Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Serine/threonine phosphorylation in Mycobacterium tuberculosis : substrates of PknH kinase Zheng, Xingji 2007

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2007-0651.pdf [ 4.81MB ]
Metadata
JSON: 831-1.0101068.json
JSON-LD: 831-1.0101068-ld.json
RDF/XML (Pretty): 831-1.0101068-rdf.xml
RDF/JSON: 831-1.0101068-rdf.json
Turtle: 831-1.0101068-turtle.txt
N-Triples: 831-1.0101068-rdf-ntriples.txt
Original Record: 831-1.0101068-source.json
Full Text
831-1.0101068-fulltext.txt
Citation
831-1.0101068.ris

Full Text

Serine/Threonine Phosphorylation in Mycobacterium tuberculosis: Substrates of PknH kinase by XINGJI ZHENG B.Sc, University of British Columbia, 2003 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATED STUDIES (Experimental Medicine) THE UNIVERSITY OF BRITISH COLUMBIA August 2007 ©Xingji Zheng, 2007 ABSTRACT Tuberculosis is a major cause of premature mortality world wide. Nevertheless, we have very limited understanding of the physiology of its causative agent M. tuberculosis. This thesis focuses on M. tuberculosis PknH kinase and signal transduction cascade mediated by it. PknH kinase is a fascinating kinase to study because it was shown to mediate reduced M. tuberculosis growth in vivo through sensing of nitric oxide. Identification of PknH signal transduction cascade can lead to better understanding of M. tuberculosis physiology during infection. The only known phosphorylation substrate of PknH to date is a transcription factor EmbR. It is know to regulate transcription of cell wall production genes. It seemed unlikely that EmbR, the only known PknH substrate, alone can mediate such complex reaction during infection. Therefore, we hypothesized that PknH kinase must phosphorylates multiple substrates, other than EmbR. And the phosphorylation sites on the substrates are similar to the autophosphorylation site on PknH kinase. We were able to visualize 9 PknH specific phospho-proteins by two-dimensional phosphor-proteome analysis. Alternatively, using a bioinformatic approach we predicted 40 i potential PknH phosphorylation substrates. Two of the predicted substrates were selected for further studies. In vitro kinase studies concluded both Rv0681 and DacBl are phosphorylated by PknH kinase, and point mutation studies confirmed that PknH kinase phosphorylates both substrates at predicted sites. We also performed enzyme kinetic studies to compare PknH phosphorylation of 3 different substrates. The results revealed that PknH is able to phosphorylate Rv0681 and DacBl with much higher enzyme velocity than EmbR; but EmbR exhibited much higher Km value than Rv0681 and DacBl. The results presented in this thesis suggest that DacBl and Rv0681 are true phosphorylation targets of PknH kinase; and the interaction between kinase and substrates are more complex than we initially thought. ii TABLE OF CONTENTS LIST OF TABLES v LIST OF FIGURES vi ABBREVIATIONS vii A C K N O W L E D G E M E N T viii Chapter 1: Introduction 1 1.1 M. tuberculosis Infection 2 1.2 Latent infection 2 1.3 M. tuberculosis cell wall 3 1.4 Signal transduction system in M. tuberculosis 5 1.4.1 Serine/Threonine Protein Kinases 6 1.4.2 PknH kinase 10 Chapter 2: Hypothesis 14 Chapter 3: Materials and Methods 15 3.1 Culture of bacteria 15 3.2 Preparation of cell lysates for 2D gels 15 3.3 2D phosphoproteome analysis 15 3.4 Silver stain 18 3.5 In-gel trypsin digestion and Mass spectrometry 19 3.6 Bioinformatic search 20 3.7 Cloning of pknH and substrates 20 3.8 Expression and purification of recombinant proteins 24 3.9 In vitro phosphorylation assay 24 3.10 Enzyme kinetic calculation 25 3.11 Site-directed mutagenesis 26 Chapter 4: Results 27 4.1 2D phosphoproteome 27 4.2 Bioinformatic search 31 4.2 Cloning and expression of pknH kinase domain and embR 35 4.3 Cloning and expression of Rv0681 and DacBl 36 iii 4.4 PknH phosphorylation of substrates 39 4.5 Point mutation studies 41 4.6 Enzyme kinetic studies 43 Chapter 5: Discussions 45 References 52 iv LIST O F T A B L E S Table 1: M. tuberculosis STPKs and their predicted roles 5 Table 2: Substrates of serine/threonine protein kinases in M. tuberculosis 8 Table 3: Bacteria strains, expression vectors, cloning and mutagenesis primers used 22 Table 4: Observed phosphorylation spots in 2D analysis: pi and M W 30 Table 5: Potential PknH phosphorylation substrates identified by bioinformatic search 33 v LIST OF FIGURES Figure 1: Mycobacterial cell wall 4 Figure 2: Schematic drawing of PknH kinase structure 11 Figure 3: Schematic of phosphoproteome analysis by 2D gel electrophoresis 17 Figure 4: Plasmid maps of expression vectors 23 Figure 5: 2D phosphoproteome analysis of M. tuberculosis 28 Figure 6: Phosphoproteome analysis with ethambutol treatment 29 Figure 7: Hydrophobicity analysis and structure of DacBl 38 Figure 8: Cloning and expression of PknH, Rv0681, and DacBl 36 Figure 9: PknH phosphorylation of Rv0681 and DacBl 40 Figure 10: In vitro kinase assay comparing wild-type and T170 mutant homologs of EmbR, Rv0681, and DacBl 42 Figure 11: Enzyme kinetic analysis of EmbR, Rv0681, and DacBl 44 A B B R E V I A T I O N S Abbreviation Definition 6x-His Polyhistidine tag A G Arabinogalactan B C G M. bovis Bacillus Calmette-Guerin Bq Becquerel CPM Counts per minute CR Complement receptor DMSO Dimethyl sulfoxide dNTP Deoxynucleotide triphosphate DPM Decay per minute DTT Dithiothreitol ESAT Early secreted antigenic target FHA Forkhead-associated domain IPTG Isopropyl-Beta-d-Thiogalactopyranoside Kcat Overall Enzymatic Catalytic Rate Km Michealis-Menton Constant L A M Lipoarabinomannan M W Molecular weight OADC Media supplement containing oleic acid, albumin, dextrose, and catalase OD Optical density PBP Penicillin binding proteins PCR Polymerase chain reaction pi Isoelectric point PSTP Phospho-serine/threonine phosphatase PTP Phospho-tyrosine phosphatases SDS-PAGE Sodium dodecyl sulphate polyacrylamide gel electrophoresis STPK Serine/threonine protein kinase TB Tuberculosis Vmax Maximum enzymatic rate at a given condition WHO World Health Organization A C K N O W L E D G E M E N T I would like to thank my supervisor Dr. Yossef Av-Gay for his guidance and his support as well as for providing me the opportunity to explore Science during this thesis project. I would also like to thank Dr. KGP Sundaram for his advice on experiment design as well as sample preparations done in the Level 3 containment lab. I am grateful for all the help and support from the rest of the Av-Gay lab members, especially our technician Mary Ko. Finally, I wish to acknowledge the never-ending support provided by my family and my girlfriend, Areta Wong, during the entirety of this project. viii Chapter 1: Introduction Mycobacterium tuberculosis, the causative agent of Tuberculosis (TB), is responsible for about 9 million new active infections and 2 million deaths worldwide in 2004 [1]. Approximately one third of the world population would return a positive result for the tuberculin skin test, which indicates prior exposure to M. tuberculosis [1]. The incident rate of TB remained stable or fell in most parts of the world as reported by the World Health Organization (WHO); the only exception is in Africa where extensive spread of the human immunodeficiency virus (HIV) fuelled the TB epidemic [1]. Current TB treatments typically involve combination of two or more antibiotics for a period of six or more months [2]. The typical first-line antibiotics include Isoniazid, rifampicin, pyrazinamide, streptomycin and ethambutol [2]. M. tuberculosis strains resistant to isoniazid and rifampicin are termed MDR-TB, which stand for multi-drug resistant TB [3]. Second-line antibiotics, which include kanamycin, ethionamide, capremycin, ciprofloxacin, cycloserine, and p-aminosalicylic acid [4], are used when MDR-TB strains are responsible for the infections. However, 4% of the MDR-TB cases in the United States are categorized as XDR-TB, which stands for extensive or extreme drug resistant M. tuberculosis [3]. XDR-TB is defined as MDR-TB strains that are also resistant to 3 or more of the second-line TB drugs [3]. These strains could have severe impact on mortality in areas with HIV epidemic since these strains "leave patients virtually untreatable with currently available anti-TB drugs" [3]. More effective treatments are desperately needed to help control TB. 1 1.1 M. tuberculosis Infection Tuberculosis is transmitted via exposure to droplet nuclei generated by infected individuals in an event of a cough [5]. Initial infection involves inhalation of droplet nuclei containing the bacteria into alveoli of lungs of uninfected individuals and followed by the internalization by alveolar macrophages [6]. Phagocytosis has been shown to be mediated by complement receptors, toll-like receptors, mannose receptors, and scavenger receptors. Normally, killing by macrophages start with acidification of the phagosome by the vesicular proton-ATPase followed by trafficking through endosomal pathway to fuse with the lysosome which then achieves killing of the bacteria and antigen presentation [7]. However, phagosomes containing M. tuberculosis were found to resist the fusion with lysosomes in unactivated macrophages [8]. The mycobacterial phagosome membrane markers composition closely resembles that on an early endosome; the only differences are the lack of early endosomal antigen 1 (EEA1) [9] and the presence of lysosomal associated membrane protein 1 (LAMP1) on the mycobacterial phagosome [10]. The lack of ATPase proton pump on the mycobacterial phagosome explains the reduced acidification compared to normally associated endosomal compartments [11]. Maturation of the phagosomes prevents killing of mycobacteria and antigen presentation. 1.2 Latent infection As the infection proceeds, more inflammatory leukocytes are recruited to the site of infection [12]. These cells aggregate around the infected macrophages and create a structure called a granuloma [12]. The initial formation of the granuloma involves the recruitment of neutrophils, eosinophils, and large mononuclear cells to the site of infection. Production of IL-2 12 by the macrophages as well as excreted mycobacterial proteins and lipids, T cells are recruited to the edges of the granuloma and differentiated to mediate Thl immune response. Inside the granuloma, M. tuberculosis is able to persist for decades. Later in an event of weakened immune system of the host, M. tuberculosis bacilli start to replicate again. In an event of compromised immune system, the bacteria can break out of the granuloma and spread to different sites in the lung [12]. In some cases, large number of mycobacteria circulate through the blood stream and lead to infection in other organs in the body [12]. 1.3 M. tuberculosis cell wall For M. tuberculosis to be a successful pathogen, it must contain sophisticated self-protection mechanisms to isolate itself from the harsh environment created by the host defence system. The mycobacterial cell wall is a thick barrier that helps to protect M. tuberculosis from its environment. The M. tuberculosis cell wall consists mainly of peptidoglycan, arabinogalactan complex (AG), mycolic acids, and lipoarabinomannan L A M (Figure 1). The peptidoglycan is made up of polymers of N-acetylglucosamine and glycolylmuramic acid disaccharide and cross-linked with peptides [13]. The cross-linking reactions are facilitated by the penicillin-binding proteins (PBPs) encoded in the M. tuberculosis genome [14]. Some of these PBPs have been shown to be involved in replication and essential for viability of the Mycobacteria [15]. The A G is made up of arabinofuranosyl monomer units, each of which can be phosphor-ester-linked to the peptidoglycan or ester-linked to high-molecular-weight a-alkyl b-hydroxy fatty acids called mycolic acids. L A M is made up of many arabinosyl side chains branched from a phosphatidylinositol anchored mannosyl backbone. This alternating hydrophobic and hydrophilic layered cell envelope contributes to low permeability [16], antibiotic resistance [17], and persistence inside host tissues [16]. 3 glycolipids mycolc acids hexaarabinofuranosyt termini arabinogalactan linker region pepMoglycan TttlrStMttttSttflfffTTTTdfrfTTAmTttM cytoplasmic membrane Figure 1: Mycobacterial cell wall. Diagram showing the main components of mycobacterial cell wall, such as peptidoglycan in blue, A G in orange, L A M in yellow and mycolic acids [18]. 1.4 Signal transduction system in M. tuberculosis To maintain normal cellular functions, M. tuberculosis must elicit proper responses to environmental changes; this is accomplished through signal transduction. Signal transduction involves covalently attaching or removing of a phosphate molecule to or from a protein. Kinases mediate the phosphate addition processes called phosphorylation; dephosphorylation is the opposite process carried out by phosphatases. Signal transduction can be categorized into two-component system, serine/threonine signalling, and tyrosine signalling. Signal transduction in bacteria typically carried out by the two-component system, which consists of a membrane-bound sensor kinase and a response regulator [19]. Phosphate is first transferred from an ATP molecule to a histidine residue on the kinase; the same phosphate is then transferred onto an aspartate residue on the response regulator. Phosphorylation of the response regulator leads to conformational changes that activates the regulator's function; and usually results in change of gene expression [19]. The dephosphorylation process for two-component system remains unclear [20]. Serine/threonine and tyrosine signalling systems consist of kinases, substrates, and associated phosphatases. Kinases transfer a phosphate from ATP directly to specific serine, threonine, or tyrosine residues on the substrates. Substrates themselves can also be kinases, thus complex cascades are created. Phosphatases counteract the effects of kinases by removing phosphate molecules from phosphorylated substrates. Kinases and phosphatases work together to function as molecular switches for cellular functions. Serine/threonine and tyrosine signalling systems were originally identified in eukaryotes; nevertheless, recent years more and more bacteria species are being discovered to contain these types signalling systems [21]. 5 Signal transduction system in M. tuberculosis includes 11 two-component histidine kinase and response regulator pairs and 11 serine/threonine protein kinases (STPK) [22]. Interestingly, only a single phospho-serine/threonine phosphate (PSTP) named PstP was predicted in M. tuberculosis genome based on sequence homologies [22]. This suggests all phospho-serine/threonine proteins in M. tuberculosis are dephosphorylated by PstP. What is even more fascinating is the M. tuberculosis genome encodes for two phosphor-tyrosine phosphatases (PTP) but no apparent tyrosine kinase [22]. Characterization of the two PTPs suggests that these enzymes may play a role in M. tuberculosis pathogenicity by interfering with tyrosine phosphorylation in macrophages [23]. 1.4.1 Serine/Threonine Protein Kinases Following the completion of M. tuberculosis genome sequencing project, eleven STPKs, named PknA through PknL without PknC, were predicted based on their homology with eukaryotic STPKs [22]. Based on some key amino acid residue signatures, such as catalytic lysine near N-terminus, G-X-G-X-X-G nucleotide binding motif, and activation loop, all eleven STPKs were found to contain the typical kinase domain analyzed by Hanks [24, 25]. Nine out of the 11 STPKs were predicted to contain a single transmembrane domain, hence membrane bound; only PknG and PknK were predicted to be soluble [24]. Membrane bound kinases were thought to function as sensors to detect and relay information about the environment. These kinases were initially proposed to be involved in many cellular processes such as cell division, membrane transport, cell wall synthesis, and virulence [24]. To date, 8 out of the 11 STPKs have been shown to have in vitro kinase activity, and the phosphorylations occur on multiple serine and threonine residues [26]. 6 Table 1: M. tuberculosis STPKs and their predicted roles. A summary of 11 STPKs and their predicted roles based on location in the genome and function of adjacent genes [24]. Name ORF M W (kDa) Predicted roll PknA Rv0015c 45.6 Cell elongation/division PknB Rv0014c 66.5 Cell elongation/division PknD Rv0931c 69.5 Phosphate transport PknE Rvl743 60.5 Membrane transport PknF Rvl746 50.7 Membrane transport PknG Rv0410c 81.6 Amino acid uptake, stationary phase metabolism PknH Rvl266c 66.8 Arabinan metabolism Pknl Rv2914c 61.8 Cell division PknJ Rv2088 61.6 ? PknK Rv3080c 119.4 Transcription, secondary metabolites PknL Rv2176 42.8 Transcription? 7 Since the discovery of STPKs in M. tuberculosis, efforts have been concentrated on discovery of the signal transduction cascades mediated by them. Substrates were identified for PknA, PknB, PknD, PknE, PknF, and PknH [27-32]. Many of these substrates have shown to contain a phospho-peptide binding domain called forkhead-associated domain (FHA) [27-32]. FHA domains are commonly deployed in eukaryotes to facilitate specific interactions with phosphor-threonine containing proteins [33]. Currently, there are two models to describe the interaction between STPKs and FHA containing proteins. The more common accepted model describes the FHA domains as the mediator to recruit substrates to the activated (autophosphorylated) STPKs in the cell membrane [27]. However, a recent study has shown that many of the membrane-bound STPKs can phosphorylate a subset of the F H A containing proteins in M. tuberculosis [30]. The authors suggested that these FHA containing proteins may not be true substrates of STPKs. Instead, FHA containing proteins could modulate the availability of STPKs in M. tuberculosis [30]. Table 2 summarizes the known substrates of M. tuberculosis STPKs. A method of regulation commonly employed in eukaryotic signalling is through dimerization of receptor kinases [34]. M. tuberculosis kinase dimerization was first suggested when PknB kinase crystal structure was solved [35]. One group observed apparent disorder of the linker region between the kinase domain and the transmembrane domain [35, 36]. This suggests that external signal may not be transmitted across the membrane via conformational changes. The crystal structures of PknB and PknE both crystallized as dimmer units with significant contact between each of the dimers [35-37]. However, functions of dimerization in PknB and PknE are not resolved by crystallization studies. An enzyme kinetic study of PknD kinase domain showed a 7 time increase in kinase activity upon dimerization [38]. 8 Table 2: Substrates of serine/threonine protein kinases in M. tuberculosis. Kinase Substrate FHA containing Method of identification Reference PknA Wag31 (Rv2145c) - In vivo [29] Rvl422 - In vivo [29] Rv0020c + In vitro [30] Rvl747 + In vitro [30] EmbR + In vitro [39] FtsZ - In vivo [40] PknB PbpA(Rv0016c) - In vitro [31] Rvl422 - In vivo [29] GarA(Rvl827) + In vitro [41] EmbR + In vitro [39] Rvl747 + In vitro [30] Rv0020c + In vitro [30] PknD Rvl747(+/-) + In vitro [30] MmpL7 - In vitro [32] Rv0516c - In vivo [38] PknE Rvl747 + In vitro [30] PknF Rvl747 + In vitro [28] Rv0020c + In vitro [30] PknH EmbR (Rvl267c) + In vitro [271 9 1.4.2 PknH kinase One of the STPKs studied extensively in our lab is PknH kinase. Initially based on genomic localization studies, PknH was suggested to be involved in cell wall synthesis regulation and antibiotic resistance [24]. PknH is one of the 9 membrane bound sensor kinases (Figure 2). The N-terminus kinase domain (M1-L296) is mostly located inside the cell, followed by proline-rich region of unknown function (P297-P403), a single transmembrane domain (L404-I420), and a C-terminal extracellular sensor domain (R427-E626) [27]. Activation of PknH kinase requires the autophosphorylation of its activation loop at Thrl70 [27]. Mass spectrometry analysis after in vitro phosphorylation reaction showed multiple autophosphorylation sites on PknH kinase [42], and T170A point mutation completely abolishes all phosphorylation [27]. The latest mass spectrometry study revealed over 10 serine/threonine autophosphorylation sites on PknH kinase intracellular domain (1-401) [42]. 10 DELKTQLGT A / 296 404 420 626 PknH Kinase Domain TM Extracellular Domain Figure 2: Schematic drawing of PknH kinase structure. Kinase domain is coloured in yellow; transmembrane region is coloured in pink; extracellular domain is coloured in green; and the activation loop within the kinase domain is coloured in red. The cloned portion encodes for the kinase domain and the linker to the transmembrane domain. 11 PknH was initially predicted to phosphorylate the protein encoded by the upstream gene designated embR [24]. This was later confirmed by in vitro kinase reaction using recombinant PknH kinase domain and recombinant EmbR protein, and the EmbR phosphorylation occurs on 5 threonine residues [27]. Mutations of key residues in, or deletion of, the FHA domain lead to greatly reduced levels of phosphorylation of EmbR protein [27]. This suggests that the EmbR FHA domain functions to recruit EmbR protein to PknH kinase by binding to the phosphorylated threonine resides on PknH [27]. EmbR functions as a transcription regulator for embCAB operon in M. tuberculosis [43]. Al l 3 emb genes encode for arabinosyl-transferases used in synthesis of key cell wall components L A M and A G . All three emb genes were found to be the targets of the antibiotic ethambutol [44], and one mutation in embB gene at position 306 is responsible for 60% of the ethambutol resistant strains [45]. A recent comprehensive study from the Av-Gay lab was carried out using a pknH deletion mutant (ApknH) [46]. The results from this study suggest that PknH kinase controls various processes involved in intracellular growth. The untreated in vitro growth rate of ApknH strain was found to be similar to that of the parental strain; however, in presence of nitric oxide (NO), the ApknH mutant was able to survive much better than the wild type and the complemented strain [46]. This suggests that the pknH knockout strain is not responding to the presence of NO [46]. Since NO is deployed by the host macrophages to kill invading bacteria, the above evidence would suggest ApknH mutant may have a hypervirulent phenotype during infection. This is indeed the case when both the wild type and knockout strains were used to infect macrophages. The rate of replication (between day 7 and day 11 post infection) of the knockout strain inside PMA-differentiated THP-1 cells was nearly 3 fold higher than that of the 12 wild type strain [46]. To test the validity of these findings, infection studies were done using a mouse model. When BALB/c mice were infected with equal number of bacteria, the ApknH mutant was able to achieve significantly higher bacterial load in the lungs and spleens of the mice throughout all time points of the study when compared to its parental strain [46]. This observation confirms the results from the earlier macrophage infection studies. The conclusion of this study is that PknH kinase senses NO and triggers adaptive gene expression to slow mycobacterial growth in order to achieve better chronic infection [46]. Given the complexity of ApknH mutant phenotype, it is unlikely that PknH specific responses are mediated through a single substrate, EmbR. Therefore, we hypothesize that in addition to EmbR, PknH phosphorylates multiple protein substrates in M. tuberculosis. In the following study, two different approaches were designed in order to identify protein substrates of PknH kinase. The first approach involves comparative phosphoproteome of the wild-type and the ApknH mutant using 2D gels followed by identification using mass spectrometry; the second approach utilizes bioinformatics to identify potential substrates followed by biochemical assays to validate our findings. The results of this study have been published in the journal Biochemical and Biophysical Research Communications. 1 3 Chapter 2: Hypothesis Hypothesis: in order to carry out the diverse response to intracellular infection PknH phosphorylates multiple substrates in M. tuberculosis. Specific hypothesis: substrates of PknH contain similar phosphorylation site to the autophosphorylation site of PknH. The specific aims of this project are to: 1) Identify protein phosphorylation substrates of PknH kinase; 2) Clone, express, and study the phosphorylation pattern, nature and kinetics of identified substrates by recombinant PknH kinase domain, in vitro; 3) Identify the phosphorylation sites on the identified substrates and create point-mutants to show phosphorylation reduction. 14 Chapter 3: Materials and Methods 3.1 Culture of bacteria M. tuberculosis strains were cultured under rolling conditions in Middlebrook 7H9 broth (Difco, Sparks, MD) supplemented with 10% OADC (Difco, Sparks, MD), 0.05% Tween-80 (BDH, Toronto, ON), and 0.2% glycerol (Fisher, Fair Lawn, NJ). E. coli strains were cultured in LB broth or LB agar (Invitrogen, Carlsbad, CA) with or without 100 ug/mL concentration of ampicillin (Sigma, St. Louis, MO). 3.2 Preparation of cell lysates for 2D gels M. tuberculosis wild-type and ApknH mutant were grown in roller bottles at 2 rpm to an OD of 0.3. Culture was then split into two aliquots; ethambutol was added one aliquot to final concentration of 0.2 ug/ml, and the other served as the untreated control. Cells were harvested after 24 hours growth under the same rolling conditions. Cell pellets were washed twice, resuspended and lysed in 50 mM HEPES (pH 7.2) in presence of Complete EDTA-free protease inhibitor (Roche, Mannheim, Germany) with glass beads in Ribolyser at a speed setting of 6.5 for 2x 25s. Lysates were centrifuged at 13,000xg for 10 min at 4 °C and the supernatant was filtered through a low-binding Durapore 0.22 um membrane filter (Millipore, Billerica, MA). Protein concentrations were determined by Bradford assay (BioRad Laboratories, Hercules, CA). 3.3 2D phosphoproteome analysis 250 \ i g of lysate supernatant was incubated in lx kinase buffer (25 mM Tris-HCl pH 7.2, 5 mM MgCl 2 , 2 mM MnCl 2 , 1 mM DTT) in presence of 20 uCi of y- 3 2P ATP (Perkin Elmer, Waltham, MA) for 30 min at 21 °C. The reactions were stopped by addition of rehydration 15 buffer (8 M urea, 2% CHAPS, 0.5% IPG buffer, 0.002% bromophenol blue). The mixture was applied to 11 cm IPG strips, pH 4-7 (GE healthcare, Piscataway, NJ) subjected to separation by isoelectric point (pi). The first dimension of separation started with 14 hours of rehydration, followed by 1 min gradient to 500 V, 90 min gradient to 4000 V, and finally 90 min step-n-hold at 8000 V. The current was limited at 50 uA per IPG strip. A total of 14 kVh was used for the separation by pi. Upon completion of separation by pi, the IPG strips were equilibrated in equilibration buffer (50 mM Tris-HCl, pH 8.8, 6 M urea, 30% glycerol, 2% SDS, trace of bromophenol blue) for 10 min and then subjected to normal SDS-PAGE. Figure 3 is a schematic representation of the 2D phosphoproteome analysis process. 16 M. tuberculosis lysate i Kinase reaction using 7- 3 2P ATP i First dimension separation by isoelectric point i Second dimension separation by molecular weight i Silver staining to visualize protein spots i Expose to Phospholmager cassette to visualize phosphorylated spots Figure 3: Schematic of phosphoproteome analysis by 2D gel electrophoresis. 17 3.4 Silver stain The silver stain used is a modified version of the Rabilloud stain [47]. For each step of the staining procedure, gels were shaken at 50 rpm on a platform shaker. After SDS-PAGE, gels were stained as follows: 1) washed in deionized water for 10 min;2) fixed in 40% ethanol, 10% acetic acid for 1 hour; 3) fixed in 0.5% glutaraldehyde, 30% ethanol, 0.25% potassium tetrathionate, 7% sodium acetate; 4) washed 4 times for 15 min in deionised water; 5) incubated in 0.2% silver nitrate and 0.001% formaldehyde for 30 min; 6) washed in deionised water for 1 min; 7) developed in 3% potassium carbonate, 0.006% formaldehyde, 0.001% sodium thiosulfate for 5 to 10 min; 8) development stopped with 5% Tris base, 2% acetic acid for 10 min. Before further analysis, gels were dried as follows: 1) washed 3 times for 30 min in distilled water; 2) washed in 2% glycerol, 20% methanol for 2 hours; 3) dried in gel dryer (Biorad Laboratories, Hercules, CA) for 4 hours at 80 °C using a temperature gradient. The sequencing compatible silver stain used is a modified version of the Morrissey protocol [48]. The procedure was as follows: 1) fixed gels for 1 hour in 50% methanol, 10% acetic acid; 2) washed in deionized water 3 times for 20 min each time; 3) washed in DTT solution (0.02g DTT in 4L deionized water); 4) stained for 20 min in 0.2% silver nitrate solution; 5) rinsed in deionized water for 5 min; 6) developed in sodium carbonate solution (138g sodium carbonate, 2 ml formaldehyde in 4 L deionized water); 7) staining process stopped with 3% acetic acid. 18 3.5 In-gel trypsin digestion and Mass spectrometry Gel containing proteins of interest were cut out from the SDS-PAGE into smaller pieces about 1-2 mm in dimensions. Gel pieces were washed in a solution containing 20% acetonitrile and 1 M ammonium bicarbonate for 1 hour followed by another wash in a solution containing 50% methanol and 5% acetic acid for 1 hour. This same procedure was repeated until all stains in the gels were removed. The gel pieces were allowed to dehydrate in pure acetonitrile for 5 minutes. The liquid was aspirated and the gel pieces were dried completely under vacuum. Gel pieces were rehydrated in 100 mM ammonium bicarbonate for 30 min, followed by another step of dehydration. Gel pieces were rehydrated in reducing solution containing 10 mM DTT and 100 mM ammonium bicarbonate for 30 min. After the reduction process, excess DTT solutions were removed, and an alkylating solution containing 100 mM iodoacetamide and 100 mM ammonium bicarbonate was added. Alkylation reaction was allowed to proceed for 30 min; this was followed by dehydration, rehydration with 100 mM ammonium bicarbonate, and one more step of dehydration. Finally, gel pieces were hydrated in a solution containing 20 mg/ml trypsin and 50 mM ammonium bicarbonate. Trypsin digestion was performed overnight at 37 °C. Peptides were eluted by incubating in 50 mM ammonium bicarbonate for 10 min, followed by complete aspiration of the liquid into another tube. Gel pieces were then incubated twice in 10% formic acid solution for 10 min. All three elutions were combined into the same tube and vacuum evaporated to final volume of about 20 pi. 19 3.6 Bioinformatic search All bioinformatic searches were done using the program called "Pattern search in Mycobacterium tuberculosis H37Rv sequence data" in the Tuberculist database (http: //www.pasteur. fr/Bio/TubercuList/). The part of the activation loop of PknH surrounding the phosphorylation site has the sequence D E K L JQLGT. The 9 amino acid peptide was used as the initial search string and 3 mismatched amino acids were allowed. The second set of searches was performed with three short peptides (DEKLT, K L T Q L , and TQLGT) and only 1 mismatch was allowed in each of the three separate searches. In the final search, only the peptide T Q L G T was used. The peptide was broken into two parts: TQ entered into field "1st part" with 0 mismatch followed by 0 gap; L G T was entered into the field "2nd part" and 1 mismatch allowed. 3.7 Cloning of pknH and substrates Plasmids constructed in this study are given in Table 3. For amplification of DNA fragments encoding the protein of interest (encoding PknH 1-401 kinase domain and substrates), M. tuberculosis H37Rv genomic DNA was used as the template in the PCR reactions using primers as described in Table 1. PCR amplification was carried out in lXPfu buffer (MBI Fermentas, Burlington, ON) containing either 1 or 1.5 mM MgS04, 200 uM of each dNTP, 300 nM of each primer, 5% DMSO and 2.5U of Pfu Polymerase. The PCR cycle for gene amplification was as follows: 1) 1 cycle of denaturation at 95°C for 3 min; 2) 30 cycles of denaturation (94°C for 30 sec), annealing (58-63 °C for 30 sec) and extension (72°C for 2 min); 3) final extension step at 72°C for 10 min. The annealing temperatures were set according to the requirements for each set of primers. The PCR products were gel purified, digested with appropriate restriction enzymes (sites as included in primer sequence) and ligated to expressions 20 vectors digested with the same restriction enzymes. Ligation products were transformed into E.coli DH5oc. Preparation of competent E. coli cells and CaCl2-mediated transformation were carried out according to standard protocols [49]. Transformants were selected on LB-ampicillin agar plates and screened by colony PCR using the sets of primers used for cloning. The plasmids carrying the correct constructs were purified and transformed into the expression host E. coli BL21. Figure 4 shows all four expression constructs. 21 Table 3: Bacterial strains, expression vectors, cloning and mutagenesis primers used in this thesis. Strains Characteristics E. coli DH5oc E. co/i"BL21(DE3) Plasmids pET15b pET22b pWAB105 pWAB106 pWAB107 pWABHO p W A B l l l pWAB112 pWAB113 Cloning primers 515- pknH-For 516- pknH-Rev 520- embR-For 521- embR-Rev 5141- Rv0681 For 5142- Rv0681 Rev Xl-dacBl 133.350 For X2-dacBl 133.350 Rev T7 expression vector for producing N-term His6-tagged proteins T7 expression vector for producing C-term His6-tagged proteins pET22b with a Xhol/Ndel insert encoding the cytoplasmic domain of PknH M01 pET15b with a Ndel/BamHI insert encoding the entire EmbR protein pET15b with a Ndel/BamHI insert encoding EmbR T209A pET22b with Ndel/Hindlll insert encoding the entire Rv0681 protein pET22b with Ndel/Hindlll insert encoding Rv0681 T35A pET22b with Ndel/Hindlll insert encoding DacBl 133-350 pET22b with Ndel/Hindlll insert encoding DacBl 133-350 T336A CTTCTTCC4 TA rGAGCGACGCACAGGACTCG TTCTC7/CG4GCGGGTTGGTTTTGCGCGGGGTCTG AGGACCCG4 TA rGGCTGGTAGCGCGACAGTGGAG TTGTGG^rCCCATCGGTGTTAAGGGCTTGTGTCC CATCACTC4Z4rGGCTCGCCCGGCCAAACTGAGC CTTG14GC77CGTTGACGCGGTACCACCGTGTGT CTACTGTC4 TA TGAAC AAGTCGGTCGCGGTCGCCGGAAC CAT AAA GCrrATTGCGGTCGGTGG AC ATC AG Mutagenesis primers 593- EmbR-S-T616C C C C T A C C G G G A G C C G C T G T G G A C A C 594- EmbR- AS-A616G GTGTCC A C A G C G G C T C C C G G T A G G G S i l l -Rv0681-T35A-S A T G C G C T G G C G G C C C A G C T C G G G SI 12-Rv0681-T35A-as C C C G A C C T G G G C C G C C A G C G C A T 5113- DacB 1-T336A-S C A C C C C G G C A G G C G C C C A G A T C G G G A C 5114- DacB 1-T3 3 6A-as G T C C C G A T C T G G G C G C C T G C C G G G G T G 5115- EmbR-T209A-s G G A G C C G C T G T G G G C A C A G C T G A T C A C 5116- EmbR-T209A-as G T G A T C A G C T G T G C C C A C A G C G G C T C C Plasmid vectors pET15b and pET22b were obtained from Novagen. All other plasmids listed above were constructed in this study. 22 Xbo! SJE i W O Bpuiio: i .Nod v„u::: ,-Hmdn: Figure 4: Plasmid maps of expression vectors constructed in this study. p W A B 1 0 5 over-produces intracellular domain of PknH kinase fused with C-terminal His6-tag. p W A B 1 0 6 and 107 over-produces EmbR and EmbR T209A with N-terminal His6-tag, respectively. p W A B l 10-113 over produce Rv0681, Rv0681 T35A, D a c B l 133-350, and D a c B l 133-350 T336A with C -terminal His6-tag, respectively. Restriction sites depicted are single cutting sites within each expression plasmid. bla encodes for ampicillin resistant gene - pMactamase. 23 3.8 Expression and purification of recombinant proteins Single colonies from positive transformants were inoculated into LB media containing 100 ug/ml of Ampicillin and were allowed to grow overnight with shaking at 37 °C. After overnight growth, this is sub-cultured for expression with a 100 fold dilution. A final concentration of 0.1 mM IPTG was added to this culture at OD of 0.6, and the culture was allowed to grow for either 4 hours at 37 °C or 14 hours at 21 °C. Cultures were spun at 5000xg for 20 min and resuspended in lysis buffer (50 mM Tris-HCl pH 8, 250 mM NaCl, and 10 mM imidazole). Resuspensions were sonicated in a sonicator (Fisher Scientific, Ottawa, ON) at power setting of 10 for 3 bursts of 30 s with 30 s cooling in between each burst. The total lysates were centrifuged at 13000 xg for 30 min and the supernatants were applied to Ni-NTA column (Qiagen). After binding of each protein, the column was washed with 20 mL of 20 mM imidazole wash buffer (50 mM Tris-HCl pH 8 and 250 mM NaCl), then with 20 mL of 50 mM imidazole wash buffer (50 mM Tris-HCl pH 8 and 250 mM NaCl). Purified proteins were eluted with 200 mM imidazole elution buffer (50 mM Tris-HCl pH 8 and 250 mM NaCl). Proteins were then dialyzed overnight in dialysis buffer (50 mM Tris-HCl pH 7.2, 5% glycerol and 1 mM DTT). Proteins were run on a SDS-PAGE to check for purity, and concentrations were estimated with Bradford reagent (Biorad Laboratories, Hercules, CA). 3.9 In vitro phosphorylation assay The in vitro kinase reactions contained 25 mM Tris-HCl pH 7.2, 5 mM MgCL;, 2 mM MnCl 2 , 1 mM DTT, 10-300 ng of recombinant PknH kinase, and with or without 0-500 nM of substrates. The reactions were started by addition of 5-10 uCi of y- 3 2P ATP (Perkin Elmer, Waltham, MA) followed by 5-30 min incubation at room temperature (21 °C). At the end of the 24 incubation period, reactions were stopped by addition of SDS-sample loading buffer and heated at 95 °C for 5 minutes. Samples were resolved by SDS-PAGE on 8% polyacrylamide gels and the gels were silver stained, and dried. The 32P-radioactively labelled protein bands were detected using a Phosphorlmager SI (Molecular Dynamics). Bands corresponding to phosphorylated proteins were cut out and subjected to scintillation count (Beckman Coulter LS 6500). 3.10 Enzyme kinetic calculation The CPM data collected from the scintillation counter was first converted to DPM data based on the counting efficiency of the machine, which is about 90%. Using the specific activity of the ATP and account for any decay, the amount of phosphate transferred onto the substrates was calculated. DPM = CPM / 0.9 Bq = DPM / 60 concentration of phosphate transferred = Bq / specific activity / reaction volume enzymatic rate = concentration of phosphate transferred / time The Lineweaver-Burk plot was obtained by plotting the inverse of enzymatic rate versus the inverse of substrate concentration. Km is the absolute value of the inverse of X-intercept, and Vmax is the inverse of Y-intercept. Km = | 1 / X-intercept | Vmax = 1 / Y-intercept 25 3.11 Site-directed mutagenesis Single step site-directed mutagenesis was carried out using Pfu enzyme (MBI Fermentas, Ottawa, ON) with sets of specific primers (Table 3) designed to create Threonine to Alanine substitutions. The mutagenic primers were designed following the primer criteria recommended by the QuickChange protocol (Stratagene, La Jolla, CA). Each primer contained a codon change from A C C (codon for threonine) to GCC (codon for alanine) flanked by 15 to 17 additional residues on each side of the mismatched residue. This provided a high annealing temperature, and thus helped to improve binding specificity. In each mutagenesis PCR reaction, the expression plasmids carrying the wild type gene was used as a template. The 50 pi reaction mix contained lx Pfu buffer, 2 mM MgS0 4 , 200 uM each dNTPs, 125 ng of each primer, 5% DMSO, 50 ng of the plasmid template, and 1 unit of Pfu polymerase. The reaction was carried out in a thermocycler with the following setting: 18 cycles of denaturation at 95 °C for 1 min, annealing at 60 °C for 1 min and extension at 68 °C for 9 min. Parental template plasmid was digested by treating 20 pi of the PCR product with 1 JJLI Dpnl enzyme at 37 °C for 1 hour. A 10 pi aliquot of the digested mixture was transformed into E. coli DH5a. Plasmids were isolated from the transformants, and nucleotide sequences of the inserts were determined to confirm that only the desired mutations were introduced. 26 Chapter 4: Results 4.1 2D phosphoproteome Analysis of phosphoproteome by 2D gel is a method commonly used by researchers because it offers a global view of the phosphorylation pattern inside the cell. Our strategy involves comparing phosphoproteomes of wild-type and the ApknH mutant M. tuberculosis. Any differences observed in the comparison can only be contributed to the lack of PknH kinase in the knockout mutant. This method involves in vitro phosphorylation of lysates with 32 radioactive y- P ATP, followed by separation of proteins by two-dimensional gel electrophoresis. In the first dimension, proteins were separated by their isoelectric point. In second dimension, proteins were separated according to their molecular weight. The comparison between untreated wild-type and ApknH mutant phosphoproteome showed no differences between the two (Figure 5). This is most likely due to the lack of a specific trigger to activate PknH kinase. The only specific trigger for PknH kinase known at this time is the antibiotic ethambutol. In the second attempt at comparing the phosphoproteomes, sub-lethal concentration of ethambutol was added to the cell culture 24 hours prior to harvesting the culture for analysis. When 2D-phosphoproteomes of ethambutol treated wild-type and ApknH mutant 2D phosphoproteomes were compared, 9 phosphoproteins present in the wild-type gel were missing in the ApknH mutant gel (Figure 6). The pi and molecular weight (MW) are listed in Table 4. An attempt was made to try to match up the spots on the autoradiogram to the spots from silver staining. However, none of the nine phosphoproteins could be visualized by silver staining. Thus, we could not identify them by mass spectrometry. 27 pi 4 5.5 pi 4 5.5 Figure 5: 2D phosphoproteome analysis of M. tuberculosis. wt shows the 2D phosphoproteome of wild-type strain (H37Rv), and ApknH shows the 2D phosphoproteome pknH knockout strain. Radioactive spot observed at 43 kDa and p i 5 was confirmed to be a contamination in the Phospholmager cassette. 2 8 Figure 6: Phosphoproteome analysis with ethambutol treatment. Spots shown in circle were found to be phosphorylated in the ethambutol treated wild-type but absent in the treated pknH knockout strain. 29 Table 4: Observed phosphorylation spots in 2D analysis: p i and M W Spot number Approximate pi Approximate M W (kDa) 1 4.2 80 2 4.1 75 3 4.8 68 4 5 68 5 5 66 6 4.4 44 7 4.6 38 8 4.5 35 9 4.8 30 4.2 Bioinformatic search Bioinformatics is an approach complementary to phosphoproteome analysis to assist kinase substrate identification. This approach assumes that the substrate binding cleft of the kinase has preference for a specific motif. Therefore, we can use existing phosphorylation sites to find other proteins with similar amino acid sequences. As described in the introduction, the only characterized phosphorylation site for PknH kinase is on its activation loop at Thrl70. The peptide sequence surrounding the Thrl70 is DELKXQLGT. This 9 amino acid sequence was used to search for potential substrates in the M. tuberculosis genome database. However, the only positive match found was PknH kinases. This is most likely due to the fact the motif searched is too long and hence too specific. Therefore, 3 separate searches were done each using a portion of the 9 amino acid sequence. Three lists of potential substrates were generated from 3 searches using the motifs D E L K J , LK7QL, and TQLGT. In these 3 lists, EmbR, the only known substrate of PknH kinase, was found in the list generated from the search using TQLGT. The predicted phosphorylation site on EmbR is TQLIT. Given the high similarity between the two motifs, restrictions were applied to the initial search parameters. The final search parameter was set to T Q X X X , where the amino acids TQ are fixed and the X X X are the variable amino acids. This search generated a list of 59 proteins that contain motifs that are very similar to the motif on the activation loop of PknH kinase as well as a predicted motif of the EmbR protein. We removed proteins containing more bulky residues to generate a list of 40 potential substrates (Table 5). These 40 potential substrates cover 7 out of 9 functional categories used by the database. Two other STPKs, PknD and PknE, were also in the list of potential PknH substrates. 31 Two out of the 40 potential substrates, Rv0681 and DacBl, were chosen for validation of our bioinformatic approach. Rv0681, a TetR transcription regulator, was chosen because it contains a motif that is a perfect match to that of PknH kinase. This protein substrate could be responsible for down stream adaptive gene expression in the PknH cascade. We also chose DacBl as second test candidate because it contains TQ/GT motif, which contains a most conserved substitution. DacBl is predicted as a penicillin-binding protein; this family of proteins is involved in making of the peptidoglycan of the cell wall and is important in cell division. This might also be linked with other cell wall enzymes regulated by PknH kinase [46] 32 Table 5: Potential PknH phosphorylation substrates identified by bioinformatic search. Functional Class Lipid metabolism Information Pathways Cell wall and cell processes PE/PPE Intermediary metabolism and respiration Protein AcrAl: Acyl-CoA reductase GpsI: Bifunctional protein polyribonucleotide nucleotidyltransferase (PNPase) LigB: ATP-dependent DNA ligase Rv3263: Probably DNA methylase DacBl: Probable penicillin-binding protein Esxl, L, N, O, V: ESAT-6 like proteins (5 proteins) FecB: Probably Fe(III)-dicitrate-binding periplasmic lipoprotein LppI: Probable lipoprotein lppl MmpL8: Integral membrane transport protein Rvl333: Hydrolase Rvl517: Conserved hypothetical transmembrane protein Rvl824: Conserved hypothetical membrane protein Rv2091c: Probable membrane protein Rv2333c: Probable conserved integral membrane transport protein PPE33: PPE family protein ArgF: Probable Ornithine carbamoyltransferase PhoH2: PhoH-like protein Rv0083: Probable oxidoreductase Rvl006: Hypothetical protein Rvl 178: Probable aminotransferase Rvl264: Adenylyl cyclase Rvl 318c: Adenylyl cyclase Rvl 320c: Adenylyl cyclase Position Sequence 287 RNMAATQLGIPAEIF 150 A A S A S T Q L G G L P F S G 37 RAAPDTQLVTIIVSW 116 T W L H K T Q L G S W D G V 336 NTPAGTQIGTLIEPD 55 FITQLGRNFQ 2 1 6 F A E H A T Q V G T K H D A 79 R D G V T T Q L G D D V A F S 337 L G M V F T Q L G I L K T V G 300 A L S P E T Q L V T A V G A A 186 G A E I G T Q L G A F W F T 93 Q L G V G T Q L S T A I I W 83 F G A Q P T Q L G V P G Q Y G 4 M N R T Q L L T L I A T G 463 V A L P D T Q L G S H 76 V D S G S T Q L G R D E T L Q 77 P I P V G T Q G G T L H V E L 142 W Y A V M T Q L G F I A I L V 281 SAFPHTQLVTSPANP 140 R A D A L T Q L G P Q S P A L 227 D L V G F T Q L G E W S A E 371 DIVGSTQLVTSRPPA 371 DIVGSTQLVTSRPAA 33 Rvl817: Possible flavoprotein Rv2251: Possible flavoprotein Regulatory EmbR: Probable transcriptional proteins regulatory protein PknD: Transmembrane Serine/Threonine protein kinase D PknE: Transmembrane Serine/Threonine protein kinase E PknH: Transmembrane Serine/Threonine protein kinase H Rv0681: Probably transcriptional regulatory protein (possible TetR-family) Conserved Rv0500A: Conserved hypothetical hypotheticals protein Rvl006: Hypothetical protein Rvl593c: Conserved hypothetical protein Rvl830: Conserved hypothetical protein Rv2133c: Conserved hypothetical protein Rv2616: Conserved hypothetical protein 464 248 209 169 170 170 35 22 281 195 2 65 35 G Y A S G T Q L G E G S F F G A L R T I T Q T G T G P T W R E P L W T Q L I T A Y Y L S S D P G L T Q T G T A V G T Y T D E K L T Q L G N T V G T L T D E K L T Q L G T A V G T W I N A L A T Q L G T K G P S L G Q Q A K T Q L L T V A E V A SAFPHTQLVTSPANP RRRVITQTGTIAQSG V T Q L V T R A R S A A Y L V S T Q L G W N L V P H HLDVSTQIGTGRQRF 34 4.2 Cloning and expression of pknH kinase domain and embR To validate our bioinformatic findings we chose to test PknH's ability to phosphorylate two predicted substrates. Due to the presence of a transmembrane domain in PknH kinase, cloning of the complete pknH gene would more than likely lead to insoluble expression. Therefore, we amplified the region encoding for the intracellular domain of PknH kinase. A single DNA band of 1.2 kb was observed in the PCR reaction and it migrated in the region between 1 and 1.5 kb (Figure 8A). The recombinant PknH produced contains a C-terminus 6x-His fusion with and expected size of about 43 kDa. The purified recombinant protein appears to run as a thick band at about 50 kDa on 10% SDS-PAGE (Figure 8B). EmbR is the only known substrate of PknH kinase, and it was used throughout this study as a positive control for phosphorylation reactions. embR was previously cloned into pET15b vector by another lab member. The recombinant protein contains an N-terminal 6xHis fusion. However sequencing results indicated a mutation at nucleotide 616. This leads to a P205S mutation 3 amino acids away from the predicted phosphorylation motif. This raises a great concern whether PknH kinase can still phosphorylate EmbR with this mutation. Therefore, site-directed mutagenesis primers were designed to restore the correct genotype. The mutagenesis was done as described in material and methods. Sequencing was done on the corrected clone to verify the reversed mutation. 35 Figure 7: Cloning and expression of PknH, Rv0681, and DacBl. Panel A shows P C R reaction used to amplify pknH, rv0681, and d a c B l . Negative control (Neg) are P C R reaction without M . tuberculosis genomic D N A . Panel B show the purified recombinant PknH, EmbR, Rv0681, and D a c B l ran on 10% S D S - P A G E and visualized using coomassie blue. 36 4.3 Cloning and expression of Rv0681 and DacBl Genes encode for both predicted substrates, Rv0681 and DacBl, were cloned into pET22b vector as described in the material and methods. The recombinant Rv0681 protein is 209 amino acids long with a molecular weight of 22.8 kDa. The penicillin-binding protein DacBl was predicted to contain two transmembrane domains (Figure 7A). To reduce the probability of producing insoluble DacBl proteins, cloning primers were design in such a way that only the soluble portion containing the predicted phosphorylation site was amplified as seen in Figure 7B. The recombinant protein is 258 amino acids long with a molecular weight of 27.5 kDa. 37 DacBl TM Over-expressed portion J M Figure 8: Hydrophobicity analysis and structure of DacBl. Panel A shows the hydrophobicity analysis of DacBl protein. Analysis was performed with ProtScale on Expasy server (http://www.expasy.org/tools/protscale.htmll using a scale published by Abraham and Leo [50]. Higher "score" indicates more hydrophobic regions. Panel B is a schematic drawing of DacBl protein. Pink coloured regions correspond to predicted transmembrane domains. Red coloured region corresponds to the over-expressed portion of DacBl. 38 4.4 PknH phosphorylation of substrates In vitro kinase reactions were performed to check whether the two DacBl and Rv0681 are true substrates of PknH kinase. The reaction condition was fixed to 20 °C for duration of 5 min. The reactions were started by the addition y- 3 2P ATP. Initially kinase activity of recombinant PknH kinase domain was tested. As seen in Figure 9, PknH was shown to undergo autophosphorylation as judged by the thick radioactive band at about 50 kDa; this matches the location and the migration pattern of PknH kinase on the silver stained gel. Myelin-basic protein is the commonly used artificial substrate for in vitro kinase reactions to test for kinase activity. However, in this study, we used the cognate substrate EmbR as the positive control. Indeed, the recombinant PknH kinase domain produced was able to phosphorylate recombinant EmbR (Figure 9A). The same reaction conditions were used to test the other two predicted protein substrates. Both Rv0681 and DacBl were clearly shown to be phosphorylated by PknH (Figure 9B). 39 kDa PknH EmbR Figure 9: PknH phosphorylation of Rv0681 and DacBl. (A) In vitro autophosphorylation of PknH kinase and phosphorylation of EmbR. (B) In vitro phosphorylation of Rv0681 (23 kDa) and truncated D a c B l protein (27 kDa) substrates by PknH kinase. 40 4.5 Point mutation studies To test whether the phosphorylations occurred at the predicted sites, site-directed mutagenesis was used to create threonine to alanine substitution mutations on the predicted amino acid residues. Mutation was introduced using a set of primers designed to include 1 mismatch to change codon ACC(Thr) to GCC(Ala). The plasmids containing the cloned substrates were used as templates for the PCR reaction. Sequencing results confirmed that all the mutagenized genes contain the desired mutation. Point-mutated proteins were expressed following the same protocol as other recombinant proteins. The point-mutated proteins were named EmbRT209A, Rv0681T35A, and DacBlT336A. As seen in Figure 10, in most cases site directed mutagenesis revealed that the predicted sites are indeed phosphorylated by PknH kinase. The level of phosphorylation for EmbRT209A was reduced to about 50% of it original level (Figure 10). DacBlT336A also showed a similar reduction in phosphorylation. However, phosphorylation of Rv0681 was completely abolished by the T35A point mutation (Figure 10). 41 Figure 10: In vitro kinase assay comparing wild-type and T170 mutant homologs of EmbR, Rv0681, and DacBl. (A) Phosphorylation levels of substrates and corresponding point mutants. (B) Silver stained gel showing equal loadings of protein substrates. 42 4.6 Enzyme kinetic studies It is very common for a kinase to have multiple phosphorylation substrates. However, the kinase's affinity and enzymatic rate might be different towards each substrate. Biochemical analysis would reveal the affinity (Km) and maximum enzyme velocity (Vmax) towards each substrate. We looked at the kinetic characteristics of PknH kinase against the three substrates. The assays involve measuring the amount of phosphate incorporation by PknH kinase at different concentrations of each substrate in a given time. By plotting the inverse of enzyme velocity versus inverse of substrate concentration (Lineweaver-burk plot), we can determine both Km and Vmax values of PknH for each of the substrates. Figure 10 shows the Lineweaver-burk plot of all three substrates. The Vmax values were determined by taking the reciprocal of the Y-intercept, and the Km values were determined by taking the reciprocal of the X-intercept. The results showed that the Vmax for the two new substrates DacBl and Rv0681 are similar, and they are much higher than that for previously known substrate EmbR. However, the Km value for EmbR is 10 fold smaller than that for DacBl and Rv0681. This signifies that the interaction between PknH kinase and EmbR is very strong, but the rate of phosphorylation is much lower. 4 3 Km = 0.597 [iM Km = 19.82 \ i M Km = 1.59u,M Vmax = 3.72 uMmin V m a x = 8 6 2 H-M/min V m a x = 1 1 4 g Figure 11: Enzyme kinetic analysis of EmbR, Rv0681, and DacBl. Panel A show examples o f the kinase assays performed for each substrate. Panel B shows the Lineweaver-burk plots as well as K m and Vmax for each substrate. 4-4^  Chapter 5: D i s c u s s i o n s Since the discovery of 11 STPKs in M. tuberculosis, several groups have devoted then-efforts to understand their pathways by identify substrates for these kinases. Yet, nearly 10 years has passed, and only a total of 9 substrates have been identified for 9 out of the 11 substrates. Substrate identification for kinase is a very difficult task for several reasons. First, signalling molecules are in low abundance inside the cell; therefore, detection methods must be extremely sensitive. Second, most of the M. tuberculosis STPKs are membrane-bound, thus most of the kinase molecules would not be present in the typical soluble extracts, thus making in vitro . Typical solubilization methods can potentially disrupt kinase activity, which makes some proteomic approaches unsuitable for M. tuberculosis kinome studies. Furthermore, due to the infectious nature of M. tuberculosis, manipulation of the membrane fraction outside a Level 3 containment facility is prohibited. In this thesis, we used 2 different approaches to attempt at identifying substrates of PknH kinase from M. tuberculosis. The first approach is the proven 2D phosphoproteome analysis where soluble lysates were subjected to in vitro phosphorylation and then analyzed by 2D gel electrophoresis. Many spots were detected by the phosphoimager; however, no differences in phosphorylation were observed when the wild-type gel was compared to the knockout gel. This approach was not as successful as we would like it to be, but this outcome was not entirely surprising to us because a sensor kinase may only be needed in presence of a specific trigger. As described in the introduction, PknH kinase is able to phosphorylate EmbR - a transcription factor that regulates expression of the embCAB operon. The gene products of this operon are known to be targeted by the antibiotic ethambutol. We wanted to see if presence of ethambutol in the growth culture can lead to alteration in the M. tuberculosis phosphoproteome 45 specific to PknH kinase. In this approach, we hoped to observe an increase in endogenous pknH kinase activity as well as a slight change in protein expression downstream of PknH kinase pathway. By treating cell culture with a sublethal concentration of ethambutol, nine differentially phosphorylated spots were observed on the wild-type gel that was not present in the ApknH gel (Figure 6). Since the only difference between the two phosphoproteome is the PknH kinase and its signalling pathway, we can conclude that these 9 phosphoproteins are substrates of PknH kinase or kinases and substrates downstream in the PknH signalling pathway. This finding confirms our hypothesis that PknH kinase can phosphorylate multiple substrates other than EmbR. The next logical step is to try to identify differentially phosphorylated proteins by mass spectrometry. However, the identification presents several challenges. The first issue is the lack of accessibility to a mass spectrometry facility that allows radioactive sample submissions. Therefore, we can not simply cut out the radioactively labelled protein spots. Instead, we have to find the silver stained spots corresponding to the spots on the phosphorylation image, and then cut the same protein spot from a non radioactive gel. The problem with this approach is the low abundance of signalling molecules. Very often signalling proteins are detected by radioactivity but are below the detection limit of other staining methods. Due to this reason, we could not identify any of the 9 differentially phosphorylated proteins. Even though no substrates can be identified through the 2D phosphoproteome approach, the experiments have clearly demonstrated that PknH kinase phosphorylates multiple substrates in M. tuberculosis. Due to the insufficient detection sensitivity of silver staining, we needed another method to identify PknH substrates. Bioinformatics have been used more and more on designing enzyme inhibitors in the drug industry. The principle is based on analyzing the 3-dimensional 46 structure of the binding pocket. We wanted to see if this method can also be applied in substrate identification for PknH kinase. For a phosphorylation event to occur, the substrate must first interact with PknH kinase in such a way so that the phosphorylation site on the substrate aligns perfectly with the substrate cleft on the kinase. For this docking event to occur properly, the substrate must be in a specific 3-dimensional structure that complements the activation cleft of the kinase. 3-dimensional structure of the protein is primarily dictated by its amino acid sequence with some adjustment by the interactions with environment. We can therefore examine any known phosphorylation sites to find common features and use that information to search potential substrates in the M. tuberculosis proteome. As described in the introduction, the only known substrate of PknH kinase is the transcription factor EmbR. However, the PknH phosphorylation site on EmbR was never identified. The only known PknH phosphorylation site is the Threonine 170 on the activation loop of PknH kinase. A 9-amino acid long sequence surrounding Thrl70, D E L K T Q L G T was used in the initial pattern search. Only PknH was returned as a positive match. This suggests that the search criteria are too stringent, and the recognition/docking sites used by PknH kinase are likely to be shorter than 9 amino acids. This sequence was broken into 3-5-amino acid long motifs: the N-terminal motif DELKT; the C-terminal motif TQLGT; and the hybrid motif L K T Q L . Pattern searches were performed with all three motifs while allowing 1 mismatch. Out of the 3 lists of proteins generated, the only known substrate of PknH, EmbR was identified in the list generated from the C-terminal motif TQLGT; and the matching site on EmbR is TQLIT. Identification of EmbR suggests that the TQLGT motif is likely to be the motif recognized by PknH kinase. 47 Given the similarity between the site on EmbR and the activation loop on PknH kinase, the search criteria was modified to contain fixed TQ followed by L G T with 1 mismatch allowed. Forty different proteins were found to match the above criteria (Table 5), including PknH and EmbR. This suggests that the prokaryotic serine/threonine signalling pathways can be as complex as its counterpart in eukaryotes. In another non-pathogenic actinomycete, Corynebacterium glutamicum, phosphoproteome studies experimentally determined 120 unique serine/threonine phosphorylated proteins that are phosphorylated by four STPK [51]; this supports our finding that 60 substrates is not an unreasonable for PknH kinase. The sixty proteins covered all eleven categories used in the Tuberculist database; this shows that PknH kinase modulates many functions inside M. tuberculosis. Interestingly, two other kinases, PknD and PknE are among the five regulatory proteins identified. Sequence analysis suggests that the activation loops of these two kinases are very similar to that of PknH and that the three dimensional structure of substrate binding cleft might be very similar between these kinases. Therefore it is likely that PknD, PknE and PknH share some substrates between them. This phenomenon of multiple overlapping substrates has previously been described for PknB, PknD, PknE, and PknF [30]. Of the predicted target proteins, we found DacBl, and Rv0681 as interesting targets for phosphorylation by PknH. DacBl is membrane-bound protein containing 405 amino acids and is predicted to be a probable penicillin-binding protein/carboxy peptidase with a predicted mass of 42 kDa. The dacBl gene itself is not a part of an operon and the expression of dacBl is not considered essential for in vitro growth [15]. It is homologous to the B. subtilis D-alanyl D-alanine carboxy peptidase with 31% identity in a 249 amino acid overlapping region. This protein is particularly interesting to us because this class of enzymes are involved in cell wall 48 biosynthesis [52, 53]. Phosphorylation of the DacBl-T 3 3 6 QIGT motif, which is located just outside the peptidase domain (80-320 aa), might regulate DacBl enzyme activity to contribute to the hypervirulent phenotype during infection. The Rv0681 protein is a 21.2 kDa protein predicted to be a transcription factor that was reported to be non-essential for survival by transposon mutagenesis studies [15]. Analysis of the primary protein structure of Rv0681 with MotifScan (http://mvhits.isb-sib.ch/cgi-bin/motif_scan) revealed a TetR-type Helix-turn-helrx (HTH) DNA binding motif from amino acids 6-66. The predicted phosphorylation site (I35QLGT) is in the middle of the HTH-motif; phosphorylation of HTH would likely alter DNA binding characteristics. Both Rv0681 and truncated DacBl were able to accept phosphate molecules from the recombinant PknH kinase. Point-mutation of the predicted phosphorylation sites showed that Rv0681 phosphorylation is over 90% abolished. However, in the case of DacBl and EmbR, significant amount of residual phosphorylation was observed. This indicates that both DacBl and EmbR are phosphorylated at multiple residues. Same observation have already been reported for EmbR [54]. The M. tuberculosis EmbR is a putative transcriptional regulatory protein characterized by the presence of a putative DNA binding domain located in its N-terminal region followed by a bacterial transcriptional activation domain and a Forkhead-Associated Domain (FHA) in its C-terminal region [27, 54]. The FHA-domains are protein-protein interaction domains found in protein kinases and transcription factors, and mediate binding to mainly phosphothreonine motifs in proteins in a sequence-specific manner [33, 55, 56]. Six proteins of M. tuberculosis including EmbR contain FHA domains [22]. In the case of M. tuberculosis EmbR, truncation of the FHA domain or point mutations in three specific residues in the FHA domain of EmbR abolished 49 PknH-mediated phosphorylation of EmbR indicating the critical role of FHA-mediated interaction between the substrate and PknH kinase [27]. This paved the way for characterizing the interactions between other STPKs and FHA-domain containing proteins identified in the M. tuberculosis proteome. PknB, PknD, PknE, and PknF phosphorylated FHA contained endogenous targets. As demonstrated for PknB and PknD [29, 32], phosphorylation of other endogenous substrates do need not involve FHA domains. We have demonstrated experimentally that both Rv0681 and DacBl are phosphorylation substrates of PknH even though both these proteins do not contain any FHA-domains. We initially thought that the phosphorylation of FHA containing substrate would be more favoured due to the function of FHA domain. Our kinetic results show that the interaction between PknH kinase and EmbR is much stronger than for Rv0681 and DacBl. However, PknH kinase can phosphorylate the latter two with much higher enzyme velocity. Together with previously published findings from Molle et al. that the PknH specific phosphorylation of EmbR was abolished when key residues of the FHA domain were mutated, we can conclude that DacBl and Rv0681 contain higher affinity sites. Despite having a less favoured recognition site, EmbR is able to compensate with the function of the FHA domain. This finding proposed evidence for a theory provided by Grundner et al. which suggests that the FHA domain containing proteins can modulate phosphorylation of other substrates by physically occupying the kinases. In conclusion, we observed up to 9 PknH phosphorylation substrates using 2D-phosphoproteome analysis, and 40 potential substrates using bioinformatic analysis. Ultimately, we have successfully identified 2 new phosphorylation substrates of PknH, Rv0681 and DacBl. In addition, we were able to show significant phosphorylation reduction with point mutation of 50 the predicted phosphorylation site. These findings can lead to further studies on PknH signal transduction pathways. 51 References 1. WHO. Global tuberculosis control - surveillance, planning, financing. 2006 [cited; Available from: http://www.who.int/tb/publications/global report/2006/pdf/full report correctedversion. pdf. 2. Janin, Y .L . , Antituberculosis drugs: Ten years of research. Bioorg Med Chem, 2007. 3. WHO. Emergence of XDR-TB. 2006 Sept 5 [cited; Available from: http://v^yw.who.int/mediacentre/news/notes/2006/np23/en/index.html. 4. Jacobs, W.R., Jr., et al., Genetic systems for mycobacteria. Methods Enzymol, 1991. 204: p. 537-55. 5. Rom, W.N. and S. Garay, Tuberculosis. First Edition ed. 1996, New York: Little, Brown and Company Inc. 6. Weaver, T., et al., Assessment of in vivo attachment/phagocytosis by alveolar macrophages. J Immunol Methods, 1996.193(2): p. 149-56. 7. Hestvik, A .L . , Z. Hmama, and Y. Av-Gay, Mycobacterial manipulation of the host cell. FEMS Microbiol Rev, 2005. 29(5): p. 1041-50. 8. Armstrong, J.A. and P.D. Hart, Phagosome-lysosome interactions in cultured macrophages infected with virulent tubercle bacilli. Reversal of the usual nonfusion pattern and observations on bacterial survival. J Exp Med, 1975.142(1): p. 1-16. 9. Deretic, V. , et al., Mycobacterial phagosome maturation, rab proteins, and intracellular trafficking. Electrophoresis, 1997.18(14): p. 2542-7. 10. Xu, S., et al., Intracellular trafficking in Mycobacterium tuberculosis and Mycobacterium avium-infected macrophages. J Immunol, 1994.153(6): p. 2568-78. 11. Sturgill-Koszycki, S., et al., Lack of acidification in Mycobacterium phagosomes produced by exclusion of the vesicular proton-ATPase. Science, 1994. 263(5147): p. 678-81. 12. Qiu, B., et al., Chemokine expression dynamics in mycobacterial (type-1) and schistosomal (type-2) antigen-elicited pulmonary granuloma formation. Am J Pathol, 2001.158(4): p. 1503-15. 13. Draper, P., The outer parts of the mycobacterial envelope as permeability barriers. Front Biosci, 1998.3:p.D1253-61. 14. Jones, G. and P. Dyson, Evolution of Transmembrane Protein Kinases Implicated in Coordinating Remodeling of Gram-Positive. Peptidoglycan: Inside versus Outside. J Bacteriol, 2006.188(21): p. 7470-6. 15. Sassetti, C M . , D.H. Boyd, and E.J. Rubin, Genes required for mycobacterial growth defined by high density mutagenesis. Mol Microbiol, 2003. 48(1): p. 77-84. 16. Camacho, L.R., et al., Analysis of the phthiocerol dimycocerosate locus of Mycobacterium tuberculosis. Evidence that this lipid is involved in the cell wall permeability barrier. J Biol Chem, 2001. 276(23): p. 19845-54. 17. Escuyer, V .E . , et al., The role of the embA and embB gene products in the biosynthesis of the terminal hexaarabinofuranosyl motif of Mycobacterium smegmatis arabinogalactan. J Biol Chem, 2001. 276(52): p. 48854-62. 18. Ducati, R.G., et al., The resumption of consumption— a review on tuberculosis. Mem Inst Oswaldo Cruz, 2006.101(7): p. 697-714. 52 19. Hoch, J.A., Two-component andphosphorelay signal transduction. Curr Opin Microbiol, 2000. 3(2): p. 165-70. 20. Hsing, W. and T.J. Silhavy, Function of conserved histidine-243 in phosphatase activity of EnvZ, the sensor for porin osmoregulation in Escherichia coli. J Bacteriol, 1997. 179(11): p. 3729-35. 21. Deutscher, J. and M.H. Saier, Jr., Ser/Thr/Tyr protein phosphorylation in bacteria - for long time neglected, now well established. J Mol Microbiol Biotechnol, 2005. 9(3-4): p. 125-31. 22. Cole, S.T., et al., Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature, 1998. 393(6685): p. 537-44. 23. Koul, A. , et al., Cloning and characterization of secretory tyrosine phosphatases of Mycobacterium tuberculosis. J Bacteriol, 2000.182(19): p. 5425-32. 24. Av-Gay, Y. and M . Everett, The eukaryotic-like Ser/Thr protein kinases of Mycobacterium tuberculosis. Trends Microbiol, 2000. 8(5): p. 238-44. 25. Hanks, S.K., A . M . Quinn, and T. Hunter, The protein kinase family: conserved features and deduced phylogeny of the catalytic domains. Science, 1988. 241(4861): p. 42-52. 26. Greenstein, A .E . , et al., Structure/function studies of Ser/Thr and Tyr protein phosphorylation in Mycobacterium tuberculosis. J Mol Microbiol Biotechnol, 2005. 9(3-4): p. 167-81. 27. Molle, V. , et al., An FHA phosphoprotein recognition domain mediates protein EmbR phosphorylation by PknH, a Ser/Thr protein kinase from Mycobacterium tuberculosis. Biochemistry, 2003. 42(51): p. 15300-9. 28. Molle, V. , et al., Two FHA domains on an ABC transporter, Rvl747, mediate its phosphorylation by PknF, a Ser/Thr protein kinase from Mycobacterium tuberculosis. FEMS Microbiol Lett, 2004. 234(2): p. 215-23. 29. Kang, C M . , et al., The Mycobacterium tuberculosis serine/threonine kinases PknA and PknB: substrate identification and regulation of cell shape. Genes Dev, 2005. 19(14): p. 1692-704. 30. Grundner, C , L . M . Gay, and T. Alber, Mycobacterium tuberculosis serine/threonine kinases PknB, PknD, PknE, and PknFphosphorylate multiple FHA domains. Protein Sci, 2005.14(7): p. 1918-21. 31. Dasgupta, A., et al., The serine/threonine kinase PknB of Mycobacterium tuberculosis phosphorylates PBPA, a penicillin-binding protein required for cell division. Microbiology, 2006.152(Pt 2): p. 493-504. 32. Perez, J., Garcia, R. L. , Bach, H., H de Waard, J., Jacobs, W. R. Jr., Av-Gay, Y. , Bubis, J and Takiff H., Mycobacterium tuberculosis transporter MmpL7 is a potential substrate for kinase PknD. Biochem Biophys Res Commun, 2006. In press. 33. Durocher, D. and S.P. Jackson, The FHA domain. FEBS Lett, 2002. 513(1): p. 58-66. 34. Shi, Z., K.A. Resing, and N.G. Ahn, Networks for the allosteric control ofprotein kinases. Curr Opin Struct Biol, 2006.16(6): p. 686-92. 35. Young, T.A., et al., Structure of Mycobacterium tuberculosis PknB supports a universal activation mechanism for Ser/Thr protein kinases. Nat Struct Biol, 2003. 10(3): p. 168-74. 36. Ortiz-Lombardia, M . , et al., Crystal structure of the catalytic domain of the PknB serine/threonine kinase from Mycobacterium tuberculosis. J Biol Chem, 2003. 278(15): p. 13094-100. 53 37. Gay, L . M . , H.L. Ng, and T. Alber, A conserved dimer and global conformational changes in the structure of apo-PknE Ser/Thr protein kinase from Mycobacterium tuberculosis. J Mol Biol, 2006. 360(2): p. 409-20. 38. Greenstein, A .E . , et al., Allosteric Activation by Dimerization of the PknD Receptor Ser/Thr Protein Kinase from Mycobacterium tuberculosis. J Biol Chem, 2007. 282(15): p. 11427-35. 39. Sharma, K., et al., EmbR, a regulatory protein with ATPase activity, is a substrate of multiple serine/threonine kinases and phosphatase in Mycobacterium tuberculosis. Febs J, 2006. 273(12): p. 2711-21. 40. Thakur, M . and P.K. Chakraborti, GTPase activity of mycobacterial FtsZ is impaired due to its transphosphorylation by the eukaryotic-type Ser/Thr kinase, PknA. J Biol Chem, 2006. 281(52): p. 40107-13. 41. Villarino, A., et al., Proteomic identification of M. tuberculosis protein kinase substrates: PknB recruits GarA, a FHA domain-containing protein, through activation loop-mediated interactions. J Mol Biol, 2005. 350(5): p. 953-63. 42. Molle, V. , et al., Characterization of the phosphorylation sites of Mycobacterium tuberculosis serine/threonine protein kinases, PknA, PknD, PknE, and PknH by mass spectrometry. Proteomics, 2006. 6: p. 3754-3766. 43. Sharma, K., et al., Transcriptional control of the mycobacterial embCAB operon by PknH through a regulatory protein, EmbR, in vivo. J Bacteriol, 2006.188(8): p. 2936-44. 44. Belanger, A .E . , et al., The embAB genes of Mycobacterium avium encode an arabinosyl transferase involved in cell wall arabinan biosynthesis that is the target for the antimycobacterial drug ethambutol. Proc Natl Acad Sci U S A , 1996. 93(21): p. 11919-24. 45. Plinke, C , S. Rusch-Gerdes, and S. Niemann, Significance of mutations in embB codon 306 for prediction of ethambutol resistance in clinical Mycobacterium tuberculosis isolates. Antimicrob Agents Chemother, 2006. 50(5): p. 1900-2. 46. Papavinasasundaram, K.G. , et al., Deletion of the Mycobacterium tuberculosis pknH gene confers a higher bacillary load during the chronic phase of infection in BALB/c mice. J Bacteriol, 2005.187(16): p. 5751-60. 47. Chevallet, M . , V . Procaccio, and T. Rabilloud, A nonradioactive double detection method for the assignment of spots in two-dimensional blots. Anal Biochem, 1997. 251(1): p. 69-72. 48. Morrissey, J.H., Silver stain for proteins in polyacrylamide gels: a modified procedure with enhanced uniform sensitivity. Anal Biochem, 1981.117(2): p. 307-10. 49. Sambrook, J.F., E F.; Maniatis, T., Molecular Cloning: A Laboratory Manual. 2nd ed. 1989: Cold Spring Harbor. 50. Abraham D .J. and Leo A.J., Hydrophobicity (delta Gl/2 cal). Proteins: Structure, Function and Genetics, 1987. 2: p. 130-152. 51. Bendt, A.K. , et al., Towards a phosphoproteome map of Corynebacterium glutamicum. Proteomics, 2003. 3(8): p. 1637-46. 52. Buchanan, C.E. and A. Gustafson, Mutagenesis and mapping of the gene for a sporulation-specific penicillin-binding protein in Bacillus subtilis. J Bacteriol, 1992. 174(16): p. 5430-5. 54 53. Buchanan, C.E. and M.L. Ling, Isolation and sequence analysis of dacB, which encodes a sporulation-specific penicillin-binding protein in Bacillus subtilis. J Bacteriol, 1992. 174(6): p. 1717-25. 54. Alderwick, L.J., et al., Molecular structure of EmbR, a response element of Ser/Thr kinase signaling in Mycobacterium tuberculosis. Proc Natl Acad Sci U S A , 2006. 103(8): p. 2558-2563. 55. Durocher, D., et al., The molecular basis of FHA domain.phosphopeptide binding specificity and implications for phospho-dependent signaling mechanisms. Mol Cell, 2000. 6(5): p. 1169-82. 56. Yaffe, M.B. and S.J. Smerdon, The use of in vitro peptide-library screens in the analysis of phosphoserine/threonine-binding domain structure and function. Annu Rev Biophys Biomol Struct, 2004. 33: p. 225-44. 55 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0101068/manifest

Comment

Related Items