UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Allelic variation in gene expression in Populus F₁ hybrids Zhuang, Yan 2007

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2007-0652.pdf [ 1.38MB ]
Metadata
JSON: 831-1.0101158.json
JSON-LD: 831-1.0101158-ld.json
RDF/XML (Pretty): 831-1.0101158-rdf.xml
RDF/JSON: 831-1.0101158-rdf.json
Turtle: 831-1.0101158-turtle.txt
N-Triples: 831-1.0101158-rdf-ntriples.txt
Original Record: 831-1.0101158-source.json
Full Text
831-1.0101158-fulltext.txt
Citation
831-1.0101158.ris

Full Text

A L L E L I C VARIATION IN GENE EXPRESSION IN POPULUS Fi HYBRIDS  by  Yan Zhuang  A THESIS S U B M I T T E D IN P A R T I A L F U L F I L L M E N T OF T H E R E Q U I R E M E N T S F O R T H E D E G R E E OF M A S T E R OF SCIENCE  in  T H E F A C U L T Y OF G R A D U A T E STUDIES  (Plant Science)  T H E U N I V E R S I T Y OF BRITISH C O L U M B I A July 2007  © Yan Zhuang, 2007  ABSTRACT  Plant hybridization can induce phenotypic novelty and speciation as well as genome rearrangements and gene expression changes. Populus hybrids provide a good system to study interspecific hybridization and its genetic and molecular consequences. In this project I determined the allelic variation of gene expression in Populus trichocarpa x Populus deltoides Fi hybrids using a single-base primer extension assay. Among 30 genes analyzed in four independently formed hybrids, 17 showed above 1.5 fold expression biases for the two alleles, and the expression patterns differed between leaves and stems for 9 genes. These results suggest differential regulation of the two parental alleles in the Populus F i hybrids. To determine i f the allelic expression biases were caused by hybridization I compared the ratios of species-specific transcripts between a hybrid and clones of its parents. Modes of gene regulation were inferred from the hybrid-parent comparisons. C«-regulation was inferred for 6 out of 19 genes. The remaining 13 genes including 1 controlled byfrvaraf-regulationand 12 by combined cis- & ^raw-regulation showed allelic expression ratios in the hybrid that were significantly different from the parental ratios, suggesting an alteration of the regulation network induced by hybridization.  TABLE OF CONTENTS  Abstract  ii  Table of Contents  iii  List of Tables  iv  List of Figures  v  Preface  vi  Acknowledgements 1  vii  Introduction 1.1  Interspecific hybridization and allelic variation  1.2 1.3 1.4  Cis-and trans-regulation Poplar hybrids Objectives  2  1 .. 1 2 2 3  Materials and Methods 2.1 2.2 2.3 2.4 2.5 2.6  3  Plant Materials Candidate gene selection and primer design Extraction of nucleotide acids and preparation of cDNA Genotyping Single base primer extension assay Statistical analysis....  , 4 t  Results  4 5 6 7 7 9 10  3.1  Allele-specific gene expression analysis  10  3.2  Cis-and trans-regulatory variation analysis  13  4  Discussion 4.1  Prevalence of unequal allelic expression.  16 16  4.2 Tissue-specific differences in allelic expression 4.3 Cis- and trans-regulatory variation 4.4 Interspecific hybridization and its effects on allelic expression Bibliography  16 17 19 21  Appendix  26  LIST OF TABLES  Table 2.1  List of Populus genes surveyed for allelic expression  Table 3.1  Allele-specific transcript ratios (Pd:Pt) in leaves and stems of four Fi hybrid  Table 3.2  5  12  Classification of regulation mode using the allele-specific transcript ratios (Pd:Pt) in mixed parental RNA and in F, hybrid  14  LIST OF FIGURES  Figure 3.1  Example outputs from single base primer extension assay in the GeneMapper 3.0 software.  Figure 3.2  11  Comparison of the percentages of Pt transcripts in equal mix of parental R N A s and in Fi hybrid  15  V  PREFACE  In addition to my thesis project, I also did a side project titled "Comparative analysis of mitochondrial gene transfer in plants" that began as a Directed Studies (PLNT 53OB) project and was then extended to a larger project with the help of Peter Zhang (an undergraduate summer student) and Allen L i u . B y comparing structural and sequence features of over 50 genes that have been transferred from the mitochondrion to the nucleus in various flowering plants, I tested hypotheses regarding how transferred genes become expressed in nucleus. The project is expected to be publishable after further sequence analyses that will be done by others.  vi  ACKNOWLEDGEMENTS  I would like to express my sincere appreciation to Dr. Keith Adams, for his guidance, and for giving me the opportunity to work with him. I would also like to thank my committee members, Dr. Jeannette Whitton and Dr. Quentin Cronk for their suggestions. I thoroughly enjoyed discussions with both. I also extend my thanks to Dr. Carl Douglas and Dr. Erin Gilchrist, who provided the Populus deltoides plant and SNP data for nine genes, and to Dan Carson from the Scott Paper company who let me take cuttings from Populus trichocarpa Nisqually-1 x Populus deltoides F l hybrids that he synthesized.  Great thanks to my lab mates including Dr. Zhenlan Liu, and the fellow graduate students Peter Zhang and Allen L i u . I enjoyed the interactions with them, both academically and personally.  Finally, thanks to my dear family who have offered me love and the strongest inspiration all the way along.  1  INTRODUCTION  1.1  Interspecific hybridization and allelic variation  Plant hybridization is a common process in nature and it plays a vital role in plant breeding. Interspecific hybridization provides a vast reservoir of new alleles. It can generate phenotypic novelty, and can lead to hybrid speciation and adaptive evolution  (HEGARTY  and  HISCOCK 2005; RIESEBERG 1997).  Allelic variation  resulting from interspecific hybridization can potentially contribute to phenotypic variation. For example, the complementation and interaction of different alleles are considered to provide a genetic basis for heterotic phenotypes 2 0 0 6 ; SPRINGER  and  STUPAR 2007).  (BIRCHLER  et al.  Allelic coding variation affecting the.  amino-acid sequence may change the protein function  (HOEKSTRA  et al.  2006).  Regulatory variation, which influences allelic expression levels, can lead to functional differences by altering the quantity of gene products  Guo et al.  2004; KNIGHT 2004).  (COWLES  et al.  2002;  Regulatory variation is considered particularly  important in reconciling the two different transcriptomes upon hybridization (ORR and P R E S G R A V E S 2 0 0 0 ; O S B O R N et al. 2 0 0 3 ) .  Allelic expression differences of non-imprinted autosomal genes have been reported in Fi hybrids of mouse and S. cereviseae  (COWLES  (RONALD  et al.  et al.  2002),  2005).  Drosophila  (WlTTKOPP  et al.  2004),  Intraspecific maize hybrids have been  documented with genes showing unequal expression of parental alleles, including silencing of one allele (Guo et al. 2006).  2003;  Guo et al.  2004; STUPAR  and  SPRINGER  A study of the ADH gene in interspecific cotton hybrids revealed  organ-specific allelic silencing of this gene  (ADAMS  and  WENDEL 2005).  Allelic  l  variation of gene expression is still poorly investigated for interspecific hybrid plants.  1.2  Cis-and trans-regulation  Allelic variation in gene expression may arise from cis- or ^raws-regulatory changes (WlTTKOPP et al. 2 0 0 4 ) . Cw-regulators are genetically tightly linked to a gene and influence transcription in an allele-specific manner. In contrast, /raws-regulators are located elsewhere in the genome and modify gene expression by interacting with cz's-regulators. Following hybridization, genes under pure cw-regulation tend to show additive expression patterns, whereas those under /raws-regulation can display either additive or nonadditive expression, depending on whether a dosage effect exists ( S P R I N G E R and S T U P A R 2 0 0 7 ; S T U P A R and S P R I N G E R 2 0 0 6 ) . Cis- or fra«s-regulation can be inferred by comparing the ratios of species-specific transcripts between the F i hybrids and the parental species (WlTTKOPP et al. 2 0 0 4 ) . Genes with strict c/s-regulation have the same bias of expression of two alleles in both the hybrid and the parents. Genes with strict rrans-regulation display allelic bias in the parents but are expected to have equal levels of allelic expression in the hybrid. While pure c/s-effects imply the preservation of parental regulatory function, differential expression between parents and hybrid due to trans-effects are caused by hybridization that brings two genomes together, allowing both alleles to be exposed to a common set of rrans-elements. The prevalence of cw-regulation in allelic variation of expression levels has been revealed in recent studies of intraspecific maize hybrids ( S T U P A R and S P R I N G E R 2 0 0 6 ) .  2  1.3  Poplar hybrids  Poplar hybrids provide a promising plant system to study interspecific hybridization and its genetic and molecular consequences. Poplar has become a model system for research of wood-forming plants. Populus trichocarpa is the first tree for which the genome has been sequenced ( T U S K A N et al. 2 0 0 6 ) . As a sustainable source for paper fiber and biofuel, poplars are important economic plants. There are 3 0 different Populus species worldwide. Interspecific crosses often generate poplar hybrids that exhibit heterosis compared to their parents ( P E A R C E et al. 2 0 0 4 ) . Poplar interspecific hybridization research offers insights into understanding of phenotypic variation in Populus species.  1.4  Objectives  In this thesis, I studied the allelic variation of gene expression levels using poplar interspecific F i hybrids, Populus trichocarpa ^Populus deltoides. A single base primer extension assay was employed to quantify the allele-specific expression for 3 0 genes in four independently formed poplar interspecific F i hybrids. This method has been shown to be effective in distinguishing between and quantifying sequence variants by a single SNP (single nucleotide polymorphism) site ( B R A Y et al. 2 0 0 3 ; NORTON  et al. 2 0 0 2 ; W A N G et al. 2 0 0 5 ; Y A N et al. 2 0 0 2 ) . To investigate whether  there are organ-specific differences in allelic expression, both leaves and stems were examined for the same genes. In addition, to specify the proportion of variation in allelic expression contributed by cw-regulation or fr-aras-regulation, I compared the ratio of species-specific transcripts in the Fi hybrid versus that in the parents.  3  2 2.1  MATERIALS AND METHODS Plant materials  To survey allelic expression levels for 30 different genes, plant tissues were collected from four P. trichocarpa x P. deltoides Fi hybrids (1 l - B U L H - 4 - 1 , 9-KTWD-4, 7-IRVC-3-1 and 7-IRVD-5-1), the hybrid nature of which has been confirmed using an ecotilling approach (GILCHRIST et al. 2006). These poplar hybrids originally came from central British Columbia and were planted at the U B C Botanical Garden Young leaves and stems from all four poplar hybrids were collected in October 2005 and June 2006. For each tissue sample, two replicates were collected at the same time. A l l harvested tissue samples were frozen immediately in liquid nitrogen and stored at - 8 0 ° C until use.  The analysis of cis- and ftvms-regulatory variation was conducted using a P. trichocarpa x P. deltoides F i hybrid of known provenance and its parent poplars, P. trichocarpa accession Nisqually-1 and P. deltoides. The hybrid was originally from a plantation of P. trichocarpa x P. deltoides Fi hybrids that were derived from the same cross by Scott Paper Co. in the Chilliwack region of British Columbia. The sampled maternal parent P. trichocarpa was planted at the U B C Botanical Garden. The sampled paternal parent P. deltoides was grown on U B C South Campus farm. Both parents belonged to the same clonal accessions of the exact parents of the hybrid I used. Cuttings of three poplars were maintained under greenhouse conditions. Young leaves from the F i hybrid and the two parents were collected at the same time during May 2007. For each tissue sample, three replicates were harvested and frozen immediately in liquid nitrogen and stored at - 8 0 ° C until use.  4  2.2  Candidate Gene selection and Primer design  Candidate genes, listed in Table 2.1, were selected under the following criteria: (i) 27 genes had sequence homology to genes important for plant growth and development or other known functions. Selected genes covered various gene categories. Four genes MATE, HAT22, Unknown! and Unknown2 that are located next to the already selected genes DXPS, KNAT1, ISP and ADK were chosen to compare allelic expression patterns between physically close gene pairs, (ii) Only genes that appeared to.be single copy or that were easily distinguishable from other family members at the genomic sequence level were selected for analysis, (iii) The genes were expressed in at least one of the two organs types, leaves and stems, (iv) I identified marker SNPs for these genes by sequencing genomic D N A s , allowing me to perform the single base primer extension assay.  Gene sequences were obtained from GenBank and the whole genome shotgun sequence database of the P. trichocarpa Nisqually-1 genome that was available from the Joint Genome Institute (http://genorne.igi-psf org/poplarO/poplarO.home.htrnQ. Primers were designed using Primer Premier 5.0 to amplify both genomic D N A s and c D N A s (Appendix).  Table 2.1  List of  Populus  genes surveyed for allelic expression.  Gene  Description  Accession #  4CL3  4-Coumarate:CoA ligase 3  AF283553 '  ADH  Alcohol dehydrogenase  grail3.0003062601  ADK  Adenylate kinase  estExt_fgenesh l_kg_v 1 .CJLGJO115  C3HC4  C3HC4-type RING finger  CN550424  CHI  Chalcone flavanone isomerase  DT517112  CaMBP  Calmodulin binding proteins  grail3.0111003801  Cel9B  Family 9 glycoside hydrolase  DT510114  5  Gene  Description  Accession #  DXPS  Deoxyxylulose-5-phosphate synthase  fgeneshl_pg.C_scaffold_171000014  F5H  Ferulate 5-hydroxylase  CV252951  GT47C  Glycosyltransferase GT47C  DQ899955  HAT22  Homeodomain-leucine zipper protein  estExt_fgenesh l_pm_v 1 . C L G J I 0 6 7 1  22, adjacent to KNAT1  ISP  Signal peptidase I  DT520192  KNAT1  Knotted 1-like  DT509858  LFY  Leafy  estExt_fgenesh l_pg_v 1 .C_LG_XV0787  MATE  Multi antimicrobial extrusion protein,  estExt_Genewise l_v 1.C 1710070  adjacent to DXPS  MP  Monopteros  graiB.0003020401  NAK  Serine/threonine kinase  eugene3.01600004  NBS-LRR  Nucleotide binding site-leucine rich  fgeneshl_pg.C_scaffold_12467000001  repeat  NPR1  Non-expresser of PR genes  • e s t E x t G e n e w i s e l v l . C L G V I l 130  P4H  Prolyl 4-hydroxylase  eugene3.01420036  PP03  polyphenol oxidase  AY665682  PPR  Pentatricopeptide repeat-containing  estExt_Genewisel_vl.C_400113  protein  PREGl-like  PREGl-like negative regulator  CX174618  RAM  RAR1 disease resistance gene  eugene3.00151105  Rpsl9  Mitochondrial ribosomal protein S19  DT487761  SKOR  Stelar K+ outward rectifying channel  grail3.0031001201  SPB  Squamosa promoter binding protein  eugene3.01640028  '* '  like  SUS  Sucrose synthase  estExtjgeneshl_pg_v 1 . C L G I I 0 8 9 5 .  TI5  Kunitz trypsin inhibitor 5  AY378090  Unknown!  Adjacent to ISP  fgenesh l_pg.C_scaffold_40000194  Unknown2 * Adjacent to ADK  CV230181  Accession # refers either to Genbank accession ID or the gene model ID in the genome shotgun sequence database of P. trichocarpa. *Gene surveyed for thecw- andfr-aws-regulatoryvariation analysis but not for screening the four hybrids from central British Columbia.  2.3  Extraction of nucleic acids and preparation of cDNA  D N A s were extracted by using Qiagen (Valencia, C A ) DNeasy Plant M i n i Kit. Total  6  R N A extraction was performed as described previously (ADAMS et al. 2003). D N A and R N A concentrations and purities were measured by using a NanoDrop spectrophotometer. R N A s were treated with DNasel (New England Biolabs) before reverse transcription. Single-stranded c D N A was synthesized from 500 ng of total R N A using M - M L V reverse transcriptase (Invitrogen) according to the manufacturer's protocol. A s controls for D N A contamination, reactions were also performed without reverse transcriptase at the same time. For the cis- and trans-regulatory variation analysis, mixed c D N A s were synthesized from equal mixes of the two parent R N A s .  2.4  Genotyping  Genes of interest were P C R amplified from genomic D N A s of the hybrid poplars. The PCR products were sequenced using Big Dye Terminator 3.1 sequencing chemistry (Applied Biosystems) by the Nucleic Acids Protein Service unit (NAPS) at the University of British Columbia. SNPs in exon regions were identified and selected for allele-specific expression analysis. Common SNPs were selected for the four hybrid poplars from central British Columbia. The same SNPs were selected for the cis- and /raws-regulatory variation analysis if they also existed in the hybrid from Chilliwack, otherwise other SNPs were selected for this hybrid.  2.5  Single base primer extension assay  D N A and c D N A segments surrounding the SNPs present in the hybrid poplars were PCR amplified. c D N A s from equally mixed parental R N A s were also P C R amplified. Following P C R thermal cycling, unincorporated primers and dNTPs  7  were removed by adding 1.67 units of shrimp alkaline phosphatase (SAP) (Fermentas) and 1 unit of Exonuclease I (Fermentas) to each 5ul P C R product. Reactions were mixed briefly and incubated at 37°C for 60 min then 80°C for 15 min. The P C R products were then subjected to a primer extension assay (SNaPshot, Applied Biosystems) using extension primers designed to anneal to the amplified D N A adjacent to the SNP site (Supplementary table 1). Primer extension reactions werecarried out in a total volume of lOpl containing 0.5ul A B I Prism SNaPshot multiplex kit mix (Applied Biosystems), 0.2 u M extension primer, 2 pi of P C R product, and 6.5ul of deionized water. Thermal cycling conditions for extension reactions were carried out with the following program: 2 min at 94°C, and 25 cycles consisting of 10 s at 96°C, 5 s at 50°C, 30 s at 60°C. After cycling, the unincorporated fluorescent ddNTPs (dideoxynucleotide triphosphates) were removed by adding 1 unit of SAP and incubating for 60 min at 37°C, followed by 15 min at 65 °C for enzyme inactivation. The resulting primer extension products were analyzed on an A B I 3730 capillary electrophoresis D N A instrument, using GeneMapper 3.7 software (Applied Biosystems) according to the manufacturer's protocol. The expression percentages of the two alleles were measured by comparing the peak heights. Since differing fluorophores may influence the incorporation and migration rates of four types of ddNTPs, the peak heights are not always identical between two alleles of equal abundance  (PlNSONNEAULT  et al.  2004). Therefore, allelic ratios of genomic D N A s assumed to be present in equal amounts (ratio=l) were used to normalize allelic ratios of c D N A samples (PlNSONNEAULT  et al. 2004;  WANG  et al. 2005). For the analysis of 30 genes in four  hybrids, five genes 4CL3, CHI, LFY, MP and NPR1 were initially assayed in Fall 2005 using the plant tissues collected in October 2005, the other genes were all  8  assayed using the June 2006 tissues. The analysis of cis- and ?ra«s-regulatory variation was performed with leaf tissues collected in May 2007.  2.6  Statistical analysis  Standard errors of replicates were calculated. Two-tailed homoscedastic variance t-tests (P=0.05) were performed with Microsoft Excel 2003 to test the difference between the allelic expression ratio in Fi hybrid versus that in mixed parental R N A compared with a 50:50 value.  9  3 3.1  RESULTS Allele-specific gene expression analysis  To study the allelic expression variation for 30 genes in the Populus hybrids, a single base primer extension assay (Figure 3.1) was used. Relative expression between the P. deltoides derived allele and the P. trichocarpa derived allele (Pd: Pt) for the four hybrids from central British Columbia is shown in Table 3.1. Using 1.5 fold (that is 60:40) as a minimum threshold ratio for allelic differential expression, among 30 genes examined, 17 genes showed allelic expression bias in either leaves or stems or both in the majority or all of the examined hybrids. Notably, DXPS showed monoallelic expression of the Pd allele in stems. For the other 13 genes, 8 showed equal allelic expression in the majority or all of the examined hybrids, and 5 genes displayed varied expression among different hybrids without a common pattern in the majority of the hybrids. Comparing three genes, DXPS, KNAT1 and ISP with their adjacent genes MATE, HAT22 and Unknownl, no correlated expression was detected among adjacent genes.  In order to test the reliability of my assay, the allelic expression ratios of two genes were confirmed by assaying additional marker SNPs (data not shown). In addition eight leaf replicates of the hybrid from Chilliwack were tested for two genes, GT47C and TI5, and the resulting standard errors were 3% and 2% respectively.  Tissue-specific expression was examined using leaves and stems. For the 17 genes classified as having differential expression of alleles, 15 genes were assayed for both leaves and stems. Among these 15 genes, consistent expression differences  10  between leaves and stems in all four hybrids were detected for 9 genes. Examples include: DXPS with biased expression in leaves but monoallelic expression in stems, ADK, CaMBP, ISP, PP03, and PPR with higher allelic expression bias in stems than in leaves, Cel9B and SKOR with higher bias in leaves than in stems, and MATE with different parental alleles being preferably expressed between leaves and stems.  Figure 3.1  Example outputs from single base primer extension assays in the GeneMapper 3.0  software. DXPS (monoallelic)  775 (unequal expression)  NAK (equal expression)  cDNA  Genomic DNA  A.  The marker SNPs between two homologous alleles result in detectable fluorescent peaks. Relative expression levels of the species-specific alleles were read from the heights of the fluorescent peaks. Readings for genomic DNAs were used to normalize that for cDNAs.  11  Table 3.1  Allele-specific transcript ratios (Pd:Pt) in leaves and stems of four Hybrid 1 Hybrid 2 Stem SE(%) Stem SE(%) Leaf SE(%) Leaf SE(%) Gene Beyond 60:40 differential allelic expression in majority of the four hybrids 4CL3 • 60 :40 2 61 :39 2 1 1 67 :33 2 66 :34 65 :35 ADK* 59 :41 0 1 54 :46 2 60 :40 3 57 :43 CaMBP* 49 :51 3 1 23 :77 2 36 :64 6 1 39 :61 Cel9B* 28 :72 82 :18 0 100 :0 0 1 100 :0 0 75 :25 DXPS* 34 :66 2 26 :74 6 F5H 4 20 :80 HAT22 1 25 :75 67 :33 1 3 57 :43 0 59 :41 4 73 :27 ISP* 4 57 :43 4 53 :47 37 :63 0 MATE* 40 :60 0 2 7 67 :33 4 65 :35 57 :43 5 49 :51 NBS-LRR 74 :26 3 56 :44 2 3. 0 77 :23 PP03* 63 :37 4 37 :63 2 3 45 :55 PPR* 42 :58 0 28 :72 74 :26 1 2 83 :17 0 1 72 :28 PREG 1-like 84 :16 1 33 :67 1 25 :75 1 30 :70 RPS19 21 :79 0 6 68 :32 0 60 :40 1 63 :37 2 49 :51 SKOR* 34 :66 2 37 :63 6 34 :66 6 36 :64 0 SPB 27 :73 1 18 :82 3 16 :84 0 17 :83 0 TI5 Within 60:40 allelic expression in majority of the four hybrids 56 :44 1 C3HC4 48 :52 1 58 :42 0 54 :46 3 2 54 :46 2 47 :53 CHI 46 :54 1 2 UN ATI 44 :56 5 44 :56 0 49 :51 LFY 56 :44 1 67 :33 5 6 55 :45 3 NAK 46 :54 44 :56 0 38 :62 0 7 P4H 41 :59 0 46 :54 58 :42 1 57 :43 2 60 :40 3 RAR1 49 :51 3 49 :51 2 1 44 :56 1 45 :55 6 Unknown! 46 :54 Varied expression among four hybrids 0 51 :49 0 48 :52 ADH 33 :67 0 38 :62 3 42 :58 2 2 38 :62 0 37 :63 2 39 :61 GT47C 68 :32 1 53 :47 2 MP 60 :40 5 63 :37 5 NPRl 1 4 7 47 :53 41 :59 0 50 :50 51 :49 SUS  F[ hybrid. Leaf  Hybrid 3 SE(%) Stem  SE(%)  70 60 61 45 100 39  :30 :40 :39 :55 :0 :61  2 2 0 1 0 3  1 2 2 0 1 2 6 1 5 4 0  77 60 69 64 46 70 27 52 38 11  :23 :40 :31 :36 :54 :30 :73 :48 :62 :89  3 1 1 4 2 4 2 4 3 3  50 :50  0  44 :56  42 :58 53 :47 54 :46 54 :46 55 :45 30 :70  0 4 3 0 1 2  44 :56 43 :57 75 :25 57 :43 38 :62  3 2 2 4 4  60 56 59 31 90  :40 :44 :41 :69 :10  0 1 4 0 3  30 59 45 70 51 63 70 26 70 35 24  :70 :41 :55 :30 :49 :37 :30 :74 :30 :65 :76  Leaf  HybridT SE(%) Stem  SE(%)  52 49 16 80  :48 :51 :84 :20  1 4 1 0  60 71 35 100  :40 :29 :65 :0  1 3 1 0  21 61 40 64 41 49 74 34 72 37 34  :79 :39 :60 :36 :59 :51 :26 :66 :28 :63 :66  6 3 1 0 3 5 1 0 1 5 2  74 60 78 73 28 73 20 57 31 20  :26 :40 :22 :27 :72 :27 :80 :43 :69 :80  3 1 2 1 2 1 1 6 0 2  2  45 :55 45 :55  2 3  45 :55 41 :59  1 3  53 :47 54 :46 54 :46 35 :65  1 2 3 0  57 :43 50 :50 57 :43 44 :56  0 1 3 0  58 :42 49 :51 64 :36 47 :53  3 2 1 1  60 :40 43 :57  2 1  2 3  4  1 1 3 0 3  50 :50 43 :57  40 :60  51 :49 42 :58 57 :43 55 :45 39 :61  41 :59  4  Hybrid 1, 2, 3, 4 refer to hybrid ll-BULH-4-1, 9-KTWD-4, 7-IRVC.3-1 and 7-IRVD-5-1 separately. SE represents standard error of two replicates. Genes with * are the ones showing different allelic expression ratios between leaves and stems.  3.2  Cis- and fra/ts-regulatory variation analysis  The expression percentage of the P. deltoides allele versus the P. trichocarpa allele (Pd:Pt) was compared between the equal mix of parental R N A s and the Fi hybrid from Chilliwack (Table 3.2, Figure 3.2). Based on different hypotheses for cis- and rraMs-regulation, hybridization would result in four different expression patterns: Conserved: equal expression of two species-specific alleles in both parents and hybrid.  Pd:Pt (parent) = Pd:Pt (hybrid) = 50:50.  Cw-regulation: the same allelic expression bias in both parents and hybrid. Pd:Pt (parent) = Pd:Pt (hybrid) ^ 50:50. Trans-regulation: biased expression in parents but equal expression in hybrid. Pd:Pt (parent) j. 50:50, Pd:Pt (hybrid) = 50:50. Cis- & trans-regulation: biased expression in hybrid which is different from the expression pattern in parents. Pd:Pt (parent) # Pd:Pt (hybrid), Pd:Pt (hybrid) ^ 50:50.  For the 19 genes surveyed, 6 were grouped as cw-regulated, 1 gene as toms-regulated, and the other 12 were considered to be adjusted by combined cis& /rans-regulation. Among these 12, 4 genes including ADH, NBS-LRR, P4H and TI5 showed biased allelic expression in the hybrid and in the parents in the same direction. NBS-LRR displayed the extreme scenario with monoallelic expression in the hybrid but not in the parents. Four of the other twelve genes including 4CL3, ADK, ISP and NAK demonstrated lower differences in the hybrid than in the parents, and 3 genes, Cel9B, GT47C and Unknown2 clearly displayed opposite directions of allelic difference in hybrid and in parents. It is ambiguous to define the expression patterns for the remaining gene RARI as it showed only slight allelic expression  13  variation in both hybrid and parents.  Table 3.2  Classification of regulation mode using the allele-specific transcript ratios (Pd:Pt)  in mixed parental RNA and in Fi hybrid. P a r e n t s  Gene  H  y  , ., b r l d  Pd :Pt SE(%) Pd :Pt SE(%) :64 2 3 38 :62 1 :15 2 88 :12 1 :18 6 70 :30 :28 6 69 :31 8 :81 6 22 :78 8 :34 6 58 :42 0 2 :66 49 :51 3 34 :66 :47 3 2 :69 3 0 :100 0 2 :51 3 39 :61 14 :86 :57 2 1 :18 1 53 :47 1 1 72 :28 1 :20 2 2 :35 58 :42 :27 3 61 :39 3 :22 1 1 39 :61 :37 1 35 :65 2 :40 35 :65 6 0 :47 1 48 :52 0  C3HC4 36 DXPS 85 NPRI 82 72 PP03 RPS19 19 Unknown66 1 CaMBP 34 ADH 53 NBS-LRR 31 P4H 49 TI5 43 4CL3 82 ADK 80 ISP 65 NAK 73 Cel9B 78 GT47C 63 Unknown!60 RAR1 53  Pd:Pt (parent) Pd:Pt (hybrid) Pd:Pt (parent) -£ .  Regulation  ^50:50  classification  P H  ^50:50 Yes Yes Yes Yes Yes Yes Yes No Yes No Yes Yes Yes Yes Yes Yes Yes No Yes  Yes Yes Yes Yes Yes Yes No Yes Yes Yes Yes Yes Yes Yes . Yes Yes Yes Yes Yes  P t  (hybrid) No No No No No No Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes  cis cis cis cis cis cis trans cis & trans cis & trans cis & trans cis & trans cis & trans cis & trans cis & trans cis & trans cis & trans cis & trans . cis & trans cis & trans  SE refers to standard error of three replicates. Two-tailed homoscedastic variance t-tests (P=Q.Q5) were performed to test the difference between the allelic expression ratio in both mixed parental RNA and F! hybrid each versus 50:50, and mixed parental RNA versus Fi hybrid.  14  Figure 3.2  Comparison of the percentages of Pt transcripts in equal mixes of parental RNAs  and in the F hybrid. t  cis  • Parents  1 trans\  —  cis & trans  • Hybrid  Black columns and striped columns represent percentages of Pt transcripts in the mix of parental RNAs and that in the F] hybrid. Error bars indicate standard error of three replicates. Genes are  grouped by the regulation patterns. Gene sC3HC4, DXPS, NPR1, PP03, RPS19 and Unknownl are inferred to be cw-regulated, CaMBP is trans-regulated, and 4CL3, ADH, ADK, Cal9B, GT47C, ISP, NAK, NBS-LRR, P4H, RAR1, TI5 and Unknown2 are cis- & frara-regulated.  15  \  4 4.1  •  DISCUSSION Prevalence of unequal allelic expression  I surveyed. 30 genes for their allelic expression in four P. trichocarpa x P. deltoides F) hybrids, and my results suggest that there are a considerable percentage of genes showing variation in allelic expression levels in Populus interspecific Fi hybrids. Using a threshold cutoff of 1.5 fold (60:40), 17 of the 30 (57%) genes showed differential allelic expression in the majority of the four hybrids. Considering the 3% and 2% standard error results from genes GT47C and TI5 with eight tested leaf replicates, 60:40 should be a conservative threshold for classifying differential allelic expression. 57% might be an underestimate of the true percentage of genes with allelic expression variation. A previous study in maize intraspecific hybrids, using less stringent criteria for differential expression, identified 11 out of 15 (73%) genes that showed below 0.85 or above 1.18 differences in allelic expression ratios (Guo et al. 2004). In contrast, the mouse study found only ~ 10% genes with above 1.5 fold allelic expression difference ( C O W L E S et al. 2002). There is a higher degree of allelic expression variation in both poplar interspecific Fi hybrids and maize hybrids than in mouse. It has been suggested that the highly polymorphic maize genome could account for its relative high degree of allelic expression variation (Guo et al. 2004). Similarly, the divergence between P. trichocarpa and P. deltoides probably contributes to a higher allelic expression variation compared to the mouse hybrids.  16  4.2  Tissue-specific differences in allelic expression  I observed expression differences between leaves and stems for 9 out of 15 ( 6 0 % ) genes that showed allelic expression variation. Although the total sample size is relatively small, my results still suggest a.surprisingly high degree of tissue-specific differences. Tissue-specific expression was previously observed for homeologous genes in cotton allopolyploids ( A D A M S 2 0 0 7 ; A D A M S et al. 2 0 0 4 ) . It has also been documented in a cotton interspecific diploid hybrid that the ADH gene showed organ-specific allelic silencing ( A D A M S and W E N D E L 2 0 0 5 ) . Similarly, the study in mouse has identified two genes with diverged allelic expression patterns in different 'tissues ( C O W L E S et al. 2 0 0 2 ) . Tissue-specific regulatory variants may play a role in producing variable expression levels among different tissues. There is much evidence for tissue-specific cw-acting elements directing controlled recognition and binding with transcription factors ( A B B A S I et al. 2 0 0 7 ; M A N I A T I S et al. 1 9 8 7 ) . Further sampling of more tissues and large scale allelic expression assays would probably provide useful insights for understanding the regulation underlying adaptive evolution of hybrid tissues.  4.3  Cis- andfrww-regulatoryvariation  The comparison of expression between a mix of parental R N A s and F i hybrid R N A revealed 6 of 19 ( 3 2 % ) genes under mainly c/s-regulation, 1 of 19 ( 5 % ) under primarily fr-aws-regulation, and the remaining 12 ( 6 3 % ) controlled coordinately by cis- & fr"a«s-regulation. This is different from the finding in maize intraspecific hybrids that pure cz's-regulation accounts for allelic expression in 18 of 3 5 ( 5 1 % ) , a majority of the sampled genes (STUPAR and S P R I N G E R 2 0 0 6 ) . The remaining 1 7 genes include 1 classified as rraws-regulated, 13 as cis- & ?ra«s-regulated, and 3 as  17  equal expression of alleles in both the parents and the hybrid. Studies in interspecific Drosophila hybrids reported 12 of 28 (43%) genes to be completely explained by cz's-regulation, and the remaining 16 all explained by cis- & /rans-regulation (WlTTKOPP et al. 2004). Although variable proportions of complete cz's-regulation is found in these studies, cz's-effects were consistently largely involved in most if not all of the assayed genes, and pure fra«s-regulation is rare, affecting only 1 of 19 genes in poplar, 1 of 35 in maize and none of 28 in Drosophila.  As cz's-elements function.in an allele-specific manner, allelic expression following merely cw-regulation reflects an inheritance of the regulatory pattern from the two parents to the hybrid. In contrast, after hybridization both alleles are exposed to common rra«s-regulators in the same cellular environment, and so /rans-regulation and combined cis- & rrans-regulation could be induced by hybridization to harmonize the two heterozygous genomes ( L A N D R Y et al. 2005). There is a hypothesis that cis- and rraras-compensatory evolution is specifically important in leading to novel gene expression and performance in the hybrids ( L A N D R Y et al. 2005). Compensatory cis- and rra/w-regulation is inferred when the allelic expression difference in an Fi hybrid is more extreme than, or in the opposite direction from that in the parents, suggesting changes in trans- compensate for the already existed cw-divergence. In my results 4 out of 19 genes display differences to a larger extent in the hybrid than in the parents, and 3 other genes, Cel9B, GT47C and Unknown2 clearly show opposite hybrid allelic divergence and parental divergence. M y finding supports the hypothesis that the coevolution of cis- and trans-effects plays a common and important role in novel expression patterns upon  18  interspecific hybridization. Cis- and /raws-regulation following hybridization could contribute to heterosis. Trans-regulation, i f it is dosage-independent, can lead to nonadditive gene expression outside the midparent value (SPRINGER and S T U P A R 2 0 0 7 ; S T U P A R and SPRINGER 2 0 0 6 ) ,  and this nonadditivity could provide a genetic basis for de novo  variation and adaptive evolution, as well as for generating heterosis ( W A N G et al. 2006).  It has been documented in Arabidopsis that there was a correlation between  nonadditive gene expression and heterosis ( V U Y L S T E K E et al. 2 0 0 5 ) . Alternatively, additive expression with midparent expression level resulted from cw-regulation or dosage-dependant /raw-regulation potentially has advantages for yielding heterotic performance (Guo et al. 2 0 0 6 ; SPRINGER and S T U P A R 2 0 0 7 ) . The positive correlation of additivity with heterosis has been found in maize hybrids (Guo et al. 2006).  The seemingly two contradictory models derived from Arabidopsis and  maize suggest that there are variable mechanisms for heterosis in different species (SPRINGER  and S T U P A R 2 0 0 7 ) . Future studies in a different plant species such as  poplar correlating the allelic variation under cis- or /raws-regulation with overall expression levels, and further with the performance of hybrid growth and development would assist our understanding of hybridization and heterosis.  4.4  Interspecific hybridization and its effects on allelic expression  It has been highlighted that plant interspecific hybridization is an important process that may result in speciation and adaptive evolution ( H E G A R T Y and HlSCOCK 2 0 0 5 ; RlESEBERG 1 9 9 7 ) .  At the genetic level, interspecific hybridization could lead to a  series of events, including  chromosomal rearrangement (RlESEBERG et al. 1 9 9 6 ) ,  transposon activation (Liu and W E N D E L 2 0 0 0 ; S H A N et al. 2 0 0 5 ) , altered D N A  19  methylation ( A D A M S et al. 2000; S H A K E D et al. 2001), and gene silencing ( C O M A I et al. 2000). Many polyploidy studies indicate that there are more changes to the genome in allopolyloids compared with autopolyploids ( H E G A R T Y and HlSCOCK 2005), which from another perspective also reveals the massive changes upon interspecific hybridization. M y finding of the prevalent allelic expression variation in Populus hybrids suggests a modification of the regulatory network upon interspecific hybridization. The coordinated cis- and frans-regulation could explain the altered allelic expression. The potential molecular mechanisms could be that D N A polymorphisms associated with cis- or /ra«s-elements may cause R N A i selectively interacting with one allele and inducing D N A methylation difference (LUKENS  and Z H A N 2007). It is also possible that cis- or trans-acting generate  allele-specific histone modification (PETERS and S C H U B E L E R 2005). The functional consequence of differential allelic expression would involve favorable expression of advantageous alleles or novel expression patterns, and even preferred expression of alleles composing a gene network, thus contributing to the adaptive evolution of hybrid species (BOLDOGKOI 2004).  20  BIBLIOGRAPHY  ABBASI,  A . A . , Z. PAPARIDIS, S. M A L I K , D. K . G O O D E , H . C A L L A W A Y et al, 2007  Human GLI3 Intragenic Conserved Non-Coding Sequences Are Tissue-Specific Enhancers. PLoS O N E 2: e366. A D A M S , K . L.,  2007 Evolution of duplicate gene expression in polyploid and hybrid  plants. JHered 98: 136-141. A D A M S , K . L . , R . C R O N N , R . PERCIFIELD  and J. E W E N D E L , 2003 Genes duplicated  by polyploidy show unequal contributions to the transcriptome and organ-specific reciprocal silencing. Proc Natl Acad Sci U S A 100: 4649-4654. ADAMS, K .  L . , R . P E R C I F I E L D and J. F . W E N D E L , 2004 Organ-specific silencing of  duplicated genes in a newly synthesized cotton allotetraploid. Genetics 168: 2217-2226. A D A M S , K . L.,  and J. F . W E N D E L , 2005 Allele-specific, bidirectional silencing of an  alcohol dehydrogenase gene in different organs of interspecific diploid cotton hybrids. Genetics 171: 2139-2142. ADAMS,  S., R . V I N K E N O O G , M . S P I E L M A N , H . G D I C K I N S O N and R . J. SCOTT, 2000  Parent-of-origin effects on seed development in Arabidopsis thaliana require D N A methylation. Development 127: 2493-2502. B I R C H L E R , J. A . , H . Y A O and S. C H U D A L A Y A N D I , 2006 Unraveling the genetic basis of hybrid vigor. Proc Natl Acad Sci U S A103: 12957-12958. B O L D O G K O I , Z., 2004 Gene network polymorphism is the raw material of natural selection: the selfish gene network hypothesis. J M o l Evol 59: 340-357.  21  B R A Y , N . J., P. R. B U C K L A N D , M . J . O W E N and M . C . O ' D O N O V A N , 2 0 0 3 Cw-acting  variation in the expression of a high proportion of genes in human brain. Hum Genet 113: 1 4 9 - 1 5 3 . C O M A I , L . , A . P. T Y A G I , K . W I N T E R , R. H O L M E S - D A V I S , S. H . R E Y N O L D S et al,  2000  Phenotypic instability and rapid gene silencing in newly formed Arabidopsis allotetraploids. Plant Cell 12: 1 5 5 1 - 1 5 6 8 . C O W L E S , C. R., J . N . H I R S C H H O R N , D . A L T S H U L E R and E. S. L A N D E R , 2 0 0 2  Detection of regulatory variation in mouse genes. Nat Genet 32: 4 3 2 - 4 3 7 . GILCHRIST, E . J., G. W . H A U G H N , C. C. Y I N G , S. P. O T T O , J . Z H U A N G et al,  2 0 0 6 Use  of Ecotilling as an efficient SNP discovery tool to survey genetic variation in wild populations of Populus trichocarpa. M o l Ecol 15: 1 3 6 7 - 1 3 7 8 . Guo, M . , M . A . R U P E , O . N . D A N I L E V S K A Y A , X . Y A N G and Z . Hu, 2 0 0 3  Genome-wide m R N A profiling reveals heterochronic allelic variation and a new imprinted gene in hybrid maize endosperm. Plant J 36: 3 0 - 4 4 . Guo, M . , M . A . R U P E , X . Y A N G , O . C R A S T A , C. Z I N S E L M E I E R et al,  2006  Genome-wide transcript analysis of maize hybrids: allelic additive gene expression and yield heterosis. TheorAppl Genet 113: 8 3 1 - 8 4 5 . Guo, M . , M . A . R U P E , C. Z I N S E L M E I E R , J . H A B B E N , B . A . B O W E N et al,  2 0 0 4 Allelic  variation of gene expression in maize hybrids. Plant Cell 16: 1 7 0 7 - 1 7 1 6 . HEGARTY,  M . J., and S. J . HlSCOCK, 2 0 0 5 Hybrid speciation in plants: new insights  from molecular studies. New Phytol 165: 4 1 1 - 4 2 3 . H O E K S T R A , H . E., R. J . H I R S C H M A N N , R. A . B U N D E Y , P. A . I N S E L and J . P. CROSSLAND, 2006  A single amino acid mutation contributes to adaptive  beach mouse color pattern. Science 313: 1 0 1 - 1 0 4 . KNIGHT, J.  C , 2 0 0 4 Allele-specific gene expression uncovered. Trends Genet 20:  22  113-116. LANDRY,  C. R., P. J . W I T T K O P P , C. H . T A U B E S , J . M . R A N Z , A . G. C L A R K et al, 2005  Compensatory cis-trans evolution and the dysregulation of gene expression in interspecific hybrids of Drosophila. Genetics 171: 1813-1822. L i u , B., and J . F . W E N D E L , 2000 Retrotransposon activation followed by rapid repression in introgressed rice plants. Genome 43: 874-880. LUKENS,  L . N . , and S. Z H A N , 2007 The plant genome's methylation status and  response to stress: implications for plant improvement. Curr Opin Plant Biol 10:317-322. MANIATIS,  T , S. G O O D B O U R N and J . A . FISCHER, 1987 Regulation of inducible and  tissue-specific gene expression. Science 236: 1237-1245. NORTON,  N . , N . M . W I L L I A M S , H . J . W I L L I A M S , G S P U R L O C K , G K I R O V et al, 2002  Universal, robust, highly quantitative SNP allele frequency measurement in D N A pools. Hum Genet 110: 471-478. O R R , H . A . , and D . C. P R E S G R A V E S , 2000 Speciation by postzygotic isolation: forces, genes and molecules. Bioessays 22: 1085-1094. OSBORN,  T. C , J . C. P I R E S , J . A . B I R C H L E R , D. L . A U G E R , Z . J . C H E N et al, 2003  Understanding mechanisms of novel gene expression in polyploids. Trends Genet 19: 141-147. PEARCE,  D. W., S. B. R O O D and R. Wu, 2004 Phytohormones and shoot growth in a  three-generation hybrid poplar family. Tree Physiol 24: 217-224. PETERS, A . H . , and D . S C H U B E L E R , 2005 Methylation of histones: playing memory with D N A . Curr Opin Cell Biol 17: 230-238. P I N S O N N E A U L T , J.,  C. U . N I E L S E N and W. S A D E E , 2004 Genetic variants of the  human H+/dipeptide transporter PEPT2: analysis of haplotype functions. J  23  Pharmacol Exp Ther 311: 1088-1096. RlESEBERG,  L. H . , 1997 Hybrid origins of plant species.. Annu. Rev. Ecol. Syst. 28:  359-389. R I E S E B E R G , L. H . , B . S I N E R V O , C . R. L I N D E R , M . C . U N G E R E R and D . M . A R I A S ,  1996 Role of Gene Interactions in Hybrid Speciation: Evidence from Ancient and Experimental Hybrids. Science 272: 741-745. R O N A L D , J., J .  M . A K E Y , J . W H I T T L E , E. N . S M I T H , G Y V E R T et al, 2005  Simultaneous genotyping, gene-expression measurement, and detection of allele-specific expression with oligonucleotide arrays. Genome Res 15: 284-291. S H A K E D , H . , K . K A S H K U S H , H . O Z K A N , M . F E L D M A N and A . A . L E V Y ,  2001  Sequence elimination and cytosine methylation are rapid and reproducible responses of the genome to wide hybridization and allopolyploidy in wheat. Plant Cell 13: 1749-1759. SHAN,  X . , Z . L i u , Z. D O N G , Y . W A N G , Y . C H E N et al, 2005 Mobilization of the active M I T E transposons mPing and Pong in rice by introgression from wild rice {Zizania latifolia Griseb.). M o l Biol Evol 22: 976-990.  SPRINGER, N .  M . , and R. M . S T U P A R , 2007 Allelic variation and heterosis in maize:  how do two halves make more than a whole? Genome Res 17: 264-275. STUPAR, R. M . , and N . M . SPRINGER, 2006 Cis-transcriptional variation in maize inbred lines B73 and M o l 7 leads to additive expression patterns in the F I hybrid. Genetics 173: 2199-2210. TUSKAN,  G. A . , S. D I F A Z I O , S. J A N S S O N , J . B O H L M A N N , I. G R I G O R I E V et al, 2006  The genome of black cottonwood, Populus trichocarpa (Torr. & Gray). Science 313: 1596-1604.  24  V U Y L S T E K E , M . , F. V A N E E U W I J K , P. V A N H U M M E L E N , M . K U I P E R and M . Z A B E A U ,  2005 Genetic analysis of variation in gene expression in Arabidopsis thaliana. Genetics 171: 1267-1275. WANG,  D., A . D. J O H N S O N , A . C . PAPP, D. L . K R O E T Z and W . S A D E E , 2005 Multidrug resistance polypeptide 1 (MDR1, A B C B 1 ) variant 3 4 3 5 0 T affects m R N A stability. Pharmacogenet Genomics 15: 693-704.  W A N G , J., L . T I A N , H .  S. L E E , N . E . W E I , H . J I A N G et al, 2006 Genomewide  nonadditive gene regulation in Arabidopsis allotetraploids. Genetics 172: 507-517. WlTTKOPP,  P. J., B . K . H A E R U M and A . G. C L A R K , 2004 Evolutionary changes in cis  and trans gene regulation. Nature 430: 85-88. YAN, H., W. Y U A N , V. E . VELCULESCU,  B . V O G E L S T E I N and K . W . K I N Z L E R , 2002  Allelic variation in human gene expression. Science 297: 1143.  25  APPENDIX List of primers, SNPs and lengths of amplified products. Product length for genomic Marker  DNA (for cDNA  SNP Gene  (PD/Pt)  4CL3  T/C  if intron exists) Primer sequence 5'-3' (F) CTGCACGCATACTGCTTTGAAAACCTC  (bp) 785  (R)ACCACAGCCGCAACCGAAACAT (estR) GTGAAACAAAGGTAAAACGCATAAAAC  ADH  A/T  (F) ACCTGTTGAACAGGCTTGTCATG  377(112)  (R) TGTTGCGGTTTTTGGACTGG (estR)  ADK  A/G  AGCAAAGAAGTTTGGTGTTACTGAGTT  (F) ATCAGCAGCGGCAGTCC  477 (377)  (R) CATTTTCACCTCTATAATAACCCTCT (estR) AACATGCTTTTTAGCTCCTGGGT  C3HC4  A/G  (F) ATGTCTTCCACCCCAACAAAT  403  (R)AGCCTGGATGGTACAAGTGACT (estR) AGGAAAGTGGTGGTGTCAGCGG  CHI  T/C  (F) CGGAGAAGGTTGCGGAGAAT  164  (R)AGCTAATGATCCATGGGGTGAT (estF) GAAGAAACCTTCCCCCCTGGCTCCTC  CaMBP  A/T  (F) TAAGAACCTTTGAAATTGAGACACA  579 (400)  (R)AGGCGTTGAAATGGTGCTG (estR) TTATAGTGGCACTTGTAGTTGCCCT  Cel9B  A/T  (F) GCCTTCACCACGACAATGC  416  (R) GGGCACACTGCTGATCCAAG (estR) GCTTCTTGCCGAGACCGAAAACAC  DXPS  T/C*  (estF)* AGGCCAGAGGATATGGACACGG  C/T  (F) CAGGAAATTGCAGCTAAAGTGG  540  (R) CATCTGTATGGGAATCTCTTTTGG ' (estR) TGCATCTTATCAGCTGCTACTTC  F5H  C/A  (F) GCCTAAAGGGTTGCCACTTGTA  552  (R) CCTAGCCAGGGAATGAAATCAGAC (estR) CTGTCCTTCATTTTTAGCCCCGAAAGC  GT47C  G/T  (F) AAGCCTCACGGTTCTGTACGA  380  (R) GTTACCAGTCAGAAATCGTCCG  26  Product length for genomic  Gene  Marker  DNA (for cDNA  SNP  if intron exists)  (PD/Pt)  Primer sequence 5'-3'  (bp)  (estR) GCCGGTCATAATTGCGGATGG  HAT22  C/T  487  (F) CCTGGGACTACCTTCTTCATCTT (R) AACCCCTTAATTAATCACATTACATT (estF) ATGGGAGCAAGAGATCATATTTCAAGG  ISP  A/T  507  (F) CACAGTAGATTTTTCAGTCTAAATCAG (R) GATGACCTAACTGTGGCTTATGAC (estR) GCAGCAGGATTTTGGTCATT  KNATI  T/G  (estF) AGAAATCCATGCAGGTCGCTTGGT  C/T  (F) CCTAATTCCTCGCCTTATGGG  223  (R) CACTTCCTTGTTGCTGCTGGT (estF) CAAATGATCAGTGCTTCCAATCTGA  LFY  T/C  249  (F) CTGCGGCGTTTGCTGTAAG (R) CAAGCCTTCTTCTTTCAGCTCTAA (estR) ACTATTCATCATTTCATCAAGCTCCTC  MATE  A/T  596 (411)  (F) AGAGGATGTGGATGGCAGAAG (R) GCCTGGCTCATACATTCAGTTTC (estR) AACAGGATCAGTGAACGATAACT  MP  T/C  (F) GATTAACATGCTAATGAAACCTCAAG  .  654  (R) TGTAATCCAAACATAGACAACGGT (estR) ACCAGATGATTTGTGGCATTCTGCTGA  NAK  A/T  (F) CATAAAGTGGGGATGCCGA  382  (R) TTTGGAGTTGTACTTCTGGAAATG (estF) CGGTTCCACAGCTAAGCATTGAAG  NBS-LRR  C/A  (F) GCTGTCTATGAGAAGATGCTGGG  461  (R) TCTGCATACTTTACAACTTGGATGG (estF) ACCACAAGAGATGAACTTCTTCTGAA  NPRl  T/C*  (estR)* CAGACAAAAGAGTTGAACGGCTTC  A/C  (F) TGAGAGATTGCTAACAAGATGCGT  526  (R) AGCTTTTCCTTCCTCTGTTGACTT (estF) GCAAAGACTACAACTGAGATTCTTGAT  P4H  C/T  (F) TTGAAGTAGAGTCTAAGGTGGAGG  374  (R) GCCAGTCGGATCCTAGCA (estF) GGATTAGAAACTAGAGTAACTTTCCAG  PP03  C/T  (F) ACCGAATGTGGTCAGTATGGA  602  (R) AACATCCAAATCCTCCAAGAGA  27  Product length for genomic Marker  DNA (for cDNA  SNP Gene  (PD/Pt)  if intron exists) Primer sequence 5'-3'  (bp)  (estR) CCAAGGAATTTCAACATCTTGATAAAC  PPR  T/A  (F) CTGGCAGCAATCTCAAGGTG  623 (514)  (R) GCGGTCTAATTATGGAAATTTTCT (estF) TGAGTTCCTGGCTTTGGCTT (estR) AAGGATATGCATGGTCAAAGTGTTTGT  PREGl-like  T/G  (F) AGGAGACTGGAGGATAGTCACTAT  353 .  (R) AACAATGCTTACTATGCAAGAGTT (estR) GTGACTCCAAACACCTTCCACA  RAR1  A/G  (F) CACAACAATATGATGGGAAAGC  496 (400)  (R) CACAAGCACAACCCAAAGC (estF) CAGTAGAACAACCCCGTAGAATAGAAC  Rpsl9  G/A  (F) CAAAGGTAATCTAACCCATCAGTT  422  (R) AAACTTTTGTTCGTGTTAAGATCAC (estF) TTTCGTGTAAAAGCAAACTCTCC  SKOR  T/C  (F) CGGAAGAGGTGAAAATGATCG  644 (404)  (R) GAGGTGATCTTCTGTCATAATCAGC (estR) TCCGATTCAGACTTTTCAATGTAAAGG  SPB  A/G  (F) CAATGAAGTGCCAGATGCAGC  684 (484)  (R) ACGAGCAGTTATTTCAAAAAGGAAG (estF) GATTTACATGACAATGGAAACGTCCA  SUS  G/T  (F) TTGTGAAACAGTCAATTCCTCCA  636 (348)  (R) GGCAAACCCTAAACTTGAAAGAAT (estR) CGTGCAGGACACTCTCTCCGCT 775  C/T  (F) TAATGGCGGTTCAGTCAAAGC  590  (R)TGTTACTACCCCTCTCCTTCCTTC (estF) CGAACACAGCACCAACATCACTAG  Unknown!  T/G*  (estR)* GATTGCTAGTGGGGATCAGGAA  T/C  (F) ATGAGTTTAAGATCCGAGTTGGTA  536 (424)  (R) TGCAGATCCAATAATTCTTATAGGTA (estF) TTAGTGGCCATGACAATTTCTCTCTG  Unknown!  G/A  (F) GGCTGGAGAGGAGTCTGTCA  510  (R) CTAAAACAGGCACTCCATTTCTAC (estR) AAAGCTAATCATACATTATTTGTA "est" refers to primer used for single base primer extension essay. * Alternative marker SNPs and primers used for the cis- and Zraws-regulatory variation analysis with the Fj hybrid from Chilliwack when the previous SNP did not exist in this hybrid.  28  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0101158/manifest

Comment

Related Items