Exploring The Role of P2X Receptors in Age-Related Macular Degeneration by  Sena Youn  BSc, The University of British Columbia, 2020  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Cell and Developmental Biology)  THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver)  April 2024  © Sena Youn, 2024  ii  The following individuals certify that they have read, and recommend to the Faculty of Graduate and Postdoctoral Studies for acceptance, a thesis entitled:  Exploring The Role of P2X Receptors in Age-Related Macular Degeneration  submitted by Sena Youn in partial fulfillment of the requirements for the degree of Master of Science in Cell and Developmental Biology   Examining Committee: Dr. Joanne Matsubara, Professor, Ophthalmology and Visual Sciences, UBC Supervisor  Dr. Orson Moritz, Professor, Ophthalmology and Visual Sciences, UBC Supervisory Committee Member  Dr. Shernaz Bamji, Professor, Cellular and Physiological Sciences, UBC Supervisory Committee Member Dr. Sonia Yeung, Assistant Professor, Ophthalmology and Visual Sciences, UBC Additional Examiner           iii  Abstract Purinergic signaling via ATP-activated P2X receptors has been studied in age-related macular degeneration (AMD), where retinal pigment epithelium (RPE) cells release ATP and contribute to inflammation and apoptosis. This study focuses on the less-explored P2X4 receptor alongside the well-studied P2X7 receptor in cultured RPE cells, human post-mortem eyes, and mouse eyes to investigate their potential roles in AMD. Immunocytochemistry indicated expression of P2X4 and P2X7 receptors in cultured ARPE-19 cells (cell surface and intracellular), particularly when permeabilized with Triton X-100. Immunohistochemistry on human post-mortem eyes showed that the P2X4 receptor subtype was the most immunoreactive in the RPE of eyes with soft drusen among the five donor groups. In contrast, the P2X7 receptor subtype was the least immunoreactive in the RPE of eyes with soft drusen among the five donor groups. In support of this, RT-qPCR revealed the presence of P2X4 and P2X7 mRNA in ARPE-19 cells, with P2X4 mRNA showing greater upregulation than P2X7 mRNA. Double immunolabeling using Fab fragments in human post-mortem eyes demonstrated co-localization of P2X4 and P2X7 receptors, particularly within and around choroidal cell nuclei. Spectral unmixing for RPE autofluorescence demonstrated co-localization of P2X4 and P2X7 receptors in the RPE of human post-mortem eyes, particularly within and around RPE cell nuclei. Immunohistochemistry on mouse eyes showed P2X4 and P2X7 immunolabeling in the RPE, choroid, and neuroretina. These findings suggest that P2X4 and P2X7 receptors are co-localized in human and mouse retina, but their expression profiles vary with age, donor group/mouse strain, and retinal degeneration. P2X4 receptors potentially play a role in RPE cells, warranting further investigation into their function and interaction with P2X7 receptors in AMD.   iv  Lay Summary Age-related macular degeneration (AMD) is a common cause of vision loss and blindness in older people, and unfortunately, there's no cure for it. Understanding why vision is affected in AMD is challenging because the disease is complicated with many factors involved. One potential factor is the presence of special sensors (P2X receptors) in different layers at the back of the eye. These special sensors are activated by adenosine triphosphate (ATP), which is our body's energy currency. During cellular stress, such as injury, cells in the eye release excessive levels of ATP. This overstimulates the special sensors, causing cell damage and death, possibly contributing to the loss of vision. There are seven types of these special sensors, but researchers have mainly focused on one called P2X7. However, activation of the P2X7 receptor requires abnormally high levels of ATP that are not normally present at the back of our eyes. This study looks into the other six types, especially P2X4, as a potential culprit in the development of AMD. Understanding how these receptors work is important for creating treatments to prevent vision loss in AMD.          v  Preface All experiments and data analyses were conducted by Sena Youn under the supervision of Dr. Joanne Matsubara in the Matsubara Lab at the Eye Care Centre at Vancouver General Hospital, affiliated with the University of British Columbia. The following individuals contributed to the experimental design and/or data collection: Eleanor To and Darian Cheng (Chapter 2: immunohistochemistry on human post-mortem eyes; masked semi-quantitative visual scoring), Siqi Li and Dr. Jing Cui (Chapter 2: ARPE-19 cell culture; immunocytochemistry), Dr. Printha Wijesinghe (Chapter 2: RT-qPCR; primer efficiencies), Eric Ai and Neilan Tan (Chapter 3: immunohistochemistry on mouse eyes; masked semi-quantitative visual scoring). The following data presented in Chapters 2 and 3 are currently being prepared for journal submissions. The work with human and animal tissue reported in Chapters 2 and 3 were covered by UBC Ethics Certificate numbers H20-02944, H11-02772, and A20-0150.   Figure 1.2 is reprinted from S. De Jong, J. Tang, and S. J. Clark, “Age‐related macular degeneration: A disease of extracellular complement amplification,” Immunological Reviews, vol. 313, no. 1, pp. 279–297, Jan. 2023, doi: 10.1111/imr.13145.   Figure 1.3. is reprinted from Z. Xu, Z.-M. Chen, X. Wu, L. Zhang, Y. Cao, and P. Zhou, “Distinct Molecular Mechanisms Underlying Potassium Efflux for NLRP3 Inflammasome Activation,” Front Immunol, vol. 11, p. 609441, 2020, doi: 10.3389/fimmu.2020.609441.   Figure 1.4 is reprinted from P. Illes et al., “Update of P2X receptor properties and their pharmacology: IUPHAR Review 30,” Br J Pharmacol, vol. 178, no. 3, pp. 489–514, Feb. 2021, doi: 10.1111/bph.15299.     vi  Table of Contents   Abstract ......................................................................................................................................... iii Lay Summary ............................................................................................................................... iv Preface ............................................................................................................................................ v Table of Contents ......................................................................................................................... vi List of Tables ................................................................................................................................. x List of Figures ............................................................................................................................... xi List of Abbreviations .................................................................................................................. xii Acknowledgements .................................................................................................................... xiv Dedication .................................................................................................................................... xv Chapter 1: Introduction ............................................................................................................... 1 1.1 The Human Eye....................................................................................................................... 1 1.1.1 The Retina .......................................................................................................................... 1 1.1.2 Photoreceptors ................................................................................................................... 2 1.1.3 Bipolar, Horizontal, Amacrine, and Retinal Ganglion Cells............................................. 2 1.1.4 Retinal Glial Cells.............................................................................................................. 3 1.1.5 The Retinal Pigment Epithelium ........................................................................................ 3 1.1.6 The Choroid ....................................................................................................................... 4 1.2 Age-related Macular Degeneration ....................................................................................... 6 1.2.1 Drusen ................................................................................................................................ 6 1.2.2 Geographic Atrophy........................................................................................................... 7 1.2.3 Choroidal Neovascularization ........................................................................................... 7 vii  1.2.4 ARPE-19 Cells ................................................................................................................. 10 1.2.5 AMD Mouse Models ........................................................................................................ 10 1.2.6 Current Treatments for AMD........................................................................................... 11 1.3 Purinergic Signaling System ................................................................................................ 12 1.3.1 Purinergic Signaling in the Retina .................................................................................. 12 1.3.2 NLRP3 Inflammasome Pathway ...................................................................................... 13 1.3.3 Inflammation Activation in AMD ..................................................................................... 14 1.4 P2X Receptors ....................................................................................................................... 16 1.4.1 P2X1 Receptor ................................................................................................................. 16 1.4.2 P2X2 Receptor ................................................................................................................. 17 1.4.3 P2X3 Receptor ................................................................................................................. 18 1.4.4 P2X4 Receptor ................................................................................................................. 18 1.4.5 P2X5 Receptor ................................................................................................................. 19 1.4.6 P2X6 Receptor ................................................................................................................. 20 1.4.7 P2X7 Receptor ................................................................................................................. 20 1.5 Study Overview ..................................................................................................................... 23 1.5.1 Study Rationales............................................................................................................... 23 1.5.2 Study Objectives ............................................................................................................... 24 1.5.3 Study Hypotheses ............................................................................................................. 24 1.5.4 Outline of Experiments .................................................................................................... 25 1.5.5 Significance of the Study .................................................................................................. 27 Chapter 2: P2X Receptors in Human Eyes .............................................................................. 28 2.1 Introduction ........................................................................................................................... 28 viii  2.2 Methods .................................................................................................................................. 30 2.2.1 ARPE-19 Cell Culture and Immunocytochemistry .......................................................... 30 2.2.2 Human Post-mortem Eyes and Immunohistochemistry ................................................... 31 2.2.3 Assessment of P2X1-7 in ARPE-19 via RT-qPCR ........................................................... 33 2.2.4 P2X4 and P2X7 Double Labeling using Fab Fragments ................................................ 35 2.2.5 Spectral Imaging and Linear Unmixing using the LSM 800 ........................................... 36 2.3 Results .................................................................................................................................... 37 2.3.1 P2X4 and P2X7 Baseline Protein Expression in Cultured ARPE-19 Cell Line .............. 37 2.3.2 Immunolabeling Scores and Trends for P2X4 and P2X7 in Human RPE ....................... 40 2.3.3 Immunolabeling Scores and Trends for P2X4 and P2X7 in Human Choroid ................. 44 2.3.4 P2X4 and P2X7 mRNA Expression Levels in ARPE-19 Cells ......................................... 44 2.3.5 P2X4 and P2X7 Fab Fluorescent Double Labeling in Human Post-mortem Eyes ......... 45 2.3.6 Spectral Imaging and Linear Unmixing  for RPE Autofluorescence ............................... 47 2.4 Discussion............................................................................................................................... 49 2.4.1 ARPE-19 Cells in RPE and AMD Studies........................................................................ 49 2.4.2 P2X7 in the Implications of Inflammation ....................................................................... 49 2.4.3 P2X4 in the Implications of Inflammation ....................................................................... 50 2.4.4 P2X4 and P2X7 in Eyes Containing Soft Drusen ............................................................ 51 2.4.5 Co-expression and Co-localization of P2X4 and P2X7 ................................................... 51 2.4.6 P2X4 and P2X7 in NLRP3 Inflammasome Activation ..................................................... 52 2.4.7 P2X4 and P2X7 in Intracellular Trafficking ................................................................... 53 Chapter 3: P2X Receptors in Mouse Eyes ................................................................................ 54 3.1 Introduction ........................................................................................................................... 54 ix  3.2 Methods .................................................................................................................................. 55 3.2.1 Mouse Eyes and Immunohistochemistry .......................................................................... 55 3.3 Results .................................................................................................................................... 56 3.3.1 Immunolabeling Scores and Trends for P2X4 and P2X7 in Mouse RPE and Choroid ... 56 3.3.2 Immunolabeling Scores and Trends for P2X4 and P2X7 in Mouse Neuroretina ............ 58 3.3.3 Expression and Localization of P2X4 and P2X7 in the Inner and Outer Mouse Retina . 61 3.4 Discussion............................................................................................................................... 63 3.4.1 P2X4 and P2X7 in the Mouse Retina ............................................................................... 63 3.4.2 Spatial Single Cell Atlas of the Mouse Retina ................................................................. 63 3.4.3 Apolipoprotein E Knockout Mice and Inflammation Implicated in AMD ....................... 64 3.4.4 Laser-induced Choroidal Neovascularization in Mice .................................................... 65 Chapter 4: Study Conclusions ................................................................................................... 66 4.1 Summary ................................................................................................................................ 66 4.2 Strengths and Limitations .................................................................................................... 66 4.3 Anticipated Significance ....................................................................................................... 68 4.4 Future Directions .................................................................................................................. 68 Bibliography ................................................................................................................................ 70 Appendix ...................................................................................................................................... 88   x  List of Tables Table 2.1 List of antibodies used in immunohistochemistry. ....................................................... 32 Table 2.2 List of primer sequences used to amplify the target genes. .......................................... 34 Table 2.3 Summary of P2X4 and P2X7 mean scores in human RPE and choroid. ...................... 41 Table 3.1 Summary of P2X4 and P2X7 mean scores in mouse RPE and choroid. ...................... 57 Appendix Table 1. P2X3-7 primer efficiencies for RT-qPCR. .................................................... 90   xi  List of Figures Figure 1.1 Layers and cell types of the retina. ................................................................................ 5 Figure 1.2 Stages of age-related macular degeneration .................................................................. 9 Figure 1.3 NLRP3 inflammasome priming and activation. .......................................................... 15 Figure 1.4 P2X receptor subtype-selective antagonists. ............................................................... 22 Figure 2.1 P2X4 and P2X7 receptor immunofluorescent labeling on ARPE-19 (cell surface). .. 38 Figure 2.2 P2X4 and P2X7 receptor immunofluorescent labeling in ARPE-19 cells (overall). .. 39 Figure 2.3 Semi-quantitative immunolabeling trends in human RPE and choroid.   ................... 42 Figure 2.4 P2X4 and P2X7 immunolabeling in human RPE and choroid.................................... 43 Figure 2.5 Relative mRNA levels of P2X4 and P2X7.................................................................. 45 Figure 2.6 P2X4 and P2X7 Fab fragment double labeling. .......................................................... 46 Figure 2.7 P2X4 and P2X7 co-localization in human RPE and choroid. ..................................... 47 Figure 2.8 P2X4 and P2X7 immunolabeling in human RPE after spectral unmixing. ................ 48 Figure 3.1 P2X4 and P2X7 immunolabeling in mouse RPE and choroid. ................................... 58 Figure 3.2 P2X4 and P2X7 immunolabeling in mouse neuroretina. ............................................ 60 Figure 3.3 Absence of RPE autofluorescence in mouse eyes. ...................................................... 61 Figure 3.4 P2X4 and P2X7 labeling in the inner and outer mouse retina. ................................... 62 Appendix Figure 1. Masked semi-quantitative visual scoring analysis. ....................................... 88 Appendix Figure 2. P2X3-7 mRNA in cultured ARPE-19 cells. ................................................. 89   xii  List of Abbreviations Aβ    Amyloid beta AC   Amacrine cell AF   Autofluorescence  AMD   Age-related macular degeneration ApoE   Apolipoprotein E  AREDS  Age-Related Eye Disease Study  ASC  Apoptosis-associated speck-like protein containing a caspase recruitment domain ATP   Adenosine triphosphate BC   Bipolar cell BM   Bruch’s membrane CNV   Choroidal neovascularization DAMP   Damage-associated molecular pattern DMEM  Dulbecco’s Modified Eagle Medium EC   Effective Concentration  ELM   External limiting membrane FBS   Fetal bovine serum  GA   Geographic atrophy  GCL    Ganglion cell layer GSDMD   Gasdermin D  HC   Horizontal cell IL-1β    Interleukin-1beta   xiii  IL-18   Interleukin-18 ILM    Inner limiting membrane INL   Inner nuclear layer IPL    Inner plexiform layer LPS    Lipopolysaccharide MOC    Mander’s overlap coefficient  MG   Müller glia NF-κB   Nuclear factor-kappaB NFL    Nerve fiber layer NLRP3   Nucleotide-binding oligomerization domain-like receptor 3 ONL    Outer nuclear layer PAMP   Pathogen-associated molecular pattern PBS    Phosphate buffered saline  PL   Photoreceptor layer PPADS   Pyridoxalphosphate-6-azophenyl-2′,4′-disulfonic acid  RGC   Retinal ganglion cell RPE    Retinal pigment epithelium  SD   Soft drusen TLR   Toll-like receptor TX-100      Triton X-100  VEGF   Vascular endothelial growth factor   xiv  Acknowledgements Words cannot adequately convey my gratitude to my supervisor, Dr. Joanne Matsubara, for accepting me as a graduate student amid a pandemic and providing me with the opportunity to delve into eye research in such an enriching environment. I extend my immense appreciation to my advisory committee members, Dr. Orson Mortiz and Dr. Shernaz Bamji, for their thought-provoking questions and invaluable advice. I am profoundly thankful to all the members of the Matsubara lab, and especially to Eleanor To, Darian Cheng, Dr. Jing Cui, Dr. Jeanne Xi, Siqi Li, Dr. Printha Wijesinghe, Manjosh Uppal, Dr. Hyung-Suk Yoo, Eric Ai, Neilan Tan, Dr. Grace Kuo, and Dr. Harshini Chakravarthy, for consistently answering my questions and providing guidance throughout various experiments. Last but certainly not least, I want to express my gratitude to my parents, extended family members, partner, and friends for their boundless love and unwavering support throughout my life.  xv  Dedication To all the ones I love. 1  Chapter 1: Introduction  1.1 The Human Eye Our eyes are complex sensory organs comprising numerous complementary parts, each with specific and coordinated functions, working together to enable sight. The main parts of the eye are the cornea, sclera, iris, pupil, lens, retina, optic nerve, vitreous humor, aqueous humor, ciliary body, choroid, fovea, macula, conjunctiva, eyelids, and eyelashes [1]. The cornea and lens collaborate to collect and focus incoming light onto the retina, housing photoreceptor cells (rods and cones) that convert light into electrical signals (phototransduction). These electrical signals are then transmitted to the brain via the optic nerve for processing and interpretation as three-dimensional images [2]. The retina is the most essential part of the eye as it is responsible for collecting and relaying visual information to the brain.  1.1.1 The Retina The retina is the innermost, light-sensitive layer of the eye that converts the entering light into electrical signals sent to the brain (Figure 1.1). The retina consists of ten distinct layers (from innermost to outermost): inner limiting membrane (ILM), nerve fiber layer (NFL), ganglion cell layer (GCL), inner plexiform layer (IPL), inner nuclear layer (INL), outer plexiform layer (OPL), outer nuclear layer (ONL), external limiting membrane (ELM), photoreceptor layer (PL), and retinal pigment epithelium (RPE) [3]. The path of light is inverted relative to the layers of the human retina, passing through the GCL first, then through the IPL, INL, OPL, ONL, and ultimately the photoreceptors [4]. Within these layers are various types of cells that play essential roles in vision. The retina is comprised of six different cell types: rods, cones, bipolar cells, horizontal 2  cells, amacrine cells, and retinal ganglion cells [5]. These cells are uniquely distributed in the retinal layers and have extensive interconnections via two different pathways: vertical and horizontal [6].  1.1.2 Photoreceptors  The vertical pathway begins with phototransduction in the outermost layer of the retina (ONL) with the absorption of light by two different types of photoreceptor cells: rods and cones [7]. Rods constitute approximately 95% of the photoreceptors in the human retina, are responsible for vision in low-light conditions (scotopic vision), provide an achromatic visual scene, and are predominantly concentrated in the outer retina for peripheral vision. Although cones make up only 5% of the remaining photoreceptors, visual acuity and color vision are achieved by cones predominantly concentrated in the central region of the retina called the fovea (devoid of rods) during bright light conditions (photopic vision) [8]. Photoreceptor nuclei in the ONL are crucial for capturing various lighting conditions to initiate visual information processing. Aging is associated with a decrease in photoreceptor layer thickness, which may impact many cellular physiological processes for visual processing [9].   1.1.3 Bipolar, Horizontal, Amacrine, and Retinal Ganglion Cells  The signals generated by photoreceptors are then transmitted to bipolar cells in the INL. The INL contains the nuclei of bipolar cells, horizontal cells, and amacrine cells, and the GCL contains the nuclei of retinal ganglion cells. The OPL contains the processes and terminals of photoreceptors, bipolar cells, and horizontal cells, and the IPL contains the processes and terminals of bipolar cells, amacrine cells, and retinal ganglion cells [10]. The horizontal pathway comprises 3  of horizontal cells that laterally connect signals between photoreceptors and bipolar cells, and amacrine cells that laterally connect signals between bipolar cells and retinal ganglion cells [11]. Horizontal and amacrine cells modulate the responses of bipolar and retinal ganglion cells [12]. The retinal ganglion cells will then transmit the processed visual information as electrical impulses to the brain via the optic nerve [13]. Since visual processing relies on these interconnections, a loss of function (e.g., a loss in photoreceptors), leads to abnormal morphological and physiological changes in the other cell types, and hence disrupts visual functioning [14].  1.1.4 Retinal Glial Cells The retina contains both neuronal (photoreceptors/bipolar/horizontal/amacrine/ganglion) and glial compartments. The human retina consists of three types of glial cells: Müller glia, astrocytes, and microglia [15]. Out of the three types of glial cells in the human retina, Müller cells are the most common, with processes that interact with all layers of the retina, suggesting potential communication with all retinal neurons [16],[17],[18]. Under normal conditions, glial cells function to maintain retinal homeostasis (e.g., metabolic support to neuronal cells, synaptic processing, immunosurveillance), whereas under pathological conditions, they are associated with retinal compromise (e.g., neuronal dysfunction, vascular abnormalities, chronic inflammation) [19],[20],[21],[22],[23].  Additionally, retinal glia undergo structural and functional changes with age [24].  1.1.5 The Retinal Pigment Epithelium  The retinal pigment epithelium is a monolayer of hexagonally shaped cells situated beneath the photoreceptors. Furthermore, the RPE is rich in pigment particles, including melanin and 4  lipofuscin [25]. The apical-basolateral polarity of the RPE, along with tight junction complexes, enables the formation of a barrier between the blood vessels in the choroid and the neural retina (blood-retinal barrier). The basal surface sits on a network of extracellular matrix proteins known as Bruch’s membrane (BM), whereas the microvilli of the RPE cells on the apical surface interface with the photoreceptor outer segments [26]. The RPE maintains photoreceptor homeostasis by providing physical support and essential nutrients and removing waste products produced by photoreceptor cells during their light-sensing activities via phagocytosis [27]. As the RPE ages, various structural changes occur such as the loss of pigmentation, accumulation of basal deposits, BM thickening, and microvilli atrophy, which may result in age-related vision changes [28].   1.1.6 The Choroid The choroid is a complex vascular network situated between the BM and sclera. There are three vascular beds for choroidal circulation: choriocapillaris, Sattler's layer, and Haller's layer. The choriocapillaris contains fenestrated capillaries of varying sizes, whereas Sattler’s layer contains small/medium vessels, and Haller’s layer contains large vessels [29]. The rate of blood flow per perfused volume is highest within the choroid compared to any other human tissue [30]. The choroid also contains various cell types such as endothelial cells and immune cells [31]. This highly vascularized layer maintains RPE homeostasis by supporting the metabolic needs of the RPE cells to maintain the homeostasis of the overlying photoreceptors [32]. As the choroid ages, various structural changes occur such as the loss of endothelial cells, changes in choroidal thickness, vascular dropout, and decreased circulation [33]. The normal functioning of the eye relies on the integrity and function of the RPE/choroid complex, and changes in these aspects with aging may increase susceptibility to disease-related vision loss (e.g., AMD) [34].    5   Figure 1.1 Layers and cell types of the retina.  The nerve fiber layer (NFL) primarily comprises the axons of retinal ganglion cells. The ganglion cell layer (GCL) contains the cell bodies of retinal ganglion cells. The inner plexiform layer (IPL) consists of the synaptic connections between retinal ganglion cells, bipolar cells, and amacrine cells. The inner nuclear layer (INL) contains the cell bodies of bipolar, horizontal, and amacrine cells. The outer plexiform layer (OPL) consists of the synaptic connections between bipolar cells, horizontal cells, and photoreceptor terminals. The outer nuclear layer (ONL) contains the cell bodies of photoreceptor cells. The photoreceptor layer (PL) consists of the inner and outer segments. Proper functioning of the retinal pigment epithelium (RPE), Bruch’s membrane (BM), and choroid is crucial for overall retinal health. The inner limiting membrane (ILM) and external limiting membrane (ELM) are not labeled in this diagram. Created using BioRender. 6  1.2 Age-related Macular Degeneration Age-related macular degeneration (AMD) is a neurodegenerative disease that affects the macula, the part of the retina responsible for sharp, central vision due to its high density of cone photoreceptor cells [35]. AMD is a leading cause of irreversible central visual impairment and vision loss in the elderly population of developed countries, with an expected global prevalence of 288 million by 2040 [36]. Risk factors for AMD are complex and multifactorial, including personal and environmental factors such as smoking, diet, sociodemographics, and systemic factors [37].  There are four stages of AMD classified based on the formation and size of cellular debris and waste material deposits called drusen, and RPE abnormalities (Figure 1.2). Stage one is normal aging with no or few small drusen (< 63 μm) and no RPE abnormalities. Stage two, or early AMD, includes some medium-sized drusen (63 – 124 μm) and no RPE abnormalities. Stage three, or intermediate AMD, comprises large drusen (> 124 μm) and RPE abnormalities. Stage four, or advanced AMD, is classified into two main forms: non-neovascular or dry AMD, and neovascular or wet AMD [38].  1.2.1 Drusen  Drusen are yellow or white deposits made of lipids, proteins, and cellular debris [39]. These deposits accumulate between the BM/RPE and are a hallmark of both passive age-related changes and pathogenic AMD development [40]. Drusen are categorized into two morphological phenotypes: soft and hard. Soft drusen deposits are larger with indistinct and less-defined borders, whereas hard drusen deposits are smaller with round and well-defined borders [41]. The presence, size, quantity, location, and type of drusen are factors that hold prognostic significance [42]. For example, a higher number of larger hard drusen located in the macula portends AMD progression 7  [43]. Drusen impairs the transfer of essential nutrients between the choroid and RPE, and thereby contributes to RPE cell dysfunction and death, and subsequent photoreceptor dysfunction and death [44]. The formation of drusen, along with the proteins associated with inflammation identified in drusen, disrupts photoreceptor/RPE/choroid homeostasis, increasing the likelihood of AMD progression [45].          1.2.2 Geographic Atrophy The late stage of non-neovascular or dry AMD is known as geographic atrophy (GA). Approximately 80 – 90% of individuals with AMD have the dry form, characterized by the presence of large and numerous drusen, BM thickening from the accumulation of drusen deposits, and photoreceptor/RPE/choriocapillaris atrophy [46]. Progressive degeneration and dysfunction of the RPE and choroid are followed by secondary photoreceptor damage, resulting in central vision loss [47],[48]. Progression of dry AMD can be slower (years or decades) and may lead to a more gradual decline in central vision [49]. Visual acuity may be spared if GA does not extend through the fovea located at the center of the macula, but will decrease if extended through the fovea [50]. Since patients with AMD commonly develop the dry form first, the onset of wet AMD occurs on a background of pre-existing dry AMD. Therefore, dry AMD may be considered a risk factor or precursor condition for the development of wet AMD [51].   1.2.3 Choroidal Neovascularization  The late stage of neovascular or wet AMD is known as choroidal neovascularization (CNV). Approximately 10 – 20% of individuals with dry AMD advance to wet AMD [52]. Wet AMD is characterized by the formation and proliferation of new and abnormal blood vessels from 8  the choroid into the BM/RPE [53]. BM thickening may result in increased choroidal vascular resistance and decreased choroidal circulation, potentially leading to CNV [54]. Progression of wet AMD is more abrupt and rapid (a few days to years) compared to dry AMD, and untreated patients may lose visual acuity in a short period [55]. Wet AMD is responsible for approximately 80% of severe vision loss and blindness due to AMD. Pathological events such as blood vessel growth, leakage/hemorrhage from the new vessels, subretinal fibrosis, and vascular endothelial growth factor (VEGF) accumulation can contribute to a decline in central vision [56]. Normally, VEGF is essential for angiogenesis, the formation of new and functional blood vessels. However, in pathological conditions like AMD, excessive VEGF contributes to abnormal and dysfunctional angiogenesis [57].              9   Figure 1.2 Stages of age-related macular degeneration In a healthy retina, intact and normal retinal pigment epithelium (RPE) and Bruch's membrane (BM) form a blood-retinal barrier (top left panel). The formation of yellow drusen deposits beneath the RPE is a hallmark of early age-related macular degeneration (top right panel). Accumulation of drusen beneath the RPE, accompanied by atrophied RPE cells exhibiting decreased pigmentation, is indicative of geographic atrophy (bottom left panel). The formation and invasion of newly formed blood vessels through the BM, accompanied by atrophied RPE cells exhibiting decreased pigmentation, is indicative of choroidal neovascularization (bottom right panel). Reprinted from S. De Jong, J. Tang, and S. J. Clark, “Age‐related macular degeneration: A disease of extracellular complement amplification,” Immunological Reviews, vol. 313, no. 1, pp. 279–297, Jan. 2023, doi: 10.1111/imr.13145. [58] 10  1.2.4 ARPE-19 Cells ARPE-19 is a spontaneously immortalized cell line of human RPE derived from the normal and healthy eyes of a 19-year-old male donor [59]. Established in 1996, the ARPE-19 cell line continues to be extensively utilized in biomedical research, particularly in ophthalmology [60]. Low-passage ARPE-19 cells, cultured and differentiated under appropriate conditions for four months, exhibit the closest phenotype characteristics to native RPE [61]. These cultured cells display physiological properties similar to RPE cells in vivo, including pigmentation, polarization, and cobblestone morphology [62]. RPE cells in vitro prove effective for investigating various aspects such as elucidating genes/proteins crucial for vision in the RPE, understanding the mechanisms by which the RPE maintains homeostasis, and identifying changes occurring due to aging and retinal disease progression [63]. Consequently, ARPE-19 cells find widespread use in studies related to RPE and AMD [64].  1.2.5 AMD Mouse Models Age-related macular degeneration impacts the cone-rich area known as the macula. Although mice lack a macula, they are commonly used as an animal model for AMD as the primary sites of AMD pathology (photoreceptors/RPE/BM/choroid) are well-preserved in the species [65]. Furthermore, mouse models are cost-efficient, easy to breed/handle, and genetically manipulable for rapid disease onset [66]. AMD mouse models are divided into five categories: early/intermediate, neovascular, geographic atrophy, acute, and inherited macular degeneration [67]. Hallmarks of AMD in humans, such as drusen formation, BM thickening, retinal cell degeneration, and CNV, have been observed in various mouse models of AMD [68]. Although there is currently no single mouse model that reflects all the signs of AMD, many different mouse 11  models have notably highlighted specific hallmarks and mechanisms for understanding AMD development and progression [69].             1.2.6 Current Treatments for AMD  To date, there is no cure for AMD. Lifestyle modifications, including smoking cessation, a diet rich in antioxidants and omega-3, regular exercise, and routine eye examinations, are believed to delay the incidence and progression of AMD [70],[71]. The AREDS (Age-Related Eye Disease Study) studies have shown that vitamin supplementation, with main components such as zinc, vitamin C, vitamin E, lutein, and zeaxanthin, slows the progression of intermediate/advanced AMD [72]. For dry AMD, therapeutic modalities include complement pathway inhibitors, antioxidative therapy, neuroprotective agents, and stem cell therapy [73]. FDA-approved complement pathway inhibitors (pegcetacoplan and avacincaptad pegol) have exhibited significant potential in slowing the progression of GA [74]. For wet AMD, anti-VEGF therapy has become a standard treatment method [75]. Anti-VEGF agents such as pegaptanib, bevacizumab, ranibizumab, aflibercept, and brolucizumab are commonly used to manage CNV by inhibiting abnormal and dysfunctional angiogenesis [76]. Although anti-VEGF therapy is an effective treatment for CNV, emerging evidence suggests that it may increase the likelihood of developing GA [77],[78]. Overall, there are treatment options for both dry and wet AMD to manage disease progression, and several potential treatments for AMD are currently undergoing clinical trials.   12  1.3 Purinergic Signaling System  Purinergic signaling was proposed in 1972 when adenosine triphosphate (ATP) was identified as an extracellular signaling molecule that modulates various signaling pathways through specific membrane receptors [79]. These membrane receptors were described in 1976 as purinergic receptors (purinoreceptors) that bind to extracellular ATP [80]. Purinergic receptors are classified into two types: P1 for adenosine and P2 for ATP. P2 receptors are then divided into two families: P2X and P2Y [81]. Purinergic signaling shows evolutionary conservation and is involved in many physiological processes crucial for normal cell functioning such as proliferation, differentiation, migration, and apoptosis [82],[83],[84]. Dysfunctional, purinergic signaling is also implicated in numerous pathological processes, including neurodegeneration, inflammation, diabetes, and cancer [85]. Understanding the pathophysiology of dysregulated purinergic signaling is essential for developing therapeutics for various diseases.  1.3.1 Purinergic Signaling in the Retina  In the retina, purinergic signaling plays a role in the proper functioning of retinal cells including RPE cells, photoreceptors, and vascular/glial cells, by facilitating communication and interactions among different cell types across various retinal layers [86]. Extracellular ATP acts as an endogenous stress-associated molecular danger signal released by cells following inflammation, oxidative stress, cell injury, and cell death [87],[88]. ATP is released from all main cell types of the retinal layers including RPE, photoreceptor, bipolar, horizontal, amacrine, retinal ganglion cells,  Müller glia , and astrocytes [89],[90]. The release of ATP has been reported from ARPE-19 cells, suggesting that the RPE is one of sources of extracellular ATP capable of stimulating P2X receptors [91]. The release of ATP from RPE cells also promotes inflammatory 13  signaling, potentially playing a role in AMD, where inflammation contributes to the damage and death of RPE and photoreceptor cells [92]. Increasing evidence suggests that the retina responds to the danger signals from extracellular ATP via purinergic signaling, thereby triggering nucleotide-binding oligomerization domain-like receptor 3 (NLRP3) inflammasome activation [93].  1.3.2 NLRP3 Inflammasome Pathway   An overview of the inflammasome pathway is briefly described in a schematic diagram (Figure 1.3). Inflammasomes are multiprotein complexes that consist of three components: a sensor protein, an adaptor protein, and an effector protein [94]. The NLRP3 inflammasome complex comprises NLRP3 as the sensor, apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC) as the adaptor, and caspase-1 as the effector [95]. Activation of the NLRP3 pathway requires two steps: priming and activation [96]. The priming step is initiated by external stimuli such as pathogen-associated molecular patterns (PAMPs) and damage-associated molecular patterns (DAMPs) binding to toll-like receptors (TLR) [97]. This triggers the nuclear factor-κB (NF-κB) signaling pathway, leading to the upregulation of NLRP3 and precursor forms of the pro-inflammatory cytokines pro-interleukin-1β (pro-IL-1β) and pro-interleukin-18 (pro-IL-18) [98]. The activation step senses the PAMPs and DAMPs, including extracellular ATP, promoting the assembly of the inflammasome complexes [99]. The inflammasome complex cleaves pro-caspase-1 to active caspase-1, which in turn cleaves pro-interleukin-18 and 1β to release mature IL-1β and IL-18 [100]. Inflammatory caspases, such as caspase-1, also cleave gasdermin D (GSDMD) into two parts: the N-terminal fragment (GSDMD-N; active form) and the C-terminal fragment (GSDMD-C; autoinhibitory domain). Once cleaved, GSDMD-N 14  translocates to the cell membrane, forming pores in the plasma membrane and facilitating the secretion of mature IL-1β and IL-18, thereby inducing a programmed cell death known as pyroptosis [101],[102].  1.3.3 Inflammation Activation in AMD  In the development of both dry and wet AMD, inflammation plays a central role, involving various proinflammatory stimuli and inflammatory signaling pathways [103]. Numerous inflammatory cytokines, including IL-1β and IL-18, are directly involved in these inflammatory cascades [104]. Interestingly, there are conflicting data regarding whether IL-18 is protective against angiogenesis, or if it promotes angiogenesis [105],[106]. Notably, the NLRP3 inflammasome pathway has been implicated in all studies exploring inflammation in RPE cells [107]. In addition to the RPE cells, inflammasome activation in immune cells such as microglia and macrophages within the pathogenic retinal space may further contribute to AMD [108]. Furthermore, constituents of drusen such as lipofuscin and amyloid-beta (Aβ) have been proven to be pro-inflammatory and capable of inducing NLRP3 inflammasome activation [109],[110]. Notably, extracellular ATP plays a crucial role as a DAMP via P2X receptors and may aggravate inflammation [111].       15   Figure 1.3 NLRP3 inflammasome priming and activation.  The priming process upregulates NLRP3, pro-IL-1β, and pro-IL-18 expressions. The activation process assembles the NLRP3 inflammasome complex, resulting in active caspase-1, mature IL-1β and IL-18, and GSDMD pores. Priming and activation are triggered by PAMPs and DAMPs such as lipopolysaccharide (LPS), ATP, and nigericin. THIK1, TWIK2, P2X7 receptor, and pannexin-1 serve as cation channels for the influx/efflux of ions such as Na+, K+, Ca2+. Reprinted from Z. Xu, Z.-M. Chen, X. Wu, L. Zhang, Y. Cao, and P. Zhou, “Distinct Molecular Mechanisms Underlying Potassium Efflux for NLRP3 Inflammasome Activation,” Front Immunol, vol. 11, p. 609441, 2020, doi: 10.3389/fimmu.2020.609441. [112]    16  1.4 P2X Receptors P2X receptors are trimeric, non-selective, cation-permeable channels activated by extracellular ATP [113]. Seven subtypes of P2X receptors, termed P2X1 to P2X7, are expressed in a wide range of animals, including mammalian cells [114],[115],[116]. P2X receptors assemble as both functional homotrimeric and heterotrimeric channels [117]. The molecular structure of all seven subtypes features the assembly of three protein subunits (trimeric), each consisting of an intracellularly located C-terminus and N-terminus, two transmembrane domains (TM1 and TM2), and a large extracellular loop (ectodomain) containing the ATP-binding sites [118]. ATP binding elicits a conformational change, opening the trimeric structures to form a channel/pore, allowing ion influx/efflux such as calcium, and subsequent cellular signaling transductions [119]. The P2X receptor subtypes are activated by different extracellular ATP concentrations, ranging from low millimolar to high nanomolar [120]. Although a few P2X receptor agonists such as BzATP have been derived, subtype-specific agonists are not yet available [121]. The available P2X receptor antagonists are summarized (Figure 1.4). P2X receptors are ubiquitously distributed and implicated in a variety of physiological and pathophysiological conditions such as thrombosis (P2X1), deafness (P2X2), pain (P2X3), bone loss (P2X5), renal cancer (P2X6), and neuroinflammation (P2X4/P2X7) [122]. Understanding the differences in their molecular structures is imperative for exploring their roles in disease pathophysiology and developing therapeutics.  1.4.1 P2X1 Receptor  The P2X1 receptor is implicated in urogenital, immune, and cardiovascular systems, showing significant cellular expression in smooth muscle [123]. Activation of the P2X1 receptor 17  plays a role in controlling longitudinal and circular smooth muscle contractions of the vas deferens [124]. P2X1 receptors are expressed in neutrophils and platelets, and may be targeted to modulate thrombosis and inflammation [125]. Furthermore, P2X1 receptors located in the smooth muscle of blood vessels in the heart contribute to contractions [126]. In the mouse retina, P2X1 immunoreactivity was observed in the IPL [127]. Several P2X1-specific antagonists have been developed, though some exhibit only partial inhibitory and selectivity effects [122].  1.4.2 P2X2 Receptor The P2X2 receptor is expressed in parts of the ear, including the cochlea and hair cells, and plays a role in modulating hearing sensitivity within auditory systems [128]. Additionally, the P2X2 receptor exhibits a neuroprotective function, as the inhibition of this subtype using pyridoxalphosphate-6-azophenyl-2′,4′-disulfonic acid (PPADS), a P2X receptor antagonist, decreases neuronal death in the retina of diabetic mice [129]. P2X2 mRNA and protein were detected in the retinal ganglion cells, INL neurons, and photoreceptors in the rat retina [130]. Furthermore, P2X2 receptors are present in amacrine cells that are exclusively associated with the axon terminals of cone bipolar cells in the INL of the rat retina, suggesting a potential role of P2X2 in retinal neuronal signaling with cone pathways [131]. In the mouse retina, P2X2 receptors are detected in amacrine cells, and in the INL, IPL, and OPL [127],[132]. Specifically, P2X2 receptors may provide a choline transport pathway to regulate cholinergic signaling transmission in amacrine cells in the mouse retina [133]. Several P2X2-specific antagonists have been developed, with variations in potency and selectivity [122].  18  1.4.3 P2X3 Receptor The P2X3 receptor is highly expressed in sensory neurons and plays a role in pain transmission where its activation contributes to inflammatory and neuropathic pain states, whereas downregulation via inhibitors alleviates neuropathic pain [134],[135]. Recently, it was proposed that activation of P2X3 receptors are involved in migraine pain [136]. P2X3 receptors have been identified in various layers and cells of the rat retina, including the GCL, INL, IPL, and OPL, and in retinal ganglion cells, horizontal cells, and amacrine cells [137],[138]. In the mouse retina, P2X3 immunoreactivity was observed in cholinergic amacrine cells [139]. Several potent and selective P2X3 receptor antagonists are under evaluation as potential drug candidates for respiratory diseases such as chronic cough [122].  1.4.4 P2X4 Receptor  The P2X4 receptor is a promising target in neuroinflammation, demonstrating widespread distribution in mammalian cells and tissues within the central nervous system [140]. P2X4 receptors are expressed in microglial cells after brain or nerve injury [141],[142],[143],[144]. Activation of P2X4 receptors are implicated in the recruitment and activity of microglia in the brain and spinal cord under various conditions such as infection, injury, degeneration, and inflammation [145]. Microglia can detect changes in the surrounding environment, become activated, and communicate with neighboring cells by releasing cytokines, thereby triggering an inflammatory state [146]. Notably, the inhibition of P2X4 receptors has been shown to reduce inflammation by downregulating caspase-1 and IL-1β, and by decreasing microglial cell death in areas of inflammation in the brain and spinal cord [147],[148],[149]. In a laser-induced model of CNV, activated microglia express P2X4 receptors, where inhibition of purinergic receptors and 19  microglia by PPADS decreased microglial activity and CNV formation [150]. Moreover, P2X4 receptors are detected in Müller cells, which span the thickness of the retina, suggesting a potential role in glial signaling [151],[152]. P2X4 immunoreactivity is expressed in retinal ganglion cell bodies and processes, bipolar cell terminals, horizontal cell bodies and processes, amacrine cell bodies and processes, photoreceptor terminals, and Müller cell processes, and is localized in the GCL, IPL, INL, and OPL of the mouse retina [127],[153]. Numerous P2X4 antagonists are available with varying potency and selectivity, with water solubility ranging from low to high [122].  1.4.5 P2X5 Receptor The P2X5 receptor is significantly involved in bone biology, particularly in regulating bone loss due to inflammation [154]. For example, the P2X5 receptor contributes to inflammatory bone less in periodontitis, a gum disease characterized by severe inflammation [155]. Additionally, P2X5 receptors may play a role in inflammasome activation in osteoclasts, cells responsible for bone development and regeneration [156]. P2X5 deficiency in P2X5 knockout mice demonstrated a decrease in inflammatory bone loss [155],[156]. Furthermore, P2X5 receptors have a strong representation in the embryonic development of the mouse nervous system [157]. In the mouse retina, P2X5 immunoreactivity was observed in cholinergic amacrine cells, and in the GCL, INL, and inner and outer photoreceptor segments [139],[158]. To date, there are no P2X5-specific antagonists available [159].   20  1.4.6 P2X6 Receptor The P2X6 receptor is implicated in cancer, although its role appears to vary depending on the type of cancer. High P2X6 expression may be associated with a poor prognosis in renal cell cancer, but presents a favourable survival prognosis for patients with bladder cancer [160],[161]. The P2X6 receptor is also expressed in the brain and may play a role in brain development [162],[163]. The function of rat recombinant P2X6 receptors may be influenced by glycosylation in response to ATP sensitivity [164]. In the mouse retina, P2X6 is not co-expressed in cholinergic amacrine cells, and exhibits weak immunoreactivity in the NFL [139]. There does not appear to be a P2X6-specific antagonist yet, and some P2X antagonists such as PPADS do not affect P2X6 [165].  1.4.7 P2X7 Receptor The P2X7 receptor has been extensively studied due to its involvement in oxidative stress, inflammation, and cell death [166]. P2X7 immunoreactivity has been observed in bipolar cell terminals, horizontal cell bodies and processes, amacrine cells, and photoreceptors, as well as in the IPL and OPL of the rat retina [167]. In the mouse retina, P2X7 immunoreactivity is expressed in retinal ganglion cells, bipolar cell terminals, horizontal cells and processes/terminals, amacrine cells, and photoreceptor terminals, and is localized in the GCL, IPL, INL, OPL [127],[158],[168]. In the human retina, P2X7 mRNA and immunoreactivity was observed in the GCL, IPL, INL and OPL. Activation of the P2X7 receptor plays a role in mediating ischemia-induced retinal ganglion cell death in the human retina [169]. Notably, activation of the P2X7 receptor also contributes to ATP-induced RPE cell death in the human retina [88]. Out of the seven P2X receptor subtypes, the P2X7 receptor has garnered the most extensive research attention and boasts the largest number 21  of available antagonists due to its potential as a therapeutic target in several inflammatory processes [170]. The intensive investigation into its development as a drug candidate has resulted in the availability of numerous commercially potent and P2X7-selective antagonists [122].   22   Figure 1.4 P2X receptor subtype-selective antagonists.  Antagonists available for P2X1, P2X2, P2X3, P2X4, and P2X7. Currently, there are no antagonists specific for P2X5 and P2X6. Reprinted from P. Illes et al., “Update of P2X receptor properties and their pharmacology: IUPHAR Review 30,” Br J Pharmacol, vol. 178, no. 3, pp. 489–514, Feb. 2021, doi: 10.1111/bph.15299. [122] 23  1.5 Study Overview   1.5.1 Study Rationales In healthy human eyes, the loss of photoreceptor cells is associated with aging, showing an annual decrease of approximately 0.2 – 0.4% throughout life [171]. Similarly, the loss of RPE cells is also associated with aging with an annual decrease of approximately 0.3% [172]. Additionally, the choroid thickness decreases with age, starting at approximately 200 μm at birth and reducing to 80 μm by the age of 90 [173]. In patients with AMD, the degeneration of photoreceptors/RPE/choroid appears to be expedited, resulting in irreversible central vision impairment and loss.   A potential mechanism for AMD development involves extracellular ATP, P2X receptor activation, and inflammation at the primary sites of AMD. To elaborate, under pathological conditions (e.g., the accumulation of drusen; a precursor of AMD), excessive levels of extracellular ATP released from stressed retinal cells activate P2X receptors (e.g., the P2X7 receptor subtype), triggering the NLRP3 inflammasome pathway and ultimately leading to further cell death (e.g., RPE cell death) [174],[175]. Notably, the overactivation of P2X7 receptors plays a pathogenic role in RPE and photoreceptor degeneration and cell death implicated in AMD [176]. In AMD pathology, RPE atrophy causes secondary photoreceptor/choriocapillaris degeneration [177],[178]. However, there is controversy regarding whether this order is absolute, as photoreceptor/choriocapillaris dysfunction may also precede RPE degeneration [179],[180]. Nonetheless, RPE atrophy is associated with photoreceptor/choriocapillaris degeneration [181].   24  1.5.2 Study Objectives  The overall objective of this study is to investigate the role of P2X receptors in the RPE, in relation to the development of AMD. While this study primarily focuses on the RPE, analyses were also conducted in the choroid and neuroretina. The four aims of this study are as follows:  Aim 1: To determine the distribution of P2X1-7 receptors in human post-mortem retinal sections  Aim 2: To determine the mRNA expression levels of P2X1-7 receptors in cultured ARPE-19 cells  Aim 3: To determine the expression and localization of P2X4 and P2X7 in human RPE and choroid Aim 4: To determine the expression and localization of P2X4 and P2X7 in mouse RPE, choroid, and neuroretina   1.5.3 Study Hypotheses The overall premise of this study is that overactivation of P2X receptors drives RPE atrophy, which promotes photoreceptor loss in AMD. ATP released during pathological conditions, such as AMD, from sites of inflammation may activate P2X receptors expressed in RPE cells. This phenomenon may increase RPE cell death, subsequently leading to the death of photoreceptor cells, and ultimately resulting in vision loss in patients with AMD. The hypotheses of the four aims are as follows:    25  Hypothesis of Aim 1: The RPE in human post-mortem retina will exhibit the same P2X receptor subtypes and patterns of expression as those previously characterized in cultured ARPE-19 cells Hypothesis of Aim 2: The level of mRNA expression of P2X1-7 receptors in ARPE-19 cells will reflect the level of protein expression of P2X1-7 receptors in human post-mortem retinal sections Hypothesis of Aim 3: P2X4 and P2X7 will be largely co-localized in human RPE and choroid because there is evidence supporting their functional interactions  Hypothesis of Aim 4: P2X4 and P2X7 expression and localization will be the same in human and mouse RPE and choroid due to evolutionary conservation   1.5.4 Outline of Experiments In Chapter 2, experiments were designed to initially survey all seven P2X receptor subtypes and their distribution in human post-mortem retinal sections. For Aim 1, cross sections of human retina were obtained from five groups: Young (age ≤ 55), Old (age ≥ 70), and three different types of diseased eyes (geographic atrophy, choroidal neovascularization, soft drusen). An immunohistochemical AEC protocol with highly specific antibodies directed against an epitope of each P2X1-7 receptor subtype was applied. Images were taken using brightfield microscopy and analyzed for immunoreactivity in the RPE and choroid using a masked semi-quantitative visual scoring method (scores of 0 to 3).   The survey of all seven P2X receptor subtypes was continued in the determination of their mRNA expression levels in cultured ARPE-19 cells. For Aim 2, ARPE-19 cells were grown in 25 mL flasks until 90% confluent. RT-qPCR was performed with an initial denaturing step of 95°C for 10 minutes followed by 40 amplification cycles of 15 sec at 95°C and 1 minute at 60°C (Quant 26  Studio™ 3, Applied Biosystems). All tested target genes were replicated in triplicate. GAPDH was used as a reference gene for data normalization, and statistical analysis was performed.   Through the experiments and results from Aims 1 and 2, Chapter 2 primarily focuses on two specific P2X receptor subtypes: P2X4 and P2X7. There were three reasons for focusing on P2X4 and P2X7. Firstly, the results from Aim 1 aligned with preliminary data where P2X4 was very immunoreactive in both the post-mortem retinal sections of young donors and cultured ARPE-19 cells. Secondly, out of all the P2X1-7 mRNAs, P2X4 mRNA was the most highly expressed in cultured ARPE-19 cells. Lastly, the P2X7 receptor is the only P2X receptor subtype that has been well-studied in the RPE. Therefore, this study focuses on the less-explored P2X4 receptor alongside the well-studied P2X7 receptor in (1) human post-mortem retina, (2) ARPE-19 cells, and (3) mouse retina.   For Aim 3, cross sections of human retina were obtained from the same five post-mortem groups as Aim 1 (Young, Old, GA, CNV, SD). An immunohistochemical fluorescence protocol using unconjugated Fab fragments was applied for double immunolabeling of P2X4 and P2X7 made from the same host species (rabbit). Images were taken using confocal microscopy and analyzed for immunoreactivity and localization in the RPE and choroid.  In Chapter 3, experiments were conducted to further explore the expression and localization of the P2X4 and P2X7 receptor subtypes in mouse models of AMD. For Aim 4, cross sections of mouse retina were obtained from five groups: Young (3 months), Old (17 months), laser-induced CNV, apolipoprotein E (ApoE) knockout on regular diet, and ApoE knockout on 27  high fat diet. An immunohistochemical fluorescence protocol with highly specific antibodies directed against an epitope of P2X4 and P2X7 was applied. Images were taken using confocal microscopy and analyzed for immunoreactivity in the RPE, choroid, and neuroretina using a masked semi-quantitative visual scoring method (scores of 0 to 3).  1.5.5 Significance of the Study  The RPE supports and maintains photoreceptor health, and it is the primary site of pathology in AMD. Disruptions in RPE homeostasis can contribute to various retinal disorders, including AMD. The overactivation of P2X receptors may disrupt photoreceptor homeostasis through RPE degeneration and cell death. Inhibiting P2X receptors has been identified as a potential drug target to delay AMD development and progression [182]. Understanding the potential mechanisms and balance of these factors is crucial for maintaining overall ocular health and visual function. Therapeutic targeting of P2X receptors could slow or prevent RPE atrophy underlying AMD.   28  Chapter 2: P2X Receptors in Human Eyes  2.1 Introduction Homeostasis of the photoreceptors/RPE/choroid is disrupted in AMD [183]. Furthermore, the loss of photoreceptors, a hallmark of AMD, is directly associated with the loss of RPE cells [184],[185],[186]. RPE cells release ATP which serves as an important signaling molecule in various processes such as proliferation, ion/fluid regulation, phagocytosis, inflammation, and apoptosis [88],[91],[187],[188]. Purinergic signaling via P2X receptors has been partially investigated in AMD. To date, only a few studies have explored the expression, localization, and mechanisms of P2X receptors within the RPE. Out of the seven P2X receptor subtypes, the P2X7 receptor is the most well-characterized in the RPE [182]. Activation of P2X7 receptors by extracellular ATP induces RPE apoptosis, which leads to proinflammatory cytokine release and inflammasome signaling, as well as an upregulation in ATP release and ATP-induced RPE apoptosis [88],[189].   Notably, current literature provides evidence of crosstalk between the P2X4 and P2X7 receptor subtypes, their frequent co-expression, the formation of P2X4/P2X7 heteromeric/heterotrimeric channels, and the potential influence on the expression levels of each other [190],[191],[192],[193],[194],[195]. The P2X4 receptor plays a role in inflammatory processes and triggers inflammation when exposed to elevated extracellular ATP levels [196]. Moreover, the addition of P2X4 and P2X7 antagonists, both in vitro and in vivo, significantly reduces inflammatory responses [197],[198],[199]. This chapter will investigate P2X1-7 expression and localization in human post-mortem retinal sections (protein) and cultured ARPE-29  19 cells (mRNA and protein). The experiments were initially designed to survey all seven P2X receptor subtypes, followed by a specific focus on the P2X4 and P2X7 receptor subtypes. The findings from Chapter 2 will elucidate which P2X receptor subtypes are expressed in the RPE and choroid of human eyes in different donor groups. Chapter 2 includes study Aims 1, 2, and 3, and the respective hypotheses:   Aim 1: To determine the distribution of P2X1-7 receptors in human post-mortem retinal sections  Hypothesis of Aim 1: The RPE in human post-mortem retina will exhibit the same P2X receptor subtypes and patterns of expression as those previously characterized in cultured ARPE-19 cells  Aim 2: To determine the mRNA expression levels of P2X1-7 receptors in cultured ARPE-19 cells  Hypothesis of Aim 2: The level of mRNA expression of P2X1-7 receptors in ARPE-19 cells will reflect the level of protein expression of P2X1-7 receptors in human post-mortem retinal sections  Aim 3: To determine the expression and localization of P2X4 and P2X7 in human RPE and choroid Hypothesis of Aim 3: P2X4 and P2X7 will be largely co-localized in human RPE and choroid because there is evidence supporting their functional interactions      30  2.2 Methods   2.2.1 ARPE-19 Cell Culture and Immunocytochemistry  This experiment was completed by a previous graduate student. ARPE-19 cells were grown as previously described [200]. Briefly, ARPE-19 cells were seeded into 8-well chamber slides containing Dulbecco’s modified Eagle Medium/F12 medium (DMEM, Life Technologies) with 10% fetal bovine serum (FBS), 100 U/mL penicillin and 100 μg/mL streptomycin, at a density of 0.05 x 105 – 0.01 x 106 cells/chamber. The 8-well chambers were kept in a humidified incubator with 5% CO2 at 37°C until 90% confluent. Next, cells were fixed with 4% paraformaldehyde at room temperature for 20 minutes, washed with PBS and blocked with 3% normal goat serum (Vector Labs) with or without 0.3% Triton X-100 (TX-100) in PBS. Cells were then incubated with P2X1-7 rabbit polyclonal antibody (1:100, Alomone Labs) for 1 hour at room temperature and overnight at 4℃. Primary antibodies were omitted for negative control. On the second day, cells were washed with PBS and incubated with Alexa 488 conjugated goat anti-rabbit secondary antibody (1:400, Invitrogen). Hoechst 33258 (1:500, Sigma) was used for cell nuclei counterstaining. Next, chambers and silicon tapes were carefully removed from slides without disturbing cells, and slides were mounted with MOWIOL 4-88 solution and 1.5 mm coverslips. An LSM 800 confocal laser scanning microscope was used to image antibody labeling for Alexa 488 and DAPI. All confocal settings were kept constant throughout the imaging sessions. Pixels representing positive labeling for each confocal image were selected and counted with ImageJ with a fixed threshold. Statistical analysis for P2X1-7 pixel counting was performed with an unpaired t-test to compare between two groups, and a one-way ANOVA test followed by Tukey’s multiple 31  comparisons post hoc test to compare between multiple groups using Prism GraphPad 9. All experiments were performed in triplicate, and all data are presented as mean ± SEM.  2.2.2 Human Post-mortem Eyes and Immunohistochemistry  Human post-mortem eye sections were obtained from five different donor groups: Young (age ≤ 55), Old (age ≥ 70), geographic atrophy (GA – late stage dry AMD), choroidal neovascularization (CNV – wet AMD), and soft drusen (SD – lipid/protein deposits, hallmark of AMD). Human paraffin eye sections were incubated at 60°C for 45 minutes before deparaffinization. The slides were deparaffinized in xylene using two changes for 5 minutes each. The xylene was removed with three washes of 100% alcohol for 2 minutes per wash. The slides were then hydrated in a series of graded alcohols (95%, 70%, 50%) for 2 minutes, and, lastly washed with distilled water twice for 5 minutes each. After deparaffinization, the human post-mortem eye sections were washed with phosphate buffered saline (PBS) and subjected to antigen retrieval using either sodium citrate buffer for 5 minutes or proteinase K for 10 minutes. Sections were blocked with 0.3% H2O2 in distilled water for 15 minutes at room temperature, and in a mixture comprising of 3% normal goat serum (Vector Labs) and 0.3% TX-100 in PBS for 20 minutes at room temperature. Sections were then incubated with P2X1-7 rabbit polyclonal antibody (1:100 or 1:200, Alomone Labs) for 1 hour at room temperature (Table 2.1). Primary antibodies were omitted for negative control. Following the primary antibody incubation, sections were washed with PBS and incubated with biotinylated anti-rabbit made in goat (1:200, Vector Labs) in PBS for 45 minutes at room temperature. After washing in PBS, sections were incubated for 30 minutes with ABC standard kit (Vector Labs) and 6 minutes with AEC substrate kit (Vector Labs). Lastly, sections were counterstained with Mayer’s Hematoxylin, washed with distilled 32  water, and mounted with an aqueous medium and 1.5 mm coverslips. All images were taken using brightfield microscopy at 60X magnification, white balanced on camera mode, and adjusted to focus on the RPE and choroid. Representative images were analyzed for immunoreactivity in the RPE and choroid using a masked semi-quantitative visual scoring method. All representative images were masked and ranked using scores 0, 1, 2 or 3 (Appendix Figure 1). A score of 0 characterized no immunolabeling, while a score of 3 characterized high immunolabeling. Representative images of the negative controls exemplified a visual immunolabeling score of 0. Statistical significance for immunolabeling score differences among donor eyes in the RPE and choroid was tested with ANOVA/Kruskal–Wallis test using Prism GraphPad 9.   Table 2.1 List of antibodies used in immunohistochemistry.   P2X1-7 rabbit polyclonal antibodies (1:100 or 1:200) used for immunolabeling in human post-mortem retinal sections and mouse retinal sections. The knockout validation of P2X1, P2X4, and P2X7 was performed by Alomone Labs. P2X1 was detected in the vas deferens of wild-type mice, but not in P2X1 receptor knockout mice (immunohistochemistry). P2X4 was detected in the hippocampus of wild-type mice, but not in P2X4 receptor knockout mice. P2X7 was detected in the spinal cord of wild type mice, but not in P2X7 receptor knockout mice (Western blot).    Primary Antibody Catalogue Number Source  P2X1 anti-P2X1 receptor APR-001 (knockout validated) Alomone Labs P2X2 anti-P2X2 receptor APR-003 Alomone Labs P2X3 anti-P2X3 receptor APR-026 Alomone Labs P2X4 anti-P2X4 receptor APR-002 (knockout validated) Alomone Labs P2X5 anti-P2X5 receptor APR-027 Alomone Labs P2X6 anti-P2X6 receptor APR-013 Alomone Labs P2X7 anti-P2X7 receptor APR-004 (knockout validated) Alomone Labs  33    2.2.3 Assessment of P2X1-7 in ARPE-19 via RT-qPCR ARPE-19 cells were seeded into 25 mL flasks and grown in the same medium and humidified incubator as mentioned above until 90% confluent. Next, cells were washed with HBSS and trypsinized with 0.25% trypsin-EDTA and incubated at 37°C for 10 min. Trypsinization was stopped by adding 9 mL DMEM medium, and the pooled suspension was centrifuged at 1500 rpm for 10 minutes to obtain the cell pellets for subsequent RNA extraction. Total RNA (RNeasy® mini kit, QIAGEN) was extracted from cell pellets which were dissolved in 350 μL RLT buffer containing 0.01% 14.3 M β-mercaptoethanol according to the manufacturer’s protocol. cDNA synthesis was performed with SuperScript™ VILO™ cDNA synthesis kit (Invitrogen) as per the manufacturer’s protocol in a BioRadT100™ thermal cycler. Synthesized cDNAs were then diluted into a concentration of 5 ng/μL. Primer sequences designed to amplify the target genes P2X4 and P2X7 are summarized (Table 2.2). In brief, the RT-qPCR reaction mix per well consisted of 5 μL PowerUp™ SYBR™ Green Master Mix (Applied Biosystems) at the manufacturer’s supplied concentration, 1.25 μL of each forward and reverse primer (10 μM), and 2.5 μL of diluted cDNA (5 ng/μL). After the reaction mix was added to the wells, the 96-well plate was centrifuged for 2 minutes at 1000 rpm. RT-qPCR was performed with an initial denaturing step of 95°C for 10 minutes followed by 40 amplification cycles of 15 sec at 95°C and 1 minute at 60°C (Quant Studio™ 3, Applied Biosystems). All tested target genes were replicated in triplicate. Relative expression level of target genes were determined using 2−ΔCt method [201]. GAPDH was used as a reference gene for data normalization. Statistical significance for P2X4 and P2X7 mRNA levels was performed using a two-tailed Student's t-test with a significance level of p < 0.05. 34  Additionally, P2X1-7 primer efficiencies were tested using standard curves. Average Ct values were calculated for each of the dilution factors completed in triplicates. Next, the logarithm of each sample dilution was calculated. The average Ct values (y-axis) were plotted against the log values (x-axis) as a scatterplot to obtain the slope of the regression. Primer efficiencies were calculated using the slope value in the following formula: E = 10(-1/slope) – 1. The resulting values were multiplied by 100 and presented as percentages.     Table 2.2 List of primer sequences used to amplify the target genes.  P2X1-7 primer sequences used for RT-qPCR in cultured ARPE-19 cells. All tested target genes were replicated in triplicate. GAPDH was used as a reference gene for data normalization. Gene Accession Number Primer sequence 5′→ 3′ Amplicon (bp) P2X1 NM_002558.4 F: GTGGAGAACGGGACCAACTA R: CCCATGTCCTCAGCGTATTT 233 P2X2 NM_001282165.2 F: CCCAAATTCCACTTCTCCAA    R: GTCCAGGTCACAGTCCCAGT 204 P2X3 NM_002559.5 F: ACTAACTCCATCGCCCACAC   R: GGGTCCCTCACCACTGTCTA 178 P2X4 NM_001256796.2 F: TTGTGTGGGAAAAGGGCTAC   R: CCTGTGTCTGGTTCATGGTG 198 P2X5 NM_001204519.2 F: TTTTGTGGTCACCAACCTGA    R: CACCAGGCAAAGATCTCACA 208 P2X6 NM_001394696.1 F: GAACCACAATTCAGCCCCTA   R: AAGGAGTAGTGAGGCCAGCA 170 P2X7 NM_002562.6 F: AAGCTGTACCAGCGGAAAGA R: GCTCTTGGCCTTCTGTTTTG 202 GADPH NM_001289746.2 F: GAGTCAACGGATTTGGTCGT   R: TTGATTTTGGAGGGATCTCG 238  35   2.2.4 P2X4 and P2X7 Double Labeling using Fab Fragments Human paraffin eye sections from the young donor group (age ≤ 55) were incubated at 60°C for 45 minutes before deparaffinization. The slides were deparaffinized as per the above protocol. After deparaffinization, the sections were washed with PBS and exposed to heat-mediated antigen retrieval with citrate buffer for 5 minutes. Sections were blocked with 0.3% H2O2 in distilled water for 15 minutes at room temperature, and in a mixture comprising of 5% normal goat serum (Vector Labs) and 0.6% TX-100 in PBS for 20 minutes at room temperature. Next, sections were washed and incubated with P2X7 rabbit polyclonal antibody (1:200, Alomone Labs) for 6 hours at room temperature and then overnight at 4°C. On the second day, sections were washed with PBS and incubated with Alexa 546 conjugated goat anti-rabbit secondary antibody (1:400, Invitrogen). Following the P2X7 secondary antibody incubation, sections were washed with PBS and incubated with 5% normal rabbit serum (Vector Labs) and 0.6% TX-100 in PBS for 20 minutes at room temperature. Sections were washed and incubated with Fab fragment goat anti-rabbit (1:25, Jackson ImmunoResearch Labs) for 2 hours at room temperature. This presents rabbit anti-P2X7 as goat Fab. Next, sections were washed and incubated with P2X4 rabbit polyclonal antibody (1:100, Alomone Labs) for 6 hours at room temperature and then overnight at 4°C. Primary antibodies were omitted for negative control. On the last day, sections were washed with PBS and incubated with Alexa 488 conjugated goat anti-rabbit secondary antibody (1:400, Invitrogen). DAPI (1:500, Vector Labs) was used for cell nuclei counterstaining. Slides were mounted with an aqueous medium and 1.5 mm coverslips. An LSM 800 confocal laser scanning microscope was used to image antibody labeling for Alexa 488, 546, and DAPI. All confocal settings were kept constant throughout the imaging sessions. Statistical analysis for P2X4 and 36  P2X7 co-localization in the choroid was performed using Mander’s overlap coefficient in Zen (blue edition) microscopy software.  2.2.5 Spectral Imaging and Linear Unmixing using the LSM 800 To visualize true P2X4 and P2X7 labeling in the double stained RPE of young donors, spectral imaging and linear unmixing were attempted using a Zeiss protocol for the LSM 800 confocal laser scanning microscope and Zen (blue edition) microscopy software. Spectral imaging entails acquiring reference spectra for the different fluorophores, including autofluorescence (AF). Negative human control slides lacking primary antibodies, which exhibit autofluorescent RPE, were used to establish the emission spectra of the AF. Next, reference emission spectra were obtained using controls of products known to be abundantly present in a non-autofluorescent sample. Mouse eyes were individually stained for GFAP using the same P2X4 and P2X7 secondaries: Alexa 488 and 546, respectively. These emission spectra were utilized to generate a spectral unmixing algorithm which allows the microscope to mathematically deconvolve the contributions of AF and the specific labeling of both the green and red channels in each pixel. Background noise was also eliminated for each pixel. Regions of interest in the RPE were defined in the human experimental slides, and the software identified and quantified the intensity of true labeling above the baseline of AF. Statistical analysis for P2X4 and P2X7 co-localization in the RPE was performed using Mander’s overlap coefficient in Zen (blue edition) microscopy software.    37  2.3 Results   2.3.1 P2X4 and P2X7 Baseline Protein Expression in Cultured ARPE-19 Cell Line Immunofluorescent labeling was performed on fixed cells grown on chamber slides to examine the expression patterns of P2X1-7 receptors in ARPE-19 cells. Prior to labeling, cells were treated with TX-100, which enabled penetration of the antibodies and study of receptor expression levels within the cells as well as on the cell surface. Samples were also immunolabeled without TX-100 treatment, to check only cell surface expression of the receptors. The average number of pixels representing positive labeling was calculated for each P2X receptor subtype. The distribution of P2X receptor subtypes in cultured ARPE-19 cells (surface and cytoplasmic compartments combined) was most abundant for P2X4. Results indicated varying immunoreactivities for  P2X4 and P2X7 in both the cell surface labeling-only group (staining without TX-100) and overall cell-labeling group (staining with TX-100). P2X4 was abundant in both groups, while P2X7 showed a higher abundance on the cell surface of ARPE-19 cells. For the cell surface staining-only group (staining without TX-100), P2X4 immunoreactivity was comparable to P2X7 immunoreactivity (p = 0.98, Figure 2.1). In the overall cell-staining group (staining with TX-100), P2X4 immunoreactivity was significantly higher than P2X7 immunoreactivity (p < 0.0001, Figure 2.2). Both receptor subtypes appear to be trafficked within cell nuclei, which was visualized with the addition of TX-100.      38   Figure 2.1 P2X4 and P2X7 receptor immunofluorescent labeling on ARPE-19 (cell surface).  Confocal images of P2X4 and P2X7 immunofluorescent labeling (green, 488 nm) on the surface of ARPE-19 cells (staining without Triton X-100). The total pixel count is normalized to the number of cell nuclei in the respective images. (A) P2X4 immunolabeling in cultured ARPE-19 cells. (B) P2X7 immunolabeling in cultured ARPE-19 cells. (C) ARPE-19 negative control (staining without primary antibody). (D) Statistical analysis (one-way ANOVA followed by Tukey’s post hoc test) of P2X4/7 immunoreactivity in ARPE-19 cells (n = 3; ± SEM) yielded a p-value of 0.98. Scale bars = 20 μm (40X magnification).     39   Figure 2.2 P2X4 and P2X7 receptor immunofluorescent labeling in ARPE-19 cells (overall).   Confocal images of overall P2X4 and P2X7 immunofluorescent labeling (green, 488 nm) in both the surface and cytoplasm of ARPE-19 cells (staining with Triton X-100). The total pixel count is normalized to the number of cell nuclei in the respective images. (A) P2X4 immunolabeling in cultured ARPE-19 cells. (B) P2X7 immunolabeling in cultured ARPE-19 cells. (C) ARPE-19 negative control (staining without primary antibody). (D) Statistical analysis (one-way ANOVA followed by Tukey’s post hoc test) revealed a highly significant difference in P2X4/7 immunoreactivity in ARPE-19 cells (n = 3; ± SEM) (**** p < 0.0001). White arrows indicate P2X4 or P2X7 intracellular labeling. Scale bars = 20 μm (40X magnification).       40  2.3.2 Immunolabeling Scores and Trends for P2X4 and P2X7 in Human RPE  Human post-mortem retinal sections were immunolabeled with P2X1-7 antibody to examine the expression patterns of P2X1-7 receptors in human RPE. The sample size in each of the five human post-mortem donor groups was as follows: Young (n = 5), Old (n = 8), GA (n = 5), CNV (n = 5), and SD (n = 4). The average age in each of the five human post-mortem donor groups was as follows: 38.7 years (Young, healthy); 72.4 years (Old, healthy); 84.8 years (GA, diseased); 83.0 years (CNV, diseased); and 74.5 years (SD, diseased). Mean immunolabeling scores obtained from masked semi-quantitative assessment were calculated for P2X4 and P2X7 in each of the five donor groups (Young, Old, GA, CNV, SD) in the RPE (Table 2.3). The RPE of young and healthy post-mortem human eyes exhibited very high P2X4 immunoreactivity. Immunohistochemistry on human post-mortem eyes showed that P2X4 in RPE was most immunoreactive in the SD group, with a 57% and 88% increase compared to the least immunoreactive GA and CNV donors (late-stage AMD), respectively (Figure 2.3). P2X4 and P2X7 immunolabeling was observed within and around RPE cell nuclei (Figure 2.4).   41   Table 2.3 Summary of P2X4 and P2X7 mean scores in human RPE and choroid.  Mean immunolabeling scores from the masked semi-quantitative visual scoring analysis for P2X4 and P2X7 in the human RPE and choroid were assessed across all five groups: Young (healthy eyes; n = 5; average age of 38.7 years), Old (healthy eyes; n = 8; average age of 72.4 years), GA (diseased eyes; n = 5; average age of 84.8 years), CNV (diseased eyes; n = 5; average age of 83.0 years), and SD (diseased eyes; n = 4; average age of 74.5 years).                      P2X4 Mean Scores P2X7 Mean Scores RPE Choroid RPE Choroid Young 2.20 1.20 1.40 0.60 Old 1.63 0.88 2.00 1.25 GA 1.43 1.00 2.00 1.29 CNV 1.20 1.40 1.40 1.00 SD 2.25 1.75 1.25 0.75  42   Figure 2.3 Semi-quantitative immunolabeling trends in human RPE and choroid.   Mean immunolabeling scores for P2X4 and P2X7 in human RPE and choroid were assessed across all five donor groups (Young; n = 5, Old; n = 8, GA; n = 5, CNV; n = 5, SD; n = 4). (A) Masked semi-quantitative assessment of P2X4 in human RPE and choroid shows higher immunoreactivity in SD donors. (B) Masked semi-quantitative assessment of P2X7 in human RPE and choroid shows higher immunoreactivity in Old and GA donors. Statistical analysis (ANOVA/Kruskal–Wallis test) did not reach significance, possibly due to a small sample size or the use of only a few distinct values (0, 1, 2, or 3).             43    Figure 2.4 P2X4 and P2X7 immunolabeling in human RPE and choroid.  (A) P2X4 and P2X7 immunolabeling within and around human RPE cell nuclei. (B) P2X4 and P2X7 immunolabeling within and around cell nuclei  in the human choroid. Black arrows indicate P2X4 or P2X7 labeling in human RPE and choroid (pinkish AEC immunolabeling). Hematoxylin was used for nuclear staining (purple). Negative control images for P2X4 and P2X7 (staining without primary antibody) are shown. Scale bars = 20 μm (60X magnification).    44  2.3.3 Immunolabeling Scores and Trends for P2X4 and P2X7 in Human Choroid  Mean immunolabeling scores obtained from masked semi-quantitative assessment were also calculated for P2X4 and P2X7 in each of the five donor groups (Young, Old, GA, CNV, SD) in the choroid (Table 2.3). In the choroid, P2X4 was also the most immunoreactive in the SD group, with a 75% and 99% increase compared to the GA and Old donors, respectively. In contrast, P2X7 in the RPE was least immunoreactive in the SD group, with a 60% decrease compared to both most immunoreactive donor groups (Old and GA). P2X7 in the choroid was most immunoreactive in the GA group, with a 115% increase compared to the least immunoreactive Young donor group (Figure 2.3). P2X4 and P2X7 immunolabeling was observed within and around cell nuclei in the choroid (Figure 2.4).  2.3.4 P2X4 and P2X7 mRNA Expression Levels in ARPE-19 Cells  Cultured ARPE-19 cells were grown to measure mRNA expression levels of P2X1-7 (Appendix Figure 2). Additionally, P2X3-7 primer efficiencies were calculated, and all values fell within the desired range of 90% – 110% (Appendix Table 1). Analysis of the relative expression levels of P2X4 (mean ± SD, 6.7 x 10-3 ± 6.3 x 10-4) and P2X7 (5.3 x 10-5 ± 8.8 x 10-6) mRNAs in ARPE-19 cells demonstrated a significantly higher level of P2X4 mRNA expression compared with P2X7 mRNA levels (p = 0.00011, Figure 2.5).       45   Figure 2.5 Relative mRNA levels of P2X4 and P2X7.  Normalized mean 2-ΔCt values (n = 3) were compared using a two-tailed Student’s t-test to determine statistical significance (**** p < 0.0001).    2.3.5 P2X4 and P2X7 Fab Fluorescent Double Labeling in Human Post-mortem Eyes Since the P2X4 and P2X7 primary antibodies were from the same host species (rabbit), a blocking method was applied to allow the use of these two same species primary antibodies. Unconjugated Fab fragments were used for blocking after the first secondary antibody step to present rabbit P2X7 antibody as goat. This enabled the ability to visualize localization of P2X4 and P2X7 immunofluorescent labeling in green and red, respectively, in the RPE and choroid of young human post-mortem donors. Immunoreactivity in the RPE was not analyzed as human RPE cells emit AF, likely attributed to the presence of lipofuscin granules [202]. For the most part, as indicated by the yellow immunofluorescent labeling and Mander’s overlap coefficient (MOC), P2X4 and P2X7 are largely co-localized within and around cell nuclei in the choroid (Figures 2.6 and 2.7). 46   Figure 2.6 P2X4 and P2X7 Fab fragment double labeling.  (A) Confocal images of P2X4 immunofluorescent labeling (green, 488 nm) and P2X7 immunofluorescent labeling (red, 546 nm) in young human post-mortem retinal sections. Yellow arrows indicate co-localized P2X4/7 (yellow immunofluorescent labeling) within and around cell nuclei in the choroid. (B)  Negative control images for P2X4 and P2X7 (staining without primary antibody). P2X4/7 labeling was not analyzed in human RPE due to autofluorescence. Scale bars = 20 μm (40X magnification). 47   Figure 2.7 P2X4 and P2X7 co-localization in human RPE and choroid.  Average Mander’s overlap coefficients (MOC) for P2X4 and P2X7 within and around human RPE and choroidal cell nuclei (± SD). MOC measures the percentage of pixels that overlap between P2X4 and P2X7 immunolabeling with values that range from 0 (no overlap) to 1 (complete overlap). All average MOC values are over 0.9, indicating a high degree of co-localization between P2X4 and P2X7 in these regions.   2.3.6 Spectral Imaging and Linear Unmixing  for RPE Autofluorescence Autofluorescence refers to the natural emission of light by biomolecules acting as endogenous fluorophores [203]. In fluorescence microscopy, the brightness at each pixel corresponds to the photoemission generated by the fluorophores [204]. The LSM 800 microscope does not inherently distinguish between AF and real labeling. Instead, it necessitates a combination of experimental design including control imaging, reference imaging, spectral unmixing, and post-acquisition analysis. Through spectral unmixing, autofluorescence is subtracted from the images to allow the visualization of true P2X4 and P2X7 labeling in the RPE of human post-mortem retinal sections. For the most part, as indicated by the yellow immunofluorescent labeling and 48  MOC, P2X4 and P2X7 are largely co-localized within and around RPE cell nuclei (Figures 2.7 and 2.8).   Figure 2.8 P2X4 and P2X7 immunolabeling in human RPE after spectral unmixing.  P2X4 and P2X7 immunolabeling within and around RPE cell nuclei in a young human donor. (A) P2X4 immunofluorescent labeling (green, 488 nm). (B) P2X7 immunofluorescent labeling (red, 546 nm). (C) Autofluorescent RPE with P2X4, P2X7, and DAPI labeling; RPE autofluorescence in white. (D) RPE without autofluorescence; true P2X4 and P2X7 labeling (with DAPI). (E) Autofluorescent RPE with P2X4 and P2X7 labeling (no DAPI); RPE autofluorescence in white. (F) RPE without autofluorescence; true P2X4 and P2X7 labeling (without DAPI). The green arrow indicates P2X4 labeling, the red arrow indicates P2X7 labeling, and the yellow arrow indicates co-localized P2X4/7 (yellow immunofluorescent labeling). Scale bars = 10 μm (80X magnification).    49  2.4 Discussion  2.4.1 ARPE-19 Cells in RPE and AMD Studies  ARPE-19 is a spontaneously arising human RPE cell line derived from a young 19-year-old male, and is widely used in RPE and AMD studies [64],[205]. ARPE-19 cells have been used to investigate the role of inflammasome activation in RPE cells implicated in AMD [206]. Therefore, ARPE-19 cells were used in this study to explore the expression of P2X1-7 receptors, which may play a role in inflammation implicated in AMD. The P2X7 receptor is expressed at both mRNA and protein levels in ARPE-19 cells, as well as native and cultured human RPE cells [88]. Furthermore, P2X7 receptors are expressed at both mRNA and protein levels in young and old mice [166]. In our data, the RT-qPCR and immunolabeling results demonstrate that P2X4 has highly abundant mRNA and protein levels in cultured ARPE-19 cells. Moreover, RPE and choroidal immunoreactivity of P2X4 was greater in both young and SD donors, whereas old and GA groups has greater P2X7 immunoreactivity in these same anatomical sites. These findings may suggest the involvement of the P2X4 receptor subtype in the early stages of AMD, while the P2X7 receptor subtype may be implicated in the intermediate or late stages of the disease.   2.4.2 P2X7 in the Implications of Inflammation  The P2X7 receptor is involved in inflammation, oxidative stress, and cell death, and mediates AMD-like defects, including RPE and photoreceptor degeneration, in both in vitro and in vivo models of AMD [166]. A lack of the P2X7 receptor or the addition of a P2X7 antagonist protects against AMD-like defects and decreases RPE and photoreceptor apoptosis [88],[207],[208],[209],[210],[211]. The P2X7 receptor is the only subtype that requires high 50  concentrations of ATP to be activated with a 50% effective concentration (EC50) of approximately 0.1-1 mM, while the remaining six P2X receptors have an EC50 of approximately 1-10 μM [88]. In comparison to P2X1-6, the P2X7 receptor has 10 to 100-fold reduced ATP sensitivity, suggesting that it may function as a detector for high concentrations of released ATP from neighbouring damaged cells [212],[213]. Under normal physiological conditions, extracellular ATP levels are approximately 10 nM [88],[122],[182]. Therefore, activation of P2X7 receptors may not be favoured under normal physiological conditions in human RPE.  2.4.3 P2X4 in the Implications of Inflammation  The P2X4 receptor is an emerging therapeutic candidate in microglia, macrophages, and endothelial cells in neuroinflammatory processes, where inhibition of P2X4 reduces the occurrence of inflammation and cell death [140],[149],[214],[215],[216],[217]. A study that used different P2X1-7 primers than ours demonstrated that P2X4 mRNA expression is higher than P2X7 mRNA expression in endothelial cells [218].  Similarly, in our data, P2X4 mRNA expression is significantly higher than P2X7 mRNA expression in RPE cells. Moreover, in our data, choroidal cells (possibly endothelial cells) exhibit immunoreactivity for both P2X4 and P2X7 receptors. Although both P2X4 and P2X7 receptors are activated by extracellular ATP and involved in inflammatory cascades, P2X4 receptors are around 1000 times more sensitive to extracellular ATP (at nanomolar concentrations) than P2X7 receptors [196],[219],[220]. Notably, likely owing to its uniquely high binding affinity for extracellular ATP, P2X4 receptors have the capability to sense extracellular ATP levels under regulated, homeostatic, and non-inflammatory conditions in bone marrow plasma cells [221]. P2X4 receptors are also recognized for triggering inflammation when exposed to elevated levels of extracellular ATP [191],[196]. Therefore, the activation of the more 51  sensitive P2X4 receptors may be more likely to occur in RPE cells when ATP concentrations fluctuate.  2.4.4 P2X4 and P2X7 in Eyes Containing Soft Drusen Notably, P2X4 and P2X7 have the highest sequence similarity compared to any of the other P2X receptor subtypes [190],[193],[220]. A haplotype of P2X7 receptor variant and P2X4 receptor variant may impair microglia and macrophage phagocytosis of subretinal and drusen deposits, which may contribute to the development of AMD [222]. P2X7-mediated phagocytosis is reduced when co-expressed with the mutant P2X4 receptor, which may result in AMD-like phenotypes such as debris accumulation, Bruch’s membrane thickening, RPE abnormalities, and inflammation [223]. Furthermore, patients with advanced AMD (GA and CNV) are more likely to inherit single nucleotide polymorphisms in P2X4 and P2X7, which reduce monocyte phagocytosis [224]. Our data show that P2X4 receptors (P2X4 RPE mean score = 2.25; P2X4 choroid mean score = 1.75) have an 80% and 133% increase in immunoreactivity when compared to P2X7 receptors (P2X7 RPE mean score = 1.25; P2X7 choroid mean score = 0.75) in the RPE and choroid of eyes containing soft drusen, respectively. It is possible that high expression and activation of P2X4 receptors under normal physiological conditions, characterized by lower ATP levels, may lead to reduced P2X7-mediated phagocytosis, contributing to the build-up of drusen deposits in AMD.  2.4.5 Co-expression and Co-localization of P2X4 and P2X7 Co-expression of P2X4 and P2X7 is observed in immune, inflammatory, and endothelial cells in different tissue types [88],[195],[225],[226]. In this study, co-expression refers to the simultaneous presence of both P2X4 and P2X7 in a specific area (e.g., RPE/choroid/neuroretina), 52  while co-localization denotes the spatial overlap within the same region. Our Fab fragment double immunolabeling data indicate that P2X4 and P2X7 are co-expressed in the choroid, possibly in immune cells or endothelial cells of the blood vessel walls. Furthermore, P2X4 and P2X7 are co-expressed in the RPE as depicted in the spectrally unmixed images. Notably, there may be crosstalk between RPE cells and choroidal endothelial cells via NLRP3 inflammasome, which promotes wet AMD [227]. In our data, P2X4 and P2X7 receptors are co-localized in the RPE and choroid as determined by MOC, suggesting potential interactions or shared functions.   2.4.6 P2X4 and P2X7 in NLRP3 Inflammasome Activation  It has been hypothesized that the P2X7 receptor plays a phagocytic role at low ATP levels, but  elevated ATP levels due to cellular stress (e.g., injury or death) may trigger the P2X7 receptor to switch to an inflammatory role [228],[229]. In the context of AMD, the NLRP3 inflammasome is activated in RPE cells and immune cells through the activation of the P2X7 receptor by extracellular ATP [177],[189],[206],[230],[231]. Notably, P2X4 tends to exacerbate the severity of diseases that pathophysiologically involve NLRP3 inflammasome activation [218]. There is evidence for the functional interaction of P2X4 and P2X7, where the P2X4 receptor contributes to P2X7-mediated signaling and cell death in macrophages [217]. Moreover, co-expression of P2X4 with P2X7 is required for P2X7-dependent proinflammatory cytokine release (IL-1β and IL-18) in dendritic cells, thereby enhancing inflammation [232]. A potential interaction between P2X4 and P2X7, possibly supported by our co-expression and co-localization data in the RPE and choroid, may involve their simultaneous activation, thereby promoting inflammation (e.g., NLRP3 activation) in RPE cells and choroidal immune cells.  53  2.4.7 P2X4 and P2X7 in Intracellular Trafficking In addition to demonstrating overlapping expression patterns in immune cells and participating in inflammatory processes, P2X4 and P2X7 receptors seem to also play a role in promoting intracellular trafficking in various cell types [220],[225],[233]. A potential explanation for their shared expression and signaling patterns may be the assembly of functional heterotrimers [191],[220]. P2X4 and P2X7 interactions may participate in pore formation through the assembly of separate homotrimers with a close physical interaction, or P2X4 and P2X7 subunits forming heterotrimeric complexes [190]. In rodent microglia and macrophages, P2X7 receptors were predominantly localized at the cell surface, whereas P2X4 receptors were predominantly localized intracellularly [225]. In our ARPE-19 cell culture data, P2X7 receptors are also more localized at the cell surface of RPE cells, and P2X4 receptors are largely localized intracellularly (Figures 2.1 and 2.2). The P2X4 receptor is also implicated in endo-lysosomal membrane trafficking [234],[235],[236]. Intracellular labeling may represent the internalization of activated receptors, especially in the case of the P2X4 subtype, where receptor activation and deactivation may occur through internalization, followed by recycling to the cell surface [237]. In our immunofluorescent data on ARPE-19 cells with TX-100, both P2X4 and P2X7 receptors seem to be trafficked, as shown by the green immunolabeling within cells, potentially localized in cellular structures such as the plasma membrane, endoplasmic reticulum, or Golgi apparatus. There seems to be a higher level of trafficking for P2X4, which may possibly be due to rapid signaling as a result of the receptor’s higher sensitivity to extracellular ATP compared to the P2X7 receptor.    54  Chapter 3: P2X Receptors in Mouse Eyes  3.1 Introduction Studies involving human donor eyes have significantly contributed to insights in understanding AMD. However, the scarcity of eye donors, particularly those diagnosed with AMD, poses a considerable challenge. The rarity of human donor eyes, both with and without AMD, coupled with the multifactorial nature of the disease, adds complexity to AMD research [238]. Despite these challenges, the use of animal models provides an opportunity to study AMD under controlled conditions. Mice are widely used to create models of AMD due to their genetic similarity, shorter gestation periods, and ease of manipulation [239]. Despite lacking a macula, mouse models successfully replicate many human AMD features such as RPE/photoreceptor atrophy and lipofuscin accumulation [240]. Using available mouse models (Young, Old, laser-induced CNV, ApoE knockout on regular diet, ApoE knockout on high fat diet), this study explores P2X receptor expression and localization in the inner and outer retina. ApoE knockout mice on both regular and high fat diets exhibit AMD-like phenotypes, while laser-induced CNV mice serve as a model for wet AMD [241],[242],[243],[244],[245]. Therefore, these mouse models are useful for studying early pathological changes or CNV in AMD. This chapter aims to investigate P2X receptor expression and localization in mouse retinal sections. The findings from Chapter 3 will elucidate the expression and localization of P2X4 and P2X7 in the RPE, choroid, and neuroretina of mouse eyes in different AMD models. Chapter 3 includes study Aim 4 and the respective hypothesis:   55  Aim 4: To determine the expression and localization of P2X4 and P2X7 in mouse RPE, choroid, and neuroretina  Hypothesis of Aim 4: P2X4 and P2X7 expression and localization will be the same in human and mouse RPE and choroid due to evolutionary conservation   3.2 Methods  3.2.1 Mouse Eyes and Immunohistochemistry  Mouse eye sections were obtained from five different experimental groups: Young (3 months; C57BL/6J mice, Jackson Laboratory), Old (17 months; C57BL/6J mice, Jackson Laboratory), laser-induced CNV (C57BL/6J mice, Jackson Laboratory), ApoE knockout on regular diet (B6.129P2-Apoetm1Unc/J, Jackson Laboratory), and ApoE knockout on high fat diet (B6.129P2-Apoetm1Unc/J, Jackson Laboratory). Mouse eye sections were incubated at 60°C for 30 minutes before deparaffinization. The slides were deparaffinized using the same steps as those applied to the human post-mortem retinal slides. After deparaffinization, the mouse eye sections were washed with PBS and subjected to antigen retrieval with proteinase K for 10 minutes. Sections were blocked with 0.3% H2O2 in distilled water for 15 minutes at room temperature, and in a mixture comprising of 5% normal goat serum (Vector Labs) and 0.6% TX-100 in PBS for 20 minutes at room temperature. Sections were then incubated with P2X4 or P2X7 rabbit polyclonal antibody (1:100, Alomone Labs) for 6 hours at room temperature and then overnight at 4℃ (Table 2.1). Primary antibodies were omitted for negative control. On the second day, sections were washed with PBS and incubated with Alexa 488 conjugated goat anti-rabbit secondary antibody (1:400, Invitrogen). DAPI (1:500, Vector Labs) was used for cell nuclei counterstaining. Slides 56  were mounted with MOWIOL 4-88 solution and 1.5 mm coverslips. An LSM 800 confocal laser scanning microscope was used to image antibody labeling for Alexa 488 and DAPI. All confocal settings were kept constant throughout the imaging sessions.   3.3 Results    3.3.1 Immunolabeling Scores and Trends for P2X4 and P2X7 in Mouse RPE and Choroid  Mouse retinal sections were immunolabeled with P2X4 or P2X7 antibody to examine the expression patterns of these two P2X receptor subtypes in mouse RPE and choroid. Mean immunolabeling scores obtained from masked semi-quantitative assessment were calculated for P2X4 and P2X7 in each of the five groups (Young, Old, laser-induced CNV, ApoE knockout on regular diet, ApoE knockout on high fat diet; n = 3) in the RPE and choroid (Table 3.1). For the laser-induced CNV mice, scores were given for both on- and off-lesion sites.   P2X4 in the RPE was most immunoreactive in the Young mice, with a 60% and 71% increase compared to both the ApoE knockout mice on regular diet and high fat diet, respectively. In the choroid, P2X4 was also the most immunoreactive in the Young mice, with a 78%, 67%, 93%, and 128% increase compared to the Old, laser-induced CNV (lesion sites only), and ApoE knockout mice (both regular diet and fat diet), respectively. Overall, P2X4 was most immunoreactive in the retina of Young mice and least immunoreactive in the ApoE knockout mice on high fat diet in both the RPE and choroid.   57  P2X7 in the RPE was also the most immunoreactive in the Young mice, with a 405%, 50%, 88%, 88% increase compared to the Old, laser-induced CNV (both on- and off-lesion sites), and ApoE knockout mice on regular diet, respectively. In the choroid, P2X7 was again the most immunoreactive in the Young mice, with a 300% increase compared to the Old mice. Overall, P2X7 was most immunoreactive in the Young mice and least immunoreactive in the Old mice in both the RPE and choroid. Representative images of P2X4 and P2X7 labeling in mice RPE and choroid are presented to illustrate variations in mean immunolabeling scores between the most and least immunoreactive groups (Figure 3.1).   Table 3.1 Summary of P2X4 and P2X7 mean scores in mouse RPE and choroid.  Mean immunolabeling scores from the masked semi-quantitative visual scoring analysis for P2X4 and P2X7 in mouse RPE and choroid were assessed across all five groups: Young (healthy eyes; n = 3; 3 months), Old (healthy eyes; n = 3; 17 months), laser-induced CNV for both on- and off-lesion sites (diseased eyes; n = 3; 3 months), ApoE knockout on regular diet (diseased eyes; n = 3; 3 months), and ApoE knockout on high fat diet (diseased eyes; n = 3; 3 months).     P2X4 Mean Scores P2X7 Mean Scores RPE Choroid RPE Choroid Young 1.78 1.85 1.11 1.04 Old 1.37 1.04 0.22 0.26 CNV (normal) 1.26 1.26 0.74 0.70 CNV (lesion) 1.22 1.11 0.59 0.96 ApoE -/- (regular diet) 1.11 0.96 0.59 0.89 ApoE -/- (high fat diet) 1.04 0.81 0.93 0.70  58   Figure 3.1 P2X4 and P2X7 immunolabeling in mouse RPE and choroid.  (A) P2X4 was most immunoreactive in Young mice and least immunoreactive in ApoE knockout mice on high fat diet for both RPE and choroid. (B) P2X7 was most immunoreactive in Young mice and least  immunoreactive in Old mice for both RPE and choroid. Negative control images for P2X4 and P2X7 (staining without primary antibody) are shown. Scale bars = 20 μm (40X magnification).  3.3.2 Immunolabeling Scores and Trends for P2X4 and P2X7 in Mouse Neuroretina  Mean immunolabeling scores obtained from masked semi-quantitative assessment were also calculated for P2X4 and P2X7 in the other retinal layers (GCL, IPL, INL, OPL, ONL, PL). P2X4 was the most immunoreactive in the GCL and least immunoreactive in the photoreceptor segments in the Young and Old mice, the non-CNV lesion sites of the laser-induced CNV mice, and the ApoE knockout mice on both regular diet and high fat. P2X4 immunoreactivity was higher in the inner retinal layers (GCL, IPL, INL) of Old mice compared to Young mice. Conversely, in the outer retinal layers (OPL, ONL, PL), P2X4 immunoreactivity was greater in Young mice than in Old mice. No significant differences for P2X4 immunoreactivity were observed between the 59  on- and off-lesion sites of the laser-induced CNV mice. Notably, P2X4 was consistently higher in the ApoE knockout mice on high fat diet than the ApoE knockout mice on regular diet in all six layers.   P2X7 was the most immunoreactive in the Young mice in five out of the six layers (IPL, INL, OPL, ONL, PL). In the GCL, P2X7 is most immunoreactive in the ApoE knockout mice on regular diet. P2X7 was the least immunoreactive in lesion sites of the laser-induced CNV mice (GCL, OPL, ONL, PL) and Old mice (IPL, INL). Notably, P2X7 was more immunoreactive in the Young mice than the Old mice for all six layers. Similarly to P2X4, no significant differences for P2X7 immunoreactivity were observed between the on- and off-lesion sites of the laser-induced CNV mice. On the contrary to the trend observed for P2X4 in the ApoE knockout mice, P2X7 was consistently higher in the ApoE knockout mice on regular diet than the ApoE knockout mice on high fat diet in all six layers. Representative images of P2X4 and P2X7 labeling in mice neuroretina are presented to illustrate variations in mean immunolabeling scores between the ApoE knockout mice on regular diet and high fat diet (Figure 3.2).  60   Figure 3.2 P2X4 and P2X7 immunolabeling in mouse neuroretina.  (A) P2X4 had higher immunoreactivity in ApoE knockout mice on high fat diet than those on regular diet in all six layers. (B) P2X7 had higher immunoreactivity in ApoE knockout mice on regular diet than those on high fat diet in all six layers. Negative control images for P2X4 and P2X7 (staining without primary antibody) are shown. Scale bars = 20 μm (20X magnification).   61  3.3.3 Expression and Localization of P2X4 and P2X7 in the Inner and Outer Mouse Retina   The expression and localization of P2X4 and P2X7 in human RPE was not possible due to AF until spectral unmixing was applied. Unlike the human RPE, mouse RPE does not exhibit autofluorescence, allowing for the investigation of P2X4 and P2X7 labeling (Figure 3.3). Similar to the observations in cultured ARPE-19 cells, P2X4 and P2X7 were labeled around RPE cell nuclei, both on the membrane and intracellularly in mice. Additionally, in the mouse choroid, P2X4 and P2X7 were localized within and around RPE and choroidal cell nuclei, consistent with observations in human post-mortem retinal sections. P2X4 and P2X7 exhibited similar localization patterns in the neuroretina, with labeling within and around cell nuclei in the GCL, INL, and ONL. Some labeling was also observed within the IPL and OPL, possibly indicating the processes and terminals of neurons in these layers, suggesting the involvement of P2X receptors in retinal neurotransmission. The photoreceptor inner segments appeared more fluorescent than the outer segments. Representative images illustrating the expression patterns of P2X4 and P2X7 in the RPE, choroid, and layers of the neuroretina (GCL, IPL, INL, OPL, ONL, PL) in the mouse retina are shown (Figure 3.4).    Figure 3.3 Absence of RPE autofluorescence in mouse eyes.  Comparison between negative control images (staining without primary antibody) of (A) a young human retinal section and (B) a young mouse retinal section shows that mouse RPE does not exhibit autofluorescence (AF). Scale bars = 20 μm (40X magnification). 62   Figure 3.4 P2X4 and P2X7 labeling in the inner and outer mouse retina.  (A) Representative images of P2X4 labeling in mouse retinal layers (GCL, IPL, INL, OPL, ONL, PL, RPE, and choroid). (B) Representative images of P2X7 labeling in mouse retinal layers (GCL, IPL, INL, OPL, ONL, PL, RPE, and choroid). White arrows indicate P2X4 or P2X7 fluorescent immunolabeling (green, 488 nm). Scale bars = 20 μm (20X and 40X magnification).    63  3.4 Discussion  3.4.1 P2X4 and P2X7 in the Mouse Retina  The diverse distribution of P2X receptor subtypes throughout the retina suggests that P2X receptor-mediated signaling may influence various mechanisms at different retinal layers or connections in the retinal synaptic network [158]. In our P2X4 and P2X7 immunolabeling results, there appear to be varying levels of immunolabeling in the RPE, choroid, and neuroretina in mice. Previous studies have demonstrated the distribution of P2X4 (GCL, IPL, INL, OPL, PL) and P2X7 (GCL, IPL, INL, OPL, PL) in the mouse retina [127],[153]. This is consistent with our P2X4 and P2X7 labeling in the GCL, IPL, INL, OPL, and PL. Furthermore, studies demonstrate the expression of P2X4 and P2X7 in retinal neurons (ganglion/horizontal/amacrine), glial cells (Müller/astrocytes/microglia), and photoreceptor terminals [153],[229],[246],[247],[248]. In our data, we observed P2X4 and P2X7 labeling in both the inner and outer segments where neuronal synaptic terminals are located, as well as in the OPL where the photoreceptor terminals are located, suggesting the potential involvement of purinergic signaling in synaptic transmission pathways, possibly through communication between neurons and glial cells in the retina.  3.4.2 Spatial Single Cell Atlas of the Mouse Retina  The Rui Chen Lab at Baylor College of Medicine (Houston, Texas) created a spatial single cell atlas of the mouse retina [249]. This atlas consisted of a total of 8854 cells, with the following major cell types: amacrine cell (AC; 953 cells), bipolar cell (BC; 1295 cells), horizontal cell (HC; 59 cells), Müller glia (MG; 383 cells), retinal ganglion cell (RGC; 160 cells), cone (372 cells), and rod (5632 cells). P2X1 was not detected in any of the mouse retina cell types (AC, BC, HC, MG, 64  RGC, cone, rod). The following P2X2-7 receptor subtypes were detected as follows: P2X2 in ACs/RGCs, P2X3 in ACs/MGs/RGCs/cones, P2X4 in ACs/BCs/HCs/MGs/RGCs/rods, P2X5 in ACs/BCs/RGCs/cones, P2X6 in ACs/MGs/RGCs, and P2X7 in MGs/RGCs. In our P2X4 and P2X7 immunolabeling in mouse eyes, labeling appears to be present in all six retinal layers (GCL, IPL, INL, OPL, ONL, PL), which house these mapped cell types in the mouse retina. Müller cells are known to support the neurons and span the entire retinal thickness, and activated Müller cells release ATP and act on P2X4 and P2X7 receptors [16],[250]. Notably, P2X7 receptors found on glial cells such as astrocytes and microglia may have an indirect influence on neuronal function/activity [248],[251]. Since retinal glia (Müller cells, astrocytes, microglia) express P2X receptors and have the ability to release ATP, the activation of purinergic signaling may further trigger downstream pathways. This phenomenon could offer another plausible explanation for the ubiquitous expression of P2X4 and P2X7 labeling observed in all six retinal layers in mouse eyes, and their possible involvement in neurotransmission among all the retinal cells.  3.4.3 Apolipoprotein E Knockout Mice and Inflammation Implicated in AMD ApoE plays a crucial role in lipid metabolism and cholesterol transportation, and is expressed in various parts of the eye including Müller cells, drusen, BM, and RPE [252],[253]. ApoE plays a role in lipid trafficking through the BM, where ApoE knockout mice subsequently exhibit lipid deposits, similar to the drusen buildup in AMD [254]. Furthermore, ApoE knockout mice exhibit AMD-like alterations such as RPE degeneration, BM thickening, lipid deposition, and photoreceptor dysfunction at the age of eight months [242],[243]. Given these AMD-like phenotypes, 9-month old ApoE knockout mice were used for the investigation of P2X4 and P2X7 expression and localization in the mouse retina. ApoE contributes to the prolonged survival of 65  subretinal mononuclear phagocytes, potentially disrupting regulatory mechanisms and leading to the accumulation of debris and sustained release of inflammatory signals, thereby promoting chronic inflammation in AMD [255]. The accumulation of debris may act as a potential stressor for retinal cells (e.g., RPE cells), resulting in the release of ATP, and subsequent P2X receptor and inflammasome activation.  3.4.4 Laser-induced Choroidal Neovascularization in Mice The laser-induced CNV mouse model is currently the dominant model used to study wet AMD. The administration of targeted laser injury to the RPE/BM induces angiogenesis, a hallmark of wet AMD [245]. Laser-induced mice eyes typically reach maximal CNV development at seven days post-laser treatment, and neovascularization begins to regress in the days following [256],[257]. Our CNV mouse model is induced using a green Argon laser (532 nm) for injury, where the lesion sites can be located by CNV penetrating the BM into the RPE layer, creating volcano-shaped mountains in the mouse retinal cross-sections. A study revealed that using a P2X7 receptor antagonist, both in vitro and in vivo, reduced retinal inflammation and neovascularization [198]. Notably, laser-induced CNV mice expressed P2X4 and P2X7 receptors in activated microglia, with immunoreactivity peaking four days post-laser treatment and decreasing in the following days. Furthermore, PPADS (P2X antagonist) inhibition decreased P2X4 and P2X7 mRNA levels, microglial activity, and the formation of CNV [150]. In our data, significant differences in P2X4 and P2X7 immunoreactivity were not observed between the on- and off-lesion sites of the laser-induced CNV mice. This may be partly due to enucleating the mice eyes on day seven, when lower levels of P2X4 and P2X7 may be present.  66  Chapter 4: Study Conclusions  4.1 Summary In this study, the potential role of P2X4 and P2X7 receptors in AMD was explored. Given that retinal cells release ATP when triggered by various pathogenic stimuli, it was hypothesized that the overactivation of ATP-activated P2X receptors drives RPE atrophy, thereby promoting photoreceptor atrophy in AMD. P2X4 and P2X7 expression and localization were determined in cultured ARPE-19 cells, human post-mortem retinal sections, and mouse retinal sections. Immunohistochemistry and RT-qPCR identified P2X4 as the main P2X receptor subtype in cultured ARPE-19 cells and human post-mortem RPE, indicating the possible involvement of another P2X receptor subtype other than P2X7 in AMD. P2X4 and P2X7 receptors are expressed in ARPE-19 cells and human/mouse retina, but their expression levels vary with age, donor group/mouse strain, and retinal degenerative pathology. The ubiquitous distribution of both P2X receptor subtypes throughout the retina warrants further investigation into their function and interactions in AMD.  4.2 Strengths and Limitations The biggest strength of this study is the use of healthy/diseased human eyes to explore P2X1-7 expression and localization, providing direct and relevant insight into the functioning of the human retina, and highlighting the translational potential of this study. However, a common limitation of post-mortem tissue is the variability in donor background such as genetics, medical history, and environmental factors, that cannot be completely controlled for and can complicate the interpretation of the results of the study.  67  While the P2X1-7 antibodies were all purchased from the same company (Alomone Labs) and some of the P2X receptor antibodies were knockout validated (P2X1, P2X4, and P2X7), these antibodies may exhibit potential differences in specificity for their respective epitopes. Therefore, it is not possible to make relative comparisons between P2X1-7 immunoreactivity. However, it is still possible to explore P2X4 or P2X7 expression and localization in human post-mortem retinal sections separately and observe trends of one antibody’s labeling patterns between the different donor groups (Figure 2.3). The same limitation can be applied to the use of different P2X1-7 primers for RT-qPCR. To determine the efficiencies of our primers, we ran standard curves for P2X3-7 (Appendix Figure 2 and Table 1). Since all the efficiencies fall within the acceptable range and are in close proximity, the results from our RT-qPCR experiment are likely more reliable. Consequently, P2X3-7 mRNA levels with large differences can be comparatively assessed.  Unlike humans, mice do not have a macula, which may limit possible extrapolations made from mouse models. Additionally, variations and characteristics among mouse models may influence the outcome of immunolabeling experiments. Nonetheless, mice share many genetic similarities with humans, serving as a powerful tool for disease modeling, mechanistic insights, and therapeutic testing. Mouse studies can be complemented with other animal models with a macula (e.g., monkeys) and in vitro cell culture systems to gain a more comprehensive understanding of AMD [258].     68  4.3 Anticipated Significance The P2X7 receptor is the only subtype that has been extensively researched within the outer retina to date, while the precise role of the P2X4 receptor in RPE cells has not been elucidated. This is the first study to investigate all seven P2X receptor subtypes in the RPE/choroid of human post-mortem eye samples. It contributes to understanding the expression and localization patterns of P2X receptors in the inner and outer retina. The results from this study may support future experiments to clarify whether P2X receptors, particularly P2X4 and P2X7, play an essential role in RPE atrophy and AMD.   4.4 Future Directions  While our study demonstrated P2X receptor immunolabeling in human post-mortem eyes and highlighted the high immunoreactivity of the P2X4 receptor subtype in eyes with soft drusen, the P2X4 immunoreactivity cannot be comparatively assessed against the immunoreactivity of the remaining six P2X receptor subtypes. Therefore, future experiments should include methods to overcome this caveat by validating the specificity of each of the P2X1-7 antibodies.   Our study revealed that the P2X4 receptor subtype is highly abundant at both mRNA and protein levels in the human/mouse retina and ARPE-19 cells, thereby highlighting a potential role due to its abundance. Further investigation into the specific mechanisms of P2X4 receptor activation associated with inflammation and cell death pathways implicated in AMD, as well as its potential interactions with the P2X7 receptor in diseased states, is warranted. Moreover, addressing the destinations and mechanisms of P2X4 and P2X7 receptors in trafficking could 69  enhance our understanding of plasma membrane regulation and the maintenance of RPE/BM/choroid/neuroretina.  Numerous P2X7 receptor antagonists have entered clinical trials to treat inflammatory conditions (e.g., JNJ-54175446 for neuropsychiatric disorders; EVT401 for rheumatoid arthritis). Furthermore, a few P2X4 receptor antagonists (e.g., NC-2600 and BX430) have entered clinical trials to treat neuropathic pain [259],[260]. In recent years, efforts have been focused on discovering a P2X7 drug capable of crossing the blood-brain barrier to treat neuroinflammation [261]. Notably, several companies (e.g., Inflammasome Therapeutics, Breye Therapeutics, Golgi Neurosciences) have proposed P2X7-targeted therapy to treat eye diseases, including AMD [262],[263]. These developments highlight the growing significance of targeting purinergic receptors, thereby presenting promising outlooks to address various medical conditions.       70  Bibliography  [1] C. E. Willoughby, D. Ponzin, S. Ferrari, A. Lobo, K. Landau, and Y. Omidi, “Anatomy and physiology of the human eye: effects of mucopolysaccharidoses disease on structure and function – a review,” Clinical Exper Ophthalmology, vol. 38, no. s1, pp. 2–11, Aug. 2010, doi: 10.1111/j.1442-9071.2010.02363.x. [2] S. Roy and P. Nagrale, “Encoding the Photoreceptors of the Human Eye,” Cureus, vol. 14, no. 10, p. e30125, Oct. 2022, doi: 10.7759/cureus.30125. [3] F. Willermain et al., “Origins and consequences of hyperosmolar stress in retinal pigmented epithelial cells,” Front Physiol, vol. 5, p. 199, 2014, doi: 10.3389/fphys.2014.00199. [4] H. Kolb, “Simple Anatomy of the Retina,” in Webvision: The Organization of the Retina and Visual System, H. Kolb, E. Fernandez, and R. Nelson, Eds., Salt Lake City (UT): University of Utah Health Sciences Center, 1995. Accessed: Jan. 08, 2024. [Online]. Available: http://www.ncbi.nlm.nih.gov/books/NBK11533/ [5] N. Mahabadi and Y. Al Khalili, “Neuroanatomy, Retina,” in StatPearls, Treasure Island (FL): StatPearls Publishing, 2023. Accessed: Jan. 03, 2024. [Online]. Available: http://www.ncbi.nlm.nih.gov/books/NBK545310/ [6] M. Ptito, M. Bleau, and J. Bouskila, “The Retina: A Window into the Brain,” Cells, vol. 10, no. 12, p. 3269, Nov. 2021, doi: 10.3390/cells10123269. [7] K. A. Hussey, S. E. Hadyniak, and R. J. Johnston, “Patterning and Development of Photoreceptors in the Human Retina,” Front Cell Dev Biol, vol. 10, p. 878350, 2022, doi: 10.3389/fcell.2022.878350. [8] T. D. Lamb, “Why rods and cones?,” Eye (Lond), vol. 30, no. 2, pp. 179–185, Feb. 2016, doi: 10.1038/eye.2015.236. [9] J. Harris, Y. Subhi, and T. L. Sørensen, “Effect of aging and lifestyle on photoreceptors and retinal pigment epithelium: cross-sectional study in a healthy Danish population,” Pathobiol Aging Age Relat Dis, vol. 7, no. 1, p. 1398016, 2017, doi: 10.1080/20010001.2017.1398016. [10] C.-H. Sung and J.-Z. Chuang, “The cell biology of vision,” J Cell Biol, vol. 190, no. 6, pp. 953–963, Sep. 2010, doi: 10.1083/jcb.201006020. [11] J. S. Diamond, “Inhibitory Interneurons in the Retina: Types, Circuitry, and Function,” Annu Rev Vis Sci, vol. 3, pp. 1–24, Sep. 2017, doi: 10.1146/annurev-vision-102016-061345. [12] R. E. Mazade and E. D. Eggers, “Inhibitory components of retinal bipolar cell receptive fields are differentially modulated by dopamine D1 receptors,” Vis Neurosci, vol. 37, p. E01, Feb. 2020, doi: 10.1017/S0952523819000129. [13] T. G. Wensel, “Chapter 51 - Molecular Biology of Vision,” in Basic Neurochemistry (Eighth Edition), S. T. Brady, G. J. Siegel, R. W. Albers, and D. L. Price, Eds., New York: Academic Press, 2012, pp. 889–903. doi: 10.1016/B978-0-12-374947-5.00051-1. [14] S. Dagar, S. Nagar, M. Goel, P. Cherukuri, and N. K. Dhingra, “Loss of Photoreceptors Results in Upregulation of Synaptic Proteins in Bipolar Cells and Amacrine Cells,” PLoS ONE, vol. 9, no. 3, p. e90250, Mar. 2014, doi: 10.1371/journal.pone.0090250. [15] A. Reichenbach and A. Bringmann, “Glia of the human retina,” Glia, vol. 68, no. 4, pp. 768–796, Apr. 2020, doi: 10.1002/glia.23727. 71  [16] S. G. Kobat and B. Turgut, “Importance of Müller Cells,” Beyoglu Eye J, vol. 5, no. 2, pp. 59–63, 2020, doi: 10.14744/bej.2020.28290. [17] M. H. Tempone et al., “The Healthy and Diseased Retina Seen through Neuron-Glia Interactions,” Int J Mol Sci, vol. 25, no. 2, p. 1120, Jan. 2024, doi: 10.3390/ijms25021120. [18] H.-S. Yoo, U. Shanmugalingam, and P. D. Smith, “Harnessing Astrocytes and Müller Glial Cells in the Retina for Survival and Regeneration of Retinal Ganglion Cells,” Cells, vol. 10, no. 6, p. 1339, May 2021, doi: 10.3390/cells10061339. [19] L. Lorenz, S. Hirmer, A. Schmalen, S. M. Hauck, and C. A. Deeg, “Cell Surface Profiling of Retinal Müller Glial Cells Reveals Association to Immune Pathways after LPS Stimulation,” Cells, vol. 10, no. 3, p. 711, Mar. 2021, doi: 10.3390/cells10030711. [20] L. Fernández-Sánchez, P. Lax, L. Campello, I. Pinilla, and N. Cuenca, “Astrocytes and Müller Cell Alterations During Retinal Degeneration in a Transgenic Rat Model of Retinitis Pigmentosa,” Front. Cell. Neurosci., vol. 9, Dec. 2015, doi: 10.3389/fncel.2015.00484. [21] E. L. Fletcher et al., “A review of the role of glial cells in understanding retinal disease,” Clinical and Experimental Optometry, vol. 91, no. 1, pp. 67–77, Jan. 2008, doi: 10.1111/j.1444-0938.2007.00204.x. [22] R. De Hoz et al., “Retinal Macroglial Responses in Health and Disease,” BioMed Research International, vol. 2016, pp. 1–13, 2016, doi: 10.1155/2016/2954721. [23] W. Ma, L. Zhao, and W. T. Wong, “Microglia in the outer retina and their relevance to pathogenesis of age-related macular degeneration,” Adv Exp Med Biol, vol. 723, pp. 37–42, 2012, doi: 10.1007/978-1-4614-0631-0_6. [24] D. V. Telegina, O. S. Kozhevnikova, and N. G. Kolosova, “Changes in Retinal Glial Cells with Age and during Development of Age-Related Macular Degeneration,” Biochemistry (Mosc), vol. 83, no. 9, pp. 1009–1017, Sep. 2018, doi: 10.1134/S000629791809002X. [25] S. Yang, J. Zhou, and D. Li, “Functions and Diseases of the Retinal Pigment Epithelium,” Front Pharmacol, vol. 12, p. 727870, 2021, doi: 10.3389/fphar.2021.727870. [26] A. Lakkaraju et al., “The cell biology of the retinal pigment epithelium,” Prog Retin Eye Res, p. 100846, Feb. 2020, doi: 10.1016/j.preteyeres.2020.100846. [27] W. Kwon and S. A. Freeman, “Phagocytosis by the Retinal Pigment Epithelium: Recognition, Resolution, Recycling,” Front Immunol, vol. 11, p. 604205, 2020, doi: 10.3389/fimmu.2020.604205. [28] V. L. Bonilha, “Age and disease-related structural changes in the retinal pigment epithelium,” Clin Ophthalmol, vol. 2, no. 2, pp. 413–424, Jun. 2008, doi: 10.2147/opth.s2151. [29] R. Agrawal et al., “Exploring choroidal angioarchitecture in health and disease using choroidal vascularity index,” Prog Retin Eye Res, vol. 77, p. 100829, Jul. 2020, doi: 10.1016/j.preteyeres.2020.100829. [30] M. Ferrara, G. Lugano, M. T. Sandinha, V. R. Kearns, B. Geraghty, and D. H. W. Steel, “Biomechanical properties of retina and choroid: a comprehensive review of techniques and translational relevance,” Eye, vol. 35, no. 7, pp. 1818–1832, Jul. 2021, doi: 10.1038/s41433-021-01437-w. [31] C. S. Cowan et al., “Cell Types of the Human Retina and Its Organoids at Single-Cell Resolution,” Cell, vol. 182, no. 6, pp. 1623-1640.e34, Sep. 2020, doi: 10.1016/j.cell.2020.08.013. 72  [32] A. Invernizzi, M. Pellegrini, E. Cornish, K. Yi Chong Teo, M. Cereda, and J. Chabblani, “Imaging the Choroid: From Indocyanine Green Angiography to Optical Coherence Tomography Angiography,” Asia Pac J Ophthalmol (Phila), vol. 9, no. 4, pp. 335–348, 2020, doi: 10.1097/APO.0000000000000307. [33] K. R. Chirco, E. H. Sohn, E. M. Stone, B. A. Tucker, and R. F. Mullins, “Structural and molecular changes in the aging choroid: implications for age-related macular degeneration,” Eye, vol. 31, no. 1, pp. 10–25, Jan. 2017, doi: 10.1038/eye.2016.216. [34] K. Ford and P. A. D’Amore, “Retinal Pigment Epithelial–Choroid Interactions,” in Encyclopedia of the Eye, D. A. Dartt, Ed., Oxford: Academic Press, 2010, pp. 81–88. doi: 10.1016/B978-0-12-374203-2.00147-0. [35] R. Ehrlich, A. Harris, N. S. Kheradiya, D. M. Winston, T. A. Ciulla, and B. Wirostko, “Age-related macular degeneration and the aging eye,” Clin Interv Aging, vol. 3, no. 3, pp. 473–482, 2008, doi: 10.2147/cia.s2777. [36] K. L. Pennington and M. M. DeAngelis, “Epidemiology of age-related macular degeneration (AMD): associations with cardiovascular disease phenotypes and lipid factors,” Eye Vis (Lond), vol. 3, p. 34, 2016, doi: 10.1186/s40662-016-0063-5. [37] A. Gheorghe, L. Mahdi, and O. Musat, “AGE-RELATED MACULAR DEGENERATION,” Rom J Ophthalmol, vol. 59, no. 2, pp. 74–77, 2015. [38] Y. Deng et al., “Age-related macular degeneration: Epidemiology, genetics, pathophysiology, diagnosis, and targeted therapy,” Genes Dis, vol. 9, no. 1, pp. 62–79, Jan. 2022, doi: 10.1016/j.gendis.2021.02.009. [39] R. F. Spaide and C. A. Curcio, “Drusen characterization with multimodal imaging,” Retina, vol. 30, no. 9, pp. 1441–1454, Oct. 2010, doi: 10.1097/IAE.0b013e3181ee5ce8. [40] D. H. Anderson, R. F. Mullins, G. S. Hageman, and L. V. Johnson, “A role for local inflammation in the formation of drusen in the aging eye,” Am J Ophthalmol, vol. 134, no. 3, pp. 411–431, Sep. 2002, doi: 10.1016/s0002-9394(02)01624-0. [41] M. Rudolf, M. E. Clark, M. F. Chimento, C.-M. Li, N. E. Medeiros, and C. A. Curcio, “Prevalence and morphology of druse types in the macula and periphery of eyes with age-related maculopathy,” Invest Ophthalmol Vis Sci, vol. 49, no. 3, pp. 1200–1209, Mar. 2008, doi: 10.1167/iovs.07-1466. [42] A. M. VanDenLangenberg and M. P. Carson, “Drusen Bodies,” in StatPearls, Treasure Island (FL): StatPearls Publishing, 2023. Accessed: Jan. 04, 2024. [Online]. Available: http://www.ncbi.nlm.nih.gov/books/NBK559087/ [43] J. Rho, P. Percelay, S. Pilkinton, T. J. Hollingsworth, I. Kornblau, and M. M. Jablonski, “An Overview of Age-Related Macular Degeneration: Clinical, Pre-Clinical Animal Models and Bidirectional Translation,” in Preclinical Animal Modeling in Medicine, E. Purevjav, J. F. Pierre, and L. Lu, Eds., IntechOpen, 2022. doi: 10.5772/intechopen.96601. [44] M. A. Williams, D. Craig, P. Passmore, and G. Silvestri, “Retinal drusen: harbingers of age, safe havens for trouble,” Age and Ageing, vol. 38, no. 6, pp. 648–654, Nov. 2009, doi: 10.1093/ageing/afp136. [45] P. T. Johnson et al., “Drusen-associated degeneration in the retina,” Invest Ophthalmol Vis Sci, vol. 44, no. 10, pp. 4481–4488, Oct. 2003, doi: 10.1167/iovs.03-0436. [46] N. Kushwah, K. Bora, M. Maurya, M. C. Pavlovich, and J. Chen, “Oxidative Stress and Antioxidants in Age-Related Macular Degeneration,” Antioxidants (Basel), vol. 12, no. 7, p. 1379, Jul. 2023, doi: 10.3390/antiox12071379. 73  [47] A. H. Khan et al., “A laser-induced mouse model of progressive retinal degeneration with central sparing displays features of parafoveal geographic atrophy,” Sci Rep, vol. 13, no. 1, p. 4194, Mar. 2023, doi: 10.1038/s41598-023-31392-3. [48] J. A. Ratnayaka and A. J. Lotery, “Challenges in studying geographic atrophy (GA) age-related macular degeneration: the potential of a new mouse model with GA-like features,” Neural Regen Res, vol. 15, no. 5, pp. 863–864, May 2020, doi: 10.4103/1673-5374.268972. [49] P. Mitchell, G. Liew, B. Gopinath, and T. Y. Wong, “Age-related macular degeneration,” Lancet, vol. 392, no. 10153, pp. 1147–1159, Sep. 2018, doi: 10.1016/S0140-6736(18)31550-2. [50] R. Sacconi, E. Corbelli, L. Querques, F. Bandello, and G. Querques, “A Review of Current and Future Management of Geographic Atrophy,” Ophthalmol Ther, vol. 6, no. 1, pp. 69–77, Jun. 2017, doi: 10.1007/s40123-017-0086-6. [51] J. Ambati and B. J. Fowler, “Mechanisms of age-related macular degeneration,” Neuron, vol. 75, no. 1, pp. 26–39, Jul. 2012, doi: 10.1016/j.neuron.2012.06.018. [52] Y. H. Kwon, Y. A. Kim, and Y. H. Yoo, “Chapter 3 - Loss of Pigment Epithelial Cells Is Prevented by Autophagy,” in Autophagy: Cancer, Other Pathologies, Inflammation, Immunity, Infection, and Aging, M. A. Hayat, Ed., Academic Press, 2017, pp. 105–117. doi: 10.1016/B978-0-12-805420-8.00003-2. [53] S. D. Hobbs and K. Pierce, “Wet Age-Related Macular Degeneration (Wet AMD),” in StatPearls, Treasure Island (FL): StatPearls Publishing, 2023. Accessed: Jan. 04, 2024. [Online]. Available: http://www.ncbi.nlm.nih.gov/books/NBK572147/ [54] M. A. Amini, A. Karbasi, M. Vahabirad, M. Khanaghaei, and A. Alizamir, “Mechanistic Insight into Age-Related Macular Degeneration (AMD): Anatomy, Epidemiology, Genetics, Pathogenesis, Prevention, Implications, and Treatment Strategies to Pace AMD Management,” Chonnam Med J, vol. 59, no. 3, pp. 143–159, Sep. 2023, doi: 10.4068/cmj.2023.59.3.143. [55] A. Stahl, “The Diagnosis and Treatment of Age-Related Macular Degeneration,” Dtsch Arztebl Int, vol. 117, no. 29–30, pp. 513–520, Jul. 2020, doi: 10.3238/arztebl.2020.0513. [56] T. Y. Wong et al., “The natural history and prognosis of neovascular age-related macular degeneration: a systematic review of the literature and meta-analysis,” Ophthalmology, vol. 115, no. 1, pp. 116–126, Jan. 2008, doi: 10.1016/j.ophtha.2007.03.008. [57] M. Xu, R. Fan, X. Fan, Y. Shao, and X. Li, “Progress and Challenges of Anti-VEGF Agents and Their Sustained-Release Strategies for Retinal Angiogenesis,” Drug Des Devel Ther, vol. 16, pp. 3241–3262, 2022, doi: 10.2147/DDDT.S383101. [58] S. De Jong, J. Tang, and S. J. Clark, “Age‐related macular degeneration: A disease of extracellular complement amplification,” Immunological Reviews, vol. 313, no. 1, pp. 279–297, Jan. 2023, doi: 10.1111/imr.13145. [59] O. Rastoin, G. Pagès, and M. Dufies, “Experimental Models in Neovascular Age Related Macular Degeneration,” Int J Mol Sci, vol. 21, no. 13, p. 4627, Jun. 2020, doi: 10.3390/ijms21134627. [60] E. Fasler-Kan et al., “The Retinal Pigment Epithelial Cell Line (ARPE-19) Displays Mosaic Structural Chromosomal Aberrations,” Methods Mol Biol, vol. 1745, pp. 305–314, 2018, doi: 10.1007/978-1-4939-7680-5_17. 74  [61] W. Samuel et al., “Appropriately differentiated ARPE-19 cells regain phenotype and gene expression profiles similar to those of native RPE cells,” Mol Vis, vol. 23, pp. 60–89, 2017. [62] K. C. Dunn, A. E. Aotaki-Keen, F. R. Putkey, and L. M. Hjelmeland, “ARPE-19, a human retinal pigment epithelial cell line with differentiated properties,” Exp Eye Res, vol. 62, no. 2, pp. 155–169, Feb. 1996, doi: 10.1006/exer.1996.0020. [63] B. A. Pfeffer and N. J. Philp, “Cell culture of retinal pigment epithelium: Special Issue,” Exp Eye Res, vol. 126, pp. 1–4, Sep. 2014, doi: 10.1016/j.exer.2014.07.010. [64] K. Bharti et al., “Cell culture models to study retinal pigment epithelium-related pathogenesis in age-related macular degeneration,” Exp Eye Res, vol. 222, p. 109170, Sep. 2022, doi: 10.1016/j.exer.2022.109170. [65] C. J. Zeiss, “Animals as models of age-related macular degeneration: an imperfect measure of the truth,” Vet Pathol, vol. 47, no. 3, pp. 396–413, May 2010, doi: 10.1177/0300985809359598. [66] S. P. Soundara Pandi, J. A. Ratnayaka, A. J. Lotery, and J. L. Teeling, “Progress in developing rodent models of age-related macular degeneration (AMD),” Exp Eye Res, vol. 203, p. 108404, Feb. 2021, doi: 10.1016/j.exer.2020.108404. [67] M. Landowski and C. Bowes Rickman, “Targeting Lipid Metabolism for the Treatment of Age-Related Macular Degeneration: Insights from Preclinical Mouse Models,” J Ocul Pharmacol Ther, vol. 38, no. 1, pp. 3–32, 2022, doi: 10.1089/jop.2021.0067. [68] P. Elizabeth Rakoczy, M. J. T. Yu, S. Nusinowitz, B. Chang, and J. R. Heckenlively, “Mouse models of age-related macular degeneration,” Experimental Eye Research, vol. 82, no. 5, pp. 741–752, May 2006, doi: 10.1016/j.exer.2005.10.012. [69] E. L. Fletcher et al., “Studying age-related macular degeneration using animal models,” Optom Vis Sci, vol. 91, no. 8, pp. 878–886, Aug. 2014, doi: 10.1097/OPX.0000000000000322. [70] H. H. Ma and R. Liutkevičienė, “Age-Related Macular Degeneration: What Do We Know So Far?,” Acta Med Litu, vol. 28, no. 1, pp. 36–47, 2021, doi: 10.15388/Amed.2021.28.1.7. [71] C. J. Flaxel et al., “Age-Related Macular Degeneration Preferred Practice Pattern®,” Ophthalmology, vol. 127, no. 1, pp. P1–P65, Jan. 2020, doi: 10.1016/j.ophtha.2019.09.024. [72] M. Chaudhuri, Y. Hassan, P. P. S. Bakka Vemana, M. S. Bellary Pattanashetty, Z. U. Abdin, and H. F. Siddiqui, “Age-Related Macular Degeneration: An Exponentially Emerging Imminent Threat of Visual Impairment and Irreversible Blindness,” Cureus, vol. 15, no. 5, p. e39624, May 2023, doi: 10.7759/cureus.39624. [73] S. Girgis and L. R. Lee, “Treatment of dry age-related macular degeneration: A review,” Clin Exp Ophthalmol, vol. 51, no. 8, pp. 835–852, Nov. 2023, doi: 10.1111/ceo.14294. [74] G. A. Borchert et al., “The Role of Inflammation in Age-Related Macular Degeneration-Therapeutic Landscapes in Geographic Atrophy,” Cells, vol. 12, no. 16, p. 2092, Aug. 2023, doi: 10.3390/cells12162092. [75] J. L. Kovach, S. G. Schwartz, H. W. Flynn, and I. U. Scott, “Anti-VEGF Treatment Strategies for Wet AMD,” J Ophthalmol, vol. 2012, p. 786870, 2012, doi: 10.1155/2012/786870. 75  [76] S. Arepalli and P. K. Kaiser, “Pipeline therapies for neovascular age related macular degeneration,” Int J Retin Vitr, vol. 7, no. 1, p. 55, Oct. 2021, doi: 10.1186/s40942-021-00325-5. [77] E. H. Sohn et al., “Choriocapillaris Degeneration in Geographic Atrophy,” Am J Pathol, vol. 189, no. 7, pp. 1473–1480, Jul. 2019, doi: 10.1016/j.ajpath.2019.04.005. [78] A. Usui-Ouchi and M. Friedlander, “Anti-VEGF therapy: higher potency and long-lasting antagonism are not necessarily better,” J Clin Invest, vol. 129, no. 8, pp. 3032–3034, Jun. 2019, doi: 10.1172/JCI129862. [79] G. Burnstock, “Introduction to Purinergic Signaling,” Methods Mol Biol, vol. 2041, pp. 1–15, 2020, doi: 10.1007/978-1-4939-9717-6_1. [80] J. Kaur and S. Dora, “Purinergic signaling: Diverse effects and therapeutic potential in cancer,” Front Oncol, vol. 13, p. 1058371, 2023, doi: 10.3389/fonc.2023.1058371. [81] I. Biaggioni, K. Browning, G. Fink, J. Jordan, P. A. Low, and J. F. R. Paton, Eds., Primer on the autonomic nervous system, Fourth edition. London ; San Diego, CA: Academic Press, an imprint of Elsevier, 2023. [82] P. Gratal et al., “Purinergic System Signaling in Metainflammation-Associated Osteoarthritis,” Front Med (Lausanne), vol. 7, p. 506, 2020, doi: 10.3389/fmed.2020.00506. [83] A. Verkhratsky and G. Burnstock, “Biology of purinergic signalling: Its ancient evolutionary roots, its omnipresence and its multiple functional significance,” BioEssays, vol. 36, no. 7, pp. 697–705, Jul. 2014, doi: 10.1002/bies.201400024. [84] Z. Huang et al., “From purines to purinergic signalling: molecular functions and human diseases,” Signal Transduct Target Ther, vol. 6, no. 1, p. 162, Apr. 2021, doi: 10.1038/s41392-021-00553-z. [85] G. Burnstock, “Purinergic Signalling: Therapeutic Developments,” Front. Pharmacol., vol. 8, p. 661, Sep. 2017, doi: 10.3389/fphar.2017.00661. [86] Yu. V. Markitantova and V. N. Simirskii, “The Role of the Purinergic Signaling System in the Control of Histogenesis, Homeostasis, and Pathogenesis of the Vertebrate Retina,” Russ J Dev Biol, vol. 52, no. 6, pp. 430–448, Nov. 2021, doi: 10.1134/S1062360421060084. [87] F. Di Virgilio, A. C. Sarti, and R. Coutinho-Silva, “Purinergic signaling, DAMPs, and inflammation,” American Journal of Physiology-Cell Physiology, vol. 318, no. 5, pp. C832–C835, May 2020, doi: 10.1152/ajpcell.00053.2020. [88] D. Yang, S. G. Elner, A. J. Clark, B. A. Hughes, H. R. Petty, and V. M. Elner, “Activation of P2X receptors induces apoptosis in human retinal pigment epithelium,” Invest Ophthalmol Vis Sci, vol. 52, no. 3, pp. 1522–1530, Mar. 2011, doi: 10.1167/iovs.10-6172. [89] A. L. M. Ventura, A. Dos Santos-Rodrigues, C. H. Mitchell, and M. P. Faillace, “Purinergic signaling in the retina: From development to disease,” Brain Res Bull, vol. 151, pp. 92–108, Sep. 2019, doi: 10.1016/j.brainresbull.2018.10.016. [90] E. Vecino, F. D. Rodriguez, N. Ruzafa, X. Pereiro, and S. C. Sharma, “Glia–neuron interactions in the mammalian retina,” Progress in Retinal and Eye Research, vol. 51, pp. 1–40, Mar. 2016, doi: 10.1016/j.preteyeres.2015.06.003. [91] C. H. Mitchell, “Release of ATP by a human retinal pigment epithelial cell line: potential for autocrine stimulation through subretinal space,” J Physiol, vol. 534, no. Pt 1, pp. 193–202, Jul. 2001, doi: 10.1111/j.1469-7793.2001.00193.x. 76  [92] C. H. Mitchell and D. Reigada, “Purinergic signalling in the subretinal space: a role in the communication between the retina and the RPE,” Purinergic Signal, vol. 4, no. 2, pp. 101–107, Jun. 2008, doi: 10.1007/s11302-007-9054-2. [93] P. Yang et al., “Retinal pigment epithelial cell death by the alternative complement cascade: role of membrane regulatory proteins, calcium, PKC, and oxidative stress,” Invest Ophthalmol Vis Sci, vol. 55, no. 5, pp. 3012–3021, May 2014, doi: 10.1167/iovs.13-13554. [94] Y. Dai, J. Zhou, and C. Shi, “Inflammasome: structure, biological functions, and therapeutic targets,” MedComm (2020), vol. 4, no. 5, p. e391, Oct. 2023, doi: 10.1002/mco2.391. [95] H. M. Blevins, Y. Xu, S. Biby, and S. Zhang, “The NLRP3 Inflammasome Pathway: A Review of Mechanisms and Inhibitors for the Treatment of Inflammatory Diseases,” Front Aging Neurosci, vol. 14, p. 879021, 2022, doi: 10.3389/fnagi.2022.879021. [96] E. Latz, T. S. Xiao, and A. Stutz, “Activation and regulation of the inflammasomes,” Nat Rev Immunol, vol. 13, no. 6, pp. 397–411, Jun. 2013, doi: 10.1038/nri3452. [97] A. Gritsenko et al., “Priming Is Dispensable for NLRP3 Inflammasome Activation in Human Monocytes In Vitro,” Front. Immunol., vol. 11, p. 565924, Sep. 2020, doi: 10.3389/fimmu.2020.565924. [98] T. Liu, L. Zhang, D. Joo, and S.-C. Sun, “NF-κB signaling in inflammation,” Signal Transduct Target Ther, vol. 2, pp. 17023-, 2017, doi: 10.1038/sigtrans.2017.23. [99] E.-K. Jo, J. K. Kim, D.-M. Shin, and C. Sasakawa, “Molecular mechanisms regulating NLRP3 inflammasome activation,” Cell Mol Immunol, vol. 13, no. 2, pp. 148–159, Mar. 2016, doi: 10.1038/cmi.2015.95. [100] J. Yao, K. Sterling, Z. Wang, Y. Zhang, and W. Song, “The role of inflammasomes in human diseases and their potential as therapeutic targets,” Sig Transduct Target Ther, vol. 9, no. 1, p. 10, Jan. 2024, doi: 10.1038/s41392-023-01687-y. [101] L. Vande Walle and M. Lamkanfi, “Snapshot of a Deadly Embrace: The Caspase-1-GSDMD Interface,” Immunity, vol. 53, no. 1, pp. 6–8, Jul. 2020, doi: 10.1016/j.immuni.2020.06.019. [102] C. Wang et al., “NLRP3 inflammasome activation triggers gasdermin D-independent inflammation,” Sci Immunol, vol. 6, no. 64, p. eabj3859, Oct. 2021, doi: 10.1126/sciimmunol.abj3859. [103] A. Arrigo, E. Aragona, and F. Bandello, “The Role of Inflammation in Age-Related Macular Degeneration: Updates and Possible Therapeutic Approaches,” Asia-Pacific Journal of Ophthalmology, vol. 12, no. 2, pp. 158–167, Mar. 2023, doi: 10.1097/APO.0000000000000570. [104] W. Tan, J. Zou, S. Yoshida, B. Jiang, and Y. Zhou, “The Role of Inflammation in Age-Related Macular Degeneration,” Int J Biol Sci, vol. 16, no. 15, pp. 2989–3001, 2020, doi: 10.7150/ijbs.49890. [105] S. L. Doyle et al., “NLRP3 has a protective role in age-related macular degeneration through the induction of IL-18 by drusen components,” Nat Med, vol. 18, no. 5, pp. 791–798, May 2012, doi: 10.1038/nm.2717. [106] Y. Hirano et al., “IL-18 is not therapeutic for neovascular age-related macular degeneration,” Nat Med, vol. 20, no. 12, pp. 1372–1375, Dec. 2014, doi: 10.1038/nm.3671. 77  [107] A. Kauppinen, J. J. Paterno, J. Blasiak, A. Salminen, and K. Kaarniranta, “Inflammation and its role in age-related macular degeneration,” Cell Mol Life Sci, vol. 73, no. 9, pp. 1765–1786, May 2016, doi: 10.1007/s00018-016-2147-8. [108] S. J. Hu et al., “Upregulation of P2RX7 in Cx3cr1-Deficient Mononuclear Phagocytes Leads to Increased Interleukin-1β Secretion and Photoreceptor Neurodegeneration,” J Neurosci, vol. 35, no. 18, pp. 6987–6996, May 2015, doi: 10.1523/JNEUROSCI.3955-14.2015. [109] C. Brandstetter, L. K. M. Mohr, E. Latz, F. G. Holz, and T. U. Krohne, “Light induces NLRP3 inflammasome activation in retinal pigment epithelial cells via lipofuscin-mediated photooxidative damage,” J Mol Med (Berl), vol. 93, no. 8, pp. 905–916, Aug. 2015, doi: 10.1007/s00109-015-1275-1. [110] R. T. Liu et al., “Inflammatory mediators induced by amyloid-beta in the retina and RPE in vivo: implications for inflammasome activation in age-related macular degeneration,” Invest Ophthalmol Vis Sci, vol. 54, no. 3, pp. 2225–2237, Mar. 2013, doi: 10.1167/iovs.12-10849. [111] A. Murao, M. Aziz, H. Wang, M. Brenner, and P. Wang, “Release mechanisms of major DAMPs,” Apoptosis, vol. 26, no. 3–4, pp. 152–162, Apr. 2021, doi: 10.1007/s10495-021-01663-3. [112] Z. Xu, Z.-M. Chen, X. Wu, L. Zhang, Y. Cao, and P. Zhou, “Distinct Molecular Mechanisms Underlying Potassium Efflux for NLRP3 Inflammasome Activation,” Front Immunol, vol. 11, p. 609441, 2020, doi: 10.3389/fimmu.2020.609441. [113] T. Kawate, “P2X Receptor Activation,” Adv Exp Med Biol, vol. 1051, pp. 55–69, 2017, doi: 10.1007/5584_2017_55. [114] K. Kaczmarek-Hájek, É. Lörinczi, R. Hausmann, and A. Nicke, “Molecular and functional properties of P2X receptors—recent progress and persisting challenges,” Purinergic Signalling, vol. 8, no. 3, pp. 375–417, Sep. 2012, doi: 10.1007/s11302-012-9314-7. [115] Z. Wang, L. Li, R. Yang, X. Xu, and S. Liang, “P2X receptors mediated abnormal interaction between satellite glial cells and neurons in visceral pathological changes,” Cell Biology International, vol. 43, no. 12, pp. 1346–1352, Dec. 2019, doi: 10.1002/cbin.11195. [116] S. J. Fountain and G. Burnstock, “An evolutionary history of P2X receptors,” Purinergic Signal, vol. 5, no. 3, pp. 269–272, Sep. 2009, doi: 10.1007/s11302-008-9127-x. [117] A. C. Oken, I. Krishnamurthy, J. C. Savage, N. E. Lisi, M. H. Godsey, and S. E. Mansoor, “Molecular Pharmacology of P2X Receptors: Exploring Druggable Domains Revealed by Structural Biology,” Front. Pharmacol., vol. 13, p. 925880, Jun. 2022, doi: 10.3389/fphar.2022.925880. [118] C. Habermacher, K. Dunning, T. Chataigneau, and T. Grutter, “Molecular structure and function of P2X receptors,” Neuropharmacology, vol. 104, pp. 18–30, May 2016, doi: 10.1016/j.neuropharm.2015.07.032. [119] M. Hattori and E. Gouaux, “Molecular mechanism of ATP binding and ion channel activation in P2X receptors,” Nature, vol. 485, no. 7397, pp. 207–212, May 2012, doi: 10.1038/nature11010. [120] M. F. Jarvis and B. S. Khakh, “ATP-gated P2X cation-channels,” Neuropharmacology, vol. 56, no. 1, pp. 208–215, Jan. 2009, doi: 10.1016/j.neuropharm.2008.06.067. 78  [121] C. Lambertucci, D. Dal Ben, M. Buccioni, G. Marucci, A. Thomas, and R. Volpini, “Medicinal chemistry of P2X receptors: agonists and orthosteric antagonists,” Curr Med Chem, vol. 22, no. 7, pp. 915–928, 2015, doi: 10.2174/0929867321666141215093513. [122] P. Illes et al., “Update of P2X receptor properties and their pharmacology: IUPHAR Review 30,” Br J Pharmacol, vol. 178, no. 3, pp. 489–514, Feb. 2021, doi: 10.1111/bph.15299. [123] F. M. Bennetts, J. I. Mobbs, S. Ventura, and D. M. Thal, “The P2X1 receptor as a therapeutic target,” Purinergic Signal, vol. 18, no. 4, pp. 421–433, Dec. 2022, doi: 10.1007/s11302-022-09880-4. [124] N. I. B. Amobi, J. Guillebaud, and I. C. H. Smith, “Perspective on the role of P2X-purinoceptor activation in human vas deferens contractility,” Exp Physiol, vol. 97, no. 5, pp. 583–602, May 2012, doi: 10.1113/expphysiol.2011.063206. [125] C. Oury, C. Lecut, A. Hego, O. Wéra, and C. Delierneux, “Purinergic control of inflammation and thrombosis: Role of P2X1 receptors,” Computational and Structural Biotechnology Journal, vol. 13, pp. 106–110, 2015, doi: 10.1016/j.csbj.2014.11.008. [126] V. Ralevic, “P2X receptors in the cardiovascular system and their potential as therapeutic targets in disease,” Curr Med Chem, vol. 22, no. 7, pp. 851–865, 2015, doi: 10.2174/0929867321666141215094050. [127] M. Kaneda et al., “OFF-cholinergic-pathway-selective localization of P2X2 purinoceptors in the mouse retina,” J Comp Neurol, vol. 476, no. 1, pp. 103–111, Aug. 2004, doi: 10.1002/cne.20208. [128] R. Mittal et al., “Molecular Structure and Regulation of P2X Receptors With a Special Emphasis on the Role of P2X2 in the Auditory System,” J Cell Physiol, vol. 231, no. 8, pp. 1656–1670, Aug. 2016, doi: 10.1002/jcp.25274. [129] J. E. Mancini et al., “Possible neuroprotective role of P2X2 in the retina of diabetic rats,” Diabetol Metab Syndr, vol. 10, p. 31, 2018, doi: 10.1186/s13098-018-0332-7. [130] D. Greenwood, W. P. Yao, and G. D. Housley, “Expression of the P2X2 receptor subunit of the ATP-gated ion channel in the retina,” Neuroreport, vol. 8, no. 5, pp. 1083–1088, Mar. 1997, doi: 10.1097/00001756-199703240-00004. [131] T. Puthussery and E. L. Fletcher, “P2X 2 receptors on ganglion and amacrine cells in cone pathways of the rat retina,” J of Comparative Neurology, vol. 496, no. 5, pp. 595–609, Jun. 2006, doi: 10.1002/cne.20889. [132] S. Sarman, J. Mancini, I. van der Ploeg, J. O. Croxatto, A. Kvanta, and J. E. Gallo, “Involvement of purinergic P2 receptors in experimental retinal neovascularization,” Curr Eye Res, vol. 33, no. 3, pp. 285–291, Mar. 2008, doi: 10.1080/02713680701885470. [133] T. Ishii et al., “Novel channel-mediated choline transport in cholinergic neurons of the mouse retina,” J Neurophysiol, vol. 118, no. 4, pp. 1952–1961, Oct. 2017, doi: 10.1152/jn.00506.2016. [134] P. Honore et al., “Analgesic profile of intrathecal P2X(3) antisense oligonucleotide treatment in chronic inflammatory and neuropathic pain states in rats,” Pain, vol. 99, no. 1–2, pp. 11–19, Sep. 2002, doi: 10.1016/s0304-3959(02)00032-5. [135] Y. Dan, H. Guo, C. Zheng, B. Wu, J. Guo, and G. Li, “Neferine alleviates P2X3 receptor in rat dorsal root ganglia mediated neuropathic pain,” Neurosci Res, vol. 170, pp. 265–272, Sep. 2021, doi: 10.1016/j.neures.2020.08.004. 79  [136] R. Giniatullin and A. Nistri, “Role of ATP in migraine mechanisms: focus on P2X3 receptors,” J Headache Pain, vol. 24, no. 1, p. 1, Jan. 2023, doi: 10.1186/s10194-022-01535-4. [137] T. Puthussery and E. L. Fletcher, “Neuronal expression of P2X3 purinoceptors in the rat retina,” Neuroscience, vol. 146, no. 1, pp. 403–414, Apr. 2007, doi: 10.1016/j.neuroscience.2007.01.055. [138] T. H. Wheeler-Schilling, K. Marquordt, K. Kohler, E. Guenther, and R. Jabs, “Identification of purinergic receptors in retinal ganglion cells,” Brain Res Mol Brain Res, vol. 92, no. 1–2, pp. 177–180, Aug. 2001, doi: 10.1016/s0169-328x(01)00160-7. [139] Y. Shigematsu, Y. Shimoda, and M. Kaneda, “Distribution of immunoreactivity for P2X3, P2X5, and P2X6-purinoceptors in mouse retina,” J Mol Histol, vol. 38, no. 4, pp. 369–371, Aug. 2007, doi: 10.1007/s10735-007-9107-4. [140] R. A. Sophocleous, L. Ooi, and R. Sluyter, “The P2X4 Receptor: Cellular and Molecular Characteristics of a Promising Neuroinflammatory Target,” Int J Mol Sci, vol. 23, no. 10, p. 5739, May 2022, doi: 10.3390/ijms23105739. [141] M. Tsuda et al., “P2X4 receptors induced in spinal microglia gate tactile allodynia after nerve injury,” Nature, vol. 424, no. 6950, pp. 778–783, Aug. 2003, doi: 10.1038/nature01786. [142] D. Gilabert et al., “Microglial P2X4 receptors are essential for spinal neurons hyperexcitability and tactile allodynia in male and female neuropathic mice,” iScience, vol. 26, no. 11, p. 108110, Nov. 2023, doi: 10.1016/j.isci.2023.108110. [143] L. Ulmann et al., “Up-regulation of P2X4 receptors in spinal microglia after peripheral nerve injury mediates BDNF release and neuropathic pain,” J Neurosci, vol. 28, no. 44, pp. 11263–11268, Oct. 2008, doi: 10.1523/JNEUROSCI.2308-08.2008. [144] Z. Zhang, M. Artelt, M. Burnet, K. Trautmann, and H. J. Schluesener, “Lesional accumulation of P2X4 receptor+ monocytes following experimental traumatic brain injury,” Exp Neurol, vol. 197, no. 1, pp. 252–257, Jan. 2006, doi: 10.1016/j.expneurol.2005.09.015. [145] A. R. Light, Y. Wu, R. W. Hughen, and P. B. Guthrie, “Purinergic receptors activating rapid intracellular Ca increases in microglia,” Neuron Glia Biol, vol. 2, no. 2, pp. 125–138, May 2006, doi: 10.1017/S1740925X05000323. [146] A. M. Jurga, M. Paleczna, and K. Z. Kuter, “Overview of General and Discriminating Markers of Differential Microglia Phenotypes,” Front. Cell. Neurosci., vol. 14, p. 198, Aug. 2020, doi: 10.3389/fncel.2020.00198. [147] J. P. de Rivero Vaccari et al., “P2X4 receptors influence inflammasome activation after spinal cord injury,” J Neurosci, vol. 32, no. 9, pp. 3058–3066, Feb. 2012, doi: 10.1523/JNEUROSCI.4930-11.2012. [148] N. Vázquez-Villoldo, M. Domercq, A. Martín, J. Llop, V. Gómez-Vallejo, and C. Matute, “P2X4 receptors control the fate and survival of activated microglia,” Glia, vol. 62, no. 2, pp. 171–184, Feb. 2014, doi: 10.1002/glia.22596. [149] W. He, Q. Wang, W. Sha, L. Wang, D. Li, and G. Chen, “P2X4 Inhibition reduces microglia inflammation and apoptosis by NLRP3 and improves nervous system defects in rat brain trauma model,” J Clin Neurosci, vol. 99, pp. 224–232, May 2022, doi: 10.1016/j.jocn.2022.03.009. 80  [150] L. Li, J. Liu, A. Xu, P. Heiduschka, N. Eter, and C. Chen, “Expression of purinergic receptors on microglia in the animal model of choroidal neovascularisation,” Sci Rep, vol. 11, no. 1, p. 12389, Jun. 2021, doi: 10.1038/s41598-021-91989-4. [151] J. E. Fries et al., “Identification of P2Y receptor subtypes in human muller glial cells by physiology, single cell RT-PCR, and immunohistochemistry,” Invest Ophthalmol Vis Sci, vol. 46, no. 8, pp. 3000–3007, Aug. 2005, doi: 10.1167/iovs.05-0043. [152] A. Bringmann et al., “Müller cells in the healthy and diseased retina,” Prog Retin Eye Res, vol. 25, no. 4, pp. 397–424, Jul. 2006, doi: 10.1016/j.preteyeres.2006.05.003. [153] T. Ho, K. A. Vessey, and E. L. Fletcher, “Immunolocalization of the P2X4 receptor on neurons and glia in the mammalian retina,” Neuroscience, vol. 277, pp. 55–71, Sep. 2014, doi: 10.1016/j.neuroscience.2014.06.055. [154] Y. H. Jeong, M. C. Walsh, J. Yu, H. Shen, E. J. Wherry, and Y. Choi, “Mice Lacking the Purinergic Receptor P2X5 Exhibit Defective Inflammasome Activation and Early Susceptibility to Listeria monocytogenes,” J Immunol, vol. 205, no. 3, pp. 760–766, Aug. 2020, doi: 10.4049/jimmunol.1901423. [155] H. Kim et al., “The purinergic receptor P2X5 contributes to bone loss in experimental periodontitis,” BMB Rep, vol. 51, no. 9, pp. 468–473, Sep. 2018, doi: 10.5483/BMBRep.2018.51.9.126. [156] H. Kim et al., “The purinergic receptor P2X5 regulates inflammasome activity and hyper-multinucleation of murine osteoclasts,” Sci Rep, vol. 7, no. 1, p. 196, Mar. 2017, doi: 10.1038/s41598-017-00139-2. [157] W. Guo, Z. Zhang, X. Liu, G. Burnstock, Z. Xiang, and C. He, “Developmental expression of P2X5 receptors in the mouse prenatal central and peripheral nervous systems,” Purinergic Signal, vol. 9, no. 2, pp. 239–248, Jun. 2013, doi: 10.1007/s11302-012-9346-z. [158] S. Ichinohe, T. Ishii, H. Takahashi, and M. Kaneda, “Physiological contribution of P2X receptors in postreceptoral signal processing in the mouse retina,” Neuroscience Research, vol. 115, pp. 5–12, Feb. 2017, doi: 10.1016/j.neures.2016.09.012. [159] B. F. King, “Rehabilitation of the P2X5 receptor: a re-evaluation of structure and function,” Purinergic Signal, vol. 19, no. 2, pp. 421–439, Jun. 2023, doi: 10.1007/s11302-022-09903-0. [160] D. Gong et al., “The m6A-suppressed P2RX6 activation promotes renal cancer cells migration and invasion through ATP-induced Ca2+ influx modulating ERK1/2 phosphorylation and MMP9 signaling pathway,” J Exp Clin Cancer Res, vol. 38, no. 1, p. 233, Jun. 2019, doi: 10.1186/s13046-019-1223-y. [161] F. Dietrich et al., “High P2X6 receptor expression in human bladder cancer predicts good survival prognosis,” Mol Cell Biochem, vol. 477, no. 8, pp. 2047–2057, Aug. 2022, doi: 10.1007/s11010-022-04425-0. [162] R. L. da Silva, R. R. Resende, and H. Ulrich, “Alternative splicing of P2X6 receptors in developing mouse brain and during in vitro neuronal differentiation,” Exp Physiol, vol. 92, no. 1, pp. 139–145, Jan. 2007, doi: 10.1113/expphysiol.2006.921304. [163] K. K. Cheung, W. Y. Chan, and G. Burnstock, “Expression of P2X purinoceptors during rat brain development and their inhibitory role on motor axon outgrowth in neural tube explant cultures,” Neuroscience, vol. 133, no. 4, pp. 937–945, 2005, doi: 10.1016/j.neuroscience.2005.03.032. 81  [164] C. A. Jones, C. Vial, L. A. Sellers, P. P. A. Humphrey, R. J. Evans, and I. P. Chessell, “Functional regulation of P2X6 receptors by N-linked glycosylation: identification of a novel alpha beta-methylene ATP-sensitive phenotype,” Mol Pharmacol, vol. 65, no. 4, pp. 979–985, Apr. 2004, doi: 10.1124/mol.65.4.979. [165] G. Collo et al., “Cloning OF P2X5 and P2X6 receptors and the distribution and properties of an extended family of ATP-gated ion channels,” J. Neurosci., vol. 16, no. 8, pp. 2495–2507, Apr. 1996, doi: 10.1523/JNEUROSCI.16-08-02495.1996. [166] D. Yang, “Targeting the P2X7 Receptor in Age-Related Macular Degeneration,” Vision (Basel), vol. 1, no. 2, p. 11, Mar. 2017, doi: 10.3390/vision1020011. [167] T. Puthussery and E. L. Fletcher, “Synaptic localization of P2X7 receptors in the rat retina,” J Comp Neurol, vol. 472, no. 1, pp. 13–23, Apr. 2004, doi: 10.1002/cne.20045. [168] K. A. Vessey and E. L. Fletcher, “Rod and Cone Pathway Signalling Is Altered in the P2X7 Receptor Knock Out Mouse,” PLoS ONE, vol. 7, no. 1, p. e29990, Jan. 2012, doi: 10.1371/journal.pone.0029990. [169] N. Niyadurupola, P. Sidaway, N. Ma, J. D. Rhodes, D. C. Broadway, and J. Sanderson, “P2X7 receptor activation mediates retinal ganglion cell death in a human retina model of ischemic neurodegeneration,” Invest Ophthalmol Vis Sci, vol. 54, no. 3, pp. 2163–2170, Mar. 2013, doi: 10.1167/iovs.12-10968. [170] R. A. North, “P2X receptors,” Philos Trans R Soc Lond B Biol Sci, vol. 371, no. 1700, p. 20150427, Aug. 2016, doi: 10.1098/rstb.2015.0427. [171] S. Panda-Jonas, J. B. Jonas, and M. Jakobczyk-Zmija, “Retinal photoreceptor density decreases with age,” Ophthalmology, vol. 102, no. 12, pp. 1853–1859, Dec. 1995, doi: 10.1016/s0161-6420(95)30784-1. [172] L. V. Del Priore, Y.-H. Kuo, and T. H. Tezel, “Age-related changes in human RPE cell density and apoptosis proportion in situ,” Invest Ophthalmol Vis Sci, vol. 43, no. 10, pp. 3312–3318, Oct. 2002. [173] D. L. Nickla and J. Wallman, “The multifunctional choroid,” Prog Retin Eye Res, vol. 29, no. 2, pp. 144–168, Mar. 2010, doi: 10.1016/j.preteyeres.2009.12.002. [174] F. Di Virgilio, D. Dal Ben, A. C. Sarti, A. L. Giuliani, and S. Falzoni, “The P2X7 Receptor in Infection and Inflammation,” Immunity, vol. 47, no. 1, pp. 15–31, Jul. 2017, doi: 10.1016/j.immuni.2017.06.020. [175] S.-S. Ye, Y. Tang, and J.-T. Song, “ATP and Adenosine in the Retina and Retinal Diseases,” Front Pharmacol, vol. 12, p. 654445, 2021, doi: 10.3389/fphar.2021.654445. [176] A. Reichenbach and A. Bringmann, “Purinergic signaling in retinal degeneration and regeneration,” Neuropharmacology, vol. 104, pp. 194–211, May 2016, doi: 10.1016/j.neuropharm.2015.05.005. [177] N. Harju, “Regulation of oxidative stress and inflammatory responses in human retinal pigment epithelial cells,” Acta Ophthalmol, vol. 100 Suppl 273, pp. 3–59, Nov. 2022, doi: 10.1111/aos.15275. [178] D. S. McLeod, R. Grebe, I. Bhutto, C. Merges, T. Baba, and G. A. Lutty, “Relationship between RPE and choriocapillaris in age-related macular degeneration,” Invest Ophthalmol Vis Sci, vol. 50, no. 10, pp. 4982–4991, Oct. 2009, doi: 10.1167/iovs.09-3639. [179] C. A. Curcio, “Photoreceptor topography in ageing and age-related maculopathy,” Eye (Lond), vol. 15, no. Pt 3, pp. 376–383, Jun. 2001, doi: 10.1038/eye.2001.140. 82  [180] R. F. Mullins, M. N. Johnson, E. A. Faidley, J. M. Skeie, and J. Huang, “Choriocapillaris vascular dropout related to density of drusen in human eyes with early age-related macular degeneration,” Invest Ophthalmol Vis Sci, vol. 52, no. 3, pp. 1606–1612, Mar. 2011, doi: 10.1167/iovs.10-6476. [181] V. K. Gullapalli and M. A. Zarbin, “New Prospects for Retinal Pigment Epithelium Transplantation,” Asia-Pacific Journal of Ophthalmology, vol. 11, no. 4, pp. 302–313, Jul. 2022, doi: 10.1097/APO.0000000000000521. [182] H. Molcak, K. Jiang, C. J. Campbell, and J. A. Matsubara, “Purinergic signaling via P2X receptors and mechanisms of unregulated ATP release in the outer retina and age-related macular degeneration,” Front Neurosci, vol. 17, p. 1216489, 2023, doi: 10.3389/fnins.2023.1216489. [183] I. Bhutto and G. Lutty, “Understanding age-related macular degeneration (AMD): relationships between the photoreceptor/retinal pigment epithelium/Bruch’s membrane/choriocapillaris complex,” Mol Aspects Med, vol. 33, no. 4, pp. 295–317, Aug. 2012, doi: 10.1016/j.mam.2012.04.005. [184] H. Maeda, N. Ogata, X. Yi, M. Takeuchi, H. Ohkuma, and M. Uyama, “Apoptosis of photoreceptor cells in ornithine-induced retinopathy,” Graefes Arch Clin Exp Ophthalmol, vol. 236, no. 3, pp. 207–212, Mar. 1998, doi: 10.1007/s004170050066. [185] S. Y. Kim, S. Sadda, M. S. Humayun, E. de Juan, B. M. Melia, and W. R. Green, “Morphometric analysis of the macula in eyes with geographic atrophy due to age-related macular degeneration,” Retina, vol. 22, no. 4, pp. 464–470, Aug. 2002, doi: 10.1097/00006982-200208000-00011. [186] S. Y. Kim et al., “Morphometric analysis of the macula in eyes with disciform age-related macular degeneration,” Retina, vol. 22, no. 4, pp. 471–477, Aug. 2002, doi: 10.1097/00006982-200208000-00012. [187] R. A. Pearson, N. Dale, E. Llaudet, and P. Mobbs, “ATP released via gap junction hemichannels from the pigment epithelium regulates neural retinal progenitor proliferation,” Neuron, vol. 46, no. 5, pp. 731–744, Jun. 2005, doi: 10.1016/j.neuron.2005.04.024. [188] D. Reigada et al., “Degradation of extracellular ATP by the retinal pigment epithelium,” Am J Physiol Cell Physiol, vol. 289, no. 3, pp. C617-624, Sep. 2005, doi: 10.1152/ajpcell.00542.2004. [189] P. Pelegrin, “P2X7 receptor and the NLRP3 inflammasome: Partners in crime,” Biochem Pharmacol, vol. 187, p. 114385, May 2021, doi: 10.1016/j.bcp.2020.114385. [190] E. Craigie, R. E. Birch, R. J. Unwin, and S. S. Wildman, “The relationship between P2X4 and P2X7: a physiologically important interaction?,” Front Physiol, vol. 4, p. 216, 2013, doi: 10.3389/fphys.2013.00216. [191] N. Martínez-Gil et al., “Purinergic Receptors P2X7 and P2X4 as Markers of Disease Progression in the rd10 Mouse Model of Inherited Retinal Dystrophy,” Int J Mol Sci, vol. 23, no. 23, p. 14758, Nov. 2022, doi: 10.3390/ijms232314758. [192] C. Guo, M. Masin, O. S. Qureshi, and R. D. Murrell-Lagnado, “Evidence for functional P2X4/P2X7 heteromeric receptors,” Mol Pharmacol, vol. 72, no. 6, pp. 1447–1456, Dec. 2007, doi: 10.1124/mol.107.035980. 83  [193] K. Weinhold, U. Krause-Buchholz, G. Rödel, M. Kasper, and K. Barth, “Interaction and interrelation of P2X7 and P2X4 receptor complexes in mouse lung epithelial cells,” Cell Mol Life Sci, vol. 67, no. 15, pp. 2631–2642, Aug. 2010, doi: 10.1007/s00018-010-0355-1. [194] G. R. Dubyak, “Go it alone no more--P2X7 joins the society of heteromeric ATP-gated receptor channels,” Mol Pharmacol, vol. 72, no. 6, pp. 1402–1405, Dec. 2007, doi: 10.1124/mol.107.042077. [195] M. Schneider et al., “Interaction of Purinergic P2X4 and P2X7 Receptor Subunits,” Front Pharmacol, vol. 8, p. 860, 2017, doi: 10.3389/fphar.2017.00860. [196] J. Suurväli, P. Boudinot, J. Kanellopoulos, and S. Rüütel Boudinot, “P2X4: A fast and sensitive purinergic receptor,” Biomed J, vol. 40, no. 5, pp. 245–256, Oct. 2017, doi: 10.1016/j.bj.2017.06.010. [197] K. Molnár et al., “Motoneuronal inflammasome activation triggers excessive neuroinflammation and impedes regeneration after sciatic nerve injury,” J Neuroinflammation, vol. 19, no. 1, p. 68, Mar. 2022, doi: 10.1186/s12974-022-02427-9. [198] M. Yang et al., “P2X7 Receptor Antagonist Attenuates Retinal Inflammation and Neovascularization Induced by Oxidized Low-Density Lipoprotein,” Oxid Med Cell Longev, vol. 2021, p. 5520644, 2021, doi: 10.1155/2021/5520644. [199] A. Imraish, T. Abu-Thiab, and H. Hammad, “P2X and P2Y receptor antagonists reduce inflammation in ATP-induced microglia,” Pharm Pract (Granada), vol. 21, no. 1, p. 2788, 2023, doi: 10.18549/PharmPract.2023.1.2788. [200] J. A. Matsubara et al., “Retinal Distribution and Extracellular Activity of Granzyme B: A Serine Protease That Degrades Retinal Pigment Epithelial Tight Junctions and Extracellular Matrix Proteins,” Front Immunol, vol. 11, p. 574, 2020, doi: 10.3389/fimmu.2020.00574. [201] T. D. Schmittgen and K. J. Livak, “Analyzing real-time PCR data by the comparative C(T) method,” Nat Protoc, vol. 3, no. 6, pp. 1101–1108, 2008, doi: 10.1038/nprot.2008.73. [202] K. Bermond et al., “Autofluorescent Organelles Within the Retinal Pigment Epithelium in Human Donor Eyes With and Without Age-Related Macular Degeneration,” Invest. Ophthalmol. Vis. Sci., vol. 63, no. 1, p. 23, Jan. 2022, doi: 10.1167/iovs.63.1.23. [203] A. C. Croce and G. Bottiroli, “Autofluorescence spectroscopy and imaging: a tool for biomedical research and diagnosis,” Eur J Histochem, vol. 58, no. 4, p. 2461, Dec. 2014, doi: 10.4081/ejh.2014.2461. [204] V. Sadashivaiah et al., “SUFI: an automated approach to spectral unmixing of fluorescent multiplex images captured in mouse and post-mortem human brain tissues,” BMC Neurosci, vol. 24, no. 1, p. 6, Jan. 2023, doi: 10.1186/s12868-022-00765-1. [205] R.-T. Yan, X. Li, J. Huang, C. Guidry, and S.-Z. Wang, “Photoreceptor-like cells from reprogramming cultured mammalian RPE cells,” Mol Vis, vol. 19, pp. 1178–1187, 2013. [206] W. A. Tseng et al., “NLRP3 inflammasome activation in retinal pigment epithelial cells by lysosomal destabilization: implications for age-related macular degeneration,” Invest Ophthalmol Vis Sci, vol. 54, no. 1, pp. 110–120, Jan. 2013, doi: 10.1167/iovs.12-10655. [207] K. A. Carver, C. M. Lin, C. Bowes Rickman, and D. Yang, “Lack of the P2X7 receptor protects against AMD-like defects and microparticle accumulation in a chronic oxidative stress-induced mouse model of AMD,” Biochem Biophys Res Commun, vol. 482, no. 1, pp. 81–86, Jan. 2017, doi: 10.1016/j.bbrc.2016.10.140. 84  [208] S. Notomi et al., “Critical involvement of extracellular ATP acting on P2RX7 purinergic receptors in photoreceptor cell death,” Am J Pathol, vol. 179, no. 6, pp. 2798–2809, Dec. 2011, doi: 10.1016/j.ajpath.2011.08.035. [209] S. Notomi et al., “Dynamic increase in extracellular ATP accelerates photoreceptor cell apoptosis via ligation of P2RX7 in subretinal hemorrhage,” PLoS One, vol. 8, no. 1, p. e53338, 2013, doi: 10.1371/journal.pone.0053338. [210] P.-A. Déchelle-Marquet, X. Guillonneau, F. Sennlaub, and C. Delarasse, “P2X7-dependent immune pathways in retinal diseases,” Neuropharmacology, vol. 223, p. 109332, Feb. 2023, doi: 10.1016/j.neuropharm.2022.109332. [211] N. Kerur et al., “TLR-independent and P2X7-dependent signaling mediate Alu RNA-induced NLRP3 inflammasome activation in geographic atrophy,” Invest Ophthalmol Vis Sci, vol. 54, no. 12, pp. 7395–7401, Nov. 2013, doi: 10.1167/iovs.13-12500. [212] R. Kopp, A. Krautloher, A. Ramírez-Fernández, and A. Nicke, “P2X7 Interactions and Signaling - Making Head or Tail of It,” Front Mol Neurosci, vol. 12, p. 183, 2019, doi: 10.3389/fnmol.2019.00183. [213] M. Gusic, K. Benndorf, and C. Sattler, “Dissecting activation steps in P2X7 receptors,” Biochem Biophys Res Commun, vol. 569, pp. 112–117, Sep. 2021, doi: 10.1016/j.bbrc.2021.06.101. [214] R.-D. Cheng, J.-J. Ren, Y.-Y. Zhang, and X.-M. Ye, “P2X4 receptors expressed on microglial cells in post-ischemic inflammation of brain ischemic injury,” Neurochem Int, vol. 67, pp. 9–13, Feb. 2014, doi: 10.1016/j.neuint.2014.01.011. [215] J. Ma, J. Gao, M. Niu, X. Zhang, J. Wang, and A. Xie, “P2X4R Overexpression Upregulates Interleukin-6 and Exacerbates 6-OHDA-Induced Dopaminergic Degeneration in a Rat Model of PD,” Front Aging Neurosci, vol. 12, p. 580068, 2020, doi: 10.3389/fnagi.2020.580068. [216] Z. Xiang, X. Jiang, R. Ji, and H. Yuan, “Enhanced expression of P2X4 purinoceptors in pyramidal neurons of the rat hippocampal CA1 region may be involved ischemia-reperfusion injury,” Purinergic Signal, vol. 17, no. 3, pp. 425–438, Sep. 2021, doi: 10.1007/s11302-021-09780-z. [217] A. Kawano et al., “Involvement of P2X4 receptor in P2X7 receptor-dependent cell death of mouse macrophages,” Biochem Biophys Res Commun, vol. 419, no. 2, pp. 374–380, Mar. 2012, doi: 10.1016/j.bbrc.2012.01.156. [218] K. Yamamoto, R. Korenaga, A. Kamiya, Z. Qi, M. Sokabe, and J. Ando, “P2X(4) receptors mediate ATP-induced calcium influx in human vascular endothelial cells,” Am J Physiol Heart Circ Physiol, vol. 279, no. 1, pp. H285-292, Jul. 2000, doi: 10.1152/ajpheart.2000.279.1.H285. [219] R. Raouf, A.-J. Chabot-Doré, A. R. Ase, D. Blais, and P. Séguéla, “Differential regulation of microglial P2X4 and P2X7 ATP receptors following LPS-induced activation,” Neuropharmacology, vol. 53, no. 4, pp. 496–504, Sep. 2007, doi: 10.1016/j.neuropharm.2007.06.010. [220] M. Adamiak et al., “The P2X4 purinergic receptor has emerged as a potent regulator of hematopoietic stem/progenitor cell mobilization and homing-a novel view of P2X4 and P2X7 receptor interaction in orchestrating stem cell trafficking,” Leukemia, vol. 36, no. 1, pp. 248–256, Jan. 2022, doi: 10.1038/s41375-021-01352-9. 85  [221] M. Ishikawa et al., “Bone marrow plasma cells require P2RX4 to sense extracellular ATP,” Nature, Feb. 2024, doi: 10.1038/s41586-024-07047-2. [222] B. J. Gu et al., “A rare functional haplotype of the P2RX4 and P2RX7 genes leads to loss of innate phagocytosis and confers increased risk of age-related macular degeneration,” FASEB J, vol. 27, no. 4, pp. 1479–1487, Apr. 2013, doi: 10.1096/fj.12-215368. [223] K. A. Vessey et al., “Loss of Function of P2X7 Receptor Scavenger Activity in Aging Mice: A Novel Model for Investigating the Early Pathogenesis of Age-Related Macular Degeneration,” Am J Pathol, vol. 187, no. 8, pp. 1670–1685, Aug. 2017, doi: 10.1016/j.ajpath.2017.04.016. [224] E. L. Fletcher, “Advances in understanding the mechanisms of retinal degenerations,” Clin Exp Optom, Oct. 2020, doi: 10.1111/cxo.13146. [225] M. Boumechache, M. Masin, J. M. Edwardson, D. C. Górecki, and R. Murrell-Lagnado, “Analysis of assembly and trafficking of native P2X4 and P2X7 receptor complexes in rodent immune cells,” J Biol Chem, vol. 284, no. 20, pp. 13446–13454, May 2009, doi: 10.1074/jbc.M901255200. [226] Z. Xiang and G. Burnstock, “Expression of P2X receptors on rat microglial cells during early development,” Glia, vol. 52, no. 2, pp. 119–126, Nov. 2005, doi: 10.1002/glia.20227. [227] M. Zhu et al., “Crosstalk Between RPE Cells and Choroidal Endothelial Cells via the ANXA1/FPR2/SHP2/NLRP3 Inflammasome/Pyroptosis Axis Promotes Choroidal Neovascularization,” Inflammation, vol. 45, no. 1, pp. 414–427, Feb. 2022, doi: 10.1007/s10753-021-01555-3. [228] C. B. M. Platania, F. Drago, and C. Bucolo, “The P2X7 receptor as a new pharmacological target for retinal diseases,” Biochemical Pharmacology, vol. 198, p. 114942, Apr. 2022, doi: 10.1016/j.bcp.2022.114942. [229] T. Ho et al., “Localization and Possible Function of P2X Receptors in Normal and Diseased Retinae,” Journal of Ocular Pharmacology and Therapeutics, vol. 32, no. 8, pp. 509–517, Oct. 2016, doi: 10.1089/jop.2015.0158. [230] L. Celkova, S. L. Doyle, and M. Campbell, “NLRP3 Inflammasome and Pathobiology in AMD,” J Clin Med, vol. 4, no. 1, pp. 172–192, Jan. 2015, doi: 10.3390/jcm4010172. [231] L. M. Lewis Luján et al., “Nutraceuticals/Drugs Promoting Mitophagy and Mitochondrial Biogenesis May Combat the Mitochondrial Dysfunction Driving Progression of Dry Age-Related Macular Degeneration,” Nutrients, vol. 14, no. 9, p. 1985, May 2022, doi: 10.3390/nu14091985. [232] H. Sakaki, T. Fujiwaki, M. Tsukimoto, A. Kawano, H. Harada, and S. Kojima, “P2X4 receptor regulates P2X7 receptor-dependent IL-1β and IL-18 release in mouse bone marrow-derived dendritic cells,” Biochem Biophys Res Commun, vol. 432, no. 3, pp. 406–411, Mar. 2013, doi: 10.1016/j.bbrc.2013.01.135. [233] S. C. Lee, N. S. Vielhauer, E. V. Leaver, and P. A. Pappone, “Differential regulation of ca(2+) signaling and membrane trafficking by multiple p2 receptors in brown adipocytes,” J Membr Biol, vol. 207, no. 3, pp. 131–142, Oct. 2005, doi: 10.1007/s00232-005-0808-x. [234] J. M. Kanellopoulos, C. L. C. Almeida-da-Silva, S. Rüütel Boudinot, and D. M. Ojcius, “Structural and Functional Features of the P2X4 Receptor: An Immunological Perspective,” Front. Immunol., vol. 12, p. 645834, Mar. 2021, doi: 10.3389/fimmu.2021.645834. 86  [235] R. D. Murrell-Lagnado and M. Frick, “P2X4 and lysosome fusion,” Curr Opin Pharmacol, vol. 47, pp. 126–132, Aug. 2019, doi: 10.1016/j.coph.2019.03.002. [236] R. D. Murrell-Lagnado and O. S. Qureshi, “Assembly and trafficking of P2X purinergic receptors (Review),” Molecular Membrane Biology, vol. 25, no. 4, pp. 321–331, Jan. 2008, doi: 10.1080/09687680802050385. [237] G. Fois et al., “P2X4 receptor re-sensitization depends on a protonation/deprotonation cycle mediated by receptor internalization and recycling,” J Physiol, vol. 596, no. 20, pp. 4893–4907, Oct. 2018, doi: 10.1113/JP275448. [238] S. Abokyi, C.-H. To, T. T. Lam, and D. Y. Tse, “Central Role of Oxidative Stress in Age-Related Macular Degeneration: Evidence from a Review of the Molecular Mechanisms and Animal Models,” Oxid Med Cell Longev, vol. 2020, p. 7901270, 2020, doi: 10.1155/2020/7901270. [239] A. Moshiri, “Animals Models of Inherited Retinal Disease,” Int Ophthalmol Clin, vol. 61, no. 3, pp. 113–130, Jul. 2021, doi: 10.1097/IIO.0000000000000368. [240] H. L. Ramkumar, J. Zhang, and C.-C. Chan, “Retinal ultrastructure of murine models of dry age-related macular degeneration (AMD),” Prog Retin Eye Res, vol. 29, no. 3, pp. 169–190, May 2010, doi: 10.1016/j.preteyeres.2010.02.002. [241] S. Dithmar, C. A. Curcio, N. A. Le, S. Brown, and H. E. Grossniklaus, “Ultrastructural changes in Bruch’s membrane of apolipoprotein E-deficient mice,” Invest Ophthalmol Vis Sci, vol. 41, no. 8, pp. 2035–2042, Jul. 2000. [242] J. Tode et al., “Selective Retina Therapy Reduces Bruch’s Membrane Thickness and Retinal Pigment Epithelium Pathology in Age-Related Macular Degeneration Mouse Models,” Transl Vis Sci Technol, vol. 8, no. 6, p. 11, Nov. 2019, doi: 10.1167/tvst.8.6.11. [243] Y. Zhang et al., “Clearance of lipid droplets by chimeric autophagy-tethering compound ameliorates the age-related macular degeneration phenotype in mice lacking APOE,” Autophagy, vol. 19, no. 10, pp. 2668–2681, Oct. 2023, doi: 10.1080/15548627.2023.2220540. [244] V. Lambert et al., “Laser-induced choroidal neovascularization model to study age-related macular degeneration in mice,” Nat Protoc, vol. 8, no. 11, pp. 2197–2211, Nov. 2013, doi: 10.1038/nprot.2013.135. [245] R. S. Shah, B. T. Soetikno, M. Lajko, and A. A. Fawzi, “A Mouse Model for Laser-induced Choroidal Neovascularization,” J Vis Exp, no. 106, p. e53502, Dec. 2015, doi: 10.3791/53502. [246] E. L. Fletcher et al., “Targeting P2X7 receptors as a means for treating retinal disease,” Drug Discovery Today, vol. 24, no. 8, pp. 1598–1605, Aug. 2019, doi: 10.1016/j.drudis.2019.03.029. [247] T. Pannicke et al., “P2X7 receptors in Müller glial cells from the human retina,” J Neurosci, vol. 20, no. 16, pp. 5965–5972, Aug. 2000, doi: 10.1523/JNEUROSCI.20-16-05965.2000. [248] P. Illes, T. M. Khan, and P. Rubini, “Neuronal P2X7 Receptors Revisited: Do They Really Exist?,” J Neurosci, vol. 37, no. 30, pp. 7049–7062, Jul. 2017, doi: 10.1523/JNEUROSCI.3103-16.2017. [249] “Baylor College of Medicine.” Accessed: Jan. 14, 2024. [Online]. Available: https://cellatlas.research.bcm.edu/ 87  [250] M.-X. Xu et al., “P2X7/P2X4 Receptors Mediate Proliferation and Migration of Retinal Microglia in Experimental Glaucoma in Mice,” Neurosci Bull, vol. 38, no. 8, pp. 901–915, Aug. 2022, doi: 10.1007/s12264-022-00833-w. [251] Y. Shinozaki, K. Saito, K. Kashiwagi, and S. Koizumi, “Ocular P2 receptors and glaucoma,” Neuropharmacology, vol. 222, p. 109302, Jan. 2023, doi: 10.1016/j.neuropharm.2022.109302. [252] M. Abyadeh et al., “Apolipoprotein ε in Brain and Retinal Neurodegenerative Diseases,” Aging Dis, vol. 14, no. 4, pp. 1311–1330, Aug. 2023, doi: 10.14336/AD.2023.0312-1. [253] G. Malek et al., “Apolipoprotein E allele-dependent pathogenesis: A model for age-related retinal degeneration,” Proc. Natl. Acad. Sci. U.S.A., vol. 102, no. 33, pp. 11900–11905, Aug. 2005, doi: 10.1073/pnas.0503015102. [254] B. Y. Ishida et al., “Regulated expression of apolipoprotein E by human retinal pigment epithelial cells,” J Lipid Res, vol. 45, no. 2, pp. 263–271, Feb. 2004, doi: 10.1194/jlr.M300306-JLR200. [255] O. Levy et al., “Apolipoprotein E promotes subretinal mononuclear phagocyte survival and chronic inflammation in age-related macular degeneration,” EMBO Mol Med, vol. 7, no. 2, pp. 211–226, Feb. 2015, doi: 10.15252/emmm.201404524. [256] C. Hara et al., “Laser-Induced Choroidal Neovascularization in Mice Attenuated by Deficiency in the Apelin-APJ System,” Invest. Ophthalmol. Vis. Sci., vol. 54, no. 6, p. 4321, Jun. 2013, doi: 10.1167/iovs.13-11611. [257] A. Salas, A. Badia, L. Fontrodona, M. Zapata, J. García-Arumí, and A. Duarri, “Neovascular Progression and Retinal Dysfunction in the Laser-Induced Choroidal Neovascularization Mouse Model,” Biomedicines, vol. 11, no. 9, p. 2445, Sep. 2023, doi: 10.3390/biomedicines11092445. [258] M. E. Pennesi, M. Neuringer, and R. J. Courtney, “Animal models of age related macular degeneration,” Molecular Aspects of Medicine, vol. 33, no. 4, pp. 487–509, Aug. 2012, doi: 10.1016/j.mam.2012.06.003. [259] S. Weinhausen et al., “Extracellular binding sites of positive and negative allosteric P2X4 receptor modulators,” Life Sciences, vol. 311, p. 121143, Dec. 2022, doi: 10.1016/j.lfs.2022.121143. [260] C. Shen et al., “Structural insights into the allosteric inhibition of P2X4 receptors,” Nat Commun, vol. 14, no. 1, p. 6437, Oct. 2023, doi: 10.1038/s41467-023-42164-y. [261] E. Genetzakis, J. Gilchrist, M. Kassiou, and G. A. Figtree, “Development and clinical translation of P2X7 receptor antagonists: A potential therapeutic target in coronary artery disease?,” Pharmacology & Therapeutics, vol. 237, p. 108228, Sep. 2022, doi: 10.1016/j.pharmthera.2022.108228. [262] F. Di Virgilio, V. Vultaggio-Poma, S. Falzoni, and A. L. Giuliani, “The Coming of Age of the P2X7 Receptor in Diagnostic Medicine,” Int J Mol Sci, vol. 24, no. 11, p. 9465, May 2023, doi: 10.3390/ijms24119465. [263] R. Dharma, “Golgi, Breye to develop P2X7 receptor antagonist programme,” Pharmaceutical Technology. Accessed: Feb. 01, 2024. [Online]. Available: https://www.pharmaceutical-technology.com/news/golgi-breye-p2x7-receptor-antagonist-programme/   88  Appendix    Appendix Figure 1. Masked semi-quantitative visual scoring analysis.  Representative images were analyzed for P2X1-7 immunoreactivity in the RPE and choroid of human post-mortem retinal sections using a masked semi-quantitative visual scoring method with scores of 0 (negative control; staining without the primary antibody), 1 (minimal pinkish AEC immunolabeling), 2 (medium levels of pinkish AEC immunolabeling), or 3 (very obvious pinkish AEC immunolabeling). Hematoxylin was used for nuclear staining (purple). (A) Examples of pinkish AEC immunolabeling representing scores of 0, 1, 2, and 3 in human RPE. (B) Examples of pinkish AEC immunolabeling representing scores of 0, 1, 2, and 3 in human choroid. Scale bars = 20 μm (60X magnification).   89   Appendix Figure 2. P2X3-7 mRNA in cultured ARPE-19 cells.  Normalized mean 2-ΔCt values (n = 3) showed the mRNA expression levels of P2X receptor subtypes in cultured ARPE-19 cells. The mRNA expression levels from highest to lowest are as follows: P2X4 > P2X5 > P2X6 > P2X7 > P2X3. P2X1 and P2X2 were excluded from the analysis due to the negligible presence of corresponding mRNA transcripts.      90   Appendix Table 1. P2X3-7 primer efficiencies for RT-qPCR.  P2X3-7 primer efficiencies, presented as percentages, were calculated using standard curves. The PCR efficiency percentages from highest to lowest are as follows: P2X4 (100.48%) > P2X6 (98.85%) > P2X7 (95.35%) > P2X5 (94.86%) > P2X3 (92.42%). Notably, all values fall within the optimal range from 90% to 110%, and are within 10% of each other.    Slope PCR Efficiency % R2 Melt Curve −3.6 ≥ slope ≥ −3.3 90 – 110% 0.95 – 1 PASS or FAIL P2X3 -3.5181 92.42% 0.9355 PASS P2X4 -3.3105 100.48% 0.9985 PASS P2X5 -3.4515 94.86% 0.9988 PASS P2X6 -3.3497 98.85% 0.9621 PASS P2X7 -3.4385 95.35% 0.9994 PASS GAPDH -3.5218 92.29% 0.9999 PASS