UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Transcriptional regulation of USP24 by NF-kappa B Wang, Ke 2007

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Notice for Google Chrome users:
If you are having trouble viewing or searching the PDF with Google Chrome, please download it here instead.

Item Metadata

Download

Media
831-ubc_2007-0634.pdf [ 6.78MB ]
Metadata
JSON: 831-1.0101119.json
JSON-LD: 831-1.0101119-ld.json
RDF/XML (Pretty): 831-1.0101119-rdf.xml
RDF/JSON: 831-1.0101119-rdf.json
Turtle: 831-1.0101119-turtle.txt
N-Triples: 831-1.0101119-rdf-ntriples.txt
Original Record: 831-1.0101119-source.json
Full Text
831-1.0101119-fulltext.txt
Citation
831-1.0101119.ris

Full Text

TRANSCRIPTIONAL REGULATION OF USP24 BY NF-KAPPA B by KE WANG B.Sc, Tsinghua University, 2005 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Neuroscience) THE UNIVERSITY OF BRITISH COLUMBIA August 2007 © Ke Wang, 2007 A B S T R A C T Parkinson's disease (PD) is one o f the most prevalent neurodegenerative diseases. Impairment o f the ubiquitin pathway is believed to play an important role i n the pathogenesis o f P D . The ubiquitination process regulates the available amount, correct localization, and proper activity o f target proteins. This process is carried out under tight regulation not only by enzymes l inking ubiquitin molecules onto their targets, but also by deubiquitinating enzymes which remove ubiquitin molecules from the ubiquitinated proteins. Little is known about the recently discovered deubiquitinating enzyme Ubiqui t in Specific Protease 24 (USP24) , a product o f USP24 gene which spans a large area (>140,000 bp) on the chromosome lp32 region. Recent genetic linkage studies indicated that the location o f the USP24 gene is significantly correlated wi th the disease. These studies imply that U S P 2 4 is l ikely a novel " P A R K " protein. A s a part o f the study to elucidate the participation o f U S P 2 4 in P D pathogenesis and mechanisms that modulate U S P 2 4 activity, we investigated the molecular mechanism o f USP24 gene transcription. Promoter o f the USP24 gene was cloned into p G L 3 - B a s i c vector and analyzed by a luciferase based reporter assay system. We identified the transcription starting site(TSS) o f USP24 gene and the transcription starting site located at 251 bp upstream of the translation starting site.'Expression o f the USP24 gene is controlled by a ii TATA-box-less promoter. N F - K B signaling plays an important role in multiple cellular events such as inflammation and programmed cel l death. It has been reported that increased N F - K B nuclear translocation occurs in substantia nigra (SN) dopaminergic neurons o f P D patients, suggesting that N F - K B signaling is involved in P D pathogenesis. A n N F - K B binding site was identified on USP24 promoter. Overexpression o f N F - K B or activation of N F - K B by TNF-ct significantly increased USP24 promoter activity. Mutat ion of the binding site abolished the regulatory effect o f N F - K B on the USP24 promoter. In summary, we have identified USP24 gene promoter and our study demonstrates that N F - K B signaling pathway regulates USP24 gene transcription. The results w i l l further our understanding o f the regulation o f ubiquitin pathway and its involvement in P D pathogenesis. iii TABLE OF CONTENTS ABSTRACT ii TABLE OF CONTENTS iv LIST OF FIGURES viii ACKNOWLEDGEMENTS ix CHAPTER 1: Introduction 1 1.1. Overview o f Parkinson's Disease 1 1.1.1. B r i e f History o f Parkinson's Disease Research 1 1.1.2. Epidemiology o f Parkinson's Disease 1 1.1.2.1. A g e and Gender as R i sk Factors Associated wi th Parkinson's Disease 2 1.1.2.2. Environmental Factors and Parkinson's Disease 2 1.1.2.3. Genetics o f Parkinson's Disease : 3 1.1.3. Pathology o f Parkinson's Disease 4 1.2. Protein Ubiquitination and Deubiquitination 5 1.2.1 Ubiquit ination and Ubiquitin-Proteasome Pathway 5 1.2.1.1. Ubiqui t in .' 5 1.2.1.2. Protein Ubiquitination 5 1.2.1.3. The Ubiquitin-Proteasome Pathway 8 1.2.1.4 The Ubiquitin-proteasome Pathway Plays Important Roles i n Cellular Activi t ies 10 1.2.2. Other Regulatory Effects o f Ubiquitination 12 1.2.3. Deubiquitination and Deubiquitinating Enzymes 12 1.2.3.1 Subfamilies o f Deubiquitinating Enzymes 13 1.2.3.2. Functional Domains o f Deubiquitinating Enzymes 14 1.2.3.3. B io log ica l Significance o f Deubiquitinating Enzymes 15 1.2.4. Involvement o f the Ubiquitination Pathway in the Molecular Pathogenesis o f Parkinson's Disease 16 1.3. Ubiqui t in Specific Protease 24. 18 1.4. Nuclear Factor-Kappa B ( N F - K B ) Signaling 20 1.4.1. Components o f N F - K B Molecules 20 1.4.2. Molecular Mechanisms o f N F - K B Act ivat ion in Cel ls 22 1.4.3. B io log ica l Functions o f N F - K B 25 1.4.3.1. N F - K B Signalling and Immunity 25 1.4.3.2. N F - K B Signalling and Apoptosis 25 1.4.4. N F - K B Signall ing In the Nervous System and in Neurodegenerative Diseases..... 26 1.4.4.1. N F - K B Signalling In the Nervous System 26 1.4.4.2. N F - K B Signalling In Neurodegeneration and Neurodegenerative Diseases 27 1.5 Rationale and Hypothesis o f the Study 28 CHAPTER 2: Materials and Methods 31 2.1. Gene Clon ing and Generation o f Plasmid Constructs !31 2.1.1. Primer Sequences for P C R Amplifications 31 2.1.2. General Procedures o f Molecular Cloning 32 2.2. Reverse-Transcription-Polymerase Chain Reaction 34 2.2.1. R N A Extraction 34 2.2.2. Reverse Transcription ....34 2.3. C e l l Culture 35 2.3.1. Culture media 35 2.3.2. Trypsinization 35 2.4. C e l l Transfection 36 2.4.1. Lipofectamine 2000 Transfection , 36 2.4.2. Ca lc ium Phosphate Method 36 2.5 T N F - a Treatment ...37 2.6. Reporter Gene Transcription Assay 38 2 .7 .5 ' R N A Ligase-Mediated Rapid Amplif icat ion o f c D N A Ends ( 5 ' R L M - R A C E ) .- 39 2.8. Immunoblotting 40 2.9. Electrophoretic M o b i l i t y Shifting Assay ( E M S A ) 43 2.10. Data Analys is 44 C H A P T E R 3: Results 45 3.1 Characterization of USP24 Gene Coding Sequence .45 3.2. Clon ing and Characterization o f the Human USP24 Promoter 46 3.3. USP24 Has a Higher m R N A Leve l in a Human Neuroblastoma C e l l L ine vi S H - S Y 5 Y than in H E K 2 9 3 Cel ls , '. 51 3.4. USP24 Promoter Contains an N F - K B Bind ing Site 52 3.5. N F - K B Signall ing Regulates Human USP24 Promoter Ac t iv i ty 55 3.6. N F - K B Increases Human USP24 m R N A Leve l 60 CHAPTER 4: Discussion 61 REFERENCES 65 vii LIST OF FIGURES Figure 1.1. A Three-step Cascade Pathway by W h i c h a Ubiqui t in is Attached to a Protein '. ,: 7 Figure 1.2. Some Members o f the NFicB/Rel Fami ly and the I K B Fami ly 21 Figure 1.3. Act ivat ion o f N F - K B 24 Figure 3.1. Protein Sequences Alignment o f Human U S P 2 4 (hUSP24) and Mouse U S P 2 4 (mUSP24) Homologues 45 Figure 3.2. Major Domains o f the U S P 2 4 Protein 46 Figure 3.3. The Nucleotide Sequence o f the Human USP24 Promoter. 47 Figure 3.4. Mapping the USP24 Transcription Starting Site by 5 ' R L M - R A C E 49 Figure 3.5. Functional Deletion Analysis o f the USP24 Promoter Region 50 Figure 3.6. Luciferase Ac t iv i ty was Measured at 48 Hours by a Luminometer. 52 Figure 3.7. Interaction between N F - K B and the N F - K B Bind ing Element in the Human USP24 Promoter 54 Figure 3.8. N F - K B Overexpression Increases USP24 Promoter Ac t iv i ty 56 Figure 3.9. Mutations on the USP24 Promoter Abo l i sh N F - K B ' S Regulatory Effect..57 Figure 3.10. T N F - a Treatment Increases USP24 Promoter Ac t iv i ty .59 Figure 3.11. N F - K B Increases Human USP24 m R N A Leve l 60 viii ACKNOWLEDGEMENTS I would l ike to thank m y supervisor Dr. Weihong Song for his k indly help and advice during my two years o f graduate study at U B C . I learnt a lot from h im, not only on experiment techniques and scientific ideas, but also on attitude towards things. H i s generosity, intelligence, patience, and passion have set an excellent model for me and my future endeavors. I need to thank m y colleagues i n the Song Lab. I appreciate Dr. B i n Chen, Dr. Shengcai Wei , Dr. Shengchun L i u , Dr. Weihui Zhou, Dr. X i u l i a n Sun, Dr. Guiqiong He, Odysseus Z i s , Ke l l ey Bromley-Bri ts , Fang C a i , and A l a n Chan for their k indly help and encouragement on m y experiments and life. I would l ike to thank K e l l e y Bromley-Bri ts for her help on the proofreading o f m y thesis. I am thankful to Odysseus Z is for his company during my working time and his effort spent on the proofreading o f my thesis. He is the best benchmate ever. People in the Song Lab have contributed a lot to make my work and life fun and much easier. They are m y family in Vancouver. I appreciate Dr. W i l l i a m G. Honer, Dr. Robert Holt , and Dr. W i l l i a m Jia for their help as my supervisory committee members and their suggestions on m y experiments and thesis. Their advices are extremely helpful for the project. I would l ike to thank m y friends at U B C , including Qiang, Shu, Zhizhen, We i , Yan, Zephyr, Haoxiang, N i n g , Shanshan, Chao, Dongchuan, Guang, Jing, Y i , Xuefeng and many others. Their help and company have made my two years i n Vancouver incredibly wonderful. Most importantly, I would l ike to thank m y parents for their support, encouragement, and care. They are the persons who keep me moving on. X CHAPTER 1: Introduction 1.1. Overview of Parkinson's Disease 1.1.1. Brief History of Parkinson's Disease Research The symptoms o f P D were fully recognized and documented i n 1817, by a Br i t i sh physician named James Parkinson i n a short report entitled "An Essay on the Shaking Palsy (1817)" (Parkinson, 2002). In the document, Dr. Parkinson described six patients who displayed similar symptoms such as rigidity, tremor at rest, an accelerated gait, and stooped posture. About fourteen years later, the syndrome characterized by these symptoms was named P D , by a French neurologist Dr. Jean-Martin Charcot who added rigidity to Parkinson's excellent cl inical description. Dur ing the 1950s, the underlying biochemical changes in Parkinson's patients' brains were discovered. Dr. A r v i d Carlsson first illustrated the importance o f dopamine i n neuronal transmission and found that reduced dopamine levels caused PD- l ike symptoms i n animal models (Carlsson, 1959, 2002). These Nobel Prize-winning discoveries led to the use o f L-dopa, a molecular precursor o f dopamine, as an effective treatment for P D beginning i n 1967 (Cotzias, 1968; Hornykiewicz, 2002). 1.1.2. Epidemiology of Parkinson's Disease The occurrence o f Parkinson's disease is widespread. A m o n g people over 60 years old, the prevalence is about 1% (Nussbaum and E l l i s , 2003). Standardized incidence rates of P D , as reported, are 8%-18% per 100,000 person-years (de L a u and Breteler, 2006). l 1.1.2.1. Age and Gender as Risk Factors Associated with Parkinson's Disease Epidemiological studies have revealed that P D is clearly an age-related disease: 95% o f P D patients are above the age o f 50 (Van Den Eeden et al. , 2003). The prevalence o f the disease increases with age, from less than 0.5% o f people 60 years o ld to 4% of people 80 years o ld (de L a u and Breteler, 2006). The mean age at onset is 61 years, but the disease can occur at juvenile ages or at very late ages o f 80 t o 90 years (DeStefano et al. , 2002) . The incidence rate for men is 9 1 % higher than for women (Van Den Eeden et al. , 2003) 1.1.2.2. Environmental Factors and Parkinson's Disease Research has suggested a relationship between the incidence o f P D and chemicals the population is commonly exposed to, such as pesticides, herbicides, and heavy metals (Bocchetta and Cors in i , 1986; Hart, 1987; Rajput et al. , 1987; Ui t t i et al . , 1989; Gore l l et al., 1999; M c C o r m a c k et al . , 2002). In 1983, a study which investigated four who had accidentally been injected intravenously with drugs contaminated with l-methy-4-phenyl-1,2,3,6-tetrahydropyridine ( M P T P ) found that dopaminergic neurons o f the substantia nigra pars compacta (SNc) were selectively damaged and the subjects showed typical P D symptomsfLangston et al. , 1983). This discovery led to the hypothesis that exposure to environmental toxins could result in an increase in the risk o f P D development. 2 M u c h attention was paid to putative environmental factors that could lead to P D onset including pesticides, herbicides, heavy metals, as we l l as activities such as farming or l iv ing in rural areas. Interestingly, M P T P , as wel l as other herbicides and pesticides such as paraquats and rotenone are complex I inhibitors that can cause dopamine depletion (Betarbet et al . , 2000). However, epidemiological studies generate heterogeneous conclusions, and thus it is unknown whether environmental factors actually contribute to the risk o f disease (La i et al . , 2002; Jankovic, 2005; de L a u and Breteler, 2006). 1 . 1.1.2.3. Genetics of Parkinson's Disease Ten regions o f the human genome (the parkl-8,10,11 regions) have been implicated in autosomal dominant and autosomal recessive forms o f P D . These regions contain several candidate genes potentially involved in the etiology o f P D . O n l y six genes have been identified within the park regions. These are: the a-synuclein gene on chromosome 4q2l-23(parkl) (Polymeropoulos et al. , 1997), the ubiquitin C-terminal hydrolase gene on 4pl4(park5) (Leroy et al. , 1998), the parkin (parkl) gene on 6q25-27 (Kitada et al . , 1998), the DJ-1 gene on lp36 (park!) (van Dui jn et al. , 2001; Bonifati et al . , 2003), the PINK1 gene on lp35-36 (park6) (Valente et al . , 2001; Valente et al. , 2004), and the LRRK2 gene on 12pl 1.2-ql3.1 (park8) (Funayama et al. , 2002; Paisan-Ruiz et a l , 2004; Zimpr ich et al. , 2004). Candidate genes on other locations, such as 2 q l 3 (parHXGasser et al. , 1998), 4 p l 5 (park4) (Farrer et al . , 1999), lp32 (parklO) (Hicks et al. , 2002), and 2q36-37 (parkll) (Pankratz et al. , 2003), have 3 not been cloned and identified. 1.1.3. Pathology of Parkinson's Disease Dopaminergic neurons i n the S N c project to the striatum. Symptoms o f P D are thought to be caused by the loss o f these pigmented dopaminergic neurons (Hirsch et al. , 1989). The loss o f these cells influences the activity o f the neural circuits within the basal ganglia that regulate movement, causing an inhibition o f the direct pathway and excitation o f the indirect pathway. Since the direct pathway facilitates movement and the indirect pathway inhibits movement, a balance is essential for the normal function o f these two pathways, which is interrupted by a loss o f dopaminergic cells. Loss o f dopaminergic neurons i n SNc leads to increased inhibit ion o f the ventral lateral nucleus o f the thalamus, which sends excitatory projections to the motor cortex, thus leading to hypokinesia (Dauer and Przedborski, 2003; Schulz and Falkenburger, 2004). Another feature o f P D is the appearance o f L e w y bodies i n surviving dopaminergic neurons. L e w y bodies were first seen and l inked to Parkinson's disease ("paralysis agitans") i n 1912 by neurologist Frederic L e w y (1885-1950). L e w y bodies are eosinophilic cytoplasmic inclusions. The primary structural component o f L e w y bodies is oc-synuclein. Immunohistochemical labeling o f L e w y bodies using a-synuclein antibodies shows a dense core surrounded by a halo o f 10-nm wide radiating fibrils. The events leading to the generation o f L e w y bodies are still unknown. It is currently under debate whether L e w y bodies are toxic to cells or serve to protect cells from harmful effects o f misfolded proteins by sequestering them away from important cellular elements(Dauer and Przedborski, 2003). 1.2. Protein Ubiquitination and Deubiquitination 1.2.1 Ubiquitination and Ubiquitin-Proteasome Pathway 1.2.1.1. Ubiquitin Ubiqui t in , as its name suggests, is a highly conserved small regulatory protein that is ubiquitously expressed i n eukaryotes. First identified i n 1975 by Schlesinger et al, (Schlesinger et al. , 1975), ubiquitin is a roughly 8.5 k D a peptide that contains 76 amino acid residues and is one o f the most highly conserved proteins across species: human and yeast ubiquitins share 96 % sequence homology. The function o f ubiquitin was not known until the early 1980s when its biochemical functions were first elucidated by Aaron Ciechanover, A v r a m Hershko and Irwin Rose (Hershko et al . , 1979; Hershko et al. , 1980), who shared the 2004 N o b e l Prize in Chemistry based on this work. 1.2.1.2. Protein Ubiquitination Ubiqui t in is covalently conjugated to a protein substrate by an amide bond between the C-terminus o f ubiquitin (amino acid residue G76) and the e-amino group o f a substrate 5 lysine residue (Hochstrasser, 1996; Hershko and Ciechanover, 1998). The recognition o f the ubiquitin signal by downstream proteins ultimately determines the fate o f a host o f intracellular proteins. Ubiqui t in is covalently l inked to target proteins v ia a three-step ATP-dependent pathway involving three separate enzymes: E l , E2 , and E 3 . E l is an activating enzyme which consumes A T P to form a high energy thiolester-ubiquitin intermediate wi th the carboxyl group o f G76 , thereby activating the C terminus o f ubiquitin for nucleophilic attack. After ubiquitin activation, E 2 , the ubiquitin-conjugating enzyme, carries the activated ubiquitin by forming a thiol-ester bond with the ubiquitin molecule. Final ly, a ligase called E3 transfers the ubiquitin molecule to the lysine residue o f its substrate (Hershko et al. , 1983; Pickart, 2000, 2001)(Figure 1.1.). E3s are the least defined components o f the pathway. However, since they are responsible for the specific recognition o f the multitude substrates, they display the greatest variety among its different components (Gl ickman and Ciechanover, 2002). 6 Ubiquitin M + H S - ; E1 AMP + PPi •*•-Ubiquitin o - c - s H E1 Ubiquitin (^ ^arget PioteifT^)- Lys — HsN H S - - ( ^ E 2 N | 0 ll z ' ~ C- s i E2 V ) I Ubiquitin |- c - N H - L y s - f " Ta-get Pioteir J} Figure 1.1. A Three-step Cascade Pathway by Which a Ubiquitin is Attached to a Protein. The free carboxyl group of ubiquitin's carboxyl-terminal Gly residue is finally linked through an amide (isopeptide) bond to an s-amino group of a Lys residue, which is on a target protein. Additional cycles can produce a polyubiquitin chain. The ubiquitin system has a hierarchical structure. A single E l enzyme can activate ubiquitin for many conjugation reactions by transferring it to different E2 enzymes (Komitzer and Ciechanover, 2000; Wilkinson, 2000). Most E2 enzymes interact with several E3 enzymes (Voges et al., 1999; Glickman, 2000), and, most E3 enzymes can anchor ubiquitin to more than one downstream target protein. This hierarchical structure is a complicated network of overlapping interactions between its components (Glickman and Ciechanover, 2002). 7 A l l known ubiquitination reactions are completed through this three-step mechanism, independent o f the downstream signaling pathway o f the target (i.e. proteasomal proteolysis, endocytosis) (Pickart, 2000). Studies have revealed distinct patterns o f ubiquitination, called polyubiquitination, monoubiquitination, and multiubiquitination (Pickart, 2000; Hicke , 2001). Monoubiquitination and multiubiquitination involve single ubiquitin molecules labeled to one (mono) or more (multi) lysine residues on target proteins, while in polyubiquitination, several ubiquitin molecules form a polyubiquitin chain on the target protein. Additionally, in polyubiquitination, since there are seven internal lysine residues on each ubiquitin peptide, different patterns o f ubiquitin chains may also contribute to more diverse codes (Mukhopadhyay and Riezman, 2007). 1.2.1.3. The Ubiquitin-Proteasome Pathway The major role o f protein polyubiquitination, as was identified by Ciechanover et al. in 1980s, is to degrade short half-life and defective proteins v i a the ubiquitin-proteasome pathway (Ciechanover et al. , 1980; G l i c k m a n and Ciechanover, 2002). This pathway requires that at least four ubiquitin moieties be l inked to each other through Lys48-Gly76 isopeptide bonds (Chau et al . , 1989; Thrower et al . , 2000; Sloper-Mould et al. , 2001). These proteins are then degraded by a single enzyme complex called the 26S proteasome. The 26S proteasome complex is a 2.5 M D a molecular machine that contains at least 32 different subunits. These subunits 8 constitute two major structural units o f the complex: a barrel-shaped core complex called the 20S particle and two cap-shaped complexes called 19S regulatory particles. The 20S particle consists o f two a rings and two p rings, each o f which is made up o f seven subunits. The two outer a rings are predominantly structural i n purpose, while the two inner P rings are predominantly catalyticfNandi et al . , 2006). In mammals, the p i , P2, and P5 subunits in each P ring display protease activity, each wi th different substrate specificities. The p i ,P2 , and P5 subunits exhibit chymotrypsin-like, trypsin-like, and peptidyl-glutamyl peptide-hydrolyzing protease activities (Heinemeyer etal . , 1997). The 19S regulatory particle are located at either end o f the barrel-shaped 20s particle and consist o f nineteen individual subunits which can be categorized into two assemblies. One is a 10-subunit base that helps the 19s particle b ind to the a rings, while the other is a 9-subunit l i d which binds to polyubiquitin chains. S ix subunits o f the 10-subunit base exhibit ATPase activity which is believed to function i n protein unfolding and translocating ubiquitinated protein substrates into the barrel for degradationfLam et al. , 2002; L i u et al. , 2006; Sharon et al . , 2006). After a protein has been ubiquitin-marked for proteolysis, it is recognized by the 19S regulatory particle i n an ATP-dependent binding step. The central channel o f the 20S core particle is narrow and gated by the N-terminal tails o f the a-ring subunits. 9 Consequently, the interior chamber is at most 53 A wide and the entrance can be as narrow as 13 A(Nandi et al., 2006). As a result, substrates entering the barrel must be at least partially unfolded before they enter the core. After the substrate has entered the interior of the 20S particle, it comes in contact with proteolytic active sites and is degraded. (Heinemeyer et al., 1997; Lam et al., 2002). 1.2.1.4 The Ubiquitin-proteasome Pathway Plays Important Roles in Cellular Activities The ubiquitin-proteasome pathway is required in various cellular functions such as cell cycle control, apoptosis, and transcription regulation. Mitotic cyclins have one of the shortest life spans of all intracellular proteins. They have a half-life of only a few minutes, after which they are degraded (Lodish, 2004). The degradation of cyclins is triggered by polyubiquitination and processed by the proteasome. This process provides directionality for the cell cycle. For example, exit from mitosis requires dissociation and degradation of cyclin B from the mitosis promoting factor complex(Chesnel et al., 2006). Disrupting this process will arrest cells in late anaphase in vertebrate cells(Surana et al., 1993; Brito and Rieder, 2006). The ubiquitin-proteasome system is also involved in apoptosis. During apoptosis, increased protein polyubiquitination and E l , E2, and E3 enzyme levels are observed (Haas et al., 1982; Schwartz et al., 1990; Low et al., 1997). Translocation of the 10 proteasome from the nucleus to outer membrane blebs is also seen during apoptosis(Pitzer et al . , 1996). Ubiqui t in sequence-specific antisense oligonucleotides can cause a decrease i n the proportion o f cells displaying the y-irradiation-induced apoptosis phenotype(Delic et al. , 1993). Furthermore, inhibit ion o f the ubiquitin system prevents the apoptosis induced by N G F deprivation i n sympathetic neurons(Sadoul et al . , 1996). These results suggest that the ubiquitin-proteasome pathway plays a key role i n apoptosis. The ubiquitin-proteasome machinery also plays an important role i n gene transcription regulation. The p50 subunit o f Nuclear Factor kappa B ( N F - k B ) is a mature form of N F - k B generated from its precursor p i 05. The partial proteolysis is carried out by the 26S proteasome complex. During activation o f N F - K B signaling, the ubiquitin-proteasome system is responsible for the degradation o f N F - K B ' S inhibitory partner IKB (refer to section 1.4.2.). B y regulating the maturation and degradation o f transcription factors, the ubiquitin-proteasome pathway is involved i n regulating gene transription. Both in vivo and in vitro studies have shown that in tumor supressor protein p53 is degraded by the ubiquitin-proteasome system(Ciechanover et al . , 1991; M a k i et al . , 1996). Accumulat ion o f p53-ubiquitin adducts in the cytosol are observed i f 26S proteasome function is inhibited(Hershko and Ciechanover, 1998). Degradation o f other oncoproteins and tumor suppressors by the ubiquitin-proteasome pathway is n also critical for the normal function and metabolism o f cel}s(Treier et al . , 1994; Aberle etal . , 1997). 1.2.2. Other Regulatory Effects of Ubiquitination Polyubiquitination associated with the Lys48 linkage normally induces proteolysis, while monoubiquitination or polyubiquitination associated wi th the Lys63 linkage is usually associated with other downstream target fates. Monoubiquit ination and multiubiquitination can subserve a variety o f functions, such as endocytosis, histone regulation, and the budding o f retroviruses from the plasma membrane (Hicke, 2001). 1.2.3. Deubiquitination and Deubiquitinating Enzymes Deubiquitinating enzymes are proteases that can specifically cleave ubiquitin molecules off ubiquitin-tagged proteins at the ubiquitin carboxy terminus (D'Andrea and Pellman, 1998). Proteases, a family o f protein consisting o f 561 members (Puente and Lopez-Otin, 2004), can be divided into five different classes based on their mechanism o f catalysis: metallo, aspartic, serine, threonine, and cysteine proteases. The majority o f deubiquitinating enzymes are cysteine proteases. The enzymatic activity o f cysteine proteases largely relies on the thiol group o f a cysteine, which sits in the active site together with an adjacent histidine residue. The histidine is polarized by an aspartate residue. The cysteine, histidine, and aspartate residules form a catalytic triad. Dur ing enzyme function, the cysteine makes a nucleophilic attack on the carbonyl group o f the peptide bond between the ubiquitin molecule and the target. 12 A s a result, the enzyme forms a covalent intermediate wi th ubiquitin, and the target protein is released. Reaction o f this intermediate with a water molecule causes the release o f ubiquitin from the enzyme(Nijman et al., 2005). 1.2.3.1 Subfamilies of Deubiquitinating Enzymes There are five subfamilies o f deubiquitinating enzymes(DUBs): Ubiqu i t in C-Terminal Hydrolases ( U C H s ) , Ubiqui t in Specific Proteases (USPs), Machado-Joseph Disease Protein Domain Proteases (MJDs) , Ovarian Tumor Proteases (OTUs) , and J A M M M o t i f Proteases. The majority o f D U B s reside in the U C H and U S P subfamilies (Amerik and Hochstrasser, 2004). The largest and most diverse subfamily o f deubiquitinating enzymes is the U S P subfamily. Cysteine proteases o f this family contain two short and conserved motifs called Cys and H i s boxes (Papa and Hochstrasser, 1993), which contain a l l the catalytic triad residues as we l l as other residues critical for catalysis. U C H s were the first deubiquitinating enzymes to be identified. They were originally purified based on their ability to bind to ubiquitin affinity columns (Woo et al. , 1995). L i k e U S P s , U C H s contain active sites containing cysteine, histidine and aspartate residues. However, they do not display the USP-conserved Cys and H i s box domains. In addition, one o f the characteristics o f U C H family members is their relatively small size and preference i n releasing small proteins from ubiquitin conjugation(Amerik and 13 Hochstrasser, 2004). The number of different E3 enzymes increases with increasing organism complexity, as do their deubiqutinating counterparts, DUBs. The large number, varying sizes, and various structural complexities of DUB members suggest that DUBs have diverse substrate specificities(Papa and Hochstrasser, 1993; Wilkinson et al., 1995). 1.2.3.2. Functional Domains of Deubiquitinating Enzymes One of the most important domains of deubiquitinating enzymes is the ubiquitin-associated (UBA) domain. Proteins participating in the ubiqutin pathway require a domain to interact with ubiquitin molecules. This is achieved by a modular composition of ubiquitin-binding motifs including UBA domains. The U B A domain is composed of a short motif of about 45 amino acid residues. This motif has been identified in E2, E3, and deubiquitinating enzymes, including mammalian E2-25K, drosophila hyperplastic discs protein, and eukaryotic ubiquitin isopeptidase T. UBA domains were found to exist singly or as multiple copies in a tandem arrangement (Hofmann and Bucher, 1996; Buchberger, 2002; Mueller and Feigon, 2002). The 3-D structure of UBA domains is classified as a compact three-helix bundle. This three-helix bundle has an unusually large hydrophobic surface area, which is where DUBs interact(Mueller and Feigon, 2002). As the UAB domain is a feature of proteins involved in the ubiquitin-proteasome 14 pathway, the peptidase_C19 domain is a feature specific to deubiquitinating enzymes. Protein peptidases can be grouped into various clans and families. The peptidase_C19 domain is a characteristic of proteins that belong to the cysteine peptidase family and the CA clan. A typical cysteine peptidase contains conserved active sites consisting of cysteine, asparagine, and histidine residues, which form a catalytic triad. 1.2.3.3. Biological Significance of Deubiquitinating Enzymes Gene deletion studies have found no relationship between deubiquitinating enzymes and cell growth or viability in yeast (Amerik et al., 2000). However, research carried out using higher eukaryotes including mammals reveales that USPs and other deubiquitinazing enzymes are involved in various critical cellular processes (Tablel). Deubiquitinating enzymes function at different stages of the ubiquitination pathway. They remove ubiquitin from ubiquitinated proteins, rescuing them from degradation or regulating their localization(Fischer-Vize et al., 1992; D'Andrea and Pellman, 1998). They also trim polyubiquitin chains, editing the polyubiquitination signal(Amerik et al., 1997; Baek et al., 1997). In addition, they remove ubiquitin molecules off target proteins just before the protein encounters the proteasome, facilitating entry into and subsequent unfolding and translocation within the proteasome(Lam et al., 1997; Verma et al., 2002; Yao and Cohen, 2002). The above processes release ubiquitin molecules, which are subsequently recycled back to the ubiquitin pool. 15 The stability of p53 is highly regulated by the deubiquitinating pathway. This involves its interaction with an enzyme called USP7. Studies have found that different levels of USP7 inhibition can result in distinct degradation fates of p53 (Li et al., 2002a; Cummins et al., 2004). Deubiquitinating enzymes are also highly involved in chromatin structure modification, and thus in regulation of gene transcription and silencing(Daniel et al., 2004; Yamashita et al., 2004). In yeast, deubiquitination of histone 2B (H2B) by the enzyme UbplO is required for telomeric silencing(Emre et al., 2005). In contrast, ubiquitin-H2B conjugates can also be deubiquitinated by Ubp8, which leads to transcriptional activation(Henry et al., 2003; Gardner et al., 2005). 1.2.4. Involvement of the Ubiquitination Pathway in the Molecular Pathogenesis of Parkinson's Disease The ubiquitin-proteasome pathway has long been found to be involved in neurodegenerative diseases including Parkinson's, Alzheimer's, and Lewy body disease (Lowe et al., 1988; Lowe et al., 1990; Gai et al., 1995). Immunohistochemical staining has revealed that ubiquitin is a component of Lewy bodies and is useful as a diagnostic tool (Kuzuhara et al., 1988; Galvin et al., 1999). The accumulation of proteins seen in brain matter presenting with Lewy bodies and 16 the presence of ubiquitin in these accumulations suggest a role for the ubiquitination-proteasome pathway in the pathogenesis of PD (Spillantini et al., 1997). Evidence for this hypothesis is being generated from studies focusing on different components of this pathway, including ubiquitinated substrates, ubiquitinating enzymes, and deubiquitinating enzymes. Mutations in a-synuclein proteins, which contribute to the occurrence of familial cases of PD, have been found to be associated with impaired proteasome function. These a-synuclein mutations can adopt an unusual protein folding pattern that prevents their degradation via the proteasome pathway, even if the proteins are polyubiquitinatedfWeinreb et al., 1996; Conway et al., 1998; Bennett et al., 1999). In addition, transgenic mice expressing wild-type human a-synuclein display dopaminergic loss and formation of inclusions similar to Lewy bodies(Masliah et al., 2000). Parkin, as its name indicates, is another important molecule involved in PD pathogenesis. Parkin was the first gene identified as a contributor to familial parkinsonism. Parkin encodes a protein with two RING domains at its carboxy terminus and a ubiquitin-like domain at its amino terminus(Kitada et al., 1998). This structure is suggestive of an E3 (i.e. ubiquitin ligase)-like activity(Imai et al., 2000; Shimura et al., 2000; Zhang et al., 2000). Specific substrates and functions of the protein are still unknown, partly due to evidence that knockout mice display no 17 significant change in neuronal inclusions or dopaminergic neuronal loss(Goldberg et al. , 2003; Perez and Palmiter, 2005). However, loss-of-function mutation o f parkin's counterpart in Drosophila display deficiency in flight muscle function and sperm individualization, indicating a function associated with mitochondria(Greene et al. , 2003). This raises the possibility that similar mitochondrial impairment initiates the selective cel l loss observed in P D . Deubiqutinating enzymes have also been found to be involved i n P D . M o s t attention has been focused on Ubiqui t in C-terminal h y d r o l a s e - L l (UCH - L l ) . A l s o called PGP9 .5 , U C H - L 1 is one o f the most abundant proteins i n the brain, counting for 20% of a l l proteins i n the human brain (Wilkinson et al. , 1989; Wi lk in son et al. , 1992). Interestingly, immunoreactivity for U C H - L 1 was found i n L e w y bodies, indicating that U C H - L 1 , l ike ubiquitin, is a component o f L e w y bodies as wel l (Lowe et al . , 1990). Moreover, a missense mutation (Ile93Met) o f U C H - L 1 , which causes a 50% reduction in its enzymatic activity, was discovered in a German family with P D history (Leroy et al. , 1998), and dopaminergic neuronal loss has been seen in transgenic mice expressing this mutant protein(Setsuie et al . , 2007). 1.3. Ubiquit in Specific Protease 24 The age at which an individual first manifests symptoms o f a disease is called Age-at-Onset or A A O . Evidence suggests that the A A O o f a disease can be genetically influenced (Daw et a l , 1999). Different lines o f evidence have shown that that AAO in neurodegenerative diseases such as Parkinson's disease and Alzheimer's disease is genetically controlled (Li et al., 2002b). In particular, genetic studies of PD have found that Apolipoprotein E and the 2ql3 region containing the putative park3 gene influence the AAO of Parkinson's disease (DeStefano et al., 2002; L i et al., 2004). The parklO region on chromosome lp32, was recently found to be related to both the risk and AAO of PD (Hicks et al., 2002; L i et al., 2006). Of 30 genes which lie within this region USP24 has been found to be linked to these findings. The USP24 gene is located at 55,304,620-55,453,627 on the p arm of Chromosome 1. Based on the predicted sequence in the Ensembl genome database (Ensembl ID: ENSG00000162402), the human USP24 gene transcript (Ensembl ID: ENST00000294383) is 10,802 bp long and is composed of 68 exons. The shortest exon is 36 bp, while the longest one, containing the 3' UTR, is 2,749bp. Oliveira et al. found that several USP24 SNPs are significantly related to the AAO of PD(01iveira et al., 2005). In addition, L i et al identified 17 SNPs of the USP24 gene which contribute to the risk of late-onset PD (Li et al., 2006). These studies suggest that genetic variation in the human USP24 gene may play an important role in the etiology of PD. 19 1.4. Nuclear Factor-Kappa B (NF-KB) Signaling N F - K B was first identified as a B cell nuclear factor that binds to a site in the immunoglobulin K enhancer (Sen and Baltimore, 1986), N F - K B proteins constitute a family o f dimeric transcription factors expressed in various tissues and involved in multiple important cellular processes such as cell division, apoptosis, and inflammation (Ghosh et al. , 1998). 1.4.1. Components of N F - K B Molecules Subunits that serve as components o f N F - K B dimers include N F - K B 1 (p50), N F - K B 2 (p52), R e l A (p65), R e l - B and C - R e l , al l o f which are characterized by the R e l homology domain ( R H D ) , an N-terminal region o f approximately 300 amino acids (Baldwin, 1996). A subfamily o f N F - K B proteins, including p65, R e l - B , and c-Rel , consist o f proteins wi th a transactivation domain in their C-termini . In contrast, the p50 and p52 proteins are synthesized as large precursors, p l 0 5 and p l00 (F igu re l .2). 20 p65 (RelA) c-Rel RelB L~ Dorsal Dif p105/p50(NF-KBl) p100/p52(NF-KB2) ! IidBB Bcl-3 cactus Rel homology domain \ / sSSSE I l l I I t 1 _ l 1 1 1 L- l t Z Figure 1.2. Some Members of the NFicB/Rel Family and the IKB Family The Rel homology domain is the main characteristic of NF-kB family members. IkB family members have multiple copies of the ankyrin repeats. PI05 and PI00 contain both the Rel homology domains and ankyrin repeats. Although the dominant form of N F - K B is a p50/p65 heterodimer, other combinations exist in vivo and in vitro, such as p65/C-Rel heterodimer, p52/p65 heterodimer, and p50, p52 and p65 homodimers (Urban et al., 1991; Duckett et al., 1993; Siebenlist et al., 1994; Baldwin, 1996). Unlike RelA, RelB, and c-Rel, the p50 and p52 N F - K B subunits do not contain transactivation domains in their C termini, and as a result, p50 and p52 homodimers act as repressors of transcription. However, both p50 and p52 21 participate i n target gene transactivation by forming heterodimers wi th R e l A , R e l B or c-Rel ( L i and Verma, 2002). The term N F - K B is most often used to describe the p50/p65 complex since the p50/p65 dimer was the first N F - K B dimer to be identified and is the most abundant i n almost a l l cell types (Kar in and Ben-Neriah, 2000). Except R e l B , which is only expressed in certain cel l types such as interdigitating dendritic cells (Ryseck et al. , 1992), al l other N F - K B subunits are constitutively expressed i n al l cell types (Carrasco et al. , 1993). A s a sequence-specific transcription factor, N F - K B has a binding preference characterized by a nucleotide consensus sequence 5 ' - G G G R N N Y Y C C - 3 ' (R is purine; Y is pyrimdine, and N is pyrimidine or purine), though different subunits exhibit dissimilar binding affinities(Kunsch et al. , 1992). 1.4.2. Molecular Mechanisms of NF-KB Activation in Cells Prior to activation, N F - K B is sequestered i n the cytosol by a family o f inhibitory proteins called Inhibitors o f kappa B s (IKBS). IKB family members include IKBOC, IKB(3, IKBY, hcBe, B c l - 3 , plOO, and p l 0 5 (Baeuerle and Baltimore, 1996; Ba ldwin , 1996), a l l o f which are characterized by several copies (six to eight) o f ankyrin repeats (Figurel .2). The most important and wel l characterized IKB protein is IKBCI. Act ivat ion o f N F - K B signaling involves deactivation o f IKB (Inoue et al. , 1992). Prior 22 to activation o f N F - K B , the IKBCX monomer binds to the p65 subunit o f N F - K B via its C-terminal ankyrin repeats, which masks the nuclear localization sequence o f p65 (Beg and Ba ldwin , 1993; Baeuerle and Henkel, 1994) and thus keeps N F - K B out o f the nucleus. The activity o f IKB is regulated by a kinase called the I K B kinase ( I K K ) . Through various signals such as tumor-necrosis factor alpha (TNF-ct) and interleukin-1 (IL-1), I K K is activated and phosphorylates two serine residues (serine 32 and 36 o f human IKBCX) located in the N-terminus regulatory domain o f IKBOC (DiDonato et al. , 1996; K a r i n and Ben-Neriah, 2000). Subsequently, phosphorylated IKBCX is modified by polyubiquitins at lysines 21 and 22 and undergoes degradation via the ubiquitin-proteasome pathway (Scherer et al . , 1995; B a l d i et al . , 1996). A s a result, N F - K B is free to translocate into the nucleus, where it activates transcription o f target genes (Figure 1.3). This mechanism o f activation makes N F - K B a rapid-acting primary transcription factor whose activation does not need novel protein synthesis and thus can respond quickly to external stimuli. Interestingly, IKBCX gene expression is regulated by N F - K B . Newly-synthesized IKBCX is able to re-inhibit N F - K B and thus forms an auto feedback loop, resulting in oscillating levels o f N F - K B activity (Nelson et al. , 2004). 23 Signal (e.g. TNF-a) Figure 1.3. Activation of N F - K B This is a schematic model o f a process i n which the N F - K B p50/p65 dimer is activated. After a stimulus activates the I K K activating kinase, I K K phosphorylates IKB at specific serine residues. Phosphorylated IKB is ubiquitinated at two lysine residues and degraded by proteasome pathway. The released N F - K B dimer translocates into nucleus and regulates target gene expression. N F - K B signaling is activated in response to a wide range o f stimuli, including pathogens, stress signals and pro-inflammatory cytokines, such as T N F - a or I L - 1 . Many pathogens are recognized by specific pattern-recognition receptors on the cel l surface. These receptors have evolved to recognize pathogen-derived substances, such 24 as lipopolysaccharide (LPS), peptidylglycans, lipoproteins, and unmethylated bacterial DNA (Kelliher et al., 1998; Imler and Hoffmann, 2000; Ruland et al., 2001; L i and Verma, 2002). 1.4.3. Biological Functions of N F - K B 1.4.3.1. N F - K B Signalling and Immunity N F - K B is required for the regulation of innate immunity and cellular defense against bacterial invasion (Ghosh et al., 1998), and in particular for the rapid induction of acute-phase defence genes in response to invading pathogens(Gerondakis et al., 1999; Li and Verma, 2002). Aberrant N F - K B activity in mice and humans is associated with susceptibility to microbial infection (Gerondakis et al., 1999; Perkins, 2000). In addition, N F - K B activity is important for the development and maturation of macrophages and neutrophils (Denk et al., 2000). N F - K B signaling is crucial in adaptive immunity as well. Mice lacking individual N F - K B proteins have defects in B -and T-cell proliferation, activation, and cytokine production(Li and Verma, 2002). 1.4.3.2. N F - K B Signalling and Apoptosis N F - K B plays an important regulatory role in cellular apoptosis. It has been found that N F - K B modulates the expression of multiple antiapoptotic or cell survival genes (Mistry et al., 2004; Shishodia and Aggarwal, 2004). Studies using p65 knockout mice reveal that p65 inhibits apoptosis in the liver at embryonic days 14-16 (Van Antwerp et al., 1998). Fibroblast cells generated from p65 knockout mice show reduced 25 viability in TNF-stimulation experiments while they can be rescued by transient expression of p65, indicating an essential role for N F - K B in preventing TNF-induced cell apoptosis (Beg and Baltimore, 1996). Inhibition of N F - K B using an I K B mutant with strengthened inhibitory ability leads to increased cell death (Liu et al., 1996). 1.4.4. N F - K B Signalling In the Nervous System and in Neurodegenerative Diseases 1.4.4.1. N F - K B Signalling In the Nervous System Much evidence supports essential roles for N F - K B signaling in the nervous system. Similar to other organ systems, N F - K B is expressed in all cell types in the nervous system, including neurons, microglia, astrocytes, and oligodendrocytes. N F - K B signalling's upstream mediators such as TNF-a receptor and Fas are also present in neurons and glial cells (Bruce et al., 1996). In addition, neurotrophin receptor p75 has also been found to mediate N F - K B signaling (Carter et al., 1996). Interestingly, electrical activity within neurons and event associated with synaptic transmission are also considered possible neuron-specific stimuli for NF-KB(O rNeill and Kaltschmidt, 1997). Several genes crucial for neuronal or microglial function are the targets of N F - K B regulation. Products of these genes include TNF-a, IL-6, Bcl-2, manganese superoxide dismutase(Mn-SOD), and inhibitor-of-apoptosis proteins (IAPs) (Mattson and Camandola, 2001). 2 6 { 1.4.4.2. N F - K B Signalling In Neurodegeneration and Neurodegenerative Diseases N F - K B signalling is highly involved in neurodegenerative conditions. In rodent stroke models, N F - K B is activated i n C A 1 hippocampal neurons o f rats fol lowing transient global forebrain ischemia (Mattson and Camandola, 2001). C e l l culture studies suggest that N F - K B activation can protect neurons against excitotoxic and metabolic insults caused by stroke (Cheng et al. , 1994), and hippocampal neurons lacking the p50 subunit o f N F - K B display increased vulnerability to excitotoxicity (Yu et al., 1999). In rats wi th traumatic spinal cord injury, N F - K B activation is observed i n neurons surrounding the injury site(Bethea et al. , 1998). Under chronic neurodegenerative conditions, N F - K B activation is also observed. N F - K B can be activated in neurons incubated with amyloid beta peptides. N F - K B is also activated in neurons surrounding early amyloid plaques in humanbrain tissue from patients with Alzheimer ' s disease ( A D ) (Kaltschmidt et al . , 1997). Immunohistochemical studies reveal increased N F - K B immunoactivity i n the hippocampal formation and cerebral cortex of A D patients(Terai et al . , 1996). Increased N F - K B activity is highly correlated with increased cyclooxygenase-2 gene transcription i n the superior temporal lobe o f sporadic A D patients(Lukiw and Bazan, 1998). Several studies have indicated the importance of N F - K B in P D pathogenesis. 27 Expression o f T N F - a has been found in microglial cells o f the substantia nigra i n P D patients (Boka et al . , 1994). Based on immunohistochemical analysis, Hunot et al found that translocation o f N F - K B to the nucleus i n the dopaminergic neurons o f P D patients significantly increased (Hunot et al . , 1997). Moreover, it was observed that the N F - K B levels in nigrostriatal dopaminergic regions were significantly higher in P D patients than i n controls ( M o g i et al., 2007). This evidence suggests that N F - K B is highly involved in P D pathogenesis; however, the identity o f genes activated by N F - K B in P D and how they participate i n P D pathogenesis remain unclear. 1.5 Rationale and Hypothesis of the Study P D , l ike most other neurodegenerative diseases, is believed to be caused by multiple factors, both genetic and environmental. To date researchers have found no single factor that can solely underlie the occurrence o f the disease; thus, before we can draw the complete picture o f the molecular mechanism o f P D we require more detailed evidence. Although studies have shown that the ubiquitin-proteasome pathway plays a very important role i n the molecular pathogenesis o f P D , several questions sti l l remain to be answered: how is this pathway involved in the pathology o f P D ? how many members are participating in it? how do those members interact wi th each other, and how does impairment o f the ubiquitin-proteasome pathway contribute to the pathogenesis o f P D ? 28 It is interesting and suggestive that several park genes are encoding proteins related to ubiquitination or deubiquitination: parkin has an E3 enzymatic activity (Imai et al., 2000; Zhang et al., 2000), oc-synuclein is targeted to be ubiquitinated when it is phosphorylated (Hasegawa et al., 2002), and UCH-L1 is a ubiquitin carboxyl-terminal hydrolase (Leroy et al., 1998). As details of ubiquitin-involved pathways are being continuously discovered, it is likely that proteins encoded by the corresponding park genes, when we consider the network of ubiquitin pathway as a whole, are just the tip of the iceberg. As a result, before we are able to elucidate the involvement of the ubiquitin pathway in the molecular pathogenesis of PD and other neurodegenerative disorders we need to identify more members involved in the ubiquitin pathway. USP24 gene, as shown in the previous introduction, is a candidate for the parklO gene. Little is known about the function, localization, or substrates of this USP family member.; however, the significant relationship between USP24 gene and the AAO of PD gives us a hint to focus on this new gene and to investigate the possible roles USP24 protein plays in PD pathology. USP24, as a deubiquitinating enzyme, is crucial for the regulation of cellular processes. Accordingly, its own expression has to be tightly regulated. Any misregulation involved in this process may lead to dysfunction of the ubiquitin pathway network, which may contribute to the occurrence and/or development of PD. As a result, it is essential to elucidate how USP24 gene expression is regulated. 29 Transcriptional regulation o f gene expression is necessary for its protein's spatial and temporal distribution. Transcriptional regulation is mainly achieved by controlling the initiation process o f transcription, i n which the promoter o f a gene plays an important role. A s the functions and properties o f the protein are currently being investigated we first elucidated the regulation o f USP24 promoter activity. This work w i l l shed light on investigations o f the USP24 gene expression profile and the upstream signalling pathways o f U S P 2 4 . We hypothesize that human USP24 gene expression is highly regulated at the transcriptional level and that the USP24. gene is a target o f an important signaling pathway which may be associated with the pathogenesis o f P D . 30 CHAPTER 2: Materials and Methods 2.1. Gene Cloning and Generation of Plasmid Constructs 2.1.1. Primer Sequences for PCR Amplifications Primers for cloning were designed to include restriction enzymes sites so that the resulting PCR-amplified fragments could be easily cloned into the multiple cloning sites of vector pGL3-basic (Promega). For USP24, ten fragments from 1749 upstream to 102 bp downstream of the translation start site (ATG) were amplified by PCR and inserted in front of the luciferase reporter gene (Luc) in,the pGL3-basic expression vector. Primers used to generate different promoter deletion plasmids include: forward, Sac-1498f: 5'-AAGAGCTCCAGCAGGGGTTTGATGG, Sac-570f: 5'-AAGAGCTCGCAGCGAGGCGTATTCAGG, Sac-504f: 5'-AAGAGCTCGACTGCGGTGCATTTCAGG, Sac-442f: 5 '-AAGAGCTCCTAGGATGGGGAGCGGGT, Sac-402f: 5'- A A G AGCTCGGGAAGTCC AACGGGGGTT, Sac-183f: 5'-AAGAGCTCCGGCAGCCCTTTCACCTTA, Sac-89f: 5 '-AAGAGCTCGCCTGCCAACGGCGAGCAC, and Sac-37f: 5 '-AAGAGCTCGCGGCCCCGCCGCCCGGGG, and reverse, Xho-370r: 5'-CCGCTCGAGCCCGAGCCTCTCCGAAC, Xho-28r: 5'-CCGCTCGAGCGGGGCCGCGCCTCGGCTC, Xho+27r: 5'-CCGCTCGAGCCCTGCGCGCCGCCATGTT, and Xho+149r: 5'-CCGCTCGAGGTTGGCCCCTGCGTTCCTG. 31 The USP24 promoter region and the inserts o f the promoter-luciferase plasmids were sequenced by an automatic fluorescence-based D N A sequencer ( A S I P R I S M D N A analyzer; App l i ed Biosystems). For mutations introduced into the USP24 promoter construct, the primer MutEcoRI-697r has the sequence: 5 ' - C G G A A T T C G G T G C G C C G C G G C T G T A G G C . For detection o f the USP24 m R N A level, the primers we used are USP24+419f : 5' - G T C C A T C C C T T A C A A G C G A and USP24+776r: 5' - G C C C A A T T C C T T T G A G A C A . 2.1.2. General Procedures of Molecular Cloning 2-5 ug o f vector plasmid and D N A inserts o f interest product were digested with restriction enzymes (New England Biolabs) in 30 u l overnight. Agarose gel electrophoresis was used to separate the desired D N A . 1.5% agarose gels with 0.5ug/ml ethidium bromide were run in l x T B E buffer (10><TBE: 108 g Trizma, 55 g Bor ic acid, 40 m l E D T A (0.5 m M / p H 8.0), make up to 1000ml with d H 2 0 ) at 110V for 30 minutes. The D N A was visualized with U V light and photographed with Kodak Imaging system. Desired D N A was cut out from the agarose gel and isolated with phenol-chlorophorm method. N a A C (final concentration 0 .3M) and 2.5 volumes o f 32 ethanol were added to the supernatant collected and incubated at - 8 0 degree Celsius for 30minutes. The D N A were pelleted with top speed (13,000rpm) for 20 minutes at room temperature and washed once with .70% ethanol. D N A was dried and dissolved in 20ul H2O and D N A concentration was tested by spectrophotometers. The ligation 1 was usually done with 50-100ng o f vector and 100-200ng o f insert depending on the size (molar ratio o f vector:insert = 1:3). 1 ul T4 D N A ligase (Invitrogen) was used in 20 ul system for cohesive ends ligation at room temperature for more than l h . The ligated product was transformed into 50-100pll DH5ct competent cells (Invitrogen) by reacting on ice for 30 minutes, 37 degree Celsius for 1 minute and on ice for 5 minutes. The transformation system was then mixed with 200ul L B and shaken for 2 hours at 300rpm and 37 degree Celsius and plated onto ampici l l in supplemented L B agar plates. 6 colonies were picked up the next day and inoculated into 1.5ml L B supplemented wi th ampicillin(60ng/ml). Minipreparation was done wi th the D N A minipreparation ki t from Promega following manufacturer's protocol. The minipreparation was checked with enzyme digestion and confirmed by sequencing. The confirmed plasmid is quickly transformed with l u l plasmid into 10ul DH5ct by on ice 1 minute, 37 degree Celsiuss 1 minute and ice 1 minute and plated onto the ampici l l in plate. The next day, one colony is picked up and inoculated into 8ml L B supplemented with antibiotics and cultured for 8 hours before diluted into 250ml L B . Antibiot ic was added right before use with a concentration o f 60ng/ml. The culture was continued for 16 hours at 37 degree Celsius and 300rpm before extracting plasmid D N A wi th the midipreparation kit from Qiagen fol lowing the manufacturer's instructions. 2.2. Reverse-Transcription-Polymerase Chain Reaction 2.2.1. RNA Extraction Cells were harvested with 0.5mL Tri-Reagent (Sigma, T9424). The sample in Tri-Reagent can be stored at -80 degree Celsius. Cell samples were treated with 0.1 mL chloroform and incubated at room temperature for 10 minutes. The mixture was then centrifuged at 4 degree Celsius at 13,000 rmp for 15 minutes. Three phases could been seen after centrifugation. The top aqueous phase containing RNA was collected and mixed with 0.25mL isopropanol. The samples were incubated for 7 minutes at room temperature and then centrifuged at 13,000 rpm for 10 minutes at 4 degree Celsius. The supernatant was removed and the pellet was washed with 0.5mL 75% Ethanol. After centrifuging at 13,000 rpm for 5 minute, RNA pellet was air-dried, dissolved in 30uL DEPC-treated water and incubated in 55°C water bath for 10 minutes. Water used in this process was DEPC-treated and tips and tubes were RNase-free) 2.2.2. Reverse Transcription cDNA synthesis was carried out with the ThermoScript RT-PCR System kit (Invitrogen, 11146-016) . 50uM Oligo(dT) 20 primer, RNA, lOmM dNTP Mix and DEPC-treated water were included in the RNA-primer denaturation reaction. 5 ug RNA was denatured at 65 degree Celsius for 5 minutes. After that, the cDNA synthesis master reaction mix was added to the reaction. The master mix contained 5 x cDNA 34 Synthesis Buffer, 0 . 1 M dithiothreitol, R N a s e O U T ™ (40U/ul), DEPC-treated water and T h e r m o S c r i p t ™ R T (15TJ/(a.l). After incubation at 50 degree Celsius for 50 minutes, the reaction was terminated by incubating at 85 degree Celsius for 5 minutes. The remaining R N A templates in the reaction were removed by incubating at 37 degree Celsius for 20 minutes after adding 1 ul o f RNase H . 2.3. Cell Culture 2.3.1. Culture media H E K 2 9 3 (Human Embryonic Kidney cel l line), N 2 a (Mouse neuroblastoma), and S H - S Y 5 Y (Human neuroblastoma) cell lines were cultured in medium shown as below: Per bottle o f medium contains: 500mL Dulbecco's Modi f i ed Eagle M e d i u m (Gibco 11960-069) 5 m L Sodium Pyruvate (Gibco 11360-070) 5 m L Penicill in-Streptomycin (Gibco 15070-063) 5 m L L-glutamine (Gibco 25030-081) 50mL Fetal Bovine Serum (Gibco 26140-079) 2.3.2. Trypsinization Trypsinization o f a l l types o f cells used in this research fol low the same protocol: Med ium was removed from the plates. Then cells were washed by room-temperature Hanks Balanced Salt Solution ( H B S S ) (Gibco 14170-112) and treated with 35 Trypsin-EDTA (Gibco 25200-072). Cells were suspended in fresh culture medium, counted and seeded for transfection. A l l cell lines were maintained in 37 degree Celsius incubator containing 5% CO2. 2.4. Cell Transfection Cell transfection in this project was done with either calcium phosphate method or with Lipofectamine 2000 (Invitrogen 11668-019). 2.4.1. Lipofectamine 2000 Transfection Proprietary transfection reagents Lipofectamine 2000 was used in this project for transfection of SH-SY5Y cells in order to achieve higher transfection efficiency. Cells were seeded one day before transfection and had a 70-80% confluence. D N A was mixed with Opt i -MEM I (Gibco 31985-070) at the dilution around lug in lOOul. Same amount of Opt i -MEM I was mixed with Lipofectamine 2000 at a ratio around 25:1. After 5 minutes at room temperature, the two mixtures were mixed together. After 10 minutes at room temperature incubation, the solution was dropped onto the cultured cells with fresh medium. 2.4.2. Calcium Phosphate Method Calcium phosphate method was used to transfect HEK293 and N2a cells in this project. Recipes of reagents are shown as below: 0 . 5 M C a C l 2 in 50mL distilled water: 3.675g C a C l 2 - 2 H 2 0 . 2* HEPES-buffered saline solution (HeBS) in lOOmL distilled water ( P H 7.0): 1.636g N a C l 1.19g H E P E S 0. 0213 g N a 2 H P 0 4 , anhydrous Cel ls were seeded one day before transfection and had a 70-80% confluence. One hour before transfection, medium was refreshed. Then transfection was done wi th the fol lowing protocol: 1. M i x e d lOug D N A with 125uL 0 . 5 M C a C l 2 to make up to 250uL D N A - C a C l 2 with autoclaved distilled water. 2. D N A - C a C l 2 was added to "bubbled" 2x H e B S solution drop by drop. Rebubble the H e B S after dropping any 100(0.1 D N A solution. 3. D N A - C a C l 2 - H e B S mixture was placed at room temperature for 30 minutes and then dropped to each plate. 4. Culture media were changed after 24 h and cells were harvested 48 h after transfection. 2.5 TNF-a Treatment Human T N F - a (Chemicon) powder was dissolved in distilled water at a stock concentration o f lOOug/ml and store at -20 degree Celsius. Before treatment, the drug 37 was diluted into fresh culture media to the final concentrations o f 0.1, 1, and 10 ng/ml. Then the old media was changed to fresh media containing the drug. 2.6. Reporter Gene Transcription Assay The reporter gene transcription assay was carried out wi th the Promega Dual-Luciferase Reporter Assay system. 48 h after transfection, cells were washed twice with and suspended i n co ld Dulbecco's Phosphate-Buffered Saline (D-PBS) (Gibco 14190-136). Fo l lowing a one minute centrifugation at 4000 rpm at 4 degree Celsius, the supernatant was removed and 1 x Passive Lysis Buffer was used to lyse the cells. The cel l lysis reaction was preceded at room temperature for 30 minutes, followed by vigorous peppiting and 1 m i n 13,000 rpm centrifugation. After that, supernatant was collected. In order to detect the firefly luciferase activity, 2 u L o f the cel l lysates were mixed with 10 u L o f luciferase assay reagent II (Promega E l 9 1 0 ) and luminescent signal was detected by Luminometer (Turner Designs, TD20/20) . The p R L - C M V plasmid expressing the Renilla Luciferase was also included in cel l transfection to serve as an internal control and used to normalize the transfection efficiency. To measure Renilla luciferase activity, the addition o f 10 u L o f Stop & G l o ® reagent was followed immediately after the reading of firefly luciferase activity. Firefly luciferase measurement was normalized by Renilla luciferase measurement. Data collected by the luminometer were transferred to a computer during detection. 38 2.7. 5' RNALigase-Mediated Rapid Amplification of cDNA Ends (5'RLM-RACE) The 5' R L M - R A C E was performed according to manufacturer's instructions (Fi rs tChoice® R L M - R A C E kit (Ambion)). lOug R N A extracted from S H - S Y 5 Y cells were treated with C a l f Intestine Alka l ine Phosphatase (CIP) for one hour at 37 degrees Celsius. After that, R N A was purified by phenokchloroform and then treated by Tobacco A c i d Pyrophosphatase (TAP) . The TAP-treated R N A was then ligated to a 5' adapter R N A by T4 R N A ligase. The ligation product then underwent reverse transcription to generate R L M - c D N A . Us ing the c D N A as a template, two nested P C R reactions were carried out to generate the specific 5' R A C E products. 5 ' primers are adapter primers provided in the kit. Sequences o f the specifically designed primers are: USP24: Outer primer: 5' C G G C C T C G T T A A T G T C G T T C T T G 3 ' Inner primer: 5' C C G C T C G A G A T G T G C T G C T C C T C C T C C G A T T C C 3 ' After the inner P C R products were generated, they were digested and inserted into the pFlagMycHis(c ) vector using the B a m H I and X h o l sites. The plasmids were then sequenced. The procedures o f cloning and sequencing have been described i n section 2.1.2. The P C R reactions for USP24 were carried out with the Phusion Enzyme ( N E Biolab). The CIP, TAP, T4 R N A ligase, M - M L V reverse transcriptase and a l l buffers and 39 reagents used in the 5' RLM-RACE were from the First Choice® RLM-RACE kit (Ambion). 2.8. Immunoblotting Recipes of buffers are shown as below: RIPA Lysis buffer: 30ml 5M NaCl, 50ml IM Tris-HCl pH7.2, 10ml Triton X-100, 10ml 10% SDS, lOg Sodium Deoxycholate to a total volume of IL with distilled water. (1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 0.15M NaCl, 0.05M Tris-HCl, pH 7.2). Supplement with protease inhibitor cocktail Complete (Roche). SDS sample buffer (2x): 2.5ml 4xTris-HCI/SDS, pH6.8 (0.1M); 2ml glycerol; 0.4g SDS; 0.31g DTT; O.lmg bromphenol Blue; Add H 2 0 to 10ml and mix. Aliquot to 1ml and store at -80 degree Celsius. 4x Tris-HCl, pH 6.8: Dissolve 6.05g Trisbase in 40ml H 2 0 . Adjust pH to 6.8 with IN HCI. Add H 2 0 to 500ml total volume. Filter the solution through a 0.45um filter and store at 4 degree Celsius up to 1 month. Tris-HCI/SDS, pH 8.45: Dissolve 182g Tris base' (3.0M) in 300ml H 2 0. Add H 2 0 to 500ml total volume. Filter the solution through a 0.45um filter, add 1.5g SDS and store at 4 degree Celsius up to 1 month. 40 1 0 x Tris-glycine running buffer: 29 g Trizma, 144 g Glyc ine , 10 g S D S , Make up to lOOOml wi th d H 2 0 . 1 Ox blotting buffer: 30.3 g Trizma, 144 g Glycine , make up to lOOOml with d H 2 0 . 1 x blotting buffer: Dilute 100 m l 10x blotting buffer i n 200 m l methanol + 700 m l d H 2 0 . 10x Phosphate buffered saline (PBS): 80 g N a C l , 2 g KC1 ,14 .4 g N a 2 H P 0 4 , 2.4 g K H 2 P 0 4 . A d d 800 m l d H 2 0 and adjust p H to 7.4, then make up to lOOOml. l x P B S - T buffer: Dilute 10x P B S to l x and add 1ml Tween-20 per I L l x P B S . B lock ing buffer: L I - C O R B l o c k i n g Buffer (927-40000), diluted by the same amount o f 1 x P B S . Stored at 4 degree Celsius. 48 hours after transfection, cells were washed twice wi th cold P B S and harvested i n R I P A - D O C cel l lysis buffer containing protease inhibitor. C e l l pellets i n the lysis buffer were sonicated(Fisher Scientific) and then centrifuged at 13,000rpm for 1 minute. The supernatant can be stored at - 2 0 or - 8 0 degree Celsius. Before loading, gradient concentration o f 0-50ug/ml o f B S A (Sigma) was used as protein standard in the test o f protein concentration o f sample. Then cel l lysates were 41 mixed with same amount o f 2><loading buffer and heated at 95 degree Celsius for 5 minutes. The samples were then loaded in 10% Tris-Glycine gels and run at constant current 2 0 m A i n M i n i - P R O T E A N 3 cel l (Bio-Rad). P V D F (Polyvinylidene fluoride) membrane (Mil l ipore , IPVH00010) was briefly incubated with methanol and proteins were transferred from S D S - P A G E (Polyacrylamide gel electrophoresis) gel to the membrane by wet transfer system (Bio-Rad, M i n i Trans-Blot cell). After 2 hours transfer at 110V, the membrane was incubated in blocking buffer for one hour at room temperature. After blocking, the membrane was incubated with the primary antibody at 4 degree Celsius overnight. Monoclona l anti-luciferase antibody (Novus Biologicals , Inc, N B 600-307) against the first 258 amino acids o f firefly luciferase protein was used to measure firefly luciferase protein expression (1:2000 working dilution in blocking buffer). Internal control P-actin protein was detected by monoclonal anti-P-actin antibody A C I 5 (1:15,000 dilution) (Sigma). The membrane was washed with P B S - T four times for 5 minutes each time and then incubated wi th the secondary antibody (1:10000 dilution for goat anti-mouse)(LI-COR) at room temperature for one hour. After rinsing the membrane 4 times for 5 minutes each time, the membrane was put into 1 x P B S and then scanned by the Odyssey infrared system ( L I - C O R ) using the 700nm wavelength. 42 2.9. Electrophoretic Mobility Shifting Assay (EMSA) Recipes o f buffers and gels used in the E M S A away are shown as bel low: 1 x T G E running buffer: 2 5 m M Tris 190mM Glyc ine I m M E D T A ( P H 8.0) 4% native polyacrylamide gel: For 40 m l mix: 5 m l 4 0 % polyacrylamide stock (Polyacrylamide-BIS ratio = 29:1) 2 m l I M Tris, p H 7.5 7.6 m l 1 M Glyc ine 160 ul 0.5 M E D T A 26 m l H 2 0 200 ul 10% A P S 30 ul T E M E D Gels were poured between glass plates and waited about 1-2 hours to polymerize. Infrared dye-labeled double-strand D N A oligos were perchased from L I - C O R Biosceince. Buffers for incubation o f samples are from the L I - C O R Infrared E M S A Buffer K i t (829-07910). Each incubation reaction contained: 1 ul • ' l O x B i n d i n g Buffer ( l O O m M Tris, 5 0 0 m M K C 1 , l O m M D T T ; p H 7.5), 43 0.5ul l u i Po ly (d l ' dC) ( lug /u l in l O m M Tris, I m M E D T A ; pH7.5) , 2 5 m M D T T / 2 . 5 % T w e e n ® - 2 0 . In each specific sample, labeled oligonucleotides, non-labeled oligonucleotide competitors, and/or H E K 2 9 3 cel l nuclear extract were added. (For specific combinations and amounts please refer to Chapter 3). Total amount in each sample is 10 (rl after the addition o f water. Samples were incubated i n dark at room temperature for 30 minutes. For the supershifting sample, l u i o f antibody (anti-p65 is from Sigma and anti-p50 and -p52 are from C e l l Signalling) was added and incubated for additional 20 minutes at room temperature. After the incubation, 1 ul or orange dye was mixed to each sample before it was loaded to the gel. The gel ran for 90 minutes at 80V and was scanned by the Odyssey Infrared System ( L I - C O R ) using the 700nm wavelength. 2.10. D a t a Ana lys i s Data o f agarose gels was collected by the software Image J. Data from western blottings was collected by L i c o r software. Statistical analysis in this study was carried out with the software GraphPad Prism 3. Figures were made with the software Canvas 9. 44 CHAPTER 3: Results 3.1 Characterization of USP24 Gene Coding Sequence. Alignment o f the predicted human and mouse USP24 protein sequences reveals a 97.7% identity, indicating that the USP24 gene is highly conserved from mouse to human (Figure3.1). Figure 3.1. Protein Sequences Alignment of Human USP24 (hUSP24) and Mouse USP24 (mUSP24) Homologues. Human and mouse U S P 2 4 protein sequences are labeled as h U S P 2 4 and m U S P 2 4 , respectively. Identical amino acids are highlighted. 45 Analysis o f the U S P 2 4 protein sequence, based on the protein domains, families, and functional sites databases P R O S I T E and P F A M , revealed two major domains o f the human U S P 2 4 protein, the Peptidase_C19 Domain and the Ubiquitin-associated Domain ( U B A ) (Figure 3.2.). A s described in section 1.2.3.2., a peptidase_C19 domain is the catalytic domain o f D U B s and U B A domains function to associate wi th Ubiqui t in molecules. These domains characterize U S P 2 4 protein as a deubiquitinating enzyme. domains | UBA domain Peptidase_C19 800 1200 1600 2000 2620 Scale (aa) 0 m Figure 3.2. Major Domains of the USP24 Protein A schematic illustration o f the full length U S P 2 4 peptide sequence. The U B A domain is located from amino acid 3 to 44. The Peptidase_C19 domain is spanning from the amino acid 1,689 to 2,043. 3.2. Cloning and Characterization of the Human USP24 Promoter For the human USP24 promoter, a 1648-bp 5' flanking region o f the coding sequence was cloned. A computer software-based analysis o f the sequence revealed that this region contains several putative regulatory elements, such as SP1 , O c t l , T C F , STAT3, and N F - K B (Figure3.3.). 46 -1498! -1450 -1400 -1350 -1300 -1250 -12QD -1150 - H O D -1D5Q -1000 -950: -900: -850: -BOO -750 -70Q -650 -600 -550 -500 -450 -400: -3 50: -3 00: -2 50: -2 00: -150: -100: - 50: + 1: + 51: +101: +151: +2 01: +2 51: cagcaggg gtttgatggg atgaaaaagt aaggttagct ggatttcagg ttcaggaaga aaccaggatg aggacattag aagatgaact cagcaagtat gtaggaataggcataggaga tgaactcagc aagaatgaag ggatatccga OCT-1 atcttgggaa agggtgggaa aataacctag agaactatgg attgaaggaa attgaagagg aaaaatagca aggacttagg cccaggacgg ctttgaatgc T C F ggctcagcac aaattcgtaa ac t tc t taaa acatgatgag a t t t t t t a a a ag t t t ca tca gctaccat ta gegttagaat a t t t t a t a t g tggtccaaga c a a t t t t t c t cc t tccaatg tagcccaggg aagccaaaag attggacacc c t tggct tag atggtggagt caagggaact aaagatatga ccccagtgtg ccaatgccaa aggtgagaag agaaagcaaa gaaagcaggc ctttaaagag P A X - 5 T C F gtagaggaat cctcaaaggt ggaaagaaac agggatagga tgctgcccaa T C F gaggcaggga caaagaatcg gagccaaaga ctgcggtaaa aatgtgggaa E2F ggtgatgtcc c tgggt t tc t tggaaaaata agagttcagt aaattcggac aagggctggc cgcgtctggt agcgttgcgg gcggtgcatt a a t t c c c t c t N F - K B gaagtccaac ccgggtcgcg cagcgctgcg tgttgccggc gcctctgcct cgcggcccct gccaacccta cgggagccga aggaggccaa tgagcgcctc gcctggcccg ctgggcgcgg ggacccgtag cATGGAATCG acgatgttcg aacgagtccg tggccgaagg aagtaagagt ggaggttttc atacagagaa ctgggatt ta gatttcgggc E 2 F ta t t t tggac tctcaggggc t t tcagggta agagttcggt cagcttggcg gagacaggta gtcagttaat gttggaagga agctgggaat taatt tcaac gggtttaggg tgatttcggc ggggctaggg tcgagtgtga a t t t c g t c t t gggtggtcca ttgggcagga a t t t c tg tgg gcagcgaggc gtattcaggc gtgaatctgc gtgggatgag ggtggatttc cttcaggact tcaggccggg gtggaggtgc ctcacagccg cggcgcaggg aggatggggg agcgggtcgg gcggcgeccrg ccagggaggg SP1 gggggttcgg agaggctcgg gggactcgga cggagagaag gctgcggagg ctcggccggc caagggattt ccgcgacgtt STAT3 agctgcgcgg cgctgcggcc cc tcccgtcc cgggggaacc gaaacaggcg ggcggtggeg acgatggaga agccttcctc SP1 E2F ggctgcacgg cagccct t tc accttaggca cgctccgcgg ccctccgctc c t t c g t t t a a aacaaacaga atacgccgcc gcctgccaac ggcgagcacg gtcgcctccc gtgccgcttc ggcgcggccc cgccgcccgg ggaggaggag gcggaggggg catggcggcg cgcagggctg ggccgggccg cagccgcgcc accgcactag ctcggctcgc aggacccaag cccgcaccca gctgctgcgg agcacccggg gcaggaacgc aggggccaac aggcggcgcg gagggtgcgc cgcgcggccc gccaggcccg ct tcgccgtg cgctggccgg ggcggccagg aggcccaagc GAGGAGGAG Figure 3.3. The Nucleotide Sequence of the Human USP24 Promoter. A l,648bp fragment of the 5' flanking region was isolated from a human genomic library. Putative transcription factor binding sites are underlined in bold. The translation starting site A T G is bold and the adenine serves as +1. 47 5' R N A Ligase-Mediated Rapid Amplif icat ion o f c D N A Ends (5 ' R L M - R A C E ) was performed to map the transcription starting site (TSS) o f the USP24 promoter. Compared wi th other methods o f mapping transcription starting sites such as primer extension, nuclease protection assay, or traditional 5' R A C E , 5' R L M - R A C E has a major advantage in that only authentic capped 5' end o f m R N A can be detected. This is fulfilled by removing the 5' phosphate from n o n - m R N A or incomplete m R N A fragments, which disable them from participating i n subsequent ligation reaction. The 7-methylguanosine cap o f m R N A s is further removed by a pyrophosphatase that leaves a 5' phosphate group. These phosphate groups make authentic m R N A the only target that can be ligated to an R N A adapter. Finally, the processed R N A s undergo reverse transcription followed by P C R using gene-specific primers and primers homologous to the R N A adapter. The 5' R L M - R A C E product was cloned into a vector and sequenced. The specific procedure was described in section 2.7. A s shown in Figure 3.4., 5 ' R L M - R A C E revealed that the TSS o f human USP24 gene is located at 251 bp upstream o f the translation starting site. The T S S , an adenine, i s marked as +1. 48 B aaaacaaacagaatacgccgccgccaaccctagcctgccaacggcgagcacggtcgcctc ccgtgecgcttccgggagecgaggcgcggccccgecgcceggggaggaggaggcggaggg ggAGGAGGCCAACATGGCGGCGCGCAGGGCTGGGCCGGGCCGCAGCCGCGCCTGAGCGCC TCACCGCACTAGGTCGGCTCGCAGGACCCAAGCCCGCACCCAGCCTGGCCCGGCTGCTGC GGAGCACCCGGGGCAGGAACGCAGGGGCCAACCTGGGCGCGGAGGCGGCGCGGAGGGTGC GCCGCGCGGCCCGCCAGGCCCGGGACCCG'rAGCTTCGCCG'IGCGCTGGCCGGGGCGGCCA GGAGGCCCAAC;CCATGGAATCGGAa;AGGAGCAGCACATGACCACGCTGCTGTGCATGGG CITCTCAGACCCCGCCACCATCCGCAAGGCCCTGCGCCTGGCCAAGAAGWJATTAACGA GGCCGTGGCACTGCTCACCAACGAGCGGCCGGGCCTCGACTACGGCGGCTACGAGCCCAT Adapter * i C C C i G C T C G G i T C C d G t C C C T G C C T T T G C r G C C T T T G J i r G J U i i t E C A G G C C t i C f c T C G C C G C C C C C l G C G C T E G C C C e Figure 3.4. Mapping the USP24 Transcription Starting Site by 5' RLM-RACE (A) Agarose gel electrophoresis o f t h e nested P C R product from the R L M - R A C E procedure using human S H - S Y 5 Y R N A . Molecular size markers are indicated on the left. (B) Sequence o f the 5 ' U T R region o f the USP24 gene. Locations o f the mapped TSS , the translation starting site, and the primers for the inner and outer 5 ' R L M - R A C E P C R are shown in bold or with arrows. (C) Sequencing result o f the 5 ' R L M - R A C E product which was cloned into the pFlagMycHis(c) vector. Sequence o f the 5' adaptor is shown underlined. The adenine next to the 3 ' o f the adaptor is the T S S o f human USP24 gene. To determine promoter activity o f this 5' U T R region, we cloned different deletions o f this 5' flanking region. Locations o f the deletions are shown on Figure3.5.. A l l deletions were inserted into the pGL3-Bas i c vector. We transfect these reporter plasmids into a human embryonic kidney cel l line ( H E K 2 9 3 cells) and performed 49 luciferase assays (Figure3.5.). The construct containing the region from -570-+149 showed the highest promoter activity compared with other constructs, indicating that the region from -570 to +149 contains a functional promoter o f the human USP24 gene. Further deletions o f this region, from -504, -442, -402, -183, -89 to -37, showed various levels o f promoter activities. However, a 64-bp region from -37 to +27 is required for a basic promoter function. This is consistent wi th our 5' R L M - R A C E assay showing that the transcriptional starting site is located within this region. lD*fa»£tMly Figure 3.5. Functional Deletion Analysis of the USP24 Promoter Region This is a schematic diagram o f the USP24 promoter deletion constructs containing various fragments o f the 5' flanking region o f USP24 gene i n the promoter-less vector pGL3-Bas i c . The firefly luciferase gene (Luc) was used as a reporter gene. The pGL3-Promoter is a non-related promoter serving as a positive control. The p R L - C M V plasmid expressing the Renilla luciferase was included i n the transfection of each wel l to serve as an internal control which normalized the transfection efficiency. The numbers represent the endpoints o f USP24p inserts. +1 is the T S S . 50 3.3. USP24 Has a Higher m R N A Level in a Human Neuroblastoma Cel l L ine SH-SY5Y than in HEK293 Cells To investigate activities o f USP24 promoters, we transfected the reporter plasmids containing these two promoters into S H - S Y 5 Y and H E K 2 9 3 cells. Compared wi th H E K 2 9 3 cells, a significant increase o f promoter activity was detected when the USP24 promoter construct was transfected into S H - S Y 5 Y cells(Figure3.6., 286 .9±14.5 vs. 35 .3±0.4 , pO.OOOT). This result suggests that USP24 transcription level is higher in S H - S Y 5 Y cells than in H E K 2 9 3 cells, indicating that USP24 gene expression is possibly neuronal specific. 51 Figure 3.6. Luciferase Activity was Measured at 48 Hours by a Luminometer. The pRL-CMV plasmid expressing the Renilla luciferase was used to normalize transfection efficiency. The values, indicating fold of corresponding controls (pGL3-Basic), represent means of the ratios (n = 3). Error bars in this and other following column figures represent standard errors of the means. The symbol "*" indicates that the p value generated by the Student's t-test (homoscedastic, unpaired, and two-tailed) is smaller than 0.01, which suggests a significant difference between the two groups being compared. 3.4. USP24 Promoter Contains an N F - K B Binding Site Computer software prediction showed a putative site for N F - K B on the USP24 promoter (Figure3.3.), which is located from -453 to -444, with the sequence GGGAATTCCC. This prediction could also be confirmed by looking through the entire USP24 promoter sequence manually: the GGGAATTCCC sequence is homologous to the N F - K B consensus sequence GGGRNNYYCC in which R is any purine, Y is any pyrimidine, and N is any deoxynucleotide. Thus, we hypothesize that 52 the USP24 gene transcription is regulated by N F - K B and the -453 to -444 region contains the c/s-acting site. To verify this putative binding site, we performed the E M S A assay (Figure3.7.). The labeled USP24p oligo containing the N F - K B binding site showed shifted bands (lane3) after incubated with the nuclear extract o f H E K 2 9 3 cells overexpressing N F - K B p65. These shifted bands are the same as those o f labeled N F - K B consensus oligo (lane2). The competition assay using oligos without labeling showed decreased intensity o f bands as the concentration o f the competitor increases (lane 4 and 5). However, there was little competition effect i f we use a high concentration mutated U S P 2 4 p oligo (lane 6), wi th two successive G to C mutations at the beginning o f the binding site, as a competitor. Anti-p65 antibody, specifically binding to the p65 subunit o f N F - K B , resulted i n a supershifting band after incubated with the sample (lane 7). A weak supershifting effect can be seen in lane 8, in which anti-p50 antibody was incubated with our sample. Anti-p52 antibody revealed no supershifting effect i n the experimental condition (lane 9). In the lane 10, both the shifted and the supershifted bands disappear when high concentration non-labeled competitors exist. The E M S A assay reveals that the USP24p N F - K B binding site has a specific interaction with the N F - K B protein complex in vitro. 53 NO 1 2 3 4 5 6 7 8 9 10 NF KB concensus okgo* + + - - - - _ - -USP24LpoSgo* + _ + + + + + + + + NFkfl concensus oligo - - - 5 50 - - " " 5 0 mutated USP24Lp oigo - _ _ _ - 5 0 - -HEK293 nuclear extract - 4 . + + + + + + + + anti-p65 _ _ _ - - - + + anli-p50 - - + - -anlH352 _ - - - - - - - + -Figure 3.7. Interaction between N F - K B and the N F - K B Binding Element in the Human USP24 Promoter. Nuclear extract used in this experiment were generated from H E K 2 9 3 cells, which were harvested 48hours after transfection with N F - K B p65 expression vector. Double stranded N F - K B consensus oligo and USP24p oligo (-453—444) containing the putative N F - K B binding site, as indicated with symbol "*"s, are labeled with infrared label (wavelength 700nm) at the 5' ends o f both strands. A l l one fold oligos used i n this experiment have a final concentration (as in the solution loaded to the gel) o f 0.005pmol/pl. Folds o f competitor oligos used in lane 4,5,6, and 10 are shown as numbers. Sequence o f the N F - K B consensus oligo is: 5 ' - A G T T G A G G G G A C T T T C C C A G G C - 3 ' ; sequence o f the U S P 2 4 oligo is: 5 ' - G G C G C A G G G A A T T C C C T C T A G G - 3 ' : and sequence o f the U S P 2 4 Mutation oligo is: 5 ' - G G C G C A C C G A A T T C C C T C T A G G - 3 ' . (Underlined is the consensus binding site, the putative binding site, or the mutated putative binding site o f N F - K B ) . 54 3.5. N F - K B Signalling Regulates Human USP24 Promoter Activity To confirm that the USP24 promoter activity is regulated by the N F - K B signalling, we cotransfected the USP24 reporter plasmid into H E K 2 9 3 or N 2 a cells wi th either the N F - K B expression vector or a corresponding empty vector p M T F . W h e n N F - K B is overexpressed, USP24 promoter activity increases significantly, as shown by luciferase assay, both in H E K 2 9 3 or N 2 a cells (Figure3.8. A and B ) . Same cotransfection was performed with H E K 2 9 3 cells for Western blotting. A s Figure3.8.C shows, overexpressing N F - K B causes increased luciferase level , which reflected increased USP24 promoter activity. N F - K B overexpression resulted in an increase o f luciferase activity from 0.217±0.007 to 0.577±0.00T ( p O . O O l ) in H E K 2 9 3 cells and from 0 .208±0.006 to 2 .126±0.044 (p<0.001) i n N 2 a cells. N F - K B overexpression also led to increased luciferase protein level from 0.0T8±0.004 to 0 .071±0.004 (p<0.001) in H E K 2 9 3 cells, p-actin was used as an internal control i n the Western blotting. 55 Control USP 241? Control USP24Lp Figure 3.8. N F - K B Overexpression Increases USP24 Promoter Activity The functional activity o f putative N F - K B binding elements was analyzed by dual-luciferase reporter assays in H E K 2 9 3 (A) (n=4) and N 2 a cells (B) (n=4). Cel ls were transfected wi th USP24 promoter reporter plasmid (USP24p), either wi th N F - K B expression vector (solid column) or empty vector p M T F ( h o l l o w column). Luciferase measurements generated from control plasmid p G L 3 - B a s i c cotransfected with N F - K B or p M T F were also included (control). (C) The Western blotting result (n=3). H E K 2 9 3 cells were transfected with USP24p and either N F - K B or p M T F . After 48hours they were harvested for Western blotting. Antibody against luciferase and P-actin were used as primary antibody. To further support the N F - K B ' S effect, we mutated the N F - K B binding site on the USP24 promoter. The same mutations as in the E M S A assay (i.e. G G to C C at the beginning o f the binding site) are introduced into the USP24p reporter plasmid (Figure3.9.). Cotransfection was performed in H E K 2 9 3 cells. The mutations result i n a significant decrease o f USP24p luciferase activity from 0 .147±0.005 to 0 .076±0.002 56 (pO.OOOT). The data demonstrated that the mutations on the promoter abolished the regulatory effect o f N F - K B on the USP24 promoter activity. A CC tggaggtgcctcac^gccgcggcgca^aattccdctaggatgggggagcgggtcgggcggcgccgg Figure 3.9. Mutations on the USP24 Promoter Abolish NF-KB'S Regulatory Effect (A) Schematic illustration o f the mutations introduced into U S P 2 4 p reporter plasmid. The N F - K B binding site is underlined. (B) Statistics o f the luciferase assay result. H E K 2 9 3 cells were transfected with the wildtype USP24 promoter reporter plasmid (USP24p) (solid column) or the mutated USP24 promoter reporter plasmid (USP24p Mut) (hollow column), together with the N F - K B expression vector or the empty vector p M T F (n=4). To determine i f a signal that can stimulate N F - K B leads to increased USP24 promoter activity, we treated cells transfected with USP24 promoter reporter plasmid-transfected wi th T N F - a . A s shown i n Figure3.10., T N F - a increased USP24 promoter activity in HEK293 and SH-SY5Y cells (746.6±23.7 (lOng/ml) vs. 601.1±3.8 (control) for HEK293 and 4 6 . 4 ± 1 . 1 vs.36.0±0.3 for SH-SY5Y, P<0.0001 by ANOVA). Taken together, these data clearly demonstrate that NF-kB regulates the transcription of the human USP24 gene. 58 A SH-SYSYcell BOO-i £ i y T 0 0 ' £ n GOO' s a « o . 2^ 400. to 300 0 2 200 - 1 !& 100 0 0.1 1 TNF-alpha (ng/rri) —r-10 B so n •a = 8 w i I a m 30-I u u HEK293 cell 0.1 1 10 TNF-alphB (ng/rrf) Figure 3.10. TNF-a Treatment Increases USP24 Promoter Activity The functional activity o f putative N F - K B binding elements was analyzed by dual-luciferase reporter assays in S H - s Y 5 Y (A) (n=4) and H E K 2 9 3 cells (B) (n=4). Cel ls were transfected with the USP24 promoter plasmid or the p G L 3 - B a s i c plasmid. 24 hours after transfection, T N F - a was added to media at final concentrations shown in the figure. 'Cells were harvested 24 hours after the T N F - a treatment. Values o f the y-axis represent ratio o f "USP24 promoter" over " p G L 3 - B a s i c " at the corresponding T N F - a doses. 59 3.6. N F - K B Increases Human USP24 mRNA Level To investigate i f N F - K B regulates transcription o f endogenous USP24 gene, we performed semi-quantitative R T - P C R with H E K 2 9 3 cells. Compared wi th the control which was transfected with the empty vector, H E K 2 9 3 cells transfected with N F - K B showed a significantly higher level o f USP24 m R N A (180 .6±2.28 vs. 100.0±10.8 , P<0.0T). These data indicate that USP24 gene transcription is increased by N F - K B overexpression. A B beta-actin USP24 Errpty vector NFkfl Figure 3.11. N F - K B Increases Human USP24 mRNA Level H E K 2 9 3 cells were transfected with either NF -KB expression vector or empty vector p M T F . Cel ls were harvested, the m R N A library was extracted, and the reverse transcription was performed as introduced i n chapter 2. After the c D N A library was obtained, P C R s using either primer pairs specific to human USP24(5'' primer: USP24+419f: G T C C A T C C C T T A C A A G C G A and 3 ' primer: USP24+776r: G C C C A A T T C C T T T G A G A C A ) or to human B-actin coding sequences were used to amplify corresponding sequences. The band intensity was analyzed by the "Image J " software. 60 CHAPTER 4: Discussion A s illustrated in Chapter 3, USP24 gene transcription is tightly regulated. USP24 gene transcription is controlled by a TATA-box-less promoter, which has its T S S located at 251 bp 5' upstream o f the translation starting site. We showed that USP24 promoter activity is regulated by N F - K B signalling. We provided evidence that increased USP24 promoter activity could be observed when N F - K B signalling is activated by its specific activator T N F - a , or when levels o f N F - K B p65 subunit are elevated. We further confirmed this signalling pathway by mutagenesis; the activating effect o f N F - K B could be diminished by mutations to the N F - K B binding site. The physical interaction o f the binding site with the N F - K B molecule was confirmed by E M S A assays. Although substrates o f the U S P 2 4 protein and the importance o f U S P 2 4 in P D pathogenesis is sti l l unclear, our study suggests a possible signalling pathway in which U S P 2 4 is involved, the N F - K B signalling pathway. N F - K B plays significant roles in apoptosis and inflammation, both o f which are important features o f the pathogenesis o f neurodegenerative diseases such as P D and A D . This evidence makes USP24 gene, a downstream target o f N F - K B , an excellent candidate involved i n apoptosis and inflammation that feature P D and other neurodegenerative diseases. Worthy o f notice is the composition o f the N F - K B dimer which binds to the USP24 promoter. Since overexpression o f N F - K B p65 significantly increased the USP24 61 promoter activity, and anti-p65 antibody generated a clear supershifted band i n our E M S A assay, we can conclude from our results that the N F - K B p65 subunit is a component o f the corresponding N F - K B dimer, however, the other component o f the dimer is sti l l unknown. We suggest that the N F - K B p50 subunit is the other component. Firstly, different N F - K B dimers have similar but not identical D N A sequence preferences, making it possible to identify the composition o f the N F - K B dimer based on the binding site sequence. The N F - K B binding site on the USP24 promoter is identical to the consensus binding sequence o f the N F - K B p50/p65 dimer. In addition, since the p50 subunit is inclined to interact wi th sequences that are more palindromic (Urban et al . , 1991), the N F - K B binding site on the USP24 promoter, with sequence G G G A A T T C C C , makes it highly possible that p50 is a component o f the dimer which interacts with the USP24 promoter. Secondly, lane 8 o f our E M S A result (Figure3.7.) partially consolidated the assumption that p50 is binding to the USP24 promoter, as a supershifted band was generated when we incubated our binding system with antibodies against p50, but not other subunits such as p52 (lane 9). Thirdly, the p50/p65 dimer is the major form of N F - K B i n cells. This evidence provides a strong case for the role o f p50 as the other dimer component; however, further evidence, such as overexpression o f p50 in our luciferase reporter assay, is required to confirm this suggestion. Another explanation is that the dimer is a homodimer o f p65. This is possible because we have no evidence to exclude this possibility and the supershifting effect o f 62 anti-p65 is much stronger than anti-p50; however, even i f this is true in our experimental conditions, it may not accurately represent in vivo conditions. For example, the nuclear extract we used in our E M S A contained overexpressed p65 subunits, which increased the chance that p65 formed dimers wi th itself other than what would truly occur in vivo. A s described i n section 1.4.4.2., N F - K B is an important responding molecule in multiple cel l events such as inflammation, antigen response, and programmed cel l death, and is highly involved in neurodegenerative diseases. Specifically, increased N F - K B levels and subsequent translocation was observed i n dopaminergic neurons o f P D patients. The identification o f USP24 as a responding gene o f N F - K B signalling provides a possible downstream pathway related to the cellular events o f P D . When N F - K B levels increase or N F - K B signalling is activated, USP24 expression is up-regulated. This, as can be expected, may increase U S P 2 4 protein levels i n the cel l , resulting i n increased deubiquitination o f its downstream substrates. Consequently, an elevated level, increased half-life, and altered localization o f target proteins may occur, all o f which may lead to protein aggregation. Thus, fol lowing the identification o f the USP24 protein and the discovery o f its downstream substrates, the possible roles N F - K B and U S P 2 4 play in cellular events o f P D can be revealed, and this may pave the way for discovering possible drug development targets. A s we look at the sequence o f the USP24 promoter we can also find putative binding 63 sites o f other transcription factors, such as SP1, T C F , and S T A T 3 . Future characterization o f these binding sites may contribute to further understanding the transcriptional regulation o f USP24 and its related cellular signalling pathways. In summary, our study revealed that human USP24 gene expression is highly regulated at the transcriptional level. Transcription o f human USP24 is controlled by a TATA-box-less promoter. N F - K B signaling, as an important signaling pathway involved in neurodegenerative diseases, can regulate human USP24 promoter activity via its specific cz's-acting element on the promoter. Our research may shed light on studies focusing on the relationship o f N F - K B signaling, deubiquitinating enzymes, and the pathogenesis o f P D . 64 REFERENCES Aberle H, Bauer A, Stappert J, Kispert A, Kemler R (1997) beta-catenin is a target for the ubiquitin-proteasome pathway. Embo J 16:3797-3804. Amerik A, Swaminathan S, Krantz BA, Wilkinson KD, Hochstrasser M (1997) In vivo disassembly of free polyubiquitin chains by yeast Ubp 14- modulates rates of protein degradation by the proteasome. Embo J 16:4826-4838. Amerik AY, Hochstrasser M (2004) Mechanism and function of deubiquitinating enzymes. Biochim Biophys Acta 1695:189-207. Amerik AY, Li SJ, Hochstrasser M (2000) Analysis of the deubiquitinating enzymes of the yeast Saccharomyces cerevisiae. Biol Chem 381:981-992. Baek SH, Choi KS, Yoo YJ, Cho JM, Baker RT, Tanaka K, Chung CH (1997) Molecular cloning of a novel ubiquitin-specific protease, UBP41, with isopeptidase activity in chick skeletal muscle. J Biol Chem 272:25560-25565. Baeuerle PA, Henkel T (1994) Function and activation of NF-kappa B in the immune system. Annu Rev Immunol 12:141-179. Baeuerle PA, Baltimore D (1996) NF-kappa B: ten years after. Cell 87:13-20. Baldi L, Brown K, Franzoso G, Siebenlist U (1996) Critical role for lysines 21 and 22 in signal-induced, ubiquitin-mediated proteolysis of I kappa B-alpha. J Biol Chem 271:376-379. Baldwin AS, Jr. (1996) The NF-kappa B and I kappa B proteins: new discoveries and insights. Annu Rev Immunol 14:649-683. Beg AA, Baldwin AS, Jr. (1993) The I kappa B proteins: multifunctional regulators of Rel/NF-kappa B transcription factors. Genes Dev 7:2064-2070. Beg AA, Baltimore D (1996) An essential role for NF-kappaB in preventing TNF-alpha-induced cell death. Science 274:782-784. 65 Bennett M C , Bishop JF, Leng Y , Chock P B , Chase T N , Mouradian M M (1999) Degradation o f alpha-synuclein by proteasome. J B i o l Chem 274:33855-33858. Betarbet R , Sherer T B , M a c K e n z i e G, Garcia-Osuna M , Panov A V , Greenamyre JT (2000) Chronic systemic pesticide exposure reproduces features o f Parkinson's disease. Nat Neurosci 3:1301-1306. Bethea JR, Castro M , Keane R W , Lee TT, Dietrich W D , Yezierski R P (1998) Traumatic spinal cord injury induces nuclear factor-kappaB activation. J Neurosci 18:3251-3260. Bocchetta A , Cors ini G U (1986) Parkinson's disease and pesticides. Lancet 2:1163. Boka G Anglade P, Wal lach D , Javoy-Agid F, A g i d Y , Hirsch E C (1994) Immunocytochemical analysis o f tumor necrosis factor and its receptors i n Parkinson's disease. Neurosci Lett 172:151 -154. Bonifati V, R i z z u P, van Baren M J , Schaap O, Breedveld G J , Krieger E , Dekker M C , Squitieri F, Ibanez P, Joosse M , van Dongen JW, Vanacore N , van Swieten J C , Br ice A , M e c o G, van Dui jn C M , Oostra B A , Heutink P (2003) Mutations i n the DJ-1 gene associated with autosomal recessive early-onset parkinsonism. Science 299:256-259. Bri to D A , Rieder C L (2006) Mito t ic checkpoint slippage in humans occurs v ia cyc l in B destruction i n the presence o f an active checkpoint. Curr B i o l 16:1194-1200. Bruce A J , B o l i n g W , K i n d y M S , Peschon J, Kraemer PJ , Carpenter M K , Holtsberg F W , Mattson M P (1996) Altered neuronal and microgl ial responses to excitotoxic and ischemic brain injury in mice l a c k i n g T N F receptors. Nat M e d 2:788-794. Buchberger A (2002) F rom U B A to U B X : new words i n the ubiquitin vocabulary. Trends C e l l B i o l 12:216-221. Carlsson A (1959) Detection and assay o f dopamine. Pharmacol Rev 11:300-304. Carlsson A (2002) Treatment o f Parkinson's with L - D O P A . The early discovery phase, and a comment on current problems. J Neural Transm 109:777-787. 66 Carrasco D , Ryseck RP, Bravo R (1993) Expression o f re lB transcripts during lymphoid organ development: specific expression i n dendritic antigen-presenting cells. Development 118:1221-1231. Carter B D , Kaltschmidt C , Kaltschmidt B , Offenhauser N , Bohm-Matthaei R , Baeuerle P A , Barde Y A (1996) Selective activation o f NF-kappa B by nerve growth factor through the neurotrophin receptor p75. Science 272:542-545. Chau V, Tobias JW, Bachmair A , Marriott D , Ecker D J , Gonda D K , Varshavsky A (1989) A multiubiquitin chain is confined to specific lysine i n a targeted short-lived protein. Science 243:1576-1583. Cheng B , Christakos S, Mattson M P (1994) Tumor necrosis factors protect neurons against metabolic-excitotoxic insults and promote maintenance o f calcium homeostasis. Neuron 12:139-153. Chesnel F, Baz i le F, Pascal A , Kubiak J Z (2006) C y c l i n B dissociation from C D K 1 precedes its degradation upon M P F inactivation in mitotic extracts o f Xenopus laevis embryos. C e l l Cyc le 5:1687-1698. Ciechanover A , Heller H , El ias S, Haas A L , Hershko A (1980) ATP-dependent conjugation o f reticulocyte proteins with the polypeptide required for protein degradation. Proc Nat l A c a d Sci U S A 77:1365-1368. Ciechanover A , DiGiuseppe J A , Bercovich B , Orian A , Richter J D , Schwartz A L , Brodeur G M (1991) Degradation o f nuclear oncoproteins by the ubiquitin system in vitro. Proc Nat l A c a d Sci U S A 88:139-143. Conway K A , Harper J D , Lansbury P T (1998) Accelerated i n vitro f ibri l formation by a mutant alpha-synuclein l inked to early-onset Parkinson disease. Nat M e d 4:1318-1320. Cotzias G C (1968) L - D o p a for Parkinsonism. N Eng l J M e d 278:630. Cummins J M , Rago C , K o h l i M , Kinz le r K W , Lengauer C , Vogelstein B (2004) Tumour suppression: disruption o f H A U S P gene stabilizes p53. Nature 428:1 p fol lowing 486. D'Andrea A , Pel lman D (1998) Deubiquitinating enzymes: a new class o f biological 67 regulators. Cri t Rev Biochem M o l B i o l 33:337-352. Daniel J A , Torok M S , Sun Z W , Schieltz D , A l l i s C D , Yates JR, 3rd, Grant P A (2004) Deubiquitination o f histone H 2 B by a yeast acetyltransferase complex regulates transcription. J B i o l Chem 279:1867-1871. Dauer W, Przedborski S (2003) Parkinson's disease: mechanisms and models. Neuron 39:889-909. Daw E W , Heath S C , Wijsman E M (1999) Mult ipoint oligogenic analysis o f age-at-onset data with applications to Alzheimer disease pedigrees. A m J H u m Genet 64:839-851. de L a u L M , Breteler M M (2006) Epidemiology o f Parkinson's disease. Lancet Neurol 5:525-535. Del ic J, Morange M , Magdelenat H (1993) Ubiqui t in pathway involvement in human lymphocyte gamma-irradiation-induced apoptosis. M o l C e l l B i o l 13:4875-4883. Denk A , Wir th T, Baumann B (2000) NF-kappaB transcription factors: crit ical regulators o f hematopoiesis and neuronal survival. Cytokine Growth Factor Rev 11:303-320. DeStefano A L , L e w M F , Golbe L I , M a r k M H , Lazzar ini A M , Guttman M , Montgomery E , Waters C H , Singer C , Watts R L , Currie L J , Wooten G F , Maher N E , W i l k J B , Sull ivan K M , Slater K M , Saint-Hilaire M H , Feldman R G , Suchowersky O , Lafontaine A L , Labelle N , Growdon J H , Vieregge P, Pramstaller PP, K l e i n C , Hubble JP, Reider C R , Stacy M , M a c D o n a l d M E , Gusella JF, Myers R H (2002) P A R K 3 influences age at onset i n Parkinson disease: a genome scan in the GenePD study. A m J H u m Genet 70:1089-1095. DiDonato J, Mercur io F, Rosette C , W u - L i J, Suyang H , Ghosh S, K a r i n M (1996) Mapping o f the inducible IkappaB phosphorylation sites that signal its ubiquitination and degradation. M o l C e l l B i o l 16:1295-1304. Duckett C S , Perkins N D , K o w a l i k TF, Schmid R M , Huang E S , B a l d w i n A S , Jr., Nabel G J (1993) Dimerizat ion o f N F - K B 2 with RelA(p65) regulates D N A binding, transcriptional activation, and inhibition by an I kappa B-alpha 68 ( M A D - 3 ) . M o l C e l l B i o l 13:1315-1322. Emre N C , Ingvarsdottir K , Wyce A , Wood A , Krogan N J , Henry K W , L i K , Marmorstein R, Greenblatt JF, Shilatifard A , Berger S L (2005) Maintenance o f low histone ubiquitylation by U b p l O correlates wi th telomere-proximal Sir2 association and gene silencing. M o l C e l l 17:585-594. Farrer M , Gwinn-Hardy K , Muenter M , DeVrieze F W , Crook R , Perez-Tur J, L i n c o l n S, Maraganore D , Ad le r C , Newman S, MacElwee K , McCar thy P, M i l l e r C , Waters C , Hardy J (1999) A chromosome 4p haplotype segregating wi th Parkinson's disease and postural tremor. H u m M o l Genet 8:81-85. Fischer-Vize J A , Rub in G M , Lehmann R (1992) The fat facets gene is required for Drosophila eye and embryo development. Development 116:985-1000. Funayama M , Hasegawa K , K o w a H , Saito M , Tsuji S, Obata F (2002) A n e w locus for Parkinson's disease ( P A R K 8 ) maps to chromosome 1 2 p l l . 2 - q 13.1. A n n Neurol 51:296-301. G a i W P , Blessing W W , Blumbergs P C (1995) Ubiquitin-positive degenerating neurites i n the brainstem in Parkinson's disease. Bra in 118 (Pt 6): 1447-1459. Ga lv in J E , Lee V M , Schmidt M L , Tu P H , Iwatsubo T, Trojanowski JQ (1999) Pathobiology o f the L e w y body. A d v Neurol 80:313-324. Gardner R G , Nelson Z W , Gottschling D E (2005) Ubp l0 /Do t4p regulates the persistence o f ubiquitinated histone H 2 B : distinct roles in telomeric silencing and general chromatin. M o l C e l l B i o l 25:6123:6139. Gasser T, Mul l e r -Myhsok B , Wszolek Z K , Oehlmann R, Calne D B , Bonifati V, Bereznai B , Fabrizio E , Vieregge P, Horstmann R D (1998) A susceptibility locus for Parkinson's disease maps to chromosome 2 p l 3 . Nat Genet 18:262-265. Gerondakis S, Grossmann M , Nakamura Y , Pohl T, Grumont R (1999) Genetic approaches in mice to understand Rel /NF-kappaB and IkappaB function: transgenics and knockouts. Oncogene 18:6888-6895. Ghosh S, M a y M J , K o p p E B (1998) NF-kappa B and R e l proteins: evolutionarily 69 conserved mediators o f immune responses. A n n u Rev Immunol 16:225-260. Gl ickman M H (2000) Getting in and out o f the proteasome. Semin C e l l Dev B i o l 11:149-158. Gl ickman M H , Ciechanover A (2002) The ubiquitin-proteasome proteolytic pathway: destruction for the sake o f construction. Physiol Rev 82:373-428.. Goldberg M S , F leming S M , Palacino JJ, Cepeda C , L a m H A , Bhatnagar A , M e l o n i E G , W u N , Ackerson L C , Klapstein G J , Gajendiran M , Roth B L , Chesselet M F , Maidment N T , Levine M S , Shen J (2003) Parkin-deficient mice exhibit nigrostriatal deficits but not loss o f dopaminergic neurons. J B i o l C h e m 278:43628-43635. Gore l l J M , R y b i c k i B A , Cole Johnson C , Peterson E L (1999) Occupational metal exposures and the risk o f Parkinson's disease. Neuroepidemiology 18:303-308. Greene J C , Whitworth A J , K u o I, Andrews L A , Feany M B , Pallanck L J (2003) Mitochondrial pathology and apoptotic muscle degeneration in Drosophila parkin mutants. Proc Nat l A c a d Sci U S A 100:4078-4083. Haas A L , Warms JV, Hershko A , Rose I A (1982) Ubiquitin-activating enzyme. Mechanism and role i n protein-ubiquitin conjugation. J B i o l Chem 257:2543-2548. Hart T B (1987) Parkinson's disease and pesticides. Lancet 1:38. Hasegawa M , Fujiwara H , Nonaka T, Wakabayashi K , Takahashi H , Lee V M , Trojanowski JQ, M a n n D , Iwatsubo T (2002) Phosphorylated alpha-synuclein is ubiquitinated i n alpha-synucleinopathy lesions. J B i o l C h e m 277:49071-49076. Heinemeyer W, Fischer M , Kr immer T, Stachon U , W o l f D H (1997) The active sites o f the eukaryotic 20 S proteasome and their involvement i n subunit precursor processing. J B i o l Chem 272:25200-25209. Henry K W , Wyce A , L o W S , Duggan L J , Emre N C , K a o C F , Pi l lus L , Shilatifard A , Osley M A , Berger S L (2003) Transcriptional activation v i a sequential histone H 2 B ubiquitylation and deubiquitylation, mediated by SAGA-assoc ia ted Ubp8. 70 Genes Dev 17:2648-2663. Hershko A , Ciechanover A (1998) The ubiquitin system. A n n u Rev Biochem 67:425-479. Hershko A , Ciechanover A , Rose I A (1979) Resolution o f the ATP-dependent proteolytic system from reticulocytes: a component that interacts wi th ATP. Proc Na t l A c a d Sci U S A 7 6 : 3 1 0 7 - 3 1 1 0 . Hershko A , Heller H , El ias S, Ciechanover A (1983) Components o f ubiquitin-protein ligase system. Resolution, affinity purification, and role i n protein breakdown. J B i o l Chem 258:8206-8214. Hershko A , Ciechanover A , Heller H , Haas A L , Rose I A (1980) Proposed role o f A T P in protein breakdown: conjugation o f protein with multiple chains o f the polypeptide o f ATP-dependent proteolysis. Proc Na t l A c a d Sc i U S A 77:1783-1786. Hicke L (2001) Protein regulation by monoubiquitin. Nat Rev M o l C e l l B i o l 2:195-201. Hicks A A , Petursson H , Jonsson T, Stefansson H , Johannsdottir H S , Sainz J , Frigge M L , K o n g A , Gulcher JR, Stefansson K , Sveinbjornsdottir S (2002) A susceptibility gene for late-onset idiopathic Parkinson's disease. A n n Neurol 52:549-555. Hirsch E C , Graybiel A M , A g i d Y (1989) Selective vulnerability o f pigmented dopaminergic neurons i n Parkinson's disease. Ac t a Neuro l Scand Suppl 126:19-22. Hochstrasser M (1996) Ubiquitin-dependent protein degradation. A n n u Rev Genet 30:405-439. Hofrnann K , Bucher P (1996) The U B A domain: a sequence mot i f present in multiple enzyme classes o f the ubiquitination pathway. Trends Biochem Sc i 21:172-173. Hornykiewicz O (2002) L - D O P A : from a biologically inactive amino acid to a successful therapeutic agent. A m i n o Ac ids 23:65-70. 71 Hunot S, Brugg B , Ricard D , M i c h e l PP, M u r i e l M P , Ruberg M , Faucheux B A , A g i d Y, Hirsch E C (1997) Nuclear translocation o f NF-kappaB is increased i n dopaminergic neurons o f patients wi th parkinson disease. Proc N a t l A c a d S c i U S A 9 4 : 7 5 3 1 - 7 5 3 6 . Imai Y , Soda M , Takahashi R (2000) Parkin suppresses unfolded protein stress-induced ce l l death through its E 3 ubiquitin-protein ligase activity. J B i o l Chem 275:35661-35664. Imler J L , Hoffmann J A (2000) Tol l and Toll- l ike proteins: an ancient family o f receptors signaling infection. Rev Immunogenet 2:294-304. Inoue J, Ker r L D , K a k i z u k a A , Verma I M (1992) I kappa B gamma, a 70 k d protein identical to the C-terminal half o f p i 10 NF-kappa B : a new member o f the I kappa B family. C e l l 68:1109-1120. Jankovic J (2005) Searching for a relationship between manganese and welding and Parkinson's disease. Neurology 64:2021-2028. Kaltschmidt B , Uherek M , Volk B , Baeuerle P A , Kaltschmidt C (1997) Transcription factor NF-kappaB is activated in primary neurons by amyloid beta peptides and in neurons surrounding early plaques from patients wi th Alzhe imer disease. Proc Na t l A c a d Sci U S A 94:2642-2647. Kar in M , Ben-Neriah Y (2000) Phosphorylation meets ubiquitination: the control o f NF-[kappa]B activity. A n n u Rev Immunol 18:621-663. Kel l iher M A , G r i m m S, Ishida Y , K u o F, Stanger B Z , Leder P (1998) The death domain kinase RIP mediates the TNF-induced NF-kappaB signal. Immunity 8:297-303. Kitada T, Asakawa S, Hattori N , Matsumine H , Yamamura Y , Minosh ima S, Yokoch i M , M i z u n o Y , Shimizu N (1998) Mutations in the parkin gene cause autosomal recessive juvenile parkinsonism. Nature 392:605-608. Komi tzer D , Ciechanover A (2000) Modes o f regulation o f ubiquitin-mediated protein degradation. J C e l l Physiol 182:1-11. Kunsch C , Ruben S M , Rosen C A (1992) Selection o f optimal kappa B / R e l 72 D N A - b i n d i n g motifs: interaction o f both subunits o f NF-kappa B with D N A is required for transcriptional activation. M o l C e l l B i o l 12:4412-4421. Kuzuhara S, M o r i H , Izumiyama N , Yoshimura M , Ihara Y (1988) L e w y bodies are ubiquitinated. A light and electron microscopic immunocytochemical study. Ac t a Neuropathol (Berl) 75:345-353. L a i B C , M a r i o n S A , Teschke K , Tsui J K (2002) Occupational and environmental risk factors for Parkinson's disease. Parkinsonism Relat Disord 8:297-309. L a m Y A , X u W, DeMart ino G N , Cohen R E (1997) Edi t ing o f ubiquitin conjugates by an isopeptidase i n the 26S proteasome. Nature 385:737-740. L a m Y A , Lawson T Q Velayutham M , Zweier J L , Pickart C M (2002) A proteasomal ATPase subunit recognizes the polyubiquitin degradation signal. Nature 416:763-767. Langston JW, Bal lard P, Tetrud TW, Irwin I (1983) Chronic Parkinsonism i n humans due to a product o f meperidine-analog synthesis. Science 219:979-980. Leroy E , Boyer R, Auburger G, Leube B , U l m Q Mezey E , Harta Q Brownstein M J , Jonnalagada S, Chernova T, Dehejia A , Lavedan C , Gasser T, Steinbach PJ , Wi lk inson K D , Polymeropoulos M H (1998) The ubiquitin pathway in Parkinson's disease. Nature 395:451-452. L i M , Chen D , Shi loh A , L u o J , Nikolaev A Y , Q i n J, G u W (2002a) Deubiquitination o f p53 by H A U S P is an important pathway for p53 stabilization. Nature 416:648-653. L i Q, Verma I M (2002) NF-kappaB regulation in the immune system. Nat Rev Immunol 2:725-734. L i Y , Schrodi S, Rowland C , Tacey K , Catanese J, Grupe A (2006) Genetic evidence for ubiquitin-specific proteases U S P 2 4 and U S P 4 0 as candidate genes for late-onset Parkinson disease. H u m Mutat 27:1017-1023. L i Y J , Hauser M A , Scott W K , Mar t in E R , Booze M W , Q i n X J , Walter JW, Nance M A , Hubble JP, K o l l e r W C , Pahwa R, Stern M B , Hiner B C , Jankovic J, Goetz C G , Smal l G W , Mastaglia F, Haines J L , Pericak-Vance M A , Vance J M (2004) 73 Apolipoprotein E controls the risk and age at onset o f Parkinson disease. Neurology 62:2005-2009. L i Y J , Scott W K , Hedges D J , Zhang F, Gaskel l P C , Nance M A , Watts R L , Hubble JP, K o l l e r W C , Pahwa R, Stern M B , Hiner B C , Jankovic J, A l l e n F A , Jr., Goetz C G , Mastaglia F, Stajich J M , Gibson R A , Middle ton LT, Saunders A M , Scott B L , Smal l G W , Nicodemus K K , Reed A D , Schmechel D E , Welsh-Bohmer K A , Conneally P M , Roses A D , Gilbert J R Vance J M , Haines J L , Pericak-Vance M A (2002b) A g e at onset i n two common neurodegenerative diseases is genetically controlled. A m J H u m Genet 70:985-993. L i u C W , L i X , Thompson D , Wooding K , Chang T L , Tang Z , Y u H , Thomas PJ , DeMart ino G N (2006) A T P binding and A T P hydrolysis play distinct roles in the function o f 26S proteasome. M o l C e l l 24:39-50. L i u Z G , Hsu H , Goeddel D V , K a r i n M (1996) Dissection o f T N F receptor 1 effector functions: J N K activation is not l inked to apoptosis while NF-kappaB activation prevents cell death. C e l l 87:565-576. Lodish H F (2004) Molecular cell biology, 5th Edit ion. N e w York: W . H . Freeman and Company. L o w P, Bussel l K , Dawson SP, Bil let t M A , Mayer R J , Reynolds S E (1997) Expression o f a 26S proteasome ATPase subunit, M S 7 3 , i n muscles that undergo developmentally programmed cell death, and its control by ecdysteroid hormones in the insect Manduca sexta. F E B S Lett 400:345-349. Lowe J, McDermot t H , Landon M , Mayer P J , Wi lk inson K D (1990) Ubiqui t in carboxyl-terminal hydrolase (PGP 9.5) is selectively present i n ubiquitinated inclusion bodies characteristic o f human neurodegenerative diseases. J Pathol 161:153-160. Lowe J , Blanchard A , Mor re l l K , Lennox G, Reynolds L , Bil le t t M , Landon M , Mayer R J (1988) Ubiqui t in is a common factor in intermediate filament inclusion bodies o f diverse type i n man, including those o f Parkinson's disease, Pick's disease, and Alzheimer's disease, as we l l as Rosenthal fibres i n cerebellar astrocytomas, cytoplasmic bodies in muscle, and mallory bodies i n alcoholic l iver disease. J Pathol 155:9-15. L u k i w W J , Bazan N G (1998) Strong nuclear factor-kappaB-DNA binding parallels 74 cyclooxygenase-2 gene transcription in aging and in sporadic Alzheimer's disease superior temporal lobe neocortex. J Neurosci Res 53:583-592. Maki CG, Huibregtse J M , Howley P M (1996) In vivo ubiquitination and proteasome-mediated degradation of p53(l). Cancer Res 56:2649-2654. Masliah E, Rockenstein E, Veinbergs I, Mallory M , Hashimoto M , Takeda A , Sagara Y, Sisk A , Mucke L (2000) Dopaminergic loss and inclusion body formation in alpha-synuclein mice: implications for neurodegenerative disorders. Science 287:1265-1269. Mattson MP, Camandola S (2001) NF-kappaB in neuronal plasticity and neurodegenerative disorders. J Cl in Invest 107:247-254. McCormack A L , Thiruchelvam M , Manning-Bog A B , Thiffault C, Langston JW, Cory-Slechta D A , D i Monte D A (2002) Environmental risk factors and Parkinson's disease: selective degeneration of nigral dopaminergic neurons caused by the herbicide paraquat. Neurobiol Dis 10:119-127. Mistry P, Deacon K, Mistry S, Blank J, Patel R (2004) NF-kappaB promotes survival during mitotic cell cycle arrest. J Biol Chem 279:1482-1490. Mogi M , Kondo T, Mizuno Y, Nagatsu T (2007) p53 protein, interferon-gamma, and NF-kappaB levels are elevated in the parkinsonian brain. Neurosci Lett 414:94-97. Mueller TD, Feigon J (2002) Solution structures of U B A domains reveal a conserved hydrophobic surface for protein-protein interactions. J Mo l Bio l 319:1243-1255. Mukhopadhyay D, Riezman H (2007) Proteasome-independent functions of ubiquitin in endocytosis and signaling. Science 315:201-205. Nandi D, Tahiliani P, Kumar A , Chandu D (2006) The ubiquitin-proteasome system. J Biosci 31:137-155. Nelson DE, Ihekwaba A E , Elliott M , Johnson JR, Gibney C A , Foreman B E , Nelson G, See V, Horton C A , Spiller D Q Edwards SW, McDowell HP, Unitt JF, Sullivan E, Grimley R, Benson N, Broomhead D, Kel l DB , White M R (2004) 75 Oscillations i n NF-kappaB signaling control the dynamics o f gene expression. Science 306:704-708. Ni jman S M , Luna-Vargas M P , Velds A , Brummelkamp T R , Dirac A M , S ixma T K , Bernards R (2005) A genomic and functional inventory o f deubiquitinating enzymes. C e l l 123:773-786. Nussbaum R L , E l l i s C E (2003) Alzheimer's disease and Parkinson's disease. N Eng l J M e d 348:1356-1364. O 'Ne i l l L A , Kaltschmidt C (1997) NF-kappa B : a crucial transcription factor for gl ial and neuronal cel l function. Trends Neurosci 20:252-258. Oliveira S A , L i Y J , Noureddine M A , Zuchner S, Q i n X , Pericak-Vance M A , Vance J M (2005) Identification o f risk and age-at-onset genes on chromosome l p in Parkinson disease. A m J H u m Genet 77:252-264. Paisan-Ruiz C , Jain S, Evans E W , Gi lk s WP, Simon J , van der Brug M , Lopez de Muna in A , Apar ic io S, G i l A M , Khan N , Johnson J, Mart inez JR, N i c h o l l D , Carrera I M , Pena AS,- de Si lva R, Lees A , Mart i -Masso JF, Perez-Tur J, Wood N W , Singleton A B (2004) Cloning o f the gene containing mutations that cause P A R K 8 - l i n k e d Parkinson's disease. Neuron 44:595-600. Pankratz N , Nichols W C , Uniacke S K , Halter C , Rudolph A , Shults C , Conneally P M , Foroud T (2003) Significant linkage o f Parkinson disease to chromosome 2q36-37. A m J H u m Genet 72:1053-1057. Papa F R , Hochstrasser M (1993) The yeast D O A 4 gene encodes a deubiquitinating enzyme related to a product o f the human tre-2 oncogene. Nature 366:313-319. Parkinson J (2002) A n essay on the shaking palsy. 1817. J Neuropsychiatry C l i n Neurosci 14:223-236; discussion 222. Perez F A , Palmiter R D (2005) Parkin-deficient mice are not a robust model o f parkinsonism. Proc Nat l A c a d Sci U S A 102:2174-2179. Perkins N D (2000) The Rel /NF-kappa B family: friend and foe. Trends B iochem Sc i 25:434-440. 76 Pickart C M (2000) Ubiqui t in in chains. Trends Biochem Sci 25:544-548. Pickart C M (2001) Mechanisms underlying ubiquitination. A n n u Rev Biochem 70:503-533. Pitzer F, Dantes A , Fuchs T, Baumeister W, Amsterdam A (1996) Removal o f proteasomes from the nucleus and their accumulation i n apoptotic blebs during programmed cel l death. F E B S Lett 394:47-50. Polyrheropoulos M H , Lavedan C , Leroy E , Ide S E , Dehejia A , Dutra A , Pike B , Root H , Rubenstein J, Boyer R, Stenroos E S , Chandrasekharappa S, Athanassiadou A , Papapetropoulos T, Johnson W G , Lazzar ini A M , Duvois in R C , D i Iorio G, Golbe L I , Nussbaum R L (1997) Mutation i n the alpha-synuclein gene identified i n families wi th Parkinson's disease. Science 276:2045-2047. Puente X S , Lopez-Ot in C (2004) A genomic analysis o f rat proteases and protease inhibitors. Genome Res 14:609-622. Rajput A H , Ui t t i R J , Stem W , Laverty W, O'Donnel l K , O'Donnel l D , Yuen W K , Dua A (1987) Geography, drinking water chemistry, pesticides and herbicides and the etiology o f Parkinson's disease. Can J Neurol Sc i 14:414-418. Ruland J, Duncan G S , E l i a A , del Barco Barrantes I, Nguyen L , Plyte S, M i l l a r D G , Bouchard D , Wakeham A , Ohashi PS, M a k T W (2001) B c l l O is a positive regulator o f antigen receptor-induced activation o f NF-kappaB and neural tube closure. C e l l 104:33-42. Ryseck RP, B u l l P, Takamiya M , Bours V, Siebenlist U , Dobrzanski P, Bravo R (1992) R e l B , a new R e l family transcription activator that can interact wi th p50-NF-kappa B . M o l C e l l B i o l 12:674-684. Sadoul R, Fernandez P A , Quiquerez A L , Martinou I, M a k i M , Schroter M , Becherer J D , Irmler M , Tschopp J, Mart inou J C (1996) Involvement o f the proteasome in the programmed cel l death o f NGF-depr ived sympathetic neurons. Embo J 15:3845-3852. Scherer D C , Brockman J A , Chen Z , Maniatis T, Bal lard D W (1995) Signal-induced degradation o f I kappa B alpha requires site-specific ubiquitination. Proc Nat l A c a d Sc i U S A 92:11259-11263. 77 Schlesinger D H , Goldstein Q Nial l HD (1975) The complete amino acid sequence of ubiquitin, an adenylate cyclase stimulating polypeptide probably universal in living cells. Biochemistry 14:2214-2218. Schulz JB, Falkenburger B H (2004) Neuronal pathology in Parkinson's disease. Cell Tissue Res 318:135-147. Schwartz L M , Myer A , Kosz L, Engelstein M , Maier C (1990) Activation of polyubiquitin gene expression during developmentally programmed cell death. Neuron 5:411-419. Sen R, Baltimore D (1986) Inducibility of kappa immunoglobulin enhancer-binding protein Nf-kappa B by a posttranslational mechanism. Cell 47:921-928. Setsuie R, Wang Y L , Mochizuki H, Osaka H, Hayakawa H, Ichihara N , L i H, Furuta A , Sano Y, Sun Y J , Kwon J, Kabuta T, Yoshimi K, Aoki S, Mizuno Y, Noda M, Wada K (2007) Dopaminergic neuronal loss in transgenic mice expressing the Parkinson's disease-associated UCH-L1 I93M mutant. Neurochem Int 50:119-129. Sharon M , Taverner T, Ambroggio XI , Deshaies RJ, Robinson C V (2006) Structural organization of the 19S proteasome lid: insights from M S of intact complexes. PLoS Bio l 4:e267. Shimura H, Hattori N , Kubo S, Mizuno Y, Asakawa S, Minoshima S, Shimizu N, Iwai K, Chiba T, Tanaka K, Suzuki T (2000) Familial Parkinson disease gene product, parkin, is a ubiquitin-protein ligase. Nat Genet 25:302-305. Shishodia S, Aggarwal B B (2004) Nuclear factor-kappaB: a friend or a foe in cancer? Biochem Pharmacol 68:1071-1080. Siebenlist U, Franzoso Q Brown K (1994) Structure, regulation and function of NF-kappa B. Annu Rev Cell B io l 10:405-455. Sloper-Mould K E , Jemc JC, Pickart C M , Hicke L (2001) Distinct functional surface regions on ubiquitin. J Biol Chem 276:30483-30489. Spillantini M G Schmidt M L , Lee V M , Trojanowski JQ; Jakes R, Goedert M (1997) Alpha-synuclein in Lewy bodies. Nature 388:839-840. 78 Surana U, Amon A , Dowzer C, McGrew J, Byers B, Nasmyth K (1993) Destruction of the GDC28/CLB mitotic kinase is not required for the metaphase to anaphase transition in budding yeast. Embo J 12:1969-1978. Terai K, Matsuo A , McGeer PL (1996) Enhancement of immunoreactivity for NF-kappa B in the hippocampal formation and cerebral cortex of Alzheimer's disease. Brain Res 735:159-168. Thrower JS, Hoffman L, Rechsteiner M , Pickart C M (2000) Recognition of the polyubiquitin proteolytic signal. Embo J 19:94-102. Treier M , Staszewski L M , Bohmann D (1994) Ubiquitin-dependent c-Jun degradation in vivo is mediated by the delta domain. Cell 78:787-798. Uitti RJ, Rajput A H , Rozdilsky B, Bickis M, Wollin T, Yuen W K (1989) Regional metal concentrations in Parkinson's disease, other chronic neurological diseases, and control brains. Can J Neurol Sci 16:310-314. Urban M B , Schreck R, Baeuerle PA (1991) NF-kappa B contacts D N A by a heterodimer of the p50 and p65 subunit. Embo J 10:1817-1825. Valente E M , Bentivoglio A R , Dixon PH, Ferraris A , Ialongo T, Frontali M , Albanese A , Wood N W (2001) Localization of a novel locus for autosomal recessive early-onset parkinsonism, PARK6, on human chromosome Ip35-p36. A m J Hum Genet 68:895-900. Valente E M , Abou-Sleiman P M , Caputo V, Muqit M M , Harvey K, Gispert S, A l i Z, Del Turco D, Bentivoglio AR , Healy D Q Albanese A , Nussbaum R, Gonzalez-Maldonado R, Deller T, Salvi S, Cortelli P, Gilks WP, Latchman DS, Harvey RJ , Dallapiccola B, Auburger G, Wood N W (2004) Hereditary early-onset Parkinson's disease caused by mutations in PINK1. Science 304:1158-1160. Van Antwerp DJ, Martin SJ, Verma IM, Green DR (1998) Inhibition of TNF-induced apoptosis by NF-kappa B. Trends Cell Biol 8:107-111. Van Den Eeden SK, Tanner C M , Bernstein A L , Fross RD, Leimpeter A , Bloch D A , Nelson L M (2003) Incidence of Parkinson's disease: variation by age, gender, and race/ethnicity. A m J Epidemiol 157:1015-1022. 79 van Dui jn C M , Dekker M C , Bonifati V, Galjaard R J , Houwing-Duistermaat JJ, Snijders PJ , Testers L , Breedveld G J , Horstink M , Sandkuijl L A , van Swieten J C , Oostra B A , Heutink P (2001) Park7, a novel locus for autosomal recessive early-onset parkinsonism, on chromosome lp36. A m J H u m Genet 69:629-634. Verma R, Arav ind L , Oania R, M c D o n a l d W H , Yates JR, 3rd, K o o n i n E V , Deshaies R J (2002) Role o f R p n l l metalloprotease in deubiquitination and degradation by the 26S proteasome. Science 298:611-615. Voges D , Z w i c k l P, Baumeister W (1999) The 26S proteasome: a molecular machine designed for controlled proteolysis. A n n u Rev Biochem 68:1015-1068. Weinreb P H , Zhen W , Poon A W , Conway K A , Lansbury PT, Jr. (1996) N A C P , a protein implicated i n Alzheimer's disease and learning, is natively unfolded. Biochemistry 35:13709-13715. Wi lk inson K D (2000) Ubiquitination and deubiquitination: targeting o f proteins for degradation by the proteasome. Semin C e l l Dev B i o l 11:141-148. Wi lk inson K D , Deshpande S, Larsen C N (1992) Comparisons o f neuronal ( P G P 9.5) and non-neuronal ubiquitin C-terminal hydrolases. B iochem Soc Trans 20:631-637. Wi lk inson K D , Lee K M , Deshpande S, Duerksen-Hughes P, Boss J M , Pohl J (1989) The neuron-specific protein P G P 9.5 is a ubiquitin carboxyl-terminal hydrolase. Science 246:670-673. Wi lk inson K D , Tashayev V L , O'Connor L B , Larsen C N , Kasperek E , Pickart C M (1995) Metabol ism o f the polyubiquitin degradation signal: structure, mechanism, and role o f isopeptidase T. Biochemistry 34:14535-14546. Woo S K , Lee JL Park I K , Yoo Y J , Cho C M , K a n g M S , H a D B , Tanaka K , Chung C H (1995) Mul t ip le ubiquitin C-terminal hydrolases from chick skeletal muscle. J B i o l Chem 270:18766-18773. Yamashita K , Shinohara M , Shinohara A (2004) Rad6-Brel-mediated histone H 2 B ubiquitylation modulates the formation o f double-strand breaks during meiosis. Proc Na t l A c a d Sci U S A 101:11380-11385. 80 Yao T, Cohen R E (2002) A cryptic protease couples deubiquitination and degradation by the proteasome. Nature 419:403-407. Yu Z, Zhou D, Bruce-Keller A J , Kindy MS, Mattson M P (1999) Lack of the p50 subunit of nuclear factor-kappaB increases the vulnerability of hippocampal neurons to excitotoxic injury. J Neurosci 19:8856-8865. Zhang Y, Gao J, Chung K K , Huang H, Dawson V L , Dawson T M (2000) Parkin functions as an E2-dependent ubiquitin- protein ligase and promotes the degradation of the synaptic vesicle-associated protein, CDCrel-1. Proc Natl Acad Sci USA97:13354-13359. Zimprich A , Biskup S, Leitner P, Lichtner P, Farrer M , Lincoln S, Kachergus J , Hulihan M , Uitti RJ , Calne DB, Stoessl A J , Pfeiffer RF, Patenge N, Carbajal IC, Vieregge P, Asmus F, Muller-Myhsok B, Dickson DW, Meitinger T, Strom T M , Wszolek ZK , Gasser T (2004) Mutations in L R R K 2 cause autosomal-dominant parkinsonism with pleomorphic pathology. Neuron 44:601-607. 81 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            data-media="{[{embed.selectedMedia}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0101119/manifest

Comment

Related Items