{"Affiliation":[{"label":"Affiliation","value":"Forestry, Faculty of","attrs":{"lang":"en","ns":"http:\/\/vivoweb.org\/ontology\/core#departmentOrSchool","classmap":"vivo:EducationalProcess","property":"vivo:departmentOrSchool"},"iri":"http:\/\/vivoweb.org\/ontology\/core#departmentOrSchool","explain":"VIVO-ISF Ontology V1.6 Property; The department or school name within institution; Not intended to be an institution name."}],"AggregatedSourceRepository":[{"label":"Aggregated Source Repository","value":"DSpace","attrs":{"lang":"en","ns":"http:\/\/www.europeana.eu\/schemas\/edm\/dataProvider","classmap":"ore:Aggregation","property":"edm:dataProvider"},"iri":"http:\/\/www.europeana.eu\/schemas\/edm\/dataProvider","explain":"A Europeana Data Model Property; The name or identifier of the organization who contributes data indirectly to an aggregation service (e.g. Europeana)"}],"Campus":[{"label":"Campus","value":"UBCV","attrs":{"lang":"en","ns":"https:\/\/open.library.ubc.ca\/terms#degreeCampus","classmap":"oc:ThesisDescription","property":"oc:degreeCampus"},"iri":"https:\/\/open.library.ubc.ca\/terms#degreeCampus","explain":"UBC Open Collections Metadata Components; Local Field; Identifies the name of the campus from which the graduate completed their degree."}],"Creator":[{"label":"Creator","value":"Bravi, Rebecca Sue","attrs":{"lang":"en","ns":"http:\/\/purl.org\/dc\/terms\/creator","classmap":"dpla:SourceResource","property":"dcterms:creator"},"iri":"http:\/\/purl.org\/dc\/terms\/creator","explain":"A Dublin Core Terms Property; An entity primarily responsible for making the resource.; Examples of a Contributor include a person, an organization, or a service."}],"DateAvailable":[{"label":"Date Available","value":"2009-03-12T17:16:41Z","attrs":{"lang":"en","ns":"http:\/\/purl.org\/dc\/terms\/issued","classmap":"edm:WebResource","property":"dcterms:issued"},"iri":"http:\/\/purl.org\/dc\/terms\/issued","explain":"A Dublin Core Terms Property; Date of formal issuance (e.g., publication) of the resource."}],"DateIssued":[{"label":"Date Issued","value":"2009","attrs":{"lang":"en","ns":"http:\/\/purl.org\/dc\/terms\/issued","classmap":"oc:SourceResource","property":"dcterms:issued"},"iri":"http:\/\/purl.org\/dc\/terms\/issued","explain":"A Dublin Core Terms Property; Date of formal issuance (e.g., publication) of the resource."}],"Degree":[{"label":"Degree (Theses)","value":"Master of Science - MSc","attrs":{"lang":"en","ns":"http:\/\/vivoweb.org\/ontology\/core#relatedDegree","classmap":"vivo:ThesisDegree","property":"vivo:relatedDegree"},"iri":"http:\/\/vivoweb.org\/ontology\/core#relatedDegree","explain":"VIVO-ISF Ontology V1.6 Property; The thesis degree; Extended Property specified by UBC, as per https:\/\/wiki.duraspace.org\/display\/VIVO\/Ontology+Editor%27s+Guide"}],"DegreeGrantor":[{"label":"Degree Grantor","value":"University of British Columbia","attrs":{"lang":"en","ns":"https:\/\/open.library.ubc.ca\/terms#degreeGrantor","classmap":"oc:ThesisDescription","property":"oc:degreeGrantor"},"iri":"https:\/\/open.library.ubc.ca\/terms#degreeGrantor","explain":"UBC Open Collections Metadata Components; Local Field; Indicates the institution where thesis was granted."}],"Description":[{"label":"Description","value":"The utility of the T. magnivelare\/P. contorta ectomycorrhizal classification is evaluated using a strictly anatomical definition of the symbiosis proposed by Jones & Smith (2004) in which the presence of structural features Hartig net, mantle and extramatrical hyphae characterize the mycorrhizal state.  A combined molecular and morphological approach was adopted to analyse samples of P. contorta roots collected from beneath T. magnivelare sporocarps from pine stands in four ecosystems in the West Chilcotin Plateau of British Columbia, Canada.  Roots mass samples were assessed and four root morphotypes were described; matchstick root, blackened root, fleshy root and cottony root. Two primer sets were developed to amplify the ITS region of the ribosomal DNA in T. magnivelare.  Primer set one amplifies all commercially significant T. magnivelare, from across North America including some T. caligatum.  Primer set two specifically amplifies T. magnivelare from the Pacific Northwest of the United States and Canada.  Primers testing against a suite of 33 other Tricholoma species and 12 other genera demonstrated the primers performed well.  Primer set one initially showed strong and specific amplification of the target species but later in the test an apparent contamination problem developed, further testing is recommended to verify this.  Primer set two demonstrated a high specificity to T. magnivelare from the Pacific Northwest of the US and Canada and was used to confirm the presence of T. magnivelare in 10 samples each of the root morphologies.  In all samples T. magnivelare presence was established.  Root morphotypes and root masses were assessed for the presence of the defining structural features of ectomycorrhizae. These features were not consistently observed individually or in combination. A variety of mantle-like structures were observed and all features were observed in association with necrotizing root tissue.  It is therefore the concluded that the current classification of the T. magnivelare\/P. contorta symbiosis as ectomycorrhizal is not concordant with the definition of the symbiosis adopted for this study nor would it encourage a full appreciation of the complexity of this symbiotic relationship.","attrs":{"lang":"en","ns":"http:\/\/purl.org\/dc\/terms\/description","classmap":"dpla:SourceResource","property":"dcterms:description"},"iri":"http:\/\/purl.org\/dc\/terms\/description","explain":"A Dublin Core Terms Property; An account of the resource.; Description may include but is not limited to: an abstract, a table of contents, a graphical representation, or a free-text account of the resource."}],"DigitalResourceOriginalRecord":[{"label":"Digital Resource Original Record","value":"https:\/\/circle.library.ubc.ca\/rest\/handle\/2429\/5954?expand=metadata","attrs":{"lang":"en","ns":"http:\/\/www.europeana.eu\/schemas\/edm\/aggregatedCHO","classmap":"ore:Aggregation","property":"edm:aggregatedCHO"},"iri":"http:\/\/www.europeana.eu\/schemas\/edm\/aggregatedCHO","explain":"A Europeana Data Model Property; The identifier of the source object, e.g. the Mona Lisa itself. This could be a full linked open date URI or an internal identifier"}],"Extent":[{"label":"Extent","value":"2693147 bytes","attrs":{"lang":"en","ns":"http:\/\/purl.org\/dc\/terms\/extent","classmap":"dpla:SourceResource","property":"dcterms:extent"},"iri":"http:\/\/purl.org\/dc\/terms\/extent","explain":"A Dublin Core Terms Property; The size or duration of the resource."}],"FileFormat":[{"label":"File Format","value":"application\/pdf","attrs":{"lang":"en","ns":"http:\/\/purl.org\/dc\/elements\/1.1\/format","classmap":"edm:WebResource","property":"dc:format"},"iri":"http:\/\/purl.org\/dc\/elements\/1.1\/format","explain":"A Dublin Core Elements Property; The file format, physical medium, or dimensions of the resource.; Examples of dimensions include size and duration. Recommended best practice is to use a controlled vocabulary such as the list of Internet Media Types [MIME]."}],"FullText":[{"label":"Full Text","value":" AN ECTOMYCORRHIZAL SYMBIOSIS? A MORPHOLOGICAL AND MOLECULAR CHARACTERIZATION OF TRICHOLOMA MAGNIVELARE IN PINUS CONTORTA ROOTS FROM THE WEST CHILCOTIN PLATEAU OF BRITISH COLUMBIA, CANADA  by   REBECCA SUE BRAVI   B.Sc., The University of Northern British Columbia, 1999    A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF   MASTER OF SCIENCE   in   THE FACULTY OF GRADUATE STUDIES   (Forestry)   THE UNIVERSITY OF BRITISH COLUMBIA   (Vancouver)   March 2009     \u00a9 Rebecca Sue Bravi, 2009 Abstract The utility of the T. magnivelare\/P. contorta ectomycorrhizal classification is evaluated using a strictly anatomical definition of the symbiosis proposed by Jones & Smith (2004) in which the presence of structural features Hartig net, mantle and extramatrical hyphae characterize the mycorrhizal state.  A combined molecular and morphological approach was adopted to analyse samples of P. contorta roots collected from beneath T. magnivelare sporocarps from pine stands in four ecosystems in the West Chilcotin Plateau of British Columbia, Canada.  Roots mass samples were assessed and four root morphotypes were described; matchstick root, blackened root, fleshy root and cottony root. Two primer sets were developed to amplify the ITS region of the ribosomal DNA in T. magnivelare.  Primer set one amplifies all commercially significant T. magnivelare, from across North America including some T. caligatum.  Primer set two specifically amplifies T. magnivelare from the Pacific Northwest of the United States and Canada.  Primers testing against a suite of 33 other Tricholoma species and 12 other genera demonstrated the primers performed well. Primer set one initially showed strong and specific amplification of the target species but later in the test an apparent contamination problem developed, further testing is recommended to verify this.  Primer set two demonstrated a high specificity to T. magnivelare from the Pacific Northwest of the US and Canada and was used to confirm the presence of T. magnivelare in 10 samples each of the root morphologies.  In all samples T. magnivelare presence was established.  Root morphotypes and root masses were assessed for the presence of the defining structural features of ectomycorrhizae. These features were not consistently observed individually or in combination. A variety of mantle-like structures were observed and all features were observed in association with necrotizing root tissue.  It is therefore the concluded that the current classification of the T. magnivelare\/P. contorta symbiosis as ectomycorrhizal is not concordant with the definition of the symbiosis adopted for this study nor would it encourage a full appreciation of the complexity of this symbiotic relationship.    ii Table of Contents  Abstract ..................................................................................................................................... ii Table of Contents..................................................................................................................... iii List of Tables ............................................................................................................................ v List of Figures .......................................................................................................................... vi Acknowledgements................................................................................................................ viii Dedication ................................................................................................................................ ix Co-Authorship Statement.......................................................................................................... x CHAPTER 1   Introduction....................................................................................................... 1 References............................................................................................................................. 9 CHAPTER 2   Development and testing of PCR oligonucleotides for specific detection of Tricholoma magnivelare ......................................................................................................... 12 Introduction......................................................................................................................... 12 Materials and Methods........................................................................................................ 14 Results................................................................................................................................. 16 Discussion........................................................................................................................... 18 Tables.................................................................................................................................. 20 References........................................................................................................................... 24 CHAPTER 3  Root assessment............................................................................................... 26 Introduction......................................................................................................................... 26 Materials and Methods........................................................................................................ 31 Results................................................................................................................................. 36 Discussion........................................................................................................................... 46 Figures and Tables .............................................................................................................. 61 References........................................................................................................................... 88  iii CHAPTER 4   Conclusions..................................................................................................... 93 Limitations and Recommendations .................................................................................... 97 References......................................................................................................................... 100 Appendix 1 - Microscopic analysis of Ectomycorrhizal Features. ....................................... 102  iv List of Tables  Table 2.1: Suite of Test sporocarps......................................................................................... 20  Table 2.2: Primer Sequences................................................................................................... 23  Table 3.1: Overview of root sampling .................................................................................... 85  Table 3.2: Quantitative analysis of morphotypes. .................................................................. 86  Table 3.3:  Molecular Assessment of morphotypes................................................................ 86  Table 3.3: Microscopic Assessment of morphotypes.  ............................................................ 87    v List of Figures Figure 3.1: Fungal Root System ............................................................................................. 61 Figure 3.2: Cortical Cell Blackening, Cracking and Sloughing ............................................. 61 Figure 3.3: Splitting and Peeling of the Bark on Secondary Roots. ....................................... 62 Figure 3.4: Matchstick Morphotype ....................................................................................... 62 Figure 3.5: Blackened Root Morphotype................................................................................ 63 Figure 3.7: Fleshy Root Morphotype...................................................................................... 64 Figure 3.8: Cottony Root Morphotype ................................................................................... 64 Figure 3.9: Cottony Root Morphotype 2 ................................................................................ 65 Figure 3.10: Cottony Aggregation .......................................................................................... 66 Figure 3.11: Cottony Association ........................................................................................... 66 Figure 3.12: Psuedo-mantle Structure..................................................................................... 67 Figure 3.13: Straight Tip Type................................................................................................ 67 Figure 3.14: Tortuotous Tip.................................................................................................... 68 Figure 3.15: Bent Tip.............................................................................................................. 68 Figure 3.16: Mantle-Like Features ......................................................................................... 69 Figure 3.18: Soil Mycelia ....................................................................................................... 70 Figure 3.20 Dichotomous Short Root Branching ................................................................... 71 Figure 3.21: Monopodial Pinnate Branching.......................................................................... 72 Figure 3.22: White Tinged Short Root Apex.......................................................................... 72 Figure 3.23: Yellow-orange Tinged Short Root Apex............................................................ 73 Figure 3.24: Knuckling ........................................................................................................... 73 Figure 3.25: Secondary Root Bark Peeling............................................................................. 74 Figure 3.27: Variation in Matchstick Morphotypes................................................................ 75  vi Figure 3.28: Variation in Blackened Morphotypes................................................................. 76 Figure 3.29: Variation in Fleshy Morphotypes....................................................................... 77 Figure 3.30: Variations of the Cottony Root Type ................................................................. 78 Figure 3.31: Gel Electrophoresis ............................................................................................ 79 Figure 3.32: Matchstick Morphotype. .................................................................................... 79 Figure 3.34: Patchy-discontinuous Mantle ............................................................................. 80 Figure 3.35: Hartig net............................................................................................................ 81 Figure 3.36: Variable Hartig net ............................................................................................. 81 Figure 3.37: Hartig net and cortical collapse. ......................................................................... 82 Figure 3.38: Non-mycorrhizal root. ........................................................................................ 82 Figure 3.39: Cortical Cell Invasion......................................................................................... 83 Figure 3.40: Cortical Cell Collapse ........................................................................................ 83 Figure 3.41: Rejuvenation and Decay..................................................................................... 84 Figure 3.42 Ectomycorrhizae of Pinus contorta................................................................... 865   vii Acknowledgements  In recognition of the fact that I am only as great as my associations:  Thank you Dr. Bill Chapman this work would not have happened without you!  Thanks also to;  Dr. Richard Hamelin for taking me on as his Graduate Student in the 11th hour.  The Ulkatcho First Nation and Yun Ka Whu\u2019ten Holdings for their involvement in and support of pine mushroom research.  Laurie Vaughan, Becky Holte, Lorne Cahoose, Andrew Cahoose, Ronald Cahoose, Samantha Sulin, and Cheryl Gilbert kudos to you.  Tolko Industries for their support of this work through a Natural Sciences and Engineering Research Council Industrial Postgraduate Scholarship.  Dr. Mary Berbee for allowing me to be a visitor in her laboratory and for getting me started on my molecular journey.  Paul Kroeger for getting me a plethora of Tricholoma samples to test my primers against.  University of British Columbia Herbarium for all the samples you helped me obtain.  Andrus Voitk for sending me T. magnivelare samples from the East Coast.  Oregon State University Herbarium for the Mexican and Japanese Tricholoma samples.  My office, school and lab mates for their support and encouragement.  My parents for taking my crazy phone calls and encouraging me to finish.  viii Dedication   I dedicate this Thesis to the Ulkatcho First Nation, whose love of the pine mushroom is as great as mine \u2013 in the hopes that we will ensure this amazing organism is recognized and maintained in your Territory for your children to enjoy!   I am a mushroom on whom the dew of heaven drops now and then  Adapted from John Fords \u201cThe Broken Heart\u201d (1633)    ix Co-Authorship Statement  The research conducted in this Thesis was co-identified by Becky Bravi and Dr. Bill Chapman.  The research design was co-developed by Becky Bravi, Dr. Bill Chapman and Dr. Richard Hamelin.  Becky Bravi conducted the research and data analysis for this study.  This manuscript was authored by Becky Bravi with edit contributions from Dr. Bill Chapman, Dr. Richard Hamelin and Dr. Melanie Jones.  x CHAPTER 1   Introduction  The pine mushroom, Tricholoma magnivelare, is among a group of Tricholomas that are globally the most highly prized and economically significant wild edible fungi.  Interest in this group of fungi originates in Japan, where traditionally and historically T. matsutake was revered as a symbol of prosperity and fertility (Hosford et al., 1997).  Annual revenues from the trade of the sporocarps produced by these fungi exceed 50 million Yen (Yamada et al., 2007).  Due to the economic and cultural significance of these Tricholomas and in particular T. matsutake, a substantial body of literature exists about these fungi. The earliest known mention of T. matsutake dates to a Japanese poem from 759 AD but it wasn\u2019t until the 17th to 18th century that the first recorded systematic investigations were conducted by a Japanese monk who recorded the annual productivity of the mushroom in his diary (Hosford et al., 1997).  Since this time an increasing amount of research has been conducted on the ecology and biology of the fungus.  The research has mirrored the demand for the mushroom in Japan which was originally the sole domain of the Japanese nobility but that later extended to the general public (Hosford et al., 1997).  As the population exploded in Japan so did the demand for the mushroom (Pilz & Molina, 1997). In North America, though T. magnivelare had been described by Peck in the late 1800\u2019s, it wasn\u2019t until the early part of the 20th century that it was recognized as a counterpart to the revered matsutake of Japan.  Japanese immigrants along the Pacific coast of the US were reported to harvest T. magnivelare as a substitute for T. matsutake (Zeller & Togashi, 1934; Redhead, 1997).  Originally the harvest of the mushroom in North America was conducted on a small scale by Japanese Americans for personal and commercial purposes.  1 However, in the late 1980\u2019s the commercial harvest and export to Japan of the North American T. magnivelare dramatically increased due to the decline of T. matsutake habitat in Japan (Pilz & Molina, 1997). T. magnivelare and T. matsutake have been described as ectomycorrhizal fungi that at times appear parasitic (Ogawa, 1974, Wang et al., 1997).  Regardless, both species only fruit when associated with a living host.  In Japan, T. matsutake fruits in association with Pinus densiflora and P. thunbergii.  In 1905, with early imports of raw logs from North America, a pine wilt nematode, Bursaphelenchus xylophilis was introduced to Japan and resulted in the loss of large tracts of T. matsutake host pine forests there.  The third in a series of epidemics peaked in the late 1970s which resulted in a subsequent decline in T. matsutake production. In order to meet the demands for the mushroom on the Japanese market the large scale harvest and import of T. magnivelare from North America began in the late 1970s. With the rise in the economic significance of T. magnivelare, research on its biology and ecology increased in North America.  Significant work on T. magnivelare was initiated by Dr. James Trappe at Oregon State University in collaboration with Japanese researchers. Some of the focus of this research was to describe T. magnivelare habitat and to develop management recommendations for the mushroom (Hosford et al., 1997; Pilz & Molina, 1997). Simultaneous to increasing research on the mushroom in North America a culture was developing around the harvest and trade of T. magnivelare.  Mushroom buyers began to set up in areas that the fungus was found throughout much of the Pacific Northwest and as the pursuit of the mushrooms increased, more areas were discovered.  Remote camps were  2 established to house pickers and a cash industry was created around the T. magnivelare mushroom harvest.  Revenues to pickers often exceeded $1000\/day in the early years of the industry\u2019s development.  Eventually newspaper articles were running in Eastern papers likening the harvest of T. magnivelare to the Gold rush (Globe & Mail, 1996).  This created an even greater influx of transient mushroom pickers.  Welland (1997) reports up to 3000 non resident mushroom pickers flooded into commercial harvest areas across the Pacific Northwest of the United States and British Columbia.  A variety of problems both social and ecological arose as a result of this increased harvest pressure. Social problems result from the fact that the fungus does not fruit on a yearly basis and the harvest is therefore not a reliable source of annual income.  Furthermore, even though the fungus is quite ubiquitous, finding its specific habitat in the forest is not easy. These two factors have resulted in a large number of transient pickers ending up destitute in mushroom camps (Welland, 1997).  Thus, it is not surprising that there has been an increase in criminal activity associated with the mushroom harvest (Globe & Mail, 1996). Beyond the social implications of an unregulated harvest on public lands, ecological problems stemming from the increase in harvest pressure may affect the survivability and\/or distribution of T. magnivelare.  Heavy foot and all-terrain-vehicle traffic (in some areas) may have negative effects on the fungal mycelium through soil compaction and subsequently fruit body production may decline (Danell, 1996).  In addition, methods of harvest which often include removing the moss or litter layer to pick the mushrooms without replacing it have been observed to reduce sporocarp productivity (Sylvester, 1989).  Further negative effects on productivity and survivability of this fungus may result from the common practice of the preferential harvest of the sporocarps in their immature state.  Immature sporocarps do not  3 have a chance to release their spores and though the effects of spore dispersal on this species have not yet been determined it is likely that interrupting this biological process will affect the regenerative abilities of the species.  Resource conflicts pose another problem and are significant in British Columbia Canada where the T. magnivelare harvest remains unregulated and timber extraction is the predominant industry in the region. In an attempt to mitigate some of the problems associated with the T. magnivelare harvest in North America, management practices were established in a number of states in the US Pacific Northwest.  Licenses to harvest the mushrooms are required and thus provide some revenue for research and regulation.  In Canada, British Columbia established a multi- government agency committee, the \u201cPine Mushroom Task Force\u201d, to make recommendations to ensure a sustainable pine mushroom industry in the province (deGeus & Berch, 1997). Though recommendations were made, the industry remains unregulated to date in BC. Hence in an attempt to bypass the problems associated with the supply and demand of this forest fungus, researchers around the world have been trying to cultivate T. matsutake. This work has been unsuccessful and the best insurance for maintaining the pine mushroom continues to be managing for its presence across its natural range on the landscape.  To this end research in the West Chilcotin Plateau of British Columbia began in the mid 1990\u2019s. During this time period a province wide effort was underway in British Columbia to develop regionally based land use and resource management plans.  With the lack of government support for province wide management regulations to ensure T. magnivelare sustainability the land use and resource planning tables became a way that management recommendations could be formed and implemented.  It was through the sub-regional planning process in Anahim Lake that the Anahim Round Table (ART) was formed.  The  4 area covered by this planning process is the traditional territory of the Ulkatcho First Nation. When resource values were identified at the ART planning table, pine mushroom was identified as an important value to the Ulkatcho First Nation.  Being joint owners in the three way partnership of West Chilcotin Forest Products and holding the forest licenses for the company provided Ulkatcho with a unique and significant opportunity to develop management plans that would ensure that pine mushroom and commercial pine mushroom patches were maintained across the landscape.  At the time of the sitting of the ART, little research had been conducted in the area on the biology and ecology of the mushroom.  A research initiative was thus begun between the Ulkatcho First Nation and the Ministry of Forests and Range to describe the ecology of the mushroom in the area and to develop management plans to ensure its maintenance on the landscape in the face of active timber harvesting (Bravi & Chapman 2008). In the course of this significant research effort, questions requiring further exploration were identified.  One question of particular interest was discovered when host roots collected from beneath T. magnivelare sporocarps were examined during the initiative.  These observations revealed root morphologies that seemed atypical of a mycorrhizal association. Most roots were blackened, elongated and necrotic.  An examination of the literature demonstrated that only two assessments of T. magnivelare roots have been previously made. The first was by Ogawa (1979) in which he examined the symbiosis between T. magnivelare and P. contorta in Oregon.  His descriptions of the root morphologies were similar to the observations made in the West Chilcotin of British Columbia, a blackened, witches broom tangle of roots that appear necrotic.  He did not observe any Hartig net or mantle structures and concluded that T. magnivelare formed a mycorrhizal parasitic relationship with its host  5 similar to T. matsutake.  Another assessment of associated P. contorta root morphologies was later conducted by Lefevre & Muller (1998) following a systematic approach for describing ectomycorrhizae (Goodman et al., 1998).  In this analysis, root morphologies that are atypical of the mycorrhizal relationship are mentioned but simply described as senescing ectomycorrhizae.  The overall assessment by Lefevre & Muller (1998) led to the classification of T. magnivelare as an ectomycorrhizal fungus.  Though clearly limited work has been done on the root morphologies, T. magnivelare is classified as an ectomycorrhizal fungus (Lefevre & Muller, 1998).    It became clear to researchers from the West Chilcotin study that this prevalent trophic classification of T. magnivelare as an ectomycorrhizal fungus was not firmly established.  In particular, no formal assessment of the atypical, blackened, necrotic roots lacking Hartig net and mantle structures had been conducted to confirm whether T. magnivelare was present in them.  A barrier to assessing T. magnivelare presence at the root interface is that it would require a molecular approach such as a method to assess the presence of the fungus in situ, for example, by DNA analysis through PCR.  DNA analysis methods developed by using the polymerase chain reaction (PCR) allow amplification of DNA from fungal material using PCR primers (short oligonucleotides) that target specific gene regions, such as the internal transcribed spacer region of the ribosomal cluster (White et al., 1990).  However, no species-specific primers are readily available for use in a DNA detection approach and though general fungal primers for the ITS region do exist, amplification of target DNA with these non species-specific primers is not guaranteed (Renker et al., 2006). Sequencing of PCR products obtained using general fungal primers may therefore give a false negative result (Renker et al., 2006) for T. magnivelare even if it is  6 present.  In addition, assessing the classification of T. magnivelare as an ectomycorrhizal symbiont of P. contorta poses another challenge.  Ectomycorrhizal relationships are considered classic mutualisms in which both partners derive a benefit from the relationship (Harley, 1969; Harley & Smith, 1983; Brundrett et al., 1996; Trappe, 1996; Jones & Smith, 2004).  Yet, assessing mutualism in a natural setting has proven to be prohibitive with analyses showing variable results (Johnson et al. 1997).  Recently therefore, researchers have suggested that the definition of a mycorrhizae be based solely on the presence of structural features, such as a Hartig net and mantle (Jones & Smith, 2004) which is a recognition and assertion of the current classification parameters.  The use of distinct and determinate morphologies currently forms the basis of classifying the ectomycorrhizal relationship as is evident in the Atlas of Mycorrhizae (Agerer, 1987-2002) and the British Columbia Ectomycorrhizal Research Networks (BCERN), Manual of Concise Descriptions of North American Ectomycorrhizae (Goodman et al., 1998). The focus of the research conducted here was thus to: 1. determine if P. contorta root morphologies observed associated with T. magnivelare sporocarps have T. magnivelare present in them, and 2. determine if the classification of the T. magnivelare \/P. contorta symbiosis as ectomycorrhizal is useful.  The general hypothesis is that the association formed by T. magnivelare and P. contorta does not meet the definition of an ectomycorrhizal relationship.  The structural definition proposed by Jones & Smith (2004) that the classification of an ectomycorrhiza should be based strictly on the presence of key anatomical features associated with the  7 symbiosis is adopted here to assess the status of the T. magnivelare and P. contorta relationship. The specific hypotheses tested in this work are: H1: Species-specific oligonucleotide primers can be used to identify T. magnivelare presence in P. contorta host roots. H2: P. contorta short roots with atypical mycorrhiza harvested from beneath T. magnivelare sporocarps are associated with T. magnivelare. H3: The classification of the T. magnivelare\/P. contorta symbiosis as ectomycorrhizal is concordant with the definition of mycorrhizae as proposed by Jones and Smith (2004). A molecular identification method was used to attempt to detect T. magnivelare in P. contorta host roots.  This involved developing specific primers to amplify the ITS region of the fungus.  The development and testing of the primers are outlined in Chapter 2 of this thesis.  Once the primers were developed they were used to confirm the presence of T. magnivelare in putatively associated host root morphologies.  Chapter 3 describes fungal\/host root tip morphotypes collected from directly beneath T. magnivelare sporocarps associated with pure lodgepole pine, P. contorta, in the West Chilcotin of British Columbia, with confirmed T. magnivelare presence.  The features present in T. magnivelare root tip morphotypes are assessed in light of definitions of the common attributes of ectomycorrhizae.  8 References Agerer, R. (1987-2002).  Colour Atlas of Ectomycorrhizae.  Schwabisch-Gmund, Einhorn-Verlag.  Bravi, R., & Chapman, W. (2008). Managing for pine mushrooms through the mountain pine beetle epidemic in the West Chilcotin. BC Ministry of Forests and Range, Southern Interior Forest Region, Kamloops BC, Extension Note 9.  Brundrett, M., Bougher, N., Grove, T., & Malajczuk, N. (1996) Working with Mycorrhizas in Forestry and Agricultural. ACIAR Monograph 32 ACIAR, Canberra.  Danell, E. (1994). Cantharellus cibarius: Mycorrhiza formation and ecology. Comprehensive summaries of Uppsala dissertations from the Faculty of Science and Technology 35.  University of Uppsala, Uppsala. 60. Retrieved from http:\/\/www- mykopat.slu.se\/Newwebsite\/mycorrhiza\/kantarellfiler\/texter\/thes.phtml  de Geus, N., & Berch, S. (1997).  The pine mushroom industry in British Columbia.  In M.E.  Palm & I.H. Chapela, I.H.  (Eds.). Mycology in sustainable development: Expanding  concepts, vanishing borders. (pp.  55-67) Boone, North Carolina: Parkway Publishers  Inc.  Goodman, D.M., Durall, D.M., Trofymow, J.A., & Berch, S.M. (Eds.). (1997). Concise descriptions of North American ectomycorrhizae. Victoria, B.C.: Mycologue Publications and Forest Resource Development Agreement, Canadian Forest Service. Retrieved from http:\/\/www.pfc.cfs.nrcan.gc.ca\/biodiversity\/bcern\/index_e.html  Harley, J.L., (1969).  The Biology of Mycorrhiza (2nd Ed.). London, England, Plant Science Monographs:Leonard Hill London.  Harley, J.L., & Smith, S.E. (1983). Mycorrhizal Symbiosis. New York, New York: Academic Press.  Hosford, D., Pilz, D., Molina, R., & Amaranthus, M. (1997).  Ecology and management of the commercially harvested American matsutake, General Technical Report. Portland, Oregon: U.S Department of Agriculture, Forest Service, Pacific Northwest Research Station.  Johnson, N.C., Graham, J.H., & Smith F.A. (1997).  Functioning of mycorrhizal associations along the mutualism-parasitism continuum.  New Phytologist, 135(4), 575-585.  Jones, M. D., & Smith, S.E. (2004).  Exploring functional definitions of mycorrhizas: Are mycorrhizas always mutualisms? Canadian Journal of Botany, 82(8), 1089-1109. Retrieved from http:\/\/article.pubs.nrc-cnrc.gc.ca   9 Lefevre, C., & Muller, W. (1998). Tricholoma magnivelare (Peck) Redhead. CDE18. In D.M. Goodman, D.M. Durall, J.A. Trofymow, & S.M. Berch. Concise Descriptions of North American Ectomycorrhizae.  Victoria, B.C.: Mycologue Publications, and Canada-B.C. Forest Resource Development Agreement, Canadian Forest Service. Retrieved from http:\/\/www.pfc.cfs.nrcan.gc.ca  Mushroom boom sweeping northern B.C. Pickers can earn up to $400.00 a day tax- free for fungus considered delicacy in Japan (News).  Globe & Mail, Toronto Canada, October 28, 1996.  Ogawa, M. (1974) Ecology of Tricholoma matsutake (Ito et Imai) Sing., mycorrhizal fungus, in pine forest. Mushroom Science, IX(1), 733-745.  Ogawa, M. (1979).  Microbial ecology of \u2018Shiro\u2019 in Tricholoma matsutake and its allied species IX: Tricholoma ponderosum in Pseudotsuga menziesii \u2013 Tsuga heterophylla and Pinus contorta forests.  Transactions of the Mycological Society of Japan 19, 391-405.  Pilz, D., & Molina, R. (1997).  American matsutake mushroom harvesting in the United  States: Social aspects and opportunities for sustainable development.  In M.E. Palm &  I.H. Chapela, I.H.  (Eds.). Mycology in sustainable development: Expanding  concepts, vanishing borders. (pp.  68-75) Boone, North Carolina: Parkway Publishers  Inc.  Redhead, S.  (1997).  The pine mushroom industry in Canada and the United States: Why it  exists and where it is going. In M.E. Palm & I.H. Chapela, I.H.  (Eds.). Mycology in  sustainable development: Expanding concepts, vanishing borders. (pp.  15-54)  Boone, North Carolina: Parkway Publishers Inc.  Renker, C., WeiBhuhn, K., Kellner, H., & Buscot, F.  (2006).  Rationalizing molecular analysis of field-collected roots for assessing diversity of arbuscular mycorrhizal fungi: to pool, or not to pool, that is the question. Mycorrhiza, 6(8), 525- 531. Retrieved from http:\/\/www.springerlink.com  Sylvester, C. (1989).  The mushroom rakers.  Equinox, 8 (2),142.  Trappe, J.M. (1996). What is a mycorrhiza? In Proceedings of the 4th European symposium on mycorrhizae.  Granada, Spain. EC report EUR. 16728, pp 3-9.  Wang, Y., Hall, I.R., & Evans, L.A. (1997). Ectomycorrhizal fungi with edible fruiting bodies: 1. Tricholoma matsutake and related fungi.  Economic Botany, 51(3), 311-327. Retrieved from http:\/\/www.springerlink.com  Welland, F. (1997).  Mushroom Madness.  Canadian Geographic January\/February 1997, 62-68.   10 White, T.J., Bruns, T., Lee, S., & Taylor, J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In M.A. Innis, D.H. Gelfand, J.J. Sninsky & T.J. White (Eds.), PCR protocols, A guide to methods and applications. (pp. 315-322) San Diego, California: Academic Press.  Yamada, A., Kobayashi, H., & Fukuda, M. (2007). Sustainable fruit body formations of edible mycorrhizal Tricholoma species for three years in open pot cultures with pine seedling hosts. Mycoscience, 48(2), 104-108.  Retrieved from http:\/\/www.springerlink.com  Zeller S.M., & Togashi, K. (1934). The American and Japanese matsu-takes. Mycologia 26(), 544-558.  11 1CHAPTER 2   Development and testing of PCR oligonucleotides for specific detection of Tricholoma magnivelare   Introduction The genus Tricholoma is comprised of approximately 70 species and contains within it some of the most commercially important edible mushrooms in the world (Hosford et al., 1997) such as Tricholoma matsutake and T. magnivelare.  Currently, T. magnivelare is considered the most valuable non-timber forest product in North America (Wills & Lipsey, 1999).  Not surprisingly, a significant body of research exists about this species.  However, several important questions remain unsolved and are obstacles that hinder our ability to study and describe the ecology of this important economic and biological organism.  First, T. magnivelare has been described as a mycorrhizal fungus (Redhead, 1984) but like other Tricholoma species it forms an atypical mycorrhizal association with a variety of host trees (Ogawa, 1979).  To date, the nature of the relationship between the fungus and host tree remains unclear.  Second, our ability to study and monitor the distribution of the fungus across the landscape is limited.  Currently, the presence of sporocarps is used to assess distribution as well as a means of locating infected host tree roots.  The inadequacy of this approach lies in the fact that the fungus does not fruit on an annual basis and sporocarp production in this species does not occur with host trees under 70 years of age (Bravi & Chapman, 2008).  Furthermore, descriptions of root morphologies vary from parasitic mycorrhizal (Ogawa, 1979) to mycorrhizal (Lefevre & Muller, 1998) and it is not certain which morphologies are actually associated with T. magnivelare making it difficult to assess the true distribution of the species.  Some attempts have been made to use host root  1 A version of this chapter will be submitted for publication.  Bravi, R., Hamelin, R. and Chapman, B.  Specific- ITS-primers for detecting Tricholoma magnivelare in soil and host roots.  12 morphologies to assess presence of the fungus in the absence of fruit body production but as other Tricholomas with overlapping habitats as T. magnivelare form similar root morphotypes this approach seems inadequate (Bravi & Chapman, 2008).  Another, attempt was made to use the distinct smell of T. magnivelare as an indicator of presence (Lefevre, 2003) and though this may in some circumstances lead to identification of the fungus in the soil it does not enable the confirmation of the presence of the fungus in its micro-habitat, the root interface.  The insufficiency of current detection approaches has recently become amplified by the mountain pine beetle epidemic in North America which is decimating Pinus species in western North America.  In some areas where T. magnivelare interacts with this host tree its habitat has been significantly diminished and our ability to study the extent of the impact on fungal persistence, distribution and abundance is limited. Molecular methods can be useful in detecting fungi in environmental samples (Gardes & Bruns, 1993).  Currently, DNA based detection methods that employ the use of oligonucleotide primers and PCR are being used for assessing fungal populations and distribution.  With the development of fungal specific primers to amplify the highly variable Internal Transcribed Spacer (ITS) region of fungal ribosomal DNA data on microbial communities is enabled as a function of the specificity of the primers used (Martin & Rygiewicz, 2005).  To study interactions at the species level the use of species specific primers is required to ensure that false positive amplifications that might occur with no- specific primers are limited or eliminated (Martin & Rygiewicz, 2005). Specific primers have been developed to assess the presence of T. matsutake in Shiro soils and mycorrhizae in Japan (Kikuchi et al., 2000).  In this study, though primers were tested against a limited and in some case unspecified number of samples and no  13 morphological descriptions of the \u2018mycorrhiza\u2019 selected for assessment are provided their potential utility in T. matsutake research is significant.  For example, being able to detect the persistence of the fungus in the soil in areas where the pine nematode has impacted its habitat may be important for T. matsutake conservation in Japan.  In this study, the development of a similar molecular detection method for T. magnivelare is described. Materials and Methods In order to enable the monitoring and assessment of T. magnivelare presence in its inconspicuous stages (in soil and roots), two specific primer sets were developed for amplifying areas of the ITS region to use in a DNA detection assays. Sequence data from the ITS region of the ribosomal DNA was obtained from GenBank on the National Centre for Biotechnology Information (NCBI) website for T. magnivelare isolates from across North America.  BLAST, Basic Local Alignment Search tool, searches of sequence data from three British Columbia isolates Accession #\u2019s AF527371, AF527370 and AF527369 were conducted to identify other fungal species with highly homologous ITS sequences using megaBLAST default parameters.   The default parameters have an expect threshold of 10 and scoring parameters for match\/mismatch set at 1,-2.  British Columbia isolates were selected for this exercise because the goal was to use the primers to assess root samples from the West Chilcotin Plateau in the Central interior of the province of British Columbia for T. magnivelare presence.  Results were compiled into a comprehensive data file that included ITS DNA sequences from 180 individuals from across 18 genera, 6 of which were Tricholoma species.   Within the Tricholoma genus 26 isolates were North American T. magnivelare.  14 An alignment file was created using MEGA 3.1, Molecular Evolutionary Genetics Analysis Software version 3.1 by Kumar, Dudley, Nei and Tamura (1993-2005).  The file was reviewed and sorted by genera and species.  It was noted during this process that differences in the ITS sequence data existed between some Eastern North American and Mesoamerican T. magnivelare and Western North American T. magnivelare.  Therefore, for primer development specific spatial distribution and species distinction information as well as primer utility was considered and two primer sets were developed.  Primer set 1 was designed to target the current continental North American T. magnivelare grouping as proposed by Chapela & Garbelloto (2004), while primer set 2 was developed to target T. magnivelare from the Pacific Northwest of the United States and Canada.   SourceForge.net\u00ae PRIMER3 was used to select potential primers. Exclusion parameters were set according to segments identified during the alignment review process. Melting temperature parameters were set at 53-570C while PCR product length parameters were set at 100 to 500 base pairs (White et al., 1997; Gardes & Bruns, 1993).  Generated primer sequences were reviewed for conformity with input parameters and amplification objectives.  A suite of potential primers were identified and ordered for screening from Integrated DNA Technologies through the University of British Columbia, Nucleic Acid Protein Service (NAPS) unit portal in Vancouver, British Columbia.  The initial screening of the primers was conducted on herbarium samples of identified in Table 1.  Primers that demonstrated non-specific binding or failed to amplify the Pacific Northwest US and Canada T. magnivelare samples during this phase of testing were eliminated. Primers that passed phase one testing were then tested against the complete array of herbarium and field samples (Table 2.1).  Field samples of sporocarps were brought fresh to  15 the lab and refrigerated at 4oC.  DNA extractions were carried out on these samples within 36 hours of field collection.  Gill snips of sporocarps were taken from dried herbarium specimens for DNA extraction. Prior to extracting the DNA, <100ug of fungal material from each sample was ground with Kimble Kontes\u00ae RNase free blue micro pestles.  DNA extractions were then carried out on each ground sample using Qiagen\u2019s DNeasy Plant Mini Kit and protocol (Qiagen, 2004).  PCR amplifications were performed in Techne TC-3000 Thermocycler, using PuReTaq Ready-To-Go\u2122 PCR Beads from GE Healthcare according to the manufacturers protocol (Amersham Biosciences, 2004).  PCR parameters were set at an initial denaturation step at 95oC for 5 minutes, followed by 36 cycles of denaturation at 95oC for 30 seconds, annealing at 55oC for 30 seconds and extension at 72oC for 35 seconds with a final extension at 72oC for 7 minutes.  ITS1F and ITS4 described by White et al. (1997) were used as controls to ensure DNA extractions were successful.  A negative control using pure PCR grade H2O and a positive control using a UBC Herbarium T. magnivelare sample (PK3132) were included in each PCR assay.  Analyses of PCR\u2019s were performed by gel electrophoresis and ethidium bromide staining. Results  Through PCR amplification and imaging, 2 primer sets were identified that performed best in detecting T. magnivelare specifically (Table 2.2).  Primer set 1 amplified a 184bp PCR product and had 1 polymorphism (position 20 in the 5\u2019 to 3\u2019 direction) on the forward primer with T. caligatum Accession # AF527374 and 5 polymorphisms (positions 8, 9, 10, 20  16 and 23 in the 5\u2019to 3\u2019 direction) on the reverse primer with T. caligatum, Accession # AF204813.  Primer set 2 amplified a 216bp PCR product in all T. magnivelare samples from the Pacific Northwest of the United States and Canada, 5 polymorphisms (positions 8, 9, 20, 25 and 27 in the 5\u2019 to 3\u2019 direction) were identified in the forward primer and 2 polymorphisms (positions 21 and 23 in the 5\u2019 to 3\u2019 direction) were detected in the reverse primer with Eastern T. magnivelare variants Accession #\u2019s AF309516, AF309524, AF309525, AF309527, AF309530, AF309531 and AF309539.  Primer set 1 amplified all North American T. magnivelare samples from the eastern US and Mexico while primer set 2 did not amplify any of the Eastern or the Mexican T. magnivelare samples.  Primer set 1 also amplified 2 T. matsutake samples while Primer set 2 showed a faint banding in one of the T. matsutake samples.  Neither primer set amplified PCR products of other Tricholoma species or other genera during the initial primer testing phase.  During phase 2 of the analysis primers were tested against a larger sample of Tricholoma species.  Some faint banding was observed in several of the Tricholoma samples as well as the negative control of primer set 1 after an initial 8 Tricholoma samples and 10 samples of other genera were tested with no non-specific binding.  It is likely that a lab contaminant is responsible for the false positives especially in light of the fact that contamination was obvious in the negative control as well as in 2 samples that failed to amplify using the ITS primers however, primer set one should be further tested to ensure its specificity to the North American T. magnivelare clade. With the exception of three samples, Hydnellum peckii, T. bufonium and T. platyphyllum, amplification of the test organisms was successful using the general fungal primers, ITS1F and ITS4.  The last 4 PCR amplification test results were inconclusive due to  17 poor quality gel electrophoresis (Table 2.1).  Primer sets were also tested to assess their ability to detect T. magnivelare in associated host roots.  Associated host root samples amplified for T. magnivelare with both primer sets.  Detailed descriptions of the root morphologies are reported in Chapter 3 of this thesis. Discussion The goal of this research was to develop a T. magnivelare primer set that would enable the study of T. magnivelare distribution, ecology and persistence in host roots and across the landscape.  Primer set 1 was developed to enable detection of all North American T. magnivelare so that assessments of the distribution of the fungus for social and commercial purposes could be achieved.  Because T. caligatum is not distinguished from T. magnivelare during the commercial harvest the amplification or potential amplification of T. caligatum was overlooked during the development of primer set one. No non-specific amplification was observed in the first 18 samples of other Tricholomas and genera tested with primer set 1.  However, a faint banding became apparent in some of the test wells as well as in the negative controls during the final test runs.  Though it is likely that these false positive bands represent a lab contaminant it is recommended that further testing of primer set 1 be conducted to ensure its specificity and therefore utility for the social and commercial distribution assessments of this species. Primer set 2 was developed with the intent of assessing T. magnivelare presence in associated host roots from the Interior of British Columbia, Canada.  This primer was therefore developed to a higher level of specificity and will be useful in assessing the  18 distribution and biology of the Western variant not only across the landscape but within and on the host root interface.  This is important because ambiguity exists about the nature of the interaction between the host tree and the fungus (Ogawa, 1979; Lefevre & Muller 1998; Wang et al., 1997; R. Agerer, personal communication July 24, 2008).  Being able to detect fungal distribution and presence in the roots should also enable us to develop a more complete understanding of the trophic status of T. magnivelare. Ecologically T. magnivelare fruit bodies are only known to be present in association with P. contorta trees 70 years and older (Bravi & Chapman 2008), though the fungus may be present in association with roots of younger hosts.  Having tools, such as specific primers that can be used for detection of the inconspicuous vegetative phase of the fungus will allow us to better assess its true distribution and gather more information on the life history of this important species.  Furthermore, as vast areas of the T. magnivelare habitat are being lost to insect infestations across North America, understanding the nature of the interaction between the fungus and host will provide us with critical information to ensure the continued presence of this intriguing species across its natural range.  Being able to detect the fungus at a microscopic scale may provide us with better knowledge on the life history and species interactions between the fungus and host.  This is of particular importance in ensuring the maintenance of the species in the West Chilcotin of BC during the mountain pine beetle salvage harvest period. In developing the primers it became clear that the basic taxonomic classification of this species across North America needs to be assessed and clarified.  Chapela & Garbelotto (2004) proposed the division of the continental classification of T. magnivelare into the following clades: Eastern, Western and Mesoamerican.   As their research was based on a  19 limited number of T. magnivelare isolates they suggested assessing a broader sample population to make a complete and accurate determination of the taxonomy of this species. Further work at a continental level is required to sort out the taxonomic and biological variation.  At present, having the Western variant distinguishable from the other North American variants may be important as their biology and ecology could differ and thus require different management  practices. Tables Table 2.1: Suite of Test sporocarps - Tricholoma magnivelare oligonucleotide primers were tested against a suite of organisms and root morphologies to confirm their specificity and to ensure the functional objective for each primer set was met. Samples used for testing were field collected, herbarium samples or samples obtained from personal collections. * Amplification results are given in the format of -, + to +++++ with \u2013 being did not amplify, + being amplified at the lowest intensity to +++++ being amplified at the same level as the positive control.  A 0 indicates that amplification with the ITS primers failed.  Test Genera and Species Test Phase Amplification Results * Primer set 1 Amplification Results * Primer set 2 Sample Origin Collector\/ Herbarium No. Locale Suite of Tricholoma species tested T. apium Phase 1 Testing _ _ UBC Herbarium PK2524 BC T. virgatum Phase 1 Testing _ _ UBC Herbarium PK3129 BC T. focale Phase 1 Testing _ _ UBC Herbarium PK4037 BC T. saponaceum Phase 1 Testing _ _ UBC Herbarium PK3330 BC T. caligatum Phase 1 Testing _ _ UBC Herbarium PK3130 BC T. zelleri Phase 1 Testing _ _ UBC Herbarium PK3155 BC T. albobrunneum Phase 2 Testing _ _ UBC Herbarium PK3318 BC T. atroviolaceum Phase 2 Testing _ _ UBC Herbarium PK1303 BC   T. aurantium Phase 2 Testing _ _ UBC Herbarium 146 WCP BC T. bufonium Phase 2 Testing 0 + 0 - UBC Herbarium 333 ER BC T. equestre Phase 2 Testing + _ UBC Herbarium Hardy Hall 10 BC T. flavovirens Phase 2 Testing + _ UBC Herbarium PK3306 BC T. imbricatum Phase 2 Testing Inconclusive poor gel Inconclusive poor gel UBC Herbarium PK 2427 BC  20 Test Genera and Species Test Phase Amplification Results * Primer set 1 Amplification Results * Primer set 2 Sample Origin Collector\/ Herbarium No. Locale Suite of Tricholoma species tested T. inamoenum Phase 2 Testing Inconclusive poor gel Inconclusive poor gel UBC Herbarium PK3351 BC T. muricatum Phase 2 Testing _ _ UBC Herbarium Anderson (2) BC T. mutabile cf. Phase 2 Testing + _ UBC Herbarium Steven Yee (2) BC T. panoeolum Phase 2 Testing _ _ UBC Herbarium l.c. schisler (s.n.) BC T. pardinum Phase 2 Testing Inconclusive poor gel Inconclusive poor gel UBC Herbarium PK4001 BC T. pessundatum Phase 2 Testing + _ UBC Herbarium PK3331 BC T. platyphyllum Phase 2 Testing 0 + 0 - UBC Herbarium PK3359 BC T. portentosum Phase 2 Testing + _ UBC Herbarium PK3244 BC T. pullum Phase 2 Testing + _ UBC Herbarium PK 2168 BC T. sejunctum Phase 2 Testing + _ UBC Herbarium PK3887 BC T. squarrulosum Phase 2 Testing + _ UBC Herbarium PK2514 BC T. sulphureum Phase 2 Testing + _ UBC Herbarium Pk1154 BC T. terreum Phase 2 Testing Inconclusive poor gel Inconclusive poor gel UBC Herbarium m.a. Waugh 145 Washington State T. sulphurescens Phase 2 Testing + _ UBC Herbarium PK 2056 BC T. vaccinum Phase 2 Testing _ _ UBC Herbarium PK3361 BC T. subsejuncta Phase 2 Testing _ _ UBC Herbarium b14b New Brunswick T. viriditinctum Phase 2 Testing _ _ UBC Herbarium b4b New Brunswick T. cingulatum Phase 2 Testing + _ UBC Herbarium PK2486 BC T. populinum Phase 2 Testing + _ UBC Herbarium PK1752 BC  T. zelleri Phase 1 Testing _ _  Fresh sample Bravi Interior BC  T. zelleri Phase 1 Testing _ _ Fresh sample Bravi North BC  T. matsutake Phase 2 Testing + + OSU Herbarium 7189 Japan  T. matsutake Phase 2 Testing + _ OSU Herbarium 7190 Japan Suite of T. magnivelare tested T. magnivelare 1 Both Phases + + Fresh sample Bravi Interior BC, EESF T. magnivelare 2 Both Phases + + Fresh sample Bravi Interior BC, SBPSxc  21 Test Genera and Species Test Phase Amplification Results * Primer set 1 Amplification Results * Primer set 2 Sample Origin Collector\/ Herbarium No. Locale Suite of T. magnivelare tested T. magnivelare 3 Both Phases + + Fresh sample Bravi Interior BC, SBPSmc T. magnivelare red Both Phases + + Fresh sample Bravi Interior BC, MSxv T. magnivelare yellow Both Phases + + Fresh sample Bravi Interior BC, SBPSxc T. magnivelare Org. 22 Both Phases + + Fresh sample Bravi Oregon, Coast T. magnivelare Org. 29 Both Phases + + Fresh sample Bravi Oregon, Cascades T. magnivelare PK3132 Both Phases + + UBC Herbarium PK3132 BC T. magnivelare PK2851 Both Phases + + UBC Herbarium PK2851 BC T. magnivelare PK3198 Both Phases + + UBC Herbarium PK3198 BC T. magnivelare East Coast 1 Phase 2 Testing + _ Personal Collection Andrus Voitk TmL T. magnivelare East Coast 2 Phase 2 Testing + _ Personal Collection Andrus Voitk TmG1 T. magnivelare East Coast 3 Phase 2 Testing + _ Personal Collection Andrus Voitk TmG2 T. magnivelare Mexico Phase 2 Testing + _ OSU Herbarium Trappe 23178 Mexico T. magnivelare Calif. 1 Phase 2 Testing + + Fresh sample Bravi California, Northern Suite of other Genera tested Clitopilus prunulus Phase 1 Testing _ _ UBC Herbarium PK3170 Unknown Entoloma nitidium Phase 1 Testing _ _ UBC Herbarium EA1 BC Laccaria amethystine Phase 1 Testing _ _ UBC Herbarium AH01 BC L. amethysteo- occidentalis Phase 1 Testing _ _ UBC Herbarium PK3313 Unknown L. bicolor Phase 1 Testing _ _ UBC Herbarium PK3992 Unknown L. lacata Phase 1 Testing _ _ UBC Herbarium PK2428 Unknown Lepista nuda Phase 1 Testing _ _ UBC Herbarium PK2681 Unknown Ampulloclitocybe avellaneoalba Phase 1 Testing _ _ UBC Herbarium Tmori1 BC Clitocybe nuda Phase 1 Testing _ _ UBC Herbarium PK1153 Unknown Cortinarius glaucopus Phase 1 Testing _ _ UBC Herbarium PK2425 Unknown Hydnellum peckii Phase 1 Testing 0 - 0 - UBC Herbarium PK3257 BC Russula albidula Phase 2 Testing + _ UBC Herbarium Bc-737 BC  22 Test Genera and Species Test Phase Amplification Results * Primer set 1 Amplification Results * Primer set 2 Sample Origin Collector\/ Herbarium No. Locale Suite of root morphologies tested (See paper 2 for a detailed description of morphotypes) Cottony Root Phase 2 Testing + + Fresh samples Bravi BC, West Chilcotin Matchstick Root Phase 2 Testing + + Fresh samples Bravi BC, West Chilcotin Fleshy Root Phase 2 Testing + + Fresh samples Bravi BC, West Chilcotin Blackened Root Phase 2 Testing + + Fresh samples Bravi BC, West Chilcotin   Table 2.2: Primer Sequences - Tricholoma magnivelare oligonucleotide primers tested and selected for use. Primer set 1 is a universal T. magnivelare universal primer and primer set 2 amplifies T. magnivelare from the pacific northwest of North America  Primer Set Forward Primer Reverse Primer Tm of pair Product Length Set 1 \u2013 Universal NA Primer Set TmF153 5\u2019- GCCTGACGCCAATCTTTTC AC-3\u2019 TmR337 5\u2019- GGCAATTAAGCCCACCAAA TAAC-3\u2019 55oC 184bps Set 2 \u2013 Specific Pacific Northwest TmF276 5\u2019- GCCTATGTGTTTTATTATAT ACTCAGC-3\u2019 TmR521 5\u2019- GAGGGTTGAGAATTTCATG ACAC -3\u2019 54oC 216bps  23 References Amersham Biosciences (2004).  Instructions: puReTaq ready-to-go PCR beads. Amersham Biosciences. 27-9557-01PL Rev C 2004. 20p.  Bravi, R., & Chapman, W. (2008). Managing for pine mushrooms through the mountain pine beetle epidemic in the West Chilcotin. BC Ministry of Forests and Range, Southern Interior Forest Region, Kamloops BC, Extension Note 9.  Chapela, I. H., & Garbelotto, M. (2004). Phylogeography and evolution of in matsutake and close allies inferred by analysis of ITS sequences and AFLPs. Mycologia 96(4), 730-741.  Gardes, M., & Bruns, T. D. (1993). ITS primers with enhanced specificity for basidiomycetes- application to the identification of mycorrhizae and rusts. Molecular Ecology 2(2), 113-118. Retrieved from http:\/\/www.wiley.com  Hosford, D., Pilz, D., Molina, R., & Amaranthus, M. (1997). Ecology and management of the commercially harvested American matsutake.  General Technical Report. Portland, Oregon: U.S Department of Agriculture, Forest Service, Pacific Northwest Research Station.  Kikuchi, K., Matsushita, N., Guerin-Laguette, A., Ohita, A., & Suzuki, K.  (2000).  Detection  of Tricholoma matsutake by specific ITS primers.  Mycological Resources, 104(12),  1427-1430. Retrieved form http:\/\/www.sciencedirect.com  Leferve, C., & Muller, W. (1998). Tricholoma magnivelare (Peck) Redhead. CDE18. In D.M. Goodman, D.M. Durall, J.A. Trofymow, & S.M. Berch. Concise Descriptions of North American Ectomycorrhizae.  Victoria, B.C.: Mycologue Publications, and Canada-B.C. Forest Resource Development Agreement, Canadian Forest Service. Retrieved from http:\/\/www.pfc.cfs.nrcan.gc.ca  Lefevre, C.K., McDaniel, M., Luoma, D.L., & Molina, R. (2003).  Sniffing for Matsutake at landscape scales. Unpublished Thesis Abstract, Oregon State University, Oregon.  Martin, K. J., & Rygiewicz, P.T. (2005).  Fungal-specific PCR primers developed for analysis of the ITS region of environmental DNA extracts.  BMC Microbiology 5, 28. Retrieved from http:\/\/www.biomedcentral.com\/1471-2180\/5\/28  Ogawa, M. (1979). Microbial ecology of \u2018Shiro\u2019 in Tricholoma matsutake and its allied species IX: Tricholoma ponderosum in Pseudotsuga menziesii \u2013 Tsuga heterophylla and Pinus contorta forests.  Transactions of the Mycological Society of Japan 19, 391-405.  Qiagen. (2004). DNEasy plant mini and DNeasy plant maxi handbook: For  24 isolation of DNA from plant tissue.  Qiagen Incorporated (2000).  Redhead, S.A. (1984). Mycological observations 13-14: on Hypsizygus and Tricholoma.  Transactions of the Mycological Society of Japan 25, 1-9. Wills, R. M., & Lipsey, R. G. (1999).  An economic strategy to develop non- timber froest products and services in British Columbia. Final Report. Forest Renewal British Columbia. Retrieved from http:\/\/www.sfp.forprod.vt.edu\/pubs\/ ntfp_bc.pdf  White, T.J., Bruns, T., Lee, S., & Taylor, J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In M.A. Innis, D.H. Gelfand, J.J. Sninsky & T.J. White (Eds.), PCR protocols, A guide to methods and applications. (pp. 315-322) San Diego, California: Academic Press.  25 2CHAPTER 3  Root assessment  Introduction Tricholoma magnivelare is a biologically intriguing species.  It has been described as mycorrhizal (Lefevre & Muller, 1998) based on the presence of mantle and Hartig net but like other Tricholoma species, it has been observed to form atypical mycorrhizal associations with its hosts, which include blackened necrotic roots and the absence of mantle and Hartig net (Ogawa, 1979).  The exact nature of the relationship between host and fungus remains unclear but certain features of the infected root system strongly suggest that the relationship may be more complex and the fungus may at times be parasitic rather than mutualistic (Wang et al., 1997). Whatever its ecological relationships, the pine mushroom is commercially significant. Since the beginnings of its export from British Columbia to Japan in the 1980\u2019s, it has become the most valuable non-timber forest product in British Columbia (Wills & Lipsey, 1999) and globally it is a member of a group of Tricholomas that are the most economically valuable fungi in the world.  In Japan annual gross revenues from this group exceed 30 million yen (Yamada et al., 2007). Though little work on host root associations formed by T. magnivelare have been conducted there is a growing body of literature on host root associations formed by T. matsutake. This is not surprising as the demand for the fruit bodies from this species is highest.  Masui (1927) was the first to suggest a classification for the T. matsutake host root  2 A version of this chapter will be submitted for publication.  Bravi, R., Chapman, B. and Hamelin, R. A morphological and molecular assessment of the Tricholoma magnivelare and Pinus contorta symbiosis from the West Chilcotin Plateau of British Columbia, Canada.  26 association.  He described the relationship formed between fungus and host as a parasitic mycorrhizal one (Wang et al., 1997) based on the presence of black necrotic roots.  Later work by Ogawa (1974) and Wang et al. (1997) also describe the host\/fungal relationship as a parasitic mycorrhizal interaction due to the presence of blackened necrotic roots. As microscopic and molecular techniques have become commonly accessible research efforts have focused on confirming T. matsutake as an ectomycorrhizal fungus.  A number of inoculation studies have been conducted on T. matsutake with P. densiflora (Yamada et al., 1999; Lu-Min et al., 2000; Guerin-Laguette et al., 2000; Yamada et al., 2006) The inoculated roots eventually developed Hartig net structures leading researchers to conclude that the fungal host association for T. matsutake was mycorrhizal.  Gill et al. (2000) looked at the range of host root associations formed by T. matsutake in environmentally collected samples. They observed several morphotypes atypical of the ectomycorrhizal relationship and suggested more research into the unusual nature of these morphotypes was needed. In comparison, very little work on describing the fungal host root association formed by T. magnivelare has been done.  Because of this the variation between observations is significant.  Ogawa (1979) describes Pinus contorta associated roots formed by T. magnivelare collected in Oregon as black necrotic tangled masses that resemble witches brooms with an absence of Hartig net and mantles.  A few years later Lefevre & Muller (1998) published a concise description of T. magnivelare as an ectomycorrhizal fungus in the British Columbia Ectomycorrhizal Research Networks (BCERN), Manual of Concise Descriptions of North American Ectomycorrhizae (see Goodman et al., 1997).  Though the authors mention the atypical host roots previously observed by Ogawa (1979) no concise  27 descriptions are offered of these atypical morphotypes and they are simply referred to as mycorrhizae in a state of senescence.  The lack of consensus about the descriptive characterization of the T. magnivelare host root associations poses significant questions about the general biology and trophic classification of the species. The lack of understanding about this organism raises questions about our ability to make management recommendations for its maintenance across its natural range and is the main barrier to cultivation efforts. One of the problems facing the characterization of the relationship between T. magnivelare and its host trees is the failure to universally adopt definitions.  The term mycorrhiza was first used in 1885 by A.B. Frank to describe the fungus-root organs found to be present in most plants growing in their natural environment (Harley, 1969).  A sheath of fungal tissue covering the short roots of plant root systems characterized these organs. Hence, the term mycorrhiza continues to be used to describe a range of structures formed by the association of fungal hyphae and the roots or root systems of plants (Peterson et al. 2004). Morphological features consistent with ectomycorrhizal fungi generally include the presence of a mantle and a Hartig net (Wiensczyk et al., 2002) in association with the healthy roots of plants (Trappe, 1996).  Furthermore, mycorrhizae are commonly accepted as mutualistic associations between plant roots and fungi (Harley, 1969; Harley & Smith, 1983; Brundrett et al., 1996; Trappe, 1996; Jones & Smith, 2004).  This functional definition is attributed to a benefit to the plant from increased nutrient and water absorption provided by the fungus and a gain of carbon by the fungus from the plant (Harley, 1969; Harley & Smith, 1983; Trappe, 1996). Interestingly, the root fungal interaction T. magnivelare forms with its plant hosts has been characterized as both mutualistic and parasitic (Ogawa, 1979).  Mycorrhizal, according  28 to the definition in the paragraph above refers to a mutualism with parasitism being on the other end of the relational continuum.  Though no clear cut off point exists along this continuum in the strict sense mutualism is a relationship in which both partners derive a benefit while parasitism is a relationship where one partner derives a benefit at a cost to the other (Raven & Johnson, 1989). Problems arise when assessing whether a relationship is mutualistic or parasitic due to the difficulty of conducting cost benefit analyses under realistic conditions.  Jones & Smith (2004) outline some of the challenges associated with evaluating the increase in fitness of the mutualistic mycorrhizal partners.  These same challenges, particularly being unable to produce controls to adequately study symbiosis under normal environmental conditions, apply to assessments of parasitic relationships.  Therefore, researchers have recently suggested that the definition of mycorrhizae be based solely on the presence of structural features, such as a Hartig net and mantle (Jones & Smith, 2004).  The definition makes sense as it supports the characterization commonly used in ectomycorrhizal research (see Agerer 1987-2002; Goodman et al., 1998). Because mycorrhizae are by nature symbiotic relationships between host plant roots and fungi, common methods for studying and classifying ectomycorrhizae employ the use of host root tips.  The anatomical characteristics of colonized root tips, often unique to a fungal species, have been used not only to describe or define the relationships formed between fungi and their associated plant hosts but also to identify fungi to species and describe a variety of other ecological data such as abundance and community structure (Anderson, 2006).  In fact, detailed descriptions of the morphological and anatomical characteristics of host roots form  29 the basis for the most comprehensive guide for identifying mycorrhizae \u2013 The Atlas of Mycorrhizae (Agerer, 1987-2002). Recently, the use of morphotyping alone to identify fungal species has been criticized for a number of reasons.  First, molecular data reveal that genetically distinct species may look very similar; by contrast, large morphological differences sometimes exist between very closely-related populations (Horton & Bruns, 2001; Anderson, 2006).  Second, because of the skill and time required to distinguish precisely enough between fungi the approach has been criticised as cumbersome (Horton & Bruns, 2001).  Using a combination of morphological and molecular methods to assess mycorrhizae is now standard practice (Horton & Bruns, 2001).  Morphotyping is particularly useful as the characterization of structural features enables insights into their function in terms of water and nutrient uptake (Agerer, 2001) and possibly others.  Molecular approaches on the other hand allow for more definitive identification of fungal species present at the root interface (Martin & Rygiewicz, 2005).  Combined they provide a powerful tool for assessing mycorrhizae. Recently, there have been a great number of ecological studies that have used morphotyping of root tip types as a precursor to molecular work.  These studies focus on the identification of fungi on specific host roots.  Wurzburger et al. (2001) characterized the ectomycorrhizae of mixed conifer stands using a combination of morphological and molecular methods while Twieg et al. (2007) used a combined approach to study fungal succession.  Other studies have focused on the use of molecular methods to confirm the presence of a specific fungal species while morphological characteristics of the fungus or fungal host interaction were described in order to study species specific habits or characters. Iotti et al. (2002) used molecular and morphological methods to identify Tuber species and to  30 characterize the macroscopic and microscopic characteristics of their mycelial growth. Similarly, and as previously mentioned, work on matsutake has been conducted by Gill et al. (2001) to morphologically characterize T. matsutake host associated roots.     In this study the range of associated root morphologies formed by T. magnivelare and P. contorta in the West Chilcotin of British Columbia was characterized in order to assess the ectomycorrhizal classification of this symbiosis.  The definition of mycorrhiza proposed by Jones & Smith (2004) which is solely based on structures (the presence of Hartig net, mantle and extramatrical mycelium) and eliminates any need to prove mutualism was adopted for this work.  A combined morphological and molecular approach was used to conduct this assessment.  First, P. contorta root morphotypes associated with T. magnivelare were described.  A DNA amplification approach using PCR primers specifically targeting T. magnivelare was then employed to confirm the presence of T. magnivelare in described root morphotypes. Materials and Methods Sample collection, storage and observation Sampling for this research was conducted in the following way.  P. contorta root masses associated with T. magnivelare sporocarps were field collected across the range of habitats in which the mushroom occurs in the West Chilcotin.  Field collected root samples were used to assess and describe gross root morphologies associated with the T. magnivelare\/P. contorta symbiosis and to identify the range of morphotypes present.  Four distinct morphotypes; matchstick tip, blackened tip, fleshy tip and cottony tip, were evident in the associated root masses.  Root tips of each of these morphotypes were then collected  31 from the field samples and subjected to DNA analysis.  Table 3.1 provides an overview of the sample sites, collection dates and number of samples obtained. Field Sampling  P. contorta roots associated with T. magnivelare sporocarps were field collected from established, pure lodgepole pine research sites in four separate biogeoclimactic (BEC) zones: Engelmann Spruce Subalpine Fir (ESSF); Montane Spruce (MS); Sub-boreal Pine Spruce (SBPS) and Interior Douglas Fir (IDF) in the West Chilcotin of British Columbia. Sample collection sites were identified from research transect plots established during a pine mushroom ecology study conducted in the area in the late 1990\u2019s (Bravi & Chapman 2008). Transect plots in each of the BEC zones were visited in the fall of 2007 and 2008 to locate T. magnivelare sporocarps.  Transects were selected for sampling based on an unbiased systematic approach.  The sites were ranked based on their distance from a central point and those closest to the central point were visited first.  If no sporocarp was identified at the first sample location then the next research transect plot in order in the same biogeoclimactic zone was visited until a T. magnivelare sporocarp was located.  When a sporocarp was identified then a 20cm wide x 20cm long x 15cm deep shovel core was collected beneath the mushroom.  In 2008, no sporocarps were identified at any of the research transects in the MS zone and therefore samples from this area were only collected in 2007. Upon collection all associated root cores were placed in labeled Hubco Sentry soil bags (IRL suppliers, Prince George, BC) and placed in a cooler for transportation to the lab.  32 Laboratory analyses of the root masses were conducted within 24 hours of sample collection. Prior to analysis, roots were gently washed with sterile, de-ionized H20. Morphotype Sampling for DNA Analysis Morphotype samples were collected from gross root masses with the aide of a 10x stereomicroscope.  At least two samples of each morphotype were selected from root masses collected at each BEC zone in 2007.  Three samples of each identified morphotype were taken from the root masses collected in the SBPS and the IDF.  This was done to ensure that a sample size of ten was achieved for each morphotype.   Morphotype selection from within the gross root masses was conducted based on a single criterion.  The same morphotype within a single root mass was not collected from one long root system.  This was done to ensure sample diversity.  Long root selection was conducted at random from within the root masses. Once collected morphotype samples were placed in sterile centrifuge tubes, labeled and frozen at -20oC until DNA extractions were conducted. Morphotype Sampling for Microscopic Observation  Morphotype samples were collected from gross root masses with the aide of a 10x stereomicroscope in 2007 and 2008.  Morphotype selection was conducted at random from gross root masses collected across the range of ecosystems. Morphotype descriptions In order to describe morphotypes and discuss the characteristics of the general root morphologies observed in the relationship between T. magnivelare and P. contorta the root  33 system terminology used and described by Brundett et al. (1996) was adopted.  In short, the morphological descriptions that follow are primarily of short and long roots, the roots that are generally involved in mycorrhiza formation.  However, as secondary roots or woody roots were at times observed to be putatively associated with T. magnivelare, some brief mention of these roots is also made. Gross morphological observations were conducted using a 10x stereomicroscope in September 2007.  Descriptions of gross pine root systems associated with T. magnivelare were made as per Agerer (1987-2002).  Briefly root masses, whole root systems and individual roots were observed for condition, form and dimensions, as well as other distinguishing features. Four root morphotypes consistently noted within all examined fungus associated root systems were described in more detail.  Distinguishing features, shape, dimension, colour, texture and reaction to certain chemicals, as well as descriptions of mantle-like features and mycelia when present were described using descriptors and methods as per BCERN\u2019s Manual of Concise Descriptions of North American Ectomycorrhizae (Goodman et al., 1998). Quantitative Analysis A relative abundance assessment of the morphotypes selected for detailed descriptions was conducted by selecting roots at random from field samples and counting the number of each morphotype present in the first 100 tips viewed along the selected root system.  Four, 100 tip counts were conducted from samples collected in each of the four BEC zones across the study area in September 2007.  34 Genetic analysis Molecular analysis was conducted to confirm T. magnivelare was associated with described root morphotypes.   A set of specific primers (Primer set 2) developed to target the internal transcribed spacer (ITS) region of T. magnivelare from the Pacific Northwest of the US and Canada (see Chapter 2 in this Thesis) were used to assess ten samples of each morphotype collected.  Samples were selected from the gross root masses as per the methods described above. DNA was extracted from frozen root tip samples using Qiagen\u2019s DNeasy mini plant extraction kit and protocol (Qiagen, 2004).  Extractions were amplified using PuReTaq Ready-To-Go\u2122 PCR Beads from GE Healthcare as per the manufacturer\u2019s methods (Amersham Biosciences, 2004).  PCRs were carried out in a 25ul volume containing 1ul of genomic DNA, 1.25ul of each TmF1 and TmR1 primers were used to a total concentration of 10 picamoles of each primer per PCR reaction with a final addition of 21.5ul of PCR grade H2O.  Reactions were performed in a Techne TC-3000 Thermocycler with  PCR parameters set at; an initial denaturation step of 95oC for 5 minutes, followed by 36 cycles of denaturation at 95oC for 30 seconds, annealing at 55oC for 30 seconds and extension at 72oC for 35 seconds with a final extension at 72oC for 7 minutes.  PCR products were analysed by gel electrophoresis and Sybr\u00ae safe (Invitrogen, catalogue #S33102) staining on a 100 ml, 3% (1% SeaKem, 2% Nusieve) gel.  T. magnivelare sporocarps, in which amplification with the primers was confirmed were used as positive and H2O was used as the negative control for this analysis.  35 Microscopic Analysis Microscopic assessments of the morphotypes were conducted to assess them for the presence of ectomycorrhizal features, Hartig net and mantle.  For this analysis a Zeiss Axioscop microscope was used.  Observations were made at 100x to 400x magnification. Morphotype samples were embedded in paraffin wax and hand sectioned with a razor blade. Sections were stained with FD&C methylene blue dye #1, BP100-25, Fisher Scientific (which stains fungal material and plant cell nuclei) and heat fixed on glass microscope slides. Quantitative analysis of microscopic features was not done in this study however, an analysis conducted by Bravi (2008) is reported in the results section and Appendix 1 of this paper. Results Morphological Descriptions  General Gross Morphology: The whole associated root systems, which include both short, long and secondary roots, observed, overwhelmingly exhibited an elongated, tangled, necrotic appearance (Figure 3.1) in which cortical cells of fine roots were most often blackened cracked and sloughing (Figure 3.2) and the bark of secondary woody roots were observed splitting and peeling (Figure 3.3).  Four morphotypes were observed in associated fine roots; matchstick roots (Figure 3.4), blackened roots (Figure 3.5 and 3.6), fleshy roots (Figure 3.7) and cottony roots (Figure 3.8).  A detailed discussion of the specific features observed in each of these distinct habits is included in the next section on morphotypes but a brief description follows here.  The matchstick tip had a live apex in front of a region where the cortex was living.  Behind the live cortical zone there is an area where the cortex is blackened (Figure 3.4) and where, at times, cracking and sloughing was observed.  The  36 blackened root morphotype had a black and at times cracking and sloughing cortex with a live apex (Figure 3.5).  Black tips were also observed with what appeared to be a broken or absent apex, sometimes with a fleshy new apical extension emerging from the broken tip (Figure 3.6).  These broken blackened tips were excluded from the analysis as it was too difficult to determine if the breaking occurred during sample collection and preparation (the blackened morphotype is particularly fragile) or if these tips represent a unique form of this root type.  The fleshy tips had no areas where blackening or cracking of the cortex was observed which gave them the appearance of being new or young fine roots that were live and fully functioning (Figure 3.7).  Discrete occurrences of cottony fungal aggregations formed loose affiliations with the variety of root morphotypes observed in the associated roots, matchstick, blackened and fleshy (Figure 3.8-3.10).  In some cases these loose affiliations appeared as if they were the start of areas of extramatrical hyphae (Figure 3.11) or mantle-like structures (Figure 3.12) while at other times it was unclear if these cottony aggregates were detached or pulled away from mycelial masses occurring in the soil during sample collection and preparation.  For the purposes of this work the cottony tip was defined and described solely by the presence of cottony mycelium associated with these fine roots.  A cottony association similar to that observed in Figures 3.8-3.12, 3.16, 3.18, 3.27, 3.30 and 3.33 was confirmed via molecular analysis to be T. magnivelare. The matchstick tip and the blackened tip were observed most frequently throughout the associated roots.  The fleshy tip and cottony association were observed least frequently. In addition, there were not clear cutoffs between different tip types and the morphologies within a tip type can vary considerably, for example tips were not consistently straight, tortuous, or bent in appearance (Figure 3.13-3.15).  37 At up to 10x magnification using the stereoscope, no true mantle structures were apparent though at times mantle-like features appeared as thin, single layered, unorganized and discontinuous patches of fungal hyphae on the roots (Figure 3.16).  What appeared to be fungal aggregations were present along some roots (Figure 3.17). However, as these assumed fungal aggregates failed to fluoresce under UV light, their true nature remains unclear.  They may instead be fungal exudates. Loose masses of white cottony fungal aggregates similar to the cottony associations in texture and lustre were observed in the soil (Figure 3.18) and encompassing roots.  The texture of the aggregations was felty, stringy and\/or cottony.  Structurally the masses were loosely aggregated, unorganized hyphae, with abundant interhyphal spaces.  The cells were distinctly elongated and according to the BCERN descriptors would be classified as felt prosenchyma.  Primordia were also observed to originate in these clusters of cottony mycelial masses (Figure 3.18).  Mycelial-strand-like features (Figure 3.18) were at times present in association with the pseudo-mantles but they lacked the distinct structural organization associated with this feature. The overall host root systems affected by the fungal interaction included both fine roots and secondary roots.  Systems were observed to be >15mm long if areas of fungal infection in the cortex as well as the extended areas of cortical and epidermal degradation occurring in the fine and woody roots respectively were included.  Short roots exhibited indeterminate growth (Figure 3.19) and short root lengths were commonly greater than 15mm long.  Individual short roots were at times much longer than the central axis of the system.  In general monopodial pinnate branching was observed with the systems but short root branching varied between dichotomous and monopodial pinnate (Figure 3.20 and 3.21).  38 Short root shape varied between bent, tortuous, matchstick shaped and straight.  Short root distal ends ranged from 0.1 \u20130.3 mm and tip base widths vary from 0.01-0.3 mm depending on whether cortical cell sloughing had occurred at the region (Figure 3.15).  Short root lengths varied depending on the tip shape.  Short root lengths ranged from 0.2 \u2013 >15mm. Widths of main axes on the short roots were 0.01 - 0.5 mm and widths of main axes at the short root-long root junction were 0.2 - 0.8 mm. Again, widths of main axes were affected by cortical cell sloughing (Figure 3.15). Apices appeared translucent with various colour tinges that ranged from white (Figure 3.22) to dark orange-brown (Figure 3.23).  However, there were occurrences where the tip was the same colour as the rest of the short root.  Short root colour varied depending on the morphotype and colour variations occurring within each morphotype.  Descriptions of the variations in morphotype colour are included in the morphotype section below. Knuckling or discrete swellings (Figure 3.24) were observed on both short and long roots.  Cortical cell necrosis and sloughing was observed on the short or fine roots throughout the associated roots (Figure 3.2).  Woody or secondary roots exhibited a cracking and peeling of their bark (Figure 3.25).  At times a cellular pattern that looked like the arrangement of epidermal cells was observed on the shed bark of these roots (Figure 3.25). Detailed Morphotype Descriptions Matchstick Root (Figure 3.4, 3.26 and 3.27)  Distinguishing Features: the most abundant morphotype found associated with P. contorta roots infected by T. magnivelare have a characteristic matchstick appearance with  39 cortical cells blacking and at times cracking or sloughing behind an area of varying length of living cortex and apex; the inner stele of the blackened areas is still living which is evidenced by the extension of a live fleshy apical tip; apical ends are translucent and tinged white to light orange; live cortical cells are opaque and shiny while the blackened cortical zone proximal to the live cortex appears shriveled and pocked prior to cracking and sloughing.  Shape and Dimensions: straight, tortuous or bent shaped (Figure 3.13-3.15), length of tips range from 1-12mm, widths range from 0.2-0.5mm, width at tip base is at times affected by cortical cell sloughing (Figure 3.13) and ranges from 0.1-0.5mm, width of the main axis is 0.2-0.8mm.  Colour and Texture: apices are translucent and range in hue from white to yellow- orange; coloration of the proximal live cortex ranges from light yellowish orange to light brownish orange while the more proximal cortex is dark brownish orange to black with a transition between these colours often noted; apices are smooth while the area of intact cortex ranges in texture from smooth to slightly pocked with at times a striated appearance; where the cortex is necrotic, the roots appear shriveled and pocked though the texture within the pocking is best described as smooth; after the cortex is sloughed the surface is slightly roughed with the appearance of a thin periderm.  Chemical reactions: no reaction to KOH or Melzers Reagent  Morphology of mycelial strands: not present  40  Anatomy of Mantle: though at times (<1 in 50) a cottony association is observed encompassing this tip type, for classification purposes the cottony association is kept as a separate morphotype because the cottony mycelium defines the cottony type.  Blackened Tip (Figure 3.5 and 3.28)  Distinguishing Features: a cortex that is entirely necrotic characterizes the blackened morphotype, no zone where the cortex appears live as with the matchstick type is present; apices are translucent white to dark orangey brown; at times portions of the cortex is cracked and sloughed though the inner stele of the root appears live as evidenced by an extending apex; rarely a broken blackened short root is observed with a <1mm translucent light white fleshy apex extending from the broken shriveled blackened cortex (Figure 3.7); these tips were excluded from the analysis as it was too difficult to determine if the ends had been broken and damaged during sample collection and preparation.  Shape and Dimensions: straight, tortuous and bent (Figure 3.13-3.15), length of tips range from 1-12mm, widths range from 0.2-0.5mm, width at tip base is at times affected by cortical cell sloughing and ranges from 0.1-0.5mm, width of the main axis is 0.2-0.8mm.  Colour and Texture: black with a pocked, dimpled or shriveled (Figure 3.28) appearance though the surface within the pocking and dimpling is best described as smooth.  Chemical reactions: no reaction to KOH or Melzers Reagent  Morphology of mycelial strands: not present  41  Anatomy of Mantle: though at times <1 in 200 a cottony association is observed encompassing this tip type, for classification purposes the cottony association is kept as a separate morphotype because the cottony mycelium defines the cottony type.  Fleshy Tip (Figure 3.7 and 3.29)  Distinguishing Features: entire root has an intact light yellow to light orange cortex in colour (which give it a fleshy appearance) with white translucent apices (Figure 3.7 and 3.29), no blackening of the cortex is observed in this morphotype though at times it appears as if cortical cell necrosis is beginning (Figure 3.7 and 3.29); colour varies among the roots classified as fleshy as well as along individual fleshy roots (Figure 3.29).  Shape and Dimensions: primarily straight but, bent and tortuous (Figure 3.13-3.15) tips are observed, length of tips range from 1-12mm, widths range from 0.2-0.5mm, width at tip base ranges from 0.3-0.5mm, width of the main axis is 0.3-0.8mm.  Colour and Texture: ranges from light yellowish white to light yellow to light orange, apices are light white and translucent; short roots are shiny and smooth or at times grainy in appearance; striations are sometimes observed on the roots.  Chemical reactions: no reaction to KOH or Melzers Reagent  Morphology of mycelial strands: not present  Anatomy of Mantle: though at times a cottony association is observed encompassing this tip type, for classification purposes the cottony association is kept as a separate morphotype because the cottony mycelium defines the cottony type.  42 Cottony Tip (Figure 3.5 and 3.30)  Distinguishing Features: the underlying roots associated with the cottony morphology can be matchstick, fleshy and rarely blackened; the coloration, shape, dimensions and texture therefore follow that of the underlying root; colour and textural descriptions provided here therefore refer to the cottony hyphal association that encompasses the roots and that at times appears as a mantle-like feature.  Colour and Texture: white to light yellowish white with a cottony texture.  Luster: cottony hyphal aggregations are matte.  Chemical reactions: no reaction to KOH or Melzers reagent.  Morphology of mycelial strands: when present restricted point strands that are very short <3mm.  Anatomy of Mantle: a loose cottony association that is at times observed as a mass of extraradical hyphae encompassing multiple root tips and at other times is observed as a loose, patchy and discontinuous mantle-like association on a single tip; the texture is felty, stringy and\/or cottony; structurally, the cottony tissue is loosely aggregated, unorganized hyphae with abundant interhyphal spaces, cells are distinctly elongated and according to the BCERN\u2019s Manual of Concise Descriptions of North American Ectomycorrhizae descriptors (Goodman et al., 1998) would be classified as felt prosenchyma; the same structural features are present in the mycelial masses observed in the soil (Figure 3.18) and encompassing roots (Figure 3.11).  43  Anatomy of Mycelial Strands in Plan View: inconclusive if present. Some strand- like structures (Figure 3.8) observed \u2013 short and wefty in structure, not coalescing into any distinct structure with differentiated tissue. Quantitative Analysis Table 3.2 presents the number of each morphotype present in a sample of 100 root tips.  Matchstick and blackened roots were consistently the most common root morphotypes observed. Genetic analysis of morphotypes Analyses of root tip morphotypes using the species-specific oligonucleotide primers described in Chapter 2 of this Thesis confirmed T. magnivelare presence in all root morphologies.  Results are outlined in Figure 3.31 and Table 3.3.  The gel electrophoresis results for the blackened short root morphotype (Figure 3.6 and 3.28) resulted in the lowest band intensities.  The cottony root morphotypes (Figure 3.5 and 3.30), having large quantities of fungal hyphae associated with them had band intensities similar to the positive controls. Microscopy of morphotypes Microscopic observations of root tips were conducted from 2007 to 2008.  All samples were hand sectioned and analysed for the presence of Hartig net and mantle structures.  Results of all theses observations revealed the inconsistent presence of both features in each of the root tip sections.  Bravi (2008) conducted microscopic assessments of the morphotypes described here.  The data from this work were used to quantify the presence of Hartig net and mantles for three of the tip morphologies identified (matchstick, fleshy and  44 cottony).  The blackened tip was not included in the analysis because of the inability to successfully section the tip for microscopic assessment.  A table detailing the results of this work is included in Appendix 1.  Table 3.4 provides a summary of the results obtained on the presence and abundance of mycorrhizal features. Of the 10 matchstick tips microscopically assessed, none had mantles (Figure 3.32) even though a mantle-like feature (Figure 3.33 & 3.34) was at times observed with this morphotype during general and non-quantitative microscopic analysis.  Seven of the matchstick roots had traces of a Hartig net present in the outer cortical cells (Figure 3.35 and 3.36), 2 had well-developed Hartig nets present in the inner and outer cortex (Figure 3.37) and 1 had no Hartig net (Figure 3.38).  Fungal hyphae was observed penetrating the cortical cells (Figure 3.39) in three of the samples.  Cortical cell collapse is apparent on all of these tips at the transition between the area of live fleshy and blackened cortex (Figure 3.40 and 3.41).  Thin mantles (Figure 3.34) were observed in 3 of the fleshy tips.  Well-established Hartig nets i.e., cell walls fully encased with fungal mycelium were noted in 7 of the fleshy tip samples.  Both inner and outer cortical cells in the 7 samples with well-developed Hartig nets had the typical cell wall thickening (Figure 3.35 and 3.36) associated with this mycorrhizal structure.  The other 3 samples had the presence of weakly developed Hartig net i.e., incomplete encasement of the cell wall with fungal mycelium.  No cell wall thickening (Figure 3.37) was evident in these samples.  In addition, two of the fleshy tip samples had fungal hyphae penetrating into the cells (Figure 3.39) and the beginning of cortical cell collapse was observed.  One of the cottony morphotype samples had what looked like the beginning of a thin mantle (Figure 3.34) developing beneath the cottony association (Figure 3.33).  Weak Hartig nets were observed in the outer cortical cell layer of 3 of the cottony tips  45 (Figure 3.37), 2 of the tips had no Hartig nets (Figure 3.38) present and 4 tips had well developed Hartig nets (Figure 3.35 and 3.36).  The beginning of cortical cell collapse (Figure 3.40 and 3.41) was witnessed in 5 of the 10 samples, with complete collapse of cortical cells noted in 1 of these samples.  No cortical cell deterioration was observed in the remaining cottony tip samples.  Discussion The central question of this research is whether T. magnivelare\u2019s classification as an ectomycorrhizal fungus is useful.  An assessment of the classification of the fungus as mycorrhizal was conducted based solely on a morphological definition of the ectomycorrhizal relationship as suggested by Jones & Smith (2004).  The anatomical features that define an ectomycorrhizae include the presence of a Hartig net, mantle and extramatrical hyphae (Peterson et al., 2004). Hartig net The Hartig net, a defining anatomical feature of an ectomycorrhiza, is a hyphal structure that surrounds the cortical and\/or epidermal cells, in conifer host roots (Pedersen et al., 2004).  The structure was first described by Robert Hartig and has been identified as the primary site of nutrient exchange between the plant and fungal symbionts.  Nutrient transfer is assumed to be reciprocal whereby the fungus acquires carbon from the plant and the plant acquires nutrients such as phosphorus and nitrogen from the fungus (Harley, 1969; Harley & Smith, 1983; Brundrett et al., 1996; Trappe, 1996; Pedersen et al., 2004; Jones & Smith, 2004).  46 Hartig net was not always present in the roots sectioned and was not consistently present or absent in affiliation with mantles.  At times the Hartig net was observed at the interface of live and necrotic tissue (Figure 3.37) or in areas where cortical cell collapse was apparent.  Though, a quantitative analysis was not conducted during microscopic assessments performed in this work, Bravi (2008) demonstrated Hartig net was present in 26 of the 29 roots sectioned for examination, 8\/10 of the matchstick tips, 10\/10 of the fleshy tips and 8\/9 of the fluffy tips had Hartig net features present to varying degrees (Table 3.4 and Appendix 1).  Though sectioning of the blackened tips was not possible it is assumed that no Hartig net is present in this morphotype as the cortical tissue is dead, collapsed and sloughing. A number of logical arguments could be made to explain why this structure is not always present in associated host roots.  For example, it could be argued that the Hartig net was not associated with T. magnivelare, but was formed by another unidentified fungus or fungi.  As in vitro studies have demonstrated T. matsutake, a close ally of T. magnivelare, is capable of forming Hartig net (Gill et al., 2000).  It is reasonable to assume that the Hartig net structures observed are formed by T. magnivelare though future research should include confirming this through a molecular assessment.  Another argument could be that the Hartig net is observed enough, 85% of the time, to say the feature can be considered to be normally present.  However, as Ogawa (1979) did not observe Hartig net during his assessment it is also possible that a greater variability in the presence of this features exists than was reported in the quantitative analysis conducted by Bravi (2008), therefore future work needs to address this possibility.  The lack of Hartig net in 15% of the roots sampled may not be enough to say the feature is intermittent; however, other observations made during this work  47 raise questions about the functional role of the Hartig net when present in the T. magnivelare\/P. contorta interaction. Hartig net was observed in 100% of the fleshy roots sampled and microscopically analysed but was only present in 80% of the matchstick and cottony associated tips and it is a fair assumption that no Hartig net is present in the blackened morphotype.  As the blackened and matchstick roots are the most dominant morphotypes observed in the T. magnivelare\/P. contorta associated roots (Table 3.2) this poses the further question about whether the more fleshy type with Hartig net is the fully developed expression of the T. magnivelare\/P. contorta, or is the type with the necrotic cortex and no Hartig net?  Hartig net was observed in combination with mantle-like features but not always.  In the 13 cases out of 30 that mantle-like associations were assessed for Hartig net it was observed 6 times but most often it was observed in the absence of any mantle or mantle-like association.  Interestingly, remnants of Hartig net-like structures as well as Hartig net were visible in the matchstick tips at the interface of the live and necrotic cortical cells where cortical penetration by fungal hyphae and cell collapse were both evident (Figure 3.37).  Hence, the Hartig net interface between plant and fungus continues in some instances to the point of host cortical cell collapse and death.  This seems contrary to the principle that mycorrhizal features protect and prolong the life of host tissues (Trappe, 1996; Pederson et al., 2004).  In addition, it again raises questions about the functional role of the Hartig net in the symbiosis formed between T. magnivelare and P. contorta.  In the zone where cortical cell penetration and collapse (Figure 3.39, 3.40 and 3.41) is observed, it is unlikely the host roots are physically able to take up nutrients.  Nevertheless, the stele of the roots in areas where total cortical collapse is observed must still be living as live extending apices are evident (Figure  48 3.40 and 3.41), indicating nutrient flow continues.  Thus the question of Hartig net functionality becomes doubly relevant \u2013 first because its presence is not always observed and second because of its association with necrotizing tissue and functionally compromised roots. Fungal hyphae were also observed penetrating the cells and the presence of what appear to be fungal bundles were observed within the cell membrane (Figure 3.39).  While this study could not assess the identity of the invading fungus, the repeated presence of invaded cells in an area of the soil\/root so totally dominated by the presence of T. magnivelare is very suggestive that T. magnivelare may at some point invade the cell.  It would be an interesting root invasion strategy if the Hartig net provides the avenue for this invasion.  A recent paper by Martin et al. (2008) indicates that similar genes are responsible for host repression during mycorrhization and pathogenicity.  It must also be pointed out that the acquisition of carbon, important in mycorrhizal associations, is similarly important in root pathogen associations (Garrett, 1970) and it is easy to imagine that some mycorrhizal fungi could have shifted one way or another along the mycorrhiza-parasite continuum. Though mycorrhizae have been described that do not develop Hartig nets but instead rely on transfer structures located on the inner mantle, as discussed below, no true mantles are present in the T. magnivelare \/P. contorta symbiosis and though a mantle-like feature is at times observed, it is present on less than half of the quantified sample group.  The problem with asserting that T. magnivelare is a mycorrhizal species is that it does not always form a mantle or a Hartig net.  In cases where ectomycorrhizal fungi have been identified that do either one of these things, they determinately behave this way.  49 Mantle The mantle, another defining anatomical feature of the ectomycorrhizal association, is a sheath-like structure of fungal hyphae that has varying degrees of organization depending on the species involved in the symbiosis.  Ectomycorrhizal mantles are determinate forms in that they present themselves in a manner that can be used as an identifying feature of the fungal symbiont (Agerer, 1987-2002).  Mantle development results when fungal hyphae interact with the root hairs and\/or the root cap of host fine roots (Peterson et al., 2004; Brundett et al., 1996).  As the mantle forms, root hairs and old root cap cells are incorporated into its structure. There is a general lack of this feature present in the gross morphological root assessments.  No structures that were definitively mantles were noted though a variety of mantle-like features (Figure 3.12, 3.16, 3.29 and 3.34) were observed.  For the purposes of this work this variety was classified into two categories.  The first is a thin mantle-like feature that is primarily a single hyphal layer and at times two hyphal layers thick, patchy and discontinuous (Figure 3.34).  The second is the cottony association that forms the basis for one of the root morphotypes included in the analysis (Figure 3.33).  Only 4 of the 30 roots assessed (Table 3.4) had the patchy thin mantle-like association and the cottony root association is rarely present \u2013 on average less than 7 times in 100 (Table 3.2). Since more than one mantle-like form is prevalent this raises the question of whether or not T. magnivelare is the only fungal species present in the association.  Even the occasional presence of these different features on roots with molecularly confirmed T. magnivelare presence suggests an unusual relationship.  50 The uniqueness of the mantle relationships observed with T. magnivelare and P. contorta should provide insights into the nature of the symbiosis.  The variety of mantles among mycorrhizal species is vast (Agerer, 1987-2002; Goodman et al., 1997) and their functions vary depending on structure (Peterson et al., 2004).  Two general functions of the mantle have been identified (Peterson & Bonfante, 1994; Peterson et al., 2004).  First, the mantle is thought to be a protective covering for the root, though Peterson et al. (2004) point out that functionality must vary among species as some mantles are structurally unlikely to provide a defensive barrier.  The two varieties of mantle identified here are unlikely to provide protection for host roots as both are patchy or loose and neither is consistently present.  Gross root morphologies associated with the symbiosis suggest that increased root longevity does not appear to be a result.  The overwhelmingly consistent presence of a mass of tangled, elongated, blackened necrotic roots interspersed with some living roots or roots that have live apices, suggests that the opposite is true.  This is further supported by the fact that both mantle-like features are observed in association with necrotic or collapsing cortical tissue (Figure 3.8, 3.9, 3.11, 3.12, 3.16, 3.29 and 3.33).  The mantle is also thought to be a storage structure for the fungus allowing it to shuttle resources sequestered from the plant to a secure area where the host is unable to retrieve them (Peterson & Bonfante, 1994; Peterson et al., 2004).  As a storage vessel the thin, patchy and discontinuous mantle-like feature would have a very limited capacity.  If nutrient storage is an issue, it might take place in a structure like the cottony mantle-like association (Figure 3.10, 3.11 and 3.18).  However, this feature is commonly observed associated with necrotic tissue.  Interestingly, parasitic and pathogenic fungi are also known to form mycelial masses and networks in the soil to sequester resources away from their hosts and to explore new habitat (Bailey et al., 2000).  51 Several other observations were made regarding the mantle-like features.  No root hairs are observed in association with the roots regardless of the presence or absence of a mantle-like structure (Figure 3.7, 3.32 and 3.38).  This is an intriguing finding because root hairs are often still visible on roots that have early Hartig net (Chapman 1991) and mantle development (Peterson et al., 2004) and remain visible for a time within new mantle features (Thompson et al., 1989).  Their complete absence on the symbiotic roots, observed even in the absence of mycorrhizal features (Hartig net and mantle), is atypical.  No increase in absorption surface is evident in the thin and discontinuous mantle-like feature, a function that is at times attributed to this structure (Peterson et al., 2004).  Finally, mantle-like structures were also observed in association with secondary roots (Figure 3.3, 3.24 and 3.25). This is unusual as ectomycorrhizal mantles are by definition fungal organs that associate with the root cap and cortex of fine roots (Peterson et al., 2004).  In addition, secondary bark was observed to crack and peel (Figure 3.3 and 3.25) away from the roots and at times a swelling or knuckling was observed in the underlying root (Figure 3.24).  This suggests that the mantle like structure may also interact with the periderm of secondary roots. Extramatrical Hyphae Another feature of the ectomycorrhizal symbiosis is the presence of emanating hyphae that radiate into the surrounding soil to form networks of extramatrical mycelium. The function of the extramatrical mycelia is two fold.  First, it acts as an avenue for exploiting and transporting soil bound nutrients and second it provide a mechanism for colonizing new roots (Agerer, 2001).   These hyphal networks originate from the mantle (Peterson et al., 2004).  52 Large, white cottony aggregates of T. magnivelare mycelium were observed in the soil (Figure 3.18), and at times mycelial-strand-like features (Figure 3.8) were noted extending from the cottony root type though it is not clear if the mycelial features observed should be classified as strands or simple concentrations of extramatrical hyphae.  These concentrations of hyphae don\u2019t have any differentiation of tissue as is found in more developed strands.  The lack of any true mantle structures and the inconsistent presence of mantle-like features and Hartig net do not in themselves negate the classification of the mycelial masses as extramatrical hyphae.  Ectomycorrhizae lacking mantles have been described and the extramatrical hyphae in these species are observed to originate from the Hartig net (Peterson et al., 2004).  If T. magnivelare does form an interface between its host and the soil, then the most definitive thing that can be said is the morphology of that interface is varied and irregular. Radiating hyphal masses are also abundantly associated with necrotic tissue on short roots (Figure 3.9, 3.11, 3.16, 3.27, 3.30 and 3.33) and apparently healthy secondary roots (Figure 3.3, 3.24 and 3.25).  Where the cortex is dead, nutrient transfer is not likely to be reciprocal because as the cortical interface collapses it could not perform its nutrient uptake function for the plant.  The presence of radiating hyphae on necrotic tissues is contrary to the principle that the anatomical features of mycorrhizae are associated with living healthy tissues of hosts (Peterson et al., 2004; Trappe, 1996).  Many root parasites are known to form mycelium in the soil by which to spread and invade new host tissue (Otten et al., 2004) and there is an entire loosely defined group of soil-dwelling parasitic fungi (Garrett, 1937).  53 Other observations During this research other observations were made, some of which have already been briefly noted, such as the presence of mantle-like structures in association with necrotic host tissues.  These additional observations may provide insights into this unique symbiosis. Rooting Patterns and Indeterminate Root Growth Studies of ectomycorrhizal short root morphology in the genus Pinus are abundant and long standing.  As early as 1910 a review of previous work on fungal\/host associated short root morphologies for the genus Pinus was published (Wilcox, 1968).  This and subsequent work has demonstrated that dichotomous branching patterns in pine are diagnostic of an ectomycorrhizal association (Kaska et al., 1999).  Interestingly, Levisohn (1959) observed irregular rooting patterns in a Pinus spp. in association with what she termed an aberrant mycorrhizae that had the distinguishing characteristics of a cottony loosely affiliated and discontinuous sheath.  A similar rooting pattern is observed with T. magnivelare in which bifurcation though observed cannot be called the norm, P. contorta short roots were found to branch both dichotomously and pinnately in the presence of T. magnivelare, and root extension appears indeterminate (Figure 3.19).  Regardless of the identity of the fungus, Levisohn\u2019s (1959) conclusions about the rooting patterns generated by the association are the same as the conclusions made here \u2013 that they are atypical or aberrant. T. magnivelare does not form the regular symmetrical dichotomous branching (Figure 3.42) that is reflective of the ectomycorrhiza associated with the genus Pinus (Levisohn, 1953). Short root lengths in the symbiosis between T. magnivelare and P. contorta ranged from 0.2mm to >15mm (Figure 3.19 - 3.21).  This is atypical of mycorrhizal short root  54 development in the genus Pinus (Levisohn, 1953; Kaska et al., 1999) where compact bifurcation is the norm (Figure 3.42).  In addition, the indeterminate elongation of roots was often observed in association with blackened and matchstick roots that had apical extension occurring in front of a collapsed and necrotic cortex (Figure 3.27 and 3.28).  An energy cost must be incurred by the host for this type of root elongation.  Furthermore, the presence of this growth pattern leads one to suspect that the fungus is exuding a growth stimulating compound to encourage host root extension. As fungal symbionts are commonly known to exude factors that result in specific host root morphologies, such as mycorrhizae inducing the bifurcation of Pinus roots (Kaska et al., 1999) it is not unlikely that T. magnivelare exudates are provoking this form of root elongation.  A knuckling or swelling in both fine and secondary roots (Figure 3.24) associated with the fungus was also observed providing a further suggestion of growth stimulation by the fungus. Necrotic Fine Roots Again, the overwhelmingly consistent gross root morphology in the symbiosis between T. magnivelare and P. contorta is a tangled mass of blackened, necrotic, elongated roots (Figure 3.1).  Two morphotypes, the blackened tip (Figure 3.5 and 3.28) and the matchstick tip (Figure 3.4 and 3.27) are observed most abundantly in the relationship and thus dominate or typify the symbiosis between host and fungus.  In both tips, complete or partial cortical collapse is observed and the presence of a live stele is still apparent.  This is most obvious in the matchstick root type where the root appears to be simultaneously in a state of decay and rejuvenation.  Typically the matchstick tip has a live apex and area of live cortex extending from an area of necrotic, collapsed and\/or collapsing cortex (Figure 3.41).  55 These observations do not support the idea that these necrotic blackened roots are senescing mycorrhizae as previously thought (Lefevre & Muller, 1998).  In addition to the gross morphological assessment, microscopic observations of sectioned roots demonstrated the presence of fungal hyphae penetrating the cortical cells (Figure 3.39) and subsequent cortical cell collapse.  On the matchstick tip, the area of cortical cell penetration and collapse was observed at the interface of the live and dead cortex (Figure 3.40 and 3.41).  However, cortical cell penetration and collapse was also witnessed in the fleshy tip type.  Though the identity of the fungal invader is unclear, cortical cell collapse is consistently observed in T. magnivelare associated short roots.  As these necrotic roots are the predominant features of the gross root morphologies associated with the T. magnivelare\/P. contorta symbiosis it is assumed that the fungus plays a role in their formation and character. Conclusions In this study an evaluation of the current classification of T. magnivelare as an ectomycorrhizal fungus was conducted using a combined morphological and molecular approach.  Species specific primers were developed to confirm the presence of T. magnivelare in putatively associated host roots.  To test the central hypothesis that T. magnivelare classification as an ectomycorrhizae is not adequate, a strict anatomical definition of the mycorrhizal relationship as proposed by Jones and Smith (2004) was adopted.  Morphological analyses were therefore conducted to assess host roots and surrounding soil for the structural features that characterize an ectomycorrhiza; Hartig net, mantle and extramatrical hyphae (Peterson et al. 2004).  56  T. magnivelare was at times observed associated with the anatomical features that define the ectomycorrhizal symbiosis.  Observations and molecular results also demonstrate that T. magnivelare can and does exist on and around the roots of P. contorta in the absence of these defining anatomical features.   Hartig net is present 85% of the time but is present in less than half of the roots observed with mantle-like structures.  No true mantles are present, but two different mantle-like structures were occasionally observed.  The dominant impression of the symbiosis is the inconsistency and variation in the presence of both the individual and combined features.  These inconsistencies oppose the whole basis of the morphological classification of ectomycorrhizae which is that mycorrhizae have a determinate growth form (see Agerer, 1987-2002; Goodman et al., 1998).  In addition the frequent association of radiating hyphae and mantle-like structures with dead cortical tissue and periderm are simply inconsistent with what is believed to be the normal function of an ectomycorrhizae.  This leads to the conclusion that the classification of the T. magnivelare\/P. contorta symbiosis as ectomycorrhizal has little meaning or utility.  Simply classifying the T. magnivelare and P. contorta symbiosis as mycorrhizal is meaningless because atypical features are the predominant characteristic of the interaction and their existence becomes secondary under a mycorrhizal classification.  Furthermore, classifying the interaction as ectomycorrhizal implies that the relationship adheres to a standard of defining features which, from observations made during this research, is not the case.  At some point the defining parameters of the mycorrhizal classification itself must be precise enough to ensure the term remains meaningful, i.e., that it provides a context within the scientific community for describing a relationship.  In the case of T. magnivelare and P.  57 contorta, their classification as ectomycorrhizal does not provide a meaningful context in which to communicate the nature of the relationship between the symbionts. A much more meaningful assessment of the relationship is possible from the morphological and molecular observations made in this work.  Inferences can be made about the symbiosis that will hopefully inspire more investigation into the interaction between T. magnivelare and its host P. contorta.  Structurally, host roots are predominately and consistently present as necrotic, elongated and tangled masses (Figure 3.1).  Most of the fine root cortex observed in associated roots is in a state of decay (Figure 3.2) obviously limiting nutrient transfer from the fungus to the plant.  Indeterminate root growth (Figure 3.19) is evidenced by short root lengths >15mm long which result in a tangled mass of roots.  This tangled rooting pattern (figure 3.1) does not appear to be an efficient arrangement for exploring and exploiting soil resources.  In addition, the presence of fungal hyphae penetrating cortical cells (Figure 3.39) and the radiating mycelial masses that envelop roots with dead and dying cortices (Figure 3.11) gives the impression that the fungus is degrading the host cortical tissue.  Furthermore, short roots that appear to be in both a state of decay and a state of rejuvenation (Figure 3.41) such as the matchstick tip coupled with indeterminate growth suggest the fungus is generating root extension so more cortical resources are available to it. In the final analysis, Ogawa (1979) may have accurately categorized T. magnivelare as a mycorrhizal parasite. The term mycorrhizal parasite has been used to describe other mycorrhizal symbioses.  Johnson et al. (1997) suggests that mutualism is the normal mycorrhizal state and that parasitic exceptions to this norm arise for various reasons; developmental, environmental and genotypic.  However, the context in which Johnson et al.  58 (1997) use the term differs from the duality of expression observed here and which Ogawa (1979) describes.  The T. magnivelare and P. contorta association lacks the consistent presence of the anatomical features of an ectomycorrhizae but has pervasive presence of cortical cell necrosis.  This gives the impression that, similar to root pathogens and parasites, T. magnivelare is mining the cortical cells of P. contorta.  Examples of fungi being both mycorrhizal and parasitic exist such as in the case of Armillaria mellea whereby the fungus forms a mycorrhizal association with orchids but parasitizes woody and herbaceous plants (Johnson et al., 1997).  This differs from the variable behaviour observed in T. magnivelare whereby the putatively mycorrhizal and parasitic characteristics are both observed within the T. magnivelare\/ P. contorta symbiosis from across its Pacific Northwest range, as is reported by Ogawa (1979), Lefevre & Muller (1997) and here. Bravi & Chapman (unpublished) collected roots from beneath T. magnivelare sporocarps associated with different hosts (Western Hemlock, Tanoak, Interior Douglas Fir and Coastal Douglas Fir) from California to Northern British Columbia and the root morphologies observed among the various hosts were similar to those reported here with P. contorta suggesting that the fungus behaves similarly regardless of the host.  Wang et al. (1997) refer to the parasitic mycorrhizal relationship observed with T. magnivelare and T. matsutake within a seasonal context suggesting the expression of mutualism and parasitism is seasonally dependent.  The two states (necrotizing root tissue and mycorrhizal features) were observed within the gross root morphologies simultaneously.  In the matchstick morphotype these states could be argued to exist within a single root.  It is possible that the variations observed in the T. magnivelare\/ P. contorta symbiosis are the result of another undetected  59 fungus and it is also possible that a parasitic T. magnivelare is capable of forming anatomical features that are currently viewed as mycorrhizal. Most mycologists agree that the mycorrhizal symbiosis arose from independent free- living, saprophytic fungi.  Recent research has suggested that the symbiosis arose independently on nine occasions (Wilkinson, 2001) and thus the possibility that this symbiosis evolved from a parasitic relationship (Cairney, 2000) should be revisited. Furthermore, ectomycorrhizal associations have been termed unstable due to the number of gains and losses modeled in this symbiosis over the evolutionary time scale (Wilkinson, 2001) and the evolution of the association is thought to have been driven largely by environmental and climatic conditions (Cairney, 2000).  It is not surprising therefore, that fungi exhibit more than one nutritional strategy or are known to develop mycorrhizal structures in vitro but not in the natural environment (Larsson et al., 2006).  We stand to learn a lot more about the nature of the T. magnivelare\/host relationship and mycorrhizal relationships in general by taking T. magnivelare out of the mycorrhizal box.  60 Figures and Tables Figure 3.1: Fungal Root System \u2013 Blackened tangled necrotic roots collected beneath a T. magnivelare fruit body in pure P. contorta stand  Figure 3.2: Cortical Cell Blackening, Cracking and Sloughing \u2013 Cortical cell necrosis is observed throughout the affected root system by a blackening, cracking (a) and sloughing (b) of these cells on the fine. a b  61  Figure 3.3: Splitting and Peeling of the Bark on Secondary Roots \u2013 The bark of the woody roots is also affected by T. magnivelare as is evident by the fungal casing (a) on a portion of the epidermis.  The bark is observed splitting and peeling (b) from these woody roots.  Figure 3.4: Matchstick Morphotype \u2013 The matchstick short root morphotype is characterized by a live apex (a) with a zone of live cortical cells (b) proximal to it.  A blackened cortical zone (c) that is at times cracked and sloughing appears closer to the main short root axis. c b b a a  62  Figure 3.5: Blackened Root Morphotype \u2013 The blackened short root morphotype is distinguished by a blackened zone of cortical cells (a) that are sometimes cracked and sloughing proximal to a live apex (b).  The colour tinge observed in the translucent apex varies from white to black (Figure 3. 22 and 3.23)  Figure 3.6: Broken Blackened Roots \u2013 Broken black short roots are also observed and at times have what appears to be a fleshy new apical extension emerging from them (a). This root type was excluded from the analysis as it was to difficult to identify if the roots were damaged during sample collection and preparation or if they represent another morphotype. b a a  63 Figure 3.7: Fleshy Root Morphotype \u2013 The fleshy roots are characterized by a live apex (a) and cortex (b) which gives these roots the appearance of being new or young fine roots that are fully functioning.  A striated appearance is sometimes observed in this root type (c) along the cortex.   An aggregation, of mycelium and soil crystals (c) is forming along the most proximal cortical zone.  a b c Figure 3.8: Cottony Root Morphotype \u2013 A loose cottony association (a) is observed with the variety of root morphotypes found in the P. contorta affected systems.  Here the underlying short root is of the matchstick type. Completed cortical cell sloughing is evident on this tip (b).  Mycelial-strand-like structures (c) radiate out from the tip. c b a  64 Figure 3.9: Cottony Root Morphotype 2 \u2013 The cottony association (a) is observed here with a blackened short root.  The live apex (b) is evident with the more proximal cortex blackened (c) and cortical cell sloughing is observed along the root towards the main axis (d). d a c b  65 Figure 3.10: Cottony Aggregation \u2013 A number of roots, fleshy (a) and blackened (b) underlie the cottony association (c).  b a c  Figure 3.11: Cottony Association \u2013 At times it is unclear if the cottony hyphal clusters associated with the roots are real features or if they were detached from pre-existing soil mycelial masses (a) during sample collection.  A cottony mycelia similar to that observed in the photo below was confirmed via molecular analysis to be T. magnivelare.  a  66 Figure 3.12: Psuedo-mantle Structure \u2013 A mantle-like structure (a) is at times observed as a patchy, discontinuous feature associated with root apices.    A cottony mycelia similar to that observed associated with this root was confirmed by molecular analysis to be T. magnivelare.  a Figure 3.13: Straight Tip Type \u2013 Straight tips are observed in all root morphotypes.  67 Figure 3.14: Tortuous Tip \u2013 Tortuous tips are characterized by twists and bulges and generally look tortured.  This tip type is most often observed in matchstick and blackened morphotypes and rarely in the fleshy roots. igure 3.15: Bent Tip \u2013 Note the sloughing of the cortex (a) distal to the zone of cortical cell necrosis.  Root   F widths vary depending on cortical cell sloughing.  Also the apex appears live and it is assumed that the stele of the root remains functional. a  68 ca a b f d e 1 2 4 3 5 6 Figure 3.16: Mantle-Like Features \u2013 In addition to the mantle-like features observed in the cottony association Figure 3.12 and Image 1 below, other mantle like structures are noted in affected roots.  The thin hyphal sheath (a) covering the fleshy bifurcated (b) root in 3 and the blackened necrotic root 2 and 4 with the sloughed cortex (c) is at times observed on all morphotypes.  The thicker hyphal sheath in 5 is covering the secondary root (d) in addition to the fine root (e) while in image 6 a very thin mycelial covering is only associated with the distal tip (f) of the blackened root.  A cottony mycelia similar to that observed in Image 1 below was confirmed by molecular analysis to be T. magnivelare.      69 Figure 3.17: Fungal Dotting of roots \u2013 What are appear to be fungal hyphae dot or line (a) the roots. these aggregates do not fluoresce under UV light and may instead be fungal exudates. a  However,  Figure 3.18: Soil Mycelia \u2013 Cottony masses of mycelium appear as clusters in the soil (a).  At times these aggregates encompass multiple roots and soil particles.  Fungal primordia (b) are observed in these mycelial masses.  Molecular analysis confirmed these masses to be T. magnivelare. a b  70  71 hotomous branching (b) and several possible pinnate branches (c) after its extension from the main root (d). he extension continues. Figure 3.19: Indeterminate Root Elongation \u2013 Short root lengths are commonly greater than 15mm long. The extent of elongation is visible in this short root (a) which has what appears as one dic a b c d  Figure 3.20 Dichotomous Short Root Branching \u2013 Dichotomous branching of short roots is evidenced by t extension of two roots (a) from the terminal end of the main short root (b).   In this root a functioning stele is assumed to exist beneath the necrotic cortex and beyond the zone of cortical cell sloughing (c) as apical a b c Figure 3.21: Monopodial Pinnate Branching  \u2013 Short roots observed here exhibit a monopodial pinnate ppearance and are tinged  branching pattern in which a single new short root (a) extends from the main short root axis (b).  Figure 3.22: White Tinged Short Root Apex \u2013 Short root apices have a translucent a from white to dark orange-brown. a b  72 Figure 3.23: Yellow-orange Tinged Short Root Apex \u2013 This yellow-orange tip demonstrates what is approximately the mid range coloration while Figure 3.5 shows the dark end of the spectrum and Figure 3.22 demonstrates the lightest hue. ry roots in the root systems associated with T. magnivelare.  A white fungal association (b) is noted on the periderm of the secondary woody root shown here, the association is assumed to be T. magnivelare.  Figure 3.24: Knuckling \u2013 At times swelling or knuckling (a ) is observed on fine and seconda a b  73 Figure 3.25: Secondary Root Bark Peeling \u2013 Splitting and peeling (a) of the bark (epidermis) associate woody roots is observed in the affected fungal root-systems.  A cellular pattern, reflective of epidermal cell arrangement (b) is sometimes n d with oted on the bark peelings.  Fungal hyphae are observed associating with these roots as well as with the fine roots.   Figure 3.26: Stained Whole Matchstick Root \u2013 The white apical tip (a) is distal to the zone of live cortex (b) which satins green for the positive presence of fungal material.  No mantle or mantle-like association is observed with this root and cortical cell necrosis is apparent by the reddish-brown cortex (c) proximal to the apex and zone of live cortical cells.                           a b a b c  74 Figu obse r, from necr hstick type.  A zone of necrotic cortical tissue proximal to the live cortex is ofte observed cracking (d) and sloughing (e).  Cottony fungal hyphae are at time observed associating with both live (f) and necrotic tissue (g) in these roots.  Cottony mycelia similar to that observed in the photo to the right were confirmed to be T. magnivelare through molecular analysis. re 3.27: Variation in Matchstick Morphotypes \u2013 The matchstick root is the predominate morphotype rved in the interaction between T. magnivelare and P. contorta.  A live translucent apex (a) that varies in colou  white to orange proximal to a zone of live cortical cells (b) which also have colour variation and a zone of otic cortical tissue (c) typify the matc n      g c ab a b d e f g  75 Figure 3.28: Variation in Blackened Morphotypes \u2013 Cortical cell necrosis is the predominate es at characteristic of this morphotype.   Cortical cell cracking (a) and sloughing (b) are often apparent.  Apic times are completely blackened (c) and at other times appear translucent with a range of colour tinges from white (d) to dark orange-brown (e).  A pocked-shriveled (f) appearance is often associated with these roots. f a b e d c   76 Figure 3.29: Variation in Fleshy Morphotypes \u2013 Variation exists within the fleshy root type both between pears in  ot cortex.  No cortical necrosis is evident in this root. roots of this type and along a single root.  The left root is an example of a fleshy morphotype that ap transition not the white apical tip (a) and the dark-orange (b) to dark-brown (c) colour of the cortex proximal to the tip while at the very proximal end cortical necrosis (d) is apparent.  Note that the mantle-like association in the enlargement is interacting with both the live (e) and necrotic cortex (f) in the transition zone.  The right ro is a lighter coloured fleshy type with a light yellow tinged apex (g) and an orange (h) to dark-orange (i) live a b g e f d c h i  77 Figure 3.30: Variations of the Cottony Root Type \u2013 The blackened root with a small but visible live apex (a) shows the cottony mycelia of T. magnivelare engulfing a black and necrotic cortex in a mantle-like (b) fashion. The matchstick roots with live apices (c) and proximal zones of live (d) and dead cortex (e) exemplify the loose fluffy hyphal masses (f) often observed throughout the system.  The newly extending fleshy root with a white apex (g) is ag ical tip appears mantle free.   fungal mycelia (k). e cottony mycelia similar to the that observed in the top right photo was confirmed to be T. magnivelare.  g i k j d a b e c f h  Th ain engulfed in a mass of hyphae (h) yet the live cortical zone (i) proximal to the ap Again the blackened root with the live orange apex (j) looks like it is engulfed by  78 Figure 3.31: Gel Electrophoresis \u2013 Molecular analysis of 9 blackened root morphotypes were assessed for magnivelare presence using species specific primers of the ITS region.  Bands in wells 1 \u2013 9 show magnivelare amplified in all 9 root samples.   As a reference for the Table of short root amplification results of band intensities will be calibrated to this photo.  Band intensities vary from +++++ in well 10 the positive control to \u2013 in well 11 the negative control.  Lane 1 ++++, Lane 2, 3, 4, 5, 8 and 9 ++, Lane 6 +, Lane 7 +++, Lane 10 +++++ and Lane 11 \u2013. ab c  T.  T.     Figure 3.32: Matchstick Morphotype \u2013The live, extending apex(a) and the live cortical zone (b) stain blue with FDC blue dye #1 indicating fungal association in the absence of a mantle or mantle-like structure.  The zone of cortical cell collapse (c) is clearly visible.  1 2 3 4 5 7 8 9 10 116  79 Figure 3.33: Loose Mantle-like Feature \u2013 A loose cottony mantle-like feature (a) is at times observed with the various morphotypes found in the T. magnivelare and P. contorta symbiosis.  This cottony mantle-like association extends from the zone of live cortex (b) to the area of cortical necrosis (c) on this matchstick root. The cottony association was confirmed through molecular analysis to be T. magnivelare.    Figure 3.34: Patchy-discontinuous Mantle \u2013 A t  mantle-like (a) association is visible on the bottom side of the root tip while no mantle is observed on the top side (b) of the same tip. The blue staining indicates the presence of a fungal association throughout the root.  Molecular analysis of the other half of this root tip tested positive for T. magnivelare presence. c a b hin a b  80 Figure 3.35: Hartig net \u2013 Hartig net (a) and the characteristic thickening of the cortical cell walls (b) are visible but no mantle or mantle-like features are present.  81 he roots observed. t in the outer cortical cells but not in the inner cortical region (b).  Cell walls remain thin (c).  Figure 3.36: Variable Hartig net \u2013 Hartig net (a) presence and abundance varies within t Limited development of the Hartig net is observed in this root.  The feature is only eviden a b a b c Figure 3.37: Hartig net and cortical collapse  \u2013 Well developed Hartig net (a) as evidenced by thickening of the call walls and its abundant presence throughout the inner and outer cortex is observed at the live-necrotic cortical interface (b).  Figure 3.38: Non-mycorrhizal root \u2013 No Hartig net or mantle is observed in this root and cortical cell wa remain thin (a).  Even in the absence of the anatomical features that define the ectomycorrhizal symbiosis molecular analysis demonstrated T. mag lls nivelare presence.  Note the lack of root hairs. b a a  82 Figure 3.39: Cortical Cell Invasion \u2013 Bundles of fungal hyphae (a) are observed invading the cells and penetrating the membrane at the zone where cortical necrosis is observed by the colour change from orange to black (b) of cortical cells.  The image on the right is a close up of the fungal invasion in a single cortical cell.  a b  Figure 3.40: Cortical Cell Collapse \u2013 The matchstick morphotype provides the best demonstration of cortical deterioration but cortical collapse is observed in the fleshy roots as well. Cortical cells begin to deteriorate as evidenced by the orange colouration (a) as necrosis progresses the cortex blackens (b) a live stele (c) is still visible in the zone of cortical necrosis. a b c  83 Figure 3.41: Rejuvenation and Decay \u2013 New apical extension is often observed in roots that are also seen to be in a state of necrosis.  Again, the matchstick morphotype provides the best demonstration of apical extensio (a) in the face of cortical d n eterioration (b), collapse (c) and sloughing (d).  A live stele (e) is obviously still present and is observed in the zone of necrotic and collapsing cortical cells. a b c d e  84 Figure 3.42 Ectomycorrhizae of Pinus \u2013 Note the compact bifurcation of the roots, a diagnostic feature o ectomycorrhizae of Pinus.  (Bending, D., Lactarius rufus-Pinus sylvestris mycorrhizas (January 21, 2009) www2.warwick.ac.ukfac\/sci\/whri\/research\/soilmicrobialdiversity\/). f the able 3.1: Overview of root sampling \u2013 Putatively associated roots were sampled from across the range of . 8 Lab analysis  T habitat types in the West Chilcotin of British Columbia.  Field samples were collected at one of two existing transects where T. magnivelare sporocarps are known to occur in pure P. contorta stands.  Field samples were taken to the lab where analyses were conducted.  Two field sampling sessions were conducted in the fall of 2007 and 2008.  If no sample was found at the first transect then the second transect was visited and searched Habitat Type Transect 1st Sampling Sept. 2007 2007 Lab analysis  2nd Sampling Oct. 2008 200 SBPSxc 1 Sample collected DNA, microscopy, gross root and morphotype analysis No sample found -  2 Not visited - Sample collected anal Microscopy, gross root and morphotype ysis ESSFxv1 1 Sample collected DNA, microscopy, gross root and morphotype analysis Sample collected anal Microscopy, gross root and morphotype ysis  2 Not visited - Not visited - MSxv 1 No sample found - No sample found -  2 Sample collected DNA, microscopy, gross root and morphotype analysis No sample found  IDFdk4 1 Sample collected DNA, microscopy, gross root and morphotype analysis Sample collected Microscopy, gross root and morphotype analysis  2 Not visited - Not visited -  85 Table 3.2: Quantitative analysis of morphotypes \u2013 The relative quantities of morphotypes was determined by counting the occurrence of each in a random 100 root sample. Site Date sampled Matchstick  Black Fleshy Cottony Kappan Oct 2008 47 33 12 8 Bf Trail  Oct 2008 53 31 14 2 Kleena Kleene Sept 2008 45 36 15 4 13 Mile August 2008 39 32 17 12  Table 3.3:  Molecular Assessment of morphotypes \u2013 Using species-specific primers approximately 10 samples of each short root orphotype was analysed by DNA extraction and PCR amplification.  Results are outlined in this table. The (+) signs indicate band intensities observed with each root.  Figure 31 above can be used as a reference for band intensities. Morphotype Root # Amplified (y\/n) Band Intensity Matchstick 1 Y +++++ Matchstick 2 Y ++ Matchstick 3 Y ++++ Matchstick 4 Y +++ Matchstick 5 Y +++ Matchstick 6 Y +++ Matchstick 7 Y +++ Matchstick 8 Y +++++ Matchstick 9 Y ++++ Matchstick 10 Y ++++ Matchstick 11 Y ++ Matchstick 12 Y +++++ Matchstick 13 Y ++++ Fleshy 1 Y +++++ Fleshy 2 Y ++++ Fleshy 3 Y ++++ Fleshy 4 Y ++++ Fleshy 5 Y ++++ Fleshy 6 Y ++++ Fleshy 7 Y ++++ Fleshy 8 Y +++ Fleshy 9 Y +++++ Fleshy 10 Y +++ Cottony 1 Y +++++ Cottony 2 Y +++++ Cottony 3 Y +++++ Cottony 4 Y +++++ Cottony 5 Y +++++ Cottony 6 Y +++++ Cottony 7 Y +++++ Cottony 8 Y +++++ Cottony 9 Y +++++ Cottony 10 Y +++++  m  86 Morphotype Root # Amplified (y\/n) Band Intensity Blackened 1 Y ++++ Blackened 2 Y ++ Blackened 3 Y ++ Blackened 4 Y ++ Blackened 5 Y ++ Blackened 6 Y + Blackened 7 Y +++ Blackened 8 Y ++ Blackened 9 Y ++  Table 3.3: Microscopic Assessment of morphotypes \u2013 Sections of 10 samples of each short root morphotype except the blackened morphotype which proved too difficult to section was analysed under a Zeiss compound microscope for the presence of Hartig net and mantle features.  This work was done as part of another project, results are outlined in this table and a complete table of results is included as Appendix 1. Tip Type Hartig net (presented as a ratio) Mantle (presented as a ratio) Hartig net with no mantle Mantle with no Hartig net Matchstick 8\/10 0\/10 8\/10 0\/10 Fleshy 10\/10 3\/10 7\/10 0\/10 Cottony 8\/10 10\/10 7\/10 3\/10 Totals 26\/30 4\/30 22\/30 3\/30  87 References Agerer, R. (2001). p co  mycelia s. A p classify  w pect to t ogical ant tact are substr  Mycorrhiz 1 (2),107-11 etrieved f w k.co   (1987-2  A of Ectomycorrhizae.  Schwabisch-Gmun Einhorn-Verlag. Anderson, I. (2006). Molecular e f e ungal communities: New fro . Cooper & J . Rao (Eds.), olecular appro  soil rhizosphere and plant microorganisms (  ed.), (pp. 183-197). Wallingford: CABI Publishing.  Bailey, D.J 2000).  Saprotrophic invasion by the soil- bor ant pathogen hizoctonia so i and percolation thresholds.  New Phy 6(3), 535-54  Bravi, R. ( phological a  molecular a lysis of Tricholoma magnivelare   Exploration ty mycorrhizal my es of ectomy celial systems rrhizal ith res l system heir ecol roposal ly importto con http a with the ate. a, 1 4. R rom :\/\/ww .springerlin m Agerer, R. 002).  Colour tlas d,  Amersham Biosciences (2004).  Instructions: puReTaq ready-to-go PCR beads. Amersham Biosciences. 27-9557-01PL Rev C 2004. 20p.  cology o ctomycorrhizal f ntiers. In J.E .R  M aches to 5th ., Otten, W., & Gilligan, C.A. ( ne fungal pl  R lan tologist, 14 4. 2008) A mor nd na associated host roots using microscopy and RFLP. Unpublished graduate essay, Un ritish Colum , Vancouver  h Mycorrhizas in Forestry and Agricultural. ACIAR Monograph 32 ACIAR, Canberra.  Cairney, J.W.G.  2000.  Evolution of mycorrhiza systems.  Naturwissenschaften, 87(11), 467\u2013475. Retrieved from http:\/\/ww pringerlink.com  Chapman W. (1991). Inoculation o tomycorrhiz fungi in the IDF Biogeoclimatic subzone of British Columbia: new techniques, fungi and outplanting tria toral Thesis, University of British Columbia, Vancouver.  Deacon, J.W. (1996)  Ecological implications of recognition events in the pre-infection stages of root pathogens. New Phytologist, 133(1), 135-175. Retrieved from http:\/\/www3.interscience.wiley.com  Garrett, S.D. (1937).  Soil conditions and the root-infecting fungi.  Biological Rev (2), 159-184. Re eved from h  Garrett, S.D. (1970).  Pathogenic root infecting fungi.  London, Engl mbridge University Press.  Gill, W.M., Lapeyrie, F., & Gomi, T. (1999). Tricholoma matsutake \u2013 an iversity of B bia . Brundrett, M., Bougher, N., Grove, T., & Malajczuk, N. (1996) Working wit w.s f ec al dk2 ls.  Doc iews, 13 tri ttp\/www3.interscience.wiley.com and: Ca  88 assess  and inf ing c ed whole roo  9(4), 227-231. Retrieved from http:\/\/www.springerlink.com  Goodman, D.M., Durall, D.M., Trofymow, J.A., & Berch, S.M. (Eds.). (1997). Concise d Forest Res rce Developm t Agreement, Canadian Forest Service. Retrieved from http:\/\/www.pfc.cfs.nrcan.gc \/biodiversity\/bce dex_e.html  Guerin-Laguette, A., Vaario, L., Gill, W., Lapeyrie, F.,  Matsushita, N., & Suzuki, K. (2000).  Rapid in vitro ectom corrhizal infe on on Pinus dens roots by Tricholoma matsutake. Mycoscience, 41(4), 389-393. Retrieved from H &  (1983). Myc mbiosis. New York, New  A ic Press. H T.R., & , T.D. (2001). Th ycorrh logy ing into the black- olecular Ecolo (8), 1855-1 etrieved  http:\/\/p io.berkeley.edu Iotti, M., Amicucci, A., Stocchi, V., & Zambonelli, A. (2002).  Morphological and molecular characterization of mycelia of some Tuber species in pure culture. New Phytologist, 155(3), 499-505. Retrieved from http:\/\/www3.interscience.wiley.com  Jones, M. D., & Smith, S.E. (2004).  Exploring functional definitions of mycorrhizas: Are mycorrhizas always mutualisms? Canadian Journal of Botany, 82(8), 1089-1109. Retrieved from http:\/\/article.pubs.nrc-cnrc.gc.ca  Kaska, D.D., Myllyla, R., & Cooper, J.B. (1999). Auxin transport inhibitors act through ethylene to regulate dichotomous branching of lateral root meristems in pine. New Phytologist,142(1), 49-57. Retrieved from http:\/\/www3.interscience.wiley.com  Larsson, K-H., Parmasto, E., Fischer, M., Langer, E., Nakasone, K.K., & Redhead, S.A. (2006). Hymenochaetales: a molecular phylogeny for the hymenochaetoid clade. Mycologia, 98(6), 926-936. http:\/\/www.mycologia.org\/  Lefevre, C., & Muller, W. (1998). Tricholoma magnivelare (Peck) Redhead. CDE18. In D.M. Goodman, D.M. Durall, J.A. Trofymow, & S.M. Berch. Concise Descriptions of North American Ectomycorrhizae.  Victoria, B.C.: Mycologue Publications, and Canada-B.C. Forest Resource Development Agreement, Canadian Forest Service. Retrieved from http:\/\/www.pfc.cfs.nrcan.gc.ca\/biodiversity\/bcern\/index_e.html  ment of in situ  in vitro ection by observ leared and stain ts. Mycorrhiza, descriptions of North American ectomycorrhizae. Victoria, B.C.: Mycologue Publications an ou en .ca r nn\/i y cti iflora   http:\/\/www.springerlink.com  Harley, J.L., (1969).  The Biology of Mycorrhiza (2nd Ed.). London, England, Plant Science Monographs:Leonard Hill London.  arley, J.L., York: Smith, S.E. orrhizal Sy cadem  orton,  Bruns e molecular revolution in ectom izal eco from : peek lantb box. M \/~bruns\/ftp\/horton2001a.pdf gy 10 871. R   89 Levisohn, I. (1959).  Root forking of pine seedlings growing under non-sterile conditions.  New Phytologist, 59(3), 326-331.  Retrieved form  Leviso ssociation. Nature (London), 172, 316\u2013317. Retrieved from http:\/\/www.nature.com Martin, F., Aerts, A., Ahre\u00b4n, D., Brun, A., Danchin, E. G. J., Duchaussoy, F., Gibon, ., et al. (2008). The genome of Laccaria bicolor provides insights into mycorrhizal ure  Martin, K. J., & Rygiewicz, P.T. (2005).  Fungal-specific PCR primers developed for  Masui, K. 1927. A study of ectrophic mycorrhizas of woody plants.  Memoirs of the College  Ogawa, M. (1974) Ecology of Tricholoma matsutake (Ito et Imai) Sing., mycorrhizal ngus, in pine forest. Mushroom Science, IX(1), 733-745. Ogawa otsuga menziesii \u2013 Tsuga heterophylla tten, W., Bailey, D.J., & Gilligan, C.A. (2004). Empirical evidence of spatial tologist, . eterson, R.L., & Bonfante, P. (1994). Comparative structure of vesicular-arbuscular   iagen. (2004). DNEasy plant mini and DNeasy plant maxi handbook: For  aven, P.H., & Johnson, G.B. (1989). Biology, 2  Ed. St. Louis, Missouri: Times  Thompson, J., Melville, L.H., & Peterson, R. L. (1989). Interaction between the http:\/\/www3.interscience.wiley.com hn, I. (1953). Growth responses of tree seedlings to mycorrhizal mycelia in the absence of a mycorrhizal a  J symbiosis. Nature, 452, 88-93. Retrieved from http:\/\/www.nature.com\/nat analysis of the ITS region of environmental DNA extracts.  BMC Microbiology 5, 28. Retrieved from http:\/\/www.biomedcentral.com of Science. Kyoto Imperial University, Series B, 3(2), 152-279.  fu  , M. (1979). Microbial ecology of \u2018Shiro\u2019 in Tricholoma matsutake and its allied species IX: Tricholoma ponderosum in Pseud and Pinus contorta forests.  Transactions of the Mycological Society of Japan 19, 391-405.  O thresholds to control invasion of fungal parasites and saprotrophs. New Phy 163(1), 125-132.  Peterson, R.L., Massicotte, H.B., & Melville, L.H. (2004). Mycorrhizas: Anatomy and Cell Biology.  Ottawa, Ontario: NRC Research Press, CABI Publishing  P mycorrhizas and ectomycorrhizas.  Plant and Soil, 159(1), 79-88. Retrieved from http:\/\/www.springerlink.com Q isolation of DNA from plant tissue.  Qiagen Incorporated (2000). ndR Mirror\/Morsby College Publishing.  90 ectomycorrhizal fungus Pisolithus tinctorius and root hairs of Picea mariana (Pinaceae).  American Journal of Botany, 76(4), 632-636. http:\/\/www.amjbot.org  ccession in mixed temperate forests. New Phytologist, 176(2), 437-447. Retrieved  Only two atsutake to differentiate ectomycorrhizal Hartig net structures in roots of Pinus densiflora seedlings cultivated on artificial substrate.   e loma matsutake and related fungi.  Economic Botany, 51(3), 11-327. Retrieved from http:\/\/www.springerlink.com Wiensc f current research nd conservation strategies. B.C. Journal of Ecosystems and Management, 2(1).  Wilcox ed pine, Pinus oots and the development of mycorrhizae. American Journal of Botany, 55(6), 686-700. http:\/\/www.amjbot.org Wilkin om tfp_bc.pdf Wurzb rests using morphotyping nd molecular methods. Canadian Journal of Botany, 79(10), 1211 \u2013 1216. Yamad     Trappe, J.M. (1996). What is a mycorrhiza? In Proceedings of the 4th European symposium on mycorrhizae (pp. 3-9).  Granada, Spain.  Twieg, B.D., Durall, D.M., & Simmard, S.W. (2007).  Ectomycorrhizal fungal su from http:\/\/www3.interscience.wiley.com  Vaario, L., Guerin-Laguette, A., Gill, W., Lapeyrie, F., & Suzuki, K.  (2000).  weeks are required for Tricholoma m   Journal of Forest Research, 5(4), 293-297.  Retrieved from http:\/\/www.springerlink.com Wang, Y., Hall, I.R., & Evans, L.A. (1997). Ectomycorrhizal fungi with edibl fruiting bodies: 1. Tricho 3  zyk, A.M., Gamiet, S., Durall, D.M., Jones, M.D., & Simard, W. (2002) Ectomycorrhizae and forest in British Columbia: A Summary o a Retrieved from http:\/\/www.forrex.org\/JEM\/ISS2\/vol2_no1_art6.pdf. , H.E. 1968.  Morphological studies of the roots of r resinosa.  II. Fungal colonization of r  son, D.M. (2001). Mycorrhizal evolution. Trends in Ecology & Evolution, 6(2), 64-65. Retrieved from http:\/\/www.sciencedirect.c  Wills, R. M., & Lipsey, R. G. (1999).  An economic strategy to develop non- timber froest products and services in British Columbia. Final Report. Forest Renewal British Columbia. Retrieved from http:\/\/www.sfp.forprod.vt.edu\/pubs\/ n  urger, N., Bidartondo, M.I., & Bledsoe, C.S. (2001). Characterization of Pinus ectomycorrhizas from mixed conifer and pygmy fo a Retrieved from http:\/\/article.pubs.nrc-cnrc.gc.ca  a, A., Kanekawa, S., & Masatake, O.  (1999).  Ectomycorrhiza formation of Tricholoma matsutake on Pinus densiflora. Mycoscience, 40(2), 193-198. Retrieved from http:\/\/www.springerlink.com  91 Yamada, A., Maeda, K., Kobayashi, H., & Murata, H.  (2006).  Ectomycorrhizal symbiosis in  lings that resembles  a, 16(2), 111-116. Retrieved from http:\/\/www.springerlink.com Yamad zal Tricholoma species for three years in open pot cultures with pine seedling hosts. Mycoscience, 48(2), 104-108.  Retrieved from vitro between Tricholoma matsutake and Pinus densiflora seed naturally occurring \u2018shiro\u2019. Mycorrhiz   a, A., Kobayashi, H., & Fukuda, M. (2007). Sustainable fruit body formations of edible mycorrhi http:\/\/www.springerlink.com  92 CHAP  are is an economically important basid ycete that is comme ills & Lipsey, 1999; mbia harvest of the m ushroom is currently classified as an Commercial timber harvest in this region of the province began to increasingly affect mushro recomm aintain mushroom habitat within a timber harvest context.  A joint on and the ushroom ost associated root sam  by Ogawa classification of the T. magnivelare\/P. contorta association as ectomycorrhizal became suspect hough limited work has been done on the associated root morphologies there is some a ts is atypi g et al., 1997).  Still, T. magnivelare t exists ogies.  However, it was unclear if T. magnivelare TER 4   Conclusions Tricholoma magnivel iom rcially harvested in North America for export to Japan (W Hosford et al., 1997).  In the West Chilcotin area of the province of British Colu ushroom began in the early 1980s.  The m ectomycorrhizal species that grows in association with several conifer hosts of which the most significant in the West Chilcotin of BC is Pinus contorta. om harvest areas in the mid to late 1990s resulting in the need for management endations to m research initiative was undertaken in the Chilcotin of BC between the Ulkatcho First Nati  provincial Ministry of Forests and Range to study the ecology of the m there.  During this significant research effort field collected sporocarp and h ples were examined in the lab.  Similar to early descriptions provided (1974), a mass of tangled necrotic looking roots were observed and the current trophic . T greement that the relationship formed between T. magnivelare and its associated hos cal of a true mycorrhizal one (Ogawa, 1974; Wan is classified as an ectomycorrhizal fungus (Lefevre & Muller 1998) though agreemen about the presence of atypical root morphol  93 is present in all of the observed host roots and no in depth descriptions of these atypical morphologies exist. Thus, the focus of the research conducted here was to assess P. contorta host root e is present in the observed root morphologies.  The information obtained from this assessment was then used to determine if the current classification of the T. magnivelare\/P. contorta symbiosis as ectomycorrhizal is useful i.e., provides a meaningful context with which to communicate the nature of the association. To complete this work a molecular identification method was selected to enable the detection of T. magnivelare in the roots of P. contorta.  Two specific oligonucleotide primer sets were developed to amplify the ITS region of the fungus.  Methods involved in the development of the primers are outlined in Chapter 2 of this thesis.  Once the primers were developed they were used to confirm the presence of T. magnivelare in P. contorta host roots.  Chapter 3 of the thesis details methods developed and used for describing root tip ith pure rphology was morphologies associated with T. magnivelare sporocarps and determine if T. magnivelar morphotypes collected from directly beneath T. magnivelare sporocarps associated w lodgepole pine in the West Chilcotin of British Columbia as well as methods used for confirming T. magnivelare presence in each morphotype.  An analysis of mo then conducted to assess the utility of the current classification of T. magnivelare\/P. contorta symbiosis as ectomycorrhizal using a strictly anatomical definition of mycorrhizae as proposed by Jones & Smith (2004).  The primers confirmed that T. magnivelare is present in the atypical host root morphologies described here and that have been previously observed by others (Ogawa,  94 1974; Wang et al., 1997; Lefevre & Muller, 1998).   In developing the primers the basic taxonom .  Primer stern ares d, agnivelares.  Being able to distinguish between the variants may be important as their biology and ecology may differ and management requirements may therefore vary between the two groups.  In addition, the distribution of T. magnivelare variants is still poorly understood and overlaps may occur. Future work is required to clarify the taxonomy of T. magnivelare across North America. of  in  with collapsing and necrotic tissues.  The T. magnivelare\/P. contorta symbiosis does not conform with the definition of ectomycorrhizae accepted in this work.  The inconsistencies and variations in morphology that were observed also oppose the principles of the morphological classification of ectomycorrhizae which is based on the assumption that mycorrhizae have a determinate growth form (see Agerer, 1987-2002; Goodman et al., 1998).  In addition the frequent association of radiating hyphae and mantle-like structures ic classification of T. magnivelare across North America came into question development proved to be a challenge as differences in the ITS regions of Eastern, We and Mesoamerican T. magnivelare became evident.  Eventually two primer sets were developed, one (Primer set 2) to distinguish between Pacific North Western T. magnivel and other North American clades as proposed by Chapela & Garbelotto (2004).  The secon (Primer set 1) was developed to amplify all North American T. m The assessment of the morphology of the T. magnivelare\/P. contorta suggested th its classification as ectomycorrhizal provides little utility for describing the nature of the relationship observed.  Features associated with this classification (Hartig net, mantle and extramatrical hyphae) are not always present and when present, either exhibit a variety forms, are inconsistently present or absent in association with each other or are observed association at  95 with dead cortical tissue and periderm are simply not consistent with what is believed to the normal function of be  an ectomycorrhiza.  ere observed to have live steles and the presence of a growing apex extending from a dead collapsed cortex demonstrated a root that was at once in a state of senescence and rejuvenation.  In addition, a rooting pattern atypical of the diagnostic dichotomous branching patterns of ectomycorrhizal associations in pine (Kaska et al., 1999) was observed. ect plex fungus directly or indirectly plays a role and\/or derives  b ungi Additionally, other observations brought to light several interesting morphological features associated with the symbiosis between T. magnivelare and P. contorta. Indeterminate root growth was witnessed as part of the overall gross root morphology associated with the symbionts.  Cortical cell invasion by fungal material and subsequent cortical cell collapse was also observed across the range of root morphotypes described. Interestingly, blackened and necrotic roots w These observations point to the possibility that Ogawa (1974) may have been corr in his assessment of the symbiosis formed between T. magnivelare and P. contorta as mycorrhizal parasite.  The observation of inconsistent anatomical features associated with ectomycorrhizal symbiosis indicates T. magnivelare is interacting with its host in a com and changing way and the repeated observations of intracellular penetration and cortical cell necrosis suggests an antagonistic relationship.  Regardless of the exact identity of the invading fungus T. magnivelare is always present in association with these root morphologies which suggests that the a enefit from this form of interaction with its host.  Both parasitic and mycorrhizal f exist that have two life strategies, spending portions of their life cycle as either parasites\/mycorrhizae or saprophytes (Trigiano et al., 2004).  It would therefore not be  96 inconceivable for a fungus to be mycorrhizal at times and parasitic at other times.  After a root parasites compete for the same habitat as mycorrhizal fungi (Graham, 2001). ll, Limitations and Recommendations  A potential criticism of this study might be that the atypical root morphologies described here could be limited to the West Chilcotin area.  Research done by Ogawa (1979) and Lefevre and Muller (1998) on T. magnivelare in Oregon and a study conducted by Gill, et al. (2000) on T. matsutake in Japan, found similar root morphologies indicating the findings reported here are not unique.  Another limitation of this study might have been that the unusual morphologies were not uniquely associated with the subject fungus but were the result of particular site factors that could have affected other mycorrhizal types.  In other words, a fungus or fungi that normally form a more determinate growth form may have been induced rms as y y ery communication March 13, 2008).  It was beyond the scope of this work to separate site  into an indeterminate growth form by site characteristics found in this study area. This possibility is contrary to the concept that a particular fungus and host combination fo a distinct morphological type.  In addition, this study did look at mycorrhizae from a wide range of BEC zones.  All of the sites in the range did have some features in common, such coarse textured soil, but the site factors would not have been considered the same across the study area.  Some other types of mycorrhizae growing on the sampling sites are known to have morphologies similar to T. magnivelare.  However, these mycorrhizae are closel related to T. magnivelare and could be exhibiting  similar life strategies. Furthermore, a stud done in the West Chilcotin by the British Columbia Ministry of Forests and Range in 2007 collected thirty P. contorta root samples from potential T. magnivelare sites and found v few morphologies similar to those observed in this study (B. Chapman, personal  97 effects from physiological effects but wide ranging observations of this symbiosis suggests that the morphological presentation found here is the norm, and that there is no type of site where some other morphotype predominates.  It would have taken a very large study indeed to try to determine if site induced indeterminate behavior in any other mycorrhizae and it would have been impossible to prove that it did not.   Future research efforts should seek to clarify the functional aspects of this relationship, e.g., why is there such a large amount of necrotic cortical tissue?  Though this work lacked methods to determine if other fungi were present in the roots this is an important assessment that needs to be addressed in future investigations.  A restriction fragment length polymorphism (RFLP) approach would help to establish if the observed root morphologies might in part be due to the presence of another unidentified fungus or if in fact T. magnivelare is the only species present.  Work was conducted to identify RFLP digestion sites unique to T. magnivelare (Bravi 2008) though the analysis was largely inconclusive, all morphotypes demonstrated banding patterns consistent with T. magnivelare banding pa This is particularly important as the analysis was conducted using a novel approach in whic roots were embedded in wax and half of the tip was hand sectioned for microscopic investigation while the other half of the tip was used in the molecular analysis.  This appears to be the first time an approach like this was used and though the technique needs refin it provides a method for conducting microscopic and molecular assessments on t root.  Therefore, inferences need not be made between different sample sets. tterns. h ement he same The development of molecular probes would be useful in identifying precisely where in the host root T. magnivelare is present and would provide information about the identity of  98 the fungal material observed invading the host cortical tissue i.e., is it T. magnivelare or another fungal species?  This would be a useful exercise to ensure that the Hartig net features observed in this work were in fact formed by T. magnivelare.  Currently, it can only be said that T. magnivelare is associated with the roots that have Hartig net.  The use of gene modeling could provide insight into the nature of the symbiosis and may assist in clarifying the causal agent of the indeterminate root growth observed in the T. magnivelare\/P. contorta symbiosis. T. magnivelare is undoubtedly an interesting and important species both socially and biologically.  The relationship it forms with its host P. contorta provides many avenues for investigation.  It certainly brings to light the complexities of species interactions and demonstrates our naivety when trying to fit our descriptions of these relationships into classification schemes. How nature loves the incomplete. If she drew a conclusion it would  She knows finish her. Christopher Fry      99 References Agerer, R. (1987-2002).  Colour Atlas of Ectomycorrhizae.  Schwabisch-Gmund,  matsutake and close allies inferred by analysis of ITS sequences and AFLPs.  Einhorn-Verlag. Chapela, I.H., & Garbelotto, M. (2004).  Phylogeography and evolution of in Mycologia, 96(4), 730-741. http:\/\/www.mycologia.org\/ Deacon, J.W. (1996)  Ecological implications of recognition events in the pre-infection stages of root pathogens. New Phytologist, 133(1), 135-175. Retrieved from http:\/\/www3.interscience.wiley.com Goodman, D.M., Durall, D.M., Trofymow, J.A., & Berch, S.M. (Eds.). (1997). Concise Publications and Forest Resource Development Agreement, Canadian Forest Service.  Phytologist,149(3), 357-359. Hosford, D., Pilz, D., Molina, R., & Amaranthus, M. (1997).  Ecology and echnical Report. Portland, Oregon: U.S Department of Agriculture, Forest Service, Pacific  associations along the mutualism-parasitism continuum.  New Phytologist, 135(4),  mycorrhizas always mutualisms? Canadian Journal of Botany, 82(8), 1089-1109.  through ethylene to regulate dichotomous branching of lateral root meristems in pine.  D.M. Goodman, D.M. Durall, J.A. Trofymow, & S.M. Berch. Concise Descriptions ations, and Canada-B.C. Forest Resource Development Agreement, Canadian Forest Service. Retrieved from http:\/\/www.pfc.cfs.nrcan.gc.ca  Ogawa, M. (1974) Ecology of Tricholoma matsutake (Ito et Imai) Sing., mycorrhizal  descriptions of North American ectomycorrhizae. Victoria, B.C.: Mycologue Retrieved from http:\/\/www.pfc.cfs.nrcan.gc.ca\/biodiversity\/bcern\/index_e.html Graham, J.H. (2001). What do root pathogens see in mycorrhizas? New  management of the commercially harvested American matsutake, General T Northwest Research Station. Johnson, N.C., Graham, J.H., & Smith F.A. (1997).  Functioning of mycorrhizal 575-585. Jones, M. D., & Smith, S.E. (2004).  Exploring functional definitions of mycorrhizas: Are Retrieved from http:\/\/article.pubs.nrc-cnrc.gc.ca Kaska, D.D., Myllyla, R., & Cooper, J.B. (1999). Auxin transport inhibitors act New Phytologist, 142(1), 49-57. Retrieved from http:\/\/www3.interscience.wiley.com Lefevre, C., & Muller, W. (1998). Tricholoma magnivelare (Peck) Redhead. CDE18. In of North American Ectomycorrhizae.  Victoria, B.C.: Mycologue Public fungus, in pine forest. Mushroom Science IX. Part 1. pp. 733-745.  100  species IX: Tricholoma ponderosum in Pseudotsuga menziesii \u2013 Tsuga heterophylla 391-405. Trigiano, R.N., Windham, M.T., & Windham, A.S. (Eds.) (2004). Plant pathology: co  fruiting bodies: 1. Tricholoma matsutake and related fungi.  Economic Botany, 51(3),  Ogawa, M. (1979).  Microbial ecology of \u2018Shiro\u2019 in Tricholoma matsutake and its allied and Pinus contorta forests.  Transactions of the Mycological Society of Japan 19, ncepts and laboratory exercises.  London: CRS Press. Wang, Y., Hall, I.R., & Evans, L.A. (1997). Ectomycorrhizal fungi with edible 311-327. Retrieved from http:\/\/www.springerlink.com Wills, R. M., & Lipsey, R. G. (1999).  An economic strategy to develop non- timber forest products and services in British Columbia. Final Report. Forest bia. Retrieved from http:\/\/www.sfp.forprod.vt.edu\/pubs\/  Renewal British Colum ntfp_bc.pdf    101  Appendix 1 - Microscopic analysis of Ectomycorrhiz 102   Fr ra  i l l l g al Features. choom:  B vi, R. (2008). A morpholog cal and mo ecular ana ysis of Tri oma ma nivelare a ia, V sso anc c  r ic L li u U r ol o  Tip R iated h uver. ost oots using m roscopy and RF P. Unpub shed grad ate essay, niversity of B itish C umb ef. # Tip Type Mantle Hartig Net Cortical Cells Other Features 1 nt imite a main nd in p. cal or e Matchstick 1 Not prese L re d an  thin d we . k.  Cell walls Bla apic ck a al ti  coll  apsing beh d the Api  tip has an ange ting 2 nt imite a main nd in p. cal orang e Matchstick 2 Not prese L re d an  thin d we . k.  Cell walls Bla apic ck a al ti  coll  apsing beh d the Api  tip has an e ting 3 nt imite a icke o nly a ell la nd in p. ca vely ated. Matchstick 3 Not prese L th O c d an ning ppea yer. d we of s rs in k.  Limited me cell wall outer cortica s. l Bla apic ck a al ti  coll  apsing beh d the Api l tip extensi elong 4 nt ot pr Bl nd in ca v  A hy m  an g al ar Matchstick 4  Not prese N esent ack a apical tip.  collapsing beh d the Api fles oran l tip ext  white ti e tinged ensi p e  apic ely elongated. erging from ea. 9 nt ot Pr Bl nd ind th ap p ele. oMatchstick 5 Not prese N esent ack a ical ti  coll and apsing up to th beh e st e Limited apical extensi n. 10 nt estig  visi Bl nd ind t y area al wt rity o  root is k Matchstick 6 Not prese V es of HN ble. ack a apical tip.  collapsing beh he Ver gro blac small, sh h.  The . ort majo of apic f the 19 M nt eak  tip. Bl d ind th y area al wt  exte om atchstick 7 Not prese W at apical ack an apical tip.  collapsing beh e Ver gro oran small, sh h. White ge apex. ort  tip of apic nds fr 22 M nt imite es of Bl d ind t ical tip v   atchstick 8 Not prese L d vestig HN visible. ack an apical tip.  collapsing beh he Ap  extensi ely elongated. 28 M nt ery loped alls t .  Ex nd cor  laye Bl d ind th apical tip. atchstick 9 Not prese V w 2 well d hick tical eve ened  cell .  Cell tends in r. to ack an  collapsing beh e 29 M nt ell d d. Black and ind t apical tip. s fille th hyph laces. e sho ood tran of ical c llapse. atchstick 10 Not prese W evelope  collapsing beh he Cell Slid cort d wi ws g ell co ae in p sition 5 Fl esent ery eveloped alls t ned.  Ex o nd cortical cell layer. ong short root. No cortical cell collapse al.  Cell tends int well d hicke V w 2 Not preshy Tip 1 103 Tip Ref. # Tip Type Mantle Hartig Net Co l Cells rtica Other Features 6 Fleshy Tip 2 Not present Very well developed.  Cell walls thickened.  Extends into 2nd cortical cell layer. No cortical cell collapse along short root.  7 Fleshy Tip 3 Not present Moderately well developed. Weaker development in the inner cortical cell layer. short root No cortical cell collapse al . ong 8 Fleshy Tip 4 Not present Very well developed.  HN extends toward stele as does the thickening of the cells. short root. No cortical cell collapse along 11 Fleshy Tip 5 Not present Extensive HN.  Large fat hyphae appear to be growing through the cells.  si endo . Pos bly an ect -mycorrhiza 16 Fleshy Tip 6 Not present Limited appearance visible. Hyphae prese l and cortical c beginning th uc is still visible nt in co ollapse ough cel . rtica is l str cells ture  20 Fleshy Tip 7 Thin mantle present. Extensive HN extends to stele. short root. ti nt. No cortical cell collapse along Cys dia prese 24 Fleshy Tip 8 Thin mantle present. Moderate to weak HN. 25 Fleshy Tip 9 Not present Vestiges of HN present. Hyphae prese l and cortical c beginning th uc is still visible to s cells ha  nt in co ollapse ough cel . rtica is l str cells ture Pho hyp  4 sh e. ow filled with 26 Fleshy Tip 10 Thin mantle present. Extensive HN extends to steele.  No cortical c exten y elon kenin d coll ex inning ell collapse Tip blac beg sivel g an . gated. apse of Root cort 12 Fluffy Tip 1 Psuedo mantle\/ cottony association Some vestiges of HN may be present.  hyph sent cal of agni e. Fat T. m ae pre velar that is atypi 13 Fluffy Tip 2 Psuedo mantle\/ cottony association Not present Cortical cell Blackening o apparent und ttony association. hae a esent  and e ma  bee me nt. collapse f cortex er the co . is Hyp ther poi re pr y have  everyw n a HN here at so 14 Fluffy Tip 3 Psuedo mantle\/ cottony association, another mantle present beneath Well developed HN.    Clamp co tion phae manatin m the visible o mantle. n hy  nnec g froe  104 Tip Ref. # Tip Type Mantle Hartig Net Cortical Cells Other Features 15 cottony association rtical cells are collapsed and full of hyphae. Semi blackened tip beneath the cottony association. Fluffy Tip 4 Psuedo mantle\/ Vestiges of HN are present Co 17 Fluffy Tip 5 Psuedo mantle\/ Weak HN in outer cortical cells No cortical cell collapse cottony association apparent 18 neath the cottony association. Fluffy Tip 6 Psuedo mantle\/ cottony association Extensive HN. Cortical cell collapse is beginning Fleshy Tip is present be 21 Fluffy Tip 7 mantle\/ ciation N with fat hyphae  collapse  with hyphae eads Psuedo cottony asso Extensive H between the cortical cells. No cortical cell apparent Fleshy tip below emanating from the tip like thr of cotton candy. 23 le\/ ation ath Fluffy Tip 8 Psuedo mant cottony associ Not present Cortical cell collapse. Blackening of cortical cells is apparent below the cottony association. Matchstick Tip is present bene the cottony association. 27 Fluffy Tip 9 Psuedo mantle\/ cottony association, semi mantle present No cortical cell collapse along root but beginning at the node of the short and secondary root Fat hyphae are present running parallel to form the beginnings of a mantle. beneath Extensive HN present system.     ","attrs":{"lang":"en","ns":"http:\/\/www.w3.org\/2009\/08\/skos-reference\/skos.html#note","classmap":"oc:AnnotationContainer"},"iri":"http:\/\/www.w3.org\/2009\/08\/skos-reference\/skos.html#note","explain":"Simple Knowledge Organisation System; Notes are used to provide information relating to SKOS concepts. There is no restriction on the nature of this information, e.g., it could be plain text, hypertext, or an image; it could be a definition, information about the scope of a concept, editorial information, or any other type of information."}],"Genre":[{"label":"Genre","value":"Thesis\/Dissertation","attrs":{"lang":"en","ns":"http:\/\/www.europeana.eu\/schemas\/edm\/hasType","classmap":"dpla:SourceResource","property":"edm:hasType"},"iri":"http:\/\/www.europeana.eu\/schemas\/edm\/hasType","explain":"A Europeana Data Model Property; This property relates a resource with the concepts it belongs to in a suitable type system such as MIME or any thesaurus that captures categories of objects in a given field. It does NOT capture aboutness"}],"GraduationDate":[{"label":"Graduation Date","value":"2009-05","attrs":{"lang":"en","ns":"http:\/\/vivoweb.org\/ontology\/core#dateIssued","classmap":"vivo:DateTimeValue","property":"vivo:dateIssued"},"iri":"http:\/\/vivoweb.org\/ontology\/core#dateIssued","explain":"VIVO-ISF Ontology V1.6 Property; Date Optional Time Value, DateTime+Timezone Preferred "}],"IsShownAt":[{"label":"DOI","value":"10.14288\/1.0067065","attrs":{"lang":"en","ns":"http:\/\/www.europeana.eu\/schemas\/edm\/isShownAt","classmap":"edm:WebResource","property":"edm:isShownAt"},"iri":"http:\/\/www.europeana.eu\/schemas\/edm\/isShownAt","explain":"A Europeana Data Model Property; An unambiguous URL reference to the digital object on the provider\u2019s website in its full information context."}],"Language":[{"label":"Language","value":"eng","attrs":{"lang":"en","ns":"http:\/\/purl.org\/dc\/terms\/language","classmap":"dpla:SourceResource","property":"dcterms:language"},"iri":"http:\/\/purl.org\/dc\/terms\/language","explain":"A Dublin Core Terms Property; A language of the resource.; Recommended best practice is to use a controlled vocabulary such as RFC 4646 [RFC4646]."}],"Program":[{"label":"Program (Theses)","value":"Forestry","attrs":{"lang":"en","ns":"https:\/\/open.library.ubc.ca\/terms#degreeDiscipline","classmap":"oc:ThesisDescription","property":"oc:degreeDiscipline"},"iri":"https:\/\/open.library.ubc.ca\/terms#degreeDiscipline","explain":"UBC Open Collections Metadata Components; Local Field; Indicates the program for which the degree was granted."}],"Provider":[{"label":"Provider","value":"Vancouver : University of British Columbia Library","attrs":{"lang":"en","ns":"http:\/\/www.europeana.eu\/schemas\/edm\/provider","classmap":"ore:Aggregation","property":"edm:provider"},"iri":"http:\/\/www.europeana.eu\/schemas\/edm\/provider","explain":"A Europeana Data Model Property; The name or identifier of the organization who delivers data directly to an aggregation service (e.g. Europeana)"}],"Publisher":[{"label":"Publisher","value":"University of British Columbia","attrs":{"lang":"en","ns":"http:\/\/purl.org\/dc\/terms\/publisher","classmap":"dpla:SourceResource","property":"dcterms:publisher"},"iri":"http:\/\/purl.org\/dc\/terms\/publisher","explain":"A Dublin Core Terms Property; An entity responsible for making the resource available.; Examples of a Publisher include a person, an organization, or a service."}],"Rights":[{"label":"Rights","value":"Attribution-NonCommercial-NoDerivatives 4.0 International","attrs":{"lang":"en","ns":"http:\/\/purl.org\/dc\/terms\/rights","classmap":"edm:WebResource","property":"dcterms:rights"},"iri":"http:\/\/purl.org\/dc\/terms\/rights","explain":"A Dublin Core Terms Property; Information about rights held in and over the resource.; Typically, rights information includes a statement about various property rights associated with the resource, including intellectual property rights."}],"RightsURI":[{"label":"Rights URI","value":"http:\/\/creativecommons.org\/licenses\/by-nc-nd\/4.0\/","attrs":{"lang":"en","ns":"https:\/\/open.library.ubc.ca\/terms#rightsURI","classmap":"oc:PublicationDescription","property":"oc:rightsURI"},"iri":"https:\/\/open.library.ubc.ca\/terms#rightsURI","explain":"UBC Open Collections Metadata Components; Local Field; Indicates the Creative Commons license url."}],"ScholarlyLevel":[{"label":"Scholarly Level","value":"Graduate","attrs":{"lang":"en","ns":"https:\/\/open.library.ubc.ca\/terms#scholarLevel","classmap":"oc:PublicationDescription","property":"oc:scholarLevel"},"iri":"https:\/\/open.library.ubc.ca\/terms#scholarLevel","explain":"UBC Open Collections Metadata Components; Local Field; Identifies the scholarly level of the author(s)\/creator(s)."}],"Title":[{"label":"Title ","value":"An ectomycorrhizal symbiosis? a morphological and molecular characterization of Tricholoma magnivelare in Pinus contorta roots from the West Chilcotin Plateau of British Columbia, Canada","attrs":{"lang":"en","ns":"http:\/\/purl.org\/dc\/terms\/title","classmap":"dpla:SourceResource","property":"dcterms:title"},"iri":"http:\/\/purl.org\/dc\/terms\/title","explain":"A Dublin Core Terms Property; The name given to the resource."}],"Type":[{"label":"Type","value":"Text","attrs":{"lang":"en","ns":"http:\/\/purl.org\/dc\/terms\/type","classmap":"dpla:SourceResource","property":"dcterms:type"},"iri":"http:\/\/purl.org\/dc\/terms\/type","explain":"A Dublin Core Terms Property; The nature or genre of the resource.; Recommended best practice is to use a controlled vocabulary such as the DCMI Type Vocabulary [DCMITYPE]. To describe the file format, physical medium, or dimensions of the resource, use the Format element."}],"URI":[{"label":"URI","value":"http:\/\/hdl.handle.net\/2429\/5954","attrs":{"lang":"en","ns":"https:\/\/open.library.ubc.ca\/terms#identifierURI","classmap":"oc:PublicationDescription","property":"oc:identifierURI"},"iri":"https:\/\/open.library.ubc.ca\/terms#identifierURI","explain":"UBC Open Collections Metadata Components; Local Field; Indicates the handle for item record."}],"SortDate":[{"label":"Sort Date","value":"2009-12-31 AD","attrs":{"lang":"en","ns":"http:\/\/purl.org\/dc\/terms\/date","classmap":"oc:InternalResource","property":"dcterms:date"},"iri":"http:\/\/purl.org\/dc\/terms\/date","explain":"A Dublin Core Elements Property; A point or period of time associated with an event in the lifecycle of the resource.; Date may be used to express temporal information at any level of granularity. Recommended best practice is to use an encoding scheme, such as the W3CDTF profile of ISO 8601 [W3CDTF].; A point or period of time associated with an event in the lifecycle of the resource.; Date may be used to express temporal information at any level of granularity. Recommended best practice is to use an encoding scheme, such as the W3CDTF profile of ISO 8601 [W3CDTF]."}]}