Open Collections

UBC Undergraduate Research

Roles of the fungal and oomycetes species in the decline of birch in South-central Kootenay area in British… Sarmiento, Carlo 2013

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
52966-Sarmiento_Carlo_FRST_498_Graduating_Thesis_2012.pdf [ 802.36kB ]
Metadata
JSON: 52966-1.0075634.json
JSON-LD: 52966-1.0075634-ld.json
RDF/XML (Pretty): 52966-1.0075634-rdf.xml
RDF/JSON: 52966-1.0075634-rdf.json
Turtle: 52966-1.0075634-turtle.txt
N-Triples: 52966-1.0075634-rdf-ntriples.txt
Original Record: 52966-1.0075634-source.json
Full Text
52966-1.0075634-fulltext.txt
Citation
52966-1.0075634.ris

Full Text

        Roles of the fungal and Oomycetes species in the decline of birch in South-central Kootenay area in British Columbia, Canada  by   Carlo Sarmiento   Department of Forestry University of British Columbia  Primary Supervisor: Richard Hamelin Secondary Supervisor: Sally Aitken        Abstract  Increasing reports of large-scale birch dieback in British Columbia could have huge implications towards the health of future forest stands. Many studies suggest that birch decline is caused by stress from changing climatic conditions. However, recent studies in Europe have determined that fungal and water mold species can play a key role in the birch decline. In this study, a survey of logs, fruiting bodies, soils and roots associated with birch species was conducted around the South-central part of the Kootenay Area of British Columbia, Canada, to determine the role of fungal and water mold species in the current decline of birch. Pure fungal cultures were isolated from roots and small sections of wood from the sampled logs. Soils were tested for Phytophthora species using a baiting technique. DNA barcoding was used for species identification. Thirteen species with max identity < 95% and E-value of 0 were identified from the logs and fruiting bodies. No Phytophthora species were detected in soils. This is sifnificant since this group of pathogens is known worldwide to cause sever epidemics in forests (eg. Sudden Oak Death, Jarrah Dieback). This is the first timea thorough survey for Phytophthora species in association with birch decline was conducted in North America. From the species identified, Fomes fomentarius, Cryptosporella tomentella, Armillaria ostoyae and Cerrena unicolor are possible pathogens that could be contributing to birch decline thus, suggesting that pathogens could play a role in the current decline in British Columbia. However, they can also be secondary pathogens saprobes, and not be primary agents. There was not a singe pathogenic species associated with all declining birches, suggesting that other factors are involved in the decline. This work was important to eliminate potential pathogen species following a thorough survey.     Key words: Birch decline, pathogens, Armillaria ostoyae, Cerrena unicolor, Fomes fomentarius, Cryptosporella tomentella, British Columbia  Table of Contents  I. Introduction          4 II. Methods/Study Design        11 III. Results           16 IV. Discussion          19 V. Acknowledgements         27 VI. Literature Citation         28 VII. Appendix           33            Introduction    Birch (Betula spp.) is a major component of mixed forests stands throughout British Columbia, which can be seen as a resource for conservation, landscape aesthetics and biodiversity. The importance of birch trees lies in its ecological role in mixed forest, increasing nitrogen fixation and soil fertility within stands and provides habitat for cavity nesting birds (Aitken et al., 2002). Birch trees resistance towards certain root rot, such as Armillaria root disease, increases tree vigor of adjacent trees thus, providing protection towards economically valuable conifers such as Lodgepole pine and Douglas fir (Simard and Hamman 2000; Delong et al. 2002; Baleshta et al. 2005). Broadleaves such as birch improve forest productivity and increase the total yield of conifer stands (Simard et al. 2004). Birch has some economic value, where it can be used for furniture, firewood and the production of veneers and saw logs (Bourque et al. 2005; Vyse and Simard 2008).   In 2010, a total of 245 hectares of small-size patches in the Southeast part of British Columbia (B.C.), Canada were experiencing some birch decline. Severe birch decline was also reported in the Fort Nelson Forest district (Westfall and Ebata 2010). In B.C., the first record of birch decline dates back to 1910 when Gussow (1911) reported massive deaths of birch trees due to a pathogen called Chondrostereum purpureum, in Vancouver, B.C. (Setliff 2002). However, despite this record, the first onset of the current birch decline in B.C. is unclear. Minimal experimental works on birch decline have been done in B.C. so far. However in other parts of the world, series of major dieback of birch trees have been reported throughout the years and different scientists have proposed different theories regarding the cause of the decline.  Sudden rapid changes in climate have been suggested to be the factor that causes the decline of birch (Jones et al. 1993; Braathe 1995; Cox & Malcolm 1997; Zhu et al. 2002; Bourque et al. 2005). Changes in climate induce stress in birch treeswhich compromises the health of the tree. Stress-inducing conditions increases its susceptibility to other biotic and abiotic factors, therefore increases chances of mortality. For instance, the changes in global surface temperature have been linked to the widespread decline in birch trees in Eastern North America in 1930, causing an estimated volume loss of 1400 million m3 of yellow and white birch (Cox and Malcolm 1997; Bourque et al. 2005). Braathe (1995), Cox and Malcolm (1997), Zhu et al. (2002), Bourque et al. (2005) and Silfver et al. (2008) have strongly suggested that the decline of birch was attributed to the reduction of cold hardiness in trees cause by the sharp fluctuating changes in temperatures between winter cold temperatures and warm early spring temperatures, called freeze-thaw events. Cold hardiness is an important attribute in maintaining the health of trees because cold hardiness allows trees to withstand adverse conditions. A decrease in cold hardiness predisposes birch trees to freeze injury in roots and stems from low winter temperatures, late spring freezes, and unfavorable combinations of precipitation and temperature (Braathe 1995). Because of the prolonged winter-thaw cycles, the reduced cold hardiness of birch populations has increased their susceptibility to xylem embolism (Cox and Malcolm 1997; Zhu et al. 2002).    In one study, Zhu et al. (2002) examined the thaw-freeze effects on one-year old yellow birch seedlings (Betula alleghaniensis Britt.) by simulating winter thaws in climate-controlled compartments. Two experiments were created by Zhu et al. (2002) to address the effects of winter thaws on roots and shoots cold hardiness and the effects of freezing injury on root pressure and growth levels of roots and shoots. From previous studies, they hypothesized that an early winter thaws would subject the tree to root and shoot damage, decreasing xylem conductivity. Using electrolyte leakage and triphenyltetrazolium chloride reduction, root and shoot cold hardiness of 200 seedlings was tested by growing one-year old plants in temperatures that would cause a significant injury, called critical temperature. They also measured root pressure using bubble manometer and measured the total leaf areas and stem diameters of the seedlings. The results of the experiment produced the same results as previous studies; the current decline is affiliated with climatic stress. Levels of cold hardiness of roots and shoots were -23,75?C and -52.5?C without thaw pretreatments and declined as the duration of thaw conditions increases. Although shoots showed more cold hardiness than roots, the cold hardiness of shoots declined faster than roots when exposed to thaw events. Root pressures on birch seedling strongly declined as cold-treatment temperatures decreased and root freezing injury increased. As well, the stunt growth of roots and stems were strongly correlated to root and shoot damage. This experiment supports the hypothesis that early winter thaws and subsequent freezing conditions cause extensive winter xylem embolism on birch which induces dieback of twigs and branches, leaf chlorosis and premature bud bursts (Cox and Malcolm 1997; Zhu et al. 2002). Xylem embolism occurs when air bubbles in the xylem create an obstruction in conducting water along the tree xylem. Birch trees exhibit a defense mechanism towards embolism by creating sufficient root pressure prior to leaf formation (Cox and Malcolm 1997; Zhu et al. 2002; Bourgue et al. 2005). However, Zhu et al. (2002) found that freezing injury reduces the capability of roots to generate adequate root pressure levels, resulting in major xylem embolism. Winter damage in shoots cause irreversible damage that also increases the xylem embolism by reducing embolism repair of roots. Thus, winter-thaw cycles on birch trees increases tree susceptibility, which reduces the survival of birch under climate change. Further supporting the idea of freezing-thaw events, Bourque et al. (2005) determined the association of extreme thaw-freeze events to past yellow birch declines in northeastern North America by comparing historical records of both birch declines events and weather events. Using newly developed algorithms and mapping approaches, they found that the locations that were affected by winter and early spring thaw-freezing events corresponded well with the spatial and temporal occurrences of birch dieback. Therefore, there is a strong implication that early freezing thaw events increase birch susceptibility in which could potentially lead to large-scale tree mortality.   Other factors, including genetic diversity, insects and management issues have been suspected to kill birch trees which could be a contributing factor in the decline of birch (Woods et al. 2010). Lowering adaptability under rapid changing conditions, a decrease of genetic diversity from sprouting would lead to a higher chance of birch mortality (Stroh et al. 2005). Similarly, insects, such as Bronze Birch Borer and leaf miners, have been associated with some birch kills in BC (Woods et al. 2010). Bronze Birch Borers have been found to increase stress on trees by feeding on the phloem of birch stems, disrupting the transportation of photosynthates (Ball 1992). As well, leaf miners damage the leaves of birch and increase stress on the trees (Westfall and Ebata 2010; Woods et al. 2010). According to a report by Westfall and Ebata (2010), these insects are suspected of facilitating the weakening of birch trees. On the other hand, management issues have been accounted for earlier tree deaths. Poor planting of birch trees, such as uprooted roots, can increase susceptibility to freeze-thaw conditions (Silva et al. 2008). Pruning actions towards birch trees would increase entry of pathogens (Vartiamaki et al. 2009). The use of bio-herbicide to prevent re-growth and revival of deciduous trees and shrub, like Chondrostereum purpureum can lead to uncontrollable outbreaks that could induce large stem loss of deciduous trees, especially birch trees (Gussow 1911; Wall 1986; Wall 1997). Known as an agent that causes silver leaf disease in hardwood, this pathogen is primarily a saprophyte that causes white rot, affecting dying birch trees (Adaskaveg and Ogawa 1990). However, C. purpureum is also an opportunistic pathogen that can attack live trees from open wounds (Setliff 2002). Outbreaks of C. purpureum can be detrimental to birch trees causing major dieback similar to the occurrence that happened in Thunder Bay, Ontario in 1985 (Mclaughlin 1991; Setliff 2002).  In recent years, studies of birch decline in Europe have determined pathogenic species playing a key role in large-scale mortality of birch (Lilja et al. 1996; Hantula et al. 1997; Witzell and Karlsson 2002; Green and MacAskill 2007; De Silva et al. 2008). There have been reports of cases of widespread birch dieback in Europe resulting from pathogenic attacks. Hantula et al. (1997) and De Silva et al. (2008) suggest high pathogenicity of Annisogramma virgultorum, Marssonina betulae, and Phytophthora cactorum on silver birch (B. pendula), causing crown damage. On the other hand, new pathogens, like C. tomentella, have been discovered to attack birch trees (Hanso and Drenkhan 2010). However unlike the research on climate-stress on birch trees, there is an inconclusive understanding on how extensive the role of pathogens is on the decline of birch populations. Regardless, pathogens can affect the health of birch trees and are capable of increasing the receptivity of birch to other stress-induced agents. Analysis of A. virgultorum, M. betulae, P. cactorum, and C. tomentella provides a fundamental insight to what role pathogens play for birch trees.  In Scotland, two ascomycetes, A. virgultorum and M. betulae, have been associated to the dieback in birch population. A. virgultorum infects the young shoot of birch causing stromatal cankers that leads to the malformation of tree branches (Massee 1914; Froidevaux and Muller 1972; De Silva et al. 2008). In the same monophyletic group, M. betulae is a foliar pathogen that causes leaf spots as well as necrotic lesions on young shoots. De Silva et al. (2008) investigated these fungal pathogens on B. pendula and downy birch (B. pubescens). This experiment evaluated the frequency and severity of these two pathogens and their relationship with crown top-kills. They surveyed 514 trees within nine native woodland assessing trees based on crown dieback rating system and presence and absence of A. virgultorum and M. betulae were recorded based on characteristics of cankers and the presence of fruiting bodies. Two surveyors visually assessed the severity of each pathogen, estimating the percentage area covered of symptoms relative to the tree. De Silva et al. (2008) found that at least 47% had severe crown dieback. B. pendula displayed higher severity than B. pubescens. Within the nine sites, 57% of the surveyed tress was infected by A. virgultorum and 28% were infected by M. betulae. Because of its foliar and canker symptoms, M. betulae showed higher damage to birch trees than A. virgultorum. With this experiment, De Silva et al. (2008) show that pathogens, such as A. virgultorum and M. betulae, play a part in birch dieback and can possibly lead to the decline of birch.  In other cases, Phytophthora cactorum and Cryptosporella tomentella have been suspected to be associated in the birch decline. P. cactorum is an oomycetous fungus that attacks 160 species of plants worldwide (Hantula et al. 1997; Rytkonen et al. 2008; Lilja et al. 2011). This pathogen causes fruit, root and collar rots, wilts, cankers and leaf blights on their hosts. Originally isolated on strawberry plants, P. cactorum was also found on B. pendula, causing necrotic stem lesions (Lilja et al. 1996; Hantula et al. 1997; Lilja et al. 2011). Hantula et al. (1997) analyzed the homogeneity of P. cactorum species between strawberry plant and B. pendula. Hantula and his colleagues used Random Amplified Microsatellites (RAMS) to review the disparity among isolates. As well, they carried out a pathogenicity test on three-month-old silver birch seedlings and strawberry plants, inoculating the isolates of P. cactorum from both host species. According to the findings, P. cactorum, in strawberry and in B. pendula, are separate species type which implies that P. cactorum in B. pendula has a different origin. At the same time, the pathogenicity test determined that P. cactorum isolates of strawberry inoculated on to B. pendula caused necrotic lesions. In Estonia, C. tomentella has been detected to reduce the health of young silver birch (B. pendula) (Hanso and Drenkhan 2010). It has been reported that this ascomycete causes necrotic lesions and broken tops in young silver birch. In Hanso and Drenkhan (2010), the life cycle of C. tomentella was characterized. However, the contribution of C. tomentella towards the current fall off of B. pendula in Estonia was unidentified. From these experiments, there is a potential for P. cactorum and C. tomentella to cause damage in birch trees which lead to a decline in tree vigor.   Because of the current cases in Europe, this present study tests if there are potential pathogens species present in the area that can play a key role in the decline of birch in south-central part of the Kootenay Area of B.C. It is hypothesized that pathogens do play a key role, specifically Armillaria and Phytophthora species. Regardless of the current knowledge of birch decline in other places, the agents that are causing the current birch decline in B.C. are still unknown and it is currently under investigation. There is an appeal in determining the underlying factors that are causing the decline of birch because of the increasing threat of the decline of birch towards forest health. The objectives of this research are to: (1) assess the fungal and Oomycete community associated with birch in B.C and (2) resolve if specific fungal or Oomycete species are associated with declining birch trees. Upon obtaining these objectives, this information aims to provide better knowledge in understanding what is causing the current birch decline in B.C.  Methods/Study Design  Study Sites   In November 2011 and in July 2012, a study was conducted of paper (Betula papyrifera) and yellow birch (Betula alleghaniensis) in numerous mixed conifer-broadleaf forests around the South-central part of the Kootenay Area of British Columbia, Canada. Selected sites were named after the nearest creek or are labeled by the collector within the forest area. Forest sites sampled within the Kootenay area are as follows: Sproule creek, Porcupine creek, Enterprise creek, Springer creek, Queen?s Bay creek, Woodbury creek, Rosebud creek, Rialto creek, Birch 1, Sanka creek, Hankins creek, Rambler creek, Chat creek, and GB stumps (Figure 1). Sampling has been done in the interior cedar-hemlock biogeoclimatic zone where areas experience warm, moist summers and moderately cold snowy winters (Vonhof and Barclay, 1996).  November 2011 experiment  Eight sites (Sproule creek, Porcupine creek, Enterprise creek, Springer creek, Queen?s Bay creek, Woodbury creek, Rosebud creek, Rialto creek) of mixed forest stands with birch were randomly selected from around the South-central Kootaney area in B.C, Canada. Sites were selected based on the presence of dying and dead birch trees in which 3-5 trees were selected in each area. A total of 28 logs and 14 fruiting bodies were collected from each tree. Selected trees were felled and areas of the tree that were marginal to death were extracted. Different sizes and number of logs were extracted from each selected tree. Fruiting bodies that were visible on the tree were pulled off the tree and were placed in paper bags to dry. Samples were shipped to UBC for analysis.  In the lab, wood pieces from the collected logs were isolated, washed with sterile water and cultured on a Malt media agar (MEA) in a petri dish. Each day, cultures were observed for fungal growth. When fungal growth is present, a plug of media with the desired fungi was subcultured to another MEA. This process was repeated until pure culture of the desired fungi was grown. Cultures were incubated at 20?C and were monitored to reduce contamination. Isolates were identified by DNA barcoding using the internal transcribed spacer region of the ribosomal DNA (ITS rDNA). From the pure cultures, mycelium is scraped into sterilized 1.5 ml tubes and frozen in a -20? C freezer overnight. DNA was extracted using the Qiagen DNEasy Plant mini kit. For DNA amplification via PCR, ITS-1F and ITS-4 primers were used. The sequences were 5?-CTTGGTCATTTAGAGGAAGTAA-3? and 5?- TCCTCCGCTTATTGATATGC -3? (White et al. 1990; Gardes and Bruns, 1993). Reaction conditions were as suggested by the maufacturer of the Dynazyme II DNA-polymerase, however, primer concentration was 25 ?M. Amplifications of extracted DNA were executed in 25 ?l reactions containing 1x Taq polymerase buffer, 1.5 nM MgCl, 0.2 ?M of each primer and 2 ng of extracted DNA (Feau et al. 2005). The samples were denatured for 2.5 minutes at 94?C, after which 35 cycles of amplification were carried out (1 min denaturation at 94?C, 1 min annealing at 48?C, and 1.5 min primer extension at 72?C). The annealing temperature for the primer was 72?C. The PCR products were separated by electrophoresis in gels consisting of 1.0% agrose and 1x TBE buffer (54g TRIS, 27.5g Boric acid, and 20 ml EDTA 0.5 M pH 8.0w), and products were visualized by ethidium bromide under ultraviolet light. Sequences were aligned using Geneious software. Using Basic Local Alignment Search Tool (BLAST), sequences were then compared to sequences stored in NCBI-Genbank for identification. Search queries that have E-values of zero and greater than 95% pairwise identity with large bands were parameters to select for identification.   Similarly, the fruiting bodies were extracted using the Qiagen DNEasy Plant mini kit. However, instead of using the tissuelyser, mortal and pestles were used to grind the samples. Samples were identified by DNA barcoding as described by Kim et al. (2006). DNA amplification was carried with two primers, ITS-1F and ITS-4, which amplifies the internal transcribed spacer region and O-1 and LR12R which amplifies the intergenic spacer region 1 of the rDNA. When amplifying the DNA, samples were denatured for 1 minutes at 94?C, after which 35 cycles of amplification were carried out (1.5 min denaturation at 94?C, 40 seconds annealing, and 2 minutes primer extension at 72?C). The annealing temperature for the primer was 72?C. July 2012 experiment  Field sampling in July 2012 consisted of sampling soils and roots from 12 sites (Sproule creek, Porcupine creek, Enterprise creek, Springer creek, Woodbury creek, Rialto creek, Birch 1, Sanka creek, HC creek, Rambler creek, Chat creek, and GB stumps). Soils, roots and leaves were sampled in late spring 2012. Samples sites were mostly mixed natural stands containing affected paper birch (Betula papyrifera) and yellow birch (Betula alleghaniensis). Areas of collection were selected based on the accessibility of the stand, severity of damaged birch and availability of birch trees. Selected age of trees averaged from 10 to 25 years old. Within each site, 3 trees were chosen and categorized based upon the health of the tree. Health status of a tree was evaluated as follows: class 1, no symptoms of dieback, no apparent damage on leaves and trunk, crown transparency is less than 10%; class 2, minimal to moderate symptoms of dieback of twigs and branches, slight yellowing and wilting of leaves, no apparent damage on tree trunk, crown transparency is 10% to 45%; class 3, moderate to severe symptoms of dieback, high transparency of crown and large volume of dead twigs and branches, leaves are restricted to shoot tips or are not present on tree, crown transparency 45% to 75%. Using these criteria, soils and roots from trees in each class in each site were collected. Samples were shipped to UBC for analysis.  At each site, two soil sub-samples were taken within a 1.5 m radius from the selected birch tree. Soils were sampled down to a depth of about 30 cm. Organic layer was removed and was not included in the collection. In total, 1 to 1.5 kg of soil was pooled from each tree and was placed in a zip lock bag. Soil samples were stored in cooler, a sealed coolant bag at 4?C or in a refrigerator until the samples are shipped. Isolation from soil samples followed methods of Balci et al. (2007). Two cups of soil subsamples were mixed and were submerged with four cups of sterile water in a 750 ml tupperware. Cheesecloth was used to keep soil away from leaves. Soils were baited by floating two young oak leaves and one birch leaf in the mixture. Leaves were unwounded and placed on the water underside down. Soils were baited for three to four days until leaves show discoloration or necrosis. Bait leaves that show discoloration or necrosis from bait traps were rinsed in sterile water and pieces of leaf tissue (approximately 5mm x 5mm) were aseptically cut from the marginal areas of symptoms. If no symptoms were visible, the tips of the leaves were cut and placed on the media. Leaves were placed in Phytophthora selective PARPH-CMA media (Ferguson & Jeffers 1999) and were labeled with Site - category# - leaf type-leaf# - sample date and sub culture date. Cultures were incubated at 20?C and were monitored for growth. Cultures were then subcultured until pure cultures were obtained. Isolates were identified using DNA barcoding. From the growth cultures, DNA was extracted using the Qiagen DNEasy Plant mini kit. ITS6 and ITS4 primers were used to amplify the DNA via PCR. The primer sequences were 5?-GAAGGTGAAGTCGTAACAAGG- 3? and 5?- TCCTCCGCTTATTGATATGC- 3?. Amplification reactions were as described by Balci et al. (2007). Isolate DNAs were denatured for 3 minutes at 94?C, after which 35 cycles of amplification were carried out (30 sec denaturation at 94?C, 30 sec annealing, and 1 min primer extension at 72?C). The annealing temperature for the primer was 72?C. Amplified DNA was sequenced. Sequences were then compared to NCBI-Genbank using BLAST for identification. Comparison criteria for sequences are similar to November 2011.  Root samples were taken from one of the main roots of the shallow roots of each tree. One root segment (maximum 10 cm in length) of the root was extracted with shears from the selected main root, making sure that the bark of the root was still intact. Root samples were place in a paper bag and were labeled. The shears were sterilized in 70% ethanol in between sampling. Samples were kept in a cooler or in a refrigerator to keep the samples dry and fresh until the samples were shipped. Following pieces from the collected root were isolated and were washed with sterile water. The bark of the root samples was peeled off to inspect Armillaria presence from present mycelial fans. Other signs of damage from roots were cultured onto a petri dish with streptomycin MEA agar. The agar plates were incubated at 20?22?C. Plates were then sub-cultured in MEA media. Isolates were identified using DNA barcoding. From the growth cultures, DNA was extracted using the Qiagen DNEasy Plant mini kit. DNA amplification follows the same procedure as in November 2011.  Results November 2011  From the 28 birch logs collected, 36 fruiting bodies and 33 cultured wood pieces were extracted and identified. Of those 69 fruiting bodies and cultures, Thirty five isolates were successfully identified (Table 1). The rest of the cultures had contaminations and were not used in the analysis. The BLAST search with the ITS1F/ITS4 primer found DNA sequence homology to 13 different species from the amplified products (Table 1). Seventeen isolates extracted out of the 35 isolates was identified to be Fomes fomentarius. Fomes fomentarius was the most common species and found in 7 of the 8 site collections. Two isolates of Absidia glauca were found from the sampled logs from Enterprise creek and Woodbury creek. Microsphaeropsis proteae was identified in three places, Porcupine creek, Rosebud creek and Springer creek. Two isolates of Panellus serotinus were obtained from the Rosebud logs. One wood sampled from Sproule creek contained isolates of Plicaturopsis crispa. Other fungi distinguished were Phlebia tremellosa and Chondrostereum purpureum and were retrieved from the tested logs from Enterprise. Epicoccum nigrum, Cerrena unicolor and Alternaria petroselini were identified from the Porcupine creek sample logs. From culturing wood sample from Sproule creek, one isolate of Cryptosporella tomentella was determined. One isolate called Pyrenochaeta cava was extracted from Rosebud creek log samples and another isolate called Piptoporus betulinus was found to be in one of the logs extracted from Sproule creek.   Within the sample sites, fourteen fruiting bodies were collected during the field sampling. From the fourteen samples, five fruiting bodies were successfully identified (Table 1). Two of the conks that were extracted from Rialto and Woodbury forest were identified as Fomes fomentarius. Spotted in the forest near Springer creek, two crusted fungi were determined to be Prenniporia subacida and Plicaturopsis crispa. The BLAST with O-1/LR12R primers identified Armillaria ostoyae from one of the fruiting bodies gathered from Rialto.  July 2012  Birch trees were spread throughout the forest in clusters. Most of the selected forests sites had active forest logging. Most birch trees within the site were situated near logging roads, where it is currently used. Based upon the observation when selecting trees for sampling, dying or dead birch trees in the sites were apparent. An estimation of greater than 70% of the birch trees in the tested sites showed heavy crown dieback and high tree defoliation. Leaves on birch trees showed wilting, discoloration and insect damage. Twigs and branches were dying showing grey coloration on bark. Fomes fomentarius was detected in most sites and was found to be present on living and dead birch trunks. In some sites like Rialto creek, an estimated of 90% of birch trees were near death which made the selection for control trees a challenge. No wilt was observed within the bark. Eleven of the twelve sites shared these types of symptoms. In contrast, HC creek showed large healthy birch trees with no crown dieback and no leaf damage. Neighboring trees were healthy or showed a few diseases, though tree mortality was not evident.  Lesions formed on bait leaves that float on soil-water mixture from Chat creek, Sanka creek, Springer creek, Enterprise creek and Woodbury creek. Baited leaves from the other sites showed no symptoms on leaves. Forty-five out of hundred and eight cultures showed mycelial growth (Table 2). All cultures isolated from the baits resulted in cultures of Pythium spp. Pythium macrosporum was detected in all five sites that showed leaf lesions on baits. Pythium irregulare was identified from the cultures from Enterprise creek and Sanka creek soils. No Phytophthora spp. was detected within the soil. On the other hand, almost all the roots extracted from the selected trees were healthy. A few roots showed symptoms of decay. Roots from eleven selected sites showed fungal growth in the cultures. The isolation led to cultures of microbes from Mucorales and Mortierellales. No Armillaria spp. was detected within the roots. Discussion   From the DNA barcoding, pathogens that have been shown elsewhere to cause large-scale birch mortality were present within the sites where we sampled. The detection of pathogens such as Fomes fomentarius, Cryptosporella tomentella, Armillaria ostoyae and Cerrena unicolor, suggests that pathogens could play a role in the current birch decline in B.C. The outcome of the interaction between these fungi and their hosts is determined by the environment, the host and the characteristic of the pathogen. Because of the detrimental effects of some detected pathogens to birch tree, the availability of birch trees within the mixed forest and the stress-induced conditions by disturbance, these pathogens are able to become virulent and are able to kill large volumes of birch trees, which can lead to an outbreak. However, we did not find a single pathogen that was consistently associated with birch decline.   Out of the four pathogens mentioned, Fomes fomentarius has been commonly found in our survey and could be associated with birch decline. Fomes fomentarius has been noted to be commonly living on birch trees in northern regions (Vetrovsky et al. 2013). Large number of identified isolates and distinct presence in observed sites strongly suggests that F. fomentarius is associated with the decline. F. fomentarius has been described as a white rot fungus that can behave as a saprobe or a parasite to deciduous trees (Vetrovsky et al. 2011). Similarly, white rot has been found on the log samples from November 2011. Fruiting bodies of F. fomentarius has also been detected on the log samples and from the collection site. In this study, surveyed forests experiences high logging activities. Most birch trees within the site are located near boundaries of logging sites and along the forest roads, therefore tree damage from the usage of logging mechanisms and from log transportation processes occur frequently. In addition, the disturbance of the forest increases its susceptibility in extreme conditions such as snow damage, and wind blows. F. fomentarius has been reported to infect trees through wounds (Vetrovsky et al. 2011). Because of these facts, the wounding of birch trees causing high infection rates assists the dissemination of this pathogen. However, it is also possible that F. fomentarius is frequently present because of the high number of dead of dying birch. F. fomentarius is usually a saprobe and could be a secondary pathogen or primary saprobe.  Signs of Cryptosporella tomentella in Sproule creek show common similarities between the birch conditions in Sproule creek and the reports in Estonia (Hanso and Drenkhen 2010). Symptoms of large top kill and broken tops were present in both study sites that suggests a possible role of C. tomentella in the birch decline in the South-central part of the Kootenay area. At the same time, no necrotic lesions or fruiting bodies of C. tomentella were observed when sampling on July 2012. However, it is possible that necrotic lesions were present at higher parts of the tree where the symptoms were not visible through the naked eye. Likewise, fruiting bodies might not have been present when the sampling was done in spring. As indicated by Hanso and Drenkhen (2010), the vegetative period of Cryptosporella tomentella occurs in the winter and is in the teleomorphic stage in springtime. Therefore, there is a high chance that C. tomentella might have been missed. This might be a possible explanation as to why one isolate was only extracted from the site and the detection of C. tomentella is low. However, despite this fact, C. tomentella is a pathogen that is worth investigating further. Because of the destructive capability of the pathogen seen in Estonia, Cryptosporella tomentella could also be a contributing factor in the current decline in British Columbia.  Found in one of the site, another pathogen that could be contributing to birch decline is Armillaria ostoyae. A. ostoyae is known to cause root rot on conifers (De long et al. 2002). Birch trees have shown to be effective in managing for root rot,because of their lover level of susceptibility, however little study has been made about the mechanisms regarding the resistance or tolerance of birch towards root rots (De long et al. 2002). Ironically, A. ostoyae has been found to be growing on birch trees in our study. This suggests that birch trees can be susceptible to the parasite. Another possible explanation is that other causes weaken the trees and A. ostoyae acts as a secondary pathogen. Consequently, there is a chance that Armillaria ostoyae could be causing the mortality of the birch trees. Possible explanation towards a decrease in resistance or tolerance in birch would be the interplay between other factors, such as climate and insect. While growth of fruiting bodies of A. ostoyae on birch is uncommon, birch trees can experience stress-induced conditions, which predispose birch trees towards this pathogen. In spite of finding one isolate in one site, there is strong evidence that large volume of A. ostoyae is present in many parts of Southern B.C. (Simard & Hannam 2000; De long et al. 2002). Therefore, this parasitic fungus can play a large role in inducing tree mortality regardless if A. ostoyae is not the primary cause of the decline.  Reported to be saprophytic and parasitic to many angiosperms (Michniewicz 2006), Cerrena unicolor has been identified in one of the samples, indicating the possible role of the polypore in the current birch decline. C. unicolor has been reported to cause white rot on wood and canker on maples and birch trees (Enebak and Blanchette 1989). In this study, logs showed similar symptoms of white rot as previous studies. However, no distinct cankers were frequently observed on the logs and on the field sampling in July. Although comparable to Cryptosporella tomentella, there is a possibility that the cankers resulted by Cerrena unicolor were located at the higher portions of the birch. Therefore, this pathogen should not be ruled out. Similar to Fomes fomentarius, C. unicolor has also been known to invade trees via wounds (Enebak and Bachette 1989). Because most of the sites are active logging sites, there is likelihood that wounding of birch trees is the method of spread of C. unicolor. Birch trees are highly susceptible to frequent wounding from logging machines because birch trees, on site, are not the subjects of harvest. Consequently, C. unicolor is able to take advantage of the wounds and cause harm on birch trees. Because of its damaging effects and its feasible methods of dissemination, C. unicolor could also be a contributor to the large-scale birch death.   Chondrostereum purpureum has been reported to cause large-scale tree mortality in birch but this pathogen is less likely to be the cause of the fall off of birch in B.C. In the similar way as the findings of MacLaughlin and Setliff (1991), log samples from November 2011 showed white rotting on birch wood. Being saprophytic fungi, finding Chondrostereum purpureum implies that there is a possibility that pathogens can also act as a secondary factor leading to tree death. On the other hand, C. purpureum is an opportunistic pathogen that can infect freshly, wounded, live birch trees via airborne basidiospores (Setliff 2002). Because of the logging activity, here is a possibility that C. purpureum could have been attacking live birch trees and high chance of wounding from forest disturbance facilitates the spread of the disease. Despite these facts, it is unlikely that this pathogen would be the cause of the decline. Because it is a basidiomycete, this pathogen forms a fruiting body that would have been visible to forest manager. Outbreaks of this fungus would have evident in the forest floor causing alarm to forest manager and triggering management towards the pathogen. If there was an outbreak of this fungus, detection of the pathogen would be easy and more isolates would have been observed from this study. At the same time, other hardwoods within the area would have heavily been affected. Since this is not the case in the visited forests, it is evident that C. purpureum plays more a role of secondary pathogen or saprobe.  Other fungi and oomycetes that were identified in the experiment are unrelated to the current decline. Most of these fungi and oomycetes are common soilbourne pathogens or saprophytes, according to previous studies. Living as a saprophyte, Phlebia tremellosa (syn. Merulius termellosus) is wood decaying basidiomycetes that cause white rot on hardwoods and softwoods (Reid 1991; Schmutzer et al. 2007). Piptoporus betulinus is a brown rot birch polypore that causes wood decay on weakened or dead birch trees (Olennikov et al. 2011) and Perenniporia subacida has been found to cause butt rot on live conifer trees and behaves as a saprophyte on hardwoods (Tabata et al. 2009). Pyrenochaeta cava has been described as saprophytic basidiomycete that lives on dead hardwoods and shrubs (De Gruyter 2010). Panellus serotinus (syn. Sarcomyxa serotina), also known as late fall oyster mushroom, is an edible mushroom that lives within different kinds of environment (Kim et al. 2012). Microsphaeropsis proteae and Plicaturopsis crispa have no records of attacking birch. Epicoccum nigrum is an ascomycete fungus that colonizes soils and host plants and is being used as a biological control for phytopathogens (Da Silva Araujo et al. 2012; De Lima Favaro et al. 2012). In parts of Italy and Australia, Alternaria petroselini has been reported to have cause leaf blight in fennel and parsley (Pryor 2002; Cunnington et al. 2007).  All of these pathogens have no characteristic of being virulent towards birch trees and for that reason, they are not considered a threat.  No Phytophthora species were detected in our survey. This is an important result since Phytophthora species can have devastating effects to other flora and have been found to cause large scale forest epidemics elsewhere (Bacli et al. 2007; Bacli et al. 2008).  Other pathogens such as Pythium sp., Mucorales and Mortierellales that were detected from the soils and roots have no records of being pathogenic towards birch trees. Pythium macrosporum is a common soil pathogen that can be pathogenic to carrots and flowering bulbs (Uzuhashi et al. 2008). Pythium irregulare is a soilborne pathogen that causes damping off and root rot in cultivated plants (Inanov et al. 2012). Mucorales and Mortierellales species, such as Absidia glauca, Mucor heimalis and Mortierella humilis, are common soilbourne zygomycetes that aids with the decomposition of organic matter in soils (Schilde et al. 2000; Ho and Chen 2008). The occurrence of Pythium sp. and other soil microbes in the different categories are random and show no particular association with our sampling scheme (Table 3). Therefore, these soil pathogens are likely unrelated to the decline.  During this study, there have been a few restrictions that were encountered which could have influenced our results. One limitation was the limited observations on upper crowns of the tree. The difficulty in accessing higher parts of tree and the intermixed of different trees in a thick canopy has made it difficult to fully assess the upper crowns. Due to this limitation, symptoms of insect and pathogen attacks might have been missed. Another limitation is the challenge of assessing the potential contributing abiotic factors that could have occurred in the past, such as freeze-thaw or drought events. Decline, by definition, are caused by multiple factors in the natural environment. Therefore, other biotic and abiotic factors are probably important but were not taken into account. In this paper, our aim was to detect whether any pathogen could be associated with the decline. We are particularly interested in pathogens that could have been overlooked in regular surveys, such as Oomycetes, which require special skills and protocols to identify. Our work shows that no single pathogen could be associated with the birch decline and importantly, no Phytophthora species were found.This study brings our knowledge closer to understanding how the decline came about. With the use of DNA barcoding, the following study highlights the potential role of pathogens is found relatively frequently on birch populations. However, most of these pathogens could play secondary role, either as week pathogens that attack stress birch, or as saprobes.    Research regarding the current birch decline has been minimal and this paper brings attention the lack of research in the current birch status. Information about pathogenic role is present in this study and can be used for future analysis. With the knowledge achieved from this research, forest managers will be able to specify and provide better management practice for mixed forest stands in the Southern-Interior of B.C. One particular management that should be taken into consideration in this paper is effects of active logging on the current status of birch. Management practices should include the reduce wounding of neighboring tree of commercial wood. Death of trees, such as birch, can give opportunities to virulent pathogens to infect other trees including commercial wood. Even though pathogens that were identified through the survey play secondary role or saprobes in this decline, there is still a potential threat fro these pathogens to increase virulence. Therefore, this management practice should be considered in the process. When non-commercial trees are neglected, future forest growth is compromised. In taking care of what is perceived to be ?weed? trees, hardwood trees, such as birch trees, are able to provide its ecological role in forest stands. As a result of this action, the mixed forest can provide a healthier and more productive forest for future commercial growth.   Since this was conceived as a survey in the absence of known pathogen associated with the decline, we wanted to apply broad screening precedures. As a result, experiments have relatively low yields of detected isolates due to of the lack of specificity in the protocol. Contamination was high in cultured samples because samples that come from nature harbor multiple microorganisms.  This made culturing difficult because other pathogens produce more spores and the media is non-specific. With the lack of specificity in techniques, the success of obtaining cultures with the protocol is decreased. Because of this study, future studies will be able to target fewer species, which would improve procedures. In sum, this study contributes to the efficacy in future experiments, providing foundation towards future experimental procedures.  Regardless of the large range of birch in BC, large-scale deaths of birch trees have huge negative impact towards the health of the forests in the interior and should induce more research. More research needs to be done on hardwoods and on their efficacious role in promoting forest health. In future research, pathogens, such as Fomes fomentarius, Cryptosporella tomentella, Armillaria ostoyae and Cerrena unicolor, should be given extra attention. This study encourages further research in pathogens along with other factors, such as temperature and insect. The government and forest companies need to be active contributors in future research. In the future, collaboration of scientists such as mycologists, climatologists and entomologists, is needed in order to fully comprehend the underlying mechanisms that drive the decline of birch trees and the interactions between environmental factors. Monitoring of birch dieback in BC is needed in order to establish consensus about the current conditions of birch. Through such actions, better insight of the present-day state of birch will increase our understanding of forest health.  Acknowledgement: Dr. Michael Murray, Ministry of Forest, Land and Resources, and Dr. Richard Hamelin have supported this research. Special thanks to Dr. Richard Hamelin, Dr. Michael Murray, Stephanie Beauseigle, Hesther Yueh and Angie Dale for providing ideas and editing my project. I am grateful for Stephanie Beauseigle, Angie Dale, Rob Roy Mcgregor, Padmini Herath, Simren Brar and Jason Fung for their assistance in data collecting and processing; Hesther Yueh and Stephanie Beauseigle for taking care of the administrative work and keeping my budget alive; Dr. Valerie Lemay for helping with the statistics of this project. Finally, I thank the rest of Richard?s team for their generosity, patience and input on this project.      Literature Cited Adaskaveg, J. E. and J. M. Ogawa. ?Wood decay pathology of fruit and nut trees in California.? Plant Disease 74 (1990): 341-351. Aitken, K.E.H., K. L. Weibe, and K. Martin. ?Nest-site reuse patterns for cavity-nesting community in interior British Columbia. Auk 119 (2002), 391-402. Balci Y, S. Balci, J. Eggers, W. L. MacDonald, J. Juzwik, R. P. Long, K. W. Gottschalk.  ?Phytophthora species associated with forest soils in Eastern and North-central U.S. oak ecosystems.? Plant Disease 91 (2007): 705?710.  Balci, Yilmaz, Selin Balci, Jaime E. Blair, Sook-Young Park, Seogchan Kang, and William L. Macdonald. "Phytophthora quercetorum Sp. Nov., a Novel Species Isolated from Eastern and North-central USA Oak Forest Soils." Mycological Research 112.8 (2008): 906-16. Baleshta, K., S. Simard, R. Guy, and C. Chanway. "Reducing Paper Birch Density Increases Douglas-fir Growth Rate and Armillaria Root Disease Incidence in Southern Interior British Columbia." Forest Ecology and Management 208.1-3 (2005): 1-13. Ball, John. "Response of the bronze birch borer to pruning wounds on paper birch." Journal of Arboriculture 18.6 (1992): 294-97.  Bourque, Charles P.-A., Roger M. Cox, Darren J. Allen, Paul A. Arp, and Fan-Rui Meng. "Spatial Extent of Winter Thaw Events in Eastern North America: Historical Weather Records in Relation to Yellow Birch Decline." Global Change Biology 11.9 (2005): 1477-492.  Braathe, P. "Birch Dieback - Caused by Prolonged Early Spring Thaws and Subsequent Frost." Norwegian Journal of Agricultural Science 20 (1995): 1-59. Cox, R. M., and J. W. Malcolm. "Effects of Duration of a Simulated Winter Thaw on Dieback and Xylem Conductivity of Betula Papyrifera." Tree Physiology 17 (1997): 389-96.  Cunnington, J. H., E. J. Minchinton, D. P. F. Auer, and H. L. Martin. "First Record of Alternaria petroselini Sensu Lato Causing Leaf Blight on Parsley in Australia." Plant Pathology 56.4 (2007): 723.  Da Silva Araujo, Francisca Diana, Leia Cecilia De Lima Favaro, Welington Luiz Araujo, Fabio Lazzarotto De Oliveira, Ricard Aparicio, and Anita Jocelyne Marsaioli. "Epicolactone ? Natural Product Isolated from the Sugarcane Endophytic Fungus Epicoccum nigrum." European Journal of Organic Chemistry 27 (2012): 5225-230.  De Gruyter, J., J. H. C. Woudenberg, M. M. Aveskamp, G. J. M. Verkley, J. Z. Groenewald, and P. W. Crous. "Systematic Reappraisal of Species in Phoma Section Paraphoma, Pyrenochaeta and Pleurophoma." Mycologia 102.5 (2010): 1066-081.  De Lima Favaro, Leia Cecilia, Fernanda Luiza De Souza Sebastianes, and Welington Luiz Araujo. "Epicoccum nigrum P16, a Sugarcane Endophyte, Produces Antifungal Compounds and Induces Root Growth." PLos ONE 7.6 (2012): e36826.  DeLong, R. L., Kathy J. Lewis, Suzanne W. Simard, and Susan Gibson. "Fluorescent Pseudomonad Population Sizes Baited from Soils under Pure Birch, Pure Douglas-fir, and Mixed Forest Stands and Their Antagonism toward Armillaria ostoyae in Vitro." Canadian Journal of Forest Research 32.12 (2002): 2146-159.  Enebak, Scott A., and Robert A. Blanchette. "Canker Formation and Decay in Sugar Maple and Paper Birch Infected by Cerrena unicolor." Canadian Journal of Forest Research 19.2 (1989): 225-31.  Feau, Nicolas, Jerry E. Weiland, Glen R. Stanosz, and Louis Bernier. "Specific and Sensitive PCR-based Detection of Septoria musiva, S. populicola and S. populi, the Causes of Leaf Spot and Stem Canker on Poplars." Mycological Research 109.9 (2005): 1015-028.  Ferguson, A. J. and S. N. Jeffers. ? Detecting multiple species of Phytophthora in container mixes from ornamental crop nurseries.? Plant Disease 83 (1999): 1129-1136. Froidevaux, L., and E. Muller. "Anisogramma Virgultorum (Fr.) Theiss. Et Syd., Un Ascomycete Pathogene Du Betula Pubescens Ehrhardt." European Journal of Forest Pathology 2 (1972): 185-87.  Gardes, M. and T. D. Bruns. ?ITS primers with enhanced specificity for basidiomycetes - application to the identification of mycorrhizae and rusts.? Molecular Ecology 2 (1993): 113-118. Green, S. and MacAskill, G. A. (2007), Pathogenicity of Marssonina betulae and other fungi on birch. Plant Pathology, 56: 242?250. Gussow, H. T. "Preliminary Note on 'silver Leaf' Disease of Fruit Trees." Phytopathology 1 (1910): 177-79. Hantula, Jarkko, Arja Lilja, and P?ivi Parikka. "Genetic Variation and Host Specificity of Phytophthora cactorum Isolated in Europe." Mycological Research 101.5 (1997): 565-72.  Hanso, Mart, and Rein Drenkhan. "Two New Ascomycetes on Twigs and Leaves of Silver Birches (Betula pendula) in Estonia." Folia Cryptog. Estonica, Fasc. 47 (2010): 21-26. Ho, S. Y., and F. Chen. "Genetic Characterization of Mortierella alpina by Sequencing the 18S-28S Ribosomal Gene Internal Transcribed Spacer Region." Letters in Applied Microbiology 47.4 (2008): 250-55.  Ivanov, Dimitre A., and Mark A. Bernards. "Ginsenosidases and the Pathogenicity of Pythium irregulare." Phytochemistry 78 (2012): 44-53.  Jones, Elizabeth A., David D. Reed, Glenn D. Mroz, Hal O. Liechty, and Peter J. Cattelino. "Climate Stress as a Precursor to Forest Decline: Paper Birch in Northern Michigan, 1985-1990." Canadian Journal of Forest Research 23.2 (1993): 229-33.  Kim, Jeong Hwa, Jae Seong Lee, Kyung Rim Lee, Mi Ja Shim, Min Woong Lee, Pyung Gyun Shin, Jong Chun Cheong, Young Bok Yoo, and Tae Soo Lee. "Immunomodulating and Antitumor Activities of Panellus serotinus Polysaccharides." Mycobiology 40.3 (2012): 181-88. Kim, M.-S., N. B. Klopfenstein, J. W. Hanna, and G. I. McDonald. "Characterization of North American Armillaria Species: Genetic Relationships Determined by Ribosomal DNA Sequences and AFLP Markers." Forest Pathology 36.3 (2006): 145-64.  Lilja, A., R. Rikala, A. Hietala, and R. Heinonen. "Stem Lesions on Betula Pendula Seedlings in Finnish Forst Nurseries and the Pathogenicity of Phytophthora Cactorum." European Journal of Forest Pathology 26 (1996): 89-96.  Lilja, Arja, Anna Rytkonen, Jarkko Hantula, Michael Muller, Paivi Parikka, and Timo Kurkela. "Introduced Pathogens Found on Ornamentals, Strawberry and Trees in Finland over the past 20 Years." Agricultural and Food Science 20.4-5 (2011): 74-85.  MacLaughlin, J. A. and E. C. Setliff.  ?Chondrostereum purpureum association with decline of Betula papyrifera in Thunder Bay, Ontario.? Plant Disease 74 (1991); 331. Massee, G. "Black-knot of Birch." Kew Bulletin (1914): 322-23.  Michniewicz, Anna, Rene Ullrich, Stanislaw Ledakowicz, and Martin Hofrichter. "The White-rot Fungus Cerrena unicolor Strain 137 Produces Two Laccase Isoforms with Different Physico-chemical and Catalytic Properties." Applied Microbiology and Biotechnology 69 (2006): 682-88.  Olennikov, D. N., S. V. Agafonova, T. A. Penzina, and G. B. Borovskii. "Branched Glucan from the Fruiting Bodies of Piptoporus betulinus (Bull.:Fr) Karst." Applied Biochemistry and Microbiology 48.1 (2012): 65-70.  Pryor, Barry M., and Robert L. Gilbertson. "Relationships and Taxonomic Status of Alternaria radicina, A. carotiincultae, and A. petroselini Based upon Morphological, Biochemical, and Molecular Characteristics." Mycologia 94.1 (2002): 49-61.  Reid, I. D. "Intermediates and Products of Synthetic Lignin (Dehydrogenative Polymerizate) Degradation by Phlebia tremellosa." Applied and Environmental Microbiology 57.10 (1991): 2834-840.  Rytkonen, Anna, Arja Lilja, Raija-lissa Petaisto, and Jarkko Hantula. "Irrigation Water and Phytophthora cactorum in a Forest Nursery." Scandinavian Journal of Forest Research 23 (2008): 404-11.  Schilde, Christina, Johannes W?stemeyer, and Anke Burmester. "Green Fluorescent Protein as a Reporter for Gene Expression in the Mucoralean Fungus Absidia glauca." Archives of Microbiology 175.1 (2001): 1-7.  Schmutzer, M., M. Schwanninger, K. Fackler, K. Messner, and C. Gradinger. "Comparison of Methods to Evaluate the Potential of Fungal Growth on Decay of Spruce Wood after Short-time Treatment." International Biodeterioration & Biodegradation 61.4 (2008): 319-24.  Setliff, E. C. "The Wound Pathogen Chonrostereum Purpureum, Its History and Incidence on Trees in North America." Australian Journal of Botany 50 (2002): 645-51.  Stroh, Esther D., Patrick Guinan and Timothy Holtsford. "Paper birch decline in Niobrara VAlley: Interactions of weather, microclimate and genetics." USGS. USGS Columbia Environmental Research Center, 5 February. 2005. Web. Oct.-Nov. 2012. Silfver, Tarja, Elina Haikio, and Matti Rousi. "Interactive Effects of Elevated Ozone and Springtime Frost on Growth and Physiology of Birch (Betula pendula) in field Conditions." Trees-structure and Function 22.3 (2008): 291-301. Silva, H. D., Green, S. and Woodward, S. Incidence and severity of dieback in birch plantings associated with Anisogramma virgultorum and Marssonina betulae in Scotland. Plant Pathology, 57 (2008): 272?279. Simard, Suzanne W., Donald L. Sachs, Alan Vyse, and Leandra Luiz Blevins. "Paper Birch Competitive Effects Vary with Conifer Tree Species and Stand Age in Interior British Columbia Forests: Implications for Reforestation Policy and Practice." Forest Ecology and Management 198.1-3 (2004): 55-74.  Simard, S. W., and K. D. Hannam. "Effects of Thinning Overstory Paper Birch on Survival and Growth of Interior Spruce in British Columbia: Implications for Reforestation Policy and Biodiversity." Forest Ecology and Management 129 (2000): 237-51.  Tabata, Masanobu. "Distribution of Genets of Perenniporia subacida in Stands of Chamaecyparis obtusa (Japanese Cypress) Determined by AFLP Fingers and Somatic Incompatibility." Plant Disease 98.8 (2009): 826-31.  Uzuhashi, Shihomi, Motoaki Tojo, Sakura Kobayashi, Katsuyuki Tokura, and Makoto Kakishima. "First Records of Pythium aquatile and P. macrosporum Isolated from Soils in Japan." Mycoscience 49.4 (2008): 276-79. Vartiamaki, Henna, Jarkko Hantula, and Antti Uotila. "Susceptibility of Silver Birch Pruning Wounds to Infection by White-Rot Fungus (Chondrostereum purpureum), a Potential Bioherbicide." Silva Fennica 43.4 (2009): 537-47.  Vetrovsky, Tomas, Jana Voriskova, Jaroslav Snajdr, Jiri Gabriel, and Petr Baldrian. "Ecology of Coarse Wood Decomposition by the Saprotrophic Fungus Fomes fomentarius." Biodegradation 22 (2011): 709-19.  Vetrovsky, Tomas, Petr Baldrian, and Jiri Gabriel. "Extracellular Enzymes of the White-Rot Fungus Fomes fomentarius and Purification of 1,4-?-Glucosidase." Applied Biochemistry and Biotechnology 169 (2013): 100-09.  Vonhof, Maarten J., and Robert M.R. Barclay. "Roost-site Selection and Roosting Ecology of Forest-dwelling Bats in Southern British Columbia." Canadian Journal of Zoology 74.10 (1996): 1797-805.  Vyse, Alan, and Suzanne Simard. "Broadleaved Species Status Report for the British Columbia Interior." Forest Genetic Council of British Columbia. Feb. 2008. Web. 23 Mar. 2012.  Wall, R. E. "Pathogenicity of Chondrostereum furpureum to Yellow Birch." Plant Disease 70.2 (1986): 158-60.  Wall, R.E. "Fructification of Chondrostereum furpureum on Hardwoods Inoculated for Biological Control." Canadian Journal of Plant Pathology 19.2 (1997): 181-84.  Westfall, Joan, and Tim Ebata. "2010 Summary of Forest Health Conditions in British Columbia." Forest Practices Branch. Ministry of Forests, Mines and Lands, 2 Mar. 2011. Web. Oct.-Nov. 2012. White, T. J., J. S. Hopple, Jr., and D. S. Hibbett. ?Phylogenetic implications of generic concepts in fungal taxonomy: The impact of molecular systematic studies.? Mycologica Helvetica 6 (1994): 73-91. Witzell, J. and Karlsson, A. (2002), Anisogramma virgultorum on saplings of Betula pendula and Betula pubescens in a district of northern Sweden. Forest Pathology, 32: 207?212. Woods, Alex J., Don Heppner, Harry K. Kope, Jennifer Burleigh, and Lorraine Maclauchlan. "Forest Health and Climate Change: A British Columbia Perspective." The Forestry Chronicle 86.4 (2010): 412-22. Zhu, X. B., R. M. Cox, C.-P A. Bourque, and P. A. Arp. "Thaw Effects on Cold-hardiness Parameters in Yellow Birch." Canadian Journal Botany 80 (2002): 390-98.                                            Appendix Figure 1: Site collections in South-central Kootaney, British Columbia Canada.    Table 1: BLAST search of isolates obtained from November 2011 log and fruiting bodies samples with GenBank Database. The ribosomal internal transcribed spacer and intergenic spacer primers were used to sequence isolate DNA and the sequences were used to search database for homologous sequences.  Species Isolation name (primer) Geographic origin Pairwise Identity E-Value Absidia glauca Ent_3 (ITS1F/4) Enterprise  98.9% 0  Woodbury_1B (ITS1F/4) Woodbury  99.2% 0 Alternaria petroselini Porcupine_2_III (ITS1F/4) Porcupine  97.9% 0 Armillaria ostoyae Rosebud2 (LR12r&O-1) Rosebud  99.9% 0 Cerrena unicolor Porcupine_2C_II (ITS1F/4) Porcupine  100.0% 0 Chondrostereum purpureum Ent2-B Enterprise  99.6% 0 Cryptosporella tomentella Sproule 1-B (ITS1F/4) Sproule  99.6% 0 Epicoccum nigrum Porcupine_2-1 (ITS1F/4) Porcupine  100.0% 0 Fomes fomentarius Rialto_3-1 (ITS1F/4) Rialto  99.8% 0  Springer_Ck_3A-1 (ITS1F/4) Springer  100.0% 0  armi_woodbury1A (ITS1F/4) Woodbury  99.7% 0  log_ent3-1 (ITS1F/4) Enterprise  100.0% 0  log_porcupine1-1 (ITS1F/4) Porcupine  100.0% 0  log_queenbay2-1 (ITS1F/4) Queen bay  100.0% 0  log_queenbay2-2 (ITS1F/4) Queen bay  100.0% 0  log_rialto1-1 (ITS1F/4) Rialto  99.8% 0  log_rialto1-2 (ITS1F/4) Rialto  100.0% 0  log_rialto2-1 (ITS1F/4) Rialto  99.8% 0  log_rialto2-2 (ITS1F/4) Rialto  100.0% 0  log_rialto3-1(ITS1F/4) Rialto  100.0% 0  log_rialto3-2 (ITS1F/4) Rialto  100.0% 0  log_springerck1-1 (ITS1F/4) Springer  99.9% 0  log_springerck1-3 (ITS1F/4) Springer  99.9% 0  log_woodbury2-1 (ITS1F/4) Woodbury  100.0% 0  log_woodbury3-1 (ITS1F/4) Woodbury  100.0% 0 Microsphaeropsis proteae Porcupine_2-2 (ITS1F/4) Porcupine  100.0% 0  Rosebud_1_sample_2 (ITS1F/4) Rosebud  99.6% 0  Springer_ck_4 (ITS1F/4) Springer  100.0% 0 Perenniporia subacida arm_springerCK (ITS1F/4) Springer  100.0% 0 Phlebia tremellosa Ent_2 (ITS1F/4) Enterprise  100.0% 0 Piptoporus betulinus Sproule 1-A (ITS1F/4) Sproule  100.0% 0 Plicaturopsis crispa armi_springerCK3 (ITS1F/4) Springer  99.6% 0  log_sproule1A-1 (ITS1F/4) Spoule  97.2% 0 Pyrenochaeta cava Rosebud_1_sample_1 (ITS1F/4) Rosebud  100.0% 0 Sarcomyxa serotina Rosebud_2 (ITS1F/4) Rosebud  99.5% 0  log_rosebud2-1 (ITS1F/4) Rosebud  99.5% 0  Table 2: BLAST search of isolates obtained from July 2012 root and soil samples with GenBank Database. The ribosomal internal transcribed spacer primers were used to sequence isolates DNA and the sequences were used to search databases for homologous sequences. Species Isolation name (primer) Geographic origin Category Max Identity E-Value Pythium macrosporum Chat_3_b_S1 (ITS6/4) Chat  3 100% 0  Chat_3_b_S3 (ITS6/4) Chat  3 100% 0  Enterprise_2_b_S1 (ITS6/4) Enterprise  2 100% 0  Enterprise_2_b_S2 (ITS6/4) Enterprise  2 100% 0  Enterprise_2_o_S2 (ITS6/4) Enterprise  2 100% 0  Sanka_1_b_S2 (ITS6/4) Sanka  1 100% 0  Sanka_1_b_S3 (ITS6/4) Sanka  1 100% 0  Woodbury_2_b_S1 (ITS6/4) Woodbury  2 100% 0  Sanka_2_b_S4 Sanka  2 100% 0 Pythium irregulare Enterprise_2_o_S1 (ITS6/4) Enterprise  2 100% 0  Sanka_1_o_S2 (ITS6/4) Sanka  1 100% 0  Sanka_2_b_S2 (ITS6/4) Sanka  2 100% 0 Mucor sp. HCCAT1S1 (ITS1F/4) Hankins 1 100% 0  HCCAT1S2 (ITS1F/4) Hankins 1 100% 0 Mucor hiemalis PORCUPINECAT2S2 (ITS1F/4) Porcupine  2 100% 0  PORCUPINECAT3S2 (ITS1F/4) Porcupine  3 100% 0  RAMBLERCAT3S2 (ITS1F/4) Rambler  3 100% 0  GBSTUMPCAT3S1 (ITS1F/4) GB stumps  3 100% 0  SPROULECAT1S1 (ITS1F/4) Sproule  1 100% 0 Mortierella humilis SPRINGERCAT1S2 (ITS1F/4) Springer  1 100% 0 Mortierella sp. SPROULECAT2S2 (ITS1F/4) Sproule  2 100% 0  GBSTUMPCAT1S1 (ITS1F/4) GB stumps  1 100% 0  HCCAT2S3 (ITS1F/4) Hankins 2 100% 0  PORCUPINECAT2S1 (ITS1F/4)  Porcupine  2 100% 0  RIALTOCAT1S1 (ITS1F/4) Rialto  1 100% 0  RIALTOCAT3S2 (ITS1F/4) Rialto  3 100% 0  SANKACAT2S2 (ITS1F/4) Sanka  2 100% 0  SANKACAT3S1 (ITS1F/4) Sanka  3 100% 0  SPRINGERCKCAT1 (ITS1F/4) Springer  1 100% 0  WOODBURYCAT2S1 (ITS1F/4) Woodbury  2 100% 0 Mortierella amoeboidea PORCUPINECAT3S1 (ITS1F/4) Porcupine  3 100% 0 Mortierella verticillata BIRCHCAT3S1 (ITS1F/4) Birch 1  3 100% 0 Mortierella alpina CHATCKCAT3S2 (ITS1F/4) Chat  3 100% 0  Table 3: A chi-squared analysis of the relationship between pathogen presence and tree health. Pathogen number is based on the pathogens identified within each tree category in each site.  Tree Health Category Control Low High Pathogen presence Pathogen 6 7 5 No Pathogen 6 5 7  Expected chi-squared 17.333    Alpha 0.05 Critical value 5.991  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.52966.1-0075634/manifest

Comment

Related Items