Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Analyses of immediate early and early transcripts and major early region, E10, of murine cytomegalovirus 1991

You don't seem to have a PDF reader installed, try download the pdf

Item Metadata

Download

Media
UBC_1991_A1 V44.pdf [ 15.89MB ]
UBC_1991_A1 V44.pdf
Metadata
JSON: 1.0101165.json
JSON-LD: 1.0101165+ld.json
RDF/XML (Pretty): 1.0101165.xml
RDF/JSON: 1.0101165+rdf.json
Turtle: 1.0101165+rdf-turtle.txt
N-Triples: 1.0101165+rdf-ntriples.txt
Citation
1.0101165.ris

Full Text

L ANALYSES OF IMMEDIATE EARLY AND EARLY TRANSCRIPTS AND MAJOR EARLY REGION, E10, OF MURINE CYTOMEGALOVIRUS By NINA N. VELLANI B.Sc, University of B r i t i s h Columbia, 1984 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY i n THE FACULTY OF GRADUATE STUDIES DEPARTMENT OF PATHOLOGY (DIVISION OF MEDICAL MICROBIOLOGY) We accept t h i s t h e s i s as conforming t o the required standard THE UNIVERSITY OF BRITISH COLUMBIA APRIL 1991 © Nina N. V e l l a n i In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department of PATHOLOGY ( D I V I S I O N OF MEDICAL MICROBIOLOGY) The University of British Columbia Vancouver, Canada Date APRIL 22, 1991 DE-6 (2/88) ABSTRACT Murine cytomegalovirus (MCMV) i s used as a b i o l o g i c a l model f o r human cytomegalovirus (HCMV). Latency, persistence and re a c t i v a t i o n are same of the important aspects of the murine model that share analogies with human CMV i n f e c t i o n s . In order t o elucidate the molecular mechanisms leading t o these events, in-depth analyses of the murine model are required at the t r a n s c r i p t i o n a l l e v e l . During the MCMV r e p l i c a t i o n cycle, there i s a sequential expression of d i f f e r e n t regions of the v i r a l genome, hence the t r a n s c r i p t s are divided i n t o three k i n e t i c classes; the immediate early ( I E ) , e a r l y (E) and l a t e (L). This study presents the analyses of MCMV (Smith s t r a i n ) t r a n s c r i p t s of the major IE and E t r a n s c r i p t i o n a l u n i t s , and a more d e t a i l analysis of one of the major E regions, E10. The IE and E tr a n s c r i p t s were studied by probing them with Ctoitplementary DNAs (cDNAs). The cDNAs were prepared from mRNA is o l a t e d from the IE and E phases o f the v i r a l r e p l i c a t i o n cycle and cloned i n t o the bacteriophage Lambda g t l O . Ten E cDNAs were mapped t o s p e c i f i c locations of the v i r u s genome, and these represented t r a n s c r i p t s from the major E regions i n H i n d l l l fragments A, B, E, F, and I - J . F i v e E cDNAs, each representing a d i f f e r e n t major E region, and two IE cDNAs representing the major IE region, were applied as probes i n one of the studies t o determine the r e l a t i v e t r a n s c r i p t l e v e l s during the course of in f e c t i o n of 3T3L1 f i b r o b l a s t c e l l s with MCMV. The major E t r a n s c r i p t i o n a l u n i t s were investigated further i n a study where Northern b l o t s of RNAs, iso l a t e d from d i f f e r e n t phases of the v i r a l r e p l i c a t i o n cycle, were probed with the f i v e E cDNAs. This study revealed t r a n s c r i p t s t h a t were temporally regulated since they were present only d u r i n g the E and usually L phases of the v i r a l r e p l i c a t i o n cycle. In addition, the quantities of these t r a n s c r i p t s varied depending on the phase. - i i - However, a l l f i v e cDNAs detected more than one t r a n s c r i p t w h i c h indicates complex s p l i c i n g events, overlapping genes, multiple i n i t i a t i o n s i t e s and/or the presence of gene(s) i n the coitpleroentary DNA strand. One of the E cDNAs, E10, corresponding t o a t r a n s c r i p t from a major E r e g i o n of H i n d l l l fragment I - J , was selected f o r further analysis. The E10 cDNA detected four t r a n s c r i p t s of 9.5, 6.9, 4.7 and 2.1 kb i n s i z e , which were found t o be transcribed from the same DNA strand. The DNA sequence of t h i s E10 cDNA was determined and shown t o contain 3223 nucleotides, however i t l acked a polyadenylation s i g n a l and a poly A t r a c t at the 3' end. The missing 3' terminus, designated as E10-A, was i s o l a t e d using the polymerase c h a i n reaction (PCJR) method and i t s DNA sequence of 1422 nucleotides was also determined. The combined sequence of E10 and E10-A ( t o t a l of 4606 nucleotides) was designated as E10-C and i s presented i n t h i s t h e s i s . The E10-C cDNA (4.6kbp) most l i k e l y represents the 4.7 kb tr a n s c r i p t . The E10-C cDNA sequence has one minor and one major open reading frame (ORF). The minor ORF i s i n i t i a t e d by the f i r s t ATG t r i p l e t (nucleotide p o s i t i o n 114) w h i l e the major ORF i s i n i t i a t e d by the second t r i p l e t (nucleotide p o s i t i o n 155). Since the sequence preceeding the second ATG t r i p l e t i s i n "good context" with regard t o the t r a n s l a t i o n i n i t i a t i o n consensus sequence, i t i s most l i k e l y that the major ORF i s translated. The major ORF (3600 bases) encodes a 1200 amino ac i d polypeptide, the putative E10 protein of approximately 135 kd i n s i z e . A protein close t o that s i z e was d e t e c t e d i n one o f the experiments i n which RNAs, t h a t were hybrid-selected by the E10 cDNA and eluted, were translated i n v i t r o . The p u t a t i v e E10 protein lacks homology with any other protein i n the data banks (SWISSPRT and GENPEPT). Portions of the v i r a l genomic fragments H i n d l l l I and J were also sequenced t o reveal the orientation of the gene coding f o r the E10 cDNA and i t s r e l a t e d t r a n s c r i p t s . - i i i - TABLE OF CONTENTS PAGE ABSTRACT i i TABLE OF CONTENTS i v LIST OF TABLES i x LIST OF FIGURES X ACKNOWLEDGEMENTS x i i i LIST OF ABBREvTATTONS . . x i v 1.0 INTRODUCITON 1 1.1 HERPESVIRUSES 1 1 .1 .1 GENERAL DESCRIPTION 1 1 .1 .2 PROPERTIES AND CIASSIFICATTON OF HERPESVIRUSES 1 1.2 ISOLATION OF HCMV AND MCMV 2 1.3 PATHOGENESIS OF HCMV AND MCMV 3 1 .3 .1 INFECTION AND EPIDEMIOLOGY OF HCMV 3 1.3.2 EXPERIMENTAL INFECTION OF MICE WITH MCMV 4 1.4 MOUEULAR BIOLOGY OF HCMV AND MCMV 8 1 .4 .1 REPLICATION OF HCMV AND MCMV IN CELL CULTURE 8 1.4.1.1 REPLICATION OF HCMV 9 1.4.1.1 REPLICATION OF MCMV 10 1 .4 .2 STRUCTURES OF HCMV AND MCMV GENOMES 11 - 1 .4 .2 .1 THE HCMV GENOME 11 1 .4 .2 .2 THE MCMV GENOME 12 1 .4 .3 HCMV AND MCMV GENE PRODUCTS 14 1 .4 .3 .1 HCMV GENE PP^DUCTS 14 1 .4 .3 .2 MCMV GENE PT^DUCTS 21 1.5 LATENCY, PERSISTENCE AND REACTIVATION OF HCMV AND MCMV IN VIVO. 24 1 .5 .1 LATENCY AND REACTIVATION OF HCMV 24 - i v - 1.5.2 LATENCY AND REACTIVATION OF HCMV 27 1.6 NCNPP^DUCITVE INFECTIONS IN VITRO 29 1.6.1 HCMV 29 1.6.2 MCMV 30 1.7 MCMV AS A BIOLOGICAL MODEL FOR HCMV 32 1.8 RA1TONAL AND OBJECTIVES 33 1.9 SUMMMARY OF THESIS 35 2.0 MATERIALS AND METHODS 38 2.1 3T3L1 CELLS 38 2.2 PREPARATION OF MURINE CYTOMEGALOVIRUS (MCMV) STOCK 38 2.3 TITRATION OF MCMV 38 2.4 PREPARATION OF MCMV DNA • 39 2.5 PLASMID ISOLATION 39 2.5.1 SMALL SCALE PLASMID ISOLATION 40 2.5.2 LARGE SCALE PLASMID ISOLATION 40 2.6 RESTRICTION ENDONUCLEASE DIGESTION OF DNA 40 2.7 QUANTIFICATION, PURIFICATION AND PRECIPITATION OF NUCLEIC ACIDS 41 2.8 GEL ELECTROPHORESIS AND TRANSFER OF DNA TO FILTERS 41 2.9 SLOT BLOTTING OF DNA 42 2.10 ISOLATION OF DNA FRAGMENTS FROM AGAROSE GELS 42 2.11 PREPARATION OF RADIOACTIVE DNA FOR HYBRIDIZATION 42 2.12 HYBRIDIZATION: DNA PROBES 43 .2 .13 RADIOACTIVE END-LABELLING OF DNA 43 2.14 PREPARATION OF IE AND E CDNA MCMV LIBRARIES 44 2.14.1 ISOLATION OF TOTAL RNA 44 2.14.2 ISOLATION OF POLY A RNA 45 2.14.3 PREPARATION OF cDNA AND CLONING IN LAMBDA gtlO 45 -v- 2.14.4 SCREENING OF I E AND E CDNA LIBRARIES: PLAQUE LIFT METHOD 45 2.15 PREPARATION OF LAMBDA g t l O PHAGE STOCK 46 2.16 ISOLATION OF LAMBDA g t l O PHAGE DNA 47 2 .15 .1 SMALL SCALE ISOLATION OF PHAGE DNA 47 2.15.2 LARGE SCALE ISOLATION OF PHAGE DNA 48 2.17 ANALYSIS OF RNA 49 2 .17 .1 SMALL SCALE ISOLATION OF TOTAL RNA: LITHIUM CHLORIDE ( L i C l ) METHOD 50 2.17.2 SLOT BLOTTING OF RNA 51 2.17.3 LARGE SCALE ISOLATION OF TOTAL RNA: VANADYL RIBONUCLEOSIDE COMPLEX (VRC) METHOD 51 2.17.4 ELECTROPHORESIS AND TRANSFER OF RNA TO FILTER 51 2.17.5 PREPARATION OF RNA PROBES 52 2 .17.6 RNA-RNA HYBRIDIZATION 52 2.17.7 ANALYSIS OF RNA BY PRIMER EXTENSION 53 2.18 DNA SEQUENCE ANALYSIS OF E cDNA E10 53 2 .18 .1 SUBCLONING OF DNA FRAGMENTS IN pGEM3Z 53 2.18.2 PREPARATION OF FROZEN COMPETENT CELLS 54 2.18.3 TRANSFORMATION OF JMI09 WITH PGEM3Z 54 2.18.4 CONSTRUCTION OF UNIDIRECTIONAL DELETION CLONES 55 2 .18.5 DOUBLE STRANDED DNA SEQUENCING 56 2 .18.6 ACRYLAMIDE GEL ELECTROPHORESIS OF SEQUENCING REACTIONS 57 2.19 ISOLATION AND DNA SEQUENCING OF THE MISSING 3' TERMINUS OF E10 CDNA 57 2 .19 .1 FIRST STRAND cDNA SYNTHESIS 57 2.19.2 AMPLIFICATION OF 3' TERMINUS OF E10 cDNA BY RACE OR - v i - PCR METHOD 58 2.19.3 CLONING OF THE 3 1 RACE PRODUCT 58 2.19.4 DNA SEQUENCING OF E10-A cDNA 58 2.20 HYBRID SELECTION BY E10 cDNA AND IN VITRO TRANSLATION OF RNA 59 3.0 RESULTS AND DISCUSSION 60 3.1 CLONING AND CHARACTERIZATION OF IE AND E cDNAs 60 RESULTS 60 3.1.1 PREPARATION AND SCREENING FOR IE AND E CDNAs 60 3.1.2 CHARACTERIZATION OF E cDNAs 60 3.1.2.1 SIZE ESTIMATION 60 3.1.2.2 MAPPING THE E cDNAs 61 3.1.3 CHARACTERIZATION OF IE CDNAs 83 3.1.3.1 SIZE ESTIMATION 83 3.1.3.2 MAPPING THE IE cDNAs 86 DISCUSSION 89 3.2 TRANSCRIPT LEVELS PROBED WITH E AND IE cDNA CLONES DURING THE VIRAL REPLICATION CYCLE 92 RESULTS 92 DISUSSION 99 3.3 ANALYSIS OF INDIVIDUAL TRANSCRIPTS MAPPING TO THE CORRESPONDING REGIONS OF E l , E3, E6, E7 AND E10 CDNAs 103 RESULTS 103 3.3.1 EARLY TRANSCRIPTS PROBED WITH cDNAs; E l , E3, E6, E7 AND E10 103 3.3.2 NORTHERN BLOT ANALYSIS OF TRANSCRIPTS PROBED WITH ANTTSENSE AND SENSE E10 RNA 107 DISCUSSION I l l - v i i - 3.4 FURTHER ANALYSES E10-C cDNA 118 RESULTS 118 3.4.1 ElO cDNA SEQUENCE 118 3.4.1.1 ANALYSIS OF E10-C CDNA SEQUENCE CAPACITY 118 3.4.1.2 FURTHER ANALYSIS OF THE E10-C cDNA SEQUENCE AND PUTATIVE ElO PROTEIN 124 3.4.2 ORIENTATION OF THE GENE CODING FOR E10-C cDNA 130 3.4.3 POSSIBLE IDENTTFICATTON OF THE 5'START SITE OF THE ElO cDNA TI^SCKLPT 134 3.4.4 POSSIBLE IDENTTFICATTON OF THE PROTEIN CODED BY ElO CDNA 140 DISCUSSION 4.0 CONCLUSIONS 147 5.0 FUTURE EXPERIMENTS 150 6.0 LTTERATURE CITED 152 7.0 APPENDIX 169 HOMOLOGY OF HSV-2 EcoRl FRAGMENT WITH A MOUSE HINDIII DNA FRAGMENT 6.1 RESULTS 169 6.1.1 HYBRDIZATTON OF E l TO ElO cDNAs TO HSV-2 EcoRl M FRAGMENT 169 6.1.2 SCREENING AND CHARACTERIZATION OF E cDNAs HYBRIDIZING TO HSV-2 EcoRl M FRAGMENT 169 6.1.3 RNA SLOT BLOT ANALYSIS TO MEASURE LEVELS OF TRANSCRIPTS OF DP5 CDNA 176 6.2 DISCUSSION 178 - v i i i - LIST OF TABLES Page TABLE I Summary of E cDNAs i n s e r t sizes and hybr i d i z a t i o n properties with H i n d l l l , Xbal and EcoRl fragments of Smith MCMV DNA 63 TABLE I I Summary of siz e s of IE cDNA inse r t s and hybr i d i z a t i o n properties with the H i n d l l l K and L fragments of Smith MCMV DNA 85 TABLE I I I Analysis of t r a n c r i p t l e v e l s probed with IE and E cDNA clones 95 TABLE TV Northern b l o t analysis of tr a n s c r i p t s probed with E cDNAs .. 108 TABLE V Properties of the putative E10 protein 127 TABLE VI Segments homologous t o the putative E10 protein 128 - i x - LIST OF FIGURES Page Figure 1: Organization of Human and Murine CMV genomes 13 a) Organization of HCMV genome 13 b) Representation of isomeric forms of HCMV genome 13 c) Organization of MCMV genome 13 Figure 2: R e s t r i c t i o n enzyme map of MCMV Smith s t r a i n DNA 15 Figure 3: Organization of IE genes i n Human and Murine CMV genomes . 17 a) Organization of IE genes i n HCMV 17 b) Organization of IE genes i n MCMV 17 Figure 4: Southern b l o t analysis of E cQNAs 62 Figure 5: Hybridization of E cDNAs t o MCMV DNA 64 Figure 6: Hybridization of El-10 cDNAs t o MCMV H i n d l l l I fragment .. 66 Figure 7: Hybridization of El-10 cDNAs t o MCMV H i n d l l l J fragment .. 67 Figure 8: Mapping of E l cDNA t o H i n d l l l , Xbal and EcoRl fragments of MCMV DNA 69 Figure 9: Hybridization of H i n d l l l , Xbal and EcoRl fragments of MCMV (Smith) DNA with a l a b e l l e d MCMV DNA probe 70 Figure 10: Mapping of E4 cDNA t o H i n d l l l , Xbal and EcoRl fragments of MCMV (Smith) DNA 71 Figure 11: Mapping of E6 cDNA t o H i n d l l l , Xbal and EcoRl fragments of MCMV (Smith) DNA 72 Figure 12: Hybridization of H i n d l l l / Xbal and EcoRl fragments of MCMV (Smith) DNA with a l a b e l l e d MCMV DNA probe 73 Figure 13: Mapping of E7 cDNA t o H i n d l l l , Xbal and EcoRl fragments of MCMV (Smith) DNA 74 -x- Figure 14: Mapping of E8 cDNA t o H i n d l l l , Xbal and EcoRl fragments of MCMV (Smith) DNA 75 Figure 15: Hybridization of H i n d l l l , Xbal and EcoRl fragments of MCMV (Smith) DNA with a l a b e l l e d MCMV DNA probe 76 Figure 16: Mapping of E9 cDNA t o H i n d l l l , Xbal and EcoRl fragments of MCMV (Smith) DNA 77 Figure 17: Hybridization of H i n d l l l , Xbal and EcoRl fragments of MCMV (Smith) DNA with a l a b e l l e d MCMV DNA probe 78 Figure 18: Mapping of E3 cDNA t o H i n d l l l , Xbal and EcoRl fragments of MCMV (Smith) DNA 79 Figure 19: Mapping of E5 cDNA t o H i n d l l l , Xbal and EcoRl fragments of MCMV (Smith) DNA ;. 80 Figure 20: Hybridization of H i n d l l l , Xbal and EcoRl fragments of MCMV (Smith) DNA with a l a b e l l e d MCMV DNA probe 81 Figure 21: Summary of mapping studies of El-10 cDNAs on the Smith s t r a i n MCMV genome 82 Figure 22: Southern b l o t of IE cDNA in s e r t s 84 Figure 23: S l o t b l o t analysis of IE cDNA clones hybridized with the Smith s t r a i n MCMV H i n d l l l K probe 87 Figure 24: S l o t b l o t analysis of IE cDNA clones hybridized with the Smith s t r a i n MCMV H i n d l l l L probe 88 Figure 25: Use of cDNAs probes t o monitor t r a n s c r i p t l e v e l s during the MCMV r e p l i c a t i o n cycle 93 Figure 26: Use of cDNAs probes t o monitor t r a n s c r i p t l e v e l s during the MCMV r e p l i c a t i o n cycle 94 Figure 27: Northern b l o t analysis of t r a n s c r i p t s from MCMV infected 3T3L1 c e l l s probed with E l , E3, E6 and E7 cDNAs 104 - x i - Figure 28: Northern b l o t analysis of tr a n s c r i p t s which hybridized t o ElO cDNA 105 Figure 29: Northern b l o t analysis of t r a n s c r i p t s which hybridized t o ElO sense and antisense RNA 109 Figure 30: DNA sequencing strategy f o r ElO cDNA 120 Figure 31: I s o l a t i o n strategy f o r E10-A cDNA . 121 Figure 32: DNA sequencing strategy f o r E10-A cDNA 122 Figure 33: E10-C cDNA sequence 123 Figure 34: R e s t r i c t i o n map f o r DNA sequence E10-C cDNA 125 Figure 35: Hydropathy index of hypothetical protein ElO 126 Figure 36: Orientation of the gene coding f o r ElO cDNA 131 Figure 37: DNA sequence from H i n d l l l I region of the MCMV genome 132 Figure 38: DNA sequence from H i n d l l l J region of the MCMV genome 133 Figure 39: Possible i d e n t i f i c a t i o n of the 5 1 s t a r t s i t e of the ElO cDNA t r a n s c r i p t using primer extension 135 Figure 40: In v i t r o t r a n s l a t i o n products of RNAs that hybridize t o ElO DNA 137 Figure 41: Southern b l o t analysis of DP2, DP3, DP5 and DP8 probed with Smith DNA 172 Figure 42: Southern b l o t analysis of DP2, DP3, DP5 and DP8 probed with 3T3L1 DNA 173 Figure 43: Mapping of cDNA DP3 174 Figure 44: Mapping of cDNA DP5 175 Figure 45: RNA s l o t b l o t analysis t o measure l e v e l s of t r a n s c r i p t s of DP5 cDNA 177 - x i i - ACKNOWLEDGEMENTS I thank Dr J.B. Hudson f o r h i s supervision and encouragement during my PhD s t u d i e s . Am a l s o g r a t e f u l t o my supervisory camittee members, Drs. P. Candido, J.K. Chantler, L. Kirby, D. Walker, and A. Warren f o r suggestions and d i r e c t i o n d u r i n g my program. Special thanks t o Dave Banfield f o r o f f e r i n g ideas and assistance during PCR experiments. I acknowledge A l l e n Delaney, J e s s i c a Boname, Elizabeth Graham, Dr. M. Mtaitiirano, Doug Yeung, Jan St. Amand, Caroline Beard, A l e x i s Maxwell, J e f f Hewitt and P a t r i c k Tarn f o r t h e i r contribution. S p e c i a l gratitude t o Dr CR. A s t e l l f o r her courtesy and supervision, and f o r a l l o w i n g me t o use her la b o r a t o r y f a c i l i t y t o complete the study required f o r t h i s t h e s i s . - x i i i - Dedicated t o Nosh V e l l a n i -yii'u - LIST OF ABBREVIATIONS A absorbance/wavelength AIDS acquired immune deficiency syndrome A+T adenine + thymine ATP adenosine 5 1-triphosphate bp base p a i r s C cytosine °C degree centigrade Cat catalogue cDNA cxatplementary DNA CH cycloheximide CPE cytopathic e f f e c t cpm counts per minute C i curies Da daltons dATP deoxyadenosine-5 1 -triphosphate dCTP deoxycytidine -5'-triphosphate dGTP deoxyguanosine-5'-triphosphate dNTP deoxyribonucleotide triphosphate mix dTTP deoxyi±iimidine-5' -triphosphate DEPC d i e t h y l pyrocarbonate DMSO dimethyl sulfoxide DNA deoxyribonucleic a c i d ds double-stranded DOT d i t h i o t h r e i t o l - x i v - E early E. c o l i Escherichia c o l i EDTA etJiylenediamine t e t r a a c e t i c a c i d EtBr ethidium bromide FBS f e t a l bovine serum g gram (s) G+C guanine + cytosine GITC guanidinium isothiocyanate HCMV Human Cytomegalovirus hr hour (s) HSV Herpes simplex v i r u s IE immediate early IFN interferon IPTG isopropylthiogalactoside ITJdr 5-Iodo-2'-deoxyuridine kb kilobases kbp kilobasepairs kd kilodaltons mM millimole M m o l e s / l i t r e MCMV Murine <zytxanegalovirus mg milligram (s) ml m i l l i l i t r e (s) mRNA messenger ribonucleic a c i d nm nanometer P page number ORF open reading frame -xv- PBS phosphate buffered s a l i n e PCR polymerase chain reaction PEG polyethylene g l y c o l p o l polymerase poly A + polyadenylated poly A non polyadenylated RNA ribonucleic a c i d RNase ribonuclease rRNA ribosomal ribonucleic a c i d rDNA ribosamal deoxyribonucleic a c i d RT room temperature SDS sodium dodecyl s u l f a t e T Thymine TEMED N, N, N', N 1 -tetramethylethylene diamine aminomethane T r i s t r i s (hydroxymethyl) aminomethane tRNA transfer ribonucleic a c i d UV u l t r a v i o l e t V v o l t s VIP v i r u s induced protein VISF v i r a l induced suppressive factor VRC vanadyl-ribonucleoside complex VZV V a r i c e l l a Zoster Xgal 5-bromo 4-chloro 3-indolylgalactoside - x v i - 1.0 INTRODUCTION Human cytomegalovirus (HCMV) plays an important e t i o l o g i c r o l e i n human dis e a s e . Since cytomegaloviruses (CMVs) are species s p e c i f i c , i t i s necessary t o study CMV pathogenecity i n an animal. The most frequent animal model used i s the murine CMV (MCMV) i n f e c t i o n i n mice because i t has b i o l o g i c a l properties s i m i l a r t o those of human i n f e c t i o n . The o b j e c t i v e of t h i s project has been t o investigate the molecular biology of MCMV i n f e c t i o n at the t r a n s c r i p t i o n a l l e v e l . This section w i l l discuss both HCMV and MCMV [and herpes simplex v i r u s (HSV), where relevant] with the emphasis on the r e g u l a t i o n of v i r a l gene expression, pathogenesis and persistent i n f e c t i o n s . 1.1 HERPESVIRUSES 1.1.1 GENERAL DESCRIPTION: The Herpesviridae are a family of enveloped viruses with a core containing double stranded (ds) l i n e a r DNA, enclosed by ah icosahedral caps i d of 162 capsomeres (Mathews, 1982). There are nearly 100 known herpesviruses, of which seven have been i d e n t i f i e d as human pathogens: HSV-1, HSV-2, HCMV, v a r i c e l l a - z o s t e r (VZV), Epstein-Barr v i r u s (EBV), Human B-lymphotropic virus, and Human herpes virus-7 (HHV-7) (Salahuddin e t a l . , 1986; Roizman, 1982 1990; Frenkel et a l . , 1990). 1.1.2 PROPERTIES AND CLASSIFICATION OF HERPESVIRUSES: In s p i t e of sharing a common morphology, herpesviruses vary i n b i o l o g i c a l p r o p e r t i e s such as host range, duration of r e p l i c a t i o n cycle, cytopathic e f f e c t (CPE), and latency. Therefore, on the basis of t h e i r b i o l o g i c a l p r o p e r t i e s , herpesviruses are c l a s s i f i e d i n t o three groups or sub-families: -1- alphaherpesvirinae, betaherpesvirinae and gamn^erpesvirinae (Mathews 1982; Roizman, 1982, 1990). Alphaherpesvirinae: Examples such as HSV-1 and HSV-2 are members of the alphaherpesvir inae sub-family. The membership c r i t e r i a of t h i s group includes a broad host range, r e l a t i v e l y short r e p l i c a t i o n cycle, extensive CPE during i n f e c t i o n i n c u l t u r e and the capacity t o produce latent i n f e c t i o n i n vi v o p r i m a r i l y i n sensory ganglia. Betaherpesvirinae: CMV belongs t o the be t a h e r p e s v i r i n a e sub-family. The most important c r i t e r i o n of t h i s group i s a l i m i t e d host range. In v i t r o , these viruses r e p l i c a t e r e a d i l y i n f i b r o b l a s t s , but t h e i r r e p l i c a t i o n cycle i s r e l a t i v e l y slow. The term 1 cytomegalovirus 1 r e f l e c t s on the f a c t that the infected c e l l s manifest a c h a r a c t e r i s t i c CPE w i t h the formation of enlarged multinucleated c e l l s (cytomegalia). Their i n f e c t i o n can r e s u l t i n latency i n t i s s u e s of secretory glands, kidneys, reproductive organs, etc. Gammaherpesvirinae: E b s t e i n - B a r r v i r u s i s one of many members of the gammaherpesvirinae sub-family. This group of viruses i s lymphotropic and has a l i m i t e d host range. The duration of the r e p l i c a t i o n cycle i s var i a b l e and i n f e c t i o n often r e s u l t s i n latency i n tissues that are lymphoid i n o r i g i n . 1.2 ISOLATION OF HCMV AND MCMV Murine cytomegalovirus (MCMV) was f i r s t i s o l a t e d i n 1954 by propagating the v i r u s contained i n f i l t r a t e s of infected mouse s a l i v a r y glands i n cultures -2- o f mouse embryonic f i b r o b l a s t c e l l s (Smith, 1954). Subsequently, three independent groups i s o l a t e d HCMV (1956-1957) by employing t i s s u e culture: Smith (1956) i s o l a t e d the v i r u s from infant s a l i v a r y gland and infant kidney; Rowe et a l . (1956) i s o l a t e d three s t r a i n s from human adenoid explant t i s s u e ; and Weller et a l . (1957) i s o l a t e d the v i r u s from infant urine and infant l i v e r biopsy. 1.3 PATHOGENESIS OF HCMV AND MCMV 1.3.1 INFECTION AND EPIDEMIOLOGY OF HCMV The prevalence of HCMV i n the general population i s high, and i t varies with the geographic region, age, sccioeconomic status and perhaps host genetic factors. In children and adults HCMV i n f e c t i o n i s usually asymptomatic, although same adults develop symptoms of mononucleosis (Alford and B r i t t , 1985). In immuncccmprcmised patients such as AIDS victims, r e c i p i e n t s of organ t r a n s p l a n t s , and p a t i e n t s undergoing chemotherapy, the in f e c t i o n r e s u l t s i n severe disease associated with high mortali t y (Osborn, 1981, Hackman e t a l . ; 1985, Nelson e t a l . , 1988). In addition, congenital i n f e c t i o n with HCMV can cause a serious disease referred t o as cytomegalic i n c l u s i o n disease (CUD). C l a s s i c a l CID may involve i n f e c t i o n of multiple organs, the r e t i c u l o e n d o t h e l i a l system and the cen t r a l nervous system (Alford and B r i t t , 1985). The incidence of HCMV i n f e c t i o n i n the general population i s high because the spread of the v i r u s occurs either v e r t i c a l l y ( i n utero) or h o r i z o n t a l l y by the excretion of the v i r u s i n secretory f l u i d s such as urine, s a l i v a , breast milk, vaginal secretions, c e r v i c a l secretions, and semen (Alford et a l . , 1981; Osborn, 1981; Ho, 1982; Hunter et a l . , 1985). Other modes of transmission r e l a t e t o procedures such as blood transfusion (Prince et a l . , -3 - 1971), leucocyte transfusion (Winston et a l . , 1980), bone marrow transplant (Hackman e t a l . , 1985) and organ transplants p a r t i c u l a r l y kidney (Naraqi et a l . , 1977, Chatterjee e t a l . , 1978). An average of 1% of l i v e infants born i n the United States are congenitally i n f e c t e d w i t h HCMV and of these, 5-10% show symptoms of CID (HCMV infection) ( s t u d i e s summarized i n A l f o r d and B r i t t , 1990; Stagno e t a l . , 1982a; Kinney e t a l . , 1985). Many of these congenital infections are believed t o have r e s u l t e d from primary i n f e c t i o n s acquired during the gestation period. S t a t i s t i c s show that the percentage of seronegative women i n childbearing years i n the United States varies widely and appears t o depend on race and socioeconomic status (Stern et a l . , 1973; Grant et a l . , 1981; Stagno et a l . , 1982b; Kinney et a l . , 1985). The i n f e c t i o n rate i s highest amongst the people of lower socioeconomic status i n United States and the people of underdeveloped countries and therefore, these groups acquire the i n f e c t i o n at an e a r l i e r age. Due t o i t s mode of transmission (natal, breastmilk, s a l i v a and uri n e ) , those that escape the congenital i n f e c t i o n may usually a c q u i r e the i n f e c t i o n during infancy or childhood (Alford et a l . , 1981; s t u d i e s summarized i n A l f o r d and B r i t t , 1985, 1990). Frequently, CMV i n f e c t s d u c t a l e p i t h e l i a l c e l l s i n the renal system and therefore v i r u r i a i s common. Also, i n up t o a t h i r d of infected infants and children, s a l i v a r y glands and often the parotid gland are involved. This often leads t o a ch r o n i c i n f e c t i o n as w e l l as t o the excretion of the v i r u s i n s a l i v a . In general, the spread of the v i r u s may be prevented by good hygiene. 1.3.2 EXPERIMENTAL INFECTION OF MICE WITH MCMV The pathogenesis of MCMV i n mice depends on a va r i e t y of factors such as age of the host, i n f e c t i v e dose, route of i n f e c t i o n , host genetics (mouse - 4 - s t r a i n ) , h i s t o r y of v i r u s passage, and the v i r u s s t r a i n . Newborn mice are highly susceptible t o l e t h a l i n f e c t i o n by MCMV but t h i s s u s c e p t i b i l i t y decreases with age. Neonates infected i n t r a p e r i t o n e a l l y show i n f e c t i o n i n m u l t i p l e organs such as spleen, l i v e r , pancreas, lungs, kidneys, o v a r i e s and adrenals (Osborn, 1982). In normal adult mice, inf e c t e d i n t r a p e r i t o n e a l l y , the common features of MCMV pathogenesis i n the acute phase include general iMnunosuppression, viremia, thrombocytopenia and i n c l u s i o n bodies i n organs such as the l i v e r , kidney, spleen, ovary, pancreas, and s a l i v a r y glands (Hudson, 1979; Osborn, 1982). The acute phase i s f o l l o w e d by the chronic phase and t h i s t r a n s i t i o n i s marked by a decrease i n detectable l e v e l s of infectious v i r u s . During t h i s phase, the s a l i v a r y glands continue t o shed a s i g n i f i c a n t amount of v i r u s , followed by lower amounts over a long p e r i o d of time; however, the duration of shedding depends on the mouse s t r a i n (Gonczol e t a l . , 1985; Mercer and Spector, 1986). There i s a s i g n i f i c a n t i n c r e a s e i n the degree of resistence t o MCMV i n f e c t i o n as the animal matures from newborn t o weanling. Studies by Hayashi e t a l . (1985) supports the notion that the a b i l i t y t o r e s i s t MCMV i n f e c t i o n depends on the protection provided by the natural k i l l e r (NK) c e l l s . I t i s speculated that as the animal matures, the population of the NK c e l l s increase and t h i s r e f l e c t s on the degree of increased resistance. Furthermore, a study by Ebihara and Minamishima (1984) has shown that the a c t i v a t o r s (OK-432 and PS-K) of NK c e l l s i n susceptible mouse s t r a i n s , increase resistance t o MCMV in f e c t i o n . I n s u s c e p t i b l e mice, the s i z e of inoculum can also determine the pattern of -5- pathogenesis. For example i n Balb\c mice infected i n t r a p e r i t o n e a l l y , 6 . 5 4 2X10 p f u i s a l e t h a l dose, while 2X10 pfu and 2X10 pfu are nonlethal doses that produce an acute and asymptomatic i n f e c t i o n respectively (Leung e t a l . , 1986) . Another important contributing factor t o the degree of pathogenesis i n susceptible mice i s the route of inoculation. The most common r o u t e of i n o c u l a t i o n i n the laboratory i s intraperitoneal which u s u a l l y r e s u l t s i n the i n f e c t i o n of multiple organs. However, studies have shown that subcutaneous inoculation of adult mice with a low dose of MCMV r e s u l t s i n an i n f e c t i o n which i s l i m i t e d t o the submaxillary gland only (Brody and Craighead, 1974). Also, a lower dose of MCMV inoculation i s required t o es t a b l i s h a pathologic e f f e c t by the intravenous route compared t o that required by the intraperitoneal route (Mannini and Medearis, 1961). S u s c e p t i b i l i t y t o MCMV i n f e c t i o n amongst adult mice depends on the host k d s t r a i n t y p e . Two H-2 l i n k e d genes H-2 and H-2 of the major h i s t o c o m p a t i b i l i t y complex, and another set of undefined non-H-2 linked genes are r e s p o n s i b l e f o r determining the degree of s u s c e p t i b i l i t y t o i n f e c t i o n of a p a r t i c u l a r mouse s t r a i n (Chalmer et a l . , 1977; Grundy et al.,1981; A l l e n and Shellam, 1984; Quinnan and Manichewitz, 1987). The two d i s t i n c t t r a i t s associated with the H-2 haplotype and the non-H-2 linked genes are the re s i s t a n t genotypes, while the t r a i t associated with H-2 haplotype i s the s u s c e p t i b l e genotype. The H-2 susceptible t r a i t i s dominant over the H-2 k r e s i s t a n t t r a i t , w h i l e t he H-2^ and non-H-2 l i n k e d t r a i t s are independent of each other (Allan and Shellam, 1984; Quinnan and Manichewitz, 1987). Studies have also shown that the resistance o f f e r e d by H-2 t r a i t i s i n t e r f e r o n (INF) dependent while the non-H-2 lin k e d t r a i t i s INF independent (Quinnan and Manichewitz, 1987). -6- C u r r e n t l y , two MCMV s t r a i n s , the Smith s t r a i n and the K-181 s t r a i n are used i n our laboratory. For reasons unknown, the K-181 s t r a i n i s more v i r u l e n t i n v i v o than the Smith s t r a i n . There are also s i g n i f i c a n t differences i n t h e i r r e s t r i c t i o n endonuclease digestion patterns (Misra and Hudson, 1980; Hudson et a l . , 1988). In addition t o the v i r u s s t r a i n , the passage h i s t o r y i s important i n the determination of virulence and pathogenesis. MCMV i s o l a t e d from s a l i v a r y glands at 2-3 weeks post i n f e c t i o n i s highly v i r u l e n t i n new born mice; however, the v i r u s becomes attenuated by a si n g l e passage i n v i t r o i n mouse embryo f i b r o b l a s t s (Osborn and Walker, 1970; Selgrade et a l . , 1981). The attenuation i s e a s i l y reversed t o virulence by one passage of t he v i r u s through mouse s a l i v a r y gland i n vivo (Osborn and Walker, 1970) . The precise mechanism responsible f o r the rapid attenuation and i t s r e v e r s i o n t o virulence has not been i d e n t i f i e d . However, a recent study by Ravindranath and Graves (1990) suggests that the s h i f t t o virulence i n MCMV may be r e l a t e d t o the viruses a b i l i t y t o recognize s i a l i c a c i d residues on a c e l l receptor. There are c o n f l i c t i n g reports about the p o s s i b i l i t y of v e r t i c a l transmission of MCMV i n mice. Johnson (1969) suggested that v e r t i c a l transmission of CMV i n mice d i d not occur, and t h i s was attributed t o the presence of three t r o p h o b l a s t i c layers i n mouse placenta which provides e f f i c i e n t protection t o the mouse fetus. However Chantler et a l . (1979) indicated that v e r t i c a l t ransmission i s possible, and that the presence of the v i r u s i n o f f s p r i n g may be latent. Horizontal spread of MCMV i n mice has also been shown, although close contact i s required f o r transmission as i t occurs by the o r a l r o u t e i n body secretions such as breastmilk, urine and s a l i v a (Mannini and Medearis, 1961). -7- MCMV i s an immuncsuppressive v i r u s and during i n f e c t i o n the mouse becomes s u s c e p t i b l e t o opportunistic infections. Preliminary studies have shown that MCMV appears t o i n f e c t macrophage-like c e l l s (Loh and Hudson, 1979, 1982) and as a r e s u l t these mice respond poorly t o foreign antigens, mitogens and INF inducers (Hudson, J . B . , 1979; Osborn, J . E., 1982). An MCMV-induced suppressive factor (VISF), which suppresses concanavalin A stimulated mitogenesis i n spleen c e l l s , appears t o be responsible f o r t h i s immunosuppression phenomenon (Whyte et a l . , 1987). This factor needs t o be characterized further and i t s precise mode of action determined. 1.4 MC&ECULAR BIOLOGY OF HCMV AND MCMV 1.4.1 REPLICAnON OF HCMV AND MCMV IN CELL CULTURE I n f e c t i o n i s i n i t i a t e d by attachment of the v i r u s t o the c e l l receptor. The molecules involved i n t h i s process i n MCMV and HCMV infections are s t i l l under i n v e s t i g a t i o n . However, evidence suggests that e i t h e r a class I HLA antigen (Grundy et a l . , 1987) or another glycoprotein of molecular weight 30kd may be the c e l l receptor f o r HCMV (Taylor et a l . , 1990). As f o r MCMV, a preliminary study by Ravindranath and Graves (1990) indicates that the v i r u s attaches t o the c e l l by binding t o N-acetylglucxjsamine on the c e l l s u r f a c e . Following attachment, v i r u s enters the cytoplasm by fusion of the v i r a l envelope with the plasma membrane and subsequently, the nucleocapsid i s transported t o the nucleus, where v i r a l t r a n s c r i p t i o n , DNA r e p l i c a t i o n and assembly of capsids takes place (Morgan e t a l . , 1968; Kohn, 1985). One of the important c h a r a c t e r i s t i c s of the herpesviruses family i s the mode of r e p l i c a t i o n which occurs i n a temporally regulated manner (Mathews, 1982). Accordingly, r e p l i c a t i o n may be divided i n t o three k i n e t i c phases: immediate ear l y (IE), e a r l y (E), and l a t e (L). -8- 1.4.1.1 REPLICATION OF H C M V T h e r e p l i c a t i o n c y c l e f o r HCMV i n d i p l o i d human f i b r o b l a s t c u l t u r e s takes 48 t o 72 h r b e f o r e t h e r e l e a s e o f progeny v i r u s ( S t i n s k i , 1977). During the course o f r e p l i c a t i o n , t h e r e i s s e q u e n t i a l express ion o f d i f f e r e n t areas o f t h e v i r a l genome. The f i r s t k i n e t i c c l a s s genes, I E , a r e expressed i n the a b s e n c e o f de novo p r o t e i n s y n t h e s i s , and are detec ted a t 2 t o 4 h r p o s t i n f e c t i o n ( p . i . ) ( S t i n s k i , 1978; DeMarchi e t a l . , 1980). I E p r o t e i n s are r e g u l a t o r y i n f u n c t i o n and are r e q u i r e d f o r t h e e x p r e s s i o n o f genes i n the n e x t k i n e t i c phase, E , which begins a t 2 h r p . i . and proceeds up t o 24 h r p . i . (DeMarchi e t a l . , 1980). The E p r o t e i n s o f h e r p e s v i r u s e s a r e mainly i n v o l v e d i n DNA s y n t h e s i s and n u c l e o t i d e metabolism, and many o f these p r o t e i n s whose f u n c t i o n s have been i d e n t i f i e d a r e d e s c r i b e d i n reviews by Roizman e t a l . (1990) f o r HSV, and Spector e t a l . (1990) f o r HCMV. V i r a l DNA s y n t h e s i s commences d u r i n g the E phase and al though i t can be d e t e c t e d b y 15 t o 16 h r p . i . , i t does not peak u n t i l 72 t o 96 h r p . i . (St . J e o r and H u t t , 1977; S t i n s k i , 1978). V i r a l DNA s y n t h e s i s i s thought t o o c c u r by a r o l l i n g c i r c l e mechanism. T h i s n o t i o n i s supported by the f a c t t h a t d u r i n g i n f e c t i o n , t h e HCMV genome terntini f u s e t o form a c i r c l e ( L a f e m i n a and Hayward, 1983). Furthermore, HCMV DNA sequence has been shown t o c o n t a i n conserved sequence elements analogous t o those found i n HSV-1 and MCMV (Spate and M o c a r s k i , 1985; Marks and Spector , 1988) which appear t o c o n t a i n s i t e s o f DNA cleavage and s i g n a l f o r packaging o f herpes v i r a l DNA. B o t h t h e E p h a s e and v i r a l DNA s y n t h e s i s a r e p r e r e q u i s i t e s f o r the e x p r e s s i o n o f L phase, which begins a t approximately 24 h r p . i . ( S t i n s k i , 1977, 1978; DeMarchi e t a l . , 1980). La te p r o t e i n s a r e u s u a l l y s t r u c t u r a l i n n a t u r e a n d a r e t h e r e f o r e i n v o l v e d i n t h e assembly process (Honess and Roizman, 1974, 1975). The c a p s i d s a r e assembled i n t h e n u c l e u s , but the - 9 - steps involved i n t h i s process f o r herpesviruses have not been defined. F i n a l l y , the assembled v i r i o n s are released from the c e l l and during t h i s event, they acquire t h e i r envelope either from the c e l l or nuclear membrane (Mathews et a l . , 1982; Kohr, 1985). 1.4 .1.2 REPLICATION OF MCMV The IE phase of the r e p l i c a t i v e cycle of MCMV l a s t s from 0 t o 4 hr p . i . and as f o r other herpes viruses, i t i s independent of de novo protein synthesis (Chantler and Hudson, 1978). The IE proteins are regulatory i n function and are required f o r the expression of the next k i n e t i c phase, E, which may be detected as early as 2 hr p . i . (Misra et a l . , 1978; Marks et a l . , 1983; K e i l et a l . , 1984; Buhler et a l . , 1990). V i r a l DNA synthesis commences l a t e r , during the E phase, between 8 t o 12 hr p . i . and i s thought t o occur by the r o l l i n g c i r c l e mechanism as described f o r HCMV and HSV (Misra et a l . , 1978; Chantler and Hudson, 1978; Marks et a l . , 1983). Evidence s i m i l a r t o that described f o r HCMV supports t h i s notion: c i r c u l a r v i r a l genomes have been i d e n t i f i e d i n infected c e l l s and the v i r a l DNA termini have been shown t o contain the conserved sequence elements common t o both HSV and HCMV, which appear t o be the s i t e s of cleavage of concatemers and contain the s i g n a l f o r packaging of v i r a l genome (Marks and Spector, 1983; 1988). The f i n a l k i n e t i c phase, L, may be detected by 10 hr p . i . The majority of the L proteins are s t r u c t u r a l i n nature and involved i n the packaging and assembly of v i r i o n s (Chantler and Hudson, 1978). F i n a l l y , the progeny v i r u s (Smith s t r a i n ) begin t o be released at approximately 20 hr p . i . (Mossmann & Hudson, 1973). Like other herpesviruses, MCMV acquires i t s envelope during -10- the r e l e a s e process either from the nuclear or c e l l u l a r membrane (Weiland et a l . , 1986). I n general, the pattern of the r e p l i c a t i o n cycle of MCMV c l o s e l y resembles that of HCMV, although, HCMV r e p l i c a t i o n i s r e l a t i v e l y slower. Contrary t o HCMV r e p l i c a t i o n which i s independent of the c e l l cycle, MCMV r e p l i c a t i o n i s dependent upon the S phase of the c e l l cycle (Muller and Hudson, 1977a); c e l l s i n Go phase do not support v i r a l DNA r e p l i c a t i o n . D espite the presence of a v i r u s induced-DNA polymerase i n infected Go phase c e l l s , the v i r a l DNA i s unable t o r e p l i c a t e , perhaps due t o the requirement of a c e l l u l a r factor which i s present only during the S phase (Muller and Hudson, 1978). 1.4.2 STRUCTURES OF THE HCMV AND MCMV GENOMES 1.4.2.1 THE HCMV GENOME The HCMV genome i s a double stranded l i n e a r DNA (150 x 10 6 daltons) e q u i v a l e n t t o 240 kilobasepairs (kbp) i n length and has a G+C content of 57% ( K i l p a t r i c k and Huang, 1977; DeMarchi et a l . , 1978; Geelen et a l . , 1978; Lakeman and Osborn, 1979; S t i n s k i et a l . , 1979). Various s t r a i n s of HCMV show polymorphisms i n t h e i r r e s t r i c t i o n endonuclease s i t e s and t h i s may be due t o genetic v a r i a t i o n r e s u l t i n g from d i f f e r e n t passage h i s t o r y (Westrate e t a l . , 1980; Oram et a l . , 1982; Spector et a l . , 1982). The complete nucleotide sequence of HCMV (AD169) has been determined and upon analysis has revealed over 200 ORFs, nearly three times the number of genes i n HSV (Chee e t a l . , 1990). However, l e s s than 50 HCMV gene products have been analysed and mapped (summary of studies i n Spector et a l . , 1990). Same reg i o n s of the HCMV DNA contain nucleotide sequences homologous t o same of -11- those of human, murine, sea urchin and 28S rRNA gene (Penden et a l . , 1982; Reger et a l . , 1984; Shaw et a l . , 1985), which were presumably acquired by the v i r u s during the course of evolution. Although s i m i l a r i n structure, the HCMV genome i s 1.5 times the s i z e of the HSV genome. The HCMV genome consists of 2 unique sequences, the unique long (U L) and the unique short (U g) sequences, which represent 82% and 18% of the genome, respectively (Westrate et a l . , 1980; DeMarchi, 1981; Oram et a l . , 1982; Spector e t a l . , 1982). The unique sequences are bound by t e r m i n a l and i n t e r n a l repeat regions; U L i s bound by TR^ and TP^, and Ug i s bound by TR g and I R g (Figure l a ) . Since the unique sequences can inve r t r e l a t i v e t o each other, there are 4 genome isomers which are found i n equimolar co n c e n t r a t i o n s (Figure lb) (Westrate et a l . , 1980; DeMarchi, 1981). The significance of such a complex DNA structure has not been elucidated. 1.4.2.2 THE MCMV GENOME The MCMV genome i s l i n e a r double stranded DNA with a molecular weight of 132 x 10 6 daltons equivalent t o 240 kbp i n length (Mossman and Hudson, 1973; Lakeman and Osborn, 1979; Mercer et a l . , 1983). As shown i n Figure l c , the MCMV genome, unlike HCMV, i s a single, long and unique sequence lacking t e r m i n a l or i n t e r n a l repeat sequences (Ebeling et a l . , 1983; Mercer et a l . , 1983) . The o v e r a l l G+C content of the MCMV genome i s 59%, but v a r i a t i o n i n t h i s content e x i s t s i n s p e c i f i c regions of the genome (Mossman and Hudson, 1973, 1974). Genetics maps f o r the MCMV genome have been constructed using r e s t r i c t i o n -12- Figure 1: Organization of Human and Murine CMV genomes a. Organization of HCMV genome TO- c o 0.1 0.2 0.3 0.4 0.5 0.6 map uni t s 0.7 0.8 0.9 1.0 The HCMV genome consists of two unique sequences, the unique long (TJL) and unique short (U q) sequences. The unique sequences are bound by the terminal and i n t e r n a l repeats. The U_ i s bound by TR_ and IR-, and U g i s bound by TRg and IR^ [data taken from Mach e t a l . (19907]. b. Representation of isomeric forms of HCMV genome The unique sequences inve r t i n r e l a t i o n t o each other a t the junction where the i n t e r n a l repeats meet. The inversion r e s u l t s i n four possible isomeric forms as i l l u s t r a t e d above [data taken from Mach e t a l . (1990)]. c. Organization of MCMV genome 0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.0 map uni t s MCMV genome i s a sin g l e , long and unique sequence lacking terminal and in t e r n a l repeat sequences (Ebeling et a l . , 1983; Mercer e t a l . , 1983). [ a ] [ a'] [ a'] [ a ] [ a'][ b ]^-[ b'] •[ a ][ b ] — [ b>] [ a ][ b ' ] — [ b ] [ a " ] [ . b " ] — [ b ] -13- enzyme d i g e s t s , by two research groups. Mercer et a l . (1983) determined the map f o r r e s t r i c t i o n enzymes H i n d l l l and EcoRl, while Ebeling et a l . (1983) determined the map f o r r e s t r i c t i o n enzymes H i n d l l l , EcoRl and Xbal (Figure 2) . These two maps d i f f e r s l i g h t l y , and t h i s may be att r i b u t e d t o genetic v a r i a t i o n r e s u l t i n g from continuous passage of the v i r u s i n d i f f e r e n t l a b o r a t o r i e s . The genomes of two commonly used s t r a i n s i n our laboratory, the Smith and K181 also d i f f e r s l i g h t l y i n t h e i r endonuclease digestion p a t t e r n s (Misra e t a l . , 1980; Hudson e t a l . , 1988). The mapping of the p r e c i s e d i f f e r e n c e s i n t h e i r genomes i s s t i l l i n progress (Boname, unpublished data). Due t o the l a r g e s i z e of the genome and the complexity of i t s gene expression, much of the v i r u s remains t o be analysed. The complete DNA nu c l e o t i d e sequence of the MCMV genome i s not known. The few documented DNA sequences t o have been elucidated are confined t o the major IE gene ( i e l ) , I E enhancer element and a major E gene (el) ( K e i l et a l . , 1987; Buhler et a l . , 1990; Koszinowski et a l . , 1990). The r e s u l t s reported i n t h i s t h esis add the nucleotide sequence of an E cDNA, ElO (4606 bases), which belongs to another major E transcribed region. 1.4.3 HCMV AND MCMV GENE PRODUCTS 1.4.3.1 HCMV GENE PRODUCTS A major IE region confined t o a small f r a c t i o n of the genome e x i s t s f o r a l l herpes v i r u s e s and i s t r a n s c r i b e d by host RNA polymerase (Spate and Mocarski, 1985b; S t i n s k i and Roehr, 1985). For HCMV, t h i s locus has been d e f i n e d between 0.66 and 0.77 map un i t s i n the long unique region (DeMarchi, 1981; Wanthen and S t i n s k i , 1982; Jahn et a l . , 1984). As i l l u s t r a t e d i n Fig u r e 3a, the IE region comprises four t r a n s c r i p t i o n u n i t s : IE1, IE2, IE3 -14- Fig 2: Restriction enzyme map of MCMV Smith strain DNA. Physical map of MCMV Smith Strain genome for enzymes H i n d l l l , EcoRl and Xbal. The map was orignally constructed and presented i n Ebeling et a l . (1983). N A B M M D C G F K L J • " T 1 0 I P E i S 3 R E P A D B C F 10 0 V J F /& h H 0 1, M, X, T i 0 u M c C w D I f N 8 *, 0,o,d P A M 1 R 1 X 1 £ i V S 3 0 0.5 L-. 1 i . ... m a p units 1 —I i 1 0 L 10 20 i ' 30 40 i » 50 • 60 70 80 i i i 90 100 i 110 120 i i 130 1 140 1 150 1 molecular weight (md) 0 L 25 1 50 75 100 125 . J L . . .._ _ l 150 1 175 i 200 i 225 molecular weight (kbp) and IE4 ( S t i n s k i et a l . , 1983; Stenberg e t a l . , 1984; Jahn e t a l . , 1984; P l a c h t e r e t a l . , 1988). The most abundant t r a n s c r i p t of 1.95kb i s t r a n s c r i b e d from a 2.8 kb genome region IE1. This t r a n s c r i p t i s s p l i c e d and comprises four exons. I t codes f o r a phosphoprotein with a molecular weight ranging from 68 t o 79 kd depending on the s t r a i n type (Michelson et a l . , 1979; Gibson, 1981; Cameron and Preston, 1981; S t i n s k i e t a l . , 1983). The IE1 u n i t a l s o codes f o r another p r o t e i n of 39kd. The IE2 gene i s transcribed i n the same d i r e c t i o n as IE1, and codes f o r mRNAs ranging i n s i z e from 1.10 t o 2.25 kb which have been translated i n v i t r o i n t o four minor p r o t e i n s (16.5 t o 56 kd) ( S t i n s k i et a l . , 1983; Stenberg et a l . , 1985; Akrigg e t a l . , 1985). The IE3 gene codes f o r a less abundant mRNA of 1.95 kb which i s translated i n t o a minor protein of 68kd, and the IE4 u n i t i s t r a n s c r i b e d i n t o an unspliced, noncoding RNA of 5kb (S t i n s k i et a l . , 1983; P l a c h t e r e t a l . , 1988). The major IE region encodes both p o s i t i v e and negati v e functions. The IE2 gene products repress the IE promoter, while the IE1 and IE2 gene products together function as transactivating factors f o r E gene t r a n s c r i p t i o n (Pizzorno et a l . , 1988; Staprons e t a l . , 1988). I n a d d i t i o n t o the promoter sequences, a c i s - a c t i n g element or a strong enhancer sequence e x i s t s upstream of IE1 region (Weber et a l . , 1984; Boshart e t a l . , 1985; S t i n s k i and Roehr, 1985). T h i s enhancer element has demonstrated t o contain binding s i t e s f o r factors and has shown t o comprise s e v e r a l sets of repeat regions of which the 18 and 19 bp repeats contribute s i g n i f i c a n t l y t o the s t r e n g t h of the promoter. The 18bp repeat has sequences homologous t o that of the 18bp repeats also found i n the enhancers of HIV, SV40 and MCMV i e l promoter (Dorsh-Hasler et a l . , 1985; Davidson et a l . , 1986; Nabel and Baltimore, 1987) and i s a binding s i t e f o r a c e l l u l a r t r a n s c r i p t i o n factor, NFkB (Sambucetti et a l . , 1989). In addition, the -16- Figure 3: Organization of IE genes i n Human and Murine CMV genomes a. Organization of IE genes i n HCMV nny- 0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.0 IE4 IE3 IE2 IE1 > < < 0.66 0.68 0.70 0.72 0.74 0.76 map uni t s This f i g u r e i l l u s t r a t e s t r a n s c r i p t s and orientations of four IE genes i n the major IE region (data taken from Mach et a l . (1990). b. Organization of IE genes i n MCMV 0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 I L 1.0 2.75kb 1.0-5.1 kb 1.75kb ie3 i e l ie2 0.773 0.781 0.796 0.803 map un i t s 0.817 This f i g u r e i l l u s t r a t e s organization and tr a n s c r i p t s of the major i e region i n MCMV genome [data taken from K e i l et a l . (1987)]. enhancer element has demonstrated binding s i t e s f o r a nuclear factor, NF-1 (Henninghausen and Fleckenstein, 1986; Jeang et a l . , 1987). The 19bp repeat element has sequences i d e n t i c a l t o that of c y c l i c AMP response element and appears t o be a binding s i t e f o r another c e l l u l a r t r a n s c r i p t i o n factor (Lee e t a l . , 1987; Hunninghake et a l . , 1989). The enhancer element has been di s c u s s e d i n great d e t a i l i n a recent review by Stanninger and Flekeinstein (1990). The IE region i s transcribed begining 2-4 hr p . i . and continues throughout the r e p l i c a t i o n c y c l e , p a r t i c u l a r l y during the L phase ( S t i n s k i , 1978; DeMarchi e t a l . , 1980; Sternberg et a l . , 1989). However, as a r e s u l t of some post - t r a n s c r i p t i o n a l control, only some of the IE RNAs are translated (Stenberg e t a l . , 1989). Overall, the IE gene expression i s complex and r e q u i r e s many c e l l u l a r and v i r a l l y coded factors. The putative IE proteins o f l e s s predominant species and precise functions of same known IE proteins have yet t o be i d e n t i f i e d . U n l i k e IE, E t r a n s c r i p t s map t o many regions of the genome and t h e i r t r a n s l a t i o n a l products are usually involved i n v i r a l DNA synthesis and nucleotide metabolism, and the regulation of L gene expression (DeMarchi, 1981; Wathen and S t i n s k i , 1982; McDonough and Spector, 1983; Chang et a l . , 1989; Spector e t a l . , 1990). Among the E p r o t e i n s are the 140kd nonphosphorylated DNA binding protein and the DNA polymerase (Anders et a l . , 1986; 1987; Heilbournn et a l . , 1987; Anders and Gibson, 1988). The 140kd protein i s a s i n g l e stranded DNA binding protein and a hamologue of the HSV-1 major DNA b i n d i n g p r o t e i n ICP8 (Anders and Gibson, 1988). The f u n c t i o n o f ICP8 r e l a t e s t o v i r a l DNA synthesis (Wu et a l . , 1988) and by -18- analogy, the 140kd protein may have a s i m i l a r function. Although several E t r a n s c r i p t i o n u n i t s have been i d e n t i f i e d , only two are mentioned here as t h e i r gene products are r e l a t i v e l y abundant and they have been e x t e n s i v e l y c h a r a c t e r i z e d . A l s o these E t r a n s c r i p t i o n u n i t s are s i m i l a r i n t h e i r t r a n s c r i p t i o n pattern t o some of the MCMV E t r a n s c r i p t i o n u n i t s s t u d i e d i n t h i s t h e s i s . I n AD169 and Town s t r a i n s , the f i r s t t r a n s c r i p t i o n u n i t maps with i n the long inverted repeat and contains three major E genes (McDonogh et a l . , 1985; Huchison et a l . , 1986). These genes code f o r 2.7, 2.0 and 1.2 Kb t r a n s c r i p t s , of which the 2.7kb t r a n s c r i p t i s the most abundant. To date, the protein coded by the abundant 2.7kb t r a n s c r i p t has not been i d e n t i f i e d . The second E t r a n s c r i p t i o n u n i t belongs t o EcoRl fragments R and d (Staprons and Spector, 1986, Spector et a l . , 1990). The t r a n s c r i p t s from t h i s u n i t are s p l i c e d and of siz e s 2.1, 2.2, 2.5 and 2.65kb, and these encode proteins of s i z e s 50, 43, 84 and 34kd respectively (Staprons and Spector, 1986; Wright et a l . , 1988; Wright and Spector, 1989). These proteins are DNA b i n d i n g proteins and therefore, are l i k e l y t o be involved i n the regulation of v i r a l gene expression and DNA synthesis (Spector e t a l . , 1990). The expression of t h i s t r a n s c r i p t i o n u n i t i s regulated at the t r a n s c r i p t i o n a l l e v e l . I n i t i a l l y , only two tr a n s c r i p t s (2.1 and 2.2kb) originate from t h i s u n i t , but as the r e p l i c a t i o n cycle progresses, the s p l i c i n g pattern changes r e s u l t i n g i n two additional t r a n s c r i p t s . In general, many of the E gene products have not been i d e n t i f i e d or f u l l y characterized. Therefore, much of the E phase remains t o be analyzed. During the L phase, a l l regions of the genome are transcribed, although the -19- abundant t r a n s c r i p t i o n occurs only i n the unique long region (Wathen and S t i n s k i , 1982; McDonough and Spector, 1983). Most of the l a t e proteins are s t r u c t u r a l proteins and up t o f o r t y proteins have been associated with the HCMV v i r i o n ( S t i n s k i , 1976, 1977; F i a l a et a l . , 1976; Rim et a l . , 1976a; Gupta e t a l . , 1977; Mach et a l . , 1990). Approximately eight glycoproteins have been detected, of which a glycosylated protein VP17 of molecular weight 66kd i s reported t o be the major s t r u c t u r a l v i r i o n protein ( S t i n s k i , 1976; Kim e t a l . , 1976a; F i a l a et a l . , 1976; Gibson, 1983; Farrar and Oram, 1984; Nowak et a l . , 1984). Once again, l i k e the E phase, most of the L phase has yet t o be analysed. Some t r a n s c r i p t s of HCMV are d i f f e r e n t i a l l y s p l i c e d , but the mechanism responsible f o r i t has not been defined. S p l i c i n g events allow genomic economy and i n viruses, these events are also important i n the regulation of gene expression. In addition t o d i f f e r e n t i a l s p l i c i n g , there i s further c o n t r o l of HCMV gene expression by regulation of mRNA transport t o the cytoplasm, t r a n s c r i p t s t a b i l i t y and accumulation, and association of t r a n s c r i p t s with polyribosomes (Wathen and S t i n s k i , 1982; DeMarchi, 1983a; Geballe et a l . , 1986; Stenberg et a l . , 1989; Wright and Spector, 1989). Twenty, seventy f i v e , and ninety percent of the HCMV genomic sequence i s t r a n s c r i b e d i n IE, E and-L phases respectively, but many of the t r a n s c r i p t s s y n t h e s i s e d do not become ribosome-associated and t h e r e f o r e are not t r a n s l a t e d (Wathen and S t i n s k i , 1982; DeMarchi et a l , 1983a; Geballe e t a l . , 1988; Wright and Spector, 1989; Stenberg et a l . , 1989).). Therefore, while whole v i r a l RNA, is o l a t e d from d i f f e r e n t times of the i n f e c t i o n , maps t o many r e s t r i c t i o n fragments, polysome associated mRNA maps t o highly s p e c i f i c regions of the v i r a l genome (Chua et a l . , 1981; Wathen and S t i n s k i , 1982; -20- DeMarchi, 1983a, Gaballe et a l . , 1988). In summary, HCMV gene expression i s a complex event and many of the mechanisms i n v o l v e d have not been elucidated. However i t i s c l e a r that there e x i s t s temporal, quantitative and post t r a n s c r i p t i o n a l c o n t r o l of HCMV gene expre s s i o n during the r e p l i c a t i o n cycle. 1.4 .3.2 MCMV GENE PRODUCTS P r e l i m i n a r y studies conducted by Misra et a l . (1978) have shown that only 50% of the MCMV t r a n s c r i p t s are transported t o the cytoplasm. Like HCMV, these and other r e s u l t s (presented below) indicate post-transcriptional and temporal regulation during the MCMV r e p l i c a t i o n cycle, but the mechanisms involved have not been f u l l y characterized. As i l l u s t r a t e d i n Figure 3b, the main IE tr a n s c r i p t s originate from a small p o r t i o n of the genome, 0.769-0.817 map un i t s (Marks et a l . , 1983; K e i l et a l . , 1984) . This region contains part of the H i n d l l l fragment K and the e n t i r e H i n d l l l fragment L ( K e i l et a l . , 1984). Six poly A + IE tra n s c r i p t s have been detected from t h i s region of the genome: 5.1, 2.75, 2.0, 1.75, 1.65 and 1.05 kb. The organization of the major IE region i s s i m i l a r t o t h a t of HCMV, that i s , i t i s divided into 3 u n i t s ; i e l , ie2 and ie3 ( K e i l et a l . , 1987a). The i e l gene codes f o r the abundant 89kd IE phosphonuclear protein, pp89, which i s translated from the abundant IE 2.75kb tr a n s c r i p t . T h i s t r a n s c r i p t i s s p l i c e d and composed of four exons ( K e i l e t a l . , 1987b). A s t r o n g enhancer of approximately 700bp has been i d e n t i f i e d w i t h i n the i e l promoter r e g i o n (Dorsch-Hasler e t a l . , 1985). The enhancer element comprises s e v e r a l sets of repeats of which the 18bp repeat sequence i s s i m i l a r t o that found i n the HCMV IE1 enhancer element. The next gene, ie2, l i e s i n the opposite orientation t o i e l and ie3 genes, and i s transcribed -21- i n t o a 1.75kb mRNA ( K e i l et a l . , 1984). This t r a n s c r i p t codes f o r a 43kd p r o t e i n , which has not been i d e n t i f i e d i n infected c e l l extracts, but has been t r a n s l a t e d i n v i t r o ( K e i l et a l . , 1985). Although the ie2 gene has been shown t o be dispensable f o r v i r a l growth i n f i b r o b l a s t c e l l cultures, i t i s r e q u i r e d f o r e s t a b l i s h i n g latency i n mouse spleen c e l l s i n vivo (Mocarski e t a l . , 1990). The ie3 gene i s responsible f o r a group of less abundant RNAs, ranging i n s i z e from 1.0 t o 5.1kb. The only information known about these t r a n s c r i p t s i s that they use the i e l t r a n s c r i p t i o n s t a r t s i t e and terminate i n the ie3 region ( K e i l et a l . , 1984; 1987a). The pp89 and other proteins of the major IE region bear very l i t t l e sequence homology t o the IE p r o t e i n s of HCMV ( K e i l et a l . , 1985; Buhler et a l . , 1990). However, r e c e n t s t u d i e s i n d i c a t e t h a t products of i e l (pp89) and ie3 cofunction as transactivators and therefore bear functional homologies t o the IE gene products of HCMV (Buhler et a l . , 1990). IE t r a n s c r i p t i o n i n reg i o n s other than H i n d l l l K and L have also been shown t o occur ( K e i l et a l . , 1984). These t r a n s c r i p t s map to the two DNA terminal fragments H i n d l l l E and N, but t h e i r gene products remain unidentified. I n our laboratory, 10 IE proteins (Smith strain) have been i d e n t i f i e d , of which eight have demonstrated the a b i l i t y t o bind t o DNA and therefore are perhaps regulatory i n function (Walker and Hudson, 1987; 1988a). Three DNA bi n d i n g proteins of sizes 89, 96 and lOOkd have been i d e n t i f i e d as the major IE p r o t e i n s and these may correspond t o proteins 76, 84 and 89kd (pp89) also d e s c r i b e d by K e i l et a l . (1985) f o r Smith s t r a i n of MCMV. The molecular weight differences may be attributed t o d i f f e r e n t experimental procedures, d i f f e r e n t c e l l l i n e s (phosphorylation patterns may d i f f e r ) , and/or v i r a l s t r a i n differences. Of the 10 IE proteins, some of the less predominant sp e c i e s may belong t o the IE genes other than those of the major IE region, - 2 2 - although further analysis i s required t o v e r i f y t h i s . As mentioned f o r HCMV, the factors e s s e n t i a l f o r the IE phase have not been defined, same p u t a t i v e IE proteins remain un i d e n t i f i e d and many of the known IE proteins have not been s u b s t a n t i a l l y characterized. During the E period, t r a n s c r i p t i o n from the IE region i s down regulated, but many regions of the genome are transcribed (Misra e t a l . , 1978; Marks et a l . , 1983). Two i n d i v i d u a l groups have i d e n t i f i e d regions that are t r a n s c r i p t i o n a l l y active during the E and L times of i n f e c t i o n , although d e t a i l s on i n d i v i d u a l t r a n s c r i p t i o n u n i t s w i t h i n these regions are lacking. Marks e t a l . (1983) have shown that the E t r a n s c r i p t s of intermediate q u a n t i t y originate from the H i n d l l l fragments A, B, G, F and E, and of high quantity originate from the termini of the genome and map u n i t s 0.824 t o 0.861, a region w i t h i n the H i n d l l l I - J fragment. One of the E cDNA clones, ElO, studied extensively i n t h i s t h e s i s maps t o the a c t i v e l y transcribed E r e g i o n , H i n d l l l I - J . In addition, K e i l e t a l . (1984) have shown that regions of act i v e E t r a n s c r i p t i o n map t o H i n d l l l fragments B, F, K and J . F i v e of the E cDNAs selected and analysed i n t h i s t h e s i s map t o H i n d l l l fragments E, B, F, J - I , and A. Therefore, the cDNAs chosen f o r t h i s study represent t r a n s c r i p t s from a c t i v e l y transcribed E regions. I n our laboratory, seven E proteins (91, 60, 54, 51.5, 51, 39 and 36kd) have been i d e n t i f i e d of which three (91, 39 and 36 kd) are abundant (Walker and Hudson, 1987) . These three E proteins are l i k e l y t o be regulatory i n f u n c t i o n because they have shown t o l o c a l i z e i n the nucleus and i n addition, have the a b i l i t y t o bind t o DNA (Walker and Hudson, 1988a). To date, only one MCMV E t r a n s c r i p t i o n u n i t or gene, e l , has been extensively analysed and documented (Buhler et a l . , 1990). The e l gene maps t o H i n d l l l F region and - 2 3 - one of the E cDNAs studied i n t h i s t h esis appears t o correspond t o t h i s gene. The e l t r a n s c r i p t i s a s p l i c e d product and codes f o r proteins (36, 37 and 38kd) of unknown function. At t h i s point further analysis i s required t o c l a r i f y whether the 39 and 36 kd proteins i d e n t i f i e d i n our laboratory correspond t o the e l gene products described by Buhler et a l . (1990). Although several other t r a n s c r i p t i o n a l l y active E regions have been mapped, d e t a i l s on i n d i v i d u a l t r a n s c r i p t i o n u n i t s w i t h i n these regions are lacking. I n t h i s t h e s i s , f i v e E t r a n s c r i p t i o n u n i t s , and i n p a r t i c u l a r one (ElO) which represents an E region of intense t r a n s c r i p t i o n ( H i n d l l l I - J ) , were subjected t o extensive analysis. During the L phase, t r a n s c r i p t i o n occurs from most regions of the genome, but t r a n s c r i p t i o n from the major E regions decrease two t o f i v e f o l d (Marks e t a l . , 1983; K e i l et a l . , 1984). At the peak of the L phase (20-24 hr p . i . ) , c e r t a i n regions are transcribed a c t i v e l y and these map t o H i n d l l l fragments B, C, D, F, G, H and M ( K e i l et a l . , 1984). Up t o 33 s t r u c t u r a l or L proteins have been i d e n t i f i e d , of which s i x are glycosylated (Kim et a l . , 1976b; Chantler et a l . , 1978). A 172 kd protein (VP2 or VP7) has been i d e n t i f i e d as the major L protein. Information on the L phase i s l i m i t e d , therefore, much of the phase gene expression remains t o be analysed. In g e n e r a l , gene expression i n MCMV has not been examined as extensively as i n HCMV and HSV. Further studies are required t o reveal and characterize i n d i v i d u a l t r a n s c r i p t i o n u n i t s , e s p e c i a l l y those that belong t o the E and/or L phase, and t h i s t h e s i s f u l f i l l s that i n part. -24- 1.5 LATENCY, PERSISTENCE AND REACTIVATION OF HCMV AND MCMV IN VIVO 1 .5 .1 LATENCY, PERSISTENCE AND REACTIVATION OF HCMV A l l herpesviruses including cytomegaloviruses have the a b i l i t y t o p e r s i s t as undetectable o r l a t e n t i n f e c t i o n s f o r the l i f e t i m e of t h e i r hosts. Molecular mechanisms responsible f o r latency, persistence and reac t i v a t i o n o f herperviruses including HCMV have not been defined. However, from a number of studies, i t i s apparent that, in-vivo, the host immune system p l a y s an important part i n the maintenance of the HCMV i n i t s l a t e n t state. I n a healthy i n d i v i d u a l , there appears t o be a balance maintained between the host and the latent HCMV, and conditions favouring immunosuppression reactivate the v i r u s . Sometimes the host's depressed immune system cannot eliminate the infected c e l l and t h i s perhaps contributes t o the e f f i c i e n t r e p l i c a t i o n of the v i r u s thus r e s u l t i n g i n r e a c t i v a t i o n (Oldstone, 1989). I n r e n a l or bone marrow transplant r e c i p i e n t s there i s a high incidence of acute HCMV i n f e c t i o n . I a t r o g e n i c immunosuppression and possibly the immunological response t o f o r e i g n antigens appear t o encourage CMV i n f e c t i o n . The source of i n f e c t i o n may be reactivated v i r u s from the r e c i p i e n t or the donor t i s s u e (Naraqi et a l . , 1977, Hackman e t a l . , 1985). A l s o , due t o the immunosuppressive nature of HCMV i n f e c t i o n , opportunistic infections i n these individuals are common (Chatterjee e t a l . , 1978). Acquired immunodeficiency syndrome (AIDS) patients are often victims of reactivated HCMV as a r e s u l t of t h e i r immunosuppressed condition, and t h i s r e a c t i v a t i o n of v i r u s i s p o t e n t i a l l y f a t a l . Recent studies have indicated t h a t HCMV i n f e c t i o n may be a cofactor i n the progression of the AIDS disease because h e r p e s v i r u s e s have been shown t o encourage HIV-1 (Human immunodeficiency v i r u s type 1) r e p l i c a t i o n i n v i t r o (Nelson et a l . , 1988). -25- I n a d d i t i o n t o that, HCMV i t s e l f may cause further immunosuppression by i n t e r a c t i n g with the c e l l s of the immune system such as lymphocytes and NK c e l l s ( S t a r r e t a l . , 1979; Le v i n et a l . , 1979). The exact mechanism in v o l v e d i n t h i s virus-induced immunosuppression phenomenon i s s t i l l under i n v e s t i g a t i o n and the subject i s reviewed i n great d e t a i l i n Waner et a l . (1989). One of the common modes of transmitting HCMV i s through blood and leucocyte t r a n s f u s i o n s (Prince e t a l . , 1971, Winston et a l . , 1980). HCMV appears t o p e r s i s t i n leucocytes, e s p e c i a l l y i n the peripheral blood mononuclear c e l l s , and the v i r u s may be reactivated, perhaps by allogeneic responses i n the tr a n s f u s e d r e c i p i e n t (Winston et a l . , 1980; Schrier et a l . , 1985; Nelson et a l . , 1990). In addition t o the host immune surveillance, latency and re a c t i v a t i o n depend on the a b i l i t y o f the v i r u s t o down-regulate v i r a l gene expression (Oldstone, 1989). When the v i r u s l i m i t s i t s gene expression, the host immune system i s unable t o recognize and cl e a r the infected c e l l and thus the v i r u s may p e r s i s t . The down-regulation of herpesviral gene expression d u r i n g l a t e n c y appears t o be a v i r u s coded p r o p e r t y , and the prime candidates i n HSV and HCMV are the IE cla s s genes and other genes ( i n HSV) that are expressed during latency (Schrier er a l . , 1985; r e s u l t s summarized i n Stevens, 1989). Unlike f o r HCMV, s i g n i f i c a n t progress has been made i n the a n a l y s i s of HSV latent infections. However, t o date, the factors that are responsible f o r HSV latency have not been f u l l y characterized. Although an IE gene, ICPO, (Russell et a l . , 1987) and a unique t r a n s c r i p t termed as 'late n c y a s s o c i a t e d t r a n s c r i p t ' (LAT) appear t o be associated with HSV - 2 6 - l a t e n c y . Studies have shown that the ICPO gene i s required f o r r e a c t i v a t i o n and the LAT tr a n s c r i p t s are found t o be present i n l a t e n t l y infected neurons (Wagner e t a l . , 1988). LAT RNA i s transcribed from the DNA strand opposite t h a t encoding ICPO (Stevens, 1989) and has been suggested t o function as an antisense RNA t o the ICPO t r a n s c r i p t , perhaps i n h i b i t i n g the ICPO function during the l a t e n t state. I n HCMV, gene products that are analogous t o ICPO and LAT have not been i d e n t i f i e d . However, studies involving detection of lat e n t HCMV i n blood c e l l s such as peripheral blood mononuclear c e l l s have revealed the presence of the major IE tr a n s c r i p t s (Schrier et a l . , 1985; Nelson et a l . , 1990). Thus, these t r a n s c r i p t s may be associated with latency. Most of the d e t a i l s on gene expression involved i n HCMV latency remain unknown. To summarize, evidence t o date cannot i d e n t i f y any c e l l type as the d e f i n i t e reservoir f o r l a t e n t HCMV. A l s o , t he molecular mechanisms responsible f o r latency, p e r s i s t e n c e and rea c t i v a t i o n of HCMV remain l a r g e l y unclear. Since i t i s not possible t o study these events i n humans, an animal model such as mice i n f e c t e d w i t h MCMV i s best suited f o r dissection at the t r a n s c r i p t i o n a l l e v e l t o provide insi g h t i n t o the molecular mechanisms leading t o these events. 1.5.2 LATENCY AND REACTIVATION OF MCMV One of the most important c h a r a c t e r i s t i c s of MCMV i s the a b i l i t y t o produce l a t e n t i n f e c t i o n s , a function which makes i t an important animal model f o r HCMV. MCMV genes involved i n latency and re a c t i v a t i o n have not been f u l l y d e f i n e d but studies t o date have shown that the IE cl a s s gene, ie2, i s required f o r establishing MCMV latency i n spleen c e l l s (Mocarski et a l . , -27- 1990) . Further studies are required t o i d e n t i f y other genes and virus-coded f u n c t i o n s t h a t are i n v o l v e d i n maintenance of the l a t e n t s t a t e and r e a c t i v a t i o n of MCMV. Like HCMV, host immune surveillance also appears t o p l a y an important r o l e i n l a t e n c y and re a c t i v a t i o n of MCMV. Several investigators have demonstrated r e a c t i v a t i o n of MCMV i n l a t e n t l y infected mice by inducing conditions that promote immunosuppression by admimstering drugs such as cyclophosphamide or co r t i c o s t e r o i d with anti-lymphocyte serum (Mayo et a l . , 1977; Jordan et a l . , 1977; Gonczol et a l . , 1985). Provoking allogeneic T c e l l responses i n l a t e n t l y infected mice can also reactivate the v i r u s as can i n f u s i o n of blood from l a t e n t l y infected mice into uninfected mice, or v i c e versa (Cheung and Lang, 1977b). I n v e s t i g a t i o n s so f a r indicate that numerous types of c e l l s and tissues have the p o t e n t i a l t o become s i t e s f o r MCMV latency. This broad t i s s u e range f o r MCMV persistence complicates the study of the mechanisms involved. Several groups have reported that latent MCMV p e r s i s t s i n spleen c e l l s , e s p e c i a l l y i n the B c e l l population (Wise et a l . , 1979; Olding et a l . , 1975, 1976; Wu and Ho, 1979) . Observations that confirm the occurrence of latency i n spleen c e l l s include r e a c t i v a t i o n of the v i r u s e i t h e r by c o c u l t i v a t i o n with allogeneic uninfected mouse embryo c e l l s or c u l t i v a t i o n i n the presence of 1 ipopolysaccharide (B c e l l mitogen), with detection of the v i r a l genomes by h y b r i d i z a t i o n t o MCMV DNA probes. More recently, a c o n f l i c t i n g report from Mercer e t a l . (1987) suggests t h a t stromal c e l l s are the predciminant r e s e r v o i r of latent MCMV i n the spleen rather than B c e l l s , T c e l l s or monocytes. Peritoneal macrophages have also been shown t o harbour latent v i r u s , and th e r e are r e p o r t s of MCMV r e a c t i v a t i o n from s t i m u l a t e d macrophages or detection of MCMV genome i n macrophages (Brautigam et a l . , -28- 1979) . Salivary glands are another s i t e of MCMV persistence. The v i r u s can be reactivated from t h i s organ by administering t o the mice cyclophosphamide or anti-lymphocyte serum (Mayo et a l . 1977; Jordan et a l . , 1977; Gonczol et a l . 1985) . Other s i t e s i n mice that may harbour latent v i r u s , include ovaries, testes, prostate glands, kidney and even the s c i a t i c nerve (Brautigam and Oldstone, 1980; Cheung and Lang, 1977a; Porter et a l . , 1985; Abols-Mantyh et a l . , 1987; Nelson e t a l . , 1990). In summary, evidence so f a r predicts s e v e r a l p o t e n t i a l s i t e s f o r MCMV l a t e n c y and conditions that promote immunosuppression or immunological responses reactivate the v i r u s from i t s l a t e n t s t a t e . D e t a i l s on v i r a l functions that control persistence and laten c y are lacking. Therefore, further investigations e s p e c i a l l y at the molecular l e v e l need t o be pursued i n order t o provide i n s i g h t i n t o these events. 1.6 NONPRODUCTIVE INFECTIONS IN VITRO 1.6.1 HCMV HCMV d i s p l a y s a l i m i t e d host range and i t s r e p l i c a t i o n i s best demonstrated i n human f i b r o b l a s t c e l l s (Vonka e t a l . , 1976). HCMV i n f e c t i o n i n nonpermissive c e l l s r e s u l t s i n l i m i t e d v i r a l expression and no v i r a l DNA r e p l i c a t i o n . Rodent c e l l s such as guinea p i g f i b r o b l a s t , r a b b i t kidney c e l l s (RK) and Balb/c-3T3 mouse c e l l s are nonpermissive f o r HCMV r e p l i c a t i o n ( F i o r e t t i e t a l . , 1973; S t i n s k i , 1978; DeMarchi, 1983b; Lafemina and Hayward, 1983, 1988). Although human f i b r o b l a s t c e l l s are permissive f o r HCMV, a d d i t i o n of immune serum or interferon during i n f e c t i o n causes a sw i t c h t o r e s t r i c t e d v i r a l expression or nonproductive i n f e c t i o n (Mocarski -29- and S t i n s k i , 1979; Rodrigueze et a l . , 1983). The outcome may be reversed by simply eliminating the antiserum or interferon. These observations support the n o t i o n t h a t t he immune system and down-regulation of v i r a l gene exp r e s s i o n may be involved i n the maintenance of persistence and latency of HCMV. L i k e rodent c e l l s , human p e r i p h e r a l blood mononuclear c e l l s are also nonpermissive t o HCMV, but investigations involving blood transfusions have i n d i c a t e d that the v i r u s can i n f e c t and p e r s i s t i n these c e l l s i n a latent s t a t e ( P r i n c e e t a l . , 1971; Winston et a l . , 1980). With the a i d of monoclonal a n t i b o d i e s , t he presence of the major IE protein has been dete c t e d i n these p e r s i s t e n t l y infected mononuclear c e l l s (Rice et a l . , 1984). The undifferentiated human teratocarcinoma stem l i n e i s another c e l l l i n e nonpermissive f o r HCMV. The r e s t r i c t i o n i n t h i s c e l l l i n e l i e s a t the l e v e l o f I E t r a n s c r i p t i o n . These c e l l s become p e r m i s s i v e when c e l l d i f f e r e n t i a t i o n i s induced by r e t i n o i c a c i d (Gonczol e t a l . , 1984; IjaFemina and Hayward, 1986, 1988; Nelson and Groudine, 1986). The IE1 gene appears t o be i n a c t i v e i n undifferentiated c e l l s due t o the absence of unidentified c e l l u l a r f a c t o r s (Nelson e t a l . , 1990). These factors, when present, i n t e r a c t with the v i r a l DNA t o bring about a conformational change which i s r e q u i r e d f o r the expression of IE genes. In conclusion, observations t o date indicate that immune responses and nonpermissive i n f e c t i o n s may help maintain HCMV latency and persistence, and ce r t a i n changes i n conditions which may induce c e l l u l a r and/or v i r a l f a c t o r s may be the cause of reac t i v a t i o n . -30- 1.6.2 MCMV* Productive i n f e c t i o n of MCMV i s best demonstrated i n primary mouse embryonic f i b r o b l a s t s , and i n 3T3 and 3T6 c e l l l i n e s (Hudson, 1984). Other mouse c e l l s such as Y - l (adrenal c e l l s ) , primary kidney, primary spleen, primary l i v e r , s e v e r a l macrophage l i n e s , T lymphocytes and L5178Y (leukaemic T) c e l l s are permissive f o r MCMV, but at a very low l e v e l (results summarized i n Hudson, 1984). Unlike HCMV, MCMV has a more diverse species range and has been shown t o r e p l i c a t e at a low l e v e l i n monkey (BSC-1), hamster (BHK-21), rabb i t (primary kidney and RK-13) and f e t a l sheep brain c e l l s (Kim and Carp, 1971). Human and simian f i b r o b l a s t are nonpermissive f o r MCMV and the v i r a l gene expression i n these c e l l s i s l i m i t e d t o IE genes (Kim and Carp, 1972; Hudson and Walker, 1987; LaFemina and Hayward, 1988). I n t r a c h e a l e p i t h e l i a l c e l l s i n culture, a productive i n f e c t i o n of MCMV i s dependent on c e l l - c e l l contact or fusion with infected f i b r o b l a s t c e l l s (Nedrud and Wu, 1984). This suggests that the infected f i b r o b l a s t may co n t a i n a f a c t o r that i s es s e n t i a l t o support v i r a l r e p l i c a t i o n . This f a c t o r may be required f o r DNA synthesis as although MCMV r e p l i c a t i o n i n mouse f i b r o b l a s t c e l l s occurs, i t i s dependent on the S-phase of the c e l l c y c l e . (Muller et a l . , 1978; Hudson et a l . , 1979). C e l l s i n Go phase do not support v i r a l r e p l i c a t i o n , but stimulation of c e l l s t o enter the c e l l cycle induces v i r a l r e p l i c a t i o n . This phenomenon i s perhaps involved i n MCMV latency and rea c t i v a t i o n , but further analysis would be required t o v e r i f y t h i s statement. Reports from numerous i n v e s t i g a t o r s are c o n t r a d i c t o r y as t o whether macrophages are permissive t o MCMV (Selgrade and Osborn, 1974;. Mims and Goul d , 1978; Loh and Hudson, 1979; Tetgmeyer and Craighead, 1988; -31- K a t z e n s t e i n e t a l . , 1983; Walker and Hudson, 1987). Studies have indicated t h a t macrophages may harbour l a t e n t v i r u s , and factors present i n the s t i m u l a t e d c e l l s may cause i t s r e a c t i v a t i o n (Brautigam et a l . , 1979; Yamaguchi e t a l . , 1988). According t o one report, i n f e c t i o n of macrophages i s dependent upon the H-2 phenotype, but v i r a l r e p l i c a t i o n i n the majority of susceptible macrophages i s blocked a t day 3 p . i . , perhaps due t o the presence of interferon (Price et a l . , 1987). MCMV i n f e c t i o n i n the undifferentiated mouse c e l l l i n e s such as CTT6050AF1 BrdU, F9 and PCC4 i s nonproductive, and l i k e HCMV, the block i s evidently at the l e v e l o f IE t r a n s c r i p t i o n (Dutko and Oldstone, 1981). However, as mentioned f o r HCMV, some of these c e l l l i n e s do become permissive t o MCMV when induced t o d i f f e r e n t i a t e (Dutko and Oldstone, 1981; LaFemina and Hayward, 1988). To date, the molecular basis f o r latency and re a c t i v a t i o n of MCMV and HCMV i n v i v o remain unclear. As speculated f o r HCMV, MCMV may remain latent i n nonproductive and/or undifferentiated c e l l s and perhaps some c e l l u l a r and/or v i r a l f a c t o r s , induced a t some time o r d u r i n g d i f f e r e n t i a t i o n , may reactivate the v i r u s . Nonpermissive system such as an undifferentiated c e l l l i n e may serve as a model f o r i n vivo latency f o r both MCMV and HCMV, but the challenge t o es t a b l i s h more i n v i t r o systems that would more c l o s e l y mimick the i n vivo system s t i l l remains. U n t i l then, we also depend on the i n v i v o studies of the murine model f o r information on CMV latency which i s r a t h e r l i m i t e d and t e c h n i c a l l y d i f f i c u l t at the molecular l e v e l . The best approach i n t h i s case would be t o use probes that have been f u l l y defined i n order t o detect s p e c i f i c t r a n s c r i p t s . Some of the studies performed i n t h i s t h e s i s involve the use of cDNAs as defined probes t o investigate the gene -32- expression at the t r a n s c r i p t i o n a l l e v e l i n a permissive c e l l l i n e (3T3L1 mouse f i b r o b l a s t ) . The r e s u l t s of t h i s study may be extended i n the future t o i n v e s t i g a t e gene expression i n vivo and i n nonpermissive c e l l l i n e s i n v i t r o during latency. 1.7 MCMV AS A BIOLOGICAL MODEL FOR HCMV HCMV i s extremely host s p e c i f i c and therefore cannot be used t o in f e c t animals other than humans. An alte r n a t i v e i s t o study an animal CMV i n i t s natural host and f o r many reasons MCMV i s an excellent choice. Both HCMV and MCMV are morphologically a l i k e . They belong t o the same sub-family ( b e t a h e r p e s v i r i n a e ) , are immunosuppressive, and are capable of causing persistent and latent infections i n t h e i r natural hosts (Mathews et a l . , 1982; Whyte et a l . , 1987; Waner et a l . 1989). They are l e t h a l f o r young animals and immunosuppressed adults. Although t h e i r DNA genomes d i f f e r i n s t r u c t u r e , they are approximately the same length, contain one major IE region, and e x h i b i t temporal gene expression (Misra et a l . , 1978; Demarchi, 1981; Mercer et a l . , 1983; G r i f f i t h and Grundy, 1987; Osborn, 1982). Due to these s i m i l a r i t i e s , MCMV i s an excellent choice as the b i o l o g i c a l model f o r HCMV. 1.8 RATIONALE AND OBJECTIVES The u l t i m a t e g o a l of the murine model i s t o help define the molecular mechanisms leading t o acute or persistent cytomegalovirus i n f e c t i o n . To achieve t h i s , gene expression during a permissive i n f e c t i o n with MCMV has t o be f u l l y c h a r a c t e r i z e d and understood esp e c i a l l y a t the t r a n s c r i p t i o n a l l e v e l . When we embarked upon t h i s project, the t r a n s c r i p t i o n a l l y active r e g i o n s of IE, E and L had been mapped i n the MCMV genome, but the i n d i v i d u a l t r a n s c r i p t i o n u n i t s and d e t a i l s such as the s i z e , number and p a t t e r n of temporal expression of i n d i v i d u a l t r a n s c r i p t s had not been -33- d e f i n e d f o r the E phase. As a detailed analyses of the IE region was being c a r r i e d out by another group ( K e i l et a l . , 1984; 1987), E t r a n s c r i p t i o n became the major focus of t h i s project. The importance of t h i s phase i n the r e p l i c a t i o n cycle can be deduced from the f a c t that many of the v i r u s coded f u n c t i o n s t h a t r e g u l a t e h e r p e s v i r u s ex p r e s s i o n , DNA s y n t h e s i s and pathogenesis are expressed at t h i s time. Moreover, several MCMV E proteins are known t o be DNA-binding proteins and t o be found exclusively i n the nucleus, c l e a r l y i n d i c a t i n g t h e i r p o t e n t i a l as regulators of gene expression or involvement i n DNA synthesis (Walker and Hudson, 1987a). There are at lea s t two indications that the E phase expression of MCMV regulates pathogenesis. The f i r s t i n d i c a t i o n comes from the study involving an E gene, sgg-1. This gene has been proven t o be es s e n t i a l f o r the v i r u s a b i l i t y t o r e p l i c a t e i n the s a l i v a r y gland t i s s u e of mice (Mocarski et a l . , 1990) . The second i n d i c a t i o n comes from V a l et a l . (1989). Their study suggests that u n i d e n t i f i e d factors produced during the E phase, a i d i n the s u r v i v a l of the infected c e l l because they appear t o in t e r f e r e with the pr e s e n t a t i o n of the antigen, pp89, the primary target of the c e l l u l a r immune response. Thus, there i s cle a r evidence of the contribution of the E phase genes i n determining MCMV pathogenesis. Furthermore, understanding of both IE and E gene expression i s es s e n t i a l i n order t o elucidate the underlying mechanisms involved i n establishment, maintenance and re a c t i v a t i o n of latent i n f e c t i o n s . The purpose of t h i s project was t o investigate i n d i v i d u a l patterns of MCMV gene t r a n s c r i p t i o n i n genomic locations previously i d e n t i f i e d as IE and E reg i o n s by other investigators. The approach taken was t o prepare an IE and E cDNA l i b r a r y from MCMV infected c e l l s , and characterize the cDNAs by -34- mapping them t o s p e c i f i c r e s t r i c t i o n fragments ( H i n d l l l , Eco R l and Xbal) on the MCMV genome. These were then used as defined probes t o study expression from i n d i v i d u a l t r a n s c r i p t i o n u n i t s . In t h i s way a de t a i l e d picture of MCMV t r a n s c r i p t i o n d u r i n g acute i n f e c t i o n was obtained. These r e s u l t s w i l l p r o v i d e the basis f o r a future d e t a i l e d analysis of MCMV expression during latency. I n addition, an in-depth study of one p a r t i c u l a r E cDNA, E10 has been c a r r i e d out. This cDNA was chosen because i t mapped t o a highly t r a n s c r i b e d E region of the MCMV genome, H i n d l l l I - J . Two independent groups have i d e n t i f i e d t h i s region as one of the major regions expressed d u r i n g E phase (Marks et a l . , 1983; K e i l et a l . , 1984). Therefore, with the view that the E10 cDNA may code f o r an important function and w i l l provide novel information on the structure of the corresponding t r a n s c r i p t and gene, i t s DNA sequence was determined, and t h i s sequence used t o predict the properties of the putative E10 protein. T h i s study represents t he f i r s t d e t a i l e d a n a l y s i s of E r e g i o n gene expresssion, and the E10 cDNA i s the second E gene t o have been mapped and sequenced. The cDNAs prepared w i l l provide useful probes i n future work f o r the analysis of MCMV expression during persistence and latency i n vivo. 1.9 SUMMARY OF THESIS PROJECT I n i t i a l l y , t he t r a n s c r i p t i o n pattern during the course of a permissive i n f e c t i o n with MCMV was analysed using the cDNAs of RNA tr a n s c r i p t s present a t I E and E times The f i r s t section of the 'Results and Discussion' d e s c r i b e s the d e t a i l e d characterization of these IE and E cDNAs. The study involved the preparation of the cDNAs from poly A + RNAs i s o l a t e d at IE and E times of i n f e c t i o n , cloning of the cDNAs a t the EcoRl s i t e i n the Lambda gt l O system, and screening f o r v i r a l i n s e r t s w i t h MCMV DNA probes. Subsequently, some of these cDNAs were characterized by estimating t h e i r -35- s i z e s and mapping them t o s p e c i f i c locations of the genome. F i v e E cDNAs, each representing a d i f f e r e n t and a c t i v e l y transcribed E r e g i o n ( H i n d l l l A, B, G, E, F, and I-J) of the genome, and four IE cDNAs mapping t o the major IE region were chosen as probes t o investigate the degree of expression displayed by t h e i r corresponding gene during a course of permissive i n f e c t i o n . This task was accomplished by i s o l a t i n g RNA from i n f e c t e d c e l l s a t d i f f e r e n t times, binding the RNA t o a nylon membrane and h y b r i d i z i n g the RNA t o the defined cDNA probes. A l l f i v e E cDNAs and two of the f o u r IE cDNAs detected t r a n s c r i p t l e v e l s that displayed the t y p i c a l E and IE expre s s i o n r e s p e c t i v e l y . Furthermore, these experiments also v e r i f i e d the v i r a l o r i g i n of most of the cDNAs, with the exception of two of the four IE cDNAs, which were found t o be c e l l u l a r i n o r i g i n . The main focus of the thesis was t o investigate the expression of i n d i v i d u a l E t r a n s c r i p t i o n u n i t s . Northern b l o t analyses were performed i n which the f i v e E cDNAs were chosen as probes, and d e t a i l s such as the s i z e and number of the r e s p e c t i v e t r a n s c r i p t s , and the p a t t e r n of complex temporal expression of i n d i v i d u a l RNA i n a permissive system were revealed. These r e s u l t s p r o v i d e a good basis f o r comparison of v i r a l expression during latency, a t the molecular l e v e l i n the future. The f i n a l portion of the thesis focuses on one E cDNA, ElO. The c r i t e r i o n f o r s e l e c t i n g that p a r t i c u l a r cDNA f o r extensive analysis was the f a c t that i t mapped t o a region ( H i n d l l l I-J) known t o be heavily transcribed during E phase. The ElO cDNA lacked a polyadenylation t r a c t . This missing 3' fragment, d e s i g n a t e d as E10-A, was i s o l a t e d u s i n g t h e PCR method ( i l l u s t r a t e d i n Figure 31). Both the ElO cDNA and i t s 3' end (E10-A) were -36- sequenced as i l l u s t r a t e d i n Figures 30 and 32. A combined DNA sequence, designated as E10-C, contained a t o t a l of 4606 bases (E10-C) and had a major ORF of 1200 amino acids with the p o t e n t i a l t o encode a 135 kd polypeptide. D e t a i l s and further analysis on both the DNA sequence and deduced protein sequence are presented i n t h i s t h e s i s . This includes the search f o r homologous DNA and protein sequences i n the data banks (Genbank, European Molecular Biology Labs, Genpept, Swissprt) and HCMV (AD169). In addition, the h y p o t h e t i c a l p r o p e r t i e s of the encoded 135 kd protein were also determined using available computer programs [PC gene (Int e l l i g e n e t i c s ) and Seqnce (Delaney software Ltd, Universion and version 2.1)]. F u r t h e r experiments t o i d e n t i f y the orientation of the major gene coding f o r the E10 cDNA were c a r r i e d out. The r e s t r i c t i o n enzyme map of E10-C cDNA sequence was matched t o the r e s t r i c t i o n enzyme map of Hind I I I I - J fragment i n order t o determine the orientation of the gene. In addition, portions of the H i n d l l l fragments I and J were also sequenced and portions of DNA with sequences i d e n t i c a l t o those present on the cDNA i d e n t i f i e d , t o confirm the orientation of the gene. F i n a l l y , attempts t o map the 5' end of the E10 cDNA and t o i d e n t i f y the p r o t e i n coded by the cDNA were conducted. Due t o the protocol f o r co n s t r u c t i o n of the cDNA l i b r a r y , the 5' end of the t r a n s c r i p t would not be in c l u d e d i n t h i s clone, hence primer extension of the E mRNAs was used i n an attempt t o map the 5' end. Attempts t o i d e n t i f y the protein of 135 kd coded by the major ORF of E10 cDNA involved hybrid s e l e c t i o n of RNA by E10 cDNA and i t s t r a n s l a t i o n i n a i n - v i t r o r a b b i t r e t i c u l o c y t e system. A v i r a l l y induced protein of approximately 135 kd, and of E and L o r i g i n was detected i n one of these experiments. -37- 2.0 MATERIALS AND METHODS 2.1 3T3L1 CELLS 3T3L1 c e l l s (ATCC CCL 92.1) are a continuous l i n e of Mouse embryonic f i b r o b l a s t c e l l s . The c e l l s were grown and passaged i n Dulbecco's Modified Eagle Medium (DMEM) containing 10% f e t a l bovine serum (FBS, Gibco), 0.37% sodium bicarbonate and 50 ug/ml gentamicin s u l f a t e (Sigma) i n a 37°C incubator supplied with 5% CC>2 and 95% a i r . For v i r u s propagation, c e l l s were grown i n r o l l e r b ottles (Falcon) i n DMEM containing 10% FBS, 0.15% sodium bicarbonate and 50 ug/ml gentamicin s u l f a t e a t 37°C. 2.2 PREPARATION OF MURINE COTCMEG3UVDVIRUS (MCMV) STOCK Murine cytomegalovirus, Smith s t r a i n was o r i g i n a l l y obtained from American Type C u l t u r e C o l l e c t i o n (ATCC). Concentrated stocks of the v i r u s were prepared by i n f e c t i n g subconfluent 3T3L1 c e l l s i n r o l l e r b o t t l e s at a m u l t i p l i c i t y of i n f e c t i o n (MOI) of 0.01 plaque forming u n i t ( p f u ) / c e l l . The medium from infected c e l l cultures was centrifuged at 6000 rpm i n a So r v a l l GSA rot o r f o r 20 minutes t o remove c e l l u l a r debris. The supernatant was recentrifuged a t 12000 rpm i n the S o r v a l l GSA roto r f o r 4 hours t o p e l l e t the v i r u s . The p e l l e t was resuspended i n phosphate buffered s a l i n e (PBS; 8 g N a C l / 1 , 0.2 g KC1/1, 1.15 g Na 2HP0 4/l, 0.2 g KH 2P04/1, 0.1 g C a C l 2 / l , 0.1 g MgCl 2 / l ) , recentrifuged a t 19,000 rpm i n a So r v a l l rotor (SS-34) f o r 1.5 hours t o recover the v i r u s , which was resuspended i n a small volume of PBS, and stored at -70°C, i n aliquots. 2.3 TITRATION OF MCMV Subconfluent 3T3L1 c e l l s equivalent t o 8 x l 0 6 c e l l s per pla t e (35x100mm, Nunc) were infected with 1.0 ml of medium containing appropriately d i l u t e d v i r u s . For a standard t i t r a t i o n , the infected c e l l s were incubated at 37°C -38- f o r 30 minutes with v i r u s t o allow adsorption. For c e n t r i f u g a l t i t r a t i o n , t he infected c e l l s were centrifuged with 2.0 ml v i r u s inoculum i n t h e i r d i s h e s a t a speed of 2000 rpm i n large buckets of an IEC centrifuge. The medium was replaced with 2 ml of overlay medium (DMEM, 5% FBS, 0.5% agarose, 0.37% sodium bicarbonate, and 50 ug/ml gentamicin s u l f a t e ) . Infected c e l l s were incubated at 37°C i n 5% C0 2 atmosphere f o r approximately f i v e days f o r t he plaques t o appear. The t i t r e was expressed as e i t h e r standard pfu/ml or as ce n t r i f u g a l pfu/ml depending on the method used. Centrifugal t i t r e i s 20 t o 50 f o l d higher than the standard t i t r e (Hudson et a l . , 1976, 1988). 2.4 PREPARATION OF MCMV DMA The MCMV p e l l e t was obtained from c e l l free supernatant by the procedure d e s c r i b e d i n Section 2.2. Virus from 5 r o l l e r b o t t l e s was treated with 1 ml of PEST s o l u t i o n [100 ug Proteinase K (Beckman)/ml, 0.01 M EDTA, 1% SDS, 0.1 M T r i s - C l pH 8.0] at 65°C f o r 2 hr, followed by overnight incubation at 37°C. S t e r i l e water was added t o a f i n a l volume of 7.0 ml, then 9.1 g of cesium chloride (CsCl) were added t o give a r e f r a c t i v e index of 1.402 g/cc t o 1.403 g/cc. The DNA was centrifuged t o equilibrium i n a quick seal tube (Beckman) at 35,000 rpm i n Ti75 rotor f o r 65 t o 72 hr at 20°C. Fractions of 0.5 ml were c o l l e c t e d from the bottom of the tube. Those that coincided w i t h the f i r s t Absorbance peak (A^Q) , a region of high v i s c o s i t y and r e f r a c t i v e index of 1.401 g/cc, were selected (Mosmann and Hudson, 1973) and dialysed against TE (10 mM T r i s - C l pH 7.4, 1 mM EDTA) buffer. 2.5 PLASMID ISOLATION E. c o l i s t r a i n s JM109 [recAl, endcAl, gyrA96, t h i - , hsdR17, supE44, r e l A l ( l a c , pro) F'traDSe pro AB l a c l q , lacZ M15] and DH5-a (supE44 l a c hsdR17 -39- r e c A l gyrA96, t h i - 1 r e l A l ) were transformed with plasmid DNA (Section 2.18.3) containing an a m p i c i l l i n r e s i s t a n t gene (Sambrook et a l . , 1989). B a c t e r i a l c u l t u r e s were grown i n the presence of a m p i c i l l i n a t a f i n a l c oncentration of 50 ug/ml i n YT medium (8.0 g Bac±cHIryptone/l, 5.0 g yeast extract/1, 5.0 g NaCl/1) (Maniatis et a l . , 1982). 2 . 5 . 1 SMALL SCALE PLASMID ISOLATION The method used was that described i n Maniatis et a l . (1982) with minor mo d i f i c a t i o n s . The a l k a l i n e l y s i s method was used t o i s o l a t e plasmid DNA from 1.5 ml overnight cultures of E. c o l i . The plasmid DNA was dissolved i n TE b u f f e r c o n t a i n i n g 20 ug/ml RNAse A and 20 units/ml RNAse T l , and incubated a t 37°C f o r 30 minutes. The DNA preparation was extracted with phenol/chloroform (1:1) as i n Section 2.7. DNA was pr e c i p i t a t e d with e t h a n o l , washed, dried and f i n a l l y dissolved i n 50 u l of TE buffer as i n Section 2.7. 2 .5 .2 LARGE SCALE PLASMID ISOLATION The method used was e s s e n t i a l l y that described i n Maniatis et a l . (1982). B a c t e r i a l c e l l s were subjected t o a l k a l i n e l y s i s . The crude plasmid DNA was p u r i f i e d by banding i n a CsCl gradient containing ethidium bromide (EtBr; 600 ug/ml). EtBr was removed by performing extractions with 1-butanol and CsCl was removed by d i a l y s i n g against TE buffer. 2.6 RESTRICTION ENDONDCLEASE DIGESTION OF DNA A l l r e s t r i c t i o n enzymes were purchased from Besthesda Research Laboratory (BRL). Approximately 1 ug of DNA was digested with 1 t o 5 un i t s of r e s t r i c t i o n enzyme using conditions recommended by the manufacturer. -40- 2 . 7 QUANTIFICATION, PURIFICATION AND PRECIPITATION OF NUCLEIC ACIDS C o n c e n t r a t i o n s of both p u r i f i e d DNA and RNA were q u a n t i f i e d by UV spectrophotometry. Absorbance was read at wavelengths 260 nm and 280 nm; f o r DNA, 1.0 A 2 6 Q was assumed t o equal 50 ug/ml and f o r RNA, 1.0 A ^ g was assumed t o equal 40 ug/ml. The r a t i o ^ 6 0 ^ 8 0 o f P^^i® 1^ D N A w a s approximately 1.8, and that of p u r i f i e d RNA was approximately 2.0. P u r i f i c a t i o n and p r e c i p i t a t i o n of DNA and RNA were performed as described i n M a n i a t i s e t a l . (1982). For p u r i f i c a t i o n and deproteinization, aqueous s o l u t i o n s of DNA and RNA were extracted with organic solvents such as p h e n o l , c h l o r o f o r m (24 p a r t s chloroform:1 p a r t isoamylalcohol) and phenol/chloroform (1:1). Nucleic acids were pr e c i p i t a t e d by addition of recommended volumes of s a l t solutions and ethanol. The p r e c i p i t a t e was washed i n 70% ethanol, dried i n a desiccator, and f i n a l l y resuspended i n an appropriate buffer. 2 . 8 GEL ELECTRCPHORESIS AND TRANSFER OF DNA TO FILTERS The method was based on the procedure described i n Maniatis et a l . (1982) w i t h same modifications. R e s t r i c t i o n enzyme digested DNA fragments were separated by electrophoresing through an agarose (Ultrapure, BRL) g e l i n TBE (50 mM T r i s , 50 mM bo r i c acid, 1 mM EDTA, pH 8.0) or TAE (40 mM t r i s acetate, 0.2 mM EDTA pH 8.0). DNA fragments were viewed with the a i d of a UV tr a n s i l l u m i n a t o r (260 nm) and EtBr (0.5 ug/ml) present i n both g e l and running buffer. Before transfer, the g e l was shaken gently i n depurinating a c i d (0.25 M HCl) f o r 15 minutes, twice i n denaturing s o l u t i o n (0.5 M NaOH, 1.5 M NaCl) f o r 15 minutes and f i n a l l y i n n e u t r a l i z i n g s o l u t i o n (1.5 M NaCl, 1.0 M T r i s - C l pH 8.0) f o r 30 minutes. DNA was. transferred t o Hybond-N membrane (Amersham) i n 10X SSPE (IX SSPE = 10 mM sodium phosphate pH 7.4, -41- 150 mM NaCl, 1 mM EDTA). The f i l t e r was a i r dried and UV i r r a d i a t e d as recommended by the manufacturer (Amersham). Sizes of DNA fragments were estimated by the presence of DNA markers, normally H i n d l l l digested bacteriophage Lambda DNA, i n the g e l . The s i z e s were calculated as described i n Maniatis et a l . (1982). 2.9 SLOT BLOTTING OF DMA DNA was b l o t t e d u s i n g a Schleicher and Schuell m i n i f o l d I I apparatus. Samples were prepared and b l o t t e d according t o t h e manufacturer's i n s t r u c t i o n s . DNA was denatured i n 0.3 M sodium hydroxide a t 70°C f o r 1 hr, followed by ne u t r a l i z a t i o n with the addition of 1 volume of 2 M ammonium ace t a t e (pH 7.0). Samples were s l o t blotted onto Hybond N that had been pre-wetted with 1 M ammonium acetate. The membrane was a i r dried, placed d i r e c t l y on the transilluminator and i r r a d i a t e d with UV l i g h t (260 nm) f o r 3-5 minutes. 2.10 ISOLATION OF DNA FRAGMENTS FROM AGAROSE GEL DNA fragments were separated by agarose g e l electrophoresis i n TAE buffer. The band of i n t e r e s t was cut out and the fragment i s o l a t e d using Gene Clean (Biolabs), according to the manufacturer's instructions. 2.11 PREPARATION OF RADIOACTIVE DNA PROBES FOR HYBRIDIZATION 32 DNA probes l a b e l l e d with [a- P] dCTP (New England Nuclear, 3000Ci/mmol) were prepared with the BRL random primer DNA l a b e l l i n g system (Cat# 8187SA), according t o the manufacturer's instructions. -42- 2.12 HYBRIDIZATION: DNA PROBES This procedure was u t i l i z e d f o r both DNA-DNA and RNA-DNA hybridization i n which a DNA probe was used. The procedure was based on the method described by Singh and John (1984) with minor modifications. F i l t e r s from plaque l i f t s and g e l transfers were submerged i n hot water f o r 10 minutes t o remove r e s i d u a l agarose o r agar, followed by e q u i l i b r a t i o n i n 4x SSPE f o r 30 minutes at 20-25°C. The f i l t e r s were prehybridized i n a sealed bag (BEL hybri d i z a t i o n bags) containing a solution of 50% (V/V) formamide, 4x SSPE, 0.2% SDS, 50 ug/ml Heparin (Sigma, sodium s a l t grade I I ) , and 0.05% sodium pyrophosphate a t 42°C f o r 30 minutes. F i l t e r s were then hybridized o v e r n i g h t a t 42 °C with the same solution containing the denatured DNA probe ( 2 - 5 x l 0 6 cpm/ml). The s p e c i f i c a c t i v i t i e s of the probes used were 8 9 approximately 10 -10 cpm/ug DNA. The f i l t e r s were washed twice i n 2x SSPE, 0.1% SDS f o r 15 minutes at RT, twice i n O.lx SSPE, 0.1% SDS f o r 15 minutes at RT, and f i n a l l y once i n O.lx SSPE, 0.1% SDS f o r 1 hr a t 50°C f o r DNA-DNA hybridization, or at 55°C f o r RNA-DNA hybridization. Damp f i l t e r s were wrapped with saran wrap and exposed t o X-ray f i l m (XRP-1, Agfa). The removal of DNA probes for reprobing of blots: Success with removing the probe was achieved by keeping the f i l t e r damp at a l l times. The probe was stripped o f f by submerging the b l o t i n a solution of 0.1% SDS. The solut i o n was brought t o 100°C and the f i l t e r was kept submerged f o r 30 t o 60 minutes. The procedure was repeated u n t i l the membrane was free of the probe. The b l o t was autoradiographed overnight t o confirm complete removal of the probe. 2.13 RADIOACTIVE END—LABELLING OF DNA • . 32 DNA r e s t r i c t i o n fragments were end la b e l l e d with [a- P] dATP (NEN; 3000 -43- Ci/mmole) u s i n g T4 DNA polymerase (BRL), e s s e n t i a l l y as described i n Maniatis e t a l . (1982). 2.14 PREPARATION OF IE AND E.CDNA MCMV LIBRARY 2.14.1 ISOLATION OF TOTAL RNA Guanidinium isothiocyanate (GITC)/CsCl method: Subconfluent monolayers of 3T3L1 c e l l s were infected with MCMV a t MOI of 20-30 c e n t r i f u g a l p f u / c e l l ; the infected c e l l s were centrifuged a t 2000 rpm t o enhance i n f e c t i o n . For the i s o l a t i o n of Immediate Early (IE) RNA, the c e l l s were maintained i n medium containing cycloheximide (CH, Gibco) 2 hours p r i o r t o i n f e c t i o n at a concentration of 100 ug/ml, and during i n f e c t i o n at a concentration of 50 ug/ml. The c e l l s were harvested a t 4 hours post i n f e c t i o n . CH i s a protein synthesis i n h i b i t o r , and since IE proteins are re q u i r e d f o r the Early (E) phase, the presence of CH blocks the t r a n s i t i o n of IE t o E phase (Walker and Hudson, 1987). For the i s o l a t i o n of E phase RNA, the in f e c t e d c e l l s were treated with CH 4 hours post i n f e c t i o n at a concentration of 100 ug/ml and harvested at 7 hours post i n f e c t i o n . The procedure f o r RNA i s o l a t i o n i s based on that of Chirgwin et a l . (1979). Infected c e l l s were washed 3 times with i c e c o l d PBS and scraped i n t o 1 ml PBS per p l a t e w i t h a rubber policeman. The c e l l s were pel l e t e d by c e n t r i f u g a t i o n i n a So r v a l l GSA rotor at 5,000 rpm f o r 5 minutes at 4°C. C e l l s were lysed i n 8 volumes of GITC solution (4.0 M GITC, 50 mM sodium c i t r a t e , 0.5 % Na-N-lauroyl- Sarkosine pH 6.5, 10 mM EDTA pH 8.0, 0.1 M B-mercaptoethanol (Biorad)). CsCl was added t o the lysed mixture (2.0 g/ml of l y s a t e ) , which was then layered onto a 4.5 ml cushion of 5.7 M CsCl s o l u t i o n i n a quick seal tube (Beckman). The tube was centrifuged i n a Ti75 r o t o r a t 44.5 K rpm f o r 24 hours at 20°C t o p e l l e t the RNA. The RNA p e l l e t was dissolved i n s t e r i l e d i e t h y l pyrocarbonate (DEPC; Sigma) treated water -44- and p r e c i p i t a t e d with 0.1 volume of 2 M K-acetate (pH 5.5) & 2 volumes of 95% ethanol at -20°C. The RNA p r e c i p i t a t e was dissolved i n s t e r i l e DEPC treated water and stored at -70°C. 2.14.2 ISOLATION OF POLY A + RNA P o l y A + RNAs were obtained by fra c t i o n a t i n g t o t a l RNA i n a buffer (0.5 M NaCl, 10 mM L i - c i t r a t e , 5 mM EDTA pH 8.0) through an oligo-dT c e l l u l o s e (Pharmacia) column according t o the procedure of Aviv and Leder (1972), except that the Poly A + RNA was eluted from the column using DEPC treated water. The poly A + RNA was precipitated with 0.1 volume of 2 M K-acetate (pH 5.5) and 2 volumes of 95% ethanol. The RNA was c o l l e c t e d by centrifugation, redissolved i n DEPC treated water and stored at -70°C. 2.14.3 PREPARATION OF CDNA AND CLONING IN BACTERIOPHAGE LAMBDA gtlO IE and E cDNA were synthesised using the Amersham cDNA synthesis k i t (cat # RPN.1256). cDNAs were l i g a t e d t o EcoRl l i n k e r s and cloned i n t o Lambda gtlO a t the EcoRl s i t e using the Amersham cDNA cloning system k i t (cat. # RPN 1257) . I n order t o p r o t e c t t he i n t e r n a l EcoRl s i t e s , the cDNAs were subjected t o a methylation (EcoRl methylase) step before l i g a t i o n t o EcoRl l i n k e r s . Preparation and cloning procedures were those described by the manufacturer. 2.14.4 SCREENING OF IE AND E cDNA LIBRARIES: PLAQUE LIFT METHOD The procedure was e s s e n t i a l l y t h a t recommended by the manufacturer (Amersham) of the cDNA cloning k i t . Preparation of Phage plating cells: C e l l s were prepared by inoculating 50 ml Luria-Bertani medium (LB; 10 g -45- Bac±o-/Cryptone/l, 5 g NaCl/1, 10 g Bactoyeast/1) that was supplemented with 0.4% maltose, with 1 ml of overnight grown LB culture of E. coli strain NM514 ( h f l + ) . The culture was shaken vigorously at 37°C for approximately 3 hr u n t i l the A,._- reached 0.5. The c e l l s were cooled on ice, DUO centrifuged at 3000 rpm at 4°C and resuspended in 15 ml of cold 10 mM MgS04. Phage plating and plaque l i f t s : Lambda gtlO phage in 100 ul SM buffer [5.8 g NaCl/1, 2 g MgSCyTIL^O/l, 5 ml 1 M Tris-Cl (pH7.5)/l, 5 ml of 2% gelatin/1] was added to 100 ul of phage plating cells and incubated at 37°C for 15 minutes. Approximately 4 ml of liq u i d top agar (1 g Bactc—Tryptone/1, 0.5 g bacto-yeast extract/1, 0.5 g NaCl/1, 0.25 g MgS04/l, 1 g bacto-agar/1) at 45°C was added, mixed quickly and poured over a plate of LB agar (15 g Bacto-agar / l i t r e LB). The plate was allowed to set and incubate overnight at 37°C. The plate was cooled to 4°C before a Hybond-N (Amersham) membrane was placed carefully over the surface of the cold agar for 30 seconds. The membrane was peeled off, placed plaque side up on f i l t e r papers (Whatman 3MM) soaked in denaturing solution (0.5 M NaOH, 1.5 M NaCl) for 5 minutes. The membrane was then placed on f i l t e r papers soaked in neutralizing solution (0.5 M Tris-Cl pH 7.0, 1.5 M NaCl) for 5 minutes, and finally rinsed in 2x SSPE. The membrane was a i r dried, placed on a transilluminator and irradiated with UV light (260 nm) for 3 to 5 minutes. 2.15 PREPARATION OF BACTERIOPHAGE LAMBDA gtlO PHAGE STOCK The procedure was that recommended by the manufacturer of the cDNA cloning k i t , Amersham. A plaque of interest was picked with a sterile pasteur pipette and added to 100 ul of phage plating cells (cells prepared as -46- described in Section 2.13). Adsorption was allowed to proceed at RT for 15 minutes followed by addition of 5 ml of LB medium containing 5 mM CaCl 2. The culture was then shaken at 37°C for 4.5 hr. A few drops of chloroform were added and the culture was allowed to shake for an additional 5 minutes. Bacterial debris was removed by spinning at 3000 rpm in a bench centrifuge for 10 minutes. The supernatant was stored over a few drops of chloroform at 4°C. 2.16 ISOLATION OF BACTERIOPHAGE LAMBDA gtlO PHAGE DNA 2.16.1 SMALL SCALE ISOLATION OF PHAGE DNA The method i s based on that of Maniatis et a l . (1982) with some . . . 5 modifications. Phage were plated (10 /80mm plate) to give confluent ly s i s ; 5 ml of SM buffer were added to the plate and left at RT for 2-3 hr. The SM buffer was transferred to a 15 ml Corex tube and left at RT for 15 minutes with 2-3 drops of chloroform. Bacterial debris was removed by centrifugation at 10,000 rpm in a Sorvall GSA rotor for 10 minutes at 4°C. One volume of SM buffer containing 2.5 M NaCl and 20% (w/v) polyethylene glycol (PEG 8000; BDH) was added, and chilled on ice for 1 hr. Phage were recovered by centrifuging at 11,000 rpm in a Sorvall GSA rotor at 4°C for 20 minutes. The pellet was resuspended in DNase I buffer (10 mM Tris-Cl pH 7.5, 5 mM MgCl2, BSA 100 ug/ml) with addition of RNase A and DNase I to a f i n a l concentration of 1 ug/ml each. The mixture was incubated at 37°C for 30 minutes, followed by centrifugation at 10,000 rpm in a Sorvall SS-34 rotor for 10 minutes at 4°C. To the supernatant, 5 ul each of 10% SDS and 0.5 M EDTA pH 8.0 were added and incubated at 68°C for 15-60 minutes. The solution was extracted with phenol/chloroform, followed by chloroform. One volume of isopropanol was added and stored at -20°C overnight to precipitate -47- DNA. The DNA precipitate was recovered by centrifugation in a Sorvall SS-34 rotor at 12,000 rpm for 20 mins, washed in 70% ethanol, dried and resuspended in 25 ul TE containing 20 ug/ml RNase A. 2.16.2 LARGE SCALE ISOLATION OF PHAGE DNA The procedures were a combination of methods from Maniatis et a l . (1982) and Davis et a l . (1986) with same modifications. Propagation of phage: Two methods were used for the propagation of phage for DNA isolation. Method I: Phage propagation in dishes . 5 Phage were plated in ten 82 mm dishes to give confluent lysis (10 pfu per dish); 5 ml of SM buffer was added to each plate and gently shaken for 2 hr at RT. The SM buffer from the dishes was combined and centrifuged at 15,000 rpm in a Sorvall SS-34 rotor for 10 minutes to remove the bacterial debris. To the supernatant, 0.15 volume of 5 M NaCl and 0.3 volume of 50% PEG 8000 were added, and the solution was stored on ice for 2 hr to precipitate the phage. Method II: High titre lysate NM514 cells were grown at 37 °C in 1 l i t r e of LB medium supplemented with 2 mM MgS04, 4 uM FeS04, 0.1 M CaCl 2, 0.15% glucose with vigorous shaking 9 to an A,...,, of 0.2. Cells were inoculated with 2x10 pfu and shaken vigorously for 4-6 hr, followed by addition of 20 ml chloroform and 120 ml of 5 M NaCl. The culture was shaken for an additional 5 minutes at 37°C. Bacterial debris was removed by centrifuging at 15,000 rpm in a Sorvall SS-34 rotor for 10 minutes at 4°C. Molar MgS04 (10 ml) and PEG 8000 (120 -48- g) were added and the phage allowed to precipitate on ice for 2 hr. Isolation of phage DNA: Phage were recovered by centrifuging at 10,000 rpm in a Sorvall GSA rotor for 15 minutes at 4°C. The pellet was resuspended in 5 ml of DNase I buffer (10 mM Tris-Cl pH 7.5, 5 mM MgCl2, 100 ug BSA/ml). DNase I and RNase A were added to a final concentration of 20 ug/ml and 200 ug/ml respectively and the phage were incubated at 37°C for 30 minutes. The preparation was extracted twice with equal volume of chloroform, followed by the addition of 0.75 g of CsCl/ml to give a refractive index of 1.45-1.5 g/cc. The phage were centrifuged in a quick seal tube in Beckman Ti75 rotor at 60,000 rpm for at least 16 hr. Phage which appeared as a bluish band were isolated by puncturing the side of the tube with an 18 gauge needle. CsCl was removed by dialysing against TE pH 7.4 at 4°C. The dialysed phage were treated with 1% SDS, 20 mM EDTA and 100 ug Proteinase K/ml at 65°C for 1 hr, followed by extractions with phenol/chloroform and chloroform. Finally, the DNA in solution was dialysed against TE pH 7.4 at 4°C. 2.17 ANALYSIS OF RNA Various precautions were taken during the RNA procedures to prevent any RNA degradation by the presence of ribonuclease. A l l glassware and solutions were treated with 0.2% DEPC as described i n Maniatis et al. (1982). Glassware was baked at 300°C for at least 12 hr. A l l items such as tubes, tips and pipettes were sterile and disposable. Gloves were worn during the procedure to prevent contamination of RNA from finger ribonuclease. Eppendorf tubes and pipette tips were siliconized to prevent RNA from sticking. -49- 2.17 .1 SMALL SCALE ISOLATION OF TOTAL RNA: IJTHIUM CHLORIDE ( L i C l ) METHOD The method was based on that of Cathala et a l . (1983). RNA isolated by this method was used for slot blotting and hybridization experiments to evaluate individual cDNAs as probes. Subconfluent 3T3L1 cells were infected with MCMV at a MOI of 20-30 centrifugal pfu/cell. The cells were scraped from the plates (60x15mm) at various time intervals after infection into 1 ml cold PBS/plate. Cells were recovered by centrifuging at 1,000 rpm in an IEC bench centrifuge (model# HN-FII) for 5 minutes and resuspended in 7 volumes (relative to the volume of the pellet) of homogenization buffer (5 M GITC, 10 mM EDTA, 50 mM Tris-Cl pH 7.5, 0.1 M 6-mercaptoethanol). Seven volumes (relative to the volume of the homogenate) of 4 M LiCl (BDH) were added to the homogenate and the solution was placed overnight at 4°C. Crude RNA was recovered by centrifugation at 10,000 rpm in an eppendorf centrifuge for 20 minutes. The pellet was resuspended in 1 ml 3 M LiCl and repelleted. The crude RNA was dissolved in 0.4 ml solubilizing buffer (10 mM Tris-Cl pH 7.5, 1 mM EDTA, 0.1% SDS), 0.05 volumes of 5 M NaCl was added, followed by phenol/chloroform extraction. RNA was precipitated with 2.2 volumes of ethanol and then dissolved in 100 ul of DNase I buffer (1 mM DTT, 10 mM MgCl, 10 mM Tris-Cl pH 7.4, 1 mM EDTA) containing 100 units of RNasin (Promega) and treated with 10 units RNase-free DNase I (Pharmacia) at 37°C for 30 minutes. The reaction was stopped by adding 10 ul of 0.5 M EDTA and 2 u l of 10% SDS. The RNA was extracted with phenol/chloroform and precipitated with 95% ethanol. The RNA was recovered by centrifugation, redissolved in DEPC treated water and stored at -20°C. -50- 2.17.2 SLOT BLOTTING OF RNA The Schleicher and Schuell itdnifold II apparatus was used to slot blot RNA onto Hybond-N that had been prewetted with 2Ox SSC (Thomas, 1980). RNA samples were prepared by a combination of procedures recommended by the manufacturers, Schleicher and, Schuell and Amersham. RNA samples were denatured in 50% Formamide and 4.6 M Formaldehyde (Baker) at 65°C for 5 minutes. The samples were chilled on ice, followed by the addition of 1 volume 2Ox SSPE. RNA was blotted onto the membrane, which was then air dried and UV irradiated for 3-5 minutes. 2.17.3 LARGE SCALE ISOLATION OF TOTAL RNA: VANADYL RIBQNUCLEOSIDE COMPLEX (VRC) METHOD RNA was prepared essentially as described in Kaufman and Sharp (1982). The RNA isolated was used for formaldehyde gel electrophoresis. For IE and E RNA, 3T3L1 cells were infected and harvested in PBS as described in Section 2.13.1. In the case of Late (L) RNA, 3T3L1 cells were infected at a MOI of 20-30 centrifugal pfu, and were harvested by scraping into PBS at 16 hr post infection. The RNA samples were treated with RNase-free DNase I as described in Section 2.16.1. 2.17.4 ELECTROPHORESIS AND TRANSFER OF RNA TO FILTERS Preparation of samples and electrophoresis procedure was as described in Ausubel et a l . (1987). Total RNA and RNA markers (BEL) were denatured with formaldehyde/50% formamide at 55°C for 15 minutes, and electrophoresed through a formaldehyde agarose gel in MOPS running buffer (0.2 M Morpholinopropanesulfonic acid, 50 mM sodium acetate, 1 mM EDTA pH 8.0). Integrity of the RNA was confirmed by the presence of discrete, non smeared 28S and 18S rRNA bands in the EtBr stained gel. Before the transfer, the -51- gel was washed in several rinses of water to remove the formaldehyde. The gel was soaked in 10X SSPE for 30 minutes, and transferred to Hybond-N (Amersham) in 20X SSPE overnight (Thomas, 1980). The f i l t e r was air dried, placed on a transilluminator and exposed to UV light (260 nm) for 3 to 5 minutes to fix the RNA. 2.17.5 PREPARATION OF RNA PROBES Radioactively labelled RNA probes were prepared by in vitro transcription of cDNA. The recombinant plasmid (1 ug), pGEM3Z (Pramega) was linearized and the cDNA was transcribed in a 20 ul reaction volume rantaining 10 mM DOT, 10 ug BSA, 20 units RNasin (Pramega), 5 mM ATP, 5 mM GTP, 5 mM OTP, 0.5 mM OTP, 2 u l [a- 3 2P] OTP (NEN; 10 mCi/ml), 10 units T7 RNA polymerase (BEL) and IX transcription buffer (supplied by BRL). The reaction mix was incubated at 37 °C for 1 hr. Following transcription the reaction was incubated with 10 units of RNase-free DNase I (Pramega) at 37 °C for 15 mins, extracted with phenol/chloroform, and the RNA was precipitated with 95% ethanol in the presence of carrier 10 ug yeast tRNA (BRL). 2.17.6 RNA-RNA HYBRIDIZATION Hybond N f i l t e r s (Amersham) from Northern blots were equilibrated in 5X SSPE . . . 32 for 30 mins followed by hybridization to [alpha- P] UTP labelled RNA probe in hybridization buffer [50% formamide (BRL), 5X SSPE, 1.0% SDS, 0.1% Tween 20 and 100 ug tRNA], at 43-45°C for 16 hr. The hybridized filters were washed as described in Section 2.12 except for the final wash, which was done at 57°C. -52- 2.17.7 ANALYSIS OF RNA BY PRIMER EXTENSION The primer extension procedure was carried out essentially as described in Sambrook et al. (1989). An 18-mer oligonucleotide (5'ATGTa3VGCCTG^ was synthesized by Mr. T. Atkinson (UBC). The oligonucleotide was labelled at the 5 • end using ^ -32P-ATP and T4 polynucleotide kinase (BEL). 5 Endlabelled primer (18-mer) (10 cpm) was annealed to 50 ug E RNA and extended using Moloney murine leukemia virus (M-MLV) reverse transcriptase (BEL). The extended products were electrophoresed through a 6% acrylamide gel as described in Section 2.18.6. 2.18 DNA SEQUENCE ANALYSIS OF E CDNA ElO The ElO fragment was subcloned into plasmid pGEM3Z (Pramega) in both orientations and deletion clones were prepared (Henikoff et al., 1984). Clones with overlapping regions were selected by digesting with EcoRl and sizing their plasmid DNA on agarose gels. Clones of both orientations were sequenced using the sequenase enzymatic sequencing procedure (United States Biochemical Corporation; USB). Overlapping sequences were compiled to give a f u l l length sequence of the ElO cDNA. The strategy for the ElO cDNA seqencing i s presented in Figure 30 (Section 3.4). 2.18.1 SUBCL0NIN6 OF DNA FRAGMENT IN pGEM3Z The cDNA fragment ElO was cloned into the EcoRl site of pGEM3Z. The plasmid was linearized with EcoRl (BEL), then ligated to ElO fragment in presence of T4 DNA ligase (BEL) in the ligation buffer provided by the manufacturer at 16°C for 16 hr. Transformation of E. coli strain JML09 was carried out as outlined in Section 2.18.3. -53- 2.18.2 PREPARATION OF FROZEN COMPETENT CET.TiB The method is based on that of Hanahan et al. (1983). E. coli strain JM109 was maintained on M9 minimal agar plates (Na2HP04 5 g/1, KH2P04 3 g/1, NH4C1 1 g/1, NaCl 0.5 g/1, 1 mM MgS04, 0.1 mM CaCl 2, 1 mM thiamine-HCl, 0.2% glucose, agar 1.5 g/1). A culture was prepared by inoculating 100 ml of SOB medium (Bactc-Tryptone 20 g/1, yeast extract 5 g/1, 0.5 g NaCl/1, 20 mM MgS04) with 1 ml of an overnight culture of JM109 in YT medium. Inoculated medium was shaken at 250 rpm until reached 0.6-0.7 (approximately 3.5 hr). The wavelength of 550 nm was used rather than 600 nm, since the sensitivity of measuring the absorbance increases as wavelength decreases (Hackett et al., 1984). The culture was chilled on ice, and centrifuged at 3,000 rpm in a Sorvall GSA rotor for 5 minutes at c 4°C. The pellet was resuspended in 30 ml of transformation medium [45 mM MnCl 2, 10 mM MgCl 2, 100 mM RbCl, 3 mM hexammine cobalt (III) chloride] and stored on ice for 15 minutes. Cells were recovered by centrifuging at 3,000 rpm in a Sorvall GSA rotor at 4°C and resuspended in 8 ml of fresh transformation medium. An aliquot of 280 ul DMSO was added to the medium and incubated on ice for 5 minutes. A second aliquot (280 ul) of DMSO was added and the ce l l suspension was divided into aliquots (210 ul/tube) which were quick frozen in a dry ice/ethanol bath and then stored at -70°C. Before transformation, cells were thawed and placed on ice for 10 minutes. 2.18.3 TRANSFORMATION OF JMI09 WITH pGEM3Z A maximum of 10 ul of each plasmid preparation was added to an aliquot of freshly thawed competent JM109 cells. Cells were left on ice for 15 minutes and then heat shocked at 42°C for 2 minutes. One ml of SOC medium (10 mM MgS04, 10 mM MgCl2, and 20 mM glucose in LB; BRL) was added and shaken gently for 1 hr. Transformed cells were selected by plating 10-100 ul on -54- 50 ug/ml ampicillin YT plates (8 g/1 Bac±o-JTryptone, 5 g/1 Bacto-yeast extract, 5 g/1 NaCl, 1.5 g/1 agar) with 50 u l X-gal/TPTG (BEL) for 6-galactosidase color selection. White colonies indicated transformants with recombinant plasmid and blue colonies indicated transformants with non recombinant plasmids. 2.18.4 CONSTRUCTION OF UNIDIRECTIONAL DELETION CLONES The method i s based on the procedure of Henikoff et a l . (1984). Approximately 15 ug of pGEM3Z containing the ElO insert (at the EcoRl site) were linearized with Sail to give a 5' overhang. The DNA was extracted with phenol/chloroform, precipitated with ethanol , washed in 70% ethanol and dried in a desiccator. The DNA was redissovled in appropriate buffer and digested with SphI to give a 3' overhang. This allows unidirectional digestion of ElO insert since exonuclease III (ExoIII) is specific only for the 5' overhang. The 3' overhang protects the remainder of the vector from the ExoIII attack. The dry DNA pellet was dissolved in ExoIII buffer (66 mM Tris-Cl pH 8.0, 0.66 mM MgCl2). The tube was warmed in a 37°C waterbath, then 500 units of ExoIII enzyme (Promega) were added, mixed rapidly and returned to the waterbath. Samples of 2.5 ul were removed at 30 seconds intervals for 10 minutes and added directly to 7.5 ul SI mix [40 mM potassium acetate pH 4.6, 333 mM NaCl, 1.3 mM ZnS04, 6.7% glycerol, 60 units SI (BEL)/200 ul] in a tube on ice. A l l SI samples were transferred to ET and incubated for 30 minutes. The SI enzyme was inactivated by adding 1 u l of SI stop buffer (0.3 M Tris base, 0.05 M EDTA pH 8.0) and heating to 70°C for 10 minutes. From each sample, 3 ul were digested with EcoRl and electrophoresed through a 1% agarose gel. The rate of digestion was approximately 300bp/minute. The SI treated samples were transferred to a 37°C water bath and 1 ul Klenow mix (20 mM Tris-Cl pH 8.0, 100 mM MgCl2, -55- 5 units Klenow/20 ul) was added, followed by addition of 1 ul dNTP mix (0.125 mM each of dATP, dTTP, dCTP and dGTP). Incubation was for 10 minutes at RT. Finally, 40 ul of ligase mix (50 mM Tris-Cl pH 7.6,10 mM MgCl2, 1 mM ATP, 5% PEG, 1 mM DOT, 5units T4 DNA ligase/ml) were added to each tube and ligation was allowed to proceed at 16°C for 16 hr. JM109 cells were transformed as described in Section 2.18.2. 2.18.5 DOUBLE STRANDED DNA SEQUENCING Sequencing of both strands of ElO insert were carried out by the dideoxy chain termination method. Plasmids were isolated using both small scale and large scale procedures (described under Section 2.5). DNA was denatured by boiling in 200 mM NaOH for 2 minutes. Three molar ammonium acetate (0.1 volume) was added and DNA was precipitated with ethanol. DNA sequencing reactions were performed using the Sequenase kit (USB; Cat # 70700). The SP6 promoter site in pGEM3Z was used as the priioing site. DNA was labelled with [a- 3 2P] dATP (NEN; 3000 Ci/mmole). For one of the orientations, isolation of overlapping clones to provide sequences in two places, each of approximately 50 bp, failed. Synthetic 17-mer oligonucleotides (51 CGCAOGAGTGTGTACrjra • and 5*GCICAGAGAGTAGTGAC31) complementary to the sequence preceding the gap were prepared by Mr. T. Atkinson, UBC (Applied Biosystems, model 380B), and used as primers to sequence the two regions. The 17-mer oligonucleotides were purified using a Sep-pak column (Millipore) according to the manufacturer's instructions. The oligonucleotide fraction was eluted in 20% acetonitrile (American Burdick and Jackson), dried in a speed-vac and suspended in sterile water. -56- 2.18.6 ACRYLAMIDE GEL ELECTROPHORESIS OF SEQUENCING REACTIONS The sequence reactions were electrophoresed through a 6% (29:1, acrylamide:bisacrylamide) acrylamide (Bio-Rad)/7 M Urea (BDH) gel, at 32 Watts/gel in TBE (50 mM Tris, 50 mM boric acid, 1 mM EDTA, pH 8.3) buffer. The gel was dried on f i l t e r paper (3MM Whatman) and exposed to XRP-1 (Agfa) film at RT for approximately 16 hours. 2.19 ISOLATION AND DNA SEQUENCING OF THE MISSING 3'TERMINUS OF E10 cDNA The 3 1 end of the E10 cDNA was found to lack an in frame stop codon, polyadenylation signal and poly A tract. The 3' terminus was obtained by amplification of E10 mRNA using PCR (polymerase chain reaction) or RACE (rapid amplification of cDNA ends) method as described in Frohman et al. (1988), with some modifications, and cloned into appropriate plasmids. The E10-A cDNA isolation and sequencing strategies are presented in Figures 31 and 32 (Section 3.4) respectively. 2.19.1 FIRST STRAND cDNA SYNTHESIS Total E RNA (10 ug) was denatured in the presence of methyl mercuric hydroxide at RT for 10 mins in a volume of 15 ul, followed by snap freezing on dry ice. To the frozen sample was added 35 ul of a solution to give a f i n a l concentration of 200 uM DOT, 40 units RNasin (Pramega), 200 uM dNTPs (dATP, dTTP, dGTP and dCTP), and 2 ug oligo d(T) 1 7 primer and 300 units Moloney murine leukemia virus (M-MLV) reverse transcriptase (BRL) per 50 u l . The 50 u l mix was incubated at 37°C for 1 hr, followed by dilution to 200 ul with water. -57- 2.19.2 AMPUTICaTION OF 3' TERMINUS OF ElO CDNA BY RACE OR PGR METHOD The amplification step was carried out using two primers: •1. oligo d(T) 1 7 with Sall/SphI sites (5 • CGAGCATGCtTKX̂ CÂ  ') ; 2. a 29-mer containing a Hindlll site (51 end) and 20 bases specific to a sequence that was 50 bases away from the 3' end of the incomplete ElO cDNA (51ACAAAC4CTTAGAAGCAGAC^ The PCR reaction was carried out in a Perkin Elmer Cetus DNA cycler in a total volume of 50 ul containing 2-5 ng ss cDNA (from Section 2.19.1), 67 mM Tris-Cl pH 8.5, 0.5 mM MgS04, 10 mM B-ME, 16.6 mM (NH4)2S04, 100 uM dNTPs (dATP, dTTP, dGTP and dCTP), 2 units of Taq DNA polymerase (Ampli Taq, BRL) and 20pmoles of each primer. The sample was subjected to 35 cycles of amplification with each cycle consisting of three steps: denaturation at 93°C for 10 sees; annealing at 53°C for 30 sees; and extension at 72°C for 60 sees. An aliquot of the RACE products was analysed by electrophoresis on an agarose gel. 2.19.3 CLONING CP THE 3' RACE PRODUCT The major RACE product (1. 4kb) was designated as E10-A. This fragment was digested with Hindlll and SphI, recovered from the gel and cloned into the Hindlll-SphI sites of pGEM4Z and pGEM3Z. Recombinant plasmids were transformed into E. coli DH5-a as described in Section 2.18. 2.19.4 DNA SEQUENCING OF E10-A cDNA The sequencing strategy for E10-A cDNA is presented in Figure 32 (Section 3.4). Restriction fragments Hindlll-Sall, Sall-Sall and Sall-SphI of E10-A cDNA were subcloned into pGEM4Z and pGEM3Z, and both strands of these inserts were sequenced with the dideoxy method as described in Section -58- 2.18. The junctions of these restricion sites in E10-A cDNA were sequenced with the aid of 17-mer specific primers. 2.20 HYBRID SELECTION BY E10 CDNA AND IN VITRO TRANSLATION OF RNA The hybridization, washing and elution procedures were carried out essentially as described by Kei l et a l . (1985). Filters (hybond N; Amersham) carrying 10 ug of linearized plasmid or 3 ug of E10 cDNA was hybridized to 5 ug of total cytoplasmic RNA in 100 ul hybridization buffer. The eluted RNA was translated in vitro in Rabbit tetiailocyte Lysate (Promega) according to the manufacturer's instructions in the presence of 35 . S-methionine (NEN) . The translation products were electrophoresed in either a linear 12% or 5-20% gradient SDS-polyacrylamide gel, essentially as described in Ausubel et al. (1987). The gels were fixed in 10% acetic acid 3 and 40% methanol, impregnated with En Hance (NEN) for fluorography, and exposed to XPP-1 film (Agfa) for various times. The standard molecular markers (BRL) used were as follows: 200 kd, myosin; 97.4 kd, phosphorylase; 68 kd, bovine serum albumin; 43 kd, ovalbumin. 29 kd, carbonic anhyrase. -59- 3.0 RESULTS AND DISCUSSION 3.1 CLONING AND CHARACTERIZATION OF IE AND E CDNAs RESULTS The purpose of this project was to reveal details on transcription from the major IE and especially major E transcription units. This task was made possible by preparing IE and E cDNAs, followed by characterization of these cDNAs and then utilizing a few cDNAs as probes to obtain new information on their respective transcription units. The aim of the work presented in this section (3.1) was to characterize the cDNAs by estimating their sizes and mapping them to specific regions (endonuclease restriction fragments) of the viral genome. 3.1.1 PREPARATION AND SCREENING FOR IE AND E CDNAs The IE and E cDNAs of Smith strain MCMV were prepared and cloned into Lambda gtlO at the EcoRl site as described in Materials and Methods. A total of 50 potential IE and 198 potential E clones were identified by the plaque l i f t method and hybridization to a MCMV DNA probe. Of these positive clones, nine IE and ten E clones were selected randomly and subjected to rescreening and characterization. 3.1.2 CHARACTERIZATION OF E cDNAs 3.1.2.1 SIZE ESTIMATION DNA from the 10 selected E ĉ NA-Lambda gtlO recombinants were subjected to EcoRl digestion and separated on an agarose gel along with Hindlll digested Lambda DNA fragments as molecular weight markers, Hindlll digested MCMV DNA (positive control) and EcoRl digested Lambda gtlO DNA (negative control). The gel was stained with ethidium bromide and viewed with a UV trans illuminator. DNA fragments were transferred to a membrane and -60- hybridized to MCMV DNA probe to confirm the origin of E cDNA clones (Figure 4). MCMV Hi n d l l l fragments (positive control) and a l l the E cDNAs hybridized to the MCMV probe, while lambda gtlO DNA (negative control) did not hybridize to MCMV DNA. None of the inserts gave more than one band and therefore none of the cDNAs had an internal EcoRl site. It is most likely that the internal EcoRl sites were not protected by the methylase during the cloning procedure. Table I summarizes the molecular weights of the 10 E cDNA inserts, which range from 1.15kb to 3.2kb. 3.1.2.2 MAPPING THE E CDNAs Unlike IE transcription, E transcription occurs in most regions of the genome (Marks et al., 1983; Keil et al., 1984). Due to the large size of the v i r a l genome, the mapping of the cDNAs to these regions became an elaborate procedure. The E cDNAs were mapped to specific restriction endonuclease fragments of the MCMV (Smith strain) genome either by the slot blot method or by the Southern blot method. METHOD 1: THE SLOT BLOT METHOD Only two of the ten E cDNAs, E2 and ElO were mapped by this method. DNAs from E cDNA-Iambda gtlO recombinants, Lambda gtlO (negative control), and MCMV were blotted onto the membrane and hybridized to various probes including MCMV total DNA (positive control) (Figure 5) and individually to Hindlll fragments I (Figure 6), J (Figure 7), K (not shown) and L (not shown) . None of the DNAs, except for MCMV, hybridized to Hindlll K or L fragments. The results of probing these blots with Hindlll I and J fragments, and MCMV DNA were as follows: 1. A l l cDNAs and MCMV DNA hybridized to MCMV DNA probe (Figure 5) 2. Lambda gtlO DNA did not hybridize to either the MCMV DNA or Hindlll -61- Figure 4: Southern blot analysis of E cDNAs. DNA (0.5 ug) from 10 selected E cDNA clones (as Lambda gtlO recombinants, E1-E10) were subjected to EcoRl digestion and separated on a 1.2% agarose gel along with 0.5 ug Lambda Hindlll DNA fragments as molecular weight markers, 0.5 ug/lane Smith Hindlll DNA fragments (positive control) and 0.5 ug Lambda gtlO EcoRl digested DNA (negative control). The DNA fragments were transferred to a membrane, hybridized to P-labelled Smith DNA probe and autoradiographed. The sizes of the inserts were estimated as described in 'Materials and Methods'. E c o Rl h l n d i III E l 12 E3 E4 E5 E6 E7 E8 E9 E10 AgtlO A A smith 1.2 % gal P R O B E : S m i t h D N A -62- TABLE I Summary of E cDNAs: insert sizes and hybridization properties with Hindlll, Xbal AND EcoRl fragments of Smith MCMV DNA. E cDNA CDNA SIZE HYBRIDIZATION TO SMITH DNA FRAGMENT GROUPS (kb) Hind III Xba I EcoR 1 GROUP 1 El 2.75 E 0,M,X/Y 0 E4 1.15 E M 0 GROUP 2 E8 1.5 E L - GROUP 3 E2 1.4 J — — E10 3.2 I,J — — GROUP 4 E3 2.3 B A L E5 1.6 B A L GROUP 5 E6 1.25 A E C GROUP 6 E7 1.30 F F/G R/S GROUP 7 E9 1.33 A R M Note: Restriction fragments correspond to those on the physical map of MCMV constructed by Ebeling et al . (1983) (see Figure 2). -63- Figure 5: Hybridization of E cDNAs to MCMV DNA. 2 ug, 1 ug and 0.5 ug of E cDNAs (as Lambda gtlO recombinants E1-E10), Lambda gt l O DNA, and 25 ng and 12.5 ng of MCMV (Smith) DNA were blotted on a membrane. The membrane was hybridized t o P-labelled t o t a l Smith MCMV DNA and autoradiographed f o r 16 hr. Lambda gtlO and MCMV (Smith) DNA served as negative and p o s i t i v e controls, respectively. DNA 2 u9 lug O.Sug Agf 10 2Sng 12.5ng PROBE : SMITH DNA -64- fragments I and J as shown in Figures 5,6 and 7 3. The E2 CDNA insert hybridized with the Hindlll J probe (Figure 7) and the ElO cDNA insert hybridized to both the Hindlll J fragment (Figure 7) and I fragment (Figure 6) In summary, the two E cDNA clones, E2 and ElO mapped to Hindlll J and adjacent I-J fragments of the MCMV genome respectively. Preliminary studies have shown that this region is heavily transcribed during the E phase (Marks et a l . , 1983; Keil et al., 1984), therefore E2 and ElO are perhaps important cDNAs. Since none of the cDNAs mapped to the Hindlll K-L region, none are of IE origin. METHOD 2 : THE SOUTHERN BLOT METHOD The Southern blot method was used to map 8 E cDNAs to specific regions of the genome. Samples of MCMV (Smith) DNA were digested to completion with Hindlll, Xbal or EcoRl and the fragments separated in a 0.7% agarose gel. The digested samples were loaded at Ohr and 48hr, and the gel was electrophoresed at low voltage (30 volts) for a total of 72 hr. The 72 hr separation was to separate the cluster of large (33.8 to 14.3 kbp) and moderate (8.1 to 7.0 kbp) sized bands so that each band could be individually recognized. Since smaller bands run off the gel in 72hr, the same samples were loaded after 48 hr in order to visualize hybridization to smaller fragments. The Southern blot was hybridized to a specific cDNA probe and autoradiographed. The probe was subsequently stripped off the membrane (see Materials and Method) and in some cases rehybridized to another cDNA probe before finally being hybridized to MCMV DNA probe to id e n t i f y the position of restriction fragments on the blot. The autoradiogram from the experiment with E cDNA probe was superimposed onto that from the experiment with the MCMV DNA probe and individual restriction -65- Figure 6: .Hybridization of El-10 cDNAs to the MCMV Hindlll I fragment. 250 ng and 125 ng of E cDNAs (as Lambda gtlO recombinants) were blotted onto a membrane, hybridized to the P-labelled MCMV Hindlll I probe and autoradiographed. 250 ng and 125 ng of Tambda gtlO, and 25 ng and 12.5 ng of MCMV (Smith) DNA were present on the blot as negative and positive controls, respectively. D N A E i E 2 E3 E 4 Es E* E7 E8 E9 ElO Agt IO smith 2S/12 .Sng 290ng 125ng Probe : h ind III I fragment -66- Figure 7:.Hybridization of El-10 cDNAs to the MCMV H i n d l l l J fragment. 250 ng and 125 ng of E cDNAs (as Lambda gtlO recombinants)^ and Lambda gtlO DNA were b l o t t e d onto a membrane, hybridized t o the P-labelled MCMV H i n d l l l J probe and autoradiographed. 12.5 ng of MCMV (Smith) DNA was also present on the s l o t b l o t as a p o s i t i v e control. 250ng 125ng DNA El E2 E3 E4 E5 E6 E7 E8 E9 E10 Agt 10 Smith 12.5 ng J probe HIND III Fragment -67- digest fragments hybridizing to specific cDNA probe were identified (Figures 8 through 20). A summary of the E cDNAs mapped by this procedure to specific H i n d l l l , Xbal and EcoRl fragments on the MCMV physical map is presented i n Figure 21. An important point to note is that the Hindlll H fragment of the Smith strain of MCMV used in our laboratory represents the Hindlll E fragment of MCMV in Ebeling et al. (1983) (unpublished data). The ten E cDNAs were assigned to seven groups with respect to their genomic location, as summarized in Table I. Preliminary studies have indicated that the transcription during the E phase occurs in most regions of the genome, although abundant transcription occurs in Hindlll fragments A, B, G, E, F, I and J. A l l of the seven groups map to one of these Hindlll fragments and therefore may represent the important class of E genes. -68- Figure 8: Mapping of El cDNA to Hindlll, Xbal and EcoRl fragments of MCMV DNA. MCMV (Smith) DNA samples were subjected to Hindlll (H), Xbal (X) and EcoRl (E) digestion, and the DNA fragments were separated on a 0.7% agarose gel and transferred to a membrane. The samples (250 ng DNA/well) were loaded at Ohr (total separation time 72 hr or 3 days) and at 48hr (total separation time 24 hr or 1 day). The f i r s t three lanes under 3d represent a three day run, and lanes 4, 5 and 6 under Id represent a one day run. The last two lanes are molecular weight markers [Lambda Hindlll fragments (250 ng/lane) separated for three days (3d) and one day (id) ]. The Southern blot was hybridized to El cDNA recombinant clone ( P-labelled) and autoradiographed for 16 hr. The E l cDNA probe was stripped off the blot and the blot was rehybridized to P-labelled MCMV (Smith) DNA probe to identify a l l the restr i c t i o n fragments (Figure 9). The Lambda Hindlll markers are visible in the autoradiogram because the fragments hybridize to the Lambda gtlO DNA in the E l cDNA recombinant clone. The sizes of the DNA fragments were estimated as described in 'Materials and Methods'. S M I T H D N A a I R U N : 3d 1d H I X H { x A DNA 3d 1d H H 9 probe : El D N A ( in Agt IO) -69- Figure 9 : Hybridization of H i n d l l l , Xbal and EcoRl fragments of MCMV (Smith) DNA with a labelled MCMV DNA probe. Detai ls of the separation are given^ln the Figure 8. The southern blot i n F igure 8 was stripped of the E l P-labelled probes and hybridized with P-labelled MCMV DNA to identify a l l H i n d l l l , Xbal and EcoRl fragments. • U N : 3 d S M I T H D N * X H 1 d A D N A 3 4 1 4 H H jj n • • • • • i 1 1 : • • , r o b « : f a i t h D N A - 7 0 - Figure 10: Mapping of cDNA E4 to Hindlll. Xbal and EcoRl fragments of MCMV (Smith) DNA. MCMV (Smith) DNA samples were digested with Hindlll (H), Xbal (X) and EcoRl (E) and separated on a 0.7% agarose gel and transferred to-^a membrane as described in Figure 8. The blot was hybridized f i r s t with P-labelled E4 DNA (this figure) and then stripped of the probe and reprobed with E6 DNA (Figure 11) and finally MCMV DNA (Figure 12). #2 S M I T H D N A R U N : 3d Id A D N A 3d id X H H H p r o b e : E 4 D N A ( in Af t 10 ) -71- F i g u r e 11: Mapping E6 cDNA t o H i n d l l l (H). Xbal (X) and EcoRl (E) fragments of MCMV (Smith) DNA. The b l o t from f i g u r e 10 was reprobed w i t h P-labelled E6 DNA. For Details see Figure 10. -72- F i g u r e 12: »yV^ization mnflTTT. XbaT and FcoRl fragments of MCMV CsnittO ^NA %aa - MSUfli B ^ l n ^ V . ^ l MCMV DNA For The b l o t from f i g u r e 10 was reprobed with P-labelled MCMV DNA. d e t a i l s see Figure 10. - 7 3 - Figure 13: Mapping of cDNA E7 to H i n d l l l , Xbal and EcoRl fragments of MCMV (Smith) DNA. MCMV (Smith) DNA samples were digested with H i n d l l l (H), Xbal (X) and EcoRl (E) and separated on a 0.7% agarose g e l and transferred t o a membrane as described i n Figure 8. The b l o t was hybridized f i r s t with P-labelled E7 DNA ( t h i s Figure) and then stripped of the probe and reprobed with E8 DNA (Figure 14) and f i n a l l y MCMV (Smith) DNA (Figure 15). -74- F i g u r e 14: Mapping of cDNA E8 t o H i n d l l l , Xbal and EcoRl fragments of MCMV (Smith) DNA. 3 2 The b l o t from f i g u r e 13 was reprobed w i t h P-labelled E8 DNA. For d e t a i l s see Figure 13. P R O B E : E8 F i g u r e 15: H y b r i d i z a t i o n of H i n d l l l . Xbal and EcoRl fragments of MCMV (Smith) DNA with a l a b e l l e d MCMV DNA probe. The b l o t from f i g u r e 13 was reprobed with P-labelled MCMV DNA. For d e t a i l s see Figure 13. PROBE : S M I T H - 7 6 - F i g u r e 16: Mapping of cDNA E9 t o H i n d l l l . Xbal and EcoRl fragments of MCMV (Smith) DNA. MCMV (Smith) DNA samples were digested with H i n d l l l (H), Xbal (X) and EcoRl (E) and separated on a 0.7% agarose ge l and transferred tCL-a membrane as described i n Figure 8. The b l o t was hybridized f i r s t with P-labelled E9 DNA ( t h i s Figure) and then stripped of the probe and reprobed with MCMV DNA (Figure 17). #4 S M I T H * R U N ; 3 d 1d 3d 1d -77- n t s _ o f _ J O ^ fe^lSTfrom figure details see figure 16. P R O B E : SMITH - 7 8 - Figure 18: Mapping of cDNA E3 to Hindlll. Xbal and EcoRl fragments of MCMV (Smith) DNA. MCMV DNA samples were digested with Hindlll (H), Xbal (X) and EcoRl (E) and separated on a 0.7% agarose gel and transferred to„a membrane as described i n Figure 8. The blot was hybridized f i r s t with P-labelled E3 DNA (this Figure) and then stripped of the probe and reprobed with E5 DNA (Figure 19) and finally MCMV DNA (Figure 20). Figure 19: Mapping of cDNA E5 t o H i n d l l l , Xbal and EcoRl fragments of MCMV (Smith) DNA. 3 2 The b l o t from f i g u r e 18 was reprobed w i t h P-labelled E5 DNA. For d e t a i l s see Figure 18. S M I T H A R U N : 3d I d 3 d E S P R O B E - 8 0 - F i g u r e 20: H y b r i d i z a t i o n of H i n d l l l . Xbal and EcoRl fragments of MCMV (Smith) DNA with a l a b e l l e d MCMV DNA probe. The b l o t from f i g u r e 18 was reprobed with P-labelled MCMV DNA. For d e t a i l s see Figure 18. #5 RUN H 3d E SMITH I d E 3d I d H H S M I T H P R O B E -81- Figure 21: Summary of mapping studies of El-10 cDNAs on the Smith s t r a i n MCMV genome. Locations of E cDNAs are assigned to the MCMV physical map. The horizontal bars represent the regions assigned t o each cDNA clone. The r e s t r i c t i o n fragment map was o r i g i n a l l y constructed and presented i n Ebeling et a l . , (1983). E10 E9 E6 E3.E5 E7 E2 E1.E4 E8 N i A e M M 0 C K L ) i ' 4 3 E l S 3 R £ K p A 0 B C 0 J r /C H n 0 1. * , * . » G M 1 C 0 I f N e K, 0,0,d P A M i R I I £ V S 3 0.2.6.1.9 F 3.1.3 CHARACTERIZATION OF IE CDNAs The IE cDNAs were characterized by estimating their sizes and their hybridization properties to Hindlll K-L region, the major IE region. 3.1.3.1 SIZE ESTIMATION The insert sizes of the MCMV IE cDNAs were estimated by electrophoresing the EcoRl digested recombinant phage DNAs on an agarose gel, along with Hindlll digested MCMV DNA, EcoRl digested Lambda gtlO DNA and Hindlll digested lambda DNA fragments as molecular weight markers. The DNA fragments were transferred to a membrane and hybridized to MCMV DNA to confirm that the DNA fragments were of viral origin. Figure 22 shows that the MCMV (Smith) DNA probe hybridized to MCMV (Smith) Hindlll fragments (positive control) and some of the IE cDNAs, but not to Lambda gtlO (negative control). Four of the nine IE cDNAs (IEa, IEb, IEh and IEi) did not contain a band hybridizing with MCMV DNA in this exposure however, examination of the ethidium bromide stained gel suggested this was likely due to insufficent DNA on the gel. Of these four, one cDNA insert (IEh) was visible on a longer exposure of the autoradiogram (not shown). Furthermore, evidence presented below (Figure 24) indicates that the IEi clone must also contain a cDNA sequence originating from MCMV sequences. Molecular weights of five of the IE cDNA inserts ranged from l.lOkb to 1.60kb (Figure 22 and Table III). A l l the inserts in the autoradiogram gave only one band. Hence there are no internal EcoRl sites in these cDNAs and again i t i s likely that the methylation reaction to protect internal EcoRl sites during the cloning procedures was ineffective. - 8 3 - Figure 22: Southern blot analysis of IE cDNA inserts. DNA (0.5ug) of lambda gtlO-IE cDNA recombinants were subjected to EcoRl digestion and separated on 1.2% agarose gel along with 250ng MOW (Smith) Hindlll DNA fragments as positive control, 0.5ug Lambda gtlO DNA digested with EcoRl as negative control and 250ng Lambda Hindlll fragments as molecular weight markera. The DNA fragments were transferred to a membrane and h y b r i d i z e d t o P - l a b e l l e d MCMV (Smith) DNA probe and autoradiographed. E c o Rl h ind III h i n d III ICQ l i b mc ltd l i e Iff K g i t h it i Agtio A A S M I T H k b ! 1.2 % g . l S m i t h D N A p r o b e - 8 4 - TABLE II Summary of sizes of IE cDNA inserts and hybridization properties with the Hindlll K and L fragments of MCMV (Smith) genome. IE cDNAs MOLECULAR WEIGHT (kb) SMITH HIND III DNA FRAGMENTS K L IEa - - - IEb - - - IEc 1.32 + + IEd 1.60 + +++ IEe 1.40 - - IEf 1.60 ++ - IEg 1.10 - (+++) IEh 1.60 - (++) IEi — - ++ The relative intensities of hybridization are indicated by +, weak; ++, moderate; +++, strong. In two cases (IEh and IEg) the intensities of hybridization symbols are bracketed [(++) and (+++)] because later studies (Figure 24) indicated that these cDNAs are likely cellular in origin. - 8 5 - 3.1.3.2 MAPPING THE IE CDNAs To identify same of the IE cDNAs, the clones were rescreened with MCMV Hindlll K and L probes since these fragments contain the major IE region (Keil et al., 1984). DNA from the nine IE cDNA-Lambda gtlO recombinants, MCMV DNA (positive control) and Lambda gtlO DNA (negative control) were blotted onto a membrane and hybridized to the Hindlll K and L probes (Figures 23 and 24, respectively). The results showed that Lambda gtlO did not hybridize to either K or L Hindlll probes, while MCMV DNA hybridized to both K and L Hindlll probes. Three clones (IEc, IEd and IEf) hybridized to the Hindlll K probe; the IEf clone gave the strongest signal (Figure 23). The weak bands in the IEe slots were disregarded as the level of hybridization was extremely low and of equal intensity in both 250ng and 125ng columns. Five clones (IEc, IEd, IEg, IEh and IEi) hybridized with the Hindlll L probe. In this case the strongest signal was observed with the IEd clone. Of the nine clones, two (IEc and IEd) hybridized to both the H i n d l l l L and K probes. Table II summarizes the sizes of the IE cDNA inserts and hybridization properties with respect to MCMV Hindlll K and L restriction fragments. The IE clones (IEa, IEb and IEe), which did not hybridize to either Hindlll K or L, may belong to IE regions other than the major IE region. -86- Figure 23: Slot blot analysis of IE cDNA clones hybridized with the MCMV Hindlll K probe. 250 and 125ng IE cDNAs (as Lambda gtlO recombinant DNAs) and Lambda gtlO (negative control), and 25ng and 12.5ng of MCMV (Smith) DNÂ  (positive control) were blotted onto a membrane and hybridized to the P-labelled Hindlll K DNA probe. smith 250/12.5 probe: h i n d l l l K fragment Figure 24: Slot blot analysis of IE cDNA clones hybridized with the MCMV Hindlll L probe. 250 and 125ng of IE cDNAs (as Lambda gtlO recombinant DNAs) and Lambda gtlO (negative control), and 25ng and 12.5ng of MCMV (Smith) DNA (positive control) were blotted onto a membrane. The blot was hybridized to P-labelled Hindlll L DNA probe. 2 5 0 n g 1 2 5 ng IEa l ib IIC w d •if 119 i i h Hi Agt K> smith 2 5 / 1 2 5 n g p r o b « ; h ind 111 * * * * * * * - 8 8 - DISCUSSION This study has established two MCMV cDNA libraries from infected cells, one for IE mRNAs and one for E mRNAs. Prior to this study, a cDNA library for MCMV had not been prepared. In this section of the study, the cDNAs were isolated and characterized in order to be utilized (in later sections of the project) as probes to obtain new information on transcription of their corresponding unit in detail. From a total of 198 E cDNA clones isolated, 10 were mapped in detail and categorized into seven groups based on their physical location within the MCMV genome. The results are summarized in Table I and Figure 21. Although the E transcripts of HCMV and MCMV originate from most regions of the genomes, the major E transcripts map to a few distinct regions of the genomes (Demarchi, 1981; Wanthen et al., 1981; Wanthen and Stinski, 1982; McDonough and Spector, 1983; Marks et al, 1983; Keil et al., 1984; Chang et al., 1988). For MCMV, these major E phase transcripts map to the Hindlll fragments A, B, G, F, K, J, I, E and N (Marks et a l . , 1983; Keil et al., 1984). This study shows that a l l seven groups mapped within these major E regions: groups 1 and 2 mapped within the Hindlll E region; group 3 mapped within the Hindlll I-J region; group 4 mapped within the Hindlll B region; groups 5 and 7 mapped within the Hindlll A region; and group 6 mapped within the Hindlll F region. Although the Hindlll K region is a major region of transcription during the E phase, curiously none of the seven groups in this study mapped to the Hindlll K or L fragments, the major IE region. Also, none of the seven groups mapped to the Hindlll H-D region, which has been shown to be transcribed at a low level during the E phase (Marks et al., 1983; Keil et al., 1984). These results help to confirm that some of the major E transcription units are confined to previously identified Hindlll fragments A, B, G, E, F and I-J, -89- since cDNA clones that were readily isolated mapped to these regions. In this study nine of the 50 IE cDNA clones were analyzed further and six (IEc, IEd, IEe, IEf IEg and IEh) were found to hybridize with the Hindlll K and L fragments (Table II and Figures 23 and 24). However, two of the clones, IEg and IEh were shown by RNA slot blot analysis, presented in a later Section (3.2), to occur at similar levels during a l l times of an infection cycle and to hybridize poorly with MCMV DNA (Figure 26). Hence the transcripts corresponding to these cDNAs are cellular in origin. Previous studies have shown that the major IE region for herpesviruses is limited to a small region of the genome. This major IE region in the MCMV Smith genome maps within the two adjacent fragments, Hindlll K and L, and is divided into three transcription units (iel, ie2 and ie3) (Keil et al., 1984) . The major IE region has been studied in great depth by the above group and the literature on the IE expression i s presented i n the •Introduction'. The IEc and IEd clones (insert size of 1.32 and 1.15kb, respectively) mapped to both fragments K and L and the cDNA IEf (insert size approximately 1.6kb) mapped to fragment Hindlll K only; therefore, these three cDNAs may be incomplete cDNAs corresponding to i e l or ie3 genes, or one of the 2.75 and 1.0-5.1 kb transcripts which are encoded by i e l and ie3 respectively, within the Hindlll K and L region (Keil et al., 1984) (see Figure 3b for more details). The i e l gene product has been shown to transactivate both viral and cellular promoters (Keil et al., 1987), and the i e l and ie3 gene products have been shown to function together as co-transactivators of an E MCMV (el) promoter (Buhler et al., 1990). -90- The IEe cDNA did not hybridize to either fragment Hindlll K or L. It is possible that the cDNA was derived from an IE gene other than those present in the major IE region (Hindlll K-L region) since low level of IE transcription has been reported in Hindlll fragment D and the genome termini (Hindlll E and N) (Marks et al., 1983; Keil et al., 1984). In addition, 10 IE proteins have been identified in our laboratory (Walker and Hudson, 1987a), of which only a few can be accounted for in the major IE region, while others may represent the minor IE regions (Hindlll D, E and N). Two other IE cDNA clones (IEa and IEb) failed to hybridize with the Hindlll K-L region. These clones may also be derived from IE genes other than those located in the major IE region. The last clone, IEi, did hybridize to the Hindlll L fragment and not to Hi n d l l l K, therefore i t may represent the ie2 gene transcript that i s encoded entirely within the Hindlll L fragment. Recently, preliininary studies have shown that the ie2 gene is essential for latency in mouse spleen cells (Mocarski et al., 1990). Therefore, this clone (IEi) may serve as a valuable probe to investigate the expression of the ie2 gene in acute and latently infected cells. In conclusion, the IE cDNA clones isolated appear to represent the IE genes of both the characterized major (Hindlll K and L) and the uncharacterized minor regions. The E cDNAs that were isolated and characterized in this study were those that belonged to the known major E transcription regions, Hindlll A, B, E, F and I-J. -91- 3.2 TRANSCRIPT LEVELS PROBED WITH E AND IE cDNA CLONES DURING THE VIRAL REPLICATION CYCLE RESULTS Five E and four IE cDNAs that were characterized in the previous section (3.1) were selected as probes to investigate transcript levels from respective transcription units during a course of permissive infection. Each of the selected five E cDNAs, El, E3, E6, E7 and E10, map to a different genomic location and represent the known actively transcribed E regions, H i n d l l l E, B, A, F and I-J respectively. The four IE cDNAs selected and used in this analysis were those that mapped to the major IE region, Hindlll K-L. Although the regions of IE and E transcription have been mapped, the expression pattern of individual transcription units during a course of infection had never been determined. Such a study also allowed further characterization and to confirm the viral origin of the cDNAs (as will be demonstrated below). RNA was isolated at various times during the course of an infection of 3T3L1 c e l l s with MCMV (Smith) and blotted onto a membrane. RNA-DNA hybridizations were performed to determine the relative levels of transcripts ccimplementary to the respective cDNA (DNA isolated from IE and E Lambda gtlO-cDNA recombinants). As controls, MCMV DNA and RNA from mock infected cells were also blotted onto the membrane. The autoradiograms of two experiments are presented in Figures 25 and 26 and the results are summarized in Table III. As expected, the 3T3L1 (cellular) DNA probe hybridized to RNA of a l l time intervals during and before (mock) the infection at approximately equal intensities (Figures 25 and 26). Another significant observation was that the 3T3L1 DNA probe hybridized to MCMV (Smith) DNA. This result has been previously noted in our laboratory and may be due to hybridization between -92- Figure 25: Use of cDNAs as probes to monitor transcript levels durim the MCMV replication cycle. RNAs were isolated at different time points [0 (mock infected), 1 through 8, 11 and 14 hr p.i.] during MCMV infection of 3T3L1 cells by means of the LiCl method (Materials and Method). The RNAs were blotted onto a membrane (3 ug/slot), hybridized to P-labelled 3T3L1 DNA (positive control), Lambda gtlO DNA (negative control), MCMV (Smith) DNA and cDNAs, IEh, IEg and E10. As controls, mock infected RNA (0 hr) and 25 ng of MCMV DNA (S) were also present on each blot. - 9 3 - Figure 26: Use of cDNAs as probes to monitor transcript levels during the MCMV replication cycle. T/he slot blot analysis was carried out as described in Figure 25. The P-labelled probes used were 3T3L1 DNA (positive control), MCMV (Smith) DNA (positive control), cDNAs El, E3, E6, E7, ELO, IEd, IEf, IEg, IEh and Lambda gtlO (negative control). As controls, mock infected RNA (0 hr) and 25 ng of MCMV DNA (S) were also present on each blot. - 9 4 - TABLE III ANALYSIS OF TRANSCRIPT LEVELS PROBED WITH IE AND E cDNA CLONES PROBES MOCK 0 1 2 3 HOURS 4 5 6 7 8 11 14 Smith 3T3L1 +++ +++ +++ +++ +++ +++ +++ +++ +++ +++ + Lambda gtlO MCMV (Smith) + + ++ -H-f +++ ++ ++ +++ +++ +++ +++ ++++ IEd - - + +++ +++ +++ + + - - + +++ IEf 1 1 1 1 1 ++ + ± + + • 1 1 1 1 1 1 1 t I T T T 1 1 1 1 1 1 1 IEg - ^ + + + + + + + + + + + + + + + + 4 + + + + IEh + + + + + H - + + + + + + 4 + + + + + + + + + + El + + + + 1 1 1 1 1 1 1 1 1 1 1 T T T T 1 1 1 1 1 1 1 E3 + I I I I I 1 1 1 1 1 | + + I I I I T T 1 1 1 1 1 1 1 T T 1 1 1 1 E6 + + + + + ++ + + + + + +++ E7 + + - -H- +++ ++ -H- ++ + + +++ ElO - - + +++ ++ ++ ++ ++-1- -4-H h ++ +++ The intensity of hybridization (Figure 25 and 26) was determined visually and is indicated by +, low; ++, moderate; +++, strong; and m m , very strong. The hybridization pattern for clones IEg and IEh indicate these cDNAs are cellular in origin. -95- GC rich regions of the DNAs. The MCMV DNA probe hybridized to RNA in mock infected and 1 hr p . i . samples to same extent. This likely indicates binding to cellular RNAs present in the samples. The hybridization signal with MCMV DNA probe increased significantly from 2 hr p.i. onwards. As a positive control the MCMV DNA probe hybridized to MCMV DNA on each blot. The Lambda gt 10 DNA probe did not hybridize to any RNAs or MCMV DNA. ANALYSIS WITH E CDNA PROBES: Five E cDNAs representing transcripts from the known major E regions (Hindlll B, A, F, E and J) were selected for the analysis (Marks et al., 1983; Ke i l et a l . , 1984). The E l probe (Figure 26) f i r s t detected transcripts 5 hr p.i. The level increased gradually at each subsequent time point reaching a maximum at 14 hr p.i. (last time point). Transcripts complementary to the E3 probe (Figure 26) were detected at 3 hr p.i. These RNAs peaked at 5hr p.i. and subsequently decreased but were detectable up to 14 hr p.i. (last time point). The E6 probe (Figure 26) detected RNAs at 4 hr p . i . The transcript level peaked at 5 hr p.i. and remained steady at 6-8, 11 and 14 hr p.i. The E7 probe (Figure 26) hybridized to transcripts at 3 hr p . i . The signal increased to a peak level at 5 hr p.i. and decreased from 6 to 8 hr p.i. The transcripts were present at 11 and 14 hr p.i., but at s t i l l lower levels than at 6-8 hr. The E10 probe (Figure 25) detected transcripts i n i t i a l l y at 3 hr p.i. There was an apparent drop in the level of transcripts at 5-7 hr p.i. and then an increase again with peak expression at 8-11 hr p.i. Transcripts were present at 14 hr p.i., but at a lower level than at 8-11 hr p.i. In a second experiment with the E10 probe (Figure 26) quantitatively similar results were obtained although the background of this blot is higher. This -96- clone, E10, maps to a heavily transcribed E region, Hindlll I-J (Marks et a l . , 1983; Keil et al., 1984), and therefore, was most extensively studied in the latter part of this thesis. ANALYSIS WITH IE cDNA PROBES The IEd probe began to detect transcripts at 2 hr p.i. (Figure 26). The transcript level peaked between 3 and 5 hr p.i. and dropped significantly at 7, 8 and 11 hr p.i. However i t increased again at 14 hr p.i. The IEd probe detected RNAs that display the IE pattern of expression. The IEf cDNA probe (Figure 26) began to detect transcripts at 2 hr p.i . The transcript level peaked at 3 hr p.i. and decreased significantly at 6, 7 and 8 hr p.i. The transcripts increased again at 14 hr p.i. The RNAs detected by this cDNA probe also displayed the typical pattern of IE transcription. The IEg and IEh probes (Figure 25 and 26) detected transcripts at a l l stages of infection, at approximately a constant level. In addition, the probes hybridized poorly to Smith MCMV DNA (positive control). Consequently the results obtained from the use of both IEg and IEh as probes, has confirmed that the transcripts of these cDNAs are almost certainly of cellular origin. An important point to note is that these experiments were conducted with higher stringency washes (0.1X SSPE, 0.1% SDS at 55°C instead of 50°C) than the previous experiments in which the IE cDNA phage clones were characterized. This suggests nonspecific binding of IEg and IEh cDNAs to MCMV DNA during previous experiments. However, in light of these results i t would appear that the stringency of the washes should have included 0.1X SSPE, 0.1% SDS at atleast 65°C. The IEi probe was not analyzed in these RNA slot blot studies. -97- Mock infected RNA samples were isolated at 0 hr or before infection, and were used as negative controls. In a l l cases in which the cDNAs were of v i r a l origin, hybridization to the RNA sample from infected cells (0 hr) was very low or not detectable. In two cases (IEg and IEh) the level of hybridization was high and as discussed above, i t was concluded that the transcripts of these cDNAs were cellular in origin. In Figure 25 and 26 the mock infected RNA (0 hr) hybridized at low levels to the MCMV DNA probe indicating nonspecific or specific binding of cellular RNAs to MCMV DNA. The Mock infected RNAs did not hybridize to the Lambda gtlO DNA probe. SUMMARY A summary of results is presented in Table III. 1. E cDNAs: A l l the E cDNAs in these experiments detected transcript levels exhibiting the typical pattern for E genes. The observations confirmed their viral origin and expression during the E phase. 2. IE cDNAs; The patterns of transcript levels detected by IEd and IEf cDNAs confirms their viral origin and expression during the IE phase. Conversely, IEg and IEh were shown to be of cellular origin. 3. Binding of Smith DNA to 3T3L1 DNA: The hybridization experiments confirmed that there is some hybridization of MCMV DNA to cellular probes. These observations have been noted in previous studies in our laboratory (unpublished data). However, the exact location of the binding is unknown. - 9 8 - DISCUSSION By the method of hybridization of RNA to a defined cDNA-probe, this study shows that i t i s possible to study the expression of an individual transcriptional unit. At the start of this project, E genes of MCMV had not been studied as extensively as the E genes of other herpesviruses. As stated earliar in the 'Rationale and Objectives' (Section 1.8), the E genes of herpesviruses are important because they are usually responsible for v i r a l gene expression, DNA synthesis and pathogenesis. Many of the E MCMV proteins have demonstrated a f f i n i t y for denatured DNA-cellulose and therefore are considered to be DNA binding (Walker and Hudson, 1987a). Same E gene products have been shown i n preliminary studies to regulate pathogenesis (Val et al., 1990; Mocarski et al., 1989). For more details, see 'Rationale and Objectives' (Section 1.8). Furthermore, MCMV genes responsible for latency and reactivation have not been determined; the possible role of E genes in these events including pathogensis, viral gene expression and DNA synthesis need to be elucidated. The availability of the E cDNAs facilitated the study of their corresponding genes individually to provide insight into their expression during the replication cycle. Five E cDNAs, El, E3, E6, E7 and E10, each mapping to a different and major E genomic region were included in this study. These E cDNAs detected transcript levels that a l l displayed a typical temporal pattern of E transcription (Figure 26). The cDNAs detected transcripts that began to appear during the E phase (3 to 6 hr p.i.) and the levels of these transcripts also fluctuated with time, confirming the viral origin of these cDNAs from the E phase of the replication cycle. During the later phase of the replication cycle, transcription from most regions of the MCMV Smith genome occurs and this accounts for the detection of trancripts at 14 hr -99- p.i. by a l l five E cDNAs. I t i s important to note that in HCMV, some of the genes that are transcriptionally active at E times are also active at L times, and may code for L proteins (reviewed in Griffiths and Grundy, 1987). This delayed translation appears to be controlled post-transcriptionally by processes such as transcript transportation to the cytoplasm, transcript stability in the cytoplasm and transcript association with ribosames. Therefore, mere detection of a transcript during both times E and L may not necessarily indicate that i t codes for an E protein, and this may also apply to MCMV. The transcripts that hybridize to the E cDNAs in this study are present at both E and L times. By analogy to HCMV, these transcripts may be translated at both times (E and L) or at either E or L times. To elucidate these p o s s i b i l i t i e s , further studies are required which would include the investigation of the individual MCMV E and L transcripts associated with the ribosomes. Using IE cDNAs as probes, the study demonstrates the expression of the major IE genes at the level of transcription during the course of an infection. Only four of the nine IE cDNA clones were used to monitor transcript levels during the MCMV replication cycle. Two of these clones, IEd and IEf, originating from the major IE region (Hindlll K-L and K fragments respectively) detected different groups of transcripts, as the levels of expression, although similar, showed slightly different patterns (Figure 26). In both cases there was a decrease in transcript levels during the E phase (5-11 hr p.i.). The transcripts were also detected at 14 hr p.i. These observations are analogous to those seen in previous studies (Marks et a l . , 1983; Keil et al., 1984). Although the Hindlll K region is expressed -100- during the E phase, there is an overall tenfold decrease in transcription from the major IE region (Hindlll K and L) (Marks et al., 1983; Keil et al., 1984) . During the late phase, transcription occurs from most regions including Hindlll K and L fragments of the MCMV genome, although the Hindlll K is one of the major regions transcribed. This explains the presence of transcripts from the respective regions at 14 hr p.i., particularly in the case of IEf (Hindlll K) where the transcript level is very high. The other two IE cDNA clones studied, IEg and IEh are likely cellular in origin. Two IE and five E cDNAs clones were capable of identifying levels of specific viral transcripts characteristic of IE and E gene expression during the course of permissive infection. These experiments provided a conclusive test to prove the origins of the cDNAs, and have also shown variation in MCMV transcription with time, indicating temporal and Quantitative regulation, as described by other investigators (Misra et al., 1978; Marks et a l . , 1983; Keil et al., 1984). The weakness of such a study is the in a b i l i t y to monitor levels of individual transcripts in the case of multiple transcripts originating from the same region. As shown in the Northern blot analysis in the next section (3.3), a l l five E cDNAs hybridize to more than one transcript and some show di f f e r e n t i a l expression, therefore, the slot blot analysis method in such cases would only indicate the presence of transcripts from their respective regions. The exact gene products associated with the establishment of latency in herpesviruses have not been defined. However, many investigators have reported detection of herpesviral transcripts in latently infected tissues (reviewed in Stevens, 1990). Schrier et al . (1985) and Galloway et al (1979, 1982) have reported detection of HCMV major IE mRNAs in peripheral -101- blood mononuclear cells and HSV mRNAs in human ganglia, respectively by hybridization techniques. Studies by Stevens (1990) have shown the presence of the unique HSV transcript, LAT (latency associated transcript), in latently infected murine neurons by in-situ hybridization. Therefore, the cDNAs may be useful as probes i n similar studies to investigate the expression of different viral genes in latently and nonpermissively infected c e l l s . The levels of transcripts present in these persistent infections may be compared to permissive infections to help identify the block in replication at the level of transcription. The significance of these observations may help reveal the criti c a l role of individual gene(s) in latently and nonpermissively infected cells, although appropriate latency models and nonpermissive ce l l lines will need to be established in the laboratory prior to the application of the cDNA as probes. In conclusion, a l l five E cDNAs of the major E regions detected typical transcription patterns and were also confirmed to be viral in origin. Of the four IE cDNAs used for the study, two (IEd and IEf) cDNAs of the major IE (iel-ie3) region detected typical IE transcription patterns, although each detected a group of different transcripts. The transcripts of other two IE cDNAs (IEg and IEh) were shown to be cellular in origin. Therefore, the five E cDNAs and two IE (IEd and IEf) could serve as valuable probes in the future to investigate the expression of corresponding transcription units in different infection systems (permissive, latent, reactivated and nonpermissive infections). -102- 3.3 ANALYSIS OF INDIVIDUAL TRANSCRIPTS MAPPING TO THE CORRESPONDING REGIONS OF El, E3, E6, E7 AND ElO CDNAs RESULTS The aim of the study in this section (3.3) was to further investigate the five major E transcription units studied in the previous section. This investigation revealed the numbers and sizes of the transcripts, and temporal expression of individual RNA from the five actively transcribed E units of the Hi n d l l l fragments A, B, E, F and I-J. This task was accomplished by using the five E cDNAs (El, E3, E6, E7 and ElO) as specific probes in Northern blot analyses. The information that was obtained from this study provided additional insight into the transcription of the major E regions of the MCMV genome. 3.3.1 TRANSCRIPTS PROBED WITH EARLY CDNAs: El, E3, E6, E7 AND ElO In order to examine the size, level and expression pattern of individual E transcripts, total cytoplasmic RNAs were isolated from mock infected 3T3L1 c e l l s , and MCMV infected cells at IE, E and L phases of the replication cycle. The RNA isolation time point for IE was 4 hr p . i . with a cycloheximide block at 2 hr prior to infection, for E was 7 hr p.i. with a cycloheximide block at 4hr p . i . , and for L was 16 hr p.i. without a cycloheximide block. Cycloheximide inhibits protein synthesis and therefore blocks progression into the next phase. For details, see 'Materials and Methods* (Sections 2.14.1 and 2.17.1). RNAs (lOug) were separated by gel electrophoresis (Materials and Methods), and transferred to a membrane, hybridized to E cDNA probe and autoradiographed. The E cDNAs selected for analysis were the same as those described in the previous Section (3.2). The quality of the total RNA was ensured by the presence of cellular rRNAs -103- Figure 27: Northern blot analysis of transcripts from MCMV infected 3T3L1 cells probed with El. E3. E6 and E7 cDNAs Total cytoplasmic RNA was isolated from mock infected 3T3L1 cells (C), IE, E and L (16hr p.i.) phases of MCMV re p l i c a t i o n using the vanadyl ribonucleoside complex method (Materials and Methods). RNA (10 ug/well) was electrophoresed through a 1%_denaturing formaldehyde gel, transferred to a membrane and hybridized to P-labelled E cDNAs: El, E3, E6 and E7. The sizes of the transcripts were estimated by the presence of RNA markers (BEL; 9.5 to 0.24kb) in the gel. -104- Figure 28: Northern blot analysis of transcripts which hybridized to ElO cDNA. Northern blot analysis was carried out as in Figure 27. The blot was hybridized to P-labelled ElO cDNA. ElO C IE E kb 4 9.5 •46.9 44.7 •4 2.1 -105- (18S and 28S) as discrete, non smeared bands in the duplicate portion of the gel which was stained with ethidium bromide. The E cDNAs hybridized to transcripts that began to appear during the E phase, and a l l E cDNAs hybridized to more than one transcript (Figure 27 and 28). Some of these transcripts were also detected during the late phase, usually at a different level. These results showed that the El cDNA (Figure 27) detected three transcripts of sizes 2.8, 1.4 and 1.2kb that are present during the E phase. The 1.4kb transcript is by far the predominant RNA species. Both the 2.8 and 1.4kb transcripts are present at extremely low levels during the L phase and are absent during the IE phase. The E3 cDNA (Figure 27) detected three transcripts of sizes: 3.5, 3.0 and 2.0kb that are present at low levels during the E phase and absent during the IE phase. Of the three, the 3.5kb RNA appeared to accumulate and is present during the L phase, at a much higher level than during the E phase. The E6 cDNA (Figure 27) detected four transcripts of sizes 5.6, 3.0, 1.8 and 1.5kb that are present during the E phase. These transcripts are absent during the IE phase. Of the four RNAs, only two (5.6kb and 3.0kb) are present during the L phase, but at a lower level. The E7 cDNA (Figure 27) detected one predominant transcript of size 2.0 kb and a minor species at 2.1 kb. These transcripts are absent during the IE phase and present at a very high level during the E phase, while the levels are greatly reduced during the L phase. The E10 cDNA (Figure 28) is the clone that was analyzed most extensively in this study because i t mapped to the major E transcription region, Hindlll I-J (Marks et a l . , 1983; Keil et al., 1984). This cDNA detected four transcripts of sizes 9.5, 6.9, 4.7 and 2.1kb that are present only during -106- the E and L phases. The major transcript that is present during the early phase is the 4.7kb species. During the L phase, the 9.5, 6.9 and 4.7kb transcripts decrease in amount, in contrast to the 2.1xb transcript, which remains at approximately the same level as in the E phase. Since none of these cDNAs (El, E3, E6, E7 and E10) hybridized to RNA present in the mock infected (C) lane (Figures 27 and 28), i t was concluded that a l l of the transcripts detected were viral in origin. Sizes of same of the E cDNAs (E3, E7 and El) do not correspond to the size of any of the transcripts they hybridize to. This may be be attributed to the failure to protect the internal EcoRl sites (during cloning) and/or synthesis of incomplete cDNAs, hence resulting in shorter cDNAs A summary of these results is presented in Table IV. In general, this study showed that a l l the five E cDNAs hybridized to more than one transcript, indicating splicing and/or overlapping genes in the E regions of the genome. Also, these E units begin to transcribe from E phase onwards; none transcribed during the IE phase (confirming the results of the slot blot analysis in the previous section). 3.3.2 NORTHERN BLOT ANALYSIS OF TRANSCRIPTS PROBED WITH ANTISENSE AND SENSE E10 RNA: In further studies I focused my efforts on the E10 cDNA and the major E region to which i t maps, Hindlll fragments I-J. The transcripts of the E10 region were subjected to further Northern analysis in which sense and antisense E10 RNAs were used as probes. The purpose of this particular study was to determine whether the gene(s) coding for the four RNAs that hybridize to the E10 cDNA are transcribed in the same or opposite direction -107- TABLE TV NORTHERN BLOT ANALYSIS OF TRANSCRIPTS PROBED WITH E CDNAs E CDNA KCNDIII E Phase L Phase El E 3 transcripts: 2.8 (high), 1.4 & 1.2kb 2 transcripts: 2.8 & 1.4 kb (lower levels) E3 B 3 transcripts: 3.5, 3.0 & 2.0kb 1 transcript: 3.5kb (higher level) E6 A -4 transcripts: 5.6, 3.0, 1.8 & 1.5kb 2 transcripts: 5.6 & 3.0.kb (both lower levels) E7 F 2 transcripts: 2.0 (very high level) & 2.lkb 2 transcripts: 2.0 & 2.lkb (both lower levels) ElO I & J 4 transcripts: 9.5, 6.9, 4.7 (high) & 2.lkb 4 transcripts: 9.5, 6.9, 4.7 (3-lower levels) & 2.lkb (same) -108- Figure 29: Northern b l o t analysis of tr a n s c r i p t s which hybridized t o E10 sense and antisense RNA. T o t a l cytoplasmic RNA, iso l a t e d from mock infected 3T3L1 c e l l s (C) and E Dhase of MCMV r e p l i c a t i o n cycle was analysed as described i n Figure 27. The P - l a b e l l e d probes were antisense RNA (strand 1) and sense RNA (strand 2) prepared by i n v i t r o t r a n s c r i p t i o n of the pGEM-ElO clones using T7 RNA polymerase ( M a t e r i a l s and Methods) . The t h i r d panel was probed with P-labelled E10 cDNA (positive c o n t r o l ) . -109- within the ElO region. Sense and antisense RNAs were transcribed in vitro from the ElO cDNA (see Materials and Methods) and designated as strand 1 and strand 2, respectively. Northern blots of mock infected (C) and E phase (E) RNA were hybridized to radioactive labelled ElO cDNA, strand 1 and strand 2. (Figure 29) . Strand 1 did not detect RNAs in lane E other than those also detected in lane C (cell) as background. In addition to detecting some background RNAs that were common i n both lanes C and E, strand 2 detected four transcripts (9.5, 6.9, 4.7 and 2.lkb) in lane E. As a positive control, the four E transcripts were also detected using the ElO cDNA probe. Since a l l four E transcripts hybridize to the same single stranded RNA probe, they must be encoded on the same DNA strand and are transcribed in the same directiom. -110- DISCUSSION Using E cDNAs as probes in Northern blot analysis has revealed details on the expression of individual transcripts from the major E transcription units of El, E3, E6, E5 and E10 corresponding to Hindlll regions E, B, A, F and I-J, respectively. Northern blot analysis of these five cDNAs have confirmed their origin from the E phase (Figures 27 and 28). The cDNAs hybridize to transcripts that are f i r s t detected during the E phase, some are also present during the L phase, but none was detected during the IE phase. The analysis also reveals some pattern of regulation in transcription involving the size and quantity of transcripts present during the E and L phases of infection. The presence of some of the E transcripts in the L phase is an observation that has also been made with HCMV (reviewed in Mach et al., 1989 and Spector et al., 1990), and this may be attributed to high stability of the E mRNAs in the cytoplasm and/or the continued expression of the gene. In general, a l l the observations mentioned above i l l u s t r a t e the temporal, quantitative, and perhaps post-transcriptional regulation of MCMV genome expression. To study transcripts that map to the corresponding regions of the cDNAs, the Northern blot analysis method is more informative than the slot blot method (previous section). There are several advantages to performing a Northern blot analysis. This analysis reveals the size and number of transcripts originating from the corresponding region in each phase of the viral replication cycle. In addition, by using single stranded RNA probes corresponding to either strand, one is able to determine the direction of transcription. An important point to note relevant to these studies is that during the isolation of IE and E transcripts for Northern analysis, cycloheximide (CH) was used in order to block progression into the next -111- phase. Therefore, the time course analysed by the Northern blot may not necessarily correspond to the time course analysed by the slot blot. Another difference between the two analyses is that the late time point for the slot blot analysis was 14 hr p.i. while the time point for the isolation of late phase RNA for Northern blot analysis was 16 hr p.i. Therefore, differences in transcript levels between the last time point in the slot blot analysis and the late phase in the Northern blot analysis may not be comparable. In this study, a l l five cDNAs (El, E3, E6, E7 and ElO) (Figures 27 and 28) showed hybridization to more than one transcript indicating a complex transcription pattern possibly similar to that of HCMV. Previous studies have shown that there are multiple transcripts originating from the IE major region of the MCMV (Keil et al., 1983, 1987) and HCMV genomes, and major E regions of HCMV genome (reviewed in Mach et al., 1989 and Spector et al., 1990) due to complicated splicing events and overlapping genes. It is like l y that a similar expression system may exist for the major E genes of MCMV. To elaborate, there are many possible events that can lead to the detection of more than one transcript. The mRNAs may be spliced transcripts from a common gene and perhaps share a 5' untranslated region (leader sequence) and/or untranslated 3* region. Such events have been shewn to occur in the E4 region of adenovirus (Virtanen et al., 1984). Sometimes, the leader sequence of one transcript may be a coding region for another transcript. Occasionally transcripts, although different in size, may code for the same protein. This event has been shown to occur in the major IE region of the MCMV Smith strain where the low abundant mRNAs of the ie3 gene, ranging from sizes 1.0 to 5.1 kb, code for a common polypeptide of size 15kd (Keil et al . , 1984, 1987). Some transcripts may also share -112- sequences but code for different amino acid residues due to translation in a different frame. In adenovirus-2 infected cells, same viral transcripts contain complementary sequences to each other when encoded by genes in the opposite or complementary DNA strands (Sharp et al., 1980). This possibilty can be elucidated by probing the Northern blots with sense and antisense RNA as was done here for the ElO cDNA to reveal the coding strand. An interesting point to note is that, in HSV, only a small portion of the transcripts are derived by splicing in comparison to adenovirus (McLaughlan and Clements, 1982; Wagner, 1984). However, some HSV transcripts originate from genes that have been shown to contain multiple initiation sites (Watson et a l . , 1981; Zisper et al., 1981; Frink et al., 1981; Murchie and MoGeoch, 1982; Sharp et al., 1983; Wagner et al., 1984). A similar organization in some of the major E genes in MCMV is possible and perhaps may be accounted for detection of more than one transcript. Further studies are required to precisely define the coding complexities of these multiple transcripts. The E3 cDNA maps to the Hindlll B fragment and detects three transcripts during the E phase, but only one transcript (3.5kb) is detected at a higher level, during the L phase. This sort of expression may be regulated at the transcriptional level or post-transcriptional level. Regulation at the transcriptional level may involve a change in the transcription initiation site, therefore favouring the transcription of the 3.5 kb transcript, and higher expression of the 3.5 kb transcript. The post-transcriptional regulation may involve changes in the splicing pattern, transportation of the transcripts to cytoplasm and s t a b i l i t y of the transcripts in the cytoplasm, to favour the accumulation of the 3.5kb RNA. Further studies would be required to elucidate the above possibilities involved in this observation. Previous studies have shown that the Hindlll B region is -113- abundantly transcribed during the E phase and a portion of this region is transcribed at a higher level during the L phase (Marks et al., 1983; Keil et a l . , 1987). Therefore, the 3.5kb transcript my represent this portion of the Hindlll B fragment. In previous studies, the Hindlll F region has been shown to be transcribed abundantly during both E and L phases of the MCMV replication cycle (Marks et a l . , 1983; K e i l et a l . , 1987). The f i r s t extensively studied and sequenced major E region, el, maps within the Hindlll F region, 0.709-0.721 mu (Buhler et al., 1990). The E7 cDNA also maps to this location and detects one predominant transcript of size 2.0kb that is present during the E phase at a considerably higher level than in the L phase. The presence of these transcripts during the L phase may be due to down-regulated expression or residual stable E transcripts in the cytoplasm. Similarly, Buhler et al. (1990) have detected one predominant transcript from the el gene which is present at a high level at E times. The level of this e l transcript drops when the replication cycle is in the L phase, as also observed for the E7 transcript. Although the el mRNA comprises three exons that add up to a 2.1 kb transcript, a 2.6kb RNA is reported to be derived from this region and i t has been speculated that the increase in the transcript size i s due to post transcriptional modification such as polyadenylation (Buhler et al., 1990). The E7 cDNA appears to represent the el transcript. Differences in the transcript sizes detected by the E7 cDNA (2.0kb) (this study) and Buhler et a l . (2.6kb) may be attributed to differences in post transcriptional modifications and/or genetic differences that may exist within the MCMV Smith strain. The el gene codes for three antigenically related proteins (36, 37 and 38 kd) presumably coded by the same transcript (Buhler et al., 1990) . However the functions of these proteins have not been elucidated. -114- Since the e l transcript peaks during the E phase, by analogy to other herpesviruses, the most likely function of these proteins may involve gene regulation, DNA synthesis or nucleotide metabolism [summary of review in Roizman (1990) for HSV and Spector et al., (1990) for HCMV] An E gene, designated as the sgg-1 gene, maps within the Hindlll J region and i s transcribed into two RNAs of sizes 1.8kb and 1.5kb (unpublished data, Manning et a l . , Westcoast Herpesviruses Workshop, 1990). In the study reported here, the ElO cDNA maps to two adjacent fragments Hindlll I and J and detects four transcripts of 9.5, 6.9, 4.7 and 2.lkb in size. Therefore, none of these four transcripts represent RNA from the sgg-1 gene. Earlier investigators have reported that the Hindlll J fragment and a portion of Hin d l l l I fragment are transcribed abundantly during both E and L phases of the MCMV replication cycle, but this transcription peaks during the E phase (Marks et al., 1983; Keil et al., 1984). This observation is analogous to that seen in the Northern blot analysis (Figure 28). During the L phase, levels of three of the four E transcripts decrease while one (2.lkb) remains the same. A l l four transcripts are encoded on the same DNA strand since the sense ElO RNA probe has been shown to hybridize to a l l four (Figure 29). It i s interesting to note that there appears to be some sort of regulation that exists within this region resulting in decreased levels of three transcripts without affecting the levels of the 2.1 kb transcript. By analogy to HCMV, i t i s tempting to speculate that this regulation may be at the level of either transcription or post-transcription (Griffiths and Grundy, 1987; Spector et al., 1990). Regulation at the post-transcriptioal level would include low stability of the three transcripts in the cytoplasm during L phase or decreased transportation of the three transcripts to the cytoplasm. Regulation at the transcriptional level would include -115- down-regulated expression of the three transcripts, and this may be the most likely explanation since previous studies have indicate lower expression of the Hindlll I-J region during the L phase (Marks et al., 1983; Keil et al., 1984). E l and E6 cDNAs map to the major E regions, E and A respectively. The transcripts from their respective regions have been shown to be present at lower levels during the L phase. These observations are similar to those documented in studies by Marks et al. (1983), although this study revealed significantly more details. The portion of the Hindlll E region where El maps and the portion of the Hindlll A region where E6 maps have been shown to be transcribed at a lower level during the L phase (Marks et al., 1983). Therefore, the presence of low levels of the corresponding E transcripts is most l i k e l y attributed to down-regulated expression of the (El and E6) transcription units during the L phase. For future studies, similar Northern blot analysis may be performed with RNA isolated from nonpermissive and latently infected cells. Such a study would reveal individual transcripts present during infection and accordingly provide the basis for an in-depth comparison between permissive and nonpermissive or latent infections with MCMV at the transcription level. In summary, the five E cDNAs (El, E3, E6, E7 and ElO) hybridized to more than one transcript and therefore, same of the major MCMV E gene expression consists of transcripts that may be spliced and/or originate from overlapping genes and/or from genes with multiple intiation sites. The major E genes corresponding to the five cDNAs begin to be express during the E phase and have been shown to be expressed in a temporally regulated -116- manner. In general, the temporal expression pattern of an individual transcription unit is very similar to the results of the major E regions previously identified in preliminary studies by Marks et al . (1983) and Keil et a l . (1984), although this study provides significantly more detail on individual transcripts. -117- 3.4 FURTHER ANALYSIS OF THE E10 CDNA RESULTS 3.4.1 E10-C cDNA SEQUENCE The E10 cDNA was subcloned from the Lambda gtlO recombinant phage into the plasmid pGEM3z at the EcoRl site. Both strands of the E10 cDNA were sequenced as outlined in the 'Materials and Methods' and Figure 30. The majority of the sequence on both strands was obtained by generating a series of overlapping deletion clones (Henikoff et al., 1984) which were sequenced using the enzymatic procedure (Sanger et al., 1977). The E10 cDNA consists of 3223 bp, but on analysis i t was observed that the clone was not f u l l length. The E10 cDNA sequence revealed one major open reading frame (ORF) with no stop codon, and no polyadenylation signal or poly A t a i l at the 3' end. The missing 3' terminus of the E10 cDNA, designated as E10-A cDNA was successfully isolated using the polymerase chain reaction method as outlined in 'Materials and Methods' and Figure 31. This clone was sequenced as described in 'Materials and Methods' (Section 2.19) and Figure 32. The combined sequence of clones E10 and E10-A, designated as E10-C (C for complete) is presented in Figure 33. Bases 1 to 3223 represent the sequence from the E10 cDNA clone, and 3184 to 4606 represent the sequence from the E10-A cDNA clone. Analysis of the E10-C cDNA sequence and the putative protein i t encodes were performed using available computer programs [PC gene (Intelligenetics) and Seqnce (Delaney Software Ltd, version 2.1 and Universion)]. 3.4.1.1 ANALYSIS OF E10-C CDNA SEQUENCE CODING CAPACITY: Analysis of the 4,606 base sequence illustrated in Figure 30 revealed one major ORF extending from nucleotide position 155 to 3754. A canonical poly adenylation signal (AATAAA) is present at nucleotide position 4569. The -118- f i r s t ATG triplet in the sequence is encountered at nucleotide position 114, but this ORF would code for a very short polypeptide of approximately 12kd ending at the TGA stop codon at position 380. However, the second ATG t r i p l e t (nucleotide position 155) initiates a major ORF. This ATG is preceded by the sequence TCACG which is close to the consensus sequence CCACC, and therefore may be the favourable start codon (Kozak, 1984). The cDNA i n this case has an untranslated leader sequence of at least 154 bases [the f u l l 5* leader has not been cloned (see Section 3.6)], and a major ORF (3600 bases) that has the potential to code for a 1,200 amino acid polypeptide of approximate molecular weight 135 kd, the putative ElO protein. -119- Figure 30: DNA sequencing strategy for ElO cDNA E10 cDNA priming site (SP6) prepare DNA Sail • Sph1 I 5' overhang 3'overhang Exo III 1 1 remove timed aliquots S1 nuclease I Klenow, dNTPs, DNA ligase transform, plate and select overlapping deletion clones Sequence Sequence overlapping clones Compile overlapping sequences from clones of both orientations to provide a full length sequence of E10 cDNA -120- Figure 31: Isolation strategy for E10-A cDNA E10 m R N A (A) I r e v e r s e t r a n s c r i p t a s e v (T) 1 7 p r i m e r E10 m R N A => (A) ^ (T) 1 7 1st s t r a n d c D N A p r i m e r 1 H i n d l l l f——j 3 5 c y c l e s of P C R 2 9 - m e r w i t h s e q u e n c e s s p e c i f i c for the E10 c D N A - 3 ' e n d p r i m e r 2 (T) 1 7 - S a H / S p h l D e n a t u r e a n n e a l p r i m e r 1 ex tend a m p l i f i c a t i o n of E 1 0 - A 1st s t r a n d c D N A (T) 1 7 I I p r i m e r 1 2 n d s t r a n d c D N A d e n a t u r e 1st & 2 n d s t r a n d a n n e a l p r i m e r s 1 & 2 ex t e n d I 5 ' E 1 0 - A H i n d l l l (A) 3 ' 1 7 S p h (T) 1 7 c o p i e s of E 1 0 - A c D N A -121- Figure 32: DNA sequencing strategy for E10-A cDNA Hindlll 5' I 3' S a h E10-A SaM -+- (A) (T) 1 7 1 7 Sal1/Sph1 Subclone restriction fragments in both orientations in pGEM3Z and pGEM4Z Hindlll S a h S a i l S a h S a i l Sph1 Sequence clones of both orientations: Hindlll-Sal1 Sal1-Sal1 Sal1-Sph1 Hindlll SaM Sequence junctions of restriction sites of E10-A cDNA with specific primers S a i l Sph1 Compile overlapping and junction sequences to give a full length sequence of E10-A cDNA -122- Figure 33: E10-C cDNA sequence E10-C cDNA sequence consisting of 4,606 bases. The po t e n t i a l t r a n s l a t i o n products of the minor and major ORF, extending from nucleotide positions 114 to 380 and 155 to 3754, respectively are indicated using the amino acid one l e t t e r symbols. The polyadenylation s i g n a l (AATAAA) i s at po s i t i o n 4569 (underlined). GGCGACTCTIGCTCC^^ 10 20 30 40 50 60 70 M Q R E K F Y R V CCTGCia^TCATO^CACm^ 80 90 100 110 120 130 140 A T A S R GOGIACGGCATCACG 150 M L L R A G M A R H R V R A F D R . R P E A V Q C C C G P A W Q G I A F G P S T V G R R P C R ATGCTCCTGCGGGC^ 164 174 184 194 204 214 M O S S V H C R S R N S S A R V D Y A N E H E C S H L S T A D H A T R A P G S I T P T N T S ATGCAGTCATCIUIXXACT^ 233 243 253 263 273 283 W L C R R D R F R P D M R T W D D A D K L A I G . C V A G T A F G P T C G R G T T R T S W P S TGGCTGTGT050CX3GC4A 302 312 322 332 342 352 N H A V R A M K R K A G E M Y T N E E E D W T T T P C A P AACCACGaXTTODGOGCCA^ 371 381 391 . 401 411 421 D T N R V G T G G R R Q Q G I R R - T R D G H H GATACCAACAGAGTGGGAACAGGAGGACXIACGACAACAGGGG^ 440 450 460 470 480 490 -123a- G P R R W L A L M H V V A R E R A N D T P G S GGGCtXXX^OGATGGC 509 519 529 539 549 559 Q P R H P N P V P L H V R E K G H V S R G G D CAACX^AGACACCCGAACXrTCm 578 588 598 608 618 628 Q K A L G E A R E S L L S E L F R S D S A D R CAGAAGGCTCTTCC&GAGGCA 647 657 667 677 687 697 E L T A P A P D G A D R E R E G C G L S A A P GAGTIGACEGCGCCGC^ 716 726 736 746 756 766 R D A T C V S M V R T T S G V W R T R I A W T AGAGACGCGACCI03Gr[TK3GATGGTCAGG^ 785 795 805 815 825 835 R S S E N T A A W T R G A F P R S G H Q F T P AGAAGTKX3GAC4AATACGGCGC^ 854 864 874 884 894 904 Q R S F I N D Q F F L R P A I G L H G S H G R CAAAGAAGCTITATAAATG^ 923 933 943 953 963 973 G R E S C G A M A E S ' D L F I D R A A L D G T GGACGCGAATCCTGCGGCGCGAT^ 992 1002 1012 1022 1032 1042 G R S D A G S R D S E S D S D F D M E S D S D GGODGCTCIGA<^^ 1061 1071 1081 1091 1101 1111 L S D D G D A A G A Y V Y G S P V E D L G R H CIUira]ACCACGGCG& 1130 1140 1150 1160 1170 1180 G V Q E G R R . E I R E E E A G A R L Y S L T M GGTGTCCAGGAAGGCXI^^ 1199 1209 1219 1229 1239 1249 -123b- R D F K S F H L A L S F R R A R S R P R G A L CC<EACTItAAGAG^ 1268 1278 1288 1298 1308 1318 P R Q A P R A P L P G E L V P D P A E T L R D (XTCGGCAAGCXXCTCGT^^ 1337 1347 1357 1367 1377 1387 P R R A R R G P V Q V S V L R R H R R R A D A (XGCGTCCTGCXO^ 1406 1416 1426 1436 1446 1456 P G G L A A R S P D L H F R E T P C A L V M D (XTGGGGGICTCX^^ 1475 1485 1495 1505 1515 1525 E R G R F F L Y D A E S D G L Y Y A A R . N I D GAGCGOGG<XXrCTTCT 1544 1554 1564 1574 1584 1594 Q L A R R G L S L C E P V Y R D G G A V V S M CAGCTGGCGAGACGGGGGCTC^ 1613 1623 1633 1643 1653 1663 P K P K T L V R K I V S A A V V G L . E K L R P CTJGAAGCCCAAGACOCT^ 1682 1692 1702 1712 1722 1732 R H G V Q G L D D R P A R P G L G T A R D V S CCrCCACGGCCTTC^ 1751 1761 1771 1781 1791 1801 G V R G V R P E E K P P F S R M D D T T Y T L GGTCITCGGGGCiTrCAGAa 1820 1830 1840 1850 1860 1870 V. R E Y I T F R L A E A W T V I G A V G E Y R GTCCGGGAGTACATCACCTIT^ 1889 1899 1909 1919 1929 1939 D D G F V F E V S T V V L - V G A R G T V Y G F GAOC&CGGCTTCGTCTT^ 1958 1968 1978 1988 1998 2008 -123c- C L L S N D V F R I A E D I S V F F K R G G V TCCCTCCTGACTAAC^ 2027 2037 2047 2057 2067 2077 S G R R R A Q P L R P R R P G R T P S G T P A 2096 2106 2116 2126 2136 2146 A L S H R D E D R P P I A T S L A S Q E I A R GCTOTJrm^CAGGGACG^ 2165 2175 2185 2195 2205 2215 R D L E D W Y R W R L G A R S R L Q D G V A L CGCGACCTGGAAGACTGGTA^ 2234 2244 2254 2264 2274 2284 S N V S E A K R Q L T H P A K G I P V S I V T TCGAACGTTC&GCG^^ 2303 2313 2323 2333 2343 2353 A E S Y H P R G I P R K P S N P V G T D E A V GCGGAGTCTJACX2AOCXXXX 2372 2382 2392 2402 2412 2422 P I P A G L R R L P V V L R P R L L S S L R P CCGAIACCCGCGGGTXJTCKX^ 2441 2451 2461 2471 2481 2491 R H G H V R R R Q G E E R A R D Y V H Q G R E OGCCATGGACATGTITCGACGGCGGCA 2510 2520 2530 2540 2550 2560 G R L . A P E D G N P I ' E T A T ' S G P R D S G G GGICQSCTOSCTCCAGAA^ 2579 2589 2599 2609 2619 2629 I D E Q Q H G N R L R S L V Q R R C V S R S R ATOGACGAGCAACAACAIGGAAACC^ 2648 2658 2668 2678 2688 2698 G A R T N H Q S I K A V P H H R N S V T E R E GGGGCGCXX1ACX]1AACCATCAGTCT 2717 2727 2737 2747 2757 2767 -123d- L K S P S S L G R Q S R G D G A F D A D R T L CTCAAGTCGCXZATCAT^ 2786 2796 2806 2816 2826 2836 P P R G R D G A S I T C V P V A L A H R D L R CCTOCTCGCGGCC^^ 2855 2865 2875 2885 2895 2905 P V Q Y L L R P G E R L H G Q G L A R P L R R OXGITCAATATCTC^ 2924 2934 2944 2954 2964 2974 R Q C Y R G M D R D G R R G D K L H F S A R W AGGCAATGCTACX3SAGG<SATGG^ 2993 3003 3013 3023 3033 ' 3043 N Y S T A D I G V Y Y V N V T E R N L T T P L AACTACTCGAGDGGXACAT 3062 3072 3082 3092 3102 3112 T Q L I T P P M T I W G M R Q G G R S R D F V AOGCAACTGATCACXXXIACXX^ 3131 3141 3151 3161 3171 3181 L C T V T G I F S K G E F T L E A N G A T V L CTCTGCACXDGTGACGGGCATCT^ 3200 3210 3220 3230 3240 3250 S V N F T K P G R Y A V K K A R V S L D L S H TCTGTCAACTTCACAAAAC^ 3269 3279 3289 3299 3309 3319 R N G T M R F L V S I R G G P M T H V K Y Q C CGCAACGGTACX^ATGOGATTICTO 3338 3348 3358 3368 3378 3388 I M T P L S V R S F C G Q Q A S D V G I R Q T ATCATGACTCtCTCTCTCTG^ 3407 3417 3427 3437 3447 3457 M P S G V K G T P R T P P G L K S P T E S A V ATGCCATCQIIGAGIGAAA^ 3476 3486 3496 3506 3516 3526 -123e- S S M I T I T G F A Q A R H R D Q N D R P V R AGCTCGATGATTACtA^ 3545 3555 3565 3575 3585 3595 R T P V L V C L R H P A V H V L H S R G G K A AGAAOXCAGTTCTTGTTTC^ 3614 3624 3634 3644 3654 3664 A G I G L D A V R R R H M E L R F H L Q W R I GCTGGAATCGGTCTIGATGC 3683 3693 3703 3713 3723 3733 D T N I GATACAAACATCTAA 3752 AAAGACGGGTCTAGGCCTCX^^ 3767 3777 3787 3797 3807 3817 3827 GGCCGCTXDGCIGATGCT^^ 3837 3847 3857 3867 3877 3887 3897 TCCAGATCXZAAATAACGJJGT^ 3907 3917 3927 3937 3947 3957 3967 ACGGACAGCOGGTGTATCAGA^ 3977 3987 3997 4007 4017 4027 4037 CAACGGCTCGCGGCTGTOC^ 4047 4057 4067 4077 • 4087 4097 4107 GGCCGGTITT^GGTGOZrX^^ 4117 4127 4137 4147 4157 4167 4177 (XAGGATGGAATACGCXXTCGJ^ 4187 4197 4207 4217 4227 4237 4247 G A O G A C C A C A A C A C T C A T C A C X X X X X T C A a 4257 4267 4277 4287 4297 4307 4317 -123f- ACO^a^CGATGACT^ 4327 4337 4347 4357 4367 4377 4387 CTCGCGTCACQDGAAGOCG^ 4397 4407 4417 4427 4437 4447 4457 CATCnXZXJTJXTGGATCT^ 4467 4477 4487 4497 4507 4517 4527 OGACTACTAA(^CTTACTAATG^ 4537 4547 4557 4567 4577 4587 4597 AAAAAAAAA -123g- 3.4.1.2 FURTHER ANALYSIS OF THE E10-C cDNA SEQUENCE AND PUTATIVE ElO PROTEIN: The DNA sequence was analyzed for the presence of six base pair restriction endonuclease sites. These are summarized in Figure 34. Of note is an EcoRl s i t e at position 3224. During the construction of the Lambda gtlO recombinant phage library (Section 2.14.3), the cDNAs were methylated with EcoRl methylase prior to addition of the EcoRl linkers used to clone the cDNA into the Lambda gtlO phage. Clearly the methylation step was incomplete as this internal EcoRl site was not protected from digestion at a later stage. Knowledge of the restriction endonuclease site map was used in determining the orientation of the gene coding for the E10-C cDNA (Section 3.5, below). Other properties of the putative ElO protein are summarized in Figure 35 and Tables V & VI. Analysis of the hydrophilic and hydrophobic regions of the ElO protein i s illustrated in Figure 35. The hydropathic index of -6.95 indicates that the protein is overall quite hydrophilic (basic) with a total of 242 positively charged residues (Arg, His, Lys) and 137 negatively charged residues (Asp, Glu) (Table V). There is one potential transmembrane segment (nt 601-624) (Table V). The amino acid sequence of this segment is GFVFEVSTVVLVC4ARGTVYGPCLL. A computer search was carried out to determine i f the ElO sequence is homologous with any of the sequences in the current data banks (European Molecular Biology Laboratory (EMBL), Oct 1990; Genbank, Oct 1990) and HCMV Adl69 (obtained from E. Mocarski, Stanford University). In addition, a computer search was carried out to determine i f the putative ElO protein is homologous with any other protein present in the current SWISSPRT data base -124- Figure 34: Restriction map for DNA sequence E10-C cDNA. The following 6 base pair restriction endonuclease sites were found within the E10-C cDNA sequence, BamHI, 2341, 2346; Bgll, 47, 2863; EcoRl, 3224, Hael, 357; Hindlll, 920; PstI, 701; Sal, 3702, 4309; and Xbal, 3313. 1 500 1000 1500 2000 2500 3000 3500 4000 4500 BamHI — Bgll H 1 EcoRl h Hindlll 1 PstI 1 Sal -125- Figure 35: Hydropathy index of hypothetical protein E10. Hydropathy index was prepared by a computer program, Soap [PC gene (Intelligenetics) ]. The horizontal bar above the hydrophobic region represents a putative transmembrane segment with the following amino acid sequence: GFVFEVSTVVLVGARGTVYGFCLL. 50 - 48 - 38 ~ Hydropathic index of E18PR0T from amino acid 1 to amino acid 1288. Computed using an in t e r v a l of 9 amino acids. (GRAUV = -6.95). -12.6- TABLE V PROPERTIES OF THE PUTATIVE ElO PROTEIN Table V summarizes the different properties of the putative ElO protein. This protein is highly basic (by PC gene: Chargpro) and has several potential glyoosylation and phosphorylation sites. A highly hydrophobic region qualifying as a transmembrane segment is predicted in the amino acid sequence position 601-624 residue and therefore, the hypothetical protein may be an integral membrane protein. FEATURES PROTEIN ElO Number of amino acid residues 1200 Molecular weight 135 kd Nature of the protein highly basic Hydrophobic residues: Ala, Gly, l i e , Leu, Val 421 Hydrophilic residues: Asn, Gin, Ser, Thr 213 Positive residues: Arg, His, Lys 242 Negative residues: Asp, Glu 137 Number of potential trans-membrane segments one Location of potential trans-membrane segment in amino acid sequence 601-624 Amino acid sequence of potential trans-membrane segment GFVFEVSTVVLVGARGTV YGFCLL -127- TABLE VT SEGMENTS HOMOLOGOUS TO THE PUTATIVE E10 PROTEIN A search for a homologous protein sequence in the data base (SWISSPRT; September 1990) revealed several regions of short homology, but small and perhaps insignificant to proteins of several herpesviruses (HSV, VZV and HCMV). The proteins are identified by the standard nomenclature system used in the SWISSPRT data base. The f i r s t four letters give the name of the protein or coding region, $ is a separator and the last five letters describe the organism or virus. Information on positions and sequences of these homologous segments is presented in the Table below. PROTEIN TYPE POSITION POSITION IN E10 PROTEIN SEQUENCE SEGMENT YHL7$HCMVA: HCMV HYPOTHETICAL PROTEIN 374-382 47-55 47 WLCRRDRFR M M M M 374 WLGRGDRFR ICP3$HSV1F: VZV-1 ICP34.5 PROTEIN 20-34 647-661 647 RRRAQPIRPRRPGRT M 1 1 M l M 1 20 RRHAGPRRPRPPGPT EXON$VZVD: > HSV EXONUCLEASE 266-280 397-411 397 RAPLPGETVPDPAET 1 M 1 M M 266 RDPLTGTLNPHPAET US09$HSV11: HSV-1 TEGUMENT PHOSPHOPROTEIN US9 51-61 424-434 424 QVSVLRRHRRR 1 M M I M l 51 QQSVLRRRRRR -128- (Sept, 1990) and ORFs of the HCMV AD169 (obtained from E. Mocarski, Stanford University). Several regions of short homology were detected to both known and hypothetical proteins from other herpesviruses (HSV, VZV and HCMV). These regions of short homology are summarized in Table VI. It is not known i f any of these regions of apparent homology i s s i g n i f i c a n t . -129- 3.4.2 CRIENTATION OF THE GENE CODING FOR E10-C cDNA The orientation of the gene coding for the cDNA was determined in i t i a l l y by comparing the Hindlll, EcoRl and Xbal restriction enzyme map of E10-C cDNA (Figure 34) to that of the corresponding region on the Smith strain MCMV genome (Hindlll I-J region) (Figure 2 in Introduction). Subsequently, a short region of the Hindlll I or J region of the viral genome was sequenced to reveal sequences common to the 5' or 3* termini of the cDNA (Figure 33). The information for the restriction sites of the cDNA was obtained from the DNA sequence and the data indicated that the 5' and 3' termini of the E10-C cDNA mapped to Hindlll fragments I and J respectively. This was confirmed by sequencing regions of Hindlll I and J fragments with primers specific for the terminal sequence to reveal sequences common to the 51 and 3' termini of the cDNA respectively. Figure 36 illust r a t e s the restriction map of the E10-C DNA and the orientation of the gene relative to viral Hindlll fragments I and J. Figures 34 and 35 represent DNA sequence present in Hindlll fragments I and J respectively. The underlined sequences in Figures 37 and 38 show sequences common to the 5' and 3' termini respectively of the E10-C DNA sequence (Figure 33). The flanking sequence preceeding the underlined sequence in fragment I (Figure 37) does not appear to contain any consensus sequence common to a MCMV promoter region (Buhler et al., 1990). In fragment J (Figure 38), the sequence following the underlined segment is ric h in T nucleotides. This is characteristic of a sequence downstream of a poly A signal in most genomic DNAs (Hames and Glover, 1988). -130- Figure 33: Orientation of the gene coding for ElO cDNA K L J I Hindlll 1 1 1 1 3 ' Genomic DNA Poly A 3'< H 1 5 ' ElO cDNA Xbal Hindlll EcoRl -131- Figure 37: DNA sequence from H i n d l l l I region of the MCMV (Smith) genome. The DNA sequence was obtained by sequencing the H i n d l l l I fragment with a primer that was s p e c i f i c f o r the 5' end of E10-C cDNA. The underlined sequence represents sequence common t o the 5' terminus of E10-C cDNA. 10 20 30 40 50 60 70 CCCACGCCTC GTCGTGGGGC TGATCATGTG CCAGACGATC TCGACCGGGT GTCXDGATTAC TGCCAGGAGA 80 90 100 110 120 130 140 ACAGOGGGCA CGTCGCGCTG TACACCCCCG GATTCAAGTA CCAGCCGATC AAACTGCTGG GTCGCGTGAG 150 160 170 180 190 200 210 AGAOGCOGCG CXCTACTGGC OXTGGATAT CATGAACCCG TCGAAOCTGA AGGOCTGCCT GGAOGAGATC 220 230 240 AOGGGGCGAC TGTGCIGCTT CTCGCACGCG TTCG -132- Figure 38: DNA sequence from Hindlll J region of the MCMV (Smith) genome. The DNA sequence was obtained by sequencing the Hindlll J fragment with a primer that was specific for the 3* terminus of E10-C cDNA. The underlined sequence represents sequence cxanmon to the 3' terminus of E10-C cDNA. 10 20 30 40 50 60 70 GCTCTCAAAC TAGACGCGGT TCCTItATTA CTCTGTTATT TITOGGTCTC CGATGGGTCA CX3GCTCTCTT 80 90 100 110 120 130 140 GCCICTCTCT CCATGTGGCG ATACTGGTAT CGGGGCGCCA TOGCGOGATA GTCGGCCATC ACCACGACGG 150 160 170 180 190 200 210 CACTGATAGC QXGGGGGGT GGGATCXXTC CGGCTITGTC GTTCGAACAG CCCGAGTTCG CTGAGGGAAC 220 230 ATGTAOGACG AOCCAGCCCA CGTGTT -133- 3.4.3 POSSIBLE IDENI'IFICATTON OF THE 5' START SITE OF THE ElO CDNA TRANSCRIPT Due to the protocol used during the construction of the cDNA library, the 5' end of the cDNA would not necessarily be included. Therefore, primer extension experiments were carried out to determine the 5' end of the ElO Y 32 cDNA; however, these studies were inconclusive. A d - P-labelled primer (18-mer) (ATGTCCAGCXJK?IAGATC) with DNA sequence specific to ElO cDNA and 98 bases away from the 5' end of the cDNA clone was annealed to E RNA and extended in the 5' direction using reverse transcriptase (Sambrook et al., 1989). As shown in Figure 39, several extended products were observed in the acrylamide gel, ranging in size from 125 to 600 bases. This may be attributed to the origin of multiple transcripts (9.5, 6.9, 4.7 and 2.0kb; Section 3.3) from the same genomic region (containing different exons), and /or pausing of the reverse transcriptase. The f i r s t major product of the extended primer was approximately 125 bases in length, only 9 bases more than the position of the 5' end of the cDNA clone. Since there are four transcripts hybridizing to ElO cDNA (Section 3.3), the interpretation of this observation would be subjective, although i t is possible that the f i r s t extension product of 125 bases represents the 5' end of the cDNA clone characterized most extensively in this thesis. -134- Figure 39: Possible identification of the 5' start site of the E10 cDNA transcript using primer extension. * -~^P-labelled primer (ATGTCCAGCiJIxniAGATC) specific for 5' end of the E10 cDNA was annealed to E RNA and extended in the 5' direction with reverse transcriptase. The extended products were electogphoresed through a 6% acrylamide denaturing gel (32 watts) along with 5-P-labelled unannealed primer (negative control) and denatured HinfT digested pBR322 markers. BASES 1631 606/517 396 344 298 220/221 154 1125 75 -135- 3.4.4 POSSIBLE IDENTIFICATIQN OF THE PROTEIN CODED BY E10 CDNA Preliminary attempts were made to identify the proteins encoded by the E10 cDNA and i t s related transcripts. This procedure was made difficult by the fact that the E10 cDNA was incomplete. Also, the joining of E10 and E10-A cDNAs, to produce an uninterrupted continuous cDNA, E10-C, for in vitro transcription was technically difficult due to the presence of numerous endonuclease restriction sites in inappropriate places. Therefore, the protocol chosen to be the most likely to give positive results involved hybrid selection of RNAs using the E10 cDNA and subsequent translation of these RNA, in vitro, as described in 'Materials and Methods'. The results were d i f f i c u l t to interpret because of problems encountered during the procedures. These included nonspecific hybridization of cellular and viral RNAs to the E10 cDNA clone (probably due to the high G+C content) and therefore the presence of nonspecific high molecular weight cellular proteins which interfered with the identification of a 135 kd protein (the putative product of the major ORF of the E10 cDNA). Autoradiograms of 12% acrylamide gels (A and B) and a 5-20% gradient gel (C) representing three experiments are presented in Figure 40. For gels B and C, hybrid selection for the appropriate transcripts was carried out using the E10 cDNA insert plus the plasmid DNA (pGEM3Z) bound to the nylon membrane. In the case of gel A, only the E10 cDNA insert (minus the plasmid DNA) was used to select for the RNA, and only in this gel, was a protein of approximately 135 kd detected. This protein was absent in the C (mock infection) and IE lanes, but was present in the E and L lanes. Despite the fact that the nylon membranes following hybridization were washed at a high stringency (65°C, 0.1X SSPE) during the RNA enrichment -136- Figure 40: In vitro translation products of RNAs that hybridize to ElO cDNA. RNAs were isolated from the IE, E and L (lanes L and L2; L2 was loaded with two times the quantity of L) phases of infected and mock infected 3T3L1 ce l l s (C) . By the method of hybrid release, the RNAs that hybridized to the ElO cDNA (plus plasmid pGEM3Z DNA for gels B and C) were eluted and translated i n a rabbit r e t i c u l o c y t e system i n the presence of S-methionine. The translation products were separated in either a linear 12% polyacrylamide gel (Figures A and B) or a gradient (5-20%) polyacrylamide gel (Figure C). Each gel represents a separate experiment. Arrows at the right side of the gel show the positions of molecular weight markers of virally induced proteins. Arrows at the left side of the gel show the molecular weights of the marker proteins. Lane 'BMV' represents a control in which Brome Mosaic virus RNA was translated. Lane '-RNA' represents endogeneously-labelled proteins which were present after translation when no exogenous RNA was added to the translation system. -137- procedure, many cellular transcripts bound nonspecifically to the blot. The presence of the proteins which resulted from the translation of these nonspecific transcripts makes these results difficult to interpret. Since a protein of approximately 135 kd can be identified only in one of the gels, gel A, in which the ElO cDNA insert (minus the plasmid) was used to enrich for the RNA, the selection procedure in this case appears to have worked better than that used in the experiments analysed on gels B and C where plasmid DNA was also present. In addition, the 135 kd protein may not be identified in gels B and C due to insufficient resolution of the high molecular weight proteins on these gels or inefficient translation of the corresponding transcript possibly due to the large size of the ORF of the ElO transcript. Four virally induced proteins were detected consistently in a l l three gels and these were proteins of 33, 39, 80 and 91 kd. The f i r s t three proteins which appear clearly in the E lanes may correspond to the transcripts that were found to hybridize to the ElO cDNA on the Northern blot (Section 3.3, Figure 28) or may be the products of transcripts that have bound nonspecif i c a l l y to the ElO cDNA (during hybrid selection). The 91 kd protein which is present in the IE and E lanes may correspond to the major IE protein that was previously detected in our laboratory (Walker and Hudson, 1987). Its presence is likely due to the nonspecific binding of the major IE transcript to the ElO cDNA. In addition, the hybridization experiments in Sections 3.1 and 3.2 have demonstrated that the Hindlll K-L region (IE region) is particularly prone to bind nonspecif ically to other DNA sequences, which may be due to its high GC rich regions. In summary, a total of five virally induced proteins were identified by -138- translation of hybrid-selected RNAs in vitro. Of the five, one protein (91 kd i n IE and E lanes) appears to represent the major IE protein and non-specific selection of this transcript by the E10 cDNA is presumed to have occurred. Only one E/L protein (approximately 135 kd) which was detected in one out of 3 gels (each of a different experiment) may represent the putative E10 protein. Detection of this protein in this case may be attributed to a better hybrid selection procedure (using only E10 insert) and better resolution of high molecular weight proteins in the gel. The presence of other E proteins (33, 39 and 80 kd) translated may correspond to the related transcripts that hybridized to E10 cDNA on the Northern blot, however, this observation would be subjective since there was a high degree of nonspecific binding of cellular transcripts as well. -139- DISCUSSION Two independent groups nave identified high levels of transcription from the Hi n d l l l I-J region during the early phase of the MCMV (Smith) replication cycle (Marks et al., 1983; Keil et al., 1984). This suggests that i t is an important E region and therefore, the E10 cDNA clone was selected for extensive analysis since i t maps to this location. This analysis included determining the DNA sequence and orientation of the E10 gene, attempts to identify the 5' end of the E10 transcript, and the in-vitro translation of the transcripts hybridizing to the E10 cDNA. The DNA sequence of the E10 cDNA has revealed two ORFs, a major ORF and a minor ORF. The f i r s t ATG t r i p l e t i s encountered at nucleotide position 114 and has the potential to ini t i a t e the minor ORF that would code for a 12 kd protein. The second ATG t r i p l e t i s encountered at nucleotide position 155 and has the potential to in i t i a t e the major ORF that codes for a 135 kd protein (1200 amino acid residues), the putative E10 protein. The preceding sequence to the fi r s t ATG triplet displays only two nucleotides common to the consensus sequence. Approximately 50% of the eukaryotic mRNA i n i t i a t i o n codons have 3-4 nucleotides in the preceding sequence common to OCACC, with A as the highly conserved nucleotide (Kozak, 1984). The preceding sequence to the second ATG t r i p l e t displays TCACG, with 3 nucleotides including the A common to the consensus sequence and therefore, the second ATG triplet is more likely to be recognized by the ribosome as the initiation codon for the translation of the polypeptide (putative E10 protein). According to Kozak (1983, 1984), five to ten percent of the eukaryotic mRNA translation is not initiated at the f i r s t AUG, rather the ribosome recognizes the sequence closest to CCACCAUG to initiate translation. In addition, there have been reports on the presence of AUG triplets as part of short ORFs within the 5' leader sequence, upstream of a major ORF in transcripts of HCMV and the el gene of -140- MCMV (Jahn et al., 1987; Kouzarides et al., 1987; Geballe and Mocarski, 1988; Buhler et al., 1990). The RNA transcript of the E gene el of MCMV, which maps to Hindlll F and is the f i r s t E MCMV gene studied, also has a minor and a major ORF (Buhler et al., 1990). The minor ORF is initiated by the f i r s t ATG triplet that is present upstream of the major ORF. It is speculated, that the minor ORF regulates expression by delaying the translation of the major ORF (Buhler et al., 1990) and this may also be the case with the ElO transcript. Another possible reason for the existence of two start codons in the transcript may be due to i t s bicistronic function, similar to that found in the viral transcripts of HSV TK mRNA, simian virus 40 late 19S mRNA and adenovirus Elb mRNA (Preston and McGeoch, 1981; Kozak, 1983) . The bicistronic function mRNAs code for two overlapping proteins and express both, therefore using the f i r s t and second initiation codons (Kozak, 1983) . The pos s i b i l i t y that the ElO transcript may be bicistronic in function i s remote because we did not detect a 12 kd protein in the in-vitro translation experiments. As stated earlier, herpes E proteins are usually involved in DNA synthesis, nucleotide metabolism and gene regulation [ summary of review in Spector et a l . (1990) and Roizman et al. (1990)]. Thus many herpes E proteins have been shown to be DNA binding proteins. Some of the MCMV E proteins identifed in our laboratory previously (Walker and Hudson, 1988a) are also DNA binding proteins, although this study did not reveal a protein that was close to 135 kd, the molecular weight of the putative ElO protein. The possible reasons for not detecting the putative ElO protein in the study by Walker and Hudson (1988a) are stated below. The putative ElO protein is highly basic, indicating the potential to be a DNA binding protein, since i t s high positive charge may allow electrostatic binding to DNA (Berg et -141- al., 1982) via charge-charge interaction between the DNA phosphate and basic amino acids. From the limited data available so far and the lack of homology to other DNA and protein sequences, the function of the protein coded by E10 cDNA can not be predicted. However, from information available from computer analysis of the putative E10 protein, i t is tempting to speculate that the protein may play a role at the level of gene regulation or DNA synthesis because of its predicted DNA binding nature. The hydropathicity pr o f i l e of the putative E10 protein predicts a transmembrane segment within the 1200 amino acid sequence and therefore, the polypeptide has the potential to be an integral membrane protein. The amino acid sequence of integral membrane proteins have polar regions on both sides of the membrane with one or more transmembrane segments (hydrophobic) interacting directly with the hydrophobic core of the phospholipid bilayer (Wickner, 1979). Since only one transmembrane region has been predicted for the putative E10 protein, further studies are required to verify whether the protein could be a membrane protein. From studies to date, the exact identification of the putative E10 protein i s subjective. The identification of protein products of the E10 cDNA and i t s related transcripts in in-vitro translations experiment demonstrated at least four virally induced proteins of which, one that was of approximate molecular weight 135k kd, perhaps the putative E10 protein, was identified only in one out of three experiments. It is not known at this point i f the other three proteins (33, 39 and 80kd) are encoded by the E10 cDNA or by any of the three related transcripts. In our laboratory, E proteins of sizes 36 and 39kd have been detected (Walker and Hudson, 1987, 1988a). These E proteins have been shown to be present i n abundance and exclusively -142- i n the nucleus, and therefore they may play a regulatory role in viral gene expression or DNA synthesis. At this point, i t is premature to state that these proteins may represent the two proteins (33 and 39kd) detected in the in-vitro translation experiment. The results of the in-vitro translation experiment were difficult to interpret due to the high degree of nonspecific hybridization of transcripts to ElO cDNA. Further experiments would be required to confirm the identity of the proteins coded by the ElO and its related transcripts. One of the ways to overcome the problem would be to reisolate the ElO cDNA in a single and complete length of 4.6kb, and then subject the cDNA to in-vitro transcription and translation. This would result in a protein coded by the ElO cDNA and confirm the ORF translated by the ribosome. In an investigation by Walker and Hudson (1987), in our laboratory, seven E proteins were detected and the highest molecular weight protein was 91kd. However, an important point to note is that the isolation time point for E proteins in Walker and Hudson (1987) was 6 hr p.i. Therefore the reasons for not detecting a higher molecular weight protein of approximately 135kd may be due to limited expression or no translation of the ElO transcript, at 6 hr p.i. in the E phase. Previous studies by Kim et a l . (1976b) and Chantler and Hudson (1978) have detected a structural protein VP5 with a molecular weight of 132-137 kd. This protein was detected at E times, lOhr p . i . In addition to Kim et a l . (1976b) and Chantler and Hudson (1978), recently Buhler et al. (1990) have detected an E protein of approximate size 130 kd along with other E proteins. This protein has been observed in 3T3 c e l l s (permisssive system), but has not been ascribed any function or been characterized further. Therefore, three groups have identified a protein of approximate size 130-137 kd. It is premature to conclude that the proteins -143- identified by these three individual groups are the same and represent the putative E10 protein as well. In order to elucidate the possibility that VP5 or another E/L protein may represent the putative E10 protein, further studies are required. This would include reisolation of f u l l length E10 cDNA, in-vitro transcription and translation of the f u l l length E10 cDNA, and raising polyclonal antibodies to the entire in-vitro translated E10 polypeptide. Alternatively, polyclonal antibodies could be prepared against synthetic peptides determined from the DNA sequence. Finally, the protein coded by the E10 cDNA could be identified using these polyclonal antibodies on a western blot and determined i f E10 is VP5. MCMV like HCMV shows temporal and quantitative expression of their genome during infection. Many investigators have identified HCMV transcripts that are present during the E phase of the replication cycle, but are not translated until the L phase (Geballe et al., 1988; Wright and Spector, 1989). Differential expression through ribosome association may be another similarity of MCMV to HCMV and such a concept for the E10 transcript i s possible. Since a long ORF exits within the E10 cDNA, i t is very likely that the putative protein is translated, i f not during the E phase, then at least during the L phase, and i t may have an important function. The 5' and the 3' termini of the E10-C cDNA maps to fragments Hindlll I and J. The orientation of the gene(s) coding for the E10 transcript and the related transcripts is the same as for i t s neighbouring gene sgg-1 in the Hindlll J region (unpublished data, Manning et al., Westcoast Herpesviruses Workshop, 1990). The restriction enzyme map of the E10 cDNA also helps to locate the precise location of the E10 cDNA. The T-rich sequence which is present downstream of the E10 poly A signal in the Hindlll J fragment is a -144- requirement for e f f i c i e n t polyadenylation (Hames et a l . , 1988). Polyadenylation of mRNAs in eukaryotic cells is required in order to yield stable transcripts. Therefore, the presence of the additional T-rich signal flanking the poly A signal indirectly reflects on the stability of the transcript (Hames et al., 1988). Studies involving HSV have shown that the E transcripts are relatively stable compared to L transcripts (Frenkel et a l . , 1972, 1973; Siverstein et al., 1973; Wolf and Roizman, 1978) and thus, the E transcripts may remain in the ce l l at L times. This fact together with the above observation (T-rich region) indicates that the same may apply to the ElO transcript. Furthermore, E transcripts that hybridize to the ElO cDNA were found to be present at low levels at L times in the Northern blots. The sequence upstream of the 51 end of the ElO cDNA in the Hindlll I fragment is lacking MCMV promoter like (TATA) and CAAT sequences (Buhler et a l . , 1990). It is difficult to predict whether this sequence represents an intron or the uncloned 5' termini of the ElO cDNA since the results of the Primer extension experiment were complicated by the fact that four transcripts (9.5, 6.9, 4.7 and 2.1 kb) originated from this region. Although the primer extension experiment showed multiple extension products, the f i r s t major product was just nine bases longer than the position of the 5 1 end of the ElO cDNA. If the rest of the multiple extension products were due to other transcripts, then the ElO cDNA is only nine bases short of the 5' terminus. The E10-C cDNA is a 4606 nucleotide sequence and by allowing the addition of approximately 100 nucleotides for a poly A t a i l , this would result in a transcript of 4.7kb. Therefore, E10-C cDNA likely represents the 4.7kb transcript. Further analysis including sequencing of the Hindlll I and J fragments are required to reveal the structure of the gene(s) -145- corresponding to the E10 and related transcripts. Also, the further sequence analysis of the Hindlll I fragment coupled with assays for promoter function using a reporter gene such as the chloramphenicol acetyl transferase (CAT) could help to identify the promoter region. It is interesting to note that the size of the corresponding region coding for the four transcripts is large and is at least 9.5kb (the size of the longest transcript). In conclusion, the E10-C cDNA is 4606bp in length and probably represents the 4.7kb transcript. The E10 cDNA most likely encodes a 1200 amino acid polypeptide of 135kd (putative E10 protein) from a major ORF of 3600 bases, which i s initiated by the second ATG triplet (nucleotide position 156). The sequence of the putative E10 protein suggests that i t may be a glycosylated, phosphorylated, DNA binding and/or integral membrane protein. The in-vitro translation experiment revealed inconclusive results, although an E/L protein of approximate 135 kd was identified in one of the gels which may represent the E10 putative protein. Also, three groups have identified an E protein with molecular weight of 130-137 kd. The 5' and 3' of the E10 cDNA map to fragments Hindlll I and J, respectively and the orientation of the gene(s) coding for the four related transcripts is identical. -146- 4.0 CONCLUSIONS Ten E cDNAs were mapped to specific locations of the virus genome, and each of these represented transcripts from one of the major E regions, Hindlll A, B, E, F and I-J. Five E cDNAs (El, E3, E6, E7 and ElO), each representing a different major E region, and two IE cDNAs (IEd and IEf) representing the major IE region were successful as probes to study transcript levels from the corresponding transcriptional units in infected cells. The E and IE cDNA probes detected transcript levels that displayed the typical E and IE gene expressions, respectively. The transcripts that correspond to the five E cDNAs begin to be transcribed during the E phase and are usually present during the L phase, although at a different level. This sort of expression pattern may involve regulation at the transcriptional or post-transcriptional level. The five E cDNAs detected more than one transcript in the corresponding transcriptional units which indicates possible complex splicing events, overlapping genes, multiple initiation sites, and/or the presence of gene(s) in the complementary DNA strand. There are four transcripts (9.5, 6.9, 4.7 and 2.1 kb in size) that correspond to the Elb region (in Hindlll I-J). A l l of these are encoded on the same DNA strand, thus are transcribed in the same orientation. The E10-C cDNA (4.6kbp) most likely represents the 4.7 kb transcript. -147- 6. The E10-C cDNA sequence (4606 bases) has one minor and one major open reading frame (ORF) . The minor ORF is initiated by the f i r s t ATG t r i p l e t (nucleotide position 114) while the major ORF is intiated by the second triplet (nucleotide position 155). Since the sequence preceeding the second ATG t r i p l e t i s in "good context" with regard to the translation initiation consensus sequence, i t i s most likely that the major ORF i s translated. The major ORF encodes a 1200 amino acid polypeptide, the putative ElO protein of approximately 135 kd in size. 7. Using hybrid-release and in vitro-translation methods, a polypeptide of approximate 135 kd in size was detected in one of the experiments. This polypeptide may represent the putative ElO protein, although further studies are required to confirm the ORF translated in the E10-C cDNA. 8. The 5' and the 3' termini of the E10-C cDNA map to Hindlll fragments I and J of the virus genome respectively, thus revealing the orientation of the gene coding for the ElO cDNA and its related transcripts. The size of the corresponding E region, ElO, is at least 9.5kb (size of the longest transcript). 9. Finally, the study of the major E transcription units corresponding to E l , E3, E6, E7 and ElO cDNAs presented in this thesis sheds light on the kinetics of MCMV gene transcription and also provides us with an insight into the transcription pattern and regulation that exists in MCMV. The extensive study of the ElO cDNA and its corresponding transcription unit, ElO, has revealed details such as the structure of the ElO -148- transcript, putative E10 protein coded by E10 major ORF, potential properties of E10 putative protein, and the orientation of the gene coding for E10 and i t s related transcripts. This information will provide a good basis for future studies on the E10 region. -149- 5.0 FUTURE EXPERIMENTS This study has established two cDNA libraries, one for IE and one for E mRNAs. From the studies I have reported here, the E library appears to be a good source of authentic E cDNAs. In contrast, although the IE library does contain authentic IE cDNA clones, at least two clones proved to be cellular in origin, and selected apparently due to mispairing between these cellular clones with the MCMV Hindlll K and L fragments. Regardless of this problem, both libraries should be a useful source of additional IE and E cDNA clones. The most interesting experiments that should follow are additional analysis of transcripts hybridizing with the ElO cDNA clone and identification of the function of the putative protein. It should be possible to identify additional cDNA clones (from the E cDNA library of 198 clones) which hybridize with ElO. In this way i t should be possible to identify alternatively spliced and/or overlapping transcripts. Other studies that would be useful would be to use short restriction fragments from the ElO cDNA as hybridization probes for Northern analysis to determine i f specific regions of the ElO transcript are contained within a l l four mRNAs (9.5, 6.9, 4.7 and 2. lkb). The putative ElO protein may be identified in MCMV infected c e l l s by immunological techniques. An antibody to a specific peptide (corresponding to a hydrophilic region of the ElO amino acid sequence) could be prepared in rabbits and used in Western blots to identify the presence and size(s) of immune-reactive polypeptides. If a region of the ElO sequence was found to be unique for one of the four transcripts (see above), an antibody to this region would be expected to identify a single polypeptide. In further studies, to elucidate the function of the ElO polypeptide, i t should be possible to express the gene in COS cells (using an approriate -150- SV40 origin vector). This would allow one to use indirect iramunofluoresence to determine the intracellular location of this protein. Again, i f a region of this protein were shown to be unique for the E10 polypeptide, similar studies could be done in MCMV infected 3T3L1 cells. It would also be of interest to see i f polyclonal antibody raised to the entire putative E10 protein could detect any polypeptides within HCMV infected cells or other Herpesvirus infected cells. The functional Mportance of the E10 gene may be investigated by performing experiments such as insertional mutagenesis and marker rescue. A recombinant MCMV can be constructed by cotransfecting a stable ce l l line containing the E10 gene in an integrated form, with wild type MCMV Smith virus and a recombinant vector containing a lacZ gene within the E10 gene. The recombinant virus containing the mutated E10 gene can be identified by selecting for blue plaques (due to X-gal). The E10 gene may be proven essential by comparing the ability of the recombinant virus to grow in a normal c e l l line versus the ce l l line contoining the integrated E10 gene. Finally, i f the E10 gene appears to be essential, then this may be confirmed by a marker rescue experiment where a normal c e l l line may be cotransfected with the recombinant virus and a vector containing the wild type E10 gene. The rescued virus should resume its ability to grow in the normal cel l line to the same extent as the wild "type virus. -151- 6.0 LITERATURE CITED ABOLS-MANTYH, I., SIEGEL, L., VERITY, M.A., LALONDE, H. and GRAVES, M.C. (1987). Latency of mouse cytomegalovirus in sciatic nerve. Neurology 37, 1809-1912. AKRIGG, A., WILKINSON, G.W.G. and ORAM, J.D. (1985). The structure of the major immediate early gene of human cytomegalovirus Adl69. Virus Research. 2, 107-12. ALFORD, C. A., STAGNO, S. PASS, R.F. and HUANG, E.-S. (1981). Epidemiology of Cytomegalovirus infections. In The Human Herpesviruses - an interdisiplinary Approach, pp. 159-172. Edited by A. J. Nahmias, W. R. Dowdle and R. F. Schinazi. Amsterdam: Elsevier Biomedical. ALFORD Jr., C.A. and BRTTT, W.J. (1985). Cytomegalovirus. In: Virology, 629-660, edited by Fields, B.N. et a l . Raven Press, New York. ALFORD Jr., C.A. and BRTTT, W.J. (1990). Cytomegalovirus. In: Virology, 1981-2001, edited by Fields, B.N. et a l . Raven Press, New York. ALLAN, J.E. and SHELLAM, G.R. (1984). Genetic control of murine cytomegalovirus infection: virus titres in resistant and susceptible strains of mice. Arch. Virol. 81, 139-150. ANDERS, D.G., IRMIERE, A. and GIBSON, W. (1986). Identification and characterization of a major early cytomegalovirus DNA-binding protein. J. Virol. 58, 253-262. ANDERS, D.G., KIDD, J.R. and GIBSON, W. (1987). Immunological characterization of an early cytomegalovirus single-strand DNA-binding protein with similarities to the HSV major DNA-binding protein. Virology 161. 579-588. ANDERS, D.G. and GIBSON, W. (1988). Location, transcript analysis, and pa r t i a l nucleotide sequence of the cytomegalovirus gene encoding and early DNA-binding protein with similarities to ICP8 of herpes simplex virus type 1. J. Virol. 62, 1364-1372. AUSUBEL, F.M., BRENT, R., KINGSTON, R.E., MOORE, D.D., SETDMAN, J.G., SMITH, J.A., and STRUHL, K. (1987). Current Protocols in Molecular Biology. John Wiley & Sons, New York. AVIV, H. and LEDER, P. (1972). Purification of biologically active globin messenger RNA by chromatography on oligotJiymidylic acid-cellulose. Proc. Natl. Aca. Sci. USA. 69, 1408-1412. BERG, O.G., WINTER, R.B. and VON KEPPEL, P.H. (1982) . How do genome-regulatory proteins locate their DNA target sites? TIBS, February issue, 53-55. BOLDOGH, I., GONCZOL, E., GARTNER, L. and VACZI, G. (1978). Stimulatin of host DNA synthesis and induction of early antigens by ultraviolet light irradiated human cytomegalovirus. Arch. Virol. 59, 289-299. -152- BOSHART, M., WEBER, F., JAHN, G., DORSH-HASLER, K. FLECKENSTEIN, B. and SCHAFFNER, W. (1985). A very strong enhancer is located upstream of an immediate early gene of human cytomegalovirus. Cell. 41, 521-530. BRAUTTGAM, A.R. ,DUTKO, F.J., OLDING, L.B. and OLDSTONE, M.B.A. (1979) . Pathogenesis of murine cytomegalovirus infection: the macrophage as a permissive c e l l for cytomegalovirus infection, replication and latency. J. Gen. Virol. 44, 349-359. BRAUTIGAM, A.R. and OLDSTONE, M.B.A. (1980). Replication of murine cytomegalovirus in reproductive tissues. Am. J. Pathol. 98, 213-220. BRODY, A.R., and CRAIGHEAD, J.E. (1974). Pathogenesis of pulmonary cytomegalovirus infection in immunosuppressed mice. J. Infect. Dis. 129. 677-689. BUHLER, B., KEEL, G. M., WETLANED, F. and KOSZINOWSKI, U. C. (1990). Characterization of the murine cytomegalovirus early Transcription unit e l that i s induced by immediate-early proteins. J. Virol. 64, 1907-1919. CAMERON, J.M. and PRESTON, CM. (1978). Comparison of the immediate early polypeptides of human cytomegalovirus isolates. J. Gen. Virol. 54. 421-424. CATHALA, G., SAVOURET, J.F., MENDEZ, B., WEST, B.L., KARIN, M., MARTIAL, J.A. and BAXTER, J.D. (1983). Laboratory methods: a method for isolation of intact translationally active ribonucleic acid. DNA 2, 329-335. CHALMER, J.E., MACKENZIE, J.S. and STANLEY, N.F. (1977). Resistance to murine cytomegalovirus linked to the major histocompatibility complex of the mouse. J. Gen. Virol. 37, 107-114. CHANG, C-P., MALONE, CL. and STINSKI, M.F. (1989). A human cytomegalovirus early gene has three inducible promoters that are regualted differentially at various times after infections. J. Virol. 63, 281-290. CHANTLER, J.K. (1978). The use of hypertonicity to selectively inhibit host translation in murine cytamegalovirus-infected cells. Virology 90. 166-169. CHANTLER, J.K. and HUDSON, J.B. (1978). Proteins of murine cytomegalovirus: identification of structural and non-structural antigens in infected cells. Virology 86, 22-36. CHANTLER, J.K., MISRA, V. and HUDSON, J.B. (1979). Vertical transmission of murine cytomegalovirus. J. Gen. Virol. 42, 621-625. CHATTERJEE, S.N., FIALA, M., WEENER, J., STEWART, J.A., STACEY, B. and WARNER,N. (1978) . Primary cytomegalovirus and opportunistic infections. Incidence in renal transplant recipients. Am. Med. Ass. J. 240. 2446-2449. CHEE, M.S., BANKLER, A.T., BECK, S., BOHNI, R., BROWN, CM., CERNY,R., HORSNELL, T., HUTCHISON, III, CA., KOUZARIDES, T., MARTIGNETTT, J.A., -153- PREDDIR, E., SATGHWELL, S.C., TOMLINSON, P., WESTON K.M. and BARREL, BG. (1990). Analysis of the protein ceding content of the sequence of human cytomegalovirus strain AD169. Microl. Immunol. 154. 125- 170. CHEUNG, K-S. and LANG, D.J. (1977a). Detection of latent cytomegalovirus i n murine salivary and prostate explant cultures and cells. Infect. Immun. 15, 568-575. CHEUNG, K-S. and LANG, D.J. (1977b). Transmission and activation of cytomegalovirus with blood transfusion: A mouse model. J. Infect. Dis. 135. 841-845. OTERGWIN, J.M., PRZYBYLA, A.E., MacDONALD, R.J. and RUTTER, W.J. (1979). Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18, 5294-5301. CHUA, C.C., CARTER, T.H. and St.JEOR, S. (1981). Transcripts of the human cytomegalovirus genome in productively infected cells. J. Gen. Virol. 56, 1-11. COLBERG-POLEY, A.M. and SANTOMENNA, L.D. (1988). Selective induction of chromosomal gene expression by human cytomegalovirus. Virology 166, 217-228. DAVIDSON, I., FROMENTAL, C., AUGEREAU, P., WLLDEMAN, A., ZENKE, M. and CHAMBON, P. (1986). Cell-type specific protein binding to the enhancer of simian virus 40 in nuclear extracts. Nature 323, 544-548. DeMARCHI, J.M. and KAPLAN, A.S. (1976). Replication of human cytomegalovirus DNA: Lack of dependence on cell DNA synthesis. J. Virol. 18, 1063-1070. DeMARCHI, J.M., BLANKENSHIP, M.L., BROWN, G.D. and KAPLAN, A.S. (1978). Size and complexity of human cytomegalovirus DNA. Virology 89, 643-646. DeMARCHI, J.M., SCHMIDT, C.A. and KAPLAN, A.S. (1980). Patterns of transcription of human cytomegalovirus in premissively infected cells. J. Virol. 35, 277-286. DeMARCHI, J.M. (1981). Human cytomegalovirus DNA: Restriction enzyme cleavage maps and map locations for immediate-early and late RNAs. Virology 114, 23-38. DeMARCHI, J.M. (1983a). Post-transcriptionnal control of human cytomegalovirus gene expression. Virology 124, 390-402. DeMARCHI, J.M. (1983b). Nature of the block in the expression of some early virus genes in cells abortively infected with HCMV. Virology 129, 287-297. DORSCH-HASLER. K., KEIL, G.M., WEBER, F., JASIN, M., SCHAFFNER, W. and KOSZINOWSKI, U.H. (1985). A long and complex enhancer activates transcription of the gene coding for the highly abundant immediate early mRNA i n murine cytomegalovirus. Proc. Natl. Acad. Sci. USA. 82, 8325-8329. -154- DUTKO, F.J. and OliDSTONE, M.B.A. (1981). Cytomegalovirus causes a latent infection in undifferentiated cells and activated by induction of ce l l differentiation. J. Exp. Med. 154, 1636-1651. EBELING, A., KEIL, G.M., KNUST, E., KOSZINOWSKE, U.H. (1983). Molecular cloning and physical mapping of murine cytomegalovirus DNA. J. Virol. 47, 421-433, EBIHARA, K and MINAMISHTMA, Y. (1984). Protective effect of biological response modifiers on murine cyotmegalovirus infection. J. Virol. 51, 117-122. ESTES, J.E. and HUANG, E.S. (1977). Stimulation of cellular thymidine kinase by human cytomegalovirus. J. Virol. 24, 13-21. FARBER, I., WUTZLER, L., SCHWEIZER, H. and SPROSSIG, M. (1979) . Human cytomegalovirus induced changes in rabbit cells. Arch. Virol. 59, 257-261. FARRAR, G.H. and ORAM, J.D. (1984). Characterization of the human cytomegalovirus envelope glycoproteins. J. Gen. Virol. 65, 1991-2001. FIALA, M., HCNESS, R.W., HE1NER, D.C., MURNANE Jr., J., WALLACE, R. and GUZE, L.B. (1976). Cytomegalovirus proteins: I. Polypeptides of virions and dense bodies. J. Virol. 19, 243-254. FIORETTT, A., FURUKAWA, T., SANTOLI, D. and PIOTKIN, S.A. (1973). Non-poductive infection of guinea pig cells with human cytomegalovirus. J. Virol. 11, 998-1003. FRENKEL,NIZA. (1990). Isolation of a new herpesvirus from human CD4+ T cells. Proc. Natl. Aca. Sci. USA. 87, 748-752. FRENKEL,N. and ROIZMAN, B. (1972). Ribonucleic acid synthesis in cells infected with herpes simplex virus: control of transcription and RNA abundance. Proc. Natl. Aca. Sci. USA. 69, 2654-2659. FRENKEL/N., SILVERSTEIN, N.S., CASSAI, E. and ROIZMAN, B. (1973). RNA synthesis in cells infected with herpes simplex virus. VII. Control of transcription and of transcript abundancies of unique and common sequences of herpes simplex 1 and 2. J. Virol. 11, 886-892. FRINK, R.J., ANDERSON, K.P. and WAGNER, E.K. (1981). Herpes simplex virus type 1 H i n d l l l fragment L encodes spliced and complementary mRNA species. J. Virol. 39, 559-572. FROHMAN, M. A., DUSH, M. K. and MARTIN, G. R. (1988). Rapid production of full-length cDNAs from rare transcripts: Amplification using a single gene-specific oligonucleotide primer. Proc. Natl. Aca. Sci. USA. 85, 8997-9002 GALLOWAY, D.A., FEN0GLIO, C., SHERCHUCK, M. and McDOUGALL, J.K. (1979). Detection of herpes simplex RNA in human sensory ganglia. Virology 95, 265-268. -155- GALLOWAY, D.A., FENOGLIO, CM. and MCDOUGALL, J.K. (1982) . limited transcription of the herpes simplex virus genome when latent in human sensory ganglia. J. Virol. 41, 686-691. GRANT, S. EDMOND, E. and SYME, J. (1981). A prospective study of cytomegalovirus i n f e c t i o n in pregnancy.I.Laboratory evidence of congenital i n f e c t i o n following maternal primary and reactivated infection. J. Infect. Dis. 143, 24-31. GEBALLE, A.P., LEACH, F.S. and MOCARSKI, E.S. (1986). Regulation of cytomegalovirus late gene expression: T genes are controlled by post transcriptional events. J. Virol. 57, 864-874. GEBALLE, A.P. and MOCARSKI, E.S. (1988). Translational control of cyta>megalovirus gene expression is mediated by uspstream AUG codons. J. Virol. 62, 3334-3340. GEELEN, J.L.M.C., WALIG, C., WEK1HE1M, P. and VAN DER NOORDAA, J. (1978). Human cytomegalovirus DNA: I. Molecular weight and infectivity. J. Virol. 26, 813-816. GIBBS, J.S., CHTOU, H.C., HALL, J.D., MOUNT, D.W., RETONDO, M. J., WELLER, S.K. and COEN, D.M. (1985). Sequence and mapping analysis of the herpes simplex virus DNA polymerase gene predict a C-terminal substrate binding domain. Proc. Natl. Aca. Sci. USA 82, 7069-7973. GIBSON, W. (1981). Immediate-early porteins of human cytomegalovirus strains AD 169, Davis, and Towne differ in electrophoretic mobility. Virology 112, 350-354. GIBSON, W. (1983). Protein counterparts of human and simian cytomegaloviruses. Virology 128. 391-406. GONCZOL, E., PLOTKIN, S.A. (1984). Cells infected with human cytomegalovirus release a factor(s) that stimulates c e l l DNA synthesis. J. Gen. Virol. 65, 1833-1837. GONCZOL, E., DANCZIG, E., BOLDOGH, I., TOTH, T. and VACZI, L. (1985). In vivo model f o r the acute, latent and reactivated phases of cytomegalovirus infection. Acta Microbiologica Hungarica 32, 39-47. GRIFFITHS, P.D. and GRUNDY, J.E. (1987). Molecular biology and immunology of cytomegalovirus. Biochem. J. 241. 313-324. GRUNDY, J.E., MACKENZIE, J.S. and STANLEY, N.F. (1981). Influence of H-2 and non H-2 genes on resistance to murine cytomegalovirus infection. Infect. Immun. 32, 277-286. GRUNDY, J., McKEATING, J., WARD, P., SANDERSON, A. and GRIFFITHS, P. (1987). b2 microglobulin enhances the infectivity of cytomegalovirus and when bound the virus enables classl HLA molecules to be used as a virus receptor. J. Gen. Virol. 68, 793-803. -156- GUPTA, P., ST. JEOR, S. and RAPP, F. (1977). Comparison of the polypeptides of several stans of human cytomegalovirus. J. Gen. Virol. 34, 447-454. HACKETT, P.B., FUCHS, J.A. and MESSING, J.W. (1984). An Introduction to Recombinant DNA Techniques: Basic Experiments in Gene Manipulation. The Benjamin /CXmradngs Publishing Company Inc., California. HACKMAN, R.C., MYERSON, D., MEYER, J.D., SHULMAN, H.M., SALE, G.E., GOLDSTEIN, L.C., RASTETTER, M., FLOURNOY, N. and THOMAS, E.D. (1985). Rapid diagnosis of cytamegaloviral pneumonia by tissue immunoflorescence with a murine monoclonal antibody. J. Infect. Dis. 151. 325-329. HAMES, B.D. and GLOVER, D. M. (1988). Transcription and Splicing. TRL Press Limited, Washington DC. HANAHAN, D. (1983). Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166, 557-580. HAYASHE, K., EIZURU, Y., SATO, S. and MINAMISHIMA, Y. (1985). The role of NK c e l l a c t i v i t y i n age-dependent resistance of mice to murine cytomegalovirus infection. Microbiol. Immunol. 29, 939-950. HETLBRONN, R., JAHN, G., BURKLE, A., FREESE, U-K., FLECKENSTEIN, B. and HAUSEN, Zur H. (1987). Genomic localization, sequence analysis, and transcription of the putative human cytomegalovirus DNA polymerase gene. J. Virol. 61/ 110-124. HENIKOFF, S. (1984). Unidirectional digestion with exonuclease III creates targeted breakpoints for DNA sequencing. Gene 28, 351-359. HO, M. (1982). Cytomegalovirus: Biology and Infection (Current topics in infectious disease: series editors, Greenough, W.B and Merigan, T.C.) New York, Plenum Press. HONESS, R.W. (1984). Herpes simplex and "the herpes complex": diverse observation and a unifying hypothesis. J. Gen. Virol. 65, 2077-2107. HONESS, R.W. and ROIZMAN, B. (1974). Regulation of hepesvirus macrcmolecular synthesis. J. Virol. 14, 8-19. HONESS, R.W. and ROIZMAN, B. (1975). Regulation of hepesvirus macrcmolecular synthesis: sequential transition of polypeptide synthesis requires functional viral polypeptides. Proc. Natl. Acad. Sci. USA. 72, 1276-1280. HUANG, E. S. (1975). Human cytomegalovirus. III. Virus-induced DNA polymerase. J. Virol. 16, 298-310. HUDSON, J.B., MISRA, V.M. and MOSMANN, T.R. (1976). Cytomegalovirus infectivity: Analysis of the phenomenon of centrifugal enhancement of infectivity. Virology 72, 235-243. HUDSON, J.B. (1979). The murine cytomegalovirus as a model for the study of viral pathogenesis and persistent infections. Arch. Virol. 62, 1-29. -157- HUDSON, J.B. (1984). Factors involved in persistent murine cytomegalovirus infections - A review. In: Latent herpesvirus infections in veterinary medicine, pp. 127-147. Edited by G. Wittmann, R.M. Gaskell & H.J. Rziha. The Hague: Martinus Nijhoff. HUDSON, J.B. (1988). Further studies on the mechanism of centrifugal enhancement of cytomegalovirus infectivity. J. Virol. Methods 19. 97-108. HUDSON, J.B., WALKER, D.G. and ALTAMIRANO, M. (1988). Analysis in vitro of two biologically distinct strains of murine cytomegalovirus. Arch. Virol. 102, 289-295. HUNNINGHAKE, G.W., MONICK, M.M., LIU, B. and STINSKI, M.F. (1989). The promoter-regulatory region of the major immediate-early gene of human cytomegalovirus responds to T-lymphocyte stimulation and contains functional cyclic AMP-response elements. J. Virol. 63, 3026-3033. HUTCHINSON, N.I., SOUDERMEYER, R.T. and TOCCI, M.J. (1986). Organization and expression of the major genes from the long inverted repeat of the human cytomegalovirus genome. Virology 155. 160-171. JAHN, G, KNUST, E., SCHMOLLA, H., SARRE, T., NELSON, J.A., MCDOUGALL J.K. and FLECKENSTEIN, B. (1984). Predominant immediate-early transcripts of human cytomegalovirus AD169. J. Virol. 49, 363-370. JAHN, G., KOUZARIDES, T., MACH, M., SCROLL, B.-C., PLACHTER, B, TRAUPE, B., PREDDIE, E., SATCHWELL, S.C., FLECKENSTEIN, B. and BARRELL, B.G. (1987). Map position and nucleotide sequence of the gene for the large structural phosphoprotein of human cytomegalovirus. J. Virol. 61. 1358-1367. JOHNSON, K.P. (1969). Mouse cytomegalovirus: placental infection. J. Infect. Dis. 120, 445-450. JORDAN, M.C. SHANLEY, J.D. and STEVENS, J.G. (1977). Immunosuppression reactivates and disseminates latent murine cytomegalovirus infection. J. Gen. Virol. 37, 419-423. KATZENSTETN, D.A., YU, G.S.M. and JORDAN, M.C. (1983). Lethal infection with murine cytomegalovirus after early viral replicaiton in the spleen. J. Infect. Dise. 148, 406-411. KAUFMAN, R.J. and SHARP, P.A. (1982). Construction of a modular dihydrofolate reductase cDNA gene: analysis of signals utilized for efficient expression. Mol. Cell. Biol. 2, 1304-1319. KEIL, G.M., EBELING-KEIL, A. and KOSZINOWSKI, U.H. (1984). Temporal regulation of murine cytomegalovirus transcription and mapping of viral RNA sythesized at immediate early times after infection. J. Virol. 50, 784-795. KEIL, G.M., FTBI, M. and KOSZINOWSKI, U.H. (1985). Characterization of the major immediate-early polypeptides encoded by murine cytomegalovirus. J. Virol. 54, 422-428. -158- KEIL, G.M., EBELING-KELL, A. and KOSZINOWSKE, U.H. (1987a). Immediate-early genes of murine cytomegalovirus: location, transcripts and translation products. J. Virol. 61, 526-533. KEIL, G.M., EBELING-KEIL, A. and KOSZINOWSKE, U.H. (1987b). Sequence and structural organization of murine cytomegalovirus immediate-early gene 1. J. Virol. 61, 1901-1908. KLTPATRICK, B.A. and HUANG, E-S. (1977). Human cytomegalovirus genome: partial denaturation map and organization of genome sequences. J. Virol. 24, 261-276. KM, K.S. and CARP, R.I. (1971). Growth of murine (Cytomegalovirus in various c e l l lines. J. Virol. 7, 720-725. KIM, K.S. and CARP, R.I. (1972). Abortive infection of human diploid cells by murine cytomegalovirus. Infect. Immun. 6, 793-797. KEM, K.S., SAPIENZA, V., CARP, R.I. and MOON, H.M. (1976a). Analysis of structural polypeptides of purified human cytomegalovirus. J. Virol. 20, 604-611. KEM, K.S., SAPIENZA, V., CARP, R.I. and MOON, H.M. (1976b). Analysis of structural proteins of purified cytomegalovirus. J. Virol. 17, 906-915. KINNEY, J.S., ONORATO, I.M., STEWART, J.A., PASS, R.F., STAGNO, S., CHEESEMAN, S.H., CHIN, J., KUMAR, M.L., YAEGER, A.S., HERRMANN, K.L., HURWITZ, E.S. and SCHONBERGER, L.B. (1985). Cytomegaloviral infection and disease. J. Infect. Dis. 151, 772-774. KOHN, A. (1985). Membrane effects of cytopathogenic viruses. Prog. Med. Virol. 31, 109-167. KOSZINOWSKE, U.H., DEL VAL, M. and REDDEHASE, M.J. (1990) Cellular and molecular basis of to cytomegalovius Infection. Microbiol. Immunol. 154. 189-254. KOUZARIDES, T., BANKEER, A.T., SATCHWELL, S.C., WESTON, K., TOMLINSON, P. and BARREL, B.G. (1987). Sequence and transcription analysis of the human cytomegalovirus DNA polymerase gene. J. Virol. 61, 125-133. KOZAK, M. (1983). Comparison of initiation of protein synthesis in procaryotes, eucaryotes, and organelles. Microbiological Reviews 47, 1-45. KOZAK, M. (1984). Compilation and analysis of sequences upstream from the translation start site in eukaryotic mRNAs. Nucleic Acids Res. 12, 857-872. LaFEMLNA, R.L. and HAYWARD, G.S. (1983). Replicative forms of human cytomegalovirus DNA with joined temini are found in permissively infected human cells but not in non-permissive Balb/c-3T3 mouse cells. J. Gen. Virol. 64, 373-389. -159- LaFEMTNA, R.L. and HAYWARD, G.S. (1986). Constitutive and retinoic acid-inducible expression of cytomegalovirus immediate-early genes in human teratocarcincma cells. J. Virol. 58, 434-440. LaFEMINA, R.L. and HAYWARD, G.S. (1988). Differences in c e l l type-specific block to immediate early gene expression and DNA replication of human, simian and murine cytomegalovirus. J. Gen. Virol. 69, 355-374. LAKEMAN, A.D. and OSBORN, J.E. (1979). Size of infectious DNA from human and murine cytomegalovirus. J. Virol. 30, 414-416. LEE,W., MTTCHEL, P. and TJIAN, R. (1987). Purified transcription factor AP-1 interancts with TPA-inducible enhancer elements. Cell. 49, 741-752. LEVIN, M.J., KENALDO, CR., LEARY, P.L., ZAIA, J.A. and HIRSH, M.S. (1979). Immune response to herpesvirus antigens in adults with acute cytomegaloviral mononucleosis. J. Infect. Dis. 140. 851-857. LOH, L. and HUDSON, J.B. (1979). Interaction of murine cytomegalovirus with separated populations of spleen cells. Infect. Immun. 26, 853-860. LOH, L. and HUDSON, J.B. (1982). Murine cytomegalovirus infection in spleen and its relationship with to immunosuppression. Infect. Immun. 32, 1067-1072 MACH, M., STAMMINGER, T. and JAHN, G. (1990). Human cytomegalovirus: Recent aspects from molecular biology. J. Gen. Virol. 70, 3117-3146. MANIATIS, T., FRITSCH, E.F. and SAMBROOK, J. (1982). Molecular cloning. Cold Spring Harbor Laboratory. Cold Spring Harbor, New York. MANNTNI, A., and MEDEARIS, D.N., Jr (1961). Mouse salivary gland virus infections. Am. J. Hyg. 73, 329-343. MARKS, J.R. MERCER, J.A. and SPECTOR, D.H. (1983). Transcription in mouse embryo cells permissively infected by murine cytomegalovirus. Virology 131. 247-254. MARKS, J.R. and SPECTOR, D.H. (1984). Fusion of the termini of the murine cytomegalovirus genome after infection. J. Virol. 52, 24-28. MARKS, J.R. and SPECTOR, D.H. (1988). Replication of the murine cytomegalovirus genome: structure and role of the termini in the generation and cleavage of concatenates. Virology 162, 98-107. MATHEWS, R.E.F. (1982). Classification and nomenclature of viruses. Intervirology 17, 1-181. MAYO, D.R., ARMSTRONG, J.A., and HO, M. (1977). Reactivation of murine cytomegalovirus by cyclaphospahnu.de. Nature (London) 267. 721-723. McDONOUGH, S.H. and SPECTOR, D.H. (1983). Transcription in human fibroblasts permissively infected by human cytomegalovirus strain AD 169. Virology 125, 31-46. -160- McOONOUGH, S.H., S T A P R A N S, S.I. and SPECTOR, D.H. (1985). Analysis of the major transcripts encoded by the long repreat of human cytomegalovirus strain AD169. J. Virol. 53, 711-718. McLAUGHLAN, J. and CLEMNTS, J.B. (1982). A 3' co-terminus of two early herpes simplex virus type 1 mRNAs. Nucleic Acids Res. 10, 501-512. MERCER, J.A., MARKS, J.R. and SPECTOR, D.H. (1983). Molecular cloning and restr i c t i o n endonuclease mapping of the murine cytomegalovirus genome (Smith strain). Virology 129, 94-106. MERCER, J.A. and SPECTOR, D.H. (1986). Pathogenesis of acute murine cytomegalovirus infection in resistant and susceptible strains of mice. J. Virol. 57, 497-504. MERCER, J.A., WILEY, C.A. and SPECTOR, D.H. (1988). Pathogenesis of murine cytomegalovirus infection: identification of infected cells in the spleen during acute and latent infections. J. Virol. 62, 987-997. M J M S , C.A. and GOULD, J. (1978). The role of macrophages in mice infected with murine cytomegalovirus. J. Gen. Virol. 41, 143-153. MICHELSON, S., HORCNICEANU, F., DRESS, M. and TARDY-PANIT, M. (1979) . Human cytomegalovirus-induced immediate early antigens: analysis in sodium dodecyl sulfate-pplycrylamide gel electrophoresis after immunoprecipitation. J. Virol. 32, 259-267. MISRA, V., MLTLLER, M.T., CHANTLER, J.K. and HUDSON, J.B. (1978). Regulation of murine cytomegalovirus gene expression 1. Transcription during productive infection. J. Virol. 27, 263-268. MISRA, V. and HUDSON, J.B. (1980). Minor base sequence differences between the genomes of two strains of murine cytomegalovirus differing in virulence. Arch. Virol. 64, 1-8. MOCARSKE, E.S. and STINSKI, M.F. (1979). Persistence of the cytomegalovirus genome in human cells. J. Virol. 31, 761-775. MOCARSKE, E.S., ABENES, G.B., MANNING, W.C. SAMBUCETT1. L.C. and (SHERRINGTON, J. M. (1990). Molecular genetic analysis of cytomegalovirus and gene regulaion i n growth, persistence and latency. Microbiol. Immunol. 154, 47-74. MORGAN, C., ROSE, H.M. and MEDNIS, B. (1968). Electron microscopy of herpes simplex virus. I. Entry. J. Virol. 2, 507-516. MOSMANN, T.R. and HUDSON, J.B. (1973). Some properties of the genome of murine cytomegalovirus. Virology 54, 135-149. MOSMANN, T.R. and HUDSON, J.B. (1974). Structural and functional heterogeneity of the murine cytomegalovirus genome. Virology 62, 175-183. MULLER, M.T. and HUDSON, J.B. (1977a). Cell cycle dependency of murine cytomegalovirus replication in synchronized 3T3 cells. J. Virol. 22, -161- 267-272. MULLER, M.T. and HUDSON, J.B. (1977b). Thymidine kinase activity in mouse 3T3 c e l l s infected by murine cytomegalovirus (MCV). Virology 80, 430-433. MULLER, M.T. and HUDSON, J.B. (1978). Murine cytomegalovirus DNA synthesis in nuclear monolayers. Virology 88, 371-378. MULLER, M.T., MISRA, V., CHANTLER, J.K. and HUDSON, J.B. (1978). Murine cyotmeglovirus gene expression during nonproductive infection in Go-phase 3T3 cells. Virology 90, 279-287. MURCHIE, M.J. and McGEOCH, D.J. (1982). DNA sequence analysis of an immediate-early gene region of the herpes simplex virus type 1 genome (map coordinates 0.950-0.978). J. Gen. Virol. 62, 1-15. NABLE, G. and BALTIMORE, D. (1987). An inducible transcription factor activates expression of human immuno-deficiency virus i n T ce l l . Nature. 326, 711-713. NARAQI, S, JACKSON, G.G., JONASSON, O. and YAMASHIROYA, H.M. (1977). Prospective study of prevalence, incidence and source of herpesvirus infections i n patients with renal allografts. J. Infect. Dis. 136, 531-540. NEDRUD, J.D., Wu, R. (1984). In vitro mouse cytomegalovirus infection of mouse tracheal epithelial cells requires the presence of other ce l l types. J. Gen. Virol. 65, 671-679. NELSON, J.A. and GROUDINE, M. (1986). Transcriptional regulation of the human cytomegalovirus major immediate-early gene i s associated wiht induction of DNase 1-hypresensitive sites. Mol. Cell. Biol. 6, 452-461. NELSON, J.A., REYNOLS-KOHLER, C., OLDSTONE, M.B.A. and WILEY, C.A. (1988). HIV and HCMV coinfect brain cells in patients with AIDS. Virology 165, 286-290. NELSON, J.A., GNANN, J.W. and GHAZAL, P. (1990). Regulation and tissue specific expression of human cytomegalovirus. Microl. Immunol. 154. 75-199. NOWAK, B., GMEHNER, A., SARNOW, P., LEVTNE, A.J. and FLECKENSTEIN, B. (1984). Physical mapping of human cytomegalovirus genes: identification of DNA sequences coding for a virion phosphoprotein of 71 kDa and a viral 65-kDa polypeptide. Virology 134, 91-102. OLDING, L.B. JENSEN, F.C. and OLDSONE, M.B.A. (1975). Pathogenesis of cyotmegalovirus infection: I. Activation of virus from bone marrow derived lymphocytes by in vitro allogneic reaction. J. Exp. Med. 141. 561-572. OLDING, L.B., KINGSBURY, D.T. and OLDSOTNE, M.B.A. (1976). Pathogenesis of cytomegalovirus infection. Distribution of vi r a l products, immune -162- complexes and autoimmunity during latent murine infection. J. Gen. Virol. 33, 267-280. OIDSTONE, M.B.A. (1989). Viral persistence. Cell. 56, 517-520. ORAM, J.D., DOWNING, R.G., AKRIGG, A., DOLLERY, A.A., DUGGLEBY, C. J., WILKINSON, G.W.G. and GREENAWAY, P.J. (1982). Use of recombinant plasmids to investigate the structure of the human cytomegalovirus genome. J. Gen. Virol. 59, 111-129. OSBORN, J.E. and WALKER, D.L. (1970). Virulence and attenuation of murine cytomegalovirus. Infect. Immun. 3, 228-236, OSBORN, J.E. (1981). Cytomegalovirus: pathogenicity, immunology, and vaccine initiatives. J. Infect. Dis. 143, 618-630. OSBORN, J.E. (1982). CMV-herpesviruses of mice. In: The Mouse in Biochemical Research Volume II, pp 267-292, edited by Foster H.L., Fox, J.G., Small, J.D. Academic Press, New York. PIZZORNO, M., O'HARE, P., SHA, L. LaFEMTNA, R.L. and HAYWARD, G.S. (1988). Transactivation and autoregulation of gene expression by the immediate-early region 2 gene products of human cytomegalovirus. J. Virol. .62, 1167-1179. PLACHTER, B., TRAUPE, B., ALBRECHT, J. and JAHN, G. (1988). Abundant 5kb RNA of human cytomegalovirus without a major translational reading frame. J. Gen. Virol. 69, 2251-2266. PORTER, K.R., STARNES, D.M. and HAMILTON, J.D. (1985), Reactivation of murine cytomegalovirus in kidney. Kidney Int. 28, 922-925. PRESTON, CM. and McGEOCH, D.J. (1981). Identification and mapping of two polypeptides encoded within the herpes simplex virus type 1 thymidine kinase gene sequences. J. Virol. 38, 593-605. PRICE, P., WINTER, J.G., NIKOLETTT, S., HUDSON, J.B. and SHELLAM, G.R. (1987) . Functional changes in murine macrophages infected with cytomegalovirus relate to H-2-determined sensitivity to infection. J. Virol. 61, 3602-3606. PRINCE, A.M., SZMUNESS, W., MTTI.TAN, S.J. and DAVID, D.S. (1971). A serologic study of cytomegalovirus infections associated with blood transfusions. N. Engl. J. Med. 284, 1125-1131. QUINNAN, G.V.Jr. and MANISCHEWTTZ, J.F. (1987). Genetically determined resistance to lethal murine cytomegalovirus infection i s mediated by interferon dependent and independent restriction of virus replication. J. Virol. 61, 1875-1881. RAVTNDRANATH, R.M.H. and GRAVES, M.C. (1990). Attenuated murine cytomegalovirus binds to N-acety lglucosamine, and shift to virulence may involve recognition of sialic acid. J. Virol. 64, 5430-5440. -163- RICE, G.P.A., SCHRIER, R.D. and OLDSONE, M.B.A. (1984). Cytomegalovirus infects human lymphocytes and moncicytes: Virus expression is restricted to immediate early gene products. Proc. Natl. Aca. Sci. USA. 81, 6134-6138. RODRIGUEZ, T.R., LOEPFE, T.R. and STINSKI, M.F. (1983). Human cytomegalovirus persists in cells treated with interferon. Arch. Virol. 77, 277-281. ROIZMAN, B. (1982). The family Herpesviridae. General description, taxonomy and classification. In: The viruses, edited by Roizman, B. Plenum Press, New York. ROIZMAN, B. and BATTERSON, W (1985). Herpesviruses and their Replication. In: Virology, edited by Fields, B.N. et al., 497-526. Raven Press, New York. ROIZMAN, B. (1990). Herpesviridae: a brief introduction. In: Virology, edited by Fields, B.N. et al. Raven Press, New York. ROWE, W.P., HARTLEY, J.W., WATERMAN, S., TURNER, H.C. and HUEBNER, R.J. (1956). Cytopathogenic agent resembling human salivary gland virus recovered from tissue cultures of human adenoids. Proc. Soc. Exp. Biol. Med. 92, 418-424. ST.JEOR, S.C., and HUTT, R. (1977). Cell DNA replication as a function in the synthesis of human cytomegalovirus. J. Gen. Virol. 37, 65-73. SAMBROOK, J., FRTTSCH, E. F. and MANIATIS, T. (1989). Molecular cloning. Second Edition. Cold Spring Habor Laboratory. Cold Spring Harbor, New York. SAMBUCETTT, L., CHERRINGTON, J., WILKINSON, G. and MOCARSKI, E. (1989). NF-kappa B activation of the cytomegalovirus enhancer i s mediated by a viral transactivator and by T cel l stimulation. EMBO. 8, 4251. SALAHUDDIN, S.Z., ABLASHI, D.V., MARKHAM, P.D., JOSEPHS, S.F., STRUZENEGGER, S., KAPLAN, M., HALLIGAN, G., BIBERFELD, P., WONG-STAAL, F., KRAMARSKY, B. and GALLO, R.C. (1986). Isolation of a new virus, HBLV, in patients with lymphoproliferative disorders. Science 234, 596-602. SCHRIER, R.D., NELSON, J.A. and OLDSONE, M.B.A. (1985). Detection of human cytomegalovirus in peripheral blood lymphocytes in a natural infection. Science 230, 1048-1051. SELGRADE, M.F. and OSBORNE, J.E. (1974). Role of macrophages in resistance to murine cytomegalovirus infectin. Infect. Immun. 10. 1383-1390. SELGRADE, M.F., NEDRUD, J.G., COLLIER, A.M. and GARDNER, D.E. (1981). Effects of c e l l souce, mouse strain, and immunosuppressive treatment on production of virulent and attenuated murine cytomegalovirus. Infect. Immun. 33, 840-847. -164- SHARP, P.A., BERK, A.J. and BERGET, S.M. (1980). Transcription maps of adenovirus. Methods Enzymol. 65, 750-769. SHARP, J.A., WAGNER, M.J. and SUMMERS, W.C. (1983). Transcription of herpes simplex virus gene in vivo: Overlap of a late promoter with the 3' end of the early thymidine kinase gene. J. Virol. 45, 10-17. SHELLAM, G.R. and FLEXMAN, J.P. (1986). Genetically determined resistance to murine cytoanegalovirus and herpes simplex virus in newborn mice. J. Virol. 58, 152-156. STLVERSTETN, S., BACHENHEXMER, S.L., FRENKEL, N. and ROIZMAN, B. (1973). Relationship between post-transcriptional adenylation of herpes virus RNA and messenger RNA abundance. Proc. Natl. Acad. Sci. USA. 70, 2101-2105. SINGH, L. and JONES, K.W. (1984). The use of heparin as a simple cost effective means of controlling background in nucleaic acid hybridization procedures. Nucleic Acid Res. 12, 5627-5638. SMITH, J.D. and DEHARVEN, E. (1973). Herpes simplex virus and human cytomegalovirus replication in WI-38 c e l l s . I. Sequence of viral replication. J. Virol. 12, 919-930. SMITH, M.G. (1954). Propagation of salivary gland virus of the mouse in tissue cultures. Proc. Soc. Exp. Biol. Med. 86, 435-440. SMITH, M.G. (1956). Propagation fo tissue culture of cytopathogenic virus from human salivary gland virus (SGV) disease. Proc. Soc. Exp. Biol. Med. 92, 424-430. SPAETE, R.R. and MOKARSKI, E. S. (1985a). The a sequence of the cytomegalovirus genome functions as a cleavage/packaging signal for herpes simplex defective genomes. J. Virol. 54, 817-824. SPAETE, R.R. and MOKARSKI, E. S. (1985b). Regulation of cytomegalovirus gene expresion: alpha and beta promoters are transactivated by viral functions in permisssive human fibroblasts. J. Virol. 56, 135-143. SPECTOR, D.H., HOCK, L.J. and TAMASHIRO, J.C. (1982). Cleavage maps for human cytomegalovirus DNA strain AD169 for restriction endonucleases EcoRl, Bglll and Hindlll. J. Virol. 42, 558-582. SPECTOR, D.H., KLUCHER, K.M., RABERT, D.K. and WRIGHT. D.A. (1990). Human cytomegalovirus early gene expression. Microbiol. Immunol. 154. 21-46. STAGNO, S. PASS, R.F., DWORSKY, M.E. and ALFORD, C.A. (1982). Maternal cytomegalovirus infection and perinatal transmission. Clin. Obstet. Gynecol. 25, 563-576. STAGNO, S. PASS, R.F., DWORSKY, M.E., HENDERSON, R.E., MOORE, E.G., WALTON, P.D. and ALFORD, C.A. (1982). Congenital cytomegalovirus infection: relative iiiportance of primary and recurrent maternal infection. N. Engl. J. Med. 306, 945-949. -165- STAMMJJNGER, T. and FLECKENSTEiN, B. (1990). Immediate-early transcription regulation of human cytomegalovirus. Microbiol. Immunol. 154. 3-20. STAPRANS, S.I. and SPECTOR, D.H. (1986). 2.2-kilobase class of early transcsripts encoded by human cytomegalovirus strain AD169. J . Virol. 57. 591-602. STAPRANS, S.I., RABERT, D.K. and SPECTOR, D.H. (1988). Identification of sequence requirements and trans-acting functions necessary for regulated expression of a human cytomegalovirus early gene. J . Virol. 62. 3463-3473. STARR, S.E., TOLPIN, M.D., FRIEDMAN, H.M., PAUKER, K. and PTJDTKIN, S.A. (1979). Impaired cellular immunity to cytomegalovirus in congenitally infected children and their mothers. J . Infect. Dis. 140. 500-505. STENBERG, R.M., THOMSEN, D.R. and STINSKI, M.F. (1984). Structural analysis of the major immediate early gene of human cytomegalovirus. J . Virol. 49, 190-199. STENBERG, R.M., WITTE, P. R. and STINSKI, M.F. (1985). Multiple spliced and unspliced transcripts from human cytomegalovirus immediate-early region 2 and evidence fro a common initiation site within immediate early region 1. J . Virol. 56, 665-675. STENBERG, R.M., DEPTO, A.S., PORTNEY, J . and NELSON, J.A. (1989). Regulated expression of early and late RNAs and proteins from the human cytomegalovirus immediate-early gene region. J . Virol. 63, 2699-2708. STERN, H. and TUCKER, S.M. (1973). Prospective study of cytcmegalovus infection in pregnancy. Br. Med. J . 1, 268-270. STEVEN, J.G. (1989). Human herpesviruses: aconsideration of the latent state. Microbiol. Reviews. 53, 318-332. STINSKI, M.F. (1976). Human cytomegalovirus: Glycoproteins associated with virions and dense bodies. J . Virol. 19, 594-609. STINSKI, M.F. (1977). Synthesis of proteins and glycoproteins in cells infected with human cytomegalovirus. J . Virol. 23, 751-767. STINSKI, M.F. (1978). Sequence of protein synthesis in cells infected by human cytomegalovirus: early and late virus-induced polypeptides. J . Virol. 26, 686-701. STINSKI, M.F., MOCARSKI, E.S. and THOMSEN, D.R. (1979). DNA of human cytomegalovirus: size heterogeneity and defectiveness resulting from serial undiluted passage. J . Virol. 31, 231-239. STINSKI, M.F. and ROEHR, T.J. (1985). Activation of the major immediate early gene of human cytomegalovirus by cis-acting elements in the promoter-regulatory sequence and by virus-specific trans-acting components. J . Virol. 55, 431-441. -166- TEGMEYER, P.J. and CRAIGHEAD, J.E. (1968). Infection of adult mouse macrophage in vitro with cytomegalovirus. Proc. Soc. Exp. Biol. Med. 129. 690-694. THCMAS, P.S. (1980). Hybridization of denatured RNA and small DNA fragments transferred to nitrocellulose. Proc. Natl Aca. Sci. USA. 77, 5201-5205. VTRTANEN, A., GHARDI, P., NASLUND, A., Ix̂ MCULLEC, J.M., PETTERSSON, U., and PERRICAUDET, M. (1984). mRNAs from human adenovirus 2 early region 4. J. Virol. 51, 822-831. VONKA, V., ANISIMOVA, E. and MACEK, M. (1976). Replication of cytomegalcvirus in human epitheloid diploid c e l l line. Arch. Virol. 52, 283-296. WAGNER, E.K. (1984). Individual HSV transcripts: characterization of specific genes. In: The herpesviruses, vol 3, pp 45-104, edited by Roizman, B. Pleknum Press, New York. WALKER, D.G. and HUDSON, J.B. (1987). Analysis of immediate-early and early proteins of murine cytomegalovirus in permissive and nonpermissive cells. Arch. Virol. 92, 103-119. WALKER, D.G. and HUDSON, J.B. (1988a). The DNA-binding properties of immediate early and early proteins of murine cytomegalovirus. Arch. Virol. 102, 233-243. WALKER, D.G. and HUDSON, J.B. (1988b). Further characterization of the murine cytomegalovirus induced early proteins i n permissive and nonpermissive cells. Arch. Virol. 101, 143-154. WANER, K.L., and WELLER, T.H., (1974). Behaviour of human cytomegaloviruses in cel l cultures of bovine and simian origin. Proc. Soc. Exp. Biol. Med. 145, 379-384. WANER, J.L. (1989). Human cyotmegalovirus. In: Virus-induced immunosuppression, edited by Spector, S., Bendinelli, M and Friedman, H. Plenum Press, New York and London. WANG, T.S-F., WONG, S.W. and KORN, D. (1989). Human DNA polymerase alpha: predicted functional domains and relationships with v i r a l DNA polymerases. FASEB J. 3, 14-21. WATHEN, M.W. and STINSKI, M.F. (1982). Temporal patterns of human cytomegalovirus transcription: mapping the viral RNAs synthesized at immediate early, early and late times after infection. J. Virol. 41. 462-477. WATSON, R.J., SULLIVAN, M. and VANDE WOUDE, G.F. (1981). Structures of two spliced herpes simplex virus type 1 immediate-early mRNA's which map at the junctions of the unique and reiterated regions of the virus DNA S component. J. Virol. 37, 431-444. -167- WEBER, F., DeVTTLTERS, J. and SCHAFFNER, W. (1984). An SV40 "enhancer trap" incorporates exogenous enhancers or generates enhancers form its own sequences. Cell. 36, 986-992. WFT.T.FR, T.H. MACAULEY, J.C., CRAIG, J.M., and WIRTH, P. (1957) . Isolation of intranuclear inclusion producing agents from infants with illnesses resembling cytomegalic inclusion disease. Proc. Soc. Exp. Biol. Med. 94, 4-12. WESTSTRATE, M.W., GEELEN, J.L.M.C. and VAN DER NCORDAA, J. (1980). Human cytomegalovirus DNA: physical maps for the restriction endonucleases Bglll, Hindlll, and Xbal. J. Gen. Virol. 49, 1-21. WHYTE, P.F., SUBRAMANIAM, R. and HUDSON, J.B. (1987). Characterization of a murine cyobiegalovirus-induced immunosuppressive factor. Arch. Virol. 96, 169-183. WICKNER, W. (1979). The assembly of proteins into biological membranes: the membrane trigger hypothesis. Ann. Rev. Biochem. 48, 23-45. WINSTON, D.J., HO, W.G., HOWELL, CL., MILLER, M.J., MICKEY, R., MARTIN, W.J., LIN, C.H. and GALE, R.P. (1980). Cytomegalovirus infections associated with leukocyte transfusions. Ann. Intern. Med. 93, 671-675. WISE, T.G., MANISCHEWTTZ, J.E., QUTNNAN, G.V., AULAKH, G.S., and ENNIS, F.A. (1979). Latent cytomegalovirus infection of BALB/c mouse spleens detected by an explant culture technique. J. Gen. Virol. 44, 551-556. WOLF, H. and ROIZMAN, B. (1978). The regulation of Lamda (structural) polypeptide synthesis in hepes simplex virus types 1 and 2 infected c e l l s . In: Oncogenesis and herpesviruses, pp 327, edited by de-The, G. et al, International agency for research on Cancer, Lyon. WRIGHT, D.A., STAPRANS, S.I., and SPECTOR, D.H. (1988). four phosphoproteins with common animo termini are encoded by cytomegalovirus. J. Virol. 62, 331-340. WRIGHT, D.A. and SPECTOR, D.H. (1989). Post transcriptional regulation of a class human cytomegalovirus phosphoproteins encoded by an early transcription unit. J. Virol. 63, 3117-3127. WU, B.C., and HO, M. (1979). Characteristics of infection of B and T lymphocytes from mice after inoculation with cytomegalovirus. Infect. Immun. 24, 856-864. WU, C.A., NELSON, N.J., McGEOCH, D.J. and CHALLBERG M.D. (1988). Identification of herpes simplex virus type 1 genes required for origin dependent DNA synthesis. J. Virol. 62, 435-443. YAMAGUCHI, T., SHTNAGAWA, Y. and POLLARD, R.B. (1988). Relationship between the production of murine cytomegalovirus and interferon in macrophages. J. Gen. Virol. 69, 2961-2971. ZIPSER, D., LIPSICH, L. and KWOH, J. (1981). Mapping functional domains in the promoter region of the herpes thymidine kinase gene. Proc. Natl. Acad. Sci. USA, 78, 6276-6280. -168- 7.0 APPENDIX HOMOLOGY OF HSV-2 EcoRl M FRAGMENT TO MOUSE HINDIII DNA FRAGMENT The objective of this study was to isolate MCMV cDNAs coding for the viral DNA polymerase (pol). A restriction fragment (EcoRl M) of the HSV-2 genome, known to contain the HSV DNA pol gene was selected as a probe to screen the MCMV DNA pol cDNAs. Although this investigation was unsuccessful, the results of the study were interesting and observations were noteworthy. (All the literature references in this appendix are included in Section 6.0, above). 6.1 RESULTS 6.1.1 HYBRIDIZATION OF El TO E10 cDNAs TO HSV-2 EcoRl M FRAGMENT Since MCMV DNA replication commences at 8-12 hrs p.i. (Misra et al., 1978; Chancier and Hudson, 1978; Marks et al., 1983), the E cDNAs were selected for the isolation of MCMV DNA pol cDNA. The ten characterized E cDNAs were slot blotted along with controls of Smith DNA and Lambda gtlO DNA. The blot was hybridized to the HSV-2 EcoRl M probe. The probe hybridized nonspecifically to most of the cDNAs El, E4, E5, E6, E7, E8 and E10, and to Smith DNA, but not to Lambda gtlO (not shown). The nonspecific binding was probably due to high GC regions present in either the HSV-2 M fragment, the cDNAs sequences or both. The next step was to make an attempt to isolate the pol cDNA directly from the unscreened E cDNAs using the HSV-2 EcoRl M fragment as a probe. 6.1.2 SCREENING AND CHARACTERIZATION OF E CDNAs HYBRIDIZING TO HSV-2 EcoRl M FRAGMENT I. SCREENING WITH HSV-2 EcoRl M FRAGMENT PROBE The unscreened E cDNAs were selected for the DNA pol gene by hybridizing -169- the recombinant plaques to the HSV-2 EcoRl M probe. Ten positives were picked of which the four (DP2, DP3, DP5 AND DP8) that hybridized strongly to both the HSV-2 EcoRl M fragment and MCMV Smith strain DNA probes during the second screening, were selected for further analysis. II. ESTIMATION OF SIZES AND SOUTHERN BLOT ANALYSIS OF DP CDNAs The sizes of the cDNA inserts were estimated by separating the EcoRl digested cDNA fragments on a 1% agarose gel along with Lambda Hindlll fragments as molecular weight markers. As a control, MCMV Smith Hindlll 0 fragment was also present in one of the lanes. The DNA fragments were transferred to a nylon membrane and hybridized to the Smith DNA probe to confirm the origin of the cDNAs. A l l the DP cDNAs and the Smith Hindlll 0 fragment (positive probe) hybridized to Smith DNA (Figure 41). The blot was washed to strip off the probe and reused to hybridize to 3T3L1 DNA probe. Unfortunately, a l l the DP clones (DP2, DP3, DP5 and DP8) hybridized to 3T3L1 DNA probe while the Smith Hindlll 0 fragment (negative control) did not hybridize to 3T3L1 DNA (Figure 42). The estimated sizes of the inserts were 1.0, 1.45, 3.16 and 3.2 kb for DP2, DP3, DP5 and DP8, respectively. III. CHARACTERIZATION OF DP CDNAs The DP cDNAs were mapped by the Southern blot method with stringent washes at 55°C (0.1X SSPE) rather than 50°C. None of the DP clones hybridized to Smith H i n d l l l fragments. However, two of the four clones DP3 and DP5 hybridized to a 5.3kb Hindlll fragment from 3T3L1 (mouse cell) DNA as shown in Figures 39 and 40, respectively and yet neither hybridized to Hindlll fragments from Smith DNA. As a positive control, the blots were washed to str i p off the probe and rehybridized to the Smith DNA probe (Figures 43 and -170- 44) . The Smith DNA probe detected the MCMV DNA H i n d l l l fragments and showed no h y b r i d i z a t i o n t o 3T3L1 DNA H i n d l l l fragments. The two clones DP2 and DP8 bound nonspecif i c a l l y t o most H i n d l l l fragments of Smith and 3T3L1 DNA on the b l o t s and t h i s may be due t o the presence of high GC region w i t h i n the cDNAs (not shown). Therefore, DP3 and DP5 cDNAs are c e l l u l a r (murine) i n o r i g i n with probable homology t o HSV-2 EcoRl M fragment. -171- Figure 41: Southern blot analysis of DP2. DP3, DP5 and DP8 probed with Smith DNA. The DNAs of Lambda gtlO recombinants with DP cDNA inserts were subjected to EcoRl digestion and electrophoresed (500ng/well) through a 1% gel along with Smith Hind III 0 fragment (150ng) as a positive control. The gel was 32 Southern blotted and hybridized to P-labelled Smith DNA probe. Eco Rl Hind pacyc DP 2 DP3 DP 5 DP8 Smith DNA Probe -172- Figure 42: Southern blot analysis of DP2. DP3. DP5 and DP8 probed with 3T3L1 DNA. The blot i n the previous figure was washed to strip off the probe and 32 rehybridized to P-labelled 3T3L1 (mouse cell) DNA probe. Eco Rl Hind III pacyc 184 + DP2 DP3 DP5 DP8 0 (smith) 3T3 II D N A Probe -173- Figure 43: Mapping of cDNA DP3. 3T3L1 DNA (lug), Smith DNA (S) (250ng) and Lambda DNA (250ng) were subjected t o H i n d l l l d i g e s t i o n , electrophoresed through a 0.7% agarose gel and t r a n s f e r e d t o a nylon membrane. As a posi t ive control , the blot was 32 hybridized to P-labelled DP3 cDNA probe and autoradiographed. The blot 32 was washed to s t r i p off the probe and rehybridized to P-labelled Smith DNA probe. B L O T A H I N D I III 8 3T3L1 S 3 T 3 L 1 P R O B E i D P 3 S M I T H -174- Figure 44: Mapping of cDNA DP5. 3T3L1 DNA (lug), Smith DNA (S) (250ng) and Lambda DNA (250ng) were subjected t o H i n d l l l d i g e s t i o n , electrophoresed through a 0.7% agarose g e l and t r a n s f e r e d t o a nylon membrane. As a p o s i t i v e control, the b l o t was . . 32 hybridized t o P - l a b e l l e d DP5 cDNA probe and autoradiographed. The b l o t . . 32 was washed t o s t r i p o f f the probe and rehybridized t o P - l a b e l l e d Smith DNA. probe. B L O T B HINDI III A SL 3T3LI X S 3T3L1 jN45.3kb P R O B E : D P 5 S M I T H -175- 6.1.3 RNA SLOT BLOT ANALYSIS TO MEASURE LEVELS OF TRANSCRIPTS OF DP5 CDNA Experiments were performed in which DP5 cDNA (Lambda gtlO recombinant) probe was used to monitor the levels of respective transcript (s) during the course of a 14 hr infection. The results (Figure 45) indicated that there is a significant and approximately similar amount of transcripts present before (mock infected) and during the infection. The DP5 DNA does not hybridize to Smith DNA in this experiment probably because the stringent washes were done at higher temperatures (55°C instead of 50°C). Since DP5 cDNA hybridized strongly to RNA at 0 hr (mock infected RNA) and did not hybridize to Smith DNA, these results confirmed its cellular origin. As a positive control, 3T3L1 DNA probe hybridized to transcripts before and during infection. It also hybridized to Smith DNA to same extent, confirming the probability of some sequence homology as previously suspected i n our laboratory (unpublished data). The Smith DNA probe hybridized moderately to RNA at 0 hrs (mock infected RNA) perhaps due to specific or nonspecific binding to c e l l transcripts or rRNA. As the time elapsed, the Smith DNA probe hybridized to MCMV transcripts present on the blot. Lambda gtlO DNA probe (negative control) showed no hybridization to any transcripts or Smith DNA present on the blot. In summary, the isolation of MCMV DNA pol cDNA failed for reasons discussed below. However, these experiments did result in the isolation of two definite cellular cDNAs mapping to a 5.3kb Hindlll mouse DNA fragment that may have some homology to HSV-2 EcoRl DNA fragment. -176- Figure 45: Analysis of t r a n s c r i p t i o n probed with DP5 cDNA. RNA was is o l a t e d from infected 3T3L1 c e l l s at d i f f e r e n t time i n t e r v a l s (0 hr s , 1 t o 8 hrs p . i . , 11 hrs p . i . and 14 hrs p.i.) and s l o t blotted (3ug RNA/slot). Mock infected RNA (0 hrs) and 25ng Smith DNA (S) were present on the b l o t as negative and p o s i t i v e controls, respectively. The bl o t s were hybridized t o 3 2 P - l a b e l l e d 3T3L1 DNA (positive c o n t r o l ) , Smith DNA, Lambda gtlO (negative control) and DP5 cDNA probes. DP5 -177- 6.2 DISCUSSION HSV-2 ECORl M FRAGMENT BDMOLOGY TO MOUSE HINDIII DNA FRAGMENT MCMV-induced DNA polymerase a c t i v i t y was f i r s t demonstrated by M u l l e r and Hudson (1978) and i t s l o c a t i o n w i t h i n the v i r a l genome has r e c e n t l y been mapped by Spencer e t a l . (unpublished d a t a ; A b s t r a c t . CMV workshop, 1989) t o r e s t r i c t i o n fragments H i n d l l l H-D and EcoRl B . The i n v e s t i g a t o r s mapped the MCMV DNA p o l gene by h y b r i d i z i n g the H i n d i subfragment o f HCMV EcoRl M f r a g m e n t , known t o c o n t a i n the DNA p o l gene, t o MCMV Smith DNA. The t r a n s c r i p t i o n s i t e and the termination s i t e a r e i n H i n d l l l fragments D and H , r e s p e c t i v e l y and t h e gene c o d e s f o r an u n s p l i c e d 3.7kb t r a n s c r i p t (Spencer e t a l . , 1989; CMV workshop). T h e DNA r e s t r i c t i o n fragment EcoRl M o f HSV-2 c o n t a i n s a s i g n i f i c a n t p o r t i o n o f t h e HSV DNA polymerase (pol) gene (Gibbs e t a l . , 1985). The HSV DNA polymerase c o n t a i n s conserved sequences t h a t are common t o DNA polymerases o f Human, HCMV, EBV and V a c c i n i a v i r u s (Wang e t a l . , 1989). HCMV and Bovine h e r p e s v i r u s - 1 DNA p o l genes were mapped by h y b r i d i z a t i o n t o HSV DNA p o l gene (Wang e t a l . , 1989). I n t h i s s tudy I have observed t h a t the HSV-2 EcoRl M f r a g m e n t h y b r i d i z e d n o n s p e c i f i c a l l y t o E cDNAs E l t o ElO under normal s t r i n g e n t c o n d i t i o n s and t h i s may be a t t r i b u t e d t o a h i g h G-C content o f a p p r o x i m a t e l y 68% i n the HSV-2 genome and G-C r i c h r e g i o n s i n MCMV genome (Honess , 1984). However, none o f the t e n E cDNAs o r i g i n a t e from fragments H i n d l l l D o r H ( S e c t i o n 3.1) and t h e r e f o r e ,none encode t h e MCMV DNA polymerase. Two cDNAs from my MCMV E l i b r a r y DP3 and DP5 cDNAs a r e o f c e l l u l a r o r i g i n , map t o a common H i n d l l l fragment (5.3kbp) and show n o n s p e c i f i c b i n d i n g t o -178- Smith DNA under normal stringent conditions (50°C). This study demonstrates the possible homology between the HSV-2 EcoRl M fragment and a mouse DNA Hin d l l l fragment. The HSV-2 EcoRl M fragment may contain sequences other than the DNA pol gene and therefore, there is a possibility that the HSV-2 probe may have identified a cellular cDNA coding for a protein other than the DNA polymerase. One could determine i f DP3 and DP5 are related by cross hybridization with each other. Also, DNA sequence analysis and a computer search of known sequences may identify the fuction of these cDNA clones. Finally, the DP5 cDNA probe detects transcripts that are present at approximately equal intensities during the course of the 14 hr MCMV infection, hence the cellular transcript levels of the corresponding region appears to be constant. Recent studies have shown that the MCMV DNA pol transcripts are present during the E phase, but at a relatively low level (Elliot et al., 1990, Westcoast Herpesviruses workshop; unpublished data). These transcripts begin to accumulate as the replication cycle approaches the L phase. Therefore, the failure to isolate the MCMV DNA pol cDNA may be attributed to i t s absence or low level in the isolated E mRNA pool. Isolation of cDNA coding for MCMV DNA polymerase may s t i l l be possible by screening the late viral cDNAs with Hindlll fragments H and D. i -179-

Cite

Citation Scheme:

    

Usage Statistics

Country Views Downloads
China 22 27
United States 1 3
City Views Downloads
Beijing 22 0
Ashburn 1 0

{[{ mDataHeader[type] }]} {[{ month[type] }]} {[{ tData[type] }]}

Share

Share to:

Comment

Related Items