent MR: Integrating genomic homology into gene structure prediction. Bioinformatics 2001, 17 Suppl LS140-148. 25. Parra G, Agarwal P, Abril JF, Wiehe T, Fickett JW, Guigo R: Comparat ive gene prediction in human and mouse. Genome Res 2003, 13:108-117. 26. Alexandersson M, Cawley S, Pachter L: S L A M : cross-species gene finding and alignment with a generalized pair hidden M a r k o v model. Genome Res 2003, 13:496-502. 27. Staden R: C o m p u t e r methods to locate signals in nucleic acid sequences. Nucleic Acids Res 1984, 12:505-519. 28. Brunak S, Engelbrecht J, Knudsen S: Predict ion of human m R N A donor and acceptor sites from the D N A sequence. J Mol Biol 1991, 220:49-65. 29. Cai D, Delcher A, Kao B, Kasif S: Mode l ing splice sites with Bayes networks. Bioinformatics 2000,16:152-158. 30. Chen TM, Lu CC, Li WH: Prediction of splice sites with dependency graphs and their expanded bayesian networks. Bioinformatics 2005, 21:471-482. 31. Stormo GD: D N A binding sites: representation and discovery. Bioinformatics 2000,16:16-23. 32. Burset M, Seledtsov IA, Solovyev VV: Analysis of canonical and non-canonical splice sites in mammal ian genomes. Nucleic Acids Res 2000, 28:4364-4375. 12 Chapter 2 SAGE2Splice: Unmapped SAGE Tags Reveal Novel Splice Junctions1 2.1 Introduction The complexity of the transcriptome is significantly greater than that of the genome due to alternative splicing. It is estimated that between 35-65% of human genes are alternatively spliced [1,2]. The slo gene, for example, is estimated to produce more than 500 distinct transcripts, which regulate various responses of the hair cells of the inner ear to sound [3]. Identification of the transcripts present within a cell can provide insights into the regulatory processes that control the cell-specific interpretation of the genome [4]. Serial analysis of gene expression (SAGE), in which a representative tag (14 to 26 bp) is excised from each transcript, is a powerful and efficient technology for high-throughput qualitative and quantitative profiling of global transcript expression patterns [5]. SAGE quantitatively measures transcript levels, providing the absolute number of each transcript-specific tag within a library of all tags. That no prior knowledge of the transcripts being studied is required makes SAGE advantageous over array-based methods for the discovery of novel transcripts [6-11]. An essential step in the analysis of SAGE data is the assignment of each tag to the transcript from which it was derived [10]. This process, termed tag-to-gene mapping, involves comparison of tag sequences to transcript databases. A commonly used ' A version of this chapter has been submitted for publication. Byron Yu-Lin Kuo, Ying Chen, Slavita Bohacec, Ojvind Johansson, Wyeth W. Wasserman, and Elizabeth M. Simpson. (2005) SAGE2Splice: Unmapped SAGE Tags Reveal Novel Splice Junctions. Sumitted to PLoS Computational Biology. 13 technique is to compare SAGE tags to predicted tags (also known as virtual tags). Based on known transcript sequences, predicted tags are those expected to be generated by a SAGE protocol [12], Often, the predicted tags closest to the 3' end of transcripts are emphasized, as SAGE protocols impart a location bias. However, in a SAGE experiment, due to alternative splicing or incomplete enzyme digestion [13, 14], tags can be excised from other positions. The choice of sequence databases impacts the quality of tag-to-gene mapping [10]. A highly curated and more complete transcriptome database not only facilitates mapping of more tags, but also increases confidence in the mappings. Many resources have been developed for mapping SAGE tags to genes, including NCBI's SAGEmap [15], CGAP's SAGE Genie [16], the Mouse SAGE Site [17], Identitag [12],1 and DiscoverySpace (personal communication, Steven J. Jones, British Columbia Cancer Agency, Vancouver, Canada). Despite these efforts, however, a major problem of tag-to-gene mapping exists as ~ 1\/3 of the tags is unmapped. Inability to map tags limits the information obtained in SAGE studies [6, 7, 10]. The identification of unmapped tags remains an active research topic in SAGE analysis. Recent studies have attempted to map SAGE tags that did not match the known transcriptome. Chen et al. [18] studied 1,000 unmapped SAGE tags from publicly available libraries by generating longer cDNA fragments from SAGE tags for gene identification (GLGI), and concluded that 67% of the unmapped tags originated from novel transcripts. In an analysis of unmapped long SAGE tags (21 bp), Saha et al. [19] predicted 60% were from transcripts of novel genes and 40% were from unidentified internal exons of predicted genes. Gorski et al. [8] identified 225 cases of genes, that 14 previously had been unidentified by gene prediction programs. Each of these studies affirmed the capacity of SAGE profiling to facilitate identification of novel transcripts. Tags that do not map to the trariscriptome or to the genome may span adjacent exons of which one or both were previously unidentified [8]. We analyzed predicted tags that had been derived from known transcripts and observed between 2 to 6% of these tags span a splice junction. Thus, even tags that do not map to the genome are anticipated to be a resource for the discovery of novel transcripts. To test our hypothesis, we developed an algorithm, SAGE2Splice, for mapping tags to potential splice junctions in a genome. Applying this new method for tag-to-gene mapping, we demonstrated that 6% of unmapped tags span candidate splice junctions. By using high sensitivity and high specificity parameters, we identified 3,458 candidate junctions for 1,212 tags from a collection of 20,000 high quality unmapped SAGE tags. Nine out of the twelve tested tag mappings were validated by RT-PCR. 15 2.2 Results 2.2.1 S o m e P r e d i c t e d S A G E T a g s S p a n a S p l i c e J u n c t i o n We defined four distinct types of spliced tags, tags that span a splice junction (Figure 2-1). A Type 0 tag matches portions of two exons at a known splice junction. Type 0 tags were identified by mapping to known transcripts. A Type J tag also spans two known exons, but the junction is not present in the transcriptome databases. A Type 2 tag spans a previously known exon and a previously unknown exon. Both Type 1 and Type 2 tags indicate a novel transcript of a previously characterized gene. A Type 3 tag spans two previously unknown exons and indicates either two novel exons of a characterized gene, or two exons of a novel gene. rx: Gfi i Type 0 (Maps to Known Transcript) Known Exons, Known Junction Type 1 (Novel Transcript) Known Exons, Novel Junction Type 2 (Novel Transcript) One Novel Exon, Novel Junction 2 3 I ! 2 4 ~ \u2022 I 3a F_ 4 I .- ~ \u2014 - . T y p e 3 (Novel Transcript or Novel Gene) 1 Two Novel Exons, Novel Junction Figure 2-1: Tags that span a splice junction may reveal novel genes or novel transcripts. This schematic demonstrates four known exons (1, 2, 3, and 4, boxes in solid lines). The 3'-most 7VMII enzyme restriction site (represented as ~) lies near the 3' edge of exon 2 and a known predicted SAGK tag ( \u2022 \u2022 ) spans exons 2 and 3 (Type 0 tag). Predicted exons (boxes in dashed line) 3a and 3b are examples of exons predicted by SAGE2Splice. Three other types of tags (Types 1 to 3) have been defined as potential candidates in SAGE2Splice predictions. Tag portions arising from known exons (BI), whereas tag portions arising from novel exons ( ). Solid lines connecting exons indicate known combinations, whereas dashed lines indicate unknown combinations. To determine the portion of predicted tags that span splice junctions of known transcripts, we studied RefSeq sequences. From 17,848 sequences studied, 198,419 16 predicted tags were extracted based on the identification of all MoIII restriction sites. One hundred and Ninety-three RefSeq sequences (approximately 1.08%) did not contain a Ma l l l restriction site, and thus, were unable to give rise to a SAGE tag. Among the predicted tags, 12,297 (6.2%) overlapped a splice junction (Type 0). In addition, 14 predicted tags traversed two splice junctions (Table 2-1). These were due to very small exons [20], between 1 bp to 4 bp in length. Since the SAGE technique excises tags from the Nlalll restriction site closest to the 3' end of transcripts; from the RefSeq sequences, 17,655 predicted tags were extracted from the 3'-most position and investigated. Among these predicted tags, only 292 (1.6%) were Type 0. The different Type 0 frequencies between the all-position set and the 3'-most set reflects that exons are generally longer at the 3'^ end of a transcript [20]. In the analyzed RefSeq sequences, the average length of all exons was 262 bp, whereas the average for all 3'-most exons was 1,068 bp. Hence, at the 3'-most position, the probability of finding a splice junction within a tag is lower than that from the set of all M a l l l positions. Table 2-1: 6.2% of predicted tags from all \/VMII restriction sites, and 1.6% from 3'-most sites were found to span a known splice junction (Type 0 tags). Tag Position Number of Predicted Tags' Number of Type 0 Tags Number of Tags Spanning Multiple Junctions All Mal l l 3'-most W\/alll 198,419 17,655 12,301 (6.2%) 283 (1.6%) 14 1 ' Curated RefSeq cDNA collection was analyzed to detect Malll restriction sites and the downstream 17 bp sequences (predicted SAGE tags). Predicted tags were extracted from UCSC Annotation Database (July 16, 2004). 17 2.2.2 I n t r o n P r o p e r t i e s In our development of SAGE2Splice, an important search criterion was to determine the maximum length the algorithm should allow for candidate introns. Previous studies have shown that, although a typical intron is 40-125 bp in length, the average length is approximately 1,000 bp because the sizes of introns vary over a very wide range [20, 21]. In our studies of the RefGene annotations, we confirmed that within the known splice junctions, introns vary from 6 to 1,195,292 bp in length, with a median of 1,271 bp (Figure 2-2). Ninety percent of introns were smaller than 10,000 bp and 95% were smaller than 20,000 bp. We incorporated 10,000 bp as the default for maximum intron size in the search for candidate splice junctions. Score (AU) Score (AU) Figure 2-2: Length and boundary nucleotides of introns are important properties for detecting a splice junction. (A) Less than 10% of introns in RefGene annotation were greater than 10,000 bp in length. (B) and (C) a position weight matrix (PWM) for splice junctions was applied to true splice junctions defined by RefGene annotations and to randomly selected genome sequences containing the canonical dinucleotide pair at the appropriate position. The scores, which were computed based on the profile model, for donors and acceptors were plotted and showed that true splice junctions acquired high scores. The information content and the relative frequency of nucleotides at each position are measured in bits (vertical axis of the sequence logo diagrams) to indicate the strength of signals. Two bits of information are required to determine the content of a DNA sequence. AU: arbitrary units. 18 To gain a more detailed understanding of the sequence patterns of splice junctions, we examined 10 bp flanking each side of the donor junctions and 10 bp flanking each side of the acceptor junctions. For each junction type, we constructed a matrix representing the frequency of each nucleotide at each position. Position weight matrices (PWM) were constructed by converting the frequencies into scores relative to the expected frequency of a randomly selected nucleotide (see Materials and Methods). By using these scoring matrices, we generated genuine score distributions for true splice junctions in RefSeq and empirical score distributions for randomly selected sequences from the genome. By superimposing the genuine distribution on the empirical distribution, it was shown that genuine splice junctions typically had high scores and were located on the far right end of the empirical curve (Figure 2-2). Hence, we incorporated these properties into our SAGE2Splice algorithm for ranking and determining the likelihood of candidates. 2 . 2 . 3 T h e S A G E 2 S p l i c e A l g o r i t h m 2.2.3.1 Pre-processing the Input SAGE Tags In a 21-bp SAGE tag, if a splice junction exists within the sequence, one of the two portions is no shorter than 11 bp in length. Each 21-bp tag is therefore split into two equal portions of 11 bp (overlapping by one bp), which are used as search strings simultaneously. We term these equal-sized portions as the halftags. Prior to a search, complementary sequences for the halftags were constructed because genes can be located on either strand of the genome. The program reads the sequences of each chromosome one segment of 100,000 bp at a time. To perform a complete search, the algorithm holds 19 three such segments in memory at any one time: the previous segment, the current segment, and the next segment. Searching for a candidate splice junction in S AGE2Splice consists of three progressive levels (Figure 2-3). At each level, only if the defined matching criteria are fulfilled will the algorithm proceed to the next level. Otherwise, the algorithm imports a new segment of the genome into memory, and the search starts over from the first level. 20 Genome 100,000 bp Genomic Segment S A G E Tag U halftags} Identify matches for each halftag in genomic sequence Search Level 1 CATGAGCMTT CAGGTCAGGCCAGCATGAGCAATTCCTGTCAGATTAGGA A G -For a match, extend to putative splice site and seek the remaining portion More Halftag matches Go to next halftag match Search Level 2 CATGAGCAATTCCI Donor Dinucleotide CAGGTCAGGCCAGCATGAGCAATTCCTGfcAGATTAGGA I Hi\/ Search Level 3 CATGAGCAATTCCT Acceptor Dinucleotide AGCATGAGCAATTCCTGKAG GGCAGGACAATAGC \u2022>\u2022 Output observed candidates All Halftag Matches Finished More tags Go to next tag More genome sequence Go to next segment All tags Finished Legend Main recognition site (CATG) Genomic Segment SAGE Tag Halftags Complementary Halftags Figure 2-3: SAGE2Splice algorithm searches the genome for novel splice junctions. By splitting each tag into 2 halftags and making complementary copies, the algorithm searches for candidate splice junctions against continuous segments of the genome in three progressive steps. After each level, if the matching criteria were fulfilled, the algorithm would go on to the next level. If criteria were not fulfilled, the algorithm would analyze the next tag. Once all tags have been analyzed, the next genomic segment is read and the algorithm returns to the first level. 21 2.2.3.2 Search Level 1: Matching Halftags In Search Level 1, SAGE2Splice searches each halftag against the current segment by using the pattern-matching function built into the Perl programming language (version 5.6). Positions of all matches are stored as a tab-delimited string. A complementary halftag match, indicating a position on the complementary strand, is stored as a negative position. If at least one halftag match is found, the algorithm proceeds to Search Level 2. Otherwise, the next segment of the chromosome is imported and the search for candidate splice junctions returns to Search Level 1.' 2.2.3.3 Search Level 2: Extending Halftags SAGE2Splice searches for one boundary of a potential candidate intron before searching for the other boundary. During Search Level 2, SAGE2Splice attempts to find, for each halftag match, one of the edges of a potential intron. From Search Level 1, a 5' halftag match to the genomic segment indicates a search of a potential donor intron-exon boundary in Search Level 2. Conversely, a 3' halftag match suggests a search for the acceptor boundary. Hence, in the second level, the SAGE2Splice algorithm extends the first level halftag match, base-by-base against the original tag. At every base extension, depending on whether or not the halftag match is 5' or 3', the respective intron boundary dinucleotide is added and matched to the genome segment. As a result, all potential candidates for one edge of an intron are discovered for every halftag match. For the 5' halftag match, the extension is toward the 3' end and the donor dinucleotide is GT, whereas for the 3' halftag match, the extension is toward the 5' end and the acceptor dinucleotide is AG. A match of the complementary halftags indicates a potential 22 candidate on the complementary strand of the genome sequence and, thus, the base extension direction is opposite that of the sense strand. If a potential intron-exon boundary is found, the algorithm continues to Search Level 3. Otherwise, SAGE2Splice reads the next genomic segment and returns to Search Level 1. 2.2.3.4 Search Level 3: Searching Remaining Portions In Search Level 3, the remaining tag portion for the corresponding candidate splice junction is sought within 10,000 bp, or a maximum distance set by the user. If the preceding level found a candidate donor junction, the search looks for candidate acceptor junctions with the conserved dinucleotide, AG, toward the 3' direction, in accord with the definition of splice junctions [21]. If, on the other hand, the previous search returned a candidate acceptor junction, the search for candidate donors is toward the 5' direction and the conserved dinucleotide is GT. Searches for the remaining tag portions for the complementary halftag are in the opposite direction. When a candidate splice junction is returned, the algorithm proceeds to scoring and ranking the candidate. Because a match in Search Level 1 could be close to the edges of the current genomic segment, having the previous and the next segments in memory allows for potential matches located beyond the current segment. If, however, Search Level 3 does not return a candidate splice junction, the search returns to Search Level 1 to start on a new segment of the chromosome. 2 . 2 . 4 S c o r i n g C a n d i d a t e S p l i c e J u n c t i o n s Once a candidate is discovered and returned by Search Level 3, for both the donor and the acceptor, 10 bp flanking each side of the boundary are extracted and evaluated 23 using the respective PWM. Probability values (p-values) are generated by comparing the observed scores against empirical score distributions. For a tag that matches multiple candidates, SAGE2Splice ranks the candidates according to the composite p-value. After this process, SAGE2Splice returns for each candidate the following information to the user: the chromosome number; the two tag portions with their positions, scores, and p-values; the composite p-value; and the predicted intron length. 2 . 2 . 5 E f f i c i e n c y T u n i n g of S A G E 2 S p l i c e Five parameters affect the performance of SAGE2Splice, including the number of SAGE tags in the search, the length of SAGE tags, the cutoffs for p-values, the cutoff for maximum intron length, and the length of genomic segment in memory. Other than the length of genomic segment in memory, all factors depend on either the input SAGE tags or user-specified parameters. We investigated the use of genomic segments of different lengths to fine-tune SAGE2Splice for best performance (Figure 2-4). The total execution time of SAGE2Splice decreased until it reached a segment size of 100,000 bp, and linearly increased thereafter. 100 200300 400 500 600 700 8009001000 Segment Size (kb) Figure 2-4: SAGE2Splice was optimized for processing time by using different genomic segment lengths (ranging from 10 kb to 1000 kb). For SAGE2Splice performance, 100 kb was determined as the optimal size. 24 2 . 2 . 6 S e n s i t i v i t y a n d S p e c i f i c i t y To test the accuracy of SAGE2Splice and determine the optimal parameter settings, we investigated the sensitivity and the specificity for various p-value cutoffs, ranging from 0.00001 to 1. The receiver operating characteristic (ROC) curve demonstrates a tradeoff between sensitivity and specificity (Figure 2-5). As we varied the overall p-value cutoffs, it was observed that to achieve a specificity of close to 95%, sensitivity dropped to 55%. The ROC curve shows that, although SAGE2Splice can achieve high sensitivity, specificity suffers dramatically at such settings. Moreover, the positive predictive value, which indicates the proportion of the candidates that are true positives, decreases as the p-value cutoffs increase (Figure 2-5). Such results correspond to previous studies [22, 23] that showed that true splice junctions acquire high profile scores in the evaluation scheme and, thus, candidates with lower p-values are more likely to be true. In the ROC curve, the point with the minimum number of misclassified candidates (defined by a tangent line for-which the slope equals 1) occurs when the composite p-value cutoff is approximately 0.0025, leading to a sensitivity (true positive rate) of 0.9 and a specificity of 0.82 (false positive rate = 0.18) (Figure 2-5). Similarly, separate analyses of the donor junction and the acceptor junction revealed the optimal cutoffs to be 0.06 and 0.15, respectively. 25 False Positive Rate (1 - Specificity) 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 False Positive Rate (1 - Specificity) C D 0 0 1 0.2 0.3 0.4 0.5 0.6 07 0.8 0.9 1 p-Value Cutoff 0 0.1 0.2 03 0.4 0.5 0.6 07 0.8 09 1 False Positive Rate (1 - Specificity) Figure 2-5: SAGE2Splice achieves high sensitivity but relatively low specificity. (A) The area under the receiver operating characteristics (ROC) curve is 0.9232, indicating a candidate found by SAGE2Splice was much better than expected by random chance. Conversely, to achieve high specificity, the sensitivity (true positive rate) was significantly compromised. The tangent point of the dashed line is the optimal point when the costs of misclassifying positive and negative candidates are equal. This point corresponds to a p-value cutoff of 0.0025. (B) Analysis of the ROC curve for the donor splice junctions indicates a cutoff p-value of 0.06 as the optimal point. (C) For the acceptor splice junctions, the optimal cutoff p-value is determined to be 0.15. (D) The positive predictive value indicates that a high probability (greater than 0.9) of correct predictions requires a restrictive p-value (less than 0.0001). 2 . 2 . 7 E d g e L e n g t h a n d R a n k A n a l y s i s To analyze the relationship between search accuracy and the position of a splice junction within a junction-spanning tag, we obtained EST transcript annotations from the UCSC Genome Browser and extracted Type 0 predicted tags that had GT and AG for the donor and acceptor boundary dinucleotides. respectively, and had introns between 50 bp (minimum imposed to avoid gaps in annotation) and 10,000 bp in length. Among the 26 200,000 unmapped SAGE tags in the Mouse Atlas of Gene Expression Project (detailed below) [24], 261 such tags, which did not map to RefSeq, Ensembl, MGC, or the mouse genome, were found to match these EST predicted tags. These 261 tags are distinct from the transcript dataset used in initial parameter selection and junction profile model building, thus providing an independent test set. For each splice junction position within the tags, the percentage of tags correctly mapped by using the optimal p-value cutoff values was determined (Figure 2-6). As illustrated, a minimum length of 5 bp for the shorter edge produces reliable predictions. In many cases, a laboratory researcher is prepared to test multiple candidate predictions. Therefore, we investigated, for each length, the number of top ranking candidates required to detect a true junction (Figure 2-6). The closer a splice junction is to the centre of the tag, the fewer candidates are required to find a validated result. For each tag, by testing the candidate with the lowest p-value, investigators can expect 90% of tags to be mapped successfully, if the junction is at least 5 bp from the edge of the tag. A B Shorter Edge Length (bp) Number of Top Candidates Figure 2-6: The probability of finding the true splice junction is lower if the splice junction is located closer to the edge of a tag. By using the unmapped tags in the Mouse Atlas Project that map to spliced tags predicted from EST transcripts, the percentage of true splice junctions found was analyzed for each short edge length. (A) By using high specificity parameters (cutoffs of 0.06,0.15, and 0.25 for donor, acceptor, and composite p-values, respectively), 93% of the true splice junctions were found when the shorter edge is >5 bp in length. (B) With no p-value cutoffs, 90% of the true splice junctions were found with the top-ranked p-value when the shorter edge is 5 bp in length. 27 2 . 2 . 8 U n m a p p e d T a g S e a r c h R e s u l t s Exhaustive mapping of the SAGE tags in the Mouse Atlas of Gene Expression project [24] resulted in 200,000 unmapped tags. From these unmapped tags, SAGE2Splice was applied to 20,000 of the highest quality SAGE tags from this set. (see Materials and Methods). There were 7,757 splice junction candidates (0.38785 per tag) found to fulfill the p-value thresholds of 0.06, 0.15, and 0.0025 for the donor, the acceptor, and overall, respectively (maximum intron length was set at 10,000 bp). Among the 1, 639 (8.2%) tags that were found to have candidate junctions, we observed that a few tags mapped to multiple candidate sites. Among the 20,000 SAGE tags in the search, six returned more than 100 candidate junctions, 90 returned between 10 and 100 candidates, 113 returned between 5 and 10 candidates, 271 returned 2 candidates, 939 returned 1 candidate, and 18,361 matched no candidate. Perl scripts were written to computationally classify the candidates into tag types. Based on matching both donor and acceptor positions to the UCSC annotation databases, 15 candidate junctions corresponded to Type 1 tags. There were 803 junctions, corresponding to Type 2 tags, for which either only the donor position or only the acceptor position matched a known exon. The remaining 6,939 candidate junctions matched no known exons and were associated with Type 3 tags. By mapping candidates corresponding to Type 2 and Type 3 tags to exons predicted by GenScan, TwinScan, or SGP, five candidates that matched Type 2 tags and three candidates that matched Type 3 tags were further categorized as prediction supported. Based on RNA sample availability, we picked eight candidates from the Type 1 category, two candidates from the Type 2 category, and two candidates from the Type 3 category for RT-PCR testing (Table 2-2). 28 Table 2-2: Twelve candidates were selected for RT-PCR validation. ID' Chr Donor Match Posrtion Acceptor Match Acceptor Position Intron Size Composite Gene p-Value* Name 3 RT-PCR Validation\/ Accession Number4 1-1 1 C A T G G T G A A G C T C G C A A A G 86244556 GA 86238632 5924 2.2 E -06 Ncl X ND 1-2 1 C A T G G T G A A G C T C G C A A A G 86244556 GA 86240496 4060 2.2 E -05 Ncl X ND 1-3 4 C A T G T A G T G T T T G 117657859 A A T G T T C C 117656489 1370 9.2 E -05 Ppih DQ113644 1-4 5 C A T G T C C C T C A A G 126140225 G T G T T C T C 126134146 6079 1.6 E -05 AK081926 DQ113645 s 1-5 10 C A T G A G A G C G A A G 128675985 G C T G A A G C 128675467 518 5.3 E -06 Rpl41 DQ113647 1-6 14 C A T G 20780218 C C A A A G G A G T A G A T C T G 20785233 5015 4.9 E -05 Rps24 X ND 1-7 19 C A T G C G A G C T G 6710208 G C A T T C G T C C 6711938 1730 9.6 E -06 Tptlh v ' DQ113648 1-8 X C A T G 124592868 G A A A G C G G C G T T A C G A C 124593658 790 6.5 E -06 Rpl136a DQ113649 2-1 4 C A T G 132062103 G A G G A C A C T T G T C A G G A 132060011 2092 2.0 E -05 C c s DQ113650 2-2 11 C A T G C A G G G T G A T G 75371984 A T T C C T A 75375252 3268 3.7 E -04 Ywhae DQ113651 3-1 4 C A T G C C C A G 135998365 G T C C A C G G C T C C 135998673 308 3.0 E -04 S2SEMS1 < \u2022 DQ113652 3-2 13 C A T G G A C A T 111936186 A T T C C T T T T G C C 111933949 2237 2.5 E -04 S2SEMS2 DQ113653 1 The first digit of the ID indicates the type of tag. The second digit is a sequential number. 2 A Composite p-value was computed as the product of the donor p-value and the acceptor p-value. 3 All selected candidates fulfill cutoffs of 0.06, 0.15, and 0.25 for donor, acceptor, and composite p-values. Gene Ontology names were assigned to Types 1 and 2 candidates. Candidate 1-4 did not match to a characterized gene. Accession number of the matched mRNA transcript was assigned. Gene names for candidates 3-1 and 3-2 were assigned by this project. 4 \" \/ , as predicted; X, not as predicted; ND, not done. For sequences that corresponded to the predicted transcript, a GenBank Accession number is assigned. 5 Candidate 1-4 generated two strong RT-PCR bands, one an unpredicted novel transcript (DQ113646). 2 . 2 . 9 C a n d i d a t e V a l i d a t i o n For the selected candidates, primers were designed based on the contiguous exons predicted by SAGE2Splice (Table 2-3). RT-PCR results showed that nine of the twelve tested candidates generated products of the predicted length (Figure 2-7). The other three candidates produced bands that were larger than expected. The latter were candidates that had their splice junctions located close to the edges of the SAGE tags. However, 2 of the 9 candidates did have the correct band sizes, even though they had their splice junction located only 4 bp away from the tag edge. Sequencing results of the RT-PCR products matched the expected sequences. Two strong bands were observed for candidate 1-4, one 29 that matched the size of the expected length (221 bp) and the other one larger (361 bp). Sequence of the expected band corresponded to the novel alternative combination predicted; sequence of the larger product revealed an unpredicted, previously unidentified alternative transcript of the same gene. Unpredicted larger bands were also observed for candidates 1-7 and 1-8 (306 bp and 197 bp, respectively) and corresponded to known transcripts. Table 2-3: RT-PCR primers were designed for the selected candidates based on sequences of the two predicted exons. ID Tissue Forward Primer (name) Reverse Primer (name) Product Size bp B-actin All tissues used GCATGGGTCAGAAGGAT (OEMS1507) CCAATGGTGATGACCTG (OEMS1508) 615 1-1 P84 Days Visual Cortex TGAGCTCTTCCGAGCTGCT (OEMS2184) GTGAAACAGATCGTCCATCAA (OEMS2185) i 165 1-2 P84 Days Visual Cortex TGAGCTCTTCCGAGCTGCT (OEMS2184) T G C C A A A C A C T T T T A A A C C A G (OEMS2186) 153 1-3 E11.5 Days Whole Head CAAACAGTGGTCCCAGTACAA (OEMS2156) GCCTGTGGGAACATTCAAA (OEMS2157) 102 1-4 P27 Days Visual Cortex AAGGAAGATGGCGAAGACAGT (OEMS2152) AGGGGAGGCTCATCTTCTGAA (OEMS2153) 215 1-5 E11.5 Days Whole Head CATGAGAGCGAAGGCTGAA (OEMS1650) TGAGACTCATTACCGATGGCA (OEMS2149) 157 1-6 P84 Days Visual Cortex TGCGCGTTGATATGATTGGT (OEMS2176) GCAGACGTGTAGGAGCTTTTT (OEMS2177) 168 1-7 1-8 P84 Days Hypothalamus P84 Days Visual Cortex CCGAAATGTGCAGCTGTCTAA (OEMS2160) GCTCCTGCGAACATGGAAA (OEMS2180) TAGGGGTCCATCGATGAACA (OEMS2161) TTGCGGAAAATAGGCTTAGTC (OEHS2181) 127 \u00b0 79 2-1 P20 Days Visual Cortex A T C A C C A A C T G C T G T G C T G T G (OEMS2168) ' AGATGGCAAAGTCCTGACAA (OEMS2169) 172 2-2 E17.5 Days Skeletal Muscle AGCAGCTTTTGATGACGCAA (OEMS2164) T T A G G A A T C A T C A C C C T G C A (OEMS2165) 136 3-1 P21 Days Uterus A T A G A A T C C T C G T C G C C A T C (OEMS2174) ACAACAATGGAAGCCTCCTT (OEMS2175) 233 3-2 P42 Days Visual Cortex CCGTGAGAGTGACTTTGGATT (OEMS2172) AACCACTGTCCGGGTGTTGTA (OEMS2173) 263 30 A Predictions 1-1 C h n Nc l .. - - _ 1-2 C h n Nc l 1-3 C h r 4 P p i h %-4 C h r 5 A K 0 8 1 9 2 6 1-5 C h r 1 0 Rp l41 \u2022 _ - - ~ - - _ \u2022 \u2014 r r K : ^ r ~ 3 ~ ~ r ^ 4~n\u2014 1-6 C h r 1 4 R p s 2 4 \u201e - - \" - \u2022 . _ 1-7 C h r 1 9 T p t l h _\u2022 , - - \" ' ~ - - \u2022 \u2014 r ~ p ~ K - ^ ^ r~3~k^7i 4 k ^ m \u2014 1-8 C h r X R p l 1 3 6 a 2-1 C h r 4 C c s JED--2-2 C h r u Y w h a e \u2022 1 5 -iVsiL'J -L'.sa\".1\u2014 3-1 C h r 4 S 2 S E M S 1 - - T \" a ~ L = - *\"h\" U \u2022 3-2 C h r 1 3 S 2 S E M S 2 \u2022 Predicled \u2022 I HQ portion on annotated exon jt Tag poriiori on predicted exon B Validation # \u00a3 # OJ Ojv OJ 5 \u00a3 8 v -P g \u00a3 <\u00b0
* ^ * \u00ab \u00ab \u00ab i > r i