Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

A functional analysis of the kalDNA plasmid from senescent strains of Neurospora intermedia Vickery, Daniel Barry 1989

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-UBC_1991_A1 V52.pdf [ 12.93MB ]
Metadata
JSON: 831-1.0101043.json
JSON-LD: 831-1.0101043-ld.json
RDF/XML (Pretty): 831-1.0101043-rdf.xml
RDF/JSON: 831-1.0101043-rdf.json
Turtle: 831-1.0101043-turtle.txt
N-Triples: 831-1.0101043-rdf-ntriples.txt
Original Record: 831-1.0101043-source.json
Full Text
831-1.0101043-fulltext.txt
Citation
831-1.0101043.ris

Full Text

A F U N C T I O N A L A N A L Y S I S OF T H E k a l D N A P L A S M I D F R O M S E N E S C E N T S T R A I N S OF Neurospvra intermedia by DANIEL BARRY VICKERY B. Sc., University of British Columbia, 1986 A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES GENETICS PROGRAMME We accept, this thesis as conforming to the required standard THE UNIVERSITY OF BRITISH COLUMBIA November, 1989 (c) Daniel B. Vickery, 1989 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at The University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the Head of my Department or by his or her representatives. It, is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Genetics Programme The University of British Columbia 2075 Wesbrook Place Vancouver, Canada V 6 T 1W5 Date: 1 November 1989 A B S T R A C T The 8.6 kb kaiilo linear mitochondrial plasmid of Neurospora intermedia was found to give rise to multiple transcripts of 8.6, 4.4, 4.0, 1.3, 1.2, and 0.9 kb. A transcription map has been generated which shows similarities to other linear plasmids. These transcripts are all transcribed from a single, unique promoter sequence reiterated near the ends of the terminal inverted repeats of the linear plasmid. The transcripts are not processed, but instead utilize optional transcription stop sites. A n analysis of sub-cellular R N A fractions has confirmed the mitochondrial location of kaiilo transcription. The strong association of kalilo-specific R N A with r R N A to yield R N A artifacts is reported. Kalilo-specific R N A appears to be selectively unstable in affected strains of N. intermedia; this may be a general consequence of linear plasmid R N A . The 5' R N A start site was determined by primer extension and R N A sequencing. The sequence in this region does not show homology to any known mitochondrial, plasmid, nor nuclear promoter, and may constitute a novel element. The transcription start site shares homology with the terminus of the linear plasmid, and marks the end of a long series of direct repeats; therefore, the plasmid R N A polymerase may be bifunctional, it may recognize sequences at the ends of the plasmid as well as at the promoter. The analysis of the insertional behaviour of the linear mitochondrial plasmid was studied in parallel subculture series of the organism. It was determined that insertion, per se is not the event required to kill the organism. Generation of inserts of kaiilo in the mtDNA is necessary, but not sufficient, for death to occur in all cases. A n analysis of insertion sites has found one new site and good agreement with previously published locations. Insertion does not always appear to be random, so cultures may inherit undetectable amounts of mtlS-kalDNA. The analysis of insertion sites in one strain has suggested a novel possible structure for the mtDNA. ii TABLE OF CONTENTS abstract ii Table of Contents iii List of Tables vi List of Figures vii List of Abbreviations x Acknowledgement xi Introduction 1 Neurospora review 1 Life cycle of Neurospora 1 Ascomycete Growth 1 Asexual Propagation 2 Sexual Propagation 3 Laboratory Propagation 5 Mitochondrial D N A 6 Mitochondrial Genetics 6 Other Mitochondrial D N A s 7 Transcription and Processing 9 Growth Aberration in Fungi 11 Manifestations of Senescence 11 Occurrence of mtDNA mutation 16 Petite Mutations of Saccharomyces cerevisiae 18 The ragged mutation of Aspergillus amstelodamii 19 Senescence in Podospora anserina 20 Mitochondrial Mutation in Neurospora 26 Group I 26 Group II 27 Group III 28 Senescence in Neurospora intermedia 30 Mitochondrial D N A 30 The Linear Plasmid.. 32 Review of Linear Plasmids 42 Definition 42 Prokaryotes 47 Plants 51 Plasmids in Male Sterile Lines 51 Plasmids in Zea 51 Fungi 53 Mitochondrial plasmids : 53 Location unknown 55 Nuclear plasmids 55 iii Table of Contents The Killer System of Kluyveromyces lactis 55 phenotypes of linear plasmids 57 Search for Functions of kaiilo 58 Materials and Methods 61 Strains 61 Neurospora intermedia 61 Escherichia coli 61 Media and Growth Conditions.. 61 Neurospora 61 Escherichia coli 62 Nucleic Acid Isolations 63 D N A Isolation : 63 Mitochondrial D N A 63 Escherichia coli Plasmid D N A 64 M13 Phage D N A 65 R N A isolation 66 Total R N A 66 Poly A RNA 67 mtRNA 67 Electrophoresis 68 D N A 68 Agarose gel 68 Polyacrylamide Gels 68 Northerns 69 Hybridizations 69 Radioactive Probe Preparation 70 Oligolabelling 70 End Labelling 70 3' Labelling 70 5' Labelling 71 M13 clones 71 S i Nuclease Protection Assays 71 Sequencing 73 Primer preparation 73 D N A sequencing 73 R N A sequencing 74 Primer Extensions 74 Cloned D N A Fragments..... 75 Preparation of Recombinant D N A ; 75 Competent E . coli 75 Probes 76 P a r t i Transcriptional Properties of kalDNA 78 Introduction 78 Results 79 Characterization of Transcription 79 iv Table of Contents Detection of Transcription Pattern 79 Kalilo-Specific R N A is Unstable 86 Transcription levels 102 Mapping of Transcripts 105 Mapping Experiments 105 Transcription Map 123 Identification of a 5' R N A End 123 Primer Extension Reactions 123 Promoter Sequences 129 Interactions with mtDNA 130 Discussion 134 Related Sequence Elements 134 Transcription of Other Linear Plasmids 135 Kalilo R N A Phenomena 136 Association of Kalilo Transcripts with rRNA 136 Variability and Heterogeneity of Kalilo-Specific R N A 138 Possibility of Other RNAs 140 R N A Phenomena from Other Systems 141 Evolution and Function 142 Part II Parallel subculture Series Experiments 146 Introduction 146 Results 152 Young Strains Do Not Contain mtlS-kalDNA 152 Analysis of Longevity 159 Molecular Analysis 167 Analysis of Junction Fragments 186 Discussion 202 Is insertion the Senescence-Determining Event? 203 Relevance of Data to Senescence 207 Other Models 209 Literature Cited, 212 LIST OF TABLES Table 1. Survey of Linear Double Stranded D N A Elements 46 Table 2. Averages and Standard Deviations of Lifespans 160 Table 3. Location of mtlS-kalDNA in Parallel Series 198 vi LIST OF FIGURES Figure 1. Life Cycle of Neurospora Showing Both the Sexual and Asexual Cycles 4 Figure 2. Diagrammatic Representation of the Succession of Degenerative Events Associated with Aging and Senescence in Neurospora 14 Figure 3. Composite Map of the Podospora anserina Mitochondrial Chromosome Showing Events Which Give Rise to senDNAs . 24 Figure 4. Regions of the mtDNA Retained in Various Mitochondrial Mutants of Neurospora 29 Figure 5. Restriction Map of Kaiilo 34 Figure 6. Model for the Insertion of Kaiilo Into the mtDNA 38 Figure 7. Previously Identified Insertion Sites of mtlS-kalDNA 40 Figure 8. Model for the Replication of Linear DNAs 43 Figure 9. Structures of Some Linear Plasmids 49 Figure 10. Subclones of kaiilo D N A 77 Figure 11. Occurrence of Transcripts of Kaiilo from Different Series and Strains of N . intermedia 81 Figure 12 Northern Background is Not Due to Low R N A Quality 83 Figure 13. Increasingly Stringent Washes of a Northern Remove Probe Equally from All Areas of a Blot ...89 Figure 14. The 8.6 kb Transcript is Apparent Upon Long Exposures of a Northern Blot. 91 Figure 15. Diagram of the Generation of b l ' and b2' Junction Fragments for the Detection of mtlS-kalDNA 94 Figure 16. Characterization of mtDNA from Strains that Do Not Have Detectable Inserts of Kaiilo 96 Figure 17. Northern Analysis of Strains That Do Not Contain mtlS-kalDNA 98 Figure 18. Dotblots of Various RNA Samples ..103 Figure 19. Northern Analysis Using Many Different Subclones of Kaiilo 107 vii List of Figures Figure 20. A Diagram of the Pattern of Hybridization of Many Different Subclones of Kalilo to R N A '. 109 Figure 21. Use of M13 ssDNA Probes in Northern Blots to Confer Strand Specificity on the Transcripts 112 Figure 22. The 2.0 and 3.5 kb Transcripts Comigrate With the 28S and 16S rRNAs of Neurospora 114 Figure 23. SI Nuclease Analysis of Transcripts 118 Figure 24. Transcription Map of Kalilo D N A 120 Figure 25. 5' End Mapping of the Kalilo Transcripts by Primer Extension Analysis 125 Figure 26. Sequence Around the Major 5' R N A End of Kalilo 127 Figure 27. Northern Analysis of the mtDNA Region Surrounding the Insert of Kalilo in Strain 561-7... 132 Figure 28. Proteinase K is Required For and Leads to Repeatable Isolation of mtAR-kalDNA 148 Figure 29. Diagram of the Generation of b l ' and b2' Junction Fragments for the Detection of mtlS-kalDNA 153 Figure 30. Characterization of the mtDNA From a Number of Senescent Progeny of Strain 561 155 Figure 31. Lifespans of Members of Parallel Series Derived from Crosses Using Strain 605 as a Male Parent 161 Figure 32. Lifespans of Members of Parallel Series Derived From Crosses Using Strain 1766 as a Male Parent 163 Figure 33. Diagram of the Generation of b l ' and b2' Junction Fragments for the Detection of mtlS-kalDNA 168 Figure 34. Characterization of Senescent mtDNAs from Strain Xl-5 . . . 170 Figure 35. Characterization of Senescent mtDNAs from Strain X l - 6 172 Figure 36. Characterization of Senescent mtDNAs from Strain 1-4 174 Figure 37. Characterization of Senescent mtDNAs from Strain 1-16 176 Figure 38. Characterization of mtDNA from Strains I-16-viii and I-16-ix 188 viii List of Figures Figure 39. Analysis of Junction Fragments of mtlS-kalDNA from Parallel Series Strain I-16-ix '. 190 Figure 40. A Model for the Inserts of mtlS-kalDNA in Parallel Series Strain I-16-ix 192 Figure 41. Insertion Sites of mtlS-kalDNA from Table 3 199 ix L I S T O F A B B R E V I A T I O N S aa Amino Acid ARS Autonoumously Replicating Sequence A T P Adenosine Triphosphate cob Apocytochrome b COI Cytochrome Oxidase I COII Cytochrome Oxidase II COIII Cytochrome Oxidase III D N A Deoxyribonucleic Acid IS Insertion Sequence ITR Inverted Terminal Repeat kalDNA D N A Sequences Homologous to the Kalilo Plasmid kb Kilobase L T R Long Terminal Repeat mRNA Mitochondrial RNA MtAR- Mitochondrial Autonomously Replicating mtDNA Mitochondrial D N A MtIS- Mitochondrial Insertion Sequence mtRNA Mitochondrial RNA mtRNA Mitochondrial RNA N A D H Nicotinamide Adenine Dinucleotide R N A Ribonucleic Acid mRNA Messenger RNA rRNA Ribosomal RNA x List of Abbreviations tRNA Transfer R N A xi A C K N O W L E D G E M E N T I would like to acknowledge all of the people at U B C who made my stay here enjoyable and productive. I thank the members of my supervisory committee, T. Grigliatti, T. Beatty and G. Spielgelman for their support and advice. I thank many people for technical help, including H . Brock, M . Decamillis, P. Durovic, D. Groden. and C. Myers. I thank my supervisor, A.J .F . Griffiths for his uncompromising faith and help. Finally I thank my friends and family without whose generosity and belief this thesis would not have been possible. xi I N T R O D U C T I O N , Although cultures of Neurospora are thought to be immortal, that is they can be subcultured indefinitely by asexual or sexual propagation, certain strains from the Hawaiian islands show a peculiar phenotype for this genus: senescence. Senescence is a process of clonal deterioration leading to death, and is readily studied in members of the filamentous fungi, including Neurospora, Podospora, and Aspergillus. In these organisms senescence is characterized by mitochondrial aberrations including DNA alterations and cytochrome deficiencies. In N. intermedia, the predisposition to senescence among wild isolates from the island of Kauai is maternally inherited and has been called the [kalilo] cytoplasm. Senescence has been correlated with the presence of a mitochondrial, linear, double stranded, DNA plasmid in affected strains. Senescence in the fungi is a mitochondrial phenomenon and in the sections to follow the phenomenon of mitochondrial senescence among the fungi is reviewed, and background with respect to the experimental system is given. Finally, information is presented concerning the occurrence of linear and mitochondrial plasmids. NEUROSPORA REVIEW Life cycle of Neurospora Ascomycete Growth Members of the Genus Neurospora, Kingdom Fungi, Class Ascomycetes, are members of the filamentous fungi. They have a mycelial growth form, in which distinct cellular organization does not occur, but instead the hyphal compartments are multinucleate, and the mycelium represents a fairly continuous bag of cytoplasm which is delineated by pored septa, rather than by discrete cell walls. 1 Introduction Growth of these organisms occurs by the concerted movement of cytoplasm from more distal regions of the hypha to the growth front, or growing tip. Another aspect of growth is the dense branching that hyphae undergo. Adding to the heterogeneity inherent in this organism is the phenomenon whereby the hyphae of species of filamentous fungi will readily fuse when they encounter one another. Ability to fuse is under the control of heterokaryon incompatibility loci. The form of cellular organization whereby many nuclei direct the synthesis of a common cytoplasm is termed coenocytic; it is relatively rare, but can be found in diverse organisms and cell types such as true slime molds, insect blastoderm, and muscle cells. The Ascomycetes are distinguished by the ascus, a. bag which contains the four products of meiosis, or ascospores. In the genus Neurospora, the ascospores are held in a linear conformation corresponding to the actual meiotic division which gave rise to them. This is the case in Neurospora tetrasperma, while in N. crassa, N. intermedia, and N. sitophila the four products of meiosis undergo an extra mitotic division and the ascus contains eight ascospores. Asexual Propagation A diagram of the life cycle of Neurospora is shown in figure 1. The Ascomycetes are haploid fungi with both asexual and sexual propagation (for a review, see Beadle, 1945). The asexual developmental cycle consists of dispersal by asexual spores called conidia. Haploid hyphae grow until the organism has formed a dense mycelial mat, and then the organism begins to differentiate into aerial hyphae. Conidia, which are typically multinucleate macroconidia, although uninucleate microconidia do exist, are formed in long branched chains atop the aerial hyphae. Conidia differentiate by becoming highly pigmented during maturation; the pigments are orange or red carotenoids. Conidia are designed for dispersal by air, and conidia easily become airborne and when 2 Introduction they alight upon a suitable media, they are capable of germinating and beginning the mycelial growth phase anew. Sexual Propagation N. crassa, N. intermedia, and TV. sitophila are heterothallic species, and the sexual cycle requires the presence of two mating types, designated A and a, that are determined by codominant alleles of the mating type gene. The mating type gene also acts as an incompatibility gene: thus hyphae of different mating type cannot fuse, they must undergo meiosis. The mating process occurs when either parent, on suitable medium, acts as a female parent and differentiates a structure called a protoperithecium, an immature fruiting body. It consists of a densely coiled mass of hyphae around ascogenous hyphae destined to undergo meiosis. Each ascogenous hyphae produces a trichogyne, which is a long hypha that is capable of fusing with a fertilizing cell of opposite mating type. The fertilizing cell can be. a conidium, or another hypha. Upon fusion, only the nucleus of the fertilizing cell is enveloped and transported down the trichogyne to the ascogenous hyphae. The paternal and maternal nuclei undergo a small number of mitotic divisions, while the protoperithecium differentiates into a perithecium, a mature fruiting body. Nuclear fusion and karyogamy are followed ~> immediately by meiosis. Ascospores undergo complete morphogenesis to become ovate, quiescent cells, blackened with melanin, and resistant to many forms of environmental insult. Indeed, germination of ascospores requires a heat shock of 60° C. Upon germination, the mycelial mode of growth is restored. 3 Introduction Figure 1. Life Cycle of Neurospora Showing Both the Sexual and Asexual Cycles. From Fincham et al, (1979). aseogcnous hypha 4 Introduction Laboratory Propagation N. crassa is a classical research organism and it is well defined genetically. It has seven chromosomes, and most, standard genetic and molecular procedures can be performed with Neurospora, including transformation, tetrad analysis, reciprocal crosses, and chromosome mapping via the O F A G E technique. It resembles most organisms in that the cytoplasm is strictly maternally inherited. It is easily cultured and grows on simple defined media consisting of vitamins, minerals and a carbon source, and supplements as required. Neurospora mates readily on a defined media low in nitrogen. V a s t collections of natural isolates of Neurospora have been obtained, providing many opportunities to study differences between these and standard laboratory stocks. Finally , it is easily manipulated using standard, microbiological techniques, although a few procedures are unique to Neurospora. 500 m m race tubes allow the determination of the linear hyphal growth rate. T h e organism is inoculated at one end of the tube, and daily measurements are made on how far the fungus has grown in that time. Typica l ly , it takes five days for a wild-type strain of Neurospora to grow to the end of a race tube, while an abnormal strain can take m u c h longer, or fail to grow the full length of the growth tube. T h e phenomenon of stop-start growth is seen in the growth tube as well, whereby a culture can 'stall' for a few days and then resume a wild-type growth rate. Serial subculturing was identified by Griffiths and Bertrand (1984) as an efficient way to identify natural.isolat.es that had growth aberrations, however the development, of senescence by the serial subculture method does not exactly parallel that in a continuously growing culture. Rather , it seems as though the act of conidial germination or some aspect of development has an enhancing effect on the expression of kalilo induced senescence (Griffiths et al, 1986). 5 Introduction Mitochondria] D N A Mitochondrial Genetics Neurospora represents an excellent organism for the study of mitochondrial biology. The mitochondrion is the site of oxidative phosphorylation in almost all eukaryotes, and the mitochondrion contains its own genetic information. However, mitochondria are not autonomous and biogenesis of mitochondria requires the concerted action of nuclear and mitochondrial genes, as the set of mitochondrial genes is incomplete. The circular mtDNA of Neurospora crassa is approximately 60 kb long, and it encodes two rRNAs, 27 tRNAs and the protein sequences for approximately 13 proteins. Most proteins are involved in the electron transport pathway and include apocytochrome b (cob), ATPase subunits, and cytochrome oxidase subunits I, II, and III (CO I, II, and III, respectively) (Reviewed by Nelson and Macino, 1985; Breitenberger and RajBhandary, 1985), and the genes for NADH dehydrogenase subunits (Nelson and Macino, 1987). This organization is standard for all of the well studied mitochondrial systems, even though the size of the mtDNA varies widely, from 16 kb for most mammalian systems (Brown et al, 1981), to as much as 2500 kb in some plants (Bendich, 1982). The genetic system in mitochondria differs from the universal genetic code. An interesting adaptation is that the codons are read differently in the mitochondrion, so that in the case of Neurospora, 25 unique tRNAs can read all the 64 possible codons of the triplet genetic code. The mechanism of this adaptation is by the use of uracil in the anticodons, which can pair with all the other bases. This reduces the number of anticodons needed to read all possible codons. Another difference, is that the genetic code is altered in mitochondria. These changes are species specific, but in Neurospora, the only change is that the stop codon, TGA, is read as tryptophan. (Reviewed by Breitenberger and RajBhandary, 1985). 6 Introduction Other Mitochondrial DNAs Many different types of supernumary DNAs in mitochondria have been identified. It has been suggested that these DNA species fall into two distinct groups (Nargang, 1985). The so-called defective DNAs consist of excised, or altered regions of the wild-type mtDNA molecule which have undergone suppressive overreplication compared to the wild-type molecule, and generally lead to a growth aberration in the organism which harbours them. These will be reviewed more fully in the section on Growth Aberration. The second group contain the "true" mitochondrial plasmids. They are autonomously replicating, or appear to be, and have little or no homology to the mitochondrial or nuclear DNA of their host. In striking contrast to the first group, virtually none of the true plasmids can be associated in any way with a phenotype in the organism which harbours it. While many organisms harbour mitochondrial plasmids, only the mitochondrial plasmids of Neurospora are to be reviewed here. The kalilo plasmid is one of a number of linear mitochondrial plasmids that have now been identified. At least three linear double stranded DNA plasmids are now known. In addition to kalilo there are maranhar and zhisi. Maranhar, a 7 kb plasmid with .7 kb terminally inverted repeats (TIRs), was found in a N. crassa strain from India which shows the same growth aberrations and phenotype as kalilo, although the two plasmids show no homology at the nucleotide level (Bertrand and Griffiths, pers. comm.). Zhisi is a plasmid from a Chinese strain of TV. intermedia which has similarities to the other two (Griffiths and Bertrand, pers. comm.). While mitochondrial plasmids in Neurospora are quite common, these three are representative of the linear senescence plasmids of Neurospora. There is also a number of circular DNA plasmids associated with the mitochondrion of Neurospora species. These plasmids, although they were discovered in different geographical isolates and different species of Neurospora, fall into three homology groups. The Fiji plasmids are a group of 7 Introduction 5 kb circular dsDNA plasmids which all show homology to a prototype 5 kb plasmid from a N. intermedia strain from Fiji (Stohl et al, 1982). There are several strains of Neurospora which have plasmids with homology to the Fiji plasmid, most notably some N. tetrasperma strains from Hawaii (Natvig ct al, 1984) and a group of TV. crassa strains from Louisiana (Taylor et al, 1985). A second circular plasmid, of 4.1 kb, has been found only in a N. intermedia strain from Labelle, Florida (Stohl et al, 1984). A third Neurospora mitochondrial plasmid homology group is the Mauriceville/Varkud plasmids. Despite the fact that the Mauriceville plasmid was discovered in an N. crassa species, from Mauricevelle, Texas (Collins et al, 1981), and the Varkud plasmid is from a N. intermedia species from India (Lambowitz et al, 1986), these two plasmids show over 97% sequence and positional identity (Nargang et al, 1984; Lambowitz et al, 1986; Nargang, 1986). The occurrence of similar plasmids in many different species of fungi may imply that the plasmids predate the speciation of organisms, however evidence suggests that the plasmids were inherited independently of the mtDNA (Taylor et al, 1985). The idea that the plasmids may be related to mobile elements has been supported by the sequence, and transcriptional analysis of these plasmids, which has yielded some surprising results. The Fiji plasmid group has never been found to be transcribed, and has not been studied further, however both the Labelle. and the Mauriceville/Varkud plasmids are transcribed, and they have been sequenced. Both plasmid groups contain long ORFs and their sequences resemble mitochondrial introns, although they do not resemble one another. The Labelle plasmid has a long ORF which resembles the ORFs of mitochondrial class II introns (these will be described in the Transcription and Processing section), but the transcriptional properties are unclear and the occurrence of a full length transcript is not a certainty (Nargang et al, 1984; Nargang, 1986; Pande et al, 1989). Therefore it is not possible to determine if the Labelle plasmid is maintained by a reverse 8 Introduction transcription step, however the transcriptional properties of the Mauriceville/Varkud plasmids have been studied in detail. The Mauriceville/Varkud plasmids have sequences that are strongly reminiscent of mitochondrial class I introns, and they both encode a 710 aa ORF which shows homology to reverse transcriptases. Both plasmids give rise to full-length transcripts (Nargang et al, 1984; Nargang, 1986; Lambowitz et al, 1986), and both have been shown to contain a reverse transcriptase activity that is not present in closely related Neurospora strains without the plasmids (Kuiper and Lambowitz, 1989). The idea that the plasmids replicate by reverse transcription has also been supported by the observation that mutants of plasmid-containing strains have been found to contain altered mtDNAs and altered plasmids that could only have arisen by reverse transcription of an altered RNA (Akins et al, 1986; Akins et al, 1989). Interestingly, the rearrangements that were found in the mutant plasmids suggested the presence of an RNA ligase activity in the. plasmid containing strains (Akins ei al, 1986). That this was indeed possible was supported by the surprise discovery that a major transcript of the Varkud plasmid, which had previously been identified as a longer than full length transcript, actually was a hybrid message generated by a trans-splicing event between the mitochondrial small rRNA and a full length transcript of the plasmid (Akins et al, 1988). A rigorous investigation of mutant forms of the plasmid has yielded the identification of a tRNA like structure at the origin of the plasmids which may be important for priming of reverse transcription (Akins et. al, 1989), which is another strong piece of evidence that these plasmids are indeed circular retroposons, or mobile introns. Transcription and Processing The N. crassa mitochondrial genome is transcribed from a limited set of promoters into long multicistronic messages which are then highly processed down to mRNAs, and all known genes are 9 Introduction transcribed from the same strand of DNA (Green et al, 1981; Breitenberger et al, 1985; Burger et al, 1985). This is characteristic of mitochondrial transcription in general. A promoter has been identified for the cob and rRNA transcription units, and it has the consensus sequence TTAGARA(T/G)G(T/G)ARTRR (Kennel and Lambowitz, 1989). It is not known if there are other sequences which can function as promoters in Neurospora mtDNA. tRNA sequences punctuate some of the mitochondrial genes, and it has been shown that excision of the tRNA sequences is often all that is required for the generation of a mature message (Breitenberger et al, 1985; Burger et al, 1985). However many genes contain introns and multiple introns and in many cases secondary processing events are necessary to generate functional mRNAs and rRNAs. Interestingly, The intron of the 25S rRNA gene in N. crassa has been found to encode the mitochondrial ribosomal protein S5 (Burke and RajBhandary, 1982). It is into this reading frame that kaiilo is found inserted in prototype senescence strain P561 (Bertrand et al, 1985). Mitochondrial introns are well-studied and many interesting observations have been made on their splicing. Mitochondrial introns fall into two classes, class' I and class II, which are distinguished by conserved sequence motifs. Class I introns are the most common and have highly conserved sequence elements which seem to be important for the formation of complex secondary structures that are required to bring the ends of the exons together for splicing. These introns are often found to be self splicing in vitro, while in vivo they probably require the action of a maturase protein. Class II introns are distinguished by a highly conserved sequence near the 3' end of the intron, and by the presence of long ORFs within them that show homology to reverse transcriptases (Davies et al, 1982; Michel et al, 1982; Cech, 1983; Michel and Dujon, 1983; Waring et al, 1983; Garriga and Lambowitz, 1984; Michel and Lang, 1985). While class I introns resemble introns such as the self-splicing intron of Tetrahymena rRNA (Kruger et al, 1982), and class II introns may share functions with nuclear pre mRNA introns such as lariat formation (VanderVeen et al, 1986; Padgett et al, 1984), 10 Introduction mitochondrial introns are distinguished from other introns in general by the presence of the ORFs within them. As an example of this, the maturase of some class I introns is found to be encoded by another intron—often in the same gene and in-frame with the preceding exon, so that it can only be expressed as a. fusion peptide prior to splicing of its own coding sequence (Burke et al, 1984; Jacq et al, 1984). Another intron-encoded phenomenon is the ui intron in the 24S rRNA of Saccharomyces. This is an optional intron in the yeasts, however, in crosses between strains heterozygous for the intron (with and without the intron, w"^  and uf, respectively), only u)~*~ are recovered. This unidirectional gene conversion event could not be explained by conventional mitochondrial crosses and recombination. Subsequently, the ORF of this intron was found to encode a restriction endonuclease which is capable of introducing a double stranded cut in the uf chromosome, and is thought to be responsible for the unidirectional gene conversion event seen in crosses (Jacquier and Dujon, 1985). The presence of reverse transcriptase-like proteins encoded within introns, and the observation of such phenomena as the u> intron has led to the speculation that mitochondrial introns may be somehow related to mobile elements (Reviewed by Dujon et al, 1986). This hypothesis is supported by the discovery of mitochondrial plasmids which resemble mobile introns (Nargang et al, 1984; Akins et al, 1986; Pande et al, 1989), and the presence of other mobile insertion sequences in mitochondria such as the kalilo plasmid. GROWTH ABERRATION IN FUNGI Manifestations of Senescence Mitochondrial-based growth aberrations have been researched in the fungi as a model for senescence and as probes of mitochondrial function. Growth aberrations can be identified as those 11 Introduction affecting the growth rate, longevity of an organism, and in the fungi, colony size. T h e y have been found in yeasts, Neurospora crassa, N. intermedia, Podospora anserina, and Aspergillus nidulans. W i l d - t y p e cultures of some of these organisms are considered to be immortal , however mutants are known which have a limited life span (Bertrand and Pittenger, 1969). T h e longevity of these simple organisms can be assayed as colony size or by serial subculturing. Mutat ions which cause mitochondrial growth aberrations can be nuclear as well as cytoplasmic, however only mitochondrial mutations are reviewed here. There are some basic differences in the way in which mitochondria! defects affect different organisms. F o r instance, the yeasts can exist with no m t D N A whatsoever, by reverting to anaerobic respiration, while filamentous fungi are obligate aerobes, and severe mitochondrial insults result in death for these organisms. Consequently there are no true cases of mitochondrial-based senescence in the yeasts, merely the slow growth phenotypes, or petites. There appear to be two types of insult to the m t D N A s in these organisms. O n e group consists of a classic mutation to the m t D N A , usually a deletion. In this group are the petites of yeast, the ragged mutat ion of Aspergillus, poky of Neurospora, etc. T h e second group, of which kaiilo is an example, also suffer from rearrangements of the m t D N A , but in these organisms extra D N A is associated with the senescence event, or rather an apparently programmed event occurs which causes extraneous D N A s to interact with the mitochondrial genome. For example, in Podospora, the s e n D N A s are programmed for excision and replication, and in Neurospora, the plasmids kaiilo and maranhar are known to insert into and alter the m t D N A . In a facultative anaerobe such as a yeast, severe mitochondrial defects do not lead to the death of the organism, rather, they lead to slow growth phenotypes called petites, a reference to colony size. Mi tochondr ia l malfunction in the filamentous fungi, however, leads to a relatively well-documented phenomenon termed senescence. Figure 2 is a representation of the changes that occur in Neurospora as it ages, and it is fairly representative of Podospora and Aspergillus as well. T h e 12 Introduction first manifestation of a growth aberration is the loss of female fertility, or the ability to form perithecia (Bertrand et al, 1968; Bertrand and Pittenger, 1969; Reick et al, 1982). In many organisms, including Podospora, the next step is the destruction of the respiratory chain, highlighted by the loss of cytochromes aag and b, and the concomitant rise, in cytochrome c (Bertrand and Pittenger, 1969; Belcour and Begel, 1978; Cummings et al, 1979a; Bertrand et al, 1985; Myers, 1988). Subsequently, complex changes begin to occur, including loss of conidia and the production of melanin like pigments (Munkres and Minssen, 1976). That changes are occurring at the growth front is suggested by the observations that in Podospora, hyphal tips are seen to swell and burst (Rizet, 1953), and in Aspergillus, the mutation ragged refers to the morphological appearance of the growth front (Jinks, 1956). 13 Introduction Figure 2. Diagrammatic Representation of the Succession of Degenerative Events Associated with Aging and Senescence in Neurospora. Growth is represented by a solid line, declining growth by a dashed line. From Bertrand (1983). 14 SI C < n z r 0 n • 0) PI z n n z rAscospore fertility loss I-Respiratory defects |-Pigment ^Conidia lost •-Death Introduction Occurrence of m t D N A mutation T h e average yeast cell is thought to contain about 50 copies of the m t D N A (Birky et al, 1978b). In an actively growing filamentous fungus, which does not contain true cell walls, this number may be even larger. T h e question then arises, how do mitochondrial mutations arise, especially those causing growth aberrations? T h e chance of fixation of a deleterious mitochondrial mutation in a filamentous fungus by purely stochastic means must be fantastically low. It is for this reason that, in almost all the examples which follow, a phenomenon termed "suppressiveness" has been invoked to explain the expression of deleterious mutations (Faye et al, 1973; Bertrand et al, 1980, 1985; D e V r i e s et al, 1981; C u m m i n g s et al, 1979b; T u d z y n s k i et al, 1980; Jamet -Vierny et al, 1980; Lazarus et al, 1980; Lazarus and K i i n t z e l 1981). T h e mechanism by which altered m t D N A s become fixed in a population has not been discovered, and no hypothesis which is completely compatible with the experimental evidence has been put forward to explain the phenomenon. In short, the phenomenon suggests that some kinds of altered m t D N A s , or indeed any kind of altered m t D N A are able to out-replicate the wild type molecule, or suppress the wild-type molecules' replication, or to have some sort of advantage in partitioning of m t D N A s at cell division. Somehow, the altered m t D N A s come to predominate in the cytoplasm. While a. mechanism for this is easily envisioned for a deviant m t D N A that consists of multiple copies of the origin of replication, it is more difficult to invoke a model which would recognize a m t D N A with a single base pair change as in the case of the mi-3 mutation of N. crassa (Lemire and Nargang, 1986); both of these types of molecules have been found to be suppressive over their wild-type counterparts. A l t h o u g h mathematical models can show that even molecules with small replicative superiorities can become fixed over time ( D . Vickery , unpublished observations; Bi rky et al, 1978a), the mechanism that would recognize such molecules remains unknown. A n idea that has been presented recently suggests that local accumulation of defective m t D N A s is the event required to affect mitochondrial function 16 . Introduction and that, mitochondria with impaired respiratory pathways undergo renegade multiplication, with the concomitant amplification of the defective genome which the organelle harbours (Bertrand and Griffiths, 1989). How non-deleterious mitochondrial mutations arise in general, given that the number of wild-type copies is so high, has been researched in some detail. Experiments were designed to test the following six hypothetical mechanisms for their ability to fix a mitochondrial drug resistance marker: random partitioning of mitochondrial genomes at cell division; intracellular selection for mtDNA molecules of one genotype; intracellular random drift of mitochondrial allele frequencies; intercellular selection for cells of a particular mitochondrial genotype; induction of mitochondrial gene mutations by the antibiotic used to select mutants; and reduction in the number of mitochondrial genomes per cell by the antibiotic. These Luria-Delbruk type experiments showed that intracellular selection of mtDNA molecules played a major role in the presence of selective pressure, but that random drift and random partitioning also played minor roles in fixing the marker (Backer and Birky, 1985; Dujon et al, 1976). Random drift, and random partitioning have been shown to occur at higher than random rates in yeast mitochondria (Birky et al, 1981; Birky, 1973), so some processes may be occurring to help fix mutations. However, these results of course do not explain why detrimental mutations are so easily fixed. The system which is most amenable to the study of suppressiveness has been in the cytoplasmic petite mutations of yeast, and two hypotheses to explain the phenomenon have been put forward. These are the destructive recombination model, and the out-replication model. The explanation of these models fits properly in the context of the background on the petite mutation of Saccharornyces. 17 Introduction Petite Mutations of Saccharomyces cerevisiae Cytoplasmic petite mutations (Ephrussi et al, 1949) arise spontaneously at 1% per generation from actively growing cultures of Saccharomyces cerevisiae. Genetic studies identified a cytoplasmic, genetic factor called p that was present in wild-type (p+), but that seemed to be altered (p-), or missing (p°) in crosses (Sherman, 1963). The p factor has since, been identified to be the mtDNA (Mounolou et al, 1966), aiid p- mutants have mtDNAs with deletions (Nagley and Linnane, 1972; Hollenberg et al, 1972; Faye et al, 1973). p° mutants have no mtDNA at all. In yeast, petite mtDNAs often exist as tandem (Faye et al, 1973) or as palindromic (Locker et al, 1974) repeats, if the deletions are large. The deletions which give rise to petite mtDNAs span the entire mtDNA, so no specific region is involved (see Dujon, 1981). Although any mtDNA deletion can give rise to a petite, they are nonetheless distinguished by their behaviour in crosses. Every petite has a characteristic suppressiveness in crosses with p+. Organelle heredity is biparental in Saccharomyces, so a p-f by p- cross creates a heteroplasmic zygote, with an equal complement of p+ and p- molecules. Output ratios are far from equal however, and depend on the suppressiveness of the petite (Ephrussi and Grandcha.mp, 1965). Hypersuppressive petites are known which give rise to 100% p- progeny (Goursot et al, 1980). Neutral petites, or p°, always give rise to grande progeny, because they are entirely unsuppressive (Moustacchi, 1972). Two mechanisms have been invoked to account for these observations. The out-replication model is the most popular, and is based on a replicative advantage for the p- molecules (Slonmiski et al, 1968; Rank, 1970a; 1970b; Rank and Bech-Hansen, 1972; Carnevali and Leone, 1981). The highly suppressive molecules would have retained an origin of replication, and its multiple duplication causes the replicative superiority. This model is supported by genetic data (Gingold, 1981), and the observation that some hypersuppressive petites contain short reiterations of a sequence which resembles an origin of replication (DeZamaroczy et al, 1979). However a direct 18 Introduction study of the relative rates of DNA synthesis in p+ by p- crosses has suggested that only the most suppressive petites have a faster rate, of DNA synthesis, and some non-suppressive petites also seem to have elevated rates of DNA synthesis (Chambers and Gingold, 1986). Further, the requirement for an origin of replication in the amplified sequence may not. always be met. Therefore the possibility remains that the destructive recombination model may also play a role in the phenomenon. The key idea in this model is that the presence of a p- molecule can cause crossovers which lead to the destruction of the wild type DNA (Coen et al, 1970; Michaelis et al, 1973; Deutsch et al, 1974; Perlman and Birky, 1974). Crossovers between mtDNAs of Saccharomyces are well documented (for a review, see Dujon, 1981), and N. crassa mtDNA is also known to undergo recombination in heteroplasmons (Mannella and Lambowitz, 1978), therefore the recombinant machinery necessary for this model is available, but the model does not account for all observations. The actual process which is occurring to cause suppressive behaviour may be a combination of mechanisms. For instance, one possibility is that as has been suggested for N. intermedia, mitochondria that have a high proportion of defective molecules may undergo renegade replication, so selection is at the organelle level, not the DNA level (Bertrand and Griffiths, 1989). At any rate, suppressiveness of altered mtDNAs seems to be a general phenomenon, rather than a specific one. The ragged mutation of Aspergillus amstelodamii A. amstelodamii was found to have a cytoplasmically inherited growth aberration that caused death of hyphal tips ("ragged" colony morphology; Jinks, 1956). The site of the lesion is the mtDNA, and it is found as a heterogeneous mixture of a tandemly repeated element and a full copy of the wild type mtDNA (Lazarus et al, 1980). This situation is analogous to the deletion/duplication seen in the petites, except for the presence of a normal copy of mtDNA; presumably this molecule is lost as the culture ages. Analysis of mtDNA from a number of 19 Introduction spontaneous ragged mutations has yielded regions of the m t D N A that are retained in the mutations. O n e region of the m t D N A is found in the tandemly repeated fragment of almost all ragged mutations. It is postulated to contain a m t D N A origin of replication which when tandemly duplicated bestows a great replicative advantage on the aberrant ragged m t D N A s . However, the presence of ragged m t D N A s which do not contain this sequence and instead are found to have a different region of the m t D N A amplified (Lazarus and K i i n t z e l , 1981) suggests that the mechanism of over replication of aberrant m t D N A s may be a more general one, as has been suggested for the petites. Senescence in Podospora anserina T h e phenomenon of programmed senescence has been studied most thoroughly in the ascomycete Podospora anserina. Historically, P. anserina was shown to be incapable of uninterrupted growth, and instead changes in mycelial morphology and the production of pigments preceded cellular death in the organism (Rizet, 1953; M a r c o u , 1961). T h e predisposition to senescence was found to be heritable, and further, that the state of senescence was maternally inherited: a juvenile female parent gave rise to juvenile progeny, while a senescent, female parent gave, rise to mixtures of senescent and juvenile progeny (Rizet, 1957; M a r c o u , 1961)..Senescence determining factors were found to be heterogeneous (Marcou, 1961), and independent of nuclear markers in crosses (Marcou and Schecroun, 1959). In an exhaustive study of the genetics of aging, all strains or races of Podospora were found to have a distinctive lifespan, the cytoplasmic nature of the particle was shown by its transmission without nuclear migration, and it was postulated that a "longevity character" would be found to exist ( M a r c o u , 1961). T h e mitochondrial location of the senescence genotype was suspected because of the mitochondrial location of mutations that had a modifying effect on longevity (Belcour and Begel, 20 Introduction 1978), and this led to the discovery of senDNAs. These are small DNA plasmids which were found in the mitochondria of senescent mycelia in place of the 94 kb wild type mtDNA (Stahl et al, 1978; Cummings et al, 1979a; 1979b). Also, it was shown that the wild type mtDNAs of juvenile cultures of races with similar lifespans were closely related and correlated with longevity (Cummings ei al, 1979a). This led to the suggestion that the phenomenon of senescence in Podospora was a special case of the petrte phenotype of Saccharomyces in an organism which was an obligate aerobe (Cummings et al, 1979b). At the. same time, an interesting body of work was being assembled on the ability of nuclear genotype to influence lifespan. The action of many of these genes seems to be to delay the onset of senescence. The most interesting observation is that the genes involved affect colony morphology, and their action upon the mitochondrial genome is unknown. A certain colony morphology double mutant, • incoloris vivax, is able to prevent senescence, even when senescent mitochondria are microinjected into a strain carrying the mutation (Esser and Tudzynski, 1979). The molecular nature of the suppression has not been investigated, but these results indicate that the action of nuclear genotype cannot be ignored in any discussion of mitochondrial growth aberration. Five different families of senDNAs, based on restriction properties, have been identified from different races of Podospora. The are designated a, (3, ^ , b, and ©. otsenDNA, the most common one, is always found as an exact molecule of 2.6 kb, and is isolated from the two shortest lived races of Podospora, race A and race s (Stahl et al, 1978; Cummings et al, 1980; Jamet-Vierny et al, 1980; Wright et al, 1982). senDNAs were subsequently cloned (Stahl et al, 1980), and it has been shown that they are derived from mtDNA (Kiick et al, 1981) and that they are senescent determinants (Vierny et al, 1982). The structure of senDNAs has been found to be similar to that of petites, in that the remaining portion of the mtDNA is often arranged in tandem repeats (Belcour et al, 1981; Cummings and Wright, 1983). As in the case of hypersuppressive petites, senDNAs have been 21 Introduction postulated to contain an A R S , which allows them to out-replicate the m t D N A (Lazdins and C u m m i n g s , 1982). Figure 3 shows the regions of the mitochondrial chromosome of P. ansenna which give rise to s e n D N A s of each type. In contrast to the Saccharomyces system where any segment of m t D N A can become amplified, only the five regions shown in figure 3 can give rise to the senescent phenotype in P. ansenna. W h i l e the locations of the various s e n D N A s were known, the surprise result f rom the study of this system has been the discovery that a - s e n D N A corresponds exactly to the mitochondrial group II intron of the C O I gene of P. ansenna (Osiewacz and Esser, 1984). T h e reader is reminded that mitochondrial class II introns contain O R F s which encode proteins with homologies to viral reverse transcriptases, and the intron of P. ansenna is no exception. Indeed all of the s e n D N A events include class I or class II intron sequences (Cummings et al, 1985; M i c h e l and C u m m i n g s , 1985), but. only the a s e n D N A is an exact intron which has no homology to the mature transcript of the region (Kiick et al, 1985a). T h e question that then arises is exactly what is the relationship between the s e n D N A s and the intron sequences. B o t h a s e n D N A and p s e n D N A long-life mutants are rearranged or deleted for intron sequences (Kiick et al, 1985a: Belcour and Vierny , 1986; K o l l et al, 1985), suggesting that sequences in the regions are required for amplification/excision. However, it is not. known whether the s e n D N A is generated from the precise excision of the D N A intron, and its subsequent amplification, or whether s e n D N A s arise by reverse transcription of the excised intron of the C O I gene. Evidence seems to suggest that at least some stage of the process is a reverse transcription step. There is reverse transcriptase activity in Podospora senescent mycelia of OisenDNA strains (Steinhilber and C u m m i n g s , 1986), and a full length transcript which may be circular is present at high levels in senescent mycelia, providing the necessary template for reverse transcription (Kiick et al, 1985a). However, the presence of mitochondrial mutants which have lost 22 Introduction the intron seems to suggest that removal of the intron occurs at the DNA level (Belcour and Vierny, 1986). 23 Introduction Figure 3. Composite Map of the Podospora anserina Mitochondria] Chromosome Showing Events Which Give Rise to senDNAs I-Restnction map from Wright et al (1982). II-Genes: COB for cytochrome b; C O l , C02, and C03 for subunits 1, 2, and 3 of cytochrome oxidase; A6, A8 and A9 for subunits 6, 8, and 9 of the mt-ATPase; rRNAG and rRNAp for large and small rRNAs; URF1 for a subunit of NADH dehydrogenase; ? for a still unknown gene; ! for tRNAs. White parts of genes marked by I are intronic sequences. III-Sequenced regions. IV-Positions of senDNAs. From Belcour et al (1986). E c o R l 6b 12 Ba 0 21 5 IK.1«HVfl'°HH'H ' l«E3 5 P.V'B ia"K!5%j cob c o l f AS coT AS U H F t AS ri Ha«m RNAC rRNAp co3 (Y) (0) 24 Introduction The molecular mechanisms required for the excision of senDNA are beginning to be described. An 11 bp consensus sequence has been described which seems to be important for the excision of all of the senDNAs except otsenDNA, and the identification of a tRNA requirement in this region is reminiscent of the reverse transcription of the Neurospora Varkud plasmid (Turker et al, 1987a; Akms et al, 1989). That asenDNA production follows autoregulatory kinetics has been shown by the isolation of a temperature sensitive asenDNA, and senDNAs in general may be produced by the reverse transcription of RNA by the asenDNA-encoded reverse' transcriptase (Turker et al, 1987b). A (3senDNA has been found to encode a protein reminiscent of an ssDNA binding protein, and it has been suggested that senescence is a result of the over production of proteins which can interact with nucleic acid (Vierny-Jamet, 1988). It appears as though the senescence phenomenon in Podospora anserina may be a special case of the evolution of mitochondrial introns and mobile mitochondrial introns such as the Neurospora mitochondrial plasmids (Nargang et al, 1984; Akins et al, 1989; Pande et al, 1989), and further work should highlight the parallels between these systems. Yet it is apparent that the presence of the intron is not sufficient for the senescence process to occur. The asenDNA intron is not an optional intron of P. anserina, and is present in many different races which have never given rise to asenDNA (Kiick et al, 1985b). Further, the two races of P. anserina which give rise to otsenDNA, races A and s, differ only by other optional introns in the CO I gene, including another very similar group II intron. Although the second intron has not been found to give rise to a senDNA, it has been suggested that the second intron functions as a modifying sequence which is responsible for the two-fold difference in the lifespans of race A and race s. This information and the role that nuclear factors are playing (Esser and Tudzynski, 1979) must be considered when determining the role that senDNAs play in the phenomenon of senescence in Podospora anserina. 25 Introduction Mitochondrial Mutation in Neurospora The first cytoplasmic mutation of N. crassa to be identified was poky (Mitchell and Mitchell, 1952), and its discovery was quickly followed by the discovery of other cytoplasmic mutations such as mi-2 and mi-3 (Mitchell et al, 1953). Subsequently, the mitochondrion was found to be responsible for the phenotypes by microinjection experiments, and the mtDNA was suspected as the site of the lesion (Diacumakos et al, 1965). The next group of extranuclear mutants to be identified was the stopper group. These were spontaneously isolated by growing N. crassa continuously on specialized 500mm growth tubes for months at a time and cultures which demonstrated stopped or slowed growth were isolated as stoppers (Bertrand et al, 1968; Bertrand and Pittenger, 1969).The numerous mitochondrial mutants which were being identified at this time were found to belong to complementation groups based on phenotypic properties, behavior in heteroplasmons, and interaction with nuclear suppressors of mitochondrial mutations (Bertrand and Pittenger, 1972a; 1972b). These fell into four groups; groups I, II, and III are described below. The fourth group consists of a single mutation that is not a growth aberration, but that is resistant to cyanide (Bertrand et al, 1976). Group I All group I mitochondrial mutants have similar phenotypes, including deficiencies in small ribosomal subunits (Rifkin and Luck, 1971), in small rRNA (Neupert et al, 1971), and in cytochromes aag and b (Haskins et al, 1953). The prototype member of the group I mutants is poky. All group I mutants are suppressed by a nuclear suppressor called /. These mutants have an initial growth lag which is replaced by near wild-type growth as a culture ages. All group I mutants are phenotypically normal in heteroplasmons with group III mutants, but not with group II mutants. 26 Introduction Lesions which give rise to pokys seem varied, although all seem to lead to deficiencies in small r R N A or small ribosomal subunits (Collins and Ber t rand, 1978; Lambowitz et al, 1979; Collins et al, 1980). In the identification o f six nuclear suppressors of poky, all were found to promote the assembly of the missing ribosomes (Bertrand and K o h o u t , 1977; K o h o u t and Ber t rand, 1976). T h i s has led to the idea that al! group I mutants affect a single process, or function, perhaps the 19S r R N A , and that all suppressors of group I mutants affect small ribosomal subunits, (Collins and Bertrand, 1978). Recently it has been shown that all pokys, regardless of their origin and in addition to any other mutations they have, contain a 4 bp deletion near the 5' end of the 19S r R N A , and that this deletion causes an aberrant 19S r R N A to be synthesized which is 38-45 nucleotides shorter than the wild type (Akins and Lambowitz , 1984). A p p a r e n t l y this small deletion is enough to cause these molecules' well documented suppressiveness over wild type m t D N A . T h i s represents an interesting case of genetic data (the identification of a complementation group) being shown to be correct in the face of conflicting molecular data (group I mutants were originally found to have many molecular defects, which now appear secondary). T h e mechanism of poky action has been hypothesized to be the impairment of transcription of the small r R N A , as the 4 bp deletion has been found to occur in the promoter sequence for the 19S r R N A gene (Kennel and Lambowitz , 1989). Group II G r o u p II mutants are characterized by deficiencies in cytochrome aag, and complement only group III mutants completely. T h e y are suppressed completely by the nuclear suppressor, su-l([mi-3}) (Bertrand and Pittenger, 1972a; 1972b). O n l y two members of this class are known: mi-3 and exn-5 (Bertrand et al, 1976). T h e molecular defect in mi-3 has been identified as a missense mutation in the oxi-3 gene (Lemire and Nargang, 1986). 27 Introduction Group III The group III mutants are the stoppers. As their name suggests, they are distinguished by alternating periods of growth and no growth in 500 mm growth tubes. They are deficient in cytochromes aag and b, and they complement both group II and group I mutants (Bertrand and Pittenger, 1979a; 1979b). Again, the molecular lesions in various stoppers have been found to be varied, however all stoppers have been found to have deleted mtDNAs which retain a large region that includes the Eco R l - 1 , -4, and -6 fragments of the m t D N A . This region contains the r R N A genes and most of the t R N A s , and has been postulated to contain an origin of replication (Bertrand et al, 1980; Collins and Lambowitz, 1981; DeVries et al, 1981). The retained regions of the mtDNAs from a number of cytoplasmic mutants including stoppers are shown in figure 4. 28 Introduction Figure 4. Regions of the m t D N A Retained in Various Mitochondrial Mutants of Neurospora Restriction cleavage map of N. crassa DNA is presented. The regions of the mtDNA retained in a number of cytoplasmic mutants are shown as dark lines. The N. crassa mtDNA restriction map for the enzymes Hind III, Eco R l , and Hinc II is shown. The cytoplasmic mutants are as follows: E-35 and [stp] are group III mutants (stoppers). 551 and Hl-10 are group I mutants (poky). The 19S and 25S rRNA genes are indicated, and tRNAs are shown as dots. From Collins and Lambowitz (1981). E35 2 9 Introduction Stoppers often contain more than one type of mtDNA molecule. One mutant, \stp], has been found to contain two populations of mtDNAs, a 21 kb molecule that spans the region mentioned above, and a 43 kb molecule that is complementary to the rest of 65 kb mtDNA. During the stop phase of growth only the 21 kb molecule can be detected, however upon resumption of growth, the larger molecule appears, thus stopper growth has been described as the ebb and flow of the different mitochondrial types as a culture ages (Bertrand et al, 1980; Gross et al, 1984). If this is true, then it would appear as though molecules which are capable of generating group III mitochondrial mutants are not as highly suppressive as those that never allow the resurrection of the wild type mtDNA, or that they are more damaged and other DNA is retained to support growth. Two other stopper mutants have been studied extensively. The E-35 mutant contains two molecules with 4 and 20 kb deletions (DeVries et al, 1981), which seem to arise via a sequence specific event. The region that is deleted to form the molecule with the 4 kb deletion has been postulated to contain the gene for a subunit of NADH dehydrogenase in Neurospora mitochondria (DeVries et al, 1986). Another stopper, ER-3, has a mtDNA molecule with a 25 bp deletion which seems to occur via the same sequence specific mechanism as E-35 (Almasan and Mishra, 1988). Therefore the mechanism by which stoppers form may be a specific one in Neurospora. crassa. SENESCENCE IN NEUROSPORA INTERMEDIA Mitochondrial D N A A survey of natural field isolates of Neurospora interme&ia from the Hawaiian islands by Reick et al, 1982 yielded five strains which were cytoplasmic variants, having cytochrome aag and b deficiencies, aberrant ribosome morphology and abnormal growth profiles in 500mm race tubes. Their striking phenotypic resemblance to the stopper cytoplasmic mutants of laboratory strains of N. 30 Introduction crassa (Bertrand et al, 1968; Bertrand and Pittenger, 1969) suggested the possibility that these were natural group III cytoplasmic mutants, and that, the cause of the abnormality was mtDNA rearrangements (Bertrand et al, 1980; De Vries et al, 1981; Gross et al, 1984; Infanger and Bertrand, 1986). A comparison of the mtDNAs from the TV. intermedia strains did indeed show differences in the restriction maps for aberrant and normal strains (Reick et al, 1982). The lack of paternal inheritance of the phenotype suggested the mtDNA as the site of the primary lesion in these natural cytoplasmic variants. Although only five of the Hawaiian strains were shown previously (Reick et al, 1982) to have an abnormal phenotype, subsequent use of the serial subculture technique showed that a high proportion of the natural isolates of TV. intermedia from the island of Kauai had a senescent phenotype, and could not be subcultured indefinitely. The phenotype was shown to be strictly maternally inherited, and it was shown that the Hawaiian phenotype differed somewhat from the classic stopper phenotype, in that juvenile cultures of a senescent strain, whether initiated from conidia or from an ascospore, were phenotypically normal. However, upon subculturing, these strains showed a. progressive loss of growth potential culminating in the death of affected strains. The process leading to the vegetative death of these organisms was termed senescence. The process was repeatable, in that duplicates of cultures initiated from a common culture always were capable of a defined number of subcultures before death. Further, it was shown that the changes occurring in the cytoplasm throughout this process are heritable, and that the progeny of a senescent parent had less growth potential than the progeny of a presenescent parent. During the changes, the cytoplasm was found to be heterogeneous for some undetermined determinate of senescence. The phenomenon of senescence among a high proportion of natural isolates of TV. intermedia from the island of Kauai was termed kalilo, a Hawaiian word meaning 'dying', and affected strains were termed kalilo strains (Griffiths and Bertrand, 1984). 31 Introduction The mitochondria] lesion in kaiilo strains was found to be the insertion of a foreign nucleotide sequence into the mtDNA, specifically into the intron of the 25S rRNA gene in prototype strain P561. The 8.6 kb transposon-like element was termed kalDNA and non-senescent strains of the fungus from the island of Kauai were not found to contain sequences which were homologous to the element. Mitochondrial chromosomes carrying the insert are thought to accumulate as a culture ages until aberrant mtDNAs dominate the cytoplasm. Sites of insertion of kalDNA were found to differ not only between senescent strains, but between senescent subcultures of individual strains. Therefore, the process which causes the accumulation of defective mtDNAs is not suspected to be unique to kaiilo senescence (Bertrand et al, 1985). This is the suppressive accumulation of defective mtDNAs seen in many experimental systems such as yeast petites (Faye et al, 1973; Locker et al, 1974), Neurospora (Bertrand et al, 1980; De Vries et al, 1981), and Aspergillus (Lazarus et al, 1980; Lazarus and Kiintzel, 1981). The Linear Plasmid An 8.6 kb linear autonomously replicating plasmid was found to be the progenitor of the mtDNA insertion sequence in affected strains. The plasmid is structurally identical to the mitochondrial insertion sequence and was found to be present in high copy numbers in the cytoplasm of senescent and presenescent strains. The autonomous plasmid, like the disposition to senesence, was found to be strictly maternally inherited. It was suggested that the element was responsible for senescence because it was a mutator of mitochondrial genes, creating suppressive mtDNAs which could out-replicate wild-type mtDNA, and cause the death of affected strains. Although the plasmid was initially thought to be nuclear (Bertrand et al, 1986), it now appears as though the phenomenon is strictly mitochondrial (Myers et al, 1989). The inserted form of the 32 Introduction plasmid has been designated mtlS-kalDNA (Bertrand et al, 1986), and the linear form has been designated mtAR-kalDNA (Myers et al, 1989). A restriction map of k a l D N A is presented in figure 5. Interestingly, studies on the transmission of kalilo during sexual crosses have shown that when a presenescent culture is used as a female parent in a cross, the only form of kalilo which is found to be transmitted is mtAR-kalDNA, mtlS-kalDNA is never seen in the progeny. During somatic propagation of these cultures, inserts of kalilo arise, and generally persist until death. However, inserts are seen that are not lethal, and instead seem to be replaced by novel inserts that persist until the death of the organism. It has been suggested that inserts arise from de novo integration of mtAR-kalDNA into the mitochondrial chromosome, and that novel inserts which are seen, based on the altered size of junction fragments in Southern analyses, arise either from rearrangements of preceding inserts, from novel insertion events, or from the transposition of mtlS-k a l D N A (Myers et al, 1989). The kalilo plasmid has now been completely sequenced. It is 8632 bp in length, with perfect inverted repeats of 1361 bp. The A:T content is 69.9%. The plasmid encodes no O R F s of appreciable size which can be read in the universal genetic code, however in mitochondrial genetic code, where the codon T G A is read as tryptophan instead of as a termination signal (Anderson et al, 1981), kalilo is found to encode two large ORFs, running in opposite orientation, of 893 and 811 aa. The larger O R F shows critical aa homologies to the putative D N A polymerases of bacteriophage 4)29, the S-l plasmid of maize, and certain other viral D N A polymerases. The smaller O R F encodes a putative R N A polymerase which shows aa homology to the T3 and T7 R N A polymerases, and to the putative R N A polymerase of the S-2 plasmid of maize. Finally, the codon usage of the kalilo O R F s has suggested that kalilo may be ancient and may have coevolved with mitochondria. (Chan et al, 1989b). 33 Introduction Figure 5. Restriction Map of Kaiilo Restriction map of kaiilo D N A showing the X b a I (X), Eco R l (E), Bgl II (B), Hind III (H), and K p n I (K) restriction sites. The fragments created from the digestion of linear kaiilo D N A with the enzymes X b a I, Eco R l , Bgl II, and Hind III are shown. The fragments are named and are referred to in the text as such. Some of the probes used in the thesis are referred to in this way, thus, X3, is the cloned fragment X3, pDV-X3. More information on probes is presented in the materials and methods (figure 10). The 1361 bp terminal repeats of the element are shown by the inverted arrowheads. Kaiilo is 8632 bp long. The locations of the two O R F s are shown. O R F 1 potentially encodes a D N A Polymerase, and O R F 2 potentially encodes an R N A polymerase. 34 Introduction The insertional behaviour of kalilo has been studied, and it has yielded some interesting observations. A l l insertions of kalilo which have been studied show a pentanucleotide match somewhere within the last approximately 20 bp of kalilo and the mtDNA. Integration of the plasmid is via an unusual mechanism which creates long inverted repeats in the m t D N A at the site of insertion. A molecule of this type, illustrating mtAR-kalDNA and mtlS-kalDNA is shown in figure 6. The long inverted repeats of m t D N A are shown, although it is not known how extensive they are. The mechanism is not known, but production either by recombination or by unique insertion regimens have been hypothesized (Bertrand, 1986; Chan et al, 1989a) The structure of the mitochondrial D N A in senescent cultures is not known, but it is known that the m t D N A of many senescent strains has undergone deletions and rearrangements (Bertrand et al, 1985, 1986; Myers, 1988; Myers et al, 1989; Chan et al, 1989a). The m t D N A may be heterogeneous and may consist of any or all of the following: wild-type circles, deleted circles, and linear mtDNAs. A further possibility is that the m t D N A may exist, as terminally inverted concatameric circles joined by inserts of mtlS-k a l D N A (Chan et al, 1989a; Bertrand, 1986). A summary of kalilo insertion sites is shown in figure 7. Another plasmid, called maranhar, that was found in a. senescent, strain of N. crassa, is functionally identical to kalilo. It is a 7 kb linear plasmid with .7 kb terminal inverted repeats (TIRs), which causes senescence by insertional mutagenesis of the m t D N A creating molecules which are suppressive over wild-type m t D N A s and can lead to the death of the organism. Maranhar causes the similar m t D N A rearrangements upon insertion, and has O R F s which encode proteins with aa homologies to the kalilo ORFs. Both have blocked 5' termini, due presumably to the covalent attachment of protein to the ends of the DNA. The two plasmids, however, show no homology at the nucleotide level (Court et al, 1988; Dasgupta et al, 1988; Griffiths and Bertrand, unpublished 36 Introduction observations). Finally, the plasmids are capable of coexisting in a common cytoplasm, so they do not compete with one another, suggesting that they have unique origins (Griffiths et al, 1989). 37 Introduction Figure 6. Model for the Insertion of Kalilo Into the m t D N A mtAR-kalDNA, the free linear plasmid, is represented as a linear d s D N A with terminally attached proteins. It is shown inserting into the m t D N A at a point between markers c and d. After insertion, the m t D N A is represented as a long inverted repeat, and mtAR-kalDNA has become mtlS-kalDNA, the mitochondrial insertion sequence. The length of the these structures and the ultimate structure of the senescent m t D N A molecules are not known, and have been represented by the dotted lines. 38 •tAR-kaDNA i t D N A a b c ItttS-kaPNAl c b a 39 Introduction Figure 7. Previously Identified Insertion Sites of mtlS-kalDNA A restriction map of the mtDNA of Neurospora intermedia showing the sites of insertion of kalDNA in different strains, designated by the lines. An Eco R l , Hmd III, and Bgl II map are shown. The positions of some of the mitochondrial genes are presented. The filled-in boxes represent the exon regions of each gene and the lines represent intron sequences. The mitochondrial tRNAs are indicated by dots. Sites marked with thin lines and sites marked with thick lines have been identified by Bertrand (1986), and Myers (1988), respectively. Sites marked with hollow lines were identified in both reports. The location of the N. crassa mtDNA clone Hind 111-13, 18, is shown at the bottom of the figure. Map is redrawn from Myers, (1988), Bertrand et al, (1985), and Bertrand (1986). 40 Introduction 41 Introduction REVIEW OF LINEAR PLASMIDS Definition Kai i lo , it appears, is another member of a growing, but as yet poorly understood group of linear double-stranded D N A plasmids. These plasmids are characterized by T I R s of varying length, and by proteins covalently attached to the 5' ends of the D N A . D N A species of this type have been studied most thoroughly in the adenoviruses, and in the Bacillus bacteriophage, 4>29. T h i s unique end structure, with the covalently attached proteins, is necessary for the maintenance of the ends of the D N A (telomeres), and it serves to initiate the novel D N A replication scheme of these viruses. T h e model is shown in figure 8. T h e terminal protein can interact with D N A polymerase and other proteins to prime replication of the D N A ; the structure, is responsible for placing the first nucleotide and generating a 3' hydroxyl group for extension by D N A polymerase (for a review of the Adenovirus , see Challberg and Kel ly , 1982; or Sti l lman, 1983; for a review of cl>29 replication, see Salas, 1988). T h i s D N A maintenance scheme was once thought to be quite unique, found only in these two viruses, but now a number of bacteriophage and plasmids with the structure are beginning to be identified and might share the same mode of replication. These plasmids have been found in a multitude of organisms, although none have been described for higher non-photosynthetic. eukaryotes. 42 Introduction Figure 8. Model for the Replication of Linear D N A s Model for the replication of virus DNA. The terminal protein is represented by a filled in circle, the DNA polymerase is represented by an open triangle, dsDNA is represented by parallel solid lines, and ssDNA which has been protected by a single stranded DNA binding protein is represented by the shaded regions. Step 1: The viruses initiate replication when the terminal protein and the DNA polymerase associate with other factors, including nucleoside triphosphates and virus-encoded replication factors. Step 2: The non replicating strand of the DNA becomes bound with a ssDNA binding protein, which in the adenovirus is also a transcription factor. The "Y" shaped structure is a type II replication intermediate. Step .3: completion of DNA replication yields a newly synthesized virus, and ssDNA bound with ssDNA binding protein. Step 4: The circular DNA shows that a single strand of the virus DNA is sufficient for DNA replication to occur due to the presence of the TIR. The inverted repeats hybridize, generating the end structure for initiation of replication. Step 5: The linear structure is a type II replication intermediate, type I and type II replication intermediates have been identified by electron microscopy. Redrawn from Stillman (1983), and Salas (1989). 43 Introduction Step Is Initiation of transcription J^x. Nativa Linaar Pla/mid \ + • and othar factor/ + I l l l l l l l l l l l l l l Step 2: Type 1 Replication Intermediate | JJcdt0£hftr Extension o-f nascent DNA, and protection of ssDNA by ssDNA binding protein 1 Step 3: * = Replication products: i_ Newly synthesized linear form, and protein bound ssDNA IIIIIIIIIIIIIIIIIIIIIIIIIIIII 1 . • arid othar Step 4: D- factor; ssDNA circularizes at inverted repeats to generate end structure for initiation of DNA replication Step 5: Type II Replication Intermediate J extenlon°n * o iiiiiiiiiiiimniiiiini I Step 6: Newly synthesized linear * form 44 Introduction It is apparent that D N A s of this type are common and may be ubiquitous. In some instances the late discovery of many of these elements may have been an artifact due to the trouble that many groups have reported in isolating these plasmids; many groups report that little or no plasmid is seen unless a proteinase K step is inserted in the D N A isolation protocol prior to phenol/chloroform extraction of protein (Meinhardt et al, 1986; Wlodarczyk and Nowicka, 1988; Diivell et al, 1988; Meyer et al, 1988; Chardon-Loriaux et al, 1986; Keen et al, 1988; Erickson et al, 1985; Kinashi and Shimaji, 1987), or centrifugation of nucleic acids through guanidium hydrochloride may be required (Kitada and Hishinuma, 1987). It seems that the 5' terminal protein is capable of causing precipitation of the plasmid in steps designed to remove protein during these D N A isolations. This seems to be the cause of the confusion as to the cellular location of the kalilo plasmid (compare Bertrand et al, (1986), and Myers et al, (1989)). A n extensive literature search for linear D N A elements has turned up examples in almost every kingdom except the higher non-photosynthetic eukaryotes. The elements are presented in table 1. 45 TABLE 1. SURVEY OF LINEAR DOUBLE-STRANDED DNA ELEMENTS. N A M E OF TYPE OF SIZE KNOWN SPECIES E L E M E N T 3 ELEMENT in kb c STRUCT. REFERENCE Agaricus bitorquis pEM mtpl 7.4 all Meyer et al, 1988 pMPJ mtpl 3.7 I Ascobolus immersus pAl unkwn 6.4 l,ir Francou, 1981 pAIl unkwn 7.9 1 Meinhardt et al, 1988 pAI2 unkwn 5.6 all several unkwn 2-20 1 Francou et al,, 1987 Bacillus spp. 029, 015 virus •18 all Yoshikawa et al, 1981 M2Y, Nf virus '"20 all GA-1 virus 18.0 all Botrytis cinerea several unkwn 2-3 1.P Hiratsuka et al, 1987 Brassica spp. mtpl 11.3 all Palmer et al, 1983 Ceratocystis fimbriata pCF637 • unkwn 8.2 l,tp Giasson and Lalonde, 1987 pFQ501 mtpl 6.0 Lir Normand et al, 1987 Claviceps purpurea pClKl mtpl 6.7 all Diivell et ai, 1988 several mtpl 5-10 all Escherichia coli P R D e virus 14.0 all Savilahti etc. Fusarium oxysporium pFOXCl mtpl 1.9 Up Kistler et al, 1987 pFOXC2 mtpl 1.9 1 pFOXC3 mtpl 1.9 1 Fusarium solani pFSCl mtpl 9.2 all Samac and Leong, 1988 pFSC2 mtpl 8.3 all Gaeumannomyces graminis E l mtpl 8.4 1 Honeyman and Currier, 1986 E2 mtpl 7.2 1 Kluyveromyces laclis K l cytpl 14.0 all Gunge et al, 1981 K2 cytpl 9.0 all Morchella conica unkwn 6.0 l,ir Meinhardt and Esser, 1984 several unkwn 1-10 1 Neurospora crassa maranhar mtpl 7.0 all Griffiths et al, unpublished Neurospora intermedia kalilo mtpl 8.6 all Myers et al, 1988 zhisi mtpl 7.0 Up Griffiths pers. comm. Pleurotus ostreatus pLPOl mtpl 10.0 Up Yui et al, 1988 pLP02 mtpl 9.4 UP Rhizoctonia solani pRS64 unknwn 2.6 1 Hashiba et al, 1984 Saccharomyces kluyveri pSKL cytpl 14.2 all Kitada and Hishinuma, 1987 Sorghum bicolor N l mtpl 5.7 all Pring et al, 1982 N2 mtpl 5.3 all mtpl 4.2 1 Baszczynski and Kemble, 1987 Streptococcus pneumoniae C P e virus -20 all Escarmis et al, 1985 Strepiomyces rochei pSLAl cytpl 17.0 all Hirochika et al, 1984 pSLA2 cytpl 17.0 all S. rimosus pSRM cytpl 43.0 UP Chardon-Loriaux et al, 1986 S. clavuligerus cytpl 12.0 all Keen et al, 1988 Thiobacillus versutus cytpl 3.2 I-P Wlodarczyk and Nowicka, 1988 Tilletia controversa pTCT unkwn 7.4 1 Kim et al, 1988 Zea diploperennis D l mtpl 7.5 all Timothy et al, 1984 D2 mtpl 5.3 all Zea mays S-l mtpl 6.2 all Pring et al, 1977 S-2 mtpl 5.2 all S-3 mtpl 2.3 all Bedingerer a/, 1986 R-l mtpl 7.5 all Weissinger et al, 1982 R-2 mtpl 5.4 all Adenoviruses several virus "50.0 all Doerfler, 1987 ^The plasmid name is given if available, dashes indicate that the plasmid is unnamed. The designation several suggests that many of the indicated .linear elements are found. "The designations ate as follows: mtpl refers to elements which exist as mitochondrial plasmids; cytpl indicates that the plasmid is not found in the mitochondrion, and may be nuclear or cytosolic; unkwn indicates that the cellular location has not been discovered; virus is self explanatory. csizes are given in kb. Where more than one element is indicated, a range of sizes has been given. For the virus families, an approximate size of a . member is given "Plasmids have three structures: codes are I, linear; p, terminal protein; tp, terminal protein attached 5'; i, inverted repeats; all designates the plasmid has all of these structure elements. Cinriiratrj: (hat a family of elements with similar structures and nucleotide homologies exists. 46 Introduction Prokaryotes The following are some examples of linear double stranded DNA plasmids that have been described in prokaryotes. Many bacteriophages with the structure have been described in addition to 4>29. The Cp-1 family are a group of pneumoccocal phages that bear resemblance to the prototype member Cp-1. Cp-1 is an 18 kb phage with an 28 kD protein covalently attached to the 5'ends of the DNA (Garcia et al, 1983), which has an 236 bp TIR (Escarmis et al, 1984). Cp-5, -7 and -9 are morphologically similar phages which do not have similar restriction maps (Lopez et al, 1984). Cp-5 has terminal repeats of 343 bp, and Cp-7 has terminal repeats of 347 bp, the initial nucleotides of which are highly homologous to those of Cp-1 (Escarmis et al, 1985). The proteins of Cp-1 and Cp-5 are closely related, while those of the Cp family differ from that of <i>29 (Escarmis et al, 1985). Since the identification of a terminal protein associated with Bacillus sub tilts phage 4>29 (Harding et al, 1978; Ito, 1978; Salas et al, 1978; and Yehle, 1978), this bacterium has been found to harbour a number of bacteriophages whose TIR homologies and tryptic terminal peptide maps divide them into groups, although the phages do not share similar restriction maps. Group A includes 4>29 and cb 15, which have identical 6 bp TIRs (Escarmis and Salas, 1981; Yoshikawa et al, 1981). Group B phages, M 2 and Nf, share 8 bp TIRs, which include the sequences of the Group A TIRs. A final phage, GA-1 , which has a. 7 bp TIR, forms group C (Yoshikawa. and Ito, 1981). All the phages, including the Cp family and the S-2 plasmid of maize, have the identical sequence A A A at their termini (Escarmis et al, 1985). An E. coli phage family, the PRD phages, also have the <f>29 structure and weak terminal sequence homologies to d>29, although the phages are fundamentally different (Bamford et al, 1983; Savilahti and Bamford, 1986). Streptomyces strains seem to harbour a number of the linear plasmids. The first plasmids to be identified were pSLAl and pSLA2, closely related plasmids of 17 kb from Streptomyces rochei (Hayakawa et al, 1979; Hirochika and Sagaguchi, 1982). They have 614 bp terminal repeats which are G:C rich, and contain a number of palindromic 47 Introduction elements (Hirochika et al, 1984). The plasmid may encode antibiotics made by this strain (Hayakawa et al, 1979). Streptomyces rvmosus is found to contain a 43 kb plasmid with the structure (Chardon-Loriaux et al, 1986). Streptomyces clavuhgerus houses a 12 kb plasmid (Keen et al, 1988). A number of strains of Streptomyces have been found to contain large plasmids by the OFAGE technique, although the identification of their terminal structure is still incomplete (Kinashi and Shimaji, 1987). Finally, a linear plasmid has been found in the archaebacterium, Thiobacillus versutus, of 3.2 kb (Wlodarczyk and Nowicka, 1988). 48 Introduction Figure 9. Structures of Some Linear Plasmids Part A is redrawn from Paillard et al (1985), and shows the S-l and S-2 maize mitochondrial plasmids. The TIRs, of 208 bp are indicated by the dark squares. Homology between S-l and S-2 is shown by thick lines. ORFs are as shown. Part B is redrawn from Levings et al (1982). The recombinant event which is thought to give rise to S-2 is shown. The numbers are sizes in kb. TIRs are represented by the dark squares at the ends of the DNA. Part C is redrawn from Sor and Fukuhara (1985). The compact organization of the plasmid is illustrated. The transcripts of the. plasmid are shown, and the ORFs are open boxes within the. transcripts. 5' and 3' untranslated sequences are presented as hatched boxes. The TIRs are shown as dark squares. 49 fl ZEftJMfiVS PLASMIDS Introduction S-1 6397 bp JPN/ i pol 929 go> S-2 5453 bp | R N 4 pol 1171 gg > 39ftft B R-1 7.5 kb R-2 5.4 kb S-2 6.3 kb 4.9 3.9 4.9 2.6 X 1.5 1.5 C KLUVVEROMVCES LftCTIf i kt 8874 bp tOAfin g|oN4pol 998gaM kilter to*in i i 4 6 a a _ ft jp**]l 50 Introduction Plants Plasmids in Male Sterile Lines A number of plasmids has been described for agricultural plants—all of them mitochondrial, and all found in association with the cytoplasmic male sterile (cms) trait of higher plants. Although there is not a single case of proof that these plasmids have anything to do with the cms trait, their presence in cms lines of many agricultural plants is highly suggestive, although many contradictions seem to abound (Escote et al, 1985). There is an 11.5 kb plasmid from a cms line of Brassica (Palmer et al, 1983; Erickson et al, 1985) which has 325 bp TIR, and which shows homology to both mtDNA and cpDNA (Turpen et al, 1987). Two plasmids, designated Nl and N2, of 5.4 and 5.8 are found in a cms line of Sorghum bicolor (Dixon and Leaver, 1982; Pring et al, 1982). While the plasmids were originally reported to have homology to the S-l and S-2 plasmids of maize (Pring et al, 1982), recent reports show that the plasmids have no homology to mtDNA, cpDNA, nuclear DNA, nor to the maize plasmids (Chase and Pring, 1986; Baszczynski and Kemble, 1987), although a third plasmid of S. bicolor, 4.2 kb long and of very low copy number, does seem to show homology to S-l (Baszczynski and Kemble, 1987). Plasmids in Zea The plant mitochondrial linear plasmids have been most highly studied in the maize system. Maize species mitochondria harbour a number of plasmids. S-l and S-2 are linear plasmids which were found in the mitochondria of the cms-S line of maize (Pring et al, 1977). They have 5' terminal proteins (Kemble and Thompson, 1982) and TIRs (Kim et al, 1982). They have been cloned and sequenced; S-l is found to be 6,397 bp long and S-2 is found to be 5,453 bp, and the plasmids have identical 208 bp TIRs. Together they encode 4 ORFs; S-l has ORFs of 2787 bp, and 768 bp, while S-51 Introduction 2 has an O R F of 3513 b p , and the two plasmids share an O R F of 1462 bp in a region of homology (Levings and Sederoff, 1983; Paillard et al, 1985). T h e two plasmids are diagrammed in figure 9. Interestingly, the plasmids terminal sequences have regions which are conserved with some of the previously mentioned bacteriophages (Levings and Sederoff, 1983). C m s - S strains are capable of reversion to male fertility, and upon reversion, the two plasmids can no longer be detected in mitochondria, but rather they seem to have recombined with the m t D N A (Levings et al, 1980; K e m b l e and M a n s , 1983) at regions of homology ( T h o m p s o n et al, 1980; Spruil l et al, 1980). A n investigation into this process led to the surprising result that m u c h of the maize m t D N A in cms-S lines is linearized by recombination with S - l and S-2 plasmids (Schardl et al, 1984), and that upon reversion to fertility, not only do S - l and S-2 disappear, but only circular D N A s can be found (Schardl et al, 1985). Despite the suggestiveness of these observations that S - l and S-2 are the determinants of male sterility, in these strains, the observation that male fertile strains do exist in the presence of free S - l and S-2 has clouded this conclusion; apparently, loss of the plasmids during sterility reversion is under nuclear control, it is not an S-cytoplasm trait (Escote et al, 1985). Nonetheless, the m t D N A rearrangements associated with reversion to fertility (Levings et al, 1980; Kemble and M a n s , 1983) appear to be highly non-random, and involve conserved sequences that are homologous to the T I R s of the plasmids, and resemble mitochondrial promoters (Braun et al, 1986). Another question concerns other maize species' plasmids; T h e plasmids R - l and R-2 are found in another Zea species and are male fertile. R-2 is identical to S-2 and R - l is highly h o m o l o g o u s t o S - l , except that it contains an insertion and some rearranged sequences (Weissinger et al, 1982). Indeed the two plasmid systems are so closely related that it has been postulated that S - l arose by a recombination event between R - l and R-2 (Levings et al, 1982). T h i s possibility is diagrammed in figure 9. Final ly , it should be noted that there are other maize mitochondrial plasmids. T h e plasmid S-3 (Koncz et al, 1981) is a 2.3 kb plasmid which is found in all maize mitochondria tested, and 52 Introduction which shows homology to S-l, S-2, mtDNA, cpDNA and nuclear DNA of maize. The plasmid is linear, has 17 bp TIRs which are homologous to those of the S plasmids, and has terminal proteins (Bedinger et al, 1986). Zea diploperrenis contains two plasmids D-l and D-2 that may be identical to R-l and R-2 (Timothy et al, 1982). Finally, a number of small circular mitochondrial plasmids of maize are known (Kemble and Bedbrook, 1980; Kemble et al, 1980; Smith and Pring, 1987). Fungi The number of plasmids described for the fungi exceed those described for any other kingdom, and they are. found in mitochondrial and other cellular compartments. Mitochondrial plasmids Mitochondrial plasmids with the linear dsDNA structure have been described in many systems. In Agaricus bitorquis, the common edible mushroom, the prototype strain, Ag4, harbours two plasmids, one of 7.3 kb and one of 3.65 kb, which have 1 kb TIRs and homology to the mtDNAs of strains of A. bitorquis and A. bisporus with and without the plasmids. A survey of Agaricus strains has found many plasmids (Mohan et al, 1984; Meyer et al, 1988). Pleurotus ostreatus has been found to contain two plasmids, one of 10.0 kb and one of 9.4 kb. They have no homology to one another, and no homology to the mtDNA or the nuclear DNA (Yui et al, 1988). Fusarium oxysponum f. sp. conglutmans has been found to contain a family of 1.9 kb plasmids, which do not appear to have homology to the mitochondrial or nuclear genomes. At least two different 1.9 kb plasmids have been defined, which do not show homology to one another. Interestingly, the presence of a certain plasmid correlates with host range of this plant pathogenic fungus. These are the smallest plasmids yet defined (Kistler and Leong, 1986). Fusarium solarium f. sp. cucurbitae is found to contain two large plasmids, of 9.2 and 8.3 kb, which do not share major sequence similarity. They 53 Introduction were once thought to correlate with pathogenicity of the fungus (Samac and Leong, 1988), although it now seems that they have no role in pathogenicity (Samac and Leong, 1989). Ceratocystis fimbnata mitochondria are found to contain a 6.0 kb plasmid with 0.75 kb TIR (Normand et al, 1987) . Of course, the senescence plasmids of Neurospora fall into this category. They include kalilo, maranhar, zhisi, and others (Griffiths et al, unpublished observations). Finally, A linear DNA whose final structure is not known, has been found in the mitochondrion of Botrytis cinerea (Hiratsuka et al, 1987). Extensive, work has been done on the plasmids of Claviceps purpurea. Originally, it was found to harbour a linear, mitochondrial plasmid of 6.3 kb (Tudzynski et al, 1983). An analysis of a large number of strains of the fungus showed that plasmids with homology to the linear plasmid were common, and that a heterogeneous family of plasmids with a similar size was found to occur, and that the TIR of the plasmids showed homology to the mtDNA (Tudzynski and Esser, 1986). Now many of the plasmids are known, and while there are sequence homologies among many of them, including identical plasmids that are found in distantly related strains, they are not all related. A prototype plasmid, pCKLl , was found to be of 6.7 kb, with 327 bp TIR (Diivell et al, 1988) . This plasmid has been reported to have homologies to the linear plasmids in a number of other systems. Although the strength of the hybridization conditions were not reported, pCKLl shows relatively weak homology to the plasmids of Ascobolus immersus, to the k2 plasmid of Kluyveromyces lactis, and to the N2 plasmid of Brassica. Relatively strong homologies have been reported for the Brassica plasmid Nl , and the maize plasmid, S-l (Tudzynski et al, 1986). They also seem capable of insertion into the mtDNA (Tudzynski et al, 1986; Tudzynski et al, 1983). 54 Introduction Location unknown There are also some plasmids whose cellular location has not been discerned. Hashiba et al, (1984) have reported a 2.6 kb linear plasmid whose titres correlate with pathogenicity in Rhizoctonia solani. Ceratocystis fimbnata harbours a second plasmid, which is 8.2 kb (Giasson and Lalonde, 1987). Saccharomyces kluyven has a 14.2 kb linear plasmid with 483 bp TIRs (Kitada and Hishinuma, 1987). Recently, a 7.4 kb linear plasmid has been found in Tilletia controversa, however, whether it conforms to the protein and TIR structure is not known (Kim et al, 1988). Nuclear plasmids Plasmids which are not mitochondrial and are presumably nuclear or cytosolic have been found in a number of fungi. Analysis of genetically unstable and wild strains of Ascobolus immersus has yielded many plasmids from 2 to. 20 kb in size (Francou et al, 1987; Meinhardt et al, 1986), which all have related sequences. Two plasmids have been studied in detail. They are 6 kb with 1.2 kb TIRs (Francou, 1981), and 5.6 kb with .7 kb TIRs (Meinhardt et al, 1986). Many strains of the morel Morchella cornea harbour 6 and 8 kb plasmids with TIRs of 0.75 kb (Meinhardt and Esser, 1984). Very little is known about, any of the fungal plasmids, regardless of their cellular location. In striking contrast to this situation are the linear plasmids, k l and k2, of the yeast Kluyveromyces lactis (Gunge et al, 1981). The Killer System of Kluyveromyces lactis k l and k2 were first identified, as a pair of linear plasmids of 8.8 and 13.4 kb in killer strains of the yeast Kluyveromyces lactis (Gunge et al, 1981). The plasmids, which are found free in the cytoplasm (Romanos and Boyd, 1988), were found to encode both the killer toxin and immunity, as transfer of the plasmids to non-killer strains transformed them into killers (Gunge and Sakaguchi, 55 Introduction 1981). It was found by mutagenesis of killer strains that kl encoded the killer phenotype, while k2 seemed to be responsible for maintenance of the plasmids, as loss of kl resulted in toxin sensitive non-killers and kl was never seen without being accompanied by k2 (Niwa et al, 1981; Wesolowski et al, 1982). Interestingly, the plasmids share no homology, even the terminal repeats of the two plasmids share no extensive homologies; they are 202 and 184 bp respectively (Sor et al, 1983). The plasmids have 5' attached proteins, although the proteins are very small, and they differ between the two plasmids (Kikuchi et al, 1984). kl has been completely sequenced and it has a high A:T content of 73.2%, and contains 4 ORFs (Stark et al, 1984; Hishinuma et al, 1984; Sor and Fukuhara, 1985). The kl plasmid is diagrammed in figure 9. Each ORF is promoted from a unique promoter with the sequence A C T A A T A T A T G A , followed by a hairpin region, followed by the transcription start site (Sor and Fukuhara, 1985). The promoters seem to be unique and are not transcribed as units on the usual yeast nuclear vectors; this seems to confirm the cytoplasmic location of the plasmids (Romanos and Boyd, 1988). It is possible that kl relies entirely on k2 for its maintenance, replication and expression, but the observation that the one of the four ORFs of kl encodes a. B family DNA polymerase, suggests that kl encodes some functions necessary for its own survival. In this scenario, the DNA polymerases used by kl and k2 differ, and kl encodes its own DNA polymerase (Fukuhara, 1987; Jung et al, 1987), while k2 encodes the rest of the functions required for plasmid maintenance: an RNA polymerase, the terminal proteins, and its own DNA polymerase. The other three ORFs of kl are thought to encode two toxin subunits (Stark and Boyd, 1986), and one immunity function (Tokunga et al, 1987). It has been shown that the Kluyveromyces plasmids replicate like the adenovirus (Fujimura et al, 1988), although they do seem to contain sequences that can function as an ARS in S. cerevisiae (Fujimura et al, 1987). It is interesting to note that these plasmids have been found to undergo deletions which create hairpin plasmids that appear to be stably replicated (e.g. Kikuchi et al, 1985). These have been used to suggest that kl does require an intact copy of the 56 Introduction DNA polymerase it encodes to be maintained (Kitada and Gunge, 1988). Final notes of interest in this system are the observations that the plasmids can be transferred with relative ease amongst the yeast families (Gunge et al, 1982; Sugisaki et al, 1985), but that S. cerevisiae can only be stably transformed if the host is a p° strain, suggesting incompatibility of the killer plasmids with the mtDNA of S. cerevisiae (Gunge and Yamane, 1984). It is not known if this information has any relevance to the discovery of mitochondrial linear plasmids in many fungi. Phenotypes of linear plasmids The vast majority of the preceding plasmids are not correlated with any phenotype in the organisms which harbour them. Extensive strain surveys frequently turn up strains which do and which do not harbour their respective plasmids, however the strains do not differ in any other detectable way. Therefore it is interesting to examine the examples where a phenotype. is present, to try and determine what these plasmids may be doing. Obviously the dsDNA viruses give rise to a phenotype, however, the consequences associated with the presence of a plasmid are less clear. Most linear plasmids have no apparent phenotype, however some have very interesting phenotypes. The plasmids in some plant species correlate with pathogenicity in the strains which harbour them (Kistler and Leong, 1986; Hiratsuka et al, 1987). While no phenotype is actually known for many of the fungal mitochondrial plasmids, many show homology with the mtDNA (Meyer et al, 1988; Duvell et al, 1988), and thus may have some as yet undetermined effect. Kaiilo, of course, has a senescent phenotype (Bertrand et al, 1985) as does maranhar; maranhar however has homology with the mitochondrial chromosome and may be responsible for RFLPs in Neurospora mtDNA (H. Bertrand, pers. comm.). The circular Neurospora mtDNA plasmid Varkud can also be forced to insert into the mtDNA, causing a phenotype similar to senescence, however, this does not appear to be a natural function of the element (Akins et al, 1986). Some of the prokaryotic plasmids are 57 Introduction thought to encode antibiotics, much as circular plasmids do. All of the plant plasmids correlate with the cms trait, but none have been proven to have a cause or effect on the system. It appears as though amongst all the elements shown in table 1, with the exception of the viruses, only the kalilo, maranhar, and the killer plasmids of the yeast Kluyveromyces, give rise to an identifiable phenotype in the organisms which harbor them, and all of the others represent some sort of vestigal or cryptic system. SEARCH FOR FUNCTIONS OF KALILO The picture that emerges is that kalilo is a mitochondrial plasmid that is frequently found in Hawaiian isolates of N. intermedia. It is a linear plasmid that is somehow related to other mitochondrial linear plasmids, and linear plasmids in general. Strains that harbour kalilo are senescent, although the evidence that kalilo causes senescence is largely circumstantial. It has been suggested that the generation of defective mtDNA molecules is the only event required to initiate the suppressive accumulation of mitochondria carrying the inserts (Bertrand et al, 1985). The suppressive nature of mitochondria with defective mtDNA molecules is not well understood, but it is well documented. Accumulation of defective mtDNA molecules can also result from recombination with circular mitochondrial plasmids (Akins et al, 1986), from point mutations (Lemire and Nargang, 1985), and from deletions (Bertrand et al, 1980; DeVries et al, 1981). In addition to Neurospora, the effect is seen in Saccharomyces cerevisiae (Borst, 1972; Faye et al, 1973), Podospora ansenna (Stahl et al, 1978; Cummings et al, 1979b), and Aspergillus amstelodami (Lazarus et al, 1980). The biology of the kalilo plasmid has remained elusive. It is apparent that the plasmid is structurally similar to linear elements, but how it functions is not clear. The sequence of the element is known, but only the two large ORFs, an R N A polymerase and a D N A polymerase, are apparent. These two proteins may be all that is needed for plasmid maintenance, however a number of other 58 Introduction biological functions may be required. Neither the terminal protein nor its gene have been identified. A transposase may be found, given the ability to insert into the mitochondrial chromosome (Bertrand et al, 1986; Myers et al, 1989). Other unidentified functions also may exist; in vivo replication of 4>29 and the adenovirus requires other viral encoded proteins in addition to the. terminal protein and the DNA polymerase (reviewed in Salas, 1988; Stillman, 1983). Kaiilo may also require such functions for its survival. Therefore a functional analysis of the kaiilo plasmid of Neurospora intermedia is expected to give insights into this very interesting, but as yet undescribed group of linear elements and plasmids. Yet analysis of kaiilo has in some ways been an intractable system. It is intuitive that a number of genetic functions must reside on the element to allow it to exhibit this lifestyle, yet none have ever been identified. This is in part due to the fact that classical genetic analysis has never been performed. This is because kaiilo DNA is present in multiple copies, both as mtAR-kalDNA and as mtlS-kalDNA, therefore mutational analysis is not possible. Transformation of non-senescent strains to senescence using cloned and purified kalDNA in a number of constructs has been unsuccessful (C. Myers, T. Cheng and H. Bertrand, Pers. Comm.), so in vitro mutagenesis cannot be employed. This may be due to the unique end structure of kalDNA, a linear plasmid. Nonetheless, it is assumed that kaiilo must encode some information that allows it to exist. It is this information that it was of interest to find. The senescence events associated with the insertion of kaiilo are complex. Therefore it was of interest to determine what senescence events are programmed by kaiilo, rather than associated coincidences of mitochondrial biology, such as the suppressive nature of altered mtDNAs. Two possibilities presented themselves towards this goal. These were to use molecular techniques to search the DNA directly for genes or functional units. Because the sequencing of kaiilo was already underway (B. Chan, pers. comm.), transcriptional experiments were designed to find genes or 59 Introduction transcriptional units on the linear plasmid. The other idea was to search for function indirectly, using experiments designed to overcome the problems caused by the stochastic processes occurring during mitochondrial growth. Observing the behaviour of multiple cultures was undertaken as an experimental protocol devised to separate programmed events directly related to senescence from random events coincidental to the senescence process. In Part I of the thesis the transcriptional analysis of kalilo is presented, and in Part II, experiments on parallel subculture series of senescent strains are presented. I hereby present, these and other experiments designed to discover what functions are directed by kalilo, the linear senescence plasmid of Neurospora intermedia. 60 Materials and Methods M A T E R I A L S A N D M E T H O D S STRAINS Neurospora intermedia Neurospora intermedia strains P561, P595, P605, P790, and P802 are natural isolates from K a u a i , Hawaii . A l l strains were collected by and obtained from D . D . Perkins. Ascospore progeny prefixed by an I, such as 1-4, were described by Griffiths and Bertrand (1984). Ascospore progeny prefixed by X I , such as X l - 4 , were described by Myers (1988). Subculture series, such as 561-0, 561-1, ...561-9 were described previously (Griffiths and Bertrand, 1984; Myers , 1988). Other strains are described in the text. Escherichia coli E. coli strain J M 8 3 was host for transformation of and D N A isolation from clones in the p U C 1 8 and p U C 1 9 vectors. Strain JM101 was host for the M 1 3 m p l 8 and m p l 9 vectors. MEDIA AND GROWTH CONDITIONS Neurospora Vegetative culturing was performed exclusively on Vogel's minimal m e d i u m containing 2% glucose (Vogel, 1956). Serial subcultures were made in 10 X 75 m m tubes. E a c h series was subcultured once or twice weekly. For the growth of mycel ium for nucleic acid isolation, liquid Vogel 's m e d i u m was inoculated with approximately 10 c o n i d i a / m l and shaken at 200 r p m for a m i n i m u m of 16 hours. A l l cultures were incubated at 2 5 ° C . Subculturing was performed as 61 Materials and Methods described by Griffiths and Bertrand (1984). T h e original member of a subculture series is designated by a -0, such as 561-0. Serial subcultures are numbered -1, -2, . . . -n , such as 561-7. Conidial isolation for the inoculation of liquid Vogel's was prepared by pouring conidial suspensions through layers of sterile nylon mesh. Cultures were harvested by suction filtration through W h a t m a n #1 filters in Buchner funnels. T h e initial cultures for the parallel series were prepared b y inoculating 10 c o n i d i a / m l into sterile water, vortexing, and adding 0.1 m l to 10, 10 X 75mm slants of Vogel's minimal m e d i u m . These were then numbered i , ii , ...x, and subjected to serial subculturing until death. A l l other procedures were standard for Neurospora and are described by Davis and DeSerres (1970). Escherichia coli T h e m e d i u m for the transformation and growth of bacteria containing p U C plasmid derivatives was L u r i a Broth (5 g Yeast Extract , 10 g Bacto-Tryptone , and 10 g N a C l / p e r litre). For the selection of pUC-series plasmid containing bacteria, media were supplemented with 50 ng/ml ampicillin. Bacteria containing M 1 3 clones were grown in Y T m e d i u m (5 g yeast extract, 8 g Bacto-T r y p t o n e , and 5 g N a C l per litre). J M 1 0 1 hosts for M13 clones were maintained on minimal A plates (0.3 g Agar , 16 m l H 2 0 , 4 m l 5X A Salts (52.5 g K 2 H P 0 4 , 22.5 g K H 2 P 0 4 , 5 g ( N H 4 ) 2 S 0 2 , and 2.5 g N a c i t r a t e . 7 H 2 0 / p e r litre), 0.2 m l 20% glucose, 20 pi 20% M g S O 4 . 7 H 2 0 , and 10 ul 10 m g / m l thiamine/per plate. These were sterilized by autoclaving except for thiamine which was filter sterilized. These procedures have been described previously (Maniatis et al, 1982; Messing, 1983) 62 Materials and Methods NUCLEIC A CID ISOLA TIONS D N A Isolation Mitochondrial DNA Mitochondrial DNA was isolated according to the small scale mtDNA isolation of Myers (1988), with the addition of a proteinase K digestion prior to phenol/chloroform precipitation of protein, unless otherwise stated in the text. All procedures were carried out at 0-4°C, unless otherwise noted. 200 ml of liquid culture was harvested and the stored on ice until needed. The mycelial pellet was ground with an equal volume of acid washed sand and suspended in 25 ml DNA isolation buffer (44 mM sucrose, 50 mM Tris-HCl, pH 7.6, 1 mM EDTA). The suspension was centrifuged at 2 krpm for 5 min. in an SS-34 rotor to pellet nuclei and cell debris. The supernatant, containing mitochondria was collected and centrifuged at 15 krpm for 15 min. to generate a crude mitochondria] pellet. The mitochondrial pellet was suspended in 3 ml 70% sucrose in T - ^ Q E ^ (10 mM Tris-HCl pH 7.6, 1 mM EDTA), and layered with 2 ml 44% sucrose in T 1 Q E 1 , or 1 ml 55% sucrose in T JQE -^ and 1 ml 44% sucrose. The flotation gradients were centrifuged at 45 krpm for 2 hours in an SW50.1 rotor. Mitochondria were collected from the interface beneath the 44% sucrose step gradient layer, and diluted to 3 ml with 2 ml ^200^1 ( 2 0 0 m M Tris-HCl pH 7.6, 1 mM EDTA) in microfuge tubes. The tubes were centrifuged for 15 min. to pellet the mitochondria. The mitochondrial pellets were pooled and resuspended in 200 ul of a solution of 200 mM NaCl in T - ^ Q E ^ . One tenth volume 10% SDS was added to lyse the mitochondria, followed by the addition of 20 \J1 of a 4mg/ml proteinase K (Boehringer Mannheim or Bethesda Research Laboratories (BRL)) solution. The mitochondrial DNA was incubated at 37°C for 6-12 hours. Protein was extracted by by the addition of one volume of Tris-HCl saturated phenol, and one volume of chloroform/isoamyl alcohol, 63 Materials and Methods 49:1. Tubes were mixed by inversion and centrifuged for 15 min. The aqueous phase was collected and this step was repeated once. Nucleic acids were precipitated from the aqueous phase by the addition of 2.5 volumes of ethanol containing 200 mM NH^CHgCOOH. The nucleic acids were pelleted and washed with 70% ethanol. The mtDNA was resuspended in 50-200 pi T-^QE J , with the addition 1 ul of 20 mg/ml RNAse A (Sigma). RNA was digested at 55°C for 30 min. DNA concentration was determined by UV absorption. Typically, the yield was 50 - 200 pig of mtDNA per 200ml of liquid culture. Escherichia coli Plasmid DNA Alkaline lysis plasmid isolations have been described previously (Maniatis et al, 1982). Large scale plasmid isolations were as follows. 500 ml ampicillin cultures were grown from a 10 ml inoculation of an overnight culture of plasmid-containing E. coli, supplemented with 50 pg/ml ampicillin. Cells were harvested by centrifugation in GSA or GS-3 rotors at 7 krpm for 7 min. Pellets were resuspended in 6 ml of T E G solution (50 mM glucose, 25 mM Tris-HCl pH 8.0, 10 mM EDTA). 1 ml of T E G plus 20 mg/ml lysozyme was added and incubated for 10 min. at RT. Cells were lysed by the. addition of 7 ml of 0.2N NaOH, 1% SDS, mixed by inversion and incubated on ice for 5 mm. Protein was precipitated by the addition of 13 ml ice cold KCHgCOOH solution (60 ml 5M KCH3COOH, 11.5 ml glacial acetic acid, 28.5 ml H2O, pH 4.8) and incubating on ice for 15 min. Cells debris was removed by centrifugation of the DNA in an SS-34 rotor at 15 krpm for 10 min. The supernatant was collected and nucleic acids were precipitated by the addition of 0.6 volumes of isopropanol. Nucleic acids were collected after incubation for 25 min. at room temperature by centrifugation in an SS-34 rotor at 15 krpm for 15 min. The nucleic acid pellet was dried, resuspended in T-^QE^ and 0.9 g/ml CsCl and 30 ul of 10 mg/ml ethidium bromide was added. DNA was centrifuged for 4 hours in a vTi 80 rotor, or for 20 hours in a Ti 80 rotor. Plasmid bands were 64 Materials and Methods collected under long wave U V light, and ethidium bromide was removed by extraction with isopropanol saturated with NaCl and H9O. Two volumes of T^QE -^ , followed by 2.5 volumes of ethanol plus 200 m M N H ^ C H g C O O H were added and D N A was collected by centrifugation in an SS-34 rotor at 10 krpm for 10 min. Pellets were washed in 70% ethanol and D N A concentration was determined by U V absorption. Small scale plasmid isolations for the screening of recombinant clones were essentially scaled down versions of the above protocol, with the omission of the CsCl centrifugation. Instead, R N A was removed by the addition of 1 pi of 20 mg/ml RNAse A , and incubation for 30 min. at 55°C. MIS Phage DNA Bacteriophage M13 ssDNA was isolated according to Messing (1983). 1.5 ml cultures of phage which were grown for 5-8 hrs were cleared of bacteria by centrifugation in a microfuge. 1.3 ml of supernatant were added to 200 pj of 27% PEG-6000 in 3.3 M NaCl. Tubes were shaken at 4 ° C for 1 hr. Phage were cleared by centrifugation for 15 min. in a microfuge, and the pellet was resuspended in 650 pi of T J Q E J . To this was added 40 pi of 40% PEG-6000 and 80 ul of 5M NaCl. The contents were mixed and the tubes were incubated at R T for 30 min. The phage were cleared by centrifugation for 15 min. and all of the supernatant was removed. The pellet was resuspended in 300 pi T ^ Q E J , and the viral coat, was removed by extraction with 300 of Tris-HCl saturated phenol. The aqueous phase was collected, and reextracted with 150 pi phenol and 150 pi chloroform. D N A was precipitated by the addition of 2.5 volumes of ethanol/200 m M NH4CH3COOH, dried and resuspended in 10 pi T-^QE^. 65 Materials and Methods R N A isolation Total RNA T w o different protocols were used for the isolation of R N A . A l l buffers, reagents, equipment, etc. for the isolation of R N A was reserved for R N A use, autoclaved for one hour to destroy endogenous R N A s e s and/or treated with 0.1% D E P . Small scale R N A isolations were performed as follows: 0.2 g of tissue was harvested, frozen in liquid nitrogen and homogenized with sand in 1 m l of 2% Tri-isopropylnapthalenesulfonic acid ( T N S ) and 1 m l 12% p-aminosalicylic acid ( P A S ) . T h e n 6 m l of Tris-saturated phenol and 2 m l more of both T N S and P A S were added, homogenized, and spun at 10 k r p m for 10 m i n . in an HB4 rotor. T h e upper phase was collected and extracted with phenol /chloroform/isoamyl alcohol 50:48:2 ( P / C / I ) , then precipitated with 100% ethanol, and washed with 70% ethanol. Finally , R N A was reprecipitated from 3.3 M L i C l . T h e use of these strong, chaotropic detergents to isolate nucleic acids has been described previously (Lovett and Leaver, 1969) Large scale R N A isolations were performed by the acid phenol method (Lucas et al, 1977) by harvesting 10 g mycelia i n . a Buchner funnel and washing with 100 m M N a C H g C O O H p H 5.5. M y c e l i u m was then powdered in a mortar with liquid nitrogen and R N A was extracted by homogenization in a W a r i n g blender in the presence of 120 m l 150 m M N a C H 3 C O O H , 4% S D S p H 5.5, and 120 m l phenol saturated with the same extraction buffer, and 5 g grinding alumina (Sigma). Samples were centrifuged at 10 k r p m for 12 m i n . in a G S A rotor, and the upper phase was extracted twice with P / C / I and twice with chloroform/isoamyl alcohol 49:1. Nucleic acids were precipitated by the addition of 0.1 volume 3 M N a C H 3 C O O H and 3 volumes 100% ethanol, washed with 70% ethanol, and R N A was reprecipitated f rom 3.3 M L i C l , washed, dried and resuspended in H^O 66 Materials and Methods Poly A RNA Poly A + R N A was prepared by passing total R N A over oligo(dT)-cellulose columns according to the directions of the supplier ( B R L ) . C o l u m n s were prepared by repeated washings with B i n d i n g Buffer (500 m M N a C l , 10 m M T r i s - H C l p H 7.5, 1 m M E D T A , 0.25% S D S ) . T o t a l R N A , at a concentration of 1 m g / m l in binding buffer was heat denatured and chilled quickly on ice. It was then applied to the column and the eluate was passed through the column twice more. C o l u m n s were eluted with E l u t i o n Buffer (10 m M T r i s - H C l p H 7.5, 1 m M E D T A , 0.1% SDS) into fractions and U V absorbing material was pooled and precipitated by the addition of 0.1 volume of 3 M N a C H , C O O H and 3 volumes of ethanol. Poly A + R N A was washed with 70% ethanol, dried and resuspended in H2O. Poly A - R N A was prepared by collection of the eluate from repeated passages of total R N A over the columns. Excess S D S was precipitated by incubation at 0 ° C , and removed by centrifugation. T h e resultant R N A was precipitated by the addition of 0.1 volume of 3 M N a C H g C O O H and 3 volumes of ethanol. Poly A - R N A was washed with 70% ethanol, dried and resuspended in H 9 0 . mtRNA m t R N A was prepared by preparing mitochondria according to the m t D N A isolation procedure, with the addition of 0.1% diethylpyrocarbonate to the sucrose mixtures and D N A isolation buffer. Nucleic acids were then prepared according small scale R N A isolation. 67 Materials and Methods ELECTR OPHORESIS DNA Agarose gel D N A s for agarose gel electrophoresis were digested by standard procedures for Boehringer M a n n h e i m , B R L , and Pharmacia restriction enzymes. 5 pig of m t D N A were generally digested for 2 hours at 3 7 ° C . 3 pi of 5 X loading buffer (5% S D S , 50% glycerol, .025% bromophenol blue) was added to make a final volume of 30 pi. m t D N A fragments were separated on 0.8% agarose I (Sigma) gels at 40 volts for 16 hours. Gels were prepared and run in T B E (81 m M T r i s base, 89 m M Borate, 2 m M E D T A ) . Gels were stained with e thidium bromide and photographed under shortwave U V illumination. For transfer to Genescreen ( N E N - D u p o n t ) , gels were denatured for 45 m i n . in 0.5 N N a O H , 1.5 M N a C l , and then neutralized for 45 m i n . in 1 M T r i s - H C l p H 8.0, 3 M N a C l . D N A was transferred in 2X S S C (300 m M N a C l , 20 m M N a Citrate p H 7.0) for 24 hrs. After transfer, filters were baked at 8 0 ° C for 3 hrs. Poly aery lamide Gels 38 cm long by 0.35mm thick polyacrylamide gels were prepared as follows. G e l plates were prepared by cleaning glass thoroughly and clamping and taping gels. For 6% gels, 7.5 m l 40% acrylamide (386 g acrylamide, 13.4 g bisacrylamide per litre), 2.5 m l 10X T B E , 24 g urea, 260 ul 10% NH4S9O7, and 21.7 m l of H2O were mixed, filtered through W h a t m a n #1 filters, and evacuated under suction for 15 m i n . 20 pi T E M E D were added, mixed thoroughly, and immediately poured into gels. Gels were polymerized for 4 hrs. 8% gels differed by the use of 10 m l 40% acrylamide, and 68 Materials and Methods 19.2 m l H2O. Gels were run in 0.5 X T B E , at 1500 V and prerun prior to loading of samples. 6% gels were run unt i l 40 m i n . after the xylene cyanol marker had reached the end of the gel. 8% gels were run until the bromophenol blue marker reached the end of the gel. After electrophoresis gels were mounted on W h a t m a n 3 M M paper, dried under v a c u u m , and exposed to K o d a k X R P fi lm. Northerns R N A was denatured in a total volume of 50 ul with 5 ul 10 X G e l buffer (200 m M M O P S , 50 m M N a C H 3 C O O H , 10 m M E D T A p H 7.0), 8.5 ul formaldehyde, 25 pj deionized formamide, and 2-20 ug R N A . Samples were heated to 6 0 ° C for 5 m i n . and cooled on ice. 1% Agarose gels were prepared in I X gel buffer with 6% formaldehyde. Electrophoresis was at 50 V for 16 hrs. Prior to transfer, gels were washed with R^O for 5 m i n . , denatured in 50 m M N a O H , 10 m M N a C l for 45 m i n , and neutralized in 100 m M T r i s - H C l p H 7.5 for 45 m i n . Transfer was onto Genescreen for 24 hours in the presence of 25 m M N a 2 H P O ^ / N a H 9 P O ^ p H 6.5. After transfer, filters were baked at 8 0 ° C for 3 hrs. Hybridizations Filters were prehybridized for 24 hours at 4 2 ° C with 40% deionized formamide, 1% S D S , I X Denhardts solution (100X = 2% B S A , .2% P V P , 2% Ficoll ) , 1 M N a C l , and 0.4 m g / m l denatured Herring sperm D N A (Bertrand, 1985). Hybridizations were carried out in the same buffer with the addition of labelled probe to 10 c p m / m l . Hybridizat ion was for 24 hours at 4 2 ° C . After hybridization, filters were washed in 2X S S C at R T for 5 m i n . , 2 X S S C , 1% S D S at 6 5 ° C for 1 hr, and in 0.1X S S C at R T for 5 m i n , unless otherwise noted in the washing experiments. Blots were wrapped in Saran W r a p and exposed to K o d a k X - O m a t R P fi lm. 69 Materials and Methods RADIOACTIVE PROBE PREPARATION Oligolabelling Reactions were to a final volume of 30 ul. 1.4 ul of r a n d o m primers (Pharmacia p o l y ( d N T P ) 6 , 90 O D u n i t s / m l 1 m M T r i s - H C l p H 7.5, 1 m M E D T A ) were mixed with 50 - 500 ng D N A to a final volume of 13.5 ul. T h i s was incubated at 1 0 0 ° C for 2 m i n . and then chilled on ice. 5 ul d N T P s (100 [M d G T P , d C T P , d T T P , 250 m M T r i s - H C l p H 8.0, 25 m M M g C l 2 , 50 m M 2-mercaptoethanol), 5 ul 1 M H E P E S p H 6.6, 5 pi [ a - 3 2 P ] d A T P (50 u C i , N E N - D u P o n t ) , 1 ul B S A (10 m g / m l ) and 0.5 ul Klenow fragment D N A polymerase ( B R L , 5 Uni ts /u l ) were added and incubation was at R T for at least 3 hrs. Unincorporated nucleotides were removed by Sephadex G-50 (Pharmacia) spin column chromatography. End Labelling 3' Labelling Molecules were 3' end-labelled only by the filling in the. overhangs of appropriate restriction digests. U p to 20 pg of D N A was mixed with 5 pi d N T P s (100 p,M d G T P , d C T P , d T T P , 250 m M T r i s - H C l p H 8.0, 25 m M M g C l 2 , 50 m M 2-mercaptoethanol), 5 pi 1 M H E P E S p H 6.6, 5 pi [a-3 2 P ] d A T P (50 u C i , N E N - D u P o n t ) , 1 ul B S A (10 m g / m l ) and 0.5 ul Klenow fragment D N A polymerase ( B R L , 5 U n i t s / u l ) , in a final volume of 30 ul. Incubation was at least 3 hrs at R T . Unincorporated nucleotides were removed by Sephadex G-50 (Pharmacia) spin column chromatography. 70 Materials and Methods 5'Labelling Restriction digested D N A was first dephosphorylated with calf intestinal alkaline phosphatase ( C I A P , Pharmacia) . U p to 20 u.g of D N A was mixed with 5 ul 10X C I P (500 m M Tris -HC1 p H 9.0, 10 m M M g C l 2 , 1 m M Z n C l 2 , 10 m M spermidine) to a final volume of 50 pi. 1 U n i t of C I A P was added and the mixture was incubated at 3 7 ° C for 30 m i n . Another unit of C I A P was added and incubation was at 5 5 ° C for a further 30 m i n . 40 ul of H 2 0 , 1 pi of 10X S T E (100 m M T r i s -HC1 p H 8.0, 1 M N a C l , 10 m M E D T A ) , and 5 pi of 10% S D S were added and the mixture was heated to 7 0 ° C for 15 m i n . T h i s phase was extracted twice with P h e n o l / C h l o r o f o r m / l s o a r n y l alcohol 50:49:1, and twice with chloroform. Approximately 500 ng of D N A thus prepared was rnixed with 10 pi 10X kinase, buffer (500 m M T r i s - H C l p H 7.5, 100 m M M g C l 2 , 50 m M D T T , 1 m M spermidine, 1 m M E D T A ) , 15 pi (150 pCi) P ] d A T P , and 20 units polynucleotide kinase. T h e reaction was incubated at. 3 7 ° C for 30 m i n . T h e reaction was stopped by adding 2 pi of 500 m M E D T A , and unincorporated nucleotides were removed by Sephadex G-50 (Pharma.cia) spin column chromatography. M13 clones Single stranded probes were prepared by a similar protocol to the oligolabelling, except that 2 pi of 15 or 17 bp M 1 3 primer ( B R L ) was mixed with D N A , rather than 1.4 pi of r a n d o m primers. Incubation was for at least 5 hours at 1 5 ° C to prevent foldback synthesis of the D N A . SI NUCLEASE PROTECTION ASSA YS Probes for the preparation of SI protection assays were prepared as uniquely end-labelled probes. 20 p,g of a kaiilo fragment cloned as a double digested fragment in p U C - 1 8 or -19 was digested with an enzyme unique to one end of the insert. T h e D N A was then 3' or 5' end labelled, as 71 Materials and Methods necessary. T h e probes were then digested with a second enzyme, P v u II. T h e p U C 18 and 19 plasmids have two convenient P v u II sites approximately 100 bp on either side of the polylinker. T h e resultant fragments were electrophoresed in the presence of 1.5% Low Mel t ing Point agarose ( B R L ) , and the probe fragment, was isolated as a gel fragment and purified by the Gene Clean (Bio 101 Inc., L a Jolla, C A ) process. Condit ions for nuclease SI digestion were predetermined for each fragment. 500 ng of gel purified D N A , and 5 ug of a non-kalilo total R N A sample were incubated in 300 pi of 280 m M N a C l , 50 m M N a C H 3 C O O H p H 4.8, 4.5 m M Z n S 0 4 , including various amounts of SI Nuclease ( B R L ) at, various temperatures to determine conditions at which the R N A was degraded and the D N A was not. T h e conditions for the two A : T rich kalilo clones were found to be approximately 1000 units of enzyme incubated at 1 5 ° C for 1 hr. Approximately 10^ c p m (100 pg - 1 ng) of labelled probe was mixed with 5 pg of R N A and 5 pg yeast t R N A , ' o r in the control lanes only 10 pg t R N A , in sample of 30 pi of 80% deionized formamide, 400 m M N a C l , 1 m M E D T A , and 40 m M P I P E S p H 6.4, heated to 8 5 ° C for 5 m i n . , and then allowed to cool to 4 2 ° C overnight, under paraffin oil. T h e hybridization mixes were removed from under the oil and added to 300 pi of 280 m M N a C l , 50 m M N a C H g C O O H p H 4.8, 4.5 m M Z n S 0 4 , including SI Nuclease ( B R L ) and incubated at 1 5 ° C for 1 hr. T h e amount, of SI nuclease is presented with each figure and was typically 0, 500, 1000,- and 1500 units per reaction. T h e n 50 ul of a solution of 4 M N H ^ C H g C O O H , 100 m M E D T A , containing 20 pg t R N A were added, and the aqueous phase was extracted once with P / C / I , and once with ether. 400 pi of isopropanol were added to precipitate the nucleic acids. T h e precipitate was recovered by centrifugation, dried and resuspended in a small volume of H 9 0 . T h i s was heated to 9 5 ° C , cooled on ice, and electrophoresed through 2% agarose gels. 5' end labelled, denatured B R L 1 kb ladder was run as a molecular size standard. Gels were mounted on W h a t m a n 3 M M paper, dried, and autoradiographed. 72 Materials and Methods SEQUENCING Primer preparation Oligonucleotide primers were designed from a sequence kindly provided by H . Ber t rand and B . S. C h a n . Sequences were checked for singularity by computer ( D N A S T A R D N A sequence software). Primers were purchased from T . A t k i n s o n (Dept . of Biochemistry, U B C ) . C r u d e oligonucleotides were purified by C-^g Sep Pak chromatography (Atkinson and S m i t h , 1984). Oligonucleotides were dissolved in 1.5 m l 500 m M NH4CH3COOH. Sep Paks were prepared by washing with 10 m l 20% acetonitrile and 10 m l H 2 0 , the oligonucleotide mixture was applied to the column, the column was washed with 10 m l H 2 0 , 1 m l air, and then oligonucleotides were eluted with 1 m l 20% acetonitrile. T h i s was evaporated to dryness and resuspended in 1 m l H 9 O . Subsequent aliquots were diluted 1:100 for use. D N A sequencing D N A was sequenced with the Promega K / R T sequencing system. 2-4 pg d s D N A was mixed with 30 ng of primer, 1 pi 2 M N a O H in a final volume of 10 pi. T h i s was incubated at 9 5 ° C for 5 m i n . , followed by the addition of 1 pi 3 M N a C - H g C O O H and 30 pi ethanol. Nucleic acids were collected by centrifugation, washed with 70% ethanol, dried and resuspended in 9 pi H2O. 1 pi 10X E n z y m e Buffer (100 m M T r i s - H C l p H 7.5, 500 m M N a C l ) was added and hybridization was allowed to occur at 3 7 ° C for 30 m i n . T o this were added 5 units Klenow and 4 pi [a- P ] d A T P , then 3 pi of this mixture were added to each of 3 pi of the promega standard dideoxy mixtures C M i x (12.5 p M d d C T P , 250 p,M d C T P , 250 p,M d T T P , 250 p M d G T P in 50 m M N a C l , 34 m M T r i s - H C l p H 8.3, 6 m M M g C l 2 , 5 m M D T T ) , T M i x (50 p,M d d T T P , 250 pJVl d C T P , 250 p,M d T T P , 250 p M d G T P in 50 m M N a C l , 34 m M T r i s - H C l p H 8.3, 6 m M M g C l 2 , 5 m M D T T ) , A M i x (1 piM d d A T P , 250 p M 73 Materials and Methods d C T P , 250 p-M d T T P , 250 p M d G T P in 50 m M N a C l , 34 m M T r i s - H C l p H 8.3, 6 m M M g C l 2 , 5 m M D T T ) , and G M i x (12.5 p,M d d G T P , 250 p,M d C T P , 250 \M d T T P , 250 u M d G T P in 50 m M N a C l , 34 m M T r i s - H C l p H 8.3, 6 m M M g C l 2 , 5 m M D T T ) . Incubation was at 3 7 ° C for 15 m m , followed by the addition of 1 pi Chase M i x ( 2 m M d A T P , 2 m M d T T P , 2 m M d C T P , 2 m M d G T P , 50 m M N a C l , 34 m M T r i s - H C l p H 8.3, 6 m M M g C l 2 , 5 m M D T T ) , and incubation at 3 7 ° C for a further 15 m i n . T h e reactions were stopped by the addition of 5 ul Stop Solution (98% formamide, 10 m M E D T A , 0.3% xylene cyanol, 0.3% bromophenol blue), heated to 9 5 ° C for 3 m i n . and 2.5 pi of each sample was electrophoresed on polyacrylamide sequencing gels. R N A sequencing R N A was sequenced with the Promega K / R T sequencing system. 5 pg of R N A was mixed with 5 ng of primer, 1 pi of 10X R T Buffer (500 m M N a C l , 340 m M T r i s - H C l p H 8.3, 60 m M M g C l 2 , 50 m M D T T ) in a final volume of 10 pi. A n n e a l i n g reactions were heated to 8 5 ° C , and allowed to cool to 4 2 ° C over 30 m i n . To each tube was added 1 pi 100 m M D T T , and 5 units of A M V Reverse Transcriptase (Pharmacia) . Reactions were then identical to those described for D N A sequencing. PRIMER EXTENSIONS Primer extensions were effected by a modification of the protocol for R N A sequencing, using the Promega K / R T sequencing kit. A n n e a l i n g reactions were essentially the same. T h e protocol employed a primer that was 5' end labelled, as previously described. For the extension reaction, the n i l addition of [ a - ° ^ P ] d A T P was omitted, and instead the mixture was extended in the presence of 3 pi of Chase M i x . Resultant D N A s were treated and electrophoresed as for sequencing reactions. 74 Materials and Methods CL ON ED DNA FRA GMENTS Preparation of Recombinant D N A Procedures were essentially as described by Maniat is et al (1982). Vectors, exclusively p U C 18, 19 and M 1 3 m p l 8 and 19, were cut. with appropriate, restriction enzymes, and treated with C I A P . Appropria te amounts of gel purified Gene Cleaned (Bio 101 Inc., L a Jolla, C A ) inserts were ligated (10 units ligase, in 66 m M T r i s - H C l p H 7.6, 5 m M M g C l 2 , 5 m M D T T , 1 m M A T P ) at R T for 3 hrs, and the resultant D N A s were heated to 6 5 ° C for 5 m i n . prior to being used to transform competent E. coli. Competent E. coli Competent cells were prepared as described previously (Messing, 1983). 50 m l cultures were incubated at 3 7 ° C until the ODQQQ of the cultures was 0.5 to 0.6. Cells were collected by centrifugation at 2.5 k r p m in an H B - 4 rotor at 4 ° C for 5 m i n . , and were gently resuspended in 25 m l ice cold CaClr,. Cells were, incubated on ice for 30 m i n . , and were again collected by centrifugation. Cells were resuspended in 5 m l ice cold C a C l ^ . 300 ul aliquots were mixed with D N A ligation reactions, incubated on ice for 60 m i n . , and heat shocked at 4 2 ° C for 2 m i n . p U C transformants were incubated with 500 ul L B r o t h at 3 7 ° C for 30 min, then dilutions were plated on plates containing 10 ul I P T G , 50 pi X - G a l , and 50 p g / m l ampicill in. M 1 3 transformations were immediately mixed in an overlayer containing 10 pi 100 m M I P T G (Isopropyl-(3-thiogalactopyranoside), 50 pi X - G a l (5-Bromo-4-Chloro-3-Indolyl-f3-D-Galactoside, 10 m g / m l in dimethlyformamide) , and 200 pi of host cells, grown from minimal A medium) , and dilutions were plated. Recombinant phage were identified as clear plaques, and further characterized as to the presence of the correct inserts. 75 Materials and Methods Probes A diagram of the. p U C and M 13 subclones of kaiilo is presented in figure 10. Some clones were gifts f rom H . Bertrand, and are indicated as such. m t D N A cloned restriction fragments H i n d 111-13,18 and H i n d III-7c used in this study are also gifts from H . Bertrand. T h e clone p J R - 2 is the cloned glutamate dehydrodgenase gene from N. crassa (Kinsey and Rambosek, 1984), and was a gift f rom J . Rambosek. T h e 7 kb r D N A cluster of C. elelgans was a gift from B. Honda. 76 Materials and Methods Figure 10. Subclones of kaiilo D N A A restriction map of kaiilo is presented in the upper part of the figure. The regions indicated by the lower case letters correspond to subcloned fragments of kaiilo generated for this study. The names of the cloned fragments are presented in the legend. The clones labelled o and p, namely pSYE-Ei and pSYE-Gi were generously provided by H. Bertrand. a= pDVKI-KXl i=pDVX3 b=pDVX3-EXr J=pDVX1 c=pDVB4-EBl k=pDVX2b d=pDVB4-EBr 1=pDVX3-EXl e=pDVB3-BXl ffl=pDVX3 f=pDVB3-BXr n=pDVX4 9=pDVK1-XHr o=pSVE-Ei h=pDVX2a-EH p=pSVE-Gi 77 Part I: Transcriptional Properties of k a l D N A P A R T I: T R A N S C R I P T I O N A L P R O P E R T I E S O F K A L D N A INTRODUCTION In this study, a full transcriptional analysis of the kalilo plasmid was undertaken. T h e sequence of the 9 kb plasmid was not known when this work was begun, and further, the plasmid was thought to reside in the nucleus as well as the mitochondrion (Bertrand et al, 1986) . Therefore, two different patterns of transcription were expected, nuclear and mitochondrial . Prel iminary observations had suggested that, transcription of the kalilo plasmid was complex. G i v e n this information, and the relationship of kalilo to linear viruses, it was suspected that there would be information available f rom the transcription of the plasmid that was not available from the sequence data, and it was of interest to determine how the element was transcribed. It was expected that mult iply processed transcripts and regulation at the level of transcription would be seen. These ideas are relevant even though the sequence of the plasmid has now been determined and describes only two large O R F s . because a number of smaller O R F s are apparent, and these could be transcribed and processed into larger O R F s . For instance, the m R N A s for the terminal protein and the D N A polymerase of the Adenovirus arise from differential splicing of the same transcription unit (Stillman, 1983). T h e experiments described in this section were designed to find functional units or genes on the kalilo plasmid. T h e y include the following experiments. A complete northern blot analysis of R N A f rom a number of different strains and subcultures was prepared to identify transcripts and to detect any temporal or developmental regulation. T h e preparation of R N A from different subcellular compartments was undertaken to separate nuclear f rom cytoplasmic functions. A transcript map was generated via transcript m a p p i n g techniques to determine how the complex R N A sequences were related to the linear plasmid. T h i s analysis suggested experiments that led to the identification of a 78 Part I: Transcript ional Properties of k a l D N A possible promoter. Finally , an experiment to determine the effect of inserts of m t l S - k a l D N A on mitochondrial transcription is presented. RESULTS Characterization of Transcription Detection of Transcription Pattern T h e initial step in identifying functions encoded in kalilo was the identification of transcripts. T h e goal was to identify all possible transcripts, and to ensure that the transcripts were initiated within the plasmid, not R N A s that had arisen via read-through of inserted copies of the plasmid, m t l S - k a l D N A . Figure 11 presents northerns of R N A from a number of senescent strains and subcultures of Neurospora intermedia. T h e blot was probed with a combination of probes containing the restriction fragments X 3 , E , and G (these probes are described in figure 5), which cover all but the terminal 300 bp of kalilo. The. use of a. number of strain types and probes was to ensure that all possible transcripts, and any strain or subculture dependent, differences would be detected. Figure 11 demonstrates a. number of things about the transcription of kalilo. First , the kalilo-homologous R N A appears heterogeneous, or highly degraded, and specific bands are often difficult to see. Lane 595-1 of figure 11 is one in which the bands are relatively clear, and bands of the following molecular weight are apparent: 4.4, 4.0, 3.5, 2.0, 1.3, 1.2, and 0.9 kb. Experiments to address the quality of the R N A and the possibility of R N A and r R N A artefacts will be presented later in the thesis. T h e same pattern of hybridization exists for lane 572-6, although the recovery of kalilo transcription products in this strain was somewhat reduced, and the bands are much fainter. T h e subculture series, f rom strain 561 indicates that transcription level increases as a culture ages, 79 Part I: Transcriptional Properties of k a l D N A from undetectable transcripts in lane 561-1, to the heavy level of heterogeneous transcription seen in lanes 561-7 and 561-8. T h i s increase in transcription level parallels the increase in m t l S - k a l D N A (Bertrand et al, 1985; 1986) and m t A R - k a l D N A (Part II of this work) that is occurring at this time. Lanes 561-8, 572-6, and 595-1 are the last subcultures f rom which nucleic acid can be prepared in these strains; they are senescent subcultures. T h e observation that the level of transcription changes as a culture ages is an important one. It presents the following di lemma in this system. Because the level of transcription of kalilo is increasing with culture age, it is often difficult to find a culture which expresses kalilo transcripts strongly, and is not too close to death to be easily cultured. T o this end much of the work in this thesis has been performed on subculture 7 of strain 561 (561-7). However, 561-7 is sterile and produces little conidia, two of the manifestations of senescence (reviewed by Bertrand, 1983). Therefore, even though 561-7 expresses kalilo R N A strongly, and can be cultured relatively easily, it is clearly a senescent culture. 80 Part I: Transcript ional Properties of k a l D N A Figure 11. Occurrence of Transcripts of Kaiilo from Different Series and Strains of TV. intermedia Northern Analysis of a subculture series and three senescent strains of TV. intermedia are presented. Senescent Strains 561. 572, and 595 have been described previously (Bertrand et al, 1985; 1986). T h e dashed numbers refer to the subculture. Subcultures 561-8, 572-6, and 595-1 are the final cultures f rom which nucleic acid can be prepared. 20 ng of total cellular R N A was loaded in each lane. T h e probe was a combination of restriction fragments X 3 , E , and G (shown in figure 5), which are homologous to all but the terminal 0.3 kb of the element. T h e B R L R N A ladder is shown as a molecular weight marker on the left, and the apparent molecular weight of the transcripts is shown on the right, by the arrows. T h e hybridizations shown are meant to be qualitative, not quantitative. 81 ladder I 561-1 561-7 561-8 Part I: Transcriptional Properties of k a l D N A Figure 12: Northern Background is Not Due to Low R N A Quality Northern analysis of different R N A types. Strains 561-7 and 595 have been described previously; strain 605 is a non-senescent control which has never been found to harbor kalilo. In the total R N A panel, all lanes contain 20 pg total R N A ; In the m t R . N A panel, lanes 605 and 561-7 contain 1 pg m t R N A , while lane 595-1 contains 5 pg m t R N A . T h e upper panels have been probed with the combination of probes X 3 , E , and G (shown in figure 5), which cover all but the terminal 300 bp of kalilo. In the lower panel the R N A samples have been probed with other non-kalilo clones to determine the state of the R N A ; the m t R N A has been reprobed with the H i n d 7 m t D N A fragment homologous to the C O I transcript (Burger et al, 1985), and the total cellular R N A has been reprobed with a nuclear D N A clone for the a m (glutamate dehydrogenase) gene of A r . crassa (Kinsey and Rambosek, 1984). T h e hybridizations shown are meant to be qualitative, not quantitative. 83 ^ 3 S S 5 S in in VD m I D KD Part I: Transcriptional Properties of k a l D N A For unknown reasons, and possibly because of these culturing problems, there is variability in the patterns seen in northern blots of R N A from kaiilo strains. For reasons that will become clearer with data to be presented in later figures, the pattern of transcription seen in lanes 561-7, 561-8, 572-6, and 595-1 is considered to be the same. F c r instance, figure 19 of the transcript m a p p i n g section details northerns of strain 561-7 R N A in which the 4.4 and 4.0 kb transcripts are readily apparent. O n l y the level of transcription and the level of background is thought to differ between strains. N o other transcripts have ever been seen, but repeat experiments eventually confirm the presence of the 7 previously mentioned transcripts. It appears that the 4.4 and 4.0 kb transcripts are always variable in separate experiments, and often are difficult or impossible to see above the background hybridization. Reasons for this are explored in the discussion, but may result from such explanations as incomplete transfer of these high molecular weight transcripts to membranes, or their varying levels in individual cultures. T h i s variability in the detection of the high molecular weight transcripts extends to a final hypothesized transcript. A full-length transcript of 8.6 kb can just be seen in lanes 561-7 and 561-8, and a. long exposure of a blot which exhibits the transcript can be seen in figure 14. T h i s transcript is often of too low a copy number to be seen, or transfers to membranes very poorly, and more experiments to confirm its presence are presented in figure 23 of the transcript mapping section. T h i s brings the total number of transcripts homologous to the element to eight. In summary, kaiilo specific R N A is highly heterogeneous, and the transcription level increases as a culture ages. Kai i lo strains of N . intermedia are found to contain eight apparent kaiilo transcripts of 8.6, 4.4, 4.0, 3.5, 2.0, 1.3, 1.2, and 0.9 kb, although the 4.4 and 4.0 kb transcripts are not always detectable above background hybridization, and the 8.6 kb transcript is often of two low of a copy number to be seen in a northern blot. 85 Part I: Transcriptional Properties of k a l D N A Kalilo-Specific RNA ts Unstable Further characterization of the R N A from senescent strains of N. intermedia leads to the conclusion that kalilo-specific R N A is selectively unstable in senescent strains. In this section it is shown that R N A which is not homologous to kaiilo appears intact, and that the heterogeneity and high background are not due to washing or cross hybridization problems, and not due to the read-through into m t l S - k a l D N A by the mitochondrial transcription apparatus. Figure 12 characterizes total cellular R N A and mitochondrial R N A ( m t R N A ) from senescent and non-senescent strains with kaiilo and non-kalilo D N A probes. T h i s figure demonstrates that the background and heterogeneity seen in the R N A is not due to the cross hybridization of kaiilo probes to other non-specific R N A , because hybridization to non-senescent control strain 605 is not seen, neither in the total R N A nor the m t R N A panel. In the total R N A panel, both of the senescent strains presented, 595-1, and 561-7 give rise to heterogeneous background in which the 4.4 and 4.0 kb transcripts are not readily apparent. T h i s observation emphasizes the variable nature of the background hybridization, because of the differences seen in the hybridization pattern between these lanes in figures 11 and 12. However, when rehybridized with a clone homologous to the single copy nuclear am gene of Neurospora crassa (Kinsey and Rambosek, 1984) in the lower portion of the figure, all three samples of R N A appear intact. It is apparent f rom figures 11 and 12 that northerns probed with kaiilo probes give rise to autoradiographs in which the bands are often fuzzy and partially obscured by background hybridization. A n effect of this type has been noted in the analysis of other mitochondrial and/or linear d s D N A plasmids (Akins et al, 1989; T r a y n o r and Levings, 1986; Pande et al, 1989). A k i n s et al (1989) suggested that the problem inherent in the inability to obtain discrete bands on northerns was that senescent mycelia contain elevated levels of R N A s e activity. W h i l e this may be true, it does not explain the observation that the same northern samples appear completely normal when hybridized with non-kalilo specific probes. Therefore, the background and 86 Part I: Transcriptional Properties of k a l D N A degradation seen when kalilo specific probes are used is not due to the degradation of the R N A during the isolation procedure, and must be an inherent quality of the R N A . T h e same effects are seen in the m t R N A panel, in which the hybridization patterns are again variable. A l t h o u g h the m t R N A , probed in the lower panel with the N. crassa H i n d III-7 m t D N A probe homologous to the cytochrome oxidase I ( C O I) transcript (Burger et al, 1985), appears intact, the use of kalilo specific probes in the upper panel again leads to northerns with high background in which distinct bands are difficult to see. In the 561-7 lane, only the smallest. R N A s are apparent, while the 595-1 lane again details bands that are difficult to see above background. A number of considerations have led to the decision not to use m t R N A for the remainder of the experiments in this section. T h e first was the general technical problem of isolating large numbers of mitochondria f rom some of the senescent strains. T h e second was the feeling that total R N A gave better results and was generally less variable than m t R N A in kalilo probed northerns. T h i s idea was reinforced by the consideration that if the kalilo R N A was selectively unstable, then the process of isolating mitochondria , which requires long sucrose gradient centrifugations, would exacerbate this problem. T h i s was suggested by such results as the lack of the 3.5 and 2.0 kb transcripts in the m t R N A panel, lane 561-7. T h e lack of these bands will be addressed more fully in the discussion. A t t e m p t s to remove the background by increasingly stringent washes removed probe equally from all areas of the blots (figure 13), therefore it does not appear that the smearing observed is due to some cross hybridization. It should also be noted that cross hybridization of kalilo probes with R N A from non-senescent strain 605 has never been observed. Figure 13 was exposed to allow for the identification of detail in the lower portion of the figure, and high molecular weight transcripts are too faint to be seen. Figure 14 is a longer exposure of the blot f rom figure 13. T w o increasingly longer exposures are presented, as this blot concerns the full length transcript, which can be seen in panels b and c. In this blot, and in others, the high molecular weight smearing is always seen to extend up 87 Part. I: Transcript ional Properties of k a l D N A to the 8.6 kb region. Also , the 4.4 and 4.0 kb transcripts become more apparent in the long exposures in panels b and c. N o change in the hybridization level was seen for non-senescent control strain 605. Analyses of this type strengthen the conviction that the pattern of transcription mentioned for figure 11 is ubiquitous among the senescent strains, and that, the high background present in these strains combined with the low copy number and/or transfer problems make the detection of these high molecular weight transcripts difficult. 88 Part I: Transcriptional Properties of k a l D N A Figure 13. Increasingly Stringent Washes of a Northern Remove Probe Equally from A l l Areas of a Blot. 20 p-g of total R N A from each of the. indicated strains was used in a northern probed with a combination of kaiilo probes X 3 , E and G (figure 5) and the panels were treated as follows: Panel A was washed for 1 hr. at 65 degrees C in 0.1 X S S C , and autoradiography was overnight without an intensifying screen. Panel B was washed for 1 hr. at 75 degrees C in 0.1 X S S C and autoradiography was overnight with an intensifying screen. Panel C was washed for 1 hr. at 85 degrees C and autoradiography was for several nights with an intensifying screen. A longer exposure of this figure, showing detail in the high molecular weight region, is presented in figure 14. 89 CO o P r r « vo roco s H i C O * * " _ • • C f l C D * 561-7 605 561-7 605 561-7 605 Part I: Transcriptional Properties of k a l D N A Figure 14. The 8.6 kb Transcript is Apparent Upon Long Exposures of a Northern Blot. T h i s figure is composed of longer exposures of the northern blot presented in panel B of figure 13. 20 pg of total R N A from the two indicated strains was used in a northern blot probed with a combination of probes X 3 , E , and G (shown in figure 5). Panel a has been exposed to show detail in the low molecular weight region, while panels b and c are increasingly long exposures which detail the emergence of the high molecular weight transcripts. T h e numbers on the right are the apparent molecular weights of the transcripts. 91 GT n 561-7 t t t t CO 665 561-7 685 561-7 685 cr Part I: Transcriptional Properties of k a l D N A Because kalilo persists as a m t D N A insertion sequence, m t l S - k a l D N A , it could be expected that transcriptional read-through into the inserted sequences f rom adjacent D N A could be causing the heterogeneity found in the R N A . T h e m t D N A of Neurospora is transcribed almost fully from several points, and then processed into discrete transcripts (Reviewed by Nelson and Macino , 1985). It is known that, kalilo affects transcription in the region in which it is inserted (to be presented in figure 27), therefore, the heterogeneity seen in the R N A could be caused by interactions of m t l S -k a l D N A with the transcription apparatus for the m t D N A region in which it is inserted. These interactions could include kalilo-directed transcription termination, promotion, and errant splicing of the nascent m t R N A s . T o this end, presenescent strains were generated which do not have' detectable inserts of kalilo. Figure 15 is a diagram of the restriction digest protocol that can be used to detect the presence of m t l S - k a l D N A in the m t D N A in a Southern Blot , and figure 16 characterizes the m t D N A f rom the control strain 605 and several senescent strains. F r o m figure 15 it can be seen that the probe, X 3 , has homology to the inverted repeats of kalilo. Therefore in a restriction digest, it will hybridize to all restriction fragments which have homology to the inverted repeats. In a Bgl II digest, the restriction fragments of the linear plasmid which hybridize to X 3 are b l and b2, the ends of the linear plasmid. However, m t l S - k a l D N A does not give rise to b l and b2 upon digestion with Bgl II. Instead, it gives rise to two m t D N A / m t l S -k a l D N A junction fragments, b l ' and b2', which must be of equal or greater molecular weight than b l and b2. Therefore, in a Southern blot of B g l II digested m t D N A probed with X 3 , the presence of two bands ( b l and b2) suggests that no insert of kalilo is present, while the presence of other bands ( b l ' and b2') confirms the presence of m t l S - k a l D N A . T h e occurrence of b l ' and b2' which are equal in size to b l and b2 is relatively unlikely, and could be checked using another restriction enzyme to digest the m t D N A , instead of B g l II. 9 3 Part I: Transcriptional Properties of k a l D N A Figure 15. Diagram of the Generation of b l ' and b2' Junction Fragments for the Detection of mtlS-kalDNA. m t A R - k a l D N A , the linear plasmid, is diagrammed in the top of the figure, and m t l S -k a l D N A , a m t D N A insertion sequence, is diagrammed at the bot tom of the figure. T h e kaiilo inverted repeat probe, X 3 , is shown, b l , b2, b3 and b4, are Bgl II restriction fragments of the linear plasmid, as shown, b l ' and b2' are the restriction fragments produced by Bgl II digestion of the m t D N A containing an insert of m t l S - k a l D N A . T h e relative sizes of b l ' and b2' are variable and are dependent, on the distance to the next Bgl II site in the m t D N A . 94 Part I: Transcriptional Properties of kalDNA X3 X X B B B b2 b4 b3 1 1 1 bl 1 kb «tAR-kalDNA X3 fttlS-kalDNA 95 Part I: Transcr ipt ional Properties of k a l D N A Figure 16. Characterization of m t D N A from Strains that Do Not Have Detectable Inserts of Kaiilo. U n c u t and B g l II digested profiles of m t D N A from strains 605, 561-7, X l - 5 , and 1-4 are presented. A n ethidium bromide stained gel is shown in the left panel, and an autoradiograph is shown on the right. T h e Southern has been probed with the X 3 clone; conditions which must exist for the occurrence of bands b l , b2, b l ' and b2' in the X 3 probed Southern blot are shown in figure 15. Strains 1-4 and X l - 5 are the juvenile progeny of crosses using strain 561 as the female parent, and are described more fully in the second part of the thesis. In the uncut lanes, additional bands are present in addition to the high molecular weight nucleic acid. These correspond to the free plasmid, m t A R - k a l D N A , and a second mitochondrial plasmid, designated plasmid, unconnected to senescence (Bertrand et al, 1985; 1986). 96 -17-Part I: Transcriptional Properties of k a l D N A Figure 17. Northern Analysis of Strains That Do Not Contain mtlS-kalDNA. Lanes in panel A contains 20 \ig of total R N A from each of the indicated strains. Strains T-4 and X l - 5 are the juvenile progeny of crosses using strain 561 as the female parent, and were introduced in the caption to figure 16. T h e R N A illustrated in this panel was isolated from the same culture as that used to make the D N A characterized in figure 16. Panel A has been probed with kaiilo probe X 3 (shown in figure 5). In panel B , the blot was stripped of probe and rehybridized with a nuclear D N A clone homologous to the a m (glutamate dehydrogenase) gene of N. crassa (Kinsey and Rambosek, 1984). T h e arrow indicates the am transcript; the presence of other apparent bands is addressed in the text. Panel C is a composite of X 3 probed autoradiographs of varying exposures which has been assembled to illustrate the pattern of R N A s detected in the northern blots. T h e numbers on the right indicate the apparent molecular weight of the transcripts in lane 595-1. 98 Part I: Transcriptional Properties of k a l D N A Figure 16 characterizes several strains using the previously mentioned protocol to assay for inserts of m t l S - k a l D N A . In addition to the Bgl II digested lanes, replicate lanes were run with undigested D N A . T h i s is another protocol for the detection of inserts, because in a strain without inserts a kalilo specific probe should hybridize only to the free plasmid and not to high molecular weight material ( m t D N A ) , and in strains which have inserts the free plasmid and the m t D N A should both become labelled. F r o m the e thidium bromide stained portion of the gel, free plasmids can readily be seen in lanes 561-7 and 1-4, while they are absent in non-senescent control lane 605. T h e X l - 5 lane seems too contaminated with nuclear D N A , or degraded, to make firm conclusions. T h e Bgl II digested lanes show that the m t D N A is digested into 14 B g l II fragments for control strain 605, while more fragments are apparent for the plasmid containing strains. These bands are discussed in more detail in figure 38 in part II of the thesis. T h e X 3 probed autoradiograph shows that the free plasmid becomes labelled in lanes 561-7, 1-4, and X l - 5 . T h e uncut m t D N A appears labelled in lane 561-7, unlabelled in lane 1-4, and firm conclusions cannot be drawn due to high background in lane X l - 5 . T h e Bgl II digested D N A s clearly show four bands in lane 561-7, and only two bands b l and b'2 in lane 1-4, while lane X l - 5 is again difficult to assess because, of background. Hybridizat ion to control D N A in lane 605 is never observed. T h i s is interpreted to mean that there is no detectable insert of m t l S - k a l D N A in strain 1-4 at least, and probably in strain X l - 5 . T h e m t D N A f rom strain X l - 5 is characterized again in figure 30, where it is found to have no detectable insert. Therefore strain 1-4 and X l - 5 contain only m t A R - k a l D N A at the detection level of the southern blot. If the reason for the heterogeneity of the R N A seen in northern blots is due to transcriptional read through into m t l S - k a l D N A from adjacent D N A , then strains without inserts should have m u c h cleaner northern blots. Northerns are presented in figure 17 that contain R N A prepared f rom the same cultures as those used for the preparation of D N A s shown in figure 16. 100 Part I: Transcript ional Properties of k a l D N A These cultures were split into two aliquots, one for D N A isolation, and one for R N A isolation, to ensure that no de novo inserts arose during culture growth. In figure 17A, it can be seen that the level of transcription in strains 1-4 and X l - 5 is very low, because the positive control, lane 561-7, is extremely overexposed while the transcripts f rom strain 1-4 are barely detectable. It is immediately apparent f rom this figure that the integrity of the R N A has not improved, and the northerns are still fuzzy. Figure 17B confirms that the am gene m R N A is a discrete b a n d and that the R N A is still intact, therefore the heterogeneity seen in the R N A is still not due to degradation of the R N A during the isolation procedure. T h e kalilo-specific probe was incompletely stripped from figure 17B, and some kaiilo bands are still slightly radioactive in lane 561-7. In figure 17C a panel composed of a longer exposure of the kaiilo probed 1-4 and X l - 5 lanes of the northern is aligned with a northern, prepared with R N A from strain 595-1 for comparison. A l t h o u g h bands are impossible to see in the lanes f rom strains without detectable inserts of k a l D N A (1-4 and X l - 5 ) , the smear is reminiscent of the pattern of transcription seen in older subcultures. A g a i n it should be emphasized that because these are juvenile strains, the transcription levels are very low, and long autoradiograph exposure times are required for hybridization to be seen. T h i s is interpreted to mean that the linear plasmid is transcribed, and that the high background seen in kaiilo R N A is an inherent quality of the R N A transcribed from this element, and not due to read-through of inserts of m t l S - k a l D N A in the m t D N A , because no m t l S - k a l D N A is thought to be present. A final observation from figure 17 is that the transcription of kaiilo is complex. T h e probe used in figure 17, X 3 , picks up the same transcripts as the combination of probes X 3 + E + G used in figures 11-16. Probe X 3 is specific for the inverted repeat of kaiilo, therefore all known transcripts contain sequences homologous to the inverted repeat. Experiments to delineate the transcript map are presented in the transcript m a p p i n g section. 101 Part I: Transcriptional Properties of kalDNA Transcription levels An experiment to characterize the level of transcription is the dotblot of various RNA types presented in figure 18. The scale presented in the figure illustrates that the intensity of a dot correlates with increasing concentration of sequences of interest. This figure confirms that the RNA levels are increasing along a subculture series (as a culture ages) as shown for the 561 series. The long exposure shown in part B of the figure confirms that transcripts can be detected in the youngest member of a senescent strain, suggesting that if any kalilo sequences are present, they will be transcribed, albeit at low levels. The level of hybridization is found once again to be very low in the strains without detectable inserts, Xl-5 and 1-4. Hybridization is never seen with non-senescent control strain 605 in part B of the figure. Finally, there has been some confusion as to the cellular location of the kalilo plasmid. To this end, the RNA types used to generate the data in figure 18 contain a number of the subsets of the RNA population. It can be seen that although kalilo is enriched in poly A+ RNA, and is seen in total RNA, the analysis of RNA types confirms that the highest level of hybridization is found in the mitochondrion, confirming the mitochondrial location of kalilo. . The kalilo sequence is 70% A:T (Chan et al, 1989b), and contains long runs of A or T residues, and the enrichment of kalilo-specific. transcripts seen after passage of senescent RNA through an oligo dT-cellulose column probably reflects association of these sequence elements with the column, rather than polyadenylation of the transcripts. Artifactual isolation of poly A+ RNA in a linear plasmid system has been suggested previously (Stark et al, 1984). Further, the increase in hybridization is approximately two-fold, not the twenty fold one expects for fully polyadenylated mRNAs, and mitochondrial transcripts are not polyadenylated in Neurospora. It should also be noted from the poly A- RNA that kalilo-specific transcripts were not completely removed from the RNA by repeated passage through oligo(dT)-cellulose, therefore these transcripts are not expected to be found to be polyadenylated. 102 Part I: Transcriptional Properties of kalDNA Figure 18. Dotblots of Various R N A Samples 5 ng of each of the indicated R N A samples were immobilized on filters. T o create the scale, the indicated amounts of the cloned fragment X3 were mixed with 5p,g tRNA, and blotted onto the filter. The scale confirms that increasing concentration of sequences of interest leads to increasing intensity of the signal. The filter was probed with X3 . Part B is a. longer exposure of some of the dots in part A. 103 Senescent Series (total RNA) 0 561-8 £ 561-7 • 561-6 561-4 56f-2 RNA types (561-7) W Total • A-• A+ Q mtRNA Senescent strains (total RNA) • 572-6 • 1-4 • 595-1 • Xl-5 1 • • Scale 1 18 38 188 388 1 3 18 188 pg pg pg pg pg ng ng ng ng Senescent Series (total RNA) 561-6 685 total RNA 561-4 56f-2 1 16 38 168 pg pg pg pg Part I: Transcriptional Properties of k a l D N A In this section it was shown that kaiilo specific R N A is selectively unstable, or exists as a heterogeneous population of molecules. T h i s was shown not to be due to degradation of R N A during R N A isolation by figure 12, and not due to incomplete washing of strips or cross hybridizations in figures 13 and 14. Figures 16 and 17 confirm that the R N A heterogeneity is probably not due to transcriptional read-through into m t l S - k a l D N A from adjacent D N A , and that there must be some other cause, such as instability of the R N A , for the quality of northerns probed with kalilo-specific probes. It also suggests that the free mitochondrial plasmid is transcribed, although at what level it is transcribed cannot be easily determined. In figure 18 kaiilo homologous R N A sequences were found in all kalilo-harbouring strains, transcription was found to increase along a subculture series, and the major site of transcription was found to be the mitochondrion, as could be expected from the cellular location of kaiilo. F inal ly this section has identified that amongst this highly heterogeneous background there are eight predominant transcripts of kaiilo, of 8.6, 4.4, 4.0, 3.5, 2.0, 1.3, 1.2, and 0.9 k b . Mapping of Transcripts Mapping Experiments Transcr ipts were initially mapped using double stranded D N A subclones of kaiilo D N A . Figure 19 demonstrates the pattern of hybridization seen when a number of different subclones of kaiilo were used as probes in a northern. Panels a and g in the figure show the same pattern of hybridization, in which the seven transcripts are apparent, of 4.4, 4.0, 3.5, 2.0, 1.3, 1.2, and 0.9 kb. B o t h probes a and g contain inverted repeat sequences, and as mentioned previously in the discussion of figure 17, all transcripts contain homology to the direct repeats. Panel g has not hybridized well in the high molecular weight region, and Panel h is a long exposure of the same blot 105 Part. I: Transcriptional Properties of k a l D N A in which the 4.4 kb transcript is apparent. Panels b, c, and d all show the same pattern of hybridization, in which the 4.4, 3.5, and 2.0 kb bands are apparent. Panels e and f are also similar; they show hybridization to the 4.0, 3.5, and 2.0 kb transcripts. T h e apparent complex nature of the transcription pattern is confirmed in panel c, in which a 300 bp probe is found to be homologous to a s u m of almost 10 kb of transcripts. For ease of analysis, figure 20 is a diagram of the blots presented here. F inal observations from figure 19 are that Poly A-f and total R N A are presented, confirming the dotblot analysis of the various R N A fractions in figure 18, and that the sample loaded into lane iii of panel a has been treated with R N A s e - f r e e - D N A s e , confirming that the apparent transcripts are not inadvertantly isolated D N A s . 106 Part 1: Transcript ional Properties of k a l D N A Figure 19. Northern Analysis Using Many Different Subclones of Kalilo. A l l lanes contain R N A from strain 561-7. Lanes marked " i " contain 20 |ig total R N A , lanes marked " i i " contain 10 pg of poly A + R N A , and lanes marked " i i i " contain 20 ug of total R N A which was treated with RNase free D N a s e I ( B R L ) , prior to electrophoresis. Panels a to g were all probed with different subclones of kalilo. T h e probe used in each panel is indicated on the restriction map of k a l D N A shown in the lower part of the figure. T h e apparent molecular weights of the transcripts, based on the B R L R N A ladder, are shown on the left. Panel h is a longer exposure of panel g. 107 Part I: Transcriptional Properties of k a l D N A Figure 20. A Diagram of the Pattern of Hybridization of Many Different Subclones of Kaiilo to R N A . A diagram of the pattern of bands seen in figure 19 is shown. Each lane, a through g, corresponds to a single lane from the corresponding panel in figure 17, and the apparent molecular weight of transcripts detected by the probe used in that lane are indicated. T h e probes used are shown in the restriction map of k a l D N A in the lower part of the figure. T h e apparent molecular weight of the R N A is shown on the right. 109 Part I: Transcriptional Properties of kalDNA d e f 9 " kb 4.4 4.8 3.5 8.3 K X E X B J L E B 1 1 X B X H E J I XK 1 kb no Part I: Transcriptional Properties of kalDNA The diagram in figure 20 is a representation of the relative location of the transcripts seen in the gels which were presented in figure 19. From figure 20 it can be seen that the shortest transcripts, of 1.3, 1.2, and 0.9 kb are seen only when probes are used which have homology to the direct repeats, and must map entirely within the 1.3 kb terminally inverted repeats of kaiilo. The two largest transcripts, of 4.4 and 4.0 kb clearly map to the left and right of the element as presented. They cover almost the entire 8.6 kb element, and because of their size they must contain almost the entire inverted repeats; the ends of these transcripts must lie close to the telomeres of kaiilo, and close to either side of the central Xba I site. Finally, the 3.5 and 2.0 kb transcripts are homologous to every subclone of kaiilo tested, over the entire 8.6 kb element. While it is possible that these two apparent transcripts are composed of a number of small exons from throughout the element, it will be shown in figures to follow that these bands most likely represent artifactual comigration of sequences of interest with the rRNAs. Figure 21 utilizes single stranded probes made from M13 subclones of kaiilo to confer strand specificity on the transcripts. The "b" strand of clone X3 in the figure hybridizes to all known transcripts while its homolog, the "a" strand, picks up nothing. This suggests that all of the transcripts are transcribed from one strand of the inverted repeat, and that the three small transcripts, of 1.3, 1.2, and 0.9 are all truncated versions of the larger transcript, because they are composed of the same DNA sequences as the larger transcripts. The direction of transcription is from the ends of the element, towards the center. Strand "d" of clone XI, and strand "e" of clone X2b confirm that the 4.0 and 4.4 kb transcripts are transcribed from opposite strands of the DNA, the direction of transcription being from the termini towards the center of the element. This situation is consistent with the transcription map presented in figure 24 in which all transcripts axe promoted from single promoters located near each end of the element, toward the center. I l l Part. I: Transcriptional Properties of kalDNA Figure 21. Use of M13 ssDNA Probes in Northern Blots to Confer Strand Specificity on the Transcripts. (A) In this restriction map of kalilo, the probes have identical polarity to the indicated sequences and were made radioactive by cloning a homolog into M13 and extending a primer in the presence of "P dATP, according to the probe preparation protocols in the materials and methods. (B) 20 pg of total RNA from the indicated strains was used to prepare the northern blots shown. The letter above each panel refers to a probe of the indicated polarity shown in (A). The apparent molecular weight of the transcripts are shown on the left, and the transcripts detected by each single1 stranded probe are indicated by arrows. 112 CO * * • • • U S * sr I 561-7 1605 I 561-7 605 I en 3 7Z DC . C D 561-7 685 561-7 605 561-7 605 561-7 605 fD 00 l u Ico • • § UJ to. I i CD Part I: Transcriptional Properties of kalDNA Figure 22. The 2.0 and 3.5 kb Transcripts Comigrate With the 28S and 16S r R N A s of Neurospora. 20 p,g of total RNA from the indicated strains was used in preparation of the northern blot. Replicate lanes are shown for stain 561-7. The probes used in the two panels are indicated on the bottom. The X3 probe is shown in figure 5. The rRNA probe is the 7.0 kb rDNA cluster from C . elegans (Files and Hirsh, 1981). The rRNAs are indicated on the left and the apparent molecular weight of the transcripts is shown on the right. 114 N in in in X CD V O so in in in CD 2 8 S * * * 16S ** 4.4 •* 4.0 ^.3.5 2.0 1.3 1.2 -* 0.9 rRNA X3 -us-Part I: Transcriptional Properties of kalDNA While the probes made from single stranded internal fragments correctly map the two large transcripts to the strands of DNA corresponding to their respective ORFS, the results suggest that the 2.0 and the 3.5 kb transcripts map to both strands of the DNA, or that each band represents more than one transcript. Figures 19 and 20 suggested that these transcripts would have to be composed of many small exons, and in addition this figure would require that these transcripts be composed of sequences from different strands of DNA, or that they be trans-spliced. While this is possible, it is much more likely that these bands are not discrete kaiilo transcripts, but represent the comigration of sequences of interest with the rRNAs. An important observation is that the 2.0 and 3.5 kb bands are always seen together, and are only seen when at least one other kaiilo homologous transcript is present. This suggests that these are not unique transcripts, but rather transcripts whose apparent molecular weight seems altered due to comigration with the rRNAs. In figure 22, the northern shown has been probed with the. 7.0 kb rDNA cluster from C. elegans (Files and Hirsh, 1981). It can be seen that the comigration of the two unmappable bands with the rRNA bands is exact. Although cross hybridization of probes with the rRNA bands from strain P605 has never been seen, it appears that somehow the kaiilo specific RNA of senescent strains can associate strongly with the rRNA and migrate with it such that its apparent molecular weight is altered. The results of figures 19, 20, 21 and 22 lead to the conclusion that the 2.0 and 3.5 kb bands are indeed artifacts. In an attempt to ascertain whether a full length transcript existed, SI nuclease protection experiments were performed as shown in figure 23. The two restriction fragments shown underneath the restriction map of kaiilo in figure 23A were chosen because they represented the extreme right and left hand fragments of the single copy region of kaiilo DNA. Figure 23B shows a protocol for the preparation of the probes in this experiment. Each probe is a uniquely end-labelled probe. The two probes are specific for the same strand of kaiilo DNA. If single promoter sequences are present near the ends of kaiilo, as hypothesized, then these probes can only be protected by an RNA which spans 116 Part I: Transcriptional Properties of k a l D N A the whole single copy region of kaiilo. In an SI protection assay, they will only pick up a transcript that is initiated from the promoter at the left of the restriction map as shown in figure 23A. T h e 5' and 3' labelled replicates of each plasmid are specific for transcripts reading out of, and into each fragment, respectively. These probes are designed such that detection of full length protection of the cloned fragment by R N A is easily distinguishable from full length protection by the D N A probe reannealing, because D N A can protect the whole probe, while only part of the probe codes for R N A . Consequently, the top band in each lane, in figure 23C, which corresponds to the single band in the control lane, is D N A : D N A hybridization, which is the internal control. T h e second band in the experimental lanes corresponds to full length protection of the cloned fragment by R N A . 117 Part 1: Transcriptional Properties of kalDNA Figure 23. SI Nuclease Analysis of Transcripts. (A) The indicated cloned fragments have been used to make probes for SI nuclease determination of the existence of a full length transcript. Restriction enzymes are as follows: K, Kpn I; X, Xba I; E, Eco R l ; B, Bgl II; H, Hind III. (B) A protocol for the preparation of single end labelled probes. The plasmids were cut as shown and 3' or 5' labelled as described in the materials and methods with ""P dATP. The fragments were then digested at the Pvu II (P) sites, and the correct fragment was gel purified for use in an SI protection assay, as described in the materials and methods. (C) The autoradiographs of 2% agarose gels shown give the results of the SI protection experiments using the single end labelled probes shown in (B) above each lane. Molecular weight markers are shown. In each panel, lane 1 is a control to which only carrier RNA was added, and lanes 2, 3 and 4 contain 100, 500 and 1500 units of nuclease SI (BRL), respectively. The small arrows indicate the relevant bands seen, with the exception of panel 2, which has an extra band that is discussed in the text. 118 Part I: Transcriptional Properties of kalDNA Figure 24. Transcription Map of Kalilo D N A A restriction map of the linear plasmid, and the 8.6, 4.4. 4.0, 1.3, 1.2, and 0.9 kb transcripts are shown. The direction of transcription is indicated by the arrows. The 8.6 kb transcript is probably transcribed from both ends of the DNA, as shown. The "P" indicates a promoter which is hypothesized to exist at the 5' ends of kalilo. 120 Part. I: Transcriptional Properties of kalDNA The nuclease SI insensitive fragments are shown in figure 23C. The first two panels correspond to the 3' and 5' end-labelled versions of pDV-X3exr. Fulllength protection of the kaiilo specific portion of this fragment is expected by the 4.4 kb transcript. The fragment entirely encodes a portion of the transcript and it should be protected by it, however, any smaller protected pieces would have to be derived from splice sites for the generation of other transcripts. The result, as expected, is that only full length protection of the fragment is seen. Smaller labelled fragments seen in lane 4 of the second panel are expected to correspond to nuclease SI attack of A : T rich regions and are not due to valid R N A protection, because the digestion has occurred in a region of the probe which was only homologous to the D N A vector and not homologous to kaiilo R N A . The situation with the clone pDV-klher is somewhat different. By design, this labelled fragment can only be protected by transcripts reading into the fragment from the left, and the only promoter is hypothesized to be 7 kb away. The result, that full length protection of both of the fragments is observed, can be explained only if all of both labelled versions of the restriction fragment code for an exon of a processed transcript, if a transcript is promoted from an internal promoter and/or if there is a full length transcript. The results in panels 3 and 4 are consistent with the hypothesis that there is an R N A species which at least spans the central single copy region of kaiilo, between the two Eco R l sites seen in figure 23A. A processed transcript, or transcripts promoted from an internal promoter are not believed to exist. Were there an internal promoter, then the transcript it represents is of too low a copy number to have been detected in the northern blots shown in the other transcript mapping experiments (figures 19, 20 and 21). Similarly, a processed transcript has not been detected, but a full length transcript is seen in some kalilo-probed northern blots, and the protection of clone pDV-Klher seen in the SI protection assay is most likely due to the existence of the full length transcript. 122 Part I: Transcr ipt ional Properties of k a l D N A Transcription Map A summary of the transcript m a p p i n g data is shown in figure 24. It is proposed that the 2.0 and 3.5 kb transcripts are artifacts and that the transcription map shown in figure 12 is the complete transcription map, and that there are only six discrete transcripts of kalilo D N A , of 8.6, 4.4, 4.0, 1.3, 1.2, and 0.9 kb. T h e absolute location of the transcripts was shown in figures 19 and 20, where the 1.3, 1.2 and 0.9 kb transcripts were found to map exclusively to the direct repeats, and the 4.4 and 4.0 kb transcripts were found to map to the left and right of the element as shown. T h e direction of transcription was shown in figure 21, where it was found that the two large transcripts mapped to opposite strands of the D N A , and that all transcripts had 5' ends near the termini of the plasmid. T h e presence of the full length transcript was suggested in figures 11 and 14, and confirmed by SI nuclease analysis in figure 23. T h e 4.0 and 4.4 kb transcripts correspond to O R F s in their regions. T h e 1.3, 1.2 and 0.9 kb begin and terminate entirely within the T I R . Presumably, both promoters are extended to yield the 8.6 kb transcript and it is composed of transcripts made from both strands of D N A . Identification of a 5' R N A End Primer Extension Reactions G i v e n that the 5' ends of the kalilo transcripts mapped so closely to the ends of the element, it was of interest to determine structures or sequences which were responsible for promoting of transcription. Primers were designed at 91 and 237 nucleotides f rom the ends of the element, and were used for primer extension and R N A sequencing of the R N A (the sequences of the primers and of the D N A in the terminal region of kalilo are shown in figure 26). T w o primers were required, because the originally designed primer inadvertently overlapped the 5' R N A end delineated by the 123 Part I. Transcriptional Properties of kalDNA second primer; the primer at 237 indicated a 5' RNA end at nucleotide position 101, while the primer at 91, which overlaps this region, failed to extend any reactions. The reactions for the oligonucleotides at position 237 and 91 are shown in figure 25. While the RNA sequencing reaction shown in panel 1 of figure 25 failed to give any readable sequence, the upper band is the point at which all reactions terminated, at the A residue after a string of 4 Cs. This is interpreted to mean that there is a 5' RNA end 101 nucleotides from the end of kalilo at which all of the RNA sequencing extensions ended, an experiment analogous to a primer extension. This site is confirmed in panel 5, where primer extension experiments using 5' end labelled primers yielded identical 5' RNA ends for RNA from three different strains of N. intermedia, 561-7, Xl-5, and 1-4, and no other bands are apparent above or below the indicated band. Even though the region prior to the proposed 5' RNA end has a site of secondary structure at the four Cs in the DNA sequence in panel 4 of figure 25, it is clear that the RNA end in panel 1 is beyond that site. An RNA end in this region is consistent with the observation that no extensions were ever observed using the 91 primer, which overlaps this site. It is proposed that the site at nucleotide 101 is the true 5' RNA site. 124 Part. I: Transcriptional Properties of kalDNA Figure 25. 5' End Mapping of the Kaiilo Transcripts by Primer Extension Analysis. Panels 1, 2, 3, and 4 are primer extensions in the presence of the dideoxy nucleotide indicated above each lane. Panels 1 and 2 contain RNA from strain 561-7 (RNA sequencing), while panels 3 and 4 contain DNA sequences from DNA clone K l . K l , from figure 5 in the introduction, is a subclone of mtlS-kalDNA that contains mtDNA, thus allowing for the determination of sequences (or primer extension events) at the termini of the kaiilo plasmid, and beyond. Lanes 1 and 4 are RNA and DNA sequences, respectively, primed from a reaction using the #237 primer, while lanes 2 and 3 are RNA and DNA sequences, respectively, using the #91 primer. The locations of these two primers are illustrated in figure 26. The #91 primer failed to extend any RNA reactions, as it overlaps the 5' RNA end indicated by the #237 primer, as shown in figure 26. In panel 5, primer extension reactions, utilizing an end-labelled primer according to the materials and methods, are shown using the #237 primer for 1-4 total RNA (lane a), Xl-5 total RNA (lane b) and 561-7 total RNA (lane c). 125 Part I: Transcriptional Properties of kalDNA Figure 26. Sequence Around the Major 5' R N A End of Kalilo Sequence analysis of the terminal regions of kalilo. (A) The sequence of the first 300 bp of kalilo is given and the locations of the #91 and #237 primers are shown. The double arrow is the inferred transcription start site from figure 25. (B) A comparison of the region around the kalilo transcription start site with some known and suspected promoters. S-2 is the region upstream from the transcription start site of the S-2 mitochondrial plasmid of maize (Traynor and Levings, 1986). Kluyveromyces promoter is the conserved sequence from the promoters of the K l killer linear DNA plasmid from Kluyveromyces lactis (Sor and Fukuhara, 1985) The putative yeast mitochondrial promoter was described by Osinga and Tabak, (1982). The underlined region is a yeast mitochondrial promoter consensus sequence that was identified later (Osinga et al, 1984). The asterisks indicate matches between the indicated sequence and the kalilo sequence. The. numbers in parentheses is the distance of the 3' end of the indicated sequence from the transcription start site. The designation tel indicates the end of the plasmid. (C) Direct repeats in the upstream sequences of kalilo and the S-2 plasmid. The asterisks indicate matches between the outer and inner sequences. The numbers in parentheses are the distances of the indicated sequence end from the ends of the plasmid. 127 CACCACTGACI^CTTTTGTTCCT A A A A A A 5ccf:i 10 69 20 38 40 50 Primer € 91- GGTGTGGGATTA CCCCTCTAT T T GC > . I I I I I I L M | | | | | | | | | | | | | | | PTrTPti^ TTTTTRATTTTTTrftTTTTTftTACCAL^CL^TflflTGS f^tGftTflftftr.RTrTTT A A A A A 70 80 90 tt 110 120 ATCGCCCCATGGTGGGGTAGAATATCCCACCTTGAGTAATGATTCCAGGGATACAATCAG A A A A A A 130 140 158 160 178 180 CTC I I I GGTAGTGGGTAGCATTATTAAATCTGGGTACCGGTGTACGTGTGTGGTATTGTCTAAGAG A A A A A A 190 208 210 220 230 248 TGTGTGCCAACGATTCCC -Primer <2 237 III11II I III I III 111 ACACACGGTTGCTAAGGGAAAGTATTCAATGTAATGTCCATGAGTGAATTTAAGCGAACT A A A A A i 290 250 260 270 280 300 B C CATTTTTATACCACACCC Ckalilo] (100) ** * * CACATGTCCAATCTACAT S-2 ACTATAATATATG Kluueromyces promoter TTATTATATATATAAGTA Yeast mitochondrial promoter tel CACCACACCC Ckalilo] < 12) TG ( 34) TTTGTGATCTTTTT-TATCAT-TTCTAGTA-CTCT CTC *** *** ***** * **** * * * * * * * * * * ( 68) TTTT-TGA—TTTTT-T-TCAT-TTTTA-TACCACACCCT &&&& j. j, £££*|.ib Jr jk}kjk ( 13 ) TTTTGT-TCCTATTTTA ACCC te l - AAAGTATACAAGC-ACAT m ******** (18) GT—CCAATCTACAT ( 67)} < 101)1 Ckalilo] ( 33), (17) (38) Part I: Transcript ional Properties of k a l D N A Promoter Sequences Figure 26A shows the sequence around the 5' R N A end, and figure 26B is a comparison of the sequence around the kalilo R N A start site and other putative promoters. Kal i lo does not seem to share extensive similarities with any of the promoters or upstream sequences described for other linear plasmids. T h e sequence shown in figure 26B for the yeast Kluyveromyces lactis occurs approximately 10 nucleotides f rom the 5' R N A start, site in all four promoters of the K 2 killer plasmid and it has been identified as a promoter element for the plasmids in that system (Sor and F u k u h a r a , 1985). T h i s is the first linear plasmid promoter to be identified, and it does not show homology to kalilo. However promoter homologies may not be expected between these two systems, because the Kluyveromyces plasmids are not found in the mitochondrion, and because this promoter is capable of forming a secondary structure which the kalilo plasmid lacks. A 5' R N A start site has recently been identified for the S-2 mitochondrial plasmid (Traynor arid Levings, 1986). T h e sequences upstream of the R N A start site in the maize system do not show any similarity to the kalilo sequences either, although the two mitochondrial plasmids might be expected to have similar promoters. A mitochondrial promoter element, has been described for yeast (Osinga et al, 1984). T h e consensus sequence which is found at the beginning of all mitochondrial transcription units forms part of a larger sequence that was previously found 5' to the transcription start site for the mitochondrial r R N A genes (Osinga and T a b a k , 1982). Interestingly, the kalilo 5' region shows similarity to the r R N A upstream regions, but not to the yeast promoter itself. Neither does the kalilo sequence share similarity with the N. crassa mitochondrial promoter, T T A G A R R ( T / G ) R ( T / G ) A (Kennel and Lambowitz , 1989). A homology that has been identified is that of the kalilo 5' region with regions further upstream. T h e sequence at the very end of the plasmid is almost identical to the region exactly preceding the 5' R N A start site. T h i s duplication seems to be a general one for, as figure 26C shows, the 5' regions of both kalilo and the S-2 plasmid 129 Part I: Transcriptional Properties of kalDNA seem to contain direct repeats. It is not known if these repeats have any bearing on the promotion of transcription in these plasmids, but the striking kaiilo repeats, each approximately 30 bp long, would be expected to have some function. Interactions with m t D N A One further experiment was performed to determine kalilo's interaction with the resident mitochondrial transcription apparatus. It was of interest to identify the pattern of transcription of the mitochondrial genes in the region surrounding an insert of kaiilo. It was suspected that kaiilo would affect RNA transcription and processing in these regions not only because of simple insertional mutagenesis of the local mtDNA sequence, but because of the long inverted repeats of mtDNA that kaiilo generates upon insertion (shown in figure 6 in the introduction). Figure 27 is a northern blot of mtRNA from senescent and non-senescent strains of N. intermedia which was probed with a radioactive DNA homologous to the intron of the 25S rRNA gene. Strain 561 has an insert of kaiilo DNA into this intron (Bertrand et al, 1985; 1986). It can be seen that there are major differences in the patterns of transcription between senescent and non-senescent control lanes. Specifically, the intron of the 25S rRNA gene, which is the mRNA for the ribosomal S-5 protein, has multiple bands in lanes 561-7 and 561-8, while in control strain 605 only a single band is apparent. The changes are more severe in lane 561-8 than 561-7, suggesting that the alterations are becoming more severe as the culture ages. Much research has been done on the splicing of this intron. Interestingly, mutations which affect the splicing of this intron generally lead to higher molecular weight splicing intermediates (Bertrand et al, 1982). However, it appears as though the effect that kaiilo is having on the transcription in the region is complex, because no high-molecular-weight splicing intermediates are seen, and instead multiple RNAs are apparent, which do not? correspond to known splice sites. There is also a transcript which seems to be a number of nucleotides larger 130 Part. I: Transcriptional Properties of kalDNA than the wild type version of the 25S rRNA intron. It is unclear how a 8.6 kb insertion into the region should lead to these changes but it would be of interest to determine how kalilo is directing these transcriptional anomalies. For instance, kalilo may be capable of acting as a transcription promoter, terminator or splice site for RNA transcribed from the surrounding mtDNA region, and the long inverted repeats of mtDNA that surround mtlS-kalDNA would be expected to cause some of the changes of the type seen in the transcription pattern. 131 Part I: Transcr ipt ional Properties of k a l D N A Figure 27. Northern Analysis of the m t D N A Region Surrounding the Insert of Kaiilo in Strain 561-7. T o t a l R N A from the indicated strains was used to prepare the autoradiograph of the northern blot shown. T h e northern blot was probed with the m t D N A clone H i n d 111-13, 18, which is specific for the r R N A intron, as shown. In Neurospora, this intron is stable as the mRNA for the S-5 ribosomal protein. 132 00 J - J . i n ^ ^ fl i n i n o kb 2.3 rRNA intron < S - 5 mRNA) Hind 111—13, 18 Part I: Transcriptional Properties of kalDNA DISCUSSION The kaliio plasmid of Neurospora intermedia was found to encode constituitive transcripts with the following molecular weights: 0.9, 1.2, 1.3, 4.0, 4.4, and 8.6 kb. Two bands at 2.0 and 3.5 kb which were seen to comigrate with the rRNAs were hypothesized to be artifactual. Dot blots have confirmed the mitochondrial location of the plasmid, and that the plasmid is increasingly transcribed as a culture ages. Kalilo-specific RNA appears to be unstable in affected strains of Neurospora intermedia, as northerns probed with kalilo-specific probes have high background hybridization, and distinct bands are often difficult to see above this background. Non-kalilo specific transcripts do not seem to be affected in this manner. A transcript map was generated which found the 5' ends of all transcripts mapped closely to the ends of the linear plasmid. Primer extensions identified a unique 5' RNA end located in the TIR of kaiilo DNA. While the actual promoter is unknown, the sequence of the upstream regions from the 5' RNA start site has only short similarities with other putative promoters. The upstream sequence of kaiilo, beginning at termini of the plasmid and ending at the 5' RNA end, was found to contain several long directly repeated motifs. Related Sequence Elements Repeated sequences associated with terminal regions have been identified in other linear dsDNA systems. The TIR of the phage Cp-1 is composed of directly repeated elements that encompass 50% of nucleotides of the 236 bp TIR (Escarmis et al, 1984). The Streptomyces rochei plasmid has a number of direct and inverted repeats in the 614 bp TIR (Hirochika et al, 1984). The purpose of this sequence motif is not clear, but a similar situation is found for the S-2 plasmid of maize (shown in figure 26C). Finally, the TIRs of the K. lactis plasmids, although they are not homologous and are not essentially promoter elements, are composed of many stretches of thymidine residues (Sor et al, 1983), a sequence that is reminiscent of the upstream sequence of kaiilo (figure 134 Part I: Transcriptional Properties of kalDNA 26A). Therefore this sequence structure may be a general one for these linear elements and the sequence in this area may help to classify the linear plasmids into discrete evolutionary groupings. An interesting finding is the repetition of a sequence in the promoter regions with a sequence at the termini of the linear plasmid. This suggests the possibility that the RNA polymerase may be bifunctional, and that some of the functions used for priming RNA transcription may also be used in the synthesis of the DNA. If this sequence is important for the binding of RNA polymerase to the DNA, then the binding of RNA polymerase to the telomeres of the kaiilo plasmid may have some as yet unknown function, such as opening up the ends of the DNA for replication. The observation that other linear plasmids have directly repeated elements in this region suggests that the mechanism may be a general one. Transcription of Other Linear Plasmids The transcription map of kaiilo can be compared to that known for other linear plasmids. Almost all linear plasmids that have been characterized in this way are, or seem to be, promoted from the termini of the plasmid towards the center. The situation in the S-2 plasmid of maize is very similar to that of kaiilo. The 5' RNA start site for the two transcripts of the S-2 plasmid is found to be 32 nucleotides from the ends of the plasmid, in comparison to nucleotide 101 in the case of kaiilo. The S-2 transcripts terminate after transcribing their respective ORFs. The S-2 transcripts are 4.1 and 1.35 kb and encompass almost the entire 5.4 kb plasmid (Traynor and Levings, 1986). These transcripts are reminiscent of the 4.0 and 4.4 kb kaiilo transcripts, which encompass almost the entire 8.6 kb plasmid. The Claviceps purpurea plasmid, pClKl is almost fully transcribed into two transcripts of 3.5 and 3.15 kb which map to either end of the 6.7 kb plasmid, and several smaller RNAs are apparent (Diivell et al, 1988). Although unmapped, The Sorghum bicolor N-2 plasmid gives rise to two transcripts the sum of whose length is close to that of the plasmid, and are 135 Part. I: Transcriptional Properties of k a l D N A consistent with this scheme (Chase and Pr ing , 1986). Transcript ion of the killer plasmids of Kluyveromyces lactis, however, seems to be somewhat different. T h e killer plasmid k l contains four O R F s , none of which is promoted from within the internal repeat (figure 9; Sor and F u k u h a h r a , 1985). Also, the K. lactis plasmid is the only non-mitochondrial example. Nonetheless, the K. lactis promoters do show weak similarity to the S-2 and the kalilo upstream sequences. Therefore, amongst mitochondrial linear plasmids, it is common for the plasmid to be transcribed into two major transcripts which cover almost, the entire length of the plasmid. Kalilo R N A Phenomena Association of Kalilo Transcripts with rRNA T h e comigration of r R N A bands and kalilo-specific R N A s of heterologous molecular weight has been reported here. While cross hybridization of probes to r R N A bands is not unusual , the case presented here is relatively extreme; often, only the artifactual bands are seen on a northern. T h e effect is seen with every kalilo specific probe that is used, and cross-hybridization with non-senescent control R N A has never been seen. Explanations which allow for the presence of discrete 2.0 and 3.5 kb transcripts and are consistent with the experimental data can be envisioned. For instance, the results shown in figures 19, 20, 21 and 23 can be resolved if the bands that are seen in the autoradiographs at 2.0 and 3.5 kb are not discrete bands, but each band consists of a number of transcripts, and if each of the 4.0 and 4.4 kb transcripts has a truncated and processed 2.0 and 3.5 kb version. In light of the observation that all transcripts seen are truncated versions of the larger transcripts, this is a remote possibility. Another possibility is that kalilo transcripts could have the capability to trans-splice segments of themselves onto other R N A s . T h i s ability is known for another Neurospora mitochondrial plasmid, where a plasmid specific, transcript has been found to have a 5' 136 Part I: Transcript ional Properties of k a l D N A leader derived from the mitochondrial r R N A (Akins et al, 1988). However, the simplest explanation for the prominent 2.0 and 3.5 kb bands in northerns is that this result is artifactual. T h e mechanism is one whereby sequences of interest become trapped in front of, or bound within the r R N A fraction as it migrates through a gel. Th<; close association of kaiilo and r R N A could be related to the fact that kaiilo and r R N A are both A : T rich, although cross hybridization of kaiilo and r R N A of non-senescent strains is not observed. Final ly , T r a y n o r and Levings (1986) have described predominant 2.0 and 3.5 kb bands in their discussion of their inability to produce discrete northerns from the S - l plasmid, and Stark et al (1984) have described r R N A artifacts in K l - p r o b e d northerns of Poly A + Kluyveromyces lactis R N A ; this suggests that the problem may be a general one for this kind of system. T h e hypothesis that the 2.0 and 3.5 kb bands are artifactual helps to explain some of the observations seen in the analysis of the different R N A fractions. These observations are that the 2.0 and 3.5 kb bands are missing in lane 561-7 of the m t R N A panel of figure 12, and the general observation that poly A 4- R N A improved the appearance of the northerns. O n l y the 0.9, 1.2, and 1.3 kb transcripts are apparent in the 561-7 lane from the m t R N A panel of figure. 12, although the mapping experiments have shown that more transcripts should be detected by the probes used in that figure. W h e n the hypothesis that the 2.0 and 3.5 kb bands were formed by comigration with r R N A s is taken into account, this observation can be explained as follows: Lane 561-7 of m t R N A portion of the figure probably contains m t R N A that was isolated relatively free of any contaminating r R N A . T h e 595-1 lane of m t R N A still exhibits prominent 2.0 and 3.5 kb bands, so mitochondria were probably not purified free of ribosomes in that lane of the figure. T h e hypothesis that the 595-1 lane contains r R N A , and that the 561-7 lane does not contain r R N A is consistent with the observation that although lane 595-1 of the m t R N A panel contains 5 (ig of R N A , and the 561-7 lane contains only 1 ng of R N A , they appear to have similar amounts of material hybridizing to 137 Part I: Transcriptional Properties of k a l D N A mitochondrial specific probes. T h i s can be seen in both of the m t R N A hybridizations, although there appears to be a greater amount of kalilo-hybridizing material in the 595-1 lane. T h e extra material in the 595-1 R N A isolation is thought to be caused by r R N A contamination. Therefore, the missing 2.0 and 3.5 kb bands in lane 561-7 of the m t R N A panel of figure 12 correlates with the absence of r R N A in that nucleic acid isolation. Similarly,the use of poly A + R N A was generally found to lead to an increase in the quality of the 4.4 and 4.0 kb bands seen on a northern. In retrospect this too was probably due to the lower concentration of r R N A in the poly A + R N A fraction, although figure 19 clearly shows that the Poly A - f R N A still contained ample r R N A to cause the comigration of kalilo-specific transcripts with the r R N A . T h e use of total R N A in these experiments may have inadvertently led to an increase in the presence of the prominent 2.0 and 3.5 kb bands. T h e decision not to use m t R N A in these experiments was based on the observation that high molecular weight bands were almost always missing in preparations of m t R N A . T h e use of m t R N A may have led quickly to the conclusion that the 3.5 and 2.0 kb band were artifacts, but it is very difficult to detect the large transcripts in m t R N A . If the loss of the 8.6, 4.4, and 4.0 kb transcripts is due to the instability of the R N A during the long centrifuga.tions required in the isolation of mitochondria, then this is also a problem. It was difficult to overcome these technical problems in this system, but it is thought that the use of a total R N A isolation protocol which included a quick freeze in liquid N 2 was justified as a solution to the problem of low quality R N A . Variability and Heterogeneity of Kalilo-Specific RNA Several explanations for the heterogeneity seen in the R N A from this system have been tested. A s A k i n s et al (1989) have suggested, senescent mycelia and/or mitochondria may have elevated levels of R N A s e activity, but if so, then the R N A s e is acting preferentially on the kalilo-138 Part I: Transcriptional Properties of k a l D N A specific sequences, because as can be seen from figure 12, many non-plasmid transcripts appear intact. Alternatively, the heterogeneity may have been due to interaction of inserted copies of the plasmid with the mitochondrial transcription apparatus. However, because R N A prepared from strains of A r. intermedia without detectable inserts of the plasmid does not appear any less degraded than that prepared from strains with inserts (figures 16 and 17), this does not appear to be the explanation. T h e conclusion that these strains do not contain inserts is strengthened by figure 30 in part II of the thesis, in which the. experimentsothat show that these two strains (and others) do not have detectable inserts are repeated. E v e n if these strains contain undetectable levels of molecules with inserts, this does not necessarily mean that the heterogeneity seen in the R N A is f rom the transcriptional read-through of the inserts. T h i s conclusion is based upon two observations. T h e first is that if read-through of inserts is the source of the transcription seen in figure 17, then the amount of R N A being transcribed from these inserts and causing the heterogeneity is far in excess of the amount of D N A present, because blot technology can detect transcripts, but seems unable to detect inserts. T h e dotblot in figure 18 confirms that detection of R N A and D N A species is comparable, therefore it is unlikely that a minute population of m t D N A molecules with inserts would give rise to the heterogeneous R N A that is seen m figure 17. T h e second consideration is that there is no a priori reason why inserts should be responsible for the heterogeneity seen in the R N A , it is merely a possibility. Therefore even the presence of low amounts of m t l S - k a l D N A is not thought to be crucial to the hypothesis that kalilo-specific R N A is unstable in affected strains of N. intermedia. R N A size heterogeneity has been seen in other systems. Maize m t D N A contains inserts of both S - l and S-2 D N A (Kemble and M a n s , 1983; Schardl et al, 1984), yet T r a y n o r and Levings have reported that only S - l R N A is highly heterogeneous, suggesting that there must be some other explanation for variability in the R N A . T w o possibilities are that kaiilo R N A must be selectively unstable, or the plasmid transcription apparatus may be very inefficient, falling off at any time after 139 Part I: Transcriptional Properties of k a l D N A transcript initiation. It is interesting to note that despite the state of the R N A from northern analysis, information is still obtainable from transcript m a p p i n g techniques. T h e reasons for this are not entirely clear, however, long exposures of both SI protection gels and primer extension experiments reveal background hybridization that is similar to that seen in northern blots (data not shown). T h e apparent variability in the ability to detect the presence of the 8.6, 4.4 and 4.0 kb transcripts may have several sources. O n e explanation is that they are simply of too low a level to be easily detected, and that there is usually a high enough background that they cannot be seen above it. T h i s could be compounded by inefficiencies in the capillary blot method used to transfer the nucleic acids to membranes. A l t h o u g h mild alkaline hydrolysis was always employed to improve transfer of high molecular weight R N A , this process may not always have been highly repeatable. M i l d variations in the molarity of the 50 m M N a O H used to hydrolyse the R N A , or fluctuations in the molarity of the gel running buffer might have led to inefficient hydrolysis during the alkaline treatment. A l s o , repeated reuse of the membranes may have led to decreasing hybridizations in the high molecular weight region. Final ly , it is also possible that the 8.6, 4.4, and 4.0 kb transcripts, or the background R N A , have variable levels in culture, and that is what is observed in specific blots, although it should be noted that no easily identifiable differences were observed between different R N A isolations from these senescent strains. Possibility of Other RNAs T h e results presented here do not specifically exclude the possibility that there are other low level m R N A s f rom the kalilo plasmid. Indeed amongst the high background observed for the element there could be numerous transcripts, albeit at low levels. T h e possibility of spliced transcripts has been excluded only for splice sites within the two restriction fragments used for nuclease SI analysis 140 Part I: Transcriptional Properties of k a l D N A in figure 23. T h e existence of other promoters on the element is also a possibility, although the presence of a full length transcript ensures that the sequences are transcribed into R N A anyway. In light of the fact that there is apparently information missing which should be required for the kalilo plasmid to function (e.g., the terminal protein m R N A ) , the possibility of other transcripts seems attractive. However, other transcripts were not detected; multiple replicate northern blots have never revealed one of these transcripts. T h e low copy number of an undiscovered transcript suggests that it could not encode a structural function of the plasmid, although it is possible that a low copy number transcript could be translated at a very high level. Further , now that the sequence of the linear plasmid is known, only O R F s corresponding to the 4.4 and 4.0 kb transcripts are apparent. T h e possibility of a mult iply processed transcript seems rare, because there are no known sequence motifs for splice sites. It is for these reasons that the transcription map shown in figure 24 is thought to be complete, and that, no other kalilo m R N A s are thought to exist. RNA Phenomena from Other Systems A final note on strange phenomena concerning the transcription of mitochondrial plasmids occurs with the Labelle circular mitochondrial plasmid of N. intermedia. T h i s plasmid has been found to be transcribed at a very low level, so researchers employed the use of Bluescribe single-stranded R N A probes labelled to high activity to probe northern blots. One strand corresponding to the O R F of this plasmid, which the reader is reminded resembles a group II intron, hybridizes to a heterogeneous family of R N A species. These R N A s range in size from 1.5 to 4.1 kb, the largest of which resembles a full length transcript, and one major transcript is reported to be of 3.2 kb. It is not known if the smaller transcripts are discrete transcripts, incomplete transcripts, or degradation products of the larger transcripts, or possibly artifacts due to r R N A s may again be involved. A m a z i n g l y however, the opposite strand of the Bluescribe vector hybridizes to a number of high 141 Part I: Transcriptional Properties of k a l D N A molecular weight nucleic acids which were not susceptible to R N A s e treatment, and does not hybridize to R N A s . Therefore, the Labelle plasmid gives rise to a number of high molecular weight single stranded D N A s , and to a heterogeneous family of degraded R N A s (Pande et al, 1989). T h e suggestion is that the peculiarities discovered in the kaiilo system may be more common to mitochondrial biology than previously known. Evolution and Function T h e evolution of linear plasmids is an intriguing phenomenon. Prokaryotes have examples of plasmids and viruses that show a linear structure. Eukaryotes too, have viruses, (Adenovirus) , cytosolic plasmids (K. lactis killer plasmids), and mitochondrial plasmids that are linear. Linear plasmids from diverse organisms have never been reported to have nucleotide homologies, however the structural similarities which exist amongst some of these elements is striking: linearity, cellular location, size, O R F location, protein sequence homologies, transcription properties, etc. T h i s suggests that the elements are somehow related, but how so is not clear. Convergent evolution of so many elements of this type is considered unlikely, because of the unique end structure and O R F homologies, however, it is possible. Some mitochondrial elements are very ancient. In Neurospora mitochondria, the circular mitochondrial plasmids have relationships to introns and mobile elements; they replicate via reverse transcription of full length R N A , and seem to be related to the progenitors of certain introns (Nargang et al, 1984; Pande et al, 1989; A k i n s et al, 1988). If the mitochondrial linear plasmids were also very ancient, then they could be related to viruses or plasmids of mitochondrial progenitors. B y analogy, cytosolic or nuclear D N A plasmids could be related to eukaryotic viruses. A s more and more of these elements are described (some may even be discovered in organisms where plasmids previously went undetected (see Chardon-Loriaux,1986; K e e n et al, 1988; Myers et al, 1989)), then their evolutionary origins may become more apparent, and the 142 Part I: Transcriptional Properties of k a l D N A identification of similarities based upon promoter usage or other criteria may help to delineate these plasmids into an evolutionary grouping. In the prototypic senescence strain P561, m t l S - k a l D N A is found located in the intron of the 25S r R N A gene. In Neurospora mitochondria, this iiitron is found to encode an O R F that is thought to be the gene for the S-5 ribosomal protein. Therefore, the suppressive accumulation of m t D N A s which have this transcription unit disrupted is thought to be deleterious for the organism. Y e t , m a n y other insertion sites of m t l S - k a l D N A are known, and indeed, many seem to be into regions of the m t D N A which do not encode any functions whatsoever. T h e reason that these organisms should die is not clear. Because kalilo insertion has such profound effects on the transcripts originating from the ribosomal intron region, the possibility exists that its deleterious nature in non-coding regions may be due to the effect it has on transcription and processing. O f course, these complex changes also may be due to the long inverted repeats of m t D N A that kalilo generates upon insertion (Chan et. al, 1989a). Kal i lo is a linear plasmid with terminal proteins which causes senescence in affected strains of Neurospora intermedia by insertion into the mitochondrial chromosome, which leads to the subsequent generation of gross rearrangements of the m t D N A (Dasgupta et al, 1988). Y e t , for this complicated lifestyle, kalilo is found to have only two O R F s , one a potential D N A polymerase, and one an R N A polymerase (Chan and Bertrand, 1988). B y the analysis of transcription of the element, it has been determined that only the O R F s are transcribed, and that no new information is generated via R N A processing. T h i s leads to some questions: for instance, what causes the unique insertion regimen (Dasgupta et al, 1988); where is the terminal protein encoded; and are other proteins required for maintenance of the D N A plasmid? A number of possibilities present themselves. First , some functions may be encoded by the nuclear a n d / o r mitochondrial genome of affected strains, especially if kalilo is very ancient and coevolved with mitochondria. A prediction of 143 Part. I: Transcriptional Properties of k a l D N A this hypothesis is that the plasmid will not be maintained in distantly related organisms, because this information will be missing. Second, if the insertion of kaiilo into the m t D N A were not inherent phenotypes of the plasmid, then the kaiilo phenotypes of senescence and m t D N A rearrangements would be gratuitous and would be seen with other mitochondrial plasmids. T h i s is a distinct possibility given that the maranhar plasmid seems to yield a similar phenotype and rearrangements, although the two elements have no sequence homology (Court et al, 1988). A third explanation for the missing information is that the identified kaiilo O R F s may encode proteins with more than one function. Demonstration of this will require further experimentation. F o u r t h , Amongst the highly heterogeneous kaiilo R N A there may be other discrete transcripts which have gone undetected. W h i l e this is certainly a possibility, if the terminal protein were encoded by one of these it would have to be translated at a very high level, as it is a structural gene whose product is required at two copies per D N A molecule. F inal ly , although kaiilo is found to be copiously transcribed, the transcripts corresponding to the O R F s are not the major transcripts, and further, they contain over one kb of 5' untranslated leader. T h e smaller transcripts may have function as well. Diivel l et al (1988) have also reported small R N A species in addition to the large transcripts. Catalytic R N A has been identified in mitochondria, and it is not inconceivable that the small R N A s of kaiilo may also have some function, perhaps in catalyzing insertion of the element, or in the regulation of translation or splicing. T h e vast majority of linear plasmids are cryptic. T h e plasmids themselves appear to encode functions necessary for the maintenance or their D N A , but little else. Indeed, when there are two or more of the plasmids (Diivell et al, 1988; K e m b l e and M a n s , 1983; Baszczynski and Kemble , 1982) homology between the two is restricted to the T I R . Often many plasmids of different sizes will be found (Diivell et al, 1988; Kemble and M a n s , 1983; Baszczynski and K e m b l e , 1982). If it is true that the D N A replication apparatus will replicate anything that lies between the T I R s , then when 144 Part I: Transcriptional Properties of k a l D N A phenotypes do exist, they may simply be cases in which gratuitous sequences of D N A have inserted into the plasmids. T h i s may be a reason why the plasmids are often found in pairs. A phenotypic plasmid depends on the other for survival . However, this phenotypic maintenance design is not the case for the killer plasmids of Kluyveromyces , as the T I R s of the two plasmids show no homology in this system (Sor et al, 1983), and two different D N A polymerases are thought to exist (Stark and B o y d , 1986; T o k u n g a et al, 1987; K i t a d a and Gunge , 1988). A n often overlooked fact is the occurrence of a circular mitochondrial plasmid in the kalilo strains of N. intermedia. It is not known how this plasmid is related to the other circular mitochondrial plasmids. Bertrand et al (1985) have dismissed the circular plasmid as being unconnected with senescence, however in light of the amazing behaviour exhibited by the circular plasmids which have been studied, it is possible that some of the transcriptional phenomena, of kalilo, and indeed the senescence phenotype itself, may have something to do with interactions between these two elements. For instance, if kalilo mitochondria, contain a reverse transcriptase activity, then reverse transcription of the full length kalilo R N A would yield a panhandle D N A structure due to the kalilo T I R , which could possibly be recombinagenic and responsible for the unique insertional regimen of kalilo ( C h a n et al, 1989a). T h e study of this mitochondrial plasmid and its interactions with the kalilo plasmid suggest an interesting project. 145 Part II: Parallel Subculture Series Experiments P A R T II: P A R A L L E L S U B C U L T U R E SERIES E X P E R I M E N T S INTRODUCTION T h e search for function on kaiilo in this part of the thesis has been extended to observations on the behaviour of the linear plasmid in large numbers of subcultures, and has been centered around the problem of determining what kaiilo is programmed to do. Senescent strains of N. intermedia f rom the island of K a u a i undergo a number of complex events during the senescence process. W h i l e many of these changes resemble the mitochondrial aberrations that occur with cytoplasmic mutants such as stopper, the kaiilo senescence process has been shown to be highly programmed and repeatable in the wild isolates of kaiilo containing strains of N. intermedia (Griffiths and Ber t rand, 1984). A l t h o u g h it is known that almost any mitochondrial aberration can lead to the suppressive accumulation of defective D N A s , the observation that kaiilo induced senescence is a highly repeatable process leads to the conclusion that there must be some aspect of kaiilo senescence that is directed by the linear plasmid in addition to its maintenance functions. It is expected that the t iming of insertion of kaiilo, the location of the insertion of kaiilo, or some other aspect of its behaviour must correlate with the occurrence of senescence. T h e parallel series experiments were designed to identify any functions of kaiilo which correlate with the senescence process, and were performed in part because of the new information that was received concerning the intracellular location of kaiilo. Bertrand et al (1986) reported that A R - k a l D N A was a nuclear or non-mitochondrial plasmid, while Myers et al (1989) have reported that kaiilo specific D N A sequences are entirely mitochondrial . T h e reason for the confusion as to the cellular location of the A R form of k a l D N A is hypothesized to be due to the presence of proteins on the ends of the linear D N A . T h i s is shown dramatically in figure 28, where a number of parallel isolations of m t D N A have been performed, with and without a proteinase K step in the isolation 146 Part II: Parallel Subculture Series Experiments protocol prior to phenol/chloroform precipitation of the proteins. W h e n the proteinase K step is omitted, m t A R - k a l D N A is usually not seen, while when the proteinase step is performed, plasmids are readily evident. It is apparent f rom the "+" lanes in the figure that isolation of the linear plasmid is a highly repeatable process with proteinase K treatment. T h e linear plasmid was not discovered in the mitochondria because m t D N A is not routinely proteinased during the isolation procedure. T h e linear plasrnid's location was incorrectly assigned to the non-mitochondrial compartment because of the characteristics of the various D N A and organelle isolation procedures: while it is possible to isolate nuclei-free mitochondria through the sucrose gradient procedure, it is not possible to isolate mitochondria-free nuclei (Bertrand et al, 1986). A n unfortunate result of these isolation procedures was that, the linear plasmid was not identified in the mitochondrion, but rather in the nucleus; the standard protocol for the isolation of Neurospora nuclear D N A has an overnight proteinase K step that is capable of liberating the linear plasmid from the contaminating mitochondria . 147 Part II: Parallel Subculture Series Experiments Figure 28. Proteinase K is Required For and Leads to Repeatable Isolation of mt A R - k a l D N A A photograph of an e thidium bromide stained gel is presented showing D N A from parallel D N A isolations. C o n t r o l lanes contain m t D N A from strain 605, while senescent lanes contain m t D N A from strain 561-7. T h e + and - signs refer to the use of a proteinase K digestion of the m t D N A prior to phenol /chloroform extraction of protein. Lane L contains the B R L 1 kb ladder. 148 CONTROLS SENESCENT Part. II: Parallel Subculture Series Experiments A consequence of the inability to repeatedly isolate the linear mitochondrial plasmid is that its behaviour has never been studied. Its apparent transient nature led to the suggestion that it was an intermediate in transposition of the element f rom the nucleus to mitochondrion (Myers. 1988). It is now known that this interpretation is incorrect, which implies that the behaviour of the linear plasmid is also not known, because systematic experiments utilizing a proteinase K step in D N A isolations have never been performed. T h i s situation has been reconciled somewhat b y a recent study. M y e r s et al, (1989) studied the somatic transmission of m t l S - k a l D N A to determine what events if any, could be correlated with the longevity of a senescent strain. T h e y had noticed that the progeny of crosses between senescent parents had very different lifespans, and they hypothesized that the differences could be due to the behaviour of m t l S - k a l D N A in somatic culture. T h i s analysis led to the discovery of m t A R - k a l D N A . Y o u n g strains did not inherit inserts, only m t A R - k a l D N A , and inserts of m t l S - k a l D N A continued to be generated until the development of senescence. T h e situation described by this result differed somewhat f rom that originally reported by Bertrand et al (1985; 1986), although they too felt that the juvenile cultures had wild type m t D N A s . Myers et al (1989) showed that as a culture grows, de novo inserts of m t l S - k a l D N A arise, and that some of these, termed lethal inserts, are maintained until the death of the organism. Other inserts do not seem to be lethal, and cultures which have one of these non-lethal inserts grow until subsequent inserts arise which persist unti l the death of the culture. It was surmised that differences in lifespan were due to the movement of the inserts of m t l S -k a l D N A , unt i l death was caused by the generation of a lethal insert (Myers et al, 1989). However, because proteinase K was not used systematically throughout that study, the behaviour of the linear plasmid in the senescent cultures could not be determined. In this part of the thesis, the next logical step is taken—the behaviour of the linear plasmid is followed in parallel series of genetically identical strains to see what the plasmid is programmed to 150 Part II: Parallel Subculture Series Experiments do. It was thought that all strains lived to be the same age, and if lethal inserts were the programmed event causing senescence, they would have to be generated at the same time. Parallel series experiments were performed on 10 progeny of senescent crosses. T e n clonal subcultures of each representative individual were prepared, and subjected to serial subculturing unti l death. T h i s was termed a parallel series. Parallel series were generated as an experimental protocol to overcome the problem of mitochondrial heterogeneity in the senescent kalilo clones. It was hoped that by examining a large number of genetically identical strains of kalilo, it would be possible to separate programmed events in that clone from r a n d o m events occurring in the mitochondrion; a programmed event, such as lifespan or the appearance of a lethal insert of m t l S - k a l D N A , should befall all members of a parallel series, while r a n d o m events, such as mitochondrial rearrangements or the generation of non-lethal inserts of m t l S - k a l D N A , should appear as differences between the otherwise genetically identical members of a parallel series. T h e parallel series experiments were performed on strains that were generated from crosses of the senescent prototype strain P561-0 or -1 and non senescent male parents, and were introduced in part I of the thesis. Strains 1-4 and X l - 5 are progeny of these crosses. Crosses using the Taiwanese male parent 1766 were described by Griffiths and Ber t rand (1984), and ascospore progeny are prefixed by an I. Crosses using the Hawaiian male parent P605 were described by Myers (1988), and ascospore progeny from this cross are prefixed by X I . T h e lifespans of these cultures generally seemed to be longer than that of their female parent. T h e progeny of the cross between 561-0 and 1766 gave rise to individuals whose lifespans ranged f rom less than 10 to more than 20 subcultures (Griffiths and Ber t rand, 1984), while strain 561 had originally been reported to live to only 10 subcultures. It had been assumed that the lifespan of these cultures was under as tight control as that of their female parent, however here it is reported that the lifespan of these and other progeny of senescent female parents are not as tightly controlled as once thought. These and a number of 151 Part II: Parallel Subculture Series Experiments other observations are reported on senescence and mitochondrial phenomena which are occurring during senescence in kaiilo strains of Neurospora intermedia. Generation of inserts of m t l S - k a l D N A seems to be r a n d o m among individuals, however some individuals seem to have a predisposition towards certain inserts. Insertion of m t l S - k a l D N A is an early event in the senescence process, but it does not appear to be the unique event which is required to cause the death of an individual . Rather it is subsequent events, such as gross rearrangements of the m t D N A which seem to correlate with the death of the organism. F inal ly some experiments on the structure of senescent m t D N A s are presented. RESULTS T h e restriction digest protocol which has been used to identify inserts of m t l S - k a l D N A was presented earlier. Figure 29 is a reprint of figure 15, which is a diagram of the restriction digest protocol which can be used to detect inserts of m t l S - k a l D N A , and figure 30 is a characterization of the m t D N A from a number of juvenile progeny of senescent female parents. F r o m figure 29 it can be seen that the probe, X3, has homology to the inverted repeats of kaiilo. Therefore in a Southern Blot , it will hybridize to all restriction fragments which have homology to the inverted repeats. In a Bgl II digest, the restriction fragments of the linear plasmid which hybridize to X 3 are b l and b2, the ends of the linear plasmid. However, m t l S - k a l D N A does not give rise to b l and b2 upon digestion with Bgl II. Instead, it gives rise to two m t D N A / m t l S - k a l D N A junction fragments, b l ' and b2', which must be of equal or greater molecular weight than b l and b2. Therefore, in a Southern blot of Bgl II digested m t D N A probed with X 3 , the presence of two bands with mobilities equal to b l and b2 suggests that no insert of kaiilo is present in the D N A , but that free plasmid is contained in the preparation, while the presence of higher molecular weight bands which hybridize to X 3 indicate the presence of kaiilo inserts in the m t D N A . 152 Part II: Parallel Subculture Series Experiments Figure 29. Diagram of the Generation of b l ' and b2' Junction Fragments for the Detection of mtlS-kalDNA. m t A R - k a l D N A , the linear plasmid, is diagrammed in the top of the figure, and m t l S -k a l D N A , a m t D N A insertion sequence, is diagrammed at the bot tom of the figure. T h e kalilo inverted repeat probe, X 3 , is shown, b l , b2, b3 and b4, are Bgl II restriction fragments of the linear plasmid, as shown, b l ' a n d b2' are the restriction fragments produced by B g l II digestion of the m t D N A containing an insert of m t l S - k a l D N A . T h e relative sizes of b l ' and b2'.are variable and are dependent on the distance to the next B g l II site in the m t D N A . T h i s diagram for the interpretation of experiments was presented in figure 15. 153 Part II: Parallel Subculture Series Experiments X3 «tAR-kalDNA X3 •tIS-kalDNA 154 Part II: Parallel Subculture Series Experiments Figure 30. Characterization of the m t D N A From a Number of Senescent Progeny of Strain 561 A number of agarose gels and Southern blots are shown in the panels. T h e strains f rom which the m t D N A has been prepared are indicated at the top of each panel. In the upper panels, D N A has been digested with the B g l II restriction enzyme, and the lower panels contain undigested D N A as indicated. Panel A is an e thidium bromide stained gel. Panels B , C , and D are autoradiographs of Southerns. T h e Southern in panel B was probed with the X 3 clone; conditions which must exist for the occurrence of bands b l , b2, b l ' and b2' in the X 3 probed Southern blot are shown in figure 29. Panel C has been hybridized with the m t D N A clone termed H i n d III-13, 18 in figure 6 in the introduction. Panel D is a long exposure of panel B . In panel B , b l , b2, b l ' and b2' are B g l II restriction fragments of m t A R - k a l D N A , and m t l S - k a l D N A , respectively. In Panel C , Bgl II-4, -12, and -14 are m t D N A fragments with homology to m t D N A fragment H i n d III- 13, 18. b l ' and b2' also have homology to this m t D N A fragment, as indicated. 155 3 n c to, 2 i i t I 1 1 5 s 1 I 1 1= Ii t t 685 X1-4-1 XI-5-1 X1-6-1 X1-7-1 X1-8-I 1-4-1 1-7-1 1-12-1 1-14-1 1-16-1 561-7 685 X1-4-1 XI-5-1 X1-6-1 X1-7-1 X1-8-1 ' 1-4-1 1-7-1 1-12-1 1-14-1 1-16-1 561-7 685 X1-4-1 XI-5-1 X1-6-1 X1-7-1 X1-8-1 1-4-1 1-7-1 1-12-1 1-14-1 1-16-1 561-7 10 a 3" in fD a Part II: Parallel Subculture Series Experiments Figure 30 characterizes the m t D N A of the initial subcultures of the 10 juvenile strains. T h e 10 strains are as follows: five progeny from a single ascus from a cross using Hawaiian strain P605 as a male parent are called X l - 4 , X l - 5 . X l - 6 . X l - 7 , and X l - 8 ; and 5 random ascosopore progeny f rom a cross using Taiwanese strain 1766 as the male parent are called 1-4, 1-7, 1-12, 1-14, and 1-16. In the ethidium bromide stained portion of the figure in panel A , the lower portion of the gel was run uncut and two plasmid bands can be seen in addition to the high molecular weight m t D N A . T h e two plasmids were introduced in figure 16 in part I of the thesis, and they correspond to m t A R -k a l D N A and a cryptic circular mitochondrial plasmid unconnected with senescence (Bertrand et al, 1985). T h e B g l II digest produces 14 B g l II m t D N A fragments in lane 605, a non-senescent control, and extra bands are apparent in the plasmid-containing strains. It is evident f rom panel B of the figure that only bands b l and b2 are detected in the juvenile progeny when probed with the X 3 clone of kaiilo, indicating that m t l S - k a l D N A is not present. Fragments corresponding to junction fragments, b l ' and b2' are seen only in the lane corresponding to the female parent, in lane 561-7, as indicated. In the lower panel, the m t D N A has been run uncut , and it can be seen that the probe hybridizes only to the free plasmid, not to the m t D N A . These results are consistent for the long exposures of this gel shown in panel D . N o bands corresponding to b l ' or b2' are seen in the juvenile strains. In panel C, the D N A s have been hybridized with the m t D N A clone H i n d III-13, 18. T h i s clone is specific for the intron of the 25S R N A gene in N. crassa. T h i s intron contains m t l S - k a l D N A in the female parent, strain P561. H i n d 111-13, 18 is homologous to the three Bgl II restriction fragments indicated in panel C , Bgl II-4, -12 and -14. In addition, the H i n d III-13, 18 probe binds to additional fragments in lane 561-7, labelled b l ' and b2'. T h e bands b l ' and b2' f rom lane 561-7 are homologous to both the m t D N A restriction fragment probe H i n d III-13, 18 in panel C , and to the kaiilo inverted repeat probe X 3 , in panel B ; b l ' and b2' have sequences homologous to both m t D N A and kaiilo as they are the junction fragments of an insert of m t l S - k a l D N A . A g a i n , it is clear that 157 Part II: Parallel Subculture Series Experiments none of the 10 progeny of this parent have received any rearranged fragments with homology to bands b l ' and b2'. T h e conclusion of figure 30 is that the juvenile progeny shown do not contain m t l S - k a l D N A . T h i s conclusion is advanced by another consideration. T o make mitochondrial D N A from strains of Neurospora requires a three step process. T h e first steps involve amplifying the cultures. Therefore the cultures used to make the D N A shown in these strains are not the first cultures, but effectively the th i rd . T h e y have undergone two amplifications to generate enough mycelia to prepare mitochondria ; one to amplify the conidia, and one to grow up mycelia in liquid culture. Therefore the inability to detect any inserted molecules at the level of the Southern blot in the third subculture strengthens the conviction that the cultures had no m t l S - k a l D N A in the first subculture. A final observation pertaining to figure 30 is that the m t D N A corresponding to the senescent female parent is highly degraded. T h i s is evidenced by the absence of the labelling of high molecular weight material in uncut, portion of lane 561-7 of panel B . Because m t l S - k a l D N A is present, the high molecular weight band should be labelled, but only the background appears labelled. T h e highly degraded state of 561-7 m t D N A is confirmed in uncut portion of panel C of the. figure in which the m t D N A probe has failed to detect high molecular weight m t D N A . T h i s is a general property of these highly senescent m t D N A s , they appear degraded in Southern blots. Analysis of Longevity A histogram of the lifespans of the senescent progeny of strains 561-1 and 605 is shown in figure 31, and of strains 561-0 and strain 1766 in figure 32. T h e ten members of each parallel series are indicated by lower case R o m a n numerals after the strain designation, thus I-4-i is parallel culture 1 of strain 1-4. T h e striking differences in the lifespans of the members of a parallel series is immediately apparent. Whereas Griffiths and Bertrand (1984) showed that 20 parallel series f rom a 158 Part II: Parallel Subculture Series Experiments single isolate of strain 801 all died at precisely the same subculture, these strains now show quite a range of longevities. Therefore, the crosses that were performed to generate these individuals have uncoupled some control of the senescence process. Whereas the female parent of these progeny always had a lifespan of 10 subcultures, her progeny have lifespans that are much more variable. A possible explanation for this is that the female parent already contained a lethal insert, and was committed to a predetermined lifespan. It nonetheless appears as though lifespan is a programmed event. T h i s is suggested in table 2, where it can be seen that the mean lifespans of the parallel series correspond closely with the lifespans originally reported for these individuals (Griffiths and Ber t rand, 1984; Myers , 1988). A l l of the strains' lifespans are within one standard deviation of the originally reported lifespan for each culture, with the exception of X l - 4 and X l - 5 . Strain X l - 4 has the smallest standard deviations for its parallel series, so the observation that it does not correlate as closely with the originally reported value suggests something about the range of the lifespan, rather than longevity. T h e lifespans of these two strains do nonetheless fit within two standard deviations of the mean. 159 Part II: Parallel Subculture Series Experiments Table 2. Averages and Standard Deviations of Lifespans (sigma) FALLS MATING M E A N STANDARD ORIGINAL WITHIN STRAIN T Y P E LIFESPAN DEVIATION LIFESPAN 1 sigma 1-4 27.4 12.4 26 yes 1-7 - 13.4 1.6 15 yes 1-12 - 10.8 3.1 13 yes 1-14 - 16.9 3.9 19 yes 1-16 - 12.0 2.3 13 yes Xl-4 A 11.2 1.8 9 no Xl-5 A 13.1 3.6 9 no Xl-6 a 12.7 5.2 8 yes Xl-7 a 9.1 2.7 10 yes Xl-8 a 14.4 9.5 7 yes 160 Part II: Parallel Subculture Series Experiments Figure 31. Lifespans of Members of Parallel Series Derived from Crosses Using Strain 605 as a Male Parent Histograms of the lifespans for each of the members of a parallel series are shown. T h e name of the original culture is shown on the left. T h e 10 parallel cultures are indicated by lowercase R o m a n numerals. T h e lifespans are presented as bars according'to the scale in subcultures at the top and bot tom of the bar graphs. T h e dotted lines indicate the parallel series member that had not died after 41 subcultures. 161 Lifespan in Subcultures C U L T U R E A N D S U B C U L T U R E N U M 6 E R Xl-4 Xl-5 Xl-6 X1-7 X1-8 Lifespan in Subcultures 10 15 20 25 30 35 40 H III iV v v! vii viii ix i M H III iv V vi vi! viii ix I •t II iii iv v vi vii viii ix i II • t i III iv V v! vii Viii ix i II in iv v vi Vii viii ix X 10 15 20 25 30 35 40 162 Part II: Parallel Subculture Series Experiments Figure 32. Lifespans of Members of Parallel Series Derived From Crosses Using Strain 1766 as a Male Parent Histograms of the lifespans for each of the members of a parallel series are shown. T h e name of the original culture is shown on the left. T h e 10 parallel cultures are indicated by lowercase R o m a n numerals. T h e lifespans are presented as bars according to the scale in subcultures at. the top and bottom of the bar graphs. T h e dotted lines indicate parallel series members who had not died after 41 subcultures. 163 Lifespan in Subcultures C U L T U R E A N D S U B C U L T U R E N U M B E R 1-4 1-7 1-12 H4 H6 Lifespan in Subcultures i II HI iV V vi vii viii ix i II HI iv V vi vii Viii ix i ii in iv v vi Vii viii ix i ii Iii iv V vi vii viii iX I ta ii III iv v vi Vii > • • • • VNI iX X 10 15 20 25 30 35 40 10 15 20 25 30 35 40 164 Part II: Parallel Subculture Series Experiments Figure 31 shows that most members of the tetrad of the cross using strain 605 as a female parent live to be between 6 and 15 subcultures, and that only a few isolated clones live beyond 20 subcultures. Because all of these strains are members of a single tetrad, two of these isolates must be clones of one another. Specifically, parallel series members vi, vii and viii are all of mating type a, therefore two of them must be spore pairs. Which two they are is not obvious from the lifespan data. Those two and all members of the tetrad show similar lifespans and ranges, suggesting at this level that the senescence process is random within the confines of a certain range, and does not seem to be under tight control. In contrast to figure 32, where the lifespans appear much more variable, the members of this cross between geographically related strains, live to be similar ages, have similar originally reported lifespans, and the lifespans have similar variation about the mean. This could be explained if the parents are homozygous for some factor capable of influencing lifespan or the senescence process. Figure 32 shows a slightly different story. All the strains shown in this figure are siblings, and all have similar lifespans, with the exception of 1-4 and with the possible exception of 1-16. Culture 1-4 has a very long mean lifespan compared to the other cultures. This cross is from geographically unrelated isolates of the fungus, and the results suggest that some nuclear gene or combination of genes is capable of controlling lifespan, although at what level lifespan is being affected is not known. The prediction of the combined results of figures 31 and 32 is that nuclear genotype, is capable of affecting the senescence process, but that the variability that is present in the lifespan of the clones of an individual makes the identification of these genes difficult, especially if their action is subtle. 165 Part II: Parallel Subculture Series Experiments Molecular Analysis m t D N A was prepared from all 100 parallel series isolates shown in the previous section. T h e nucleic acid was prepared with a proteinase K step to ensure that m t A R - k a l D N A would be isolated. B o t h ethidium bromide-stained gels and Southern blots hybridized with kaiilo probe X 3 were prepared to examine junction fragments as indicators of the presence of m t l S - k a l D N A . Blots were rehybridized with the m t D N A clone H i n d III-13, 18 to determine if any of the inserts were into the same region of the m t D N A as the female parent. T h e D N A isolations were performed when all the cultures of a parallel series had died, or alternatively at some defined point in the growth process. T h i s allowed for differences between living and dead cultures to be determined, so that events which were incidental to the senescence process could be identified. A l l of the D N A isolates were found to contain m t l S - k a l D N A , whether D N A was prepared f rom the final subculture or f rom earlier subcultures. T h i s result is noteworthy because some of the parallel series died within six subcultures, suggesting that the senescence process can occur very rapidly. T h i s analysis has shown that the generation of m t l S - k a l D N A and the events leading to the death of a culture appear to be complex processes, and no absolute requirements, other than the generation of m t l S - k a l D N A , seem to be required. T h e interpretation of these data is very difficult, however a few trends are apparent in some series. For this reason only four of the 10 parallel series molecular analyses are presented in detail. T h e y are representative of what is believed to be occurring during the senescence process, and are presented in figures 34-37. Figure 33 is a reprint of figures 29 and 15, which illustrates the restriction digest protocol which can be used to identify inserts of m t l S - k a l D N A by the presence of novel junction fragments that are derived f rom Bgl II digestion of m t D N A which contains inserts of m t l S - k a l D N A . F r o m figure 33 it can be. seen that the probe, X 3 , has homology to the inverted repeats of kaiilo. Therefore in a restriction digest, it will hybridize to all restriction fragments which have homology to the 166 Part II: Parallel Subculture Series Experiments inverted repeats. In a B g l II digest, the restriction fragments of the linear plasmid which hybridize to X 3 are b l and b2, the ends of the linear plasmid. However, m t l S - k a l D N A does not give rise to b l and b2 upon digestion with Bgl II. Instead, it gives rise to two m t D N A / m t l S - k a l D N A junction fragments, b l ! and b2', which must be of equal or greater molecular weight than b l and b2. Therefore, in a Southern blot of Bgl II digested m t D N A probed with X 3 , the presence of two bands ( b l and b2) suggests that no insert of kalilo is present, while the presence of other bands ( b l ' and b2') confirms the presence of m t l S - k a l D N A . In the figures to follow, b l ' and b2' junct ion fragments are readily apparent in the X 3 probed Southern blot portions of the figures, and references are made to cultures sharing junction fragments. W h e n this is stated in the text, the following experiment was performed. After identification of junction fragments of similar molecular weight by the X 3 hybridization protocol illustrated in figure 33, low melting point agarose gels were prepared and run to isolate the junction fragments. T h e junction fragments were isolated, made radioactive, and used as probes to Southern blots of restriction digested m t D N A . If two similar-sized junction fragments hybridized to the same pattern of restriction fragments on one of these gels, then the inserts were assumed to be in the same location. More information on the junction fragments and the location of the inserts will be presented in figures 38, 39, 40 and 41. 167 Part II: Parallel Subculture Series Experiments Figure 33. Diagram of the Generation of b l ' and b2' Junction Fragments for the Detection of mtlS-kalDNA. m t A R - k a l D N A , the linear plasmid, is diagrammed in the top of the figure, and m t l S -k a l D N A , a m t D N A insertion sequence, is diagrammed at the bot tom of the figure. T h e kalilo inverted repeat probe, X 3 , is shown, b l , b2, b3 and b4, are B g l II restriction fragments of the linear plasmid, as shown, b l ' a n d b2' are the restriction fragments produced by B g l II digestion of the m t D N A containing an insert of m t l S - k a l D N A . T h e relative sizes of b l ' and b2' are variable and are dependent on the distance to the next Bgl II site in the m t D N A . T h i s diagram for the interpretation of experiments was presented in figures 15 and 29. 168 Part II; Parallel Subculture Series Experiments •tAR-kalDNA X3 •tIS-kalDNA 169 Part II: Parallel Subculture Series Experiments Figure 34. Characterization of Senescent m t D N A s from Strain Xl-5 A Bgl II digested profile of the m t D N A is shown. The panel on the left has been stained with ethidium bromide, and the panel on the right is an autoradiograph of a Southern blot which was probed with the X3 clone; conditions which must exist for the occurrence of bands b l , b2, b l ' and b2' in the X3 probed Southern blot are shown in figure 33. In the region of the autoradiograph where no sequences homologous to the probe and shorter than b2 should have been detected, a histogram of the lifespans of the cultures in question has been pasted. The lane designations are as follows. L is the B R L 1 kb ladder. N is control strain 605. S is senescent control strain 561-7. The parallel cultures are numbered 1 to 10. The asterisks in the Southern panel refer to strains which have bands that cohybridize with the X3 probe and the Hind III-13, 18 probe, indicating that the inserts are into the Hind 111-13, 18 m t D N A restriction fragment. The 14 Bgl II restriction fragments of the m t D N A from strain 605 are indicated by the small numbers on the left. The four Bgl II restriction fragments of mtAR-kalDNA, b l , b2, b3, and b4 are indicated by the large numbers on the left. Only two of these, b l and b2 hybridize to clone. X3 as shown on the right. The restriction fragments of the senescent mtDNAs in the ethidium bromide stained portion of the figure, and the various b l ' and b2' fragments in the Southern blot differ between individual lanes and ha.ve not been indicated to avoid confusion. In the bar graph, the numbers in parentheses indicate strains which lived beyond 17 subcultures. 170 L N S 1 2 3 4 5 6 7 8 9 18NS*1 2 5 6*7 8 9*18 LIFESPANS Part II: Parallel Subculture Series Experiments Figure 35. Characterization of Senescent mtDNAs from Strain X l - 6 A Bgl II digested profile of the m t D N A is shown. The panel on the left has been stained with ethidium bromide, and the panel on the right is an autoradiograph of a Southern blot which was probed with the X3 clone; conditions which must exist for the occurrence of bands b l , b2, b l ' and b2' in the X3 probed Southern blot are shown in figure 33. In the region of the autoradiograph where no sequences homologous to the probe and shorter than b2 should have been detected, a histogram of the lifespans of the cultures in question has been pasted. The lane designations are as follows. L is the B R L 1 kb ladder. N is control strain 605. S is senescent control strain 561-7. The parallel cultures are numbered 1 to 10. The asterisks in the Southern panel refer to strains which have bands that cohybridize with the X3 probe and the. Hind III-13, 18 probe, indicating that the inserts are into the Hind 111-13, 18 mtDNA restriction fragment. The 14 Bgl II restriction fragments of the mtDNA from strain 605 are indicated by the small numbers on the left. The four Bgl II restriction fragments of mtAR-kalDNA, b l , b2, b3, and b4 are indicated by the large numbers on the left. Only two of these, b l and b2 hybridize to clone X3 as shown on the right. The restriction fragments of the. senescent mtDNAs in the ethidium bromide stained portion of the figure, and the various b l ' and b2' fragments in the Southern blot differ between individual lanes and have not been indicated to avoid confusion. In the bar graph, the numbers in parentheses indicate strains which lived beyond 17 subcultures. 172 i. bl -+ ^ b2 -+ b3 - * b4 L N S 1 2 3 5 6 7 9 10 N d* 1 2 3 7 9 10 LIFESPANS Part II: Parallel Subculture Series Experiments Figure 36. Characterization of Senescent mtDNAs from Strain 1-4. A Bgl II digested profile of the mtDNA is shown. The panel on the left has been stained with ethidium bromide, and the panel on the right is an autoradiograph of a Southern blot which was probed with the X3 clone; conditions which must exist for the occurrence of bands bl , b2, b l ' and b2' in the X3 probed Southern blot are shown in figure 33. In the region of the autoradiograph where no sequences homologous to the probe and shorter than b2 should have been detected, a histogram of the lifespans of the cultures in question has been pasted. The lane designations are as follows. L is the BRL 1 kb ladder. N is control strain 605. S is senescent control strain 561-7. The parallel cultures are numbered 1 to 10. The asterisks in the Southern panel refer to strains which have bands that cohybridize with the X3 probe and the Hind 111-13, 18 probe, indicating that the inserts are into the Hind 111-13, 18 mtDNA restriction fragment. The 14 Bgl II restriction fragments of the mtDNA from strain 605 are indicated by the small numbers on the left. The four Bgl II restriction fragments of mtAR-kalDNA, bl, b2, b3, and b4 are indicated by the large numbers on the left. Only two of these, bl and b2 hybridize, to clone X3 as shown on the right. The restriction fragments of the senescent mtDNAs in the ethidium bromide stained portion of the figure, and the various bl ' and b2' fragments in the Southern blot differ between individual lanes and have not been indicated to avoid confusion. In the bar graph, the numbers in parentheses indicate strains which lived beyond 17 subcultures. 174 L N S 1 2 3 4 5 6 7 8 9 10 N d*1 2* 3 4* 5 6 7 8 9 18 LIFESPANS Part II: Parallel Subculture Series Experiments Figure 37. Characterization of Senescent. m t D N A s from Strain 1-16. A Bgl II digested profile of the mtDNA is shown. The panel on the left has been stained with ethidium bromide, and the panel on the right is an autoradiograph of a Southern blot which was probed with the X3 clone; conditions which must exist for the occurrence of bands bl, b2, b l ' and b2' in the X3 probed Southern blot are shown in figure 33. In the region of the autoradiograph where no sequences homologous to the probe and shorter than b2 should have been detected, a histogram of the lifespans of the cultures in question has been pasted. The lane designations are as follows. L is the BRL 1 kb ladder. N is control strain 605. S is senescent control strain 561-7. The parallel cultures are numbered 1 to 10. The asterisks in the Southern panel refer to strains which have bands that cohybridize with the X3 probe and the Hind 111-13, 18 probe, indicating that the inserts are into the Hind 111-13, 18 mtDNA restriction fragment. The 14 Bgl II restriction fragments of the mtDNA from strain 605 are indicated by the small numbers on the left. The four Bgl II restriction fragments of mtAR-kalDNA, bl, b2, b3, and b4 are indicated by the large numbers on the left. Only two of these, bl and b2 hybridize to clone X3 as shown on the right. The restriction fragments of the senescent mtDNAs in the ethidium bromide stained portion of the figure, and the various b l ' and b2' fragments in the Southern blot differ between individual lanes and have not been indicated to avoid confusion. In the bar graph, the numbers in parentheses indicate strains which lived beyond 17 subcultures. 176 L N S I 2 3 4 5 6 7 8 9 I 6 N ^ I 2 3 4 5 6 7 8*9 18 1 2 3 4 5 6 7 8 9 1 0 PARALLEL CULTURE NUMBER LIFESPANS Part II: Parallel Subculture Series Experiments Figures 34-37 are characterizations of the mtDNA of the parallel series. The Bgl II digested mtDNAs are shown in the ethidium bromide stained portion of the figures. Bgl II digests the wild type mtDNA from strain 605, in lane " N " , into 14 fragments which are numbered on the left as shown, from the largest to the smallest. The Bgl II digest of the senescent cultures in the numbered lanes is seen to yield a heterogeneous population of fragments which includes the following: wild type fragments which comigrate with the restriction fragments from the " N " lane; Bgl II fragments of mtAR-kalDNA, these are labelled bl. b2, b3 and b4 on the left of the figure; Bgl II fragments of the circular mitochondria] plasmid; novel bands which are junction fragments corresponding to b l ' and b2', these become labelled in the autoradiograph portion of the figure; and novel bands that are the result of rearrangements of the mtDNA not associated with kaiilo sequences. Because of the complex nature of the rearrangements occurring in the ethidium bromide stained portion of the gels, only Bgl II fragments 1-6, and the mtAR-kalDNA restriction fragments bl, b2, b3 and b4 are referenced in the text. While Bgl II fragments 1 -6 are not very clear in figure 34, they are readily apparent in lane " N " of figure 35. As a sample analysis it can be seen from the ethidium bromide stained portion of figure 35 that lane " N " contains all six Bgl II fragments, while in lane "S", only Bgl II fragments 1, 2, 3, and 4 are detected; Bgl II-5 and -6 have apparently been deleted. Missing Bgl II fragments are referred to throughout the text in this manner. The autoradiographs have been probed with kaiilo clone X3, as shown in figure 33, and it should hybridize only with fragments that are larger than b2. Background in the autoradiographs can be attributed to the degradation of senescent mtDNA that was shown for the 561-7 lanes of figure 30. Fragments which are smaller than b2 can only be generated by gross rearrangements and deletions of kaiilo; none of these events were ever observed. In this region of the autoradiographs a bar graph of the lifespan of the cultures in question has been pasted, to easily reference the longevity of the subcultures. An interpretation of some of the 178 Part II: Parallel Subculture Series Experiments lanes seen in figure 37 is shown in figure 38. T h i s figure layout is maintained in figures 34, 35, 36 and 37. Figure 34 is representative of m a n y aspects of the molecular analysis. T h e only parallel culture still alive at the time D N A was prepared was number 5. T h i s is illustrated in the bar graph beneath the autoradiograph. Overal l , there seems to be a heterogeneous population of insertions and D N A rearrangements which have occurred prior to D N A isolation. Nonetheless, different members of a parallel series can generate identical insertions and m t D N A rearrangements. T h i s is demonstrated by lanes 3 and 10, and lanes 2 and 7 of the autoradiograph. Lanes 2 and 7 share the same two pairs of junction fragments. Junction fragments in the X 3 probed autoradiograph are bands which are larger than b l and b2, as illustrated in figure 33. Inspection of the ethidium bromide stained gel shows that the subsequent deletions of the B g l II fragments 2, 5 and 6 are also identical between parallel cultures 2 and 7. T h e major difference between these subcultures is their lifespans; parallel culture 2 lived to be 12 subcultures, while culture 7 lived to be 14 subcultures. Similarly for lanes 3 and 10, they share a single pair of junction fragments, and their D N A is characterized by the loss of many Bgl II fragments, but their corresponding lifespans are 9 and 11 subcultures. One parallel culture in this figure, corresponding to lane 9, actually has the same insert as the female parent. It is not known whether this insert was inherited, or whether it has arisen from de novo insertion into the same location. If an insert such as this was inherited, then the other members of the parallel series have failed to inherit or lost it. A single insert of kaiilo was found to be lethal in parallel culture 1, in the absence of any other obvious D N A rearrangement. A final observation is that in this case the only strain which was still alive at the time of D N A isolation (parallel culture 5) is found to contain two inserts of kaiilo. Neither of these inserts is apparently lethal. Figure 34 illustrates another novel result of this work: It seems as though one of the previously unreported manifestations of senescence is the amounts of m t A R - k a l D N A that are seen at 179 Part II: Parallel Subculture Series Experiments the death of some of these cultures. T h i s is typified by lanes S, 2, 3, 6, 8, 9 and 10. T h e m t A R -k a l D N A restriction fragments b l , b2, b3 and b4 are very prominent in these lanes, especially in lanes 3, 8, and 10. T h i s factor in the senescent process could not have been discovered in the absence of proteinase K treated D N A isolations. Figure 28 illustrated that multiple isolations of m t D N A f rom strain 561-7 all yield similar amounts of the linear plasmid, confirming that the proteinase K treatment of the nucleic acid leads to repeatable isolation of m t A R - k a l D N A . High levels of the free plasmid may even be a general cause of death. For instance, lanes 3 and 10 were reported to have similar junction fragments and similar m t D N A deletions. T o this can be added similar huge amounts of m t A R - k a l D N A ; indeed almost all of the U V absorbing material run on the gel in these lanes corresponds to m t A R - k a l D N A Bgl II fragments b l , b2, b3 and b4. It is obvious that a number of complex events are occurring in the mitochondria of these senescent strains. However the complex analysis, required to determine what is going on suggests that a previously unreported trend may be evident. Parallel culture number 8 in figure 34 died at 6 subcultures. Inspection of its m t D N A shows that it has two inserts of k a l D N A , and it has lost a number of B g l II fragments including 5 and 6. It also has a high level of m t A R - k a l D N A , as evidenced bv the prominence of the b l , b2, b3 and b4 restriction fragments. T h i s D N A was prepared from the third subculture of the parallel culture, yet D N A prepared from the first subculture, shown in figure 30 was completely normal, except for the presence of the linear plasmid. Therefore, all of the rearrangements seen in this culture occurred within 3 subcultures. Since it takes 3 subcultures to amplify a culture for the preparation of m t D N A , these results suggest the possibility that changes in the m t D N A which are not present in the original culture of interest could have occurred during the amplification procedure that is required for D N A isolation. If the molecular events that occur which are responsible for the death of a culture occur rapidly, say during the growth of one subculture, then the analysis of m t D N A is a fruitless endeavour because it takes three subcultures to prepare a 180 Part II: Parallel Subculture Series Experiments culture for DNA isolation, and it will be impossible to determine what is happening at the DNA level with current techniques. Figure 35 is an analysis of the mtDNA of culture Xl-6. The situation in figure 35 is similar to that in figure 34. A number of the parallel cultures in figure 35 seem to have an mtlS-kalDNA with in a location similar to that of the parental insert (indicated by asterisks in the figure). Because the size of the junction fragments differs from the female parent, it is probably not an inherited insert, but it might be a rearrangement of the inherited insert or a de novo insertion, although lane 6 again has the same insert as the female parent. Interestingly, a culture which is long lived, lane 7, contains 3 pairs of junction fragments. The parallel cultures presented in lanes 1, 2, 3, 5, and 10 all live to be 11 subcultures in this parallel series. Two of them, 1 and 2, have identical junction fragments and mtDNA profiles. A third parallel culture, number 9, has identical DNA but lives to be only 8 subcultures. Almost all the lanes, with the exception of lane 7, have high levels of mtAR-kalDNA as evidenced by the prominence of bl, b2, b3 and b4 in the ethidium bromide stained portion of the figure. This strain and the one presented in figure 34 are representative of many of the parallel series, where a variety of processes seem to be occurring, but the correlations between them are difficult to see. However the presence of senescent mtDNAs with similar DNA profiles suggests that either events which are programmed are occurring, or that senescent molecules are being inherited. mtDNA from strain 1-4 was prepared midway through its lifespan, when most series members were still viable. This parallel series provides some insight into what is occurring at the molecular level in the senescence process (figure 36). Of the 10 parallel cultures from this strain, only five different junction fragments were observed. Two of these inserts have similar molecular weight to inserts which have been identified previously (Myers et al, 1989). Parallel cultures 8 and 10 both contain an insert that was identified by Myers et al (1989) as a lethal insert. The DNA was prepared 181 Part II: Parallel Subculture Series Experiments from the 16th subculture, yet these two both survive on to 30 and 41+ subcultures, so the identification of these inserts as lethal is probably premature. Three strains, 5, 6, and 7, have the insert deemed non-lethal by Myers et al (1989). T h e bar graph indicates that strain 7 had died at the time the D N A was prepared, and inspection of the ethidium bromide stained gel suggests that the lethal event is not generation of m t l S - k a l D N A per se, but rather the secondary event which can be seen in the e thidium bromide stained portion of the figure: T h e loss of B g l II fragments 4, 5, 6 and others, and the subsequent amplification of m t A R - k a l D N A . T h i s is also suggested strongly by inspection of parallel series 2 and^ 4, which have identical unique inserts of m t l S - k a l D N A , yet one was alive and one had died by the 16th subculture. A g a i n , inspection of the e thidium bromide stained portion of the gel shows that the culture which died has suffered the loss of at least Bgl II fragments 5 and 6. Parallel cultures 1 and 3 have an insert which seems to be benign, as they are both long lived. It is clear from the analysis of the m t D N A of this strain that insertion of m t l S -k a l D N A is necessary, but not sufficient for kalilo induced senescence to occur, and secondary events such as deletions of m t D N A seem to be the lethal events. O n l y three of the cultures from strain 1-4 had died at the time D N A was prepared. T w o of these exhibit, very high amounts of m t A R - k a l D N A and m t D N A deletions, in lane 7 and lane 9 of the. e thidium bromide stained portion of the figure. T h e third culture that had died at the time D N A was prepared (lane 2) has bands corresponding to m t A R - k a l D N A , but not at the level of lanes 7 and 9. Isolation of m t A R - k a l D N A is thought to be repeatable within experimental limits because of the observed repeatability of isolations demonstrated in figure 28. These three dead cultures are the only ones with an appreciable amount of m t A R - k a l D N A at the time that D N A was prepared, therefore it again seems as though the level of m t A R - k a l D N A is an important criterion in the senescence process in these three cultures. 182 Part II: Parallel Subculture Series Experiments An interesting final observation on figure 3G pertains to lane 9. The culture illustrated in lane 9 harbours the fifth observed junction fragment, seen amongst the 10 subcultures of strain 1-4. This parallel culture lived to 10 subcultures, the shortest of all of the ones from strain 1-4. At death, it has suffered mitochondrial DNA arrangements, including the loss of Bgl II fragments 5 and 6, and the sharp increase in the level of mtAR-kalDNA. Interestingly, the insertion of mtlS-kalDNA, the mtDNA deletions, and the increase in the level of mtAR-kalDNA seen in this strain are the same in strain 1-4 parallel culture number 9, and strain Xl-5 parallel cultures number 3 and 10 in figure. 34. Strain Xl-6 parallel cultures 1, 2 and 9 from figure 35 may also have the same insertion of mtlS-kalDNA, and possibly the same mtDNA rearrangements, but the degradation of the senescent mtDNAs from these senescent cultures makes the interpretation difficult. The occurrence of the particular senescent mtDNA type seen amongst these cultures suggests that there may be a general mechanism for the production of the senescent mtDNAs based on the insertion site of mtlS-kalDNA and the subsequent generation of site specific deletions. The observation that all of these parallel cultures die at a relatively early subculture suggests that the mechanism can be a programmed event which correlates with the occurrence of death at a certain subculture. The stopper extranuclear mutants of AT. crassa are thought to occur via site specific recombination of the mtDNA (Gross et al, 1984; DeVries et al, 1986; Almasan and Mishra, 1989), and this may be what is seen in the mtDNA rearrangements occurring in the kaiilo strains. This idea is considered more fully in the discussion. Figure 37 shows mtDNAs from strain 1-16. In this strain it appears as though the insertions of mtlS-kalDNA may be site specific and strain specific, or that progeny inherit undetectable amounts of a senescent molecule. This idea is based on the observation that 7 of the 10 parallel cultures in this strain (namely lanes 1, 2, 5, 6, 7, 9 and 10) exhibit the same two pairs of high molecular weight junction fragments (The junction fragments in lanes 8 and 9 of this figure are illustrated in greater detail in figure 38). It is possible that these inserts reside on two different 183 Part. II: Parallel Subculture Series Experiments mitochondrial molecules because of differences in their relative intensities in some lanes (e.g., lane 5). This is the only strain which shows the same junction fragment so many times. If a mechanism is present which is able to direct the insertion of mtlS-kalDNA into particular regions of the mtDNA, then it is functioning only in strain 1-16, and not in any of the other individuals described here. However, the combination of nuclear genes required to specify insertion of kalilo into a specific mitochondrial sequence is not obvious; an easier explanation is that these molecules were inherited. The location of these two inserts was determined (to be presented in figures 38, 39, and 40) and it was found that they represent different polarity insertions into the same location in the mtDNA, so only a single insertion site may exist. The evidence for and against the inheritance of inserts is explored more fully in the discussion. There are two final observations on figure 37. The mtDNA with the pair of junction fragments seen in lanes 1, 2, 5, 6, 7, 9, and 10 was lethal in every case. In contrast to the situation seen for the strain 1-4 (figure 36), these junction fragments are found to be lethal in the absence of any other identifiable mtDNA deletions or rearrangements, with the possible exception of the loss of Bgl II fragment 2. It will be shown in the next section that the insert in both these cases is into the Bgl II-2 fragment, therefore the fragment has not been lost, only rearranged. On the. other hand, the parallel cultures with mtDNAs with other junction fragments all lived to be much longer, greater than 20 subcultures, suggesting that, the pair of junction fragments seen in lanes 1, 2, 5, 6, 9, and 10 correlates with a short lifespan. The second observation is that parallel cultures 7 and 10 have in addition to the two aforementioned junction fragments, evidence of other inserts. This brings the number of inserts in these strains to three. The occurrence of a high number of similar inserts was unexpected, because it has never been reported before. At most, one major and one minor junction fragment were usually seen (Myers, 1988). The analysis of the mtDNAs from a parallel series derived from strain 1-16, in figure 37, has indicated that death of these cultures can occur in the absence of 184 Part. II: Parallel Subculture Series Experiments the large amounts of mtAR-kalDNA and mitochondrial deletions seen in most of the other strains, and instead seems to imply that the presence of mtDNAs with multiple inserts is the event, required to cause the death of this strain. In this section a number of events were seen to correlate with the death of the members of a parallel series. In some strains, for instance strain 1-16 in figure 37, the important event seems to be the presence of a mtDNA with multiple copies of mtlS-kalDNA. In strain 1-4 in figure 36, the important, event, seems to be mtDNA deletions and the increase in the amount of mtAR-kalDNA. Strains Xl-5 and Xl-6, in figures 34 and 35, seem to succumb to combinations of the above events. Senescent, events are found to be variable, but new information from this section has been the identification of large amounts of mtAR-kalDNA in senescent strains, and the relative importance of rearrangements involving mtDNA Bgl II fragments 5 and 6. Finally, the occurrence of similar inserts and mtDNA rearrangements within members of a parallel subculture series, and between different, parallel series, suggest that strains may be. inheriting undetectable amounts of mtlS-kalDNA, or that insertion site and subsequent mtDNA rearrangements may be programmed events. Analysis of Junction Fragments While routinely mapping the junction fragments referred to in the above section to show that fragments of a similar size had a. similar location in the mtDNA, it was discovered that, certain pairs of junction fragments seemed to have interesting mtDNA structures surrounding them. This conclusion was based on the mtDNA insertion regimen that was presented in the introduction. A model for the insertion of kaiilo was presented in the introduction which proposes that the mtDNA surrounding an insert of kaiilo DNA is present in long inverted repeats (Chan et al, 1989a). This is illustrated in figure 6 in the introduction. The experiments presented in this section map the inserts 185 Part II: Parallel Subculture Series Experiments of kaiilo identified in the parallel series experiments, and propose a unique structure for the mtDNA molecule in one strain. The long inverted repeats of mtDNA that surround mtlS-kalDNA lead to Bgl II junction fragments of kaiilo that are always one kb apart in size. This is because bl and b2 differ in size by one kb, therefore the inverted repeats of mtDNA will always show the same distance to another Bgl II site, and the junction fragments can only differ by the. asymmetry present in the single copy region of kaiilo; namely, by the difference in sizes between bl and b2. This is illustrated in figure 33, the diagram of the protocol for the detection of mtlS-kalDNA. In that figure, b l ' is shown as being derived from bl, and b2' is derived from b2; b l ' and b2' always differ by 1 kb, the same amount that bl and b2 differ by. A testable result of this is that if the mitochondrial DNA were cut with Eco R l , or Xba I, which cut within the TIR of kaiilo, then only a single junction fragment would be detected in X3 probed Southerns. Figures 38 and 39 illustrate how the location of the junction fragments alluded to in the previous section was determined. Figure 38 is a enlarged view of lanes 8 and 9 of the ethidium bromide and X3 probed Southern portions of figure 37. Lanes 8 and 9 of figure 38 contain mtDNA from parallel cultures which have undergone different fates at the time of DNA isolation. Lane 9 contains mtDNA which harbours the pair of high molecular weight junction fragments which have been termed bl' , b2', b l " and b2" on the right of the figure, and which were common to seven of the parallel series of strain 1-16. Lane 8 contains a single pair of junction fragments which are only slightly larger than bl and b2. These junction fragments have not been indicated on the figure, to avoid confusion with bl ' and b2' in lane 9. This insert was found to be into Hind 111-13, 18 by hybridization to that fragment. Only the fragments generated from Bgl II digestion of the mtDNA from the parallel culture in lane 8 in the ethidium bromide stained portion of the figure are indicated on the left. The fragments from lane 9 have not been indicated to avoid confusion, but reading from 186 Part II: Parallel Subculture Series Experiments the top, they would be B g l II-1, b l ' , b2', Bgl II-3, b l " , b 2 " , Bgl II-4, -5, -6, -7, b l , plasmid, b2, etc. In the Southern portion of the figure it can be seen that the kalilo specific probe clearly picks up b l ' , b2', b l " , b 2 " , b l , and b2. T h e four junction fragments f rom lane 9 (namely b l ' , b2', b l " , and b2") were isolated f rom 0.5 % low melting point agarose gels, labelled, and used as probes for the panels indicated in figure 39. 187 Part II: Parallel Subculture Series Experiments Figure 38. Characterization of m t D N A from Strains 1-16-viii and I-16-ix. A B g l II digested profile of the m t D N A from two of the parallel cultures from strain 1-16 is shown. T h e designations 8 and 9 refer to lanes 8 and 9 of the ethidium bromide and Southern blot panels of figure 37. Therefore, lane 8 contains m t D N A from parallel culture I-16-viii, and lane 9 contains m t D N A from parallel culture I-16-ix. T h e panel on the left was stained with e thidium bromide, and the panel on the right is an X 3 probed Southern blot; conditions which must exist for the occurrence of bands b l , b2, b l ' , b2', b l " and b 2 " in the X 3 probed Southern blot are shown in figure 33. T h e B g l II fragments of the D N A species f rom the mitochondria f rom lane 8 are indicated on the left. T h e " / " designates fragments which comigrate. T h e numbers indicate B g l II fragments ,which have the same mobility as B g l II fragments f rom strain 605. Bgl II digests the cryptic circular mitochondrial plasmid into two fragments, as shown. T h e expected Bgl II fragments of m t A R -k a l D N A and m t l S - k a l D N A are shown in figure 33. O n the right, the fragments with homology to kalilo probe X 3 from lane 9 are indicated. T h e B g l II m t D N A fragments f rom lane 9 of the e thidium bromide stained panel, and the b l ' and b2' fragments from lane 8 of the Southern blot have not been indicated to avoid confusion. 188 8 9 8 9 2 3 4 5 6 bY b2' bl" b2" bl" / 7 bl plaswd b2' b2 8 9 b3 plasmid / 16 n 12 b2 EtBr X3 - m -Part II: Parallel Subculture Series Experiments Figure 39. Analysis of Junction Fragments of mtlS-kalDNA from Parallel Series Strain I-16-ix Lanes designated II in the figure contain m t D N A from strain 605 which has been digested with H i n d III. Lanes S contain m t D N A from senescent strain 1-4, which does not contain an insert of k a l D N A , digested with Bgl II. T h e panels are the results of Southern blots that were all hybridized with different probes. T h e Southern in panel a was hybridized with radioactively labelled m t D N A from strain 605. T h e southerns shown in panels b, c, d, and e were probed with the gel purified junction fragments indicated in figure 38, b l ' , b2', b l " , and b2" , respectively. W h i c h correspond to the junction fragments f rom culture I-16-ix in figure 37, lane 9. T h e H i n d III m t D N A restriction fragments indicated on the left correspond to panels b and c, while the fragments indicated on the right correspond to panels d and e. T h e presence of other bands is addressed in the text. 190 bl Hind Ill-lOa b2 Hind 111-17 Hind 111-21 «-Hind HI—1 bl Hind IIMOa b2 Hind 111-14 Part II: Parallel Subculture Series Experiments Figure 40. A Model for the Inserts of mtlS-kalDNA in Parallel Series Strain I-16-ix (A) A portion of the N. intermedia mtDNA restriction map is presented which shows the proposed site of insertion in parallel strain I-16-ix. This site is indicated by the arrow. The numbered fragments correspond to those seen in figure 7 in the introduction, and to the mtDNA to be presented in figure 41. (B) and (C) illustrate the long inverted repeats of mtDNA which arise upon insertion of mtlS-kalDNA. mtlS-kalDNA is represented between the arrowheads. The lettered, bold lines in (B) and (C) are proposed to be the junction fragments which when made radioactive would give the pattern shown on the corresponding gel in figure 39. The mtDNA in (B) has the mtDNA sequences to the left of the insert of mtlS-kalDNA inverted, and illustrates the junction fragment hybridizations seen in figure 39 panels d and e. The mtDNA shown in (C) has the mtDNA sequences to the right inverted, and illustrates the mtDNA rearrangements which could give rise to the pattern seen in panels b and c of figure 39. 192 I Part II: Parallel Subculture Series Experiments 2 i 18 14 Ilea 21 17 16 Hind III <H) B 2 \b2D4 b3 bl / 2 1 14 19a / \ 16a 14 1 B 2 \ bl b3|b4 b2S 2 1 14 10a / \ 10a 14 1 c 10 2 \ b 2 D4 b3 bl / 2 10 E 17 21 10a \ 10a 21 17 \ 10 2 \ b 1 b3|b4 2 10 i 17 21 10a \ 10a 21 17 f H 193 Part II: Parallel Subculture Series Experiments The panels in figure 39 are composed of lanes of mtDNA which have been digested with Hind III and Bgl II. mtDNA from a non-senescent control strain is digested with Hind III in the " H " lanes, and the "S" lanes contain Bgl II digested mtDNA from a senescent strain which does not contain detectable inserts of kalDNA. The four panels b, c, d, and e of the blots have been probed with the radioactively labelled, gel purified mtlS-kalDNA junction fragments designated b2", b l " , b2', and b l ' in figure 38. The junction fragment analysis was performed by isolating Bgl II digested fragments of senescent mtDNA which had previously shown homology to kaiilo clone X3. Therefore every junction fragment contains a full copy of the kaiilo fragment bl or b2, depending on whether it was a larger or a smaller junction fragment. In addition, each junction fragment contains mtDNA sequences up to and including the next Bgl II site. Thus, in the figure to follow, The S lane contains mtDNA from a senescent culture with mtAR-kalDNA only, therefore bl , b2 and the Bgl II fragment from which the junction fragment was derived will be detected in that lane. Other sequences in the gel which will be detected are the Hind III digested fragments of the mtDNA in lane H. Only a portion of the Hind III fragments which are homologous to the Bgl II fragment in which the insert was located will be detected, because the junction fragment homology consists only of that portion of the Bgl II fragment which extends from the Bgl II site in the mtDNA to the ends of location of mtlS-kalDNA. For instance, if an insert were in the center of a Bgl II restriction fragment of mtDNA, then the bl ' and b2' junction fragments would consist of a full copy of bl or b2, plus either the right or the left half of the sequences of the Bgl II mtDNA fragment. Therefore it is possible to accurately determine the location of most inserts by this procedure. The pattern of hybridization seen was specific for each junction fragment of a specific size. However, an interesting result was obtained when the four common junction fragments of strain 1-16 were tested: all four behaved as though they were inserted into the same region of the DNA. This situation is illustrated in figure 39. 194 Part II: Parallel Subculture Series Experiments The Southern blots.in panels b, c, d, and e have been probed with probes which correspond to the four junction fragments from strain 1-16 parallel culture number ix. Hybridizations using the two smallest junction fragments, b2" and b l " , are shown in panels b and c, and the larger junction fragments, b2' and bl ' were used as probes in panels d and e. Panel a was hybridized with radioactively labelled mtDNAs as a control. All four of the experimental probes hybridize to Bgl II fragment 2, indicating that the insert is into this Bgl II fragment. In lane S fragments bl and b2 are detected in addition to Bgl II-2. The junction fragments hybridize to different, sets of Hind III fragments. The smaller junction fragments hybridize to the same fragments of mtDNA in panels b and c as expected, indicating that the probes differ only by the presence of bl or b2 within them. These Hind III fragments are indicated in the figure as Hind III-10a, Hind 111-17 and Hind 111-21. Extra fragments have become labelled in panels b and c. In panel b, an extra Hind III fragment has become slightly labelled in lane H. This fragment is Hind 111-12. It is not clear why this fragment should have become, labelled, as Hind III-12 is not contiguous with any of the other fragments. Hind III-12 is homologous with Bgl II-4, which seems slightly labelled in the S lane. These fragments are not labelled as intensely as the others, and are not thought to contain sequences homologous to the junction fragments. These could represent incomplete stripping of the blot or some sort of probe contamination, but are not. considered signifigant because replicate experiments on the b l " and b2" junction fragments always give similar results (data not shown). A similar situation is thought, to exist for the Hind III-l fragment in lane H of panel c, which also appears labelled, but it is not contiguous with the other fragments which are labelled in the panel. Panels d and e indicate hybridization to the same Bgl II fragments as panels b and c, namely Bgl II-2, and bl and b2. Panels d and e also show hybridization to Hind III-10a, and in addition to two other Hind III fragments, Hind III-l and -14. This confirms that insertion is into the common fragments, Bgl II-2, and more specifically, Hind III-10a. The model shown in figure 40 195 Part II: Parallel Subculture Series Experiments accounts for these observations. These Hind III fragments, and those mentioned for panels b and c. are contiguous on the mtDNA. A map of the mitochondrial DNA region of interest is shown in part A. The proposed location of the insert is shown by a dotted line. The mtDNA rearrangements capable of giving the results shown in figure 39 are diagrammed in parts B and C of figure 40. The lettered, bold lines above the mtDNA maps in figures 40B and 40C correspond to the junction fragments generated by Bgl II digestion of the indicated DNAs, and can be thought of as probes to the panels with the same lower case letters in figure 39. The situation for junction fragments corresponding to panels d and e of figure 39 are shown in figure 40B, while the situation for junction fragments corresponding to panels b and c of figure 39 are shown in figure 40C. The observation that sequences are found which extend from both directions of the proposed site of integration in Hind III-10a suggests that two types of insertion sequences are present, one with the mtDNA flanking sequences to the left inverted , and the other with the mtDNA flanking sequences to the right inverted. This is the situation that is diagrammed in figure 40. In addition to the two possible conformations of the mtDNA, the two possible conformations of mtlS-kalDNA are shown in the figure. Due to the inverted nature of the mtDNA, it is not possible to determine exactly in which orientation mtlS-kalDNA is in relation to the mtDNA, because both orientations give rise to the same junction fragments. The discovery of mtDNA with different flanking repeats of mtDNA suggests the possibility that the structure of a senescent mtDNA molecule is a dimeric inverted repeat joined by two mtlS-kalDNAs. This structure was hypothesized to exist by Bertrand (1986), in a model suggesting that the long inverted repeats of mitochondrial DNA that arise upon generation of mtlS-kalDNA may be the result of intermolecular recombination between mtDNAs carrying inserts of mtlS-kalDNA. The observation that the inserted structures predicted by the model are found in at least one kaiilo strain of N. intermedia supports the model, 196 Part II: Parallel Subculture Series Experiments however it is equally possible that the junct ion fragments arise from two different m t D N A molecules, with similar, but opposite inserts. A table of all of the junction fragments identified in this study is shown in table 3. T h e location of the insert is reported to be in the smallest B g l II, E c o R l or H i n d III restriction fragment to which it could be mapped. It is immediately apparent that there are a limited number of sites in which m t l S - k a l D N A is found. T h i s is in agreement with previously reported observations (Bertrand, 1986; Myers , 1988; C h a n et al, 1989a). T h e reason that kaiilo is found inserted in a limited number of sites has been hypothesized to be due to the requirement of a five base pair match between the termini of kaiilo and the m t D N A ; the presence of a target site ( C h a n et al, 1989a). T h e final figure, figure 41, diagrams the locations of m t l S - k a l D N A . T e n inserts were identified from the parallel cultures of strains X l - 5 , 1-4 and 1-16. T h e locations are numbered and refer back to table 3. Comparison of the locations of these inserts shows that several locations have been previously identified as sites of insertion of m t l S - k a l D N A . These were shown previously in figure 6 in the introduction. Sites 4, 5, 7, and 8 have been reported by Bertrand (1986), while site 9 was reported by Myers et al, (1989). T h e location of site 2 is very close to one mapped previously (Myers, 1988). These two sites are probably analogous, and the report of different locations probably represents differences in how the two sites were identified. The. originally reported location was by hybridization to cloned m t D N A fragment H i n d III-12 (a TV. crassa clone which corresponds to TV. intermedia fragment H i n d 111-14). T h e junction fragment identified in this study for location 2 would also show homology to this cloned m t D N A fragment, however the use of the junction fragment as a clone shows that the homology extends further than H i n d 111-14, into H i n d III-10a. B y analogy, the insert shown in location 1 may also correspond to a previously identified insert in E c o R l - 4 (Myers et al, 1989). T h e only location which is reported to be a novel insertion site of m t l S - k a l D N A is location numbered 3 in figure 41. 197 Part II: Parallel Subculture Series Experiments Table 3. Location of mtlS-kalDNA in Parallel Series JUNCTION LOCATION INSERT F R A G M E N T IN mtDNA NUMBER IN STRAIN NUMBER MAP FIGURE 36 Xl-5-i 1 Eco Rl-11 1 Xl-5-ii 2 Hind IIMOa 2 Xl-5-iii 1 Eco Rl-10 3 Xl-5-v 3 Eco Rl-5 4 4 it n 4 Xl-5-vi 2 Hind 111-13,18 5 3 5 Xl-5-vii 1 Hind IH-lOa 6 3 tl n 6 Xl-5-viii 2 Hind III-12b 7 3 M M 7 Xl-5-ix 2 Hind IH-13,18 5 Xl-5-x 1 Eco Rl-10 3 1-4-i 1 Eco Rl-6 8 I-4-ii 1 Hind IH-13,18 5 2 5 I-4-iii 2 Eco Rl-6 8 I-4-iv 1 Hind 111-13,18 5 2 « it 5 I-4-v 1 Hind IH-lOb 9 I-4-vii 1 H tt 9 I-4-vii 1 Bgl 11-1,2 10 I-4-x 2 i) tt 10 I-16-i 1 Hind IH-lOa 2 2 tt II 2 3 n tt 2 4 H it 2 I-16-ix 1 Hind IH-lOa 2 2 ti n 2 3 tt II 2 4 it tt 2 I 198 Part II: Parallel Subculture Series Experiments Figure 41. Insertion Sites of mtlS-kalDNA from Table 3. In this figure, the insertion sites of mtlS-kalDNA determined in table 3 have been placed on a restriction map of the mtDNA of N. intermedia. The numbers which match the thick lines correspond to the numbers in the last column of table 3. The mitochondrial restriction map is redrawn from Myers, (1988) and Bertrand et al, (1985). 199 Part II: Parallel Subculture Series Experiments 200 Part II: Parallel Subculture Series Experiments The use of labelled junction fragments to map the inserts of kalilo generally worked well, however a few problems were apparent. The obvious technical difficulty was the removal of the junction fragments from agarose gels free of contaminating D N A sequences. This was overcome by running gels for long periods of time and/or modulation of agarose concentration to effect the separation of junction fragments from other bands. A problem that was not so easily overcome was that the D N A rearrangements that were present in some of cultures may have involved Bgl II sites that belonged to the junction fragments. Consequently, the analysis of the patterns of radioactivity sometimes implied that non-contiguous mtDNA bands had become labelled. That this was not simply due to contamination of the probes was indicated by the observation that similar-sized equivalent probes from different gels gave rise to the same pattern. If the location of a junction fragment could not be determined, but similar sized junction fragments gave identical patterns, then they were reported as equivalent for the purposes of the comparisons shown in figures 34-37. The locations of inserts of mtlS-kalDNA shown in table 3 include only those whose labelled junction fragments gave unambiguous results. DISCUSSION The overview of the parallel series data suggests the following. First, although the lifespans of the members of the parallel series of the progeny of crosses involving a senescent female parent show much more variability than that of the wild isolates of N. intermedia, statistical analysis of the data suggests that lifespan is still highly regulated and it is a characteristic of individual members of a parallel series. Second, multiple inserts in senescent strains are the norm rather than the exception. There does not seem to be an upper limit to the number of pairs of junction fragments, but in practice three pairs can only be seen clearly because the mtDNA of strains with many inserts is usually so highly degraded that interpretation is difficult. Third, there seems to be a limited number 201 Part II: Parallel Subculture Series Experiments of insertion sites available for m t l S - k a l D N A , however among the members of a parallel series the insertion seems to be random among a limited number of sites. T h e exception to this rule is that in certain cultures, a single insertion site seems to predominate. It is not known if this represents inheritance of these inserts, or strain specific insertion. F o u r t h , strains that contain molecules with multiple types of insertions at a single site have been found, suggesting the possibility that recombination between molecules with insertions of kaiilo may be occurring to generate the long inverted repeats. Finally , death of a culture seems not to be dependent upon inserts of kaiilo, but upon other insults to the m t D N A , often the loss of Bgl II fragments 5 and 6. O f course there are striking exceptions to this rule as well. T a k e n together, these observations suggest that complex events are occurring whose analysis is difficult, given the mitochondrial biology at hand. Further , the observation that these events seem to happen very rapidly suggests the possibility that the system cannot be studied using current procedures for preparing cultures. Nonetheless this analysis has provided novel information concerning the senescence process including the presence of high levels of m t A R - k a l D N A and the importance of deletions of m t D N A . Is insertion the Senescence-Determining Event? T h e deletions seen in all of the strains which were analyzed in this study seem to resemble those seen in the stopper cytoplasmic mutations of Neurospora. A l m o s t all of the deletions that were described included B g l II fragments 5 and 6, meaning that B g l II fragments 1, 2 and 3 were retained. Figure 4 in the introduction illustrated the regions of the m t D N A that are retained in a number of cytoplasmic mutants of N. crassa. A l l of them include the same region as that retained in the senescent kaiilo strains, including a region that is thought to be important in stopper formation; the retained region contains a major Neurospora m t D N A origin of replication on the E c o Rl -4 , -6 Boundary (Bertrand et al, 1980; Collins and Lambowitz , 1981). Indeed, the clustering of the m t l S -202 Part II: Parallel Subculture Series Experiments k a l D N A sites that is seen in the t . R N A - r R N A region of the m t D N A may be due to the fact that it is precisely this region of the m t D N A that is retained by the stopper generation mechanism. T h e deletions seen in stoppers are now thought to be generated by site specific intramolecular recombination of the m t D N A (Gross et al, 1984; DeVries et al, 1986; A l m a s a n and M i s h r a , 1989). T h e possibility that kalilo strains undergo deletions at these previously identified sites of recombination could be easily tested. A scenario is possible whereby senescent, m t l S - k a l D N A containing m t D N A s undergo repeated rounds of recombination to generate the long inverted repeats of m t D N A that are seen to surround inserts, and to generate subsequent deletions of portions of the m t D N A . If this hypothesis is true, then the senescence induced by kalilo and maranhar linear senescence plasmids is only a special case of mitochondrial stopper formation, and kalilo and maranhar are acting like the Act ivator and Dissociator elements of maize (McCl int lock , 1947, 1949, 1951). Insertion of the element would give rise to secondary events which were capable of killing the organism, such as the chromosome breakage seen in the maize system. Mitochondria l mutation has been described as the ebb and flow of m t D N A molecules of different types (Gross et al, 1984), and the situation with the kalilo cytoplasms seems to be no exception. However, major differences between kalilo and mutants such as stopper do exist, because the kalilo phenotype is always lethal. T h e time of the appearance of some inserts of m t l S - k a l D N A correlates with the lifespan of the associated strain (Myers, 1988), suggesting a possible stochastic mechanism for this process, however insertion per se is not the event which seems to be responsible for the death of these organisms. T h i s hypothesis does not account for the fact that strains have been identified which show no identifiable m t D N A alterations other than the insertion of m t l S -k a l D N A . Therefore, integration is an event which is necessary for senescence to occur, but it is not always sufficient. Exact ly what is killing the kalilo strains of N. intermedia is not known T h e senescence process may only resemble the suppressive accumulation of altered m t D N A s in general, 203 Part II: Parallel Subculture Series Experiments and any of the previously described structures and processes may be sufficient for death to occur. Bertrand et al (1985; 1986) have hypothesized that kaiilo may simply generate deficient m t D N A s , which then become suppressive over wild type and lead to the death of the strain. T h e longevity of a particular strain may depend on the position of the insertion or the extent of the m t D N A disruption. For instance, grossly deleted molecules may be more suppressive than their counterparts with simple insertions. However, this hypothesis does not account for the difference in longevity between parallel cultures. Perhaps these molecules are suppressive, but only mildly so, and the occurrence of a second event, such as a deletion, can cause the death of the organism. T h e parallel series protocol was found to be very useful for the identification and separation of processes which are programmed from those that are purely random in this system. It has shown, for instance, that lifespans are heterogeneous and that events other than insertion may be responsible for death. However it. has failed to answer some important questions. F o r instance, it has not resolved whether the insertion of kaiilo is a r a n d o m or a programmed process. Evidence for both possibilities was found. If insertion sites were programmed then insertion could be controlled by the nuclear genotype. Another possibility is that insertion is non-random, due to the inheritance of low levels of molecules with inserts. It would take an experimental protocol which was more sensitive than the southern blot to determine if insertion was due to inheritance. A n experiment which could be performed on strain 1-16 to determine if insertion was due to inheritance of a low level of m t D N A s with m t l S - k a l D N A would be the amplification of m t D N A fragment H i n d III-10a from ascospore D N A through the Polymerase C h a i n Reaction ( P C R ) . T h e presence of multiple forms of the fragment would prove that cultures had inherited m t l S - k a l D N A . However, the isolation of D N A from ascospores is difficult, and the observation of strain 1-16 suggests that this analysis may not be so simple. If the inserts in this strain were inherited, then all the cultures have died with inserts that were not prominent in their female parent; f rom where they inherited the insert is not clear. T h e 204 Part II: Parallel Subculture Series Experiments concept that insertion site is dependent on nuclear genotype is also complicated; in this case by the consideration that the nuclear functions required to specify insertion of kalilo into a specific m t D N A location are not intuitively obvious. However, the observation of figures 38-40, which suggest that the two junction fragments seen in strain 1-16 only represent insertion into a single site, makes the possibility of programmed insertion into that site more plausible. W h i l e the observation of identical m t D N A s within clones argues for inheritance of the aberrant m t D N A s , the observation of similar m t D N A s between strains, such as those identified for clone ix of strain 1-4 (figure 36), clones iii and x f rom strain X l - 5 (figure 34), and clones i , ii and ix from strain X l - 6 (figure 35) argues for programmed insertions and deletions. Therefore, it is impossible to decide between these two possibilities as to the origin of inserts, however, the isolation of D N A from ascospores, and its subsequent amplification using P C R , might be able to answer this question. Nonetheless, certain observations as to whether insertion is the senescence determining event can be made. T h e only definitive function of kalilo was found to be insertion into the m t D N A ; this is what kalilo was found to be programmed to do. m t l S - k a l D N A is always found in senescent cultures of N. intermedia. In addition there were certain senescent m t D N A types with specific inserts of m t l S - k a l D N A that were found to be associated with reduced longevity, such as the pair of insertions in strain 1-16 that correlated with the clones with the shortest lifespan. Even though there are a number of complex mitochondrial changes that are occurring, including deletions of m t D N A and the increase in m t A R - k a l D N A , insertion always precedes, and may even direct these other m t D N A abnormalities. Therefore insertion is a very important event in the senescence process, although the location of inserts may not be relevant. 205 Part II: Parallel Subculture Series Experiments Relevance of Data to Senescence T h i s work utilizing a large number of strains was originally undertaken to identify the genes encoded by kaiilo and the genetic processes they affect. T h e identification of how nuclear genotype affects senescence has been hampered by the observation that there is a lot of variability in the lifespan of individual clones of N. intermedia. T h e statistical treatment of the lifespans of the 100 parallel series members suggests that overall, lifespan is a highly controlled event, and the individual lifespans fall into the normal distribution around the mean for each series. Individual clones of the parallel series however can exhibit unrelated lifespans. For instance, parallel clone v i of strain X l - 8 in figure 31 lived to be 41+ subcultures. N o other parallel culture f rom the 50 in figure 31 lives to be nearly that long. Escape from senescence has been observed before (Griffiths, pers. comm.), and explanations which account for it include the possibility that the culture has become contaminated and is no longer senescent. Another explanation is that cytoplasmic recombination and assortment may have led to the loss of m t A R - k a l D N A . Statistically, the parallel series data could be used to find nuclear genotypes and molecular events which affect longevity. T h i s sort of analysis is called ANalysis O f V A r i a n c e ( A N O V A ) , and can be used to describe crosses which give rise to individuals with different lifespans, but to be statistically accurate A N O V A requires numbers of individuals that would be prohibitive for many types of analyses. For instance, from the data provided in figures 31 and 32, A N O V A can be used to show that there are statistically significant differences in the lifespans between the crosses using geographically distinct male parents shown in figures 31 and 32 (the lifespans presented in figure 31 are f rom geographically similar parents, and those in figure 32 are f rom geographically isolated parents). T h i s implies that there are differences between the male parents that can be detected in the longevities of their progeny. T h i s is only possible because the two groups of 50 are significant for this analysis (data not shown). T o determine whether there were statistically significant differences 206 Part II: Parallel Subculture Series Experiments between the lifespans of the individual strains would require approximately 50 parallel cultures for each, instead of 10. It is at this level that the numbers become prohibitive. A n o t h e r problem is that the identification of important events in the senescence process, like the. apparent deletions of the m t D N A which are seen in strain 1-4, may be specific only to that strain. Is this process general or specific to the genotype present in this individual? Is a lifespan of 12 equal to a lifespan of 14? These are the questions which the use of large numbers of progeny can answer, and the use of statistical methods and many progeny may be required in spite of the formidable numbers involved to determine what senescent events are programmed to occur in this stochastic process. T h e interpretation of the results is hampered by the observation that, at least in some cases, the analysis may be different every time it is performed. If sampling in this system disturbs it so m u c h that it is impossible to tell what is happening, then the situation in this system may resemble the Heisenberg uncertainty principle. T h i s paradox can only be resolved if procedures are developed which do not require the amplification of the senescent cultures prior to m t D N A isolation. A n ultra-small scale m t D N A isolation would solve this problem, or alternatively, the use of t o t a l D N A isolations which do not require strain amplification may be required. T h e n the P C R could be used to amplify very small amounts of D N A . Another experimental protocol for s tudying function in this system is to analyze the m t D N A s from every subculture. In this way it should be possible to observe the events occurring, rather than making predictions based on one m t D N A isolation. T h i s , coupled with the use of parallel series may provide a better way of identifying the etiology of events in this very complicated system. 207 Part II: Parallel Subculture Series Experiments Other Models Several relevant observations on these processes have been made in the study of senescence in Podospora anserina. In Podospora anserina it has been found that senescence occurs in two phases. Its onset corresponds to a. unique event with a constant probabili ty per unit of time. T h i s is followed by the incubation phase which is specific for each race (Marcou, 1961). T h e same kinetics of senescence may apply to senescence in TV. intermedia, however the data for lifespan in Podospora is reported in months, and growth is reported as the movement of a growth front on a petri dish, therefore the data are difficult to compare. It should also be noted that there are fundamental differences in the underlying molecular events; senescence in P. anserina is caused by the excision and amplification of s e n D N A s , while in TV. intermedia, senescence is caused by the destruction of the m t D N A by kaiilo. A n o t h e r clear phenomenon in P. anserina is the effect that nuclear genes have on lifespan. Eight nuclear genes which affect colony morphology have been found to delay or even prevent the onset of senescence in this organism. How these genes can affect the expression of a mitochondrial intron is not entirely clear. O n a similar note, nuclear suppressors have been found to affect the expression of kaiilo senescence in Neurospora ( A . J . F . Griffiths pers. comm.). Therefore it may be possible to identify functional processes in the kaiilo process after all, if, say, nuclear genes which prevent the integration of m t A R - k a l D N A were found. T h e structure of the m t D N A in the cms S strains of maize is a collection of linear molecules with S-plasmid sequences at their termini that have arisen through recombination with the linear plasmids S - l and S-2. These recombinations occur at sites of homology between the T I R s of SI and S-2 and the maize m t D N A (Schardl et al, 1984). Reversion to male fertility in these strains correlates with the loss of S - l and S-2, and the recircularization of the m t D N A (Schardl et al, 1985). It is not known if insertion of kaiilo D N A in the m t D N A of TV. intermedia also has such profound affects on the structure of the m t D N A , however the lack of regions of extensive homology between the plasmid 208 Part II: Parallel Subculture Series Experiments and the m t D N A seen in this system suggests that insertion is via a different mechanism, although the presence of a target site seems important ( C h a n et al, 1989a). T h e structure of the m t D N A from the senescent strains is not known, although m t D N A seems highly degraded as shown in figure 30. If kalilo were to promote these types of m t D N A rearrangements, then they too may have an effect on the senescence process. T h e cms traits are affected by a number of nuclear restorer genes. T h i s implies that insertional behavior or some aspect of plasmid biology can be modulated by nuclear genotype (Laughnan et al, 1981). Therefore similar processes may be seen in the kalilo system. Finally , the report of the existence of m t l S - k a l D N A with oppositely oriented terminal repeats of m t D N A suggests the possibility that, this m t D N A aberration arises by crossovers between molecules with similar inserts of kalilo (Bertrand, 1986). Another model for the insertion of kalilo D N A is the generation of long inverted repeats through the illegitimate recombination of the T I R s of kalilo with short homologous regions of the m t D N A , allowing for an unscheduled round of D N A replication ( C h a n et al, 1989a). T h e identification of only one pair of junct ion fragments in some strains is consistent with the latter hypothesis. It should be noted that a structure other than the one illustrated in figure 40 is possible based upon the data. T h i s structure is a simple insertion of kalilo without the m t D N A inversion. T h e four junction fragments arise v ia molecules with kalilo in both orientations. It is impossible to decide between these two models for the structure of the m t D N A in strain 1-16, as many different sorts of m t D N A molecules could give the results illustrated in figures 38 and 39. However, the terminally inverted repeats of m t D N A that are thought to surround inserts of m t l S - k a l D N A are expected to exist because cultures with single insertions always exhibit junction fragments that differ in molecular weight b y 1 kb in B g l II digests of the m t D N A . In this part of the thesis a number of experiments were described that were designed to find the programmed functions of the kalilo plasmid, in response to the observation that the kalilo linear plasmid was entirely mitochondrial . These experiments have led to the discovery that juvenile 209 Part. II: Parallel Subculture Series Experiments strains that are the. progeny of senescent female parents have a m u c h more extensive range of lifespans than their female parents, and that nuclear genes which affect the lifespan are thought to exist. W i t h respect to senescence, a number of novel ideas on the underlying molecular events have been discovered. These are the relative importance of m t D N A alterations in addition to the generation of m t l S - k a l D N A , and the presence of large amounts of the free plasmid, m t A R - k a l D N A . T h e observation that large numbers of identical clones of juvenile strains can acquire identical inserts of m t l S - k a l D N A , and similar alterations of m t D N A , suggests the possibility that insertion and subsequent D N A deletion may be programmed events, or the possibility that juvenile strains inherit undetectable amounts of altered m t D N A s . Final ly , the presence of m t l S - k a l D N A with oppositely oriented long inverted repeats of m t D N A suggests that recombination may be occurring between molecules of m t D N A with inserts of m t l S - k a l D N A . 210 Literature C i t e d LITERATURE CITED A k i n s R A . , G r a n t D . M . , Stohl L . L . , Bottoroff D . A . , Nargang F . E . , and Lambowitz A . M . (1988). Nucleotide Sequence of the V a r k u d Mitochondria l Plasmid of Neurospora and Synthesis of a H y b r i d Transcript W i t h a 5' Leader Derived from Mitochondria l R N A . J . M o l . B i o l . 204(1): 1-25. . A k i n s R . A . , Kelley R . L . , and Lambowitz A . M . (1986). Mitochondria l Plasmids of Neurospora: Integration into Mitochondria l D N A and Evidence for Reverse Transcr ipt ion in Mitochondria . Cell 47: 505-516. A k i n s R . A . , Kelley R . L . , and Lambowitz A . M . (1989). Characterization of M u t a n t Mitochondria l Plasmids of Neurospora. spp. T h a t Have Incorporated t R N A s by Reverse Transcr ipt ion. M o l . C e l l . Biol . 9(2): 678-691. A k i n s R . A . , and Lambowitz A . M . (1984). T h e poky M u t a n t of Neurospora Contains a 4-base-pair Deletion at the 5' E n d of the Mitochondr ia l Small r R N A . Proc . N a t l . A c a d . Sci. 81: 3791-3795. A l m a s a n A . , and M i s h r a N . C . (1988). Molecular Characterization of the Mitochondria l D N A of a New Stopper M u t a n t E R - 3 of Neurospora crassa. Genetics 120(4): 935-945. Anderson S., Bankier A . T . , Barrell B . G . , D e B r u i j n M . H . L . , Coulson A . R . , D r o u i n J . , Eperon I .C. , Nierlich C P . , Roe B . A . , Sanger F . , Schreier P . H . , Smith A . J . H . , Staden R., and Y o u n g I . G . (1981). Sequence and Organization of the H u m a n Mitochondria l Genome. Nature 290:457-464. A t k i n s o n T . , and S m i t h M . (1984). Purification of Oligonucleotides O b t a i n e d by Small Scale (0.2uxnol) A u t o m a t e d Synthesis by G e l Electrophoresis, in Oligonucleotide Synthesis: A  Practical A p p r o a c h . M . J . G a i t , ed. ( IRL Press: Oxford) , p p . 35-81. 2 1 1 Literature Ci ted Backer J . S , and B i r k y C . W . Jr. (1985). T h e Origin of M u t a n t Cells: M e c h a n i s m b y W h i c h Saccharomyces cerevisiae Produces Cells Homoplasmic for New Mitochondr ia l Mutations. C u r r . Genet . 9: 627-640. Bamford D . H , M c G r a w T , Mackenzie G , and M i n d i c h L . (1983). Identification of a Protein Coat Covalently B o u n d to the T e r m i n i of Bacteriophage P R D 1 D N A . J . V i r o l . 45:311-316. Baszczynski C L , and K e m b l e R . J . (1987). T e r m i n a l Protein Association and Sequence Homology in Linear Mitochondria l Plasmid-Like D N A s of Sorghum and Maize . Plant Cel l Reports 6:127-130. Beadle G . W . (1945). Genetics and Metabol ism in Neurospora. Physiol . Rev. 25: 643-663. Bedinger P , De Hostos E . L , Leon P , and W a l b o t V . (1986). C l o n i n g and Characterization of a linear 2.3kb Mitochondrial Plasmid of Maize . M o l . G e n . Genet . 205: 206-212. Belcour L , K o l l F , V i e r n y C , Sainsard-Chanet A , and Begel O . (1986). A r e Proteins Encoded in Mitochondria l Introns Involved in the Process of Senescence in the Fungus Podospora anserina? In M o d e r n Trends in A g i n g Research, Y . Courtois, B . Faucheux, B . Forette, D . L . K n o o k , and J . A . Tre ton , eds. (London: John Libbey & C o m p a n y L t d . ) . Colloque I N S E R M vol. 147: 63-71. CP Belcour L , Begel O , Mosse M . O , and V i e r n y C . (1981). Mitochondrial D N A amplification in Senescent Cultures of Podospora anserina: Variabi l i ty Between the Retained, Ampli f ied Sequences. C u r r . Genet. 3: 13-22. Belcour L , and Begel O . (1978). Lethal Mitochondria l Genotypes in Podospora anserina: A M o d e l for Senescence. M o l . G e n . Genet . 163: 113-123. Belcour L , and V i e r n y C . (1986). Variable D N A Splice Sites of a Mitochondria l Intron: Relationship to the Senescence Process in Podospora. E M B O J . 5(3): 609-614. 212 Literature Ci ted Bendich A . J . (1982). Plant Mitochondria l D N A : T h e Last Frontier, in Mitochondria l Genes. P . Slonmiski , P . Borst and G . A t t a r d i , eds. (Cold Spring Harbour Laboratory: C o l d Spring Harbour) , p p . 477-481. Bertrand H . (1983). A g i n g and Senescence in F u n g i . In Intervention in the A g i n g Process, Part B :  Basic Research and Preclinical Screening, W . Regelson and R . M . Sines, eds. (New Y o r k : A l a n R. Liss), pp. 233-251. Bertrand H . (1986). T h e kalilo Senescence Factor of Neurospora intermedia: A Mitochondria l IS-Element Derived from a Nuclear Plasmid. In Extrachromosomal Elements in Lower  Eukaryotes , R . Wickner , A . Hinnebusch, L . Mets , A . Lambowitz , A . Holaender, eds. (New Y o r k : P l e n u m Press), pp. 93-104. Bertrand H . , C h a n B . S . S . , and Griffiths A . J . F . (1985). Insertion of a Foreign Nucleotide Sequence . Into Mitochondr ia l D N A Causes Senescence in Neurospora intermedia. C e l l 41: 877-884. Ber t rand H . , Collins R . A . , Stohl L . L . , Goewert R . R . , and Lambowitz A . M . (1980). Deletion M u t a n t s of Neurospora crassa Mitochondrial D N A a n d ' T h e i r Relationship to the "Stop-Start" G r o w t h Phenotype. Proc . N a t l . A c a d . Sci. 77(10): 6032-6036. Bertrand H . , Griffiths A . J . F . , Court D . A . , and C h e n g O K . (1986). A n Extrachromosomal Plasmid is the Etiological Precursor of k a l D N A Insertion Sequences in the M i t o c h o n d r i a of Senescent Neurospora. Cell 47: 829-837. Bertrand H . , M c D o u g a l l K . J . , and Pittenger T . H . (1968). Somatic Cel l Variat ion D u r i n g Uninterrupted G r o w t h of Neurospora crassa in Continuous G r o w t h Tubes . J . G e n . Microbiol . 50: 337-350. Bertrand H . , Szakacs N . A . , Nargang F . E . , Zagozeski O A . , Collins R . A . , and Harrigan J . C . (1976). T h e F u n c t i o n of Mitochondrial Genes in Neurospora crassa. C a n . J . Genet . C y t o l . 18: 397-409. 213 Literature C i t e d Ber t rand H . , Bridge P . , Collins R . A . , Garr iga G . , and Lambowitz A . M . (1982). R N A Splicing in Neurospora Mitochondria : Characterization of New Nuclear M u t a n t s W i t h Defects in Splicing the Mitochondrial Large r R N A . Cell 29: 517-526. Bertrand H . , and Griffiths A . J . F . (1989). Linear Plasmids that Integrate into the Mitochondrial D N A in Neurospora. Genome 31(1): 155-159. Ber t rand H . , and K o h o u t J . (1977). Nuclear Suppressors of the poky Cytoplasmic mutant in Neurospora crassall: Mi tochondria l Cytochrome Systems. C a n . J . Genet . C y t o l . 19: 81-91. Bertrand H . , and Pittenger T . H . (1969). Cytoplasmic Mutants Selected F r o m Continuously Growing Culutres of Neurospora crassa. Genetics 61: 643-659. Bertrand H . , and Pittenger T . H . (1972a). Isolation and Classification of Extranuclear M u t a n t s of Neurospora crassa. Genetics 71: 521-533. Ber t rand H . , and Pittenger T . H . (1972b). Complementation A m o n g Cytoplasmic M u t a n t s of Neurospora crassa. M o l . G e n . Genet . 117: 82-90. B i r k y C . W . J r . , V a n Winkle-Swift K . P , Sears B . B , B o y n t o n J . E . , and G i l l h a m N . W . (1981). Frequency Distributions for Chloroplast Genes in Chlamydomonas Z y g o t e , C l o n e s : E v i d e n c e for R a n d o m D r i f t . Plasmid 6:173-192. B i r k y C . W . J r . , Demko C . A . , Per lman P .S . , and Strausberg R. (1978a). Uniparental Inheritance of Mitochondrial genes in yeast: Dependence on Input Bias of D N A and Preliminary Investigations of the M e c h a n i s m . Genetics 89:615-651. B i r k y C . W . J r . , Strausberg R . L . , Per lman P .S . , and Forster J . L . (1978b). Vegetative Segregation of M i t o c h o n d r i a in Yeast : Es t imat ing Parameters Using a R a n d o m M o d e l . M o l . G e n . Genet . 158:251-264. B i r k y C . W . J r . (1973). O n the Origin of Mitochondria l M u t a n t s : Evidence for Intracellular Selection of M i t o c h o n d r i a in the O r i g i n of Antibiotic-Resistant Cells in Yeast . Genetics 74:421-432. 214 Literature Ci ted Borst P . (1972). Mitochondrial Nucleic A c i d s . A n n . Rev. Biochem. 41: 333-376. B r a u n C . J , Sisco P . H , Sederoff R . R , and Levings, C . S . I l l (1986). Characterization of Inverted Repeats f rom Plasmid-Like D N A s and the Maize Mitochondrial Genome. C u r r . Genet . 10(8):625-630. Breitenberger C . A , and R a j B h a n d a r y U . L . (1985).- Some Highlights of Mitochondria l Research Based on Analysis of Neurospora crassa Mi tochondria l D N A . T I B S , December, 1985. Breitenberger C . A , Browning K . S , A l z n e r - D e Weered B , and R a j B a h n d a r y U1L. (1985). R N A Processing in Neurospora crassa Mi tochondria : Use of Transfer R N A Sequences as Signals. E M B O J . 4(1): 185-195. Brown G . G , Castora F . J , Frantz S . C , and Simpson M . V . (1981) Mitochondria l D N A P o l y m o r p h i s m : Evolutionary Studies on the Genus Rattus. In Origins and Evolut ion of  Eukaryot ic Intracellular Organelles, A n n . N : Y . A c a d . Sci . 361: 119-134. Burger G , Cit ter ich M . H , Nelson M . A , Werner S , and M a c i n o G . (1985). R N A Processing in Neurospora crassa Mitochondria : Transfer R N A s Punctuate a Large Precursor Transcr ipt . E M B O J . 4(1): 197-204. Burke J . M , and R a j B h a n d a r y U . L . (1982). Intron W i t h i n the Large r R N A Gene, of N. crassa M i t o c h o n d r i a : A Long O p e n Reading Frame and a Consensus Sequence Possibly Important in Splicing. Cell 31: 509-520. Burke J . M , Breitenberger C . A , Heckman J . E , D u j o n B , and R a j B h a n d a r y U . L . (1984). Cytochrome b Gene of Neurospora crassa Mi tochondria . J . B i o l . C h e m . 259: 504-511. Carnevali F , and Leoni L . (1972). Intramolecular Hetereogeneity of Yeast Mitochondria l D N A . Biochem. Byophys . Res. C o m m u n . 47: 1332-1331. C e c h T . R . (1983) R N A Splicing: Three Themes with Variations. Cell 34:713-716. 215 Literature C i t e d Challberg M . D . , and Kel ly T . J . (1982). Eukaryotic D N A Replication: V i r a l and Plasmid M o d e l Systems. A n n . Rev. Biochem. 51:901-934. Chambers P , and Gingold E . (1986). A Direct Study of the Relative Synthesis of Petite and Grande Mitochondrial D N A in Zygotes F r o m Crosses Involving Suppressive Petite M u t a n t s of Saccharomyces cerevisiae. C u r r . Genet . 10:565-571. C h a n B . S , and Bertrand H . (1988). Sequence Analysis of the kahlo plasmid from Neurospora intermedia. Genome 30(Suppl. 1): 318. C h a n B . S , Dasgupta J , Court D . A , Griffiths A . J . F , and Ber t rand H . (1989a). A New T y p e of Insertion Element in Neurospora Generates L o n g Inverted Repeats of Target D N A U p o n Integration into the Mitochondria l Chromosome. Submit ted to Nature. C h a n B . S , Griffiths A . J . F , and B e r t r a n d H . (1989b). T h e kaiilo Senescence Plasmid of Neurospora M a y Encode Vira l -L ike D N A and R N A Polymerases and Has C o - E v o l v e d with Mitochondria . Submitted. Chardon-Lor iaux I , Charpentier M , and Percheron F . (1986). Isolation and Characterization of a Linear Plasmid from Streptomyces mmosus. F E M S Microbiol . Lett . 35(2-3): 151-155. Chase C D , and P r i n g D . R . (1986). Properties of the Linear N l and N2 Plasmid-Like D N A s from M i t o c h o n d r i a of Cytoplasmic Male-Sterile Sorghum bicolor. Plant M o l . Biol . 6(1): 53-64. Coen D , Netter P , Petrochilo E , and Slonmiski* P . P . (1970). Mitochondrial Genetics I: Methodology and Phenomenology. S y m p . Soc. E x p . Biol . 24: 449-453. Collins R . A , and Bertrand H . (1978). Nuclear Suppressors of the [poky] Cytoplasmic M u t a n t in Neurospora crassa. M o l . G e n . Genet . 161: 267-273. Collins R . A , and Lambowitz A . M . (1981). Characterization of a V a r i a n t Neurospora crassa Mitochondria l D N A W h i c h Contains T a n d e m Reiterations of a 1.9 kb Sequence. C u r r . Genet. 4:131-133. 216 Literature C i t e d Coll ins R . A . , and Lambowitz A . M . (1983). Structural Variations in the Mitochondrial D N A s of Neurospora Strains Isolated from Nature . Plasmid 9(1): 53-70. Collins R . A . , and Lambowitz A . M . (1985). R N A Splicing in Neurospora Mitochondria : Defective Splicing of Mitochondrial m R N A Precursors in the Nuclear M u t a n t c y t l 8 - l . J . M o l . Bio l . 184: 413-428. Collins R . A . , Stohl L . L . , Cole M . D . , and Lambowitz A . M . (1981). Characterization fo a Novel Plasmid D N A F o u n d in M i t o c h o n d r i a of N. Crassa. Cell 24: 443-452. C o u r t D . A . , Holmes J . M . , and Bertrand H . (1988). T w o Unique Neurospora Plasmids Integrate Into Mitochondria l D N A by a C o m m o n M e c h a n i s m . Genome 30(Suppl. 1): 318. C u m m i n g s D . J . , and W r i g h t R . M . (1983). D N A Sequence of the Excision Sites of a Mitochondria l Plasmid from Senescent Podospora ansenna. N u c l . Acids Res. 11: 2111-2119. C u m m i n g s D . J . , Belcour L . , and- G r a n d c h a m p C . (1979a). Mitochondr ia l D N A from Podospora anserinal: Isolation and Characterization. M o l . G e n . Genet . 171:229-238. C u m m i n g s D . J . , Belcour L . , and G r a n d c h a m p C . (1979b). Mitochondria l D N A from Podospora ansenna II: Properties of M u t a n t D N A and Mult imeric Circular D N A from Senescent Cultures. M o l . G e n . Genet. 171: 239-250. C u m m i n g s D . J . , L a p i n g J . L . , and Nolan P . E . (1980). Cloning of Senescent Mitochondrial D N A from Podospora ansenna: A Beginning. In T h e Organization and Expression of the Mitochondrial Genome, C . Saccone, A . M . K r o o n , eds. (New Y o r k : Elsevier/ Nor th Holland) , pp.97-102. C u m m i n g s D . J . , M a c N e i l J . A . , Domenico J . , and M a t s u u r a E . T . (1985). Excision-Amplification of Mitochondria l D N A D u r i n g Senescence of Podospora ansenna: D N A Sequence Analysis of Three Unique "Plasmids . " J . M o l . B i o l . 185; 659-680. 217 Literature C i t e d Dasgupta J , C h a n B . S , and Bertrand H . (1988). Kaiilo Insertion Sequences f rom Senescent Strains of Neurospora intermedia are Flanked by L o n g Inverted Repeats of the Mitochondria l D N A . G e n o m e 30(Suppl. 1): 318. Davies R . W , W a r i n g R . B , Ray J . A , B r o w n T . A , and Scazzocchio C . (1982). M a k i n g E n d s Meet : A M o d e l for R N A Splicing in Fungal Mitochondria . Nature 300:719-724. Davis R . H , and DeSerres F . J . (1970). Genetic and Microbiological Techniques for Neurospora crassa. In Methods in Enzymology, H . T a b o r , and C . T a b o r , eds. (New Y o r k : Academic Press). P P . 79-143. De Jonge J . C , and De Vries H . (1983). T h e Structure of the Gene for Subunit I of Cytochrome c Oxidase in Neurospora crassa Mi tochondria . C u r r . Genet. 7: 21-28. De Vries H , A l z n e r - D e Weerd B , Breitenberger C . A , C h a n g D . D , De Jonge J . C , and R a j B h a n d a r y U . L . (1986). T h e E35 Stopper M u t a n t of Neurospora crassa: Precise Localization of Deletion Endpoints in Mitochondria l D N A and Evidence that the Deleted D N A Codes for a Subunit. of N A D H Dehydrogenase. E M B O J . 5(4): 779-785. De Vries H , De Jonge J . C , V a n ' t Sant P , Agsteribbe E , and A r n b e r g A . (1981). A "Stopper" M u t a n t of Neurospora crassa Containing T w o Populations af Aberrant Mitochondria l D N A . C u r r . Genet . 3: 205-211. Deutsch J , D u j o n B , Netter P , Petrochilo E , Slonmiski P . P . , B o l o t i n - F u k u h a r t a M , and Coen D . (1974). Mitochondria l Genetics V I . T h e Petite Mutat ions in Saccharomyces cerevisiae: Interrelations Between the Loss of the o+ Factor and the Loss of the D r u g Resistance Mitochondr ia l Genetic Markers . Genetics 76: 95-219. DeZamaroczy M . G , Baldacci G , a n d Bernardi G . (1979). Putative Origins of Replication in the Mitochondria l Genome of Yeast . F E B S Lett . 108: 429-432. 218 Literature C i t e d Diacumakos E . G . , Garnjobst L . , and T a t u m E . L . (1965). A Cytoplasmic Character in Neurospora crassa. J . Cel l . B io l . 26: 427-433. Dixon L . K . , and Leaver C . J . (1982). Mitochondria l Gene Expression and Cytoplasmic Male Sterility in Sorghum. PI. M o l . Biol . 1:89-102. D u j o n B . (1981). Mitochondrial Genetics and Funct ions . In T h e Molecular Biololgy of the Yeast Saccharomyces: Life Cycle and Inheritance, J . N . Strather, E . W . Jones, and J . R . Broach, eds. (New Y o r k : C o l d Spring Harbour Laboratories), pp. 505-635. D u j o n B . , Bolo t in -Fukuhara M . , Coen D . , Deutsch J . , Netter P . , Slonmiski P . P . , and W e i l l L . (1976). Mitochondria l Genetics. X I . Mutat ions at the Mitochondria l Locus omega Affecting the Recombination of Mitochondria l Genes in Saccharomyces cerevisiae. M o l . G e n . Genet. 143: 131-165. D u j o n B . , Colleaux L . , Jacquier A . , M i c h e l F . , and Monteilhet C . (1986). Mitochondria l Introns as Mobile Genetic Elements: T h e Role of Intron-Encoded Proteins. In Extrachromosomal ' Elements in Lower Eukaryotes, R. Wickner , A . Hinnebusch, L . Mets , A . Lambowitz , A . Holaender, eds. (New Y o r k : P l e n u m Press), pp. 5-28. Diivell A . , Hesseberg-Stutzke H . , Oeser B . , Rogmann-Ba.ckwinkel P. , and T u d z y n s k i P . P . (1988). Structural and Funct ional Analysis of Mitochondria l Plasmids in Claviceps purpurea. M o l . G e n . Genet . 214(1): 128-134. Ephruss i B . , and G r a n d c h a m p S. (1965). Etudes sur la Suppressivite des mutants a Deficience Respiratoire de la Levure I: Existence au Niveau Cellulaire. de Divers Degres de Suppressivite. Heredity 20: 1-7. Ephruss i B . , Hottinger H . , and Chimenes A . M . (1949) A c t i o n de L 'Acrif lavine sur les Levures I: L a M u t a t i o n 'petite cplonie'. A n n . Inst. Pasteur 76:351-364. 219 Literature C i t e d Erickson L . , Beversdorf W . D . . and Pauls K . P . (1985). Linear Mitochondria l P lasmid in Brassica Has T e r m i n a l Protein. C u r r . Genet . 9(8): 679-682. Escarmis, C , G a r c i a P . , Mendez E , Lpez R , Salas M , and Garc ia E . (1985). Inverted T e r m i n a l Repeats and T e r m i n a l Proteins of the Genomes of Pneumococcal Phages. Gene 36: 341-348. Escarmis, C , Gomez A , G a r c i a P , Concepcion R , Lopez R , and Salas M . (1984). Nucleotide Sequence at the T e r m i n i of the D N A of Streptococcus pneumoniae Phage C p - 1 . Virology 133:166-171. Escarmis C , and Salas M . (1981). Nucleotide Sequence at the T e r m i n i of the D N A of Bacillus subtilis phage cp29. Proc. N a t l . A c a d . Sci. 78(3): 1446-1450. Escote L . J , G a b a y - L a u g h n a n S . J , and Laughna n J . R . (1985). Cytoplasmic Reversion to Fertili ty in cms-S Maize Need Not Involve Loss of Linear Mitochondrial Plasmids. Plasmid 14(3): 264-267. Esser K , K u c k U , Lang-Hinrichs C , Lemke P , Osiewacz H , Stahl U , and T u d z y n s k i P . P . (1986). Plasmids of Eukaryotes. (Berlin: Springer-Verlag) . Esser K , and T u d z y n s k i P . (1979). Genetic. Control and Expression of Senescence in Podospora anserina. In Viruses and Plasmids in F u n g i , P . A . Lemke, ed. (New Y o r k : Marcel Dekker Inc.), Series O n Mycology V o l . 1: 595-616. Faye G , F u k u h a r a H , G r a n d c h a m p C , Lazowska J , Michel F , Casey J , Getz G , Locker J , Rabinowitz M , B o l o t i n - F u k u h a r a M , Coen D , Deutsch J , D u j o n A , Netter B , and Slonmiski P . P . (1973). Mitochondria l Nucleic Acids in the Petite Colony M u t a n t s : Deletions and Repetitions of Genes. Biochimie 55: 779-792. Feinberg A . P , and Vogelstein B . (1983). A Technique for Radiolabelling D N A Restriction Endonuclease Fragments to H i g h Specific A c t i v i t y . A n a l . Biochem. 132:6-13. Files J . G , and Hirsch D . (1981). r D N A of C. elegans. J . M o l . Biol . 149:233-240. 220 Literature C i t e d F i n c h a m J . R . S . , D a y R . R . , and Radford A . (1979). F u n g a l Genetics (Los Angeles: University of California Press), p. 21. Francou F . X . (1981). Isolation and Characterization of a Linear D N A Molecule in the Fungus Ascobolus vmmersus. M o l . G e n . Genet . 184:440-444. Francou F . X . , Randscholt N . , Decaris B . , and Gregoire A . (1987). Presence of Several Plasmids in the F u n g u s Ascobillus immersus, and Homologies with T h e Linear P lasmid p A l . J . G e n . Microbiol . 133(2): 311-316. F u j i m u r a H . , H i s h i s h i m u m a F . , and Gunge N . (1987). T e r m i n a l Segment of Kluyveromyces lactis Linear D N A Plasmid p G K L 2 Supports A u t o n o m o u s Replication of H y b r i d Plasmids in Saccharomyces cerevisiae. C u r r . Genet . 12(2): 99-104. F u j i m u r a H . , Y a m a d a T . , H i s h i n u m a F . , and Gunge N . (1988). D N A Replication m vivo of linear D N A Kil ler Plasmids p G K L l an p G K L 2 in Saccharomyces cerevisiae. FEMS Microbiol. Lett. 49(3): 441-441 F u k u h a r a H . , Faye G . , M i c h e l F . , Lazowska J . , Deutsch J . , B o l o t i n - F u k u h a r a M . , and Slonmiski P . P . (1974) Physical and Genetic Organization of Petite and Grande Yeast Mitochondria l D N A I: Studies by R N A - D N A Hybridizations. M o l . G e n . Genet . 130:215-219. Garcia E . , G o m e z A . , Concepcion R. , Escarmis O , and Lopez R. (1983). Pneumococcal Bacteriophage Cp-1 Contains a Protein B o u n d to the 5' T e r m i n i of Its D N A . Virology 128:92-104. Garr iga G . , and Lambowitz A . M . (1984). R N A Splicing in Neurospora Mitochondria : Self-Splicing of a Mitochondr ia l Intron In Vitro. Cell 39:631-641. Giasson L . , and Lalonde M. (1987). Analysis of a Linear Plasmid Isolated from the Pathogeic Fungus Ceratocystis fimbriata Ell. & Halst. Curr. Genet. 11(4): 331-334-221 Literature C i t e d G i n g o l d E . B . (1981). Genetic Analysis of the. Products of a Cross Involving a Suppressive 'petite' M u t a n t of 5. cerevisiae. C u r r . Genet . 3: 313-320. Goursot R , DeZamaroczy M , Baldacci G , and Bernardi G . (1980). Supersuppressive 'petite' M u t a n t s of Yeast . C u r r . Genet . 8: 387-398. Green M . R , G r i m m M . F . , Goewert R . R , Collins R . A , Cole M . D , Lambowitz A . M . , Heckman J . E , Y i n S , and R a j B h a n d a r y U . L . (1981). Transcripts and Processing Patterns for the Ribosomal and Transfer R N A Region of Neurospora crassa Mitochondria l D N A . J . Bio l . C h e m . 256: 2027-2034. Griffiths A . J . F , and Bertrand H . (1984). Unstable Cytoplasms in Hawaiian Strains of Neurospora intermedia. C u r r . Genet. 8: 387- 398. Griffiths A . J . F , K r a u s S , and Ber t rand H . (1986). Expression of Senescence in Neurospora intermedia. C a n . J . Genet . C y t o l . 28: 459-467. Gross S . R , Hsieh T , Levine P . (1984). Intramolecular Recombination as a Source of Mitochondria l Chromosome Heteromorphism in Neurospora. Cell 38: 233-239. Gunge N , M u r a t a K , and Sakaguchi K . (1982). Transformation of Saccharomyces cerevisiae with Linear D N A Killer Plasmids from Kluyveromyces lactis. J . B a c t e r i d . 151(1): 462-464. Gunge N , T u m a r u A , Ozawa F , and Sakaguchi K . (1981). Isolation and Characterization of Linear Deoxyribonucleic A c i d Plasmids from Kluyveromyces lactis and the Plasmid-Associated Kil ler Character . J . Bacteriol. 145(1): 382-390. Gunge N , and Sakaguchi K . (1981). Intergenic Transfer of Deoxyribonucleic A c i d Killer Plasmids, p G K L l and p G K L 2 , f rom Kluyveromyces lactis into Saccharomyces cerevisiae by Cell Fusion . J . Bacteriol. 147(1): 155-160. 222 Literature C i t e d Gunge N . , and Y a m a n e C . (1984). Incompatibility of Linear D N A Killer Plasmids p G K L l and p G K L 2 from Kluyveromyces lactis with Mitochondria l D N A from Saccharomyces cerevisiae. J . Bacteriol. 159(2): 533-539. H a r d i n g N . E . , Ito J . , and D a v i d G . S . (1978). Identification of the Protein F i r m l y B o u n d to the E n d s of Bacteriophage (j>29 D N A . Virology 84:279-292. Hashiba T . , H o m m a Y . , H y a k u m a c h i M . , and M a t s u d a I. (1984). Isolation of a D N A Plasmid in the F u n g u s Rhizoctania solani. J . G e n . Microbiol . 130:2067-2070. Haskins F . A . , Tissieres A . , Mitchel l H . K . , and Mitchel l M . B . (1953). Cytochromes and the Succinic A c i d Oxidase System of poky Strains of Neurospora. J . Biol . C h e m . 200: 819-826. Hayakawa T . , T a n a d a T . , Sakaguchi K . , Otake N . , and Yonehara H . (1979). J . G e n . A p p l . Microbiol . 25:225-260. Hira tsuka K . , N a m b a S., Y a m a s h i t a S., and D o i Y . (1987). Linear Plasmid-Like D N A s in the F u n g u s Botrytis cmerea. A n n . Phytopath . Soc. Japan 53: 638-642. Hirochika H . , and Sakaguchi K . (1982). Analysis of Linear Plasmids Isolated from Streptomyces: A s s o c i a t i o n of P r o t e i n W i t h the E n d s of the P l a s m i d D N A . Plasmid 7:59-65 Hirochika H . , N a k a m u r a K . , and Sakaguchi K . (1984). A Linear D N A Plasmid from Streptomyces rocher with an Inverted T e r m i n a l Repetition of 614 Base Pairs. E M B O J . 3(4):761-766. H i s h i n u m a F . , N a k a m u r a K . , Hirai K . , Nishizawa R., Gunge N . , and Maede T . (1984). C l o n i n g and Nucleotide Sequences of the Linear D N A Killer Plasmids from Yeast . N u c . A c i d s . Res. 12(19):7581-7597. Hollenberg C P . , Borst P . , and V a n Bruggen E . F . J . (1972a). Mitochondrial D N A from Cytoplasmic Petite M u t a n t s of Yeasts. B i o c h i m . Biophys. A c t a . 277: 35-43. Infanger A . , and Ber t rand H . (1986). Inversions and recombinations in mitochondrial D N A of the (SG-1) cytoplasmic M u t a n t in two Neurospora Species. C u r r . Genet. 10(8): 607-617. 223 Literature C i t e d Ito J . (1978). Bacteriophage 629 T e r m i n a l Protein: Its Assocation wtih the 5' T e r m i n i of the tb29 Genome. J . V i r o l . 28(3):895-904. Jacq C , Banroques J . , Becam A . M . , Slonmiski P . P . , G u i s o N , and D a n c h i n A . (1984). Antibodies against a fused 'lacZ-Yeast Mitochondrial Intron' Gene Product A l l o w Identification of the m R N A Maturase Encoded by the F o u r t h Intron of the Yeast cob-box Gene. E M B O J . 3:1567-1572. Jacquier A , and D u j o n B . (1985). A n Intron Encoded Protein is Act ive in a Gene Conversion Process that Spreads an Intron into a Mitochondria l Gene. Cel l 41: 383-394. J a m e t - V i e r m y C , Begel O . , and Belcour" L . (1980). Senescence in Podospora anserina: Amplif ica t ion of a Mitochondrial D N A Sequence. Cell 21: 189-194. Jinks J . L . (1956). Naturally Occurr ing Cytoplasmic Changes in F u n g i . R e n d . L a . Carlsberg. Ser. Physiol . 26: 183-195. J u n g G , Leavitt M . C , and Ito J . (1987). Yeast Killer Plasmid p G K L l encodes a D N A Polymerase Belonging to the Family B D N A Polymerases. N u c . Acids . Res. 15(21):9088. Keen C L , Mendelovitz S , Cohen G , Aharonowitz Y , and Roy K . L . (1988). Isolation and Characterization of a Linear D N A Plasmid from Streptomyces clavuligerus. M o l . G e n . Genet . 212(1): 172-176. Kemble R . J , and Bedbrook J . R . (1980). Low Molecular Weight Circular and Linear D N A in Mitochondria, from N o r m a l and Male-Sterile Zea mays C y t o p l a s m . Nature 284:565-566. K e m b l e R . J , and M a n s R . J . (1983). Examinat ion of the Mitochondrial Genome of Revertant Progeny from S cms Maize with Cloned S - l and S-2 Hybridizat ion Probes. J . M o l . A p p l . Genet . 2:161-171. 224 Literature Cited Kemble R.J., and Thompson R.D. (1982). SI and S2, the Linear Mitochondrial DNAs Present in a Male-Sterile Line of Maize, Posess Terminally Attached Proteins. Nuc. Acids Res. 10(24):8181-8190. Kemble R.J., Gunn R.E., Flavell R.B. (1980). Classification of Normal and Male-Sterile Cytoplasms in Maize. II. Electrophoretic Analysis of DNA Species in Mitochondria. Genetics 95:451-458. Kennel J.C., and Lambowitz A . M . (1989). Development of an In Vitro Transcription System for Neurospora crassa Mitochondrial DNA and Identification of Transcription Intiation Sites. Mol. Cell. Biol. 9(9):3603-3613. Kikuchi Y., Hirai K., Gunge N., and Hishinuma F. (1985). Hairpin Plasmid - a Novel Linear DNA of Perfect Hairpin Structure. EMBO J. 4(7): 1881-1886. Kikuchi Y., Hirai K., and Hishinuma F. (1984). The Yeast Linear DNA Killer Plasmids, pGKLl and pGKL2, Possess Terminally Attached Proteins. Nuc. Acids. Res. 12(14): 5685-5692. Kim B.D., Mans R.J., Conde M.F., Pring D.R., and Levings III C S . (1982). Physical Mapping of Homologous Segments of Mitochondrial Episomes from S Male-Sterile Maize. Plasmid 7:1-14. Kim W.K., McNabb S.A., and Klassen G.R. (1988). A Linear Plasmid m Tilletia controversa, a Fungal Pathogen of Wheat. Can. J.Bot. 66(6):1098-1100. Kinashi H., and Shimaji M. (1987). Streptomyces plasmids. J. Antibiotics 40(6). Kinsey J.A., and Rambosek J.A. (1984). Transformation of Neurospora crassa with the Cloned am (Glutamate Dehydrogenase) Gene. Mol. Cell. Biol. 4(1):117-127. Kistler H.C., and Leong S.A. (1986). Linear Plasmidlike DNA in the Plant Pathogenic Fungus Fusarium oxysporiumi. sp. conglutinans. J. Bacterid. 167(2): 587-593. Kitada K., and Gunge N. (1988). Palindrome-Hairpin Linear Plasmids Possessing Only a Part of the Yeast Killer Plasmid pGKLl . Mol. Gen. Genet. 215(1): 46-52. 225 Literature Cited K i t ad a K , and H i s h i n u m a F . (1987). A New Linear D N A Plasmid Isolated F r o m the Yeast Saccharomyces kluyveri. M o l . G e n . Genet . 206(3): 377-381. K o h o u t J . , and Bertrand H . (1976). Nuclear Suppressors of the poky Cytoplasmic mutant in Neurospora crassa I: Genetic and Respiratory Properties. C a n . J . Genet . C y t o l . 18: 311-324. K o l l F . , Belcour L , and V i e r n y C . (1985). A 1100-bp Sequence of Mitochondria l D N A is Involved in Senescence Process in Podospora: S tudy of Senescent M u t a n t Cultures . Plasmid 14(2): 106-117. K o n c z C , Sumegi J , U d v a r d y A , Racsmany M , and Dudits D . (1981). C l o n i n g of m t D N A Fragments Homologous to Mitochondria l S2 Plasmid-Like D N A in Maize . M o l . G e n . Genet. 183: 449-458. ' ' Kruger K , Grabowski P . J , Zaug A . J , Sands J , Gottschling D . E , and Cech T . (1982). Self-Splicing R N A : Autoexcision and Autocyclizat ion of the Ribosomal R N A Intervening Sequence of Tet rahymena . Cell 31:147-157. K i i c k U , Stahl II, and Esser K . (1981). Plasmid-like D N A is Part of Mitochondria l D N A in Podospora anserina. C u r r . Genet . 3: 151-156. K i i c k U , Osiewacz H . D , Scmidt U , Kappelhoff B , Schulte E , Stahl U , and Esser K . (1985a). T h e Onset of Senescence is Affected by D N A Rearrangements of a. Discontinuous Mitochondrial Gene in Podospora anserina. C u r r . Genet . 9: 373-382. K i i c k U , Kappelhoff B , and Esser K . (1985b). Despite D N A P o l y m o r p h i s m the Mobile Intron (pi D N A ) of the C O I Gene is Present in T e n Different Races of Podospora anserina. C u r r . Genet . 10:59-67. K u i p e r M . T . R , and Lambowitz A . M . (1988). A Novel Reverse Transcriptase A c t i v i t y Associated with Mitochondrial Plasmids of Neurospora. Cell 55(4): 693-704. 226 Literature C i t e d Lambowitz A . M . (1979). Preparation and Analysis of Mitochondria l Ribosomes. M e t h . E n z y m o l . 59:421-433. Lambowitz A . M . , L a P o l l a R . J . , and Collins R . A . (1979). Mitochondria l Ribosome Assembly in Neurospora. J . Cel l Biol . 82:17-31. Lambowitz A . M . , A k i n s R . A . , Kelley R . L . , Pande S., and Nargang F . E . (1986). Mitochondria l Plasmids of Neurospora and Other Filamentous F u n g i . In Extrachromosomal Elements in Lower Eukaryotes, R. Wickner , A . Hinnebusch, L . Mets , A . Lambowdtz, A . Holaender, eds. (New Y o r k : P l e n u m Press), p p . 83-92. Laughnan J .R . , G a b a y - L a u g h a n a n S., and Carlson J . E . (1981). Characteristics of cms-S Reversion to Male Fert i l i ty in Maize. Stadler S y m p . 13:93-114. Lazarus C M . , and K u n t z e l H . (1981). A n a t o m y of A m p l i f i e d Mitochondria l D N A in 'Ragged' M u t a n t s of Aspergillus amstelodami: Excision Points W i t h i n Protein Genes and a C o m m o n 215bp Segment Containing a Possible Origin of Replication. C u r r . Genet . 4: 99-107. Lazarus C M . ; E a r l A . J . , Turner G . , and K u n t z e l H . (1980). Amplif icat ion of a Mitochondria l D N A Sequence in the Cytoplasmically Inherited 'Ragged' M u t a n t of Aspergillus amsielodami. E u r . J . Biochem. 106: 633-641. Lazdins I.B., and C u m m i n g s D . J . (1982). Autonomously Replicating Sequences in Y o u n g and Senescent Mitochondrial D N A F r o m Podospora ansenna. C u r r . Genet . 6: 173-178. Lemire E . G . , and Nargang F . E . (1986). A Missense M u t a t i o n in the oxi-3 Gene of the mi-3 Extranuclear M u t a n t of Neurospora crassa. J . B i o l . C h e m . 261: 5610-5615. Levings III C . S . , K i m B . D . , P r i n g D . R . , Conde M . F . , M a n s R . J . , Laughnan J .R . , and G a b a y -Laughnan S.J . (1980). Cytoplasmic Reversion of cms-s in Maize : Association with a Transpositional Event . Science 209:1021-1023. 227 Literature C i t e d Levings III C . S . , Sederoff R . R . , H u W . W . L . , and T i m o t h y D . H . (1982). Relationships A m o n g Plasmid-Like D N A s of the Maize Mitochondria . In Structure and Funct ion of Plant Genomes, O . Ciferri , and L . Dure , eds. (Plenum:New Y o r k ) , p p . 363-372. Levings III C . S . , and Sederoff R . R . (1983). Nucleotide Sequence of the S-2 Mitochondria l D N A from the S C y t o p l a s m of Maize . Proc . N a t l . A c a d . Sci . 80:4055-4059. Locker J . , Rabinowitz M . , and Getz G . S . (1974). T a n d e m Inverted Repeats in Mitochondrial D N A ofPetite M u t a n t s of Saccharomyces cerevisiae. Proc. N a t l . A c a d . Sci. 71:1366-1370. Lopez R. , Concepcion R. , G a r c i a P . , Escarmis C , and Garcia E . (1984). Restriction Cleavage M a p s of the D N A s of Streptococcus pneumoniae Bacteriophages Containing Protein Covalently B o u n d to T h e i r 5' E n d s . M o l . G e n . Genet. (1984). 197:67-74. Lovett J .S. , and Leaver C . J . (1969). High-Molecular -Weight Artifacts in R N A Extracted from Blastociella at Elevated Temperature . B i o c h i m . Biophys. A c t a 195:319-3237. Lucas M . C . , Jacobsen J . W . , and Giles N . H . (1977). Characterization of an in vitro Translation of Polyadenylated Messenger Ribonucleic A c i d f rom Neurospora crassa. J . Bacteriol. 130:1192-1198. M a n n e l l a C . A . , and Lambowitz A.M. (1978). Interaction of W i l d T y p e and Poky Mitochondrial D N A in Heterokaryons of Neurospora. Biochem. Biophys. Res. C o m m u n . 80(3): 673-679. M a n n e l l a C . A . , and Lambowitz A . M . (1979). Unidirectional Gene Conversion Associated with T w o Insertions in Neurospora crassa Mitochondria l D N A . Genetics 93: 645-654. Maniatis T . , Fr i tsch E . F . , and Sambrook J . (1982). Molecular Cloning : A Laboratory M a n u a l (Cold Spring Harbour , New Y o r k : C o l d Spring Harbour Laboratories). Marcou D . (1961). Notion de Longevite et Nature Cytoplasmique du Determinant de la Senescence Chez Quelques Champignons . A n n . Sci . Natur . Botan . 12:653-764. 228 Literature Ci ted M a r c o u D , and Schecroun J . (1959). L a Senescence Chez Podospora anserina Pourrait etre due a des Particules Cytoplasmique Infectants. C o m p . R e n d . A c a d . Sci. Ser. D . 248: 280-295. M c C l i n t l o c k B . (1947). Cytogenetic. Studies of Maize and Neurospora. Carnegie Inst. Washington Yearbook 46:146-152. M c C l i n t l o c k B . (1949). Mutable Loci in Maize . Carnegie Inst. Washington Yearbook 48:157-167. M c C l i n t l o c k B . (1951). Chromosome Organization and Gene Expression. C o l d Spring Harbour S y m p . Q u a n t . B io l . 16:13-47. Meinhardt F , K e m p k e n F , and Esser K . (1986). Proteins A r e At tached to the E n d s of a Linear P lasmid in the filamentous Fungus Ascobillus vmmersus. C u r r . Genet . 11(3): 243-246. Meinhardt F , and Esser K . (1984). Linear Extrachromosomal D N A in the Morel Morchell conica, C u r r . Genet . 8:15-18. Messing J . (1983). New M 1 3 Vectors for C l o n i n g . M e t h . E n z y m . 101: 20-78. Meyer R . J , Hintz W . A , M o h a n M , Robison M , Anderson J . B , and Horgen P . A . (1988). Homology of Agaricus Mitochondria l Plasmids with Mitochondria l D N A . Genome 30(5'):710-716. Michealis G , Petrochilo E , and Slonmiski P . P . (1973). Mitochondrial Genes III. Recombined Molecules of Mitochondrial D N A Obtained F r o m Crosses Between Cytoplasmic Petite M u t a n t s of Saccharomyces cerevisiae: Physical and Genetic Characterization. M o l . G e n . Genet . 123: 51-62. M i c h e l F , and D u j o n B . (1983). Conservation of R N A Secondary Structure in T w o Intron Families Including Mitochondrial , Chloroplast , and Nuclear Encoded Members . E M B O J . 2:33-37. M i c h e l F , and C u m m i n g s D . J . (1985). Analysis of Class I Introns in a Mitochondria l Plasmid Associated with Senescence of Podospora anserina Reveals Extraordinary Resemblance to the Tetrahymena Ribosomal Intron. C u r r . Genet . 10(1): 69-79. 229 Literature Cited Michel F , and Lang F.B. (1985). Mitochondrial Class II Introns Encode Proteins Related to the Reverse Transcriptases of Retroviruses. Nature 316:641-643. Michel F , Jacquier A., and Dujon B. (1982). Comparison of Fungal Mitochondrial Introns Reveals Extensive Homologies in RNA Secondary Structure. Biochimie 64:867-881. Mitchell M . B , and Mitchell H.K. (1952). A case of 'Maternal' Inheritance in Neurospora crassa. Proc. Natl. Acad. Sci. 38: 442-449. Mitchell M . B , Mitchell H . K , and Tissieres A. (1953). Mendelian and Non-Mendelian Factors Affecting the Cytochrome System in Neurospora crassa. Proc. Natl. Acad. Sci. 39: 606-613. Mohan M , Meyer R.J , Anderson J .B, and Horgen P.A. (1984). Plasmid-Like DNAs in the Comercially Important Mushroom Genus Agaricus. Curr. Genet. 8: 615-619. Mounolou J .C , Jakob H , and Slonmiski P.P. (1966). Mitochondrial DNA from Yeast "Petite" Mutants: Specific Changes of Buoyant Density Corresponding to Different Cytoplasmic Mutations. Biochem. Biophys. Res. Commun. 24:218-122. Moustacchi E. (1972). Determination of the Degree of Suppressivity of Saccharomyces cerevisae Strain RD1A. Biochim. Biophys. Acta 277: 59-60. Munkres K . D , and Minssen M. (1976). Ageing of Neurospora crassa I. Evidence for the Free Radical Theory of Ageing from Studies of a Natural-Death Mutant. Mech. Age. Develop. 5:79-98. Myers C.J. (1988). Transmission of Kaiilo DNA in Senescent Strains of Neurospora intermedia. Ph. D. Thesis, University of British Columbia. Myers C.J , Griffiths A.J .F, and Bertrand H. (1989). Linear Kaiilo DNA is a Neurospora Mitochondrial Plasmid That Integrates into the Mitochondrial DNA. Mol. Gen. Genet, (in Press). 230 Literature Cited Nagley P. and Linnane A.W. (1972). Cellular Regulation of Mitochondrial DNA Synthesis in Saccharomyces cerevisae. Cell. Differ. 1: 143-152. Nargang F.E. (1985). Fungal Mitochondrial Plasmids. Exp. Mycol. 9: 285-293. Nargang F.E. (1986). Conservation of a Long Open Reading Frame in Two Neurospora Mitochondrial Plasmids. Mol. Biol. Evol. 3:19-28. Nargang F.E., Bell J.B., Stohl L.L., and Lambowitz A . M . (1984). The DNA Sequence and Genetic Organization of a Neurospora Mitochondrial Plasmid Suggest a Relationship to Introns and Mobile Elements. Cell 38(2): 441-453. Natvig D.O., May G., Taylor J.W. (1984). Distribution and Evolutionary Signifigance of Mitochondrial Plasmids in Neurospora spp. J. Bacteriol. 159(1): 288-293. Nelson M.A., and Macino G. (1985). Gene Organization and Expression in Neurospora crassa Mitochondria. In Achivements and Perspectives of Mitochondrial Research Volume II: Biogenesis, E. Quagliariello, E.C. Slater, F. Palmieri, C. Saccone and A.M. Kroon, eds. (Amsterdam: Elsevier) pp.293-304. Nelson M.A., and Macino G. (1987). Three Class I Introns in the ND4/ND5 Transcriptional Unit of Neurospora crassa Mitochondria. Mol. Gen. Genet. 206:318-325. Neupert W., Massinger P., and Pfaller P. (1971). Amino Acid Incorporation into Mitochondrial Ribosomes of Neurospora crassa Wild-Type and mi-1 Mutant. In Autonomy and Biogenesis of Mitochondria and Chloroplast. (Amsterdam: North/Holland), pp. 328-338. Niwa O., Sakaguchi K., and Gunge N. (1981). Curing of the Killer Deoxyribonucleic Acid Plasmids of Kluyveromyces lactis. J. Bacteriol. 148(3): 988-990. Normand P., Simonet P., Giasson L., Ravel-Chapuis P., Fortin J.A., and Lalonde M. (1987). Presence of a Linear Plasmid-Like DNA Molecule in the Fungal Pathogen Ceratocystis fimbriata Ell. & Halst. Curr. Genet. 11(4): 335-338. 231 Literature Cited Osiewacz H.D. , and Esser K. (1984). The Mitochondrial Plasmid of Podospora anserina: A Mobile Intron of a Mitochondrial Gene. Curr. Genet. 8: 299-305. Osinga K . A , DeVries E , VanderHorst G . T . J , and Tabak H.F . (1984). Initiation of Transcription in Yeast Mitochondria: Analysis of Origins of Replication and of Genes Coding for a Messenger R N A and a Transfer R N A . Nuc. Acids. Res. 12(4): 1889-1990. Osinga K . A , and Tabak H.F. (1982). Initiation of Transcription of Genes for Mitochondrial Ribosomal R N A in Yeast: Comparison of the Nucleotide Sequence around the 5'-ends of both Genes Reveals a. Homologous Stretch of 17 Nucleotides. Nuc. Acids. Res. 10(12): 3617-3626. Padgett R . A , Konarska M . M , Grabowski P . J , Hardy S . F , and Sharp P .A. (1984). Lariats R N A Intermediates and Products in the Splicing of Messenger R N A Precursors. Science 225:898-903. Paillard M , Sederoff R . R , and Levings III C.S. (1985). Nucleotide Sequence of the S-l Mitochondrial D N A from the S Cytoplasm of Maize . E M B O J. 4(5)-.1125-1128. Palmer J . D , Shields C R , Cohen D B , and Orton T . J . (1983). An Unusual Mitochondrial D N A Plasmid in the Genus Brassica. Nature 301:725-728. Pande S , Lemire E . G . , and Nargang F . E . (1989). The Mitochondrial Plasmid from Neurospora intermedia Strain Labelle-lb Contains a Long Open Reading Frame With Blocks of Amino Acids Characteristic of Reverse Transcriptases and Related Proteins. Nuc. Acids Res. 17(5): 2023-2042. Perlman P . S , and Birky C.W. (1974). Mitochondrial Genetics of Baker's Yeast: A Molecular Mechanism for Recombinational Polarity and Suppressiveness. Proc. Natl. Acad. Sci. 71: 4612-4616. 232 Literature Cited Pring D.R., Conde M.F., Schertz K.F., and Levings, C S . III. (1982). Plasrnid-Like DNAs Associated withMitochondria of Male-Sterile Sorghum. Mol. Gen. Genet. 186: 180-184. Pring D.R., Levings III C.S., Hu W.W.L., and Timothy D.H. (1977). Unique DNA Associated wtih Mitochondrial in the "S"-type Cytoplasm of Male-Sterile Maize. Proc. Natl. Acad. Sci. 74(7):2904-2908. Rank G.H. (1970a). Genetic. Evidence for 'Darwinian' Selection at the Molecular Level I: The Effect of the Suppressive Factor on Cytoplasmically Inherited Erythromycin Resistance in Saccharomyces cerevisiae. Can. J. Genet. Cytol. 12: 129-138. Rank G.H. (1970a). Genetic Evidence for 'Darwinian' Selection at the Molecular Level II: Genetic Analysis of Cytoplasmically-Inherited High and Low Suppressivity in Saccharomyces cerevisiae. Can. J. Genet. Cytol. 12: 340-351. Rank G.H., and Bech-Hansen N.T. (1972). Somatic Segregation, Recombination, Asymmetrical Distribution and Complementation Tests of Cytoplasmically-Inhertited Antibiotic-Resistance Markers in Saccharomyces cerevisiae. Genetics 72: 1-15. Reick A., Griffiths A.J.F., and Bertrand H. (1982). Mitochondrial Variants of Neurospora intermedia From Nature. Can. J. Genet. Cytol. 24: 741-759. Rifkin M.R., and Luck D.J.L. (1971). Defective Production of Mitochondrial Ribosomes in the poky Mutant of Neurospora crassa. Proc. Natl. Acad. Sci. 68: 287-290. Rizet G. (1953). Sur 1'impossibilite d'obtenir la multiplication vegetative ininterrrompue et illimitee de l'ascomycete Podospora anserina. Comp. Rend. Acad. Sci. Ser. D. 237:838-840. Rizet G. (1957). Les Modifications qui Conduisent a la Senescence Chez Podospora Sontelles de Nature Cytoplasmique. Comp. Rend. Acad. Sci. Ser. D. 244:663-675. Rizet G., and Esser K. (1953). Sur des Phenomenes d'incompatibilite entre souchesd'origines differentes chez Podospora anserina. Comp. Rend. Acad. Sci. 237: 760-761. 233 Literature Cited Romanos M . A , and Boyd A. (1988). A Transcriptional Barrier to Expression of Cloned Toxin Genes of the Linear Plasmid kl of Kluyveromyces lactis: Evidence That Native kl Has Novel Promoters. Nuc. Acids. Res. 16(15): 7333-7350. Salas M. (1988). Initiation of DNA Replication by Primer Proteins: Bacteriophage <b29 and Its Relatives. Curr. Topics Microbiol. Immunol. 136:71-88. Salas M , Mellado R.P., and Vinuela E. (1978). Characterization of a Protein Covalently Linked to the 5' Termini of the DNA of Bacillus subtilis Phage <j>29. J. Mol. Biol. 119:269-291. Samac D . A , and Leong S.A. (1988). Two Linear Plasmids in Mitochondria of Fusarium solani f. sp. cucurbitae. Plasmid 19(1): 57-67. Samac D . A , and Leong S.A. (1989). Mitochondrial Plasmids of Filamentous Fungi: Characteristrics and Use In Transformation Vectors. Mol. Plant-Microbe Interactions 2(4): 155-159. Savilahti H , and Bamford D.H. (1986). Linear DNA Replication: Inverted Terminal Repeats of Five Closely Related Escherchia coli Bacteriophages. Gene 49: 199-205. Schardl C L , Lonsdale D . M , Pring D.R, and Rose K.R. (1984). Linearization of Maize Mitochondrial Chromosome by Recombination with Linear Episomes. Nature 310:292-296. Schardl C L , Pring D.R, and Lonsdale D.M. (1985). Mitochondrial DNA Rearrangements Associated with Fertile Revertants of S-type Male-Sterile. Maize. Cell 43:361-368. Sherman F. (1963). Respiration Deficient Mutants of Yeasts. I. Genetics. Genetics 48:375-386. Slonmiski P.P., Perrodin G , and Croft J.H. (1968). Ethidium Bromide Induced Mutation of Yeast Mitochondria: Complete Transformation of Cells into Respiratory Deficient Nonchromosomal "Petites". Biochim. Biophys. Res. Commun. 30:232-239. Smith A . G , and Pring D.R. (1987). Nucleotide Sequence and Molecular Characterization of a Maize Mitochondrial Plasmid-Like DNA. Curr. Genet. 12(8): 617-623. 234 Literature Cited Sor F., and Fukuhara H. (1985). Structure of a linear Plasmid of the Yeast Kluyveromyces lactis; Compact Organization of the Killer Genome. Curr. Genet. 9(2): 147-155. Sor F., Wesolowski M., and Fukuhara H. (1983) Inverted Terminal Repetitions of the Two Linear DNA Associated With The Killer Character of the Yeast Kluyveromyces lactis. Nuc. Acids. Res. 11(15): 5037-5044. Spruill W.M.Jr., Levings III C.S., and Sederoff R.R. (1980). Recombinant DNA Analysis Indicates That the Multiple Chromosomes of Maize Mitochondria Contain Different Sequences. Dev. Genet. 1:363-378. Stahl U., Lemke P.A., Tudzynski P., Kuck U.. and Esser K. (1978). Evidence for Plasmid-Like DNA in a Filamentous Fungus, the Ascomycete Podospora anserina. Mol. Gen. Genet. 162: 341-343. Stahl U., Kiick U., Tudzynski P., and Esser K. (1980). Characterization and Cloning of Plasmid Like DNA of the Ascomycete Podospora anserina. Mol. Gen. Genet. 178: 639-646. Stark M.J.R., and Boyd A. (1986). The Killer Toxin kluyveromyces lactis: Characterization of the toxin subunits and of the genes which encode them. EMBO J. 5:1995-2002. Stark M.J.R., Mileham A.J., Romanos M.A., and Boyd A. (1984). Nucleotide Sequence and Transcription Analysis of a Linear DNA Plasmid Associated with the Killer Character of the Yeast Kluyveromyces lactis. Nuc. Acids. Res. 12(15): 6011-6030. Steinhilber W., and Cummings D.J. (1986). A DNA Polymerase Activity with Characteristics of a Reverse Transcriptase in Podospora anserina. Curr. Genet. 10: 389-392. Stillman B.W. (1983). The Replication of Adenovirus DNA with Purified Proteins. Cell 35: 7-9. Stohl L.L., Collins R.A., Cole M.D., and Lambowitz A . M . (1982). Characterization of Two New Plasmid DNAs Found in Mitochondria of Wild-Type Neurospora intermedia Strains. Nuc. Acids Res. 10(5): 1439-1458. 235 Literature Cited Stohl L.L, Akins R.A, and Lambowitz A.M. (1984). Characterization of Deletion Derivatives of an Autonomously Replicating Neurospora Plasmid. Nuc. Acids. Res. 12:6169-6178. Sugisaki Y , Gunge N , Sakaguchi K , Yamasaki M , and Tamura G. (1985). Transfer of D N A Killer Plasmids from Kluyveromycts lactis to Kluyveromyces fragilis and Candida Pseudotropicalis. J. Bacteriol. 164(3): 1373-1375. Taylor J.VV, Smoich B.D, and May G. (1985). A n Evolutionary Comparison of Homologous Mitochondrial Plasmid D N A s from Three Neurospora Species. Mol. Gen. Genet. 201:161-167. Thompson R.D, Kemble R.J, and Flavell R.B. (1980). Variations in Mitochondrial D N A Organisation Between Normal and Male-Sterile Cytoplasms of Maize. Nuc. Acids Res. 8(9):1999-2008. Timothy D.H, Levings C.S. I l l , Hu W.W.L, and Goodman M.M. (1982). Zea diploperennis May Have Plasmid-Like Mitochondrial DNAs. Maize Genet. Coop. News Lett. 56:133-134. Tokunga T , Wada N , and Hishinuma F. (1987). Expression and Identification of Immunity Determinants on Linear D N A Killer Plasmids p G K L l and p G K L 2 in Kluyveromyces lactis. Nuc. Acids. Res. 15:1031-1046. Traynor P.L, and Levings C.S. Ill (1986). Transcription of the S-2 Maize Mitochondrial Plasmid. Plant Mol. Biol. 7(4): 255-264. Tudzynski P, and Esser K. (1979). Chromosomal and Extrachromosomal Control of Senescence in the Ascomycete Podospora anserina. Mol. Gen. Genet. 173: 71-84. Tudzynski P, and Esser K. (1986). Extrachromosomal Genetics of Claviceps purpurea II. Plasmids in Various W i l d Strains and Integrated Plasmid Sequences in Mitochondrial Genomic DNA. Curr. Genet. 10:463-467. 236 Literature C i t e d T u d z y n s k i P. , Stahl U . , and Esser K . (1980). Transformation to Senescence with Plasmid Like D N A in the Ascomycete Podospora ansenna. C u r r . Genet . 2:181-184. T u d z y n s k i P. , D u v e l l A . , and Esser K . (1983). Extrachromosomal Genetics of Claviceps purpurea. I. Mi tochondr ia l D N A and Mitochondria l Plasmids. C u r r . Genet. 7:145-150. T u d z y n s k i P . , Duvel l A . , and Oeser B . (1986). Linear Plasmids in the Phytopathogenic Fungus Claviceps purpurea. In Extrachromosomal Elements in Lower Eukaryotes, R. Wickner , A . Hinnebusch , L . Mets, A . Lambowitz , A . Holaender, eds. (New Y o r k : P l e n u m Press), pp. 119-128. T u r k e r M . S . , Domenico J . M . , and C u m m i n g s D . J . (1987). Excision-amplification of Mitochondrial D N A D u r i n g Senescence in Podospora anserina: A Potential Role for an 11 Base-Pair Consensus Sequence in the Excision Process. J . M o l . Biol . 198(2): 171-185. T u r k e r M . S . , Nelson J . G . , and C u m m i n g s D . J . (1987). A Podospora ansenna Longevity M u t a n t with a Temperature-Sensitive Phenotype for Senescence. M o l . C e l l . B io l . 7(9): 3199-3204. T u r p e n T . , Garger S.J. , Marks M . D . , and G r i l l L . K . (1987). Molecular C l o n i n g and Physical Characterization of a Brassica Linear Mitochondrial Plasmid. M o l . G e n . Genet . 209(2): 227-233. V a n d e r V e e n R. , A r n b e r g A . C . , V a n d e r H o r s t L . , Bonen L . , Tabak H . F . , and Grivel l L . A . (1986). Excised G r o u p II Introns are Lariats and C a n Be Formed by Self-Splicing in vitro. Cell 44:225-234. V i e r n y C , Keller A . M . , Begel O . , and Belcour, L . (1982). A Sequence of Mitochondrial D N A is Associated with the Onset of Senescence in a Fungus. Nature 297: 157-159. Vierny-Jamet C . (1988). Senescence in Podospora anserina: A Possible Role for Nucleic A c i d Interacting Proteins Suggested B y the Sequence Analysis of a Mitochondr ia l D N A Region Specifically Amplif ied in Senescent Cultures . Gene 74(2): 387-398. 237 Literature Cited Vogel H.G. (1956). A Convenient Medium for Neurospora. Microbiol. Genet. Bull. 13:42-43. Wakabayashi K , and Furutani Y. (1984). Inversions in Mitochondrial DNA of a Petite Mutant of Yeast. J. Biochem. 96(5): 1559-1564. Waring R.B, Scazzocchiio C , Brown T . A , and Davies R.W. (1983). Close Relationship Between Certain Nuclear and Mitochondrial Introns. J. Mol. Biol. 167:595-605. Weissinger A.K., Timothy D . H , Levings III C.S, Hu W.W.L, and Goodman M.M. (1982). Mitochondrial DNA Variation in Latin American Maize Races. Maize Genet. Coop. News Lett. 56:133-138. Weissinger A . K , Timothy D . H , Levings III C.S, Hu W.W.L, and Goodman M.M. (1982). Unique Plasmid-Like Mitochondrial DNAs from Indigenous Maize Races of Latin America. Proc. Natl. Acad. Sci. 79:1-5. Wesolowski M , Algen A , Goffrini P., and Fukuhara H. (1982). Killer DNA Plasmids of the Yeast Kluyveromyces lactis I: Mutations Affecting the Killer Phenotype. Curr. Genet. 5:191-197. Wlodarczyk M , and Nowicka B. (1988). Preliminary Evidence for the Linear Nature of Thiobacillus versutus pTAV2 Plasmid. FEMS Microbiol. Lett. (552): 125-128. Wright R . M , Laping J .L, Horrum M . A , and Cummings D.J. (1982). Mitochondrial DNA from Podospora anserina III: Cloning, Physical Map, and Localization of the Ribosomal RNA Genes. Mol. Gen. Genet. 185: 56-64. Yehle C O . (1978). Genome-Linked Protein Associated with the 5' Termini of Bacteriophage cb29 DNA. J. Virol. 27(3):776-783. Yoshikawa H , Friedmann T , and Ito J. (1981). Nucleotide Sequences at the Termini of <)>29 DNA. Proc. Natl. Acad. Sci. 78(3): 1336-1340. Yoshikawa H , and Ito J. (1981). Terminal Proteins and Short Inverted Terminal Repeats of the Small Bacillus Bacteriophages. Proc. Natl. Acad. Sci. 78(4): 2596-2600. 238 Literature Cited Yui Y., Katayose Y., and Shishido K. (1988). Two Linear Plasmid-Like DNA Elements Simultaneously Maintained in Pleurotus ostreatus. Biochim. Biophys. Acta 951(1): 53-60. 239 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0101043/manifest

Comment

Related Items