Open Collections

UBC Undergraduate Research

The Susceptibility of Populus trichocarpa Provenances in the Pacific Northwest to Septoria musiva and.. Fung, Jason Chun-Yin 2012-04-30

You don't seem to have a PDF reader installed, try download the pdf

Item Metadata

Download

Media
Fung_Jason_FRST_498_Graduating_Thesis_2012.pdf [ 2.34MB ]
[if-you-see-this-DO-NOT-CLICK]
Metadata
JSON: 1.0075629.json
JSON-LD: 1.0075629+ld.json
RDF/XML (Pretty): 1.0075629.xml
RDF/JSON: 1.0075629+rdf.json
Turtle: 1.0075629+rdf-turtle.txt
N-Triples: 1.0075629+rdf-ntriples.txt
Original Record: 1.0075629 +original-record.json
Full Text
1.0075629.txt
Citation
1.0075629.ris

Full Text

     The Susceptibility of Populus trichocarpa Provenances  in the Pacific Northwest to Septoria musiva and Septoria populicola  by Jason Chun-Yin Fung   A THESIS SUBMITTED IN PARTIAL FULFILLMENT  OF THE REQUIREMENTS FOR THE DEGREE OF   BACHELOR OF SCIENCE IN FOREST SCIENCES,  GENETICS CONCENTRATION  in  THE FACULTY OF FORESTRY  THE UNIVERSITY OF BRITISH COLUMBIA  (VANCOUVER)   April 2012 © Jason Chun-Yin Fung, 2012     Contents Abstract........................................................................................................................................... 2 Introduction .................................................................................................................................... 3 Methods and Materials .................................................................................................................. 5 Description of the Plantation ...................................................................................................... 5 Figure 1 – map of P. trichocarpa provenances across the pacific northwest .......................... 6 Septoria spp. Identification ......................................................................................................... 7 Figure 2 – photographs of Septoria spp. leaf spots and S.musiva cankers ............................. 7 Leaf Sample Collection ................................................................................................................ 8 Leaf Spot Extraction .................................................................................................................... 8 DNA Extraction ............................................................................................................................ 9 Real-time Polymerase Chain Reaction (RT-PCR) ....................................................................... 10 Table 1 – Septoria spp. specific primers and probes ............................................................. 10 Statistical Analysis .................................................................................................................... 11 Table 2 – Summary of Septoria spp. infection proportions in 2010 and 2011 ...................... 12 Results ........................................................................................................................................... 12 Results Overview ....................................................................................................................... 12 Table 3 – Summary of Septoria infected trees by geographical region in 2010 and 2011 ... 13 Table 4 – Septoria musiva infected trees in 2011 .................................................................. 14 Septoria musiva and Septoria populicola infection in 2010 ...................................................... 14 Septoria musiva and Septoria populicola infection in 2011 ...................................................... 15 Septoria spp. infection in 2010 vs. 2011 .................................................................................... 16 Discussion ..................................................................................................................................... 17 Sampling in 2010 vs. 2011- Methods and Protocol Differences................................................ 17 Septoria spp. infected trees in 2011 .......................................................................................... 19 Z-test Results Interpretation ..................................................................................................... 21 Experimental Improvements and Future Research ................................................................... 24 Acknowledgements ...................................................................................................................... 24 Literature Cited............................................................................................................................. 25 Appendices ................................................................................................................................... 27    Abstract   A Populus trichocarpa provenance trial in Harrison Mills had tested positive in 2009 and 2010 for Septoria musiva, a pathogen that reduces the photosynthetic activity of its host through necrotic spots on the leaf surface and has the potential to girdle and kill the host through cankers that develop on the branches and main stem. A closely related pathogen, Septoria populicola, has also been reported in the provenance trial; this particular pathogen is native to British Columbia and causes only non-lethal minor leaf lesions, but is impossible to distinguish from Septoria musiva without conducting DNA-based analyses. This study is aimed to assess the frequency of S. musiva and S. populicola infections on provenances of P. trichocarpa to determine if there is a pattern of differential susceptibility. The provenances of the P. trichocarpa extend from Alaska, through British Columbia and down into Oregon; these were grouped into two categories: a North and South population. The proportions of Septoria musiva and Septoria populicola infections were compared between the north and south populations to determine if there is a difference in infection proportions between the regions. The north and south proportions were also compared between 2010 and 2011.  Although the number of infections were always higher in northern than in southern provenances, no significant differences were found between northern and southern infection proportions for Septoria musiva or Septoria populicola in 2010 or 2011. A comparison between regional infections in 2010 and 2011 was also not significantly different from one another for Septoria musiva. Although no significant differences was observed in the infection proportions of Septoria populicola between the southern populations over 2010 and 2011, a significant difference was observed in the infection proportions between northern regions in 2010 and 2011.    Keywords: Septoria musiva, Septoria populicola, Populus trichocarpa, black cottonwood, Mycosphaerella populorum,  Mycosphaerella populicola    Introduction Poplars are integral in Canada due to their vast abundance and potential in the country’s forest industry; in addition, poplars have several desirable biological characteristics such as rapid, indeterminate growth, hybridization characteristics that make them ideal for culturing (Feau, Mottet, Perinet, Hamelin, & Bernier, 2010). As the demand for energy increases, and the limits of the fossil fuel economy projected to peak within the next several decades, the demand for renewable energy is rapidly increasing (McPhail, Cigolotti, & Moreno, 2012).  Black cottonwood (Populus trichocarpa Torr. & A. Gray) is native to British Columbia and is also distributed along the northwestern coast of North America from California to Alaska; the poplar embodies all the characteristics that make them ideal for cultivation. In BC, black cottonwood has already been utilized for lumber harvest, pulping and riparian restoration; its role in the future biofuel endeavors is also met with high expectations. As such, several plantations across the province have been cultivating the tree for the economical applications listed.  As with all other poplars, P. trichocarpa is host to many diseases and other biotic stress factors, especially in areas of intensive culturing, as the selection of cottonwood by breeders if often placed on wood quality and growth characteristics (Ostry & Mcnabb Jr., Susceptibility of Populus species and hybrids to disease in the North central United States, 1985). Two such diseases include Septoria musiva Peck. (telomorph: Mycosphaerella populorum Thomps.) and Septoria populicola (telomorph: Mycosphaerella populicola). Septoria populicola is native to British Columbia, while Septoria musiva has historically been localized in eastern North America    (Ostry, 1987; Krupinsky, 1989). The injury symptoms of the two pathogens are indentical in which they cause circular, necrotic spots on the foliage, which leads to reduced photosynethic leaf area, as well as  premature scenscence of leaves (Bier, 1939). However, a key difference in the injury symptoms is that S. musiva has been associated with canker development in the main stem and branches, which can potentially girdle and kill the tree (Bier, 1939; Ostry, 1987; Newcombe & Ostry, 2001; Callan, Leal, Foord, Dennis, & van Oosten, 2007; Feau, Mottet, Perinet, Hamelin, & Bernier, 2010). The canker causing ability of S. musiva has is detrimental and can lead to plantation failure (Bier, 1939; Ostry, 1987). S. musiva, despite being native to eastern Canada, has recently been reported and isolated from several poplar plantations within Fraser Valley, British Columbia (Callan, Leal, Foord, Dennis, & van Oosten, 2007); as P. trichocarpa has never been exposed to S. musiva in western Canada, the pathogen’s establishment in the province could be detrimental to local P. trichocarpa populations.  A black cottonwood plantation comprised of P. trichocarpa from 35 different drainages was established in Harrison Mills, BC in 2007. Several trees in that plantation have tested positive for S. musiva and S. populicola. Currently, the S. musiva disease outbreak is localized within the plantation and black cottonwood adjacent to the plantation has not shown any symptoms of infection. As the two pathogens are morphologically identical with overlapping characteristics, and have injury symptoms that are virtually indistinguishable, the two pathogens must be identified and distinguished at the genetic level through the use of ITS (Internal Transcribed Spacer) primers developed by Feau et al. (2005).  The threat of S. musiva has now reached the Pacific Northwest; it is important to determine if there are patterns in the P. trichocarpa provenances in their susceptibility to the    two pathogens and whether or not some provenances display less susceptibility. A field study was conducted at the plantation in Harrison Mills with the objective to determine if any P. trichocarpa within the plantation exhibit any resistance to S. musiva and S. populicola; the plantation had been sampled by Beauseigle et al. (2010) many elements of this study have been drawn on their work with various changes to sampling methodology, laboratory protocol, and statistical analyses. This study divides the 7 geographical regions delineated by Beauseigle et al. 2010 into a northern and southern population and uses a subsample of 306 trees out of over 3000 trees within the plantation to gain a coarse scale analyses.  Methods and Materials Description of the Plantation  Established in 2007, provenance trial EP1123.02 is a Populus trichocarpa plantation located in the Fraser Valley at Harrison Mills, B.C. (49o 13’42.00 N, 121o54’51.30). It is comprised of 516 clones from 35 different drainage regions and distributed within the plantation in a randomized complete block design; each individual tree plot had a spacing of approximately 2.5m x 2.5m. Eight repetitions for each block was planted with each clone is represented 4-8 times within the block, depending on the availability of clonal material. Fertilizers were not applied to the plantation.      Figure 1 – A map of the origins of each P. trichocarpa within the plantation at Harrison Mills. Obtained from Dr. Harry H. Kope, Forest Practices and Investment Branch, British Columbia, Ministry of Forests, Lands, and Natural Resource Operations, Victoria, British Columbia)    Septoria spp. Identification   Identification of leaf spots that were potential Septoria spp. lesions was based on characterization in literature (Bier, 1939; Ostry & Mcnabb, 1985; Sinclair and Lyon, 2005). Lesions on the leaves are generally localized in the lower branches and are characterized as circular necrotic spots that are black in colour. Pycnidia can sometimes be seen within the center of the lesions. Cankers are also characterized as dark, necrotic protrusions from the stem or branches. The figures below illustrate features that are generally associated with Septoria musiva and Septoria populicola; cankers in the figures belong exclusively to Septoria musiva:                   Figure 2 – (On left) Photograph of P. trichocarpa that has been infected with multiple Septoria musiva cankers around the stem (Photograph by Fung, 2012). (On top right) Example of Septoria musiva leaf spots on hybrid poplar (Photograph from Sinclair & Lyon, 2005). (On bottom right) Juvenile tree showing symptoms of Septoria spp. leaf spot injury. (Photograph from Ostry et al., 1989)    Leaf Sample Collection Each tree was screened for leaf spots originating from the lower branches that resembled S. musiva or S. populicola; 3-5 leaves with Septoria-like leaf spots were collected from each individual, with each leaf originating from a different side of the tree. Leaves containing Septoria and other foliage diseases which had been found in Beauseigle et al. 2010, were omitted to avoid contamination of other leaf samples and complications during the DNA amplification. The collected leaves were placed in a brown paper lunch bag and stored in 4oC while awaiting leaf spot extraction. Trees were also inspected for branch or stem cankers that resemble S. musiva infection symptoms. Cankers were also collected to extract S. musiva isolates, which would support the samples identified in the leaves. However, the cankers, although extracted for S. musiva isolates, were not cross-referenced in this study.   Leaf Spot Extraction The leaf spot extraction protocol from Beauseigle et al. 2010 was modified from selecting one leaf of the three leaves and selecting a single leaf spot from the leaf to extracting three leaf spots per leaf for each of the leaves collected from the plantation and pooling the spots into a microcentrifuge tube. The leaf spots were excised using a cork borer due to its circular shape, which allowed a more accurate excision while reducing the amount of uninfected plant tissue. All extraction tools were sterilized under a flame torch and 100% ethanol after each sample was processed to avoid cross sample contamination.      DNA Extraction For each sample, 3-5 leaf spots were selected from and pooled into a new microcentrifuge tube for DNA extraction; this was another change from the protocol used by Beauseigle et al. 2010, where several leaf spots are pooled together for DNA extraction, as opposed to one leaf spot selected from the sample. Several DNA pooling experiments were conducted by spiking S. musiva DNA from petri dish cultures with plant and S. populicola DNA to determine the maximum number of leaf spots that could be pooled with distinctively observable S. musiva readings. This pooling of several leaf spots from one individual tree increases the chance of detecting S. musiva by obtaining a broader representation of all the leaf spots on an infected tree.  Metal beads were added to each microcentrifuge tubes and submerged in liquid nitrogen to weaken the cell membranes and allow the extraction of high quality DNA required for the real-time PCR. The microcentrifuge tubes were then placed in a mechanical shaker and ground up into a fine powder. The DNA from the grounded leaf spot samples were then extracted using the DNeasy Plant Mini Kit from Qiagen Company); the protocol (http://www.qiagen.com/literature/render.aspx?id=201167) enclosed with the extraction kit was used with the following amendments:  11.  Add 100μl autoclaved water for elution. Incubate for 5 min at room temperature (15–25°C). Centrifuge for 1 min at ≥6000 x g.     12.  Repeat step 11 - this step was omitted from the extraction protocol.    Extracted DNA samples were then stored in -20oC conditions until the RT-PCR is conducted.      Real-time Polymerase Chain Reaction (RT-PCR) The efficacy of real-time polymerase chain reaction (RT-PCR) has seen a high degree of success in fungal pathogen detection (Gottsberger, 2010; Qu, Wanner, & Christ, 2011; Schaad, et al., 2003; Callan, Leal, Foord, Dennis, & van Oosten, 2007). RT-PCR also allows for a large number of samples to be processed with the possibility of a quantitative analysis DNA within each sample. The ITS sequence showed distinct polymorphisms between S. musiva and S. populicola (Feau, Weiland, Stanosz, & Bernier, 2005), and as such, ITS was targeted using sequence specific oligonucleotides and probes were used to amplify the region. Such methods were also used in Beauseigle, et al. (2010) to detect and differentiate between S. musiva and S. populicola DNA. An RT-PCR procedure based on the TaqMan probe was used; the primers and probes used is summarized below: Table 1 - Summary of S. musiva and S. populicola primers and probes used in RT-PCR to detect and differentiate between the pathogens’ DNA. (Beauseigle, Feau, & Hamelin, 2010) Primer Name Specificity Sequence 5’-3’ Smus_SSU193F S. musiva CGGTATTTTCAGCCTGCAG Smus_SSU_288R S. musiva GCC GTT ATC CGT ACA ACT GA Smus_SSU243F_probe S. musiva AGGTAGATATTAGGACAATTGGTGTAAAGA TGAT Spopulicola_SSU193F S. populicola CGGTATTTTCAGCCTGCAC Spopulicola_SSU288R  S. populicola GCCGTTATCCGTACAACTAG Spopulicola_SSU243F_probe S. populicola AGGAAGATATTAGGACGATGGGTGTAAAGATGAAA  The primers and probes were designed based on the small subunit (SSU) gene using IDT Sci Tools Oligo Analyzer 3.1 software and were custom ordered from Biosearch Technologies (Novato, CA, USA).  The probe FAM-BHQ 1 was an oligonucleotide containing fluorescent dye 6- carboxyfluorescein (FAM) as a reporter at the 5’ end, and a non-fluorescent quencher dye at the 3’ end.     Real-time PCR reactions were performed in MicroAmp Optical 96-well plates using a Bio-rad CFX96TM thermal cycler system (Bio-Rad. Hercules, CA, USA). Each reaction contained 3.6µl of sample DNA, 10µl of 1X SsoFast probes supermix (Bio-Rad. Hercules, CA, USA), with 0.7µl of each forward and reverse primer, 5µl of probe for a total volume of 20µl. Each primer and probe was used at 350nM and 250nM final concentration, respectively. Each sample was duplicated on the same plate.  The thermal cycling parameters used were 2 min at 95oC for enzyme activation followed by 40 cycles of denaturation at 95oC for 5s and 5s of annealing/extension at 60oC. The threshold cycles (CT) were determined by plotting the relative fluorescence Units (RFU) against the cycle number. The results of the amplifications were analyzed using the CFX Manager software (version 1.0, Bio-Rad. Hercules, CA., USA).  Statistical Analysis Two-tailed Z-test comparisons of the difference between two proportions were conducted on the 2011 and 2010 dataset, using the formulae: (1.1)          ̂    ̂    ̂   ̂  (1.2)   ̂   ̂  √   ̂  ̂       ̂  ̂        The Z-test was set at an alpha level of 0.05, where the Z0.05 value = ±1.96; P-values for Z0.05 = 0.256. p = proportion of trees infected with a specific pathogen over the total number of trees uninfected by the pathogen; the pathogen could be Septoria musiva or Septoria populicola.   = number of uninfected trees/total number of trees in region. n1 and n2 are the total number of uninfected individuals, which includes samples that were positive for S. populicola and samples that were negative for both diseases. Using these formulae, the proportions of infected trees/uninfected trees from the Northern provenances were compared against the Southern populations for separately for both 2010 and 2011 datasets; a summary of the values used listed in the results section below: Table 2 – Summary of disease infection substituted into equations 1.1 and 1.2. The total number of trees uninfected by either Septoria musiva or Septoria populicola is excluded from this table.   2010 2011 North South North South S.musiva S. populicola S.musiva S. populicola S.musiva S. populicola S.musiva S. populicola # Infected 11 92 9 118 9 104 6 106 Total #(trees) 115 155 149 157 p 0.096 0.800 0.058 0.761 0.047 0.685 0.0385 0.679 q 0.904 0.200 0.942 0.239 0.953 0.315 0.962 0.321 Results Results Overview The 2010 data set was collected by Beauseigle et al. (2010) and is summarized below in table 3, along with the 2011 results. Beauseigle et al. (2010) had grouped the 35 regions into 7 locations; in this study, the 7 locations (Dease Lake, Far North, Midcoast, Prince George, Smithers, South Coast and USA) were divided into a Northern and Southern population. The    north consists of: Dease Lake, Far North, Midcoast, Prince George and Smithers, while the south is composed of South Coast and USA. The division of these two groups is illustrated in table 3 where the non-shaded regions represent the north, while the shaded cells represent the south. A total of 940 trees were sampled in 2010, but only 270 samples representing 100 families had been analyzed (Beauseigle et al. 2010).  In 2011, trees from all 8 repetitions were sampled from provenance trial EP1123.02, with a total sample size of over 3000 trees; however, a sub-sample of 306 trees were processed, with 149 samples from the north and 157 samples representing the south. A summary of the data collected in 2011 and 2010 are shown in table 3 below; the S. musiva infected trees in 2011 are summarized in table 4.  Table 3 - Summary of Septoria spp. infection from 2011 and 2010. The pink shaded rows are collectively the Northern region, while the blue shaded rows represent the Southern region. Trees that were positive for both Septoria species are not counted in the “S. musiva only” and “S. populicola only” columns.2010 data from Beauseigle et al. (2010) 2011 Area Number of  trees sampled S.musiva only S.populicola only S. musiva +  S. populicola Negative for Both Septoria spp. Dease Lake 7 2 3 0 2 Far North  3 0 3 0 0 Midcoast 40 0 31 2 7 Prince George 41 2 28 0 11 Smithers 58 1 35 0 22 South Coast 135 4 100 2 29 USA 22 0 4 0 18 Total  306 9 204 4 89 2010 Dease Lake 11 2 9 - 0 Far North  3 1 2 - 0 Midcoast 46 5 35 - 5 Prince George 22 1 17 - 4 Smithers 33 2 29 - 2 South Coast 136 7 101 - 28 USA 19 2 17 - 1 Total  270 20 210 - 40    Table 4 – Summary of trees that tested positive for S. musiva in 2011. The grey shaded rows indicate trees that were also positive for S. musiva infection in 2010. The green shaded rows indicate S. musiva infected trees in 2011 that were directly adjacent or in close proximity to S. musiva positive trees in 2010. Un-shaded rows indicate newly infected trees that are spatially segregated from S. musiva infected trees in 2010. The tree tag refers to the actual label of the tree within the plantation, while the tree number denotes the geographical origin and replicate number. Lat = Latitude, Long = Longitude, Elev = Elevation.  Tree Tag Tree Number Area Main Drainage Lat Long Elev Identification 311 A150-3 Dease Lake Bell-Irving 5644 12944 579 S.musiva 570 A150-3 Dease Lake Bell-Irving 5644 12944 579 S.musiva 1020 A56-3 Mid Coast Homathko 5117 12450 152 S.musiva and S.populicola 1249 A75-4 Mid Coast Dean 5249 12657 27 S.musiva and S.populicola 901 A165-7 Prince George McGregor 5411 12200 579 S.musiva 1398 A171-5 Prince George Nechako R. 5406 12426 655 S.musiva 618 A93-4 Smithers Kitimat 5409 12835 61 S.musiva 52 A7-5 South Coast Fraser R. 4924 12133 500 S.musiva 599 ATXD 15- 29 South Coast - - - - S.musiva 724 A25-3 South Coast EVIC 4957 12515 76 S.musiva 735 A23-2 South Coast EVIS 4914 12404 60 S.musiva and S.populicola 958 A17-3 South Coast EVIN 5013 12548 30 S.musiva 1212 ADTAC 7 South Coast - - - - S.musiva and S.populicola   Septoria musiva and Septoria populicola infection in 2010  The proportion of infected individuals in Beauseigle et al. (2010) was not divided between north and south populations, but rather a total number of infected individuals across the entire plantation. When divided into north and south, the north had 11 S.musiva infected individuals out of a 115 leaf samples (9.6%), while the south had 9 trees that tested positive for S.musiva out of 155 trees (5.8%). With S. populicola infected individuals, the north had 92 infected trees out of 115 (80.0%) and the south 118 out of 155 (76.1%) that tested positive. The number of trees infected with both diseases is unknown, as it was not reported in Beauseigle et    al. (2010). 40 trees tested negative for either Septoria species; however, it should be noted that these 40 individuals were not free of lesions, but simply did not test positive for either disease under the identification protocol.    Z-test comparison of proportions between the number of trees infected with S. musiva in the northern population was not significantly different from the number of individuals infected with S. musiva in southern populations [Two-tailed Z-test, Z0.05 = ±1.96 > Ztest =1.353; P- value = 0.256]. Similarly, the proportion of trees infected with S. populicola from the north was not significantly different from proportion of infected trees in the south [Two-tailed Z-test, Z0.05 = ±1.96 > Ztest =0.946; P-value = 0.256].  Septoria musiva and Septoria populicola infection in 2011 Analogous to the 2010 analyses, the 7 geographical regions from Beauseigle et al. 2010 were separated into a north and south population and tested for proportion of infected trees over the total number of trees. The samples analyzed in 2011 contained a total of 13 individuals infected with Septoria musiva out of 306 processed trees (4.2%). Septoria populicola had a higher disease incidence of 210 infected individuals out of 306. Of the infected individuals, 4 trees were positive for both Septoria musiva and Septoria populicola. 89 trees were negative for infection of either Septoria species on leafs with lesions on it.  As in 2010, the proportion of trees infected with S. musiva in the north was not significantly different from the proportion of trees infected with S. musiva in the south [Two- tailed Z-test, Z0.05 = ±1.96 > Ztest =0.499; P-value = 0.256]. The proportion of trees infected with    S. populicola in the north was also statistically the same as the proportion of S. populicola infected trees in the south. [Two-tailed Z-test, Z0.05 = ±1.96 > Ztest =0.237; P-value = 0.256].   Septoria spp. infection in 2010 vs. 2011 Trees 570, 901 and 1020 had tested positive in 2010 for S. musiva infection; these same three trees have once again tested positive for S. musiva in 2011. In addition, trees: 311, 736 and 1398 have tested positive in 2011 and are situated directly adjacent to trees (tree 310 735 and 1400 respectively) that had tested positive in the previous year. Generally, trees that tested positive for S. musiva in 2011 are in close proximity to trees that were positive for S. musiva in 2010. The exceptions to this are trees 618, 1212 and 1249, which are confirmed for S. musiva infection in 2011, but are spatially segregated from previously infected trees in 2010.  A Z-test comparison of proportions was also conducted to compare the proportion of infected of individuals in 2010 versus 2011 for each Septoria disease, with 2010 infection in the north compared with 2011 infection in the north. In 2010, 9.6% of the 115 samples from the north were infected with S. musiva, compared to the 4.7% of the 149 samples in 2011. However, the proportion of S. musiva infected trees in the north in 2011 did not statistically differ from the trees that were positive for S. musiva in 2010 [Two-tailed Z-test, Z0.05 = -1.96 < Ztest = -1.500; P-value = 0.256]. S. musiva infection was present in 3.8% of the 157 leaf samples from southern trees that were processed in 2011; however, this did not differ significantly from the 5.8% of S. musiva infection reported in the south in 2010 [Two-tailed Z-test, Z0.05 = -1.96 < Ztest = -0.739; P-value = 0.256].      76.1% of the 149 trees sampled from the southern population in 2010 were positive for S. populicola, compared to the 67.9% of the 157 trees southern trees in 2011; these proportions were not statistically different [Two-tailed Z-test, Z0.05 = -1.96 < Ztest = -1.660; P-value = 0.256]. However, the proportion of northern trees infected with S. populicola in 2010 (80.0%) did differ significantly from the proportion of infected individuals in 2011 (68.5%) [Two-tailed Z-test, Z0.05 = -1.96 > Ztest = -2.166; P-value = 0.256].  Discussion Sampling in 2010 vs. 2011- Methods and Protocol Differences Although nearly 3000 trees are present within the 8 repetitions at Harrison Mills, leaf samples and statistical analyses were only conducted on a subset of 306 trees located within repetitions 1-3. The purpose of analyzing a subsample of tree leaves is to detect any trends that could be observable at a coarse level scale and reduce the time and effort required to process over 3000 leaf spot samples. In addition, data from the previous year was available for repetitions 1-3 from Beauseigle et al. (2010); this allowed a temporal comparison of available data to detect any apparent trends in S. musiva and S. populicola infection within the plantation. Tree mortality was also a concern with respect to resampling trees from 2010, more specifically, the trees along the southern edge of replicates 2 and 3, where most of the trees had died, possibility due to maladaptation to the local environment. Trees such as tree 929, which was positive for a S. musiva canker in 2010 (Beauseigle et al. 2010), could not be resampled as it was one of the trees along the southeastern edge that had been removed. The 2010 data set from Beauseigle et al. (2010) also represented 100 families within the    provenance trial with a total sample size of 269 individual trees. In the 2011 data set, 107 families are represented over 306 tree samples; however, as the 2011 samples were randomly selected, there is no direct overlap between the families analyzed in 2010 versus those analyzed in 2011. The plantation contains families from 138 provenances; although not all of these families are represented in the 2011 data, a large proportion of the families are covered (107 out of 138). The time of sampling in 2011 was also slightly earlier in the year compared to the collection time of the 2010 dataset. The 2011 leaf samples, more specifically, replicates 1 – 3, were collected in August, while the samples collected by Beauseigle et al. (2010) were collected in the latter half of September. Initial lesions usually appear 3 – 4 weeks after bud burst (Feau, Mottet, Perinet, Hamelin, & Bernier, 2010), which would have been the optimal time to collect samples before other diseases propagate within the plantation. However, flooding from the adjacent river restricted the accessibility of the site and thus, leaf collection was delayed to August.   A key difference between the 2010 and the 2011 dataset is the protocol in the DNA extraction protocol. In Beauseigle et al. (2010), only 1 leaf spot from a single leaf was excised from the infected leaves and extracted. This method was changed to extracting 3 leaf spots from at least 3 leaves per tree, for a total of 9 leaf spots; from these leaf spots, 3-5 are randomly selected and pooled during the DNA extraction and RT-PCR. The detectability S. musiva and S. populicola using the pooled leaf spot protocol were tested using known isolates of S. populicola and S. musiva and the primers and probes from table 1. After several pooling and detection experiments, it was determined that 3-5 leaf spots was the optimal number to use. In addition, a portion of the samples in 2010 were processed using a modified Zolan and    Pukkila (1986) extraction protocol; although this protocol allowed more flexibility and controlling DNA purity, the DNA yield is lower than the DNeasy Plant Mini Kit extraction protocol (Beauseigle et al. 2010). The data set from 2011 also contained more than two times the samples that were negative for Septoria spp. (40 negatives in 2010 vs. 89 negatives in 2011), which could have been the result of standardizing the extraction protocol that favors the DNA quantity over DNA quality.   Septoria spp. infected trees in 2011  Previous studies have suggested that the primary inoculum for S. musiva originates from the leaf litter (Luley & McNabb Jr., 1989; Ostry, 1987). This is reflected in the 2010/2011 data, as the trees that were previously infected in 2010 were once again infected in 2011; trees 570, 901 and 1020 are all positive for Septoria musiva in both years of data (table 4). Of the 13 S. musiva positive trees identified in 2011, 7 of the infected trees are directly adjacent or in close proximity to trees that were previously infected in 2010 (table 4). However, trees 618, 1212 and 1249 had no prior history of S. musiva infection. In addition, these three trees were at least 3 tree rows and columns away from the closest S. musiva positive tree in 2010. It is uncertain if the flood from the Fraser River contributed to the spread of the disease, as the extent of the flooding is unknown. However, the three newly infected trees are relatively distant from the riverbank itself. Nonetheless, the infection of S. musiva within the plantation appears to have become self-propagating by infecting previously uninfected areas. It is worth noting that tree family A150-3, which originates from the Dease Lake geographical region, appears to be the most highly susceptible to S. musiva. Trees 311, 570, 1443 are all within the A150-3 family with    tree 570 testing positive for S. musiva infection in 2010 and 2011. Tree 311, although negative for S. musiva in 2010, was directly adjacent to tree S. musiva positive tree 310 and has been tested positive in 2011. Tree 1443 was not included in the 2011 subsampled data from this study. Beauseigle et al. (2010) had attributed this infection of two trees within the same provenance to a 1) chance event or 2) local inoculum concentrated in the area or 3) they are more susceptible to S. musiva than other provenances. The reinfection of tree 570, along with the newly affected tree 311 suggests the infection could be more than a chance event. Trees 291 and 350, similar to tree 311, are also directly adjacent to tree 310; neither of the two trees tested positive for S. musiva, suggesting a relatively higher resistance compared to 311. However, the absence of S. musiva on 291 and 350 could simply be due to sampling error, where despite increasing the number and pooling the collected leaf spots, the true S. musiva infected spots are missed. The susceptibility of northern geographical regions cannot be statistically shown however, as low representation Dease Lake and Far North provenances and tree mortality have drastically reduced the number of available samples from the northern geographical regions and limiting statistical analyses.  Unlike S. musiva, the infection of S. populicola within the plantation is well established and has infected the majority of the trees in the plantation, infecting 208 out of the total 306 samples collected in 2011. There are no apparent trends with respect to S. populicola infection within the plantation, as the disease is native to British Columbia and is distributed wherever susceptible hosts are present (Newcombe, Ostry, Hubbes, Perinet, & Mottet, 2001).      Z-test Results Interpretation  Analyses of the proportion of infected individuals within each geographical region would be the most ideal way of identifying resistant provenances; however, processing over 3000 leaf samples representing all 7 geographical demands a vast amount of time and resources. By using a subset of data, coarse scale analyses can be conducted; the results of such analyses could dictate if the additional 2700 samples would need to be processed. Furthermore, there was an unequal representation of each provenance from when the provenance trial was established due to the availability of clonal material; the mortality of numerous trees have also contributed to the low representation of each geographical region, as reflected in table 3. In response to these limiting factors, the regions were divided into a northern and southern population where the north includes: Dease Lake, Far North, Smithers, Prince George and Midcoast, while the south includes: Southcoast and USA.   In the 2010-northern population, 11/115 (9.6%) of the total samples were positive for S. musiva infection, compared to the 9/155 (5.8%) infected in the southern region. Although the north has a greater proportion of individuals infected, this was not statistically different from the proportion of infected individuals found in the southern population. Similarly, in 2011, the 7/149 (4.7%) of S. musiva infected trees in the north was not statistically different from the 6/157 (3.8%) infected trees in the south. It is interesting to note that the total number of S. musiva infected individuals is approximately an even split between the north and south, with 11 and 9 respectively in 2010, and 7 and 6 respectively in 2011. A comparison between proportion of infected individuals in 2010-north and 2011-north, as well as 2010-south and 2011-south also indicates that the proportions are not statistically different. This could be    interpreted as a stable rate of infection within the plantation between 2010 and 2011. The non- significant variation in S. musiva infection between the north and the south interesting, as one would expect a degree of resistance in one region over another, given the large amount of diversity within natural populations of poplars (Newcombe & Bradshaw, Quantitative trait loci conferring resistance in hybrid poplar to Septoria Populicola, the cause of leaf spot, 1996). However, as S. musiva had never been reported in the Pacific Northwest until 2006 (Callan, Leal, Foord, Dennis, & van Oosten, 2007), it is unlikely that P. trichocarpa has coevolved with S. musiva to generate some level of adaptive resistance (Clay & Kover, 1996). This is also reflected in Populus deltoides exhibiting some degree of resistances to S. musiva cankers, as the two have coevolved together and selective pressures place on one another have yielded resistance and increased virulence to one another (Newcombe & Ostry, 2001). Given total number of trees within the provenance trial, the frequency of cankers on the poplar clones was low. Cankers from branches that were found during the sampling were negative for S. musiva and were attributed to other injury causal agents. Several trees appeared to have cankers in the main stem; however, extracting the canker for S. musiva was not possible without killing the tree and was thus avoided. Variability in S. musiva aggressiveness has been documented given different isolates of the pathogen (Krupinsky, 1989); as the plantation is infected by a newly colonized pathogen that is subjected to population bottlenecks, it is possible that the S. musiva present within the plantation is one of mild aggressiveness. However, as LeBoldus et al. (2007) reports that host genotype variability had a bigger influence on disease severity than pathogen genotype variability, the founder’s effect the newly colonized S. musiva might not be restricting the aggressiveness and disease severity within the plantation. Analyses of neutral molecular    markers within the S. musiva genome have suggested that S. musiva has a high potential for local adaptation to sudden environmental changes (Feau, Hamelin, Vandecasteele, Stanosz, & Bernier, 2005). Furthermore, LeBoldus et al. (2010) found a significant clone-isolate interaction when conducting spray inoculations on Populus clones and S. musiva isolates to induce cankers. This clone-isolate interaction could account for the low frequency of cankers within the plantation, as the newly colonized population of S. musiva is unable to bypass the tree’s natural defense systems to generate cankers without infection through tissue wounds (LeBoldus & Blenis, 2010). Although the aggressiveness and disease severity in the plantation appear to be rare events, overtime, the infection of S. musiva in the Fraser Valley could be much more detrimental.  S. populicola infection also showed no significant differences between the north and south population in 2010 and 2011. This result is expected, as S. populicola is native to British Columbia; as such, the pathogen and the host have coevolved together through the selective pressure they exert on one another (Clay & Kover, 1996). However, as pathogens have a higher generation turnover, any resistance to S. populicola could be by P. trichocarpa can be rapidly negated through several generations of genetic recombination. Finally, a significant difference was found in between the S. populicola infection in the 2011-north infection and the 2010- north infection. The same significance was not detected in the comparison between 2011-south and 2010-south populations. This year over year difference could be attributed to S. populicola being epidemic in some years and not epidemic in others (Newcombe & Bradshaw, 1996).      Experimental Improvements and Future Research  Although north and south populations showed no significant differences in S. musiva infection proportions, the apparent trend in the reinfection of the provenances in Dease Lake suggests that the region is relatively more susceptible to S. musiva than the geographical regions to the south. However, given the limited dataset, statistically analyses could not be conducted on each geographical region alone. As such, a better representation of each individual region, specifically from the northern provenances could strengthen this apparent relationship. As samples from the other 5 repetitions are available, it may be beneficial to process the samples to detect for the presence or absence of S. musiva. In addition, repeating the experiment for an additional year may be helpful in determining if the reinfections of specific regions are due to chance and high inoculum concentrations, or if there is a difference in quantitative resistance to S. musiva.  Acknowledgements  I would like to thank Dr. Richard C. Hamelin for his giving me the opportunity, as well as his tutelage and supervision throughout the research; his positive attitude and dynamic personality has made the working under him enjoyable and fun. Next, I would like to thank everyone in Dr. Hamelin’s lab, specifically: Stephanie Beauseigle, Ben Lai, Padmini Herath and Braham Dhillon for their guidance and assistance over the course of the thesis.  A quick thanks my program peer Brett Nelson for helping me collect leaves under the hot summer heat filled swarming with mosquitos. Finally, I would like to thank my parents and my siblings for their unending love, support and encouragement.     Literature Cited  Beauseigle, S., Feau, N., & Hamelin, R. (2010). Poplar leaf spot and canker caused by Septoria musiva in British Columbia: risk assessment. Vancouver. Bier, J. (1939). Septoria canker of introduced and native hybrid poplars. Canadian journal of Research, 195-204. Callan, B., Leal, I., Foord, B., Dennis, J., & van Oosten, C. (2007). Septoria musiva isolated from cankered stems in hybrid poplar stool beds, Fraser Valley, British Columbia. Pacific Northwest Fungi, 1-9. Cimolai, T. (2011). Septoria spp. infection among North American Northwest Coast Provenances of Black Cottonwood (Populus trichocarpa): a field study of natural infection in a Fraser Valley Plantation. Vancouver: University of British Columbia Library. Clay, K., & Kover, P. (1996). The red queen hypothesis and plant/pathogen interactions. Annu. Rev. Phytopathology, 29-50. Feau, N., Hamelin, R., Vandecasteele, C., Stanosz, G., & Bernier, L. (2005). Genetic structure of Mycosphaerella populorum (anamorph Septoria musiva) populations in north-central and northeastern North America. Phytopathology, 608-616. Feau, N., Mottet, M., Perinet, P., Hamelin, R., & Bernier, L. (2010). Recent advances related to poplar leaf spot and canker caused by Septoria musiva. Canadian Journal of Plant Pathology, 122-134. Feau, N., Weiland, J., Stanosz, G., & Bernier, L. (2005). Specific and sensitive PCR-based detection of Septoria musiva, S. populicola and S. populi, the causes of leaf spot and stem canker on poplars. Mycol Res, 1015-1028. Gottsberger, R. (2010). Development and Evaluation of a real-time PCR assay targeting chromosomal DNA of Erwinia amylovora. Letters in Applied Microbiology, 285-292. Krupinsky, J. (1989). Variability in Septoria musiva aggressiveness. Phytopathology, 413-416. LeBoldus, J., & Blenis, P. (2010). A Method to Induce Stem Cankers by Inoculating Nonwounded Populus Clones with Septoria musiva Spore Suspensions. Plant Disease, 1238-1242. LeBoldus, J., Blenis, P., & Thomas, B. (2007). Evaluating the interaction between genotype and water stress in the hybrid poplar - Septoria musiva pathosystem. Canadian Journal of Botany, 1098-1102.    Luley, C., & McNabb Jr., H. (1989). Ascospore production, release, germination and infection of Populus by Mycosphaerella populorum. . Phytopathology, 1013-1018. McPhail, S., Cigolotti, V., & Moreno, A. (2012). Prospects of Hydrogen as a Future Energy Carrier. In L. Jorissen, Green Energy and Technology (pp. 189-203). London: Springer London. Newcombe, G., & Bradshaw, H. (1996). Quantitative trait loci conferring resistance in hybrid poplar to Septoria Populicola, the cause of leaf spot. Canadian Journal Of Forestry, 1943- 1950. Newcombe, G., & Ostry, M. (2001). Recessive Resistance to Septoria stem canker of hybrid poplar. Phyotpathology, 1081-1084. Newcombe, G., Chastagner, G., Callan, B., & Ostry, M. (1995). An epidemic of Septoria leaf spot on Populus trichocarpa in the Pacific Northwest in 1993. Plant Dis, 79:212. Newcombe, G., Ostry, M., Hubbes, M., Perinet, P., & Mottet, M. (2001). Poplar Diseases. Ottawa, ON: National Research Council of Canada Press. Ostry, M. (1987). Biology of Septoria musiva and Marsonina brunnea in hybrid Populus plantations and controls of Septoria canker in nurseries. European Journal of Forest Pathology, 158-165. Ostry, M., & Mcnabb Jr., H. (1985). Susceptibility of Populus species and hybrids to disease in the North central United States. Plant Dis., 755-757. Ostry, M., Wilson, L. M., & Moore, L. (1989). A Guide to Insect, Disease and Animal Pests of Poplars. In United States Department of Agric. For Serv. Agricultural Handbook (p. 677). Qu, X., Wanner, L., & Christ, B. (2011). Multiplex real-time PCR (TaqMan) assay for the simultaneous detection and discrimination of potato powdery and common scab diseases and pathogens. Journal of Applied Microbiology, 769-777. Schaad, N., Frederick, R., Shaw, J., Schneider, W., Hickson, R., Petrillo, M., & Luster, D. (2003). Advances in molecular-based diagnostics in meeting crop biosecurity and phytosanitary issues. . Annual Review of Phytopathology, 305-324. Sinclair, W., & Lyon, H. (2005). Diseases of Trees and Shrubs, Second Edition. Ithaca, NY.: Cornell University Press.     Appendices  Tree No. Tree ID Area Main Drainage Location Map # Lat Long Elev Pathogen Identity 40 A80-2 Smithers Skeena  Skeena RID.   SKN 80 5451 12820 140 S.populicola 44 A165-6 Prince George McGregor McGregorR.   MCG 165 5411 12200 579 S.populicola 45 A105-5 Smithers Bulkley (Telkwa) wa)lla   Telkwa R./ 105 5440 12707 567 S.populicola 52 A7-5 South Coast Fraser R.      4924 12133 500 S.musiva 55 A146-7 Far North Aisek      Tatshenshini 146 5926 13750 34 S.populicola 95 A162-1 Prince George Fraser R.  Hixon   HIXN   1 162 5324 12238 518 S.populicola 109 A158-3 Prince George Cunningham R. 16   Kimball Cr. 158 5256 12110 823 S.populicola 115 A158-4 Prince George Cunningham R. 16   Kimball Cr. 158 5256 12110 823 S.populicola 168 A55-4 Mid Coast Homathko  Homathko R.lC. 55 5114 12 457 88 S.populicola 169 A12-4 South Coast Fraser  Vender Cana1IL. 12 4909 12206 20 negative for both Septoria species 176 A178-4 USA GS033 Pittsburg, W A.   P 178 4550 12307 900 S.populicola 177 A1-5 South Coast Fraser  Nahatlatch R./A. 1 5000 12134 213 S.populicola 184 A87-4 Smithers Skeena  Skeena R.IN.   SK 87 5417 12922 30 S.populicola 185 A153-3 Smithers U. Nass White RIA.   WHTA 153 5556 12916 366 S.populicola 190 A27-3 South Coast EVIC Courtenay/H.   CNYH 27 4940 12504 76 S.populicola 192 A161-3 Prince George Fraser R.  Fraser R.   QFRS 161 5304 12231 472 S.populicola 231 A158-2 Prince George Cunningham R. 16   Kimball Cr. 158 5256 12110 823 S.populicola 257 A163-7 Prince George Fraser R.  WillowR.   WLOW 163 5355 12217 640 negative for both Septoria species 274 A88-2 Smithers Skeena  Skeena R.lO.   SK 88 5413 12932 21 S.populicola 281 A164-6 Prince George Fraser R.  5   Shelley   SHEL 164 5402 12236 564 negative for both Septoria species 282 A156-7 Prince George Quesnel R.  6   Australian   QA 156 5243 12228 442 S.populicola 285 A94-4 Smithers Kitimat Kitimat R.lC.   K 94 5403 12841 18 negative for both Septoria species 291 A164-1 Prince George Fraser R.  5   Shelley   SHEL 164 5402 12236 564 S.populicola 311 A150-3 Dease Lake Bell-Irving 7   Bell- Irving/C. 150 5644 12944 579 S.musiva    321 A92-1 Smithers Kitimat Kitimat R./ A. 92 5415 12831 122 S.populicola 323 A82-2 Smithers Skeena  KitwangaIF .   KT 82 5505 12811 177 S.populicola 325 A156-6 Prince George Quesnel R.  6   Australian   QA 156 5243 12228 442 S.populicola 326 A161-3 Prince George Fraser R.  Fraser R.   QFRS 161 5304 12231 472 S.populicola 331 A160-4 Prince George Fraser R.  6   Cottonwood   QC 160 5302 12209 823 S.populicola 337 A94-2 Smithers Kitimat Kitimat R.lC.   K 94 5403 12841 18 S.populicola 348 A88-2 Smithers Skeena  Skeena R.lO.   SK 88 5413 12932 21 negative for both Septoria species 349 A87-2 Smithers Skeena  Skeena R.IN.   SK 87 5417 12922 30 negative for both Septoria species 350 A95-4 Smithers Kitimat Hirsch Cr.lD.   H 95 5404 12827 335 negative for both Septoria species 356 A159-5 Prince George Fraser R.  Baker Cr.   QBKR 159 5257 12252 823 S.populicola 367 A116-5 Smithers U. Nass NassRtH.   NASH 116 5543 12849 183 S.populicola 410 A156-7 Prince George Quesnel R.  6   Australian   QA 156 5243 12228 442 S.populicola 424 A76-5 Smithers Skeena  Exehamsiks RIP 76 5425 12926 46 negative for both Septoria species 448 A171-4 Prince George Nechako R. 14   Redmond Cr. A. 171 5406 12426 655 negative for both Septoria species 453 A153-3 Smithers U. Nass White RIA.   WHTA 153 5556 12916 366 S.populicola 468 A98-4 Smithers Bulkley  Bulkley R.lC.   B 98 5457 12717 451 negative for both Septoria species 475 A162-1 Prince George Fraser R.  Hixon   HIXN   1 162 5324 12238 518 negative for both Septoria species 505 A95-2 Smithers Kitimat Hirsch Cr.lD.   H 95 5404 12827 335 negative for both Septoria species 506 A136-2 Dease Lake L. Stikine 6   Iskut R.lC.   I 136 5656 13020 317 negative for both Septoria species 519 A96-4 Smithers Bulkley  Bulkley R./ A. 96 5515 12730 311 negative for both Septoria species 522 A41-3 South Coast Squamish GlacierlB Aha L. 41 5006 12300 579 negative for both Septoria species 531 A163-4 Prince George Fraser R.  WillowR.   WLOW 163 5355 12217 640 negative for both Septoria species 570 A150-3 Dease Lake Bell-Irving 7   Bell- Irving/C. 150 5644 12944 579 S.musiva 571 A22-4 South Coast EVIS Cassigy/J.   CSYJ 22 4904 12352 20 S.populicola 573 A33-3 South Coast Lillooet a   Lillooet R./ A. 33 5037 12323 411 S.populicola    574 A89-8 Smithers Skeena  Skeena R.IP.   SK 89 5433 12828 61 S.populicola 576 A9-2 South Coast Fraser  Chilliwack R.#2/I. 9 4906 12138 360 S.populicola 577 A105-1 Smithers Bulkley (Telkwa) wa)lla   Telkwa R./ 105 5440 12707 567 S.populicola 578 A179-2 USA GS031  North Plains, OR. 179 4534 12300 100 S.populicola 579 A35-4 South Coast Lillooet a   Lillooet R.lC. 35 5030 12300 271 S.populicola 580 A25-2 South Coast EVIC Campbell R.IF.   CM 25 4957 12515 76 negative for both Septoria species 581 A57-5 South Coast Southgate  1   Southgate R./ A 57 5049 12429 239 S.populicola 583 A171-1 Prince George Nechako R. 14   Redmond Cr. A. 171 5406 12426 655 S.populicola 584 A67-1 Mid Coast Rivers Chuckwalla R.lC. 67 5144 12719 67 S.populicola 585 A87-4 Smithers Skeena  Skeena R.IN.   SK 87 5417 12922 30 S.populicola 586 A179-5 USA GS031  North Plains, OR. 179 4534 12300 100 S.populicola 587 A71-2 Mid Coast Burke Bella Coola R.lC. 71 5223 12636 135 S.populicola 588 A174-3 USA GS001  Carson, WA.   CARS 174 4545 12250 650 negative for both Septoria species 590 A47-5 South Coast Jervis Skwawka R.IF.   SK 47 5015 12356 244 S.populicola 591 A74-1 Mid Coast Dean eanR./C.   DENC   7 74 5250 12648 91 S.populicola 592 A1-1 South Coast Fraser  Nahatlatch R./A. 1 5000 12134 213 negative for both Septoria species 593 A154-4 Mid Coast KingcomeR. 20a   Atlatzi R.lA. 154 5059 12607 0 S.populicola 594 A13-5 South Coast Fraser  MatsQui Is.IM.   M 13 4907 12220 8 S.populicola 596 A19-3 South Coast EVIN Salmon R. #2/C   SL 19 5016 12550 30 S.populicola 598 A72-4 Mid Coast Dean eanR./A.   DENA   7 72 5246 12637 213 S.populicola 599 ATXD 15-29 South Coast             S.musiva 615 A79-4 Smithers Skeena  Skeena R/e.   SKN 79 5446 12816 122 negative for both Septoria species 616 A84-5 Smithers Skeena  HazeltonIH.   HAZ 84 5513 12740 238 negative for both Septoria species 618 A93-4 Smithers Kitimat Kitimat R.IB.   K 93 5409 12835 61 S.musiva 619 A106-2 Smithers Bulkley (Telkwa) wa)lla   Telkwa R.I 106 5437 12730 735 S.populicola    624 A163-3 Prince George Fraser R.  WillowR.   WLOW 163 5355 12217 640 S.populicola 627 A151-1 Dease Lake Bell-Irving 7   Bell- Irving/D. 151 5651 12937 677 S.populicola 631 A95-4 Smithers Kitimat Hirsch Cr.lD.   H 95 5404 12827 335 S.populicola 636 A76-5 Smithers Skeena  Exehamsiks RIP 76 5425 12926 46 negative for both Septoria species 644 A156-1 Prince George Quesnel R.  6   Australian   QA 156 5243 12228 442 negative for both Septoria species 645 A123-3 Smithers Skeena  Kitsumkalum R.IB. 123 5444 12847 155 negative for both Septoria species 661 A93-4 Smithers Kitimat Kitimat R.IB.   K 93 5409 12835 61 negative for both Septoria species 663 A106-1 Smithers Bulkley (Telkwa) wa)lla   Telkwa R.I 106 5437 12730 735 S.populicola 667 A164-3 Prince George Fraser R.  5   Shelley   SHEL 164 5402 12236 564 S.populicola 685 A113-1 Smithers U. Nass Nass RIE.   NASE 113 5524 12859 207 negative for both Septoria species 702 A163-4 Prince George Fraser R.  WillowR.   WLOW 163 5355 12217 640 negative for both Septoria species 705 A53-1 South Coast Homathko  Homathko R./ A. 53 5056 12451 46 negative for both Septoria species 706 A92-1 Smithers Kitimat Kitimat R./ A. 92 5415 12831 122 S.populicola 709 A37-2 South Coast Harrison Lillooet R./ A. 37 5007 12232 314 S.populicola 711 A94-3 Smithers Kitimat Kitimat R.lC.   K 94 5403 12841 18 S.populicola 713 A183-1 USA GS056  Lafayette, OR.   LA 183 4512 12305 100 S.populicola 714 A157-3 Prince George Quesnel R.  6   Quesnel L.   QL 157 5258 12219 488 S.populicola 715 A36-1 South Coast Lillooet Lillooet R.ID. 36 5018 12245 222 S.populicola 716 A44-3 South Coast Jervis Skwawka R.lC.   SK 44 5015 12400 152 S.populicola 717 A123-3 Smithers Skeena  Kitsumkalum R.IB. 123 5444 12847 155 S.populicola 718 A177-1 USA GS024  Castle Rock, W A. 177 4620 12255 100 negative for both Septoria species 719 A182-2 USA GS051 Jasper, OR.   JASP 182 4400 12255 150 S.populicola 720 A8-3 South Coast Fraser  Chilliwack R.#l/H. 8 4906 12131 480 S.populicola 721 A3-3 South Coast Fraser  Wellington Bar/C. 3 4940 12125 91 S.populicola 722 A39-3 South Coast Harrison Lillooet R.lC. 39 4946 12213 64 S.populicola 723 A64-3 Mid Coast Knight  0   W.Klinaklini R. 64 5118 12546 546 S.populicola 724 A25-3 South Coast EVIC Campbell R.IF.   CM 25 4957 12515 76 S.musiva    726 A72-1 Mid Coast Dean eanR./A.   DENA   7 72 5246 12637 213 S.populicola 727 A9-2 South Coast Fraser  Chilliwack R.#2/I. 9 4906 12138 360 S.populicola 729 A45-4 South Coast Jervis Skwawka R.ID.   SK 45 5015 12401 323 S.populicola 730 A53-1 South Coast Homathko  Homathko R./ A. 53 5056 12451 46 S.populicola 732 A4-2 South Coast Fraser  Yale West/D.   YA 4 4934 12128 549 S.populicola 733 A17-2 South Coast EVIN Memekav R./ A.   ME 17 5013 12548 30 S.populicola 735 A23-2 South Coast EVIS Lantzville/K.   LNZ 23 4914 12404 60 S.musiva and S.populicola 736 A69-5 Mid Coast Burke Bella Coola R./ A. 69 5225 12610 152 S.populicola 737 A13-2 South Coast Fraser  MatsQui Is.IM.   M 13 4907 12220 8 S.populicola 738 A27-2 South Coast EVIC Courtenay/H.   CNYH 27 4940 12504 76 S.populicola 740 A172-6 Prince George Nechako R. 14   Diamond Is. B. 172 5357 12426 671 S.populicola 741 A39-2 South Coast Harrison Lillooet R.lC. 39 4946 12213 64 S.populicola 742 A59-4 Mid Coast Knight  W.Klinaklini R./ A 59 5107 12535 30 negative for both Septoria species 743 A64-1 Mid Coast Knight  0   W.Klinaklini R. 64 5118 12546 546 negative for both Septoria species 748 A23-4 South Coast EVIS Lantzville/K.   LNZ 23 4914 12404 60 negative for both Septoria species 756 A18-2 South Coast EVIN Salmon R. #IIB.   S 18 5013 12549 30 S.populicola 757 A28-5 South Coast EVIC Fanny Bayll.   FNYI 28 4931 12451 46 S.populicola 758 A26-5 South Coast EVIC Black Creek/G.   BL 26 4950 12511 91 negative for both Septoria species 759 A5-5 South Coast Fraser  Yale East/E.   YA 5 4934 12124 61 negative for both Septoria species 760 A52-1 South Coast Phillips Phillips R.lC. 52 5041 12515 58 S.populicola 761 A46-1 South Coast Jervis Skwawka R.IE.   S 46 5013 12357 231 negative for both Septoria species 762 A9-4 South Coast Fraser  Chilliwack R.#2/I. 9 4906 12138 360 negative for both Septoria species 764 A161-4 Prince George Fraser R.  Fraser R.   QFRS 161 5304 12231 472 negative for both Septoria species 765 A66-4 Mid Coast Machmell Machmell R.IB 66 5137 12635 122 negative for both Septoria species 768 A12-2 South Coast Fraser  Vender Cana1IL. 12 4909 12206 20 negative for both Septoria species 770 A74-4 Mid Coast Dean eanR./C.   DENC   7 74 5250 12648 91 negative for both Septoria species    771 A19-5 South Coast EVIN Salmon R. #2/C   SL 19 5016 12550 30 S.populicola 772 A33-5 South Coast Lillooet a   Lillooet R./ A. 33 5037 12323 411 S.populicola 774 A32-2 South Coast Squamish Elaho R.ID.   EL 32 5015 12235 305 S.populicola 778 A128-1 Dease Lake L. Stikine L. Stikine 128 5731 13147 61 S.populicola 779 A32-3 South Coast Squamish Elaho R.ID.   EL 32 5015 12235 305 S.populicola 781 A50-1 South Coast Phillips Phillips R./ A. 50 5036 12519 5 S.populicola 782 A48-2 South Coast Toba Inlet 23   Toba R./A.   T 48 5031 12414 67 negative for both Septoria species 833 A29-2 South Coast Squamish Squamish R./ A. 29 4952 12314 61 S.populicola 835 A66-5 Mid Coast Machmell Machmell R.IB 66 5137 12635 122 S.populicola 837 A50-4 South Coast Phillips Phillips R./ A. 50 5036 12519 5 S.populicola 838 A39-5 South Coast Harrison Lillooet R.lC. 39 4946 12213 64 S.populicola 840 A75-2 Mid Coast Dean eanR.lD.   DEND   7 75 5249 12657 27 S.populicola 841 A105-5 Smithers Bulkley (Telkwa) wa)lla   Telkwa R./ 105 5440 12707 567 S.populicola 842 A14-3 South Coast Fraser  McMillan Is.IN. 14 4911 12235 15 negative for both Septoria species 844 A177-5 USA GS024  Castle Rock, W A. 177 4620 12255 100 S.populicola 845 A92-4 Smithers Kitimat Kitimat R./ A. 92 5415 12831 122 negative for both Septoria species 846 A15-2 South Coast Fraser  Harrison R./O.   H 15 4917 12157 40 S.populicola 848 A19-4 South Coast EVIN Salmon R. #2/C   SL 19 5016 12550 30 S.populicola 849 A159-2 Prince George Fraser R.  Baker Cr.   QBKR 159 5257 12252 823 S.populicola 851 A100-4 Smithers Bulkley  Bulkley R.IE.   B 100 5445 12707 494 negative for both Septoria species 852 A92-3 Smithers Kitimat Kitimat R./ A. 92 5415 12831 122 S.populicola 854 A43-4 South Coast Jervis Skwawka R.IB.   SK 43 5014 12400 115 S.populicola 856 A45-4 South Coast Jervis Skwawka R.ID.   SK 45 5015 12401 323 S.populicola 857 A92-2 Smithers Kitimat Kitimat R./ A. 92 5415 12831 122 negative for both Septoria species 858 A41-5 South Coast Squamish GlacierlB Aha L. 41 5006 12300 579 S.populicola 860 A49-5 South Coast Toba Inlet 23   TobaR.IB.   TO 49 5034 12405 73 S.populicola 861 A58-2 South Coast Southgate  1   Southgate R.IB. 58 5053 12444 91 negative for both Septoria species    862 A174-3 USA GS001  Carson, WA.   CARS 174 4545 12250 650 S.populicola 863 A37-2 South Coast Harrison Lillooet R./ A. 37 5007 12232 314 S.populicola 880 A17-2 South Coast EVIN Memekav R./ A.   ME 17 5013 12548 30 S.populicola 881 A73-4 Mid Coast Dean eanR.IB.   DENB   7 73 5250 12642 152 S.populicola 882 A32-5 South Coast Squamish Elaho R.ID.   EL 32 5015 12235 305 S.populicola 883 A49-2 South Coast Toba Inlet 23   TobaR.IB.   TO 49 5034 12405 73 S.populicola 884 A181-5 USA GS048  Halsey, OR.   HALS 181 4425 12320 300 S.populicola 886 A4-5 South Coast Fraser  Yale West/D.   YA 4 4934 12128 549 S.populicola 888 A53-2 South Coast Homathko  Homathko R./ A. 53 5056 12451 46 S.populicola 889 A24-2 South Coast EVIS Chemainus R.IL.   C 24 4853 12342 5 S.populicola 890 A15-5 South Coast Fraser  Harrison R./O.   H 15 4917 12157 40 negative for both Septoria species 892 A23-4 South Coast EVIS Lantzville/K.   LNZ 23 4914 12404 60 S.populicola 893 A133-1 Dease Lake U. Stikine Tanzilla R./A. 133 5818 13028 567 S.populicola 894 A15-3 South Coast Fraser  Harrison R./O.   H 15 4917 12157 40 S.populicola 896 A28-2 South Coast EVIC Fanny Bayll.   FNYI 28 4931 12451 46 S.populicola 897 A58-2 South Coast Southgate  1   Southgate R.IB. 58 5053 12444 91 negative for both Septoria species 898 A122-2 Smithers Skeena  Cedar R./A (KITA) 122 5457 12855 274 S.populicola 899 A21-4 South Coast EVIN White R.IE.   WHTE, 21 5008 12603 213 negative for both Septoria species 900 A177-2 USA GS024  Castle Rock, W A. 177 4620 12255 100 S.populicola 901 A165-7 Prince George McGregor McGregorR.   MCG 165 5411 12200 579 S.musiva 902 A6-1 South Coast Fraser  Hope North/F.   H 6 4926 12126 61 S.populicola 904 A78-3 Smithers Skeena  Skeena RIB.   SKN 78 5441 12823 122 negative for both Septoria species 905 A154-5 Mid Coast KingcomeR. 20a   Atlatzi R.lA. 154 5059 12607 0 S.populicola 906 A180-4 USA GS041  Jefferson, OR.   JE 180 4444 12305 100 negative for both Septoria species 907 A12-1 South Coast Fraser  Vender Cana1IL. 12 4909 12206 20 negative for both Septoria species 909 A75-1 Mid Coast Dean eanR.lD.   DEND   7 75 5249 12657 27 S.populicola    910 A32-4 South Coast Squamish Elaho R.ID.   EL 32 5015 12235 305 negative for both Septoria species 911 A58-1 South Coast Squamish GlacierlB Aha L. 41 5006 12300 579 negative for both Septoria species 912 A67-4 Mid Coast Southgate  1   Southgate R.IB. 58 5053 12444 91 negative for both Septoria species 916 A71-4 Mid Coast Burke Bella Coola R.lC. 71 5223 12636 135 negative for both Septoria species 917 A2-3 South Coast Fraser  Nahatlatch L.IB. 2 4958 12149 335 S.populicola 918 A54-4 South Coast Homathko  Homathko R.IB. 54 5057 12454 37 S.populicola 919 A7-1 South Coast Fraser  Hope South/G.   H 7 4924 12133 500 negative for both Septoria species 920 A106-2 Smithers Bulkley (Telkwa) wa)lla   Telkwa R.I 106 5437 12730 735 S.populicola 921 A154-2 Mid Coast KingcomeR. 20a   Atlatzi R.lA. 154 5059 12607 0 S.populicola 922 A178-2 USA GS033 Pittsburg, W A.   P 178 4550 12307 900 S.populicola 923 A52-2 South Coast Phillips Phillips R.lC. 52 5041 12515 58 negative for both Septoria species 937 A161-2 Prince George Fraser R.  Fraser R.   QFRS 161 5304 12231 472 negative for both Septoria species 938 A15-3 South Coast Fraser  Harrison R./O.   H 15 4917 12157 40 negative for both Septoria species 939 A54-3 South Coast Homathko  Homathko R.IB. 54 5057 12454 37 S.populicola 940 A122-2 Smithers Skeena  Cedar R./A (KITA) 122 5457 12855 274 negative for both Septoria species 942 A72-1 Mid Coast Dean eanR./A.   DENA   7 72 5246 12637 213 negative for both Septoria species 943 A38-2 South Coast Harrison Lillooet R.IB. 38 5002 12232 213 S.populicola 944 A54-2 South Coast Homathko  Homathko R.IB. 54 5057 12454 37 negative for both Septoria species 946 A53-4 South Coast Homathko  Homathko R./ A. 53 5056 12451 46 S.populicola 948 A20-2 South Coast EVIN Salmon R. #3ID.   S 20 5017 12552 30 S.populicola 949 A175-5 USA GS009  N. Bonneville WA. 175 4535 12200 300 S.populicola 950 A171-1 Prince George Nechako R. 14   Redmond Cr. A. 171 5406 12426 655 S.populicola 951 A22-3 South Coast EVIS Cassigy/J.   CSYJ 22 4904 12352 20 S.populicola 953 A11-2 South Coast Fraser  Chilliwack R.#4/K. 11 4905 12144 280 negative for both Septoria species 957 A50-5 South Coast Phillips Phillips R./ A. 50 5036 12519 5 negative for both Septoria species    958 A17-3 South Coast EVIN Memekav R./ A.   ME 17 5013 12548 30 S.musiva 959 A42-4 South Coast Jervis Skwawka R./ A.   S 42 5013 12359 61 negative for both Septoria species 960 A183-4 USA GS056  Lafayette, OR.   LA 183 4512 12305 100 S.populicola 961 A158-6 Prince George Cunningham R. 16   Kimball Cr. 158 5256 12110 823 S.populicola 962 A80-2 Smithers Skeena  Skeena RID.   SKN 80 5451 12820 140 negative for both Septoria species 963 A46-5 South Coast Jervis Skwawka R.IE.   S 46 5013 12357 231 S.populicola 964 A1-2 South Coast Fraser  Nahatlatch R./A. 1 5000 12134 213 S.populicola 966 A75-5 Mid Coast Dean eanR.lD.   DEND   7 75 5249 12657 27 S.populicola 967 A28-3 South Coast EVIC Fanny Bayll.   FNYI 28 4931 12451 46 S.populicola 968 A41-3 South Coast Squamish GlacierlB Aha L. 41 5006 12300 579 S.populicola 969 A36-2 South Coast Lillooet Lillooet R.ID. 36 5018 12245 222 S.populicola 970 A180-3 USA GS041  Jefferson, OR.   JE 180 4444 12305 100 S.populicola 983 A87-2 Smithers Skeena  Skeena R.IN.   SK 87 5417 12922 30 S.populicola 998 A165-7 Prince George McGregor McGregorR.   MCG 165 5411 12200 579 S.populicola 1020 A56-3 Mid Coast Homathko  Homathko R.ID. 56 5117 12450 152 S.musiva and S.populicola 1049 A178-3 USA GS033 Pittsburg, W A.   P 178 4550 12307 900 S.populicola 1068 A128-3 Dease Lake L. Stikine L. Stikine 128 5731 13147 61 negative for both Septoria species 1200 A7-3 South Coast Fraser  Hope South/G.   H 7 4924 12133 500 S.populicola 1212 ADTAC 7 South Coast             S.musiva and S.populicola 1216 A45-5 South Coast Jervis Skwawka R.ID.   SK 45 5015 12401 323 S.populicola 1217 A158-5 Prince George Cunningham R. 16   Kimball Cr. 158 5256 12110 823 S.populicola 1218 A105-5 Smithers Bulkley (Telkwa) wa)lla   Telkwa R./ 105 5440 12707 567 S.populicola 1225 A23-5 South Coast EVIS Lantzville/K.   LNZ 23 4914 12404 60 S.populicola 1230 A15-4 South Coast Fraser  Harrison R./O.   H 15 4917 12157 40 negative for both Septoria species 1233 A7-4 South Coast Fraser  Hope South/G.   H 7 4924 12133 500 S.populicola 1235 A55-3 Mid Coast Homathko  Homathko R.lC. 55 5114 12 457 88 S.populicola    1245 A79-4 Smithers Skeena  Skeena R/e.   SKN 79 5446 12816 122 S.populicola 1247 A35-1 South Coast Lillooet a   Lillooet R.lC. 35 5030 12300 271 S.populicola 1249 A75-4 Mid Coast Dean eanR.lD.   DEND   7 75 5249 12657 27 S.musiva and S.populicola 1254 A173-2 Prince George Nechako R. 14   Chilako R.   C 173 5353 12259 183 S.populicola 1261 A64-2 Mid Coast Knight  0   W.Klinaklini R. 64 5118 12546 546 S.populicola 1272 A28-4 South Coast EVIC Fanny Bayll.   FNYI 28 4931 12451 46 S.populicola 1277 A50-2 South Coast Phillips Phillips R./ A. 50 5036 12519 5 S.populicola 1278 A11-1 South Coast Fraser  Chilliwack R.#4/K. 11 4905 12144 280 S.populicola 1279 A178-1 USA GS033 Pittsburg, W A.   P 178 4550 12307 900 negative for both Septoria species 1298 A182-3 USA GS051 Jasper, OR.   JASP 182 4400 12255 150 S.populicola 1302 A10-1 South Coast Fraser  Chilliwack R.#3/J. 10 4905 12143 280 S.populicola 1303 A164-2 Prince George Fraser R.  5   Shelley   SHEL 164 5402 12236 564 negative for both Septoria species 1304 A17-2 South Coast EVIN Memekav R./ A.   ME 17 5013 12548 30 S.populicola 1307 A53-1 South Coast Homathko  Homathko R./ A. 53 5056 12451 46 S.populicola 1308 A32-4 South Coast Squamish Elaho R.ID.   EL 32 5015 12235 305 S.populicola 1309 A26-2 South Coast EVIC Black Creek/G.   BL 26 4950 12511 91 S.populicola 1313 A165-6 Prince George McGregor McGregorR.   MCG 165 5411 12200 579 S.populicola 1314 A25-1 South Coast EVIC Campbell R.IF.   CM 25 4957 12515 76 S.populicola 1316 A142-5 Far North Taku  Taku River/B   142 5842 13324 49 S.populicola 1317 A54-3 South Coast Homathko  Homathko R.IB. 54 5057 12454 37 S.populicola 1319 A181-1 USA GS048  Halsey, OR.   HALS 181 4425 12320 300 S.populicola 1323 A16-2 South Coast Fraser  Harrison Mill/P. 16 4914 12151 30 negative for both Septoria species 1324 A92-3 Smithers Kitimat Kitimat R./ A. 92 5415 12831 122 negative for both Septoria species 1326 A45-4 South Coast Jervis Skwawka R.ID.   SK 45 5015 12401 323 S.populicola 1327 A154-5 Mid Coast KingcomeR. 20a   Atlatzi R.lA. 154 5059 12607 0 S.populicola 1328 A76-5 Smithers Skeena  Exehamsiks RIP 76 5425 12926 46 S.populicola    1329 A154-2 Mid Coast KingcomeR. 20a   Atlatzi R.lA. 154 5059 12607 0 S.populicola 1330 A68-3 Mid Coast Rivers Chuckwalla R.ID. 68 5146 12712 79 S.populicola 1331 A9-5 South Coast Fraser  Chilliwack R.#2/I. 9 4906 12138 360 S.populicola 1332 A4-2 South Coast Fraser  Yale West/D.   YA 4 4934 12128 549 S.populicola 1333 A27-3 South Coast EVIC Courtenay/H.   CNYH 27 4940 12504 76 S.populicola 1336 A43-3 South Coast Jervis Skwawka R.IB.   SK 43 5014 12400 115 S.populicola 1337 A36-3 South Coast Lillooet Lillooet R.ID. 36 5018 12245 222 S.populicola 1338 A22-4 South Coast EVIS Cassigy/J.   CSYJ 22 4904 12352 20 S.populicola 1339 A46-1 South Coast Jervis Skwawka R.IE.   S 46 5013 12357 231 S.populicola 1340 A181-5 USA GS048  Halsey, OR.   HALS 181 4425 12320 300 S.populicola 1341 A19-2 South Coast EVIN Salmon R. #2/C   SL 19 5016 12550 30 S.populicola 1342 A16-5 South Coast Fraser  Harrison Mill/P. 16 4914 12151 30 S.populicola 1343 A31-3 South Coast Squamish Squamish R.lC. 31 5006 12322 177 S.populicola 1344 A165-8 Prince George McGregor McGregorR.   MCG 165 5411 12200 579 S.populicola 1345 A69-3 Mid Coast Burke Bella Coola R./ A. 69 5225 12610 152 S.populicola 1346 A3-1 South Coast Fraser  Wellington Bar/C. 3 4940 12125 91 S.populicola 1347 A69-4 Mid Coast Burke Bella Coola R./ A. 69 5225 12610 152 S.populicola 1348 A48-2 South Coast Toba Inlet 23   Toba R./A.   T 48 5031 12414 67 S.populicola 1349 A142-3 Far North Taku  Taku River/B   142 5842 13324 49 S.populicola 1350 A38-4 South Coast Harrison Lillooet R.IB. 38 5002 12232 213 S.populicola 1352 A38-4 South Coast Harrison Lillooet R.IB. 38 5002 12232 213 S.populicola 1353 A106-2 Smithers Bulkley (Telkwa) wa)lla   Telkwa R.I 106 5437 12730 735 S.populicola 1354 A89-8 Smithers Skeena  Skeena R.IP.   SK 89 5433 12828 61 S.populicola 1355 A13-3 South Coast Fraser  MatsQui Is.IM.   M 13 4907 12220 8 S.populicola 1356 A64-1 Mid Coast Knight  0   W.Klinaklini R. 64 5118 12546 546 S.populicola 1357 A50-4 South Coast Phillips Phillips R./ A. 50 5036 12519 5 S.populicola 1360 A56-4 Mid Coast Homathko  Homathko R.ID. 56 5117 12450 152 S.populicola    1362 A41-5 South Coast Squamish GlacierlB Aha L. 41 5006 12300 579 S.populicola 1380 A156-1 Prince George Quesnel R.  6   Australian   QA 156 5243 12228 442 S.populicola 1382 A18-4 South Coast EVIN Salmon R. #IIB.   S 18 5013 12549 30 S.populicola 1383 A62-1 Mid Coast Knight  Klinaklini R.ID. 62 5134 12530 427 S.populicola 1384 A72-1 Mid Coast Dean eanR./A.   DENA   7 72 5246 12637 213 S.populicola 1386 A62-3 Mid Coast Knight  Klinaklini R.ID. 62 5134 12530 427 S.populicola 1387 A22-5 South Coast EVIS Cassigy/J.   CSYJ 22 4904 12352 20 S.populicola 1388 A114-2 Smithers U. Nass Nass RIF.   NASF 114 5534 12847 152 S.populicola 1389 A67-1 Mid Coast Rivers Chuckwalla R.lC. 67 5144 12719 67 S.populicola 1390 A8-4 South Coast Fraser  Chilliwack R.#l/H. 8 4906 12131 480 S.populicola 1391 A183-1 USA GS056  Lafayette, OR.   LA 183 4512 12305 100 S.populicola 1392 A75-2 Mid Coast Dean eanR.lD.   DEND   7 75 5249 12657 27 S.populicola 1397 A154-3 Mid Coast KingcomeR. 20a   Atlatzi R.lA. 154 5059 12607 0 S.populicola 1398 A171-5 Prince George Nechako R. 14   Redmond Cr. A. 171 5406 12426 655 S.musiva 1437 A163-1 Prince George Fraser R.  WillowR.   WLOW 163 5355 12217 640 negative for both Septoria species 1440 A164-1 Prince George Fraser R.  5   Shelley   SHEL 164 5402 12236 564 S.populicola 1442 A87-5 Smithers Skeena  Skeena R.IN.   SK 87 5417 12922 30 S.populicola 1462 A88-2 Smithers Skeena  Skeena R.lO.   SK 88 5413 12932 21 S.populicola 1490 A94-3 Smithers Kitimat Kitimat R.lC.   K 94 5403 12841 18 S.populicola 1491 A89-4 Smithers Skeena  Skeena R.IP.   SK 89 5433 12828 61 S.populicola 1493 A82-6 Smithers Skeena  KitwangaIF .   KT 82 5505 12811 177 S.populicola 1495 A94-4 Smithers Kitimat Kitimat R.lC.   K 94 5403 12841 18 negative for both Septoria species Provenance Trial EP.1123.02.05     991 990 931 X 871 870 811 810 751 750 X X 631 630 571 570 511 510 992 989 932 929 872 869 812 809 752 749 692 689 632 629 X 569 512 509 993 988 933 X X 868 X 808 753 748 693 X 633 628 573 568 X 508 994 987 934 927 874 867 814 807 754 747 694 687 634 627 574 567 514 507 rep 3 1130 1129 X 1079 X  995 986 935 926 X 866 X X X X 695 686 635 626 X X 515 506 1514 1467 1466 X 1418 1371 1370 1323 1322 1275 X 1227 X 1179 1178 1131 1128 1081 1078 1031 996 985 X 925 876 865 X 805 756 745 696 685 636 X 576 565 516 505 1513 1468 1465 1420 X X X 1324 1321 X 1273 1228 1225 1180 1177 1132 X 1082 1077 1032 997 984 937 924 877 864 817 804 757 744 697 684 637 624 577 564 517 X 1512 X X 1421 1416 1373 1368 1325 X 1277 1272 1229 1224 X 1176 1133 1126 1083 1076 1033 998 983 938 923 878 863 818 803 758 743 698 683 638 623 578 X 518 503 X 1470 1463 1422 X 1374 1367 1326 1319 1278 1271 1230 1223 1182 1175 1134 1125 1084 1075 1034 999 982 939 922 879 862 819 802 759 742 699 682 639 622 579 562 519 502 1510 1471 1462 1423 1414 1375 1366 1327 1318 1279 1270 1231 1222 1183 X 1135 1124 1085 1074 1035 X 981 940 921 880 861 820 801 760 741 700 681 640 621 580 561 520 501 1509 1472 1461 1424 1413 X 1365 1328 1317 1280 1269 1232 X 1184 X 1136 1123 1086 1073 1036 1001 980 X 920 881 860 821 800 761 740 701 680 X 620 581 560 521 500 1508 1473 X X X 1377 1364 1329 1316 1281 1268 1233 X X 1172 1137 1122 X 1072 X 1029 X X 942 919 882 X 822 799 762 X 702 679 642 619 582 X 522 X 1507 1474 1459 1426 1411 1378 1363 1330 X 1282 1267 X 1219 1186 1171 1138 1121 X X 1038 X 1003 978 943 918 883 858 823 798 X 738 703 678 X 618 583 X 523 X 1506 1475 1458 1427 1410 1379 1362 1331 1314 1283 X 1235 1218 1187 X 1139 X 1089 1070 1039 1027 1004 X 944 917 884 857 824 797 764 737 704 677 644 617 584 557 524 497 1505 1476 1457 1428 1409 1380 X 1332 1313 1284 1265 1236 1217 1188 X X 1119 1090 1069 1040 1026 X 976 X 916 X 856 X 796 765 736 705 676 645 616 585 556 X X 1504 X 1456 1429 1408 X 1360 1333 1312 1285 1264 1237 1216 1189 1168 1141 1118 1091 1068 1041  1006 975 946 X 886 855 X X X 735 706 675 646 615 586 555 526 495 1503 X X 1430 X 1382 1359 X X 1286 1263 1238 1215 1190 1167 1142 X 1092 X 1042 1007 974 X X X 854 827 794 X X X 674 647 614 587 554 527 494 1502 1479 1454 1431 X 1383 X X X 1287 1262 1239 1214 1191 1166 1143 1116 1093 1066 X X 973 948 913 888 853 828 793 768 733 X 673 648 613 588 553 528 493 1501 1480 1453 1432 1405 1384 1357 1336 1309 1288 1261 1240 1213 1192 1165 1144 1115 1094 1065 1044 X 972 949 912 889 852 829 X X 732 709 672 649 612 X 552 529 X 1500 1481 X 1433 1404 1385 1356 1337 1308 1289 X 1241 1212 1193 1164 1145 1114 1095 1064 X 1010 971 950 911 890 851 830 791 770 X X X X X 590 X 530 491 1499 1482 X 1434 1403 1386 1355 1338 1307 1290 1259 1242 1211 1194 1163 1146 X 1096 1063 1046 1011 970 951 910 X 850 831 790 771 730 711 670 651 610 591 550 531 490 X X 1450 X 1402 1387 1354 1339 X 1291 1258 1243 1210 1195 1162 1147 1112 1097 1062 1047 1012 969 952 909 892 849 832 789 772 729 X 669 652 609 592 549 532 489 X 1484 1449 1436 1401 1388 1353 1340 X 1292 1257 1244 1209 1196 1161 1148 1111 1098 1061 1048 1013 968 953 908 893 848 833 788 773 X 713 668 653 X 593 548 533 488 X 1485 1448 1437 1400 1389 1352 1341 1304 1293 1256 1245 1208 1197 1160 1149 1110 1099 1060 1049 1014 967 954 907 894 X X 787 774 727 714 667 654 607 594 547 534 487 1495 1486 X X 1399 1390 X 1342 1303 X X 1246 1207 1198 1159 1150 1109 1100 1059 1050 1015 966 955 906 X 846 835 786 775 726 715 666 655 X X 546 535 486 1494 1487 1446 1439 1398 1391 1350 1343 1302 X 1254 1247 X 1199 1158 1151 1108 1101 1058 1051 X 1016 965 X 905 896 845 836 785 776 X 716 665 656 605 596 545 536 485 1493 1488 1445 1440 1397 1392 1349 1344 1301 1296 X 1248 1205 1200 1157 1152 1107 1102 1057 X 1024 1017 964 957 904 897 844 837 784 X 724 717 664 X 604 X 544 X X 1492 1489 1444 X 1396 1393 1348 1345 X 1297 X 1249 1204 1201 1156 1153 1106 1103 X 1053 1023 1018 963 958 903 898 843 838 783 778 723 718 663 658 603 598 543 X 483 1491 1490 1443 1442 1395 1394 1347 1346 1299 1298 1251 1250 1203 1202 1155 1154 1105 X 1055 1054 1022 1019 962 959 902 899 842 839 782 779 722 719 662 659 602 599 542 X 482  1021 1020 961 960 901 900 841 840 781 780 721 720 661 660 601 X 541 X 481  S p u r R o a d     Provenance Trial EP.1123.02.05 Layout Kilby - Harrison Mills Ct     Fraser River Fraser Riv   trees in subsample of Fung, 2012 trees positive for S. musiva leafspot in 2010 and 2011 trees positive for S. musiva leafspot in 2011 trees positive for S. musiva leafspot in 2010 trees with S. musiva canker in 2010 (isolated by culture)       r30 rep 2 c55 c54 c53 c52 c51 c50 c49 c48 c47 c46 c45 c44 c43 c42 c41 c40 c39 c38 c37 c36 c35 c34 c33 c32 c31 c30 c29 c28 c27 c26 c25 c24 c23 c22 c21 c20 c19 c18 c17 r29 rep 2 r28 r27 r26 r25 r24 r23 r22 r21 r20 r19 r18 r17 r16 r15 r14 r13 r12 r11 r10 r9 r8 r7 r6 r5 r4 r3 r2 r1 rep 3 c55 c54 c53 c52 c51 c50 c49 c48 c47 c46 c45 c44 c43 c42 c41 c40 c39 c38 c37 c36 c35 c34 c33 c32 c31 c30 c29 c28 c27 c26 c25 c24 c23 c22  c21 c20 c19 c18 c17 rep 1 Provenance Trial EP.1123.02.05     1883 X 1957 X X 2032 2495 2496 X X 2531 2532  X 1663 1734 1735 1808 X X 1885 1956 X 2030 2033 2494 2497 X 2515 2530 2533 1661 1664 1733 1736 1807 1810 X X 1955 1960 2029 X 2493 2498 2511 X 2529 X 1660 X X 1737 X 1811 X 1887 1954 1961 2028 X X X X X 2528 X 1659 1666 1731 1738 1805 1812 1879 1888 1953 1962 2027 X X 2500 X X 2527 2536 1658 X 1730 1739 1804 1813 1878 X 1952 1963 2026 2037 X X X X 2526 2537 1657 1668 1729 X X X 1877 1890 1951 1964 2025 2038 X 2502 X 2520 X X 1656 1669 1728 1741 1802 X 1876 X 1950 X 2024 X 2488 2503 2506 2521 2524 X 1655 1670 X X X 1816 1875 1892 1949 1966 2023 2040 2487 X X X X 2540 X 1543 1598 1599 1654 1671 1726 1743 1800 1817 1874 1893 1948 1967 X 2041 r28 r27 r26 r25 r24 r23 1541 X 1597 1600 1653 1672 1725 X 1799 X 1873 X 1947 X X 2042 1540 X 1596 1601 1652 1673 X 1745 1798 1819 1872 X 1946 X 2020 X 1539 X 1595 X 1651 1674 1723 1746 1797 1820 1871 1896 1945 1970 2019 X 1538 X X X 1650 1675 1722 1747 X X 1870 1897 1944 1971 2018 X 1537 X 1593 1604 X 1676 1721 X 1795 1822 1869 1898 X 1972 X X 1536 1549 1592 1605 X 1677 X 1749 1794 X 1868 1899 X 1973 2016 2047 2090 2091 r22 r21 r20 r19 r18                         rep 5 r17 1535 1550 X 1606 1647 1678 1719 1750 1793 1824 X 1900 1941 1974 2015 2048 X 2092 1534 X 1590 1607 1646 1679 1718 1751 X 1825 1866 X 1940 X 2014 2049 2088 2093 1533 1552 1589 X 1645 X 1717 X 1791 1826 1865 X X 1976 2013 2050 2087 2094 X 1553 1588 1609 X 1681 1716 1753 1790 1827 1864 1903 1938 1977 2012 2051 2086 2095 1531 1554 X 1610 1643 1682 X 1754 1789 1828 1863 X 1937 1978 2011 2052 2085 2096 X 1555 1586 1611 1642 X 1714 1755 1788 1829 1862 1905 X 1979 2010 X 2084 2097 2128 X 2160 2161 1529 1556 1585 1612 1641 1684 1713 1756 1787 1830 X 1906 1935 1980 2009 2054 2083 2098 2127 2130 2159 2162 1528 X 1584 1613 1640 1685 1712 1757 1786 X 1860 1907 1934 1981 2008 X 2082 X 2126 2131 2158 2163 X 1558 1583 1614 X 1686 1711 1758 1785 1832 1859 1908 1933 1982 2007 X 2081 X 2125 2132 2157 X 1526 1559 1582 1615 1638 X 1710 1759 1784 1833 1858 X 1932 1983 2006 2057 2080 2101 2124 2133 X 2165 X 1560 1581 1616 1637 X 1709 X 1783 1834 1857 X 1931 1984 2005 2058 2079 2102 2123 2134 2155 2166 1524 1561 1580 1617 1636 X X 1761 X 1835 1856 1911 X 1985 2004 2059 2078 2103 2122 2135 2154 2167 X 1562 1579 1618 1635 X 1707 1762 X X 1855 1912 1929 X X X X X 2121 2136 2153 X 1522 1563 1578 X 1634 X 1706 1763 X X 1854 1913 1928 X 2002 2061 X X X 2137 X 2169 1521 1564 1577 X X X 1705 1764 1779 1838 1853 1914 1927 X 2001 X 2075 2106 2119 2138 X 2170 1520 1565 1576 1621 1632 X 1704 1765 1778 1839 1852 1915 1926 1989 X 2063 2074 X 2118 X X X X 1566 1575 X 1631 X 1703 X 1777 1840 X 1916 1925 1990 1999 2064 2073 2108 X X 2149 2172 1518 1567 1574 1623 1630 1695 1702 X 1776 1841 1850 1917 1924 X 1998 2065 2072 X 2116 2141 2148 X 1517 X 1573 1624 1629 X 1701 X 1775 1842 X 1918 1923 1992 X 2066 X 2110 2115 2142 2147 2174 1516 X 1572 1625 1628 1697 X 1769 1774 1843 X X 1922 1993 X 2067 X 2111 X X X X X X X X 1627 1698 X 1770 X X 1847 1920 X 1994 1995 2068 2069 2112 2113 2144 X X  451 450 391 390 331 330 271 270 211 210 151 150 91 90 31 30 452 449 392 389 332 329 272 X X 209 152 149 92 89 32 29 453 448 393 388 X 328 273 268 213 208 X X 93 88 33 28 X X X 387 334 327 274 X 214 207 X X 94 X X 27 455 446 395 386 335 326 275 266 215 206 155 146 95 X 35 26 456 445 396 385 336 325 276 265 216 205 X 145 96 85 36 25 457 444 397 384 337 324 277 264 217 204 157 144 97 84 X X 458 443 398 X 338 323 278 263 X X 158 143 98 X X 23 459 442 399 382 X 322 279 X 219 202 X 142 99 X 39 22 X 441 400 381 340 321 280 261 220 201 X X X 81 40 21 461 X 401 380 341 320 281 260 221 200 X X X X X 20 X 439 402 X 342 319 282 259 222 199 X X 102 79 42 19 X X X X 343 X 283 X 223 X 163 X X 78 43 18 464 X 404 377 344 317 284 257 224 197 164 X 104 77 44 X X X 405 376 345 316 285 X 225 196 X 136 105 76 45 16 X 435 406 375 346 315 286 255 226 195 166 135 106 75 46 15 467 434 407 374 347 314 287 254 X 194 167 134 107 74 47 14 468 433 408 373 348 313 288 253 228 193 168 133 108 73 48 13 469 432 409 372 349 X X 252 229 192 169 132 109 72 49 12 470 431 410 X 350 311 290 251 230 X 170 131 110 71 50 11 471 430 411 370 351 310 291 250 231 190 X 130 111 70 51 10 X 429 X 369 X 309 292 X X 189 X 129 112 X 52 9 473 428 X 368 353 308 293 X X 188 173 X 113 68 53 8 474 X 414 367 354 307 294 X 234 187 X X 114 67 54 7 475 X X X X X 295 X 235 186 175 126 115 66 55 X 476 425 X 365 356 305 X 245 236 185 176 X 116 65 56 X X 424 X 364 357 304 297 X 237 184 177 124 117 X 57 4 478 X 418 363 X 303 X 243 238 183 X 123 118 63 58 X 479 X 419 362 X 302 299 X 239 182 X 122 X X 59 2 480 421 420 361 360 301 X 241 X 181 180 121 120 61 60 1  S p u r R o a d  S p u r R o a d     EP.1123.02.05 Kilby - Harrison Mills Ct     er Fraser River      r37 r36 r35 r34 r33 r32 c16    c15    c14    c13    c12    c11    c10     c9      c8      c7      c6      c5      c4      c3      c2      c1                           r31 r30               r30 r29               r29 r28               r28 r27               r27 r26               r26 r25               r25 r24               r24 r23               r23 r22               r22 r21               r21 r20               r20 r19               r19 r18               r18 r17               r17 r16               r16 r15                r15 r14                r14 r13                r13 r12                r12 r11                r11 r10                r10 r9 r9 r8 r8 r7                 r7 r6                 r6 r5                 r5 r4                 r4 r3                 r3 r2                 r2 r1 r1 rep 6 c1 c2 c3 c4 c5 c6 c7 c8 c9 c10 c11 c12 c13 c14 c15 c16 c17 c18 c19 c20 c21 c22 c16 c15 c14 c13 c12 c11 c10 c9 c8 c7 c6 c5 c4 c3 c2 c1 c1 c2 c3 c4 c5 c6 c7 c8 c9 c10 c11  c12 c13 c14 c15 c16 c17 c18 c19 c20 c21 c22 rep 4 Provenance Trial EP.1123.02.05    X 2550 2567 2568 2585 2586 2603 X 2621 2622 2639 2640 2657 2658 2675 X 2693 2694 2711 2712 2729 2730 X X 2768 2769 X X X 2817 X X 2864 2865 2888 2889 2912 X 2936 X X 2548 2551 2566 X X X 2602 2605 X 2623 2638 X 2656 X 2674 X 2692 2695 2710 2713 X 2731 X 2749 2767 2770 X X X X X X X 2866 2887 X X 2914 X X X 2547 X X 2570 X 2588 2601 2606 2619 2624 2637 2642 2655 2660 2673 2678 X X X 2714 X 2732 X 2750 2766 X 2790 X 2814 2819 X X 2862 X X X X X 2934 X 2958 2546 X 2564 2571 2582 2589 2600 2607 2618 2625 2636 X 2654 2661 X X X X X X 2726 2733 X X 2765 X 2789 X 2813 2820 X 2844 X X 2885 X 2909 X 2933 X 2957 2545 X X 2572 X 2590 2599 2608 2617 X X X X 2662 2671 2680 2689 X 2707 2716 2725 2734 2743 2752 2764 X X 2797 2812 2821 X X 2860 X X 2893 2908 2917 X X X 2544 X X X 2580 2591 2598 2609 2616 X 2634 2645 2652 X X X 2688 2699 2706 X 2724 2735 X 2753 X 2774 X X X 2822 X X 2859 2870 2883 2894 X 2918 X X X X X X 2574 X 2592 2597 2610 X 2628 2633 2646 2651 X X 2682 X X 2705 2718 X X X 2754 X X X X X X 2834 2847 X 2871 X X 2906 X 2930 X X 2542 2557 2560 2575 2578 X 2596 X 2614 X 2632 X 2650 2665 2668 2683 X X 2704 2719 X 2737 2740 2755 2761 X X X X X 2833 2848 2857 X 2881 2896 2905 2920 X X 2953 2541 X 2559 X 2577 2594 2595 2612 2613 2630 2631 2648 X 2666 X 2684 2685 X 2703 X X X X X X 2777 2784 2801 2808 X X 2849 2856 2873 2880 2897 2904 X X 2945 2952  X 2778 2783 2802 2807 X 2831 2850 X 2874 X 2898 2903 2922 2927 X X 2758 2779 X 2803 X 2827 2830 2851 2854 2875 2878 2899 2902 2923 2926 X X 2757 2780 X 2804 X 2828 2829 2852 2853 2876 X 2900 X 2924 2925 2948 2949  2192 2193 2224 2225 2256 2257 2288 2289 2320 2321 X X X  2191 2194 2223 2226 2255 X 2287 2290 2319 2322 2351 2354 2383 2190 X 2222 2227 2254 X X 2291 2318 2323 2350 2355 2382 2189 X 2221 2228 2253 2260 X 2292 2317 2324 2349 2356 2381 2188 2197 2220 2229 2252 2261 2284 2293 2316 2325 2348 2357 2380 X 2198 2219 2230 2251 2262 2283 2294 2315 2326 2347 2358 X X 2199 2218 2231 X 2263 2282 2295 X X 2346 2359 2378 2385 2404 2405 2424 X 2444 2445 2464 2465 2484 r10 r9 r8 r7 r6 r5 r4 r3 2185 2200 2217 X 2249 2264 2281 2296 X 2328 2345 2360 2377 2386 2403 2406 2423 2426 2443 2446 2463 2466 X 2184 2201 2216 2233 2248 2265 2280 X X 2329 2344 2361 X 2387 X 2407 X 2427 2442 2447 2462 X X 2183 2202 2215 2234 2247 X X X 2311 X 2343 X X 2388 2401 2408 2421 2428 X 2448 2461 2468 2481 2182 2203 2214 2235 2246 2267 2278 2299 2310 X 2342 2363 2374 2389 2400 X 2420 2429 2440 2449 2460 X 2480 X 2204 2213 2236 X X 2277 2300 2309 2332 X X 2373 2390 2399 2410 X 2430 2439 2450 2459 X 2479 2180 2205 2212 2237 2244 2269 2276 2301 2308 X X 2365 2372 2391 2398 2411 2418 2431 2438 2451 2458 2471 2478 2179 2206 X X 2243 2270 2275 X X X 2339 X 2371 2392 X 2412 2417 2432 2437 2452 2457 2472 2477 X X 2210 X X X 2274 X X X X X 2370 2393 2396 2413 2416 2433 2436 X 2456 X X X 2177 2208 2209 X 2241 2272 2273 X X 2336 2337 2368 X 2394 2395 2414 X 2434 2435 2454 2455 2474 X 2486          Fraser River Fraser River   rep 7  c23 c24 c25 c26 c27 c28 c29 c30 c31 c32 c33 c34 c35 c36 c37 c38 c39 c40 c41 c42 c43 c44 c45 c46 c47 c48 c49 c50 c51 c52 c53 c54 c55 c56 c57 c58 c59 c60 c61 c62 c63            rep 6    rep 7            r16 r15 r14 r13 r12 r11      rep 4     r2 r1 c23 c24 c25 c26 c27 c28 c29 c30 c31 c32 c33 c34 c35 c36 c37 c38 c39 c40 c41 c42 c43 c44 c45 c46 Provenance Trial EP.1123.02.05    X X X X X 3032 X X X X X 3104 X X X X X 3176 X X X 3224 X X X X X X X 3007 3010 X X X 3058 X X X X X X X X X X X 3202 X X 3247 X X X X 2987 X X 3030 X X X X X X X X X X 3155 X X X X X X X X X X X X X 3012 X 3036 X X X X X X X X X X X X 3197 3204 X 3228 X X X X X 2989 X X X 3037 3052 X 3076 X 3100 3109 X X X X X 3181 X 3205 X 3229 3244 X X X X 2990 X X X X X X 3075 X X 3110 3123 3134 3147 X X X 3195 X X 3230 X 3254 X X X X X 3015 X X 3050 X X 3087 X X X 3135 X X 3170 X 3194 3207 X 3231 3242 X  X X X 3001 3016 X X X X X X X X X X X X 3169 X X X 3217 X X X X 2976 X 3000 3017 3024 3041 X 3065 X X 3096 X X X X 3161 3168 X X 3209 3216 X X X X 2975 2994 2999 X 3023 X X 3066 X X X X 3119 3138 X 3162 X X 3191 3210 X 3234 3239 X 2971 2974 2995 2998 3019 X 3043 X X X X X 3115 3118 3139 3142 3163 3166 X 3190 X 3214 3235 X X 2972 X 2996 2997 3020 X 3044 X 3068 3069 3092 X 3116 3117 X 3141 X 3165 3188 3189 X 3213 3236 X 3260          Fraser River   rep 8 c64 c65 c66 c67 c68 c69 c70 c71 c72 c73 c74 c75 c76 c77 c78 c79 c80 c81 c82 c83 c84 c85 c86 c87 c88 c89                 rep 8    r37 r36 r35 r34 r33 r32 r31 r30 r29 r28 r27 r26  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Country Views Downloads
United States 11 3
Canada 8 0
Germany 6 0
China 6 5
Russia 1 0
City Views Downloads
Unknown 6 7
Ashburn 5 0
Québec 4 0
Shenzhen 4 5
Mountain View 3 0
Fargo 2 0
Beijing 2 0
Edmonton 2 0
Dieppe 2 0
Saint Petersburg 1 0
Fremont 1 0

{[{ mDataHeader[type] }]} {[{ month[type] }]} {[{ tData[type] }]}
Download Stats

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.52966.1-0075629/manifest

Comment

Related Items