Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Analysis of the functions and the promoter structures of B-cell translocation gene-2 in rat cortical… Huang, Alan Lo-Chin 2007

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2007-0122a.pdf [ 7.7MB ]
Metadata
JSON: 831-1.0101308.json
JSON-LD: 831-1.0101308-ld.json
RDF/XML (Pretty): 831-1.0101308-rdf.xml
RDF/JSON: 831-1.0101308-rdf.json
Turtle: 831-1.0101308-turtle.txt
N-Triples: 831-1.0101308-rdf-ntriples.txt
Original Record: 831-1.0101308-source.json
Full Text
831-1.0101308-fulltext.txt
Citation
831-1.0101308.ris

Full Text

ANALYSIS OF T H E FUNCTIONS AND T H E PROMOTER STRUCTURES OF B - C E L L TRANSLOCATION GENE-2 IN RAT CORTICAL NEURONS by Alan Lo-Chin Huang B.Sc, University of British Columbia, 2004 A THESIS SUBMITTED IN PARTIAL FULFUILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in The Faculty of Graduate Studies Neuroscience THE UNIVERSITY OF BRITISH COLUMBIA April, 2007 © Alan Lo-Chin Huang ABSTRACT Previously data from out lab have shown that B T G 2 is up-regulated in both in vitro and in vivo ischemic models. We hypothesize that B T G 2 may play a neuro-protective role following glutamate-mediated activation of N M D A R , and that this neuro-protection depends on the collaboration of various transcription factors and cis-acting elements that are found on the B T G 2 promoter. To determine the function of B T G 2 , B T G 2 was either over-expressed or reduced in rat cortical neurons, and treated with either N M D A or oxygen glucose deprivation (OGD). Over-expression of B T G 2 reduced NMDA-induced cell death, as measured by L D H assay, and reduced activation of Caspase 3. In addition, Cycl inDl m R N A level was significantly increased following N M D A treatment in cells with reduced B T G 2 expression by s iRNA. Thus, B T G 2 appeared to have a neuro-protective function, possibly through down-regulation of Cycl inDl expression. To better understand the mechanism that regulated B T G 2 expression, we studied the B T G 2 promoter by cloning various lengths of B T G 2 promoter into a luciferase expression vector. The role of two specific cis-acting elements, a putative P 5 3 binding element P 5 3 R E ( -53/ -94) (-53 to - 9 4 relative to ATG) and a G A G A box, were investigated. While the isolated P 5 3 R E (-537-94) sequence functioned as a cis-activating and N M D A inducible ii element, it became repressive in the context of BTG2 promoter. Removal of P53RE (-53A94) and/or G A G A box not only increased the BTG2 promoter activity, but also made the promoter inducible to N M D A . Consistently, reduction of P53 expression with P53 s iRNA led to a significant increase in basal BTG2 expression. Immuno-coprecipitation results showed that the P53 and the G A G A box binding protein were associated together. Taken together, our results suggest that P53 may associate with G A G A box binding protein to form a complex to repress BTG2 expression. A hypothetical mode of action is then proposed, showing that binding of P53 to the P53RE (-53/-94) may activate G A G A box caused suppression, which becomes dominant for BTG2 expression. This mode illustrates a possible mechanism that an transactivating factor P53 and its cis-activating binding site can be turned into a suppressor depending on the location of P53 binding site and the transcriptional regulator(s) P53 associated with. i i i TABLE OF CONTENTS Abstract » Table of Contents iv List of Tables vi List of Figures vii Acknowledgements >x 1 Introduction 1 1.1 Molecular mechanisms following an ischemic stroke 1 1.2 Structure, expression, and localization of BTG2 4 1.3 Aims of the thesis 5 1.4 Bibliography 8 2 Neuro-protective Effect of BTG2 11 2.1 Introduction U 2.1.1 Functions of BTG2 11 2.1.2 Aims of the chapter 14 2.2 Methods 15 2.2.1 Rat primary cortical neuronal culture 15 2.2.2 Excitotoxicity treatments with N M D A and O G D 16 2.2.3 Assessment of neuronal death using L D H and T U N E L 17 2.2.4 Immunocytochemistry 17 2.2.5 Quantitative RT-PCR (qRT-PCR) for measurement of mRNA 18 2.2.6 Western immunoblotting 19 2.2.7 Generation of rat BTG2 siRNA in pLentiLox3.7 vector 20 2.2.8 Generation of BTG2-cMyc and BTG2-GFP fusion proteins 20 2.2.9 Construction of second generation lentivirus 21 2.2.10 Statistical analysis 21 2.3 Results 22 2.3.1 Expression and subcellular localization of BTG2 following N M D A ... 22 2.3.2 Role of BTG2 in following N M D A and O G D insults 23 2.3.3 Role of BTG2 in controlling CyclinDl expression following N M D A . . 25 2.4 Discussion 26 2.5 Bibliography 53 3 Analysis of BTG2 Promoter 57 3.1 Introduction 57 3.1.1 Properties of the BTG2 promoter 57 3.1.2 Role of P53 in BTG2 expression 59 3.1.3 Aims of the chapter 61 3.2 Methods 62 3.2.1 Electroporation of reporter gene into rat cortical neurons 62 • 3.2.2 Excitotoxicity treatment with N M D A 62 3.2.3 Quantitative RT-PCR (qRT-PCR) for measurement of mRNA 63 3.2.4 Western immunoblotting 63 3.2.5 Immunoprecipitation 63 3.2.6 Generation of rat P53 s iRNA in pLentiLox3.7 vector 64 3.2.7 Generation of P53 dominant negatives 64 3.2.8 Construction of second generation lentivirus 65 3.2.9 Generation of P53 response elements 65 3.2.10 BTG2 promoter luciferase reporter gene assay 65 3.2.11 Statistical analysis 66 3.3 Results 67 3.3.1 Analysis of BTG2 promoter 67 3.3.1.1 G A G A box is a suppresser element for BTG2 transcription .... 67 3.3.1.2 P53 acted as an enhancer in the absence of G A G A box but a suppressor with the G A G A box 68 3.3.1.3 P53 and GBP may form a complex to suppress BTG2 promoter activity 69 3.3.1.4 BTG2 promoter region -2246 to -4200 may contain a N M D A inducible element 70 3.3.1.5 The P53/GBP complex may also suppress the N M D A inducibility 70 3.3.1.6 P5 3 down regulated endogenous BTG2 expression in unstimulated neurons 71 3.3.1.7 Summary 72 3.4 Discussion 73 3.5 Bibliography 96 Concluding Chapter 100 LIST OF TABLES Table 2.1 List of Real-Time PCR primers 31 Table 2.2 List of BTG2 siRNAs and s iRNA controls sequences 32 Table 2.3 Methods to generate BTG2-cMyc and BTG2-GFP fusion c D N A 33 Table 3.1 List of Real-Time P C R primers 77 Table 3.2 List of p53 siRNAs and s iRNA controls sequences 78 Table 3.3 Methods and primers used to generate p53 dominant negatives 79 Table 3.4 Methods to generate pGL3-BTG2-promoters 80 Table 3.5 Putative transcription factor binding sites on BTG2 promoter 81 LIST OF FIGURES Figure 1.1 Structures of BTG2 gene and protein 7 Figure 2.1 A n example of BTG2 siRNA oligos following annealing 34 Figure 2.2 BTG2 m R N A expression following retina ischemia 35 Figure 2.3 BTG2 mRNA expression following M C A O ischemia 36 Figure 2.4 BTG2 mRNA expression following N M D A treatment 37 Figure 2.5 BTG2 mRNA expression following N M D A treatment 38 Figure 2.6 BTG2 protein expression following N M D A treatment 39 Figure 2.7 Subcellular localization of BTG2 following N M D A 40 Figure 2.8 Over-expression of BTG2 protein 42 Figure 2.9 Effect of BTG2 s iRNA on BTG2 m R N A expression levels 43 Figure 2.10 Effect of BTG2 s iRNA on BTG2 protein expression levels 44 Figure 2.11 Effect of over-expressing BTG2 or reducing BTG2 expression level on activation of Caspase 3 following N M D A treatment 45 Figure 2.12 L D H analysis of the effect on NMDA-induced excitotoxicity 46 Figure 2.13 L D H analysis of the effect of BTG2 s iRNA on NMDA-induced excitotoxicity 47 Figure 2.14 T U N E L analysis of the effect of BTG2 siRNA on NMDA-induced excitotoxicity 48 Figure 2.15 L D H analysis of the effect of over-expressing BTG2 on NMDA-induced excitotoxicity 49 Figure 2.16 L D H analysis on OGD-induced cell death 50 Figure 2.17 L D H analysis of the effect of BTG2 siRNA on OGD-induced cell death 51 Figure 2.18 Effect of BTG2 s iRNA on Cycl inDl mRNA expression following N M D A treatment 52 Figure 3.1 Sequences of the putative P53 binding site found on the BTG2 promoter ... 82 Figure 3.2 Primers used to amplify different regions of BTG2 promoter 83 Figure 3.3 Transfection efficiency of rat cortical neurons 84 Figure 3.4 Analysis of the transfection efficiency of different BTG2 promoter lengths 85 Figure 3.5 Luciferase study of the basal level of BTG2 promoter activity 86 Figure 3.6 Luciferase study of the G A G A box on the SV40 promoter 87 Figure 3.7 Luciferase study on the effect of N M D A on P53RE (-53/-94) 88 Figure 3.8 Analysis of interaction between P53 and GBP 89 Figure 3.9 Luciferase study of the BTG2 promoter activities following N M D A Treatment 90 Figure 3.10 Effect of P53 s iRNA on P53 mRNA expression 91 Figure 3.11 Effect of P53 s iRNA on P53 protein expression 92 Figure 3.12 Effect of P53 s iRNA on BTG2 protein expression 93 Figure 3.13 A possible mechanism in which P53 interacts with GBP to suppress BTG2 expression 94 Figure 3.14 Schematic diagram of the putative transcription binding sites on rat BTG2 promoter upstream of A T G 95 viii A C K N O W L E D G E M E N T I would like to thank both Dr. William Jia and Dr. Max Cynader for guiding me over this project and teaching me so much about science. Everybody in the lab was very helpful when I had questions, and I really enjoyed working with them. Previous microarray data and BTG2 work (Figure 2.2, 2.3, and 2.4) were the work of Dr. Shiv Prasad, Dr. Luba Kojic, and Wendy. Finally, I am greatful for the helpful comments and suggestions given by my committee members, Dr. Tim Murphy, Dr. Wang Y u Tian, and Dr. Max Cynader, at the last committee meeting. I X 1 INTRODUCTION 1.1 Molecular Mechanisms Following an Ischemic Stroke According to the Heart and Stroke Foundation of Canada, stroke is the fourth leading cause of death in Canada and is one of the main causes that lead to adult neurological disabilities (Heart and Stroke Foundation of Canada, 2007). During a stroke, the supply of glucose and oxygen to the brain cells is drastically reduced due to a reduction of blood flow to the brain, which in turn activates several cellular events leading to neuronal death (for review, see Hou and MacManus, 2003; Lipton, 1999; Mattson et al., 2000). As the mitochondria dysfunctions and the cellular A T P level reduces in response to the loss of energy supply to the brain cells, the ability of ATP-dependent ion channels to remove ions, such as N a + , Cl~ and C a 2 + , from the cells becomes impaired leading to a loss of membrain potential and cell swelling (Schinder et al., 1996). Both neuronal and non-neuronal cells become depolarized and the voltage-dependent C a 2 + channels activated causing the release of neurotransmitters, such as the excitatory amino acid glutamate, leading to further activation of a series of ligand-gated Ca 2 +permeable channels and metabotropic Ca 2 +channels. Since the re-uptake mechanisms of neurotransmitters are impaired due to the lack of production of ATP , the accumulation of glutamate further activates post-synaptic glutamate receptors causing a massive influx of C a 2 + ions. This massive influx of C a 2 + then acts as a messenger activating a series of cellular events including: protein phosphorylation leading to reduced R N A and protein synthesis; proteolysis leading to degradation of cytoskeleton; lipolysis leading to membrane degradation which further disrupts the cellular C a 2 + homeostasis; and reactive oxygen species production leading to oxidative stress (for review, see Hou and MacManus, 2003; Lipton, 1999; Mattson et al., 2000). Glutamate-mediated excitotoxicity, which leads to the activation of both metabotropic and ionotropic glutamate receptors, has been suggested to be one of the major causes of neuronal death following a stroke and other neurodegenerative diseases (Faden et al., 1989; for review, see Lynch and Guttmann, 2002). When the GTP-dependent metabotropic glutamate receptors are activated, C a 2 + ions are mobilized from the internal stores, such as the mitochondria. On the other hand, the activation of glutamate ionotropic receptors leads to an increase in the permeability to N a + , K + , and C a 2 + ions. N-methyl-D-aspartate receptor ( N M D A R ) , 2-amino-3-(3-hydroxy-5- methylisoxazol-4-yl) proprionate receptor ( A M P A R ) and kainite receptor are the three subtypes of ionotropic glutamate receptors that are believed to play a major role in the glutamate-mediated excitotoxicity (Choi, 1988; Ozyurt et al., 1988; Simon et al., 1984; for review, see Arundine and Tymianski, 2004). Of these three subtypes of ionotropic glutamate receptors, the role of N M D A R in glutamate-mediated excitotoxicity has also been extensively studied (for review, see Arundine and Tymianski, 2004; Lynch and Guttmann, 2002). N M D A R consists of five N M D A R subunits, NR1 and N R 2 A - D , and exists as either heterotetramer or heteropentamer structures (Hollmann and Heinemann, 1994; Laube et al., 1998). In order for the N M D A R to be functional, NR1 subunit needs to be present as shown both in in vitro and in vivo studies (Forrest et al., 1994; Kutsuwada et al., 1992; L i et al., 1994; Monyer et al., 1992; Yuzaki et a l , 1996). Furthermore, a channel pore loop structure at the second membrain domain of the NR1 subunit is responsible for the channel activities, such as permeability of C a 2 + ions, controlling voltage-dependent M g 2 + block of N M D A receptors, and binding to glutamate and glycine (Burnashev et al., 1992; Schneggenburger and Ascher, 1997). The C-terminal domains of the N M D A R subunits exhibit variations and that each subunit interacts with specific downstream signaling pathways at the post-synaptic density following glutamate-mediated C a 2 + influx (for review, 2 see Sheng and Pak, 2000; Scannevin and Huganir, 2000). Distinct Ca signaling pathways also exist for NMDAR-mediated excitotoxicity since C a 2 + influx through N M D A R results in more cell death compare to C a 2 + influx through the non-NMDAR or voltage-gated calcium channels (Sattler et al., 1998; Tymianski et al., 1993). Although the relationship between excessive C a 2 + influx and glutamate-mediated excitotoxicity has been well studied and established, the downstream signaling pathways are not well understood. Numerous studies have described neuronal death following traumatic brain injury, ischemia and NMDAR-mediated excitotoxicity (Buki et al., 2000; Graham and Chen et al., 2001; Sakhi et al., 1997; for review, see Hou and MacManus, 2000). In many cases, NMDAR-mediated neuronal death is caspase-dependent, and the release of Cytochrome c, a component of the electron transport chain, from the mitochondria is crucial to this process (Liu et al., 1996; Rodriguez and lazebnik, 1999; Tenneti and Lipton, 2000; for review, see Wang, 2001). However, recent studies also suggest a caspase-independent form of programmed cell death following activation of N M D A R , whereby the release of mitochondrial proteins, such as Endonuclease g and apoptosis inducing factor (AIF), induce nuclear D N A fragmentation through Poly(ADP-ribose) polymerase-1 (PARP-1) (Liu et al., 1998; L i et al., 2001; Wang et al., 2004; for review, see Y u et al., 2003). Another pro-death pathway that is activated by the NMDAR-mediated excitotoxicity is the cell-cycle pathway. A n increase in cyclins and its associated cyclin-dependent kinases activities have been shown both in vitro and in vivo following ischemia (Katchanov et al., 2001; Osuga et al., 2000; Park et al., 2000; Timsit et al., 1999; Wang et al., 2002, 2003). Furthermore, cyclin-dependent kinases have been studied as a therapeutic target for stroke. Surprisingly, glutamate-mediated N M D A R activation also activates pro-survival pathway (for review, see Hetman and Kharebava, 2006). The apparent effect of N M D A R in activating pro-survival signaling pathway is seen during central nervous system 3 development where basal N M D A R activity is required for not only to support survival, but also may protect against excitotoxicity (Pohl et al., 1999; Verhage et al., 2000). Survival responses that are mediated by the N M D A R following neuronal injuries include activation of: pro-survival kinases, such as Erk, PDKVAkt, and C a M K ; growth factors, such as B D N F , and erythropoietin; pro-survival transcription factors, such as C R E B , and NF-kB; and apoptosis inhibitors, such as Bcl-2 (for review, see Hetman and Kharebava, 2006). Recently it was found that B-cell translocation gene 2 (BTG2) was protective in mouse hippocampal neurons against staurosporine-induced cell death and growth factor withdrawal-induced cell death (Zhang et al., 2007). Furthermore, the activation of BTG2 expression depended on the nuclear calcium signaling pathway activated by N M D A R (Zhang et al., 2007). 1.2 Structure, Expression, and Localization of BTG2 BTG2 belongs to the PC3/BTG/TOB family with antiproliferative properties. Rat BTG2 was first discovered as an immediate early gene activated by nerve growth factor at the onset of neuronal differentiation in the PC 12 cells (Bradbury et al., 1991). In that same year, its homolog in mouse was isolated as a tetradecanoyl phorbol acetate-induced early gene in N I H 3T3 cells (Fletcher et al., 1991). Furthermore, the human homolog was shown to be P53- and P73-inducible in response to D N A damage (Rouault et al., 1996; Zhu et al., 1998). The rat BTG2 protein shares 92.41% and 97.47% homology to the human BTG2 and mouse BTG2, respectively. The rat BTG2 gene is mapped to chromosomal region 13ql3-13q31 and has two exons separated by an intron (Figure 1.1). The total gene content consists of 3760 bp and encodes for a transcript that is 2519 bp long. The open reading frames on the two exons encode for a protein with 158 amino acids that has a half life of only 15 minutes, suggesting a highly regulated mRNA (Varnum et al., 1994). Furthermore, long 3' un-translated region contains 4 several A U U U A sequences that contribute to the high instability of the transcript (Bradbury et al., 1991; Fletcher et al., 1991). In addition, the degradation of BTG2 protein is mediated through the ubiquitin-proteasome system (Sasajima et al., 2002). There are three conserved boxes on the BTG2 protein that are important to the anti-proliferative function of BTG2 (Figure 1.1). Furthermore, the N-terminal region of the BTG2 protein consists of numerous hydrophobic residues, which may suggest for a secreted protein (Bradbury et al., 1991; Varnum, 1994). However, this phenomenon has yet to be shown. The C-terminal region of BTG2 has been suggested to control the stability of BTG2 protein (Sasajima et al., 2002). The BTG2 protein is widely expressed in normal tissues, including the kidney, lung, prostate, germinal cells, and neurons (Lim et al., 1994; Melamed et al., 2002). As for the subcellular localization of the protein, it is found predominantly either in the nucleus or cytoplasm depending on the state of the cell (cancer cell V S normal cell), developmental stage of the cell, and response to the external stress (discussed in the following chapters). 1.3 Aims of the Thesis Previous studies in our lab have shown that BTG2 m R N A is up-regulated in both in vivo microarray (retinal ischemia and M C A O model) and in vitro N M D A model. Although its function in development and cancer is well known, its functions and reasons for up-regulation following stroke remain unclear. We hypothesize that BTG2 may play a neuro-protective role following glutamate-mediated activation of N M D A R , and that this neuro-protection depends on the collaboration of various transcription factors and cis-acting elements that are found on the BTG2 promoter. In Chapter Two, we examined the functions of BTG2 by treating primary rat cortical neurons with either N M D A or oxygen glucose deprivation (OGD). Furthermore, the 5 neuro-protective effect of BTG2 was tested by either over-expressing BTG2 or knocking down BTG2 expression using R N A i . In Chapter Three, the region of BTG2 promoter responsible for the up-regulation of BTG2 following N M D A treatment was determined by placing various BTG2 promoter lengths upstream of the luciferase reporter gene. Two transcriptional elements, specifically the G A G A box and the putative P53 binding site, that may influence the BTG2 transcription were also examined. 6 Figure 1.1: The rat BTG2 gene has two exons (1-206, and 1448-3760) that are separated by one intron (207-1447). The 5' un-translated region is relatively short compare to the 3' un-translated region. The black regions are the open reading frames that make up for the 158 amino acids of the BTG2 protein. Box A , B , and C (shown in grey boxes) are conserved boxes that are important to the anti-proliferative function of BTG2. Exon 1 1448 1782" Exon 2 3 ' UTR poly- A tail 3760 N-terminal Box A Box B Box C C- terminal 50 68 96 115 118 129 158 7 1.4 Bibliography Arundine M , Tymianski M (2004) Molecular mechanisms of glutamate-dependent neurodegeneration in ischemia and traumatic brain injury. Cell Mol Life Sci 61:657-668. Bradbury A , Possenti R, Shooter E M , Tirone F (1991) Molecular cloning of PC3, a putatively secreted protein whose mRNA is induced by nerve growth factor and depolarization. Proc Natl Acad Sci U S A 88:3353-3357. Buki A , Okonkwo DO, Wang K K , Povlishock JT (2000) Cytochrome c release and caspase activation in traumatic axonal injury. J Neurosci 20:2825-2834. Burnashev N , Schoepfer R, Monyer H , Ruppersberg JP, Gunther W, Seeburg PH, Sakmann B (1992) Control by asparagines residues of calcium permeability and magnesium blockade in the N M D A receptor. Science 257:1415-1419. Choi D W (1988) Calcium-mediated neurotoxicity: relationship to specific channel types and role in ischemic damage. Trends Neurosci 11:465-467. Faden AI , Demediuk P, Panter SS, Vink R (1989) The role of excitatory amino acids and N M D A receptors in traumatic brain injury. Science 244:798-800. Fletcher BS, L im RW, Varnum B C , Kujubu D A , Koski R A , Herschmann H R (1991) Structure and expression of TIS21, a primary response gene induced by growth factors and tumor promoters. J Biol Chern 266:14511-14518. Forrest D, Yuzaki M , Soares H D , Ng L , Luk DC, Sheng M , Stewart C L , Morgan JI, Connor JA, Outran T (1994) Targeted disruption of N M D A receptor 1 gene abolishes N M D A response and results in neonatal death. Neuron 13:325-338 Graham SH, Chen J (2001) Programmed cell death in cerebral ischemia. J Cereb Blood Flow Metab 21:99-109. Heart and Stroke Foundation of Canada (March, 2007) http://ww2.heartandstroke.ca/Page.asp?PageID=33&ArticleID=1078&Src=news&From= Subcategory. Hollmann M , Heinemann S (1994) Cloned glutamate receptors. Ann Rev Neurosci 17:31-108. Hou ST, MacManus JP (2000) Molecular mechanisms of cerebral ischemia-induced neuronal death. Int Rev Cytol 221:93-148. Katchanov J, Harms C, Gertz K , Hauck L , Waeber C, Hirt L , Priller J, von Harsdorf R, Bruck W, Hortnagl H , Dirnagl U , Bhide PG, Endres M (2001) M i l d cerebral ischemia induces loss of cyclin-dependent kinase inhibitors and activation of cell cycle machinery before delayed neuronal cell death. J Neurosci 21:5045-53. Hetman M , Kharebava G (2006) Survival signaling pathways activated by N M D A receptors. Curr Top Med Chern 6:787-799. Kutsuwada T, Kashiwabuchi N , Mori H , Sakimura K , Kushiya E, Araki K Meguro H , Masaki H , Kumanishi T, Arakawa M , Mishina M (1992) Molecular diversity of the N M D A receptor channel. Nature 358:36-41 Laube B , Kuhse J, Betz H (1998) Evidence for a tetrameric structure of recombinant N M D A receptors. J Neurosci 18:2954-2961. L i L Y , Luo X , Wang X (2001) Endonuclease G is an apoptotic DNase when released from mitochondria. Nature 412:95-99. L i Y , Erzurumlu RS, Chen C, Jhaveri S, Tonegawa S (1994) Whisker-related neuronal patterns fail to develop in the trigeminal brainstem nuclei of N M D A R 1 knockout mice. Cell 76:427-437 Lim IK, K i m N K , Lee M S , Lee SH (1994) Expression of TIS-21 gene during the development of Balb/c mice and the liver regeneration. Korean J Biochem 26:169-175. 8 Lipton P (1999) Ischemic cell death in brain neurons. Physiol Rev 70:1431-1568. Liu X , K i m C N , Yang J, Jemmerson R, Wang X (1996) Induction of apoptotic program in cell-free extracts: requirement for dATP and cytochrome c. Cell 86:147-157. L iu X , L i P, Widlak P, Zou H , Luo X , Garrard WT , Wang X (1998) The 40-kDa subunit of D N A fragmentation factor induces D N A fragmentation and chromatin condensation during apoptosis. Proc Natl Acad Sci U S A 95:8461-8466. Lynch DR, Guttmann RP (2002) Excitotoxicity: Perspectives based on N-methyl-D-aspartate receptor subtypes. J Pharmacol Exp Ther 300:717-723. Mattson M P , Culmsee C, Y u ZF (2000) Apoptotic and antiapoptotic mechanisms in stroke. Cell Tissue Res 301:173-187. Melamed J, Kernizan S, Walden PD (2002) Expression of B-cell translocation gene 2 protein in normal human tissues. Tissue Cell 34:28-32 Monyer H , Sprengel R, Schoepfer R, Herb A , Higuchi M , Lomeli H , Burnashev N , Sakmann B , Seeburg P H (1992) Heteromeric N M D A receptors: molecular and functional distinction of subtypes. Science 256:1217-1221. Osuga H , Osuga S, Wang F, Fetni R, Hogan M J , Slack RS, Hakim A M , Ikeda JE, Park DS (2000) Cyclin-dependent kinases as a therapeutic target for stroke. Proc Natl Acad Sci U S A 97:10254-10259. Oxyurt E, Graham DI, Woodruff G N , McCulloch J (1988) Protective effect of the glutamate antagonist, MK-801 in focal cerebral ischemia in the cat. J Cereb Blood Flow Metab 8:138-143. Park DS, Obeidat A , Giovanni A , Greene L A (2000) Cell cycle regulators in neuronal death evoked by excitotoxic stress: implications for neurodegeneration and its treatment. Neurobiol Aging 21:771-781. Pohl D, Bittigau P, Ishimaru M J , Stadthaus D, Hubner C, Olney JW, Turski L , Ikonomidou C (1999) N-methyl-D-asparte antagonists and apoptotic cell death triggered by head trauma in developing rat brain. Proc Natl Acad Sci U S A 96:2508-2513. Rodriguez J , Lazebnik Y (1999) Caspase-9 and APAF-1 form an active holoenzyme. Genex Dev 13:3179-3184. Rouault JP, Falette N , Guehennuux F, Guillot C, Rimokh R, Wang Q, Berthet C, Moyret -Lal le C, Savatier P, Pain B , Shaw P, Berger R, Samarut J, Magaud JP, Ozturk M , Samarut C, Puisieux A (1996) Idnetification of BTG2, an antiproliferative p53-dependent component of the D N A damage cellular response pathway. Nat Genet 14:482-486. Sakhi S, Bruce A , Sun N , Tocco G, Baudry M , Schreiber SS (1997) Induction of tumor suppressor p53 and D N A fragmentation in organotypic hippocampal cultures following excitotoxin treatment. Exp Neurol 145:81-88. Sasajima H , Nakagawa K , Yokosawa H (2002) Antiproliferative proteins of the BTG2/Tob family are degraded by the ubiquitin-proteasome system. Eur J Biochem 269:3596-3604 Sattler R, Charlton M P , Hafner M , Tymianski M (1998) Distinct influx pathways, not calcium load, determine neuronal vulnerability to calcium neurotoxicity. J Neurochem 71:2349-2364. Scannevin R H , Huganir R L (2000) Postsynaptic organization and regulation of excitatory synapses. Nat Rev Neurosci 1:133-141. Schinder A F , Olson EC, Spitzer N C , Montal M (1996) Mitochondrial dysfunction is a primary event in glutamate neurotoxicity. J Neurosci 16:6125-6133. Schneggenburger R, Ascher P (1997) Coupling of permeation and gating in an NMDA-channel pore mutant. Neuron 18:167-177. 9 Sheng M , Pak DT (2000) Ligand-gated ion channel interactions with cytoskeletal and signaling proteins. Annu Rev Physiol 62: 755-778. Simon RP, Swan JH, Meldrum BS (1984) Blockade of N-methyl-D-aspartate receptors may protect against ischemic damage in the brain. Science 226:850-852. Tenneti L , Lipton SA (2000) Involvement of activated caspase-3-like proteases in N-methyl-D-aspartate-induced apoptosis in cerebrocortical neurons. J Neurochem 74:134-142. Timsit S, Rivera S, Ouaghi P, Guischard F, Tremblay E, Ben-Ari Y , Khrestchatisky M (1999) Increased cyclin DI in vulnerable neurons in the hippocampus after ischaemia and epilepsy: a modulator of in vivo programmed cell death? Eur J Neurosci 11:263-278. Tymianski M , Charlton M P , Carlen PL, Tator C H (1993) Source specificity of early calcium neurotoxicity in cultured embryonic spinal neurons. J Neurosci 13:2085-2104. Varnum B C , Reddy ST, Koski R A , Herschman H R (1994) Synthesis, degradation, and subcellular localization of proteins encoded by the primary response genes TIS7/PC4 and TIS21/PC3. J Cell Physiol 158:205-213. Verhage M , Maia A S , Plomp JJ, Brussaard A B , Heeroma JH, Vermeer H , Toonen RF, Hammer R E , vanden Berg T K , Missler M , Geuze HJ, Sudhof TC (2000) Synaptic assembly of the brain in the absence of neurotransmitter secretion. Science 287:864-869. Wang F, Corbett D, Osuga H , Osuga S, Ikeda JE, Slack RS, Hogan M J , Hakim A M , Park DS (2002) Inhibition of cyclin-dependent kinases improves CA1 neuronal survival and behavioral performance after global ischemia in the rat. J Cereb Blood Flow Metab 22:171-182. Wang H , Y u SW, Koh DW, Lew J, Coombs C, Bowers W, Federoff HJ, Poirier G G , Dawson T M , Dawson V L (2004) Apoptosis-inducing factor substitutes for caspase executioners in NMDA-triggered excitotoxic neuronal death. J Neurosci 24:10963-10973. Wang J, L iu S, Fu Y , Wang JH, L u Y (2003) Cdk5 activation induces hippocampal CA1 cell death by directly phosphorylating N M D A receptors. Nat Neurosci 6:1039-1047. Wang X (2001) The expanding role of mitochondria in apoptosis. Genes Dev 15:2922-2933. Y u SW, Wang H , Dawson T M , Dawson V L (2003) Poly(ADP-ribose) polymerase-1 and apoptosis inducing factor in neurotoxicity. Neurobiol Dis 14:303-317. Yuzaki M , Forrest D, Verselis L M , Sun SC, Curran T, Connor JA (1996) Functional N M D A receptors are transiently active and support the survival of Purkinje cells in culture. J Neurosci 16:4651-4661 Zhang SJ, Steijaert M N , Lau D, Schutz G, Vivier C D , Descombes P, Bading H (2007) Decoding N M D A receptor signaling: identification of genomic programs specifying neuronal survival and death. Neuron 53:549-562. Zhu J, Jiang J, Zhou W, Chen X (1998) The potential tumor suppressor p73 differentially regulates cellular p53 target genes. Cancer Res 58:5061-5065. 10 2 NEURO-PROTECTIVE EFFECT OF B T G 2 2.1 INTRODUCTION 2.1.1 Functions of BTG2 Compare to other immediate early genes, such as c-fos and c-jun, the role of BTG2 is not yet well understood. Several studies have described BTG2 as a transcriptional co-regulator that modulates the activities of its interacting proteins. It is able to bind to murine carbon catabolite repressor protein CCR4-associated factor 1 (mCAF-1) through Box B domain of BTG2, and possibly regulates cell cycle through their interactions with the cyclin dependent kinases and the CCR4 protein, a component of the general transcription multi-subunit complex (Ikematsu et al., 1999; Rouault et al., 1998; Prevot et al., 2001). Furthermore, it serves as a co-activator of ERa-mediated transcription with CCR4 and human CAF-1 (Morel et al., 2003). Since BTG2 has been shown to interact with CAF-1 and that CAF-1 in yeast interacts with RAD52, a protein that is involved in D N A repair by binding to double stranded D N A breakage and directs end-to-end assembly, it is possible that BTG2 plays a role in D N A repair (Schild et al., 1995). Another important protein that BTG2 binds to and mediate the growth arrest of the cell through protein methylation is the protein-arginine methyltransferase 1 (PRMT-1) (Lin et al., 1996). The PRMT-1 protein, which interacts with the Box C domain of BTG2 protein, is able to modulate the activities of several proteins including the R N A processing proteins and histones (Cortes et al., 2000; Lin et al., 1996; Passed et al., 2006). Perhaps one of the most studied roles of BTG2 is its role in neurogenesis in the neuroepithelial cells (Calegari et al., 2002, 2005; Canzoniere et al., 2004, Corrente et al, 11 2002; Iacopetti et al., 1999; Kosodo et al., 2004, Haubensak et al., 2004). Evidences supporting this hypothesis came from studies showing that over-expression of BTG2 in PC 12 or N I H 3T3 cells inhibited cell divisions, promoted neurite outgrowth, and protected the terminal differentiated neurons from apoptosis following nerve growth factor withdrawal (Corrente et al., 2002; el-Ghissassi et al., 2002; Malatesta et al., 2000; for review, see Tirone 2001). In addition, the presence of N G F , FGF, and IL-6 in PC 12 cells induced BTG2 expression and neuronal differentiation (Bradbury et al., 1991; Fletcher et al., 1991; Montagnoli et al., 1996). Interestingly, BTG2 was also induced by cellular depolarization, suggesting for a role in activity-dependent survival of neurons (Bradbury et al., 1991; Jung et al., 1996). Finally, BTG2 was able to insert its anti-proliferative property by interacting with H O X B 9 , a member that belonged to the Hox family of homeodomain-containing transcription factors involved in regulating cell fates during development, and enhanced HOXB9-dependent transcription (Gehring et al., 1994; Prevot et al., 2000). Another function of BTG2, which is not well studied, is its role in development. BTG2 was shown to regulate vertebrate patterning in vivo through the bone morphogenetic protein signaling pathway by interacting with both Smadl and Smad8 (Park et al., 2004). Another in vivo study in Xenopus showed an involvement of BTG2 in notochord development (Sugimoto et al., 2005). Finally, BTG2 played a key role in mesoderm development in Zebrafish (Sakaguchi et al., 2001). Several studies have reported a loss of BTG2 expression early at the tumorigenic process, and that restoring its expression in cancerous cells led to cell death, which suggests for a role as a tumor suppressor. Thymic carcinoma tissues, renal cell carcinoma, and prostate carcinoma have all been found to have a reduced BTG2 expression (Ficazzola et al., 2001; L i m et al., 1995; Struckmann et al., 2004). The subcellular location of BTG2 depends on the status of the cells where it predominantly presides in the nucleus of normal 12 cells and mostly in the cytoplasm of cancerous cells (Kawakubo et al., 2006). One mechanism in which BTG2 induces cell death in cancerous cells is believed to be the interaction between BTG2 and Pin-1 (Hong et al., 2005). BTG2 is able to induce cell death through mitochondrial depolarization and inhibition of CyclinBl/Cdc2 complex activities both in vitro and in vivo by interacting with Pin-1 in cytoplasm following phosphorylation of Serl47 on BTG2 protein by Erkl /2 in human cancer cell (Hong et al., 2005). Another mechanism in which BTG2 acts as a tumor suppressor is by regulating the cell cycle progression at both G l / S and G 2 / M phases (for review, see Lim, 2006). BTG2 is able to inhibit G l / S progression both through pRB dependent and independent pathways. Over-expression of BTG2 in 293T cells, where both P53 and pRB were inactive due to infection by adenovirus type 5, led to an inhibition of G l / S progression by delaying the CyclinE protein synthesis and inhibiting the Cycl inDl associated C D K 4 activity (Lim et al., 1998; Graham et al., 1977; Moran, 1993). On the other hand, over-expression of BTG2 in N I H 3T3 cells with active pRB also inhibited the cell cycle progression at the G l / S step by either directly or indirectly repressing Cycl inDl expression (Guardavaccaro et al., 2000). This repression of Cycl inDl was dependent on all Box A , B, and C domains of BTG2 (Kawakubo et al., 2006). When U937 cells, a human cancer cell devoid of active P53 activity, were stimulated with tetradecanoyl phorbol-acetate (TPA), BTG2 was found to be induced and prevented cell cycle progression at the G 2 / M phase (Ryu et al., 2004). Furthermore, this inhibition at the G 2 / M phase was due to an inhibition of Cycl inBl binding to Cdc2 thereby inhibiting CyclinB 1 associated kinase activity. Taken together, BTG2 appears to play a role in: (1) transcriptional co-regulation; (2) neuronal differentiation; (3) promoting survival in terminally differentiated neurons; (4) development; (5) cell cycle; and (6) preventing tumor progression. 13 2.1.2 Aims of the Chapter Previous studies in our lab have shown that BTG2 m R N A is up-regulated in both in vivo microarray (retinal ischemia and M C A O model) and in vitro N M D A model. Although its function in development and cancer is well known, its functions and reasons for up-regulation following stroke remain unclear. Furthermore, the mechanism in which BTG2 promotes survival in terminally differentiated neurons remains to be studied. The present study is to exam the functions of BTG2 gene in rat cortical neurons following N M D A and oxygen glucose deprivation, by either over-expressing or reducing BTG2 expression using s iRNA. This is to test the hypothesis that BTG2 may play a neuro-protective role following NMDAR-mediated excitotoxicity. 14 2.2 METHODS 2.2.1 Rat Primary Cortical Neuronal Culture Rat primary cortical neuronal culture was prepared from 18-day-old Wistar rat embryos in cold sterile dissection buffer containing Hanks Balanced Solutions (Gibco-BRL, Grand Island, NY) and lOmM HEPES (Sigma, Saint Louis, MO), pH 7.4 and osmolarity 310-320 mOsm. Cortices were trypsinized (Gibco-BRL, Grand Island, NY) at 37°C for 20-3 Omin, followed by two washes with DMEM (Gibco-BRL, Grand Island, NY) containing 10% fetal bovine serum (Gibco-BRL, Grand Island, NY) and 1% antibiotics (Gibco-BRL, Grand Island, NY). To dissociate the tissues into individual cells, cortical tissues were triturated using a lOmL pipet. The cells were collected by centrifuging at 800rpm for 45sec, and resuspended in Neuralbasal plating medium containing the following: Neuralbasal (Gibco-BRL, Grand Island, NY), 2% B-27 supplement with AO (GIBCO BRL, Grand Island, NY), 0.5mM L-glutamine (Sigma, Saint Louis, MO), 25uM glutamic acid (Sigma, Saint Louis, MO), and 1% antibiotics (Gibco-BRL, Grand Island, NY). Cells were counted and plated onto poly-D-lysine (Sigma, Saint Louis, MO) coated tissue culture plates at a density of approximately 1.5X105 cells for 24-well plates, and 9X105 cells for 6-well plates. Total medium was changed 48hr after plating into maintenance medium consisting of Neuralbasal medium, 2% B-27 supplement with AO, 0.5mM L-glutamine, and 1% antibiotics. A half volume of medium was replaced with a fresh maintenance medium every 3-4 days thereafter. According to the Gibco company and by others, the maintenance medium used for the neuronal culture would reduce the glial cell growth to less than 0.5-2%, thus providing a nearly pure neuronal population (Brewer, 1997; Brewer et al., 1993; Svendsen et al., 1995; 15 Xie et al., 2000). Only mature cortical neurons (12-13 days old) were used for all experiments. For both over-expression and knock down experiments, lentivirus was used as a delivery system. Neurons were infected with lentivirus expressing either transgene or s iRNA at day 8-9 with approximately IX10 6 virus particles for neurons in 6-well plates and 2X10 5 virus particles for 24-well plates (MOI=l). 2.2.2 Excitotoxicity Treatments with NMDA and Oxygen Glucose Deprivation (OGD) To induce N M D A excitotoxicity, 20uM Glycine ± various concentrations of N M D A were added to the maintenance medium. 5uM of MK-801, a N M D A R open channel blocker, was added along with N M D A to prevent N M D A R activation in certain experiments. For real time-PCR experiments, medium was aspirated and l m L of Trizol (Invitrogen, Cat #15596-026) was added to extract total R N A . To analyze protein expression or cell death assays, cells were allowed to recover in maintenance medium. The oxygen-glucose deprivation (OGD) experiments were performed using protocols from Dr. Wang Y T lab (Yitao et al., 2006). Cells were first placed in a specialized chamber (Thermo EC) containing an anaerobic gas mixture (85% N 2 , 10% H 2 , and 5% C O 2 ) where the oxygen content was <0.01% at 37°C. Cell medium was then washed and replaced with deoxygenated, glucose-free extracellular solution containing (in mM): 140 NaCl , 5.4 KC1, 1.3 CaCl 2 , 2.0 M g C l 2 , and 25 HEPES, with pH 7.35 and osmolarity of 310-320. For O G D control wells, cell medium was replaced with the oxygenated ECS containing glucose, and were kept at normal incubator with 95% O2 and 5% C O 2 at 37°C. After various time, cells were removed from the OGD chamber, washed with warm ECS and replaced with maintenance medium. L D H assay was measured 24hr following treatment. 2.2.3 Assessment of Neuronal Death using Lactate Dehydrogenase (LDH) Assay and Terminal Transferase dUTP Nick End Labeling (TUNEL) For L D H assays, 50uL of supernatant was collected from each well 24hr following excitotoxicity ( N M D A or OGD) treatment and placed into 96-well plates. To obtain 100% cell death, medium in the wells containing untreated cells was aspirated and replaced with 0.3% Triton in PBS to lyse the cells in the entire well. 50uL of supernatant of lysed cells was also put into the 96-well plate. 150uL of pre-warmed master mix, containing 20mL PBS, 4.36nM sodium pyruvate, and 0.45nM N A D H , was added to each well and the decrease of N A D H was measured by a spectrophotometer at 340nm for lOsec/cycle for 60 cycles. The slope of each reaction was calculated and divided by the slope of the wells lysed by Triton (assumed 100% cell death) to obtain % cell death. For all L D H experiments, all treatments were duplicated each time, and were performed independently for at least three times. T U N E L was used to determine cell death by detecting D N A fragmentation 24hr following N M D A excitotoxicity treatment (Roche In Situ cell death detection kit T M R R E D Cat #12156792910). Cells were washed with cold PBS and fixed with cold methanol at -20°C for lOmin. They were then washed with cold PBS and DAPI was used to stain and visualize the nucleus. T U N E L staining was performed according manufacturer's protocols. 2.2.4 Immunocytochemistry Four to five days following infection of rat cortical neuron culture with a lentiviral vector expression BTG2-GFP fusion protein, cells were washed with warm PBS and fixed with warm 4% Paraformaldehyde containing 2% sucrose in PBS for 15min at room temperature. They were then washed with PBS for 3 times and permeabilized with 0.1% Triton in PBS for 2min at room temperature. Fixed cells were again washed with PBS for 17 3 times, blocked with 10% Bovine serum albumin for lhr at room temperature, and incubated with polyclonal rabbit M A P 2 (Cell Signaling; Cat #4542) at 1:1000 dilution in PBS overnight at 4°C. Alexa Fluor 568 goat anti-rabbit IgG (Invitrogen; Cat # A - l 1036) at 1:1000 dilution in PBS was then used to visualize the neurons. DAPI was used to stain the nucleus. To visualize cellular localization of BTG2-GFP fusion protein, Olympus Fluoview FV1000 Confocal microscope was used. 2.2.5 Quantitative RT-PCR (qRT-PCR) for Measurement of mRNA Following excitotoxicity treatment, neurons in 6-well plates were homogenized in l m L Trizol reagent at room temperature for 5min and transferred to 1.5mL tubes. 0.2mL of chloroform per mL of Trizol was added to each tube and the tubes were hand-shaked for 15 sec. The aqueous phase (top phase) containing R N A was obtained by centrifuging the samples at 13krpm for 15min at room temperature. 0.5mL of isopropanol alcohol per mL of Trizol was then added to each tube containing the aqueous phase. Tubes were shaked gently by hand and incubated at room temperature for lOmin. R N A pellets were obtained by centrifuging at 13krpm for lOmin at 4°C. Supernatant was removed and pellet washed with 75%o ethanol in DEPC-treated water. Samples were then mixed by vortexing followed by centrifuging at 7500rpm for 5min at 4°C. Finally, R N A pellet was air dried and dissolved in RNase free water by incubating samples at 55-60°C for lOmin. R N A samples were stored at -80°C. Possible contaminated D N A in the R N A samples were removed by treating with DNase I (Invitrogen, Cat #18068-015) at room temperature for 15min, followed by the inactivation of DNase I with 2.5mM E D T A at 65°C for lOmin. One microgram of the DNA-free R N A R N A was used to synthesize first-strand c D N A using a Superscript II RT kit (Invitrogen, 18 Cat #11904-018) according to the manufacturer's protocol. c D N A samples were stored at -80°C. For real-time PCR analysis, c D N A samples were diluted and 2uL of each dilution was added to 96-well real-time PCR plates along with 23uL of master mix containing 12.5uL S Y B R Green ( A B M , Richmond, BC) , 0.75uL of lOuM mixed primers, and 9.75ul DEPC-treated water. The plates were then read by A B I 7000 Real Time PCR machine. For a list of real time PCR primers, see Table 2.1. 2.2.6 Western Immunoblotting Following treatments and recoveries, cells were washed with cold PBS and samples were collected by lysing the cells with I X sample buffer directly on ice. The 2X sample buffer contains the following: 62.5mM Tris-HCl, pH 6.8, 25% Glycerol, 2% SDS, 0.01% Bromophenol blue, and 5% (or 710mM) P-mercaptoethanol. Protein concentrations were measured using a modified Bio-Rad DC Protein assay protocol using Thiols. 20ug of protein for each sample was analyzed with 12% SDS-polyacrylamide resolving gels and 5% stacking gels using Bio-Rad Gel electrophoresis system (Bio-Rad, Hercules, C A ) . Bio-Rad Wet Transfer system (Bio-Rad, Hercules, C A ) was then used to the transfer the protein from the gel onto Nitrocellulas membrane (Bio-Rad, Hercules, C A ) . Membrane was blocked with 5% milk, and probed with diluted primary Antibodies overnight at 4°C. The primary antibodies used include: rabbit polyclonal Actin antibody (Sigma, Saint Louis, M O ; 1:1000); goat polyclonal BTG2 (Santa Cruz, Cat #sc-30342; 1:1000); rabbit monoclonal Caspase 3 (Cell Signaling, Cat #9665; 1:1000); and mouse monoclonal c-Myc (Santa Cruz, Cat #sc-40: 1000). Membrane was washed with TBST and incubated with HRP-conjugated secondary antibody at 1:2000 dilution for one hour at room temperature. The HRP-secondary antibody used include: goat anti-mouse (PerkinElmer Cat # NEF822); goat anti-rabbit 19 (PerkinElmer Cat # NEF812); donkey anti-goat (Sigma, Saint Louis, MO) . Membrane was then washed again with TBST and visualized with equal volume of Western lightning chemiluminescence reagent and oxidizing reagent (PerkinElmer, Cat #NEL104) using Bio-Rad Fluor-S Multilmager. Fermentas Pagerulers Prestained Protein Ladder (Cat #SM0671) was used to estimate the protein molecular sizes. To normalize western membranes, Image J was used to normalize the average intensity of each protein band against the actin band. 2.2.7 Generation of Rat BTG2 siRNA in pLentiLox3.7 Vector To construct both rat BTG2 siRNA, as well as their scrambled controls, synthetic D N A sequences were made and shown in Table 2.2 in 5' to 3' order. The forward and reverse strands of each s iRNA were dissolved in TE buffer to a final concentration of lOOuM, and were annealed using PCR machine with the following parameters: 95°C for 30sec, 72°C for 2min, 37°C for 2min, and 25°C for 2min. The annealed s iRNA were cloned into the B g l l l and Hindl l l sites of the pSUPER R N A i vector (a gift from Dr. Alaa El-Husseini Lab). The Xbal and Xho l were then used to excise the HI - s iRNA from the pSUPER vector into the pLentiLox3.7 vector (a gift from Dr. Alaa El-Husseini Lab) replacing the U6 R N A i promoter. A n example of the oligo following annealing is shown in Figure 2.1. 2.2.8 Generation of BTG2-cMyc and BTG2-GFP Fusion Proteins BTG2-cMyc was generated by tagging the BTG2 c D N A with a c-Myc tag at the 3' end and cloned into the viral F U W vector at BamHI and EcoRI sites. BTG2-GFP was cloned into the F U W vector in the following order: B g l l l - A T G - BTG2 - Kpnl - GFP - T A G termination codon. For all PCR condition, the following PCR parameters were used: 1 cycle of 94°C for 3min; 35 cycles of amplification steps with 94°C for 45sec, 60°C for 60sec, 20 and 72°C for 60sec; and 1 cycle of 72°C for lOmin. Both fusion proteins were confirmed by restriction enzymes analysis and sequencing. Primers and methods used to clone the fusion proteins are shown in Table 2.3. 2.2.9 Construction of Second Generation Lentivirus (pLentiLox3.7 and FUGW) 293T cells were split the day before transfection (90-95% confluency the day of transfection) in 10mm plates. On the day of transfection, cells were transfected with D N A vector (lOug), Delta 8.9 packaging vector (7.5ug), and envelope V S V G vector (5ug) using either Calcium/Phosphate (Sigma) or PEI transfection protocol according to the manufacturer's protocol. Medium was changed 16-20hr after transfection, and supernatant was obtained at 48 and 72 hr. To concentrate the virus, cellular debris was first removed by centrifuging at 3krpm for 15min, followed by ultra-centrifuging at 25-30krpm for 2hr at 4°C. The virus pellet was dissolved in neuron maintenance medium, aliquoted, and stored at -80°. To titer the virus concentration, a series of dilutions of virus were made and 293T cells were infected. Green cells were counted 48-72hr after infection and the numbers of virus particles were calculated. 2.2.10 Statistical Analysis A l l data were expressed as Mean +/- S E M , and the Student's t test was used to examine the statistical significance of the differences between groups of data. Data were considered significant when p < 0.05. * indicates p < 0.05, while ** indicates p < 0.01. For all experiments^ data was obtained independently for at least 3 times. 21 2.3 RESULTS 2.3.1 Expression and Subcellular Localization of BTG2 Following NMDA Previous data from members in our lab showed an up-regulation of BTG2 mRNA expression following retinal ischemia, M C A O ischemia, and primary cortical neuronal cultures treated with N M D A (Figure 2.2, 2.3, and 2.4). However, the function of this up-regulation was not investigated. BTG2 m R N A expression was analyzed at a lower N M D A concentration where 20uM Glycine ± 10 or lOOuM N M D A were added to the neuron medium directly. The total R N A of each treatment was collected after 2hr of N M D A treatment and analyzed by real-time PCR (Figure 2.5). BTG2 m R N A levels were up-regulated at 2hr following the treatment with either lOuM or lOOuM N M D A . Next, BTG2 protein expression levels were studied. 20uM Glycine ± lOuM N M D A were added directly into the neuron medium for lhr, followed by a recovery of 3hr, 6hr, or 9hr in NMDA-free medium (Figure 2.6). BTG2 protein level was up-regulated at 6hr and 9hr following N M D A treatment, but not at 3hr. The highest level of BTG2 protein was seen at 6hr following lhr of N M D A treatment. Since BTG2 has been found both in the nucleus and cytoplasm, we investigated subcellular localization of BTG2 following N M D A . Cortical neurons were infected with lentiviral vector expressing BTG2-GFP fusion protein, and treated with 20uM Glycine ± lOuM N M D A for lhr followed by various hours of recovery (Ohr, lhr, 2.5hr, 4hr, 6hr, 8hr, and 9hr ). Cells were fixed and BTG2-GFP was visualized with a confocal microscope (Figure 2.7). BTG2 was found to localize to both the cytoplasm and nucleus, with little or no expression in the neurites. This distribution of BTG2 was not changed following N M D A and various hours of recoveries. For neurons infected with lentiviral vector 22 expressing only GFP, the GFP was seen not only in both the cytoplasm and the nucleus, but also in the neurites as well. 2.3.2 Role of BTG2 in Rat Cortical Neurons Following NMDA and OGD Insults To investigate whether BTG2 has any neuro-protective function following cellular stresses, BTG2 expression levels were either over-expressed or knocked down using R N A i . Neurons were infected with lentiviral vectors expressing either BTG2-cMyc fusion gene driven by an Ubiquitin promoter or BTG2 siRNAs driven by a HI R N A i promoter. The efficiencies of these vectors were tested. When neurons infected with the lentivirus vector carrying BTG2-cMyc fusion gene, both the BTG2 m R N A (increased by 434.1 ±5.6 fold changes) and the protein levels were all dramatically increased in infected neurons (Figure 2.8). Compared to the simple over-expression techniques, selecting a BTG2 s iRNA and s iRNA control were difficult and several sequences had to be tested in order to select for the best ones. The efficiency of the BTG2 s iRNA caused inhibition on BTG2 mRNA and protein expression were determined (Figure 2.9 and 2.10). Although BTG2 siRNA was able to reduce the BTG2 m R N A level by 70-80%, only 20-30% of protein was reduced. To investigate the role of BTG2 in neuro-protection following either N M D A or OGD, several cell death measures were employed, including the Caspase 3 activation, L D H assay, and T U N E L . Cortical neurons were treated with 20uM Glycine ± lOuM N M D A for lhr and the protein samples were then collected 20-24hr following N M D A treatment. Effects of over-expression or reduced BTG2 expression on neuronal apoptosis following the insults were determined by analyzing the levels of active Caspase 3 (Figure 2.11). Reduction of BTG2 expression by BTG2 s iRNA had no effect, whereas over-expression of BTG2 significantly reduced Caspase 3 activation. 23 Next, L D H assays were performed to determine the effect of either reducing or over-expressing BTG2 on cell death following treatment with various concentrations of N M D A . The effect of N M D A on cell death was first tested (Figure 2.12). Cells were treated with various concentrations of N M D A for either 30min or 60min followed by a 24hr recovery. lOuM of N M D A was able to ki l l -20% neurons while 20uM of N M D A was able to ki l l -30-35%) of neurons. 50uM, lOOuM and ImM all gave an approximately same %> of cell deaths of-40-50%. 5uM of MK-801 was able to abolish the effect of N M D A induced cell death even at I m M of N M D A . BTG2 expression was then reduced with BTG2 s iRNA and the neurons were treated with Glycine ± 20uM or 50uM N M D A for lhr, followed by 24hr of recovery (Figure 2.13). Compared to both viral infection control and the BTG2 s iRNA scrambled controls, reducing BTG2 expression with BTG2 s iRNA had no effect on NMDA-induced excitotoxicity cell death. Again, no significant difference in cell death was observed when T U N E L was used to determine the % of cell death in neurons treated with lOuM N M D A for lhr followed by 24hr of recovery, suggesting that reduction of BTG2 expression had no effect on NMDA-induced D N A fragmentation, or apoptosis (Figure 2.14). Although T U N E L was only done once, it supported the results obtained when L D H assay was used to measure cell death. However, when cells were over-expressed with a viral vector expressing BTG2-cMyc and treated with Glycine ± lOuM or lOOuM N M D A for lhr followed by 24hr of recovery, cell death, as measured by L D H , was significantly reduced (Figure 2.15). Finally, cells were undergone OGD treatment, and the effect of reducing BTG2 expression was determined. The effect of O G D treatment on cells was first determined and % of cell death was measured by the L D H assay (Figure 2.16). 30min of OGD treatment did not showe a significant cell death, while 60min, 90min, 120min and 150min O G D treatments all led to similar, but significant, amount of cell death of 20-25%. It is important 24 to note that the low amount of cell death even after 150min of treatment may suggest for a leaky anoxia chamber. Next, the effect of reducing BTG2 expression with BTG2 s iRNA on OGD-induced cell death was determined (Figure 2.17). It appeared that replacing the maintenance medium with extracellular solution containing glucose was enough to induce cell death in neurons infected with a lentiviral vector. Again, BTG2 siRNA did not increase the cell death following O G D treatment when compared to either empty viral vector or BTG2 s iRNA scrambled control 1-3. Taken together, over-expressing BTG2 appeared to protect neurons from NMDA-induced excitotoxicity as shown by the reduction in Caspase 3 activation and the L D H cell death assay. However, at our current level of knock down with the BTG2 siRNA, we did not see any increased cell death after both N M D A and O G D treatments. 2.3.3 Role of BTG2 in Controlling CyclinDl Expression Following NMDA Cortical neurons, infected with either BTG2 s iRNA or BTG2 over-expression vector, were treated with 20uM Glycine ± lOuM N M D A for 2hr, and the changes in Cycl inDl m R N A expression were analyzed by real-time PCR (Figure 2.18). When BTG2 was over-expressed, basal Cycl inDl mRNA level was significantly reduced by -30% (CyclinDl m R N A level was 0.69±0.015 in BTG2 over-expressed.cells compared to neurons infected with control viral vector FUGW). Reducing BTG2 expression did not change basal Cycl inDl mRNA level. However, Cycl inDl mRNA level was significantly increased in cells with reduced BTG2 expression following N M D A treatment. This increase was not seen in virus empty vector control or BTG2 scrambled control, and was abolished with 5uM MK-801. Taken together, these results suggested that the increase in Cycl inDl transcription was NMDA-dependent and that endogenous BTG2 suppressed the upregulation of Cycl inDl transcription stimulated by N M D A . 25 2.4 DISCUSSIONS The present study showed that BTG2 mRNA was up-regulated in rat cortical neuron culture as early as 30min following N M D A treatment, with the highest protein expression 6hr following the N M D A treatment. Furthermore, BTG2 was localized to both cytoplasm and nucleus with or without N M D A treatment, as shown by the BTG2-GFP fusion protein. Our results showed that BTG2, when over-expressed, appeared to protect rat cortical neurons from NMDA-induced excitotoxicity cell death with reduced levels of active Caspase 3. However, at our current level of BTG2 protein knock down using lentiviral mediated s iRNA, we did not see any increased cell death following N M D A and O G D treatments as measured by L D H , T U N E L , and there was no further activation of Caspase 3. Interestingly, Cycl inDl mRNA was increased following N M D A treatment when BTG2 was knocked down, suggesting that BTG2 functions as a regulator to inhibit NMDA-induced Cycl inDl transcription. This negative regulation by BTG2 on Cycl inDl transcription was supported by the results of BTG2 over-expression as in that case, levels of Cycl inDl mRNA was significantly reduced. However, the level of Cycl inDl in cells at resting status was not affected by knocking down BTG2 expression by s iRNA at our current level. Several studies have reported an up-regulation of cell cycle proteins following excitotoxicity leading to neuronal cell death (Katchanov et al., 2001; Osuga et al., 2000; Park et al., 2000; Timsit et al., 1999; Wang et al., 2002, 2003). In particular, it was shown that inhibition of the cell cycle regulator, Cdk4, and its activator, Cyc l inDl , played critical roles in the delayed death component of ischemic/hypoxic stress by regulating the tumor suppressor retinoblastoma protein (Rashidian et al., 2005). Our finding that endogenous BTG2 is capable of inhibiting Cycl inDl up-regulation by N M D A suggests for a potential neuro-protective effect of BTG2 during ischemia. Although over-expressing BTG2 reduced apoptosis in neurons after N M D A treatment, no effect was seen in neuronal cultures 26 infected with a virus expressing BTG2 siRNA. One possible explanation is that the s iRNA used in the present study was not efficient enough to reduce the protein level of BTG2 to abolish the function of the gene. Another interesting possibility is that perhaps BTG2 only delayed the onset of apoptosis and that the 24 hours recovery used in our study was too long to show this effect. A n easy way to test this hypothesis would be to measure the cell death at an earlier time point instead of 24hr following treatment. The use of knock-out BTG2 mice would definitely help to uncover several of the signaling pathways that BTG2 is involved in. However, due to resources and facility restraint, it was not feasible to use the knock out mice in the present study. Although we did not see any effects on N M D A induced cell death in BTG2-s iRNA expressing neurons, over-expressing BTG2 resulted in significant increased cell survival in N M D A treated cultures. BTG2 has been observed to interact with several proteins responsible for transcriptional activation and D N A repair. Therefore, it is also likely that over-expressing BTG2 activates D N A repair proteins and together with other transcriptional factors, activated key genes for neuronal survival. To test this hypothesis, immunoprecipitation can be performed to determine whether BTG2 interacts with any proteins following N M D A treatment. As previously mentioned before, BTG2 has been reported to act as a transcriptional co-regulator through interactions with mCAF-1 and PRMT-1 (Ikematsu et al., 1999; Lin et al., 1996; Rouault et al., 1998; Prevot et al., 2001). A recent paper by Zhang et al., (2007) showed that, when over-expressing BTG2, BTG2 acted as a pro-survival gene in the mouse hippocampal neurons by reducing staurosporine-induced Caspase 3 activation, and growth factor withdrawal-induced cell death. However, it is interesting to note that their BTG2 s iRNA also did not significantly knock down basal BTG2 expression and that there was no significant change in cell death in BTG2-s iRNA expressing hippocampal neurons following staurosporine treatment. Their 27 results further suggested that the activation of nuclear calcium signaling pathway through activation of synaptic, but not the extrasynaptic, N M D A R induced BTG2 expression. It is interesting to note that in their case, BTG2 was N O T induced following glutamate treatment in mouse hippocampal neurons, whereas our experiments showed that BTG2 was up-regulated following N M D A treatment in rat cortical neurons. Perhaps there is a difference in the distribution of different subtypes-containing N M D A R between mouse hippocampal cells and rat cortical neurons, or it is possible that the regulation of BTG2 is different between mouse and rat. To support for this hypothesis, only the rat BTG2 promoter, but not the mouse or human promoter, has a G A G A box that may be responsible for its regulation (see chapter three). Several studies have suggested BTG2 to be an immediate early gene in response to cellular stresses. However, those studies were based on the transcriptional level of BTG2. Indeed, BTG2 mRNA, but not protein, was shown to be up-regulated in culture of rat cortical neurons as early as 30min following N M D A treatment. The BTG2 protein was only shown to be up-regulated 6hr following treatment at earliest, suggesting that a highly regulated post-transcriptional process exists. It is also possible that the NMDA-induced excitotoxicity led to a global reduction in protein synthesis, and the BTG2 protein didn't get made until the cells restored its homeostasis. Using BTG2-GFP fusion protein, we showed that BTG2 is localized in both the cytoplasm and the nucleus, which further supports the idea that BTG2 not only acts as a transcriptional factor, but also functions in the cytoplasm. It is possible that the BTG2-GFP fusion protein driven by ubiquitin maybe expressed at a very high level thus saturated the transport system between the nucleus and the cytoplasm. If this is the case, then we wouldn't be able to see any changes following N M D A treatment. Therefore, replacing the strong Ubiquitin promoter with a less strong promoter, such as the endogenous BTG2 promoter, may solve this problem. Currently, the signaling pathways associated with each subunit of N M D A R that activate BTG2 expression following excitotoxicity in neurons are not well known. To complicate the matter further, the signaling pathways that each of the N M D A R subtypes activates remains unclear. N M D A R activates several calcium dependent pathways, such as the M A P kinase and the C a M kinase pathways, that modulate the activities of several transcriptional factors in the nucleus (Bading and Greenberg, 1991; Bading et a l , 1993; Bading, 2000, West et al., 2001). A microarray study showed that activation of synaptic and extrasynaptic N M D A R led to differential genomic responses, which was dependent on nuclear calcium signaling (Zhang et al., 2007). Furthermore, BTG2 R N A was induced following calcium entry through synaptic N M D A R , and was involved in glutamate-mediated neuronal survival (Zhang et al., 2007). The emergence of N M D A R blockers may prove useful to the study of signaling pathways activated by each of the N M D A R subtypes. Previous data from our lab showed that NMDA-induced BTG2 mRNA was found to be partially abolished following treatment with ifenprodil, suggesting that NR2B subunit of N M D A R was responsible for the induction of BTG2 following N M D A (data not shown). However, a very high concentration of N M D A was used (lOOuM) and it is unclear whether this induction of BTG2 through NR2B subunit is N M D A concentration dependent or N M D A R subunit dependent. It is interesting to note that the up-regulation of BTG2 is neuron-specific as previous microarray data from our lab suggested that the glutamate treatment in astrocytes did not show the up-regulation of BTG2 (data not shown). As others have suggested, viral vectors based R N A i may induce toxicity that needs to be addressed (Lewis et al., 2005; L im et al., 2005; for review, see Cullen, 2006; Marques and 29 Williams, 2005; Snove Jr and Rossi, 2006; Thomas et al., 2003). Although the viral vector mediated s iRNA in our hands did not show any toxicity associated with the viral expression system in untreated cortical neurons, replacing neuronal medium with extracellular solution containing glucose (OGD control; Figure 2.17) induced an even high number of cell death. Perhaps infection of neurons with lentivirus sensitized neurons to cell death. 30 Table 2.1: List of Real-Time PCR primers. Sequences Actin Forward ACGAGGCCCAGAGCAAGAG Reverse TCTCCATGTCGTCCCAGTTG CyclinDl Forward GCCAGAGGCGGATGAGAAC Reverse GGCACAGAGGGCCACAAA BTG2 Forward CAAACACCACTGGTTTCCAGAA Reverse TTGTGGTTGATGCGGATACAG 31 Table 2.2: List of B T G 2 siRNAs and siRNA controls sequences. rat BTG2 siRNA Forward GATCCCCGCAGGAGCAGTCCATCGAAGAACTATTCAAGAGATAGTTCTTCGATGGACTGCTCCTG CTTTTTA rat BTG2 siRNA Reverse AGCTTA.AAAAGCAGGAGCAGTCCATCGAAGAACTATCTCTTGAATAGTTCTTCGATGGACTGCTC CTGCGGG rat BTG2 siRNA scrambled 1-3 Forward GATCC'CCGAGCGTAACCTCGGAGACGAAATCATTCAAGAGATGATTTCGTCTCCGAGGTTACGCT CTTTTTA rat BTG2 siRNA scrambled 1-3 Reverse ACiCrrAAAAAGAGCGTAACCTCGGAGACGAAATCATCTCTTGAATGATTTCGTCTCCGAGGTTAC GCTCGGG rat BTG2 siRNA scrambled 2-1 Forward GArC(XX;CTGACAGACGACGATACGAGGCAATTTCAAGAGAATTGCCTCGTATCGTCGTCTGTCA GTTTTTA rat BTG2 siRNA scrambled 2-1 Reverse AGCTTAAAA-\CTGACAGACGACGATACGAGGCAATTCTCTTGAAATTGCCTCGTATCGTCGTCTG TCAGGGG 32 Table 2.3: Methods and primers used to generate BTG2 - c M y c and B T G 2 - G F P fusion c D N A Primers used to generate BTG2 fusion proteins (enzymes are indicated in bold) BTG2-cMyc rBTG2_F: TAGGATCCATGAGCCACGGGAAGAGAAC rBTG2_R_cmyc: CAGAATTCCTAcagatcttcttcagaaata agtttttgttcGCTGGAGACAGTCATCACG BTG2-GFP • BTG2 BTG2_F_BglII: GAagatctATGAGCCACGGGAAGAGAACCGA BTG2_R_KpnI: ATggtaccGCTGGAGACAGTCATCACGTA • GFP GFP_F_KpnI: ATggtacc ATGGTG AGC A AGGGCG AG GFP R EcoRI: CCgaattcTAGAGTCGCGGCCGCTTTACTT • BTG2 and GFP ligated with Ligase using Kpnl 33 Figure 2.1: A n example of B T G 2 s iRNA oligos following annealing. (Bglll) (HI) (Sense) (Hairpin) (Antisense) (Termination) (Hindlll) 5' - G A T C C C C G C A G G A G C A G T C C A T C G A A G A A C T A T T C A A G A G A T A G T T C T T C G A T G G A C T G C T C C T G C T T T T T A - 3' 3' - GGGCGTCCTCGTCAGGTAGCTTC TTGATAAGTTCTCTATCAAGAAGCTACCTGACGAGGACGAAAAATTCGA -Figure 2.2: Microarray data of BTG2 mRNA expression following retina ischemia. BTG2 mRNA was shown to be up-regulated 3 hours following either 30min or 90min retinal ischemia in vivo. However, 12 hours or 48 hours following treatment had no effect on the BTG2 mRNA expression. Microarray Data of BTG2 mRNA Expression Following Retina Ischemia 3hours 12hours 43hours 35 Figure 2.3: Microarray data of BTG2 mRNA expression following M C A O ischemia. BTG2 mRNA was shown to be up-regulated 3 hours following M C A O ischemia in vivo. However, 24 hours or 72 hours following treatment had no effect on the BTG2 mRNA expression. Microarray Data of BTG2 mRNA Expression Following MCAO Ischemia 1 f 5 o 2 4 o * 3 2 * 2 b • ischemia • sham 3hours 24hours 3days 36 Figure 2 . 4 : Real-time PCR analysis of BTG2 mRNA expression following 30min, 60min or 3hr of lOOuM N M D A treatment. BTG2 mRNA was shown to be up-regulated at all of the time tested. tt T 1 » 2 e z a 10 9 8 7 6 5 4 3 2 1 0 BTG2 m R N A E x p r e s s i o n F o l l o w i n g 100uM N M D A Treatment H NMDA • Control 30min 1hour 3hours 37 Figure 2.5: Real-time PCR analysis of BTG2 mRNA expression following 2hr of either lOuM or lOOuM N M D A treatments. BTG2 mRNA was shown to be up-regulated at both concentrations tested. BTG2 mRNA Expression Following 2hr NMDA Treatment 4 3.5 3 i 2 . 5 < i z * 1-5 f-> 1 m 0.5 0 ** T ** T -G l y + l O u M N M D A G l y + l O O u M N M D A 38 Figure 2.6: Western immunoblotting analysis of BTG2 protein expression following lhr of lOuM N M D A treatments with 3hr, 6hr, or 9hr of recovery. BTG2 was shown to be up-regulated 6hr and 9hr after lhr of N M D A treatment, but not 3hr afterwards (a). A representative of the Western immunoblotting is shown in (b). (a) BTG2 Protein Expression Following lhr of NMDA Treatment p (b) 3hr 6hr 9hr Recovery time (hr) 3hr 6hr 9hr £ly NMDA 6ly NMDA Gly NMDA — — BT&Z —— — Actin 39 Figure 2.7: Confocal image analysis of subcellular localization of BTG2 following NMDA. For neurons infected with a lentiviral vector expressing only GFP (A-C), GFP was found to be highly expressed not only at the nucleus and the cytoplasm, but also the neurites. For untreated neurons (D-G), Glycine treated neurons (H-K), and Gly+NMDA treated neurons (L-O) infected with a lentiviral vector expression BTG2-GFP fusion protein, BTG2 was found to localize mainly to the cytoplasm and the nucleus. For all cells, DAPI was used to stain the nucleus (A, D, H, L), and MAP2 was used to stain the neurons (F, J, N). Images were merged to show the subcellular localization of the GFP (C, G, K, O). Only a representative of the Glycine and NMDA treatments are shown here, but the results are the time for various recovery times following lhr of NMDA. (<) * ft L « # • I T ft 1 2 Figure 2.8: Western immunoblotting analysis of BTG2 protein expression following infection of neurons with a lentiviral vector expressing BTG2-cMyc. Rat cortical neuron cultures were infected either with a viral vector expression BTG2-cMyc (lane 1) or GFP (lane 2). Lane 3 is a control with no viral infection. Cells were lysed and protein samples collected 4-5 days following infection and probed with a c-Myc antibody. 1 2 3 m c-Myc Actin 42 Figure 2.9: Real-time P C R analysis of the effect of BTG2 s iRNA on BTG2 mRNA expression levels. BTG2 s iRNA was able to reduce BTG2 mRNA level by 70-80 %, but was only able to reduce the mRNA level by -50% when cells were treated with N M D A . Two BTG2 s iRNA scrambled controls (BTG2 SCI-3 and BTG2 SC2-1) were found that had no effect on the BTG2 m R N A expression levels. The degree of BTG2 mRNA knock down was normalized to cells infected with an empty viral vector. 1.4 1.2 1 0.8 0.6 0.4 0.2 Efficiency of BTG2 siRNA *.* I 4>' 4 43 Figure 2.10: Western immunoblotting analysis of the effect of BTG2 siRNA on BTG2 protein expression levels. BTG2 siRNA was only able to reduce BTG2 protein level by 20-30% while the two BTG2 siRNA scrambled controls (BTG2 SCI-3 and BTG2 SC2-1) had no effect on the BTG2 protein expression levels when compared to the empty viral vector infection control, pLentiLox3.7 (a). A representative of the Western immunoblot is shown in (b) with the numbers ordered as follow: lane 1, empty viral vector infection; lane 2, BTG2 siRNA; lane 3, BTG2 SC1-3; lane 4, BTG2 SC2-1. (a) l f i 16 1.4 12 1 OS Qfi 0.4 02 0 BTG2 siRNA on BTG2 Protein Expression I, T * T 1 1 pLentiLox3.7 BTG2 s iRNA BTG2 SC1-3 BTG2SC2-1 (b) 1 2 3 4 ~~~ *~ —•- — 4eti« 44 Figure 2.11: Western immunoblotting analysis of the effect of over-expressing BTG2 or reducing BTG2 expression level on activation of Caspase 3 following NMDA treatment. Neurons were treated with Gly ± lOuM NMDA for lhr followed by 20-24hr of recovery. Reduction in BTG2 expression with BTG2 siRNA had no effect on the caspase 3 activation, whereas over-expressing BTG2 significantly reduced the activation of Caspase 3 (a). A representative of the Western immunoblot is shown in (b). For BTG2 siRNA western immunoblot, lanes were numbered as follow: lane 1, pLentiLox3.7 Gly; lane 2, pLentiLox3.7 Gly+NMDA; lane 3, BTG2 siRNA Gly; lane 4, BTG2 siRNA Gly+NMDA; lane 5, BTG2 SCI-3 Gly; lane 6, BTG2 SC2-1 Gly+NMDA; lane 7, BTG2 SC2-1 Gly; lane 8, BTG2 SC2-1 Gly+NMDA. For BTG2 over-expression Western immunoblot, lanes were numbered as follow: lane 1, FUGW Gly; lane 2, FUGW Gly+lOuM NMDA; lane 3, FUGW Gly+lOOuM NMDA; lane 4, BTG2-cMyc Gly; lane 5, BTG2-cMyc Gly+lOuM NMDA; lane 6, BTG2-cMyc Gly+lOOuM NMDA. (a) A 3.5 3 2.5 2 1.5 1 0.5 0 Changes in Active Caspase 3 Protein Level Following NMDA Treatment T T — Vial Infection Control + NMDA BTG2 siRNA + NMDA BTG2SC1-3+NMDA BTG2SC2-1+NMDA BTG2-cmyc + NMDA 1 2 3 4 5 6 7 8 BTG2 sifcN-4 mm mm rnmt mm mm mm Active caspojc 3 , , , Actia (b) 1 2 3 4 5 * BTG2 ov«rcxprc$tioi» — * Active caspase 3 Act hi 45 Figure 2.12: L D H analysis of the effect on NMDA-induced excitotoxicity. L D H assays were performed to determine the % of cell death 24hr following treatment with various concentrations of N M D A . 30min and 60min of lOuM N M D A was able to kil l -20% of neurons, while 30min and 60min of 20uM N M D A was able to kil l -30-35% of neurons. 50uM N M D A , lOOuM N M D A and I m M N M D A gave approximately the same % of cell deaths of -40-50%. 5uM of MK-801 was able to abolish the NMDA-induced cell death at all N M D A concentrations tested. NMDA-induced Cell Death Following NMDA Treatment 60 OS Figure 2.13: L D H analysis of the effect of BTG2 siRNA on NMDA-induced excitotoxicity. Neurons infected with empty virus vector, BTG2 s iRNA or BTG2 siRNA scrambled controls were treated with 20uM Gly ± 20 or 50uM N M D A for lhr, followed by 24hr of recovery. Reduction of BTG2 with BTG2 siRNA had no effect on NMDA-induced excitotoxicity cell death when compared to both infection control and BTG2 s iRNA scrambled controls. Effect of BTG2 siRNA on NMDA-induced Excitotoxicity 45 -, 40 35 30 JZ 25 CO a 5 20 0 ) o 15 10 Vims BTG2 BTG2 BTG2 Control Gly siRNA Gly scrambled scrambled 1-3 Gly 2-1 Gly Virus Control Gly+20uM NMDA BTG2 SiRNA Gly+20uM NMDA BTG2 scrambled 1-3 Gly+20uM NMDA BTG2 scrambled 2-1 Gly+20uM NMDA Virus BTG2 BTG2 BTG2 Control siRNA scrambled scrambled Gly+50uM Gly+50uM 1-3 2-1 NMDA NMDA Gly+50uM Gly+50uM NMDA NMDA Figure 2.14: TUNEL analysis of the effect of BTG2 siRNA on NMDA-induced excitotoxicity. Rat cortical neurons were infected with empty virus vector, BTG2 siRNA or BTG2 siRNA scrambled controls. Cells were treated with 20uM Gly ± 10 NMDA for lhr, followed by 24hr of recovery. Comparing to both viral infection control and the BTG2 siRNA scrambled controls, reducing BTG2 expression with BTG2 siRNA had no effect on NMDA-induced excitotoxicity cell death. This was only done once. Effect of BTG2 siRNA on NMDA-induced Excitotoxicity as Measured by TUNEL CD CD T3 0 O _ l LU Z z => 0.8 -r 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0 pLenti3.7 BTG2 BTG2 SC1 - BTG2 SC Gly siRNA Gly 3 Gly 2-1 Gly pLenti3.7 BTG2 B T G 2 S C 1 - BTG2 SC Gly+NMDA siRNA 3 2-1 Gly+NMDA Gly+NMDA Gly+NMDA 48 Figure 2.15: LDH analysis of the effect of over-expressing BTG2 on NMDA-induced excitotoxicity. Rat cortical neurons were infected with either FUGW viral vector or vector over-expressing BTG2. Cells were treated with 20uM Gly ± 10 or lOOuM NMDA for lhr, followed by 24hr of recovery. Comparing to the viral infection control, over-expression of BTG2 significantly reduced NMDA-induced excitotoxicity cell death at both NMDA concentrations tested. Effect of BTG2 Over-expression on NMDA-induced Excitotoxicity 50 45 40 35 * 30 JL 15 10 5 0 FUGW Gly BTG2_cmyc Gly FUGW BTG2_cmyc Gly+lOuM Gly+lOuM N M D A N M D A FUGW BTG2_cmyc Gly+lOOuM Gly+lOOuM N M D A N M D A 49 Figure 2.16: L D H analysis on OGD-induced cell death. Rat cortical neurons were treated with O G D for various times, followed by a 24hr recovery. 30min OGD treatment did not give a significant amount of cell death, whereas 60min, 90min, 120min, and 150min all led to similar, but significant, amount of cell death of 20-25%. Oxygen Glucose Deprivation Induced Cell Death 30rain 60rain 90min 120rain lSOrain OGD OGD OGD OGD OGD Control Control Control Central Control 30rnin 60rnin 90tnin 120rain lSOrain OGD OGD OGD OGD OGD 50 Figure 2.17: L D H analysis of the effect of BTG2 s iRNA on OGD-induced cell death. Rat cortical neurons were infected with empty viral vector, BTG2 siRNA, or BTG2 scrambled control (SCI-3). Cells were then undergone lhr treatment followed by 24hr of recovery. Infection alone with an empty vector gave a much higher cell death in OGD control group. Comparing to either empty viral vector or BTG2 s iRNA scrambled control 1-3, BTG2 s iRNA did not give a significant number of cell death following O G D treatment. Effect of BTG2 siRNA on OGD-induced Cell Death 70 60 50 40 30 20 N/A OGD BTG2 siRNA BTG2 SC1-3 pLentiLox3.7 control OGD control OGD control virus OGD control N/A OGD BTG2 siRNA BTG2 SCI-3 pLentiLox3.7 OGD OGD virus OGD 51 Figure 2.18: Real time P C R analysis o f the effect o f BTG2 s i R N A on C y c l i n D l m R N A expression following 2hr N M D A treatment. Reducing BTG2 expression did not change basal C y c l i n D l m R N A level. However, C y c l i n D l m R N A level was significantly increased in cells with reduced BTG2 expression following N M D A treatment. This increase was not seen in viral empty vector control or BTG2 scrambled control, and was abolished with 5uM MK-801. 52 2.5 BIBLIOGRAPHY Bading H , Greenberg M E (1991) Stimulation of protein tyrosine phosphorylation by N M D A receptor activation. Science 253:912-914. Bading H (2000) Transcription-dependent neuronal plasticity: The nuclear calcium hypothesis. Eur J Biochem 267:5280-5283. Bading H , Ginty D D , Greenberg M E (1993) Regulation of gene expression in hippocampal neurons by distinct calcium signaling pathways. Science 260:181-186. Bradbury A , Possenti R, Shooter E M , Tirone F (1991) Molecular cloning of PC3, a putatively secreted protein whose m R N A is induced by nerve growth factor and depolarization. Proc Natl Acad Sci U S A 88:3353-3357. Brewer GJ (1997) Isolation and culture of adult rat hippocampal neurons. J Neurosci Methods 71:143-155. Brewer GJ, Torricelli JR, Evege E K , Price PJ (1993) Optimized survival of hippocampal neurons in B27-supplemented neurobasal, a new serum-free medium combination. J Neurosci Res 35:567-576. Calegari F, Haubensak W, Yang D, Huttner W B , Buchholz F (2002) Tissue-specific R N A interference in postimplantation mouse embryos with endoribonuclease-prepared short interfering R N A . Proc Natl Acad Sci U S A 99:14236-14240. Calegari F, Haubensak W, Haffner C, Huttner W B (2005) Selective lengthening of the cell cycle in the neurogenic subpopulation of neural progenitor cells during mouse brain development. J Neurosci 24:6533-6538. Canzoniere D, Farioli-Vecchioli S, Conti F, Ciotti M T , Tata A M , Augusti-Tocco G, Mattei E, Lakshmana M K , Krizhanovsky V , Reeves SA, Giovannoni R, Castano F, Servadio A , Ben-Arie N , Tirone F (2004) Dual control of neurogenesis by PC3 through cell cycle inhibition and induction of Math 1. J Neurosci 24:3355-3369. Corrente G, Guardavaccaro D, Tirone F (2002) PC3 potentiates NGF-induced differentiation and protects neuron from apoptosis. Neuroreport 13:417-422. Cortes U , Moyret-Lalle C, Falette N , Curiez C, Ghissassi FE, Barnas C, Morel A P , Hainaut P, Magaud JP, Puisieux A (2000) BTG2 gene expression in the p5 3-dependent and -independent cellular response to D N A damage. M o l Carcinog 27:57-64. Cullen B R (2006) Enhancing and confirming the specificity of R N A i experiments. Nat Methods 3:677-679. El-Ghissassi F, Valsesia-Wittmann S, Falette N , Curiez C, Walden PD, Puisieux A (2002) B T G 2 T l s 2 1 / P C 3 induces neuronal differentiation and prevents apoptosis of terminally differentiated PC 12 cells. Oncogene 21:6772-6778. Ficazzola M A , Fraiman M , Gitlin J, Woo K , Melamed J, Rubin M A , Walden PD (2001) Antiproliferative B cell translocation geen 2 protein is down-regulated post-transcriptionally as an early event in prostate carcinogenesis. Carcinogenesis 22:1271-1279. Fletcher BS, L im RW, Varnum B C , Kujubu D A , Koski R A , Herschmann H R (1991) Structure and expression of TIS21, a primary response gene induced by growth factors and tumor promoters. J Biol Chern 266:14511-14518. Gehring WJ, Affolter M , Burglin T (1994) Homeodomain proteins. Annu Rev Biochem 63:487-526. Graham F L , Smiley J, Russell WC, Nairn R (1977) Characteristics of a human cell line transoformed by D N A from human adenovirus type 5. J Gen Virol 36:59-74 Guardavaccaro D, Corrente G, Covone F, Micheli L , D'Agnano I, Starace G, Caruso M , Tirone F (2000) Arrest of G(l)-S progression by the p53-inducible gene PC3 is Rb 53 dependent and relies on the inhibition of cyclinDl transcription. M o l Cell Biol .20:1797-1815. Haubensak W, Attado A , Denk W, Huttner W B (2004) Neurons arise in the basal neuroepithelium of the early mammalian telecephalon: a major site of neurogenesis. Proc Natl Acad Sci U S A 101:3196-3201. Hong JW, Ryu M S , L im IK (2005) Phosphorylation of serine 147 of tis21/BTG2/pc3 by p-Erkl/2 induces Pin-1 binding in cytoplasm and cell death. J Biol Chern 280:_21256-63 Iacopetti P, Michelini M , Stuckmann I, Oback B, Aaku-Saraste E, Huttner WB (1999) Expression of the antiproliferative gene TIS2 1 at the onset of neurogenesis identifies single neuroepithelial cells that switch from proliferative to neuron-generating division. Proc Natl Acad Sci U S A 96:4639-4644. Ikematsu N , Yoshida Y , kawamura-Tsuzuku J, Oshugi M , Onda M , Hirai M , Fujimoto J, yamamoto T (1999) Tob2, a novel antiproliferative Tob /BTBl family member, associates with a component of the CCR4 transcriptional regulatory complex capable of binding cyclin-dependent kinases. Oncogene 18:7432-7441. Jung H Y Kang U G , Ahn Y M , Joo Y H , Park JB, K i m Y S (1996) Induction of tetradecanoyl phorbol acetate-inducible sequence (TIS) genes by electroconvulsive shock in rat brain. Biol Psychiatry 40:503-507. Katchanov J, Harms C, Gertz K , Hauck L , Waeber C, Hirt L , Priller J, von Harsdorf R, Brack W, Hortnagl H , Dirnagl U , Bhide PG, Endres M (2001) M i l d cerebral ischemia induces loss of cyclin-dependent kinase inhibitors and activation of cell cycle machinery before delayed neuronal cell death. J Neurosci 21:5045-53. Kawakubo H , Brachtel E, Hayashida T, ZYeo G, Kish J, Muzikansky A , Walden PD, Maheswaran S (2006) Loss of B-cell translocation gene-2 in estrogen receptor-positive breast carcinoma is associated with tumor grade and overexpression of cyclinDl protein. Cancer Res 66:7075-7082. Kosodo Y , Roper K , Haubensak W, Marzesco A M , Corbeil D, Huttner WB (2004) Asymmetric distribution of the apical plasma membrane during neurogenic divisions of mammalian neuroepithelial cells. E M B O J 23:2314-2324. Lewis BP, Burge C B , Battel DP (2005) Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell 120:15-20. L im IK (2006) TIS21/BTG2/PC3 as a link between ageing and cancer: cell cycle regulator and endogenous cell death molecule. J Cancer Res Clin Oncol 132: 417-426 Lim IK, Lee M S , Lee SH, K i m N K , Jou I, Se JS, Park SC (1995) Differential expression of TIS21 and TIS1 genes in the various organs of Balb/c mice, thymic carcinoma tissues and the human cancer cell lines. J Cancer Res Clin Oncol 121:279-284. L im IK, Lee M S , Ryu M S , park TJ, Fujiki H , Eguchi H , Paik W K (1998) Induction of growth inhibition of 293 cells by downregulation of cyclin E and cyclin-dependent kinase 4 proteins due to overexpression of TIS21. Mol Carcinog 23:25-35. L im LP, Lau N C , Garrett-Engele P, Grimson A , Schelter J M , Castle J, Battel DP, Linsley PS, Johnson J M (2005) Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Nature 433:769-773. L in WJ, Gary JD, Yang M C , Clarks S, Herschmann H R (1996) The mammalian immediate early TIS21 protein and the leukemia-associated BTG1 protein interact with a protein-arginine N-methyltransferase. J Biol Chem 271:15034-15044. Malatesta P, Gotz M , Barsacchi G, Price J, Zoncu R, Cremisi F (2000) PC3 overexpression affects the pattern of cell division of rat cortical precursors. Mech Dev 90:17-28. Marques JT, Williams B R (2005) Activation of the mammalian immune system by siRNAs. Nat Biotechnol 23:1399-1405. 54 Montagnoli A , Guardavaccaro D, Starace G, Tirone F (1996) Overexpression of the nerve growth factor-inducible PC3 immediate early gene is associated with growth inhibition. Cell Growth Differ 7:137-1336. Moran E (1993) interaction of adenoviral proteins with pRB and p53. F A S E B J 7:880-885. Morel A P , Sentis S, Bianchin C, Le Romancer M , Jonard L , Rostan M C , Rimokh R, Corbo L (2003) BTG2 antiproliferative protein interacts with the human CCR4 complex existing in vivo in three cell-cycle-regulated forms. J Cell Sci 116:2929-2936. Osuga H , Osuga S, Wang F, Fetni R, Hogan M J , Slack RS, Hakim A M , Ikeda JE, Park DS (2000) Cyclin-dependent kinases as a therapeutic target for stroke. Proc Natl Acad Sci U S A 97:10254-10259. Park DS, Obeidat A , Giovanni A , Greene L A (2000) Cell cycle regulators in neuronal death evoked by excitotoxic stress: implications for neurodegeneration and its treatment. Neurobiol Aging 21:771-781. Park S, Lee Y J , Lee HJ, Seki T, Hong K H , Park J, Beppu H , L im IK, Yoon JW, L i E, K i m SJ, Oh SP (2004) B-cell translocation gene 2 (Btg2) regulates vertebral patterning by modulating bone morphogenetic protein/smad signaling. M o l Cell Biol 24:10256-10262. Passed D, Marcucci A , Rizzo G, Ri l l i M , Panigada M , Lernardi L , Tirone F, Grignani F (2006) BTG2 enhances retinoic acid-induced differentiation by modulating histone H4 methylation and acetylation. M o l Cell Biol 26:5023-5032 Prevot D, Morel A P , Voeltzel T, Tostan M C , Rimokh R, Magaud JP, Corbo L (2001) Relationships of the antiproliferative proteins BTG1 and BTG2 with C A F 1 , the human homolog of a component of the yeast CCR4 transcriptional complex: involvement in estrogen receptor alpha signaling pathway. J Biol Chern 276:9640-9648. Prevot D, Voeltzel T, Birot A M , Morel A P , Rostan M C , Magaud JP, Corbo L (2000) The leukemia-associated protein Btg l and the p53-regulated protein Btg2 interact with the homeoprotein Hoxb9 and enhance its transcriptional activation. J Biol Chem 275:147-153. Rashidian J, Iyirhiaro G, Aleyasin H , Rios M , Vincent I, Callaghan S, Bland RJ, Slack RS, During M J , Park DS (2005) Multiple cyclin-dependent kinases signals are critical mediators of ischemia/hypoxic neuronal death in vitro and in vivo. Proc Natl Acad Sci U S A 102:14080-14085 Rouault JP, Pervot D, Berthet C, Birot A M , billaud M , Magaud JP, Corbo L (1998) Interaction of BTG1 and p53-regulated BTG2 gene products with mCafl , the murine homolog of a component of the yeast CCR4 transcriptional regulatory complex. J Biol Chem 273:22563-22569. Ryu M S , Lee M S , Hong JW, Hahn TR, Moon E, L im IK (2004) TIS21/BTG2/PC3 is expressed through PKC-delta pathway and inhibits binding of cyclin Bl -Cdc2 and its activity, independent of p53 expression. Exp Cell Res 299:159-70. Sakaguchi T, Kuroiqa A , Takeda H (2001) Expression of Zebrafish btg-b, an anti-proliferative cofactor, during early embryogenesis. Mech Dev 104:113-115. Schild D (1995) Suppression of a new allele of the yeast RAD52 gene by overexpression of RAD51 , mutation in srs2 and ccr4, or mating type heterozygosity. Genetics 140:115-127. Snove Jr O, Rossi JJ (2006) Expressing short hairpin RNAs in vivo. Nat Methods 3:689-695. Struckmann K , Schraml P, Simon R, Elmenhorst K , Mirlacher M , Kononen J, Moch H (2004) Impaired expression of the cell cycle regulator BTG2 is common in clear cell renal cell carcinoma. Cancer Res 64:1632-1638. Sugimoto K , Hayata T, Asashima M (2005) XBtg2 is required for notochord differentiation during early Xenopus development. Dev Growth Differ 47:435-443. 55 Svendsen C N , Fawcett JW, Bentlage C, Dunnett SB (1995) Increased survival of rat EGF-geenrated CNS precursor cells using B27-supplemented medium. Exp Brain Res 102:407-414. Thomas C E , Ehrhaardt A , Kay M A (2003) Progress and pblems with the use of viral vectors for gene therapy. Nat Rev Genet 4:346-358. Timsit S, Rivera S, Ouaghi P, Guischard F, Tremblay E, Ben-Ari Y , Khrestchatisky M (1999) Increased cyclin D1 in vulnerable neurons in the hippocampus after ischaemia and epilepsy: a modulator of in vivo programmed cell death? Eur J Neurosci 11:263-278. Tirone F (2001) The gene PC3(TIS21/BTG2), prototype member of the PC3/BTG/TOB family: regulator in control of cell growth, differentiation, and D N A repair? J Cell Physiol 187:155-165. Wang F, Corbett D , Osuga H , Osuga S, Ikeda JE, Slack RS, Hogan M J , Hakim A M , Park DS (2002) Inhibition of cyclin-dependent kinases improves C A I neuronal survival and behavioral performance after global ischemia in the rat. J Cereb Blood Flow Metab 22:171-182. Wang J, Liu S, Fu Y , Wang JH, Lu Y (2003) Cdk5 activation induces hippocampal C A I cell death by directly phosphorylating N M D A receptors. Nat Neurosci 6:1039-1047. West A E , Chen W G , Dalva M B , Dolmetsch RE, Kornhauser J M , Shaywitz A J , Takasu M A , Tao X , Greenberg M E (2001) Calcium regulation of neuronal gene expression. Proc Natl Acad Sci US A 98:11024-11031. Xie C, Markesbery WR, Lovell M A . Survival of hippocampal and cortical neurons in a mixture of M E M + and B27- supplemented neurobasal medium. Free Radic Biol Med 2000; 28:665-72. Yitao L , Wong TP, Aarts M , Rooyakkers A , LiuL, Lai TW, Wu DC, Lu J, Tymianski M , Craig A M , Wang Y T (2007) N M D A receptor subunits have differential roles in mediating excitotoxic neuronal death both in vitro and in vivo. J Neurosci 27:2846-2857. Zhang SJ, Steijaert M N , Lau D, Schutz G, Vivier C D , Descombes P, Bading H (2007) Decoding N M D A receptor signaling: identification of genomic programs specifying neuronal survival and death. Neuron 53:549-562. 56 3 Analysis of BTG2 Promoter 3.1 I N T R O D U C T I O N 3.1.1 Properties of the BTG2 Promoter In order to study complex factors regulating the BTG2 promoter, it is important to first identify the functional cis-regulatory sequences in the promoter that interact with the trans-acting factors. Using Matlnspector, a program that searches for transcription factor binding sites, several interesting transcription factor binding sites are identified in the rat BTG2 promoter (Matlnspector, 2006; Figure 3.14). Firstly, there is no T A T A box upstream of A T G start codon. However, C C A T T boxes, and several GC-rich regions containing Sp 1 binding sites are identified, which are common features of a promoter that is TATA-less (Ji et al., 1996). Comparison of BTG2 promoter between the different species reveals the presence of several conserved cis-acting domains including the C C A A T box, GC-rich regions containing Spl binding sites, cAMP-responsive elements, AP-1 binding sites, and P53 response elements. However, two major differences are seen. Firstly, the mouse BTG2 promoter contains the presence of a T A T A box 22 bp upstream of A T G (Fletcher et al., 1991). Secondly, a G A G A box with repeated G A sequences is found between -590 to -656 relative to A T G on the rat BTG2 promoter and is only present on the rat BTG2 promoter, but not on human or mouse BTG2 promoter. A schematic diagram of the rat BTG2 promoter is shown in Figure 3.14. Other transcriptional factors including enhancers, suppressors, and activators are shown in Table 3.5. 57 A recent paper characterized the P53 binding sites in human BTG2 promoter and found that a P53 response element -74 to -122 relative to the A T G was enough to constitute as a BTG2 promoter when P53 was present (Duriez 2002). This P53 response element was blasted and the homolog region was found to be -53 to -94 relative to A T G on the rat BTG2 promoter (P53RE (-53/-94)). The G A G A element has been well studied in the fruit fly Drosophila melanogaster, and that the GAGA-associated factor (GAF) is involved in modulation of gene expression through modifications of the chromatin structure (Petrascheck et al., 2005; for review, see Adkins et al., 2006; Granok et al., 1995; Lehmann, 2004). It has both activator/anti-repressor and repressor activities depending on the genomic location of its target gene. The G A F , along with N U R F (ATP-dependent nucleosome remodeling factor) and F A C T (facilitates chromatin transcription), is able to displace the nucleosome and make the D N A recognition sites available for either activators or repressors, which in turn would recruit transcriptional machinery or other proteins that mediate transcriptional activation or silencing (for review, see Lehmann, 2004). For it to act as an activator/antirepressor, the G A G A box needs to be kept in close proximity to the T A T A box (Legraverend et al., 1996). As for the repressor activity of G A F , the BTB/POZ domain of G A F , a protein-protein interaction motif that is required for transcriptional activation and repression, is able to interact with repressors and represses gene expression (Barna et al., 2002; Huynh, and Bardwell, 1998). Although the G A F is well studied in the fruit fly, very little information is known about the proteins that are bound to the G A G A element in mammalian cells (all the putative mammalian G A G A binding factors are referred to as GBP from here on). A recent study suggested that p38 and p40 protein, homologs of m C B F - A (mouse CA-richG box binding factor A) and hABBP-1 (human Apobec-1-binding protein-1) that belonged to the 58 heterogeneous nuclear ribonucleoprotein (hnRNP) family, may bind to the G A G A box in the rat Spi-2 gene promoter and behave as transcriptional factors (Kamada and Miwa, 1992; Lau et al., 1997; Leverrier, et al., 2000). However, it is still unclear whether the G A G A element found on the rat BTG2 promoter has any effect in BTG2 expression or whether P53 may interact with G A G A binding protein and influence BTG2 expression. 3.1.2 Role of P53 in BTG2 Expression It is well known that P53, a tumor suppressor, is up-regulated following cellular stress, and this up-regulation is followed by the translocation of stabilized P53 into the nucleus and the transcriptional transactivation of P53 specific target genes containing P53 response elements in the promoters of P53 gene targets (for review, see Morrison and Kinoshita, 2000). Many have reported an up-regulation of P53 in response to D N A damage, excitotoxins, hypoxia, ischemia, and neurotraumas (Banasiak and Haddad, 1998; L i et al., 2002; Lu et al., 2000; McGahn et al., 1998; Napieralski et al., 1999; Xiang e tel., 1998; for review, see Morrison and Kinoshita, 2000). Furthermore, studies using either heterozygous transgenic mice or pifithrin-a, a chemical inhibitor of P53, have all shown a significantly reduced brain infarction and an increased resistance to ischemia (Crumrine et al., 1994; Culmsee et al., 2001). One mechanism in which P53 may promote neuronal death following disruption to the mitochondrial membrane potential and increased reactive oxygen species production is through regulation of Bax, a Bcl-2 family member (Polyak et al., 1997; Xiang et al., 1998). The activation of Bax through P53 stimulates the release of Cytochrome c from the mitochondria leading to the activation of Caspase 3 (Schuler et al., 2000). However, depending on the insult and the degree of damage, P53 may play a role in neuro-protection by tranactivating genes involved in the D N A repair (for review, see Hou and MacManus et al., 2002). 59 Although P53 induces transcriptional activation of its target genes in response to cellular response, it is important to note that P53 may also promote apoptosis by repressing the expression of certain genes, which does not appear to depend on the presence of P53 consensus binding sites in the promoter region of repressed genes (Miyashita et al., 1994; Roperch et al., 1998). Furthermore, P53 may mediate apoptosis through transcription-independent pathways (Ding et al., 1998; Gottlieb and Oren, 1998). One mechanism in which P53 may transcriptionally repress target gene expressions is by recruiting histone deacetylases through a co-repressor protein Sin3 to the target promoters (Murphy et a l , 1999). Several genes, including c-Myc, Nanog, and Hsp90-beta, have been shown to be transcriptionally suppressed by P53 directly (Ho et al., 2005; Lin et al., 2005; Zhang et al., 2004). Furthermore, it is also possible for P53 to suppress the expression of genes that do not contain the P53 response elements in the target gene promoters (Imbriano et al., 2005). So far, no study has yet to show any association between P53 and transcriptional factor(s) that interacts with the G A G A box. BTG2 is induced in response to D N A damage and cellular stress (Cortes et al., 2000; Fiedler et al., 1998; Rouault et al., 1996). Using either P53 dominant negatives or cell lines carrying temperature-sensitive P53, the induction of BTG2 was found to be P53-dependent (Cortes et al., 2000; Fiedler et al., 1998; Rouault et al., 1996). The P53 consensus elements, which consists of four pentameric repeats composed of 2 (PuPuPuCA/T) and 2 (PyPyPyGA/T) sequences, that are found in the BTG2 promoter also supports for a role of P53 in BTG2 expression (El-Diery et al., 1992; Rouault et al., 1996). Treatments that are known to induce P53 activation also induced BTG2 mRNA level in cell lines where P53 is active, t (Cortes et al., 2000; Gubits et al., 1993; Jung et al., 1996; Rouault et al., 1996). One of the pathways that P53 influences following its up-regulation in response to cellular stress is the cell cycle pathway. P53 is able to inhibit the cell cycle progression at 60 G l / S phase through inhibition of C D K 4 and C D K 2 activity, and at G 2 / M phase through direct transcriptional repression of Cdc2 gene (for review, see Dasika et al., 1999). As mentioned in Chapter One, BTG2 is also able to control the cell cycle progression at both G l / S and G 2 / M phases through inhibition the CyclinE associated C D K 4 activity, and inhibition of Cycl inBl binding to Cdc2 thereby inhibiting Cycl inBl associated kinase activity (Lim et al., 1998; Moran, 1993; Ryu et al., 2004). This overlapping function between P53 and BTG2 further suggests a relationship between them. However, it is important to note that even though P53 induces transcriptional activation of BTG2 following D N A damages and cellular stresses, other transcriptional/translational regulations exist, which maybe P53-independent (for review, see Tirone, 2001). For examples, several other transcriptional factors have been proposed to interact with the BTG2 promoter (Figure 3.14; Table 3.5). Furthermore, post-translational modification of BTG2, such as phosphorylation, has been shown to important for the BTG2-Pinl-induced cell death (Hong et al., 2005). 3.1.3 Aims of the Chapter In the last chapter, we have demonstrated that BTG2 is up-regulated following N M D A treatment. In the present study, BTG2 promoter is dissected and analyzed for the cis-elements involved in the transcriptional regulation of the gene. The aim of this study is to determine the promoter activity of various lengths of BTG2 promoter upstream of A T G initiation site, and the roles of transcriptional elements found on the BTG2 promoters, specifically the putative P53 binding site and the G A G A box. 61 3.2 METHODS 3.2.1 Electroporation of Reporter Gene into Rat Primary Cortical Neurons For obtaining, maintaining, and infecting rat primary cortical neuronal culture, please see Methods in Chapter Two. For BTG2 promoter studies, neurons were transfected with maxi-prepped D N A using A M A X A Nucleofector Ki t (Amaxa, Gaithersburg, M D ) . Following dissociation of the rat cortical cells, six million cells were re-suspended in room temperature electroporation solution containing the following (in mM): 120 KC1, 10 K H 2 P 0 4 , 2 E G T A , 24 HEPES, 5 M g C l 2 , 0.5 CaCl 2 , 5 GSSG, and 2 ATP , with pH 7.5-7.6 and osmolarity 310-350. For luciferase activity reading using a Microplate Luminometer, 3ug of promoter construct D N A was added. Electroporation solution containing both D N A and neurons were then mixed and transferred into Amaxa Nucleofector cuvettes. Electroporation program was set at 0-03 on the Amaxa Nucleofector. Following electroporation, cells were transferred into D M E M containing 10% FBS, and plated onto poly-D-lysine coated plates. The medium was replaced with the maintenance medium 4hr after plating. The cell culture was maintained as described in Chapter one. Only mature cortical neurons (12-13 days old) were used in all experiments. 3.2.2 Excitotoxicity Treatment with NMDA To induce N M D A excitotoxicity, 20uM Glycine ± lOuM of N M D A were added to the maintenance medium. To analyze luciferase activity, cells were allowed to recover from lhr of N M D A treatment in NMDA-free maintenance medium for 7hr. 62 3.2.3 Quantitative RT-PCR (qRT-PCR) for Measurement of mRNA Please refer to Chapter Two Method section for the complete procedures, and to Table 3.1 for primer sequences. 3.2.4 Western Immunoblotting Please refer to Chapter Two Method section for the complete procedures. Mouse monoclonal P53 (Calbiochem Cat #OP03T; lug/mL) was used probe for P53 protein. 3.2.5 Immunoprecipitation Following N M D A treatment (20uM Gly ± lOuM N M D A ) for lhr, cells were washed with cold PBS once and collected by centrifuging at 7.5krpm for lOmin at 4°C. The pellet was then homogenized in l m L of T E E N buffer without SDS. Cellular debris was removed by centrifuging at 13krpm for 15min at 4°C. Heterogeneous nuclear ribonucleoproteins A / B (hnRNP A/B) bound proteins were immunoprecipitated by adding 15uL of rabbit polyclonal hnRNP A / B (Santa Cruz, Cat #15385) to the supernatant, and rotated for 2hr at 4°C. Protein A beads (60uL/tube) were added to each tube and rotated at for 2hr at 4°C. The protein-bound beads were then spun down at 3.5krpm for 2min, washed with T E E N without SDS, and then spun down at 3.5krpm for 2min. The final pellet was dissolved in 2X protein sample buffer, and analyzed with 10% SDS-polyacrylamide gels. 1:200 hnRNP A / B and lug/mL of P53 Antibody were used to probe the membrane overnight at 4°C. Their corresponding HRP-conjugated secondary antibodies were used at 1:2000 dilutions. Fermentas Pagerulers Prestained Protein Ladder (Cat #SM0671) was used to estimate the protein molecular sizes. Since hnRNP A / B antibody was able to recognize putative GBPs including the m C B F - A (-38 kDa), we used Image J normalize the average intensity of P53 protein band against the hnRNP A / B (band size ~38-40kDa) band. 63 3.2.6 Generation of Rat P53 siRNA in pLentiLox3.7 Vector To construct both rat P53 s iRNA and the P53 s iRNA control, synthetic D N A sequences were made and shown in Table 3.2 in 5' to 3' order. The forward and reverse strands of each s iRNA were dissolved in TE buffer to a final concentration of lOOuM, and were annealed using PCR machine with the following parameters: 95°C for 30sec, 72°C for 2min, 37°C for 2min, and 25°C for 2min. The annealed s iRNA were cloned into the B g l l l and Hindl l l sites of the pSUPER R N A i vector. The Xbal and Xhol were then used to excise the HI - s iRNA from the pSUPER vector into the pLentiLox3.7 vector replacing the U6 R N A i promoter. It is important to note that the P53 s iRNA control is not a scrambled control like the BTG2 s iRNA scrambled control, but instead has only two bases changes at nucleotide #14 (G to T) and #20 (T to A) . 3.2.7 Generation of P53 Dominant Negatives Several P53 dominant negatives have been reported and reviewed (Cho et al., 1994). Two dominant negatives were cloned and tested in our experiments. The first P53 dominant negative (designated P53DN_short) was generated by removing the P53 core domain responsible for its sequence specific D N A binding, while leaving the transactivation and the tetramerization domains intact (Shaulian et al., 1992). The second P53 dominant negative (designated P53DN_173His) was generated by replacing 173_Arg (CGC) with His (CAC), thus abolishing the sequence specific D N A binding of P53 (Willis et al., 2004). Both P53 dominant negatives were cloned into the viral F U W vector at BamHI and EcoRI sites. For all PCR reactions, High Fidelity Taq enzyme was used with the following condition: 1 cycle of 94°C for 3min; 35 cycles of amplification steps with 94°C for 45sec, 60°C for 60sec, and 72°C for 60sec; and 1 cycle of 72°C for lOmin. The primers and the methods used to clone the P53 dominant negatives are shown in Table 3.3. 64 3.2.8 Construction of Second Generation Lentivirus (pLentiLox3.7 and FUGW) Please refer to Chapter Two Method section for complete procedures. 3.2.9 Generation of P53 Response Elements Synthetic D N A containing a putative P53 binding site on the BTG2 promoter (-50 to -100) followed by T A T A box was made and cloned into the pGL3-basic luciferase expression vector at Hind l l l and B g l l l . Their sequences and restriction sites are shown in Figure 3.1. 3.2.10 BTG2 Promoter Luciferase Reporter Gene Assay Various lengths of BTG2 promoter sequences upstream of the A T G initiation sites were amplified and inserted into the pGL3-basic (Promega) using Hindl l l and B g l l l sites. A l l the constructs were confirmed by restriction enzymes analysis and sequencing. The primers used to generate each of the promoter construct are shown in Table 3.4, and the location of each primer is shown in Figure 3.2. To generate pGL3_2246, pGL3_4200 was digested with P a d and Nhel, overhang D N A was filled with D N A T4 polymerase, and self ligated with Ligase. For all PCR reactions, High Fidelity PCR Taq enzyme (Invitrogen) was used according to the manufacture protocol. For annealing steps, the following PCR conditions were used: 95°C for 30sec, 72°C for 2min, 37°C for 2min, and 25°C for 2min. For all PCR condition, the following PCR parameters were used: 1 cycle of 94°C for 3min; 35 cycles of amplification steps with 94°C for 45sec, 60°C for 60sec, and 72°C for 60sec; and 1 cycle of 72°C for lOmin. The only exception was the annealing time for pGL3_4200, which was 4min. To evaluate the transfection efficiency, constructs containing various lengths of BTG2 promoters were transfected into the neurons and the total amount of D N A were extracted 12 days following transfection for real-time PCR analysis. The relative copies of the luciferase D N A (representing number of vectors transfected into the neurons) was normalized to the genomic actin. For experiments in BTG2 promoter analysis, neurons were transfected with various lengths of pGL3-BTG2 promoters and treated with N M D A 12-13 days following transfection. Following 1 hour of N M D A treatment and 7hr of recovery, cells were washed with PBS, lysed with lOOuL of I X reporter lysis buffer (Promega). A n extra freeze/thaw step was needed to ensure the complete lysis of the cells. Cellular debris was removed by centrifugation at 13krpm for 30sec. 20uL of the supernatant was assayed for luciferase activity (Luciferase Assay system, Promega Cat #E4030) using a Microplate Luminometer. 3.2.11 Statistical Analysis A l l data were expressed as Mean +/- S E M , and the Student's t test was used to examine the statistical significance of the differences between groups of data. Data were considered significant when p < 0.05. * indicates p < 0.05, while ** indicates p < 0.01. For all experiments, data was obtained independently for at least 3 times. 66 3.3 RESULTS 3.3.1 Analysis of BTG2 Promoter In order to understand how BTG2 gene was regulated in neurons, various lengths of BTG2 promoter were cloned into a luciferase expression vector, pGL3-basic, and transfected into rat cortical neurons prior to plating. We found a consistent 10-15% of neurons were expressing EGFP transgene when the cultures were analyzed on day 12-13 after electroporation with the present protocol (Figure 3.3). To ensure that different levels of reporter gene expression from various lengths of BTG2 promoter were not caused by the variation in the transfection efficiency among the constructs, the transfection efficiencies of different lengths of BTG2 promoters in neurons were first determined. Total D N A was extracted 12 days following transfection and the amount of the transfected luciferase D N A found on the constructs was analyzed by qPCR (Figure 3.4). There was no significant difference in transfection efficiency between promoter lengths ranging from 600 to 4200 since neurons transfected with these promoter vectors had similar copy numbers of the vectors. 3.3.1.1 GAGA Box is a Suppresser Element for BTG2 Transcription To analyze the BTG2 promoter structure and its transcriptional activity, neurons were transfected with various lengths of BTG2 promoter constructs, and the basal activities of each promoter length were measured 12-13 days following transfection and several observations were made (Figure 3.5). The basal promoter activity was significantly reduced when the promoter length was extended beyond -600, thus indicating the presence of a suppressor between -600 and -700 (i.e. pGL3-700 had only approximately half of the 67 luciferase activity when compared to pGL3-600). A close look at the promoter elements between region -600 and -700 relative to A T G revealed the presence of a G A G A box. To confirm that this region of BTG2 promoter was indeed a gene repressor, the -100 bp fragment between -600 and -700 was then cloned and inserted at either 3' end or 5' end of the SV40 promoter in the pGL3-SV40-promoter vector. Indeed, the SV40 promoter activity was significantly reduced (Figure 3.6). The highest reduction in promoter activity was when the G A G A box was inserted 3' end of the SV40 promoter. Thus, we concluded that the G A G A box located between -600 and -700 of the BTG2 promoter was a functional suppressor. 3.3.1.2 P53 acted as an Enhancer in the Absence of GAGA Box but a Suppressor with the GAGA Box We then asked whether the P53RE (-53A94) located downstream from G A G A box, was important for the promoter activity. This P53 binding site was removed and resulted in a structure of pGL3-600-P53 (Figure 3.5). Not surprisingly, removal of the P53 binding site significantly reduced BTG2 promoter activity in neurons. However, the promoter without the P53 binding site remained active, indicating that P53 is not necessary for the promoter basal activity but may act as an enhancer for BTG2 transcription as suggested by others. The above results showed that P53 enhanced BTG2 promoter activity in a structure lacking the G A G A box. Our next question was what was the relationship between the P53 binding site and G A G A box when they were both present in the BTG2 promoter? To answer that question, a 1068 bp promoter construct pGL3-1068, containing both the P53RE (-53/-94) and G A G A box was analyzed by deleting G A G A box or P53RE (-53A94) (Figure 3.5). While removal of G A G A box (pGL3-1068-GAGA) gave rise to an increased transcription level similar to that of pGL3-600 as we expected, it was surprising that removal 68 of the P53RE (-53A94) in pGL3-1068 (pGL3-1068-P53) also increased reporter gene expression to the same degree as pGL3-1068-GAGA. This was completely opposite to what we had observed in the pGL3-600, where P53RE (-53/-94) was acting as an enhancer. Therefore, it appeared that P53 acted as an enhancer for BTG2 transcription in the absence of G A G A box but became a suppressor when the G A G A box was present. To further verify the function of the P53RE (-53/-94) in the BTG2 promoter, a fragment of 50 bp containing this site was cloned into a pGL3-basic vector and the reporter gene expression was compared following N M D A treatment (Figure 3.7). Neurons were treated with lOuM N M D A for lhr and allowed to recover for lhr, 2hr, or 3hr. In contrast to the results from using the intact BTG2 promoter, treatment with N M D A significantly induced the promoter activity containing P53RE (-53A-94) from the BTG2 promoter. Therefore, it is apparent that P53RE (-53/-94) can be functional as both an activator and a N M D A inducible element when it was isolated from the BTG2 promoter. But both functions were lost when the element was in the context of neighboring structure of BTG2 promoter. 3.3.1.3 P53 and GBP May Form a Complex to Suppress BTG2 Promoter Activity The deletion of either P53RE (-53/-94) or G A G A box resulted in increased promoter activity, we then asked whether the two transcriptional regulators acted independently or jointly? Since the transcriptional suppressive effect of P53 seemed to be dependent on the presence of G A G A box, the answer should be the latter. To prove that, both G A G A box and P53RE (-53A94) were deleted together in pGL3-1068 (pGL3-1068-P53-GAGA) (Figure 3.5). As we expected, deletion of both sites did not further increase the promoter activity compared with the single deletions. Thus, P53 and GBP may need to work together to act as a suppressor for BTG2 transcription (Figure 3.5). 69 To support the above hypothesis, an immunoprecipitation experiment was performed (Figure 3.8). Proteins were pulled down with a hnRNP A / B antibody (an antibody that recognizes putative GBPs, including mCBF-A) , and probed with the P53 antibody and the hnRNP A / B antibody. The result showed that P53 was indeed associated with mCBF-A in neurons with or without lOuM N M D A stimulation. 3.3.1.4 BTG2 Promoter Region -2246 to -4200 May Contain a NMDA Inducible Element To study how N M D A up-regulated transcriptional activity of BTG2, the inducibility of each promoter construct by N M D A was determined (Figure 3.9). Neurons were treated with 20uM Gly ± lOuM N M D A for lhr followed by 7hr of recovery. As shown in Figure 3.9, various lengths of BTG2 promoter constructs tested from pGL3-600 to pGL3-2246, did not shown any inducibility by N M D A on reporter gene expression, except for the construct pGL3-700, which showed a slight increase in the presence of N M D A . It is apparent that the P53RE (-53/-94) was not responsible for the induction. But, it is clear that the construct containing the sequence extended to -4200 could be induced by N M D A , suggesting that there is probably an inducible element between -2246 and -4200 in the BTG2 gene regulatory region. 3.3.1.5 The P53/GBP Complex May Also Suppress The NMDA Inducibility Although deletion of P53RE (-53A94) in pGL3-600 had no effect on the N M D A inducibility, removal of either P53RE (-53A94) or G A G A box from pGL3-1068 not only increased basal activity of the promoter as shown earlier but also rendered the promoter construct much more responsive to N M D A stimulation (Figure 3.9). Therefore, P53RE 70 (-53/-94) and G A G A box suppressed not only the basal activity of the promoter but also the inducible element, which maybe located in a region between -850 and -1068 of the promoter. 3.3.1.6 P53 Down Regulated Endogenous BTG2 Expression in Unstimulated Neurons Our above results of various BTG2 promoter constructs have all led to a conclusion that P53 is not an enhancer for BTG2 gene expression in primary cultured neurons, which is contradictory to previous reports suggesting that P53 is an activator for BTG2 gene expression in various proliferating cell lines, including the mouse embryonic N I H 3T3 fibroblast. To finally confirm our findings from the promoter analysis, we needed to examine the role of P53 in endogenous BTG2 gene expression. We thought that the best way to reveal the physiological role of P53 on BTG2 gene regulation is to knock-down the P53 expression level in the neurons and to examine the BTG2 level. To knock-down endogenous P53 levels, s iRNA against P53 m R N A was made according to the sequences previously reported and its efficiency was determined following infection of neurons with the viral vector expressing P53 siRNA (Bae et al., 2005). P53 s iRNA was able to reduce the P53 mRNA by -50% while the P53 s iRNA control had no significant effect on P53 mRNA expression (Figure 3.10). It is important to note that, unlike the scrambled control for BTG2 siRNA, the P53 s iRNA control had only two bases different from the functional s iRNA. At the protein level, P53 s iRNA was able to reduce P53 protein by -50%. However, P53 siRNA control also reduced the P53 protein by -20% when compared to empty vector infection (Figure 3.11). Next, the effect of reducing P53 protein on BTG2 protein expression was evaluated. Following infection of neurons with P53 s iRNA expressing lentivirus, protein samples were collected and the BTG2 protein expression was analyzed with Western immunoblotting. As shown in Figure 3.12, reducing P53 protein led to a significant increase of BTG2 protein, 71. suggesting that in rat cortical neurons, P53 acted to repress B T G 2 protein expression. Similarly, P53 dominant negatives, which had mutations in the sequence specific D N A binding domain also caused a slight increase of B T G 2 protein (data not shown) Thus, we have shown that, in terms of transcriptional regulatory role of P53 for B T G 2 gene expression, our results of B T G 2 promoter structure analysis and that of endogenous B T G 2 gene expression have been very consistent that P53 acts as a suppressor for B T G 2 expression in rat cortical neurons. 3.3.1.7 Summary Taken together, both P 5 3 R E (-53/-94) and G A G A box need to be present to act as a suppressor element, and that together with the GAGA-box binding protein, P53 may play a role in regulating B T G 2 basal level but not its inducibility. The P53 siRNA data also supports the promoter analysis since reducing P53 with P53 siRNA resulted in a significant increase of B T G 2 protein. 72 3.4 D I S C U S S I O N S BTG2 has been reported to be induced following cellular stress, and that this induction is P5 3-dependent. However, in our experiments P53 appeared to suppress BTG2 basal level and that the induction of BTG2 following N M D A in rat cortical neurons may not be P53 dependent. Following infection of neurons with P53 siRNA, basal BTG2 expression was significantly increased. Furthermore, removal of P53RE (-53/-94) from the BTG2 promoter (pGL3-1068-p53) not only led to an increase in the basal luciferase activity, but also made the promoter inducible to N M D A . This suppressive effect of P53 appeared to be dependent on the presence of the G A G A box. The G A G A box was shown to be a suppressor element since it reduced the basal BTG2 promoter activity (promoter lengths longer than 600) and reduced the SV40 promoter activity when inserted as an independent fragment. Interestingly, a construct containing the G A G A box but lacking the P53 binding site (pGL3-1068-GAGA) was also highly active. It appears that G A G A box binding protein (GBP), in order to act as a suppressor for BTG2 promoter, requires the presence of both G A G A box and the nearby P53 binding site. Therefore, a possible mechanism is that GBP and P53 are acting together to suppress BTG2 transcriptional activity (Figure 3.13). This is supported by the co-IP result showing that P53 and GBP were bound to each other in the neurons. Given the close proximity between the P53 binding site and G A G A box in the promoter, we hypothesize that GBP, when form the GBP/P53 complex, wil l be able to bind to G A G A box and play a dominant role in suppressing the BTG2 transcription and that the binding of P53 to P53RE (-53A94) nearby the G A G A box may enhance the affinity of GBP to G A G A box. This mode explains the above results using BTG2 promoter constructs with a series of deletions. Although it fits well for the experimental results of BTG2 promoter activity in neurons at resting status, this mode cannot explain the up-regulation of BTG2 when the cells were stimulated with N M D A . We were hoping that under N M D A stimulation, 73 the P53 and GBP might be dissociated to relieve the suppression of G A G A site to allow P53 to bind to P53RE (-53/-94) alone and to cause enhanced transcription. Unfortunately, our co-IP results do not support this hypothesis as the association of P53 and GBP does not seem to change in neurons treated with N M D A . Therefore, other mode of action needs to be explored. Not only does P53 was found to have a suppressor activity when interacted with a putative GBP protein, it also appeared to have an enhancer function. When the putative P53RE (-53/-94) was removed by the promoter pGL3-600, which contained no G A G A box, the basal promoter activity of pGL3-600-P53 was significantly reduced, suggesting that P53 acted as an enhancer. Furthermore, when the P53RE (-53/-94) was cloned into a luciferase expression vector, the luciferase activity was significant increased and the reporter gene expression can be further elevated by N M D A stimulation. Therefore, our results clearly showed that the transcriptional regulatory function of P53 really depends on the environment of the regulatory region of a gene where its binding site is located. The neighboring D N A structure of a promoter significantly influence the consequence of P53 binding on the target gene expression. It is also worthwhile pointing out that although our immunoprecipitation experiment showed an interaction between a putative G A G A binding protein and P53, we could not be certain whether this interaction occurs at the BTG2 promoter. In addition, other mechanisms may also play important roles in regulating BTG2 expression, such as C R E B mediated activation and P53 binding to other P53 binding sites that are found on the BTG2 promoter. The latter include regions of-339 to -369, -880 to -900, -1677 to -1698, -1841 to -1871, -2523 to -2502, and -2798 to -2819 that are upstream of A T G (Figure 3.14). As previously mentioned, P53 may either transactivates or inhibits its target depending on the location of the binding sites and the presence of other transcriptional factors. Since there 74 are several putative P53 binding sites found on the BTG2 promoter, it is possible that P53 may inhibit BTG2 expression at the P53RE (-53/-94) region, but activate BTG2 expression at other putative P53 binding sites. To test this hypothesis, promoters lacking these putative P53 binding sites would have to be cloned and tested. Two possible mechanisms in which P53 act to suppress BTG2 expression are proposed. Firstly, as previously mentioned, GBP may have a repressor activity in a TATA-less promoter (like the BTG2 promoter) by reorganizing the chromatin structure allowing suppressor to bind to the D N A and to suppress transcriptional activation. Secondly, P53 has been reported to interact with the C C A A T motif and mediate transcriptional repression, such as in the case of human hsp70 promoter (Agoff et al., 1993; Isaacs et al., 1996; Wang et al., 1997). Therefore, it is possible that P53 may interact with the C C A A T motif found on the BTG2 promoter and mediate suppression. Several putative C C A A T boxes are found on the BTG2 promoter at -1355 to -1369, -1556 to -1570, -1411 to -1425, -2432 to -2446, -3221 to -3235, and -3157 to -3171 (Figure 3.14). Other putative transcriptional factors that are found on the BTG2 promoter include several activators, enhancers, and suppressors are shown in Table 3.5. It would be interesting to determine whether P53 does indeed interact with the C C A A T binding factor and mediated suppression, and whether this interaction remain true in neurons following N M D A . A recent study by Goldschneider et al (2005) showed that over-expression of an isoform of p73 (DeltaNp73alpha) lacking the N-terminal transactivation domain acted as a dominant negative suppressing the wild type P53 activity in human neuroblastoma line SH-SY5Y, and that this observation required the presence of wild type P53. More importantly, BTG2 gene was shown to be up-regulated when the P53 activity was suppressed by the DeltaNp73alpha. This observation supports our finding that P53 does indeed have a role in suppressing BTG2 expression. P73, a protein that also belongs to the 75 same family as P53, has also been shown to play a role in the induction of BTG2 (Goldschneider et al., 2004, 2005). However, this relationship remains to be seen in neurons following N M D A stimulation. 76 Table 3.1: List of Real-Time PCR primers p53 Forward TAGGATCCATGGAGGATTCACATGC Reverse CAGAATTCTCAGTCTGAGTCAGGCCCC P21 Forward CAAAGTATGCCGTCGTCTGTTC Reverse CATGAGCGCATCGCAATC Actin Forward ACGAGGCCCAGAGCAAGAG Reverse TCTCCATGTCGTCCCAGTTG 77 Table 3.2: L i s t o f p53 s i R N A s a n d s i R N A controls sequences . rat p53 siRNA Forward OATCCCCAAGACTCCAGTGGGAATCTTCTTCAAGAGAGAAGATTCCCACTGGAGTCTTTTTTTA rat p53 siRNA Reverse AGCTTAAAAAAAGACTCCAGTGGGAATCTTCTCTCTTGAAGAAGATTCCCACTGGAGTCTTGGG rat p53 siRNA control Forward GATCCCCAAGACTCCAGTGGTAATCTACTTCAAGAGAGTAGATTACCACTGGAGTCTTTTTTTA rat p53 siRNA control Reverse AGCTTAAAAAAAGACTCCAGTGGTAATCTACTCTCTTGAAGTAGATTACCACTGGAGTCTTGGG 78 Table 3.3: Methods and primers used to generate p53 dominant negatives. Primers used to generate p53 dominant negatives (enzymes are indicated in bold) p53DN_short p53DN_short_F: TAGGATCCATGGAGGATTCACAGTCGGATATGAGCATCGAGCTC CCTCTGAAGAGAGCACTGCCCACCAGCACAAGCTCCTCTCCCCAGC p53DN short R: CAGAATTCTCAGTCTGAGTCAGGCCCC p53DN_173_His • p53_F and p53DN_l 73_His_R (fragment 1) p53_F: TAGGATCCATGGAGGATTCACAGTC p53DN_l 73_His_R: CAGAGCAACGCTCATGGTGGGGCCAGtGTCTCACGAC CTCAGTCA • p53_R and p53DN_l 73_His_F (fragment 2) p53_R: CAGAATTCTCAGTCTGAGTCAGGCCCC p53DN_l73_His_F: TGACTGAGGTCGTGAGACaCTGGCCCCACCATGAGCG TTGCTCTG • Fragment 1 and 2 ligated with Ligase 79 Table 3.4: Methods and primers used to generate various lengths of BTG2 promoter into the pGL3-basic luciferase expression vector. BTG2 promoter Primers used to generate promoters (enzymes sites are indicated in red) pGL3-4200 rBF 4200: gcTTAATTAACCTCCTGCCCACACTGATA rBR: taGGATCCACCGGTGGTTGAGGAAGTA pGL3_1068 rBF 1068: cgTTAATTAAAGACAGCTCGAGGATAGAC rBR: taGGATCCACCGGTGGTTGAGGAAGTA pGL3_1068-p53 (removal of p53 consensus binding site at -53 to -94) • rDF and rDR annealed (fragment 1) rDF: CGCCTCTCTGAGGGGTAGCGGCCGGACCATCATCGTC CTGCTAATACAGCTACTTCCTCAACCACCGGTGGATCCta rDR: taGGATCCACCGGTGGTTGAGGAAGTAGCTGTATTAGCA GGACGATGATGGTCCGGCCGCTACCCCTCAGAGAGGCG • rBF 1068 and rBR3 (fragment 2) rBF 1068: cgTTAATTAAAGACAGCTCGAGGATAGAC rBR3: TACCCCTCAGAGAGGCGTGGAG • Fragment 1 and 2 ligated with Ligase pGL3_1068-GAGA (removal of GAGA box at -600 to -650) • GA F and rBR (fragment 1) GA F: atGAATTCTTTTAGGCAATTACAGAAGAGG rBR: taGGATCCACCGGTGGTTGAGGAAGTA • GA Rand rBF 1068 (fragment 2) GA R: atGAATTCTGTAATCTGGTGTGAACTGTAC rBF_1068: cgTTAATTAAAGACAGCTCGAGGATAGAC • Fragment 1 and 2 ligated with Ligase using EcoRI pGL3_1068-p53-GAGA (removal of both p53 binding site and GAGA box • rDF and rDR annealed (fragment 1) rDF: CGCCTCTCTGAGGGGTAGCGGCCGGACCATCATCGTC CTGCTAATACAGCTACTTCCTCAACCACCGGTGGATCCta rDR: taGGATCCACCGGTGGTTGAGGAAGTAGCTGTATTAGCA GGACGATGATGGTCCGGCCGCTACCCCTCAGAGAGGCG • rBR3andGA F (fragment 2) rBR3: TACCCCTCAGAGAGGCGTGGAG G A F : atGAATTCTTTTAGGCAATTACAGAAGAGG • Fragment 1 and 2 ligated with Ligase (fragment 3) • GA Rand rBF 1068 (fragment4) GA R: atGAATTCTGTAATCTGGTGTGAACTGTAC r B F l 068: cgTTAATTAAAGACAGCTCGAGGATAGAC • Fragment 3 and 4 ligated with Ligase using EcoRI pGL3_850 rBF 850: cgTTAATTAAAGTTGACCCACTCAGTAGTC rBR: taGGATCCACCGGTGGTTGAGGAAGTA pGL3_700 rBF 700: cgTTAATTAAGCAGGGAAGTGATGGAA rBR: taGGATCCACCGGTGGTTGAGGAAGTA pGL3_600 rBF 600: cgTTAATTAAAGAGGAATAATCTTCTGTGAGA rBR: taGGATCCACCGGTGGTTGAGGAAGTA 80 Table 3.5: Putative activators, enhancers, and repressors found on the BTG2 promoter within 1500bp upstream of A T G initiation site. Putative Activators Promoter Location Upstream of ATG Activator Protein 4 -132 to-148 ;-477 to -493 Signal Transducer and Activator of Transcription -401 to -419;-1128 to-1146;-1418 to -1436 Fork head Related Activator-2 (FOXF2) -746 to-762 ;-1119 to-1135 ;-1339 to -1355 cAMP-response element-binding protein -234 to -272; -565 to -585; -741 to -788; -907 to -927;-1325 to-1345 Putative Enhancers Promoter Location Upstream of ATG Winged-helix transcription factor IL-2 enhancer binding factor (ILF), forkhead box K 2 (FOXK2) -1061 to-1077 MEF3 binding site, present in skeletal muscle-specific transcriptional enhancers -1355 to-1391 L B P - l c (leader-binding protein-lc), LSF (late SV40 factor), CP2, SEF (SAA3 enhancer factor) -1570 to-1588 Putative Repressors Promoter Location Upstream of ATG Zinc finger protein insulinoma-associated 1 (IA-1) functions as a transcriptional repressor -1160 to-1172 Hey-like bHLH-transcriptional repressor -282 to -296 Hypermethylated in cancer 1, transcriptional repressor containing five Kruppel-like C2H2 zinc fingers -119 to -131 POZ/zinc finger protein, transcriptional repressor, translocations observed in diffuse large cell lymphoma -1419 to-1435 E4BP4, bZIP domain, transcriptional repressor -1325 to-1345 81 Figure 3.1: Sequences of the putative P53 binding site found on the BTG2 promoter (-50 to -100 relative to the A T G initiation site). (BamHI) (putative P53 binding site on B T G 2 promoter) ( T A T A box) (EcoRI) 5' - G O t t a a t t a a G G G G T A T O A A A A G C G C A G C C C G G G G A A A G T C C G G X j C A G A G C C C O T G A G O C T A T A T A g g a t c c T T - 3' 3' - CCaattaatt ( ' ( ' C C A I A C T T T T C G C G T C G G G C C C C II I C A G G C C C G T C T C G G G C A C T C C ' G AT A T A T c c t a g g A A - 5' 82 Figure 3.2: The location of the primers used to amplify different regions of B T G 2 promoter. r B F 106S r B F _ B 5 D r B F _ 7 0 0 r D F / r D R G A F ] ATG -10BB -850 -700 ^ G A _ R GAGA box (-590 to -656) r B R 3 -1 r B R p53 response element (-53 to -94) 83 Figure 3.3: Transfection efficiency of rat cortical neurons. Rat cortical neurons were transfected with a GFP expression viral vector (FUGW) and visualized using a fluorescence microscope 12 days following transfection. The transfection efficiency was low as 84 Figure 3.4: Real time PCR analysis of the transfection efficiency of different BTG2 promoter lengths. Various lengths of pGL3-BTG2 promoters were transfected into neurons, and the total D N A was extracted 12 days following transfection. There was no significant difference in the number of transfected plasmids between promoter lengths ranging from 600 to 4200. Transfection Efficiency of BTG2 Promoters (0 CD CO c ro 2 < z o 1.4 1.2 1 0.8 0.6 0.4 0.2 JL. pGL3-600 pGL3-1068 pGL3-1068-p53 pGL3-1068-GAGA pGL3-2246 pGL3-4200 85 Figure 3.5: Luciferase study of the basal level of BTG2 promoter activity. Various BTG2 promoter constructs are shown on the left hand side, and their corresponding luciferase activity is shown on the right. A l l of the promoter activities were compared to the pGL3-600 promoter activity for significance. Putative P53 binding site: -53 to -94 relative to the A T G site. G A G A box: -590 to -656 relative to A T G site. pGL3-SV40 promoter | |_UC GAGA Box p53 pGL34200 pGL3-2246 pGL3-1068-GAGA ~ pGL3-1068-p53-GAGA -|>GL3-1068-p53 -pGL3-1068 — PGL3-850 — B — — B — GAGA E H Luc E H Luc E H Luc GAGA p53 Luc - B -- E h p53 — M Luc E H Luc -Eh E H Luc pGL3-700 + 3 E H LUC pGL3j600-p53 pGL3450O p53 Luc E H Luc 1Q000 30000 40000 50000 60000 7D000 oo 0\ Figure 3.6: Luciferase study of the G A G A box on the SV40 promoter of pGL3-promoter vector. BTG2 promoter region -600 to -700, which included the. G A G A box, was inserted either 5' end of the SV40 promoter at B g l l l site (pGL3-promoter B5) or 3' end of the SV40 promoter at Hindl l l site (pGL3-promoter H10). The SV40 promoter activity was significantly reduced when the BTG2 promoter region containing G A G A box was present. The highest reduction in promoter activity was when the G A G A box was inserted 3' end of the SV40 promoter. c T J 05 CD a: CD to CO u. CD *^ O 3 Effect of GAGA Box on SV40 Promoter 18000 16000 14000 12000 10000 8000 6000 4000 2000 0 pGL3-promoter pGL3-promoter B5 pGL3-promoter H10 87 Figure 3.7: Luciferase study on the effect of N M D A on BTG2 promoter region containing putative P53 binding site, P53RE (-53/-94). Neurons were transfected pGL3-basic vector P53RE (-53A94) fused to a T A T A box. After 12-13 days, neurons were treated with lOuM of N M D A for lhr followed by lhr, 2hr, or 3hr recovery. Treatment with N M D A significantly induced the promoter activity containing P53RE (-53A94) from the BTG2 promoter. 2.5 M C o 33 PL, 1.5 E9 1 0.5 Effect of N M D A on P53RE (-537-94 ) _ X _ lhr 2hr 3hr Recovery Time (hr) following lhr NMDA Treatment 88 Figure 3.8: Western analysis of interaction between P53 and a putative GAGA-box binding protein. Neurons were treated with 20uM Gly ± lOuM N M D A for lhr, and the samples were prepared for an immunoprecipitation experiment. Proteins were pulled down with a hnRNP A / B antibody (an antibody that recognizes GBP, including mCAF-1), and probed with the P53 antibody and the hnRNP A / B antibody. P53 was shown to interact with the hnRNP A / B domain, and that this interaction remained following N M D A treatment (a). A Western immunoblot is shown in (b) with number ordered as follow: lane 1, 5, 6 are Gly; lane 2, 3, 4 are Gly+lOuM N M D A . This data was only done once. (a) Interaction Between p53 and a Putative GAGA-Box Binding Protein 1.1 •3 1 2 a c 0 . 9 Gly Gly+lOuM NMDA (b) 1 2 3 4 5 6 p53 hnRNP A /B 8 9 Figure 3.9: Luciferase study of the BTG2 promoter activities following N M D A treatment. Neurons were treated with 20uM Gly ± lOuM N M D A for lhr followed by 7hr of recovery. Samples were extracted and assayed for luciferase activity. pGL3-BTG2 Promoter Activities Following NMDA 1068-GAGA 140000 120000 100000 80000 - -re aj 60000 40000 20000 NMDA Treatment so o Figure 3.10: Real time PCR analysis of the effect of P53 s iRNA on P53 mRNA expression. Neurons were infected with viral vector expressing P53 s iRNA or P53 s iRNA control. P53 s iRNA was able to reduce the P53 m R N A level by -50% while the P53 s iRNA control had no effect on P53 m R N A level. E/3 txo c u 32 o < r n LT) 1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0 Effect of P53 siRNA on P53 mRNA Expression 1 ssiiiiii illll^BilPlIB 1 p53 siRNA p53 siRNA control 91 Figure 3.11: Western immunoblotting analysis of the effect of P53 s iRNA on P53 protein expression. Neurons were infected with viral vector expression P53 s iRNA or P53 siRNA control. P53 s iRNA was also able to reduce P53 protein by -50% while P53 s iRNA control also reduced the P53 protein by - 20% when compared to neurons with empty vector infection (a). A representative of the Western immunoblot is shown in (b) with the numbers ordered as follow: lane 1-4, pLentiLox3.7 empty vector infection; lane 5-8, P53 s iRNA control; and lane 9-12, P53 siRNA. (a) P 5 3 siRNA on P 5 3 Protein Expression m V a rd <_) 32 o c "S o i—. ex mt LTN d 1.2 1 0.8 0.6 0.4 0.2 0 X , , , T T 1 1 pLentiLox 3.7 p53 siRNA control p53 siRNA (b) 1 2 3 4 5 6 7 8 9 10 11 12 — ' p53 m 92 Figure 3.12: Western immunoblotting analysis of the effect of P53 s iRNA on BTG2 protein expression. Reduction in P53 protein by P53 s iRNA led to a significant increase of BTG2 protein, while P53 s iRNA control also increased the level of BTG2 protein possibly due to the non-specificity of the P53 s iRNA control (a). A representative of the Western immunoblot is shown in (b) with the numbers ordered as follow: lane 1-3, pLentiLox3.7; lane 4-6, P53 s iRNA; lane 7-9, P53 siRNA control. (a) Effect of p53 siRNA on BTG2 protein to C D c C O o a c CD -I—I O i— CL 3 2.5 2 1.5 1 0.5 0 _I_ pLentiLox 3.7 p53 siRNA p53 scrambled (b) 1 2 3 4 5 6 7 8 9 ***** -mm-- • mm &>TQ2. 93 Figure 3.13: A possible mechanism in which P53 interacts with GBP to suppress BTG2 expression. P53 first recruits G A G A binding protein(s) (a) forming a P53/GBP complex (b). At this point, it is not clear whether there are other proteins present or whether P53 interacts with GBP directly or indirectly. P53 then enhances the affinity of GBP to G A G A box by guiding the P53/GBP complex to a P53 binding site nearby the G A G A box (c). The presence of the P53/GBP complex on the BTG2 promoter then transcriptionally represses the BTG2 m R N A expression (d). 94 Figure 3.14: Schematic diagram of the putative transcription binding sites on rat B T G 2 promoter upstream of A T G . 95 3.5 BIBLIOGRAPHY Adkins N L , Hagerman T A , Georgel P (2006) G A G A protein: a multi-faceted transcription factor. Biochem Cell Biol 84:559-567. Agoff SN, Hou J, Linzer DIH, Wu B (1993) Regulation of human hsp70 promoter by p53. Science 259:84-87. Bae BI, X u H , Igarashi S, Fujimuro M , Agrawal N , Taya Y , Hay ward SD, Moran T H , Montell C, Ross C A , Snyder SH, Sawa A (2005) P53 mediates cellular dysfunction and behavioral abnormalities in Huntington's disease. Neuron 47:29-41. Banasiak K J , Haddad G G (1998) Hypoxia-induced apoptosis: effect of hypoxic severity and role of p53 in neuronal cell death. Brain Res 797:295-304. Barna M , Merghoub T, Costoya JA, Ruggero D, Branford M , Bergia A , Samori B , Pandolfi PP (2002) Plzf mediates transcriptional repression of HoxD gene expression through chromatin remodeling. Dev Cell 3:499-510. Cho Y , Gorina S, Jeffrey PD, Pavletich NP (1994) Crystal structure of a p53 tumor suppressor-DNA complex: understanding tumorigenic mutations. Science 265:346-355. Cortes U , Moyret-Lalle C, Falette N , Curiez C, Ghissassi FE, Barnas C, Morel A P , Hainaut P, Magaud JP, Puisieux A (2000) BTG2 gene expression in the p53-dependent and -independent cellular response to D N A damage. M o l Carcinog 27:57-64. Crumrine R C , Thomas A L , Morgan PF (1994) Attenuation of p53 expression protects against focal ischemic damage in transgenic mice. J Cereb Blood Flow Metab 14:887-891 Cull-Candy SG, Leszkiewicz D N (2004) Role of distinct N M D A receptor subtypes at central synapses. Sci STKE_255:rel6 Culmsee C, Zhu X , Y u QS, Chan SL, Camandola S, Guo Z, Greig N H , Mattson M P (2001) A synthetic inhibitor of p53 protects neurons against death induced by ischemic and excitotoxic insults, and amyloid beta-peptide. J Neurochem 77:220-228. Dasika G K , Lin S-CJ, Zhao S, Sung P, Tomkinson A , Lee E Y - H P (1999) D N A damageOinduced cell cycle checkpoints and D N A strand break repair in development and tumorigenesis. Oncogene 18:7883-7899. Ding HF, M c G i l l G , Rowan S, Schmaltz C, shimamura A , Fisher D E (1998) Oncogene-dependent regulation of caspase activation by p53 protein in a cell-free system. J Biol Chem 273:28378-28383. Duriez C, Falette N , Audoynaud C, Moyret-Lalle C, Bensaad K , Courtois S, Wang Q, Soussi T, Puisieux A (2002) The human BTG2/TIS21/PC3 gene: genomic structure, transcriptional regulation and evaluation as a candidate tumor suppressor gene. Gene 282:207-214. El-Deiry WS, Kern SE, Pietenpol JA, Kinzler K W , Vogelstein B (1992) Definition of a consensus binding site for p53. Nat Genet 1:45-49. Fiedler F, Mallo G V , Bodeker H , Keim V , Dagom JC, Iovanna JL (1998) Overexpression of the PC3/TIS21/B TG2 mRNA is part of the stress response induced by acute pancreatitis in rats. Biochem Biophys Res Commun 249:562-565. Fletcher BS, Lim RW, Varnum B C , Kujubu D A , Koski R A , Herschmann HR (1991) Structure and expression of TIS21, a primary response gene induced by growth factors and tumor promoters. J Biol Chem 266:14511-14518. Goldschneider D, Blanc E, Raguenez G, Barrois M , Legrand A , Le Roux G, Haddada H , Benard J, Douc-Rasy S (2004) Differential response of p53 target genes to p73 overexpression in SH-SY5Y neuroblastoma cell line. J Cell Sci 117:293-301. 96 Goldschneider D, Mil l ion K , Meiller A , Haddada H , Puisieux A , Benard J, May E, Douc-Rasy S (2005) The neurogene BTG2TIS21/PC3 is transactivated by DeltaNp73alpha via p53 specifically in neuroblastoma cells. J Cell Sci 118: 1245-1253. Gottlieb E, Oren M (1998) p53 facilitates pRb cleavage in IL-3-deprived cells: novel pro-apoptotic activity of p53. E M B O J 17:3587-3596. Granok H , Leibovitch B A , Shaffer CD, Elgin SCR (1995) Ga-ga over G A G A factor. Curr Biol 5:238-241. Gubits R M , Burke RE, Casey-Mcintosh G, Bandele A , Munell F (1993) Immediate early gene induction after neonatal hypoxia-ischemia. Brain Res Mol Brain Res 18:228-238. Ho JS, M a W, Mao D Y , Benchimol S (2005) p53-dependent transcriptional repression of c-myc is required for G l cell cycle arrest. M o l Cell Biol 25:7423-7431. Hong JW, Ryu M S , L im IK (2005) Phosphorylation of serine 147 of tis21/BTG2/pc3 by p-Erkl/2 induces Pin-1 binding in cytoplasm and cell death. J Biol Chern 280:_21256-63 Hou ST, MacManus JP (2000) Molecular mechanisms of cerebral ischemia-induced neuronal death. Int Rev Cytol 221:93-148. Huynh K D , Bardwell V J (1998) The B C L - 6 POZ domain and other POZ domains interact with the co-repressors N-Cor and SMRT. Oncogene 17:2473-2484. Imbriano C, Gurtener A , Cocchiarella F, D i Agostino S, Basile V , Gostissa M , Dobbelstein M , Del Sal G, Piaggio G, Mantovani R (2005) Direct p53 transcriptional repression. In vivo analysis of CCAAT-cotnaining G 2 / M promoters. Mol Cell boil 25:3737-3751. Isaacs RJ, Harris A L , Hickson ID (1996) Regulation of the human topoisomerase Ilalpha gene promoter in confluence-arrested cells. J Biol Chem 271:16741-16747. Ji C, Casinghino S, McCarthy T L , Centrella M (1996) Cloning, characterization, and expression of the transforming growth factor-beta type I receptor promoter in fetal rat bone cells. J Cell Biochem 63:478-490. Jung H Y Kang U G , Ahn Y M , Joo Y H , Park JB, K i m Y S (1996) Induction of tetradecanoyl phorbol acetate-inducible sequence (TIS) genes by electroconvulsive shock in rat brain. Biol Psychiatry 40:503-507. Kamada S, Miwa T (1992) A protein binding to C A r G box motifs and to single-stranded D N A functions as a transcriptional repressor. Gene 119:229-236. Lau PP, Zhu HF, Nakamuta M , Chan L (1997) Cloning of an Apobec-1-binding protein that also interacts with apolipoprotein B mRNA and evidence for an involvement in R N A deiding. J Biol Chem 272:1452-1455. Legraverend C, simar-Blanchet A E , Paul C, Sotiropoulos A , Finidori J, Le Cam A (1996) A novel growth hormone response element unrelated to STAT (signal transducer and activator of transcription)-binding ites is a bifunctional enhancer. Mol Endocrinol 10:1507-1518. Lehmann M (2004) Anything else but G A G A : a nonhistone protein complex reshapes chromatin structure. Trends in Genet 20:15-22. Leverrier S, Cinato E, Paul C, Derancourt J, Bemark M , Leanderson T, Legraverend C (2000) Purification and cloning of type A / B hnRNP proteins involved in transcriptional activation from the rat spi2 gene G A G A box. Biol Chem 38:1031-1040. L i Y , Schlamp C L , Poulsen G L , Jacosn M W , Griep A E , Nickells R W (2002) p53 regulates apoptotic retinal ganglion cell death induced by N-methyl-D-aspartate. Mol Vis 8:314-50. L im IK, Lee M S , Ryu M S , park TJ, Fujiki H , Eguchi H , Paik W K (1998) Induction of growth inhibition of 293 cells by downregulation of cyclin E and cyclin-dependent kinase 4 proteins due to overexpression of TIS21. M o l Carcinog 23:25-35. 97 Lin T, Chao C, Saito S, Mazur SJ, Murphy M E , Appella E, X u Y (2005) p53 induces differentiation of mouse embryonic stem cells by suppressing Nanog expression. Nat Cell Biol 7:165-171. Lu J, Moochhala S, Kaur C, Ling E (2000) Changes in apoptosis-related protein (p53, Bax, Bcl-2 and Fos) expression with D N A fragmentation in the central nervous system in rats after closed head injury. Neurosci Lett 290:89-92. Matlnspector professional 7.4.1 (Dec, 2006) http://www.genomatix.de/online_help/help_matinspector/matinspector_help.html. McGahn L , Hakim A M , Robertson GS (1998) Hippocampal Myc and p53 expression following transiet global ischemia. Brain Res M o l Brain Res 56:133-145. Miyashita T, Harigai M , hanada M , Reed JC (1994) Identification of a p53-dependent negative response element in the bcl-2 gene. Cancer Res 54:3131-3135. Moran E (1993) interaction of adenoviral proteins with pRB and p53. F A S E B J 7:880-885. Morrison RS, Kinoshita Y (2000) The role of p53 in neuronal cell death. Cell Death Differ 7:868-897. Murphy M , Ahn J, Walker K K , hoffman, W H , Evans R M , Levine A J , George D L (1999) Transcriptional repression by wild type p53 utilizes histone deacetylases, mediated by interaction with mSin3a. Genes Dev 13:2490-2501. Napieralski JA, Raghupathi R, Mcintosh T K (1999) The tumor-suppressor gene, p53, is induced in injured brain regions following experimental traumatic brain injury. Brain Res M o l Brain Res 71:78-86. Petrascheck M , Escher D, Mahmoudi T, Verrijzer CP, Schaffher W, Barberis A (2005) D N A looping induced by a transcriptional enhancer in vivo. Nucleids Acids res 33:3743-3750. Polyak K , X i a Y , Zweier JL, Kinzler K W , Vogelstein B (1997) A model for p53-induced apopotisis. Nature 389:300-305. Roperch JP, Alvaro V , Prierur S, Tuynder M , Nemani M , Lethorosne F, Piouffre L , Gendron M C , Israeli D, Dausset J, Oren M , Amson R, Teleman A (1998) Inhibition of presenilin 1 expression is promoted by p53 and p21WAF-l and results in apoptosis and tumor suppression . Nat Med 4:835-838. Rouault JP, Falette N , Guehennuux F, Guillot C, Rimokh R, Wang Q, Berthet C, Moyret -Lal le C, Savatier P, Pain B , Shaw P, Berger R, Samarut J, Magaud JP, Ozturk M , Samarut C, Puisieux A (1996) Idnetification of BTG2, an antiproliferative p53-dependent component of the D N A damage cellular response pathway. Nat Genet 14:482-486. Ryu M S , Lee M S , Hong JW, Hahn TR, Moon E, Lim IK (2004) TIS21/BTG2/PC3 is expressed through PKC-delta pathway and inhibits binding of cyclin Bl -Cdc2 and its activity, independent of p53 expression. Exp Cell Res 299:159-70. Schuler M , Bossy-Wetzel E, Goldstein JC, Fitzgerald P, Green D R (2000) p53 induces apoptosis by caspase activation through mitochondrial cytochrome c release. J boil Chem 275:7337-7342. Shaulian E, Zauberman A , Ginsberg D, Oren M (1992) Identification of a minimal transforming domain of p53: negative dominance through abrogation of sequence-specific D N A binding. M o l Cell Biol 12:5581-5592. Tirone F (2001) The gene PC3(TIS21/BTG2), prototype member of the PC3/BTG/TOB family: regulator in control of cell growth, differentiation, and D N A repair? J Cell Physiol 187:155-165. Wang Q, Zambetti GP, Suttle DP (1997) Inhibition of D N A topoisomerase II alpha gene expression by the p53 tumor suppressor. Mol Cell Biol 17:389-397. 98 Willis A , Jung EJ, Wakefield T, Chen X (2004) Mutant p53 exerts a dominant negative effect by preventing wild-type p53 from finding to the promoter of its target genes. Oncogene 23:2330-2338. Xiang H , Kinoshita Y , Knudson C M , Korsmeyer SJ, Schwartzkroin P A , Morrison RS (1998) Bax involvement in p53-mediated neuronal cell death. J Neurosci 18:1363-1373. Zhang Y , Wang JS, Chen L L , Zhang Y , Cheng X K , Heng F Y , Wu N H , Shen Y F (2004) Repression of hsp90beta gene by p53 in U V irradiation-induced apoptosis of ZJurkat cells. J Biol Chem 279:42545-42551. 99 4 CONCLUDING CHAPTER Understanding the mechanisms in which neurons activate pro-survival pathways following excitotoxicity wil l help us to understand more about how the brain respond to cellular stress, and most of all, design therapeutic strategies against several neurodegenerative diseases. One of the key proteins, as suggested by others and from our experiments, that may play a role in protecting neurons from excitotoxicity-induced cell death is BTG2. BTG2 was found to be induced following activation of N M D A R , and that this induction maybe part of the pro-survival pathway in response to excitotoxicity. The increase in Cycl inDl expression following N M D A treatment in BTG2 knocked down neurons further supports that idea that BTG2 may exerts its neuro-protective function through down regulation of cell cycle proteins. It remains to be seen whether BTG2 exerts its neuro-protective activity by regulating other cell cycle proteins. In order to further understand how BTG2 plays a role in the pro-survival signaling pathway, both the signaling pathways activated by N M D A R and the BTG2 downstream targets need to be studied. Since a lot of the studies focus on the role of BTG2 inside the nucleus, it would be interesting to determine the functions of BTG2 in the cytoplasm and its interacting proteins. The use of BTG2 knock out mice would certainly help to discover the role of BTG2 in neurons following excitotoxicity. Analysis of the BTG2 promoter revealed several interesting observations that are important to the regulation of BTG2 expression. P53 appeared to have both enhancer and suppressor activity depending on the presence of other transcriptional factors and the genomic location of its targets. Although we did not determine the element(s) responsible 100 for the basal expression and the inducibility following N M D A in the BTG2 promoter, we observed a possible interaction between P53 and G A G A binding proteins that act to suppress basal BTG2 expression. , While our results demonstrated that P53 suppresses BTG2 expression, other transcriptional factors may also regulate BTG2 expression. In addition, the N M D A response element(s) that up-regulates BTG2 promoter activity following N M D A treatment remains to be determined, which not only wil l help us understand more about the complex protein interactions important for the survival of the cells, but also provide clues as to the real functions of BTG2 following cellular stress. 101 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0101308/manifest

Comment

Related Items