Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

A functional analysis of the kalDNA plasmid from senescent strains of Neurospora intermedia Vickery, Daniel Barry 1989

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1991_A1 V52.pdf [ 12.93MB ]
Metadata
JSON: 831-1.0101043.json
JSON-LD: 831-1.0101043-ld.json
RDF/XML (Pretty): 831-1.0101043-rdf.xml
RDF/JSON: 831-1.0101043-rdf.json
Turtle: 831-1.0101043-turtle.txt
N-Triples: 831-1.0101043-rdf-ntriples.txt
Original Record: 831-1.0101043-source.json
Full Text
831-1.0101043-fulltext.txt
Citation
831-1.0101043.ris

Full Text

A F U N C T I O N A L ANALYSIS OF T H E kalDNA P L A S M I D F R O M S E N E S C E N T S T R A I N S O F Neurospvra intermedia by DANIEL BARRY VICKERY B. Sc., University of British Columbia,  1986  A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR T H E DEGREE OF DOCTOR OF PHILOSOPHY  in T H E F A C U L T Y OF G R A D U A T E STUDIES GENETICS P R O G R A M M E  We accept, this thesis as conforming to the required standard  THE UNIVERSITY OF BRITISH COLUMBIA November, 1989 (c) Daniel B. Vickery, 1989  In presenting this thesis in partial fulfilment of the requirements for an advanced degree at The University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the Head of my Department or by his or her representatives. It, is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission.  Genetics Programme The University of British Columbia 2075 Wesbrook Place Vancouver, Canada V 6 T 1W5 Date: 1 November 1989  ABSTRACT The 8.6 kb kaiilo linear mitochondrial plasmid of Neurospora intermedia was found to give rise to multiple transcripts of 8.6, 4.4,  4.0,  1.3,  1.2,  and 0.9 kb. A transcription map has been  generated which shows similarities to other linear plasmids. These transcripts are all transcribed from a single, unique promoter sequence reiterated near the ends of the terminal inverted repeats of the linear plasmid. The transcripts are not processed, but instead utilize optional transcription stop sites. A n analysis of sub-cellular R N A fractions has confirmed the mitochondrial location of kaiilo transcription. The strong association of kalilo-specific R N A with r R N A to yield R N A artifacts is reported. Kalilo-specific R N A appears to be selectively unstable in affected strains of N. intermedia; this may be a general consequence of linear plasmid R N A . The 5' R N A start site was determined by primer extension and R N A sequencing. The sequence in this region does not show homology to any known mitochondrial, plasmid, nor nuclear promoter, and may constitute  a novel element. The  transcription start site shares homology with the terminus of the linear plasmid, and marks the end of a long series of direct repeats; therefore, the plasmid R N A polymerase may be bifunctional, it may recognize sequences at the ends of the plasmid as well as at the promoter. The analysis of the insertional behaviour of the linear mitochondrial plasmid was studied in parallel subculture series of the organism. It was determined that insertion, per se is not the event required to kill the organism. Generation of inserts of kaiilo in the m t D N A is necessary, but not sufficient, for death to occur in all cases. A n analysis of insertion sites has found one new site and good agreement with previously published locations. Insertion does not always appear to be random, so cultures may inherit undetectable amounts of mtlS-kalDNA. The analysis of insertion sites in one strain has suggested a novel possible structure for the m t D N A .  ii  TABLE OF CONTENTS abstract  ii  Table of Contents  iii  List of Tables  vi  List of Figures  vii  List of Abbreviations  x  Acknowledgement  xi  Introduction  1  Neurospora review Life cycle of Neurospora Ascomycete Growth Asexual Propagation Sexual Propagation Laboratory Propagation Mitochondrial D N A Mitochondrial Genetics Other Mitochondrial D N A s Transcription and Processing Growth Aberration in Fungi Manifestations of Senescence Occurrence of mtDNA mutation Petite Mutations of Saccharomyces cerevisiae The ragged mutation of Aspergillus amstelodamii Senescence in Podospora anserina Mitochondrial Mutation in Neurospora Group I Group II Group III Senescence in Neurospora intermedia Mitochondrial D N A The Linear Plasmid.. Review of Linear Plasmids Definition Prokaryotes Plants Plasmids in Male Sterile Lines Plasmids in Zea Fungi Mitochondrial plasmids Location unknown Nuclear plasmids  iii  :  1 1 1 2 3 5 6 6 7 9 11 11 16 18 19 20 26 26 27 28 30 30 32 42 42 47 51 51 51 53 53 55 55  Table of Contents The Killer System of Kluyveromyces lactis phenotypes of linear plasmids Search for Functions of kaiilo Materials and Methods Strains Neurospora intermedia Escherichia coli Media and Growth Conditions.. Neurospora Escherichia coli Nucleic Acid Isolations D N A Isolation Mitochondrial D N A Escherichia coli Plasmid D N A M13 Phage D N A R N A isolation Total R N A Poly A R N A mtRNA Electrophoresis DNA Agarose gel Polyacrylamide Gels Northerns Hybridizations Radioactive Probe Preparation Oligolabelling End Labelling 3' Labelling 5' Labelling M13 clones S i Nuclease Protection Assays Sequencing Primer preparation D N A sequencing R N A sequencing Primer Extensions Cloned D N A Fragments..... Preparation of Recombinant D N A Competent E . coli Probes  55 57 58  :  ;  Parti Transcriptional Properties of kalDNA Introduction Results Characterization of Transcription  61 61 61 61 61 61 62 63 63 63 64 65 66 66 67 67 68 68 68 68 69 69 70 70 70 70 71 71 71 73 73 73 74 74 75 75 75 76  78 78 79 79  iv  Table of Contents Detection of Transcription Pattern Kalilo-Specific R N A is Unstable Transcription levels Mapping of Transcripts Mapping Experiments Transcription Map Identification of a 5' R N A End Primer Extension Reactions Promoter Sequences Interactions with m t D N A Discussion Related Sequence Elements Transcription of Other Linear Plasmids Kalilo R N A Phenomena Association of Kalilo Transcripts with r R N A Variability and Heterogeneity of Kalilo-Specific R N A Possibility of Other R N A s R N A Phenomena from Other Systems Evolution and Function  79 86 102 105 105 123 123 123 129 130 134 134 135 136 136 138 140 141 142  Part II Parallel subculture Series Experiments Introduction Results Young Strains Do Not Contain mtlS-kalDNA Analysis of Longevity Molecular Analysis Analysis of Junction Fragments Discussion Is insertion the Senescence-Determining Event? Relevance of Data to Senescence Other Models  146 146 152 152 159 167 186 202 203 207 209  Literature Cited,  212  LIST OF T A B L E S Table 1. Survey of Linear Double Stranded D N A Elements  46  Table 2. Averages and Standard Deviations of Lifespans  160  Table 3. Location of mtlS-kalDNA in Parallel Series  198  vi  LIST OF FIGURES Figure 1. Life Cycle of Neurospora Showing Both the Sexual and Asexual Cycles Figure 2. Diagrammatic Representation of the Succession Associated with Aging and Senescence in Neurospora Figure 3. Composite Map of the Podospora anserina Events Which Give Rise to senDNAs . Figure 4. Regions Neurospora  of the  mtDNA  Retained  of Degenerative  4 Events 14  Mitochondrial Chromosome Showing 24  in Various Mitochondrial Mutants  of 29  Figure 5. Restriction Map of Kaiilo  34  Figure 6. Model for the Insertion of Kaiilo Into the m t D N A  38  Figure 7. Previously Identified Insertion Sites of mtlS-kalDNA  40  Figure 8. Model for the Replication of Linear D N A s  43  Figure 9. Structures of Some Linear Plasmids  49  Figure 10. Subclones of kaiilo D N A  77  Figure 11. Occurrence of Transcripts of Kaiilo from Different Series and Strains of N . intermedia 81 Figure 12 Northern Background is Not Due to Low R N A Quality  83  Figure 13. Increasingly Stringent Washes of a Northern Remove Probe Equally from All Areas of a Blot ...89 Figure 14. The 8.6 kb Transcript is Apparent Upon Long Exposures of a Northern Blot. 91 Figure 15. Diagram of the Generation of b l ' and b2' Junction Fragments for the Detection of mtlS-kalDNA 94 Figure 16. Characterization of m t D N A from Strains that Do Not Have Detectable Inserts of Kaiilo 96 Figure 17. Northern Analysis of Strains That Do Not Contain mtlS-kalDNA Figure 18. Dotblots of Various R N A Samples Figure 19. Northern Analysis Using Many Different Subclones of Kaiilo  vii  98 ..103 107  List of Figures Figure 20. A Diagram of the Pattern of Hybridization of Many Different Subclones of Kalilo to R N A '. 109 Figure 21. Use of M13 ssDNA Probes in Northern Blots to Confer Strand Specificity on the Transcripts 112 Figure 22. The 2.0 and 3.5 kb Transcripts Comigrate With the 28S and 16S rRNAs of Neurospora 114 Figure 23. SI Nuclease Analysis of Transcripts  118  Figure 24. Transcription Map of Kalilo D N A  120  Figure 25. 5' End Mapping of the Kalilo Transcripts by Primer Extension Analysis  125  Figure 26. Sequence Around the Major 5' R N A End of Kalilo  127  Figure 27. Northern Analysis of the mtDNA Region Surrounding the Insert of Kalilo in Strain 561-7... 132 Figure 28. Proteinase K is Required For and Leads to Repeatable Isolation of mtARkalDNA 148 Figure 29. Diagram of the Generation of b l ' and b2' Junction Fragments for the Detection of mtlS-kalDNA 153 Figure 30. Characterization of the mtDNA From a Number of Senescent Progeny of Strain 561 155 Figure 31. Lifespans of Members of Parallel Series Derived from Crosses Using Strain 605 as a Male Parent 161 Figure 32. Lifespans of Members of Parallel Series Derived From Crosses Using Strain 1766 as a Male Parent 163 Figure 33. Diagram of the Generation of b l ' and b2' Junction Fragments for the Detection of mtlS-kalDNA 168 Figure 34. Characterization of Senescent mtDNAs from Strain X l - 5 . . .  170  Figure 35. Characterization of Senescent mtDNAs from Strain X l - 6  172  Figure 36. Characterization of Senescent mtDNAs from Strain 1-4  174  Figure 37. Characterization of Senescent mtDNAs from Strain 1-16  176  Figure 38. Characterization of mtDNA from Strains I-16-viii and I-16-ix  188  viii  List of Figures Figure 39. Analysis of Junction Fragments of mtlS-kalDNA from Parallel Series Strain I16-ix '. 190 Figure 40. A Model for the Inserts of mtlS-kalDNA in Parallel Series Strain I-16-ix  192  Figure 41. Insertion Sites of mtlS-kalDNA from Table 3  199  ix  LIST O F ABBREVIATIONS aa  Amino Acid  ARS  Autonoumously Replicating Sequence  ATP  Adenosine Triphosphate  cob  Apocytochrome b  COI  Cytochrome Oxidase I  COII  Cytochrome Oxidase II  COIII  Cytochrome Oxidase III  DNA  Deoxyribonucleic Acid  IS  Insertion Sequence  ITR kalDNA  Inverted Terminal Repeat D N A Sequences Homologous to the Kalilo Plasmid  kb  Kilobase  LTR  Long Terminal Repeat  mRNA  Mitochondrial R N A  MtAR-  Mitochondrial Autonomously Replicating  mtDNA  Mitochondrial D N A  MtIS-  Mitochondrial Insertion Sequence  mtRNA  Mitochondrial R N A  mtRNA  Mitochondrial R N A  NADH  Nicotinamide Adenine Dinucleotide  RNA  Ribonucleic Acid  mRNA  Messenger R N A  rRNA  Ribosomal R N A  x  List of Abbreviations tRNA  Transfer R N A  xi  ACKNOWLEDGEMENT I would like to acknowledge all of the people at U B C who made my stay here enjoyable and productive. I thank the members of my supervisory committee, T. Grigliatti, T. Beatty and G. Spielgelman for their support and advice. I thank many people for technical help, including H . Brock, M . Decamillis, P. Durovic, D . Groden. and C. Myers. I thank my supervisor, A . J . F . Griffiths for his uncompromising faith and help. Finally I thank my friends and family without whose generosity and belief this thesis would not have been possible.  xi  INTRODUCTION , Although cultures of Neurospora are thought to be immortal, that is they can be subcultured indefinitely by asexual or sexual propagation, certain strains from the Hawaiian islands show a peculiar phenotype for this genus: senescence. Senescence is a process of clonal deterioration leading to death, and is readily studied in members of the filamentous fungi, including Neurospora, Podospora, and Aspergillus. In these organisms senescence is characterized aberrations  including DNA alterations  and cytochrome  by mitochondrial  deficiencies. In N. intermedia, the  predisposition to senescence among wild isolates from the island of Kauai is maternally inherited and has been called the [kalilo] cytoplasm. Senescence has been correlated with the presence of a mitochondrial, linear, double stranded, DNA plasmid in affected strains. Senescence in the fungi is a mitochondrial phenomenon and in the sections  to follow the phenomenon of mitochondrial  senescence among the fungi is reviewed, and background with respect to the experimental system is given. Finally, information is presented concerning the occurrence of linear and mitochondrial plasmids.  NEUROSPORA  REVIEW  Life cycle of Neurospora  Ascomycete Growth Members of the Genus Neurospora, Kingdom Fungi, Class Ascomycetes, are members of the filamentous fungi. They have a mycelial growth form, in which distinct cellular organization does not occur, but instead the hyphal compartments are multinucleate, and the mycelium represents a fairly continuous bag of cytoplasm which is delineated by pored septa, rather than by discrete cell walls.  1  Introduction Growth of these organisms occurs by the concerted movement of cytoplasm from more distal regions of the hypha to the growth front, or growing tip. Another aspect of growth is the dense branching that hyphae undergo. Adding to the heterogeneity inherent in this organism is the phenomenon whereby the hyphae of species of filamentous fungi will readily fuse when they encounter one another. Ability to fuse is under the control of heterokaryon incompatibility loci. The form of cellular organization whereby many nuclei direct the synthesis of a common cytoplasm is termed coenocytic; it is relatively rare, but can be found in diverse organisms and cell types such as true slime molds, insect blastoderm, and muscle cells. The Ascomycetes are distinguished by the ascus, a. bag which contains the four products of meiosis, or ascospores. In the genus Neurospora, the ascospores are held in a linear conformation corresponding to the actual meiotic division which gave rise to them. This is the case in Neurospora tetrasperma, while in N. crassa, N. intermedia, and N. sitophila the four products of meiosis undergo an extra mitotic division and the ascus contains eight ascospores.  Asexual Propagation A diagram of the life cycle of Neurospora is shown in figure 1. The Ascomycetes are haploid fungi with both asexual and sexual propagation (for a review, see Beadle, 1945). The asexual developmental cycle consists of dispersal by asexual spores called conidia. Haploid hyphae grow until the organism has formed a dense mycelial mat, and then the organism begins to differentiate into aerial hyphae. Conidia, which are typically multinucleate macroconidia, although uninucleate microconidia do exist, are formed in long branched chains atop the aerial hyphae. Conidia differentiate by becoming highly pigmented during maturation; the pigments are orange or red carotenoids. Conidia are designed for dispersal by air, and conidia easily become airborne and when  2  Introduction they alight upon a suitable media, they are capable of germinating  and beginning the mycelial  growth phase anew.  Sexual Propagation N. crassa, N. intermedia, and TV. sitophila are heterothallic species, and the sexual cycle requires the presence of two mating types, designated A and a, that are determined by codominant alleles of the mating type gene. The mating type gene also acts as an incompatibility gene: thus hyphae of different mating type cannot fuse, they must undergo meiosis. The mating process occurs when either parent, on suitable medium, acts as a female parent and differentiates a structure called a protoperithecium, an immature fruiting body. It consists of a densely coiled mass of hyphae around ascogenous hyphae destined to undergo meiosis. Each ascogenous hyphae produces a trichogyne, which is a long hypha that is capable of fusing with a fertilizing cell of opposite mating type. The fertilizing cell can be. a conidium, or another hypha. Upon fusion, only the nucleus of the fertilizing cell is enveloped and transported down the trichogyne to the ascogenous hyphae. The paternal and maternal  nuclei undergo a small number of mitotic  divisions, while the  protoperithecium  differentiates into a perithecium, a mature fruiting body. Nuclear fusion and karyogamy are followed ~>  immediately by meiosis. Ascospores undergo complete morphogenesis to become ovate, quiescent cells, blackened with melanin, and resistant to many forms of environmental insult. Indeed, germination of ascospores requires a heat shock of 60° C. Upon germination, the mycelial mode of growth is restored.  3  Introduction Figure 1. Life Cycle of Neurospora Showing Both the Sexual and Asexual Cycles.  From Fincham et al, (1979).  aseogcnous hypha  4  Introduction  Laboratory Propagation N. crassa chromosomes,  Neurospora,  and  is a classical research most,  standard  o r g a n i s m a n d it is well defined genetically. It has  genetic  and  molecular  procedures  can  be  performed  seven with  i n c l u d i n g t r a n s f o r m a t i o n , tetrad analysis, reciprocal crosses, and chromosome m a p p i n g  via the O F A G E technique. It resembles most organisms i n that the c y t o p l a s m is strictly m a t e r n a l l y inherited. It is easily c u l t u r e d a n d grows on simple defined m e d i a consisting of v i t a m i n s , minerals and a carbon source, a n d supplements as required.  Neurospora  mates readily o n a defined m e d i a low  in nitrogen. V a s t collections of n a t u r a l isolates of  Neurospora  have been o b t a i n e d , p r o v i d i n g m a n y  opportunities to s t u d y differences between these a n d s t a n d a r d laboratory stocks. F i n a l l y , it is easily m a n i p u l a t e d u s i n g s t a n d a r d , microbiological techniques, although a few procedures are u n i q u e to  Neurospora. 500 m m race tubes allow the d e t e r m i n a t i o n of the linear h y p h a l growth rate. T h e organism is inoculated at one end of the tube, and daily measurements  are made on how far the fungus has  grown in that t i m e . T y p i c a l l y , it takes five days for a w i l d - t y p e strain of  Neurospora  to grow to the  end of a race tube, while an a b n o r m a l strain can take m u c h longer, or fail to grow the full length of the growth tube. T h e p h e n o m e n o n of stop-start g r o w t h is seen in the growth tube as well, whereby a culture can 'stall' for a few days and then resume a w i l d - t y p e growth rate. Serial s u b c u l t u r i n g was identified b y G r i f f i t h s and B e r t r a n d (1984) as an efficient way to identify natural.isolat.es t h a t h a d growth aberrations, however the development, of senescence b y the serial s u b c u l t u r e m e t h o d does not exactly parallel t h a t in a continuously growing culture. R a t h e r , it seems as t h o u g h the act of conidial germination or some  aspect of development  has  i n d u c e d senescence (Griffiths et al, 1986).  5  an e n h a n c i n g effect  on the expression  of kalilo  Introduction Mitochondria] D N A  Mitochondrial Genetics Neurospora represents an excellent organism for the study of mitochondrial biology. The mitochondrion is the site of oxidative  phosphorylation in almost  all eukaryotes,  and the  mitochondrion contains its own genetic information. However, mitochondria are not autonomous and biogenesis of mitochondria requires the concerted action of nuclear and mitochondrial genes, as the set of mitochondrial genes is incomplete. The circular mtDNA of Neurospora crassa is approximately 60 kb long, and it encodes two rRNAs, 27 tRNAs and the protein sequences for approximately 13 proteins. Most proteins are involved in the electron transport pathway and include apocytochrome b (cob), ATPase subunits, and cytochrome oxidase subunits I, II, and III (CO I, II, and III, respectively) (Reviewed by Nelson and Macino, 1985; Breitenberger and RajBhandary, 1985), and the genes for NADH dehydrogenase subunits (Nelson and Macino, 1987). This organization is standard for all of the well studied mitochondrial systems, even though the size of the mtDNA varies widely, from 16 kb for most mammalian systems (Brown et al, 1981), to as much as 2500 kb in some plants (Bendich, 1982). The genetic system in mitochondria differs from the universal genetic code. An interesting adaptation is that the codons are read differently in the mitochondrion, so that in the case of Neurospora, 25 unique tRNAs can read all the 64 possible codons of the triplet genetic code. The mechanism of this adaptation is by the use of uracil in the anticodons, which can pair with all the other bases. This reduces the number of anticodons needed to read all possible codons. Another difference, is that the genetic code is altered in mitochondria. These changes are species specific, but in Neurospora, the only change is that the stop codon, T G A , is read as tryptophan. (Reviewed by Breitenberger and RajBhandary, 1985).  6  Introduction Other Mitochondrial DNAs Many different types of supernumary DNAs in mitochondria have been identified. It has been suggested that these DNA species fall into two distinct groups (Nargang, 1985). The so-called defective DNAs consist of excised, or altered regions of the wild-type mtDNA molecule which have undergone suppressive overreplication compared to the wild-type molecule, and generally lead to a growth aberration in the organism which harbours them. These will be reviewed more fully in the section on Growth Aberration. The second group contain the "true" mitochondrial plasmids. They are autonomously replicating, or appear to be, and have little or no homology to the mitochondrial or nuclear DNA of their host. In striking contrast to the first group, virtually none of the true plasmids can be associated in any way with a phenotype in the organism which harbours it. While many organisms harbour mitochondrial plasmids, only the mitochondrial plasmids of Neurospora are to be reviewed here. The kalilo plasmid is one of a number of linear mitochondrial plasmids that have now been identified. At least three linear double stranded DNA plasmids are now known. In addition to kalilo there are maranhar and zhisi. Maranhar, a 7 kb plasmid with .7 kb terminally inverted repeats (TIRs), was found in a N. crassa strain from India which shows the same growth aberrations and phenotype as kalilo, although the two plasmids show no homology at the nucleotide level (Bertrand and Griffiths, pers. comm.). Zhisi is a plasmid from a Chinese strain of TV. intermedia which has similarities to the other two (Griffiths and Bertrand, pers. comm.). While mitochondrial plasmids in Neurospora are quite common, these three are representative of the linear senescence plasmids of Neurospora. There is also a number of circular DNA plasmids associated with the mitochondrion of Neurospora species. These plasmids, although they were discovered in different geographical isolates and different species of Neurospora, fall into three homology groups. The Fiji plasmids are a group of  7  Introduction 5 kb circular dsDNA plasmids which all show homology to a prototype 5 kb plasmid from a N. intermedia strain from Fiji (Stohl et al, 1982). There are several strains of Neurospora which have plasmids with homology to the Fiji plasmid, most notably some N. tetrasperma strains from Hawaii (Natvig ct al, 1984) and a group of TV. crassa strains from Louisiana (Taylor et al, 1985). A second circular plasmid, of 4.1 kb, has been found only in a N. intermedia strain from Labelle, Florida (Stohl  et al, 1984). A third  Neurospora mitochondrial  plasmid homology  group  is the  Mauriceville/Varkud plasmids. Despite the fact that the Mauriceville plasmid was discovered in an N. crassa species, from Mauricevelle, Texas (Collins et al, 1981), and the Varkud plasmid is from a N. intermedia species from India (Lambowitz et al, 1986), these two plasmids show over 97% sequence and positional identity (Nargang et al, 1984; Lambowitz et al, 1986; Nargang, 1986). The occurrence of similar plasmids in many different species of fungi may imply that the plasmids predate the speciation of organisms, however evidence suggests that the plasmids were inherited independently of the mtDNA (Taylor et al, 1985). The idea that the plasmids may be related to mobile elements has been supported by the sequence, and transcriptional analysis of these plasmids, which has yielded some surprising results. The Fiji plasmid group has never been found to be transcribed, and has not been studied further, however both the Labelle. and the Mauriceville/Varkud plasmids are transcribed, and they have been sequenced. Both plasmid groups contain long ORFs and their sequences resemble mitochondrial introns, although they do not resemble one another. The Labelle plasmid has a long ORF which resembles the ORFs of mitochondrial class II introns (these will be described in the Transcription and Processing section), but the transcriptional properties are unclear and the occurrence of a full length transcript is not a certainty (Nargang et al, 1984; Nargang, 1986; Pande et al, 1989). Therefore it is not possible to determine if the Labelle plasmid is maintained by a reverse  8  Introduction transcription step, however the transcriptional properties of the Mauriceville/Varkud plasmids have been studied in detail. The Mauriceville/Varkud plasmids have sequences  that are strongly reminiscent of  mitochondrial class I introns, and they both encode a 710 aa ORF which shows homology to reverse transcriptases. Both plasmids give rise to full-length transcripts (Nargang et al, 1984; Nargang, 1986; Lambowitz et al, 1986), and both have been shown to contain a reverse transcriptase activity that is not present in closely related Neurospora strains without the plasmids (Kuiper and Lambowitz, 1989). The idea that the plasmids replicate by reverse transcription has also been supported by the observation that mutants of plasmid-containing strains have been found to contain altered mtDNAs and altered plasmids that could only have arisen by reverse transcription of an altered RNA (Akins et al, 1986; Akins et al, 1989). Interestingly, the rearrangements that were found in the mutant plasmids suggested the presence of an RNA ligase activity in the. plasmid containing strains (Akins ei al, 1986). That this was indeed possible was supported by the surprise discovery that a major transcript of the Varkud plasmid, which had previously been identified as a longer than full length transcript,  actually was a hybrid message generated  by a trans-splicing event between the  mitochondrial small rRNA and a full length transcript of the plasmid (Akins et al, 1988). A rigorous investigation of mutant forms of the plasmid has yielded the identification of a tRNA like structure at the origin of the plasmids which may be important for priming of reverse transcription (Akins et. al, 1989), which is another strong piece of evidence that these plasmids are indeed circular retroposons, or mobile introns.  Transcription and Processing The N. crassa mitochondrial genome is transcribed from a limited set of promoters into long multicistronic messages which are then highly processed down to mRNAs, and all known genes are  9  Introduction transcribed from the same strand of DNA (Green et al, 1981; Breitenberger et al, 1985; Burger et al, 1985). This is characteristic of mitochondrial transcription in general. A promoter has been identified for  the  cob and  rRNA  transcription  units,  and  it  has  the  consensus  sequence  T T A G A R A ( T / G ) G ( T / G ) A R T R R (Kennel and Lambowitz, 1989). It is not known if there are other sequences which can function as promoters in Neurospora mtDNA. tRNA sequences punctuate some of the mitochondrial genes, and it has been shown that excision of the tRNA sequences is often all that is required for the generation of a mature message (Breitenberger et al, 1985; Burger et al, 1985). However many genes contain introns and multiple introns and in many cases secondary processing events are necessary to generate functional mRNAs and rRNAs. Interestingly, The intron of the 25S rRNA gene in N. crassa has been found to encode the mitochondrial ribosomal protein S5 (Burke and RajBhandary, 1982). It is into this reading frame that kaiilo is found inserted in prototype senescence strain P561 (Bertrand et al, 1985). Mitochondrial introns are well-studied and many interesting observations have been made on their splicing. Mitochondrial introns fall into two classes, class' I and class II, which are distinguished by conserved sequence motifs. Class I introns are the most common and have highly conserved sequence elements which seem to be important for the formation of complex secondary structures that are required to bring the ends of the exons together for splicing. These introns are often found to be self splicing in vitro, while in vivo they probably require the action of a maturase protein. Class II introns are distinguished by a highly conserved sequence near the 3' end of the intron, and by the presence of long ORFs within them that show homology to reverse transcriptases (Davies et al, 1982; Michel et al, 1982; Cech, 1983; Michel and Dujon, 1983; Waring et al, 1983; Garriga and Lambowitz, 1984; Michel and Lang, 1985). While class I introns resemble introns such as the self-splicing intron of Tetrahymena rRNA (Kruger et al, 1982), and class II introns may share functions with nuclear pre mRNA introns such as lariat formation (VanderVeen et al, 1986; Padgett et al, 1984),  10  Introduction mitochondrial introns are distinguished from other introns in general by the presence of the ORFs within them. As an example of this, the maturase of some class I introns is found to be encoded by another intron—often in the same gene and in-frame with the preceding exon, so that it can only be expressed as a. fusion peptide prior to splicing of its own coding sequence (Burke et al, 1984; Jacq et al, 1984). Another intron-encoded phenomenon is the ui intron in the 24S rRNA of Saccharomyces. This is an optional intron in the yeasts, however, in crosses between strains heterozygous for the intron (with and without the intron, w"^ and uf, respectively), only u)~*~ are recovered. This unidirectional gene conversion event could not be explained by conventional mitochondrial crosses and recombination. Subsequently, the ORF of this intron was found to encode a restriction endonuclease which is capable of introducing a double stranded cut in the uf chromosome, and is thought to be responsible for the unidirectional gene conversion event seen in crosses (Jacquier and Dujon, 1985). The presence of reverse transcriptase-like  proteins encoded within introns, and the  observation of such phenomena as the u> intron has led to the speculation that mitochondrial introns may be somehow related to mobile elements (Reviewed by Dujon et al, 1986). This hypothesis is supported by the discovery of mitochondrial plasmids which resemble mobile introns (Nargang et al, 1984; Akins et al, 1986; Pande et al, 1989), and the presence of other mobile insertion sequences in mitochondria such as the kalilo plasmid.  GROWTH ABERRATION  IN FUNGI  Manifestations of Senescence Mitochondrial-based growth aberrations have been researched in the fungi as a model for senescence and as probes of mitochondrial function. Growth aberrations can be identified as those  11  Introduction affecting the g r o w t h rate, longevity of an o r g a n i s m , and in the fungi, colony size. T h e y have f o u n d in yeasts,  Neurospora crassa, N. intermedia, Podospora anserina,  and  been  Aspergillus nidulans.  W i l d - t y p e cultures of some of these organisms are considered to be i m m o r t a l , however m u t a n t s are k n o w n w h i c h have a l i m i t e d life span ( B e r t r a n d organisms  can  be  assayed  as  colony  size  and Pittenger,  or  by  serial  1969). T h e longevity of these simple  subculturing.  Mutations  which  cause  m i t o c h o n d r i a l growth aberrations can be nuclear as well as cytoplasmic, however o n l y m i t o c h o n d r i a l mutations  are reviewed here. T h e r e are some basic differences in the way i n w h i c h m i t o c h o n d r i a !  defects affect different organisms. F o r instance, the yeasts can exist w i t h n o m t D N A whatsoever, b y reverting  to  anaerobic  respiration,  while  filamentous  m i t o c h o n d r i a l insults result in death for these organisms. mitochondrial-based  senescence  T h e r e appear  ragged  are  obligate  aerobes,  in the yeasts, merely the slow growth phenotypes, or  m u t a t i o n of  to the m t D N A ,  and  petites. One  usually a deletion. In this group are the  Aspergillus, poky  of  severe  C o n s e q u e n t l y there are no true cases of  to be two types of insult to the m t D N A s in these organisms.  consists of a classic m u t a t i o n yeast, the  fungi  Neurospora,  group  petites  of  etc. T h e second group, of w h i c h kaiilo  is an example, also suffer f r o m rearrangements of the m t D N A , but in these organisms e x t r a D N A is associated  with  the  senescence event, or  rather  an  apparently  programmed  event occurs which  causes extraneous D N A s to interact with the m i t o c h o n d r i a l genome. F o r example, in s e n D N A s are p r o g r a m m e d for excision and replication, and in  Neurospora,  Podospora,  the  the plasmids kaiilo and  m a r a n h a r are k n o w n to insert into a n d alter the m t D N A . In a facultative anaerobe such as a yeast, severe m i t o c h o n d r i a l defects do not lead to death of the o r g a n i s m , rather, they lead to slow growth phenotypes  called  petites,  the  a reference to  colony size. M i t o c h o n d r i a l m a l f u n c t i o n in the filamentous fungi, however, leads to a relatively welld o c u m e n t e d p h e n o m e n o n termed senescence. F i g u r e 2 is a representation in  Neurospora  as it ages, and it is fairly representative of  12  Podospora  of the changes t h a t and  Aspergillus  occur  as well. T h e  Introduction first manifestation of a growth aberration is the loss of female fertility, or the ability to form perithecia (Bertrand et al, 1968; Bertrand and Pittenger, 1969; Reick et al, 1982). In many organisms, including Podospora, the next step is the destruction of the respiratory chain, highlighted by the loss of cytochromes aag and b, and the concomitant rise, in cytochrome c (Bertrand and Pittenger, 1969; Belcour and Begel, 1978; Cummings et al, 1979a; Bertrand et al, 1985; Myers, 1988). Subsequently, complex changes begin to occur, including loss of conidia and the production of melanin like pigments (Munkres and Minssen, 1976). That changes are occurring at the growth front is suggested by the observations that in Podospora, hyphal tips are seen to swell and burst (Rizet, 1953), and in Aspergillus, the mutation ragged refers to the morphological appearance of the growth front (Jinks, 1956).  13  Introduction  Figure 2. Diagrammatic Representation of the Succession of Degenerative Events Associated with Aging and Senescence in Neurospora.  Growth is represented by a solid line, declining growth by a dashed line. From Bertrand  (1983).  14  SI  rAscospore  C <  n z r  0  n •  fertility loss  0)I-Respiratory PI  z n n z  defects  |-Pigment ^Conidia lost •-Death  Introduction  Occurrence of m t D N A mutation T h e average yeast cell is t h o u g h t t o contain about 50 copies of the m t D N A 1978b). In an actively growing filamentous fungus, w h i c h does not contain number  m a y be even  larger.  T h e question t h e n  especially those causing growth aberrations?  arises,  ( B i r k y et al,  true cell walls, this  how do m i t o c h o n d r i a l m u t a t i o n s  arise,  T h e chance of fixation of a deleterious m i t o c h o n d r i a l  m u t a t i o n in a filamentous fungus b y p u r e l y stochastic means must be fantastically low. It is for this reason that, i n almost all the examples w h i c h follow, a p h e n o m e n o n termed "suppressiveness" has been i n v o k e d t o explain the expression of deleterious m u t a t i o n s ( F a y e et al, 1973; B e r t r a n d  et al,  1980, 1985; D e V r i e s et al, 1981; C u m m i n g s et al, 1979b; T u d z y n s k i et al, 1980; J a m e t - V i e r n y et al, 1980; L a z a r u s become  et al, 1980; Lazarus a n d K i i n t z e l 1981). T h e m e c h a n i s m by w h i c h altered  fixed in a p o p u l a t i o n has not been  discovered, a n d n o hypothesis  mtDNAs  w h i c h is completely  compatible w i t h the experimental evidence has been p u t forward to explain the p h e n o m e n o n . In short, the p h e n o m e n o n suggests t h a t some k i n d s of altered m t D N A s , or indeed a n y k i n d of altered mtDNA  are able to out-replicate  the wild  type  molecule, or suppress  the w i l d - t y p e molecules'  replication, or to have some sort of advantage in p a r t i t i o n i n g of m t D N A s at cell division. Somehow, the altered m t D N A s come t o p r e d o m i n a t e in the c y t o p l a s m . W h i l e a. m e c h a n i s m for this is easily envisioned for a deviant m t D N A t h a t consists of m u l t i p l e copies of the origin of replication, it is more difficult t o invoke a m o d e l w h i c h w o u l d recognize a m t D N A w i t h a single base pair change as in the case of the mi-3 m u t a t i o n of molecules  have  been  found  to  N. crassa  be  (Lemire a n d N a r g a n g , 1986); b o t h of these types of  suppressive  over  their  wild-type  counterparts.  Although  m a t h e m a t i c a l models can show that even molecules w i t h small replicative superiorities can become fixed over time  ( D . V i c k e r y , u n p u b l i s h e d observations;  Birky  et al, 1978a), the m e c h a n i s m t h a t  w o u l d recognize s u c h molecules remains u n k n o w n . A n i d e a that has been presented recently suggests t h a t local a c c u m u l a t i o n of defective m t D N A s is the event required to affect m i t o c h o n d r i a l f u n c t i o n  16  . Introduction and that, mitochondria with impaired respiratory pathways undergo renegade multiplication, with the concomitant amplification of the defective genome which the organelle harbours (Bertrand and Griffiths, 1989). How non-deleterious mitochondrial mutations arise in general, given that the number of wild-type copies is so high, has been researched in some detail. Experiments were designed to test the following six hypothetical mechanisms for their ability to fix a mitochondrial drug resistance marker: random partitioning of mitochondrial genomes at cell division; intracellular selection for mtDNA molecules of one genotype; intracellular random drift of mitochondrial allele frequencies; intercellular selection for cells of a particular mitochondrial genotype; induction of mitochondrial gene mutations by the antibiotic used to select mutants; and reduction in the number of mitochondrial genomes per cell by the antibiotic. These Luria-Delbruk type experiments showed that intracellular selection of mtDNA molecules played a major role in the presence of selective pressure, but that random drift and random partitioning also played minor roles in fixing the marker (Backer and Birky, 1985; Dujon et al, 1976). Random drift, and random partitioning have been shown to occur at higher than random rates in yeast mitochondria (Birky et al, 1981; Birky, 1973), so some processes may be occurring to help fix mutations. However, these results of course do not explain why detrimental mutations are so easily fixed. The system which is most amenable to the study of suppressiveness has been in the cytoplasmic petite mutations of yeast, and two hypotheses to explain the phenomenon have been put forward. These are the destructive recombination model, and the out-replication model. The explanation of these models fits properly in the context of the background on the petite mutation of Saccharornyces.  17  Introduction Petite Mutations of Saccharomyces cerevisiae Cytoplasmic petite mutations (Ephrussi et al, 1949) arise spontaneously at 1% per generation from actively growing cultures of Saccharomyces cerevisiae. Genetic studies identified a cytoplasmic, genetic factor called p that was present in wild-type (p+), but that seemed to be altered (p-), or missing (p°) in crosses (Sherman, 1963). The p factor has since, been identified to be the mtDNA (Mounolou et al, 1966), aiid p- mutants have mtDNAs with deletions (Nagley and Linnane, 1972; Hollenberg et al, 1972; Faye et al, 1973). p° mutants have no mtDNA at all. In yeast, petite mtDNAs often exist as tandem (Faye et al, 1973) or as palindromic (Locker et al, 1974) repeats, if the deletions are large. The deletions which give rise to petite mtDNAs span the entire mtDNA, so no specific region is involved (see Dujon, 1981). Although any mtDNA deletion can give rise to a petite, they are nonetheless distinguished by their behaviour in crosses. Every petite has a characteristic suppressiveness in crosses with p+. Organelle heredity is biparental in Saccharomyces, so a p-f by p- cross creates a heteroplasmic zygote, with an equal complement of p+ and p- molecules. Output ratios are far from equal however, and depend on the suppressiveness of the petite (Ephrussi and Grandcha.mp, 1965). Hypersuppressive petites are known which give rise to 100% p- progeny (Goursot et al, 1980). Neutral petites, or p°, always give rise to grande progeny, because they are entirely unsuppressive (Moustacchi, 1972). Two mechanisms have been invoked to account for these observations. The out-replication model is the most popular, and is based on a replicative advantage for the p- molecules (Slonmiski et al, 1968; Rank, 1970a; 1970b; Rank and Bech-Hansen, 1972; Carnevali and Leone, 1981). The highly suppressive molecules would have retained an origin of replication, and its multiple duplication causes the replicative superiority. This model is supported by genetic data (Gingold, 1981), and the observation that some hypersuppressive petites contain short reiterations of a sequence which resembles an origin of replication (DeZamaroczy et al, 1979). However a direct  18  Introduction study of the relative rates of DNA synthesis in p+ by p- crosses has suggested that only the most suppressive petites have a faster rate, of DNA synthesis, and some non-suppressive petites also seem to have elevated rates of DNA synthesis (Chambers and Gingold, 1986). Further, the requirement for an origin of replication in the amplified sequence may not. always be met. Therefore the possibility remains that the destructive recombination model may also play a role in the phenomenon. The key idea in this model is that the presence of a p- molecule can cause crossovers which lead to the destruction of the wild type DNA (Coen et al, 1970; Michaelis et al, 1973; Deutsch et al, 1974; Perlman and Birky, 1974). Crossovers between mtDNAs of Saccharomyces are well documented (for a review, see Dujon, 1981), and N. crassa mtDNA is also known to undergo recombination in heteroplasmons (Mannella and Lambowitz, 1978), therefore the recombinant machinery necessary for this model is available, but the model does not account for all observations. The actual process which is occurring to cause suppressive behaviour may be a combination of mechanisms. For instance, one possibility is that as has been suggested for N. intermedia, mitochondria that have a high proportion of defective molecules may undergo renegade replication, so selection is at the organelle level, not the DNA level (Bertrand and Griffiths, 1989). At any rate, suppressiveness of altered mtDNAs seems to be a general phenomenon, rather than a specific one.  The ragged mutation of Aspergillus  amstelodamii  A. amstelodamii was found to have a cytoplasmically inherited growth aberration that caused death of hyphal tips ("ragged" colony morphology; Jinks, 1956). The site of the lesion is the mtDNA, and it is found as a heterogeneous mixture of a tandemly repeated element and a full copy of the wild  type  mtDNA  (Lazarus  et al, 1980).  This  situation  is analogous  to the  deletion/duplication seen in the petites, except for the presence of a normal copy of mtDNA; presumably this molecule is lost as the culture ages. Analysis of mtDNA from a number of  19  Introduction  ragged  spontaneous One  m u t a t i o n s has yielded regions of the m t D N A t h a t are retained i n the m u t a t i o n s .  region of the m t D N A  mutations.  It  is postulated  d u p l i c a t e d bestows presence of  is f o u n d to  i n the t a n d e m l y  contain  a mtDNA  a great replicative advantage  ragged  repeated  fragment  origin of replication  on the aberrant  of almost which  all ragged  when  ragged m t D N A s .  tandemly  However, the  m t D N A s w h i c h d o not contain this sequence a n d instead are f o u n d to have a  different region of the m t D N A amplified ( L a z a r u s a n d K i i n t z e l , 1981) suggests that the m e c h a n i s m of over replication of aberrant  m t D N A s m a y be a more general one, as has been suggested for the  petites.  Senescence in Podospora The ascomycete  anserina  p h e n o m e n o n of p r o g r a m m e d  Podospora anserina.  senescence has been  Historically,  P. anserina  s t u d i e d most was  shown  thoroughly in the  to  be  incapable  of  u n i n t e r r u p t e d growth, a n d instead changes i n m y c e l i a l m o r p h o l o g y a n d the p r o d u c t i o n of pigments preceded  cellular  death  senescence was found  in the o r g a n i s m  to be heritable,  (Rizet,  a n d further,  1953;  Marcou,  1961).  T h e predisposition  t h a t the state of senescence was maternally  inherited: a juvenile female parent gave rise to juvenile progeny, while a senescent, female gave, rise to mixtures  of senescent a n d juvenile progeny  d e t e r m i n i n g factors were f o u n d to be heterogeneous  to  (Rizet,  parent  1957; M a r c o u , 1961)..Senescence  ( M a r c o u , 1961), a n d independent of nuclear  markers i n crosses ( M a r c o u a n d S c h e c r o u n , 1959). In an exhaustive s t u d y of the genetics of aging, all strains or races of  Podospora  were f o u n d to have a distinctive lifespan, the cytoplasmic nature of the  particle was s h o w n b y its transmission w i t h o u t nuclear m i g r a t i o n , a n d it was postulated t h a t  a  "longevity c h a r a c t e r " would be f o u n d to exist ( M a r c o u , 1961). The  m i t o c h o n d r i a l location  of the senescence  genotype  was suspected  because  of the  m i t o c h o n d r i a l location of m u t a t i o n s that h a d a m o d i f y i n g effect on longevity (Belcour a n d Begel,  20  Introduction 1978), and this led to the discovery of senDNAs. These are small DNA plasmids which were found in the mitochondria of senescent mycelia in place of the 94 kb wild type mtDNA (Stahl et al, 1978; Cummings et al, 1979a; 1979b). Also, it was shown that the wild type mtDNAs of juvenile cultures of races with similar lifespans were closely related and correlated with longevity (Cummings ei al, 1979a). This led to the suggestion that the phenomenon of senescence in Podospora was a special case of the petrte phenotype of Saccharomyces in an organism which was an obligate aerobe (Cummings et al, 1979b). At the. same time, an interesting body of work was being assembled on the ability of nuclear genotype to influence lifespan. The action of many of these genes seems to be to delay the onset of senescence. The most interesting observation is that the genes involved affect colony morphology, and their action upon the mitochondrial genome is unknown. A certain colony morphology double mutant, • incoloris vivax, is able to prevent senescence, even when senescent mitochondria are microinjected into a strain carrying the mutation (Esser and Tudzynski, 1979). The molecular nature of the suppression has not been investigated, but these results indicate that the action of nuclear genotype cannot be ignored in any discussion of mitochondrial growth aberration. Five different families of senDNAs, based on restriction properties, have been identified from different races of Podospora. The are designated a, (3, ^ , b, and ©. otsenDNA, the most common one, is always found as an exact molecule of 2.6 kb, and is isolated from the two shortest lived races of Podospora, race A and race s (Stahl et al, 1978; Cummings et al, 1980; Jamet-Vierny et al, 1980; Wright et al, 1982). senDNAs were subsequently cloned (Stahl et al, 1980), and it has been shown that they are derived from mtDNA (Kiick et al, 1981) and that they are senescent determinants (Vierny et al, 1982). The structure of senDNAs has been found to be similar to that of petites, in that the remaining portion of the mtDNA is often arranged in tandem repeats (Belcour et al, 1981; Cummings and Wright, 1983). As in the case of hypersuppressive petites, senDNAs have been  21  Introduction postulated  t o contain  an A R S , w h i c h allows t h e m  t o out-replicate  the m t D N A  C u m m i n g s , 1982). F i g u r e 3 shows the regions of the m i t o c h o n d r i a l chromosome of  (Lazdins and  P. ansenna  which  give rise to s e n D N A s of each type. In  contrast  t o the Saccharomyces system  where  any segment  of m t D N A  can  become  amplified, only the five regions s h o w n i n figure 3 can give rise to the senescent p h e n o t y p e in P.  ansenna.  W h i l e the locations of the various s e n D N A s were k n o w n , the surprise result f r o m the s t u d y  of this s y s t e m has been the discovery t h a t a - s e n D N A corresponds group II i n t r o n of the C O I gene of  P. ansenna  exactly t o the m i t o c h o n d r i a l  (Osiewacz a n d Esser, 1984). T h e reader is r e m i n d e d  that m i t o c h o n d r i a l class II introns contain O R F s w h i c h encode proteins w i t h homologies to v i r a l reverse transcriptases,  a n d the i n t r o n of  P. ansenna  events i n c l u d e class I or class II i n t r o n sequences  is n o exception.  Indeed all of the s e n D N A  ( C u m m i n g s et al, 1985; M i c h e l a n d C u m m i n g s ,  1985), but. o n l y the a s e n D N A is an exact i n t r o n w h i c h has n o h o m o l o g y t o the m a t u r e transcript of the region  ( K i i c k et al, 1985a). T h e question that t h e n arises is exactly what is the relationship  between the s e n D N A s a n d the i n t r o n sequences. B o t h a s e n D N A a n d p s e n D N A long-life m u t a n t s are rearranged or deleted for intron sequences ( K i i c k et al, 1985a: Belcour a n d V i e r n y , 1986; K o l l et al, 1985), suggesting that sequences in the regions are required for a m p l i f i c a t i o n / e x c i s i o n . However, it is not. k n o w n whether the s e n D N A is generated f r o m the precise excision of the D N A i n t r o n , and its subsequent a m p l i f i c a t i o n , or whether s e n D N A s arise b y reverse t r a n s c r i p t i o n of the excised intron of the C O I gene. transcription  E v i d e n c e seems t o suggest that at least some stage of the process is a reverse  step.  There  is reverse  transcriptase  activity  in  Podospora  senescent  mycelia  of  O i s e n D N A strains  (Steinhilber a n d C u m m i n g s , 1986), a n d a full length transcript  w h i c h m a y be  circular is present  at h i g h levels i n senescent mycelia, p r o v i d i n g the necessary template for reverse  t r a n s c r i p t i o n ( K i i c k et al, 1985a). However, the presence of m i t o c h o n d r i a l m u t a n t s w h i c h have lost  22  Introduction the intron seems to suggest that removal of the intron occurs at the DNA level (Belcour and Vierny, 1986).  23  Introduction Figure 3. Composite M a p of the Podospora anserina Mitochondria] Chromosome Showing Events Which Give Rise to senDNAs  I-Restnction map from Wright et al (1982). II-Genes: COB for cytochrome b; C O l , C02, and C03 for subunits 1, 2, and 3 of cytochrome oxidase; A6, A8 and A9 for subunits 6, 8, and 9 of the mt-ATPase; rRNAG and rRNAp for large and small rRNAs; URF1 for a subunit of NADH dehydrogenase; ? for a still unknown gene; ! for tRNAs. White parts of genes marked by I are intronic sequences. III-Sequenced regions. IV-Positions of senDNAs. From Belcour et al (1986).  EcoRl  Ha«m  6b  21 IK.1«HVfl'°HH'H  '  5  cob  col  f  12  l«E3 AS  5  Ba  P.V'B  c o T AS  0  ia"K!5%j UHFt  AS  riRNAC  (Y) (0)  24  rRNAp  co3  Introduction The molecular mechanisms required for the excision of senDNA are beginning to be described. An 11 bp consensus sequence has been described which seems to be important for the excision of all of the senDNAs except otsenDNA, and the identification of a tRNA requirement in this region is reminiscent of the reverse transcription of the Neurospora Varkud plasmid (Turker et al, 1987a; Akms et al, 1989). That asenDNA production follows autoregulatory kinetics has been shown by the isolation of a temperature sensitive asenDNA, and senDNAs in general may be produced by the reverse transcription of RNA by the asenDNA-encoded reverse' transcriptase (Turker et al, 1987b). A (3senDNA has been found to encode a protein reminiscent of an ssDNA binding protein, and it has been suggested that senescence is a result of the over production of proteins which can interact with nucleic acid (Vierny-Jamet, 1988). It appears as though the senescence phenomenon in Podospora anserina may be a special case of the evolution of mitochondrial introns and mobile mitochondrial introns such as the Neurospora mitochondrial plasmids (Nargang et al, 1984; Akins et al, 1989; Pande et al, 1989), and further work should highlight the parallels between these systems. Yet it is apparent that the presence of the intron is not sufficient for the senescence process to occur. The asenDNA intron is not an optional intron of P. anserina, and is present in many different races which have never given rise to asenDNA (Kiick et al, 1985b). Further, the two races of P. anserina which give rise to otsenDNA, races A and s, differ only by other optional introns in the CO I gene, including another very similar group II intron. Although the second intron has not been found to give rise to a senDNA, it has been suggested that the second intron functions as a modifying sequence which is responsible for the two-fold difference in the lifespans of race A and race s. This information and the role that nuclear factors are playing (Esser and Tudzynski, 1979) must be considered when determining the role that senDNAs play in the phenomenon of senescence in Podospora anserina.  25  Introduction Mitochondrial Mutation in Neurospora The first cytoplasmic mutation of N. crassa to be identified was poky (Mitchell and Mitchell, 1952), and its discovery was quickly followed by the discovery of other cytoplasmic mutations such as mi-2 and mi-3 (Mitchell et al, 1953). Subsequently, the mitochondrion was found to be responsible for the phenotypes by microinjection experiments, and the mtDNA was suspected as the site of the lesion (Diacumakos et al, 1965). The next group of extranuclear mutants to be identified was the stopper group. These were spontaneously isolated by growing N. crassa continuously on specialized 500mm growth tubes for months at a time and cultures which demonstrated stopped or slowed growth were isolated as stoppers (Bertrand et al, 1968; Bertrand and Pittenger, 1969).The numerous mitochondrial mutants which were being identified at this time were found to belong to complementation groups based on phenotypic properties, behavior in heteroplasmons, and interaction with nuclear suppressors of mitochondrial mutations (Bertrand and Pittenger, 1972a; 1972b). These fell into four groups; groups I, II, and III are described below. The fourth group consists of a single mutation that is not a growth aberration, but that is resistant to cyanide (Bertrand et al, 1976).  Group I All group I mitochondrial mutants have similar phenotypes, including deficiencies in small ribosomal subunits (Rifkin and Luck, 1971), in  small rRNA (Neupert et al, 1971), and in  cytochromes aag and b (Haskins et al, 1953). The prototype member of the group I mutants is poky. All group I mutants are suppressed by a nuclear suppressor called /. These mutants have an initial growth lag which is replaced by near wild-type growth as a culture ages. All group I mutants are phenotypically normal in heteroplasmons with group III mutants, but not with group II mutants.  26  Introduction Lesions w h i c h give rise t o  pokys  seem v a r i e d , although all seem t o lead to deficiencies i n  small r R N A or s m a l l ribosomal s u b u n i t s ( C o l l i n s and B e r t r a n d , 1978; L a m b o w i t z et al, 1979; C o l l i n s  et al,  1980). In the identification o f six nuclear suppressors of  poky,  all were f o u n d t o p r o m o t e the  assembly of the missing ribosomes ( B e r t r a n d a n d K o h o u t , 1977; K o h o u t a n d B e r t r a n d , 1976). T h i s has led to the i d e a t h a t a l ! group I m u t a n t s rRNA,  affect  a n d t h a t all suppressors of group I m u t a n t s  a single process, or f u n c t i o n , perhaps the 19S affect small ribosomal s u b u n i t s , ( C o l l i n s a n d  B e r t r a n d , 1978). R e c e n t l y it has been shown that all  pokys,  regardless of their origin a n d in a d d i t i o n to a n y  other m u t a t i o n s they have, contain a 4 b p deletion near the 5' e n d of the 19S r R N A , a n d that this deletion causes an aberrant  19S r R N A to be synthesized w h i c h is 38-45 nucleotides shorter t h a n the  wild type ( A k i n s a n d L a m b o w i t z , 1984). A p p a r e n t l y this small deletion is enough t o cause these molecules' well d o c u m e n t e d suppressiveness over wild t y p e m t D N A . T h i s represents  an interesting  case of genetic d a t a (the identification of a c o m p l e m e n t a t i o n group) being shown to be correct in the face of conflicting molecular d a t a (group I m u t a n t s were originally f o u n d t o have m a n y molecular defects, w h i c h now appear secondary). T h e m e c h a n i s m of  poky  action has been hypothesized to be  the i m p a i r m e n t of transcription of the small r R N A , as the 4 b p deletion has been f o u n d to occur i n the promoter sequence for the 19S r R N A gene ( K e n n e l a n d L a m b o w i t z , 1989).  Group II G r o u p II m u t a n t s only group III m u t a n t s  l([mi-3}) and  are characterized  (Bertrand  m u t a t i o n in the  oxi-3  aag, a n d c o m p l e m e n t  completely. T h e y are suppressed completely b y the nuclear suppressor, su-  ( B e r t r a n d a n d Pittenger,  exn-5  b y deficiencies in cytochrome  et al,  1972a; 1972b). O n l y t w o members of this class are k n o w n :  1976). T h e molecular defect i n  gene ( L e m i r e and N a r g a n g , 1986).  27  mi-3  mi-3  has been identified as a missense  Introduction Group III The group III mutants are the stoppers. As their name suggests, they are distinguished by alternating periods of growth and no growth in 500 mm growth tubes. They are deficient in cytochromes aag and b, and they complement both group II and group I mutants (Bertrand and Pittenger, 1979a; 1979b). Again, the molecular lesions in various stoppers have been found to be varied, however all stoppers have been found to have deleted m t D N A s which retain a large region that includes the Eco R l - 1 , -4, and -6 fragments of the m t D N A . This region contains the r R N A genes and most of the t R N A s , and has been postulated to contain an origin of replication (Bertrand et al, 1980; Collins and Lambowitz, 1981; DeVries et al, 1981). The retained regions of the m t D N A s from a number of cytoplasmic mutants including stoppers are shown in figure 4.  28  Introduction Figure 4. Regions of the m t D N A Retained in Various Mitochondrial Mutants of Neurospora  Restriction cleavage map of N. crassa DNA is presented. The regions of the mtDNA retained in a number of cytoplasmic mutants are shown as dark lines. The N. crassa mtDNA restriction map for the enzymes Hind III, Eco R l , and Hinc II is shown. The cytoplasmic mutants are as follows: E-35 and [stp] are group III mutants (stoppers). 551 and Hl-10 are group I mutants (poky). The 19S and 25S rRNA genes are indicated, and tRNAs are shown as dots. From Collins and Lambowitz (1981).  E35  29  Introduction Stoppers often contain more than one type of mtDNA molecule. One mutant, \stp], has been found to contain two populations of mtDNAs, a 21 kb molecule that spans the region mentioned above, and a 43 kb molecule that is complementary to the rest of 65 kb mtDNA. During the stop phase of growth only the 21 kb molecule can be detected, however upon resumption of growth, the larger molecule appears, thus stopper growth has been described as the ebb and flow of the different mitochondrial types as a culture ages (Bertrand et al, 1980; Gross et al, 1984). If this is true, then it would appear as though molecules which are capable of generating group III mitochondrial mutants are not as highly suppressive as those that never allow the resurrection of the wild type mtDNA, or that they are more damaged and other DNA is retained to support growth. Two other stopper mutants have been studied extensively. The E-35 mutant contains two molecules with 4 and 20 kb deletions (DeVries et al, 1981), which seem to arise via a sequence specific event. The region that is deleted to form the molecule with the 4 kb deletion has been postulated to contain the gene for a subunit of NADH dehydrogenase in Neurospora mitochondria (DeVries et al, 1986). Another stopper, ER-3, has a mtDNA molecule with a 25 bp deletion which seems to occur via the same sequence specific mechanism as E-35 (Almasan and Mishra, 1988). Therefore the mechanism by which stoppers form may be a specific one in Neurospora. crassa.  SENESCENCE IN NEUROSPORA  INTERMEDIA  Mitochondrial D N A A survey of natural field isolates of Neurospora interme&ia from the Hawaiian islands by Reick et al, 1982 yielded five strains which were cytoplasmic variants, having cytochrome aag and b deficiencies, aberrant ribosome morphology and abnormal growth profiles in 500mm race tubes. Their striking phenotypic resemblance to the stopper cytoplasmic mutants of laboratory strains of N.  30  Introduction crassa (Bertrand et al, 1968; Bertrand and Pittenger, 1969) suggested the possibility that these were natural group III cytoplasmic mutants, and that, the cause of the abnormality was mtDNA rearrangements (Bertrand et al, 1980; De Vries et al, 1981; Gross et al, 1984; Infanger and Bertrand, 1986). A comparison of the mtDNAs from the TV. intermedia strains did indeed show differences in the restriction maps for aberrant and normal strains (Reick et al, 1982). The lack of paternal inheritance of the phenotype suggested the mtDNA as the site of the primary lesion in these natural cytoplasmic variants. Although only five of the Hawaiian strains were shown previously (Reick et al, 1982) to have an abnormal phenotype, subsequent use of the serial subculture technique showed that a high proportion of the natural isolates of TV. intermedia from the island of Kauai had a senescent phenotype, and could not be subcultured indefinitely. The phenotype was shown to be strictly maternally inherited, and it was shown that the Hawaiian phenotype differed somewhat from the classic stopper phenotype, in that juvenile cultures of a senescent strain, whether initiated from conidia or from an ascospore, were phenotypically normal. However, upon subculturing, these strains showed a. progressive loss of growth potential culminating in the death of affected strains. The process leading to the vegetative death of these organisms was termed senescence. The process was repeatable, in that duplicates of cultures initiated from a common culture always were capable of a defined number of subcultures before death. Further, it was shown that the changes occurring in the cytoplasm throughout this process are heritable, and that the progeny of a senescent parent had less growth potential than the progeny of a presenescent parent. During the changes, the cytoplasm was found to be heterogeneous for some undetermined determinate of senescence. The phenomenon of senescence among a high proportion of natural isolates of TV. intermedia from the island of Kauai was termed kalilo, a Hawaiian word meaning 'dying', and affected strains were termed kalilo strains (Griffiths and Bertrand, 1984).  31  Introduction The mitochondria] lesion in kaiilo strains was found to be the insertion of a foreign nucleotide sequence into the mtDNA, specifically into the intron of the 25S rRNA gene in prototype strain P561. The 8.6 kb transposon-like element was termed kalDNA and non-senescent strains of the fungus from the island of Kauai were not found to contain sequences which were homologous to the element. Mitochondrial chromosomes carrying the insert are thought to accumulate as a culture ages until aberrant mtDNAs dominate the cytoplasm. Sites of insertion of kalDNA were found to differ not only between senescent strains, but between senescent subcultures of individual strains. Therefore, the process which causes the accumulation of defective mtDNAs is not suspected to be unique to kaiilo senescence (Bertrand et al, 1985). This is the suppressive accumulation of defective mtDNAs seen in many experimental systems such as yeast petites (Faye et al, 1973; Locker et al, 1974), Neurospora (Bertrand et al, 1980; De Vries et al, 1981), and Aspergillus (Lazarus et al, 1980; Lazarus and Kiintzel, 1981).  The Linear Plasmid An 8.6 kb linear autonomously replicating plasmid was found to be the progenitor of the mtDNA insertion sequence in affected strains. The plasmid is structurally identical to the mitochondrial insertion sequence and was found to be present in high copy numbers in the cytoplasm of senescent and presenescent strains. The autonomous plasmid, like the disposition to senesence, was found to be strictly maternally inherited. It was suggested that the element was responsible for senescence because it was a mutator of mitochondrial genes, creating suppressive mtDNAs which could out-replicate wild-type mtDNA, and cause the death of affected strains. Although the plasmid was initially thought to be nuclear (Bertrand et al, 1986), it now appears as though the phenomenon is strictly mitochondrial (Myers et al, 1989). The inserted form of the  32  Introduction p l a s m i d has been designated m t l S - k a l D N A  ( B e r t r a n d et al, 1986), a n d the linear f o r m  has been  designated m t A R - k a l D N A ( M y e r s et al, 1989). A restriction m a p of k a l D N A is presented i n figure 5. Interestingly, studies on the transmission of kalilo d u r i n g sexual crosses have shown t h a t when a presenescent culture is used as a female parent i n a cross, the only f o r m of kalilo w h i c h is found  to be t r a n s m i t t e d is m t A R - k a l D N A ,  somatic  propagation  mtlS-kalDNA  of these cultures, inserts of kalilo  is never  seen  i n the progeny.  arise, a n d generally persist  During  until  death.  However, inserts are seen t h a t are not lethal, a n d instead seem to be replaced b y novel inserts t h a t persist u n t i l the death  of the organism.  integration of m t A R - k a l D N A seen, based  on the altered  It has been suggested  that inserts arise f r o m  de novo  into the m i t o c h o n d r i a l chromosome, and that novel inserts w h i c h are size  of j u n c t i o n  fragments i n S o u t h e r n  analyses, arise  either  from  rearrangements of preceding inserts, f r o m novel insertion events, or f r o m the transposition of m t l S k a l D N A ( M y e r s et al, 1989). T h e kalilo p l a s m i d has now been completely sequenced. It is 8632 b p i n length, with perfect inverted repeats of 1361 bp. T h e A : T content is 69.9%. T h e p l a s m i d encodes no O R F s of appreciable size w h i c h can be read in the universal genetic code, however in m i t o c h o n d r i a l genetic code, where the codon T G A  is read as t r y p t o p h a n  instead of as a t e r m i n a t i o n signal ( A n d e r s o n  et al, 1981),  kalilo is found to encode two large O R F s , r u n n i n g i n opposite orientation, of 893 a n d 811 aa. T h e larger O R F  shows critical aa homologies to the p u t a t i v e D N A  S - l p l a s m i d of maize, a n d certain other viral D N A  polymerases of bacteriophage 4)29, the  polymerases. T h e smaller O R F  RNA  polymerase w h i c h shows aa homology to the T 3 a n d T 7 R N A  RNA  polymerase of the S-2 p l a s m i d  suggested  that kalilo m a y  encodes a p u t a t i v e  polymerases, a n d t o the p u t a t i v e  of maize. F i n a l l y , the codon usage of the kalilo O R F s  be ancient a n d may  1989b).  33  have coevolved  with  mitochondria. ( C h a n  has  et al,  Introduction  Figure 5. Restriction M a p of Kaiilo  R e s t r i c t i o n m a p of kaiilo D N A a n d K p n I ( K ) restriction sites.  showing the X b a I ( X ) , E c o R l ( E ) , B g l II ( B ) , H i n d III ( H ) ,  T h e fragments created f r o m the digestion of linear kaiilo D N A  the enzymes X b a I, E c o R l , B g l II, a n d H i n d III are shown. referred to i n the text as such.  T h e fragments are n a m e d  with  a n d are  Some o f the probes used i n the thesis are referred to i n this way,  thus, X 3 , is the cloned fragment  X3, pDV-X3.  M o r e information o n probes is presented i n the  materials a n d m e t h o d s (figure 10). T h e 1361 b p t e r m i n a l repeats of the element are shown b y the inverted arrowheads.  K a i i l o is 8632 bp long. T h e locations of the two O R F s  potentially encodes a D N A  Polymerase, a n d O R F  2 potentially encodes an R N A  34  are shown. O R F polymerase.  1  Introduction The  insertional behaviour  observations. A l l insertions  o f kalilo has been studied, a n d it has yielded some interesting  of kalilo  which  have  been  s t u d i e d show  a pentanucleotide  match  somewhere w i t h i n the last a p p r o x i m a t e l y 20 b p of kalilo a n d the m t D N A . Integration of the p l a s m i d is v i a an u n u s u a l  m e c h a n i s m w h i c h creates long inverted repeats i n t h e m t D N A  at the site of  insertion. A molecule of this type, illustrating m t A R - k a l D N A a n d m t l S - k a l D N A is shown in figure 6. The The  long i n v e r t e d repeats of m t D N A mechanism  regimens  have  are shown, although i t is not k n o w n how extensive they are.  is n o t known, b u t p r o d u c t i o n either been  mitochondrial D N A  hypothesized  by recombination  ( B e r t r a n d , 1986; C h a n  or b y unique  insertion  et al, 1989a) T h e s t r u c t u r e of the  i n senescent cultures is not known, b u t it is k n o w n t h a t the m t D N A of m a n y  senescent strains has undergone deletions a n d rearrangements ( B e r t r a n d et al, 1985, 1986; Myers, 1988; M y e r s et al, 1989; C h a n et al, 1989a). T h e m t D N A m a y be heterogeneous a n d m a y consist of any or all of the following: wild-type circles, deleted circles, a n d linear m t D N A s . A further possibility is that the m t D N A m a y exist, as t e r m i n a l l y i n v e r t e d concatameric circles j o i n e d b y inserts of m t l S kalDNA  ( C h a n et al, 1989a; B e r t r a n d , 1986). A s u m m a r y of kalilo insertion sites is shown in figure  7. A n o t h e r plasmid, called maranhar, that was found functionally identical t o kalilo. It is a 7 kb linear p l a s m i d  in a. senescent, strain of with  N. crassa,  is  .7 kb t e r m i n a l i n v e r t e d repeats  ( T I R s ) , which causes senescence b y insertional mutagenesis of the m t D N A  creating molecules which  are suppressive over wild-type m t D N A s a n d can lead t o the death of the organism. M a r a n h a r causes the similar m t D N A  rearrangements u p o n insertion, a n d has O R F s w h i c h encode proteins w i t h a a  homologies t o t h e kalilo O R F s . B o t h  have blocked  5' termini, due p r e s u m a b l y t o t h e covalent  a t t a c h m e n t of p r o t e i n to the ends of the D N A . T h e t w o plasmids, however, show no homology at the nucleotide level  (Court  et  al, 1988; D a s g u p t a  et  36  al, 1988; G r i f f i t h s  and Bertrand,  unpublished  Introduction observations). F i n a l l y , the plasmids are capable of coexisting i n a c o m m o n cytoplasm, so they do not compete with one another, suggesting t h a t they have unique origins (Griffiths et al, 1989).  37  Introduction  Figure 6. Model for the Insertion of Kalilo Into the mtDNA m t A R - k a l D N A , the free linear plasmid, is represented as a linear d s D N A attached proteins. It is shown inserting into the m t D N A insertion, the m t D N A  w i t h terminally  at a point between markers c a n d d. A f t e r  is represented as a long i n v e r t e d repeat, a n d m t A R - k a l D N A  has become  m t l S - k a l D N A , t h e m i t o c h o n d r i a l insertion sequence. T h e length of the these s t r u c t u r e s a n d the u l t i m a t e s t r u c t u r e of the senescent m t D N A molecules are n o t known, a n d have been represented b y the d o t t e d lines.  38  •tAR-kaDNA  itDNA  a  b  c  ItttS-kaPNAl  39  c  b  a  Introduction Figure 7. Previously Identified Insertion Sites of mtlSkalDNA  A restriction map of the mtDNA of Neurospora intermedia showing the sites of insertion of kalDNA in different strains, designated by the lines. An Eco R l , Hmd III, and Bgl II map are shown. The positions of some of the mitochondrial genes are presented. The filled-in boxes represent the exon regions of each gene and the lines represent intron sequences. The mitochondrial tRNAs are indicated by dots. Sites marked with thin lines and sites marked with thick lines have been identified by Bertrand (1986), and Myers (1988), respectively. Sites marked with hollow lines were identified in both reports. The location of the N. crassa mtDNA clone Hind 111-13, 18, is shown at the bottom of the figure. Map is redrawn from Myers, (1988), Bertrand et al, (1985), and Bertrand (1986).  40  Introduction  41  Introduction  REVIEW OF LINEAR  PLASMIDS  Definition K a i i l o , it appears, is another m e m b e r of a growing, b u t as yet poorly understood group of linear d o u b l e - s t r a n d e d D N A p l a s m i d s . T h e s e plasmids are characterized  b y T I R s of v a r y i n g l e n g t h ,  and b y proteins covalently attached t o the 5' ends of the D N A . D N A species of this type have been studied most t h o r o u g h l y in the adenoviruses, a n d in the B a c i l l u s bacteriophage, end structure,  4>29. T h i s  unique  w i t h the covalently a t t a c h e d proteins, is necessary for the maintenance of the ends of  the D N A (telomeres), a n d it serves to initiate the novel D N A replication scheme of these viruses. T h e m o d e l is s h o w n i n figure 8. T h e t e r m i n a l protein can interact with D N A polymerase a n d other proteins to p r i m e replication of the D N A ; the structure, is responsible for p l a c i n g the first nucleotide and  generating  a  3'  h y d r o x y l group  A d e n o v i r u s , see C h a l l b e r g a n d K e l l y , Salas,  1988).  T h i s D N A maintenance  for extension  1982;  by D N A polymerase  or S t i l l m a n ,  1983;  (for a review  for a review of  of the  cl>29 replication,  see  scheme was once t h o u g h t to be quite unique, f o u n d only in  these two viruses, b u t now a n u m b e r of bacteriophage and plasmids w i t h the structure are b e g i n n i n g to be identified a n d might share the same mode of replication. T h e s e plasmids have been f o u n d in a multitude  of  organisms,  although  none  have  eukaryotes.  42  been  described  for  higher  non-photosynthetic.  Introduction Figure 8. Model for the Replication of Linear D N A s  Model for the replication of virus DNA. The terminal protein is represented by a filled in circle, the DNA polymerase is represented by an open triangle, dsDNA is represented by parallel solid lines, and ssDNA which has been protected by a single stranded DNA binding protein is represented by the shaded regions. Step 1: The viruses initiate replication when the terminal protein and the DNA polymerase associate with other factors, including nucleoside triphosphates and virusencoded replication factors. Step 2: The non replicating strand of the DNA becomes bound with a ssDNA binding protein, which in the adenovirus is also a transcription factor. The " Y " shaped structure is a type II replication intermediate. Step .3: completion of DNA replication yields a newly synthesized virus, and ssDNA bound with ssDNA binding protein. Step 4: The circular DNA shows that a single strand of the virus DNA is sufficient for DNA replication to occur due to the presence of the TIR. The inverted repeats hybridize, generating the end structure for initiation of replication. Step 5: The linear structure is a type II replication intermediate, type I and type II replication intermediates have been identified by electron microscopy. Redrawn from Stillman (1983), and Salas (1989).  43  Introduction  Nativa Linaar Pla/mid  Step Is Initiation of transcription  \  + •  and othar factor/  J^x. + Il l l l l l l l l l l l l l  Step 2: Type 1 Replication Intermediate Extension o-f nascent DNA, and protection of ssDNA by ssDNA binding protein Step 3: * Replication products: Newly synthesized linear form, and protein bound ssDNA  Step 6: Newly synthesized linear form  *  d c t0  IIIIIIIIIIIIIIIIIIIIIIIIIIIII  1  . •  D-  J  o iiiiiiiiiiiimniiiiini  I * 44  hftr  = i_  Step 5: Type II Replication Intermediate n  JJ £  1  Step 4: ssDNA circularizes at inverted repeats to generate end structure for initiation of DNA replication  extenlon°  |  arid othar factor;  Introduction It is apparent  that  DNAs  o f this type  are c o m m o n  and may  be ubiquitous. In some  instances the late discovery of m a n y of these elements m a y have been an artifact due t o the t r o u b l e t h a t m a n y groups have reported i n isolating these plasmids; m a n y groups report that little or no plasmid  is seen  unless a proteinase K  step is inserted  p h e n o l / c h l o r o f o r m extraction of protein  (Meinhardt  D i i v e l l et al, 1988; M e y e r et al, 1988; C h a r d o n - L o r i a u x  i n the D N A  isolation protocol prior t o  et al, 1986; W l o d a r c z y k a n d Nowicka, 1988; et al, 1986; K e e n et al, 1988; E r i c k s o n et al,  1985; K i n a s h i a n d Shimaji, 1987), or centrifugation of nucleic acids t h r o u g h g u a n i d i u m h y d r o c h l o r i d e m a y be required ( K i t a d a a n d H i s h i n u m a , 1987). It seems that the 5' t e r m i n a l protein is capable of causing  precipitation  of the p l a s m i d  i n steps designed  t o remove  protein  d u r i n g these  DNA  isolations. T h i s seems t o be the cause of the confusion as to the cellular location of the kalilo p l a s m i d (compare B e r t r a n d et al, (1986), a n d M y e r s et al, (1989)). An  extensive literature search for linear D N A  elements has t u r n e d u p examples i n almost  every k i n g d o m except the higher non-photosynthetic eukaryotes. T h e elements are presented i n table 1.  45  TABLE 1. SURVEY OF LINEAR DOUBLE-STRANDED DNA ELEMENTS. SPECIES Agaricus bitorquis Ascobolus immersus  Bacillus spp. Botrytis cinerea Brassica spp. Ceratocystis fimbriata  N A M E OF ELEMENT pEM pMPJ pAl pAIl pAI2 several 029, 015 M2Y, Nf GA-1 several  pCF637 • pFQ501 Claviceps purpurea pClKl several Escherichia coli PRD Fusarium oxysporium pFOXCl pFOXC2 pFOXC3 Fusarium solani pFSCl pFSC2 Gaeumannomyces graminis E l E2 Kluyveromyces laclis Kl K2 Morchella conica several Neurospora crassa maranhar Neurospora intermedia kalilo zhisi Pleurotus ostreatus pLPOl pLP02 Rhizoctonia solani pRS64 Saccharomyces kluyveri pSKL Sorghum bicolor Nl N2 e  Streptococcus pneumoniae C Strepiomyces rochei pSLAl pSLA2 S. rimosus pSRM S. clavuligerus Thiobacillus versutus Tilletia controversa pTCT Zea diploperennis Dl D2 Zea mays S-l S-2 S-3 R-l R-2 Adenoviruses several P  e  3  T Y P E OF ELEMENT mtpl mtpl unkwn unkwn unkwn unkwn virus virus virus unkwn mtpl unkwn mtpl mtpl mtpl virus mtpl mtpl mtpl mtpl mtpl mtpl mtpl cytpl cytpl unkwn unkwn mtpl mtpl mtpl mtpl mtpl unknwn cytpl mtpl mtpl mtpl virus cytpl cytpl cytpl cytpl cytpl unkwn mtpl mtpl mtpl mtpl mtpl mtpl mtpl virus  SIZE in kb 7.4 3.7 6.4 7.9 5.6 2-20 •18 '"20 18.0 2-3 11.3 8.2 6.0 6.7 5-10 14.0 1.9 1.9 1.9 9.2 8.3 8.4 7.2 14.0 9.0 6.0 1-10 7.0 8.6 7.0 10.0 9.4 2.6 14.2 5.7 5.3 4.2 -20 17.0 17.0 43.0 12.0 3.2 7.4 7.5 5.3 6.2 5.2 2.3 7.5 5.4 "50.0  c  KNOWN STRUCT. all I l,ir  1  all  REFERENCE Meyer et al, 1988 Francou, 1981 Meinhardt et al, 1988  1  Francou et al,, 1987 Yoshikawa et al, 1981  1.P  Hiratsuka et al, 1987 Palmer et al, 1983 Giasson and Lalonde, 1987 Normand et al, 1987 Diivell et ai, 1988  all all all  all l,tp Lir all all all Up  1 1  Savilahti etc. Kistler et al, 1987  all all  Samac and Leong, 1988  all all l,ir  Gunge et al, 1981  all all Up Up  Griffiths et al, unpublished Myers et al, 1988 Griffiths pers. comm. Yui et al, 1988  1 1  1  UP 1 all all all 1 all all all  UP all  I-P 1  all all all all all all all all  Honeyman and Currier, 1986  Meinhardt and Esser, 1984  Hashiba et al, 1984 Kitada and Hishinuma, 1987 Pring et al, 1982 Baszczynski and Kemble, 1987 Escarmis et al, 1985 Hirochika et al, 1984 Chardon-Loriaux et al, 1986 Keen et al, 1988 Wlodarczyk and Nowicka, 1988 Kim et al, 1988 Timothy et al, 1984 Pring et al, 1977 Bedingerer a/, 1986 Weissinger et al, 1982 Doerfler, 1987  ^The plasmid name is given if available, dashes indicate that the plasmid is unnamed. The designation several suggests that many of the indicated .linear elements are found. "The designations ate as follows: mtpl refers to elements which exist as mitochondrial plasmids; cytpl indicates that the plasmid is not found in the mitochondrion, and may be nuclear or cytosolic; unkwn indicates that the cellular location has not been discovered; virus is self explanatory. sizes are given in kb. Where more than one element is indicated, a range of sizes has been given. For the virus families, an approximate size of a . member is given "Plasmids have three structures: codes are I, linear; p, terminal protein; tp, terminal protein attached 5'; i, inverted repeats; all designates the plasmid has all of these structure elements. Cinriiratrj: (hat a family of elements with similar structures and nucleotide homologies exists. c  46  Introduction Prokaryotes The following are some examples of linear double stranded DNA plasmids that have been described in prokaryotes. Many bacteriophages with the structure have been described in addition to 4>29. The Cp-1 family are a group of pneumoccocal phages that bear resemblance to the prototype member Cp-1. Cp-1 is an 18 kb phage with an 28 kD protein covalently attached to the 5'ends of the DNA (Garcia et al, 1983), which has an 236 bp TIR (Escarmis et al, 1984). Cp-5, -7 and -9 are morphologically similar phages which do not have similar restriction maps (Lopez et al, 1984). Cp-5 has terminal repeats of 343 bp, and Cp-7 has terminal repeats of 347 bp, the initial nucleotides of which are highly homologous to those of Cp-1 (Escarmis et al, 1985). The proteins of Cp-1 and Cp-5 are closely related, while those of the Cp family differ from that of <i>29 (Escarmis et al, 1985). Since the identification of a terminal protein associated with Bacillus sub tilts phage 4>29 (Harding et al, 1978; Ito, 1978; Salas et al, 1978; and Yehle, 1978), this bacterium has been found to harbour a number of bacteriophages whose TIR homologies and tryptic terminal peptide maps divide them into groups, although the phages do not share similar restriction maps. Group A includes 4>29 and cb 15, which have identical 6 bp TIRs (Escarmis and Salas, 1981; Yoshikawa et al, 1981). Group B phages, M 2 and Nf, share 8 bp TIRs, which include the sequences of the Group A TIRs. A final phage, GA-1 , which has a. 7 bp TIR, forms group C (Yoshikawa. and Ito, 1981). All the phages, including the Cp family and the S-2 plasmid of maize, have the identical sequence A A A at their termini (Escarmis et al, 1985). An E. coli phage family, the PRD phages, also have the <f>29 structure and weak terminal sequence homologies to d>29, although the phages are fundamentally different (Bamford et al, 1983; Savilahti and Bamford, 1986). Streptomyces strains seem to harbour a number of the linear plasmids. The first plasmids to be identified were pSLAl and pSLA2, closely related plasmids of 17 kb from Streptomyces rochei (Hayakawa et al, 1979; Hirochika and Sagaguchi, 1982). They have 614 bp terminal repeats which are G:C rich, and contain a number of palindromic  47  Introduction elements (Hirochika et al, 1984). The plasmid may encode antibiotics made by this strain (Hayakawa et al, 1979). Streptomyces rvmosus is found to contain a 43 kb plasmid with the structure (Chardon-Loriaux et al, 1986). Streptomyces clavuhgerus houses a 12 kb plasmid (Keen et al, 1988). A number of strains of Streptomyces have been found to contain large plasmids by the O F A G E technique, although the identification of their terminal structure is still incomplete (Kinashi and Shimaji, 1987). Finally, a linear plasmid has been found in the archaebacterium, Thiobacillus versutus, of 3.2 kb (Wlodarczyk and Nowicka, 1988).  48  Introduction F i g u r e 9. S t r u c t u r e s of Some L i n e a r P l a s m i d s  Part A is redrawn from Paillard et al (1985), and shows the S-l and S-2 maize mitochondrial plasmids. The TIRs, of 208 bp are indicated by the dark squares. Homology between S-l and S-2 is shown by thick lines. ORFs are as shown. Part B is redrawn from Levings et al (1982). The recombinant event which is thought to give rise to S-2 is shown. The numbers are sizes in kb. TIRs are represented by the dark squares at the ends of the DNA. Part C is redrawn from Sor and Fukuhara (1985). The compact organization of the plasmid is illustrated. The transcripts of the. plasmid are shown, and the ORFs are open boxes within the. transcripts. 5' and 3' untranslated sequences are presented as hatched boxes. The TIRs are shown as dark squares.  49  ZEftJMfiVS  fl  S-1 6397 bp  Introduction  PLASMIDS  J P N / i pol 929 go>  S-2 5453 bp  | R N 4 pol 1171 gg  > 39ftft  B R-1 7.5 kb  4.9  R-2 5.4 kb  3.9  S-2 6.3 kb  C  4.9  KLUVVEROMVCES  2.6  X  1.5  1.5  LftCTIfi  kt 8874 bp  g|oN4pol 998gaM kilter to*in i i 4 6 a a _  50  ft  tOAfin  jp**]l  Introduction Plants  Plasmids in Male Sterile Lines A number of plasmids has been described for agricultural plants—all of them mitochondrial, and all found in association with the cytoplasmic male sterile (cms) trait of higher plants. Although there is not a single case of proof that these plasmids have anything to do with the cms trait, their presence in cms lines of many agricultural plants is highly suggestive, although many contradictions seem to abound (Escote et al, 1985). There is an 11.5 kb plasmid from a cms line of Brassica (Palmer et al, 1983; Erickson et al, 1985) which has 325 bp TIR, and which shows homology to both mtDNA and cpDNA (Turpen et al, 1987). Two plasmids, designated N l and N2, of 5.4 and 5.8 are found in a cms line of Sorghum bicolor (Dixon and Leaver, 1982; Pring et al, 1982). While the plasmids were originally reported to have homology to the S-l and S-2 plasmids of maize (Pring et al, 1982), recent reports show that the plasmids have no homology to mtDNA, cpDNA, nuclear DNA, nor to the maize plasmids (Chase and Pring, 1986; Baszczynski and Kemble, 1987), although a third plasmid of S. bicolor, 4.2 kb long and of very low copy number, does seem to show homology to S-l (Baszczynski and Kemble, 1987).  Plasmids in Zea The plant mitochondrial linear plasmids have been most highly studied in the maize system. Maize species mitochondria harbour a number of plasmids. S-l and S-2 are linear plasmids which were found in the mitochondria of the cms-S line of maize (Pring et al, 1977). They have 5' terminal proteins (Kemble and Thompson, 1982) and TIRs (Kim et al, 1982). They have been cloned and sequenced; S-l is found to be 6,397 bp long and S-2 is found to be 5,453 bp, and the plasmids have identical 208 bp TIRs. Together they encode 4 ORFs; S-l has ORFs of 2787 bp, and 768 bp, while S-  51  Introduction 2 has an O R F of 3513 b p , and the t w o plasmids share an O R F of 1462 b p i n a region of homology (Levings a n d Sederoff, 1983; P a i l l a r d et al, 1985). T h e t w o plasmids are d i a g r a m m e d i n figure 9. Interestingly,  the plasmids terminal sequences have regions w h i c h are conserved w i t h some of the  previously m e n t i o n e d reversion  bacteriophages  (Levings  a n d Sederoff,  to male fertility, and u p o n reversion,  1983). C m s - S strains  are capable of  the two plasmids can no longer  be detected in  m i t o c h o n d r i a , b u t rather they seem to have recombined  with the m t D N A  (Levings et al, 1980;  K e m b l e a n d M a n s , 1983) at regions of homology ( T h o m p s o n et al, 1980; S p r u i l l et al, 1980). A n investigation i n t o this process led to the s u r p r i s i n g result t h a t m u c h of the maize m t D N A i n cms-S lines is linearized b y r e c o m b i n a t i o n w i t h S - l a n d S-2 plasmids ( S c h a r d l et al, 1984), a n d t h a t upon reversion to fertility, not only do S - l a n d S-2 disappear, ( S c h a r d l et al, 1985). Despite the suggestiveness  b u t only circular D N A s  of these observations  can be f o u n d  that S - l a n d S-2 are the  determinants of male sterility, in these strains, the observation that male fertile strains d o exist in the presence of free S - l a n d S-2 has clouded this conclusion; apparently, loss of the plasmids d u r i n g sterility reversion  is under  nuclear  control,  it is not an S - c y t o p l a s m  Nonetheless, the m t D N A rearrangements associated  trait  (Escote et al, 1985).  with reversion to fertility (Levings et al, 1980;  K e m b l e a n d M a n s , 1983) appear to be highly n o n - r a n d o m , and involve conserved sequences that are homologous to the T I R s of the plasmids, a n d resemble m i t o c h o n d r i a l promoters ( B r a u n et al, 1986). A n o t h e r question concerns other maize species' plasmids; T h e plasmids R - l a n d R-2 are f o u n d in another Z e a species a n d are male fertile. R-2 is i d e n t i c a l to S-2 a n d R - l is highly h o m o l o g o u s t o S - l , except t h a t it contains an insertion a n d some rearranged sequences (Weissinger et al, 1982). Indeed the two p l a s m i d systems are so closely related  that it has been postulated  t h a t S - l arose b y a  r e c o m b i n a t i o n event between R - l a n d R - 2 (Levings et al, 1982). T h i s possibility is d i a g r a m m e d in figure  9. F i n a l l y , it s h o u l d be noted t h a t there are other maize m i t o c h o n d r i a l p l a s m i d s . T h e p l a s m i d  S-3 ( K o n c z et al, 1981) is a 2.3 k b p l a s m i d w h i c h is f o u n d in all maize m i t o c h o n d r i a tested, and  52  Introduction which shows homology to S-l, S-2, mtDNA, cpDNA and nuclear DNA of maize. The plasmid is linear, has 17 bp TIRs which are homologous to those of the S plasmids, and has terminal proteins (Bedinger et al, 1986). Zea diploperrenis contains two plasmids D - l and D-2 that may be identical to R-l and R-2 (Timothy et al, 1982). Finally, a number of small circular mitochondrial plasmids of maize are known (Kemble and Bedbrook, 1980; Kemble et al, 1980; Smith and Pring, 1987).  Fungi The number of plasmids described for the fungi exceed those described for any other kingdom, and they are. found in mitochondrial and other cellular compartments.  Mitochondrial plasmids Mitochondrial plasmids with the linear dsDNA structure have been described in many systems. In Agaricus bitorquis, the common edible mushroom, the prototype strain, Ag4, harbours two plasmids, one of 7.3 kb and one of 3.65 kb, which have 1 kb TIRs and homology to the mtDNAs of strains of A. bitorquis and A. bisporus with and without the plasmids. A survey of Agaricus strains has found many plasmids (Mohan et al, 1984; Meyer et al, 1988). Pleurotus ostreatus has been found to contain two plasmids, one of 10.0 kb and one of 9.4 kb. They have no homology to one another, and no homology to the mtDNA or the nuclear DNA (Yui et al, 1988). Fusarium oxysponum f. sp. conglutmans has been found to contain a family of 1.9 kb plasmids, which do not appear to have homology to the mitochondrial or nuclear genomes. At least two different 1.9 kb plasmids have been defined, which do not show homology to one another. Interestingly, the presence of a certain plasmid correlates with host range of this plant pathogenic fungus. These are the smallest plasmids yet defined (Kistler and Leong, 1986). Fusarium solarium f. sp. cucurbitae is found to contain two large plasmids, of 9.2 and 8.3 kb, which do not share major sequence similarity. They  53  Introduction were once thought to correlate with pathogenicity of the fungus (Samac and Leong, 1988), although it now seems that they have no role in pathogenicity (Samac and Leong, 1989). Ceratocystis fimbnata mitochondria are found to contain a 6.0 kb plasmid with 0.75 kb TIR (Normand et al, 1987) . Of course, the senescence plasmids of Neurospora fall into this category. They include kalilo, maranhar, zhisi, and others (Griffiths et al, unpublished observations). Finally, A linear DNA whose final structure is not known, has been found in the mitochondrion of Botrytis cinerea (Hiratsuka et al, 1987). Extensive, work has been done on the plasmids of Claviceps purpurea. Originally, it was found to harbour a linear, mitochondrial plasmid of 6.3 kb (Tudzynski et al, 1983). An analysis of a large number of strains of the fungus showed that plasmids with homology to the linear plasmid were common, and that a heterogeneous family of plasmids with a similar size was found to occur, and that the TIR of the plasmids showed homology to the mtDNA (Tudzynski and Esser, 1986). Now many of the plasmids are known, and while there are sequence homologies among many of them, including identical plasmids that are found in distantly related strains, they are not all related. A prototype plasmid, p C K L l , was found to be of 6.7 kb, with 327 bp TIR (Diivell et al, 1988) . This plasmid has been reported to have homologies to the linear plasmids in a number of other systems. Although the strength of the hybridization conditions were not reported, p C K L l shows relatively weak homology to the plasmids of Ascobolus immersus, to the k2 plasmid of Kluyveromyces lactis, and to the N2 plasmid of Brassica. Relatively strong homologies have been reported for the Brassica plasmid N l , and the maize plasmid, S-l (Tudzynski et al, 1986). They also seem capable of insertion into the mtDNA (Tudzynski et al, 1986; Tudzynski et al, 1983).  54  Introduction Location unknown There are also some plasmids whose cellular location has not been discerned. Hashiba et al, (1984) have reported a 2.6 kb linear plasmid whose titres correlate with pathogenicity in Rhizoctonia solani. Ceratocystis fimbnata harbours a second plasmid, which is 8.2 kb (Giasson and Lalonde, 1987). Saccharomyces kluyven has a 14.2 kb linear plasmid with 483 bp TIRs (Kitada and Hishinuma, 1987). Recently, a 7.4 kb linear plasmid has been found in Tilletia controversa, however, whether it conforms to the protein and T I R structure is not known (Kim et al, 1988).  Nuclear plasmids Plasmids which are not mitochondrial and are presumably nuclear or cytosolic have been found in a number of fungi. Analysis of genetically unstable and wild strains of Ascobolus immersus has yielded many plasmids from 2 to. 20 kb in size (Francou et al, 1987; Meinhardt et al, 1986), which all have related sequences. Two plasmids have been studied in detail. They are 6 kb with 1.2 kb TIRs (Francou, 1981), and 5.6 kb with .7 kb TIRs (Meinhardt et al, 1986). Many strains of the morel Morchella cornea harbour 6 and 8 kb plasmids with TIRs of 0.75 kb (Meinhardt and Esser, 1984). Very little is known about, any of the fungal plasmids, regardless of their cellular location. In striking contrast to this situation are the linear plasmids, k l and k2, of the yeast Kluyveromyces lactis (Gunge et al, 1981).  The Killer System of Kluyveromyces lactis k l and k2 were first identified, as a pair of linear plasmids of 8.8 and 13.4 kb in killer strains of the yeast Kluyveromyces lactis (Gunge et al, 1981). The plasmids, which are found free in the cytoplasm (Romanos and Boyd, 1988), were found to encode both the killer toxin and immunity, as transfer of the plasmids to non-killer strains transformed them into killers (Gunge and Sakaguchi,  55  Introduction 1981). It was found by mutagenesis of killer strains that kl encoded the killer phenotype, while k2 seemed to be responsible for maintenance of the plasmids, as loss of kl resulted in toxin sensitive non-killers and kl was never seen without being accompanied by k2 (Niwa et al, 1981; Wesolowski et al, 1982). Interestingly, the plasmids share no homology, even the terminal repeats of the two plasmids share no extensive homologies; they are 202 and 184 bp respectively (Sor et al, 1983). The plasmids have 5' attached proteins, although the proteins are very small, and they differ between the two plasmids (Kikuchi et al, 1984). k l has been completely sequenced and it has a high A : T content of 73.2%, and contains 4 ORFs (Stark et al, 1984; Hishinuma et al, 1984; Sor and Fukuhara, 1985). The kl plasmid is diagrammed in figure 9. Each ORF is promoted from a unique promoter with the sequence A C T A A T A T A T G A , followed by a hairpin region, followed by the transcription start site (Sor and Fukuhara, 1985). The promoters seem to be unique and are not transcribed as units on the usual yeast nuclear vectors; this seems to confirm the cytoplasmic location of the plasmids (Romanos and Boyd, 1988). It is possible that kl relies entirely on k2 for its maintenance, replication and expression, but the observation that the one of the four ORFs of kl encodes a. B family DNA polymerase, suggests that kl encodes some functions necessary for its own survival. In this scenario, the DNA polymerases used by kl and k2 differ, and kl encodes its own DNA polymerase (Fukuhara, 1987; Jung et al, 1987), while k2 encodes the rest of the functions required for plasmid maintenance: an RNA polymerase, the terminal proteins, and its own DNA polymerase. The other three ORFs of kl are thought to encode two toxin subunits (Stark and Boyd, 1986), and one immunity function (Tokunga et al, 1987). It has been shown that the Kluyveromyces plasmids replicate like the adenovirus (Fujimura et al, 1988), although they do seem to contain sequences that can function as an ARS in S. cerevisiae (Fujimura et al, 1987). It is interesting to note that these plasmids have been found to undergo deletions which create hairpin plasmids that appear to be stably replicated (e.g. Kikuchi et al, 1985). These have been used to suggest that kl does require an intact copy of the  56  Introduction DNA polymerase it encodes to be maintained (Kitada and Gunge, 1988). Final notes of interest in this system are the observations that the plasmids can be transferred with relative ease amongst the yeast families (Gunge et al, 1982; Sugisaki et al, 1985), but that S. cerevisiae can only be stably transformed if the host is a p° strain, suggesting incompatibility of the killer plasmids with the mtDNA of S. cerevisiae (Gunge and Yamane, 1984). It is not known if this information has any relevance to the discovery of mitochondrial linear plasmids in many fungi.  Phenotypes of linear plasmids The vast majority of the preceding plasmids are not correlated with any phenotype in the organisms which harbour them. Extensive strain surveys frequently turn up strains which do and which do not harbour their respective plasmids, however the strains do not differ in any other detectable way. Therefore it is interesting to examine the examples where a phenotype. is present, to try and determine what these plasmids may be doing. Obviously the dsDNA viruses give rise to a phenotype, however, the consequences associated with the presence of a plasmid are less clear. Most linear plasmids have no apparent phenotype, however some have very interesting phenotypes. The plasmids in some plant species correlate with pathogenicity in the strains which harbour them (Kistler and Leong, 1986; Hiratsuka et al, 1987). While no phenotype is actually known for many of the fungal mitochondrial plasmids, many show homology with the mtDNA (Meyer et al, 1988; Duvell et al, 1988), and thus may have some as yet undetermined effect. Kaiilo, of course, has a senescent phenotype (Bertrand et al, 1985) as does maranhar; maranhar however has homology with the mitochondrial chromosome and may be responsible for RFLPs in Neurospora mtDNA (H. Bertrand, pers. comm.). The circular Neurospora mtDNA plasmid Varkud can also be forced to insert into the mtDNA, causing a phenotype similar to senescence, however, this does not appear to be a natural function of the element (Akins et al, 1986). Some of the prokaryotic plasmids are  57  Introduction thought to encode antibiotics, much as circular plasmids do. A l l of the plant plasmids correlate with the cms trait, but none have been proven to have a cause or effect on the system. It appears as though amongst all the elements shown in table 1, with the exception of the viruses, only the kalilo, maranhar, and the killer plasmids of the yeast Kluyveromyces, give rise to an identifiable phenotype in the organisms which harbor them, and all of the others represent some sort of vestigal or cryptic system.  SEARCH FOR FUNCTIONS OF KALILO The picture that emerges is that kalilo is a mitochondrial plasmid that is frequently found in Hawaiian isolates of N. intermedia. It is a linear plasmid that is somehow related to other mitochondrial linear plasmids, and linear plasmids in general. Strains that harbour kalilo are senescent, although the evidence that kalilo causes senescence is largely circumstantial. It has been suggested that the generation of defective m t D N A molecules is the only event required to initiate the suppressive accumulation of mitochondria carrying the inserts (Bertrand  et al, 1985). The  suppressive nature of mitochondria with defective m t D N A molecules is not well understood, but it is well documented. Accumulation of defective m t D N A molecules can also result from recombination with circular mitochondrial plasmids (Akins et al, 1986), from point mutations (Lemire and Nargang, 1985), and from deletions (Bertrand et al, 1980; DeVries et al, 1981). In addition to Neurospora, the effect is seen in Saccharomyces cerevisiae (Borst, 1972; Faye et al, 1973), Podospora ansenna (Stahl et al, 1978; Cummings et al, 1979b), and Aspergillus amstelodami (Lazarus et al, 1980). The biology of the kalilo plasmid has remained elusive. It is apparent that the plasmid is structurally similar to linear elements, but how it functions is not clear. The sequence of the element is known, but only the two large O R F s , an R N A polymerase and a D N A polymerase, are apparent. These two proteins may be all that is needed for plasmid maintenance, however a number of other  58  Introduction biological functions may be required. Neither the terminal protein nor its gene have been identified. A transposase may be found, given the ability to insert into the mitochondrial chromosome (Bertrand et al, 1986; Myers et al, 1989). Other unidentified functions also may exist; in vivo replication of 4>29 and the adenovirus requires other viral encoded proteins in addition to the. terminal protein and the DNA polymerase (reviewed in Salas, 1988; Stillman, 1983). Kaiilo may also require such functions for its survival. Therefore a functional analysis of the kaiilo plasmid of Neurospora intermedia is expected to give insights into this very interesting, but as yet undescribed group of linear elements and plasmids. Yet analysis of kaiilo has in some ways been an intractable system. It is intuitive that a number of genetic functions must reside on the element to allow it to exhibit this lifestyle, yet none have ever been identified. This is in part due to the fact that classical genetic analysis has never been performed. This is because kaiilo DNA is present in multiple copies, both as mtAR-kalDNA and as mtlS-kalDNA, therefore mutational analysis is not possible. Transformation of non-senescent strains to senescence using cloned and purified kalDNA in a number of constructs has been unsuccessful (C. Myers, T. Cheng and H. Bertrand, Pers. Comm.), so in vitro mutagenesis cannot be employed. This may be due to the unique end structure of kalDNA, a linear plasmid. Nonetheless, it is assumed that kaiilo must encode some information that allows it to exist. It is this information that it was of interest to find. The senescence events associated with the insertion of kaiilo are complex. Therefore it was of interest to determine what senescence events are programmed by kaiilo, rather than associated coincidences of mitochondrial biology, such as the suppressive nature of altered mtDNAs. Two possibilities presented themselves towards this goal. These were to use molecular techniques to search the DNA directly for genes or functional units. Because the sequencing of kaiilo was already underway (B. Chan, pers. comm.), transcriptional experiments were designed to find genes or  59  Introduction transcriptional units on the linear plasmid. The other idea was to search for function indirectly, using experiments designed to overcome the problems caused by the stochastic processes occurring during mitochondrial growth. Observing the behaviour of multiple cultures was undertaken as an experimental protocol devised to separate programmed events directly related to senescence from random events coincidental to the senescence process. In Part I of the thesis the transcriptional analysis of kalilo is presented, and in Part II, experiments on parallel subculture series of senescent strains are presented. I hereby present, these and other experiments designed to discover what functions are directed by kalilo, the linear senescence plasmid of Neurospora intermedia.  60  Materials and Methods  MATERIALS AND METHODS  STRAINS  Neurospora  intermedia  Neurospora intermedia  strains P 5 6 1 , P595, P605, P790, a n d P802 are n a t u r a l isolates f r o m  K a u a i , H a w a i i . A l l strains were collected  b y a n d o b t a i n e d f r o m D . D . Perkins. Ascospore  prefixed b y an I, such as 1-4, were described b y G r i f f i t h s a n d B e r t r a n d  (1984). Ascospore  progeny progeny  prefixed b y X I , such as X l - 4 , were described b y M y e r s (1988). S u b c u l t u r e series, such as 561-0, 5611, ...561-9 were described previously (Griffiths a n d B e r t r a n d ,  1984; M y e r s , 1988). O t h e r strains are  described i n the text.  Escherichia coli E. coli  strain J M 8 3  was host for transformation  of a n d D N A isolation f r o m clones in the  p U C 1 8 a n d p U C 1 9 vectors. Strain J M 1 0 1 was host for the M 1 3 m p l 8 a n d m p l 9 vectors.  MEDIA AND GROWTH CONDITIONS  Neurospora Vegetative glucose  (Vogel,  c u l t u r i n g was performed exclusively o n V o g e l ' s m i n i m a l m e d i u m c o n t a i n i n g 2%  1956).  Serial  s u b c u l t u r e d once or twice  subcultures  were  made  weekly. F o r the growth  of 16 hours.  A l l cultures  were i n c u b a t e d  61  75 m m tubes.  Each  series was  of m y c e l i u m for nucleic acid isolation,  V o g e l ' s m e d i u m was inoculated w i t h a p p r o x i m a t e l y minimum  i n 10 X  10 at  liquid  c o n i d i a / m l a n d shaken at 200 r p m for a 2 5 ° C . S u b c u l t u r i n g was performed  as  Materials and M e t h o d s described by Griffiths a n d B e r t r a n d (1984). T h e original member of a subculture series is designated b y a -0, such as 561-0. Serial subcultures are n u m b e r e d -1, -2, . . . - n , such as 561-7. C o n i d i a l isolation for the inoculation of liquid Vogel's was prepared by p o u r i n g conidial suspensions through layers of sterile n y l o n m e s h . C u l t u r e s were harvested  by suction filtration t h r o u g h W h a t m a n  #1  filters in  B u c h n e r funnels. T h e initial cultures for the parallel series were prepared b y i n o c u l a t i n g 10 sterile water, vortexing, and a d d i n g 0.1  m l to 10,  c o n i d i a / m l into  10 X 7 5 m m slants of V o g e l ' s m i n i m a l m e d i u m .  T h e s e were then n u m b e r e d i , ii, ...x, a n d subjected to serial s u b c u l t u r i n g u n t i l d e a t h .  Neurospora and are described b y D a v i s and DeSerres  A l l other procedures were s t a n d a r d for (1970).  Escherichia coli The  m e d i u m for  the  transformation  and  growth  of bacteria  containing  p U C plasmid  derivatives was L u r i a B r o t h (5 g Y e a s t E x t r a c t , 10 g B a c t o - T r y p t o n e , a n d 10 g N a C l / p e r litre). F o r the selection of p U C - s e r i e s p l a s m i d c o n t a i n i n g bacteria,  m e d i a were s u p p l e m e n t e d with 50  ng/ml  a m p i c i l l i n . B a c t e r i a containing M 1 3 clones were grown in Y T m e d i u m (5 g yeast extract, 8 g BactoT r y p t o n e , and 5 g N a C l per litre). J M 1 0 1 hosts for M 1 3 clones were m a i n t a i n e d on m i n i m a l A plates (0.3 g A g a r , 16 m l H 0 , 4 m l 5 X A Salts (52.5 2  g N a citrate.7H 0/per 2  thiamine/per  plate.  litre), 0.2  These  m l 20%  g K H P 0 , 22.5 g K H P 0 , 5 g ( N H ) S 0 , a n d 2.5 2  glucose,  were sterilized by  sterilized. T h e s e procedures have been described  4  2  20 pi 20%  autoclaving  4  4  MgSO .7H 0,  except  4  for  2  2  a n d 10 ul 10  thiamine  which was  previously ( M a n i a t i s et al, 1982; M e s s i n g ,  62  2  mg/ml filter  1983)  Materials and Methods NUCLEIC A CID ISOLA TIONS  DNA  Isolation  Mitochondrial DNA Mitochondrial DNA was isolated according to the small scale mtDNA isolation of Myers (1988), with the addition of a proteinase K digestion prior to phenol/chloroform precipitation of protein, unless otherwise stated in the text. All procedures were carried out at 0-4°C, unless otherwise noted. 200 ml of liquid culture was harvested and the stored on ice until needed. The mycelial pellet was ground with an equal volume of acid washed sand and suspended in 25 ml DNA isolation buffer (44 mM sucrose, 50 mM Tris-HCl, pH 7.6, 1 mM EDTA). The suspension was centrifuged at 2 krpm for 5 min. in an SS-34 rotor to pellet nuclei and cell debris. The supernatant, containing mitochondria was collected and centrifuged at 15 krpm for 15 min. to generate a crude mitochondria] pellet. The mitochondrial pellet was suspended in 3 ml 70% sucrose in T-^QE^ (10 mM Tris-HCl pH 7.6, 1 mM EDTA), and layered with 2 ml 44% sucrose in T  1 Q  E , or 1 ml 55% sucrose 1  in TJQE-^ and 1 ml 44% sucrose. The flotation gradients were centrifuged at 45 krpm for 2 hours in an SW50.1 rotor. Mitochondria were collected from the interface beneath the 44% sucrose step gradient layer, and diluted to 3 ml with 2 ml ^200^1 (  200  m  M  Tris-HCl pH 7.6, 1 mM EDTA) in  microfuge tubes. The tubes were centrifuged for 15 min. to pellet the mitochondria. The mitochondrial pellets were pooled and resuspended in 200 ul of a solution of 200 mM NaCl in T-^QE^. One tenth volume 10% SDS was added to lyse the mitochondria, followed by the addition of 20 \J1 of a 4mg/ml proteinase K (Boehringer Mannheim or Bethesda Research Laboratories (BRL)) solution. The mitochondrial DNA was incubated at 37°C for 6-12  hours. Protein was extracted by by the  addition of one volume of Tris-HCl saturated phenol, and one volume of chloroform/isoamyl alcohol,  63  Materials and Methods 49:1. Tubes were mixed by inversion and centrifuged for 15 min. The aqueous phase was collected and this step was repeated once. Nucleic acids were precipitated from the aqueous phase by the addition of 2.5 volumes of ethanol containing 200 mM NH^CHgCOOH. The nucleic acids were pelleted and washed with 70% ethanol. The mtDNA was resuspended in 50-200 pi T-^QEJ, with the addition 1 ul of 20 mg/ml RNAse A (Sigma). RNA was digested at 55°C for 30 min. DNA concentration was determined by UV absorption. Typically, the yield was 50 - 200 pig of mtDNA per 200ml of liquid culture.  Escherichia coli Plasmid DNA Alkaline lysis plasmid isolations have been described previously (Maniatis et al, 1982). Large scale plasmid isolations were as follows. 500 ml ampicillin cultures were grown from a 10 ml inoculation of an overnight culture of plasmid-containing E. coli, supplemented with 50 pg/ml ampicillin. Cells were harvested by centrifugation in GSA or GS-3 rotors at 7 krpm for 7 min. Pellets were resuspended in 6 ml of T E G solution (50 mM glucose, 25 mM Tris-HCl pH 8.0, 10 mM EDTA). 1 ml of T E G plus 20 mg/ml lysozyme was added and incubated for 10 min. at RT. Cells were lysed by the. addition of 7 ml of 0.2N NaOH, 1% SDS, mixed by inversion and incubated on ice for 5 mm. Protein was precipitated by the addition of 13 ml ice cold KCHgCOOH solution (60 ml 5M KCH3COOH, 11.5 ml glacial acetic acid, 28.5 ml H2O, pH 4.8) and incubating on ice for 15 min. Cells debris was removed by centrifugation of the DNA in an SS-34 rotor at 15 krpm for 10 min. The supernatant was collected and nucleic acids were precipitated by the addition of 0.6 volumes of isopropanol. Nucleic acids were collected after incubation for 25 min. at room temperature by centrifugation in an SS-34 rotor at 15 krpm for 15 min. The nucleic acid pellet was dried, resuspended in T-^QE^ and 0.9 g/ml CsCl and 30 ul of 10 mg/ml ethidium bromide was added. DNA was centrifuged for 4 hours in a vTi 80 rotor, or for 20 hours in a Ti 80 rotor. Plasmid bands were  64  Materials and Methods collected under long wave isopropanol saturated  U V light, and ethidium bromide was removed by extraction  with  with NaCl and H9O. Two volumes of T^QE-^, followed by 2.5 volumes of  ethanol plus 200 m M N H ^ C H g C O O H were added and D N A was collected by centrifugation in an SS-34 rotor at 10 krpm for 10 min. Pellets were washed in 70% ethanol and D N A concentration was determined by U V absorption. Small scale plasmid isolations for the screening of recombinant clones were essentially scaled down versions of the above protocol, with the omission of the CsCl centrifugation. Instead, R N A was removed by the addition of 1 pi of 20 mg/ml RNAse A , and incubation for 30 min. at 5 5 ° C .  MIS Phage DNA Bacteriophage M13 ssDNA was isolated according to Messing (1983). 1.5 ml cultures of phage which were grown for 5-8 hrs were cleared of bacteria by centrifugation in a microfuge. 1.3 ml of supernatant were added to 200 pj of 27% PEG-6000 in 3.3 M NaCl. Tubes were shaken at 4 ° C for 1 hr. Phage  were  cleared  by centrifugation for  15 min. in a microfuge, and the pellet  was  resuspended in 650 pi of T J Q E J . T o this was added 40 pi of 40% PEG-6000 and 80 ul of 5M NaCl. The contents were mixed and the tubes were incubated at R T for 30 min. The phage were cleared by centrifugation for 15 min. and all of the supernatant was removed. The pellet was resuspended in 300 pi T ^ Q E J , and the viral coat, was removed by extraction with 300 of Tris-HCl saturated phenol. The aqueous phase was collected, and reextracted with 150 pi phenol and 150 pi chloroform. D N A was precipitated by the addition of 2.5 volumes of ethanol/200 m M NH4CH3COOH, dried and resuspended in 10 pi T-^QE^.  65  Materials and Methods  R N A isolation  Total RNA T w o different protocols were used for the isolation of R N A . A l l buffers, reagents, e q u i p m e n t , etc.  for  the  isolation  of R N A was  reserved  endogenous R N A s e s a n d / o r treated w i t h 0.1% follows:  for  R N A use,  autoclaved  for  one  hour  to  destroy  D E P . S m a l l scale R N A isolations were performed as  0.2 g of tissue was harvested, frozen i n liquid nitrogen a n d homogenized w i t h s a n d i n 1 m l  of 2% T r i - i s o p r o p y l n a p t h a l e n e s u l f o n i c acid ( T N S ) and 1 m l 12% p-aminosalicylic acid ( P A S ) . T h e n 6 m l of T r i s - s a t u r a t e d  phenol a n d 2 m l more of b o t h T N S a n d P A S were a d d e d , homogenized, a n d  s p u n at 10 k r p m for 10 m i n . in an H B 4  rotor.  phenol/chloroform/isoamyl  alcohol  washed w i t h 70%  F i n a l l y , R N A was reprecipitated  strong, Leaver,  chaotropic  ethanol.  50:48:2  T h e u p p e r phase was collected and extracted w i t h  detergents to isolate  (P/C/I),  then  nucleic acids  precipitated  with  100%  f r o m 3.3  M LiCl.  ethanol,  and  T h e use of these  has been described previously ( L o v e t t  and  1969) Large scale R N A isolations were performed b y the acid phenol m e t h o d (Lucas et al,  by harvesting Mycelium  was  1977)  10 g m y c e l i a i n . a B u c h n e r funnel and washing with 100 m M N a C H g C O O H p H then  powdered  in  a  mortar  with  liquid  nitrogen  and  R N A was  extracted  5.5. by  h o m o g e n i z a t i o n in a W a r i n g blender in the presence of 120 m l 150 m M N a C H C O O H , 4% S D S p H 3  5.5, a n d 120 m l p h e n o l saturated w i t h the same extraction buffer, a n d 5 g g r i n d i n g a l u m i n a (Sigma). Samples were centrifuged at 10 k r p m for 12 m i n . i n a G S A rotor, a n d the u p p e r phase was extracted twice w i t h P / C / I a n d twice with c h l o r o f o r m / i s o a m y l alcohol 49:1. b y the a d d i t i o n of 0.1 volume  3  M Na  CH3COOH  and  3  N u c l e i c acids were precipitated  volumes 100%  ethanol, washed w i t h  ethanol, a n d R N A was reprecipitated f r o m 3.3 M L i C l , washed, dried a n d resuspended i n H ^ O  66  70%  Materials and Methods  Poly A RNA Poly  A+  R N A was  prepared  by  passing  total  R N A over  oligo(dT)-cellulose  columns  a c c o r d i n g to the directions of the supplier ( B R L ) . C o l u m n s were prepared b y repeated washings w i t h B i n d i n g Buffer (500 m M N a C l , 10 m M T r i s - H C l p H 7.5, a concentration  1 m M E D T A , 0.25%  S D S ) . T o t a l R N A , at  of 1 m g / m l in b i n d i n g buffer was heat denatured a n d chilled quickly on ice. It was  t h e n applied to the c o l u m n and the eluate was passed t h r o u g h the c o l u m n twice more. C o l u m n s were eluted w i t h E l u t i o n Buffer (10 and  U V absorbing material  NaCH,COOH  m M Tris-HCl  was pooled and precipitated  a n d 3 volumes of ethanol. P o l y A +  resuspended in  p H 7.5,  1 mM EDTA, b y the  0.1%  S D S ) i n t o fractions  a d d i t i o n of 0.1  v o l u m e of 3  M  R N A was washed w i t h 70% ethanol, dried a n d  H2O.  P o l y A - R N A was prepared b y collection of the eluate f r o m repeated passages of total R N A over  the  columns.  centrifugation. NaCHgCOOH  The  Excess  SDS  resultant  was  precipitated  R N A was  precipitated  by by  incubation the  at  addition  0°C, of  0.1  and 3 volumes of ethanol. P o l y A - R N A was washed w i t h 70%  and  removed  volume  of  3  by M  ethanol, dried a n d  resuspended in H 0 . 9  mtRNA mtRNA procedure,  with  was the  prepared  by  preparing  a d d i t i o n of 0.1%  mitochondria  diethylpyrocarbonate  according to  the  to  the  mtDNA  sucrose mixtures  isolation buffer. N u c l e i c acids were t h e n prepared according small scale R N A isolation.  67  isolation and D N A  Materials and Methods  ELECTR OPHORESIS  DNA  Agarose gel D N A s for agarose gel electrophoresis  were digested b y s t a n d a r d procedures for Boehringer  M a n n h e i m , B R L , and P h a r m a c i a restriction enzymes. 5 pig of m t D N A were generally digested for 2 hours at 3 7 ° C . 3 pi of 5 X l o a d i n g buffer (5%  S D S , 50%  glycerol, .025%  b r o m o p h e n o l blue)  a d d e d to make a final volume of 30 pi. m t D N A fragments were separated on 0.8%  was  agarose I (Sigma)  gels at 40 volts for 16 hours. Gels were prepared and r u n in T B E (81 m M T r i s base, 89 m M B o r a t e , 2 mM EDTA).  Gels were stained w i t h e t h i d i u m b r o m i d e and p h o t o g r a p h e d under shortwave  UV  illumination. F o r transfer to Genescreen ( N E N - D u p o n t ) , gels were d e n a t u r e d for 45 m i n . in 0.5 N N a O H , 1.5  M NaCl,  and then  neutralized for 45  transferred in 2 X S S C (300  m i n . in 1 M T r i s - H C l  m M N a C l , 20 m M N a C i t r a t e p H 7.0)  p H 8.0,  3 M NaCl.  D N A was  for 24 hrs. A f t e r transfer,  filters  were baked at 8 0 ° C for 3 hrs.  Poly aery lamide Gels 38 c m long b y 0.35mm thick p o l y a c r y l a m i d e gels were prepared as follows. G e l plates were prepared  b y cleaning glass t h o r o u g h l y a n d c l a m p i n g a n d t a p i n g gels.  For  6%  gels,  7.5  ml  40%  acrylamide (386 g acrylamide, 13.4 g bisacrylamide per litre), 2.5 m l 10X T B E , 24 g urea, 260 ul 10%  NH4S9O7,  a n d 21.7  m l of  H2O  were m i x e d , filtered t h r o u g h W h a t m a n  under suction for 15 m i n . 20 pi T E M E D  #1  filters, a n d  evacuated  were a d d e d , m i x e d t h o r o u g h l y , a n d i m m e d i a t e l y p o u r e d  i n t o gels. G e l s were polymerized for 4 hrs. 8% gels differed b y the use of 10 m l 40% acrylamide, a n d  68  Materials and Methods 19.2 m l H2O.  Gels were r u n i n 0.5 X T B E , at 1500 V a n d p r e r u n prior to l o a d i n g of samples. 6% gels  were r u n u n t i l 40 m i n . after the  xylene cyanol marker h a d reached the e n d of the gel. 8% gels were  r u n u n t i l the b r o m o p h e n o l blue marker reached the e n d of the gel. A f t e r electrophoresis gels were m o u n t e d on W h a t m a n 3 M M paper, dried under v a c u u m , and exposed to K o d a k X R P f i l m .  Northerns R N A was d e n a t u r e d i n a total volume of 50 ul w i t h 5 ul 10 X G e l buffer (200 m M M O P S , mM NaCH COOH, 3  10 m M E D T A p H 7.0),  20 ug R N A . Samples were heated  50  8.5 ul f o r m a l d e h y d e , 25 pj deionized f o r m a m i d e , and 2-  to 6 0 ° C for 5 m i n . a n d cooled on ice. 1% Agarose gels were  prepared in I X gel buffer w i t h 6% f o r m a l d e h y d e . Electrophoresis was at 50 V for 16 hrs. P r i o r to transfer, gels were washed w i t h R ^ O for 5 m i n . , d e n a t u r e d in 50 m M N a O H , 10 m M N a C l for 45 m i n , a n d neutralized i n 100 m M T r i s - H C l p H 7.5 for 45 m i n . T r a n s f e r was o n t o Genescreen for 24 hours in the presence of 25 m M N a 2 H P O ^ / N a H P O ^ p H 6.5. A f t e r transfer, filters were baked at 8 0 ° C for 9  3 hrs.  Hybridizations F i l t e r s were p r e h y b r i d i z e d for 24 hours at 4 2 ° C w i t h 40% deionized f o r m a m i d e , 1% S D S , I X D e n h a r d t s solution (100X  =  2% B S A , .2% P V P , 2% F i c o l l ) , 1 M N a C l , a n d 0.4 m g / m l d e n a t u r e d  H e r r i n g s p e r m D N A ( B e r t r a n d , 1985). H y b r i d i z a t i o n s were carried out in the same buffer w i t h the addition  of  labelled probe  to  10  cpm/ml.  Hybridization  was  for  24  hours  at  42°C.  After  h y b r i d i z a t i o n , filters were washed in 2 X S S C at R T for 5 m i n . , 2 X S S C , 1% S D S at 6 5 ° C for 1 hr, and in 0.1X  S S C at R T for 5 m i n , unless otherwise n o t e d in the washing experiments. B l o t s were  w r a p p e d i n S a r a n W r a p and exposed to K o d a k X - O m a t R P f i l m .  69  Materials a n d M e t h o d s  RADIOACTIVE  PROBE  PREPARATION  Oligolabelling Reactions  were  to  a  final  volume  of  30  ul.  p o l y ( d N T P ) , 90 O D u n i t s / m l 1 m M T r i s - H C l p H 7.5, 6  1.4  ul  of  random  primers  (Pharmacia  1 m M E D T A ) were m i x e d w i t h 50 - 500 n g  D N A to a final v o l u m e of 13.5 ul. T h i s was i n c u b a t e d at 1 0 0 ° C for 2 m i n . a n d then chilled on ice. 5 ul d N T P s  (100  [M  dGTP,  dCTP,  dTTP,  250  m M T r i s - H C l p H 8.0,  mercaptoethanol), 5 ul 1 M H E P E S p H 6.6, 5 pi [ a -  3 2  25 m M M g C l , 2  50 m M 2-  P ] d A T P (50 u C i , N E N - D u P o n t ) , 1 ul B S A (10  m g / m l ) and 0.5 ul K l e n o w fragment D N A polymerase ( B R L , 5 U n i t s / u l ) were added a n d i n c u b a t i o n was  at  RT  for  at  least  3  hrs.  U n i n c o r p o r a t e d nucleotides  were  removed  by  Sephadex  G-50  ( P h a r m a c i a ) spin c o l u m n c h r o m a t o g r a p h y .  E n d Labelling  3' Labelling Molecules were 3' end-labelled only b y the filling in the. overhangs of appropriate restriction digests. U p to 20 pg of D N A was m i x e d w i t h 5 pi d N T P s (100  p,M d G T P ,  T r i s - H C l p H 8.0,  5 pi 1 M H E P E S  3 2  P]dATP  (50  25 m M M g C l , 2  50 m M 2-mercaptoethanol),  uCi, NEN-DuPont),  1 ul B S A (10  mg/ml)  and  0.5  d C T P , d T T P , 250 m M p H 6.6,  5 pi [a-  ul K l e n o w fragment D N A  polymerase ( B R L , 5 U n i t s / u l ) , in a final v o l u m e of 30 ul. I n c u b a t i o n was at least  3 hrs at R T .  Unincorporated  spin  nucleotides  were  removed  by  chromatography.  70  Sephadex  G-50  (Pharmacia)  column  Materials and Methods  5'Labelling Restriction  digested  DNA  was  first  dephosphorylated  with  calf  intestinal  phosphatase ( C I A P , P h a r m a c i a ) . U p to 20 u.g of D N A was m i x e d with 5 ul 10X C I P (500 HC1 p H 9.0,  10 m M M g C l , 2  alkaline m M Tris-  1 m M Z n C l , 10 m M spermidine) to a final v o l u m e of 50 pi. 1 U n i t of 2  C I A P was a d d e d and the m i x t u r e was i n c u b a t e d at 3 7 ° C for 30 m i n . A n o t h e r unit of C I A P  was  added a n d i n c u b a t i o n was at 5 5 ° C for a further 30 m i n . 40 ul of H 0 , 1 pi of 10X S T E (100 m M T r i s 2  H C 1 p H 8.0,  1 M NaCl,  10 m M E D T A ) ,  a n d 5 pi of 10%  S D S were added and the m i x t u r e  was  heated to 7 0 ° C for 15 m i n . T h i s phase was extracted twice with P h e n o l / C h l o r o f o r m / l s o a r n y l alcohol 50:49:1, a n d twice w i t h chloroform. A p p r o x i m a t e l y 500 n g of D N A thus prepared was rnixed w i t h 10 pi 10X kinase, buffer m M T r i s - H C l p H 7.5, pCi)  100 m M M g C l , 50 m M D T T , 1 m M spermidine, 1 m M E D T A ) , 2  15 pi  (500 (150  P ] d A T P , a n d 20 units polynucleotide kinase. T h e reaction was i n c u b a t e d at. 3 7 ° C for 30  m i n . T h e reaction was stopped b y a d d i n g 2 pi of 500 m M E D T A ,  and unincorporated  nucleotides  were r e m o v e d b y Sephadex G-50 (Pharma.cia) spin c o l u m n c h r o m a t o g r a p h y .  M13 clones Single s t r a n d e d probes were prepared by a similar protocol to the oligolabelling, except that 2 pi of 15 or 17 b p M 1 3 primer ( B R L ) was mixed with D N A , rather t h a n 1.4 pi of r a n d o m primers. Incubation was for at least 5 hours at 1 5 ° C to prevent foldback synthesis of the D N A .  SI NUCLEASE PROTECTION  ASSA YS  Probes for the preparation of S I protection assays were prepared as u n i q u e l y end-labelled probes. 20  p,g of a kaiilo fragment  cloned as a double digested fragment  i n p U C - 1 8 or -19  was  digested w i t h an enzyme unique to one end of the insert. T h e D N A was then 3' or 5' end labelled, as  71  Materials and Methods necessary.  T h e probes were t h e n  digested  with a second enzyme, P v u II.  T h e p U C 18  and  19  plasmids have two convenient P v u II sites a p p r o x i m a t e l y 100 b p on either side of the polylinker. T h e resultant fragments were electrophoresed in the presence of 1.5% L o w M e l t i n g P o i n t agarose ( B R L ) , a n d the probe fragment, was isolated as a gel fragment a n d purified b y the G e n e C l e a n ( B i o 101  Inc.,  L a J o l l a , C A ) process. C o n d i t i o n s for nuclease SI digestion were p r e d e t e r m i n e d for each fragment. 500  n g of gel  purified D N A , a n d 5 ug of a n o n - k a l i l o total R N A sample were i n c u b a t e d i n 300 pi of 280 m M N a C l , 50 m M N a C H C O O H p H 4.8, 4.5 m M Z n S 0 , i n c l u d i n g various amounts of S I Nuclease ( B R L ) at, 3  4  various temperatures  to determine conditions at w h i c h the R N A was degraded a n d the D N A was  not. T h e conditions for the two A : T rich kalilo clones were f o u n d to be a p p r o x i m a t e l y 1000 units of enzyme i n c u b a t e d at 1 5 ° C for 1 hr. A p p r o x i m a t e l y 10^ c p m (100  p g - 1 ng) of labelled probe was  m i x e d w i t h 5 pg of R N A a n d 5 pg yeast t R N A , ' o r i n the control lanes only 10 pg t R N A , i n sample of 30 pi of 80% deionized f o r m a m i d e , 400 m M N a C l , 1 m M E D T A , and 40 m M P I P E S p H 6.4,  heated  to 8 5 ° C for 5 m i n . , and then allowed to cool to 4 2 ° C overnight, under paraffin oil. T h e h y b r i d i z a t i o n mixes were removed f r o m under the oil a n d added to 300 pi of 280 m M N a C l , 50 m M N a C H g C O O H p H 4.8, 4.5 m M Z n S 0 , i n c l u d i n g S I Nuclease ( B R L ) and i n c u b a t e d at 1 5 ° C for 1 hr. T h e amount, 4  of SI nuclease is presented  with each  figure  a n d was t y p i c a l l y 0, 500,  reaction. T h e n 50 ul of a solution of 4 M N H ^ C H g C O O H ,  1000,- a n d 1500  units per  100 m M E D T A , c o n t a i n i n g 20 pg t R N A  were a d d e d , and the aqueous phase was extracted once w i t h P / C / I , a n d once w i t h ether. 400 pi of isopropanol  were  added  to  precipitate  the  nucleic  acids.  The  precipitate  was  recovered  by  centrifugation, dried a n d resuspended i n a small v o l u m e of H 0 . T h i s was heated to 9 5 ° C , cooled on 9  ice, a n d electrophoresed t h r o u g h 2% agarose gels. 5' e n d labelled, denatured B R L 1 kb ladder was run  as  a molecular  size  standard.  Gels  were  mounted  autoradiographed.  72  on  Whatman  3 M M paper,  dried,  and  Materials and Methods  SEQUENCING  Primer preparation O l i g o n u c l e o t i d e primers were designed f r o m a sequence k i n d l y p r o v i d e d b y H . B e r t r a n d a n d B.  S.  Chan.  software).  Sequences  Primers  oligonucleotides  were  were  were checked purchased  purified b y  for singularity  from  T.  C-^g Sep  Oligonucleotides were dissolved in 1.5  by  Atkinson Pak  m l 500  computer (Dept.  (DNASTAR  of  chromatography  Biochemistry, (Atkinson  NH4CH3COOH.  mM  and  DNA  sequence  UBC).  Crude  Smith,  1984).  Sep P a k s were prepared  by  washing with 10 m l 20% acetonitrile a n d 10 m l H 0 , the oligonucleotide m i x t u r e was applied to the 2  c o l u m n , the c o l u m n was washed w i t h 10 m l H 0 , 1 m l air, a n d t h e n oligonucleotides were eluted 2  with  1 ml  20%  acetonitrile.  This  was  evaporated  to  dryness  and  resuspended  in  1 mlH9O.  Subsequent aliquots were diluted 1:100 for use.  D N A sequencing D N A was sequenced with the P r o m e g a K / R T sequencing system. 2-4 pg d s D N A was mixed with 30 n g of p r i m e r , 1 pi 2 M N a O H in a final volume of 10 pi. T h i s was i n c u b a t e d at 9 5 ° C for 5 m i n . , followed by the a d d i t i o n of 1 pi 3 M N a C - H g C O O H and 30 pi e t h a n o l . Nucleic acids were collected by centrifugation, washed with 70% ethanol, dried and resuspended in 9 pi H2O. E n z y m e Buffer (100  1 pi 10X  m M T r i s - H C l p H 7.5, 500 m M N a C l ) was a d d e d and h y b r i d i z a t i o n was allowed  to occur at 3 7 ° C for 30 m i n . T o this were added 5 units K l e n o w a n d 4 pi [a-  P ] d A T P , then 3 pi of  this m i x t u r e were a d d e d to each of 3 pi of the p r o m e g a s t a n d a r d dideoxy mixtures C M i x (12.5 p M d d C T P , 250 p,M d C T P , 250 p,M d T T P , 250 p M d G T P i n 50 m M N a C l , 34 m M T r i s - H C l p H 8.3,  6  m M M g C l , 5 m M D T T ) , T M i x (50 p,M d d T T P , 250 pJVl d C T P , 250 p,M d T T P , 250 p M d G T P i n 2  50 m M N a C l , 34 m M T r i s - H C l p H 8.3,  6 m M M g C l , 5 m M D T T ) , A M i x (1 piM d d A T P , 250 p M 2  73  M a t e r i a l s and M e t h o d s d C T P , 250 p-M d T T P , 250 p M d G T P in 50 m M N a C l , 34 m M T r i s - H C l p H 8.3, 6 m M M g C l , 5 m M 2  D T T ) , a n d G M i x (12.5  p,M d d G T P , 250 p,M d C T P , 250 \M d T T P , 250 u M d G T P in 50 m M N a C l ,  34 m M T r i s - H C l p H 8.3, 6 m M M g C l , 5 m M D T T ) . Incubation was at 3 7 ° C for 15 m m , followed 2  b y the addition of 1 pi Chase M i x ( 2 m M d A T P , 2 m M d T T P , 2 m M d C T P , 2 m M d G T P , 50 m M N a C l , 34 m M T r i s - H C l p H 8.3, 6 m M M g C l , 5 m M D T T ) , a n d i n c u b a t i o n at 3 7 ° C for a further 15 2  m i n . T h e reactions were stopped b y the a d d i t i o n of 5 ul Stop S o l u t i o n (98%  f o r m a m i d e , 10 m M  E D T A , 0.3% xylene cyanol, 0.3% b r o m o p h e n o l blue), heated to 9 5 ° C for 3 m i n . and 2.5 pi of each sample was electrophoresed on p o l y a c r y l a m i d e sequencing gels.  R N A sequencing R N A was sequenced with the P r o m e g a K / R T sequencing system. 5 pg of R N A was m i x e d with 5 n g of p r i m e r , 1 pi of 10X R T Buffer (500 m M N a C l , 340 m M T r i s - H C l p H 8.3, 60 m M M g C l , 2  50 m M D T T ) i n a final volume of 10 pi. A n n e a l i n g reactions were heated to 8 5 ° C , and allowed to cool to 4 2 ° C over 30 m i n . T o each tube was a d d e d 1 pi 100 m M D T T , a n d 5 units of A M V Reverse T r a n s c r i p t a s e ( P h a r m a c i a ) . Reactions were then identical to those described for D N A sequencing.  PRIMER EXTENSIONS P r i m e r extensions were effected b y a modification of the protocol for R N A sequencing, using the P r o m e g a K / R T sequencing kit. A n n e a l i n g reactions were essentially the same. T h e protocol e m p l o y e d a primer that was 5' end labelled, as previously described. F o r the extension reaction, the nil  a d d i t i o n of [ a - ° ^ P ] d A T P  was o m i t t e d , a n d instead the m i x t u r e was extended i n the presence of 3 pi  of Chase M i x . R e s u l t a n t D N A s were treated a n d electrophoresed as for sequencing reactions.  74  Materials and Methods  CL ONED DNA FRA GMENTS  Preparation of Recombinant D N A Procedures were essentially as described b y M a n i a t i s et al (1982). V e c t o r s , exclusively p U C 18, 19 a n d M 1 3 m p l 8 a n d 19, were cut. with appropriate, restriction enzymes, a n d treated with C I A P . A p p r o p r i a t e a m o u n t s of gel p u r i f i e d G e n e C l e a n e d ( B i o 101 Inc., L a J o l l a , C A ) inserts were ligated (10 units ligase, in 66 m M T r i s - H C l p H 7.6, 5 m M M g C l , 5 m M D T T , 1 m M A T P ) at R T for 3 hrs, 2  and the resultant D N A s were heated to 6 5 ° C for 5 m i n . prior to being used to t r a n s f o r m  competent  E. coli.  Competent E. coli C o m p e t e n t cells were prepared as described previously (Messing, 1983). 50 m l cultures were incubated  at  37°C  until  the O D Q Q Q  of the cultures  was 0.5  to 0.6.  Cells were  collected  by  centrifugation at 2.5 k r p m in an H B - 4 rotor at 4 ° C for 5 m i n . , a n d were gently resuspended in 25 m l ice cold CaClr,. Cells were, i n c u b a t e d on ice for 30 m i n . , a n d were again collected b y centrifugation. Cells were resuspended  in 5 m l ice cold C a C l ^ .  300 ul aliquots were m i x e d with D N A ligation  reactions, i n c u b a t e d on ice for 60 m i n . , a n d heat shocked at 4 2 ° C for 2 m i n . p U C transformants were i n c u b a t e d w i t h 500 ul L B r o t h at 3 7 ° C for 30 m i n , then dilutions were plated on plates containing 10 ul I P T G , 50 pi X - G a l , a n d 50 p g / m l a m p i c i l l i n . M 1 3 transformations were i m m e d i a t e l y m i x e d i n an overlayer c o n t a i n i n g 10 pi 100 m M I P T G (Isopropyl-(3-thiogalactopyranoside),  50 pi X - G a l  (5-Bromo-  4-Chloro-3-Indolyl-f3-D-Galactoside, 10 m g / m l i n d i m e t h l y f o r m a m i d e ) , a n d 200 pi of host cells, grown f r o m m i n i m a l A m e d i u m ) , a n d dilutions were p l a t e d . R e c o m b i n a n t phage were identified as clear plaques, a n d further characterized as to the presence of the correct inserts.  75  Materials and Methods  Probes A d i a g r a m of the. p U C a n d M 13 subclones of kaiilo is presented in figure 10. Some clones were gifts f r o m H . B e r t r a n d , and are i n d i c a t e d as s u c h . m t D N A  cloned restriction fragments  Hind  111-13,18 a n d H i n d III-7c used in this s t u d y are also gifts f r o m H . B e r t r a n d . T h e clone p J R - 2 is the cloned glutamate dehydrodgenase gene f r o m  N. crassa  f r o m J . R a m b o s e k . T h e 7 kb r D N A cluster of  ( K i n s e y a n d R a m b o s e k , 1984), a n d was a gift  C. elelgans was a gift from B. Honda.  76  Materials and Methods Figure 10. Subclones of kaiilo D N A  A restriction map of kaiilo is presented in the upper part of the figure. The regions indicated by the lower case letters correspond to subcloned fragments of kaiilo generated for this study. The names of the cloned fragments are presented in the legend. The clones labelled o and p, namely pSYE-Ei and pSYE-Gi were generously provided by H. Bertrand.  a= pDVKI-KXl i=pDVX3 b=pDVX3-EXr J=pDVX1 c=pDVB4-EBl k=pDVX2b d=pDVB4-EBr 1=pDVX3-EXl e=pDVB3-BXl ffl=pDVX3 f=pDVB3-BXr n=pDVX4 9=pDVK1-XHr o=pSVE-Ei h=pDVX2a-EH p=pSVE-Gi  77  P a r t I: T r a n s c r i p t i o n a l Properties of k a l D N A  P A R T I: T R A N S C R I P T I O N A L P R O P E R T I E S O F K A L D N A  INTRODUCTION In this s t u d y ,  a full transcriptional  analysis of the kalilo p l a s m i d was u n d e r t a k e n . T h e  sequence of the 9 k b p l a s m i d was not k n o w n when this work was b e g u n , a n d further, the p l a s m i d was t h o u g h t to reside i n the nucleus as well as the m i t o c h o n d r i o n ( B e r t r a n d et al, 1 9 8 6 ) . Therefore, two  different  observations  patterns  of t r a n s c r i p t i o n  h a d suggested  that,  were  transcription  expected,  nuclear  and mitochondrial. Preliminary  of the kalilo p l a s m i d was complex.  Given  this  i n f o r m a t i o n , a n d the relationship of kalilo t o linear viruses, it was suspected that there w o u l d be i n f o r m a t i o n available f r o m the transcription of the p l a s m i d that was not available f r o m the sequence data, a n d it was of interest  t o determine h o w the element was t r a n s c r i b e d . It was expected  that  m u l t i p l y processed transcripts a n d regulation at the level of t r a n s c r i p t i o n w o u l d be seen. T h e s e ideas are relevant even t h o u g h the sequence of the p l a s m i d has now been d e t e r m i n e d a n d describes only two large O R F s . because  a n u m b e r of smaller O R F s are apparent, a n d these could be t r a n s c r i b e d  and processed into larger O R F s . F o r instance, the m R N A s for the t e r m i n a l protein and the D N A polymerase of the A d e n o v i r u s arise from differential splicing of the same transcription unit ( S t i l l m a n , 1983). T h e experiments described in this section were designed to f i n d f u n c t i o n a l units or genes o n the kalilo p l a s m i d . T h e y include the following experiments.  A complete n o r t h e r n blot analysis of  R N A f r o m a n u m b e r of different strains a n d subcultures was prepared t o identify transcripts a n d t o detect a n y t e m p o r a l or developmental regulation. T h e p r e p a r a t i o n of R N A f r o m different subcellular c o m p a r t m e n t s was u n d e r t a k e n to separate nuclear f r o m cytoplasmic functions. A transcript m a p was generated  v i a transcript  m a p p i n g techniques to determine how the complex R N A sequences  were  related to the linear p l a s m i d . T h i s analysis suggested experiments that led to the identification of a  78  P a r t I: T r a n s c r i p t i o n a l Properties of k a l D N A possible p r o m o t e r .  F i n a l l y , an experiment  to determine the effect of inserts of m t l S - k a l D N A  on  m i t o c h o n d r i a l t r a n s c r i p t i o n is presented.  RESULTS  Characterization of Transcription  Detection of Transcription Pattern The  initial  step  in  i d e n t i f y i n g functions  encoded  in  kalilo  was  the  identification  transcripts. T h e goal was to identify all possible transcripts, and to ensure t h a t the transcripts  of  were  i n i t i a t e d w i t h i n the p l a s m i d , not R N A s that h a d arisen via r e a d - t h r o u g h of inserted copies of the p l a s m i d , m t l S - k a l D N A . F i g u r e 11 presents northerns of R N A f r o m a n u m b e r of senescent a n d subcultures  of  Neurospora intermedia.  strains  T h e blot was probed w i t h a c o m b i n a t i o n of probes  containing the restriction fragments X 3 , E , and G (these probes are described in figure 5), w h i c h cover all b u t the t e r m i n a l 300 b p of kalilo. The. use of a. n u m b e r of strain types and probes was t o ensure that all possible transcripts, detected.  F i g u r e 11 demonstrates  kalilo-homologous R N A appears difficult to see. L a n e 595-1  and any strain or subculture dependent, differences would be  a. n u m b e r of things about the t r a n s c r i p t i o n of kalilo. F i r s t , heterogeneous,  or highly degraded, a n d specific bands are  the  often  of figure 11 is one in w h i c h the bands are relatively clear, and bands of  the following molecular weight are apparent: 4.4,  4.0,  3.5, 2.0,  1.3,  1.2,  a n d 0.9 k b . E x p e r i m e n t s  to  address the quality of the R N A and the possibility of R N A and r R N A artefacts will be presented later in the thesis. T h e same p a t t e r n of h y b r i d i z a t i o n exists for lane 572-6, a l t h o u g h the recovery of kalilo t r a n s c r i p t i o n p r o d u c t s i n this strain was somewhat reduced, a n d the b a n d s are m u c h fainter. T h e s u b c u l t u r e series, f r o m strain 561 indicates t h a t transcription level increases as a culture ages,  79  P a r t I: T r a n s c r i p t i o n a l Properties of k a l D N A f r o m undetectable transcripts i n lane 561-1, to the heavy level of heterogeneous t r a n s c r i p t i o n seen i n lanes 561-7 a n d 561-8. T h i s increase (Bertrand  i n t r a n s c r i p t i o n level parallels the increase  in m t l S - k a l D N A  et al, 1985; 1986) a n d m t A R - k a l D N A ( P a r t II of this work) t h a t is o c c u r r i n g at this time.  Lanes 561-8, 572-6, a n d 595-1 are the last subcultures f r o m w h i c h nucleic acid can be prepared i n these strains; they are senescent subcultures. T h e observation that the level of t r a n s c r i p t i o n changes  as a culture ages is an i m p o r t a n t  one. It presents the following d i l e m m a i n this system. Because the level of t r a n s c r i p t i o n of kalilo is increasing w i t h culture age, it is often difficult to find a culture w h i c h expresses kalilo  transcripts  strongly, a n d is not too close to death t o be easily c u l t u r e d . T o this e n d m u c h of the work in this thesis has been performed o n subculture produces  little  7 of strain  c o n i d i a , two of the manifestations  561  (561-7).  of senescence  However, 561-7 is sterile a n d (reviewed  by Bertrand,  1983).  Therefore, even t h o u g h 561-7 expresses kalilo R N A strongly, a n d can be c u l t u r e d relatively easily, it is clearly a senescent culture.  80  P a r t I: T r a n s c r i p t i o n a l Properties of k a l D N A  Figure 11. Occurrence of Transcripts of Kaiilo from Different Series and Strains of TV. intermedia  N o r t h e r n A n a l y s i s of a s u b c u l t u r e series a n d three senescent strains of TV.  intermedia  are  presented. Senescent Strains 561. 572, a n d 595 have been described previously ( B e r t r a n d et al, 1985; 1986). T h e dashed n u m b e r s refer to the s u b c u l t u r e . S u b c u l t u r e s 561-8, 572-6, a n d 595-1 are the final cultures f r o m w h i c h nucleic acid can be p r e p a r e d . 20 ng of total cellular R N A was loaded i n each lane. T h e probe was a c o m b i n a t i o n of restriction fragments X 3 , E , a n d G (shown i n figure 5), w h i c h are homologous to all b u t the t e r m i n a l 0.3 k b of the element. T h e B R L R N A ladder is shown as a molecular weight marker on the left, a n d the apparent molecular weight of the transcripts is shown on the right, b y the arrows. T h e h y b r i d i z a t i o n s shown are meant to be qualitative, not quantitative.  81  ladder  I  561-1 561-7 561-8  P a r t I: T r a n s c r i p t i o n a l Properties of k a l D N A  Figure 12: Northern Background is Not Due to Low R N A Quality  Northern  analysis  of different  R N A types.  Strains  561-7 a n d 595 have  been  described  previously; strain 605 is a non-senescent control w h i c h has never been f o u n d t o harbor kalilo. In the total R N A p a n e l , all lanes contain 20 pg total R N A ; In the m t R . N A p a n e l , lanes 605 a n d 561-7 contain 1 pg m t R N A , while lane 595-1 contains 5 pg m t R N A . T h e u p p e r panels have been p r o b e d w i t h the c o m b i n a t i o n of probes X 3 , E , a n d G (shown in figure 5), w h i c h cover all b u t the t e r m i n a l 300 b p of kalilo. In the lower panel the R N A samples have been p r o b e d w i t h other non-kalilo clones to determine  the state of the R N A ; the m t R N A  fragment homologous t o the C O I transcript  has been  (Burger  reprobed w i t h the H i n d  and Rambosek,  1984).  T h e hybridizations shown  quantitative.  83  mtDNA  et al, 1985), a n d the total cellular R N A has  been reprobed w i t h a nuclear D N A clone for the a m (glutamate dehydrogenase) (Kinsey  7  are  meant  to  be  gene of A . r  crassa  qualitative,  not  ^in  3 in  S mS  VD  ID  S  5 KD  P a r t I: T r a n s c r i p t i o n a l Properties of k a l D N A F o r u n k n o w n reasons, a n d possibly because of these c u l t u r i n g p r o b l e m s , there is v a r i a b i l i t y in the patterns seen in n o r t h e r n blots of R N A f r o m kaiilo strains. F o r reasons t h a t will become clearer with d a t a to be presented in later figures, the p a t t e r n of t r a n s c r i p t i o n seen i n lanes 561-7, 561-8, 572-6, a n d 595-1 is considered to be the same.  F c r instance, figure 19 of the transcript  m a p p i n g section details northerns of strain 561-7 R N A in which the 4.4 a n d 4.0 k b transcripts are readily apparent. O n l y the level of t r a n s c r i p t i o n a n d the level of b a c k g r o u n d is thought to differ between strains.  N o other  transcripts  have  ever  been seen,  b u t repeat  experiments  eventually  confirm the presence of the 7 previously m e n t i o n e d transcripts. It appears t h a t the 4.4 a n d 4.0 k b transcripts are always variable i n separate experiments, a n d often are difficult or impossible t o see above the b a c k g r o u n d h y b r i d i z a t i o n . Reasons for this are explored in the discussion, b u t m a y result from  such  explanations  as incomplete  transfer  of these  high  molecular  weight  transcripts  to  m e m b r a n e s , or their v a r y i n g levels in i n d i v i d u a l cultures. T h i s v a r i a b i l i t y in the detection of the high molecular weight transcripts extends to a final hypothesized transcript. A full-length transcript of 8.6 k b can just be seen in lanes 561-7 and 561-8, and a. long exposure of a blot which exhibits the transcript can be seen i n figure 14. T h i s transcript is often of too low a copy n u m b e r to be seen, or transfers to m e m b r a n e s very poorly, and more experiments to c o n f i r m its presence are presented in figure 23 of the t r a n s c r i p t m a p p i n g section. T h i s brings the total n u m b e r of transcripts homologous to the element t o eight. In s u m m a r y , kaiilo specific R N A is h i g h l y heterogeneous, a n d the t r a n s c r i p t i o n level increases as a culture ages. K a i i l o strains of N . i n t e r m e d i a are f o u n d to contain eight apparent kaiilo transcripts of 8.6, 4.4, 4.0, 3.5, 2.0, 1.3,  1.2,  a n d 0.9  k b , although the 4.4  a n d 4.0 k b transcripts  are not always detectable  above  b a c k g r o u n d h y b r i d i z a t i o n , a n d the 8.6 k b transcript is often of t w o low of a copy n u m b e r to be seen in a n o r t h e r n b l o t .  85  P a r t I: T r a n s c r i p t i o n a l Properties of k a l D N A  Kalilo-Specific RNA ts Unstable F u r t h e r characterization  of the R N A f r o m senescent strains of  N. intermedia  leads t o the  conclusion t h a t kalilo-specific R N A is selectively unstable in senescent strains. In this section it is shown that R N A w h i c h is not homologous to kaiilo appears intact, a n d that the heterogeneity a n d high b a c k g r o u n d are not due to washing or cross h y b r i d i z a t i o n problems, a n d not due t o the readt h r o u g h i n t o m t l S - k a l D N A b y the m i t o c h o n d r i a l t r a n s c r i p t i o n a p p a r a t u s . Figure  12  characterizes  total  cellular  R N A and mitochondrial  R N A (mtRNA)  from  senescent a n d non-senescent strains w i t h kaiilo a n d n o n - k a l i l o D N A probes. T h i s figure demonstrates that the b a c k g r o u n d a n d heterogeneity  seen in the R N A is not due to the cross h y b r i d i z a t i o n of  kaiilo probes to other non-specific R N A , because h y b r i d i z a t i o n to non-senescent control strain 605 is not seen, neither in the total R N A nor the m t R N A  p a n e l . In the total R N A panel, b o t h of the  senescent strains presented, 595-1, a n d 561-7 give rise to heterogeneous b a c k g r o u n d i n w h i c h the 4.4 and 4.0 kb transcripts  are not readily apparent. T h i s observation emphasizes the variable nature of  the b a c k g r o u n d h y b r i d i z a t i o n , because of the differences seen in the h y b r i d i z a t i o n pattern  between  these lanes in figures 11 a n d 12. However, when r e h y b r i d i z e d w i t h a clone homologous to the single copy nuclear a m gene of  Neurospora crassa  ( K i n s e y a n d R a m b o s e k , 1984) in the lower p o r t i o n of the  figure, all three samples of R N A appear intact. It is apparent f r o m figures 11 a n d 12 that northerns p r o b e d w i t h kaiilo probes give rise to autoradiographs  in w h i c h the bands are often fuzzy a n d  partially obscured by b a c k g r o u n d h y b r i d i z a t i o n . A n effect of this type has been noted in the analysis of other m i t o c h o n d r i a l a n d / o r linear d s D N A plasmids ( A k i n s et al, 1989; T r a y n o r a n d Levings, 1986; P a n d e et al, 1989). A k i n s et al (1989) suggested that the p r o b l e m inherent in the i n a b i l i t y to o b t a i n discrete bands o n northerns was that senescent m y c e l i a contain elevated levels of R N A s e  activity.  W h i l e this m a y be true, it does not explain the observation t h a t the same n o r t h e r n samples appear completely n o r m a l when h y b r i d i z e d w i t h non-kalilo specific probes. Therefore, the b a c k g r o u n d a n d  86  P a r t I: T r a n s c r i p t i o n a l Properties of k a l D N A degradation seen when kalilo specific probes are used is not due to the degradation of the R N A d u r i n g the isolation procedure, and m u s t be an inherent quality of the R N A . T h e same effects  are seen i n the m t R N A p a n e l , in w h i c h the h y b r i d i z a t i o n p a t t e r n s  again variable. A l t h o u g h the m t R N A , mtDNA  probe homologous to the  probed i n the lower p a n e l w i t h the  cytochrome  oxidase  I ( C O I)  transcript  N. crassa (Burger  are  H i n d III-7  et al, 1985),  appears intact, the use of kalilo specific probes i n the u p p e r p a n e l again leads to northerns w i t h high b a c k g r o u n d i n w h i c h distinct bands are difficult to see. In the 561-7 are apparent, while the 595-1  lane, only the smallest.  RNAs  lane again details b a n d s that are difficult to see above b a c k g r o u n d . A  n u m b e r of considerations have led to the decision not to use m t R N A  for the r e m a i n d e r of the  experiments in this section. T h e first was the general technical p r o b l e m of isolating large n u m b e r s of m i t o c h o n d r i a f r o m some of the senescent strains. T h e second was the feeling that total R N A gave better results a n d was generally less variable t h a n m t R N A i n kalilo p r o b e d northerns. T h i s idea was reinforced b y the consideration that if the kalilo R N A was selectively unstable, t h e n the process of isolating m i t o c h o n d r i a , w h i c h requires long sucrose gradient centrifugations, w o u l d exacerbate this p r o b l e m . T h i s was suggested  by such results as the lack of the 3.5  and 2.0  kb transcripts  in the  m t R N A panel, lane 561-7. T h e lack of these bands will be addressed more fully in the discussion. A t t e m p t s to remove the b a c k g r o u n d by increasingly stringent washes r e m o v e d probe equally f r o m all areas of the blots (figure 13), therefore it does not appear that the smearing observed is due to some cross h y b r i d i z a t i o n . It should also be noted that cross h y b r i d i z a t i o n of kalilo probes w i t h R N A f r o m non-senescent strain 605 has never been observed. F i g u r e 13 was exposed to allow for the identification of detail i n the lower p o r t i o n of the figure, a n d high molecular weight transcripts  are  too faint to be seen. F i g u r e 14 is a longer exposure of the blot f r o m figure 13. T w o increasingly longer exposures are presented, as this blot concerns the full length transcript, w h i c h can be seen i n panels b a n d c. In this blot, and in others, the high molecular weight smearing is always seen to extend u p  87  Part. I: T r a n s c r i p t i o n a l Properties of k a l D N A to the  8.6  kb region. A l s o ,  the 4.4  a n d 4.0  k b transcripts  become more a p p a r e n t  in the  long  exposures in panels b a n d c. N o change i n the h y b r i d i z a t i o n level was seen for non-senescent control strain  605.  A n a l y s e s of this type  strengthen  the  conviction that  the  pattern  of t r a n s c r i p t i o n  m e n t i o n e d for figure 11 is ubiquitous a m o n g the senescent strains, a n d that, the high b a c k g r o u n d present in these strains c o m b i n e d with the low copy n u m b e r a n d / o r transfer p r o b l e m s make the detection of these high molecular weight transcripts difficult.  88  P a r t I: T r a n s c r i p t i o n a l Properties of k a l D N A  Figure 13. Increasingly Stringent Washes of a Northern Remove Probe Equally from A l l Areas of a Blot.  20 p-g of total R N A f r o m each of the. i n d i c a t e d strains was used in a n o r t h e r n p r o b e d w i t h a c o m b i n a t i o n of kaiilo probes X 3 , E a n d G (figure 5) and the panels were treated as follows: P a n e l A was washed for 1 hr. at 65 degrees C i n 0.1 X S S C , a n d a u t o r a d i o g r a p h y was overnight w i t h o u t an intensifying screen. P a n e l B was washed for 1 hr. at 75 degrees C in 0.1 X S S C and a u t o r a d i o g r a p h y was overnight  w i t h an intensifying screen.  P a n e l C was washed for 1 hr. at  85  degrees C  and  a u t o r a d i o g r a p h y was for several nights with an i n t e n s i f y i n g screen. A longer exposure of this figure, showing detail i n the high molecular weight region, is presented in figure 14.  89  561-7 605  561-7  CO  605  561-7  o  605  P r r « vo roco s  H i  C O * * "_• • CflCD*  P a r t I: T r a n s c r i p t i o n a l Properties of k a l D N A  Figure 14. The 8.6 kb Transcript is Apparent Upon Long Exposures of a Northern Blot.  T h i s figure is composed of longer exposures  of the northern blot presented  in panel B  of  figure 13. 20 pg of total R N A f r o m the two i n d i c a t e d strains was used in a n o r t h e r n blot p r o b e d w i t h a c o m b i n a t i o n of probes X 3 , E , and G (shown in figure 5). P a n e l a has been exposed to show detail in the low molecular weight region, while panels b a n d c are increasingly long exposures w h i c h detail the emergence of the high molecular weight transcripts. T h e numbers on the right are the molecular weights of the  transcripts.  91  apparent  561-7 665 561-7 685 561-7  GT  n t  t  t  t CO  cr  685  P a r t I: T r a n s c r i p t i o n a l Properties of k a l D N A Because kalilo persists as a m t D N A insertion sequence, m t l S - k a l D N A , it could be expected that t r a n s c r i p t i o n a l read-through i n t o the inserted sequences f r o m adjacent the heterogeneity  f o u n d in the R N A . T h e m t D N A of  Neurospora  D N A could be causing  is transcribed almost fully f r o m  several points, a n d then processed i n t o discrete transcripts (Reviewed by N e l s o n a n d M a c i n o , 1985). It is known that, kalilo affects t r a n s c r i p t i o n in the region i n w h i c h it is inserted (to be presented in figure 27), kalDNA  therefore, the heterogeneity seen in the R N A could be caused b y interactions of m t l S -  w i t h the  transcription apparatus  for the  mtDNA  region in w h i c h it is inserted.  These  interactions could include kalilo-directed t r a n s c r i p t i o n t e r m i n a t i o n , p r o m o t i o n , a n d errant splicing of the nascent m t R N A s . T o this e n d , presenescent strains were generated w h i c h do not have' detectable inserts of kalilo. F i g u r e 15 is a d i a g r a m of the restriction digest p r o t o c o l that can be used to detect the presence  of m t l S - k a l D N A i n the m t D N A in a S o u t h e r n B l o t , a n d figure 16 characterizes  the  m t D N A f r o m the control strain 605 a n d several senescent strains. F r o m figure 15 it can be seen that the probe, X 3 , has homology to the inverted repeats of kalilo. Therefore in a restriction  digest,  it will h y b r i d i z e to all restriction fragments  w h i c h have  homology to the inverted repeats. In a B g l II digest, the restriction fragments of the linear p l a s m i d which h y b r i d i z e to X 3 are b l and b2, the ends of the linear p l a s m i d . However, m t l S - k a l D N A not give rise to b l and b2 u p o n digestion with B g l II. Instead, it gives rise to two k a l D N A j u n c t i o n fragments, b l ' a n d b2', which m u s t be of equal  does  mtDNA/mtlS-  or greater molecular weight than  b l a n d b2. T h e r e f o r e , in a S o u t h e r n blot of B g l II digested m t D N A p r o b e d w i t h X 3 , the presence of two b a n d s ( b l a n d b2) suggests t h a t no insert of kalilo is present, while the presence of other bands ( b l ' a n d b2') confirms the presence of m t l S - k a l D N A . T h e occurrence of b l ' a n d b 2 ' w h i c h are equal in size to b l a n d b2 is relatively unlikely, and could be checked u s i n g another restriction e n z y m e to digest the m t D N A , instead of B g l II.  9 3  P a r t I: T r a n s c r i p t i o n a l Properties of k a l D N A  Figure 15. Diagram of the Generation of b l ' and b2' Junction Fragments for the Detection of m t l S - k a l D N A .  mtAR-kalDNA, kalDNA,  a mtDNA  the  linear p l a s m i d , is d i a g r a m m e d  insertion sequence,  is d i a g r a m m e d  at  in the the  top  of the  figure, and  mtlS-  bottom  of the  figure. T h e kaiilo  inverted repeat probe, X 3 , is shown, b l , b2, b3 a n d b4, are B g l II restriction fragments of the linear p l a s m i d , as s h o w n , b l ' a n d b 2 ' are the restriction fragments  p r o d u c e d b y B g l II digestion of the  m t D N A c o n t a i n i n g an insert of m t l S - k a l D N A . T h e relative sizes of b l ' a n d b 2 ' are variable and are dependent, on the distance to the next B g l II site i n the m t D N A .  94  Part I: Transcriptional Properties of kalDNA  X3 X  X  B  B  b2 1  b4 1  B  b3 1  «tAR-kalDNA  X3  fttlS-kalDNA  95  bl  1 kb  P a r t I: T r a n s c r i p t i o n a l Properties of k a l D N A  Figure 16. Characterization of m t D N A from Strains that Do Not Have Detectable Inserts of Kaiilo.  U n c u t a n d B g l II digested profiles of m t D N A  f r o m strains 605, 561-7, X l - 5 , a n d 1-4 are  presented. A n e t h i d i u m b r o m i d e stained gel is shown i n the left p a n e l , a n d an autoradiograph is shown on the right. T h e S o u t h e r n has been p r o b e d w i t h the X 3 clone; conditions w h i c h must exist for the occurrence of bands b l , b2, b l ' a n d b 2 ' i n the X 3 probed S o u t h e r n blot are shown in figure 15. Strains 1-4 a n d X l - 5 are the j u v e n i l e progeny of crosses using strain 561 as the female  parent,  and are described more fully in the second part of the thesis. In the u n c u t lanes, additional b a n d s are present  in a d d i t i o n to the high molecular weight nucleic acid. T h e s e correspond to the free  p l a s m i d , m t A R - k a l D N A , a n d a second m i t o c h o n d r i a l p l a s m i d , designated p l a s m i d , unconnected to senescence ( B e r t r a n d et al, 1985; 1986).  96  -17-  P a r t I: T r a n s c r i p t i o n a l Properties of k a l D N A  Figure 17. Northern Analysis of Strains That Do Not Contain m t l S - k a l D N A .  Lanes i n panel A contains 20 \ig of total R N A f r o m each of the i n d i c a t e d strains. Strains T-4 and  Xl-5  are  the juvenile progeny  of crosses using strain  561  as  the  female parent,  and  were  i n t r o d u c e d i n the c a p t i o n to figure 16. T h e R N A illustrated i n this p a n e l was isolated f r o m the same culture as that used to make the D N A characterized i n figure 16. P a n e l A has been p r o b e d w i t h kaiilo probe X 3 (shown i n figure 5). In p a n e l B , the blot was s t r i p p e d of probe and r e h y b r i d i z e d w i t h a nuclear D N A clone homologous to the a m (glutamate dehydrogenase)  gene of N. crassa ( K i n s e y  and R a m b o s e k , 1984). T h e arrow indicates the a m transcript; the presence of other apparent b a n d s is addressed i n the text. P a n e l C is a composite of X 3 p r o b e d autoradiographs of v a r y i n g exposures w h i c h has been assembled to illustrate the p a t t e r n  of R N A s detected  in the northern blots. T h e  n u m b e r s on the right indicate the apparent molecular weight of the transcripts in lane 595-1.  98  P a r t I: T r a n s c r i p t i o n a l Properties of k a l D N A F i g u r e 16 characterizes inserts of m t l S - k a l D N A .  several strains using the previously m e n t i o n e d protocol to assay for  In a d d i t i o n to the B g l II digested lanes, replicate  lanes were r u n w i t h  undigested D N A . T h i s is another protocol for the detection of inserts, because in a strain w i t h o u t inserts a kalilo specific probe s h o u l d h y b r i d i z e only t o the free p l a s m i d a n d not to high molecular weight m a t e r i a l  (mtDNA),  a n d in strains  w h i c h have inserts  the free p l a s m i d a n d the  mtDNA  should b o t h become labelled. F r o m the e t h i d i u m b r o m i d e stained p o r t i o n of the gel, free plasmids can readily be seen i n lanes 561-7 a n d 1-4, while they are absent in non-senescent  control lane 605.  T h e X l - 5 lane seems too c o n t a m i n a t e d w i t h nuclear D N A , or degraded, to make f i r m conclusions. T h e B g l II digested lanes show that the m t D N A is digested into 14 B g l II fragments for control strain 605, while more fragments are apparent for the p l a s m i d c o n t a i n i n g strains. These b a n d s are discussed i n more detail in figure 38 i n part II of the thesis. T h e X 3 p r o b e d autoradiograph t h a t t h e free p l a s m i d becomes labelled i n lanes 561-7, 1-4, a n d X l - 5 . T h e u n c u t m t D N A labelled in lane 561-7, unlabelled i n lane 1-4, a n d f i r m conclusions cannot  shows appears  be d r a w n due t o high  b a c k g r o u n d i n lane X l - 5 . T h e B g l II digested D N A s clearly show four b a n d s in lane 561-7, a n d only two bands b l a n d b'2 in lane 1-4, while lane X l - 5 is again difficult to assess because, of b a c k g r o u n d . H y b r i d i z a t i o n to control D N A in lane 605 is never observed. T h i s is interpreted to mean t h a t there is no detectable  insert of m t l S - k a l D N A  in strain 1-4 at least, a n d p r o b a b l y i n strain X l - 5 . T h e  m t D N A f r o m strain X l - 5 is characterized again in figure 30, where it is f o u n d t o have no detectable insert.  Therefore strain  1-4 a n d X l - 5 contain  only m t A R - k a l D N A  at the detection  level of the  southern blot. If  the  reason  for the  heterogeneity  of the  R N A seen  t r a n s c r i p t i o n a l read t h r o u g h into m t l S - k a l D N A f r o m adjacent  in northern  blots  is  D N A , t h e n strains without  due t o inserts  should have m u c h cleaner n o r t h e r n blots. N o r t h e r n s are presented i n figure 17 that c o n t a i n R N A prepared f r o m the same cultures as those used for the preparation of D N A s shown in figure 16.  100  P a r t I: T r a n s c r i p t i o n a l Properties of k a l D N A T h e s e cultures were split into t w o aliquots, one for D N A isolation, a n d one for R N A isolation, to ensure t h a t no  de novo  inserts arose d u r i n g culture g r o w t h . In figure 1 7 A , it can be seen that the  level of t r a n s c r i p t i o n i n strains 1-4 a n d X l - 5 is very low, because the positive control, lane 561-7, is extremely overexposed while the transcripts f r o m strain 1-4 are barely detectable.  It is i m m e d i a t e l y  apparent f r o m this figure that the integrity of the R N A has not i m p r o v e d , a n d the northerns are still fuzzy. F i g u r e 17B confirms that the a m gene m R N A is a discrete b a n d a n d that the R N A is still intact,  therefore  the heterogeneity  seen in the R N A is still not due t o degradation  of the R N A  d u r i n g the isolation procedure. T h e kalilo-specific probe was incompletely s t r i p p e d f r o m figure 17B, a n d some kaiilo bands are still slightly radioactive i n lane 561-7. In figure 1 7 C a panel composed of a longer exposure of the kaiilo p r o b e d 1-4 a n d X l - 5 lanes of the n o r t h e r n is aligned w i t h a northern, p r e p a r e d w i t h R N A f r o m strain 595-1 for c o m p a r i s o n . A l t h o u g h bands are impossible to see in the lanes f r o m strains w i t h o u t detectable inserts of k a l D N A (1-4 a n d X l - 5 ) , the smear is reminiscent of the p a t t e r n of t r a n s c r i p t i o n seen in older subcultures. A g a i n it s h o u l d be emphasized that because these are juvenile strains, the t r a n s c r i p t i o n levels are very low, a n d long a u t o r a d i o g r a p h  exposure  times are required for h y b r i d i z a t i o n to be seen. T h i s is interpreted to m e a n that the linear p l a s m i d is t r a n s c r i b e d , a n d that the high b a c k g r o u n d seen in kaiilo R N A is an inherent quality of the R N A transcribed  f r o m this element,  a n d not due to read-through  of inserts  of m t l S - k a l D N A  in the  m t D N A , because no m t l S - k a l D N A is thought t o be present. A final observation f r o m figure 17 is t h a t the transcription of kaiilo is complex. T h e probe used i n figure 17, X 3 , picks u p the same transcripts as the c o m b i n a t i o n of probes X 3 + E + G used in figures 11-16. P r o b e X 3 is specific for the inverted repeat of kaiilo, therefore all k n o w n transcripts contain sequences homologous to the inverted repeat. E x p e r i m e n t s t o delineate the transcript m a p are presented i n the transcript m a p p i n g section.  101  Part I: Transcriptional Properties of kalDNA Transcription levels An experiment to characterize the level of transcription is the dotblot of various RNA types presented in figure 18. The scale presented in the figure illustrates that the intensity of a dot correlates with increasing concentration of sequences of interest. This figure confirms that the RNA levels are increasing along a subculture series (as a culture ages) as shown for the 561 series. The long exposure shown in part B of the figure confirms that transcripts can be detected in the youngest member of a senescent strain, suggesting that if any kalilo sequences are present, they will be transcribed, albeit at low levels. The level of hybridization is found once again to be very low in the strains without detectable inserts, Xl-5 and 1-4. Hybridization is never seen with non-senescent control strain 605 in part B of the figure. Finally, there has been some confusion as to the cellular location of the kalilo plasmid. To this end, the RNA types used to generate the data in figure 18 contain a number of the subsets of the RNA population. It can be seen that although kalilo is enriched in poly A+ RNA, and is seen in total RNA, the analysis of RNA types confirms that the highest level of hybridization is found in the mitochondrion, confirming the mitochondrial location of kalilo. . The kalilo sequence is 70% A : T (Chan et al, 1989b), and contains long runs of A or T residues, and the enrichment of kalilo-specific. transcripts seen after passage of senescent RNA through an oligo dT-cellulose column probably reflects association of these sequence elements with the column, rather than polyadenylation of the transcripts. Artifactual isolation of poly A+ RNA in a linear plasmid system has been suggested previously (Stark et al, 1984). Further, the increase in hybridization is approximately two-fold, not the twenty fold one expects for fully polyadenylated mRNAs, and mitochondrial transcripts are not polyadenylated in Neurospora. It should also be noted from the poly A- RNA that kalilo-specific transcripts were not completely removed from the RNA by repeated passage through oligo(dT)cellulose, therefore these transcripts are not expected to be found to be polyadenylated.  102  P a r t I: T r a n s c r i p t i o n a l Properties of k a l D N A  Figure 18. Dotblots of Various R N A Samples  5 ng of each of the indicated R N A  samples were i m m o b i l i z e d on filters. T o create the scale,  the i n d i c a t e d a m o u n t s of the cloned fragment X 3 were m i x e d with 5p,g t R N A , a n d blotted o n t o the filter. T h e scale confirms that increasing concentration  of sequences of interest leads to increasing  intensity of the signal. T h e filter was probed w i t h X 3 .  P a r t B is a. longer exposure of some of the  dots i n part A .  103  Senescent Series (total RNA)  0  RNA types (561-7)  Senescent strains (total RNA)  Total  •  572-6  •  A-  •  1-4  561-6  •  A+  •  595-1  561-4  Q  mtRNA  •  Xl-5  •  •  561-8  W  £  561-7  •  56f-2  1  Scale  1 18 38 188 388 1 3 18 188 pg pg pg pg pg ng ng ng ng  Senescent Series (total RNA) 561-6 561-4 56f-2  1 16 38 168 pg pg pg pg  685 total RNA  P a r t I: T r a n s c r i p t i o n a l Properties of k a l D N A In this section it was shown t h a t kaiilo specific R N A is selectively unstable, or exists as a heterogeneous p o p u l a t i o n of molecules. T h i s was shown not to be due to degradation of R N A d u r i n g R N A isolation b y figure 12, and not due to incomplete washing of strips or cross h y b r i d i z a t i o n s i n figures 13 a n d 14. Figures 16 a n d 17 c o n f i r m that the R N A heterogeneity  is p r o b a b l y not due to  t r a n s c r i p t i o n a l r e a d - t h r o u g h into m t l S - k a l D N A f r o m adjacent D N A , a n d that there m u s t be some other cause, s u c h as instability of the R N A , for the quality of northerns p r o b e d with kalilo-specific probes. It also suggests that the free m i t o c h o n d r i a l p l a s m i d is t r a n s c r i b e d , although at what level it is t r a n s c r i b e d  cannot  be easily d e t e r m i n e d . In figure 18 kaiilo homologous R N A sequences  were  f o u n d i n all k a l i l o - h a r b o u r i n g strains, t r a n s c r i p t i o n was f o u n d to increase along a s u b c u l t u r e series, and the major site of transcription was f o u n d to be the m i t o c h o n d r i o n , as could be expected f r o m the  cellular  heterogeneous  location  of  kaiilo.  Finally  this  section  has  identified  that  amongst  this  highly  b a c k g r o u n d there are eight p r e d o m i n a n t transcripts of kaiilo, of 8.6, 4.4, 4.0, 3.5,  2.0,  1.3, 1.2, a n d 0.9 k b .  Mapping of Transcripts  Mapping Experiments T r a n s c r i p t s were initially m a p p e d using double stranded  D N A subclones of kaiilo D N A .  F i g u r e 19 demonstrates the pattern of h y b r i d i z a t i o n seen when a n u m b e r of different subclones of kaiilo were used as probes in a n o r t h e r n . Panels a a n d g i n the figure show the same p a t t e r n h y b r i d i z a t i o n , i n w h i c h the seven transcripts Both  probes  a  and  g contain  discussion of figure 17,  inverted  all transcripts  are apparent, of 4.4, 4.0,  repeat  sequences,  and  contain homology to the  as  3.5, 2.0,  1.3,  mentioned  direct  of  1.2, a n d 0.9 k b .  previously i n  the  repeats. P a n e l g has  not  h y b r i d i z e d well in the high molecular weight region, a n d P a n e l h is a long exposure of the same blot  105  Part. I: T r a n s c r i p t i o n a l Properties of k a l D N A i n which  the  4.4  kb transcript  is apparent.  Panels b , c,  a n d d all show the  same p a t t e r n  of  h y b r i d i z a t i o n , i n which the 4.4, 3.5, a n d 2.0 kb b a n d s are apparent. Panels e a n d f are also similar; they show h y b r i d i z a t i o n to the 4.0, 3.5, a n d 2.0 kb transcripts. T h e apparent complex nature of the t r a n s c r i p t i o n p a t t e r n is confirmed i n p a n e l c, i n which a 300 bp probe is found to be homologous to a s u m of almost 10 kb of transcripts. F o r ease of analysis, figure 20 is a d i a g r a m of the blots presented here. F i n a l observations f r o m figure 19 are t h a t P o l y A - f a n d total R N A are presented, c o n f i r m i n g the dotblot analysis of the various R N A fractions i n figure 18, and that the sample loaded i n t o lane iii of panel a has been treated with R N A s e - f r e e - D N A s e , confirming t h a t the apparent transcripts are not i n a d v e r t a n t l y isolated D N A s .  106  P a r t 1: T r a n s c r i p t i o n a l Properties of k a l D N A  Figure 19. Northern Analysis Using Many Different Subclones of Kalilo.  A l l lanes contain R N A f r o m strain 561-7. Lanes m a r k e d " i " contain 20 |ig total R N A , lanes m a r k e d " i i " contain  10 pg of poly A +  R N A , and lanes m a r k e d  " i i i " contain 20 ug of total R N A  which was treated w i t h R N a s e free D N a s e I ( B R L ) , prior to electrophoresis.  Panels a to g were all  p r o b e d w i t h different subclones of kalilo. T h e probe used i n each panel is i n d i c a t e d on the map  of k a l D N A  transcripts,  shown i n the  lower part of the figure. T h e apparent  molecular  restriction  weights  of the  based on the B R L R N A ladder, are shown on the left. P a n e l h is a longer exposure of  panel g.  107  P a r t I: T r a n s c r i p t i o n a l Properties of k a l D N A  Figure 20. A Diagram of the Pattern of Hybridization of Many Different Subclones of Kaiilo to R N A .  A  d i a g r a m of the pattern  of bands seen in figure 19 is s h o w n . E a c h  lane, a t h r o u g h  corresponds to a single lane f r o m the corresponding panel in figure 17, and the apparent weight of transcripts  molecular  detected b y the probe used in that lane are i n d i c a t e d . T h e probes used  shown in the restriction  m a p of k a l D N A i n the lower part of the figure. T h e apparent  weight of the R N A is shown on the right.  109  g,  are  molecular  Part I: Transcriptional Properties of kalDNA  d  e  f  9  " kb 4.4 4.8 3.5  8.3  KX  E X  J  B  L  EB 1 1  X  X  B J  no  HE I  XK  1 kb  Part I: Transcriptional Properties of kalDNA The diagram in figure 20 is a representation of the relative location of the transcripts seen in the gels which were presented in figure 19. From figure 20 it can be seen that the shortest transcripts, of 1.3, 1.2, and 0.9 kb are seen only when probes are used which have homology to the direct repeats, and must map entirely within the 1.3 kb terminally inverted repeats of kaiilo. The two largest transcripts, of 4.4 and 4.0 kb clearly map to the left and right of the element as presented. They cover almost the entire 8.6 kb element, and because of their size they must contain almost the entire inverted repeats; the ends of these transcripts must lie close to the telomeres of kaiilo, and close to either side of the central Xba I site. Finally, the 3.5 and 2.0 kb transcripts are homologous to every subclone of kaiilo tested, over the entire 8.6 kb element. While it is possible that these two apparent transcripts are composed of a number of small exons from throughout the element, it  will be shown in figures to follow that these bands most likely represent artifactual  comigration of sequences of interest with the rRNAs. Figure 21 utilizes single stranded probes made from M13 subclones of kaiilo to confer strand specificity on the transcripts. The "b" strand of clone X3 in the figure hybridizes to all known transcripts while its homolog, the "a" strand, picks up nothing. This suggests that all of the transcripts are transcribed from one strand of the inverted repeat, and that the three small transcripts, of 1.3, 1.2, and 0.9 are all truncated versions of the larger transcript, because they are composed of the same DNA sequences as the larger transcripts. The direction of transcription is from the ends of the element, towards the center. Strand " d " of clone XI, and strand "e" of clone X2b confirm that the 4.0 and 4.4 kb transcripts are transcribed from opposite strands of the DNA, the direction of transcription being from the termini towards the center of the element. This situation is consistent with the transcription map presented in figure 24 in which all transcripts axe promoted from single promoters located near each end of the element, toward the center.  Ill  Part. I: Transcriptional Properties of kalDNA Figure 21. Use of M13 ssDNA Probes in Northern Blots to Confer Strand Specificity on the Transcripts.  (A) In this restriction map of kalilo, the probes have identical polarity to the indicated sequences and were made radioactive by cloning a homolog into M13 and extending a primer in the presence of "P dATP, according to the probe preparation protocols in the materials and methods. (B) 20 pg of total RNA from the indicated strains was used to prepare the northern blots shown. The letter above each panel refers to a probe of the indicated polarity shown in (A). The apparent molecular weight of the transcripts are shown on the left, and the transcripts detected by each single  1  stranded probe are indicated by arrows.  112  CO * • • U S  *  •  *  sr 7Z  561-7  DC  1605  I  I en  561-7  3  605  .CD  I  561-7 00  685  l u Ico  561-7 605  •• §  561-7 605  561-7 605  UJ  to.  fD  Ii  CD  Part I: Transcriptional Properties of kalDNA Figure 22. The 2.0 and 3.5 kb Transcripts Comigrate W i t h the 28S and 16S r R N A s of Neurospora.  20 p,g of total RNA from the indicated strains was used in preparation of the northern blot. Replicate lanes are shown for stain 561-7. The probes used in the two panels are indicated on the bottom. The X3 probe is shown in figure 5. The rRNA probe is the 7.0 kb rDNA cluster from C . elegans (Files and Hirsh, 1981). The rRNAs are indicated on the left and the apparent molecular weight of the transcripts is shown on the right.  114  N  in  in in  CD  X  VO  so in  in  in  CD  ** 4.4 •* 4.0 ^.3.5  2 8 S * * *  2.0 1.3 1.2 -* 0.9  16S  rRNA  -us-  X3  Part I: Transcriptional Properties of kalDNA While the probes made from single stranded internal fragments correctly map the two large transcripts to the strands of DNA corresponding to their respective ORFS, the results suggest that the 2.0 and the 3.5 kb transcripts map to both strands of the DNA, or that each band represents more than one transcript. Figures 19 and 20 suggested that these transcripts would have to be composed of many small exons, and in addition this figure would require that these transcripts be composed of sequences from different strands of DNA, or that they be trans-spliced. While this is possible, it is much more likely that these bands are not discrete kaiilo transcripts, but represent the comigration of sequences of interest with the rRNAs. An important observation is that the 2.0 and 3.5 kb bands are always seen together, and are only seen when at least one other kaiilo homologous transcript is present. This suggests that these are not unique transcripts, but rather transcripts whose apparent molecular weight seems altered due to comigration with the rRNAs. In figure 22, the northern shown has been probed with the. 7.0 kb rDNA cluster from C. elegans (Files and Hirsh, 1981). It can be seen that the comigration of the two unmappable bands with the rRNA bands is exact. Although cross hybridization of probes with the rRNA bands from strain P605 has never been seen, it appears that somehow the kaiilo specific RNA of senescent strains can associate strongly with the rRNA and migrate with it such that its apparent molecular weight is altered. The results of figures 19, 20, 21 and 22 lead to the conclusion that the 2.0 and 3.5 kb bands are indeed artifacts. In an attempt to ascertain whether a full length transcript existed, SI nuclease protection experiments were performed as shown in figure 23. The two restriction fragments shown underneath the restriction map of kaiilo in figure 23A were chosen because they represented the extreme right and left hand fragments of the single copy region of kaiilo DNA. Figure 23B shows a protocol for the preparation of the probes in this experiment. Each probe is a uniquely end-labelled probe. The two probes are specific for the same strand of kaiilo DNA. If single promoter sequences are present near the ends of kaiilo, as hypothesized, then these probes can only be protected by an RNA which spans  116  P a r t I: T r a n s c r i p t i o n a l Properties of k a l D N A the whole single copy region of kaiilo. In an SI protection assay, they will o n l y pick u p a transcript that is initiated f r o m the promoter at the left of the restriction m a p as s h o w n in figure 2 3 A . T h e 5' and  3' labelled replicates of each p l a s m i d are specific for transcripts  reading out of, a n d into each  fragment, respectively. T h e s e probes are designed such that detection of full length protection of the cloned fragment  b y R N A is easily distinguishable f r o m full length protection  b y the D N A probe  reannealing, because D N A can protect the whole probe, while only part of the probe codes for R N A . C o n s e q u e n t l y , the top b a n d in each lane, i n figure 2 3 C , w h i c h corresponds to the single b a n d i n the control lane, is D N A : D N A  h y b r i d i z a t i o n , which is the  internal control. T h e second b a n d in the  experimental lanes corresponds to full length protection of the cloned fragment b y R N A .  117  Part 1: Transcriptional Properties of kalDNA Figure 23. SI Nuclease Analysis of Transcripts.  (A) The indicated cloned fragments have been used to make probes for SI nuclease determination of the existence of a full length transcript. Restriction enzymes are as follows: K, Kpn I; X, Xba I; E, Eco R l ; B, Bgl II; H, Hind III. (B) A protocol for the preparation of single end labelled probes. The plasmids were cut as shown and 3' or 5' labelled as described in the materials and methods with ""P dATP. The fragments were then digested at the Pvu II (P) sites, and the correct fragment was gel purified for use in an SI protection assay, as described in the materials and methods. (C) The autoradiographs of 2% agarose gels shown give the results of the SI protection experiments using the single end labelled probes shown in (B) above each lane. Molecular weight markers are shown. In each panel, lane 1 is a control to which only carrier RNA was added, and lanes 2, 3 and 4 contain 100, 500 and 1500 units of nuclease SI (BRL), respectively. The small arrows indicate the relevant bands seen, with the exception of panel 2, which has an extra band that is discussed in the text.  118  Part I: Transcriptional Properties of kalDNA Figure 24. Transcription M a p of Kalilo D N A  A restriction map of the linear plasmid, and the 8.6, 4.4. 4.0, 1.3, 1.2, and 0.9 kb transcripts are shown. The direction of transcription is indicated by the arrows. The 8.6 kb transcript is probably transcribed from both ends of the DNA, as shown. The "P" indicates a promoter which is hypothesized to exist at the 5' ends of kalilo.  120  Part. I: Transcriptional Properties of kalDNA The  nuclease SI insensitive fragments are shown in figure 23C. The first two panels  correspond to the 3' and 5' end-labelled versions of pDV-X3exr. Fulllength protection of the kaiilo specific portion of this fragment is expected by the 4.4 kb transcript. The fragment entirely encodes a portion of the transcript and it should be protected by it, however, any smaller protected pieces would have to be derived from splice sites for the generation of other transcripts. The result, as expected, is that only full length protection of the fragment is seen. Smaller labelled fragments seen in lane 4 of the second panel are expected to correspond to nuclease SI attack of A : T rich regions and are not due to valid R N A protection, because the digestion has occurred in a region of the probe which was only homologous to the D N A vector and not homologous to kaiilo R N A . The situation with the clone pDV-klher  is somewhat different. By design, this labelled  fragment can only be protected by transcripts reading into the fragment from the left, and the only promoter is hypothesized to be 7 kb away. The result, that full length protection of both of the fragments is observed, can be explained only if all of both labelled versions of the restriction fragment code for an exon of a processed transcript, if a transcript is promoted from an internal promoter and/or if there is a full length transcript. The results in panels 3 and 4 are consistent with the hypothesis that there is an R N A species which at least spans the central single copy region of kaiilo, between the two Eco R l sites seen in figure 23A. A processed transcript, or transcripts promoted from an internal promoter are not believed to exist. Were there an internal promoter, then the transcript it represents is of too low a copy number to have been detected in the northern blots shown in the other transcript mapping experiments (figures 19, 20 and 21). Similarly, a processed transcript has not been detected, but a full length transcript is seen in some kalilo-probed northern blots, and the protection of clone p D V - K l h e r seen in the SI protection assay is most likely due to the existence of the full length transcript.  122  P a r t I: T r a n s c r i p t i o n a l Properties of k a l D N A  Transcription Map A s u m m a r y of the transcript m a p p i n g d a t a is shown i n figure 24. It is proposed that the and  3.5  kb transcripts  are  artifacts a n d t h a t  the  transcription  map  shown in figure  complete t r a n s c r i p t i o n m a p , and that there are only six discrete transcripts 4.4,  4.0,  1.3,  1.2,  where the 1.3, 4.4  a n d 4.0  12  2.0  is  the  of kalilo D N A , of  8.6,  a n d 0.9 k b . T h e absolute location of the transcripts was shown in figures 19 and  20,  1.2 a n d 0.9 kb transcripts were f o u n d to m a p exclusively to the direct repeats, a n d the  kb transcripts  were f o u n d to m a p to the left a n d right of the element as shown. T h e  direction of t r a n s c r i p t i o n was shown in figure 21,  where it was f o u n d t h a t the two large  transcripts  m a p p e d to opposite strands of the D N A , a n d t h a t all transcripts h a d 5' ends near the t e r m i n i of the p l a s m i d . T h e presence of the full length transcript was suggested in figures 11 and 14, and confirmed b y SI nuclease analysis in figure 23. regions. T h e 1.3,  1.2  and 0.9  T h e 4.0  a n d 4.4  kb begin a n d terminate  promoters are extended to yield the 8.6  kb transcript  kb transcripts  correspond to O R F s i n their  entirely w i t h i n the T I R . P r e s u m a b l y ,  both  and it is composed of transcripts made f r o m  b o t h strands of D N A .  Identification of a 5' R N A E n d  Primer Extension Reactions G i v e n t h a t the 5' ends of the kalilo transcripts m a p p e d so closely to the ends of the element, it was of interest to determine  structures or sequences  t r a n s c r i p t i o n . P r i m e r s were designed at 91 a n d  237  w h i c h were responsible for p r o m o t i n g of  nucleotides f r o m the ends of the element,  and  were used for primer extension a n d R N A sequencing of the R N A (the sequences of the primers a n d of the D N A i n the t e r m i n a l region of kalilo are s h o w n i n figure 26).  T w o primers were required,  because the originally designed primer i n a d v e r t e n t l y overlapped the 5' R N A end delineated b y the  123  Part I. Transcriptional Properties of kalDNA second primer; the primer at 237 indicated a 5' RNA end at nucleotide position 101, while the primer at 91, which overlaps this region, failed to extend any reactions. The reactions for the oligonucleotides at position 237 and 91 are shown in figure 25. While the RNA sequencing reaction shown in panel 1 of figure 25 failed to give any readable sequence, the upper band is the point at which all reactions terminated, at the A residue after a string of 4 Cs. This is interpreted to mean that there is a 5' RNA end 101 nucleotides from the end of kalilo at which all of the RNA sequencing extensions ended, an experiment analogous to a primer extension. This site is confirmed in panel 5, where primer extension experiments using 5' end labelled primers yielded identical 5' RNA ends for RNA from three different strains of N. intermedia, 561-7, Xl-5, and 1-4, and no other bands are apparent above or below the indicated band. Even though the region prior to the proposed 5' RNA end has a site of secondary structure at the four Cs in the DNA sequence in panel 4 of figure 25, it is clear that the RNA end in panel 1 is beyond that site. An RNA end in this region is consistent with the observation that no extensions were ever observed using the 91 primer, which overlaps this site. It is proposed that the site at nucleotide 101 is the true 5' RNA site.  124  Part. I: Transcriptional Properties of kalDNA Figure 25. 5' E n d Mapping of the Kaiilo Transcripts by Primer Extension Analysis.  Panels 1, 2, 3, and 4 are primer extensions in the presence of the dideoxy nucleotide indicated above each lane. Panels 1 and 2 contain RNA from strain 561-7 (RNA sequencing), while panels 3 and 4 contain DNA sequences from DNA clone K l . K l , from figure 5 in the introduction, is a subclone of mtlS-kalDNA that contains mtDNA, thus allowing for the determination of sequences (or primer extension events) at the termini of the kaiilo plasmid, and beyond. Lanes 1 and 4 are RNA and DNA sequences, respectively, primed from a reaction using the #237 primer, while lanes 2 and 3 are RNA and DNA sequences, respectively, using the #91 primer. The locations of these two primers are illustrated in figure 26. The #91 primer failed to extend any RNA reactions, as it overlaps the 5' RNA end indicated by the #237 primer, as shown in figure 26. In panel 5, primer extension reactions, utilizing an end-labelled primer according to the materials and methods, are shown using the #237 primer for 1-4 total RNA (lane a), Xl-5 total RNA (lane b) and 561-7 total RNA (lane c).  125  Part I: Transcriptional Properties of kalDNA Figure 26. Sequence Around the Major 5' R N A E n d of Kalilo  Sequence analysis of the terminal regions of kalilo. (A) The sequence of the first 300 bp of kalilo is given and the locations of the #91 and #237 primers are shown. The double arrow is the inferred transcription start site from figure 25. (B) A comparison of the region around the kalilo transcription start site with some known and suspected promoters. S-2 is the region upstream from the transcription start site of the S-2 mitochondrial plasmid of maize (Traynor and Levings, 1986). Kluyveromyces promoter is the conserved sequence from the promoters of the K l killer linear DNA plasmid from Kluyveromyces lactis (Sor and Fukuhara, 1985) The putative yeast mitochondrial promoter  was described by Osinga and Tabak, (1982). The underlined region is a yeast  mitochondrial promoter consensus sequence that was identified later (Osinga et al, 1984). The asterisks indicate matches between the indicated sequence and the kalilo sequence. The. numbers in parentheses is the distance of the 3' end of the indicated sequence from the transcription start site. The designation tel indicates the end of the plasmid. (C) Direct repeats in the upstream sequences of kalilo and the S-2 plasmid. The asterisks indicate matches between the outer and inner sequences. The numbers in parentheses are the distances of the indicated sequence end from the ends of the plasmid.  127  5ccf:i  CACCACTGACI^CTTTTGTTCCT A  A  10  20  A  38  Primer € 91>  A  A  A  40  50  69  GGTGTGGGATTA CCCCTCTAT T T GC . II  II  II  L M  |  | | | |  | | | |  |  | | | | |  PTrTPti^TTTTTRATTTTTTrftTTTTTftTACCAL^CL^TflflTGS^ftGftTflftftr.RTrTTT A  70  A  A  80  A  90  tt  110  A  120  ATCGCCCCATGGTGGGGTAGAATATCCCACCTTGAGTAATGATTCCAGGGATACAATCAG A  A  130  140  158  A  160  A  178  A  A  A  A  A  A  190  208  210  220  230  A  180 CTC I I I GGTAGTGGGTAGCATTATTAAATCTGGGTACCGGTGTACGTGTGTGGTATTGTCTAAGAG A  248  TGTGTGCCAACGATTCCC -Primer <2 237 III11II I III I III 111 ACACACGGTTGCTAAGGGAAAGTATTCAATGTAATGTCCATGAGTGAATTTAAGCGAACT A  250  B  A  A  260  270  A  280  A  i  290  300  CATTTTTATACCACACCC Ckalilo] (100) ** * * CACATGTCCAATCTACAT S-2 ACTATAATATATG  Kluueromyces promoter  TTATTATATATATAAGTA Yeast mitochondrial promoter tel CACCACACCC TG  C  Ckalilo] < 12)  ( 34)  TTTGTGATCTTTTT-TATCAT-TTCTAGTA-CTCT CTC *** * * * * * * * * * * * * * * * * * * * * * * * ( 68) TTTT-TGA—TTTTT-T-TCAT-TTTTA-TACCACACCCT & & & & j.  ( 13 )  j, £££*|.ib  TTTTGT-TCCTATTTTA  Jr jk}kjk  ACCC  t e l - AAAGTATACAAGC-ACAT m  (18)  ********  GT—CCAATCTACAT  ( 67)} < 101)1 ( 33), (17) (38)  Ckalilo]  P a r t I: T r a n s c r i p t i o n a l Properties of k a l D N A  Promoter Sequences F i g u r e 2 6 A shows the sequence a r o u n d the 5' R N A e n d , a n d figure 26B is a c o m p a r i s o n of the sequence a r o u n d the kalilo R N A start site a n d other p u t a t i v e promoters. K a l i l o does not seem to share extensive similarities w i t h a n y of the promoters or u p s t r e a m sequences described for other linear  plasmids. T h e sequence  approximately  shown in  figure  26B for the yeast  Kluyveromyces lactis  occurs  10 nucleotides f r o m the 5' R N A start, site in all four promoters of the K 2 killer  p l a s m i d a n d it has been identified as a promoter element for the p l a s m i d s in that s y s t e m (Sor a n d Fukuhara,  1985). T h i s is the first linear p l a s m i d promoter to be identified, a n d it does not show  homology t o kalilo. However p r o m o t e r homologies m a y not be expected between these two systems, because the  Kluyveromyces  p l a s m i d s are not f o u n d in the m i t o c h o n d r i o n , a n d because this promoter  is capable of f o r m i n g a secondary structure w h i c h the kalilo p l a s m i d lacks. A 5' R N A start site has recently  been  identified  for the S-2 m i t o c h o n d r i a l p l a s m i d  (Traynor  arid  Levings, 1986). T h e  sequences u p s t r e a m of the R N A start site in the maize s y s t e m do not show any similarity to the kalilo sequences either, although the t w o m i t o c h o n d r i a l p l a s m i d s m i g h t be expected to have similar promoters. A m i t o c h o n d r i a l promoter element, has been described for yeast ( O s i n g a et al, 1984). T h e consensus sequence which is found at the beginning of all m i t o c h o n d r i a l t r a n s c r i p t i o n units forms part  of a larger  mitochondrial  sequence  rRNA  genes  similarity t o the r R N A kalilo  sequence  that  was previously f o u n d  ( O s i n g a a n d T a b a k , 1982).  5' to the t r a n s c r i p t i o n start Interestingly,  site for the  the kalilo 5' region shows  u p s t r e a m regions, b u t not to the yeast p r o m o t e r itself. Neither does t h e  share  TTAGARR(T/G)R(T/G)A  similarity  with  the  N.  crassa  mitochondrial  promoter,  ( K e n n e l a n d L a m b o w i t z , 1989). A h o m o l o g y t h a t has been identified is  that of the kalilo 5' region w i t h regions further u p s t r e a m . T h e sequence at the very e n d of the p l a s m i d is almost identical to the region exactly preceding the 5' R N A start site. T h i s d u p l i c a t i o n seems to be a general one for, as figure 2 6 C shows, the 5' regions of b o t h kalilo a n d the S-2 p l a s m i d  129  Part I: Transcriptional Properties of kalDNA seem to contain direct repeats. It is not known if these repeats have any bearing on the promotion of transcription in these plasmids, but the striking kaiilo repeats, each approximately 30 bp long, would be expected to have some function.  Interactions with m t D N A One further experiment was performed to determine kalilo's interaction with the resident mitochondrial transcription apparatus. It was of interest to identify the pattern of transcription of the mitochondrial genes in the region surrounding an insert of kaiilo. It was suspected that kaiilo would affect RNA transcription and processing in these regions not only because of simple insertional mutagenesis of the local mtDNA sequence, but because of the long inverted repeats of mtDNA that kaiilo generates upon insertion (shown in figure 6 in the introduction). Figure 27 is a northern blot of mtRNA from senescent and non-senescent strains of N. intermedia which was probed with a radioactive DNA homologous to the intron of the 25S rRNA gene. Strain 561 has an insert of kaiilo DNA into this intron (Bertrand et al, 1985; 1986). It can be seen that there are major differences in the patterns of transcription between senescent and non-senescent control lanes. Specifically, the intron of the 25S rRNA gene, which is the mRNA for the ribosomal S-5 protein, has multiple bands in lanes 561-7 and 561-8, while in control strain 605 only a single band is apparent. The changes are more severe in lane 561-8 than 561-7, suggesting that the alterations are becoming more severe as the culture ages. Much research has been done on the splicing of this intron. Interestingly, mutations which affect the splicing of this intron generally lead to higher molecular weight splicing intermediates (Bertrand et al, 1982). However, it appears as though the effect that kaiilo is having on the transcription in the region is complex, because no high-molecular-weight splicing intermediates are seen, and instead multiple RNAs are apparent, which do not? correspond to known splice sites. There is also a transcript which seems to be a number of nucleotides larger  130  Part. I: Transcriptional Properties of kalDNA than the wild type version of the 25S rRNA intron. It is unclear how a 8.6 kb insertion into the region should lead to these changes but it would be of interest to determine how kalilo is directing these transcriptional anomalies. For instance, kalilo may be capable of acting as a transcription promoter, terminator or splice site for RNA transcribed from the surrounding mtDNA region, and the long inverted repeats of mtDNA that surround mtlS-kalDNA would be expected to cause some of the changes of the type seen in the transcription pattern.  131  P a r t I: T r a n s c r i p t i o n a l Properties of k a l D N A  Figure 27. Northern Analysis of the m t D N A Region Surrounding the Insert of Kaiilo in Strain 561-7.  Total  R N A f r o m the i n d i c a t e d  strains  was used  t o prepare  the autoradiograph  of the  111-13, 18,  w h i c h is  northern blot s h o w n . T h e northern blot was p r o b e d with the m t D N A clone H i n d specific for the r R N A i n t r o n , as s h o w n . In  Neurospora, this intron is stable as the m R N A for  the S-5 ribosomal protein.  132  00  J-  J.  in  ^  ^  fl  in  i n o  kb 2.3  rRNA intron < S - 5 mRNA)  Hind 111—13, 18  Part I: Transcriptional Properties of kalDNA DISCUSSION The kaliio plasmid of Neurospora intermedia was found to encode constituitive transcripts with the following molecular weights: 0.9, 1.2, 1.3, 4.0, 4.4, and 8.6 kb. Two bands at 2.0 and 3.5 kb which were seen to comigrate with the rRNAs were hypothesized to be artifactual. Dot blots have confirmed the mitochondrial location of the plasmid, and that the plasmid is increasingly transcribed as a culture ages. Kalilo-specific RNA appears to be unstable in affected strains of Neurospora intermedia, as northerns probed with kalilo-specific probes have high background hybridization, and distinct bands are often difficult to see above this background. Non-kalilo specific transcripts do not seem to be affected in this manner. A transcript map was generated which found the 5' ends of all transcripts mapped closely to the ends of the linear plasmid. Primer extensions identified a unique 5' RNA end located in the TIR of kaiilo DNA. While the actual promoter is unknown, the sequence of the upstream regions from the 5' RNA start site has only short similarities with other putative promoters. The upstream sequence of kaiilo, beginning at termini of the plasmid and ending at the 5' RNA end, was found to contain several long directly repeated motifs.  Related Sequence Elements Repeated sequences associated with terminal regions have been identified in other linear dsDNA systems. The TIR of the phage Cp-1 is composed of directly repeated elements that encompass 50% of nucleotides of the 236 bp TIR (Escarmis et al, 1984). The Streptomyces rochei plasmid has a number of direct and inverted repeats in the 614 bp TIR (Hirochika et al, 1984). The purpose of this sequence motif is not clear, but a similar situation is found for the S-2 plasmid of maize (shown in figure 26C). Finally, the TIRs of the K. lactis plasmids, although they are not homologous and are not essentially promoter elements, are composed of many stretches of thymidine residues (Sor et al, 1983), a sequence that is reminiscent of the upstream sequence of kaiilo (figure  134  Part I: Transcriptional Properties of kalDNA 26A). Therefore this sequence structure may be a general one for these linear elements and the sequence in this area may help to classify the linear plasmids into discrete evolutionary groupings. An interesting finding is the repetition of a sequence in the promoter regions with a sequence at the termini of the linear plasmid. This suggests the possibility that the RNA polymerase may be bifunctional, and that some of the functions used for priming RNA transcription may also be used in the synthesis of the DNA. If this sequence is important for the binding of RNA polymerase to the DNA, then the binding of RNA polymerase to the telomeres of the kaiilo plasmid may have some as yet unknown function, such as opening up the ends of the DNA for replication. The observation that other linear plasmids have directly repeated elements in this region suggests that the mechanism may be a general one.  Transcription of Other Linear Plasmids The transcription map of kaiilo can be compared to that known for other linear plasmids. Almost all linear plasmids that have been characterized in this way are, or seem to be, promoted from  the termini of the plasmid towards the center. The situation in the S-2 plasmid of maize is very  similar to that of kaiilo. The 5' RNA start site for the two transcripts of the S-2 plasmid is found to be 32 nucleotides from the ends of the plasmid, in comparison to nucleotide 101 in the case of kaiilo. The S-2 transcripts terminate after transcribing their respective ORFs. The S-2 transcripts are 4.1 and 1.35 kb and encompass almost the entire 5.4 kb plasmid (Traynor and Levings, 1986). These transcripts are reminiscent of the 4.0 and 4.4 kb kaiilo transcripts, which encompass almost the entire 8.6 kb plasmid. The Claviceps purpurea plasmid, pClKl is almost fully transcribed into two transcripts of 3.5 and 3.15 kb which map to either end of the 6.7 kb plasmid, and several smaller RNAs are apparent (Diivell et al, 1988). Although unmapped, The Sorghum bicolor N-2 plasmid gives rise to two transcripts the sum of whose length is close to that of the plasmid, and are  135  Part. I: T r a n s c r i p t i o n a l Properties of k a l D N A consistent  with  this  scheme  Kluyveromyces lactis,  (Chase  and P r i n g ,  1986).  T r a n s c r i p t i o n of the killer  however, seems to be somewhat different. T h e killer p l a s m i d k l contains four  O R F s , none of w h i c h is p r o m o t e d f r o m w i t h i n the i n t e r n a l repeat 1985). A l s o , the  p l a s m i d s of  K. lactis  (figure 9; Sor a n d F u k u h a h r a ,  p l a s m i d is the only n o n - m i t o c h o n d r i a l example. Nonetheless, the  K. lactis  promoters d o show weak similarity to the S-2 a n d the kalilo u p s t r e a m sequences. T h e r e f o r e , amongst m i t o c h o n d r i a l linear plasmids, it is c o m m o n for the plasmid  to be t r a n s c r i b e d into two major  transcripts which cover almost, the entire length of the p l a s m i d .  Kalilo R N A Phenomena  Association of Kalilo Transcripts with rRNA T h e c o m i g r a t i o n of r R N A b a n d s a n d kalilo-specific R N A s of heterologous molecular weight has been reported here. W h i l e cross h y b r i d i z a t i o n of probes to r R N A b a n d s is not u n u s u a l , the case presented here is relatively extreme; often, only the artifactual b a n d s are seen o n a n o r t h e r n . T h e effect is seen w i t h every kalilo specific probe that is used, a n d cross-hybridization w i t h non-senescent control R N A has never been seen. E x p l a n a t i o n s w h i c h allow for the presence of discrete 2.0 a n d 3.5 kb transcripts a n d are consistent w i t h the e x p e r i m e n t a l data can be envisioned. F o r instance, the results shown i n figures 19, 20, 21 a n d 23 can be resolved if the b a n d s t h a t  are seen  in the  autoradiographs at 2.0 a n d 3.5 k b are not discrete b a n d s , b u t each b a n d consists of a n u m b e r of transcripts, a n d if each of the 4.0 a n d 4.4 k b transcripts has a t r u n c a t e d a n d processed 2.0 a n d 3.5 kb version. In light of the observation that all transcripts seen are t r u n c a t e d versions of the larger transcripts, this is a remote possibility. A n o t h e r possibility is t h a t kalilo transcripts could have the c a p a b i l i t y to trans-splice segments of themselves o n t o other R N A s . T h i s ability is k n o w n for another  Neurospora  m i t o c h o n d r i a l p l a s m i d , where a p l a s m i d specific, transcript has been f o u n d t o have a 5'  136  P a r t I: T r a n s c r i p t i o n a l Properties of k a l D N A leader derived f r o m the m i t o c h o n d r i a l r R N A  ( A k i n s et al, 1988). However, the simplest explanation  for the p r o m i n e n t 2.0 a n d 3.5 k b b a n d s i n northerns is t h a t this result is artifactual. T h e m e c h a n i s m is one whereby sequences of interest become t r a p p e d i n front of, or b o u n d w i t h i n the r R N A fraction as it migrates t h r o u g h a gel. Th<; close association of kaiilo a n d r R N A could be related t o the fact t h a t kaiilo a n d r R N A are b o t h A : T r i c h , a l t h o u g h cross h y b r i d i z a t i o n of kaiilo a n d r R N A of n o n senescent strains is not observed. F i n a l l y , T r a y n o r a n d Levings (1986) have described p r e d o m i n a n t 2.0 a n d 3.5 k b b a n d s in their discussion of their i n a b i l i t y t o produce discrete northerns f r o m the S - l p l a s m i d , a n d S t a r k et al (1984) have described r R N A artifacts i n K l - p r o b e d northerns of P o l y A +  Kluyveromyces lactis  R N A ; this suggests that the p r o b l e m m a y be a general one for this k i n d of  system. T h e hypothesis t h a t the 2.0 a n d 3.5 k b b a n d s are artifactual helps to explain some of the observations seen in the analysis of the different R N A fractions. T h e s e observations are t h a t the 2.0 and 3.5 k b b a n d s are missing in lane 561-7 of the m t R N A  panel of figure 12, a n d the general  observation t h a t poly A 4- R N A i m p r o v e d the appearance of the northerns. O n l y the 0.9, 1.2, a n d 1.3 kb transcripts  are apparent  m a p p i n g experiments  in the 561-7 lane f r o m the m t R N A  panel of figure. 12, although the  have shown that more transcripts s h o u l d be detected  b y the probes used in  that figure. W h e n the hypothesis that the 2.0 a n d 3.5 k b bands were formed b y comigration w i t h r R N A s is taken into account,  this observation can be explained as follows: L a n e 561-7 of m t R N A  p o r t i o n of the figure p r o b a b l y contains m t R N A t h a t was isolated relatively free of any c o n t a m i n a t i n g rRNA.  T h e 595-1 lane of m t R N A still exhibits p r o m i n e n t 2.0 a n d 3.5 k b b a n d s , so m i t o c h o n d r i a  were p r o b a b l y not purified free of ribosomes in t h a t lane of the figure. T h e hypothesis that the 595-1 lane  contains  rRNA,  a n d that  the 561-7 lane  does  not contain  rRNA  is consistent  w i t h the  observation t h a t although lane 595-1 of the m t R N A p a n e l contains 5 (ig of R N A , a n d the 561-7 lane contains  only  1 ng of R N A , they  appear  to have  137  similar a m o u n t s  of material  hybridizing  to  P a r t I: T r a n s c r i p t i o n a l Properties of k a l D N A m i t o c h o n d r i a l specific probes. T h i s can be seen in b o t h of the m t R N A h y b r i d i z a t i o n s , although there appears to be a greater a m o u n t of k a l i l o - h y b r i d i z i n g material i n the 595-1 the 595-1  lane. T h e e x t r a material in  R N A isolation is thought to be caused b y r R N A c o n t a m i n a t i o n . T h e r e f o r e , the missing 2.0  a n d 3.5 k b b a n d s i n lane 561-7 of the m t R N A p a n e l of figure 12 correlates w i t h the absence of r R N A in t h a t nucleic acid isolation. S i m i l a r l y , t h e use of poly A +  R N A was generally f o u n d to lead to an  increase i n the quality of the 4.4 a n d 4.0 kb b a n d s seen on a n o r t h e r n . In retrospect this too was p r o b a b l y due to the lower concentration of r R N A in the poly A +  R N A fraction, although figure 19  clearly shows that the P o l y A - f R N A still contained ample r R N A to cause the comigration of kalilospecific transcripts w i t h the r R N A . T h e use of total R N A in these experiments m a y have i n a d v e r t e n t l y led to an increase i n the presence  of the  experiments  prominent  2.0  and  3.5  kb  bands.  The  decision not  to  use  mtRNA  i n these  was based on the observation t h a t high molecular weight bands were almost  always  missing in preparations of m t R N A . T h e use of m t R N A m a y have led quickly to the conclusion that the 3.5  and 2.0  kb b a n d were artifacts,  but it is very difficult to detect the large transcripts  in  m t R N A . If the loss of the 8.6, 4.4, and 4.0 kb transcripts is due to the instability of the R N A d u r i n g the long centrifuga.tions required in the isolation of m i t o c h o n d r i a , then this is also a p r o b l e m . It was difficult to overcome these technical problems in this system, b u t it is thought t h a t the use of a total R N A isolation protocol w h i c h i n c l u d e d a quick freeze in liquid N  2  was justified as a solution to the  p r o b l e m of low quality R N A .  Variability and Heterogeneity of Kalilo-Specific RNA Several explanations for the heterogeneity tested.  A s Akins  et al (1989) have suggested,  seen i n the R N A f r o m this system have been  senescent m y c e l i a a n d / o r  mitochondria may  have  elevated levels of R N A s e activity, b u t if so, t h e n the R N A s e is acting preferentially on the kalilo-  138  P a r t I: T r a n s c r i p t i o n a l Properties of k a l D N A specific sequences, because as can be seen f r o m figure 12,  many non-plasmid  transcripts  appear  intact. A l t e r n a t i v e l y , the heterogeneity m a y have been due to interaction of inserted copies of the plasmid with strains of A . r  the m i t o c h o n d r i a l t r a n s c r i p t i o n a p p a r a t u s .  intermedia  However, because  R N A prepared from  without detectable inserts of the p l a s m i d does not appear any less degraded  t h a n that p r e p a r e d f r o m strains w i t h inserts (figures 16 a n d 17),  this does not appear t o be the  e x p l a n a t i o n . T h e conclusion that these strains d o not contain inserts is strengthened b y figure 30 in part II of the thesis, i n w h i c h the. experimentsothat show that these two strains (and others) do not have detectable inserts are repeated. E v e n if these strains contain undetectable levels of molecules w i t h inserts, this does not necessarily m e a n t h a t the heterogeneity seen in the R N A is f r o m the t r a n s c r i p t i o n a l r e a d - t h r o u g h of the inserts. T h i s conclusion is based u p o n two observations. T h e first is t h a t if r e a d - t h r o u g h of inserts is the source of the t r a n s c r i p t i o n seen i n figure 17, t h e n the a m o u n t of R N A being t r a n s c r i b e d f r o m these inserts a n d causing the heterogeneity is far in excess of the a m o u n t of D N A present, because blot technology can detect transcripts, b u t seems unable to detect inserts. T h e d o t b l o t in figure 18 confirms that detection of R N A and D N A species is comparable, therefore it is unlikely that a m i n u t e p o p u l a t i o n of m t D N A molecules with inserts would give rise to the heterogeneous  priori reason  R N A that is seen m figure 17.  T h e second consideration is t h a t there is no a  w h y inserts should be responsible for the heterogeneity seen in the R N A , it is merely a  possibility. Therefore even the presence of low a m o u n t s of m t l S - k a l D N A is not t h o u g h t to be crucial to the hypothesis t h a t kalilo-specific R N A is unstable i n affected strains of  N. intermedia.  R N A size heterogeneity has been seen i n other systems. M a i z e m t D N A contains inserts of b o t h S - l a n d S-2 D N A ( K e m b l e a n d M a n s ,  1983;  S c h a r d l et al, 1984), yet T r a y n o r a n d Levings  have reported t h a t only S - l R N A is highly heterogeneous, suggesting t h a t there m u s t be some other e x p l a n a t i o n for v a r i a b i l i t y in the R N A . T w o possibilities are that kaiilo R N A m u s t be selectively unstable, or the p l a s m i d transcription apparatus m a y be very inefficient, falling off at any time after  139  P a r t I: T r a n s c r i p t i o n a l Properties of k a l D N A transcript  i n i t i a t i o n . It  is interesting  to note that  despite  the state of the  R N A from northern  analysis, i n f o r m a t i o n is still obtainable f r o m transcript m a p p i n g techniques. T h e reasons for this are not  entirely  clear,  however,  long exposures  of b o t h  SI  protection  gels  and  primer  extension  experiments reveal b a c k g r o u n d h y b r i d i z a t i o n that is similar to that seen in n o r t h e r n blots ( d a t a not shown). T h e apparent  v a r i a b i l i t y in the ability to detect the presence of the 8.6,  4.4  and 4.0  kb  transcripts m a y have several sources. O n e explanation is t h a t they are s i m p l y of too low a level to be easily detected, a n d that there is usually a high enough b a c k g r o u n d that they cannot be seen above it. T h i s could be c o m p o u n d e d b y inefficiencies in the nucleic acids to m e m b r a n e s .  capillary blot m e t h o d used to transfer  A l t h o u g h m i l d alkaline hydrolysis was always e m p l o y e d to  the  improve  transfer of h i g h molecular weight R N A , this process m a y not always have been h i g h l y repeatable. M i l d variations i n the m o l a r i t y of the 50 m M N a O H used to hydrolyse the R N A , or fluctuations in the m o l a r i t y of the gel r u n n i n g buffer might have led to inefficient hydrolysis d u r i n g the alkaline treatment. A l s o , repeated reuse of the membranes m a y have led to decreasing h y b r i d i z a t i o n s in the high molecular weight region. F i n a l l y , it is also possible t h a t the 8.6, 4.4,  and 4.0 kb transcripts,  or  the b a c k g r o u n d R N A , have variable levels in culture, and t h a t is what is observed in specific blots, although it s h o u l d be noted that no easily identifiable differences were observed between different R N A isolations f r o m these senescent strains.  Possibility of Other RNAs T h e results presented here do not specifically exclude the possibility that there are other low level m R N A s f r o m the kalilo p l a s m i d . Indeed amongst the h i g h b a c k g r o u n d observed for the element there could be numerous transcripts,  albeit at low levels. T h e possibility of spliced transcripts  has  been excluded o n l y for splice sites w i t h i n the two restriction fragments used for nuclease S I analysis  140  P a r t I: T r a n s c r i p t i o n a l Properties of k a l D N A in figure 23. T h e existence of other promoters on the element is also a possibility, a l t h o u g h the presence of a full length transcript ensures t h a t the sequences are t r a n s c r i b e d i n t o R N A a n y w a y . In light of the fact that there is a p p a r e n t l y i n f o r m a t i o n missing which s h o u l d be required for the kalilo p l a s m i d to f u n c t i o n (e.g., the t e r m i n a l p r o t e i n m R N A ) , attractive.  H o w e v e r , other transcripts were not  the possibility of other transcripts seems  detected; multiple replicate n o r t h e r n blots have  never revealed one of these transcripts. T h e low copy n u m b e r of an u n d i s c o v e r e d transcript suggests t h a t it could not encode a s t r u c t u r a l f u n c t i o n of the p l a s m i d , a l t h o u g h it is possible t h a t a low copy n u m b e r t r a n s c r i p t could be translated at a very high level. F u r t h e r , now t h a t the sequence of the linear p l a s m i d is k n o w n , only O R F s c o r r e s p o n d i n g to the 4.4 a n d 4.0 kb transcripts are a p p a r e n t . T h e possibility of a m u l t i p l y processed transcript seems rare, because there are n o known sequence motifs for splice sites. It is for these reasons t h a t the t r a n s c r i p t i o n m a p s h o w n i n figure 24 is thought to be complete, a n d that, n o other kalilo m R N A s are t h o u g h t to exist.  RNA Phenomena from Other Systems A final note on strange p h e n o m e n a concerning the t r a n s c r i p t i o n of m i t o c h o n d r i a l plasmids occurs with the Labelle circular m i t o c h o n d r i a l p l a s m i d of  N. intermedia.  f o u n d to be t r a n s c r i b e d at a very low level, so researchers  e m p l o y e d the use of Bluescribe single-  T h i s plasmid has been  s t r a n d e d R N A probes labelled to high a c t i v i t y to probe n o r t h e r n blots. O n e s t r a n d corresponding to the O R F of this p l a s m i d , which the reader is r e m i n d e d resembles a group II i n t r o n , hybridizes to a heterogeneous family of R N A species. T h e s e R N A s range in size f r o m 1.5 to 4.1 k b , the largest of w h i c h resembles a full length transcript, a n d one major transcript is reported to be of 3.2 k b . It is not k n o w n if the smaller transcripts are discrete transcripts, incomplete transcripts, or degradation p r o d u c t s of the  larger  transcripts,  or possibly  artifacts  due to r R N A s  may  again be  involved.  A m a z i n g l y however, the opposite s t r a n d of the Bluescribe vector h y b r i d i z e s to a n u m b e r of high  141  P a r t I: T r a n s c r i p t i o n a l Properties of k a l D N A molecular  weight  nucleic acids  w h i c h were  not susceptible  to R N A s e  treatment,  a n d does not  h y b r i d i z e to R N A s . Therefore, the Labelle p l a s m i d gives rise to a n u m b e r of high molecular weight single stranded D N A s , a n d to a heterogeneous f a m i l y of degraded R N A s ( P a n d e et al, 1989). T h e suggestion  is t h a t  the peculiarities  discovered  in the kaiilo system  m a y be more  common  to  m i t o c h o n d r i a l biology t h a n previously k n o w n .  Evolution and Function T h e evolution of linear plasmids is an i n t r i g u i n g p h e n o m e n o n . Prokaryotes have examples of plasmids a n d viruses t h a t cytosolic plasmids  show a linear s t r u c t u r e .  (K. lactis  Eukaryotes  too, have viruses, ( A d e n o v i r u s ) ,  killer p l a s m i d s ) , a n d m i t o c h o n d r i a l plasmids that are linear. L i n e a r  plasmids f r o m diverse organisms have never been reported to have nucleotide homologies, however the s t r u c t u r a l similarities w h i c h exist amongst some of these elements is s t r i k i n g : linearity, cellular location, size, O R F location, protein sequence homologies, t r a n s c r i p t i o n properties, etc. T h i s suggests that the elements are somehow related, b u t how so is not clear. C o n v e r g e n t evolution of so m a n y elements  of this  type  is considered  unlikely,  because  of the unique e n d structure  homologies, however, it is possible. Some m i t o c h o n d r i a l elements are very ancient. In  and O R F  Neurospora  m i t o c h o n d r i a , the circular m i t o c h o n d r i a l plasmids have relationships to introns a n d mobile elements; they replicate v i a reverse t r a n s c r i p t i o n of full length R N A , a n d seem t o be related to the progenitors of certain introns ( N a r g a n g et al, 1984; P a n d e et al, 1989; A k i n s et al, 1988). If the m i t o c h o n d r i a l linear  plasmids were  also  m i t o c h o n d r i a l progenitors.  very  ancient,  B y analogy,  then  they  cytosolic  could  be related  or nuclear  to viruses  or plasmids of  D N A plasmids could be related  to  eukaryotic viruses. A s more a n d more of these elements are described (some m a y even be discovered in organisms where plasmids previously went undetected  (see C h a r d o n - L o r i a u x , 1 9 8 6 ;  1988; M y e r s et al, 1989)), t h e n their evolutionary origins m a y become  142  more  K e e n et al,  apparent,  a n d the  P a r t I: T r a n s c r i p t i o n a l Properties of k a l D N A identification of similarities based u p o n promoter usage or other criteria m a y help to delineate these plasmids into an evolutionary g r o u p i n g . In the p r o t o t y p i c senescence strain P561, m t l S - k a l D N A is f o u n d located i n the i n t r o n of the 25S r R N A gene. In  Neurospora  m i t o c h o n d r i a , this iiitron is found to encode an O R F that is thought  to be the gene for the S-5 r i b o s o m a l p r o t e i n . Therefore, the suppressive a c c u m u l a t i o n of m t D N A s w h i c h have this transcription  unit d i s r u p t e d is thought  to be deleterious for the o r g a n i s m . Y e t ,  m a n y other insertion sites of m t l S - k a l D N A are k n o w n , a n d i n d e e d , m a n y seem t o be i n t o regions of the m t D N A w h i c h do not encode a n y functions whatsoever. T h e reason t h a t these organisms s h o u l d die is not clear. Because kalilo insertion has such p r o f o u n d effects o n the transcripts originating f r o m the r i b o s o m a l i n t r o n region, the possibility exists that its deleterious nature in n o n - c o d i n g regions m a y be due t o the effect it has o n t r a n s c r i p t i o n a n d processing. O f course, these complex  changes  also m a y be due to the long inverted repeats of m t D N A t h a t kalilo generates u p o n insertion ( C h a n et. al, 1989a). K a l i l o is a linear p l a s m i d w i t h t e r m i n a l proteins w h i c h causes senescence in affected strains of  Neurospora intermedia  by insertion into the m i t o c h o n d r i a l chromosome,  subsequent generation of gross rearrangements  of the m t D N A  (Dasgupta  w h i c h leads  to the  et al, 1988). Y e t , for this  complicated lifestyle, kalilo is f o u n d to have only two O R F s , one a p o t e n t i a l D N A polymerase, and one an R N A polymerase ( C h a n a n d B e r t r a n d , 1988). B y the analysis of t r a n s c r i p t i o n of the element, it has been  determined  that  only the O R F s  are t r a n s c r i b e d ,  a n d that  no new i n f o r m a t i o n is  generated v i a R N A processing. T h i s leads t o some questions: for instance, what causes the u n i q u e insertion regimen ( D a s g u p t a et a l , 1988); where is the t e r m i n a l p r o t e i n encoded; a n d are other proteins  required  for m a i n t e n a n c e  of the  D N A plasmid?  A  number  of possibilities  present  themselves. F i r s t , some functions m a y be encoded by the nuclear a n d / o r m i t o c h o n d r i a l genome of affected strains, especially if kalilo is very ancient a n d coevolved w i t h m i t o c h o n d r i a . A p r e d i c t i o n of  143  Part. I: T r a n s c r i p t i o n a l Properties of k a l D N A this hypothesis is t h a t the p l a s m i d will not be m a i n t a i n e d in distantly related organisms,  because  this i n f o r m a t i o n will be missing. S e c o n d , if the insertion of kaiilo into the m t D N A were not inherent phenotypes of the p l a s m i d , then the kaiilo phenotypes of senescence a n d m t D N A would  be gratuitous  a n d would  be seen  w i t h other  rearrangements  mitochondrial plasmids. T h i s  is a distinct  possibility given that the m a r a n h a r p l a s m i d seems to yield a similar p h e n o t y p e a n d rearrangements, a l t h o u g h the two elements have n o sequence homology ( C o u r t et al, 1988). A t h i r d explanation for the missing information is that the identified kaiilo O R F s m a y encode proteins w i t h more t h a n one f u n c t i o n . D e m o n s t r a t i o n of this will require further e x p e r i m e n t a t i o n . F o u r t h , A m o n g s t the highly heterogeneous  kaiilo R N A there m a y be other  discrete  transcripts  w h i c h have gone  undetected.  W h i l e this is certainly a possibility, if the t e r m i n a l protein were encoded by one of these it w o u l d have t o be translated at a very high level, as it is a s t r u c t u r a l gene whose p r o d u c t is required at two copies  per D N A molecule.  Finally,  although  kaiilo  is found  to be copiously  transcribed,  the  transcripts corresponding to the O R F s are not the major transcripts, a n d further, they contain over one k b of 5' u n t r a n s l a t e d leader. T h e smaller transcripts  m a y have f u n c t i o n as well. D i i v e l l et al  (1988) have also reported small R N A species in a d d i t i o n to the large transcripts. C a t a l y t i c R N A has been identified in m i t o c h o n d r i a , a n d it is not inconceivable that the small R N A s of kaiilo m a y also have some f u n c t i o n , perhaps in catalyzing insertion of the element, or in the regulation of translation or splicing. T h e vast m a j o r i t y of linear plasmids are c r y p t i c . T h e plasmids themselves appear to encode functions necessary for the maintenance or their D N A , b u t little else. Indeed, when there are two or more of the plasmids (Diivell et al, 1988; K e m b l e a n d M a n s , 1983; B a s z c z y n s k i a n d K e m b l e , 1982) h o m o l o g y between the two is restricted  t o the T I R . O f t e n m a n y plasmids of different sizes will be  f o u n d ( D i i v e l l et al, 1988; K e m b l e a n d M a n s , 1983; B a s z c z y n s k i a n d K e m b l e , 1982). If it is true that the  D N A replication apparatus  will replicate  a n y t h i n g that  144  lies between  the T I R s , then  when  P a r t I: T r a n s c r i p t i o n a l Properties of k a l D N A phenotypes d o exist, they m a y s i m p l y be cases in w h i c h gratuitous sequences of D N A have inserted i n t o the p l a s m i d s . T h i s m a y be a reason w h y the plasmids are often f o u n d in pairs. A p h e n o t y p i c p l a s m i d depends o n the other for s u r v i v a l . H o w e v e r , this p h e n o t y p i c maintenance design is not the case for the killer plasmids of K l u y v e r o m y c e s , as the T I R s of the two plasmids show n o homology i n this system (Sor et al, 1983), a n d two different D N A polymerases are thought to exist (Stark a n d B o y d , 1986; T o k u n g a et al, 1987; K i t a d a a n d G u n g e , 1988). A n often overlooked fact is the occurrence of a circular m i t o c h o n d r i a l p l a s m i d i n the kalilo strains  of  N. intermedia.  mitochondrial  plasmids.  It  is not k n o w n h o w this  Bertrand  u n c o n n e c t e d w i t h senescence,  et  al (1985)  have  p l a s m i d is related dismissed  t o the other  the circular  plasmid  circular  as b e i n g  however i n light of the a m a z i n g behaviour exhibited b y the circular  plasmids w h i c h have been s t u d i e d , it is possible t h a t some of the t r a n s c r i p t i o n a l phenomena, of kalilo, a n d i n d e e d the senescence p h e n o t y p e itself, m a y have s o m e t h i n g to do w i t h between  these two elements.  F o r instance,  if kalilo mitochondria, c o n t a i n a reverse  interactions transcriptase  activity, t h e n reverse t r a n s c r i p t i o n of the full length kalilo R N A would yield a p a n h a n d l e D N A structure  due to the kalilo T I R , w h i c h could possibly be recombinagenic a n d responsible for the  unique insertional regimen of kalilo ( C h a n et al, 1989a). T h e s t u d y of this m i t o c h o n d r i a l p l a s m i d a n d its interactions w i t h the kalilo p l a s m i d suggest an interesting project.  145  P a r t II: P a r a l l e l S u b c u l t u r e Series E x p e r i m e n t s  P A R T II: P A R A L L E L S U B C U L T U R E S E R I E S E X P E R I M E N T S  INTRODUCTION T h e search for f u n c t i o n on kaiilo in this part of the thesis has been extended to observations on the behaviour of the linear p l a s m i d i n large n u m b e r s of subcultures, a r o u n d the p r o b l e m of d e t e r m i n i n g what  intermedia process.  t o d o . Senescent  centered  strains  of N.  f r o m the island of K a u a i undergo a n u m b e r of complex events d u r i n g the senescence  While many  cytoplasmic m u t a n t s programmed  kaiilo is p r o g r a m m e d  a n d has been  of these changes resemble s u c h as  a n d repeatable  stopper,  the m i t o c h o n d r i a l aberrations  that  occur  with  the kaiilo senescence process has been shown t o be h i g h l y  i n the wild  isolates  of kaiilo c o n t a i n i n g  strains  of  N. intermedia  (Griffiths a n d B e r t r a n d , 1984). A l t h o u g h it is k n o w n that almost a n y m i t o c h o n d r i a l aberration c a n lead  t o the suppressive  accumulation  of defective  DNAs,  the observation  that  kaiilo i n d u c e d  senescence is a h i g h l y repeatable process leads to the conclusion t h a t there m u s t be some aspect of kaiilo senescence t h a t is directed b y the linear p l a s m i d in a d d i t i o n to its maintenance functions. It is expected that the t i m i n g of insertion of kaiilo, the location of the insertion of kaiilo, or some  other  aspect of its behaviour must correlate with the occurrence of senescence. The  parallel series experiments  correlate w i t h the senescence process,  were designed to identify any functions  of kaiilo w h i c h  a n d were performed in part because of the new i n f o r m a t i o n  t h a t was received concerning the intracellular location of kaiilo. B e r t r a n d  et al (1986) reported t h a t  A R - k a l D N A was a nuclear or n o n - m i t o c h o n d r i a l p l a s m i d , while M y e r s et al (1989) have  reported  that kaiilo specific D N A sequences are entirely m i t o c h o n d r i a l . T h e reason for the confusion as to the cellular location of the A R f o r m of k a l D N A is h y p o t h e s i z e d to be due t o the presence of proteins o n the ends of the linear D N A . T h i s is shown d r a m a t i c a l l y in figure 28, where a n u m b e r of parallel isolations of m t D N A have been performed, with a n d without a proteinase K step i n the isolation  146  P a r t II: Parallel S u b c u l t u r e Series  Experiments  protocol prior to p h e n o l / c h l o r o f o r m precipitation of the proteins. W h e n the proteinase o m i t t e d , m t A R - k a l D N A is usually not seen, while when the proteinase are  readily evident.  It  is apparent  f r o m the  "+"  lanes  p l a s m i d is a highly repeatable process w i t h proteinase discovered in the m i t o c h o n d r i a because m t D N A procedure.  The  compartment  linear  plasrnid's  location  was  K step is  step is performed, plasmids  i n the figure t h a t isolation of the  linear  K t r e a t m e n t . T h e linear p l a s m i d was  is not routinely proteinased incorrectly  assigned  to  the  d u r i n g the  not  isolation  non-mitochondrial  because of the characteristics of the various D N A and organelle isolation  procedures:  while it is possible to isolate nuclei-free m i t o c h o n d r i a through the sucrose gradient procedure, it is not possible to isolate mitochondria-free nuclei ( B e r t r a n d et al, 1986). A n unfortunate result of these isolation procedures was that, the linear p l a s m i d was not identified in the m i t o c h o n d r i o n , but rather in the nucleus; the s t a n d a r d protocol for the isolation of N e u r o s p o r a nuclear D N A has an overnight proteinase  K  step  that  is  capable  of  liberating  mitochondria.  147  the  linear  plasmid  from  the  contaminating  P a r t II: P a r a l l e l S u b c u l t u r e Series  Experiments  Figure 28. Proteinase K is Required For and Leads to Repeatable Isolation of mt A R - k a l D N A  A p h o t o g r a p h of an e t h i d i u m b r o m i d e stained gel is presented showing D N A f r o m parallel DNA  isolations.  C o n t r o l lanes  contain  m t D N A f r o m s t r a i n 561-7. T h e +  mtDNA  f r o m strain  605,  while senescent  and - signs refer to the use of a proteinase  lanes  contain  K digestion of the  m t D N A prior to p h e n o l / c h l o r o f o r m extraction of protein. L a n e L contains the B R L 1 k b ladder.  148  CONTROLS  SENESCENT  Part. II: P a r a l l e l S u b c u l t u r e Series E x p e r i m e n t s A consequence of the inability t o repeatedly isolate the linear m i t o c h o n d r i a l plasmid is that its behaviour has never been s t u d i e d . Its apparent transient nature led t o the suggestion t h a t it was an  intermediate  i n transposition of the element f r o m the nucleus t o m i t o c h o n d r i o n ( M y e r s . 1988). It  is now k n o w n t h a t this interpretation is incorrect, which implies that the behaviour of the linear p l a s m i d is also not k n o w n , because systematic experiments utilizing a proteinase K step in D N A isolations have never been p e r f o r m e d . T h i s s i t u a t i o n has been reconciled somewhat b y a recent s t u d y . M y e r s et al, (1989) s t u d i e d the somatic transmission of m t l S - k a l D N A to determine what events if a n y , c o u l d be correlated w i t h the longevity of a senescent strain. T h e y h a d noticed that the progeny of crosses between senescent parents h a d very different lifespans, a n d they h y p o t h e s i z e d that the differences could be due to the behaviour of m t l S - k a l D N A in somatic culture. T h i s analysis led t o the discovery of m t A R - k a l D N A . Y o u n g strains d i d not inherit inserts, only m t A R - k a l D N A , a n d inserts of m t l S - k a l D N A c o n t i n u e d to be generated  u n t i l the development of senescence.  T h e situation described b y this result differed  somewhat f r o m that originally reported b y B e r t r a n d et al (1985; 1986), although they too felt that the juvenile cultures h a d wild type m t D N A s . M y e r s et al (1989) showed t h a t as a culture grows, de  novo  inserts of m t l S - k a l D N A  arise, a n d that some of these, termed lethal inserts, are m a i n t a i n e d  u n t i l the death of the organism. O t h e r inserts do not seem to be lethal, a n d cultures w h i c h have one of these n o n - l e t h a l inserts grow u n t i l subsequent inserts arise which persist u n t i l the death of the culture. It was s u r m i s e d that differences i n lifespan were due to the m o v e m e n t of the inserts of m t l S k a l D N A , u n t i l d e a t h was caused b y the generation of a lethal insert ( M y e r s et al, 1989). However, because proteinase K was not used systematically t h r o u g h o u t that s t u d y , the behaviour of the linear p l a s m i d in the senescent cultures could not be d e t e r m i n e d . In this part of the thesis, the next logical step is taken—the behaviour of the linear p l a s m i d is followed in parallel series of genetically identical strains to see what the p l a s m i d is p r o g r a m m e d to  150  P a r t II: P a r a l l e l S u b c u l t u r e Series E x p e r i m e n t s do.  It  was t h o u g h t  that  all strains  p r o g r a m m e d event causing senescence,  lived  t o be the same  age, a n d i f lethal inserts  were the  they w o u l d have to be generated at the same time. P a r a l l e l  series experiments were performed o n 10 progeny of senescent crosses. T e n clonal subcultures of each representative i n d i v i d u a l were p r e p a r e d , a n d subjected to serial s u b c u l t u r i n g u n t i l death. T h i s was termed a parallel series. P a r a l l e l series were generated as an experimental protocol to overcome the problem  of m i t o c h o n d r i a l heterogeneity  i n the senescent  kalilo  clones.  It  was h o p e d  that b y  e x a m i n i n g a large n u m b e r of genetically identical strains of kalilo, it w o u l d be possible t o separate programmed  events  in that  clone  from  random  events  p r o g r a m m e d event, such as lifespan or the appearance  occurring  in  the  mitochondrion;  of a lethal insert of m t l S - k a l D N A ,  a  should  befall all members of a parallel series, while r a n d o m events, such as m i t o c h o n d r i a l rearrangements or the generation  of non-lethal inserts  of m t l S - k a l D N A ,  should  appear  as differences between the  otherwise genetically identical m e m b e r s of a parallel series. T h e parallel series experiments were performed on strains that were generated f r o m crosses of the senescent p r o t o t y p e strain P561-0 or -1 a n d n o n senescent male parents, a n d were i n t r o d u c e d in part I of the thesis. Strains 1-4 a n d X l - 5 are progeny of these crosses. Crosses using the T a i w a n e s e male parent  1766 were  described b y Griffiths a n d B e r t r a n d  (1984),  a n d ascospore  progeny are  prefixed by an I. Crosses using the H a w a i i a n male parent P605 were described b y M y e r s (1988), a n d ascospore  progeny f r o m this cross are prefixed b y X I .  T h e lifespans of these cultures generally  seemed to be longer t h a n that of their female parent. T h e progeny of the cross between 561-0 a n d 1766 gave rise t o i n d i v i d u a l s whose lifespans ranged f r o m less t h a n 10 t o more t h a n 20 subcultures (Griffiths a n d B e r t r a n d ,  1984), while strain 561 h a d originally been reported to live to o n l y  10  subcultures. It h a d been assumed that the lifespan of these cultures was u n d e r as tight control as that of their female parent, however here it is reported t h a t the lifespan of these a n d other progeny of senescent  female parents are not as tightly controlled as once t h o u g h t . T h e s e a n d a n u m b e r of  151  P a r t II: Parallel S u b c u l t u r e Series E x p e r i m e n t s other observations are reported on senescence d u r i n g senescence in kaiilo strains of  a n d m i t o c h o n d r i a l p h e n o m e n a w h i c h are o c c u r r i n g  Neurospora intermedia.  G e n e r a t i o n of inserts of m t l S - k a l D N A  seems to be r a n d o m a m o n g i n d i v i d u a l s , however some individuals seem to have a predisposition towards certain inserts. Insertion of m t l S - k a l D N A is an early event in the senescence process, b u t it does not appear to be the u n i q u e event which is required to cause the death of an i n d i v i d u a l . R a t h e r it is subsequent events, such as gross rearrangements of the m t D N A which seem to correlate w i t h the death of the o r g a n i s m . F i n a l l y some experiments on the structure  of senescent  mtDNAs  are  presented.  RESULTS T h e restriction digest protocol w h i c h has been used to identify inserts of m t l S - k a l D N A was presented earlier. F i g u r e 29 is a reprint of figure 15, which is a d i a g r a m of the restriction digest protocol w h i c h can be used to detect inserts of m t l S - k a l D N A , and figure 30 is a characterization of the m t D N A f r o m a n u m b e r of juvenile progeny of senescent female parents. F r o m figure 29 it can be seen that the probe, X3,  has homology to the inverted repeats of kaiilo. Therefore in a S o u t h e r n  B l o t , it will h y b r i d i z e to all restriction fragments which have homology to the inverted repeats. In a B g l II digest, the restriction fragments of the linear p l a s m i d which h y b r i d i z e to X 3 are b l a n d b2, the ends of the  linear p l a s m i d .  However, m t l S - k a l D N A  does not  give rise to b l a n d b2  upon  digestion w i t h B g l II. Instead, it gives rise to two m t D N A / m t l S - k a l D N A j u n c t i o n fragments, b l ' a n d b2', which must be of equal  or greater molecular weight t h a n b l a n d b2. Therefore, in a S o u t h e r n  blot of B g l II digested m t D N A p r o b e d w i t h X 3 , the presence of two b a n d s with mobilities equal to b l a n d b2 suggests that n o insert of kaiilo is present i n the D N A , b u t t h a t free p l a s m i d is contained in the p r e p a r a t i o n , while the presence  of higher molecular weight b a n d s which hybridize to  indicate the presence of kaiilo inserts in the m t D N A .  152  X3  P a r t II: Parallel S u b c u l t u r e Series E x p e r i m e n t s  Figure 29. Diagram of the Generation of b l ' and b2' Junction Fragments for the Detection of m t l S - k a l D N A .  mtAR-kalDNA, kalDNA,  a mtDNA  the  linear p l a s m i d , is d i a g r a m m e d  insertion sequence,  is d i a g r a m m e d  at  in the the  top  of the  figure, and  mtlS-  bottom  of the  figure. T h e kalilo  inverted repeat probe, X 3 , is shown, b l , b2, b3 a n d b4, are B g l II restriction fragments of the linear p l a s m i d , as s h o w n , b l ' a n d b 2 ' are the restriction  fragments  p r o d u c e d b y B g l II digestion of the  m t D N A c o n t a i n i n g an insert of m t l S - k a l D N A . T h e relative sizes of b l ' a n d b2'.are variable a n d are dependent on the distance to the next B g l II site i n the m t D N A . T h i s d i a g r a m for the interpretation of experiments was presented in figure 15.  153  Part II: Parallel Subculture Series Experiments  X3  «tAR-kalDNA  X3  •tIS-kalDNA  154  P a r t II: Parallel S u b c u l t u r e Series E x p e r i m e n t s  Figure 30. Characterization of the m t D N A From a Number of Senescent Progeny of Strain 561  A n u m b e r of agarose gels a n d S o u t h e r n blots are shown i n the panels. T h e strains f r o m w h i c h the m t D N A has been prepared are indicated at the top of each panel. In the u p p e r panels, D N A has been digested with the B g l II restriction enzyme, and the lower panels contain undigested DNA  as  indicated.  Panel  A  is  an  ethidium  bromide  stained  gel.  Panels  B,  C,  and  D  are  autoradiographs of Southerns. T h e S o u t h e r n in panel B was p r o b e d w i t h the X 3 clone; conditions w h i c h m u s t exist for the occurrence of bands b l , b2, b l ' a n d b 2 ' in the X 3 p r o b e d S o u t h e r n blot are shown i n figure 29. P a n e l C has been h y b r i d i z e d with the m t D N A clone termed H i n d III-13, 18 i n figure 6 in the i n t r o d u c t i o n . P a n e l D is a long exposure of panel B . In panel B , b l , b2, b l ' and b 2 ' are B g l II restriction fragments of m t A R - k a l D N A , and m t l S - k a l D N A , respectively. In P a n e l C , B g l II-4, -12, and -14 are m t D N A fragments w i t h homology to m t D N A fragment H i n d III- 13, 18. b l ' a n d b 2 ' also have homology to this m t D N A fragment, as i n d i c a t e d .  155  2  to,  3 n  c  i  t  I 1  1  685 X1-4-1 XI-5-1 X1-6-1 X1-7-1 X1-8-I 1-4-1 1-7-1 1-12-1 1-14-1 1-16-1 561-7  i  1  I  1 1=  Ii t 5 s t  685 X1-4-1 XI-5-1 X1-6-1 X1-7-1 X1-8-1 ' 1-4-1 1-7-1 1-12-1 1-14-1 1-16-1 561-7 685 X1-4-1 XI-5-1 X1-6-1 X1-7-1 X1-8-1 1-4-1 1-7-1 1-12-1 1-14-1 1-16-1 561-7  10  a 3" in  fD  a  P a r t II: Parallel S u b c u l t u r e Series E x p e r i m e n t s F i g u r e 30 characterizes the m t D N A of the initial subcultures of the 10 juvenile strains. T h e 10 strains are as follows: five progeny f r o m a single ascus f r o m a cross using H a w a i i a n strain P605 as a male parent are called X l - 4 , X l - 5 . X l - 6 . X l - 7 , a n d X l - 8 ; a n d 5 r a n d o m ascosopore progeny f r o m a cross using T a i w a n e s e strain 1766 as the male parent are called 1-4, 1-7, 1-12, 1-14, a n d 1-16. In the e t h i d i u m b r o m i d e stained p o r t i o n of the figure i n panel A , the lower p o r t i o n of the gel was r u n u n c u t a n d t w o p l a s m i d bands can be seen in addition t o t h e high molecular weight m t D N A . T h e two plasmids were i n t r o d u c e d i n figure 16 i n part I of the thesis, a n d they correspond t o m t A R k a l D N A a n d a c r y p t i c circular m i t o c h o n d r i a l p l a s m i d u n c o n n e c t e d w i t h senescence ( B e r t r a n d 1985). T h e B g l II digest produces 14 B g l II m t D N A fragments i n lane 605, a non-senescent  et al,  control,  a n d extra b a n d s are apparent in the p l a s m i d - c o n t a i n i n g strains. It is evident f r o m panel B of the figure  that only b a n d s b l a n d b2 are detected i n the juvenile progeny when p r o b e d w i t h the X 3  clone of kaiilo, i n d i c a t i n g that m t l S - k a l D N A is n o t present.  Fragments  corresponding t o j u n c t i o n  fragments, b l ' a n d b 2 ' are seen only in the lane corresponding to the female parent, in lane 561-7, as i n d i c a t e d . In the lower panel, the m t D N A has been r u n u n c u t , and it can be seen that the probe hybridizes only t o the free p l a s m i d , not to the m t D N A . T h e s e results are consistent  for the long  exposures of this gel shown in panel D . N o bands corresponding to b l ' or b 2 ' are seen in the juvenile strains. In p a n e l C , the D N A s have been h y b r i d i z e d w i t h the m t D N A clone is specific for the intron of the 25S R N A gene i n in the female parent,  N. crassa.  clone H i n d III-13, 18. T h i s  T h i s i n t r o n contains m t l S - k a l D N A  strain P561. H i n d 111-13, 18 is homologous to the three B g l II restriction  fragments i n d i c a t e d in p a n e l C , B g l II-4, -12 a n d -14. In a d d i t i o n , the H i n d III-13, 18 probe b i n d s to a d d i t i o n a l fragments i n lane 561-7, labelled b l ' a n d b 2 ' . T h e bands b l ' a n d b 2 ' f r o m lane 561-7 are homologous to b o t h the m t D N A restriction fragment probe H i n d III-13, 18 in p a n e l C , a n d t o the kaiilo inverted repeat probe X 3 , in p a n e l B ; b l ' a n d b 2 ' have sequences homologous t o b o t h m t D N A and kaiilo as they are the j u n c t i o n fragments of an insert of m t l S - k a l D N A . A g a i n , it is clear  157  that  P a r t II: Parallel S u b c u l t u r e Series E x p e r i m e n t s none of the 10 progeny of this parent  have received any rearranged  fragments  w i t h homology to  bands b l ' and b2'. T h e conclusion of figure 30 is that the juvenile p r o g e n y shown do not  contain  mtlS-kalDNA. T h i s conclusion is advanced by another  Neurospora  strains of  consideration. T o make m i t o c h o n d r i a l D N A f r o m  requires a three step process. T h e first steps involve a m p l i f y i n g the  cultures.  Therefore the cultures used to make the D N A shown in these strains are not the first cultures, b u t effectively the t h i r d . T h e y have undergone two amplifications to generate enough m y c e l i a to prepare m i t o c h o n d r i a ; one to amplify the conidia, a n d one to grow u p m y c e l i a in liquid culture. Therefore the  i n a b i l i t y to  detect  any  inserted  molecules  at  the  level of the  Southern  blot  in the  third  s u b c u l t u r e strengthens the conviction t h a t the cultures h a d n o m t l S - k a l D N A in the first s u b c u l t u r e . A  final  observation  p e r t a i n i n g to  figure  30  is t h a t  the  mtDNA  corresponding to  the  senescent female parent is highly degraded. T h i s is evidenced b y the absence of the labelling of high molecular present,  weight  the  material in uncut, portion of lane 561-7  high molecular  weight  b a n d s h o u l d be labelled, but  labelled. T h e highly degraded state of 561-7 figure in w h i c h the m t D N A  of panel B .  Because  only the  mtlS-kalDNA  background  is  appears  m t D N A is confirmed in uncut portion of panel C of the.  probe has failed to detect high molecular weight m t D N A .  T h i s is a  general p r o p e r t y of these highly senescent m t D N A s , they appear degraded in S o u t h e r n blots.  Analysis of Longevity A h i s t o g r a m of the lifespans of the senescent progeny of strains 561-1 figure 31, and of strains 561-0  and 605 is shown in  and strain 1766 in figure 32. T h e ten m e m b e r s of each parallel series  are i n d i c a t e d b y lower case R o m a n numerals after the strain designation, t h u s I-4-i is parallel culture 1 of strain  1-4.  T h e striking differences in the  lifespans of the  members  of a parallel series  is  i m m e d i a t e l y a p p a r e n t . Whereas Griffiths and B e r t r a n d (1984) showed t h a t 20 parallel series f r o m a  158  P a r t II: P a r a l l e l S u b c u l t u r e Series E x p e r i m e n t s single isolate of strain 801 all died at precisely the same s u b c u l t u r e , these strains now show quite a range of longevities. Therefore, the crosses t h a t were performed to generate these i n d i v i d u a l s have u n c o u p l e d some  control of the senescence process.  Whereas  the female parent  of these progeny  always had a lifespan of 10 subcultures, her progeny have lifespans t h a t are m u c h more variable. A possible explanation for this is that the female parent  already contained a lethal insert, a n d was  c o m m i t t e d to a predetermined lifespan. It nonetheless appears as t h o u g h lifespan is a p r o g r a m m e d event. T h i s is suggested in table 2, where it can be seen t h a t the m e a n lifespans of the parallel series correspond closely w i t h the lifespans originally reported for these i n d i v i d u a l s (Griffiths a n d B e r t r a n d , 1984;  M y e r s , 1988). A l l of the strains' lifespans are w i t h i n one s t a n d a r d deviation of the originally  reported lifespan for each culture, w i t h the exception of X l - 4 a n d X l - 5 . S t r a i n X l - 4 has the smallest s t a n d a r d deviations for its parallel series, so the observation that it does not correlate as closely w i t h the  originally reported  longevity.  value  suggests  something  about  the  range  of the  lifespan, rather  than  T h e lifespans of these two strains do nonetheless fit w i t h i n two s t a n d a r d deviations of the  mean.  159  Part II: Parallel Subculture Series Experiments Table 2. Averages and Standard Deviations of Lifespans (sigma)  MEAN LIFESPAN  1-4 1-7 1-12 1-14 1-16  -  27.4 13.4 10.8 16.9 12.0  12.4 1.6 3.1 3.9 2.3  26 15 13 19 13  yes yes yes yes yes  Xl-4 Xl-5 Xl-6 Xl-7 Xl-8  A A a a a  11.2 13.1 12.7 9.1 14.4  1.8 3.6 5.2 2.7 9.5  9 9 8 10 7  no no yes yes yes  STRAIN  STANDARD DEVIATION  160  ORIGINAL LIFESPAN  FALLS WITHIN  MATING TYPE  1 sigma  P a r t II: Parallel S u b c u l t u r e Series E x p e r i m e n t s  Figure 31. Lifespans of Members of Parallel Series Derived from Crosses Using Strain 605 as a Male Parent  Histograms of the lifespans for each of the members of a parallel series are s h o w n . T h e name of the original culture is shown on the left. T h e 10 parallel cultures are i n d i c a t e d b y  lowercase  R o m a n numerals. T h e lifespans are presented as bars a c c o r d i n g ' t o the scale i n subcultures at the top and b o t t o m of the bar graphs. T h e d o t t e d lines indicate the parallel series m e m b e r that h a d not died after 41 subcultures.  161  Lifespan in Subcultures Xl-4 C U L T U R E A N D  10  15  20  25  30  35  40  10  15  20  25  30  35  40  H  III  iV v v! vii viii ix i M  H  III  Xl-5 iv  V vi vi! viii ix I  •t  II  iii  iv v  Xl-6 vi S vii U viii B ix C i U II L III T iv U R X1-7 V v! E vii •ti  Viii ix  N i U II in M iv 6 E X1-8 vvi R Vii Lifespan in viii ix Subcultures X  162  P a r t II: P a r a l l e l S u b c u l t u r e Series E x p e r i m e n t s  Figure 32. Lifespans of Members of Parallel Series Derived From Crosses Using Strain 1766 as a Male Parent  H i s t o g r a m s of the lifespans for each of the m e m b e r s of a parallel series are shown. T h e n a m e of the original culture is shown on the left. T h e 10 parallel cultures are i n d i c a t e d by  lowercase  R o m a n n u m e r a l s . T h e lifespans are presented as bars according to the scale i n subcultures at. the top a n d b o t t o m of the bar graphs. T h e dotted lines indicate parallel series members who h a d not died after 41 subcultures.  163  Lifespan in Subcultures  i  10  15  20  25  30  35  40  10  15  20  25  30  35  40  II HI  iV  1-4 vi V  C U L T U R E  vii viii ix i II  1-7  A N D S U B C U L T U R E N U M B E R  HI iv V vi vii Viii ix i ii  in  iv v 1-12 vi Vii viii ix i  ii  Iii  H4 iv  V vi vii viii iX I  H6  ta  ii  III  iv  Lifespan in v vi Subcultures Vii  > ••••  VNI  iX X  164  Part II: Parallel Subculture Series Experiments Figure 31 shows that most members of the tetrad of the cross using strain 605 as a female parent live to be between 6 and 15 subcultures, and that only a few isolated clones live beyond 20 subcultures. Because all of these strains are members of a single tetrad, two of these isolates must be clones of one another. Specifically, parallel series members vi, vii and viii are all of mating type a, therefore two of them must be spore pairs. Which two they are is not obvious from the lifespan data. Those two and all members of the tetrad show similar lifespans and ranges, suggesting at this level that the senescence process is random within the confines of a certain range, and does not seem to be under tight control. In contrast to figure 32, where the lifespans appear much more variable, the members of this cross between geographically related strains, live to be similar ages, have similar originally reported lifespans, and the lifespans have similar variation about the mean. This could be explained if the parents are homozygous for some factor capable of influencing lifespan or the senescence process. Figure 32 shows a slightly different story. All the strains shown in this figure are siblings, and all have similar lifespans, with the exception of 1-4 and with the possible exception of 1-16. Culture 1-4 has a very long mean lifespan compared to the other cultures. This cross is from geographically unrelated isolates of the fungus, and the results suggest that some nuclear gene or combination of genes is capable of controlling lifespan, although at what level lifespan is being affected is not known. The prediction of the combined results of figures 31 and 32 is that nuclear genotype, is capable of affecting the senescence process, but that the variability that is present in the lifespan of the clones of an individual makes the identification of these genes difficult, especially if their action is subtle.  165  P a r t II: Parallel S u b c u l t u r e Series E x p e r i m e n t s  Molecular Analysis m t D N A was prepared f r o m all 100 parallel series isolates shown i n the previous section. T h e nucleic acid was p r e p a r e d w i t h a proteinase K step t o ensure that m t A R - k a l D N A would be isolated. Both  e t h i d i u m b r o m i d e - s t a i n e d gels  a n d S o u t h e r n blots  hybridized  w i t h kaiilo probe X 3  were  p r e p a r e d to examine j u n c t i o n fragments as indicators of the presence of m t l S - k a l D N A . Blots were r e h y b r i d i z e d w i t h the m t D N A clone H i n d III-13, 18 to determine if a n y of the inserts were i n t o the same region of the m t D N A as the female parent. T h e D N A isolations were performed when all the cultures of a parallel series h a d died, or alternatively at some defined p o i n t i n the growth process. T h i s allowed for differences between living a n d dead cultures to be d e t e r m i n e d , so t h a t events w h i c h were i n c i d e n t a l to the senescence process could be identified. A l l of the D N A isolates were f o u n d to contain m t l S - k a l D N A , whether D N A was p r e p a r e d f r o m the final s u b c u l t u r e or f r o m earlier subcultures. T h i s result is n o t e w o r t h y because some of the parallel series died w i t h i n six subcultures, suggesting t h a t the senescence  process  can occur  very  r a p i d l y . T h i s analysis has shown that the generation of m t l S - k a l D N A a n d the events leading to the death of a culture appear to be complex processes,  and n o absolute requirements, other t h a n the  generation of m t l S - k a l D N A , seem to be required. T h e interpretation of these d a t a is very difficult, however a few trends are apparent i n some series. F o r this reason only four of the 10 parallel series molecular  analyses  are presented  i n detail. T h e y  are representative  of what  is believed to be  o c c u r r i n g d u r i n g the senescence process, and are presented i n figures 34-37. F i g u r e 33 is a reprint of figures 29 a n d 15, w h i c h illustrates the restriction digest p r o t o c o l w h i c h can be used t o identify inserts of m t l S - k a l D N A b y the presence of novel j u n c t i o n fragments t h a t are derived f r o m B g l II digestion of m t D N A  w h i c h contains inserts of m t l S - k a l D N A .  From  figure 33 it c a n be. seen that the probe, X 3 , has homology t o the inverted repeats of kaiilo. Therefore in a restriction digest, it will h y b r i d i z e to all restriction fragments w h i c h have homology t o the  166  P a r t II: Parallel S u b c u l t u r e Series E x p e r i m e n t s inverted repeats. In a B g l II digest, the restriction fragments of the linear p l a s m i d w h i c h h y b r i d i z e to X 3 are b l a n d b2, the ends of the linear p l a s m i d . However, m t l S - k a l D N A does not give rise to b l a n d b2 u p o n digestion w i t h B g l II. Instead, fragments,  bl  !  and b2',  which must  it gives rise to two m t D N A / m t l S - k a l D N A j u n c t i o n  be of equal  or greater molecular weight t h a n b l and  b2.  Therefore, i n a S o u t h e r n blot of B g l II digested m t D N A probed w i t h X 3 , the presence of two bands ( b l and b2) suggests that no insert of kalilo is present, while the presence of other bands ( b l ' and b2') confirms the presence of m t l S - k a l D N A . In the figures to follow, b l ' a n d b 2 ' j u n c t i o n fragments p r o b e d S o u t h e r n blot portions of the figures, and references fragments.  When  this  is  stated  in  identification of j u n c t i o n fragments  the  text,  the  are readily apparent  in the  X3  are m a d e to cultures s h a r i n g j u n c t i o n  following  experiment  of similar molecular weight b y the X 3  was  performed.  After  h y b r i d i z a t i o n protocol  illustrated i n figure 33, low m e l t i n g point agarose gels were prepared a n d r u n to isolate the j u n c t i o n fragments. T h e j u n c t i o n fragments were isolated, m a d e radioactive, and used as probes to S o u t h e r n blots of restriction digested m t D N A . If two similar-sized j u n c t i o n fragments h y b r i d i z e d to the same p a t t e r n of restriction fragments on one of these gels, then the inserts were assumed to be in the same location.  M o r e information on  the j u n c t i o n  fragments  presented in figures 38, 39, 40 and 41.  167  and  the  location  of the  inserts  will  be  P a r t II: P a r a l l e l S u b c u l t u r e Series E x p e r i m e n t s  Figure 33. Diagram of the Generation of b l ' and b2' Junction Fragments for the Detection of m t l S - k a l D N A .  mtAR-kalDNA, kalDNA,  a mtDNA  the  linear p l a s m i d , is d i a g r a m m e d  insertion sequence,  is d i a g r a m m e d  at  i n the the  top  of the  figure, a n d  mtlS-  bottom  of the  figure. T h e kalilo  inverted repeat probe, X 3 , is shown, b l , b2, b3 a n d b4, are B g l II restriction fragments of the linear p l a s m i d , as s h o w n , b l ' a n d b 2 ' are  the restriction  fragments  p r o d u c e d b y B g l II digestion of the  m t D N A c o n t a i n i n g an insert of m t l S - k a l D N A . T h e relative sizes of b l ' a n d b 2 ' are variable a n d are dependent on the distance to the next B g l II site in the m t D N A . T h i s d i a g r a m for the of experiments was presented in figures 15 and 29.  168  interpretation  Part II; Parallel Subculture Series Experiments  •tAR-kalDNA  X3  •tIS-kalDNA  169  P a r t II: P a r a l l e l S u b c u l t u r e Series E x p e r i m e n t s  Figure 34. Characterization of Senescent m t D N A s from Strain Xl-5  A  B g l II digested profile of the m t D N A  is shown. T h e panel o n the left has been stained  w i t h e t h i d i u m bromide, a n d the panel o n the right is a n a u t o r a d i o g r a p h of a S o u t h e r n was  probed  blot which  w i t h the X 3 clone; conditions w h i c h m u s t exist for t h e occurrence o f bands b l , b2, b l '  and b2' i n t h e X 3 p r o b e d Southern blot are shown i n figure 33. In the region of the a u t o r a d i o g r a p h where no sequences homologous t o t h e probe a n d shorter t h a n  b2 should have been detected, a  h i s t o g r a m of the lifespans of the cultures i n question has been pasted. T h e lane designations are as follows. L is t h e B R L 1 kb ladder. N is control strain 605. S is senescent control strain 561-7. T h e parallel cultures are n u m b e r e d  1 t o 10. T h e asterisks i n the S o u t h e r n  panel refer t o strains which  have bands t h a t cohybridize with t h e X 3 probe a n d t h e H i n d III-13, 18 probe, i n d i c a t i n g t h a t the inserts are i n t o the H i n d 111-13, 18 m t D N A of the m t D N A  from  restriction fragment. T h e 14 B g l II restriction fragments  strain 605 are indicated b y the s m a l l n u m b e r s o n the left. T h e four B g l II  restriction fragments of m t A R - k a l D N A , b l , b2, b3, a n d b4 are i n d i c a t e d b y t h e large n u m b e r s on the left. O n l y two of these, b l a n d b2 h y b r i d i z e to clone. X 3 as shown on the right. T h e restriction fragments of the senescent m t D N A s i n t h e e t h i d i u m b r o m i d e stained p o r t i o n of the figure, and the various b l ' a n d b2' fragments in the S o u t h e r n blot differ between i n d i v i d u a l lanes a n d ha.ve not been indicated t o avoid confusion. In the b a r graph, the n u m b e r s i n parentheses indicate strains w h i c h lived beyond 17 subcultures.  170  LNS  1 2 3 4 5 6 7 8 9 18NS*1 2  5 6*7 8 9*18  LIFESPANS  Part II: Parallel Subculture Series Experiments  Figure 35. Characterization of Senescent m t D N A s from Strain X l - 6  A Bgl II digested profile of the m t D N A is shown. The panel on the left has been stained with ethidium bromide, and the panel on the right is an autoradiograph of a Southern blot which was probed with the X3 clone; conditions which must exist for the occurrence of bands b l , b2, b l ' and b2' in the X 3 probed Southern blot are shown in figure 33. In the region of the autoradiograph where no sequences homologous to the probe and shorter than b2 should have been detected, a histogram of the lifespans of the cultures in question has been pasted. The lane designations are as follows. L is the B R L 1 kb ladder. N is control strain 605. S is senescent control strain 561-7. The parallel cultures are numbered 1 to 10. The asterisks in the Southern panel refer to strains which have bands that cohybridize with the X 3 probe and the. Hind III-13, 18 probe, indicating that the inserts are into the Hind 111-13, 18 m t D N A restriction fragment. The 14 Bgl II restriction fragments of the m t D N A from strain 605 are indicated by the small numbers on the left. The four Bgl II restriction fragments of m t A R - k a l D N A , b l , b2, b3, and b4 are indicated by the large numbers on the left. Only two of these, b l and b2 hybridize to clone X3 as shown on the right. The restriction fragments of the. senescent mtDNAs in the ethidium bromide stained portion of the figure, and the various b l ' and b2' fragments in the Southern blot differ between individual lanes and have not been indicated to avoid confusion. In the bar graph, the numbers in parentheses indicate strains which lived beyond 17 subcultures.  172  L N S  i. bl ^  1 2 3 5 6 7 9  10 N d * 1 2 3  7 9 10  -+  b2 -+ b3 - * b4  LIFESPANS  Part II: Parallel Subculture Series Experiments Figure 36. Characterization of Senescent m t D N A s from Strain 1-4.  A Bgl II digested profile of the mtDNA is shown. The panel on the left has been stained with ethidium bromide, and the panel on the right is an autoradiograph of a Southern blot which was probed with the X3 clone; conditions which must exist for the occurrence of bands b l , b2, b l ' and b2' in the X3 probed Southern blot are shown in figure 33. In the region of the autoradiograph where no sequences homologous to the probe and shorter than b2 should have been detected, a histogram of the lifespans of the cultures in question has been pasted. The lane designations are as follows. L is the BRL 1 kb ladder. N is control strain 605. S is senescent control strain 561-7. The parallel cultures are numbered 1 to 10. The asterisks in the Southern panel refer to strains which have bands that cohybridize with the X3 probe and the Hind 111-13, 18 probe, indicating that the inserts are into the Hind 111-13, 18 mtDNA restriction fragment. The 14 Bgl II restriction fragments of the mtDNA from strain 605 are indicated by the small numbers on the left. The four Bgl II restriction fragments of mtAR-kalDNA, b l , b2, b3, and b4 are indicated by the large numbers on the left. Only two of these, bl and b2 hybridize, to clone X3 as shown on the right. The restriction fragments of the senescent mtDNAs in the ethidium bromide stained portion of the figure, and the various b l ' and b2' fragments in the Southern blot differ between individual lanes and have not been indicated to avoid confusion. In the bar graph, the numbers in parentheses indicate strains which lived beyond 17 subcultures.  174  L  N S 1 2  3 4 5 6 7 8 9 10 N d*1 2 * 3 4* 5 6 7 8 9 18  LIFESPANS  Part II: Parallel Subculture Series Experiments Figure 37. Characterization of Senescent. m t D N A s from Strain 1-16.  A Bgl II digested profile of the mtDNA is shown. The panel on the left has been stained with ethidium bromide, and the panel on the right is an autoradiograph of a Southern blot which was probed with the X3 clone; conditions which must exist for the occurrence of bands bl, b2, b l ' and b2' in the X3 probed Southern blot are shown in figure 33. In the region of the autoradiograph where no sequences homologous to the probe and shorter than b2 should have been detected, a histogram of the lifespans of the cultures in question has been pasted. The lane designations are as follows. L is the BRL 1 kb ladder. N is control strain 605. S is senescent control strain 561-7. The parallel cultures are numbered 1 to 10. The asterisks in the Southern panel refer to strains which have bands that cohybridize with the X3 probe and the Hind 111-13, 18 probe, indicating that the inserts are into the Hind 111-13, 18 mtDNA restriction fragment. The 14 Bgl II restriction fragments of the mtDNA from strain 605 are indicated by the small numbers on the left. The four Bgl II restriction fragments of mtAR-kalDNA, b l , b2, b3, and b4 are indicated by the large numbers on the left. Only two of these, bl and b2 hybridize to clone X3 as shown on the right. The restriction fragments of the senescent mtDNAs in the ethidium bromide stained portion of the figure, and the various b l ' and b2' fragments in the Southern blot differ between individual lanes and have not been indicated to avoid confusion. In the bar graph, the numbers in parentheses indicate strains which lived beyond 17 subcultures.  176  L N S  I2  3 4 5 6 7 8  9 I 6 N ^ I  2  3  4  5  6 7 8*9  18  1 2 3 4 5 6 7 8 9 1 0 PARALLEL CULTURE NUMBER LIFESPANS  Part II: Parallel Subculture Series Experiments Figures 34-37 are characterizations of the mtDNA of the parallel series. The Bgl II digested mtDNAs are shown in the ethidium bromide stained portion of the figures. Bgl II digests the wild type mtDNA from strain 605, in lane " N " , into 14 fragments which are numbered on the left as shown, from the largest to the smallest. The Bgl II digest of the senescent cultures in the numbered lanes is seen to yield a heterogeneous population of fragments which includes the following: wild type fragments which comigrate with the restriction fragments from the " N " lane; Bgl II fragments of mtAR-kalDNA, these are labelled b l . b2, b3 and b4 on the left of the figure; Bgl II fragments of the circular mitochondria] plasmid; novel bands which are junction fragments corresponding to b l ' and b2', these become labelled in the autoradiograph portion of the figure; and novel bands that are the result of rearrangements of the mtDNA not associated with kaiilo sequences. Because of the complex nature of the rearrangements occurring in the ethidium bromide stained portion of the gels, only Bgl II fragments 1-6, and the mtAR-kalDNA restriction fragments b l , b2, b3 and b4 are referenced in the text. While Bgl II fragments 1 - 6  are not very clear in figure 34, they are readily apparent in  lane " N " of figure 35. As a sample analysis it can be seen from the ethidium bromide stained portion of figure 35 that lane " N " contains all six Bgl II fragments, while in lane "S", only Bgl II fragments 1, 2, 3, and 4 are detected; Bgl II-5 and -6 have apparently been deleted. Missing Bgl II fragments are referred to throughout the text in this manner. The autoradiographs have been probed with kaiilo clone X3, as shown in figure 33, and it should hybridize only with fragments that are larger than b2. Background in the autoradiographs can be attributed to the degradation of senescent mtDNA that was shown for the 561-7 lanes of figure 30. Fragments which are smaller than b2 can only be generated by gross rearrangements and deletions of kaiilo; none of these events were ever observed. In this region of the autoradiographs a bar graph of the lifespan of the cultures in question has been pasted, to easily reference the longevity of the subcultures. An interpretation of some of the  178  P a r t II: Parallel S u b c u l t u r e Series E x p e r i m e n t s lanes seen i n figure 37 is shown i n figure 38. T h i s figure layout is m a i n t a i n e d in figures 34, 35, 36 a n d 37. F i g u r e 34  is representative  of m a n y aspects of the molecular analysis. T h e only parallel  culture still alive at the time D N A was p r e p a r e d was n u m b e r 5. T h i s is illustrated i n the bar graph beneath the a u t o r a d i o g r a p h . O v e r a l l , there seems to be a heterogeneous p o p u l a t i o n of insertions a n d D N A rearrangements w h i c h have occurred prior to D N A isolation. Nonetheless, different m e m b e r s of a parallel series can generate i d e n t i c a l insertions a n d m t D N A rearrangements. T h i s is demonstrated by lanes 3 a n d 10, a n d lanes 2 a n d 7 of the a u t o r a d i o g r a p h . Lanes 2 and 7 share the same two pairs of j u n c t i o n fragments. J u n c t i o n fragments i n the X 3 p r o b e d autoradiograph are b a n d s w h i c h are larger t h a n b l a n d b2, as illustrated i n figure 33. Inspection of the e t h i d i u m b r o m i d e stained gel shows that the subsequent deletions of the B g l II fragments 2, 5 and 6 are also identical between parallel cultures 2 a n d 7. T h e major difference between these subcultures is their lifespans; parallel culture 2 lived to be 12 subcultures, while culture 7 lived to be 14 subcultures. Similarly for lanes 3 and 10, they share a single pair of j u n c t i o n fragments, and their D N A is characterized b y the loss of m a n y B g l II fragments, b u t their corresponding lifespans are 9 and 11 subcultures. O n e parallel culture in this figure, corresponding to lane 9, actually has the same insert as the female parent. It is not k n o w n whether this insert was inherited, or whether it has arisen f r o m de n o v o insertion into the same location. If an insert such as this was inherited, t h e n the other members of the parallel series have failed to inherit or lost it. A single insert of kaiilo was found to be lethal i n parallel culture 1, i n the absence of any other obvious D N A rearrangement.  A final observation is t h a t in this case the  only strain w h i c h was still alive at the time of D N A isolation (parallel culture 5) is f o u n d to contain two inserts of kaiilo. Neither of these inserts is a p p a r e n t l y lethal. F i g u r e 34  illustrates another  novel result  of this work: It  seems as  t h o u g h one of the  previously u n r e p o r t e d manifestations of senescence is the amounts of m t A R - k a l D N A that are seen at  179  P a r t II: Parallel S u b c u l t u r e Series E x p e r i m e n t s the death of some of these cultures. T h i s is typified b y lanes S, 2, 3, 6, 8, 9 and 10. T h e m t A R k a l D N A restriction fragments b l , b2, b3 and b4 are very p r o m i n e n t i n these lanes, especially in lanes 3, 8, a n d 10. T h i s factor i n the senescent process could not have been discovered i n the absence of proteinase K treated D N A isolations. F i g u r e 28 illustrated that m u l t i p l e isolations of m t D N A f r o m strain  561-7  all yield  similar amounts  of the  linear p l a s m i d , c o n f i r m i n g that  the  proteinase  K  t r e a t m e n t of the nucleic acid leads to repeatable isolation of m t A R - k a l D N A . H i g h levels of the free p l a s m i d m a y even be a general cause of death. F o r instance, lanes 3 a n d 10 were reported to have similar j u n c t i o n fragments and similar m t D N A deletions. T o this can be a d d e d similar huge a m o u n t s of m t A R - k a l D N A ; indeed almost  all of the U V a b s o r b i n g material r u n on the gel in these lanes  corresponds to m t A R - k a l D N A B g l II fragments b l , b2, b3 and b4. It is obvious that a n u m b e r of complex events are o c c u r r i n g i n the m i t o c h o n d r i a of these senescent strains. However the complex analysis, required to determine what is going on suggests t h a t a previously u n r e p o r t e d t r e n d m a y be evident. P a r a l l e l culture n u m b e r 8 i n figure 34 died at 6 subcultures. Inspection of its m t D N A shows that it has two inserts of k a l D N A , and it has lost a n u m b e r of B g l II fragments i n c l u d i n g 5 and 6. It also has a high level of m t A R - k a l D N A , as evidenced bv the prominence of the b l , b2, b3 and b4 restriction fragments. T h i s D N A was prepared f r o m the t h i r d s u b c u l t u r e of the parallel culture, yet D N A prepared f r o m the first s u b c u l t u r e , shown in figure 30  was  completely n o r m a l , except for the  rearrangements  presence  of the  linear p l a s m i d . Therefore,  all of the  seen i n this culture occurred w i t h i n 3 subcultures. Since it takes 3 subcultures  to  a m p l i f y a culture for the preparation of m t D N A , these results suggest the possibility that changes in the m t D N A w h i c h are not present i n the original culture of interest could have occurred d u r i n g the amplification procedure t h a t is required for D N A isolation. If the molecular events that occur w h i c h are responsible for the death of a culture occur r a p i d l y , say d u r i n g the g r o w t h of one s u b c u l t u r e , t h e n the analysis of m t D N A is a fruitless endeavour because it takes three subcultures to prepare a  180  Part II: Parallel Subculture Series Experiments culture for DNA isolation, and it will be impossible to determine what is happening at the DNA level with current techniques. Figure 35 is an analysis of the mtDNA of culture Xl-6. The situation in figure 35 is similar to that in figure 34. A number of the parallel cultures in figure 35 seem to have an mtlS-kalDNA with in a location similar to that of the parental insert (indicated by asterisks in the figure). Because the size of the junction fragments differs from the female parent, it is probably not an inherited insert, but it might be a rearrangement of the inherited insert or a de novo insertion, although lane 6 again has the same insert as the female parent. Interestingly, a culture which is long lived, lane 7, contains 3 pairs of junction fragments. The parallel cultures presented in lanes 1, 2, 3, 5, and 10 all live to be 11 subcultures in this parallel series. Two of them, 1 and 2, have identical junction fragments and mtDNA profiles. A third parallel culture, number 9, has identical DNA but lives to be only 8 subcultures. Almost all the lanes, with the exception of lane 7, have high levels of mtARkalDNA as evidenced by the prominence of b l , b2, b3 and b4 in the ethidium bromide stained portion of the figure. This strain and the one presented in figure 34 are representative of many of the parallel series, where a variety of processes seem to be occurring, but the correlations between them are difficult to see. However the presence of senescent mtDNAs with similar DNA profiles suggests that either events which are programmed are occurring, or that senescent molecules are being inherited. mtDNA from strain 1-4 was prepared midway through its lifespan, when most series members were still viable. This parallel series provides some insight into what is occurring at the molecular level in the senescence process (figure 36). Of the 10 parallel cultures from this strain, only five different junction fragments were observed. Two of these inserts have similar molecular weight to inserts which have been identified previously (Myers et al, 1989). Parallel cultures 8 and 10 both contain an insert that was identified by Myers et al (1989) as a lethal insert. The DNA was prepared  181  P a r t II: P a r a l l e l S u b c u l t u r e Series E x p e r i m e n t s from  the  16th  s u b c u l t u r e , yet  these two  both  survive on to  30  and  41+  subcultures,  so  the  identification of these inserts as lethal is p r o b a b l y p r e m a t u r e . T h r e e strains, 5, 6, and 7, have the insert deemed n o n - l e t h a l b y M y e r s et al (1989). T h e bar graph indicates t h a t strain 7 h a d died at the time the D N A was p r e p a r e d , a n d inspection of the e t h i d i u m b r o m i d e stained gel suggests t h a t the lethal event is not generation of m t l S - k a l D N A per  se, b u t rather the secondary event w h i c h can  be seen i n the e t h i d i u m b r o m i d e stained p o r t i o n of the figure: T h e loss of B g l II fragments 4, 5, 6 and others, a n d the subsequent amplification of m t A R - k a l D N A . T h i s is also suggested strongly b y inspection of parallel series 2 and^ 4, w h i c h have identical unique inserts of m t l S - k a l D N A , yet one was alive a n d one h a d died b y the  16th  s u b c u l t u r e . A g a i n , inspection of the e t h i d i u m b r o m i d e  stained p o r t i o n of the gel shows t h a t the culture w h i c h died has suffered the loss of at least B g l II fragments 5 and 6. Parallel cultures 1 and 3 have an insert w h i c h seems to be b e n i g n , as they are b o t h long l i v e d . It is clear f r o m the analysis of the m t D N A  of this strain that insertion of m t l S -  k a l D N A is necessary, b u t not sufficient for kalilo i n d u c e d senescence to occur, and secondary events such as deletions of m t D N A seem to be the lethal events. O n l y three of the cultures f r o m strain 1-4 h a d died at the time D N A was p r e p a r e d . T w o of these exhibit, very high amounts of m t A R - k a l D N A a n d m t D N A deletions, in lane 7 and lane 9 of the. e t h i d i u m b r o m i d e stained p o r t i o n of the figure. T h e t h i r d culture that h a d died at the time D N A was prepared (lane 2) has bands corresponding to m t A R - k a l D N A , b u t not at the level of lanes 7 and 9. Isolation of m t A R - k a l D N A is thought to be repeatable w i t h i n experimental limits because of the observed repeatability of isolations d e m o n s t r a t e d i n figure 28. T h e s e three dead cultures are the o n l y ones w i t h an appreciable a m o u n t of m t A R - k a l D N A at the time t h a t D N A was p r e p a r e d , therefore it again seems as t h o u g h the level of m t A R - k a l D N A is an i m p o r t a n t criterion in the senescence in these three cultures.  182  process  Part II: Parallel Subculture Series Experiments An interesting final observation on figure 3G pertains to lane 9. The culture illustrated in lane 9 harbours the fifth observed junction fragment, seen amongst the 10 subcultures of strain 1-4. This parallel culture lived to 10 subcultures, the shortest of all of the ones from strain 1-4. At death, it has suffered mitochondrial DNA arrangements, including the loss of Bgl II fragments 5 and 6, and the sharp increase in the level of mtAR-kalDNA. Interestingly, the insertion of mtlS-kalDNA, the mtDNA deletions, and the increase in the level of mtAR-kalDNA seen in this strain are the same in strain 1-4 parallel culture number 9, and strain Xl-5 parallel cultures number 3 and 10 in figure. 34. Strain Xl-6 parallel cultures 1, 2 and 9 from figure 35 may also have the same insertion of mtlSkalDNA, and possibly the same mtDNA rearrangements, but the degradation of the senescent mtDNAs from these senescent cultures makes the interpretation difficult. The occurrence of the particular senescent mtDNA type seen amongst these cultures suggests that there may be a general mechanism for the production of the senescent mtDNAs based on the insertion site of mtlS-kalDNA and the subsequent generation of site specific deletions. The observation that all of these parallel cultures die at a relatively early subculture suggests that the mechanism can be a programmed event which correlates with the occurrence of death at a certain subculture. The stopper extranuclear mutants of A . crassa are thought to occur via site specific recombination of the mtDNA (Gross et al, T  1984; DeVries et al, 1986; Almasan and Mishra, 1989), and this may be what is seen in the mtDNA rearrangements occurring in the kaiilo strains. This idea is considered more fully in the discussion. Figure 37 shows mtDNAs from strain 1-16. In this strain it appears as though the insertions of mtlS-kalDNA may be site specific and strain specific, or that progeny inherit undetectable amounts of a senescent molecule. This idea is based on the observation that 7 of the 10 parallel cultures in this strain (namely lanes 1, 2, 5, 6, 7, 9 and 10) exhibit the same two pairs of high molecular weight junction fragments (The junction fragments in lanes 8 and 9 of this figure are illustrated in greater detail in figure 38). It is possible that these inserts reside on two different  183  Part. II: Parallel Subculture Series Experiments mitochondrial molecules because of differences in their relative intensities in some lanes (e.g., lane 5). This is the only strain which shows the same junction fragment so many times. If a mechanism is present which is able to direct the insertion of mtlS-kalDNA into particular regions of the m t D N A , then it is functioning only in strain 1-16, and not in any of the other individuals described here. However, the combination of nuclear genes required to specify insertion of kalilo into a specific mitochondrial sequence is not obvious; an easier explanation is that these molecules were inherited. The location of these two inserts was determined (to be presented in figures 38, 39, and 40) and it was found that they represent different polarity insertions into the same location in the m t D N A , so only a single insertion site may exist. The evidence for and against the inheritance of inserts is explored more fully in the discussion. There are two final observations on figure 37. The m t D N A with the pair of junction fragments seen in lanes 1, 2, 5, 6, 7, 9, and 10 was lethal in every case. In contrast to the situation seen for the strain 1-4 (figure 36), these junction fragments are found to be lethal in the absence of any other identifiable m t D N A deletions or rearrangements, with the possible exception of the loss of Bgl II fragment 2. It will be shown in the next section that the insert in both these cases is into the Bgl II-2 fragment, therefore the fragment has not been lost, only rearranged. On the. other hand, the parallel cultures with mtDNAs with other junction fragments all lived to be much longer, greater than 20 subcultures, suggesting that, the pair of junction fragments seen in lanes 1, 2, 5, 6, 9, and 10 correlates with a short lifespan. The second observation is that parallel cultures 7 and 10 have in addition to the two aforementioned junction fragments, evidence of other inserts. This brings the number of inserts in these strains to three. The occurrence of a high number of similar inserts was unexpected, because it has never been reported before. A t most, one major and one minor junction fragment were usually seen (Myers, 1988). The analysis of the m t D N A s from a parallel series derived from strain 1-16, in figure 37, has indicated that death of these cultures can occur in the absence of  184  Part. II: Parallel Subculture Series Experiments the large amounts of mtAR-kalDNA and mitochondrial deletions seen in most of the other strains, and instead seems to imply that the presence of mtDNAs with multiple inserts is the event, required to cause the death of this strain. In this section a number of events were seen to correlate with the death of the members of a parallel series. In some strains, for instance strain 1-16 in figure 37, the important event seems to be the presence of a mtDNA with multiple copies of mtlS-kalDNA. In strain 1-4 in figure 36, the important, event, seems to be mtDNA deletions and the increase in the amount of mtAR-kalDNA. Strains Xl-5 and Xl-6, in figures 34 and 35, seem to succumb to combinations of the above events. Senescent, events are found to be variable, but new information from this section has been the identification of large amounts of mtAR-kalDNA in senescent strains, and the relative importance of rearrangements involving mtDNA Bgl II fragments 5 and 6. Finally, the occurrence of similar inserts and mtDNA rearrangements within members of a parallel subculture series, and between different, parallel series, suggest that strains may be. inheriting undetectable amounts of mtlS-kalDNA, or that insertion site and subsequent mtDNA rearrangements may be programmed events.  Analysis of Junction Fragments While routinely mapping the junction fragments referred to in the above section to show that fragments of a similar size had a. similar location in the mtDNA, it was discovered that, certain pairs of junction fragments seemed to have interesting mtDNA structures surrounding them. This conclusion was based on the mtDNA insertion regimen that was presented in the introduction. A model for the insertion of kaiilo was presented in the introduction which proposes that the mtDNA surrounding an insert of kaiilo DNA is present in long inverted repeats (Chan et al, 1989a). This is illustrated in figure 6 in the introduction. The experiments presented in this section map the inserts  185  Part II: Parallel Subculture Series Experiments of kaiilo identified in the parallel series experiments, and propose a unique structure for the mtDNA molecule in one strain. The long inverted repeats of mtDNA that surround mtlS-kalDNA lead to Bgl II junction fragments of kaiilo that are always one kb apart in size. This is because bl and b2 differ in size by one kb, therefore the inverted repeats of mtDNA will always show the same distance to another Bgl II site, and the junction fragments can only differ by the. asymmetry present in the single copy region of kaiilo; namely, by the difference in sizes between bl and b2. This is illustrated in figure 33, the diagram of the protocol for the detection of mtlS-kalDNA. In that figure, b l ' is shown as being derived from bl, and b2' is derived from b2; b l ' and b2' always differ by 1 kb, the same amount that bl and b2 differ by. A testable result of this is that if the mitochondrial DNA were cut with Eco R l , or Xba I, which cut within the TIR of kaiilo, then only a single junction fragment would be detected in X3 probed Southerns. Figures 38 and 39 illustrate how the location of the junction fragments alluded to in the previous section was determined. Figure 38 is a enlarged view of lanes 8 and 9 of the ethidium bromide and X3 probed Southern portions of figure 37. Lanes 8 and 9 of figure 38 contain mtDNA from parallel cultures which have undergone different fates at the time of DNA isolation. Lane 9 contains mtDNA which harbours the pair of high molecular weight junction fragments which have been termed bl', b2', b l " and b2" on the right of the figure, and which were common to seven of the parallel series of strain 1-16. Lane 8 contains a single pair of junction fragments which are only slightly larger than b l and b2. These junction fragments have not been indicated on the figure, to avoid confusion with b l ' and b2' in lane 9. This insert was found to be into Hind 111-13, 18 by hybridization to that fragment. Only the fragments generated from Bgl II digestion of the mtDNA from the parallel culture in lane 8 in the ethidium bromide stained portion of the figure are indicated on the left. The fragments from lane 9 have not been indicated to avoid confusion, but reading from  186  P a r t II: P a r a l l e l S u b c u l t u r e Series  Experiments  the top, they w o u l d be B g l II-1, b l ' , b2', B g l II-3, b l " , b 2 " , B g l II-4, -5, -6, -7, b l , p l a s m i d , b2,  etc.  In the S o u t h e r n p o r t i o n of the figure it can be seen t h a t the kalilo specific probe clearly picks u p b l ' , b2', b l " , b 2 " , b l , a n d b2. T h e four j u n c t i o n fragments f r o m lane 9 (namely b l ' , b2', b l " , and  b2")  were isolated f r o m 0.5 % low m e l t i n g point agarose gels, labelled, a n d used as probes for the panels i n d i c a t e d i n figure 39.  187  P a r t II: P a r a l l e l S u b c u l t u r e Series  Experiments  Figure 38. Characterization of m t D N A from Strains 1-16viii and I-16-ix.  A B g l II digested profile of the m t D N A f r o m two of the parallel cultures f r o m strain 1-16 is shown. T h e designations 8 a n d 9 refer to lanes 8 a n d 9 of the e t h i d i u m b r o m i d e a n d S o u t h e r n blot panels of figure 37. Therefore, lane 8 contains contains  mtDNA  f r o m parallel culture  mtDNA  f r o m parallel culture  I-16-viii,  a n d lane 9  I-16-ix. T h e panel on the left was stained w i t h e t h i d i u m  bromide, a n d the panel o n the right is an X 3 p r o b e d S o u t h e r n blot; conditions w h i c h m u s t exist for the occurrence of b a n d s b l , b2, b l ' , b 2 ' , b l " a n d b 2 " i n the X 3 p r o b e d S o u t h e r n blot are shown i n figure 33. T h e B g l II fragments of the D N A species f r o m the m i t o c h o n d r i a f r o m lane 8 are i n d i c a t e d on the left. T h e " / " designates fragments w h i c h comigrate. T h e n u m b e r s indicate B g l II fragments ,which have the same m o b i l i t y as B g l II fragments f r o m strain 605. B g l II digests the cryptic m i t o c h o n d r i a l p l a s m i d into t w o fragments,  as s h o w n . T h e expected B g l II fragments  k a l D N A a n d m t l S - k a l D N A are shown i n figure 33. O n the right, the fragments  circular  of m t A R -  w i t h homology to  kalilo probe X 3 f r o m lane 9 are i n d i c a t e d . T h e B g l II m t D N A fragments f r o m lane 9 of the e t h i d i u m bromide stained panel, a n d the b l ' a n d b2' fragments been indicated to avoid confusion.  188  f r o m lane 8 of the S o u t h e r n blot have not  8  9 8  9 bY  2 3  b2' bl" b2"  4  5 6  bl" / 7 bl plaswd b2' b2 8 9  b2  b3 plasmid / 16  n  12  EtBr -m-  X3  P a r t II: Parallel S u b c u l t u r e Series E x p e r i m e n t s  Figure 39. Analysis of Junction Fragments of mtlSk a l D N A from Parallel Series Strain I-16-ix  Lanes designated II in the figure contain m t D N A f r o m strain 605 w h i c h has been digested with H i n d III. Lanes S contain m t D N A f r o m senescent strain 1-4, w h i c h does not c o n t a i n an insert of k a l D N A , digested w i t h Bgl II. T h e panels are the results of S o u t h e r n blots t h a t were all h y b r i d i z e d w i t h different probes. T h e S o u t h e r n i n p a n e l a was h y b r i d i z e d w i t h radioactively labelled m t D N A f r o m strain 605. T h e southerns shown in panels b , c, d, a n d e were p r o b e d w i t h the gel purified j u n c t i o n fragments i n d i c a t e d i n figure 38, b l ' , b2', b l " , a n d b 2 " , respectively. W h i c h correspond to the j u n c t i o n fragments f r o m culture I-16-ix in figure 37, lane 9. T h e H i n d III m t D N A  restriction  fragments i n d i c a t e d on the left correspond to panels b a n d c, while the fragments i n d i c a t e d on the right correspond to panels d a n d e. T h e presence of other bands is addressed i n the text.  190  «-Hind HI—1  bl Hind Ill-lOa b2  bl Hind IIMOa b2 Hind 111-14  Hind 111-17  Hind 111-21  Part II: Parallel Subculture Series Experiments Figure 40. A Model for the Inserts of m t l S - k a l D N A in Parallel Series Strain I-16-ix  (A) A portion of the N. intermedia mtDNA restriction map is presented which shows the proposed site of insertion in parallel strain I-16-ix. This site is indicated by the arrow. The numbered fragments correspond to those seen in figure 7 in the introduction, and to the mtDNA to be presented in figure 41. (B) and (C) illustrate the long inverted repeats of mtDNA which arise upon insertion of mtlS-kalDNA. mtlS-kalDNA is represented between the arrowheads. The lettered, bold lines in (B) and (C) are proposed to be the junction fragments which when made radioactive would give the pattern shown on the corresponding gel in figure 39. The mtDNA in (B) has the mtDNA sequences to the left of the insert of mtlS-kalDNA inverted, and illustrates the junction fragment hybridizations seen in figure 39 panels d and e. The mtDNA shown in (C) has the mtDNA sequences to the right inverted, and illustrates the mtDNA rearrangements which could give rise to the pattern seen in panels b and c of figure 39.  192  I  Part II: Parallel Subculture Series Experiments  18 21 17 16  i  2  14  Ilea  Hind III <H)  B 2  2  c 10  10  bl  \ 14 10a  2 17 21 10a  2 17 21 10a  /  \  bl  2 16a 14  b3|b4 b2S  \ 10a 14  b 2 D4 b3  \b1  /  \  /  1  1  \ b 2 D 4 b3 14 19a  bl  /  \  2 10a  b3|b4  \ 10a 193  2  B 1  2 1  10 E 2117  \  10 i fH 2117  Part II: Parallel Subculture Series Experiments The panels in figure 39 are composed of lanes of mtDNA which have been digested with Hind III and Bgl II. mtDNA from a non-senescent control strain is digested with Hind III in the " H " lanes, and the "S" lanes contain Bgl II digested mtDNA from a senescent strain which does not contain detectable inserts of kalDNA. The four panels b, c, d, and e of the blots have been probed with the radioactively labelled, gel purified mtlS-kalDNA junction fragments designated b2", b l " , b2', and b l ' in figure 38. The junction fragment analysis was performed by isolating Bgl II digested fragments of senescent mtDNA which had previously shown homology to kaiilo clone X3. Therefore every junction fragment contains a full copy of the kaiilo fragment b l or b2, depending on whether it was a larger or a smaller junction fragment. In addition, each junction fragment contains mtDNA sequences up to and including the next Bgl II site. Thus, in the figure to follow, The S lane contains mtDNA from a senescent culture with mtAR-kalDNA only, therefore b l , b2 and the Bgl II fragment from which the junction fragment was derived will be detected in that lane. Other sequences in the gel which will be detected are the Hind III digested fragments of the mtDNA in lane H. Only a portion of the Hind III fragments which are homologous to the Bgl II fragment in which the insert was located will be detected, because the junction fragment homology consists only of that portion of the Bgl II fragment which extends from the Bgl II site in the mtDNA to the ends of location of mtlS-kalDNA. For instance, if an insert were in the center of a Bgl II restriction fragment of mtDNA, then the b l ' and b2' junction fragments would consist of a full copy of bl or b2, plus either the right or the left half of the sequences of the Bgl II mtDNA fragment. Therefore it is possible to accurately determine the location of most inserts by this procedure. The pattern of hybridization seen was specific for each junction fragment of a specific size. However, an interesting result was obtained when the four common junction fragments of strain 1-16 were tested: all four behaved as though they were inserted into the same region of the DNA. This situation is illustrated in figure 39.  194  Part II: Parallel Subculture Series Experiments The Southern blots.in panels b, c, d, and e have been probed with probes which correspond to the four junction fragments from strain 1-16 parallel culture number ix. Hybridizations using the two smallest junction fragments, b2" and b l " , are shown in panels b and c, and the larger junction fragments, b2' and b l ' were used as probes in panels d and e. Panel a was hybridized with radioactively labelled mtDNAs as a control. All four of the experimental probes hybridize to Bgl II fragment 2, indicating that the insert is into this Bgl II fragment. In lane S fragments b l and b2 are detected in addition to Bgl II-2. The junction fragments hybridize to different, sets of Hind III fragments. The smaller junction fragments hybridize to the same fragments of mtDNA in panels b and c as expected, indicating that the probes differ only by the presence of b l or b2 within them. These Hind III fragments are indicated in the figure as Hind III-10a, Hind 111-17 and Hind 111-21. Extra fragments have become labelled in panels b and c. In panel b, an extra Hind III fragment has become slightly labelled in lane H. This fragment is Hind 111-12. It is not clear why this fragment should have become, labelled, as Hind III-12 is not contiguous with any of the other fragments. Hind III-12 is homologous with Bgl II-4, which seems slightly labelled in the S lane. These fragments are not labelled as intensely as the others, and are not thought to contain sequences homologous to the junction fragments. These could represent incomplete stripping of the blot or some sort of probe contamination, but are not. considered signifigant because replicate experiments on the b l " and b2" junction fragments always give similar results (data not shown). A similar situation is thought, to exist for the Hind III-l fragment in lane H of panel c, which also appears labelled, but it is not contiguous with the other fragments which are labelled in the panel. Panels d and e indicate hybridization to the same Bgl II fragments as panels b and c, namely Bgl II-2, and bl and b2. Panels d and e also show hybridization to Hind III-10a, and in addition to two other Hind III fragments, Hind III-l and -14. This confirms that insertion is into the common fragments, Bgl II-2, and more specifically, Hind III-10a. The model shown in figure 40  195  Part II: Parallel Subculture Series Experiments accounts for these observations. These Hind III fragments, and those mentioned for panels b and c. are contiguous on the mtDNA. A map of the mitochondrial DNA region of interest is shown in part A. The proposed location of the insert is shown by a dotted line. The mtDNA rearrangements capable of giving the results shown in figure 39 are diagrammed in parts B and C of figure 40. The lettered, bold lines above the mtDNA maps in figures 40B and 40C correspond to the junction fragments generated by Bgl II digestion of the indicated DNAs, and can be thought of as probes to the panels with the same lower case letters in figure 39. The situation for junction fragments corresponding to panels d and e of figure 39 are shown in figure 40B, while the situation for junction fragments corresponding to panels b and c of figure 39 are shown in figure 40C. The observation that sequences are found which extend from both directions of the proposed site of integration in Hind III-10a suggests that two types of insertion sequences are present, one with the mtDNA flanking sequences to the left inverted , and the other with the mtDNA flanking sequences to the right inverted. This is the situation that is diagrammed in figure 40. In addition to the two possible conformations of the mtDNA, the two possible conformations of mtlS-kalDNA are shown in the figure. Due to the inverted nature of the mtDNA, it is not possible to determine exactly in which orientation mtlS-kalDNA is in relation to the mtDNA, because both orientations give rise to the same junction fragments. The discovery of mtDNA with different flanking repeats of mtDNA suggests the possibility that the structure of a senescent mtDNA molecule is a dimeric inverted repeat joined by two mtlS-kalDNAs. This structure was hypothesized to exist by Bertrand (1986), in a model suggesting that the long inverted repeats of mitochondrial DNA that arise upon generation of mtlS-kalDNA may be the result of intermolecular recombination between mtDNAs carrying inserts of mtlS-kalDNA. The observation that the inserted structures predicted by the model are found in at least one kaiilo strain of N. intermedia supports the model,  196  P a r t II: P a r a l l e l S u b c u l t u r e Series E x p e r i m e n t s however it is equally possible that the j u n c t i o n fragments arise f r o m two different m t D N A molecules, w i t h similar, b u t opposite inserts. A table of all of the j u n c t i o n fragments identified i n this s t u d y is shown i n table 3. T h e location of the insert is reported to be in the smallest B g l II, E c o R l or H i n d III restriction fragment to w h i c h it could be m a p p e d . It is i m m e d i a t e l y apparent that there are a limited n u m b e r of sites in w h i c h m t l S - k a l D N A is f o u n d . T h i s is i n agreement w i t h previously reported observations ( B e r t r a n d , 1986; M y e r s , 1988; C h a n et a l , 1989a). T h e reason that kaiilo is f o u n d inserted i n a limited n u m b e r of sites has been hypothesized t o be due t o the requirement of a five base pair m a t c h between the t e r m i n i of kaiilo a n d the m t D N A ; the presence of a target site ( C h a n et al, 1989a). The  final  figure, figure 41, diagrams  the locations  of m t l S - k a l D N A .  T e n inserts  were  identified f r o m t h e parallel cultures of strains X l - 5 , 1-4 a n d 1-16. T h e locations are n u m b e r e d a n d refer back to table 3. C o m p a r i s o n of the locations of these inserts shows that several locations have been previously identified as sites of insertion of m t l S - k a l D N A . T h e s e were shown previously i n figure 6 i n the i n t r o d u c t i o n . Sites 4, 5, 7, a n d 8 have been reported b y B e r t r a n d (1986), while site 9 was reported b y M y e r s et al, (1989). T h e location of site 2 is very close to one m a p p e d previously ( M y e r s , 1988). T h e s e two sites are p r o b a b l y analogous, a n d the report of different locations p r o b a b l y represents differences i n how the two sites were identified. The. originally reported location was b y h y b r i d i z a t i o n to cloned m t D N A fragment H i n d III-12 (a TV. crassa clone w h i c h corresponds to TV. intermedia  fragment H i n d 111-14). T h e j u n c t i o n fragment identified in this s t u d y for location 2 w o u l d  also show h o m o l o g y to this cloned m t D N A fragment, however the use of the j u n c t i o n fragment as a clone shows that t h e homology extends further t h a n H i n d 111-14, into H i n d III-10a. B y analogy, the insert shown i n location 1 m a y also correspond t o a previously identified insert i n E c o R l - 4 ( M y e r s et al, 1989). T h e only location w h i c h is reported to be a novel insertion site of m t l S - k a l D N A is location n u m b e r e d 3 i n figure 41.  197  Part II: Parallel Subculture Series Experiments Table 3. Location of m t l S - k a l D N A in Parallel Series  STRAIN Xl-5-i Xl-5-ii Xl-5-iii Xl-5-v Xl-5-vi Xl-5-vii Xl-5-viii Xl-5-ix Xl-5-x 1-4-i I-4-ii I-4-iii I-4-iv I-4-v I-4-vii I-4-vii I-4-x I-16-i  I-16-ix  JUNCTION FRAGMENT NUMBER  LOCATION IN mtDNA MAP  1 2 1 3 4 2 3 1 3 2 3 2 1 1 1 2 2 1 2 1 1 1 2 1 2 3 4 1 2 3 4  Eco Rl-11 Hind IIMOa Eco Rl-10 Eco Rl-5 it  n  Hind 111-13,18 Hind IH-lOa tl  n  Hind III-12b M M  Hind IH-13,18 Eco Rl-10 Eco Rl-6 Hind IH-13,18 Eco Rl-6 Hind 111-13,18 «  it  Hind IH-lOb H  tt  Bgl 11-1,2 i)  tt  Hind IH-lOa tt  II  n  tt  H  it  Hind IH-lOa ti  n  tt  II  it  tt  I  198  INSERT N U M B E R IN FIGURE 36 1 2 3 4 4 5 5 6 6 7 7 5 3 8 5 5 8 5 5 9 9 10 10 2 2 2 2 2 2 2 2  Part II: Parallel Subculture Series Experiments Figure 41. Insertion Sites of m t l S - k a l D N A from Table 3.  In this figure, the insertion sites of mtlS-kalDNA determined in table 3 have been placed on a restriction map of the mtDNA of N. intermedia. The numbers which match the thick lines correspond to the numbers in the last column of table 3. The mitochondrial restriction map is redrawn from Myers, (1988) and Bertrand et al, (1985).  199  P a r t II: Parallel S u b c u l t u r e Series E x p e r i m e n t s  200  Part II: Parallel Subculture Series Experiments The use of labelled junction fragments to map the inserts of kalilo generally worked well, however a few problems were apparent. The obvious technical difficulty was the removal of the junction fragments from agarose gels free of contaminating D N A sequences. This was overcome by running gels for long periods of time and/or modulation of agarose concentration to effect the separation of junction fragments from other bands. A problem that was not so easily overcome was that the D N A rearrangements that were present in some of cultures may have involved Bgl II sites that belonged to the junction fragments. Consequently, the analysis of the patterns of radioactivity sometimes implied that non-contiguous m t D N A bands had become labelled. That this was not simply due to contamination of the probes was indicated by the observation that similar-sized equivalent probes from different gels gave rise to the same pattern. If the location of a junction fragment could not be determined, but similar sized junction fragments gave identical patterns, then they were reported as equivalent for the purposes of the comparisons shown in figures 34-37. The locations of inserts of mtlS-kalDNA shown in table 3 include only those whose labelled junction fragments gave unambiguous results.  DISCUSSION The overview of the parallel series data suggests the following. First, although the lifespans of the members of the parallel series of the progeny of crosses involving a senescent female parent show much more variability than that of the wild isolates of N. intermedia,  statistical analysis of the  data suggests that lifespan is still highly regulated and it is a characteristic of individual members of a parallel series. Second, multiple inserts in senescent strains are the norm rather than the exception. There does not seem to be an upper limit to the number of pairs of junction fragments, but in practice three pairs can only be seen clearly because the m t D N A of strains with many inserts is usually so highly degraded that interpretation is difficult. Third, there seems to be a limited number  201  P a r t II: P a r a l l e l S u b c u l t u r e Series E x p e r i m e n t s of insertion sites available for m t l S - k a l D N A , however a m o n g the m e m b e r s of a parallel series  the  insertion seems to be r a n d o m a m o n g a limited n u m b e r of sites. T h e exception t o this rule is that in certain cultures,  a single insertion site seems to p r e d o m i n a t e . It is not k n o w n if this  represents  inheritance of these inserts, or strain specific insertion. F o u r t h , strains t h a t contain molecules with multiple  types  of insertions  at  a  single site  have  been  found,  suggesting  the  possibility that  r e c o m b i n a t i o n between molecules w i t h insertions of kaiilo m a y be o c c u r r i n g to generate the long inverted repeats.  F i n a l l y , death of a culture seems not to be dependent u p o n inserts of kaiilo, b u t  u p o n other insults to the m t D N A , often the loss of B g l II fragments 5 and 6. O f course there are striking exceptions  to this rule as well. T a k e n together,  these observations suggest  that  complex  events are o c c u r r i n g whose analysis is difficult, given the m i t o c h o n d r i a l biology at h a n d . F u r t h e r , the observation that these events seem to h a p p e n very r a p i d l y suggests the possibility that the s y s t e m cannot  be s t u d i e d using current  procedures for p r e p a r i n g cultures. Nonetheless this analysis has  p r o v i d e d novel i n f o r m a t i o n concerning the senescence process i n c l u d i n g the presence of high levels of m t A R - k a l D N A and the importance of deletions of m t D N A .  Is insertion the Senescence-Determining Event? T h e deletions seen in all of the strains w h i c h were analyzed in this study seem to resemble those seen i n the stopper cytoplasmic m u t a t i o n s of Neurospora.  A l m o s t all of the deletions that were  described i n c l u d e d B g l II fragments 5 a n d 6, m e a n i n g that B g l II fragments 1, 2 and 3 were retained. F i g u r e 4 i n the i n t r o d u c t i o n illustrated the regions of the m t D N A that are retained in a n u m b e r of cytoplasmic m u t a n t s  of N.  crassa.  A l l of t h e m include the same region as that retained i n the  senescent kaiilo strains, i n c l u d i n g a region that is thought to be i m p o r t a n t in stopper f o r m a t i o n ; the retained  region  contains  Boundary (Bertrand  a major  et al, 1980;  Neurospora  mtDNA  origin  of replication on the  Eco  Rl-4,-6  C o l l i n s a n d L a m b o w i t z , 1981). Indeed, the clustering of the m t l S -  202  P a r t II: P a r a l l e l S u b c u l t u r e Series E x p e r i m e n t s k a l D N A sites t h a t is seen in the t . R N A - r R N A region of the m t D N A m a y be due to the fact t h a t it is precisely this region of the m t D N A deletions  seen  i n stoppers  are n o w t h o u g h t  r e c o m b i n a t i o n of the m t D N A The  possibility  recombination  that  t h a t is retained b y the stopper  kalilo  to  be generated  generation  b y site  mechanism. T h e  specific  intramolecular  (Gross et al, 1984; D e V r i e s et al, 1986; A l m a s a n a n d M i s h r a , strains  c o u l d be easily  undergo  tested.  deletions  A scenario  at  these  previously  is possible whereby  identified  senescent,  1989).  sites  of  mtlS-kalDNA  containing m t D N A s undergo repeated r o u n d s of r e c o m b i n a t i o n t o generate the long inverted repeats of m t D N A that are seen to s u r r o u n d inserts, a n d to generate subsequent deletions of portions of the mtDNA.  If this hypothesis is true,  then  senescence plasmids is only a special  the senescence i n d u c e d b y kalilo a n d m a r a n h a r  case of m i t o c h o n d r i a l stopper  formation,  linear  a n d kalilo a n d  m a r a n h a r are acting like the A c t i v a t o r a n d Dissociator elements of maize ( M c C l i n t l o c k , 1947, 1949, 1951). Insertion of the element w o u l d give rise to secondary events w h i c h were capable of killing the organism, such as the chromosome breakage seen i n the maize system. M i t o c h o n d r i a l m u t a t i o n has been described as the ebb a n d flow of m t D N A different types  (Gross  molecules of  et al, 1984), a n d the situation w i t h the kalilo cytoplasms seems to be no  exception. However, major differences between kalilo a n d m u t a n t s such as stopper do exist, because the kalilo p h e n o t y p e is always lethal. T h e time of the appearance of some inserts of m t l S - k a l D N A correlates w i t h the lifespan of the associated strain ( M y e r s , 1988), suggesting a possible  stochastic  m e c h a n i s m for this process, however insertion per se is not the event w h i c h seems to be responsible for the death of these organisms. T h i s hypothesis does not account been identified w h i c h show n o identifiable m t D N A  alterations  for the fact t h a t strains  other  have  t h a n the insertion of m t l S -  k a l D N A . Therefore, integration is an event w h i c h is necessary for senescence to occur, b u t it is not always sufficient. E x a c t l y  what  is killing the kalilo strains  of N.  intermedia  is not k n o w n T h e  senescence process m a y only resemble the suppressive a c c u m u l a t i o n of altered m t D N A s i n general,  203  P a r t II: P a r a l l e l S u b c u l t u r e Series E x p e r i m e n t s a n d a n y of the previously described structures a n d processes m a y be sufficient for death to occur. B e r t r a n d et al (1985; 1986) have hypothesized that kaiilo m a y s i m p l y generate deficient m t D N A s , w h i c h then become suppressive over w i l d type a n d lead to the death of the strain. T h e longevity of a particular strain m a y d e p e n d o n the position of the insertion or the extent of the m t D N A d i s r u p t i o n . F o r instance, grossly deleted molecules m a y be more suppressive t h a n their counterparts w i t h simple insertions. H o w e v e r , this hypothesis does not account for the difference in longevity between parallel cultures. P e r h a p s these molecules are suppressive, b u t o n l y m i l d l y so, a n d the occurrence of a second event, such as a deletion, can cause the death of the o r g a n i s m . T h e parallel series protocol was f o u n d to be very useful for the identification a n d separation of processes w h i c h are p r o g r a m m e d f r o m those that are p u r e l y r a n d o m i n this system. It has shown, for  instance,  that  lifespans  are heterogeneous  and that  events  other  than  insertion  m a y be  responsible for d e a t h . However it. has failed to answer some i m p o r t a n t questions. F o r instance, it has not resolved whether the insertion of kaiilo is a r a n d o m or a p r o g r a m m e d process. E v i d e n c e for b o t h possibilities was f o u n d . If insertion sites were p r o g r a m m e d t h e n insertion could be controlled by the nuclear genotype. A n o t h e r possibility is t h a t insertion is n o n - r a n d o m , due to the inheritance of low levels of molecules w i t h inserts. It would take an experimental protocol w h i c h was more sensitive t h a n the s o u t h e r n blot to determine if insertion was due to inheritance. A n experiment w h i c h could be p e r f o r m e d o n strain 1-16 to determine if insertion was due to inheritance mtDNAs  with m t l S - k a l D N A  would be the a m p l i f i c a t i o n of m t D N A  fragment  of a low level of H i n d III-10a f r o m  ascospore D N A t h r o u g h the Polymerase C h a i n R e a c t i o n ( P C R ) . T h e presence of m u l t i p l e forms of the fragment w o u l d prove t h a t cultures h a d inherited m t l S - k a l D N A . However, the isolation of D N A f r o m ascospores is difficult, a n d the observation of strain 1-16 suggests t h a t this analysis m a y not be so simple. If the inserts i n this strain were inherited, t h e n all the cultures have died w i t h inserts that were not p r o m i n e n t i n their female parent; f r o m where they inherited the insert is not clear. T h e  204  P a r t II: P a r a l l e l S u b c u l t u r e Series E x p e r i m e n t s concept that insertion site is dependent on nuclear genotype is also c o m p l i c a t e d ; in this case b y the consideration that the nuclear functions required to specify insertion of kalilo into a specific m t D N A location are not i n t u i t i v e l y obvious. However, the observation of figures 38-40, w h i c h suggest  that  the two j u n c t i o n fragments seen in strain 1-16 only represent insertion i n t o a single site, makes the possibility of p r o g r a m m e d insertion i n t o that site more plausible. W h i l e the observation of identical m t D N A s within clones argues for inheritance of the aberrant  m t D N A s , the observation of similar  m t D N A s between strains, such as those identified for clone ix of strain 1-4 (figure 36), clones i i i and x f r o m strain X l - 5 programmed  (figure  insertions  possibilities as to the  34),  and  and clones i , ii a n d ix f r o m strain X l - 6  deletions. Therefore, it  is impossible to  (figure 35)  decide  between  argues  for  these  two  origin of inserts, however, the isolation of D N A f r o m ascospores,  a n d its  subsequent a m p l i f i c a t i o n using P C R , m i g h t be able to answer this question. Nonetheless, certain  observations  as to whether  insertion is the senescence  determining  event can be m a d e . T h e only definitive f u n c t i o n of kalilo was f o u n d to be insertion into the m t D N A ; this is what kalilo was f o u n d to be p r o g r a m m e d to do. m t l S - k a l D N A is always f o u n d in senescent cultures  of N. intermedia.  In a d d i t i o n there were  certain  senescent  mtDNA  types  w i t h specific  inserts of m t l S - k a l D N A that were found to be associated w i t h reduced longevity, such as the pair of insertions in strain 1-16 t h a t correlated w i t h the clones with the shortest lifespan. E v e n t h o u g h there are a n u m b e r of complex m i t o c h o n d r i a l changes that are o c c u r r i n g , i n c l u d i n g deletions of m t D N A and  the increase i n m t A R - k a l D N A ,  mtDNA  insertion always precedes,  abnormalities. Therefore insertion is a very i m p o r t a n t  although the location of inserts m a y not be relevant.  205  a n d m a y even direct these event  in the senescence  other  process,  P a r t II: Parallel S u b c u l t u r e Series E x p e r i m e n t s  Relevance of Data to Senescence T h i s work utilizing a large n u m b e r of strains was originally u n d e r t a k e n to identify the genes encoded b y kaiilo a n d the genetic processes they affect. T h e identification of how nuclear  genotype  affects senescence has been h a m p e r e d b y the observation t h a t there is a lot of variability i n the lifespan of i n d i v i d u a l clones of N. intermedia.  T h e statistical  treatment of the lifespans of the  100  parallel series m e m b e r s suggests that overall, lifespan is a h i g h l y controlled event, a n d the i n d i v i d u a l lifespans fall i n t o the n o r m a l d i s t r i b u t i o n a r o u n d the m e a n for each series. I n d i v i d u a l clones of the parallel series however can exhibit unrelated lifespans. F o r instance, parallel clone v i of strain in figure 31 lived to be 41+  Xl-8  subcultures. N o other parallel culture f r o m the 50 in figure 31 lives to be  nearly t h a t l o n g . E s c a p e f r o m senescence has been observed before ( G r i f f i t h s , pers. c o m m . ) , explanations w h i c h account for it include the possibility t h a t the culture has become and  and  contaminated  is n o longer senescent. A n o t h e r explanation is that cytoplasmic r e c o m b i n a t i o n a n d assortment  m a y have led to the loss of m t A R - k a l D N A . Statistically, the parallel series d a t a could be used to find nuclear genotypes and molecular events which affect longevity. T h i s sort of analysis is called A N a l y s i s O f V A r i a n c e ( A N O V A ) , can be  used to describe crosses w h i c h give rise to i n d i v i d u a l s with different lifespans, but to  statistically accurate A N O V A  and be  requires n u m b e r s of i n d i v i d u a l s that w o u l d be p r o h i b i t i v e for m a n y  types of analyses. F o r instance, f r o m the d a t a p r o v i d e d i n figures 31 a n d 32, A N O V A show t h a t there are statistically  significant differences i n the lifespans between  can be used to  the crosses using  geographically distinct male parents shown i n figures 31 a n d 32 (the lifespans presented i n figure 31 are f r o m geographically similar parents,  a n d those i n figure 32  are  f r o m geographically  isolated  parents). T h i s implies that there are differences between the male parents t h a t can be detected i n the longevities of their progeny. T h i s is o n l y possible because the two groups of 50 are significant for this analysis ( d a t a not shown). T o determine whether there were statistically significant differences  206  P a r t II: Parallel S u b c u l t u r e Series E x p e r i m e n t s between the lifespans of the i n d i v i d u a l strains would require a p p r o x i m a t e l y 50 parallel cultures for each, instead of 10. It is at this level that the n u m b e r s become prohibitive. A n o t h e r p r o b l e m is t h a t the identification of i m p o r t a n t events i n the senescence process, like the. apparent deletions of the m t D N A w h i c h are seen in strain 1-4, m a y be specific only to t h a t strain. Is this process general or specific to the genotype present i n this i n d i v i d u a l ? Is a lifespan of 12 equal to a lifespan of 14? T h e s e are the questions w h i c h the use of large n u m b e r s of progeny can answer,  a n d the  use of statistical  methods  and m a n y progeny m a y be required i n spite of the  formidable n u m b e r s involved to determine what senescent events are p r o g r a m m e d to occur i n this stochastic  process.  T h e i n t e r p r e t a t i o n of the results is h a m p e r e d b y the observation that, at least i n some cases, the analysis m a y be different every time it is p e r f o r m e d . If s a m p l i n g i n this s y s t e m disturbs it so m u c h t h a t it is impossible to tell what is h a p p e n i n g , t h e n the situation in this s y s t e m m a y resemble the Heisenberg u n c e r t a i n t y p r i n c i p l e . T h i s paradox can only be resolved if procedures are developed which do not require the amplification of the senescent cultures prior to m t D N A isolation. A n u l t r a small  scale  mtDNA  isolation would  solve  this  p r o b l e m , or  alternatively,  the  use  of  totalDNA  isolations w h i c h do not require strain amplification m a y be required. T h e n the P C R could be used to amplify very small amounts of D N A . A n o t h e r e x p e r i m e n t a l protocol for s t u d y i n g f u n c t i o n i n this system is to analyze the m t D N A s f r o m every s u b c u l t u r e . In this way it s h o u l d be possible to observe the events o c c u r r i n g , rather t h a n m a k i n g predictions based on one m t D N A isolation. T h i s , c o u p l e d w i t h the use of parallel series m a y p r o v i d e a better way of identifying the etiology of events i n this very complicated system.  207  P a r t II: Parallel S u b c u l t u r e Series E x p e r i m e n t s  Other Models Several relevant observations on these processes have been m a d e i n the s t u d y of senescence in Podospora  anserina.  In Podospora  anserina  it has been found t h a t senescence  occurs i n two  phases. Its onset corresponds t o a. u n i q u e event w i t h a constant p r o b a b i l i t y per unit of time. T h i s is followed b y the i n c u b a t i o n phase w h i c h is specific for each race ( M a r c o u , 1961). T h e same kinetics of senescence m a y a p p l y t o senescence in TV. intermedia,  however the d a t a for lifespan in Podospora  is  reported in m o n t h s , a n d growth is reported as the m o v e m e n t of a g r o w t h front on a p e t r i dish, therefore the d a t a are difficult to compare. It s h o u l d also be noted t h a t there are f u n d a m e n t a l differences i n the u n d e r l y i n g molecular events; senescence i n P. anserina a n d amplification of s e n D N A s , while in TV. intermedia,  senescence is caused b y the destruction of the  m t D N A b y kaiilo. A n o t h e r clear p h e n o m e n o n in P. anserina lifespan. E i g h t nuclear genes w h i c h affect prevent the onset of senescence  is caused by the excision  is the effect t h a t nuclear genes have o n  colony m o r p h o l o g y have been f o u n d t o delay or even  in this organism. H o w these genes can affect the expression of a  m i t o c h o n d r i a l i n t r o n is not entirely clear. O n a similar note, nuclear suppressors have been f o u n d to affect the expression of kaiilo senescence in Neurospora  ( A . J . F . Griffiths pers. c o m m . ) . Therefore it  m a y be possible to identify functional processes in the kaiilo process after all, if, say, nuclear  genes  w h i c h prevent the integration of m t A R - k a l D N A were f o u n d . T h e structure of the m t D N A in the cms S strains of maize is a collection of linear molecules w i t h S - p l a s m i d sequences at their t e r m i n i that have arisen t h r o u g h r e c o m b i n a t i o n with the linear plasmids S - l a n d S-2. T h e s e recombinations occur at sites of homology between the T I R s of S I a n d S-2 a n d the maize m t D N A ( S c h a r d l et al, 1984). R e v e r s i o n to male fertility i n these strains  correlates  w i t h the loss of S - l a n d S-2, a n d the recircularization of the m t D N A ( S c h a r d l et al, 1985). It is not k n o w n if insertion of kaiilo D N A i n the m t D N A of TV. intermedia  also has such p r o f o u n d affects o n  the structure of the m t D N A , however the lack of regions of extensive h o m o l o g y between the p l a s m i d  208  P a r t II: Parallel S u b c u l t u r e Series E x p e r i m e n t s a n d the m t D N A seen in this system suggests t h a t insertion is v i a a different m e c h a n i s m , although the presence of a target site seems i m p o r t a n t ( C h a n et al, 1989a). T h e structure of the m t D N A f r o m the senescent strains is not k n o w n , a l t h o u g h m t D N A seems h i g h l y degraded as shown i n figure 30. If kalilo were to p r o m o t e these types of m t D N A rearrangements, the senescence process.  then they too m a y have an effect o n  T h e cms traits are affected b y a n u m b e r of nuclear restorer genes.  This  implies that insertional behavior or some aspect of p l a s m i d biology can be m o d u l a t e d b y nuclear genotype ( L a u g h n a n et al, 1981). T h e r e f o r e similar processes m a y be seen i n the kalilo system. Finally,  the report  of the existence of m t l S - k a l D N A  w i t h oppositely oriented  terminal  repeats of m t D N A suggests the possibility that, this m t D N A aberration arises b y crossovers between molecules w i t h similar inserts of kalilo ( B e r t r a n d ,  1986). A n o t h e r m o d e l for the insertion of kalilo  D N A is the generation of long i n v e r t e d repeats t h r o u g h the illegitimate r e c o m b i n a t i o n of the T I R s of kalilo w i t h short homologous regions of the m t D N A ,  allowing for an u n s c h e d u l e d r o u n d of D N A  replication ( C h a n et al, 1989a). T h e identification of only one pair of j u n c t i o n fragments i n some strains is consistent w i t h the latter hypothesis. It s h o u l d be noted that a structure other t h a n the one illustrated i n figure 40 is possible based u p o n the data. T h i s structure  is a simple insertion of  kalilo without the m t D N A inversion. T h e four j u n c t i o n fragments arise v i a molecules w i t h kalilo in b o t h orientations.  It is impossible to decide between  these two models for the structure  of the  m t D N A in strain 1-16, as m a n y different sorts of m t D N A molecules could give the results illustrated in figures 38 a n d 39. However, the t e r m i n a l l y inverted repeats of m t D N A  that  are t h o u g h t  to  s u r r o u n d inserts of m t l S - k a l D N A are expected to exist because cultures w i t h single insertions always exhibit j u n c t i o n fragments that differ i n molecular weight b y 1 k b in B g l II digests of the m t D N A . In this part of the thesis a n u m b e r of experiments were described that were designed to f i n d the p r o g r a m m e d functions of the kalilo p l a s m i d , in response t o the observation that the kalilo linear p l a s m i d was entirely m i t o c h o n d r i a l . T h e s e experiments  209  have  led t o the discovery that juvenile  Part. II: P a r a l l e l S u b c u l t u r e Series E x p e r i m e n t s strains that  are the. progeny of senescent  female parents  have a m u c h more extensive  range  of  lifespans t h a n their female parents, a n d that nuclear genes which affect the lifespan are t h o u g h t to exist. W i t h respect to senescence, a n u m b e r of novel ideas on the u n d e r l y i n g molecular events have been  discovered. T h e s e  are  the  relative  importance  of m t D N A  alterations  in a d d i t i o n  to  the  generation of m t l S - k a l D N A , a n d the presence of large a m o u n t s of the free p l a s m i d , m t A R - k a l D N A . T h e observation that large n u m b e r s of identical clones of juvenile strains can acquire identical inserts of m t l S - k a l D N A ,  a n d similar alterations  of m t D N A ,  suggests  the possibility that  insertion and  subsequent D N A deletion m a y be p r o g r a m m e d events, or the possibility that j u v e n i l e strains inherit undetectable a m o u n t s of altered m t D N A s . oriented long inverted repeats  of m t D N A  F i n a l l y , the presence of m t l S - k a l D N A with oppositely suggests t h a t r e c o m b i n a t i o n m a y be o c c u r r i n g between  molecules of m t D N A w i t h inserts of m t l S - k a l D N A .  210  Literature Cited  LITERATURE CITED A k i n s R A . , G r a n t D . M . , S t o h l L . L . , B o t t o r o f f D . A . , N a r g a n g F . E . , a n d L a m b o w i t z A . M . (1988). Nucleotide Sequence of the V a r k u d M i t o c h o n d r i a l P l a s m i d of Neurospora  a n d Synthesis of a  H y b r i d T r a n s c r i p t W i t h a 5' Leader D e r i v e d f r o m M i t o c h o n d r i a l R N A . J . M o l . B i o l . 204(1): 1-25. . Akins R . A . , Kelley R . L . , and Lambowitz Integration  into  Mitochondria.  Mitochondrial  A . M . (1986). D N A and  Mitochondrial Plasmids Evidence  for  Reverse  of  Neurospora:  Transcription  in  C e l l 47: 505-516.  A k i n s R . A . , K e l l e y R . L . , a n d L a m b o w i t z A . M . (1989). P l a s m i d s of Neurospora.  spp. That  Characterization  of M u t a n t M i t o c h o n d r i a l  H a v e Incorporated t R N A s b y Reverse  Transcription.  M o l . C e l l . B i o l . 9(2): 678-691. A k i n s R . A . , a n d L a m b o w i t z A . M . (1984).  T h e poky M u t a n t of Neurospora  D e l e t i o n at the 5' E n d of the M i t o c h o n d r i a l S m a l l r R N A .  C o n t a i n s a 4-base-pair  P r o c . N a t l . A c a d . S c i . 81:  3791-  3795. A l m a s a n A . , a n d M i s h r a N . C . (1988).  Molecular Characterization  New Stopper M u t a n t E R - 3 of Neurospora  crassa.  of the M i t o c h o n d r i a l D N A of a  Genetics 120(4): 935-945.  A n d e r s o n S., B a n k i e r A . T . , B a r r e l l B . G . , D e B r u i j n M . H . L . , C o u l s o n A . R . , D r o u i n J . , E p e r o n I . C . , N i e r l i c h C P . , R o e B . A . , Sanger F . , Schreier P . H . , S m i t h A . J . H . , S t a d e n R . , a n d Y o u n g I . G . (1981). Sequence  a n d O r g a n i z a t i o n of the H u m a n M i t o c h o n d r i a l G e n o m e . N a t u r e 290:457-  464. Atkinson  T . , a n d S m i t h M . (1984).  (0.2uxnol) A u t o m a t e d  Purification  Synthesis  of Oligonucleotides  b y G e l Electrophoresis,  Obtained by Small  i n Oligonucleotide Synthesis:  P r a c t i c a l A p p r o a c h . M . J . G a i t , e d . ( I R L Press: O x f o r d ) , p p . 35-81.  211  Scale A  Literature Cited Backer  J . S , a n d B i r k y C . W . J r . (1985). Saccharomyces  cerevisiae  Produces  T h e Origin  of M u t a n t  Cells:  Mechanism by Which  Cells H o m o p l a s m i c for N e w M i t o c h o n d r i a l M u t a t i o n s .  C u r r . G e n e t . 9: 627-640. B a m f o r d D . H , M c G r a w T , M a c k e n z i e G , a n d M i n d i c h L . (1983). Identification of a P r o t e i n  Coat  C o v a l e n t l y B o u n d t o the T e r m i n i of B a c t e r i o p h a g e P R D 1 D N A . J . V i r o l . 45:311-316. B a s z c z y n s k i C L , a n d K e m b l e R . J . (1987).  T e r m i n a l P r o t e i n A s s o c i a t i o n a n d Sequence H o m o l o g y in  L i n e a r M i t o c h o n d r i a l P l a s m i d - L i k e D N A s of S o r g h u m a n d M a i z e .  P l a n t C e l l R e p o r t s 6:127-  130. Beadle G . W . (1945). Genetics a n d M e t a b o l i s m i n Neurospora.  P h y s i o l . R e v . 25: 643-663.  Bedinger P , D e Hostos E . L , Leon P , a n d W a l b o t V . (1986). linear 2.3kb M i t o c h o n d r i a l P l a s m i d of M a i z e . Belcour L , K o l l F , V i e r n y C , S a i n s a r d - C h a n e t M i t o c h o n d r i a l Introns Involved anserina?  Cloning and Characterization  of a  M o l . G e n . G e n e t . 205: 206-212.  A , a n d Begel O . (1986). A r e Proteins  E n c o d e d in  i n the Process of Senescence in the F u n g u s  In M o d e r n T r e n d s in A g i n g Research, Y . C o u r t o i s , B . F a u c h e u x ,  Podospora  B . Forette, D . L .  K n o o k , a n d J . A . T r e t o n , eds. ( L o n d o n : J o h n L i b b e y & C o m p a n y L t d . ) . Colloque I N S E R M vol. 147: 63-71. CP  Belcour  L , Begel O , Mosse M . O , a n d V i e r n y C . (1981). Senescent C u l t u r e s of Podospora Sequences.  anserina:  the R e t a i n e d ,  L e t h a l M i t o c h o n d r i a l G e n o t y p e s in Podospora  for Senescence. M o l . G e n . G e n e t . 163: L ,  V a r i a b i l i t y Between  Amplified  C u r r . G e n e t . 3: 13-22.  Belcour L , a n d Begel O . (1978).  Belcour  M i t o c h o n d r i a l D N A amplification in  and Vierny  C . (1986).  anserina:  A Model  113-123.  Variable  D N A Splice  R e l a t i o n s h i p to the Senescence Process i n Podospora.  212  Sites  of a  Mitochondrial  E M B O J . 5(3): 609-614.  Intron:  Literature Cited Bendich  A . J . (1982). P l a n t  Mitochondrial D N A : T h e Last  F r o n t i e r , i n M i t o c h o n d r i a l Genes.  S l o n m i s k i , P . Borst a n d G . A t t a r d i , eds. ( C o l d S p r i n g H a r b o u r  Laboratory: Cold  P.  Spring  H a r b o u r ) , p p . 477-481. B e r t r a n d H . (1983).  A g i n g a n d Senescence i n F u n g i .  Basic R e s e a r c h a n d Preclinical  Screening,  In Intervention i n the A g i n g Process, P a r t B :  W . Regelson  a n d R . M . Sines, eds. ( N e w Y o r k :  A l a n R . Liss), p p . 233-251. B e r t r a n d H . (1986). Element  T h e kalilo Senescence F a c t o r of Neurospora  Derived  from  a Nuclear  Plasmid.  intermedia:  A M i t o c h o n d r i a l IS-  In E x t r a c h r o m o s o m a l  Elements  in  Lower  E u k a r y o t e s , R . W i c k n e r , A . H i n n e b u s c h , L . M e t s , A . L a m b o w i t z , A . Holaender, eds. ( N e w York:  P l e n u m Press), p p . 93-104.  B e r t r a n d H . , C h a n B . S . S . , a n d G r i f f i t h s A . J . F . (1985). .  Insertion of a F o r e i g n Nucleotide  Into M i t o c h o n d r i a l D N A Causes Senescence i n Neurospora  Bertrand  H . , C o l l i n s R . A . , Stohl  Mutants  of Neurospora  L . L . , Goewert  crassa  intermedia.  R . R . , and Lambowitz  Mitochondrial D N A and'Their  Sequence  C e l l 41: 877-884.  A . M . (1980).  Relationship  Deletion  to the " S t o p -  S t a r t " G r o w t h P h e n o t y p e . P r o c . N a t l . A c a d . S c i . 77(10): 6032-6036. B e r t r a n d H . , G r i f f i t h s A . J . F . , C o u r t D . A . , a n d C h e n g O K . (1986). A n E x t r a c h r o m o s o m a l P l a s m i d is the E t i o l o g i c a l Precursor of k a l D N A Insertion Sequences in the M i t o c h o n d r i a of Senescent N e u r o s p o r a . C e l l 47: 829-837. Bertrand  H . , McDougall  Uninterrupted  K . J . , a n d Pittenger  Growth  of Neurospora  T . H . (1968). crassa  Somatic  in Continuous  Cell  Growth  Variation Tubes.  During J. Gen.  M i c r o b i o l . 50: 337-350. B e r t r a n d H . , Szakacs N . A . , N a r g a n g F . E . , Zagozeski O A . , C o l l i n s R . A . , a n d H a r r i g a n J . C . (1976). T h e F u n c t i o n of M i t o c h o n d r i a l Genes i n Neurospora 409.  213  crassa.  C a n . J . G e n e t . C y t o l . 18: 397-  Literature C i t e d Bertrand  H . , B r i d g e P . , Collins R . A . , G a r r i g a G . , a n d L a m b o w i t z A . M . (1982). R N A S p l i c i n g i n Neurospora  Mitochondria:  Characterization  S p l i c i n g the M i t o c h o n d r i a l Large r R N A . Bertrand  H . , a n d Griffiths A . J . F . (1989). D N A in Neurospora.  Bertrand  Bertrand  crassall:  Bertrand  C.W.Jr.,  crassa.  Suppressors  of the poky  Cytoplasmic  crassa.  Cytoplasmic mutant  in  C a n . J . G e n e t . C y t o l . 19: 81-91.  Mutants  Selected  From  Continuously  Genetics 6 1 : 643-659.  Isolation a n d Classification of E x t r a n u c l e a r  M u t a n t s of  Genetics 71: 521-533. T . H . (1972b).  Complementation  A m o n g Cytoplasmic  M u t a n t s of  M o l . G e n . G e n e t . 117: 82-90.  V a n Winkle-Swift  Frequency  Nuclear  T . H . (1972a).  H . , a n d Pittenger Neurospora  Birky  crassa.  Defects i n  Linear P l a s m i d s that Integrate i n t o the M i t o c h o n d r i a l  T . H . (1969).  G r o w i n g C u l u t r e s of Neurospora  Neurospora  With  C e l l 29: 517-526.  M i t o c h o n d r i a l C y t o c h r o m e Systems.  H . , a n d Pittenger  B e r t r a n d H . , a n d Pittenger  Mutants  G e n o m e 31(1): 155-159.  H . , a n d K o h o u t J . (1977). Neurospora  of N e w N u c l e a r  Distributions  K . P , Sears for  B . B , Boynton  Chloroplast  Genes  in  J . E . , and Gillham Chlamydomonas  N . W . (1981).  Zygote,  Clones:  E v i d e n c e f o r R a n d o m D r i f t . P l a s m i d 6:173-192. B i r k y C . W . J r . , D e m k o C . A . , P e r l m a n P . S . , a n d Strausberg Mitochondrial  genes  in yeast:  Dependence  on  R . (1978a). U n i p a r e n t a l Inheritance of  Input  Bias  of D N A a n d  Preliminary  Investigations of the M e c h a n i s m . Genetics 89:615-651. B i r k y C . W . J r . , Strausberg R . L . , P e r l m a n P . S . , a n d Forster J . L . (1978b). V e g e t a t i v e Segregation of M i t o c h o n d r i a in Y e a s t : E s t i m a t i n g P a r a m e t e r s U s i n g a R a n d o m M o d e l . M o l . G e n . G e n e t . 158:251-264. B i r k y C . W . J r . (1973). O n the O r i g i n of M i t o c h o n d r i a l M u t a n t s : E v i d e n c e for Intracellular  Selection  of M i t o c h o n d r i a in the O r i g i n of A n t i b i o t i c - R e s i s t a n t Cells in Y e a s t . Genetics 74:421-432.  214  Literature Cited B o r s t P . (1972). M i t o c h o n d r i a l N u c l e i c A c i d s . A n n . R e v . B i o c h e m . 41: 333-376. B r a u n C . J , Sisco P . H , Sederoff R . R , a n d Levings, C . S . I l l (1986). Repeats from Plasmid-Like D N A s  C h a r a c t e r i z a t i o n of Inverted  a n d the M a i z e M i t o c h o n d r i a l G e n o m e .  Curr.  Genet.  10(8):625-630. Breitenberger  C . A , and RajBhandary  U . L . (1985).-  B a s e d o n A n a l y s i s of Neurospora Breitenberger C . A , B r o w n i n g  Some  of M i t o c h o n d r i a l  crassa M i t o c h o n d r i a l D N A . T I B S , D e c e m b e r ,  K . S , Alzner-De Weered  Processing in Neurospora  Highlights  crassa M i t o c h o n d r i a :  B , and RajBahndary  Research  1985.  U 1 L . (1985). R N A  U s e of Transfer R N A Sequences as Signals.  E M B O J . 4(1): 185-195. Brown  G . G , Castora Polymorphism:  F.J,  Frantz  Evolutionary  S . C , and Studies  Simpson  on the G e n u s  M . V . (1981) Rattus.  Mitochondrial D N A  In O r i g i n s a n d E v o l u t i o n of  E u k a r y o t i c Intracellular Organelles, A n n . N : Y . A c a d . S c i . 361: 119-134. Burger G , Citterich Neurospora  M . H , Nelson M . A , W e r n e r S , a n d M a c i n o G . (1985). crassa M i t o c h o n d r i a :  R N A Processing i n  Transfer R N A s P u n c t u a t e a Large Precursor  Transcript.  E M B O J . 4(1): 197-204. Burke  J . M , and RajBhandary  U . L . (1982). Intron W i t h i n the Large r R N A  Gene, of N.  crassa  M i t o c h o n d r i a : A L o n g O p e n R e a d i n g F r a m e a n d a Consensus Sequence Possibly I m p o r t a n t in S p l i c i n g . C e l l 31: 509-520. Burke  J . M , Breitenberger  C . A , Heckman  C y t o c h r o m e b G e n e of Neurospora Carnevali F ,  a n d L e o n i L . (1972).  J.E,  Dujon  B,  and RajBhandary  U . L . (1984).  crassa M i t o c h o n d r i a . J . B i o l . C h e m . 259: 504-511.  Intramolecular Hetereogeneity of Y e a s t M i t o c h o n d r i a l D N A .  B i o c h e m . B y o p h y s . Res. C o m m u n . 47: 1332-1331. C e c h T . R . (1983) R N A Splicing: T h r e e T h e m e s with V a r i a t i o n s . C e l l 34:713-716.  215  Literature C i t e d C h a l l b e r g M . D . , a n d K e l l y T . J . (1982). E u k a r y o t i c  D N A Replication: V i r a l and Plasmid  Model  Systems. A n n . R e v . B i o c h e m . 51:901-934. Chambers  P,  Grande  a n d G i n g o l d E . (1986).  Synthesis of Petite a n d  M i t o c h o n d r i a l D N A i n Zygotes F r o m Crosses Involving Suppressive Petite  of Saccharomyces Chan  A Direct S t u d y of the Relative  cerevisiae.  B . S , and Bertrand intermedia.  Curr.  H . (1988).  Genet.  Sequence  10:565-571.  A n a l y s i s of the kahlo p l a s m i d f r o m  E l e m e n t in Neurospora  Generates  L o n g Inverted  Integration into the M i t o c h o n d r i a l C h r o m o s o m e .  H . (1989a).  A N e w T y p e of  Repeats of Target  Encode  Viral-Like  D N A and  D N A Upon  S u b m i t t e d to N a t u r e .  C h a n B . S , G r i f f i t h s A . J . F , and B e r t r a n d H . (1989b). T h e kaiilo Senescence P l a s m i d of May  Neurospora  G e n o m e 30(Suppl. 1): 318.  C h a n B . S , Dasgupta J , Court D . A , Griffiths A . J . F , a n d Bertrand Insertion  Mutants  R N A Polymerases  and  Has  Neurospora  Co-Evolved  with  Mitochondria. Submitted. C h a r d o n - L o r i a u x I , C h a r p e n t i e r M , a n d P e r c h e r o n F . (1986). Isolation a n d C h a r a c t e r i z a t i o n Linear P l a s m i d f r o m Streptomyces Chase C D , a n d P r i n g D . R . (1986).  mmosus. F E M S M i c r o b i o l . L e t t . 35(2-3): 151-155.  Properties of the Linear N l a n d N 2 P l a s m i d - L i k e D N A s f r o m  M i t o c h o n d r i a of C y t o p l a s m i c Male-Sterile Sorghum Coen  D ,  Netter  P,  Petrochilo  E ,  Neurospora Collins  crassa.  H . (1978).  P l a n t M o l . B i o l . 6(1): 53-64.  S y m p . Soc. E x p . B i o l .  Mitochondrial  Genetics  I:  24: 449-453.  Nuclear Suppressors of the [poky] C y t o p l a s m i c M u t a n t in  M o l . G e n . G e n e t . 161: 267-273.  R . A , and Lambowitz Mitochondrial D N A  bicolor.  a n d Slonmiski* P . P . (1970).  Methodology and Phenomenology. Collins R . A , a n d B e r t r a n d  of a  A . M . (1981).  Characterization  of a V a r i a n t  W h i c h C o n t a i n s T a n d e m Reiterations  G e n e t . 4:131-133.  216  Neurospora  of a 1.9 kb Sequence.  crassa Curr.  Literature C i t e d Collins R . A . , and Lambowitz Neurospora  A . M . (1983).  Structural Variations  Strains Isolated f r o m N a t u r e .  Collins R . A . , a n d Lambowitz  A . M . (1985).  i n the M i t o c h o n d r i a l D N A s of  P l a s m i d 9(1): 53-70.  R N A Splicing in Neurospora  Mitochondria:  Splicing of M i t o c h o n d r i a l m R N A Precursors i n the Nuclear M u t a n t c y t l 8 - l .  Defective  J. M o l . Biol.  184: 413-428. Collins R . A . , S t o h l L . L . , Cole M . D . , a n d L a m b o w i t z  A . M . (1981).  P l a s m i d D N A F o u n d in M i t o c h o n d r i a of N. Crassa. C o u r t D . A . , Holmes J . M . , a n d B e r t r a n d H . (1988).  P l a s m i d f r o m Senescent Podospora C u m m i n g s D . J . , Belcour anserinal:  ansenna Cultures.  II:  ansenna.  L . , and- G r a n d c h a m p  L . , and G r a n d c h a m p  Properties of M u t a n t  M o l . G e n . Genet.  ansenna:  Mitochondrial  A  Genome,  G e n o m e 30(Suppl. 1): 318.  N u c l . A c i d s R e s . 11: 2111-2119.  C . (1979a).  M i t o c h o n d r i a l D N A from  M o l . Gen. Genet.  C . (1979b).  Podospora  171:229-238.  Mitochondrial D N A from  D N A and Multimeric Circular  D N A from  Podospora Senescent  171: 239-250.  C u m m i n g s D . J . , L a p i n g J . L . , and N o l a n P . E . (1980). Podospora  P l a s m i d s Integrate Into  D N A Sequence of the E x c i s i o n Sites of a M i t o c h o n d r i a l  Isolation and C h a r a c t e r i z a t i o n .  C u m m i n g s D . J . , Belcour  fo a N o v e l  Cell 24: 443-452.  T w o U n i q u e Neurospora  Mitochondrial D N A by a Common Mechanism. C u m m i n g s D . J . , a n d W r i g h t R . M . (1983).  Characterization  Beginning.  C . Saccone,  In  C l o n i n g of Senescent M i t o c h o n d r i a l D N A f r o m T h e Organization  A . M . Kroon,  eds.  a n d Expression  (New Y o r k :  Elsevier/  of the North  H o l l a n d ) , pp.97-102. Cummings D . J . , MacNeil J . A . , Domenico J . , and Matsuura E . T . M i t o c h o n d r i a l D N A D u r i n g Senescence of Podospora Three Unique "Plasmids."  J . M o l . Biol.  ansenna:  185; 659-680.  217  (1985).  E x c i s i o n - A m p l i f i c a t i o n of D N A Sequence A n a l y s i s of  Literature C i t e d D a s g u p t a J , C h a n B . S , a n d B e r t r a n d H . (1988). of Neurospora  intermedia  Kaiilo  Insertion Sequences f r o m Senescent Strains  are F l a n k e d b y L o n g Inverted  Repeats of the M i t o c h o n d r i a l  D N A . G e n o m e 3 0 ( S u p p l . 1): 318. Davies R . W , W a r i n g R . B , R a y J . A , B r o w n T . A , a n d Scazzocchio C . (1982). M a k i n g E n d s M e e t : A M o d e l for R N A S p l i c i n g in F u n g a l M i t o c h o n d r i a . N a t u r e 300:719-724. D a v i s R . H , a n d DeSerres crassa.  F . J . (1970). G e n e t i c  a n d Microbiological Techniques  for  Neurospora  In M e t h o d s i n E n z y m o l o g y , H . T a b o r , a n d C . T a b o r , eds. ( N e w Y o r k :  Academic  Press). P P . 79-143. D e Jonge J . C , a n d D e V r i e s H . (1983). O x i d a s e i n Neurospora De  Vries  H , Alzner-De  RajBhandary  T h e S t r u c t u r e of the G e n e for S u b u n i t I of C y t o c h r o m e c  crassa M i t o c h o n d r i a . C u r r . Genet. 7: 21-28.  Weerd  U . L . (1986).  B ,  Breitenberger  C . A , Chang  T h e E 3 5 Stopper  Mutant  D . D , D e Jonge  of Neurospora  crassa:  J . C , and Precise  L o c a l i z a t i o n of Deletion E n d p o i n t s in M i t o c h o n d r i a l D N A a n d E v i d e n c e that the Deleted D N A C o d e s for a Subunit. of N A D H Dehydrogenase.  E M B O J . 5(4): 779-785.  D e V r i e s H , D e Jonge J . C , V a n ' t Sant P , A g s t e r i b b e E , a n d A r n b e r g A . (1981). M u t a n t of Neurospora  A  "Stopper"  crassa C o n t a i n i n g T w o P o p u l a t i o n s af A b e r r a n t M i t o c h o n d r i a l D N A .  C u r r . G e n e t . 3: 205-211. D e u t s c h J , D u j o n B , Netter P , Petrochilo E , S l o n m i s k i P . P . , B o l o t i n - F u k u h a r t a M , a n d C o e n D . (1974).  M i t o c h o n d r i a l Genetics V I .  Interrelations Between  T h e Petite  the Loss of the o+  Mitochondrial Genetic Markers.  F a c t o r a n d the Loss of the D r u g  cerevisiae: Resistance  Genetics 76: 95-219.  D e Z a m a r o c z y M . G , B a l d a c c i G , a n d B e r n a r d i G . (1979). M i t o c h o n d r i a l G e n o m e of Y e a s t .  M u t a t i o n s i n Saccharomyces  Putative  F E B S L e t t . 108: 429-432.  218  O r i g i n s of R e p l i c a t i o n in the  Literature Cited D i a c u m a k o s E . G . , G a r n j o b s t L . , a n d T a t u m E . L . (1965). crassa.  A Cytoplasmic Character in  Neurospora  J . C e l l . B i o l . 26: 427-433.  D i x o n L . K . , a n d Leaver C . J . (1982). M i t o c h o n d r i a l G e n e E x p r e s s i o n a n d C y t o p l a s m i c M a l e Sterility i n S o r g h u m . PI. M o l . B i o l . 1:89-102. D u j o n B . (1981).  M i t o c h o n d r i a l Genetics a n d F u n c t i o n s .  Saccharomyces: eds.  In T h e M o l e c u l a r Biololgy of the Y e a s t  Life C y c l e a n d Inheritance, J . N . Strather, E . W . Jones, a n d J . R . B r o a c h ,  (New Y o r k :  Cold  Dujon B . , Bolotin-Fukuhara  S p r i n g H a r b o u r Laboratories),  M . , Coen D . , Deutsch  p p . 505-635.  J . , Netter P . , S l o n m i s k i P . P . , a n d W e i l l L .  (1976). M i t o c h o n d r i a l G e n e t i c s . X I . M u t a t i o n s at the M i t o c h o n d r i a l L o c u s omega A f f e c t i n g the R e c o m b i n a t i o n of M i t o c h o n d r i a l Genes in Saccharomyces 143:  cerevisiae.  M o l . G e n . Genet.  131-165.  D u j o n B . , C o l l e a u x L . , Jacquier Mobile Genetic ' Elements  A . , M i c h e l F . , a n d M o n t e i l h e t C . (1986).  Elements:  in Lower  T h e Role of I n t r o n - E n c o d e d  Eukaryotes,  Holaender, eds. (New Y o r k : D i i v e l l A . , Hesseberg-Stutzke  M i t o c h o n d r i a l Introns as  Proteins.  In  Extrachromosomal  R. Wickner, A . Hinnebusch, L . Mets, A . Lambowitz, A .  P l e n u m Press), p p . 5-28.  H . , Oeser B . , R o g m a n n - B a . c k w i n k e l P . , a n d T u d z y n s k i P . P . (1988).  S t r u c t u r a l a n d F u n c t i o n a l A n a l y s i s of M i t o c h o n d r i a l P l a s m i d s in Claviceps  purpurea.  Mol.  G e n . G e n e t . 214(1): 128-134. Ephrussi B . , and G r a n d c h a m p Respiratoire Suppressivite.  S. (1965).  de l a Levure  I:  Etudes Existence  sur l a Suppressivite au  Niveau  des m u t a n t s a Deficience  Cellulaire.  de  Divers  Degres  de  H e r e d i t y 20: 1-7.  E p h r u s s i B . , Hottinger H . , a n d C h i m e n e s A . M . (1949) A c t i o n de L ' A c r i f l a v i n e sur les Levures I: L a M u t a t i o n 'petite cplonie'.  A n n . Inst. P a s t e u r 76:351-364.  219  Literature Cited E r i c k s o n L . , B e v e r s d o r f W . D . . a n d P a u l s K . P . (1985). Has T e r m i n a l Protein. Escarmis,  C u r r . Genet.  Linear M i t o c h o n d r i a l P l a s m i d i n  9(8): 679-682.  C , G a r c i a P . , M e n d e z E , L p e z R , Salas M , a n d G a r c i a E . (1985).  Inverted  Repeats a n d T e r m i n a l P r o t e i n s of the G e n o m e s of P n e u m o c o c c a l Phages. Escarmis,  C , Gomez A , Garcia P ,  Sequence  Brassica  Concepcion R ,  Lopez  G e n e 36: 341-348.  R , a n d Salas M . (1984).  at the T e r m i n i of the D N A of Streptococcus  pneumoniae  Terminal  Nucleotide  Phage C p - 1 . Virology  133:166-171. Escarmis  C , a n d Salas M . (1981).  Nucleotide Sequence  at the T e r m i n i of the D N A of  Bacillus  subtilis phage cp29. P r o c . N a t l . A c a d . S c i . 78(3): 1446-1450. E s c o t e L . J , G a b a y - L a u g h n a n S . J , a n d L a u g h n a n J . R . (1985).  C y t o p l a s m i c Reversion to F e r t i l i t y in  cms-S M a i z e N e e d N o t Involve Loss of Linear M i t o c h o n d r i a l P l a s m i d s .  P l a s m i d 14(3):  264-  267. Esser K , K u c k U , L a n g - H i n r i c h s C , L e m k e P , Osiewacz H , Stahl U , a n d T u d z y n s k i P . P . (1986). P l a s m i d s of E u k a r y o t e s .  (Berlin:  Esser K , a n d T u d z y n s k i P . (1979). anserina. Inc.),  Springer-Verlag).  Genetic. C o n t r o l a n d Expression  In V i r u s e s a n d P l a s m i d s in F u n g i , P . A . Lemke, ed. ( N e w Y o r k :  Podospora  M a r c e l Dekker  Series O n M y c o l o g y V o l . 1: 595-616.  Faye G , Fukuhara H , Grandchamp Rabinowitz Slonmiski  C , Lazowska J ,  M , Bolotin-Fukuhara P . P . (1973).  M , Coen  Mitochondrial  Deletions a n d Repetitions of Genes. Feinberg  of Senescence in  A . P , a n d Vogelstein  B.  (1983).  Michel F ,  D , Deutsch  Nucleic  Acids  Casey J,  J,  Getz  G , Locker  D u j o n A , Netter  in the  Petite  Colony  J,  B , and Mutants:  B i o c h i m i e 55: 779-792. A  Technique  for R a d i o l a b e l l i n g  D N A Restriction  E n d o n u c l e a s e F r a g m e n t s t o H i g h Specific A c t i v i t y . A n a l . B i o c h e m . 132:6-13. Files J . G , a n d H i r s c h D . (1981). r D N A o f C. elegans. J . M o l . B i o l . 149:233-240.  220  Literature C i t e d Fincham J.R.S.,  D a y R . R . , a n d R a d f o r d A . (1979). F u n g a l Genetics  (Los Angeles: U n i v e r s i t y of  C a l i f o r n i a Press), p . 21. Francou  F . X . (1981). Isolation Ascobolus  a n d Characterization  of a Linear  D N A M o l e c u l e i n the F u n g u s  vmmersus. M o l . G e n . G e n e t . 184:440-444.  F r a n c o u F . X . , R a n d s c h o l t N . , Decaris B . , a n d Gregoire A . the F u n g u s Ascobillus  immersus,  (1987).  Presence of Several P l a s m i d s i n  a n d Homologies w i t h T h e Linear P l a s m i d p A l .  J.Gen.  M i c r o b i o l . 133(2): 311-316. F u j i m u r a H . , H i s h i s h i m u m a F . , and G u n g e N . (1987). Linear  D N A Plasmid p G K L 2  Saccharomyces  cerevisiae.  Supports  T e r m i n a l Segment of Kluyveromyces  Autonomous  Plasmids in  C u r r . G e n e t . 12(2): 99-104.  F u j i m u r a H . , Y a m a d a T . , H i s h i n u m a F . , a n d G u n g e N . (1988). D N A Killer Plasmids p G K L l Lett. 49(3):  R e p l i c a t i o n of H y b r i d  lactis  D N A R e p l i c a t i o n m vivo  an p G K L 2 i n Saccharomyces  cerevisiae.  FEMS  of linear Microbiol.  441-441  F u k u h a r a H . , Faye G . , Michel F . , Lazowska J . , Deutsch J . , Bolotin-Fukuhara M . , and Slonmiski P . P . (1974)  P h y s i c a l a n d G e n e t i c O r g a n i z a t i o n of Petite and Grande  Yeast Mitochondrial  D N A I: Studies b y R N A - D N A H y b r i d i z a t i o n s . M o l . G e n . G e n e t . 130:215-219. Garcia  E.,  Gomez  A . , Concepcion  R.,  Escarmis  Bacteriophage C p - 1 C o n t a i n s a P r o t e i n  O ,  a n d Lopez  R.  (1983).  Pneumococcal  B o u n d to the 5' T e r m i n i of Its D N A . V i r o l o g y  128:92-104. G a r r i g a G . , a n d L a m b o w i t z A . M . (1984). R N A S p l i c i n g i n Neurospora a M i t o c h o n d r i a l Intron In Vitro. G i a s s o n L . , a n d L a l o n d e M. (1987). F u n g u s Ceratocystis  fimbriata  M i t o c h o n d r i a : Self-Splicing of  C e l l 39:631-641. A n a l y s i s of a L i n e a r P l a s m i d Isolated f r o m the Pathogeic  Ell. & Halst.  221  Curr.  Genet.  11(4): 331-334-  Literature C i t e d G i n g o l d E . B . (1981).  G e n e t i c A n a l y s i s of the. P r o d u c t s of a Cross I n v o l v i n g a Suppressive  M u t a n t of 5. cerevisiae. Goursot  R,  C u r r . Genet.  DeZamaroczy M , Baldacci  M u t a n t s of Y e a s t .  Curr. Genet.  3:  'petite'  313-320.  G , and Bernardi  G . (1980).  Supersuppressive  'petite'  8: 387-398.  G r e e n M . R , G r i m m M . F . , Goewert R . R , Collins R . A , Cole M . D , L a m b o w i t z A . M . , H e c k m a n J . E , Yin  S,  and RajBhandary  U . L . (1981).  Transcripts  a n d Processing  Patterns  for the  R i b o s o m a l a n d Transfer R N A R e g i o n of N e u r o s p o r a crassa M i t o c h o n d r i a l D N A . J . B i o l . C h e m . 256: 2027-2034. G r i f f i t h s A . J . F , a n d B e r t r a n d H . (1984). intermedia. Griffiths  A.J.F,  C u r r . G e n e t . 8: 387- 398.  Kraus  intermedia.  U n s t a b l e C y t o p l a s m s in H a w a i i a n Strains of N e u r o s p o r a  S,  and Bertrand  H . (1986).  Expression  of Senescence i n  Neurospora  C a n . J . G e n e t . C y t o l . 28: 459-467.  G r o s s S . R , H s i e h T , Levine P . (1984).  Intramolecular R e c o m b i n a t i o n as a Source of M i t o c h o n d r i a l  C h r o m o s o m e H e t e r o m o r p h i s m in Neurospora.  C e l l 38: 233-239.  G u n g e N , M u r a t a K , a n d S a k a g u c h i K . (1982). T r a n s f o r m a t i o n of Saccharomyces Linear D N A K i l l e r P l a s m i d s f r o m Kluyveromyces  cerevisiae  with  lactis. J . B a c t e r i d . 151(1): 462-464.  G u n g e N , T u m a r u A , O z a w a F , a n d S a k a g u c h i K . (1981). Isolation a n d C h a r a c t e r i z a t i o n of L i n e a r Deoxyribonucleic  Acid  Plasmids from  Kluyveromyces  lactis  a n d the P l a s m i d - A s s o c i a t e d  K i l l e r C h a r a c t e r . J . B a c t e r i o l . 145(1): 382-390. G u n g e N , a n d S a k a g u c h i K . (1981). from  Intergenic T r a n s f e r of D e o x y r i b o n u c l e i c A c i d Killer P l a s m i d s ,  pGKLl  and p G K L 2 ,  Kluyveromyces  Fusion.  J . B a c t e r i o l . 147(1): 155-160.  222  lactis  into  Saccharomyces  cerevisiae  by Cell  Literature C i t e d Gunge N . , and Yamane  C . (1984).  p G K L 2 f r o m Kluyveromyces  I n c o m p a t i b i l i t y of Linear D N A Killer P l a s m i d s p G K L l a n d lactis w i t h M i t o c h o n d r i a l D N A f r o m Saccharomyces  cerevisiae.  J . B a c t e r i o l . 159(2): 533-539. H a r d i n g N . E . , Ito J . , a n d D a v i d G . S . (1978). Identification of the P r o t e i n F i r m l y B o u n d t o the E n d s of Bacteriophage  (j>29 D N A . V i r o l o g y 84:279-292.  H a s h i b a T . , H o m m a Y . , H y a k u m a c h i M . , a n d M a t s u d a I. (1984). Isolation of a D N A P l a s m i d in the F u n g u s Rhizoctania  solani. J . G e n . M i c r o b i o l . 130:2067-2070.  H a s k i n s F . A . , Tissieres A . , M i t c h e l l H . K . , a n d M i t c h e l l M . B . (1953). C y t o c h r o m e s a n d the Succinic A c i d O x i d a s e S y s t e m of poky Strains of Neurospora. Hayakawa  T . , Tanada  T . , Sakaguchi  K . , Otake  J . B i o l . C h e m . 200: 819-826.  N . , and Yonehara  H . (1979).  J.  Gen. Appl.  M i c r o b i o l . 25:225-260. H i r a t s u k a K . , N a m b a S., Y a m a s h i t a F u n g u s Botrytis  cmerea.  S., a n d D o i Y . (1987).  Linear P l a s m i d - L i k e D N A s  in the  A n n . P h y t o p a t h . Soc. J a p a n 53: 638-642.  H i r o c h i k a H . , a n d Sakaguchi K . (1982). A n a l y s i s of Linear P l a s m i d s Isolated  from  Streptomyces:  A s s o c i a t i o n o f P r o t e i n W i t h t h e E n d s o f t h e P l a s m i d D N A . P l a s m i d 7:59-65 H i r o c h i k a H . , N a k a m u r a K . , a n d S a k a g u c h i K . (1984). A Linear D N A P l a s m i d f r o m  Streptomyces  rocher with an Inverted T e r m i n a l R e p e t i t i o n of 614 Base Pairs. E M B O J . 3(4):761-766. H i s h i n u m a F . , N a k a m u r a K . , H i r a i K . , N i s h i z a w a R . , G u n g e N . , a n d M a e d e T . (1984). C l o n i n g a n d N u c l e o t i d e Sequences  of the Linear  D N A Killer  Plasmids  from Yeast. N u c . Acids. Res.  12(19):7581-7597. H o l l e n b e r g C P . , B o r s t P . , a n d V a n B r u g g e n E . F . J . (1972a). Petite M u t a n t s of Y e a s t s .  Mitochondrial D N A from Cytoplasmic  B i o c h i m . B i o p h y s . A c t a . 277: 35-43.  Infanger A . , a n d B e r t r a n d H . (1986).  Inversions a n d recombinations i n m i t o c h o n d r i a l D N A of the  ( S G - 1 ) cytoplasmic M u t a n t i n two N e u r o s p o r a Species.  223  C u r r . G e n e t . 10(8): 607-617.  Literature Cited Ito J . (1978). Bacteriophage 629 T e r m i n a l P r o t e i n : Its A s s o c a t i o n  wtih the 5' T e r m i n i of the tb29  G e n o m e . J . V i r o l . 28(3):895-904. J a c q C , B a n r o q u e s J . , B e c a m A . M . , Slonmiski P . P . , G u i s o N , a n d D a n c h i n A . (1984). A n t i b o d i e s against a fused 'lacZ-Yeast  M i t o c h o n d r i a l I n t r o n ' G e n e P r o d u c t A l l o w Identification  mRNA  b y the  Maturase Encoded  Fourth  Intron of the Y e a s t  cob-box  of the  Gene. E M B O  J.  3:1567-1572. Jacquier A , a n d D u j o n B . (1985).  A n Intron E n c o d e d  Protein  is A c t i v e i n a G e n e  Process t h a t Spreads an Intron into a M i t o c h o n d r i a l G e n e . Jamet-Viermy  C ,  Begel  O . , and  Belcour"  L.  (1980).  A m p l i f i c a t i o n of a M i t o c h o n d r i a l D N A Sequence. Jinks J . L . (1956). Physiol.  Naturally Occurring Cytoplasmic  Conversion  C e l l 41: 383-394.  Senescence  in  Podospora  anserina:  C e l l 21: 189-194.  Changes  in Fungi.  R e n d . L a . C a r l s b e r g . Ser.  26: 183-195.  J u n g G , L e a v i t t M . C , a n d Ito J . (1987). Y e a s t K i l l e r P l a s m i d p G K L l encodes a D N A P o l y m e r a s e B e l o n g i n g to the F a m i l y B D N A Polymerases. N u c . A c i d s . R e s . 15(21):9088. Keen  C L , Mendelovitz Characterization Genet.  Kemble  S,  Cohen  G , Aharonowitz  of a Linear  D N A Plasmid  from  a n d R o y K . L . (1988).  Isolation a n d  Streptomyces clavuligerus.  Mol. Gen.  Weight  DNA  212(1): 172-176.  R . J , and Bedbrook  J . R . (1980).  L o w Molecular  M i t o c h o n d r i a , f r o m N o r m a l a n d Male-Sterile Kemble  Y ,  R . J , and Mans  R . J . (1983).  Examination  Zea mays  Circular  a n d Linear  in  C y t o p l a s m . N a t u r e 284:565-566.  of the M i t o c h o n d r i a l  Genome  of R e v e r t a n t  P r o g e n y f r o m S cms M a i z e with C l o n e d S - l a n d S-2 H y b r i d i z a t i o n Probes. J . M o l . A p p l . G e n e t . 2:161-171.  224  Literature Cited Kemble R.J., and Thompson R.D. (1982). SI and S2, the Linear Mitochondrial DNAs Present in a Male-Sterile Line of Maize, Posess Terminally Attached  Proteins. Nuc. Acids Res.  10(24):8181-8190. Kemble R.J., Gunn R.E., Flavell R.B. (1980). Classification of Normal and Male-Sterile Cytoplasms in Maize. II. Electrophoretic Analysis of DNA Species in Mitochondria. Genetics 95:451-458. Kennel J.C., and Lambowitz A . M . (1989). Development of an In Vitro Transcription System for Neurospora  crassa  Mitochondrial DNA and Identification of Transcription Intiation Sites.  Mol. Cell. Biol. 9(9):3603-3613. Kikuchi Y., Hirai K., Gunge N., and Hishinuma F. (1985). Hairpin Plasmid - a Novel Linear DNA of Perfect Hairpin Structure. EMBO J. 4(7): 1881-1886. Kikuchi Y., Hirai K., and Hishinuma F. (1984). The Yeast Linear DNA Killer Plasmids, p G K L l and pGKL2, Possess Terminally Attached Proteins. Nuc. Acids. Res. 12(14): 5685-5692. Kim B.D., Mans R.J., Conde M.F., Pring D.R., and Levings III C S . (1982). Physical Mapping of Homologous Segments of Mitochondrial Episomes from S Male-Sterile Maize. Plasmid 7:114. Kim W.K., McNabb S.A., and Klassen G.R. (1988).  A Linear Plasmid m  controversa,  a  with the Cloned  am  Tilletia  Fungal Pathogen of Wheat. Can. J.Bot. 66(6):1098-1100. Kinashi H., and Shimaji M. (1987). Streptomyces plasmids. J. Antibiotics 40(6). Kinsey J.A., and Rambosek J.A. (1984). Transformation of  Neurospora  crassa  (Glutamate Dehydrogenase) Gene. Mol. Cell. Biol. 4(1):117-127. Kistler H.C., and Leong S.A. (1986). Linear Plasmidlike DNA in the Plant Pathogenic Fungus Fusarium oxysporiumi.  sp.  conglutinans.  J. Bacterid. 167(2): 587-593.  Kitada K., and Gunge N. (1988). Palindrome-Hairpin Linear Plasmids Possessing Only a Part of the Yeast Killer Plasmid p G K L l . Mol. Gen. Genet. 215(1): 46-52.  225  Literature Cited K i t ad a K , a n d H i s h i n u m a F . (1987). Saccharomyces Kohout  kluyveri.  J., and Bertrand Neurospora  A N e w Linear  D N A Plasmid  Isolated  From  the Y e a s t  Cytoplasmic  m u t a n t in  M o l . G e n . G e n e t . 206(3): 377-381.  H . (1976).  Nuclear  Suppressors  of the poky  crassa I: G e n e t i c a n d R e s p i r a t o r y Properties. C a n . J . G e n e t . C y t o l . 18: 311-324.  K o l l F . , B e l c o u r L , a n d V i e r n y C . (1985).  A 1100-bp Sequence of M i t o c h o n d r i a l D N A is Involved in  Senescence Process in Podospora:  S t u d y of Senescent M u t a n t  Cultures.  P l a s m i d 14(2):  106-117. Koncz  C , Sumegi  J,  Udvardy  A , Racsmany  M , a n d D u d i t s D . (1981).  C l o n i n g of m t D N A  F r a g m e n t s Homologous to M i t o c h o n d r i a l S2 P l a s m i d - L i k e D N A i n M a i z e . M o l . G e n . G e n e t . 183: 449-458.  '  '  K r u g e r K , G r a b o w s k i P . J , Z a u g A . J , Sands J , G o t t s c h l i n g D . E , a n d C e c h T . (1982). Self-Splicing RNA:  Autoexcision  a n d A u t o c y c l i z a t i o n of the R i b o s o m a l R N A Intervening  Sequence of  T e t r a h y m e n a . C e l l 31:147-157. Kiick  U , Stahl  II,  Podospora  a n d Esser  K . (1981).  P l a s m i d - l i k e D N A is P a r t  of M i t o c h o n d r i a l D N A in  anserina. C u r r . G e n e t . 3: 151-156.  K i i c k U , Osiewacz H . D , S c m i d t U , K a p p e l h o f f B , Schulte E , Stahl U , a n d Esser K . (1985a). T h e O n s e t of Senescence is A f f e c t e d b y D N A Rearrangements of a. D i s c o n t i n u o u s M i t o c h o n d r i a l G e n e in Podospora  anserina.  C u r r . G e n e t . 9: 373-382.  K i i c k U , K a p p e l h o f f B , a n d Esser K . (1985b). Despite D N A P o l y m o r p h i s m the M o b i l e Intron (pi DNA)  of the C O I G e n e is Present in T e n Different Races of Podospora  anserina.  Curr.  G e n e t . 10:59-67. Kuiper M . T . R ,  a n d L a m b o w i t z A . M . (1988). A N o v e l Reverse T r a n s c r i p t a s e  w i t h M i t o c h o n d r i a l P l a s m i d s of N e u r o s p o r a .  226  C e l l 55(4): 693-704.  Activity  Associated  Literature Cited L a m b o w i t z A . M . (1979). P r e p a r a t i o n  a n d A n a l y s i s of M i t o c h o n d r i a l Ribosomes.  Meth. Enzymol.  59:421-433. Lambowitz  A . M . , L a P o l l a R . J . , a n d C o l l i n s R . A . (1979).  Neurospora.  Mitochondrial Ribosome  J . C e l l B i o l . 82:17-31.  L a m b o w i t z A . M . , A k i n s R . A . , K e l l e y R . L . , P a n d e S., a n d N a r g a n g P l a s m i d s of  Neurospora  Lower E u k a r y o t e s , (New Y o r k :  A s s e m b l y in  and Other Filamentous  Fungi.  F . E . (1986).  Mitochondrial  In E x t r a c h r o m o s o m a l E l e m e n t s i n  R . W i c k n e r , A . H i n n e b u s c h , L . M e t s , A . Lambowdtz, A . H o l a e n d e r , eds.  P l e n u m Press), p p . 83-92.  L a u g h n a n J . R . , G a b a y - L a u g h a n a n S., a n d C a r l s o n J . E . (1981). Characteristics of cms-S Reversion t o M a l e F e r t i l i t y in M a i z e . Stadler S y m p . 13:93-114. Lazarus  C M . , a n d K u n t z e l H . (1981). M u t a n t s of  Anatomy  Aspergillus amstelodami:  of A m p l i f i e d  Mitochondrial D N A i n 'Ragged'  E x c i s i o n P o i n t s W i t h i n P r o t e i n Genes a n d a C o m m o n  215bp Segment C o n t a i n i n g a Possible O r i g i n of R e p l i c a t i o n . Lazarus C M . ; E a r l A . J . , T u r n e r G . , a n d K u n t z e l H . (1980). Sequence in the C y t o p l a s m i c a l l y Eur. J. Biochem.  Inherited  (1982).  E . G . , and Nargang  F . E . (1986).  E x t r a n u c l e a r M u t a n t of  Mutant  Podospora ansenna. A Missense  Neurospora crassa.  Levings III C . S . , K i m B . D . , P r i n g D . R . , C o n d e S.J.  A m p l i f i c a t i o n of a M i t o c h o n d r i a l D N A of  Aspergillus amsielodami.  A u t o n o m o u s l y R e p l i c a t i n g Sequences i n Y o u n g a n d  Senescent M i t o c h o n d r i a l D N A F r o m  Laughnan  4: 99-107.  106: 633-641.  L a z d i n s I.B., a n d C u m m i n g s D . J .  Lemire  'Ragged'  Curr. Genet.  (1980).  Cytoplasmic  in the  J . Biol. Chem.  261:  T r a n s p o s i t i o n a l E v e n t . Science 209:1021-1023.  of  cms-s  6:  oxi-3  173-178.  G e n e of the  mi-3  5610-5615.  M . F . , Mans R . J . , Laughnan  Reversion  227  Mutation  C u r r . Genet.  in M a i z e :  J.R., and GabayAssociation  with  a  Literature C i t e d Levings  III C . S . , Sederoff Plasmid-Like  R . R . , H u W . W . L . , and Timothy  DNAs  of the M a i z e  Mitochondria.  D . H . (1982).  In S t r u c t u r e  Relationships  and Function  Among of  Plant  G e n o m e s , O . Ciferri, a n d L . D u r e , eds. ( P l e n u m : N e w Y o r k ) , p p . 363-372. Levings III C . S . , a n d Sederoff R . R . (1983). Nucleotide Sequence of the S-2 M i t o c h o n d r i a l D N A f r o m the S C y t o p l a s m of M a i z e . P r o c . N a t l . A c a d . S c i . 80:4055-4059. Locker J . , R a b i n o w i t z M . , a n d G e t z G . S . (1974). T a n d e m Inverted ofPetite M u t a n t s of Saccharomyces  cerevisiae.  Repeats in M i t o c h o n d r i a l D N A  P r o c . N a t l . A c a d . S c i . 71:1366-1370.  L o p e z R . , C o n c e p c i o n R . , G a r c i a P . , E s c a r m i s C , a n d G a r c i a E . (1984). R e s t r i c t i o n Cleavage of the D N A s of Streptococcus  pneumoniae  Bacteriophages C o n t a i n i n g P r o t e i n  Maps  Covalently  B o u n d to T h e i r 5' E n d s . M o l . G e n . G e n e t . (1984). 197:67-74. Lovett  J . S . , a n d Leaver Blastociella  C . J . (1969).  High-Molecular-Weight Artifacts  in R N A Extracted  from  at E l e v a t e d T e m p e r a t u r e . B i o c h i m . B i o p h y s . A c t a 195:319-3237.  L u c a s M . C . , Jacobsen J . W . , a n d Giles N . H . (1977). C h a r a c t e r i z a t i o n P o l y a d e n y l a t e d Messenger R i b o n u c l e i c A c i d f r o m Neurospora  of an in vitro T r a n s l a t i o n of crassa. J . Bacteriol.  130:1192-  1198. Mannella C . A . , and Lambowitz  A . M . (1978). Interaction of W i l d T y p e a n d Poky  D N A in Heterokaryons of Neurospora.  Mitochondrial  B i o c h e m . B i o p h y s . R e s . C o m m u n . 80(3): 673-679.  M a n n e l l a C . A . , a n d L a m b o w i t z A . M . (1979). U n i d i r e c t i o n a l G e n e C o n v e r s i o n Associated with T w o Insertions i n Neurospora  crassa M i t o c h o n d r i a l D N A . Genetics 93: 645-654.  M a n i a t i s T . , F r i t s c h E . F . , a n d S a m b r o o k J . (1982). M o l e c u l a r C l o n i n g : A L a b o r a t o r y M a n u a l ( C o l d S p r i n g H a r b o u r , New Y o r k : C o l d S p r i n g H a r b o u r M a r c o u D . (1961).  Laboratories).  N o t i o n de Longevite et N a t u r e C y t o p l a s m i q u e d u D e t e r m i n a n t de l a Senescence  Chez Quelques Champignons.  A n n . Sci. Natur. Botan.  228  12:653-764.  Literature Cited M a r c o u D , and Schecroun  J . (1959).  L a Senescence C h e z  des P a r t i c u l e s C y t o p l a s m i q u e Infectants. M c C l i n t l o c k B . (1947). Cytogenetic. Studies  Podospora anserina  P o u r r a i t etre due a  C o m p . R e n d . A c a d . S c i . Ser. D . 248: 280-295.  of M a i z e a n d  Neurospora.  Carnegie  Inst.  Washington  Y e a r b o o k 46:146-152. M c C l i n t l o c k B . (1949). M u t a b l e L o c i in M a i z e . Carnegie Inst. W a s h i n g t o n Y e a r b o o k 48:157-167. McClintlock  B . (1951).  Chromosome  Organization  a n d Gene  Expression.  Cold  Spring  Harbour  S y m p . Q u a n t . B i o l . 16:13-47. M e i n h a r d t F , K e m p k e n F , a n d Esser K . (1986). P l a s m i d i n the filamentous F u n g u s  Proteins A r e Attached  Ascobillus vmmersus.  t o the E n d s of a Linear  C u r r . G e n e t . 11(3): 243-246.  M e i n h a r d t F , a n d Esser K . (1984). Linear E x t r a c h r o m o s o m a l D N A i n the M o r e l  Morchell conica,  C u r r . G e n e t . 8:15-18. M e s s i n g J . (1983). N e w M 1 3 V e c t o r s for C l o n i n g . M e t h . E n z y m . 101: 20-78. Meyer  R . J , Hintz Homology  W . A , Mohan of  Agaricus  M , Robison  Mitochondrial  M , Anderson Plasmids  with  J . B , and Horgen Mitochondrial  P . A . (1988).  DNA.  Genome  30(5'):710-716. Michealis G , P e t r o c h i l o E , a n d S l o n m i s k i P . P . (1973). Molecules  of M i t o c h o n d r i a l  D N A Obtained  Mitochondrial  From  Crosses  Genes  Between  III.  Recombined  Cytoplasmic  Petite  M u t a n t s of Saccharomyces cerevisiae: P h y s i c a l a n d Genetic C h a r a c t e r i z a t i o n . M o l . G e n . Genet.  123: 51-62.  M i c h e l F , a n d D u j o n B . (1983). C o n s e r v a t i o n  of R N A Secondary S t r u c t u r e i n T w o Intron Families  I n c l u d i n g M i t o c h o n d r i a l , C h l o r o p l a s t , a n d N u c l e a r E n c o d e d M e m b e r s . E M B O J . 2:33-37. Michel F ,  and Cummings  Associated the  D . J . (1985).  w i t h Senescence of  Tetrahymena  A n a l y s i s of Class I Introns in a M i t o c h o n d r i a l  Podospora anserina  R i b o s o m a l Intron.  Reveals E x t r a o r d i n a r y Resemblance to  C u r r . G e n e t . 10(1): 69-79.  229  Plasmid  Literature Cited Michel F , and Lang F.B. (1985). Mitochondrial Class II Introns Encode Proteins Related to the Reverse Transcriptases of Retroviruses. Nature 316:641-643. Michel F , Jacquier A., and Dujon B. (1982). Comparison of Fungal Mitochondrial Introns Reveals Extensive Homologies in RNA Secondary Structure. Biochimie 64:867-881. Mitchell M . B , and Mitchell H.K. (1952). A case of 'Maternal' Inheritance in  Neurospora  crassa.  Proc. Natl. Acad. Sci. 38: 442-449. Mitchell M . B , Mitchell H . K , and Tissieres A. (1953). Affecting the Cytochrome System in  Neurospora  Mendelian and Non-Mendelian Factors  crassa.  Proc. Natl. Acad. Sci. 39: 606-613.  Mohan M , Meyer R . J , Anderson J . B , and Horgen P.A. (1984). Comercially Important Mushroom Genus  Agaricus.  Plasmid-Like DNAs in the  Curr. Genet. 8: 615-619.  Mounolou J . C , Jakob H , and Slonmiski P.P. (1966). Mitochondrial DNA from Yeast "Petite" Mutants: Specific Changes of Buoyant Density Corresponding to Different Cytoplasmic Mutations. Biochem. Biophys. Res. Commun. 24:218-122. Moustacchi E. (1972). Determination of the Degree of Suppressivity of  Saccharomyces  cerevisae  Strain R D 1 A . Biochim. Biophys. Acta 277: 59-60. Munkres  K . D , and Minssen M. (1976). Ageing of  Neurospora  crassa  I. Evidence for the Free  Radical Theory of Ageing from Studies of a Natural-Death Mutant. Mech. Age. Develop. 5:79-98. Myers C.J. (1988). Transmission of Kaiilo DNA in Senescent Strains of  Neurospora  intermedia.  Ph.  D. Thesis, University of British Columbia. Myers C . J , Griffiths A . J . F , and Bertrand H. (1989).  Linear Kaiilo DNA is a  Neurospora  Mitochondrial Plasmid That Integrates into the Mitochondrial DNA. Mol. Gen. Genet, (in Press).  230  Literature Cited Nagley P. and Linnane A.W. (1972). Saccharomyces  Cellular Regulation of Mitochondrial DNA Synthesis in  Cell. Differ. 1: 143-152.  cerevisae.  Nargang F.E. (1985). Fungal Mitochondrial Plasmids. Exp. Mycol. 9: 285-293. Nargang F.E. (1986). Conservation  of a Long Open Reading Frame in Two  Neurospora  Mitochondrial Plasmids. Mol. Biol. Evol. 3:19-28. Nargang F.E., Bell J.B., Stohl L.L., and Lambowitz A . M . (1984). The DNA Sequence and Genetic Organization of a  Neurospora  Mitochondrial Plasmid Suggest a Relationship to Introns and  Mobile Elements. Cell 38(2): 441-453. Natvig D.O., May G., Taylor J.W. (1984). Distribution and Evolutionary Mitochondrial Plasmids in  Neurospora  Signifigance of  spp. J. Bacteriol. 159(1): 288-293.  Nelson M.A., and Macino G. (1985). Gene Organization and Expression in  Neurospora  crassa  Mitochondria. In Achivements and Perspectives of Mitochondrial Research Volume II: Biogenesis, E. Quagliariello, E.C. Slater, F. Palmieri, C. Saccone and A . M . Kroon, eds. (Amsterdam: Elsevier) pp.293-304. Nelson M.A., and Macino G. (1987). Three Class I Introns in the ND4/ND5 Transcriptional Unit of Neurospora  crassa  Mitochondria. Mol. Gen. Genet. 206:318-325.  Neupert W., Massinger P., and Pfaller P. (1971). Ribosomes of  Neurospora  crassa  Amino Acid Incorporation into Mitochondrial  Wild-Type and  mi-1  Mutant. In Autonomy and Biogenesis  of Mitochondria and Chloroplast. (Amsterdam: North/Holland), pp. 328-338. Niwa O., Sakaguchi K., and Gunge N. (1981). Curing of the Killer Deoxyribonucleic Acid Plasmids of  Kluyveromyces  lactis.  J. Bacteriol. 148(3): 988-990.  Normand P., Simonet P., Giasson L., Ravel-Chapuis P., Fortin J.A., and Lalonde M . (1987). Presence of a Linear Plasmid-Like DNA Molecule in the Fungal Pathogen fimbriata  Ell. & Halst. Curr. Genet. 11(4): 335-338.  231  Ceratocystis  Literature Cited Osiewacz H . D . , and Esser K . (1984). The Mitochondrial Plasmid of Podospora  anserina:  A Mobile  Intron of a Mitochondrial Gene. Curr. Genet. 8: 299-305. Osinga K . A , DeVries E , VanderHorst G . T . J , and Tabak H . F . (1984). in Yeast Mitochondria:  Initiation of Transcription  Analysis of Origins of Replication and of Genes Coding for a  Messenger R N A and a Transfer R N A . Nuc. Acids. Res. 12(4): 1889-1990. Osinga K . A , and Tabak H . F . (1982). Initiation Ribosomal R N A in Yeast:  of Transcription of Genes for Mitochondrial  Comparison of the Nucleotide Sequence around the 5'-ends of  both Genes Reveals a. Homologous Stretch of 17 Nucleotides. Nuc. Acids. Res. 10(12): 36173626. Padgett R . A , Konarska M . M , Grabowski P . J , Hardy S . F , and Sharp P . A . (1984). Lariats R N A Intermediates and Products in the Splicing of Messenger R N A Precursors. Science 225:898903. Paillard  M , Sederoff  R . R , and Levings  III C . S . (1985).  Nucleotide  Sequence  of the S-l  Mitochondrial D N A from the S Cytoplasm of M a i z e . E M B O J . 4(5)-.1125-1128. Palmer J . D , Shields C R , Cohen D B , and Orton T . J . (1983). A n Unusual Mitochondrial D N A Plasmid in the Genus Brassica.  Nature 301:725-728.  Pande S , Lemire E . G . , and Nargang F . E . (1989). intermedia  The Mitochondrial Plasmid from  Neurospora  Strain Labelle-lb Contains a Long Open Reading Frame With Blocks of Amino  Acids Characteristic  of Reverse Transcriptases  and Related Proteins.  Nuc. Acids Res.  17(5): 2023-2042. Perlman P . S , and Birky C . W . (1974).  Mitochondrial Genetics of Baker's Yeast:  Mechanism for Recombinational Polarity and Suppressiveness. 4612-4616.  232  A Molecular  Proc. Natl. Acad. Sci. 71:  Literature Cited Pring D.R., Conde M.F., Schertz K.F., and Levings, C S . III. (1982). Plasrnid-Like DNAs Associated withMitochondria of Male-Sterile  Sorghum.  Mol. Gen. Genet. 186: 180-184.  Pring D.R., Levings III C.S., Hu W.W.L., and Timothy D.H. (1977). Unique DNA Associated wtih Mitochondrial in the "S"-type Cytoplasm of Male-Sterile Maize. Proc. Natl. Acad. Sci. 74(7):2904-2908. Rank G.H. (1970a). Genetic. Evidence for 'Darwinian' Selection at the Molecular Level I: The Effect of the Suppressive Factor on Cytoplasmically Inherited Erythromycin Resistance in Saccharomyces  cerevisiae.  Can. J. Genet. Cytol. 12: 129-138.  Rank G.H. (1970a). Genetic Evidence for 'Darwinian' Selection at the Molecular Level II: Genetic Analysis of Cytoplasmically-Inherited High and Low Suppressivity in cerevisiae.  Can. J. Genet. Cytol. 12: 340-351.  Rank G.H., and Bech-Hansen N.T. (1972). Distribution  and Complementation  Resistance Markers in  Saccharomyces  Somatic Segregation, Recombination, Asymmetrical Tests cerevisiae.  Reick A., Griffiths A.J.F., and Bertrand H. (1982). intermedia  Saccharomyces  of Cytoplasmically-Inhertited  Antibiotic-  Genetics 72: 1-15. Mitochondrial Variants of  Neurospora  From Nature. Can. J. Genet. Cytol. 24: 741-759.  Rifkin M.R., and Luck D.J.L. (1971). Defective Production of Mitochondrial Ribosomes in the Mutant of  Neurospora  crassa.  poky  Proc. Natl. Acad. Sci. 68: 287-290.  Rizet G. (1953). Sur 1'impossibilite d'obtenir la multiplication vegetative ininterrrompue et illimitee de l'ascomycete Podospora anserina. Comp. Rend. Acad. Sci. Ser. D. 237:838-840. Rizet G. (1957).  Les Modifications qui Conduisent a la Senescence Chez  Podospora  Sontelles de  Nature Cytoplasmique. Comp. Rend. Acad. Sci. Ser. D. 244:663-675. Rizet G., and Esser K. (1953). differentes chez  Podospora  Sur des Phenomenes d'incompatibilite entre souchesd'origines anserina.  Comp. Rend. Acad. Sci. 237: 760-761.  233  Literature Cited Romanos M . A , and Boyd A. (1988). A Transcriptional Barrier to Expression of Cloned Toxin Genes of the Linear Plasmid k l of  Kluyveromyces  Evidence That Native k l Has Novel  lactis:  Promoters. Nuc. Acids. Res. 16(15): 7333-7350. Salas M . (1988). Initiation of DNA Replication by Primer Proteins: Bacteriophage <b29 and Its Relatives. Curr. Topics Microbiol. Immunol. 136:71-88. Salas M , Mellado R.P., and Vinuela E. (1978). Characterization of a Protein Covalently Linked to the 5' Termini of the DNA of  Bacillus  subtilis  Phage <j>29. J. Mol. Biol. 119:269-291.  Samac D . A , and Leong S.A. (1988). Two Linear Plasmids in Mitochondria of Fusarium solani f. sp. cucurbitae. Plasmid 19(1): 57-67. Samac  D . A , and Leong  S.A. (1989).  Mitochondrial Plasmids  of Filamentous  Fungi:  Characteristrics and Use In Transformation Vectors. Mol. Plant-Microbe Interactions 2(4): 155-159.  Savilahti H , and Bamford D.H. (1986). Five Closely Related Schardl C L , Lonsdale  Escherchia  Linear DNA Replication: Inverted Terminal Repeats of coli  Bacteriophages. Gene 49: 199-205.  D . M , Pring D . R , and Rose K.R. (1984). Linearization of Maize  Mitochondrial Chromosome by Recombination with Linear Episomes. Nature 310:292-296. Schardl C L , Pring D . R , and Lonsdale D.M. (1985). Mitochondrial DNA Rearrangements Associated with Fertile Revertants of S-type Male-Sterile. Maize. Cell 43:361-368. Sherman F. (1963). Respiration Deficient Mutants of Yeasts. I. Genetics. Genetics 48:375-386. Slonmiski P.P., Perrodin G , and Croft J.H. (1968). Ethidium Bromide Induced Mutation of Yeast Mitochondria:  Complete  Transformation  of  Cells  into  Respiratory  Deficient  Nonchromosomal "Petites". Biochim. Biophys. Res. Commun. 30:232-239. Smith A . G , and Pring D.R. (1987). Nucleotide Sequence and Molecular Characterization of a Maize Mitochondrial Plasmid-Like DNA. Curr. Genet. 12(8): 617-623.  234  Literature Cited Sor F., and Fukuhara H. (1985). Structure of a linear Plasmid of the Yeast Kluyveromyces lactis; Compact Organization of the Killer Genome. Curr. Genet. 9(2): 147-155. Sor F., Wesolowski M., and Fukuhara H. (1983)  Inverted Terminal Repetitions of the Two Linear  DNA Associated With The Killer Character of the Yeast Kluyveromyces lactis. Nuc. Acids. Res. 11(15): 5037-5044. Spruill W.M.Jr., Levings III C.S., and Sederoff R.R. (1980). Recombinant DNA Analysis Indicates That the Multiple Chromosomes of Maize Mitochondria Contain Different Sequences. Dev. Genet. 1:363-378. Stahl U., Lemke P.A., Tudzynski P., Kuck U.. and Esser K. (1978).  Evidence for Plasmid-Like  DNA in a Filamentous Fungus, the Ascomycete Podospora anserina.  Mol. Gen. Genet. 162:  341-343. Stahl U., Kiick U., Tudzynski P., and Esser K. (1980).  Characterization and Cloning of Plasmid  Like DNA of the Ascomycete Podospora anserina. Mol. Gen. Genet. 178: 639-646. Stark M.J.R., and Boyd A. (1986). The Killer Toxin kluyveromyces lactis: Characterization of the toxin subunits and of the genes which encode them. EMBO J. 5:1995-2002. Stark M.J.R., Mileham A.J., Romanos M.A., and Boyd A. (1984). Nucleotide Sequence and Transcription Analysis of a Linear DNA Plasmid Associated with the Killer Character of the Yeast  Kluyveromyces  lactis.  Nuc. Acids. Res. 12(15): 6011-6030.  Steinhilber W., and Cummings D.J. (1986). A DNA Polymerase Activity with Characteristics of a Reverse Transcriptase in Podospora  anserina.  Curr. Genet. 10: 389-392.  Stillman B.W. (1983). The Replication of Adenovirus DNA with Purified Proteins. Cell 35: 7-9. Stohl L.L., Collins R.A., Cole M.D., and Lambowitz A . M . (1982).  Characterization of Two New  Plasmid DNAs Found in Mitochondria of Wild-Type Neurospora Acids Res. 10(5): 1439-1458.  235  intermedia  Strains. Nuc.  Literature C i t e d S t o h l L . L , A k i n s R . A , a n d L a m b o w i t z A.M. (1984). C h a r a c t e r i z a t i o n of D e l e t i o n Derivatives of an A u t o n o m o u s l y R e p l i c a t i n g Neurospora  P l a s m i d . Nuc. A c i d s . Res. 12:6169-6178.  Sugisaki Y , G u n g e N , Sakaguchi K , Y a m a s a k i M , a n d T a m u r a G. (1985). T r a n s f e r of D N A Plasmids  Kluyveromycts  from  Pseudotropicalis. Taylor  J.VV, S m o i c h  lactis  to  Kluyveromyces  fragilis  Killer Candida  and  J . Bacteriol. 164(3): 1373-1375. B.D,  and M a y  Mitochondrial Plasmid  G. (1985). A n  Evolutionary  D N A s f r o m T h r e e Neurospora  Comparison  of H o m o l o g o u s  Species. M o l . Gen. Genet. 201:161-  167. Thompson  R.D,  Kemble  Organisation  R.J, and  Between  Normal  Flavell  R.B.  (1980).  Variations  a n d Male-Sterile C y t o p l a s m s  in Mitochondrial  DNA  of Maize. Nuc. A c i d s Res.  8(9):1999-2008. T i m o t h y D . H , Levings  C.S. I l l , H u W.W.L, a n d G o o d m a n M.M.  (1982). Zea  diploperennis  May  H a v e P l a s m i d - L i k e M i t o c h o n d r i a l D N A s . M a i z e Genet. Coop. News Lett. 56:133-134. Tokunga  T,  Wada  N,  and H i s h i n u m a  F. (1987). Expression  a n d Identification  of I m m u n i t y  K i l l e r P l a s m i d s p G K L l a n d p G K L 2 i n Kluyveromyces  D e t e r m i n a n t s on Linear D N A  lactis.  Nuc. A c i d s . Res. 15:1031-1046. T r a y n o r P . L , a n d Levings C.S. I l l (1986).  T r a n s c r i p t i o n of the S-2 M a i z e M i t o c h o n d r i a l  Plasmid.  P l a n t M o l . Biol. 7(4): 255-264. Tudzynski  P , a n d Esser K. (1979).  the A s c o m y c e t e Podospora Tudzynski  C h r o m o s o m a l a n d E x t r a c h r o m o s o m a l C o n t r o l of Senescence i n anserina.  M o l . G e n . Genet. 173: 71-84.  P , a n d Esser K. (1986). E x t r a c h r o m o s o m a l Genetics of Claviceps  in V a r i o u s W i l d Strains a n d Integrated P l a s m i d C u r r . Genet. 10:463-467.  236  purpurea  II. P l a s m i d s  Sequences in M i t o c h o n d r i a l G e n o m i c  DNA.  Literature C i t e d T u d z y n s k i P . , S t a h l U . , a n d Esser K . (1980). T r a n s f o r m a t i o n to Senescence w i t h P l a s m i d L i k e D N A in the A s c o m y c e t e Podospora  ansenna.  C u r r . G e n e t . 2:181-184.  T u d z y n s k i P . , D u v e l l A . , a n d Esser K . (1983). E x t r a c h r o m o s o m a l  G e n e t i c s of Claviceps  purpurea. I.  M i t o c h o n d r i a l D N A a n d M i t o c h o n d r i a l P l a s m i d s . C u r r . G e n e t . 7:145-150. T u d z y n s k i P . , D u v e l l A . , a n d Oeser Claviceps  purpurea.  B . (1986).  Linear Plasmids in the P h y t o p a t h o g e n i c  In E x t r a c h r o m o s o m a l  E l e m e n t s in Lower E u k a r y o t e s ,  H i n n e b u s c h , L . M e t s , A . L a m b o w i t z , A . Holaender, eds.  (New Y o r k :  Fungus  R. Wickner, A .  P l e n u m Press), p p .  119-128. T u r k e r M . S . , D o m e n i c o J . M . , a n d C u m m i n g s D . J . (1987). DNA  D u r i n g Senescence i n Podospora  anserina:  Consensus Sequence i n the E x c i s i o n Process.  Turpen  T . , Garger  A Potential  A Podospora  P h e n o t y p e for Senescence.  S.J., Marks M . D . , and Grill  C h a r a c t e r i z a t i o n of a Brassica  Role for an 11  Base-Pair  J . M o l . B i o l . 198(2): 171-185.  T u r k e r M . S . , N e l s o n J . G . , a n d C u m m i n g s D . J . (1987). with a T e m p e r a t u r e - S e n s i t i v e  E x c i s i o n - a m p l i f i c a t i o n of M i t o c h o n d r i a l  L . K . (1987).  ansenna  Longevity  Mutant  M o l . C e l l . B i o l . 7(9): 3199-3204. Molecular  Cloning and Physical  Linear Mitochondrial Plasmid. M o l . G e n . Genet.  209(2): 227-  233. VanderVeen R., Arnberg A . C . , VanderHorst Excised  G r o u p II Introns are Lariats  L . , B o n e n L . , T a b a k H . F . , a n d G r i v e l l L . A . (1986). and C a n Be Formed  b y Self-Splicing in vitro.  Cell  44:225-234. V i e r n y C , Keller A . M . , Begel O . , a n d Belcour,  L . (1982).  A Sequence  A s s o c i a t e d with the O n s e t of Senescence in a F u n g u s . Vierny-Jamet  C . (1988).  Senescence i n Podospora  Interacting Proteins  Suggested  anserina:  B y the Sequence  Specifically A m p l i f i e d in Senescent C u l t u r e s .  237  of M i t o c h o n d r i a l D N A is  N a t u r e 297: 157-159. A Possible  Role for Nucleic  Acid  A n a l y s i s of a M i t o c h o n d r i a l D N A Region  G e n e 74(2): 387-398.  Literature Cited Vogel H.G. (1956). A Convenient Medium for  Neurospora.  Microbiol. Genet. Bull. 13:42-43.  Wakabayashi K , and Furutani Y. (1984). Inversions in Mitochondrial DNA of a  Petite  Mutant of  Yeast. J. Biochem. 96(5): 1559-1564. Waring R . B , Scazzocchiio C , Brown T . A , and Davies R.W. (1983). Close Relationship Between Certain Nuclear and Mitochondrial Introns. J. Mol. Biol. 167:595-605. Weissinger A.K., Timothy D . H , Levings III C . S , Hu W . W . L , and Goodman M . M . (1982). Mitochondrial DNA Variation in Latin American Maize Races. Maize Genet. Coop. News Lett. 56:133-138. Weissinger A . K , Timothy D . H , Levings III C.S, Hu W . W . L , and Goodman M.M. (1982). Unique Plasmid-Like Mitochondrial DNAs from Indigenous Maize Races of Latin America. Proc. Natl. Acad. Sci. 79:1-5. Wesolowski M , Algen A , Goffrini P., and Fukuhara H. (1982). Killer DNA Plasmids of the Yeast Kluyveromyces  lactis  I: Mutations Affecting the Killer Phenotype. Curr. Genet. 5:191-197.  Wlodarczyk M , and Nowicka B. (1988). Preliminary Evidence for the Linear Nature of versutus  Thiobacillus  pTAV2 Plasmid. FEMS Microbiol. Lett. (552): 125-128.  Wright R . M , Laping J . L , Horrum M . A , and Cummings D.J. (1982). Podospora  anserina  Mitochondrial DNA from  III: Cloning, Physical Map, and Localization of the Ribosomal RNA  Genes. Mol. Gen. Genet. 185: 56-64. Yehle C O . (1978). Genome-Linked Protein Associated with the 5' Termini of Bacteriophage cb29 DNA. J. Virol. 27(3):776-783. Yoshikawa H , Friedmann T , and Ito J. (1981). Nucleotide Sequences at the Termini of <)>29 DNA. Proc. Natl. Acad. Sci. 78(3): 1336-1340. Yoshikawa H , and Ito J. (1981). Terminal Proteins and Short Inverted Terminal Repeats of the Small  Bacillus  Bacteriophages. Proc. Natl. Acad. Sci. 78(4): 2596-2600.  238  Literature Cited Yui Y., Katayose Y., and Shishido K. (1988). Simultaneously Maintained in  Pleurotus  Two Linear  ostreatus.  239  Plasmid-Like DNA Elements  Biochim. Biophys. Acta 951(1): 53-60.  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0101043/manifest

Comment

Related Items