Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Serine/threonine phosphorylation in Mycobacterium tuberculosis : substrates of PknH kinase Zheng, Xingji 2007

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata


831-ubc_2007-0651.pdf [ 4.81MB ]
JSON: 831-1.0101068.json
JSON-LD: 831-1.0101068-ld.json
RDF/XML (Pretty): 831-1.0101068-rdf.xml
RDF/JSON: 831-1.0101068-rdf.json
Turtle: 831-1.0101068-turtle.txt
N-Triples: 831-1.0101068-rdf-ntriples.txt
Original Record: 831-1.0101068-source.json
Full Text

Full Text

Serine/Threonine Phosphorylation in Mycobacterium tuberculosis: Substrates of PknH kinase by XINGJI ZHENG B.Sc, University of British Columbia, 2003  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATED STUDIES (Experimental Medicine)  THE UNIVERSITY OF BRITISH COLUMBIA August 2007 ©Xingji Zheng, 2007  ABSTRACT Tuberculosis is a major cause of premature mortality world wide. Nevertheless, we have very limited understanding of the physiology of its causative agent M. tuberculosis.  This thesis  focuses on M. tuberculosis PknH kinase and signal transduction cascade mediated by it.  PknH  kinase is a fascinating kinase to study because it was shown to mediate reduced M. tuberculosis growth in vivo through sensing of nitric oxide.  Identification of PknH signal transduction  cascade can lead to better understanding of M. tuberculosis physiology during infection. The only known phosphorylation substrate of PknH to date is a transcription factor EmbR. It is know to regulate transcription of cell wall production genes. It seemed unlikely that EmbR, the only known PknH substrate, alone can mediate such complex reaction during infection. Therefore, we hypothesized that PknH kinase must phosphorylates multiple substrates, other than EmbR. And the phosphorylation sites on the substrates are similar to the autophosphorylation site on PknH kinase. We were able to visualize 9 PknH specific phospho-proteins by two-dimensional phosphor-proteome analysis.  Alternatively, using a bioinformatic approach we predicted 40  i  potential PknH phosphorylation substrates.  Two of the predicted substrates were selected for  further studies. In vitro kinase studies concluded both Rv0681 and DacBl are phosphorylated by PknH kinase, and point mutation studies confirmed that PknH kinase phosphorylates both substrates at predicted sites.  We also performed enzyme kinetic studies to compare PknH  phosphorylation of 3 different substrates.  The results revealed that PknH is able to  phosphorylate Rv0681 and DacBl with much higher enzyme velocity than EmbR; but EmbR exhibited much higher K m value than Rv0681 and DacBl.  The results presented in this thesis  suggest that DacBl and Rv0681 are true phosphorylation targets of PknH kinase; and the interaction between kinase and substrates are more complex than we initially thought.  ii  TABLE OF CONTENTS LIST OF T A B L E S  v  LIST OF FIGURES  vi  ABBREVIATIONS  vii  ACKNOWLEDGEMENT  viii  Chapter 1: Introduction 1.1 M. tuberculosis Infection 1.2 Latent infection 1.3 M. tuberculosis cell wall 1.4 Signal transduction system in M. tuberculosis 1.4.1 Serine/Threonine Protein Kinases 1.4.2 PknH kinase  1 2 2 3 5 6 10  Chapter 2: Hypothesis  14  Chapter 3: Materials and Methods  15  3.1 Culture of bacteria  15  3.2 Preparation of cell lysates for 2D gels  15  3.3 2D phosphoproteome analysis  15  3.4 Silver stain  18  3.5 In-gel trypsin digestion and Mass spectrometry  19  3.6 Bioinformatic search  20  3.7 Cloning of pknH and substrates  20  3.8 Expression and purification of recombinant proteins  24  3.9 In vitro phosphorylation assay  24  3.10 Enzyme kinetic calculation  25  3.11 Site-directed mutagenesis  26  Chapter 4: Results  27  4.1 2D phosphoproteome  27  4.2 Bioinformatic search  31  4.2 Cloning and expression of pknH kinase domain and embR  35  4.3 Cloning and expression of Rv0681 and DacBl  36  iii  4.4 PknH phosphorylation of substrates  39  4.5 Point mutation studies  41  4.6 Enzyme kinetic studies  43  Chapter 5: Discussions  45  References  52  iv  LIST O F T A B L E S Table 1: M. tuberculosis STPKs and their predicted roles  5  Table 2: Substrates of serine/threonine protein kinases in M. tuberculosis  8  Table 3: Bacteria strains, expression vectors, cloning and mutagenesis primers used  22  Table 4: Observed phosphorylation spots in 2D analysis: pi and M W  30  Table 5: Potential PknH phosphorylation substrates identified by bioinformatic search  33  v  LIST OF FIGURES Figure 1: Mycobacterial cell wall  4  Figure 2: Schematic drawing of PknH kinase structure  11  Figure 3: Schematic of phosphoproteome analysis by 2D gel electrophoresis  17  Figure 4: Plasmid maps of expression vectors  23  Figure 5: 2D phosphoproteome analysis of M. tuberculosis  28  Figure 6: Phosphoproteome analysis with ethambutol treatment  29  Figure 7: Hydrophobicity analysis and structure of DacBl  38  Figure 8: Cloning and expression of PknH, Rv0681, and DacBl  36  Figure 9: PknH phosphorylation of Rv0681 and DacBl  40  Figure 10: In vitro kinase assay comparing wild-type and T170 mutant homologs of EmbR, Rv0681, and DacBl Figure 11: Enzyme kinetic analysis of EmbR, Rv0681, and DacBl  42 44  ABBREVIATIONS Abbreviation 6x-His AG BCG Bq CPM CR DMSO dNTP DPM DTT ESAT FHA IPTG Kcat Km LAM MW OADC OD PBP PCR pi PSTP PTP SDS-PAGE STPK TB Vmax WHO  Definition Polyhistidine tag Arabinogalactan M. bovis Bacillus Calmette-Guerin Becquerel Counts per minute Complement receptor Dimethyl sulfoxide Deoxynucleotide triphosphate Decay per minute Dithiothreitol Early secreted antigenic target Forkhead-associated domain Isopropyl-Beta-d-Thiogalactopyranoside Overall Enzymatic Catalytic Rate Michealis-Menton Constant Lipoarabinomannan Molecular weight Media supplement containing oleic acid, albumin, dextrose, and catalase Optical density Penicillin binding proteins Polymerase chain reaction Isoelectric point Phospho-serine/threonine phosphatase Phospho-tyrosine phosphatases Sodium dodecyl sulphate polyacrylamide gel electrophoresis Serine/threonine protein kinase Tuberculosis Maximum enzymatic rate at a given condition World Health Organization  ACKNOWLEDGEMENT I would like to thank my supervisor Dr. Yossef Av-Gay for his guidance and his support as well as for providing me the opportunity to explore Science during this thesis project. I would also like to thank Dr. K G P Sundaram for his advice on experiment design as well as sample preparations done in the Level 3 containment lab. I am grateful for all the help and support from the rest of the Av-Gay lab members, especially our technician Mary Ko. Finally, I wish to acknowledge the never-ending support provided by my family and my girlfriend, Areta Wong, during the entirety of this project.  viii  C h a p t e r 1: Introduction Mycobacterium tuberculosis, the causative agent of Tuberculosis (TB), is responsible for about 9 million new active infections  and 2 million deaths worldwide in 2004 [1].  Approximately one third of the world population would return a positive result for the tuberculin skin test, which indicates prior exposure to M. tuberculosis [1].  The incident rate of T B  remained stable or fell in most parts of the world as reported by the World Health Organization (WHO); the only exception is in Africa where extensive spread of the human immunodeficiency virus (HIV) fuelled the TB epidemic [1]. Current T B treatments typically involve combination of two or more antibiotics for a period of six or more months [2]. The typical first-line antibiotics include Isoniazid, rifampicin, pyrazinamide, streptomycin and ethambutol [2].  M. tuberculosis strains resistant to isoniazid  and rifampicin are termed MDR-TB, which stand for multi-drug resistant T B [3]. Second-line antibiotics, which include kanamycin, ethionamide, capremycin, ciprofloxacin, cycloserine, and p-aminosalicylic acid [4], are used when M D R - T B strains are responsible for the infections. However, 4% of the M D R - T B cases in the United States are categorized as X D R - T B , which stands for extensive or extreme drug resistant M. tuberculosis [3]. X D R - T B is defined as M D R TB strains that are also resistant to 3 or more of the second-line T B drugs [3].  These strains  could have severe impact on mortality in areas with HIV epidemic since these strains "leave patients virtually untreatable with currently available anti-TB drugs" [3].  More effective  treatments are desperately needed to help control TB.  1  1.1 M. tuberculosis  Infection  Tuberculosis is transmitted via exposure to droplet nuclei generated by infected individuals in an event of a cough [5].  Initial infection involves inhalation of droplet nuclei  containing the bacteria into alveoli of lungs of uninfected individuals and followed by the internalization by alveolar macrophages [6]. Phagocytosis has been shown to be mediated by complement receptors, toll-like receptors, mannose  receptors, and scavenger  receptors.  Normally, killing by macrophages start with acidification of the phagosome by the vesicular proton-ATPase followed by trafficking through endosomal pathway to fuse with the lysosome which then achieves killing of the bacteria and antigen presentation [7]. However, phagosomes containing M. tuberculosis were found to resist the fusion with lysosomes in unactivated macrophages [8].  The mycobacterial phagosome membrane markers composition closely  resembles that on an early endosome; the only differences are the lack of early endosomal antigen 1 (EEA1) [9] and the presence of lysosomal associated membrane protein 1 (LAMP1) on the mycobacterial phagosome [10].  The lack of ATPase proton pump on the mycobacterial  phagosome explains the reduced acidification compared to normally associated endosomal compartments [11]. Maturation of the phagosomes prevents killing of mycobacteria and antigen presentation.  1.2 Latent infection As the infection proceeds, more inflammatory leukocytes are recruited to the site of infection [12].  These cells aggregate around the infected macrophages and create a structure  called a granuloma [12].  The initial formation of the granuloma involves the recruitment of  neutrophils, eosinophils, and large mononuclear cells to the site of infection. Production of IL-  2  12 by the macrophages as well as excreted mycobacterial proteins and lipids, T cells are recruited to the edges of the granuloma and differentiated to mediate T h l immune response. Inside the granuloma, M. tuberculosis is able to persist for decades.  Later in an event of  weakened immune system of the host, M. tuberculosis bacilli start to replicate again. In an event of compromised immune system, the bacteria can break out of the granuloma and spread to different sites in the lung [12]. In some cases, large number of mycobacteria circulate through the blood stream and lead to infection in other organs in the body [12].  1.3 M. tuberculosis  cell wall  For M. tuberculosis to be a successful pathogen, it must contain sophisticated selfprotection mechanisms to isolate itself from the harsh environment created by the host defence system. The mycobacterial cell wall is a thick barrier that helps to protect M. tuberculosis from its environment. The M. tuberculosis cell wall consists mainly of peptidoglycan, arabinogalactan complex (AG), mycolic acids, and lipoarabinomannan L A M (Figure 1). The peptidoglycan is made up of polymers of N-acetylglucosamine and glycolylmuramic acid disaccharide and cross-linked with peptides [13]. The cross-linking reactions are facilitated by the penicillin-binding proteins (PBPs) encoded in the M. tuberculosis genome [14]. Some of these PBPs have been shown to be involved in replication and essential for viability of the Mycobacteria [15]. The A G is made up of arabinofuranosyl monomer units, each of which can be phosphor-ester-linked to the peptidoglycan or ester-linked to high-molecular-weight a-alkyl bhydroxy fatty acids called mycolic acids.  L A M is made up of many arabinosyl side chains  branched from a phosphatidylinositol anchored mannosyl backbone.  This alternating  hydrophobic and hydrophilic layered cell envelope contributes to low permeability [16], antibiotic resistance [17], and persistence inside host tissues [16].  3  glycolipids  mycolc acids  hexaarabinofuranosyt termini  arabinogalactan linker region pepMoglycan  TttlrStMttttSttflfffTTTTdfrfTTAmTttM  cytoplasmic membrane  Figure 1: Mycobacterial cell wall. Diagram showing the main components of mycobacterial cell wall, such as peptidoglycan in blue, A G in orange, L A M in yellow and mycolic acids [18].  1.4 Signal transduction system in M.  tuberculosis  To maintain normal cellular functions, M. tuberculosis must elicit proper responses to environmental changes; this is accomplished through signal transduction. Signal transduction involves covalently attaching or removing of a phosphate molecule to or from a protein. Kinases mediate the phosphate addition processes called phosphorylation; dephosphorylation is the opposite process carried out by phosphatases. Signal transduction can be categorized into twocomponent system, serine/threonine signalling, and tyrosine signalling. Signal transduction in bacteria typically carried out by the two-component system, which consists of a membranebound sensor kinase and a response regulator [19]. Phosphate is first transferred from an A T P molecule to a histidine residue on the kinase; the same phosphate is then transferred onto an aspartate residue on the response regulator. Phosphorylation of the response regulator leads to conformational changes that activates the regulator's function; and usually results in change of gene expression [19].  The dephosphorylation process for two-component system remains  unclear [20]. Serine/threonine and tyrosine signalling systems consist of kinases, substrates, and associated phosphatases.  Kinases transfer a phosphate from A T P directly to specific serine,  threonine, or tyrosine residues on the substrates. Substrates themselves can also be kinases, thus complex cascades are created.  Phosphatases counteract the effects of kinases by removing  phosphate molecules from phosphorylated substrates. Kinases and phosphatases work together to function as molecular switches for cellular functions. Serine/threonine and tyrosine signalling systems were originally identified in eukaryotes; nevertheless, recent years more and more bacteria species are being discovered to contain these types signalling systems [21].  5  Signal transduction system in M. tuberculosis includes 11 two-component histidine kinase and response regulator pairs and 11 serine/threonine protein kinases (STPK) [22]. Interestingly,  only a single phospho-serine/threonine  phosphate (PSTP) named PstP was  predicted in M. tuberculosis genome based on sequence homologies [22].  This suggests all  phospho-serine/threonine proteins in M. tuberculosis are dephosphorylated by PstP.  What is  even more fascinating is the M. tuberculosis genome encodes for two phosphor-tyrosine phosphatases (PTP) but no apparent tyrosine kinase [22].  Characterization of the two PTPs  suggests that these enzymes may play a role in M. tuberculosis pathogenicity by interfering with tyrosine phosphorylation in macrophages [23].  1.4.1 Serine/Threonine Protein K i n a s e s Following the completion of M. tuberculosis genome sequencing project, eleven STPKs, named PknA through PknL without PknC, were predicted based on their homology with eukaryotic STPKs [22].  Based on some key amino acid residue signatures, such as catalytic  lysine near N-terminus, G - X - G - X - X - G nucleotide binding motif, and activation loop, all eleven STPKs were found to contain the typical kinase domain analyzed by Hanks [24, 25]. Nine out of the 11 STPKs were predicted to contain a single transmembrane domain, hence membrane bound; only PknG and PknK were predicted to be soluble [24]. Membrane bound kinases were thought to function as sensors to detect and relay information about the environment. These kinases were initially proposed to be involved in many cellular processes such as cell division, membrane transport, cell wall synthesis, and virulence [24].  To date, 8 out of the 11 STPKs have been  shown to have in vitro kinase activity, and the phosphorylations occur on multiple serine and threonine residues [26].  6  Table 1: M. tuberculosis STPKs and their predicted roles. A summary of 11 STPKs and their predicted roles based on location in the genome and function of adjacent genes [24]. Name PknA PknB PknD PknE PknF PknG PknH Pknl PknJ PknK PknL  ORF Rv0015c Rv0014c Rv0931c Rvl743 Rvl746 Rv0410c Rvl266c Rv2914c Rv2088 Rv3080c Rv2176  M W (kDa) 45.6 66.5 69.5 60.5 50.7 81.6 66.8 61.8 61.6 119.4 42.8  Predicted roll Cell elongation/division Cell elongation/division Phosphate transport Membrane transport Membrane transport Amino acid uptake, stationary phase metabolism Arabinan metabolism Cell division  ? Transcription, secondary metabolites Transcription?  7  Since the discovery of STPKs in M. tuberculosis, efforts have been concentrated on discovery of the signal transduction cascades mediated by them. Substrates were identified for PknA, PknB, PknD, PknE, PknF, and PknH [27-32]. Many of these substrates have shown to contain a phospho-peptide binding domain called forkhead-associated domain (FHA) [27-32]. F H A domains are commonly deployed in eukaryotes to facilitate specific interactions with phosphor-threonine containing proteins [33].  Currently, there are two models to describe the  interaction between STPKs and F H A containing proteins. The more common accepted model describes  the  F H A domains  as  the  mediator to  recruit substrates  to  the  activated  (autophosphorylated) STPKs in the cell membrane [27]. However, a recent study has shown that many of the membrane-bound STPKs can phosphorylate a subset of the F H A containing proteins in M. tuberculosis [30]. The authors suggested that these F H A containing proteins may not be true substrates of STPKs. Instead, F H A containing proteins could modulate the availability of STPKs in M. tuberculosis [30].  Table 2 summarizes the known substrates of M. tuberculosis  STPKs. A method of regulation commonly employed in eukaryotic signalling is through dimerization of receptor kinases [34]. M. tuberculosis kinase dimerization was first suggested when PknB kinase crystal structure was solved [35]. One group observed apparent disorder of the linker region between the kinase domain and the transmembrane domain [35, 36].  This  suggests that external signal may not be transmitted across the membrane via conformational changes.  The crystal structures of PknB and PknE both crystallized as dimmer units with  significant contact between each of the dimers [35-37]. However, functions of dimerization in PknB and PknE are not resolved by crystallization studies. A n enzyme kinetic study of PknD kinase domain showed a 7 time increase in kinase activity upon dimerization [38].  8  Table 2: Substrates of serine/threonine protein kinases in M. tuberculosis. Kinase PknA  Substrate Wag31 (Rv2145c) Rvl422 Rv0020c Rvl747 EmbR FtsZ  F H A containing  + + + -  Method of identification In vivo In vivo In vitro In vitro In vitro In vivo  Reference [29] [29] [30] [30] [39] [40]  PknB  PbpA(Rv0016c) Rvl422 GarA(Rvl827) EmbR Rvl747 Rv0020c  + + + +  In In In In In In  vitro vivo vitro vitro vitro vitro  [31] [29] [41] [39] [30] [30]  PknD  Rvl747(+/-) MmpL7 Rv0516c  + -  -  In vitro In vitro In vivo  [30] [32] [38]  PknE  Rvl747  +  In vitro  [30]  PknF  Rvl747 Rv0020c  + +  In vitro In vitro  [28]  EmbR (Rvl267c)  +  In vitro  [271  PknH  [30]  9  1.4.2 PknH kinase One of the STPKs studied extensively in our lab is PknH kinase.  Initially based on  genomic localization studies, PknH was suggested to be involved in cell wall synthesis regulation and antibiotic resistance [24].  PknH is one of the 9 membrane bound sensor kinases  (Figure 2). The N-terminus kinase domain (M1-L296) is mostly located inside the cell, followed by proline-rich region of unknown function (P297-P403), a single transmembrane domain (L404I420),  and a C-terminal extracellular sensor domain (R427-E626) [27]. Activation of PknH kinase  requires the autophosphorylation of its activation loop at Thrl70 [27].  Mass spectrometry  analysis after in vitro phosphorylation reaction showed multiple autophosphorylation sites on PknH kinase [42], and T170A point mutation completely abolishes all phosphorylation [27]. The latest mass spectrometry study revealed over 10 serine/threonine autophosphorylation sites on PknH kinase intracellular domain (1-401) [42].  10  DELKTQLGT  A/  Kinase Domain  296  404 420  626 PknH  TM Extracellular Domain  Figure 2: Schematic drawing of PknH kinase structure. Kinase domain is coloured in yellow; transmembrane region is coloured in pink; extracellular domain is coloured in green; and the activation loop within the kinase domain is coloured in red. The cloned portion encodes for the kinase domain and the linker to the transmembrane domain.  11  PknH was initially predicted to phosphorylate the protein encoded by the upstream gene designated embR [24]. This was later confirmed by in vitro kinase reaction using recombinant PknH kinase domain and recombinant EmbR protein, and the EmbR phosphorylation occurs on 5 threonine residues [27]. Mutations of key residues in, or deletion of, the F H A domain lead to greatly reduced levels of phosphorylation of EmbR protein [27]. This suggests that the EmbR F H A domain functions to recruit EmbR protein to PknH kinase by binding to the phosphorylated threonine resides on PknH [27]. EmbR functions as a transcription regulator for embCAB operon in M. tuberculosis [43]. A l l 3 emb genes encode for arabinosyl-transferases used in synthesis of key cell wall components L A M and A G . A l l three emb genes were found to be the targets of the antibiotic ethambutol [44], and one mutation in embB gene at position 306 is responsible for 60% of the ethambutol resistant strains [45]. A recent comprehensive study from the Av-Gay lab was carried out using a pknH deletion mutant (ApknH) [46].  The results from this study suggest that PknH kinase controls  various processes involved in intracellular growth. The untreated in vitro growth rate of ApknH strain was found to be similar to that of the parental strain; however, in presence of nitric oxide (NO), the ApknH mutant was able to survive much better than the wild type and the complemented strain [46]. This suggests that the pknH knockout strain is not responding to the presence of N O [46]. Since N O is deployed by the host macrophages to kill invading bacteria, the above evidence would suggest ApknH mutant may have a hypervirulent phenotype during infection. This is indeed the case when both the wild type and knockout strains were used to infect macrophages. The rate of replication (between day 7 and day 11 post infection) of the knockout strain inside PMA-differentiated THP-1 cells was nearly 3 fold higher than that of the  12  wild type strain [46]. To test the validity of these findings, infection studies were done using a mouse model. When BALB/c mice were infected with equal number of bacteria, the ApknH mutant was able to achieve significantly higher bacterial load in the lungs and spleens of the mice throughout all time points of the study when compared to its parental strain [46].  This  observation confirms the results from the earlier macrophage infection studies. The conclusion of this study is that PknH kinase senses N O and triggers adaptive gene expression to slow mycobacterial growth in order to achieve better chronic infection [46]. Given the complexity of ApknH mutant phenotype, it is unlikely that PknH specific responses are mediated through a single substrate, EmbR.  Therefore, we hypothesize that in  addition to EmbR, PknH phosphorylates multiple protein substrates in M. tuberculosis. In the following study, two different approaches were designed in order to identify protein substrates of PknH kinase. The first approach involves comparative phosphoproteome of the wild-type and the ApknH mutant using 2D gels followed by identification using mass spectrometry; the second approach utilizes bioinformatics to identify potential substrates followed by biochemical assays to validate our findings. The results of this study have been published in the journal Biochemical and Biophysical Research Communications.  13  Chapter 2: Hypothesis Hypothesis: in order to carry out the diverse response to intracellular infection PknH phosphorylates multiple substrates in M. tuberculosis. Specific  hypothesis:  substrates of PknH  contain similar phosphorylation  site to  the  autophosphorylation site of PknH.  The specific aims of this project are to: 1) Identify protein phosphorylation substrates of PknH kinase; 2) Clone, express, and study the phosphorylation pattern, nature and kinetics of identified substrates by recombinant PknH kinase domain, in vitro; 3) Identify the phosphorylation sites on the identified substrates and create point-mutants to show phosphorylation reduction.  14  C h a p t e r 3: M a t e r i a l s a n d M e t h o d s 3.1 Culture of bacteria M. tuberculosis strains were cultured under rolling conditions in Middlebrook 7H9 broth (Difco, Sparks, MD) supplemented with 10% O A D C (Difco, Sparks, MD), 0.05% Tween-80 (BDH, Toronto, ON), and 0.2% glycerol (Fisher, Fair Lawn, NJ). E. coli strains were cultured in L B broth or L B agar (Invitrogen, Carlsbad, C A ) with or without 100 ug/mL concentration of ampicillin (Sigma, St. Louis, MO).  3.2 Preparation of cell lysates for 2D gels M. tuberculosis wild-type and ApknH mutant were grown in roller bottles at 2 rpm to an OD of 0.3. Culture was then split into two aliquots; ethambutol was added one aliquot to final concentration of 0.2 ug/ml, and the other served as the untreated control. Cells were harvested after 24 hours growth under the same rolling conditions.  Cell pellets were washed twice,  resuspended and lysed in 50 mM HEPES (pH 7.2) in presence of Complete EDTA-free protease inhibitor (Roche, Mannheim, Germany) with glass beads in Ribolyser at a speed setting of 6.5 for 2x 25s.  Lysates were centrifuged at 13,000xg for 10 min at 4 °C and the supernatant was  filtered through a low-binding Durapore 0.22 um membrane filter (Millipore, Billerica, M A ) . Protein concentrations were determined by Bradford assay (BioRad Laboratories, Hercules, CA).  3.3 2D phosphoproteome analysis 250 \ i g of lysate supernatant was incubated in lx kinase buffer (25 m M Tris-HCl pH 7.2, 5 m M M g C l , 2 m M M n C l , 1 m M DTT) in presence of 20 uCi of y- P A T P (Perkin Elmer, 32  2  2  Waltham, M A ) for 30 min at 21 °C. The reactions were stopped by addition of rehydration  15  buffer (8 M urea, 2% CHAPS, 0.5% IPG buffer, 0.002% bromophenol blue). The mixture was applied to 11 cm IPG strips, pH 4-7 (GE healthcare, Piscataway, NJ) subjected to separation by isoelectric point (pi). The first dimension of separation started with 14 hours of rehydration, followed by 1 min gradient to 500 V , 90 min gradient to 4000 V , and finally 90 min step-n-hold at 8000 V . The current was limited at 50 uA per IPG strip. A total of 14 kVh was used for the separation by pi. Upon completion of separation by pi, the IPG strips were equilibrated in equilibration buffer (50 m M Tris-HCl, pH 8.8, 6 M urea, 30% glycerol, 2% SDS, trace of bromophenol  blue) for 10 min and then subjected to normal SDS-PAGE.  Figure 3 is a  schematic representation of the 2D phosphoproteome analysis process.  16  M. tuberculosis lysate  i Kinase reaction using 7- P A T P 32  i First dimension separation by isoelectric point  i Second dimension separation by molecular weight  i Silver staining to visualize protein spots  i Expose to Phospholmager cassette to visualize phosphorylated spots  Figure 3: Schematic of phosphoproteome analysis by 2D gel electrophoresis.  17  3.4 Silver stain The silver stain used is a modified version of the Rabilloud stain [47]. For each step of the staining procedure, gels were shaken at 50 rpm on a platform shaker. After SDS-PAGE, gels were stained as follows: 1) washed in deionized water for 10 min;2) fixed in 40% ethanol, 10% acetic acid for 1 hour; 3) fixed in 0.5% glutaraldehyde, 30% ethanol, 0.25% potassium tetrathionate, 7% sodium acetate; 4) washed 4 times for 15 min in deionised water; 5) incubated in 0.2% silver nitrate and 0.001% formaldehyde for 30 min; 6) washed in deionised water for 1 min; 7) developed in 3% potassium carbonate, 0.006% formaldehyde, 0.001% sodium thiosulfate for 5 to 10 min; 8) development stopped with 5% Tris base, 2% acetic acid for 10 min. Before further analysis, gels were dried as follows: 1) washed 3 times for 30 min in distilled water; 2) washed in 2% glycerol, 20% methanol for 2 hours; 3) dried in gel dryer (Biorad Laboratories, Hercules, CA) for 4 hours at 80 °C using a temperature gradient. The sequencing compatible silver stain used is a modified version of the Morrissey protocol [48].  The procedure was as follows: 1) fixed gels for 1 hour in 50% methanol, 10%  acetic acid; 2) washed in deionized water 3 times for 20 min each time; 3) washed in D T T solution (0.02g D T T in 4L deionized water); 4) stained for 20 min in 0.2% silver nitrate solution; 5) rinsed in deionized water for 5 min; 6) developed in sodium carbonate solution (138g sodium carbonate, 2 ml formaldehyde in 4 L deionized water); 7) staining process stopped with 3% acetic acid.  18  3.5 In-gel trypsin digestion and Mass spectrometry Gel containing proteins of interest were cut out from the SDS-PAGE into smaller pieces about 1-2 mm in dimensions. Gel pieces were washed in a solution containing 20% acetonitrile and 1 M ammonium bicarbonate for 1 hour followed by another wash in a solution containing 50% methanol and 5% acetic acid for 1 hour. This same procedure was repeated until all stains in the gels were removed. The gel pieces were allowed to dehydrate in pure acetonitrile for 5 minutes. The liquid was aspirated and the gel pieces were dried completely under vacuum. Gel pieces were rehydrated in 100 mM ammonium bicarbonate for 30 min, followed by another step of dehydration. Gel pieces were rehydrated in reducing solution containing 10 m M D T T and 100 mM ammonium bicarbonate for 30 min. After the reduction process, excess D T T solutions were removed, and an alkylating solution containing 100 m M iodoacetamide and 100 m M ammonium bicarbonate was added. Alkylation reaction was allowed to proceed for 30 min; this was followed by dehydration, rehydration with 100 m M ammonium bicarbonate, and one more step of dehydration. Finally, gel pieces were hydrated in a solution containing 20 mg/ml trypsin and 50 m M ammonium bicarbonate.  Trypsin digestion was performed overnight at 37 °C.  Peptides were eluted by incubating in 50 m M ammonium bicarbonate for 10 min, followed by complete aspiration of the liquid into another tube. Gel pieces were then incubated twice in 10% formic acid solution for 10 min. A l l three elutions were combined into the same tube and vacuum evaporated to final volume of about 20 pi.  19  3.6 Bioinformatic search All bioinformatic searches were done using the program called "Pattern search in Mycobacterium  tuberculosis H37Rv  sequence  data"  in  the  Tuberculist  database  (http: //www.pasteur. fr/Bio/TubercuList/). The part of the activation loop of PknH surrounding the phosphorylation site has the sequence D E K L J Q L G T . The 9 amino acid peptide was used as the initial search string and 3 mismatched amino acids were allowed. The second set of searches was performed with three short peptides (DEKLT, K L T Q L , and TQLGT) and only 1 mismatch was allowed in each of the three separate searches. In the final search, only the peptide T Q L G T was used.  The peptide was broken into two parts: T Q entered into field "1 part" with 0 st  mismatch followed by 0 gap; L G T was entered into the field "2 part" and 1 mismatch allowed. nd  3.7 Cloning of pknH and substrates Plasmids constructed in this study are given in Table 3. For amplification of D N A fragments encoding the protein of interest (encoding PknH 1-401 kinase domain and substrates), M. tuberculosis H37Rv genomic D N A was used as the template in the PCR reactions using primers as described in Table 1.  PCR amplification was carried out in lXPfu buffer (MBI  Fermentas, Burlington, ON) containing either 1 or 1.5 mM MgS04, 200 u M of each dNTP, 300 nM of each primer, 5% DMSO and 2.5U of Pfu Polymerase.  The PCR cycle for gene  amplification was as follows: 1) 1 cycle of denaturation at 95°C for 3 min; 2) 30 cycles of denaturation (94°C for 30 sec), annealing (58-63 °C for 30 sec) and extension (72°C for 2 min); 3) final extension step at 72°C for 10 min. The annealing temperatures were set according to the requirements for each set of primers.  The PCR products were gel purified, digested with  appropriate restriction enzymes (sites as included in primer sequence) and ligated to expressions  20  vectors digested with the same restriction enzymes. Ligation products were transformed into E.coli DH5oc. Preparation of competent E. coli cells and CaCl2-mediated transformation were carried out according to standard protocols [49]. Transformants were selected on LB-ampicillin agar plates and screened by colony PCR using the sets of primers used for cloning. The plasmids carrying the correct constructs were purified and transformed into the expression host E. coli BL21. Figure 4 shows all four expression constructs.  21  Table 3: Bacterial strains, expression vectors, cloning and mutagenesis primers used in this thesis. Strains E. coli DH5oc E. co/i"BL21(DE3) Plasmids pET15b pET22b pWAB105  Characteristics  pWABlll pWAB112 pWAB113  T7 expression vector for producing N-term His6-tagged proteins T7 expression vector for producing C-term His6-tagged proteins pET22b with a Xhol/Ndel insert encoding the cytoplasmic domain of PknH M01 pET15b with a Ndel/BamHI insert encoding the entire EmbR protein pET15b with a Ndel/BamHI insert encoding EmbR T209A pET22b with Ndel/Hindlll insert encoding the entire Rv0681 protein pET22b with Ndel/Hindlll insert encoding Rv0681 T35A pET22b with Ndel/Hindlll insert encoding DacBl 133-350 pET22b with Ndel/Hindlll insert encoding DacBl 133-350 T336A  Cloning primers 515-pknH-For 516-pknH-Rev 520- embR-For 521- embR-Rev 5141- Rv0681 For 5142- Rv0681 Rev Xl-dacBl 133.350 For X2-dacBl 133.350 Rev  C T T C T T C C 4 TA rGAGCGACGCACAGGACTCG TTCTC7/CG4GCGGGTTGGTTTTGCGCGGGGTCTG AGGACCCG4 TA rGGCTGGTAGCGCGACAGTGGAG TTGTGG^rCCCATCGGTGTTAAGGGCTTGTGTCC CATCACTC4Z4rGGCTCGCCCGGCCAAACTGAGC CTTG14GC77CGTTGACGCGGTACCACCGTGTGT CTACTGTC4 TA TGAAC AAGTCGGTCGCGGTCGCCGGAAC CAT AAA GCrrATTGCGGTCGGTGGAC ATC A G  Mutagenesis primers 593- EmbR-S-T616C 594- EmbR- AS-A616G S i l l -Rv0681-T35A-S SI 12-Rv0681-T35A-as 5113- DacB 1-T336A-S 5114- DacB 1-T3 3 6A-as 5115- EmbR-T209A-s 5116- EmbR-T209A-as  CCCTACCGGGAGCCGCTGTGGAC AC GTGTCC AC AGCGGCTCCCGGTAGGG ATGCGCTGGCGGCCCAGCTCGGG CCCGACCTGGGCCGCCAGCGCAT CACCCCGGCAGGCGCCCAGATCGGGAC GTCCCGATCTGGGCGCCTGCCGGGGTG GGAGCCGCTGTGGGCAC AGCTGATCAC GTGATCAGCTGTGCCCACAGCGGCTCC  pWAB106 pWAB107 pWABHO  Plasmid vectors pET15b and pET22b were obtained from Novagen. A l l other plasmids listed above were constructed in this study.  22  Xbo! SJE i WO  Bpuiio:  i  .Nod  v„u:::  ,-Hmdn:  Figure 4: Plasmid maps of expression vectors constructed in this study. p W A B 1 0 5 overproduces intracellular domain o f P k n H kinase fused with C-terminal His6-tag. p W A B 1 0 6 and 107 over-produces E m b R and E m b R T 2 0 9 A with N-terminal His6-tag, respectively. p W A B l 10113 over produce Rv0681, Rv0681 T 3 5 A , D a c B l 133-350, and D a c B l 133-350 T 3 3 6 A with C terminal His6-tag, respectively. Restriction sites depicted are single cutting sites within each expression plasmid. bla encodes for ampicillin resistant gene - pMactamase.  23  3.8 Expression and purification of recombinant proteins Single colonies from positive transformants were inoculated into L B media containing 100 ug/ml of Ampicillin and were allowed to grow overnight with shaking at 37 °C. After overnight growth, this is sub-cultured for expression with a 100 fold dilution.  A final  concentration of 0.1 m M IPTG was added to this culture at OD of 0.6, and the culture was allowed to grow for either 4 hours at 37 °C or 14 hours at 21 °C. Cultures were spun at 5000xg for 20 min and resuspended in lysis buffer (50 m M Tris-HCl pH 8, 250 m M NaCl, and 10 m M imidazole).  Resuspensions were sonicated in a sonicator (Fisher Scientific, Ottawa, ON) at  power setting of 10 for 3 bursts of 30 s with 30 s cooling in between each burst. The total lysates were centrifuged at 13000 xg for 30 min and the supernatants were applied to Ni-NTA column (Qiagen).  After binding of each protein, the column was washed with 20 mL of 20 m M  imidazole wash buffer (50 m M Tris-HCl pH 8 and 250 mM NaCl), then with 20 mL of 50 m M imidazole wash buffer (50 mM Tris-HCl pH 8 and 250 mM NaCl). Purified proteins were eluted with 200 m M imidazole elution buffer (50 m M Tris-HCl pH 8 and 250 m M NaCl).  Proteins  were then dialyzed overnight in dialysis buffer (50 mM Tris-HCl pH 7.2, 5% glycerol and 1 m M DTT).  Proteins were run on a SDS-PAGE to check for purity, and concentrations were  estimated with Bradford reagent (Biorad Laboratories, Hercules, CA).  3.9 In vitro phosphorylation assay The in vitro kinase reactions contained 25 m M Tris-HCl pH 7.2, 5 m M MgCL;, 2 m M M n C l , 1 m M DTT, 10-300 ng of recombinant PknH kinase, and with or without 0-500 n M of 2  substrates.  The reactions were started by addition of 5-10 uCi of y- P A T P (Perkin Elmer, 32  Waltham, M A ) followed by 5-30 min incubation at room temperature (21 °C). At the end of the  24  incubation period, reactions were stopped by addition of SDS-sample loading buffer and heated at 95 °C for 5 minutes. Samples were resolved by SDS-PAGE on 8% polyacrylamide gels and the gels were silver stained, and dried.  The P-radioactively labelled protein bands were 32  detected using a Phosphorlmager SI (Molecular Dynamics).  Bands corresponding to  phosphorylated proteins were cut out and subjected to scintillation count (Beckman Coulter LS 6500).  3.10 Enzyme kinetic calculation The C P M data collected from the scintillation counter was first converted to D P M data based on the counting efficiency of the machine, which is about 90%. Using the specific activity of the A T P and account for any decay, the amount of phosphate transferred onto the substrates was calculated. D P M = C P M / 0.9 Bq = D P M / 60 concentration of phosphate transferred = Bq / specific activity / reaction volume enzymatic rate = concentration of phosphate transferred / time The Lineweaver-Burk plot was obtained by plotting the inverse of enzymatic rate versus the inverse of substrate concentration. K m is the absolute value of the inverse of X-intercept, and Vmax is the inverse of Y-intercept. K m = | 1 / X-intercept | Vmax = 1 / Y-intercept  25  3.11 Site-directed mutagenesis Single step site-directed mutagenesis was carried out using Pfu enzyme (MBI Fermentas, Ottawa, ON) with sets of specific primers (Table 3) designed to create Threonine to Alanine substitutions. The mutagenic primers were designed following the primer criteria recommended by the QuickChange protocol (Stratagene, La Jolla, CA). Each primer contained a codon change from A C C (codon for threonine) to G C C (codon for alanine) flanked by 15 to 17 additional residues on each side of the mismatched residue. This provided a high annealing temperature, and thus helped to improve binding specificity.  In each mutagenesis PCR reaction, the  expression plasmids carrying the wild type gene was used as a template. The 50 pi reaction mix contained lx Pfu buffer, 2 mM M g S 0 , 200 u M each dNTPs, 125 ng of each primer, 5% D M S O , 4  50 ng of the plasmid template, and 1 unit of Pfu polymerase. The reaction was carried out in a thermocycler with the following setting: 18 cycles of denaturation at 95 °C for 1 min, annealing at 60 °C for 1 min and extension at 68 °C for 9 min. Parental template plasmid was digested by treating 20 pi of the PCR product with 1 JJLI Dpnl enzyme at 37 °C for 1 hour. A 10 pi aliquot of the digested mixture was transformed into E. coli DH5a.  Plasmids were isolated from the  transformants, and nucleotide sequences of the inserts were determined to confirm that only the desired mutations were introduced.  26  Chapter 4: Results 4.1 2D phosphoproteome Analysis of phosphoproteome by 2D gel is a method commonly used by researchers because it offers a global view of the phosphorylation pattern inside the cell.  Our strategy  involves comparing phosphoproteomes of wild-type and the ApknH mutant M. tuberculosis. Any differences observed in the comparison can only be contributed to the lack of PknH kinase in the knockout mutant.  This method involves in vitro phosphorylation of lysates with  32 radioactive  y- P  electrophoresis.  A T P , followed  by  separation  of  proteins  by  two-dimensional  gel  In the first dimension, proteins were separated by their isoelectric point. In  second dimension, proteins were separated according to their molecular weight. The comparison between untreated wild-type and ApknH mutant phosphoproteome showed no differences between the two (Figure 5). This is most likely due to the lack of a specific trigger to activate PknH kinase.  The only specific trigger for PknH kinase known at this time is the antibiotic  ethambutol. In the second attempt at comparing the phosphoproteomes, sub-lethal concentration of ethambutol was added to the cell culture 24 hours prior to harvesting the culture for analysis. When 2D-phosphoproteomes  of ethambutol treated wild-type  and ApknH mutant 2D  phosphoproteomes were compared, 9 phosphoproteins present in the wild-type gel were missing in the ApknH mutant gel (Figure 6). The pi and molecular weight (MW) are listed in Table 4. A n attempt was made to try to match up the spots on the autoradiogram to the spots from silver staining.  However, none of the nine phosphoproteins could be visualized by silver staining.  Thus, we could not identify them by mass spectrometry.  27  pi  4  5.5  pi  4  5.5  Figure 5: 2D phosphoproteome analysis of M. tuberculosis. wt shows the 2 D phosphoproteome o f wild-type strain (H37Rv), and ApknH shows the 2 D phosphoproteome pknH knockout strain. Radioactive spot observed at 43 k D a and p i 5 was confirmed to be a contamination i n the Phospholmager cassette.  28  Figure 6: Phosphoproteome analysis with ethambutol treatment. Spots shown in circle were found to be phosphorylated in the ethambutol treated wild-type but absent in the treated pknH knockout strain.  29  Table 4: Observed phosphorylation spots in 2D analysis: p i and M W  Spot number 1 2 3 4 5 6 7 8 9  Approximate pi 4.2 4.1 4.8 5 5 4.4 4.6 4.5 4.8  Approximate M W (kDa) 80 75 68 68 66 44 38 35 30  4.2 Bioinformatic search Bioinformatics is an approach complementary to phosphoproteome analysis to assist kinase substrate identification.  This approach assumes that the substrate binding cleft of the  kinase has preference for a specific motif. Therefore, we can use existing phosphorylation sites to find other proteins with similar amino acid sequences. As described in the introduction, the only characterized phosphorylation site for PknH kinase is on its activation loop at Thrl70. The peptide sequence surrounding the Thrl70 is D E L K X Q L G T .  This 9 amino acid sequence was  used to search for potential substrates in the M. tuberculosis genome database. only positive match found was PknH kinases.  However, the  This is most likely due to the fact the motif  searched is too long and hence too specific. Therefore, 3 separate searches were done each using a portion of the 9 amino acid sequence. Three lists of potential substrates were generated from 3 searches using the motifs D E L K J , L K 7 Q L , and TQLGT.  In these 3 lists, EmbR, the only  known substrate of PknH kinase, was found in the list generated from the search using TQLGT. The predicted phosphorylation site on EmbR is TQLIT.  Given the high similarity between the  two motifs, restrictions were applied to the initial search parameters. The final search parameter was set to T Q X X X , where the amino acids TQ are fixed and the X X X are the variable amino acids. This search generated a list of 59 proteins that contain motifs that are very similar to the motif on the activation loop of PknH kinase as well as a predicted motif of the EmbR protein. We removed proteins containing more bulky residues to generate a list of 40 potential substrates (Table 5).  These 40 potential substrates cover 7 out of 9 functional categories used by the  database. Two other STPKs, PknD and PknE, were also in the list of potential PknH substrates.  31  Two out of the 40 potential substrates, Rv0681 and DacBl, were chosen for validation of our bioinformatic approach. Rv0681, a TetR transcription regulator, was chosen because it contains a motif that is a perfect match to that of PknH kinase. This protein substrate could be responsible for down stream adaptive gene expression in the PknH cascade.  We also chose  DacBl as second test candidate because it contains T Q / G T motif, which contains a most conserved substitution.  DacBl is predicted as a penicillin-binding protein; this family of  proteins is involved in making of the peptidoglycan of the cell wall and is important in cell division. This might also be linked with other cell wall enzymes regulated by PknH kinase [46]  32  Table 5: Potential PknH phosphorylation substrates identified by bioinformatic search. Functional Class Lipid metabolism Information Pathways  Protein  A c r A l : Acyl-CoA reductase GpsI: Bifunctional protein polyribonucleotide nucleotidyltransferase (PNPase) LigB: ATP-dependent D N A ligase Rv3263: Probably D N A methylase  Cell wall and DacBl: Probable penicillin-binding cell processes protein Esxl, L, N , O, V : ESAT-6 like proteins (5 proteins) FecB: Probably Fe(III)-dicitratebinding periplasmic lipoprotein LppI: Probable lipoprotein lppl MmpL8: Integral membrane transport protein Rvl333: Hydrolase Rvl517: Conserved hypothetical transmembrane protein Rvl824: Conserved hypothetical membrane protein Rv2091c: Probable membrane protein Rv2333c: Probable conserved integral membrane transport protein PE/PPE Intermediary metabolism and respiration  PPE33: PPE family protein  ArgF: Probable Ornithine carbamoyltransferase PhoH2: PhoH-like protein Rv0083: Probable oxidoreductase Rvl006: Hypothetical protein Rvl 178: Probable aminotransferase Rvl264: Adenylyl cyclase Rvl 318c: Adenylyl cyclase Rvl 320c: Adenylyl cyclase  Position  Sequence  287  RNMAATQLGIPAEIF  150  AASASTQLGGLPFSG  37 116  RAAPDTQLVTIIVSW TWLHKTQLGSWDGV  336  NTPAGTQIGTLIEPD  55  FITQLGRNFQ  2  1  6  FAEHATQVGTKHDA  79  RDGVTTQLGDDVAFS  337  LGMVFTQLGILKTVG  300  ALSPETQLVTAVGAA  186  GAEIGTQLGAFWFT  93  QLGVGTQLSTAIIW  83  FGAQPTQLGVPGQYG  4  MNRTQLLTLIATG  463  VALPDTQLGSH  76  VDSGSTQLGRDETLQ  77 142 281 140 227 371 371  PIPVGTQGGTLHVEL WYAVMTQLGFIAILV SAFPHTQLVTSPANP RADALTQLGPQSPAL DLVGFTQLGEWSAE DIVGSTQLVTSRPPA DIVGSTQLVTSRPAA  33  Rvl817: Possible flavoprotein Rv2251: Possible flavoprotein Regulatory proteins  Conserved hypotheticals  EmbR: Probable transcriptional regulatory protein PknD: Transmembrane Serine/Threonine protein kinase D PknE: Transmembrane Serine/Threonine protein kinase E PknH: Transmembrane Serine/Threonine protein kinase H Rv0681: Probably transcriptional regulatory protein (possible TetRfamily) Rv0500A: Conserved hypothetical protein Rvl006: Hypothetical protein Rvl593c: Conserved hypothetical protein Rvl830: Conserved hypothetical protein Rv2133c: Conserved hypothetical protein Rv2616: Conserved hypothetical protein  464 248  GYASGTQLGEGSFFG ALRTITQTGTGPTW  209  REPLWTQLITAYYLS  169  SDPGLTQTGTAVGTY  170  TDEKLTQLGNTVGTL  170  TDEKLTQLGTAVGT W  35  INALATQLGTKGPSL  22  GQQAKTQLLTVAEV A  281  SAFPHTQLVTSPANP  195  RRRVITQTGTIAQSG  2  VTQLVTRARSA  65  AYLVSTQLGWNLVP H  35  HLDVSTQIGTGRQRF  34  4.2 Cloning and expression of pknH kinase domain and embR To validate our bioinformatic findings we chose to test PknH's ability to phosphorylate two predicted substrates.  Due to the presence of a transmembrane domain in PknH kinase,  cloning of the complete pknH gene would more than likely lead to insoluble expression. Therefore, we amplified the region encoding for the intracellular domain of PknH kinase.  A  single D N A band of 1.2 kb was observed in the PCR reaction and it migrated in the region between 1 and 1.5 kb (Figure 8A). The recombinant PknH produced contains a C-terminus 6xHis fusion with and expected size of about 43 kDa. The purified recombinant protein appears to run as a thick band at about 50 kDa on 10% SDS-PAGE (Figure 8B). EmbR is the only known substrate of PknH kinase, and it was used throughout this study as a positive control for phosphorylation reactions. embR was previously cloned into pET15b vector by another lab member. The recombinant protein contains an N-terminal 6xHis fusion. However sequencing results indicated a mutation at nucleotide 616.  This leads to a P205S  mutation 3 amino acids away from the predicted phosphorylation motif.  This raises a great  concern whether PknH kinase can still phosphorylate EmbR with this mutation. Therefore, sitedirected mutagenesis primers were designed to restore the correct genotype.  The mutagenesis  was done as described in material and methods. Sequencing was done on the corrected clone to verify the reversed mutation.  35  Figure 7: Cloning and expression of PknH, Rv0681, and D a c B l . Panel A shows P C R reaction used to amplify p k n H , rv0681, and d a c B l . Negative control (Neg) are P C R reaction without M . tuberculosis genomic D N A . Panel B show the purified recombinant P k n H , E m b R , Rv0681, and D a c B l ran on 10% S D S - P A G E and visualized using coomassie blue.  36  4.3 Cloning and expression of Rv0681 and DacBl Genes encode for both predicted substrates, Rv0681 and DacBl, were cloned into pET22b vector as described in the material and methods. The recombinant Rv0681 protein is 209 amino acids long with a molecular weight of 22.8 kDa. The penicillin-binding protein DacBl was predicted to contain two transmembrane domains (Figure 7A).  To reduce the  probability of producing insoluble DacBl proteins, cloning primers were design in such a way that only the soluble portion containing the predicted phosphorylation site was amplified as seen in Figure 7B. The recombinant protein is 258 amino acids long with a molecular weight of 27.5 kDa.  37  DacBl TM  Over-expressed portion  JM  Figure 8: Hydrophobicity analysis and structure of D a c B l . Panel A shows the hydrophobicity analysis of DacBl protein. Analysis was performed with ProtScale on Expasy server ( using a scale published by Abraham and Leo [50]. Higher "score" indicates more hydrophobic regions. Panel B is a schematic drawing of DacBl protein. Pink coloured regions correspond to predicted transmembrane domains. Red coloured region corresponds to the over-expressed portion of DacBl.  38  4.4 PknH phosphorylation of substrates In vitro kinase reactions were performed to check whether the two DacBl and Rv0681 are true substrates of PknH kinase. The reaction condition was fixed to 20 °C for duration of 5 min.  The reactions were started by the addition y- P A T P . Initially kinase activity of 32  recombinant PknH kinase domain was tested. As seen in Figure 9, PknH was shown to undergo autophosphorylation as judged by the thick radioactive band at about 50 kDa; this matches the location and the migration pattern of PknH kinase on the silver stained gel. Myelin-basic protein is the commonly used artificial substrate for in vitro kinase reactions to test for kinase activity. However, in this study, we used the cognate substrate EmbR as the positive control.  Indeed, the recombinant PknH kinase domain produced was able to  phosphorylate recombinant EmbR (Figure 9A). The same reaction conditions were used to test the other two predicted protein substrates.  Both Rv0681 and DacBl were clearly shown to be  phosphorylated by PknH (Figure 9B).  39  kDa  PknH EmbR  Figure 9: PknH phosphorylation of Rv0681 and DacBl. ( A ) In vitro autophosphorylation o f P k n H kinase and phosphorylation o f EmbR. (B) In vitro phosphorylation o f Rv0681 (23 kDa) and truncated D a c B l protein (27 kDa) substrates by P k n H kinase.  40  4.5 Point mutation studies To test whether the phosphorylations occurred at the predicted sites, site-directed mutagenesis was used to create threonine to alanine substitution mutations on the predicted amino acid residues.  Mutation was introduced using a set of primers designed to include 1  mismatch to change codon ACC(Thr) to GCC(Ala).  The plasmids containing the cloned  substrates were used as templates for the PCR reaction. Sequencing results confirmed that all the mutagenized genes contain the desired mutation. Point-mutated proteins were expressed following the same protocol as other recombinant proteins.  The point-mutated  proteins  were named EmbRT209A,  Rv0681T35A, and  DacBlT336A. As seen in Figure 10, in most cases site directed mutagenesis revealed that the predicted sites are indeed phosphorylated by PknH kinase.  The level of phosphorylation for  EmbRT209A was reduced to about 50% of it original level (Figure 10). showed a similar reduction in phosphorylation.  DacBlT336A also  However, phosphorylation of Rv0681 was  completely abolished by the T35A point mutation (Figure 10).  41  Figure 10: In vitro kinase assay comparing wild-type and T170 mutant homologs of EmbR, Rv0681, and D a c B l . ( A ) Phosphorylation levels of substrates and corresponding point mutants. (B) Silver stained gel showing equal loadings o f protein substrates.  42  4.6 Enzyme kinetic studies It is very common for a kinase to have multiple phosphorylation substrates. However, the kinase's affinity and enzymatic rate might be different towards each substrate. Biochemical analysis would reveal the affinity (Km) and maximum enzyme velocity (Vmax) towards each substrate. We looked at the kinetic characteristics of PknH kinase against the three substrates. The assays involve measuring the amount of phosphate incorporation by PknH kinase at different concentrations of each substrate in a given time. By plotting the inverse of enzyme velocity versus inverse of substrate concentration (Lineweaver-burk plot), we can determine both K m and Vmax values of PknH for each of the substrates. Figure 10 shows the Lineweaver-burk plot of all three substrates. The Vmax values were determined by taking the reciprocal of the Y-intercept, and the K m values were determined by taking the reciprocal of the X-intercept. The results showed that the Vmax for the two new substrates DacBl and Rv0681 are similar, and they are much higher than that for previously known substrate EmbR.  However, the K m value for EmbR is 10 fold smaller than that for  DacBl and Rv0681. This signifies that the interaction between PknH kinase and EmbR is very strong, but the rate of phosphorylation is much lower.  43  Km = 0.597 [iM Vmax = 3.72 u M m i n  K m = 19.82 \ i M V  m  a  x  =  8  6  2  H-M/min  K m = 1.59u,M V  m  a  x  =  1 1  4  g  Figure 11: Enzyme kinetic analysis of EmbR, Rv0681, and D a c B l . Panel A show examples o f the kinase assays performed for each substrate. Panel B shows the Lineweaver-burk plots as well as K m and V m a x for each substrate.  44^  Chapter 5: D i s c u s s i o n s Since the discovery of 11 STPKs in M. tuberculosis, several groups have devoted thenefforts to understand their pathways by identify substrates for these kinases. Yet, nearly 10 years has passed, and only a total of 9 substrates have been identified for 9 out of the 11 substrates. Substrate identification for kinase is a very difficult task for several reasons. First, signalling molecules are in low abundance inside the cell; therefore, detection methods must be extremely sensitive.  Second, most of the M. tuberculosis STPKs are membrane-bound, thus most of the  kinase molecules would not be present in the typical soluble extracts, thus making in vitro . Typical solubilization methods can potentially disrupt kinase activity, which makes some proteomic approaches unsuitable for M. tuberculosis kinome studies. Furthermore, due to the infectious nature of M. tuberculosis, manipulation of the membrane fraction outside a Level 3 containment facility is prohibited. In this thesis, we used 2 different approaches to attempt at identifying substrates of PknH kinase from M. tuberculosis. The first approach is the proven 2D phosphoproteome analysis where soluble lysates were subjected to in vitro phosphorylation and then analyzed by 2D gel electrophoresis. Many spots were detected by the phosphoimager; however, no differences in phosphorylation were observed when the wild-type gel was compared to the knockout gel. This approach was not as successful as we would like it to be, but this outcome was not entirely surprising to us because a sensor kinase may only be needed in presence of a specific trigger. As described in the introduction, PknH kinase is able to phosphorylate EmbR - a transcription factor that regulates expression of the embCAB operon. The gene products of this operon are known to be targeted by the antibiotic ethambutol. We wanted to see if presence of ethambutol in the growth culture can lead to alteration in the M. tuberculosis phosphoproteome  45  specific to PknH kinase. In this approach, we hoped to observe an increase in endogenous pknH kinase activity as well as a slight change in protein expression downstream of PknH kinase pathway.  By treating cell culture with a sublethal concentration of ethambutol, nine  differentially phosphorylated spots were observed on the wild-type gel that was not present in the ApknH gel (Figure 6). Since the only difference between the two phosphoproteome is the PknH kinase and its signalling pathway, we can conclude that these 9 phosphoproteins are substrates of PknH kinase or kinases and substrates downstream in the PknH signalling pathway. This finding confirms our hypothesis that PknH kinase can phosphorylate multiple substrates other than EmbR. The next logical step is to try to identify differentially phosphorylated proteins by mass spectrometry. However, the identification presents several challenges. The first issue is the lack of accessibility to a mass spectrometry facility that allows radioactive sample submissions. Therefore, we can not simply cut out the radioactively labelled protein spots. Instead, we have to find the silver stained spots corresponding to the spots on the phosphorylation image, and then cut the same protein spot from a non radioactive gel. The problem with this approach is the low abundance of signalling molecules. Very often signalling proteins are detected by radioactivity but are below the detection limit of other staining methods. Due to this reason, we could not identify any of the 9 differentially phosphorylated proteins. Even though no substrates can be identified  through the  2D  phosphoproteome  approach, the  experiments  have  clearly  demonstrated that PknH kinase phosphorylates multiple substrates in M. tuberculosis. Due to the insufficient detection sensitivity of silver staining, we needed another method to identify PknH substrates.  Bioinformatics have been used more and more on designing  enzyme inhibitors in the drug industry. The principle is based on analyzing the 3-dimensional  46  structure of the binding pocket. We wanted to see if this method can also be applied in substrate identification for PknH kinase. For a phosphorylation event to occur, the substrate must first interact with PknH kinase in such a way so that the phosphorylation site on the substrate aligns perfectly with the substrate cleft on the kinase. For this docking event to occur properly, the substrate must be in a specific 3-dimensional structure that complements the activation cleft of the kinase.  3-dimensional structure of the protein is primarily dictated by its amino acid  sequence with some adjustment by the interactions with environment. We can therefore examine any known phosphorylation sites to find common features and use that information to search potential substrates in the M. tuberculosis proteome. As described in the introduction, the only known substrate of PknH kinase is the transcription factor EmbR.  However, the PknH phosphorylation site on EmbR was never  identified. The only known PknH phosphorylation site is the Threonine 170 on the activation loop of PknH kinase. A 9-amino acid long sequence surrounding Thrl70, D E L K T Q L G T was used in the initial pattern search. Only PknH was returned as a positive match. This suggests that the search criteria are too stringent, and the recognition/docking sites used by PknH kinase are likely to be shorter than 9 amino acids. This sequence was broken into 3-5-amino acid long motifs: the N-terminal motif D E L K T ; the C-terminal motif TQLGT; and the hybrid motif L K T Q L . Pattern searches were performed with all three motifs while allowing 1 mismatch. Out of the 3 lists of proteins generated, the only known substrate of PknH, EmbR was identified in the list generated from the C-terminal motif T Q L G T ; and the matching site on EmbR is TQLIT. Identification of EmbR suggests that the TQLGT motif is likely to be the motif recognized by PknH kinase.  47  Given the similarity between the site on EmbR and the activation loop on PknH kinase, the search criteria was modified to contain fixed TQ followed by L G T with 1 mismatch allowed. Forty different proteins were found to match the above criteria (Table 5), including PknH and EmbR.  This suggests that the prokaryotic serine/threonine signalling pathways can be as  complex  as  its  counterpart in eukaryotes.  In another non-pathogenic  actinomycete,  Corynebacterium glutamicum, phosphoproteome studies experimentally determined 120 unique serine/threonine phosphorylated proteins that are phosphorylated by four STPK [51]; this supports our finding that 60 substrates is not an unreasonable for PknH kinase.  The sixty  proteins covered all eleven categories used in the Tuberculist database; this shows that PknH kinase modulates many functions inside M. tuberculosis. Interestingly, two other kinases, PknD and PknE are among the five regulatory proteins identified. Sequence analysis suggests that the activation loops of these two kinases are very similar to that of PknH and that the three dimensional structure of substrate binding cleft might be very similar between these kinases. Therefore it is likely that PknD, PknE and PknH share some substrates between them. This phenomenon of multiple overlapping substrates has previously been described for PknB, PknD, PknE, and PknF [30]. Of the predicted target proteins, we found DacBl, and Rv0681 as interesting targets for phosphorylation by PknH. DacBl is membrane-bound protein containing 405 amino acids and is predicted to be a probable penicillin-binding protein/carboxy peptidase with a predicted mass of 42 kDa. The dacBl gene itself is not a part of an operon and the expression of dacBl is not considered essential for in vitro growth [15].  It is homologous to the B. subtilis D-alanyl D-  alanine carboxy peptidase with 31% identity in a 249 amino acid overlapping region.  This  protein is particularly interesting to us because this class of enzymes are involved in cell wall  48  biosynthesis [52, 53].  Phosphorylation of the D a c B l - T Q I G T motif, which is located just 336  outside the peptidase domain (80-320 aa), might regulate DacBl enzyme activity to contribute to the hypervirulent phenotype during infection.  The Rv0681 protein is a 21.2 kDa protein  predicted to be a transcription factor that was reported to be non-essential for survival by transposon mutagenesis studies [15]. Analysis of the primary protein structure of Rv0681 with MotifScan ( (HTH) D N A binding motif from amino acids 6-66.  revealed a TetR-type Helix-turn-helrx The predicted phosphorylation site  (I35QLGT) is in the middle of the HTH-motif; phosphorylation of H T H would likely alter D N A binding characteristics. Both Rv0681 and truncated DacBl were able to accept phosphate molecules from the recombinant PknH kinase.  Point-mutation of the predicted phosphorylation sites showed that  Rv0681 phosphorylation is over 90% abolished.  However, in the case of DacBl and EmbR,  significant amount of residual phosphorylation was observed. This indicates that both DacBl and EmbR are phosphorylated at multiple residues.  Same observation have already been  reported for EmbR [54]. The M. tuberculosis EmbR is a putative transcriptional regulatory protein characterized by the presence of a putative D N A binding domain located in its N-terminal region followed by a bacterial transcriptional activation domain and a Forkhead-Associated Domain (FHA) in its C terminal region [27, 54].  The FHA-domains are protein-protein interaction domains found in  protein kinases and transcription factors, and mediate binding to mainly phosphothreonine motifs in proteins in a sequence-specific manner [33, 55, 56]. Six proteins of M. tuberculosis including EmbR contain F H A domains [22]. In the case of M. tuberculosis EmbR, truncation of the F H A domain or point mutations in three specific residues in the F H A domain of EmbR abolished  49  PknH-mediated phosphorylation of EmbR indicating the critical role of FHA-mediated interaction between the substrate and PknH kinase [27]. This paved the way for characterizing the interactions between other STPKs and FHA-domain containing proteins identified in the M. tuberculosis proteome. PknB, PknD, PknE, and PknF phosphorylated F H A contained endogenous targets. As demonstrated for PknB and PknD [29, 32], phosphorylation of other endogenous substrates do need not involve F H A domains. We have demonstrated experimentally that both Rv0681 and DacBl are phosphorylation substrates of PknH even though both these proteins do not contain any FHA-domains.  We  initially thought that the phosphorylation of F H A containing substrate would be more favoured due to the function of F H A domain. Our kinetic results show that the interaction between PknH kinase and EmbR is much stronger than for Rv0681 and DacBl. phosphorylate the latter two with much higher enzyme velocity.  However, PknH kinase can Together with previously  published findings from Molle et al. that the PknH specific phosphorylation of EmbR was abolished when key residues of the F H A domain were mutated, we can conclude that DacBl and Rv0681 contain higher affinity sites. Despite having a less favoured recognition site, EmbR is able to compensate with the function of the F H A domain. This finding proposed evidence for a theory provided by Grundner et al. which suggests that the F H A domain containing proteins can modulate phosphorylation of other substrates by physically occupying the kinases. In conclusion, we observed up to 9 PknH phosphorylation substrates using 2Dphosphoproteome analysis, and 40 potential substrates using bioinformatic analysis. Ultimately, we have successfully identified 2 new phosphorylation substrates of PknH, Rv0681 and DacBl. In addition, we were able to show significant phosphorylation reduction with point mutation of  50  the predicted phosphorylation site. These findings can lead to further studies on PknH signal transduction pathways.  51  References 1.  2. 3. 4. 5. 6. 7. 8.  9. 10. 11.  12.  13. 14.  15. 16.  17.  18.  W H O . Global tuberculosis control - surveillance, planning, financing. 2006 [cited; Available from: report/2006/pdf/full report correctedversion. pdf. Janin, Y . L . , Antituberculosis drugs: Ten years of research. Bioorg Med Chem, 2007. W H O . Emergence of XDR-TB. 2006 Sept 5 [cited; Available from: http://v^ Jacobs, W.R., Jr., et al., Genetic systems for mycobacteria. Methods Enzymol, 1991. 204: p. 537-55. Rom, W.N. and S. Garay, Tuberculosis. First Edition ed. 1996, New York: Little, Brown and Company Inc. Weaver, T., et al., Assessment of in vivo attachment/phagocytosis by alveolar macrophages. J Immunol Methods, 1996.193(2): p. 149-56. Hestvik, A . L . , Z. Hmama, and Y . Av-Gay, Mycobacterial manipulation of the host cell. FEMS Microbiol Rev, 2005. 29(5): p. 1041-50. Armstrong, J.A. and P.D. Hart, Phagosome-lysosome interactions in cultured macrophages infected with virulent tubercle bacilli. Reversal of the usual nonfusion pattern and observations on bacterial survival. J Exp Med, 1975.142(1): p. 1-16. Deretic, V . , et al., Mycobacterial phagosome maturation, rab proteins, and intracellular trafficking. Electrophoresis, 1997.18(14): p. 2542-7. Xu, S., et al., Intracellular trafficking in Mycobacterium tuberculosis and Mycobacterium avium-infected macrophages. J Immunol, 1994.153(6): p. 2568-78. Sturgill-Koszycki, S., et al., Lack of acidification in Mycobacterium phagosomes produced by exclusion of the vesicular proton-ATPase. Science, 1994. 263(5147): p. 67881. Qiu, B., et al., Chemokine expression dynamics in mycobacterial (type-1) and schistosomal (type-2) antigen-elicited pulmonary granuloma formation. A m J Pathol, 2001.158(4): p. 1503-15. Draper, P., The outer parts of the mycobacterial envelope as permeability barriers. Front Biosci, 1998.3:p.D1253-61. Jones, G . and P. Dyson, Evolution of Transmembrane Protein Kinases Implicated in Coordinating Remodeling of Gram-Positive. Peptidoglycan: Inside versus Outside. J Bacteriol, 2006.188(21): p. 7470-6. Sassetti, C M . , D.H. Boyd, and E.J. Rubin, Genes required for mycobacterial growth defined by high density mutagenesis. Mol Microbiol, 2003. 48(1): p. 77-84. Camacho, L.R., et al., Analysis of the phthiocerol dimycocerosate locus of Mycobacterium tuberculosis. Evidence that this lipid is involved in the cell wall permeability barrier. J Biol Chem, 2001. 276(23): p. 19845-54. Escuyer, V . E . , et al., The role of the embA and embB gene products in the biosynthesis of the terminal hexaarabinofuranosyl motif of Mycobacterium smegmatis arabinogalactan. J Biol Chem, 2001. 276(52): p. 48854-62. Ducati, R.G., et al., The resumption of consumption— a review on tuberculosis. Mem Inst Oswaldo Cruz, 2006.101(7): p. 697-714.  52  19. 20.  21.  22. 23. 24. 25. 26.  27.  28.  29.  30.  31.  32.  33. 34. 35. 36.  Hoch, J.A., Two-component andphosphorelay signal transduction. Curr Opin Microbiol, 2000. 3(2): p. 165-70. Hsing, W. and T.J. Silhavy, Function of conserved histidine-243 in phosphatase activity of EnvZ, the sensor for porin osmoregulation in Escherichia coli. J Bacteriol, 1997. 179(11): p. 3729-35. Deutscher, J. and M . H . Saier, Jr., Ser/Thr/Tyr protein phosphorylation in bacteria - for long time neglected, now well established. J Mol Microbiol Biotechnol, 2005. 9(3-4): p. 125-31. Cole, S.T., et al., Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature, 1998. 393(6685): p. 537-44. Koul, A . , et al., Cloning and characterization of secretory tyrosine phosphatases of Mycobacterium tuberculosis. J Bacteriol, 2000.182(19): p. 5425-32. Av-Gay, Y . and M . Everett, The eukaryotic-like Ser/Thr protein kinases of Mycobacterium tuberculosis. Trends Microbiol, 2000. 8(5): p. 238-44. Hanks, S.K., A . M . Quinn, and T. Hunter, The protein kinase family: conserved features and deduced phylogeny of the catalytic domains. Science, 1988. 241(4861): p. 42-52. Greenstein, A . E . , et al., Structure/function studies of Ser/Thr and Tyr protein phosphorylation in Mycobacterium tuberculosis. J Mol Microbiol Biotechnol, 2005. 9(34): p. 167-81. Molle, V . , et al., An FHA phosphoprotein recognition domain mediates protein EmbR phosphorylation by PknH, a Ser/Thr protein kinase from Mycobacterium tuberculosis. Biochemistry, 2003. 42(51): p. 15300-9. Molle, V . , et al., Two FHA domains on an ABC transporter, Rvl747, mediate its phosphorylation by PknF, a Ser/Thr protein kinase from Mycobacterium tuberculosis. FEMS Microbiol Lett, 2004. 234(2): p. 215-23. Kang, C M . , et al., The Mycobacterium tuberculosis serine/threonine kinases PknA and PknB: substrate identification and regulation of cell shape. Genes Dev, 2005. 19(14): p. 1692-704. Grundner, C , L . M . Gay, and T. Alber, Mycobacterium tuberculosis serine/threonine kinases PknB, PknD, PknE, and PknFphosphorylate multiple FHA domains. Protein Sci, 2005.14(7): p. 1918-21. Dasgupta, A . , et al., The serine/threonine kinase PknB of Mycobacterium tuberculosis phosphorylates PBPA, a penicillin-binding protein required for cell division. Microbiology, 2006.152(Pt 2): p. 493-504. Perez, J., Garcia, R. L., Bach, H., H de Waard, J., Jacobs, W. R. Jr., Av-Gay, Y . , Bubis, J and Takiff H., Mycobacterium tuberculosis transporter MmpL7 is a potential substrate for kinase PknD. Biochem Biophys Res Commun, 2006. In press. Durocher, D. and S.P. Jackson, The FHA domain. FEBS Lett, 2002. 513(1): p. 58-66. Shi, Z., K . A . Resing, and N.G. Ahn, Networks for the allosteric control ofprotein kinases. Curr Opin Struct Biol, 2006.16(6): p. 686-92. Young, T.A., et al., Structure of Mycobacterium tuberculosis PknB supports a universal activation mechanism for Ser/Thr protein kinases. Nat Struct Biol, 2003. 10(3): p. 168-74. Ortiz-Lombardia, M . , et al., Crystal structure of the catalytic domain of the PknB serine/threonine kinase from Mycobacterium tuberculosis. J Biol Chem, 2003. 278(15): p. 13094-100.  53  37.  38.  39.  40.  41.  42.  43. 44.  45.  46.  47.  48. 49. 50. 51. 52.  Gay, L . M . , H.L. Ng, and T. Alber, A conserved dimer and global conformational changes in the structure of apo-PknE Ser/Thr protein kinase from Mycobacterium tuberculosis. J Mol Biol, 2006. 360(2): p. 409-20. Greenstein, A . E . , et al., Allosteric Activation by Dimerization of the PknD Receptor Ser/Thr Protein Kinase from Mycobacterium tuberculosis. J Biol Chem, 2007. 282(15): p. 11427-35. Sharma, K., et al., EmbR, a regulatory protein with ATPase activity, is a substrate of multiple serine/threonine kinases and phosphatase in Mycobacterium tuberculosis. Febs J, 2006. 273(12): p. 2711-21. Thakur, M . and P.K. Chakraborti, GTPase activity of mycobacterial FtsZ is impaired due to its transphosphorylation by the eukaryotic-type Ser/Thr kinase, PknA. J Biol Chem, 2006. 281(52): p. 40107-13. Villarino, A., et al., Proteomic identification of M. tuberculosis protein kinase substrates: PknB recruits GarA, a FHA domain-containing protein, through activation loopmediated interactions. J Mol Biol, 2005. 350(5): p. 953-63. Molle, V . , et al., Characterization of the phosphorylation sites of Mycobacterium tuberculosis serine/threonine protein kinases, PknA, PknD, PknE, and PknH by mass spectrometry. Proteomics, 2006. 6: p. 3754-3766. Sharma, K., et al., Transcriptional control of the mycobacterial embCAB operon by PknH through a regulatory protein, EmbR, in vivo. J Bacteriol, 2006.188(8): p. 2936-44. Belanger, A . E . , et al., The embAB genes of Mycobacterium avium encode an arabinosyl transferase involved in cell wall arabinan biosynthesis that is the target for the antimycobacterial drug ethambutol. Proc Natl Acad Sci U S A , 1996. 93(21): p. 1191924. Plinke, C , S. Rusch-Gerdes, and S. Niemann, Significance of mutations in embB codon 306 for prediction of ethambutol resistance in clinical Mycobacterium tuberculosis isolates. Antimicrob Agents Chemother, 2006. 50(5): p. 1900-2. Papavinasasundaram, K . G . , et al., Deletion of the Mycobacterium tuberculosis pknH gene confers a higher bacillary load during the chronic phase of infection in BALB/c mice. J Bacteriol, 2005.187(16): p. 5751-60. Chevallet, M . , V . Procaccio, and T. Rabilloud, A nonradioactive double detection method for the assignment of spots in two-dimensional blots. Anal Biochem, 1997. 251(1): p. 6972. Morrissey, J.H., Silver stain for proteins in polyacrylamide gels: a modified procedure with enhanced uniform sensitivity. Anal Biochem, 1981.117(2): p. 307-10. Sambrook, J.F., E F.; Maniatis, T., Molecular Cloning: A Laboratory Manual. 2nd ed. 1989: Cold Spring Harbor. Abraham D . J . and Leo A.J., Hydrophobicity (delta Gl/2 cal). Proteins: Structure, Function and Genetics, 1987. 2: p. 130-152. Bendt, A . K . , et al., Towards a phosphoproteome map of Corynebacterium glutamicum. Proteomics, 2003. 3(8): p. 1637-46. Buchanan, C . E . and A . Gustafson, Mutagenesis and mapping of the gene for a sporulation-specific penicillin-binding protein in Bacillus subtilis. J Bacteriol, 1992. 174(16): p. 5430-5.  54  53.  54.  55.  56.  Buchanan, C.E. and M . L . Ling, Isolation and sequence analysis of dacB, which encodes a sporulation-specific penicillin-binding protein in Bacillus subtilis. J Bacteriol, 1992. 174(6): p. 1717-25. Alderwick, L.J., et al., Molecular structure of EmbR, a response element of Ser/Thr kinase signaling in Mycobacterium tuberculosis. Proc Natl Acad Sci U S A , 2006. 103(8): p. 2558-2563. Durocher, D., et al., The molecular basis of FHA domain.phosphopeptide binding specificity and implications for phospho-dependent signaling mechanisms. M o l Cell, 2000. 6(5): p. 1169-82. Yaffe, M.B. and S.J. Smerdon, The use of in vitro peptide-library screens in the analysis of phosphoserine/threonine-binding domain structure and function. Annu Rev Biophys Biomol Struct, 2004. 33: p. 225-44.  55  


Citation Scheme:


Citations by CSL (citeproc-js)

Usage Statistics



Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            async >
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:


Related Items