Open Collections

UBC Undergraduate Research

The Susceptibility of Populus trichocarpa Provenances in the Pacific Northwest to Septoria musiva and… Fung, Jason Chun-Yin Apr 30, 2012

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
52966-Fung_Jason_FRST_498_Graduating_Thesis_2012.pdf [ 2.34MB ]
Metadata
JSON: 52966-1.0075629.json
JSON-LD: 52966-1.0075629-ld.json
RDF/XML (Pretty): 52966-1.0075629-rdf.xml
RDF/JSON: 52966-1.0075629-rdf.json
Turtle: 52966-1.0075629-turtle.txt
N-Triples: 52966-1.0075629-rdf-ntriples.txt
Original Record: 52966-1.0075629-source.json
Full Text
52966-1.0075629-fulltext.txt
Citation
52966-1.0075629.ris

Full Text

The Susceptibility of Populus trichocarpa Provenances in the Pacific Northwest to Septoria musiva and Septoria populicola by Jason Chun-Yin Fung  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF  BACHELOR OF SCIENCE IN FOREST SCIENCES, GENETICS CONCENTRATION  in  THE FACULTY OF FORESTRY  THE UNIVERSITY OF BRITISH COLUMBIA (VANCOUVER)  April 2012 © Jason Chun-Yin Fung, 2012  Contents Abstract........................................................................................................................................... 2 Introduction .................................................................................................................................... 3 Methods and Materials .................................................................................................................. 5 Description of the Plantation ...................................................................................................... 5 Figure 1 – map of P. trichocarpa provenances across the pacific northwest .......................... 6 Septoria spp. Identification ......................................................................................................... 7 Figure 2 – photographs of Septoria spp. leaf spots and S.musiva cankers ............................. 7 Leaf Sample Collection ................................................................................................................ 8 Leaf Spot Extraction .................................................................................................................... 8 DNA Extraction ............................................................................................................................ 9 Real-time Polymerase Chain Reaction (RT-PCR) ....................................................................... 10 Table 1 – Septoria spp. specific primers and probes ............................................................. 10 Statistical Analysis .................................................................................................................... 11 Table 2 – Summary of Septoria spp. infection proportions in 2010 and 2011 ...................... 12 Results........................................................................................................................................... 12 Results Overview ....................................................................................................................... 12 Table 3 – Summary of Septoria infected trees by geographical region in 2010 and 2011 ... 13 Table 4 – Septoria musiva infected trees in 2011 .................................................................. 14 Septoria musiva and Septoria populicola infection in 2010 ...................................................... 14 Septoria musiva and Septoria populicola infection in 2011 ...................................................... 15 Septoria spp. infection in 2010 vs. 2011.................................................................................... 16 Discussion ..................................................................................................................................... 17 Sampling in 2010 vs. 2011- Methods and Protocol Differences................................................ 17 Septoria spp. infected trees in 2011 .......................................................................................... 19 Z-test Results Interpretation ..................................................................................................... 21 Experimental Improvements and Future Research ................................................................... 24 Acknowledgements ...................................................................................................................... 24 Literature Cited............................................................................................................................. 25 Appendices ................................................................................................................................... 27  Abstract A Populus trichocarpa provenance trial in Harrison Mills had tested positive in 2009 and 2010 for Septoria musiva, a pathogen that reduces the photosynthetic activity of its host through necrotic spots on the leaf surface and has the potential to girdle and kill the host through cankers that develop on the branches and main stem. A closely related pathogen, Septoria populicola, has also been reported in the provenance trial; this particular pathogen is native to British Columbia and causes only non-lethal minor leaf lesions, but is impossible to distinguish from Septoria musiva without conducting DNA-based analyses. This study is aimed to assess the frequency of S. musiva and S. populicola infections on provenances of P. trichocarpa to determine if there is a pattern of differential susceptibility. The provenances of the P. trichocarpa extend from Alaska, through British Columbia and down into Oregon; these were grouped into two categories: a North and South population. The proportions of Septoria musiva and Septoria populicola infections were compared between the north and south populations to determine if there is a difference in infection proportions between the regions. The north and south proportions were also compared between 2010 and 2011. Although the number of infections were always higher in northern than in southern provenances, no significant differences were found between northern and southern infection proportions for Septoria musiva or Septoria populicola in 2010 or 2011. A comparison between regional infections in 2010 and 2011 was also not significantly different from one another for Septoria musiva. Although no significant differences was observed in the infection proportions of Septoria populicola between the southern populations over 2010 and 2011, a significant difference was observed in the infection proportions between northern regions in 2010 and 2011.  Keywords: Septoria musiva, Septoria populicola, Populus trichocarpa, black cottonwood, Mycosphaerella populorum, Mycosphaerella populicola  Introduction Poplars are integral in Canada due to their vast abundance and potential in the country’s forest industry; in addition, poplars have several desirable biological characteristics such as rapid, indeterminate growth, hybridization characteristics that make them ideal for culturing (Feau, Mottet, Perinet, Hamelin, & Bernier, 2010). As the demand for energy increases, and the limits of the fossil fuel economy projected to peak within the next several decades, the demand for renewable energy is rapidly increasing (McPhail, Cigolotti, & Moreno, 2012). Black cottonwood (Populus trichocarpa Torr. & A. Gray) is native to British Columbia and is also distributed along the northwestern coast of North America from California to Alaska; the poplar embodies all the characteristics that make them ideal for cultivation. In BC, black cottonwood has already been utilized for lumber harvest, pulping and riparian restoration; its role in the future biofuel endeavors is also met with high expectations. As such, several plantations across the province have been cultivating the tree for the economical applications listed. As with all other poplars, P. trichocarpa is host to many diseases and other biotic stress factors, especially in areas of intensive culturing, as the selection of cottonwood by breeders if often placed on wood quality and growth characteristics (Ostry & Mcnabb Jr., Susceptibility of Populus species and hybrids to disease in the North central United States, 1985). Two such diseases include Septoria musiva Peck. (telomorph: Mycosphaerella populorum Thomps.) and Septoria populicola (telomorph: Mycosphaerella populicola). Septoria populicola is native to British Columbia, while Septoria musiva has historically been localized in eastern North America  (Ostry, 1987; Krupinsky, 1989). The injury symptoms of the two pathogens are indentical in which they cause circular, necrotic spots on the foliage, which leads to reduced photosynethic leaf area, as well as premature scenscence of leaves (Bier, 1939). However, a key difference in the injury symptoms is that S. musiva has been associated with canker development in the main stem and branches, which can potentially girdle and kill the tree (Bier, 1939; Ostry, 1987; Newcombe & Ostry, 2001; Callan, Leal, Foord, Dennis, & van Oosten, 2007; Feau, Mottet, Perinet, Hamelin, & Bernier, 2010). The canker causing ability of S. musiva has is detrimental and can lead to plantation failure (Bier, 1939; Ostry, 1987). S. musiva, despite being native to eastern Canada, has recently been reported and isolated from several poplar plantations within Fraser Valley, British Columbia (Callan, Leal, Foord, Dennis, & van Oosten, 2007); as P. trichocarpa has never been exposed to S. musiva in western Canada, the pathogen’s establishment in the province could be detrimental to local P. trichocarpa populations. A black cottonwood plantation comprised of P. trichocarpa from 35 different drainages was established in Harrison Mills, BC in 2007. Several trees in that plantation have tested positive for S. musiva and S. populicola. Currently, the S. musiva disease outbreak is localized within the plantation and black cottonwood adjacent to the plantation has not shown any symptoms of infection. As the two pathogens are morphologically identical with overlapping characteristics, and have injury symptoms that are virtually indistinguishable, the two pathogens must be identified and distinguished at the genetic level through the use of ITS (Internal Transcribed Spacer) primers developed by Feau et al. (2005). The threat of S. musiva has now reached the Pacific Northwest; it is important to determine if there are patterns in the P. trichocarpa provenances in their susceptibility to the  two pathogens and whether or not some provenances display less susceptibility. A field study was conducted at the plantation in Harrison Mills with the objective to determine if any P. trichocarpa within the plantation exhibit any resistance to S. musiva and S. populicola; the plantation had been sampled by Beauseigle et al. (2010) many elements of this study have been drawn on their work with various changes to sampling methodology, laboratory protocol, and statistical analyses. This study divides the 7 geographical regions delineated by Beauseigle et al. 2010 into a northern and southern population and uses a subsample of 306 trees out of over 3000 trees within the plantation to gain a coarse scale analyses.  Methods and Materials Description of the Plantation Established in 2007, provenance trial EP1123.02 is a Populus trichocarpa plantation located in the Fraser Valley at Harrison Mills, B.C. (49o 13’42.00 N, 121o54’51.30). It is comprised of 516 clones from 35 different drainage regions and distributed within the plantation in a randomized complete block design; each individual tree plot had a spacing of approximately 2.5m x 2.5m. Eight repetitions for each block was planted with each clone is represented 4-8 times within the block, depending on the availability of clonal material. Fertilizers were not applied to the plantation.  Figure 1 – A map of the origins of each P. trichocarpa within the plantation at Harrison Mills. Obtained from Dr. Harry H. Kope, Forest Practices and Investment Branch, British Columbia, Ministry of Forests, Lands, and Natural Resource Operations, Victoria, British Columbia)  Septoria spp. Identification Identification of leaf spots that were potential Septoria spp. lesions was based on characterization in literature (Bier, 1939; Ostry & Mcnabb, 1985; Sinclair and Lyon, 2005). Lesions on the leaves are generally localized in the lower branches and are characterized as circular necrotic spots that are black in colour. Pycnidia can sometimes be seen within the center of the lesions. Cankers are also characterized as dark, necrotic protrusions from the stem or branches. The figures below illustrate features that are generally associated with Septoria musiva and Septoria populicola; cankers in the figures belong exclusively to Septoria musiva:  Figure 2 – (On left) Photograph of P. trichocarpa that has been infected with multiple Septoria musiva cankers around the stem (Photograph by Fung, 2012). (On top right) Example of Septoria musiva leaf spots on hybrid poplar (Photograph from Sinclair & Lyon, 2005). (On bottom right) Juvenile tree showing symptoms of Septoria spp. leaf spot injury. (Photograph from Ostry et al., 1989)  Leaf Sample Collection Each tree was screened for leaf spots originating from the lower branches that resembled S. musiva or S. populicola; 3-5 leaves with Septoria-like leaf spots were collected from each individual, with each leaf originating from a different side of the tree. Leaves containing Septoria and other foliage diseases which had been found in Beauseigle et al. 2010, were omitted to avoid contamination of other leaf samples and complications during the DNA amplification. The collected leaves were placed in a brown paper lunch bag and stored in 4 oC while awaiting leaf spot extraction. Trees were also inspected for branch or stem cankers that resemble S. musiva infection symptoms. Cankers were also collected to extract S. musiva isolates, which would support the samples identified in the leaves. However, the cankers, although extracted for S. musiva isolates, were not cross-referenced in this study.  Leaf Spot Extraction The leaf spot extraction protocol from Beauseigle et al. 2010 was modified from selecting one leaf of the three leaves and selecting a single leaf spot from the leaf to extracting three leaf spots per leaf for each of the leaves collected from the plantation and pooling the spots into a microcentrifuge tube. The leaf spots were excised using a cork borer due to its circular shape, which allowed a more accurate excision while reducing the amount of uninfected plant tissue. All extraction tools were sterilized under a flame torch and 100% ethanol after each sample was processed to avoid cross sample contamination.  DNA Extraction For each sample, 3-5 leaf spots were selected from and pooled into a new microcentrifuge tube for DNA extraction; this was another change from the protocol used by Beauseigle et al. 2010, where several leaf spots are pooled together for DNA extraction, as opposed to one leaf spot selected from the sample. Several DNA pooling experiments were conducted by spiking S. musiva DNA from petri dish cultures with plant and S. populicola DNA to determine the maximum number of leaf spots that could be pooled with distinctively observable S. musiva readings. This pooling of several leaf spots from one individual tree increases the chance of detecting S. musiva by obtaining a broader representation of all the leaf spots on an infected tree. Metal beads were added to each microcentrifuge tubes and submerged in liquid nitrogen to weaken the cell membranes and allow the extraction of high quality DNA required for the real-time PCR. The microcentrifuge tubes were then placed in a mechanical shaker and ground up into a fine powder. The DNA from the grounded leaf spot samples were then extracted using the DNeasy Plant Mini Kit from Qiagen Company); the protocol (http://www.qiagen.com/literature/render.aspx?id=201167) enclosed with the extraction kit was used with the following amendments:  11.  Add 100μl autoclaved water for elution. Incubate for 5 min at room temperature (15–25°C). Centrifuge for 1 min at ≥6000 x g.  12.  Repeat step 11 - this step was omitted from the extraction protocol.  Extracted DNA samples were then stored in -20oC conditions until the RT-PCR is conducted.  Real-time Polymerase Chain Reaction (RT-PCR) The efficacy of real-time polymerase chain reaction (RT-PCR) has seen a high degree of success in fungal pathogen detection (Gottsberger, 2010; Qu, Wanner, & Christ, 2011; Schaad, et al., 2003; Callan, Leal, Foord, Dennis, & van Oosten, 2007). RT-PCR also allows for a large number of samples to be processed with the possibility of a quantitative analysis DNA within each sample. The ITS sequence showed distinct polymorphisms between S. musiva and S. populicola (Feau, Weiland, Stanosz, & Bernier, 2005), and as such, ITS was targeted using sequence specific oligonucleotides and probes were used to amplify the region. Such methods were also used in Beauseigle, et al. (2010) to detect and differentiate between S. musiva and S. populicola DNA. An RT-PCR procedure based on the TaqMan probe was used; the primers and probes used is summarized below: Table 1 - Summary of S. musiva and S. populicola primers and probes used in RT-PCR to detect and differentiate between the pathogens’ DNA. (Beauseigle, Feau, & Hamelin, 2010)  Primer Name Smus_SSU193F Smus_SSU_288R Smus_SSU243F_probe Spopulicola_SSU193F Spopulicola_SSU288R Spopulicola_SSU243F_probe  Specificity S. musiva S. musiva S. musiva S. populicola S. populicola S. populicola  Sequence 5’-3’ CGGTATTTTCAGCCTGCAG GCC GTT ATC CGT ACA ACT GA AGGTAGATATTAGGACAATTGGTGTAAAGA TGAT CGGTATTTTCAGCCTGCAC GCCGTTATCCGTACAACTAG AGGAAGATATTAGGACGATGGGTGTAAAGATGAAA  The primers and probes were designed based on the small subunit (SSU) gene using IDT Sci Tools Oligo Analyzer 3.1 software and were custom ordered from Biosearch Technologies (Novato, CA, USA). The probe FAM-BHQ 1 was an oligonucleotide containing fluorescent dye 6carboxyfluorescein (FAM) as a reporter at the 5’ end, and a non-fluorescent quencher dye at the 3’ end.  Real-time PCR reactions were performed in MicroAmp Optical 96-well plates using a Bio-rad CFX96TM thermal cycler system (Bio-Rad. Hercules, CA, USA). Each reaction contained 3.6µl of sample DNA, 10µl of 1X SsoFast probes supermix (Bio-Rad. Hercules, CA, USA), with 0.7µl of each forward and reverse primer, 5µl of probe for a total volume of 20µl. Each primer and probe was used at 350nM and 250nM final concentration, respectively. Each sample was duplicated on the same plate. The thermal cycling parameters used were 2 min at 95oC for enzyme activation followed by 40 cycles of denaturation at 95oC for 5s and 5s of annealing/extension at 60oC. The threshold cycles (CT) were determined by plotting the relative fluorescence Units (RFU) against the cycle number. The results of the amplifications were analyzed using the CFX Manager software (version 1.0, Bio-Rad. Hercules, CA., USA).  Statistical Analysis Two-tailed Z-test comparisons of the difference between two proportions were conducted on the 2011 and 2010 dataset, using the formulae: (1.1) ̂  ̂ ̂  ̂  (1.2)  ̂  ̂  √  ̂ ̂  ̂ ̂  The Z-test was set at an alpha level of 0.05, where the Z0.05 value = ±1.96; P-values for Z0.05 = 0.256. p = proportion of trees infected with a specific pathogen over the total number of trees uninfected by the pathogen; the pathogen could be Septoria musiva or Septoria populicola. = number of uninfected trees/total number of trees in region. n1 and n2 are the total number of uninfected individuals, which includes samples that were positive for S. populicola and samples that were negative for both diseases. Using these formulae, the proportions of infected trees/uninfected trees from the Northern provenances were compared against the Southern populations for separately for both 2010 and 2011 datasets; a summary of the values used listed in the results section below: Table 2 – Summary of disease infection substituted into equations 1.1 and 1.2. The total number of trees uninfected by either Septoria musiva or Septoria populicola is excluded from this table.  2010  2011  North S.musiva  # Infected Total #(trees) p q  11  South  S. populicola 92  S.musiva 9  115 0.096 0.904  North  S. populicola 118  S.musiva 9  155 0.800 0.200  0.058 0.942  South  S. populicola 104  S.musiva 6  149 0.761 0.239  0.047 0.953  S. populicola 106 157  0.685 0.315  0.0385 0.962  0.679 0.321  Results Results Overview The 2010 data set was collected by Beauseigle et al. (2010) and is summarized below in table 3, along with the 2011 results. Beauseigle et al. (2010) had grouped the 35 regions into 7 locations; in this study, the 7 locations (Dease Lake, Far North, Midcoast, Prince George, Smithers, South Coast and USA) were divided into a Northern and Southern population. The  north consists of: Dease Lake, Far North, Midcoast, Prince George and Smithers, while the south is composed of South Coast and USA. The division of these two groups is illustrated in table 3 where the non-shaded regions represent the north, while the shaded cells represent the south. A total of 940 trees were sampled in 2010, but only 270 samples representing 100 families had been analyzed (Beauseigle et al. 2010). In 2011, trees from all 8 repetitions were sampled from provenance trial EP1123.02, with a total sample size of over 3000 trees; however, a sub-sample of 306 trees were processed, with 149 samples from the north and 157 samples representing the south. A summary of the data collected in 2011 and 2010 are shown in table 3 below; the S. musiva infected trees in 2011 are summarized in table 4. Table 3 - Summary of Septoria spp. infection from 2011 and 2010. The pink shaded rows are collectively the Northern region, while the blue shaded rows represent the Southern region. Trees that were positive for both Septoria species are not counted in the “S. musiva only” and “S. populicola only” columns.2010 data from Beauseigle et al. (2010)  Number of trees sampled Dease Lake 7 Far North 3 Midcoast 40 Prince George 41 Smithers 58 South Coast 135 USA 22 Total 306 Area  Dease Lake Far North Midcoast Prince George Smithers South Coast USA Total  11 3 46 22 33 136 19 270  2011 S.musiva S.populicola only only 2 3 0 3 0 31 2 28 1 35 4 100 0 4 9 204 2010 2 9 1 2 5 35 1 17 2 29 7 101 2 17 20 210  S. musiva + S. populicola 0 0 2 0 0 2 0 4  Negative for Both Septoria spp. 2 0 7 11 22 29 18 89  -  0 0 5 4 2 28 1 40  Table 4 – Summary of trees that tested positive for S. musiva in 2011. The grey shaded rows indicate trees that were also positive for S. musiva infection in 2010. The green shaded rows indicate S. musiva infected trees in 2011 that were directly adjacent or in close proximity to S. musiva positive trees in 2010. Un-shaded rows indicate newly infected trees that are spatially segregated from S. musiva infected trees in 2010. The tree tag refers to the actual label of the tree within the plantation, while the tree number denotes the geographical origin and replicate number. Lat = Latitude, Long = Longitude, Elev = Elevation.  311 570  Tree Number A150-3 A150-3  Lat  Long  Elev  Identification  Dease Lake Dease Lake  Main Drainage Bell-Irving Bell-Irving  5644 5644  12944 12944  579 579  A56-3  Mid Coast  Homathko  5117  12450  152  1249  A75-4  Mid Coast  Dean  5249  12657  27  S.musiva S.musiva S.musiva and S.populicola S.musiva and S.populicola  1020  901  A165-7  1398  A171-5  618 52  724  A93-4 A7-5 ATXD 1529 A25-3  735  Tree Tag  Area  Prince George Prince George Smithers South Coast  McGregor  5411  12200  579  S.musiva  Nechako R.  5406  12426  655  S.musiva  Kitimat Fraser R.  5409 4924  12835 12133  61 500  S.musiva S.musiva  South Coast  -  -  -  -  S.musiva  South Coast  EVIC  4957  12515  76  A23-2  South Coast  EVIS  4914  12404  60  958  A17-3  South Coast  EVIN  5013  12548  30  1212  ADTAC 7  South Coast  -  -  -  -  S.musiva S.musiva and S.populicola S.musiva S.musiva and S.populicola  599  Septoria musiva and Septoria populicola infection in 2010 The proportion of infected individuals in Beauseigle et al. (2010) was not divided between north and south populations, but rather a total number of infected individuals across the entire plantation. When divided into north and south, the north had 11 S.musiva infected individuals out of a 115 leaf samples (9.6%), while the south had 9 trees that tested positive for S.musiva out of 155 trees (5.8%). With S. populicola infected individuals, the north had 92 infected trees out of 115 (80.0%) and the south 118 out of 155 (76.1%) that tested positive. The number of trees infected with both diseases is unknown, as it was not reported in Beauseigle et  al. (2010). 40 trees tested negative for either Septoria species; however, it should be noted that these 40 individuals were not free of lesions, but simply did not test positive for either disease under the identification protocol. Z-test comparison of proportions between the number of trees infected with S. musiva in the northern population was not significantly different from the number of individuals infected with S. musiva in southern populations [Two-tailed Z-test, Z0.05 = ±1.96 > Ztest =1.353; Pvalue = 0.256]. Similarly, the proportion of trees infected with S. populicola from the north was not significantly different from proportion of infected trees in the south [Two-tailed Z-test, Z0.05 = ±1.96 > Ztest =0.946; P-value = 0.256].  Septoria musiva and Septoria populicola infection in 2011 Analogous to the 2010 analyses, the 7 geographical regions from Beauseigle et al. 2010 were separated into a north and south population and tested for proportion of infected trees over the total number of trees. The samples analyzed in 2011 contained a total of 13 individuals infected with Septoria musiva out of 306 processed trees (4.2%). Septoria populicola had a higher disease incidence of 210 infected individuals out of 306. Of the infected individuals, 4 trees were positive for both Septoria musiva and Septoria populicola. 89 trees were negative for infection of either Septoria species on leafs with lesions on it. As in 2010, the proportion of trees infected with S. musiva in the north was not significantly different from the proportion of trees infected with S. musiva in the south [Twotailed Z-test, Z0.05 = ±1.96 > Ztest =0.499; P-value = 0.256]. The proportion of trees infected with  S. populicola in the north was also statistically the same as the proportion of S. populicola infected trees in the south. [Two-tailed Z-test, Z0.05 = ±1.96 > Ztest =0.237; P-value = 0.256].  Septoria spp. infection in 2010 vs. 2011 Trees 570, 901 and 1020 had tested positive in 2010 for S. musiva infection; these same three trees have once again tested positive for S. musiva in 2011. In addition, trees: 311, 736 and 1398 have tested positive in 2011 and are situated directly adjacent to trees (tree 310 735 and 1400 respectively) that had tested positive in the previous year. Generally, trees that tested positive for S. musiva in 2011 are in close proximity to trees that were positive for S. musiva in 2010. The exceptions to this are trees 618, 1212 and 1249, which are confirmed for S. musiva infection in 2011, but are spatially segregated from previously infected trees in 2010. A Z-test comparison of proportions was also conducted to compare the proportion of infected of individuals in 2010 versus 2011 for each Septoria disease, with 2010 infection in the north compared with 2011 infection in the north. In 2010, 9.6% of the 115 samples from the north were infected with S. musiva, compared to the 4.7% of the 149 samples in 2011. However, the proportion of S. musiva infected trees in the north in 2011 did not statistically differ from the trees that were positive for S. musiva in 2010 [Two-tailed Z-test, Z0.05 = -1.96 < Ztest = -1.500; P-value = 0.256]. S. musiva infection was present in 3.8% of the 157 leaf samples from southern trees that were processed in 2011; however, this did not differ significantly from the 5.8% of S. musiva infection reported in the south in 2010 [Two-tailed Z-test, Z0.05 = -1.96 < Ztest = -0.739; P-value = 0.256].  76.1% of the 149 trees sampled from the southern population in 2010 were positive for S. populicola, compared to the 67.9% of the 157 trees southern trees in 2011; these proportions were not statistically different [Two-tailed Z-test, Z0.05 = -1.96 < Ztest = -1.660; P-value = 0.256]. However, the proportion of northern trees infected with S. populicola in 2010 (80.0%) did differ significantly from the proportion of infected individuals in 2011 (68.5%) [Two-tailed Z-test, Z0.05 = -1.96 > Ztest = -2.166; P-value = 0.256].  Discussion Sampling in 2010 vs. 2011- Methods and Protocol Differences Although nearly 3000 trees are present within the 8 repetitions at Harrison Mills, leaf samples and statistical analyses were only conducted on a subset of 306 trees located within repetitions 1-3. The purpose of analyzing a subsample of tree leaves is to detect any trends that could be observable at a coarse level scale and reduce the time and effort required to process over 3000 leaf spot samples. In addition, data from the previous year was available for repetitions 1-3 from Beauseigle et al. (2010); this allowed a temporal comparison of available data to detect any apparent trends in S. musiva and S. populicola infection within the plantation. Tree mortality was also a concern with respect to resampling trees from 2010, more specifically, the trees along the southern edge of replicates 2 and 3, where most of the trees had died, possibility due to maladaptation to the local environment. Trees such as tree 929, which was positive for a S. musiva canker in 2010 (Beauseigle et al. 2010), could not be resampled as it was one of the trees along the southeastern edge that had been removed. The 2010 data set from Beauseigle et al. (2010) also represented 100 families within the  provenance trial with a total sample size of 269 individual trees. In the 2011 data set, 107 families are represented over 306 tree samples; however, as the 2011 samples were randomly selected, there is no direct overlap between the families analyzed in 2010 versus those analyzed in 2011. The plantation contains families from 138 provenances; although not all of these families are represented in the 2011 data, a large proportion of the families are covered (107 out of 138). The time of sampling in 2011 was also slightly earlier in the year compared to the collection time of the 2010 dataset. The 2011 leaf samples, more specifically, replicates 1 – 3, were collected in August, while the samples collected by Beauseigle et al. (2010) were collected in the latter half of September. Initial lesions usually appear 3 – 4 weeks after bud burst (Feau, Mottet, Perinet, Hamelin, & Bernier, 2010), which would have been the optimal time to collect samples before other diseases propagate within the plantation. However, flooding from the adjacent river restricted the accessibility of the site and thus, leaf collection was delayed to August. A key difference between the 2010 and the 2011 dataset is the protocol in the DNA extraction protocol. In Beauseigle et al. (2010), only 1 leaf spot from a single leaf was excised from the infected leaves and extracted. This method was changed to extracting 3 leaf spots from at least 3 leaves per tree, for a total of 9 leaf spots; from these leaf spots, 3-5 are randomly selected and pooled during the DNA extraction and RT-PCR. The detectability S. musiva and S. populicola using the pooled leaf spot protocol were tested using known isolates of S. populicola and S. musiva and the primers and probes from table 1. After several pooling and detection experiments, it was determined that 3-5 leaf spots was the optimal number to use. In addition, a portion of the samples in 2010 were processed using a modified Zolan and  Pukkila (1986) extraction protocol; although this protocol allowed more flexibility and controlling DNA purity, the DNA yield is lower than the DNeasy Plant Mini Kit extraction protocol (Beauseigle et al. 2010). The data set from 2011 also contained more than two times the samples that were negative for Septoria spp. (40 negatives in 2010 vs. 89 negatives in 2011), which could have been the result of standardizing the extraction protocol that favors the DNA quantity over DNA quality.  Septoria spp. infected trees in 2011 Previous studies have suggested that the primary inoculum for S. musiva originates from the leaf litter (Luley & McNabb Jr., 1989; Ostry, 1987). This is reflected in the 2010/2011 data, as the trees that were previously infected in 2010 were once again infected in 2011; trees 570, 901 and 1020 are all positive for Septoria musiva in both years of data (table 4). Of the 13 S. musiva positive trees identified in 2011, 7 of the infected trees are directly adjacent or in close proximity to trees that were previously infected in 2010 (table 4). However, trees 618, 1212 and 1249 had no prior history of S. musiva infection. In addition, these three trees were at least 3 tree rows and columns away from the closest S. musiva positive tree in 2010. It is uncertain if the flood from the Fraser River contributed to the spread of the disease, as the extent of the flooding is unknown. However, the three newly infected trees are relatively distant from the riverbank itself. Nonetheless, the infection of S. musiva within the plantation appears to have become self-propagating by infecting previously uninfected areas. It is worth noting that tree family A150-3, which originates from the Dease Lake geographical region, appears to be the most highly susceptible to S. musiva. Trees 311, 570, 1443 are all within the A150-3 family with  tree 570 testing positive for S. musiva infection in 2010 and 2011. Tree 311, although negative for S. musiva in 2010, was directly adjacent to tree S. musiva positive tree 310 and has been tested positive in 2011. Tree 1443 was not included in the 2011 subsampled data from this study. Beauseigle et al. (2010) had attributed this infection of two trees within the same provenance to a 1) chance event or 2) local inoculum concentrated in the area or 3) they are more susceptible to S. musiva than other provenances. The reinfection of tree 570, along with the newly affected tree 311 suggests the infection could be more than a chance event. Trees 291 and 350, similar to tree 311, are also directly adjacent to tree 310; neither of the two trees tested positive for S. musiva, suggesting a relatively higher resistance compared to 311. However, the absence of S. musiva on 291 and 350 could simply be due to sampling error, where despite increasing the number and pooling the collected leaf spots, the true S. musiva infected spots are missed. The susceptibility of northern geographical regions cannot be statistically shown however, as low representation Dease Lake and Far North provenances and tree mortality have drastically reduced the number of available samples from the northern geographical regions and limiting statistical analyses. Unlike S. musiva, the infection of S. populicola within the plantation is well established and has infected the majority of the trees in the plantation, infecting 208 out of the total 306 samples collected in 2011. There are no apparent trends with respect to S. populicola infection within the plantation, as the disease is native to British Columbia and is distributed wherever susceptible hosts are present (Newcombe, Ostry, Hubbes, Perinet, & Mottet, 2001).  Z-test Results Interpretation Analyses of the proportion of infected individuals within each geographical region would be the most ideal way of identifying resistant provenances; however, processing over 3000 leaf samples representing all 7 geographical demands a vast amount of time and resources. By using a subset of data, coarse scale analyses can be conducted; the results of such analyses could dictate if the additional 2700 samples would need to be processed. Furthermore, there was an unequal representation of each provenance from when the provenance trial was established due to the availability of clonal material; the mortality of numerous trees have also contributed to the low representation of each geographical region, as reflected in table 3. In response to these limiting factors, the regions were divided into a northern and southern population where the north includes: Dease Lake, Far North, Smithers, Prince George and Midcoast, while the south includes: Southcoast and USA. In the 2010-northern population, 11/115 (9.6%) of the total samples were positive for S. musiva infection, compared to the 9/155 (5.8%) infected in the southern region. Although the north has a greater proportion of individuals infected, this was not statistically different from the proportion of infected individuals found in the southern population. Similarly, in 2011, the 7/149 (4.7%) of S. musiva infected trees in the north was not statistically different from the 6/157 (3.8%) infected trees in the south. It is interesting to note that the total number of S. musiva infected individuals is approximately an even split between the north and south, with 11 and 9 respectively in 2010, and 7 and 6 respectively in 2011. A comparison between proportion of infected individuals in 2010-north and 2011-north, as well as 2010-south and 2011-south also indicates that the proportions are not statistically different. This could be  interpreted as a stable rate of infection within the plantation between 2010 and 2011. The nonsignificant variation in S. musiva infection between the north and the south interesting, as one would expect a degree of resistance in one region over another, given the large amount of diversity within natural populations of poplars (Newcombe & Bradshaw, Quantitative trait loci conferring resistance in hybrid poplar to Septoria Populicola, the cause of leaf spot, 1996). However, as S. musiva had never been reported in the Pacific Northwest until 2006 (Callan, Leal, Foord, Dennis, & van Oosten, 2007), it is unlikely that P. trichocarpa has coevolved with S. musiva to generate some level of adaptive resistance (Clay & Kover, 1996). This is also reflected in Populus deltoides exhibiting some degree of resistances to S. musiva cankers, as the two have coevolved together and selective pressures place on one another have yielded resistance and increased virulence to one another (Newcombe & Ostry, 2001). Given total number of trees within the provenance trial, the frequency of cankers on the poplar clones was low. Cankers from branches that were found during the sampling were negative for S. musiva and were attributed to other injury causal agents. Several trees appeared to have cankers in the main stem; however, extracting the canker for S. musiva was not possible without killing the tree and was thus avoided. Variability in S. musiva aggressiveness has been documented given different isolates of the pathogen (Krupinsky, 1989); as the plantation is infected by a newly colonized pathogen that is subjected to population bottlenecks, it is possible that the S. musiva present within the plantation is one of mild aggressiveness. However, as LeBoldus et al. (2007) reports that host genotype variability had a bigger influence on disease severity than pathogen genotype variability, the founder’s effect the newly colonized S. musiva might not be restricting the aggressiveness and disease severity within the plantation. Analyses of neutral molecular  markers within the S. musiva genome have suggested that S. musiva has a high potential for local adaptation to sudden environmental changes (Feau, Hamelin, Vandecasteele, Stanosz, & Bernier, 2005). Furthermore, LeBoldus et al. (2010) found a significant clone-isolate interaction when conducting spray inoculations on Populus clones and S. musiva isolates to induce cankers. This clone-isolate interaction could account for the low frequency of cankers within the plantation, as the newly colonized population of S. musiva is unable to bypass the tree’s natural defense systems to generate cankers without infection through tissue wounds (LeBoldus & Blenis, 2010). Although the aggressiveness and disease severity in the plantation appear to be rare events, overtime, the infection of S. musiva in the Fraser Valley could be much more detrimental. S. populicola infection also showed no significant differences between the north and south population in 2010 and 2011. This result is expected, as S. populicola is native to British Columbia; as such, the pathogen and the host have coevolved together through the selective pressure they exert on one another (Clay & Kover, 1996). However, as pathogens have a higher generation turnover, any resistance to S. populicola could be by P. trichocarpa can be rapidly negated through several generations of genetic recombination. Finally, a significant difference was found in between the S. populicola infection in the 2011-north infection and the 2010north infection. The same significance was not detected in the comparison between 2011-south and 2010-south populations. This year over year difference could be attributed to S. populicola being epidemic in some years and not epidemic in others (Newcombe & Bradshaw, 1996).  Experimental Improvements and Future Research Although north and south populations showed no significant differences in S. musiva infection proportions, the apparent trend in the reinfection of the provenances in Dease Lake suggests that the region is relatively more susceptible to S. musiva than the geographical regions to the south. However, given the limited dataset, statistically analyses could not be conducted on each geographical region alone. As such, a better representation of each individual region, specifically from the northern provenances could strengthen this apparent relationship. As samples from the other 5 repetitions are available, it may be beneficial to process the samples to detect for the presence or absence of S. musiva. In addition, repeating the experiment for an additional year may be helpful in determining if the reinfections of specific regions are due to chance and high inoculum concentrations, or if there is a difference in quantitative resistance to S. musiva.  Acknowledgements I would like to thank Dr. Richard C. Hamelin for his giving me the opportunity, as well as his tutelage and supervision throughout the research; his positive attitude and dynamic personality has made the working under him enjoyable and fun. Next, I would like to thank everyone in Dr. Hamelin’s lab, specifically: Stephanie Beauseigle, Ben Lai, Padmini Herath and Braham Dhillon for their guidance and assistance over the course of the thesis. A quick thanks my program peer Brett Nelson for helping me collect leaves under the hot summer heat filled swarming with mosquitos. Finally, I would like to thank my parents and my siblings for their unending love, support and encouragement.  Literature Cited Beauseigle, S., Feau, N., & Hamelin, R. (2010). Poplar leaf spot and canker caused by Septoria musiva in British Columbia: risk assessment. Vancouver. Bier, J. (1939). Septoria canker of introduced and native hybrid poplars. Canadian journal of Research, 195-204. Callan, B., Leal, I., Foord, B., Dennis, J., & van Oosten, C. (2007). Septoria musiva isolated from cankered stems in hybrid poplar stool beds, Fraser Valley, British Columbia. Pacific Northwest Fungi, 1-9. Cimolai, T. (2011). Septoria spp. infection among North American Northwest Coast Provenances of Black Cottonwood (Populus trichocarpa): a field study of natural infection in a Fraser Valley Plantation. Vancouver: University of British Columbia Library. Clay, K., & Kover, P. (1996). The red queen hypothesis and plant/pathogen interactions. Annu. Rev. Phytopathology, 29-50. Feau, N., Hamelin, R., Vandecasteele, C., Stanosz, G., & Bernier, L. (2005). Genetic structure of Mycosphaerella populorum (anamorph Septoria musiva) populations in north-central and northeastern North America. Phytopathology, 608-616. Feau, N., Mottet, M., Perinet, P., Hamelin, R., & Bernier, L. (2010). Recent advances related to poplar leaf spot and canker caused by Septoria musiva. Canadian Journal of Plant Pathology, 122-134. Feau, N., Weiland, J., Stanosz, G., & Bernier, L. (2005). Specific and sensitive PCR-based detection of Septoria musiva, S. populicola and S. populi, the causes of leaf spot and stem canker on poplars. Mycol Res, 1015-1028. Gottsberger, R. (2010). Development and Evaluation of a real-time PCR assay targeting chromosomal DNA of Erwinia amylovora. Letters in Applied Microbiology, 285-292. Krupinsky, J. (1989). Variability in Septoria musiva aggressiveness. Phytopathology, 413-416. LeBoldus, J., & Blenis, P. (2010). A Method to Induce Stem Cankers by Inoculating Nonwounded Populus Clones with Septoria musiva Spore Suspensions. Plant Disease, 1238-1242. LeBoldus, J., Blenis, P., & Thomas, B. (2007). Evaluating the interaction between genotype and water stress in the hybrid poplar - Septoria musiva pathosystem. Canadian Journal of Botany, 1098-1102.  Luley, C., & McNabb Jr., H. (1989). Ascospore production, release, germination and infection of Populus by Mycosphaerella populorum. . Phytopathology, 1013-1018. McPhail, S., Cigolotti, V., & Moreno, A. (2012). Prospects of Hydrogen as a Future Energy Carrier. In L. Jorissen, Green Energy and Technology (pp. 189-203). London: Springer London. Newcombe, G., & Bradshaw, H. (1996). Quantitative trait loci conferring resistance in hybrid poplar to Septoria Populicola, the cause of leaf spot. Canadian Journal Of Forestry, 19431950. Newcombe, G., & Ostry, M. (2001). Recessive Resistance to Septoria stem canker of hybrid poplar. Phyotpathology, 1081-1084. Newcombe, G., Chastagner, G., Callan, B., & Ostry, M. (1995). An epidemic of Septoria leaf spot on Populus trichocarpa in the Pacific Northwest in 1993. Plant Dis, 79:212. Newcombe, G., Ostry, M., Hubbes, M., Perinet, P., & Mottet, M. (2001). Poplar Diseases. Ottawa, ON: National Research Council of Canada Press. Ostry, M. (1987). Biology of Septoria musiva and Marsonina brunnea in hybrid Populus plantations and controls of Septoria canker in nurseries. European Journal of Forest Pathology, 158-165. Ostry, M., & Mcnabb Jr., H. (1985). Susceptibility of Populus species and hybrids to disease in the North central United States. Plant Dis., 755-757. Ostry, M., Wilson, L. M., & Moore, L. (1989). A Guide to Insect, Disease and Animal Pests of Poplars. In United States Department of Agric. For Serv. Agricultural Handbook (p. 677). Qu, X., Wanner, L., & Christ, B. (2011). Multiplex real-time PCR (TaqMan) assay for the simultaneous detection and discrimination of potato powdery and common scab diseases and pathogens. Journal of Applied Microbiology, 769-777. Schaad, N., Frederick, R., Shaw, J., Schneider, W., Hickson, R., Petrillo, M., & Luster, D. (2003). Advances in molecular-based diagnostics in meeting crop biosecurity and phytosanitary issues. . Annual Review of Phytopathology, 305-324. Sinclair, W., & Lyon, H. (2005). Diseases of Trees and Shrubs, Second Edition. Ithaca, NY.: Cornell University Press.  Appendices Tree No.  Tree ID  Area  Main Drainage  40  A80-2  Smithers  44  A165-6  Location  Map #  Lat  Long  Elev  Pathogen Identity  Skeena  Skeena RID. SKN  80  5451  12820  140  S.populicola  Prince George  McGregor  McGregorR. MCG  165  5411  12200  579  S.populicola  A105-5  Smithers  Bulkley (Telkwa)  wa)lla Telkwa R./  105  5440  12707  567  S.populicola  52  A7-5  South Coast  Fraser R.  4924  12133  500  S.musiva  55  A146-7  Far North  Aisek  Tatshenshini  146  5926  13750  34  S.populicola  95  A162-1  Prince George  5324  12238  518  S.populicola  A158-3  Prince George  158  5256  12110  823  S.populicola  115  A158-4  Prince George  Hixon HIXN 1 16 Kimball Cr. 16 Kimball Cr.  162  109  Fraser R. Cunningham R. Cunningham R.  158  5256  12110  823  S.populicola  55  5114  12 457  88  S.populicola  45  168  A55-4  Mid Coast  Homathko  Homathko R.lC.  169  A12-4  South Coast  Fraser  Vender Cana1IL.  12  4909  12206  20  negative for both Septoria species  176  A178-4  USA  GS033  Pittsburg, W A. P  178  4550  12307  900  S.populicola  1  5000  12134  213  S.populicola  177  A1-5  South Coast  Fraser  Nahatlatch R./A.  184  A87-4  Smithers  Skeena  Skeena R.IN. SK  87  5417  12922  30  S.populicola  185  A153-3  Smithers  U. Nass  White RIA. WHTA  153  5556  12916  366  S.populicola  EVIC  Courtenay/H. CNYH  27  4940  12504  76  S.populicola  Fraser R. Cunningham R.  Fraser R. QFRS 16 Kimball Cr.  161  5304  12231  472  S.populicola  158  5256  12110  823  S.populicola  163  5355  12217  640  negative for both Septoria species  190  A27-3  South Coast  192  A161-3  Prince George  231  A158-2  Prince George  257  A163-7  Prince George  Fraser R.  WillowR. WLOW  274  A88-2  Smithers  Skeena  Skeena R.lO. SK  88  5413  12932  21  S.populicola  281  A164-6  Prince George  Fraser R.  5 Shelley SHEL  164  5402  12236  564  negative for both Septoria species  282  A156-7  Prince George  Quesnel R.  6 Australian QA  156  5243  12228  442  S.populicola  94  5403  12841  18  negative for both Septoria species  285  A94-4  Smithers  Kitimat  Kitimat R.lC. K  291  A164-1  Prince George  Fraser R.  5 Shelley SHEL  164  5402  12236  564  S.populicola  311  A150-3  Dease Lake  Bell-Irving  7 BellIrving/C.  150  5644  12944  579  S.musiva  321  A92-1  Smithers  Kitimat  Kitimat R./ A.  92  5415  12831  122  S.populicola  323  A82-2  Smithers  Skeena  KitwangaIF . KT  82  5505  12811  177  S.populicola  156  5243  12228  442  S.populicola  325  A156-6  Prince George  Quesnel R.  6 Australian QA  326  A161-3  Prince George  Fraser R.  Fraser R. QFRS  161  5304  12231  472  S.populicola  Fraser R.  6 Cottonwood QC  160  5302  12209  823  S.populicola  Kitimat  Kitimat R.lC. K  94  5403  12841  18  S.populicola  88  5413  12932  21  negative for both Septoria species  331 337  A160-4 A94-2  Prince George Smithers  348  A88-2  Smithers  Skeena  Skeena R.lO. SK  349  A87-2  Smithers  Skeena  Skeena R.IN. SK  87  5417  12922  30  negative for both Septoria species  350  A95-4  Smithers  Kitimat  Hirsch Cr.lD. H  95  5404  12827  335  negative for both Septoria species  356  A159-5  Prince George  Fraser R.  Baker Cr. QBKR  159  5257  12252  823  S.populicola  367  A116-5  Smithers  U. Nass  NassRtH. NASH  116  5543  12849  183  S.populicola  410  A156-7  Prince George  Quesnel R.  6 Australian QA  156  5243  12228  442  S.populicola  424  A76-5  Smithers  Skeena  448  A171-4  Prince George  Nechako R.  Exehamsiks RIP 14 Redmond Cr. A.  453  A153-3  Smithers  U. Nass  White RIA. WHTA  153  5556  12916  366  S.populicola  468  A98-4  Smithers  Bulkley  Bulkley R.lC. B  98  5457  12717  451  negative for both Septoria species  475  A162-1  Prince George  Fraser R.  Hixon HIXN 1  162  5324  12238  518  negative for both Septoria species  505  A95-2  Smithers  Kitimat  Hirsch Cr.lD. H  95  5404  12827  335  negative for both Septoria species  506  A136-2  Dease Lake  L. Stikine  6 Iskut R.lC. I  136  5656  13020  317  negative for both Septoria species  519  A96-4  Smithers  Bulkley  Bulkley R./ A.  96  5515  12730  311  negative for both Septoria species  522  A41-3  South Coast  Squamish  GlacierlB Aha L.  41  5006  12300  579  negative for both Septoria species  531  A163-4  Prince George  Fraser R.  WillowR. WLOW  163  5355  12217  640  negative for both Septoria species  570  A150-3  Dease Lake  Bell-Irving  7 BellIrving/C.  150  5644  12944  579  S.musiva  EVIS  Cassigy/J. CSYJ  22  4904  12352  20  S.populicola  Lillooet  a Lillooet R./ A.  33  5037  12323  411  S.populicola  571 573  A22-4 A33-3  South Coast South Coast  76  5425  12926  46  negative for both Septoria species  171  5406  12426  655  negative for both Septoria species  574  A89-8  Smithers  Skeena  Skeena R.IP. SK  89  5433  12828  61  S.populicola  576  A9-2  South Coast  Fraser  Chilliwack R.#2/I.  9  4906  12138  360  S.populicola  577  A105-1  Smithers  Bulkley (Telkwa)  wa)lla Telkwa R./  105  5440  12707  567  S.populicola  GS031  North Plains, OR.  179  4534  12300  100  S.populicola  35  5030  12300  271  S.populicola  25  4957  12515  76  negative for both Septoria species  578  A179-2  USA  579  A35-4  South Coast  Lillooet  a Lillooet R.lC.  580  A25-2  South Coast  EVIC  Campbell R.IF. CM  581  A57-5  South Coast  Southgate  583  A171-1  Prince George  584  A67-1  585  A87-4  586  A179-5  57  5049  12429  239  S.populicola  Nechako R.  1 Southgate R./ A 14 Redmond Cr. A.  171  5406  12426  655  S.populicola  Mid Coast  Rivers  Chuckwalla R.lC.  67  5144  12719  67  S.populicola  Smithers  Skeena  Skeena R.IN. SK  87  5417  12922  30  S.populicola  GS031  North Plains, OR.  179  4534  12300  100  S.populicola  71  5223  12636  135  S.populicola  USA  587  A71-2  Mid Coast  Burke  Bella Coola R.lC.  588  A174-3  USA  GS001  Carson, WA. CARS  174  4545  12250  650  negative for both Septoria species  590  A47-5  South Coast  Jervis  Skwawka R.IF. SK  47  5015  12356  244  S.populicola  74  5250  12648  91  S.populicola  591  A74-1  Mid Coast  Dean  eanR./C. DENC 7  592  A1-1  South Coast  Fraser  Nahatlatch R./A.  1  5000  12134  213  negative for both Septoria species  593  A154-4  Mid Coast  KingcomeR.  20a Atlatzi R.lA.  154  5059  12607  0  S.populicola  Fraser  MatsQui Is.IM. M  13  4907  12220  8  S.populicola  19  5016  12550  30  S.populicola  72  5246  12637  213  S.populicola  594  A13-5  South Coast  596  A19-3  South Coast  EVIN  Salmon R. #2/C SL  598  A72-4  Mid Coast  Dean  eanR./A. DENA 7  599  ATXD 15-29  South Coast Skeena  Skeena R/e. SKN  79  5446  12816  122  negative for both Septoria species  84  5513  12740  238  negative for both Septoria species  615  A79-4  Smithers  S.musiva  616  A84-5  Smithers  Skeena  HazeltonIH. HAZ  618  A93-4  Smithers  Kitimat  Kitimat R.IB. K  93  5409  12835  61  S.musiva  619  A106-2  Smithers  Bulkley (Telkwa)  wa)lla Telkwa R.I  106  5437  12730  735  S.populicola  624  A163-3  Prince George  Fraser R.  WillowR. WLOW  163  5355  12217  640  S.populicola  627  A151-1  Dease Lake  Bell-Irving  7 BellIrving/D.  151  5651  12937  677  S.populicola  631  A95-4  Smithers  Kitimat  Hirsch Cr.lD. H  95  5404  12827  335  S.populicola  Skeena  Exehamsiks RIP  76  5425  12926  46  negative for both Septoria species  156  5243  12228  442  negative for both Septoria species  636  A76-5  Smithers  644  A156-1  Prince George  Quesnel R.  6 Australian QA  645  A123-3  Smithers  Skeena  Kitsumkalum R.IB.  123  5444  12847  155  negative for both Septoria species  661  A93-4  Smithers  Kitimat  Kitimat R.IB. K  93  5409  12835  61  negative for both Septoria species  663  A106-1  Smithers  Bulkley (Telkwa)  wa)lla Telkwa R.I  106  5437  12730  735  S.populicola  164  5402  12236  564  S.populicola  667  A164-3  Prince George  Fraser R.  5 Shelley SHEL  685  A113-1  Smithers  U. Nass  Nass RIE. NASE  113  5524  12859  207  negative for both Septoria species  702  A163-4  Prince George  Fraser R.  WillowR. WLOW  163  5355  12217  640  negative for both Septoria species  705  A53-1  South Coast  Homathko  Homathko R./ A.  53  5056  12451  46  negative for both Septoria species  706  A92-1  Smithers  Kitimat  Kitimat R./ A.  92  5415  12831  122  S.populicola  709  A37-2  South Coast  Harrison  Lillooet R./ A.  37  5007  12232  314  S.populicola  Kitimat  Kitimat R.lC. K  94  5403  12841  18  S.populicola  183  4512  12305  100  S.populicola  711  A94-3  Smithers  713  A183-1  USA  GS056  Lafayette, OR. LA  714  A157-3  Prince George  Quesnel R.  6 Quesnel L. QL  157  5258  12219  488  S.populicola  715  A36-1  South Coast  Lillooet  Lillooet R.ID.  36  5018  12245  222  S.populicola  716  A44-3  South Coast  Jervis  Skwawka R.lC. SK  44  5015  12400  152  S.populicola  717  A123-3  Smithers  Skeena  Kitsumkalum R.IB.  123  5444  12847  155  S.populicola  GS024  Castle Rock, W A.  177  4620  12255  100  negative for both Septoria species  182  4400  12255  150  S.populicola  8  4906  12131  480  S.populicola  718  A177-1  USA  719  A182-2  USA  GS051  Jasper, OR. JASP  720  A8-3  South Coast  Fraser  Chilliwack R.#l/H.  721  A3-3  South Coast  Fraser  Wellington Bar/C.  722  A39-3  South Coast  Harrison  723  A64-3  Mid Coast  Knight  Lillooet R.lC. 0 W.Klinaklini R.  EVIC  Campbell R.IF. CM  724  A25-3  South Coast  3  4940  12125  91  S.populicola  39  4946  12213  64  S.populicola  64  5118  12546  546  S.populicola  25  4957  12515  76  S.musiva  726  A72-1  Mid Coast  Dean  eanR./A. DENA 7  72  5246  12637  213  S.populicola  727  A9-2  South Coast  Fraser  Chilliwack R.#2/I.  9  4906  12138  360  S.populicola  729  A45-4  South Coast  Jervis  Skwawka R.ID. SK  45  5015  12401  323  S.populicola  Homathko  Homathko R./ A.  53  5056  12451  46  S.populicola  4  4934  12128  549  S.populicola  730  A53-1  South Coast  732  A4-2  South Coast  Fraser  Yale West/D. YA  733  A17-2  South Coast  EVIN  Memekav R./ A. ME  17  5013  12548  30  S.populicola  735  A23-2  South Coast  EVIS  Lantzville/K. LNZ  23  4914  12404  60  S.musiva and S.populicola  736  A69-5  Mid Coast  Burke  Bella Coola R./ A.  69  5225  12610  152  S.populicola  13  4907  12220  8  S.populicola  737  A13-2  South Coast  Fraser  MatsQui Is.IM. M  738  A27-2  South Coast  EVIC  Courtenay/H. CNYH  27  4940  12504  76  S.populicola  172  5357  12426  671  S.populicola  39  4946  12213  64  S.populicola  740  A172-6  Prince George  Nechako R.  14 Diamond Is. B.  741  A39-2  South Coast  Harrison  Lillooet R.lC.  742  A59-4  Mid Coast  Knight  743  A64-1  Mid Coast  Knight  W.Klinaklini R./ A 0 W.Klinaklini R.  59  5107  12535  30  negative for both Septoria species  64  5118  12546  546  negative for both Septoria species  748  A23-4  South Coast  EVIS  Lantzville/K. LNZ  23  4914  12404  60  negative for both Septoria species  756  A18-2  South Coast  EVIN  Salmon R. #IIB. S  18  5013  12549  30  S.populicola  28  4931  12451  46  S.populicola  757  A28-5  South Coast  EVIC  Fanny Bayll. FNYI  758  A26-5  South Coast  EVIC  Black Creek/G. BL  26  4950  12511  91  negative for both Septoria species  759  A5-5  South Coast  Fraser  Yale East/E. YA  5  4934  12124  61  negative for both Septoria species  760  A52-1  South Coast  Phillips  Phillips R.lC.  52  5041  12515  58  S.populicola  761  A46-1  South Coast  Jervis  Skwawka R.IE. S  46  5013  12357  231  negative for both Septoria species  762  A9-4  South Coast  Fraser  Chilliwack R.#2/I.  9  4906  12138  360  negative for both Septoria species  764  A161-4  Prince George  Fraser R.  Fraser R. QFRS  161  5304  12231  472  negative for both Septoria species  765  A66-4  Mid Coast  Machmell  Machmell R.IB  66  5137  12635  122  negative for both Septoria species  768  A12-2  South Coast  Fraser  Vender Cana1IL.  12  4909  12206  20  negative for both Septoria species  770  A74-4  Mid Coast  Dean  eanR./C. DENC 7  74  5250  12648  91  negative for both Septoria species  771  A19-5  South Coast  EVIN  772  A33-5  South Coast  Lillooet  774  A32-2  South Coast  Squamish  778  A128-1  Dease Lake  L. Stikine  779  A32-3  South Coast  781  A50-1  782  Salmon R. #2/C SL  19  5016  12550  30  S.populicola  33  5037  12323  411  S.populicola  32  5015  12235  305  S.populicola  128  5731  13147  61  S.populicola  Squamish  L. Stikine Elaho R.ID. EL  32  5015  12235  305  S.populicola  South Coast  Phillips  Phillips R./ A.  50  5036  12519  5  S.populicola  A48-2  South Coast  Toba Inlet  23 Toba R./A. T  48  5031  12414  67  negative for both Septoria species  833  A29-2  South Coast  Squamish  29  4952  12314  61  S.populicola  835  A66-5  Mid Coast  Machmell  Squamish R./ A. Machmell R.IB  66  5137  12635  122  S.populicola  837  A50-4  South Coast  Phillips  Phillips R./ A.  50  5036  12519  5  S.populicola  838  A39-5  South Coast  Harrison  Lillooet R.lC.  39  4946  12213  64  S.populicola  Mid Coast  Dean  eanR.lD. DEND 7  75  5249  12657  27  S.populicola  wa)lla Telkwa R./  105  5440  12707  567  S.populicola negative for both Septoria species  840  A75-2  a Lillooet R./ A. Elaho R.ID. EL  841  A105-5  Smithers  Bulkley (Telkwa)  842  A14-3  South Coast  Fraser  McMillan Is.IN.  14  4911  12235  15  844  A177-5  USA  GS024  Castle Rock, W A.  177  4620  12255  100  S.populicola  845  A92-4  Smithers  Kitimat  Kitimat R./ A.  92  5415  12831  122  negative for both Septoria species  846  A15-2  South Coast  Fraser  Harrison R./O. H  15  4917  12157  40  S.populicola  848  A19-4  South Coast  EVIN  Salmon R. #2/C SL  19  5016  12550  30  S.populicola  Fraser R.  Baker Cr. QBKR  159  5257  12252  823  S.populicola  100  5445  12707  494  negative for both Septoria species  849  A159-2  Prince George  851  A100-4  Smithers  Bulkley  Bulkley R.IE. B  852  A92-3  Smithers  Kitimat  Kitimat R./ A.  92  5415  12831  122  S.populicola  43  5014  12400  115  S.populicola  854  A43-4  South Coast  Jervis  Skwawka R.IB. SK  856  A45-4  South Coast  Jervis  Skwawka R.ID. SK  45  5015  12401  323  S.populicola  857  A92-2  Smithers  Kitimat  Kitimat R./ A.  92  5415  12831  122  negative for both Septoria species  858  A41-5  South Coast  Squamish  41  5006  12300  579  S.populicola  860  A49-5  South Coast  Toba Inlet  GlacierlB Aha L. 23 TobaR.IB. TO  49  5034  12405  73  S.populicola  861  A58-2  South Coast  Southgate  1 Southgate R.IB.  58  5053  12444  91  negative for both Septoria species  862  A174-3  USA  GS001  Carson, WA. CARS  174  4545  12250  650  S.populicola  863  A37-2  South Coast  Harrison  Lillooet R./ A.  37  5007  12232  314  S.populicola  Memekav R./ A. ME  17  5013  12548  30  S.populicola  73  5250  12642  152  S.populicola  32  5015  12235  305  S.populicola  49  5034  12405  73  S.populicola  880  A17-2  South Coast  EVIN  881  A73-4  Mid Coast  Dean  882  A32-5  South Coast  Squamish  883  A49-2  South Coast  Toba Inlet  eanR.IB. DENB 7 Elaho R.ID. EL 23 TobaR.IB. TO  884  A181-5  USA  GS048  Halsey, OR. HALS  181  4425  12320  300  S.populicola  Fraser  Yale West/D. YA  4  4934  12128  549  S.populicola  53  5056  12451  46  S.populicola  886  A4-5  South Coast  888  A53-2  South Coast  Homathko  Homathko R./ A.  889  A24-2  South Coast  EVIS  Chemainus R.IL. C  24  4853  12342  5  S.populicola  890  A15-5  South Coast  Fraser  Harrison R./O. H  15  4917  12157  40  negative for both Septoria species  892  A23-4  South Coast  EVIS  Lantzville/K. LNZ  23  4914  12404  60  S.populicola  893  A133-1  Dease Lake  U. Stikine  Tanzilla R./A.  133  5818  13028  567  S.populicola  Fraser  Harrison R./O. H  15  4917  12157  40  S.populicola  28  4931  12451  46  S.populicola negative for both Septoria species  894  A15-3  South Coast  896  A28-2  South Coast  EVIC  Fanny Bayll. FNYI  897  A58-2  South Coast  Southgate  1 Southgate R.IB.  58  5053  12444  91  898  A122-2  Smithers  Skeena  Cedar R./A (KITA)  122  5457  12855  274  S.populicola  21  5008  12603  213  negative for both Septoria species  899  A21-4  South Coast  EVIN  White R.IE. WHTE,  900  A177-2  USA  GS024  Castle Rock, W A.  177  4620  12255  100  S.populicola  901  A165-7  Prince George  McGregor  McGregorR. MCG  165  5411  12200  579  S.musiva  Fraser  Hope North/F. H  6  4926  12126  61  S.populicola  78  5441  12823  122  negative for both Septoria species  902  A6-1  South Coast  904  A78-3  Smithers  Skeena  Skeena RIB. SKN  905  A154-5  Mid Coast  KingcomeR.  20a Atlatzi R.lA.  154  5059  12607  0  S.populicola  906  A180-4  USA  GS041  Jefferson, OR. JE  180  4444  12305  100  negative for both Septoria species  907  A12-1  South Coast  Fraser  Vender Cana1IL.  12  4909  12206  20  negative for both Septoria species  909  A75-1  Mid Coast  Dean  eanR.lD. DEND 7  75  5249  12657  27  S.populicola  910  A32-4  South Coast  Squamish  Elaho R.ID. EL  32  5015  12235  305  negative for both Septoria species  911  A58-1  South Coast  Squamish  GlacierlB Aha L.  41  5006  12300  579  negative for both Septoria species  912  A67-4  Mid Coast  Southgate  1 Southgate R.IB.  58  5053  12444  91  negative for both Septoria species  916  A71-4  Mid Coast  Burke  Bella Coola R.lC.  71  5223  12636  135  negative for both Septoria species  917  A2-3  South Coast  Fraser  Nahatlatch L.IB.  2  4958  12149  335  S.populicola  918  A54-4  South Coast  Homathko  Homathko R.IB.  54  5057  12454  37  S.populicola  919  A7-1  South Coast  Fraser  Hope South/G. H  7  4924  12133  500  negative for both Septoria species  920  A106-2  Smithers  Bulkley (Telkwa)  wa)lla Telkwa R.I  106  5437  12730  735  S.populicola  154  5059  12607  0  S.populicola  178  4550  12307  900  S.populicola  921  A154-2  Mid Coast  KingcomeR.  20a Atlatzi R.lA.  922  A178-2  USA  GS033  Pittsburg, W A. P  923  A52-2  South Coast  Phillips  Phillips R.lC.  52  5041  12515  58  negative for both Septoria species  161  5304  12231  472  negative for both Septoria species negative for both Septoria species  937  A161-2  Prince George  Fraser R.  Fraser R. QFRS  938  A15-3  South Coast  Fraser  Harrison R./O. H  15  4917  12157  40  939  A54-3  South Coast  Homathko  Homathko R.IB.  54  5057  12454  37  S.populicola  Skeena  Cedar R./A (KITA)  122  5457  12855  274  negative for both Septoria species  72  5246  12637  213  negative for both Septoria species  38  5002  12232  213  S.populicola  940  A122-2  Smithers  942  A72-1  Mid Coast  Dean  eanR./A. DENA 7  943  A38-2  South Coast  Harrison  Lillooet R.IB.  54  5057  12454  37  negative for both Septoria species  944  A54-2  South Coast  Homathko  Homathko R.IB.  946  A53-4  South Coast  Homathko  Homathko R./ A.  53  5056  12451  46  S.populicola  948  A20-2  South Coast  EVIN  Salmon R. #3ID. S  20  5017  12552  30  S.populicola  175  4535  12200  300  S.populicola  171  5406  12426  655  S.populicola  22  4904  12352  20  S.populicola  949  A175-5  USA  GS009  950  A171-1  Prince George  Nechako R.  N. Bonneville WA. 14 Redmond Cr. A.  951  A22-3  South Coast  EVIS  Cassigy/J. CSYJ  11  4905  12144  280  negative for both Septoria species  50  5036  12519  5  negative for both Septoria species  953  A11-2  South Coast  Fraser  Chilliwack R.#4/K.  957  A50-5  South Coast  Phillips  Phillips R./ A.  958  A17-3  South Coast  EVIN  Memekav R./ A. ME  17  5013  12548  30  S.musiva  959  A42-4  South Coast  Jervis  Skwawka R./ A. S  42  5013  12359  61  negative for both Septoria species  960  A183-4  USA  4512  12305  100  S.populicola  A158-6  Prince George  Lafayette, OR. LA 16 Kimball Cr.  183  961  GS056 Cunningham R.  158  5256  12110  823  S.populicola  962  A80-2  Smithers  Skeena  Skeena RID. SKN  80  5451  12820  140  negative for both Septoria species  963  A46-5  South Coast  Jervis  Skwawka R.IE. S  46  5013  12357  231  S.populicola  1  5000  12134  213  S.populicola  964  A1-2  South Coast  Fraser  Nahatlatch R./A.  966  A75-5  Mid Coast  Dean  eanR.lD. DEND 7  75  5249  12657  27  S.populicola  967  A28-3  South Coast  EVIC  Fanny Bayll. FNYI  28  4931  12451  46  S.populicola  41  5006  12300  579  S.populicola  968  A41-3  South Coast  Squamish  GlacierlB Aha L.  969  A36-2  South Coast  Lillooet  Lillooet R.ID.  36  5018  12245  222  S.populicola  GS041  Jefferson, OR. JE  180  4444  12305  100  S.populicola  87  5417  12922  30  S.populicola  970  A180-3  USA  983  A87-2  Smithers  Skeena  Skeena R.IN. SK  998  A165-7  Prince George  McGregor  McGregorR. MCG  165  5411  12200  579  S.populicola  1020  A56-3  Mid Coast  Homathko  Homathko R.ID.  56  5117  12450  152  S.musiva and S.populicola  1049  A178-3  USA  GS033  Pittsburg, W A. P  178  4550  12307  900  S.populicola  1068  A128-3  Dease Lake  L. Stikine  L. Stikine  128  5731  13147  61  negative for both Septoria species  1200  A7-3  South Coast  Fraser  Hope South/G. H  7  4924  12133  500  1212  ADTAC 7  South Coast  1216  A45-5  South Coast  1217  A158-5  S.populicola S.musiva and S.populicola  Skwawka R.ID. SK 16 Kimball Cr.  45  5015  12401  323  S.populicola  Prince George  Jervis Cunningham R.  158  5256  12110  823  S.populicola  wa)lla Telkwa R./  105  5440  12707  567  S.populicola  1218  A105-5  Smithers  Bulkley (Telkwa)  1225  A23-5  South Coast  EVIS  Lantzville/K. LNZ  23  4914  12404  60  S.populicola  1230  A15-4  South Coast  Fraser  Harrison R./O. H  15  4917  12157  40  negative for both Septoria species  1233  A7-4  South Coast  Fraser  Hope South/G. H  7  4924  12133  500  S.populicola  Homathko  Homathko R.lC.  5114  12 457  88  S.populicola  1235  A55-3  Mid Coast  55  1245  A79-4  Smithers  Skeena  Skeena R/e. SKN  79  5446  12816  122  S.populicola  1247  A35-1  South Coast  Lillooet  a Lillooet R.lC.  35  5030  12300  271  S.populicola  1249  A75-4  Mid Coast  Dean  eanR.lD. DEND 7  75  5249  12657  27  S.musiva and S.populicola  1254  A173-2  Prince George  Nechako R.  173  5353  12259  183  S.populicola  1261  A64-2  Mid Coast  Knight  14 Chilako R. C 0 W.Klinaklini R.  64  5118  12546  546  S.populicola  1272  A28-4  South Coast  EVIC  Fanny Bayll. FNYI  28  4931  12451  46  S.populicola  1277  A50-2  South Coast  Phillips  Phillips R./ A.  50  5036  12519  5  S.populicola  1278  A11-1  South Coast  Fraser  Chilliwack R.#4/K.  11  4905  12144  280  S.populicola  GS033  Pittsburg, W A. P  178  4550  12307  900  negative for both Septoria species  182  4400  12255  150  S.populicola  1279  A178-1  USA  1298  A182-3  USA  GS051  Jasper, OR. JASP  1302  A10-1  South Coast  Fraser  Chilliwack R.#3/J.  10  4905  12143  280  S.populicola  1303  A164-2  Prince George  Fraser R.  5 Shelley SHEL  164  5402  12236  564  negative for both Septoria species  1304  A17-2  South Coast  EVIN  Memekav R./ A. ME  17  5013  12548  30  S.populicola  53  5056  12451  46  S.populicola  1307  A53-1  South Coast  Homathko  1308  A32-4  South Coast  Squamish  Homathko R./ A. Elaho R.ID. EL  32  5015  12235  305  S.populicola  26  4950  12511  91  S.populicola  1309  A26-2  South Coast  EVIC  Black Creek/G. BL  1313  A165-6  Prince George  McGregor  McGregorR. MCG  165  5411  12200  579  S.populicola  1314  South Coast Far North  EVIC Taku  Campbell R.IF. CM Taku River/B  25 142  4957 5842  12515 13324  76 49  S.populicola  1316  A25-1 A142-5  1317  A54-3  South Coast  Homathko  Homathko R.IB.  54  5057  12454  37  S.populicola  GS048  Halsey, OR. HALS  181  4425  12320  300  S.populicola  16  4914  12151  30  negative for both Septoria species  1319  A181-1  USA  S.populicola  1323  A16-2  South Coast  Fraser  Harrison Mill/P.  1324  A92-3  Smithers  Kitimat  Kitimat R./ A.  92  5415  12831  122  negative for both Septoria species  1326  A45-4  South Coast  Jervis  Skwawka R.ID. SK  45  5015  12401  323  S.populicola  154  5059  12607  0  S.populicola  76  5425  12926  46  S.populicola  1327  A154-5  Mid Coast  KingcomeR.  20a Atlatzi R.lA.  1328  A76-5  Smithers  Skeena  Exehamsiks RIP  1329  A154-2  Mid Coast  KingcomeR.  20a Atlatzi R.lA.  154  5059  12607  0  S.populicola  1330  A68-3  Mid Coast  Rivers  Chuckwalla R.ID.  68  5146  12712  79  S.populicola  1331  A9-5  South Coast  Fraser  Chilliwack R.#2/I.  9  4906  12138  360  S.populicola  Fraser  Yale West/D. YA  4  4934  12128  549  S.populicola  27  4940  12504  76  S.populicola  1332  A4-2  South Coast  1333  A27-3  South Coast  EVIC  Courtenay/H. CNYH  1336  A43-3  South Coast  Jervis  Skwawka R.IB. SK  43  5014  12400  115  S.populicola  1337  A36-3  South Coast  Lillooet  Lillooet R.ID.  36  5018  12245  222  S.populicola  1338  A22-4  South Coast  EVIS  Cassigy/J. CSYJ  22  4904  12352  20  S.populicola  1339  A46-1  South Coast  Jervis  Skwawka R.IE. S  46  5013  12357  231  S.populicola  181  4425  12320  300  S.populicola  19  5016  12550  30  S.populicola  16  4914  12151  30  S.populicola  31  5006  12322  177  S.populicola  1340  A181-5  USA  GS048  Halsey, OR. HALS  1341  A19-2  South Coast  EVIN  Salmon R. #2/C SL  1342  A16-5  South Coast  Fraser  1343  A31-3  South Coast  Squamish  Harrison Mill/P. Squamish R.lC.  1344  A165-8  Prince George  McGregor  McGregorR. MCG  165  5411  12200  579  S.populicola  1345  A69-3  Mid Coast  Burke  Bella Coola R./ A.  69  5225  12610  152  S.populicola  3  4940  12125  91  S.populicola  1346  A3-1  South Coast  Fraser  Wellington Bar/C.  1347  A69-4  Mid Coast  Burke  Bella Coola R./ A.  69  5225  12610  152  S.populicola  1348  South Coast Far North  Toba Inlet Taku  23 Toba R./A. T Taku River/B  48 142  5031 5842  12414 13324  67 49  S.populicola  1349  A48-2 A142-3  1350  A38-4  South Coast  Harrison  Lillooet R.IB.  38  5002  12232  213  S.populicola  1352  A38-4  South Coast  Harrison  Lillooet R.IB.  38  5002  12232  213  S.populicola  wa)lla Telkwa R.I  106  5437  12730  735  S.populicola  Skeena R.IP. SK  89  5433  12828  61  S.populicola  13  4907  12220  8  S.populicola  64  5118  12546  546  S.populicola  S.populicola  1353  A106-2  Smithers  Bulkley (Telkwa)  1354  A89-8  Smithers  Skeena  1355  A13-3  South Coast  Fraser  1356  A64-1  Mid Coast  Knight  MatsQui Is.IM. M 0 W.Klinaklini R.  1357  A50-4  South Coast  Phillips  Phillips R./ A.  50  5036  12519  5  S.populicola  Homathko  Homathko R.ID.  56  5117  12450  152  S.populicola  1360  A56-4  Mid Coast  1362  A41-5  South Coast  Squamish  GlacierlB Aha L.  41  5006  12300  579  S.populicola  1380  A156-1  Prince George  Quesnel R.  6 Australian QA  156  5243  12228  442  S.populicola  1382  A18-4  South Coast  EVIN  18  5013  12549  30  S.populicola  1383  A62-1  Mid Coast  Knight  62  5134  12530  427  S.populicola  1384  A72-1  Mid Coast  Dean  72  5246  12637  213  S.populicola  1386  A62-3  Mid Coast  Knight  eanR./A. DENA 7 Klinaklini R.ID.  62  5134  12530  427  S.populicola  1387  A22-5  South Coast  EVIS  Cassigy/J. CSYJ  22  4904  12352  20  S.populicola  1388  A114-2  Smithers  U. Nass  Nass RIF. NASF  114  5534  12847  152  S.populicola  Rivers  Chuckwalla R.lC.  67  5144  12719  67  S.populicola  8  4906  12131  480  S.populicola  1389  A67-1  Mid Coast  Salmon R. #IIB. S Klinaklini R.ID.  1390  A8-4  South Coast  Fraser  Chilliwack R.#l/H.  1391  A183-1  USA  GS056  Lafayette, OR. LA  183  4512  12305  100  S.populicola  1392  A75-2  Mid Coast  Dean  eanR.lD. DEND 7  75  5249  12657  27  S.populicola  154  5059  12607  0  S.populicola  171  5406  12426  655  S.musiva  1397  A154-3  Mid Coast  KingcomeR.  1398  A171-5  Prince George  Nechako R.  20a Atlatzi R.lA. 14 Redmond Cr. A.  1437  A163-1  Prince George  Fraser R.  WillowR. WLOW  163  5355  12217  640  negative for both Septoria species  1440  A164-1  Prince George  Fraser R.  5 Shelley SHEL  164  5402  12236  564  S.populicola  87  5417  12922  30  S.populicola  1442  A87-5  Smithers  Skeena  Skeena R.IN. SK  1462  A88-2  Smithers  Skeena  Skeena R.lO. SK  88  5413  12932  21  S.populicola  1490  A94-3  Smithers  Kitimat  Kitimat R.lC. K  94  5403  12841  18  S.populicola  89  5433  12828  61  S.populicola  1491  A89-4  Smithers  Skeena  Skeena R.IP. SK  1493  A82-6  Smithers  Skeena  KitwangaIF . KT  82  5505  12811  177  S.populicola  1495  A94-4  Smithers  Kitimat  Kitimat R.lC. K  94  5403  12841  18  negative for both Septoria species  Provenance Trial EP.1123.02.05  Provenance Trial EP.1123.02.05 Layout  Kilby - Harrison Mills Ct  Fraser River  Fraser Riv  trees in subsample of Fung, 2012 trees positive for S. musiva leafspot in 2010 and 2011 trees positive for S. musiva leafspot in 2011 trees positive for S. musiva leafspot in 2010 trees with S. musiva canker in 2010 (isolated by culture)  rep 2 c55  c54  c53  c52  c51  c50  c49  c48  c47  c46  c45  c44  c43  c42  c41  c40  c39  c38  c37  c36  c35  c34  c33  c32  c31  c30  c29  c28  c27  c26  c25  c24  c23  c22  c21  c20  c19  c18  c17  991 992  990 989  931 932  X 929  871 872  870 869  811 812  810 809  751 752  750 749  X 692  X 689  631 632  630 629  571 X  570 569  511 512  510 509  r28  993  988  933  X  X  868  X  808  753  748  693  X  633  628  573  568  X  508  r27  994  987  934  927  874  867  814  807  754  747  694  687  634  627  574  567  514  507  995  986  935  926  X  866  X  X  X  X  695  686  635  626  X  X  515  506  996 997  985 984  X 937  925 924  876 877  865 864  X 817  805 804  756 757  745 744  696 697  685 684  636 637  X 624  576 577  565 564  516 517  505 X  1176 1133 1126 1083 1076 1033  998  983  938  923  878  863  818  803  758  743  698  683  638  623  578  X  518  503  1374 1367 1326 1319 1278 1271 1230 1223 1182 1175 1134 1125 1084 1075 1034  r30 r29  rep 2  1130 1129  rep 3  r26 r25  1514 1467 1466  r24  1513 1468 1465 1420  r23  1512  X  1418 1371 1370 1323 1322 1275 X  X  X  1324 1321  1421 1416 1373 1368 1325  1470 1463 1422  1227  X  1079  X  X  1179 1178 1131 1128 1081 1078 1031 1273 1228 1225 1180 1177 1132 X 1082 1077 1032  1277 1272 1229 1224  X  999  982  939  922  879  862  819  802  759  742  699  682  639  622  579  562  519  502  1510 1471 1462 1423 1414 1375 1366 1327 1318 1279 1270 1231 1222 1183  X  1135 1124 1085 1074 1035  X  981  940  921  880  861  820  801  760  741  700  681  640  621  580  561  520  501  r20  1509 1472 1461 1424 1413  X  1136 1123 1086 1073 1036  1001  980  X  920  881  860  821  800  761  740  701  680  X  620  581  560  521  500  r19 r18  1508 1473 X X X 1377 1364 1329 1316 1281 1268 1233 X X 1172 1137 1122 1507 1474 1459 1426 1411 1378 1363 1330 X 1282 1267 X 1219 1186 1171 1138 1121  1072 X 1029 X X 1038 X 1003  X 978  942 943  919 918  882 883  X 858  822 823  799 798  762 X  X 738  702 703  679 678  642 X  619 618  582 583  X X  522 523  X X  r17  1506 1475 1458 1427 1410 1379 1362 1331 1314 1283  r16  1505 1476 1457 1428 1409 1380  r15 r14  1504 1503  r13  1502 1479 1454 1431  r12  1501 1480 1453 1432 1405 1384 1357 1336 1309 1288 1261 1240 1213 1192 1165 1144 1115 1094 1065 1044  r11  1500 1481  r10  1499 1482  Spur Road  X X  X  X  X  X  r21  r22  X  X  X  X  1365 1328 1317 1280 1269 1232  X  X  X  1184  1235 1218 1187  X  1139  1332 1313 1284 1265 1236 1217 1188  X  X  X  X X  1089 1070 1039 1027 1004  1119 1090 1069 1040 1026  1456 1429 1408 X 1360 1333 1312 1285 1264 1237 1216 1189 1168 1141 1118 1091 1068 1041 X 1430 X 1382 1359 X X 1286 1263 1238 1215 1190 1167 1142 X 1092 X 1042 X  1383  X  X  X  1287 1262 1239 1214 1191 1166 1143 1116 1093 1066  X  1433 1404 1385 1356 1337 1308 1289  X  1241 1212 1193 1164 1145 1114 1095 1064  X  1434 1403 1386 1355 1338 1307 1290 1259 1242 1211 1194 1163 1146  X  944  917  884  857  824  797  764  737  704  677  644  617  584  557  524  497  976  X  916  X  856  X  796  765  736  705  676  645  616  585  556  X  X  1006  975  946  X  886  855  X  X  X  735  706  675  646  615  586  555  526  495  1007  974  X  X  X  854  827  794  X  X  X  674  647  614  587  554  527  494  X  973  948  913  888  853  828  793  768  733  X  673  648  613  588  553  528  493  X  972  949  912  889  852  829  X  X  732  709  672  649  612  X  552  529  X  1010  971  950  911  890  851  830  791  770  X  X  X  X  X  590  X  530  491  1096 1063 1046  1011  970  951  910  X  850  831  790  771  730  711  670  651  610  591  550  531  490  1402 1387 1354 1339  X  1291 1258 1243 1210 1195 1162 1147 1112 1097 1062 1047  1012  969  952  909  892  849  832  789  772  729  X  669  652  609  592  549  532  489  r8  X  1484 1449 1436 1401 1388 1353 1340  X  1292 1257 1244 1209 1196 1161 1148 1111 1098 1061 1048  1013  968  953  908  893  848  833  788  773  X  713  668  653  X  593  548  533  488  r7  X  1485 1448 1437 1400 1389 1352 1341 1304 1293 1256 1245 1208 1197 1160 1149 1110 1099 1060 1049  1014  967  954  907  894  X  X  787  774  727  714  667  654  607  594  547  534  487  r9  X  X  1450  X  X  X  r6  1495 1486  1015  966  955  906  X  846  835  786  775  726  715  666  655  X  X  546  535  486  r5 r4  X 1016 1494 1487 1446 1439 1398 1391 1350 1343 1302 X 1254 1247 X 1199 1158 1151 1108 1101 1058 1051 1493 1488 1445 1440 1397 1392 1349 1344 1301 1296 X 1248 1205 1200 1157 1152 1107 1102 1057 X 1024 1017  965 964  X 957  905 904  896 897  845 844  836 837  785 784  776 X  X 724  716 717  665 664  656 X  605 604  596 X  545 544  536 X  485 X  r3  1492 1489 1444  1053 1023 1018  963  958  903  898  843  838  783  778  723  718  663  658  603  598  543  X  483  r2  1491 1490 1443 1442 1395 1394 1347 1346 1299 1298 1251 1250 1203 1202 1155 1154 1105  1055 1054 1022 1019  962  959  902  899  842  839  782  779  722  719  662  659  602  599  542  X  482  1021 1020  961  960  901  900  841  840  781  780  721  720  661  660  601  X  541  X  481  c33  c32  c31  c30  c29  c28  c27  c26  c25  c24  c23  c22  c21  c20  c19  c18  c17  X  1399 1390  X  1342 1303  1396 1393 1348 1345  r1  X  X  1297  X  X  X  X  X  X  1246 1207 1198 1159 1150 1109 1100 1059 1050  1249 1204 1201 1156 1153 1106 1103 X  X  rep 3 c55  c54  c53  c52  c51  c50  c49  c48  c47  c46  c45  c44  c43  c42  c41  c40  c39  c38  c37  c36  c35  c34  rep 1  Provenance Trial EP.1123.02.05  EP.1123.02.05  er  Kilby - Harrison Mills Ct  Fraser River rep 6 c1  c2  c3  c4  c5  c6  c7  c8  c9  c10  r37 X  r36  1663 1734 1735 1808  Spur Road  X  X  X  2528  2500  X  X  2527 2536  r32  1658  2526 2537  X  36  25  c1  451 452  450 449  391 392  390 389  331 332  330 329  271 272  270 X  211 X  210 209  151 152  150 149  91 92  90 89  31 32  30 29  453  448  393  388  X  328  273  268  213  208  X  X  93  88  33  X  X  X  387  334  327  274  X  214  207  X  X  94  X  X  455  446  395  386  335  326  275  266  215  206  155  146  95  X  456  445  396  385  336  325  276  265  216  205  X  145  96  85  1811  1730 1739 1804 1813 1878  26  c2  X  X X  X X  1952 1963 2026 2037  X  X  X  X  X  1877 1890 1951 1964 2025 2038  X  2502  X  2520  X  1876  X  1595  X  1651 1674 1723 1746 1797 1820 1871 1896 1945 1970 2019  X  r25  r24 1538 r23 1537  X  X  X  1650 1675 1722 1747  X  r24  X  r23  384  337  324  277  264  217  204  157  144  97  84  X  X  r24  X  338  323  278  263  X  X  158  143  98  X  X  23  r23  459  442  399  382  X  322  279  X  219  202  X  142  99  X  39  22  r22  X  1593 1604  X  1676 1721  X  X  X  1870 1897 1944 1971 2018  1795 1822 1869 1898  X  1972  X  X  X  2014 2049 2088 2093  r20  1976 2013 2050 2087 2094  r19  1681 1716 1753 1790 1827 1864 1903 1938 1977 2012 2051 2086 2095  r18  X  441  400  381  340  321  280  261  220  201  X  X  X  81  40  21  X  401  380  341  320  281  260  221  200  X  X  X  X  X  20  r20  r20 1534  X  439  402  X  342  319  282  259  222  199  X  X  102  79  42  19  r19  r19 1533 1552 1589  X  X  X  X  343  X  283  X  223  X  163  X  X  78  43  18  r18  r18  464  X  404  377  344  317  284  257  224  197  164  X  104  77  44  X  r17  r17 1531 1554  X  X  405  376  345  316  285  X  225  196  X  136  105  76  45  16  r16  r16  X  435  406  375  346  315  286  255  226  195  166  135  106  75  46  15  r15  r15 1529 1556 1585 1612 1641 1684 1713 1756 1787 1830  467  434  407  374  347  314  287  254  X  194  167  134  107  74  47  14  r14  r14 1528  X X  X  X  1590 1607 1646 1679 1718 1751 X  1553 1588 1609  X  1645 X  1610 1643 1682  1555 1586 1611 1642 X  X  X  1717  X  X  X  1825 1866  X  1940  1791 1826 1865  X  X  1754 1789 1828 1863  1714 1755 1788 1829 1862 1905  1584 1613 1640 1685 1712 1757 1786  1558 1583 1614  X  X  X  X  X  1937 1978 2011 2052 2085 2096 X  1979 2010  X  X  X X 2540  r26  r22  461  X  X  r27  r22 1536 1549 1592 1605 X 1677 X 1749 1794 X 1868 1899 X 1973 2016 2047 2090 2091 X 1606 1647 1678 1719 1750 1793 1824 X 1900 1941 1974 2015 2048 X 2092 r21 1535 1550  r21  X  2488 2503 2506 2521 2524  X  398  r21  rep 5  r17  2084 2097 2128  X  2160 2161  1906 1935 1980 2009 2054 2083 2098 2127 2130 2159 2162  1860 1907 1934 1981 2008  X  2082  X  2126 2131 2158 2163  1686 1711 1758 1785 1832 1859 1908 1933 1982 2007  X  2081  X  2125 2132 2157  X  288  253  228  193  168  133  108  73  48  13  r13  r13  X  X  252  229  192  169  132  109  72  49  12  r12  1710 1759 1784 1833 1858  X  1932 1983 2006 2057 2080 2101 2124 2133  290  251  230  X  170  131  110  71  50  11  r11  r12 1526 1559 1582 1615 1638 X 1560 1581 1616 1637 r11  X  311  X  1709  X  X  1931 1984 2005 2058 2079 2102 2123 2134 2155 2166  291  250  231  190  X  130  111  70  51  10  r10  r10 1524 1561 1580 1617 1636 X 1562 1579 1618 1635 r9  X  X  468  433  408  373  348  469  432  409  372  349  470  431  410  X  350  471  430  411  370  351  310  313  X  369  X  309  292  X  X  189  X  129  112  X  52  9  428  X  368  353  308  293  X  414  367  354  307  294  X  X  188  173  X  113  68  53  8  r8  X  234  187  X  X  114  67  54  7  r7  X  X  X  X  X  295  X  235  186  175  126  115  66  55  X  r6  r9  476  425  X  365  356  305  X  245  236  185  176  X  116  65  56  X  r5  X  424  X  364  357  304  297  X  237  184  177  124  117  X  57  4  r4  478  X  418  363  X  303  X  243  238  183  X  123  118  63  58  X  r3  479  X  419  362  X  302  299  X  239  182  X  122  X  X  59  2  r2  480  421  420  361  360  301  X  241  X  181  180  121  120  61  60  1  c16  c15  c14  c13  c12  c11  c10  c9  c8  c7  c6  c5  c4  c3  c2  c1  r1  Spur Road  475  2024  r25 1539  397  474  X  r25  443  473  1950  r26  444  429  X  1816 1875 1892 1949 1966 2023 2040 2487 r28  458  X  X  X 1543 1598 1599 1654 1671 1726 1743 1800 1817 1874 1893 1948 1967 X 2041 X 1597 1600 1653 1672 1725 X 1799 X 1873 X 1947 X X 2042 r27 1541 X 1596 1601 1652 1673 X 1745 1798 1819 1872 X 1946 X 2020 X r26 1540  457  c22  X  35  c3  c21  2531 2532  X  r28  c4  X  X  X  r27  c5  c20  X  X  1737  r28  c6  c19  1887 1954 1961 2028  X  27  c7  c18  X  X  28  c8  c17  1659 1666 1731 1738 1805 1812 1879 1888 1953 1962 2027  1655 1670  c9  c16  2032 2495 2496  1660  1656 1669 1728 1741 1802  c10  X  r33  r29  c11  X  r34  r30  c12  c15  1957  1885 1956 X 2030 2033 2494 2497 X 2515 2530 2533 X 1955 1960 2029 X 2493 2498 2511 X 2529 X  r29  c13  c14  X  X X  r30  c14  c13  1883 1661 1664 1733 1736 1807 1810  r31  c15  c12  r35  1657 1668 1729  c16  X  c11  1783 1834 1857  1761  X  X  1707 1762  X  1835 1856 1911 X  1855 1912 1929  X  X  X  X  X  X  1522 1563 1578  X  1634  X  1706 1763  1854 1913 1928  X  2002 2061  r7  1521 1564 1577  X  X  X  1705 1764 1779 1838 1853 1914 1927  X  2001  r6  1520 1565 1576 1621 1632  X  1704 1765 1778 1839 1852 1915 1926 1989  X  1703  X  1777 1840  r4  1518 1567 1574 1623 1630 1695 1702  X  1776 1841 1850 1917 1924  r3  1517  X  1573 1624 1629  X  1775 1842  r2  1516  X  1572 1625 1628 1697  r1  X  X  X  X  c1  c2  c3  c4  r5  1566 1575  X  1631  X  1627 1698 c5  c6  1701 X  1769 1774 1843  X  1770  X  X  c7  c8  c9  c10  X  X X  c11  X  X  X  X  X  X  X  1918 1923 1992 X  c12 rep 4  1922 1993 X c13  2121 2136 2153 2137  X  2169  X  2170  X  X  2063 2074  X  1998 2065 2072  X  X 2118  X  X  X  2149 2172  2116 2141 2148  X  X  2066  X  2110 2115 2142 2147 2174  X  2067  X  2111  X  X  1994 1995 2068 2069 2112 2113 2144 c14  X  2075 2106 2119 2138  1916 1925 1990 1999 2064 2073 2108  1847 1920  2165  1985 2004 2059 2078 2103 2122 2135 2154 2167  r8  X  X  c15  c16  c17  c18  c19  c20  X  X  X  X  c21  c22  Provenance Trial EP.1123.02.05  Fraser River  Fraser River rep 7  c23 X  c24  c25  c26  c27  c29  2550 2567 2568 2585 2586 2603  2548 2551 2566 X  X  X  2570  X  2547  X  2546  X  2545  X  X  2572  2544  X  X  X  X  X  X  2574  X  X  c30 X  2602 2605  c31  c32  c33  X  2559  X  c35  c36  c37  X  2623 2638  X  2656  X  2674  c38  X  2580 2591 2598 2609 2616  X  2592 2597 2610 X  2596  X  X 2614  X  X X  2654 2661 X  X  c39  c40  c41  c42  c43  2692 2695 2710 2713  X  X  X  X  X  2662 2671 2680 2689  X  2726 2733  X  c53  c54  X  X  X  2817  X  X  X  X  c55  c56  X  X  X  2862  X  X  2765  X  2789  X  2813 2820  X  2844  X  X  2885  2707 2716 2725 2734 2743 2752 2764  X  X  2797 2812 2821  X  X  2860  X  X  X  X  2859 2870 2883 2894  2682  X  X  2705 2718  X  X  X  2704 2719  X  X  2703  X  X  2724 2735  X  X  X  2753  X  2774  X  X  X  2822  X  2754  X  X  X  X  X  X  2834 2847  X  X  X  X  X  2833 2848 2857  2737 2740 2755 2761 X  X  X  X  2777 2784 2801 2808  X  X  X  2866 2887  2871 X  2192 2193 2224 2225 2256 2257 2288 2289 2320 2321 X  2222 2227 2254  X  2189  X  2221 2228 2253 2260  X  X  X  2287 2290 2319 2322 2351 2354 2383  r16 r15  X  2291 2318 2323 2350 2355 2382  r14  X  2292 2317 2324 2349 2356 2381  r13  2188 2197 2220 2229 2252 2261 2284 2293 2316 2325 2348 2357 2380  r12  X  2198 2219 2230 2251 2262 2283 2294 2315 2326 2347 2358  X  2199 2218 2231  2185 2200 2217  X  X  X  X  r11  2263 2282 2295  X  2249 2264 2281 2296  X  2328 2345 2360 2377 2386 2403 2406 2423 2426 2443 2446 2463 2466  X  2346 2359 2378 2385 2404 2405 2424  r9  2329 2344 2361  X  r8  2184 2201 2216 2233 2248 2265 2280  X  X  2183 2202 2215 2234 2247  X  2311  X  2343  2182 2203 2214 2235 2246 2267 2278 2299 2310  X  2342 2363 2374 2389 2400  X  2204 2213 2236  X  X X  X  2277 2300 2309 2332  X  2180 2205 2212 2237 2244 2269 2276 2301 2308  X  X  2179 2206  X  2339  X  X X 2210 2177 2208 2209 c23  c24  c25  X  2243 2270 2275  X  X  X X  X X 2274 2241 2272 2273  X X  X X  c30  c31  c26  c27  c28  c29  X  c60  c61  c62  c63  X  2936  X  X  X  X  2914  X  X  X  X  X  X  2934  X  2958  X  2909  X  2933  X  2957  X  X  X X  2893 2908 2917  X  X  2918  X  X  2906  X  2930  X  X  X  X  2953  2881 2896 2905 2920  2849 2856 2873 2880 2897 2904  X  2804  X  2828 2829 2852 2853 2876 rep 7  2190  c59  X  X  X 2778 2783 2802 2807 X 2831 2850 X 2874 X 2898 2903 2922 2927 2758 2779 X 2803 X 2827 2830 2851 2854 2875 2878 2899 2902 2923 2926 2757 2780  X  c58  X  rep 6  2191 2194 2223 2226 2255  c57  2864 2865 2888 2889 2912  X  X  2684 2685  c52  2814 2819  X  2750 2766  c51  X  2688 2699 2706  2749 2767 2770  X  c50 X  X  X  2732  c49 X  X  2731  X  X  X  2768 2769  X  2650 2665 2668 2683 2666  c48  2790  2714  2628 2633 2646 2651 X  c47  X  X  X  2577 2594 2595 2612 2613 2630 2631 2648  X  X  X  X  c46  X  X  2632  c45  2693 2694 2711 2712 2729 2730  2634 2645 2652  X  c44  X  2588 2601 2606 2619 2624 2637 2642 2655 2660 2673 2678 2590 2599 2608 2617  X  c34  2621 2622 2639 2640 2657 2658 2675  2564 2571 2582 2589 2600 2607 2618 2625 2636  2542 2557 2560 2575 2578 2541  c28  X  X  2407  X  2387  X  2388 2401 2408 2421 2428  2444 2445 2464 2465 2484  2427 2442 2447 2462 X  X  2448 2461 2468 2481  r6  X  2479  r5  2365 2372 2391 2398 2411 2418 2431 2438 2451 2458 2471 2478  r4  X  2371 2392  X  X  2430 2439 2450 2459  2412 2417 2432 2437 2452 2457 2472 2477  X X X 2370 2393 2396 2413 2416 2433 2436 X 2456 X 2336 2337 2368 X 2394 2395 2414 X 2434 2435 2454 2455 2474 c32  c33  r7  2480  2373 2390 2399 2410  2420 2429 2440 2449 2460  r10  X  X  X  X  X  c34  c35  c36  c37  c38  c39  c40  c41  c42  c43  c44  X X c45  rep 4  r3 X  r2  2486 r1 c46  X  2900  X  2945 2952 X X  X X  2924 2925 2948 2949  Provenance Trial EP.1123.02.05  Fraser River rep 8 c64  c65  c66  c67  c68  c69  c70  c71  c72  c73  c74  c75  c76  c77  c78  c79  c80  c81  c82  c83  c84  c85  c86  c87  c88  c89  X  X  X  X  X  3032  X  X  X  X  X  3104  X  X  X  X  X  3176  X  X  X  3224  X  X  X  X  r37  X  X  X  X  X  X  3058  X  X  X  X  X  X  X  X  X  X  X  3202  X  X  3247  X  X  r36  X  X  2987  X  X  3030  X  X  X  X  X  X  X  X  X  X  3155  X  X  X  X  X  X  X  X  X  r35  X  X  X  X  3012  X  3036  X  X  X  X  X  X  X  X  X  X  X  X  X  3228  X  X  X  r34  X  X  2989  X  X  X  3037 3052  X  3076  X  X  X  X  X  X  3181  X  3205  X  3229 3244  X  X  r33  X  X  2990  X  X  X  X  X  X  3075  X  X  X  X  X  3195  X  X  3230  3254  X  r32  X  X  X  X  3015  X  X  3050  X  X  3087  X  X  X  3135  X  X  3170  X  3194 3207  X  3231 3242  X  X  X  3001 3016  X  X  X  X  X  X  X  X  X  X  X  X  3169  X  X  X  2976  X  3000 3017 3024 3041  X  3065  X  X  3096  X  X  X  X  3161 3168  X  X  X  2975 2994 2999  X  3162  X  3191 3210  X  3190  X  3214 3235  X  3165 3188 3189  X  3213 3236  X  3007 3010  3110 3123 3134 3147  3023  X  X  3066  X  X  X  2971 2974 2995 2998 3019  X  3043  X  X  X  X  X  3115 3118 3139 3142 3163 3166  2972  X  3044  X  X  3116 3117  X  X  3100 3109  2996 2997 3020  3068 3069 3092  X  3119 3138 X  3141  X rep 8  X  3197 3204  X  X  X  r31  3217  X  X  X  r30  3209 3216  X  X  X  r29  X  r28  X  r27  3260  r26  X  3234 3239  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.52966.1-0075629/manifest

Comment

Related Items