UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Studies on the transcription of photosynthesis genes of the photosynthetic bacterium Rhodobacter capsulatus Forrest, Mary Elspet 1988

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1988_A1 F68.pdf [ 9.84MB ]
Metadata
JSON: 831-1.0302154.json
JSON-LD: 831-1.0302154-ld.json
RDF/XML (Pretty): 831-1.0302154-rdf.xml
RDF/JSON: 831-1.0302154-rdf.json
Turtle: 831-1.0302154-turtle.txt
N-Triples: 831-1.0302154-rdf-ntriples.txt
Original Record: 831-1.0302154-source.json
Full Text
831-1.0302154-fulltext.txt
Citation
831-1.0302154.ris

Full Text

STUDIES O N THE TRANSCRIPTION OF PHOTOSYNTHESIS GENES OF THE PHOTOSYNTHETIC BACTERIUM RHODOBACTER CAPSULATUS by Mary Elspet Forrest B.Sc, University of Calgary, 1982 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (DEPARTMENT OF MICROBIOLOGY) We accept this thesis as conforming to the required standards THE UNIVERSITY OF BRITISH COLUMBIA AUGUST 1988 © Mary Elspet Forrest, 1988 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department of The University of British Columbia 1956 Main Mall Vancouver, Canada V6T 1Y3 Date QCJ 11/88 i i A B S T R A C T Rhodobacter capsulatus is a G r a m negative bacterium that exhibits a variety of growth modes, i n c l u d i n g chemoheterotrophic growth and photoheterotrophic growth. U p o n a shift of cultures f r o m h i g h to l o w oxygen concentrations the photosynthetic apparatus is synthesized and incorporated into the inner membrane. The puf operon contains genes that encode structural proteins f o u n d i n the light-harvesting and reaction center complexes. In a p r e l i m i n a r y attempt to p i n p o i n t the location of the p u f promoter R. capsulatus R N A polymerase was p u r i f i e d by standard techniques and used i n i n v i t r o run-off transcription assays. It was found that the polymerase was capable of specific transcription w i t h l i n e a r i z e d p U C 13 D N A but no specific transcription c o u l d be obtained w i t h K capsulatus DNA. It was concluded that some factor or condition necessary for specific transcription w i t h R capsulatus D N A was absent from these assays. The location of the puf promoter was subsequently f o u n d through a series of deletions and oligonucleotide-directed mutations i n the 5' region of the puf operon. Fragments that contained these mutations were placed translationally in-frame w i t h the l a c Z gene of Escherichia c o l i i n plasmids that c o u l d be conjugated into K capsulatus. Assays of beta-galactosidase activities under l o w and high oxygen conditions resulted i n l o c a l i z a t i o n of the promoter i i i to a position approximately 540 basepairs upstream of what was previously believed to be the first gene of the operon, the pufB gene. RNA 5' end-mapping experiments showed that the quantity of RNA transcripts obtained were comparable to the lacZ activities. The existence of multiple low abundance RNA 5' ends prompted the theory that the primary transcript has a short half-life, and is rapidly processed to yield a more stable transcript with a 5' end that maps just upstream of the pufB gene. It was found that only the 5' end nearest to the promoter could be capped by guanylyl transferase, and this could only be detected when the putative processing sites were deleted. The D N A sequence between the promoter and the pufB gene contains a new gene of the puf operon, the pufQ gene. Deletion of this gene showed that it plays an essential role in the formation of mature light-harvesting and reaction center complexes. i v TABLE OF CONTENTS ABSTRACT ii LIST OF TABLES vii LIST OF FIGURES viii ABBREVIATIONS A N D SYMBOLS x ACKNOWLEDGEMENTS xii INTRODUCTION 1 MATERIALS A N D METHODS 12 1. Bacterial strains, growth conditions, and beta-galactosidase assays 12 1.1. Bacterial strains 12 1.2. Growth of bacterial cultures for RNA polymerase purification 12 1.3. Growth of bacterial cultures for beta-galactosidase assays 13 2. Purification of R. capsulatus RNA polymerase 13 2.1. Purification of RNA polymerase for run-off transcription assays...13 2.2. Further purification of RNA polymerase 14 2.3. RNA polymerase assays 14 3. Run-off transcription assays 15 V 4. Polyacrylamide gel electrophoresis 16 4.1. Slab gel electrophoresis of RNA polymerase 16 4.2. Polyacrylamide gel electrophoresis of RNA transcripts 16 5. Preparation of D N A and cellular RNA 17 5.1. Preparation of D N A 17 5.2. Purification of cellular RNA 17 6. Plasmid constructions 17 6.1. Construction of the promoter-identification vector pXCA601 17 6.2. Construction of the lacZ fusion plasmids 19 6.3. Site-directed mutagenesis 23 6.4. Construction of the pufQ gene deletion 26 7. Sl nuclease mapping of RNA 26 7.1. Sl nuclease mapping of puf operon RNA ends 26 7.2. Sl nuclease protection experiments for detection of RNA from the puc operon 27 8. Primer extension experiments 28 9. Capping experiments 28 10. Absorption spectroscopy of various strains of R. capsulatus 29 RESULTS 30 1. Purification and characterization of RNA polymerase 30 1.1. Purification of RNA polymerase 30 v i 1.2. Optimization of the assay conditions 33 1.3. Subunit composition of RNA polymerase 35 1.4. Gel electrophoresis of run-off transcription products 39 2. Localization of the puf promoter 47 2.1. Localization of the puf promoter through gene fusion experiments 47 2.2. Absorption spectrophotometric analysis.of puf promoter mutants 52 2.3. Mapping of RNA transcripts from the puf operon 57 2.4. Mapping of a capped RNA 5' end 69 3. Assessment of the role of the pufQ gene product 74 3.1. Absorption spectroscopy of cells containing wild-type or mutant pufQ genes 74 3.2. The effects of pufQ on transcription and translation of puf or puc mRNA 78 DISCUSSION 81 REFERENCES 91 APPENDIX 98 v i i LIST OF TABLES Table I. Summary of RNA polymerase purification 32 Table II. Utilization of different templates by R capsulatus RNA polymerase 34 Table III. Utilization of templates used for run-off transcriptions 43 Table IV. Assays of beta-galactosidase activities of cells containing puf 5' regions fused to the lacZ gene of pXCA601 49 v i i i LIST OF FIGURES Figure 1. A diagramatic representation of the photosynthetic apparatus of Rhodobacter sphaeroides 3 Figure 2. A representation of the puf operon and mapped RNA transcripts 7 Figure 3. Nucleotide sequence of part of the puf promoter region 9 Figure 4. A representation of the promoter identification vector pXCA601...18 Figure 5. Construction of the puf promoter deletion mutants in pXCA601....20 Figure 6. Construction of oligonucleotide-directed mutations in pXCA601...24 Figure 7. Chromatography of RNA polymerase from chemoheterotrophically grown cells 31 Figure 8. SDS polyacrylamide gel electrophoresis of purified RNA polymerase from chemoheterotrophically and photoheterotrophically grown K capsulatus 36 Figure 9. SDS polyacrylamide gel electrophoresis of RNA polymerase after DEAE-Sephadex chromatography 38 Figure 10. SDS polyacrylamide gel electrophoresis of RNA polymerase after glycerol gradient centrifugation 40 i x Figure 11. A representation of the construct pJAJ21 42 Figure 12. Polyacrylamide gel electrophoresis of run-off transcripts obtained with photoheterotrophic RNA polymerase 44 Figure 13. Polyacrylamide gel electrophoresis of run-off transcripts obtained with photoheterotrophic RNA polymerase and the purified |L capsulatus promoter fragment as template 46 Figure 14. A representation of the vector pTB999 54 Figure 15. Absorption spectra of various strains of JL capsulatus 55 Figure 16. Construction of D N A probes used in RNA end-mapping experiments 59 Figure 17. 5' end-mapping of BIO RNA with Sl nuclease 61 Figure 18. Primer extension titration experiment 62 Figure 19. 3' end-mapping of BIO RNA with Sl nuclease 65 Figure 20. 5' end-mapping of RNA from K capsulatus ARC6 containing puf/lac fusion plasmids by Sl nuclease 67 Figure 21. 5' end-mapping of capped RNA with nucleases 70 Figure 22. Absorption spectra of R. capsulatus strains BIO, ARC6, and U43 75 Figure 23. Absorption spectra of various strains of R. capsulatus 77 Figure 24. Sl nuclease protection measurement of puc mRNA from BIO and ARC6 80 Figure 25. Processing of puf mRNA 89 X ABBREVIATIONS A N D SYMBOLS Ap ampicillin ATP adenosine triphosphate bchl bacteriochlorophyll a BSA bovine serum albumin ca approximately Ci Curie CTP cytidine triphosphate cyt C2 cytochrome C2 D N A deoxyribonucleic acid dpm disintegrations per minute dut . dUTPase gene of K coli EDTA ethylenediaminetetraacetic acid GC guanine /cytosine G T A gene transfer agent GTP guanosine triphosphate kb kilobase lacY E. coli lactose permease gene lacZ E. coli beta-galactosidase gene x i B870 B800-850 m R N A ntr ONPG puc puf puhA RF R N A SDS SDS-PAGE ss Tc T C A U ung UTP light-harvesting I (LH I) complex light-harvesting II (LH II) complex messenger RNA E. coli nitrogen regulation genes ortho-nitrophenyl-beta-D-galactoside K capsulatus puc operon, encodes B800-850 structural proteins K capsulatus puf operon, encodes B870 (B and A) and reaction center (L and M) structural proteins, plus two open reading frames (Q and X) K capsulatus gene for the H protein of the reaction center replicative form ribonucleic acid sodium dodecyl sulphate SDS-polyacrylamide gel electrophoresis single stranded tetracycline trichloroacetic acid uracil E. coli uracil glycosylase gene uridine triphosphate x i i ACKNOWLEDGEMENTS I would like to thank my supervisor Tom Beatty for his constant support and for teaching me how to become a researcher. I would also like to thank my fellow lab members, especially Cheryl Keen, Tim Lilburn, and Anthony Zucconi, for their friendship and advice. I am very grateful for the support from a University of British Columbia Fellowship, a Natural Sciences and Engineering Research Council Postgraduate Fellowship, and an Izaak Killam Postgraduate Fellowship. This work was supported by a Natural Sciences and Engineering Research Council Grant, A-2796. I would like to acknowledge the members of my committee and all the people in the Department of Microbiology at the University of British Columbia for their warmth and helpfulness. I dedicate this thesis to Gord and to my family for their love and for always believing in me. 1 INTRODUCTION My thesis has been directed toward the study of gene expression in the Gram negative photosynthetic bacterium Rhodobacter capsulatus (formerly known as Rhodopseudomonas capsulata [25]). R capsulatus shares many traits with other photosynthetic bacteria, especially K sphaeroides. Although most of the information presented in this section was obtained from studies of R. capsulatus, occasionally some general statements derive from studies of R. sphaeroides [27]. JL capsulatus regulates the composition and amount of its cell membrane in response to oxygen concentration and light intensity. Under high oxygen tension (high O2) cells grow chemoheterotrophically by respiration and the cell membrane composition is similar to that of non-photosynthetic bacteria [19]. When the oxygen tension is lowered, the photosynthetic apparatus is synthesized and the cytoplasmic membrane becomes an invaginated intracytoplasmic membrane into which the photosynthetic complexes are inserted [19]. There are three distinct pigment-protein complexes contained in the photosynthetic apparatus (seen in Fig. 1). There are two different light-harvesting 2 complexes that gather the light energy and funnel it toward the third complex, the reaction center, where the light energy is turned into electron flow [20]. Cyclic electron flow results in protons being pumped across the membrane to create a proton gradient that drives the synthesis of ATP [20]. The key pigment involved is bacteriochlorophyll a (bchl) which either traps and transfers light energy in the light-harvesting complexes, or is involved in the excitation of electrons to initiate cyclic electron transport in the reaction centers [19]. Carotenoids are present to shield the cell from harmful byproducts due to photo-oxidation, and also may harvest some light energy at wavelengths outside of the bchl/protein complex absorption range [47]. The B800-850 light-harvesting complex is so named because of the maximal wavelengths at which it absorbs light [56]. Each complex contains two alpha and two beta peptides, which bind six molecules of bchl and three carotenoids. A third peptide, of 14 kiloDaltons, co-purifies with the alpha and beta peptides but it does not bind pigments and its function is unknown [56]. This complex is present in the cell in varying amounts relative to the reaction center, depending on the light intensity [41]. As the light intensity decreases the number of B800-850 complexes increases in order to maximize the efficiency of photon capture. The second light-harvesting complex, the B870 complex, absorbs light maximally at 870 nm and also contains two peptides (B870 alpha and beta) that bind two molecules each of bchl and carotenoids [20]. These complexes are 3 Fig. 1. A diagramatic representation of the photosynthetic apparatus of K sphaeroides, a facultatively photosynthetic bacterium that is functionally similar to JL. capsulatus. Shown are the B800-850 and B875 (comparable to the B870 of R. capsulatus) complexes as well as the reaction center complex (designated RC). Also shown is the cyt 0 2 /bc i complex with the mobile cyt C 2 protein, and the ATP phosphohydrolase complex. The succinate DH and NADH DH complexes are involved in maintainence of the redox state of the quinone pool. The symbols are as follows: Q and Q H 2 , the quinone pool; ADP, adenosine 5'-diphosphate; ATP, adenosine 5'-triphoshate; DH, dehydrogenase; NADH, reduced nicotinamide adenine dinucleotide. Reproduced from Kiley and Kaplan [27] with the permission of the authors and the American Society for Microbiology. 4 believed to be in a relatively constant ratio with the reaction centers (approximately 10-20 B870 complexes per reaction center). It is generally believed that the flow of light energy is from B800-850 to B870 to reaction center [21]. The reaction center contains three peptides, designated L, M , and H , which orient four bchl molecules and other cofactors (bacteriopheophytin, iron, and quinones) in the membrane [54]. The cycle of electron flow that initiates at the reaction center is completed by the diffusion of a reduced quinone to the cytochrome C2:oxidoreductase (cyt C 2 / bc^) complex, and the transfer of an electron from this complex back to the reaction center by a mobile, periplasmic cytochrome C 2 (cyt C2) carrier [14]. However, R capsulatus (in contrast to R. sphaeroides) is also capable of tranferring electrons directly from the bc\ complex to the reaction center [15]. Genetic analysis of the K. capsulatus genome has been accomplished by use of promiscuous R plasmids that act to catalyze chromosome transfer [34,51], and fine-structure mapping has been done by use of gene transfer agent (GTA). GTA acts like a generalized transducing phage and packages random fragments of chromosomal DNA, but only host D N A has been found in the GTA particles [33]. GTA has been used as a vehicle to transfer genes mutated in vitro into the chromosome by homologous recombination [51]. The analyses of these mutants have greatly advanced the study of genes needed for photosynthesis. Almost all of the genes known to be necessary for photosynthesis have 5 been found in a cluster of about 50 kilobases (kb) on the chromosome [34]. Genetic and physical maps have been aligned and specific genes have been isolated. The genes encoding the two B870 peptides have been designated the B and A genes and are part of an operon that also encodes two of the reaction center peptides (L and M). This was previously designated the rxcA operon [54], but is now known as the puf operon. The gene for the third reaction center peptide is called puhA and is separate from the L and M genes [54]. The H peptide has been shown to be present in K sphaeroides cells grown aerobically and may be involved in assembly of the reaction center upon a shift to low C*2 [12]. Other genes found in the cluster are genes involved in the biosynthesis of the bchl and carotenoid pigments. The genes for the B800-850 structural proteins map just outside of the 50 kb cluster in close proximity to one another, and have been shown to be in one operon, the puc operon [58]. At the time I began my thesis work it was known that after a shift from chemoheterotrophic growth to photoheterotrophic growth there was an 80 fold increase in bchl, and that the number of photosynthetic complexes increased 10-20 fold [40]. Corresponding with these increases was an increase in levels of mRNA encoding bchl biosynthetic enzymes and photosynthetic complex peptides [13]. It had also been found that cells that contained plasmids with photosynthesis peptide gene fusions to the lacZ gene of R coli had more beta-6 galactosidase activity when grown in low O2 conditions [8]. Since the levels of mRNA and lacZ expression roughly corresponded to the levels of photosynthetic complexes found in cells grown under high O2 and low O2 conditions, it appeared that expression of these genes was regulated by oxygen and that the regulation was at the level of transcription. The mechanism of regulation by O2 was not known but had been postulated by various people to involve a redox carrier, a repressor or activator protein, or the intracellular levels of some small effector molecule [27]. I have focussed my work on the localization of the C>2-regulated promoter for the puf operon. Figure 2a shows a representation of the puf operon with the four known genes: B and A (genes for the B870 peptides) and L and M (genes for two of the three reaction center peptides), and the two open reading frames Q (see below) and X [54]. The use of Sl nuclease for RNA end-mapping studies of this operon had located a 5' RNA end (end 4 in Fig. 2a) about 100 base pairs upstream from the pufB gene [8]. This RNA transcript was found to have three 3' ends that mapped 0.49, 0.5, and 2.7 kb downstream from the 5' end [8]. The molar ratio of the longer:shorter transcripts is about 1:9, and the longer transcript in Figure 2a has been shown to be a precursor transcript which is then processed to yield the shorter transcripts [8]. The pufX open reading frame is co-transcribed with the 2.7 kb puf transcript but no gene product has yet been found. A segment of the 5' region of the puf operon, from the XhoII to the 7 Fig. 2. A representation of the puf operon and mapped RNA transcripts. 2a represents the puf operon with the 6 known genes (Q, B, A, L, M , and X; L and M actually overlap [54]); 2b represents the puf promoter region expanded from 2a (1.1 kb from XhoII to SphI). The thin lines represent non-coding regions of D N A and the thick lines represent puf genes. The arrows represent RNA transcripts with thinner arrows designating less abundant transcripts. The arrows above the puf operon in 2a represent transcripts previously studied [8], and the 5' end of these transcripts has been designated end 4. The thinner arrows below the promoter fragment in 2b represent recently mapped transcripts, with 5' ends 1, 2, and 3, while the thick arrow represents the 5' end of the transcripts seen in 2a. The letters shown below the D N A designate restriction endonuclease recognition sites as follows: X, XhoII; Sp, SphI; A, AccI; 5, Sail; E, EcoRI; M , Mnll. 8 SphI restriction sites shown i n Figure 2a, is expanded i n Figure 2b and can be seen to contain the p u f Q gene and the 5' end of the p u f B gene, as w e l l as the site of the 5' end of the R N A transcripts described above. This thesis presents the results of R N A end-mapping studies that have located the 5' ends of R N A molecules that map even further upstream than the p r e v i o u s l y discovered 5' end, and that are less abundant i n the cell. Three of these less abundant transcripts have 5' ends that map upstream of the p u f Q gene and are shown i n Figure 2b, designated ends 1, 2, and 3. A large portion of the D N A fragment shown i n Figure 2b has been sequenced [1,5,54] and part of this sequence is shown i n Figure 3. A n important feature of this sequence is the presence of an open reading frame that is capable of encoding a 74 amino acid l o n g protein [1,5]. This open reading frame is preceded by a possible Shine-Dalgarno sequence that is s i m i l a r to other k n o w n R. capsulatus Shine-Dalgarno sequences [54]. The open reading frame, designated p u fQ, has been shown to contain a hydrophobic stretch of amino acids [1]. Other puf operon gene products have also been shown to contain hydrophobic stretches [54] and a comparison of these showed sequence s i m i l a r i t y between p u f Q and the p u f L and p u f M gene products [1]. The segments of L and M that a l i g n w i t h the p u f Q gene product are believed to be transmembrane stretches that b i n d bacteriochlorophyll pigments [2,54]. The possible role of p u f Q has been studied and w i l l be discussed later i n this thesis. A l s o shown i n Figure 3 are 9 10 20 30 40 50 60 70 80 90 100 A4 ACCTTGCGCCTTTGCGGTGGCCCGAAAGGCCGGAGAGAAGACGAAAAGCGACGAAGTTCGCGGTTTGATCCGCCAAACTCGCCCTCTGGTGGTGTTCGGC 110 120 130 140 150 160 170 180 190 200 TCGATCAACGAGAAGATTTATCTGGCCGAAACCAAGGCCGGCCACGCTGCGGCCTCGTTCGTGCGCGCTTCCTTCCCCGGCGCGGCGATCCGCCGCGCGA Nael 210 220 230 240 250 260 270 280 290 300 A14 CGGGCACCCCCTTCATGGGTTACATGGGTAGCGTCTACCTGCTGCAAGAAATCTGTAACGGACTGTTCGACGCGCTGTTCAATATCCTGCCGCTTGCTTC AccI 310 320 330 340 350 360 370 380 390 400 A24 CGAAATGGACAGTGCTGCGGCAACACCGGCAACCTTGCGTCGTGACATGCCCTGGATGCGGATGCGCAGGCGGCTCTGGACCGGATCGTGTCGCAACACC 410 420 430 440 450 460 470 480 490 500 CGGTTCTGACACGGATTTCGGCGGCCAAGTCGCTGCGTGACGCGGCCGAGAAGGCGGCTCTCGATCAGGGGGCTGAAAGAGTGGTTCTTGAAATGGTCGA 510 520 530 540 550 560 570 580 590 600 SD m q s q r l r a h g v q h v d r v p r AGCCCTGGGCGACGCGACCATGGATCGGAAGGGGGGGAACTGAAATGCAAAGCCAGCGTCTTCGCGCTCATGGGGTCCAACATGTCGACCGCGTGCCGCG Sail 610 620 630 640 650 660 670 680 690 700 p e f a l y f s l i l i v a v p f a l v g w v m a l v r e r r i p TCCCGAGTTCGCGCTTTACTTTTCGCTGATCCTGATCGTCGCGGTGCCTTTCGCGCTGGTCGGCTGGGTCATGGCCCTGGTGCGCGAGCGCCGCATCCCC 710 720 730 740 750 760 770 780 . 790* 800 e c g p f a r a w r e a g e i t p e l f r p e . GAGTGCGGGCCCTTCGCCCGCGCCTGGCGCGAGGCGGGCGAGATCACGCCCGAGATTTTCCGGCCCTGAGCCGGTACGGAATTCCGGCGGGGGCCATAGC EcdRI 810 820 830 840 850 860 870 880 890 900 CCCGTCGGGTCAAGTTCTCCACGGGTGGGATGAGCCCCTCGTGGTGGAAATGCGGGATGGCAGGTGCCATTTCGTTTGCCCAGCCGCAGGGAATGCGGCG 910 920 930 940 950 960 970 980 990 SD m a d k n d l s f t g l t d e q a q e l h " TCAGTCTGCCAATCCGGAGGTTGTTATGGCTGATAAGAACGACCTGAGCTTCACAGGTCTTACCGACGAGCAAGCGCAAGAACTGCAT1 Mnll Fig. 3. Nucleotide sequence of part of the puf promoter region. The sequence begins approximately 115 nucleotides downstream of the XhoII site, shown in Fig. 2, to within the pufB gene. The amino acid sequences of the pufQ and part of the pufB genes are shown above the D N A sequence. The Shine-Dalgarno sequence (SD) of the pufB gene is indicated above the D N A sequence as is a possible Shine-Dalgarno sequence for pufQ. The end-points of the A4, A14, and A24 deletions are also shown above the D N A sequence. The palindromes removed to create the A41 and A42 deletions are indicated by solid lines beneath the D N A sequence, as are the locations of key restriction enzyme recognition sites. Two • symbols adjacent to the AccI site indicate the possible position of the 5' end of RNA transcript 1 discussed in the text. 10 sequences that were mutagenized to a i d i n lo c a l i z a t i o n of the p u f promoter. The photosynthesis genes have not yet been expressed i n heterologous systems such as R c o l i and it is believed that part of this block is at the level of transcription [26]. For this reason, studies of R. capsulatus gene expression have been performed i n mutant cells of K capsulatus through what is sometimes slow and tedious work. Therefore I i n i t i a l l y attempted to develop an i n v i t r o transcription assay system us i n g K capsulatus R N A polymerase i n order to create a simple and fast method of assaying for promoter activity. The results of this w o r k are described i n the first part of my thesis. A n other approach taken to locate the p u f promoter was to compare the i n v i v o effects of wild-type and mutant promoter fragments on genes carried by conjugative plasmids. This was accomplished w i t h the use of vectors that enabled promoter activity to be monitored b y f o l l o w i n g expression of the R c o l i  l a c Z gene. Since K capsulatus does not o r d i n a r i l y use lactose as a cabon source, expression of the l a c Z gene i n this bacterium proved to be a useful tool for study of gene expression and promoter mutations. The location of the p u f promoter was f o u n d through the use of deletions and oligonucleotide-directed mutations, as were sequences that may be i n v o l v e d i n C*2 regulation of the promoter. The results of the gene f u s i o n w o r k were correlated w i t h measurement of the levels of m R N A fo u n d i n the cells, and R N A 5' ends were mapped by a number of techniques. M y data show that transcription initiates at R N A end 1 11 (see F i g . 2) a n d that p r o c e s s i n g is the p r o b a b l e cause o f the p r e s e n c e o f the o t h e r R N A t r a n s c r i p t s , i n c l u d i n g the m o s t stable t r a n s c r i p t s w i t h e n d 4. T h i s p r o c e s s i n g o f the p r i m a r y t r a n s c r i p t m a y be a n o t h e r m e t h o d of c o n t r o l of s y n t h e s i s o f the p h o t o s y n t h e t i c c o mplexes. 12 MATERIALS A N D METHODS 1. Bacterial strains, growth conditions, and beta-galactosidase assays 1.1 Bacterial strains. The R. capsulatus wild-type strain BIO has been described [33], as have the deletion mutant strains ARC6 [11], and U43 [55]. 1.2. Growth of bacterial cultures for RNA polymerase purification. Cultures of R capsulatus BIO were grown at 34°C in 20 liter batches of RCV medium [49] supplemented with 10 mM potassium phosphate buffer (pH 6.8) and 0.1% yeast extract, in a glass fermentation vessel. Chemoheterotrophic (aerobic) cultures were vigorously aerated with 12 liters per minute of sterile air, with 250 rpm agitation. These cultures were grown only to a density of approximately 2.4 x 10^ cells/ml to minimize the effects of oxygen limitation. Measurement of bacteriochlorophyll in such cultures confirmed that levels of this pigment were 300-fold lower than in cells grown photosynthetically. Medium for photoheterotrophic (anaerobic) growth of cells was purged of oxygen by vigorous bubbling with 5% CO2 in N 2 for 0.5 hr prior to inoculation. After inoculation the medium was sparged for 15 min before sealing the fermentor. 13 Illumination was provided by a bank of nine 60 Watt Lumiline tungsten lamps encircling the vessel. The cells were grown to a density of about 4 x 10^ cells/ml. The cells were collected by centrifugation through a Sharpies continuous flow centrifuge. The cell paste was stored at -80°C immediately after centrifugation. 1.3. Growth of bacterial cultures for beta-galactosidase assays. R. capsulatus was grown under low and high G*2 conditions as described [8]. The cultures were inoculated at a cell density of 0.8 x 10^ cells/ml and grown to a cell density of 3.2 x 10^ cells/ml. Twenty-five ml of cells were then harvested for assays as described [8]. 2. Purification of K capsulatus RNA polymerase 2.1. Purification of RNA polymerase for run-off transcription assays. RNA polymerase was purified using a modified version of a published procedure [45]. The procedure was performed at 0-4°C and was changed as described below. The fractions from the D N A cellulose column containing activity were combined and concentrated as before [45], diluted with buffer B (buffer A + 10% glycerol) to a conductivity of 5 milliohms (equivalent to buffer B containing 0.1 M NaCl), and applied to a 1 x 3 cm heparin-Sepharose column. 14 The column was washed successively with 3 column volumes each of solutions of buffer B containing 0.1 M , 0.25 M and 0.35 M NaCl, and then the RNA polymerase activity was eluted with buffer B containing 0.6 M NaCL 2.2. Further purification of RNA polymerase. One milliliter (150 ng) of RNA polymerase from the heparin Sepharose eluate was diluted to a conductivity equivalent to 0.1 M NaCl in buffer B and applied to a 1 x 2 cm column of DEAE Sephadex. The enzyme was eluted with 12 ml of a 0.1 M to 0.6 M NaCl gradient in buffer B. Fractions of 0.5 ml were collected and assayed for activity. A second milliliter (150 |ig) of RNA polymerase from the heparin Sepharose column was applied to a 15 to 30% glycerol gradient made in buffer A with 0.5 M NaCl (in a 9/16 by 3 1/2" tube). After centrifugation for 24 hr at 37,000 rpm in a SW41 rotor at 4°C, the bottom of the tube was pierced and 0.5 ml fractions were collected and assayed for activity. 2.3. RNA polymerase assays. RNA polymerase assays for monitoring polymerase activity through its purification contained: 48 mM Tris-HCl, pH 8.2; 8 mM M g C l 2 ; 40 mM NaCl; 10% glycerol; 1.6 mM ATP, CTP, and GTP; 16 uM UTP; 28 nM ^H-UTP (14 uCi/nmole); 5 (ig salmon sperm DNA; and various amounts of RNA polymerase in a total volume of 500 ul. The tubes were incubated at 15 34°C for 10 min and RNA was precipitated by addition of 1.0 ml of 10% trichloroacetic acid. One unit of activity was defined as one nmole of UTP incorporated in 10 min. The amount of protein present was determined by measurement of Coomassie blue dye binding (Bio-Rad), with crystallized bovine serum albumin (BSA) as standard. Specific activity was defined as units of activity per mg of protein. 3. Run-off transcription assays Run-off transcription assays contained: 60 mM Tris-HCl, p H 8.2; 8 mM M g C l 2 ; 40 mM KC1; 13% glycerol; 16 mM CTP, UTP, and GTP; 1.6 uM ATP; 66 nM 3 2P-ATP (756 jiCi/nmole); 1 |ig template DNA; and RNA polymerase in a 4:1 molar ratio of RNA polymerase:DNA, in a volume of 200 u.1. The tubes were placed at 34°C for 20 min. One tenth of the reaction mixture was diluted into 1.0 ml of 10% trichloroacetic acid for measurement of the amount of radioactivity incorporated into RNA, and the remainder was extracted with an equal volume of phenohchloroform (1:1), then with chloroform, and then, after the addition of 1/10 volume of 3M sodium acetate, the RNA was precipitated by addition of 0.5 ml 95% ethanol. 16 4. Polyacrylamide gel electrophoresis 4.1. Slab gel electrophoresis of RNA polymerase. Electrophoresis of RNA polymerase was performed as described by Laemmli [31] with a 14 to 20% gradient of polyacrylamide [35]. Aliquots of the RNA polymerase preparation were diluted in protein loading buffer (20% glycerol; 10% 2-mercaptoethanol; 0.0625 M Tris-HCl, p H 6.9; 0.1% bromphenol blue), and heated at 90°C for 5 min before loading onto the gel. The gels were run at 100V for 4 hr and then stained overnight in 0.1% Coomassie blue stain (in 30% methanol and 10% acetic acid). Destaining was accomplished in the above solution with no dye. |L coli RNA polymerase subunits were used as molecular weight markers. 4.2. Polyacrylamide gel electrophoresis of RNA transcripts. Gel electrophoresis was done in 5% polyacrylamide-7 M urea gels, in 0.5X TBE buffer [32]. After a 70% ethanol wash, the precipitated samples were dissolved in 20 (il of 80% formamide; 0.5X TBE; 0.025% xylene cyanol; 0.025% bromophenol blue, and then heated for 5 min at 90°C before loading. Radiolabeled D N A from the single stranded phage M13mpll, digested with Haelll, was used for molecular length markers. The gels were electrophoresed at 100V for 3 hr, dried, and used for autoradiography. 17 5. Preparation of D N A and cellular RNA 5.1. Preparation of DNA. Salmon sperm D N A was obtained from Sigma. K. capsulatus chromosomal D N A and plasmid D N A were purified by CsCl gradient ultracentrifugation [32]. Fragments of plasmid D N A were generated by restriction enzyme digestion, gel electrophoresis, and electroelution [32]. 5.2. Purification of cellular RNA. Cellular RNA was purified as described [48] from cells that had been grown under high conditions to 80 Klett units (3.2xl08 cells/ml) and then shifted to low 0 2 conditions [8] for 45 min prior to cell harvest. 6. Plasmid constructions 6.1. Construction of the promoter-identification vector pXCA601. This vector was used for in-frame gene fusions and was constructed by Cam Adams in Dr. S.N. Cohen's lab at Stanford. The fragment containing the lacZ gene was obtained from plasmid pMC1403Plac [24]. The 3' ends of fusion transcripts were stabilized by insertion of the ompA terminator [7]. To prevent transcription initiated within the vector from continuing into the D N A inserts being tested for 18 Fig. 4. A representation of the promoter identification vector pXCA601. The thin line represents vector D N A , the boxes designate sequences of importance as follows: TI, the T4 phage terminator; T2, the ompA terminator; and lacZ, the lacZ gene of E. coli. The letters designate restriction endonuclease digestion sites as follows: P-Pstl, B-BamHI, S-Sall. The arrow shows the direction of transcription and Tc^ implies tetracycline resistance. 19 promoter activity the T4 phage transcription-translation termination signals [38] were introduced upstream of the insertion site. The replicon for this vector was derived from pTJS133 [39], which can be mobilized into R. capsulatus. A diagram of pXCA601 is shown in Figure 4. 6.2. Construction of the lacZ fusion plasmids. Figure 5 shows a flowchart of the construction of the puf promoter mutants used for this thesis work. The exonuclease III deletions were made as described [23], with Xhol-cleaved plasmid pJAJ21 [26] as substrate. After completion of the procedure the D N A was cleaved with BamHI to release shortened fragments which were then sized on a 5% polyacrylamide gel. The fragments were recovered by electroelution and religated into M13mpl8 that had been cleaved at the H i n d i and BamHI sites. The resultant phages were screened to identify those that contained fragments of the desired length, which were then subcloned as PstI to BamHI fragments into pXCA601 to create pA4, pA14, and pA24. The 935 construct was made by digestion of pJAJ21 with PstI and BamHI and subcloning of the insert into pXCA601. The 932 deletion was made by a complete Sail digestion of pJAJ21 and purification of the larger fragment, followed by recircularization. The resultant plasmid (pUC932) was cleaved with PstI and BamHI and the smaller fragment was cloned into pXCA601. The pAMSP plasmid was made from pUCESp, a derivative of pJAJ21, as 20 Fig. 5. Construction of the puf promoter deletion mutants in pXCA601. The thin lines represent vector DNA, the thicker lines represent capsulatus chromosomal DNA, and the boxes represent the pufQ gene and the 5' end of the pufB gene (see Fig. 11). The letters designate restriction endonuclease digestion sites as follows: P-PstI, S-Sall, Xj-Xhol. A-AccI, E-EcoRI. M-Mnll. B-BamHI. For p935, pA4, pA14, pA24, pAAM, pAMSP, and p932 the small PstI to BamHI fragments obtained were cloned into pXCA601 (that had been digested with PstI and BamHI) to yield the final constructs shown. The diagrams of the constructs are not to scale. A detailed description of each construction can be found in section 6.2 of the Materials and Methods. \ 21 . M 'E PstI and Bam HI. small fragment p935 X Xhol, exonuclease III, P* " ^ Klenow, BamHI, small fragments, M13mpl8( Hindi and BamHI). PstI and Bam HI, small fragments 22 described below. The plasmid pJAJ21 was digested with Sail, methylated with TaqI methylase enzyme, digested with EcoRI and the large fragment purified. Methylation blocked digestion of the EcoRI sites found 3' of the pufB gene segment in pJAJ21 [26] so that only the EcoRI site shown in Figure 5 was cleaved. The purified fragment was treated with Klenow enzyme to form blunt ends and religated to produce pUCESp. The pUCESp plasmid was digested to completion with Mnll and BamHI, and the 100 base pair fragment containing the 5' end of the pufB gene was purified and subcloned into pUC13 digested with Hindi and BamHI to create pUCAMSP, yielding a PstI site upstream of the pufB ribosome binding site. The approximately 110 base pair PstI to BamHI fragment was then subcloned into pXCA601 to give pAMSP. The pAAM construct was made by digestion of the plasmid pUCAMSP with PstI, followed by mung-bean nuclease digestion to create a blunt end, and then digested with BamHI. The smaller fragment released was purified and subcloned into pJAJ21 that had been treated with TaqI methylase (to protect the Sail sites from cleavage by the AccI enzyme), digested with AccI, the site filled in with Klenow fragment [32], followed by digestion with BamHI. The larger fragment was purified and ligated with the small fragment from pUCAMSP. The resultant plasmid, named pUCAAM, was then digested with BamHI and PstI and the smaller fragment was subcloned into pXCA601. After transformation into E. coli C600 the plasmids were conjugated into strains of R. capsulatus [18]. 23 6.3. Site-directed mutagenesis. Figure 6 shows a flowchart of the process of oligonucleotide-directed mutagenesis. The single-stranded template used was M13mpl8A4, which contained the A4 deletion (shown in Table IV, and Figs. 3 and 5) inserted between the Hindi and BamHI sites of M13mpl8. The procedure used was adapted from Zoller and Smith [60]. The oligonucleotides were annealed to the templates in a 4:1 molar ratio of oligonucleotide: template. Specific priming was tested for by dideoxy sequencing using the mutagenic oligonucleotide as primer, and completion of second strand synthesis was ascertained by restriction endonuclease digestion. After annealing, extension and ligation the D N A was transformed directly into E. coli TM101. Enrichment for mutants was achieved by use of E. coli RZ1032 (ung, dut) for production of deoxyuracil enriched template [29]. The potential mutants were screened by dot-blot hybridization with the appropriate labelled oligonucleotide as probe with washes of increasing temperature, and candidates were verified by dideoxy sequencing of the PstI to AccI region. The RF forms of the M13 mutants were purified by standard techniques [32] and digested with PstI and AccI to obtain the mutated regions which were used to replace the unmutated PstI to AccI region of pJAJ21. The mutant derivatives of pJAJ21 were then digested with PstI and BamHI to subclone into pXCA601. The A42 mutant was created with the oligonucleotide 5' -GAAGATTTATCTAGACGCTTCCTT-3' , so that sequences 24 Fig. 6. Construction of oligonucleotide-directed mutations in pXCA601. The thin lines represent vector DNA, the thicker lines represent R capsulatus chromosomal D N A , and the boxes represent the pufQ and the 5' end of the pufB genes (see Fig. 11). The dashed lines designate uricil-rich DNA, the thick arrow represents primer hybridization, and the thinner arrows represent second-strand synthesis. The mutations were introduced by synthesized oligonucleotides that were used for the primers. The letters designate restriction endonuclease digestion sites as follows: P-Pstl, A-AccI, B-BamHI. Although the figure represents the construction of the A41 deletion the same procedure was performed for the A42 and A44 mutations. 25 26 124-165 of Figure 3 were replaced with 5-AGA-3' to generate an Xbal site. The A41 construct was created with the oligonucleotide 5'-CTTCCTTCTAGACCCCCT TCAT- 3' so that sequences 176-205 of Figure 3 were replaced with 5-TAG-3' to create an Xbal site, and the A44 construct was made with the oligonucleotide 5'-CATGGGTTGCGTGGGTAGCGTC-3' so that the A residues at 222 and 224 of Figure 3 were replaced by G residues. After transformation into E. coli C600 the plasmids were conjugated into strains of R. capsulatus [18]. 6.4. Construction of the pufQ gene deletion. The plasmid pJAJ21 (see Fig. 11) was digested with Ncol, treated with TaqI methylase, digested with EcoRI, and the large fragment was purified and religated to form pUCAQ after formation of blunt ends with Klenow fragment (this created a new EcoRI site at the ligation point). The construct pUCAQ was either digested with PstI and BamHI and the small fragment cloned into pJAJ103::lac903 (a derivative of pJAJ103 [26,62]), or digested with Hindlll and EcoRI and the small fragment cloned into pTB999 (a derivative of pRCVI [11], see Fig. 14). After transformation into E. coli the constructs were conjugated into strains of R. capsulatus [18]. 7. SI nuclease mapping of RNA 7.1. SI nuclease mapping of puf operon RNA ends. SI nuclease 27 (Bethesda Research Laboratories) experiments were performed as described [48], with hybridization at 55°C for 3 hr and Sl nuclease treatment for 30 min at 37°C. After one ethanol precipitation the samples were denatured in formamide loading dye (see section 4.2) and loaded onto 6% polyacrylamide-urea gels. After electrophoresis and drying the gels were used for autoradiography. 7.2. Sl nuclease protection experiments for detection of RNA from the puc operon. The probe used was an anti-sense RNA molecule which had been transcribed by T7 RNA polymerase from a pT7-2 vector (United States Biochemical Corporation) that contained the 5' end of the puc operon [61]. About 500 ng of linearized D N A template were used to homogeneously label RNA with T7 RNA polymerase as recommended by the supplier (Pharmacia). After phenol extraction and ethanol precipitation the samples were resuspended in DNase buffer and treated with 23 units of DNase I [61], and then phenol extracted and precipitated again. About 5 |ig of RNA were obtained with a specific activity of 8 x 10^ dpm/[ig RNA. This labelled anti-sense RNA was hybridized to RNA from BIO or ARC6 (purified as described [48]), or to yeast tRNA, and then treated as for an Sl nuclease RNA end-mapping experiment (see section 7.1). 8. Primer extension experiments 28 Primer extension mapping of 5' RNA ends was performed as described [52]. Ten |ig of cellular RNA were mixed with a 5'-^p end-labelled oligodeoxyribonucleotide primer, with the sequence of 5 - G T G A A G C T C A G GTCGTTCTTAT-3' (complementary to mRNA transcribed from bases 932 to 953 of the puf 5' D N A sequence [see Fig. 3]) and hybridized at 55°C for 3 hr. After extension, phenol extraction, and ethanol precipitation the samples were denatured in formamide loading dye (see section 4.2) and run on a 6% polyacrylamide-urea gel. 9. Capping experiments Cellular RNA was capped essentially as described [36,61]. Forty |ig of RNA were mixed with 100 pmoles of alpha 3 2 P - G T P (3000 Ci/mmole) and 12.5 units of guanylyl transferase (Bethesda Research Laboratories, Inc.). After incubation and phenol extraction the RNA was ethanol precipitated three times to remove unincorporated label, and resuspended in RNA storage buffer (20 mM sodium phosphate, pH 6.5/1 mM EDTA). An average of 4 x 10^ dpm/[Lg of RNA were obtained in successful capping experiments. Approximately 8 |ig of capped RNA were run on a 6% polyacrylamide-urea gel to obtain an autoradiogram for examination to ensure uniform capping. 29 Capped RNA was hybridized at 55°C for 3 hr to D N A probes as described [36,61] and after Sl nuclease (750U) digestion at 37°C the samples were digested with 2.5 ng of boiled RNase A at room temperature. The products were run on 6% polyacrylamide-urea gels after denaturation in formamide loading dye (see section 4.2). 10. Absorption spectroscopy of various strains of R. capsulatus Cells were grown under high or low 0 2 conditions [8] in RCV medium [49] as described. Equal amounts of cells were resuspended in 22.5% BSA and scanned in a Varian DMS 100 spectrophotometer. 30 RESULTS 1. P u r i f i c a t i o n and characterization of R N A polymerase 1.1. P u r i f i c a t i o n of R N A polymerase R N A polymerase was p u r i f i e d f r o m both chemoheterotrophically and photoheterotrophically g rown cells as described i n Materials and Methods. Figure 7 shows a typical elution of R N A polymerase activity f r o m the Biogel A1.5m column, the D N A cellulose c o l u m n and the heparin Sepharose column. A l t h o u g h salmon sperm D N A was routi n e l y used as a template to monitor the polymerase activity throughout the pur i f i c a t i o n , comparable results were obtained w i t h K capsulatus chromosomal DNA. A ty p i c a l p u r i f i c a t i o n of R N A polymerase is summarized i n Table I. The o v e r a l l y i e l d was usually between 10 and 15%, w i t h an increase i n specific a c t i v i t y of 100-200 f o l d , w h i c h compare favourably w i t h purifications of other bacterial R N A polymerases [10,50]. The f i n a l specific activity obtained was from 50 to 100 u n i t s / m g protein. Fractions containing the peak of activity f rom the heparin Sepharose column were pooled and then separated into aliquots. The p u r i f i e d R N A polymerase was either stored at -20°C i n the elution buffer (buffer 31 Fig. 7. Chromatography of RNA polymerase from chemoheterotrophically grown cells. Fig. la, elution from BioGel A1.5m; Fig. lb, elution from DNA cellulose; Fig. lc, elution from heparin Sepharose. The supernatant fluid applied to the columns were purified as described in Materials and Methods. Fractions were collected and assayed for RNA polymerase activity, (•—•). The optical density of the fractions at 280 nm was also measured, (o—o). The arrows designate the fraction at which the [NaCl] was changed as described in Materials and Methods. 32 Table I: Summary of RNA polymerase purification One unit of activity is defined as one nmole of UTP incorporated in 10 min at 34°C. Purification mg units of units/mg % yield fold step: protein activity protein purification crude extract: 2241.0 594 0.26 0-30% ( N H 4 ) 2 S 0 4 supernatant: 405.0 986 2.44 166 9 30-60% ( N H 4 ) 2 S 0 4 pellet: 294.0 642 2.18 108 8 Bio-Gel A1.5m eluate: 67.0 495 7.40 83 28 D N A cellulose eluate: 3.6 160 45.70 27 176 heparin Sepharose eluate: 1.4 87 60.70 15 234 33 B containing 0.6 M NaCl) supplemented with 40% glycerol, or at -80°C in the same buffer containing 10% glycerol. Specific activity declined during storage under both conditions over a period of 3-4 months to about 50% of the initial activity, and then stabilized. Several DNAs were compared as templates for the R capsulatus anaerobic RNA polymerase. (Table II). The greatest specific activity was obtained with phage M13 RF as template and K capsulatus D N A gave the lowest activity. Phage M13 differed from the other templates in that it was supercoiled. Although the R. capsulatus D N A was linear, like the other templates tested, it has a much higher GC content (67% as opposed to 41-50% for the other templates [6,43]) and this may have caused its lower activity. 1.2. Optimization of the assay conditions After the first purification was completed the assay conditions were optimized for the concentration of DNA, nucleotides, and other components, and for temperature and pH. The assay conditions used in the first purification were taken from published procedures for in vitro transcriptions [44], but subsequent purifications utilized the conditions given in the Materials and Methods. The optimization increased activity three-fold. Conditions were optimized with either R. capsulatus chromosomal D N A or salmon sperm D N A as template; optimal conditions for the two 34 Table II: Utilization of different templates by R. capsulatus anaerobic RNA polymerase Specific activity is in units/mg protein; assay conditions were those used for salmon sperm D N A (see Materials and Methods), 10 of each D N A template were used. Specific activity D N A template 52 35 83 23 9 Salmon sperm T7 M13mpll E. coli R. capsulatus 35 templates were very similar. The changes made for use of K capsulatus D N A as template were to increase the glycerol content to 13%, increase the Tris-HCl buffer to 60 mM, and to include 40 mM KC1 instead of NaCl. The enzyme had an absolute requirement for MgCl2, DNA, and nucleotides. The optimal p H was 8.2 for both templates, with a sharp drop in activity below p H 7.0. A concentration of at least 25 mM Tris-HCl buffer was necessary for activity. There was no consistent stimulation of activity when spermidine, EDTA, or 2-mercaptoethanol were added to the reaction mixture. 1.3. Subunit composition of RNA polymerase The purified polymerase was subjected to SDS polyacrylamide gel electrophoresis (SDS-PAGE) to assess its subunit composition. Figure 8 shows the results of an experiment in which RNA polymerase preparations purified from aerobic and anaerobic cultures of K capsulatus were compared to a preparation of R coli RNA polymerase. The gel contained a number of bands representing proteins that were associated with R capsulatus RNA polymerase activity. Of the 10-11 visible bands, six were designated as RNA polymerase subunits because they consistently co-purified with RNA polymerase activity through two additional purification steps (see below). The designation and molecular mass (estimated by comparison with E. coli RNA polymerase subunits as standards) of the subunits are: beta and beta-prime subunits of about 150,000 to 160,000 36 Fig. 8. SDS polyacrylamide gel electrophoresis of purif ied R N A polymerase from chemoheterotrophically and photoheterotrophically grown IjL capsulatus. Ten |ig of protein from the heparin Sepharose eluate, along wi th ten (ig E. coli R N A polymerase, were subjected to electrophoresis and stained as described i n Materials and Methods. The subunit designations for R. capsulatus R N A polymerase are given on the left, and the subunits of E. coli R N A polymerase are labelled on the right. Lane 1: R N A polymerase from chemoheterotrophically grown cells. Lane 2: R N A polymerase from photoheterotrophically grown cells. Lane 3: R coli R N A polymerase. 37 Daltons; an alpha subunit of about 45,000 Daltons; and a sigma subunit of 70,000 Daltons. Two smaller proteins, tentatively designated as omega factors, were also consistently observed. The pattern of bands in the gel was identical for aerobic and anaerobic RNA polymerase preparations. However there was a much larger amount of one protein, which migrated to a position between the putative alpha and sigma subunits, associated with the polymerase activity purified from cells grown aerobically. Because of the large number of proteins present in the preparations analyzed in Figure 8, aliquots of the polymerase were put through two additional purifications to see if some of the proteins could be removed without loss of RNA polymerase activity. The methods used were centrifugation through a glycerol gradient and ion-exchange chromatography over a DEAE-Sephadex column. A single peak of activity was observed with chromatography over DEAE-Sephadex, and SDS-PAGE revealed about 7-8 bands in the three fractions with greatest activity (Fig. 9). The specific activity of the peak fraction (lanes 3, Fig. 9) in the preparation from aerobic cells increased 1.5-fold, whereas the specific activity of the peak fraction of RNA polymerase from anaerobic cells remained the same. The results from the glycerol gradient were comparable. The three fractions containing the greatest activity were analyzed by SDS-PAGE as shown 38 A B 1 2 3 4 5 1 2 3 4 5 Fig. 9. SDS polyacrylamide gel electrophoresis of R N A polymerase after DEAE-Sephadex chromatography. The subunit designations for K capsulatus R N A polymerase are given on the left of each gel. A , R N A polymerase from chemoheterotrophically grown cells. B, R N A polymerase from photoheterotrophically grown cells. Lanes 1: 10 |ig of R N A polymerase from the heparin Sepharose eluate. Lanes 2 to 4: peak fractions from the DEAE Sephadex column (equal volumes of each loaded with lane 3 containing 10 fig of protein). Lanes 5: 10 ug of E. coli R N A polymerase. 39 in Figure 10. The number of bands present was reduced to 7 or 8, including the 6 that have been designated as RNA polymerase components. The specific activity of the peak fraction in the preparation from aerobic cells increased 3-fold, whereas the specific activity of the polymerase from anaerobic cells increased only slightly. Only the gel bands that I have designated as being representative of R. capsulatus RNA polymerase subunits were visible in both preparations after both of the additional purification steps. On occasion extra bands were seen to co-purify with the RNA polymerase. These bands were not present in every purification performed so it is unlikely that they were components of the RNA polymerase that were essential for activity. 1.4. Gel electrophoresis of run-off transcription products The RNA polymerase preparations used for run-off transcriptions were obtained by step elution from heparin Sepharose with 0.6 M NaCl (see Figs. 7 and 8). A restriction endonuclease site map of a recombinant plasmid, designated pJAJ21 [26], which contains the K capsulatus puf transcriptional regulatory region, is depicted in Figure 11. The fragment of R. capsulatus D N A inserted into this plasmid has been shown to contain an 02-regulated promoter [26], and is shown in Figure 2b. Preliminary in vitro transcription assays were performed to determine 40 Fig. 10. SDS polyacrylamide gel electrophoresis of RNA polymerase after glycerol gradient centrifugation. The subunit designations for K capsulatus RNA polymerase are given on the left of each gel. A, RNA polymerase from chemoheterotrophically grown cells. B, RNA polymerase from photoheterotrophically grown cells. Lanes 1: 10 (ig of RNA polymerase from the heparin Sepharose eluate. Lanes 2 to 4: peak fractions of activity from the glycerol gradient (equal volumes were loaded with lane 3 containing 10 [ig protein). Lanes 5: 10 [ig E. coli RNA polymerase. 41 if the presence of K capsulatus D N A in the pUC13 vector stimulated activity. Table III shows the results from both aerobic and anaerobic RNA polymerase. The linearized pUC13 and pJAJ21 templates were present in equimolar amounts. The presence of R capsulatus D N A caused an increase of 20-30% in activity with both the forms of RNA polymerase. Run-off transcription assays were performed as described in Materials and Methods. An example of an autoradiogram of a polyacrylamide-urea gel of RNA transcripts produced by a preparation of RNA polymerase from anaerobically grown cells is shown in Figure 12. The template consisted of 1 jxg of either the plasmid pUC13 or pJAJ21, digested with BamHI and Hindlll, and various amounts of heparin were added to the standard reaction assay. It had been found previously that inclusion of heparin reduced a background that could obscure bands due to specific transcripts. About 3-4 distinct RNA species were visible over the entire range of heparin concentrations. Especially notable was an approximately 104 nucleotide transcript that was probably RNA I (a predominant transcript involved in plasmid replication and copy number [42]). The additional transcripts seen ranged from approximately 500 to about 2500 nucleotides in length. A longer exposure of the autoradiogram revealed no additional transcripts, but the resolution of the bands at the top of the gel was lost. It can be seen that the pattern of bands in the autoradiogram is the same when either pUC13 or pJAJ21 were used as template. It was concluded 42 Fig. 11. A representation of the construct pJAJ21 [26]. The thin line represents pUC13 vector DNA, the thicker line represents the puf promoter region of K capsulatus, and the boxes represent the genes present on the R. capsulatus insert. The arrow designates the direction of transcription, and the letters represent restriction endonuclease digestion sites as follows: H-Hindlll, P-Pstl, X-XhoII, N-Ncol, S-Sall (not unique), E-EcoRI (not unique), B-BamHI. The ApR designation implies ampicillin resistance. 43 Table III: Utilization of linear templates used for run-off transcriptions Specific activity is in units/mg protein; assay conditions were those used for R capsulatus D N A (see Materials and Methods), equimolar amounts of each template were used. RNA polymerase D N A template Specific activity aerobic pUC13 18 aerobic pJAJ21 24 anaerobic anaerobic pUC13 PJAJ21 23 28 44 Fig. 12. Polyacrylamide gel electrophoresis of run-off transcripts obtained with photoheterotrophic (anaerobic) RNA polymerase. The templates used were: A, pUC13, and B, pJAJ21, both digested with BamHI and Hindlll. Reaction conditions and gel electrophoresis were as described in Materials and Methods, except that the following amounts of heparin were added to the reactions: lanes 1, 0.1 |ig; 2, 0.3 |ig; 3,1.0 u.g; 4,3.0 |ig; 5,10.0 u\g. 45 that under these conditions the amount of transcription originating from the R.  capsulatus promoter present in pJAJ21 was undetectably low compared to vector-derived activity. In other experiments the cloned fragment of R capsulatus D N A was purified and used as a template for run-off transcription. Figure 13 shows that transcription of the insert alone yielded a large number of transcripts of various sizes, and that an increase in the concentration of heparin in the reaction decreased the intensity of all bands equally. Because the pattern of transcripts seen with the purified fragment could have resulted from initiation of transcription at sites other than promoters, the concentrations of various components of the transcription assay were titrated in an attempt to increase specificity of transcription. For example, the concentrations of glycerol and KC1 were varied and titration of spermidine concentration was also attempted. These conditions did not reduce the number of bands seen in autoradiograms. Although this preparation of R. capsulatus RNA polymerase could be used to initiate transcription at promoters present on the plasmid pUC13, additional factors appear to be necessary for efficient recognition of the puf promoter. However, inclusion of cruder fractions from earlier stages in the purification did not reduce the number of bands either. 46 Fig. 13. Polyacrylamide gel electrophoresis of run-off transcripts obtained with photoheterotrophic (anaerobic) RNA polymerase and the purified K capsulatus promoter fragment as template. The fragment was purified by digestion of pJAJ21 with BamHI and HindllL agarose gel electrophoresis, and electroelution [32]. Reaction conditions and gel electrophoresis were as described in Materials and Methods, except that the following amounts of heparin were added: lane A, 0.01 |ig; B, 0.03 ug; C, 0.1 ug; D, 0.3 ug; E, 1.0 ug; F, 3.0 ng; G, 10.0 ug. 47 2. Localization of the puf promoter 2.1. Localization of the puf promoter through gene fusion experiments Initial studies were performed with the use of a vector called pJAJ103::lac903, a derivative of pJAJ103 [26,62], that contained the lacZ gene (see Appendix). Unique PstI and BamHI sites upstream of the lacZ gene allowed for the cloning of puf operon promoter fragments from pJAJ21 into the vector as operon fusions. The search for the promoter at one time focussed on regions immediately upstream of the position where the 5' end of the predominant RNA transcript mapped (end 4, Fig. 2). This region initially appeared to have promoter activity, but it was later concluded that this was due to read-through transcription from vector sequences (see Appendix). When this was discovered a new vector was obtained that eliminated read-through transcription with the T4 terminator sequences, and allowed for gene fusions with lacZ. This vector was designated pXCA601 (see Materials and Methods). A series of fragments from the puf operon promoter region was cloned into this vector and tested for promoter activity. Construction of all of these plasmids is described in detail in Materials and Methods. The constructs were mated into K capsulatus and beta-galactosidase assays were performed on cells grown under low and high 0 2 conditions, enabling both activity and oxygen 48 regulation of the promoter to be studied. All of the plasmids were mated into the ARC6 strain of R. capsulatus which has been deleted for the puf operon [11]. This strain was used so that results obtained could be directly compared to results obtained from RNA end-mapping experiments (described further on in this thesis). Equivalent results were obtained with the use of the wild-type strain BIO (J. T. Beatty and C. W. Adams, personal communication). Table IV shows representations of these fragments and gives the beta-galactosidase activities obtained. The MSP construct contained a fragment of the puf operon that extended from the Mnll site, 6 base pairs upstream of the Shine-Dalgarno sequence of the pufB gene, to a BamHI site introduced after the 20th codon of the pufB gene [26]. The activities obtained with this fragment were considered to be background level, and showed the absence of read-through transcription from the vector. The fragment designated 935 is the fragment described previously that was cloned into pUC13 to create pJAJ21 (see Figs. 2 and 11) [26]. This fragment in the pXCA601 vector gave strong expression of the lacZ gene as seen by the high activities obtained. More than 6-fold higher activity was obtained under low 0 2 conditions as opposed to high 0 2 conditions, supporting the concept that the fragment contains the (Deregulated promoter for the puf operon (Table rv). Removal of about 180 base pairs from the 5' end of 935 to yield the A4 construct had a minor effect on the expression of lacZ, but removal of another 49 Table IV. Assays of beta-galactosidase activities of cells containing puf 5' regions fused to the lacZ gene of pXCA601 1 Representation of the constructs used for puf promoter mapping. Restriction sites are indicated by vertical lines and are labelled in the top construct as follows: X-XhoIL A-AccL M-Mnll.The structural genes are designated by thick lines and are labelled in the 935 representation. The dashed line represents the sequences that were removed in the A A M construct. The hillocks represent the palindromic sequences that were studied and the x's designate sites of oligonucleotide-directed deletions or mutations. ^Activities are expressed as nmoles ONPG/min/mg protein. The values in brackets are standard deviations of 3 to 7 assays that were performed on each construct. ^The ratio of activities obtained under low 0 2 versus high 0 2 . 50 CONSTRUCT A A M 51 160 base pairs to create the A14 construct decreased expression by 90-95%. The A14 level of expression is almost as low as the MSP expression and the ratio of low to high (>> activities seems to show the loss of 0 2 regulation. Further deletions to give the A24 construct and the 932 construct had no additional effect on activity (Table IV). The A14 construct showed that sequences upstream of this deletion were essential for promoter activity, so an internal deletion was constructed between the AccI site and the Mnll site (see Figs. 2 and 3) and designated AAM. This construct, shown in Table IV, retained both full activity as well as 0 2 regulation. Thus it can be concluded that sequences between the 5' end of the A4 construct and the AccI site are necessary and sufficient for (^-regulated initiation of transcription. The sequence within this transcriptional control region was examined and two palindromes (inverted repeats) were discovered (see Fig. 3). Inverted repeats have been associated with transcriptional regulation in other systems [37] so these were each deleted separately by oligonucleotide-directed mutagenesis (see Materials and Methods). The more upstream of the two sequences, from nucleotides 124 to 165 in Figure 3, was replaced by 5-AGA-3' to yield the construct A42. As can be seen in Table IV the beta-galactosidase activities of cells containing this construct were comparable to the A4 construct from which the deletion came. However, replacement of the other palindrome, from nucleotides 52 176 to 205, with the sequence 5-TAG-3' (to yield the construct A41) resulted in a dramatic reduction in lacZ expression to about the levels seen with the A14 construct. Transcriptional regulation of the R capsulatus puc operon, which encodes structural proteins for the B800-850 light-harvesting complexes, has also been studied [61]. Two initiation sites have been mapped near a direct repeat of 7 base pairs with the sequence 5'-ACACTTG-3', found just upstream of the puc structural genes. The region immediately upstream of the AccI site of the puf operon contains a sequence similar to this, 5-ACATGGG-3', near nucleotide 225 (Fig. 3). This sequence was changed to 5-GCGTGGG-3' by oligonucleotide-directed mutagenesis of the A4 construct to yield the A44 construct. Table IV shows that mutation of two base pairs within this region reduced expression 90-95% compared to the A4 construct. 2.2. Absorption spectrophotometric analysis of puf promoter mutants In order to determine if results obtained from fusions of the puf promoter region and various mutants of this region with the lacZ gene were comparable to results from fusions of these fragments with puf operon genes, a vector was obtained from J. T. Beatty that contained all of the puf operon. This vector, designated pTB999, is shown in Figure 14 and is a derivative of pRCVI [11]. The effects of mutations in the regulatory region of the puf operon can be 53 observed by replacement of the Hindlll to EcoRI fragment of the regulatory region with various mutated fragments. These constructs were mated into a strain of K capsulatus called U43. This strain has had chromosomal puf sequences from an Apal site in the pufQ gene to an Apal site just beyond the pufX gene replaced with a D N A fragment that determines spectinomycin resistance [55]. This replacement of puf operon sequences was done in a strain that previously had been isolated as a mutant deficient in B800-850 complexes, and the result is that no light-harvesting or reaction center complexes are detected in U43 cells [55]. This strain is useful for analysis of plasmid-borne mutant copies of puf operon sequences because the absorption spectrum of B870 complexes is not masked by B800-850 complex absorption (see Introduction). The deletions tested with pTB999 in U43 were the A4, A41, and A42 constructs (see Table IV), to compare the effects of loss of either of the two palindromic sequences. Figure 15 shows absorption spectra of U43 cells that contain these constructs grown under low and high 0 2 conditions. The presence of B870 spectral peaks seen only under low 0 2 conditions confirms that the 0 2 -regulated puf promoter is present on the plasmid. Removal of the upstream palindrome in A42 yields a spectrum that is virtually identical to the parental A4, but removal of the other palindrome to yield A41 causes a reduction in the amount of absorbancy at 870 nm, under low 0 2 , presumably due to loss of B870 complexes. Although this reduction is noticeable it is not as dramatic as the loss 54 Fig. 14. A representation of the vector pTB999. The thin line represents vector DNA, the thicker line represents R. capsulatus chromosomal DNA, and the thickest lines represent the structural genes of the puf operon. The arrow shows the direction of transcription, and the letters outside the plasmid designate restriction endonuclease digestion sites as follows: H-Hindlll, E-EcoRI. The letters inside the plasmid indicate puf operon genes, and the Tc^ designates tetracycline resistance. 55 Fig. 15. Absorption spectra of various strains of R. capsulatus. The abscissa represents wavelength of light, and the ordinate represents absorbancy units. The strains are designated as follows: A4, ARC6 (pTBA4); A41, ARC6 (pTBA41); A42, ARC6 (pTBA42). The representations of the constructs shown at the top of the page are from Table IV. The cells were grown under low or high 0 2 conditions as described in Materials and Methods. The zoom scans enlarge the region of the spectrum where the B870 complexes absorb maximally. 56 57 of beta-galactosidase activity seen with the pXCA601 constructs in the ARC6 strain (see Table IV). The vector used in the study of the absorption spectra (pTB999) is similar to the pJAJ103::lac903 vector that showed the existence of read-through activity (see Appendix) when the initial lacZ fusion assays were performed. Thus the presence of B870 complexes in pTBA41, under low 0 2 conditions, is most likely due to read-through from upstream on the pTB999 vector. Although a quantitative comparison can not be made between the pTB999 constructs in U43 and the pXCA601 constructs in ARC6 the results obtained do show that removal of the downstream palindrome results in a decrease in B870 gene expression, in keeping with the hypothesis that this palindrome is important for promoter activity. 2.3. Mapping of RNA transcripts from the puf operon Cam Adams (in S.N. Cohen's lab at Stanford) performed RNA 5' end mapping experiments with the use of the 935 fragment (see Table IV, and Fig. 2b) as probe and obtained the predominant RNA 5' end (designated end 4 in Fig. 2) previously reported [8], plus three or more less abundant RNA 5' ends that mapped further upstream. The three most upstream 5' ends are designated 1, 2, and 3, and are shown in Figure 2b. An interesting point to note is that the most 5' of these ends maps just downstream from the sequences shown by lacZ fusion experiments to be involved in transcription of the puf operon. It had previously 58 been believed that these ends might have been artifacts in the SI nuclease procedure because of their low intensity in comparison with the predominant RNA end 4. I performed a series of RNA end-mapping experiments to confirm these data and to better correlate these 5' ends with the lacZ fusion results. The D N A probes used in these experiments are described in Figure 16. Figure 17 shows an autoradiogram of an SI nuclease mapping experiment in which pJAJ21 had been 5' end labelled at the EcoRI site (see Fig. 16a). This site was chosen in order to maximize hybridization to the less abundant transcripts that map upstream of the EcoRI site. The probe was hybridized to RNA from R capsulatus BIO cells ( a wild type strain). Digestion with SI nuclease yielded three RNA 5' ends that mapped to the positions of the three most upstream 5' ends shown in Figure 2 (ends 1, 2, and 3). A primer extension experiment was performed to look for the presence of these 5' ends through the use of a different technique. Initial primer extension experiments yielded many more 5' ends than had been seen in the SI protection experiments, so a primer titration was performed in order to minimize non-specific priming. Figure 18 shows the results of a primer titration experiment in which a primer, complementary to bases 932 to 953 of the sequence shown in Figure 3, was hybridized to R. capsulatus BIO RNA. Hybridization of the highest amount of primer to the RNA yielded bands corresponding to a multiple number of 5' ends. Ends 1, 2, and 3 can be seen as well as end 4, and many other 59 Fig. 16. Construction of D N A probes used in RNA end-mapping experiments. The arrow inside the plasmid pJAJ21 (shown in greater detail in Fig. 11, [26]) depicts the direction of transcription. The thin lines represent vector D N A , the thicker lines represent R capsulatus chromosomal DNA, and the boxes represent the pufQ gene and the 5' end of the pufB gene. The letters designate restriction endonuclease digestion sites as follows: P-Pstl, A-AccI, E-EcoRI, M-Mnll, B-BamHI, N-Nael. Some of the D N A modifying enzymes are also abbreviated as follows: CIP, calf intestine alkaline phosphatase; PNK, T4 polynucleotide kinase. The asterisk designates the site of radioactive labelling. The use of each probe is described in the text and the results obtained shown in the following figures. 60 TaqI methylase, EcoRI, CIP, 32 gamma P-ATPand PNK, BamHI, large fragment 32 TaqI methylase, AccI, alpha P-ATP and Klenow, Bam HI, small fragment • * 32 c: BamHI, CIP, gamma P-ATP and PNK, PstI, small fragment 1 d: same as c, except no labelling step E M B c , d e: BamHI, CIP, gamma J ZP-ATP and PNK, PstI, small fragment P N N A'/M' B 61 - 1 6 9 •117 98 Fig. 17. 5' end-mapping of BIO RNA with SI nuclease. The 5' end-mapping of RNA transcripts from the wild-type strain BIO to the puf operon promoter region was as described in Materials and Methods. The DNA probe is described in Fig. 16a. Lanes A and B contain 40 ng of D N A probe hybridized to 10 ug of yeast tRNA, and lanes C to E contain 40 ng of D N A probe hybridized to 10 ug of BIO RNA. Varying amounts of SI nuclease were added to the reactions as follows: lanes A and C, 500 units; lanes B and E, 1500 units; and lane D, 1000 units. Lane F contains M13mpll ssDNA cut with Haein for molecular length markers. The arrows designate the bands that correspond to RNA ends 1, 2, and 3. 62 A B C D E F G - 8 4 5 - 3 0 9 - 169 Fig. 18. Primer extension titration experiment. The primer extension experiments were performed as described in Materials and Methods. Lane A contains the results of an experiment in which 5 picomoles of primer were hybridized to 10 |ig of yeast tRNA. Lanes B to E contain the results of primer hybridized to 10|ig of BIO RNA in the following amounts: B, 5.0 picomoles; C, 1.0 picomoles; D, 0.2 picomoles; and E, 0.04 picomoles. Molecular length markers based on the digestion of M13mpll ssDNA with Haelll are shown in lane F. The arrows indicate the bands that correspond to ends 1, 2, 3, and 4. 63 ends immediately upstream and downstream of end 4 are seen as well. As the primer was titrated out the RNA bands disappeared until only end 4 remained. Since the three most upstream of the less abundant ends (ends 1, 2, and 3) showed up consistently in experiments based on different principles, it was more likely that they were genuine RNA ends and not artifacts of one type of experimental procedure. The presence of some of the less abundant ends that mapped close to the predominant end were likely due to premature termination of the reverse transcriptase enzyme. This interpretation is based on unpublished results obtained by others in this laboratory, and the results seen in Figure 20 which will be discussed. Since all of the sequences necessary and sufficient for G^-regulated initiation of transcription of the puf operon are present upstream of the AccI site it is possible that the most 5' of the RNA ends, end 1, is part of the primary transcript which is processed to yield the shorter transcripts. The processing previously found with other segments of the puf transcripts (shown in Fig. 2a [8]) strengthens this theory. A 3' end mapping experiment was performed in an attempt to find 3' RNA ends that would correspond to the processed 5' ends seen, and confirm the processing theory. Figure 19 shows the result of an experiment in which pJAJ21 was 3'-end labelled at the AccI site (see Fig. 16b) and hybridized to R capsulatus 64 BIO RNA. Many bands were seen in lanes that contained the results of experiments in which the probe was hybridized to yeast tRNA (Fig. 19, lanes A and B), or when the probe was hybridized to BIO RNA (Fig. 19, lanes C to E). No BIO RNA-specific bands were obtained. In many cases when mRNA processing occurs there is rapid 3'-5' degradation of the processed products [3]. If this is the case visualization of the 3' ends of the putative processing products may not be possible. The differences in the level of expression of the lacZ gene with the various fragments cloned into the pXCA601 vector localized sequences important for transcription of the puf operon to a position just upstream of the AccI site shown in Figures 2 and 3 (see Table IV). It was important to correlate the beta-galactosidase activities from the deletion experiments with the results of RNA end-mapping experiments to better understand which sequences are involved in initiation of transcription. In addition, it was important to compare the pattern of plasmid-derived puf mRNA 5' ends with the ends of the chromosomal-derived transcripts. Therefore, the RNA from a number of the strains containing lacZ fusion plasmids with the inserts described in Table IV were purified and hybridized to complementary puf D N A probes. The results of 5' end mapping experiments with Sl nuclease are shown in Figure 20. The A4 construct (see lanes E and F), which contains all the sequences necessary for de-regulated initiation of transcription, gave bands representing 5' ends of a length 65 A B C D E Fig. 19. 3' end-mapping of BIO RNA with SI nuclease. The 3' end-mapping of RNA transcripts from wild-type strain BIO to the puf operon promoter region was done as described in Materials and Methods. The D N A probe used is shown in Fig. 16b. Lanes A and B contain the results of an experiment in which 200 ng of D N A were hybridized to 10 ug of yeast tRNA, the results in lanes C to E are from experiments in which 200 ng of D N A were hybridized to 10 ug of B10 RNA. Varying amounts of SI nuclease were added as follows: lanes A and C, 500 units; lanes B and E, 1500 units; and lane D, 1000 units. The positions of molecular length markers, based on M13mpll ssDNA cut with Haelll, are shown on the right. 66 comparable to RNA molecules with the three less abundant 5' ends 1, 2, and 3, as well as the predominant end 4 previously discussed (Fig. 2). Other 5' ends were also obtained that mapped close to end 4, but that did not show up in the photograph of the autoradiogram. A comparison of Figures 18 and 20 showed that the 5' ends obtained in lanes E and F of Figure 20 were the only ones that showed up in both techniques, thus these ends are likely to be genuine RNA 5' ends. Further examination of Figure 20 shows that when RNA from the strain containing the A14 construct (see lanes G and H) was hybridized to the same probe used for A4 (lanes E and F) no RNA 5' ends were detected. This corresponds to the loss of 95% of beta-galactosidase activity found with the analogous lacZ fusions (Table IV). A similar result was obtained with the A41 construct (lanes I and J) in which the downstream palindrome was removed (see Table IV). Hybridization of RNA from the strain containing the A44 construct (Table rV) with the same probe yielded a low level of the predominant 5' RNA end 4 (not visible in the photograph), and no other RNA protected bands were visible (see lanes K and L). This is consistent with the low levels of beta-galactosidase activity found with the corresponding lacZ fusions (Table IV). Also included in Figure 20 is the result of an Sl nuclease mapping of RNA from the A A M construct (lanes O and P) with the PstI to BamHI fragment of pUCAAM as probe (see Fig. 16e). One protected end that mapped to the position of the RNA end 1 was detected. 67 Fig. 20. 5' end-mapping of RNA from R capsulatus ARC6 containing puf/lac fusion plasmids by Sl nuclease. The 5' end-mapping experiments were performed as described in Materials and Methods. The D N A used for probe in lanes C to L is described in Fig. 16c (25 ng was used per reaction), and the DNA probe used in lanes M to P is shown in Fig. 16e (5 ng was used per reaction). Lanes C, E, G, I, K, M , and O are the results of 500 units of Sl nuclease added to the reactions, and lanes D, F, H , J, L, N , and P are the results of 1000 units of Sl nuclease added to the reactions. Lanes C, D, M , and N contain probes hybridized to 10 u.g of yeast tRNA. The other lanes contain probes hybridized to 10 ug of RNA from strains of R capsulatus ARC6 containing the following plasmids: lanes E and F, pA4; lanes G and H , pA14; lanes I and J, pA41; lanes K and L, pA44, lanes O and P, pAAM. The longest band in each lane is probe hybridized to its complementary strand, the arrows on the left indicate the positions of the three most upstream less abundant RNA transcripts (ends 1, 2, and 3 of Fig. 2) and the predominant transcript (end 4) seen in lanes E and F. Lanes A, B, and Q contain M13mpll ssDNA cut with Haelll for molecular length markers. 68 A B C D E F G H I J K L M N O P Q - 8 4 5 309 -169 - 117 - 98 69 2.4. Mapping of a capped RNA 5' end Although RNA 5' end 1 maps immediately downstream of the sequences shown to be necessary and sufficient for transcription of the puf operon, it is conceivable that this end may be processed. To determine if this end is the first nucleotide of the primary transcript, capping experiments were performed using guanylyl transferase to end label di- and triphosphate ends of 5' RNA from FL capsulatus. Initial experiments were performed with capped RNA from the wild type strain BIO, with the 935 fragment (see Fig. 16d) as probe. The results of this experiment can be seen in Figure 21a. No protected capped end could be detected with the 935 probe (lane C), although a positive control with a puc operon probe [61] detected capped RNA (Fig. 21a, lane A). It is possible that the capped end from the puf operon was present in amounts too low to be detected by this technique. In an attempt to bypass this problem the experiment was repeated using RNA from the ARC6 strain that contained the A A M plasmid (see Table IV). The A A M construct does not contain the putative processing sites (see Fig. 2), so RNA transcripts from the initiation site might be present in much greater amounts. This hypothesis was supported by the observation that the intensity of the band representing end 1 in the 5' end-mapping experiment with RNA from the A A M construct (Fig. 20, lanes O and P) was similar to that of the predominant 70 Fig. 21. 5' end-mapping of capped RNA with nucleases. The capping experiments were performed as described in Materials and Methods. For Fig. 21a 10 ug of capped RNA from BIO was hybridized to either 25 ng of a puc promoter region probe [61] (lane A) or 50 ng of the PstI to BamHI fragment seen in Fig. 16d (lane C). Lane B contains the results of capped RNA hybridized to 50 ng of non-specific pUC13 DNA. Fig. 21b, lane A contained 10 ug of capped RNA from ARC6 (pAAM) treated in the absence of D N A probe. Lane B contains the results of 10 |i.g of capped RNA from ARC6 (pAAM) hybridized to 35 ng of the small PstI to BamHI fragment from pUCAAM (see Fig. 16f). Fig. 21c contains the results of 10 ug of capped RNA from ARC6 (pAAM) hybridized to either 40 ng of the small PstI to Nael fragment seen in Fig. 16g (lane B) or 20 ng of the small Nael to BamHI fragment in Fig. 16h (lane C). Lane A contains the results of capped RNA treated in the absence of D N A probe. Molecular length markers based on the digestion of M13mpll ssDNA with Haelll are shown on the right of Fig. 21a. The arrows indicate protected capped RNA bands discussed in the text. 8 4 5 309 169 117 98 72 band (representing end 4) seen in the A4 hybridization (Fig. 20, lanes E and F). It should be noted that two different probes were used in Figure 20, 34 femptomoles of one probe (see Fig. 16c), with a specific activity of 1.3 x 10^ dpm/femptomole, were hybridized to 10 ug of A4 RNA to yield the results seen in lanes E and F, while 16 femptomoles of another probe (see Fig. 16e), with a specific activity of 2.0 x 10^ dpm/femptomole, were hybridized to 10 ug of A A M RNA to give the results seen in lanes O and P. Figure 21b shows the results of a capping experiment in which RNA from ARC6 (pAAM) was hybridized to the A A M probe shown in Figure 16f. This experiment yielded a band representative of a capped, protected RNA that mapped to a position corresponding to RNA end 1. Another band also appeared further up on the gel that appeared to represent a protected RNA segment of about 290 nucleotides in length. This other band did not appear in the SI nuclease mapping experiment (see Fig. 20, lanes O and P), so it was either an experimental artifact, or resulted from a transcript that initiated further upstream and terminated before the AccI site, or else was from the opposite strand. An experiment was performed in which the A A M probe was digested at the Nael site seen in Figure 3 to yield two probe fragments. The putative longer capped RNA should have hybridized to one of these fragments. If this 290 nucleotide band was a true protected capped transcript from the same strand as the puf mRNA it would have then appeared to be 190 nucleotides long. 73 However, if it were from the other strand it would be 130 to 200 nucleotides in length. In any event the Nael to BamHI fragment should still have protected RNA end 1. Figure 21c shows the results of this experiment. Lane B contained the results of the hybridization of A A M RNA to the fragment upstream of the Nael site (Fig. 16g) and no clear band was visible. In contrast, hybridization of the D N A downstream of the Nael site (Fig. 16h) to capped A A M RNA once again yielded a protected fragment (lane C) with 5' end 1 of the same length as previously seen in Figure 21b. The approximate position of this 5' end in the D N A sequence is shown in Figure 3 at nucleotide 228 (•). Upon comparison of the length of protected D N A that appears in the Sl nuclease mapping experiment of A A M (Fig. 20, lanes O and P) with the length of protected RNA seen in the capping experiment shown in Figure 21, it was found that they appear to be 4-6 nucleotides different in length. This may be due to the differences in the mobility between a single-stranded D N A molecule and its complementary RNA, or the presence of the GMP molecule added in the capping experiment may cause alterations in mobility on the gel. The Sl protected fragment seen in Figure 20, lanes O and P, has a 5' end that maps approximately to nucleotide 233 (•) in Figure 3. The presence of an RNA 5' end that is capable of being capped, and that maps immediately downstream of sequences shown to be necessary and sufficient for correct initiation of transcription of the puf operon, supports the 74 conclusion that the C>2-regulated promoter for the puf operon has been located. 3. Assessment of the role of the pufQ gene product 3.1. Absorption spectroscopy of cells containing wild-type or mutant pufQ genes. As described in the Introduction, an open reading frame was found upstream of the pufB gene that was capable of encoding a protein of 74 amino acids, and that was preceded by a Shine-Dalgarno like sequence [1,5]. Preliminary studies were performed on this open reading frame in order to deduce a possible function for the gene product. One approach taken in the study of the role of pufQ was to compare the light absorption spectra of strains of R capsulatus that were deleted for pufQ to the spectra of strains that contained pufQ. The spectrum shown in Figure 22A is of the wild-type strain BIO. The B800-850 light-harvesting absorption peaks are easily seen, whereas the less abundant B870 and reaction center peaks are hidden by the absorption at 850 nm. The result obtained with the ARC6 strain, which has a chromosomal deletion that begins at the Sail site within pufQ (see Fig. 2) and extends to an XhoII site beyond the pufX gene, is shown in Figure 22B. It can be seen that although the genes for the B800-850 peptides (found in the puc operon) are still present in this strain, very little absorption due to B800-850 complexes was seen. 75 Fig. 22. Absorption spectra of R. capsulatus strains BIO (A), ARC6 (B), and U43 (C). The abscissa represents wavelength and ranges from 350 run to 900 nm. The ordinate represents absorbancy units and ranges from 0.0 to 0.6. 76 The second strain used was U43 (described in section 2.2), a strain from which the puf operon has been deleted, and which is mutated in the puc operon. Thus U43 contains no B800-850, B870, or reaction center peptides, as well as no pufQ gene product. The absorption spectrum for this strain is shown in Figure 22C. Figure 23A shows the absorption spectrum of a strain of ARC6 that contains the plasmid pJAJ935. The plasmid pJAJ935 has cloned into it the XhoII-Sphl region of the puf operon shown in Figure 2b, thus it contains a complete copy of the pufQ gene. The absorption scan shows a dramatic increase in absorbancy at 800 and 850 nm in comparison with ARC6 (Fig. 22B). To ensure that the formation of the B800-850 complexes was due to the presence of the pufQ gene, and not the result of the presence of some other component of the insert or vector, the pufQ gene was deleted from the plasmid pJAJ935 by removal of the NcoI-EcoRI segment shown in Figure 11, and the resultant plasmid (pJAJAQ) was tested in cells of ARC6. As shown in Figure 23B, the removal of pufQ from pJAJ935 resulted in an absorption scan similar to that of ARC6. Thus it appeared that the pufQ gene product was necessary for the formation of B800-850 complexes. To observe the effects of pufQ on B870 complex formation a strain of U43 that contained the plasmid pTB999 (shown in Fig. 14) was used. The use of 77 Fig. 23. Absorption spectra of various strains of JL. capsulatus. The abscissa represents wavelength and ranges from 350 nm to 900 nm. The ordinate represents absorbancy units and ranges from 0.0 to 0.6. 78 U43 allows for B870 complexes to be seen as they are no longer masked by the B800-850 complexes (which are not formed in U43). Figure 23C shows an absorption scan of U43 (pTB999) in which there is absorbance at 870 nm due to the presence of B870 complexes. The pufQ gene was deleted in pTB999 as described in Materials and Methods and, as shown in Figure 23D, the removal of pufQ results in the loss of B870 complex absorption. 3.2. The effects of pufQ on transcription and translation of puf or puc mRNA. The pufQ gene product could be involved in light-harvesting complex formation in several ways. For example, it may be needed for initiation of puf or puc operon transcription or mRNA translation, or it could be necessary for posttranslational assembly of mature complexes. The results that I have obtained while studying the promoter of the puf operon show that pufQ is not needed for transcription of the puf operon. This was shown by the high lacZ activities obtained with the A A M construct (see Table IV) in which pufQ has been deleted, and by the amount of RNA that was obtained from ARC6 containing pAAM (shown in Fig. 20, lanes O and P). Both the lacZ activities and the quantity of RNA obtained are similar to those of the A4 construct, which contains pufQ (see Table IV and Fig. 20, lanes E and F). The effects of pufQ on transcription of puc genes were tested by Anthony Zucconi in our lab by measurements of beta-galactosidase activities in 79 cells of BIO or ARC6 that contained plasmids in which the puc promoter was fused to the K coli lacZ gene. One plasmid construct (pAZIII) contained the entire lacZ gene and translation initiation was controlled by the native lacZ Shine-Dalgarno and associated translational regulatory sequences (operon fusion) [62]. The specific activities of beta-galactosidase extracts of BIO and ARC6 cells were very similar [62]. This indicates that deletion of pufQ has no affect on initiation of transcription at the puc promoter. The second plasmid used by Zucconi (pAZV) contained the same segment of the puc operon, except that there was an in-frame fusion between the twenty-fifth codon of the pucB gene and the eighth codon of lacZ (gene fusion) [62]. The activities obtained with this plasmid in cells of BIO or ARC6 showed that there are no significant differences regardless of the presence or absence of pufQ [62]. Therefore, pufQ does not seem to affect the frequency of translation initiation at puc translational regulatory sequences. In order to evaluate the effect of pufQ deletion on puc mRNA levels, I performed SI nuclease protection measurements of puc mRNA from BIO or ARC6 cells. The results are shown in Figure 24. The hybridization was performed with the probe concentration in excess of that of the puc mRNA [61], and the levels of RNA detected from BIO and ARC6 were similar. This result confirms that puc operon transcription occurs normally in strain ARC6, and also shows that the stability of puc mRNA is equivalent in the two strains. 80 A B C - 8 4 5 -309 -169 - 117 _ 98 Fig. 24. SI nuclease protection measurement of puc mRNA from BIO and ARC6. The SI experiments were performed as described in Materials and Methods. Lane A, 500 ng of puc probe hybridized to 10 ug yeast tRNA; lane B, 500 ng of puc probe hybridized to 10 ug B10 RNA; lane C, 500 ng puc probe hybridized to 10 ug ARC6 RNA. Molecular length markers based on M13mpll ssDNA digested with Haelll are shown on the right. The arrow indicates the bands that correspond to puc mRNA. 81 DISCUSSION In the first part of this thesis I described the purification of RNA polymerase from K capsulatus cells grown either chemoheterotrophically or photoheterotrophically. The subunit composition of the enzyme was similar to that of other eubacterial RNA polymerases [10,50]. The putative beta and beta-prime subunits were very close in molecular weight to those of K coli, whereas the putative alpha subunit was larger than the 40,000 Dalton K coli alpha subunit. Although the polymerase that was obtained from the heparin Sepharose column had several components that could have been the sigma subunit(s), the two further purifications performed removed most of these additional protein bands and prompted my provisional designation of sigma. This component appeared to be the same for RNA polymerase purified from chemoheterotrophically and photoheterotrophically grown R. capsulatus. The RNA polymerase purified from the heparin Sepharose column was the preparation used for in vitro transcription. Radioactive RNA transcripts made from linearized pUC13 or pJAJ21 templates showed that the preparation of RNA polymerase can initiate transcription efficiently at some promoters in the absence of accessory factors. Although the R. capsulatus region present in pJAJ21 82 promotes regulated transcription of adjacent genes in vivo [26], no transcripts other than those found with the linearized vector (pUC13) alone were detected in vitro. When the cloned R. capsulatus D N A fragment was used alone as template a much lower level of transcription was obtained than when pUC13 D N A was present, and this activity was much more sensitive to heparin inhibition. It was also observed that a quasi-random size distribution of RNA transcripts was obtained. This result is similar to results obtained with core RNA polymerase preparations [30,46], and I conclude that some factor or condition necessary for specific transcription from the puf promoter is absent in these assays. For example, transcription of the puf promoter may be regulated by the extent of supercoiling of the DNA, so that the use of linear templates may have prevented the initiation of transcription. The control of transcription by the extent of supercoiling has been described for other promoters [9,53], and has recently been implicated in the oxygen regulation of the photosynthesis genes of R. capsulatus [59]. Alternatively, it may be that a protein factor, lost during RNA polymerase purification, is necessary for specific initiation of transcription from this promoter. Although tests of cruder extracts showed no significant decrease in the number of run-off transcripts, the salts or polyethylene-glycol present at earlier stages of purification could have inhibited such a factor. Another possibility is that some or all of the "non-specific" transcripts arose from premature termination after initiation at a specific site. It also cannot be ruled 83 out that the genuine sigma factor was lost during the purification. The purification and preliminary characterization of R capsulatus RNA polymerase has shown that the enzyme is similar to K coli RNA polymerase in basic subunit structure. Both enzymes were capable of specific initiation of run-off transcription with linearized pUC13 D N A as template, but neither enzyme gave specific transcripts in a run-off assay with the puf D N A fragment (JL coli data not shown). These results, along with the observation that the puf promoter does not function in E\ coli [26] are consistent with the possibility that an accessory factor which facilitates transcription of photosynthesis genes is present in cells of R capsulatus. The second part of my thesis was based on localization of the puf promoter through the use of in vitro mutagenesis and evaluation of the mutagenesis effects on the functional activity of the promoter as measured with fusions of the puf promoter region to the K coli lacZ gene. This approach was complemented by the use of RNA end-mapping and capping techniques. The existence of a predominant RNA transcript with a 5' end (end 4) that mapped just downstream of the EcoRI site seen in Figure 2 led to an initial assumption that the promoter lies just upstream of the EcoRI site. However, the results of large scale deletions of the puf promoter region showed that the promoter lies upstream of the AccI site, which is more than 540 base pairs upstream of the EcoRI site (see Table IV and Fig. 2). 84 Exonuclease deletion experiments localized the puf operon promoter between the 5' end of the A4 deletion shown in Table IV and the AccI site. RNA end-mapping experiments revealed the existence of less abundant RNA transcripts whose 5' ends mapped further upstream from the predominant RNA 5' end (see Fig. 2; ends 1, 2, and 3). The most upstream of these transcripts maps just before the AccI site. The promoter was located more precisely by oligonucleotide-directed mutagenesis. An inverted repeat between nucleotides 176-205 (see Fig. 3) was shown to be necessary for transcription initiation (see A41, Table IV). Just downstream of this inverted repeat is a sequence of D N A similar to sequences of the puc promoter region implicated in transcription initiation [61]. Since a change of only two nucleotides in the puf sequence decreased activity drastically (A44, Table IV), I propose that the AT-rich region around these two nucleotides, 5'-TTACAT-3" (see Fig. 3), is the "-10" region of the promoter. This would place the "-35" region within the inverted repeat that was deleted in the A41 construct. The finding that the A41 and A14 deletions eliminated promoter activity (see Table IV and Fig. 3) strengthens this suggestion. It may be that the cis-active component involved in O2 regulation of promoter activity also lies within the "-35" inverted repeat. Upon comparison of the ratio of low to high 0 2 activities shown in Table IV it can be seen that the A41 construct (in which the "-35" inverted repeat has been deleted) has a lower ratio 85 than the A44 construct, in which the inverted repeat and putative "-35" are present but the "-10" has been mutated. The A44 construct has three-fold higher activity under low 0 2 conditions than the A41 construct. Although the values are low, due to removal of essential promoter sequences, this difference in ratios may indicate that the inverted repeat is involved in cis-active regulation by 0 2 . A promoter, termed PI, was located recently in the region in which I have located the puf promoter [5]. A second, constitutive promoter, P2, with 3% of the activity of PI was located about 190 base pairs downstream of PI [5]. P2 lies at about position 420 in Figure 3, which is between the 5' ends of the A24 and 932 constructs shown in Table IV. The data I obtained, shown in Table IV, showed a decrease in promoter activity of about 50% when that region was deleted. I believe that the residual activity seen in the A24 and 932 constructs is due to non-specific initiation of transcription because a further deletion to the Mnll site (see AMSP) resulted in a further decrease in activity of approximately 50%, supporting the theory of non-specific initiation over the existence of a weak constitutive promoter. Although there is evidence for multiple promoters in R. shaeroides (which is closely related to R. capsulatus), one upstream of pufQ [27] and two upstream of pufB [57], I interpret my data as suggesting that these two species use different methods of expression of the puf operon. It was also suggested by Bauer et al. that the sequence at their PI had homology with the ntrA sigma factor consensus recognition sequence and that 86 the puf promoter may be transcribed by an RNA polymerase that contains an ntrA-like sigma factor [5]. This seems unlikely as the ntrA sigma subunit exists in E. coli and it has been shown that puf promoter does not function in E. coli [26]. However, the lack of transcription may be due to incompatability of other components of the IL coli RNA polymerase. The wild-type strain BIO was used as a source of RNA for end-mapping experiments that were performed in order to test the validity of the gene fusion data. The existence of the less abundant RNA transcripts was confirmed by 5' end-mapping with SI nuclease (see Fig. 17) and primer extension (Fig. 18). The use of these two different techniques to show the existence of RNA 5' end 1 supports the conclusion that transcription initiates upstream of the AccI site shown in Figure 2. The additional 5' ends detected by both procedures (2, 3, and 4) prompted the hypothesis that the most 5' of the less abundant ends (end 1, Fig. 2) maps to the site of transcription initiation, and the presence of the other 5' ends is due to processing of the primary transcript. A 3' end-mapping experiment was attempted to determine if stable 3' ends could be detected as a product of this putative processing, but no 3' ends could be detected. The existence of active 3' to 5' RNases in the cell may make the detection of these processed 3' ends difficult. RNA preparations from the puf deletion strain ARC6 that contained a number of the plasmids with mutant puf 5' sequences (shown in Table IV) were studied to see if the effects on lacZ activity presented in Table IV corresponded to 87 the levels of RNA obtained from the cells. The results displayed in Figure 20 showed that RNA levels matched the levels of beta-galactosidase found. These RNA end-mapping experiments also gave support to the processing theory. The A A M construct has all of the putative processing sites removed (see Fig. 2) so it was hypothesized that RNA transcripts that initiated from the site just upstream of the AccI site might not be processed in this strain and would be present in the cells in an abundance comparable to the predominant transcript described in Figure 2 (end 4), and seen in lanes E and F of Figure 20. Comparison of the intensity of the band seen in lanes O and P of Figure 20 with the predominant band in lanes E and F shows that the intensity is similar. Although the amount of probe (Fig. 16e) added to the A A M RNA to yield the results seen in lanes O and P was only about 50% of the amount of the other probe (Fig. 16c) added to the same amount of A4 RNA to yield the results seen in lanes E and F, the former probe had about twice the specific activity. If the probes were in excess, and processing was not occuring then the band seen in lanes O and P would appear to be about twice as intense as the band representing end 1 in lanes E and F. The band in lanes O and P is many times more intense than that, and is similar in intensity to the band representing end 4 in lanes E and F. Therefore it was concluded that ends 2, 3, and 4 arise by processing of the primary transcript (which initiates with end 1), and that the low abundance of this segment of the puf transcript is due to this processing 88 The presence of an RNA 5' end that could be capped, and which mapped immediately downstream of the sequences shown to be essential for promoter activity confirmed that the puf promoter had been located. Although this capped end could only be found in the A A M construct, the extreme instability of the wild-type primary transcript could account for the inability to detect it. Shown in Figure 25 is a model for the initiation of puf mRNA transcription and subsequent processing to yield the multiple transcripts that have been found. The B and A gene products are present in the cell in much greater amounts than the L and M gene products, and differential mRNA stability has been suggested as one method of control of production of these components of the photosynthetic apparatus [8]. Along the same lines, because of the low amount of the pufQ segment of the puf transcript it may be that the pufQ gene product is required in much lower amounts than the other puf gene products. The presence of an open reading frame located between the sequences found to be involved in promoter activity and what was previously believed to be the first gene of the operon, pufB, helped to explain the distance between the two regions. The predicted amino acid sequence of the product of the new gene was similar to a segment of both the L and M gene products of puf, specifically the region where the peptides had been shown to bind to bacteriochlorophyll [1]. The low level of pufQ segments of puf mRNA suggests that the pufQ gene product is present in relatively low amounts in the cell and has a catalytic rather 89 Fig. 25. Processing of puf mRNA. The top line represents K. capsulatus chromosomal D N A , the boxes represent puf operon genes. The horizontal arrows designate puf RNA transcripts, with the primary transcript indicated with an asterisk. The thicker the arrows the more abundant the RNA molecules represented. 90 than a structural role (see Fig. 2). I have shown that pufQ is necessary for formation of mature photosynthetic pigment/protein complexes, but this role of pufQ is not at the level of transcription or translation of the peptide genes (Figs. 23 and 24). Whether Q is involved in assembly of complexes or in bacteriochlorophyll synthesis is as yet unknown. Deletion of pufQ has no effect on transcription of the bchC gene, which encodes a bchl biosynthetic enzyme (C. Keen, personal communication). It is known that synthesis of both peptides and bacteriochlorophyll is necessary for assembly of the complexes [28]. No peptides are found in bch" mutants [17] and no free bchl is seen in strains that contain mutations in photosynthetic complex peptide genes (as in U43) [55]. Yet, when all of the bchl biosynthetic enzyme genes and B800-850 peptide genes are present in a strain that is pufQ" (as in ARC6) no complexes can be seen. Thus it appears that pufQ may be necessary for assembly of mature complexes, or bchl biosynthesis [5]. My localization of the puf promoter and determination of the sequences involved in initiation of transcription will aid in localization of other photosynthesis promoters of R, capsulatus, and will enable further studies to be performed on this and other promoters to achieve a better understanding of gene expression in general. 91 REFERENCES 1. Adams, C. W., M . E. Forrest, S. N . Cohen, and J. T. Beatty. 1988. Transcriptional control of the R capsulatus puf operon: a structural and functional analysis. Manuscript submitted to J. Bacteriol. 2. Allen, J. P., G. Feher, T. O. Yeates, D. C. Rees, J. Deisenhofer, H . Michel, and R. Huber. 1986. Structural homology of reaction centers from Rhodopseudomonas sphaeroides and Rhodopseudomonas viridis as determined by x-ray diffraction. Proc. Natl. Acad. Sci. USA 83: 8589-8593. 3. Apiron, D. 1973. Degradation of RNA in Escherichia coli. Molec. Gen. Genet. 122: 313-322. 4. Bauer, C. E., M . Eleuterio, D. A. Young, and B. L. Marrs. 1987. Analysis of transcription through the Rhodobacter capsulatus puf operon using a translational fusion of pufM to the R coli lacZ gene, in: Progress in Photosynthesis Research. Vol. IV. pp. 699-705. (J. Biggens ed.). Martinus Nijhoff Publishers, Dordrecht The Netherlands. 5. Bauer, C. E., D. A. Young, and B. L. Marrs. 1988. Analysis of the Rhodobacter capsulatus puf operon. Location of the oxygen-regulated promoter region and the identification of an additional puf-encoded gene. J. Biol. Chem. 263: 4820-4827. 6. Beatty, J. T., and S. N . Cohen. 1983. Hybridization of cloned Rhodopseudomonas capsulata photosynthesis genes with D N A from other photosynthetic bacteria. J. Bacteriol. 154: 1440-1445. 7. Beck, E., and E. Bremer. 1980. Nucleotide sequence of the gene ompA coding the outer membrane protein II* of Escherichia coli K-12. Nuc. Acids Res. 8: 3011-3024. 8. Belasco, J. G., J. T. Beatty, C. W. Adams, A. von Gabain, and S. N. Cohen. 1985. Differential expression of photosynthesis genes in R capsulata results from segmental differences in stability within the polycistronic rxcA transcript. Cell 40:171-181. 92 9. Borowiec, J. A., and J. D. Gralla. 1985. Supercoiling response of the lac p s promoter in vitro. J. Mol. Biol. 184: 587-598. 10. Burgess, R.R. 1976. in: RNA Polymerase. (Losick, R., and Chamberlin, M. , eds) pp. 69-100, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. 11. Chen, C-Y. A., J. T. Beatty, S. N. Cohen, and J. G. Belasco. 1988. An intercistronic stem-loop structure functions as an mRNA decay terminator necessary but insufficient for puf mRNA stability. Cell 52: 609-619. 12 Chory, J., T. J. Donahue, A. R. Varga, L. A. Staehelin, and S. Kaplan. 1984. Induction of the photosynthetic membranes of Rhodopseudomonas  sphaeroides: biochemical and morphological studies. J. Bacteriol. 159: 540-554. 13. Clark, W. G., E. Davidson, and B. L. Marrs. 1984. Variation of levels of mRNA coding for antenna and reaction center polypeptides in Rhodopseudomonas capsulata in response to changes in oxygen concentration. J. Bacteriol. 157: 945-948. 14. Crofts, A. R., and C. A. Wraight. 1983. The electrochemical domain of photosynthesis. Biochim. Biophys. Acta. 726: 149-185. 15. Daldal, F., S. Chen, J. Applebaum, E. Davidson, and R. C. Prince. 1986. Cytochrome c 2 is not essential for photosynthetic growth of Rhodopseudomonas capsulata. Proc. Natl. Acad. Sci. USA 83: 2012-2016. 16. Deisenhofer, J., O. Epp, K. Miki, R. Huber, and H . Michel. 1985. Structure of the protein subunits in the photosynthetic reaction centre of Rhodopseudomonas viridis at 3A resolution. Nature 318: 618-624. 17. Dierstein, R. 1983. Biosynthesis of pigment-protein complex polypeptides in bacteriochlorophyll-less mutant cells of Rhodopseudomonas capsulata YS. FEBS. Lett. 160: 281-286. 18. Ditta, G., T. Schmidhauser, E. Yakobson, P. Lu, X.-W. Liang, D. R. Finlay, D. 93 Guiney and D. R. Helinski. 1985. Plasmids related to the broad host range vector pRK290 useful for gene cloning and for monitoring gene expression. Plasmid 13: 149-153. 19. Drews, G., and J. Oelze. 1981. Organization and differentiation of membranes of phototrophic bacteria. Adv. Microb. Physiol. 22: 1-92. 20. Drews, G., J. Peters and R. Dierstein. 1983. Molecular organization and biosynthesis of pigment-protein complexes of Rhodopseudomonas  capsulata. Ann. Microbiol.(Inst. Pasteur) 134b: 151-158. 21. Drews, G. 1985. Structure and functional organization of light-harvesting complexes and photochemical reaction centers in membranes of phototrophic bacteria. Microbiol. Rev. 49: 59-70. 22. Hawley, D. K., and W. R. McClure. 1983. Compilation and analysis of Escherichia coli promoter D N A sequences. Nuc. Acids Res. 11: 2237-2255. 23. Henikoff, S. 1984. Unidirectional digestion with exonuclease III creates targeted breakpoints for D N A sequencing. Gene 28: 351-359. 24. Hui, A., J. Hayflick, K. Dinkelspiel, and H . A. de Boer. 1984. Mutagenesis of the three bases preceding the start codon of the beta-galactosidase mRNA and its effects on translation in Escherichia coli. EMBO J. 3: 623-629. 25. Imhoff J. F., H . G. Truper, and N. Pfennig. 1984. Rearrangement of the species and genera of the phototrophic "purple non-sulfur bacteria". Int. J. Syst. Bacteriol. 34: 340-343. 26. Johnson, J. A., W. K. R. Wong, and J. T. Beatty. 1986. Expression of cellulase genes in Rhodobacter capsulatus by use of plasmid expression vectors. J. Bacteriol. 167: 604-610. 27. Kiley, P. J., and S. Kaplan. 1988. Molecular genetics of photosynthetic membrane biosynthesis in Rhodobacter sphaeroides. Micro. Rev. 52: 50-69. 28. Klug, G., R. Liebetanz, and G. Drews. 1986. The influence of bacteriochlorophyll biosynthesis on formation of pigment-binding proteins and assembly of pigment protein complexes in Rhodopseudomonas capsulata. Arch. Microbiol. 146: 284-291. 9 4 29 Kunkel, T. A. 1985. Rapid and efficient site-specific mutagenesis without phenotypic selection. Proc Natl. Acad. Sci. USA 82: 488-492. 30. Kiipper, H. , R. Contreras, H . G. Khorana, and A. Landy. 1976. in: RNA polymerase. (Losick, R. and Chamberlin, M . eds) pp. 473-484, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York 31. Laemmli, U . K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680-685. 32. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N. Y. 33. Marrs, B. 1974. Genetic recombination in Rhodopseudomonas capsulata. Proc. Natl. Acad. Sci. USA 71: 971-973. 34. Marrs, B. 1981. Mobilization of the genes for photosynthesis from Rhodopseudomonas capsulata by a promiscuous plasmid. J. Bacteriol. 146: 1003-1012. 35. McGuire, J. C , J. J. Pene, and J. Barrow-Carraway. 1974. Gene expression during the development of bacteriophage o29 i n . Analysis of viral-specific protein synthesis with suppressible mutants. J. Virol. 13: 690-698. 36. Moss, B. 1981. 5' end labelling of RNA with capping and methylating enzymes, in: Gene Amplification and Analysis, Vol. 2. (J. G. Chirikjian and T. S. Papas eds) pp. 253-266. Publishing Co., Amsterdam. Elsevier-Holland. 37. Neidhardt, F. C. (ed. in chief). 1987. in: Escherichia coli and Salmonella  typhimurium: cellular and molecular biology. Vol. 2. (J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaechter, and H . E. Umbarger, eds) pp 1444-1526. American Society of Microbiology. Washington D. C. 38. Prentki, P. and H . M . Krisch. 1984. In vitro insertional mutagenesis with a selectable D N A fragment. Gene 29: 303-313. 95 39. Schmidhauser, T. J., and D. R. Helinski. 1985. Regions of broad-host-range plasmid RK2 involved in replication and stable maintenance in nine species of gram-negative bacteria. J. Bacteriol. 164: 446-455. 40. Schumacher, A., and G. Drews. 1978. The formation of bacteriochlorophyll-protein complexes of the photosynthetic apparatus of Rhodopseudomonas capsulata during early stages of development. Biochim. Biophys. Acta. 501: 183-194. 41. Schumacher, A., and G. Drews. 1979. Effects of light intensity on membrane differentiation in Rhodopseudomonas capsulata. Biochim. Biophys. Acta. 547: 417-428. 42. Scott, J.R. 1984. Regulation of plasmid replication. Microbiol. Reviews 48: 1-23. 43. Sober, H.A. 1968. CRC Handbook of Biochemistry: selected data for molecular biology, 1st Ed. pp. H33-H49, The Chemical Rubber Co., Cleveland, Ohio. 44. Spiegelman, G.B. and H . R. Whiteley. 1974. Purification of ribonucleic acid polymerase from SP-82 infected Bacillus subtilis. J. Biol. Chem. 249: 1476-1482. 45. Spiegelman, G.B., W. R. Hiatt, and H . R. Whiteley. 1978. Role of the 21,000 molecular weight polypeptide of Bacillus subtilis RNA polymerase in RNA synthesis. J. Biol. Chem. 253: 1756-1765. 46. Sugiura, M . , T. Okamoto, and M . Takanami. 1970. RNA polymerase sigma-factor and the selection of initiation site. Nature 225: 598-600. 47. Thornber, J. P., R. J. Cogdell, B. K. Pierson, R. E. B. Seftor. 1983. Pigment-protein complexes of purple photosynthetic bacteria: an overview. J. Cell. Biochem. 23: 159-169. 48. von Gabain, A., J. G. Belasco, J. L. Schottel, A. C. Y. Chang, and S. N . Cohen. 1983. Decay of mRNA in Escherichia coli: investigation of the fate of specific segments of transcripts. Proc. Natl. Acad. Sci. USA 80: 653-657. 49. Weaver, P. F., J. D. Wall, and H . Gest. 1975. Characterization of 96 Pvhodopseudomonas capsulata. Arch. Microbiol. 105: 207-216. 50. Wiggs, J.L., J. W. Bush, and M . J. Chamberlin. 1979. Utilization of promoter and terminator sites on bacteriophage T7 D N A by RNA polymerases from a variety of bacterial orders. Cell 16: 97-109. 51. Willison, J. C , G. Ahombo, J. Chabert, J.-P. Magnin, and P. M. Vignais. 1985. Genetic mapping of the Rhodopseudomonas capsulata chromosome shows non-clustering of genes involved in nitrogen fixation. J. Gen. Microbiol. 131: 3001-3015. 52. Wilson, H . R., P. T. Chan, and C. L. Turnbough Jr. 1987. Nucleotide sequence and expression of the pyrC gene of Escherichia coli K-12. J. Bacteriol. 169: 3051-3058. 53. Yamamoto, N . and M . L. Droffner. 1985. Mechanisms determining aerobic or anaerobic growth in the facultative anaerobe Salmonella typhimurium. Proc. Natl. Acad. Sci. USA 82: 2077-2081. 54. Youvan, D. C , E. J. Bylina, A. M. Alberti, H. Begusch, and J. E. Hearst. 1984. Nucleotide and deduced polypeptide sequences of the photosynthetic reaction center, B870 antenna and flanking polypeptides from R capsulata. Cell 37: 949-957. 55. Youvan, D. C , S. Ismail, and E. J. Bylina. 1985. Chromosomal deletion and plasmid complementation of the photosynthetic reaction center and light-harvesting genes from Rhodopseudomonas capsulata. Gene 38: 19-30. 56. Youvan, D. C , and S. Ismail. 1985. Light harvesting II (B800-850 complex) structural genes from Rhodopseudomonas capsulata. Proc. Natl. Acad. Sci. USA 82: 58-62. 57. Zhu, Y. S., P. J. Kiley, T. J. Donohue, and S. Kaplan. 1986. Origin of the mRNA stoichiometry of the puf operon in Rhodobacter sphaeroides. J. Bacteriol. 261: 10366-10374. 58. Zhu, Y. S., and J. E. Hearst. 1986. Regulation of expression of genes for light-harvesting antenna proteins LH-I and LH-II; reaction center polypeptides RC-L, RC-M and RC-H; and enzymes of bacteriochloriophyll 97 and carotenoid biosynthesis in Rhodobacter capsulatus by light and oxygen. Proc. Natl. Acad. Sci. USA 83: 7613-7617. 59. Zhu, Y. S., and J. E. Hearst. 1988. Transcription of oxygen-regulated photosynthetic genes requires D N A gyrase in Rhodobacter capsulatus. Proc. Natl. Acad. Sci. USA 85: 4209-4213. 60. Zoller, M . J., and M . Smith. 1983. Oligonucleotide directed mutagenesis of D N A fragments cloned into M13 vectors. Meth. Enzymol. 100: 468-500. 61. Zucconi, A. P., and J. T. Beatty. 1988. Posttranscriptional regulation by light of the steady-state levels of mature B800-850 light-harvesting complexes in Rhodobacter capsulatus. J. Bacteriol. 170: 877-882. 62. Zucconi A. P. 1988. Regulation of the steady-state levels of B800-850 complexes in Rhodobacter capsulatus by light and oxygen. M . Sc. thesis. University of British Columbia. Vancouver, B. C. 98 APPENDIX The vector pJAJ103::lac903 [62] is a derivative of pJAJ103 [26], which in turn is a derivative of the broad host range vector pRK404 [18] into which was placed a fragment that contained the lacZ gene [Casadaban, etal. 1980. J. Bacteriol. 143: 971-980]. No attempt was made to place transcriptional or translational terminators into this vector. The first six constructs seen in Table V show a gradual decrease in activity as 5' sequences are removed. This trend continued as more and more sequences were removed between the 5' ends of the 932 construct and the AMSP construct (see ESP and A2). Removal of promoter sequences should result in a dramatic loss of activity rather than a gradual decrease so the results of these experiments led to the belief that read-through transcription from upstream sequences on the vector was contributing to the activity seen. The vector pTB999 (section 2.2 of the results) is a derivative of pRCVI [11] which was derived from pTJS133 [39]. No attempt was made to place terminators into this vector either. Since both pRK404 and pTJS133 are derived from pRK2, and share sequences upstream of the insertion site for fragments, this commonality in the two vectors led me to assume that read-through was a likely possibility in the pTB999 vector as well. This would explain the presence of B870 complexes in U43 (pTBA41). 99 Table V. Assays of beta-galactosidase activities of cells containing puf 5' region operon fusions to the lacZ gene of pJAJ103::lac903 1 Representation of the constructs used for puf promoter mapping. Restriction sites are indicated by vertical lines and are labelled in the top construct as follows: X-XhoII, A-AccI, M-Mnll.The structural genes are designated by thick lines and are labelled in the 935 representation. The dashed line represents the sequences that were removed in the A A M construct. The hillocks represent the palindromic sequences that were studied and the x's designate sites of oligonucleotide-directed deletions or mutations. 2 Activities are expressed as nmoles ONPG/min/mg protein. The values in brackets are standard deviations of 3 to 7 assays that were performed on each construct. ^The ratio of activities obtained under low 0 2 versus high C*2. 100 PUBLICATIONS Forrest, M.E., and J. T. Beatty Purification of Rhodobacter capsulatus RNA Polymerase and Its use for in vitro Transcription FEBS Letters, 212,28-34 (1987) Adams, C. W., M. E. Forrest, S. N . Cohen, and J. T. Beatty Transcriptional Control of the Rhodobacter  capsulatus puf Operon: A Structural and Functional Analysis. Submitted to J. Bacteriol. Forrest, M. E., A. J. Zucconi, and J. T. Beatty The pufQ Gene Product of Rhodobacter capsulatus is Essential for Formation of Mature B800-850 Light-harvesting Complexes. Submitted to FEMS Microbiology Letters GRADUATE AWARDS 1983-1987 The University of British Columbia Post-graduate Fellowship 1985-1987 Natural Sciences and Engineering Research Council Pre-doctoral Fellowship 1985-1987 Izaak Killam Pre-doctoral Research Fellowship 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0302154/manifest

Comment

Related Items