{"@context":{"@language":"en","Affiliation":"http:\/\/vivoweb.org\/ontology\/core#departmentOrSchool","AggregatedSourceRepository":"http:\/\/www.europeana.eu\/schemas\/edm\/dataProvider","Campus":"https:\/\/open.library.ubc.ca\/terms#degreeCampus","Creator":"http:\/\/purl.org\/dc\/terms\/creator","DateAvailable":"http:\/\/purl.org\/dc\/terms\/issued","DateIssued":"http:\/\/purl.org\/dc\/terms\/issued","Degree":"http:\/\/vivoweb.org\/ontology\/core#relatedDegree","DegreeGrantor":"https:\/\/open.library.ubc.ca\/terms#degreeGrantor","Description":"http:\/\/purl.org\/dc\/terms\/description","DigitalResourceOriginalRecord":"http:\/\/www.europeana.eu\/schemas\/edm\/aggregatedCHO","Extent":"http:\/\/purl.org\/dc\/terms\/extent","FileFormat":"http:\/\/purl.org\/dc\/elements\/1.1\/format","FullText":"http:\/\/www.w3.org\/2009\/08\/skos-reference\/skos.html#note","Genre":"http:\/\/www.europeana.eu\/schemas\/edm\/hasType","GraduationDate":"http:\/\/vivoweb.org\/ontology\/core#dateIssued","IsShownAt":"http:\/\/www.europeana.eu\/schemas\/edm\/isShownAt","Language":"http:\/\/purl.org\/dc\/terms\/language","Program":"https:\/\/open.library.ubc.ca\/terms#degreeDiscipline","Provider":"http:\/\/www.europeana.eu\/schemas\/edm\/provider","Publisher":"http:\/\/purl.org\/dc\/terms\/publisher","Rights":"http:\/\/purl.org\/dc\/terms\/rights","RightsURI":"https:\/\/open.library.ubc.ca\/terms#rightsURI","ScholarlyLevel":"https:\/\/open.library.ubc.ca\/terms#scholarLevel","Title":"http:\/\/purl.org\/dc\/terms\/title","Type":"http:\/\/purl.org\/dc\/terms\/type","URI":"https:\/\/open.library.ubc.ca\/terms#identifierURI","SortDate":"http:\/\/purl.org\/dc\/terms\/date"},"Affiliation":[{"@value":"Science, Faculty of","@language":"en"},{"@value":"Botany, Department of","@language":"en"}],"AggregatedSourceRepository":[{"@value":"DSpace","@language":"en"}],"Campus":[{"@value":"UBCV","@language":"en"}],"Creator":[{"@value":"Zhao, Lifang","@language":"en"}],"DateAvailable":[{"@value":"2009-07-13T13:57:47Z","@language":"en"}],"DateIssued":[{"@value":"2009","@language":"en"}],"Degree":[{"@value":"Master of Science - MSc","@language":"en"}],"DegreeGrantor":[{"@value":"University of British Columbia","@language":"en"}],"Description":[{"@value":"Seed storage lipids are major carbon reserves that accumulate in developing embryos, and are stored in the form of triacylglycerols (TAGs) within specialized organelles called oil bodies. Even though several key factors that control oil yield have been identified, many rate-limiting steps remain to be established. One such step may be the export of acyl chains from the plastid where they are synthesized, to the ER where they are used for the production of TAGs. Since acyl chain export and utilization requires activation of acyl chain precursors to acyl-coenzyme A (CoA), I hypothesized that long-chain acyl-CoA synthetase (LACS) enzymes which catalyze acyl-CoA biosynthesis may be rate-limiting activities for the accumulation of TAGs in the seed. Based on the available information, I predicted that of the nine LACS enzymes described in Arabidopsis thaliana, three enzymes, LACS8, LACS9 and LACS1, may be involved in supplying acyl-CoAs for TAG formation. Using a reverse genetic approach, I then examined the contribution of LACS8 to TAG accumulation in developing seeds, and investigated whether LASC9 and LACS1 have overlapping functions with LACS8 in TAG production.\r\n Expression analyses using in situ hybridization, \u03b2-glucuronidase (GUS) activity assays in transgenic plants expressing LACS8promoter-\u03b2-glucuronidase (pLACS8::GUS) construct, and quantitative polymerase chain reaction (PCR) demonstrated that LACS8 is transcribed predominantly in the developing embryo. Yellow fluorescent protein (YFP)-tagged LACS8 was localized to the endoplasmic reticulum (ER) in Arabidopsis by confocal microscopy. Identification and characterization of loss-of-function lacs8 mutants did not reveal any reductions in the amount of TAG produced. Similarly, introduction of additional copies of the LACS8 gene did not result in increased TAG accumulation in transgenic seeds. In contrast, analyses of lacs8lacs9, lacs8lacs1 and lacs1lacs9 double mutants and lacs1lacs8lacs9 triple mutants revealed altered TAG levels. The most pronounced TAG decreases were detected in lacs1lacs9 and lacs1lacs8lacs9 mutants, an indication that LACS1 and LACS9 have redundant functions in supplying adequate acyl-CoA amounts for TAG biosynthesis.\r\n I also tried to increase the TAG yield through seed-specific expression of LACS8, LACS9 and FATB genes, but the oil content of all the generated transgenic plants in the T2 generation was in the wild type range.","@language":"en"}],"DigitalResourceOriginalRecord":[{"@value":"https:\/\/circle.library.ubc.ca\/rest\/handle\/2429\/10654?expand=metadata","@language":"en"}],"Extent":[{"@value":"2314373 bytes","@language":"en"}],"FileFormat":[{"@value":"application\/pdf","@language":"en"}],"FullText":[{"@value":"CHARACTERIZATION OF THE ROLE OF ARABIDOPSIS LONG- CHAIN ACYL-COENZYME A SYNTHETASE 8 IN SEED OIL BIOSYNTHESIS by Lifang Zhao B.Sc., Nankai University, 2006 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Botany) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) July 2009 \u00a9 Lifang Zhao, 2009 ii ABSTRACT Seed storage lipids are major carbon reserves that accumulate in developing embryos, and are stored in the form of triacylglycerols (TAGs) within specialized organelles called oil bodies. Even though several key factors that control oil yield have been identified, many rate-limiting steps remain to be established. One such step may be the export of acyl chains from the plastid where they are synthesized, to the ER where they are used for the production of TAGs. Since acyl chain export and utilization requires activation of acyl chain precursors to acyl-coenzyme A (CoA), I hypothesized that long- chain acyl-CoA synthetase (LACS) enzymes which catalyze acyl-CoA biosynthesis may be rate-limiting activities for the accumulation of TAGs in the seed. Based on the available information, I predicted that of the nine LACS enzymes described in Arabidopsis thaliana, three enzymes, LACS8, LACS9 and LACS1, may be involved in supplying acyl-CoAs for TAG formation. Using a reverse genetic approach, I then examined the contribution of LACS8 to TAG accumulation in developing seeds, and investigated whether LASC9 and LACS1 have overlapping functions with LACS8 in TAG production. Expression analyses using in situ hybridization, \u03b2-glucuronidase (GUS) activity assays in transgenic plants expressing LACS8promoter-\u03b2-glucuronidase (pLACS8::GUS) construct, and quantitative polymerase chain reaction (PCR) demonstrated that LACS8 is transcribed predominantly in the developing embryo. Yellow fluorescent protein (YFP)- tagged LACS8 was localized to the endoplasmic reticulum (ER) in Arabidopsis by confocal microscopy. Identification and characterization of loss-of-function lacs8 mutants did not reveal any reductions in the amount of TAG produced. Similarly, introduction of additional copies of the LACS8 gene did not result in increased TAG accumulation in transgenic seeds. In contrast, analyses of lacs8lacs9, lacs8lacs1 and lacs1lacs9 double mutants and lacs1lacs8lacs9 triple mutants revealed altered TAG levels. The most pronounced TAG decreases were detected in lacs1lacs9 and iii lacs1lacs8lacs9 mutants, an indication that LACS1 and LACS9 have redundant functions in supplying adequate acyl-CoA amounts for TAG biosynthesis. I also tried to increase the TAG yield through seed-specific expression of LACS8, LACS9 and FATB genes, but the oil content of all the generated transgenic plants in the T2 generation was in the wild type range. iv TABLE OF CONTENTS ABSTRACT........................................................................................................................ ii TABLE OF CONTENTS................................................................................................... iv LIST OF TABLES........................................................................................................... viii LIST OF FIGURES............................................................................................................ ix LIST OF ABBREVIATIONS.............................................................................................xi CHAPTER 1: INTRODUCTION AND LITERATURE REVIEW.................................... 1 1.1 Fatty acids and plant lipids.................................................................................... 1 1.2 Plant lipid biosynthesis.......................................................................................... 2 1.2.1 de novo fatty acid biosynthesis................................................................... 2 1.2.2 Fatty acid termination, desaturation and transport......................................3 1.2.3 Glycerolipid synthesis.................................................................................5 1.2.4 Biosynthesis of storage TAGs.................................................................... 5 1.2.4.1 Overview of TAG synthesis............................................................ 5 1.2.4.2 The pathways of TAG synthesis......................................................6 1.2.4.3 Polyunsaturation.............................................................................. 6 1.2.4.4 Formation of oil bodies....................................................................7 1.2.5 Other uses of the acyl-CoA pool.................................................................7 1.3 Roles of LACS enzymes in fatty acid metabolism................................................ 8 1.3.1 Biochemical role of LACS enzymes.......................................................... 8 1.3.2 LACS gene family in Arabidopsis thaliana................................................ 8 1.3.2.1 Phylogenetic analysis.......................................................................9 1.3.2.2 Biological functions of LACS enzymes in Arabidopsis................12 1.4 Thesis objectives..................................................................................................14 1.4.1 Research hypotheses................................................................................. 15 1.4.2 Project goals..............................................................................................16 CHAPTER 2: MATERIALS AND METHODS............................................................... 17 v2.1 Nucleic acid analysis........................................................................................... 17 2.1.1 Isolation of Arabidopsis genomic DNA................................................... 17 2.1.1.1 Quick genomic DNA preparation for genotyping......................... 17 2.1.1.2 Genomic DNA preparation for cloning......................................... 17 2.1.2 Isolation of Arabidopsis total RNA.......................................................... 18 2.1.3 RNA quality determination, quantification and reverse transcription......18 2.2 Polymerase chain reaction (PCR)........................................................................ 18 2.2.1 Amplification of T-DNA insertions in SALK lines..................................19 2.2.2 Amplification of the LACS8 5\u2019 promoter region from genomic DNA..... 19 2.2.3 Amplification from cDNA template......................................................... 20 2.2.4 PCR verification of inserts in transgenic plants........................................23 2.2.5 Real time PCR analysis.............................................................................24 2.3 DNA manipulations and bacterial transformation............................................... 24 2.3.1 Plasmid vectors......................................................................................... 24 2.3.2 Plasmid DNA preparation, DNA gel purification and DNA ligation.......24 2.3.3 Preparation and transformation of competent Escherichia coli and Agrobacterium tumefaciens cells.......................................................................24 2.3.4 Identification of bacterial colonies that contain recombinant plasmids and DNA sequencing................................................................................................25 2.3.5 Construct design....................................................................................... 26 2.3.5.1 Generation of LACS8promoter::GUS construct............................ 26 2.3.5.2 Generation of LACS8-YFP and YFP-LACS8 constructs..............27 2.3.5.3 Generation of seed-specific over-expression constructs................28 2.3.5.4 Preparation of constructs for plant transformation........................ 31 2.4 Plant growth conditions, plant transformation, selection, and plant crossing..... 31 2.4.1 Plant growth conditions............................................................................ 31 2.4.2 Plant transformation..................................................................................32 vi 2.4.2.1 Floral dip........................................................................................32 2.4.2.2 Spraying......................................................................................... 32 2.4.3 Screening for transgenic Arabidopsis in the T1 generation...................... 33 2.4.4 Crossing Arabidopsis plants..................................................................... 33 2.5 GUS histochemical assays................................................................................... 34 2.6 RNA in situ hybridization....................................................................................34 2.7 Confocal microscopy........................................................................................... 37 2.8 Gas chromatographic (GC) analysis of seed oil.................................................. 37 2.8.1 Single seed analysis.................................................................................. 37 2.8.2 Analysis of seed batches........................................................................... 38 CHAPTER 3: RESULTS AND DISCUSSION.................................................................39 3.1 Characterization of the LACS8 gene....................................................................39 3.1.1 Real time PCR analysis of LACS8 expression in different organs........... 39 3.1.2 In situ hybridization of LACS8 in the embryo.......................................... 40 3.1.3 GUS activity assays of LACS8 expression............................................... 41 3.1.4 Subcellular localization of the YFP-LACS8 fusion................................. 42 3.1.5 Summary...................................................................................................42 3.2 T-DNA insertional SALK line analyses.............................................................. 43 3.2.1 Genotyping SALK lines............................................................................43 3.2.2 RT-PCR analysis of homozygous mutants............................................... 44 3.2.3 Visible phenotypes of single, double, and triple mutants......................... 45 3.2.4 Biochemical phenotypes of single, double, and triple mutants................ 47 3.2.5 Real time PCR analysis of LACS expression in lacs mutants...................50 3.2.6 Summary...................................................................................................52 3.3 Over-expression of LACS8, LACS9, and FATB genes in the seed...................... 52 3.3.1 Over-expression of LACS8, LACS9, or FATB individually......................52 vii 3.3.2 Simultaneous over-expression of LACS9 and FATB or LACS8, LACS9, and FATB........................................................................................................... 57 3.3.3 Summary...................................................................................................58 CHAPTER 4: CONCLUSIONS AND FUTURE DIRECTIONS..................................... 59 4.1 Conclusions..........................................................................................................59 4.2 Future directions.................................................................................................. 60 4.2.1 Expression analysis of LACS1\/LACS9 in the seed....................................60 4.2.2 LACS enzyme activity assays in the seed of lacs mutants....................... 60 4.2.3 Seed oil analysis of the T3 and T4 generations of LACS8\/LACS9\/FATB transgenic lines.................................................................................................. 60 4.2.4 Characterization of the remaining LACS genes (LACS3\/LACS4\/LACS5) 61 REFERENCES.................................................................................................................. 62 viii LIST OF TABLES Table 1. 1 Summary of Genebank accession numbers, chromosomal locations, ESTs, eFP profiles, and known subcellular locations of LACS gene products........... 12 Table 3. 1The amount of total fatty acids measured in lacs1lacs9 and lacs1lacs8lacs9 mutants.................................................................................... 49 ix LIST OF FIGURES Figure1. 1 Fatty acid biosynthesis occurs in the plastid............................................. 3 Figure1.2 The phylogenetic tree of all LACS members in Arabidopsis...................10 Figure1.3 LACS enzymes and the subcellular sites where they are determined\/proposed to function....................................................................... 14 Figure1.4 Digital northern of all LACS genes in siliques and seeds.........................15 Figure1.5 Digital northern of LACS8 and LACS9 in different tissues...................... 16 Figure 2. 1 Three over-expression cassettes............................................................. 22 Figure 2.2 The construct of LACS8promoter::GUS..................................................27 Figure 2.3 The constructs of LACS8-YFP and YFP-LACS8...................................28 Figure 2.4 Cloning strategy for the creation of the LACS8 seed-specific over- expression construct...........................................................................................29 Figure 2.5 Over-expression cassettes cloned into pBluescript II SK (+)..................30 Figure 2.6 The constructs for simultaneous over-expression of LACS8, LACS9, and FATB..................................................................................................................31 Figure 3. 1 Organ-specific expression patterns of LACS8 detected by quantitative real time PCR.....................................................................................................39 Figure 3.2 In situ localization of LACS8 mRNA...................................................... 40 Figure 3.3 Organ-specific expression pattern of LACS8 detected in LACS8promoter: GUS lines...........................................................................................................41 Figure 3.4 ER localization of YFP-LACS8 fusion protein.......................................42 Figure 3.5 Genomic organizations of LACS genes and locations of T-DNA insertions in the SALK lines..............................................................................44 Figure 3.6 RT-PCR analyses of LACS8, LACS9 and LACS1 steady state transcript levels in mutant and wild type leaves................................................................ 45 xFigure 3.7 Phenotypes of wild type Arabidopsis and lacs1 mutant..........................46 Figure 3.8 Seed phenotypes of lacs1lacs9 and lacs1lacs8lacs9 mutants................. 47 Figure 3.9 Comparisons of seed oil content between single, double and triple mutants and their corresponding wild types...................................................... 48 Figure 3.10 Comparison of fatty acid content in lacslacs9 and lacs1lacs8lacs9 mutants with their corresponding wild types.....................................................49 Figure 3.11 LACS gene expression levels in lacs1 and lacs9 mutants..................... 51 Figure 3.12 Oil content of transgenic Arabidopsis lines transformed with the LACS8 cDNA under the control of a seed-specific promoter-pFAE1........................... 53 Figure 3.13 Oil content of transgenic Arabidopsis lines transformed with the FATB cDNA under the control of a seed-specific promoter-pFAE1........................... 54 Figure 3.14 Oil content of transgenic Arabidopsis with the LACS9 cDNA under the control of a seed-specific promoter-pFAE1.......................................................55 Figure 3.15 Oil content of T3 seeds transformed with LACS8 cDNA behind the FAE1 promoter in pCAMBIA1380 vector........................................................ 56 Figure 3.16 Oil content of T4 seeds transformed with LACS8 behind the FAE1 promoter in pCAMBIA1380 vector...................................................................56 Figure 3.17 Oil content of transgenic Arabidopsis with the FATB and LACS9 cDNA under the control of a seed-specific promoter-pFAE1.......................................57 Figure 3.18 Oil content of transgenic Arabidopsis with the FATB, LACS8 and LACS9 cDNAs under the control of a seed-specific promoter-pFAE1............. 58 xi LIST OF ABBREVIATIONS ACP acyl carrier protein AMPBP AMP-binding protein cer eceriferum CoA coenzyme A DAG diacylglycerol DGAT diacylglycerol acyltransferase DGDG digalactosyldiacylglycerol DIG digoxygenin DPA days post anthesis E.coli Escherichia coli ER endoplasmic reticulum FAD fatty acid desaturase FAE fatty acid elongation FAME fatty acid methyl ester FAS fatty acid synthase G-3-P glycerol-3-phosphate GAPC glyceraldehyde-3-phosphate dehydrogenase C (cytosolic form) GC gas chromatograph GFP green fluorescent protein GPAT glycerol-3-phosphate acyltransferase GUS \u03b2-glucuronidase KAS \u03b2-ketoacyl-ACP synthase KCS \u03b2-ketoacyl-CoA synthase LACS long-chain acyl-CoA synthetase LPA lysophosphatidic acid LPAAT lysophosphatidic acid acyltransferase xii MGDG monogalactosyldiacylglycerol NOS nopalin synthase ORF open reading frame PA phosphatidic acids PCR polymerase chain reaction PDAT phospholipid:diacylglycerol acyltransferase RT-PCR reverse-transcriptase polymerase chain reaction TAG triacylglycerol UTR untranslated region VLCFA very long chain fatty acid X-gluc 5-bromo-4-chloro-3-indolyl \u03b2-D-glucuronide cyclohexylamine salt YFP yellow fluorescent protein 1CHAPTER 1: INTRODUCTION AND LITERATURE REVIEW 1.1 Fatty acids and plant lipids Fatty acids are a diverse group of compounds that have many important biological functions in plant cells. They are structural components of cell membranes bordering the various cellular compartments; they function as intermediates in intracellular signaling pathways, and they serve as energy reserves for ATP production. In addition, fatty acids are substrates for protein modifications that affect localization or three-dimensional structure of an enzyme (Gordon et al., 1991; Ishitani et al., 2000; Martin and Busconi, 2000; Yalovsky et al., 1999). Finally, they give rise to various cuticle components that are deposited on the aerial surfaces of land plants (von Wettstein-Knowles, 1993). To form lipids with the appropriate physiological properties, the constituent fatty acids are usually esterified or modified at their carboxyl or hydroxyl groups. Membrane glycerolipids are found to have fatty acids esterified at the sn-1 and sn-2 positions of the glycerol backbone with a headgroup occupying the sn-3 position. These two nonpolar fatty acyl chains together with the polar headgroup can give the glycerolipids amphipathic characteristics that are required for membrane bilayer formation. Triacylglycerols (TAGs), which are suitable for deposition in the seed, have all three positions of glycerol molecule occupied by fatty acyl groups. Similarly, plant cuticles contain long chain, often oxygenated fatty acids esterified to glycerol moieties present within the cutin network, and very long chain oxygenated fatty acid coenzyme A (CoA) esters and alkyl esters present within the cuticular waxes (von Wettstein-Knowles, 1993). These distinct types of plant lipids are produced in different amounts and often by specific tissues or cell types. For example, lipids represent approximately 5 to 10% of dry mass of leaf mesophyll cells in the vegetative tissues (Ohlrogge and Browse, 1995), while in the seeds of many oilseed crops, storage TAGs may form up to 80% of total dry matter (Crops UDN. http:\/\/www.ncaur.usda.gov\/nc\/nchome.htm). In contrast, insignificant 2amounts of fatty acids usually participate in acylation of specific membrane proteins or signaling of a particular cellular response (Gordon et al., 1991; Ishitani et al., 2000). The amounts of cuticular lipids, especially cuticular waxes, which are secreted by the epidermal cells, are the most variable and depend on individual plant species. In some plants like carnauba (Copernica cerifera) wax can accumulate up to 1 mg\/cm2 on leaf surfaces (Tulloch, 1976). However, in most plant species leaf wax deposits range between 1-100 \u00b5g\/cm2 (Jetter and Kunst, 2008). 1.2 Plant lipid biosynthesis 1.2.1 de novo fatty acid biosynthesis Fatty acid biosynthesis is an essential metabolic process crucial to plant growth and development, and no mutants with disruptions in the enzymes of this pathway have been isolated. Unlike fungi and animals, which synthesize fatty acids predominantly in the cytoplasm, plants use the plastid as their fatty acid biosynthetic site. Fatty acid biosynthesis in plants is catalyzed by a type II fatty acid synthase (FAS), which is dissociable and typically consists of more than 8 separate proteins. In the stroma of plastids, C2 units from malonyl-CoA are condensed to form acyl chains by a four step elongation cycle until the chain length reaches 18 carbons (Ohlrogge and Browse, 1995). Acetyl-CoA carboxylase (ACCase) starts fatty acid biosynthesis by activating acetyl-CoA to make malonyl-CoA. After that, malonyl-ACP is formed by transferring malonyl group from malonyl-CoA to acyl carrier protein (ACP) by a malonyl-CoA:ACP transacylase (MCAT). Four separate enzymes then catalyze acyl chain extension. The first step is carried out by \u03b2-ketoacyl-ACP synthase III (KAS III), which uses acetyl-CoA and malonyl-ACP to generate \u03b2-ketoacyl-ACP and CO2 (Tai and Jaworski, 1993) (Figure 1.1). \u03b2-ketoacyl-ACP is then converted to \u03b2-hydroxyacyl-ACP by \u03b2-ketoacyl-ACP reductase (KR), and trans2-enoyl acyl-ACP by \u03b2-hydroxyacyl-ACP dehydratase (DH). Finally, an elongated 4:0-ACP is generated by enoyl-ACP reductase (ENR) (Slabas et al, 2001). Another two condensing enzymes (also named as \u03b2-ketoacyl-ACP synthases) are needed 3for the formation of fatty acids 18-carbons in length. The biosynthesis of fatty acids 6 to 16 carbons long requires KAS \u0399 and the elongation of the 16-carbon palmitoyl-ACP to 18-carbon stearoyl-ACP is carried out by KAS II. KAS II was demonstrated to play critical roles in Arabidopsis embryogenesis by controlling the embryo development between globular and heart phases (Hakozaki et al., 2008). This whole fatty acid biosynthetic process is the so-called ACP track since acyl groups are always attached to the ACP during chain elongation (Figure 1.1). Figure1. 1 Fatty acid biosynthesis occurs in the plastid 1.2.2 Fatty acid termination, desaturation and transport 18:0-ACP made by the FAS is usually desaturated at C9 to form oleoyl-ACP. This reaction happens exclusively in the plastid and is catalyzed by a \u03949 stearoyl-ACP desaturase, which also shows activity on palmitoyl-ACP (Shanklin and Somerville, 1991; Shanklin and Cahoon, 1998; Sperling et al., 2000). Stearoyl-ACP desaturase is a soluble enzyme, which distinguishes it from all other plant desaturases known to be integral membrane proteins. The gene encoding this enzyme was cloned by Fox et al. in 1993. 4The functional enzyme is a dimer, with each of the monomers containing an active site made of a diiron-oxo cluster. When fatty acids reach 16 or 18 carbons in length, they are released from ACP by acyltransferases, or thioesterases. Acyltransferases hydrolyze fatty acids and attach them to glycerol-3-phosphate (G-3-P) or monoacylglycerol-3-phosphate within the plastid. If a fatty acid is set free by a thioesterase, it will leave the plastid and be used as the precursor for lipid biosynthesis in the endoplasmic reticulum (ER). Generally, two different thioesterases, encoded by paralogous FATA and FATB genes catalyze this reaction. The FATA enzyme shows high activity towards 18:1-ACP in vitro and displays lower activity when using 18:0-ACP or 16:0-ACP as substrates. Conversely, the FATB enzyme hydrolyzes predominantly saturated fatty acyl ACPs, but also has some activity with 18:1-ACP (Figure 1.1) (Doeman et al., 1995 & 2000; Voelker et al., 1997; Salas and Ohlrogge, 2002). In 2003, Bonaventure et al. found that a disruption of the Arabidopsis FATB gene resulted in reduced palmitate and stearate content of the leaves, flowers, roots and seeds. Decreased wax load of leaves and stems, retarded growth rate, and an altered morphology of the seed were also detected in the fatbmutant. The mechanism of export of free fatty acids from the plastid is not known. During export, fatty acids are known to be activated to acyl-CoA thioesters by a long-chain acyl- CoA synthetase (LACS) residing on the outer membrane of the chloroplast envelope (Andrews and Keegstra, 1983; Pollard and Ohlrogge, 1999). The proportion of acyl chains produced by the FAS within the plastid that is used for plastidial lipid versus extraplastidial lipid biosynthesis is determined by the interaction among the plastidial acyltransferases and thioesterases. For example, in the developing seed, most of the fatty acids are released by thioesterases and used for TAG production, while only a minor fraction of acyl chains is retained in the plastid (Voelker and Kinney, 2001). 51.2.3 Glycerolipid synthesis In most plant tissues, fatty acids are predominantly needed for the assembly of glycerolipids for the cellular membranes. In these glycerolipids, C16 and C18 acyl groups are used to construct the hydrophobic part of the molecules. The first two steps in glycerolipid synthesis involve the sequential production of lysophosphatidic acid (LPA) and phosphatidic acid (PA) by esterifying two fatty acids to G-3-P. PA is then utilized for the production of diacylglycerol (DAG) through dephosphorylation of the sn-3 position of the glycerol by a phosphatase, or for the production of a nucleotide-activated form of DAG using cytidine 5\u2019-triphosphate. Phospholipids, including phosphatidylinositol (PI), phosphatidylserine (PS), phosphatidyl glycerol phosphate (the precursor of PG), and glycolipids such as monogalactosyldiacylglycerol (MGDG), digalactosyldiacylglycerol (DGDG) and sulfoquinovosyldiacylglycerol (SL) are then synthesized by a series of specific enzymes (Browse and Somerville, 1991; Joyard et al., 1993; Kinney et al, 1993). Two different pathways can be used to synthesize glycerolipids in higher plants, with the PA production occurring in the plastid or in the ER. The ER derived PA can also be sent back to the plastid envelope for the production of DAG, and then used for the biosynthesis of plastid glycerolipids (Awai et al., 2006). 1.2.4 Biosynthesis of storage TAGs 1.2.4.1 Overview of TAG synthesis Lipids are an important type of reserve material that, in addition to protein and carbohydrate, accumulates in many angiosperm seeds during maturation of the embryo and\/or the endosperm (Aalen et al., 1994; Anil et al., 2003). Seed storage lipids predominantly consist of TAGs and represent ~1 to 80% of the dry weight of the storage organs. Similar to membrane glycerolipids, TAGs also contain typical acyl groups such as palmitate (16:0), stearate (18:0), oleate (18:1), linoleate (18:2), and linolenate (18:3). Distinct from membrane glycerolipid synthesis, TAG production requires enzymes that are able to esterify the sn-3 position of DAG. In the mature seed, TAG is localized in 6small discrete intracellular organelles called oleosomes (Murphy, 1990), lipid-rich spherical bodies (Frey-Wyssling et al., 1963), or oil bodies, with variable diameters ranging between 0.5-2.0 \u03bcm (Huang, 1992; Murphy, 1993; Herman, 1994; Tzen et al., 1993). 1.2.4.2 The pathways of TAG synthesis In most species TAG biosynthesis is carried out by the Kennedy pathway comprised of 3 acyltransferase reactions and a phosphatase reaction. The 1st and 2nd acytransferases transferring fatty acids from fatty acyl-CoAs to G-3-P at the sn-1 and sn-2 positions, and the phosphatidic acid phosphatase generating DAG, are common with membrane glycerolipid synthesis. The sn-1-specific membrane-bound glycerol-3-phosphate acyltransferase (GPAT) exhibits low selectivity for acyl chains (Frentzen, 1998), whereas the lysophosphatidic acid acyltransferase (LPAAT), which esterifies the glycerol molecule at the sn-2 position is highly selective towards its fatty acid substrate (Frentzen, 1998). After removal of the phosphate from the sn-3 position of PA by the phosphatidic acid phosphatase, a third fatty acid will be esterified to this position by the diacylglycerol acyltransferase (DGAT). TAG synthesis also occurs in an acyl-CoA-independent way in plants and yeast. In this case, DAG accepts acyl groups from phospholipids. An enzyme termed phospholipid:diacylglycerol acyltransferase (PDAT) catalyzes this reaction (Dahlquist et al., 2000). Fatty acids from the sn-2 position of phospholipids (PC or PE) can be transferred to DAG by PDAT. It is still an open question whether acyl-CoA-dependent or -independent TAG biosynthetic pathway is relatively more important in oil crops. 1.2.4.3 Polyunsaturation Double bonds can be added to oleate (18:1) to produce linoleate (18:2) and linolenate (18:3) by two ER desaturases, fatty acid desaturase 2 (FAD2) (\u03c96) and FAD3 (\u03c93), respectively (Miquel and Browse, 1992; Browse et al., 1993). These enzymes have been demonstrated to act on fatty acids at both sn-1 and sn-2 positions of PC. 7Polyunsaturated fatty acids can then either be released from PC, converted to CoA esters and enter the cytoplasmic acyl-CoA pool, or be directly used in TAG biosynthesis by PDAT (Browse and Somerville, 1991). 1.2.4.4 Formation of oil bodies The TAG production pathways apparently operate in the rough ER and TAGs are deposited in the structures known as oil bodies (Herman, 1994). Previous ultrastructural and chemical analysis showed that seed oil bodies are bounded by a phospholipid monolayer rather than a unit membrane (Jacks et al., 1990). Unique proteins called oleosins are abundant in covering and embedding the oil bodies (Tzen and Huang, 1992; Huang, 1996). Oleosins are thought to be translated on the rough ER ribosomes and serve a structural role to stabilize the oil bodies during seed maturation (Siloto et al., 2006). Down-regulation of the major oleosin encoding gene OLEO1 in Arabidopsis resulted in very large oil bodies in seed cells, which affected seed germination, TAGs degradation, and storage of lipids and proteins during seed filling process (Siloto et al., 2006). 1.2.5 Other uses of the acyl-CoA pool Besides being used for membrane glycerolipid and TAG synthesis, fatty acyl-CoAs in the cytoplasmic acyl-CoA pool are also substrates for protein modification or cuticular lipid production. Protein modification by acyl transfer to the N-terminus of a polypeptide can result in altered properties of the target protein. For example, the changed hydrophobicity caused by palmitoylation can disrupt original protein-protein interactions or eliminate membrane bindings by altering protein three-dimensional conformation (Gordon et al., 1991; Yalovsky et al., 1999; Ishitani et al., 2000; Martin and Busconi, 2000). Some C16 and C18 fatty acyl-CoAs are further elongated by the enzymes of the fatty acid elongase (FAE) in the ER to chain lengths between C20 and C32. These very long chain fatty acids (VLCFAs) are then either esterified into TAGs in the seed, used for wax biosynthesis in the epidermis, or synthesized into suberin mainly in root tissues. 8Furthermore, VLCFAs are used for sphingolipid biosynthesis in all cells (Ohlrogge and Browse, 1995). 1.3 Roles of LACS enzymes in fatty acid metabolism 1.3.1 Biochemical role of LACS enzymes As discussed above, acyl-CoAs are key substrates for diverse lipid biosynthetic pathways. Additional metabolic pathways, like \u03b2-oxidation, also require fatty acyl CoA esters. Therefore, the knowledge of acyl-CoA biosynthesis and regulation of this process is critical for our overall understanding of lipid metabolism. Acyl-CoA synthesis is catalyzed by LACS enzymes through a two-step mechanism (Shockey et al., 2002). In the first step, an intermediate acyl-AMP is made by attaching a fatty acid to the pyrophosphorolyzed ATP in the presence of Mg2+, and an inorganic pyrophosphate is released as a byproduct. In the second step, the fatty acyl chain is transferred from AMP to CoA and the AMP is released: Fatty acid + ATP \u2192 fatty acyl-AMP + inorganic pyrophosphate (1) Fatty acyl-AMP + CoA\u2192 fatty acyl-CoA + AMP (2) These reactions are not unique to LACS enzymes, since other AMP-binding proteins (AMPBP) also generate adenylate intermediate for carboxylic acid activation. Algal polyketide synthetases cloned by Bibb et al. in 1994, arthropod luciferases described by Conti et al. in 1996, and bacterial peptide antibiotic synthetases reported again by Conti et al. in 1997 are such enzymes, and have the highly conserved AMPBP motif in their structures. 1.3.2 LACS gene family in Arabidopsis thaliana Due to the lack of molecular information about LACS genes in plants, progress in exploring plant acyl-CoA formation has been slow. Fulda et al. (1997) made a major break-through in this area by cloning five cDNAs in Brassica napus (B. napus) based on sequence similarity with known LACSs from other organisms. In 2001, Pongdontri and Hills also cloned a B. napus LACS gene which showed activity in lipogenic tissues. 9Finally, Shockey et al. (2002) cloned nine LACS members from Arabidopsis, and some of these genes were later characterized by several research teams. 1.3.2.1 Phylogenetic analysis To help with the investigation of the specific functions of each LACS isoform, a phylogenetic tree (Figure 1.2) was created based on the amino acid identity and similarity of the predicted LACS proteins. As a group the LACS family is ~30% identical and sequences can be clearly sorted into several different subgroups. The LACS6 and LACS7 were placed in the same branch due to 74% sequence identity. LACS8 and LACS9 are 67% identical, whereas LACS4\/LACS5 branch shows similarity to LACS3, LACS2, and LACS1. Shockey et al. (2002) suggested that the genes residing on the same branch of the phylogenetic tree may have a certain level of redundancy in function and\/or that this tree could be used in predicting the subcellular locations of these enzymes. 10 Figure1.2 The phylogenetic tree of all LACS members in Arabidopsis The tree was generated by maximum likelihood analyses using PHYML. According to Protest analysis, WAG+G model was used to calculate the bootstrap numbers. Analysis of the loci of the LACS gene family revealed that the 9 genes are spread over all the five Arabidopsis chromosomes. Each chromosome has at least one LACS gene. LACS genes lying on the same chromosome are separated by more than 5.3 Mbp, suggesting that all the LACS genes are unique and not produced by gene duplication. A summary of genetic information for the LACS gene family including eFP profiles, genebank accesstion numbers, tissue-specificities based on the corresponding expressed sequence tag (EST) sequences, and the known subcellular locations of the gene products is shown in Table 1.1. The 9 LACS members of Arabidopsis identified by Shockey et al. (2002) also show heterogeneity in length. LACS1, LACS2, LACS3, LACS4 and LACS5 encode proteins 11 nearly the same in length (about 665 amino acids), whereas all the remaining LACS genes specify much longer proteins with a putative N-terminal targeting peptide 30-60 amino acids in length. ChloroP and TargetP servers were used to predict the subcellular locations of the LACS proteins by analyzing the N-terminal sequences. Both programs suggested that LACS6 was targeted to the chloroplast,whereas LACS8 and LACS9 could not be located to any compartment of the cell using these programs. However, subcellular localization of LACS green fluorescent protein (GFP) fusions by confocal microscopy demonstrated that LACS6 and LACS7 were localized to the peroxisome (Fulda et al., 2002). In addition, different from the prediction, LACS9 was found to be located on the outer membrane of the chloroplast in onion epidermal cells (Schnurr et al., 2002). 12 Table 1. 1 Summary of Genebank accession numbers, chromosomal locations, ESTs, eFP profiles, and known subcellular locations of LACS gene products 1.3.2.2 Biological functions of LACS enzymes in Arabidopsis As mentioned above, two of the genes in Arabidopsis, LACS6 and LACS7, have been found to produce LACS enzymes functioning in peroxisomes (Figure 1.3). The peroxisomal localization of LACS6 was determined by a type 2 targeting sequence, while for LACS7, both a type 1 and a type 2 targeting sequences were demonstrated (Fulda et Gene Genebank Accession Number Chromosome\/ MIPS Code ESTs eFP Profile Established Cellular Location LACS1 AF503751 Chromosome 2, At2g47240 Developing seed: 8 Green siliques: 7 Roots:2 Flower buds\/inflorescences: 2 Flower Silique LACS2 AF503752 Chromosome 1, At1g49430 Developing seed: 1 Green siliques: 4 Roots: 1 Flower buds\/inflorescences: 1 Flower Shoot Seed LACS3 AF503753 Chromosome 1, At1g64400 Rosette leaves: 1 Liquid-cultured seedlings: 1 Flower Cotyledon LACS4 AF503754 Chromosome 4, At4g23850 Green siliques: 2 Flower Seed LACS5 AF503755 Chromosome 4, At4g11030 None Flower LACS6 AF50375 Chromosome 3, At3g05970 Green siliques:1 Roots: 1 Leaf Seed Peroxisome LACS7 AF503757 Chromosome 5, At5g27600 Developing seed: 2 Roots: 1 Seed Peroxisome LACS8 AF503758 Chromosome 2, At2g04350 Roots: 1 Etiolated hypocotyls: 1 Flower Leaf seed LACS9 AF503759 Chromosome 1, At1g77590 Developing seed: 2 Green siliques: 2 Roots: 3 Flower Seed Chloroplast 13 al, 2002). The researchers in this study predicted that both LACS proteins might have overlapping functions in initiating \u03b2-oxidation in plant peroxisomes. To explore the biological functions of LASC6 and LACS7 in Arabidopsis, loss-of-function mutants for both genes were identified and analyzed. Neither lacs6 nor lacs7 single mutant showed any obvious phenotypes in seed germination, plant growth, or reproductive organ development when compared with the wild type. On the other hand, the lacs6lacs7 double mutant produced by crossing needed supplemental sucrose for seed germination and seedling development, indicating that lipid mobilization in the double mutant was severely compromised. A similar phenotype was also found in other mutants with a disrupted \u03b2-oxidation pathway, such as pxa1, lacking a functional peroxisomal ABC transporter (Zolman et al., 2001). It is possible that LACS6\/LACS7 in the peroxisome function to esterify free fatty acids delivered by the PXA1 transporter. Another possibility is that PXA1 and LACS6\/LACS7 are both required for delivering acyl-CoA to the \u03b2- oxidation pathway in peroxisomes (Fulda et al, 2002). Another well studied LACS gene in Arabidopsis is LACS2 (Schnurr et al., 2004), which is specifically expressed in the epidermis of young, rapidly expanding tissues. Lost-of-function lacs2 mutants displayed defects in the cuticle, since the mutant leaf released chlorophyll much faster than normal leaf when treated with ethanol. In in vitro assays, LACS2 can produce hydroxy fatty acyl-CoAs, which are intermediates needed for cutin synthesis. LACS2 has been confirmed to participate in cutin biosynthesis with the lacs2 mutant accumulating only one fifth of the wild type levels of dicarboxylic acids (Bessire et al., 2007). More recently, LACS1 was also found to be involved in cutin biosynthesis, specifically in incorporating C16 fatty acids into the cutin network. Wax deficient phenotype of lacs1 mutant and the substrate preference assays of the LACS1 enzyme indicated that LACS1 was also required for the production of very long chain fatty acyl-CoA esters. In addition, analysis of the lacs1lacs2 double mutant revealed an 14 additive effect indicating that LACS1 and LACS2 act jointly in providing precursors for cuticular lipid biosynthesis (L\u0171 et al., 2009). Figure1.3 LACS enzymes and the subcellular sites where they are determined\/proposed to function LACS9 was characterized as the major plastidial LACS isoform, but lost-of-function lacs9 mutant is undistinguishable from the wild type plant in appearance, growth rate or lipid composition of the leaves. This suggested that a functionally redundant LACS enzyme might support acyl-CoA production and export of acyl-CoAs from the plastid in this mutant. So far, no other LACS isoform is known to localize to or function in the plastid, but LACS8, which has 78% similarity to LACS9, was considered to be a good candidate (Shockey et al., 2002). In vitro chloroplast import assays done by Schnurr et al. (2002) suggested that the LACS8 enzyme might be targeted to the chloroplast membranes. 1.4 Thesis objectives Although the LACS gene family was identified in Arabidopsis a long time ago, our understanding of the specific roles that the different LACS isozymes play in lipid 15 metabolic pathways is limited. I am interested in identifying LACS enzymes that are important for seed TAG formation. If I am successful, I plan to further investigate if the seed-specific LACS genes can be employed for improving seed TAG content by genetic engineering. 1.4.1 Research hypotheses To determine which LACS genes would be good candidates for my project, I performed digital northern analysis (Figure 1.4), a computer based study using published raw microarray data. Digital northern results revealed that LACS1, LACS8 and LACS9 are highly expressed in siliques and developing seeds. Considering that LACS8 and LACS9 share high similarity and identity, that lacs9 null mutant did not show any obvious phenotype or exhibit noticeable deficiencies in seed oil deposition, and that LACS8 and LACS9 have a similar expression pattern in all tissues and in most locations (Figure 1.5), I hypothesized that they might have redundant functions in TAG production in the seed. Furthermore, because LACS1 is most closely related to the LACS8 and LACS9 polypeptides, I also predicted that LACS1 might be functionally redundant with LACS8 and\/or LACS9. Figure1.4 Digital northern of all LACS genes in siliques and seeds 16 Figure1.5 Digital northern of LACS8 and LACS9 in different tissues 1.4.2 Project goals Based on the data available in the literature and my own computer analyses I proposed to focus on the LACS8 gene, and using a reverse genetic approach to examine the role of the LACS8 isozyme in seed TAG biosynthesis. In addition, I wanted to determine if LACS8 had overlapping functions with LACS9, and\/or LACS1, in seed oil biosynthesis. Finally, I planned to evaluate the effect of seed-specific over-expression of LACS8 alone, or in combination with LACS9 and FATB genes on seed TAG deposition. My specific research goals were to: 1) Functionally characterize the LACS8 gene and determine the subcellular location of the LACS8 enzyme; 2) Analyze TAG accumulation in the lacs8\/lacs9, lacs8\/lacs1 and lacs9\/lacs1 double mutants, as well as the lacs1\/lacs8\/lacs9 triple mutant; 3) Determine the effects of seed-specific over-expression of the LACS8, LACS9 and FATB genes on seed TAG content. 17 CHAPTER 2: MATERIALS AND METHODS 2.1 Nucleic acid analysis 2.1.1 Isolation of Arabidopsis genomic DNA 2.1.1.1 Quick genomic DNA preparation for genotyping To quickly extract DNA for genotyping, one young rosette leaf from each plant was cut and frozen in liquid nitrogen and then stored at -80\u2103 in an autoclaved 1.5 mL Eppendorf tube. 50 \u03bcL of 0.5 N NaOH were added to each tube when all samples were ready. The leaf tissue was vigorously ground with a plastic pestle until the buffer became green because of the released chlorophyll. Then the tube was vortexed and centrifuged for 5 min at 12,000 g in a microcentrifuge. 2 \u03bcL of supernatant were transferred to a new tube and diluted in 198 \u03bcL of 100 mM Tris-HCl (pH 7.9) buffer. Then 2 \u03bcL of this solution were used as a template for PCR when genotyping the T-DNA insertional mutants ordered from the ABRC stock center (Columbus, OH) (Alonso et al., 2003). 2.1.1.2 Genomic DNA preparation for cloning To get cleaner genomic DNA for cloning, two young rosette leaves were harvested and DNA was extracted using the method of Edwards et al. (1991). Briefly, leaf material was ground with a plastic pestle after the addition of 200 \u03bcL of extraction buffer (200 mM Tris-HCl pH 7.5, 250 mM NaCl, 25 mM EDTA pH 8.0, 0.5% SDS). Another 200 \u03bcL of extraction buffer was then added to the sample and the material was ground further, then vortexed and centrifuged at 12,000 g in a microcentrifuge for 10 min. The DNA in the resultant supernatant was precipitated by the addition of an equal volume of isopropanol (about 380 \u03bcL). The sample was centrifuged again at 12,000 g in a microcentrifuge for 5 min, washed with 70% ethanol, air dried and the DNA was dissolved in 150 \u03bcL of water and stored at -20\u2103 for further analysis. 18 2.1.2 Isolation of Arabidopsis total RNA Rosette leaves, whole-stems, unopened flower buds, 7-day-old seeds, 14-day-old seedlings and whole roots of wild type Arabidopsis (Columbia 0 ecotype) and homozygous SALK T-DNA insertional mutants were collected and frozen immediately in 1.5 mL or 15 mL Eppendorf tubes using liquid nitrogen. When all samples were ready, RNA extraction procedure was performed. With the exception of the developing green seeds, total RNA was isolated using Trizol Reagent (Invitrogen, Carlsbad, CA) according to manufacturer\u2019s protocol. Because developing seeds usually have lot of polysaccharides, a method involving acid phenol-LiCl (Downing et al., 1992) was used to isolate RNA from green seeds. To remove excess polysaccharides from the RNA sample, 3M sodium acetate (pH 5.2) was added after the RNA was dissolved in DEPC-treated water and the sample was re-precipitated. 2.1.3 RNA quality determination, quantification and reverse transcription Agarose gel electrophoresis and ethidium bromide staining were applied to verify the integrity and size distribution of the isolated total RNA samples. The concentration and purity of the RNA was determined by measuring the sample absorbance values at 260 nm (A260) and 280 nm (A280) in a BioSpec-1601 B UV\/visible spectrophotometer (Mandel Scientific Co. Ltd, Shimadzu, Japan). By adding DNase I (Invitrogen, Carlsbad, CA) to each sample, possible residual DNA in the RNA sample was removed. For reverse transcription, 1-5 \u03bcg of total RNA, oligo-dT, and SuperScript II reverse transcriptase (Invitrogen, Carlsbad, CA) were mixed to synthesize the first-strand cDNA as specified by the manufacturer. 2.2 Polymerase chain reaction (PCR) All PCR reactions were carried out in 0.2 mL Eppendorf tubes, using a Peltier Thermal Cycler 200 (Bio-Rad Laboratories, Hercules, CA). 19 2.2.1 Amplification of T-DNA insertions in SALK lines For each SALK line, a left primer (LP) and a right primer (RP) were selected using the SALK T-DNA primer design program (Salk Institute Genomic Analysis Laboratory; http:\/\/signal.salk.edu\/tdnaprimers.2.html). The two sequence specific primers and a left T-DNA border primer (LB) were used to set up two reactions: LP+RP and LB+RP. For WT lines (Wild type - no insertion), a band of about 900-1100 bps was expected in the LP+RP reaction, and no band in the LB+RP reaction. For heterozygous lines (HZ) containing an insertion in one of the two homologous chromosomes, a band of about 900- 1100 bps was expected in the LP+RP reaction and a band of 410+N bps (from RP to insertion site 300+N bases, plus 110 bases from LB to the left border of the vector) in the LB+RP reaction. For homozygous mutant lines (HM), only a band of 410+N bps in the LB+RP reaction was expected. 2.2.2 Amplification of the LACS8 5\u2019 promoter region from genomic DNA A 1667-bp long region (1069 bps immediately upstream of the translation start site of the LACS8 gene and 598 bps of the open reading frame (ORF)), hereafter referred to as the LACS8 promoter, was amplified from genomic DNA using gene specific oligonucleotide primers and high fidelity Pfx polymerase (Invitrogen, Carlsbad, CA). The forward primer contained a SalI (underlined) restriction enzyme cutting site 5\u2019- GAGGTCGACCGCAAGGTAAACCGCTCTATTAAATC-3\u2019 and a BamHI cutting site was included in the reverse primer (underlined) 5\u2019- GCGGATCCACATCCCTGGAAATTTACAACACCAAC-3\u2019. Amplification was performed in a 50 \u03bcL reaction under the following conditions: Initial denaturation at 94\u2103 for 2 min and 30 s, followed by 34 cycles of denaturation at 94\u2103 for 15 s, annealing at 55\u2103 for 30 s, and extension at 68\u2103 for 1 min, then a final extension at 68\u2103 for 5 min. 20 2.2.3 Amplification from cDNA template Amplification of a specific region overlapping two exons of LACS8, LACS9, LACS1 or glyceraldehyde-3-phosphate dehydrogenase C (GAPC) for expression analysis by reverse-transcriptase PCR (RT-PCR) or real time PCR was carried out using the following primers: Two pairs of primers amplifying different domains of LACS8 were used to demonstrate that the transcription of LACS8 gene was impaired in the homozygous SALK T-DNA insertional lines resulting in a truncated mRNA. The coding sequence of the LACS8 gene for generating the LACS8::yellow fluorescent protein (YFP) fusion for subcellular localization, was obtained by PCR amplification using 5\u2019-attB1 (GGGGACAAGTTTGTACAAAAAAGCAGGCTTC) ATGGAAGATTCTGGAGTGAATCCAATGGA-3\u2019 (forward primer), 5\u2019-attB2 (GGGGACCACTTTGTACAAGAAAGCTGGGTC) GGCATATAACTTGCTGAGTTCATCTTTGAA-3\u2019 (reverse primer) and high fidelity Pfx polymerase (Invitrogen, Carlsbad, CA). To over-express LACS8 in a seed-specific manner, LACS8 coding sequence was amplified from leaf cDNA with a forward primer containing an XbaI (underlined) cutting site 5\u2019-GCTCTAGAATGGAAGATTCTGGAGTGAATCCAA-3\u2019 and a reverse primer containing an SalI (underlined) cutting site 5\u2019- GCGTCGACTTAGGCATATAACTTGCTGAGTTCA-3\u2019. Forward primers Reverse primers LACS8 (1) 5\u2019-AGATTCCACCCTGATGGATGTCT-3\u2019 5\u2019-ATGCTCCTCGTGATGGAACAACAA-3\u2019 LACS8 (2) 5\u2019-TTGATGATCGTGTTGCTATCT-3\u2019 5\u2019-CTCATTGAGTGAGTAAATCAAA-3\u2019 LACS9 5\u2019-GGAATTCTCTGAAGATCTCACCA-3\u2019 5\u2019-TCGTCCTAGTTCCCACACAA-3\u2019 LACS1 5\u2019-CAGGTGGGCTAAAGATCTCGGTT-3\u2019 5\u2019-CTTGAGCGTCGCAGTCACTAAGT-3\u2019 GAPC 5\u2019-ACTCGAGAAAGCTGCTAC-3\u2019 5\u2019-ATTCGTTGTCGTACCATG-3\u2019 21 For simultaneous over-expression of several genes in the seed, coding sequences of LACS8, LACS9 and FATB were amplified from leaf cDNA using the following primers: Seed-specific FAE1 promoters used to drive the expression of FATB and LACS genes were amplified from the Arabidopsis genomic DNA with the primers provided below (restriction enzyme sites are underlined): Terminators of nopaline synthase (NOS) used for over-expression constructs were amplified from the plasmid pRD400 (Datla et al., 1992) with the primers shown below (restriction enzyme sites are underlined): Forward primers Reverse primers LACS8 5\u2019- GACACAAACAGAGCAATGGAAGATTCT GGAGTGAAT-3\u2019 5\u2019- TTAGGCATATAACTTTGCTCTGTTTGTGTC GGAAAA-3\u2019 LACS9 5\u2019- GACACAAACAGAGCAATGATTCCTTAT GCTGCTGGT-3\u2019 5\u2019- CCGGCAACAGGATTCTTAGGCATATAACT TGGTGAGATCTTCAGAGAATTCCCT-3\u2019 FATB 5\u2019- GACACAAACAGAGCAATGGTGGCCACC TCTGCTACG-3\u2019 5\u2019- CCGGCAACAGGATTCTTACGGTGCAGTTC CCCAAGT-3\u2019 Forward primers Reverse primers FAE1p for LACS8 5\u2019- ACGCGTCGACCTAGTAGATTGGT TGGTTGGT-3\u2019 5\u2019- TTAGGCATATAACTTTGCTCTGTTTG TGTCGGAAAA-3\u2019 FAE1p for LACS9 5\u2019- TCCCCGCGGCTAGTAGATTGGTT GGTTGGT-3\u2019 5\u2019- AGCATAAGGAATCATTGCTCTGTTT GTGTCGGAAAA-3\u2019 FAE1p for FATB 5\u2019- TCCCCCGGGCTAGTAGATTGGTT GGTTGGT-3\u2019 5\u2019- AGAGGTGGCCACCATTGCTCTGTTT GTGTCGGAAAA-3\u2019 22 Specific FAE1 promoters, NOS terminators and coding sequences of the three genes were amplified and ligated to produce the three cassettes shown in Figure 2.1: Figure 2. 1 Three over-expression cassettes To synthesize the probes for in situ hybridization analysis of LACS8 in developing embryos, DNA templates were amplified by PCR from the pDONR207-LACS8 construct containing LACS8 cDNA using primers that added the T7 RNA polymerase binding site at the 5\u2019 end: Forward primers Reverse primers NOSt for LACS8 5\u2019- AAGTTATATGCCTAAGAATCCTGTTG CCGGTCTTG-3\u2019 5\u2019- TCCCCCGGGTTATCCTAGTTTGCG CGCTA-3\u2019 NOSt for LACS9 5\u2019- AAGTTATATGCCTAAGAATCCTGTTG CCGGTCTTG-3\u2019 5\u2019- ACGCGTCGACTTATCCTAGTTTGC GCGCTA-3\u2019 NOSt for FATB 5\u2019- GGAACTGCACCGTAAGAATCCTGTT GCCGGTCTTG-3\u2019 5\u2019- GCGAGCTCTTATCCTAGTTTGCGC GCTA-3\u2019 23 Reaction volume for RT-PCR and real time PCR was 20 \u03bcL, and the reactions were carried out using Taq DNA polymerase (Invitrogen, Carlsbad, CA) using the following protocol: 2 min denaturation at 94\u2103 followed by 30 (RT-PCR) or 40 (real time PCR) cycles of 94\u2103 for 15 s, annealing at 55\u2103 for 30 s, and extension at 72\u2103 for 30 s. After the cycles were completed, a final extension of 10 min at 72\u2103 was performed. Fragments used for subsequent cloning were amplified by Platinum Pfx DNA polymerase (Invitrogen, Carlsbad, CA) under the same conditions as described previously for LACS8promoter::GUS construct. SuperScript III Platinum Two-Step qRT-PCR Kit with SYBR Green (Invitrogen, Carlsbad, CA) was used for real time PCR analysis as specified by the manufacturer\u2019s protocol. Amplification products were separated by electrophoresis on a 1% (w\/v) agarose- TAE gel, stained with ethidium bromide and visualized in a MultiImage Light Cabinet (Alpha Innotech Corporation, San Leandro, CA). 2.2.4 PCR verification of inserts in transgenic plants Primers designed to amplify fragments that were intended for cloning into expression vectors were also used to test whether those fragments were present in the genome of the transformed plants. PCR amplification was usually carried out in a 20 \u03bcL reaction using genomic DNA isolated from putative transformants and Taq DNA polymerase (Invitrogen, Carlsbad, CA). The basic PCR protocol used was 2 min of denaturation at 94\u2103 followed by 35 cycles of 15 s denaturation at 94\u2103, 15 s annealing at Forward primers Reverse primers Sense probe 5\u2019- CATAATACGACTCACTATAGGAT GGAAGATTCTGGAGTGA-3\u2019 5\u2019- GCGTCGACTTAGGCATATAACTTG CTGAGTTCA-3\u2019 Anti-sense probe 5\u2019- GCTCTAGAATGGAAGATTCTGGA GTGAATCCAA-3\u2019 5\u2019- CATAATACGACTCACTATAGGTTA GGCATATAACTTGCT-3\u2019 24 53\u2103, and 2 or 3 min (according to the length of the fragments) extension at 72\u2103. A final extension at 72\u2103 for 10 min was added to the program when the cycles were completed. 2.2.5 Real time PCR analysis Primers used for real time PCR were the same as those designed for RT-PCR. Platinum SYBR Green qPCR SuperMix-UDG (Invitrogen, Carlsbad, CA) was used to perform real time PCR in a MJ Mini Opticon Personal Thermal Cycler (Bio-Rad Laboratories, Hercules, CA) as specified by the manufacturer\u2019s protocol. 2.3 DNA manipulations and bacterial transformation 2.3.1 Plasmid vectors Binary vector pBI101.1 (Clontech) was used to design the LACS8promoter::GUS construct. Gateway entry vector pDONR207 (Invitrogen, Carlsbad, CA) was used to clone LACS8 cDNA, while Gateway destination vectors pEarleyGate 101 (C-YFP-HA) and pEarleyGate 104 (N-YFP) (Earley et al., 2006) were used for the protein localization study. pBluescript II SK(+) (Alting-Mees et al., 1992) was used as a middle vector to build the FAE1promoter-gene-NOSterminator cassettes, which were then transferred to binary vectors pCAMBIA1380 (Deblaere et al., 1987) or pZP211 (Hajdukiewicz et al. 1994) for plant transformation. 2.3.2 Plasmid DNA preparation, DNA gel purification and DNA ligation Plasmid DNA was isolated using GeneJETTM Plasmid Miniprep Kit (Fermentas, Burlington, ON) and performed according to manufacturer\u2019s protocol. Plasmid DNA and PCR product were digested by specific restriction enzymes, separated on agarose gels, then excised and purified using QIAquick Gel Extraction Kit (QIAGEN, Mississauga, ON) as directed by the manufacturer. All ligations were carried out using T4 DNA ligase (Invitrogen, Carlsbad, CA) as specified by the manufacturer. 25 2.3.3 Preparation and transformation of competent Escherichia coli and Agrobacterium tumefaciens cells Competent E. coli cells (DH5\u03b1) were prepared by treatment with 0.1 M MgCl2 followed by 0.1 M CaCl2 for 10 min each and resuspended in 0.1 M CaCl2 with 10% glycerol. 200 \u03bcL aliquots of the cell suspension were instantly frozen on dry ice and stored at -80\u2103 until needed. Before transformation, cells were taken from -80\u2103 and allowed to thaw on ice. Plasmid DNA or ligation product was then added, mixed gently, and left on ice for 30 min. Cells were then heat shocked at 42\u2103 for 90 s, and incubated with vigorous shaking at 37\u2103 for 1 h after addition of 840 \u03bcL of fresh LB medium. Various amounts of the cell suspension were spread on plates containing LB medium, agar (7 g\/500 mL), and the appropriate antibiotic for selection, and allowed to grow overnight at 37\u2103. All E. coli liquid cultures were grown at 37\u2103 with shaking for 14-16 h. Competent Agrobacterium tumefaciens (A. tumefaciens) cells (GV3101, pMP90) (Koncz and Schell, 1986) were grown in LB medium containing 25 mg\/L rifampicin and 25 mg\/L gentamicin for 5 h, then treated with 20 mM CaCl2, and frozen immediately in liquid nitrogen in 200 \u03bcL aliquots. Competent cells were stored at -80\u2103 until needed. Transformation with binary vectors was carried out after the competent cells were thawed on ice. 1-2 \u03bcg plasmid DNA was added and the tube was kept on ice for 45 min with periodic mixing. Fresh LB medium was added after the sample was incubated at 37\u2103 for 3 min. Processed cells were then allowed to grow at 28\u2103 for 2-3 h with gentle shaking. Aliquots of the transformation culture were spread on LB plates containing the appropriate antibiotics and allowed to grow for 48 h at 28\u2103. 2.3.4 Identification of bacterial colonies that contain recombinant plasmids and DNA sequencing Usually a number of independently transformed bacterial colonies were picked and their DNAs were used as PCR templates to test whether the foreign DNA fragment could be amplified. If a colony contained such a fragment, it would be grown in a small scale 26 culture (3-5 mL). Plasmid DNAs purified using GeneJETTM Plasmid Miniprep Kit (Fermentas, Burlington, ON) from each culture were then digested by specific restriction enzyme(s) and run on an agarose gel. Finally, selected plasmid DNAs containing inserts were sent out for sequencing. DNA sequencing was performed at the University British Columbia Nucleic Acid and Protein Service (NAPS) unit by automated Prism Cycle Sequencing. NEB cutter V2.0 (Vincze et al., 2003; http:\/\/tools.neb.com\/NEBcutter2\/index.php) was used for restriction enzyme mapping and sequence manipulation. The Basic Local Alignment Search Tool (BLAST), (Altschul et al., 1990) at The Arabidopsis Information Resource (http:\/\/www.Arabidopsis.org\/BLAST) was used for similarity searches and identity verifications. 2.3.5 Construct design 2.3.5.1 Generation of LACS8promoter::GUS construct The genomic fragment obtained by PCR amplification in section 2.2.2 and the binary vector pBI101.1 (Clontech) were both digested with SalI and BamHI (Invitrogen, Carlsbad, CA) (Figure 2.2). Purified vector and insert were ligated using T4 DNA ligase (Invitrogen, Carlsbad, CA) at room temperature overnight. The ligation product was transformed into chemically competent E. coli cells (DH5\u03b1) and selected based on resistance to kanamycin (50 mg\/L). Insertion of the fragment was verified by colony PCR and test digestion. Sequencing confirmed that the PCR product corresponded to the region -1069 to +598 bps relative to the LACS8 translational start point in the Arabidopsis database. 27 Figure 2.2 The construct of LACS8promoter::GUS The 1667-bp-long promoter region of LACS8 contains the 5\u2019 regulatory region (including a part of the coding region of the upstream gene At2g04340 and 5\u2019 untranslated region (UTR) of LACS8), the first intron (denoted I), and a part of the open reading frame of LACS8 (including one intron that is denoted II). The UTR is shown as hatched box, introns as thin lines, and coding regions as open boxes. Numbers shown here are relative to the LACS8 translational start point. 2.3.5.2 Generation of LACS8-YFP and YFP-LACS8 constructs The PCR product described in section 2.2.3 was introduced by BP recombination into the pDONR207 (Invitrogen, Carlsbad, CA) entry vector using BP ClonaseTM II Enzyme Mix (Invitrogen, Carlsbad, CA) and transformed into chemically competent E. coli cells (DH5\u03b1). Following the selection on plates containing gentamicin (25 mg\/mL), sequencing of an individual clone confirmed that there were no errors in the LACS8 coding sequence. The insert was then transferred to the binary vectors pEarleyGate 101 (C-YFP-HA) and pEarleyGate 104 (N-YFP) (Earley et al., 2006) using LP ClonaseTM II Enzyme Mix (Invitrogen, Carlsbad, CA) by an LR recombination reaction to obtain translational fusions between the LACS8 coding sequence and the YFP coding sequence (Figure 2.3). Transformed colonies were selected on LB medium containing kanamycin (50 mg\/mL). 28 Figure 2.3 The constructs of LACS8-YFP and YFP-LACS8 2163-bp of the LACS8 coding sequence was amplified from leaf cDNA of wild type Arabidopsis (Columbia 0 ecotype) by PCR and introduced into pEarleyGate vectors 101 and 104. attB1 and attB2 refer to the Gateway recombination sequences. Both vectors have kanamycin resistance in bacteria and Basta resistance in plants. 2.3.5.3 Generation of seed-specific over-expression constructs For over-expression of LACS8 in the seed, the LACS8 fragment amplified using PCR in section 2.2.3 was introduced into the pBluescript II KS (+) vector (Alting-Mees et al., 1992) behind the FAE1 promoter. Then the whole FAE1 promoter::LACS8 cassette was excised using SalI and SspI restriction enzymes (Invitrogen, Carlsbad, CA), which produce a blunt end and a sticky end, respectively, and ligated into the binary vector pCAMBIA 1380 (Deblaere et al., 1987) digested by SalI and SmaI (Invitrogen, Carlsbad, CA), which also created a blunt end and a sticky end (Figure 2.4). 29 Figure 2.4 Cloning strategy for the creation of the LACS8 seed-specific over-expression construct Using different restriction enzyme combinations, three over-expression cassettes harboring LACS8, LACS9 and FATB described in section 2.2.3 were inserted into the corresponding sites in pBlusescript II SK (+) (Alting-Mees et al., 1992) (Figure 2.5). Because these cassettes were ultimately destined for the binary vector pZP211 (Hajdukiewicz et al. 1994), FAE1p-LACS9-NOSt was introduced to pBlusescript II SK (+) (Alting-Mees et al., 1992) with a HindIII site (Invitrogen, Carlsbad, CA) instead of SacII site (Invitrogen, Carlsbad, CA) using two pairs of primers: Forward primers Reverse primers 5\u2019- AGCTTCTAGTAGATTGGTTGGTTG GT-3\u2019 5\u2019-CTTATCCTAGTTTGCGCGCTA-3\u2019 5\u2019-TCTAGTAGATTGGTTGGTTGGT- 3\u2019 5\u2019- TCGACTTATCCTAGTTTGCGCGCT A-3\u2019 30 The PCR products were mixed together, then denatured at 94\u2103 for 1 min and annealed at 20\u2103 for 1 min to produce a fragment with HindIII\/SalI (Invitrogen, Carlsbad, CA) hanging sites (Figure 2.5a). The fragment was ligated into pBluescript II SK (+) again (Alting-Mees et al., 1992) (Figure 2.5b). (a) (b) Figure 2.5 Over-expression cassettes cloned into pBluescript II SK (+) Over-expression cassettes were then transferred into the binary vector pZP211 (Hajdukiewicz et al. 1994) to create constructs for individual or simultaneous over- expression in the seed (Figure 2.6). 31 Figure 2.6 The constructs for simultaneous over-expression of LACS8, LACS9, and FATB 2.3.5.4 Preparation of constructs for plant transformation All the binary vectors described above were introduced into the competent A. tumefaciens GV3101 (pMP90) cells (Koncz and Schell, 1986) and used for transformation of Arabidopsis inflorescences (Bechtold et al., 1993). 2.4 Plant growth conditions, plant transformation, selection, and plant crossing 2.4.1 Plant growth conditions Seeds of wild type Arabidopsis thaliana or mutants were sowed on Arabidopsis thaliana (AT)-agar (3.5 g\/500 mL) plates (Somerville and Ogren, 1982) supplemented with the specific antibiotics for selection (for transgenic seeds only). The seeds were kept at 4\u2103 for 2-3 days to break the dormancy and then germinated at 20\u2103 under continuous light (75 \u03bcEm-2s-1 of photosynthetically active radiation). After 10-14 days, seedlings 32 were transplanted into soil (Sunshine Mix 4, SunGro, Kelowna BC) with AT medium added. Plants were grown at 20\u2103 under continuous light until maturity. 2.4.2 Plant transformation 2.4.2.1 Floral dip Floral dip method (Clough and Bent, 1998) was usually used to transform Arabidopsis plants. A 200 mL culture of A. tumefaciens cells was centrifuged at 7,500 g for 10 min and the resulting pink pellet was resuspended in a 5% sucrose solution supplemented with 0.02% silwet-L77 (LEHLE SEEDS, Round Rock, TX). For easier immersion of the inflorescences into the transformation solution, the bacterial suspension was placed in a shallow container. Pots containing 15-20 Arabidopsis plants with ~3-inch tall secondary inflorescences were inverted and the flowers were immersed in the bacterial suspension for about 30 s with gentle shaking. Black plastic bags were used to cover the plants to generate low light conditions and the pots were placed on their sides overnight. Normal growth conditions were applied to the transformed plants again after 24 h until senescence, at which point the seeds were collected. 2.4.2.2 Spraying Spraying the plants with an A. tumefaciens suspension was also used to transform Arabidopsis (Hooker et al., 2007). For this purpose Arabidopsis plants were grown at a density of ~100 plants per 12 inch pot. After A. tumefaciens cells were grown to an appropriate concentration, the suspension was spun down at 7,500 g for 10 min at room temperature. Precipitated pink cell pellet was resuspended in 100 mL of 5% sucrose, washed and then spun down again at 7,500 g for 10 min at room temperature. Finally, A. tumefaciens pellet was resuspended in 200 mL of 5% sucrose solution supplemented with 0.02% (v\/v) Silwet L-77 (LEHLE SEEDS, Round Rock, TX) and used to spray ~3-inch tall inflorescences. Transformed plants were covered with black plastic bags for 1 day before returning to normal growing conditions. 33 2.4.3 Screening for transgenic Arabidopsis in the T1 generation Harvested seeds were sterilized and then germinated on the AT medium supplemented with agar (3.5 g\/500 mL) and appropriate antibiotics. Only seedlings that had acquired the transgene (s) could grow normally because they were resistant to the specific antibiotics that were added to the media. After 7-14 days, based on the growth rate of the transgenic plants, the resistant seedlings were transferred into soil. Along with transgenic plants, WT plants (Columbia 0 ecotype) and WT Columbia 0 plants transformed with an empty vector were always planted as controls for comparison. 2.4.4 Crossing Arabidopsis plants To avoid self-fertilization, flowers used as the female parents must be manipulated before the anthers begin to shed pollen onto the stigma. Usually 2-3 most suitable flowers on the main shoot of a female parent were selected for crossing. Other flowers just above and below those used for the cross, or any siliques that might be present on the stem were removed by scissors or jeweler\u2019s forceps. All the sepals, petals, and stamens were then excised from each flower, leaving only the carpels intact. For the male parent, an open flower that was visibly shedding pollen was chosen. It was removed from the male parent and squeezed near the base with the forceps. The stigmatic surface of the exposed carpels on the female parent was then brushed against the convex surface of the anthers. The pollinated naked carples were covered with plastic film to keep moisture for 1 day. A piece of tape with both parents\u2019 name was used to label the shoot to allow the seed to be identified when mature. The crosses were checked the next day to confirm that siliques had elongated, indicating successful pollination. The siliques were collected after 2-3 weeks when they began to turn yellow. The siliques were further dried at room temperature for 2 weeks before planting. Double or triple mutants were identified from the F2 generation by genotyping. 34 2.5 GUS histochemical assays Tissues from transgenic plants containing the LACS8promoter::GUS construct were removed and immersed in GUS staining buffer containing 0.5 mM potassium ferricyanide, 0.5 mM potassium ferrocyanide, 100 mM NaPO4, 0.2% Triton-X-100, and 1 mM 5-bromo-4-chloro-3-indolyl-\u03b2-D-glucuronide (X-gluc; Jefferson, 1987). Air was eliminated from the tissues by vacuum infiltration. Infiltrated tissues were incubated in the staining buffer for 4 h, or overnight. Stem and leaf tissues were cleared of chlorophyll by overnight incubation in a clearing solution (72% choralhydrate, 11% glycerol, 17% water). Stained and cleared samples were examined visually either directly or under dissecting microscope or compound light microscope. 2.6 RNA in situ hybridization To generate the hybridization probe for in situ hybridization, 1 \u03bcL of the PCR product amplified as described in section 2.2.3 was run on an agarose gel to confirm that a single product was synthesized at a high concentration. The remaining PCR product was cleaned up on a column and 2 \u03bcL (about 1 \u03bcg) were used in in vitro transcription reaction. Transcription was carried out at 37\u2103 for 2 h, and then the RNA was precipitated by adding 2.5 \u03bcL of 4 M LiCl and 75 \u03bcL of 100% ethanol, and kept at -20\u2103 overnight. The next day RNA was spun down at 4\u2103 at 7,500 g in the microcentrifuge and resuspended in 100 \u03bcL of DEPC-treated water. The RNA probe was then hydrolyzed into fragments between 75 and 150 base pairs long by adding 60 \u03bcL 200 mM Na2CO3 and 40 \u03bcL 200 mM NaHCO3 followed by incubation at 60\u2103 for 87 min. This optimal hydrolysis time was calculated using the formula: T (time) = (Li-Lf)\/K*Li*Lf (where Li is the initial length of probe, Lf is the final length of probe and K=0.11kb\/min). The reaction was neutralized by the addition of 10 \u03bcL of 20% acetic acid. The probe was precipitated using 21 \u03bcL of 3 M NaOAC, 2 volumes of 100% ethanol and 1 \u03bcL of 20 mg\/ml oyster glycogen as carrier at -20\u2103 for 2-3 h. 100 \u03bcL of 50% deionized formamide was used to 35 dissolve the pelleted probe and then the probe was quantified against digoxgenin (DIG) standard according to manufacturer\u2019s instructions. Arabidopsis wild type seeds of different developmental stages were fixed in 20 ml scintillation vials in FAA (3.7% formaldehyde, 5% acetic acid, 50% ethanol) for 1.5 h according to Huijser et al. (1992). The samples were then dehydrated by immersion in the following ethanol series for 30 min each: 60%, 70%, 85%, 95%, and 100% twice. After ethanol dehydration, 75:25, 50:50, 25:75 ethanol\/Histoclear, and two times of 100% Histoclear were applied to the samples. The vials were filled half way with Histoclear and topped up with paraffin (Paraplast Plus, Sigma) for incubation at 55\u2103 overnight. The next day, molten paraffin was used to replace the Histoclear\/paraffin solution, and after that, paraffin was replaced at least three times during the day. Samples were embedded the following day and then sectioned with a microtome to 8, 12 or 20 \u03bcm for selecting the most appropriate thickness. Sections were floated onto microscope slides using double- distilled water, dried at 42\u2103 overnight, and affixed to the slides by raising the temperature of the hot plate to 56\u2103 for 4 h. The in situ hybridization protocol used was a modified procedure based on that of Coen et al. (1990) and Drews (personal communication). FAE1 antisense probe was used as positive control, while LACS8 sense probe was used as negative control. Paraffin was removed by immersing slides in 100% xylene twice, and 100% ethanol twice for 5 min each. Sections were hydrated by immersion in 95%, 90%, 80%, 60%, and 30% ethanol, 0.85% NaCl, and 1X PBS (0.13 M NaCl, 3 mM NaH2PO4, 7 mM Na2HPO4 mM) for 5 min each, incubated for exactly 30 min at 37\u2103 with 1 \u03bcg\/mL proteinase K in 100 mM Tris-HCl, pH 7.5, and 50 mM EDTA, and washed with 1X PBS again at the end. Slides were then dehydrated in 0.85% NaCl, 30%, 60%, 80%, 90%, 95%, and 100% ethanol for 5 min each and stored at 4\u2103 in a closed box with a few drops of ethanol soaking the paper until further processing. 36 Hybridization was done overnight at 55\u2103 with a DIG-labeled RNA probe (10-50 ng) in 150 \u03bcL of hybridization buffer (10 mM Tris-HCl, pH7.5, 1 mM NaCl, 50% formamide, 7% dextransulfate, 1 X Denhardt\u2019s solution (1 X Denhardt\u2019s solution is 0.02% Ficoll type 400, 0.02% polyvinylpyrrolidone, 0.02% BSA), 500 \u03bcg\/mL rRNA, and 250 \u03bcg\/mL poly (A) RNA). Slides were washed in 2 X SSC (1 X SSC is 0.15 M NaCl, 0.015 M sodium citrate) for 5 min to remove the coverslips of the sections. The samples were then washed four times in 0.2 X SSC at 55\u2103 for 30 min each, then once at 37\u2103 and once at room temperature. After a 5 min wash in 1 X PBS, the slides were stored overnight at 4\u2103 for immunological detection. According to the protocol described by Coen et al. (1990), immunological detection of the hybridization probe was performed as follows: slides were covered for 45 min with 1 mL of 1% blocking reagent (Boehringer Mannheim) in 100 mM maleic acid, pH 7.5, and 150 mM NaCl, then incubated for 45 min in 1 mL of buffer A (1% BSA (Sigma), 0.3% Triton X-100 (Sigma), 100 mM Tris-HCl, pH 7.5, and 150 mM NaCl) after washing with 1-2 mL of fresh BSA solution. The slides were then incubated for 1.5 hour with 1 mL of diluted (1:1250) antibody conjugated (Boehringer Mannheim) in buffer A, followed by three washes in buffer A for 20 min each. The buffer A was removed at the end to avoid detergent precipitation in the subsequent color reaction by washing the slides in TNM-50 (100 mM Tris-HCl pH 9.5, 100 mM NaCl, 50 mM MgCl2) twice for 15 min each. To activate the color reaction, slides were incubated overnight with 0.25 mL of 0.34 mg\/mL nitroblue tetrazolium salt and 0.175 mg\/mL 5-bromo-4-chloro-3-indolyl- phosphate p-toluidine salt in substrate buffer in the dark. 10 mM Tris-HCl, pH 8.0, and 5 mM EDTA were added to stop the color reaction, and slides were viewed before (brown color) or after (blue color) ethanol dehydration, 100% xylene immersion, and coverslip mounting with Entellen (Merck). Sections were photographed under a compound light microscope. 37 2.7 Confocal microscopy Leaves of Arabidopsis transformants containing the YFP::LACS8 transgene were immersed in hexyl rhodamine B solution (1.6 \u03bcM) for 10-30 min. The YFP and hexyl rhodamine B fluorescence were examined with a Zeiss Pascal Excite laser scanning confocal microscope (Carl Zeiss MicroImaging GmbH, Jena, Germany). A 488 nm excitation wavelength with the emission filter set at 500-530 nm were used for YFP. A 543-nm argon ion laser line and a 600-nm long-pass emission filter were used to excite hexyl rhodamine B. All confocal images obtained were processed with ImageJ (http:\/\/rsb.info.nih.gov\/ij) and Adobe Photoshop 5.0 (Mountain View, CA) software. 2.8 Gas chromatographic (GC) analysis of seed oil 2.8.1 Single seed analysis 20 seeds from each line were placed individually into screw top Pyrex tubes and 0.5 mL 1N methanolic-HCl (Supelco) and 300\u03bcL of hexane were added to each tube. 10 \u03bcL of 0.1 mg\/mL 17:0 methyl ester was added to each seed sample as an internal standard. Each tube was capped tightly and heated at 80 \u2103 overnight. This procedure simultaneously digests the seed tissue and converts fatty acids to methyl esters (Browse et al., 1986). The following day, samples were cooled down for 5 min on ice, and 0.5 mL of 0.9% NaCl was added to each tube. The tubes were then recapped and vortexed vigorously. 200-250 \u03bcL of hexane (top phase) was carefully drawn from each tube and transferred to a clean GC vial. Samples were then dried completely under N2. 20 \u03bcL of hexane was added to each dried fatty acid methyl ester (FAME)-containing vial, vortexed and transferred into the conical glass insert (Agilent Technologies, Waldbronn, Germany). Individual inserts were placed into the GC vial and analyzed by GC on a 30 m \u00d7 0.25 mm DB-23 capillary column (J and W Scientific). GC analysis was carried out at the initial temperature of 180\u2103 for 1 minute, followed by an increase at 4\u2103 min-1 until 240\u2103, which was maintained for further 3 min. Injector and flame ionization detector temperatures of 250\u2103 were used, and the gas flow rates applied were as follows: H2 30 38 ml min-1, air 300 ml min-1, N2 makeup 30 ml min-1 and He 23 cm s-1 at 150\u2103. Retention times of reference standards were recorded and used for identifying the FAME components from each sample. 2.8.2 Analysis of seed batches About 2.5 mg of dry seeds from each line were weighed and transferred into 1 cm \u00d7 10 cm glass tubes (pre-washed with chloroform and dried) with Teflon screw caps. 1 mL of freshly prepared 5% (v\/v) concentrated sulfuric acid in methanol, 25 \u03bcL of BHT solution (0.2% w\/v butylated hydroxyl toluene in methanol), and 300 \u03bcL of toluene with internal standard (triheptadecanoin, 12.5 \u03bcg\/300 \u03bcL) were added to each tube. All the tubes were then vortexed for 30 s and heated at 90\u2103 for 2 h. 1.5 mL of 0.9% NaCl (w\/v) were added to each sample after cooling on ice. FAMEs from each tube were extracted by using 2 mL hexane twice, evaporated under N2, dissolved in 50 \u03bcL of hexane and transferred to GC vials. Samples were then loaded on the GC and run under the same conditions as described for single seed GC analysis. 39 CHAPTER 3: RESULTS AND DISCUSSION 3.1 Characterization of the LACS8 gene 3.1.1 Real time PCR analysis of LACS8 expression in different organs To confirm the expression patterns of LACS8 obtained from digital northern analysis, quantitative real time PCR (qPCR) was used to investigate the transcription profile of the LACS8 gene in developing roots, stems, leaves, flower buds, developing seeds and seedlings of wild type Arabidopsis (Figure 3.1). Mean Normalized Expression 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 Root Stem Leaf Flower Seed Seedling E x p r e s s i o n  l e v e l s  r e l a t i v e  t o   G A P C Mean Normalized Expression 0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 1.8 Root Stem Leaf Flower Seed Seedling E x p r e s s i o n  l e v e l s  r e l a t i v e  t o   G A P C Figure 3. 1 Organ-specific expression patterns of LACS8 detected by quantitative real time PCR LACS8 expression level is normalized to GAPC expression. Developing seeds were collected at 7 days post anthesis (DPA). Roots and seedling were 3 weeks old. Two biological replicates were performed (the upper and lower panel, respectively). Error bars indicate SE calculated from 3 experimental replicates. 40 In comparison with the internal standard GAPC, highest LACS8 mRNA accumulation was detected in developing seeds, followed by leaves and seedlings. Relatively low levels of transcript were found in roots, stems and flower buds. The high transcript levels of LACS8 detected in developing seeds of 7 days post anthesis (DPA) coincided with the period of maximal oil deposition and suggested that LACS8 might be involved in providing acyl-CoA precursors for TAG biosynthesis. 3.1.2 In situ hybridization of LACS8 in the embryo Spatial distribution of LACS8 mRNA in Arabidopsis developing seeds was further analyzed in more details in an in situ hybridization experiment (Figure 3.2). In all of the developing embryos tested, the LACS8 transcript was generally present in the whole embryo. This further indicated that LACS8 might contribute to the oil production in the seed. Figure 3.2 In situ localization of LACS8 mRNA Sections of Arabidopsis developing seeds hybridized to anti-sense LACS8 RNA probe (A-C) and sense LACS8 RNA probe (D). Hybridization is indicated by a purple precipitate produced as a result of an alkaline phosphatase reaction with the nitroblue tetrazolium\/5-bromo-4-chloro-3- indolyl phosphate substrate. A. 6 DPA, B. 7 DPA, C. 9 DPA. 41 3.1.3 GUS activity assays of LACS8 expression To verify the qPCR results and more precisely define the organ specificity of LACS8 expression, a 1,667-bp genomic fragment containing the 5\u2019 UTR and a part of the coding region of the LACS8 was fused to GUS reporter gene (P LACS8 : GUS) and the construct was introduced into wild type plants. Consistent with the qPCR and in situ hybridization results, histochemical analysis of GUS activity in transgenic plants harbouring P LACS8 : GUS showed a high level of expression throughout embryo development (Figure 3.3). In addition, GUS activity was also detected in roots, stems, leaves, flowers and siliques. In the top 3 cm of the stem GUS was expressed in all cell types. Figure 3.3 Organ-specific expression pattern of LACS8 detected in LACS8promoter: GUS lines Tissues were incubated in X-gluc assay buffer. Gus activity is indicated by a blue precipitate. Developing seeds were aligned as from 3 DPA to 12 DPA. 42 3.1.4 Subcellular localization of the YFP-LACS8 fusion A previous study by Shockey et al. (2002) revealed that LACS9 was localized to the outer membrane of the plastid. To determine if LACS8 is also localized in the chloroplast envelope, the LACS8 coding sequence under the control of the 35S promoter was C- terminally fused to the sequence encoding YFP and the construct was transformed into wild type Arabidopsis. Leaves of several transgenic lines with different expression levels of YFP-LACS8 were analyzed by confocal microscopy. In all cases the YFP fluorescence was found in a reticulate network typical of the ER (Figure 3.4). The same reticulate network was also marked by hexyl rhodamine B, a dye that stains the ER in plants. Figure 3.4 ER localization of YFP-LACS8 fusion protein (A) ER network stained by hexyl rhodamine B. (B) YFP-LACS8 fluorescence labeled ER network. Image C was obtained by merging (A) and (B). 3.1.5 Summary LACS8 is expressed in all the organs and tissues examined, and the highest expression levels were observed in the developing seeds and embryos. Unlike the highly 43 homologous LASC9 which was localized to the chloroplast, LACS8 was found to be associated with the ER network. 3.2 T-DNA insertional SALK line analyses 3.2.1 Genotyping SALK lines To investigate if the LACS8 isozyme is involved in seed TAG biosynthesis and determine if it has overlapping functions with LACS9, and\/or LACS1 in seed oil metabolism, several SALK T-DNA insertional lines (Alonso et al., 2003) for LACS8 (At2g04350), LACS9 (At1g77850), and LACS1 (At2g47240) were obtained from the ABRC stock center. Two sets of PCR amplifications using LP+RP and LBA1+RP primer combinations were carried out for each line to identify the homozygous mutants with inserts in both homologous chromosomes. To determine the nature of the gene disruption in individual T-DNA insertional lines, genomic regions from each line were amplified by PCR and sequenced. The sequence information was compared to the wild type (Columbia 0 ecotype) and the location of T-DNA in each line is shown in Figure 3.5. 44 Figure 3.5 Genomic organizations of LACS genes and locations of T-DNA insertions in the SALK lines The coding sequence is represented by a colored box, the untranslated regions and introns are indicated by solid lines. Vertical arrows above the genes indicate the positions of the T-DNA insertions. 3.2.2 RT-PCR analysis of homozygous mutants To examine the effect of gene disruption on transcript accumulation in each homozygous mutant, RT-PCR assays using total leaf RNA were carried out (Figure 3.6). These assays demonstrated that lacs8-3, lacs8-4, lacs9-1, lacs9-2, lacs9-4 and all LACS1 alleles except lacs1-1 have wild type-like steady-state transcript levels. Reduced transcript abundance was detected in lacs8-1, lacs8-2, lacs9-3, and lacs1-1. Transcript levels of lacs9-5, lacs9-6, and lacs9-7 were affected most severely. Since lacs8-1, lacs9-5 and lacs1-1 probably represent null alleles, they were selected for further study in my project, unless otherwise specified. 45 Figure 3.6 RT-PCR analyses of LACS8, LACS9 and LACS1 steady state transcript levels in mutant and wild type leaves RT-PCR was performed using total RNA and the expression level of GAPC was used as a control. Two different sets of primers were applied to assess the transcript abundance of LACS8 alleles: Gene-specific results depicted in LACS8 (P1) correspond to a unique set of primers ranging from the end of the first exon of the gene to the beginning of the third exon; LACS8 (P2) results correspond to a set of primers spanning the region from the ninth to the tenth exon. 3.2.3 Visible phenotypes of single, double, and triple mutants Although mRNA levels of the LACS1 gene in all lacs1 mutant alleles were shown to be quite similar to wild type, lacs1-1, lacs1-3, lacs1-4 and lacs1-5 plants displayed bright green glossy stems and small siliques (Figure 3.7), suggesting altered cuticular wax deposition on the stem surface and reduced fertility of these mutant lines. A recently published paper (L\u0171 et al., 2009) revealed that LACS1 was the gene mutated in the eceriferum (cer) 8, a wax deficient mutant exhibiting partial male sterility under low humidity (Koornneef et al 1989). This result suggests that LACS1 may be involved in providing activated fatty acids for cuticular wax production and pollen development. In contrast to lacs1, none of the lacs8 or lacs9 alleles were distinguishable from wild type 46 plants in appearance, growth rate, or seed germination, even though some of the alleles were transcriptional knock outs. Figure 3.7 Phenotypes of wild type Arabidopsis and lacs1 mutant A is wild type Columbia 0, B is lacs1-4. To investigate whether LACS8, LACS9 and LACS1 have overlapping functions, pair- wise crosses were made between lacs8-1, lacs9-5 and lacs1-4 alleles to generate double and triple mutants. With the exception of lacs8-1lacs9-5, all the other double mutants and the lacs1lacs8lacs9 triple mutant had similar phenotypes to lacs1 single mutants, including bright green glossy stems and small siliques. Interestingly, seeds from small siliques developed on double and triple mutants were much larger, darker and heavier than those from normal siliques (Figure 3.8). 1000 seeds of lacs1lacs9 and lacs1lacs8lacs9 weighed ~33 mg and ~30 mg, respectively, whereas the average weight of wild type seeds was ~22 mg. These increases corresponded to about 47.6% and 36.2% over wild type dry seed weight, respectively. 47 Figure 3.8 Seed phenotypes of lacs1lacs9 and lacs1lacs8lacs9mutants A. Photos were taken under dissecting microscope using 20 \u00d7 magnifications. B. Weight of 1000 mutant and wild type seeds. Error bars indicate standard error (SE) (n=3). 3.2.4 Biochemical phenotypes of single, double, and triple mutants To directly determine whether LACS1, LACS8, and LACS9 isozymes were involved in seed oil production, TAG content in the seeds of corresponding lacs mutants was measured by GC. As shown in Figure 3.9, lacs1 and lacs1lacs8 were found to have wild type TAG content, while lacs8, lacs9, and lacs8lacs9 mutant lines displayed only a slight decrease in TAG accumulation. On the other hand, a drop in TAG content was much more pronounced in lacs1lacs9 and lacs1lacs8lacs9 mutants, reaching approximately 10.8% and 11.9%, respectively. These results suggest that there is virtually no functional redundancy between LACS1 and LACS8 or LACS8 and LACS9 whereas LACS1 and LACS9 isozymes likely have overlapping functions in TAG production. Thus, even though LACS9 and LACS8 exhibit the highest degree of sequence identity, 48 their functional relationship in seed oil production is not as close as that between LACS1 and LACS9. The evidence that LACS1 can also contribute to TAG production was unexpected, since LACS1 has been shown to participate in wax and cutin biosynthesis (L\u0171 et al., 2009). Figure 3.9 Comparisons of seed oil content between single, double and triple mutants and their corresponding wild types Data are expressed as mean percentages \u00b1 SE (n=3 replicate analyses performed on seed lots from each line with 120-140 seeds analyzed\/replicate). Student T-test was applied to the data. * means p<0.01 and ** means p<0.0005. Because the lacs1lacs9 double mutant and lacs1lacs8lacs9 triple mutant had heavier seeds than the wild type, I wanted to determine if the TAG content in these seeds was actually reduced when expressed per unit seed weight. I therefore performed single seed GC analysis on these mutants and their corresponding wild types (Table 3.1). The results for 12 randomly selected seeds for each line revealed that the average fatty acid content in the mutant is ~12 \u00b5g\/seed, considerably higher than in the wild type measured at ~9 \u00b5g\/seed. No changes in seed fatty acid composition between the wild type and lacs mutants were detected (data not shown). 49 Table 3. 1The amount of total fatty acids measured in lacs1lacs9 and lacs1lacs8lacs9 mutants 12 seeds from each genotype were chosen for single seed GC analysis. Average values were expressed as mean \u00b1 standard deviation (SD) (n=12). As shown in Table 3.1 and Figure 3.10, the fatty acid content is 32.2% higher in lacs1lacs9 and 34.2% higher in lacs1lacs8lacs9 when compared to the the wild type. Considering that the dry seed weights of lacs1lacs9 and lacs1lacs8lacs9 are 47.6% and 36.2% heavier than that of wild type, respectively, the oil content (% of dry seed weight) of the mutants is still lower than that of the wild type. Figure 3.10 Comparison of fatty acid content in lacslacs9 and lacs1lacs8lacs9 mutants with their corresponding wild types Error bars indicate SD calculated for each line (n=12). Student T-test was performed on the data, where ** indicates p<0.0005. 50 3.2.5 Real time PCR analysis of LACS expression in lacs mutants Given the fact that lacs1lacs9 and lacs1lacs8lacs9 mutants showed a significant reduction of seed TAG content in comparison to the wild type, which was also much more substantial than that measured in mutants disrupted in individual LACS genes, it is reasonable to suggest that LACS1 and LACS9 may have overlapping functions in TAG biosynthesis. I was interested in investigating if disruptions of individual LACS genes involved in TAG accumulation were reflected in compensatory changes in the transcript levels of the remaining functional TAG-related LACS genes. The transcriptional activity measurements for LACS1, LACS8 and LACS9 in lacs1, lacs8 and lacs9 mutants were carried out by real time PCR (Figure 3.11). 51 Figure 3.11 LACS gene expression levels in lacs1 and lacs9 mutants Using GAPC as an internal standard, target gene expression levels were normalized and compared between each mutant and the corresponding wild type. Two biological replicates (only one is shown) were carried out on leaf material from two generations. Error bars represent SE calculated from three experimental replicates. Primer efficiency for LACS1, LACS9, and GAPC were 0.9991, 0.9994, and 0.9833, respectively. Consistent with previous RT-PCR results, LACS1 and LACS9 transcripts were significantly decreased in lacs1 and lacs9 single mutants, respectively, when compared with the corresponding wild types. LACS1 transcript was found to be increased in lacs9 mutant, a result which was reproducible in both biological replicates. Similarly, LACS9 52 expression was up-regulated in lacs1 mutant, but this result was not reproducible. In contrast, LACS8 transcript levels were not altered in either lacs1 or lacs9 mutants. The interpretation of these data could be that an overall decrease in LACS activity and\/or a corresponding drop in TAG content caused by reduced activity of one of the LACS isozymes, may trigger enhanced transcription of functionally related LACS genes. For example, LACS1 transcription may be up-regulated to compensate for the low abundance of LACS9 mRNA in the lacs9 mutant. Since LACS8 transcript levels did not change in either lacs1 or lacs9 mutant, LACS8 isozyme may not participate in the same lipid biosynthetic pathway as LACS1 and LACS9 do, namely TAG biosynthesis. Another possibility is that the relationship between LACS8 and the two LACS isozymes involved in TAG formation could not be detected in leaf tissue. 3.2.6 Summary lacs1, lacs8, and lacs9 single mutants did not display biologically significant changes in seed oil content. However, the lacs1lacs9 double mutant and the lacs1lacs8lacs9 triple mutant showed reduced seed oil content of 10.8% and 11.9%, respectively. Redundancy between LACS1 and LACS9 in providing sufficient acyl-CoAs for TAG production is proposed. Increased mRNA levels of alternative, functionally related LACS genes were detected in lacs mutants disrupted in single LACS genes. 3.3 Over-expression of LACS8, LACS9, and FATB genes in the seed 3.3.1 Over-expression of LACS8, LACS9, or FATB individually The pFAE1::LACS8, pFAE1::FATB and pFAE1::LACS9 plasmids were introduced into A. tumefaciens, and used to transform wild type Arabidopsis. Fifteen primary transgenic (T1) lines for each construct were selected, the plantlets grown to maturity, and T2 seeds harvested. At the same time, 8 independent control transgenic lines carrying only the empty vector (pZP211) were generated. GC analyses of these transgenic lines (T2 generation) were carried out and the results are shown in Figures 3.12-3.14. 53 Figure 3.12 Oil content of transgenic Arabidopsis lines transformed with the LACS8 cDNA under the control of a seed-specific promoter-pFAE1 T2 lines were sampled in triplicate, each sample consisting of ~0.25mg seeds. Transgenic plants with empty vector pZP211 and non-transformed wild type (nt-WT) plants were used as controls. 3 samples of seeds from each line were analyzed. Error bars indicate SE. Seed oil content is shown in nt-WT plants (black bar), empty plasmid controls (gray bar) and different transformed lines (red bars). Student T-test was applied to the data, where* indicates significant decrease of seed oil content (p<0.001). Most of the transgenic lines displayed a similar TAG yield as wild type, some lines showed decreased TAG content, but no lines with considerably higher TAG content were found. The decrease in seed oil content may be the result of co-suppression. However, this possibility needs to be confirmed by expression analysis of transgenes. 54 Figure 3.13 Oil content of transgenic Arabidopsis lines transformed with the FATB cDNA under the control of a seed-specific promoter-pFAE1 T2 lines were sampled in triplicate, each sample consisting of ~0.25mg seeds. Transgenic plants with empty vector pZP211 and non-transformed wild type (nt-WT) plants were used as controls. 3 samples of seeds from each line were analyzed. Error bars indicate SE. Seed oil content is shown in nt-WT plants (black bar), empty plasmid controls (gray bar) and different transformed lines (purple bars). Student T-test was applied to the data, where* indicates significant decrease of seed oil content (p<0.001). 55 Figure 3.14 Oil content of transgenic Arabidopsis with the LACS9 cDNA under the control of a seed-specific promoter-pFAE1 T2 lines were sampled in triplicate, each sample consisting of ~0.25mg seeds. Transgenic plants with empty vector pZP211 and non-transformed wild type (nt-WT) plants were used as controls. 3 samples of seeds from each line were analyzed. Error bars indicate SE. Seed oil content is shown in nt-WT plants (black bar), empty plasmid controls (gray bar) and different transformed lines (pink bars). Student T-test was applied to the data, where* indicates significant decrease of seed oil content (p<0.001). For over-expression of LACS8 in the seed, pCAMBIA1380 vector with the same seed-specific promoter pFAE1 was also used. A total of 23 transgenic (T1) plants were selected on hygromycin plates. The T2 seeds were individually harvested from each plant and grown to harvest the T3 seeds. In addition, homozygous T3 lines were identified before the seeds were subjected to GC analysis. As shown in Figure 3.15, the results were similar to those obtained using the pZP211 binary vector, with decreased oil content in some of the lines, but no lines with increased seed oil content were detected. Homozygous lines that showed varied oil content were also examined in T4 generation (Figure 3.16), but in general all the T4 lines had a similar TAG content to the wild type. 56 Figure 3.15 Oil content of T3 seeds transformed with LACS8 cDNA behind the FAE1 promoter in pCAMBIA1380 vector Error bars represent SD calculated from four batches of seeds from individual plants in the same transgenic lines. Black bar indicates the oil content of nt-WT plants. Homozygous plants used for GC analysis in T4 generation came from the lines that are labeled with *. Figure 3.16 Oil content of T4 seeds transformed with LACS8 behind the FAE1 promoter in pCAMBIA1380 vector Seeds from fourteen homozygous plants were examined, all of which showed similar oil content to wild type plants. Error bars are SE (n=3) and black bar represents nt-WT. Student T-test was applied and * indicates p<0.01. 57 3.3.2 Simultaneous over-expression of LACS9 and FATB or LACS8, LACS9, and FATB FATB encodes an acyl-ACP thioesterase, an enzyme that releases fatty acids from ACP and may be an important component of fatty acid export out of the plastid. I decided to over-express this gene together with LACS9 and LACS8 in a seed-specific manner. Plasmids containing LACS9 and FATB or LACS8, LACS9 and FATB driven by the FAE1 promoter were transformed into wild type plants. As shown in Figures 3.17 and 3.18, simultaneous expression of LACS9 and FATB or a combination of LACS8, LACS9 and FATB was not effective in increasing seed oil content above wild type levels. Figure 3.17 Oil content of transgenic Arabidopsis with the FATB and LACS9 cDNA under the control of a seed-specific promoter-pFAE1 T2 lines were sampled in triplicate, each sample consisting of ~0.25mg seeds. Transgenic plants with empty vector pZP211 and non-transformed wild type (nt-WT) plants were used as controls. Error bars indicate SE (n=3). Seed oil content is shown in nt-WT plants (black bar), empty plasmid controls (gray bar) and different transformed lines (yellow bars). Student T-test was applied to the data, where * indicates significant decrease of seed oil content (p<0.001). 58 Figure 3.18 Oil content of transgenic Arabidopsis with the FATB, LACS8 and LACS9 cDNAs under the control of a seed-specific promoter-pFAE1 T2 lines were sampled in triplicate, each sample consisting of ~0.25mg seeds. Transgenic plants with empty vector pZP211 and non-transformed wild type (nt-WT) plants were used as controls. Error bars indicate SE (n=3). Seed oil content is shown in nt-WT plants (black bar), empty plasmid controls (gray bar) and different transformed lines (green bars). Student T-test was applied to the data, where * indicates significant decrease of seed oil content (p<0.001). 3.3.3 Summary Transgenic expression of LACS8, LACS9 and FATB genes individually or simultaneously under the control of the seed-specific FAE1 promoter did not result in higher TAG content in the T2, T3, or T4 generation of transformants. This may be due to the fact that LACS and FATB activities are not limiting factors for TAG biosynthesis. Moreover, introduction of these transgenes into Arabidopsis seed often decreased TAG accumulation, possibly as a result of co-suppression even though this idea has not been confirmed by expression analyses of transgenes in transformed lines. 59 CHAPTER 4: CONCLUSIONS AND FUTURE DIRECTIONS 4.1 Conclusions The major goals of my MSc thesis were to investigate if LACS8 isozyme contributes to seed TAG biosynthesis, if it functionally overlaps with LACS9, and LACS1 in seed TAG deposition and whether LACS enzymes can be used to improve TAG content of the seed. The major findings are summarized below: 1. LACS8 gene is broadly expressed in all the reproductive and vegetative organs or tissues. The highest LACS8 expression was detected in the developing embryos. Unlike the highly homologous LASC9 which was localized to the chloroplast, LACS8 is associated with the ER network. 2. lacs8 mutants are indistinguishable from wild type plants in appearance. They exhibit a slight decrease in seed oil content but do not display any changes in seed fatty acid composition. 3. Even though LACS8 and LACS9 share very high amino acid sequence identity and similarity, they do not seem to be functionally redundant in providing acyl-CoAs for TAG production in the seed. This conclusion is based on the GC analysis of the lacs8lacs9 double mutant which has almost identical TAG content to the lacs8 mutant. 4. Surprisingly, analyses of the lacs1lacs9 double mutant and the lacs1lacs8lacs9 triple mutant revealed that there is redundancy between LACS1 and LACS9 in supplying acyl-CoAs for seed TAG biosynthesis. 5. Seed-specific expression of LACS8, LACS9 and FATB genes either individually or simultaneously did not lead to increased TAG content in the T2 generation of transgenic plants. Re-evaluation of seed oil content in subsequent generations is needed once stable lines with a defined number of transgenes are generated. 60 4.2 Future directions 4.2.1 Expression analysis of LACS1\/LACS9 in the seed GC analysis showed that the lacs1lacs9 double mutant and the lacs1lacs8lacs9 triple mutant displayed lower oil content than the wild type suggesting that LACS1 and LACS9 enzymes are both involved in providing precursors for TAG biosynthesis in the seed. Computer based e-northern analysis also indicates high expression levels of both genes in developing seeds and embryos. E-northern data should be confirmed by expression analysis of both LACS1 and LACS9 using promoter-reporter gene activity assays in transgenic plants and in situ hybridization assays. In addition, co-localization studies of LACS1 and LACS9 isoforms tagged with fluorescent proteins by confocal microscopy should be carried out. 4.2.2 LACS enzyme activity assays in the seed of lacs mutants Based on my data described in this thesis, it is clear that several LACS isozymes may be acting redundantly in providing precursors for TAG production in the seed. LACS activity assays in the seeds of lacs mutants would be valuable in unraveling the contributions of different LACS isozymes to TAG biosynthesis. 4.2.3 Seed oil analysis of the T3 and T4 generations of LACS8\/LACS9\/FATB transgenic lines Even though the transgenic lines expressing the LACS8\/LACS9\/FATB gene combination driven by FAE1 promoter did not exhibit increased TAG content in the T2 generation, some of the lines displayed a lower oil content perhaps caused by co- suppression of the introduced gene\/genes. To test this possibility, real time PCR using seed mRNA should be performed. If this is indeed the case, T3 or T4 generations of these transgenic lines may obtain fewer copies of the introduced transgenes due to segregation. Therefore, the overall transgene transcript levels may be lower than in the T2 generation and would not trigger co-suppression, but would still be relatively high. This could result 61 in higher accumulation\/activity of LACS8\/LASC9\/FATB enzymes and elevated oil content in the seed. 4.2.4 Characterization of the remaining LACS genes (LACS3\/LACS4\/LACS5) Of the nine members in the Arabidopsis LACS gene family, only LACS3, LACS4, and LACS5 have not been studied to date. Obtaining information on the biochemical functions of LACS3, LACS4, and LACS5 isozymes and their localization in different cell types and organs is essential for understanding their specific roles in fatty acid metabolic pathways, as well as the overall contributions of this family of enzymes to plant lipid metabolism. 62 REFERENCES Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK, Zimmerman J, Barajas P, Cheuk R, Gadrinab C, Heller C, Jeske A, Koesema E, Meyers CC, Parker H, Prednis L, Ansari Y, Choy N, Deen H, Geralt M, Hazari N, Hom E, Karnes M, Mulholland C, Ndubaku R, Schmidt I, Guzman P, Aguilar-Henonin L, Schmid M, Weigel D, Carter DE, Marchand T, Risseeuw E, Brogden D, Zeko A, Crosby WL, Berry CC, Ecker JR (2003) Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301: 653-657 Alting-Mees MA, Sorge JA, Short JM (1992) pBluescriptII: multifunctional cloning and mapping vectors. Methods Enzymol 216, 483-495 Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tool. J Mol Biol 215: 403-410 Andrews J, Keegstra K (1983) Acyl-coenzyme A synthetase is located in the outer membrane and acyl-CoA thioesterase in the inner membranes of pea chloroplast envelopes Pisum sativum. Plant Physiol 72: 735-740 Awai K, Xu C, Tamot B, Benning C (2006) A phosphatidic acid-binding protein of the chloroplast inner envelope membrane involved in lipid trafficking. Proc Natl Acad Sci USA 103: 10817-10822 Bessire M, Chassot C, Jacquat AC, Humphry M, Borel S, Petetot JM, Metraux JP, Nawrath C (2007) A permeable cuticle in Arabidopsis leads to a strong resistance to Botrytis cinerea. EMBO J 26: 2158-2168 Bibb MJ, Sherman DH, Omura S, Hopwood DA (1994) Cloning, sequencing and deduced functions of a cluster of Streptomyces genes probably encoding biosynthesis of the polyketide antibiotic frenolicin. Gene 142: 31-39 63 Bonaventure G, Salas JJ, Pollard MR, Ohlrogge JB (2003) Disruption of the FATB gene in Arabidopsis demonstrates an essential role of saturated fatty acids in plant growth. Plant Cell 15: 1020-1033 Browse J, McConn M, James D, Miquel M (1993) Mutants of Arabidopsis deficient in the synthesis of \u03b1-linolenate. Biochemical and genetic characterization of the endoplasmic reticulum linoleoyl desaturase. J Biol Chem 268: 16345-16351 Browse JA, McCourt P, Somerville CR (1986) Fatty acid composition of leaf lipids determined after combined digestion and fatty acid methyl ester formation from fresh tissue. Anal Biochem 152: 141-145 Browse J, Somerville C (1991) Glycerolipid synthesis: biochemistry and regulation. Annu Rev Plant Physiol Plant Mol Biol 42: 467-506 Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735-743 Coen ES, Romero JM, Doyle S, Elliott R, Murphy G, Carpenter R (1990) floricaula: A homeotic gene required for flower development in Antirrhinum majus. Cell 63: 1311-1322 Conti E, Franks NP, Brick P (1996) Crystal structure of firefly luciferase throws light on a superfamily of adenylate-forming enzymes. Structure 4: 287-298 Conti E, Stachelhaus T, Marahiel MA, Brick P (1997) Structural basis for the activation of phenylalanine in the non-ribosomal biosynthesis of gramicidin S. EMBO J 16: 4174-4183 Dahlquist A, Stahl U, Lenman M, Banas A, Lee M, Sandager L, Ronne H (2000) Phospholipid: diacylglycerol acyltransferase: An enzyme that catalyzes the acyl-CoA-independent formation of triacylglycerol in yeast and plants. Proc Natl Acad Sci USA 97: 6487-6492 64 Datla RS, Hammerlindl JK, Panchuk B, Pelcher LE, Keller W (1992) Modified binary plant transformation vectors with the wild-type gene encoding NPTII. Gene 122: 383-384 Deblaere R, Reynaerts A, Hofte H, Hernalsteens JP, Leemans J, Van Montagu M (1987) Vectors for cloning in plant cells. Methods Enzymol 153: 277-292 Doermann P, Voelker TA, Ohlrogge JB (1995) Cloning and expression in Escherichia coli of a novel thioesterase from Arabidopsis thaliana specific for long-chain acyl-acyl carrier proteins. Arch Biochem Biophys 316: 612-618 Doermann P, Voelker TA, Ohlrogge JB (2000) Accumulation of palmitate in Arabidopsis mediated by the acyl-acyl carrier protein thioesterase FATB1. Plant Physiol 123: 637-644 Downing WL, Mauxion F, Fauvarque MO, Reviron MP, de Vienne D, Vartanian N, Giraudat J (1992) A Brassica napus transcript encoding a protein related to the Kunitz protease inhibitor family accumulates upon water stress in leaves, not in seeds. Plant J 2: 685-693 Earley KW, Haag JR, Pontes O, Opper K, Juehne T, Song K, Pikaard CS (2006) Gateway-compatible vectors for plant functional genomics and proteomics. Plant J 45(4): 616-629 Edwards K, Johnstone C, Thompson C (1991) A simple and rapid method for the preparation of plant genomic DNA for PCR analysis. Nucleic Acid Res 19: 1349 Fox BG, Shanklin J, Somerville CR, Munck E (1993) Stearoyl-acyl carrier protein desaturase from Ricinus communis is a diiron-oxo protein. Proc Natl Acad Sci USA 90: 2486-2490 Frentzen M (1998) Acyltransferases from basic science to modified seed oils. Lipid\/Fett 100: 161-166 65 Frey-Wyssling A, Grieshaber E, Muhlethaler K (1963) Origin of spherosomes in plant cells. J Ultrastruct Res 8: 506-516 Fulda M, Heinz E, Wolter FP (1997) Brassica napus cDNAs encoding fatty acyl-CoA synthetase. Plant Mol Biol 33: 911-922 Fulda M, Shockey J, Werber M, Wolter FP, Heinz E (2002) Two long-chain acyl- CoA synthetases from Arabidopsis thaliana involved in peroxisomal fatty acid \u03b2-oxidation. Plant J 32 93-103 Gordon JI, Duronio RJ, Rudnick DA, Adams SP, Gokel GW (1991) Protein N- myristoylation. J Biol Chem 266: 8647\u20138650 Hajdukiewicz P, Svab Z, Maliga P (1994) The small versatile pPZP family of Agrobacterium binary vectors for plant transformation. Plant Mol Biol 25: 989- 994 Hakozaki H, Park JI, Endo M, Takada Y, Kaazama T, Takeda Y, Suzuki G, Kawagishi-Kobayashi M, Watanabe M (2008) Expression and developmental function of the 3-ketoacyl-ACP synthase2 gene in Arabidopsis thaliana. Genes and Genet Syst 83: 143-152 Herman EM (1994) Cell and molecular biology of seed oil bodies. In Seed Development and Germination, Kigel H, Galili G, eds (New York: Marcel Dekker), pp. 195- 214 Hooker TS, Lam P, Zheng H, Kunst L (2007) A core subunit of the RNA- processing\/degrading exosome specifically influences cuticular wax biosynthesis in Arabidopsis. Plant Cell 19: 904-917 Huang AHC (1992) Oil bodies and oleosins in seeds. Annu Rev Plant Physiol Plant Mol Biol 43: 177-200 Huang A (1996) Oleosins and oil bodies in seeds and other organs. Plant Physiol 110: 1055-1061 66 Huijser P, Klein J, Lonnig WE, Meijer H, Saedler H, Sommer H (1992) Bracteomania, an inflorescence anomaly, is caused by the loss of function of the MADS-box gene squamosa in Antirrhinum majus. EMBO J 11: 1239-1249 Ishitani M, Liu J, Halfter U, Kim CS, Shi W, Zhu JK (2000) SOS3 function in plant salt tolerance requires N-myristoylation and calcium binding. Plant Cell 12: 1667\u20131678 Jacks TJ, Hensarling TP, Neucere JN, Yatsu LY, Barker RH (1990) Isolation and physiocochemical characterization of the half-unit membranes of oilseed lipid bodies. J Am Oil Chem Soc 67: 353-361 Jefferson RA (1987) Assaying chimeric genes in plants: The GUS gene fusion system. Plant Mol Biol Rep 5: 387-405 Jetter R, Kunst L (2008) Plant surface lipid biosynthetic pathways and their utility for metabolic engineering of waxes and hydrocarbon biofuels. Plant J 54: 670-683 Joyard J, Block MA, Malherbe A, Marachal E, Douce R (1993) Origin and synthesis of glactolipid and sulfolipid headgroups. In Lipid Metabolism in Plants, T.S. Moore, Jr., ed (Boca Raton, FL: CRC Press), pp. 231-258 Katavic V, Reed DW, Taylor DC, Giblin EM, Barton DL, Zou J, Mackenzie SL, Covello PS, Kunst L (1995) Alteration of seed fatty acid composition by an ethyl methanesulfonate-induced mutation in Arabidopsis thaliana affecting diacylglycerol acyltransferase activity. Plant Physiol 108: 399-409 Kinney, AJ (1993) Phospholipid headgroups. In Lipid Metabolism in Plants. T.S. Moore, Jr., ed (Boca Raton, FL: CRC Press). Pp. 259-284 Koncz C, Schell J (1986) The promoter of TL-DNA gene 5 controls the tissue-specific expression of chimeric genes carried by a novel type of Agrobacterium binary vector. Mol Gen Genet 204: 383-396 Koornneef M, Hanhart CJ, Thiel F (1989) A genetic and phenotypic description of eceriferum (cer) mutants in Arabidopsis thaliana. J Hered 80: 118-122 67 Lu C, Hills MJ (2002) Arabidopsis mutants deficient in diacylglycerol acyltransferase display increased sensitivity to abscisic acid, sugars, and osmotic stress during germination and seedling development. Plant Physiol 129: 1352-1358 L\u0171 S, Song T, Kosma DK, Parson EP, Rowland O, Jenks MA (2009) Arabidopsis CER8 encodes a long-chain acyl-CoA synthetase 1 (LACS1) that has overlapping functions with LACS2 in plant wax and cutin synthesis. Plant J Early view online) Martin ML, Busconi L (2000) Membrane localization of a rice calcium-dependent protein kinase (CDPK) is mediated by myristoylation and palmitoylation. Plant J 24: 429\u201343 Miquel M, Browse J (1992) Arabidopsis mutants deficient in polyunsaturated fatty acid synthesis. Biochemical and genetic characterization of a plant oleoyl- phosphatidylcholine desaturase. J Biol Chem 267: 1502-1509 Murphy DJ (1990) Storage lipid bodies in plants and other organisms. Prog Lipid Res 29: 299-324 Murphy DJ (1993) Structure, function, and biogenesis of storage lipid bodies and oleosins in plants. Prog Lipid Res 32: 247-280 Ohlrogge J, Browse J (1995) Lipid Biosynthesis. Plant Cell 7: 957-970 Pidkowich MS, Nguyen HT, Heilmann I, Ischebeck T, Shanklin J (2007) Modulating seed \u03b2-ketoacyl-acyl carrier protein synthase II level converts the composition of a temperate seed oil to that of a palm-like tropical oil. Proc Natl Acad Sci USA 104: 4742-4747 Pollard M, Ohlrogge J (1999) Testing models of fatty acid transfer and lipid synthesis in spinach leaf using in vivo oxygen-18 labeling. Plant Physiol 121: 1217-1226 Pongdontri P, Hills M (2001) Characterization of a novel plant acyl-coA synthetase that is expressed in lipogenic tissues of Brassica napus L. Plant Mol Biol 47: 717- 726 68 Routaboul J, Benning C, Bechtold N, Caboche M, Lepiniec L (1999) The TAG1 locus of Arabidopsis encodes for a diacylglycerol acyltransferase. Plant Physiol Biochem 37: 831-840 Salas JJ, Ohlrogge JB (2002) Characterization of substrate specificity of plant FatA and FatB acyl-ACP thioesterases. Arch Biochem Biophys 403: 25-34 Schnurr JA, Shockey JM, Boer GJ, Browse JA (2002) Fatty acid export from the chloroplast. Molecular characterization of a major plastidial acyl-coenzyme A synthetase from Arabidopsis. Plant Physiol. 129: 1700-1709 Schnurr J, Shockey J, Browse J (2004) The acyl-CoA synthetase encoded by LACS2 is essential for normal cuticle development in Arabidopsis. Plant Cell 16: 629-642 Shanklin J, Cahoon EB (1998) Desaturation and related modifications of fatty acids. Annu Rev Plant Physiol Plant Mol Biol 49: 611-641 Shanklin J, Somerville C (1991) Stearoyl-acyl-carrier-protein desaturase from higher plants is structurally unrelated to the animal and fungal homologues. Proc Natl Acad Sci USA 8: 10-14 Shockey JM, Fulda MS, Browse JA (2002) Arabidopsis contains nine long-chain acyl- coenzyme A synthetase genes that participate in fatty acid and glycerolipid metabolism. Plant Physiol 129: 1710-1722 Siloto RMP, Findlay K, Lopez-Villalobos A, Yeung E, L. Nykiforuk C, Moloney MM (2006) The accumulation of oleosins determines the size of the seed oilbodies in Arabidopsis. Plant Cell 18: 1961-1974 Sperling P, Lee M, Girke T, Zahringer U, Stymne S, Heinz E (2000) A bifunctional delta-fatty acyl acetylenase\/desaturase from the moss Ceratodon purpureus: a new member of the cytochrome b5 superfamily. Eur J Biochem 267:3801-3811 Slabas AR, Simon JW, Brown AP (2001) Biosynthesis and regulation of fatty acids and triglycerides in oil seed rape. Current status and future trends. Eur J Lipid Sci Technol 103: 455-466 69 Somerville CR, Ogren WL (1982) Isolation of photorespiratory mutants of Arabidopsis. In RB Hallick, NH Chua, eds Methods in Chloroplast Molecular Biology. Elsevier, New York, pp 129-139 Tai H, Jaworski JG (1993) 3-ketoacyl-acyl carrier protein synthase III from spinach (Spinacia oleracea) is not similar to other condensing enzymes of fatty acid synthase. Plant Physiol 103: 1361-1367 Tulloch AP (1976) Chemistry of waxes of higher plants. In Chemistry and Biochemistry of Natural Waxes (Kolattukudy, P.E., ed.). Amsterdam: Elsevier, pp. 235-287. Tzen JTC, Cao YZ, Laurent P, Ratnayake C, Huang AHC (1993) Lipids, proteins, and structure of seed oilbodies from diverse species. Plant Physiol 101: 267-276 Tzen JT, Huang AH (1992) Surface structure and properties of plant seed oilbodies. J Cell Biol 117: 327-335 Tzen JTC, Lai YK, Chan KL, Huang AHC (1990) Oleosin isoforms of high and low molecular weights are present in the oilbodies of diverse seed species. Plant Physiol 94:1282-1289 Vincze T, Posfai J, Roberts RJ (2003) NEB cutter: a program to cleave DNA with restriction enzymes. Nucleic Acid Res 31: 3688-3691 Voelker TA, Jones A, Cranmer AM, Davies HM, Knutzon DS (1997) Broad-range and binary-range acyl-acyl-carrier protein thioesterases suggest an alternative mechanism for medium-chain production in seeds. Plant Physiol 114: 669-677 Voelker T, Kinney AJ (2001) Variations in the biosynthesis of seed-storage lipids. Annu Rev Plant Physiol Plant Mol Biol 52: 335-361 von Wettstein-Knowles PM (1993) Waxes, cutin and suberin. In Lipid Metabolism in Plants, Moore TS, Jr ed (Boca Raton, FL: CRC Press) pp. 127-166 Yalovsky S, Rodriguez-Concepcion M, Gruissem W (1999) Lipid modifications of proteins-slipping in and out of membranes. Trends Plant Sci 4: 439\u2013445 70 Zolman BK, Silva ID, Bartel B (2001) The Arabidopsis pxal mutant is defective in an ATP-binding cassette transporter-like protein required for peroxisomal fatty acid beta-oxidation. Plant Physiol 127: 1266-1278 Zou J, Wei Y, Jako C, Kumar A, Selvaraj G, Taylor DC (1999) The Arabidopsis thaliana TAG1 mutant has a mutation in a diacylglycerol acyltransferase gene. Plant J 19: 645-653","@language":"en"}],"Genre":[{"@value":"Thesis\/Dissertation","@language":"en"}],"GraduationDate":[{"@value":"2009-11","@language":"en"}],"IsShownAt":[{"@value":"10.14288\/1.0067310","@language":"en"}],"Language":[{"@value":"eng","@language":"en"}],"Program":[{"@value":"Botany","@language":"en"}],"Provider":[{"@value":"Vancouver : University of British Columbia Library","@language":"en"}],"Publisher":[{"@value":"University of British Columbia","@language":"en"}],"Rights":[{"@value":"Attribution-NonCommercial-NoDerivatives 4.0 International","@language":"en"}],"RightsURI":[{"@value":"http:\/\/creativecommons.org\/licenses\/by-nc-nd\/4.0\/","@language":"en"}],"ScholarlyLevel":[{"@value":"Graduate","@language":"en"}],"Title":[{"@value":"Characterization of the role of Arabidopsis long-chain acyl-coenzyme A synthetase 8 in seed oil biosynthesis","@language":"en"}],"Type":[{"@value":"Text","@language":"en"}],"URI":[{"@value":"http:\/\/hdl.handle.net\/2429\/10654","@language":"en"}],"SortDate":[{"@value":"2009-12-31 AD","@language":"en"}],"@id":"doi:10.14288\/1.0067310"}