Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Roles of Confined Placental Mosaicism (CPM) and H19/IGF2 imprinting in pregnancies derived from intracytoplasmic… Hatakeyama, Chiho 2007

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2007-0113a.pdf [ 8.76MB ]
Metadata
JSON: 831-1.0101287.json
JSON-LD: 831-1.0101287-ld.json
RDF/XML (Pretty): 831-1.0101287-rdf.xml
RDF/JSON: 831-1.0101287-rdf.json
Turtle: 831-1.0101287-turtle.txt
N-Triples: 831-1.0101287-rdf-ntriples.txt
Original Record: 831-1.0101287-source.json
Full Text
831-1.0101287-fulltext.txt
Citation
831-1.0101287.ris

Full Text

R O L E S OF C O N F I N E D P L A C E N T A L M O S A I C I S M ( C P M ) A N D H19/IGF2 I M P R I N T I N G I N P R E G N A N C I E S D E R I V E D F R O M I N T R A C Y T O P L A S M I C S P E R M I N J E C T I O N (ICSI) by C H L H O H A T A K E Y A M A B . Sc., The University of British Columbia, 2003 A THESIS S U B M I T T E D I N P A R T I A L F U L F I L L M E N T OF T H E R E Q U I R E M E N T S F O R T H E D E G R E E OF M A S T E R OF S C I E N C E . i n The Faculty of Graduate Studies (Reproductive and Developmental Science) T H E U N I V E R S I T Y OF B R I T I S H C O L U M B I A January, 2007 © Chiho Hatakeyama, 2007 Abstract In contrast to the success of ICSI in treating male infertility, concerns have been raised about the health outcomes of the children conceived through this procedure. Cohort studies have shown that the ICSI population has an increase in low birth weight ( L B W ) , birth defects, chromosomal abnormalities, and imprinting disorders. However, the underlying causes remain unknown. Two potential risk factors for these negative pregnancy outcomes, particularly for L B W , were investigated in this study - Confined Placental Mosaicism ( C P M ) and epigenetic defects at the differentially methylated region ( D M R ) of H19/IGF2. C P M was examined in vi l l i from thirty post-delivery placentas derived from ICSI after confirming a normal karyotype in cord blood. Subsequently, the parental origin was determined in detected C P M as well as in non-mosaic chromosomal abnormalities ascertained through spontaneous abortions. When a paternal origin was confirmed, aneuploidy in sperm from the father was investigated. Finally, methylation pattern at two C p G sites from the D M R of H19/IGF2 was quantitatively analyzed in placentas from ICSI pregnancies with L B W (n=10) and with normal B W (n=12). Placentas from natural conceptions (n=14) served as controls. Among the thirty placentas, one monosomy X case was detected from a conceptus with a normal blood karyotype and pregnancy outcomes. Thus, the incidence of C P M was 3.3% in the study population, which is not significantly different from the rate observed in the general population (6.0%). A paternal origin was revealed in one out of four cases, which include chromosome abnormalities derived from C P M (n=2) and spontaneous abortions (n=2). In the paternally inherited t(13;21) case, 88.39%) of the sperm were normal or balanced, and 7.29%> were nullisomic or disomic for chromosome 13 and 21. In methylation analysis, differences were not found among the three groups; however, hypomethylation (<33%>) was exclusively detected from the I C S I - L B W group. Taken together, the roles of C P M and epigenetic alteration at the D M R of H19/IGF2 were not apparent in ICSI pregnancies studied, regardless of the pregnancy outcomes. However, due to the limited sample size, we cannot exclude the possibility that these factors may play a role in certain cases that were not included in the present study. Table of Contents Abstract •  i i Table of Contents : i i i List of Table v i i List of Figures vi i i List of Abbreviations 1 X Acknowledgements x l CHAPTER 1 Introduction. 1 1.1 Human reproduction 1 1.1.1 Basics of cell divisions and possible errors 1 1.1.1.1 Mitosis 1 1.1.1.2 Meiosis 2 1.1.1.3 Aneuploidy formation 2 1.1.2 Gametogenesis 5 1.1.2.1 Oogenesis 6 1.1.2.2 Spermatdgenesi s 7 1.1.3 Fertilizatidn and implantatidn 8 1.2 Male Infertility .... 9 1.2.1 Overview of male infertility 9 1.2.2 Genetic causes for male infertility ..: 9 1.2.2.1 Chromosomal abnormalities... 10 1.2.2.1.1 Somatic chromosomal abnormalities. 10 1.2.2.1.2 Germ line specific abnormalities 11 1.2.2.2 Other genetic causes for male infertility 13 1.2.2.2.1 Cystic fibrosis . 13 1.2.2.2.2 Y-chromosome microdeletion..... 13 1.2.2.2.3 Sperm D N A fragmentation 14 1.3 Intracytoplasmic sperm injection (ICSI) = ,...15 1.3.1 Development of assisted reproductive technologies proceeding ICSI 15 1.3.2 Clinical practice of ICSI 16 1.3.3 Pregnancy outcomes of ICSI. . : 17 1.3.3.1 Reduced birth weight in ICSI 17 1.3.3.2 Spontaneous abortion 20 1.3.3.3 Chromosomal abnormalities 21 1.3.3.4 Imprinting disorders 24 1.4 Confined placental mosaicism 26 1.4.1 Normal placental development and functions 27 1.4.1.1 Development of the placenta 27 1.4.1.2 Placental functions : 28 1.4.2 Pathogenesis of C P M 30 1.4.3 Ascertainment of CPM 32 1.4.4 Outcomes of pregnancy affected by C P M 33 1.4.4.1 Uniparental disomy and C P M 33 L4.4.2 Pregnancy loss and C P M 34 1.4.4.3 Intrauterine growth restriction ( IUGR) and C P M 35 1.5 Genomic Imprinting 38 1.5.1 Imprinted genes and human health 38 1.5.2 Epigenetic regulation o f imprinted genes 40 1.5.3 Genomic imprinting in the placenta 43 1.5.4 H19/IGF2 ; 45 1.5.5 Imprinting aberration and ICSI 49 1.6 Hypothesis and objectives 51 1.7 Bibliography 53 CHAPTER 2 Confined placental mosaicism in term placentas derived from ICSI pregnancies 70 2.1 Introduction 70 2.2 Materials and methods 71 2.2.1 Sample collection 71 2.2.2 Tissue preparation and D N A extraction 71 iv 2.2.3 Karyotyping 72 2.2.4 Comparative genomic hybridization ( C G H ) 72 2.2.5 F low cytometry .' 75 2.2.6 Fluorescent in situ hybridization (FISH).... , 76 2.2.7 Molecular analysis 77 2.3 Results • 78 2.3.1 Clinical outcomes 78 2.3.2 Detection of C P M in ICSI pregnancies 79 2.3.2.1 C P M detected by C G H 79 2.3.2.2 Confirmation of C P M by F I S H 82 2.3.2.3 Confirmation of C P M by molecular analysis 83 2.3.2.4 Ploidy determination by flow cytometry 84 2.4 Discussion and conclusion 86 2.5 Bibliography 90 CHAPTER3 Origin of chromosomal abnormalities in conceptus derived from ICSI 93 3.1 Introduction 93 3.2 Materials and methods 94 3.2.1 Clinical information.. 94 3.2.2 Gendtyping for the origin of chromosomal abnormality 95 3.3 Results 96 3.4 Discussion and conclusion 99 3.5 Bibliography 100 C H A P T E R 4 Meiotic segregation patterns and aneuploidy rate in sperm from a father of a Robertsonian translocation t(13;2l) 102 4.1 Introduction 102 4.2 Materials and methods 103 4.2.1 Clinical information 103 4.2.2 Fluorescent in situ hybridization (FISH) ...104 4.3 Results 105 4.3.1 ICSI outcomes 105 4.3.2 F I S H on sperm 106 4.4 Discussion and conclusion 107 4.5 Bibliography H O CHAPTER 5 Methylation statuses at the differentially methylated domain o f H19IIGF2 in placentas derived from ICSI pregnancies 112 5.1 Introduction ....112 5.2 Materials and methods 114 5.2.1 Clinical information 114 5.2.2 Methylation sensitive-single nucleotide primer extension (Ms-SNuPE) 114 5.3 Results . 117 5.4 Discussion and conclusion 123 5.5 Bibliography.. 125 CHAPTER 6 Summary and conclusion 128 5.1 Summary • 128 5.2 Conclusion 130 5.3 Bibliography 131 vi List of Tables Table 1.1 Rates of low birth weight ( L B W ) and very low birth weight ( V L B W ) in ICSI and natural pregnancies for singletons and twins 19 Table 1.2 Prenatal diagnoses in ICSI pregnancies 22 Table 1.3 Summary o f imprinting disorders in the A R T population 26 Table 1.4 Fatal loss and C P M 34 Table 1.5 C P M ascertained from abnormal C V S in foetuses with I U G R 35 Table 1.6 C P M in term placentas 37 Table 1.7 Common imprinting disorders found in human 39 Table 1.8 Examples of imprinted genes and their functions 43 Table 2.1 Clinical information for term pregnancies 78 Table 2.2 L B W in singletons and twins in ICSI pregnancies compared with controls 79 Table 2.3 Summary of C G H results 79 Table 2.4 Confirmation of the 45, X abnormality ascertained thought C P M by F I S H 82 Table 2.5 Summary of peak ratios for all tissues tested by P C R 83 Table 2.6 Summary of polyploidy detected by flow cytometry 86 Table 2.7 Confirmation of polyploidy by F I S H 86 Table 2.8 Summary o f C P M rate in the previous study, the current study, and the combined data 89 Table 3.1 Clinical information 95 Table 3.2 Parent-of-origins for chromosomal abnormalities found in ICSI conceptuses....96 Table 4.1 ICSI clinical outcomes of the t( 13 ;21) case 105 Table 4.2 Meiotic segregation analysis for chromosome 13 and 21 for t(13;21) case 106 Table 4.3 Analysis of I C E for chromosome 18, X and Y in the tl3;21 case 106 Table 5.1 Primer sequences 117 Table 5.2 Summary of the incidence of hypomethylation in the study groups 121 List of Figures Figure 1.1 Aneuploidy due to mitotic non-disjunction ..' 3 Figure 1.2 Aneuploidy due to meiotic non-disjunction and its consequence upon fertilization 4 Figure 1.3 Basic scheme of gametogenesis in males and females 5 Figure 1.4 Development of placental tissues 27 Figure 1.5 Three types of confined placental mosaicism ( C P M ) 30 Figure 1.6 Methylation reprogramming in germ lines and in preimplantation embryos 42 Figure 1.7 Schematic structures ofH19 and Ig/2 (a) and the chromatin loop model (b) 46 Figure 1.8 Differentially methylated region at H19/IGF2 47 Figure 2.1 Schematics of Comparative Genomic Hybridization ( C G H ) 74 Figure 2.2 Balanced C G H profiles for (a) a normal female and (b) a normal male 80 Figure 2.3 C G H profile of the abnormal site from SM04-69 81 Figure 2.4 F I S H confirmation of the cytogenetic abnormality (monosomy X ) 82 Figure 2.5 A B I results representing (a) normal tissues (b) a mosaic monosomy X and (c) a non-mosaic monosomy X 83 Figure 2.6 A t y p i c a l flow cytometry result representing diploidy 84 Figure 2.7 F low cytometry results representing (a) triploidy and (b) tetraploidy 85 Figure 2.8 Confirmation of previously detected abnormal case with a gain of 7q31>qter and loss of Xp21 >pter by C G H using mixed trophoblast and mesenchymal D N A ....87 Figure 5.1 The sequence of the 6 t h C T C F binding site of the D M R of H19IIGF2 116 Figure 5.2 Schematics of SNuPE assay 116 Figure 5.3 Reproducibility of the M s - S N u P E assay and the effect of D N A purity on methylation assessment 118 Figure 5.4 Correlation between the level of methylation at CIO and C12 119 Figure 5.5 Methylation patterns measured at the D M R oiH19IIGF2 120 Figure 5.6 Average methylation at the D M R of H19IIGF2 120 Figure 5.7 Methylation patterns of the trophoblast and the mesenchyme in controls 122 Figure 5.8 Methylation patterns of the trophoblast and the mesenchyme in the I C S I - L B W group.. 122 List of Abbreviations A D P Adenosine diphosphate A R Androgen receptor A R T Assisted reproductive technologies A S Angelman Syndrome A Z F Azoospermia factor region B W Birth weight B W S Beckwith-Wiedemann Syndrome C Cytosine C B A V D Congenital bilateral absence of vas deferens C C D Charge-coupled device C F Cystic fibrosis C F T R Cystic fibrosis trans-membrane conductance regulator C G H Comparative genomic hybridization C P M Confined placental mosaicism C T C F CCCTC-bind ing factor C V S Chorionic villus sampling D A P I 4',6-Diamidine-2'-phenylindole D M R Differentially methylated region D N A Deoxyribonucleic acid D N M T D N A methyltransferase D S A 3,5-Di-iodosalicytic acid D T T Dithiothreitol E D T A Ethylenediamine tetra-acetic acid E E M Extraembryonic mesoderm E M Embryonic lineage E X Extraembryonic lineage F Forward F I S H fluorescent in situ hybridization F I T C fluorescein-12-dUTP F S H Follicle stimulating hormone G n R H Gonadotropin-releasing hormone H B S S Hank's Balanced Salt Solution h C G Human chorionic gonadotropin H D A C hi stone deacetylase H T F Human tubal fluid IC ICSI controls I C E Interchromosomal effects ICSI Intracytoplasmic sperm injection IGF2 Insulin-like growth factor 2 LL I C S I - L B W I U D Intrauterine death I U G R Intrauterine growth restriction I V F In vitro fertilization I V M In vitro maturation L H Luteinizing hormone ix L T C Long term culture M E S A Microsurgical epididymal sperm aspiration Mesen Mesenchyme M I Meiosis I M i l Meiosis II M P I Maintenance of paternal imprint M s - S N u P E Methylation sensitive Single Nucleotide Primer Extension N A Not available N C Natural conceptions No . Number N O A Non-obstructive azoospermia N S Not significant O A Obstructive azoospermia O A T Oligoasthenoteratozoospermia O M I M Online Mendelian Inheritance in M a n P Short chromosome arm P A G E Polyacrylamide P A R Pseudoautosomal region P B S Phosphate Buffered Saline P C R polymerase chain reaction P H A phytohaemagglutinin PP Placental protein P Z D Partial zona dissection q Long chromosome arm R Reverse R N A Ribonucleic acid R T Robertsonian translocation S A Spontaneous abortion SD Standard deviation SDS Sodium dodecyl sulphate S G A Small for gestational age SRS Silver-Russell syndrome S R Y Sex-determining region Y SSC . Sodium chloride sodium citrate S T C Short term culture SUZI Subzonal insemination T E T r i s - E D T A T E S E Testicular sperm extraction T R I T C Tetramethylrhodamine-5-dUTP Troph Trophoblast U B E 3 A Ubiquitin protein ligase E 3 A U P D Uniparental disomy U S United States W H O World Health Organization W K Week Acknowledgements I would like to thank my supervisor, Dr. Sai M a , for her continuous guidance and encouragement throughout the project. I want to thank Dr. Wendy Robinson, who is my co-mentor in the Interdisciplinary Women's Reproductive Health ( IWRH) program, for all her friendly support and constructive criticism on my work. I am also grateful to the other committee members, Dr. Basil Ho Yuen and Dr. Helene Bruyere, for their knowledgeable comments and discussions. I want to express my gratitude to Dr. Zakaria Hmama and Dr. Nobuaki Ozawa for their technical support. I am very thankful to Steven Tang for proofreading the manuscript and to Agata Minor for her technical assistance and useful discussions. They have also offered me friendship and support at every stressful moment in my graduate study. M y warm thanks also go to Edgar Chan Wong, K y l e Ferguson, Sina Sakian, Ruby Jiang, and Mar ia Penaherrera for their support and friendship. Finally, I owe the warmest and deepest thanks to my mom for always being there to give me unconditional love and support. xi CHAPTER 1. Introduction 1.1 Human reproduction 1.1.1. Basics of cell divisions and possible errors Human reproduction involves two major processes - gametogenesis and fertilization/implantation (Carslon, 2004). These events comprise a series of cell divisions, namely, mitosis and meiosis. Somatic cell divisions and multiplication of the germinal stem cells are facilitated through mitosis. Meiosis, unique to gametogenesis, reduces the number of the chromosome complement from diploid to haploid in the gametes. Both mitosis and meiosis are subjected to formation of aneuploidy i f proper segregation of chromosomes fails. 1.1.1.1. Mitosis Mitosis is the basic mechanism of cell proliferation, by which a single parent cell gives rise to two genetically identical daughter cells. There are four stages in mitosis -prophase, metaphase, anaphase, and telophase. During prophase, the chromatin, which was duplicated prior to mitosis, condenses into chromosomes, each consisting of two identical chromatids held together by a centromere. As the nuclear envelope dissolves, centriosomes migrate to opposite sides o f the nucleus and begin to develop the mitotic spindle. At metaphase, following prophase, the growing spindle microtubules start to interact with chromosomes and align them on the equator of the spindle. Anaphase begins with the separation o f centromeres, which leads to a splitting of sister chromatids into individual daughter chromosomes. These daughter chromosomes move toward opposite poles of the spindle as the kinetochore microtubules shorten. Once chromosomes reach the poles, the cell enters telophase, when the nuclear envelop reforms and chromosomes uncoil back into chromatin. Simultaneously, cytokinesis occurs, which splits the cytoplasm into two compartments and completes the formation of two daughter cells (Mil ler and Therman, 2001). 1 r. 1.1.2 Meiosis Meiosis is a process of cell division by which chromosome number is reduced from diploid (2n) to haploid (n). It comprises of two successive nuclear divisions, meiosis one (MI) and meiosis two ( M i l ) . Prior to meiosis, each chromosome is replicated to form two identical sister chromatids in interphase. M I then begins, and consists of four stages: prophase, metaphase, anaphase, and telophase (Alberts et al., 1983). M I is also called reductive division because the chromosome complement is reduced from 2n to n. At prophase of M I , replicated homologous chromosomes pair, mediated by a protein structure known as the synaptdnemal complex, and recombination occurs between non-sister (from different parents) chromatids. The recombination sites, also known as chiasmata, play an additional role of keeping the two homologous chromosomes together throughout prophase I. After Prophase I, homologous chromosomes are aligned at the equatorial plate in metaphase I, and then separate during anaphase I. Subsequently at telophase I, two' daughter cells are formed, each containing a haploid (n) number of chromosomes (Mil ler and Therman, 2001). In M i l , the two chromatids in each chromosome are further separated, without an intervening round of D N A replication. The end product of meiosis is four haploid (n) daughter cells (Miller and Therman, 2001). Meiosis in spermatogenesis gives rise to four functional spermatozoa; whereas in oogenesis, only one daughter cell becomes a functional • oocyte and the rest degrades eventually (Elder and Dale, 2001). 1.1.1.3 Aneuploidy formation Aneuploidy arises from segregation errors during mitosis and meiosis. The predominant mechanism for aneuploidy is non-disjunction, in which homologous chromosomes or chromatids migrate to the same nuclear pole (Hassold and Hunt, 2001). Alternatively, anaphase lag, which is a failure to incorporate a chromosome into the daughter cells, can also generate aneuploidy, specifically monosomy (Warburton 1987). Mitotic non-disjunction, occurring in post-zygotic somatic cells, results from sister chromatids failing to separate at anaphase. Mitotic non-disjunction leads to a mixed population of trisomic and mono'somic cells (Figure 1.1). Meiotic non-disjunction occurs 2 during gametogenesis at either anaphase I or II. When a resulting nullisomic or disomic gamete (gametes being normally monosomic. for each chromosome) is involved in fertilization, an aneuploid zygote is produced (Figure 1.2). M I non-disjunction has been suggested to result from reduced recombination (Hassold and Hunt, 2001). It has been reported that 85% of 47, X X Y cases result from failure of recombination between the pseudoautosomal region of the X and Y chromosomes (Hassold et al, 1991). The effect of reduced recombination on aneuploidy is also evidenced in small chromosomes, which contain fewer recombination sites (Thomas et al, 2000; Cupisti et al, 2003). In addition to the reduction or absence of recombination, a position shift of chiasmata toward the centromere has also been suggested to cause a M I non-disjunction (Hassold et al, 1995). M i l non-disjunction occurs through a mechanism similar to that of mitotic non-disjunction: by chromatid separation failure. Interestingly, recombination errors is also thought to be responsible for M i l non-disjunction i f the pericentromeric exchange is present, as seen in trisomy 21 cases (Lamb et al, 1996). The most common origin for autosomal trisomy in human, detected predominantly in spontaneous abortions, is a maternal M I non-disjunction. This becomes more prevalent with age; thus, suggesting that the spindle or chiasmata holding the chromosomes in place may deteriorate during the prolonged M I arrest in females (Hawley et al, 1994; Lamb et al, 1996). Nevertheless, sex chromosome aneuploidy has been linked to paternal errors, presumably due to limited pairing regions between the X and Y chromosomes (Ma et al, 2006). A paternal age effect on segregation errors has yet to be determined (Nicolaidis and Petersen, 1998). Figure 1.1 Aneuploidy due to mitotic non-disjunction. Failure of sister chromatid separation leads to a monosomic and a trisomic cell. (www.medgen.ubc.ca/wrobinson/mosaic/mos_how.htm) /111 \ \ a) Generation of aneuploid gametes due to meiotic non-disjunction M I non-disjunction M i l non-disjunction V f I \ fx \J1 / it * / T v /It t b) Generation of aneuploid zygotes upon fertilization / / \ J 3& •****' SI mmm zygote a « 45 Figure 1.2 M I non-disjunction leads to disomic and nullisomic gametes, whereas M i l non-disjunction results in normal haploid, hyperploid, and hypoploid gametes, b) Fertilization of a disomic gamete with a normal gamete results in a trisomic zygote; fertilization of a nullisomic gamete with a normal gamete results in a monosomy zygote. (Modified from www.medgen.ubc.ca/vvrobinson/mosaic/mos_how.htm). 4 1.1.2 Gametogenesis Gametogenesis is a series of changes by which diploid germ cells transform into specialized haploid gametes, i.e. oogenesis in the female and spermatogenesis in the male (Figure 1.3). Gametogenesis consists of four typical phases: (l)migration of primordial germ cells, the precursors of gametes, to the gonad (2) mitotic division of germinal stem cells (3) reduction to haploid by meiosis (4) Structural and functional maturation (Carlson, 2004). Spermatogonia (2roO Testis \ Primordial germ cell enter gonad V Mitosis 1* spermatocytes (2n) T spermatocyte • is Spermatids.*/ \ , . (n) mmm ) I I I f (") Oogania {2n> Ovary Growth and differentiation ,,:„„:- £mk is mi mmm. .mm /Si.- r'N •{. Mature spermatozoa m) I Mefosls I Ii i Meiosis II ;Toocyte\ Maturation /uam&\ 2 n -£°oocyte\ iiiiiiiiiiif i 1* (n) ( j , 2 n d ( n i Polar bodies Figure 1.3 Basic scheme of gametogenesis in males and females. 5 1.1.2.1 Oogenesis Oogenesis begins in the developing ovary at approximately the eighth week of gestation. Primordial germ cells become oogonia as they enter the ovary. Oogonia undergo a period of intensive mitotic division from the second to the fifth month of gestation, increasing their number from a few thousand to about seven million. However, most of them degenerate through a process known as atresia, which continuously decrease the number of germ cells until menopause. B y the fifth month of gestation, all the surviving oogonia develop into primary oocytes as they enter the first meiotic division (Elder and Dale, 2001). Meiosis, however, halts in the diplotene stage of prophase I until just prior to ovulation at puberty. During this extended period, the primary oocytes become surrounded by zona pellucida and cortical granules, and actively synthesize and store bio-molecules required for development. As primary oocytes grow, they become further enveloped by layers of follicle cells such as granulosa and theca cells. The primary oocytes together with their surrounding follicle cells become primary follicles. Nutrients and meiosis inhibiting substances enter the primary follicles, and allow the oocytes to grow in size while remaining at prophase of M I (Alberts et al, 1983). At puberty, follicular maturation and ovulation are regulated by pituitary gonadotropins, namely follicle stimulating hormone (FSH) and luteinizing hormone (LH) , which are in turn controlled by gonadotropin hormone releasing hormone (GnRH) produced from the hypothalamus. At the beginning of each menstrual cycle, the low level of circulating estrogen and progesterone leads to an increased release of F S H and L H as part of the negative feedback system. F S H enhances the production of granulosa cells and the development of follicles to fluid-filled secondary follicles. L H stimulates the theca cells to secret androgens, which are subsequently converted to estrogen by the granulosa cells. In response to the peak of estrogen production around the time that follicles reach maturity, a surge of L H is induced, which initiates ovulation by disrupting the supplement of nutrients and meiosis inhibiting factors to the ovulating follicles. This allows the oocyte to resume meiosis, and complete M I with extrusion of the first polar body. However, the oocyte is arrested again at metaphase of M i l until fertilization (Alberts et al, 1983). 6 1.1.2.2 Spermatogenesis Testicular development begins in male embryos after the arrival of primordial germ cells to the genital ridge and expression of the sex-determining region Y ( S R Y ) gene is initiated. However, unlike oogenesis, the onset of spermatogenesis comes at puberty when the level of F S H and L H is elevated (Elder and Dale, 2001). Also, in contrast to the prolonged process of oogenesis, each cycle of spermatogenesis is estimated to take approximately 64 days (Carlson 2004). Spermatogenesis occurs in the seminiferous tubules of the testis and consists of three major stages - spermatogoniogenesis, meiosis, and spermiogenesis. Spermatogoniogenesis begins with successive mitotic divisions of type A spermatogonia at the basal compartment of the seminiferous epithelium. In contrast to oogenesis, this mitotic proliferation continues throughout life in males. During each wave of mitosis, about 40% of the undifferentiated type A spermatogonia cells succumb to apoptotic cell death, while the remaining continue to proliferate. Some of the surviving type A spermatogonia develop into type B spermatogonia, which differentiate into meiotic preleptdtene primary spermatocytes. These primary spermatocytes move into the adluminal compartment and enter into meiosis. After the first meiotic division, two secondary spermatocytes are produced from each primary spermatocyte. Subsequently, the two secondary spermatocytes divide into four immature haploid spermatids by the second meiotic division (Alberts et al. 1983; Carlson, 2004). Meiosis of spermatocytes is thought to possess a more stringent selection over meiotic errors than in oogenesis. Two additional checkpoints, pachytene checkpoint and spindle assembly checkpoint, assure D N A quality, chromosome alignment, and spindle integrity (Hunt and Hassold, 2002). Upon the completion of meiosis, spermatids undergo a differentiation process called spermiogenesis to become mature spermatozoa. Spermiogenesis involves a series of morphological changes such as condensation of chromatin by replacing histones with protamines, acrosome development, formation of middle piece and tail, and removal of majority of the cytoplasm. The mature spermatozoa migrate from the seminiferous tubules to the epididymis, where they obtain the last modification, a glycoprotein coat, at which point, the spermatozoa are finally ready to fertilize oocytes (Carlson, 2004). 7 1.1.3 Fertilization and implantation Fertilization takes place in the fallopian tube one or two days after an ovum is released (Norwitz et al, 2001). Prior to fertilization, sperm are further capacitated by secretions in the female genital tract including the removal of the epididymal and seminal plasma protein coating, and an alteration in the glycoproteins in the sperm plasma membrane. As the first sperm attaches to the zona pellucida, the contents of its acrosome, mainly enzymes, are released to assist in the penetration of the ovum and to initiate a series of chemical reactions. Depolarization was induced by activating potassium channels by the spermatozoon, resulting in an outward current in the oocyte plasma membrane. Meanwhile, a cortical reaction occurs, which induces a calcium influx into the ooplasm arid a structural change in the surface glycoprotein. Both the depolarization and cortical reactions prevent other sperm from fertilizing the ovum (Elder and Dale, 2001). As mentioned earlier, fertilization triggers the completion of meiosis and the formation of an ovum containing the haploid female pronucleus and a second polar body, which eventually degenerates. Fertilization also transforms the sperm nucleus to a male pronucleus by breaking down the sperm nuclear envelop, decondensing the chromatin, and reforming a pronuclear envelop. The completion of fertilization is marked by the fusion of the two pronuclei and the formation of a zygote (fertilized ovum). After fertilization, the zygote increases its mass by mitotic divisions and develops into a morula in approximately three days. The morula travels down the fallopian tube to the uterine cavity, and further develops into a blastocyst, which implants into the uterine lining (Carlson, 2004). After implantation, the different cell lineages in the blastocyst develop into embryo and placenta, which grow dependent on the maternal nourishment and eventually lead to a birth (Elder and Dale, 2001). 8 1.2 Male infertility 1.2.1 Overview of male infertility The chance for a fertile couple to achieve a pregnancy is expected to be 25% for each month, and 90% for a year under unprotected intercourse (Spira, 1986). Those who fail to conceive after a year of regular unprotected intercourse are categorized as infertile. It has been estimated that 15% of couples are suffering from infertility, of which about one third is linked to solely male factors, and another third of the cases are caused by a combination of male and female factors. While 30-50% of those cases remain idiopathic, male factors contribute significantly to infertility (Bhasin et al, 1994). The World Health Organization (WHO) established a guideline to identify the population of males who have a reduced ability to conceive naturally and thus are sub-fertile by evaluating sperm according to three parameters: sperm concentration, motility, and morphology ( W H O , 1999). Oligozoospermia is diagnosed when the sperm concentration is lower than 20 million sperm per milliliter of semen; asthenozoospermia describes the condition that less than 50% of the sperm are motile; and teratozoospermia is defined as less than 70% of the sperm with normal morphology. L o w sperm concentration, and abnormal levels of motile and amorphous sperm can be present in isolation or in combination in a given infertile patient. The condition where the patient has no sperm in ejaculated semen sample is known as azoospermia. Azoospermia can be further sub-divided into non-obstructive azoospermia ( N O A ) and obstructive azoospermia (OA) (Chow and Cheung, 2006). 1.2.2 Genetic causes for male infertility The etiology of male infertility is multi-factorial, primarily involving defects in sperm production, sperm dysfunction, and transport. These defective functions are thought to result from pituitary disorders, varicocele, cryptorchidism, anti-sperm antibodies, testicular cancer, and other unknown pathogenic factors (Sigman and Howards, 1998). However, it is almost impossible to exclude genetic contributions from these physical, endocrinal, and immunological explanations (Chow and Cheung, 2006). In this chapter, the genetic causes for male fertility are reviewed with focus on chromosome abnormalities. Other important contributing factors such as cystic fibrosis (CF), Y-chromosome microdeletions, and sperm D N A fragmentation are also discussed. 1.2.2.1 Chromosomal abnormalities The common types of chromosome abnormalities associated with male infertility are: somatic abnormalities, which primarily include sex chromosome aneuploidy and structural rearrangement, and germ cell specific chromosomal abnormalities. 1.2.2.1.1 Somatic chromosome abnormalities The incidence of chromosomal abnormalities in infertile men is 7.1% on average, ranging from 2.2% to 14.3%. This is 10 to 20 fold higher than the general male population in which the rate of chromosomal abnormalities is 0.7-1% (Retief et al, 1984; Matsuda et al, 1992). Specifically, a karyotype abnormality is detected in approximately 14.3% of azoospermic and 6.5 % of oligozoospermic patients (Nagvenkar et al, 2005). M e n with constitutional chromosome abnormalities have an increased risk to produce chromosomally abnormal sperm and offspring (Shi and Martin, 2000; M&et al, 2003). Sex chromosome aneuploidy and balanced structural rearrangement have been predominantly identified in infertile men, however, other aberrations such as supernumerary marker chromosomes and ring chromosomes have also been observed (Gekas et al, 2001). Sex chromosome aneuploidy is present in 3.7% of infertile men, but only in 0.3% in the general population (Gekas etal, 2001). Individuals with Klinefelter's syndrome (47, X X Y karyotype) typically have testicular atrophy and frequently have non-obstructive azoospermia. In some cases, sperm can be found in the semen; however, the rate of sex chromosome disomy (2-25%) in the sperm is significantly higher than that in the general population. A less common sex chromosome aberration is 47, X Y Y , which is present in 0.32 % in the infertile population (Gekas et al, 2001). Individuals with this aberration have also been reported to have a higher incidence of sperm aneuploidy (0.3-15%) (Shi and Martin, 2000). 10 Translocations are the structural chromosomal rearrangements detected most frequently in infertile men. Gekas et al. performed cytogenetic investigation in 2,196 men undergoing intracytoplasmic sperm injection (ICSI), and identified reciprocal translocation, Robertsonian translocation, and inversion in 1.2%, 0.8%, and 0.1% on the study population respectively. M e n carrying a balanced reciprocal or a Robertsonian (translocation between acrocentric chromosomes) translocation often have problems with fertility but are otherwise phenotypically normal (Morel et al., 2004; Scriven et al, 2001; Hatakeyama et al, 2006). Structurally rearranged chromosomes may produce chromosomally unbalanced gametes depending on the segregation pattern of quadrivalent (for reciprocal) or trivalent (for Robertsonian) during meiosis. Consequently, abnormal germ cells are arrested at cell cycle check-points before maturation or escape the check points, producing chromosomally abnormal sperm. Since fluorescent in situ hybridization (FISH) became available, a number of studies have been performed to investigate meiotic segregation patterns in sperm from men carrying translocations using this technique. The majority of sperm from reciprocal translocation carriers were found to be normal or balanced, with individual values ranging from 19% to above 80% (Benet et al, 2005). In contrast, investigations of meiotic segregation in Robertsonian translocation carriers have been carried out in fewer cases, with t(13;14) and t(14;21) being most frequently studied. According to available data, the prevalence of normal or balanced gametes has been found to range from 73.5% to 96.6% (Morel et al, 2004). This high incidence of normal balanced segregations may result from the preference of a cis configuration of the trivalent during meiosis which promotes the alternate segregation pattern leading to normal or balanced chromosomal complement (Sybenga, 1975). 1.2.2.1.2 Germ line specific chromosomal abnormalities M e n with a normal somatic karyotype of 46, X Y can produce chromosomally abnormal sperm i f segregation errors occur during meiosis. The rate of sperm aneuploidy in infertile men has been reported to be higher than in the fertile controls (Shi and Martin, 2001). Most studies in the literature agree with the association between abnormal sperm parameters 11 and an increased rate of sperm aneuploidy (Rives. 2005). It is now well established that males with reduced sperm concentration have a higher incidence of sperm aneuploidy (Miharu, 2005). While the aneuploidy rate varies dependent on the chromosome, the incidence of sex chromosome aneuploidy has been reported to be particularly pronounced by several studies (Nishikawa et al, 2000; Ohashi et al, 2001; Martin et al, 2003). This observation may be explained by an abnormal pairing of the pseudoautosomal region (PAR) between the X and Y chromosomes in infertile men. A reduced recombination in P A R has been associated with sex chromosome aneuploidy (Shi et al, 2001; M a r f d , 2006). The relationship between other abnormal semen parameters (motility and morphology) and sperm aneuploidy remains controversial. A few studies have reported an increased rate of sperm aneuploidy in asthenozoospermic patients (those with immotile sperm), although most other studies have shown no such correlation (Vegetti et al, 2000; Hristova et al, 2002). Asthenozoospermia induced by flagella deformities, however, was found to have a significantly higher risk for sperm aneuploidy (Rives et al, 2005). The relationship between sperm morphology and aneuploidy has been investigated in (karyotypically normal) infertile men with different sperm morphological abnormalities - polymorphic teratozoospermia, globozoospermia, and enlarged head teratozoospermia. "Enlarged head teratozoospermia" has a particularly high risk of aneuploidy, ranging from 1.5% to 62.4% depending on the percentage of enlarged heads. The other two forms also had increased rates of aneuploid sperm, but the increases were moderate (Machev et al, 2005). It is worth noting that there is a considerable variability in results from studies investigating the correlation between sperm parameter and aneuploidy rate. The inconsistency probably results from 1) the variability of laboratory conditions such as sample size and number of sperm included for analysis; (2) the difficulty to isolate abnormal sperm parameters. Infertile men frequently possess abnormal values in more than one parameter; (3) the complexity of infertility pathogenesis. Other genetic factors may contribute to abnormal sperm parameters besides chromosomal abnormalities. 12 1.2.2.2 Other genetic causes for male infertility 1.2.2.2.1 Cystic fibrosis Cystic fibrosis (CF) is a common autosomal recessive disorder among western European and Ashkenazi Jewish population. C F is caused by mutations in the cystic fibrosis transmembrane regulator (CFTR) gene, which maps to chromosome 7q31.2 (Stern, 1997). To date, more than one thousand different mutations have been identified with the AF508 deletion (a 3bp deletion responsible for the absence of phenylalanine at position 508) being most common. The C F T R protein is involved in regulation of airway chloride transport as well as sodium and water transport across the respiratory epithelium and sweat ducts. Its malfunction causes typical clinical phenotypes of C F including dehydrated airway mucus, pancreatic insufficiency, and high chloride concentration in sweat (Jarzabek et al, 2004). C F has also been closely associated with male infertility, accounting for 10% of obstructive azoospermic (OA) cases (Gazvani and Lewis-Jones, 2004). U p to 99% of adult men with C F T R mutation have Congenital Bilateral Absence of Vas Deferens ( C B A V D ) with which spermatozoa cannot be transported to the ejaculate, thus leading to O A (Jarzabek etal., 2004). However, C B A V D does not always concur with other clinical phenotypes o f C F and may not even have identifiable CFTR mutations. In fact, the majority o f patients with C B A V D have only a single allele mutation (>50%), fewer patients have double allele mutations, and no mutation is detected in about one third of the cases (Chillon et al, 1995). Intracytoplasmic sperm injection (ICSI) using sperm retrieved from the epididymis has accomplished a high pregnancy rate for CF-related O A patients (McCal lum et al, 2000). It is important that the underlying C F T R mutation can be passed to the offspring through the procedure. Therefore, genetic screening for the C F T R mutation is recommended to couples undergoing ICSI treatments (Gazvani and Lewis-Jones, 2004). 1.2.2.2.2 Y-chromosome microdeletion The Y chromosome is important in sexual development and spermatogenesis. Deletions of the long arm of the Y chromosome can impair spermatogenesis, and is thought to affect about 10-15% of men with severe oligozoospermia or azoospermia (Pryor et al, 13 1997). The Azoospermia factor (AZF) region, mapped to Y q l 1.23, has been identified as an essential genetic component for spermatogenesis (Tiepolo and Zuffardi 1976). The proximal, middle, and distal domains A Z F are designated A Z F a, A Z F b , and A Z F c , respectively. Microdeletions in each region have been associated with different types of infertility. Microdeletions in A Z F a have been associated with the absence of germ cells; A Z F b deletions cause meiotic arrest at spermatocytes; and A Z F c deletions affect the maturation process of the post-meiotic germ cells (Vogt et al, 1996). Krausz et al. reported that the most frequently deleted region is A Z F c , accounting for approximately 60% of all A Z F deletions, followed by 35% of the cases in A Z F b , A Z F b + A Z F c , or A Z F a + A Z F b + A Z F c . Deletions in the A Z F a region account for only 5% of the cases (Krausz et al, 2003). Y-chromosome microdeletion in at least one of the A Z F regions occurs in 3.5% of azoospermic or severe oligozoospermic patients (Vogt et al, 1996). The most common A Z F c deletions have been identified in 20% of azoospermic patients, of whom 50% had sperm in their testis. The same deletion was identified in 13% of men with severe oligozoospermia. Pregnancies were achieved in 56% of the patients aided by assisted reproductive technologies; however the deletion was transmitted to their sons (Silber ei al, 1998). N o sperm was found from the testis of patients with deletions extending beyond the A Z F c region (Silber, 1998); therefore, screening for Y deletions is recommended to infertile patients before they undergo the invasive testicular sperm extraction procedure (Brandell et al, 1998). 1.2.2.2.3 Sperm D N A fragmentation Sperm D N A integrity has been associated with male fertility potential. Abnormal sperm chromatin/DNA structure is thought to arise from three potential sources: 1) incomplete maturation of sperm due to diminished topoisomerase II activity (Bianchi et al, 1996; Manicardi et al, 1995); 2) incomplete apoptosis (Richburg, 2000); and 3) oxidative stress (Aitken et al, 2003). Damaged sperm D N A is increased in subfertile men, in spite of normal sperm parameters (Spano etal, 2000). Thus, sperm integrity may provide an explanation for some idiopathic infertility and serve as an independent indicator. The probability o f natural 14 fertilization becomes extremely low i f the level of D N A damage exceeds 30% as detected by the sperm chromatin structure assay (SCSA) (Evenson et al, 1999). Several studies have also linked abnormal sperm concentration, morphology and mobility with increased D N A fragmentation (Zini et al, 2000, Host et al, 1999; Gandini et al, 2000). Although A R T , particularly ICSI, may improve fertilization efficiency, studies have suggested that sperm D N A damage is associated with poor A R T outcome, affecting embryo cleavage, blastocyst development, and post-implantation embryo development. Hence, the assessment of chromatin organization and D N A integrity has been suggested in the clinical practice (Erenpreiss et al, 2006). 1.3 Intracytoplasmic sperm injection (ICSI) 1.3.1 Development of assisted reproductive technologies ( A R T ) preceding ICSI Currently, one in six couples worldwide experiences infertility (Anderson et al., 2004). A number of assisted reproductive technologies have been developed to fulfill the infertile couples' wishes to have their own biological children. The beginning of A R T can be traced back to two centuries ago. The first birth after artificial insemination, by which sperm is placed into the uterus or cervix using artificial means, was carried out in 1785. However, there was no further development until artificial insemination with frozen semen was successfully performed in 1954. About two decades later, the birth of Louise Brown was successfully facilitated by in vitro fertilization (IVF) followed by embryo transfer in 1978 (Edwards et al., 1980). Since then, there has been an remarkable development in this field, and more than one million of children are born world-wide using assisted reproductive technologies (ARTs) (Anderson et al., 2004). I V F consists of ovarian stimulation, oocyte retrieval, fertilization in vitro, and embryo culture followed by embryo transfer to the uterus (Elder and Dale, 2001). It has proven to be effective in treating a variety of infertility including tubal dysfunctions, endometriosis, unexplained infertility and fertility involving male factors. However, the 15 success rate was extremely low when I V F was used to treat couples with severe male factor infertility. Thus, patients with less than 500,000 progressive motile sperm could not be included in the I V F treatment (Devroey and Van Steirteghem, 2004). Several techniques were developed to improve the conventional I V F . Partial zona dissection (PZD), which introduces a small opening in the zona pellucida to improve the access of sperm to the ooplasm, was first developed, but the results were inconsistent. Subsequently, subzonal insemination (SUZI) was invented, with which a few motile sperm were microinjected into the perivitelline space between the oocyte and zona pellucida. Similar to P Z D , SUZI also could not provide a satisfying fertilization rate. In 1992, the first successful birth facilitated by ICSI was reported. In ICSI, a single viable sperm is drawn up into a micropipette and injected directly into the ooplasm (Palermo et al, 1992). ICSI has improved fertilization rate and implantation rate compared to the previous technologies, and has been used world-wide to treat male factor infertility (Van Steirteghem et al., 2002). 1.3.2 Clinical practice of ICSI ICSI is a breakthrough in the field of male infertility treatment as it requires only a single viable sperm. Ovarian stimulation and oocyte retrieval are similar to that for I V F . The female partner of a couple pursuing treatment with ICSI is given hormonal medications to stimulate the ovary to mature several oocytes simultaneously. Approximately twelve cumulus-oocytes are retrieved, but only M i l oocytes, identified by the extrusion of the first polar body, wi l l be used for ICSI. A single sperm is drawn up into a micropipette and injected directly into the cytoplasm of the oocyte with the use of a micromanipulator. Once fertilization is accomplished with ICSI, embryos are cultured in vitro (as with conventional IVF) , and transferred to the uterine cavity (Palermo et al, 1992). Embryo transfer is performed on day 2 at the four-cell stage in most centres. Day-3 transfer and blastocyst transfer on day 5 are carried out less frequently. Preferentially, two embryos with good quality are transferred; however the number may be increased depending on maternal age and rank of trial. Limit ing the number of embryo transferred is thought to effectively prevent multiple birth (Van Steirteghem, 1999). 16 In general, ICSI is offered to infertile couples with severely defective semen parameters or with previously failed I V F cycles (Lewis and Klonoff-Cohen, 2005). ICSI can be used to treat some azoospermic patients, who have been considered sterile until ICSI became available, so long as a single viable sperm can be retrieved (Devroey and Van Steirteghem., 2004; Craft et al, 1995; Schoysman et al, 1993). Microsurgical epididymal sperm aspiration ( M E S A ) is used to extract sperm from the epididymis in O A patients with blockages in the ductal system such as C B A V D in men affected by C F (Tournarye et al, 1994; Schlegel et al, 2004). Testicular sperm extraction (TESE) can be used to obtain sperm from the testis when no sperm is present in even the epididymis. Consequently, T E S E can be performed on patients with abnormal spermatogenesis, endocrine defects, maturation arrest, hypogonadism, and hypospermatogenesis (Schelgel etal, 2004, Silber et al, 1995, Tournaye etal, 1996). 1.3.3 Pregnancy outcomes of ICSI In contrast to the remarkable success of ICSI in treating male infertility, concerns have been raised regarding the short- and long- term effects of this technology. When compared with natural conceptions, a higher incidence of low birth weight, multiple-birth, pregnancy loss, chromosomal abnormality, and congenital and developmental abnormalities in ICSI pregnancies have been repeatedly reported (Bounduelle et al, 1999, Schieve et al, 2002, Aytoz etal, 1999). More recently, increased rates of imprinting disorders have also been documented in the literature (DeBaun et al, 2003; Halliday et al, 2004). 1.3.3.1 Reduced birth weight in ICSI There are several ways to define reduced birth weight. L o w birth weight ( L B W ) and very low birth weight ( V L B W ) describe birth weight below 2500g and 1500g, respectively. Small for gestational age ( S G A ) describes a birth weight below a specific cut-off, normally the 10 t h or the 5 t h percentile, at particular gestational age. Intrauterine growth retardation ( IUGR) is thought to best describe the pathological state of reduced birth weight, defined as failure of a fetus to reach their genetic potential. Because the detection of I U G R requires ultrasound measurements of in utero growth, which is not readily available in every study, 17 th I U G R is commonly used interchangeably with S G A to describe birth weight below the 5 or 10th percentile (Kingdom et al, 2000; Cetin et al., 2003). Although these terms are not synonymous, there is a considerable overlap among them (Monk and Moore, 2004). Infants with abnormal fetal growth may be predisposed to health problems at all stages of life. Infants have increased rates of perinatal mortality and morbidity (Jarvis et al., 2003). Children with lower birth weights were also found to have abnormal neurodevelopment and cerebral palsy (Blair, 2000). According to Barker's hypothesis suggests, size at birth may even play a role in developing cardiovascular disease, hypertension, and type II diabetes later in adulthood (Barker et al, 1998). Many studies have reported that the rate of L B W and V L B W is higher in ICSI pregnancies compared to those conceived naturally. Although the difference was originally thought to be attributed to the higher rate of multiple-births in ICSI pregnancies, significantly higher rates of L B W have been observed in singletons born after ICSI (Table 1.1). Katalinic et al. (2004) investigated 2055 ICSI babies and found a 2-fold increase in the incidence of L B W in ICSI singletons compared to the natural conceived controls. While not limited to ICSI, Schieve et al. (2002) studied 18398 A R T newborns and estimated a 2.6-fold increase in L B W singletons conceived with A R T compared to the controls, although the type of A R T used was not specified. Similarly, Wang et al (2005) concluded that A R T derived pregnancies (including 7174 ICSI newborns), in general, are 2.1 times more likely to have L B W than natural conceptions, with no significant difference between the ICSI and I V F groups. In contrast, one study found a weaker correlation between reduced birth weight and ICSI. Ombelet et al. (2005) conducted a large scale retrospective cohort study including 1655 singletons and 1102 twin ICSI births. The naturally conceived control group was selected from a regional registry and was matched for maternal age, parity, place of delivery, year of delivery and fetal sex. Interestingly, the rates of L B W and V L B W in the ICSI and control singleton pregnancies were comparable. 18 Table 1.1 Rates of L o w Birth Weight ( L B W ) and Very L o w Birth Weight ( V L B W ) in ICSI and natural pregnancies for singletons and twins Singleton LBW VLBW ICSI Natural conceptions ICSI Natural conceptions Wang et al., 2005a 9.1% - - -Ombeletef al., 2005 132/1655(7.9) 231/3278 (7.0) 32/1655 (1.9) 51/3278 (1.5) Katalinic etal., 2004 224/2055 (10.9)* 417/7861 (5.3) 66/2055(3.2)* 86/7861(1.1) . Vernaeve et al., 2003b 16/142 (11.3) - -Bounduelle et al., 2002 106/1493 (7.1) - 22/1493 (1.5) -Schieve et al., 2002c 2723/18398 (13.2)* 1339/18398 (7.3)d 480/18398 (2.6)* 263/18398 (1.4) Wennerholmetal., 2000 59/773 (7.6) - 11/773 (1.4) -Loft etal., 1999 32/476 (6.7) - 8/476 (1.7) -Govaerts etal., 1998 23/121 (19) - 4/121 (3.3) -Twins LBW VLBW ICSI Natural conceptions ICSI Natural conceptions Ombelet etal., 2005 652/1102 (59.2) 1290/2163 (59.6) 97/1102 (8.8) 218/2163 (10.1) Katalinic etal., 2004 656/1158 (56.7) 79/152 (52.3) 11/1158(10) 21/152(13.9) Vernaeve et ai, 2003b 42/88 (47.7) - - -Bounduelle et al., 2002 593/1233 (48.1) - 64/1233 (5.2) -Schieve ef al., 2002c 10156/18399(55.2) - - -Wennerholm era/., 2000 164/416 (39.4) - 35/416(8.4) -Loft era/., 1999 44/118 (37.6) - 6/118(5.1) -Govaerts ef a/., 1998 114/170(67.1) - 20/170(11.8) -a. Numbers were not available. The total number of infants born after ICSI was 7174 b. Non-obstructive and obstructive azoospermia only b. Data includes both ICSI and IVF c. The expected values were calculated according to the LBW from the 1997 U.S> birth-certificate data. Values were adjusted to the difference in the distribution of maternal age was adjusted * Significantly different from the control values Several studies also investigated birth weight from ICSI pregnancies derived through variable conditions. Aytoz et al. (1999) investigated the effect of cryopreservation of embryos on birth weight and concluded that the incidence of L B W is higher in ICSI pregnancies using frozen embryos compared to fresh embryos (12.1% for fresh vs 32.7% for frozen), although the difference was only significant in twin pregnancies. Wennerholm et al. (2000) compared the birth weights according to sperm origins and quality, and found comparable results in the subgroups with different sperm concentration and sperm sources (i.e. ejaculate, epididymal, and testicular). Interestingly, the authors also reported that 19 cryopreservation led to a higher birth weight; however, significant difference was found in the singleton group. Since reduced birth weight is a general concern of ICSI and other A R T s , the neonatal outcomes of V L B W infants born after A R T were studied (Schimmel et al, 2006). The risks for congenital abnormality, postnatal morbidity or mortality in the A R T conceptions were not higher than that of natural conceptions, after adjusting for plurality. However, this study did not provide information on the specific types of A R T used or report the pregnancy loss rates due to fetal malformations. 1.3.3.2 Spontaneous abortions Spontaneous abortion (SA) occurs in approximately 10-20 % of clinically detected pregnancies in the general population (Wilcox et al, 1981; Nybo Andersen et al, 2004). The incidence of S A in pregnancies conceived by ICSI has been investigated by multiple studies. However, an accurate comparison of S A rates between ICSI and natural conceptions is difficult because the incidence is strongly influenced by maternal age, which tends to be higher in the ICSI population. In addition, the detection of pregnancy is more accurate in A R T cycles than natural conceptions due to closer surveillance. The general belief is that the rate of S A is slightly higher in ICSI conceptions compared to natural conceptions because of the inherent insufficiencies found in the infertile couples undergoing ICSI (Schieve et al 2004). The overall rate of spontaneous loss in ICSI conceptions ranges from 11% to 26% (Aytoz et al, 1999; Wennerholm et al, 2000; Van der Westerlaken et al, 2001; Vernaeve et al, 2003), however, these rates did not fully adjust for important factors such as maternal age, pregnancy plurality, and pregnancy history. In studies with appropriate adjustments, the relative risk of S A in ICSI pregnancies was determined to be 1.03 fold (Schieve et al 2003) and 1.20 fold increase (including both ICSI and IVF , Wang et al, 2004). To investigate the potential factors that may contribute to pregnancy loss in ICSI conceptions, several studies attempted to correlate the risk of S A with types of infertility and sperm source. Some studies found that S A rate was not affected by underlying infertility (Bahceci and Ulung, 2005, Wang ei al, 2004, Vernaeve et al, 2003) or by the sperm types 20 (e.g. ejaculate or testicular sperm). (Palermo et al, 2000; Wennerholm et al, 2000; Bahceci and Ulung, 2005). Others found a higher rate of S A in cases with severely defective sperm in the ejaculate, but no such increase in cases where sperm was obtained from epididymis and testis (Aytoz et al, 1998a, b). The impact of hormonal ovarian stimulation on ICSI or I V F has been suggested as one risk factor for SA. Schieve et al. (2003) found that S A rate increased in pregnancies using clomiphene for stimulation. Raziel et al. (2002) also found that the risk of S A was significantly increased in I V F patients with severe ovarian hyperstimulation syndrome. A few studies indicated that transferring thawed embryos or poor quality embryos could increase the risk for S A (Winter et al, 2002; Schieve et al, 2003). Thus, the etiology of S A in ICSI or I V F conceptions has yet to be fully elucidated. 1.3.3.3 Chromosomal abnormalities ICSI conception assumes several risk factors that may lead to chromosomal abnormalities - advanced maternal age, male infertility, and the invasiveness of the procedure. Firstly, the correlation between maternal age and chromosome anomaly has been well established. It is thought that as women age, the spindles that organize and facilitate chromosomal segregation in oocytes tend to deteriorate and cell division becomes more susceptible to chromosomal non-disjunction (Hawley et al, 1994; Lamb et al, 1996). Secondly, chromosomal abnormalities have also been associated to male infertility. The incidence of chromosomal abnormalities in infertile men is 10 to 20 fold higher than in the general male population (Retief et al, 1984; Matsuda et al, 1992). Hence, there may be an elevated risk that ICSI can transmit a chromosomal abnormality to the conception from the selection of an abnormal sperm. Finally, as demonstrated in animal models, the injection procedure has been shown to result in perturbations of spindle apparatus, cytoskeleton, and chromatin configurations. These damages delivered on the oocyte may cause meiotic II or mitotic segregation errors (Hewitson et al, 1996; Terada et al, 2000). The incidence of chromosomal abnormality in ICSI-derived offspring detected by prenatal diagnosis ranges from 1.5% to 4.2% (Table 1.2), which is significantly higher than the 0.9%> reported in natural conceptions (Jacobs et al, 1992; Nielsen and Wohlert, 1991). Several studies reported de novo abnormalities in ICSI derived offspring involving both 21 autosomal and sex chromosomes; while other studies with relatively small sample size could detect only autosomal abnormalities (Wennerholm et al, 2000; Vernaeve et al, 2003.). Comparing with the incidence of chromosomal abnormalities detected in the general population, Bounduelle et al. (2002) suggested that the increase is primarily attributed to the higher incidence of sex chromosome abnormalities, estimated to be 3-fold higher than that of the controls. Similarly, a higher incidence of de novo gonosomal than autosomal abnormalities were observed in some studies (Van Opstal et al, 1997; Samli et al, 2003), confirming the preponderance of sex chromosomal abnormalities in the ICSI pregnancies. Inherited abnormalities, mostly balanced structural rearrangement, also present more frequently in the ICSI population. These inherited structural abnormalities were found to be mostly of paternal origin (Table 2). This is thought to be a direct consequence of the chromosomal abnormalities in the underlying male-factor infertility (Bonduelle et al, 2002). However, an effect due to increased maternal age is also widely considered to exist in the ICSI population. Advanced maternal age is present in up to 49% of the infertile couples undergoing ICSI ( S A R T , 2000). Loft et al (1999) reported about a half o f the chromosomal abnormalities (1.9% out of 3.4%) detected in ICSI conceptions were due to advanced maternal age, which incidentally encompassed 29% of the couples studied. Table 1.2. Prenatal diagnosis in ICSI pregnancies. conception Reference n de novo (%) inherited total origin Gonosomal Autosomal % % ICSI Jozwiak et al., 2004 1136 0.6 (n=7) 0.6 (n=7) 0.2 (n=3) 1.5 (n=17) 2/3 pat Samli et al, 2003 142 2.8 (n=4) 1.4 (n=2) 0 4.2 (n=6) — Veraeve et al., 2003 85 0 2.35 (n=2) 1.18 (n=l) 3.53 (n=3) ~ Bonduelle etal., 2002 1586 0.63 (n=10) 0.95 (n=15) 1.39 (n=22) 2.96 (n=47) 17/22 pat Wennerholm etal., 2000 149 0 1.34 . (n=2) 1.34 (n=2) 2.68 (n=4) 2/2 pat Loft etal., 1999 209 0 2.9 (n=6) 0.5 (n=l) 3.35 (n=7) 1/1 pat Van Opstal etal., 1997 71 8.4 (n=6) 4.2 (n=3) ~ 12.7 (n=9) 6/8 pat Natural Jacobs et ai, 1992 56952 0.19 0.26 0.47 0.92 — Nielsen and Wolhlert, 1991 34910 0.23 0.61 - 0.84 . ~ 22 Several studies have, correlated de novo chromosomal abnormality in ICSI conceptions to sperm parameters. Bonduelle et al. (2002) found correlation between low sperm concentration (<10xl0 6/ml) and abnormal sperm motility to abnormal karyotypes detected through prenatal testing. Similarly, Samli et al. (2003) found an association between very low sperm count (<106/ml) with abnormal karyotypes in the conceptions. These findings suggest that chromosomal abnormalities may be associated with some types of male infertility and can be passed on from the fathers to the offspring. Case reports have provided further evidence for the direct association between aneuploidy in sperm and that in the fetus. Moosani et al. (1999) reported a 47, X X Y pregnancy conceived with sperm from a man with elevated level of X Y disomy in his gametes (1.39% vs. 0.16% in controls). Carrell et al. (2001) also reported atrisomy 15 pregnancy with a paternal origin. A significantly higher level o f disomy 15 (4.03% vs. 0.4% in controls) was observed in sperm from the father, who was affected by the round-headed sperm syndrome. A slight increase in aneuploidy involving sex chromosomes was also observed. This finding is in agreement with the interchromosomal effect reported in many studies (reviewed by Douet-Guilbert et al., 2005). More recently. Tang et al. (2004) conducted a series of investigations on a 45, X case which was missing the paternal X chromosome. F I S H analysis on the father's sperm revealed a roughly 1:1 ratio of sex chromosome nullisomy (19.6%) and X Y disomies (18.6%), both higher than the controls (0.3%> and 0.1%). Therefore, a meiotic II non-disjunction was speculated to be responsible for the abnormality. A moderate but statistically significant elevation of aneuploidy involving chromosome 13, 18, and 21 was also detected, suggesting an interchromosomal effect. Furthermore, an immunofluorescent assay was used to investigate the synaptonemal complex and recombination foci in spermatocytes in pachytene stage. N o recombination between sex chromosomes was observed in this man, while in controls (n=2), the recombination rate involving the sex chromosomes was about 80%. Reduced recombination was also observed on chromosomes 13 and 21 (Ma et al, 2006). These thorough analyses provided insight into the etiology of aneuploidy in ICSI conceptions, further linking chromosomal abnormalities in the father's sperm to chromosome pairing and recombination. 23 The incidence of chromosomal abnormality in spontaneously aborted conceptions has also been investigated. Studying spontaneous abortions allows for a wider investigation of abnormalities than what can be detectable at prenatal testing. The rate of chromosomal abnormalities detected in abortuses from IGSI has been suggested to be comparable to that from I V F and natural conceptions (Causio et al, 2002; M a et al, 2006). In the general population, the incidence of chromosomal abnormality in spontaneous abortions is estimated to be about 65% though it is strongly influenced by maternal age (Ohno et al, 1991; Sanchez et al, 1999). As per A R T pregnancies, Causio et al (2002) found that chromosomal abnormality was present in 48% of ICSI and 43% of I V F abortions, respectively. M a et al. (2006) found that 59% of ICSI and 71% of I V F abortuses were chromosomally abnormal. Another study found a significant higher rate of aneuploidy in abortuses from ICSI (76%) than those from I V F (41%) (Lathi and M i l k i , 2004). However, the number of cases included in the study was relatively small, with only 21 abortion cases from ICSI. Cytogenetic analysis of spontaneous abortions in the general population showed that the predominant abnormality was autosomal trisomy (64%; 62%), followed by polyploidy (9%; 20%), monosomy X (7%>; 11%), structural rearrangements (6%>; 5%), mosaicism (6%), double trisomy (4%>), and double chromosome anomaly (3%) (Ohno et al, 1991; Eiben et al., 1991). Data from ICSI studies consistently reported a higher rate of monosomy 45, X cases with a frequency of up to 33.3% (Causio et al, 2002). This may be associated with the higher level of sex chromosome aneuploidy observed in infertile men. Also, the rate of triploidy and tetraploidy is lower in ICSI abortuses than those from I V F and even natural conceptions. This can probably be explained by the nature of the ICSI procedure which prevents possibility of more than one sperm fertilizing an oocyte (Causio et al, 2002). 1.3.3.4 Imprinting disorders Recently, increasing interest has focused on the association between A R T and imprinting disorders, such as Beckwith-Wiedemann Syndrome (BWS) (DeBaun et al, 2003; Maher et al, 2003, Gicquel et al, 2003; Halliday et al, 2004), and Angelman Syndrome (AS) (Cox et al, 2002; Orstavik et al, 2003) (Tablel.3). 24 B W S occurs in one in 14,500 live births in the general population. It is characterized by macroglossia, pre- or/and postnatal overgrowth, and anterior abdominal wall defects. Pregnancy affected by B W S may have large and thickened placenta, polyhydramnios, long umbilical cord, and a large fetus for gestational age. Additional clinical features include hemihypertrophy, ear pits and creases, neonatal hypoglycemia, and facial nevus flammeus. B W S patients are also at risk of developing embryonic tumors such as Wi lms tumor (Elliott, 1994). Most sporadic cases are caused by mutations or epimutations affecting the imprinted genes located on chromosome 1 l p l 5 . 5 . Up to 45% of the sporadic cases are due to epigenetic alterations at imprinting centers (IC), which regulate imprinted genes such as maternally expressed H19 and CDKN1C and paternally expressed 1GF2 and KCNQ1. Other etiologies include uniparental disomy (20%) and mutations of CDKN1C gene (-10%) (BWS [ O M L M 130650]). It has been suggested that B W S is overrepresented in the A R T population. Among a total of 33 A R T derived B W S cases, 11 cases underwent ICSI. The relative risk for A R T derived children to develop B W S has been estimated to be about 4 fold higher than the general population in two retrospective studies (Maher et al. 2003; Gicquel et al, 2003), whereas, two other groups reported even more alarming numbers (up to 9 fold higher risk) (DeBaun et al, 2003; Halliday et al, 2004). Molecular analyses have demonstrated that 13 out 14 cases were caused by hypomethylation at the KCNQIOT gent; one case was also affected by hypermethylation at the H19 (Table 1.3). Thus, the prevalence of epigenetic disturbance in the A R T derived B W S cases (93%) is much higher than the expect rate of 45%> in the sporadic cases. These findings mirror studies that linked Angelman Syndrome (AS) and ICSI. A S is characterized by mental retardation, delayed motor development, poor balance, speech impairment, and happy disposition. The majority of the A S cases (70%) is caused by deletion of the maternal chromosome 15 followed by UBE3A mutation (5-10%) (OMDVI 105830). Merely 2% of the sporadic A S cases are caused by epigenetic defects at the imprinting centre. However, 3/3 cases of A S reported in children born after ICSI were found to be due to this infrequent epigenetic error. Although the fathers of the two A S children reported by Cox et al. (2002) had abnormal sperm parameters, the third case indicated that infertility was related to maternal factors (Orstavik et al, 2003). Thus, authors suggested a possible correlation 25 between the ICSI procedure and A S . However, a recent study reported that 4/16 (25%) of A S children born to subfertile couples had a sporadic imprinting defect. Some of these patients underwent ICSI, but the relative risk of A S in ICSI population was identical to those who were untreated but had more than two years of infertility history. Also, hormonal treatment was found to increase the relative risk of A S (Ludwig et al, 2005). Thus, these observations extended the possible causes for imprinting defects to other factors related to infertility rather than ICSI procedure. Table 1.3 Summary of imprinting disorders in the A R T population. Syndrome Reference No. of ICSI No. analyzed Molecular analysis results BWS DeBaun et al, 2003 . . 5/7 6 4/6 KCNQIOT hypomethylation Malieretal, 2003 3/6 2 1/6 KCNQIOT hypomethylation and HI9 hypermethylation 2/2 KCNQIOT hypomethylation Gicquel et al., 2003 2/6 6 6/6 KCNQIOT hypomethylation Halliday etal., 2004 1/4 3 3/3 KCNQ1OT hypomethylation AS Cox et al. 2002 2/2 2 2/2 imprinting defects at IC Orstavikef ai, 2003 1/1 1 imprinting defects at IC IC: imprinting centre. 1.4 Confined placental mosaicism Since the first birth facilitated by ICSI in 1992, a number of cohort studies have revealed an elevated incidence of prenatal and perinatal abnormalities in children born through this treatment, as described above. However, the underlying causes have not been identified. In the current study, we hypothesized that confined placental mosaicism ( C P M ) might be one of the factors contributing to these abnormalities, particularly for low birth weight ( L B W ) . C P M is defined as a feto-placental chromosomal discrepancy where abnormality is found only in the placenta but not in the embryo proper (Kalousek and D i l l , 1983). 26 1.4.1 Normal placental formation and functions The placenta has a short life span as it develops only during the nine months of gestation; however it contributes significantly to the development of the fetus. In order to understand the etiology and clinical relevance of C P M on pregnancies, normal development and functions of the placenta are reviewed here. 1.4.1.1 Development of the placenta A blastocyst, which develops about four days after fertilization, consists of a fluid-filled inner cavity (blastocele), an inner cell mass, and trophoectoderm on its surface. These different cell types define the developmental lineages. Only a few cells in the inner cell mass are destined to become the embryo, while the remaining cells in the inner cell mass and the trophoectoderm give rise to the extraembryonic tissues (e.g. the placenta) (Norwitz et al, 2001) (Figure 1.4). Amniotic ectoderm / ** * steak' fcr-uofterri / \ , / fc;>i*rvorac v . X S/!*nf«nJe — Art is t ic epithsSum / Hypo&iast \ B!3«totysS * \ EbaraarbryDrtc . ExSramtoyonic O w t a f c v f t u * ' nescKJerm mesenchyme TrcprseeetoJtemi \ Figure 1.4 Development of placenta tissues. (Modified from Carlson 2004; Minor , 2005) The trophoblast, the main constituent of the placenta, derives from the trophoectoderm and contains two layers: the inner cytotrophoblast and the outer syncytiotrophoblast. Trophoblast plays an important role in implantation by enhancing the interaction and invasion into the uterine lining (Carlson 2004). Upon the invasion of syncytiotrophoblast into uterine epithelium, lacunae (later called intervillous space) begin to form among trophoblast 27 cells, and maternal blood enters to provide a source of nutrients. Concurrently, a series of differentiation steps takes place in the inner cell mass of the blastocyst. The hypoblast begins to give rise to the yolk sac, some of which wi l l transform into extraembryonic mesoderm. The extraembryonic mesoderm, in turn, gives rise to the mesodermal core of the v i l l i and the allantois, and forms the chorion when fused with the trophoblast endoderm. The dorsal cells of the epiblast (extraembryonic ectoderm) spread across the mesoderm and give rise to the mesenchymal layer of amniotic membrane, whereas, the amniotic epithelium arises from embryonic ectoderm. The amniotic membrane provides a fluid-filled cavity to protect the embryo. As the blastocyst continues to invade, the fibroblast-like stromal cells of the maternal endometrium begin to enlarge and accumulate glycogen and lipid droplets. These cells, now called decidua, surround the implanting embryo and form the maternal compartment of the placenta (Carlson, 2004). B y the 10 t h day after fertilization, the blastocyst becomes completely implanted into the uterine wall (Norwitz etal, 2001). Upon implantation, primary vi l l i begin to form as the cytotrophoblast invades into the syncytiotrophoblast. Once mesenchymal core appears inside an expanding villus, secondary villus is formed. Tertiary v i l l i develop when blood vessels penetrate into the mesenchymal core. This occurs at the end of the third week of the pregnancy. The invasive nature of the cytotrophoblast is limited to the first trimester when photolytic enzymes are expressed. Cytotrophoblast invasion goes beyond the syncytiotrophoblast, and into the maternal endometrium, myometrium, and uterine vasculature. As trophoblast erodes maternal endometrial blood vessels (e.g. the spiral arteries), maternal blood seeps into the intervillous space and bathes the chorionic v i l l i . The feto-maternal exchange of gases and molecules takes place across the villus capillaries that separate the maternal and fetal blood (Carlson, 2004). 1.4.1.2 Placental functions The placenta has three important functions for the survival and development of the embryo: (1) allows the fetus to acquire oxygen and nutrients and to extrude waste; (2) serves as a barrier from rejection of the embryo by the maternal immune system; (3) synthesizes a 28 number of hormones and growth factors that are required for the progress of the pregnancy. Gas exchange between the maternal and the fetal blood occurs by diffusion across the villous capillaries. Despite similarities to gas exchange in the adult lung, diffusion across the placenta is not as efficient because of greater diffusion distances and smaller surface area available for diffusion. To compensate, fetal hemoglobin is more concentrated and has higher affinity to oxygen. Fetal cardiac output is also much higher than that in adults to increase the delivery of oxygen to fetal tissues. Finally, maternal blood flow to the uterus is increased .during pregnancy (Rurak, 2001). The nutrition from the mother to the fetus is transferred through active transporters. The main nutrients, glucose and amino acids, are transported via specific transporters (Bell et al, 1990; Cetin et al, 2003). In addition, fatty acids, cholesterols, steroid hormones are also transported across the placenta to the fetus (Rurak, 2001). The placenta also serves as a barrier to protect the fetus from the maternal immune system. The trophoblast, specifically the syncytiotrophoblast and the non-villous cytotrophoblast cells, do not produce two major histo-compatibility antigens that can trigger an immune response, as seen in tissue transplantations (Carlson, 2004). In addition, the placenta is thought to produce compounds with immunosuppressive properties. These include human chorionic gonadotropin (hCG), progesterone, prostaglandins, and placental proteins such as PP-5, PP-12, and PP-14 (Rurak, 2001). The placenta, particularly the syncytiotrophoblast, produces a number of protein and steroid hormones that are important for the pregnancy ; h C G is the first protein hormone produced by the embryo even before implantation (Carlson, 2004). h C G stimulates the differentiation of cytotrophoblast into syncytiotrophoblast (Kliman et al, 1986).and maintains the corpus luteum and its production of progesterone and estrogen. The production of h C G peaks at around the 8 t h week of gestation, and declines as the placenta begins to produce enough progesterone and estrogen by itself. Human placental lactogen, also produced by the syncytiotrophoblast, enhances fetal growth, lactation, and l ipid and carbohydrate metabolism (Carlson, 2004). In addition, several hormones produced by the syncytiotrophoblast are thought to influence exclusively the maternal metabolism during pregnancy. Some examples are human placental growth hormone, chorionic thyrotropin and 29 chorionic corticotrophin. Cytotrophoblast cells produce a homologue of gonadotropin-releasing hormone (GnRH), which regulates the production of h C G and progesterone by the syncytiotrophoblast (Carlson, 2004). 1.4.2 Pathogenesis of C P M A s described above, the placenta plays essential roles for the development of the fetus. Therefore, when the placenta is pathologically affected, the pregnancy outcome can be adversely influenced. One of such examples is confined placental mosaicism ( C P M ) in which a chromosomal abnormality is limited to the extra-embryonic tissues and does not affect the embryo proper. There are three categories of C P M according to the cell type involved. The type I C P M is the most common and affects trophoblast cells only. Type II C P M is limited to the mesenchymal core cells. In type III C P M , abnormality is present in both trophoblast and mesenchymal cells (Figure 1.5) (Kalousek and Vekemans, 1996). chorionic stroma Figure 1.5. Three types of confined placental mosaicism ( C P M ) . Shaded tissues are chromosomally abnormal. In all three types, the fetus is unaffected, (from Kalousek and Vekemans, 1996). C P M can have a mitotic or a meiotic origin. With mitotic origin, C P M results from chromosomal non-disjunction in a post-zygotic cell division event in an originally normal zygote, leading to a chromosomal abnormality in the extra-embryonic tissues. Mitotic errors give rise to all three types of C P M , depending on the timing of the error (Simoni and Sirchia, 1994). Type I (trophoblast only) and type II (mesenchymal cells only) C P M derive from the propagation of a chromosomal mal-segregation event in a small portion of cells in a developing morula destined to become extraembryonic mesoderm ( E E M ) (Wolstenholme, 1996). Type III C P M derives from an error occurring early in an undifferentiated blastomere prior to the blastocyst stage. In addition to timing, the mosaic pattern of C P M is also influenced by the number of cells affected by the error, viability o f the error, and the level of developmental selection occurring after the erroneous event (Robinson et al, 1997). C P M can have a meiotic origin i f an aneuploid gamete (derived from chromosomal non-disjunction in Meiosis I or II) produces an aneuploid zygote upon fertilization and the chromosomal abnormal zygote subsequently undergoes a 'rescue' process such that abnormal cells are selected against, promoting the development of any normal cells. Because the zygote starts off abnormal, a larger proportion of chromosomally abnormal cells is expected (Wolstenholme, 1996). Meiotic C P M may lead to a particularly high level of trisomy in trophoblasts as a large proportion of an early blastocyst gives rise to the trophoblast lineage. However, i f the 'rescue' event affects cell lineages specifically excluding E E M cells that develop into mesenchymal stroma, then type II C P M can result. Because such specific requirements for type II C P M are less likely, meiotic origin is more often associated with type I and type III C P M (Wolstenholme, 1996). Robinson et al. (1997) have, however, identified three exceptional cases of meiotically-derived C P M : one had no detectable abnormality in the placenta at term despite a non-mosaic abnormality detected by C V S ; another case had no abnormality in trophoblasts at term but a high level o f abnormality in stroma cells; a third case had trisomy 22 in 100% cultured mesenchyme but 0% in trophoblast (direct C V S culture). However, the sensitivity of mosaicism detection can be affected by the number of cells analyzed, site-to-site variability in the distribution of trisomic cells. The origin of C P M , whether it is meiotic or mitotic, also appears to differentially involve specific chromosomes. The majority of the C P M cases involving chromosomes 2, 3, 7, 8, 10, and 12 have a mitotic origin; whereas, C P M 9, 16, and 22 more frequently have a meiotic origin. C P M 16 almost exclusively evolves from a maternal meiotic error. This 31 chromosome specific association with origin of C P M has been suggested to involve the selection and viability o f certain trisomic cells (Wolstenholme, 1996; Robinson et al, 1997). 1.4.3 Ascertainment of C P M C P M is typically diagnosed through prenatal diagnosis by chorionic villus sampling (CVS) at 10-12 weeks of gestation, with which a biopsy of chorionic v i l l l i is taken and subsequently cultured to examine the chromosomal complement. Discrepant results can be observed in short and long term culture methods because the cell populations are different. The direct or short-term culture selectively grows the rapidly dividing cytotrophoblast cells, and the long-term culture promotes the growth of mesenchymal core cells (Phillips et al, 1997). The mesenchymal core cells are thought to be more representative of the fetal cells (Phillips etal, 1997), presumably because mesenchymal cells and the embryo proper both originate from the progenitor cells in the inner cell mass (Crane and Cheung, 1988). C P M is identified in 1-2% of C V S when a different cytogenetic result is obtained from amniocentesis or fetal blood karyotyping, both of which are representative of the fetal chromosome constitution (Grati et al, 2006). In contrast, mosaicism found exclusively in the fetal cells is about ten times less common than C P M (Stetten et al, 2004). It has been suggested that a higher rate of placental abnormality is either due to error-prone cell divisions in the extraembryonic cells, or due to a less stringent selection against aneuploidy in the extraembryonic cells compared to the fetal cells (Schreck et al. 1990). A s pregnancy progresses, C P M detected by C V S may disappear, decrease or persist. Approximately 30-50%> of C P M found by C V S is not detectable at term. However, when abnormalities persist, C P M has been associated with negative pregnancy outcomes such as spontaneous abortion, I U G R , or congenital abnormalities (Schwinger et al, 1989; Kalousek et al, 1991; M i n y et al, 1991). C P M has been ascertained through various pregnancy complications, although ascertainment through I U G R cases is the most frequent. 32 1.4.4 Outcomes of pregnancies affected by C P M The majority of pregnancies affected by C P M have normal pregnancy course and fetal development. In fact, an abnormal C V S result is often disregarded when the abnormality is not detectable in the subsequent amniotic fluid cell culture and there is normal fetal development in ultrasound examinations (Simoni and Sirchia, 1994). Also, C P M involving chromosomes 2, 3, 7, 8 and sex chromosomes is usually associated with a normal fetal development (Wolstenholme, 1996; Farra etal., 2000). However, C P M involving chromosomes carrying imprinted genes may have more severe outcomes due to U P D (Wolstenholme et al, 1994). In addition, several prenatal and perinatal complications have been associated with C P M , such as spontaneous abortions, intrauterine growth restriction ( IUGR), and congenital abnormalities. It has been suggested that the outcome of C P M is chromosome specific and largely influenced by the origin (Robinson et al, 1997). 1.4.4.3 Uniparental disomy and C P M Uniparental disomy (UPD), a possible consequence of the 'trisomic rescue', has been associated with meiotic C P M (Robinson et al, 1997). If a trisomic conception loses the duplicated chromosome, it leads to a normal constitution with biparental chromosomes. However, i f two chromosomes from the same parent are left after "rescue", the result is a U P D . In theory, the probability of U P D resulting from trisomic rescue is one in three, derived from a random loss of one chromosome out of three. However, U P D is present in 14.2% of C P M and in 49% of the meiotically derived cases (reviewed by Kotzot, 2002). The deviation from the expected one-third ratio can possibly be explained by ascertainment bias toward I U G R and other pregnancy complications (Robinson et al, 1997). In agreement with the high incidence of U P D in meiotic C P M , U P D occurs with high levels of mosaicism, particularly in the trophoblast (Robinson et al, 1997; Kotzot, 2002). U P D has been correlated to negative pregnancy outcomes including I U G R , malformations, and fetal death, presumably due either to altered expression of imprinted genes that are developmentally important or to homozygosity of recessive traits (Wolstenholme et al, 2001, Robinson et al, 1997). 33 1.4.4.1 Pregnancy loss and C P M A positive correlation has been suggested between C P M and fetal losses including spontaneous abortion (SA), intrauterine death (KID), neonatal death, and stillbirth, partially due to ascertainment bias (Table 1.4). It has been suggested that these losses may result from abnormal placental development and function caused by the presence of chromosomally abnormal cells in the placenta (Kalousek et al, 1992). The reported S A rates in pregnancies affected by C P M range between 5% and 33% (Eiben et ai, 1990; Warburton et al., 1978; Qumsiyeh, 1998; Griffin et al, 1997; Johnson etal, 1990; Hogge etal, 1986). C P M has also been associated with stillbirth and neonatal death in 4.8% and 2.4% of cases, respectively (Johnson et al, 1990). However, the C P M rate is often underestimated in many studies because only one tissue type and low number of cells are examined (Kalousek et al, 1992; Wolstenholme, 1996). Table 1.4 Fetal loss and C P M Reference Abnormality Ascertained through Cytogenetic results Troph(%) Stroma(%) pregnancy outcomes Kalousek et al, 1992 Trisomy2 SA 100 73 SA Trisomy 3 SA 27 100 SA Trisomy 4 SA 0 100 SA Trisomy 7 SA 100 60 SA Trisomy 16 SA 58 100 SA Trisomy 16 SA 100 84 SA Trisomy 16 SA 100 - SA Tetraploidy SA 0 100 SA Tetraploidy SA 0 100 SA Tetraploidy SA 13 100 SA Kennerknecht et al., trisomy 18 CVS positive IUD at 3 lwks 1993 Leschotef ai, 1996 tetraploidy CVS 100 ~ neonatal death, micrognathia trisomy 10 CVS 63 ~ infant death 7wks, heart defect Griffin et al., 1997 trisomy 16 CVS 75 100 SA trisomy 13 CVS 0 100 SA iso (8q) CVS 0 63 SA trisomy 15 CVS 0 100 SA Qumsiyeh, 1998* monosomy X SA 0 100 SA trisomy 16 SA 0 100 SA Farm etal., 2000 Trisomy 9 CVS 30 ~ SA trisomy 13 CVS 10 ~ SA trisomy 16 CVS 80 -- SA 34 1.4.4.2 Intrauterine growth restriction ( IUGR) and C P M I U G R , birth weight below the 10 t h percentile for gestational age, has also been linked to C P M (Leschot etal, 1996). The incidence of C P M in pregnancies ascertained through I U G R has been reported to range from 6.5% to 16%, which is significantly higher than the background rate'(1-2%, detected by C V S ) (Kennerknecht et al, 1993; Wolstenholme et al, 1994; Leschot etal, 1996). The chromosomes most commonly involved in IUGR-related C P M are (in order of prevalence) chromosome 16, followed by chromosomes 22, 2, 7, and 8 (Table 1.5). Table 1.5 C P M ascertained from abnormal C V S in fetuses affected by I U G R Reference abnonnality % abnormalities detected by CVS Direct (trophoblast) Cultured (mesenchyme) Kalousekera/., 1991 Trisomy 2 Trisomy 7 Trisomy 7 Trisomy 15 Tetraploidy Trisomy 8 2 7 53 96 24 73 10 0 33 0 Schring-Blom etal, 1993 100 100 100 78 Monosomy X Kennerknecht et al., 1993 Trisomy 18 Tetraploidy Wolstenholme et al., 1994 Triple trisomy 6, 21, 22 Double trisomy 2, 15 Leschot etal, 1996 Trisomy 9 Trisomy 16 Trisomy 16 Trisomy 16 del (13) (ql3) Trisomy 22 Trisomy 3 Trisomy 8 Trisomy 13 Trisomy 13 Trisomy 16 Trisomy 22 30 100 100 100 31 100 54 13 100 95 89 100 53 100 13 Monosomy X Monosomy X double trisomy 20, 21 double trisomy 5, 13 46, XX, der(5) 35 Reference abnormality % abnormalities detected by CVS Direct (trophoblast) Cultured (mesenchyme) Robinson et al., 1997* Trisomy 2 100 43 Trisomy 7 100 --Trisomy 8 0 100 Trisomy 16 100 100 Trisomy 16 100 100 Trisomy 16 100 100 Trisomy 16 100 --Trisomy 16 100 100 Trisomy 16 -- 100 Trisomy 22 100 -Trisomy 22 70 66 Farmer al., 2000 Trisomy 2 40 -Trisomy 2 30 -Double Trisomy 13, 16 48 --* includes data from Hansen et al. (1993) and Kalousek et al. (1996) 36 The investigation o f C P M in term placentas has been conducted by many groups (Table 1.6). The C P M rate at term in I U G R pregnancies has been estimated to be approximately 15%, which is significantly higher than that detected in pregnancies with normal outcomes (about 1.5%) (Wilkins-Haug, et al, 2006; Minor el al, 2006). Only two studies failed to identify C P M in any o f the I U G R pregnancies studied (Kennerknecht et al, 1993; Verp and Uriger, 1990). However, only one tissue type was analyzed in these studies and therefore, the rate is presumably underestimated. Table 1.6 C P M in term placentas Reference IUGR Non- Abnormality detected Methods n (%) IUGR (% aneuplody) Kalousek and Dill, 1983 2/9 (22.2) 0/9 (1) trisomy 2 culture chorion (100 cells) (1) trisomy X Verp andUnger, 1990 0/11 0/2 culture chorion (10 cells) Kennerknecht et al., 1993 0/71 0/24 STC/LTC (20 cells) Krishnomoorthy et al., 4/26 0/30 (2) monosomy 21 (>15) Culture villi-FISH 1995 (15.4) (30 cells) (1) monosomy 3 (>15) (1) multiple aneuploidy Artaner al., 1995 6/10 (60) 0/115 (1) trisomy 14 (17) culture chorion, villi (1) trisomy 18 (52) (10-15 cells) (2) trisomy 21 (17, 54) (1) monosomy X (59) (1) tetraploidy (54) Cowles etal., 1996 1/20 (5) 0/20 (1) tetraploidy culture villi (20 cells) Amiel etal., 2002 8/16 (50) 0/6 (1) Trisomy 8, XXY CGH on villi (1) XXY (1) monosomy 16, 17 (1) monosomy 17 (3) XXX ( l )XYY Matsuzaki et a I., 2004 9/50 n.a (1) trisomy 22 (80) culture villi (50 cells) (1) trisomy 2 (84) (1) trisomy 7 (68) other cases n.a Wilkins-Haug et ai, 1995 11/70 1/70 (10) tetraploidy LTC chorion (>10 cells) (15.7) (1,4) (1) double trisomy 17, 21 Barrett etal. 2001 0 5/219 (1) trisomy 2 (21) CGH -(2.3) (background rate) (1) trisomy 4 (17) chrorion, villi, trophoblast (1) trisomy 12 (15) (1) trisomy 13 (13) (1) trisomy 18 (77) Total 43/303 6/515 (14.2) (1.2) 37 The mechanism by which C P M causes fetal growth abnormalities remains unknown; however, several studies have characterized IUGR-related C P M . It has been reported that I U G R is more prevalent in pregnancies with type III C P M (Johnson et al, 1990; Kalousek et al 1991), particularly when the high level of abnormality persisted to term (Miny et al, 1991). It has also been suggested that C P M with meiotic origin is associated with a higher risk of I U G R (Robinson et al, 1997). Meiotic C P M is intrinsically related to higher level o f aneuploidy and U P D , thus it is difficult to distinguish the effects by the high-level mosaicism, U P D , or undetected fetal trisomy (Kalousek et al, 1993; Robinson et al, 1997). However, evidence from U P D 16 indicates that U P D may cause abnormal fetal growth independently of fetal trisomy (Yohg et al, 2002). It has also been suggested that certain types of U P D may have placenta-specific imprinting effects that influence placental function and thus, cause abnormal fetal growth (Robinson et al, 1997). 1.5 Genomic imprinting The other possible contributing factor for the elevated incidence of abnormal pregnancies outcomes derived from ICSI may be epigenetic alteration in imprinted genes. Genomic imprinting is the differential gene expression of alleles from different parents. 1.5.1 Imprinted genes and human health One to two hundred genes in human are estimated to be imprinted (Lucifero, 2004). Imprinted genes tend to be clustered within the same chromosomal domain, resulting in a highly coordinated regulatory system. Several imprinting centres have been identified, which can affect the expression of imprinted genes kilobases away (Spahn and Barlow, 2003). Another hallmark of imprinted genes is the abundance of C p G islands. A mouse study has suggested that approximately 88% of imprinted genes have C p G islands compared to the average of 47% observed in the whole genome (Paulsen et al, 2000). Tandem repeats are also abundant in the vicinity of the C p G islands and considered important for the maintenance of their imprints (Reinhart etal, 2002). In addition, asynchronous replication timing (Kitsberg et al, 1993) and sex-specific meiotic recombination frequency (Paldi et al, 1995; Robinson and Lalande, 1995) are two other features of imprinted genes. 38 Current understanding on genomic imprinting suggests that the regulation of expression of imprinted genes is rather intricate. A primary imprint by means of methylation is established in the germ line. However, a secondary imprint may be acquired during post-implantation development to stabilize the imprints either through D N A methylation and/or histone modifications (Gabory et al, 2006). For instance, a secondary imprint is placed on the differentially methylated region 1 ( D M R 1 ) of thelg/2r (insulin-like growth factor 2 receptor) promoter region (Fournier et al, 2002; Yang et al, 2000). Finally, tissue-specific transcription factors control the expression of imprinted genes (Gabory et al, 2006). Imprinted genes are highly expressed in fetal and placental tissues during development; thus, their importance in early development is speculated. Disruptions of imprinted genes such as Igf2 in mice, , have been shown to lead to placental insufficiency and I U G R (Constancia etal, 2002). Aberrant expression of imprinted genes have also been associated with many imprinting disorders such as Beckwith-Weidmann syndrome (BWS), Prader-Willi syndrome (PWS), Angelman syndrome (AS) and Silver-Russell Syndrome (SRS) in human (Table 1.7). The phenotypes of these imprinting disorders include developmental delay, neurological disorders, hormonal and metabolic dysfunctions, and certain types of cancers. The pathogenesis seems to also be distinctive for each disease and presumably depends on the chromosome involved. Imprinting disorders can be caused by epimutations, uniparental disomies (UPD), translocations, deletions of the imprinting regulatory region, and even microdeletions or point mutations that interrupt the imprints (reviewed by Walter and Paulsen, 2003). Table 1.7 Common imprinting disorders in human. Disorder Main phenotype (s) Loci Main genes involved Pathogenesis OMIM Beckwith-Wiedemann Syndrome (BWS) Over-growth, Wilm's cancer llpl5.5 IGF2, CDKN1C Imprinting defects; UPD; Duplication; translocation 130650 Prader-Willi Syndrome (PWS) Obesity, muscular hypotonia 15ql 1-13 SNRPN Deletion; matUPD; Imprinting defects 176270 Angelman Syndrome (AS) Neurological disorder 15qll-13 UBE3A Deletion; patUPD; Imprinting defects 105830 Silver-Russell Syndrome (SRS) Pre- and postnatal growth retardation 7pll.2 7q32 GRB10, PEG! UPD; Duplication; Translocation; Inversion 180860 39 1.5.2 Epigenetic regulation of imprinted genes Imprinting is regulated by epigenetic modifications such as histone modifications and D N A methylation (L i , 2002). Histone modifications including acetylation, phosphorylation, methylation, and ubiquination have been suggested to play important roles on imprinted genes. These modifications may not only regulate accessibility of D N A binding proteins, but also serve as landmarks for effector proteins (Morgan et al., 2005). However, understanding of the mechanism and functions of histone modification is still limited. D N A methylation is the best characterized epigenetic modulator in the literature. Approximately 70 imprinted genes have been identified to be regulated by D N A methylation at differentially methylated regions (DMRs) (Holmes and Soloway, 2006). D N A methylation is the attachment of methyl groups (-CH3) to cytosine bases located at the 5'side of guanosines (CpG). D N A methylation is facilitated by D N A methyltransferases ( D N M T s ) and use of S-adenosylmethionine as the methyl donor (Bestor, 1988). The role of D N M T 1 is to maintain methylation patterns in replicated D N A sequences with its ability to recognize hemi-methylated D N A sequences. D N M T 3a/3b and 3L function on de novo methylation and are particularly important in the establishment of imprints (Suetake etal, 2004). Although D N M T 3 L lacks methyltransferase activity, it regulates the catalytic activity of other enzymes in the D N M T 3 family both in vitro and in vivo (Hata el al, 2002; Suetake et al, 2004). The function of D N M T 2 has not been fully elucidated. L i u et al. (2003) confirmed D N M T 2 activity for methylation of the endogenous genomic sequence in vivo, although biallelic deletion of Dnmt2 does not cause any obvious methylation defects in mice (Okano et al, 1998). The mechanism of D N A methylation has been extensively studied using the murine model. There are three main components in the life cycle of primary methylation imprints: erasure, establishment, and maintenance. Around the time of implantation (10.5 to 12.5 days post coitum), D N A demethylation takes place in primordial germ cells (PGCs) up until their arrival to the genital ridge (Hajkova et al, 2002). As a result, the old imprints from the parents are erased so that a new set of imprints can be established according to the sex of the embryo (Brandeis et al, 1993; Tada etal, 1998). Demethylation in male and female P G C s 40 appears to occur around the same time for most genes and is completed by day 12 -13 of embryonic development. The mechanism of demethylation remains unknown; however, it has been suggested to be an active process because it is completed within one day (Hajkova etal, 2002). Subsequent to erasure, new imprints are established by de novo methylation during gametogenesis. It is well documented that this process occurs at different times in the male and the female. In the male, remethylation occurs earlier, starting before spermatogonia stage in the embryo and is completed by the pachytene stage of meiosis I at puberty (Davis et al, 2000). In contrast, oocytes begin to acquire methylation postnatally while still arrested at prophase I, and methylation is completed by metaphase II for most genes (Obata et al, 1998). The establishment of imprints in spermatocytes is mainly conducted by DNMT3a /3b , D N M T 3 L , and histone modification enzymes such as Suv39h and H D A C s (Lucifero et al, 2002; Obata and Kono, 2002). In oocytes, de novo methylation is also mediated by DNMT3a/3b and D N M T 3 L , but no histone modification is involved (Suetake et al, 2004). A n oocyte-specifie D N M T 1 isoform has been identified during oocyte growth; however, it does not appear to be involved in de novo methylation (Howell et al, 2001). Interestingly, there seems to be an allele-dependent difference in the timing of re-methylation in some imprinted genes. As seen in the paternally methylated H19 and maternally methylated Snrpn, studies using mice suggested that the originally methylated alleles acquired de novo methylation earlier than the originally unmethylated ones, as i f the alleles retained epigenetic memory of their origin (Davis et al, 1999; Lucifero et al, 2004). These finding suggested that other types of epigenetic markings, perhaps histone modifications, may persist after complete erasure of methylation in those genes and provide signals for earlier remethylation (Morgan etal, 2005). Once the imprints are established in the gametes, they are maintained through fertilization and development, even during a wave of gehome-wide demethylation occurring in zygotes after the fertilization (Figure 1.6) (Reik and Walter, 2001). The maternal genome is demethylated by a passive mechanism that depends on the absence of D M N T 1 function during D N A replication; whereas, the paternal genome is presumably demethylated by an 41 active mechanism as it occurs before D N A replication. Although it is not understood how imprinted genes escape the active and passive genome-wide demethylation in early embryos, a specialized chromatin structure has been speculated to preserve methylation at those genes (Reik and Walter, 2001). Several cis-acting D N A sequences have been suggested to bring about the specialized chromatin structure. For instance, these cis-acting signals include the tandem repeats seen with Rasgrf 1 (Yoon et al, 2002), the 'maintenance o f paternal imprint' (MPI) sequences in Snrpn (Kantor et al, 2004), and the differentially methylated region ( D M R ) of HI9. Similarly, the unmethylated alleles are also thought to be maintained by distinct chromatin structure from de novo re-methylation around the time of implantation (Reik and Walter, 2001). D N M T s are suggested to be trans-acting factors that affect the maintenance of imprinted methylation. Okano etal (1999) reported t h a t D N M T 1 and D N M T 3a/3b are required for the maintenance of methylation at the D M R 2 of IGF2. > _ l c o sz c5 PGCs Gametogenesis Fertilization (Imprinted genes) Male gamete Male r|enome Female gamete / | Female genome \ \ Germ line-specific epigenetic remodeling Genome-wide epigenetic remodeling Figure 1.6 Methylation reprogramming in germ lines and in preimplantation embryos. Imprinted genes and some repeat sequences (green dashed line) do not become demethylated after fertilization. Unmethylated imprinted genes do not become methylated in somatic cells during development. PGCs : Primordial germ cells; E M : embryonic lineage; E X : extraembryonic lineage. 42 1.5.3 Genomic imprinting in the placenta A genetic conflict model has been proposed to explain the evolution of imprinted genes which suggests that the paternal genome promotes growth of the placenta as the nutritive source for the fetus whereas the maternal genome is inhibitory with respect to the placental development to preserve resources for her own survival (Haig, 1996). Nuclear transplantation experiments that generated parthenogenetic embryos demonstrated such contrasting contributions of the maternal and paternal genome to the embryonic and extraembryonic development (McGrath and Solter, 1984). Similar parental conflicts in human physiological development also include hydatidiform moles and ovarian teratoma (de Grouchy, 1980). Indeed, functional discrepancy is apparent in placental development for many imprinted genes. Data from knockout and transgenic mice suggest that, in general, the paternally active genes tend to enhance the placental growth and the maternally active genes suppress placental growth and trophoblastic invasion (Table 1.8). For instance, knockout of paternally expressed Igf2, Pegl, and Peg3 led to restricted growth of the labyrinthine trophoblast, spongiotrophoblast, and labyrinthine blood vessels (Lefebvre et al, 1998; Li et al, 1999; Constanticia et al, 2002); whereas deletions of maternally expressed Igf2r and p57Kip2 resulted in placental hyperplasia in all layers (Ludwig et al, 1996; Takahashi et al, 2000). . Table 1.8 Examples of imprinted genes and their functions Imprinted active function on placenta protein product Reference genes allele growth 1GF2 pat positive Insulin-like growth factor II Constancia et al., 2002 Pegl/Mest pat positive Paternally expressed gene 1 Lefebvre etal, 1998 Peg3 pat positive Paternally expressed gene 3 Li etal, 1999 Ascl2 mat ? (lethal if deleted) Achaete-scute homolog 2 Tanaka, etal, 1997 IGF2r mat negative Insulin-like growth factor II Ludwig etal, 1996 Phlda2 mat negative receptor pleckstrin homology-like domain, family A, member 2 Franker a/., 2004 p57Kip2 mat negative a cyclin-dependent kinase inhibitor Takahashi etal, 2003 Den mat invasion suppressor Decorin Mizuno etal, 2002 Stoxl mat invasion suppressor Storkhead box 1 VanDijk et al, 2005 Ctnna3 mat invasion suppressor Catenin (cadherin-association Van Dijk et al., 2004 protain) a3 43 It is well documented that imprinted genes are highly expressed in extraembryonic tissues. Some imprinted genes even have placenta-specific promoters such as IGF2 PO (Constancia et al, 2002). In addition, placenta-specific expression has been discovered in some imprinted genes. To date, a number of these genes have been identified in mice that are located on chromosomes 2, 6, 7, 10, and 17. While human data is still limited, several genes on chromosomes 10 and 11 have been found (Wagschal and Feil , 2006). Consistently, the paternal allele is suppressed and the maternal allele is expressed for these placenta-specific imprinted genes. Although functions of these genes have not been fully determined, some have been suggested to exhibjt suppressive regulation of placental growth (Phlda2) and trophoblastic invasion (Den, Ctnna3, andStoxl) (Tablel.8). While the maintenance of D N A methylation by D M N T 1 seems to be essential for proper expression of imprinted genes in the embryo (Li et al, 1993), it has been demonstrated that the placental imprinting is maintained independently from D N A methylation (Tanaka et al, 1999; Lewis et al, 2004). Lewis et al. (2004) identified several imprinted genes clustered at the distal end of mouse chromosome 7 (Ascl2, Cd81, Tssc4 and Osbpl5) that exhibit this property. These genes are imprinted exclusively in the placenta and maternally expressed. Also, inactivation of the paternal allele o f these genes is not mediated by D N A methylation because the promoter sequences of these genes were un-methylated. Similar findings have also been observed for the promoters of other placenta-specific imprinted genes such as Slc22a2, Slc22a3, Gatm, Ppplr9a, Pon2, andPon3 (Sleutels et al, 2002; Sandell et al, 2003; Ono et al, 2003). Instead of D N A methylation, the inactive allele is possibly suppressed by histone modification. For instance, histone methylation of K 9 and K27 was observed at those genes on the distal chromosome 7. Furthermore, Kcnqlotl non-coding antisense R N A seems to play a role in the recruitment of such histone modifications (Fitzpatrick et al, 2002). Lewis et al. (2004) also provided an evolutionary explanation for the histone-based mechanism for placenta-specific expression of imprinted genes: histone modification is a less stable but evolutionarily older imprinting mechanism, but such a mechanism is sufficient for the placenta, a temporary organ that develops only during gestation. 44 1.5AH 19 and IGF2 Maternally expressed H19 and paternally expressed IGF2 are known as two paradigms of imprinted genes. These two genes are adjacently located on chromosome l i p 15 in humans and chromosome 7 in mice, with about lOOkb of intervening sequence (Gabory et al., 2006). The proximity of the two genes allows for the sharing of several regulatory elements, including enhancers lying downstream of HI 9 and a differentially methylated region ( D M R ) 2 kb upstream of HI9, which contains 25 CpGs methylated only on the paternal allele in human (Vu et al., 2000). In mice, in addition to the H19 D M R that controls expression o f both genes, Ig/2 exclusively has several additional D M R s , of which D M R 1 and D M R 2 are suggested to have silencing and activating functions on Igf2 expression, respectively (Constancia et al, 2000; Murrell et al, 2001). Human H19/IGF2 has been suggested to have D M R s corresponding to the mouse H I 9 D M R and D M R 2 (Vu et al., 2000). The chromatin structure and the interactions of the regulatory factors between H19 and IGF2 have been studied extensively using targeted deletions and transgenic mice. The latest model in the mouse proposes that chromatin loops separating an active and an inactive nuclear domain are formed distinctively on maternal and paternal chromosomes; thus, regulate the allele-specific expression of Igf2 (Murrell et al, 2004) (Figure 1.7) 45 (a) Schematics of H19/Igf2 Igf2 1_ LU DMR 0 DMR1 DMR 2 H19 **** H19 DMR (b) The chromatin loop model Maternal allele DMR 2 Paternal allele DMR 1 Silent loop Figure 1.7 Schematic structures of HI 9 and Ig/2 (a) and the chromatin loop model (b). ****. m e t hy l a t i on . The Hl9 D M R has been suggested to play a particularly important role in allele-specific expression of H19 and IGF2, as it regulates the interaction between enhancers and promoters of the two genes The H19 D M R is methylated exclusively on the paternal chromosome and contains a CCCTC-b ihd ing factor (CTCF) binding domain (Figure 1.8). Methylation suppresses the/779 promoter of the paternal allele; in contrast, H19 expression occurs on the unmethylated maternal allele. Regulation of IGF2 involves the binding of C T C F , which is a zinc finger protein that binds to the unmethylated maternal allele and functions as an insulator, blocking the interaction of enhancers with the promoter region of IGF2. As a result, IGF2 expression is suppressed on the maternal allele, but occurs on the 46 methylated paternal allele (Fedoriw et al, 2004).. Recent evidence indicates that a post-translational poly ADP-ribosylation of C T C F is important for its proper function. When poly ADP-ribosylation is interrupted, maternal IGF2 is expressed, regardless of C T C F binding (Yu etal, 2004). In addition to regulation ofIGF2 expression, the C T C F binding domain within the D M R has been suggested to be involved in establishment of methylation during gametogenesis. Point mutations in the C T C F binding site led to inappropriate methylation at the maternal allele, suggesting that methylation may be a default state in the H19 D M R unless negatively regulated by C T C F binding site (Pant et al, 2004). Maternal CTCF IGF2 i • DMR H19 Paternal —• ***** IGF2 DMR H19 i OO Figure 1.8 Differentially methylated domain at H19/IGF2. Imprinting regulation at H19 and IGF2 involving maternally methylated D M R domain. H19 and IGF2 play important roles in fetal and placental development, as does many other imprinted genes. Hypermethylation at the H19 D M R , which in turn leads to over-expression of IGF2 and reduced expression of H19, is responsible for the fetal overgrowth observed in B W S patients (OMIM130650). Hypomethylation at the H19 D M R , on the other hand, has been recently associated with the Silver-Russell Syndrome, characterized by I U G R , postnatal growth retardation, and asymmetry ( O M I M 103280) (Gicquel etal, 2005; Bl iek et al, 2006). H19 is highly expressed throughout fetal development in extraembryonic and embryonic tissues mostly derived from endoderm and mesoderm. Postnatal expression of HI9 is significantly down-regulated in all tissues except for skeletal muscles (Weber etal, 2001). However, mice with targeted deletion of H19 were basically viable and fertile, 47 although some deletions within the upstream region and transcription unit resulted in overgrowth of fetuses (Leighton et al, 1995). As indicated above, interruptions in the HI 9 D M R , which decrease H19 expression and increase IGF2 expression, can lead to fetal overgrowth. However, intriguingly a mouse model showed that maternal IGF2 expression was also induced by a deletion within the H19 transcription unit. This implies that in addition to the H19 D M R , the H19 gene product itself may have a regulatory function on IGF2 expression. Because the open reading frames that H19 encodes contain multiple stop codons shortly after the initiators and H19 m R N A does not associate with ribosomes, H19 likely encodes for untranslated R N A (Brannan et al, 1990). In vitro and in vivo studies also suggested that HI9 R N A may affect IGF2 expression in a trans-acting manner (Forne et al, 1997; Wi lk in et al, 2000). These findings may explain the coordinated expression of H19 and IGF2 in the same tissue and at the same developmental stage (Lee et al, 1990). H19 has also been suggested to be a tumor suppressor gene (Hao et al, 1993; Juan et al, 2000). Hao et al (1993) demonstrated tumor suppressing activity in two embryonic tumor cell lines when transfected with H19 expression. Thus, disruption of H19 expression may provide an explanation to the high incidence of Wilms tumor observed in B W S (Gabory et al, 2006). IGF2 is also expressed in the fetus and extraembryonic tissues. A n abundant expression of Ig/2 was observed in the placenta during early development in mice (Reynolds et al, 1997) and was suggested to be related to the early invasion of trophoblast (Hamilton et al, 1998). IGF2, along with other IGFs, have been suggested to positively affect nutrient transport in the placenta (Kniss et al, 1994). A recent murine model demonstrated that targeted deletion of Ig/2 led to absence of a placental specific expression of the P0 transcript and caused reduced growth of the placenta and the fetus. The passive permeability for nutrients across the placenta was found to be significantly decreased. In contrast, active transport mechanisms were initially unrestrained to compensate for the reduced transport; however, this compensation could not supply enough nutrients for later gestational stages and I U G R resulted (Constancia et al, 2002). 48 1.5.6 Epigenetic aberration and ICSI Imprinting disorders casused by epigenetic alterations are over-represented in children conceived through A R T s including ICSI. Normal methylation was detected in 92 children born after ICSI at chromosome 15ql 1-13, which is associated with Angelman syndrome (AS) and Prader-Willi syndrome (PWS) (Manning et al, 2000). However, the sample size was small and the number of methylation sites analyzed was limited. Thus, the link between imprinting error and A R T has yet to be determined. Moreover, conclusions should not be drawn before the investigation of individual risk factors such as embryo culture, oocyte maturation, immature sperm, and abnormal semen parameters. Animal studies have demonstrated that in vitro culture may have effects on epigenetic changes and subsequently, fetal growth and development. Large offspring syndrome (LOS) , characterized by increased birth weight and perinatal morbidity, has been reported in ruminants after nuclear transfer and in vitro culture (Sinclair et al, 2000). L O S has been linked to reduced methylation and expression of Igf2r (Young et al, 2001). However, I U G R or L B W appears to be more prevalent in children born after A R T , and epigenetic alteration of IGF2r has not been correlated to human growth disorders (Maher et al, 2005). Mouse models have provided further insights into the effects of preimplantation culture on expression and epigenetic alterations of different imprinted genes. Growth deficiency was observed in fetuses derived from embryos cultured in media complemented with fetal calf serum. Expression level of imprinted genes such as H19, Igf2, Grb7, and GrblO was altered in those fetuses, whereas Mest expression was not affected (Khosla et al, 2001). Doherty et al (2000) observed increased H19 expression and reduced methylation at the H19 D M R region in embryos cultured in Whitten's medium but not in those cultured in K S O M media with amino acids. Snrpn expression was not affected under the same conditions. Conversely, L i et al. (2005) compared mouse blastocysts and morulas cultured in human tubal fluid (HTF) with those derived in vivo, and detected abnormal H19 expression that possibly resulted from a gain of D N A methylation and histone methylation at the C T C F binding site within the H19 D M R region. The expression of other imprinted genes, Cdknlc and Slc221L, were unaffected. It has been proposed that H19 is particularly vulnerable to 49 the environmental stress compared to other imprinted genes based on overtly observed H19/IGF2 epigenetic alterations under different culture conditions (Doherty et al. 2001). In addition to a gene-dependent methylation change, Mann et al. (2004) proposed a tissue type (embryonic vs. extraembryonic) dependent methylation reduction based on their finding of a particularly high level o f epigenetic alteration in the placenta after in vitro culture. Although these hypotheses remain to be tested, it is clear that in vitro culture of embryos indeed affects gene expression epigenetically, possibly in a gene dependent or tissue dependent manner. Epigenetic alterations observed in a conceptus can be potentially inherited from the parents. A n error can originate from a failure to erase or acquire methylation during gametogenesis. With regard to A R T conceptions, manipulation of gametes may also give rise to epigenetically abnormal germ cells. The current belief is that the oocyte may be more prone to imprinting errors than sperm. In contrast to the early reset of paternal imprints (David et al, 2000), acquisition of maternal imprints occurs after birth, and it is mostly completed by metaphase II with some exceptions. For instance, the maternal methylation in chromosome 15ql l - q l 3 is established after fertilization (El-Maarri et al, 2001). In vitro oocyte maturation ( I V M ) , by which immature germinal vesicle stage oocytes are cultured until metaphase II, may pose a risk as the oocyte undergoes the epigenetic reprogramming in vitro. Mouse data suggested that D N A methylation is altered during I V M at the IGF2r, Mest/Pegl, and H19 loci with the alteration at IGF2r being most frequent (Kerjean et al, 2003). Borghol et al. (2006) detected similar findings in human oocytes retrieved from women who underwent ICSI. A gain of methylation at the C T C F binding domain within the H19 D M R was found in the majority of Mi-arrested oocytes and some of Mil-arrested oocytes that were matured in vitro. In addition to I V M , hormonal treatment may also cause perturbation on maternal imprints. A two-fold higher incidence of abnormal global methylation pattern was observed in two-cell embryos derived from superovulated female mice compared to those from non-superovulated mice. This is consistent with the subsequent finding that embryos derived from superovulation fail to develop to the blastocyst stage at a higher rate (Shi and Haaf, 2002). To date, only three genes - H19, RASGRFJ, and GTL2 - are known to be paternally 50 methylated through primary imprints. Despite this small number of genes known to acquire methylation in spermatogenesis, those genes may play essential role in fetal development. For instance, the importance of HI 9 has been demonstrated by the creation of parthenogenetic mice using H19 ~'~ females as donors for non-growing oocytes to mimic the paternal genome (Kono et al, 2004). Thus, paternal contribution to the epigenetic regulation should not be overlooked. A low level of global methylation in ejaculated sperm has been associated with lower pregnancy rates in I V F (8.3% in the low methylation group vs. 33.3% . in the high methylation group), while no correlation to fertilization rates was observed (Benchaib et al, 2005). When the specific region of 15ql 1-13 imprinting center was examined, Manning etal. (2001) did not find significant difference in methylation of sperm from men with normal semen parameters compared to that with abnormal parameters. On the contrary, Marques et al. (2004) reported incomplete methylation at H19 in oligozoospermic patients, and even more so in severe oligozoospermia, but not in the normozoospermic controls. In ICSI, sperm from infertile men with various abnormal semen parameters are routinely used. Immature spermatids have also been used in cases where ejaculate sperm is not available. In theory, both erasure and re-establishment of primary imprints should be completed by spermatid stage (Reik and Walter, 2001). Shamanski et al. (1999) suggested that imprinting is not affected in mouse embryos derived from ICSI using spermatids. A similar finding was reported by M i k i et al. (2004), who examined mouse embryos derived from round spermatids and detected normal monoallelic expression of HI9, IGF2, Meg3, and IGF2r. Thus, the potential risk regarding epigenetic alteration with the use of ICSI and the accompanying infertility factors is not related to the use of immature male germ cells. However, taking into account that chemical substances or oxidative stress during spermatogenesis have been suggested to alter the chromatin structure and cause D N A damage in sperm (Aitken et al, 2003; Hales et al, 2005), the epigenetic profile in sperm from infertile men requires further investigation. 1.6 Hypothesis and objectives Pregnancies derived from Intracytoplasmic Sperm Injection (ICSI) have been associated with an increased incidence of low birth weight ( L B W ) (Schieve et al, 2002, 51 Katalinic etal, 2004), birth defects (Hansen et al, 2002), chromosomal abnormalities particularly involving sex chromosomes (Bonduelle etal, 2002), and imprinting disease (DeBaun et al, 2003; Cox et al, 2002). Nevertheless, the underlying causes for these adverse outcomes remain unknown. One contributing factor to some of the negative pregnancy outcomes may be Confined Placenta Mosaicism ( C P M ) . Although the prenatal and perinatal complications reported in ICSI pregnancies are reminiscent of clinical outcomes of C P M , few studies have determined the incidence and parental origin of C P M in ICSI pregnancies. Considering the higher rate of chromosomal abnormalities reported in ICSI newborns (Bonduelle et al, 2002; Lam et al, 2001), it would not be surprising to see a higher rate of placental mosaicism in the ICSI population. If a higher rate of C P M was indeed present in ICSI pregnancies, it may provide an explanation for the increased rate of L B W and S A detected in the ICSI conceptions. In the regard, we speculate a higher rate of C P M in the ICSI pregnancies compared to the general population and expect particularly more profound effects in the L B W group. The ICSI population is subjected to three risk factors that may lead to chromosomal abnormalities - advanced maternal age, male infertility, and the invasiveness of the procedure. According to the limited data on origin, the origin for chromosomal abnormality is primarily paternal, although most abnormality was inherited instead of de novo (Van Opstal et al, 1997; Jozwiak et al, 2004; Boundualle et a\., 2002; Tang et al, 2004). Thus, we speculate that the origin for C P M detected in ICSI pregnancies may differ from that observed in the general population. I f a paternal bias was present in chromosomal abnormalities found in ICSI conceptus, further investigation in sperm would help us to understand the etiology and to assess the risk. Therefore, the rate of chromosomal abnormality was investigated in cases determined with paternal origins. Another possible cause for poor pregnancy outcome may be epigenetic defects in imprinted genes important for fetal and placental growth. Assisted reproductive technologies including ICSI has been linked with a higher rate of imprinting disorders (Beckwith-Wiedemann Syndrome and Angelman Syndrome) predominantly caused by an epigenetic alteration. This is not commonly found in the general population. Furthermore, studies in 52 mice have suggested that the differentially methylated domain ( D M R ) of H19/IGF2 is particularly vulnerable to lose methylation in response to an unfavorable media condition. Such effects appear to be most apparent in the placenta (Doherty et al, 2000). Because H19 and IGF2 are two important developmental genes, loss of methylation at H19/IGF2 may subsequently leads to poor placental and fetal development. Taking into account the ICSI-related risk factors for epigenetic alterations such as in vitro oocyte maturation, embryo culture, and the use of immature sperm and sperm with abnormal semen parameters, we speculate that altered methylation pattern at the D M R of H19/IGF2 may be associated with L B W observed in the ICSI population. In summary, we hypothesize that (1) C P M may be more frequently detected in placentas derived from ICSI pregnancies, especially from those with L B W . 2) The origin o f C P M in ICSI pregnancies may differ from the commonly observed mitotic origin in the general population; (3) Epigenetic alteration may be present at H19/IGF2 in placentas derived from ICSI pregnancies with L B W . Objective 1: To investigate the incidence of C P M in placentas derived from ICSI (Chapter II) Objective 2: To determine the parental origin of C P M and non-mosaic chromosomal abnormalities in ICSI conceptions (Chapter III). Objective 3: To determine the aneuploidy rate in sperm from the paternally derived chromosomal abnormalities (Chapter IV). Objective 4: To investigate the methylation status at two CpGs from the D M R of H19/IGF2 in placentas from ICSI pregnancies with L B W (Chapter V ) . 1.7 Bibliography Aitken, R.J., Baker, M A . and Sawyer, D. (2003) Oxidative stress in the male germ line and its role in the aetiology of male infertility and genetic disease. Reprod. Biomed. Online, 7, 65-70. Alberts B. Bray D. Lewis J, Raff M, Roberts K and Watson JD (1983) Physiological role of human placenta growth hormone. Mol Cell Endocrinol., 140, 121-127. Amiel A, Bouaron N, Kidron D, Sharony R, Gaber E, Fejgin MD (2002) CGH in die detection of confined placental mosaicism (CPM) in placentas of abnormal pregnancies.Prenat Diagn., 22, 752-8. 53 Anderson AN, Gianaroli L, Nygren KG. (2004) Assisted reproductive technology in Europe, 2000. Results generated from European registries by ESHRE. Hum Reprod., 19, 490-503. Artan, S., Basaran, N., Hassa, H., Ozalp, S., Sener, T., Sayli, B.S., Cengiz, C , Ozdemir, M., Durak, T. and Dolen, I. (1995) Confined placental mosaicism in term placentae: analysis of 125 cases. Prenat. Diagn., 15, 1135-1142. Aytoz A, De Catte L, Camus M, Bouduelle M, Van Assche, Liebaers I, Van Steirteghem A and Devroey P (1998a) Obstetric outcome after prenatal diagnosis in pregnancies after intracytoplasmic sperm injection. Hum Reprod., 13,2958-2961 Aytoz A, Camus M, Tournaye H, Bouduelle M, Van Steirteghem A and Devroey P (1998b) Obstetric outcome of pregnancies after intracytoplasmic sperm injection and the effect of sperm origin and quality on its outcome. Hum Reprod 13: 2958-2961 Aytoz A, Van den Abbeel E, Camus M, Bouduelle M, Joris H, Van Steirteghem A and Devroey P (1999) Obstetric outcome of pregnancies after the transfer of cryopreserved and fresh embryos obtained by conventional in-vitro fertilization and intracytoplasmic sperm injection. Hum Reprod., 14, 2619-2624 Bahceci, M. and Ulug, U. (2005) Does underlying infertility aetiology impact on first trimester miscarriage rate following ICSI? A preliminary report from 1244 singleton gestations. Hum. Reprod., 20, 717-721. Barker, D.J. (1998) In utero programming of chronic disease. Clin. Sci. (Lond), 95, 115-128. Barrett IJ, Lomax BL, Loukianova T, Tang SS, Lestou VS, Kalousek DK (2001) Comparative genomic hybridization. A new tool for reproductive padiology. Arch Pathol Lab Med., 125, 81-84. Bell, G.I., Kayano, T., Buse, J.B., Burant, C.F., Takeda, I, Lin, D., Fukumoto, H. and Seino, S (1990) Molecular biology of mammalian glucose transporters. Diabetes Care, 13, 198-208. Benchaib, M., Bratm, V., Ressnikof, D., Lornage, J., Durand, P., Niveleau, A. and Guerin, J.F. (2005) Influence of global sperm DNA methylation on IVF results. Hum. Reprod., 20, 768-773. Benet J, Oliver-Bonet M, Cifuentes P, Templado C, Navarro J (2005) Segregation of chromosomes in sperm of reciprocal translocation carriers: a review. Cytogenet Genome Res., I l l , 281-90. Bestor, T.H. (1988) Cloning of a mammalian DNA methyltransferase. Gene, 74, 9-12. Bhasin S, de Kretser DM, Baker HW (1994) Clinical review 64: Pathophysiology and natural history of male infertility. J Clin Endocrinol Metab., 79, 1525-9. Bianchi, P.G., Manicardi, G.C., Urner, F., Campana, A. and Sakkas, D. (1996) Chromatin packaging and morphology in ejaculated human spermatozoa: evidence of hidden anomalies in normal spermatozoa. Mol. Hum. Reprod., 2, 139-144. Blair E. (2000) Paediatric implication of IUGR with special reference to cerebral palsy. Intrauterine growth restriction. Springer-Verlag, pp351-363. Blair, P.S., Nadin, P., Cole, T.J., Fleming, P.J., Smith, I.J.; Piatt, M.W., Berry, P.J. and Golding, J. (2000) Weight gain and sudden infant death syndrome: changes in weight z scores may identify infants at increased risk. Arch. Dis. Child., 82, 462-469. 54 Bliek, J., Terhal, P., van den Bogaard, M.J., Maas, S., Hamel, B., Salieb-Beugelaar, G., Simon, M , Letteboer, T., van der Smagt, J. and Kroes, H., et al (2006) Hypomethylation of the H19 gene causes not only Silver-Russell syndrome (SRS) but also isolated asymmetry or an SRS-like phenotype. Am. J. Hum. Genet., 78, 604-614. Bonduelle M, Van Assche E, Joris H, Keymolen K, Devroey P, Van Steirteghem A, and Liebaers I (2002) Prenatal testing in ICSI pregnancies: incidence of chromosome anomalies in 1586 karyotypes and relation to sperm parameters. Hum Reprod., 17, 2600-2614 Bonduelle, M., Camus, M., De Vos, A., Staessen, C , Tournaye, H., Van Assche, E., Verheyen, G., Devroey, P., Liebaers, I. and Van Steirteghem, A. (1999) Seven years of intracytoplasmic sperm injection and follow-up of 1987 subsequent children. Hum. Reprod., 14 Suppl 1, 243-264. Borghol, N., Lornage, J., Blachere, T., Sophie Garret, A. and Lefevre, A. (2006) Epigenetic status of the HI9 locus in human oocytes following in vitro maturation. Genomics, 87, 417-426. Brandeis M, Kafri T, Ariel M, Chaillet JR, McCarrey J, Razin A, Cedar H. (1993) The ontogeny of allele-specific methylation associated with imprinted genes in the mouse. EMBO J., 12, 3669-77. Brandell RA, Mielnik A, Liotta D, Ye Z, Veeck LL, Palermo GD, Schlegel PN (1998). AZFb deletions predict the absence of spermatozoa with testicular sperm extraction: preliminary report of a prognostic genetic test. Hum Reprod., 13, 2812-5. Brannan CI, Dees EC, Ingram RS, Tilghman SM (1990). The product of the HI9 gene may function as an RNA. Mol Cell Biol., 10(1), 28-36 Carlson, B.M. (2004) Human embryology and developmental biology. Philadelphia: Mosby, 3rd ed: pp3-41. Carrell DT, Wilcox AL, Udoff LC, Thorp C, Campbell B (2001) Chromosome 15 aneuploidy in the sperm and conceptus of a sibling with variable familial expression of round-headed sperm syndrome. Fertil Steril., 76, 1258-60. Causio F, Fischetto R, Sarcina E, Geusa S, and Tartagni M (2002) Chromosome analysis of spontaneous abortions after in vitro fertilization (IVF) and intracytoplasmic sperm injection (ICSI). Eur J Obstet Gynecol Reprod Biol., 105, 44-48. Cetin, I. (2003) Placental transport of amino acids in normal and growth-restricted pregnancies. Eur. J. Obstet. Gynecol. Reprod. Biol., 110 Suppl 1, S50-4. Cetin, I., Cozzi, V. and Antonazzo, P. (2003) Fetal development after assisted reproduction—a review. Placenta, 24 Suppl B, S104-13. Chillon M, Casals T, Mercier B, Bassas L, Lissens W, Silber S, Romey MC, Ruiz-Romero J, Verlingue C, Claustres M, et all(1995) Mutations in the cystic fibrosis gene in patients with congenital absence of the vas deferens. N Engl J Med., 332, 1475-80. Chow V, Cheung AP (2006) Male infertility. J Reprod Med., 51, 149-56. Constancia M, Hemberger M, Hughes J, Dean W, Ferguson-Smith A, Fundele R, Stewart F, Kelsey G, Fowden A, Sibley C, Reik W (2002) Placental-specific IGF-II is a major modulator of placental and fetal growth. Nature., 417, 945-8. Cowles TA, Zneimer SM, Elder FFB (1996) A prospective cytogenetic study in third trimester, placentas of fetuses with unexplained intrauterine growth restriction. J Matern Fetal Invest., 6, 207-109. 55 Cox GF, Burger J, Lip V, Mau UA, Sperling K, Wu BL, Horsthemke B (2002) Intracytoplasmic sperm injection may increase the risk of imprinting defects. Am J Hum Genet., 71, 162-4. Craft, I.L., Khalifa, Y., Boulos, A., Pelekanos, M , Foster, C. and Tsirigotis, M (1995) Factors influencing the outcome of in-vitro fertilization with percutaneous aspirated epididymal spermatozoa and intracytoplasmic sperm injection in azoospermic men. Hum. Reprod., 10, 1791-1794. Crane JP, Cheung SW. (1988) An embryogenic model to explain cytogenetic inconsistencies observed in chorionic villus versus fetal tissue.Prenat Diagn., 8, 119-29. Cupisti S, Conn CM, Fragouli E, Whalley K, Mills JA, Faed MJ, Delhanty JD (2003) Sequential FISH analysis of oocytes and polar bodies reveals aneuploidy mechanisms. Prenat Diagn., 23(8):663-8. Davis TL, Yang GJ, McCarrey JR, Bartolomei MS (2000) The HI 9 methylation imprint is erased and re-established differentially on the parental alleles during male germ cell development. Hum Mol Genet., 9(19), 2885-94. de Grouchy J (1980) Human parthenogenesis: a fascinating single event. Biomedicine., 32, 51-3. DeBaun MR, Niemitz EL, Feinberg AP (2003) Association of in vitro fertilization with Beckwith-Wiedemann syndrome and epigenetic alterations of LIT1 and H19. Am J Hum Genet. 72, 156-60. Devroey, P. and Van Steirteghem, A (2004) A review of ten years experience of ICSI. Hum. Reprod. Update, 10, 19-28. Doherty AS, Mann MR, Tremblay KD, Bartolomei MS, Schultz RM. (2000) Differential effects of culture on imprinted HI 9 expression in the preimplantation mouse embryo. Biol Reprod. 62, 1526-35. Douet-Guilbert, N., Bris, M.J., Amice, V., Marchetti, C , Delobel, B., Amice, J., Braekeleer, M.D. and Morel, F (2005) Interchromosomal effect in sperm of males with translocations: report of 6 cases and review of the literature. Int. J. Androl., 28, 372-379. Edwards, R.G., Steptoe, P.C. and Purdy, J.M. (1980) Establishing full-term human pregnancies using cleaving embryos grown in vitro. Br. J. Obstet. Gynaecol., 87, 737-756. Eiben, B., Bartels, I., Bahr-Porsch, S., Borgmann, S., Gatz, G., Gellert, G., Goebel, R., Hammans, W., Hentemann, M. and Osmers, R. (1990) Cytogenetic analysis of 750 spontaneous abortions with the direct-preparation method of chorionic villi and its implications for studying genetic causes of pregnancy wastage. Am. J. Hum. Genet., 47, 656-663. Elder and Dale (2001) In vitro fertilization. Cambridge, 2nd ed: pp 1-92 Elliott, M. andMaher, E.R. (1994) Beckwith-Wiedemann syndrome. J. Med. Genet., 31, 560-564. El-Maarri O, Buiting K, Peery EG, Kroisel PM, Balaban B, Wagner K, Urman B, Heyd J, Lich C, Brannan CI, Walter J, Horsthemke B (2001) Maternal methylation imprints on human chromosome 15 are established during or after fertilization. Nat Genet., 27(3), 341-4. Erenpreiss, J., Bungum, M., Spano, M., Elzanaty, S., Orbidans, J. and Givvercman, A. (2006) Intra-individual variation in sperm chromatin structure assay parameters in men from infertile couples: clinical implications. Hum. Reprod., 21, 2061-2064. 56 Evenson, D.P., Jost, L.K., Marshall, D., Zinaman, M.J., Clegg, E., Purvis, K., de Angelis, P. and Claussen, O.P. (1999) Utility of the sperm chromatin structure assay as a diagnostic and prognostic tool in the human fertility clinic. Hum. Reprod., 14, 1039-1049. Farra, C , Giudicelli, B., Pellissier, M.C., Philip, N. and Piquet, C. (2000) Fetoplacental chromosomal discrepancy. Prenat. Diagn., 20, 190-193. Fedoriw A.M., Stein P, Svoboda P, Schultz R, and Bartolomei MS. (2004) Transgenic RNAi reveals essential function for CTCF in H19 gene imprinting. Science. 303, 238-240 Fitzpatrick, G.V., Soloway, P.D. and Higgins, M.J. (2002) Regional loss of imprinting and growth deficiency in mice with a targeted deletion of KvDMRl. Nat. Genet., 32, 426-431. Forne, T., Oswald, I, Dean, W., Saam, J.R., Bailleul, B., Dandolo, L., Tilghman, S.M., Walter, J. and Reik, W. (1997) Loss of the maternal HI9 gene induces changes in IGF2 methylation in both cis and trans. Proc. Natl. Acad. Sci. U. S. A., 94, 10243-10248. Fournier, C , Goto, Y., Ballestar, E., Delaval, K., Hever, A.M., Esteller, M. and Feil, R. (2002) Allele-specific histone lysine methylation marks regulatory regions at imprinted mouse genes. EMBO J., 21, 6560-6570. Gabory, A., Ripoche, M. A., Yoshimizu, T. and Dandolo, L. (2006) The HI9 gene: regulation and function of a non-coding RNA. Cytogenet. Genome Res., 113, 188-193. Gandini L, Lombardo F, Paoli D, Caponecchia L, Familiari G, Verlengia C, et al (2000) Study of apoptotic DNA fragmentation in human spermatozoa. Hum Reprod., 15, 830-9. Gazvani R, Lewis-Jones DI (2004) Cystic fibrosis mutation screening before assisted reproduction. Int J Androl., 27, 1-4. Gekas J, Thepot F, Turleau C, Siffroi JP, Dadoune JP, Briault S, Rio M, Bourouillou G, Carre-Pigeon F, Wasels R, Benzacken B (2001) Association des Cytogeneticiens de Langue Francaise. Cliromosomal factors of infertility in candidate couples for ICSI: an equal risk of constitutional aberrations in women and men. Hum Reprod. 16, 82-90. Gicquel C, Gaston V, Mandelbaum J, Siffroi JP, Flahault A, Le Bouc Y (2003) In vitro fertilization may increase the risk of Beckwith-Wiedemann syndrome related to the abnormal imprinting of the KCNIOT gene. Am J Hum Genet., 72, 1338-41. Gicquel, C , Rossignol, S., Cabrol, S., Houang, M., Steunou, V., Barbu, V., Danton, F., Thibaud, N , Le Merrer, M. and Burglen, L., et al (2005) Epimutation of the telomeric imprinting center region on chromosome 1 lpl5 in Silver-Russell syndrome. Nat. Genet., 37, 1003-1007. Govaerts I, Devreker F, Koenig I, Place I, Van den Bergh M, Englert Y (1998) Comparison of pregnancy outcome after intracytoplasmic sperm injection and in-vitro fertilization. Hum Reprod. 13, 1514-8. Grati, F.R., Grimi, B., Frascoli, G., Di Meco, A.M., Liuti, R., Milani, S., Trotta, A., Dulcetti, F., Grosso, E. and Miozzo, M., et al (2006) Confirmation of mosaicism and uniparental disomy in amniocytes, after detection of mosaic chromosome abnormalities in chorionic villi. Eur. J. Hum. Genet., 14, 282-288. Griffin DK, Millie EA, Redline RW, Hassold TJ, ZaragozaMV. (1997) Cytogenetic analysis of spontaneous abortions: comparison of techniques and assessment of the incidence of confined placental mosaicism. Am J Med Genet, 72, 297-301. 57 Haig, D (1996) Altercation of generations: genetic conflicts of pregnancy. Am. J. Reprod. Immunol., 35, 226-232. Hajkova P, Erhardt S, Lane N, Haaf T, El-Maarri O, Reik W, Walter J, Surani MA.(2002) Epigenetic reprogramming in mouse primordial germ cells. Mech Dev. 117, 15-23. Hales BF, Aguilar-Mahecha A, Robaire B (2005) The stress response in gametes and embryos after paternal chemical exposures. Toxicol Appl Pharmacol., 207, 514-20. Halliday J, Oke K, Breheny S, Algar E, J Amor D (2004) Beckwith-Wiedemann syndrome and IVF: a case-control study. Am J Hum Genet. 75, 526-8 Hamilton, G.S., Lysiak, J.J., Han, V.K. and Lala, P.K. (1998) Autocrine-paracrine regulation of human trophoblast invasiveness by insulin-like growth factor (IGF)-II and IGF-binding protein (IGFBP)-l. Exp. Cell Res., 244, 147-156. Hansen, M., Kurinczuk, J.J., Bower, C. and Webb, S. (2002) The risk of major birth defects after intracytoplasmic sperm injection and in vitro fertilization. N. Engl. J. Med., 346, 725-730. Hansen, W.F., Bernard, L.E., Langlois, S., Rao, K.W., Chescheir, N.C., Aylsworth, A.S., Smith, D.I., Robinson, W.P., Barrett, I.J. and Kalousek, D.K. (1997) Maternal uniparental disomy of chromosome 2 and confined placental mosaicism for trisomy 2 in a fetus with intrauterine growth restriction, hypospadias, and oligohydramnios. Prenat. Diagn., 17, 443-450. Hao Y, Crenshaw T, Moulton T, Newcomb E, Tycko B: Tumor-supressor activity of H19 RNA. Nature 1993, 365, 764-767 Hassold T, Hunt P (2001) To err (meiotically) is human: the genesis of human aneuploidy. Nat Rev Genet 2(4), 280-91. Hassold T, Sherman S, Hunt PA (1995) The origin of trisomy in humans. Prog Clin Biol Res, 393:1-12. Hassold, T.J., Sherman, S.L., Pettay, D., Page, D'.C. and Jacobs, P.A. (1991) XY chromosome nondisjunction in man is associated with diminished recombination in the pseudoautosomal region. Am. J. Hum. Genet., 49, 253-260. Hata, K., Okano, M., Lei, H. and Li, E. (2002) Dnmt3L cooperates with the Dnmt3 family of de novo DNA methyltransferases to establish maternal imprints in mice. Development, 129, 1983-1993. Hatakeyama C, Gao H, Harmer K, Ma S (2006) Meiotic segregation patterns and ICSI pregnancy outcome of a rare (13;21) Robertsonian translocation carrier: a case report. Hum Reprod. 21(4):976-9. Hawley RS, Frazier JA, Rasooly R (1994) Separation anxiety: the etiology of nondisjunction in flies and people. Hum Mol Genet., 3(9), 521-8. Hewitson LC, Simerly CR, Tengowski MW, Sutovsky P, Navara CS, Haavisto AJ, Schatten G (1996) Microtubule and chromatin configurations during rhesus intracytoplasmic sperm injection: successes and failures. Biol Reprod., 55(2), 271-80. Hogge WA, Schonberg SA, Golbus MS. (1986) Chorionic villus sampling: experience of the first 1000 cases. Am J Obstet Gynecol., 154, 1249-52. 58 Holmes, R. and Soloway, P.D. (2006) Regulation of imprinted DNA methylation. Cytogenet. Genome Res., 113, 122-129. Host E, Lindenberg S, Kahn JA, Christensen F (1999) DNA strand breaks in human sperm cells: a comparison between men with normal and oligozoospennic sperm samples. Acta Obstet Gynecol Scand., 78, 336-9. Howell, C.Y., Bestor, T.H., Ding, F., Latham, K.E., Mertineit, C , Trasler, J.M. and Chaillet, J.R. (2001) Genomic imprinting disrupted by a maternal effect mutation in the Dnmtl gene. Cell, 104, 829-838. Hristova R, Ko E, Greene C, Rademaker A, Chernos J, Martin R (2002). Chromosome abnormalities in sperm from infertile men with asthenoteratozoospermia. Biol Reprod. 66(6): 1781-3 Hunt P A Hassold TJ (2002) Sex matters in meiosis. Science 296(5576), 2181-3. Jacobs, P. A., Browne, C , Gregson, N., Joyce, C. and White, H. (1992) Estimates of the frequency of chromosome abnormalities detectable in tmselected newborns using moderate levels of banding. J. Med. Genet., 29, 103-108. Jarvis, S., Glinianaia, S.V. and Blair, E. (2006) Cerebral palsy and intrauterine growth. Clin. Perinatal., 33, 285-300. Jarzabek K, Zbucka M, Pepinski W, Szamatowicz J, Domitrz J, Janica J, Wolczynski S, Szamatowicz M (2004) Cystic fibrosis as a cause of infertility. Reprod Biol., 4, 119-29. Johnson A, Wapner RJ, Davis GH, Jackson LG. (1990) Mosaicism in chorionic villus sampling: an association with poor perinatal outcome. Obstet Gynecol., 75, 573-7. Jozwiak, E. A., Ulug, U., Mesut, A., Erden, H.F. and Bahceci, M. (2004) Prenatal karyotypes of fetuses conceived by intracytoplasmic sperm injection. Fertil. Steril., 82,628-633. Juan, V., Crain, C. and Wilson, C (2000) Evidence for evolutionarily conserved secondary structure in die H19 tumor suppressor RNA. Nucleic Acids Res., 28, 1221-1227. Kalousek DK, Vekemans M. (1996) Confined placental mosaicism. J Med Genet., 33, 529-33. Kalousek, D.K. and Dill, F.J. (1983) Chromosomal mosaicism confined to the placenta in human conceptions. Science, 221, 665-667. Kalousek, D.K, Barrett, I.J. and Gartner, A.B. (1992) Spontaneous abortion and confined chromosomal mosaicism. Hum. Genet., 88, 642-646. Kalousek, D.K., Howard-Peebles, P.N., Olson, S.B., Barrett, I.J., Dorfmann, A , Black, S.H., Schulman, J.D. and Wilson, R.D. (1991) Confirmation of CVS mosaicism in term placentae and high frequency of intrauterine growth retardation association with confined placental mosaicism. Prenat. Diagn., 11, 743-750. Kalousek, D.K!, Langlois, S., Barrett, I., Yam, I., Wilson, D.R., Howard-Peebles, P.N., Johnson, M.P. and Giorgiutti, E. (1993) Uniparental disomy for chromosome 16 in humans. Am. J. Hum. Genet., 52, 8-16. Kantor, B., Makedonski, K., Green-Finberg, Y., Shemer, R. and Razin, A. (2004) Control elements within the PWS/AS imprinting box and their function in die imprinting process. Hum. Mol. Genet., 13, 751-762. 59 Katalinic, A., Rosch, C , Ludwig, M. and German ICSI Follow-Up Study Group (2004) Pregnancy course and outcome after intracytoplasmic sperm injection: a controlled, prospective cohort study. Fertil. Steril., 81, 1604-1616. Kennerknecht I, Kramer S, Grab D, Terinde R, Vogel W. (1993) A triploid fetus with a diploid placenta: proposal of a mechanism. Prenat Diagn. 13, 885-6. Kerjean A, Couvert P, Heams T, Chalas C, Poirier K, Chelly J, Jouannet P, Paldi A, Poirot C. (2003) In vitro follicular growth affects oocyte imprinting establishment in mice. Eur J Hum Genet. 11:493-6. Khosla S, Dean W, Brown D, Reik W, Feil R (2001) Culture of preimplantation mouse embryos affects fetal development and the expression of imprinted genes. Biol Reprod., 64, 918-26. Kingdom J, Baker P, Blair E. (2000) Definition of intrauterine growth restriction. Intrauterine growth restriction. Springer-Verlag, ppl-3. Kitsberg D, Selig S, Brandeis M, Simon I, Keshet I, Driscoll DJ, Nicholls RD, Cedar H (1993) Allele-speciftc replication timing of imprinted gene regions. Nature., 364(6436):459-63 Kliman, H.J., Nestler, J.E., Sennasi, E., Sanger, J.M. and Strauss, J.F.,3rd (1986) Purification, characterization, and in vitro differentiation of cytotrophoblasts from human term placentae. Endocrinology, 118, 1567-1582. KnisS; D.A., Shubert, P.J., Zimmerman, P.D., Landon, M.B. and Gabbe, S.G. (1994) Insulinlike growth factors. Their regulation of glucose and amino acid transport in placental trophoblasts isolated from first-trimester chorionic villi. J. Reprod. Med., 39, 249-256. Kono, T., Obata, Y., Wu, Q., Niwa, K., Ono, Y., Yamamoto, Y., Park, E.S., Seo, J.S. and Ogawa, H. (2004) Birth of parthenogenetic mice that can develop to adulthood. Nature, 428, 860-864. Kotzot, D. (2002) Review and meta-analysis of systematic searches for uniparental disomy (UPD) other than UPD 15. Am. J. Med. Genet., I l l , 366-375. Krausz C, Forti G, McElreavey K (2003) The Y chromosome and male fertility and infertility. Int J Androl., 26, 70-5. Lam, R., Ma, S., Robinson, W.P., Chan, T. and Yuen, B.H. (2001) Cytogenetic investigation of fetuses and infants conceived through intracytoplasmic sperm injection. Fertil. Steril., 76, 1272-1275. Lamb, N.E., Freeman, S.B., Savage-Austin, A., Pettay, D., Taft, L., Hersey, J., Gu, Y., Shen, J., Saker, D. and May, K.M., etal (1996) Susceptible chiasmate configurations of chromosome 21 predispose to non-disjunction in both maternal meiosis I and meiosis II. Nat. Genet., 14, 400-405. Lathi, R.B. andMilki, A. A. (2004) Rate of aneuploidy in miscarriages following in vitro fertilization and intracytoplasmic sperm injection. Fertil. Steril., 81, 1270-1272. Lee, J.E., Pintar, J. and Efstratiadis, A (1990) Pattern of the insulin-like growth factor II gene expression during early mouse embryogenesis. Development, 110, 151-159. Lefebvre, L., Viville, S., Barton, S.C, Isliino, F., Keveme, E.B. and Surani, M.A. (1998) Abnonnal maternal behaviour and growth retardation associated with loss of the imprinted gene Mest. Nat. Genet., 20, 163-169. Leighton, P.A., Ingram, R.S., Eggenschwiler, J., Efstratiadis, A. and Tilghman, S.M. (1995) Disruption of imprinting caused by deletion of the HI 9 gene region in mice. Nature, 375, 34-39. 60 Leschot NJ, Schuring-Blom GH, Van Prooijen-Knegt AC, Verjaal M, Hansson K, Wolf H, Kanhai HH, Van Vugt JM and Christiaens GC (1996) the outcome of pregnancies with confined placental mosaicism in cytotrophoblast cells. Prenat Diagn., 16, 705-712 Lestou, V.S. and Kalousek, D.K. (1998) Confined placental mosaicism and intrauterine fetal growth. Arch. Dis. Child. Fetal Neonatal Ed., 79, F223-6. Lewis, A., Mitsuya, K., Umlauf, D., Smith, P., Dean, W., Walter, J., Higgins, M., Feil, R. and Reik, W. (2004) Imprinting on distal chromosome 7 in the placenta involves repressive histone methylation independent of DNA methylation. Nat. Genet, 36, 1291-1295. Lewis, S. and Klonoff-Cohen, H. (2005) What factors affect intracytoplasmic sperm injection outcomes? Obstet. Gynecol. Surv., 60, 111-123. Li E. (2002) Chromatin modification and epigenetic reprogramming in mammalian development. Nat Rev Genet 3:662-73. Li, L.L., Keverne, E.B., Aparicio, S.A., Isliino, F., Barton, F.C. and Surani, M.A. (1999) Regulation of maternal behavior and offspring growth by paternally expressed Peg3. Science, 284, 330-333. Li, T., Vu, T.H., Ulaner, G.A., Littman, E., Ling, J.Q., Chen, H.L., Hu, J.F., Behr, B., Giudice, L. and Hoffman, A.R. (2005) IVF results in de novo DNA methylation and histone medrylation at an 1GF2-H19 imprinting epigenetic switch. Mol. Hum. Reprod., 11, 631-640. Liu, K., Wang, Y.F., Cantemir, C. andMuller, M.T. (2003) Endogenous assays of DNA methy transferases: Evidence for differential activities of DNMT1, DNMT2, and DNMT3 in mammalian cells in vivo. Mol. Cell. Biol., 23, 2709-2719. Loft A, Petersen K, Erb K, Mikkelsen AL, Grinsted J, Hald F, Hindkjaer J, Nielsen KM, Lundstorm P, Gabrielsen A, Lenz S, Hornnes P, Ziebe S, Ejdrup HB, Lindhard A, Zhou Y and Andersen AN (1999) A Danish national cohort of 730 infants born after Intracytoplasmic sperm injection. Hum Reprod 14: 2143-2148 Lucifero D, Mertineit C, Clarke HJ, Bestor TH, Trasler JM. (2002) Methylation dynamics of imprinted genes in mouse germ cells. Genomics. 79:530-8. Lucifero, D., Chaillet, J.R. and Trasler, J.M. (2004) Potential significance of genomic imprinting defects for reproduction and assisted reproductive technology. Hum. Reprod. Update, 10, 3-18. Ludwig M, Katalinic A, Gross S, Sutcliffe A, Varon R, Horsthemke B (2005) Increased prevalence of imprinting defects in patients with Angelman syndrome born to subfertile couples. J Med Genet., 42(4), 289-91. Ludwig, T., Eggenschwiler, J., Fisher, P., D'Ercole, A.J., Davenport, M.L. and Efstratiadis, A. (1996) Mouse mutants lacking the type 2 IGF receptor (IGF2R) are rescued from perinatal lethality in IGF2 and Igflr null backgrounds. Dev. Biol., 177, 517-535. Ma S, Yuen BH, Penaherrera M, Koehn D, Ness L, Robinson W (2003) ICSI and the transmission of X-autosomal translocation: a three-generation evaluation of X;20 translocation: case report. Hum Reprod. 18(7), 377-82. Ma, S., Philipp, T., Zhao, Y., Stetten, G., Robinson, W.P. and Kalousek, D. (2006) Frequency of chromosomal abnormalities in spontaneous abortions derived from intracytoplasmic sperm injection compared with those from in vitro fertilization. Fertil. Steril., 85, 236-239. 61 Machev N, Gosset P, Viville S (2005). Chromosome abnormalities in sperm from infertile men with normal somatic karyotypes: teratozoospennia. Cytogenet Genome Res. lll(3-4):352-7. Maher ER, Brueton LA, Bowdin SC, Luharia A, Cooper W, Cole TR, Macdonald F, Sampson JR, Barratt CL, Reik W, Hawkins MM. (2003) Beckwith-Wiedemann syndrome and assisted reproduction technology (ART). J Med Genet. 40:62-4. Manicardi, G.C., Bianchi, P.G., Pantano, S., Azzoni, P., Bizzaro, D., Bianchi, U. and Sakkas, D. (1995) Presence of endogenous nicks in DNA of ejaculated human spermatozoa and its relationship to chromomycin A3 accessibility. Biol. Reprod., 52, 864-867. Mann MR, Lee SS, Doherty AS, Verona Rl, Nolen LD, Schultz RM, Bartolomei MS. (2004) Selective loss of imprinting in the placenta following preimplantation development in culture. Development. 131, 3727-35 Manning M, Lissens W, Liebaers I, Van Steirteghem A, Weidner W. (2001) Imprinting analysis in spermatozoa prepared for intracytoplasmic sperm injection (ICSI).Int J Androl., 24, 87-94. Marques CJ, Carvalho F, Sousa M, Barros A. (2004) Genomic imprinting in disruptive spermatogenesis. Lancet 363, 1700-2. Martin RH, Rademaker AW, Greene C, Ko E, Hoang T, Barclay L, Chernos J (2003) A comparison of the frequency of sperm chromosome abnormalities in men widi mild, moderate, and severe oligozoospermia. Biol Reprod. 69, 535-9. Masuzaki H, Miura K, Yoshiura K, Yoshimura S, Niikawa N, Ishimaru T (2004) Detection of cell free placental DNA in maternal plasma: Direct evidence from three eases of confined placental mosaicis. J Med Genet 41, 289-292. Matsuda T, Horii Y, Ogura K, Nonomura M, Okada K, Yoshida O (1992) Chromosomal survey of 1001 subfertile males: incidence and clinical features of males with chromosomal anomalies. Hinyokika Kiyo., 38, 803-9. McCallum TJ, Milunsky JM, Cunningham DL, Harris DH, Maher TA, Oates RD (2000) Fertility in men with cystic fibrosis: an update on current surgical practices and outcomes. Chest. 118(4): 1059-62. McGrath, J. and Solter, D. (1984) Completion of mouse embryogenesis requires both the maternal and paternal genomes. Cell, 37, 179-183. Miharu N (2005) Chromosome abnormalities in sperm from infertile men with normal somatic karyotypes: oligozoospermia. Cytogenet Genome Res 111(3-4), 347-51 Miki H, Lee J, Inoue K, Ogonuki N, Noguchi Y, Mochida K, Kohda T, Nagashima H, Ishino F, Ogura A. (2004) Microinsemination with first-wave round spermatids from immature male mice. J Reprod Dev., 50(1), 131-7. Miller OJ and Therman E. (2001) Human chromosome. Springer-Verlag 4th ed: ppl3-151 Minor A. (2005) Investigation of confined placental mosaicism (CPM) at multiple sites in post-delivery placentas derived through intracytoplasmic sperm injection (ICSI) with comparative genomic hybridization (CGH)., Mater's thesis, University of British Columbia., pp7 Minor, A., Harmer, K., Peters, R , Yuen, B.H. and Ma, S. (2006) Investigation of confined placental mosaicism (CPM) at multiple sites in post-delivery placentas derived through intracytoplasmic sperm injection (ICSI). Am. J. Med. Genet. A., 140, 24-30. 62 Miny P, Hammer P, Gerlach B, Tercanli S, Horst J, Holzgreve W, Eiben B (1991) Mosaicism and accuracy of prenatal cytogenetic diagnoses after chorionic villus sampling and placental biopsies. Prenat Diagn., 11(8), 581-9. Mizuno Y, Sotomaru Y, Katsuzawa Y, Kono T, Meguro M, Oshimura M, Kawai J, Tomaru Y, Kiyosawa H, Nikaido I, Amanuma H, Hayashizaki Y, Okazaki Y (2002) Asb4, Ata3, and Den are novel imprinted genes identified by high-throughput screening using RIKEN cDNA microarray. Biochem Biophys Res Commun., 290(5), 1499-505 Monk, D. and Moore, G.E. (2004) Intrauterine growth restriction—genetic causes and consequences. Semin. Fetal. Neonatal Med., 9, 371-378. Moosani N, Chernos J, Lowry RB, Martin RH, Rademaker A (1999). A 47,XXY fetus resulting from ICSI in a man with an elevated frequency of 24,XY spermatozoa. Hum Reprod.., 14, 1137-8. Moosani, N., Chernos, J., Lowry, R.B., Martin, R.H. and Rademaker, A. (1999) A 47,XXY fetus resulting from ICSI in a man with an elevated frequency of 24,XY spermatozoa. Hum. Reprod., 14, 1137-1138. Morel F, Douet-Guilbert N, Le Bris MJ, Herry A, Amice V, Amice J, De Braekeleer M (2004) Meiotic segregation of translocations during male gametogenesis. Int J Androl. 27(4), 200-12. Morgan, H.D., Santos, F., Green, K., Dean, W. and Reik, W. (2005) Epigenetic reprogramming in mammals. Hum. Mol. Genet, 14 Spec No 1, R47-58. Murrell A, Heeson S, Bowden L, Constancia M, Dean W, Kelsey G, Reik W (2001) An intragenic methylated region in the imprinted IGF2 gene augments transcription. EMBO Rep., 2(12), 1101-6. Murrell, A., Heeson, S. and Reik, W. (2004) Interaction between differentially methylated regions partitions the imprinted genes IGF2 and HI 9 into parent-specific chromatin loops. Nat. Genet., 36, 889-893. Nagvenkar P, Desai K, Hinduja I, Zaveri K (2005) Chromosomal studies in infertile men with oligozoospermia & non-obstructive azoospermia. Indian J Med Res., 122, 34-42. Nicolaidis P, Petersen MB (1998) Origin and mechanisms of non-disjunction in human autosomal trisomies. Hum Reprod., 13, 313-9. Nielsen, J. and Wohlert, M. (1991) Chromosome abnormalities found among 34,910 newborn children: results from a 13-year incidence study in Arhus, Denmark. Hum. Genet., 87, 81-83. Nishikawa N, Murakami I, Ikuta K, Suzumori K (2000). Sex chromosomal analysis of spermatozoa from infertile men using fluorescence in situ hybridization. J Assist Reprod Genet., 17, 97-102 Norwitz ER, Schunst DJ, and Fisher SJ (2001) Implantation and the survival of early pregnancy. N Eng J Med., 345, 1400-1408. Nybo Andersen, A.M., Hansen, K.D., Andersen, P.K. andDavey Smith, G. (2004) Advanced paternal age and risk of fetal death: a cohort study. Am. J. Epidemiol., 160, 1214-1222. Obata Y, Kaneko-Ishino T, Koide T, Takai Y, Ueda T, Domeki I, Shiroishi T, Ishino F, Kono T (1998) Disruption of primary imprinting during oocyte growth leads to the modified expression of imprinted genes during embryogenesis. Development, 125, 1553-60. 63 Obata Y, Kono T. (2002) Maternal primary imprinting is established at a specific time for each gene throughout oocyte growth. J Biol Chern. 277, 5285-9. Oliashi Y, Miharu N, Honda H, Samura O, Ohama K (2001) High frequency of XY disomy in spermatozoa of severe oligozoospennic men. Hum Reprod. 16, 703-8. Ohno M, Maeda T, Matsunobu A (1991) A cytogenetic study of spontaneous abortions with direct analysis of chorionic villi. Obstet Gynecol., 77, 394-8. Okano M, Bell DW, Haber DA, Li E (1999) DNA methyltransferases Dnmt3a and Dmnt3b are essential for de novo methylation and mammalian development. Cell., 99, 247-57. Ombelet, W., Cadron, I., Gerris, J., De Sutter, P., Bosnians, E., Martens, G., Ruyssinck, G., Defoort, P., Molenberghs, G. and Gyselaers, W. (2005) Obstetric and perinatal outcome of 1655 ICSI and 3974 IVF singleton and 1102 ICSI and 2901 IVF twin births: a comparative analysis. Reprod. Biomed. Online, 11, 76-85. Ono, R., Sliiura, H., Aburatani, H., Kohda, T., Kaneko-Ishino, T. and Ishino, F. (2003) Identification of a large novel imprinted gene cluster on mouse proximal chromosome 6. Genome Res., 13, 1696-1705. Orstavik KH, Eiklid K, van der Hagen CB, Spetalen S, Kierulf K, Skjeldal O, Buiting K. (2003) Another case of imprinting defect in a girl with Angelman syndrome who was conceived by intracytoplasmic semen injection. Am J Hum Genet., 72, 218-9. Paldi A, Gyapay G, Janu J (1995) Imprinted chromosomal regions of the human genome display sex-specific meiotic recombination frequencies. CurrBiol., 5, 1030-5 Palermo, G , Joris, H., Devroey, P. and Van Steirteghem, A.C. (1992) Pregnancies after intracytoplasmic injection of single spermatozoon into an oocyte. Lancet, 340, 17-18. Palermo, G.D., Neri, Q.V., Hariprashad, J.J., Davis, O.K., Veeck, L.L. and Rosenwaks, Z. (2000) ICSI and its outcome. Semin. Reprod. Med., 18, 161-169. Pant, V., Kurukuti, S., Pugacheva, E., Shamsuddin, S., Mariano, P., Renkawitz, R., Klenova, E., Lobanenkov, V. and Ohlsson, R. (2004) Mutation of a single CTCF target site within the HI 9 imprinting control region leads to loss of 1GF2 imprinting and complex patterns of de novo methylation upon maternal inheritance. Mol. Cell. Biol., 24, 3497-3504. Paulsen M, El-Maarri O, Engemann S, Strodicke M, Franck O, Davies K, Reinhardt R, Reik W, Walter J. (2000) Sequence conservation and variability of imprinting in the Beckwith-Wiedemann syndrome gene cluster in human and mouse. Hum Mol Genet. 9, 1829-41. Phillips, O.P., Velagaleti, G.V., Tharapel, A.T. and Shulman, L.P. (1997) Discordant direct and culture results following chorionic villus sampling and the diagnosis of a third cell line in the fetus. Prenat. Diagn., 17, 170-172. Pinborg, A., Loft, A., Rasmussen, S., Schmidt, L., Langhoff-Roos, J., Greisen, G. and Andersen, A.N. (2004) Neonatal outcome in a Danish national cohort of 3438 IVF/ICSI and 10,362 non-IVF/ICSI twins born between 1995 and 2000. Hum. Reprod., 19, 435-441. Pryor JL, Kent-First M, Muallem A, Van Bergen AH, Nolten WE, Meisner L, Roberts KP (1997). Microdeletions in the Y chromosome of infertile men. N Engl J Med. 336(8):534-9. 64 Qumsiyeh MB. (1998) Clrromosome abnonnalities in the placenta and spontaneous abortions. J Matern Fetal Med. 7:210-2. Raziel, A., Friedler, S., Schachter, M., Strassburger, D., Mordechai, E. and Ron-El, R. (2002) Increased early pregnancy loss in IVF patients with severe ovarian hyperstimulation syndrome. Hum. Reprod., 17, 107-110. Reik W, Walter J (2001) Genomic imprinting: parental influence on the genome. Nat Rev Genet, 2, 21-32. Reinhart B, Eljanne M, Chaillet JR. (2002) Shared role for differentially methylated domains of imprinted genes. Mol Cell Biol. 22:2089-98. Retief AE, Van Zyl JA, Menkveld R, Fox MF, Kotze GM, Brusnicky J (1984) Cluomosome studies in 496 infertile males with a sperm count below 10 million/ml. Hum Genet., 66, 162-4. Reynolds, T.S., Stevenson, K.R. and Wathes, D.C. (1997) Pregnancy-specific alterations in the expression of the insulin-like growth factor system during early placental development in the ewe. Endocrinology, 138, 886-897. Richburg, J.H. (2000) The relevance of spontaneous- and chemically-induced alterations in testicular germ cell apoptosis to toxicology. Toxicol. Lett, 112-113, 79-86. Rives NM (2005) Chromosome abnormalities in sperm from infertile men with normal somatic karyotypes: asthenozoospermia. Cytogenet Genome Res. I l l , 358-62. Robinson WP, Barrett IJ, Bernard L, Telenius A, Bernasconi F, Wilson RD, Best RG, Howard-Peebles PN, Langlois S, Kalousek DK. (1997) Meiotic origin of trisomy in confined placental mosaicism is correlated with presence of fetal uniparental disomy, high levels of trisomy in trophoblast, and increased risk of fetal intrauterine growth restriction. Am J Hum Genet 60:917-27. Robinson WP, Lalande M (1995) Sex-specific meiotic recombination in the Prader-Willi/Angelman syndrome imprinted region. Hum Mol Genet 4, 801-6. Robinson, W.P., Bernasconi, F., Lau, A. and McFadden, D.E. (1999) Frequency of meiotic trisomy depends on involved chromosome and mode of ascertainment Am. J. Med. Genet, 84, 34-42. Rurak DW (2001) Development and function of the placenta. In: Harding R and Booking AD eds. Fetal growth and development. Cambridge: Cambridge University Press, 17-43. Salas, M., John, R., Saxena, A., Barton, S„ Frank, D., Fitzpatrick, G., Higgins, M.J. and Tycko, B. (2004) Placental growth retardation due to loss of imprinting of Phlda2. Mech. Dev., 121, 1199-1210. Samli H, Solak M, Imirzalioglu N, Beyatli Y, Simsek S, and Kahraman S (2003) Fetal chromosomal analysis of pregnancies following intracytoplasmic sperm injection with amniotic tissue culture. Prenat Diagn., 23, 847-850 Sanchez JM, Franzi L, Collia F, De Diaz SL, Panal M, Dubner M. (1999) Cytogenetic study of spontaneous abortions by transabdominal villus sampling and direct analysis of villi. Prenat Diagn., 19, 601-3. Sandell, L.L., Guan, X.J., Ingram, R. and Tilghman, S.M. (2003) Garni, a creatine synthesis enzyme, is imprinted in mouse placenta. Proc. Natl. Acad. Sci. U. S. A., 100, 4622-4627. Schieve, L.A., Meikle, S.F., Ferre, C , Peterson, H.B., Jeng, G. and Wilcox, L.S. (2002) Low and very low birth weight in infants conceived with use of assisted reproductive technology. N. Engl. J. Med., 346, 731-737. 65 Schieve, L.A., Rasmussen, S.A., Buck, G.M., Schendel, D.E., Reynolds, M.A. and Wright, V.C. (2004) Are children born after assisted reproductive technology at increased risk for adverse health outcomes? Obstet. Gynecol., 103, 1154-1163. Schieve, L.A., Tatham, L., Peterson, H.B., Toner, J. and Jeng, G. (2003) Spontaneous abortion among pregnancies conceived using assisted reproductive technology in the United States. Obstet. Gynecol., 101, 959-967. Schimmel, M.S., Hammerman, C., Lusky, A. and Reichman, B. (2006) Very low-birth-weight-infants conceived by in vitro fertilization are riot at higher risk for mortality and morbidity: a population-based study. Fertil. Steril., 85, 907-912. Schlegel, P.N. (2004) Causes of azoospermia and their management. Reprod. Fertil. Dev., 16, 561-572. Schoysman, R., Lejeune, B., Segal, L., van Roosendaal, E., Vanderzwalmen, P., Nijs, M., Bertin, S.G. and Vandamme, B. (1995) New therapeutic possibilities handling residual azoospermia. Acta Eur. Fertil., 26, 131-136. Schreck, R.R., Falik-Borenstein, Z. and Hirata, G. (1990) Chromosomal mosaicism in chorionic villus sampling. Clin. Perinatol., 17, 867-888. Schwinger, E., Seidl, E., Klink, F. and Rehder, H. (1989) Chromosome mosaicism of the placenta~a cause of developmental failure of the fetus? Prenat. Diagn., 9, 639-647. Scriven PN, Flinter FA, Braude PR, Ogilvie CM (2001) RobertsOnian translbcations—reproductive risks and indications for preimplantation genetic diagnosis. Hum Reprod. 16, 2267-73. Shamanski FL, Kimura Y, Lavoir MC, Pedersen RA, Yanagimachi R. (1999) Status of genomic imprinting in mouse spermatids. Hum Reprod. 14, 1050-6. Shi'Q, Martin RH (2000). Aneuploidy in human sperm: a review of the frequency and distribution of aneuploidy, effects of donor age and lifestyle factors. Cytogenet Cell Genet., 90, 219-26. Shi Q, Spriggs E, Field LL, Ko E, Barclay L, Martin RH (2001) Single sperm typing demonstrates that reduced recombination is associated with the production of aneuploid 24,XY human sperm. Am J Med Genet., 99, 34-8. Shi W, Haaf T (2002) Aberrant methylation patterns at the two-cell stage as an indicator of early developmental failure. Mol Reprod Dev. 63:329-34. Sigman M and Howards SS (1998) Male infertility. Campbell's Urology, 7 th ed: ppl297-1330. Silber SJ, Alagappan R, Brown LG, Page DC (1998) Y chromosome deletions in azoospermic and severely oligozoospermic men undergoing intracytoplasmic sperm injection after testicular sperm extraction. Hum Reprod., 13, 3332-7. Silber, S.J., Nagy, Z., Liu, J., Tournaye, H., Lissens, W., Ferec, C , Liebaers, I., Devroey, P. and Van Steirteghem, A.C. (1995) The use of epididymal and testicular spermatozoa for intracytoplasmic sperm injection: the genetic implications for male infertility. Hum. Reprod., 10, 2031-2043. Simoni G, Sirchia SM. (1994) Confined placental mosaicism. Prenat Diagn., 14, 1185-9. Sinclair, K.D., Young, L.E., Wilmut, I. and McEvoy, T.G. (2000) In-utero overgrowth in ruminants following embryo culture: lessons from mice and a warning to men. Hum. Reprod., 15 Suppl 5, 68-86. 66 Sleutels, F., Zwart R. and Barlow, D.P. (2002) The non-coding Air RNA is required for silencing autosomal imprinted genes. Nature, 415, 810-813. Soejima H, Wagstaff J. (2005) Imprinting centers, chromatin structure, and disease. J Cell Biochem. 95, 226-33. Spahn L, Barlow DP. (2003) An ICE pattern crystallizes. Nat Genet. 35:11-2. Spano, M., Bonde, J.P., Hjollund, H.I., Kolstad, H.A., Cordelli, E. and Leter, G. (2000) Sperm chromatin damage impairs human fertility. The Danish First Pregnancy Planner Study Team. Fertil. Steril.; 73, 43-50. Spira, A. (1986) Epidemiology of human reproduction. Hum. Reprod., 1, 111-115. Stern RC (1997). The diagnosis of cystic fibrosis. N Engl J Med. 336(7):487-91 Stetten, G., Escallon, C.S., South, S.T., McMichael, J.L., Saul, D.O. and Blakemore, K.J. (2004) Reevaluating confined placental mosaicism. Am. J. Med. Genet. A., 131, 232-239. Suetake I, Shinozaki F, Miyagawa J, Takeshima H, Tajima S. (2004) DNMT3L stimulates the DNA methylation activity of Dnmt3a and Dnmt3b through a direct interaction. J Biol Chem. 279:27816-23. Sybenga J (1975) Chromosome structural variants, hi J. Sybenga (ed) General Cytogenetics. North-Holland Publishing Company, Amsterdam. The Netherlands, pp. 165-212. Tada T, Tada M, Hilton K, Barton SC, Sado T, Takagi N, Surani MA. (1998) Epigenotype switching of unprintable loci in embryonic germ cells. Dev Genes Evol., 207,551-61. Takahashi, K., Nakayama, K. and Nakayama, K. (2000) Mice lacking a CDK inhibitor, p57Kip2, exhibit skeletal abnormalities and growth retardation. J. Biochem., 127, 73-83. Tanaka, M., Gertsenstein, M., Rossant, J. and Nagy, A. (1997) Mash2 acts cell autonomously in mouse spongiotrophoblast development. Dev. Biol., 190, 55-65. Tanaka, M., Puchyr, M., Gertsenstein, M., Harpal, K., Jaenisch, R., Rossant, J. and Nagy, A. (1999) Parental origin-specific expression of Mash2 is established at the time of implantation with its imprinting mechanism highly resistant to genome-wide demethylation. Mech. Dev., 87, 129-142. Tang SS, Gao H, Robinson WP, Ho Yuen B, Ma S (2004) An association between sex chromosomal aneuploidy in sperm and an abortus with 45,X of paternal origin: possible transmission of chromosomal abnormalities through ICSI. Hum Reprod., 19, 147-51. Terada, Y., Luetjens, C M . , Sutovsky, P. and Schatten, G. (2000) Atypical decondensation of the sperm nucleus, delayed replication of the male genome, and sex chromosome positioning following intracytoplasmic human sperm injection (ICSI) into golden hamster eggs: does ICSI itself introduce chromosomal anomalies? Fertil. Steril., 74, 454-460. Thomas NS, Collins AR, Hassold TJ, Jacobs PA. (2000) A reinvestigation of non-disjunction resulting in 47, XXY males of paternal origin. Eur J Hum Genet 8, 805-8. Tiepolo L, Zuffardi O (1976) Localization of factors controlling spermatogenesis in the nonfluorescent portion of the human Y chromosome long arm. Hum Genet, 34, 119-24. 67 Tournarye H, Devroey P, Liu J, Nagy Z, Lissens W, and Van Steirteghem A (1994) Microsugical epididymal sperm aspiration and intracytoplasmic sperm injection: a new effective approach to infertility as a result of congenital bilateral absence of the vas deference. Fertil Steril 61, 1045-1051. Tournaye, H., Liu, J., Nagy, P.Z., Camus, M , Goossens, A., Silber, S., Van Steirteghem, A.C. and Devroey, P. (1996) Correlation between testicular histology and outcome after intracytoplasmic sperm injection using testicular spermatozoa. Hum. Reprod., 11, 127-132. Van der Westerlaken L, Verburg H, Naaktgeboren N, Breuning M and Helmerhorst F (2001) Incasive prental diagnosis after intracytoplasmic sperm injection. Fertil Steril 75: 1240-1241 van Dijk, M., Mulders, J., Konst, A., Janssens, B., van Roy, F., Blankenstein, M. mid Oudejans, C. (2004) Differential downregulation of alphaT-catenin expression in placenta: trophoblast cell type-dependent imprinting of the CTNNA3 gene. Gene Expr. Patterns, 5, 61-65. van Dijk, M., Mulders, J., Poutsma, A., Konst, A. A., Lachmeijer, A.M., Dekker, G.A.; Blankenstein, M.A. and Oudejans, C B . (2005) Maternal segregation of the Dutch preeclampsia locus at 10q22 with a new member of the winged helix gene family. Nat. Genet., 37, 514-519. Van Opstal D, Los FJ, Ramlaklian S, Van Hemel JO, Van Den Ouweland AMW, Brandengurg H, Pieters MHCE, Verhoeff A, Vermeer MCS, Dhont M and In't Veld PA (1997) Determination of the parent of origin in nine cases of prenatally detected chromosome aberration found after intracytoplasmic sperm injection. Hum Reprod., 12, 682-686. Van Steirteghem, A., Bonduelle, M., Devroey, P. and Liebaers, I. (2002) Follow-up of children born after ICSI. Hum. Reprod. Update, 8, 111-116. Vegetti W, Van Assche E, Frias A, Verheyen G, Bianchi MM, Bonduelle M, Liebaers I, Van Steirteghem A (2000) Correlation between semen parameters and sperm aneuploidy rates investigated by fluorescence in-situ hybridization in infertile men. Hum Reprod., 15, 351-65. Vernaeve V, Bounduelle M, Tournaye H, Camus M, Van Steirteghem and Devroey P (2003) Pregancy outcome and neonatal data of children born after ICS using testicular sperm in obstructive and non-obstructive azoospermia. Hum Reprod., 18, 2093-2097. Verp MS, Unger NL. (1990) Chorionic chromosome abnormalities and intrauterine growth retardation. J Perinatal. 10, 52-4. Vogt PH, Edelmann A, Kirsch S, Henegariu O, Hirschmann P, Kiesewetter F, Kohn FM, Schill WB, Farali S, Ramos C, Hartmann M, Hartschuh W, Meschede D, Belrre HM, Castel A, Nieschlag E, Weidner W, Grone HJ, Jung A, Engel W, Haidl G (1996) Human Y chromosome azoospermia factors (AZF) mapped to different subregions in Yql 1. Hum Mol Genet, 5, 933-43. Vu, T.H., Li, T„ Nguyen, D., Nguyen, B.T., Yao, X.M., Hu, J.F. and Hoffman, A.R. (2000) Symmetric and asymmetric DNA methylation in the human IGF2-H19 imprinted region. Genomics, 64, 132-143. Wagschal, A. and Feil, R. (2006) Genomic imprinting in die placenta. Cytogenet. Genome Res., 113, 90-98. Walter, J. and Paulsen, M. (2003) Imprinting and disease. Semin. Cell Dev. Biol., 14, 101-110. Wang, J.X., Clark, A.M., Kirby, C. A., Philipson, G , Petrucco, O., Anderson, G. and Matthews, C D . (1994) The obstetric outcome of singleton pregnancies following in-vitro fertilization/gamete intra-fallopian transfer. Hum. Reprod., 9, 141-146. 68 Wang, Y.A., Sullivan, E.A., Black, D., Dean, J., Bryant, J. and Chapman, M. (2005) Preterm birth and low birth weight after assisted reproductive technology-related pregnancy in Australia between 1996 and 2000. Fertil. Steril., 83, 1650-1658. Warburton D (1987) Chromosomal causes of fetal death. Clin Obstet Gynecol. 30(2), 268-77. Weber, M., Milligan, L., Delalbre, A., Antoine, E„ Brunei, C , Cathala, G. and Forae, T. (2001) Extensive tissue-specific variation of allelic methylation in the 1GF2 gene during mouse fetal development: relation to expression and imprinting. Mech. Dev., 101, 133-141. Wennerholm UB, Bergh C, Hamberger L, Westlander G, Wikland M, and Wood M . (2000) Obstetric outcome of pregnancies following ICSI, classified according to sperm origin and quality. Hum Reprod., 15, 1189-1194 WHO (World Health Organization) (1999) Laboratory manual for the examination of human semen and sperm-cervical mucus interactions, 3 ed. Cambrige: Cambrige University Press. Wilcox, J., Treloar, A.E. and Sandler, D.P. (1981) Spontaneous abortion over time: comparing occurrence in two cohorts of women a generation apart. Am. J. Epidemiol., 114, 548-553. Wilkin, F., Paquette, J., Ledru, E., Hamelin, C , Pollak, M. and Deal, C.L. (2000) HI 9 sense and antisense transgenes modify insulin-like growth factor-H mRNA levels. Eur. J. Biochem., 267, 4020-4027. Wilkins-Haug, L., Quade, B. and Morton, C C . (2006) Confined placental mosaicism as a risk factor among newborns with fetal growth restriction. Prenat. Diagn., 26, 428-432. Winter, E., Wang, J., Davies, M. J. and Norman, R. (2002) Early pregnancy loss following assisted reproductive technology treatment. Hum. Reprod., 17, 3220-3223. Wolstenholme J. (1996) Confined placental mosaicism for trisomies 2, 3, 7, 8, 9, 16, and 22: their incidence, likely origins, and mechanisms for cell lineage compartmentalization. Prenat Diagn., 16, 511-24. Wolstenholme, I, Rooney, D.E. and Davison, E.V. (1994) Confined placental mosaicism, IUGR, and adverse pregnancy outcome: a controlled retrospective U.K. collaborative survey. Prenat. Diagn., 14, 345-361. Yang, I.C, Yang, S.K., Park, C. W. and Chung, J.H. (2000) De novo methylation at intrbnic CpG islands of IGF2r is associated with decreased expression of antisense RNA in aged mice. Biochem. Biophys. Res. Commun., 274, 722-726. Yoon, B.J., Herman, H., Sikora, A., Smith, L.T., Plass, C. and Soloway, P.D. (2002) Regulation of DNA methylation of Rasgrfl. Nat. Genet., 30, 92-96. Yu, W., Ginjala, V., Pant, V., Chernukhin, I., Whitehead, J., Docquier, F., Farrar, D., Tavoosidana, G , Mukhopadhyay, R. and Kanduri, C , et al (2004) Poly(ADP-ribosyl)ation regulates CTCF-dependent chromatin insulation. Nat. Genet., 36, 1105-1110. Zini, A., Finelli, A., Phang, D. and Jarvi, K. (2000) Influence of semen processing technique on human sperm DNA integrity. Urology, 56, 1081-1084. 69 CHAPTER2. Confined placental mosaicism in term placentas derived from ICSI pregnancies 2.1 Introduction Cohort studies have consistently reported that the ICSI population has an increased incidence of low birth weight ( L B W ) in singleton births (Schieve et al, 2002, Katalinie et al, 2004), birth defects (Hansen et al, 2002), and chromosomal abnormalities particularly involving sex chromosomes (Bonduelle et al, 2002). One contributing factor to some negative pregnancy outcomes may be confined placenta mosaicism ( C P M ) , which describes a feto-placental chromosomal discrepancy such that an abnormality is limited to the placenta. C P M has often been associated with intrauterine growth restriction ( IUGR) (Wolstenholme et al, 1996; Lestou and Kalousek, 1998), but is also thought to be responsible for a number of other pregnancy complications such as pregnancy loss (Johnson et al, 1990), congenital abnormalities (Leschot et al, 1996; Ferra et al, 2000), premature labour (Schuring-Blom et al 1993), and stillbirth (Kalousek and Barrett, 1994). The incidence of C P M has been well established in the general population. It accounts for about 1-2 % of viable pregnancies detected by chorionic villus sampling ( C V S ) (Simoni et al, 1986; Johnson et al, 1990). Although the majority have a normal pregnancy outcome, C P M has been associated with fetal mortality and morbidity. C P M has been detected in 5-33% of spontaneous abortions (Kalousek et al, 1992; Johnson etal, 1990; Griffin et al, 1997; Qumsiyeh, 1998), and in about 20% of the idiopathic I U G R cases (Leschot et al, 1996; Lestou and Kalousek, 1998). When compared to the total incidence of 6.0%) in the general population (Table 1.6), the role of C P M in I U G R cases is evident. Taking into account the elevated rate of chromosomal abnormalities and other pregnancy anomalies in ICSI conceptions that mirror the clinical phenotypes of C P M , we hypothesized that C P M may be prevalent in the ICSI pregnancies and may explain for some of those frequently observed perinatal complications. The study of C P M in the ICSI population is still limited. Our previous study found that the incidence of C P M in the ICSI population was not statistically different from that in the general population (Minor et al. 2006). However, due to a relatively small sample size (n=51), further study was required 70 to more accurately elucidate the prevalence of C P M in ICSI pregnancies. Furthermore, it is still unknown whether C P M accounts for the higher incidence of low birth weight and other congenital abnormalities found in ICSI pregnancies. 2.2 Materials and methods 2.2.1 Sample collection Thirty term placentas and cord blood from pregnancies derived from ICSI were collected from patients who gave informed consent. These patients underwent ICSI treatments at the U B C affiliated fertility clinic at Vancouver General Hospital from 2004 to 2006. Attending physicians were requested to provide us with clinical information including birth weight, maternal age, gestational age, pregnancy complications, and congenital abnormalities. L B W involved birth weights below 2500g, while I U G R defined birth weight below the 10 t h percentile, after adjusting for the gestational age, gender, and plurality. The adjustments were based on the methods described by Hoffman et al. (1974) for singletons, and M i n et al. (2004) for twins. Only pregnancies in which newborns were confirmed to have a normal karyotype in cord blood were included in the current study as the focus of this study is on abnormalities confined to the placenta. Ethics approval was obtained from the University of British Columbia Ethics Committee. 2.2.2 Tissue preparation and D N A extraction Each placenta was measured, weighed and examined for any morphological abnormalities. Amnion and chorionic v i l l i were collected from ten sites from each placenta. Maternal decidua was also sampled for maternal D N A in the case that genotyping for parental origin was required. D N A was extracted from whole v i l l i at three random sites using standard salt extraction protocols. Specifically, a small piece of chorionic v i l l i (about 2 cm 3) was washed in Phosphate Buffered Saline (PBS) to remove blood and stored at 4°C overnight in minimum essential medium complemented with 4% penicillin streptomycin. Clean v i l l i were then resuspended in 3ml of 2x tissue lysis buffer ( lOOmM Tris; 4 0 m M E D T A ; 500mM NaCl ) mixed with 50 uL of Proteinase K (5mg/ml), 300 u L of 10% sodium dodecyl sulphate (SDS), and incubated at 55°C overnight. One-third volume (3ml) o f 6 M 71 N a C l was added, and the solution was shaken vigorously for about 30 seconds until stiff foam was formed. The mixture was then centrifuged at 4000 rpm at 4°C for 20 minutes. The clear supernatant was transferred to a test tube containing two volumes (8ml) o f ice-cold 100% ethanol to precipitate D N A . The D N A was taken out with a pipette tip and washed briefly in l m L o f ice-cold 70% ethanol. The pellet was air dried and dissolved in an adequate amount of T E buffer ( l O m M Tr i s -HCl ; I m M E D T A , pH8.0). D N A concentration was measured with a U V spectrophotometer before being used in subsequent molecular analysis. 2.2.3 Karyotyping Cord blood was cultured for 72 hours using standard protocols. Each flask contains 8.3 mL of culture Medium; 1.7mL of calf serum; 0.25mL of phytohaemagglutinin (PHA) ; 0.025mL of heparin; 0.083mL of Penicillin and Streptomycin and 0.5 m L of fresh cord blood. 5-Fluoro-deoxy-uridine ( F U D R ) was added eighteen hours before, thymidine was added four hours before, and colcemid was added 45 minutes before harvesting. Harvested cells were fixed in 3:1 methanol: acetic acid and dropped to slides. Cells spread on slides were stained with Leishman's staining (5ml) and Giemsa (3ml). Twenty-five G-banded metaphases were analyzed in karyotyping analysis including three metaphases fully analyzed by a certified technologist. In the event of culture failure, comparative genomic hybridization ( C G H ) was performed on D N A from amnion (representative of fetal chromosomal constitution). 2.2.4 Comparative genomic hybridization ( C G H ) Comparative genomic hybridization ( C G H ) is a molecular cytogenetic technique that detects chromosomal imbalances at a resolution of 3 M b (Kallioniemi et al., 1993). In the current study, C G H was performed following a previously described protocol by Minor (2004) with minor modifications (Figure 2.1). 2ug of test D N A from whole v i l l i was labeled with 4u\L of dNTPs containing fluorescein-12-dUTP (FITC) (Roche Diagnostic, Penzberg, Germany) using 1.5ul of N ick Translation Enzyme M i x (Roche Diagnostic, Penzberg, Germany) in combination with 0.8uL of D N A polymerase I (New England Biolabs, Ipswich, M A ) , in a total 20ul reaction mixture. Nick translation products with optimal fragments lengths o f 600bp to 3kb were obtained after incubation at 25°C for about 2 hours and 45 72 minutes. Reference D N A from a diploid genome (46, X X ) was similarly labeled with tetramethylrhodamine-5-dUTP (TRITC) (Roche Diagnostic, Penzberg, Germany). The size and concentration of labeled fragments in each sample was estimated by gel electrophoresis on a 1.2% agarose gel using a Hind III digested Lambda D N A (Sigma, St. Louis, M o ) as a size marker. Test and reference D N A were mixed in a roughly 1:1 ratio, and then co-precipitated with 20 ug of highly repetitive human Cot-1 D N A (Sigma St. Louis, M o ) at -20 °C overnight in 200 uL of ethanol and 5uL of 5 M L i C l . The probe pellet was reconstituted in 14uL of hybridization buffer (50% formamide/10% dextransulfate/2x sodium chloride sodium citrate (SSC)). The probe mixture was then denatured at 78°C for 5 minutes and pre-annealed at 37°C for 1 hour before it was applied to a target slide with metaphases from a male control with a confirmed chromosomal constitution of 46, X Y . The metaphase slides were prepared with 450-500 band resolution, a high mitotic index, and minimal cytoplasm. Before hybridization, slides were pre-treated with RNase (0.125mg/ml; Sigma, St. Louis, M O ) in 2x SSC, fixed in 10% buffered formalin for 10 minutes, and finally denatured in 70% formamide/2x SSC for 5 minutes at 73-75°C on a hot plate. After the probe mixture was applied to a slide, a glass coverslip was applied, sealed with rubber cement and allowed to hybridize in a humid chamber for at least three days. Post-hybridization washes included 0.4xSSC/0.3% NP-40 at 72°C for 2 minutes and subsequently 2xSSC/0.1%> NP-40 at room temperature for 30 seconds. Lastly, the slides were counterstained in 4',6-Diamidine-2'-phenylindole (DAPI) (0.2ug/ml; Sigma, St. Louis, M O ) and mounted with anti-fade reagent, Vectashield (Vector Laboratories, Burlingame, C A ) . The slides were stabilized at 4°C for several hours before analysis. For each case, ten evenly hybridized metaphases with minimum background were captured with a C C D camera attached to a Zeiss Axioplan epifluorescent microscope. Digital images were captured for D A P I , F ITC, and T R I T C fluorescent wavelengths and analyzed with Cytovision Image Analysis software (Applied Imaging International, Santa Clara, C A ) . A t least six captured metaphases were analyzed for each case. A profile is generated and illustrates a fluorescence ratio between the test and referenced D N A , with the centre line representing the 1:1 proportion. A shift in the profile to the left indicates a loss, and a shift to the right represents a gain of genetic material in the test sample. Abnormal 73 cases were re-analyzed with C G H before confirmation by fluorescent in situ hybridization (FISH) or polymerase chain reaction (PCR). Test DNA labeled with FITC Control DNA labeled with TRITC 0S Cot-1 DNA Hybridization for 48-72 hours to a normal metaphase slide image processing and analysis (gain or loss of DNA show as shifts on the profile) ! H..I1J U-1 ** 1 pt m m M p ii: 1 W m m M N i \i 1 m Normal Loss G a i n Figure 2.1 Schematics of comparative genomic hybridization (CGH) . 74 2.2.5 F low cytometry One of the limitations o f C G H is its inability to detect balanced polyploidy; therefore, flow cytometry was used to determine the ploidy level. The analysis was done on mesenchymal cells only, because in the presence of multi-nucleated syncytiotrophoblast cells in the trophoblast samples may inappropriately influence the measurement of ploidy. Preparation and analysis followed protocols described by Minor et al. (2006). V i l l i were digested in collagenase 1A ( lmg/mL) (Sigma, Oakville, Canada) at 37°C for 20 minutes with intermittent vortexing. Once the enzyme digestion was complete, 3mL of Hank's Balanced Salt Solution (HBSS) with Ca and M g was added to each sample to stop the digestion. The supernatant containing the trophoblast cells discarded, and the precipitated mesenchymal cells were washed in 0.9% N a C l solution (pH 1.5) and then digested with 0.5% pepsin (Sigma, St. Louis, M O ) for 10 to 15 minutes in a 37°C water bath with constant agitation. The cells were then washed in P B S and filtered through a cell strainer (40um, Becton Dickson, Franklin Lakes, NJ). The single cells were then fixed in 70% ethanol overnight at -20°C. The cells were resuspended in P B S and the concentration was determined with a haemocytometer. A total volume of about 500uL of single cell suspension with a concentration of 1 mill ion cells per milliliter was prepared. The cells were stained with propidium iodide (PI; 40 ug/mL) (Sigma, St. Louis, M O ) and pretreated with RNase (20ug/mL; Sigma, St. Louis, Mo) . The analyses of stained cells were performed with the F A C S c a n flow cytometer (Becton Dickson, Franklin Lakes, NJ) at Dr. Hmama's lab in the Department of Infectious Disease located at Vancouver General Hospital. The instrument was calibrated with a diploid control sample and the accuracy was confirmed with a polyploidy (triploidy or tetraploidy) control sample. Twenty thousand cells were included in the analysis for each case. The data recording was facilitated by the CellQuest software, and data analysis was performed with computer software called FlowJo (Tree Star, Inc. Ashland, OR). Diploidy range was determined by a peak area that shifted within ± 1 0 % of the control diploid peak ( G l ) , and a G2 peak that contains lower than or equal to 15% of the cell population (Rua et al., 1995). Abnormal cases were repeated before confirmation by F ISH. 75 2.2.6 Fluorescent in situ hybridization (FISH) Abnormalities detected by C G H or flow cytometry in v i l l i samples were confirmed by Fluorescent in situ Hybridization (FISH). Preparation and pretreatment V i l l i were separated into cytotrophoblast and mesenchymal stroma cells in order to determine the type and level of mosaicism in cases where presence of aneuploidy was suggested by C G H or flow cytometry. Tissue separation was performed as described by Henderson et al. (1996). V i l l i were first cleaned of blood and decidua under an inverted light microscope. The v i l l i were then digested in collagenase 1A ( lmg/mL; Sigma, Oakville, Canada) at 37°C for 20 minutes with intermittent vortexing. Once the enzyme digestion was complete, 3mL of Hank's Balanced Salt Solution (HBSS) with Ca and M g was added to each sample to stop the digestion. The supernatant containing the trophoblast cells was collected in a different tube, and the precipitated mesenchymal cells were further washed in H B S S several times. Trophoblast cells were resuspended in pre-warmed 1% sodium citrate and incubated at 37°C for 20 minutes before being fixed in 3:1 methanol:acetic acid. The cells were then dropped onto glass slides, pretreated with 0.03% trypsin (Difco, Oakville, Canada) in P B S for 10 seconds and further fixed in 10% buffered formalin for 10 minutes. The mesenchymal cells were first washed in 0.9% N a C l solution (pH 1.5) and then digested with 0.5%i pepsin (Sigma, St. Louis, M O ) for 10 to 15 minutes in a 37°C water bath with constant agitation. The cells were then washed in P B S and filtered through a cell strainer (Becton Dickson, Franklin Lakes, NJ) to isolate single cells. Subsequently, the cells were dropped onto slides and fixed in 10% buffered formalin for 2 hours and 15 minutes. Hybridization procedure Dual-colour F I S H was carried out using L S I 13/21 probes (13ql4 LSI13, Spect.rumGreen/21q22.13-q22.2 LSI2.1, SpectrumOrange; Vysis, Downers Grove, IL, U S A ) . Triple-colour F I S H was performed using a-satellite D N A probes for chromosome 18, X and Y (CEP 18 SpectrumAqua / C E P X SpectrumGreen / C E P Y SpectrumOrange; Vysis, Downers Grove, IL, U S A ) . Prior to hybridization, the slides were denatured in 70% 76 formamide/2x SSC (pH7.4-7.5) at 75°C for 5 minutes. The slides were dehydrated in an ice-cold ethanol series (70%, 80%>, and 100%) for 2 minutes each and air-dried at room temperature. 10 u L of pre-denatured probe mixture was applied onto each slide, and a 22x22 mm coverslip was applied and sealed with rubber cement. Hybridization occurred in a humid chamber overnight at 37 °C. Post-hybridization wash was carried out as described for the C G H protocol. Scoring and analysis The analysis was carried out with an epifluorescent microscope (Nikon Elipse E600W) equipped with a triple bandpass filter ( D A P I / F I T C / Cy3), a dual bandpass filter (FLTC/Cy3), and single bandpass filters for D A P I , Aqua, F ITC, and Cy3. Scoring was performed in areas with consistent hybridization. At least 500 non-overlapped intact nuclei from each tissue type were scored for the analysis of mosaicism. 2.2.1 Molecular analysis Additional sites of the placenta from which the abnormality was detected were investigated using microsatellite D N A markers. V i l l i were enzymatically separated into trophoblast and mesenchymal cells as described above, and D N A was subsequently extracted. P C R amplification was performed using fluorescently labeled primers that target the microsatellite repeats on the chromosomes involved. A n automated genetic analyzer, ABI310 ( A B I , Foster city, C A ) , was used to quantify the P C R products. The products were separated by the size of alleles, displayed as distinctive peaks on ABI310 i f heterozygous. Because there is an allele amplification bias for some markers, especially for those with relatively short amplicons, estimation of dosage difference was made after adjusting for the bias. 77 2.3 Results 2.3.1 Clinical outcomes A total of thirty post-delivery placentas from ICSI pregnancies were included. These consist of 22 singletons and 4 sets of twins (Table 2.1). The common observation of advanced maternal age and multiple births in the A R T population was present in this group as well. The average maternal age was 36.24 ± 5.10 years, which is significantly higher than that in the general population [29.9 years in British Columbia (BC) ; p<0.0001, t-test]. The rate of twins was 13%, which is also significantly higher than the 2.8% observed in the B C population (p<0.05, Chi-square). Surprisingly, the average birth weights for singletons (3430.73g ± 413.27g) and twins (3045.25g ± 532.63g) were both higher than those conceived spontaneously (3405g in B C for all live births in 2004; 3,368g ±580g for singletons, 2,299g ±738g for twins in German data, Katalinic et al., 2004), although the differences were not statistically significant (p>0.05, t-test). The mean gestational ages observed in the ICSI group were 40.2 ± 1.37 weeks for singletons and 37.32 ± 1.01 weeks for twins, which are significantly higher than the 39.2 ± 2.3 weeks and 35.0 ± 3.6 weeks, respectively, observed in the general German population [Katalinic et al., 2004 (Germany); 38.5 weeks for all live births estimated in B C ] . . About 62% of births overall in this study population occurred after 40 weeks, which is significantly higher than the rate reported by Katalinic et al. (2004) (30.1% in ICSI and 22.2% in the controls, both pO.OOOl, Chi-square; B C data not available). The perinatal outcomes were generally normal except that two twins were found with L B W (2497g and 2313g). The frequency o f L B W in twins (25%) is not significantly different from that in twin spontaneous pregnancies (52.3%) [Katalinic et al. 2004 (German); B C data not available], however sample size was small (n=8). N o L B W or I U G R cases were observed in the singleton births (Table 2.2). ICSI newborns Maternal age Gestational age Birth after birth weight (yr) (wk) >40WK ges. (g) n % (mean ± SD) (mean ± SD) (%) singletons 22 73 35.18±4.58 40.2 ± 1.37* 16 /22 (73) 3430.73 ±413.27 N s twins 8 27 38.50 ±6.35 37.32 ± 1.01* o 3045.25 ± 532.63 N S total 30 100 35.62 ±5 .02* 39.61 ± 1.62 16/26 (62)** 3380.96 ±435.24 *Significantly higher than that in natural conceptions ( B C and German data) (t-test: p<0.05) ••Significantly higher than the controls (German data) (Chi-square: p<0.05) N S N o t significantly different from the natural conception data. 78 Table 2.2 L B W in singletons and twins in ICSI pregnancies compared with controls ICSI newborns N B W I U G R L B W L B W rate in controls Statistics d (n) n (%) German da taa B C data b p-value singleton 22 0 0 416/7861 2260/40318 n.s (5.3%) (5.6%) c twins 6 0 2 80/152 n.s (25) (52.3%) a. from Katalinic et al, 2004 b. from B C Vita l Statistics Agency c. data includes both singletons (97.1%) and multiple births (2.9%) d. n.s = not significant (p>0.05, Chi-square) 2.3.2 Detection of C P M in ICSI pregnancies 2.3.2.1 C P M detected by C G H C G H was performed to detect gain or loss of genetic material in whole v i l l i from the thirty placentas. In addition, amnion was analyzed by C G H when karyotype results were not available due to culture failure. Figure 2.2 illustrates typical C G H profiles for balanced chromosome constitution [Figure 2.2 (a) Balanced X X ; Figure 2.2 (b) Balanced X Y ] at 95% confidence intervals. The C G H results are summarized in Table 2.3. Table 2.3 Summary of C G H results Fetal compartment CGH on whole villi number of cases chromosome constitution Tissue type Site 1 Site 2 Site 3 46,XX Cord blood bal, XX bal, XX bal, XX . 12 46,XY Cord blood bal, XY bal, XY bal, XY 7 bal,XX Amnion bal, XX bal, XX bal, XX 6 bal.XY Amnion bal, XY bal,XY bal, XY 4 46,XX Cord blood bal, XX bal, XX unhal, -X 1 79 (a) (b) * : i l l a i f ] u '•r'f'.i: ItM »i j I S i »: ["if - • if. i : ~ * mi 11 M i i l l t S i i I * j I I '(!: r i.<' i I * „.,lu : 0 TO IL nft'" II ..... , faiti Itttii « 143 1 iii M ~ I"' "#"ri ii; i $ i i ^ ~tf-ri m i §• M i i -H-i-i £ u U4-U * U .141J IS Figure 2.2 Balanced CGH profiles for (a) a normal female and (b) a normal male. Because normal female DNA was used as the reference, all chromosomes in the female profile (a) show a 1:1 ratio; whereas, the male profile (b) has a shift to the left on the X chromosome and to the right for the Y chromosome, representing a loss of X chromosome and gain of a Y chromosome compared with the female reference. 80 Sex chromosome monosomy (unbalanced X ) was detected by C G H from one site of a placenta (SM04-69), while the other two placental sites sampled possessed balanced X X constitutions. The C G H profile of the abnormal cite from SM04-69 shows a shift to the left on the X chromosome but no shift on the Y chromosome (Figure 2.3), indicating monosomy of the whole X chromosome. The pregnancy outcome of this C P M case was normal with the birth weight being 4173g at 41weeks of gestation. Thus, the incidence of C P M in the present study is one in thirty cases (3.3%), which is lower than the background rate of 6.0 % (49/818) in the general population (Table 1.6). Moreover, C P M was not observed in either of the two L B W cases. Figure 2.3 C G H profile of the abnormal site from SM04-69. A shift to the left indicates the loss of the whole X chromosome. 81 2.3.2.2 Confirmation o f C P M by F I S H Trophoblast and mesenchymal core cells were separated from vi l l i originally sampled from the site with the abnormality (SM04-69 site 10). F I S H was performed on each tissue type with probes targeting chromosome 18, X and Y (Figure 2.4). The chromosome 18 probe serves as an internal control and provides a measure of hybridization efficiency (>99%). About 500 nuclei were scored for each tissue, and the results were compared to 200 nuclei isolated from mesenchymal core from control placentas with known normal karyotype. The results indicate that monosomy X (45,X) was present in the trophoblast (98.8%) but absent from the mesenchymal cells (5.1%) (Table 2.4). (a) Trophoblast cells (b) Mesenchymal cells Figure 2.4 F I S H confirmation of the cytogenetic abnormality (monosomy X ) . Images captured under D A P I and F ITC filter were overlain to represent nuclei hybridized with the C E P X SpectrumGreen probe, (a) Trophoblast cells with a 45, X constitution (b) mesenchymal core cells with a 46, X X constitution. Table 2.4 Confirmation of the 45, X abnormality ascertained thought C P M by F I S H . Chromosomal SM04-69 Troph 10 SM04-69 Mesen 10 Controls constitution (n=507) (n=530) (n=205) 18, 18,X,X 4 (0.79%)* 503 (94.9%)NS 200 (93.5%) 18,18, X 501 (98.8%)* 27 (5.1%)NS 5 (2.2%) 18, X 2(0.4%)NS 0 Controls are mesenchymal cells in control placentas with known normal karyotypes *significantly different from the control (p<0.05 by Chi-square) Not significantly different from the control (p>0.05 by Chi-square) 82 2.3.2.3 Confirmation of C P M by molecular analysis Trophoblast and mesenchymal cells from other sites sampled from the placenta with 45, X were analyzed by genotyping. P C R amplification was performed using fluorescently labeled primers that target the microsatellite repeats at the Androgen Receptor (AR) locus on the X chromosome. A n allele ratio was calculated by Piow/Phigh, where P i o w represents the peak area of lower allele and Phigh represents that of the higher allele. Due to an allele amplification bias, the allele ratio in a normal cell line is not exactly 1:1 (Table 2.5). The average ratio observed in our normal tissues was 1.42 ± 0 . 1 1 . However, the ratio of 3.22 observed from trophoblast at site 9 is obviously higher and indicates mosaicism. If the allele ratio in the normal cells within the placenta with mosaicism is 1.42, the level of mosaicism is calculated to be 56% by the equation (Phigh - 1.42 x P i o w ) / Phigh.. In addition, the abnormality was again confirmed at the site 10. Thus, the 45 ,X constitution was found to be confined to trophoblast from two sites of the placenta, sites 9 and 10, both of which are relatively close to the center of the placenta (Figure 2.5). Table 2.5 Summary of peak ratios for all tissues tested by P C R site 1 site 2 site 3 site 4 site 5 site 6 site 7 site 8 site 9 site 10 Trophoblast 1.47 1.44 1.41 1.34 1.58 1.46 1.62 1.41 3.22 complete loss of X Mesenchyme 1.41 1.41 1.32 1.23 1.4 1.23 1.37 1.54 1.32 1.56 Nonaal Slit 1 Mesenchyme (b) Mosaic Sits 9 Trophoblast mn-momc J. Site 10 .JS Trophoblast ::::::::::::::::::::^::::::::::::::.:::::::::::::^::-~::^-Figure 2.5 A B I results representing (a) normal tissues (b) a mosaic monosomy X and (c) a non-mosaic monosomy X . 83 2.3.2.4 Ploidy determination by flow cytometry Because of C G H ' s inability to detect polyploidy, flow cytometry was used to examine the ploidy levels in all cases except SM04-69, in which the absence o f polyploidy was confirmed by F I S H analysis. A G l peak represents the diploid cell population and a G2 peak represents the tetraploidy cell population. Triploidy is characterized by a peak positioned between the G l and G2 peaks (Figure 2.6 and 2.7). Polyploidy detection is considered positive i f triploid or tetraploid cell populations indicated by respective peaks represent more than 15% of the entire sample. Three samples were identified as tetraploidy ( S M 05-100 S2, S M 06-131 SI , S M 06-135 SI) and one sample as triploidy ( S M 05-94 SI) by the flow cytometry (Table 2.6). In spite of this, all abnormalities found were determined to be false positives by F I S H analysis with chromosome 13 and 21 probes. About 200 nuclei were scored for each case (Table 2.7). Figure 2.6 A typical flow cytometry result representing diploidy. The G l and G2 peak represented 88.75% and 7.58% of the cells respectively. The G l peak indicates a diploid cell population at the G l phase. The G2 peak indicates the G2 phase or possible tetraploidy i f higher than 15%. 84 (a) Triploidy (b) Tetraploidy Figure 2.7 F low cytometry results representing (a) triploidy and (b) tetraploidy. (a) 71.06% of the cells fall between the G l and G2 peak, indicating a possible triploid cell population, (b) The G l peak represents 49.66% of the cell population. The G2 peak was also higher than the threshold 15%, thus indicating a possible tetraploidy. 85 Table 2.6 Summary of polyploidy detected by flow cytometry case number Flow cytometry results FISH confirmation Diploidy (%) Triploidy (%) Tetraploidy (%) SM 05-94 SI - 71.06 - Diploid SM 05-100 S2 70.43 - 17.1 Diploid SM 06-131 SI 49.66 - 25.31 Diploid SM 06-135 SI 65.02 - 20.75 Diploid Table 2.7 Confirmation of polyploidy by F I S H Case total counts Diploidy (%) Polyploidy P-value Triploidy (%) Tetraploidy (%) SM 05-94 SI 216 216 (100) 0 0 ns SM 05-100 S2 239 237 (99.1) 0 0 ns SM 06-131 SI 208 205 (98.6) 0 2 (0.96) ns SM06-135 SI 220 216 (98.2) 0 3 (1.36) ns control 214 200 (93.5) 0 0 ns - Not significantly different from the rate in the control (p>0.05, Chi-square) 2.4 Conclusions and discussions The current study included thirty placentas collected from twenty eight pregnancies facilitated by ICSI. Advanced maternal age and multiple-births (twins), frequently reported in the A R T population, were observed. In contrast with most cohort studies that reported reduced birth weight in ICSI pregnancies (Schieve etal., 2004; Helmerhorst etal, 2004; Katalinic et al, 2004), our study group found comparable birth weights with that from natural conceptions, in both singletons and twins. N o L B W was present in the singletons, and two cases of L B W (<2500g) were observed out of eight twins (25%), which is less frequent than in other ICSI and control cohorts (40-60%) (Pinborg et al, 2004; Katalinic et al, 2004). These two cases could not be classified as I U G R because the birth weights were above the 10 t h percentile, after adjusting for gestational age, plurality, and gender of the infants. The lack of reduced birth weight cases in our study group may be influenced by the effects of higher gestational age, with 62% of births occurring after 40 weeks. This is significantly higher than the 30.1% in ICSI and 22.2% in controls observed in a recent cohort study (Katalinic et al. 2004). C G H was previously used to identify chromosomal abnormalities in the whole v i l l i without separation of trophoblast and mesenchymal tissues (Minor et al, 2006). Although it 86 has been suggested that C G H may not be sensitive enough to detect low level mosaicism (Barrett et al, 2000), high resolution C G H used in the current study has proven to improve sensitivity in the detection of low level mosaicism (about 30%). In fact, the sensitivity may be better than reported values (Kallioniemi et al, 1994; Ness et al, 2002), as Minor et al. (2006) were able to detect mosaicism as low as 10.8%. To test the sensitivity of detecting aneuploidy in whole v i l l i , C G H was performed on D N A from a combination of trophoblast and mesenchymal stroma from a case where abnormalities were confined to the trophoblast but absent from the mesenchymal layer (Minor et al, 2006). Subsequently, C G H was sensitive enough to detect the trophoblast-confmed abnormalities, gain o f 7q3 l>qter (34% by FISH) and loss of Xp21 >pter (79% by FISH) (Figure 2.8) (Minor et al, 2006). Although an extremely low level of mosaicism may be overlooked, the clinical significance of low level mosaicism is expected to be less (Miny et al., 1991). Figure 2.8 Confirmation of previously detected abnormal case with a gain o f 7q31>qter and loss of Xp21 >pter by C G H using mixed trophoblast and mesenchymal D N A . In combination with C G H , the incidence of C P M in term placentas derived from conceptions induced by ICSI was investigated by flow cytometry, F I S H and microsatellite genotyping. Monosomy X (45,X) was identified from two sites of one placenta with approximately 56%> and 99% mosaicism respectively, estimated by F I S H and dosage ratio on genotyping . The abnormality was confined to the trophoblast tissue. This type I C P M has been associated with the least severe clinical outcomes (Kalousek et al 1991). It has also been suggested that C P M involving sex chromosomes is linked to normal fetal development (Farra et al, 2000). In agreement with these reports, the pregnancy outcome of this placental 45, X karyotype was normal with the birth weight being 4173g at 41 weeks of gestation. 87 Because only one tissue type was affected and the abnormality was limited to two out of ten sites, this cytogenetic abnormality is most likely derived from a post-zygotic error (for details on origin determination, refer to chapter 3). F low cytometry detected four polyploidy cases that could not be identified by C G H . However, the results were confirmed to be false positive by F I S H with probes targeting two chromosomes (13 and 21). The possibility of mosaicism can be eliminated as cells from the exactly same sites were used for confirmation. False results from flow cytometry have been frequently reported in other studies at various rates (Jones et al, 1991, Konchuba et al, 1993; Zbieranowski et al, 1993). It also has been suggested that flow cytometry has lower sensitivity than interphase F I S H in the determination of aneuploidy (Cajulis et al, 1995). The three false tetraploidy cases in the current study are presumably due to an incomplete isolation of single cells in a small fraction of cells since the G2 peaks were only 2 -10% higher than the threshold 15%. For future studies, finer cell strainers (<40 um) should be used to improve separation of single cells. In contrast, the reason for the false triploidy case is more obscure since 71.06%> of the cells appeared affected and the main peak was between G l and G2 phases. We speculate that the diploid G l peak shifted to the right either because of D N A degradation or sporadic instrumentation error from bubbles or voltage fluctuation, causing false readings. Thus, only one case of C P M was identified in the thirty term placentas collected from ICSI-induced pregnancies (1/30 (3.33%)), which is not significantly different from that in the natural conceptions [49/818 (6.0%), Table 1.6; p>0.05, Chi-square], This case had normal pregnancy outcomes including a normal birth weight; therefore we could not evaluate the role of C P M in L B W cases. Also, it is worth noting that the two L B W cases in this study were both from twins and did not fall into the I U G R category. Considering that twin pregnancies are intrinsically born smaller, the observed low birth weight may not be lower than their growth potential and is unlikely to be related to any pathology. Due to the limited sample size (n=30), we combined our data with a previous study (n=51, including nine cases of I U G R ) (Minor et al, 2006) in order to increase the statistical power. With the combined data, the incidence of C P M is 4/81 (4.94%) in the ICSI population; however, it still does not differ significantly from the controls (6.0%). Although an increased aneuploidy rate has been observed in ICSI-derived pregnancies by C V S 88 (Bonduelle et al, 2002), placental mosaicism does not appear to be prevalent in the ICSI population according to our findings. The discrepancy between the incidence of aneuploidy detected by C V S and that in term placentas may result from a selection against the abnormalities in early fetal development, by which a pregnancy may end in spontaneous abortion. In the general population, C P M has been associated with a number of prenatal and perinatal complications, particularly with I U G R . However, we did not observe an increased incidence of C P M in I U G R pregnancies derived from ICSI [0/9 (0%) in ICSI vs. 43/303 (14.2%) in naturally conceived controls (Table 1.6)]. Combining I U G R (n=9) and L B W (n=2) cases still does not reveal any cases associating C P M with reduced birth weight (0/11). Despite the extensively reported susceptibility of ICSI conceptions to L B W and chromosomal abnormalities, we observed a lower incidence of C P M in the ICSI-derived I U G R / L B W pregnancies (0%) compared to that in the spontaneous conceptions (14.2%). Table 2.8 Summary of C P M rate in the previous study, the current study, and the combined data Pregnancy outcomes *CPM rate in the CPM rate in the CPM rate in the Controls previous study " (%) present study (%) combined data (%) (%) normal 2/41(4.88) 1/28 (3.57) 3/69 (4.34)NS 6/515 (1.2) N S Abnormal 1/10(10) 0/2 1/13 (7.69)NS 43/303 (14.2) w s congenital abnormalities 1/2 0 1/2 -IUGR 0/9 0 0/9 43/303 (14.2) LBW 0 0/2 0/2 -Total 3/51(5.88) 1/30(3.3) 4/81(4.94)NS 49/818 (6.0)Nii *Minor etal, 2006 N S : The difference is not statistically significant (p>0.05 by Chi-square). Although our findings suggested lack of correlation between C P M and reduced birth weight, more cases have to be examined in order to thoroughly evaluate this association. While both L B W and I U G R are used to describe reduced birth weight, they are significantly different in definition and etiology. Unfortunately, many clinical reports of perinatal outcomes of ICSI pregnancies indicate only the incidence o f L B W and V L B W but not I U G R (or S G A ) , which requires a correction for gestational age and sex. This made it harder to pinpoint the cause for the generally observed reduced birth weight in the ICSI population. L B W is largely related to premature birth (delivery before the 37 t h week of gestation) and can be affected by maternal age ( B C vital statistics). In addition, Gaudoin et al. (2003) 89 suggested that infertility, at least related to female factor, may also be responsible for L B W , because infertile females treated with ovarian induction/intrauterine insemination (OI/IUI) were associated with L B W pregnancies, while such a relation was not observed in fertile females treated by OI/IUI with donor sperm because of male factor infertility. On the other hand, the pathogenesis of I U G R appears to involve complicated interactions between the uterus, the placenta and the fetus. It has been well established that I U G R can result from a shallow trophoblast invasion at early gestation, adverse utero-placenta circulation, and inadequate placenta transport properties (Cetin et ai, 2004). The underlying genetic causes for I U G R have been suggested to include C P M , single gene disorders, and aberrant genomic imprinting, which has been evidenced by uniparental disomy cases and knockout mouse models. Thus, there are a number of contributing factors to consider as a cause for L B W and I U G R . 2.6 Bibliography Bonduelle M, Van Assche E, Joris H, Keymolen K, Devroey P, Van Steirteghem A, and Liebaers I (2002) Prenatal testing in ICSI pregnancies: incidence of chromosome anomalies in 1586 karyotypes and relation to sperm parameters. Hum Reprod., 17, 2600-2614 Cajulis, R.S., Haines, G.K.,3rd, Frias-Hidvegi, D., McVary, K. andBacus, J.W. (1995) Cytology, flow cytometry, image analysis, and interphase cytogenetics by fluorescence in situ hybridization in the diagnosis of transitional cell carcinoma in bladder washes: a comparative study. Diagn. Cytopathol., 13, 214-23; discussion 224. Cetin, I., Foidart, J.M., Miozzo, M , Raun, T., Jansson, T., Tsatsaris, V., Reik, W., Cross, J., Hauguel-de-Mouzon, S. and Illsley, N., etal (2004) Fetal growth restriction: a workshop report. Placenta, 25, 753-757. Farra, C , Giudicelli, B., Pellissier, M.C., Philip, N. and Piquet, C. (2000) Fetoplacental chromosomal discrepancy. Prenat. Diagn., 20, 190-193. Griffin DK, Millie EA, Redline RW, Hassold TJ, ZaragozaMV. (1997) Cytogenetic analysis of spontaneous abortions: comparison of techniques and assessment of the incidence of confined placental mosaicism. Am J Med Genet., 72, 297-301. Hansen, M., Kurinczuk, J.J., Bower, C. and Webb, S. (2002) The risk of major birth defects after intracytoplasmic sperm injection and in vitro fertilization. N. Engl. J. Med., 346, 725-730. Henderson, K.G., Shaw, T.E., Barrett, I.J., Telenius, A.H., Wilson, RD. and Kalousek, D.K. (1996) Distribution of mosaicism in human placentae. Hum. Genet, 97, 650-654. Hoffman, H.J., Stark, C.R., Lundin, F.E.Jr and Ashbrook, J.D. (1974) Analysis of birth weight, gestational age, and fetal viability, U. S. births, 1968. Obstet. Gynecol. Surv., 29, 651-681. Johnson A, WapnerRJ, Davis GH, Jackson LG. (1990) Mosaicism in chorionic villus sampling: an association witii poor perinatal outcome. Obstet Gynecol., 75, 573-7. 90 Jones, M.A., Hitchcox, S., D'Ascanio, P., Papillo, J. and Tarraza, H.M. (1991) Flow cytometric DNA analysis versus cytology in the evaluation of peritoneal fluids. Gynecol. Oncol., 43, 226-232. Kallioniemi, O.P., Kallioniemi, A., Piper, I, Isola, J., Waldman, F.M., Gray, J.W. and Pinkel, D. (1994) Optimizing comparative genomic hybridization for analysis of DNA sequence copy number changes in solid tumors. Genes Chromosomes Cancer, 10, 231-243. Kallioniemi, O.P., Kallioniemi, A., Sudar, D., Rutovitz, D., Gray, J.W., Waldman, F. and Pinkel, D. (1993) Comparative genomic hybridization: a rapid new method for detecting and mapping DNA amplification in tumors. Semin. Cancer Biol., 4, 41-46. Kalousek, D.K. and Barrett, I. (1994) Confined placental mosaicism and stillbirth. Pediatr. Pathol., 14, 151-159. Kalousek, D.K., Howard-Peebles, P.N., Olson, S.B., Barrett, I.J., Dorfmann, A., Black, S.H., Schulman, J.D. and Wilson, R.D. (1991) Confirmation of CVS mosaicism in term placentae and high frequency of intrauterine growth retardation association with confined placental mosaicism. Prenat. Diagn., 11, 743-750. Katalinic, A., Rosch, C , Ludwig, M. and German ICSI Follow-Up Study Group (2004) Pregnancy course and outcome after intracytoplasmic sperm injection: a controlled, prospective cohort study. Fertil. Steril., 81, 1604-1616. Konchuba, A.M., Clements, M.C., Schellhammer, P.F., Schlossberg, S.M. and Wright, G.L.,Jr (1992) Failure of anticytokeratin 18 antibody to improve flow cytometric detection of bladder cancer. Cancer, 70, 2879-2884. Leschot NJ, Schuring-Blom GH, Van Prooijen-Knegt AC, Verjaal M, Hansson K, Wolf H, Kanhai HH, Van Vugt JM and Christiaens GC (1996) the outcome of pregnancies with confined placental mosaicism in cytotrophoblast cells. Prenat Diagn., 16, 705-712 Lestou, V.S. and Kalousek, D.K. (1998) Confined placental mosaicism and intrauterine fetal growth. Arch. Dis. Child. Fetal Neonatal Ed., 79, F223-6. Min, S.J., Luke, B., Gillespie, B., Min, L., Newman, R.B., Mauldin, J.G., Witter, F.R., Salman, F.A. and O'sullivan, M.J. (2000) Birth weight references for twins. Am. J. Obstet. Gynecol., 182, 1250-1257. Minor A. (2005) Investigation of confined placental mosaicism (CPM) at multiple sites in post-delivery placentas derived through intracytoplasmic sperm injection (ICSI) with comparative genomic hybridization (CGH)., Mater's thesis, University of British Columbia., pp7 Minor, A., Hanner, K., Peters, N , Yuen, B.H. and Ma, S. (2006) Investigation of confined placental mosaicism (CPM) at multiple sites in post-delivery placentas derived through intracytoplasmic sperm injection (ICSI). Am. J. Med. Genet. A., 140, 24-30. Ness, G.O., Lybaek, H. and Houge, G. (2002) Usefulness of high-resolution comparative genomic hybridization (CGH) for detecting and characterizing constitutional chromosome abnormalities. Am. J. Med. Genet., 113, 125-136. Pinborg, A., Loft, A., Rasmussen, S., Schmidt, L., Langhoff-Roos, J., Greisen, G. and Andersen, A.N. (2004) Neonatal outcome in a Danish national cohort of 3438 IVF/ICSI and 10,362 non-IVF/ICSI twins born between 1995 and 2000. Hum. Reprod., 19, 435-441. Qumsiyeh MB. (1998) Chromosome abnormalities in the placenta and spontaneous abortions. J Matern Fetal Med. 7:210-2. 91 Rua, S., Comino, A., Fruttero, A. and Abrate, M. (1995) DNA flow cytometric analysis of abortions. A simple method for detection of triploidy and tetraploidy in the trophoblastic cells. Pathologica, 87, 107-111. Schieve, L. A., Meikle, S.F., Ferre, C , Peterson, H.B., Jeng, G. and Wilcox, L.S. (2002) Low and very low birth weight in infants conceived with use of assisted reproductive technology. N. Engl. J. Med., 346, 731-737. Schuring-Blom, G.H., Keijzer, M., Jakobs, M.E., Van denBrande, D.M., Visser, H.M., Wiegant, J., Hoovers, J.M. and Leschot, N.J. (1993) Molecular cytogenetic analysis of term placentae suspected of mosaicism using fluorescence in situ hybridization. Prenat. Diagn., 13, 671-679. Simoni G, SirchiaSM. (1994) Confined placental mosaicism. Prenat Diagn., 14, 1185-9. Wang, J.X., Clark, A.M., Kirby, C.A., Philipson, G , Petrucco, O., Anderson, G. and Matthews, C D . (1994) The obstetric outcome of singleton pregnancies following in-vitro fertilization/gamete intra-fallopian transfer. Hum. Reprod., 9, 141-146. Wang, J.X., Norman, R.J. and Wilcox, A.J. (2004) Incidence of spontaneous abortion among pregnancies produced by assisted reproductive technology. Hum. Reprod., 19, 272-277. Winter, E., Wang, J., Davies, M.J. and Norman, R. (2002) Early pregnancy loss following assisted reproductive technology treatment. Hum. Reprod., 17, 3220-3223. Wolstenholme, J., Rooney, D.E. and Davison, E.V. (1994) Confined placental mosaicism, IUGR, and adverse pregnancy outcome: a controlled retrospective U.K. collaborative survey. Prenat. Diagn., 14, 345-361. Zbieranowski, I., Demianiuk, C , Bell, V., Knape, W.A. and Murray, D. (1993) Detection of false DNA aneuploidy and false DNA multiploidy in flow cytometric DNA analysis. Anal. Cell. Pathol., 5, 69-84. 92 CHAPTER 3. Origin of chromosomal abnormalities in conceptus derived from ICSI 3.1 Introduction In the general population, most aneuploidies ascertained from spontaneous abortions (SA) have been attributed to maternal meiotic error, except trisomy 4, 5 and sex chromosome aneuploidy. Trisomy 4 and 5 primarily derive mitotically (Robinson et al., 1999), and sex chromosome has a higher rate of paternal contribution especially in monosomy X (75% paternal, Hassold et al., 1992) and in cases involving the Y chromosome (Hassold and Hunt 2001; Robinson and Jacobs 1999). In contrast, confined placental mosaicism ( C P M ) is more frequently associated with mitotic origin, with the exception of trisomy 16 and 22, and possibly trisomy 9 (Wolstenholme, 1996; Robinson et al, 1999). Trisomy 16 and 22 almost exclusively derive from a meiotic error in both non-mosaic and mosaic cases (Robinson et al, 1999). While much remains to be understood regarding the etiology of aneuploidy, maternal age seems to be the only clear predisposing factor for aneuploidy in the general population (Hassold and Chiu, 1985). Advanced maternal age is known to be prevalent in patients undergoing assisted reproductive technologies (ART) ; this may partially explain for the increase in chromosomal abnormality in the A R T population. However, intracytoplasmic sperm injection (ICSI) appears to add additional risk for chromosomal anomalies, as a higher incidence of chromosomal abnormality has been detected in ICSI conceptions compared to those conceived through conventional in vitro fertilization (IVF) (Wennerholm et al, 2000). Considering the fundamental difference between these two technologies, ICSI assumes two additional risk factors, the underlying male infertility and the invasiveness of the procedure. The incidence of somatic chromosomal abnormality in infertile men is 10-20 fold higher than the fertile population (Matsuda etal, 1992), primarily involving sex chromosome aneuploidy and structural rearrangements (Gekas et al, 2001). Also, a significantly higher rate of de novo aneuploidy has been found in sperm from infertile men with normal somatic karyotypes compared to the fertile controls (Shi and Martin, 2001). These paternal abnormalities can be more readily transmitted through ICSI as it bypasses many physiological selection barriers. ICSI is also a much more invasive by nature compared to other A R T s . The injection 93 procedure has been suggested to disrupt spindle apparatus, cytoskeleton, and chromatin configurations in animal models (Hewitson et al., 1996; Terada et al., 2000). This kind of damage on an oocyte may lead to a meiotic II error i f the perturbation occurred early during the exclusion of the second polar body; or may lead to a mitotic segregation error i f the damage takes effect later on. Because of these combined risk factors, origin of chromosomal abnormalities in ICSI conceptions may be distinctive from that found in other A R T and the natural conceptions. In fact, not only did most of the inherited chromosome abnormalities have a paternal origin (17/22, Bonduelle et al., 2001), de novo cases were also predominantly resulted from a paternal error (6/8, Van Opstal et al., 1997). Although the available data predominantly points to a paternal origin, the number of cases studied is too small to eliminate other contributing factors. Thus, parental origin should be determined for every cytogenetically abnormal case in ICSI pregnancies, in order to clarify how much each risk factor - maternal age, male infertility, and mechanical stress - contributes to the elevated incidence of chromosomal abnormalities in the ICSI population. To date, studies of origin of chromosomal abnormalities in ICSI conceptions have been limited to non-mosaic cases. Studying the origin of mosaic and non-mosaic chromosomal abnormalities in ICSI conceptions and comparing it to that in the general population wi l l contribute to our understanding of how the aforementioned factors are related to chromosomal abnormalities in the ICSI population. The study of parental origin in ICSI conceptions may also provide insight into the safety of the procedure as well as information for genetic counseling. 3.2 Material and methods 3.2.1 Clinical information Two cases of C P M and three cases of spontaneous abortions were included in the study of origin o f chromosomal abnormalities. The two C P M cases include the abnormal case (45, X ) found in the current study and another case from previous study with a partial gain on chromosome 7 (7q31>qter) and a partial loss on the X chromosome (Xp21>pter) (Minor et al, 2006). Three cases of spontaneous abortions (SAs) ascertained from Genesis, a local I V F clinic, all occurred during the first trimester (Table 3.1). C P M cases were identified by C G H , whereas chromosomal abnormalities in SAs were determined by routine 94 cytogenetic analysis at a clinical cytogenetic laboratory. Parents have given informed consent to provide us with placental tissues and peripheral blood for the study of parental origin. Table 3.1 Clinical information case Ascertainment Maternal age (years) Gestational age (WK) Abnormality 1 CPM 40 41 45, X (Troph) 2 CPM 31 40 Gain 7q3 l>qter; Loss Xp21>pter 3 SA 39 8 Balanced t(13;21) 4 SA 40 5 trisomy 2 5 SA 39 7+4/7 Analysis failed 3.2.2 Genotyping for the origin of chromosomal abnormality Genotyping for the parental origin of a chromosomal abnormality was based on the inter-individual variation on the size of microsatellite repeats. Genomic D N A was amplified with primers that flank microsatellite repeat regions using polymerase chain reaction (PCR). A total o f l O u L P C R reaction contained 1 x Rose Taq buffer [20 m M Tris HC1 (pH8.0); l O m M KC1; 0.1% Triton X 100; 50ug / ml nuclease free B S A ; 2 m M MgC12], 2 0 0 u M dNTP, 300nM of each primer, 2 .0U of Rose Taq and about 30ng D N A . Amplification was performed on an M J research thermocycler with 35 cycles of 30s at 95°C for denaturation, 55s at 45°C for annealing, and 1 min 30sec at 72°C for elongation. Primers close to the centromeres are ideal for genotyping to distinguish Meiotic I and II errors because less recombination occurs between these sites and the centromere. D N A from abnormal tissues, maternal blood, and/or paternal blood was included in the analyses. In the event parental blood was unavailable, D N A was extracted from maternal decidua after removal of v i l l i with the aid of a microscope. The P C R products were separated by the size of amplicons. For products amplified with non-fluorescent primers, a 6% polyacrylamide ( P A G E ) gel (6% polyacrylamide/50% urea) was used. A n equal amount of urea loading buffer (4.2% urea; 0.1% xylene cyanol; 0.1%) bromophenol blue; 5 m M E D T A ) was added to each P C R product. The mixture was denatured at 95°C and set on ice-water shortly before loading onto the P A G E gel. Samples 95 were electrophoresed at 45 W for 30-90 minutes depending on the size of the fragment. The gel was then stained with silver nitrate solution (0.6g in 300mL dHzO) and developed in 300mL of 0 .28M N a C 0 3 and 0.05% formaldehyde. The gel was transferred to blotting paper and dried at 80°C for up to 2 hours. The A B B 10 automated genetic analyzer was used for analysis when fluorescently labeled P C R primers were used. A forward primer was labeled with fluorescent dyes, H E X (green) or 6 - F A M (blue) ( N A P S Oligonucleotide Synthesis Facility, U B C ) . In each tube, 9.5 u L of H id i deionized formamide, 0.5uL of P C R products, and 0.2uL of R O X 500 size standards were mixed. The mixture was then denatured at 95°C for 5 minutes and then immediately cooled in ice water. The A B I prism data collection software and the GeneScan analysis software installed in the instrument converts the fluorescence signals to interpretable data. The peaks obtained from A B I data are equivalent to bands appearing on a silver stained P A G E gel. In a normal heterozygous biparental case, two differently sized peaks (bands) represent the maternal and paternal alleles. In cases of trisomy, an extra peak or a double-sized peak (band) may be present; whereas, in cases of monosomy, a single peak (band) is present. 3.3 Results The results for origin determination are summarized in Table 3.2. Case 5 was not included because it did not have enough material for any cytogenetic analysis. Table 3.2 Parent-of-origins for chromosomal abnormalities found in ICSI conceptuses. Case# Chr abnormality ascertainment Origin FISH on sperm 1 45, X (Troph) CPM Mitotic, Missing paternal X, n.a 2 Gain 7q3 l>qter Loss Xp21>pter CPM (previous study) Mitotic Chr7:N.A; Chr X: missing maternal n.a. 3 t(13;21) SA Paternal (by Karyotype) Yes 4 Trisomy 2 SA Maternal meiotic I n.a 96 Case 1 Genotyping using microsatellite marker at the Androgen Receptor gene (AR) , revealed an absence of paternal X chromosome in the 45, X case. However, our observation was not unique, as the missing X is paternal in most monosomy X cases (83% in SA, and 74%o in livebirth, Hassold et al, 1992; Jacobs et al, 1997). The low level o f mosaicism and the lack of U P D for the X chromosome in diploid cells implicate a mitotic error. As described in the previous chapter, two out of ten sites were affected exclusively in the trophoblast layer. One site is non-mosaic with 98.8% of trophoblast cells being 45,X, while the other abnormal site has lower level mosaicism with approximately half of the trophoblast being 45, X and the rest being 46,XX . Thus, the monosomic cells were probably derived from a diploid (46,XX) conception with a post-zygotic error in some progenitor cells of the trophoectoderm, which gives rise to the trophoblast (Carlson, 2004). Furthermore, based on the finding of only a monosomic cell line and no trisomic 47,XXX cell line (0/507), the error may be due to anaphase lag instead of nondisjunction. Mitotic nondisjunction theoretically gives rise to an equal number of monosomy and trisomy cells; whereas anaphase lag produces only monosomy. Nevertheless, we can not exclude the presence of the trisomic cell line in other parts of the placenta. Case 2 Parental blood was not available for genotyping analysis; therefore D N A from decidua was used to determine the maternal genotype. However, the contamination of v i l l i embedded in the decidua made the identification of parental origin for this case difficult. The partial monosomy X was determined to be a lack of maternal X chromosome contribution; whereas, the origin of partial trisomy 7 was not clear. C G H analysis revealed that this abnormality was present in the.trophoblast at two out of ten sites (Minor et al, 2006). Accordingly, the origin of this abnormality is probably a post-zygotic error resulting in an independent partial loss of chromosome X and a partial gain of chromosome 7. 97 Case 3 The origin o f the abnormality found in the spontaneously aborted case, t(13;21), was determined from the cytogenetic analysis performed by a certified clinical technologist. Analysis of cultured chorion revealed a male karyotype with a balanced Robertsonian translocation with the breakpoint at the centromeres of both chromosomes [45 ,XY, t(13;21) (qlO;qlO)]. The same translocation was observed in his father, who presented with oligoasthenoteratozoospermia (OAT) . In addition, the father's brother was found to have the same translocation; however, his fertility status is not clear because he underwent a vasectomy. The father's sister was not available for cytogenetic analysis although she reported a five-year history of infertility. Thus, this translocation appears to be familial involving at least two generations. Interestingly, the grandparents did not appear to have a problem with fertility. Unfortunately, they were not available for cytogenetic analysis or for providing pregnancy history. Although the translocation was balanced, the pregnancy ended as a spontaneous abortion at 8 t h week of gestation. Since the fetus carried the same translocation as the father's and uncle's, the translocation is probably not responsible for the miscarriage. Female anatomical factors may also be excluded as being responsible for the pregnancy loss, as the mother did not have tubal, ovulatory or pelvic infertility factors. Thus, the cause for the pregnancy loss remains unexplained. Case 4 The spontaneous abortion occurring at the 5 t h week of gestation was found to be trisomic for chromosome 2. Although the placental tissues appeared to be non-mosaic, the chromosomal constitution of the fetus is not known. The two informative markers located with great proximity to the centromeres support origin from a maternal meiotic I nondisjunction. In spontaneous abortions occurring after natural conception, a trisomy 2 was due to a maternal meiotic I error in 54% of the cases (n=18) (Hassold.and Hunt, 2000). The couple had a previous ICSI cycle that ended in spontaneous abortion due to trisomy 21. Although its origin was not determined, considering trisomy 21 is associated with a maternal origin in 90% of the cases in the general population (Miller and Therman, 2001), we 98 speculate that the advanced maternal age (40 years old) in this case may have led to the trisomic conception and subsequent SA. 3.4 Discussion and conclusion The 45 ,X confined to the placenta demonstrated a lack of paternal chromosome due to a post-zygotic error. Although C P M with monosomy X has been reported as the most common placental mosaicism involving sex chromosomes, origin has been not being frequently studied. Farra et al. (2000) reported two cases of C P M with monosomy X through C V S , of which one had 50% and the other had 100% monosomy cells in chorionic v i l l i , but both cases had 0% abnormality in amniotic fluid. It is possible that the error occurred mitotically particularly in the case with 50% C V S result, as a small number of cells might have been affected. The investigation of origin for placental mosaicism with 45 ,X is difficult because meiotic and mitotic error cannot be distinguished, unless multiple sites from the affected placenta are examined. Moreover, many cases may be missed due to the lack of clinical phenotype in this type of C P M (Farra et al, 2000) Origin of monosomy X cases has been more frequently studied in non-mosaic cases (possibly including mosaic cases) ascertained through S A or C V S . In those cases, investigations were limited to the parental origin, i.e. mitotic errors were not looked. In the general population, 83% of S A cases showed an absence of the paternal X chromosome (n=47, Hassold et al, 1992), and the rate is 74% in livebirths (n=93; Jabods et al, 1997). It has been suggested that over 90% of the livebirth 45 ,X are mosaic (Fernandez-Garcia et al, 2000). Although this data may not be representative of the placental mosaicism, it implies that the paternal chromosome is more susceptible to loss. Monosomy X found in ICSI conceptions including the present case, however, has been shown to be 42% (3/7) maternal and 57% (4/7) paternal in origin (Ma et al, 2006; Van Opstal et al, 1997; L a m et al, 2001). Due to the extremely small sample size, it remains to be established whether the increase in monosomy X cases missing maternal chromosome is truly prevalent in the ICSI population. The trisomy 2 case had a maternal meiotic I origin. Studies in the general population revealed that trisomy 2 is present in 1.1% of S A and does not lead to a livebirth (Jacobs and Hassold 1987). In about 54% of the cases the extra chromosome is derived from a maternal 99 M I error, and 28% of the cases are due to a paternal a M I error (Hassold and Hunt 2001). Prior to our study, only one case o f trisomy 2 has been reported in ICSI conceptions (ascertained through SA); however, the origin was not determined (Causio et al., 2002) Among the four abnormalities analyzed, only the Robertsonian translocation (13;21) was of paternal origin. Because this is a rare Robertsonian translocation involving two chromosomes that account for the majority of trisomies among livebirths, the meiotic segregation pattern in sperm should be investigated (chapter 4). It wi l l add insight to the correlation between the chromosomal abnormality in sperm from infertile men and that in the resulting conception, In summary, the chromosomal abnormalities in two C P M cases were mitotic in origin, and two S A cases were maternal and paternal in origin, respectively, in the ICSI group studied. Due to the limited sample size, we cannot draw any meaningful conclusion in terms of the distribution of origins of aneuploidy in ICSI conceptions. However, we emphasize the importance of the study of parental origin o f aneuploidy in ICSI conceptions because it may provide answers for the increased incidence of chromosomal abnormality found in the ICSI population. 3.5 Bibliography Bonduelle M, Van Assche E, Joris H, Keymolen K, Devroey P, Van Steirteghem A, and Liebaers I (2002) Prenatal testing in ICSI pregnancies: incidence of chromosome anomalies in 1586 karyotypes and relation to sperm parameters. Hum Reprod., 17, 2600-2614 Carlson, B.M. (2004) Human embryology and developmental biology. Philadelphia: Mosby, 3rd ed: pp3-41. Causio F, Fischetto R, Sarcina E, Geusa S, and Tartagni M (2002) Chromosome analysis of spontaneous abortions after in vitro fertilization (IVF) and intracytoplasmic sperm injection (ICSI). Eur J Obstet Gynecol Reprod Biol., 105, 44-48. Gekas J, Thepot F, Turleau C, Siffroi JP, Dadoune JP, Briault S, Rio M, Bourouillou G, Carre-Pigeon F, Wasels R, Benzacken B (2001) Association des Cytogeneticiens de Langue Francaise. Chromosomal factors of infertility in candidate couples for ICSI: an equal risk of constitutional aberrations in women and men. Hum Reprod. 16, 82-90. Hassold T, Hunt P (2001) To err (meiotically) is human: the genesis of human aneuploidy. Nat Rev Genet 2(4), 280-91. Hassold, T. and Chiu, D. (1985) Maternal age-specific rates of numerical chromosome abnormalities with special reference to trisomy. Hum. Genet, 70, 11-17. 100 Hassold, T., Pettay, D., Robinson, A. and Uchida, I. (1992) Molecular studies of parental origin and mosaicism in 45,X conceptuses. Hum. Genet., 89, 647-652. Jacobs PA, Hassold TJ (1987) Chromosome abnormalities: Origin and etiology in abortions and livebirths. In F.V.K.S (eds) Human genetics. Vol. 1987. Verlag, Berlin, pp233-244. Jacobs, P., Dalton, P., James, R., Mosse, K., Power, M., Robinson, D. and Skuse, D. (1997) Turner syndrome: a cytogenetic and molecular study. Ann. Hum. Genet., 61, 471-483. Ma, S., Philipp, T., Zhao, Y., Stetten, G , Robinson, W.P. and Kalousek, D. (2006) Frequency of chromosomal abnormalities in spontaneous abortions derived from intracytoplasmic sperm injection compared with those from in vitro fertilization. Fertil. Steril., 85, 236-239. Matsuda T, Horii Y, Ogura K, Nonomura M, Okada K, Yoshida O (1992) Chromosomal survey of 1001 subfertile males: incidence and clinical features of males with chromosomal anomalies. Hinyokika Kiyo., 38, 803-9. Miller OJ and Therman E. (2001) Human chromosome. Springer-Verlag 4th ed: ppl3-151. Minor, A., Harmer, K., Peters, N., Yuen, B.H. and Ma, S. (2006) Investigation of confined placental mosaicism (CPM) at multiple sites in post-delivery placentas derived through intracytoplasmic sperm injection (ICSI). Am. J. Med. Genet. A , 140, 24-30. Robinson, W.P., Bernasconi, F., Lau, A. and McFadden, D.E. (1999) Frequency of meiotic trisomy depends on involved chromosome and mode of ascertainment. Am. J. Med. Genet., 84, 34-42. Shi Q, Martin RH (2000). Aneuploidy in human sperm: a review of the frequency and distribution of aneuploidy, effects of donor age and lifestyle factors. Cytogenet Cell Genet., 90, 219-26. Van Opstal D, Los FJ, Ramlakhan S, Van Hemel JO, Van Den Ouweland AMW, Brandengurg H, Pieters MHCE, Verhoeff A, Vermeer MCS, Dhont M and In't Veld PA (1997) Determination of the parent of origin in nine cases of prenatally detected chromosome aberration found after intracytoplasmic sperm injection. Hum Reprod., 12, 682-686. Wolstenholme J. (1996) Confined placental mosaicism for trisomies 2, 3, 7, 8, 9, 16, and 22: their incidence, likely origins, and mechanisms for cell lineage compartmentalization. Prenat Diagn., 16, 511-24. Wennerholm, U.B., Bergh, C , Hamberger, L., Lundin, K , Nilsson, L., Wikland, M. andKallen, B. (2000) Incidence of congenital malformations in children born after ICSI. Hum. Reprod., 15, 944-948. 101 CHAPTER 4. Meiotic segregation patterns and aneuploidy rate in sperm from a father of a Robertsonian translocation ^ I S J H ) 1 4.1 Introduction Robertsonian translocations (RTs), fusions between two acrocentric chromosomes, are the most common structural chromosomal rearrangements in humans, occuring in approximately 1 in every 1000 newborns (Therman et al., 1989). Among the possible combinations o f the five acrocentric chromosomes (13, 14, 15, 21 and 22), translocations between chromosomes 13 and 14 and between chromosomes 14 and 21 are the most frequent, comprising about 75% and 10% of all R T cases, respectively. The t(13;21) is one of the rarest rare RTs, estimated to occur in approximately 2% of all RTs (Therman et al, 1989). M e n carrying balanced RTs often have some degree of infertility, for instance oligozoospermia or azoospermia, but are otherwise phenotypically normal (Scriven et al, 2001). The aetiology of infertility is related to synaptic abnormalities during meiosis leading to meiotic arrest. The incidence of RTs in infertile men is approximately 2 -3% compared to 0.12%) in the general population. (Nielsen and Wohlert, 1991; Baschat et al, 1996; Testart et al, 1996). With current advances in assisted reproductive technologies ( A R T ) , such patients have increasingly been given the opportunity to conceive their own biological children. Thus, it is of concern that chromosomally unbalanced gametes from R T carriers may be incorporated into the conceptus. In addition, RTs may adversely affect the meiotic segregations of uninvolved chromosome pairs. The presence of such interchromosomal effects (ICE) is still an open debate. Supporting data have been provided by several studies using multicolour fluorescent in situ hybridization (FISH) to investigate sperm in infertile men (Rousseaux et al, 1995; Morel et al, 2001; Baccetti et al, 2002; Anton et al, 2004). Gianaroli et al. (2002) examined 111 in vitro-generated embryos from R T carriers and reported a considerable amount of I C E such that 31%> of the embryos had abnormalities on R T non-related chromosomes and 36%> 1 A version of this chapter has been published. Hatakeyama C, Gao H, Harmer K, Ma S. 2006. Meiotic segregation patterns and ICSI pregnancy outcome of a rare (13;21) Robertsonian translocation carrier: a case report. Hum Reprod: 21(4):976-9. 102 had abnormalities in both RT-related and non-related chromosomes. Conversely, other authors reported lack of I C E in RTs (Blanco et al, 2000; Pellestor et al, 2001), and some suggest that I C E is restricted to sperm with poor quality (Vegetti et al, 2000; Pellestor et al, 2001). As most studies on I C E were done on common RTs, the investigation on the rare t(13;21) case wi l l not only add information to the debate on the presence of I C E but also provide insight into the association between the types of translocated chromosomes and I C E , i f it exists. Although meiotic segregation and I C E in spermatozoa have been repeatedly studied in the t(13;14) and t(14;21) cases, t(13;21) cases have yet to be well documented. The aim of the current study was to investigate meiotic segregation pattern of involved chromosomes and possible I C E in a man with a balanced t(13;21), which was also transmitted to his ICSI-facilitated conception. 4.2 Materials and methods 4.2.1 Clinical information A couple (39-years-old, female; 40-years-old male) presented with a 3-year history of primary infertility. The female partner displayed no evidence of tubal, ovulatory or pelvic infertility factors. The male partner (proband), however, was found to have oligoasthenoteratozoospermia from two consecutive semen analyses (sperm count, 7.4-8.4 x 10 6/ml; normal motility, 3-7%; and normal morphology, 2%>). Subsequent karyotyping of the man's peripheral blood revealed a balanced R T involving chromosomes 13 and 21. The breakpoint appears to be at the centromeres of both chromosomes. This translocation karyotype, 45,XY,t(13;21)(qlO;qlO), appeared in all cells examined. The proband's brother was found to have the same translocation. However, the proband's parents and female sibling was not available for cytogenetic analysis. Both the proband's brother and sister had no children: his brother underwent a vasectomy in his early thirties and his sister had a 5-year history of infertility. Because of the severity of the proband's sperm parameters, I V F combined with ICSI was undertaken. 103 4.2.2 Fluorescent in situ hybridization (FISH) Sperm preparations Semen was washed in P B S and centrifuged at moderate speed (280g) for 5 minutes. The cell pellets were fixed in 3:1 methanol: acetic acid, and then spread and fixed onto slides. Prior to hybridization, sperm were decondensed as described by Palermo et al. (1999) with minor modifications. The slides were first washed in 2 x SSC solutions for 5 minutes. The slides were immersed in l O m M dithiothreitol (DTT) (Sigma, St. Louis, M O ) / lOOmM Tris (pH8.0; Fisher Scientific, N Y ) for 30 minutes, and then further treated with l O m M 3,5-Di-iodosalicytic acid (DSA) / I m M - D T T / l O O m M Tris (pH8.0) for another 30 minutes. The slides were then rinsed twice in 2x SSC and examined under a phase-contrast microscope while the slide was still wet. If sperm heads appeared to be larger and evenly darkened, the decondensation was complete. If decondensation was incomplete, the slide was further incubated in l O m M D T T / lOOmM Tris and l O m M D S A / I m M DDT/1 OOmM Tris until the sperm were sufficiently decondensed while still retaining their tails. Hybridization and Analysis Dual-colour F I S H was carried out using L S I 13/21 probes (13q l4LSI13 , SpectrumGreen / 21q22.13-q22.2 LSI21, SpectrumOrange; Vysis, Downers Grove, IL, U S A ) . Triple-colour F I S H was performed using a-satellite D N A probes for chromosome 18, X and Y (CEP 18 SpectrumAqua / C E P X SpectrumGreen / C E P Y SpectrumOrange; Vysis, Downers Grove, IL, U S A ) . Prior to hybridization, the slides were denatured in 70% formamide / 2x SSC (pH7.4-7.5) at 75°C for 5 minutes. The slide was dehydrated in an ice-cold ethanol series (70%>, 80%, and 100%) for 2 minutes each and air-dried at room temperature, pre-denatured probes (10 uL) were applied onto the slide and covered with a 22x22 mm coverslip and sealed with rubber cement. Hybridization occurred in a humid chamber overnight at 37 °C. Post-hybridization wash was carried out as described for C G H protocol. The analysis was carried out with an epifluorescent microscope (Nikon Elipse E600W) equipped with a triple bandpass filter (DAPI / F I T C / Cy3), a dual bandpass filter (FITC/Cy3), and single bandpass filters for D A P I , Aqua, F I T C , and Cy3. Scoring was 104 performed in areas with consistent hybridization. Only morphologically intact sperm cells with tails were included to avoid scoring of other cell types or hybridization artifacts. A t least ten thousand nuclei were scored for each probe set. The result was compared with data from infertile controls previously assessed in our laboratory under the same procedures. 4.3 Results 4.3.1 ICSI outcome A summary of results from three ICSI cycles is given in Table I. O f the 17 oocytes retrieved in three consecutive ICSI cycles (over a 2-year interval), 12 metaphase II ( M i l ) oocytes were used for ICSI. O f the 12 oocytes injected, 9 of them fertilized normally (75%). Four (4-, 6-, 7- arid 8-cell stage), three (all 8-cell stage) and two (7- and 8-cell stage) embryos were transferred in three separate cycles. Among the nine transferred embryos, only two were of poor quality, while the others displayed normal development and good quality. In all three cycles, it was noted that sperm parameters had worsened at the time of the ICSI procedure compared to previous semen analyses: sperm concentrations were all less than 3 x 10 6/ml, and very few motile sperm were present. Pregnancy was achieved only in the first ICSI cycle, in which a total of four embryos were transferred. At the eighth week o f gestation, the pregnancy spontaneously aborted. Cytogenetic analysis o f cultured chorion revealed a male karyotype with a balanced R T of paternal origin [45,XY,t(13;21)]. Table 4.1 ICSI clinical outcomes of the t(13;21) case . Table 10. Cycle one ' Cycle two Cycle three Total No. of injected oocytes 4 5 3 12 No. of fertilized oocytes 4 3 2 9 No. of clinical pregnancies 1 0 0 1 No. of spontaneous abortion 1 - - 1 105 4.3.2 FISH on sperm The meiotic segregation analysis on chromosomes 13 and 21 was performed on a total number of 10 223 sperm nuclei (Table 4.2). With respect to chromosomal constitutions of 13 and 21, the majority of spermatozoa (88.39%) were normal, 13q/21q, or balanced, der(13q;21q), both derived from alternate segregation in meiosis. Chromosomally unbalanced spermatozoa for chromosomes 13 and 21, derived from an adjacent segregation, account for 11.08%). This was significantly higher than in the six fertile controls (0.6%) (p<0.05). The rates of nullisomy for both chromosomes 13 and 21 were higher than the complementary disomy rates in the patient (P < 0.05); however, such discrepancy was not observed in the control group (P > 0.05). The rate for the 3:0 segregation and diploidy, indicated by two signals for each of 13 and 21, was 0.26%, whereas the control group had a frequency of 0.1%. In addition, there was 0.18% of 21q/21q and 0.09% of 13q/13q exclusively observed in the patient, which were categorized as 'other' modes of segregation in Table 4.2. Table 4.2 Meiotic segregation analysis for chromosome 13 and 21 for t(13;21) case. Segregation Chromosomal Chromosomal FISH results Controls modes constitution status (n=10223) (n=60975) n % % Alternate 13q/21qorder(13q;21q) Normal or balanced 9036 88.39 99.29 13q Nullisomy 21 387 3.79 * 0.11 Adjacent 21q/der(13q;21q) Disomy 21 208 2.03 * 0.15 21q Nullisomy 13 399 3.9* 0.24 13q/der(13q;21q) Disomy 13 139 1.36* 0.1 1133 11.08* 0.6 3:0 or diploid 13q/21q/der(13q;21q) or 13q/13q/21q/21q Diploidy 27 0.26 0.1 other 27 0.26 0 *P<0.05 by Chi-square test 106 The results of the I C E investigation are summarized in Table 4.3. A total of 10 172 sperm nuclei were analyzed with the 18, X , Y probe set, and 98.79% were normal haploid. The overall aneuploidy rate was not significantly higher in the patient compared to that of controls (P > 0.05). The rate of sex chromosome disomy (0.15%) was about five times as high as disomy 18 (0.03%), which was also observed in the control group (0.39 versus 0.07%o). The diploidy rate was 0.05% in the patient and 0.04% in the controls. Table 4.3 Analysis of I C E for chromosome 18, X and Y in the tl3;21 case Chromosomal number FISH results Controls P-values (n= 10172) (n=50740) n % % Haploid 10047 98.79 99.07 n.s. Sex chromosome disomy 15 0.15 0.39 n.s Disomy 18 3 0.03 0.07 as Diploidy 5 0.05 0.04 as n.s: Not significant (p>0.05 by Chi-square test). 4.4 Discussion and conclusion Studies on meiotic segregation in R T carriers have been of great informative value in reproductive counseling. However, few reports of t(13;21) cases, along with other rare RTs, are available in the literature, despite the involvement of the two chromosomes accounting for the majority o f trisomies among live births. To our knowledge, this is the first study that has investigated the meiotic segregation pattern and the possible I C E of t(13;21) in sperm. The clinical information regarding the ICSI treatment and the pregnancy outcome were also reported thoroughly in order to provide further information for the physicians and patients considering A R T . The segregation analysis of chromosomes 13 and 21 in the current study showed that 88.39%) of the spermatozoa were normal or balanced. This percentage is in agreement with previous F I S H studies on sperm for other types of RTs (Martin et al, 1992; Mennicke et al, 1997; Honda et al, 2000; Ogawa et al, 2000; Morel et al, 2001). Normal or balanced sperm were present predominantly in all segregation studies, ranging from 60 to 96.6%, 107 regardless of different methodologies used for analyses (heterospecific I V F , sperm injection into mouse oocytes or FISH). Among the most well-studied t(13;14) cases, the percentage of normal or balanced constitutions also ranges from 73.5 to 92.3% (reviewed by Anton et al, 2004). The high frequency of normal or balanced spermatozoa is presumably attributable to a selection in all RTs towards the cis-configuration of the trivalent during meiosis which leads to an alternate segregation (Sybenga, 1975). The unbalanced chromosomal constitutions were comprised of nullisomies and disomies derived from adjacent segregations, 3:0 or diploidy, and unexpected combinations ('other' in Table II). There was an obvious deviation from the expected 1:1 ratio of disomic to its complementary nullisomic spermatozoa. For both chromosomes 13 and 21, the nullisomy rates were significantly higher than disomy rates (p< 0.05). Similar observations were made previously by other researchers (Honda et al, 2000; Frydman et al., 2001; Morel et al, 2001; Anton et al, 2004). The discrepancy possibly originates from two factors. First, hybridization artifacts can lead to a higher frequency of nullisomy. However, the high efficiency o f hybridization makes hybridization artifacts an unlikely cause. Also, taking into consideration that such inconsistency was not seen in the controls and that a hybridization failure would affect all combinations of signals rather than one category, in our case the discrepancy is unlikely to be due to experimental errors. The second factor that may contribute to the observation is differential detection by meiotic checkpoints. A s suggested by Honda et al. (2000), there may be a more stringent selection against disomic cells than nullisomic cells. Therefore, a higher frequency of nullisomy in the spermatozoa can be expected. Two signals for each of chromosomes 13 and 21 were displayed in about 0.26% of spermatozoa, which is similar to that in studies on other R T types (0-0.8%; reviewed by Morel etal, 2001). This phenomenon is caused by either diploidy or 3:0 segregation. The distinction was aided by the comparison with the diploidy rate found from the I C E analysis. The diploidy rate was 0.05% according to the investigation on chromosomes 18, X and Y . Hence, the rate of 3:0 segregation is estimated to be approximately 0.2%. This confirms that the occurrence of 3:0 segregation is a much rarer event compared to alternate and adjacent patterns. 108 The unexpected abnormalities observed in this study (13q/13q and 21q/21q) were perhaps attributable to non-disjunction events in meiosis II following an adjacent segregation pattern. In other words, a non-disjunction event at M i l may have prevented the formation of nullisomy 13 or 21. Instead, cells with disomy for one chromosome and nullisomy for the other chromosome (13q/13q and 21q/21q) can be formed. However, the theoretical 'co-products' o f the non-disjunction, cells missing both 13 and 21, were not detected in the study. Those cells may have been arrested at cell-cycle checkpoints, as they are genetically more intolerable forms. Investigating a larger number of nuclei may increase the chance to find such cells; however, in order to distinguish from those with hybridization failures, one would need to co-hybridize the slide with another chromosome marker as an internal control. Although the existence of I C E remains controversial, a number of studies have supported its prevalence in patients with chromosomal arrangements including RTs. Gianaroli et al. (2002) suggested that I C E is more common in cases of RTs than other types of translocations. Several F I S H studies on spermatozoa from R T patients have reported an increased frequency of sex chromosome and certain autosomal disomies (reviewed by Shi and Martin, 2001). The current case did not provide evidence for I C E on chromosome 18 and sex chromosomes. There was no significant difference in the aneuploidy rate of those chromosomes compared to the control group (P > 0.05). While Baccetti et al. (2002) observed I C E on sex chromosome disomy, disomy 18 and diploidy in a t(13;21) case, the disparity may depend on the region of chromosome involved, which may lead to certain meiotic configurations that enhance the formation of aneuploidies (Estop et al, 2000). Thus, the same type of R T may have variable I C E during spermatogenesis. Even though ICSI can possibly facilitate the transmission of the structural abnormality, in the current case, an unbalanced spermatozoon was not introduced to the conceptus. However, the pregnancy unfortunately ended as a spontaneous abortion. Although the fetus carried the same R T as in the father, the translocation is probably not directly responsible for the miscarriage because the breakpoint would likely be conserved; one may also exclude the female anatomical factors for the pregnancy loss, as the mother had no evidence of tubal, ovulatory or pelvic infertility factors. Thus, the cause for the loss remains unexplained with the available information at this point. 109 4.5 Bibliography Anton E, Blanco J, Egozcue J, and Vidal F (2004) Sperm FISH studies in seven male carriers of Robertsonian translocation t(13;14)(ql0;ql0). Hum Reprod 19, 45-51. Baccetti B, Capitani S, Collodel G, Estenoz M, Gambera L, and Piomboni P (2002) Infertile spermatozoa in a human carrier of robertsonian translocation 14;22. Fertil Steril 78, 1127-30. Baschat AA, Kupker W, al Hasani S, Diedrich K,and SchwingerE (1996) Results of cytogenetic analysis in men with severe subfertility prior to intracytoplasmic sperm injection. Hum Reprod 11, 330-3. Blanco J, Egozcue J, and Vidal F (2000) Interchromosomal effects for chromosome 21 in carriers of structural chromosome reorganizations determined by fluorescence in situ hybridization on sperm nuclei. Hum Genet 106, 500-5. Colombero, L.T., Hariprashad, J.J., Tsai, M C , Rosenwaks, Z. and Palermo, GD. (1999) Incidence of sperm aneuploidy in relation to semen characteristics and assisted reproductive outcome. Fertil. Steril 72, 90-96. Estop AM, Cieply K, Munne S, Surti U, Wakim A, and Feingold E (2000) Is there an interchromosomal effect in reciprocal translocation carriers? Sperm FISH studies. Hum Genet 106, 517-24. Frydman N, Romana S, Le Lorc'h M, Vekemans M, Frydman R, and Tachdjian G (2001) Assisting reproduction of infertile men carrying a Robertsonian translocation. Hum Reprod 16, 2274-7. Gianaroli L, Magli MC, Ferraretti AP, Munne S, Balicchia B, Escudero T, and Crippa A (2002) Possible interchromosomal effect in embryos generated by gametes from translocation carriers. Hum Reprod 17, 3201-7. Honda H, Miharu N, Samura O, He H, and Ohama K (2000) Meiotic segregation analysis of a 14;21 Robertsonian translocation carrier by fluorescence in situ hybridization. Hum Genet 106, 188-93. Martin RH, Ko E, and Hildebrand K (1992) Analysis of sperm chromosome complements from a man heterozygous for a robertsonian translocation 45,XY,t(15q;22q). Am J Med Genet 43, 855-7. Mennicke K, Diercks P, Schlieker H, Bals-Pratsch M, al Hasani S, Diedrich K, and SchwingerE. (1997) Molecular cytogenetic diagnostics in sperm. Int J Androl. 20 Suppl 3:11-9. MOrel F, Roux C, and Bresson JL (2001) FISH analysis of the chromosomal status of spermatozoa from three men with 45,XY, der(13;14)(qlO;qlO) karyotype. Mol Hum Reprod 7, 483-8. Nielsen J and Wohlert M (1991) Chromosome abnormalities found among 34,910 newborn children: results from a 13-year incidence study in Arhus, Denmark. Hum Genet 87, 81-3. Ogawa S, Araki S, Araki Y, Ohno M and Sato I (2000) Chromosome analysis of human spermatozoa from an oligoasthenozoospermic carrier for a 13; 14 Robertsonian translocation by their injection into mouse oocytes. Hum Reprod 15, 1136-9. Pellestor F, Imbert I, Andreo B, Lefort G (2001) Study of the occurrence of interchromosomal effect in spermatozoa of chromosomal rearrangement carriers by fluorescence in-situ hybridization and primed in-situ labelling techniques. Hum Reprod 16, 1155-64. Rousseaux S, Chevret E, Monteil M, Cozzi J, Pelletier R, Delafontaine D, and Sele B (1995) Sperm nuclei analysis of a Robertsonian t(14q21q) carrier, by FISH, using three plasmids and two Y A C probes. Hum Genet 96, 655-60. 110 Scriven PN, Flinter FA, Braude PR, and Ogilvie CM (2001) Robertsonian translocations-reproductive risks and indications for preimplantation genetic diagnosis. Hum Reprod 16, 2267-73. Shi Q and Martin RH (2001) Aneuploidy in human spermatozoa: FISH analysis in men with constitutional chromosomal abnormalities, and in infertile men. Reproduction 121, 655-66. Sybenga J (1975) Chromosome structural variants. In J. Sybenga (ed) General Cytogenetics. North-Holland Publishing Company, Amsterdam. The Netherlands, pp. 165-212. Tang SS, Gao H, Robinson WP, Ho Yuen B, and Ma S (2004) An association between sex chromosomal aneuploidy in sperm and an abortus with 45,X of paternal origin: possible transmission of chromosomal abnormalities through ICSI. Hum Reprod 19, 147-51. Testart J, Gautier E, Brami C, Rolet F, Sedbon E, and Thebault A (1996) Intracytoplasmic sperm injection in infertile patients with structural chromosome abnormalities. Hum Reprod 11, 2609-12. Therman E, Susman B, and Denniston C (1989) The nonrandom participation of human acrocentric chromosomes in Robertsonian translocations. Aim Hum Genet 53, 49-65. Vegetti W, Van Assche E, Frias A, Verheyen G, Bianchi MM, Bonduelle M, Liebaers I, and Van Steirteghem A (2000) Correlation between semen parameters and sperm aneuploidy rates investigated by fluorescence in-situ hybridization in infertile men. Hum Reprod 15, 351-65. I l l CHAPTER 5. Methylation status at the differentially methylated domain of H19I1GF2 in placentas derived from ICSI pregnancies 5.1 Introduction Genomic imprinting is an epigenetic phenomenon that allows for differential expression of certain genes dependent on the parent-of-origin. Imprinting aberrations have been linked to abnormal fetal development and various diseases including cancers (Abu-Amero et al, 2006; Arnaud and Feil , 2005). There is increasing evidence that assisted reproductive technologies (ARTs) , including ICSI, are associated with an unexpectedly high incidence of imprinting disorders such as Beckwith-Wiedemann Syndrome (BWS) and Angelman Syndrome (AS) (Chang et al, 2005; DeBaun et al, 2003; Gicquel et al, 2003; Maher et al, 2003; Orstavik et al, 2003). Interestingly, molecular studies have revealed that the cause for these diseases found in the A R T population was predominantly epimutation, which is not common in the general population. Hypomethylation at the differentially methylated region ( D M R ) of KCNQIOT caused 13/14 B W S cases, while the other case was due to epigenetic alteration at D M R s at both KCNQIOT and H19. These types of epimutations are responsible for up to 45% of the sporadic B W S cases. Similarly, all three A S cases reported in the ICSI group were due to epigenetic defects at an imprinting center, while this etiology account for only an estimated 5%> of the whole A S population (Cox et al, 2002; Orstavik et al, 2003). Notwithstanding the importance of epigenetic changes on specific imprinting disorders, they may also influence development and long-term health of A R T children (Maher et al., 2003). Thus, there is a pressing need to investigate the relationship between A R T and epigenetic dysregulation. Maternally expressed HI9 and paternally expressed IGF2 are known as two paradigms of imprinted genes. These genes are conversely regulated by a common D M R , which is methylated only on the paternal allele. H19 encodes for untranslated m R N A that is expressed strongly during embryogenesis, and is important for embryonic development (Weber et al, 2001; Kono et al, 2004). IGF2 also has been known to be important for embryogenesis, particularly for the placental development (Constancia et al, 2002). Hypermethylation at the D M R down-regulates H19 expression and is associated with a 112 increase in IGF2 expressions. This is thought to result in placento-megaly and fetal overgrowth as seen in B W S cases. In contrast, hypomethylation at the D M R leads to over-expression of H19 and reduced expression of IGF2 (Fedoriw et al, 2004). This may inversely suppress the placental development and lead to intrauterine growth restriction ( IUGR) as seen in patients with maternal duplication of 1 l p l 5 (Fisher et al, 2002), and some with Silver-Russell Syndrome (SRS) or SRS-like conditions (Gicquel et al, 2005; Bl iek et al, 2006). Mouse studies have suggested that the D M R at H19IIgf2, compared to other imprinted genes, was the most labile site to lose methylation when embryos were cultured in an unfavorable media condition (Mann et al, 2004). Furthermore, the placenta appears to be particularly vulnerable to such environmental stress compared to the embryo proper. The reason for such a discrepancy has been suggested to be either due to vicinity of the trophoectoderm cells with the culture media, or due to a less robust restoring system in the placenta compared to the embryo (Mann et al, 2004). ICSI involves not only in vitro culture of immature oocytes and embryos as in other A R T , but also assumes additional risks that may be inherent in the use of sperm with abnormal parameters. Incomplete methylation at H19 has been detected in mature spermatozoa in oligozoospermic patients (Marques et al. 2004). Hence, there is a concern that imprinted genes may not only be epigenetically altered during the process of ICSI, but also be passed on from the abnormal gamete to the offspring through the procedure. If hypomethylation at the HI9 D M R was somehow induced during ICSI, it would lead to over-expression of H19 and reduced expression of IGF2, which in turn may cause poor placenta formation and restricted fetal development. Therefore, we speculated that this mechanism may account for some of the frequently observed but unexplained low birth weight ( L B W ) cases in ICSI pregnancies (Katalinic et al, 2004). In the current study, the methylation pattern at the D M R of H19IIGF2 was investigated in placentas from ICSI pregnancies with L B W . Comparisons were made between the ICSI-L B W placentas and those from normal-birth-weight pregnancies conceived naturally and through ICSI treatment. 113 5.2 Materials and methods 5.2.1 Clinical information Placentas from ICSI pregnancies with reduced birth weight (9 I U G R and one L B W ) were collected from patients who underwent an ICSI procedure at the University of British Columbia in vitro Fertilization (IVF) Program from 1997 to 2006. These cases were grouped as I C S I - L B W and included L B W (birth weight <2500g) and intrauterine growth restriction ( IUGR) (birth weight below the 10 t h percentile). Each birth weight was also quantitatively converted to Z-score, which measures the standard deviation (SD) from the expected mean at the matched gestational age (Langlois et al., 2006). The Z value was obtained by (patient value-expected mean)/population SD, and the expected mean vague and SD for each gestational age was adopted from Usher and Mclean (1969). Placentas derived from ICSI pregnancies with normal birth weight ( ICSI-NBW, n=12) were also collected from the same fertility center. D N A from placentas derived from natural conceptions was included in analysis as controls (control, n=14). A l l of these controls had normal birth weight and were the healthy controls in a preeclampsia study conducted in Dr. Robinson's laboratory at the B C Research Institute. 5.2.2 Methylation sensitive Single Nucleotide Primer Extension (Ms-SNuPE) Chorionic v i l l i were sampled from two sites from each placenta and D N A was extracted using standard protocols (Chapter 2). Methylation status of two C p G sites within the D M R of H19IIGF2 was measured the using the SNuPE assay described by Sievers et al. (2005) with minor modifications (Figure 5.1). 300-500 ug of D N A was modified with bisulfite to convert unmethylated cytosine to uracil (EZ D N A Methylation-Gold Kit™, Zymo Research, Orange, C A ) . The converted D N A was first amplified by primers flanking the region of interest with F6005-R6326 followed by a semi-nested amplification with F6115-R6326 (GenBank accession no. AF087017: nucleotides 6005-6326; table 5.1) using Polymerase Chain Reaction (PCR). Each P C R reaction contained 1 x Rose Taq buffer [20 m M Tris HC1 (pH8.0); l O m M KC1; 0.1% Triton X 100; 50ug / ml nuclease free B S A ; 2 m M MgC12], 2 0 0 u M dNTP, 300nM of each primers; 2 .0U of Rose Taq. For the first round of amplification, a total of lOuL reaction was prepared with 2 u L of bisulfite-converted D N A . 114 For the second round of amplification, 1 u L of P C R product from the first amplification was added to a total of 20uL reaction. P C R amplification was performed on an M J research thermocycler with 30 cycles of 45 s at 94 °C for denaturation, 45s at 61 °C for annealing, and 1 min at 72 °C for elongation. Products from the second round of P C R were cleaned ( D N A Clean & Concentrator™-5, Zymo Research, Orange, C A ) prior to the S N u P E reactions. For the M s - S N u P E assay, the Snapshot Multiple K i t (ABI , Foster city, C A ) was used to amplify the differentially methylated CpGs with primers (CIO and C12) that target the sequences located one nucleotide upstream from a differentially methylated cytosine (Figure 5.2; table 5.1). Each primer was elongated by one of the four fluorescently labeled dideoxy nucleotides (ddNTP), depending on the methylation status at the C p G site. Specifically, ddCTPs targeting methylated sequences are labeled with d T A M R A (black) and ddTTPs targeting unmethylated sequences are labeled with d R O X (red). Each assay was performed in a total of l O u L containing 5uL of SNaPshot Ready Reaction Premix, 0 . 2 u M of primer (CIO or C12), and 2uL of cleaned P C R products. Amplification was done on the M J Research thermocycler with 25 cycles of 10s at 96°C, 5s at 52 °C, and 30s at 60°C, followed by rapid cooling to 4°C. The extension reaction was terminated by treatment with 1U of calf intestinal phosphatase, which dephosphorylates the extending primers, at 37°C for 1 hour. The enzyme was then thermally deactivated at 72°C for 15 minutes. 0.5uL of the products was added to 9.5uL of H i D i formamide and denatured at 95°C for 5 minutes before processing by A B I Prism 310 automated capillary electrophoresis ( A B I , Foster city, C A ) . Methylation status was visualized with the ABI310 and Genescan software. A typical result is shown in Figure 5.1 along with a completely methylated control obtained from sperm D N A . Peak areas were used to calculate the % methylation with the following formula: methylated peak/ (methylated + unmethylated peaks) x 100. Exclusively in the I C S I - L B W group, chorionic v i l l i were further separated to trophoblast and mesenchymal layers before the analysis, whereas whole v i l l i were used in the I C S I - N B W and the control group. The methylation level in the trophoblast and the mesenchyme was averaged in the I C S I - L B W group when comparison was made with the control groups. Hypomethylation is defined by methylation below 33%, and such cases were repeated to ensure accurate measurements. 115 TGTATAGTATATGGGTATTTTTGG AGGTTTTTTTTTCGGTTTTATCGTTT G G A T G G T A C G G A A T T G G T T G T A G T T G T G G A A T C G G A A G T G G T ZGCGCGGCG *. i C12 C10 G T A G T G T A G G T T T A T A T A T T A T A G T T C G A G T T C G T T T T A A T T G G G G T T C G T T C G T T C G T G G A A A C G T T T C G G G T T A T T T A A G T T A C G C G T C G T A G G G T T T A C G G G G G T T A T T T G G G AATAGG ATATTTATAGG A Figure 5.1 The sequence of the H19IIGF2 D M R analyzed. The primers target the sequences within the D M R of the human H19IIGF2, located within the differentially methylated domain (Sievers et al, 20005). The C T C F core binding domain is highlighted in the box. The primers used in semi-nested amplification with F6115-R6326 are underlined. The M s -SNuPE primers (CIO and CI2) are represented by arrows. The CpGs in boldface have been identified as consistently differentially methylated (Kerjean etal, 2000). (a) (b) Bisulfite •-conversion of D N A P C R p r o d u c t s U M Methylated Vumetiivtotect , M s - S N u P E , . -C — » " T ' • A C 1 Figure 5.2 Schematics of SNuPE assay, (a) Schematic outline of M s - S N u P E assay (b) a typical result obtained from A B I genetic analyzer. The black (left) peak represents the methylated sequences and the red (right) peak represents the unmethylated sequences, (c) Control using sperm D N A representing completely methylated sequences at the H19IIGF2 D M R . 116 Table 5.1 Primer sequences Primer Sequence (5'-3') F6005 AGG TGT TTT AGT TTT ATG GAT GAT GG R6326 TCC TAT AAA TAT CCT ATT CCC AAA TAA CC F6115 TGT ATA GTA TAT GGG TAT TTT TGG AGG TTT CIO GTT GTG GAA T(C/T)G GAA GTG GT C12 GAA TTG GTT GTA GTT GTG GAA T Primer sequences for semi-nested P C R amplification (F6005; F6115; R6326) and M s - S N u P E assays (CIO and CI2) . 5.3 Results In order to assure an accurate measurement of D N A methylation, the reproducibility of the assay was first examined (Figure 5.3). Eight D N A samples were analyzed in two independent assays using both primers (CIO and C12). Similar results were obtained with the inter-assay difference ranges 0-5% (average 1%> ± 2%; p>0.05 by Chi-square test). Assays were also repeated for several samples with purified D N A to test the effect of D N A purity on the validity of the assay, because D N A purity varies depending on the extraction procedure, and may affect the efficiency of certain molecular assays. Similar percentage of methylation was detected (p>0.05 by Chi-square test). The difference in % methylation ranges from 1-8%> and was not statistically significant. Two primers, (CIO and C12) were used to amplify two differentially methylated C p G sites within the H19/IGF2 D M R . Methylation assessed at both C p G sites were compared, and similar results were obtained from independent assays using the two primers (r=0.92; p<0.001; Figure 5.4). 117 Figure 5.3 Reproducibility of the M s - S N u P E assay and the effect of D N A purity on methylation assessment, (a) The reproducibility was tested using the same D N A repeated the entire process. The assay is reproducible as the results were not significantly different between independent experiments (p>.05, by Chi-square). Primer CIO (solid) and C12 (striped) were used in analysis, (b) D N A purity did not affect the measurement of methylation as uncleaned D N A (white) and cleaned D N A (shaded) yield similar results (p>.05, by Chi-square). 118 60%-50% 40%-30%-20%-10%-o%-0% 10% 20% 30% C 1 0 40% 50% 60% Figure 5.4 Correlations between the level of methylation at CIO and C12. Percent methylation measured in independent reactions (r=0.92; p<0.001) The methylation patterns at the D M R of H19 and IGF2 were compared in placentas from ICSI pregnancies with L B W ( ICSI -LBW; n=10), those with normal B W ( ICSI -NBW; n=12), and placentas from natural conceptions (control; n=14) (Figure 5,5). The average percent methylation measured at C10 was 39 ± 7% in the I C S I - L B W group, 38 ± 2% in the I C S I - N B W group, and 36 ± 3% in the control group. C12 had similar results with the average % methylation being 40 ± 8% in the I C S I - L B W group, 38 ± 3% in the I C S I - N B W group, and 36 ± 3% in the control group (Figure 5.6). The Kruskal-Wallis Test yielded a non-significant result for the comparison-of the means of the three groups (p>0.05). In more stringently defied I U G R cases [n=4, Z-score lower than -2SD (about 3 percentile)], the mean %methylation was 41.7% ± 4.8%> when values for C10 and C12 are averaged. This is slightly higher than those defined by less stringent criteria (BW<2500g; B W below 10 t h percentile; or by ultrasound diagnosis), which had a mean %> methylation o f 39.0%> ± 4.8%>. 119 Figure 5.5 Methylation patterns measured at the DMR of HI 9IIGF2. Methylation was assessed using the Ms-SNuPE assay in the three study groups (IL: ICSI-LBW; IC: ICSI-NBW; NC: controls from natural conceptions). 50% 45% 40% 35% .1 30% >.25% | 20% * 15% 10% 5% 0% 39% 38% 36% 40% 38% 36%o • L • IC U N C C10 C12 Figure 5.6 Average methylation at the DMR of H19IIGF2. Methylation patterns measured at differentially methylated CpGs, C10 and C12. (IL: ICSI-LBW; IC: ICSI-NBW; NC: controls from natural conceptions. 120 Using 33% as the cut-off for hypomethylation (Seivers et al, 2005), hypomethylation (<33%) was present only in the I C S I - L B W group (Table 5.2). Case 1 (methylation: 16.6% at CIO, 15.5%) at C12) had a birth weight was below the 10 t h percentile of the average birth weight at the matched gestational age (2177g at 37WK, -1.51SD), and case 2 (methylation: 23.5%o at CIO, 22.5%o at C12) was diagnosed by ultrasound examination (2088g at 36WK, -0.78SD). However, interestingly, hypomethylation was detected from only one out the two sites analyzed in each case. Correlation was not found between birth weights and the degree of methylation (r =-0.0048, P>0.05) nor between the Z-scores and methylation (r=-0.2054, p>0.05) in the I C S I - L B W cases. C10 C12 >33% <33% >33% <33% I C S I - L B W a b 92% 8% (n=2) 92% 8% (n=2) I C S I - N B W a 100% 0% 100% 0% Controls' 3 100% 0% 100% 0% a,b: not significantly different by Chi-square test (p>0.05). Hypomethylation was defined by less than 33%>. Our preliminary data showed that the trophoblast and mesenchymal cells presented similar rates of methylation (r=0.65, P<0.05) in placentas derived from ICSI pregnancies with normal outcomes (Figure 5.7). Therefore, analysis was performed on whole v i l l i for the controls including the I C S I - N B W and the control group. However, as previously suggested by Mann et al. from studies in the mouse, the cells with trophoectoderm origin may be more vulnerable to in vitro culture effects than those derived from the inner cell mass. In order to test this hypothesis, v i l l i were separated before the analysis of the I C S I - L B W group, which is more likely to be affected adversely by in vitro conditions. The results indicated that methylation pattern was comparable in most samples in the I C S I - L B W cases (Figure 5.8), with the average difference in % methylation being 2%o lower in the trophoblast cells. In 64%o of the cases, the trophoblast had a lower level of methylation but the difference ranges from 0%> to 19%>. Assuming the %> methylation of the whole v i l l i is represented by the average o f the trophoblast and the mesenchyme, two I U G R cases were identified as hypomethylated (methylation <33%>). Exclusively in these two cases, the methylation 121 level in the trophoblast was considerably lower than the mesenchyme (25.0% vs 7.0%> in case 1; 26.5% vs 19.5% in case 2). 40% m mesen S troph Figure 5.7 Methylation patterns of the trophoblast and the mesenchyme in placentas derived from ICSI pregnancies with normal outcomes. Methylation levels are similar in the trophoblast cells (dark) and the mesenchymal cells (light), measured in placentas derived from natural conceptions (n=9). iCSi-LBW C 8 S 8 S ornesen fgiroph Figure 5.8 Methylation patterns of the trophoblast and the mesenchyme in the ICSI-LBW group. Methylation levels in the trophoblast cells (dark) and the mesenchymal cells (light), measured in the EL group, which comprises placentas derived from ICSI pregnancies with low birth weight. Level of methylation in the trophoblast is considerably lower than the mesenchyme in the hypomethylated cases (striped). 122 5.4. Discussion and Conclusion: Several clinical studies have reported a considerably high incidence of imprinting disorders caused by epigenetic dysregulation in children conceived with A R T s (Cox et al, 2002; DeBaun et al, 2003; Maher et al, 2003). Researchers are concerned that these imprinting disorders might be merely "the tip of an iceberg"; that is, epigenetic alterations may affect other imprinted genes, which may lead to less recognizable clinical features, but affect the health of A R T children in long-term (Maher et al, 2003). Today, up to 50% of A R T treatments are performed with ICSI, which bypasses many physiological selection mechanisms that would be found in a natural conception. A number of prenatal and perinatal abnormalities have been associated with ICSI (Allen et al, 2006); however, the causes remain unclear. This study was designed to investigate the methylation patterns at the D M R of two developmental genes, H19 and IGF2, in placentas derived from ICSI pregnancies with focus on those with I U G R and L B W . Comparing the three study groups: I C S I - L B W , I C S I - N B W , and controls, we did not detect a significant difference in average methylation level. Rodent models suggested that in vitro culture adversely affects the methylation pattern at certain imprinted genes, depending on the type of the media. Mann et al. reported that culturing in the Whitten's medium resulted in loss of methylation at the H19 gene in mouse embryos (2004). In contrast, the same gene gained methylation when embryos were cultured in human tubal fluid (L i et al, 2005). However, it should be noted that neither the medium used in these studies had the optimal composition for culturing mouse embryos. Based on our findings, in vitro culture with media used in clinical settings did not seem to significantly alter the methylation patterns at the D M R of H19IIGF2 in the placentas derived from ICSI pregnancies. However, focusing on specific cases, we found two hypomethylated cases (<33%) exclusively from the I C S I - L B W L group. In both cases, the trophoblast appeared to be more hypomethylated than the mesenchymal cells. This observation is in agreement with the hypothesis proposed by Mann et al. that tissue with trophoectoderm origin is more vulnerable to external stress (2005). Curiously, only one site of these placentas was hypomethylated. Thus, it remains to be clarified whether partial hypomethylation at H19IIGF2 in the placenta has a causal relationship with reduced birth weight, and whether these cases represent a subset of L B W / I U G R pregnancies after ICSI. In order to determine i f methylation altered 123 specifically in ICSI derived L B W cases, we need to investigate methylation patterns in L B W cases not associated with ICSI. There are several drawbacks in this study. First, the sample size was limited to ten cases, which included nine I U G R (birth weight below 10 t h percentile) and one L B W (birth weight below 2500g). Many of these cases had borderline birth weight; therefore, may not truly represent the population of the pathological category. Also, because of the small sample size, we may have failed to identify a subgroup in which epigenetic defects play a role on L B W . Another shortcoming is that only two CpGs were examined out of the twenty-five differentially methylated CpGs present with in the D M R ofHJ9/IGF2. Although similar approach was informative for analyzing tumor tissues (Sievers et al., 2005; Nguyen et al., 2001), a smaller number of CpGs may be perturbed in the L B W group as the phenotype is less severe. Furthermore, expression of H19 and IGF2 was not studied; therefore, understanding the effects of the ICSI procedure is limited to the very bottom of the biological pathway. The findings in the current study are preliminary; therefore, are insufficient to draw conclusions about the possibility of epigenetic dysregulation caused by the ICSI procedure. For future studies, not only should these limitations be overcome, but a broader spectrum of the pathogenesis of fetal growth deficiency should be explored. Study of uniparental disomy (UPD) has revealed the association between P J G R and matUPD7, mat U P D 14, mat U P D 16, and matUPD20 (Kozot etal., 2002). This suggests that many other candidate imprinted genes may be involved in fetal growth. Several placental imprinted genes are suggested to control the fetal growth rate in order to maintain the nutrient supplement to the placenta. These include Slc22a2, Slc22a3, Impt l /Slc22al l , and Ata3 (Dao et al, 1998; Zwart et al, 2001; Mizuno et al, 2002). Furthermore, in order to pinpoint the step at which the epigenetic changes occurred, study of gametes and embryos at different stages should continue be conducted in animal models. Also, there are several other risk factors for epigenetic alteration related to ICSI, in addition to embryo culture. Considering the relatively delayed acquisition of maternal imprints compared to paternal imprints, manipulation of oocytes has raised concerns for causing epigenetic dysfunction. Borghol et al. (2006) detected a gain of methylation at the C T C F binding domain with in the H19/IGF2 D M R in Mi-arrested and Mil-arrested oocytes that were matured in vitro. Furthermore, superovulation has been suggested to increase 124 the incidence of abnormal global methylation by two folds in two-cell mice embryos (Shi and Haaf, 2002). Risk is not limited to the oocyte; sperm from infertile men with severe oligozoospermia have been demonstrated with incomplete methylation at H19 (Marques et al, 2004). While no supporting data has been published, the effect o f germ cell and mechanical stress due to injection should also be considered. 5.5 Bibliography Abu-Amero, S., Monk, D., Apostolidou, S., Stanier, P. and Moore, G. (2006) Imprinted genes and their role in human fetal growth. Cytogenet. Genome Res., 113, 262-270. Allen, V.M., Wilson, R.D. and Cheung, A. (2006) Pregnancy outcomes after assisted reproductive technology. J. Obstet. Gynaecol. Can., 28, 220-250. Arnaud, P. and Feil, R. (2005) Epigenetic deregulation of genomic imprinting in human disorders and following assisted reproduction. Birth Defects Res. C. Embryo. Today, 75, 81-97. Bliek, J., Terhal, P., van den Bogaard, M.J., Maas, S., Hamel, B., Salieb-Beugelaar, G , Simon, M., Letteboer, T., van der Smagt, J. and Kroes, H., et al (2006) Hypomethylation of the HI 9 gene causes not only Silver-Russell syndrome (SRS) but also isolated asymmetry or an SRS-like phenotype. Am. J. Hum. Genet., 78, 604-614. Borghol, N., Lornage, J., Blachere, T., Sophie Garret, A. and Lefevre, A. (2006) Epigenetic status of the HI9 locus in human oocytes following in vitro maturation. Genomics, 87, 417-426. Chang, A.S., Moley, K.H., Wangler, M., Feinberg, A.P. andDebaun, M.R. (2005) Association between Beckwith-Wiedemann syndrome and assisted reproductive technology: a case series of 19 patients. Fertil. Steril., 83, 349-354. Constancia M, Hemberger M, Hughes J, Dean W, Ferguson-Smith A, Fundele R, Stewart F, Kelsey G, Fowden A, Sibley C, Reik W (2002) Placental-specific IGF-II is a major modulator of placental and fetal growth. Nature., 417, 945-8. Cox GF, Burger J , Lip V, Mau UA, Sperling K, Wu BL, Horsthemke B (2002) Intracytoplasmic sperm injection may increase the risk of imprinting defects. Am J Hum Genet., 71, 162-4. Dao, D., Frank, D., Qian, N., O'Keefe, D., Vosatka, R.J., Walsh, CP. and Tycko, B. (1998) IMPTl, an imprinted gene similar to polyspecific transporter and multi-drug resistance genes. Hum. Mol. Genet., 7, 597-608. DeBaun, M.R., Niemitz, E.L. and Feinberg, A.P. (2003) Association of in vitro fertilization with Beckwith-Wiedemann syndrome and epigenetic alterations of LIT1 and HI9. Am. J. Hum. Genet., 72, 156-160. Fedoriw A.M., Stein P, Svoboda P, Schultz R, and Bartolomei MS. (2004) Transgenic RNAi reveals essential function for CTCF in H19 gene imprinting. Science. 303, 238-240 Fisher, A M . , Thomas, N.S., Cockwell, A., Stecko, O., Kerr, B., Temple, I.K. and Clayton, P. (2002) 125 Duplications of chromosome 1 lp 15 of maternal origin result in a phenotype that includes growth retardation. Hum. Genet, 111,290-296. Gicquel C, Gaston V, Mandelbaum J, Siffroi JP, Flahault A, Le Bouc Y (2003) In vitro fertilization may increase the risk of Beckwith-Wiedemann syndrome related to the abnormal imprinting of the KCNIOT gene. Am J Hum Genet, 72, 1338-41. Gicquel, C , Rossignol, S., Cabrol, S., Houang, M , Steunou, V., Barbu, V., Danton, F., Thibaud, N , Le Merrer, M. and Burglen, L., et al (2005) Epimutation of the telomeric imprinting center region on chromosome 1 lpl5 in Silver-Russell syndrome. Nat. Genet, 37, 1003-1007. Gonzalgo, M.L. and Jones, P.A. (1997) Rapid quantitation of methylation differences at specific sites using methylation-sensitive single nucleotide primer extension (Ms-SNuPE). Nucleic Acids Res., 25, 2529-2531. Katalinic, A., Rosch, C., Ludwig, M. and German ICSI Follow-Up Study Group (2004) Pregnancy course and outcome after intracytoplasmic sperm injection: a controlled, prospective cohort study. Fertil. Steril., 81, 1604-1616. Kerjean A, Couvert P, Heams T, Chalas C, Poirier K, Chelly J, Jouannet P, Paldi A, Poirot C. (2003) In vitro follicular growth affects oocyte imprinting establishment in mice. Eur J Hum Genet. 11:493-6. Kono, T., Obata, Y., Wu, Q., Niwa, K., Ono, Y„ Yamamoto, Y., Park, E.S., Seo, J.S. and Ogawa, H. (2004) Birth of parthenogenetic mice that can develop to adulthood. Nature, 428, 860-864. Kotzot, D. (2002) Review and meta-analysis of systematic searches for uniparental disomy (UPD) other than UPD 15. Am. J. Med. Genet, 111, 366-375. Langlois, S., Yong, P.J., Yong, S.L., Barrett, I., Kalousek, D.K.', Miny, P., Exeler, R., Morris, K. and Robinson, W.P. (2006) Postnatal follow-up of prenatally diagnosed trisomy 16 mosaicism. Prenat. Diagn., 26, 548-558. Li, T., Vu, T.H., Ulaner, G.A., Littman, E., Ling, J.Q., Chen, H.L., Hu, J.F., Behr, B„ Giudice, L. and Hoffman, A.R. (2005) IVF results in de novo DNA methylation and histone methylation at an IGF2-H19 imprinting epigenetic switch. Mol. Hum. Reprod., 11, 631-640. Maher, E.R., Afnan, M. and Barratt, C.L. (2003) Epigenetic risks related to assisted reproductive technologies: epigenetics, imprinting, ART and icebergs? Hum. Reprod., 18, 2508-2511. Mann MR, Lee SS, Doherty AS, Verona Rl, Nolen LD, Schultz RM, Bartolomei MS. (2004) Selective loss of imprinting in the placenta following preimplantation development in culture. Development 131, 3727-35 Marques CJ, Carvalho F, Sousa M, Barros A. (2004) Genomic imprinting in disniptive spermatogenesis. Lancet 363, 1700-2. Marques CJ, Carvalho F, Sousa M, Barros A. (2004) Genomic imprinting in disniptive spermatogenesis. Lancet 363, 1700-2. Mizuno, Y., Sotomaru, Y., Katsuzawa, Y., Kono, T., Meguro, M., Oshimura, M., Kawai, J., Tomaru, Y., Kiyosawa, H. and Nikaido, I., et al (2002) Asb4, Ata3, and Den are novel imprinted genes identified by high-throughput screening using RIKEN cDNA microarray. Biochem. Biophys. Res. Commun., 290, 1499-1505. Nguyen, C , Liang, G., Nguyen, T.T., Tsao-Wei, D., Groshen, S., Lubbert, M., Zhou, J.H., Benedict, W.F. and 126 Jones, P. A. (2001) Susceptibility of nonpromoter CpG islands to de novo methylation in normal and neoplastic cells. J. Natl. Cancer Inst, 93, 1465-1472. Orstavik KH, Eiklid K, van der Hagen CB, Spetalen S, Kierulf K, Skjeldal O, Buiting K. (2003) Another case of imprinting defect in a girl with Angelman syndrome who was conceived by intracytoplasmic semen injection. Am J Hum Genet, 72, 218-9. Shi W, Haaf T (2002) Aberrant methylation patterns at the two-cell stage as an indicator of early developmental failure. Mol Reprod Dev. 63:329-34. Sievers, S., Alemazkour, K., Zahn, S., Permian, E.J., Gillis, A.J., Looijenga, L.H., Gobel, U. and Schneider, D.T. (2005) IGF2IH19 imprinting analysis of human germ cell tumors (GCTs) using the methylation-sensitive single-nucleotide primer extension method reflects the origin of GCTs in different stages of primordial germ cell development. Genes Chromosomes Cancer, 44, 256-264. Usher, R. and McLean, F. (1969) Intrauterine growth of live-born Caucasian infants at sea level: standards obtained from measurements in 7 dimensions of infants born between 25 and 44 weeks of gestation. J. Pediatr., 74,901-910. Weber, M., Milligan, L., Delalbre, A., Antoine, E., Brunei, C , Cathala, G. and Forne, T. (2001) Extensive tissue-specific variation of allelic methylation in die IGF2 gene during mouse fetal development: relation to expression and imprinting. Mech. Dev., 101, 133-141. Zwart, R., Sleutels, F., Wutz, A., Schinkel, A.H. and Barlow, D.P. (2001) Bidirectional action of theIGF2r imprint control element on upstream and downstream imprinted genes. Genes Dev., 15, 2361-2366. 127 CHAPTER 6. Summary and conclusion 6.1 Summary Uti l iz ing only a single sperm to achieve fertilization, intracytoplasmic sperm injection (ICSI) has achieved remarkable success in treating male infertility since 1992. Today, ICSI accounts more than 50% of assisted reproductive technologies ( A R T ) performed worldwide; however, health outcomes of children born from this technology remain a concern. A n elevated rate of low birth weight ( L B W ) , preterm delivery, birth defects and other pregnancy complications have been extensively reported in ICSI pregnancies (Loft et al, 1999; Wennerholm et al, 2000; Hansen et al, 20.02). The prevalence of chromosomal abnormalities, particularly those involving sex chromosomes, has also been suggested in ICSI conceptions (Bonduelle etal, 2002). More recently, the unexpectedly high incidence of imprinting disorders, namely Beckwith-Weidman Syndrome and Angelman Syndrome, has been reported among children born after A R T including ICSI (Cox et al, 2002; DeBaun et al, 2003). Despite the alarming data, little is understood regarding the etiology behind these findings. The current study was designed to investigate two potential risk factors in ICSI pregnancies that may lead to adverse pregnancy outcomes - confined placental mosaicism ( C P M ) and epigenetic alterations at imprinted genes. C P M , defined as the presence of chromosomal abnormalities limited to the placenta, has been associated with intrauterine growth restriction ( IUGR) and a number of other pregnancies complications (Lestou and Kalousek, 1998). Limited information is available in the literature regarding placental mosaicism in ICSI pregnancies and its correlation with the increased L B W rate. Taking into account that the increased rate of chromosomal abnormalities and other pregnancy anomalies that mirror the clinical phenotypes of C P M in ICSI conceptions, we hypothesized that the rate of C P M might be higher in ICSI pregnancies in general, and would be particularly high in those with L B W . The investigation of C P M was carried out in thirty term placentas at three random sites using comparative genomic hybridization ( C G H ) complemented with flow cytometry. One case of C P M (45, X ) was identified out of the thirty placentas (3.33%), which is not significantly different from that in natural conceptions (5.88 %). The abnormality was detected from two out of ten sites in the 128 placenta, which was derived from a pregnancy with normal birth weight. In this study, no L B W case (n=2) presented with C P M . A s an extension to the study of C P M , origin o f abnormalities was investigated using microsatellite markers in C P M cases as well as non-mosaic chromosomal abnormalities ascertained through spontaneous abortion (SA) in ICSI pregnancies. In the general population, maternal meiotic origin has been frequently found in non-mosaic trisomies (Robinson et al, 1999) and post-zygotic origin has been suggested to predominate C P M cases (Wolstenholme, 1996; Robinson et al, 1999). ICSI possesses three risk factors for chromosomal abnormalities - advanced maternal age, male infertility, and the invasiveness of the procedure. According to the limited data to date, the origin for chromosomal abnormality is primarily paternal, although most cases reported were inherited rather than de novo (Van Opstal et al, 1997; Jozwiak et al, 2004; Bonduelle et al, 2002). Thus, we speculate that the origin of chromosomal abnormalities detected in ICSI pregnancies may differ from that in the general population. In this study, which included four cases, we identified that two C P M cases carried a mitotic origin, and the two S A cases were of maternal and paternal origin respectively. Due to the small sample size, the data lacks statistical power to draw conclusion as to whether there is a difference in origin of chromosomal abnormalities in ICSI conceptions compared to natural conceptions. Subsequently, the meiotic segregation pattern and interchromosomal effect (ICE) were studied in sperm from the father of the paternally inherited cases [t(13;21)], using fluorescent in situ hybridization (FISH). Because t(13;21) is one of the rarest Robertsonian translocations (RTs), accounting for 2% of the R T cases, cytogenetic study of sperm in this case not only provide insight into the pathogenesis of this chromosomal abnormality, but also have great informative value in reproductive counseling. With respect to chromosomal constitutions of 13 and 21, 88.39% of the spermatozoa were normal or balanced, derived from alternative segregations, and nullisomy or disomy, as a result of adjacent segregations, account for 11.08%, which was significantly higher than that in the fertile controls (0.6%>, p<0.05). However, for chromosome 18 and sex chromosomes, the proportion of normal haploid sperm was 98.79%>. The rate of disomy was not significantly higher than the controls for either chromosome 18 or X / Y . Thus, the rare t(13;21) case exhibited similar pattern of meiotic segregation as in the common RTs, and I C E was not observed. 129 Finally, imprinting defect was studied as the other hypothesized risk factor for negative pregnancy outcomes in the ICSI population. The possible epigenetic dysregulation on ICSI conceptions has been brought to attention by the over-represented epimutations in the B W S and A S cases identified in children born after ICSI (Maher et al, 2003). Animal studies have supported the hypothesis that epigenetic markings such as D N A methylation could be altered during in vitro culture (Doherty et al, 2001; Mann et al, 2005). In the present study, methylation patterns were investigated at the differentially methylated region ( D M R ) of H19IIGF2 in placentas derived from ICSI pregnancies with I U G R or L B W (ICSI-L B W ) . Comparisons were made between the I C S I - L B W group and those from ICSI pregnancies with normal birth weight and the controls with normal birth weight. We did not detect a significant difference in average methylation level among the three groups. Interestingly, hypomethylated cases (<33%) were observed exclusively from the I C S I - L B W group in which the trophoblast lineage was more severely demethylated. We speculate that this could implicate a subset of L B W cases where methylation was reduced by in vitro culture particularly in the trophoectoderm that was in direct contact with media. Curiously though, the epigenetic change seems to affect the placenta unevenly; that is Only one site of these placentas was hypomethylated. Nevertheless, the findings in the current study are preliminary and inconclusive due to the small sample size. 6.2 Conclusion Based on our findings, the incidence of C P M in ICSI pregnancies was not higher than that in the general population, notwithstanding the reported increase in rate of chromosomal abnormality in ICSI conceptions detected through prenatal diagnosis. C P M was also not prevalent in ICSI pregnancies with L B W , suggesting that the cause for L B W may be other factors related to ICSI. Study of origin of chromosomal abnormality added information to the database; however, we could not conclude a general trend for origin o f chromosomal abnormality in C P M and non-mosaic aneuploidy in ICSI conceptions. Meiotic segregation patterns were investigated in a paternally inherited t(13;21), which have not been previously reported in the literature. The incidence of abnormal segregation pattern in t(13;21) was significantly higher than in the infertile controls, however, was similar to other types of 130 Robertsonian translocations. Lastly, the methylation patterns at the D M R of H19IIGF2 in placentas from ICSI pregnancies with L B W were found to be comparable with those with normal birth weight from ICSI pregnancies and natural conceptions. Hypomethylation (<33% methylation) was present in the two cases from the I C S I - L B W group, in which the trophoblast had considerably lower level o f methylation compared to the mesenchymal lineage. Nevertheless, due to the limited sample size in this study, the mechanism responsible for the increased adverse pregnancy outcomes in ICSI is still unknown. 6.3 Bibliography Bonduelle M, Van Assche E, Joris H, Keymolen K, Devroey P, Van Steirteghem A, and Liebaers I (2002) Prenatal testing in ICSI pregnancies: incidence of chromosome anomalies in 1586 karyotypes and relation to sperm parameters. Hum Reprod., 17, 2600-2614 Cox GF, Burger J, Lip V, Mau UA, Sperling K, Wu BL, Horsthemke B (2002) Intracytoplasmic sperm injection may increase the risk of imprinting defects. Am J Hum Genet., 71, 162-4. DeBaun MR, Niemitz EL, Feinberg AP (2003) Association of in vitro fertilization with Beckwith-Wiedemann syndrome and epigenetic alterations of LIT 1 and HI 9. Am J Hum Genet. 72, 156-60. Doherty AS, Mann MR, Tremblay KD, Bartolomei MS, Schultz RM. (2000) Differential effects of culture on imprinted HI9 expression in the preimplantation mouse embryo. Biol Reprod. 62, 1526-35. Hansen, M., Kurinczuk, J.J., Bower, C. and Webb, S. (2002) The risk of major birth defects after intracytoplasmic sperm injection and in vitro fertilization. N. Engl. J. Med., 346, 725-730. Jozwiak, E. A., Ulug, U., Mesut, A., Erden, H.F. and Bahceci, M. (2004) Prenatal karyotypes of fetuses conceived by intracytoplasmic sperm injection. Fertil. Steril., 82, 628-633. Lestou, V.S. and Kalousek, D.K. (1998) Confined placental mosaicism and intrauterine fetal growth. Arch. Dis. Child. Fetal Neonatal Ed., 79, F223-6. Loft A, Petersen K, Erb K, Mikkelsen AL, Grinsted J, Hald F, Hindkjaer J, Nielsen KM, Lundstorm P, Gabrielsen A, Lenz S, Hornnes P, Ziebe S, Ejdrup HB, Lindhard A, Zhou Y and Andersen AN (1999) A Danish national cohort of 730 infants born after Intracytoplasmic sperm injection. Hum Reprod 14: 2143-2148 Maher ER, Brueton LA, Bowdin SC, Luharia A, Cooper W, Cole TR, Macdonald F, Sampson JR, Barratt CL, Reik W, Hawkins MM. (2003) Beckwith-Wiedemann syndrome and assisted reproduction technology (ART). J Med Genet. 40:62-4. Minor, A., Harmer, K., Peters, N , Yuen, B.H. and Ma, S. (2006) Investigation of confined placental mosaicism (CPM) at multiple sites in post-delivery placentas derived through intracytoplasmic sperm injection (ICSI). Am. J. Med. Genet. A., 140, 24-30. Robinson, W.P., Bernasconi, F., Lau, A. andMcFadden, D.E. (1999) Frequency of meiotic trisomy depends on involved chromosome and mode of ascertainment. Am. J. Med. Genet, 84, 34-42. 131 Van Opstal D, Los FJ, Ramlakhan S, Van Hemel JO, Van Den Ouweland AMW, Brandengurg H, Pieters MHCE, Verhoeff A, Vermeer MCS, Dhont M and In't Veld PA (1997) Determination of the parent of origin in nine cases of prenatally detected chromosome aberration found after intracytoplasmic sperm injection. Hum Reprod., 12, 682-686. Wennerholm UB, Bergh C, Hamberger L, Westlander G, Wikland M, and Wood M. (2000) Obstetric outcome of pregnancies following ICSI, classified according to sperm origin and quality. Hum Reprod., 15, 1189-1194 Wolstenholme J. (1996) Confined placental mosaicism for trisomies 2, 3, 7, 8, 9, 16, and 22: their incidence, likely origins, and mechanisms for cell lineage compartmentalization. Prenat Diagn., 16, 511-24. 1 3 2 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0101287/manifest

Comment

Related Items