{"@context":{"@language":"en","Affiliation":"http:\/\/vivoweb.org\/ontology\/core#departmentOrSchool","AggregatedSourceRepository":"http:\/\/www.europeana.eu\/schemas\/edm\/dataProvider","Campus":"https:\/\/open.library.ubc.ca\/terms#degreeCampus","Creator":"http:\/\/purl.org\/dc\/terms\/creator","DateAvailable":"http:\/\/purl.org\/dc\/terms\/issued","DateIssued":"http:\/\/purl.org\/dc\/terms\/issued","Degree":"http:\/\/vivoweb.org\/ontology\/core#relatedDegree","DegreeGrantor":"https:\/\/open.library.ubc.ca\/terms#degreeGrantor","Description":"http:\/\/purl.org\/dc\/terms\/description","DigitalResourceOriginalRecord":"http:\/\/www.europeana.eu\/schemas\/edm\/aggregatedCHO","Extent":"http:\/\/purl.org\/dc\/terms\/extent","FileFormat":"http:\/\/purl.org\/dc\/elements\/1.1\/format","FullText":"http:\/\/www.w3.org\/2009\/08\/skos-reference\/skos.html#note","Genre":"http:\/\/www.europeana.eu\/schemas\/edm\/hasType","GraduationDate":"http:\/\/vivoweb.org\/ontology\/core#dateIssued","IsShownAt":"http:\/\/www.europeana.eu\/schemas\/edm\/isShownAt","Language":"http:\/\/purl.org\/dc\/terms\/language","Program":"https:\/\/open.library.ubc.ca\/terms#degreeDiscipline","Provider":"http:\/\/www.europeana.eu\/schemas\/edm\/provider","Publisher":"http:\/\/purl.org\/dc\/terms\/publisher","Rights":"http:\/\/purl.org\/dc\/terms\/rights","RightsURI":"https:\/\/open.library.ubc.ca\/terms#rightsURI","ScholarlyLevel":"https:\/\/open.library.ubc.ca\/terms#scholarLevel","Title":"http:\/\/purl.org\/dc\/terms\/title","Type":"http:\/\/purl.org\/dc\/terms\/type","URI":"https:\/\/open.library.ubc.ca\/terms#identifierURI","SortDate":"http:\/\/purl.org\/dc\/terms\/date"},"Affiliation":[{"@value":"Medicine, Faculty of","@language":"en"}],"AggregatedSourceRepository":[{"@value":"DSpace","@language":"en"}],"Campus":[{"@value":"UBCV","@language":"en"}],"Creator":[{"@value":"Huang, Kun","@language":"en"}],"DateAvailable":[{"@value":"2008-08-12T20:53:41Z","@language":"en"}],"DateIssued":[{"@value":"2008","@language":"en"}],"Degree":[{"@value":"Doctor of Philosophy - PhD","@language":"en"}],"DegreeGrantor":[{"@value":"University of British Columbia","@language":"en"}],"Description":[{"@value":"In neurons, modification by the lipid palmitate regulates trafficking and function of signaling molecules, neurotransmitter receptors and associated synaptic scaffolding proteins. HIP14 (huntingtin interacting protein 14) is the first identified and characterized mammalian palmitoyl transferase that regulates this process. I have shown that HIP14 has striking effects on modulating trafficking and function of many proteins important for synapse formation and plasticity such as PSD-95, a postsynaptic scaffolding molecule.\n\nThe importance of the finding that HIP14 is a neuronal palmitoyl transferase is further emphasized by our recent discovery that huntingtin protein folding, trafficking and function are regulated by the enzyme HIP14. Expansion of the polyglutamine tract in huntingtin as seen in Huntington Disease (HD) results in reduced association with HIP14 and decreased palmitoylation of huntingtin, which contributes to the formation of inclusion bodies and enhanced neuronal toxicity. By manipulating HIP14 levels through expression or knockdown, we can manipulate the number of huntingtin inclusion bodies and neuronal cell viability. Overall, these discoveries offer novel mechanism for HD pathogenesis and provide new approaches to therapy for HD.\n\nThe tight association of HIP14 with wild-type huntingtin, which differs from other known enzyme-substrate interactions, indicates that huntingtin serves other functions beyond being a substrate of HIP14. I have discovered that, in vitro, wild-type huntingtin may facilitate activity of HIP14 to palmitoylate other neuronal substrates such as SNAP25, PSD95 and GAD65. By contrast, mutant htt does not act this way, probably due to lack of interaction with HIP14. Furthermore, immunoprecipitated HIP14 from huntingtin+\/- mice also exhibits less enzyme activity in palmitoylating GST-SNAP25 in vitro, suggesting that decreased huntingtin expression compromises HIP14 activity. In vivo, using Acyl Biotin Exchange assay, I have also found that palmitoylation of a number of presynaptic and postsynaptic proteins that are involved in neurotransmission are reduced in huntingtin+\/- mice. This study not only ascribes an important biochemical function to wild-type huntingtin, but also suggests that defects in protein palmitoylation in general due to mutant huntingtin lack of ability to facilitate HIP14 activity may contribute to the pathogenesis of HD.","@language":"en"}],"DigitalResourceOriginalRecord":[{"@value":"https:\/\/circle.library.ubc.ca\/rest\/handle\/2429\/1356?expand=metadata","@language":"en"}],"Extent":[{"@value":"8177281 bytes","@language":"en"}],"FileFormat":[{"@value":"application\/pdf","@language":"en"}],"FullText":[{"@value":" Identification of Novel Palmitoyl Acyl Transferases and Characterization of The Role of Huntingtin Palmitoylation in Huntington Disease   by  KUN HUANG B.Sc., Peking University, 2003      A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY  in  THE FACULTY OF GRADUATE STUDIES (Neuroscience)     THE UNIVERSITY OF BRITISH COLUMBIA VANCOUVER  August 2008 \u00a9 Kun Huang, 2008  ii ABSTRACT In neurons, modification by the lipid palmitate regulates trafficking and function of signaling molecules, neurotransmitter receptors and associated synaptic scaffolding proteins. HIP14 (huntingtin interacting protein 14) is the first identified and characterized mammalian palmitoyl transferase that regulates this process. I have shown that HIP14 has striking effects on modulating trafficking and function of many proteins important for synapse formation and plasticity such as PSD-95, a postsynaptic scaffolding molecule.  The importance of the finding that HIP14 is a neuronal palmitoyl transferase is further emphasized by our recent discovery that huntingtin protein folding, trafficking and function are regulated by the enzyme HIP14.  Expansion of the polyglutamine tract in huntingtin as seen in Huntington Disease (HD) results in reduced association with HIP14 and decreased palmitoylation of huntingtin, which contributes to the formation of inclusion bodies and enhanced neuronal toxicity. By manipulating HIP14 levels through expression or knockdown, we can manipulate the number of huntingtin inclusion bodies and neuronal cell viability. Overall, these discoveries offer novel mechanism for HD pathogenesis and provide new approaches to therapy for HD.  The tight association of HIP14 with wild-type huntingtin, which differs from other known enzyme-substrate interactions, indicates that huntingtin serves other functions beyond being a substrate of HIP14. I have discovered that, in vitro, wild-type huntingtin may facilitate activity of HIP14 to palmitoylate other neuronal substrates such as SNAP25, PSD95 and GAD65. By contrast, mutant htt does not act this way, probably due to lack of interaction with HIP14. Furthermore, immunoprecipitated HIP14 from huntingtin+\/- mice also exhibits less enzyme activity in palmitoylating GST-SNAP25 in vitro, suggesting that decreased huntingtin expression compromises HIP14 activity. In vivo, using Acyl Biotin Exchange assay, I have also found that palmitoylation of a number of presynaptic and postsynaptic proteins that are involved in neurotransmission are reduced in huntingtin+\/- mice. This study not only ascribes an important biochemical function to wild-type huntingtin, but also suggests that defects in protein palmitoylation in general due to mutant huntingtin lack of ability to facilitate HIP14 activity may contribute to the pathogenesis of HD.    iii TABLE OF CONTENTS ABSTRACT ........................................................................................................................ ii TABLE OF CONTENTS ................................................................................................... iii LIST OF TABLES ............................................................................................................ vii LIST OF FIGURES .......................................................................................................... viii LIST OF ABBREVIATIONS ............................................................................................. x ACKNOWLEDGEMENTS .............................................................................................. xii CO-AUTHORSHIP STATEMENT ................................................................................. xiii 1. CHAPTER 1   INTRODUCTION .............................................................................. 1 1.1. PROTEIN PALMITOYLATION ....................................................................... 2 1.1.1 General Introduction ................................................................................... 2 1.1.2 New approaches for studying protein palmitoylation ................................. 3 1.1.2.1 New methods for rapid detection of palmitoylated proteins ................... 4 1.1.2.2 Approaches to study palmitate turnover.................................................. 8 1.1.2.3 Assessment of the dynamics of palmitoylated proteins in live cells ..... 10 1.1.3 Palmitoylation as a signal for protein sorting to specific membrane microdomains ............................................................................................................ 11 1.1.3.1 Control of presynaptic protein trafficking by palmitoylation ............... 12 1.1.3.2 Control of postsynaptic protein trafficking by palmitoylation .............. 15 1.1.3.3 Palmitoylation influences dendritic spine development........................ 18 1.1.4 Modulation of neuronal signaling by palmitoylation ................................ 21 1.1.5 Palmitate cycling controls protein trafficking and function ...................... 22 1.1.6 Enzymes involved in the modulation of protein palmitoylation ............... 25 1.1.7 Concluding remarks .................................................................................. 31 1.2. HUNTINGTON DISEASE ............................................................................... 32 1.2.1 Huntington Disease Clinical Features ....................................................... 32 1.2.2 Neuropathology ......................................................................................... 33 1.2.2.1 Patterns of Neuronal degeneration ........................................................ 33 1.2.2.2 Neuronal Inclusions............................................................................... 34 1.2.3 HD Genetics .............................................................................................. 38 1.2.4 Mouse Models Used in Studying huntingtin and HD ............................... 39 1.2.4.1 Huntingtin knockout mice (huntingtin-\/- and huntingtin+\/-) ................ 39 1.2.4.2 HD Transgenic Mice ............................................................................. 40 1.2.4.2.1 Full-length huntingtin transgenic mice (Human huntingtin)........... 41 1.2.4.2.2 Knock-in transgenic mouse models (Mouse huntingtin) ................ 41 1.2.4.2.3 N-terminal huntingtin transgenic mouse models ............................ 42 1.2.5 Function of Huntingtin .............................................................................. 43 1.2.5.1 Huntingtin is essential for development ................................................ 44 1.2.5.2 Huntingtin is involved in transcriptional regulation ............................. 45 1.2.5.3 Neuroprotective Role of Huntingtin ...................................................... 46 1.2.5.4 Huntingtin and synaptic transmission ................................................... 47 1.2.5.5 The Relevance of WT Huntingtin function to the Pathogenesis of HD 48 1.2.6 Post-Translational Modification of huntingtin .......................................... 50 1.3. PALMITOYLATION AND HUMAN DISEASE ............................................ 51 1.4. THESIS HYPOTHESIS AND OBJECTIVES .................................................. 55 1.5. BIBLIOGRAPHY ............................................................................................. 58  iv 2. CHAPTER 2         Huntingtin Interacting Protein HIP14 Is A Palmitoyl Transferase Involved in Palmitoylation and Trafficking of Multiple Neuronal Proteins ..................... 74 2.1. INTRODUCTION ............................................................................................. 75 2.2. MATERIALS AND METHODS ...................................................................... 76 2.2.1 Constructs, cDNA Cloning and Mutagenesis ........................................... 76 2.2.2 Cell Culture, Transfection and Time Lapse Imaging ................................ 77 2.2.3 Immunofluorescence ................................................................................. 78 2.2.4 Electron microscopy .................................................................................. 78 2.2.5 Cell Radiolabeling and Immunoprecipitation ........................................... 79 2.2.6 Expression and Purification of Fusion Proteins ........................................ 79 2.2.7 Immunoprecipitation of HIP14 GFP ......................................................... 80 2.2.8 Synthesis of Palmitoyl CoA ...................................................................... 80 2.2.9 Palmitoylation Assay................................................................................. 81 2.2.10 HIP14 siRNA ............................................................................................ 81 2.2.11 Imaging and Analysis ................................................................................ 82 2.3. RESULTS.......................................................................................................... 83 2.3.1 HIP14 is a neuronal palmitoyl transferase ................................................ 83 2.3.2 Multiple Neuronal Proteins Serve as Substrates for HIP14 ...................... 86 2.3.3 HIP14 associates with multiple vesicular compartments. ......................... 91 2.3.4 Palmitoylation Dependent Trafficking is Regulated by HIP14 ................ 95 2.4. DISCUSSION ................................................................................................. 103 2.5. BIBLIOGRAPHY ........................................................................................... 106 3. CHAPTER 3       Palmitoylation Of Huntingtin By HIP14 Is Essential For Its Trafficking And Function................................................................................................ 108 3.1. INTRODUCTION ........................................................................................... 109 3.2. MATERIALS AND METHODS .................................................................... 110 3.2.1 Antibodies ............................................................................................... 110 3.2.2 DNA mutagenesis and cloning ................................................................ 111 3.2.3 Cell culture and transfections .................................................................. 111 3.2.4 [3H]-palmitoylation assay and immunoprecipitation .............................. 111 3.2.5 Huntingtin co-immunoprecipitation with HIP14 .................................... 112 3.2.6 Immunofluorescence and time-lapse imaging......................................... 112 3.2.7 Terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) assay ....................................................................................................... 112 3.2.8 Cell death assay ....................................................................................... 113 3.2.9 Imaging and Anaylsis .............................................................................. 113 3.2.10 Flotation assay ......................................................................................... 113 3.2.11 Labeling with biotin-conjugated 1-biotinamido-4-[4- (maleimidomethyl)cyclohexanecarboxamido] butane (Btn-BMCC) ...................... 114 3.2.12 Viral infection ......................................................................................... 114 3.3. RESULTS........................................................................................................ 115 3.3.1 Palmitoylation of huntingtin at Cys214 is modulated by CAG size ....... 115 3.3.2 Palmitoylation regulates distribution and function of huntingtin............ 119 3.3.3 HIP14 regulates the palmitoylation and trafficking of huntingtin .......... 128 3.4. DISCUSSION ................................................................................................. 136 3.5. BIBLIOGRAPHY ........................................................................................... 139  v 4. CHAPTER 4         Neuronal Palmitoyl Acyl Transferases Exhibit Distinct Substrate Specificity........................................................................................................................ 142 4.1. INTRODUCTION ........................................................................................... 143 4.2. MATERIALS AND METHODS .................................................................... 146 4.2.1 Plasmid Constructions ............................................................................. 146 4.2.2 Antibodies and chemicals........................................................................ 146 4.2.3 Cell Culture and Transfections ................................................................ 147 4.2.4 Immunocytochemistry and Imaging........................................................ 147 4.2.5 Immunoprecipitation and Immunoblotting ............................................. 147 4.2.6 Btn-BMCC Labeling ............................................................................... 148 4.2.7 Statistical Analysis .................................................................................. 148 4.3. RESULTS........................................................................................................ 149 4.3.1 DHHC-3, -8, -13 (HIP14L) and \u201317 (HIP14) all reside in the golgi compartment ............................................................................................................ 149 4.3.2 DHHC-3, -8, -13 (HIP14L) and \u201317 (HIP14) exhibit distinct substrate preferences .............................................................................................................. 151 4.3.3 Expression of DHHC proteins alters the distribution and trafficking of their respective substrates........................................................................................ 157 4.3.4 DHHC enzymes interact with their respective substrates ....................... 159 4.3.5 Regions distinct from the DHHC catalytic domain determines the specificity between substrates and enzymes ........................................................... 162 4.4. DISCUSSION ................................................................................................. 164 4.5. BIBLIOGRAPHY ........................................................................................... 169 5. CHAPTER 5      Huntingtin Regulates the Enzymatic Activity of the Neuronal Palmitoyl Transferase HIP14 .......................................................................................... 171 5.1. INTRODUCTION ........................................................................................... 172 5.2. MATERIALS AND METHODS .................................................................... 173 5.2.1 Plasmids .................................................................................................. 173 5.2.2 Antibodies and Chemicals ....................................................................... 174 5.2.3 Western blotting analysis ........................................................................ 175 5.2.4 Cell culture and transfections .................................................................. 175 5.2.5 Synthesis of Palmitoyl CoA .................................................................... 175 5.2.6 Immunoprecipitation ............................................................................... 176 5.2.7 Palmitoylation Assay............................................................................... 176 5.2.8 Btn-BMCC labeling ................................................................................ 177 5.2.9 Yeast 2 hybrid analysis ........................................................................... 177 5.3. RESULTS........................................................................................................ 178 5.3.1 Huntingtin and HIP14 form a tight complex that has enzymatic activity178 5.3.2 Only HIP14 and HIP14L palmitoylate huntingtin .................................. 179 5.3.3 Interaction of HIP14 and huntingtin is distinct from other palmitoylation enzyme-substrate interaction ................................................................................... 180 5.3.4 Palmitoylation of GST-SNAP25 by GST-HIP14 is potentiated in vitro in the presence of wildtype but not mutant huntingtin ................................................ 183 5.3.5 HIP14 activity in mice lacking wildtype huntingtin (huntingtin+\/-) is significantly reduced ............................................................................................... 188 5.4. DISCUSSION ................................................................................................. 192  vi 5.5. BIBLIOGRAPHY ........................................................................................... 194 6. CHAPTER 6   Conclusions ..................................................................................... 196 6.1. SUMMARY OF FINDINGS .......................................................................... 197 6.2. ROLE OF PALMITOYLATION IN THE MOLECULAR FUNCTION OF HUNTINGTIN ............................................................................................................ 200 6.2.1 Palmitoylation associates huntingtin with the membranes ..................... 200 6.2.2 Palmitoylation may modify huntingtin folding ....................................... 200 6.2.3 Huntingtin palmitoylation and other posttranslational modification ...... 201 6.2.4 Palmitoylation and protein nuclear localiazation .................................... 202 6.3. GLOBAL DEFFECTS IN PALMITOYLATION MAY UNDERLIE HD .... 203 6.4. HUNTINGTIN PAMLITOYLATION AS A THERAPUETIC TARGET .... 204 6.5. OTHER PALMITOYLATION SITES OF HUNTINGTIN ........................... 204 6.6. FUTURE DIRECTIONS................................................................................. 206 6.6.1 HIP14-\/- and HIP14L-\/- mice ................................................................. 206 6.6.2 HIP14 and\/or HIP14L transgenic mice cross YAC128 mice .................. 207 6.7. CONCLUSIONS ............................................................................................. 207 6.8. BIBLIOGRAPHY ........................................................................................... 208 APPENDIX ..................................................................................................................... 210 A.1 REAGENTS AND SAMPLES ....................................................................... 210 A.1.1 Mouse Lines ............................................................................................ 210 A.1.2 Antibodies ............................................................................................... 210 A.2 EXPERIMENT PROCEDURES .................................................................... 212 A.2.1 Primary Neuronal Culture and Transfection ........................................... 212 A.2.2 Cell Lysis and Tissue Preparation ........................................................... 213 A.2.3 Immunoprecipitations.............................................................................. 214 A.2.4 Immunoblotting ....................................................................................... 215 A.2.5 Expression and Purification of GST-Fusion Proteins ............................. 215 A.2.6 Synthesis of Palmitoyl CoA .................................................................... 216 A.2.7 Palmitoylation Assay............................................................................... 217 A.2.8 Btn-BMCC assay..................................................................................... 217 A.2.9 Immunofluorescence techniques ............................................................. 218 A.2.10 Electron microscopy ................................................................................ 219 A.2.11 Cell Radiolabeling with 3H palmitate ..................................................... 219 A.2.12 Bioinformatics ......................................................................................... 220 A.3 BIBLIOGRAPHY ........................................................................................... 221   vii LIST OF TABLES Table 1.1. A table that summarizes some of the key candidate palmitoylated proteins identified by the ABE method. .................................................................................... 7 Table 1.2. Evidence against a relationship between inclusions or amyloid plaques and disease specific pathology ......................................................................................... 35 Table 1.3. CAG sizes for alleles in the HD gene. ............................................................. 39 Table 1.4. Pathophysiological functions of DHHC proteins ............................................. 55 Table 2.1. Summary of Changes in the Localization of Palmitoylated Proteins in the Presence of HIP14 in Both COS Cells and Neurons. ................................................ 97 Table 6.1. Predicted palmitoylation sites in full length huntingtin with high cutoff value  ................................................................................................................................. 205 Table 6.2. Predicted palmitoylation sites in full length huntingtin with medium cutoff value ........................................................................................................................ 205   viii LIST OF FIGURES Figure 1.1. Schematic illustration of \u201cfatty acyl exchange labeling\". ................................. 5 Figure 1.2. Acyl-Biotin Exchange approach for detection of palmitoylated proteins. ....... 6 Figure 1.3. Schematic representation of the reaction for the detection of palmitoylated proteins using a fatty acid analog. ............................................................................... 8 Figure 1.4 Palmitoylation is required for PSD-95 clustering at the synapse. ..................... 9 Figure 1.5. Proposed role for palmitoylation in regulation of presynaptic vesicle exocytosis and neurotransmitter release. ................................................................... 14 Figure 1.6. Palmitoylation acts as a signal for protein sorting to specific membrane microdomains. ........................................................................................................... 16 Figure 1.7. Proposed roles for palmitoylation in regulating dendritic spine development and morphology......................................................................................................... 20 Figure 1.8. Dynamic palmitate turnover regulates signalling by GPCR pathways. ......... 22 Figure 1.9. Palmitoylation-dependent cycling of Ras between the plasma membrane and the Golgi. ................................................................................................................... 24 Figure 1.10. Proposed role for Palmitoyl Acyl Transferases (PATs) and Thioesterases (APTs) in regulation of palmitate addition and removal........................................... 25 Figure 1.11. The phylogenetic tree of mouse DHHC protein family. ............................... 27 Figure 1.12. Domain structures of mammalian DHHC proteins, DHHC-3 and DHHC-17 (HIP14). ..................................................................................................................... 28 Figure 1.13. Neuronal intranuclear inclusions (NIIs) in the brains of HD mice and human HD patients. ............................................................................................................... 34 Figure 1.14. Wild-type but not mutant huntingtin facilitates cortical BDNF mRNA production.................................................................................................................. 47 Figure 1.15. Schematic diagram of N terminal huntingtin amino acid sequence, proteolysis sites and post-translational modification sites. ....................................... 50 Figure 1.16. Putative roles of huntingtin palmitoylation. ................................................. 53 Figure 2.1. HIP14 is a Neuronal Palmitoyl Transferase. .................................................. 85 Figure 2.2. HIP14 Palmitoylates Multiple Substrates. ...................................................... 88 Figure 2.3. HIP14 palmitoylates specific neuronal proteins. ............................................ 89 Figure 2.4. HIP14 Palmitoylation and Golgi Localization Requires the DHHC Domain. 90 Figure 2.5. Localization of HIP14 With Endosomal Markers in NT2 Cells. .................... 92 Figure 2.6. Association of HIP14 with Golgi and Cytoplasmic Vesicles. ........................ 94 Figure 2.7. HIP14 Modulates Trafficking of Palmitoylated Proteins in Neurons. ........... 96 Figure 2.8. Differential Distribution of Acylated Proteins in Cells Expressing HIP14. ... 98 Figure 2.9. Manipulation of Endogenous Expression of HIP14 Alters Clustering of PSD- 95 in Neurons. ......................................................................................................... 101 Figure 2.10. Interference with Endogenous Expression of HIP14 reduces axonal clustering of GAD-65 in Neurons. .......................................................................... 102 Figure 3.1. Huntingtin is associated with detergent resistant membranes and Cysteine 214 is conserved in all species analyzed. ....................................................................... 117 Figure 3.2. Huntingtin is palmitoylated in neurons and COS cells. Palmitoylation is modulated by CAG size. ......................................................................................... 118 Figure 3.3.  Increased inclusions of palmitoylation-resistant mutant htt in COS cells. .. 120 Figure 3.4. Altered distribution of palmitoylation resistant huntingtin in HEK-293 cells.  ................................................................................................................................. 121  ix Figure 3.5.  Plamitate on huntingtin turns over and inhibition of palmitoylation increases the inclusion formation............................................................................................ 123 Figure 3.6. Altered distribution of palmitoylation-resistant mutant huntingtin in COS cells and neurons. ............................................................................................................ 124 Figure 3.7. Enhanced toxicity of palmitoylation-resistant mutant huntingtin................. 127 Figure 3.8. HIP14 influences the distribution and catalyzes the palmitoylation of htt in neurons. ................................................................................................................... 130 Figure 3.9. HIP14 associates less with mutant htt, and mutant htt is less palmitoylated in vivo. ......................................................................................................................... 132 Figure 3.10. Knockdown of HIP14 in neurons by HIP14 specific siRNA. .................... 134 Figure 3.11. HIP14 regulates the palmitoylation and distribution of huntingtin in vivo. 135 Figure 4.1. Structures and Localizations of four neuronal DHHC proteins. ................... 150 Figure 4.2. DHHC-3, -8, HIP14L (DHHC-13) and HIP14 do not colocalize with early endosomal marker or with ER marker. ................................................................... 151 Figure 4.3. Validation of ABE-Acyl Biotin Exchange-method with substrate SNAP25.  ................................................................................................................................. 153 Figure 4.4. Application of ABE method to identify substrate and DHHC enzyme specificity. ............................................................................................................... 155 Figure 4.5. Palmitoylation of GAD65, GABAA receptor \u03b32 subunit, AMPA receptor GluR1 subunit and synaptotagmin VII by DHHC-3, -8, -13 and HIP14. ............... 156 Figure 4.6. DHHC enzymes Modulates Trafficking of their respective Palmitoylated substrates. ................................................................................................................ 158 Figure 4.7. DHHC enzymes specifically interact with their respective palmitoylated substrates. ................................................................................................................ 161 Figure 4.8. The substrate specificity is determined by specific domains of the DHHC enzymes. .................................................................................................................. 163 Figure 5.1. huntingtin and HIP14 form a complex in the brain. ..................................... 179 Figure 5.2. Among DHHC proteins, only HIP14 and HIP14L palmitoylate huntingtin. 180 Figure 5.3. The interaction of HIP14 and htt requires ankyrin repeats domain and is palmitoylation independent. .................................................................................... 182 Figure 5.4. Huntingtin (htt) increases HIP14 activity to palmitoylate GST-SNAP25 in vitro. ........................................................................................................................ 184 Figure 5.5. Palmitoylation of PSD95 and GAD65 by HIP14 in vitro can also be enhanced by huntingtin. .......................................................................................................... 186 Figure 5.6. Potentiation of enzymatic activity by huntingtin is unique to HIP14. .......... 187 Figure 5.7. Palmitoylation of GAD65 by HIP14 in COS cells can also be enhanced when wt huntingtin is co-expressed. ................................................................................. 188 Figure 5.8. HIP14 from huntingtin+\/- mice exhibits less palmitoylation enzyme activity toward GST-SNAP25. ............................................................................................. 189 Figure 5.9. Global analysis of palmitoylation reveals palmitoylation defect in a number of neuronal proteins in huntingtin+\/- mice. ................................................................. 190 Figure 5.10. Confirmation of PSD95 and SNAP25 palmitoylation defect in huntingtin+\/- mice by ABE assay. ................................................................................................ 191   x LIST OF ABBREVIATIONS 2BP                  2-bromopalmitate ABE  acyl biotin exchange AMPAR  \u03b1-amino-3-hydroxy-5-methylisoxazole-4-propionic acid type glutamate receptors ANK ankyrin repeat APT acyl-protein thioesterase biotin-BMCC   1-biotinamido-4-[4\u2019-(maleididomethyl) cyclohexanecarboxamido] butane CaMK  Ca2+\/calmodulin-dependent protein kinase CBP cAMP response-element binding protein (CREB)-binding protein CRD cysteine rich domain CSP cysteine string protein DAPI  4\u2019,6-diamidino-2-phenylindole DIV days in vitro DMEM  Dulbecco\u2019s Modified Eagle\u2019s Medium ECL  Electrochemiluminescence EM Electron microscopic eNOS  endothelial nitric oxide synthase FRAP  fluorescence recovery after photobleaching GABA \u03b3-aminobutyric acid GAD  glutamic acid decarboxylase GAP  Growth cone associated protein GCP golgi complex protein GFP green fluorescent protein GKAP guanylate kinase-associated protein GPCR  G-protein-coupled receptor HAM Hydroxylamine HRP horseradish peroxidase IPTG Isopropyl \u0001-D-1-thiogalactopyranoside KA Kainic acid NEM   N-ethylmaleimide NMDA  N-methyl-D-aspartic acid PDZ   postsynaptic density-95 (PSD-95)\/Discs large\/zona occludens-1 PFA paraformaldehyde PPT   protein palmitoyl thioesterase RGS  regulators of G-protein signalling SFK  Src family of non-receptor tyrosine kinases siRNA small interference RNA SNARE soluble NSF (N-ethylmaleimide-sensitive factor) attachment receptor SUMO  small ubiquitin-related modifier TBP tata-binding protein TOR target of rapamycin TMD transmembrane domain  xi TUNEL  Terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling UCHL1  ubiquitin carboxy-terminal hydrolase L1 WT wildtype YAC  yeast artificial chromosome   xii ACKNOWLEDGEMENTS I would like to dedicate this work to my dear friend and supervisor Alaa El-Husseini, who has supported me for almost five years with his incredible enthusiasm in research and care for my growth as a person. Alaa, I miss you terribly, your contagious laugh, your blue eyes sparkling with wisdom, and the sunshine you have brought to the lab. With the days passing by, the pain of having lost you, our dear friend and mentor, only seems to intensify. As the Chinese proverb says, \u201cBeing my teacher for a day, you are a teacher for me for a life-time,\u201d I will always learn from your wisdom, strength and good heart the rest of my life.  I would also like to thank Michael Hayden who has given me immeasurable amount of support since the start of my PhD project and especially during this difficult time when Alaa has passed away. The experience of collaborating and working with you has provided me with an incredible opportunity to grow and learn.  To my PhD committee members, Yutian Wang, Lynn Raymond and Weihong Song, thank you for generously giving your time, expertise and suggestions to better my work. Steve Vincent, thank you for taking me for a 3-month orientation in your lab and for generously supporting me along the way.  I am also very grateful to the members of AEH lab. Every one of you has been a treasure in my life. Rujun Kang, Ester Yu, and Cindy Jiang, thank you for your friendship and technical advice. Pamela Astikaitis, Marie-france Lise, Kimerbly Gerrow, Rochelle Hines, Josh Levison, Dove, Keith, Daria Krivosheya and Catherine Campell, I am lucky to have known you and been your labmate for the last 5 years. Besides a great amount of technical support and intellectual advice, you guys have always been an endless source of positive attitude and fun. Special thanks to all of you for being my English teachers. With each day, our friendship and love for each other will only grow stronger and stronger.  Many thanks to people in the Hayden Lab, Anat Yanai, Roshni Singaraja, Fiona Young, Simon Warby, Rona Graham, Lu Gan and many others for your excellent techniques, intellectual advice and friendship.  There are many of my peers who have had a positive influence on my research and have been a great source of inspiration in my life. I am very grateful to Mannie Fan, Allan Kwan, Liz Wong, Lily Zhang, Alicia Davis, Vijay Viswanathan, Soroush Moghaddam, Souraya Mansour, Hideto Takahashi, Lylia Nini, and other members of the Detwiller Pavillion \u2013 there are too many to name you all.  I would never have come this far without my old university friends, whom I reunited with in Vancouver, Jing Fan, Shanshan Zhu, Chao Tai, Xuefeng Liu, Xiaocao Qu, Ning Zhou and Dongchuan Wu. With you guys, I have always felt like being at home.  Finally, endless thanks to Erik Vanerstrom and mother. Thank you for being my lovely family.  xiii CO-AUTHORSHIP STATEMENT  For Chapter 2, I performed the GST protein purification, designed and performed the in vitro palmitoylation assays, made the HIP14 siRNA to study the neuronal protein trafficking, and wrote the manuscript. Pamela Arstikaitis did the live imaging to look at the vesicular trafficking of  HIP14 in COS cells. Anat Yanai and Rujun Kang designed and made the constructs of HIP14, SNAP25, PSD95 and synaptotagmin I. Roshni R. Singaraja initially identified HIP14 as a huntingtin interacting protein. Brendan Haigh purfied His-tagged huntingtin. Claire-Anne Gutekunst provided Electron Microscopy image of HIP14 localization in brains.  For Chapter 3, I conducted all the Btn-BMCC palmitoylation assays for full-length huntingtin, scored cells for inclusions in huntingtin-transfected COS cells and neurons, designed and characterized HIP14 siRNA, performed all experiments (and corresponding data analysis) in which the alteration of huntingtin trafficking was investigated by knocking down HIP14, conducted the virus production and infection experiments, and scored for TUNEL assay. Anat Yanai performed all DNA manipulations to generate truncated and full-length mutant huntingtin and HIP14 proteins, and performed most of the [ 3 H]palmitoylation assays and data analyses. Runjun Kang performed endogenous huntingtin [ 3 H]palmitoylation assay, scored inclusions in neurons transfected with full- length huntingtin, and performed fragment-huntingtin toxicity assay and the corresponding data analysis. Roshni Singaraja and Lu Gan performed the huntingtin and HIP14 coimmunoprecipitation experiment. Anat Yanai and I wrote the manuscript.  For Chapter 4, I designed the experiments, and performed the biotin labeling palmitoylation assays and immunostainings in this manuscript. Pamela Arstikaitis performed endogenous HIP14, synaptophysin and PSD95 staining in primary culture neurons (Figure 4.1D). Tony Cijsouw validated the acyl biotin labeling method with substrate SNAP25 (Figure 4.3B) and Lylia Nini performed western blot of Figure 4.3C. Anat Yanai assisted in making ANK-DHHC-3 construct. Anat Yanai and Roshni Singaraja provided intellectual help. I performed the data analysis for all experiments, generated the figures, and wrote the manuscript.  For Chapter 5, I designed the experiments, and performed the biotin labeling palmitoylation assays and the in vitro palmitoylation assay in this manuscript. Junmei Wan precipitated and purified all the palmitoylated proteins from wildtype and huntingtin+\/- mice. I performed western blot and did the quantifications. Roshni Singaraja provided the yeast 2-hybrid result (Figure 5.2). Anat Yanai made the HIP14 \u2206ANK and HIP14 \u2206DHHC constructs. Akio Kihara from Igarashi lab provided all the DHHC constructs. I performed the data analysis for all experiments, generated the figures, and wrote the manuscript.          1. CHAPTER 1   INTRODUCTION  2 1.1. PROTEIN PALMITOYLATION 1.1.1 General Introduction Fatty acylation increases protein hydrophobicity and promotes association with the lipid bilayer, the most common being prenylation, myristoylation, and palmitoylation (reviewed in(Resh 1999)).  Prenylation and myristoylation are stable modifications and occur co-translationally. In contrast, palmitoylation is a reversible posttranslational modification by which palmitate, a 16 carbon fatty acid, is covalently linked to proteins. Palmitoylation often refers to S-acylation, which is the covalent linkage of a 16 carbon saturated fatty acid to cysteine residues via a thioester bond(Resh 1999; Smotrys and Linder 2004). Being reversible, palmitoylation can be modulated by specific signaling pathways(Resh 1999; Qanbar and Bouvier 2003; Smotrys and Linder 2004). Thus, addition and removal of palmitate may provide an important tool for dynamically regulating responses to diverse cellular stimuli. Less frequent is N-palmitoylation, which occurs on the luminal side of secreted proteins(Chamoun et al. 2001). Palmitate modifies numerous soluble and integral membrane proteins in neurons(el-Husseini Ael and Bredt 2002). In cytosolic proteins, palmitoylation occurs primarily at cysteine residues found near the amino- and carboxy- termini. Modification of cysteines located at internal sites adjacent to transmembrane domains or in conjunction with other lipid modifications has also been documented. This proximity presumably strengthens interactions with lipid membranes. In the case of dually lipidated proteins, such as N-myristoylation on Gly residues or prenylation at C terminal CaaX motifs, palmitoylation of these proteins usually occurs at adjacent sites, and requires myristoylation or prenylation, prior to palmitoylation. Examples of this modification  3 include: signal-transducing proteins, such as guanine-nucleotide-binding protein-\u03b1 (G\u03b1) subunits, non-receptor tyrosine kinases, small GTPase Ras, and the filopodia inducing protein paralemmin. However, not all prenylated proteins are palmitoylated at adjacent C-terminal cysteines.  For example, the prenylated Rho GTPAse Rho3 is palmitoylated at an N-terminal cysteine (Roth et al. 2006a; Roth et al. 2006b). It is also worth noting that, in some cases, the palmitoylated cysteines are found near basic residues. The presence of positively charged basic residues facilitates interactions with the negatively charged acidic phopholipid headgroups. Thus, sequences neighboring palmitoylated cysteines contribute to the strength of protein association with membranes. In this chapter, we will highlight approaches recently developed to detect and assess the dynamics of palmitoylation. We will also review the new emerging roles for palmitoylation in protein function, with focus on involvement of palmitoylation in controlling neuronal development and synaptic transmission. The recently discovered enzymes that regulate this lipid modification will also be discussed. 1.1.2 New approaches for studying protein palmitoylation Classical methods used to assess the dynamics of addition and removal of palmitate have been limited due to the lack of feasible approaches to assess palmitoylation in vivo. This process traditionally has been studied by metabolic labeling with radioactive palmitate followed by pulse chase analysis to assess the half-life of palmitate on individual proteins.  However, recently, several new approaches have been developed to measure protein palmitoylation in vivo and to monitor palmitoylation dynamics in live cells. These new methods are highlighted below and their relevance for assessing the dynamics of protein palmitoylation in vivo is discussed.  4 1.1.2.1 New methods for rapid detection of palmitoylated proteins Methods used to quantify protein palmitoylation involve metabolic labeling of cultured cells with radiolabeled palmitate ([ 3 H]-palmitate or [ 125 I]-palmitate) for 3-5 hours before harvesting cells and immunoprecipitating proteins of interest (protocol reviewed in (Resh 2006b)). The use of this approach is limited because it requires the use of cultured cells as well as incubation with radiolabeled palmitate for 3-5 hours. The fraction that is available for labeling is also limited by the amount of protein synthesized and\/or the rate of palmitate turnover on a particular protein during the labeling process. As a result, this method only allows detection of a small fraction of the total palmitoylated pool of a protein. A novel approach developed by Drisdel and Green overcomes these limitations by allowing detection of the total pool of palmitoylated proteins present in tissue extracts(Drisdel and Green 2004; Drisdel et al. 2004). This approach is known as \"fatty acyl exchange labeling\", which involves (i) blockade of free thiols with N-ethylmaleimide (NEM); (ii) cleavage of the Cys-palmitoyl thioester linkage with hydroxylamine (HAM); and (iii) labeling newly exposed thiols with a sulfhydryl- specific labeling compound, such as non-radioactive biotin-BMCC (1-biotinamido-4-[4'- (maleididomethyl) cyclohexanecarboxamido] butane)(Drisdel and Green 2004; Drisdel et al. 2004). The palmitoylated protein can then be detected by western blotting using strepdavidin or anti-biotin antibodies (Figure 1.1). This approach is highly sensitive and allows the use of a variety of probes, radiolabeled ([ 3 H]-NEM) or non-radioactive (biotin- BMCC), and for quantitative estimates of the total palmitoylated pool of a protein. This method also allows for assessment of changes in the dynamics of protein palmitoylation  5 after stimulation of specific signaling pathways, or after alterations in neuronal activity (Drisdel et al. 2006).  Figure 1.1. Schematic illustration of \u201cfatty acyl exchange labeling\". This approach involves (i) immunoprecipitation of a protein with the specific antibody binded to sepharose beads; (ii) blockade of free thiols with N-ethylmaleimide (NEM); (iii) cleavage of the Cys-palmitoyl thioester linkage with hydroxylamine (HAM); and (iv) labeling newly exposed thiols with a sulfhydryl-specific labeling compound, such as non-radioactive biotin-BMCC   This approach was further modified by Davis and colleagues and elegantly used to triple the overall dimension of the yeast palmitoylome. This approach also allowed identification of specific substrates for each of the newly discovered enzymes that regulate palmitoylation(Roth et al. 2006a; Roth et al. 2006b). Starting with protein extracts, biotin tags are exchanged for protein palmitoyl-modifications, which allow the palmitoylated proteins to be specifically purified from complex protein extracts.  This protocol also involves the three chemical steps described earlier in the \u2018fatty acyl exchange labeling\u2019 procedure developed by Drisdel and Green with some modifications (Roth et al. 2006a). After labeling with sulfhydryl-specific biotin, the biotinylated proteins are affinity-purified using streptavidin-agarose and identified by multi- dimensional protein identification technology (MuDPIT), a high-throughput, tandem mass spectrometry (MS\/MS)-based proteomic technology (Figure 1.2) (Wan et al. 2007). Our group applied this proteomic technique to the neuronal proteins and identified  6 hundreds of new palmitoylated proteins, as summarized in Table 1.1. Proteins that are highlighted with red are already confirmed to be palmitoylated.  Figure 1.2. Acyl-Biotin Exchange approach for detection of palmitoylated proteins. To identify palmitoylated proteins, denatured protein extracts are subject to three steps: (i) blockade of free thiols with N-ethylmaleimide; (ii) cleavage of the Cys-palmitoyl thioester linkage with hydroxylamine; and (iii) labeling of newly exposed thiols with sulfhydryl-specific labeling compound, such as non-radioactive biotin-BMCC (1-biotinamido-4-[4'- (maleididomethyl) cyclohexanecarboxamido] butane). After labeling, the biotinylated proteins are  7 affinity-purified using streptavidin-agarose beads and identified by multi-dimensional protein identification technology (MuDPIT).  Table 1.1. A table that summarizes some of the key candidate palmitoylated proteins identified by the ABE method. The proteins that are highlighted in red are already confirmed to be palmitoylated with 3 H palmitate metabolic labeling.    More recently, Berthiaume and colleagues developed another method for rapid detection of palmitoylated proteins using a non-radioactive bio-orthogonal azidopalmitate analogue that can be modified with a variety of triarylphosphine-tags via the Staudinger  8 ligation. Azido-palmitoylated proteins are then labeled with either phosphine-associated tags or biotin, and can be detected with tag specific antibodies or neutravidin-conjugated HRP. Fluorescently labeled phosphine can also be used to detect palmitoylated proteins. This method offers rapid detection of palmitoylated proteins and was recently used to identify new palmitoylated mitochondrial proteins (Figure 1.3)(Kostiuk et al. 2008).  Figure 1.3. Schematic representation of the reaction for the detection of palmitoylated proteins using a fatty acid analog. i) Azido-palmitate is transferred to a protein from azido-palmitoyl-CoA, forming a thioester bond with a cysteine residue. ii) The azide moiety of the azido-palmitate reacts with the tagged triaryl- phosphine, forming an amide bond. Probe = Myc, biotin or fluorescein. Reprint from (Kostiuk et al. 2008) with permission.  1.1.2.2 Approaches to study palmitate turnover Currently, there are three methods that are widely used to inhibit protein palmitoylation. First, application of 2-bromopalmitate (2BP), a non-metabolizable palmitate analog that blocks palmitate incorporation into proteins (Webb et al. 2000). This approach has been used to assess palmitate cycling on many proteins including PSD-95(El-Husseini Ael et al. 2002), Rho family proteins(Adamson et al. 1992), Ras(Chen et al. 2003), huntingtin(Yanai et al. 2006), AMPA-type glutamate  9 receptors(Hayashi et al. 2005) and nicotinic \u03b17 receptors(Drisdel et al. 2004). For instance, palmitoylation of the postsynaptic density protein (PSD-95) is essential for targeting to postsynaptic sites (Figure 1.4A,B). Treatment of hippocampal neurons with 2BP that blocks the ongoing palmitoylation specifically de-clusters PSD-95 but not the presynaptic protein synaptophysin (Figure 1.4C). The advantages of this approach are twofold. Firstly, this approach allows for assessment of changes in protein trafficking by blocking protein repalmitoylation without the need to mutate the palmitoylated cysteine residues, which may indirectly influence protein folding. Second, 2BP can be used to assess the rate of palmitate turnover of endogenous palmitoylated proteins. However, since the use of 2BP globally blocks palmitoylation, this approach cannot be used to assess changes in the function of individual proteins.  Figure 1.4 Palmitoylation is required for PSD-95 clustering at the synapse. (A, B)  Palmitoylation of the postsynaptic density protein (PSD-95) is essential for targeting to postsynaptic sites. Wild-type PSD95 clusters at synaptic sites (puncta), whereas a palmitoylation- deficient mutant form (PSD95:C3,5S) (C) Treatment of hippocampal neurons with 2- bromopalmitate, an agent that blocks ongoing palmitoylation, specifically de-cluster PSD-95 (loss of puncta) but not the presynaptic protein synaptophysin. Adapted from (el-Husseini Ael and Bredt 2002) with permission.   10 Other reagents that have been shown to function as inhibitors of protein palmitoylation include cerulenin (2,3-epoxy-4-oxo-7,10 dodecadienoylamide) and tunicamycin (Lawrence et al. 1999) (Patterson and Skene 1994). The inhibitory effect of cerulenin on palmitoylation has been validated in several studies with myelin proteolipid protein(DeJesus and Bizzozero 2002) and some rat adipocyte proteins(Jochen et al. 1995). Inhibitory effects of tunicamycin on palmitoylation have also been documented with GAP43, N-type Ca 2+  channels, estrogen receptor \u03b1 variant and myelin proteolipid protein(Patterson and Skene 1994; Jochen et al. 1995; Hurley et al. 2000; DeJesus and Bizzozero 2002; Li et al. 2003b). 1.1.2.3 Assessment of the dynamics of palmitoylated proteins in live cells Imaging techniques have been significantly advanced to enable the tracking of fluorescence-tagged proteins in live cells.  In particular, fluorescence recovery after photobleaching (FRAP) has gained increasing popularity as a means to monitor protein dynamics. The principle of FRAP experiments is: fluorescent molecules are irreversibly photobleached in a defined region of interest, and the exchange of bleached and unbleached molecules is then monitored over time (reviewed in (Lippincott-Schwartz et al. 2001; Lippincott-Schwartz et al. 2003)). In a similar approach but complementary mechanism, specially developed fluorescent proteins are photoactivated, enabling one to monitor their subsequent redistribution from the site of photoactivation over time (reviewed in (Politz 1999; Rocks et al. 2005)). These techniques have been applied to study the rapid retrograde trafficking of palmitoylated Ras isoforms from the plasma membrane to the Golgi apparatus(Rocks et al. 2005). In particular, Rocks et al.  11 selectively photobleached the entire Golgi-associated pool of protein and the fluorescence recovery was determined ratiometrically. Conversely, in the photoactivation experiment, they fused a photo-activatable variant of green fluorescent protein (paGFP) to Hras or Nras. paGFP-Hras or -Nras was selectively photoconverted at the lateral plasma membrane with 405-nm laser light, and accumulation of fluorescence was tracked at the Golgi(Rocks et al. 2005). Both FRAP and photoactivation methods achieved the fluorescence recovery half time on the same time scale. These approaches also revealed remarkable differences in the shuttling of mono- and dually palmitoylated Ras isoforms between the Golgi and the plasma membrane. In summary, using FRAP and photoactivation experiments, one can test the strength of binding of palmitoylated proteins to various cellular membranes, and measure the kinetics of recycling of palmitoylated proteins between the different membranous compartments. 1.1.3 Palmitoylation as a signal for protein sorting to specific membrane microdomains Palmitoylation, being a lipid modification, facilitates protein incorporation into membranes. However, palmitate does not simply serve as a membrane anchor signal, as many different types of plasma membrane associated vesicular and transmembrane proteins are palmitoylated. There is now compelling evidence that palmitoylation plays a key role in regulating the dynamics of protein sorting within the cell (see review in (Huang and El-Husseini 2005; Greaves and Chamberlain 2007; Linder and Deschenes 2007)). In particular, palmitoylation reversibly regulates assembly and compartmentalization of many neuronal proteins to specific subcellular domains such as the presynaptic terminal and postsynaptic sites. This process influences not only the  12 protein sorting but also the assembly of protein complexes at the synapse that modulate synaptic transmission and neuronal function.  Some of these new emerging roles are highlighted below. 1.1.3.1 Control of presynaptic protein trafficking by palmitoylation Palmitoylation regulates trafficking and function of numerous presynaptic proteins. Some enzymes involved in neurotransmitter synthesis require palmitoylation for proper sorting. For instance, glutamic acid decarboxylase 65 kDa (GAD65), which synthesizes the inhibitory neurotransmitter \u03b3-aminobutyric acid (GABA), depends on palmitoylation for delivery from Golgi membranes to Rab5-regulated endosomes, and eventually to presynaptic sites(Kanaani et al. 2004). Several SNARE proteins and associated molecules that regulate vesicle fusion and neurotransmitter release are palmitoylated. Previous studies showed that palmitoylation of synaptosome associated protein-25 (SNAP-25) is required for efficient SNARE- complex dissociation and vesicle exocytosis(Veit 2000; Washbourne et al. 2001). In the case of Ykt6, another SNARE component protein, palmitoylation provides a mechanism for regulating the rate of intracellular membrane flow and vesicle fusion(Fukasawa et al. 2004). Palmitoylation of synaptotagmin I, a presynaptic vesicle associated protein required for Ca 2+  regulated exocytosis, contributes to protein sorting to presynaptic terminals, and sequestration from the presynaptic plasma membrane to synaptic vesicles(Han et al. 2004; Kang et al. 2004). More recently, the yeast palmitoylome analysis revealed that one-third of the yeast SNARE proteins are palmitoylated(Roth et al. 2006a). These palmitoylated yeast SNAREs are distinguished both by sequence, having cysteines positioned adjacent to  13 cytoplasmic C-terminal hydrophobic anchor domains and by localization, generally mediating transport steps late in the secretory pathway (e.g. Golgi, secretory vesicles, plasma membrane) or within the endosomal system. Although the exact role of palmitoylation of individual SNARE proteins remains unclear, it is noteworthy that many of these molecules localize to raft-like domains. Thus, palmitoylation may serve to assemble these proteins at specific lipid microdoamins in anticipation of membrane fusion (Chamberlain et al. 2001; Salaun et al. 2004; Puri and Roche 2006).  By directly interacting with particular lipids, palmitate may also facilitate the rate of vesicle-membrane fusion cycle and\/or vesicle internalization. In support of a vital role for palmitoylation in regulating synaptic vesicle recycling and neurotransmitter release, recent studies identified other palmitoylated presynaptic proteins. For example, cysteine string proteins (CSPs), palmitoylated on a \"string\"  of 14 cysteine residues, are members of the cellular folding machinery family that play a role in regulated exocytosis in neurons and endocrine cells(Evans et al. 2003). Palmitoylation at the cysteine-string domain mediates  binding of CSP to ER membranes (Greaves and Chamberlain 2006). Subsequent palmitoylation on other cysteines facilitates CSP exit from ER and for sorting to presynaptic terminals. Moreover, palmitoylation of \u03b22A subunit of the presynaptic CaV2.2 (N type) calcium channels gates the influx of calcium ions to trigger transmitter release(Khanna et al. 2007) (Chan et al. 2007). The modification of a large number of presynaptic proteins with palmitate points to a crucial role for this modification in regulating various aspects of presynaptic signaling and neurotransmitter release (Figure 1.5).  14 In addition to regulating protein trafficking to synaptic sites, mounting evidence implicates a key role for palmitoylation  in protein sorting to myelin-enriched membranes (Schneider et al. 2005). Future studies are needed to clarify whether palmitoylation is required for myelin sheath formation and assembly.    Figure 1.5. Proposed role for palmitoylation in regulation of presynaptic vesicle exocytosis and neurotransmitter release. Palmitoylation is required for proper trafficking and function of proteins that regulate calcium dependent vesicle exocytosis such as synaptotagmin I, and others that influence neurotransmitter release such as cysteine string protein (CSP), and the SNARE proteins SNAP-25, and Ykt6. Palmitoylation also regulates presynaptic targeting of the GABA synthesizing enzyme, GAD-65. Other candidate palmitoylated proteins that influence neurotransmitter release and re-uptake include syntaxins, and several neurotransmitter transporters. Palmitoylation modulates voltage sensing and current amplitude of several voltage gated ion channels such as the \u03b22A-subunit of the Ca 2+  channel.   15 1.1.3.2 Control of postsynaptic protein trafficking by palmitoylation Neurons assemble neurotransmitter receptors and associated proteins at postsynaptic sites opposed to presynaptic terminals that harbor the proper neurotransmitters. This perfect opposition allows for efficient synaptic transmission and rapid signal transfer between neuronal cells. The postsynaptic density-95 (PSD-95) protein is a PDZ (postsynaptic density-95 (PSD-95)\/Discs large\/zona occludens-1) protein which acts as a scaffold to regulate assembly of complexes containing cell adhesion molecules and neurotransmitter receptors at excitatory glutamatergic synapses(el-Husseini Ael and Bredt 2002; El-Husseini Ael et al. 2002). Palmitoylation of PSD-95 is required for its postsynaptic targeting and clustering of \u03b1-amino-3-hydroxy-5- methylisoxazole-4-propionic acid (AMPA) type glutamate receptors (Figure 1.6A) (Craven et al. 1999; El-Husseini et al. 2000b; Christopherson et al. 2003). Consequently, specific forms of synaptic plasticity associated with the delivery of AMPA receptor subunits to the synapse are compromised when PSD-95 palmitoylation is disrupted(El- Husseini et al. 2000b; Ehrlich and Malinow 2004). The ability of PSD-95 to  recruit other scaffold molecules to the synapse such as Shank1B and GKAP1A, both of which are core components of the PSD, also relies on PSD-95 palmitoylation (Figure 1.6A) (Romorini et al. 2004). These results emphasize the vital role of palmitoylation as a postsynaptic organizing signal to regulate AMPA receptor function and synapse integrity.   16  Figure 1.6. Palmitoylation acts as a signal for protein sorting to specific membrane microdomains. (A) Palmitoylation-dependent sorting of postsynaptic receptors and scaffolding proteins at excitatory synapses. 1. Palmitoylation of AMPA receptor (AMPAR) subunits at transmembrane 2 (TM2) regulates receptor accumulation in the Golgi apparatus, a process regulated by DHHC-3, a palmitoyltransferase enriched in the Golgi. 2. Depalmitoylation of the TM2 site may regulate release of AMPARs from the Golgi for surface delivery. 3. At the postsynaptic membrane, palmitoylation at the distal region of the C terminal cytoplasmic tail of AMPARs facilitates ligand-induced internalization of the receptor. 4. Depalmitoylation of the AMPARs on the C  17 terminal cytoplasmic tail increases the receptors\u2019 affinity for 4.1N, which stabilizes receptors at the cell surface by the interaction of 4.1N with F-actin and spectrin. 5. Palmitoylation regulates clustering of PSD-95, a major scaffolding molecule required for AMPAR retention at the synapse. Enhanced neuronal activity induces depalmitoylation of PSD-95 and removal from the PSD. Prolonged loss of PSD-95 from the synapse results in AMPAR removal. (B) DHHC-3 is also required for palmitoylation and trafficking of GABAA receptors to inhibitory synapses.   Differential palmitoylation of a subset of members of the PSD-95 family enables differential regulation of certain functions mediated by these proteins(El-Husseini et al. 2000c). The PSD-95 family includes PSD-93 (also known as Chapsyn-110), SAP-102 and SAP-97. Studies in heterologous cells showed that only the palmitoylated members, PSD-95 and PSD-93, are capable of clustering ion channels and associated proteins(El- Husseini Ael et al. 2002). Other PDZ-containing anchoring proteins for  AMPA receptors have splicing variants that exhibit  differential palmitoylation and subcellular localization (El-Husseini et al. 2000b; DeSouza et al. 2002; Christopherson et al. 2003). For example, an isoform of the AMPA receptor binding protein (ABP\/GRIP2), pABP-L, is palmitoylated  and concentrated at the spines, whereas the non-palmitoylated isoform  ABP-L is abundant in the cell body and dendritic shafts(DeSouza et al. 2002).  It is presumed that this provides another mechanism for these two isoforms to regulate AMPA receptor clustering at separate subcellular sites. A similar mechanism has been proposed to control the GluR\u03b42, a glutamate receptor subunit predominantly expressed at postsynaptic sites of Purkinje cells of the cerebellum.  This subunit plays crucial roles in synaptogenesis and synaptic plasticity by controlling the endocytosis of AMPA receptors(Matsuda et al. 2006). Delphilin, a binding partner of GluR\u03b42, is expressed in two splice forms with distinct localizations: the palmitoylated form is concentrated in dendritic spines; whereas the non-palmitoylated  18 form clusters in the soma and dendritic shafts. Thus, differential palmitoylation of splice variants of GRIP\/ABP and delphilin regulate clustering of two separate intracellular and surface glutamate receptor pools to control glutamate signaling at different loci (Matsuda et al. 2006). AMPA receptors subunits, on the other hand, are palmitoylated on two cysteine residues present in the second transmembrane domain (TM2) and the distal cytoplasmic C-terminal region (Hayashi et al. 2005). Palmitoylation at TM2 regulates retention of AMPA receptors in the Golgi, controls receptor surface expression, and modulates association of AMPA receptors with 4.1N, a skeletal membrane protein. In contrast, palmitoylation of the cytoplasmic C-terminal region regulates agonist induced receptor internalization (Figure 1.6). More recently, a membrane-anchored form of Ca 2+ \/calmodulin-dependent protein kinase, CaMKI\u03b3, has been shown to be palmitoylated (Takemoto-Kimura et al. 2007). In this case, palmitoylation regulates trafficking of CaMKI\u03b3 to lipid rafts, a process potentially required for controlling CaMKI\u03b3 activation at specific subcellular locations that couple changes of extrinsic neuronal activity with cytoskeletal remodeling to regulate dendritic extension and branching at particular sites. Taken together, these recent discoveries elucidate key roles for palmitoylation in mediating trafficking, assembly and function of several molecules localized at the postsynaptic side of the synapse. 1.1.3.3 Palmitoylation influences dendritic spine development Another key process involved in compartmentalization of postsynaptic proteins and regulation of synaptic signal strength at the of the majority of excitatory synapses is the formation of spines, bulbous protrusions enriched with F-actin (Hall and Nobes 2000;  19 Yuste and Bonhoeffer 2004; Halpain et al. 2005; Matus 2005; Gerrow and El-Husseini 2006; Gerrow et al. 2006). Changes in spine dynamics and morphology in mature neurons, have been also associated with various learning paradigms and memory storage. Spines are thought to emerge from dendritic filopodia, and a key regulator of this process is paralemmin-1, a dually acylated protein (Burwinkel et al. 1998; Kutzleb et al. 1998; Gauthier-Campbell et al. 2004; Castellini et al. 2005; Basile et al. 2006; Kutzleb et al. 2007). Palmitoylation localizes paralemmin-1 to dendritic membranes, enables it to induce filopodia, and recruit synaptic elements such as AMPA receptors to contact sites. Interestingly, paralemmin-1 enrichment at the plasma membrane is subject to rapid changes in neuronal excitability, and this process controls protrusion size (Figure 1.7A). In addition to paralemmin-1, specific members of the Rho family of small GTPases are subject to protein palmitoylation. These molecules are well-known regulators of the actin cytoskeleton and have profound influence on spine morphogenesis(Newey et al. 2005) (Figure 1.7B). These findings point to a general role of palmitoylation in regulating the function of key proteins that modulate spine induction and morphology. Palmitoylation may also serve as a signal to rapidly induce changes in dendritic protrusion size and morphology, which are associated with changes in neuronal firing or those involved in learning and memory.  20  Figure 1.7. Proposed roles for palmitoylation in regulating dendritic spine development and morphology. (A) Palmitoylation of paralemmin is required for filopodia induction and spine development. In developing neurons, palmitoylation is required for paralemmin-induced changes in membrane dynamics and actin cytoskeleton, two processes involved in filopodia induction. The increase in spine density by paralemmin is thought to be mediated through enhanced filopodia production, protrusions thought to serve as precursors of spines. (B) Palmitoylation of specific members of the Rho family of GTPases that influence spine morphology. In mature neurons, palmitoylation may modulate retention and activity of specific Rho GTPases at the synapse. This process may serve as a mechanism to dynamically control changes in spine morphology associated with the induction of several paradigms that control synaptic plasticity.    21 1.1.4 Modulation of neuronal signaling by palmitoylation Neuronal excitability in the brain is modulated by a wide array of receptors and their downstream signaling proteins. One major group consists of neurotransmitter receptors coupled to G-proteins that control diverse signaling pathways. Many components of G-protein complexes are subject to modification by palmitate attachment. For example, palmitoylation near the amino termini of G-protein \u03b1-subunits regulates localization of G-protein signaling pathways to plasma membrane caveolae and lipid rafts(Qanbar and Bouvier 2003) (Figure 1.8). In addition, many G-protein coupled neurotransmitter receptors themselves are palmitoylated. These include metabotropic glutamate receptor mGluR1\u03b1, dopamine D1 receptor, serotonin and \u03b2-adrenergic receptors (for reviews see (Resh 1999; el-Husseini Ael and Bredt 2002; Qanbar and Bouvier 2003; Smotrys and Linder 2004; Torrecilla and Tobin 2006).   22 Figure 1.8. Dynamic palmitate turnover regulates signalling by GPCR pathways. (A) Ligand (L) binding to a G-protein-coupled receptor (GPCR) induces receptor activation and interaction with the G-protein \u03b1-subunit. This association triggers GDP\u2013GTP exchange on G\u03b1, and the dissociation of \u03b2\u03b3 from the G-protein complex. (B-D) Ligand binding increases palmitate turnover, leading to depalmitoylation of the receptor and activated G\u03b1. Depalmitoylation downregulates coupling to adenylyl cyclase (AC) by removing G\u03b1 from the membrane and enhancing its association with the RGS (regulators of G-protein signalling) GTPase. Receptor depalmitoylation facilitates GRK (GPCR kinase) phosphorylation, which recruits \u03b2-arrestin and enhances receptor internalization by the clathrin\u2013AP-2 complex. Reprint from (el-Husseini Ael and Bredt 2002) with permission.   Specific members of the Src family of non-receptor tyrosine kinases (SFK) are also palmitoylated. Structurally, these proteins are highly homologous,  and are able to perform overlapping  functions. However, they are differentially activated by particular biological processes (Klinghoffer et al. 1999). Activation of the non-palmitoylated SFK Src requires  RhoB endosome-associated actin assembly and transit to the cell  periphery. In contrast, the palmitoylated Fyn is present in RhoD-positive endosomes (Sandilands et al. 2007). Taken together, sorting of particular kinases  to specific sub-cellular compartments provides  means for tightly and spatially controlling enzyme activity. Thus, palmitoylation may provide a mechanism to ensure that activation of a particular kinase occurs  at the correct sub-cellular location,  conferring functional specificity. 1.1.5 Palmitate cycling controls protein trafficking and function Distinct from other lipid modification, palmitoylation is a reversible process and can be regulated by specific cellular stimuli. Binding of ligand to the \u03b2-adrenoreceptor markedly accelerates the depalmitoylation of the associated G\u03b1s subunit, which dampens G-protein signaling(Qanbar and Bouvier 2003). Depalmitoylation of PSD-95 is regulated by neuronal activity and promotes the removal of PSD-95 from synapses(el-Husseini Ael  23 and Bredt 2002). This process in turn controls activity-induced internalization of the AMPA receptor subunit GluR1, and thus provides a mechanism for regulating synaptic strength(Osten et al. 2000; El-Husseini Ael et al. 2002). Likewise, AMPA  receptors exhibit stimulation-dependent changes in palmitoylation  status and internalization(Hayashi et al. 2005).  These findings indicate that dynamic palmitoylation modulates  directly and indirectly (via PSD-95) surface expression of AMPA receptors and hence synaptic activity. Differential palmitate cycling on members of the Ras family of GTPases provides another potential mechanism for controlling signaling of many neurotrophic factors. Recent studies by Rocks et al. showed that mono-palmitoylated N-Ras displays a more pronounced Golgi localization, faster retrograde plasma membrane to Golgi trafficking, and several-fold shorter plasma membrane dwell time than dually palmitoylated H- Ras(Rocks et al. 2005). A high rate of palmitate turnover limits N-Ras access to endosomes resulting in compartmentalization of signaling mediated by these Ras family members (Figure 1.9).  24  Figure 1.9. Palmitoylation-dependent cycling of Ras between the plasma membrane and the Golgi. Constitutive cycling of palmitate on H-Ras and N-Ras regulates rapid protein shuttling between the plasma membrane and the Golgi. A differential rate of palmitate turnover regulates the rate of retrograde trafficking, resulting in a more pronounced accumulation of both N-Ras in the Golgi and H-Ras at the plasma membrane. Reprint from (Huang and El-Husseini 2005) with permission.  However, it is important to note that not all palmitoylated proteins exhibit rapid turnover of palmitate, as in the case of the presynaptic proteins, synaptotagmin I and SNAP-25, which are stably associated with palmitate. Here, palmitoylation probably functions as a structural signal for correct targeting and assembly of elements involved in neurotransmitter release(Heindel et al. 2003; Kang et al. 2004).   25 1.1.6 Enzymes involved in the modulation of protein palmitoylation Although the modified sequences and enzymes involved in protein myristoylation and prenylation have been well characterized, mechanisms that control protein palmitoylation have been poorly understood due to the limited knowledge of enzymes involved in this process, the lack of consensus sequence for palmitoylation and the identity of palmitoylated proteins (Figure 1.10). The first characterization of enzymes involved in palmitoylation came from work done on flies(Chamoun et al. 2001; Nusse 2003; Zhai et al. 2004). skinny hedgehog and porcupine (porc) are palmitoyl acyl- transferases (PATs) that localize in the lumen of the secretory pathway to mediate palmitoylation of the secreted factors hedgehog and Wnt-1(Chamoun et al. 2001; Nusse 2003; Zhai et al. 2004). Therefore, these two enzymes are unlikely to be involved in palmitoylation of cytosolic proteins. OH O H SCoA O H S S O O R R R H H R ATP CoASNa Palmitate OH O Br PSD-95 Acyl-CoA Synthetase (AS) Palmitoyl Acyl Transferase (PAT) Acyl Protein Thioesterase (APT) R 2-Br-Palmitate 2-Br-Palmitate  Figure 1.10. Proposed role for Palmitoyl Acyl Transferases (PATs) and Thioesterases (APTs) in regulation of palmitate addition and removal.  26 Palmitate addition to Co enzyme A is mediated by Acyl-CoA synthetase. The generated palmitoyl CoA is utilized by Palmitoyl acyl transferase (PAT) which catalyzes the addition of palmitate to substrates on specific cysteine residues through a thioester bond. Palmitate removal is catalyzed by acyl protein thioesterase (APT). 2-bromopalmitate, an analog of palmitate acts as an inhibitor of palmitoylation. The presence of the bromine (Br) atom interferes with the transfer of palmitate from palmitoyl CoA to substrate.  The recent discovery of some yeast PATs that mediate palmitoylation of cytoplasmic proteins uncovered a large family of enzymes essential for palmitoylation. The Erf2p\u2013Erf4p protein complex and Akr1p were first shown to palmitoylate Ras(Lobo et al. 2002), and the yeast enzyme casein kinase II, respectively(Roth et al. 2002). Discovery of these enzymes led to the identification of a family of seven yeast PATs named DHHC proteins, all of which contain a conserved DHHC (Asp-His-His-Cys) motif present in a cysteine rich domain (CRD). These include Pfa3 and Pfa4, which palmitoylate yeast vacuole fusion factor Vac8(Hou et al. 2005), and yeast chitin synthase Chs3(Lam et al. 2006). Detailed analysis performed by the Davis group further elucidated the multiple substrates regulated by individual yeast PATs (Roth et al. 2006a). The identification of yeast DHHC proteins also led to the identification of 23 mammalian proteins that contain the DHHC domain as PATs (Figure 1.11 and Figure 1.12) (Fukata et al. 2004). Work done by Bredt and our group characterized the palmitoyl transferase activity of some of these proteins towards specific neuronal protein substrates (Fukata et al. 2004; Huang et al. 2004). Using in vitro palmitoylation assays, we revealed that the huntingtin interacting protein 14 (HIP14), also known as DHHC-17, palmitoylates several proteins including huntingtin, PSD-95, SNAP-25, synaptotagmin I and GAD65(Singaraja et al. 2002) (Huang et al. 2004). DHHC-2, -3, -7 and -15 also showed the strongest specificity for palmitoylating PSD-95. Enzyme specificity towards many other substrates has been assessed by several other investigations. DHHC-2, -3, -7, -8,  27 and \u201321 have been shown to enhance incorporation of [ 3 H]-palmitate into endothelial nitric oxide synthase (eNOS). These PATs all colocalize with eNOS in the Golgi and plasma membrane and interact with eNOS(Fernandez-Hernando et al. 2006). DHHC-3 and -7 interact with, and palmitoylate GABA(A) receptors at a cysteine-rich 14-amino acid domain, located in the large cytoplasmic loop of the \u03b32 subunit(Fang et al. 2006). Others showed that a protein complex composed of DHHC-9 and a Golgi-localized  protein designated GCP16 palmitoylates H- and N-Ras(Swarthout et al. 2005). Moreover, purified DHHC-9 and GCP16 exhibits substrate specificity, palmitoylating H- and N-Ras but not myristoylated G (\u03b1i1) or GAP-43, proteins with N-terminal palmitoylation motifs. These results demonstrate the requirement for specific enzymes in the regulation of protein palmitoylation.  Figure 1.11. The phylogenetic tree of mouse DHHC protein family. DHHC-3 is also known as GODZ; DHHC-17, as HIP14. Adapted from (Fukata et al. 2006) with permission.    28   Figure 1.12. Domain structures of mammalian DHHC proteins, DHHC-3 and DHHC-17 (HIP14). As described for yeast DHHC proteins, they have several transmembrane domains and a conserved cysteine-rich domain containing a DHHC (Asp-His-His-Cys) motif (DHHC-CRD). The DHHC sequence is essential for palmitoylating activity. DHHC-17 has six ankyrin repeat sequences in the N-terminal half. Adapted from (Fukata et al. 2006) with permission.    Overexpression and loss of function analyses provided further support for an important role for DHHC proteins in protein palmitoylation in mammalian cells (Fukata et al. 2004). For instance, knock down of HIP14 reduces synaptic clustering of PSD-95 and GAD65, and alters huntingtin distribution in the soma(Huang et al. 2004; Yanai et al. 2006). In contrast, overexpression of HIP14 in neurons increases huntingtin localization to the Golgi apparatus. Inhibition of DHHC-21 in human endothelial cells reduces eNOS palmitoylation, eNOS targeting, and nitric oxide production(Fernandez-Hernando et al. 2006). Furthermore, expression of a dominant-negative form of DHHC-3 (DHHC-3 C157S ) or DHHC-3 knock down by specific  short hairpin RNA (shRNA) alters \u03b32  subunit- containing GABAA receptors trafficking to synapses, and compromises GABAergic transmission (Figure 1.6B) (Fang et al. 2006).  29 Why have many PATs been employed by yeast and mammals to carry out the same enzymatic reaction? The palmitoyl proteome profiles of the mutant yeast strains that are deficient for single or multiple yeast DHHC proteins revealed overlapping DHHC PAT functionality yet some specificity between enzymes and substrates (Roth et al. 2006a). In mammalian cells, differential localization of these enzymes might enable tight regulation of protein palmitoylation at specific subcellular sites. However, recent analysis revealed that the majority of mammalian DHHC proteins are localized to the ER and\/or Golgi, and few are enriched at the plasma membrane(Ohno et al. 2006). The enrichment of the majority of the identified DHHC proteins in the ER and\/or Golgi suggests that these compartments are major sites for palmitoylation(Huang et al. 2004; Keller et al. 2004; Mukai et al. 2004).  Studies on HIP14 revealed that this enzyme associates with tubulovesicular organelles and recycling endosomes present in dendrites, axons and spine necks(Huang et al. 2004). Mobile HIP14-positive vesicular structures rapidly transport from a perinuclear compartment to various subcellular locations. RNA expression analysis also revealed specificity in the expression of DHHC mRNAs to particular tissues. Taken together, these results suggest that each PAT functions to palmitoylate a limited subset of neuronal proteins at specific subcellular sites, ensuring a high level of control of protein acylation. Although there is no consensus sequence for palmitoylation, detailed mutagenesis analysis of specific palmitoylated motifs indicates that the presence of hydrophobic residues surrounding the modified cysteines is crucial for proper palmitoylation(El- Husseini et al. 2000a). Postsynaptic clustering of PSD-95 in neurons is dependent on  dual palmitoylation of a specific amino acid sequence, MDCLCIV(Craven et al. 1999). The  30 exclusive postsynaptic targeting of PSD-95 is disrupted if this sequence is replaced by the N terminal palmitoylation sequence from the axonally localized GAP43 protein (MLCCMRR). Consequently, a fraction of PSD-95 is redistributed to axons. Thus, specific palmitoylated motifs may direct proteins to distinct  subcellular domains(El- Husseini et al. 2000a; Greaves and Chamberlain 2007). Different palmitoylation motifs may also be recognized by distinct PATs. In the future it will be important to determine the exact sequences required for substrate recognition by individual PATs. Another unresolved issue is how protein depalmitoylation is regulated. It is thought that this process is controlled by palmitoyl thioesterases. However, only two enzymes that regulate depalmitoylation have been identified. One of these enzymes is acyl-protein thioesterase 1 (APT1), a cytosolic thioesterase that depalmitoylates specific signaling molecules such as G\u03b1, Ras and endothelial nitric oxide synthase(Yeh et al. 1999). Another putative depalmitoylation enzyme is protein palmitoyl thioesterase-1 (PPT1), whose deficiency leads to infantile neuronal ceroid lipofuscinosis. Although PPT1 primarily localizes in lysosomes and associates with the proteosomal degradation pathway, it is also present in axons, synaptosomes and synaptic vesicles (Lehtovirta et al. 2001; Ahtiainen et al. 2003). In vitro palmitoylation assays revealed that PPT1 is able to hydrolyze a range of cysteinyl peptide sequences found in both neuron-specific and ubiquitous (e.g., G\u03b1) proteins(Cho et al. 2000). Interestingly, PPT1 activity is also regulated by synaptic activity(Suopanki et al. 2002). Kainic acid (KA)-induced experimental epilepsy, a model of excitotoxicity, enhanced localization of PPT1 at presynaptic terminals. Thus translocation of PPT1 to the synapse may be required to regulate palmitoylation levels of proteins that control neurotransmitter release. However,  31 it remains to be confirmed whether PPT1 serves as a thioesterase toward proteins in vivo. The fact that PPT1 localizes primarily in the lysosomal compartment for degradation infers the existence of a larger, yet to be discovered, family of thioesterases that regulate protein depalmitoylation at other subcellular locations. 1.1.7 Concluding remarks Recent studies indicate that palmitoylation plays a key role in controlling trafficking and function of numerous proteins. In neurons, alterations in protein palmitoylation are associated with protein mistargeting, disruption of postsynaptic protein clustering and neurotransmitter release, and altered synaptic morphology and activity. The finding that key proteins that regulate neuronal development and firing are subject to regulated cycles of palmitoylation and depalmitoylation, combined with the identification of a large family of enzymes that regulate this process suggest that palmitoylation is tightly regulated in vivo. The profound changes in the function of many neuronal proteins upon interference with palmitoylation clearly underscore the importance of palmitoylation in normal brain function. It is not surprising that defects in protein palmitoylation and loss of function of enzymes that regulate this process have been associated with neurodegenerative and psychiatric disorders. Future investigations of the mechanisms that govern protein palmitoylation will further advance our understanding of the importance of this lipid modification in health and disease. Future avenues of study include examining the endogenous localization of mammalian DHHC proteins, elucidating mechanisms for substrate specificity, and determining whether the efficacy of these enzymes is subject to changes in neuronal activity.  32 1.2. HUNTINGTON DISEASE 1.2.1 Huntington Disease Clinical Features Huntington disease (HD) is an autosomal-dominant, progressive neurodegenerative disorder. Typically, onset of symptoms is in middle-age after affected individuals have had children, but the disorder can manifest at any time between infancy and senescence. Huntington disease is fatal and currently has no effective treatment or cure. The mutant protein in Huntingtin disease\u2014huntingtin\u2014results from an expanded CAG repeat leading to a polyglutamine strand of variable length at the N-terminus. Clinical features of Huntington disease include cognitive, psychiatric and behavioural symptoms. Cognitive dysfunction in Huntington disease often impairs executive functions, such as organising, planning, checking, or adapting alternatives, and delays the acquisition of new motor skills(Walker 2007). These features are progressive. However, long-term memory is often spared. Motor dysfunction is characterized by the involuntary writhing movements of the face, trunk and limbs. Other motor symptoms such as abnormalities in eye movements, fine motor control, and gait (Folstein et al. 1986; Kremer et al. 1992; Di Maio et al. 1993; Lasker and Zee 1997) often accompany or precede(Kirkwood et al. 1999) chorea. Most individuals have chorea that initially progresses but then, with later onset of dystonia and rigidity, it becomes less prominent(Young et al. 1986; Mahant et al. 2003). Therefore, although useful for diagnosis, chorea is a poor marker of disease severity(Young et al. 1986; Mahant et al. 2003). Huntington disease is also associated with a wide range  of psychiatric disturbances, including affective disorders(Dewhurst et al. 1970; Caine and Shoulson 1983; Folstein et al. 1983a), irritability(Bolt 1970; Pflanz et al. 1991; Craufurd et al. 2001),  33 apathy(Dewhurst et al. 1970; Caine and Shoulson 1983; Craufurd et al. 2001)  and psychosis(Bolt 1970; Shiwach 1994; Lovestone et al. 1996).Both  major depression(Bolt 1970; Dewhurst et al. 1970; Folstein et al. 1983a; Folstein et al. 1983b) and more subtle mood disturbances(Baxter et al. 1992)  have been reported to predate clinical onset, conventionally  defined by onset of motor symptoms.  1.2.2 Neuropathology 1.2.2.1 Patterns of Neuronal degeneration Neuropathological changes in Huntington\u2019s disease are initially selective, with prominent cell loss and atrophy in the caudate and putamen of the striatum (Vonsattel et al. 1985). GABA-releasing medium-spiny neurons that project from the striatum are the most vulnerable. The pattern of neurodegeneration and receptor changes that occur in the basal ganglia follow a specific sequence (Glass et al. 2000). The initial GABAergic subpopulation of neurons to degenerate are those of the indirect striatal pathway that express enkephalin and are enriched in the dopamine receptor D2 (Reiner et al. 1988). It is the initial loss of neurons in this indirect pathway (and therefore loss of thalamic- cortical inhibition) that is believed to cause the choreiform movement disorder characteristic of HD (Mitchell et al. 1999). Later in the disease, loss of neurons in the direct pathway, composed of GABAergic neurons expressing substance P, suppresses movement and results in hypoactivity and dystonia. Interneurons are generally spared. Other brain areas greatly affected in people with Huntington disease include the substantia nigra, cortical layers 3, 5, and 6, the CA1 region of the hippocampus(Spargo et al. 1993), the angular gyrus in the parietal lobe(Macdonald et al. 1997; Macdonald and  34 Halliday 2002), purkinje cells of the cerebellum(Jeste et al. 1984), lateral tuberal nuclei of the hypothalamus(Kremer et al. 1991; Kremer 1992) and the centromedialparafascicular complex of the thalamus(Heinsen et al. 1999). 1.2.2.2 Neuronal Inclusions  Figure 1.13. Neuronal intranuclear inclusions (NIIs) in the brains of HD mice and human HD patients. Neuronal intranuclear inclusions (A\u2013C) in the neocortex of the brains of two at-risk individuals with grade I (A,B) and grade 0 (C) HD pathology, respectively. Immunostaining was performed with an antibody against (A) ubiquitin and antiserum H7 (B) and antibody 5374 (C) both directed to the N-terminus of huntingtin. Scale bar (A\u2013C) 10 \u00b5m. (Reprint from (Maat-Schieman et al. 2007) with permission) (D) NIIs stain as dark EM48 inclusions inside the stained nucleus of striatal neurons from a YAC128 mouse brain (R Graham).   The appearance of nuclear and cytoplasmic inclusions that contain mutant huntingtin is one of the pathological characteristics of Huntington\u2019s disease(Davies et al. 1997). In both transgenic mice models of HD and human HD brains, neuronal intranuclear inclusions were observed (Figure 1.13) (Davies et al. 1997; DiFiglia et al.  35 1997; Scherzinger et al. 1997; Becher et al. 1998). As mutant huntingtin proteins fail to fold properly, they are either refolded by chaperones or destroyed by the proteasome(Glickman and Ciechanover 2002; Young et al. 2004; McClellan et al. 2005). In neurodegenerative diseases, these quality control mechanisms are overwhelmed, possibly partly due to a natural decline in function as neurons age(Keller et al. 2002; Soti and Csermely 2003). Ultimately, misfolded protein accumulates and disrupts cellular function, contributing to neuronal degeneration. A classically held view of HD pathogenesis is that these nuclear inclusions cause neurodegeneration and HD symptomatology as their presence seems to correlate with pathology (Davies et al. 1998; Wanker 2000). However, further studies have dissociated inclusion formation and pathology, in cell culture models, animal models and even human brain samples (Klement et al. 1998; Saudou et al. 1998; Cummings et al. 1999; Gutekunst et al. 1999; Kuemmerle et al. 1999; Slow et al. 2005). Current evidence suggests that poly glutamine aggregates are not the toxic species (also summarized inError! Reference source not found.). Table 1.2. Evidence against a relationship between inclusions or amyloid plaques and disease specific pathology (Adapted from (Slow et al. 2006) with permission)  Studies of HD\u0001 Experimental Results\u0001 Human studies\u0002 \u0002 Inclusions, plaques and NFTs do not correlate with clinical features or pathology\u0002 Inclusions do not correlate with regional specificity of neuronal degeneration(Kuemmerle et al. 1999)\u0002 Mouse studies\u0002 \u0002  36 Studies of HD\u0001 Experimental Results\u0001 Specific disease pathology or clinical features before or without inclusions or plaques\u0002 Cognitive and motor dysfunction (Menalled et al. 2003; Slow et al. 2003; Van Raamsdonk et al. 2005c), striatal neuronal loss (Slow et al. 2003)is present months before inclusions\u0002 Dissociation between treatment effects and inclusions in pathology and clinical phenotype\u0002 HDAC inhibitors (Ferrante et al. 2003; Hockly et al. 2003)or decreasing transglutaminase (Mastroberardino et al. 2002) improves clinical features with no improvement in or increased inclusions\u0002 Inclusions with no clinical symptoms or pathology\u0002 Shortstop mice develop widespread inclusions without motor dysfunction, brain or striatal neuron loss (Slow et al. 2005)\u0002 Neuroprotective role of inclusions in vitro\u0002 Inclusions improve survivability of neurons in vitro(Arrasate et al. 2004)and sequester mTOR, promoting autophagy of toxic huntingtin (Ravikumar et al. 2004)\u0002  Indeed, nuclear inclusions and the selective degeneration in striatum observed in HD are not correlated. Within the striatum, nuclear inclusions are predominantly observed in spared interneurons, whereas degenerating medium spiny neurons contain no or few inclusions. Cortex, a brain region affected later in the disease, exhibits a much greater inclusion presence (Kuemmerle et al. 1999). Furthermore, the shortstop mouse expresses a fragment of huntingtin (exon 1 and 2) and develops extensive nuclear inclusions throughout the brain but does not develop any other pathological features of the disease (Slow et al. 2005). These dissociations argue against inclusions being the toxic moiety. Other evidence also demonstrates that it is possible to halt or reverse the pathology and symptomatology of HD including cognitive loss, early death and motor dysfunction without any effect on inclusion formation. For instance, treating the R6\/2 mouse model of  37 HD with histone deacetylase (HDAC) inhibitors (Ferrante et al. 2003; Hockly et al. 2003) resulted in improvements in HD symptoms without decreasing huntingtin inclusion burden. Furthermore, crossing this mouse model with tissue transglutaminase knockout mice partially alleviated HD phenotype but was accompanied by a significant increase in huntingtin inclusions(Mastroberardino et al. 2002). Conversely, a new identified compound B2 (5-[4-(4-chlorobenzoyl)-1-piperazinyl]-8-nitroquinoline) that prevents huntingtin-mediated proteasome dysfunction actually promotes inclusion formation in cellular models of HD (Bodner et al. 2006). Huntingtin protein inclusions can also sequester other cellular proteins, besides toxic huntingtin, as a neuroprotective strategy. Recording the survival of neurons that were transfected with mutant huntingtin in vitro revealed that, surprisingly, the neurons that formed huntingtin inclusions had an increased likelihood of survival (Arrasate et al. 2004).Another study applied time-lapse analysis of aggregate formation in an inducible PC12 cell model of Huntington's disease and revealed time-dependent aggregate formation that transiently delays cell death(Gong et al. 2008). It is suggested that inclusions may improve neuron survival, possibly by sequestering mTOR and promoting autophagy of toxic huntingtin (Ravikumar et al. 2004). Rather, it is the oligomer huntingtin containing the HD mutation, or intermediate stages of poly glutamine aggregates that are the toxic species. This hypothesis is supported by the finding that translocation of soluble huntingtin into the nucleus is an early marker of HD in mouse and human studies (Menalled et al. 2003; Van Raamsdonk et al. 2005a).   38 1.2.3 HD Genetics The prevalence of HD is ~7 to 10 cases per 100,000 in white populations, less in populations that are mixed white, and significantly less common in black and Asian populations (Harper 1992; Squitieri et al. 1994). The HD locus is located on chromosome 4p16.3 and contains 67 exons across 180kb of genomic sequence (Ambrose et al. 1994). Due to differential 3\u2019 polyadenylation, the human HD gene encodes two mRNA products of 10.3kb and 13.6kb, with the larger transcript predominantly expressed in the brain and the smaller transcript highly expressed in other tissues (Lin et al. 1993). HD is monogenic and dominantly inherited (Harper 1993; Harper 2005). The mutation that causes HD is an expansion in the number of repeated CAG codons in exon 1 of the HD gene, which was identified in 1993 using linkage analysis (The Huntington's Disease Collaborative Research Group, 1993). If the expansion has 40 or more repeats, the disease is fully penetrant (Kremer et al. 1994); with 36 to 40 repeats, it is variably penetrant (Rubinsztein et al. 1996; Brinkman et al. 1997; McNeil et al. 1997); and with 35 repeats or less, the disease does not occur (also summarized in Table 1.3)(Rubinsztein et al. 1996; Langbehn et al. 2004). However, the instability of the expanded CAG repeat begins at repeat size of 27 or greater. In gametogenesis, these CAG repeats are prone to further expansion (Ranen et al. 1995), which explains that the age of onset of the disease tends to get younger with succeeding generations. This may also result in the expansion of a repeat size in the 27 to 35 range into the symptomatic range in offspring, which contributes to the ~8% of patients who have no known family history (Yamamoto et al. 2000; Montoya et al. 2006).  39 Table 1.3. CAG sizes for alleles in the HD gene.   CAG SIZE Normal Allele 7 - 26 Intermediate Allele 27 - 35 HD Allele Reduced Penetrance 36 - 39 Full Penetrance 40 - 60 Juvenile Onset 60 +  The age of onset of symptoms in patients correlates robustly with the number of CAG repeats, which accounts for ~50 to 60% of the variation in age of onset for any given patient(Andrew et al. 1993; Ranen et al. 1995). The majority of adult onset HD cases have between 40-55 CAG repeats (Kremer et al. 1994) with a typical age of onset of 30-50 years. Individuals with > 60 repeats inevitably develop juvenile-onset HD (Telenius et al. 1993; Trottier et al. 1994).  1.2.4 Mouse Models Used in Studying huntingtin and HD 1.2.4.1 Huntingtin knockout mice (huntingtin-\/- and huntingtin+\/-) An important advance in the study of HD was the development of mouse models. Initially, generation of mice with a targeted disruption of the HD gene was attempted by several groups. However, mice derived from targeted embryonic stem (ES) cell lines (huntingtin-\/-) do not survive to term and suffer early postimplantation embryonic lethality (Duyao et al. 1995; Nasir et al. 1995; Zeitlin et al. 1995).  40 Mice heterozygous for the Hdh ex5  mutation survive to adulthood, but display increased motor activity and cognitive deficits (Nasir et al. 1995). Detailed morphometric and stereological analyses of the basal ganglia in adult heterozygous mice demonstrated a significant neuronal apoptosis and loss from both the globus pallidus and the subthalamic nucleus. Stereological analyses in the subthalamic nucleus also revealed a significant decrease in the numerical density of symmetric synapses (43%), suggesting a relatively selective loss of inhibitory pallido-subthalamic afferents (O'Kusky et al. 1999). These studies show that the HD gene is essential for post-implantation development and reduction of huntingtin protein is associated with abnormal functioning of the striatum. Intriguingly, huntingtin+\/- mice have behavioral deficits similar to that seen in rodents with lesions in the striatum, and they have significant reductions of neurons in the subthalamic nucleus, a nucleus which also shows obvious neuronal loss (25%) in patients with HD (Lange et al. 1976). Taken together, these data suggest that HD may partially result from loss of wildtype huntingtin function. 1.2.4.2 HD Transgenic Mice The ideal HD transgenic mouse model would have a robust phenotype, rapid disease onset and progression, well-defined behavioural abnormalities that can be quantified, and neuropathological features such as selective loss of striatal projection neurons, all of which accurately replicate human HD. There are many mouse models of HD and they fall into three broad categories: (1) mice that express the full-length human HD gene (plus murine Hdh); (2) mice with pathogenic CAG repeats inserted into the existing CAG tract in murine Hdh (knock-in mice); (3) mice that express N-terminal  41 fragments of the human huntingtin protein containing polyglutamine mutations (in addition to both alleles of murine wild-type huntingtin). 1.2.4.2.1 Full-length huntingtin transgenic mice (Human huntingtin) Yeast artificial chromosome (YAC) transgenic models of HD (YAC128) express full length mutant huntingtin with 120 CAG repeats from a YAC(Van Raamsdonk et al. 2007b). The YAC128 mouse contains the human HD gene endogenous promoter elements, providing appropriate developmental and tissue-specific expression of the huntingtin protein. Accordingly, they recapitulate the motor deficits, cognitive impairment and selective degeneration similar to HD in humans (Hodgson et al. 1999); (Slow et al. 2003; Van Raamsdonk et al. 2005a; Van Raamsdonk et al. 2005c). The expression level of the polyglutamine-expanded huntingtin modulates the HD phenotype in the YAC mice. Increased expression leads to an earlier age of onset, more rapid progression, increased striatal volume loss and nuclear accumulation of huntingtin (Graham et al. 2006). 1.2.4.2.2 Knock-in transgenic mouse models (Mouse huntingtin) The knock-in mice are accurate genetic models of the disease in the murine huntingtin gene (rather than human huntingtin in the YAC and BAC lines), but in general tend to manifest milder motor or neuropathological phenotypes without overt neurodegeneration (Lin et al. 2001; Menalled 2005). For example, a knock-in Hdh mouse with 72\u201380 CAG repeats in the murine HD gene behaves aggressively and has aggregates in neuropil but shows no gliosis or cell loss(Shelbourne et al. 1999; Menalled et al. 2002). HdhQ111-knock-in mice, with 111 CAG repeats inserted into the murine HD  42 gene, have a progressively developing neuropathological phenotype characterized by accumulation of huntingtin in the nucleus that is specific for striatal neurons, but gait abnormalities are not apparent until 2 years of age (Wheeler et al. 2000). 1.2.4.2.3 N-terminal huntingtin transgenic mouse models The R6\/2 mouse belongs to this category. The R6\/2 line is the most commonly studied model, and expresses exon 1 (67aa) of the human gene with about 150 CAG repeats (Mangiarini et al. 1996). The R6\/2 model has many of the temporal, behavioural and neuropathological features that are observed in patients with HD, such as jerky movements and striatal atrophy (Mangiarini et al. 1996; Davies et al. 1997). Altough the efficiency and clear experimental endpoints of the R6\/2 mice are advantages, these animals are not a perfect genetic and neuropathological match for human HD pathology. R6\/2 mice have more extensive huntingtin aggregate distribution \u2014 including the cerebral cortex and hippocampus \u2014 than is typical of HD(Davies et al. 1997). Moreover, they are resistant to excitotoxicity, which might be related to an increased capacity to process calcium, and show little cell loss (Davies et al. 1997; Hansson et al. 1999; Hansson et al. 2001). Other N-terminal huntingtin transgenic models include the N171 mouse (Schilling et al. 1999; Schilling et al. 2001), the conditional exon 1 model (Yamamoto et al. 2000), NSE mouse (Laforet et al. 2001) and shortstop mouse which contains the same 25kb endogenous promoter as the YAC128 and exon 1 and 2 of huntingtin. The shortstop mouse does not develop a pathological phenotype despite the widespread presence of inclusions in the brain (Slow et al. 2005).   43 1.2.5 Function of Huntingtin Huntingtin is a completely soluble protein of 3,144 amino acids, expressed ubiquitously in humans and rodents, with the highest levels in the brain (Li et al. 1993; Gutekunst et al. 1995; Landwehrmeyer et al. 1995; Schilling et al. 1995; Sharp et al. 1995)and the testes(Van Raamsdonk et al. 2007a). Huntingtin is present in both neurons and glia (Landwehrmeyer et al. 1995), and the regional distribution of huntingtin in the brain, and even within cell types of the striatum, does not correlate with the selective neuropathology (Vonsattel and DiFiglia 1998). At the subcellular level, huntingtin is found in the nucleus (Hoogeveen et al. 1993; De Rooij et al. 1996; Saudou et al. 1998; Dorsman et al. 1999; Wheeler et al. 2000; Tao and Tartakoff 2001; Kegel et al. 2002) and throughout the cytoplasm(DiFiglia et al. 1995; Trottier et al. 1995a; Jones 1999), where it is associated with various organelles, such as endoplasmic reticulum and Golgi complex(DiFiglia et al. 1995; Velier et al. 1998; Hilditch-Maguire et al. 2000; Hoffner et al. 2002; Rockabrand et al. 2007), and it is also found in neurites and at synapses(Li et al. 2003a), where it associates with vesicular structures such as clathrin-coated vesicles(DiFiglia et al. 1995), endosomal compartments(Velier et al. 1998) or caveolae(Trushina et al. 2004), and microtubules(Hoffner et al. 2002; Kegel et al. 2005). Taken together, the widespread regional expression and subcellular localization of huntingtin does not facilitate the definition of a single precise function in any specific compartment of the cell. Rather, current knowledge about huntingtin suggests it may have a number of functions.    44 1.2.5.1 Huntingtin is essential for development Huntingtin is essential for embryonic development, as its complete inactivation of mouse homolog Hdh gene (Hdh -\/- ) causes impaired gastrulation and embryonic death between Day 7.5 and Day 10.5(Duyao et al. 1995; Nasir et al. 1995; Zeitlin et al. 1995; Dragatsis et al. 1998). Interestingly, Hdh deletion mainly interferes with embryo viability by impairing the nutritive function of the visceral endoderm, rather than the embryo itself (Dragatsis et al. 1998). While one normal huntingtin allele (50% of normal huntingtin) is sufficient in humans or mice for development and postpartum life that is largely or entirely indistinguishable from normal (Wexler et al. 1987; Ambrose et al. 1994; Duyao et al. 1995; Nasir et al. 1995; Zeitlin et al. 1995; Persichetti et al. 1996), reduction of huntingtin to levels lower than 50% of normal have been found to result in severe developmental malformations including defective neurogenesis, profound malformations of cortex and striatum, telencephalic ventricular enlargement, and agenesis of fiber tracts in late-term embryos and postpartum mice (White et al. 1997). The inability to produce viable chimeras containing Hdh\u2013\/\u2013 cells using the method of early embryo aggregation also suggests that even limited colonization of the extraembryonic membranes by Hdh\u2013\/\u2013 cells may impair their function so severely as to be lethal to the developing embryo. However, several lines of evidence suggest that the CAG tract does not affect the physiological function of the protein during development, and also shows that mutant huntingtin can compensate for the loss of wild-type function in development. First, the extra-embryonic function of huntingtin (that is, in tissues such as the placenta) does not depend on the CAG tract and ancestral huntingtin has no CAG domain. Second, patients  45 with HD who are homozygous for the polyglutamine expansion do not express wild-type huntingtin but develop normally and are born with no apparent defects (Wexler et al. 1987; Myers et al. 1989; Gusella and MacDonald 1996). Third, the expression of mammalian huntingtin with a pathological polyglutamine expansion (even up to 128 CAG repetitions) rescues huntingtin-null mice from embryonic lethality (Hodgson et al. 1999; Leavitt et al. 2001). 1.2.5.2 Huntingtin is involved in transcriptional regulation Huntingtin might not only act as a scaffold but could also function as a transcriptional cofactor in the nucleus. Huntingtin has been shown to interact with a large number of transcription factors including the cAMP response-element binding protein (CREB)-binding protein (CBP) (McCampbell et al. 2000; Steffan et al. 2000), p53 (McCampbell et al. 2000; Steffan et al. 2000), the co-activator CA150 (Holbert et al. 2001) and the transcriptional co-repressor C-terminal binding protein (CtBP) (Kegel et al. 2002). Although there is no direct evidence that wildtype huntingtin regulates normal gene expression, numerous studies have revealed changes in the expression of many genes in HD brains of human patients and mice models (Cha et al. 1999; Cha 2000; Chan et al. 2002; Luthi-Carter et al. 2002a; Luthi-Carter et al. 2002b; Sipione et al. 2002; Spektor et al. 2002; Luthi-Carter et al. 2003; Zucker et al. 2005; Desplats et al. 2006), with the greatest number of changes occurring in the striatum (Hodges et al. 2006). Interestingly, expression of polyglutamine-expanded huntingtin in cell models of HD has been shown to alter the mitogen-activated protein kinase (MAPK) signalling pathway and therefore suggest this may be a viable target for therapeutic intervention (Apostol et al. 2006).  46 1.2.5.3 Neuroprotective Role of Huntingtin Huntingtin appears to exert a neuroprotective effect against lethal stresses in cultured striatal neurons (Rigamonti et al. 2000; Ho et al. 2001; Rigamonti et al. 2001; Leavitt et al. 2006), and neurons in the mousebrain (Zhang et al. 2003; Leavitt et al. 2006), including partial protection from the toxic effects of polyglutamine-expanded huntingtin (Leavitt et al. 2001; Van Raamsdonk et al. 2005b; Van Raamsdonk et al. 2006). Neuroprotection is enhanced with a progressive increase in the level of wild-type huntingtin, which indicates a gene-dosage effect(Leavitt et al. 2006). All of these studies indicate that wild-type huntingtin can trigger molecular events that lead to increased cell survival well beyond the developmental period. Huntingtin also appears to exert an important receptor-mediated, prosurvival effect in striatum via stimulating the production of brainderived neurotrophic factor (BDNF) (Zuccato et al. 2001) by corticostriatal neurons (Altar et al. 1997; Ivkovic and Ehrlich 1999; Schuman 1999). Wild-type huntingtin may have this effect on BDNF production by regulates the activity of the BDNF promoter (Figure 1.14) (Zuccato et al. 2003).  47  Figure 1.14. Wild-type but not mutant huntingtin facilitates cortical BDNF mRNA production. Wild-type huntingtin contributes to brain-derived neurotrophic factor (Bdnf) transcription in the cortical neurons that project to the striatum by inhibiting the Repressor element 1\/neuron- restrictive silencer element (RE1\/NRSE) that is located in BDNF promoter exon II. I\u2013IV indicate BDNF promoter exons in rodent Bdnf; V indicates the coding region. The RE1\/NRSE consensus sequence is shown. Inactivation of the RE1\/NRSE in Bdnf leads to increased mRNA transcription and protein production in the cortex. BDNF, which is also produced through translation from exons III and IV is then made available to the striatal targets via the cortico-striatal afferents. Wild-type huntingtin might also facilitate vesicular BDNF transport from the cortex to the striatum. Adapted from(Cattaneo et al. 2005)with permission.   1.2.5.4 Huntingtin and synaptic transmission Besides interacting with a number of cytoskeletal and synaptic vesicle proteins that are essential for exo- and endocytosis at synaptic terminals (Smith et al. 2005), huntingtin also interacts with a key molecule in synaptic transmission, PSD-95, a member of the  48 membrane-associated guanylate kinase (MAGUK) family of proteins that binds the NMDA (N-methyl-D-aspartate) and kainate receptors at the postsynaptic density (Sheng and Kim 2002). Wild-type huntingtin directly binds the Src homology 3 (SH3) domains of PSD-95 (Sun et al. 2001). The decreased interaction of mutant huntingtin with PSD-95 may indirectly affect the activity of NMDA receptors and lead to their overactivation or sensitization, and excitotoxicity (Sun et al. 2001). Indeed, a shift of NMDAR subunits NR1 and NR2B from internal pools to the plasma membrane and a significantly faster rate of NMDAR insertion to the surface are reported in YAC72 medium spiny striatal neurons(Fan et al. 2007). By contrast, the overexpression of wild-type huntingtin seems to attenuate the neuronal toxicity induced by NMDA receptors and mutant huntingtin (Sun et al. 2001; Leavitt et al. 2006). 1.2.5.5 The Relevance of WT Huntingtin function to the Pathogenesis of HD Is the loss of wild-type huntingtin involved in the disease process? If wild-type huntingtin has a function in mammalian neurons and this is inhibited by mutant huntingtin, the defects observed in mutant mice and cells should also be observed in the absence or reduced expression of wild-type huntingtin. Several lines of evidence indicate that at least some of the molecular dysfunctions observed in HD are a consequence of reduced wild-type huntingtin activity (Cattaneo et al. 2005).  In several different animal or cell models with reduced wildtype huntingtin expression, neuronal cell death and neurological dysfunction were observed, similar to what were seen with HD patients and mice. Mice with <50% huntingtin level have abnormal brain development (White et al. 1997; Auerbach et al. 2001); Hdh +\/-  mice show neuronal cell death and neurological  49 dysfunction in the globus pallidus and the subthalamic nucleus (Nasir et al. 1995; Dragatsis et al. 2000). Adult conditional Hdh -\/-  mice manifest a Huntington's disease-like phenotype and show apoptosis in the brain and testes(Dragatsis et al. 2000). On a cellular level, neurons that have less wildtype huntingtin also exhibit a similar phenotype as those expressing mutant huntingtin. Both HD mice and conditional Hdh -\/-  mice exhibit reduced vesicle and mitochondria transport(Gunawardena et al. 2003; Trushina et al. 2004). Reducing huntingtin by RNA interference in a mouse cell line also decreases BDNF vesicular transport (Gauthier et al. 2004). The loss of function of wildtype huntingtin hypothesis is further supported by evidence that wildtype huntingtin can alleviate the mutant huntingtin phenotype. Increased expression of wild-type huntingtin in a mutant huntingtin background causes: i) reduced toxicity in peripheral cells overexpressing mutant huntingtin (Ho et al. 2001); ii) inactivation of the RE1\/NRSE silencer in heterozygous mutant huntingtin knock-in cells (Zuccato et al. 2003); iii) reduced neuronal toxicity mediated by NMDA (N-methyl-D- aspartate) or kainate receptors in an immortalized rat hippocampal neuronal cell line (Sun et al. 2001). iv) improved HD phenotype in YAC128 mice (Van Raamsdonk et al. 2006). Conversely, depletion of wild-type huntingtin in a mutant huntingtin background causes: i) increased apoptotic cell death in the testes of YAC72 -\/-  mice (in which Hdh is knocked out in both endogenous alleles, and an additional yeast-derived artificial chromosome (YAC) containing the entire human mutant huntingtin 72-CAG gene is inserted) in comparison with YAC72 +\/+  mice (in which Hdh is wild-type in both endogenous alleles, and an additional YAC containing the entire human mutant huntingtin gene is inserted) (Leavitt et al. 2001); ii) worsening of behavioural phenotype and increased apoptosis in  50 the testes of YAC128 -\/-  mice compared with YAC128 +\/+  mice (Van Raamsdonk et al. 2005b). Together these results highlight the relevant evidence that implicates wild-type huntingtin in the pathogenesis of HD.  1.2.6 Post-Translational Modification of huntingtin Huntingtin protein is subject to a number of post-translational modifications such as palmitoylation(Huang et al. 2004; Yanai et al. 2006), phosphorylation(Humbert et al. 2002), ubiquination (Kalchman et al. 1996; Sieradzan et al. 1999) and SUMOlyation (Steffan et al. 2004) (Figure 1.15). Huntingtin is also a substrate for many enzymes that cleave proteins, including caspases, calpains and aspartyl peptidases (Wellington et al. 1998; Lunkes et al. 2002; Gafni et al. 2004). Various studies have shown that altered post-translational modifications are associated with mutant huntingtin and contribute to the pathogenesis of HD (Warby et al. 2005; Yanai et al. 2006; Davies et al. 1997; Hackam et al. 1998; Schilling et al. 1999; Cha 2000; Li et al. 2000; Yu et al. 2003).   Figure 1.15. Schematic diagram of N terminal huntingtin amino acid sequence, proteolysis sites and post-translational modification sites.  51 (Q)n indicates the polyglutamine tract, which is followed by the polyproline sequence, (P)n. The green arrowheads indicate the caspase cleavage sites, the red arrowheads the aspartyl proteases, and the black arrows the calpain cleavage sites. The indicated post-translational modifications include: ubiquitination (UBI) and\/or sumoylation (SUMO) (black circle), phosphorylation at serine 421 and serine 434 (blue circle) and palmitoylation at cysteine 214. Adapted from (Cattaneo et al. 2005) with permission.   1.3. PALMITOYLATION AND HUMAN DISEASE Recent studies revealed that altered palmitoylation leads to neuronal dysfunction, and in some cases the manifestation of neurodegenerative diseases. In Alzheimer\u2019s patients, extracellular \u03b2-amyloid release is enhanced, leading to aggregate formation. \u03b2- amyloid is proteolytically cleaved from a large transmembrane glycoprotein amyloid precursor protein by a membrane-bound protease, known as \u03b2-secretase (BACE) (reviewed in (Finder and Glockshuber 2007)). Mouse BACE is palmitoylated and mutation of the palmitoylation sites changes the membrane-associated form of BACE into a shed form(Benjannet et al. 2001; Sidera et al. 2005). Notably, a decrease in the palmitoylation of BACE occurs when cells expressing it are treated with statins, a cholesterol-lowering drug(Sidera et al. 2005; Kivipelto and Solomon 2006). Thus, inhibition of BACE palmitoylation may reduce BACE association with cholesterol-rich rafts, and alter amyloid precursor protein processing. This in turn may favor the formation of harmful protein aggregates. Palmitoylation of huntingtin by HIP14 (DHHC-17) is also essential to maintain normal huntingtin trafficking and function(Huang et al. 2004; Yanai et al. 2006). A defect in the association between HIP14 and huntingtin, which is triggered by poly- glutamine repeat expansion, contributes to neuronal dysfunction associated with  52 Huntington's disease (HD)(Gervais et al. 2002). Specifically, this reduced association causes a marked reduction in huntingtin palmitoylation, which further accelerates inclusion formation and increases neuronal toxicity. Down-regulation of HIP14 in neurons increases huntingtin inclusion formation, whereas overexpression of HIP14 substantially reduces inclusions(Yanai et al. 2006) (Figure 1.16). These results point to a possible therapeutic strategy by which mutant huntingtin function can be corrected through increasing its palmitoylation by HIP14.  53  Figure 1.16. Putative roles of huntingtin palmitoylation. (A) Palmitoylation of huntingtin (htt), may regulate protein sorting to specific lipid microdomains including lipid rafts, Golgi apparatus and post-Golgi transport vesicles, and synaptic membranes. Palmitoylation may also control huntingtin (htt) protein shuttling between cytosol and the nucleus and regulation of gene transcription. (B) Abolishing palmitoylation of polyglutamine expanded htt accelerates formation of inclusion bodies. Images show the enhanced number of inclusion formed in COS cells upon expression of the palmitoylation deficient form of poly-Q expanded htt.   54 Mutations in PPT1, causes the devastating neurodegenerative storage disorder of childhood, Infantile Neuronal Ceroid Lipofuscinosis (INCL), which is manifested by rapidly progressive brain atrophy (reviewed in(Haltia 2006; Kyttala et al. 2006)). Although PPT1 is predominantly expressed in lysosomes in non-neuronal cells, in neurons, studies done by Jalanko and Kopra groups revealed axonal and presynaptic localization of PPT1(Lehtovirta et al. 2001; Ahtiainen et al. 2003). Indeed, PPT-1 knockout mice show a progressive and gradual decline in presynaptic vesicle number and size, an early indicator of synapse degeneration(Virmani et al. 2005). Other studies also showed that PPT1 deficiency causes a defect in fluid-phase and receptor-mediated endocytosis(Ahtiainen et al. 2006). Although the exact molecular mechanism(s) remains unclear, the observed neurotransmission deficiency at the presynaptic terminal suggests that PPT1 may play a role in depalmitoylating proteins that facilitate presynaptic vesicle exocytosis and endocytosis. In addition to synaptic dysfunction, loss of PPT1 results in several other anomalies including altered endoplasmic reticulum structure, activation of the unfolded protein response, increased expression of chaperone proteins and activation of specific caspases and apoptosis(Zhang et al. 2006). Several forms of X-linked mental retardation (XLMR) have been linked to loss of DHHC proteins (Ropers 2006). Chromosomal translocation abnormalities and mutations in ZDHHC9, which palmitoylates RAS, is associated with Marfanoid habitus(Mansouri et al. 2005; Swarthout et al. 2005). Mutations in the ZDHHC8 gene, which is located on chromosome 22q11, has been linked to bipolar disorder and schizophrenia (Chen et al. 2004; Mukai et al. 2004). Analysis of ZDHHC8-knockout mice also revealed a sexually dimorphic deficit in prepulse inhibition, a gene dosage-dependent decrease in exploratory  55 activity in a new environment, and decreased sensitivity to the locomotor stimulatory effects of psychomimetic drugs (Mukai et al. 2004). These behaviors recapitulate many aspects of schizophrenic symptoms. However, several other studies indicate that mutations in ZDHHC8 are most likely associated with a small number of individuals suffering from bipolar disorder or schizophrenia(Faul et al. 2005; Glaser et al. 2005; Otani et al. 2005; Saito et al. 2005; Demily et al. 2007). DHHC proteins that have been reported to be associated with human diseases are summarized in the table below. Table 1.4. Pathophysiological functions of DHHC proteins (Reprint from (Tsutsumi et al. 2008)with permission) Hs, Homo sapiens; Mm, Mus musculus; Dm, Drosophila melanogaster DHHC protein Pathophysiological function(s) Associated substrates Reference(s) DHHC-2 Colorectal cancer (Hs)  (Oyama et al. 2000)\u0002 DHHC-8 Schizophrenia (Hs, Mm) (Chen et al. 2004; Mukai et al. 2004)\u0002 DHHC-9 X-linked mental retardation (Hs)  (Raymond et al. 2007)\u0002 Colorectal cancer (Hs)  (Mansilla et al. 2007)\u0002 DHHC-11 Bladder cancer (Hs) (Yamamoto et al. 2007)\u0002 DHHC-15 X-linked mental retardation (Hs)  (Mansouri et al. 2005)\u0002 DHHC-17\/ HIP14 Huntington disease (Mm)\u0002 Huntingtin (Yanai et al. 2006)\u0002 Synaptic transmission (Dm)\u0002 CSP, SNAP-25 (Ohyama et al. 2007; Stowers and Isacoff 2007)\u0002 1.4. THESIS HYPOTHESIS AND OBJECTIVES In chapter 1, we have discussed that palmitoylation regulates the subcellular trafficking and function of numerous proteins in neurons (el-Husseini Ael and Bredt 2002; Smotrys and Linder 2004; Huang and El-Husseini 2005; Resh 2006a). Palmitoyl acyl-transferases (PATs) are the class of enzymes that transfer palmitate to a substrate, while palmitoyl thioesterases catalyze the reverse reaction. At the beginning of this  56 graduate study in 2003, little was known about the identity of the enzymes that regulate the process of palmitoylation. In 2002, Singaraja et al found that a new huntingtin interacting protein named HIP14 was a mammalian homolog of Akr1p, a PAT in the yeast.  This initial finding raised two questions: whether HIP14 is a mammalian PAT and whether huntingtin is palmitoylated. These two questions promoted the pursuit of the following specific goals in this thesis: 1. Identify HIP14 as a neuronal palmitoyl acyl transferase (PAT) HIP14 is the first identified mammalian protein that is homologous to the yeast PAT Akr1p. Expression of human HIP14 results in rescue of the temperature-sensitive lethality in akr1\u2206 yeast cells and, furthermore, restores their defect in endocytosis, demonstrating a role for HIP14 in intracellular trafficking in mammals. Is HIP14 the neuronal PAT? What proteins are substrates of HIP14? Is the trafficking of these proteins influenced by HIP14? 2. Determine the effect of huntingtin palmitoylation at C214 by HIP14 Huntingtin interacts with HIP14, therefore could potentially be a substrate of HIP14 enzyme. HIP14's interaction with htt is inversely correlated to the polyglutamine expansion length in htt. Is huntingtin palmitoylated by HIP14? Which cysteines are the palmioylation sites? Does polyglutamine expansion influence the palmitoylation of huntingtin? How does huntingtin palmitoylation contribute to our understanding of HD pathogenesis? 3. Analyze four neuronal DHHC palmitoyl acyl transferases and compare their substrate specificity HIP14 is one of the 23 existing DHHC proteins, all of which are putative PATs.  57 Why mammals need so many proteins to exert the same enzymatic process? We focus on four neuronal expressed DHHCs and explore the following questions: Do they have substrate specificity? Do enzymes and their respective substrates colocalize? Do they interact in vitro and in vivo? Do regions other than DHHC domain contribute to the specificity between enzymes and their substrates? 4. Determine the role of wildtype huntingtin in regulating HIP14 enzymatic activity Huntingtin associates with HIP14 both in vitro and in vivo. Unlike the relationship between other DHHC enzymes and their substrates, interaction of huntingtin with HIP14 does not require the presence of palmitoylated cysteines. Does huntingtin function beyond only being a substrate of HIP14? Does wildtype huntingtin influence enzymatic activity of HIP14? If true, what role does wildtype huntingtin play in HD pathogenesis?  58 1.5. BIBLIOGRAPHY The Huntington's Disease Collaborative Research Group.(1993). \"A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington's disease chromosomes. \" Cell 72(6): 971-83. Adamson, P., C. J. Marshall, et al. (1992). \"Post-translational modifications of p21rho proteins.\" J Biol Chem 267(28): 20033-8. Ahtiainen, L., K. Luiro, et al. (2006). \"Palmitoyl protein thioesterase 1 (PPT1) deficiency causes endocytic defects connected to abnormal saposin processing.\" Exp Cell Res 312(9): 1540-53. Ahtiainen, L., O. P. Van Diggelen, et al. (2003). \"Palmitoyl protein thioesterase 1 is targeted to the axons in neurons.\" J Comp Neurol 455(3): 368-77. Altar, C. A., N. Cai, et al. (1997). \"Anterograde transport of brain-derived neurotrophic factor and its role in the brain.\" Nature 389(6653): 856-60. Ambrose, C. M., M. P. Duyao, et al. (1994). \"Structure and expression of the Huntington's disease gene: evidence against simple inactivation due to an expanded CAG repeat.\" Somat Cell Mol Genet 20(1): 27-38. Andrew, S. E., Y. P. Goldberg, et al. (1993). \"The relationship between trinucleotide (CAG) repeat length and clinical features of Huntington's disease.\" Nat Genet 4(4): 398- 403. Apostol, B. L., K. Illes, et al. (2006). \"Mutant huntingtin alters MAPK signaling pathways in PC12 and striatal cells: ERK1\/2 protects against mutant huntingtin- associated toxicity.\" Hum Mol Genet 15(2): 273-85. Arrasate, M., S. Mitra, et al. (2004). \"Inclusion body formation reduces levels of mutant huntingtin and the risk of neuronal death.\" Nature 431(7010): 805-10. Auerbach, W., M. S. Hurlbert, et al. (2001). \"The HD mutation causes progressive lethal neurological disease in mice expressing reduced levels of huntingtin.\" Hum Mol Genet 10(22): 2515-23. Basile, M., R. Lin, et al. (2006). \"Paralemmin interacts with D3 dopamine receptors: implications for membrane localization and cAMP signaling.\" Arch Biochem Biophys 446(1): 60-8. Baxter, L. R., Jr., J. C. Mazziotta, et al. (1992). \"Psychiatric, genetic, and positron emission tomographic evaluation of persons at risk for Huntington's disease.\" Arch Gen Psychiatry 49(2): 148-54. Becher, M. W., J. A. Kotzuk, et al. (1998). \"Intranuclear neuronal inclusions in Huntington's disease and dentatorubral and pallidoluysian atrophy: correlation between the density of inclusions and IT15 CAG triplet repeat length.\" Neurobiol Dis 4(6): 387-97. Benjannet, S., A. Elagoz, et al. (2001). \"Post-translational processing of beta-secretase (beta-amyloid-converting enzyme) and its ectodomain shedding. The pro- and transmembrane\/cytosolic domains affect its cellular activity and amyloid-beta production.\" J Biol Chem 276(14): 10879-87. Bodner, R. A., T. F. Outeiro, et al. (2006). \"From the Cover: Pharmacological promotion of inclusion formation: A therapeutic approach for Huntington's and Parkinson's diseases.\" Proceedings of the National Academy of Sciences 103(11): 4246-4251.  59 Bolt, J. M. (1970). \"Huntington's chorea in the West of Scotland.\" Br J Psychiatry 116(532): 259-70. Brinkman, R. R., M. M. Mezei, et al. (1997). \"The likelihood of being affected with Huntington disease by a particular age, for a specific CAG size.\" Am J Hum Genet 60(5): 1202-10. Burwinkel, B., G. Miglierini, et al. (1998). \"Structure of the human paralemmin gene (PALM), mapping to human chromosome 19p13.3 and mouse chromosome 10, and exclusion of coding mutations in grizzled, mocha, jittery, and hesitant mice.\" Genomics 49(3): 462-6. Caine, E. D. and I. Shoulson (1983). \"Psychiatric syndromes in Huntington's disease.\" Am J Psychiatry 140(6): 728-33. Castellini, M., L. V. Wolf, et al. (2005). \"Palm is expressed in both developing and adult mouse lens and retina.\" BMC Ophthalmol 5: 14. Cattaneo, E., C. Zuccato, et al. (2005). \"Normal huntingtin function: an alternative approach to Huntington's disease.\" Nat Rev Neurosci 6(12): 919-30. Cha, J. H. (2000). \"Transcriptional dysregulation in Huntington's disease.\" Trends Neurosci 23(9): 387-92. Cha, J. H., A. S. Frey, et al. (1999). \"Altered neurotransmitter receptor expression in transgenic mouse models of Huntington's disease.\" Philos Trans R Soc Lond B Biol Sci 354(1386): 981-9. Chamberlain, L. H., R. D. Burgoyne, et al. (2001). \"SNARE proteins are highly enriched in lipid rafts in PC12 cells: implications for the spatial control of exocytosis.\" Proc Natl Acad Sci U S A 98(10): 5619-24. Chamoun, Z., R. K. Mann, et al. (2001). \"Skinny hedgehog, an acyltransferase required for palmitoylation and activity of the hedgehog signal.\" Science 293(5537): 2080-4. Chan, A. W., S. Owens, et al. (2007). \"Resistance of presynaptic CaV2.2 channels to voltage-dependent inactivation: Dynamic palmitoylation and voltage sensitivity.\" Cell Calcium 42(4-5): 419-25. Chan, E. Y., R. Luthi-Carter, et al. (2002). \"Increased huntingtin protein length reduces the number of polyglutamine-induced gene expression changes in mouse models of Huntington's disease.\" Hum Mol Genet 11(17): 1939-51. Chen, H. Q., M. Tannous, et al. (2003). \"Novel roles for palmitoylation of Ras in IL-1 beta-induced nitric oxide release and caspase 3 activation in insulin-secreting beta cells.\" Biochem Pharmacol 66(9): 1681-94. Chen, W. Y., Y. Y. Shi, et al. (2004). \"Case-control study and transmission disequilibrium test provide consistent evidence for association between schizophrenia and genetic variation in the 22q11 gene ZDHHC8.\" Hum Mol Genet 13(23): 2991-5. Cho, S., P. E. Dawson, et al. (2000). \"In vitro depalmitoylation of neurospecific peptides: implication for infantile neuronal ceroid lipofuscinosis.\" J Neurosci Res 59(1): 32-8. Christopherson, K. S., N. T. Sweeney, et al. (2003). \"Lipid- and protein-mediated multimerization of PSD-95: implications for receptor clustering and assembly of synaptic protein networks.\" J Cell Sci 116(Pt 15): 3213-9. Craufurd, D., J. C. Thompson, et al. (2001). \"Behavioral changes in Huntington Disease.\" Neuropsychiatry Neuropsychol Behav Neurol 14(4): 219-26. Craven, S. E., A. E. El-Husseini, et al. (1999). \"Synaptic targeting of the postsynaptic density protein PSD-95 mediated by lipid and protein motifs.\" Neuron 22(3): 497-509.  60 Cummings, C. J., E. Reinstein, et al. (1999). \"Mutation of the E6-AP ubiquitin ligase reduces nuclear inclusion frequency while accelerating polyglutamine-induced pathology in SCA1 mice.\" Neuron 24(4): 879-92. Davies, S. W., K. Beardsall, et al. (1998). \"Are neuronal intranuclear inclusions the common neuropathology of triplet-repeat disorders with polyglutamine-repeat expansions?\" Lancet 351(9096): 131-3. Davies, S. W., M. Turmaine, et al. (1997). \"Formation of neuronal intranuclear inclusions underlies the neurological dysfunction in mice transgenic for the HD mutation.\" Cell 90(3): 537-48. De Rooij, K. E., J. C. Dorsman, et al. (1996). \"Subcellular localization of the Huntington's disease gene product in cell lines by immunofluorescence and biochemical subcellular fractionation.\" Hum Mol Genet 5(8): 1093-9. DeJesus, G. and O. A. Bizzozero (2002). \"Effect of 2-fluoropalmitate, cerulenin and tunicamycin on the palmitoylation and intracellular translocation of myelin proteolipid protein.\" Neurochem Res 27(12): 1669-75. Demily, C., S. Legallic, et al. (2007). \"ZDHHC8 Single Nucleotide Polymorphism rs175174 is not associated with psychiatric features of the 22q11 Deletion Syndrome or Schizophrenia.\" Psychiatr Genet 17(5): 311-312. DeSouza, S., J. Fu, et al. (2002). \"Differential palmitoylation directs the AMPA receptor- binding protein ABP to spines or to intracellular clusters.\" J Neurosci 22(9): 3493-503. Desplats, P. A., K. E. Kass, et al. (2006). \"Selective deficits in the expression of striatal- enriched mRNAs in Huntington's disease.\" J Neurochem 96(3): 743-57. Dewhurst, K., J. E. Oliver, et al. (1970). \"Socio-psychiatric consequences of Huntington's disease.\" Br J Psychiatry 116(532): 255-8. Di Maio, L., F. Squitieri, et al. (1993). \"Onset symptoms in 510 patients with Huntington's disease.\" J Med Genet 30(4): 289-92. DiFiglia, M., E. Sapp, et al. (1995). \"Huntingtin is a cytoplasmic protein associated with vesicles in human and rat brain neurons.\" Neuron 14(5): 1075-81. DiFiglia, M., E. Sapp, et al. (1997). \"Aggregation of huntingtin in neuronal intranuclear inclusions and dystrophic neurites in brain.\" Science 277(5334): 1990-3. Dorsman, J. C., M. A. Smoor, et al. (1999). \"Analysis of the subcellular localization of huntingtin with a set of rabbit polyclonal antibodies in cultured mammalian cells of neuronal origin: comparison with the distribution of huntingtin in Huntington's disease autopsy brain.\" Philos Trans R Soc Lond B Biol Sci 354(1386): 1061-7. Dragatsis, I., A. Efstratiadis, et al. (1998). \"Mouse mutant embryos lacking huntingtin are rescued from lethality by wild-type extraembryonic tissues.\" Development 125(8): 1529- 39. Dragatsis, I., M. S. Levine, et al. (2000). \"Inactivation of Hdh in the brain and testis results in progressive neurodegeneration and sterility in mice.\" Nat Genet 26(3): 300-6. Drisdel, R. C., J. K. Alexander, et al. (2006). \"Assays of protein palmitoylation.\" Methods 40(2): 127-34. Drisdel, R. C. and W. N. Green (2004). \"Labeling and quantifying sites of protein palmitoylation.\" Biotechniques 36(2): 276-85. Drisdel, R. C., E. Manzana, et al. (2004). \"The role of palmitoylation in functional expression of nicotinic alpha7 receptors.\" J Neurosci 24(46): 10502-10.  61 Duyao, M. P., A. B. Auerbach, et al. (1995). \"Inactivation of the mouse Huntington's disease gene homolog Hdh.\" Science 269(5222): 407-10. Ehrlich, I. and R. Malinow (2004). \"Postsynaptic density 95 controls AMPA receptor incorporation during long-term potentiation and experience-driven synaptic plasticity.\" J Neurosci 24(4): 916-27. El-Husseini, A. E., S. E. Craven, et al. (2000a). \"Dual palmitoylation of PSD-95 mediates its vesiculotubular sorting, postsynaptic targeting, and ion channel clustering.\" J Cell Biol 148(1): 159-72. El-Husseini, A. E., E. Schnell, et al. (2000b). \"PSD-95 involvement in maturation of excitatory synapses.\" Science 290(5495): 1364-8. El-Husseini, A. E., J. R. Topinka, et al. (2000c). \"Ion channel clustering by membrane- associated guanylate kinases. Differential regulation by N-terminal lipid and metal binding motifs.\" J Biol Chem 275(31): 23904-10. el-Husseini Ael, D. and D. S. Bredt (2002). \"Protein palmitoylation: a regulator of neuronal development and function.\" Nat Rev Neurosci 3(10): 791-802. El-Husseini Ael, D., E. Schnell, et al. (2002). \"Synaptic strength regulated by palmitate cycling on PSD-95.\" Cell 108(6): 849-63. Evans, G. J., A. Morgan, et al. (2003). \"Tying everything together: the multiple roles of cysteine string protein (CSP) in regulated exocytosis.\" Traffic 4(10): 653-9. Fan, M. M., H. B. Fernandes, et al. (2007). \"Altered NMDA receptor trafficking in a yeast artificial chromosome transgenic mouse model of Huntington's disease.\" J Neurosci 27(14): 3768-79. Fang, C., L. Deng, et al. (2006). \"GODZ-mediated palmitoylation of GABA(A) receptors is required for normal assembly and function of GABAergic inhibitory synapses.\" J Neurosci 26(49): 12758-68. Faul, T., M. Gawlik, et al. (2005). \"ZDHHC8 as a candidate gene for schizophrenia: analysis of a putative functional intronic marker in case-control and family-based association studies.\" BMC Psychiatry 5: 35. Fernandez-Hernando, C., M. Fukata, et al. (2006). \"Identification of Golgi-localized acyl transferases that palmitoylate and regulate endothelial nitric oxide synthase.\" J Cell Biol 174(3): 369-77. Ferrante, R. J., J. K. Kubilus, et al. (2003). \"Histone deacetylase inhibition by sodium butyrate chemotherapy ameliorates the neurodegenerative phenotype in Huntington's disease mice.\" J Neurosci 23(28): 9418-27. Finder, V. H. and R. Glockshuber (2007). \"Amyloid-beta aggregation.\" Neurodegener Dis 4(1): 13-27. Folstein, S., M. H. Abbott, et al. (1983a). \"The association of affective disorder with Huntington's disease in a case series and in families.\" Psychol Med 13(3): 537-42. Folstein, S. E., M. L. Franz, et al. (1983b). \"Conduct disorder and affective disorder among the offspring of patients with Huntington's disease.\" Psychol Med 13(1): 45-52. Folstein, S. E., R. J. Leigh, et al. (1986). \"The diagnosis of Huntington's disease.\" Neurology 36(10): 1279-83. Fukasawa, M., O. Varlamov, et al. (2004). \"Localization and activity of the SNARE Ykt6 determined by its regulatory domain and palmitoylation.\" Proc Natl Acad Sci U S A 101(14): 4815-20.  62 Fukata, M., Y. Fukata, et al. (2004). \"Identification of PSD-95 palmitoylating enzymes.\" Neuron 44(6): 987-96. Fukata, Y., T. Iwanaga, et al. (2006). \"Systematic screening for palmitoyl transferase activity of the DHHC protein family in mammalian cells.\" Methods 40(2): 177-82. Gafni, J., E. Hermel, et al. (2004). \"Inhibition of calpain cleavage of huntingtin reduces toxicity: accumulation of calpain\/caspase fragments in the nucleus.\" J Biol Chem 279(19): 20211-20. Gauthier-Campbell, C., D. S. Bredt, et al. (2004). \"Regulation of dendritic branching and filopodia formation in hippocampal neurons by specific acylated protein motifs.\" Mol Biol Cell 15(5): 2205-17. Gauthier, L. R., B. C. Charrin, et al. (2004). \"Huntingtin controls neurotrophic support and survival of neurons by enhancing BDNF vesicular transport along microtubules.\" Cell 118(1): 127-38. Gerrow, K. and A. El-Husseini (2006). \"Cell adhesion molecules at the synapse.\" Front Biosci 11: 2400-19. Gerrow, K., S. Romorini, et al. (2006). \"A preformed complex of postsynaptic proteins is involved in excitatory synapse development.\" Neuron 49(4): 547-62. Gervais, F. G., R. Singaraja, et al. (2002). \"Recruitment and activation of caspase-8 by the Huntingtin-interacting protein Hip-1 and a novel partner Hippi.\" Nat Cell Biol 4(2): 95-105. Glaser, B., J. Schumacher, et al. (2005). \"No association between the putative functional ZDHHC8 single nucleotide polymorphism rs175174 and schizophrenia in large European samples.\" Biol Psychiatry 58(1): 78-80. Glass, M., M. Dragunow, et al. (2000). \"The pattern of neurodegeneration in Huntington's disease: a comparative study of cannabinoid, dopamine, adenosine and GABA(A) receptor alterations in the human basal ganglia in Huntington's disease.\" Neuroscience 97(3): 505-19. Glickman, M. H. and A. Ciechanover (2002). \"The ubiquitin-proteasome proteolytic pathway: destruction for the sake of construction.\" Physiol Rev 82(2): 373-428. Gong, B., M. C. Lim, et al. (2008). \"Time-lapse analysis of aggregate formation in an inducible PC12 cell model of Huntington's disease reveals time-dependent aggregate formation that transiently delays cell death.\" Brain Res Bull 75(1): 146-57. Graham, R. K., E. J. Slow, et al. (2006). \"Levels of mutant huntingtin influence the phenotypic severity of Huntington disease in YAC128 mouse models.\" Neurobiol Dis 21(2): 444-55. Greaves, J. and L. H. Chamberlain (2006). \"Dual role of the cysteine-string domain in membrane binding and palmitoylation-dependent sorting of the molecular chaperone cysteine-string protein.\" Mol Biol Cell 17(11): 4748-59. Greaves, J. and L. H. Chamberlain (2007). \"Palmitoylation-dependent protein sorting.\" J Cell Biol 176(3): 249-54. Gunawardena, S., L. S. Her, et al. (2003). \"Disruption of axonal transport by loss of huntingtin or expression of pathogenic polyQ proteins in Drosophila.\" Neuron 40(1): 25- 40. Gusella, J. F. and M. E. MacDonald (1996). \"Trinucleotide instability: a repeating theme in human inherited disorders.\" Annu Rev Med 47: 201-9.  63 Gutekunst, C. A., A. I. Levey, et al. (1995). \"Identification and localization of huntingtin in brain and human lymphoblastoid cell lines with anti-fusion protein antibodies.\" Proc Natl Acad Sci U S A 92(19): 8710-4. Gutekunst, C. A., S. H. Li, et al. (1999). \"Nuclear and neuropil aggregates in Huntington's disease: relationship to neuropathology.\" J Neurosci 19(7): 2522-34. Hackam, A. S., R. Singaraja, et al. (1998). \"The influence of huntingtin protein size on nuclear localization and cellular toxicity.\" J Cell Biol 141(5): 1097-105. Hall, A. and C. D. Nobes (2000). \"Rho GTPases: molecular switches that control the organization and dynamics of the actin cytoskeleton.\" Philos Trans R Soc Lond B Biol Sci 355(1399): 965-70. Halpain, S., K. Spencer, et al. (2005). \"Dynamics and pathology of dendritic spines.\" Prog Brain Res 147: 29-37. Haltia, M. (2006). \"The neuronal ceroid-lipofuscinoses: from past to present.\" Biochim Biophys Acta 1762(10): 850-6. Han, W., J. S. Rhee, et al. (2004). \"N-glycosylation is essential for vesicular targeting of synaptotagmin 1.\" Neuron 41(1): 85-99. Hansson, O., E. Guatteo, et al. (2001). \"Resistance to NMDA toxicity correlates with appearance of nuclear inclusions, behavioural deficits and changes in calcium homeostasis in mice transgenic for exon 1 of the huntington gene.\" Eur J Neurosci 14(9): 1492-504. Hansson, O., A. Petersen, et al. (1999). \"Transgenic mice expressing a Huntington's disease mutation are resistant to quinolinic acid-induced striatal excitotoxicity.\" Proc Natl Acad Sci U S A 96(15): 8727-32. Harper, B. (2005). \"Huntington disease.\" J R Soc Med 98(12): 550. Harper, P. S. (1992). \"The epidemiology of Huntington's disease.\" Hum Genet 89(4): 365-76. Harper, P. S. (1993). \"A specific mutation for Huntington's disease.\" J Med Genet 30(12): 975-7. Hayashi, T., G. Rumbaugh, et al. (2005). \"Differential regulation of AMPA receptor subunit trafficking by palmitoylation of two distinct sites.\" Neuron 47(5): 709-23. Heindel, U., M. F. Schmidt, et al. (2003). \"Palmitoylation sites and processing of synaptotagmin I, the putative calcium sensor for neurosecretion.\" FEBS Lett 544(1-3): 57-62. Heinsen, H., U. Rub, et al. (1999). \"Nerve cell loss in the thalamic mediodorsal nucleus in Huntington's disease.\" Acta Neuropathol 97(6): 613-22. Hilditch-Maguire, P., F. Trettel, et al. (2000). \"Huntingtin: an iron-regulated protein essential for normal nuclear and perinuclear organelles.\" Hum Mol Genet 9(19): 2789-97. Ho, L. W., R. Brown, et al. (2001). \"Wild type Huntingtin reduces the cellular toxicity of mutant Huntingtin in mammalian cell models of Huntington's disease.\" J Med Genet 38(7): 450-2. Hockly, E., V. M. Richon, et al. (2003). \"Suberoylanilide hydroxamic acid, a histone deacetylase inhibitor, ameliorates motor deficits in a mouse model of Huntington's disease.\" Proc Natl Acad Sci U S A 100(4): 2041-6. Hodges, A., A. D. Strand, et al. (2006). \"Regional and cellular gene expression changes in human Huntington's disease brain.\" Hum Mol Genet 15(6): 965-77.  64 Hodgson, J. G., N. Agopyan, et al. (1999). \"A YAC mouse model for Huntington's disease with full-length mutant huntingtin, cytoplasmic toxicity, and selective striatal neurodegeneration.\" Neuron 23(1): 181-92. Hoffner, G., P. Kahlem, et al. (2002). \"Perinuclear localization of huntingtin as a consequence of its binding to microtubules through an interaction with beta-tubulin: relevance to Huntington's disease.\" J Cell Sci 115(Pt 5): 941-8. Holbert, S., I. Denghien, et al. (2001). \"The Gln-Ala repeat transcriptional activator CA150 interacts with huntingtin: neuropathologic and genetic evidence for a role in Huntington's disease pathogenesis.\" Proc Natl Acad Sci U S A 98(4): 1811-6. Hoogeveen, A. T., R. Willemsen, et al. (1993). \"Characterization and localization of the Huntington disease gene product.\" Hum Mol Genet 2(12): 2069-73. Hou, H., K. Subramanian, et al. (2005). \"The DHHC protein Pfa3 affects vacuole- associated palmitoylation of the fusion factor Vac8.\" Proc Natl Acad Sci U S A 102(48): 17366-71. Huang, K. and A. El-Husseini (2005). \"Modulation of neuronal protein trafficking and function by palmitoylation.\" Curr Opin Neurobiol 15(5): 527-35. Huang, K., A. Yanai, et al. (2004). \"Huntingtin-interacting protein HIP14 is a palmitoyl transferase involved in palmitoylation and trafficking of multiple neuronal proteins.\" Neuron 44(6): 977-86. Humbert, S., E. A. Bryson, et al. (2002). \"The IGF-1\/Akt pathway is neuroprotective in Huntington's disease and involves Huntingtin phosphorylation by Akt.\" Dev Cell 2(6): 831-7. Hurley, J. H., A. L. Cahill, et al. (2000). \"The role of dynamic palmitoylation in Ca2+ channel inactivation.\" Proc Natl Acad Sci U S A 97(16): 9293-8. Ivkovic, S. and M. E. Ehrlich (1999). \"Expression of the striatal DARPP-32\/ARPP-21 phenotype in GABAergic neurons requires neurotrophins in vivo and in vitro.\" J Neurosci 19(13): 5409-19. Jeste, D. V., L. Barban, et al. (1984). \"Reduced Purkinje cell density in Huntington's disease.\" Exp Neurol 85(1): 78-86. Jochen, A. L., J. Hays, et al. (1995). \"Inhibitory effects of cerulenin on protein palmitoylation and insulin internalization in rat adipocytes.\" Biochim Biophys Acta 1259(1): 65-72. Jones, A. L. (1999). \"The localization and interactions of huntingtin.\" Philos Trans R Soc Lond B Biol Sci 354(1386): 1021-7. Kalchman, M. A., R. K. Graham, et al. (1996). \"Huntingtin is ubiquitinated and interacts with a specific ubiquitin-conjugating enzyme.\" J Biol Chem 271(32): 19385-94. Kanaani, J., M. J. Diacovo, et al. (2004). \"Palmitoylation controls trafficking of GAD65 from Golgi membranes to axon-specific endosomes and a Rab5a-dependent pathway to presynaptic clusters.\" J Cell Sci 117(Pt 10): 2001-13. Kang, R., R. Swayze, et al. (2004). \"Presynaptic trafficking of synaptotagmin I is regulated by protein palmitoylation.\" J Biol Chem 279(48): 50524-36. Kegel, K. B., A. R. Meloni, et al. (2002). \"Huntingtin is present in the nucleus, interacts with the transcriptional corepressor C-terminal binding protein, and represses transcription.\" J Biol Chem 277(9): 7466-76. Kegel, K. B., E. Sapp, et al. (2005). \"Huntingtin associates with acidic phospholipids at the plasma membrane.\" J Biol Chem 280(43): 36464-73.  65 Keller, C. A., X. Yuan, et al. (2004). \"The gamma2 subunit of GABA(A) receptors is a substrate for palmitoylation by GODZ.\" J Neurosci 24(26): 5881-91. Keller, J. N., J. Gee, et al. (2002). \"The proteasome in brain aging.\" Ageing Res Rev 1(2): 279-93. Khanna, R., Q. Li, et al. (2007). \"The presynaptic CaV2.2 channel-transmitter release site core complex.\" Eur J Neurosci 26(3): 547-59. Kirkwood, S. C., E. Siemers, et al. (1999). \"Longitudinal cognitive and motor changes among presymptomatic Huntington disease gene carriers.\" Arch Neurol 56(5): 563-8. Kivipelto, M. and A. Solomon (2006). \"Cholesterol as a risk factor for Alzheimer's disease - epidemiological evidence.\" Acta Neurol Scand Suppl 185: 50-7. Klement, I. A., P. J. Skinner, et al. (1998). \"Ataxin-1 nuclear localization and aggregation: role in polyglutamine-induced disease in SCA1 transgenic mice.\" Cell 95(1): 41-53. Klinghoffer, R. A., C. Sachsenmaier, et al. (1999). \"Src family kinases are required for integrin but not PDGFR signal transduction.\" Embo J 18(9): 2459-71. Kostiuk, M. A., M. M. Corvi, et al. (2008). \"Identification of palmitoylated mitochondrial proteins using a bio-orthogonal azido-palmitate analogue.\" Faseb J 22(3): 721-32. Kremer, B., P. Goldberg, et al. (1994). \"A worldwide study of the Huntington's disease mutation. The sensitivity and specificity of measuring CAG repeats.\" N Engl J Med 330(20): 1401-6. Kremer, B., B. Weber, et al. (1992). \"New insights into the clinical features, pathogenesis and molecular genetics of Huntington disease.\" Brain Pathol 2(4): 321-35. Kremer, H. P. (1992). \"The hypothalamic lateral tuberal nucleus: normal anatomy and changes in neurological diseases.\" Prog Brain Res 93: 249-61. Kremer, H. P., R. A. Roos, et al. (1991). \"The hypothalamic lateral tuberal nucleus and the characteristics of neuronal loss in Huntington's disease.\" Neurosci Lett 132(1): 101-4. Kuemmerle, S., C. A. Gutekunst, et al. (1999). \"Huntington aggregates may not predict neuronal death in Huntington's disease.\" Ann Neurol 46(6): 842-9. Kutzleb, C., E. Petrasch-Parwez, et al. (2007). \"Cellular and subcellular localization of paralemmin-1, a protein involved in cell shape control, in the rat brain, adrenal gland and kidney.\" Histochem Cell Biol 127(1): 13-30. Kutzleb, C., G. Sanders, et al. (1998). \"Paralemmin, a prenyl-palmitoyl-anchored phosphoprotein abundant in neurons and implicated in plasma membrane dynamics and cell process formation.\" J Cell Biol 143(3): 795-813. Kyttala, A., U. Lahtinen, et al. (2006). \"Functional biology of the neuronal ceroid lipofuscinoses (NCL) proteins.\" Biochim Biophys Acta 1762(10): 920-33. Laforet, G. A., E. Sapp, et al. (2001). \"Changes in cortical and striatal neurons predict behavioral and electrophysiological abnormalities in a transgenic murine model of Huntington's disease.\" J Neurosci 21(23): 9112-23. Lam, K. K., M. Davey, et al. (2006). \"Palmitoylation by the DHHC protein Pfa4 regulates the ER exit of Chs3.\" J Cell Biol 174(1): 19-25. Landwehrmeyer, G. B., S. M. McNeil, et al. (1995). \"Huntington's disease gene: regional and cellular expression in brain of normal and affected individuals.\" Ann Neurol 37(2): 218-30. Langbehn, D. R., R. R. Brinkman, et al. (2004). \"A new model for prediction of the age of onset and penetrance for Huntington's disease based on CAG length.\" Clin Genet 65(4): 267-77.  66 Lange, H., G. Thorner, et al. (1976). \"Morphometric studies of the neuropathological changes in choreatic diseases.\" J Neurol Sci 28(4): 401-25. Lasker, A. G. and D. S. Zee (1997). \"Ocular motor abnormalities in Huntington's disease.\" Vision Res 37(24): 3639-45. Lawrence, D. S., J. T. Zilfou, et al. (1999). \"Structure-activity studies of cerulenin analogues as protein palmitoylation inhibitors.\" J Med Chem 42(24): 4932-41. Leavitt, B. R., J. A. Guttman, et al. (2001). \"Wild-type huntingtin reduces the cellular toxicity of mutant huntingtin in vivo.\" Am J Hum Genet 68(2): 313-24. Leavitt, B. R., J. M. van Raamsdonk, et al. (2006). \"Wild-type huntingtin protects neurons from excitotoxicity.\" J Neurochem 96(4): 1121-9. Lehtovirta, M., A. Kyttala, et al. (2001). \"Palmitoyl protein thioesterase (PPT) localizes into synaptosomes and synaptic vesicles in neurons: implications for infantile neuronal ceroid lipofuscinosis (INCL).\" Hum Mol Genet 10(1): 69-75. Li, J. Y., M. Plomann, et al. (2003a). \"Huntington's disease: a synaptopathy?\" Trends Mol Med 9(10): 414-20. Li, L., M. P. Haynes, et al. (2003b). \"Plasma membrane localization and function of the estrogen receptor alpha variant (ER46) in human endothelial cells.\" Proc Natl Acad Sci U S A 100(8): 4807-12. Li, S. H., S. Lam, et al. (2000). \"Intranuclear huntingtin increases the expression of caspase-1 and induces apoptosis.\" Hum Mol Genet 9(19): 2859-67. Li, S. H., G. Schilling, et al. (1993). \"Huntington's disease gene (IT15) is widely expressed in human and rat tissues.\" Neuron 11(5): 985-93. Lin, B., J. M. Rommens, et al. (1993). \"Differential 3' polyadenylation of the Huntington disease gene results in two mRNA species with variable tissue expression.\" Hum Mol Genet 2(10): 1541-5. Lin, C. H., S. Tallaksen-Greene, et al. (2001). \"Neurological abnormalities in a knock-in mouse model of Huntington's disease.\" Hum Mol Genet 10(2): 137-44. Linder, M. E. and R. J. Deschenes (2007). \"Palmitoylation: policing protein stability and traffic.\" Nat Rev Mol Cell Biol 8(1): 74-84. Lippincott-Schwartz, J., N. Altan-Bonnet, et al. (2003). \"Photobleaching and photoactivation: following protein dynamics in living cells.\" Nat Cell Biol Suppl: S7-14. Lippincott-Schwartz, J., E. Snapp, et al. (2001). \"Studying protein dynamics in living cells.\" Nat Rev Mol Cell Biol 2(6): 444-56. Lobo, S., W. K. Greentree, et al. (2002). \"Identification of a Ras palmitoyltransferase in Saccharomyces cerevisiae.\" J Biol Chem 277(43): 41268-73. Lovestone, S., S. Hodgson, et al. (1996). \"Familial psychiatric presentation of Huntington's disease.\" J Med Genet 33(2): 128-31. Lunkes, A., K. S. Lindenberg, et al. (2002). \"Proteases acting on mutant huntingtin generate cleaved products that differentially build up cytoplasmic and nuclear inclusions.\" Mol Cell 10(2): 259-69. Luthi-Carter, R., B. L. Apostol, et al. (2003). \"Complex alteration of NMDA receptors in transgenic Huntington's disease mouse brain: analysis of mRNA and protein expression, plasma membrane association, interacting proteins, and phosphorylation.\" Neurobiol Dis 14(3): 624-36.  67 Luthi-Carter, R., S. A. Hanson, et al. (2002a). \"Dysregulation of gene expression in the R6\/2 model of polyglutamine disease: parallel changes in muscle and brain.\" Hum Mol Genet 11(17): 1911-26. Luthi-Carter, R., A. D. Strand, et al. (2002b). \"Polyglutamine and transcription: gene expression changes shared by DRPLA and Huntington's disease mouse models reveal context-independent effects.\" Hum Mol Genet 11(17): 1927-37. Maat-Schieman, M., R. Roos, et al. (2007). \"Neuronal intranuclear and neuropil inclusions for pathological assessment of Huntington's disease.\" Brain Pathol 17(1): 31-7. Macdonald, V. and G. Halliday (2002). \"Pyramidal cell loss in motor cortices in Huntington's disease.\" Neurobiol Dis 10(3): 378-86. Macdonald, V., G. M. Halliday, et al. (1997). \"Significant loss of pyramidal neurons in the angular gyrus of patients with Huntington's disease.\" Neuropathol Appl Neurobiol 23(6): 492-5. Mahant, N., E. A. McCusker, et al. (2003). \"Huntington's disease: clinical correlates of disability and progression.\" Neurology 61(8): 1085-92. Mangiarini, L., K. Sathasivam, et al. (1996). \"Exon 1 of the HD gene with an expanded CAG repeat is sufficient to cause a progressive neurological phenotype in transgenic mice.\" Cell 87(3): 493-506. Mansilla, F., K. Birkenkamp-Demtroder, et al. (2007). \"Differential expression of DHHC9 in microsatellite stable and instable human colorectal cancer subgroups.\" Br J Cancer 96(12): 1896-903. Mansouri, M. R., L. Marklund, et al. (2005). \"Loss of ZDHHC15 expression in a woman with a balanced translocation t(X;15)(q13.3;cen) and severe mental retardation.\" Eur J Hum Genet 13(8): 970-7. Mastroberardino, P. G., C. Iannicola, et al. (2002). \"'Tissue' transglutaminase ablation reduces neuronal death and prolongs survival in a mouse model of Huntington's disease.\" Cell Death Differ 9(9): 873-80. Matsuda, K., S. Matsuda, et al. (2006). \"Characterization of the delta2 glutamate receptor-binding protein delphilin: Splicing variants with differential palmitoylation and an additional PDZ domain.\" J Biol Chem 281(35): 25577-87. Matus, A. (2005). \"Growth of dendritic spines: a continuing story.\" Curr Opin Neurobiol 15(1): 67-72. McCampbell, A., J. P. Taylor, et al. (2000). \"CREB-binding protein sequestration by expanded polyglutamine.\" Hum Mol Genet 9(14): 2197-202. McClellan, A. J., S. Tam, et al. (2005). \"Protein quality control: chaperones culling corrupt conformations.\" Nat Cell Biol 7(8): 736-41. McNeil, S. M., A. Novelletto, et al. (1997). \"Reduced penetrance of the Huntington's disease mutation.\" Hum Mol Genet 6(5): 775-9. Menalled, L. B. (2005). \"Knock-in mouse models of Huntington's disease.\" NeuroRx 2(3): 465-70. Menalled, L. B., J. D. Sison, et al. (2003). \"Time course of early motor and neuropathological anomalies in a knock-in mouse model of Huntington's disease with 140 CAG repeats.\" J Comp Neurol 465(1): 11-26. Menalled, L. B., J. D. Sison, et al. (2002). \"Early motor dysfunction and striosomal distribution of huntingtin microaggregates in Huntington's disease knock-in mice.\" J Neurosci 22(18): 8266-76.  68 Mitchell, I. J., A. J. Cooper, et al. (1999). \"The selective vulnerability of striatopallidal neurons.\" Prog Neurobiol 59(6): 691-719. Montoya, A., B. H. Price, et al. (2006). \"Brain imaging and cognitive dysfunctions in Huntington's disease.\" J Psychiatry Neurosci 31(1): 21-9. Mukai, J., H. Liu, et al. (2004). \"Evidence that the gene encoding ZDHHC8 contributes to the risk of schizophrenia.\" Nat Genet 36(7): 725-31. Myers, R. H., J. Leavitt, et al. (1989). \"Homozygote for Huntington disease.\" Am J Hum Genet 45(4): 615-8. Nasir, J., S. B. Floresco, et al. (1995). \"Targeted disruption of the Huntington's disease gene results in embryonic lethality and behavioral and morphological changes in heterozygotes.\" Cell 81(5): 811-23. Newey, S. E., V. Velamoor, et al. (2005). \"Rho GTPases, dendritic structure, and mental retardation.\" J Neurobiol 64(1): 58-74. Nusse, R. (2003). \"Wnts and Hedgehogs: lipid-modified proteins and similarities in signaling mechanisms at the cell surface.\" Development 130(22): 5297-305. O'Kusky, J. R., J. Nasir, et al. (1999). \"Neuronal degeneration in the basal ganglia and loss of pallido-subthalamic synapses in mice with targeted disruption of the Huntington's disease gene.\" Brain Res 818(2): 468-79. Ohno, Y., A. Kihara, et al. (2006). \"Intracellular localization and tissue-specific distribution of human and yeast DHHC cysteine-rich domain-containing proteins.\" Biochim Biophys Acta 1761(4): 474-83. Ohyama, T., P. Verstreken, et al. (2007). \"Huntingtin-interacting protein 14, a palmitoyl transferase required for exocytosis and targeting of CSP to synaptic vesicles.\" J Cell Biol 179(7): 1481-96. Osten, P., L. Khatri, et al. (2000). \"Mutagenesis reveals a role for ABP\/GRIP binding to GluR2 in synaptic surface accumulation of the AMPA receptor.\" Neuron 27(2): 313-25. Otani, K., H. Ujike, et al. (2005). \"The ZDHHC8 gene did not associate with bipolar disorder or schizophrenia.\" Neurosci Lett 390(3): 166-70. Oyama, T., Y. Miyoshi, et al. (2000). \"Isolation of a novel gene on 8p21.3-22 whose expression is reduced significantly in human colorectal cancers with liver metastasis.\" Genes Chromosomes Cancer 29(1): 9-15. Patterson, S. I. and J. H. Skene (1994). \"Novel inhibitory action of tunicamycin homologues suggests a role for dynamic protein fatty acylation in growth cone-mediated neurite extension.\" J Cell Biol 124(4): 521-36. Persichetti, F., L. Carlee, et al. (1996). \"Differential expression of normal and mutant Huntington's disease gene alleles.\" Neurobiol Dis 3(3): 183-90. Pflanz, S., J. A. Besson, et al. (1991). \"The clinical manifestation of mental disorder in Huntington's disease: a retrospective case record study of disease progression.\" Acta Psychiatr Scand 83(1): 53-60. Politz, J. C. (1999). \"Use of caged fluorochromes to track macromolecular movement in living cells.\" Trends Cell Biol 9(7): 284-7. Puri, N. and P. A. Roche (2006). \"Ternary SNARE complexes are enriched in lipid rafts during mast cell exocytosis.\" Traffic 7(11): 1482-94. Qanbar, R. and M. Bouvier (2003). \"Role of palmitoylation\/depalmitoylation reactions in G-protein-coupled receptor function.\" Pharmacol Ther 97(1): 1-33.  69 Ranen, N. G., O. C. Stine, et al. (1995). \"Anticipation and instability of IT-15 (CAG)n repeats in parent-offspring pairs with Huntington disease.\" Am J Hum Genet 57(3): 593- 602. Ravikumar, B., C. Vacher, et al. (2004). \"Inhibition of mTOR induces autophagy and reduces toxicity of polyglutamine expansions in fly and mouse models of Huntington disease.\" Nat Genet 36(6): 585-95. Raymond, F. L., P. S. Tarpey, et al. (2007). \"Mutations in ZDHHC9, which encodes a palmitoyltransferase of NRAS and HRAS, cause X-linked mental retardation associated with a Marfanoid habitus.\" Am J Hum Genet 80(5): 982-7. Reiner, A., R. L. Albin, et al. (1988). \"Differential loss of striatal projection neurons in Huntington disease.\" Proc Natl Acad Sci U S A 85(15): 5733-7. Resh, M. D. (1999). \"Fatty acylation of proteins: new insights into membrane targeting of myristoylated and palmitoylated proteins.\" Biochim Biophys Acta 1451(1): 1-16. Resh, M. D. (2006a). \"Palmitoylation of ligands, receptors, and intracellular signaling molecules.\" Sci STKE 2006(359): re14. Resh, M. D. (2006b). \"Use of analogs and inhibitors to study the functional significance of protein palmitoylation.\" Methods 40(2): 191-7. Rigamonti, D., J. H. Bauer, et al. (2000). \"Wild-type huntingtin protects from apoptosis upstream of caspase-3.\" J Neurosci 20(10): 3705-13. Rigamonti, D., S. Sipione, et al. (2001). \"Huntingtin's neuroprotective activity occurs via inhibition of procaspase-9 processing.\" J Biol Chem 276(18): 14545-8. Rockabrand, E., N. Slepko, et al. (2007). \"The first 17 amino acids of Huntingtin modulate its sub-cellular localization, aggregation and effects on calcium homeostasis.\" Hum Mol Genet 16(1): 61-77. Rocks, O., A. Peyker, et al. (2005). \"An acylation cycle regulates localization and activity of palmitoylated Ras isoforms.\" Science 307(5716): 1746-52. Romorini, S., G. Piccoli, et al. (2004). \"A functional role of postsynaptic density-95- guanylate kinase-associated protein complex in regulating Shank assembly and stability to synapses.\" J Neurosci 24(42): 9391-404. Ropers, H. H. (2006). \"X-linked mental retardation: many genes for a complex disorder.\" Curr Opin Genet Dev 16(3): 260-9. Roth, A. F., Y. Feng, et al. (2002). \"The yeast DHHC cysteine-rich domain protein Akr1p is a palmitoyl transferase.\" J Cell Biol 159(1): 23-8. Roth, A. F., J. Wan, et al. (2006a). \"Global analysis of protein palmitoylation in yeast.\" Cell 125(5): 1003-13. Roth, A. F., J. Wan, et al. (2006b). \"Proteomic identification of palmitoylated proteins.\" Methods 40(2): 135-42. Rubinsztein, D. C., J. Leggo, et al. (1996). \"Phenotypic characterization of individuals with 30-40 CAG repeats in the Huntington disease (HD) gene reveals HD cases with 36 repeats and apparently normal elderly individuals with 36-39 repeats.\" Am J Hum Genet 59(1): 16-22. Saito, S., M. Ikeda, et al. (2005). \"No association was found between a functional SNP in ZDHHC8 and schizophrenia in a Japanese case-control population.\" Neurosci Lett 374(1): 21-4. Salaun, C., D. J. James, et al. (2004). \"Lipid rafts and the regulation of exocytosis.\" Traffic 5(4): 255-64.  70 Sandilands, E., V. G. Brunton, et al. (2007). \"The membrane targeting and spatial activation of Src, Yes and Fyn is influenced by palmitoylation and distinct RhoB\/RhoD endosome requirements.\" J Cell Sci 120(Pt 15): 2555-64. Saudou, F., S. Finkbeiner, et al. (1998). \"Huntingtin acts in the nucleus to induce apoptosis but death does not correlate with the formation of intranuclear inclusions.\" Cell 95(1): 55-66. Scherzinger, E., R. Lurz, et al. (1997). \"Huntingtin-encoded polyglutamine expansions form amyloid-like protein aggregates in vitro and in vivo.\" Cell 90(3): 549-58. Schilling, G., M. W. Becher, et al. (1999). \"Intranuclear inclusions and neuritic aggregates in transgenic mice expressing a mutant N-terminal fragment of huntingtin.\" Hum Mol Genet 8(3): 397-407. Schilling, G., H. A. Jinnah, et al. (2001). \"Distinct behavioral and neuropathological abnormalities in transgenic mouse models of HD and DRPLA.\" Neurobiol Dis 8(3): 405- 18. Schilling, G., A. H. Sharp, et al. (1995). \"Expression of the Huntington's disease (IT15) protein product in HD patients.\" Hum Mol Genet 4(8): 1365-71. Schneider, A., H. Lander, et al. (2005). \"Palmitoylation is a sorting determinant for transport to the myelin membrane.\" J Cell Sci 118(Pt 11): 2415-23. Schuman, E. M. (1999). \"Neurotrophin regulation of synaptic transmission.\" Curr Opin Neurobiol 9(1): 105-9. Sharp, A. H., S. J. Loev, et al. (1995). \"Widespread expression of Huntington's disease gene (IT15) protein product.\" Neuron 14(5): 1065-74. Shelbourne, P. F., N. Killeen, et al. (1999). \"A Huntington's disease CAG expansion at the murine Hdh locus is unstable and associated with behavioural abnormalities in mice.\" Hum Mol Genet 8(5): 763-74. Sheng, M. and M. J. Kim (2002). \"Postsynaptic signaling and plasticity mechanisms.\" Science 298(5594): 776-80. Shiwach, R. (1994). \"Psychopathology in Huntington's disease patients.\" Acta Psychiatr Scand 90(4): 241-6. Sidera, C., R. Parsons, et al. (2005). \"Post-translational processing of beta-secretase in Alzheimer's disease.\" Proteomics 5(6): 1533-43. Sieradzan, K. A., A. O. Mechan, et al. (1999). \"Huntington's disease intranuclear inclusions contain truncated, ubiquitinated huntingtin protein.\" Exp Neurol 156(1): 92-9. Singaraja, R. R., S. Hadano, et al. (2002). \"HIP14, a novel ankyrin domain-containing protein, links huntingtin to intracellular trafficking and endocytosis.\" Hum Mol Genet 11(23): 2815-28. Sipione, S., D. Rigamonti, et al. (2002). \"Early transcriptional profiles in huntingtin- inducible striatal cells by microarray analyses.\" Hum Mol Genet 11(17): 1953-65. Slow, E. J., R. K. Graham, et al. (2006). \"To be or not to be toxic: aggregations in Huntington and Alzheimer disease.\" Trends Genet 22(8): 408-11. Slow, E. J., R. K. Graham, et al. (2005). \"Absence of behavioral abnormalities and neurodegeneration in vivo despite widespread neuronal huntingtin inclusions.\" Proc Natl Acad Sci U S A 102(32): 11402-7. Slow, E. J., J. van Raamsdonk, et al. (2003). \"Selective striatal neuronal loss in a YAC128 mouse model of Huntington disease.\" Hum Mol Genet 12(13): 1555-67.  71 Smith, R., P. Brundin, et al. (2005). \"Synaptic dysfunction in Huntington's disease: a new perspective.\" Cell Mol Life Sci 62(17): 1901-12. Smotrys, J. E. and M. E. Linder (2004). \"Palmitoylation of intracellular signaling proteins: regulation and function.\" Annu Rev Biochem 73: 559-87. Soti, C. and P. Csermely (2003). \"Aging and molecular chaperones.\" Exp Gerontol 38(10): 1037-40. Spargo, E., I. P. Everall, et al. (1993). \"Neuronal loss in the hippocampus in Huntington's disease: a comparison with HIV infection.\" J Neurol Neurosurg Psychiatry 56(5): 487-91. Spektor, B. S., D. W. Miller, et al. (2002). \"Differential D1 and D2 receptor-mediated effects on immediate early gene induction in a transgenic mouse model of Huntington's disease.\" Brain Res Mol Brain Res 102(1-2): 118-28. Squitieri, F., S. E. Andrew, et al. (1994). \"DNA haplotype analysis of Huntington disease reveals clues to the origins and mechanisms of CAG expansion and reasons for geographic variations of prevalence.\" Hum Mol Genet 3(12): 2103-14. Steffan, J. S., N. Agrawal, et al. (2004). \"SUMO modification of Huntingtin and Huntington's disease pathology.\" Science 304(5667): 100-4. Steffan, J. S., A. Kazantsev, et al. (2000). \"The Huntington's disease protein interacts with p53 and CREB-binding protein and represses transcription.\" Proc Natl Acad Sci U S A 97(12): 6763-8. Stowers, R. S. and E. Y. Isacoff (2007). \"Drosophila huntingtin-interacting protein 14 is a presynaptic protein required for photoreceptor synaptic transmission and expression of the palmitoylated proteins synaptosome-associated protein 25 and cysteine string protein.\" J Neurosci 27(47): 12874-83. Sun, Y., A. Savanenin, et al. (2001). \"Polyglutamine-expanded huntingtin promotes sensitization of N-methyl-D-aspartate receptors via post-synaptic density 95.\" J Biol Chem 276(27): 24713-8. Suopanki, J., M. Lintunen, et al. (2002). \"Status epilepticus induces changes in the expression and localization of endogenous palmitoyl-protein thioesterase 1.\" Neurobiol Dis 10(3): 247-57. Swarthout, J. T., S. Lobo, et al. (2005). \"DHHC9 and GCP16 constitute a human protein fatty acyltransferase with specificity for H- and N-Ras.\" J Biol Chem 280(35): 31141-8. Takemoto-Kimura, S., N. Ageta-Ishihara, et al. (2007). \"Regulation of dendritogenesis via a lipid-raft-associated Ca2+\/calmodulin-dependent protein kinase CLICK- III\/CaMKIgamma.\" Neuron 54(5): 755-70. Tao, T. and A. M. Tartakoff (2001). \"Nuclear relocation of normal huntingtin.\" Traffic 2(6): 385-94. Telenius, H., H. P. Kremer, et al. (1993). \"Molecular analysis of juvenile Huntington disease: the major influence on (CAG)n repeat length is the sex of the affected parent.\" Hum Mol Genet 2(10): 1535-40. Torrecilla, I. and A. B. Tobin (2006). \"Co-ordinated covalent modification of G-protein coupled receptors.\" Curr Pharm Des 12(14): 1797-808. Trottier, Y., V. Biancalana, et al. (1994). \"Instability of CAG repeats in Huntington's disease: relation to parental transmission and age of onset.\" J Med Genet 31(5): 377-82. Trottier, Y., D. Devys, et al. (1995). \"Cellular localization of the Huntington's disease protein and discrimination of the normal and mutated form.\" Nat Genet 10(1): 104-10.  72 Trushina, E., R. B. Dyer, et al. (2004). \"Mutant huntingtin impairs axonal trafficking in mammalian neurons in vivo and in vitro.\" Mol Cell Biol 24(18): 8195-209. Tsutsumi, R., Y. Fukata, et al. (2008). \"Discovery of protein-palmitoylating enzymes.\" Pflugers Arch. Van Raamsdonk, J. M., Z. Murphy, et al. (2007a). \"Testicular degeneration in Huntington disease.\" Neurobiol Dis 26(3): 512-20. Van Raamsdonk, J. M., Z. Murphy, et al. (2005a). \"Selective degeneration and nuclear localization of mutant huntingtin in the YAC128 mouse model of Huntington disease.\" Hum Mol Genet 14(24): 3823-35. Van Raamsdonk, J. M., J. Pearson, et al. (2006). \"Wild-type huntingtin ameliorates striatal neuronal atrophy but does not prevent other abnormalities in the YAC128 mouse model of Huntington disease.\" BMC Neurosci 7: 80. Van Raamsdonk, J. M., J. Pearson, et al. (2005b). \"Loss of wild-type huntingtin influences motor dysfunction and survival in the YAC128 mouse model of Huntington disease.\" Hum Mol Genet 14(10): 1379-92. Van Raamsdonk, J. M., J. Pearson, et al. (2005c). \"Cognitive dysfunction precedes neuropathology and motor abnormalities in the YAC128 mouse model of Huntington's disease.\" J Neurosci 25(16): 4169-80. Van Raamsdonk, J. M., S. C. Warby, et al. (2007b). \"Selective degeneration in YAC mouse models of Huntington disease.\" Brain Res Bull 72(2-3): 124-31. Veit, M. (2000). \"Palmitoylation of the 25-kDa synaptosomal protein (SNAP-25) in vitro occurs in the absence of an enzyme, but is stimulated by binding to syntaxin.\" Biochem J 345 Pt 1: 145-51. Velier, J., M. Kim, et al. (1998). \"Wild-type and mutant huntingtins function in vesicle trafficking in the secretory and endocytic pathways.\" Exp Neurol 152(1): 34-40. Virmani, T., P. Gupta, et al. (2005). \"Progressively reduced synaptic vesicle pool size in cultured neurons derived from neuronal ceroid lipofuscinosis-1 knockout mice.\" Neurobiol Dis 20(2): 314-23. Vonsattel, J. P. and M. DiFiglia (1998). \"Huntington disease.\" J Neuropathol Exp Neurol 57(5): 369-84. Vonsattel, J. P., R. H. Myers, et al. (1985). \"Neuropathological classification of Huntington's disease.\" J Neuropathol Exp Neurol 44(6): 559-77. Walker, F. O. (2007). \"Huntington's disease.\" Lancet 369(9557): 218-28. Wan, J., A. F. Roth, et al. (2007). \"Palmitoylated proteins: purification and identification.\" Nat Protoc 2(7): 1573-84. Wanker, E. E. (2000). \"Protein aggregation and pathogenesis of Huntington's disease: mechanisms and correlations.\" Biol Chem 381(9-10): 937-42. Warby, S. C., E. Y. Chan, et al. (2005). \"Huntingtin phosphorylation on serine 421 is significantly reduced in the striatum and by polyglutamine expansion in vivo.\" Hum Mol Genet 14(11): 1569-77. Washbourne, P., V. Cansino, et al. (2001). \"Cysteine residues of SNAP-25 are required for SNARE disassembly and exocytosis, but not for membrane targeting.\" Biochem J 357(Pt 3): 625-34. Webb, Y., L. Hermida-Matsumoto, et al. (2000). \"Inhibition of protein palmitoylation, raft localization, and T cell signaling by 2-bromopalmitate and polyunsaturated fatty acids.\" J Biol Chem 275(1): 261-70.  73 Wellington, C. L., L. M. Ellerby, et al. (1998). \"Caspase cleavage of gene products associated with triplet expansion disorders generates truncated fragments containing the polyglutamine tract.\" J Biol Chem 273(15): 9158-67. Wexler, N. S., A. B. Young, et al. (1987). \"Homozygotes for Huntington's disease.\" Nature 326(6109): 194-7. Wheeler, V. C., J. K. White, et al. (2000). \"Long glutamine tracts cause nuclear localization of a novel form of huntingtin in medium spiny striatal neurons in HdhQ92 and HdhQ111 knock-in mice.\" Hum Mol Genet 9(4): 503-13. White, J. K., W. Auerbach, et al. (1997). \"Huntingtin is required for neurogenesis and is not impaired by the Huntington's disease CAG expansion.\" Nat Genet 17(4): 404-10. Yamamoto, A., J. J. Lucas, et al. (2000). \"Reversal of neuropathology and motor dysfunction in a conditional model of Huntington's disease.\" Cell 101(1): 57-66. Yamamoto, Y., Y. Chochi, et al. (2007). \"Gain of 5p15.33 is associated with progression of bladder cancer.\" Oncology 72(1-2): 132-8. Yanai, A., K. Huang, et al. (2006). \"Palmitoylation of huntingtin by HIP14 is essential for its trafficking and function.\" Nat Neurosci 9(6): 824-31. Yeh, D. C., J. A. Duncan, et al. (1999). \"Depalmitoylation of endothelial nitric-oxide synthase by acyl-protein thioesterase 1 is potentiated by Ca(2+)-calmodulin.\" J Biol Chem 274(46): 33148-54. Young, A. B., I. Shoulson, et al. (1986). \"Huntington's disease in Venezuela: neurologic features and functional decline.\" Neurology 36(2): 244-9. Young, J. C., V. R. Agashe, et al. (2004). \"Pathways of chaperone-mediated protein folding in the cytosol.\" Nat Rev Mol Cell Biol 5(10): 781-91. Yu, Z. X., S. H. Li, et al. (2003). \"Mutant huntingtin causes context-dependent neurodegeneration in mice with Huntington's disease.\" J Neurosci 23(6): 2193-202. Yuste, R. and T. Bonhoeffer (2004). \"Genesis of dendritic spines: insights from ultrastructural and imaging studies.\" Nat Rev Neurosci 5(1): 24-34. Zeitlin, S., J. P. Liu, et al. (1995). \"Increased apoptosis and early embryonic lethality in mice nullizygous for the Huntington's disease gene homologue.\" Nat Genet 11(2): 155-63. Zhai, L., D. Chaturvedi, et al. (2004). \"Drosophila wnt-1 undergoes a hydrophobic modification and is targeted to lipid rafts, a process that requires porcupine.\" J Biol Chem 279(32): 33220-7. Zhang, Y., M. Li, et al. (2003). \"Depletion of wild-type huntingtin in mouse models of neurologic diseases.\" J Neurochem 87(1): 101-6. Zhang, Z., Y. C. Lee, et al. (2006). \"Palmitoyl-protein thioesterase-1 deficiency mediates the activation of the unfolded protein response and neuronal apoptosis in INCL.\" Hum Mol Genet 15(2): 337-46. Zuccato, C., A. Ciammola, et al. (2001). \"Loss of huntingtin-mediated BDNF gene transcription in Huntington's disease.\" Science 293(5529): 493-8. Zuccato, C., M. Tartari, et al. (2003). \"Huntingtin interacts with REST\/NRSF to modulate the transcription of NRSE-controlled neuronal genes.\" Nat Genet 35(1): 76-83. Zucker, B., R. Luthi-Carter, et al. (2005). \"Transcriptional dysregulation in striatal projection- and interneurons in a mouse model of Huntington's disease: neuronal selectivity and potential neuroprotective role of HAP1.\" Hum Mol Genet 14(2): 179-89.    74 2. CHAPTER 2         Huntingtin Interacting Protein HIP14 Is A Palmitoyl Transferase Involved in Palmitoylation and Trafficking of Multiple Neuronal Proteins   A version of this chapter has been published. Huang, K., Yanai, A., Kang, R., Arstikaitis, P., Singaraja, R.R., Metzler, M., Mullard, A., Haigh, B., Gauthier-Campbell, C., Gutekunst, C.A., Hayden, M.R. and El-Husseini, A. (2004) Huntingtin-interacting protein HIP14 is a palmitoyl transferase involved in palmitoylation and trafficking of multiple neuronal proteins. Neuron. Dec 16;44(6):977- 86.     75 2.1. INTRODUCTION  Trafficking of proteins to specialized subcellular and plasma membrane domains is vital for normal cell development and function (Lee and Sheng 2000; da Silva and Dotti 2002). Modification by the lipid palmitate, a 16-carbon fatty acid chain, influences sorting and function of several proteins (El-Husseini Ael et al. 2002; Linder and Deschenes 2004; Smotrys and Linder 2004). In particular, palmitoylation has recently emerged as a critical modification in neurons where it controls axon pathfinding, filopodia formation, polarized protein targeting and clustering of scaffolding and signaling proteins (Strittmatter et al. 1995; Ueno 2000; El-Husseini Ael et al. 2001; El- Husseini Ael et al. 2002; Gauthier-Campbell et al. 2004). Postsynaptic targeting and clustering of the postsynaptic density (PSD) protein PSD-95 requires palmitoylation and this process regulates glutamate receptor retention at the synapse (Craven et al. 1999; El-Husseini Ael et al. 2002). Palmitoylation also regulates SNAP25-mediated SNARE complex disassembly, presynaptic targeting of the GABA synthesizing enzyme GAD-65, multimerization and presynaptic trafficking of the calcium sensor synaptotagmin I (Chapman et al. 1996; Fukuda et al. 2001; Washbourne et al. 2001; Kanaani et al. 2002; Kang et al. 2004; Rathenberg et al. 2004). In addition, palmitoylation of secreted proteins regulates neuronal differentiation (Chamoun et al. 2001; Linder and Deschenes 2004). Remarkably, physiological stimuli and neuronal activity dynamically alter protein palmitoylation levels, and this provides an important mechanism for the regulation of neuronal cell development and activity (Resh 1999; El- Husseini Ael et al. 2002; Smotrys and Linder 2004).  76 While the importance of palmitoylation in protein trafficking is well documented, the palmitoyl transferases involved in this process remain unknown (Smotrys and Linder 2004). The diversity of sequences modified by palmitate hindered the identification of these enzymes using classical protein purification approaches. A significant advance in the field came from genetic analysis in yeast which revealed a family of PATs that contains a DHHC domain, a cysteine rich region that harbors a conserved tetra-peptide motif. These include Erf2p\/Erf4p protein complex, which palmitoylate H-Ras proteins, and Akr1p which is involved in the palmitoylation of the yeast casein kinase Yck2p (Roth et al. 2002; Linder and Deschenes 2004). However, it remained unknown whether related proteins serve a similar function in mammalian cells. Here, we use biochemical assays to show that huntingtin interacting protein, HIP14, is a neuronal palmitoyl transferase involved in palmitoylation of specific substrates. We also show that HIP14 modulates palmitoylation-dependent vesicular trafficking and clustering of a subset of synaptic proteins. 2.2. MATERIALS AND METHODS 2.2.1 Constructs, cDNA Cloning and Mutagenesis Full length HIP14 was subcloned into pCI-neo as described earlier (Singaraja et al. 2002). HIP14 GFP was generated by inserting EGFP (Clontech, CA) at the C-terminus, and HIP14-Flag was generated by PCR using a reverse primer containing FLAG sequence. HIP14\u2206DHHC was generated by deletion of nucleotides encoding amino acids 440 to 487. Construction of GFP fusion proteins of wild type and mutant forms of synaptotagmin I, SNAP25, GAD-65, and PSD-95 were generated by PCR and subcloned  77 into the Hind III and EcoR I sites in frame with GFP in pEGFP-N3 (Clontech). Wild type and palmitoylation mutant GST-SNAP25 fusion proteins were PCR amplified and subcloned into EcoR I\/Sal I of pGEX-6P3 (Amersham Biosciences, UK). Synaptotagmin I GST fusion constructs were subcloned into BamH I\/Sal I of pGEX-6P3. HIP14-GST was generated by insertion of full length HIP14 cDNA in frame with GST into pGEX- 6P3 at Xma I site. For production of 6\u00d7His-huntingtin, sequences corresponding to amino acids 1-548 of huntingtin were subcloned into EcoR I and Hind III sites of pTrcB (Gibco- Invitrogen, Calsbad, CA). For the generation of GST fusion proteins of other acylated proteins, nucleotide sequences corresponding to the acylated motifs of paralemmin (amino acids 364-383), lck (amino acids 1-20aa), synaptotagmin VII (amino acids 25-44) and H-Ras (amino acids 169-188) were subcloned into BamH I and Xho I sites of pGEX- 4T1 (Amersham). PSD95 (1-PDZ3) in pGEX-2T was a gift from Dr. David Bredt (University of California at San Francisco, CA). All constructs were verified by DNA sequencing. 2.2.2 Cell Culture, Transfection and Time Lapse Imaging COS cells, hippocampal and cortical neurons from embroynic day 18 rat brains were cultured as described earlier (Craven et al. 1999; El-Husseini et al. 2000a). Neuronal cultures were maintained in neurobasal media (Gibco-Invitrogen) supplemented with B27, penicillin, streptomycin, and L-glutamine. For transient expression, both COS cells and 4 days in vitro (DIV) neurons were transfected with Lipofectamine 2000 (Gibco-Invitrogen) according to manufacturer\u2019s protocol and stained 8-14 h later. For time-lapse Imaging, COS cells were transfected and images were collected 10 h post- transfection using a 63x oil objective affixed to a Zeiss inverted light microscope and  78 Axiovision software. While images were acquired, cells were kept in a 37\u00baC chamber, supplemented with 5% carbon dioxide. Images were collected every 3 seconds for a total time of 3 minutes. 2.2.3 Immunofluorescence Cells were washed in phosphate-buffered saline (PBS) (20 mM NaH2PO4, 0.9% NaCl, pH7.4), fixed in 4% paraformaldehyde in PBS, and permeabilized in 0.3% Triton X-100, 1% paraformaldehyde.  For immunofluorescence, primary antibodies were incubated in 2% NGS in PBS for 1 h at room temperature. Cells were washed in PBS between each incubation followed by incubation with appropriate secondary antibodies conjugated to Alexa 488 and Alexa 568. Primary antibodies used include mouse monoclonal antibodies recognizing \u03b1-adaptin, Rab5 and Rab8 (Transduction Laboratories), GM-130 (BD Biosciences, Palo Alto, CA), GST and actin (Santa Cruz Biotechnology, Inc. CA), PSD-95 (Affinity Bioreagents. Inc., CO), huntingtin antibody 2166 (Chemicon, CA), and goat polyclonal antibodies against Rab7 (Santa Cruz). Rabbit polyclonal antibodies against GFP (Clontech Laboratories Inc., CA) were also used. Rabbit polyclonal antibodies against HIP14 have been described previously (Singaraja et al. 2002). Guinea pig antibody against SAP102 was a gift from Dr. David Bredt (University of California at San Francisco, CA). 2.2.4 Electron microscopy Electron microscopy on HIP14 in the brain was performed as previously described (Singaraja et al. 2002). Ultra-small colloidal gold conjugated  secondary antibody (Aurion, Wageningen, The Netherlands) was  used. Following a post-fixation with 2.5% glutaraldehyde, gold  particles were intensified using the R-gent SE-EM silver  79 enhancement  kit (Aurion). Sections were further fixed with 0.5% OsO4 in  0.1 M PB, dehydrated in ethanol and propylene oxide (1:1)  and flat-embedded in Eponate 12 (Ted Pella, Redding, CA). Ultrathin  sections (90 nm) were cut using a Leica Ultracut S ultramicrotome,  and counterstained with 5% aqueous uranyl acetate for 5 min  followed by lead citrate for 5 min. Thin sections were  examined using a HITACHI H-7500 electron microscope. 2.2.5 Cell Radiolabeling and Immunoprecipitation COS cells were labeled with 1 mCi\/ml [ 3 H]palmitate (57 Ci\/mmol; Perkin Elmer Life Sciences, Inc.) for 3 h while expressing the transfected proteins. Labeled cells were washed with ice-cold PBS and re-suspended in 0.1 ml of lysis buffer containing TEE (50 mM Tris-HCl [pH 7.4], 1 mM EDTA, 1 mM EGTA), 150 mM NaCl, and 1% SDS. Triton X-100 was added to 1% to neutralize the SDS in a final volume of 0.5 ml. Insoluble material was removed by centrifugation at 14,000 rpm for 10 min at 4 0 C.  For immunoprecipitation, samples were incubated with SNAP25 monoclonal antibodies for 1 h at 4 0 C. After addition of 20 \u00b5l protein G sepharose beads (Pharmacia), samples were incubated for 1 h at 4 0 C. Immunoprecipitates were washed three times with buffer containing TEE, 150 mM NaCl, and 1% Triton X-100, boiled in SDS-PAGE sample buffer with 1 mM DTT for 2 min, and separated by SDS-PAGE and dried under vacuum. Gels were exposed to Hyper Film (Amersham) with intensifying screens at -80 0 C for 3 to 20 days. 2.2.6 Expression and Purification of Fusion Proteins GST fusion proteins were produced in E. coli using the pGEX 6p3 expression system (Amersham) and isolated using Glutathione Sepharose TM  4B (Amersham) from  80 clarified cell lysates. The substrates were dialyzed and then eluted with 20mM Glutathione. GST-HIP14 was purified in the presence of bovine liver lipids with no detergent to maintain proper protein folding. To generate a free N-terminus of PSD-95, GST-PSD-95 protein was cleaved using thrombin (50mM Tris-HCl pH 8.0, 150mM NaCl, 2.5mM CaCl2, 0.1% 2-mercapto-ethanol). His-tagged huntingtin protein was purified from DH5\u03b1 with Ni-NTA magnetic agarose beads (Qiagen). 2.2.7 Immunoprecipitation of HIP14 GFP Transfected COS cells were sonicated for 15 seconds in TEEN buffer (50 mM Tris- HCl [pH 7.4], 1 mM EDTA, 1 mM EGTA, 150 mM NaCl) and insoluble material was removed by centrifugation at 14000rpm for 10 min at 4 0 C. Supernatants were incubated with anti-GFP antibody (10\u00b5l) for 1 hr at 4 0 C. 50 \u00b5l Protein A Sepharose 4 Fast Flow beads (Amersham) were added and samples were incubated for 1 h at 4 0 C. Immunoprecipitates were washed 2X with buffer containing TEEN, 150 mM NaCl and then subjected to in vitro palmitoylation assays described below. 2.2.8 Synthesis of Palmitoyl CoA [ 3 H]palmitoyl-CoA, [ 3 H]myristoyl-CoA and palmitoyl-CoA were synthesized enzymatically from [9,10- 3 H(N)]palmitic acid (5 mCi\/ml; Perkin Elmer Life Sciences), [9,10- 3 H(N)]myristic acid (1mCi\/ml; Perkin Elmer Life Sciences) and palmitic acid (Sigma-Aldrich), respectively. Synthesis components also included co-enzyme A (CoA), ATP and acyl-CoA synthase (Sigma-Aldrich). Synthesized products were purified as previously described (Dunphy et al. 1996). Synthesized [ 3 H]palmitoyl-CoA and [ 3 H]myristoyl-CoA were subjected to TLC (TLC aluminium sheet, silica gel, EM Science, Germany) to determine the efficiency. Ninhydrin Staining was used for the detection of  81 synthesized non-radiolabeled palmitoyl-CoA. The synthesis was highly efficient, with >95% conversion of acid to fatty acid-CoA. Specific activity for [ 3 H]palmitoyl-CoA was 60 Ci\/mmol and for [ 3 H]myristoyl-CoA was 30Ci\/mmol. 2.2.9 Palmitoylation Assay Palmitoylation reaction (60 \u00b5l) contained 5 \u00b5Ci of [ 3 H]palmitoyl-CoA, 0.33 \u00b5g\/\u00b5l substrate protein, 1 mM ATP, 50 mM MES, pH 6.4, 0.2 mg\/ml bovine liver lipids, and either 20\u00b5l of COS cell lysates expressing HIP14, immunoprecipitated HIP14 GFP, or 0.5\u00b5g of purified HIP14-GST as described in results. After 15min incubation at 37\u00b0C, sample buffer was added with final concentration of 5mM DTT was added and samples were subjected to SDS-PAGE analysis. 2.2.10 HIP14 siRNA HIP14 siRNA primers were annealed and inserted into the HindIII\/BglII sites of pSUPER vector (Oligo Engine). Primers used to generate HIP14 siRNA: complementary oligonucleotides: 5'- GATCCCCGGAGATACAAGCACTTTAATTCAAGAGATTAAAGTGCTTGTATCTC CTTTTTGGAAA-3', and 5'- AGCTTTTCCAAAAAGGAGATACAAGCACTTTAATCTCTTGAATTAAAGTGCTT GTATCTCCGGG-3' (corresponding to nucleotides 2039\u20132057 of rat HIP14 mRNA). Primers used to generate scrambled siRNA (control siRNA): 5\u2019- GATCCCCGATAAGAACAGCGGCTATATTCAAGAGATATAGCCGCTGTTCTTA TCTTTTTA-3\u2019 and 5\u2019- AGCTTAAAAAGATAAGAACAGCGGCTATATCTCTTGAATATAGCCGCTGTTC TTATCGGGGATCGGG -3\u2019.  The specificity HIP14 siRNA was tested both against  82 exogenously expressed HIP14 in COS cells and endogenous HIP14 in cultured hippocampal and cortical neurons. 2.2.11   Imaging and Analysis Images were acquired on a Zeiss Axiovert M200 motorized microscope by using a monochrome 14-bit Zeiss Axiocam HR charge-coupled device camera at 1,300\u00d71,030 pixels. Exposure times were individually adjusted to yield an optimum immunofluorescent brightness without saturation. Images were analyzed in Northern Eclipse (Empix Imaging, Missasauga, Canada). Briefly, images were processed at a constant threshold level (of 32,000 pixel values) to create a binary image, which was multiplied with the original image by using Boolean image arithmetics. An observer blinded to the identity of proteins examined performed analysis in protein clustering upon expression of siRNA. For analysis of protein clustering, dendrites of the cell of interest were outlined using a combination of the GFP fluorescence signal and differential interference contrast bright-field images. Puncta were defined as sites of intensities at least twice the dendritic background. The number of dendritic puncta per unit dendritic length was measured. The two-tailed two sample unequal variance Student T test was used to compare the average number of puncta per unit length between experimental groups. For analysis of clustering of GAD-65 GFP, the intensity of axonal clusters was determined.  This was done by tracing 3-4 representative sections of axons.  For each cell, the average intensity of axonal puncta versus axonal background was used to calculate the degree of clustering of GAD-65. Results were analyzed by a student t test using a two-tailed distribution and two-sample unequal variance.   83 2.3. RESULTS 2.3.1 HIP14 is a neuronal palmitoyl transferase HIP14, a mammalian ortholog of Akr1p, was previously identified as a huntingtin interacting protein involved in regulating protein trafficking (Singaraja et al. 2002). This protein is predominantly expressed in neurons in the brain and localizes to Golgi membranes and cytoplasmic vesicles (Singaraja et al. 2002). Structurally, HIP14 contains 5 predicted transmembrane domains and a DHHC domain similar to that seen in yeast PATs (Figure 2.1A). These observations prompted us to test whether HIP14 is involved in the palmitoylation of several neuronal proteins. First we co-expressed HIP14 with SNAP25, a well characterized palmitoylated neuronal protein(Hess et al. 1992; Gonzalo and Linder 1998), followed by metabolic labeling with [ 3 H]palmitate. These experiments demonstrated that SNAP25 palmitoylation was potentiated in the presence of HIP14, suggesting that SNAP25 may serve as a substrate for this putative enzyme (Figure 2.1B). Next, several in vitro assays were performed to determine if the enzymatic reaction was directly mediated by HIP14. Purified GST-SNAP25 was incubated with extracts obtained from COS cells transfected with wild type HIP14 in the presence of [ 3 H]palmitoyl-CoA and this induced palmitoylation of SNAP25 (Figure 2.1C). In contrast, lysates containing HIP14 failed to palmitoylate a mutant form of SNAP25 lacking the cysteines normally modified by palmitate. Consistent with the postulated role for the DHHC domain in PAT activity, we also found that a mutant form of HIP14 lacking this domain failed to catalyze palmitoylation of SNAP25. To further characterize the role of HIP14, GST-SNAP25 was incubated with  84 HIP14 GFP immunoprecipitates (IP) obtained from transfected cells to determine whether HIP14 is sufficient for SNAP25 palmitoylation. In vitro labeling assays showed that SNAP25 palmitoylation occurs only in the presence of wild type but not a mutant form of HIP14 lacking the DHHC domain. (Figure 2.1D and E). To determine whether purified HIP14 is sufficient to induce protein palmitoylation, a HIP14-GST fusion protein was generated in bacteria and then purified using glutathione beads. The eluted protein was used in an in vitro assay in the presence or absence of [ 3 H]palmitoyl-CoA (Figure 2.1F-H). Indeed, purified HIP14-GST was sufficient to palmitoylate GST-SNAP25 in the presence of [ 3 H]palmitoyl-CoA but not [ 3 H]palmitate, and this reaction was competed by addition of excess non-radiolabeled palmitoyl-CoA (Figure 2.1H). To further characterize the specificity of this enzyme in this reaction, we next evaluated whether purified HIP14- GST may mediates the transfer of other lipids such as myristate. However, in the presence of [ 3 H]myristoyl-CoA, HIP14 failed to modify GST-SNAP25 with myristate (Figure 2.1H). These findings establish that HIP14 utilizes palmitoyl-CoA to specifically modify SNAP25 with palmitate on cysteine residues normally modified by this lipid in vivo.  85   Figure 2.1. HIP14 is a Neuronal Palmitoyl Transferase. (A) Schematic illustration of HIP14 primary structure. HIP14 lacking the DHHC domain (HIP14\u2206DHHC) was generated by deletion of amino acids 440-487 containing the cysteine rich zinc finger domain. (B) Enhancement of SNAP25 palmitoylation in vivo by HIP14. COS cells were transfected either with SNAP25 alone or with HIP14. 8 h post-transfection, cells were metabolically labeled with [ 3 H]palmitate, and SNAP25 was immunoprecipitated and analyzed by  86 western blotting (WB) and autoradiography ([ 3 H]palm). SNAP25 palmitoylation levels were enhanced in cells co-expressing HIP14. (C) Extracts of COS cells transfected with HIP14 induce palmitoylation of purified GST-SNAP25 in the presence of [ 3 H]palmitoyl-CoA. (D,E) COS cells were transfected with GFP fusion of either wild type HIP14 (HIP14 GFP) or the mutant form lacking the DHHC domain (HIP14\u2206DHHC GFP). GFP fusion proteins were then immunoprecipitated (IP) using GFP antibodies. HIP14 GFP (IP) induced palmitoylation of wild type (GST-SNAP25) but not the palmitoylation mutant form of SNAP25 (GST-SNAP25 Palm mut) or GST-GFP. In contrast, HIP14\u2206DHHC failed to palmitoylate GST-SNAP25. (F,G) Purified HIP14-GST is sufficient to induce palmitoylation of GST-SNAP25. HIP14-GST produced in bacteria was purified and samples were subjected to western blotting and silver staining. No palmitoylated products were detected when GST-SNAP25 Palm mut or GST-GFP were incubated with HIP14-GST. (H) Acylation mediated by HIP14 requires palmitoyl-CoA. HIP14 requires [ 3 H]palmitoyl-CoA but not [ 3 H]palmitate for SNAP25 palmitoylation. This reaction was competed with excess cold palmitoyl-CoA. HIP14 did not induce transfer of the lipid myristate from [ 3 H]myristoyl-CoA.  2.3.2 Multiple Neuronal Proteins Serve as Substrates for HIP14 Previous work established that the postsynaptic density protein, PSD-95, is palmitoylated at two N-terminal cysteines present at positions 3 and 5 and that this lipid modification is required for trafficking of PSD-95 to the synapse (Craven et al. 1999; El- Husseini et al. 2000a). To test whether HIP14 may also palmitoylate PSD-95, we first generated a GST fusion protein of PSD-95 containing the N-terminal amino acids 1-385, which contains the palmitoylation motif and PDZ domains 1-3 (PSD-95 (1-PDZ3)). Because PSD-95 palmitoylation requires a free N-terminus, GST was cleaved and a purified PSD-95 (1-PDZ3) was obtained. Both extracts from COS cells transfected with HIP14 as well as purified HIP14-GST induced PSD-95 palmitoylation in vitro (Figure 2.2A andFigure 2.3). To further analyze the role of HIP14 in the acylation of other neuronal proteins, we preformed in vitro assays on GST fusion proteins of synaptotagmin I, and acylated sequences of GAD-65, H-Ras, lck, paralemmin and synaptotagmin VII. This analysis showed that HIP14-GST can also palmitoylate GST-synaptotagmin I, a presynaptic  87 vesicle protein palmitoylated on 5 cysteine residues (Cys-74, Cys-75, Cys-77, Cys-79, and Cys-82) present in the junction between the transmembrane and cytoplasmic region of synaptotagmin I (Heindel et al. 2003) (Figure 2.2B). HIP14 also modified sequences of GAD-65 containing the N-terminal palmitoylation motif (Figure 2.3C). However, HIP14 did not palmitoylate the C-terminal motif of the dually palmitoylated and prenylated neuronal protein paralemmin (Kutzleb et al. 1998) (Figure 2.2A). Moreover, HIP14 did not induce palmitoylation of acylated sequences of H-Ras, lck and synaptotagmin VII (Figure 2.3C). These results indicate that HIP14 is involved in the palmitoylation of a specific subset of neuronal proteins. The association of N-terminal sequences of huntingtin (amino acids 1-548) with HIP14 suggested that huntingtin is also a substrate for HIP14. Metabolic labeling analysis showed that the N-terminal region of huntingtin is subject to palmitoylation (Figure 2.2C). Using a similar in vitro assay to the one described for SNAP25, we also find that extracts of COS cells expressing HIP14 induced the palmitoylation of purified His-tagged huntingtin (Figure 2.2D). These results demonstrate that huntingtin is another substrate subject to palmitoylation by HIP14.  88  Figure 2.2. HIP14 Palmitoylates Multiple Substrates. (A) HIP14-GST induces palmitoylation of purified PSD-95 (1-PDZ3) and GST-SNAP25, but not the dually acylated motif of paralemmin (GST-para CT). HIP14-GST purification efficiency is low. Since only 1\/10 of the reaction is loaded for western blot, the amount of HIP14-GST is very little compared to GST-substrate concentration. Therefore, HIP14-GST band could only be visualized with long exposure. (B) Palmitoylation of GST fusion protein of synaptotagmin I (GST-synaptotagmin I) by purified HIP14-GST. (C) Huntingtin is palmitoylated. COS cells transfected with the N-terminal fragment of huntingtin containing amino acids 1-548 (huntingtin (1-548aa)) were metabolically labeled with [ 3 H]palmitate and palmitoylation of immunoprecipitated Huntingtin (1-548aa) was analyzed by western blotting (WB) and autoradiography ([ 3 H]palm). (D) Huntingtin is a substrate for HIP14. Purified His-Huntingtin (1- 548aa) was palmitoylated in the presence of COS cell extracts expressing HIP14.    89  Figure 2.3. HIP14 palmitoylates specific neuronal proteins. (A) Palmitoylation of purified PSD-95 (1-PDZ3) was enhanced in the presence of COS cell extracts expressing wild type HIP14 but not with extracts obtained from either mock transfected cells or cells expressing a mutant form of HIP14 lacking the DHHC domain (HIP14\u2206DHHC). Number of repeats n=2. (B) Immunoprecipitated (IP) HIP14 GFP induces palmitoylation of purified PSD-95 (1-PDZ3). Number of repeats n=2. (C) HIP14 palmitoylates SNAP25 and N- terminal sequences of GAD-65 but not the acylated motifs of H-Ras, lck and synaptotagmin VII. GST fusion proteins containing the acylated motifs of GAD-65, H-Ras, lck, synaptotagmin VII or full length SNAP25 were incubated with purified HIP14 GST and with [ 3 H]palmitoyl-CoA. Products were analyzed by western blotting (WB) and autoradiography ([ 3 H]palm). Number of repeats n=1.     90 In addition to modifying several substrates with palmitate, metabolic labeling studies showed that HIP14 itself is palmitoylated and that this process relies on the presence of its DHHC domain (Figure 2.4A). These findings indicate that akin to Akr1p, acylation of the DHHC domain within HIP14 may also be required for the enzyme activity. Interestingly, deletion of the DHHC domain disrupted accumulation of HIP14 in the Golgi and resulted in a diffuse localization of this protein in the soma and dendrites (Figure 2.4B). Thus, the DHHC domain also appears to contribute to proper folding and\/or trafficking of HIP14.  Figure 2.4. HIP14 Palmitoylation and Golgi Localization Requires the DHHC Domain. (A) HIP14 is palmitoylated in vivo. COS cells transfected with either wild type HIP14 or a mutant form lacking the DHHC domain (HIP14\u2206DHHC). Cells were metabolically labeled with [ 3 H]palmitate and palmitoylation of immunoprecipitated proteins was analyzed by western blotting (WB) and autoradiography ([ 3 H]palm). (B) Hippocampal neurons were transfected with GFP tagged wild type HIP14 or HIP14\u2206DHHC. Distribution of HIP14\u2206DHHC in neurons is altered.   91 2.3.3 HIP14 associates with multiple vesicular compartments. Previous studies showed that endogenous HIP14 is localized to Golgi and in vesicles located in the cytoplasm (Singaraja et al. 2002). Double labeling analysis performed in NT2 cells showed that HIP14 is partially co-localized with the recycling and late endosomal markers Rab7 and Rab8. In contrast, HIP14 positive puncta did not significantly overlap with the early endosomal marker Rab5 or the adaptor protein AP2 (Figure 2.5). Electron microscopic (EM) analysis revealed that HIP14 is associated with the cytosolic side of diverse vesicular structures present in the soma and dendrites (Figure 2.6A-G). In addition, immunogold particles were observed in dendritic spines and at the plasma membrane (Figure 2.6). Taken together, these results indicate that HIP14 associates with several vesicular structures including the Golgi as well as sorting\/recycling and late endosomal structures.  92  Figure 2.5. Localization of HIP14 With Endosomal Markers in NT2 Cells. NT2 cells were double labeled with antibodies against HIP14 and either with Rab5, Rab7, Rab8 or AP2.  Results show partial co-localization of HIP14 with Rab7 and Rab8.  space bar= 10\u00b5m.   In cultured hippocampal neurons, HIP14 showed prominent staining in a perinuclear compartment that significantly co-localizes with the Golgi marker GM-130  93 (Figure 2.6H). Similar distribution was also observed in COS cells transfected with HIP14 GFP (Figure 2.6I). Time lapse imaging of COS cells transfected with HIP14 GFP, showed that HIP14 traffics in tubulovesicular structures budding from the perinuclear compartment (Figure 2.6J). Moreover, vesicular structures containing SNAP25 GFP and HIP14 DsRed were seen undergoing rapid transport in the cytoplasm (Figure 2.6K). These results indicate that HIP14 is involved in the cytosolic modification of both cytoplasmic and integral membrane proteins. Moreover, HIP14 in all likelihood modifies substrates at several subcellular locations.  94  Figure 2.6. Association of HIP14 with Golgi and Cytoplasmic Vesicles. (A-G) Electron micrographs showing the subcellular localization of HIP14. (A) Micrograph showing a portion of neuronal perikarya. HIP14 immunogold particles are mostly decorating the cytoplasmic side of the Golgi stacks. (B) Micrograph showing HIP14 immunogold particles in a large caliber dendrite receiving synaptic contacts (arrowheads). Immunogold particles are either free in the cytoplasm, or associated with tubulo-vesicular elements (arrows). (C) Micrograh showing HIP14 immuogold particles associated with a coated vesicle (arrow) near the Golgi apparatus. A non-labeled vesicle is also visible (arrowhead). (D) Micrograph of HIP14 immunogold particles associated with the cytoplasmic side of tubulovesicular elements (arrows) near the plasma membrane in the perikarya of a neuron. (E) HIP14 immunogold particles (arrows)  95 associated with the plasma membrane (outlined by the arrowheads). (F) Micrograph showing HIP14 immunogold particles in the neck of a dendritic spine (s) receiving a synaptic contact (arrowhead) from an axon terminal (star). (G) HIP14 immunogold in an axon (a) surrounded by myelin (arrowhead). (H) HIP14 is mainly localized to the Golgi and cytoplasmic vesicles in hippocampal neurons. Hippocampal neurons (DIV 8) were stained for HIP14 and the Golgi marker GM-130. HIP14 accumulates in a perinuclear region positive for GM-130 and in small puncta throughout the cytoplasm. (I) Co-localization of HIP14 GFP and GM-130 in COS cells. (J) Tubulovesicular-like structures (arrowheads) containing HIP14 GFP budding from the perinuclear region in COS cells. Inverse color time lapse images are shown. (K) HIP14 DsRed and SNAP25 GFP co-localize in the perinuclear region and cytoplasmic vesicles. Time lapse images show trafficking of both HIP14 DsRed and SNAP25 GFP in vesicle-like structures (arrowheads) present in the cytoplasm. Inverse color time lapse images are shown. Abbreviations: a: axon; g: Golgi apparatus; m: mitochondria, n: nucleus; s: dendritic spine. Scale bars: A = 500 nm; B = 833 nm; C and D = 250 nm; E = 150 nm; F = 200 nm; G =500 nm; H and I = 10 \u00b5m, Magnified panels in J and K = 1 \u00b5m.  2.3.4 Palmitoylation Dependent Trafficking is Regulated by HIP14 Palmitoylation is essential for vesicular trafficking of several proteins including PSD-95, GAP-43 and SNAP25 and usually results in the accumulation of these proteins in a compartment located in a perinuclear region (El-Husseini et al. 2000a). Hence, we used this approach to assess the effects of HIP14 on the trafficking of these putative substrates in both heterologous cells and neurons. This analysis revealed that exogenous HIP14 enhanced perinuclear accumulation of PSD-95 and SNAP25 (Figure 2.7 and Table 2.1 and Figure 2.8). Enhanced perinuclear accumulation was also observed for some of the other proteins examined including GAP-43, GAD-65 and synaptotagmin I. In contrast, HIP14 did not alter the distribution of paralemmin and synaptotagmin VII or the palmitoylation-deficient forms of SNAP-25 and PSD-95(Table 2.1). Consistent with these findings, metabolic labeling studies in heterologous cells showed that expression of HIP14 enhanced palmitoylation of synaptotagmin I, GAP-43 and SNAP25 by 30-50%. However, no change in the palmitoylation of synaptotagmin VII was observed (data not  96 shown). The strong correlation between altered protein trafficking in vivo and protein acylation in both heterologous cells and in vitro assays indicate an important role for HIP14 in the acylation of several proteins in neurons.  Figure 2.7. HIP14 Modulates Trafficking of Palmitoylated Proteins in Neurons. (A,B) GFP fusion proteins of SNAP25, GAD-65, synaptotagmin I (Syt 1), GAP-43, paralemmin and HA-tagged synaptotagmin VII (Syt 7 HA) were transfected into cultured neurons (DIV 4) alone (left panels) or with a FLAG-tagged HIP14 (HIP14-FLAG; right panels). Overexpression  97 of HIP14 enhances perinuclear accumulation of SNAP25 GFP, GAD-65 GFP, Syt 1 GFP, and GAP-43 GFP. In contrast, HIP14 did not alter the distribution of paralemmin GFP and Syt 7 HA. Scale bars = 10 \u00b5m.  Table 2.1. Summary of Changes in the Localization of Palmitoylated Proteins in the Presence of HIP14 in Both COS Cells and Neurons. (A) HIP14 induces redistribution of a subset of palmitoylated proteins. The effects on palmitoylated proteins require the presence of cysteines modified by palmitate. (B) Sequences of the palmitoylated motifs of proteins analyzed.  A. Altered localization of palmitoylated proteins in the presence of HIP14 in COS cells and neurons  COS cells Neurons  Enhanced perinuclear accumulation Co-localization with HIP14 Enhanced perinuclear accumulation Co-localization with HIP14 PSD-95-GFP +++ C +++ C PSD-95-C3,5S- GFP - N - N SNAP25-GFP +++ C +++ C SNAP25-Palm mut GFP - N - N GAP-43-GFP +++ C +++ P Synaptotagmin I-GFP ++ C +++ C GAD-65-GFP ++ C +++ C Synaptotagmin VII-HA - N - N Paralemmin- GFP - P - P PSD95-prenyl- GFP - P - P  C: co-localized; N: not co-localized; P: partially co-localized  B. Sequences of palmitoylated motifs analyzed Protein Palmitoylation motif Location SNAP25 LGKFCGLCVCPCNKLKSSDA Internal PSD-95 MDCLCIVTTKKY Amino terminus GAP-43 MLCCMRRTKQV Amino terminus SynaptotagminI VVTCCFCVCKKCL Internal GAD-65 ARAWCQVAQKFTGGIGNKLCALLYG Internal Synaptotagmin VII VTIVLCGLCHWCQRKLG Internal lck MGCVCSSNPEDDWME Amino terminus HRas GPGCMSCKCVLS Carboxyl terminus Paralemmin DMKKHRCKCCSIM Carboxyl terminus  98   Figure 2.8. Differential Distribution of Acylated Proteins in Cells Expressing HIP14. (A) FLAG tagged HIP14 lacking the DHHC domain (HIP14 DHHC-FLAG) does not induce redistribution of SNAP25 GFP. (B) Distribution of transfected GFP alone or GFP fused to several acylated proteins as indicated in various panels. HIP14 induces perinuclear accumulation of SNAP25, GAD-65, GAP-43, synaptotagmin I and PSD-95.  In contrast, HIP14 did not alter the  99 distribution of paralemmin, synaptotagmin VII or a mutant form of SNAP-25 lacking the palmitoylated cysteines (SNAP25 Palm mut-GFP). Scale bars = 10 \u00b5m.  Previous work has established that palmitoylation is important for trafficking of neuronal proteins to either the presynaptic or postsynaptic compartment. Specifically, palmitoylation is essential for postsynaptic targeting of PSD-95 (El-Husseini et al. 2000b). When expressed in developing neurons, PSD-95 forms clusters that can be detected 12 h post-transfection (El-Husseini et al. 2000c). The number of clusters is gradually increased in the following 2-3 days. To assess whether HIP14 can modulate palmitoylation dependent PSD-95 trafficking, we compared changes in PSD-95 GFP clustering 12-14 h post-transfection when expressed alone or with HIP14. Figure 2.9A shows that expression of HIP14 specifically enhanced clustering of wild type PSD-95, but did not alter the distribution of the palmitoylation deficient form of PSD-95 or PSD- 95 fused to a prenylated motif. These results are consistent with the proposed role for HIP14 in palmitoylation and trafficking of PSD-95 in neurons. To further address whether endogenous HIP14 is important for palmitoylation- dependent trafficking of neuronal proteins, we generated a small interference RNA (siRNA) that specifically disrupts HIP14 expression (Figure 2.9B and C).  Next, we examined whether disruption of HIP14 expression alters trafficking of PSD-95 and GAD- 65, two neuronal proteins that rely on palmitoylation for targeting to post- and presynaptic sites, respectively (Craven et al. 1999; Kanaani et al. 2002). Remarkably, neurons transfected with HIP14 siRNA showed significant reduction in clustering of endogenous PSD-95 (Figure 2.9D-F). In contrast, clustering of SAP-102, a non- palmitoylated synaptic protein closely related to PSD-95, was not affected by HIP14 siRNA expression.  In addition to altered localization of PSD-95, HIP14 siRNA  100 significantly reduced axonal clustering of GFP-tagged GAD-65 (Figure 2.10). These results establish that HIP14 is critical for trafficking of acylated proteins targeted to both pre- and postsynaptic sites.   101 Figure 2.9. Manipulation of Endogenous Expression of HIP14 Alters Clustering of PSD-95 in Neurons. (A) HIP14 enhances palmitoylation dependent clustering of PSD-95. Cultured hippocampal neurons (DIV 4) were transfected with the indicated constructs. 12 h post-transfection, clusters of wild type PSD-95 GFP can be observed. In the presence of HIP14-FLAG, PSD-95 GFP clustering was enhanced. HIP14-FLAG did not alter trafficking of either the palmitoylation deficient form (PSD-95 GFP C3,5S) or a mutant form of PSD-95 containing a prenyl motif (PSD- 95 GFP Prenyl). (B-F) Blocking endogenous expression of HIP14 reduces clustering of PSD-95. (B) Western blot analysis of COS cells transfected with HIP14 GFP and either with HIP14 specific small interference RNA (HIP14 siRNA) or scrambled siRNA (Control siRNA) and then probed with antibodies against GFP (Top panel) and actin (Bottom panel). Analysis shows that HIP14 siRNA blocks expression of HIP14 GFP. (C) Hippocampal neurons (DIV 7) were transfected with GFP and either with HIP14 siRNA or control siRNA.  At DIV 10, neurons were fixed and stained with antibodies against HIP14.  Loss of HIP14 staining in neurons transfected with HIP14 siRNA (Bottom panels; arrowheads) but not control siRNA (Top panels; arrowheads). (D,E) HIP14 siRNA reduces clustering of (D) PSD-95 but not (E) SAP-102. (F) Summary of changes in the number of puncta of PSD-95 and SAP-102 in the dendrites of neurons expressing HIP14 siRNA compared to neurons expressing control siRNA. Scale bars in A, C and D = 10 \u00b5m, enlarged panels in D and E = 1 \u00b5m.     102  Figure 2.10. Interference with Endogenous Expression of HIP14 reduces axonal clustering of GAD-65 in Neurons. (A) HIP14 specific small interference RNA (HIP14 siRNA) blocks expression of HIP14 but does not alter the expression or localization of the Golgi marker GM-130. Neurons were transfected at DIV 7 with GFP and either with HIP14 siRNA or scrambled siRNA (Control siRNA) and then stained at DIV 10 with antibodies against HIP14 and GM-130. Loss of HIP14 staining in neurons transfected with HIP14 siRNA but not with control siRNA. (B) Neurons were transfected with GAD-65 GFP and either with HIP14 siRNA or control siRNA. HIP14 siRNA reduces axonal clustering of GAD-65. (C) Summary of changes in the intensity of puncta of GAD-65 in axons of neurons expressing HIP14 siRNA compared to neurons expressing control siRNA. Scale bars = 10 \u00b5m.    103 2.4. DISCUSSION In this study, we have identified HIP14 as a mammalian palmitoyl transferase that confers multiple substrate specificity. We demonstrate that HIP14 influences palmitoylation-dependent sorting and localization of acylated proteins in heterologous cells and neurons. Remarkably, HIP14 induced palmitoylation of diverse neuronal proteins sorted to both pre- and postsynaptic sites. The altered clustering of PSD-95 and GAD-65 in neurons lacking HIP14 supports an in vivo role for this enzyme in protein palmitoylation. Another important finding of this study is that huntingtin is also subject to palmitoylation by HIP14. Although characterization of the kinetics of this enzyme have not been established, the ability of purified HIP14 to catalyze the transfer of palmitate on specific cysteine residues palmitoylated in vivo strongly supports its action as a palmitoyl transferase. Palmitoylated sequences modified by HIP14 lack a conserved consensus sequence and can be found at the N-terminus or at internal sites. This finding is in contrast to enzymes involved in other lipid modifications such as myristoylation and prenylation that require a more defined consensus sequence located either at the N-terminus or C-terminus of modified proteins, respectively (El-Husseini Ael et al. 2002; Linder and Deschenes 2004; Smotrys and Linder 2004). Previous investigations indicate that palmitoylation may occur at many cellular sites, including the cytosol, plasma membrane, Golgi\/ER, and synaptic membranes (Resh 1999; Smotrys and Linder 2004). In this study we show that HIP14 is a palmitoyl transferase that is mainly localized to the Golgi. Enrichment of HIP14 and other putative palmitoyl transferases such as GODZ and ZDHHC8 in the Golgi (Keller et al. 2004;  104 Mukai et al. 2004) suggests that this compartment is a major site for palmitoylation. Importantly, several proteins examined in this study, including SNAP25, synaptotagmin I, GAD-65 and GAP-43 traffic through the Golgi (Gonzalo and Linder 1998; Resh 1999; el-Husseini Ael and Bredt 2002; Kanaani et al. 2002; Smotrys and Linder 2004). Thus, acylation of some of the analyzed proteins may occur in this compartment. Our EM analysis revealed that HIP14 is mainly found associated with the cytosolic side of vesicles present in the cytoplasm. HIP14 immunogold particles were also detected at the plasma membrane and dendritic spines. Further evidence for the enrichment of HIP14 in vesicular structures trafficking in the cytosol was revealed by time lapse imaging of cells expressing HIP14 GFP. The association of HIP14 with several vesicular compartments that may include recycling and late endosomes indicates that this enzyme acts at multiple subcellular locations. However, the ability of HIP14 to modulate acylation of cytosolic proteins such as PSD-95 is intriguing. Previous studies showed that PSD-95 and huntingtin associate with vesicular membranes (DiFiglia et al. 1995; Velier et al. 1998; El-Husseini et al. 2000a). In addition, vesicular trafficking of PSD-95 to a perinuclear compartment is palmitoylation dependent and can be blocked by agents that disrupt the Golgi (El-Husseini et al. 2000a; El-Husseini et al. 2000b; El-Husseini et al. 2000c). The detection of HIP14 on the cytosolic side of vesicular structures suggests that HIP14 may directly modify PSD-95 in the cytoplasm or on vesicles containing HIP14. A recent report identified ski as an acyl-transferase involved in palmitoylation of proteins within the lumen of the secretory pathway (Chamoun et al. 2001). In contrast, HIP14 appears to mediate palmitoylation of several intracellular proteins trafficking through a Golgi-dependent vesicular pathway, most likely at the cytosolic side of the membrane.  105 These findings suggest the existence of at least two families of PATs that regulate acylation of intracellular and secreted proteins. It is intriguing that HIP14 induced palmitoylation and altered trafficking of several unrelated neuronal proteins. These results suggest that HIP14 is a major PAT in neurons. However, the DHHC domain of HIP14 is conserved in 22 other DHHC containing proteins that are present in both the mouse and the human genome (Smotrys and Linder 2004). It is as yet unknown whether these proteins are functionally redundant palmitoyl transferases, or whether they are differentially localized and specialized in the palmitoylation of a subset of proteins.  106 2.5. BIBLIOGRAPHY Chamoun, Z., R. K. Mann, et al. (2001). \"Skinny hedgehog, an acyltransferase required for palmitoylation and activity of the hedgehog signal.\" Science 293(5537): 2080-4. Chapman, E. R., J. Blasi, et al. (1996). \"Fatty acylation of synaptotagmin in PC12 cells and synaptosomes.\" Biochem Biophys Res Commun 225(1): 326-32. Craven, S. E., A. E. El-Husseini, et al. (1999). \"Synaptic targeting of the postsynaptic density protein PSD-95 mediated by lipid and protein motifs.\" Neuron 22(3): 497-509. da Silva, J. S. and C. G. Dotti (2002). \"Breaking the neuronal sphere: regulation of the actin cytoskeleton in neuritogenesis.\" Nat Rev Neurosci 3(9): 694-704. DiFiglia, M., E. Sapp, et al. (1995). \"Huntingtin is a cytoplasmic protein associated with vesicles in human and rat brain neurons.\" Neuron 14(5): 1075-81. Dunphy, J. T., W. K. Greentree, et al. (1996). \"G-protein palmitoyltransferase activity is enriched in plasma membranes.\" J Biol Chem 271(12): 7154-9. El-Husseini, A. E., S. E. Craven, et al. (2000). \"Dual palmitoylation of PSD-95 mediates its vesiculotubular sorting, postsynaptic targeting, and ion channel clustering.\" J Cell Biol 148(1): 159-72. El-Husseini, A. E., E. Schnell, et al. (2000). \"PSD-95 involvement in maturation of excitatory synapses.\" Science 290(5495): 1364-8. El-Husseini, A. E., J. R. Topinka, et al. (2000). \"Ion channel clustering by membrane- associated guanylate kinases. Differential regulation by N-terminal lipid and metal binding motifs.\" J Biol Chem 275(31): 23904-10. el-Husseini Ael, D. and D. S. Bredt (2002). \"Protein palmitoylation: a regulator of neuronal development and function.\" Nat Rev Neurosci 3(10): 791-802. El-Husseini Ael, D., S. E. Craven, et al. (2001). \"Polarized targeting of peripheral membrane proteins in neurons.\" J Biol Chem 276(48): 44984-92. El-Husseini Ael, D., E. Schnell, et al. (2002). \"Synaptic strength regulated by palmitate cycling on PSD-95.\" Cell 108(6): 849-63. Fukuda, M., E. Kanno, et al. (2001). \"Mechanism of the SDS-resistant synaptotagmin clustering mediated by the cysteine cluster at the interface between the transmembrane and spacer domains.\" J Biol Chem 276(43): 40319-25. Gauthier-Campbell, C., D. S. Bredt, et al. (2004). \"Regulation of dendritic branching and filopodia formation in hippocampal neurons by specific acylated protein motifs.\" Mol Biol Cell 15(5): 2205-17. Gonzalo, S. and M. E. Linder (1998). \"SNAP-25 palmitoylation and plasma membrane targeting require a functional secretory pathway.\" Mol Biol Cell 9(3): 585-97. Heindel, U., M. F. Schmidt, et al. (2003). \"Palmitoylation sites and processing of synaptotagmin I, the putative calcium sensor for neurosecretion.\" FEBS Lett 544(1-3): 57-62. Hess, D. T., T. M. Slater, et al. (1992). \"The 25 kDa synaptosomal-associated protein SNAP-25 is the major methionine-rich polypeptide in rapid axonal transport and a major substrate for palmitoylation in adult CNS.\" J Neurosci 12(12): 4634-41. Kanaani, J., D. el-Husseini Ael, et al. (2002). \"A combination of three distinct trafficking signals mediates axonal targeting and presynaptic clustering of GAD65.\" J Cell Biol 158(7): 1229-38.  107 Kang, R., R. Swayze, et al. (2004). \"Presynaptic trafficking of synaptotagmin I is regulated by protein palmitoylation.\" J Biol Chem 279(48): 50524-36. Keller, C. A., X. Yuan, et al. (2004). \"The gamma2 subunit of GABA(A) receptors is a substrate for palmitoylation by GODZ.\" J Neurosci 24(26): 5881-91. Kutzleb, C., G. Sanders, et al. (1998). \"Paralemmin, a prenyl-palmitoyl-anchored phosphoprotein abundant in neurons and implicated in plasma membrane dynamics and cell process formation.\" J Cell Biol 143(3): 795-813. Lee, S. H. and M. Sheng (2000). \"Development of neuron-neuron synapses.\" Curr Opin Neurobiol 10(1): 125-31. Linder, M. E. and R. J. Deschenes (2004). \"Model organisms lead the way to protein palmitoyltransferases.\" J Cell Sci 117(Pt 4): 521-6. Mukai, J., H. Liu, et al. (2004). \"Evidence that the gene encoding ZDHHC8 contributes to the risk of schizophrenia.\" Nat Genet 36(7): 725-31. Rathenberg, J., J. T. Kittler, et al. (2004). \"Palmitoylation regulates the clustering and cell surface stability of GABAA receptors.\" Mol Cell Neurosci 26(2): 251-7. Resh, M. D. (1999). \"Fatty acylation of proteins: new insights into membrane targeting of myristoylated and palmitoylated proteins.\" Biochim Biophys Acta 1451(1): 1-16. Roth, A. F., Y. Feng, et al. (2002). \"The yeast DHHC cysteine-rich domain protein Akr1p is a palmitoyl transferase.\" J Cell Biol 159(1): 23-8. Singaraja, R. R., S. Hadano, et al. (2002). \"HIP14, a novel ankyrin domain-containing protein, links huntingtin to intracellular trafficking and endocytosis.\" Hum Mol Genet 11(23): 2815-28. Smotrys, J. E. and M. E. Linder (2004). \"Palmitoylation of intracellular signaling proteins: regulation and function.\" Annu Rev Biochem 73: 559-87. Strittmatter, S. M., C. Fankhauser, et al. (1995). \"Neuronal pathfinding is abnormal in mice lacking the neuronal growth cone protein GAP-43.\" Cell 80(3): 445-52. Ueno, K. (2000). \"Involvement of fatty acid synthase in axonal development in mouse embryos.\" Genes Cells 5(10): 859-69. Velier, J., M. Kim, et al. (1998). \"Wild-type and mutant huntingtins function in vesicle trafficking in the secretory and endocytic pathways.\" Exp Neurol 152(1): 34-40. Washbourne, P., V. Cansino, et al. (2001). \"Cysteine residues of SNAP-25 are required for SNARE disassembly and exocytosis, but not for membrane targeting.\" Biochem J 357(Pt 3): 625-34.           108 3. CHAPTER 3       Palmitoylation Of Huntingtin By HIP14 Is Essential For Its Trafficking And Function  A version of this chapter has been published. Yanai, A., Huang, K., Kang, R., Singaraja, R.R., Arstikaitis, P., Gan, L., Orban, P.C., Mullard, A., Cowan, C.M., Raymond, L.A., Drisdel, R.C., Green, W.N., Ravikumar, B., Rubinsztein, D.C., El-Husseini, A. and Hayden, M.R. (2006) Palmitoylation of huntingtin by HIP14 is essential for its trafficking and function. Nat Neurosci. 2006 Jun;9(6):824-31.   109 3.1. INTRODUCTION Post-translational modification of cysteine residues with palmitate has recently emerged as an important and reversible modification, which is involved in trafficking and functional modulation of different membrane proteins and their signalling pathways (El- Husseini et al. 2000a; el-Husseini Ael and Bredt 2002; Huang and El-Husseini 2005). We have recently demonstrated, by in vitro labelling assays, that HIP14 is a palmitoyl transferase that palmitoylates numerous neuronal substrates, including huntingtin (Huang et al. 2004). Expansion of the polyglutamine tract of huntingtin is the mutation underlying HD ( The Huntington's Disease Collaborative Research Group, 1993). A characteristic feature of HD ( The Huntington's Disease Collaborative Research Group, 1993) is neuronal toxicity markedly affecting medium spiny neurons of the striatum associated with formation of intranuclear and cytoplasmic inclusions (Hackam et al. 1998).  An early feature of the pathogenesis of HD is the translocation of mutant huntingtin into the nucleus (Wheeler et al. 2002; Van Raamsdonk et al. 2005a). Huntingtin is normally located on plasma and intracellular membranes and associates with vesicles and different organelles such as the Golgi (DiFiglia et al. 1995; Velier et al. 1998).  Disturbed trafficking of mutant huntingtin appears to be an early and consistent feature of HD.  However, the factors influencing the trafficking of huntingtin are unknown. Different post-translational modifications of huntingtin alter its cellular function. Ubiquitination targets huntingtin for degradation (Kegel et al. 2005) and SUMOylation promotes its capacity to repress transcription (Steffan et al. 2004). Phosphorylation of  110 mutant huntingtin is reduced and is associated with increased toxicity (Humbert et al. 2002; Warby et al. 2005). Here we show that huntingtin is palmitoylated in vivo and that alteration in palmitoylation of huntingtin affects its normal distribution and function. We provide evidence that the palmitoylation of huntingtin in vivo is regulated by HIP14 and is crucial for its normal trafficking to the Golgi. Furthermore, palmitoylation of mutant huntingtin is dramatically reduced in vivo, as a result of its lower interaction with HIP14, leading to increased inclusion formation and enhanced toxicity. 3.2. MATERIALS AND METHODS 3.2.1 Antibodies The generation of huntingtin-specific antibodies BKP1 and HD650 are described elsewhere (Kalchman et al. 1996; Slow et al. 2003).  Antibodies used in this study: BKP1 (1:500 dilution), HD650 (1:85), huntingtin antibody 2166 (Chemicon;1:250 for immunoprecipitation, 1:2000 for Western blotting and 1:1000 for immunofluorescent assays), monoclonal GFP, EEA1 and GM130 (BD Biosciences; 1:5000, 1:500 and 1:200, respectively), anti Hsp70 (Neomarker; 1:200), monoclonal transferrin receptor (Zymed; 1:1000), polyclonal caveolin antibody (Santa Cruz Biotechnology; 1:500), goat and rabbit anti-mouse HRP conjugates (BioRad; 1:5000),   Phalloidin, Lysotracker, Alexa Fluor 488 and 568 (Molecular Probes; 1:50, 1:7000, 1:1000, respectively), Cy3 donkey anti-mouse (Jackson ImmunoResearch laboratories; 1:200), monoclonal anti-\u03b3-tubulin (Sigma; 1:100), anti-proteasome Lmp2 (Abcam; 1:400 dilution) and polyclonal anti-ubiquitin (DakoCytomation; 1:500).  111 3.2.2 DNA mutagenesis and cloning Truncated huntingtin constructs N548 and N224 were previously described(Wellington et al. 1998). Cysteine substitutions were generated by PCR based site-directed mutagenesis as described earlier (Wellington et al. 1998).  Generation of C- terminal GFP tagged proteins was performed using a similar strategy, with the stop codon of the tagged proteins replaced by the initiation codon of EGFP.  All mutated DNA constructs were sequence confirmed. 3.2.3 Cell culture and transfections All reagents for cell cultures were purchased from Invitrogen Corporation (Carlsbad, CA). COS cells were cultured as previously described (Huang et al. 2004). For live cell imaging, DMEM without Phenol Red was used, to eliminate autofluorescence.  COS cells were transiently transfected with FuGene 6 transfection reagent (Roche) or Lipofectamine 2000 (Invitrogen) as indicated by the manufacturers. 24 to 48 hours post transfection, cells were processed as described for each experiment. Cultured cortical and striatal neurons were prepared as previously described (Singaraja et al. 2002) and experiments were performed at 5-12 days in vitro (DIV).  Neurons were transfected with a Nucleofector (Amaxa Inc) at day 0. 3.2.4 [3H]-palmitoylation assay and immunoprecipitation Transfected COS cells were labeled with 1 mCi\/ml [ 3 H]-palmitic acid (57 Ci\/mmol; Perkin Elmer Life Sciences, Inc.) for 3 hrs and processed as previously decribed(Huang et al. 2004). For pulse-chase experiments, transfected cells were labeled for 3 hrs and then chased for 0, 1, 3 and 6 hr with cold palmitate.  112 3.2.5 Huntingtin co-immunoprecipitation with HIP14 Brains from YAC18 and YAC128 transgenic mice were homogenized in PBS, containing protease inhibitors, and precleared in the presence of 0.2% SDS and 0.8% Triton X-100 for 1.5 hour at 4\u00baC, followed by centrifugation at 2700 g for 5 min. Normal mouse IgG, or anti-HIP14 mouse monoclonal antibody were incubated with 3mg precleared lysate at 4\u00baC for 1 hour. 30\u00b5l of equilibrated Protein(A+G) Sepharose 4 Fast Flow beads were added and samples were further incubated at 4\u00baC overnight. Beads were washed with PBS, containing 1% Triton X-100, boiled at 95\u00baC for 5 min and run on NuPAGE Novex 3-8% Tris-Acetate Gel (Invitrogen). Western Blots were probed with anti huntingtin monoclonal antibody HD650 which recognizes the transgene. 3.2.6 Immunofluorescence and time-lapse imaging Transfected cells growing on coverslips were processed as previously decribed (Huang et al. 2004) with the indicated antibodies. For time lapse,  images were collected 28 hours post-transfection using a 63x oil objective affixed to a Zeiss inverted light microscope, and AxioVision software.  While images were acquired, cells were kept in a 37\u00baC chamber, supplemented with 5% CO2. Images were collected every 15 minutes for a total time of 2 hours. 3.2.7 Terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) assay Day 0 Rat cortical neurons were transfected with different N-terminal truncations of huntingtin. DMEM was replaced with neurobasal medium 1 hr posttransfection. Neurons (5-11 DIV) were exposed to 500 \u00b5M NMDA for 10min and further incubated with neurobasal medium for 24hr, fixed for 10 min in 4% paraformaldehyde in PBS (pH  113 7.4) and then 5 min in 100% methanol at \u201320 0 C. Cells were stained with GFP antibody for 1 hr followed by incubation with a secondary antibody conjugated to Alexa 488 fluorophore for 1 hr at RT. Neurons were stained using the ApopTag Red In Situ Apoptosis Detection Kit (Chemicon) according to the manufacturer\u2019s instructions. Nuclei were counterstained with 0.5 \u00b5g\/ml DAPI (Molecular Probes). Neurons transfected with various huntingtin constructs were counted under the microscope, and the number of TUNEL-positive (red) neurons was determined as a fraction of DAPI-positive (blue) neuronal nuclei in each transfected cell (green) by an observer blinded to the identity of the samples. Experiments were repeated 5 times and 100-200 cells were counted in each experiment. The fractions of TUNEL-positive nuclei determined for each experiment were averaged, and the results are presented as means \u00b1 SD (n= number cells counted). 3.2.8 Cell death assay Cell death\/toxicity was monitored by scoring the proportion of transfected COS-7 cells with apoptotic nuclear morphology as previously described (Wyttenbach et al. 2002). 3.2.9 Imaging and Anaylsis Images were acquired on a Zeiss Axiovert M200 motorized microscope by using a monochrome 14-bit Zeiss Axiocam HR charge-coupled device camera at 1,300\u00d71,030 pixels. Image analysis was performed as previously described (Huang et al. 2004). 3.2.10  Flotation assay Brains from wild type and YAC128 mice  were homogenized, sonicated and then centrifuged at 9500 g for 10 min in a SW55 Ti rotor (Beckman Coulter) to remove debris. Following further centrifugation at 100.000 g for 90 min, the plasma membrane fraction  114 was resuspended in 2ml solubilization buffer.  5mg total protein was brought up to 2ml and further diluted with an equal volume of 80% (w\/v) sucrose in MBS, and loaded at the bottom of thin wall ultracentrifuge tubes.  4ml of 30% sucrose was overlaid on the membrane fraction and 4 ml of 5% sucrose made the top layer. Gradients were centrifuged at 118,000 g for 16hr at 4\u00ba in a SW41 Ti rotor to isolate detergent resistant membranes.  Fractions of 1 ml were collected from the top and analyzed on SDS-PAGE. 3.2.11  Labeling with biotin-conjugated 1-biotinamido-4-[4- (maleimidomethyl)cyclohexanecarboxamido] butane (Btn- BMCC) Brains from YAC 18Q and YAC128Q mice were homogenized and processed for immunoprecipitation as described above. The beads were then washed with wash buffer (PBS, containing 1% Triton X-100) supplemented with 10 mM N-ethylmaleimide (NEM), followed by treatment with 1 M hydroxylamine (NH2OH pH 7.4) for 1 h at 25\u00b0C. Samples were then processed as previously described  (Drisdel and Green 2004). 3.2.12  Viral infection Control siRNA and HIP14 siRNA were cloned into human immunodeficiency virus type 1 (HIV-1)-based lentiviral vectors pLL3.7. Production of lentiviral supernatants and infection of dissociated primary cortical neurons were done as previously described (Janas et al. 2006). Briefly, rat cortical neurons (8 DIV) were infected with viruses expressing siRNA for 4 d, followed by exposure to 500 M NMDA for 10 min; they were then further incubated with neurobasal medium. After 24 h, cells were processed for the TUNEL assay as described above.   115 3.3. RESULTS 3.3.1 Palmitoylation of huntingtin at Cys214 is modulated by CAG size The observation that palmitoylation is critical for the distribution of proteins to particular membrane locations, combined with the presence of huntingtin in detergent- resistant membranes (Figure 3.1), raised the possibility that the palmitoylation of huntingtin may be crucial for regulating its trafficking and function. Immunoprecipitation of huntingtin from cortical neurons revealed that full-length huntingtin is indeed palmitoylated (Figure 3.2A). Treatment of cells with NMDA, which induces cleavage of huntingtin, revealed that the N-terminal region is modified by palmitate (Figure 3.2A). Deletion mapping with N-terminal truncations of huntingtin showed that palmitoylation occurred in the first 224 amino acids (Figure 3.2B; N224). Palmitoylation was abolished by treatment with hydroxylamine (NH2OH; Figure 3.2C), indicating that the incorporation of palmitate is due to the modification of cysteines through a thioester bond. Further deletion mapping localized the site of palmitoylation to a fragment containing six cysteine residues (Figure 3.2D and Figure 3.1; Huntingtin 79\u2013 224). Subsequent mutagenesis localized the palmitoylated residue to three cysteines in the C terminus of this fragment (Figure 3.2D and Figure 3.1; Huntingtin 141\u2013224). Protein sequence alignment (The Huntington's Disease Collaborative Research Group, 1993) suggested that C214 was a likely candidate for palmitoylation by virtue of it being the only site in this region that was conserved in all the species we analyzed, including Drosophila (Figure 3.1). Indeed, C214 was identified as the site at which the N-terminal fragment of huntingtin (Figure 3.2D) and full-length huntingtin (Figure 3.2E) are  116 palmitoylated, consistent with the existence of a single major site (C214) for palmitoylation within huntingtin. Protein palmitoylation is regulated by flanking sequences that can markedly alter the levels of protein palmitoylation(el-Husseini Ael and Bredt 2002). As the major site of palmitoylation is in the N terminus of huntingtin, close to the polyglutamine tract, this immediately raised the possibility that palmitoylation of huntingtin was modulated by CAG size. Indeed, palmitoylation of the N-terminal fragment of huntingtin in COS cells (N548) was significantly reduced in the presence of a disease-associated expansion of the polyglutamine tract (Figure 3.2F,G; P = 0.001). Palmitoylation of other proteins such as SNAP25 was not altered in the presence of the mutation for Huntington disease (Figure 3.1). The fact that polyglutamine expansion markedly decreases huntingtin palmitoylation raised the question of whether some of the pathogenic effects of mutant huntingtin might be operating through this mechanism.  117  Figure 3.1. Huntingtin is associated with detergent resistant membranes and Cysteine 214 is conserved in all species analyzed. (A) Huntingtin is associated with detergent resistant membranes (DRM).  Membranes from mouse brains were solubilized in 0.5% Triton X-100 lysis buffer and subjected to a flotation assay.  Some huntingtin localizes to the fraction containing detergent resistant membranes (fraction 5), similar to caveolin but in contrast to the transferrin receptor, which is solubilized under these conditions. (B) A diagram representing huntingtin truncations and amino acid substitutions used to determine the site of palmitoylation within huntingtin.  (C) Huntingtin protein sequence alignment demonstrates that C214 is conserved in all species analyzed.    118  Figure 3.2. Huntingtin is palmitoylated in neurons and COS cells. Palmitoylation is modulated by CAG size. (A) Rat cortical neurons were treated (+) with 100\u00b5M NMDA for 10 min, followed by [ 3 H]- palmitate metabolic labeling. Huntingtin (huntingtin) was immunoprecipitated (IP) and visualized by Western blotting and fluorography.  A [ 3 H]-palmitate band is detected in untreated cells, whereas following NMDA treatment a palmitoylated fragment of huntingtin, detected by N- terminus specific antibody BKP1, is generated (right panel). (B) COS cells transfected with two truncated fragments of huntingtin (N548, N224) were metabolically labeled and processed as described above.  The smallest palmitoylated huntingtin fragment contains six cysteine residues. (C) COS cells were transfected with N548-15 and metabolically labeled.  Immunoprecipitates were treated with or without 1M NH2OH and processed as previously described.  Palmitate is cleaved from huntingtin following NH2OH treatment (right), indicating that it is coupled to huntingtin through a thioester bond. (D,E) Palmitoylation of huntingtin occurs on cysteine 214. COS cells were transfected with plasmids encoding full length huntingtin  or containing six, three N- or three C-terminal cysteines, tagged with GFP, or eight cysteines for C152S and C204S substitutions (diagram in Figure 3.1B). Huntingtin from labeled cells was analyzed as described above.  Substitution of C214 to serine (C214S) abolished the palmitoylation of Huntingtin 79-224, Huntingtin 141-224 (D) and full length huntingtin (E). (F) COS cells were transfected with N548, containing 15 or 128Q, and metabolically labeled. Huntingtin from labeled cells was analyzed as described above. (G) Results of four independent experiments were quantified using Image J software, adjusted for protein levels and demonstrated a reduction of ~50% in the palmitoylation of mutant huntingtin (p=0.001; Student\u2019s t-test).   119 3.3.2 Palmitoylation regulates distribution and function of huntingtin We investigated whether the palmitoylation of huntingtin influences its subcellular distribution, frequency of inclusion body formation and toxicity. Palmitoylation-resistant full-length wild-type huntingtin (huntingtin-15(C214S)), mutant huntingtin (huntingtin- 128(C214S)) and the N-terminal fragment N548-128(C214S) showed a marked redistribution of the protein in both COS and HEK-293 cells (Figure 3.3A,B arrows, Figure 3.4 and data not shown). Expression of N548-128(C214S) resulted in a threefold increase in the number of cells containing huntingtin inclusions (Figure 3.3B). This tendency for increased inclusion formation appeared specific to the C214S change, as mutation of an adjacent cysteine residue (C204S) did not increase the formation of inclusions (Figure 3.3B). Consistent with this, time-lapse imaging in COS cells revealed that inclusions formed three times faster in cells expressing palmitoylation-resistant huntingtin (N548-128(C214S); Figure 3.3C,D).  120   Figure 3.3.  Increased inclusions of palmitoylation-resistant mutant htt in COS cells. (A-D) COS cells were transfected with N548-128, with or without the C214S substitution, and stained with htt antibody. (A) Inclusion bodies (arrows) are occasionally seen with expression of N548-128. However, a C214S substitution altered mutant htt distribution and enhanced the formation of inclusions. Scale bar = 10 \u00b5m. (B) The percentage of cells containing inclusions increases in COS cells expressing N548-128 (6.7% \u00b1 0.46) and is maximal in cells expressing N548-128(C214S) (19.4% \u00b1 0.58). This effect was not observed with N548-128(C204S) (8% \u00b1 0.68%). (C) Time lapse images captured over 2 hours revealed an accelerated rate of development of inclusions in the presence of the C214S substitution in mutant htt (lower panels). Scale bar = 10 \u00b5m. (D) The rate of inclusion formation in N548-128(C214S) transfected cells was significantly faster than in N548-128 transfected cells.  121   Figure 3.4. Altered distribution of palmitoylation resistant huntingtin in HEK-293 cells. Cells were transfected with full-length huntingtin constructs and an N-terminal fragment of mutant huntingtin, with or without the C214S substitution, and stained with huntingtin antibody. The C214S substitution resulted in altered distribution of full length wt huntingtin (A) and of full length as well as a truncated form (N548-128) of mutant huntingtin (B) to a perinuclear compartment indicating a defect in protein sorting.  (C) The percentage of cells containing full length mutant huntingtin inclusions was 1.2%, and significantly increased upon expression of mutant huntingtin with the C214S mutation (4.8%, p=0.008).   An important question is whether palmitoylation directly influences the trafficking of huntingtin or whether this effect could be operating via another mechanism. Mutation of the palmitoylated cysteine may have indirectly disrupted other protein-protein  122 interactions or resulted in an altered conformation of huntingtin that promoted inclusion body formation. To exclude this possibility, we assessed whether treatment with drugs that specifically block protein palmitoylation alter huntingtin trafficking. The palmitate modification of huntingtin is transient, with a half-life of 2.5 h (Figure 3.5). This rapid turnover allowed us to use the inhibitor 2-bromopalmitate to block palmitoylation and investigate the trafficking of nonpalmitoylated huntingtin in cells. Indeed, 14 h of treatment with 2-bromopalmitate resulted in a significant increase in huntingtin inclusion bodies in cells expressing N548-128 (Figure 3.5; P =0.006). Taken together, these findings indicate that a defect in palmitoylation specifically alters huntingtin distribution in COS cells. In fact, inclusions in cells expressing palmitoylation-resistant huntingtin colocalized with \u03b3-tubulin, ubiquitin, Lmp2 and Hsp70, indicating that C214S huntingtin is misfolded  (Kopito 2000; Waelter et al. 2001) in both COS cells and neurons (Figure 3.6).  123   Figure 3.5.  Plamitate on huntingtin turns over and inhibition of palmitoylation increases the inclusion formation. (A,B) Palmitate turns over on huntingtin.  (A) COS cells transfected with wild type huntingtin (N548-15) were metabolically labeled with [ 3 H]-palmitate for 3 hours and then chased with unlabeled palmitate for 0,1,3 and 6 hours.  Huntingtin was immunoprecipitated and subjected to SDS-PAGE and autoradiography.  (B) The pulse-chase experiment demonstrated that palmitate turnover on wildtype huntingtin has a half-life of 2.5 hours.  The half-life of palmitate reported here is the calculated time that would be needed to remove 50% of the original [ 3 H]palmitate. (C) COS cells transfected with mutant huntingtin were treated with or without the palmitoylation inhibitor 2 bromopalmitate (2 Br Palm).  Cells were stained with huntingtin antibody. 2 Br Palm treatment markedly altered mutant huntingtin distribution and significantly increased the number of inclusions. (D) The percentage of cells containing huntingtin inclusions in cells expressing mutant huntingtin was 6.7% (n=271), and significantly increased following 2 Br Palm treatment (13.7%; n=220, p=0.006).  124  Figure 3.6. Altered distribution of palmitoylation-resistant mutant huntingtin in COS cells and neurons.  125 (A,B) COS cells transfected with N548-128(C214S) were immunolabeled with antibodies detecting huntingtin and several markers. Huntingtin inclusions colocalized with the centrosome marker \u03b3-tubulin, the proteasome markers ubiquitin and Lmp2, and misfolded protein marker Hsp70, but not with the Golgi marker GM-130, the lysosomal marker Lysotracker or the early endosome marker EEA1. Scale bar: 10 \u00b5m in a, 5 \u00b5m in b. (C) Rat cortical neurons transfected with N548-15-GFP or N548-128(C214S)-GFP were immunolabeled with antibodies detecting Hsp70 (red). Mutant huntingtin with the C214S substitution accelerated the formation of inclusions that colabeled with Hsp70. Scale bar, 10 \u00b5m. (D) Representative images showing that the inclusions formed in cortical neurons expressing N548-128(C214S) also colocalized with Lmp2. Scale bar, 10 \u00b5m.   In an independent assay, we examined what effect the loss of huntingtin palmitoylation has on COS cell survival by analyzing nuclei of transfected cells for fragmentation or Pyknosis (Wyttenbach et al. 2002). Cell death in the presence of palmitoylation-resistant mutant huntingtin (N548-128(C214S)) was significantly higher than in the presence of huntingtin with polyglutamine expansion alone (Figure 3.7A,B; P = 10 -5 ). To examine whether these effects are seen in a cell type relevant to Huntington disease, we next investigated the functional effects of a loss of huntingtin palmitoylation on inclusion formation and cell survival in neurons. For both truncated (N548) and full- length huntingtin, inclusion formation was more frequent in the presence of polyglutamine expansion (Figure 3.7C-E) and was significantly increased when both wild-type (P = 0.02) and mutant huntingtin (N548: P = 0.01; full-length: P = 10 -5 ) were made palmitoylation resistant (C214S; Figure 3.7C-E). We then examined the effects of a loss of huntingtin palmitoylation on the localization of huntingtin in neurons. After transfection of wild-type and mutant full-length huntingtin, huntingtin was predominantly expressed in the cytosol and inclusions were seen only in the presence of mutant huntingtin (Figure 3.7D). In contrast, after transfection of palmitoylation-resistant huntingtin, inclusions were occasionally seen even in the presence of a normal polyglutamine tract (Figure 3.7D,E). Notably, in the presence of palmitoylation-resistant  126 huntingtin with polyglutamine expansion, the frequency of nuclear inclusions was increased (Figure 3.7D,E). Localization of mutant huntingtin in the nucleus is an early reproducible marker of huntingtin toxicity in vivo in animal models for Huntington disease(Van Raamsdonk et al. 2005a) and in humans(Sapp et al. 1997). This suggests that one mechanism for the localization of mutant huntingtin in the nucleus may be the decreased palmitoylation consequent to the expansion of the polyglutamine tract. We made use of the fact that neurons expressing mutant huntingtin are more vulnerable to NMDA-induced toxicity(Zeron et al. 2002) by transfecting cortical neurons with N-terminal fragments of wild-type and mutant huntingtin, including palmitoylation- resistant huntingtin (C214S), treating the cells with 500 \u00b5M NMDA and assessing changes in neuronal viability. Notably, both wild-type and mutant huntingtin became significantly more toxic in the presence of the C214S mutation (Figure 3.7F; P = 0.01 and P = 0.03, respectively).  127    Figure 3.7. Enhanced toxicity of palmitoylation-resistant mutant huntingtin. (A,B) COS cells transfected with N548-128 and N548-128(C214S) were scored for toxicity by analyzing nuclei for changes associated with cell death. Cell death was significantly (P = 10 -5 ) induced by the expression of N548-128(C214S). Representative images show a normal nucleus and an apoptotic nucleus (arrowhead). (C\u2013E) Rat cortical neurons were transfected with truncated huntingtin (N548) or full-length huntingtin (fl htt) constructs as indicated, and stained with huntingtin antibody. (C) The percentage of neurons containing inclusions increased in neurons expressing N548-15(C214S) (2.5 0.35%), increased still further in neurons expressing N548-128 (15.17 1.3%) and was maximal in neurons expressing N548-128(C214S) (25.08 3.1%). (D) Representative images showing neurons expressing the indicated fl htt constructs. Scale bar, 5 m. (E) The percentage of neurons containing inclusions increased in neurons expressing flhuntingtin-15Q(C214S) (0.5 0.27%), increased still further in neurons expressing fl htt-128Q (1 0.41%) and was maximal in neurons expressing fl htt-128Q(C214S) (2.1 0.44%). There was a significant (P = 10 -5 ) increase in the percentage of cells with nuclear inclusions in neurons expressing fl htt-128Q(C214S). (F) Rat cortical neurons transfected with the indicated huntingtin constructs were treated with NMDA for 10 min and processed for the TUNEL assay. The percentage of cell death was significantly greater in transfected cells expressing N548-15Q  128 (C214S) (23.16 5.2; P = 0.01) and N548-128Q(C214S) (27.75% 4.7; P = 0.03), demonstrating that the loss of palmitoylation significantly reduces cellular viability.   3.3.3 HIP14 regulates the palmitoylation and trafficking of huntingtin HIP14, a protein that interacts with huntingtin in vitro (Singaraja et al. 2002), is a conserved mammalian palmitoyl transferase for different neuronal substrates, including huntingtin(Huang et al. 2004). HIP14 is mainly localized in the Golgi(Singaraja et al. 2002). Sorting of some neuronal proteins, such as Ras, requires palmitoylation for trafficking to Golgi membranes and for delivery to transport vesicles. Palmitoylated Ras shows a pronounced Golgi localization and faster retrograde trafficking from the plasma membrane to the Golgi(Huang and El-Husseini 2005). HIP14 alters the distribution of a subset of palmitoylated proteins in a palmitoylation-dependent manner(Huang et al. 2004). We found that HIP14 overexpression resulted in the redistribution of endogenous huntingtin (Figure 3.8A), and to a lesser extent of mutant huntingtin (Figure 3.8B), to the Golgi. This redistribution was not observed with palmitoylation-resistant huntingtin (Figure 3.8C), suggesting that huntingtin trafficking to the Golgi is at least partially regulated by palmitoylation. HIP14's known interaction with huntingtin, combined with the fact that huntingtin is palmitoylated and its trafficking is regulated at least in part by palmitoylation, raised the possibility that HIP14 is involved in huntingtin palmitoylation in vivo. Overexpression of HIP14 with wild-type and mutant huntingtin significantly (P = 0.03 and P = 0.02, respectively) increased their palmitoylation (Figure 3.8D,E), demonstrating  129 that HIP14 catalyzes huntingtin palmitoylation. We obtained further evidence for the role of palmitoylation in the normal distribution of huntingtin by examining the effect of HIP14 on the formation of inclusions in neurons. Overexpression of HIP14 significantly (P = 0.005) reduced the number of inclusions seen in the presence of polyglutamine expansion (Figure 3.8F) but had no effect on that seen with palmitoylation-resistant mutant huntingtin (Figure 3.8F), highlighting the importance of HIP14 palmitoylation of huntingtin in the intracellular distribution and trafficking of huntingtin.  130  Figure 3.8. HIP14 influences the distribution and catalyzes the palmitoylation of htt in neurons. (A) Cortical neurons transfected with control vector (left) or with FLAG-tagged HIP14 were labeled with the appropriate antibodies. The overexpression of HIP14 resulted in marked redistribution of endogenous htt to the Golgi. Scale bar, 5 \u00b5m. (B,C) Cortical neurons transfected with N548-128Q-GFP or N548-128Q(C214S)-GFP alone (left) or with HIP14-FLAG were labeled with the appropriate antibodies. Scale bar, 5 \u00b5m. (B) Partial redistribution of N548-128Q- GFP was observed in the presence of HIP14. (C) No effect in the distribution of palmitoylation- resistant htt (N548-128Q(C214S)-GFP) was observed in the presence of HIP14. (D) COS cells transfected with N548-15Q or N548-128Q, and with a control vector or HIP14, were metabolically labeled. Immunoprecipitated htt was analyzed as described above. (E) Palmitoylation was significantly (P = 0.03) increased in cells coexpressing wild-type htt and  131 HIP14. In addition, HIP14 significantly (P = 0.02) increased palmitoylation of mutant htt. However, in the presence of HIP14, mutant htt was still significantly (P = 0.03) less palmitoylated than wild-type htt. (F) Cortical neurons transfected with GFP-tagged N548-128Q or N548-128Q(C214S), and with a control vector or FLAG-tagged HIP14, were labeled with the appropriate antibodies. The percentage of cells containing htt inclusions was significantly (P = 0.005) lower in the presence of HIP14 whereas no change was detected in the number of C214S inclusions, emphasizing the importance of HIP14 palmitoylation of htt in its distribution.  The reduced palmitoylation of mutant huntingtin (Figure 3.2F) suggested that a defect in huntingtin palmitoylation may have resulted from an altered association with HIP14. Our analysis showed that the in vivo interaction of HIP14 with huntingtin was markedly reduced in the presence of mutant huntingtin in brains of YAC128 mice(Slow et al. 2003) (Figure 3.9A), indicating that reduced palmitoylation of mutant huntingtin results, in all likelihood, from a decreased association with HIP14. To further test this, we compared palmitoylation(Drisdel and Green 2004) of full-length wild-type huntingtin and mutant huntingtin obtained from the brains of YAC18 and YAC128 mice, respectively. Similar to our findings with the N-terminal fragment of mutant huntingtin in heterologous cells (Figure 3.2F), palmitoylation of full-length mutant huntingtin was significantly (P = 0.01) diminished in YAC128 brain extracts (Figure 3.9B,C).  132    Figure 3.9. HIP14 associates less with mutant htt, and mutant htt is less palmitoylated in vivo. (A) Coimmunoprecipitation of HIP14 and htt from brains of YAC18 and YAC128 mice demonstrated a weaker interaction between mutant htt and HIP14. (B) Immunoprecipitated htt from YAC18 and YAC128 mouse brain lysate was incubated in the presence or absence of 1 M NH2OH and labeled with Btn-BMCC sulfhydryl-specific reagent. Western blots were probed with streptavidin-conjugated HRP (top) to detect biotin-labeled htt or probed with htt antibody (bottom) to detect total immunoprecipitated htt. (C) Palmitoylation was significantly (P = 0.01) reduced in htt with an expanded polyglutamine tract.   To further investigate the alteration in the palmitoylation of mutant huntingtin and its decreased association with HIP14, and their role in the disturbed trafficking and increased inclusion formation seen in Huntington disease, we used a small interfering RNA (siRNA) that disrupts HIP14 expression as previously described(Huang et al. 2004) (Figure 3.10). Neurons derived from YAC18 and YAC128 brains and transfected with HIP14 siRNA showed significant redistribution of both wild-type and mutant huntingtin (Figure 3.11A-F; P = 3 \u00d710 -4  and P = 8 \u00d710 -5 , respectively). In YAC128Q neuronal  133 cultures, HIP14 downregulation resulted in the increased formation of huntingtin inclusions (Figure 3.11B, arrowhead). Accordingly, we observed a significant increase in inclusions in cortical neurons transfected with N548-128 and HIP14 siRNA (Figure 3.11G; P = 0.025). Moreover, reduced levels of HIP14 significantly increased perinuclear distribution of the proteasome marker Lmp2 (Figure 3.11C,F; P = 0.02). In contrast, we observed no increase in the perinuclear accumulation of several other proteins examined, including GM130, the NMDAR receptor subunit NR1 and the postsynaptic proteins PSD- 95 and SAP-102, upon downregulation of HIP14; this indicated that the altered trafficking of huntingtin is not due to a disruption of Golgi function or a generalized change in protein sorting (Figure 3.10 and data not shown). We also found that decreasing HIP14 expression in neurons increased their susceptibility to NMDA treatment (Figure 3.11H), indicating that reduced palmitoylation is detrimental to neuronal viability. These results establish that HIP14 is critical for the normal targeting and folding of huntingtin in vivo. Our discoveries that HIP14 palmitoylates huntingtin (Figure 3.8D) and that polyglutamine expansion markedly decreases the interaction of huntingtin with HIP14 in vivo (Figure 3.9A) provide an explanation for the decreased palmitoylation of mutant huntingtin.  134   Figure 3.10. Knockdown of HIP14 in neurons by HIP14 specific siRNA. (A) Wild type mouse cortical neurons (DIV 7) were transfected with either HIP14 or control siRNA.  At DIV 10, neurons were fixed and stained with antibodies against HIP14.  Loss of HIP14 staining is evident in neurons transfected with HIP14 siRNA (bottom panels) but not with control siRNA (top panels). As a control, GM130 staining shows that the Golgi structure is intact. (B) Western blot analysis of COS cells transfected with HIP14-GFP and with either HIP14 or control siRNA were probed with HIP14 antibodies (top panel) and actin (bottom panel) demonstrating that HIP14 siRNA markedly decreases expression of HIP14 GFP.  (C,D)  As a control, cytoplasmic NR1 was not affected by HIP14 knockdown.      135   Figure 3.11. HIP14 regulates the palmitoylation and distribution of huntingtin in vivo. (A\u2013F) Downregulation of HIP14 expression altered the trafficking of wild-type and mutant htt and increased perinuclear accumulation of Lmp2. Cortical neurons (6 DIV) from YAC18 and YAC128 mice were transfected with GFP and either control siRNA or HIP14 siRNA. Arrowheads in panels a,b and c indicate transfected cells. Scale bar, 5 \u00b5m. Representative images show an increase in the cytoplasmic accumulation of wild-type htt in YAC18 neurons (A), and mutant htt (B) and Lmp2 (C) in neurons from YAC128 mice expressing HIP14 siRNA. Quantification of htt (D,E) and Lmp2 (F) staining intensity in the cytoplasm of neurons expressing control or HIP14 siRNA demonstrated that htt and Lmp2 intensities were substantially higher in cells expressing HIP14 siRNA. (G) Downregulation of HIP14 in neurons transfected  136 with N548-128 significantly (P = 0.025) increased the percentage of neurons with inclusions. (H) Downregulation of HIP14 in neurons decreased cellular viability following NMDA-induced cell death. Cortical neurons (8 DIV) were infected with lentiviruses expressing either control or HIP14 siRNA for 3 d, followed by NMDA treatment (Methods). The percentage of cell death in neurons infected with HIP14 siRNA virus was significantly (P = 0.002) higher, demonstrating that decreased expression of HIP14 significantly increases cell death.    3.4. DISCUSSION In this study, we demonstrated a critical role for palmitoylation in regulating the trafficking and folding of huntingtin. Palmitoylation may contribute to the sorting of huntingtin to cytosolic transport vesicles or it may serve as a structural signal for proper protein folding and for the association of huntingtin with other molecules required for its proper trafficking. A protein domain in the N terminus of huntingtin, spanning amino acids 172\u2013372, is essential for the membrane association of huntingtin and for targeting wild-type huntingtin to the plasma membrane(Kegel et al. 2005). Here we showed that the palmitoylation of huntingtin at cysteine 214 might be contributing to this finding. The importance of palmitoylation for the correct folding and assembly of the \u03b17 nicotinic receptor, for PSD-95\u2013regulated clustering and for the function of AMPA-type glutamate receptors at the synapse has recently been demonstrated(El-Husseini Ael et al. 2002; Drisdel et al. 2004). Notably, the reduced palmitoylation of nicotinic receptors results in their aggregation(Rakhilin et al. 1999), similar to that seen in palmitoylation-deficient mutant huntingtin. Also, the reversible nature of palmitoylation makes it subject to regulation by several stimuli that modulate neuronal protein function and synaptic strength. For instance, cycles of palmitoylation and depalmitoylation regulate the localization and function of specific Ras isoforms(Rocks et al. 2005) and of R7BP (Drenan et al. 2005), a membrane anchor for the RGS7 family. Furthermore, the cycling  137 of palmitate on PSD-95 at the synapse is also regulated by neuronal activity, and this modulates the retention of both PSD-95 and specific glutamate receptor subunits at the synapse(El-Husseini Ael et al. 2002). How the disturbance of huntingtin palmitoylation may be contributing to previously described disturbances in synaptic transmission in Huntington disease(Zeron et al. 2002) remains to be determined. The palmitoylation of huntingtin normally occurs as a result of its interaction with HIP14. The presence of polyglutamine expansion disturbed the interaction of huntingtin with HIP14 (Figure 3.9A), resulting in both decreased palmitoylation (Figure 3.2F and Figure 3.9B) and altered distribution of huntingtin (Figure 3.3, Figure 3.6, Figure 3.7, Figure 3.8); consequently, huntingtin accumulated in inclusions and failed to reach its appropriate cellular destinations. Palmitoylation thus is an important regulator of huntingtin trafficking in vivo. When huntingtin is less palmitoylated, as seen in the YAC model for Huntington disease, disturbances in its trafficking are evident; this is associated with enhanced toxicity and increased cell death in neurons. The presence of insoluble huntingtin inclusions in the brains of individuals with Huntington disease has led to the hypothesis that these inclusions contribute to the neuronal dysfunction and ultimate cell death that are characteristics of the disease. Much research has focused on these inclusions and on the discovery of aggregation inhibitors as possible therapeutic interventions. However, an increasing body of data suggests that these inclusions are not the disease-causing agents. For example, in YAC128 mouse models of Huntington disease, huntingtin inclusions are first observed months after the initial onset of motor and cognitive dysfunction(Slow et al. 2003). In addition, experimental manipulation of mouse models of the disease has revealed the dissociation between insoluble inclusions  138 and neuronal dysfunction and loss(Mastroberardino et al. 2002; Ferrante et al. 2003). Furthermore, in a transgenic mouse model expressing a short fragment of huntingtin whose CAG size, tissue distribution and level of expression are identical to those in the full-length YAC128 model, inclusions form earlier and are more prevalent, but this model does not manifest the neuronal dysfunction or degeneration present in the YAC mouse(Slow et al. 2005). Results from recent in vitro studies(Arrasate et al. 2004) indicate that although the insoluble form of huntingtin may not be toxic, it is likely that a soluble, diffuse form of huntingtin is toxic to neurons. In this study, we showed that inclusion formation, resulting from the decreased palmitoylation of huntingtin, serves as a biomarker for the altered trafficking of huntingtin but does not necessarily directly cause cell death or cellular toxicity. Removal of palmitate from proteins is thought to be mediated by thioesterases, which cleave cysteine linkages(Verkruyse and Hofmann 1996; Soyombo and Hofmann 1997). We have shown that the increased expression of HIP14 with increased palmitoylation of mutant huntingtin partially restores the normal trafficking and distribution of huntingtin. Once the enzymes involved in the depalmitoylation of huntingtin are identified, inhibiting their function could result in increased palmitoylation of mutant huntingtin; potentially, this could restore normal trafficking and alleviate the cellular defects induced by polyglutamine expansion in this protein.     139 3.5. BIBLIOGRAPHY The Huntington's Disease Collaborative Research Group. (1993). \"A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington's disease chromosomes. \" Cell 72(6): 971-83. Arrasate, M., S. Mitra, et al. (2004). \"Inclusion body formation reduces levels of mutant huntingtin and the risk of neuronal death.\" Nature 431(7010): 805-10. DiFiglia, M., E. Sapp, et al. (1995). \"Huntingtin is a cytoplasmic protein associated with vesicles in human and rat brain neurons.\" Neuron 14(5): 1075-81. Drenan, R. M., C. A. Doupnik, et al. (2005). \"Palmitoylation regulates plasma membrane-nuclear shuttling of R7BP, a novel membrane anchor for the RGS7 family.\" J Cell Biol 169(4): 623-33. Drisdel, R. C. and W. N. Green (2004). \"Labeling and quantifying sites of protein palmitoylation.\" Biotechniques 36(2): 276-85. Drisdel, R. C., E. Manzana, et al. (2004). \"The role of palmitoylation in functional expression of nicotinic alpha7 receptors.\" J Neurosci 24(46): 10502-10. El-Husseini, A. E., S. E. Craven, et al. (2000). \"Dual palmitoylation of PSD-95 mediates its vesiculotubular sorting, postsynaptic targeting, and ion channel clustering.\" J Cell Biol 148(1): 159-72. el-Husseini Ael, D. and D. S. Bredt (2002). \"Protein palmitoylation: a regulator of neuronal development and function.\" Nat Rev Neurosci 3(10): 791-802. El-Husseini Ael, D., E. Schnell, et al. (2002). \"Synaptic strength regulated by palmitate cycling on PSD-95.\" Cell 108(6): 849-63. Ferrante, R. J., J. K. Kubilus, et al. (2003). \"Histone deacetylase inhibition by sodium butyrate chemotherapy ameliorates the neurodegenerative phenotype in Huntington's disease mice.\" J Neurosci 23(28): 9418-27. Hackam, A. S., R. Singaraja, et al. (1998). \"The influence of huntingtin protein size on nuclear localization and cellular toxicity.\" J Cell Biol 141(5): 1097-105. Huang, K. and A. El-Husseini (2005). \"Modulation of neuronal protein trafficking and function by palmitoylation.\" Curr Opin Neurobiol 15(5): 527-35. Huang, K., A. Yanai, et al. (2004). \"Huntingtin-interacting protein HIP14 is a palmitoyl transferase involved in palmitoylation and trafficking of multiple neuronal proteins.\" Neuron 44(6): 977-86. Humbert, S., E. A. Bryson, et al. (2002). \"The IGF-1\/Akt pathway is neuroprotective in Huntington's disease and involves Huntingtin phosphorylation by Akt.\" Dev Cell 2(6): 831-7. Janas, J., J. Skowronski, et al. (2006). \"Lentiviral delivery of RNAi in hippocampal neurons.\" Methods Enzymol 406: 593-605. Kalchman, M. A., R. K. Graham, et al. (1996). \"Huntingtin is ubiquitinated and interacts with a specific ubiquitin-conjugating enzyme.\" J Biol Chem 271(32): 19385-94. Kegel, K. B., E. Sapp, et al. (2005). \"Huntingtin associates with acidic phospholipids at the plasma membrane.\" J Biol Chem 280(43): 36464-73. Kopito, R. R. (2000). \"Aggresomes, inclusion bodies and protein aggregation.\" Trends Cell Biol 10(12): 524-30.  140 Mastroberardino, P. G., C. Iannicola, et al. (2002). \"'Tissue' transglutaminase ablation reduces neuronal death and prolongs survival in a mouse model of Huntington's disease.\" Cell Death Differ 9(9): 873-80. Rakhilin, S., R. C. Drisdel, et al. (1999). \"alpha-bungarotoxin receptors contain alpha7 subunits in two different disulfide-bonded conformations.\" J Cell Biol 146(1): 203-18. Rocks, O., A. Peyker, et al. (2005). \"An acylation cycle regulates localization and activity of palmitoylated Ras isoforms.\" Science 307(5716): 1746-52. Sapp, E., C. Schwarz, et al. (1997). \"Huntingtin localization in brains of normal and Huntington's disease patients.\" Ann Neurol 42(4): 604-12. Singaraja, R. R., S. Hadano, et al. (2002). \"HIP14, a novel ankyrin domain-containing protein, links huntingtin to intracellular trafficking and endocytosis.\" Hum Mol Genet 11(23): 2815-28. Slow, E. J., R. K. Graham, et al. (2005). \"Absence of behavioral abnormalities and neurodegeneration in vivo despite widespread neuronal huntingtin inclusions.\" Proc Natl Acad Sci U S A 102(32): 11402-7. Slow, E. J., J. van Raamsdonk, et al. (2003). \"Selective striatal neuronal loss in a YAC128 mouse model of Huntington disease.\" Hum Mol Genet 12(13): 1555-67. Soyombo, A. A. and S. L. Hofmann (1997). \"Molecular cloning and expression of palmitoyl-protein thioesterase 2 (PPT2), a homolog of lysosomal palmitoyl-protein thioesterase with a distinct substrate specificity.\" J Biol Chem 272(43): 27456-63. Steffan, J. S., N. Agrawal, et al. (2004). \"SUMO modification of Huntingtin and Huntington's disease pathology.\" Science 304(5667): 100-4. Van Raamsdonk, J. M., Z. Murphy, et al. (2005). \"Selective degeneration and nuclear localization of mutant huntingtin in the YAC128 mouse model of Huntington disease.\" Hum Mol Genet 14(24): 3823-35. Velier, J., M. Kim, et al. (1998). \"Wild-type and mutant huntingtins function in vesicle trafficking in the secretory and endocytic pathways.\" Exp Neurol 152(1): 34-40. Verkruyse, L. A. and S. L. Hofmann (1996). \"Lysosomal targeting of palmitoyl-protein thioesterase.\" J Biol Chem 271(26): 15831-6. Waelter, S., A. Boeddrich, et al. (2001). \"Accumulation of mutant huntingtin fragments in aggresome-like inclusion bodies as a result of insufficient protein degradation.\" Mol Biol Cell 12(5): 1393-407. Warby, S. C., E. Y. Chan, et al. (2005). \"Huntingtin phosphorylation on serine 421 is significantly reduced in the striatum and by polyglutamine expansion in vivo.\" Hum Mol Genet 14(11): 1569-77. Wellington, C. L., L. M. Ellerby, et al. (1998). \"Caspase cleavage of gene products associated with triplet expansion disorders generates truncated fragments containing the polyglutamine tract.\" J Biol Chem 273(15): 9158-67. Wheeler, V. C., C. A. Gutekunst, et al. (2002). \"Early phenotypes that presage late-onset neurodegenerative disease allow testing of modifiers in Hdh CAG knock-in mice.\" Hum Mol Genet 11(6): 633-40. Wyttenbach, A., O. Sauvageot, et al. (2002). \"Heat shock protein 27 prevents cellular polyglutamine toxicity and suppresses the increase of reactive oxygen species caused by huntingtin.\" Hum Mol Genet 11(9): 1137-51.  141 Zeron, M. M., O. Hansson, et al. (2002). \"Increased sensitivity to N-methyl-D-aspartate receptor-mediated excitotoxicity in a mouse model of Huntington's disease.\" Neuron 33(6): 849-60.                                       142 4. CHAPTER 4         Neuronal Palmitoyl Acyl Transferases Exhibit Distinct Substrate Specificity  A version of this chapter will be submitted for publication. Huang, K., Arstikaitis, P., Cijsouw, T., Nini, L., Singaraja, R., Yanai, A., Hayden, M.R., El-Husseini, A. Determining the substrate specificity of four neuronal palmitoyl- transferases.     143 4.1. INTRODUCTION  Protein palmitoylation represents a common lipid modification of neuronal proteins. This posttranslational change involves addition of the saturated 16 carbon palmitate lipid in a thioester linkage to specific cysteine residues. In neurons, at least 32 proteins have been  shown to be palmitoylated(el-Husseini Ael and Bredt 2002). These include channels, cell adhesion  molecules, scaffolding molecules, neurotransmitter release machinery and signaling proteins (Huang and El-Husseini 2005; Resh 2006a; Roth et al. 2006a; Linder and Deschenes 2007) as well as huntingtin(Huang et al. 2004; Yanai et al. 2006), a protein that when mutated causes Huntington disease (HD)(The Huntington's Disease Collaborative Research Group. 1993). Importantly, palmitoylation occurs in a reversible fashion, which allows palmitoylation to dynamically regulate protein function and to participate in diverse aspects of neuronal signaling (reviewed in(el-Husseini Ael and Bredt 2002; Huang and El-Husseini 2005)). For example, glutamate receptor activity regulates palmitoylation of PSD95, where the regulated addition and removal of palmitate on this postsynaptic scaffolding protein in turn regulates the synaptic retention\/removal of glutamate receptors(El-Husseini Ael et al. 2002). This process is thought to be fundamental for synaptic plasticity, the dynamic changes in the content and morphology of synapses associated with learning and memory. The identity of the protein fatty acyltransferases  (PATs) that enzymatically modify palmitoylated proteins has recently  been discovered. The defining  feature of this family of PATs is the presence of a cysteine-rich domain  (CRD) with a core Asp-His-His-Cys  144 (DHHC) motif, which is essential  for PAT activity both in vitro and in vivo(Roth et al. 2002; Fukata et al. 2004; Huang et al. 2004). Proteins with DHHC-CRD  are conserved from yeast to mammals. Genetic and biochemical  studies have identified substrates for several DHHC proteins in S. cerevisiae (Lobo et al. 2002; Roth et al. 2002), and proteomic analyses have expanded the repertoire of substrates  for this family of enzymes significantly (Roth et al. 2006a).  Mammals contain 23 DHHC proteins(Fukata et al. 2004). Their tissue distribution  and subcellular localization has recently been documented (Ohno et al. 2006). When overexpressed in HEK cells, a majority of these DHHC proteins localize to the ER, Golgi and endosomal vesicles and some also localize to the plasma membrane(Ohno et al. 2006). However, whether the localization of an enzyme directly correlates with its potential substrate is not yet known. An unanswered question is whether different PATs exhibit distinct substrate specificity and what factors may influence this selectivity. In this study, we chose four brain enriched DHHC containing enzymes, namely DHHC-3, DHHC-8, DHHC-13 (HIP14L) and DHHC-17 (HIP14), to examine these questions. The methods used to quantify protein palmitoylation involve metabolic labeling of cultured cells with radiolabeled palmitate ([ 3 H]-palmitate or [ 125 I]-palmitate) for 3-5 hours before harvesting cells and immunoprecipitating the protein(s) of interest (protocol reviewed in (Resh 2006b). The use of this approach is limited to cultured live cells as well as incubation with expensive radiolabeled palmitate for 3-5 hours. The fraction that is available for labeling is also limited by the rate of palmitate turnover on a particular protein during the labeling process. As a result, this method, not only requires weeks to months to expose the readiolabeling signal, but also only allows detection of a small  145 fraction of the total palmitoylated pool of a protein. A novel approach developed by Drisdel and Green overcomes these limitations by allowing detection of the total pool of palmitoylated proteins present in tissue extracts(Drisdel and Green 2004; Drisdel et al. 2004). This approach is known as \"fatty acyl exchange labeling\", which involves (i) blockade of free thiols with N-ethylmaleimide; (ii) cleavage of the Cys-palmitoyl thioester linkage with hydroxylamine; and (iii) labeling newly exposed thiols with a sulfhydryl-specific labeling compound, such as non-radioactive biotin-BMCC (1- biotinamido-4-[4'-(maleididomethyl) cyclohexanecarboxamido] butane)(Drisdel and Green 2004; Drisdel et al. 2004). The palmitoylated protein can then be detected by western blotting using strepdavidin or anti-biotin antibodies. This approach is highly sensitive and allows the use of a variety of probes, radiolabeled ([ 3 H]-NEM) or non- radioactive (biotin-BMCC), and facilitates quantitative estimates of the total palmitoylated pool of a specific protein. This method also allows for rapid assessment of changes in the dynamics of protein palmitoylation after stimulation of specific signaling pathways, or upon alterations in neuronal activity (Drisdel et al. 2006). Using this approach, we examined the enzymatic activity of four neuronal DHHC proteins, DHHC-3, DHHC-8, DHHC-13 and HIP14, toward several proteins. We determined that these DHHC proteins have substrate specificity\/preference, a finding that is in agreement with the loss-of-function analysis in yeast (Roth et al. 2006a). Our study also suggests that domains within the protein, other than the catalytic DHHC domain, may influence the specificity for the interaction between the enzyme and its substrate.   146 4.2. MATERIALS AND METHODS 4.2.1 Plasmid Constructions The following cDNAs were used for COS cell transfection: DHHC-3 cDNAs (Flag tagged and GFP tagged) (provided by Dr. Bernhard L\u0003scher, Penn State university), DHHC-8 in pEF-Bos-HA (provided by Dr. Masaki Fukata, National Institute for Physiological Sciences Japan and Dr. David Bredt, Eli Lilly), GluR1 and GluR2 GFP in pRK5 (provided by Dr. Takashi Hayashi, and Dr. Richard L. Huganir, Johns Hopkins University), DHHC-13 Flag and HIP14 Flag in pCIneo vector, HIP14\u2206DHHC (Flag tagged and GFP tagged) lacking amino acids 440 to 487 in pCIneo vector, HIP14\u2206ANK- GFP lacking amino acids 89 to 257 in pCIneo vector, SNAP25 in pEGFP-C1 vector, PSD95-GFP in pGW1 vector, PSD95 Flag in pcDNA3 vector, huntingtin 1-548aa in pCIneo vector, paralemmin in pEGFP-C1 vector. ANK-DHHC3 was generated by two step cloning: first, DHHC-3 cDNA was subcloned into Hind III and EcoR I sites of pEGFP N3; Then, HIP14 amino acid 1-294 was further subcloned into the BglII and HindIII sites of the previous construct. 4.2.2 Antibodies and chemicals The following  primary antibodies were used for immunocytochemistry and immunoblot (immunoreactivity and dilution  as indicated): huntingtin 2166 (mouse, 1:1000, Chemicon), HA (mouse, 1:1000, BABCO), Flag M2 (mouse, 1:1000, Sigma), GFP (rabbit, 1:1000, homemade),  GFP (rabbit, 1:2000, synaptic system), GM130 (mouse, 1:200, BD Biosciences), Calnexin (rabbit, 1:500, Sigma), EEA1 (mouse, 1:200, Abcam), PSD-95 (rabbit, 1:1000,  homemade), and synaptophysin (mouse, 1:1000, Abcam).  147 Appropriate fluorescently conjugated secondary  antibodies for immunocytochemistry were used as previously described (Prange et al. 2004). Fluorescently conjugated secondary  antibodies for immunoblotting were IRDye 800 antibody (mouse, 1:10000, Rockland) and Alexa fluor 680 antibody (rabbit, 1:10000, Invitrogen). 4.2.3 Cell Culture and Transfections All reagents for cell cultures were purchased from Invitrogen Corporation (Carlsbad, CA). COS cells were cultured as previously described(Huang et al. 2004). COS cells were transiently transfected with Lipofectamine 2000 (Invitrogen) as indicated by the manufacturers.  24 to 48 hours post-transfection, cells were processed as described for each experiment. 4.2.4 Immunocytochemistry and Imaging The coverslips were removed from culture  wells and fixed in 2% PFA. The cells were  washed three times with phosphate-buffered saline containing  0.3% Triton-X-100 before each antibody incubation. All of the  antibody reactions were performed in blocking solution (2% normal  goat or horse serum) for 1 h at room temperature or overnight  at 4 \u0004C. The coverslips were then mounted on slides (Frost Plus; Fisher) with Fluoromount-G (Southern Biotechnology Associates,  Birmingham, AL). Images were acquired on a Zeiss Axiovert M200 motorized microscope by using a monochrome 14-bit Zeiss Axiocam HR charge-coupled device camera at 1,300\u00d71,030 pixels. 4.2.5 Immunoprecipitation and Immunoblotting COS-7 cells were lysed in ice-cold buffer containing  50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% Triton,  1 mg\/ml protease  inhibitor cocktail (Roche), and 0.25 mg\/ml  148 PMSF. Cell  lysates were rotated at 4\u0004C for 30 min before the insoluble material was removed by centrifugation at 14,000 rpm for 15 min.  Lysates were  precleared by incubation with protein A+G agarose (GE health) for 45  min at 4\u0004C with rocking. Precleared samples were then incubated  with anti-GFP (3ug, rabbit, homemade) antibody at 4\u0004C for an hour, followed by incubation with 30ul of protein A agarose (GE health) for another hour. Proteins in both the  cell lysates and immunoprecipitates were heated in SDS sample  buffer before separation by SDS-PAGE. After overnight transfer  of the proteins onto nitrocellulose membranes, western blots  were performed using the antibodies described above (see Antibodies and chemicals).   4.2.6 Btn-BMCC Labeling After the immunoprecipitation, the beads were then washed with wash buffer (HEPES, containing 1%Triton X-100) supplemented with 50 mM NEM for an hour at 4\u00b0C, followed by treatment with 1 M hydroxylamine pH 7.4 for 1 hour at room temperature.  Samples were then processed as previously described (Drisdel and Green 2004). 4.2.7 Statistical Analysis The results are expressed as mean \u0005 SD. Statistical comparisons between groups were done by the t test, using the Statgraphics  Plus 5.0 program (Statistical Graphics Corp.).     149 4.3. RESULTS 4.3.1 DHHC-3, -8, -13 (HIP14L) and \u201317 (HIP14) all reside in the golgi compartment 23 DHHC containing proteins have recently been cloned. We chose four that are enriched in the brain. Previous studies have established the subcellular localizations of some of these DHHC proteins. DHHC-3 (also named GODZ) localizes to the Golgi apparatus(Uemura et al. 2002). HIP14 is primarily concentrated in Golgi apparatus but also associated with endosomal vesicles in soma and processes(Singaraja et al. 2002; Huang et al. 2004). However, in drosophila motor neurons, exogenous HIP14 localized in presynaptic terminals(Ohyama et al. 2007; Stowers and Isacoff 2007). Overall, the homology among these four DHHC proteins is restricted to the cysteine rich domain (Figure 4.1A, B), as is shown in the schematic illustration. For example, the ankyrin repeat domain, which is common in HIP14L and HIP14, is not found in either DHHC-3 or DHHC-8. Despite their distinct difference in molecular identity, when expressed in COS cells, these four proteins all colocalized with the Golgi marker GM130 (Figure 4.1C), but not with EEA1, an early endosomal marker, nor with Calnexin, an ER marker (Figure 4.2). In rat cultured Day in vitro18 hippocampal neurons, endogenous HIP14 mainly associates with the Golgi apparatus, and sparsely associates with vesicles (Huang et al. 2004). Co-immunostaining of endogenous HIP14 with a presynaptic marker synaptophysin or a postsynaptic marker PSD95 shows that HIP14 is is not obviously present in synapses (Figure 4.1D).  150  Figure 4.1. Structures and Localizations of four neuronal DHHC proteins. (A) Schematic illustration of the primary structures of the four DHHC proteins. (B) 3D schematic illustration of the primary structures of the four DHHC proteins. (C) Localization of four DHHC proteins in COS cells. Exogenous DHHC-3, DHHC-8, HIP14L and HIP14 (green) are localized in the Golgi compartment which is positive for GM130 (red), a cis-Golgi marker. (D) Localization of HIP14 in DIV 18 hippocampal neurons. Endogenous HIP14 in neurons do not  151 colocalize with either a presynaptic protein marker synaptophysin or a postsynaptic protein marker PSD95.   Figure 4.2. DHHC-3, -8, HIP14L (DHHC-13) and HIP14 do not colocalize with early endosomal marker or with ER marker. (A,B,C,D) Green Fluorescent Protein (GFP) tagged DHHC proteins were overexpressed in COS cells and stained with EAA1 (red), an early endosomal marker, or with Calnexin (red), an ER marker.   4.3.2 DHHC-3, -8, -13 (HIP14L) and \u201317 (HIP14) exhibit distinct substrate preferences To determine the level of protein palmitoylation, we used the acyl biotin exchange (ABE) assay. Unlike radioactive palmitate labeling, the ABE palmitoylation assay relies on hydroxylamine cleavage of  the thioester bond between the fatty acid and the cysteine side  chain, followed by reaction of the newly generated free sulfhydryl  with sulfhydryl- specific reagents, such as Biotin-BMCC or 3 H-NEM (Figure 4.3A). These techniques  are  152 significantly more sensitive than metabolic labeling, and can be used quantitatively to measure levels  of protein palmitoylation(Drisdel and Green 2004; Drisdel et al. 2006). Previously, this method was applied to examine the palmitoylation of SNAP25 and Nicotinic \u03b17 subunits in mammals(Drisdel and Green 2004; Drisdel et al. 2004), and then to many palmitoylated yeast proteins through proteomic analysis (Lam et al. 2006; Roth et al. 2006a). To validate this method in detecting an increase in palmitoylation of a protein by an enzyme, we used SNAP25 as a substrate upon co-expression with each of the four DHHC enzymes (Figure 4.3B).  After blocking the free thiols on SNAP25 with 50mM N-ethylmaleimide, half of the sample was treated with 1M hydroxylamine to cleave the Cys-palmitoyl thioester linkage; the other half (no hydroxylamine) served as our control. Next, the newly exposed thiols were labeled with a 10\u00b5M biotin-BMCC. After protein gel electrophoresis, nitrocellulose membranes containing SNAP25 protein were probed with strepdavidin-HRP, and palmitoylation level of SNAP25 was detected by standard ECL.  Provided that the expression of DHHC-3, DHHC-8, HIP14L and HIP14 was about equal (Figure 4.3C), DHHC-3, DHHC-8 and HIP14 significantly enhanced the palmitoylation of SNAP25 while DHHC-13 did not. Samples that were not treated with hydroxylamine, and do not have free cysteines to be re-labeled by biotin, therefore are not detected by strepdavidin (Figure 4.3B).  153  Figure 4.3. Validation of ABE-Acyl Biotin Exchange-method with substrate SNAP25. (A) A diagram of ABE procedure. First, GFP tagged SNAP25 was immunoprecipitated by GFP antibody. Next, the Protein A sepharose that contains SNAP25 was incubated with 50mM NEM at 4\u00b0C for an hour to block the free thiols. Then, 1M Hydroxylamine was used to cleave the Cys- palmitoyl thioester linkage. At last, the newly exposed free thiols were labeled with a sulfhydryl- specific labeling compound, biotin-BMCC (1-biotinamido-4-[4'-(maleididomethyl) cyclohexanecarboxamido] butane).  (B) Application of ABE method in examining the enhancement of SNAP25 palmitoylation by four DHHC proteins. Palmitoylation level is detected by strepdavidin-HRP on nitrocellular membrane. Untreated samples (-HAM) were used to estimate residual, non-specific binding of the biotin-BMCC with antibodies and sepharoses (negative control). In treated samples (+HAM), SNAP25-GFP substrate protein loading were even, yet its palmitoylation level was enhanced to different extent by DHHC-3, DHHC-8 and HIP14. DHHC-13, in contrast, did not increase SNAP25 palmitoylation. (C) Expression of DHHC-3, DHHC-8, DHHC-13 and HIP14 in COS cells were even. The stars point to the protein bands.   We next used the same approach to determine the potential substrates for these DHHC enzymes. Our group has previously demonstrated that huntingtin, in which a poly-glutamine tract expansion causes Huntington disease, is a substrate of HIP14(Huang  154 et al. 2004; Yanai et al. 2006). Using the ABE method, we now show that huntingtin can also be palmitoylated by DHHC-13, a protein that shares 57%  similarity with HIP14 (Figure 4.4A). Interestingly, DHHC-13 also interacts with huntingtin when co-expressed in COS cells (data not shown). Unlike huntingtin, palmitoylation of paralemmin, a protein implicated in spine formation (Arstikaitis et al. 2008), is specifically enhanced by DHHC-8 (Figure 4.4B). It has shown by metabolic labeling approach that DHHC-3 enhances palmitoylation of AMPA receptor GluR2 (Hayashi et al. 2005). The ABE method reveals that the AMPA receptor GluR2 is a substrate of both DHHC3 and HIP14 (Figure 4.4C). In addition to huntingtin, paralemmin and AMPA receptors, we also examined the effects of these DHHC proteins on palmitoylation of other neuronal proteins including GABAA receptor \u03b32 subunit, GAD65, and synaptotagmin VII (Figure 4.5). In accordance with published 3 H palmitate labeling results, palmitoylation of GABAA receptor \u03b32 subunit is enhanced specifically by DHHC-3 (Fang et al. 2006). All four DHHC proteins can enhance the palmitoylation of GAD65 while none of them seem to regulate the palmitoylaiton of Synaptotagmin VII.  In conclusion, individual palmitoyl transferase DHHC enzymes exhibit distinct substrate preference. However, whether each DHHC enzyme recognizes its respective substrates via specific consensus motifs is not determined.   155   Figure 4.4. Application of ABE method to identify substrate and DHHC enzyme specificity. (A) palmitoylation of huntingtin is specifically enhanced by HIP14 and HIP14L. (B) palmitoylation of paralemmin, a protein involved in inducing spines, is specifically enhanced by DHHC-8. (C) palmitoylation of AMPA receptor GluR2 subunit is specifically enhanced by DHHC-3 and HIP14. Quantification in A, B and C were controlled for the protein expression. The number of repeat was indicated in each column. The arrows point to the protein bands.   156   Figure 4.5. Palmitoylation of GAD65, GABAA receptor \u03b32 subunit, AMPA receptor GluR1 subunit and synaptotagmin VII by DHHC-3, -8, -13 and HIP14. For each panel, a representative image of at least 2 experiments is shown. (A) DHHC-3, -8, -13 and HIP14 all increases GAD65 palmitoylation in COS cells, with HIP14 being the most efficient. (B, C) DHHC-3 increases palmitoylation of GABAA receptor \u03b32 subunit and AMPA receptor GluR1 subunit in COS cells. (D) None of these four DHHC proteins influence palmitoylation of synaptotagmin VII.    157 4.3.3 Expression of DHHC proteins alters the distribution and trafficking of their respective substrates Previous studies showed that palmitoylation targets PSD-95 to a perinuclear domain (El-Husseini et al. 2000a). In agreement with this finding, we previously showed that HIP14 enhances palmitoylation dependent vesicular trafficking of huntingtin to the perinuclear region in both COS cells and neurons (Huang et al. 2004). In addition, Fukata et al demonstrated that DHHC-15, a PSD95 PAT, increased the segregation of PSD-95 to a perinuclear region (Fukata et al. 2004). In this study, we also found that DHHC-13 enhanced perinuclear accumulation of huntingtin, while DHHC-3 and DHHC-8 did not (Figure 4.6A,B). Paralemmin specifically accumulated in a perinuclear domain as a result of DHHC-8, but not DHHC-3, -13 or HIP14 overexpression (Figure 4.6A,C). Accumulation of GluR2 Receptor in the perinuclear domain was specifically mediated by DHHC-3, but not by DHHC-8, DHHC-13 or HIP14 (Figure 4.6A,D). Taken together, our results indicate that these enzymes play two closely related roles, including regulation of palmitoylation and modulation of vesicular trafficking of their respective substrate.  158  Figure 4.6. DHHC enzymes Modulates Trafficking of their respective Palmitoylated substrates. (A,B) huntingtin alone localizes to the cytoplasm in a diffuse pattern. Exogenous HIP14 and HIP14L enhance the trafficking of huntingtin into a perinuclear region, where enzyme and huntingtin colocalize. (A,C) paralemmin alone predominantly localizes to plasma membranes and slightly at the Golgi. Exogenous DHHC-8 enhances the trafficking of paralemmin into the perinuclear region where both colocalize. (A,D) DHHC-3, PAT of GluR2, also enhances the trafficking of GluR2 into the perinuclear region where the two proteins partially colocalize.   159 4.3.4 DHHC enzymes interact with their respective substrates Mounting evidence suggests that an interaction exists between a substrate and its potential palmitoylating enzyme. The interaction may be transient and mediated by palmitate when the enzyme transfers palmitate to the substrate. Alternatively it could be a long-term protein-protein interaction, as in the case of huntingtin and HIP14, which is mediated by the ankryin repeats domain (Singaraja et al. 2002). Previous results from several groups have shown that DHHC-3 interacts with its substrates GABAA receptor \u03b32 subunit and AMPA receptors when overexpressed in heterologous cell lines (Uemura et al. 2002; Keller et al. 2004). In another study, putative enzymes that palmitoylate endothelial nitric oxide synthase (eNOS) including DHHC-2, DHHC-3, DHHC-7, DHHC-8 and DHHC-21 all interact with eNOS (Fernandez-Hernando et al. 2006). We therefore examined whether the respective enzymes specifically interact with their substrates and whether this can be used as a new approach for identifying putative enzyme-substrate interactions. As is seen in Figure 4.7A, when we overexpressed paralemmin-GFP or huntingtin-GFP with HIP14 and immunoprecipitated GFP tagged substrates using a GFP polyclonal antibody, HIP14 was only found in an association with huntingtin, not with paralemmin. Likewise, when we overexpressed paralemmin-GFP or huntingtin-GFP with DHHC-8, DHHC-8 was only found in an association with paralemmin, not with huntingtin (Figure 4.7B). These results indicate that the interaction is rather specific to the enzyme and its respective substrates. In addition to paralemmin and huntingtin, SNAP-25 and PSD95, which are palmitoylated by both DHHC-3 and HIP14, also interact with these two enzymes (Figure 4.7C).  160 Next, we examined whether palmitoylation of a specific substrate is essential for its interaction with the respective enzyme. Our previous work demonstrated that palmitoylation of  PSD-95 is mediated by a short NH2-terminal consensus sequence  that critically relies on five consecutive hydrophobic amino  acids (Cys-Leu-Cys-Ile-Val) (El- Husseini et al. 2000a).  Mutations of both cysteines abolished PSD95 palmitoylation. Mutating amino  acids 4-Leu or 6-Ile to histidine and serine respectively (L4D, I6S) also significantly reduced palmitoylation (El-Husseini et al. 2000a). Interestingly, the interactions between these PSD95 mutants and HIP14 are also altered, corresponding to their level of palmitoylation (El-Husseini et al. 2000a) (Figure 4.7D).  This result suggested to us that the amino acids flanking the palmitoylated cyteines are likely to be critical for the interaction between enzyme and substrate. Next, we asked whether the palmitoylated motif of a substrate is sufficient for the interaction with the enzyme. Previous work identified that the first 13 amino acids of PSD95 are essential for its palmitoylation and correct vesicular sorting(El-Husseini et al. 2000a). Consistent with this, we also found that this short N-terminal motif of PSD95 is sufficient for the interaction with HIP14 when exogenously expressed in COS cells (Figure 4.7E). To further confirm that the DHHC enzyme recognizes the palmitoylation motif, we made a chimeric protein containing the full length PSD95 C3,5S (palm deficient mutant) and 12 amino acids of the paralemmin Carboxyl terminus that contain the palmitoylated cysteines. A coimmunoprecipitation experiment shows that this new protein, containing only the palmitoylation motif of paralemmin, is sufficient to interact with DHHC-8 (Figure 4.7F).   161  Figure 4.7. DHHC enzymes specifically interact with their respective palmitoylated substrates. (A) huntingtin, but not paralemmin, interact with HIP14. COS cells overexpressing huntingtinGFP alone, huntingtinGFP with HIP14Flag and paralemminGFP with HIP14Flag were lysed and subjected to immunoprecipitation by GFP antibody. Western blot was probed with Flag antibody to detect whether HIP14 Flag was associated with the substrates. Arrow: httGFP; arrowhead: paralemmine GFP. (B) Conversely, paralemmin, but not huntingtin, interact with DHHC-8. Arrow: httGFP; arrowhead: paralemmine GFP. Coimmunoprecipitation procedure was the same as described in (A). (C) Both SNAP25 and PSD95 coimmunoprecipitates with their palmitoylating enzymes DHHC-3 and HIP14. Arrow: DHHC3 GFP; arrowhead: HIP14 GFP. (D) Interaction of HIP14 and PSD95 requires the dual palmitoylated cysteines and the nearby amino acids. (E) PSD95 palmitoylation motif, containing amino acid 1 to 13, is sufficient to interact with HIP14. (F) paralemmin pamitoylation motif, containing the last 12 amino acid at its C terminus, is sufficient to interact with DHHC-8.   162 4.3.5 Regions distinct from the DHHC catalytic domain determines the specificity between substrates and enzymes Unlike DHHC-3 and DHHC-8, huntingtin palmitoylation enzymes, HIP14, and HIP14L, contain an ankryin repeats domain that interacts with a N-terminal fragment of huntingtin (Singaraja et al. 2002). To determine whether the ankyrin repeats domain within HIP14 plays a role in palmitoylating huntingtin, we made a new chimeric protein, which contains ankryin repeats fused to the full length DHHC-3. This chimeric protein, which mimics the HIP14 structure, is now able to interact with huntingtin and redistributes htt into a perinuclear region via a palmitoylation dependent vesicular trafficking (Figure 4.8A, B). Remarkably, this chimera is capable of enhancing the palmitoylation of huntingtin in COS cells to the same extent as HIP14 (Figure 4.8C). This result suggested a possibility that regions other than the DHHC domain of the enzyme determine the specificity between substrates and enzymes.  163   Figure 4.8. The substrate specificity is determined by specific domains of the DHHC enzymes. (A) A chimeric protein, composed of Ankyrin repeats and full length DHHC-3, is now able to interact with huntingtin. The strength of the interaction between ANK-DHHC-3 with huntingtin is comparable to that of HIP14 with huntingtin. (B) The new chimera protein ANK-DHHC-3 is now also able to accumulate huntingtin into a perinuclear region. (C) The new chimeric protein ANK-DHHC-3 is also able to palmitoylate huntingtin in COS cells. All quantifications were normalized to the protein expression.    164 4.4. DISCUSSION  The number of DHHC PATs suggested that substrate specificity would exist for each PAT. In yeast, loss-of-function analysis mapped the potential substrates of each DHHC enzyme (Roth et al. 2006a). Our study, along with others, indicates that mammalian DHHC enzymes also have substrate specificity(Tsutsumi et al. 2008). Compelling evidence has revealed that DHHC3 and the closely related DHHC7 seem to have broad substrate specificity(Tsutsumi et al. 2008). These two DHHC enzymes enhance the palmitoylation of various substrates, including PSD95, eNOS, the GABAA receptor \u03b32 subunit, SNAP25, G\u03b1s, and GAP43 (Fukata et al. 2004; Fang et al. 2006; Fernandez-Hernando et al. 2006). DHHC3 also enhances the palmitoylation of GluR receptors (Hayashi et al. 2005). In contrast, DHHC2 and DHHC15 are more specific to PSD95 and GAP43 (Fukata et al. 2004). HIP14 (DHHC-17) palmitoylates huntingtin, but also increases palmitoylation of SNAP25, PSD95, GAD65 and synaptotagmin1 in vitro (Huang et al. 2004). DHHC-8 is specific to paralemmin, and DHHC-9 and DHHC-18 are specific to H-Ras (Fukata et al. 2004; Swarthout et al. 2005). Taken together, these combined data clearly supports distinct substrate specificity of individual PATs. However, the determinants of the specific interaction between PATs and their substrates remain elusive.  One possibility is that subcellular localization of each DHHC protein may play a role in palmitoylating substrates that share the same compartments during substrate posttranslational modification and transport. Indeed, 23 DHHC enzymes showed various expression patterns in HEK cells (Ohno et al. 2006). However, the four DHHC proteins examined in this study all localize to Golgi compartment, yet exhibit  165 distinct substrate preference, suggesting other factors must be contributing to the enzyme- substrate specificity. In this study, we utilize the biotin labeling palmitoylation method to examine the level of protein palmitoylation. The disadvantage of traditional metabolic labeling method is that 3 H palmitate only labels a pool of protein that turns over rapidly during the 3-4 hour of labeling process. Therefore, if the half-life of palmitate turnover on a substrate is longer than the labeling hours, then only a proportion of the total palmitoylated protein pool is accessible with 3 H palmitate. This limitation also applies when a DHHC enzyme is coexpressed. Thus, the 3 H palmitate signal detected on the film does not reflect the total palmitoylated protein, and it may not be linearly correlated to the total palmitoylated protein. Therefore, we postulated that it is possible that two different methods may show different or even opposing results due to the limitation of 3 H palmitate labeling. Additional tools, such as generation of mice with targeted disruption of DHHC proteins or the use of specific small interference RNAs will help to definitely determine the in vivo specificity of palmitoylation substrate for each enzyme. Previous work has shown that PSD-95 transiently associates with a perinuclear membranous compartment and traffics with vesiculotubular structures(El-Husseini et al. 2000a). Trafficking of PSD-95 with these vesiculotubular structures requires dual palmitoylation. In many examples, palmitoylation of a substrate by an enzyme correlates with the ability of the enzyme to enhance the association of the substrate with perinuclear membraneous compartment and vesiculotubular structures(Fukata et al. 2004; Huang et al. 2004). This is exemplified by HIP14 with huntingtin, SNAP25 and PSD95, DHHC8 with paralemmin, DHHC3 with GluR receptors and GABAA receptor \u03b32 subunit, and  166 DHHC-15 with PSD95. Therefore, the strong recruitment of a substrate into the perinculear compartment by an enzyme can be used to predict the putative enzyme- substrate interaction. We also revealed the specificity of the interaction between an enzyme and a substrate by coimmunoprecipitation. The stable interaction of an enzyme and its substrate is palmitoylation dependent, as mutations on palmitoylated cysteines abolish the interaction. It is intriguing that the palmitoylation motif is sufficient to be recognized by the respective enzyme, which suggests that a consensus sequence may exist. However, whereas these DHHC enzymes readily form a stable complex on overexpression with their respective substrates in heterologous cells, no such complex could be detected in brain extracts ((Uemura et al. 2002; Keller et al. 2004) and data not shown). Therefore, such stable complexes detected in overexpression experiments might represent long-lived enzymatic reaction intermediates resulting from low catalytic processing of enzymes in heterologous cells (also in (Fang et al. 2006)). Nevertheless, the stable interaction between the DHHC proteins and substrates is useful for predicting the putative enzyme- substrate relationship. What determines the specificity and whether palmitoylation consensus sequences exist are not yet known. Previous analyses have prompted the classification of the 23 DHHC proteins into several subfamilies. There may be some structural correlations to enzyme specificity. Besides the catalytically critical DHHC domain, an individual DHHC protein may have regulatory regions such as the SH3 domain in DHHC6, the ankyrin repeat domain in HIP14 and HIP14L, and type II PDZ-binding motif in DHHC-3 (Tsutsumi et al. 2008)(similarly, protein kinases also share a core catalytic region and  167 differ in regulatory domains that afford differential control systems). It is conceivable that these regions may recruit specific substrates or regulators to DHHC proteins. This is exemplified in our result showing that fusing the ankyrin repeat domain to DHHC3 now nables this new protein to behave like HIP14, interacting with and palmitoylating huntingtin. It is noteworthy that DHHC protein enzyme may require binding partners to be functionally active. This was first shown in yeast that, Erf2, a yeast DHHC protein, functions as a PAT for yeast Ras2 in a complex with Erf4(Zhao et al. 2002). Recently, DHHC9 has been shown to require GCP16, a mammalian functional ortholog of Erf4, for its PAT activity toward H\/N-Ras and protein stability(Swarthout et al. 2005). Binding partners of DHHC proteins may also contribute to the substrate specificity, enzymatic kinetics, subcellular localization, and stability of some DHHC proteins as an auxiliary subunit. Catalysis of protein palmitoylation by a DHHC enzyme also seems to require the autopalmitoylation of the enzyme itself. For example, deletion of HIP14 DHHC domain, which abolishes HIP14 autopalmitoylation, also abrogates its ability to palmitoylate SNAP25 {Huang, 2004 #63}. PSD-95 PAT DHHC-15 with mutations or deletions such as AAHC-15, DHHC-15-C159S, or DHHC-15-\u2206C (aa 1\u2013238), all of which abolish autopalmitoylation, loses its ability to enhance PSD-95 palmitoylation {Fukata, 2004 #108}. These examples support the notion that the PAT activity of a DHHC enzyme correlates with its autopalmitoylation. To summarize this work, we addressed the hypothesis that neuronal PATs have distinct substrate specificity. We showed that one factor that contributes to this specificity  168 is the regulatory domains beside from catalytic DHHC domain. We also identified a consistent correlation among palmitoylation, altered distribution of a substrate by its enzyme, and the interaction between sustrate and enzyme. These detailed analysis provide further understanding of the mechanisms of DHHC enzymes.  169 4.5. BIBLIOGRAPHY The Huntington's Disease Collaborative Research Group. (1993). \"A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington's disease chromosomes. The Huntington's Disease Collaborative Research Group.\" Cell 72(6): 971-83. Arstikaitis, P., C. Gauthier-Campbell, et al. (2008). \"Paralemmin-1, a Modulator of Filopodia Induction is Required for Spine Maturation.\" Mol Biol Cell. Drisdel, R. C., J. K. Alexander, et al. (2006). \"Assays of protein palmitoylation.\" Methods 40(2): 127-34. Drisdel, R. C. and W. N. Green (2004). \"Labeling and quantifying sites of protein palmitoylation.\" Biotechniques 36(2): 276-85. Drisdel, R. C., E. Manzana, et al. (2004). \"The role of palmitoylation in functional expression of nicotinic alpha7 receptors.\" J Neurosci 24(46): 10502-10. El-Husseini, A. E., S. E. Craven, et al. (2000). \"Dual palmitoylation of PSD-95 mediates its vesiculotubular sorting, postsynaptic targeting, and ion channel clustering.\" J Cell Biol 148(1): 159-72. el-Husseini Ael, D. and D. S. Bredt (2002). \"Protein palmitoylation: a regulator of neuronal development and function.\" Nat Rev Neurosci 3(10): 791-802. El-Husseini Ael, D., E. Schnell, et al. (2002). \"Synaptic strength regulated by palmitate cycling on PSD-95.\" Cell 108(6): 849-63. Fang, C., L. Deng, et al. (2006). \"GODZ-mediated palmitoylation of GABA(A) receptors is required for normal assembly and function of GABAergic inhibitory synapses.\" J Neurosci 26(49): 12758-68. Faul, T., M. Gawlik, et al. (2005). \"ZDHHC8 as a candidate gene for schizophrenia: analysis of a putative functional intronic marker in case-control and family-based association studies.\" BMC Psychiatry 5: 35. Fernandez-Hernando, C., M. Fukata, et al. (2006). \"Identification of Golgi-localized acyl transferases that palmitoylate and regulate endothelial nitric oxide synthase.\" J Cell Biol 174(3): 369-77. Fukata, M., Y. Fukata, et al. (2004). \"Identification of PSD-95 palmitoylating enzymes.\" Neuron 44(6): 987-96. Hayashi, T., G. Rumbaugh, et al. (2005). \"Differential regulation of AMPA receptor subunit trafficking by palmitoylation of two distinct sites.\" Neuron 47(5): 709-23. Huang, K. and A. El-Husseini (2005). \"Modulation of neuronal protein trafficking and function by palmitoylation.\" Curr Opin Neurobiol 15(5): 527-35. Huang, K., A. Yanai, et al. (2004). \"Huntingtin-interacting protein HIP14 is a palmitoyl transferase involved in palmitoylation and trafficking of multiple neuronal proteins.\" Neuron 44(6): 977-86. Keller, C. A., X. Yuan, et al. (2004). \"The gamma2 subunit of GABA(A) receptors is a substrate for palmitoylation by GODZ.\" J Neurosci 24(26): 5881-91. Lam, K. K., M. Davey, et al. (2006). \"Palmitoylation by the DHHC protein Pfa4 regulates the ER exit of Chs3.\" J Cell Biol 174(1): 19-25. Linder, M. E. and R. J. Deschenes (2007). \"Palmitoylation: policing protein stability and traffic.\" Nat Rev Mol Cell Biol 8(1): 74-84.  170 Lobo, S., W. K. Greentree, et al. (2002). \"Identification of a Ras palmitoyltransferase in Saccharomyces cerevisiae.\" J Biol Chem 277(43): 41268-73. Mukai, J., H. Liu, et al. (2004). \"Evidence that the gene encoding ZDHHC8 contributes to the risk of schizophrenia.\" Nat Genet 36(7): 725-31. Ohno, Y., A. Kihara, et al. (2006). \"Intracellular localization and tissue-specific distribution of human and yeast DHHC cysteine-rich domain-containing proteins.\" Biochim Biophys Acta 1761(4): 474-83. Ohyama, T., P. Verstreken, et al. (2007). \"Huntingtin-interacting protein 14, a palmitoyl transferase required for exocytosis and targeting of CSP to synaptic vesicles.\" J Cell Biol 179(7): 1481-96. Prange, O., T. P. Wong, et al. (2004). \"A balance between excitatory and inhibitory synapses is controlled by PSD-95 and neuroligin.\" Proc Natl Acad Sci U S A 101(38): 13915-20. Resh, M. D. (2006). \"Palmitoylation of ligands, receptors, and intracellular signaling molecules.\" Sci STKE 2006(359): re14. Resh, M. D. (2006). \"Use of analogs and inhibitors to study the functional significance of protein palmitoylation.\" Methods 40(2): 191-7. Roth, A. F., Y. Feng, et al. (2002). \"The yeast DHHC cysteine-rich domain protein Akr1p is a palmitoyl transferase.\" J Cell Biol 159(1): 23-8. Roth, A. F., J. Wan, et al. (2006). \"Global analysis of protein palmitoylation in yeast.\" Cell 125(5): 1003-13. Singaraja, R. R., S. Hadano, et al. (2002). \"HIP14, a novel ankyrin domain-containing protein, links huntingtin to intracellular trafficking and endocytosis.\" Hum Mol Genet 11(23): 2815-28. Stowers, R. S. and E. Y. Isacoff (2007). \"Drosophila huntingtin-interacting protein 14 is a presynaptic protein required for photoreceptor synaptic transmission and expression of the palmitoylated proteins synaptosome-associated protein 25 and cysteine string protein.\" J Neurosci 27(47): 12874-83. Swarthout, J. T., S. Lobo, et al. (2005). \"DHHC9 and GCP16 constitute a human protein fatty acyltransferase with specificity for H- and N-Ras.\" J Biol Chem 280(35): 31141-8. Tsutsumi, R., Y. Fukata, et al. (2008). \"Discovery of protein-palmitoylating enzymes.\" Pflugers Arch. Uemura, T., H. Mori, et al. (2002). \"Isolation and characterization of Golgi apparatus- specific GODZ with the DHHC zinc finger domain.\" Biochem Biophys Res Commun 296(2): 492-6. Yanai, A., K. Huang, et al. (2006). \"Palmitoylation of huntingtin by HIP14 is essential for its trafficking and function.\" Nat Neurosci 9(6): 824-31. Zhao, L., S. Lobo, et al. (2002). \"Erf4p and Erf2p form an endoplasmic reticulum- associated complex involved in the plasma membrane localization of yeast Ras proteins.\" J Biol Chem 277(51): 49352-9.       171 5. CHAPTER 5      Huntingtin Regulates the Enzymatic Activity of the Neuronal Palmitoyl Transferase HIP14   A version of this chapter will be submitted for publication. Huang, K., Wan, J., Singaraja, R., Young, F., Yanai, A., Igarashi, Y., Davis, N.G., El- Husseini, A. and Hayden, M.R. Huntingtin regulates the enzymatic activity of the neuronal palmitoyl transferase HIP14.   172 5.1. INTRODUCTION Protein palmitoylation represents a common lipid modification of neuronal proteins. This posttranslational change involves addition of the saturated 16 carbon palmitate lipid in a thioester linkage to specific cysteine residues(Resh 1999). In neurons, at least 32 proteins have been  shown to be palmitoylated. These include channels, cell adhesion  molecules, scaffolding molecules, neurotransmitter release machinery and signaling proteins(el-Husseini Ael and Bredt 2002; Huang and El-Husseini 2005; Resh 2006a). The molecular identity of the protein fatty acyltransferases  (PATs) that modify palmitoylated proteins has recently  been determined(Lobo et al. 2002; Roth et al. 2002; Fukata et al. 2004; Huang et al. 2004). The defining  feature of this family of enzymes is the presence of a cysteine-rich domain  (CRD) with an Asp-His-His-Cys (DHHC) core motif, which is essential  for PAT activity both in vitro and in vivo. HIP14, the huntingtin interacting protein 14, is one of the 23 mammalian DHHC proteins in this family(Huang et al. 2004). Huntington disease (HD) is a neurodegenerative disorder caused by an expansion of a polyglutamine tract in the neuronal protein huntingtin (The Huntington's Disease Collaborative Research Group,1993). Recent studies by our group reveal that defective palmitoylation of mutant huntingtin contributes to the neuronal dysfunction associated with HD. In these studies we also demonstrate that the polyglutamine expansion in huntingtin results in a reduced association with HIP14. This defect causes a marked reduction in huntingtin palmitoylation both in vitro and in whole mouse brain, which further accelerates inclusion formation and enhances neuronal toxicity and cell death. Downregulation of HIP14 in mouse neurons expressing wildtype and mutant huntingtin  173 increases inclusion formation, whereas overexpression of HIP14 substantially reduces inclusions. Taken together, these results indicate that loss of palmitoylation exacerbates huntingtin protein aggregation and contributes to the molecular pathology of HD. In vitro, HIP14 palmitoylates other neuronal substrates, including PSD95 and SNAP25 (Huang et al. 2004). However, in contrast to the stable association of HIP14 and huntingtin, there is no detectable interaction between HIP14 and PSD95 or SNAP25 examined by coimmunoprecipitation experiments from brain lysate (data not shown). This suggested to us that huntingtin may function beyond only being a substrate of HIP14. Although polyglutamine expansion of mutant huntingtin has been shown to disrupt various cellular events such as gene transcription and intracellular transport, little is known about the function of wildtype huntingtin. In this study we investigated how normal huntingtin may be involved in regulating the enzymatic activity of HIP14. 5.2. MATERIALS AND METHODS 5.2.1 Plasmids All DHHC constructs were previously described and were generously provided by Dr. Yasuyuki Igarashi (Ohno et al. 2006). Full length HIP14 was subcloned into pCI-neo as described earlier (Singaraja et al. 2002). HIP14 GFP was generated by fusing EGFP (Clontech, CA) at its C-terminus, and HIP14-Flag was generated by PCR using primers containing the FLAG sequence. HIP14\u2206DHHC was generated by deletion of nucleotides encoding amino acids 440 to 487. HIP14\u2206ANK was generated by deletion of the Ankyrin repeats, nucleotides encoding amino acids 89 to 257. GST-SNAP25 fusion proteins were PCR amplified and subcloned into EcoR I\/Sal I of pGEX-6P3 (Amersham Biosciences,  174 UK). HIP14-GST was generated by insertion of full length HIP14 cDNA in frame with GST into pGEX-6P3 at Xma I site. For the generation of GST-GAD65 (1-80aa), nucleotide sequences corresponding to GAD65 amino acids 364-383 were PCR amplified and subcloned into BamH I and Xho I sites of pGEX-4T1 (Amersham). PSD95 (1-PDZ3) in pGEX-2T was a gift from Dr. David Bredt (University of California at San Francisco, CA). Truncated huntingtin constructs N548 were previously described(Singaraja et al. 2002). Cysteine substitutions were generated by PCR based site-directed mutagenesis as described earlier (Singaraja et al. 2002).  All mutated DNA constructs were sequence confirmed. 5.2.2 Antibodies and Chemicals htt antibody 2166 (Chemicon;1:250 for immunoprecipitation, 1:2000 for western blotting), HIP14 anti-rabbit antibody (homemade; 1:50 for immunoprecipitation, 1:250 for western blotting), GFP anti-rabbit antibody (homemade, 1:100 for immunoprecipitation),  GFP anti-rabbit antibody(Synaptic System, 1:2000 for western blotting), paralemmin (provided by Dr. Manfred Kilimann), Ras, PSD95 (homemade, 1:500 for western blotting), SNAP25 (Stressgen, 1:1000 for western blotting and 1:500 for immunoprecipitation), GAD65 (Synaptic System, 1:1000 for western blotting), SYT1 (Synaptic System, 1:1000 for western blotting and 1:500 for immunoprecipitation), AKAP150, GluR1 (provided by Dr. Yutian Wang), GluR2 (provided by Dr. Yutian Wang), SCAMP (Upstate Biotech, 1:1000 for western blotting), Syntaxin 1B (Synaptic system, 1:1000 for western blotting), Glutamate Transporter 1 (EAAC1) (Chemicon, 1:1000 for western blotting).   175  5.2.3 Western blotting analysis Primary antibodies were applied for an hour at room temperature in Odyssey blocking buffer (Li-COR Bioscience); the secondary antibodies (anti-rabbit IRD800, Anti-Mouse Alexa Fluor 680) (Rockland) were used in a ratio of 1:10000. The signal was scanned using Odyssey Infrared Imaging System (Li-COR Bioscience), and quantified by means of Image J software. A distribution profile was calculated with Excel software (Microsoft Office) as the average value \u00b1 SD from at least 3 independent experiments. Data were analyzed by Student T test. 5.2.4 Cell culture and transfections All reagents for cell cultures were purchased from Invitrogen Corporation (Carlsbad, CA). COS cells were cultured as previously described (Huang et al. 2004) and were transiently transfected with Lipofectamine 2000 (Invitrogen) as indicated by the manufacturers.  24 to 48 hours post transfection, cells were processed as described for each experiment. Cultured cortical neurons were prepared as previously described (Huang et al. 2004) and experiments were performed at 14 days in vitro (DIV). 5.2.5 Synthesis of Palmitoyl CoA [ 3 H]palmitoyl-CoA, [ 3 H]myristoyl-CoA and palmitoyl-CoA were synthesized enzymatically from [9,10- 3 H(N)]palmitic acid (5 mCi\/ml; Perkin Elmer Life Sciences), [9,10- 3 H(N)]myristic acid (1mCi\/ml; Perkin Elmer Life Sciences) and palmitic acid (Sigma-Aldrich), respectively. Synthesis components also included co-enzyme A (CoA), ATP and acyl-CoA synthase (Sigma-Aldrich). Synthesized products were purified as  176 previously described (Dunphy et al. 1996). Synthesized [ 3 H]palmitoyl-CoA and [ 3 H]myristoyl-CoA were subjected to TLC (TLC aluminium sheet, silica gel, EM Science, Germany) to determine the efficiency. Ninhydrin Staining was used for the detection of synthesized non-radiolabeled palmitoyl-CoA. The synthesis was highly efficient, with >95% conversion of acid to fatty acid-CoA. Specific activity for [ 3 H]palmitoyl-CoA was 60 Ci\/mmol and for [ 3 H]myristoyl-CoA was 30Ci\/mmol. 5.2.6 Immunoprecipitation Brains from wildtype and huntingtin-\/- mice were homogenized in 50mM Tris and 150mM NaCl, containing 1% Igpal, protease inhibitors (Roche), and ZVAD. Tissue debris were removed by centrifuging the brain lysate at 45000rpm, 4\u00baC for 30min. Normal rabbit IgG, or anti-HIP14 rabbit polyclonal antibody were incubated with 3mg precleared lysate at 4\u00baC for 1 hour. 30\u00b5l of equilibrated Protein A Sepharose 4 Fast Flow beads were added and samples were further incubated at 4\u00baC for 2 hours. Beads were washed 3-6 times with buffer containing 50mM Tris and 150mM NaCl. Residual buffer in the beads was taken away by thin gel loading tips. 5.2.7 Palmitoylation Assay Palmitoylation reaction (60 \u00b5l) contained 5 \u00b5Ci of [ 3 H]palmitoyl-CoA, 0.33 \u00b5g\/\u00b5l substrate protein, 1 mM ATP, 50 mM MES, pH 6.4, 0.2 mg\/ml bovine liver lipids, and 20\u00b5l of the Protein A Sepharose beads containing HIP14 immunoprecipitates from the brain. After 15min incubation at 37\u00b0C, sample buffer was added with final concentration of 5mM DTT was added and samples were subjected to SDS-PAGE analysis.   177  5.2.8 Btn-BMCC labeling COS cells overexpressing htt alone or htt with individual DHHC proteins were lysed and processed for immunoprecipitation as described above. The beads were then washed with wash buffer (PBS, containing 1%Triton X-100) supplemented with 50 mM NEM, followed by treatment with 1 M hydroxylamine pH 7.4 for 1 hour at room temperature.  Samples were then processed as previously described(Drisdel and Green 2004). 5.2.9 Yeast 2 hybrid analysis The series of truncated huntingtin constructs (Hackam et al. 1998) were inserted into the yeast expression vector pGBT and sequences were verified. Yeast transformations with pGADHIP14 and each pGBT9 huntingtin constructs were performed using the lithium acetate method (Gietz et al. 1995). To detect the intensity of interaction, liquid \u03b2-galactosidase assays were performed by inoculating 3 individual colonies from each transformation in liquid leu - trp -  media. After overnight growth at 30\u00bac, cells were pelleted, washed and resuspended in Z buffer (0.06 M Na2HPO4, 0.04M NaH2PO4, 10mM KCl), and frozen and thawed three times. Z buffer supplemented with 20% SDS, 1M DTT, \u03b2-mercaptoethanol and O-Nirophenyl \u03b2-D-galactopyranoside were added to the tubes and reactions continued until a yellow colour appeared. Reactions were stopped by adding 1M Na2CO3 and spun to remove cell debris. The intensity of the reaction was quantified at OD420 and relative units calculated using the formula Relative units=(1000*OD420)\/(time*concentration factor*volume of lysate*yeast cell density).  178  5.3. RESULTS 5.3.1 Huntingtin and HIP14 form a tight complex that has enzymatic activity We previously showed that HIP14 is a palmitoyl transferase for SNAP25 (Huang et al. 2004). Consistent with this, immunoprecipitated HIP14 from cortical neurons (Figure 5.1A left) and brain (Figure 5.1B left) exhibited palmitoyl transferase activity toward GST-SNAP25 in vitro. When we immunoprecipitated (IP) huntingtin from cortical neurons (Figure 5.1A right) and brain (Figure 5.1B right), the resulting immunoprecipitate also increased palmitoylation of GST-SNAP25. This suggested to us that huntingtin\u2019s binding partner, HIP14, was co-IPed and resulted in PAT activity. Western blots (Figure 5.1A, B bottom panels) confirmed that, in all IPs, the respective binding partner was co-IPed. .  These results suggest that huntingtin and HIP14 form a tight complex that contains enzymatic activity.  179  Figure 5.1. huntingtin and HIP14 form a complex in the brain. (A, B) In cultured rat cortical neurons and the whole rat brain, immunoprecipitated (IP) HIP14 or huntingtin forms a tight complex, exhibiting palmitoyl transferase activity toward GST-SNAP25 in vitro.  5.3.2 Only HIP14 and HIP14L palmitoylate huntingtin We have previously shown that palmitoylation of huntingtin by HIP14 is essential for its trafficking and function (Yanai et al. 2006). The identification of 22 other DHHC proteins in this PAT family raised the questions as to whether other DHHC proteins may palmitoylate huntingtin and whether the tight association of huntingtin and its PAT HIP14 is unique. We therefore, applied the ABE (Acyl Biotin Exchange) labeling method to examine the palmitoylation level of huntingtin upon expression of individual DHHC proteins in COS cells. Both HIP14 (DHHC-17) and HIP14L (DHHC-13), a homolog of HIP14, are the only two PATs that significantly increase palmitoylation of huntingtin (Figure 5.2A,B). Examining the internal structures of the 23 DHHC proteins reveals that only HIP14 and HIP14L contain an ankryin repeats domain, which appears to mediate  180 these enzymes binding to huntingtin(Fukata et al. 2004; Ohno et al. 2006; Tsutsumi et al. 2008).  Figure 5.2. Among DHHC proteins, only HIP14 and HIP14L palmitoylate huntingtin. (A) COS cells overexpressing either huntingtin alone or huntingtin with individual DHHC protein were subject to the biotin palmitoylaiton labeling assay. Among the indicated DHHC proteins, only HIP14L (DHHC-13) and HIP14 (DHHC-17) palmitoylate huntingtin. (B) Quantification of huntingtin palmitoylation increase by individual DHHC protein. HIP14L and HIP14 increase huntingtin palmitoylaiton about 2.5 folds. The numbers in the columns of the graph indicate the repeat times.   5.3.3 Interaction of HIP14 and huntingtin is distinct from other palmitoylation enzyme-substrate interaction We previously showed that the interaction of a PAT with its substrate requires the presence of the palmitoylated cysteines and its surrounding amino acids. For instance,  181 mutations of PSD95 C3,5S, L4D and I6S which abolish or reduce palmitoylation significantly (El-Husseini et al. 2000a) also abrogate or decrease the interaction of PSD95 with HIP14 (see Figure 4.7D). Similarly, other groups reported that mutations of eNOS such as C15\/26S eNOS and L2S eNOS (both N-myristoylated  but not palmitoylated) disrupted the interaction with its palmitoylation enzymes DHHC-3 and DHHC-21 (Fernandez-Hernando et al. 2006). In contrast to PSD95 and eNOS, huntingtin C214S mutation, despite a compromise in palmitoylation, remained strongly associated with its PAT HIP14 (Figure 5.3A). This result suggests that, unlike other substrate and enzyme interaction that might be transient, the association between huntingtin and HIP14 is very stable, and does not require the palmitoylated cysteine. To determine the interacting domains between huntingtin and HIP14, we generated HIP14 constructs lacking either the ankryin repeats domain or the catalytic DHHC domain. We found that deletion of the ankyrin repeats greatly reduced the interaction between HIP14 and the N-terminal fragment of huntingtin, whereas deletion of HIP14\u2019s catalytic DHHC domain preserved the interaction (Figure 5.3B). Therefore, this particular interaction does not require the catalytic domain, which also differs from other substrate- PAT association such as eNOS and DHHC-21. Mutations in the DHHC catalytic domain of DHHC-21 abolishes interaction of eNOS and DHHC-21(Fernandez- Hernando et al. 2006). Furthermore, using yeast-2-hybrid, we mapped the region that is required for the interaction to be downstream of amino acid 427 in huntingtin, a region not including huntingtin\u2019s palmitoylation site (Cysteine 214; Figure 5.3C,D). The tight association of HIP14 with wild type huntingtin, which differs from other known PAT- substrate interactions, suggests that huntingtin may play a role in regulating HIP14\u2019s  182 palmitoyl transferase activity.  Figure 5.3. The interaction of HIP14 and htt requires ankyrin repeats domain and is palmitoylation independent. (A) In COS cells, exogenous wt htt (1-548aa) interacts with HIP14. Mutation of the palmitoylated cysteine does not affect the interaction with HIP14, suggesting that palmitoylation of htt is not required for the interaction. (B) Deletion of Ankyrin repeats significantly reduces the association of HIP14 and huntingtin. In contrast, deletion of DHHC catalytic domain does not affect the interaction. (C, D) Yeast 2 hybrid semiquantitative \u03b2-galactosidase assays to map the region of htt to which HIP14 binds. (C) The strength of interaction is indicated by a semiquantitative scale of colony growth with +, and - indicating strong and no growth, respectively, indicating that HIP14 interacts specifically with a region of htt encompassing aa427 to 548. (D) HIP14 showed strong interaction with wt htt (18CAG) containing aminoacids 1 to 548. The interaction of HIP14 with mutant htt (128CAG) on the 1-548aa fragment was significantly reduced, indicating that the efficiency of the interaction between HIP14 and mutant htt is reduced. The interaction of HIP14 with the 1-427aa htt fragment containing both 18 and 128 CAG was significantly reduced compared to its interaction with the 548aa fragment. No interaction between HIP14 and the further truncated 224, 151, 88 and 40 aa htt fragments were observed. Thus HIP14 interacts specifically with a region of htt encompassing aa427 to 548. 3 independent experiments were performed to obtain the statistical analysis.  183  5.3.4 Palmitoylation of GST-SNAP25 by GST-HIP14 is potentiated in vitro in the presence of wildtype but not mutant huntingtin To examine whether huntingtin can modulate HIP14\u2019s activity toward other substrates, we used an in vitro palmitoylation assay, in which both substrate (SNAP25) and enzyme (HIP14) were fused to GST and purified using bacteria. In vitro, HIP14 alone enhanced GST-SNAP25 palmitoylation by about 70%. In the presence of COS cell lysate that expressed wildtype N-terminal fragment huntingtin (amino acids 1-548), palmitoylation of GST-SNAP25 by HIP14 was further significantly enhanced. In contrast, mutant N-terminal fragment huntingtin was not capable of potentiating HIP14 activity (Figure 5.4A,B). These results were reproduced with full-length huntingtin (Figure 5.4C,D).  184  Figure 5.4. Huntingtin (htt) increases HIP14 activity to palmitoylate GST-SNAP25 in vitro. (A) Representative blot showing that GST-HIP14 could enhance palmitoylation of GST-SNAP25 in the presence of N terminal fragment wt htt (1-548aa), but not mutant htt. (B) Quantification showing that GST-HIP14 could enhance palmitoylation of GST-SNAP25 by 70%. In the presence of wt htt, HIP14 activity was further potentiated by about 2 folds. (C) Representative blot showing that GST-HIP14 could enhance palmitoylation of GST-SNAP25 in the presence of full length wt htt (1-548aa), but not mutant htt. (D) Quantification showing that HIP14 activity was further potentiated by 2 folds with full-length wt htt, but not mutant htt.  185 Similarly, palmitoylation of PSD-95(1-PDZ2) and GST-GAD65(1-80aa) by GST- HIP14 was also potentiated in vitro in the presence of wildtype huntingtin but not mutant huntingtin (Figure 5.5). To validate these in vitro palmitoylation assays, we reproduced the results in two similar paradigms. First, we used immunoprecipitated huntingtin from COS cell lysate expressing huntingtin (Figure 5.5). Second, HIP14 and huntingtin were expressed in COS cells and immunoprecipitated as a complex (Figure 5.5). In both paradigms, HIP14 enhanced the palmitoylation of PSD95 only in the presence of wildtype huntingtin (Figure 5.5). Next, we expressed DHHC-3 and huntingtin in COS cells and immunoprecipitated DHHC-3 as an enzyme to palmitoylate GST-SNAP25. Huntingtin was unable to further enhance the activity of DHHC-3 (Figure 5.6A). Furthermore, GAD-65, a substrate of HIP14, was not able to enhance the activity of HIP14 (Figure 5.6B). These results indicate that the ability of huntingtin to regulate HIP14 enzymatic activity is a unique feature of the two proteins. Next, we expressed GAD65, HIP14 and normal huntingtin in COS cells and palmitoylation of GAD65 was measured by the ABE assay. Palmitoylation of GAD65 by HIP14 was also further potentiated by wildtype huntingtin (Figure 5.7).  186  Figure 5.5. Palmitoylation of PSD95 and GAD65 by HIP14 in vitro can also be enhanced by huntingtin. We showed that huntingtin could potentiate HIP14 activity to palmitoylate PSD95 in vitro with three different approaches. (A) purified GST-HIP14 and COS cell lysate overexpressing huntingtin. (B) purified GST-HIP14 with IPed huntingtin from COS cell lysate overexpressing huntingtin. (C) IPed HIP14 and huntingtin complex from COS cell lysate overexpressing both. (D) in vitro palmitoylation of GST-GAD65 (1-80aa) by GST-HIP14 is also enhanced in the presence of IPed huntingtin from COS cell lysate overexpressing huntingtin.   187  Figure 5.6. Potentiation of enzymatic activity by huntingtin is unique to HIP14. (A) DHHC-3 enzymatic activity to palmitoylate GST-SNAP25 is not affected by either wt htt or mutant htt. Moreover, full length or N terminus truncated htt itself does not exhibit palmitoylation enzymatic activity. (B) The ability to potentiate HIP14 enzymatic activity is specific to huntingtin. GAD65, which is also a palmitoylation substrate of HIP14, does not increase HIP14 activity to palmitoylate GST-SNAP25 in vitro.     188 Figure 5.7. Palmitoylation of GAD65 by HIP14 in COS cells can also be enhanced when wt huntingtin is co-expressed. (A) COS cells overexpressing GAD65-GFP alone or with HIP14 and huntingtin were subject to ABE assay to access the palmitoylation level of GAD65. (B) Quantification showed that HIP14 normally enhanced palmitoylation of GAD65 by 75%, whereas presence of wildtype huntingtin further potentiated HIP14 activity by another fold.  5.3.5 HIP14 activity in mice lacking wildtype huntingtin (huntingtin+\/-) is significantly reduced If HIP14 activity were indeed enhanced by wildtype huntingtin in vivo, then reduced huntingtin level would be expected to impair HIP14\u2019s enzymatic activity toward other substrates. To test this hypothesis, we immunoprecipitated HIP14 from the brain lysate of wildtype mice and heterozygous mice with targeted deletion of huntingtin (huntingtin+\/-), and performed the in vitro palmitoylation assay on GST-SNAP25. Indeed, HIP14 from these mice exhibited less enzymatic activity toward GST-SNAP25 (Figure 5.8). Next, we applied the ABE method to examine the global palmitoylation changes in huntingtin +\/- mice and determined palmitoylation of a number of presynaptic and postsynaptic proteins was reduced. These include SNAP25, SynaptotagminI, GAD65, SCAMP, the glutamate transporter and PSD95 (Figure 5.9). To validate these results, immunoprecipitation of individal substrates, including SNAP25 and PSD95, were performed and the palmitoylation level of these proteins in wildtype and huntingtin+\/- mice brains was examined (Figure 5.10). Indeed, similar reduction of SNAP25 and PSD95 palmitoylation was observed in  mice expressing reduced level of huntingtin. In agreement with the in vitro palmitoylation data, these results suggest that, in vivo, huntingtin plays a role in maintaining the normal HIP14 enzymatic activity.  189  Figure 5.8. HIP14 from huntingtin+\/- mice exhibits less palmitoylation enzyme activity toward GST-SNAP25. (A) Western blot of the brain lysate from huntingtin+\/- mice showed reduced huntingtin expression but normal HIP14 expression, compared to wt mice. (B) Quantification revealing approximately 60% reduction of huntingtin expression level in huntingtin+\/- mice brain. N=3. (C) Representative image showing immunoprecipitated HIP14 of huntingtin+\/- mice brain lysate exhibited less enzyme activity to palmitoylate GST-SNAP25, compared to that of wt mice. (D) Quantification revealing that purified HIP14 from huntingtin+\/- mice brain showed approximately 30% reduction in activity. The numbers in the columns of the graph indicate the repeat times.   190  Figure 5.9. Global analysis of palmitoylation reveals palmitoylation defect in a number of neuronal proteins in huntingtin+\/- mice. (A,B) ABE assay was performed on wt and huntingtin+\/- mice brain to precipitate all the palmitoylated proteins. Samples were then subject to electrophoresis and western blotting analysis. Quantification and representative blots showed alteration in palmitoylation of a number of neuronal proteins, predominantly presynaptic.   191    Figure 5.10. Confirmation of PSD95 and SNAP25 palmitoylation defect in huntingtin+\/- mice by ABE assay. Brain lysate from 3 wt and 3 huntingtin+\/- mice were subject to PSD95 or SNAP25 immunoprecipitation followed by ABE assay. Quantification showed a 25% reduction in PSD95 palmitoylation and a 40% reduction in SNAP25 palmitoylation in huntingtin+\/- mice.      192 5.4. DISCUSSION Huntingtin is associated with membranes (Kim et al. 2001; Kegel et al. 2005; Suopanki et al. 2006)including caveolae(Trushina et al. 2006), clathrin coated vesicles(DiFiglia et al. 1995), and other endosomal compartments (Velier et al. 1998). Huntingtin also associates with microtubules (Hoffner et al. 2002) and other organelles such as the endoplasmic reticulum (ER) and Golgi (Rockabrand et al. 2007). The widespread regional distribution and subcellular localization of huntingtin does not help define a precise function in any specific compartment of the cell. However, a number of different functions have been proposed for wildtype huntingtin (reviewed in (Cattaneo et al. 2005)): i) It is a scaffolding molecule which binds to many proteins; ii) It is directly and indirectly involved in regulating gene expression; iii) It is also responsible for intracellular transport of some proteins; iv) It is required for normal embryonic development. Our study shows that huntingtin, beyond these proposed functions, can regulate the enzymatic activity of one of its binding partners, the neuronal palmitoyl transferase HIP14. The association of huntingtin with HIP14 in the Golgi and other endosomal compartments suggests that these may be the subcellular locations where huntingtin regulates HIP14 activity. It has been previously shown that some DHHC enzymes must form complexes with other proteins in order to be functional PATs. The yeast DHHC protein Erf2 has to form a complex with Erf4 in order to palmitoylate the yeast Ras. In mammals, DHHC9 and GCP16 display the properties of a functional human ortholog of the yeast Ras palmitoyltransferase. Therefore, binding partners of some DHHC proteins may determine  193 the substrate specificity, enzymatic kinetics, subcellular localization, and stability of these DHHC proteins as an auxiliary subunit. Our finding that huntingtin plays an auxiliary subunit role in regulating HIP14\u2019s enzymatic activity is very intriguing because of the relative large three-dimensinal structure of huntingtin protein. Future studies are needed to examine the crystal structures of huntingtin and HIP14.   Such studies may help determine how this interaction facilitates the palmitoylation of other proteins by HIP14. It is also worth noting that examination of global palmitoylation level changes reveal palmitoylation deficiency of a number of neuronal proteins, most of which are presynaptic proteins involved in neurotransmitter release and uptake. These proteins could directly be the in vivo substrates of HIP14, or indirectly affected by lack of palmitoylation of other proteins. It is still to be determined how the predominant palmitoylation deficiency in these presynaptic proteins correlates with the phenotype observed in huntingtin+\/- mice. However, our results do complement two recent Drosophila HIP14 knockout studies, both of which identify a role of the Drosophila HIP14 in neurotransmitter release. The drosophila studies also reveal that two exocytic components-cysteine string protein (CSP) and SNAP25-are severely mislocalized at hip14 mutant synapses, suggesting these are the two in vivo substrate of drosophila HIP14. In huntingtin+\/- mice, however, palmitoylation of CSP is not affected. This may be due to the fact that DHHC proteins have different substrate preference in different organisms. Therefore, generation and characterization of HIP14-\/- mice will provide a better knowledge of the in vivo substrates of HIP14 in mammals.  194 5.5. BIBLIOGRAPHY The Huntington's Disease Collaborative Research Group.(1993). \"A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington's disease chromosomes. \" Cell 72(6): 971-83. Cattaneo, E., C. Zuccato, et al. (2005). \"Normal huntingtin function: an alternative approach to Huntington's disease.\" Nat Rev Neurosci 6(12): 919-30. DiFiglia, M., E. Sapp, et al. (1995). \"Huntingtin is a cytoplasmic protein associated with vesicles in human and rat brain neurons.\" Neuron 14(5): 1075-81. Drisdel, R. C. and W. N. Green (2004). \"Labeling and quantifying sites of protein palmitoylation.\" Biotechniques 36(2): 276-85. Dunphy, J. T., W. K. Greentree, et al. (1996). \"G-protein palmitoyltransferase activity is enriched in plasma membranes.\" J Biol Chem 271(12): 7154-9. El-Husseini, A. E., S. E. Craven, et al. (2000). \"Dual palmitoylation of PSD-95 mediates its vesiculotubular sorting, postsynaptic targeting, and ion channel clustering.\" J Cell Biol 148(1): 159-72. el-Husseini Ael, D. and D. S. Bredt (2002). \"Protein palmitoylation: a regulator of neuronal development and function.\" Nat Rev Neurosci 3(10): 791-802. Fernandez-Hernando, C., M. Fukata, et al. (2006). \"Identification of Golgi-localized acyl transferases that palmitoylate and regulate endothelial nitric oxide synthase.\" J Cell Biol 174(3): 369-77. Fukata, M., Y. Fukata, et al. (2004). \"Identification of PSD-95 palmitoylating enzymes.\" Neuron 44(6): 987-96. Gietz, R. D., R. H. Schiestl, et al. (1995). \"Studies on the transformation of intact yeast cells by the LiAc\/SS-DNA\/PEG procedure.\" Yeast 11(4): 355-60. Hackam, A. S., R. Singaraja, et al. (1998). \"The influence of huntingtin protein size on nuclear localization and cellular toxicity.\" J Cell Biol 141(5): 1097-105. Hoffner, G., P. Kahlem, et al. (2002). \"Perinuclear localization of huntingtin as a consequence of its binding to microtubules through an interaction with beta-tubulin: relevance to Huntington's disease.\" J Cell Sci 115(Pt 5): 941-8. Huang, K. and A. El-Husseini (2005). \"Modulation of neuronal protein trafficking and function by palmitoylation.\" Curr Opin Neurobiol 15(5): 527-35. Huang, K., A. Yanai, et al. (2004). \"Huntingtin-interacting protein HIP14 is a palmitoyl transferase involved in palmitoylation and trafficking of multiple neuronal proteins.\" Neuron 44(6): 977-86. Kegel, K. B., E. Sapp, et al. (2005). \"Huntingtin associates with acidic phospholipids at the plasma membrane.\" J Biol Chem 280(43): 36464-73. Kim, Y. J., Y. Yi, et al. (2001). \"Caspase 3-cleaved N-terminal fragments of wild-type and mutant huntingtin are present in normal and Huntington's disease brains, associate with membranes, and undergo calpain-dependent proteolysis.\" Proc Natl Acad Sci U S A 98(22): 12784-9. Lobo, S., W. K. Greentree, et al. (2002). \"Identification of a Ras palmitoyltransferase in Saccharomyces cerevisiae.\" J Biol Chem 277(43): 41268-73.  195 Ohno, Y., A. Kihara, et al. (2006). \"Intracellular localization and tissue-specific distribution of human and yeast DHHC cysteine-rich domain-containing proteins.\" Biochim Biophys Acta 1761(4): 474-83. Resh, M. D. (1999). \"Fatty acylation of proteins: new insights into membrane targeting of myristoylated and palmitoylated proteins.\" Biochim Biophys Acta 1451(1): 1-16. Resh, M. D. (2006). \"Palmitoylation of ligands, receptors, and intracellular signaling molecules.\" Sci STKE 2006(359): re14. Rockabrand, E., N. Slepko, et al. (2007). \"The first 17 amino acids of Huntingtin modulate its sub-cellular localization, aggregation and effects on calcium homeostasis.\" Hum Mol Genet 16(1): 61-77. Roth, A. F., Y. Feng, et al. (2002). \"The yeast DHHC cysteine-rich domain protein Akr1p is a palmitoyl transferase.\" J Cell Biol 159(1): 23-8. Singaraja, R. R., S. Hadano, et al. (2002). \"HIP14, a novel ankyrin domain-containing protein, links huntingtin to intracellular trafficking and endocytosis.\" Hum Mol Genet 11(23): 2815-28. Suopanki, J., C. Gotz, et al. (2006). \"Interaction of huntingtin fragments with brain membranes--clues to early dysfunction in Huntington's disease.\" J Neurochem 96(3): 870-84. Trushina, E., R. D. Singh, et al. (2006). \"Mutant huntingtin inhibits clathrin-independent endocytosis and causes accumulation of cholesterol in vitro and in vivo.\" Hum Mol Genet 15(24): 3578-91. Tsutsumi, R., Y. Fukata, et al. (2008). \"Discovery of protein-palmitoylating enzymes.\" Pflugers Arch. Velier, J., M. Kim, et al. (1998). \"Wild-type and mutant huntingtins function in vesicle trafficking in the secretory and endocytic pathways.\" Exp Neurol 152(1): 34-40. Yanai, A., K. Huang, et al. (2006). \"Palmitoylation of huntingtin by HIP14 is essential for its trafficking and function.\" Nat Neurosci 9(6): 824-31.    196      6. CHAPTER 6   Conclusions  197 6.1. SUMMARY OF FINDINGS The objective of this thesis was to conduct molecular and cell biological studies to identify HIP14 as a neuronal palmitoyl transferase, determine whether huntingtin palmitoylation was regulated by HIP14, and examine what role huntingtin might play in HIP14 enzymatic activity and whether this role is implicated in the disease. The first specific goal was to identify HIP14 as a neuronal palmitoyl acyl transferase (PAT). To do this, we adapted the in vitro palmitoylation assay from yeast to the mammalian system. In this in vitro palmitoylation, we showed that GST-HIP14 was able to transfer 3 H Palmitoyl from synthesized 3 H Palmitoyl-CoA onto the cysteines of GST-SNAP25, synaptotagmin I, GAD65 and PSD95. We also found that, in both COS cells and neurons, palmitoylation dependent trafficking of these neuronal proteins were altered by overexpression or knockdown of HIP14, in agreement with the in vitro palmitoylation result. From this study, we also believed that huntingtin, through binding to HIP14, could be palmitoylated by HIP14 in vivo. This study led to the second specific goal of my thesis. The second specific goal was to determine whether huntingtin is palmitoylated by HIP14, which cysteines are the palmitoylation sites, whether huntingtin palmitoylation is implicated in pathogenesis of HD and what role HIP14 plays in huntingtin trafficking and function. We demonstrate that huntingtin is palmitoylated by HIP14 primarily at Cysteine 214. Expansion of the polyglutamine tract in mutant huntingtin reduces its association with HIP14 and results in decreased palmitoylation of huntingtin, which contributes to the formation of inclusion bodies and enhanced neuronal toxicity. By manipulating  198 HIP14 level through overexpression or knockdown, we can manipulate the number of huntingtin inclusion bodies and neuronal cell viability. The existence of 23 DHHC proteins as palmitoyl transferases which all contain a cysteine rich catalytic domain led to the third specific goal of this thesis. Why are so many PATs required in mammals? Is there substrate specificity? What determines the substrate preference of these DHHCs? We were able to apply the new technique, acyl biotin exchange palmitoylation assay to examine the substrate specificity of four brain expressed DHHCs, namely DHHC-3, DHHC-8, DHHC-13 (HIP14L) and DHHC-17 (HIP14). They exhibit distinct substrate preference, with DHHC-3 showing the least substrate specificity. These DHHCs interact with their respective substrates in a manner that requires the presence of the palmitoylated cysteines and proper surrounding amino acids. By adding the ankryin repeat domain of HIP14 to DHHC-3, we reveal that a region other than the catalytic DHHC domain probably determines substrate preference. The fourth specific goal of this thesis was to examine whether wildtype huntingtin functions in regulating HIP14 enzymatic activity. The tight association between huntingtin and HIP14 distinguishes them from other known substrate and PAT pairs, which led us to hypothesize that huntingtin may function beyond being a substrate of HIP14. Determining a specific function for wildtype huntingtin proves to be a challenging task considering the complex and multiple functions of huntingtin, and lack of a defined functional assay. However, we were able to show that, both in vitro and in vivo, wildtype huntingtin can modulate HIP14 activity toward palmitoylating other neuronal substrates, including a number of presynaptic proteins and PSD-95. In vitro, mutant huntingtin loses the capacity to enhance HIP14 PAT activity, suggesting that  199 deficient protein palmitoylation may contribute to pathogenesis of HD. The significance of this thesis lies in several aspects. This work identifies the first neuronal palmitoyl transferase HIP14 that regulates the trafficking of multiple neuronal proteins. Then we demonstrate how HIP14 regulates the trafficking and function of huntingtin protein, and how palmitoylation deficiency in mutant huntingtin is implicated in HD pathology. The fact that we are able to manipulate inclusion formation and neuron viability through changing HIP14 expression levels promises a potential in therapeutic strategy. In addition, this work provides some pioneer studies in comparing and contrasting substrate specificity among different DHHC PATs. Although the exact elements that determine the specificity between enzymes and substrates are not clear, this work reveals that regions other than the catalytic domain may be critical for the recognition of a substrate. Finally, this work discovers a new function for wildtype huntingtin. Besides being a scaffold, neuroprotective and facilitating vesicle transporting, wildtype huntingtin can modulate HIP14 PAT activity toward other neuronal substrates. The fact that mutant huntingtin lacks this function indicates that one mechanism underlies the pathogenesis of HD is a defect of protein palmitoylation.  200 6.2. ROLE OF PALMITOYLATION IN THE MOLECULAR FUNCTION OF HUNTINGTIN How does C214 palmitoylation fit in with the current understanding of huntingtin function? 6.2.1 Palmitoylation associates huntingtin with the membranes Palmitoylation, in many cases, increases the hydrophobicity of a protein and directs it to membranous structures. Recently, using imaging, integrative proteomics, and cell biology, huntingtin has been defined as a membrane-associated protein, with activities related to axonal trafficking of vesicles and mitochondria. The discovery of huntingtin palmitoylation at C214 reinforces the fact that huntingtin is membrane associated. In addtion, huntingtin is also reported to contain a membrane association domain (1-18aa) that reversibly targets to vesicles and the endoplasmic reticulum (ER) (Atwal et al. 2007; Atwal and Truant 2008). 6.2.2 Palmitoylation may modify huntingtin folding  The framework of the huntingtin protein is flexible. Differential detection of huntingtin by various antibodies, depending on the polyglutamine size (ie 1C2 antibody) and subcellular location (ie EM48 antibody), indicates that this protein\u2019s intrinsic structure changes in such circumstances(Trottier et al. 1995b; Trettel et al. 2000; Ko et al. 2001). Therefore, palmitoylation, which increases the hydrophobicity of huntingtin, may also have an impact on the folding of the protein itself. Indeed, we have shown that palmitoylation-deficient forms of even wildtype polyglutamine huntingtin exhibit significant more neuronal inclusions, indicating palmitoylation contributes to huntingtin  201 proper folding. Similarly, the importance of palmitoylation in proper folding of several other proteins has been demonstrated. The stability of the coronavirus envelope protein depends on its palmitoylation(Lopez et al. 2008). Drisdel et al also showed that palmitoylation is critical for proper protein folding and ER processing of the Bgt Receptor (Drisdel et al. 2004). Early \u03b17 subunit precursors, which exist in the form of aggregates, and unassembled subunits or assembling subunits that have not yet formed Bgt binding sites, are not or poorly palmitoylated. In contrast, intracellular BgtRs are  highly palmitoylated, and inhibition of \u03b17 subunit palmitoylation  in PC12 cells blocks formation of new Bgt binding sites. In another example, palmitoylation influences the oligomerization state of G\u03b1(o) to regulate the GDP\/GTP exchange of G\u03b1 (o) and thereby modulate the on-off switch of the G protein in G protein-coupled signal transduction(Yang et al. 2008). However, palmitoylation is not always a favorable default. In the case of the mammalian water channel aquaporin-4, formation of aquaporin-4 arrays is inhibited by palmitoylation of N-terminal cysteine residues(Suzuki et al. 2007). 6.2.3 Huntingtin palmitoylation and other posttranslational modification In many cases, co-regulation exists between palmitoylation and phosphorylation of a substrate (Soskic et al. 1999; Hawtin et al. 2001; Dorfleutner and Ruf 2003; Ponimaskin et al. 2005). In some other examples, palmitoylation and proteolysis also co- regulate each other. For instance, palmitoylation-deficient recombinant human A1 adenosine receptor is subject to enhanced proteolysis (Gao et al. 1999). Palmitoylation of  202 the C-terminal fragment of p75(NTR) is required for subsequent cleavage by \u03b3- secretase(Underwood et al. 2008). It is also possible that phosphorylation, proteolysis and\/or palmitoylation of huntingtin modulate one another and ultimately the subcellular localization of huntingtin. 6.2.4 Palmitoylation and protein nuclear localiazation Mounting new evidence also indicates that regulated palmitoylation can control shuttling of signaling proteins between plasma membrane\/and the nucleus. G protein- coupled receptor (GPCR) kinases (GRKs) specifically phosphorylate agonist-occupied GPCRs at the inner surface of the plasma membrane, leading to receptor desensitization(Jiang et al. 2007). Non-palmitoylated forms of GRK6A are released from  the plasma membrane to the cytoplasm and then into the nucleus. A similar mechanism may also control huntingtin protein shuttling between cytosol and the nucleus. Huntingtin, the protein affected in Huntington\u2019s Disease, is N-terminally palmitoylated, and this palmitoylation is essential for its proper sorting and folding. The palmitoylation deficient form of wild type huntingtin results in its accumulation in the nucleus (Figure 1.15A) (Yanai et al. 2006). Likewise, the R7 family  binding protein (R7BP) that binds to a subfamily of the regulator  of G protein\u2013signaling (RGS) proteins is C-terminally  palmitoylated. This palmitoylation targets  the R7BP\/RGS7\/G\u03b25 complex to the plasma membrane, while nonpalmitoylated R7BP directs  the complex to the nucleus(Drenan et al. 2005; Drenan et al. 2006; Song et al. 2006). Similarly, estrogen receptor (Li et al. 2003b; Acconcia et al. 2005; Rai et al. 2005), and phospholipid scramblase  1(Wiedmer et al. 2003) have been demonstrated recently to  localize to the plasma membrane when palmitoylated but translocate to the nucleus  when depalmitoylated. Taken together, these  203 studies reveal a novel role for palmitoylation in controlling shuttling of several signaling proteins between the plasma membrane and the nucleus. 6.3. GLOBAL DEFFECTS IN PALMITOYLATION MAY UNDERLIE HD The wide distribution in tissue and subcellular fractions prevent us from defining a single unique function of wildtype huntingtin. To date, huntingtin has been reported to facilitate vesicle transport in axons and regulate gene transcription. Huntingtin also functions in development and neuroprotection, probably through mechanisms such as promotion of Bdnf gene transcription. Although it is challenging to define wildtype huntingtin function, conclusions from studying various genetic models of HD have provided much valuble information about the wildtype protein. These studies have implied that HD is a disease of both a loss of wildtype huntingtin function and a gain of mutant huntingtin function (Cattaneo et al. 2005). From the work of this thesis, we identified a new role for wildtype huntingtin, which is to enhance the enzymatic activity of a PAT HIP14. In vitro, mutant huntingtin does not have the same capacity, indicating a loss in the wildtype function. If in vivo mutant huntingtin plays a dominant negative role, then palmitoylation defects of a similar pool of proteins are expected in both YAC 128 mice and huntingtin+\/- mice. A comparison of the palmitoylation profile of these two mice will further provide in vivo evidence of this hypothesis.    204 6.4. HUNTINGTIN PAMLITOYLATION AS A THERAPUETIC TARGET The data in this thesis provide evidence that increasing huntingtin palmitoylation may be a useful strategy for therapeutical approaches, because palmitoylation deficiency of mutant huntingtin is evident and is implicated in HD. In YAC 128 mice primary cortical neurons that express mutant huntingtin, cell viability following NMDA-induced excitotoxicity is correlated with HIP14 expression. Knocking down expression of the huntingtin PAT HIP14 decreases cell resistance to excitotoxicity whereas exogenous HIP14 increases the cell viability. Therefore increasing huntingtin palmitoylation may be a viable strategy for improvement of symptoms and prognosis of HD. One possibility is to stabilize the interaction of HIP14 and mutant huntingtin, and thereby increase mutant huntingtin palmitoylation. Using the atomic insight gleaned from the 3D structure, it may be possible to employ rational drug design to increase interaction between HIP14 and huntingtin, either by increasing the binding surfaces between the two proteins, or by increasing the ionic bonding between the two, thereby stabilizing the interaction. Thioesterase inhibitors may offer another promising method of increasing the palmitoylation at huntingtin C214. For HD, the effective use of thioesterase inhibitors requires identification of the thioesterases that act on huntingtin and specifically on C214. 6.5. OTHER PALMITOYLATION SITES OF HUNTINGTIN Cysteine mutagenesis of huntingtin was intensively investigated at the N terminus of huntingtin and only C214 was confirmed to the palmitoylation site of N terminal fragment. However, other cysteines at the C terminus may also possible to be  205 palmitoylated. CSS-Palm 2.0 palmitoylation site predictor (Zhou et al. 2006) detects several other possible palmitoylation cysteines, as are shown in the table (http:\/\/bioinformatics.lcd-ustc.org\/css_palm\/prediction.php). This web-based palmitoylation site predictor uses a Clustering and Scoring Strategy. 210  experimentally verified palmitoylation sites from 83 distinct  proteins were grouped into several subsets  based on their sequence similarity. Each subset is characterized by the high sequence similarity  between the palmitoylation sites. For each given cysteine residue,  its final score as a potential palmitoylation site is defined  as the highest similarity score among all similarity scores  against the above partitioned subsets. Its  prediction performance on the curated dataset is highly encouraging  with Jack-Knife sensitivity of 82.16% and specificity of 83.17%,  respectively.   Table 6.1. Predicted palmitoylation sites in full length huntingtin with high cutoff value Cysteine site Peptide Score Cutoff Type 214 LLPCLTR 2.878 1.000 TypeIII: Others 1597\u0002 LQQCHKE\u00021.235\u00021.000\u0002 TypeIII: Others\u0002 2284\u0002 LDCCCLA\u00021.984\u00021.700\u0002 TypeI: -CC-\u0002 3144\u0002 VTTC***\u0002 2.113\u00021.000\u0002 TypeIII: Others\u0002  Table 6.2. Predicted palmitoylation sites in full length huntingtin with medium cutoff value Cysteine site Peptide Score Cutoff Type 214\u0002 LLPCLTR\u0002 2.878\u00020.800\u0002 TypeIII: Others\u0002 835\u0002 VRNCVMS\u00020.809\u00020.800\u0002 TypeIII: Others\u0002 1027\u0002 TFGCCEA\u0002 1.547\u00020.700\u0002 TypeI: -CC-\u0002 1028\u0002 FGCCEAL\u0002 1.484\u00020.700\u0002 TypeI: -CC-\u0002 1597\u0002 LQQCHKE\u00021.235\u00020.800\u0002 TypeIII: Others\u0002 2283\u0002 GLDCCCL\u0002 1.359\u00020.700\u0002 TypeI: -CC-\u0002 2284\u0002 LDCCCLA\u0002 1.984\u00020.700\u0002 TypeI: -CC-\u0002  206 2285\u0002 DCCCLAL\u0002 1.141\u00020.700\u0002 TypeI: -CC-\u0002 3094\u0002 NLFCLVA\u0002 0.922\u00020.800\u0002 TypeIII: Others\u0002 3144\u0002 VTTC***\u0002 2.113\u00020.800\u0002 TypeIII: Others\u0002  Our studies have shown that C214 mutation of huntingtin loses a significant portion of the palmitoylation signal compared to wildtype, indicating C214 is a major site for palmitoylation. However, whether other putative palmitoylated cysteines participate in HD pathology still remain to be determined.  6.6. FUTURE DIRECTIONS The data presented in this thesis suggest numerous avenues of future investigation. This includes genetic and molecular studies ultimately aimed at identifying therapeutic targets for HD. 6.6.1 HIP14-\/- and HIP14L-\/- mice HIP14 and HIP14L are the major PATs for huntingtin (see Figure 5.2). HIP14 and HIP14L knockout mice are essential to determine (i) if these proteins are the important PATs for huntingtin; (ii) in vivo consequences of loss of huntingtin palmitoylation; and (iii) the contribution of each PAT to huntingtin palmitoylation. Our discovery that huntingtin regulates HIP14 activity suggests that altered palmitoylation of neuronal substrates\u2014other than huntingtin itself\u2014may underlie the selective striatal loss in HD. Thus, it is a possibility that HIP14, HIP14L or HIP14\/HIP14L double knockout mice will show similar phenoypes to those observed in our YAC128 HD mice. To this end, both HIP14 and HIP14L knockout mice are being generated to determine the phenotype. We expect that, because huntingtin may act as an auxiliary subunit for HIP14, proteins  207 showing altered palmitoylation in huntingtin+\/- mice and YAC128 mice may also show altered palmitoylation in HIP14-\/- and HIP14L-\/- mice. 6.6.2 HIP14 and\/or HIP14L transgenic mice cross YAC128 mice Generation of HIP14 and HIP14L transgenic mice will be valuble to determine the effect of overexpression of HIP14 and HIP14L on the palmitoylation of huntingtin in vivo. Crossing either HIP14 or HIP14L to the YAC128 mice will determine if the increase in palmitoylation of huntingtin will result in an abrogation or delay of any aspect of the HD phenotype. 6.7. CONCLUSIONS The discovery of mammalian palmitoyl acyl transferases has significantly promoted the progress of the palmitoylation field. Recent studies reveal a role of palmitoylation in many aspects of health and disease including Huntington Disease. Palmitoylation is a dynamic means of regulating huntingtin and is implicated in HD because it is reduced by the polyglutamine-expansion and modifies the cell viability. The findings from the characterization of C214 palmitoylation of huntingtin suggest that posttranslational modifications of huntingtin can modify crucial pathogenic processes and open new therapeutic possibilities for HD.  208 6.8. BIBLIOGRAPHY Acconcia, F., P. Ascenzi, et al. (2005). \"Palmitoylation-dependent estrogen receptor alpha membrane localization: regulation by 17beta-estradiol.\" Mol Biol Cell 16(1): 231-7. Atwal, R. S. and R. Truant (2008). \"A stress sensitive ER membrane-association domain in Huntingtin protein defines a potential role for Huntingtin in the regulation of autophagy.\" Autophagy 4(1): 91-3. Atwal, R. S., J. Xia, et al. (2007). \"Huntingtin has a membrane association signal that can modulate huntingtin aggregation, nuclear entry and toxicity.\" Hum Mol Genet 16(21): 2600-15. Cattaneo, E., C. Zuccato, et al. (2005). \"Normal huntingtin function: an alternative approach to Huntington's disease.\" Nat Rev Neurosci 6(12): 919-30. Dorfleutner, A. and W. Ruf (2003). \"Regulation of tissue factor cytoplasmic domain phosphorylation by palmitoylation.\" Blood 102(12): 3998-4005. Drenan, R. M., C. A. Doupnik, et al. (2005). \"Palmitoylation regulates plasma membrane-nuclear shuttling of R7BP, a novel membrane anchor for the RGS7 family.\" J Cell Biol 169(4): 623-33. Drenan, R. M., C. A. Doupnik, et al. (2006). \"R7BP augments the function of RGS7*Gbeta5 complexes by a plasma membrane-targeting mechanism.\" J Biol Chem 281(38): 28222-31. Drisdel, R. C., E. Manzana, et al. (2004). \"The role of palmitoylation in functional expression of nicotinic alpha7 receptors.\" J Neurosci 24(46): 10502-10. Gao, Z., Y. Ni, et al. (1999). \"Palmitoylation of the recombinant human A1 adenosine receptor: enhanced proteolysis of palmitoylation-deficient mutant receptors.\" Biochem J 342 ( Pt 2): 387-95. Hawtin, S. R., A. B. Tobin, et al. (2001). \"Palmitoylation of the vasopressin V1a receptor reveals different conformational requirements for signaling, agonist-induced receptor phosphorylation, and sequestration.\" J Biol Chem 276(41): 38139-46. Jiang, X., J. L. Benovic, et al. (2007). \"Plasma membrane and nuclear localization of G protein coupled receptor kinase 6A.\" Mol Biol Cell 18(8): 2960-9. Ko, J., S. Ou, et al. (2001). \"New anti-huntingtin monoclonal antibodies: implications for huntingtin conformation and its binding proteins.\" Brain Res Bull 56(3-4): 319-29. Li, L., M. P. Haynes, et al. (2003). \"Plasma membrane localization and function of the estrogen receptor alpha variant (ER46) in human endothelial cells.\" Proc Natl Acad Sci U S A 100(8): 4807-12. Lopez, L. A., A. J. Riffle, et al. (2008). \"Importance of conserved cysteine residues in the coronavirus envelope protein.\" J Virol 82(6): 3000-10. Ponimaskin, E., A. Dumuis, et al. (2005). \"Palmitoylation of the 5-hydroxytryptamine4a receptor regulates receptor phosphorylation, desensitization, and beta-arrestin-mediated endocytosis.\" Mol Pharmacol 67(5): 1434-43. Rai, D., A. Frolova, et al. (2005). \"Distinctive actions of membrane-targeted versus nuclear localized estrogen receptors in breast cancer cells.\" Mol Endocrinol 19(6): 1606- 17.  209 Song, J. H., J. J. Waataja, et al. (2006). \"Subcellular targeting of RGS9-2 is controlled by multiple molecular determinants on its membrane anchor, R7BP.\" J Biol Chem 281(22): 15361-9. Soskic, V., E. Nyakatura, et al. (1999). \"Correlations in palmitoylation and multiple phosphorylation of rat bradykinin B2 receptor in Chinese hamster ovary cells.\" J Biol Chem 274(13): 8539-45. Suzuki, H., K. Nishikawa, et al. (2007). \"Formation of aquaporin-4 arrays is inhibited by palmitoylation of N-terminal cysteine residues.\" Biochim Biophys Acta. Trettel, F., D. Rigamonti, et al. (2000). \"Dominant phenotypes produced by the HD mutation in STHdh(Q111) striatal cells.\" Hum Mol Genet 9(19): 2799-809. Trottier, Y., Y. Lutz, et al. (1995). \"Polyglutamine expansion as a pathological epitope in Huntington's disease and four dominant cerebellar ataxias.\" Nature 378(6555): 403-6. Underwood, C. K., K. Reid, et al. (2008). \"Palmitoylation of the C-terminal fragment of p75(NTR) regulates death signaling and is required for subsequent cleavage by gamma- secretase.\" Mol Cell Neurosci 37(2): 346-58. Wiedmer, T., J. Zhao, et al. (2003). \"Palmitoylation of phospholipid scramblase 1 controls its distribution between nucleus and plasma membrane.\" Biochemistry 42(5): 1227-33. Yanai, A., K. Huang, et al. (2006). \"Palmitoylation of huntingtin by HIP14 is essential for its trafficking and function.\" Nat Neurosci 9(6): 824-31. Yang, H., L. Qu, et al. (2008). \"Palmitoylation participates in G protein coupled signal transduction by affecting its oligomerization.\" Mol Membr Biol 25(1): 58-71. Zhou, F., Y. Xue, et al. (2006). \"CSS-Palm: palmitoylation site prediction with a clustering and scoring strategy (CSS).\" Bioinformatics 22(7): 894-896.    210 APPENDIX A.1 REAGENTS AND SAMPLES A.1.1 Mouse Lines All in vivo work, including YAC and wildtype mice, was done with mice from the FVB strain. Mice were housed either at the CMMT or the Wesbrook Building at UBC. The YAC18Q (line 212) and YAC128Q (line 53) mouse models contain the full-length genomic human HD gene with its endogenous promoter elements, providing appropriate developmental and tissue specific expression of the huntingtin protein (Slow et al. 2003). Huntingtin+\/- mouse was created to have a disruption in exon 5 of the Hdh gene. The targeting construct pHdhNeo6 contained approximately half of exon 5 plus intron sequences and a PGKneobpA cassette. Disruption of murine exon 5 results in stop codons in all reading frames. Cognitive, behavioural and neuropathological features of the YAC128 mouse model and huntingtin+\/- mice have been studied extensively (Nasir et al. 1995; O'Kusky et al. 1999; Slow et al. 2003; Van Raamsdonk et al. 2005a). The use of mice for research was approved in UBC animal care certificate A04-0073. A.1.2 Antibodies Commercial antibodies 1\u00b0 ANTIBODY SUPPLIER CAT# SOURCE EPITOPE WORKING DILUTION Actin Sigma A2066 rabbit SGPSIVHRK CF 1:200 Huntingtin Chemicon mAb2166 mouse  aa 443 - 457 1:2000 \u03b3-Tubulin Sigma T3559 mouse mAb aa 38-53 1:1000 HA BABCO AFC-101P mouse YPYDVPDY A 1:1000 GM130 BD 610822 mouse  aa869-982 1:200  211 Ubiquitin Upstate 07-375 rabbit bovine ubiquitin NT \u03b1-adaptin Transduction Laboratories 610501 mouse  aa 38-215 1:2000 Rab5 Transduction Laboratories 610281 mouse  aa 1-215 1:500 Rab8 Transduction Laboratories 610845 mouse  aa 84-205 1:4000 GST Santa Cruz Biotechnolo gy Sc-138 mouse Full length GST 1:1000 PSD-95 Affinity Bioreagents MA1-045 mouse Full length PSD-95 1:2000 SNAP25 Stressgen VAM- SV012E mouse  ND 1:1000 EEA1 BD Biosciences 610457 mouse  aa 3-281 1:500 Hsp70 Neomarker RB-080- A0 rabbit  ND 1:200 Transferrin receptor Zymed A-11130 mouse  ND 1:1000 Calnexin Sigma \u0006\u0007\b  Rabbit  aa 573-592 1:200 GFP Synaptic system 132 002 Rabbit full-length GFP 1:2000 GAD65 Abcam ab26113  mouse near the C- terminus 1:1000 Synaptotagmin I Synaptic system 105-221 mouse lumenal domain 1:100 SCAMP Upstate Biotech 05-741 mouse Purified GLUT4 vesicles 1:1000 Syntaxin 1B Synaptic system 110402 rabbit GKLAIFTDD IKMDSQMT 1:1000 Glutamate Transporter (EAAC1) Chemicon MAB1587 mouse KDKSDTISF TQTSQF 1:500 Flag M2 Sigma F1804 mouse DYKDDDDK 1:1000 ND: Not Determined  Antibodies generated in El-Husseini lab or Hayden Lab 1\u00b0 ANTIBODY REFERENCE SOURCE EPITOPE WORKING DILUTION BKP1 poly  (Kalchman et al. 1996)  Rabbit aa 1-17 1:500 BKP1mono  (Kalchman et al. 1996)  mouse aa 1-17 1:500  212 HD650  (Slow et al. 2003)  mouse human specific @ aa 650 1:85 HIP14 (Singaraja et al. 2002) Rabbit aa 49-60 1:200 PSD-95 (Arstikaitis et al. 2008) Rabbit GST-PSD95 (1-PDZ2) 1:1000 GFP (Huang et al. 2004) Guinea pig Full length GST-GFP 3\u00b5g for IP GFP N\/A Rabbit Full length GST-GFP 3\u00b5g for IP N\/A: Not Applicable  A.2 EXPERIMENT PROCEDURES A.2.1 Primary Neuronal Culture and Transfection Neuronal cultures were prepared from hippocampi of E18\/E19 rats. The hippocampi were dissociated by enzyme digestion with papain followed by brief mechanical trituration. Cells are plated on poly-D-lysine\u000b (Sigma) treated glass coverslips (12 mm in diameter, Fisher) in 24-well plates (Falcon) and maintained in Neurobasal media (Gibco) supplemented with B27, penicillin, streptomycin, and L-glutamine. Hippocampal or cortical cultures are transfected with lipofectamine 2000 (Invitrogen) based on factory mannul. Briefly, cells were transfected between DIV 5 to 7. For each well of the 24 well plate, 1\u00b5l of DNA and 0.5\u00b5l of lipofectamine 2000 reagent are mixed in 50 \f l of OPTIMEN (Invitrogen) and incubated at room temperature for 15 minutes. After the mixture is added to the well, the cells are incubated for 3 hr at 37\u00b0C and 5% CO2 and then cell media that contains the transfection reagent is replaced with fresh pre-warmed media.    213  A.2.2 Cell Lysis and Tissue Preparation Cultured Cells To harvest the cultured cells, 1ml of PBS was added to each well of the plates and cells were scraped into a 1.5ml eppendof tube. After spinning the tube at 14000rpm for 1min, we collected the cell pellete and added 500ul of lysis buffer. The cells were sonicated briefly (3 x 10s on ice) and centrifuged at 14,000 rpm for 15 min at 4\u00b0C. Lysis buffer for extracting PSD-95: 50 mM Tris pH 7.5, 150 mM NaCl, 2mM EDTA, 2mM EGTA, 0.2% SDS, 1% Triton-X100, 1X protease inhibitors (Roche) and 1mM PMSF). Lysis buffer for extracting huntingtin and HIP14: 50 mM Tris pH 8.0, 150 mM NaCl, 1% Igepal, 1 mM PMSF, 1X protease inhibitors (Roche) and 5\u00b5M zVAD. Lysis buffer for extracting other soluble proteins: 50 mM Tris pH 7.5, 150 mM NaCl, 2mM EDTA, 2mM EGTA, 1% Triton-X100, 1X protease inhibitors (Roche) and 1mM PMSF). Fresh Brain Lysates To generate fresh brain lysates, FVB wildtype or huntingtin+\/- mice or YAC transgenic mice were sacrificed with Halothane and the brain was isolated and homogenized in lysis buffer without the detergent supplement. Samples were homogenized for 20 times on ice and then sonicated briefly (3 x 10s on ice). Next, detergent was supplemented and the samples were rotated at 4\u00b0C for an hour to for lysis. Samples were then centrifuged at 14,000 rpm for 30 min at 4\u00b0C. Protein concentration was assessed with the BCA assay (Pierce).  214  A.2.3 Immunoprecipitations Huntingtin immunoprecipitation Immunopurification of huntingtin was performed to purify huntingtin to quantify its bound protein interactors or to be used for ex vitro pamitoylation assay. Sepharose G beads (25uL) were washed and pre-bound with anti huntingtin mAb2166 for roughly 1-2 hours. Lysates (250ug to 2mg) were incubated with the beads for two hours, rotating at 4 \u00b0C and then washed three times with lysis buffer. When huntingtin is purified for ex vitro palmitoylation assay, lysis buffer that is used for washing the beads does not contain Igepal or Triton because the palmiotylation assay is very sensitive to the amount of detergent. HIP14 immunoprecipitation Immunopurification of HIP14 was performed to purify HIP14 to quantify its bound protein interactors or to be used for ex vitro pamitoylation assay. For HIP14 mAb (HD26), Sepharose G beads (25\u00b5L) were washed and pre-bound with 4 \u00b5g of HIP14 mAb for an hour. For HIP14 pAb (HD27), Sepharose A beads (25\u00b5L) were washed and pre-bound with 4 \u00b5g of HIP14 pAb for an hour. Lysates (2-4 mg) were incubated with the beads for two hours, rotating at 4 \u00b0C and then washed three times with lysis buffer. When HIP14 is purified for ex vitro palmitoylation assay, lysis buffer that is used for washing the beads does not contain Igepal or Triton because the palmiotylation assay is very sensitive to the amount of detergent.    215  A.2.4 Immunoblotting Procedure Standard procedures were used for most immunoblotting. Briefly, sample preparation involved denaturing the lysates or immunoprecipitates in SDS gel loading buffer and heating for 10mins at 90\u00b0C. For proteins of molecular weight between 40kDa to 200kDa, 10% polyacrylamide gels were used. For proteins of smaller molecular weight (20 \u2013 30kDa), 4-12% bis-tris (Invitrogen) gels were used. For proteins of big molecular weight such as huntingtin 350kDa, 3-8% Tris-acetate gels (Invitrogen) were used. The gels were run for 1-2 hours at 150-200V. Rainbow marker (GE health, RPN800) was used for indicating the molecular weight. Transfers were performed onto Nitrocellular membranes (Amersham) at 0.5A for 60-90 minutes using transfer buffer (11.6g Tris, 58g glycine, 400ml MeOH and 2g SDS in 2L H2O). Blocking was performed with 5% milk or 5% BSA depending on the primary antibody. Quantitative Immunoblotting All immunoblots were used with fluorescently labeled secondaries and the Licor Odyssey immunoblotting system. Reliable quantitation relies on clean, crisp separation of bands that are of moderate exposure (not over\/underexposed). For statistical analysis of immunoblotting, groups were compared based on the numerical densitometry results from Image J software. Student T-test was performed with 2 groups. P values <0.05 were considered to be statistically significant. A.2.5 Expression and Purification of GST-Fusion Proteins  216 GST fusion proteins were produced in E. coli using the pGEX 6p3 expression system (Amersham). For GST-SNAP25, PSD95 (1-PDZ2), GAD65 (1-80aa), paralemmin (C- terminal 12aa) and synaptotagmin VII (C-terminal 12aa), the induction was performed with 300\u00b5M IPTG at 30\u00b0C for 5 hours. For GST-HIP14, the induction was performed at RT with 100uM IPTG for overnight. For 1L of induced bacteria culture, cells were resuspended in 10ml of ice cold lysis buffer containing 50mM Tris, 150mM NaCl, 1% Triton X-100, 0.1mg\/ml DNAase, 1mg\/ml Lysosome, 1mM PMSF and 1X protease inhibitor (Roche). The lysis solution was then sonicated on ice for 4X 15 seconds, followed by incubation at 4\u00b0C for an hour. GST-HIP14 was purified with no detergent to maintain proper protein folding. Next, the lysis solution was then centrifuged at 45000rpm, 4\u00b0C for 60 minutes to remove the bacteria debris. Supernatant was then subject to Glutathione Sepharose TM  4B (Amersham) to extract the GST fusion proteins. After the sepharose was washed 6 times with wash buffer containing 25mM Tris, 150mM NaCl, 1mM PMSF, the GST fusion proteins were then eluted with 20mM Glutathione and dialyzed with 25Mm Tris pH7.0. To generate a free N-terminus of PSD-95, GST- PSD-95 protein was cleaved using thrombin (50mM Tris-HCl pH 8.0, 150mM NaCl, 2.5mM CaCl2, 0.1% 2-mercapto-ethanol). A.2.6 Synthesis of Palmitoyl CoA [ 3 H]palmitoyl-CoA, [ 3 H]myristoyl-CoA and palmitoyl-CoA were synthesized enzymatically from [9,10- 3 H(N)]palmitic acid (5 mCi\/ml; Perkin Elmer Life Sciences), [9,10- 3 H(N)]myristic acid (1mCi\/ml; Perkin Elmer Life Sciences) and palmitic acid (Sigma-Aldrich), respectively. Synthesis components also included co-enzyme A (CoA), ATP and acyl-CoA synthase (Sigma-Aldrich). Synthesized products were purified as  217 previously described (Dunphy et al. 1996). Synthesized [ 3 H]palmitoyl-CoA and [ 3 H]myristoyl-CoA were subjected to TLC (TLC aluminium sheet, silica gel, EM Science, Germany) to determine the efficiency. Ninhydrin Staining was used for the detection of synthesized non-radiolabeled palmitoyl-CoA. The synthesis was highly efficient, with >95% conversion of acid to fatty acid-CoA. Specific activity for [ 3 H]palmitoyl-CoA was 60 Ci\/mmol and for [ 3 H]myristoyl-CoA was 30Ci\/mmol. A.2.7 Palmitoylation Assay Palmitoylation reaction (60 \u00b5l) contained 5 \u00b5Ci of [ 3 H]palmitoyl-CoA, 0.33 \u00b5g\/\u00b5l substrate protein, 1 mM ATP, 50 mM MES, pH 6.4, 0.2 mg\/ml bovine liver lipids, and either 10\u00b5l of COS cell lysates expressing full length or N terminus huntingtin, or immunoprecipitated huntingtin. After 15min incubation at 37\u00b0C, sample buffer was added with final concentration of 5mM DTT was added and samples were subjected to SDS-PAGE analysis (Roth et al. 2002; Huang et al. 2004). A.2.8 Btn-BMCC assay After the immunoprecipitation was performed with lysis buffer containing 50mM HEPES pH7.0, 150mM NaCl, 1.0%Triton and 1X Protease inhibitors (Roche), Protein sepharose that contained the IPed protein was washed 3X with lysis buffer and incubated with 50mM NEM (Sigma) in lysis buffer at 4\u00b0C for an hour. The beads were washed 4X with lysis buffer very well and split evenly into two tubes: one tube was treated with 1M Hydroxylamine (HAM) (Sigma) supplemented with 1X protease inhibitor in 50mM HEPES pH7.0 at RT for an hour; the other tube was incubated with 50mM HEPES pH7.0 containing no HAM as a control. After an hour, each sample was washed 3X with lysis buffer and incubated with sulfhydryl-specific biotinylating reagent Btn-BMCC at 20 \u00b5M  218 in lysis buffer for 2 hours at 4\u00b0C. Samples were then washed 3X with lysis buffer and boiled in 5mM DTT SDS loading buffer for 10min before SDS electrophoresis and transferring to nitrocellular membranes. After blocking with BSA, blots are probed with streptavidin-conjugated horseradish peroxidase (Pierce) at a dilution of 1:10000 followed by ECL detection(Drisdel and Green 2004). A.2.9 Immunofluorescence techniques Immunofluorescence microscopy was performed in cultured cells that were grown on coverslips. One of two fixation methods was used depending on the primary antibody: 2% (w\/v) paraformaldehyde for 10min at room temperature or ice-cold MeOH for 5 mins at a -20\u00b0C freezer. Many antibodies produced similar staining with both fixation methods, however some antibodies such as synaptic proteins only stained appropriately with MeOH fixation. Following fixation, cells were washed briefly with PBS containing 0.3% Triton X-100 (PBS-T) 3 times. Cells were then incubated with the primary antibody in 2% normal goat serum in PBS for 1h at RT or overnight at 4\u00b0C. Cells were washed 3x with PBS-T, and then incubated in the secondary antibody (Goat anti Mouse Alexa 568 (red): 1\/1000, Goat anti Rabbit Alexa 568 (red): 1\/1000, Goat anti Mouse Alexa 488 (green): 1\/1000, or Goat anti Rabbit Alexa 488 (green): 1\/1000) in 2% normal goat serum in PBS for 1h at RT. Cells were washed 3x PBS-T before mounting. Fluoromount-G (Southern Biotech Cat. #0100-01) was used to mount coverlips on slides. Immunofluorescence was detected using a laser confocal microscope (Zeiss) or conventional immunofluorescence microscopy (Zeiss) with a CCD camera (Princeton Instruments Inc.). Images were captured using Zeiss software and stored as separate JPG or TIFF files for each channel.  219   A.2.10 Electron microscopy Electron microscopy on HIP14 in the brain was performed as previously described (Singaraja et al. 2002). Ultra-small colloidal gold conjugated  secondary antibody (Aurion, Wageningen, The Netherlands) was  used. Following a post-fixation with 2.5% glutaraldehyde, gold  particles were intensified using the R-gent SE-EM silver enhancement  kit (Aurion). Sections were further fixed with 0.5% OsO4 in  0.1 M PB, dehydrated in ethanol and propylene oxide (1:1)  and flat-embedded in Eponate 12 (Ted Pella, Redding, CA). Ultrathin  sections (90 nm) were cut using a Leica Ultracut S ultramicrotome,  and counterstained with 5% aqueous uranyl acetate for 5 min  followed by lead citrate for 5 min. Thin sections were  examined using a HITACHI H-7500 electron microscope. A.2.11 Cell Radiolabeling with 3H palmitate COS cells were labeled with 1 mCi\/ml [ 3 H]palmitate (57 Ci\/mmol; Perkin Elmer Life Sciences, Inc.) for 3 h while expressing the transfected proteins. Labeled cells were washed with ice-cold PBS and re-suspended briefly in 0.1 ml of lysis buffer containing 50 mM Tris-HCl [pH 7.4], 1 mM EDTA, 1 mM EGTA, 150 mM NaCl, 1% SDS. Triton X-100 was added to 1% to neutralize the SDS in a final volume of 0.5 ml.  26-Gage syringe was applied to break the nuclear chromosome DNAs. Insoluble material was removed by centrifugation at 14,000 rpm for 15 min at 4 0 C.  Immunoprecipitation procedure was performed as described above. Immunoprecipitates were washed three times with buffer containing 50 mM Tris-HCl [pH 7.4], 1 mM EDTA, 1 mM EGTA, 150  220 mM NaCl, and 1% Triton X-100, boiled in SDS-PAGE sample buffer with 1 mM DTT for 10 min, and separated by SDS-PAGE and dried under vacuum. Gels were exposed to Hyper Film (Amersham) with intensifying screens at -80 0 C for 3 to 20 days. A.2.12 Bioinformatics The prediction of potential palmitoylation sites was performed by submitting huntingtin protein sequence (P42858) to CSS-Palm site (http:\/\/bioinformatics.lcd- ustc.org\/css_palm\/prediction.php). This prediction program is based on the hypothesis that a short peptide surrounding the Cysteine amino acid contains sufficient information for whether the residue could be palmitoylated. However, the features for palmitoylation are quite elusive and almost all the existing studies proposed that there is no consensus sequence\/motif for palmitoylation (el-Husseini Ael and Bredt 2002; Smotrys and Linder 2004). Therefore, CSS-Palm predictor divided the set of known palmitoylation sites into several clusters according to the similarities between them. Then, an algorithm to score the possibility of a potential palmitoylation site peptide was applied and the result was compared to the already known palmitoylated peptides.  221 A.3 BIBLIOGRAPHY Arstikaitis, P., C. Gauthier-Campbell, et al. (2008). \"Paralemmin-1, a Modulator of Filopodia Induction is Required for Spine Maturation.\" Mol Biol Cell. Drisdel, R. C. and W. N. Green (2004). \"Labeling and quantifying sites of protein palmitoylation.\" Biotechniques 36(2): 276-85. Dunphy, J. T., W. K. Greentree, et al. (1996). \"G-protein palmitoyltransferase activity is enriched in plasma membranes.\" J Biol Chem 271(12): 7154-9. el-Husseini Ael, D. and D. S. Bredt (2002). \"Protein palmitoylation: a regulator of neuronal development and function.\" Nat Rev Neurosci 3(10): 791-802. Huang, K., A. Yanai, et al. (2004). \"Huntingtin-interacting protein HIP14 is a palmitoyl transferase involved in palmitoylation and trafficking of multiple neuronal proteins.\" Neuron 44(6): 977-86. Kalchman, M. A., R. K. Graham, et al. (1996). \"Huntingtin is ubiquitinated and interacts with a specific ubiquitin-conjugating enzyme.\" J Biol Chem 271(32): 19385-94. Nasir, J., S. B. Floresco, et al. (1995). \"Targeted disruption of the Huntington's disease gene results in embryonic lethality and behavioral and morphological changes in heterozygotes.\" Cell 81(5): 811-23. O'Kusky, J. R., J. Nasir, et al. (1999). \"Neuronal degeneration in the basal ganglia and loss of pallido-subthalamic synapses in mice with targeted disruption of the Huntington's disease gene.\" Brain Res 818(2): 468-79. Roth, A. F., Y. Feng, et al. (2002). \"The yeast DHHC cysteine-rich domain protein Akr1p is a palmitoyl transferase.\" J Cell Biol 159(1): 23-8. Singaraja, R. R., S. Hadano, et al. (2002). \"HIP14, a novel ankyrin domain-containing protein, links huntingtin to intracellular trafficking and endocytosis.\" Hum Mol Genet 11(23): 2815-28. Slow, E. J., J. van Raamsdonk, et al. (2003). \"Selective striatal neuronal loss in a YAC128 mouse model of Huntington disease.\" Hum Mol Genet 12(13): 1555-67. Smotrys, J. E. and M. E. Linder (2004). \"Palmitoylation of intracellular signaling proteins: regulation and function.\" Annu Rev Biochem 73: 559-87. Van Raamsdonk, J. M., Z. Murphy, et al. (2005). \"Selective degeneration and nuclear localization of mutant huntingtin in the YAC128 mouse model of Huntington disease.\" Hum Mol Genet 14(24): 3823-35.   ","@language":"en"}],"Genre":[{"@value":"Thesis\/Dissertation","@language":"en"}],"GraduationDate":[{"@value":"2008-11","@language":"en"}],"IsShownAt":[{"@value":"10.14288\/1.0066508","@language":"en"}],"Language":[{"@value":"eng","@language":"en"}],"Program":[{"@value":"Neuroscience","@language":"en"}],"Provider":[{"@value":"Vancouver : University of British Columbia Library","@language":"en"}],"Publisher":[{"@value":"University of British Columbia","@language":"en"}],"Rights":[{"@value":"Attribution-NonCommercial-NoDerivatives 4.0 International","@language":"en"}],"RightsURI":[{"@value":"http:\/\/creativecommons.org\/licenses\/by-nc-nd\/4.0\/","@language":"en"}],"ScholarlyLevel":[{"@value":"Graduate","@language":"en"}],"Title":[{"@value":"Identification of novel palmitoyl acyl transferases and characterization of the role of Huntingtin palmitoylation in Huntington Disease","@language":"en"}],"Type":[{"@value":"Text","@language":"en"}],"URI":[{"@value":"http:\/\/hdl.handle.net\/2429\/1356","@language":"en"}],"SortDate":[{"@value":"2008-12-31 AD","@language":"en"}],"@id":"doi:10.14288\/1.0066508"}