{"Affiliation":[{"label":"Affiliation","value":"Medicine, Faculty of","attrs":{"lang":"en","ns":"http:\/\/vivoweb.org\/ontology\/core#departmentOrSchool","classmap":"vivo:EducationalProcess","property":"vivo:departmentOrSchool"},"iri":"http:\/\/vivoweb.org\/ontology\/core#departmentOrSchool","explain":"VIVO-ISF Ontology V1.6 Property; The department or school name within institution; Not intended to be an institution name."},{"label":"Affiliation","value":"Medicine, Department of","attrs":{"lang":"en","ns":"http:\/\/vivoweb.org\/ontology\/core#departmentOrSchool","classmap":"vivo:EducationalProcess","property":"vivo:departmentOrSchool"},"iri":"http:\/\/vivoweb.org\/ontology\/core#departmentOrSchool","explain":"VIVO-ISF Ontology V1.6 Property; The department or school name within institution; Not intended to be an institution name."}],"AggregatedSourceRepository":[{"label":"Aggregated Source Repository","value":"DSpace","attrs":{"lang":"en","ns":"http:\/\/www.europeana.eu\/schemas\/edm\/dataProvider","classmap":"ore:Aggregation","property":"edm:dataProvider"},"iri":"http:\/\/www.europeana.eu\/schemas\/edm\/dataProvider","explain":"A Europeana Data Model Property; The name or identifier of the organization who contributes data indirectly to an aggregation service (e.g. Europeana)"}],"Campus":[{"label":"Campus","value":"UBCV","attrs":{"lang":"en","ns":"https:\/\/open.library.ubc.ca\/terms#degreeCampus","classmap":"oc:ThesisDescription","property":"oc:degreeCampus"},"iri":"https:\/\/open.library.ubc.ca\/terms#degreeCampus","explain":"UBC Open Collections Metadata Components; Local Field; Identifies the name of the campus from which the graduate completed their degree."}],"Creator":[{"label":"Creator","value":"Grewal, Navdeep","attrs":{"lang":"en","ns":"http:\/\/purl.org\/dc\/terms\/creator","classmap":"dpla:SourceResource","property":"dcterms:creator"},"iri":"http:\/\/purl.org\/dc\/terms\/creator","explain":"A Dublin Core Terms Property; An entity primarily responsible for making the resource.; Examples of a Contributor include a person, an organization, or a service."}],"DateAvailable":[{"label":"Date Available","value":"2013-05-15T09:15:21Z","attrs":{"lang":"en","ns":"http:\/\/purl.org\/dc\/terms\/issued","classmap":"edm:WebResource","property":"dcterms:issued"},"iri":"http:\/\/purl.org\/dc\/terms\/issued","explain":"A Dublin Core Terms Property; Date of formal issuance (e.g., publication) of the resource."}],"DateIssued":[{"label":"Date Issued","value":"2013","attrs":{"lang":"en","ns":"http:\/\/purl.org\/dc\/terms\/issued","classmap":"oc:SourceResource","property":"dcterms:issued"},"iri":"http:\/\/purl.org\/dc\/terms\/issued","explain":"A Dublin Core Terms Property; Date of formal issuance (e.g., publication) of the resource."}],"Degree":[{"label":"Degree (Theses)","value":"Master of Science - MSc","attrs":{"lang":"en","ns":"http:\/\/vivoweb.org\/ontology\/core#relatedDegree","classmap":"vivo:ThesisDegree","property":"vivo:relatedDegree"},"iri":"http:\/\/vivoweb.org\/ontology\/core#relatedDegree","explain":"VIVO-ISF Ontology V1.6 Property; The thesis degree; Extended Property specified by UBC, as per https:\/\/wiki.duraspace.org\/display\/VIVO\/Ontology+Editor%27s+Guide"}],"DegreeGrantor":[{"label":"Degree Grantor","value":"University of British Columbia","attrs":{"lang":"en","ns":"https:\/\/open.library.ubc.ca\/terms#degreeGrantor","classmap":"oc:ThesisDescription","property":"oc:degreeGrantor"},"iri":"https:\/\/open.library.ubc.ca\/terms#degreeGrantor","explain":"UBC Open Collections Metadata Components; Local Field; Indicates the institution where thesis was granted."}],"Description":[{"label":"Description","value":"Tendinopathy is a major cause of morbidity in athletic populations and in the work force, traditionally thought to occur as a consequence of an imbalance between damage (resulting from mechanical loading) and repair. However, one third of the cases for midportion Achilles tendinopathy occur in sedentary individuals, and recent data suggests an association between hypercholesterolemia and the occurrence of tendon rupture or tendinopathy. The aim of this study was to examine the link between elevated lipids and tendon pathology. We used an apolipoprotein E-knockout model (ApoE-KO), in which apolipoprotein E deficiency leads to development of atherosclerosis. We hypothesized that tendons from ApoE-KO mice fed a high fat diet, in comparison to those fed a regular chow diet and the wild type (non-atherosclerotic mice), will demonstrate increased lipid deposition, increased cross-sectional area, and increased expression levels of collagen genes (Col1a1 and Col3a1), a growth factor gene (TGF-\u03b2), and an indicator of mast cell presence (Cpa3). \nTo test these hypotheses, ApoE-KO and control mice were fed a regular or high fat diet and sacrificed at different time points: 0, 15, and 30 weeks. The morphological properties were examined on H&E stained Achilles tendon sections while the lipid content was analyzed with Oil Red O staining. Tendon thickening was measured by ultrasonography of patellar tendon cross-sectional area.  qPCR analysis was carried out on tail tendons at 30 week time point to analyze gene expression of Cpa3, TGF-\u03b2, Col1a1, and Col3a1. \nApoE-KO mice developed xanthomatous lesions, and showed less weight gain than control mice. ApoE-KO mice showed no appreciable changes in tendon histomorphology. Compared to control mice, ApoE-KO mice had lower tendon lipid content but demonstrated an increase in tendon cross-sectional area. Col1a1 gene expression levels were decreased in ApoE-KO mice. Cpa3, TGF-\u03b2, and Col3a1 showed no differences between strains; however, Cpa3 expression was decreased in mice that were fed the high fat diet. ApoE-KO mice demonstrated significant tendon alterations, demonstrating thicker tendons with decreased collagen expression. Future work is required to determine the mechanism involved and the potential impact on tendon function.","attrs":{"lang":"en","ns":"http:\/\/purl.org\/dc\/terms\/description","classmap":"dpla:SourceResource","property":"dcterms:description"},"iri":"http:\/\/purl.org\/dc\/terms\/description","explain":"A Dublin Core Terms Property; An account of the resource.; Description may include but is not limited to: an abstract, a table of contents, a graphical representation, or a free-text account of the resource."}],"DigitalResourceOriginalRecord":[{"label":"Digital Resource Original Record","value":"https:\/\/circle.library.ubc.ca\/rest\/handle\/2429\/44472?expand=metadata","attrs":{"lang":"en","ns":"http:\/\/www.europeana.eu\/schemas\/edm\/aggregatedCHO","classmap":"ore:Aggregation","property":"edm:aggregatedCHO"},"iri":"http:\/\/www.europeana.eu\/schemas\/edm\/aggregatedCHO","explain":"A Europeana Data Model Property; The identifier of the source object, e.g. the Mona Lisa itself. This could be a full linked open date URI or an internal identifier"}],"FullText":[{"label":"Full Text","value":"THE LINK BETWEEN HYPERCHOLESTEROLEMIA AND TENDON PATHOLOGY  by NAVDEEP GREWAL  B.Sc., Simon Fraser University, 2010  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Experimental Medicine)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  May 2013  \u00a9 Navdeep Grewal, 2013   ii  Abstract Tendinopathy is a major cause of morbidity in athletic populations and in the work force, traditionally thought to occur as a consequence of an imbalance between damage (resulting from mechanical loading) and repair.  However, one third of the cases for midportion Achilles tendinopathy occur in sedentary individuals, and recent data suggests an association between hypercholesterolemia and the occurrence of tendon rupture or tendinopathy. The aim of this study was to examine the link between elevated lipids and tendon pathology. We used an apolipoprotein E-knockout model (ApoE-KO), in which apolipoprotein E deficiency leads to development of atherosclerosis. We hypothesized that tendons from ApoE-KO mice fed a high fat diet, in comparison to those fed a regular chow diet and the wild type (non-atherosclerotic mice), will demonstrate increased lipid deposition, increased cross-sectional area, and increased expression levels of collagen genes (Col1a1 and Col3a1), a growth factor gene (TGF-\u03b2), and an indicator of mast cell presence (Cpa3). To test these hypotheses, ApoE-KO and control mice were fed a regular or high fat diet and sacrificed at different time points: 0, 15, and 30 weeks. The morphological properties were examined on H&E stained Achilles tendon sections while the lipid content was analyzed with Oil Red O staining. Tendon thickening was measured by ultrasonography of patellar tendon cross- sectional area.  qPCR analysis was carried out on tail tendons at 30 week time point to analyze gene expression of Cpa3, TGF-\u03b2, Col1a1, and Col3a1. ApoE-KO mice developed xanthomatous lesions, and showed less weight gain than control mice. ApoE-KO mice showed no appreciable changes in tendon histomorphology. Compared to control mice, ApoE-KO mice had lower tendon lipid content but demonstrated an increase in iii  tendon cross-sectional area. Col1a1 gene expression levels were decreased in ApoE-KO mice. Cpa3, TGF-\u03b2, and Col3a1 showed no differences between strains; however, Cpa3 expression was decreased in mice that were fed the high fat diet. ApoE-KO mice demonstrated significant tendon alterations, demonstrating thicker tendons with decreased collagen expression. Future work is required to determine the mechanism involved and the potential impact on tendon function.      iv  Preface All animal procedures were performed according to the guidelines for animal experimentation approved by Animal Care Committee of University of British Columbia. The Animal Care Certificate number was A11-0027. Part of the methods and results in the thesis (Chapter 2 and 3) were presented at Physiotherapy Association of British Columbia Conference and International Scientific Tendinopathy Symposium: Grewal, N., Granville, D., Reid, D., Scott, A. Hypercholesterolemia and Tendon Pathology. Physiotherapy Association of British Columbia Conference. Vancouver, British Columbia, April 2, 2011 and April 27, 2013. Grewal, N., Granville, D., Reid, D., Scott, A.  Hypercholesterolemia and Tendon Pathology. International Scientific Tendinopathy Symposium. Vancouver, British Columbia, September 27-29, 2012. For gene expression analysis, cDNA synthesis and qPCR experiments were done in the Scott laboratory by Aishwariya Sharma. Statistical analysis was done by Dr. Rick White. v  Table of Contents  Abstract .......................................................................................................................................... ii Preface ........................................................................................................................................... iv Table of Contents ...........................................................................................................................v List of Tables .............................................................................................................................. viii List of Figures ............................................................................................................................... ix List of Abbreviations and Acronyms ...........................................................................................x Acknowledgements ..................................................................................................................... xii Dedication ................................................................................................................................... xiv Chapter  1: Introduction ...............................................................................................................1 1.1 Overview ......................................................................................................................... 1 1.2 Scope\/significance of problem in workers, athletes, and sedentary individuals ............. 4 1.3 Tendon structure and function ........................................................................................ 5 1.4 Tendon physiology........................................................................................................ 14 1.5 Tendon injury and repair ............................................................................................... 19 1.6 Epidemiology of tendinopathy ...................................................................................... 25 1.7 Summary: literature on link between tendinopathy and cardiovascular disease\/lipids 29 1.8 Animal models for studying tendon .............................................................................. 31 1.9 Summary of findings from ApoE-deficient mice ......................................................... 33 1.10 Objectives ..................................................................................................................... 34 1.11 Aims .............................................................................................................................. 35 1.12 Hypotheses .................................................................................................................... 35 vi  1.13 Significance of research ................................................................................................ 36 Chapter  2: Materials and Methods ...........................................................................................37 2.1 Mice .............................................................................................................................. 37 2.2 Diet ................................................................................................................................ 37 2.3 Tissue collection and processing .................................................................................. 38 2.4 Histology ....................................................................................................................... 39 2.5 Cross-sectional area ...................................................................................................... 41 2.6 RNA isolation and quantitative PCR ............................................................................ 41 2.7 Statistical analysis ......................................................................................................... 44 Chapter  3: Results.......................................................................................................................45 3.1 Morbidity and skin pathology ....................................................................................... 45 3.2 Weight ........................................................................................................................... 46 3.3 Histology ....................................................................................................................... 48 3.4 Cross-sectional area ...................................................................................................... 53 3.5 Analysis of Cpa3, TGF-\u03b2, Col1a1, and Col3a1 expression ......................................... 55 Chapter  4: Discussion .................................................................................................................57 Chapter  5: Conclusion ................................................................................................................66 5.1 Limitations .................................................................................................................... 66 5.2 Future directions ........................................................................................................... 67 References .....................................................................................................................................69 Appendices ....................................................................................................................................82 Appendix A Initial weight of mice at 7 weeks of age and final weights at their respective time points. ........................................................................................................................................ 82 vii  Appendix B ApoE monitoring sheet ......................................................................................... 84 Appendix C Normal quantile and residual plots for all variables studied. ............................... 85 Appendix D Cross-sectional area (CSA) measurements for animals sacrificed at 0 weeks on diet............................................................................................................................................. 89 Appendix E 2 (-\u0394Ct)  and standard errors of each gene in qPCR analysis. ................................... 91  viii  List of Tables Table 2.1   Primer sequences for qPCR ........................................................................................ 43  ix  List of Figures Figure 1.1   Schematic of a multi-unit hierarchical structure of the tendon. .................................. 7 Figure 1.2  Graphic representation of the biomechanical properties of tendon ............................ 10 Figure 1.3   Stress-strain curve of a tendon. ................................................................................. 11 Figure 1.4   Load-displacement curve ........................................................................................... 13 Figure 1.5   Schematic presentation of the effects of training and immobilization on the quality of tendon tissue.................................................................................................................................. 18 Figure 3.1   Effect of diet and strain on weight ............................................................................ 47 Figure 3.2   Tendon morphology of ApoE-KO mice Achilles tendon.......................................... 48 Figure 3.3   Analysis of Oil Red O staining before and after use of Positive Pixel Count Algorithm. ..................................................................................................................................... 50 Figure 3.4   Effect of strain and diet on tendon lipid content ....................................................... 52 Figure 3.5   Effect of diet and strain on patellar tendon cross-sectional area. .............................. 54 Figure 3.6   Effect of strain and diet on gene expression. ............................................................. 56  x  List of Abbreviations and Acronyms ApoEApolipoprotein E ApoE-KOApolipoprotein E-knockout bFGFBasic fibroblast growth factor BMP-12Bone morphogenic protein 12 C57Bl\/6C57 black 6 cDNAComplementary DNA (deoxyribonucleic acid) Col1a1Collagen type I, alpha 1 Col3a1Collagen type III, alpha 1 COX2Cyclooxygenase 2 Cpa3Carboxypeptidase A3 CSACross-sectional area ECMExtracellular matrix ESEmbryonic stem GAGGlycosaminoglycan H&EHematoxylin and eosin HDLHigh density lipoprotein HDL-CHigh density lipoprotein-cholesterol IGF-1Insulin-like growth factor 1 IL-1\u03b2Interleukin 1 beta IL-6Interleukin 6 iNOSInducible nitric oxide synthase xi  JNKc-JUN N-terminal kinase LDLLow density lipoprotein LDL-CLow density lipoprotein-cholesterol LLDLeg length discrepancy MMPMatrix metalloproteinase mRNAMessenger RNA OCTOptimal cutting temperature PCRPolymerase chain reaction PDGFPlatelet-derived growth factor PGE2Prostaglandin E2 qPCRQuantitative PCR RNARibonucleic acid SHGSecond harmonic generation TGF-\u03b2Transforming growth factor beta VEGFVascular endothelial growth factor VLDLVery low density lipoprotein      xii  Acknowledgements First and foremost, I offer my enduring gratitude to my supervisor Dr. Alex Scott for his tremendous help, invaluable assistance, support, and guidance. Continuous advice and feedback from Dr. Scott assured me I was on the right track, and made me confident in my work. I am grateful for the opportunities provided and given a chance for growth and self-reflection. Deepest gratitude is also due to the members of the supervisory committee, Dr. Darlene Reid and Dr. David Granville for their encouragement, insights and critical advice during this research. Thank you to all the staff at the Centre for Hip Health and Mobility for providing necessary lab training and always helping out with anything I needed. Thank you to all my friends and colleagues in the lab \u2013 Angie Fearon, Elise Huisman, Rouhollah Mousavizadeh, Hayedeh Behzad, and Riya Sharma for all their help, endless guidance and support, encouragement, and for making this journey possible. Thank you for all the fun times and laughs. Sincere thanks to the Animal Facility at Jack Bell Research Centre, especially Stephanie Smith and Kate Orchard, for their expertise in animal care and for providing help with animal care whenever needed. Thank you to Julie Lorette, Lynda Bell, and Sylvia Lee at the histology lab at Center for Translational and Applied Genomics for carrying out the cryosectioning on Achilles tendons multiples time to provide us with the best sections possible. Thank you for being so patient and friendly. xiii  I would like to thank the Department of Physical Therapy and the Vancouver Coastal Health Research Institute for providing funding and making this research possible. A special thanks to my parents, Bag Grewal and Parmjit Grewal, and the rest of my family, Tehal Grewal, Mandeep Grewal and Pavan Grewal, for all the love, and continuous and unconditional support. Heartfelt thank you to my best friend, Simran Mondair, for helping me get through the difficult times, and for always being there and encouraging me. Without them, this achievement would not have been possible. Last but not least, thank you to God for answering my prayers and giving me the strength to struggle and overcome the obstacles and difficulties. xiv  Dedication To my parents, for their endless love, support, and encouragement.   1   Chapter  1: Introduction 1.1 Overview Overuse injuries account for 30-50% of all injuries related to sports (Kannus, 1997). Tendon disorders are a major problem for those participating in competitive and recreational sports, and cause morbidity in both elite and recreational athletes. Tendon disorders are seen in physically active workers as well, and the prevalence of musculoskeletal symptoms increases with duration of employment (Forde, 2005). Tendinopathy and tendon degeneration might result from various factors such as overuse, poor vascularity, lack of flexibility, genetic makeup, sex, and endocrine or metabolic factors. Much attention has been given to the overuse aspect of this injury, but not enough to its occurrence in sedentary individuals as they age. Cardiovascular diseases are a major cause of death in the Western society, and they result from interactions among multiple genetic and environmental factors (Berg, 1983). Hypercholesterolemia (a condition characterized by high levels of cholesterol in the blood) has been linked to pathophysiology of cardiovascular diseases; however there is not enough data regarding its potential effects on the musculoskeletal system. The gene encoding Apolipoprotein E (ApoE) involved in lipid metabolism is considered to be one of those factors causing hypercholesterolemia, eventually leading to atherosclerosis. As a high affinity ligand for the Apolipoprotein B and ApoE (LDL) receptor and chylomicron remnant receptor, it allows the specific uptake of ApoE-containing particles by the liver (Curtiss, 2000). The effect of hypercholesterolemia on tendon pathology has been shown in few studies. Serum total cholesterol has been shown to be a factor associated with Achilles tendon ruptures. Murano 2   et al. examined the potential relation between Achilles tendon rupture and total cholesterol level in patients with familial hypercholesterolemia, a genetic disorder characterized by high cholesterol levels, specifically low-density lipoprotein (LDL). Serum concentrations of total cholesterol, LDL-cholesterol (LDL-C), and triglycerides were significantly higher in the Achilles tendon rupture group than control group; while high-density lipoprotein cholesterol concentration was significantly lower (Murano, 1993; Zehntner, 1984). Lipid deposition is also known to occur in tendons (Adams, 1974; Jozsa, 1984). Patients with familial hypercholesterolemia develop tendon xanthomas, which are deposits of lipid and connective tissue consisting of cholesterol and cholesterol esters (Kruth, 1985). Xanthomas also consist of foam cells, which are tissue macrophages that have phagocytosed the lipid components of lipoproteins deposited in tissues (Parker, 1973). Xanthomas can develop in the Achilles tendon (Fahey, 1973), with lipid infiltrating the tendon and tendon sheath (Galloway, 1970), resulting in a diffuse and irregular thickening of the tendon. The increase in tendon size may interfere with function and produce pain (Fahey, 1973). With the Achilles tendon being one of the main sites for xanthomas, it can be used to study lipid deposition. Hypercholesterolemia can affect tendons in several ways. The deposits of cholesterol byproducts have been implicated in the formation of tendon xanthomas (Bahr, 2002). The tendon xanthomas may change the mechanical properties of the tendon and result in an increased rate of tendon ruptures. Hypercholesterolemia may also alter the tendon\u2019s extracellular matrix (and in turn biomechanical properties) in a way that leads to impaired healing or homeostasis (Abboud, 2012). An example was shown in a research study in which embryonic fibroblasts were used to 3   study the effect of hyperlipidemic rat serum on connective tissue cell isolated from embryonic tendons. It was found that embryonic fibroblasts reacted differently to hyperlipidemic rat serum, which was less likely to stimulate the synthesis of non-collagenous proteins or the incorporation of glycosamine and cytidine compared to serum with normal cholesterol levels. This suggested that elevated cholesterol levels may impair healing or alter the biomechanical properties in a manner that could promote injury (Ronnemaa, 1975). Hypercholesterolemia may also cause changes in collagen levels and growth factors that play a role in tendon function, injury, and repair. Type I is the main type of collagen in tendons. In tendinopathic and ruptured tendons, there is a decrease in the proportion of collagen I and a significant increase in type III collagen (Maffulli, 2000). Reduced number of cross-links in type III collagen, compared to type I collagen, is responsible for reduced tensile strength of the tendon (Jozsa, 1990). Growth factors, such as TGF-\u03b2, are involved in embroyonic differentiation and healing of tissues. Not only do they influence the process of healing, but they also stimulate cell proliferation and differentiation among many of its other functions (Kader, 2007). In order to detect if hypercholesterolemia affects changes in collagen levels and growth factors, gene expression studies can be done to measure mRNA levels of Col1a1 and Col3a1 for collagen I and III respectively, growth factor TGF-\u03b2, and mast cell indicator Cpa3. High cholesterol levels can also cause a change in biomechanical properties. It has been shown in a previous research study that patellar tendons of hypercholesterolemic mice showed reduced baseline elastic modulus and strength compared with controls, when tested to failure (Beason, 2010). The tensile strength of tendon is dependent on its thickness and collagen content. 4   Hypercholesterolemia may also cause changes at the molecular level, which can be analyzed by quantitative PCR to measure mRNA levels of genes associated with normal tendon function or with diseased tendon. 1.2 Scope\/significance of problem in workers, athletes, and sedentary individuals Tendon injuries affect a large number of individuals and account for enormous associated costs. They are increasing as the population continues to age and remain active. Tendinopathy, mainly associated with sports and physical activity, is a major medical problem of tendons resulting in many cases from overload and overuse (Woo, 2007). In workers and athletes, the associated pain results in reduced physical activity and productivity, missed work days, and a large amount of costs to Worksafe BC. Overuse is considered to be one of the causes of tendinosis and tendinopathy, which develop when tendons are exposed to forceful loads and\/or high repetition (O\u2019Brien, 1997). However, there may be other factors contributing to tendon injury. Hypercholesterolemia affects approximately 17% of the United States population 20 years and older (Schober, 2007). High levels of total cholesterol, triglycerides, LDL have all been associated with cardiovascular diseases such as atherosclerosis, in which the soft tissue vascular endothelium is damaged (Abboud, 2012). In the U.S. population, 66.5% of patients diagnosed with diabetes also have cholesterols levels higher than normal, alongside cardiovascular heart disease or other risk factors (Harris, 1991). Furthermore, studies have shown those patients with even a mild insulin resistance show changes in their dyslipidemic profile, which is an increase in triglycerides (TG) and a decrease in high density lipoproteins (HDL), but no change in LDL (Laws, 1992; McLaughlin, 2005). 5   1.3 Tendon structure and function 1.3.1 Gross anatomy and cellular features Tendons are load bearing structures that transmit forces generated by muscles to bone, making joint movement possible. They are white in color and have a fibroelastic texture, showing great resistance to mechanical loads (Jozsa, 1997).  They are made up of tightly packed, longitudinally oriented collagen fibrils, consisting mainly of type I collagen, with some type III collagen, cross- linked to provide stiffness. The dry mass of tendons is about 30% of the total tendon mass, while the rest of the 70% is made up of water. Type I collagen accounts for 65-80% of the dry mass of tendons, whereas elastin makes up approximately 2% of the dry mass (O\u2019Brien, 1997; Hess, 1989). The main cell population in tendons responsible for producing collagen is elongated tenocytes, which are fibroblast-like cells that lie between collagen fibers (Kirkendall, 1997). Due to their proliferation ability, tenocytes are important for the maintenance of a healthy tendon. They consistently undergo metabolic and repair activity which involves collagen synthesis and breakdown. This ongoing process is regulated by how much loading the tendons are exposed to. Upon mechanical loading, calcium-dependant signalling is activated leading to stimulation of extracellular matrix gene expression. Therefore, a loading stimulus is required for tenocytes to maintain the normal tendon structure (Jozsa, 1997). Tendons have a multi-unit hierarchical structure that consists of collagen molecules, fibrils, fiber bundles, fascicles, and tendon units running parallel to the tendon\u2019s long axis (Figure 1.1). The smallest structural unit of a tendon is the fibril (Wang, 2006) that consists of triple helix polypeptide chains of tropocollagen (Jozsa, 1997). The next level of tendon structure is formed 6   by fibers, which are made up of collagen fibrils and bound by endotenon (Kastelic, 1978). Endotenon is a thin layer of connective tissue that contains blood vessels, lymphatics, and nerves (Kastelic, 1978; Ochiai, 1979). A bunch of collagen fibers form a primary fiber bundle (subfascicle) and a group of primary fiber bundles forms a secondary primary bundle called a fascicle. Furthermore, a group of secondary fascicles form a tertiary bundle, which makes up the tendon surrounded by epitenon (Jozsa, 1997). Epitenon is a fine, loose connective-tissue sheath that contains vascular, lymphatic, and nerve supply to the tendon (Kastelic, 1978). Tendons are also surrounded by a third layer of connective tissue called the paratenon. It mainly consists of type I and III collagen fibrils, elastic fibrils, and synovial cells that line the inner surface of paratenon. Due to its elasticity function, it allows free movement of the tendon against surrounding tissues (Jozsa, 1997). The epitenon and the paratenon make up peritendon, which reduces friction with the adjacent tissue (Wang, 2006). 7    1.3.2 Extracellular matrix components and organization The extracellular matrix (ECM) of tendon consists of the structural proteins, collagen and elastin, and ground substance. The most abundant type I collagen makes up about 65-80% of the dry mass, and 90% of the total collagen (Jozsa, 1997). Collagen in the matrix is cross-linked, which Figure 1.1   Schematic of a multi-unit hierarchical structure of the tendon (Wang, 2006, reproduced with permission). 8   increases the Young\u2019s modulus and reduces its strain at failure (Wang, 2006). On the other hand, elastin makes up only about 2% of the tendon\u2019s dry mass (Jozsa, 1997). The ground substance in the ECM surrounds the collagen and consists of proteoglycans, glycosaminoglycans (GAGs), structural glycoproteins, and other small molecules. Proteoglycans are negatively charged hydrophilic molecules made of a protein core with covalently attached GAG. They are entrapped within and between collagen fibrils and fibers, and allow rapid diffusion of water soluble molecules and migration of cells (Jozsa, 1997). In the ECM, they trap water and affect the viscoelastic properties of the tissue, therefore helping the tissue resist compressive forces (Xu, 2008). Proteoglycans and GAGs play an important role in physiological processes in tendon such as ion transport, water retention, diffusion of nutrients, mediating cell- matrix interactions, resistance of compression, and sequestration of growth factors and enzymes in the matrix (Hardingham, 1992; Yoon, 2005). Examples of proteoglycans are aggrecan and decorin. Aggrecan holds water within the fibrocartilage and resists compression (Vogel, 1989). Decorin, a leucine-rich proteoglycan located on the surface of the middle portion of collagen fibrils (Graham, 2000), facilitates fibrillar slippage during mechanical deformation (Pins, 1997). Glycoproteins are macromolecules that consist of a large protein fraction and a small glyceridic component. The adhesive glycoproteins are a subgroup of the matrix glycoproteins that can bind other macromolecules or cell surfaces together (Jozsa, 1997).  Examples of such glycoproteins are fibronectin (Jozsa, 1991) and thrombospondin (Miller, 1988). Fibronectin is involved in degeneration and repair processes of tendons, while thrombospondin mediates cell matrix interactions that occur in normal homeostasis and in repair and regeneration processes. 9   1.3.3 Biomechanical function The physical characteristics of tendons are great tensile strength, good flexibility, and considerable inextensibility. This is due to the molecular and supermolecular structure of collagen and its elastic fibers. Tendons have a good ability to withstand tensile or stretching forces but are less able to withstand the shear and compressive forces transmitted by the muscles. They also have the ability to change the direction of the pull because of their flexibility and resistance to extension (Jozsa, 1997). The parallel arrangement of fiber bundles enables the tendons to transmit high muscle forces to the bone for movement with minimal energy loss and deformation (Kirkendall, 1997).  Tendons are viscoelastic materials and sensitive to different strain rates. They undergo stress- relaxation, creep, and hysteresis, with the first two being the main features of biomechanical properties. As seen in figure 1.2A, stress-relaxation means that with the same degree of extension (deformation), the load required to maintain that extension decreases over time (Best, 1994). On the other hand, creep means that with a constant load, length (deformation) increases over time (Jozsa, 1997) (Figure 1.2B).   10    Figure 1.2  Graphic representation of the biomechanical properties of tendon. (A) Stress- relaxation (B) Creep (Kirkendall, 1997, reproduced with permission).  The characteristic mechanical behavior of tendon\u2019s unique structure and composition is illustrated by a typical stress-strain curve (Figure 1.3) (Wang, 2006). In the resting state, the collagen fibers and fibrils of the tendons have a wavy configuration. In the toe region, the wavy configuration of the tendon disappears when it is stretched by about 2%, corresponding to straightening of the fibers. The tendon resumes its normal wavy appearance when the tensile force is released (Jozsa, 1997). In the linear region of the curve, the tendon is stretched less than 4% and the collagen fibers lose their wavy appearance becoming more parallel. The slope of the curve in this region is referred to as the Young\u2019s modulus and is the elastic stiffness of the tendon (Wang, 2006). When the tendon is stretched more than 4%, microscopic tearing of the tendon occurs. The collagen fibers slide past one another as cross-links fail. Any further stretch leads to rupture and recoil of the tendon at the ruptured end. When the muscle-tendon-bone unit fails, the locations are bone, bone-tendon junction (osteotendinous junction), or muscle-tendon junction (myotendinous junction) (Kirkendall, 1997). These are the changes that occur in tendon rupture when the forces on the tendon exceeds its tensile strength. On the other hand, tendinosis (A) (B) 11   is described as intratendinous degeneration characterized histologically by intratendinous collagen degeneration, fiber disorientation, and vascular growth. There is no inflammatory cell infiltrate or swelling of the tendon sheath in tendinosis, but there can be a palpable tendon nodule (Khan, 1999). Tendinosis results in a decreased stiffness and Young\u2019s modulus, and tendinopathy alters mechanical and material properties of the Achilles tendon (Arya, 2010).  Figure 1.3   Stress-strain curve of a tendon (Wang, 2006, reproduced with permission). 1.3.4 Biomechanical testing: pilot study I conducted a pilot study to biomechanically test mice patellar tendons. Using the blunt end of the scalpel handle, the quadriceps muscle was removed by scraping. The tibia of the tibia-patellar tendon-patella complex was molded in glue and fixed with flat metal clamps provided by Bose. Custom-made grips were designed to hold the patella in place. The patella was clamped in 12   between two plastic screws with concave tips on the custom-made grips and tightened to hold it in place. Biomechanical testing was performed on a Bose ElectroForce 5100 Biodynamic test instrument (Bose Corporation, Eden Prairie, Minnesota) with a 22N load cell on tendons from C57Bl\/6 mice. The instrument was tuned in load and displacement control using Manual TuneIQ with a patellar tendon. Load control TuneIQ settings were: level 1, 0.5N; level 2, 1.5N; frequency, 2 Hz; 1000 cycles; and absolute position. Displacement control TuneIQ settings were: level 1, 0mm; level 2, 0.5 mm; frequency of 0.5 Hz; 1000 cycles; absolute position. Once the TuneIQ was successful, the sample to be tested was clamped on to the instrument. Each tendon was preloaded to 0.5N; at this point the length of the tendon can be measured (Lo) with a digital caliper. Preconditioning was established with loads of 0.5N to 1.5N at a frequency of 2 Hz in 10 cycles in load control (Sereysky, 2012). A compensation rate of 0.5% was applied to adjust for the decrease in load overtime due to stress-relaxation behavior of a tendon. Constant ramp to failure test was performed at a rate of 0.167 mm\/s in displacement control (Rigozzi, 2009). Preconditioning and preload (as seen in figure 1.4A) were done to obtain a uniform zero point and to allow the sample to settle into the testing apparatus (Provenzano, 2002). Displacement and load data computed from the software can be used to calculate stress-strain values. Strain is calculated by dividing the change in length by the original length of tendon. Stress is calculated by dividing the load by initial cross-sectional area. The following parameters can be calculated for each group: maximum load to failure, maximum normalized load, strain at 13   maximum normalized load, and stress at maximum normalized load. The load-displacement curve (Figure 1.4B) and stress-strain curve can be produced from this data.       Figure 1.4   Load-displacement curve. (A) Change in load and displacement with time. Preconditioning is done in the first 5 seconds as illustrated by the sine wave. In this region, there is minimal change in displacement, but it increases when ramp to failure starts after 5 seconds at -1 0 1 2 3 4 5 6 7 8 0 5 10 15 20 25 30 35 40 Time (seconds) Load Displacement -1 0 1 2 3 4 5 6 7 0 1 2 3 4 5 Load (N) Displacement (mm) Toe region Linear region Macroscopic failure 14   a rate of 0.167 mm\/s. (B) Patellar tendon of a C57Bl\/6 mouse (approximate age 24-28 week old) ruptured at the tibial insertion with a maximum load of 6.26 N. The length was not measured for this tendon; therefore, stress-strain data could not be produced. The shape of the graph is similar to the stress-strain curve, showing a toe region, linear region, and macroscopic failure at 6.26 N.  1.4 Tendon physiology 1.4.1 Response to exercise Tendons have been shown to undergo remodelling in response to exercise, and this response can be measured at the biomechanical, biochemical, and structural levels. Tendon has a capacity to adapt its structural and mechanical properties to the functional demands of the whole muscle- tendon unit (Buchanan, 2002). With respect to biomechanical properties, endurance training results in increased tensile strength and stiffness of the tendon. In a study done by Viidik et al., the rabbit tibialis posterior and Achilles tendon had increased stiffness of approximately 10% and tensile strength increase by approximately 5%, when these rabbits were trained for 40 weeks on a running machine (Viidik, 1967, 1969). Another study by Woo et al. of swine digital extensor tendons, a 12-month training program of running at maximum speed increased ultimate strength by 62%, along with an increase in stiffness (Woo, 1980). Therefore, there seems to be a correlation between increased tendon strength and stiffness associated with long-term training; however, this response seems to be better in growing animals than in adult animals (Jozsa, 1997).  Since collagen is the most abundant protein found in tendon, theoretically, it can be expected that there may be changes in collagen concentration. However, research studies done on Achilles 15   tendons of trained rats (Vailas, 1985), and chickens (Curwin, 1988), or peroneous brevis tendons of rabbits (Viidik, 1967) did not show any difference in collagen concentration when compared to non-trained animals or birds. It has been reported that mechanical failure in collagen is not due to breakage of tropocollagen molecules but pulling apart of adjacent molecules (Wainwright, 1967). An important factor in determining the stiffness and tensile strength of collagen is an inter-molecular cross-link molecule called pyridinoline (Eyre, 1984). It was found that tensile strength of rat patellar tendon during healing was directly related to pyridinoline concentration. Therefore, changes in the mechanical properties of tendon due to exercise may be associated with a change in concentration of pyridinoline cross-links (Chan, 1998). On the contrary, physical training in growing chicks decreased the number of cross-links. Curwin et al. suggested that exercise leading to increased collagen turnover results in an accumulation of immature collagen with decreased cross-links (Curwin, 1988). Overall, the data suggests that training does not increase collagen concentration. At a structural level, tendons of exercised rabbits, when compared to control animals, showed no difference in dry or fresh weights (Viidik, 1967). This finding was supported by few other studies that showed that training did not alter the dry weight of patellar tendon of trained rats (Vailas, 1985), or the Achilles tendon of trained chicks (Curwin, 1988). Studies of cross- sectional area (CSA) of tendons reported that there was in increase following long-term training (Woo, 1980; Birch, 1999). Microscopically, the collagen fibers and fibrils are thickened (Enwemeka, 1992), and these fibrils were more intensely packed in the Achilles tendon of rats after 30 days of exercise (Vilarta, 1989). 16   In summary, exercise in normal tendons immediately increases the uptake of blood flow, glucose, and oxygen. It improves protein production by tenocytes and increase in type I collagen production is observed even with a single exercise session (Langberg, 1999, 2007). An increase in cross-sectional area was also seen in tendons along with collagen fibril thickness and increase in concentration of nuclei. Long term training resulted in increased tensile strength and stiffness (Buchanan, 2002). The increased tenocyte activity leads to accelerated collagen synthesis and proteoglycan matrix (Jozsa, 1997).  1.4.2 Response to immobilization Immobilization has a negative effect on tendons, even though it is a slow process due to low metabolic rate and vascularity of tendons (Kannus, 1992). The tensile strength of the tendon decreases along with a reduction in elastic stiffness and total weight of the tendon (Woo, 1982). At a microscopic level, collagen fibers become thinner and disorientated, with longitudinal splitting of the fibers (Jozsa, 1984). Cross-links decrease in number. Immobilization of hind limbs of young rats for five weeks showed a decrease in the number of the thick collagen fibrils, as well as the average diameter of the fibrils (Nakagawa, 1989). Proteoglycan content is also shown to be decreased, with tenocytes showing alteration in size and shape of mitochondria and nuclei (Jozsa, 1989). The activity of enzymes catalyzing collagen biosynthesis was decreased in immobilized Achilles tendons (Karpakka, 1991). The biosynthesis of new collagen is likely to be decreased during immobilization; however some studies show that hydroxyproline, an indicator of collagen concentration, remains unchanged during moderate immobilization. Overall, total hydroxyproline maybe decreased during immobilization due to reduction in collagen synthesis 17   (Akenson, 1973; Sayolainen, 1988). The effects of exercise and immobilization on tendon tissue are summarized in Figure 1.5. 18    Figure 1.5   Schematic presentation of the effects of training and immobilization on the quality of tendon tissue (Kannus, 1997, reproduced with permission).  1.4.3 Effects of aging As a person ages, changes are seen in both the collagenous and noncollagenous component of tendons (Jozsa, 1997). The collagen content does not change much in old age; however, there is a decrease in the proportion of proteoglycans and glycoproteins present. The elastic component and water content increase into early adulthood and decrease with old age. Cross-linking of tropocollagen molecules in collagen increases with aging, and this causes a decrease in collagen solubility (Best, 1994). The number of thick fibrils, as well as the diameter of these fibrils, is also decreased (Nakagawa, 1994). There is a decline in collagen turnover as the tenocyte number decreases with aging as well. With a reduction in tensile strength, the collagen becomes tougher, 19   its fibers shrink, and the tendon becomes stiff. With an overall decrease in elastin, proteoglycan, and water content, there is reduction in tendon elasticity as well. A decrease in tendon blood flow and tenocyte activity affects its repair ability. Due to all these changes, an aged tendon is weaker and more likely to tear from overuse injury (Jozsa, 1997). 1.4.4 Gender influences With respect to gender, most tendon injuries occur in males with a ratio of 7 to 1 and 4 to 1 in Achilles tendon ruptures (Wong, 2002). Sixty percent of the overuse injuries occur in males (Segesser, 1980). Majority of the Achilles tendon injuries from sports occur in males because of their higher rates of participation in sport (Kvist, 1994). Larger cohort studies have also found that females have a decreased risk for developing patellar tendinopathy (Cook, 2000). Women under the age of 30 are also at the greatest risk for overuse injuries (Maffulli, 2003), as the proportion of female participants has increased in the past few decades (Maffulli, 2002). Tendinopathy induced through work, which involves repetitive overloading of the muscle-tendon unit, is present in over 60% of women, with a mean age of 41 years. The upper limb is involved in 93% of the cases of which 63% occur in the forearm, and 24% is elbow epicondylitis (Kivi, 1984).  1.5 Tendon injury and repair 1.5.1 Phases of healing and cells There are three phases of healing that are initiated by the body when tendons are injured. The homeostasis\/inflammation is the initial phase that occurs immediately after tendon injury. 20   Erythrocytes, and inflammatory cells as neutrophils, enter the site of injury. Monocytes and macrophages predominate in the first twenty-four hours to phagocytose the necrotic material. As vasoactive and chemotactic factors are released, there is an increase in vascular permeability, initiation of angiogenesis, tenocyte proliferation, and recruitment of more inflammatory cells (Murphy, 1994). The migration of tenocytes to the wound initiates synthesis of type III collagen (Oakes, 2003). The second phase of proliferation\/fibroplasias phase begins after a few days. The synthesis of type III collagen is increased and lasts for few weeks, along with an increase in water content and glycosaminoglycan concentrations, and fibroblasts are the predominant cells (Lin, 2004). The remodelling\/maturation phase begins after about six weeks, with a decrease in cellularity, and collagen and glycosaminoglycan synthesis. It is further divided into consolidation and maturation stage (Tillman, 1996). In the consolidation stage (from six to ten weeks), (i) the repair tissue changes from cellular to fibrous, (ii) tenocytes and collagen fibers become aligned in the direction of stress (Hooley, 1979), and (iii) type I collagen is synthesized in increasing amounts (Abrahamsson, 1991). The maturation stage begins after ten weeks, in which fibrous tissue changes to scar-like tendon tissue over the ensuing year (Hooley, 1979; Parkas, 1973). There is more type I collagen compared to type III in this phase, with accumulation of collagen cross-links (Sharma, 2005). Extrinsic and intrinsic healing are two models of tendon healing. In extrinsic healing, the tendons are thought to have no internal ability to heal on its own (Potenza, 1962, 1969), and require invasion of cells from the surrounding sheath and synovium (Sharma, 2005). Therefore, this type of healing results in the formation of adhesions due to inflammatory cells infiltration with 21   fibroblasts and new blood supply derived from surrounding tissues (Potenza, 1962, 1969). Cells from the tendon sheath produce less collagen and GAG compared to epitenon and endotenon cells (Sharma 2005). On the contrary, in intrinsic healing the tendon is believed to heal by proliferation of epitenon and endotenon tenocytes with intratendinous blood supply (Mass, 1991). Epitenon tenoblasts initiate the repair process through proliferation and migration (Manske, 1985). Internal tenocytes secrete larger and more abundant collagen fibers than epitenonon cells, thereby contributing to the intrinsic repair process (Fujita, 1992). Fibroblasts in the epitenon and tenocytes synthesize collagen during repair. Collagen is initially synthesized by epitenon cells, and later by endotenon cells (Ingraham, 2003). There are fewer complications and improved biomechanics with intrinsic healing. With this type of healing, a normal gliding mechanism is preserved within the tendon sheath (Koob, 2002). On the other hand, extrinsic healing leads to scar tissue which results in adhesion formation, and this disrupts gliding. The biochemical and mechanical properties of healed tendon never match those of an intact tendon. For instance, the rupture force of a spontaneously healed transected sheep Achilles tendon was only 56.7% of normal at 12 months (Bruns, 2000), which could be due in part to the absence of mechanical loading, and thus de-adaptation of the tendon as a whole, during the immobilization period (Sharma, 2005). 1.5.2 Growth factors Cellular growth factors and cytokines are important for their roles in embryonic tissue differentiation and during wound healing (Gabra, 1994; Goomer 2000). Growth factors stimulate cell differentiation, chemotaxis, angiogenesis, and ECM synthesis (Mason, 1941; Nakamura, 22   1998). The influence of growth factors on tendon healing was studied by comparing the cytokine profiles of injured and normal tendons. It was shown that wounding and inflammation cause release of growth factors (Nakamura, 1996; Party, 1978). Growth factors such as platelet derived growth factor (PDGF), transforming growth factor-\u03b2 (TGF-\u03b2), insulin-like growth factor-1 (IGF-1), vascular endothelial growth factor (VEGF), and basic fibroblast growth factor (bFGF) are upregulated throughout tendon repair. They are produced by intrinsic and extrinsic cells and have dose dependant effects. Not only do they require specific receptors to be active, but they also work together with other signalling molecules (Molloy, 2003). (i) Platelet-derived growth factor: PDGF is a group of dimeric polypeptide isoforms consisting of three types of structurally similar units (Molloy, 2003). Healing tendons have an increased concentration of PDGF. PDGF influences the rate of fibroblast proliferation; also, chemotaxis and collagen synthesis are somewhat elevated (O\u2019Brien, 1992). PDGF is thought to play a significant role in the early stages of healing, by inducing the synthesis of other growth factors, such as IGF-1 (Lynch, 1989). Yoshikawa et al. show the role of PDGF during tissue remodeling. It was observed to stimulate both collagen and non-collagen protein production and DNA synthesis in a dose-dependent manner (Yoshikawa, 2001). (ii) Insulin-like growth factor: The upregulation of IGF-1 during the initial repair process and the inflammatory phase stimulates the migration and proliferation of fibroblasts and inflammatory cells to the wound site (James, 2008; Kurtz, 1999). James et al. also 23   mentioned that IGF-1 may be stored as an inactive precursor protein in normal tendon, and released as a growth factor by enzymes upon injury. The local increase of IGF-1 after soft tissue injury, at both the mRNA and protein levels, is associated with corresponding up-regulation of its receptors (Bos, 2001; Edwall, 1989). In the later phases of remodeling, IGF-1 functions in stimulating synthesis of collagen and other ECM components. This is shown by in vitro studies and it has been reported that these effects are dose-dependent (James, 2008). Overall, IGF-1 stimulates the proliferation and migration of fibroblasts and other cells at the site of injury, followed by increase in collagen production and other ECM components during remodeling stages. (iii) Transforming growth factor-\u03b2: In the healing process of an injured tendon, TGF-\u03b2 plays an important role in directing the fibroblast migration (Roberts, 1988), neovascularization, and secretion of ECM proteins like procollagen type I and III (Kashiwagi, 2004). It is normally expressed in the process of inflammation and reorganization at 4 and 7 days, but its expression decreases at 2 and 4 weeks (Chan, 2003), which may  be due to loading and mobilization of the tendon (Eliasson, 2009). It is also shown that this TGF-\u03b2 expression increases again at 8 weeks. The changes in expression reflect the initial inflammation and activation of cells, followed by intermediary period, and then the remodeling of the tendon with increased apoptosis of cells (such as fibrocytes) that are no longer necessary (Jorgensen, 2005; Wurgler- Hauri, 2007). In a healing tendon, TGF-\u03b2 induces the expression of collagen I and III, 24   and accelerates the healing process by improving the mechanical properties of the tendon (Hou, 2009); Kashiwagi, 2004). (iv) Vascular endothelial growth factor: During early granulation tissue development, VEGF is required for the formation of an initial vascular plexus. In neovascularization, which occurs during the repair stage of tendon healing, VEGF contributes to vascular bud formation and endotheliocyte migration (Muller, 2012). VEGF is expressed in the healing tendon, along with increased expression of receptors 1 and 2 (Petersen, 2003). In a healing tendon, VEGF increases vascularization from 1 to 8 weeks after rupture (Hou, 2009). It is essential for establishing and maintaining the vasculature present in the endotenon and epitenon (James, 2008). (v) Basic fibroblast growth factor: bFGF increases cellularity during the early healing process in a healing tendon (Chan, 2008). In the ECM, it increases lubricants and matrix metalloproteases (MMPs) during the first week, therefore, creating the space needed for additional tenoblasts and tenocytes (Thomopoulos, 2010). The initial increase in bFGF stimulates the proliferation of tenocytes and fibroblasts needed for ECM repair (Muller, 2012). (vi) Bone morphogenic protein -12: BMP-12 plays an important role in tendon healing as it increases tendon callus and improves mechanical properties such as, strength and stiffness (Forslund, 2003; Majewski, 2008). In the first week of healing, BMP-12 leads to a more organized tendon tissue (Murray, 2007), higher volumes of collagen I, and an earlier of fibroblasts to fibrocytes (Majewski, 2008). 25   1.6 Epidemiology of tendinopathy 1.6.1 Prevalence of different tendinopathies Overuse injuries of tendons are usually induced through work or sports due to overloading of muscle-tendon work unit, and tendinopathy is the most commonly diagnosed musculoskeletal disorder (Forde, 2005). Work induced overuse injuries are of upper extremities and a risk for those manual workers who engage in repetitive or forceful movements (Jozsa, 1997). Common upper extremity tendinopathies include rotator cuff injury, lateral and medial epicondylitis, and De Quervain\u2019s tenosynovitis. Shoulder tendinopathies in physical workers have an incidence of 4% to 56% for hand and wrist tendinopathies, and this risk is increased with a combination of high force, repetition, or exposure to vibration during repetitive work (Werner, 2005). Lateral epicondylitis or tennis elbow is common in athletes of all ages, with an incidence of 9% to 40% in tennis players (Maffuli, 2003; Scott, 2006). It is 5 to 10 times more common than medial epicondylitis (Hume, 2006), and also 2 to 3.5 times more frequent in people over the age of 40 (Scott, 2006). Rotator cuff tendinopathy represents 18% of overuse injuries in adult athletes (Maffuli, 2003), and anterior shoulder pain due to this condition is often present in swimmers (Scott, 2006). Bicipital tendinopathy is the most common occurring pathology in the wheelchair population (Finley, 2004), as the shoulder is reported as the most common site of pain (Kaplan, 2005). De Quervain\u2019s disease seems to be the best known form of paratendinopathy of the wrist and hand, which is caused by stenosing tenosynovitis of the first dorsal compartment of the wrist. It is approximately six times more common in women than in men (Maffuli, 2003). 26   Achilles tendinopathy is the most prevalent tendinopathy of lower extremities with a frequency of 50% in elite endurance athletes and 5.9% in sedentary individuals (Scott, 2006; Fredberg, 2008). It is highest in individuals participating in sports such as long-distance running, tennis, badminton, and soccer (Kvist, 1994).  Mid-portion tendinopathies and insertional problems are the most common clinical Achilles disorders (Jarvinen, 2005).Achilles tendinopathy is more prevalent in males because of their higher rate of participation in sports (Kvist, 1994). One quarter of the athletes that are treated for a knee injury are diagnosed with tendinopathy. The most common knee disorder is the jumper\u2019s knee, which has an incidence of 7 to 40%. Patellar tendinopathy represents two-thirds of knee conditions induced by volleyball or basketball practice (Scott, 2006). Males are affected twice as often as females due primarily to their activity levels (Mafulli, 2003). Hamstring tenosynovitis accounts for 3% of knee problems and is present in patients active in sprinting, jumping, and soccer (Maffuli, 2003). Greater tronchanteric pain syndrome is mainly caused by tendinopathy of the gluteus medius tendon (Bard, 2009). It has an incidence of 1.8 patients per 1000 per year, and a higher prevalence in women and in patients with coexisting back pain, osteoarthritis, iliotibial band tenderness, and obesity (Williams, 2009). 1.6.2 Risk factors There are intrinsic and extrinsic risk factors that interact, making an individual more susceptible to tendon injury. The most common intrinsic risk factors are alignment abnormalities, leg length discrepancy, muscle weakness and imbalance, decreased flexibility, joint laxity, female sex, aging, and overweight obesity (Josza, 1997). 27   The most common misalignment in the foot is hyperpronation. Excessive and prolonged pronation during walking or running creates increased stress on the soft tissue of the foot, resulting in an angular traction (whipping or bowstring action) on the Achilles tendon. It can cause secondary effects to the lower extremities resulting in lower leg and knee problems, and can also occur because of anatomic reasons such as leg length discrepancy (LLD) (Renstrom, 1985). LLD of 5-6mm may be symptomatic; however, proper shoes with orthotics are required for 10 mm discrepancy or more to prevent overuse symptoms. Biomechanical alterations may occur due to LLD such as the pelvic tilting to the shorter side resulting in lumbar scoliosis and compression of the inner intervertebral disc, along with excess foot pronation of the foot on the longer or shorter side. Therefore, LLD is may be a factor in development of lower back pain, hip osteoarthritis, patellar tendinitis, and stress fractures (Renstrom, 1991). Muscle imbalance refers to asymmetry between the extremities, or the agonist and antagonist muscles in one extremity. No direct relationship has been found between muscle weakness or imbalance, and injury. It is also not clear if muscle imbalance is a causative factor for reinjury as persistent joint instability, pain, swelling, and impairment of neuromuscular coordination are also involved (Jozsa, 1997). Musculotendinous flexibility is also important for physical performance and for prevention of sports injuries such as muscle spasm, muscle rupture, tendinitis, and patellofemoral pain syndrome. As with muscle imbalance, there is not enough evidence that musculotendinous tightness is the cause of injury (Jozsa, 1997). Joint laxity or instability can be caused by a ligamentous injury, and lead to problems in knee, ankle, and shoulder joints, and their tendons. The participation of women in sports has increased over the years, but studies also show that 28   there is a higher incidence of tendon injuries among women than men during athletic endeavours (Drinkwater, 1988; Kannus, 1987). This could be due to their weaker musculoskeletal system not being able to absorb the repetitive impact loads on the body, compared to the musculoskeletal system of men of equal body weight. Women have less muscle mass per body weight (20 to 25%) than equally trained men (40%), and their overall muscle strength averages about two- thirds to that of men (Drinkwater, 1988). Along with other functions of the body, the musculoskeletal system is also affected with age. Sports injuries in elderly athletes are more frequently overuse-related rather than acute, and more commonly degenerative (Jozsa, 1997). Being overweight has been associated with many diseases such as diabetes, hypertension, stroke, osteoarthritis, gall stones, and lung emphysema. In full weight bearing recreational physical activities, being overweight may be a problem due to development of knee and hip osteoarthritis (Hartz, 1986). Tendon overuse symptoms may also be associated with overweight (Jozsa, 1997). The extrinsic risk factors are those that act externally on the human body. The most common extrinsic risk factors are training errors, poor environmental conditions, and equipment. Training errors account for 60-80% of tendon and other overuse injuries (James, 1978). These result from a distance that is too long, a training intensity that is too high or progressed too quickly, and excessive hill work (whether uphill or downhill). Poor technique and fatigue also play a role in injury development, and if repeated continually, can cause tendon overuse injuries. Fatigued muscles have a decreased ability to absorb repetitive shock or stress, and can result in overuse injuries such as tennis elbow, Achilles tendinopathy, and medial tibial stress syndrome (Jozsa, 1997). Environmental conditions such as extreme temperatures, humidity, and high altitude can 29   all play a role in overuse injury pathogenesis. In sports like downhill or cross-country skiing, ski jumping, and mountain climbing, low temperature can inhibit contractility and decrease the shock absorption capacity of the tendon muscle units. Improper equipment may promote overuse injuries. For instance, a tennis racket that is too stiff in composition or strung too tightly can transmit increased forced and initiate symptoms of tennis elbow. Use of proper equipment is a way to prevent many sports injuries (Jozsa, 1997).  1.7 Summary: literature on link between tendinopathy and cardiovascular disease\/lipids Hypercholesterolemia is defined as the presence of high levels of cholesterol in the blood. It is a risk factor for many conditions such as cardiovascular disease (Romero-Corral 2006), kidney disease (Chalmers, 2006), and type 2 diabetes mellitus (Smith, 2001). Hypercholesterolemia has been reported to affect approximately 17% of the US population 20 years and older (Schober, 2007). Recent research suggests that some musculoskeletal problems may be linked to hypercholesterolemia. Tendinopathy, a major cause of morbidity in the work force (Pottie, 2006), has traditionally been thought to occur as a consequence of increased mechanical loading (i.e. overuse) (Gaida, 2008). However, one third of the cases for midportion Achilles tendinopathy occur in sedentary individuals, and it is often observed in overweight individuals (Rolf, 1997). In the study by Rolf et al (Rolf, 1997), surgeries were performed on patients suffering from achillodynia. Most of the cases were associated with sports activity, but 31% of the patients had no association with sports or excessive physical activity. 30   Cross sectional data from research studies suggested that patients with chronic Achilles tendinopathy demonstrated dyslipidemia, characterized by lower HDL-C and higher TG levels (Gaida, 2009). Similarly, Ozgurtas et al. reported increased total cholesterol, LDL-C and TG levels, and lower HDL-C levels in patients with Achilles tendon ruptures compared to patients without rupture. The mean age was 25.7 years in the study group of 47 patients and 32.6 years in the control group of 263 subjects. Blood samples were obtained from the patient group within 6- 8 hours following Achilles tendon rupture (Ozgurtas, 2003). Dyslipidemia is also associated with rotator cuff tears. Compared to controls, patients with torn rotator cuff tendons had increased total cholesterol, TG, LDL-C and decreased HDL-C (Abboud, 2010).  Serum levels and lipid profiles were collected from 74 patients with rotator cuff tears, with mean age of 66.3 years. The control group consisted of 73 patients with shoulder complaints unrelated to tendons (mean age 67.4 years). Another research study further supports the deposition of lipid in tendons. Tissue samples prepared from tendons from necropsy from subjects ages 5-88 were stained in Oil Red O, Sudan black, and bromine Sudan black. Lipids accumulated in tendons in ages 40 and on. Lipid deposits in tendons were extracellular and arranged as finely dispersed droplets along the axis of collagen fibers. Histochemical results showed that the tendon deposits contained mainly cholesterol in its esterified form (Adams, 1974). The link between hypercholesterolemia and tendon pathology is highlighted by research on tendon xanthomas, a dramatic but common occurrence in patients with severe, familial hypercholesterolemia (Tsouli, 2005). Tendon xanthomas are characterized as a painful 31   thickening of the tendon which can lead to spontaneous tendon rupture (Fahey, 1973; Lehtonen, 1981); the pathology is driven by an accumulation of cholesterol in tendon both extracellularly and intracellularly (Kruth, 1985). An increase in tendon size is observed in Achilles tendon xanthoma due to lipid infiltrating the tendon and the surrounding tendon sheath, as well as a local inflammatory reaction with peritendinous edema, the combination of which results in a painful thickening (Galloway, 1940).  1.8 Animal models for studying tendon Animal models are used to study human diseases to allow in-depth studies on etiology, molecular mechanisms, and potential treatment. Variation among animals is easier to control, making it possible to isolate the effect of a single factor. Unlike humans, it is easier to obtain tissue samples in animals, even at early time points in the pathological process. Using a single animal model would not be realistic to study all aspects of tendinopathy, as every animal model has its advantages and disadvantages. To be considered a valid model for tendinopathy, the animal needs to consistently replicate clinical, histopathological and functional characteristics of tendinopathy in humans (Lui, 2010). Horses and dogs have been used in the past and developed tendinopathy when trained and raced (Dowling, 2000; Fransson, 2005). Due to the anatomical differences between quadriceps and bipeds, along with their large size and high costs, they are not considered practical laboratory animal models for tendinopathy (Lui, 2010).  Current animal models frequently being used are rats and rabbits as they are less costly and 32   easily available compared with large animals. The larger tendons in rabbits provide larger samples for analysis, and make it easier for manipulation during surgical procedures, whereas rats are more resilient and have frequently been used in studies of running-induced tendinopathy. Despite this, both animal models are popular but having a better understanding about their behaviour and physiology is essential (Lui, 2010).  One of the challenges in using animal models is that tendinopathy is defined as an activity related pain with tendon thickening. This causes some limitations as it is not possible to directly ask the animal how much pain it experiences in response to its athletic performance. Rather, the animal is monitored, and the pain is related to gait pattern or withdrawal reflex. However, these patterns are easier to observe in large animals like horses than small animals like mice and rats. As mentioned earlier, there is no validated animal model for all tendinopathies observed in humans. Mice are considered an appropriate species for human diseases mainly due to their lower cost, short life cycle, and availability. Transgenic and knockout mice provide tools for understanding the pathophysiology of tendinopathy. Even then, the use of mice is limited as its small size causes difficulty in manipulation such as intratendinous injection, histology, biomechanical testing, functional testing, and sample amount. Overall, it is necessary to study the behavioural changes, such as stress, pain, and discomfort, during the establishment and use of the animal models (Liu, 2010).  33   1.9 Summary of findings from ApoE-deficient mice 1.9.1 Importance of ApoE ApoE is one of the lipoprotein transfer genes that functions in a receptor-mediated lipoprotein removal from the blood. It is a glycoprotein synthesized in the liver and brain, and a constituent for all lipoproteins except LDL. Furthermore, it is a ligand for receptors that clear chylomicrons and very low density lipoproteins (VLDL) remnants (Meir, 2004). Synthesized by monocytes and macrophages in vessels, it has effects on cholesterol homeostasis and inflammatory reactions in atherosclerotic vessels (Curtiss, 2000). 1.9.2 ApoE-deficient mouse Genetic variation at the ApoE locus is suggested to be associated with increased risk of developing atherosclerosis and hypercholesterolemia. Knockout mice are used to study gene function by creating mice without the desired gene. Mice deficient in ApoE is the first animal model used for atherosclerosis, and to show the importance of high density lipoproteins in preventing atherosclerosis (Plump, 1995). Mice are considered the mammalian system of choice to study the genetic contributions to disease because of their advantages like easy breeding, short generation time, and availability of inbred strains. They are normally resistant to atherosclerosis but ApoE deficiency leads to severe hypercholesterolemia that makes them highly susceptible to this disease (Jawien, 2004). This condition is known to be similar in humans (Plump, 1995). However, there are differences as well, the most obvious being the life span of a mouse which is 2 years, compared to about 75 years in humans. Mice also weigh much less, and their lipid profile is very different that in 34   humans. Mice carry most of their cholesterol on HDL lipoproteins whereas human carry about 75% of their plasma cholesterol on LDL (Jawien, 2004). ApoE deficiency results in an inability to clear plasma lipoproteins. When fed a low-fat diet of mouse chow, ApoE-deficient mice develop significant hypercholesterolemia and have increased sensitivity to dietary fat and cholesterol (Plump, 1995). They have high levels of plasma cholesterol (500 mg\/dl) compared with wild type mice (60-90mg\/dl). On high fat diet, their plasma cholesterol levels increase to greater than 2000 mg\/dl (Curtiss, 2000), and they also develop complex lesions. Macrophages are present in these lesions as their function is to phagocytose modified lipids, lipoproteins, and cell debris, which leads to formation of foam cells (Jawien, 2004).  1.10 Objectives The overall objective is to study the link between hypercholesterolemia and tendon pathology by using the Apolipoprotein E-knockout (ApoE-KO) mice model. The ApoE-KO mice will be fed a high fat or regular diet starting at 7 weeks of age. This diet is known to cause rapid development of hypercholesterolemia and atherosclerosis, and is widely used by academic and industry research as a valid model of cardiovascular disease (Plump, 1995).  The animals will be sacrificed at 0, 15, and 30 weeks.  Tendon structure and function will be examined using validated measures. C57Bl\/6 mice will be used as controls for both on and off high fat diet. 35   1.11 Aims To determine if, after 15 or 30 weeks on either a normal or high fat diet, ApoE-KO mice demonstrate the following changes, in comparison to wild type controls: 1) An increase in lipid deposition in the Achilles tendons. 2) An increase in the cross-sectional area of patellar tendons. 3) Changes in gene expression of Cpa3, TGF-\u03b2, Col1a1, or Col3a1 levels in the tail tendons. 1.12 Hypotheses We hypothesize that ApoE-KO mice will demonstrate, in comparison to wild type mice (WT): 1) Increased lipid deposition in the Achilles tendon, as measured by the positivity ratio of Oil Red O staining 2) Increased patellar tendon cross-sectional area, as measured by high resolution ultrasound 3) Increased gene expression levels of Cpa3, TGF-\u03b2, Col1a1, and Col3a1, as measured with quantitative PCR We further hypothesize that mice fed a high fat diet will demonstrate the same changes outlined above, in comparison to mice receiving a normal diet. 36   1.13 Significance of research Tendon problems and cardiovascular disease are both very prevalent in our society, and the paradox has often been noted that tendon problems are associated with increased mechanical demand on the one hand (e.g. athletes, workers), and with sedentary behavior and hypercholesterolemia on the other hand. The latter finding has received very little scientific or clinical attention. Studies on high cholesterol and tendon pathology can allow us to determine the link between the two, and if mechanism found, potentially therapeutic interventions can be used. In the future, the presence of tendinopathy could be seen as a prompt to measure serum cholesterol.    37   Chapter  2: Materials and Methods 2.1 Mice All animal procedures were performed according to the guidelines for animal experimentation approved by Animal Care Committee of University of British Columbia. Male wild type C57Bl\/6 mice were purchased from Charles River Laboratories (Wilmington, MA, USA) and ApoE-KO mice were purchased from The Jackson Laboratory (Bar Harbor, Maine, USA). The knockout mice were derived from a C57Bl\/6 background. ApoE-KO mice were bred on site and housed at the animal facility at Jack Bell Research Centre (JBRC). 2.2 Diet All mice were fed either a high fat (21.2% fat, TD.88137, Harlan Tekland, Madison, WI) or regular chow (PicoLab Mouse Diet 20: 5053, LabDiet; Richmond, IN) diet beginning at 7 weeks of age for either 15 or 30 weeks. At 7 weeks of age, the animals were weighed and their initial age and weights were recorded (see Appendix A). While on diet, mice were checked twice per week and weighed once per week, and their weights were recorded on the Animal Monitoring Sheet (see Appendix B), along with any abnormalities observed. Their daily food intake was estimated by weighing food given and food remaining at each feeding, which was also done once a week. If mice developed cutaneous xanthomas or skin lesions, they were monitored closely every day. At the early signs of xanthoma development, the mice had their nails trimmed and hair shaved under anesthesia, and the corticosteroid ointment Theraderm was applied directly to the skin lesions. The degree of severity of skin lesions was determined by the animal care staff at 38   JBRC. Animals with severe skin lesions were considered for euthanasia if they exhibited ongoing distress and pain medication did not improve the condition within 6-7 days. 2.3 Tissue collection and processing At their respective time points, the mice were weighed again (see Appendix A) and anesthetized. Isoflurane was used as an anesthetic agent with a calibrated vaporizer. The animal to be anesthetized was placed inside an induction chamber. The chamber was loaded with 5% isoflurane and 2 liters\/minute oxygen for one to two minutes. The mouse was monitored closely by observing respiration changes. Once the breathing became slow but frequent, the pain reflex was checked (toe pinch of hind limb). If there was no response, the mouse was transferred onto a heating pad and isoflurane delivery continued through a mask it. The pain reflex was assessed again, i.e. loss of toe pinch reflex. The vaporizer was adjusted to 2-3% isoflurane to ensure proper depth of anesthesia. Following anesthesia, the mouse was placed on the heating pad in dorsal recumbency (on its back). Blood was drawn using a cardiac puncture procedure under general anesthesia, isoflurane. By placing fingers around the chest to secure the mouse and using a 1-3 ml syringe with a 21- 22g needle, the needle was inserted into the chest caudal to the xyphoid process at a 30 degree angle aiming at the left shoulder. Approximately 1 ml of blood was collected, following which it was ensured that the mouse was dead by performing cervical dislocation. These mice were then used to harvest tendon samples: tail, patellar, and Achilles tendons. Two tail tendons were harvested from each mouse and stored in an RNA preservative (RNAlater) at -20\u00b0C for qPCR gene expression experiments. Patellar tendons were dissected 39   from both limbs of each mouse with patella-patellar tendon-tibia as one unit. They were wrapped in phosphate buffered saline-soaked gauze and frozen at -20\u00b0C until testing. Achilles tendons were removed with the gastrocnemius muscle attached, frozen with Tissue Tek Optimal Cutting Temperature (OCT) Compound, and stored at -20\u00b0C until further processing. Mice that developed cutaneous xanthomas were treated accordingly and monitored closely. If there was no improvement, and the xanthomas worsened (greater than 1 cm 2 ) and caused obvious discomfort, the mouse was sacrificed before its time point. Tendons were collected from three of these mice and only included in the analysis of qPCR experiments, but not for morphological measurements (histology or cross-sectional area). 2.4 Histology Frozen samples of Achilles tendon embedded in OCT were sent to a certified histology laboratory for hematoxylin & eosin (H&E) and Oil Red O staining (Centre for Translational and Applied Genomics, BC Cancer Agency, Vancouver, B.C.). For H&E staining, the frozen section slides of Achilles tendons were fixed in formalin, washed in water, and stained in Selectech Hematoxylin 560 (Leica Biosystems, Concord, ON). After staining, the slides were washed in water, differentiated in Selectech Define with base Selectech Bluing (Leica Biosystems, Concord, ON). Once again, these slides were washed in water, followed by staining in Selectech alcoholic Eosin Y 515 (Leica Biosystems, Concord, ON). The changes were done in 95% alcohol, 100% alcohol, and xylene, and then mounted. The H&E stained slides were viewed under a Zeiss Axiophot Upright Light Microscope (Carl Zeiss Microscopy, Thornwood, NY, USA). 40   For Oil Red O staining, sections of frozen tissue were cut in the cryostat onto charged slides. These slides were rinsed in 70% isopropanol and stained with a solution of Oil Red O. Working Oil Red O solution was made with 70 ml stock Oil Red O (approximately 0.5g per 100 ml of 100% isopropanol) and 30 ml dH2O. Before mounting with ImmunoHistoMount TM  (ImmunoBioScience Corp, Mukilteo, WA, USA), the slides were counterstained with hematoxylin. Oil Red O stained slides were also viewed using the same microscope as for H&E stained slides, and were blinded using a random number generator. These slides were sent to St. Paul\u2019s Hospital (Vancouver, B.C., Canada) for digital slide scanning using an Aperio Scancope XT (Aperio Technologies, Vista, CA, USA). This is a brightfield system that digitizes entire microscope slides at 20X and 40X magnification and provides high resolution images \u2013 approximately 0.5 microns\/pixel for 20X and 0.25 microns\/pixel for 40X scans (Model: Aperio Scanscope XT, 120 slide capacity; Objective lenses: Olympus 20X\/0.75NA Plan Fluor, Olympus 40X\/0.75NA UPlanFL N). The digital scanned images were viewed and the Oil Red O staining was quantitated using ImageScope TM  viewer software ((Aperio Technologies, Vista, CA, USA). The digital magnification was set at 2X, and the largest tendon region visible on the screen was chosen as the area of interest. Any folded regions of the tendon and aponeurosis were excluded. The largest possible tendon region was selected using a rectangle tool, followed by selecting the Positive Pixel Count algorithm (Version 9.1) for analysis. The hue value was changed to zero (red hue). A trial analysis confirmed that the algorithm successfully captured only red hued pixels. 41   2.5 Cross-sectional area Prior to measuring cross-sectional area (CSA), the patellar tendons were trimmed to remove as much of the retinaculum and peritendinous tissue as possible, using the EMZ Zoom Stereo Microscope (Meiji Techno Co. Ltd, Santa Clara, CA, USA). Ultrasonography was used to determine the cross-sectional area of the tendon. The patella was clamped on one side into a metal clamp, and tibia on the other side, leaving the patellar tendon in the middle. The whole specimen with the metal clamps was submersed in phosphate buffered saline (PBS). CLI 1500 Water-Path Diagnostic Ultrasound Probe 35 MHz transducer (E-Technologies, Inc., Davenport, IA, USA) was used to scan the tendon in a transverse direction with a sweep angle of ten degrees. The image captured in the Reflex Ultrasound Bio-Microscope software (E- Technologies, Inc., Davenport, IA, USA) was outlined to calculate the tendon\u2019s CSA. CSA was measured twice for each tendon, and the correlation coefficient was calculated for reliability. Test-retest reliability of patellar tendon CSA measurements had a correlation coefficient of 0.81. 2.6 RNA isolation and quantitative PCR 2.6.1 RNA isolation Total RNA was extracted from tail tendons of both ApoE-KO and C57Bl\/6 mice on high fat and normal diet for 30 weeks, following the methods used in mouse patellar tendon injury studies (Scott, 2011; Sharma, 2011). Tail tendons stored in RNAlater at -20\u00b0C were transferred to a new eppendorf tube, and washed three times with nuclease-free water. They were flash-frozen immediately in liquid nitrogen, followed by placing these frozen tendons in a liquid nitrogen- cooled vial together with a liquid nitrogen-cooled stainless steel ball. The tendons were 42   powdered in a tissue mill (Mikro-Dismembrator S, Sartorius, Goettingen, Germany) for 30 seconds at 3000 RPM in cryogenic tubes (Nalgene, Rochester, NY). 1ml of Trizol reagent (Ambion by Life Technologies, Burlington, Ontario, Canada) was added to the powdered tissue, followed by mixing until all the powder was dissolved. These samples were stored at -80\u00b0C for at least 30 minutes before continuing onto the extraction step. 2.6.2 RNA extraction For extraction, the samples were thawed at room temperature. Equal amounts of chloroform (Fisher Scientific, Fair Lawn, New Jersey, USA) was added, mixed by shaking vigorously for 30 seconds, and incubated for 1-2 minutes. The samples were centrifuged at 12,000 rpm for 15 minutes at 4\u00baC (Sorvall Legend Micro 21R Centrifuge, Thermo Scientific). The top aqueous layer containing RNA was transferred to a new tube and used for purification. 2.6.3 RNA purification The RNA extracted was purified using the QIAGEN RNeasy\u00ae Mini Kit (Qiagen Inc., Toronto, Ontario, Canada) for the first four samples (49, 22, 23, 24) randomly chosen for the experiment. Only four samples were purified using this kit due to the availability of the materials. RNA yields were checked for these samples and compared with the rest of the samples. The housekeeping gene values were also checked for consistency, as their threshold cycle is expected to be between 14 and 16. The purification procedure was followed according to instructions provided by the manufacturer (Qiagen Quick-Start Protocol, steps 2-7). Ethanol was added to the samples, and transferred to the RNeasy spin columns. Several wash steps were carried out with the buffers provided in the kit. After the final wash, RNA was eluted with 30\u00b5l of RNase-free 43   water. The rest of the 50 samples were purified using Thermo Scientific GeneJET RNA Purification Kit. The procedure was followed as outlined in Thermo Scientific GeneJET RNA Purification Kit Handbook (page 6-7, steps 4-10). 100\u00b5l of RNA was eluted for all the samples purified using this kit. RNA concentrations were measured using the NanoDrop 2000 Spectrophotometer and software. All RNA samples were stored in -80\u00b0C until further use. 2.6.4 cDNA synthesis and qPCR Each tail tendon sample was analyzed in triplicates for qPCR analysis, and standard errors of all the samples are listed in Appendix E. Sample with the lowest RNA concentration was used to calculate the amount of RNA needed for cDNA synthesis and quantitative PCR (qPCR). RNA was reverse-transcribed using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City, CA, USA), as described in previous studies (Scott, 2011; Sharma, 2011). Gene expressions of Cpa3, TGF-\u03b2, Col1a1, and Col3a1 were quantitated using qPCR on an ABI (Applied Biosystems) 7500 Fast system with SYBR green probe and primers sets for Cpa3, TGF-\u03b2, Col1a1, and Col3a1 (Table 2.1). Each replicated was performed in triplicates. The quantity of mRNA for each gene was computed using 2 -\u0394Ct method. Gene  Forward Primer Reverse Primer Cpa3 TTGGTCATGGACACAGGATCG GTTGAGGTCAGTGCCAATGC TGF-\u03b2 GCTGAACCAAGGAGACGGAA ATGTCATGGATGGTGCCCAG Col1a1 CGATGGATTCCCGTTCGAGT GAGGCCTCGGTGGACATTAG Col3a1 CAGGAGAAAAGGGTCCTCCC ATACCCCGTATCCCTGGACC Table 2.1   Primer sequences for qPCR 44    2.7 Statistical analysis After consulting with a statistician, a linear model was used to analyze differences in weight among ApoE-KO and C57Bl\/6, normal and high fat diets, at the 15 week and 30 week time points. For cross-sectional area, Oil Red O staining, and mRNA levels, a linear mixed model was used to determine if there were any significant differences according to strain (ApoE vs. C57Bl\/6) or diet (regular chow vs. high fat) at 15 and 30 weeks. Normal quantile plots and residuals plots were graphed to ensure the assumptions of the tests were met (see Appendix C). 45   Chapter  3: Results 3.1 Morbidity and skin pathology A total of 77 mice were used for this study of which 36 were C57Bl\\6 and 41 were ApoE-KO mice. Ten of the ApoE-KO mice were euthanized prior to their designated time points due to cutaneous xanthoma or skin lesion development. Of all the 36 C57Bl\\6 mice, 11 were assigned to no diet (i.e. baseline\/0 week time point), 12 to regular chow, and 13 to high fat diet. The C57Bl\/6 mice did not develop any skin lesions and all survived the 30 week period, even when fed a high fat diet.  Specifically, the ApoE-KO mice developed xanthomatotic skin lesions. They also showed a decline in health compared to the wild type C57Bl\/6 mice, resulting in increased morbidity including hair loss, signs of frailty, hair graying, skin lesions on back, neck, and irritation of ears, but the condition was more severe for mice on high fat diet. Of all the 41 ApoE-KO used in the study, 10 were assigned to no diet (i.e. baseline\/ 0 week time point), 13 to regular chow diet, and 18 to high fat diet. For ApoE-KO mice fed regular chow diet, 4\/13 (31%) showed signs of xanthomas or skin lesions, with the earliest case occurring at 10 weeks. 1\/4 (25%) of these mice had to be sacrificed earlier than its experimental endpoint. When fed a high fat diet, 16\/18 (89%) of the ApoE-KO mice developed skin lesions or ear irritations, with the earliest case occurring at 9 weeks. 9\/16 (56%) had to be sacrificed earlier than their experimental endpoint. Two other mice, one on high fat and one on regular chow diet, were sacrificed due to conditions\/diseases other than those resulting from the experiment. 46   3.2 Weight Strain, week, and diet were all factors that had a significant effect on weight. The starting weights of mice of both strains are listed in Appendix A. Wild type C57Bl\/6 mice were significantly heavier than ApoE-KO mice (p<0.01) (Figure 3.1). Mice that were fed a high fat diet were heavier than those on regular chow (p<0.001), and those who were sacrificed at 30 week time point were heavier than those sacrificed at 15 weeks (p<0.001). High fat diet resulted in a significant weight gain in mice overall at the 30 week time point but not at the 15 week time point. As illustrated in Figure 3.1, at the 15 week time point all mice had similar weights. The interaction between diet and week demonstrates that mice on high fat diet at 30 week time point were significantly heavier than mice on high fat diet at 15 week time point. Within each time point, mice fed on high fat diet were significantly heavier than those on regular chow diet, as seen in Figure 3.1 (p<0.001). Furthermore, the interaction between diet and strain also demonstrates that high fat fed C57Bl\/6 mice were significantly heavier than high fat fed ApoE- KO mice. Within each strain, high fat diet led to a significant increase in weight compared to regular chow diet (p<0.05). There was also an interaction between strain and time point. C57Bl\/6 mice at 30 week time point were significantly heavier than ApoE-KO mice at 30 week time point. Moreover, mice on diet for 30 weeks had a significantly higher weight compared to mice on diet for 15 weeks (p<0.01). 47   Figure 3.1   Effect of diet and strain on weight. C57Bl\/6 and ApoE-KO mice are denoted as \u201c+\/+\u201d and \u201c-\/-,\u201d respectively. Regular chow and high fat diet are symbolized as \u201c-\u201d and \u201c+\u201d respectively. The bars represent range of values between 25 th  and 75 th  percentile. The horizontal line inside the bar is the median, and the whiskers represent minimum and maximum in the data set.  The differences between strain, diet, and time points were all significant. At 30 week time point, high fat diet showed a significant difference compared to regular chow diet. Similarly, on high fat diet, 30 week time point was significantly different than 15 week time point. On high fat diet, weights of C57Bl\\6 mice were significantly different. Also, high fat diet resulted in significant differences compared to regular chow diet. At 30 week time point, weights of C57Bl\\6 mice were also significantly different than ApoE-KO mice. Left to right:  N=5, 5, 7, 8, 4, 5, 7, 3.*P<0.05, ***P<0.001 48    3.3 Histology There were no appreciable changes between C57Bl\/6 and ApoE-KO mice observed in the tendon morphology as assessed on H&E stained cryosections of Achilles tendon (Figure 3.2). The tenocytes typically had an elongated shape and no obvious difference in quantity or density was seen; they were predominantly normal in shape and size, and collagen fibers were aligned in parallel orientation. However, morphology was challenging to assess due to small size of the samples, and due to folding artifact that remained a problem, despite extensive re-sectioning by trained histology technicians. There was no obvious evidence of inflammatory cell infiltration, foam cell accumulation or metaplastic change. Figure 3.2   Tendon morphology of ApoE-KO mice Achilles tendon. (A) 0 week, no diet (B) 15 week, regular chow (C) 15 week, high fat (D) 30 week, regular chow (E) 30 week, high fat. Original magnification x 20. No difference is observed in collagen organization, cellularity, or shape of tenocytes. A B C D E 49   Oil Red O staining on the tissue sections was typically concentrated in and around the tendon tissue, whereas muscle tissue was typically devoid of staining. Oil Red O stained a large number of adipocytes, particularly in the peritendinous and vascular regions, but was also occasionally observed within tenocytes and also within the collagenous extracellular matrix. The Positive Pixel Count Algorithm used in ImageScope software selected the tendon areas stained with Oil Red O, and quantified them in two ways: number of strong positives (red), and positivity ratio. The number of strong positives is a result of number of red pixels in the image (Figure 3.3). It is normalized by total area in square millimeters of all tissue within the selected area, including both positive and negative pixels but not blank spaces. Positive pixels refer to Oil Red O staining on tendon; however the algorithm further classified these pixels into weak, medium, and strong. The positivity ratio is the total number of positive pixels divided by total number of pixels (Ntotal- Nn)\/(Ntotal), where Ntotal is number of total pixels (positive and negative, Nn). 50    Figure 3.3   Analysis of Oil Red O staining before and after use of Positive Pixel Count Algorithm. (A) Achilles tendon stained with Oil Red O stain at (original) 2X digital magnification. (B) Achilles tendon stained with Oil Red O stain and analyzed by Positive Pixel Count algorithm(C) Boxed area in \u201cB\u201d shown at higher magnification (original 20X digital magnification). Strong positive pixels are in red as shown by the arrow. Medium positive pixels and weak positive pixels are shown in orange and yellow, respectively. Negative pixels are shown in blue.  A B C 51    Oil Red O stained slides showed differences in staining of tendons between C57Bl\/6 and ApoE- KO Achilles mice. The number of strong positives were significantly lower overall in ApoE-KO (1.52x10 6 \u00b12.4x10 5 ) mice compared to C57Bl\/6 (3.1x10 6 \u00b12.9x10 5 ; p<0.001). Between the two time points, 30 week time point showed a significantly lower number of strong positives than 15 week time point (p<0.05). However, there was no interaction between strain and time points. Diet had no effect on number of strong positives. The positivity ratio also showed significantly less staining in ApoE-KO (0.32\u00b10.04) than C57Bl\/6 mice (0.53\u00b10.05p<0.01), as seen in Figure 3.4. The side of the tendon used, i.e. right or left, had no effect on the positivity ratio, therefore, only the results from right tendons are shown in the figure below. Regular chow and high fat diet, or the two time points had no significant effect on the positivity ratio of Achilles tendons. 52    Figure 3.4   Effect of strain and diet on tendon lipid content. The lipid content was quantified as positivity ratio of Oil Red O staining in tendon. C57Bl\/6 and ApoE-KO mice are denoted as \u201c+\/+\u201d and \u201c-\/-,\u201d respectively. Regular chow and high fat diet are symbolized as \u201c-\u201d and \u201c+\u201d respectively. The bars represent range of values between 25 th  and 75 th  percentile. The horizontal line inside the bar is the median, and the whiskers represent minimum and maximum in the data set. Graph shows results from staining of the right Achilles tendons. Lipid content was significantly different between strains, with increased lipid content in C57Bl\/6 mice. Left to right:  N= 7, 6, 10, 14, 6, 8, 9, 4. **P<0.01. 53   3.4 Cross-sectional area The average CSA of the patellar tendons from mice sacrificed at 0 weeks was 0.72+0.18 mm 2  of C57Bl\/6 and 0.77+0.22 mm 2 of ApoE-KO mice (Appendix D). After 15 or 30 weeks, there was a significant difference observed in the cross-sectional area of patellar tendons of ApoE-KO (0.84+0.03) and wild type C57Bl\/6 mice (0.70+0.02). The patellar tendons of ApoE-KO mice had a significantly larger CSA than patellar tendons of the wild type mice (p<0.001) (Figure 3.5). When the left and right patellar tendons of all mice were compared, there was no significant difference between the two sides. Unexpectedly, there was a statistically significant interaction between the side of the tendon and two other factors (strain and diet); however, since the side of the tendon (left or right) is not an important factor in this study, the graph below shows CSA of right tendons only. Diet (regular vs. high fat) and time (15 vs. 30 weeks) did not significantly influence the tendon CSA. 54    Figure 3.5   Effect of diet and strain on patellar tendon cross-sectional area. C57Bl\/6 and ApoE-KO mice are denoted as \u201c+\/+\u201d and \u201c-\/-,\u201d respectively. Regular chow and high fat diet are symbolized as \u201c-\u201d and \u201c+\u201d respectively. The bars represent range of values between 25th and 75th percentile. The horizontal line inside the bar is the median, and the whiskers represent minimum and maximum in the data set. Graph shows results of CSA from right patellar tendons. Cross- sectional area was significantly different between strains. Left to right: 10, 8, 14, 14, 8, 10, 14, 6. ***P<0.001.  55   3.5 Analysis of Cpa3, TGF-\u03b2, Col1a1, and Col3a1 expression Cpa3, Col1a1, Col3a1 and TGF-\u03b2 were expressed in both wild type and ApoE-KO mice (Figure 3.6). Cpa3 expression was significantly decreased (1.6 times lower) in mice that were fed high fat diet (0.0021+0.0003) compared to those on normal diet (0.0034+0.0006; p<0.05). Col1a1 expression was significantly decreased (5 times lower in log2 ratio) in ApoE-KO mice (0.48+0.13) compared to C57Bl\/6 mice (1.08+0.16). Col3a1 and TGF-\u03b2 expression did not differ significantly between the strains, diets, or time points.  There was one outlier among the samples observed during TGF-\u03b2 qPCR analysis. Statistical tests were conducted both with and without this outlier; the outlier did not influence the results of the analysis and the RNA sample was not an outlier for any other gene examined. The TGF-\u03b2 expression graph does not include this outlier.          56    Figure 3.6   Effect of strain and diet on gene expression. C57Bl\/6 and ApoE-KO mice are denoted as \u201c+\/+\u201d and \u201c-\/-,\u201d respectively. Regular chow and high fat diet are symbolized as \u201c-\u201d and \u201c+\u201d respectively. Each diamond represents one of two samples taken from each animal. Linear mixed model with log 2 ratio showed significant differences in Cpa3 and Col1a1 expression due to strain. Cpa3 expression was significantly lower in mice fed high fat diet, compare to regular chow diet. Col1a1 expression was significantly lower in ApoE-KO mice, compared to C57Bl\/6 mice.  Left to right for Cpa3, Col1a1, Col3a1: 14, 16, 13, 11. Left to right for TGF-\u03b2: 14, 15, 13, 11. *P<0.05, **P<0.01. 57   Chapter  4: Discussion In this study, we found that the tendons of Apo-KO mice were significantly altered compared to wild type controls. The patellar tendons demonstrated an increased CSA, and the tail tendons demonstrated reduced Col1a1 expression levels. However, high fat diet did not influence any of the measured tendon-related variables (with the exception of a small decrease in Cpa3 levels occurring in both ApoE-KO and wild type mice). We did not observe any evidence of increased lipid deposition in tendons, compared to control mice. Taken together, these findings indicate that tendons are negatively affected in ApoE-KO mice, however future work is required to determine the mechanism involved and the potential impact on tendon function. ApoE is a lipoprotein known for its function in cholesterol transport and other lipids between peripheral tissues and the liver. It serves as a ligand for cellular lipoprotein receptors (Curtiss, 2000) and its deficiency leads to severe hypercholesterolemia and atherosclerosis. In this study, ApoE deficient mice on a high fat diet for 30 weeks showed frailty and increased morbidity compared to wild type C57Bl\/6 mice. It is known that ApoE-KO mice have higher plasma cholesterol levels compared with wild type mice. Their plasma levels increase even more when fed a high fat diet, and mice start to develop skin lesions (Piedrahita, 1992), and these lesions were also observed in mice used in the present study. The lesions, mainly composed of lipids and extracellular matrix, develop in the form of xanthomas on the shoulder and back area due to extremely high plasma cholesterol (Moghadasian, 1999). ApoE deficiency also results in the development of atherosclerotic lesions, whether the mice are fed a high fat or regular chow diet. These lesions develop and grow in size with age in the aortic 58   root and throughout the aorta, and also affect the peripheral vasculature, eventually leading to vascular senescence (Bonomini, 2010). Mononuclear cells adhere to the endothelial surface leading to the development of foam cell lesions in the intima of the artery, which further progress to fibrofatty lesions containing multiple layers of lipid-filled macrophages and smooth muscle cells, culminating in the formation of fibrous plaques (Nakashima, 1994). These lesions are commonly identified with Oil Red O staining, which stains both intra- and extra-cellularly. We hypothesized that ApoE-KO mice would demonstrate increased extracellular or intracellular lipid deposition in the Achilles tendons as gauged by Oil Red O staining, however, the opposite was found: ApoE-KO mice Achilles tendons demonstrated decreased lipid content compared to C57Bl\/6 mice, as determined both by the normalized number of pixels strongly stained with Oil Red O, as well as by the Oil Red O positivity ratio. Oil Red O is a non-specific lipid soluble dye that stains cholesterol esters and other hydrophobic lipid red, both intracellularly and extracellularly. The deposits of cholesterol byproducts have been implicated in the formation of tendon xanthomas. Detailed lipid analysis in previous studies has showed that lipid composition of tendon xanthomas is mainly free cholesterol, with some cholesterol esters and phospholipids. Staining of these tissue sections demonstrated that unesterified cholesterol accumulated predominantly extracellularly, and esterified cholesterol accumulated both extra and intracellularly (Adams, 1974; Kruth, 1985). To determine the presence of intracellular and extracellular cholesterol, Kruth et al.\u2019s study also used Oil Red O staining on human Achilles tendon sections. Similar to their results, in our study lipids were stained in ApoE-KO mice tendons both intracellularly in fibroblasts and adipocytes, and in the extracellular space along the 59   collagen fibers. Much of the staining was concentrated in the paratenon, rather than in the tendon proper. Control tendons in Kruth et al.\u2019s study demonstrated small amounts of Oil Red O staining in the extracellular space and within fibroblasts. In our study, there was more lipid deposition in controls at both time points, (Figure 3). Adam et al. also showed lipid deposition in normal tendons, mainly esterified cholesterol, using Oil Red O staining (Adams, 1974). It is uncertain whether the lipids detected in control mice were a result of excessively high plasma cholesterol levels, or whether it is physiological for fat to be stored around tendons. The wild type mice did not develop any skin lesions or xanthomas, however traces of lipids were observed macroscopically around tendons when they were harvested from C57Bl\/6 mice, especially those on high fat diet for 30 weeks. These findings suggest that there may be a normal, cell-mediated process that relies on the LDL-receptor in tendon cholesterol deposition. Furthermore, ApoE-KO weighed less overall than C57Bl\/6 mice. Similar results were also found in Pereira et al.\u2019s study where ApoE-deficient mice had a lower body weight compared to C57Bl\/6 mice. In that study, ApoE-KO fed a high fat diet had smaller adipocytes compared to wild type controls. Since the adipocyte size was smaller, the mice may have been less likely to gain weight with a high fat diet (Pereira, 2012). Adipocyte size was not studied in this present study but this could also be a reason why ApoE-KO mice had lower lipid content in and around the Achilles tendon. The adipocytes in C57Bl\/6 may have expanded and adipose deposition around tendons may be the reason that we saw higher lipid content in the Achilles tendons of these wild type mice. 60   Another way to quantify Oil Red O staining would be to choose an area of interest, and count the number of stained and unstained tenocytes. We were unable to use this method because 1) the tendon tends to fold on itself during cryosectioning and staining between these folds could be an artifact, 2) during the staining process (which is conducted on unfixed tissue), the lipids might have been displaced as in some Oil Red O stained slides, lipids were seen around the tendons as well. We did not see any significant morphological changes in tendon structure between ApoE-KO and wild type mice or between the two diets, as gauged by H&E staining. There may have been some changes in the paratendon of ApoE-KO mice, but due to limited number of samples it was not possible to confirm if this was true. A few sections of ApoE-KO Achilles tendons showed some changes in the paratendon including the presence of inflammatory cells such as macrophages, and an increase in cellularity compared to wild type controls seemed to suggest that there might be some ongoing inflammation in the paratendon contributing to these changes. Possible inflammation in the paratendon may have led to changes in the patellar tendon cross- sectional area. However it could not be assessed as this change was only observed in a small number of samples. In support of our hypothesis, ApoE-KO mice were found to have thicker patellar tendons than C57Bl\/6 mice. The thicker tendons of ApoE-KO mice could be due to inflammation in paratendon (as mentioned above) and aging. A previous study has shown that tendons of older people are thicker, compared to younger people (Stenroth, 2012). With aging, there may be a decrease in the loading of the tendon, which could increase the extracellular water content, 61   resulting in an increased tendon CSA. Studies on tendon xanthomas have measured the cross- sectional area of the Achilles tendon, as xanthomas predominantly occur in Achilles tendons or in the extensor tendons of the hands (Dussault, 1995), but our study measured cross-sectional area on patellar tendons. Therefore, it cannot be concluded that tendon thickness was due to xanthoma formation. Another explanation for a larger patellar tendon CSA is related to high levels of circulating cholesterol. Lipid droplets can be deposited along collagen fibers and disrupt the interaction of the fiber network, making it more prone to tendon rupture or injury (Jozsa, 1984). Biomechanical testing of ApoE-KO and C57Bl\/6 patellar tendons would give further explanation and clarification of the effect of lipid accumulation on tendon function. It can be hypothesized that ApoE-KO patellar tendons would have reduced biomechanical properties, or fail at a lower load, compared to C57Bl\/6 patellar tendons. This can be tested in a materials testing device that gives information on load and displacement when tendons are tested to failure (Figure 1.4). ApoE-KO mice also demonstrated decreased expression levels of Col1a1, which suggests that these tendons were not thicker due to increased type I collagen content, but that the thickening resulted from other substances or factors. As mentioned earlier, tendon thickening could be due to inflammation, and the tendency of tendinopathic or aging tendon tissue to increase in size. To determine if tendon thickness in ApoE-KO mice is due to aging and\/or inflammation, changes in pro-inflammatory cytokines can be examined. Pro-inflammatory cytokines IL-6 and iNOS are induced during the aging process due to age-related redox imbalance that activates many signaling pathways (Chung, 2009). Compared to controls, ApoE-KO mice had increased IL-6 62   and iNOS expression in the renal cortex and medulla, and cytoplasm of hepatocytes. In addition, IL-6 expression was also increased in cardiomyocytes of Apo-KO mice (Bonomini, 2010). mRNA levels of these pro-inflammatory cytokines, along with IL-1\u03b2, can be measured with qPCR. It is hypothesized that ApoE-KO mice would have increased levels of IL-6, iNOS, and IL-1\u03b2 in the tendon. Collagen is the most important component of tendons, with type I collagen accounting for 65- 80% of the total tendon mass. Expression of Col1a1 was seen to be lower in ApoE-KO mice.  A decrease in Col1a1 could be related to aging. Couppe and his colleagues showed that collagen concentration was lower in older men compared to younger men. This may represent the reduced size or density of collagen fibrils that is known to occur with aging (Couppe, 2009). Inflammation, mediated by prostaglandin E2 (PGE2), has been to shown to affect collagen concentration. In human tendon fibroblasts, high levels of PGE2 have been shown to decrease collagen synthesis (unpublished data, Scott laboratory). PGE2 is a product of COX2 gene, so measuring gene expression levels of COX2 can further provide information on the potential mechanism of decreased Col1a1 expression in ApoE-KO mice. The mRNA expression levels of TGF-\u03b2 and Col3a1 showed no differences between ApoE-KO and wild type mice or between diets. TGF-\u03b2 expression was measured as it plays an important role in fibroblast migration, neovascularization, and secretion of ECM proteins such as procollagen type I and III (Kashiwagi, 2004). It is normally expressed in the process of tendon and repair and remodeling. However, no such difference in its gene expression was seen therefore, it may imply that the ApoE mice did not experience an increase in collagen repair and 63   remodeling. This is also in agreement with the other finding that Col1a1 expression was decreased in ApoE-KO mice. In a healing tendon, TGF-\u03b2 increases expression of collagen I and III, however, none of the mRNA levels of these genes were seen to be increased in ApoE-KO mice. Mast cells play a role in connective tissue remodeling, including repair after direct mechanical injury or overuse (Dumont, 2007). Mast cells degranulate as a reaction to physical trauma and release a number of different factors that contribute to the first inflammatory stage of healing process (Moyer, 2004). Carboxypeptidase A3 (CPA3), also known as mast cell carboxypeptidase A, is an enzyme secreted from mast cells which functions together with endopeptidases secreted from mast cells to degrade proteins and peptides (Abe, 2000). The strain of mice did not affect the expression of Cpa3, but it was lower in high fat fed mice in both strains. No significant changes between wild type and ApoE-KO mice may suggest that mast cells were equally present in the tendons of both mouse strains. ApoE-KO mice have been considered as a model of aging in a few other studies. These mice are used in cardiovascular research because ApoE deficiency leads to accumulation of cholesterol enriched particles in the blood. On a high fat diet, these mice develop fatty streaks and lesions as they age. As mentioned in Ang et al.\u2019s study, ApoE-KO mice develop age-related phenotypes regardless of what diet they are fed, even though high fat diet accelerates these phenotypes. This is in agreement with our results as we observed that these mice had hair loss and graying earlier than C57Bl\/6 mice, and shortened life spans (Ang, 2008). 64   It is possible that the results presented may not be directly due to ApoE deficiency, but could be because of ApoE induced oxidative or inflammatory stress. ApoE not only regulates cellular and systemic cholesterol metabolism, but it also has anti-inflammatory, anti-atherogenic, and anti- oxidant properties (Tarnus, 2009). High fat diet in ApoE-KO mice causes an increase in oxidative stress and inflammation in adipose tissue. Moreover, fatty acid oxidation is increased with high fat diet intake compared to regular chow diet. The oxidative status in these animals is responsible for inflammation in adipose tissue, which in turn is a risk factor for a disease such as atherosclerosis (Pereira, 2012). Aging, a biological process, is characterized by time-dependent, progressive, and physiological declines, accompanied by an increased incidence of age-related diseases. According to the oxidative stress hypothesis, oxidative damage is not only caused by the uncontrolled production of oxygen species (Herman, 1956), but also by other oxidants such as reactive nitrogen species and reactive lipid species.  Atherosclerosis is now considered to be an age-related disease that occurs due to chronic inflammation. Inflammatory mediators increase with aging due to redox imbalance induced by oxidative stress. This redox imbalance is most likely caused by the net effect of weakened anti-oxidative defense systems, which deficiency of ApoE provides, and increasing production of reactive species (Chung, 2009). The pathogenesis of tendon degeneration, such as decreased collagen synthesis by tendon cells and increased degradation of synthesized collagen in the tendon matrix, may be due to changes induced by oxidative stress. Furthermore, oxidative stress could also be the reason for hair loss and lack of weight gain in ApoE-KO mice, along with development of xanthomatic skin lesions. Collagen synthesis by human tendon cells has been shown to decrease under oxidative stress 65   (Yuan, 2004). Tendon matrix degradation can be due to increased MMP1 expression, which is upregulated by phosphorylated JNK induced via oxidative stress (Wang, 2007). Last but not least, oxidative stress can also induce apoptosis which has also been proposed to play an important role in tendon degeneration (Yuan, 2003).   66   Chapter  5: Conclusion ApoE-KO mice fed a high fat diet can be used as a model to study tendon pathology related to hypercholesterolemia. Our study demonstrated that the tendons of ApoE-KO mice were thicker and displayed reduced Col1a1 expression levels, possibly making them more susceptible to injury. The thickness in tendon could possibly be due to inflammation in paratendon, aging, or lipid accumulation. Further experiments using biomechanical testing, qPCR of pro-inflammatory genes, and measures of collagen density and organization, could provide more information about the changes in the tendons of ApoE-KO mice and potentially the mechanisms involved. The link between hypercholesterolemia and tendon pathology can lead to studies on mechanisms involved, which may be used for therapeutic interventions. These studies can aid in establishing a suitable model that can be used to examine the potential reversibility of tendinopathy associated with high cholesterol levels. 5.1 Limitations Because this study was conducted with animals, it has limitations as information obtained with mice cannot always be directly translated into data that would be clinically relevant for humans. ApoE-KO mice are known to demonstrate hypercholesterolemia with systemic effects, but this may not be clinically applicable as most patients have mixed hypercholesterolemia. The total cholesterol to HDL-C ratio gives is a good indicator for determining if an individual is hypercholesterolemic. ApoE-KO mice are known to have high total cholesterol and low HDL-C, which increases their total cholesterol to HDL-C ratio.  However, lipid tests were not carried out on ApoE-KO mice in our study to confirm this. For cross-sectional area measurements, the study 67   seemed to be underpowered. As seen in results (Fig 3.4), ApoE-KO at 30 week time point showed an increase in cross-sectional area; however it was not significant. Low number of samples could be a reason why this was not statistically significant. The histology on frozen sections was very challenging and may have limited our ability to detect morphological differences. The genes were evaluated at defined time points, therefore, the study does not give information about when the gene expression levels started to decline, or if the expression patterns observed were uniform for the whole duration of the experiment. Gene expression also does not always correlate to protein levels. At a given point in time, often they have no relationship and sometimes the reverse. Furthermore, gene expression experiments were done on tail tendons, which are not load-bearing. Carrying out this experiment on a tendon, such as patellar or Achilles, may have been more useful as those tendons are used for load-bearing and could give us more relevant information. 5.2 Future directions Further studies are planned using biomechanical testing of the ApoE-KO mice patellar tendons. Due to the increased cross-sectional area and the reduced type I collagen mRNA, it is expected that patellar tendons of these mice would rupture at a lower stress than the wild type mice. Studies on gene expression of pro-inflammatory cytokines or other markers of aging could give further insight into the mechanisms underlying the observed changes. Second harmonic generation (SHG) imaging could also be conducted to determine if there is an influence of mouse strain or diet on collagen density and organization. SHG is a non linear optical process in which photons interact with non linear material and combine to form new photons with twice as energy, 68   twice the frequency, and half the wavelength of the initial photons.The association between high cholesterol and tendon injuries can be studied in larger studies, and cholesterol levels can be checked in people with tendon injuries. Information gained from this study and similar studies on ApoE deficiency and hypercholesterolemia can give further insight on intrinsic risk factors that affect tendon biology and biomechanics. The effects of cholesterol on the cardiovascular system have been studied, but not much has been examined on the musculoskeletal system. Studies like these can give a better understanding of how hypercholesterolemia affects the long-term structure and function of tendons. Furthermore, it can provide orthopaedic patients and clinicians information on musculoskeletal health and preventative treatments.             69   References Abboud, J., Beason, D., Soslowsky, L. (2012). Emerging ideas: The effect of hypercholesterolemia on tendons. Clinical Orthopaedics and Related Research, 470, 317- 320. Abboud, J., Kim, J. (2010). The effect of hypercholesterolemia on rotator cuff disease. Clinical Orthopaedics and Related Research, 468, 1493-1497. Abe, M., Kurosawa, M., Ishikawa, O., Miyachi, Y. (2000). Effect of mast cell-derived mediators and mast cell-related neutral proteases on human dermal fibroblast proliferation and type I collagen production. Journal of Allergy and Clinical Immunology, 106, S78-S84. Abrahamsson, S. (1991). Matrix metabolism and healing in the flexor tendon. Experimental studies on rabbit tendon. Scandinavian Journal of Plastic and Reconstructive Surgery, 23, 1. Adams, C., Bayliss, O., Baker, R., Abdulla, Y., Hunter-Craig, C. (1974). Lipid deposition in ageing human arteries, tendons, and fascia. Atherosclerosis, 19, 429-440. Akenson, W., Woo, S., Amiel, D., Coutts, R., Daniel, D. (1973). The connective tissue response to immobility: biomechanical changes in periarticular connective tissue of immobilized rabbit knee. Journal of Clinical Orthopaedics, 93, 356-362. Ang, L., Cruz, R., Hendel, A., Granville, D. (2008). Apolipoprotein E, an important player in longevity and age-related diseases. Experimental Gerontology, 43, 615-622. Arya, S., Kulig, K. (2010). Tendinopathy alters mechanical and material properties of the Achilles tendon. Journal of Applied Physiology, 108(3), 670-675. Bahr, S., Movin, T., Papadogiannakis, N., Pikuleva, I., Ronnow, P., Diczfalusy, U., Bjorkhem, I. (2002). Mechanism of accumulation of cholesterol and cholestanol in tendons and the role of Sterol 27-hydroxylase (CYP24A1). Arteriosclerosis, Thrombosis, and Vascular Biology , 22, 1129-1135. Bard, H. (2009). Tendinopathy of the gluteus medius tendon. La Revue du Praticien, 59, 463. Beason, D., Abboud, J., Kuntz, A., Bassora, R., Soslowsky, L. (2010). Cumulative effects of hyperchoelesterolemia on tendon biomechanics in a mouse model. Journal of Orthopaedic Research, 29, 380-383. Berg, K. (1983).  In A. Steinberg, Bear, A., Motulsku, A., Child, B. (Ed.), Progress in Medical Genetics (Vol. 5, pp. 35-90). Philadelphia: Saunders. Best, T., Garrett, W. (1994). Basic science of soft tissue: Muscle and tendon. In J. DeLee, Drez, D. (Ed.), Orthopaedic Sports Medicine (pp. 1-45). Philadelphia: WB Saunders. 70   Birch, H., McLaughlin, L., Smith, R., Goodship, A. (1999). Treadmill exercise induced tendon hypertrophy: Assessment of tendons with different mechanical functions. Equine Veterinary Journal Supplement, 30, 222-226. Bonomini, F., Filippini, F., Hayek, T., Aviram, M., Keidar, S., Rodella, L., Coleman, R., Rezzani, R. (2010). Apolipoprotein E and its role in aging and survival. Experimental Gerontology, 45(2), 149-157. Bos, P., Van Osch, G,, Frenz, D., et al. (2007). Growth factor expression in cartilage wound healing: temporal and spatial immunolocalization in a rabbit auricular cartilage wound model. Osteoarthritis Cartilage, 9(4), 382. Bruns, J., Kampen, J., Kahrs, J., Plitz, W. (2000). Achilles tendon rupture: Experimental results on spontaneous repair in a sheep-model. Knee Surgery, Sports Traumology, Arthroscopy, 8(6), 364-369. Buchanan, C., Marsh, L. (2002). Effects of exercise on the biomechanical, biochemical, and structural properties of tendons. Comparative Biochemistry and Physiology, 133, 1101- 1107. Chalmers, L., Kaskel, F., Bamgbola, O. (2006). The role of obesity and its bioclinical correlates in the progression of chronic kidney disease. Advances in Chronic Kidney Diseases, 13, 352-364. Chan, B., Fu, S., Qin, L., Rolf, C., Chan, K. (1998). Pyridinoline in relation to ultimate stress of the patellar tendon during healing: An animal study. Journal of Orthopaedic Research, 16, 597. Chan, K., Fu, S., Wong, Y., Hui, W., Cheuk, Y., Wong, M. (2008). Expression of transforming growth factor beta isoforms and their roles in tendon healing. Wound Repair and Regeneration, 16(3), 399-407. Chung, H., Cesari, M., Anton, S., Marzetti, E., Giovannini, S., Seo, A., Carter, C., Yu, B., Leeuwenburgh, C. (2009). Molecular inflammation: Underpinnings of aging and age- related diseases. Ageing Research Reviews, 8(1), 18-30. Cook, J., Kiss, Z., Khan, K., Purdam, C., and Griffiths, L. (2000). Propective imaging study of asymptomatic patellar tendinopathy in elite junior basketball players. Journal of Ultrasound in Medicine, 19, 473-479. Couppe, C., Hansen, P., Kongsgaard, M., Kovanen, V., Suetta, C., Aagaard, P., Kjaer, M., Magnusson, S. (2009). Mechanical properties and collagen cross-linking of the patellar tendon in old and young men. Journal of Applied Physiology, 107(3), 880-886. Curtiss, L., Boisvert, W. (2000). Apolipoprotein E and atherosclerosis. Current Opinion in Lipidology, 11, 243-251. Curwin, S., Vailas, A., Wood, J. (1988). Immature tendon adaptation to strenuous exercise. Journal of Applied Physiology, 65, 2297-2301. 71   Dowling, B., Dart, A., Hodgson, D., Smith, R. (2000). Superficial digital flexor tendonitis in the horse. Equine Veterinary Journal, 32, 369-378. Drinkwater, B. (1988). Training of female athletes. In A. Dirix, Knuttgen, H., Tittel, K. (Ed.), The Olympic Book of Sports Medicine (pp. 309-24). Oxford: Blackwell Scientific Publications. Dumont, N., Lepage, K., Cote, C., Frenette, J. (2007). Mast cells modulate leukocyte accumulation and skeletal muscle function following hindlimb unloading. Journal of Applied Physiology, 103(1), 97-104. Dussault, R., Kaplan, P., Roederer, G. (1995). MR imaging of Achilles tendon in patients with familial hyperlipidemia: comparison with plain films, physical examination, and patients with traumatic tendon lesions. American Journal of Roentgenology, 164, 403-407. Edwall, D., Schalling, M., Jennische, E., et al. (1989). Induction of insulin- like growth factor I messenger ribonucleic acid during regener- ation of rat skeletal muscle. Endocrinology, 124, 820-825. Eliasson, P., Andersson, T., Aspenberg, P. (2009). Rat Achilles tendon healing: mechanical loading and gene expression. Journal of Applied Physiology, 107(2), 399-407. Enwemeka, C., Maxwell, L., Fernandes, G. (1992). Ultrastructural morphometry of matrical changes induced by exercise and food restriction in the rat calcaneal tendon. Tissue Cell, 24, 499-510. Eyre, D., Koob, T., Van Ness, K. (1984). Quantitation of hydroxypyridinium crosslinks in collagen by high-performance liquid chromatography. Analytical Biochemistry, 137, 380- 388. Fahey, J., Stark, H., Donovan, W., Drennan, D. (1973). Xanthoma of the Achilles tendon. Journal of Bone and Joint Surgery , 55-A, 1197. Farkas, L., McCain, W., Sweeney, P., Wilson, W., Hurst, L., Lindsay, W. (1973). An experimental study of changes following silastic rod preparation of a new tendon sheath and subsequent tendon grafting. Journal of Bone and Joint Surgery, 55, 1149-1158. Finley, M., Rodgers, M. (2004). Prevalence and identification of shoulder pathology in athletic and nonathletic wheelchair users with shoulder pain: A pilot study. Journal of Rehabilitation Research and Development, 4, 395-402. Forde, M., Punnett, L., Wegman, D. (2005). Prevalence of musculoskeletal disorders in union ironworkers. Journal of Occupational and Environmental Hygiene, 2, 203-212. Forslund, C., Rueger, D., Aspenberg, P. (2003). A comparative dose-response study of cartilagederived morphogenetic protein (cdmp)-1, -2 and -3 for tendon healing in rats. Journal of Orthopaedic Research, 21(4), 617-621. 72   Fransson, B., Gavin, P., Lahmers, K. (2005). Supraspinatus tendinosis associated with biceps brachii tendon displacement in a dog. Journal of American Veterinary Medical Association, 277, 1429-1433. Fredberg, U., Bolvig, L., Pfeiffer-Jensen, M. Clemmensen, D., Jakobsen, B., Stengaard- Pedersen, K. (2004). Ultrasonography as a tool for diagnosis, guidance of local steroid injection and, together with pressure algometry, monitoring of the treatment of athletes with chronic jumper's nknee and Achilles tendinitis. Scandinavian Journal of Rheumatology, 33, 94-101. Fujita, M., Hukuda, S,, Doida, Y. (1992). Experimental study of intrinsic healing of the flexor tendon: collagen synthesis of the cultured flexor tendon cells of the canine. Nippon Seikeigeka Gakkai Zasshi, 66, 326. Gaida, J., Ashe, M., Bass, S., Cook, J. (2009). Is adiposity an under-recognized risk factor for tendinopathy? A systemic review. Arthritis & Rheumatism, 61(6), 840-849. Gaida, J., Cook, J., Bass, S. (2008). Adiposity and tendinopathy. Disability & Rehabilitation, 30(20-22), 1555. Galloway, J., Broders, A., Ghormley, R. (1940). Xanthoma of tendon sheaths and synovial membranes. Archives of Surgery, 40, 485-538. Gerich, T., Kang, R., Fu, F., Robbins, P., Evans, C. (1994). Detection of elevated basic fibroblast growth lactat during early hours of in vitra angiogenesis using a fast ElISA immunoassay. Biochemistry and Biophysical Research Communications, 205, 1423-1430. Goomer, R., Maris T., Gelberman, R., Boyer, M., Silvia, M., Amiel, D. (2000). Nonviral in vivo gene therapy for tissue engenieering of articular cartilage and tendon repair. Clinical Orthopaedics and Related Research, 379 Suppl, 189-200. Graham, H., Holmes, D., Watson, R., Kadler, K. (2000). Identification of collagen fibril fusion during vertebrate tendon morphogenesis. Journal of Molecular Biology, 295, 891-902. Hardingham, T., Fosang, A. (1992). Proteoglycans: Many forms and many functions. The Faseb Journal, 6, 861-870. Harman, D. (1956). Aging: a theory based on free radical and radiation chemistry. The Journal of Gerontology, 11, 298-300. Harris, M. (1991). Hypercholesterolemia in diabetes and glucose intolerance in the US population. Diabetes Care, 14(5), 366-374. Hartz, A., Fischer, M., Bril, G., Kelber, S., Rupley, D., Oken, B., Rimm, A. (1986). The association of obesity with joint pain and osteoarthritis in the HANES data. Journal of Chronic Diseases, 39, 311-319. Hess, G., Cappiello, W., Poole, R., Hunter, S. (1989). Prevention and treatment of overuse injuries. Sport Medicine, 8, 371-384. 73   Hiebert, P., Boivin, W., Abraham, T., Pazooki, S., Zhao, H., Granville, D. (2011). Granzyme B contributes to extracellular matrix remodelling and skin aging in apolipoprotein E knockout mice. Experimental Gerontology, 46(6), 489-499. Hooley, C., Cohen, R. (1979). A model for the creep behavior of tendon. International Journal of Biological Macromolecules, 1, 123. Hou, Y., Mao, Z., Wei, X., Lin, L., Chen, L., Wang, H., Fu, X., Zhang, J., Yu, C. (2009). Effects of transforming growth factor-beta1 and vascular endothelial growth factor 165 gene transfer on achilles tendon healing. Matix Biology, 28(6), 324. Hume, P., Reid, D., Edwards, T. (2006). Epicondylar injury in sport: epidemiology, type, mechanisms, assessment, management and prevention. Sports Medicine, 36, 151-170. Ingraham, J., Hauck, R., Ehrlich, H. (2003). Is the tendon embryogenesis process resurrected during tendon healing? Plastic and Reconstructive Surgery, 112(3), 844-854. James, R., Kesturu, G., Balian, G., Chhabra, A. (2008). Tendon: biology, biomechanics, repair, growth factors, and evolving treatment options. Journal of Hand Surgery American, 33, 102-112. James, S., Bates, B., Osternig, C. (1978). Injuries to runners. American Journal of Sports Medicine, 6, 40-50. Jarvinen, T., Kannus, P., Maffulli, N., Khan, K. (2005). Achilles tendon disorders: etiology and epidemiology. Foot and Ankle Clinics, 10, 255-266. Jawien, J., Nastalek, P., Korbut, R. (2004). Mouse models of experimental atherosclerosis. Journal of Physiology and Pharmacology, 55(3), 503-517. Jorgensen, H., McLellan, S., Crossan, J., and Curtis, A. (2005). Neutralisation of tgf beta or binding of vla-4 to fibronectin prevents rat tendon adhesion following transection. Cytokine, 30(4), 195. Josza, L., Reffy, A., Kannus, P., Demel, S. Elek, E. (1990). Pathological alterations in human tendons. Archives of Orthopaedic and Trauma Surgery, 110, 15-21. Jozsa, L. (1984). Morphological and biochemical alterations in hypokinetic human tendons. Finn, 3, 111-115. Jozsa, L., Kannus, P. (1997). Human tendons: Anatomy, physiology, and pathology (1 ed.). Champaign, Illinois: Human Kinetics. Jozsa, L., Kvist, M., Kannus, P., Vieno, T., Jarvinen, M., Lehto, M. (1991). Structure and macromolecular composition of the myotendinous junction. Acta Morphol Hung, 39, 287-297. Jozsa, L., Lehto, M., Kvist, M., Balint, B., Reffy, A. (1989). Alterations in dry mass content of collagen fibers in degenerative tendinopathy and tendon rupture. Matrix, 9, 140-149. 74   Kader, D., Maffulli, N. (2007). Surgery for chronic overuse tendon problems in athletes. In S. Woo, Renstrom, A., Anoczky, S. (Ed.), Tendinopathy in Athletes (Vol. 12, pp. 215-21). Massachusetts: Blackwell Publishing Ltd. Kannus P., J. L., Renstrom P., Jarvinen M., Kvist M., Lehto M., Oja P., Vuori I. (1992). The Effect of Training. Immobilization and Remobilization on Musculoskeletal Tissue. Scandinavian Journal of Medicine & Science in Sports, 2, 100-118. Kannus, P. (1997). Tendons: a source of major concern in competitive and recreational athletes [editorial]. Scandinavian Journal of Medicine & Science in Sports, 7, 53-54. Kannus, P., Jozsa, L. (1991). Histopathological changes preceding spontaneuous rupture of a tendon. A controlled study of 891 patients. Journal of Bone and Joint Surgery, 73, 1507- 1525. Kannus, P., Nittymaki, S., Jarvinen, M. (1987). Sports injuries in women: A one-year prospective follow-up study at an outpatient sports clinic. British Journal of Sports Medicine, 21, 37-39. Karpakka, J., Palokangas, H., Kovanen, V., Takala, T. (1991). The effects of immobilization on the quality of Achilles tendon in rats. Scandinavian Journal of Plastic and Reconstructive Surgery, 1, 55-58. Kashiwagi, K., Mochizuki, Y., Yasunaga, Y., Ishida, O., Deie, M., Ochi, M. (2004). Effects of transforming growth factor-beta 1 on the early stages of healing of the achilles tendon in a rat model. Scandinavian Journal of Plastic and Reconstructive Surgery, 38(4), 193. Kastelic, J., Galeski, A., Baer, E. (1978). The multicoomposite structure of tendon. Connective Tissue Research, 6, 11-23. Khan, K., Cook, J., Bonar, F., Harcourt, P. (1999). Histopathology of common tendinopathies. Update and implications for clinical management. Sports Medicine, 27(6), 393-408. Khan, K., Maffulli, N. (1998). Tendinopathy: An Achilles' heel for athletes and clinicians. Clinical Journal of Sports Medicine, 8, 151. Kirkendall, D., Garrett, W. (1997). Function and biomechanics of tendons. Scandinavian Journal of Medicine & Science in Sports, 7, 62-66. Kivi, P. (1984). Rheumatic disorders of the upper limbs associated with repetitive occupational tasks in Finland in 1975-1979. Scandinavian Journal of Rheumatology, 13, 101-107. Koob, T., Summers, A. (2002). Tendon-bridging the gap. Comparative Biochemistry and Physiology A Molecular and Intergrative Physiology, 133, 905-909. Kruth, H. (1985). Lipid deposition in human tendon xanthoma. American Journal of Physiology, 121, 311-315. 75   Kurtz, C., Loebig, T., Anderson, D., DeMeo, P., Campbell, P. (1999). Insulin-like growth factor I accelerates functional recovery from Achilles tendon injury in a rat model. American Journal of Sports Medicine, 27, 363-369. Kvist, M. (1994). Achilles tendon injuries in athletes. Sport Medicine, 18, 173-201. Langberg, H., Ellingsgaard, H., Madsen, T, et al. (2007). Eccentric rehabilitation exercise increases peritendinous type I collagen synthesis in humans with Achilles tendinosis. Scandinavian Journal of Medicine & Science in Sports, 17, 61-66. Langberg, H., Skovgaard, D., Peterson, L., Bulow J., Kjaer,M. (1999). Type I collagen synthesis and degradation in peritendinous tissue after determined by microdialysis in humans. The Journal of Physiology1999, 521, 299-306. Laws, A., Reaven, G. (1992). Evidence for an independant relationship between insulin resistance and fasting plasma HDL-cholesterol, triglyceride and insulin concentrations. Journal of Internal Medicine, 231(1), 25-30. Lehtonen, A., Makela, P., Viikari, J., Virtama, P. (1981). Achilles tendon thickness in hypercholesterolaemia. Annal of Clinical Research, 13, 39. Leiter, L., Genest, J., Harris, S. et al. for the Canadian Diabetes Association Clinical Practice Guidelines Expert Committee. (2006). Dyslipidemia in adults with diabetes. Canadian Journal of Diabetes, 30(3), 230-240. Lin, T., Cardenas, L., Soslowsky, L. (2004). Biomechanics of tendon injury and repair. Journal of Biomechanics, 37, 865-877. Lui, P., Maffulli, N., Rolf, C., Smith, R. (2010). What are the validated animal models for tendinopahty? . Scandinavian Journal of Medicine & Science in Sports. Lynch, S., Colvin, R., Antoniades, H. (1989). Growth factors in wound healing: single and synergistic effects on partial thickness porcine skin wounds. Journal of Clinical Investigation, 84(2), 640-646. Maffulli, N. (2002). The female athlete. Sports Medicine and Arthroscopy Review, 10, 1. Maffulli, N., Benazzo, F. (2000). Basic sciences of tendons. Sports Medicine and Arthroscopy Review, 8, 1-5. Maffulli, N., Wong, J., Almekinders, L. (2003). Types and epidemiology of tendinopathy . Clinics in Sports Medicine, 22, 675-692. Majewski, M., Betz, O., Ochsner, P., Liu, F., Porter, R., Evans, C. (2008). Ex vivo adenoviral transfer of bone morphogenetic protein 12 (bmp-12) cdna improves achilles tendon healing in a rat model. Gene Therapy, 15(16), 1139-1146. Manske, P., Gelberman, R., Lesker, P. (1985). Flexor tendon healing. Hand Clinics, 1, 25-34. 76   Mason, M., Allen, H. (1941). The rate of healing of tendons: An experimental study of tensile strength. Annals of Surgery, 113, 424. Mass, D., Tuel, R. (1991). Intrinsic healing of the laceration site in human superficialis flexor tendons in vitro. Journal of Hand Surgery, 16, 24-30. McLaughlin, T., Reaven, G., Abbasi, F., et al. (2005). Is there a simple way to identify insulin- resistant individuals at increased risk of cardiovascular disease? American Journal of Cardiology, 96(3), 399. Meir, K., Leitersdorf, E. (2004). Atherosclerosis in the apolipoprotein E-deficient mouse. Arteriosclerosis, Thrombosis, and Vascular Biology , 24, 1006-1014. Metcalfe, D., Baram, D., Mekori, Y. (1997). Mast cells. Physiological Reviews, 77, 1033-1079. Miller, R., McDevitt, C. (1988). The presence of thrombospondin in ligaement, meniscus, and intervertebral disc. Glycoconjugate, 5, 312-316. Moghadasian, M., McManus, B., Nguyen, L., Shefer, S., Nadji, M., Godin, D., Green, T., Hill, J., Yang, Y., Scudamore, C., Frohlich, J. (2001). Pathophysiology of apolipoprotein E deficiency in mice: relevance to apo E-related disorders in humans. The FASEB Journal, 15, 2623. Moghadasian, M., Nguyem, L., Shefer, S., Salen, G., Batta, A., Frohlich, J. (1999). Histologic, hematologic, and biomechanical characteristics of apoE-KO mice: effects of dietary cholesterol and phytosterols. Laboratory Investigation, 79, 355-364. Molloy, T., Wang, Y., Murrell, G. (2003). The roles of growth factors in tendon and ligament healing. Sports Medicine, 33(5), 381-394. M\u00fcller, S., A., Heisterbach, P., Majewski, M. (2012). Tendon healing with growth factors. In A. Cretnik (Ed.), Achilles Tendon (pp. 43-62). Croatia: InTech. Murphy, P., Loitz, B., Frank, C., Hart, D. (1994). Influence of exogenous growth factors on the synthesis and secretion of collagen types I and III by explants of normal and healing rabbit ligaments. Biochemistry and Cell Biology, 72, 403-409. Murray, D., Kubiak, E., Jazrawi, L., Araghi, A., Kummer, F., Loebenberg, M., Zuckerman, J. (2007). The effect of cartilage-derived morphogenetic protein 2 on initial healing of a rotator cuff defect in a rat model. Journal of Shoulder and Elbow Surgery, 16(2), 251- 254. Nakagawa, Y., Majima, T., Nagashima, K. (1994). Effect of ageing on ultrastructure of slow and fast skeletal muscle tendon in rabbit Achilles tendon. Acta Physiologica Scandinavica, 152, 307-313. Nakagawa, Y., Totsuka, M., Sato, T., Fukuda, Y., Hirota, K. (1989). Effect of disuse on the ultrastructure of the achilles tendon in rats. European Jounal of Applied Physiology, 59, 239-242. 77   Nakamura, N., Horibe, S., Matsumoto, N., Tomita, T., Natsuume, T., Kaneda, Y., Shino, K., Ochi, T. (1996). Transient introduction of a foreign gene info healing rat patellar ligament. Journal of Clinical Investigation, 97, 226-231 . Nakamura, N., Shino, K., Natsuume, T., Horibe, S., Matsumoto, N., Kaneda, Y., Ochi, T. (1998). Early biological effect of in vivo gene transfer of platelet-derived growth factor (PDGF)- B into healing patellar ligament. Gene Therapy, 5, 1165-1170. Nakashima, Y., Plump, A., Raines, E., Breslow, J., Ross, R. (1994). ApoE-deficient mice develop lesions of all phases of atherosclerosis throughout the arterial tree. Arteriosclerosis, Thrombosis, and Vascular Biology , 14, 133. Oakes, B. (2003). Tissue healing and repair: tendons and ligaments. In W. Frontera (Ed.), Rehabilitation of sports injuries: scientific basis. (pp. 56-98). Boston: Blackwell Science. O'Brien, M. (1997). Structure and metabolism of tendons. Scandinavian Journal of Medicine & Science in Sports, 7, 55-61. O'Brien, T. (1992). Functional anatomy and physiology of tendons. Clinics in Sports Medicine, 11, 505. Ochiai, N., Matsui, T., Miyaji, N., Merklin, R., Hunter, J. (1979). Vascular anatomy of flexor tendons . Journal of Hand Surgery, 4, 321-330. Ozgurtas, T., Yildiz, C., Serdar, M., Atesalp, S., Kutluay, T.  (2003). Is High Concentration of Serum Lipids a Risk Factor for Achilles Tendon Rupture? Clinical Chimica Acta, 331, 25-28. Parker, F., Odland, G. (1973). Ultrastructural and lipid biomechanical comparisons of human eruptive, tuberous, and planar xanthomas. Israel Journal of Medical Sciences, 9, 395- 423. Party, D., Barnes, G., Craig, A. (1978). A comparison of the size distribution of collagen fibrils in connective tissues as a function of age and a possible relationship between fibril size distribution and mechanical properties. Proceedings of the Royal Society London, 203, 305-321. Pereira, S., Teixeira, L., Aguilar, E., Matoso, R., Soares, F., Ferreira, A., Alvarez-Leite, J. (2012). Differences in adipose tissue inflammation and oxidative status in C57BL\/6 and ApoE-\/- mice fed high fat diet. Animal Science Journal, 83, 549-555. Petersen, W., Pufe, T., Unterhauser, F., Zantop, T., Mentlein, T., Weiler, A. (2003). The splice variants 120 and 164 of the angiogenic peptide vascular endothelial cell growth factor (vegf) are expressed during achilles tendon healing. Archives of Orthopaedic and Trauma Surgery, 123(9), 475-480. Pins, G., Christiansen, D., Patel, R., Silver, F. (1997). Selfassembly of collagen fibers: Influence of fibrillar alignment and decorin on mechanical properties. Biophysical Journal, 73, 2164-2172. 78   Plump, A., Breslow, J. (1995). Apolipoprotein E and the apolipoprotein E-deficient mouse. Annual Review of Nutrition, 15, 495. Plump, A., Scott, C., Breslow, J. (1994). Human apolipoprotein A-I gene expression increases high density lipoproteins and suppresses atherosclerosis in the apolipoprotein E-deficient mouse. Proceedings of the National Academy of Sciences USA, 91, 9607-9611. Potenza, A. (1969). Mechanisms of healing of digital flexor tendons. Hand, 1, 40-41. Potenza, A. (1962). Tendon healing within the flexor digital sheath in the dog. Journal of Bone and Joint Surgery , 44A, 49. Pottie, P., Presle, N., Terlain, B., Netter, P., Mainard, D., Berenbaum, F. (2006). Obesity and osteoarthritis: more complex than predicted! Annals of the Rhuematic Diseases, 50, 425- 435. Ree, J., Gijbels, M., Broek, W., Hofker, M., Havekes, L. (1995). Atypical xanthomatosis in apolipoprotein E-deficient mice after cholesterol feeding. Atherosclerosis, 112, 237-243. Renstrom, P., Johnson, R. (1985). Overuse injuries in sports: A review. Sport Medicine, 2, 316. Renstrom, P., Kannus, P. (1991). Prevention of sports injuries . In H. Strauss (Ed.), Sports Medicine (pp. 307-29). Philadelphia: W.B. Saunders. Rigozzi, S., Muller, R., Snedeker, J. (2009). Local strain measurements reveals a varied regional dependance of tensile mechanics on glycoaminoglycan content. Jorunal of Biomechanics, 42, 1547-1552. Roberts, A., Flanders, K., Kondaiah, P., Thompson, N., Obberghen-Schilling , E., Wakefield, L., Rossi, P., de Crombrugghe, B., Heine, U., Sporn, M. (1988). Transforming growth factor beta: biochemistry and roles in embryogenesis, tissue repair and remodeling, and carcinogenesis. Recent Progress in Hormone Research, 44, 157-197. Rolf, C., Movin, T. (1997). Etiology, histopathology, and outcome of surgery in achillodynia. Foot and Ankle International , 18, 565. Romero-Corral, A., Montori. V., Somers, V., Korinek, J., Thomas, R., Allison, T., et al. (2006). Association of bodyweight with total mortality and with cardiovascular events in coronary artery disease: a systematic review of cohort studies. Lancet, 368, 666-678. Ronnemaa, T., Juva, K., Kulonen, E. (1975). Effect of hyperlipidemic rat serum on the synthesis of collagen by chick embryo fibroblasts. Clinical Orthopaedics and Related Research, 21, 315-324. Savolainen, J., Myllyla, R., Vihko, V., V\u2019daniinen, K., Takala, T. (1988). Effects of denervation and immobilisation on collagen synthesis in rat skeletal muscle and tendon. American Journal of Physiology, 254, R897-902. 79   Schober, S., Carroll, M., Lacher, D., Hirsch, R. (2007). Division of Health and Nutrition Examination Surveys. High serum total cholesterol: an indicator for monitoring cholesterol lowering efforts: US adults. NCHS Data Brief, 2, 1-8. Scott, A., Ashe, M. (2006). Common tendinopathies in the upper and lower extremities. Current Sports Medicine Reports, 5, 233-241. Scott, A., Sampio, A., Abraham, T., Duronio, C., Underhill, M. (2011). Scleraxis expression is coordinately regulated in a murine model of patellar tendon injury. Journal of Orthopaedic Research, 29, 289-296. Segesser, B., Nigg, B., Morell, F. (1980). Achillodynie und tibiale insertiotendinosen. Medizine and Sport, 18, 565-569. Sharma, A., Abraham, T., Sampio, A., Cowan, M., Underhill, M., Scott, A. (2011). Sodium cromolyn reduces expression of CTGF, ADAMTS1, and TIMP3 and modulates post- injury patellar tendon morphology. Journal of Orthopaedic Research, 29, 678-683. Sharma, P., Maffulli, N. (2005). Tendon injury and tendinopathy: Healing and repair. The Journal of Bone and Joint Surgery (American), 87, 187-202. Smith, S., Lovejoy, J., Greenway, F., Ryan, D., deJonge, L., de la Bretonne, J., et al. (2001). Contributions of total body fat, abdominal subcutaneous adipose tissue compartments, and visceral adipose tissue to the metabolic complications of obesity. Metabolism, 50, 425-435. Stenroth, L., Peltonen, J., Cronin, N., Sipila, S., Finni, T. (2012). Age-related differences in Achilles tendon properties and triceps surae muscle architecture in vivo. Journal of Applied Physiology, 113, 1537-1544. Tarnus, E., Wassef, H., Carmel, J., Rondeau, P., Roche, M., Davignon, J., Bernier, L., Bourdon, E. (2009). Apolipoprotein E limits oxidative stress-induced cell dysfunctions in human adipocytes. FEBS letters, 583(12), 2042-2048. Thomopoulos, S., Das, R., Sakiyama-Elbert, S., Silva, M., Charlton, N., Gelberman, R. (2010). bfgf and pdgf-bb for tendon repair: controlled release and biologic activity by tendon fibroblasts in vitro. Annals of Biomedical Engineering, 38(2), 225-234. Tillman, L., Chasan, N. (1996). Properties of dense connective tissue and wound healing. In: Hertling D, Kessler RM, editors. Management of common musculoskeletal disorders: physical therapy principles and methods (Vol. 3). Philadelphia: Lippincott. Tsouli, S., Kiortsis, D., Argyropoulou, M., Mikhaildis, D., Elisaf, M. (2005). Pathology, detection and treatment of Achilles tendon xanthomas. European Journal of Clinical Investigation, 35, 236. Vailas, A., Pedrini, V., Pedrini-Mille, A., Holloszy, J. (1985). Patellar tendon matrix changes associated with aging and voluntary exercise. Journal of Applied Physiology, 58, 1572- 1576. 80   Viidik, S. (1967). The effect of training on the tensile strength of isolated rabbit tendons. Scandinavian Journal of Plastic and Reconstructive Surgery, 1, 141-147. Viidik, S. (1969). Tensile strength properties of Achilles tendon systems in trained and untrained rabbits. Acta Orthopaedica Scandinavica, 40, 261-272. Vilarta, R., Vidal, B. (1989). Anisotropic and biomechanical properties of tendons modified by exercise and dennervation: Aggregation and macromolecular order in collagen bundles. Matrix, 9, 55-61. Vogel, K., Koob, T. (1989). Structural specialization in tendons under compression. International Review of Cytology, 115, 267-293. Wang, F., Murrell, G., Wang, M. (2007). Oxidative stress-induced c-Jun N-terminal kinase (JNK) activation in tendon cells upregulates MMP1 mRNA and protein expression. Journal of orthopaedic research, 25(3), 378-389. Wang, J. (2006). Mechanobiology of tendon. Journal of Biomechanics, 39, 1563-1582. Wang, J., Guo, Q., Li, B. (2012). Tendon biomechanics and mechanobiology-A minireview of basic concepts and recent advancements. Journal of Hand Therapy, 25(2), 133-141. Werner, R., Franzblau, A., Gell, N., Ulin, S., Armstrong, T. (2005). A longitudinal study of industrial and clerical workers: predictors of upper extremity tendonitis. Journal of Occupational Rehabilitation, 15, 37-46. Williams, B., Cohen, S. (2009). Greater trochanteric pain syndrome: a review of anatomy, diagnosis and treatment. Anesthesia and Analgesia, 108, 1662-1670. Wong, J., Barrass, V., Maffulli, N. (2002). Quantitative review of operative and nonoperative management of Achilles tendon ruptures. American Journal of Sports Medicine, 30(4), 565-575. Woo, S., Gomez, M., Woo, Y., Akeson, W. (1982). Mechanical properties of tendons and ligaments. Biorheology, 19, 985-396. Woo, S., Renstrom, A., Anoczky, S. (2007). Tendinopathy: a major medical problem in sport. In S. Woo, Renstrom, A., Anoczky, S. (Ed.), Tendinopathy in Athletes (Vol. 12, pp. 1-8). Massachusetts: Blackwell Publishing Ltd. . Woo, S., Ritter, M, Amiel, D., et al. (1980). The Biomechanical and biochemical properties of swine tendons: Long-term effects of exercise on the digital extensors. Connective Tissue Research, 7, 177-183. W\u00fcrgler-Hauri, C., Dourte, L., Baradet, T., Williams, G., Soslowsky, L. (2007). Temporal expression of 8 growth factors in tendon-to-bone healing in a rat supraspinatus model. Journal of Shoulder and Elbow Surgery, 16(5(Suppl)), 198-203. Xu, Y., Murrell, G. (2008). The basic science of tendinopathy. Clinical Orthopaedics and Related Research, 466(7), 1528-1538. 81   Yoon, J., Halper, J. (2005). Tendon proteoglycans: Biochemistry and function. Journal of Musculoskeletal and Neuronal Interactions, 5, 22-34. Yoshikawa, Y., Abrahamsson, S. (2001). Dose-related cellular effects of platelet-derived growth factor-BB differ in various types of rabbit tendons in vitro. Acta Orthopaedica Scandinavica, 72(3), 287-292. Yuan, J., Murrell, G., Trickett, A., Landtmeters, M., Knoops, B., Wang, M. (2004). Overexpression of antioxidant enzyme peroxiredoxin 5 protects human tendon cells against apoptosis and loss of cellular function during oxidative stress. Biochimica et Biophysica Acta (BBA)-Molecular Cell Research, 1693, 37-45. Yuan, J., Murrell, G., Trickett, A., Wang, M. (2003). Involvement of cytochrome c release and caspase-3 activation in the oxidative stress-induced apoptosis in human tendon fibroblasts. Biochimica et Biophysica Acta (BBA)-Molecular Cell Research, 1641, 35-41. Zadelaar S., K. R., Verschuren L., Van der Weij J., Van der Hoorn J., Princen M., Kooistra T. (2007). Mouse models for atherosclerosis and pharmaceutical modifiers. Arteriosclerosis, Thrombosis, and Vascular Biology , 27, 1706-1721. Zhang S., R. R., Piedrahita l., Maeda N. (1992). Spontaneous hypercholesterolemia and arterial lesions in mice lacking apolipoprotein E. Science, 258, 468-471. 82   Appendices Appendix A   Initial weight of mice at 7 weeks of age and final weights at their respective time points.  Some mice were sacrificed prior to their experimental time points, labeled as \u201cSick.\u201d Animals with an \u201c*\u201d were sacrificed prior to their planned time point as well, but their tendons were harvested and included in the qPCR analysis.  Strain Cage Animal number Diet Initial weight (g) Final weight (g) Time point ApoE-KO  C 43 Normal 20.1 20.1 Sick B 8 High fat 23 26.8 Sick B 2 High fat 27.6 31.8 15 weeks B 3 High fat 25.1 25.5 15 weeks B 5 High fat 25.1 27.8 15 weeks A 9 High fat 25.6 29.8 15 weeks A 10 High fat 26.4 31.1 15 weeks B 4 High fat 26.4 28 Sick A 7 High fat 27.3 32.9 Sick B 1 High fat 26.3 28.9 Sick D 24 Normal 24.7 30.7 15 weeks D 25 Normal 25 28.6 15 weeks F 26 Normal 28.3 33.7 15 weeks E 31 Normal 28 26.8 Sick C 42 High fat 27.9 30.1 Sick E 30 Normal 26.1 26.2 15 weeks A 6 High fat 25.6 39.1 30 weeks A 8 High fat 25.4 28.5 30 weeks F 27 High fat 26 26.9 Sick F 29 High fat 23 23.6 Sick A 15 Normal 29 34.4 30 weeks A 16 Normal 27.6 34.3 30 weeks A 17 Normal 26.8 25.1 30 weeks A 18 Normal 25.8 33.8 30 weeks F 51 High fat 25.6 23.9 Sick * D 21 Normal 26.2 33.2 30 weeks D 22 Normal 24.3 31.7 30 weeks D 23 Normal 26.3 31.8 30 weeks F 28 High fat 27.2 39.3 30 weeks C 41 High fat 27.9 31 Sick * F 53 High fat 21.9 23.4 Sick * 83   Strain Cage Animal number Diet Initial weight (g) Final weight (g) Time point C57Bl\/6 C 1 Normal 23 31.2 15 weeks C 2 Normal 23.2 31.6 15 weeks C57Bl\/6  C 3 Normal 23 28.5 15 weeks C 4 Normal 21 27.4 15 weeks C 5 Normal 21.5 28.5 15 weeks B 6 High fat 23.7 28.5 15 weeks B 7 High fat 25 30.2 15 weeks B 8 High fat 24.3 31.5 15 weeks B 9 High fat 23.6 28.5 15 weeks B 10 High fat 23.6 28.5 15 weeks A 1 High fat 23.2 47.6 30 weeks A 2 High fat 23.9 40.3 30 weeks A 3 High fat 21.8 45 30 weeks A 4 High fat 23.2 51.1 30 weeks A 5 High fat 21.5 45 30 weeks D 6 Normal 23.1 35.4 30 weeks D 7 Normal 23.7 30.1 30 weeks D 8 Normal 21.7 35.4 30 weeks E 9 Normal 22.2 36.8 30 weeks E 10 Normal 22.6 36.7 30 weeks F 11 Normal 22.5 29.8 30 weeks F 12 Normal 22 33.7 30 weeks G 54 High fat 27.6 52.6 30 weeks G 55 High fat 27.6 53.4 30 weeks G 56 High fat 24.7 50.8 30 weeks   84   Appendix B   ApoE monitoring sheet  ApoE monitoring sheet  Week 1 1 2 2 3 3 4 4 Animal number  Date and initial when checked  Assigned end-point  Weight DOB  Xanthoma size (diameter)  High fat or normal Date started on high fat or control   If any distress, note below  Initial weight Critical weight (85% weight)  While on diet, animals to be checked twice per week, and weighed once per week. Weight loss > 15% will require euthanasia  Food (normal or high fat) can be added ad libitum Distress:                          Animals will be checked twice per week and general behaviour will be followed. For those animals where a change in behaviour is noted then the animal will be examined for the following: 1) posture, hunching posture would indicate pain in the abdomen; 2) gait and movement, do the animals exhibit normal gait and movement ( circling, excessive activity, wobbly, etc.); 3) behaviour, do animals exhibit normal behaviour when stimulated (ie. being picked up or fleeing); 4) respiration, do the animals exhibit laboured respiration, noisy breathing, wide stance, or open-mouth breathing. Animals that fall into the 4th category will be immediately sacrificed. Animals that exhibit signs in 1-3 will be closely monitored (checked several times per day) or sacrificed. In the case of the appearance of cutaneous xanthomas appearing, mice will be monitored closely. If the xanthomas worsen (area greater than 1 cm2) or are causing obvious discomfort, the mouse will be sacrificed. Discomfort will be assessed based on gait, attitude, appearance, behavior, appetite and weight. 85   Appendix C   Normal quantile and residual plots for all variables studied.  86     87    88    89   Appendix D   Cross-sectional area (CSA) measurements for animals sacrificed at 0 weeks on diet.  Strain Animal Number Side CSA1 CSA2 CSAaverage ApoE-KO  A41 L 0.85 0.79 0.82 A41 R 0.97 1.01 0.99 A42 L 1 1.2 1.1 A42 R 0.68 0.64 0.66 A43 L 0.8 0.88 0.84 A43 R 0.72 0.8 0.76 A44 L 0.96 0.88 0.92 A44 R 0.72 0.71 0.715 A45 L 0.5 0.46 0.48 A45 R 0.74 0.77 0.755 F52 L 0.48 0.56 0.52 F52 R 0.5 0.52 0.51 F54 L 0.61 0.57 0.59 F54 R 1.15 1.26 1.205 F55 L 0.78 1.06 0.92 F55 R 0.65 0.77 0.71 F56 L 0.63 0.61 0.62 F56 R 0.54 0.58 0.56 F57 L 1.29 1.13 1.21 F57 R 0.68 0.72 0.7 B50 L 0.84 0.9 0.87 B50 R 0.58 0.57 0.575 C57Bl\/6  H13 L 1.26 0.91 1.085 H13 R 0.56 0.53 0.545 H14 L 0.68 0.71 0.695 H14 R 1.13 1.08 1.105 H15 L 0.64 0.61 0.625 H15 R 0.46 0.52 0.49 H16 L 0.75 0.7 0.725 H16 R 0.52 0.42 0.47 H17 L 0.66 0.63 0.645 H17 R 0.48 0.56 0.52 I18 L 0.86 1.04 0.95 I18 R 0.67 0.85 0.76 I19 L 0.78 0.86 0.82 I19 R 0.63 0.56 0.595 90   Strain Animal Number Side CSA1 CSA2 CSAaverage C57Bl\/6  I20 L 0.76 0.86 0.81 I20 R 0.72 0.71 0.715 J21 L 0.74 0.82 0.78 J21 R 0.61 0.61 0.61 J22 L NA NA NA J22 R 0.66 0.56 0.61 J23 L 0.91 0.93 0.92 J23 R 0.61 0.71 0.66 91   Appendix E  2 (-\u0394Ct)  and standard errors of each gene in qPCR analysis. Strain Diet Cpa3 TGF-\u03b2 Col1a1 Col3a1 2 (-\u0394Ct)  SE 2 (-\u0394Ct)  SE 2 (-\u0394Ct)  SE 2 (-\u0394Ct)  SE ApoE-KO  Regular chow 0.007521 9.6E-05 0.017007 0.000196 0.380416 0.006045 0.088516 0.001796 0.002248 4.17E-05 0.006509 0.000144 1.872218 0.032047 0.284101 0.002615 0.001544 1.05E-05 0.00395 3.81E-05 0.957784 0.004769 0.26478 0.001985 0.002743 4.34E-05 0.004139 3.14E-05 0.081414 0.004065 0.034235 0.00504 0.000304 1.84E-06 0.001819 1.8E-05 0.008616 0.000142 0.005027 0.000124 0.0021 4.76E-05 0.007959 0.000134 0.016055 0.002024 0.006839 0.000253 0.015995 0.0003 0.009807 0.000153 1.042111 0.028968 0.232863 0.008133 0.003133 5.36E-05 0.005129 9.22E-05 1.851165 0.022592 0.346608 0.004033 0.001435 4.63E-05 0.003735 5.13E-05 0.33765 0.001252 0.101467 0.001012 0.002836 0.000125 0.003222 3.87E-06 1.424363 0.013353 0.19399 0.005513 0.001641 4.86E-05 0.001485 9.23E-06 0.159671 0.000145 0.023215 0.000244 0.009633 0.000411 0.014194 0.000344 0.583848 0.013812 0.1606 0.016483 0.002327 5.41E-05 0.000944 1.99E-05 0.189724 0.000164 0.024097 7.91E-05 High fat 0.006231 0.000125 0.011086 0.000129 1.521569 0.025739 0.247219 0.002582 0.000968 3.28E-05 0.001914 4.04E-05 0.077625 0.000888 0.023992 0.000248 0.001642 9.06E-05 0.003741 8.46E-05 0.34229 0.005538 0.078916 0.000906 0.001224 1.91E-05 0.002354 2.9E-05 0.161848 0.002218 0.070059 0.000708 0.001215 9.7E-06 0.004628 4.47E-05 0.346059 0.001217 0.095839 0.00142 0.00087 3.6E-05 0.005677 0.00016 0.031915 9.45E-05 0.014337 0.000646 0.000756 7.7E-05 0.005373 0.000484 0.029187 0.000526 0.010623 0.000281 0.001196 1.88E-05 0.005038 1.05E-05 0.004336 0.000101 0.002509 7.45E-05 0.000471 4.95E-06 0.001003 1.03E-05 0.00207 3.33E-05 0.000985 2.09E-05 0.000306 6.09E-06 0.002368 2.05E-05 0.022794 0.000328 0.011187 5.7E-05 0.002398 7.51E-05 0.00712 0.000103 0.01762 0.000321 0.004767 0.000303 92    Strain Diet Cpa3 TGF-\u03b2 Col1a1 Col3a1 2 (-\u0394Ct)  SE 2 (-\u0394Ct)  SE 2 (-\u0394Ct)  SE 2 (-\u0394Ct)  SE C57Bl\/6  Regular chow  0.002927 0.000254 0.003945 6.7E-05 1.758513 0.027494 0.158885 0.001707 0.005687 0.000169 0.008605 7.82E-05 1.385522 0.013515 0.16863 0.008517 0.002611 0.000188 0.002567 2.29E-05 0.905743 0.005371 0.088723 0.002981 0.001563 6.22E-05 0.002344 1.11E-05 0.269309 0.003312 0.031452 0.000579 0.002714 0.0001 0.00309 4.83E-05 2.016183 0.007365 0.148018 0.00143 0.003807 0.000284 0.002285 9.37E-06 1.352272 0.012257 0.137844 0.006542 0.005092 5.27E-05 0.010007 0.000291 1.34176 0.01243 0.12789 0.002659 0.000881 0.000101 0.002999 5.8E-05 1.63475 0.02409 0.119203 0.003212 0.003492 6.72E-05 0.002986 0.00015 1.395496 0.008216 0.112273 0.002844 0.001157 4.75E-05 0.002095 0.000125 0.230305 0.003522 0.034454 0.000167 0.00264 2.4E-05 0.002101 2.02E-05 0.461644 0.009213 0.045608 0.000318 0.003224 2.14E-05 0.010581 9.96E-05 0.339928 0.004962 0.063194 0.001093 0.001178 3.21E-05 0.002052 2.28E-05 0.149241 0.00163 0.02457 0.000202 0.001494 1.27E-05 0.002219 3.49E-06 0.180776 0.001223 0.02489 0.000452 High fat 0.001644 8.9E-05 0.003335 0.00012 1.407218 0.010205 0.091568 0.001393 0.002232 6.11E-05 0.002357 3.48E-05 0.567587 0.004038 0.06099 0.000905 0.000585 1.59E-05 0.002721 2.04E-05 1.482445 0.084526 0.17058 0.003822 0.002621 0.000116 0.007493 0.000223 1.003434 0.010405 0.109771 0.002702 0.003362 5.2E-05 0.005707 0.00021 1.097189 0.004365 0.114541 0.004231 0.003663 5.12E-05 0.00718 0.000237 4.144638 0.094375 0.291129 0.009019 0.001128 4.1E-05 0.003611 4.04E-05 0.224442 0.022591 0.023199 0.000185 0.00074 2.4E-05 0.0017 3.18E-05 0.220457 0.00069 0.016586 0.000191 0.00257 4.64E-05 0.003435 7.8E-05 1.135021 0.015156 0.165259 0.001677 0.001159 1.06E-05 1.407218 0.010205 0.453147 0.002873 0.042826 0.001162 0.001648 2.88E-05 0.004945 5.31E-05 2.452028 0.071061 0.236093 0.004044 0.00521 5.37E-05 0.008587 0.000179 0.234771 0.001072 0.044685 0.000269 0.001247 2.85E-05 0.001968 9.58E-06 0.201071 0.003024 0.022647 0.000188 0.002156 1.49E-05 0.003358 7.48E-05 1.124138 0.017357 0.193857 0.005553 0.006454 7.2E-05 0.009979 7.53E-05 0.572248 0.026145 0.07376 0.000542 0.001898 2.18E-05 0.004273 0.000225 2.550851 0.04075 0.261861 0.001675","attrs":{"lang":"en","ns":"http:\/\/www.w3.org\/2009\/08\/skos-reference\/skos.html#note","classmap":"oc:AnnotationContainer"},"iri":"http:\/\/www.w3.org\/2009\/08\/skos-reference\/skos.html#note","explain":"Simple Knowledge Organisation System; Notes are used to provide information relating to SKOS concepts. There is no restriction on the nature of this information, e.g., it could be plain text, hypertext, or an image; it could be a definition, information about the scope of a concept, editorial information, or any other type of information."}],"Genre":[{"label":"Genre","value":"Thesis\/Dissertation","attrs":{"lang":"en","ns":"http:\/\/www.europeana.eu\/schemas\/edm\/hasType","classmap":"dpla:SourceResource","property":"edm:hasType"},"iri":"http:\/\/www.europeana.eu\/schemas\/edm\/hasType","explain":"A Europeana Data Model Property; This property relates a resource with the concepts it belongs to in a suitable type system such as MIME or any thesaurus that captures categories of objects in a given field. It does NOT capture aboutness"}],"GraduationDate":[{"label":"Graduation Date","value":"2013-11","attrs":{"lang":"en","ns":"http:\/\/vivoweb.org\/ontology\/core#dateIssued","classmap":"vivo:DateTimeValue","property":"vivo:dateIssued"},"iri":"http:\/\/vivoweb.org\/ontology\/core#dateIssued","explain":"VIVO-ISF Ontology V1.6 Property; Date Optional Time Value, DateTime+Timezone Preferred "}],"IsShownAt":[{"label":"DOI","value":"10.14288\/1.0073845","attrs":{"lang":"en","ns":"http:\/\/www.europeana.eu\/schemas\/edm\/isShownAt","classmap":"edm:WebResource","property":"edm:isShownAt"},"iri":"http:\/\/www.europeana.eu\/schemas\/edm\/isShownAt","explain":"A Europeana Data Model Property; An unambiguous URL reference to the digital object on the provider\u2019s website in its full information context."}],"Language":[{"label":"Language","value":"eng","attrs":{"lang":"en","ns":"http:\/\/purl.org\/dc\/terms\/language","classmap":"dpla:SourceResource","property":"dcterms:language"},"iri":"http:\/\/purl.org\/dc\/terms\/language","explain":"A Dublin Core Terms Property; A language of the resource.; Recommended best practice is to use a controlled vocabulary such as RFC 4646 [RFC4646]."}],"Program":[{"label":"Program (Theses)","value":"Experimental Medicine","attrs":{"lang":"en","ns":"https:\/\/open.library.ubc.ca\/terms#degreeDiscipline","classmap":"oc:ThesisDescription","property":"oc:degreeDiscipline"},"iri":"https:\/\/open.library.ubc.ca\/terms#degreeDiscipline","explain":"UBC Open Collections Metadata Components; Local Field; Indicates the program for which the degree was granted."}],"Provider":[{"label":"Provider","value":"Vancouver : University of British Columbia Library","attrs":{"lang":"en","ns":"http:\/\/www.europeana.eu\/schemas\/edm\/provider","classmap":"ore:Aggregation","property":"edm:provider"},"iri":"http:\/\/www.europeana.eu\/schemas\/edm\/provider","explain":"A Europeana Data Model Property; The name or identifier of the organization who delivers data directly to an aggregation service (e.g. Europeana)"}],"Publisher":[{"label":"Publisher","value":"University of British Columbia","attrs":{"lang":"en","ns":"http:\/\/purl.org\/dc\/terms\/publisher","classmap":"dpla:SourceResource","property":"dcterms:publisher"},"iri":"http:\/\/purl.org\/dc\/terms\/publisher","explain":"A Dublin Core Terms Property; An entity responsible for making the resource available.; Examples of a Publisher include a person, an organization, or a service."}],"Rights":[{"label":"Rights","value":"Attribution-NonCommercial-NoDerivatives 4.0 International","attrs":{"lang":"en","ns":"http:\/\/purl.org\/dc\/terms\/rights","classmap":"edm:WebResource","property":"dcterms:rights"},"iri":"http:\/\/purl.org\/dc\/terms\/rights","explain":"A Dublin Core Terms Property; Information about rights held in and over the resource.; Typically, rights information includes a statement about various property rights associated with the resource, including intellectual property rights."}],"RightsURI":[{"label":"Rights URI","value":"http:\/\/creativecommons.org\/licenses\/by-nc-nd\/4.0\/","attrs":{"lang":"en","ns":"https:\/\/open.library.ubc.ca\/terms#rightsURI","classmap":"oc:PublicationDescription","property":"oc:rightsURI"},"iri":"https:\/\/open.library.ubc.ca\/terms#rightsURI","explain":"UBC Open Collections Metadata Components; Local Field; Indicates the Creative Commons license url."}],"ScholarlyLevel":[{"label":"Scholarly Level","value":"Graduate","attrs":{"lang":"en","ns":"https:\/\/open.library.ubc.ca\/terms#scholarLevel","classmap":"oc:PublicationDescription","property":"oc:scholarLevel"},"iri":"https:\/\/open.library.ubc.ca\/terms#scholarLevel","explain":"UBC Open Collections Metadata Components; Local Field; Identifies the scholarly level of the author(s)\/creator(s)."}],"Title":[{"label":"Title ","value":"The link between hypercholesterolemia and tendon pathology","attrs":{"lang":"en","ns":"http:\/\/purl.org\/dc\/terms\/title","classmap":"dpla:SourceResource","property":"dcterms:title"},"iri":"http:\/\/purl.org\/dc\/terms\/title","explain":"A Dublin Core Terms Property; The name given to the resource."}],"Type":[{"label":"Type","value":"Text","attrs":{"lang":"en","ns":"http:\/\/purl.org\/dc\/terms\/type","classmap":"dpla:SourceResource","property":"dcterms:type"},"iri":"http:\/\/purl.org\/dc\/terms\/type","explain":"A Dublin Core Terms Property; The nature or genre of the resource.; Recommended best practice is to use a controlled vocabulary such as the DCMI Type Vocabulary [DCMITYPE]. To describe the file format, physical medium, or dimensions of the resource, use the Format element."}],"URI":[{"label":"URI","value":"http:\/\/hdl.handle.net\/2429\/44472","attrs":{"lang":"en","ns":"https:\/\/open.library.ubc.ca\/terms#identifierURI","classmap":"oc:PublicationDescription","property":"oc:identifierURI"},"iri":"https:\/\/open.library.ubc.ca\/terms#identifierURI","explain":"UBC Open Collections Metadata Components; Local Field; Indicates the handle for item record."}],"SortDate":[{"label":"Sort Date","value":"2013-12-31 AD","attrs":{"lang":"en","ns":"http:\/\/purl.org\/dc\/terms\/date","classmap":"oc:InternalResource","property":"dcterms:date"},"iri":"http:\/\/purl.org\/dc\/terms\/date","explain":"A Dublin Core Elements Property; A point or period of time associated with an event in the lifecycle of the resource.; Date may be used to express temporal information at any level of granularity. Recommended best practice is to use an encoding scheme, such as the W3CDTF profile of ISO 8601 [W3CDTF].; A point or period of time associated with an event in the lifecycle of the resource.; Date may be used to express temporal information at any level of granularity. Recommended best practice is to use an encoding scheme, such as the W3CDTF profile of ISO 8601 [W3CDTF]."}]}