CHARACTERIZATION OF A NUCLEOTIDE BINDING DOMAIN ASSOCIATED WITH NEISSERIAL IRON TRANSPORT by GLORIA HIU Y A N L A U B.Sc, The University of British Columbia, 1998 A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER.. OF SCIENCE in THE F A C U L T Y OF G R A D U A T E STUDIES Department of Biochemistry and Molecular Biology We accept this thesis as conforming to the required standard THE UNIVERSITY OF BRITISH C O L U M B I A April 2001 © Gloria HiuYan Lau, 2001 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department of 77 The University of British Columbia Vancouver, Canada DE-6 (2/88) A B S T R A C T The ability for the pathogen Neisseria gonorrhoeae to sequester iron from sources such as transferrin from the human host plays an important role in initiating infection. The Neisseria! fbpABC operon encodes an A B C (ATP binding cassette) transporter proposed to function in transporting iron at the periplasm-to-cytosol level. The highly conserved ATP binding domain of these transporters typically utilizes the energy of ATP hydrolysis to pump substrates across the membrane against a concentration gradient. The goal of my project is to show that FbpC functions as a nucleotide binding domain for this iron transport system. First, the N. gonorrhoeae fbpC gene was successfully amplified and cloned into the pET28a expression vector. The resulting fusion protein (FbpC(hiS6)) of approximately 40kDa was overexpressed in Escherichia coli HMS174(DE3) cells and purified to near homogeneity by nickel-chelate affinity followed by anion-exchange chromatography. Isolated FbpC(hiS6) has intrinsic ATPase activity uncoupled from the iron transport process and displays a specific activity of approximately 0.5 pmol/min/mg, similar to that determined for the distantly related nucleotide binding domains HisP and MalK in their purified forms. An FbpC mutant, E164D, designed to be defective in ATP hydrolysis was produced, purified, and found to contain a ten-fold reduction in specific activity as compared to the wild-type. Purified FbpC(hjS6) was also covalently modified by 8-azido-[y32P]ATP, and this interaction was shown to be specific by preincubation of reactions with unlabeled ATP. In conclusion, FbpC is a functional nucleotide binding domain capable of powering the iron transporter. ii TABLE OF CONTENTS ABSTRACT ii LIST OF FIGURES vi LIST OF TABLES vii LIST OF ABBREVIATIONS viii ACKNOWLEDGMENTS xi 1. INTRODUCTION 1 1.1 Importance of iron in microorganisms 1 1.2 Sources of iron for different pathogenic bacteria 2 1.3 Pathogenic Neisseria 4 1.4 Receptor-mediated iron acquisition in Neisseria gonorrhoeae 5 1.4.1 Extracellular-to-periplasm 7 1.4.2 Periplasm-to-cytosol 8 1.5 Studies on homologous transport systems : 10 1.6 A B C transporters: general characteristics, functions and examples 11 1.6.1 Prokaryotic members 13 1.6.2 Eukaryotic members '. 13 1.7 A B C transporters: components 14 1.7.1 Integral membrane components 16 1.7.2 The ATP-hydrolyzing subunits 17 iii 1.8 FbpC and Neisserial iron transport 20 1.9 Objective of the present study 22 2. M A T E R I A L S A N D M E T H O D S 23 2.1 Materials 23 2.1.1 Chemical supplies and media 23 2.1.2 Bacterial strains and plasmids 23 2.2 Methods 24 2.2.1 PCR amplification of the fbpC gene 24 2.2.2 Cloning and D N A sequence analysis of the fbpC gene 26 2.2.3 Site directed mutagenesis 28 2.2.4 Overexpression of FbpC 31 2.2.5 Purification of FbpC 31 2.2.6 Protein characterization 33 2.2.7 ATPase activity assay 34 2.2.8 Photoaffinity labeling with [y- 3 2P]N 3ATP 35 3. R E S U L T S 36 3.1 Cloning and construction of FbpC(hiS6) expression vector 36 3.2 Overexpression and Purification of FbpC(hiS6) 38 3.3 Properties of FbpC(h;S6) 41 3.4 ATPase activity of FbpC ( h, s 6) 42 3.5 Site-directed mutagenesis and properties of the E164D mutant 44 3.6 Binding of [y- 3 2P]N 3ATP to purified FbpC (hi s 6) 46 4. D I S C U S S I O N 48 iv 4.1 Cloning and sequence analysis offbpC 48 4.2 Production and purification of FbpC(hiS6) and the El64D mutant 51 4.3 Nucleotide binding and ATP hydrolyzing activity of FbpC(hiS6) 54 4.4 Conclusion 55 4.5 Future directions 56 5. B I B L I O G R A P H Y 57 v L I S T O F F I G U R E S 1. Schematic diagram of receptor-mediated iron uptake in Neisseria 6 2. Schematic diagram of the Fe(III) periplasm-to-cytosol iron transporter encoded by the fbpABC operon 9 3. Different domain organizations of A B C transporters 15 4. Linear representation of a prototype A B C domain 18 5. Proposed model for ATP hydrolysis in HisQMP2 system 20 6. Schematic illustration of PCR-based site directed mutagenesis 30 7. D N A sequence alignment offbpC 37 8. Expression profile of FbpC(hiS6) 38 9. Purification of FbpC(his6) 40 10. Properties of the ATPase activity of FbpC(his6) 43 11. Purification of E164D FbpC ( h i S6) 45 12. An autoradiogram showing binding of 8-azido-[y-32P]-ATP to FbpC(hiS6) 47 13. Amino acid sequence comparison of FbpC sequences with HitC and SfuC 49 14. Comparison of FbpC amino acid sequence with HisP and MalK 50 vi L I S T O F T A B L E S 1. Enhancement of virulence or lethality of different pathogens in animal models by the addition of exogenous iron 2 2. List of Fe(III) periplasm-to-cytosol transporters 11 3. List of bacterial strains and plasmids used in the study 24 4. List of primers used in construction of vectors and sequencing 26 5. Primers designed for the construction of E164D FbpC mutant 29 vii L I S T O F A B B R E V I A T I O N S A B C ATP-binding cassette ATP Adenosine 5' triphosphate bp Base pair(s) CAPS (3 - [Cyclohexylamino] -1 -propanesulfonic acid) CBR Coomassie Blue R CFTR Cystic fibrosis transmembrane conductance regulator CHES 2- [N-Cyclohexylamino] ethane-sulfonic acid C-terminal Carboxyl terminal Da Dalton D N A Deoxyribonucleic acid dNTP Deoxyribonucleotide triphosphate DTT dithiothreitol EDTA Ethylenediamine tetraacetic acid Fbp Ferric binding protein FPLC Fast Protein Liquid Chromatography Hb Hemoglobin Hp-Hb Haptoglobin-hemoglobin IM Inner membrane IPTG Isopropyl-R-D-Thiogalactopyranoside kDa Kilodaltons Vll l K s o i Solubility equilibrium constant L B Luria-Bertani (media) Lbp Lactoferrin binding protein L f Lactoferrin MES (2-[N-Morpholino]ethanesulfonic acid} MOPSNa (3-[N-Morpholino]propanesulfonic acid), sodium salt N.A.P.S. Unit Nucleic-Acid and Protein Service Unit N 3 - A T P Azido-adenosine triphosphate N B D Nucleotide binding domain Ni -NTA Nickel-nitrilo-triacetic acid N-terminal Amino-terrninal NTHI Non-typeable Haemophilus influenzae O.D. Optical density O M Outer membrane ORF Open reading frame P A G E Polyacrylamide gel electrophoresis PCR Polymerase chain reaction Pi Inorganic phosphate rpm Revolutions per minute SDS Sodium dodecyl sulfate Taq Thermus aquaticus Tbp Transferrin binding protein Tf Transferrin ix T M Transmembrane Tris Tris(hydroxymethyl)aminomethane U V Utraviolet v/v Volume-to-volume ratio w/v Weight-to-volume ratio x ACKNOWLEDGMENTS There are many special individuals to whom I must express my deepest appreciation - I cannot imagine what my graduate studies would have been like without you all as the guiding light. I would like to thank my research supervisor Dr. Michael E.P. Murphy for his helpful discussion and guidance throughout the project as well as his endless patience in training me as a scientist. Thank you Michael! I would also like to express my gratitude toward Dr. Ross MacGillivray for his stimulating discussions regarding my project and his constant encouragement. I thank Dr. Bob Molday, the other member of my committee, for reviewing the thesis and giving me invaluable advice and suggestions along the way. In addition, I am especially grateful to Marty Boulanger who has provided me with so many remarkable suggestions in my project and who has carefully reviewed much of the thesis. You have demonstrated for me what an amazing graduate student is like! Moreover, I want to thank all present and past members of the Murphy and MacGillivray labs. I thank Dr. Michael Gold and his lab members for help with the photoaffinity labeling experiment, David Chan and the BC Center for Disease Control for supplying the clinical strain of N. gonorrhoeae. I also recognize National Science and Engineering Research Council (NSERC) for financial support. Finally I would like to express my deepest gratitude to my parents who have faithfully loved, taught, supported, and encouraged me. I owe you so much more than a mere "thank you!" xi 1. INTRODUCTION 1.1 Importance of iron in microorganisms Iron is an essential nutrient for most microorganisms, including pathogenic bacteria. It is an integral part of many metabolic enzymes and participates in a number of key metabolic functions such as cell respiration and D N A synthesis. Examples of important proteins that contain iron include electron-transfer proteins such as cytochromes and iron-sulfur proteins, as well as hydroperoxidases, ribonucleotide reductases and iron-activated enzymes. The ability of iron to exist in aqueous solution as Fe (II) or Fe (III), or as inorganic or organic ferrous or ferric complexes also makes it an important cofactor for a variety of biochemical reactions. Even though iron is the fourth most abundant in the earth's crust, its extremely low solubility (K s o , Fe (OH) 3 ~ 10"38) (Neilands et al., 1987) under physiological conditions, especially around neutral pH in aqueous solution, makes iron limiting in the living environment of many microorganisms. The concentration of free, uncomplexed Fe (III) in aqueous solution is less than 10"17 M ; this presents a challenge for the survival of microorganisms. Iron deprivation leads to reduced growth rates in many bacteria (Archibald and DeVoe, 1978), important morphological changes and alterations in the compositions of proteins that contain iron or whose syntheses are regulated by iron (Criado et al., 1993). Early studies by Schade and Caroline (1946) established the bacteriostatic property of serum in Shigella dysenteriae that can be reversed by the addition of iron (Schade and 1 Caroline, 1944; Schade and Caroline, 1946). Other investigators have also demonstrated the importance of iron availability in microbial infection (Payne and Lawlor, 1990). Iron enhanced lethality of N. meningitidis and N. gonorrhoeae has been demonstrated in mice and chicken embryos, respectively (Holbein, 1980; Holbein, 1981; Payne and Finkelstein, 1975). Table 1 shows enhancement of virulence or lethality of different pathogens in animal models by the addition of exogenous iron. Table 1. Enhancement of virulence or lethality of different pathogens in animal models by the addition of exogenous iron (Payne and Lawlor, 1990). Pathogen Animal Model Bacillus anthracis Mouse Campylobacter jejuni 11 -Day chick embryo Clostridium perfringens Guinea pig Escherichia coli Guinea pig Klebsiella pneumoniae Rat, mouse Listeria monocytogenes Mouse Mycobacterium tuberculosis Mouse Neisseria gonorrhoeae 11 -Day chick embryo Neisseria meningitidis Mouse Pasteurella multocida Guinea pig Pseudomonas aeruginosa Rabbit Salmonella typhimurium Mouse Staphylococcus aureus Mouse Vibrio cholerae Mouse Vibrio vulnificus Mouse Yersinia enterocolitica Mouse Yersinia pestis Mouse 1.2 Sources of iron for different pathogenic bacteria In the infection process, pathogenic bacteria must be able to acquire sufficient iron from the environment to establish colonies in the host. Depending on where they grow in the host, different pathogens have developed a variety of strategies to obtain the 2 required iron and transport it into the cytoplasm (Payne, 1993; Payne and Lawlor, 1990; Schryvers and Stojiljkovic, 1999). Many bacteria produce and secrete small molecular-weight siderophores to their extracellular environment to satisfy their iron requirement (Neilands, 1995; Neilands et al., 1987; Payne and Lawlor, 1990). Siderophores are small molecule (500 - 1000 Da), nonproteinaceous organic Fe (III) chelators secreted by many bacteria, including Escherichia coli, Salmonella, Shigella and Vibrio Species (Neilands et al., 1987). These ferric carriers have very high affinity for ferric iron and are usually categorized based on their ligands as either hydroxamate or catechol siderophores. These siderophores, together with their corresponding receptors on the microbial surface, enable transport of iron into the cell (Neilands, 1982). Iron acquisition with the use of siderophores has the advantage that specific sources of iron are not restricted, thereby allowing microorganisms to grow in a variety of hosts and environments (Mietzner et al., 1998). E. coli, for example, has developed multiple siderophore-driven systems that reflect the physiological flexibility to use different iron sources in different environments. The disadvantage of siderophore-mediated iron transport is the high energy cost of continually synthesizing new apo-siderophores and maintaining specific uptake components (Mietzner et al., 1998). Therefore, some other bacteria, especially those that have a narrow host range, possess special transport systems to mobilize and take up iron directly from the host environment (Cornelissen et al., 1993; Cornelissen and Sparling, 1994; Criado et al., 1993; Schryvers et al., 1998). A representative example is the Neisseria spp. These 3 bacteria express specific surface receptor proteins that interact with a variety of iron-containing proteins and compounds, including extracellular host iron-binding proteins such as transferrin and lactoferrin, and heme-containing proteins such as haemoglobin (Hb) and haptoglobin-hemoglobin (Hp-Hb) (Genco and Desai, 1996; Gray-Owen and Schryvers, 1996). Receptor-mediated iron acquisition in Neisseria will be discussed further in Section 1.4. 1.3 Pathogenic Neisseria The two most clinically significant species of the genus Neisseria are N. gonorrhoeae and N. meningitidis, which cause the diseases gonorrhea and meningitis (inflammation of the membranes covering the central nervous system), respectively. Both microorganisms are non-spore-forming, non-motile Gram-negative diplococci which inhabit human mucosal surfaces (Genco and Desai, 1996). In this study, only N. gonorrhoeae was used, and will be discussed in detail below. N. gonorrhoeae strains infect the mucosal surfaces of urogenital sites and the oro-and nasopharynx, causing symptomatic or asymptomatic infection. Despite the availability of excellent treatment, gonorrhea is one of the most widespread human infectious diseases in the United States and worldwide (Brock et al., 1994). This prevalence of infections could be attributed to several factors, including the lack of acquired immunity, widespread use of oral contraceptives, and the frequent occurrence of subclinical infections (Brock et a l , 1994). The increase in antibiotic resistance of N. 4 gonorrhoeae (Gorwitz et al., 1993; Lind, 1997) further raised concern and interest to study the pathogenesis of this bacterium. 1.4 Receptor-mediated iron acquisition in Neisseria gonorrhoeae The ability for the pathogen N. gonorrhoeae to sequester its iron requirement from the human host plays an important role in establishing infection and causing disease. Within the mucosal surfaces that N. gonorrhoeae inhabit, the majority of iron is bound to lactoferrin (Genco and Desai, 1996); hemin is also present at mucosal sites as a result of the desquamation of epithelial cells. Unlike many bacteria, N. gonorrhoeae does not produce siderophores; however, the ability to use some siderophores has been observed (Finkelstein and Yancey, 1981; Yancey and Finkelstein, 1981a; Yancey and Finkelstein, 1981b). Instead, the gonococci express on their outer membrane surface an array of receptors that interact specifically with human iron-binding proteins such as lactoferrin (Mickelsen et al., 1982), transferrin (McKenna et al., 1988), hemoglobin (Archibald and DeVoe, 1980) and hemin (Mickelsen and Sparling, 1981; Yancey and Finkelstein, 1981a). Cornelissen et. al. (1992) identified and isolated two iron-repressible gonococcal transferrin receptors, Tbpl and Tbp2, both shown to be homologous to the TonB dependent class of outer membrane receptors in gram-negative bacteria (Cornelissen et al., 1992). Homologous receptors were then found to bind to lactoferrin (Pettersson et al., 1994), hemoglobin (Stojiljkovic et al., 1995), and haptoglobin-hemoglobin complex (Stojiljkovic et al., 1996) for the closely related N. meningitidis. In addition, several open 5 reading frames that share homology with siderophore receptors have been revealed recently (Beucher and Sparling, 1995; Carson et al., 1999; Klee et al., 2000), suggesting that Neisseria can also utilize exogenous siderophores provided by neighboring microbes. These receptor-mediated iron uptake systems typically function in a two-stage process, first removing iron from the host iron-binding proteins into the periplasm, then transporting the metal into the cytoplasm (Figure 1). In the case of siderophore-mediated iron transport, the whole siderophore is taken up into the cell via a similar mechanism (Schryvers and Stojiljkovic, 1999). The transferrin-mediated iron transport process is discussed below. Host Iron Proteins Figure 1. Schematic diagram of receptor-mediated iron uptake in Neisseria. Tbpl and Lbp are shown as outer membrane (OM) proteins and initiate the first step of iron uptake by binding to the host iron proteins, transferrin (Tf) and lactoferrin (Lf). The second stage of transferrin-mediated iron-uptake involves the transfer of iron from the periplasmic binding protein (FbpA) into the inside of the cell via a membrane bound permease (FbpB). See text for detailed description. Adapted from (Cornelissen and Sparling, 1994). 6 1.4.1 Extracellular-to-periplasm The outer membrane receptor consists of two transferrin binding proteins, Tbpl and Tbp2, of which Tbpl is essential for growth of gonococci on transferrin in vitro (Cornelissen et al., 1992). Once bound to the receptors, iron is removed from transferrin in an energy-dependent process and transferred to a periplasmic protein, FbpA (Fbp, for ferric binding protein). Energy required for this transport process is proposed to be transferred from the cytoplasm to the outer membrane receptor via a TonB-dependent process (Cornelissen et al., 1997; Gray-Owen and Schryvers, 1996). FbpA is a 34 kDa protein, the first soluble component identified from the Neisseria iron uptake system (Mietzner et al., 1986; Mietzner et al., 1984). It is iron regulated by the fur locus (Berish et al., 1993; Desai et al., 1996; Karkhoff-Schweizer et al., 1994; Thomas and Sparling, 1994) and is compartmentalized to the periplasmic space of the pathogen (Ames, 1986; Chen et al., 1993; Mietzner et al., 1987; Mietzner et al., 1984). Expressed by all strains of N. gonorrhoeae and N. meningitidis and highly conserved between species, FbpA functions as the periplasmic binding component of a high-affinity active transport system of iron from human transferrin and other non-heme iron carriers (Chen et al., 1993; Khun et al., 1998). The gene was cloned and the nucleotide sequence determined (Berish et al., 1990). Recombinant FbpA can be expressed in E. coli and purified in large quantities. FbpA binds reversibly a single molecule of ferric iron with a high affinity approaching that of transferrin (Chen et al., 1993; Crichton, 1990). Iron coordination of the homologous periplasmic iron binding protein, HitA, is through four protein ligands (from the side chains of two tyrosines, a 7 histidine and a glutamate) and a phosphate anion (Bruns et al., 1997). Pulse chase experiments demonstrate transient association of transferrin-bound iron with FbpA (Chen et al., 1993) and suggest that iron is deposited from transferrin to FbpA in the periplasmic space. 1.4.2 Periplasm-to-cytosol The second step of Neisserial iron acquisition, the metal transport from the periplasm across the cytoplasmic membrane, is of equal importance. Studies on other periplasmic transport systems (Adhikari et al., 1995; Angerer et al., 1990; Davidson and Nikaido, 1991; Kerppola et al., 1991) led to the generalization that three components are employed in these types of transporters involved in active transport of many growth-essential nutrients: 1) a periplasmic binding protein, that binds the substrate to be transported and thus initiates the periplasmic transport process; 2) a cytoplasmic permease, through which the substrate is transported across the membrane, and 3) a nucleotide binding domain, which provides the energy for the transport process through the hydrolysis of ATP. Adhikari et al. (1996) determined the nucleotide sequences of two open-reading frames (ORFs), termed fbpB and fbpC, downstream of the fbpA gene in Neisseria gonorrhoeae and proposed that these two ORFs correspond to genes for the cytoplasmic permease and nucleotide-binding domain respectively for the periplasmic transport of iron. Altogether \heJbpABC operon composes an iron transport system that functions at the periplasm-to-cytosol level (Figure 2). 8 Figure 2. Schematic diagram of the Fe(III) periplasm-to-cytosol iron transporter encoded by the fbpABC operon. The operon is iron-regulated by the fur locus. The first gene (a) encodes the periplasmic binding protein, FbpA, followed by a stem-loop structure preceding the permease-encoding gene,fbpB (b). The nucleotide binding domain is encoded by fbpC, the last gene in the operon (c). FbpB is a highly hydrophobic protein consisting of 511 amino acids, 62% of which are hydrophobic. FbpB has an estimated molecular weight of 56 kDa, and contains an E A A loop typical for cytoplasmic permeases in bacterial uptake systems. The toxicity from the expression of fbpABC operon to E. coli was found to be due to the expression of FbpB, even when only a partial gene product was produced (Adhikari et al., 1996). Because of these properties, little is known about this protein. FbpC, on the other hand, could be readily expressed ((Adhikari et al., 1996), this study). This proposed nucleotide binding domain (NBD), of 352 amino acids, contains 50.5% hydrophobic residues. It contains conserved motifs with other members of NBDs in A B C transporters, such as the Walker A, Walker B, and the helical and linker regions in between (Adhikari et a l , 1996). 9 The involvement of the fbpABC operon in periplasm-to-cytosol transport of iron has been demonstrated, as the addition of a plasmid containing the fbpABC operon can enable siderophore-deficient aroB E. coli strains to grow on nutrient agar containing an inhibitory concentration of 2,2'-dipyridyl, an iron chelator (Adhikari et al., 1996). However, the mechanism by which the three components of the transport system work together is yet to be described. 1.5 Studies on homologous transport systems Fe(III) periplasm-to-cytosol transporters are expressed by N. gonorrhoeae and N. meningitidis as well as other pathogens (Table 2). Two homologous iron transport systems are encoded by the hitABC operon in H. influenzae, the etiologic agent of otitis media and meningitis (Murphy and Apicella, 1987), and by the sfuABC operon in Serratia marcescens, an important nosocomial pathogen (Hejazi and Falkiner, 1997). A l l three operons were shown to confer the ability of siderophore-deficient E. coli strains to grow on nutrient agar containing dipyridyl, suggesting roles in non-heme iron acquisition (Adhikari et al., 1996; Sanders et al., 1994; Zimmermann et al., 1989). At the genetic level, fbpABC shares approximately 60% amino acid identity with the hitABC and 40% identity with sfuABC (Mietzner et al., 1998). 10 Table 2. List of Fe(III) periplasm-to-cytosol transporters Pathogen Genetic locus Reference Neisseria gonorrhoeae FbpABC (Adhikari etal., 1996) Neisseria meningitidis FbpABC (Khun e ta l , 1998) Haemophilus influenzae HitABC (Sanders et al., 1994) Serratia marcescens SfuABC (Angerer et a l , 1990; Angerer et al., 1992) Yersinia enterocolitica YfuABC (Saken et a l , 2000) Actinobacillus pleuropneumoniae AfuABC (Chinet al., 1996) Comparing the fbp, hit, and sfu operons reveals several common features including gene organizational similarity and some biochemical and functional properties. Studies on the importance for pathogenesis of the periplasmic binding proteins FbpA and HitA in the corresponding pathogens were hindered by the inability to construct mutants by allelic exchange, probably because the proteins are growth-essential (Chen et al., 1993; Sanders et al., 1994). Studies on the NBDs of Fe(III) periplasm-to-cytosol transporters will be described in more detail in section 1.8. Together, these bacterial iron uptake systems belong to the superfamily of A B C (ABC, for ATP-binding cassette) transporters, as discussed below. 1.6 ABC transporters: general characteristics, functions and examples The A B C transporter superfamily (also called traffic ATPases) consists of a very diverse group of integral membrane proteins involved in the ATP-dependent transport of different solutes across biological membranes (Higgins, 1992; Schneider and Hunke, 11 1998). These proteins share a conserved nucleotide-binding domain (Higgins, 1992; Holland and Blight, 1999) and are ubiquitous in both eukaryotes and prokaryotes. They can typically be divided into subfamilies based on the type of substrates as well as the direction of transport across membranes. Despite the prominence of these A B C transporters in all biological systems, the molecular mechanisms are not well characterized. In bacteria, many A B C transporters function in the uptake of amino acids, sugars, peptides and ions. These transporters have low capacity but high affinity systems, can accumulate substrate against very large concentration gradients (> 10,000-fold) and are most appropriate for a scavenging role (Higgins, 1992). The focus of the current study, the Neisserial periplasmic iron transport system (FbpABC), also belongs to this subfamily. On the other hand, A B C exporters are involved in the export of hydrophobic drugs, toxins (colicin, haemolysin), capsule polysaccharide, proteases, peptides, ions and heavy metals (Fath and Kolter, 1993; Higgins, 1992; Holland and Blight, 1999; Schneider and Hunke, 1998). These do not have a ligand-binding protein, and the ligand presumably interacts with the membrane domain initially. A well-studied example is the signal peptide-independent export of the 107 kDa HlyA hemolysin polypeptide of E. coli (Fath and Kolter, 1993; Koronakis et al., 1995; Koronakis et al., 1993). Although the vast majority of A B C transporters are involved with membrane transport events, a few apparently atypical A B C proteins serve alternative function, such as the UvrA protein which is a cytoplasmic enzyme involved in D N A repair (Doolittle et al., 1986). 12 1.6.1 Prokaryotic members Biochemically and genetically, the two best characterized examples of prokaryotic A B C transporters are the histidine permease in S. typhimurium and periplasmic maltose transport system in E. coli. Both systems belong to the subfamily of bacterial nutrient uptake systems. The histidine permease complex consists of HisJ, the periplasmic binding protein, HisM and HisQ, the transmembrane proteins, and two ATP-binding HisP subunits. Similarly, the E. coli maltose transporter complex, MalEFGK.2, is made up of the MalE, the periplasmic binding subunits, MalF and MalG, the integral membrane components, and MalK, the ATP-binding protein. Both periplasmic binding proteins function to confer high affinity to the corresponding ligand transport processes (histidine and maltose). Purified recombinant HisP and MalK were shown to exhibit a spontaneous ATPase activity in the absence of integral membrane components (Morbach et al., 1993; Nikaido et al., 1997; Walter et al., 1992); however, in both permease complexes (HisQMP2 and MalFGK2) reconstituted in proteoliposomes, ATP hydrolysis and ligand translocation depend greatly on the presence of the liganded periplasmic binding protein (Davidson and Nikaido, 1991; Liu et al., 1997). 1.6.2 Eukaryotic members Many eukaryotic members of the A B C transporter superfamily are of biomedical relevance. For example, P-glycoprotein pumps hydrophobic drugs out of cells in an 13 ATP-dependent manner, and its over-expression is frequently associated with multidrug resistance especially important in cancer cells (Germann et al., 1993; Gottesman and Pastan, 1993). Mutations in the nucleotide binding domains of cystic fibrosis transmembrane conductance regulator (CFTR) protein, a unique human epithelial chloride channel that regulates the rate of movement of Cl" ions across epithelia, lead to the genetic disease cystic fibrosis (Collins, 1992). More examples include TAP1 and TAP2 peptide transporters associated with the major histocompatibility complex (MHC) Class I antigen (Meyer et al., 1994), as well as A B C R , the rod photoreceptor-specific A B C transporter whose mutations at varying sites are responsible for Stargardt disease, an early onset macular degeneration (Ahn et al., 2000; Allikmets et al., 1997; Azarian and Travis, 1997). 1.7 ABC transporters: components An A B C transporter is typically composed of four parts: two integral membrane domains, each of which spans the membrane approximately six times, and two ATP-hydrolyzing domains (Doige and Ames, 1993; Higgins, 1992). In prokaryotes, the different domains are often individually expressed as separate polypeptides translated from the same operon, such as the histidine permease of S. typhimurium (Higgins et al., 1982). However, in many eukaryotic systems, the domains are fused into one large, multifunctional polypeptide, an example of which is the human multidrug resistance P-glycoprotein. 14 Bacterial periplasmic solute transporters are frequently equipped with an additional periplasmic protein component that has the following potential functions: 1) scavenging molecules with high affinity for the subsequent transport; 2) communicating its state of occupancy to the membrane components; 3) triggering the transport/ATPase cycle; and 4) delivering its ligand to the membrane components (Doige and Ames, 1993). Figure 3 shows different domain organizations of A B C transporters. HisJ,Q ,M,P S. typhimurium OppA,B,C,D,F 5. typhimurium FhuB.C.D E. coli ' 1 f 1 • 1- n B H l y B E. coli CFTR Figure 3. Different domain organizations of A B C transporters. The basic system has four subunits, two membrane domains and two ATPase subunits. Certain transporters have additional domains, e.g. the periplasmic binding protein in prokaryotic importers (A - D). Examples A - E represent prokaryotic systems; examples F and G are eukaryotic transporters. Adapted from (Higgins, 1992; Holland and Blight, 1999). 15 1.7.1 Integral membrane components The transmembrane domains of A B C transporters are highly hydrophobic, consisting of multiple a-helical segments that span the membrane. Although the majority of transporters are predicted to form six membrane-spanning segments per domain, the number of transmembrane segments can vary from three to eleven (Holland and Blight, 1999). Sequence similarity between different permeases is relatively limited, but structural similarity is extensive based on computer-assisted topology studies, especially in their carboxy-terminal ends (Kerppola and Ames, 1992). A common motif in all membrane-bound permeases that function in bacterial import systems is a conserved E A A loop located in the large hydrophilic cytoplasmic loop between the third and fourth membrane spanning segments of the minimum structure (Doige and Ames, 1993). Both transmembrane proteins forming the heterodimers reveal such a feature, which is unique to bacterial importers and is apparently neither in eukaryote membrane domains of A B C transporters nor in the E. coli HlyB-transporter nor in any ABC-dependent export systems in B. subtilis. The binding of liganded periplasmic protein to specific sites on the permease probably triggers a sequence of events that leads to ATP hydrolysis. This initiates the release of the receptor-bound substrate and the opening of a specific pore in the complex through which the substrate is translocated (Liu et al., 1999; Nikaido and Ames, 1999). 16 1.7.2 The A TP-hydrolyzing subunits The ATP-binding domains are the most conserved and are most characteristic of A B C transporters, with two short sequence motifs in their primary structure, called the Walker A and Walker B motifs (Walker et al., 1982) (Figure 4). The known nucleotide binding domains share considerable sequence identity, varying between 30 to 50% depending on the transporters being compared. The Walker A motif (GXS/TGXGKS/TS/T) corresponds to the phosphate-binding loop (P-loop), a glycine-rich loop that is followed by an uncapped a-helix. The invariant lysine within this motif is crucial for the binding of p- and y-phosphates of the nucleotide substrate (Schneider and Hunke, 1998). The Walker B site (hhhD, where h stands for hydrophobic) is also directly involved in the binding and hydrolysis of ATP (Jones and George, 1999; Schneider and Hunke, 1998). Preceding this site is a highly conserved sequence motif, the linker peptide, which has the following consensus sequence LSGGQQ/R7KQR. Mutations in this region abolished ATP hydrolysis (Schneider and Hunke, 1998), suggesting an essential role of the linker peptide in the transport process. 17 Walker A G X X G X G K T / S Walker B hhhhD A A N Helical Linker Domain peptide L S G G O Q / R / K Q R variable Figure 4. Linear representation of a prototype A B C domain. The highly conserved motifs, including the Walker A, Walker B and the Linker peptide, are marked. The ATP-hydrolyzing subunit of A B C transporters provides the energy for the transport process and has been studied for over 30 years (Jones and George, 1999). The high-resolution crystal structure of HisP, the nucleotide binding domain of the S. typhimurium histidine permease complex (Hung et al., 1998), led to a proposed mechanism by which the N B D couples the energy of ATP hydrolysis to ligand substrate transport across the membrane. The HisP structure (Hung et al., 1998) reveals an overall shape of an " L " with two thick arms (arm I and arm II). Arm I is a domain with an a+R structure and contains the ATP binding pocket formed by the Walker A residues and the Walker B aspartate (D178) which is involved in the coordination of the catalytic M g 2 + ion (Jones and George, 1999). Arm II is predominantly composed of a helices and appears to be embedded in the membrane by interacting with the integral subunits, HisQ and HisM. Many mutations 18 located on Arm II result in constitutive ATPase activity and a loosely assembled H1SQMP2 complex, suggesting that interaction with the integral subunits of Arm II is responsible for regulation of the ATPase activity (Liu et al., 1999). Based on the HisP structure, as well as other biochemical and genetic evidence (Kerppola et al., 1991; Liu and Ames, 1998; Liu et al., 1999; Mimura et al., 1990; Nikaido and Ames, 1999), a model of ATP hydrolysis and ligand translocation in Salmonella histidine permease system was proposed (Figure 5). Briefly, ATP binds to one of the HisP subunits in the tight membrane-bound complex HisQMP2, causing the HisP dimer to disengage from the integral components HisQM and also increasing the affinity of the second ATP to bind. Interaction of the liganded HisJ (receptor) with the integral subunits cause conformational change and further disengagement of HisP. ATP hydrolysis occurs and leads to the opening of the translocation pathway and the release of the histidine ligand. Finally, after the release of ADP and Pi, the HisP dimer is reengaged and the system resumes its resting stage. 19 ATP II ADP + ATP <r ATP III his / „ O + D ADP + Pi n ATPLj D A T P IV Figure 5. Proposed model representing ATP hydrolysis and ligand translocation by wild type HisQMP2. HisQ and HisM are represented in dark gray; HisP is shown in light gray; ATP is represented by dotted circle, while ADP + Pi is indicated by white circle. See text for detailed description of the ATP hydrolysis cycle. Adapted from (Liu et al., 1999; Nikaido and Ames, 1999). 1.8 FbpC and Neisserial iron transport Unlike the more distantly-related HisP of the histidine permease and MalK of the maltose transporter in S. typhimurium, the bacterial iron transport systems have not been well characterized. The involvement of these systems to function in periplasm-to-cytosol transport of iron has been demonstrated, however. Siderophore-deficient E. coli strains unable to utilize many iron sources can be complemented by the addition of a plasmid containing the hitABC (Adhikari et al., 1995), sfuABC (Zimmermann et al., 1989), or 20 fbpABC operons (Adhikari et al., 1996). These experiments provided solid evidence indicating the importance of these operons in iron transport. An elegant experiment by Sanders et. al. showed that insertional inactivation of the hitC gene produced an isogenic nontypeable H. influenzae (NTHI) strain unable to utilize iron bound to transferrin pr iron chelates. Interestingly, reconstitution of the wild-type genotype by replacing the mutated hitC gene with the wild-type allele by allelic exchange created a new strain that was able to utilize all of these iron sources (Sanders et al., 1994), indicating the critical role of HitC in the iron transport process. Khun et. al. (2000) recently showed the presence offbpAB and fbpBC transcripts by RT-PCR using an /7jpC-sequence-specific oligonucleotide, suggesting that the fbpABC locus in N. meningitidis is transcribed as a single contiguous mRNA (Khun et al., 2000). This result contradicts previous reports that failed to detect fbpC transcripts in RNA samples from N. gonorrhoeae cultures (Adhikari et al., 1996; Sebastian and Genco, 1999). However, the difference in results may be due to several factors, including quality of the total Nesserial RNA preparation used in the RT-PCR procedure (Bowler et al., 1999), differences in primer design and the PCR amplification protocol (Khun et al., 2000). Detection of fbpBC transcripts implies a functional role for FbpB and FbpC in Neisseria meningitidis periplasmic iron transport. A potential stemloop structure after the fbpA gene may function to stabilize mRNA, which may explain the higher expression level of FbpA in comparison to those of FbpB and FbpC. 21 Genetic conservation of the fbpABC operon also suggests that the above observation applies to N. gonorrhoeae. However, an N. gonorrhoeae fbpC mutant (by insertional inactivation) was previously shown to be capable of growth with transferrin as the sole exogenous iron source (Sebastian and Genco, 1999), conflicting the evidence obtained in the H. influenzae iron transport model. Whether FbpC is essential for transferrin-mediated periplasm-to-cytosol transport of iron remains controversial. 1.9 Objective of the present study Biochemical characterization of FbpC is crucial for understanding better how energy can be coupled to translocate iron across the Neisseria! cytoplasmic membrane. The goal of this study was to show biochemically that FbpC binds ATP and has ATPase activity in the absence of the first two gene products in the fbpABC operon. An FbpC mutant was created with El64 replaced by an aspartate residue, and the mutant ATP-hydrolyzing activity was compared with that of the wild-type FbpC. The functional characteristics of FbpC were also compared with the more extensively characterized HisP and MalK systems. 22 2. MATER IALS AND METHODS 2.1 Materials 2.1.1 Chemical supplies and media A l l chemicals were purchased from Fisher Scientific, Sigma Chemical Co, or Boehringer Mannheim unless otherwise specified. Restriction endonucleases and IPTG were obtained from Gibco-BRL, and Vent D N A polymerase and T4 D N A Ligase were from New England Biolabs. Taq polymerase and buffer were kindly provided by Dr. Ross MacGillivray (University of British Columbia). Acrylamide and other electrophoresis reagents were obtained from Bio-Rad laboratories. Nickel-NTA agarose resin was purchased from Qiagen, Inc. Bacterial media components were purchased from Difco laboratories. L B broth with appropriate antibiotics was used for overnight inoculation of bacteria; 2xYT media (with the modification of lOg of NaCl per liter of culture) were used for bacterial protein expression. Antibiotics were used at the following concentrations: ampicillin, 100 p.g/ml; kanamycin, 25 pg/ml. 2.1.2 Bacterial strains and plasmids Table 3 lists the bacterial strains and plasmid constructs used in the study. Escherichia coli strain DH5ot was used as the host strain in genetic manipulations. HMS174(DE3) E. coli strain was used for protein overexpression. Bacterial stocks were stored at -80°C in L B medium containing 15% glycerol. pBluescript® II SK- and pET28a vectors were obtained from Stratagene and Novagen Inc., respectively. 23 Table 3. Bacterial strains and plasmid constructs used in this study Strain, or plasmid Relevant characteristic(s) Reference Strains N. gonorrhoeae Genomic D N A for PCR amplification offbpC This study (clinical strain, fragment 03,21) E. coli DH5a General host for cloning fbpC and plasmid Novagen propagation E. coli Strain for high-level expression offbpC cloned Novagen HMS174(DE3) into pET28a vector containing bacteriophage T7 promoter Plasmids pBluescript® II SK- E. coli cloning vector , Amp r Stratagene pET28a E. coli expression vector, Kan Novagen pBSfbpC3 fbpC fragment ligated into Hindlll and Xhol of This study pBSSK(-) , Amp r pEfbpC3 fbpC fragment ligated into Ndel and Xhol of This study pET28a, Kan r pBSMutC3 fbpC fragment with amino acid change E164D This study ligated into HindSR a n d Z M l of pBSSK(-), Amp r pEMutC3 fbpC fragment with amino acid change E164D This study ligated into Ndel and Xhol of pET28a, Kan r 2.2 Methods 2.2.1 PCR amplification of the fbpC gene The fbpC gene was amplified from the genomic D N A of a clinical isolate (Q3, 21) of M gonorrhoeae (Provincial Laboratory, BC Center for Disease Control, 24 Vancouver, BC) by PCR using Taq polymerase. Synthetic oligonucleotide primers for the PCR reactions were designed with the aid of the program Oligo and prepared by the U B C Nucleic Acid and Protein Service Unit (N.A.P.S.) with an Applied Biosystems 394-08 or 380A D N A synthesizer. Restriction enzyme sites, HindlU, Ndel, and Xhol, as well as stop codons, were encoded within the primer sequences for cloning purposes. A l l primers are described in Table 4. A PCR reaction mixture was prepared by adding together the following components to a 0.5 ml thin-walled microcentrifuge tube: 1 pi of both forward and reverse primers (10 uM), 2 pi of 10 mM dNTPs, 5 pi of genomic D N A (prepared by the InstaGene Matrix method, Bio-Rad, Inc.), 5 pi of Buffer E (10X PCR reaction buffer composed of 0.67 M Tris-HCl pH 9.0, 0.11 M ammonium sulfate, 0 . 1 M 2 -mercaptoethanol), 1 pi Taq polymerase. The PCR was carried out using a Perkin Elmer D N A thermal Cycler with the following conditions: denaturation at 94°C for 45 seconds; annealing at 58°C for 45 seconds; extension at 72°C for 1 minute; 30 cycles. 25 Table 4. List of primers used in construction of vectors and sequencing Primers D N A sequence FbpCfl 5' - A T G A A G CTT C A T A T G A C C GCC GCC CTG C A - 3' Hindlll Ndel FbpCrl •5' - C A T CTC G A G TCA G A G GGT ATT TCC G G G G A A G A A - 3' Xhol stop T3 * 5' - ATT A A C CCT C A C T A A A G G G A - 3' "P7 * 5' - T A A TAC G A C T C A CTA T A G GG - 3' FbpC-tl 5' - CAT CTC G A G T C A TCG GTA C A A TTC GTG A G G GCT TG - 3' * Standard primers for D N A sequence analysis 2.2.2 Cloning and DNA sequence analysis of the fbpC gene Construction of pBluescript cloning vector. PCR products were mixed with D N A loading buffer (Sambrook et al., 1989) and electrophoresed on a 1% agarose gel using the Bio-Rad mini-Sub cell GT apparatus. The bands were visualized and photographed on a U V transilluminator after staining with ethidium bromide for approximately 10 minutes. The fragments of interest were excised from the gel and subjected to purification by the QIAquick Gel Extraction Kit (Qiagen, Inc.). The purified PCR product fbpC was digested with restriction enzymes Hindlll and Xhol (Gibco-BRL) for 3 hours in React2 buffer (Gibco-BRL) at 37°C. The cut fragment was then purified by gel electrophoresis as before and then cloned into 26 pBluescript" II SK- vector at the Hindlll and Xhol sites by overnight ligation at 16°C, resulting in the pBSfbpC3 plasmid. Competent cell preparation. An overnight bacterial culture (500 pl, DH5ct for cloning and HMS174(DE3) for protein expression) was inoculated into 500 ml of Luria-Bertani (LB) broth and incubated at 37°C in a shaking incubator until an O.D.600 of approximately 0.55 was reached. Cells were then transferred to two sterile centrifuge bottles, cooled on ice for 30 minutes, and were centrifuged at 2,000 g for 15 minutes in a GSA rotor at 4°C. The supernatant was then decanted, and each bottle of cells was resuspended gently in 20 ml cold sterile RFI solution (100 mM RbCl, 10 m M CaCl 2 , 30 mM potassium acetate, 50 mM MgCL., 15% glycerol, pH 5.8). The bacterial suspensions were then incubated on ice for 15 minutes and then centrifuged at 1,500 g for 15 minutes at 4°C. Each cell pellet was resuspended with 3.5 ml cold sterile RF2 solution (75 m M CaCl 2 , 10 m M RbCl, 10 mM MOPSNa, 15% glycerol, pH 6.8). The cells were cooled on ice for 15 minutes, aliquoted (150 pl), flash-frozen in a dry ice/ethanol bath, and stored at -80°C. Transformation and isolation of plasmids. Frozen competent cells were thawed on ice. D N A solutions (7.5 pl of ligation products) were added to the cells, and the mixture was cooled on ice for 30 minutes, then heat shocked at 37°C for 90 seconds. L B broth (200 pl) was added to the mixture followed by a 45-minute incubation with shaking at 37°C. Different quantities of bacterial suspension were then plated on L B agar plates with appropriate antibiotic and incubated overnight. Crude plasmid purification from bacterial cells to screen for successful transformation was performed by the alkaline lysis method as described previously 27 (Sambrook et al., 1989). Isolated plasmids were then analyzed by restriction enzyme digestion to confirm the presence of the desired insert. Sequencing grade plasmids were then prepared using the QIAprep Miniprep Kit (Qiagen, Inc.) as described by the manufacturer. DNA sequence analysis. The fbpC fragment in pBluescripf®II SK- was sequenced using a Taq DyeDeoxy terminator cycle sequencing kit (Applied Biosystems) with an Applied Biosystems model 377 automated sequencer at the U B C N.A.P.S. Unit. The primers used for D N A sequencing are shown in Table 4. Cloning offbpC into expression vector. The fbpC insert was excised from pBSfbpC3 and introduced into the pET28a expression vector (Novagen, Inc.) at the Ndel site at the 5' end and Xhol site at the 3' end resulting in the plasmid construct pEfbpC3. The pET28a expression vector was chosen because it codes for an N-terminal histidine tag as well as an optional C-terminal His-tag which allows for simplified protein purification. It also contains a T7 promoter and a lac operator sequence to regulate expression of the inserted gene (fbpC). 2.2.3 Site directed mutagenesis Mutagenesis procedure. An FbpC mutant, E164D, was created using a PCR-based method (Nelson and Long, 1989). Synthetic oligonucleotides used for mutagenesis were prepared by U B C N.A.P.S. (Nucleic Acid and Protein Service) Unit and are listed in Table 5. The overall scheme of the procedure is illustrated in Figure 6. The first step results in the production of a PCR product defined by the mutagenizing oligonucleotide (5' primer: FbpC-Mutl) and the flanking oligonucleotide (3' primer: Primer B). The 28 vector pBSfbpC3 was used as a template. A 50 pl PCR reaction mixture was prepared containing the following components in a 0.5 ml thin-walled microcentrifuge tube: 1 pl of both 5' and 3' primers (10 uM final concentration), 2 pl of 10 m M dNTP, 1 pl of template (pBSfbpC3), 5 pl of lOx Buffer E, 1 pl Taq polymerase. Thirty cycles of PCR amplification was carried out using the Mastercycler® gradient 5331 (Eppendorf Scientific, Inc., N.Y.) using the following conditions: denaturing at 94 °C for 45 seconds, annealing at 58 °C for 45 seconds, extension at 72 °C for 1 minute. The 0.7 kb PCR product was then purified using the QIAquick kit (Qiagen, Inc.), and 5 pl was used in the second step of PCR mutagenesis to prime a single round of replication. The same template (pBSfbpC3), dNTPs, buffer and Taq polymerase were used in the condition as follows: denaturation at 94 °C for 2 minutes; annealing at 50 °C for 2 minutes; and extension at 72 °C for 2 minutes. Primers C and D (100 pmol - see Table 5) were added to the reaction tube, followed by 30 cycles of PCR amplification using the following program setting: denaturation at 94 °C for 30 seconds; annealing at 50 °C for 30 seconds; extension at 72 °C for 45 seconds. The final product was cloned into the pBluescript vector at restriction sites Hindlll and Xhol, forming a new construct pBSMutC3. The ligation mixture was transformed, and the resulting colonies were screened for positive mutants. Table 5. Primers designed for the construction of E164D FbpC mutant by PCR-based site directed mutagenesis (Nelson and Long, 1989) Primers D N A sequence FbpC-Mutl 5' - T G T T G G A C G A C C C C T T C A G C - 3' Primer B 5' - G G A G T A C T A G T A A C C C T G G C C C C A G T C A C G A C G T T G T A A A - 3 Primer C 5' - C A G G A A A C A G C T A T G A C C A T - 3' Primer D 5' - G G A G T A C T A G T A A C C C T G G C - 3' 29 S T E P 1 B 5, < nmn S T E P 2 A y -VV- 5' I • I ° I • I — • Hlllllll 1 ^ , , y 5, 5 — . y 3 S T E P 3 3' • lllllllll : vl 5' ZZZ2- - o > C D + ? r r w i 5' i /yyy i • 3 v • 111111111% vl 5' o > «3r- <V i / w y i — - • — t < < < \ Figure 6. Schematic illustration of PCR-based site-directed mutagenesis. 30 Screening for mutants. A positive mutant clone was confirmed by D N A sequence analysis using the BigDye™ Terminator Cycle Sequencing Kit (Applied Biosystems, Inc.). The primer used for sequencing mutants (FbpC-tl) is described in Table 4 and is a 3' internal primer located at 662 bp downstream of the start codon of fbpC (170 bp downstream of the altered site). The entire sequence of the mutant fbpC was also confirmed by sequencing at N.A.P.S. Unit. 2.2.4 Overexpression of FbpC A single colony of E. coli strain HMS174 (DE3) containing pEfbpC3 was inoculated into 10 ml of LB broth with 25 pg/ml kanamycin and incubated with shaking at 30 °C overnight. The culture was then diluted 1:200 into fresh 2xYT media (modified with the addition of 5g of NaCl per liter) and incubated at 30°C with shaking until an OD600 of 0.9 to 1.0 was reached. Expression of the FbpC fusion protein was induced with 0.5 m M IPTG for 2 to 2.5 hours at 30 °C. The cells were then harvested by cooling for 5 minutes on ice followed by centrifugation at 5,000 g for 25-30 minutes. The cell pellet was frozen and stored at -80 °C until needed. 2.2.5 Purification of FbpC Nickel-chelate affinity chromatography. Cells were defrosted and resuspended in 40 ml of cold buffer A (50 mM Tris-HCl pH 8.0, 15% glycerol, 0.4 M NaCl). ATP was added to the cell resuspension to a final concentration of 5 mM, and the cells were 31 then lysed using a French press. After centrifugation at 5,500 g for 30 minutes, the supernatant was applied to a column containing 10 ml of a slurry of N i -NTA resin (Qiagen, Inc.) previously equilibrated with cold binding buffer. The column was washed with (i) 40 ml of buffer B (50 m M Tris-HCl pH 8.0, 15% glycerol, 0.4 M NaCl, 4 m M ATP), (ii) 25 ml of buffer B containing 20 m M imidazole, and (iii) 30 ml of buffer B containing 50 m M imidazole. Subsequently, FbpC was eluted with 30 ml of buffer B supplemented with 250 mM imidazole. A l l fractions were collected, kept on ice, and analyzed by SDS-PAGE. EDTA was added to the FbpC fraction to a final concentration of 1 m M immediately following elution, and the fraction was dialyzed overnight against the following buffer: 40 m M Tris-HCl pH 7.9, 1 mM EDTA, 20% glycerol, 75 mM NaCl, 1 m M DTT, 2 mM ATP. High-Q ion-exchange chromatography. The 5-ml high-Q Econo-Pac cartridge (Bio-Rad) (prepared for use as instructed by the manufacturer) was connected to a Pharmacia FPLC system and washed with 20 ml of degassed deionized distilled water, followed by 20 ml of degassed high salt buffer D (20 mM Tris-HCl pH 7.9, 20% glycerol, 1 M NaCl, 1 mM EDTA) at a flow rate of 2 ml/min before each use. The cartridge was then equilibrated with degassed low salt buffer C (20 m M Tris-HCl pH 7.9, 20% glycerol, 75 mM NaCl, 1 mM DTT, 1 mM EDTA, 1 to 2 mM ATP). The 10 ml FbpC dialysis fraction from the nickel affinity chromatography was loaded onto the cartridge at 1 ml/min using a peristaltic pump. The FbpC protein was present in the flow through fraction (10 ml) and was kept on ice. The cartridge was washed with (i) 10 ml of low salt buffer C, (ii) 10 ml of buffer F (Buffer C and Buffer D in ratio of 1:1), and (iii) 10 ml high salt buffer D. The cartridge was cleaned as described by the manufacturer 32 and stored in 20% (v/v) ethanol solution at 4 °C. Fractions were analyzed by 10% SDS-PAGE. Pure FbpC (from flow through fraction) was immediately aliquoted (500 pl), flash-frozen in dry-ice/ethanol bath and stored at -80 °C. 2.2.6 Protein characterization Bradford Standard assay. Protein samples were diluted to an appropriate concentration and quantified by the Bradford method (Bradford, 1976) using the Bio-Rad Protein Assay Dye Reagent Concentrate (Bio-Rad) as described by the manufacturer. SDSPAGE. Samples were heated at 95 °C in 5x sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) loading buffer (62.5 m M Tris-HCl pH 6.8, 10% glycerol, 2% (w/v) SDS, 5% P-mercaptoethanol, 0.025% (v/v) bromophenol blue) for 5 minutes. After denaturation, samples were resolved on 10% polyacrylamide gels. N-terminal Amino Acid Sequence Analysis. Purified FbpC protein was electrophoresed on a 10% SDS-PAGE, electroblotted onto a polyvinylidene difluoride membrane in CAPS electroblotting buffer (10 mM CAPS in 10% methanol) at 50 V (100-170 mA) for 30 minutes. Subsequently, protein was visualized by staining with Coomassie Brilliant Blue R solution (0.025% (w/v) CBR 250 in 40% (v/v) methanol). Bands corresponding to FbpC were excised, pooled, and subjected to sequence analysis using the Perkin Elmer ABI 476A automated sequencer at UBC N.A.P.S. Unit. The first 10 amino acids were found to be identical to those predicted from the fbpC gene sequence except that the amino terminal methionine was cleaved off. 33 2.2.7 A TPase activity assay ATPase assays were performed essentially as described previously (Nikaido et al., 1997) with a few minor modifications. Purified FbpC(hiS6) (10 pg, final concentration: 45 pM, 320 pl total reaction volume) in assay buffer (100 m M Tris-HCl, pH 8.0, 40 m M NaCl, 4 m M ATP, 20% (v/v) glycerol, 1 m M EDTA, 1 mM DTT) was equilibrated at 37°C for 3 minutes. The reaction was started by the addition of M g C l 2 (final concentration: 4 mM). Samples (75 pl) were taken every 2.5 minutes and added to microcentrifuge tubes containing 75 pl of 12% SDS to stop the reaction. A control reaction was performed in parallel without the addition of M g C l 2 . The amount of inorganic phosphate liberated from each reaction was measured by a colorimetric assay (Chifflet et al., 1988) using Na2HPC>4 as a standard. The standards result in a linear calibration curve with a range of 1 - 30 nmol of inorganic phosphate. The procedure for phosphate determination is briefly described as follows. Solution P l (12% SDS, 150 pl) was added to the sample (150 pl) and vortexed, followed by the addition of 300 pl of solution P2 (1:1 ratio of 6% ascorbic acid in 1 N HC1 (freshly prepared prior to each use) and 1% ammonium molybdate). A l l tubes were incubated for 7-10 minutes before 562.5 pl of solution P3 (2% sodium citrate, 2% sodium metaarsenite, 2% acetic acid) was added. The mixtures were further incubated at 37 °C for 10 minutes, and the absorbance at 850 nm was read with a Cary 50 UV-v/s spectrophotometer. Similar assays were performed to determine the dependence of FbpC ATPase 34 activity on pH, FbpC concentration, ATP, and MgCb, with the exception that the total reaction volume was 90 pi only, and that only the 10-minute time point (75 pi) was taken. The procedure for each experiment is detailed in appropriate figure legends. 2.2.8 Photoaffinity labeling with ly-2P]NjATP [y- Z P]N 3 ATP was purchased from ICN Biomedical Inc. and was supplied with a specific activity of 19.8 Ci/mmol. The labeling procedure was as follows: purified FbpC(hiS6) (1-5 pg) were diluted in photoaffinity labeling buffer (40 mM Tris-HCl, pH 8, 5 mM M g C l 2 , 50 m M NaCl, 5 m M CaCl 2 , 7.5% glycerol) to a final volume of 75 pi, placed in a 24-well glass plate, and kept on ice. 2.0 pCi of [y- P]-N 3 ATP was mixed with unlabeled N 3 A T P to a final concentration of 100 p M and added to the well. The reaction mixture was irradiated with a handheld short wave (254 nm) U V lamp (Spectronics Corporation, N.Y.) placed at a 3 cm distance for two 1-minute intervals, with 1-minute cooling in between. The reaction was stopped by the addition of 4 m M dithiothreitol and protein sample loading buffer. Following photolabeling, the samples were heated in a boiling water bath for 5 minutes prior to electrophoresis. One third of the sample volume (30 pi) was subject to SDS-PAGE analysis. Autoradiography was performed using Kodak Bio Max film and an intensifying screen at -80°C after transfer of the proteins onto nitrocellulose. Quantitative studies were performed with a phosphorimager (PSI-M A C ) and the program ImageQuant (Molecular Dynamics, Inc.). 35 3. RESULTS 3.1 Cloning and construction of FbpC(hjS6) expression vector Genomic D N A of a clinical strain of Neisseria gonorrhoeae was isolated in the Provincial Laboratory at the BC Center for Disease Control (Vancouver, BC) using InstaGene matrix (Bio-Rad). The fbpC gene was amplified by PCR, generating a D N A fragment of 1059 nucleotides that encode fbpC flanked by restriction sites for Hindlll and Ndel at the 5' end and a stop codon and a Xhol restriction site at the 3' end. Cloning the amplified fbpC into the pBluescript and the pET28a expression vectors produced stable genetic constructs pBSfbpC3 and pEfbpC3, respectively. After ligation and transformation into E. coli strain DH5ct, positive clones containing the fbpC insert were confirmed by restriction digestion. Plasmids were prepared using the QIAprep Miniprep kit (Qiagen, Inc.) and successfully transformed into E. coli expression strain HMS174(DE3) which carries an IPTG-inducible chromosomal T7 RNA polymerase gene. D N A sequence analysis of N. gonorrhoeae fbpC was performed using standard T7 and T3 primers designed for the pBluescript vector (Table 4) to confirm the correct amplification offbpC from the N. gonorrhoeae genome. When the D N A sequence for the amplified fbpC fragment was compared to the available Neisseria gonorrhoeae complete genome sequence of Strain FA 1090 (Roe et al., 2000), it was found to be identical except at nucleotide position 567 (A instead of C), which represents a silent mutation (Figure 7). 36 C l o n e d _ f b p C 1 Ng-genome 1 C l o n e d _ f b p C 71 Ng-genome 71 C l o n e d _ f b p C 141 Ng-genome 141 C l o n e d _ f b p C 211 Ng-genome 211 C l o n e d _ f b p C 281 Ng-genome 281 C l o n e d _ f b p C 351 Ng-genome 351 C l o n e d _ f b p C 421 Ng-genome 421 C l o n e d _ f b p C 4 91 Ng-genome 4 91 C l o n e d _ f b p C 561 Ng-genome 561 C l o n e d _ f b p C 631 Ng-genome 631 C l o n e d _ f b p C 771 Ng-genome 771 C l o n e d _ f b p C 841 Ng-genome 841 C l o n e d _ f b p C 911 Ng-genome 911 C l o n e d _ f b p C 981 Ng-genome 981 C l o n e d _ f b p C 1051 Ng-genome 1051 A T G A C C G C C G C C C T G C A C A T C G G A C A C C T G T C C A A A A G T T T T C A A A A C A C C C C G G T T T T A A A C G A C A T T T A T G A C C G C C G C C C T G C A C A T C G G A C A C C T G T C C A A A A G T T T T C A A A A C A C C C C G G T T T T A A A C G A C A T T T C G C T C A G C C T C G A C C C G G G C G A A A T T C T C T T T A T C A T C G G C G C G T C C G G C T G C G G C A A A A C C A C C C T T T T C G C T C A G C C T C G A C C C G G G C G A A A T T C T C T T T A T C A T C G G C G C G T C C G G C T G C G G C A A A A C C A C C C T T T T A C G C T G C C T T G C C G G T T T C G A A C A A C C C G A T T C C G G C G A A A T T T C G C T T T C C G G C A A A A C C A T C T T C T C G A C G C T G C C T T G C C G G T T T C G A A C A A C C C G A T T C C G G C G A A A T T T C G C T T T C C G G C A A A A C C A T C T T C T C G A A A A A T A C C A A C C T T C C C G T C C G C G A A C G C C G T T T G G G T T A C C T C G T A C A G G A A G G C G T G C T G T T C C C C C A A A A A T A C C A A C C T T C C C G T C C G C G A A C G C C G T T T G G G T T A C C T C G T A C A G G A A G G C G T G C T G T T C C C C C ACCTGACCGTTTACCGCAATATCGCCTACGGTCTCGGCAACGGCAAAGGCAGGACGGCGCAAGAGCGACA ACCTGACCGTTTACCGCAATATCGCCTACGGTCTCGGCAACGGCAAAGGCAGGACGGCGCAAGAGCGACA G C G C A T C G A A G C C A T G T T G G A A T T G A C C G G C A T T T C C G A A C T T G C C G G A C G C T A T C C G C A C G A A C T T T C G G C G C A T C G A A G C C A T G T T G G A A T T G A C C G G C A T T T C C G A A C T T G C C G G A C G C T A T C C G C A C G A A C T T T C G G G C G G A C A A C A A C A G C G C G T C G C C C T C G C C C G C G C C C T C G C C C C C G A C C C C G A A C T G A T T T T G T T G G A C G G G C G G A C A A C A A C A G C G C G T C G C C C T C G C C C G C G C C C T C G C C C C C G A C C C C G A A C T G A T T T T G T T G G A C G AACCCTTCAGCGCGCTGGACGAACAGTTGCGCCGCCAGATTCGCGAAGACATGATTGCCGCCCTGCGCGC AACCCTTCAGCGCGCTGGACGAACAGTTGCGCCGCCAGATTCGCGAAGACATGATTGCCGCCCTGCGCGC C A A C G G S A A A T C C G C C G T T T T T G T C A G C C A C G A C C G C G A A G A A G C C C T G C A A T A C G C C G A C C G G A T T G C C CAACGGHAAATCCGCCGTTTTTGTCAGCCACGACCGCGAAGAAGCCCTGCAATACGCCGACCGGATTGCC G T G A T G A A A C A G G G G C G C A T C C T C C A A A C C G C A A G C C C T C A C G A A T T G T A C C G A C A A C C T G C C G A C C T T G G T G A T G A A A C A G G G G C G C A T C C T C C A A A C C G C A A G C C C T C A C G A A T T G T A C C G A C A A C C T G C C G A C C T T G C l o n e d _ f b p C 701 g Ng-genome 701 T G C C G C C C T G T T T A T C G G C G A A G G C A T C G T G T T C C C C G C C G C G C T C A A C G C C G A C G G C A C C G C C G A T T G A T G C C G C C C T G T T T A T C G G C G A A G G C A T C G T G T T C C C C G C C G C G C T C A A C G C C G A C G G C A C C G C C G A T T G CAGATTGGGCCGCCTGCCCGTCCAAAGCGGCGCACCCGCAGGCACGCGCGGTACACTGCTCATCCGTCCG CAGATTGGGCCGCCTGCCCGTCCAAAGCGGCGCACCCGCAGGCACGCGCGGTACACTGCTCATCCGTCCG G A A C A G T T C A G C C T T C A C C C C C A T T C C G C A C C C G C C G C C T C C A T T C A C G C C G T G G T T C T C A A A A C C A C G C G A A C A G T T C A G C C T T C A C C C C C A T T C C G C A C C C G C C G C C T C C A T T C A C G C C G T G G T T C T C A A A A C C A C G C C C A A A G C G C G G C A T A C C G A A A T C A G C C T C A G G G C C G G A C A A A C C G T C C T C A C G C T C A A C C T C C C T T C C G C C C A A A G C G C G G C A T A C C G A A A T C A G C C T C A G G G C C G G A C A A A C C G T C C T C A C G C T C A A C C T C C C T T C C G C C C C C A C C C T G T C A G A C G G C A T T T C C G C C G T C C T C C A T T T G G A C G G T C C C G C C C T G T T C T T C C C C G G A A A T C C C C A C C C T G T C A G A C G G C A T T T C C G C C G T C C T C C A T T T G G A C G G T C C C G C C C T G T T C T T C C C C G G A A A T A C C C T C T G A A C C C T C T G A Figure 7. Sequence alignment of PCR-amplified fbpC gene (this study) and data from N. gonorrhoeae genome sequencing project (Strain FA 1090) at the University of Oklahoma (Roe et al., 2000). 37 3.2 Overexpression and Purification of FbpC(hiS6) FbpC(his6) was successfully overexpressed in HMS174(DE3) cells containing the plasmid pEfbpC3 upon induction by IPTG to a final concentration of 0.5 mM for 2.5 hours (Figure 8). The cells were grown at 30°C at all times to optimize the amount of soluble fbpC protein. The amount of overexpressed protein increases with respect to time of induction; however, a greater fraction of cells was susceptible to lysis i f induction was allowed for more than 3 hours. The overproduced protein had an apparent molecular weight of approximately 40 kDa as judged by SDS-PAGE, corresponding well with the predicted molecular weight of fusion FbpC with an N-terminal histidine tag. N-terminal sequence analysis of the first 10 amino acids also confirmed the identity of the expressed FbpC. 18.4 Figure 8. Expression profile of FbpC(hiS6)- SDS-PAGE showing FbpC(hiS6) overproduction. HMS174 (DE3) cells containing the pEfbpC3 plasmid were grown under conditions as described in the Materials and Methods section. Lanes 1, 3, 5 represent total proteins in cells growing in non-inducing conditions at 30°C for 2 hours (lane 1), 4 hours {lane 3), and 16 hours (lane 5). Lanes 2, 4, 6 represent total proteins of cells induced with 0.5 mM IPTG for 2 hours (lane 2), 4 hours (lane 4), and 16 hours (lane 6) respectively. 38 Harvested cells were disrupted by passage through a French press twice. After centrifugation, the cell pellet was found to contain a large amount of insoluble FbpC aggregates. However, due to the difficulty encountered in refolding functional protein after denaturing purification by the use of 6 M urea, a native purification procedure was used to purify soluble, recombinant FbpC protein in the clear lysate. Nickel-affinity column chromatography was used as the first step of purification, taking advantage of the metal-binding properties of the histidine tail of fusion FbpC. Figure 9 shows the result of a typical purification procedure from a 2-liter preparation. Most of the overproduced FbpC(his6) remains in the pellet fraction after cell lysis by French press. The majority of FbpC(his6) is released from the column upon addition of elution buffer (lane 9, Figure 9a). The presence of ATP, NaCl, and glycerol is critical to maintain the bulk of recombinant FbpC in solution during the entire purification procedure before the elution step. The FbpC preparation after elution from the nickel column is not sufficiently pure. The fraction was immediately dialyzed overnight against buffer containing 5 m M ATP and 20% glycerol and further purified using the high Q cartridge on an FPLC system (Pharmacia). FbpC(hiS6) was present in the flow-through fraction (lane 2, Figure 9b), and is over 95% pure as judged by SDS-PAGE. The yield of a typical 2-liter preparation is around 1.3 mg of pure FbpC(hjS6)-39 1 2 3 4 5 6 7 8 9 10 11 12 13 97.4 68 43 29 18.4 • 18.4 Figure 9. Purification of FbpC(hiS6)- A. SDS-PAGE of fractions from FbpC purification by nickel-affinity chromatography. Molecular weight markers in kDa are shown on the left. Lane 1, total cell proteins after 2 hours of induction at 30°C; lane 2, supernatant fraction after cell lysis by French Press; lane 3, column flow-through; lanes 4-7, wash fractions; lanes 8-12, 250 m M imidazole eluate; lane 13, 500 mM imidazole eluate. B. Further purification of FbpC (his6) by passage of proteins obtained from nickel column (lane 9 in A.) through a high-Q cartridge. Lane 1, proteins before high Q; lane 2, flow-through fraction. FbpC comes off at flow-through. FbpC (hiS6) is indicated by an arrow. 40 3.3 Properties of FbpC(hiS6) FbpC(his6) has a high content of hydrophobic amino acid residues (50%) (Adhikari et al., 1996) and is difficult to solubilize even before purification. Different non-ionic detergents, including Triton X-100, Tween-20, MEGA-8, and L D A O , were ineffective in increasing the solubility of FbpC(hiS6) (data not shown). Lauroylsarkosine (0.5%) or SDS completely solubilize but denature the protein, making recovery of functional FbpC(hiS6) extremely difficult. The addition of ATP to at least 2 mM throughout the whole purification procedure was found to be essential in maintaining FbpC(hjS6) solubility, as the final yield of FbpC is reduced by more than 50% if ATP is omitted before the nickel column purification step and thereafter. It is possible that ATP interacts with FbpC(hiS6) in such a way as to stabilize the protein. Pure FbpC(his6) had a tendency to form a white precipitate within 24 hours at 0°C. Varying salt, concentration of salt, pH, and additives like DTT did not have a positive effect in maintaining FbpC(hiS6) solubility. Previous experiments involving the purification of HisP(his6) indicated the importance of 20% glycerol and 5 mM ATP in maintaining HisP(hjS6) solubility over 2 mg/ml (Nikaido et al., 1997). In this study, I estimate that at least 30-40% of the purified FbpC(hiS6) precipitates within 2 weeks at 4°C in a buffer containing 20% glycerol and 2 mM ATP. Increasing the glycerol concentration to 50% significantly improves the solubility of pure FbpC(hiS6), but renders the purified protein harder to work with. Attempts to concentrate FbpC(hiS6) by both Amicon concentrators and Ultrafree-4 centrifugal filter units (Millipore, Inc.) yielded precipitates and were unsuccessful. Therefore, final, pure FbpC(hiS6) was immediately aliquoted and stored at -80°C in 20% 41 glycerol and 2 m M ATP. EDTA, a divalent cation chelator, was also added to 1 mM to avoid hydrolysis of ATP. 3.4 ATPase activity of FbpC(hiS6) Isolated nucleotide binding domains of more extensively characterized bacterial A B C transporters, such as HisP and MalK, were demonstrated previously to display ATP hydrolysis activity. Purified FbpC(hiS6) was therefore first characterized by its ability to hydrolyze ATP into ADP and inorganic phosphate. Figure 10a shows linear ATPase activity of FbpC(hiS6) with respect to time in the presence of M g + + . This activity is linear up to at least 10 minutes, and is dependent on the M g + + cation with the maximal activity displayed when the concentration of M g + + is between 1 to 2 mM (Figure 10b). The calculated specific activity of FbpC(hiS6) is 0.5 ± 0.1 pmol/min/mg. ATP hydrolysis by FbpC(hiS6) activity was also monitored by varying pH values from 6.0 to 10.2, and the pH optimum was found to be slightly alkaline, from pH 7.5 to 8.0 (Figure 10c). Glycerol was essential for maintaining FbpC(hiS6) in solution, and it was added throughout the entire purification procedure up to a concentration of 20% (v/v). However, it was not known if the presence of glycerol would inhibit FbpC(hiS6) activity. This was found to be true for HisP (Nikaido et al., 1997) where glycerol above 7.5% inhibits the activity. In the case of FbpC(hiS6)> however, the presence of glycerol up to 20% actually stimulated the rate of ATP hydrolysis (Figure lOd) with the activity dropping off at higher glycerol concentration possibly due to disruption of hydrophobic interactions (Nikaido et al., 1997). 42 D 400 11 p H 10 15 [Glycerol] (% 30 Figure 10. Properties of the ATPase activity of FbpC(hjS6)- A, Linearity of ATP hydrolyzing activity with respect to time. The assay was performed as described in "Materials and Methods" in the presence (A) or absence ( A ) of MgCL.. The concentration of FbpC(his6) is 60 pg/ml. B, M g 2 + dependence of FbpC(hiS6) activity. The assay was performed as described with M g 2 + added to the concentration indicated on the abscissa. The reaction was allowed to proceed for 10 minutes. The ordinate represents specific ATPase activity. C. pH dependence of FbpC(hiS6) activity. The FbpC(hiS6) solution was diluted in assay buffers of various pHs and the ATPase activity measured after 10 minutes of assay time. The buffers used are as follows: MES/Na, 6.0-6.5; MOPS/Na, 7.0; Tris/Cl, 7.5-8.8; CHES, 9.3; CAPS, 10.2. D, Glycerol dependence of FbpC ( h i S6) activity. FbpC ( h i s 6) solution containing 20% glycerol (v/v) was diluted in assay buffers with various amounts of glycerol such that the final concentration of glycerol is that indicated on the abscissa. The ordinate represents the ATPase specific activity. In panels B -D, background was corrected using control assays with no M g C l 2 added. 43 3.5 Site-directed mutagenesis and properties of the E164D mutant To ensure that the ATPase activity displayed by the purified FbpC(hiS6) preparation was not due to contaminating ATPases, PCR-based mutagenesis was performed to create the FbpC mutant E164D. Based on previous structural and mutational analyses of the HisP in the Salmonella histidine transport system (Hung et al., 1998; Shyamala et al., 1991), this mutant is hypothesized to be defective in hydrolysis but would have little effect in ATP binding. This feature is desirable in the characterization of FbpC(hiS6) because the presence of ATP is absolutely essential for the purification process. The plasmid construct containing the point mutation in the fbpC gene was successfully cloned into the pBluescript vector and subcloned into the pET28a expression vector. The presence of the mutation was confirmed by DNA sequence analysis. The mutant construct (pEfbpCMut3) was transformed into the HMS174(DE3) E. coli strain, overexpressed and purified using identical protocol as the wild-type. Figure 11 shows the SDS-PAGE result of a typical E164D mutant purification. The E164D mutant expression profile is comparable to that of the wild-type; however, the final yield is lower, giving approximately 0.3 mg purified protein from a typical 2-liter preparation. The low yield may be due to lower solubility and weaker ATP binding of the E164D mutant as compared to the wild-type. When the E164D mutant was characterized by the ATPase activity assay, the mutant was found to have a specific activity of around 0.047 pmol/min/mg, representing a greater than 10-fold reduction in specific activity compared to the wild-type FbpC. 44 A 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 29 mm mWW: 1 2 3 18.4 14.3 ^ B kDa 200 97 68 43 29 18.4 14.3 Figure 11. Purification of E l 64D FbpC ( hiS6). A. SDS-PAGE of fractions from E l 64D purification by nickel-affinity chromatography. Molecular weight markers in kDa are shown on the left. Lane 1, total cell proteins after 2 hours of induction by 0.5 mM IPTG at 30°C; lane 2, supernatant fraction after cell lysis by French Press; lane 3, column flow-through; lanes 4-9, wash fractions; lanes 10-15, 250 mM imidazole eluate; lanes 16-17, 500 mM imidazole eluate. B. Further purification of FbpC (hiS6) by passage of proteins obtained from nickel column through a high-Q cartridge. Lane 1, proteins before high Q; lanes 2-3, flow-through fraction. E164D FbpC (hiS6) is indicated by an arrow. 45 3.6 B i n d i n g of [y - 3 2 P]N 3 ATP to purified F b p C ( h i s 6 ) To test the ability of FbpC(hiS6) to bind ATP, a photoaffinity ATP analog, 8-azido-32 [y J ZP]ATP, was used to label the purified FbpC(hjS6) protein. The protein was resolved on a 10% SDS-PAGE after U V irradiation, transferred to nitrocellulose and analyzed with autoradiography. The photoaffinity conditions were optimized by varying the FbpC concentration (0.5 pg to 1.5 pg per reaction), the amount of 8-azido-[y32P]ATP added (0.5 pCi to 2.0 pCi), and the time length of U V irradiation (two or three 1-minute irradiation with 1-minute cooling period). The optimal condition was determined as described in the Materials and Methods section. Purified FbpC(hiS6) was found to bind [y- 3 2 P]N 3 ATP under different conditions (Figure 12a). The protein band was absent in the control experiment where U V irradiation was omitted. Preincubation with 5 m M unlabeled ATP led to reduced intensity in the FbpC band suggesting the specific binding of ATP to FbpC. Figure 12b shows that photoaffinity labeling of FbpC was reduced as the concentration of unlabeled ATP was increased. 46 B Figure 12. An autoradiogram showing binding of 8-azido-[y- PJ-ATP to FbpC(hiS6)-A. Purified FbpC(hiS6) (1-5 pg) was diluted in photoaffinity labeling buffer (40 mM Tris-HCl , pH 8, 5 mM M g C l 2 , 50 mM NaCl, 5 mM CaCl 2,7.5% glycerol) and incubated with 8-azido-[y- P]-ATP in the absence of (lanes 1-2) and in the presence of (lanes 3-4) 5 mM unlabeled ATP. Labeled azido-ATP used per reaction was as follows: lanel. 0.5 pCi; lane 2. 2.0 pCi; lane 3. 1.0 pCi; lane 4. 2.0 pCi. lane 5. control experiment with the U V irradiation step omitted. B. Preincubation of photoaffinity labeling reactions with different concentrations of unlabeled ATP prior to U V irradiation. Lane 1. 0 mM; lane 2. 1 mM; lane 3. 2 mM; lane 4. 5 mM; lane 5. 10 mM. Approximately 1.5 pCi labeled azido-ATP was used in each reaction. 47 4. DISCUSSION 4.1 Clon ing and sequence analysis oifbpC A l l bacterial ATP-binding cassette (ABC) importers share a conserved nucleotide binding motif, shown to provide energy for the transport of many growth essential nutrients through the hydrolysis of ATP (Higgins, 1992). The cloning of the fbpC gene from the genome into the pBluescript® II SK" and the expression pET28a vectors was successful. D N A sequence analysis of the fbpC clone, when aligned with the N. gonorrhoeae complete genome sequence of FA 1090 (Roe et al., 2000), was found to be identical except at one nucleotide position that represents a silent mutation (Figure 7). Comparison of the cloned fbpC with the published N. gonorrhoeae fbpC sequence by Adhikari et. al. (1996) revealed a difference of 16 base pairs (Adhikari et al., 1996), including a frame shift in a region between WalkerA and WalkerB (Figure 13). Since this region is highly conserved among NBDs, the frame shift present in the published fbpC but not in the genome sequences of N. gonorrhoeae and N. meningitidis or in the nucleotide binding domain of a closely related Fe (III) periplasm-to-cytosol transporter, hitC, suggests that there is some error in the published D N A sequence offbpC. The FbpC protein shares 51% amino acid identity with HitC of the hit ABC operon in H. influenzae and 40% identity with SfuC of the sfuABC operon in S. marcescens, both are nucleotide binding subunits of closely related Fe (III) periplasmic transporters (Figure 13) (Mietzner et al., 1998). FbpC is compared to HisP (29kDa) and MalK (40 kDa), the nucleotide binding subunits of the S. typhimurium histidine permease and maltose transporter by multiple sequence alignment (Figure 14). The region flanked by Walker A 48 and Walker B motifs display considerable sequence similarity, sharing approximately 38% identity. However, HisP lacks a sequence of approximately 100 amino acids at the C-terminus, the function of which remains unclear in FbpC. C l o n e d - f b p C 1 N g - f b p C 1 P u b - f b p C 1 N m - f b p C 1 H i t C 1 S f u C 1 C l o n e d - f b p C 64 N g - f b p C 64 P u b - f b p C 64 N m - f b p C 64 H i t C 71 S f u C 63 C l o n e d - f b p C 133 N g - f b p C 133 P u b - f b p C 133 N m - f b p C 133 H i t C 140 S f u C 130 C l o n e d - f b p C 203 N g - f b p C 203 P u b - f b p C 203 N m - f b p C 203 H i t C 210 S f u C 200 Q@QA|GNGS C l o n e d - f b p C N g - f b p C P u b - f b p C N m - f b p C H i t C S f u C 273 273 273 273 280 ' £ 269 R G T L L I R P E Q F S L H P H S R G T L L I R P E Q F S L H P H S R G T L L I R P E Q F S L H P H S R G T L L I R P E Q F S L H P H S P E Q F S L PEQBffif 3LSD DNLPjjY QVT IN C l o n e d - f b p C N g - f b p C P u b - f b p C N m - f b p C H i t C S f u C Figure 13. Amino acid sequence comparison of FbpC sequences with HitC and SfuC. Four FbpC sequences are used: (1) N. gonorrhoeae FbpC sequence from this study (Cloned-fbpC); (2) N. gonorrhoeae FbpC genome sequence (Roe et al., 2000); (3) Previously published N. gonorrhoeae FbpC sequence (Adhikari et al., 1996); (4) N. meningitidis FbpC genome sequence (Parkhill et al., 2000). The highly conserved Walker A , Walker B and the Linker peptide are indicated. 49 FbpC HisP MalK I S H Q N T P |GHE DW Walker A FbpC 59 5 I s HisP 61 B MalK 58 B FbpC HisP MalK 102 i A l FbpC 166 HisP 181 MalK 161 EVM^JLQI Walker ts Linker 1 pegitl | M G F § R H B S • LLDEP s L0DEP LLDEP FbpC 22 6 HisP 240 MalK 221 LYiiPAD JLDA0L j G g g Q S P R ^ Q |EGpFPAA|NAD^EDCR|GRLP VQSgAPAgTRG| iKGSgK |SPK|NFLP |KVTH I EQiQ V E L P N RQQ I W LPVESR@VQV@ANM| FbpC 276 J3LH33gQFSLHPHSAPAASIHAVHKTTP|ARHTE0s|RgGQTv[3TLNLPSAPT|sHl HisP — MalK 281 J3G3233HLLPSDIADVTLEGEVQHEQLG|ETQIHBQ|pglRQN|3vYRQNDVVL|E FbpC 336 AV§HJJDGPALFFPGNTL HisP MalK 341 FA|G|3PPERCHLFREDGSACRRLHQEPGV Figure 14. Comparison of FbpC amino acid sequence with HisP and MalK. The FbpC sequence used is that obtained from this study. The highly conserved Walker A , Walker B and the Linker peptide are indicated. 50 4.2 Production and purification of FbpC(hjs6) and the E164D mutant The fbpC gene is likely not transcribed in large quantities in N. gonorrhoeae; therefore, FbpC was expressed and purified in a recombinant system. The high content of the hydrophobic residues in FbpC (Adhikari et al., 1996) may explain the relatively low solubility of the overproduced FbpC fusion proteins. The first few attempts of native FbpC purification did not yield protein fractions clearly visible on Coomassie blue-stained SDS-PAGE. Denaturing purification of FbpC(hjS6) using urea was attempted, and resulted in a much greater yield (data not shown); however, recovering native proteins was unsuccessful. Urea was removed by drop-wise, continuous dilution by buffer containing 0.1% Tween-20, 50 m M NaCl and 5% glycerol. Most of the FbpC protein precipitated at approximately 0.6 M urea. The remaining renatured protein did not show ATP-hydrolyzing activity, possibly due to improper folding following removal of the denaturant. A native FbpC(hiS6) purification procedure was optimized. Purification of FbpC(hiS6) to near homogeneity was achieved by a two-step procedure, by nickel-chelate affinity chromatography followed by ion-exchange chromatography (Figure 9). Keeping a 0.4 M NaCl concentration in the initial purification step and the addition of 2 m M ATP and 20% glycerol throughout the purification procedures are both critical to maintain the protein in solution. The difficulty encountered in solubilizing FbpC(hjS6) is consistent with the previous findings that both MalK and HisP were prone to aggregation (Nikaido et al., 1997; Walter et al., 1992). Overproduced MalK was sequestered in inclusion bodies and purified by denaturation-renaturation procedures that included solubilizing inclusion bodies with urea and purifying the protein by red agarose chromatography (Walter et al., 1992). Soluble 51 HisP also showed a requirement for 5 mM ATP and 20% glycerol, both added throughout the purification procedure to obtain sufficient quantities for characterization (Nikaido et al., 1997). Purification by nickel-affinity chromatography does not yield sufficiently pure FbpC(his6) (Figure 9). The problem of co-purification of targeted protein with non-histidine tagged host proteins was solved by the addition of an extra purification step: anion exchange chromatography. In contrast, the purification of HisP yielded proteins greater than 95% pure by a single metal (cobalt-based) affinity chromatography step (Nikaido et al., 1997). The extra purification step for FbpC(hjS6) is required possibly because of the lower initial concentration of soluble overexpressed FbpC(hiS6), leading to a higher level of non-specific binding of host proteins on the column. The difference in the properties of the two proteins and of the interaction between host cell proteins to the column may also be a contributing factor. In any case, the goal of removing contaminant proteins from FbpC(hiS6) after passage through the high-Q cartridge was achieved. The maximum yield of pure FbpC(hiS6) was 0.6 - 0.7 mg per liter of culture. In comparison, purification of HisP(hiS6) yielded approximately 2 mg of pure protein per liter of culture (Nikaido et al., 1997). It should also be noted that attempts to concentrate pure FbpC(his6) to greater than 1 mg/ml had not been successful, which made characterization of the protein difficult because larger volumes had to be used. The additional 100 amino acids at the C-terminus that contain many hydrophobic residues may increase the tendency for FbpC(his6) to aggregate, effectively reducing the solubility. 52 The recently resolved HisP crystal structure showed that residue G l u 1 7 9 in HisP is responsible for forming a water bridged hydrogen bond with the y-phosphate of the bound ATP at the active site (Hung et al., 1998). The E179D mutant of HisP eliminated transport activity but allowed ATP binding (Shyamala et al., 1991), suggesting that this residue is only necessary for ATP hydrolysis but does not affect greatly nucleotide binding. The corresponding residue in FbpC is El64. The construction of such a mutant is desirable because the presence of ATP is absolutely essential for solubility in the current purification process, possibly due to the stabilization effect provided by the interaction between ATP and FbpC ( h i S6). I constructed an FbpC mutant E164D and compared its activity with the wild-type. The E164D FbpC(hjS6) preparation by this identical purification step also yielded proteins that contain similar ATPase activity as the wild-type, but the addition of the second ion-exchange chromatography step produced a E164D FbpC(hiS6) preparation that contained at least a ten-fold reduction in specific activity. This observation of reduced activity in the E164D mutant was reproducible, suggesting that the activity observed from the wild-type (after the two-step purification procedure) is due to the pure FbpC(hiS6) protein and not some impurities from the preparation. 53 4.3 Nucleotide binding and A T P hydrolyzing activity of FbpC(hi S6) The purified wild-type FbpC(hiS6) protein could be photolabeled with N 3 A T P , indicating a suitable nucleotide binding site. The interaction was specific as preincubation with increasing ATP concentration washed out the labeling (Figure 12). The Michaelis-Menten constant of other traffic ATPases for ATP varies widely, with high K m values mostly in the range of 50 to several thousand p M (Holland and Blight, 1999). Additional binding and activity assays are required in order for the binding constant of FbpC(hiS6) (for ATP) to be determined accurately, but preliminary experiments indicated that the K m is in the millimolar range (data not shown), consistent with the idea that in general traffic ATPases have relatively low affinity for ATP (Holland and Blight, 1999). FbpC displays ATP-hydrolyzing activity with a specific activity of approximately 0.5 pmol/min/mg, comparable to that determined for MalK of the S. typhimurium maltose transporter (0.7-1.3 pmol/min/mg) (Morbach et al., 1993; Schneider and Hunke, 1998) and HisP of the histidine permease in S. typhimurium (0.5 pmol/min/mg) (Nikaido et al., 1997) 2+ General characteristics of the enzyme, such as M g and pH dependence are in agreement with previous findings of isolated MalK (Morbach et al., 1993) and HisP (Nikaido et a l , 1997). Glycerol was found to exert a positive effect on the activity of FbpC(hiS6)- This finding is different from that observed for HisP, where glycerol concentration greater than 10% (v/v) resulted in a decrease in ATP hydrolysis. It should be noted, however, that the activity values obtained and the general characteristics observed should be treated with caution because isolated ATP-binding domains may exhibit different properties in the 54 absence of the integral permease subunits and the periplasmic binding component in a reconstituted complex. The ATPase activity of HisP was studied in both purified forms (0.5 pmol/min/mg) and in a HisQMP 2 reconstituted liposome complexes (0.37 pmol/min/mg in the presence of liganded HisJ, the periplasmic binding component). Observed differences in the properties of HisP in the two forms include a lack of cooperativity for ATP in isolated HisP, and a stimulatory effect of HisJ on ATPase activity only in the reconstituted complex (Liu et al., 1997) and not in isolated HisP (Nikaido et al., 1997). Different HisP mutants were characterized to investigate how different amino acid residues contributed to ATP binding or hydrolysis, or to the interaction between the nucleotide binding domain and the membrane permease components. The mutational analyses have further established the functional importance of conserved motifs such as the Walker A and Walker B regions for ATP binding, and the signature motif (also called the linker region) and the helical region for coupling of ATP hydrolysis to transport (Schneider and Hunke, 1998). 4.4 Conclusion The goal of this study was to work towards showing that FbpC is a nucleotide binding domain for the periplasm-to-cytosol transport of iron in Neisseria gonorrhoeae. A biochemical approach was taken to characterize the recombinant FbpC protein. Amplification and cloning of the N. gonorrhoeae fbpC gene into the pET28a expression vector produced a stable genetic construct, pEfbpC3. FbpC(hiS6) was successfully overexpressed in HMS174(DE3) cells containing the pEfbpC3 plasmid and purified by 55 nickel-chelate affinity chromatography and anion-exchange chromatography. The purified fusion protein was enzymatically active, as it has the ability to hydrolyze ATP and to interact with 8-azido-[y32P]ATP. The specific activity of FbpC as an isolated ATPase is 0.5 pmol/min/mg. 4.5 Future directions Establishing FbpC(hiS6) as a functional ATPase biochemically was an important initial characterization of FbpC. To further establish the physiological relevance of the ATPase activity of FbpC(hjS6)> the activity should be compared to that of the reconstituted FbpABC complex. Mutational analyses of FbpC will also help identify its interaction with the permease subunit (FbpB) and provide further insight into the mechanism of energy coupling to the rest of the transport system. Given the diversity of pathogenic bacteria that express A B C transporter operons that take up iron at the periplasm-to-cytosol level and their amino acid sequence similarity, I am convinced that FbpC functions as an ATP-binding subunit in Neisseria! iron transport. 56 5. BIBLIOGRAPHY Adhikari, P., Berish, S.A., Nowalk, A.J. , Veraldi, K .L . , Morse, S.A. and Mietzner, T.A. (1996) The fbpABC locus of Neisseria gonorrhoeae functions in the periplasm-to-cytosol transport of iron. J Bacteriol, 178, 2145-9. Adhikari, P., Kirby, S.D., Nowalk, A.J. , Veraldi, K .L . , Schryvers, A .B . and Mietzner, T.A. (1995) Biochemical characterization of a Haemophilus influenzae periplasmic iron transport operon. J Biol Chem, 270, 25142-9. Ahn, J., Wong, J.T. and Molday, R.S. (2000) The effect of lipid environment and retinoids on the ATPase activity of A B C R , the photoreceptor A B C transporter responsible for Stargardt macular dystrophy. JBiol Chem, 275, 20399-405. Allikmets, R., Singh, N . , Sun, H., Shro'yer, N.F., Hutchinson, A. , Chidambaram, A. , Gerrard, B., Baird, L., Stauffer, D., Peiffer, A. , Rattner, A. , Smallwood, P., L i , Y . , Anderson, K.L . , Lewis, R.A., Nathans, J., Leppert, M . , Dean, M . and Lupski, J.R. (1997) A photoreceptor cell-specific ATP-binding transporter gene (ABCR) is mutated in recessive Stargardt macular dystrophy [see comments], Nat Genet, 15, 236-46. Ames, G.F. (1986) Bacterial periplasmic transport systems: structure, mechanism, and evolution. Annu Rev Biochem, 55, 397-425. Angerer, A. , Gaisser, S. and Braun, V . (1990) Nucleotide sequences of the sfuA, sfuB, and sfuC genes of Serratia marcescens suggest a periplasmic-binding-protein-dependent iron transport mechanism. J Bacteriol, 172, 572-8. Angerer, A. , Klupp, B. and Braun, V. (1992) Iron transport systems of Serratia marcescens. J Bacteriol, 11 A, 1378-87. Archibald, F.S. and DeVoe, I.W. (1978) Iron in Neisseria meningitidis: minimum requirements, effects of limitation, and characteristics of uptake. J Bacteriol, 136, 35-48. Archibald, F.S. and DeVoe, I.W. (1980) Iron acquisition by Neisseria meningitidis in vitro. Infect Immun, 21, 322-34. Azarian, S.M. and Travis, G.H. (1997) The photoreceptor rim protein is an A B C transporter encoded by the gene for recessive Stargardt's disease (ABCR). FEBS Lett, 409, 247-52. Berish, S.A., Mietzner, T.A., Mayer, L.W., Genco, C.A., Holloway, B.P. and Morse, S.A. (1990) Molecular cloning and characterization of the structural gene for the major iron-regulated protein expressed by Neisseria gonorrhoeae. J Exp Med, 171, 1535-46. Berish, S.A., Subbarao, S., Chen, C.Y., Trees, D.L. and Morse, S.A. (1993) Identification and cloning of a fur homolog from Neisseria gonorrhoeae. Infect Lmmun, 61, 4599-606. Beucher, M . and Sparling, P.F. (1995) Cloning, sequencing, and characterization of the gene encoding FrpB, a major iron-regulated, outer membrane protein of Neisseria gonorrhoeae. J Bacteriol, 111, 2041-9. Bowler, L.D., Hubank, M . and Spratt, B.G. (1999) Representational difference analysis of cDNA for the detection of differential gene expression in bacteria: development using a model of iron-regulated gene expression in Neisseria meningitidis. Microbiology, 145, 3529-37. 58 Bradford, M . M . (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem, 72, 248-54. Brock, T.D., Madigan, M.T., Martinko, J.M. and Parker, J. (1994) Biology of Microorganisms. Prentice-Hall, Inc., Englewood Cliffs, NJ. Bruns, C M . , Nowalk, A.J. , Arvai, A.S., McTigue, M.A. , Vaughan, K .G . , Mietzner, T.A. and McRee, D.E. (1997) Structure of Haemophilus influenzae Fe(+3)-binding protein reveals convergent evolution within a superfamily. Nat Struct Biol, 4, 919-24. Carson, S.D., Klebba, P.E., Newton, S.M. and Sparling, P.F. (1999) Ferric enterobactin binding and utilization by Neisseria gonorrhoeae. J Bacteriol, 181, 2895-901. Chen, C.Y., Berish, S.A., Morse, S.A. and Mietzner, T.A. (1993) The ferric iron-binding protein of pathogenic Neisseria spp. functions as a periplasmic transport protein in iron acquisition from human transferrin. Mol Microbiol, 10, 311-8. Chifflet, S., Torriglia, A. , Chiesa, R. and Tolosa, S. (1988) A method for the determination of inorganic phosphate in the presence of labile organic phosphate and high concentrations of protein: application to lens ATPases. Anal Biochem, 168, 1-4. Chin, N . , Frey, J., Chang, C F . and Chang, Y.F. (1996) Identification of a locus involved in the utilization of iron by Actinobacillus pleuropneumoniae. FEMS Microbiol Lett, 143, 1-6. Collins, F.S. (1992) Cystic fibrosis: molecular biology and therapeutic implications. Science, 256, 774-9. 59 Cornelissen, C.N., Anderson, J.E. and Sparling, P.F. (1997) Energy-dependent changes in the gonococcal transferrin receptor. Mol Microbiol, 26, 25-35. Cornelissen, C.N., Biswas, G.D. and Sparling, P.F. (1993) Expression of gonococcal transferrin-binding protein 1 causes Escherichia coli to bind human transferrin. J Bacteriol, 175,2448-50. Cornelissen, C.N., Biswas, G.D., Tsai, J., Paruchuri, D.K., Thompson, S.A. and Sparling, P.F. (1992) Gonococcal transferrin-binding protein 1 is required for transferrin utilization and is homologous to TonB-dependent outer membrane receptors. J Bacteriol, 174, 5788-97. Cornelissen, C.N. and Sparling, P.F. (1994) Iron piracy: acquisition of transferrin-bound iron by bacterial pathogens. Mol Microbiol, 14, 843-50. Criado, M.T., Pintor, M . and Ferreiros, C M . (1993) Iron uptake by Neisseria meningitidis. Res Microbiol, 144, 77-82. Crichton, R.R. (1990) Proteins of iron storage and transport. Adv Protein Chem, 40, 281-363. Davidson, A . L . and Nikaido, H. (1991) Purification and characterization of the membrane-associated components of the maltose transport system from Escherichia coli. J Biol Chem, 266, 8946-51. Desai, P.J., Angerer, A . and Genco, C A . (1996) Analysis of Fur binding to operator sequences within the Neisseria gonorrhoeae fbpA promoter. J Bacteriol, 178, 5020-3. 60 Doige, C A . and Ames, G.F. (1993) ATP-dependent transport systems in bacteria and humans: relevance to cystic fibrosis and multidrug resistance. Annu Rev Microbiol, 47, 291-319. Doolittle, R.F., Johnson, M.S., Husain, I., Van Houten, B., Thomas, D . C and Sancar, A . (1986) Domainal evolution of a prokaryotic DNA repair protein and its relationship to active-transport proteins. Nature, 323, 451-3. Fath, M.J. and Kolter, R. (1993) A B C transporters: bacterial exporters. Microbiol Rev, 57, 995-1017. Finkelstein, R.A. and Yancey, R.J. (1981) Effect of siderophores on virulence of Neisseria gonorrhoeae. Infect Immun, 32, 609-13. Genco, C A . and Desai, P.J. (1996) Iron acquisition in the pathogenic Neisseria. Trends in Microbiology, 4, 179-84. Germann, U.A. , Pastan, I. and Gottesman, M . M . (1993) P-glycoproteins: mediators of multidrug resistance. Semin Cell Biol, 4, 63-76. Gorwitz, R.J., Nakashima, A .K . , Moran, J.S. and Knapp, J.S. (1993) Sentinel surveillance for antimicrobial resistance in Neisseria gonorrhoeae---United States, 1988-1991. The Gonococcal Isolate Surveillance Project Study Group. Mor Mortal Wkly Rep CDC Surveill Summ, 42, 29-39. Gottesman, M . M . and Pastan, I. (1993) Biochemistry of multidrug resistance mediated by the multidrug transporter. Annu Rev Biochem, 62, 385-427. Gray-Owen, S.D. and Schryvers, A . B . (1996) Bacterial transferrin and lactoferrin receptors. Trends Microbiol, 4, 185-91. Hejazi, A . and Falkiner, F.R. (1997) Serratia marcescens. J Med Microbiol, 46, 903-12. 61 Higgins, C F . (1992) A B C transporters: from microorganisms to man. Annu Rev Cell Biol, 8,67-113. Higgins, C.F., Haag, P.D., Nikaido, K. , Ardeshir, F., Garcia, G. and Ames, G.F. (1982) Complete nucleotide sequence and identification of membrane components of the histidine transport operon of S. typhimurium. Nature, 298,123-1. Holbein, B.E. (1980) Iron-controlled infection with Neisseria meningitidis in mice. Infect Immun, 29, 886-91. Holbein, B.E. (1981) Enhancement of Neisseria meningitidis infection in mice by addition of iron bound to transferrin. Infect Immun, 34, 120-5. Holland, I.B. and Blight, M.A. (1999) ABC-ATPases, adaptable energy generators fuelling transmembrane movement of a variety of molecules in organisms from bacteria to humans. J Mol Biol, 293, 381-99. Hung, L.W., Wang, I.X., Nikaido, K. , Liu, P.Q., Ames, G.F. and Kim, S.H. (1998) Crystal structure of the ATP-binding subunit of an A B C transporter [see comments]. Nature, 396, 703-7. Jones, P .M. and George, A . M . (1999) Subunit interactions in A B C transporters: towards a functional architecture. FEMS Microbiol Lett, 179, 187-202. Karkhoff-Schweizer, R.R., Schryvers, A .B . and Schweizer, H.P. (1994) Cloning and sequence analysis of the fur gene encoding an iron- regulatory protein of Neisseria meningitidis. Gene, 141, 139-40. Kerppola, R.E. and Ames, G.F. (1992) Topology of the hydrophobic membrane-bound components of the histidine periplasmic permease. Comparison with other members of the family. J Biol Chem, 267, 2329-36. Kerppola, R.E., Shyamala, V .K . , Klebba, P. and Ames, G.F. (1991) The membrane-bound proteins of periplasmic permeases form a complex. Identification of the histidine permease HisQMP complex. J Biol Chem, 266, 9857-65. Khun, H.H., Deved, V. , Wong, H. and Lee, B.C. (2000) fbpABC gene cluster in Neisseria meningitidis is transcribed as an operon [In Process Citation]. Infect Immun, 68, 7166-71. Khun, H.H., Kirby, S.D. and Lee, B.C. (1998) A Neisseria meningitidis fbpABC mutant is incapable of using nonheme iron for growth. Infect Immun, 66, 2330-6. Klee, S.R., Nassif, X . , Kusecek, B., Merker, P., Beretti, J.L., Achtman, M . and Tinsley, C R . (2000) Molecular and biological analysis of eight genetic islands that distinguish Neisseria meningitidis from the closely related pathogen Neisseria gonorrhoeae. Infect Immun, 68, 2082-95. Koronakis, E., Hughes, C , Milisav, I. and Koronakis, V. (1995) Protein exporter function and in vitro ATPase activity are correlated in ABC-domain mutants of HlyB. Mol Microbiol, 16, 87-96. Koronakis, V. , Hughes, C. and Koronakis, E. (1993) ATPase activity and ATP/ADP-induced conformational change in the soluble domain of the bacterial protein translocator HlyB. Mol Microbiol, 8, 1163-75. Lind, I. (1997) Antimicrobial resistance in Neisseria gonorrhoeae. Clin Infect Dis, 24 Suppl 1, S93-7. Liu, C.E., Liu, P.Q. and Ames, G.F.L. (1997) Characterization of the adenosine triphosphatase activity of the periplasmic histidine permease, a traffic ATPase (ABC transporter). JBiol Chem, 272, 21883-91. Liu, P.Q. and Ames, G.F. (1998) In vitro disassembly and reassembly of an A B C transporter, the histidine permease. PNAS, 95, 3495-500. Liu, P.Q., Liu, C E . and Ames, G.F. (1999) Modulation of ATPase activity by physical disengagement of the ATP-binding domains of an A B C transporter, the histidine permease. J Biol Chem, 274, 18310-8. McKenna, W.R., Mickelsen, P.A., Sparling, P.F. and Dyer, D.W. (1988) Iron uptake from lactoferrin and transferrin by Neisseria gonorrhoeae. Infect Immun, 56, 785-91. Meyer, T.H., van Endert, P .M. , Uebel, S., Ehring, B. and Tampe, R. (1994) Functional expression and purification of the A B C transporter complex associated with antigen processing (TAP) in insect cells. FEBS Lett, 351, 443-7. Mickelsen, P. A. , Blackman, E. and Sparling, P.F. (1982) Ability of Neisseria gonorrhoeae, Neisseria meningitidis, and commensal Neisseria species to obtain iron from lactoferrin. Infect Immun, 35, 915-20. Mickelsen, P. A . and Sparling, P.F. (1981) Ability of Neisseria gonorrhoeae, Neisseria meningitidis, and commensal Neisseria species to obtain iron from transferrin and iron compounds. Infect Immun, 33, 555-64. Mietzner, T.A., Barnes, R . C , JeanLouis, Y . A . , Shafer, W.M. and Morse, S.A. (1986) Distribution of an antigenically related iron-regulated protein among the Neisseria spp. Infect Immun, 51, 60-8. Mietzner, T.A., Bolan, G., Schoolnik, G.K. and Morse, S.A. (1987) Purification and characterization of the major iron-regulated protein expressed by pathogenic Neisseriae. J Exp Med, 165, 1041-57. 64 Mietzner, T.A., Luginbuhl, G.H., Sandstrom, E. and Morse, S.A. (1984) Identification of an iron-regulated 37,000-dalton protein in the cell envelope of Neisseria gonorrhoeae. Infect Immun, 45, 410-6. Mietzner, T.A., Tencza, S.B., Adhikari, P., Vaughan, K . G . and Nowalk, A.J . (1998) Fe(III) periplasm-to-cytosol transporters of gram-negative pathogens. Curr Top Microbiol Immunol, 225, 113-35. Mimura, C.S., Admon, A. , Hurt, K . A . and Ames, G.F. (1990) The nucleotide-binding site of HisP, a membrane protein of the histidine permease. Identification of amino acid residues photoaffinity labeled by 8-azido-ATP. J Biol Chem, 265, 19535-42. Morbach, S., Tebbe, S. and Schneider, E. (1993) The ATP-binding cassette (ABC) . transporter for maltose/maltodextrins of Salmonella typhimurium. Characterization of the ATPase activity associated with the purified MalK subunit. J Biol Chem, 268, 18617-21. Murphy, T.F. and Apicella, M.A. (1987) Nontypable Haemophilus influenzae: a review of clinical aspects, surface antigens, and the human immune response to infection. Rev Infect Dis, 9, 1-15. Neilands, J.B. (1982) Microbial envelope proteins related to iron. Annu Rev Microbiol, 36, 285-309. Neilands, J.B. (1995) Siderophores: structure and function of microbial iron transport compounds. J Biol Chem, 270, 26723-6. Neilands, J.B., Konopka, K., Schwyn, B., Coy, M . , Francis, R.T., Paw, B.H. and Bagg, A . (1987) Comparative Biochemistry of Microbial Iron Assimilation. In Winkelmann, 65 G., van der Helm, D. and Neilands, J.B. (eds.), Iron Transport in Microbes, Plants and Animals. V C H Press, Weinheim, pp. pp. 3-33. Nelson, R . M . and Long, G.L. (1989) A general method of site-specific mutagenesis using a modification of the Thermus aquaticus polymerase chain reaction. Anal Biochem, 180, 147-51. Nikaido, K. and Ames, G.F. (1999) One intact ATP-binding subunit is sufficient to support ATP hydrolysis and translocation in an A B C transporter, the histidine permease. J Biol Chem, 21 A, 26727-35. Nikaido, K. , Liu, P.Q. and Ames, G.F. (1997) Purification and characterization of HisP, the ATP-binding subunit of a traffic ATPase (ABC transporter), the histidine permease of Salmonella typhimurium. Solubility, dimerization, and ATPase activity. J Biol Chem, 272, 27745-52. Parkhill, J., Achtman, M . , James, K.D. , Bentley, S.D., Churcher, C , Klee, S.R, Morelli, G., Basham, D., Brown, D., Chillingworth, T., Davies, R .M. , Davis, P., Devlin, K. , Feltwell, T., Hamlin, N . , Holroyd, S., Jagels, K., Leather, S., Moule, S., Mungall, K., Quail, M.A. , Rajandream, M.A. , Rutherford, K . M . , Simmonds, M . , Skelton, J., Whitehead, S., Spratt, B.G. and Barrell, B.G. (2000) Complete D N A sequence of a serogroup A strain of Neisseria meningitidis Z2491 [see comments]. Nature, 404, 502-6. Payne, S.M. (1993) Iron acquisition in microbial pathogenesis. Trends Microbiol, 1, 66-9. Payne, S.M. and Finkelstein, R.A. (1975) Pathogenesis and immunology of experimental gonococcal infection: role of iron in virulence. Infect Immun, 12, 1313-8. 66 Payne, S.M. and Lawlor, K . M . (1990) Molecular Studies on Iron Acquisition by Non-Escherichia coli Species. In Iglewski, B.H. and Clark, V .L . (eds.), Molecular Basis of Bacterial Pathogenesis. Academic Press, Inc., San Diego, CA. Pettersson, A. , Maas, A . and Tommassen, J. (1994) Identification of the iroA gene product of Neisseria meningitidis as a lactoferrin receptor. J Bacteriol, 176, 1764-6. Roe, B.A. , Song, L., Lin, S.P., Yuan, X . , Clifton, S., Ducey, T., Lewis, L. and Dyer, D.W. (2000) Neisseria gonorrhoeae Genome Sequencing Strain F A 1090. http://www.genome.ou.edu/gono.html. Saken, E., Rakin, A . and Heesemann, J. (2000) Molecular characterization of a novel siderophore-independent iron transport system in Yersinia [In Process Citation]. Int J Med Microbiol, 290, 51-60. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, New York. Sanders, J.D., Cope, L.D. and Hansen, E.J. (1994) Identification of a locus involved in the utilization of iron by Haemophilus influenzae. Infect Immun, 62, 4515-25. Schade, A . L . and Caroline, L. (1944) Raw Hen Egg White and the Role of Iron in Growth Inhibition oi Shigella dysenteriae, Staphylococcus auerus, Escherichia coli and Saccharomyces cerevisiae. Science, 100, 14-15. Schade, A . L . and Caroline, L. (1946) An Iron-binding Component in Human Blood Plasma. Science, 104, 340-341. Schneider, E. and Hunke, S. (1998) ATP-binding-cassette (ABC) transport systems: functional and structural aspects of the ATP-hydrolyzing subunits/domains. FEMS Microbiol Rev, 22, 1-20. Schryvers, A.B. , Bonnah, R., Yu, R.H., Wong, H. and Retzer, M . (1998) Bacterial lactoferrin receptors. Adv Exp Med Biol, 443, 123-33. Schryvers, A . B . and Stojiljkovic, I. (1999) Iron acquisition systems in the pathogenic Neisseria. Mol Microbiol, 32, 1117-23. Sebastian, S. and Genco, C.A. (1999) FbpC is not essential for iron acquisition in Neisseria gonorrhoeae. Infect Immun, 67, 3141-5. Shyamala, V. , Baichwal, V. , Beall, E. and Ames, G.F. (1991) Structure-function analysis of the histidine permease and comparison with cystic fibrosis mutations. J Biol Chem, 266, 18714-9. Stojiljkovic, I., Hwa, V. , de Saint Martin, L., O'Gaora, P., Nassif, X . , Heffron, F. and So, M . (1995) The Neisseria meningitidis haemoglobin receptor: its role in iron utilization and virulence. Mol Microbiol, 15, 531-41. Stojiljkovic, I., Larson, J., Hwa, V. , Anic, S. and So, M . (1996) HmbR outer membrane receptors of pathogenic Neisseria spp.: iron- regulated, hemoglobin-binding proteins with a high level of primary structure conservation. J Bacteriol, 178, 4670-8. Thomas, C E . and Sparling, P.F. (1994) Identification and cloning of a fur homologue from Neisseria meningitidis. Mol Microbiol, 11, 725-37. Walker, J.E., Saraste, M . , Runswick, M.J. and Gay, N.J. (1982) Distantly related sequences in the alpha- and beta-subunits of ATP synthase, myosin, kinases and other ATP-requiring enzymes and a common nucleotide binding fold. EMBOJ, 1, 945-51. Walter, C , Honer zu Bentrup, K. and Schneider, E. (1992) Large scale purification, nucleotide binding properties, and ATPase activity of the MalK subunit of Salmonella typhimurium maltose transport complex. J Biol Chem, 267, 8863-9. 68 Yancey, R.J. and Finkelstein, R.A. (1981a) Assmilation of iron by pathogenic Neisseria spp. Infect Immun, 32, 592-9. Yancey, R.J. and Finkelstein, R.A. (1981b) Siderophore production by pathogenic Neisseria spp. Infect Immun, 32, 600-8. Zimmermann, L. , Angerer, A . and Braun, V . (1989) Mechanistically novel iron(III) transport system in Serratia marcescens. J Bacteriol, 171, 238-43. 69 