UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The expression of XAF1 in melanoma and the role of ILK in melanoma invasive behavior Ng, Kin Cheung Philip 2007

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2007-0535.pdf [ 10.12MB ]
Metadata
JSON: 831-1.0100902.json
JSON-LD: 831-1.0100902-ld.json
RDF/XML (Pretty): 831-1.0100902-rdf.xml
RDF/JSON: 831-1.0100902-rdf.json
Turtle: 831-1.0100902-turtle.txt
N-Triples: 831-1.0100902-rdf-ntriples.txt
Original Record: 831-1.0100902-source.json
Full Text
831-1.0100902-fulltext.txt
Citation
831-1.0100902.ris

Full Text

THE EXPRESSION OF XAF1 IN MELANOMA AND THE ROLE OF ILK IN MELANOMA INVASIVE BEHAVIOR by KIN CHEUNG PHILIP NG B.Sc, The University of British Columbia, 2002 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Experimental Medicine) THE UNIVERSITY OF BRITISH COLUMBIA October 2007 © Kin Cheung Philip Ng, 2007 A B S T R A C T The high metastatic potential and the resistance to apoptosis are common features of melanoma that make effective treatment difficult. The design of novel strategies for the treatment of this disease relies on the identification of key regulators of melanoma apoptosis and metastasis. In the current study, we characterized the protein expression of a novel tumor suppressor, XIAP-associated factor 1 (XAF1) in 70 primary melanomas and determined the role of integrin-linked kinase (ILK) in melanoma cell migration and invasion. Our first study shows that XAF1 mRNA expression was weak or undetectable in majority of melanoma cell lines. More importantly, XAF1 expression was significantly reduced in melanoma tissues compared with benign nevi in both nucleus and cytoplasm. Since XAF1 has been shown to inhibit the antiapoptotic activity of XIAP, the loss of XAF1 in melanoma may contribute to the impairment of apoptosis pathway and ultimately the malignant nature of melanoma. In the second study, we have determined the possible role of ILK as a regulator of melanoma progression. Inhibition of the kinase activity of ILK and depletion of endogenous ILK expression both significantly reduced melanoma cell migration. Moreover, melanoma cells stably expressing ILK short hairpin RNA resulted in a marked reduction in colony formation on soft agar and inhibition of invasion through Matrigel. In vivo data from melanoma xenograft indicated that mice inoculated with melanoma cells depleted of ILK expression showed a much slower tumor growth compared with mice inoculated with control melanoma cells. In summary, the loss of XAF1 expression in melanoma biopsies and the inhibition of cell migration and invasion through the inhibition of ILK suggest that both factors may play a prominent role in melanoma apoptosis pathway and invasion, respectively. Further study on the ii therapeutic value of ILK inhibition and proapoptotic function of X A F 1 may help the development of effective therapy against metastatic melanoma. T A B L E O F C O N T E N T S Abstract ii Table of Contents iv List of Tables • vi List of Figures vii List of Abbreviations viii Acknowledgements x Co-Authorship Statement xi CHAPTER 1. General Introduction 1 1.1 Cutaneous Malignant Melanoma 1 1.1.1 Melanoma Incidence 1 1.1.2 Melanocyte Biology 1 1.1.3 Biology of Melanocyte Nevus 3 1.1.4 Melanoma Progression and Prognosis 4 1.2 Melanoma and Apoptosis 7 1.2.1 Overview of Conventional Melanoma Therapies 7 1.2.2 Programmed Cell Death Pathways 8 1.2.3 Inhibitor of Apoptosis (IAP) 9 1.2.4 XAF1: a Novel Inhibitor of XIAP 11 1.3 Survival Signaling in Melanoma 12 1.3.1 PI3K/AKT Signaling Pathway 12 1.3.2 Biological Effect of Akt Activation 14 1.3.3 Integrin-linked kinase (ILK) 15 1.4 Objectives 18 1.5 References 19 CHAPTER 2. Material and Methods 35 2.1 Cell Culture 35 2.2 Reverse Transciptase-Polymerase Chain Reaction (RT-PCR) 35 2.3 Immunofluorescent Staining 36 2.4 Tissue Microarray (TMA) 37 2.5 Immunohistochemistry 38 2.6 Evaluation of Tissue Immunostaining 38 2.7 Statistical Analysis 39 2.8 Small Interfering RNA (siRNA) .40 2.9 ILK Inhibitor Treatment 40 2.10 shRNA Gonstructs and Stable Transfection 40 iv 2.11 Western Blot 41 2.12 Cell Migration Assay 42 2.13 Cell Proliferation Assay 43 2.14 Small GTPase Pull-down Assay 43 2.15 Cell Invasion Assay 44 2.16 Soft Agar Assay 45 2.17 Melanoma Xenograft 45 2.18 References 47 CHAPTER 3. XAF1 Expression is Significantly Reduced in Human Melanoma 48 3.1 Rationale and Hypothesis 48 3.2 Results 49 3.2.1 Reduced XAF1 mRNA Expression in Melanoma Cell Lines 49 3.2.2 Clinicopathological Features 54 3.2.3 Reduction of XAF1 Protein Expression in Primary Melanoma 56 3.2.4 XAF1 Expression in Melanoma Progression and Survival 60 3.3 Discussion 63 3.4 References 74 CHAPTER 4. The Role of Integrin-linked kinase in Melanoma Cell Migration, Invasion, and Tumor Growth 79 4.1 Rationale and Hypothesis 79 4.2 Results 80 4.2.1 Aberrant Activation of PI3K Signaling Pathway 80 4.2.2 Inhibition of ILK Activity did not Reduce Akt Activation 84 4.2.3 Silencing ILK Expression by RNA Interference 87 4.2.4 Effect of ILK Knockdown on Melanoma Cell Migration 90 4.2.5 Role of ILK in GTPase Activation 95 4.2.6 ILK Regulates Anchorage-independent Growth and Cell Invasion in Melanoma Cells 98 4.2.7 Knockdown of ILK Expression Suppress Melanoma Tumor Growth ....101 4.3 Discussion 103 4.4 References 114 CHAPTER 5. General Conclusion 121 5.1 Summary and Future Directions 121 5.2 References 124 v L I S T O F T A B L E S Table 3.1 XAF1 expression and clinicopathological characteristics 55 Table 3.2 Distribution of XAF1 expression in normal nevi and primary melanomas 57 vi L I S T O F F I G U R E S Figure 3.1 Expression of XAFl transcript in melanoma cell lines 51 Figure 3.2 Protein expression of XAF1 52 Figure 3.3 Nuclear and cytoplasmic distribution of XAFl in melanoma cell lines and melanocytes 53 Figure 3.4 XAFl is significantly reduced in melanoma tissues compared to benign nevi 58 Figure 3.5 XAFl expression is reduced in both nucleus and cytoplasm of melanoma cells 59 Figure 3.6 XAFl nuclear expression did not correlate with melanoma thickness 61 Figure 3.7 Correlation between XAFl expression and 5-year patient survival 62 Figure 3.8 The schematic structures of XAFl gene and alternate splice variants 73 Figure 4.1 Expression of ILK and PTEN in 14 melanoma cell lines and normal human epidermal melanocyte (NHEM) 82 Figure 4.2 Phosphorylation of Akt at serine 473 was reduced in PTEN-positive melanoma cells under serum starvation 83 Figure 4.3 Inhibition of ILK activity did not reduce Akt activation 86 Figure 4.4 siRNA-mediated knockdown of endogenous ILK expression and its effect on the phosphorylation of Akt at serine 473 88 Figure 4.5 shRNA-mediated knockdown of endogenous ILK expression 89 Figure 4.6 Inhibition of ILK kinase activity inhibited melanoma cell migration 91 Figure 4.7 Silencing ILK expression inhibited melanoma cell migration 92 Figure 4.8 Cell proliferation of ILK shRNA-stable clones. 94 Figure 4.9 Activation of Rac, RhoA and Cdc42 in melanoma cells 97 Figure 4.10 ILK regulates melanoma anchorage-independent growth 99 Figure 4.11 ILK regulates melanoma cell invasion 100 Figure 4.12 ILK shRNA inhibits the growth of melanoma xenografts 102 LIST O F ABBREVIATIONS Apaf-1 Apoptotic protease activating factor-1 BIR Baculoviral IAP repeat CREB cAMP responsive element binding protein DIABLO Direct IAP-binding protein with low PI DTIC Dacarbazine EMT Epithelial-mesenchymal transition ES Embryonic stem GSK3 Glycogen synthase kinase-3 HtrA2 High-temperature requirement protein A2 IAP Inhibitor of apoptosis IKK IKB kinase IL-2 Interleukin 2 ILK Integrin-linked kinase INF Interferon ISG Interferon-stimulated gene LOH Loss of heterozygosity MLC Myosin light chain MLCK Myosin light chain kinase MMP Matrix metalloproteinase NHEM Normal human epidermal melanocyte PDK-1 Phosphoinositide-dependent protein kinase-1 PH Pleckstrin homology PI3K Phosphatidylinositol 3' kinase PIP2 Phoshatidylinositol-4,5-bisphosphate PIP3 Phoshatidylinositol-3,4,5 -tisphosphate PKB Protein kinase B PVDF Polyvinylidene difluoride RGP Radial growth phase RT-PCR Reverse Transciptase-Polymerase Chain Reaction SCID Severe combined immunodeficient shRNA Short-hairpin RNA Smac Second mitochondria-derived activator of caspase SRB Sulforhodamine B TCF/LEF T cell factor/lymphoid enhancer factor TNF-a Tumor necrosis factor-a TMA Tissue microarray T S C 2 Tuberous sclerosis complex 2 uPA Urokinase plasminogen activation VGP Vertical growth phase XAF1 XIAP-associated factor XIAP X-linked inhibitor of apoptosis ix A C K N O W L E D G E M E N T S It was a great pleasure for me to conduct this thesis work under the supervision of Dr. Gang Li. I would like to express my sincere gratitude for his personal guidance and continuing supports. Throughout these years he has shown me the way of doing quality research. This thesis and the two papers that I have published would not be completed without his extensive feedback and commitment. Secondly, I am fortunate to meet Dr. Shoukat Dedhar, who has given me the opportunity to work on the ILK project and make this thesis possible. I am thankful for his directions on my project and his invaluable comments during the supervisory committee meeting. I would also like to thank Dr. Michael Cox for donating his precious time to serve on the committee and all the constructive inputs. As for the members of the Li lab, life in the lab would not be that simple if they were not working side by side with me, answering my questions and offering help. I own many thanks to their support and encouragement. I would also like to thank members of the Dedhar lab, especially Virginia Gray and Dr. Nolan R. Filipenko, for teaching me various techniques and providing me materials necessary for my project. I am grateful to be the recipient of studentships offered by Michael Smith Foundation for Health Research and BC Foundation for Non-Animal Research. Lastly, I would like to express my thanks from bottom of my heart to my family and friends for their endless love, patience and understanding. They have inspired me to stay strong and provide me the strength to strive for my best. x CO-AUTHORSHIP STATEMENT This thesis includes the materials from the following publications: 1. Ng, K.C., Campos, E.L, Martinka, M. and Li, G. (2004) XAF1 Expression is Significantly Reduced in Human Melanoma. J Invest Dermatol. 123(6): 1127-34. I contributed to the experimental works including RT-PCR, western blot, immunofluorescent microscopy, immunohistochemistry, data collection and statistical analysis and the writing of the manuscript. Dr. E.I. Campos performed immunohistochemistry on primary melanoma samples and evaluated the nuclear staining of the tumor samples. Dr. M. Martinka helped in the evaluation of the tissue staining. This project was supervised by Dr. G. Li. 2. Wong, R.P., Ng, P., Dedhar, S. and Li, G. (2007) The Role of Integrin-linked kinase in Melanoma Cell Migration, Invasion, and Tumor Growth. Mol Cancer Ther. 6(6): 1692-700. I contributed to all the experimental works described in this thesis. R.P. Wong helped in the preparation of the manuscript for the publication. The Chapter 4 of this thesis which includes materials from this publication was written by me, K.C.P. Ng. Dr. S. Dedhar is our collaborator and he provided reagents and technical support. This project was supervised by Dr. G. Li. CHAPTER 1. GENERAL INTRODUCTION 1.1 Cutaneous Malignant Melanoma 1.1.1 Melanoma Incidence Cutaneous melanoma is the most fatal form of skin cancers which accounts for the majority of skin cancer deaths (Jemal et al., 2006). Over decades the incidence of melanoma among the Caucasian population has risen more rapidly than any other malignancies to the present rate of 3-7% per year (Baruch et al., 2005; Bevona and Sober, 2002; Houghton and Polsky, 2002). The lifetime risk of developing melanoma is 1 in 52 for men and 1 in 77 for women, making melanoma the fifth and sixth most common cancer among men and women respectively. In 2007, an estimated 4,600 new cases of melanoma are expected to be diagnosed, with 900 patients expected to die from the disease in Canada (Canadian Cancer Society/National Cancer Institute of Canada, 2007). Despite the mortality rate has steadily improved over recent years, patients with metastatic melanoma continues to have poor prognosis, with a median survival of only 6-9 months (Tarhini and Agarwala, 2006). 1.1.2 Melanocyte Biology Melanoma arises from uncontrolled proliferation of cells of melanocyte origin. Melanocytes are melanin-producing cells that provide key physiological functions including photoprotection, trapping scavenge reactive oxygen species, and sequestering metal ions. In human skin, melanocytes are found in the basal layer of epidermis and are interspersed among every 5 keratinocytes. Synthesis of melanin takes place within specialized membrane bound organelles known as melanosomes and each melanocyte transports the pigment-containing melanosomes to approximately 36 associated 1 keratinocytes through a network of dendritic processes, forming the epidermal melanin unit(Jimbow, 1995). Melanocytes are derived from neural crest cells. Commitment of neural crest cells to the melanogenic lineage gives rise to melanoblasts, which migrate to their destinations sites in response to chemotactic signal gradients and subsequently differentiate to mature melanocytes. Melanocytes, similar to many neural crest derivatives such as cells of the peripheral nervous system, utilize tyrosine to generate the catechol intermediate dihydrophenylalanine (DOPA), a precursor in the synthesis of neurotransmitters or pigments. In melanocyte, the enzyme tyrosinase catalyzes the conversion of tyrosine to DOPA and subsequently dopaquinone, which is oxidized further to form melanin (Cooksey et al., 1997; Furumura et al., 1996). Proliferation of melanocytes in the epidermis is strictly controlled and rarely observed under physiologic conditions. Unlike their counterparts in situ, melanocytes in culture display different phenotypes: they grow continuously with doubling time of 48-96 hours (Eisinger and Marko, 1982), assume bi-or tripolar morphology, and acquire expression of melanoma-associated antigens such as MelCAM, and P3 integrin subunit (Shih et al., 1994). Earlier co-culture experiments have suggested undifferentiated basal keratinocyte as a crucial regulator of normal melanocytic phenotype. For example, melanocytes and keratinocytes in co-culture proliferated at a constant ratio, suggesting that keratinocytes regulate their equilibrium with the melanocytes (Valyi-Nagy et al., 1993). Furthermore, expression of the melanoma-associated antigens is lost when melanocytes are co-cultured with keratinocytes (Shih et al., 1994). This regulatory activity of keratinocytes occurs through direct cell-cell contact rather than through soluble factors. Melanoma cells, on the other hand, are retractile to the regulatory control 2 of keratinocytes. In the course of melanoma tumorigenesis, melanocytes must therefore acquire phenotypic characteristics that enable them to escape from the control by keratinocytes. These includes the downregulation of receptors important for communication with keratinocytes, upregulation of receptors and signaling molecules important for melanoma cell-cell interactions, deregulation of morphogens that directed them to the epidermis and helped maintain their proper position, loss of anchorage to the basement membrane because of altered expression of cell-matrix adhesion molecules, and increased motility and elaboration of metalloproteinases (Haass and Herlyn, 2005). 1.1.3 Biology of Melanocytic Nevus The common mole or melanocyte nevus is the benign clusters of melanocytes. They have drawn special attention as an increased number of nevi has been shown to confer increased risk of developing melanoma (Bliss et al., 1995; Tucker et al., 1997). It is generally believed that the common acquired nevus follows a pattern of evolution through a person's lifetime. Initially, common acquired nevi develop as a proliferation of single melanocytes along the dermo-epidermal junction forming small nests of cells in the lower-most part of the epidermis called junctional nevus. These nevi are macular or thinly papular and appear brown to black in color. With continued maturation, nest of melanocytes can be found along the junction and within the superficial dermis, resulting a compound nevus. Compound nevi often display elevation and are lighter in color than junctional nevi. As nevus ages, the junctional component often diminishes or entirely involutes. The resulting intradermal nevus is found only in the papillary and reticular dermis and clinically displays no significant pigmentation. These cells become less dendritic and lose the ability to generate pigment and morphologically resemble Schwann 3 cells (Cramer, 1991). At any stage of their evolution, common acquired nevi are usually smaller than 5 mm in diameter, and rarely larger than 10 mm. Dysplastic nevus, also referred to as atypical nevus, is a nevus with architectural disorder and cytological atypia of melanocytes. A dysplastic nevus is generally a larger lesion that measures greater than 5 mm in diameter. The lesion is slightly asymmetric, with an irregular, ill-defined border and both macular and papular areas may be present within a single lesion. The color is highly variable and ranges from shades of tan to pink. The importance of dysplastic nevi lies in their association with increased risk of developing melanoma (Bataille et al., 1996; Halpern et al., 1991; Marghoob et al., 1994) and the notion that some of these dysplastic lesions may represent an intermediate transitional stage in the course of melanoma tumorigenesis. Dysplastic nevi are prevalent in approximately 16-39% of the sporadic melanoma cases, whereas the prevalence of dysplastic nevi in the general population is only 2-7% (Bataille et al., 1996; Halpern et al., 1991; Hussein, 2005). The 10-year cumulative risk of developing invasive melanoma is increased from 0.6% among Caucasians without dysplastic nevi to 10% among those with the lesions (Marghoob et al., 1994). The cumulative risk may approach and even exceed 50% in individuals with dysplastic nevi and a family history of melanoma (Greene et al., 1985; Tucker et al., 1993). Patients with numerous dysplastic nevi are at a higher risk of developing melanoma than those individuals with a single or only a few dysplastic nevi (Tucker et al., 1997). 1.1.4 Melanoma Progression and Prognosis The development of melanoma and its progression has been described as several well-defined interrelated steps (Clark et al., 1984), whose temporal sequence is determined by complex interactions between accumulative genetic defects of melanocyte 4 cells and host response. The common acquired nevus is postulated to represent the earliest hyperplastic malanocytic lesion and is destined in most instances to follow a programmed pathway of differentiation. A n aberrant differentiation results in a dysplastic nevus, which shows an increased level o f cytologic and architectural atypia. It is regarded as the candidate precursor for cutaneous melanoma. The first recognizable malignant stage is the radial growth phase (RGP) of primary melanoma, where tumor cells proliferate inexorably in the epidermal but not in the dermal compartment. Individual or small nest o f tumor cells from R G P can extend into the papillary dermis (microinvasive) but lack the competence for metastasis. Clinically, R G P lesions represent patches or plaques. More advance melanoma gains the capacity for proliferation in three dimensions in the extracellular matrix of the dermis to form an expansible mass or nodule with cytology different from melanoma cells in the overlying epidermis. This lesion is termed the vertical growth phase (VGP) . V G P is a pivotal lesion in melanoma biology since it is the first step in tumor progression that is associated with metastatic potential. Tumor cells from V G P are immortal in tissue culture and are tumorigenic in nude mice (Herlyn et al., 1985). Finally, metastasis represents the most advanced step of tumor progression. In addition to the described model of stepwise progression from precursor lesions, melanomas may arise de novo without an antecedent or associated melanocyte nevus. Such melanomas have a significantly higher rate of metastasis and death; and have been suggested to have a different biologic behavior compared to nevus-associated melanomas (Friedman et al., 1983; Sober et al., 1983). Staging of melanoma has been established by the American Joint Committee on Cancer ( A J C C ) . In this classification, the localized growth phase is represented by stage 5 I (< 2.0 mm depth without ulceration) and stage II (> 2.0 mm depth), regional lymph node involvement by stage III, and distant metastasis by stage IV. Tumor thickness and ulceration are consistently the most powerful independent prognostic factors in localized cutaneous melanoma (Balch et al., 2001b; Breslow, 1970; Schuchter et al., 1996; Soong et al., 1992). Tumor depth measurement is based on Breslow's method, which is measured in millimeters from the top of the granular layer o f the epidermis to the deepest point of tumor involvement (Breslow, 1970). The 2002 A J C C system stratified melanoma thickness into four categories: < 1.0 mm, 1.01 - 2.0 mm, 2.01 - 4.0 mm, and > 4.0 mm; a change from the previous cut off points of 0.75 mm, and 1.50 mm used in the 1997 A J C C system. Increased tumor thickness is correlated with increased incidence of metastasis and poorer prognosis. Another staging system, Clark 's levels, refers to deepest portion of the skin invaded by tumor, with level I being the outermost epidermis and level V being the subcutaneous fat. It has been found that Clark 's level is only predictive in thin melanoma of less than 1 mm (Balch et al., 2001b). In thicker melanoma lesions, ulceration becomes the most predictive factor of patient survival (Balch et al., 2001b). Ulceration is defined as the absence of an intact epidermis overlying the primary tumor. Ulcerated melanoma has a significantly impact on 5-year survival in all tumor thicknesses. The decrement can be as high as 22% in thick (> 4.0 mm) melanomas (Balch et al., 2001b). This event is associated with increased incidence of metastasis since a primary melanoma has invaded through the overlying epidermis rather than simply displacing it upward. In nodal metastasis of melanoma, the number of metastatic nodes, the tumor burden of the involved lymph node (ie, whether the nodal 6 tumor is microscopic or macroscopic), and ulceration become the most significant predictor of patient outcome. 1.2 Melanoma and Apoptosis 1.2.1 Overview of Conventional Melanoma Therapies Melanoma prognosis depends heavily on detection at very early stages. Over 90% 5-year survival rate can be achieved by complete surgical excision of the localized tumor of stages I disease (Balch et al., 2001a). Unfortunately, melanoma lesions can remain unnoticeable or asymptomatic for extended periods of time. Added to the complexity is that about 1.6% to 10% of all melanomas are non-pigmented and nodular melanomas often fail to fulfill the well-recognized ABCD diagnostic criteria (Asymmetry, border irregularity, Colour variegation, Diameter greater than 6 mm) (Thompson et al., 2005). Moreover, melanoma can metastasize without a clearly identifiable primary lesion and therefore present a challenge to surgical intervention at the early stage of evolution. For the past 30 years, there has been little progress on in the systemic therapy of metastatic melanoma. Dacarbazine (DTIC), the most active and the reference alkylating drug as a single agent yields response rates of only 20%, with a short lived median response duration of 6 months (Chowdhury et al., 1999; Nathan and Mastrangelo, 1998; Pavlick, 2002). Complete remissions are infrequent and it is ineffective against brain metastases. Other single agents including platinum compounds, nitrosoureas, taxanes and vinca alkaloids did not show much improvement over DTIC on the response rates. On the other hand, the role of combination chemotherapy remains uncertain. The most commonly used combination regimen includes the Dartmounth regimen which comprises of carmustine, cisplatin, DTIC and tamoxifen. High response rates have been reported from single institution phase II studies (Del Prete et al., 1984), but large multicentre randomized trials failed to confirm these improvements over DTIC (Chapman et al., 1999). In addition, combination chemotherapies are associated with greater toxicity and offer no survival advantages (Chapman et al., 1999; Margolin et al., 1998). The host immune response is thought to play an important role in the natural history of melanoma. Therefore, there has been considerable interest in biochemotherapies, in which conventional chemotherapeutic agents are combined with a nonspecific biological response modifier, in particular interferon alpha (IFN-a) and interleukin-2 (IL-2). However, a combination either IFN-a or IL-2 with chemotherapy did not show a significant difference in response rate and survival advantage over chemotherapy (Chowdhury et al., 1999). There have been some encouraging evidences that multi-agent chemotherapy in combination with both IL-2 and IFN-a can achieve a more durable complete response (Legha, 1997; Richards et al., 1992). However, these regimens produce substantial toxicity over single agent therapy. Further studies are needed to determine their correct combination, optimal dosing and schedules. 1.2.2 Programmed Cel l Death Pathways The ability of tumor cell populations to expand in number is determined not only by the rate of cell proliferation but also by the rate of cell destruction. Programmed cell death or apoptosis represents a major way to rid of excess, unwanted and damaged cells. The notorious resistance of melanoma cells to wide spectrum of cytotoxic agents is therefore thought to be due to the intrinsic survival features of their parental melanocytes coupled with additional alternations acquired during tumor progression. Since most chemotherapeutic drugs function by induction of apoptosis, resistance to apoptosis is likely to underlie drug resistance in melanoma. Two principal pathways to apoptosis have been recognized: the 'intrinsic' pathway that links to mitochondrial functions and the 'extrinsic' pathway that involves transmembrane 'death receptors'. Both depend on a complex network of positive and negative regulators and the net balance determines whether a cell will undergo apoptosis. Ultimately, this leads to activation of a series of cysteinyl aspartate-specific protesases named 'caspases' that cleave after aspartate residues and subsequently leads to the disintegration of the cell. p53 acts as the main sensor in the mitochondrial pathway and is activated in response to infra-cellular stress, such as DNA damage, hypoxia and growth factor deprivation. Once activated, it will induce the expression of multiple transcriptional targets that regulate apoptosis, including apoptotic protease activating factor 1 (Apaf-1), and members of proapoptotic bcl-2 family such as Bax, Puma and Noxa (Vousden and Lu, 2002). These factors promote the loss of mitochondrial membrane potential that favors cytochrome c release, resulting in the formation of apoptosome with Apaf-1 and caspase 9 and subsequent activation of effector caspases. The extrinsic pathway is activated by binding of TNF-a, FasL or TRAIL with their cognate receptors, which results in trimerization of the receptors and binding of adaptors proteins. This leads to recruitment of caspase 8 and -10, with concomitant activation of effector caspases. 1.2.3 Inhibitor of Apoptosis (LAP) The search for endogenous protector of apoptosis came from the pioneer studies of viruses that identified baculovirus proteins for their ability to block apoptosis in order to increase the infectivity by keeping the host cell alive (Miller, 1997). These factors are collectively called inhibitors of apoptosis (IAPs) and are characterized by the presence of one or more repeats of highly conserved 70 amino acids domain, termed the baculoviral 9 IAP repeat (BIR). Up until now, eight cellular homologues have been identified in human: NAIP, c-IAPl, C-IAP2, XIAP, Survivin, BRUCE, ILP-2, and Livin. Among all IAPs, XIAP has received greatest interest as a therapeutic target as it has been suggested to be the only member of this family able to directly inhibit proteolytic activity of caspases and that other IAPs simply bind but do not display any inhibitory action (Eckelman and Salvesen, 2006; Eckelman et al., 2006). The third BIR domain (BIR3) is responsible for the inhibition of the initiator caspase-9, whereas the second BIR domain (BIR2) inhibits the effector caspase-3 and -7 (Deveraux et al., 1999). The potent caspase inhibition uses a two-site binding mechanism. One of these sites is a conserved surface groove found in BIR2 and BIR3 of XIAP that interacted with the IAP-binding motif found in the amino terminus of the small-subunit of the caspases as a result of autocatalytic processing or activity of upstream protease during their activation, essentially anchors the caspase to the BIR domain of XIAP (Scott et al., 2005). The second site contributes to the actual inhibitory mechanism and is different between the caspase-9 and the effector caspases. A distal helix of BIR3 directly participate in the interaction with the dimer interface of caspase-9, thereby preventing its homodimerization and activation (Shiozaki et al., 2003). On the other hand, caspase-3 and -7 is inhibited by the linker region preceding BIR2 that binds across the substrate-binding site, thereby sterically preventing the entry of substrates (Huang et al., 2001; Riedl et al., 2001). In addition to the direct inhibition mediated by the BIR domain, XIAP contains a carboxyl terminal RING zinc finger domain that has an E3 ubiquitin ligase activity. Therefore, XIAP may be able to regulate apoptosis by controlling its 10 turnover (Yang et al., 2000) and promote the degradation of various substrates, including casapase-3 and -9 (Morizane et al., 2005; Suzuki et al., 2001b). The antiapoptotic effect of IAPs is modulated by yet other mitochondrial proteins, Smac/DIABLO and HtrA2/Omi, that are released along with cytochrom c at the initiation of apoptosis in response to apoptotic stimuli (Du et al., 2000; Faccio et al., 2000; Gray et al., 2000; Verhagen et al., 2000). Smac is synthesized as precursor protein containing an N-terminal mitochondrial targeting sequence. Upon mitochondrial import, the targeting sequence is removed by proteolysis, exposing a tetrapeptide IAP binding motif (Ala-Val-Pro-Ile). The mature Smac exists as a dimer and is able to bind XIAP, cIAPl, cIAP2, and Survivin, thereby enhancing apoptosis by relieving IAP-mediated inhibition (Du et al., 2000). HtrA2/Omi is a mammalian homologue of bacterial heat-inducible serine protease, HtrA/DegP. Similar to Smac, a conserved IAP binding motif is exposed upon cleavage of an N-terminal mitochondrial targeting sequence and a second leader sequence (Hegde et al., 2002; Martins et al., 2002; Suzuki et al., 2001a; Verhagen et al., 2002). The proapoptotic effect of HtrA2/Omi is mediated by disrupting the IAP-caspase interaction, as well as through the direct proteolytic processing of IAPs (Srinivasula et al., 2003; Yang et al., 2003) and other unidentified cellular targets independent of its IAP binding activity (Hegde et al., 2002; Suzuki et al., 2001a; Verhagen et al., 2002). 1.2.4 XAFl: a Novel Inhibitor of XIAP Recently, a novel XIAP binding protein termed XIAP-associated factor 1 (XAFl) has been identified using a two hybrid system (Liston et al., 2001). XAFl is a 301 amino acid nuclear protein containing seven zinc fingers. Biochemical study has shown that XAFl is able to antagonize the XIAP-mediated inhibition of caspase-3 and has been shown to reverse antiapoptotic effect of XIAP against serum withdrawal and 11 chemotherapeutic drug treatment (Liston et al., 2001). The expression of XAF1 is induced by interferon- p and is able to sensitize TRAIL-resistant melanoma cell lines to TRAIL-induced apoptosis (Leaman et al., 2002). Furthermore, adenoviral delivery of XAF1 to established tumor in nude mice exhibits antitumor effect (Qi et al., 2007). More intriguingly, XAF1 mRNA is ubiquitously expressed in normal human tissue (Fong et al., 2000), but is low or missing in majority of cancer cell lines, suggesting the downregulation or the loss of XAF1 may contribute to apoptosis suppression as part of the tumorigenesis process. 1.3 Surv iva l Signaling i n M e l a n o m a 1.3.1 P I 3 K / A K T Signal ing Pathway The phosphatidylinositol 3' kinase (PI3K) pathway has emerged as one of the crucial pathways in tumorigenesis by providing survival signals, promoting cell proliferation and growth. This pathway is engaged in response to multiple mitogens that binds to receptor tyrosine kinase on the cell surface. Upon activation by the direct recruitment to the activated receptor tyrosine kinase or through receptor associated adaptor proteins such as IRS-1, PI3K catalyzes the phosphorylation of phoshatidylinositol-4,5-bisphosphate (PIP2) at the D3 position of the inositol ring to generate phosphatidylinositol-3,4,5-trisphosphate (PIP3). The generation of PIP3 recruits Akt, also known as protein kinase B (PKB) to the cell surface where it becomes activated upon phosphorylation of two key residues. Akt, the human homologue of viral oncogene v-akt, consists of three members: Aktl, Akt2, and Akt3 (PKBa, PKBp, PKBy respectively) sharing greater than 80% homology in amino acid sequence with one another (Brodbeck et al., 1999; Nakatani et al., 1999; Staal, 1987). All isoforms contain 12 an N-terminal pleckstrin homology (PH) domain for PIP3 binding, a serine/threonine kinase domain structurally similar to protein kinase A, G, and C and a C-terminal hydrophobic motif. The importance of PI3K/Akt pathway is implicated by its frequent alternation in human cancer. Amplification of the gene that encode the pi 10a catalytic subunit of PI3K was found in ovarian, head and neck squamous cell carcinomas and gastric carcinomas (Byun et al., 2003; Pedrero et al., 2005; Shayesteh et al., 1999). The pi 10a subunit and the p85a regulatory subunit of PI3K are also targeted for mutation in many cancers (Philp et al., 2001; Saal et al., 2005; Samuels et al., 2004). These mutations presumably contribute to oncogenic transformation by enhancing the lipid kinase activity of the catalytic subunit or by releasing the p85-pl 10 complex from negative regulation. In addition, mounting evidence suggests that Akt is subjected to perturbation in human malignancy. Akt2 is amplified in ovarian, breast and pancreatic tumors, while amplification in Akt 1 was much less frequent (Bellacosa et al., 1995; Cheng et al., 1992; Cheng et al., 1996; Staal, 1987). In melanoma, increased activation of Akt has been observed from benign lesions to metastatic tumors, and is inversely correlated with patient survival (Dai et al., 2005; Dhawan et al., 2002). The isoform responsible for elevated activated Akt levels in melanomas has recently been identified to be Akt3 (Stahl et al., 2004). Although no amplification of Akt genes in melanoma was found, an increase in copy number of the chromosomal region containing Akt3 has been reported (Bastian et al., 1998; Mertens et al., 1997), suggesting that increased expression as a possible mechanism contributing to increased Akt3 activity in melanoma. Compelling evidence showing PI3K/Akt pathway being involved in human cancer also comes from 13 the studies of tumor suppressor PTEN. The lipase phosphatase activity of PTEN is capable of removing 3'-phosphate from its major substrate PIP3, effectively removing the second messenger for activation of PI3K/Akt pathway. In melanoma, loss of heterozygosity of chromosome lOq containing PTEN is a frequent event (Healy et al., 1995; Herbst et al., 1994). Premutations have been shown to occur in up to 20% of melanoma tissues and 30-43% of melanoma cell lines, with homozygous deletion being one of the major inactivating mechanisms (Wu et al., 2003). Loss of function of PTEN and subsequent alternation of PI3K7PKB pathway is clearly implicated in melanoma tumor development (Stahl et al., 2003). 1.3.2 Biological Effect of A k t Activation Activated Akt is well established to promote cell survival. Akt phosphorylates and inactivate procaspase-9 and BH3-only protein Bad, which promotes apoptosis by neutralizing the action of prosurvival Bcl-2 members (Cardone et al., 1998; Datta et al., 1997; del Peso et al., 1997). Phosphorylation of Bad creates binding pocket for 14-3-3 proteins and sequestration by 14-3-3 prevents Bad from interacting with prosurvival Bcl-2 members (Datta et al., 2000). Akt also phosphorylates Forkhead family of transcription factors and triggers their export from the nucleus, thereby preventing the transcription of proapoptotic target genes such as Bim and Fas-L (Brunet et al., 1999). Another phosphorylation target of Akt is MDM2 (Mayo and Dormer, 2001; Zhou et al., 2001b). Phosphorylation of MDM2 promotes translocation of MDM2 to the nucleus, where it binds p53 and negatively regulates p53-mediated transcription of BH3-only proteins Puma and Noxa. Akt may also influence cell survival through its indirect effects on N F K B by phosphorylating IKB kinase (IKK) to free N F K B from inhibition (Ozes et al., 1999; Romashkova and Makarov, 1999). 14 Beside its effect on cell survival, Akt confers cancer cells selective advantage by stimulating cell proliferation. Akt is essential in inactivation of glycogen synthase kinase-3 (GSK-3) by direct phosphorylation (Cross et al., 1995). This prevents phosphorylation-triggered ubiquitination of GSK3-targeted proteins such as cyclin DI and cyclin E from proteasomal degradation (Diehl et al., 1998; Welcker et al., 2003). The resulting accumulation of cyclins promotes Gl/S transition. Furthermore, Akt phosphorylates cyclin-dependent kinase inhibitors p2i c l P 1 / W A F 1 and p27KIP1 at a site near the nuclear localization signal and results in their exclusion from the nucleus (Liang et al., 2002; Rossig et al., 2001; Shin et al., 2002; Viglietto et al., 2002; Zhou et al., 2001a). Akt may also limit their expression indirectly through downregulation of Forkhead-mediated transcription of p27 and p53-mediated transcription of p21. The result is an increase in cellular proliferation due to decreased inhibition of cyclins. In addition, Akt stimulates cell growth, a process that is enhanced in cancer cells to meet the requirements imposed by faster growth rate. The mechanism appears to be through activation of mTOR complex. mTOR regulates translation in response to nutrients by phosphorylating components of the protein synthesis machinery (Mamane et al., 2006). Akt is able to stimulate the mTOR signaling pathway by phosphorylating and inactivating a negative regulator of mTOR known as tuberous sclerosis complex 2 (TSC2) and subsequently lead to mTOR-mediated attenuation of growth inhibition (Inoki et al., 2002; Manning et al, 2002). 1.3.3 Integrin-linked kinase (ILK) Activation of Akt depends on phosphorylation at two sites, Thr308 in the activation loop and Ser473 in the hydrophobic motif. Phosphorylation of Akt on Thr308 is mediated by phosphoinositide-dependent protein kinase-1 (PDK-1) and is critical for 15 Akt's activation (Alessi et al., 1997). Full activity requires Ser473 to be phosphorylated. Integrin-linked kinase was first identified to be a pi and P 3 integrin binding protein (Hannigan et al., 1996) and was subsequently been shown to be capable of directly phosphorylating Akt at Ser473 (Delcommenne et al., 1998; Persad et al., 2001). Although several studies have cast doubt on this claim and a recent study indicates the rictor-mTOR complex to be an attractive candidate responsible for Ser473 phosphorylation (Grashoff et al., 2003; Hill et al., 2002; Lynch et al., 1999; Mackinnon et al., 2002; Sakai et al., 2003; Sarbassov et al., 2005; Zervas et al., 2001), nevertheless compelling evidences suggest that the kinase activity of ILK is crucial in the activation of Akt and is likely to be regulated in a context dependent manner (Persad et al., 2001; Troussard et al., 2003). The N-terminus of ILK is comprised of four ankyrin repeats, which are essential for binding to protein phosphatase ILKAP and the adaptor proteins PINCH-1 and PINCH-2 (Leung-Hagesteijn et al., 2001; Tu et al., 1999; Zhang et al., 2002a). The C-terminus is a kinase domain with significant homology to other serine/threonine kinases. Overlapping between the ankyrin repeats and kinase domain is a PH domain. The kinase activity of ILK is believed to be stimulated in a PI3K-dependent manner by PIP3 binding at the PH domain (Delcommenne et al., 1998). ILK has been demonstrated to phosphorylate GSK-3 and Akt upon stimulation by growth factor and cell-extracellular matrix interaction (Delcommenne et al., 1998; Persad et al., 2000). Beside its kinase activity, the C-terminal kinase domain is involved in many protein-protein interactions including the cytoplasmic tail of pi and P 3 integrins, and various adaptor proteins such as a-parvin/CH-ILKBP/actopaxin, P-parvin/affixin and paxillin (Hannigan et al., 1996; 16 Nikolopoulos and Turner, 2001; Tu et al., 2001; Yamaji et al., 2001). The formation of PINCH-ILK-parvin complex facilitates the localization of these proteins to focal adhesion (Zhang et al., 2002b). Through these adaptor proteins, ILK is linked to the actin cytoskeleton, thus ILK may play a major role in cytoskeletal reorganization and signal transduction from the extracellular matrix. Aberrant ILK expression and activity have been shown to contribute to many oncogenic properties in many cancers. Overexpression of ILK in epithelial cells downregulates E-cadherin as a result of nuclear translocation of P-catenin and activation of E-cadherin repressor Snail (Barbera et al., 2004; Li et al., 2003; Novak et al., 1998; Somasiri et al., 2001; Tan et al., 2001; Wu et al., 1998). ILK overexpression leads to the induction of cyclin DI in a mechanism due to ILK-mediated inactivation of GSK-3 and subsequent activation of CREB, AP-1 or P-catenin/TCF transcription factors (D'Amico et al., 2000; Radeva et al., 1997; Troussard et al., 1999). ILK-induced AP-1 activity also results in the upregulation of matrix metalloproteinase-9 (Troussard et al., 2000). In addition, ILK can stimulate survival pathways via activation of Akt and its downstream target N F - K B (Delcommenne et al., 1998; Tan et al., 2002). The ability of ILK to regulate diverse cellular functions has placed ILK as a key player in tumorigenesis. It is interesting that many tumors including prostate, gastric and ovarian cancers have increased expression of ILK and the expression increases with tumor grade (Ahmed et al., 2003; Graff et al, 2001; Ito et al., 2003). In melanoma, higher levels of ILK were correlated with the thickness of melanoma lesion and inversely correlated with patient survival, suggesting an important role of ILK in melanoma progression and tumorigenesis (Dai et al., 2003). 17 1.4 Objectives The objectives of this study are to evaluate the prognostic significance of the proapoptotic protein XAF1 and its role in melanoma tumorigenesis and progression. As the aggressive behavior of melanoma not only depends on the dysregulation of apoptotic pathway, this study also aims to investigate the role of ILK in melanoma cell migration, invasion and anchorage-independent growth and to determine whether inhibition of ILK expression or activity suppresses the ILK-mediated oncogenic processes. 18 1.5 References Ahmed, N., Riley, C , Oliva, K., Stutt, E., Rice, G.E. and Quinn, M.A. (2003) Integrin-linked kinase expression increases with ovarian tumour grade and is sustained by peritoneal tumour fluid. J Pathol, 201,229-237. Alessi, D.R., James, S.R., Downes, CP., Holmes, A.B., Gaffney, P.R., Reese, C.B. and Cohen, P. (1997) Characterization of a 3-phosphoinositide-dependent protein kinase which phosphorylates and activates protein kinase Balpha. Curr Biol, 7, 261-269. Balch, CM., Buzaid, A.C, Soong, S.J., Atkins, M.B., Cascinelli, N., Coit, D.G., Fleming, I.D., Gershenwald, J.E., Houghton, A., Jr., Kirkwood, J.M., McMasters, K.M., Mihm, M.F., Morton, D.L., Reintgen, D.S., Ross, M.I., Sober, A., Thompson, J.A. and Thompson, J.F. (2001a) Final version of the American Joint Committee on Cancer staging system for cutaneous melanoma. JClin Oncol, 19, 3635-3648. Balch, CM., Soong, S.J., Gershenwald, J.E., Thompson, J.F., Reintgen, D.S., Cascinelli, N., Urist, M., McMasters, K.M., Ross, M.I., Kirkwood, J.M., Atkins, M.B., Thompson, J.A., Coit, D.G., Byrd, D., Desmond, R., Zhang, Y., Liu, P.Y., Lyman, G.H. and Morabito, A. (2001b) Prognostic factors analysis of 17,600 melanoma patients: validation of the American Joint Committee on Cancer melanoma staging system. JClin Oncol, 19, 3622-3634. Barbera, M.J., Puig, I., Dominguez, D., Julien-Grille, S., Guaita-Esteruelas, S., Peiro, S., Baulida, J., Franci, C , Dedhar, S., Larue, L. and Garcia de Herreros, A. (2004) Regulation of Snail transcription during epithelial to mesenchymal transition of tumor cells. Oncogene, 23, 7345-7354. Baruch, A.C, Shi, J., Feng, Y. and Nelson, M.A. (2005) New developments in the staging of melanoma. Cancer Invest, 23, 561-567. Bastian, B.C., LeBoit, P.E., Hamm, H., Brocker, E.B. and Pinkel, D. (1998) Chromosomal gains and losses in primary cutaneous melanomas detected by comparative genomic hybridization. Cancer Res, 58, 2170-2175. Bataille, V., Bishop, J.A., Sasieni, P., Swerdlow, A.J., Pinney, E., Griffiths, K. and Cuzick, J. (1996) Risk of cutaneous melanoma in relation to the numbers, types and sites of naevi: a case-control study. Br J Cancer, 73, 1605-1611. Bellacosa, A., de Feo, D., Godwin, A.K., Bell, D.W., Cheng, J.Q., Altomare, D.A., Wan, M., Dubeau, L., Scambia, G., Masciullo, V., Ferrandina, G., Benedetti Panici, P., 19 Mancuso, S., Neri, G. and Testa, J.R. (1995) Molecular alterations of the AKT2 oncogene in ovarian and breast carcinomas. Int J Cancer, 64, 280-285. Bevona, C. and Sober, A.J. (2002) Melanoma incidence trends. Dermatol Clin, 20, 589-595, vii. Bliss, J.M., Ford, D., Swerdlow, A.J., Armstrong, B.K., Cristofolini, M., Elwood, J.M., Green, A., Holly, E.A., Mack, T., MacKie, R.M. and et al. (1995) Risk of cutaneous melanoma associated with pigmentation characteristics and freckling: systematic overview of 10 case-control studies. The International Melanoma Analysis Group (IMAGE). Int J Cancer, 62, 367-376. Breslow, A. (1970) Thickness, cross-sectional areas and depth of invasion in the prognosis of cutaneous melanoma. Ann Surg, 172, 902-908. Brodbeck, D., Cron, P. and Hemmings, B.A. (1999) A human protein kinase Bgamma with regulatory phosphorylation sites in the activation loop and in the C-terminal hydrophobic domain. J Biol Chem, 274, 9133-9136. Brunet, A., Bonni, A., Zigmond, M.J., Lin, M.Z., Juo, P., Hu, L.S., Anderson, M.J., Arden, K.C., Blenis, J. and Greenberg, M.E. (1999) Akt promotes cell survival by phosphorylating and inhibiting a Forkhead transcription factor. Cell, 96, 857-868. Byun, D.S., Cho, K., Ryu, B.K., Lee, M.G., Park, J.I., Chae, K.S., Kim, H.J. and Chi, S.G. (2003) Frequent monoallelic deletion of PTEN and its reciprocal associatioin with PIK3CA amplification in gastric carcinoma. Int J Cancer, 104, 318-327. Canadian Cancer Society/National Cancer Institute of Canada. (2007) Canadian Cancer Statistics 2007. ISSN 0835-2976. Cardone, M.H., Roy, N., Stennicke, H.R., Salvesen, G.S., Franke, T.F., Stanbridge, E., Frisch, S. and Reed, J.C. (1998) Regulation of cell death protease caspase-9 by phosphorylation. Science, 282,1318-1321. Chapman, P.B., Einhorn, L.H., Meyers, M.L., Saxman, S., Destro, A.N., Panageas, K.S., Begg, C.B., Agarwala, S.S., Schuchter, L.M., Ernstoff, M.S., Houghton, A.N. and Kirkwood, J.M. (1999) Phase III multicenter randomized trial of the Dartmouth regimen versus dacarbazine in patients with metastatic melanoma. J Clin Oncol, 17, 2745-2751. 20 Cheng, J.Q., Godwin, A.K., Bellacosa, A., Taguchi, T., Franke, T.F., Hamilton, T.C., Tsichlis, P.N. and Testa, J.R. (1992) AKT2, a putative oncogene encoding a member of a subfamily of protein-serine/threonine kinases, is amplified in human ovarian carcinomas. Proc Natl Acad Sci USA, 89, 9267-9271. Cheng, J.Q., Ruggeri, B., Klein, W.M., Sonoda, G., Altomare, D.A., Watson, D.K. and Testa, J.R. (1996) Amplification of AKT2 in human pancreatic cells and inhibition of AKT2 expression and tumorigenicity by antisense RNA. Proc Natl Acad Sci USA, 93,3636-3641. Chowdhury, S., Vaughan, M.M. and Gore, M.E. (1999) New approaches to the systemic treatment of melanoma. Cancer Treat Rev, 25, 259-270. Clark, W.H., Jr., Elder, D.E., Guerry, D.t., Epstein, M.N., Greene, M.H. and Van Horn, M. (1984) A study of tumor progression: the precursor lesions of superficial spreading and nodular melanoma. Hum Pathol, 15, 1147-1165. Cooksey, C.J., Garratt, PJ., Land, E.J., Pavel, S., Ramsden, C.A., Riley, P.A. and Smit, N.P. (1997) Evidence of the indirect formation of the catecholic intermediate substrate responsible for the autoactivation kinetics of tyrosinase. J Biol Chem, 212, 26226-26235. Cramer, S.F. (1991) The origin of epidermal melanocytes. Implications for the histogenesis of nevi and melanomas. Arch Pathol Lab Med, 115, 115-119. Cross, D.A., Alessi, D.R., Cohen, P., Andjelkovich, M. and Hemmings, B.A. (1995) Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase B. Nature, 378, 785-789. Dai, D.L., Makretsov, N., Campos, E.I., Huang, C , Zhou, Y., Huntsman, D., Martinka, M. and Li, G. (2003) Increased expression of integrin-linked kinase is correlated with melanoma progression and poor patient survival. Clin Cancer Res, 9,4409-4414. Dai, D.L., Martinka, M. and Li, G. (2005) Prognostic significance of activated Akt expression in melanoma: a clinicopathologic study of 292 cases. JClin Oncol, 23, 1473-1482. D'Amico, M., Hulit, J., Amanatullah, D.F., Zafonte, B.T., Albanese, C , Bouzahzah, B., Fu, M., Augenlicht, L.H., Donehower, L.A., Takemaru, K., Moon, R.T., Davis, R., Lisanti, M.P., Shtutman, M., Zhurinsky, J., Ben-Ze'ev, A., Troussard, A.A., Dedhar, S. 21 and Pestell, R.G. (2000) The integrin-linked kinase regulates the cyclin Dl gene through glycogen synthase kinase 3 beta and cAMP-responsive element-binding protein-dependent pathways. JBiol Chem, 2 7 5 , 32649-32657. Datta, S.R., Dudek, H., Tao, X., Masters, S., Fu, H., Gotoh, Y. and Greenberg, M.E. (1997) Akt phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery. Cell, 91, 231-241. Datta, S.R., Katsov, A., Hu, L., Petros, A., Fesik, S.W., Yaffe, M.B. and Greenberg, M.E. (2000) 14-3-3 proteins and survival kinases cooperate to inactivate BAD by BH3 domain phosphorylation. Mol Cell, 6 , 41-51. del Peso, L., Gonzalez-Garcia, M., Page, C , Herrera, R. and Nunez, G. (1997) Interleukin-3-induced phosphorylation of BAD through the protein kinase Akt. Science, 2 7 8 , 687-689. Del Prete, S.A., Maurer, L.H., O'Donnell, J., Forcier, R.J. and LeMarbre, P. (1984) Combination chemotherapy with cisplatin, carmustine, dacarbazine, and tamoxifen in metastatic melanoma. Cancer Treat Rep, 6 8 , 1403-1405. Delcommenne, M., Tan, C , Gray, V., Rue, L., Woodgett, J. and Dedhar, S. (1998) Phosphoinositide-3-OH kinase-dependent regulation of glycogen synthase kinase 3 and protein kinase B/AKT by the integrin-linked kinase. Proc Natl Acad Sci USA, 9 5 , 11211-11216. Deveraux, Q.L., Leo, E., Stennicke, H.R., Welsh, K., Salvesen, G.S. and Reed, J.C. (1999) Cleavage of human inhibitor of apoptosis protein XIAP results in fragments with distinct specificities for caspases. Embo J, 18 , 5242-5251. Dhawan, P., Singh, A.B., Ellis, D.L. and Richmond, A. (2002) Constitutive activation of Akt/protein kinase B in melanoma leads to up-regulation of nuclear factor-kappaB and tumor progression. Cancer Res, 6 2 , 7335-7342. Diehl, J.A., Cheng, M., Roussel, M.F. and Sherr, C.J. (1998) Glycogen synthase kinase-3beta regulates cyclin Dl proteolysis and subcellular localization. Genes Dev, 12 , 3499-3511. Du, C , Fang, M., Li, Y., Li, L. and Wang, X. (2000) Smac, a mitochondrial protein that promotes cytochrome c-dependent caspase activation by eliminating IAP inhibition. Cell, 102 , 33-42. 22 Eckelman, B.P. and Salvesen, G.S. (2006) The human anti-apoptotic proteins cIAPl and cIAP2 bind but do not inhibit caspases. J Biol Chem, 281, 3254-3260. Eckelman, B.P., Salvesen, G.S. and Scott, F.L. (2006) Human inhibitor of apoptosis proteins: why XIAP is the black sheep of the family. EMBO Rep, 7, 988-994. Eisinger, M. and Marko, O. (1982) Selective proliferation of normal human melanocytes in vitro in the presence of phorbol ester and cholera toxin. Proc Natl Acad Sci USA, 79, 2018-2022. Faccio, L., Fusco, C , Chen, A., Martinotti, S., Bonventre, J.V. and Zervos, A.S. (2000) Characterization of a novel human serine protease that has extensive homology to bacterial heat shock endoprotease HtrA and is regulated by kidney ischemia. J Biol Chem, 275, 2581-2588. Fong, W.G., Liston, P., Rajcan-Separovic, E., St Jean, M., Craig, C. and Korneluk, R.G. (2000) Expression and genetic analysis of XIAP-associated factor 1 (XAF1) in cancer cell lines. Genomics, 70, 113-122. Friedman, R.J., Rigel, D.S., Kopf, A.W., Lieblich, L., Lew, R., Harris, M.N., Roses, D.F., Gumport, S.L., Ragaz, A., Waldo, E., Levine, J., Levenstein, M., Koenig, R., Bart, R.S. and Trau, H. (1983) Favorable prognosis for malignant melanomas associated with acquired melanocytic nevi. Arch Dermatol, 119, 455-462. Furumura, M., Sakai, C , Abdel-Malek, Z., Barsh, G.S. and Hearing, V.J. (1996) The interaction of agouti signal protein and melanocyte stimulating hormone to regulate melanin formation in mammals. Pigment Cell Res, 9, 191-203. Graff, J.R., Deddens, J.A., Konicek, B.W., Colligan, B.M., Hurst, B.M., Carter, H.W. and Carter, J.H. (2001) Integrin-linked kinase expression increases with prostate tumor grade. Clin Cancer Res, 7, 1987-1991. Grashoff, C , Aszodi, A., Sakai, T., Hunziker, E.B. and Fassler, R. (2003) Integrin-linked kinase regulates chondrocyte shape and proliferation. EMBO Rep, 4,432-438. Gray, C.W., Ward, R.V., Karran, E., Turconi, S., Rowles, A., Viglienghi, D., Southan, C , Barton, A., Fantom, K.G., West, A., Savopoulos, J., Hassan, N.J., Clinkenbeard, H., Hanning, C , Amegadzie, B., Davis, J.B., Dingwall, C , Livi, G.P. and Creasy, CL. (2000) Characterization of human HtrA2, a novel serine protease involved in the mammalian cellular stress response. Eur J Biochem, 267, 5699-5710. 23 Greene, M.H., Clark, W.H., Jr., Tucker, M.A., Kraemer, K.H., Elder, D.E. and Fraser, M.C. (1985) High risk of malignant melanoma in melanoma-prone families with dysplastic nevi. Ann Intern Med, 102, 458-465. Haass, N.K. and Herlyn, M. (2005) Normal human melanocyte homeostasis as a paradigm for understanding melanoma. J Investig Dermatol Symp Proc, 10, 153-163. Halpern, A.C., Guerry, D.t, Elder, D.E., Clark, W.H., Jr., Synnestvedt, M., Norman, S. and Ayerle, R. (1991) Dysplastic nevi as risk markers of sporadic (nonfamilial) melanoma. A case-control study. Arch Dermatol, 127, 995-999. Hannigan, G.E., Leung-Hagesteijn, C , Fitz-Gibbon, L., Coppolino, M.G., Radeva, G., Filmus, J., Bell, J.C. and Dedhar, S. (1996) Regulation of cell adhesion and anchorage-dependent growth by a new beta 1-integrin-linked protein kinase. Nature, 379, 91-96. Healy, E., Rehman, I., Angus, B. and Rees, J.L. (1995) Loss of heterozygosity in sporadic primary cutaneous melanoma. Genes Chromosomes Cancer, 12, 152-156. Hegde, R., Srinivasula, S.M., Zhang, Z., Wassell, R., Mukattash, R., Cilenti, L., DuBois, G., Lazebnik, Y., Zervos, A.S., Fernandes-Alnemri, T. and Alnemri, E.S. (2002) Identification of Omi/HtrA2 as a mitochondrial apoptotic serine protease that disrupts inhibitor of apoptosis protein-caspase interaction. J Biol Chem, 277, 432-438. Herbst, R.A., Weiss, J., Ehnis, A., Cavenee, W.K. and Arden, K.C. (1994) Loss of heterozygosity for 10q22-10qter in malignant melanoma progression. Cancer Res, 54, 3111-3114. Herlyn, M., Thurin, J., Balaban, G., Bennicelli, J.L., Herlyn, D., Elder, D.E., Bondi, E., Guerry, D., Nowell, P., Clark, W.H. and et al. (1985) Characteristics of cultured human melanocytes isolated from different stages of tumor progression. Cancer Res, 45, 5670-5676. Hill, M.M., Feng, J. and Hemmings, B.A. (2002) Identification of a plasma membrane Raft-associated PKB Ser473 kinase activity that is distinct from ILK and PDK1. Curr Biol, 12,1251-1255. Houghton, A.N. and Polsky, D. (2002) Focus on melanoma. Cancer Cell, 2, 275-278. 24 Huang, Y., Park, Y.C., Rich, R.L., Segal, D., Myszka, D.G. and Wu, H. (2001) Structural basis of caspase inhibition by XIAP: differential roles of the linker versus the BIR domain. Cell, 104, 781-790. Hussein, M.R. (2005) Melanocyte dysplastic naevi occupy the middle ground between benign melanocyte naevi and cutaneous malignant melanomas: emerging clues. J Clin Pathol, 58, 453-456. Inoki, K., Li, Y., Zhu, T., Wu, J. and Guan, K.L. (2002) TSC2 is phosphorylated and inhibited by Akt and suppresses mTOR signalling. Nat Cell Biol, 4, 648-657. Ito, R., Oue, N., Zhu, X., Yoshida, K., Nakayama, H., Yokozaki, H. and Yasui, W. (2003) Expression of integrin-linked kinase is closely correlated with invasion and metastasis of gastric carcinoma. Virchows Arch, 442, 118-123. Jemal, A., Siegel, R., Ward, E., Murray, T., Xu, J., Smigal, C. and Thun, M.J. (2006) Cancer statistics, 2006. CA Cancer J Clin, 56, 106-130. Jimbow, K. (1995) Current update and trends in melanin pigmentation and melanin biology. Keio J Med, 44, 9-18. Leaman, D.W., Chawla-Sarkar, M., Vyas, K., Reheman, M., Tamai, K., Toji, S. and Borden, E.C. (2002) Identification of X-linked inhibitor of apoptosis-associated factor-1 as an interferon-stimulated gene that augments TRAIL Apo2L-induced apoptosis. JBiol Chem, 277, 28504-28511. Legha, S.S. (1997) Durable complete responses in metastatic melanoma treated with interleukin-2 in combination with interferon alpha and chemotherapy. Semin Oncol, 24, S39-43. Leung-Hagesteijn, C , Mahendra, A., Naruszewicz, I. and Hannigan, G.E. (2001) Modulation of integrin signal transduction by ILKAP, a protein phosphatase 2C associating with the integrin-linked kinase, ILK1. Embo J, 20, 2160-2170. Li, Y., Yang, J., Dai, C , Wu, C. and Liu, Y. (2003) Role for integrin-linked kinase in mediating tubular epithelial to mesenchymal transition and renal interstitial fibrogenesis. J Clin Invest, 112, 503-516. 25 Liang, J., Zubovitz, J., Petrocelli, T., Kotchetkov, R., Connor, M.K., Han, K., Lee, J.H., Ciarallo, S., Catzavelos, C , Beniston, R., Franssen, E. and Slingerland, J.M. (2002) PKB/Akt phosphorylates p27, impairs nuclear import of p27 and opposes p27-mediated Gl arrest. Nat Med, 8, 1153-1160. Liston, P., Fong, W.G., Kelly, N.L., Toji, S., Miyazaki, T., Conte, D., Tamai, K., Craig, C.G., McBurney, M.W. and Korneluk, R.G. (2001) Identification of XAFl as an antagonist of XIAP anti-Caspase activity. Nat Cell Biol, 3, 128-133. Lynch, D.K., Ellis, C.A., Edwards, P.A. and Hiles, LD. (1999) Integrin-linked kinase regulates phosphorylation of serine 473 of protein kinase B by an indirect mechanism. Oncogene, 18, 8024-8032. Mackinnon, A.C., Qadota, H., Norman, K.R., Moerman, D.G. and Williams, B.D. (2002) C. elegans PAT-4/ILK functions as an adaptor protein within integrin adhesion complexes. Curr Biol, 12, 787-797. Mamane, Y., Petroulakis, E., LeBacquer, O. and Sonenberg, N. (2006) mTOR, translation initiation and cancer. Oncogene, 25, 6416-6422. Manning, B.D., Tee, A.R., Logsdon, M.N., Blenis, J. and Cantley, L.C. (2002) Identification of the tuberous sclerosis complex-2 tumor suppressor gene product tuberin as a target of the phosphoinositide 3-kinase/akt pathway. Mol Cell, 10,151-162. Marghoob, A.A., Kopf, A.W., Rigel, D.S., Bart, R.S., Friedman, R.J., Yadav, S., Abadir, M., Sanfilippo, L., Silverman, M.K. and Vossaert, K.A. (1994) Risk of cutaneous malignant melanoma in patients with 'classic' atypical-mole syndrome. A case-control study. Arch Dermatol, 130, 993-998. Margolin, K.A., Liu, P.Y., Flaherty, L.E., Sosman, J.A., Walker, M.J., Smith, J.W., 3rd, Fletcher, W.S., Weiss, G.R., Unger, J.M. and Sondak, V.K. (1998) Phase II study of ' carmustine, dacarbazine, cisplatin, and tamoxifen in advanced melanoma: a Southwest Oncology Group study. J Clin Oncol, 16, 664-669. Martins, L.M., Iaccarino, I., Tenev, T., Gschmeissner, S., Totty, N.F., Lemoine, N.R., Savopoulos, J., Gray, C.W., Creasy, C.L., Dingwall, C. and Downward, J. (2002) The serine protease Omi/HtrA2 regulates apoptosis by binding XIAP through a reaper-like motif. JBiol Chem, 277, 439-444. 26 Mayo, L.D. and Donner, D.B. (2001) A phosphatidylinositol 3-kinase/Akt pathway promotes translocation of Mdm2 from the cytoplasm to the nucleus. Proc Natl Acad Sci US A, 98,11598-11603. Mertens, F., Johansson, B., Hoglund, M. and Mitelman, F. (1997) Chromosomal imbalance maps of malignant solid tumors: a cytogenetic survey of 3185 neoplasms. Cancer Res, 57, 2765-2780. Miller, L.K. (1997) Baculovirus interaction with host apoptotic pathways. J Cell Physiol, 173, 178-182. Morizane, Y., Honda, R., Fukami, K. and Yasuda, H. (2005) X-linked inhibitor of apoptosis functions as ubiquitin ligase toward mature caspase-9 and cytosolic Smac/DIABLO. J Biochem (Tokyo), 137, 125-132. Nakatani, K., Sakaue, H., Thompson, D.A., Weigel, R.J. and Roth, R.A. (1999) Identification of a human Akt3 (protein kinase B gamma) which contains the regulatory serine phosphorylation site. Biochem Biophys Res Commun, 257, 906-910. Nathan, F.E. and Mastrangelo, M.J. (1998) Systemic therapy in melanoma. Semin Surg Oncol, 14, 319-327. Nikolopoulos, S.N. and Turner, CE. (2001) Integrin-linked kinase (ILK) binding to paxillin LD1 motif regulates ILK localization to focal adhesions. J Biol Chem, 276, 23499-23505. Novak, A., Hsu, S.C, Leung-Hagesteijn, C , Radeva, G., Papkoff, J., Montesano, R., Roskelley, C , Grosschedl, R. and Dedhar, S. (1998) Cell adhesion and the integrin-linked kinase regulate the LEF-1 and beta-catenin signaling pathways. Proc Natl Acad Sci US A, 95,4374-4379. Ozes, O.N., Mayo, L.D., Gustin, J.A., Pfeffer, S.R., Pfeffer, L.M. and Donner, D.B. (1999) NF-kappaB activation by tumour necrosis factor requires the Akt serine-threonine kinase. Nature, 401, 82-85. Pavlick, A.C. (2002) Chemotherapy approaches to melanoma. Dermatol Clin, 20, 709-712. 27 Pedrero, J.M., Carracedo, D.G., Pinto, CM., Zapatero, A.H., Rodrigo, J.P., Nieto, CS. and Gonzalez, M.V. (2005) Frequent genetic and biochemical alterations of the PI 3-K/AKT/PTEN pathway in head and neck squamous cell carcinoma. Int J Cancer, 114, 242-248. Persad, S., Attwell, S., Gray, V., Delcommenne, M., Troussard, A., Sanghera, J. and Dedhar, S. (2000) Inhibition of integrin-linked kinase (ILK) suppresses activation of protein kinase B/Akt and induces cell cycle arrest and apoptosis of PTEN-mutant prostate cancer cells. Proc Natl Acad Sci USA, 97, 3207-3212. Persad, S., Attwell, S., Gray, V., Mawji, N., Deng, J.T., Leung, D., Yan, J., Sanghera, J., Walsh, M.P. and Dedhar, S. (2001) Regulation of protein kinase B/Akt-serine 473 phosphorylation by integrin-linked kinase: critical roles for kinase activity and amino acids arginine 211 and serine 343. J Biol Chem, 276, 27462-27469. Philp, A.J., Campbell, I.G., Leet, C , Vincan, E., Rockman, S.P., Whitehead, R.H., Thomas, R.J. and Phillips, W.A. (2001) The phosphatidylinositol 3-kinase p85alpha gene is an oncogene in human ovarian and colon tumors. Cancer Res, 61, 7426-7429. Qi, R., Gu, J., Zhang, Z., Yang, K., Li, B., Fan, J., Wang, C , He, Z., Qiao, L., Lin, Z. and Liu, X.Y. (2007) Potent antitumor efficacy of XAFl delivered by conditionally replicative adenovirus vector via caspase-independent apoptosis. Cancer Gene Ther, 14, 82-90. Radeva, G., Petrocelli, T., Behrend, E., Leung-Hagesteijn, C , Filmus, J., Slingerland, J. and Dedhar, S. (1997) Overexpression of the integrin-linked kinase promotes anchorage-independent cell cycle progression. J Biol Chem, 272, 13937-13944. Richards, J.M., Mehta, N., Ramming, K. and Skosey, P. (1992) Sequential chemoimmunotherapy in the treatment of metastatic melanoma. J Clin Oncol, 10, 1338-1343. Riedl, S.J., Renatus, M., Schwarzenbacher, R., Zhou, Q., Sun, C , Fesik, S.W., Liddington, R.C and Salvesen, G.S. (2001) Structural basis for the inhibition of caspase-3 by XIAP. Cell, 104, 791-800. Romashkova, J.A. and Makarov, S.S. (1999) NF-kappaB is a target of AKT in anti-apoptotic PDGF signalling. Nature, 401, 86-90. 28 Rossig, L., Jadidi, A.S., Urbich, C , Badorff, C , Zeiher, A.M. and Dimmeler, S. (2001) Akt-dependent phosphorylation of p21(Cipl) regulates PCNA binding and proliferation of endothelial cells. Mol Cell Biol, 21, 5644-5657. Saal, L.H., Holm, K., Maurer, M., Memeo, L., Su, T., Wang, X., Yu, J.S., Malmstrom, P.O., Mansukhani, M., Enoksson, J., Hibshoosh, H., Borg, A. and Parsons, R. (2005) PIK3CA mutations correlate with hormone receptors, node metastasis, and ERBB2, and are mutually exclusive with PTEN loss in human breast carcinoma. Cancer Res, 65, 2554-2559. Sakai, T., Li, S., Docheva, D., Grashoff, C , Sakai, K., Kostka, G., Braun, A., Pfeifer, A., Yurchenco, P.D. and Fassler, R. (2003) Integrin-linked kinase (ILK) is required for polarizing the epiblast, cell adhesion, and controlling actin accumulation. Genes Dev, 17, 926-940. Samuels, Y., Wang, Z., Bardelli, A., Silliman, N., Ptak, J., Szabo, S., Yan, H., Gazdar, A., Powell, S.M., Riggins, G.J., Willson, J.K., Markowitz, S., Kinzler, K.W., Vogelstein, B. and Velculescu, V.E. (2004) High frequency of mutations of the PIK3CA gene in human cancers. Science, 304, 554. Sarbassov, D.D., Guertin, D.A., Ali, S.M. and Sabatini, D.M. (2005) Phosphorylation and regulation of Akt/PKB by the rictor-mTOR complex. Science, 307, 1098-1101. Schuchter, L., Schultz, D.J., Synnestvedt, M., Trock, B.J., Guerry, D., Elder, D.E., Elenitsas, R., Clark, W.H. and Halpern, A.C. (1996) A prognostic model for predicting 10-year survival in patients with primary melanoma. The Pigmented Lesion Group. Ann Intern Med, 125, 369-375. Scott, F.L., Denault, J.B., Riedl, S.J., Shin, H., Renatus, M. and Salvesen, G.S. (2005) XIAP inhibits caspase-3 and -7 using two binding sites: evolutionarily conserved mechanism of IAPs. Embo J, 24, 645-655. Shayesteh, L., Lu, Y., Kuo, W.L., Baldocchi, R., Godfrey, T., Collins, C , Pinkel, D., Powell, B., Mills, G.B. and Gray, J.W. (1999) PIK3CA is implicated as an oncogene in ovarian cancer. Nat Genet, 21, 99-102. Shih, I.M., Elder, D.E., Hsu, M.Y. and Herlyn, M. (1994) Regulation of Mel-CAM/MUC18 expression on melanocytes of different stages of tumor progression by normal keratinocytes. Am J Pathol, 145, 837-845. 29 Shin, I., Yakes, F.M., Rojo, F., Shin, N.Y., Bakin, A.V., Baselga, J. and Arteaga, CL. (2002) PKB/Akt mediates cell-cycle progression by phosphorylation of p27(Kipl) at threonine 157 and modulation of its cellular localization. Nat Med, 8, 1145-1152. Shiozaki, E.N., Chai, J., Rigotti, D.J., Riedl, S.J., Li, P., Srinivasula, S.M., Alnemri, E.S., Fairman, R. and Shi, Y. (2003) Mechanism of XIAP-mediated inhibition of caspase-9. Mol Cell, 11,519-527. Sober, A.J., Day, C.L., Jr., Fitzpatrick, T.B., Lew, R.A., Kopf, A.W. and Mihm, M.C, Jr. (1983) Early death from clinical stage I melanoma. J Invest Dermatol, 80 Suppl, 50s-52s. Somasiri, A., Howarth, A., Goswami, D., Dedhar, S. and Roskelley, CD. (2001) Overexpression of the integrin-linked kinase mesenchymally transforms mammary epithelial cells. J Cell Sci, 114, 1125-1136. Soong, S.J., Shaw, H.M., Balch, CM., McCarthy, W.H., Urist, M.M. and Lee, J.Y. (1992) Predicting survival and recurrence in localized melanoma: a multivariate approach. World J Surg, 16, 191-195. Srinivasula, S.M., Gupta, S., Datta, P., Zhang, Z., Hegde, R., Cheong, N., Fernandes-Alnemri, T. and Alnemri, E.S. (2003) Inhibitor of apoptosis proteins are substrates for the mitochondrial serine protease Omi/HtrA2. J Biol Chem, 278, 31469-31472. Staal, S.P. (1987) Molecular cloning of the akt oncogene and its human homologues AKT1 and AKT2: amplification of AKT1 in a primary human gastric adenocarcinoma. Proc Natl Acad Sci USA, 84, 5034-5037. Stahl, J.M., Cheung, M., Sharma, A., Trivedi, N.R., Shanmugam, S. and Robertson, G.P. (2003) Loss of PTEN promotes tumor development in malignant melanoma. Cancer Res, 63, 2881-2890. Stahl, J.M., Sharma, A., Cheung, M., Zimmerman, M., Cheng, J.Q., Bosenberg, M.W., Kester, M., Sandirasegarane, L. and Robertson, G.P. (2004) Deregulated Akt3 activity promotes development of malignant melanoma. Cancer Res, 64, 7002-7010. Suzuki, Y., Imai, Y., Nakayama, H., Takahashi, K., Takio, K. and Takahashi, R. (2001a) A serine protease, HtrA2, is released from the mitochondria and interacts with XIAP, inducing cell death. Mol Cell, 8, 613-621. 30 Suzuki, Y., Nakabayashi, Y. and Takahashi, R. (2001b) Ubiquitin-protein ligase activity of X-linked inhibitor of apoptosis protein promotes proteasomal degradation of caspase-3 and enhances its anti-apoptotic effect in Fas-induced cell death. Proc Natl Acad Sci USA, 98, 8662-8667. Tan, C , Costello, P., Sanghera, J., Dominguez, D., Baulida, J., de Herreros, A.G. and Dedhar, S. (2001) Inhibition of integrin linked kinase (ILK) suppresses beta-catenin-Lef/Tcf-dependent transcription and expression of the E-cadherin repressor, snail, in APC-/- human colon carcinoma cells. Oncogene, 20, 133-140. Tan, C , Mui, A. and Dedhar, S. (2002) Integrin-linked kinase regulates inducible nitric oxide synthase and cyclooxygenase-2 expression in an NF-kappa B-dependent manner. J Biol Chem, 277, 3109-3116. Tarhini, A.A. and Agarwala, S.S. (2006) Cutaneous melanoma: available therapy for metastatic disease. Dermatol Ther, 19, 19-25. Thompson, J.F., Scolyer, R.A. and Kefford, R.F. (2005) Cutaneous melanoma. Lancet, 365, 687-701. Troussard, A.A., Costello, P., Yoganathan, T.N., Kumagai, S., Roskelley, CD. and Dedhar, S. (2000) The integrin linked kinase (ILK) induces an invasive phenotype via AP-1 transcription factor-dependent upregulation of matrix metalloproteinase 9 (MMP-9). Oncogene, 19, 5444-5452. Troussard, A.A., Mawji, N.M., Ong, C, Mui, A., St -Arnaud, R. and Dedhar, S. (2003) Conditional knock-out of integrin-linked kinase demonstrates an essential role in protein kinase B/Akt activation. J Biol Chem, 278, 22374-22378. Troussard, A.A., Tan, C , Yoganathan, T.N. and Dedhar, S. (1999) Cell-extracellular matrix interactions stimulate the AP-1 transcription factor in an integrin-linked kinase- and glycogen synthase kinase 3-dependent manner. Mol Cell Biol, 19, 7420-7427. Tu, Y., Huang, Y., Zhang, Y., Hua, Y. and Wu, C. (2001) A new focal adhesion protein that interacts with integrin-linked kinase and regulates cell adhesion and spreading. J Cell Biol, 153, 585-598. 31 Tu, Y., Li, F., Goicoechea, S. and Wu, C. (1999) The LIM-only protein PINCH directly interacts with integrin-linked kinase and is recruited to integrin-rich sites in spreading cells. Mol Cell Biol, 19, 2425-2434. Tucker, M.A., Fraser, M.C., Goldstein, A.M., Elder, D.E., Guerry, D.t. and Organic, S.M. (1993) Risk of melanoma and other cancers in melanoma-prone families. J Invest Dermatol, 100, 350S-355S. Tucker, M.A., Halpern, A., Holly, E.A., Hartge, P., Elder, D.E., Sagebiel, R.W., Guerry, D.t. and Clark, W.H., Jr. (1997) Clinically recognized dysplastic nevi. A central risk factor for cutaneous melanoma. Jama, 277, 1439-1444. Valyi-Nagy, I.T., Hirka, G., Jensen, P.J., Shih, I.M., Juhasz, I. and Herlyn, M. (1993) Undifferentiated keratinocytes control growth, morphology, and antigen expression of normal melanocytes through cell-cell contact. Lab Invest, 69, 152-159. Verhagen, A.M., Ekert, P.G., Pakusch, M., Silke, J., Connolly, L.M., Reid, G.E., Moritz, R.L., Simpson, RJ. and Vaux, D.L. (2000) Identification of DIABLO, a mammalian protein that promotes apoptosis by binding to and antagonizing IAP proteins. Cell, 102, 43-53. Verhagen, A.M., Silke, J., Ekert, P.G., Pakusch, M., Kaufmann, H., Connolly, L.M., Day, C.L., Tikoo, A., Burke, R., Wrobel, C , Moritz, R.L., Simpson, RJ. and Vaux, D.L. (2002) HtrA2 promotes cell death through its serine protease activity and its ability to antagonize inhibitor of apoptosis proteins. JBiol Chem, 277,445-454. Viglietto, G., Motti, M.L., Bruni, P., Melillo, R.M., D'Alessio, A., Califano, D., Vinci, F., Chiappetta, G., Tsichlis, P., Bellacosa, A., Fusco, A. and Santoro, M. (2002) Cytoplasmic relocalization and inhibition of the cyclin-dependent kinase inhibitor p27(Kipl) by PKB/Akt-mediated phosphorylation in breast cancer. Nat Med, 8,1136-1144. Vousden, K.H. and Lu, X. (2002) Live or let die: the cell's response to p53. Nat Rev Cancer, 2, 594-604. Welcker, M., Singer, J., Loeb, K.R., Grim, J., Bloecher, A., Gurien-West, M., Clurman, B.E. and Roberts, J.M. (2003) Multisite phosphorylation by Cdk2 and GSK3 controls cyclin E degradation. Mol Cell, 12, 381-392. 32 Wu, C, Keightley, S.Y., Leung-Hagesteijn, C, Radeva, G., Coppolino, M., Goicoechea, S., McDonald, J.A. and Dedhar, S. (1998) Integrin-linked protein kinase regulates fibronectin matrix assembly, E-cadherin expression, and tumorigenicity. JBiol Chem, 273, 528-536. Wu, H., Goel, V. and Haluska, F.G. (2003) PTEN signaling pathways in melanoma. Oncogene, 22, 3113-3122. Yamaji, S., Suzuki, A., Sugiyama, Y., Koide, Y., Yoshida, M., Kanamori, H., Mohri, H., Ohno, S. and Ishigatsubo, Y. (2001) A novel integrin-linked kinase-binding protein, affixin, is involved in the early stage of cell-substrate interaction. J Cell Biol, 153, 1251-1264. Yang, Q.H., Church-Hajduk, R., Ren, J., Newton, M.L. and Du, C. (2003) Omi/HtrA2 catalytic cleavage of inhibitor of apoptosis (IAP) irreversibly inactivates IAPs and facilitates caspase activity in apoptosis. Genes Dev, 17,1487-1496. Yang, Y., Fang, S., Jensen, J.P., Weissman, A.M. and Ashwell, J.D. (2000) Ubiquitin protein ligase activity of IAPs and their degradation in proteasomes in response to apoptotic stimuli. Science, 288, 874-877. Zervas, C.G., Gregory, S.L. and Brown, N.H. (2001) Drosophila integrin-linked kinase is required at sites of integrin adhesion to link the cytoskeleton to the plasma membrane. J Cell Biol, 152, 1007-1018. Zhang, Y., Chen, K., Guo, L. and Wu, C. (2002a) Characterization of PINCH-2, a new focal adhesion protein that regulates the PINCH-1-ILK interaction, cell spreading, and migration. JBiol Chem, 277, 38328-38338. Zhang, Y., Chen, K., Tu, Y., Velyvis, A., Yang, Y., Qin, J. and Wu, C. (2002b) Assembly of the PINCH-ILK-CH-ILKBP complex precedes and is essential for localization of each component to cell-matrix adhesion sites. J Cell Sci, 115, 4777-4786. Zhou, B.P., Liao, Y., Xia, W., Spohn, B., Lee, M.H. and Hung, M.C. (2001a) Cytoplasmic localization of p21Cipl/WAFl by Akt-induced phosphorylation in HER-2/neu-overexpressing cells. Nat Cell Biol, 3,245-252. 33 Zhou, B.P., Liao, Y., Xia, W., Zou, Y., Spohn, B. and Hung, M.C. (2001b) HER-2/neu induces p53 ubiquitination via Akt-mediated MDM2 phosphorylation. Nat Cell Biol, 3, 973-982. 34 CHAPTER 2. MATERIAL AND METHODS 2.1 Cell Culture All melanoma cell lines were cultured in Dulbecco's Modified Eagle Medium supplemented with 10% fetal bovine serum (Invitrogen, Burlington, ON, Canada). Normal human epidermal melanocytes were cultured in melanocyte basal medium supplemented with 50 ng/ml amphotericin B, 1.0 ng/ml basic fibroblast growth factor, 0.004 ml/ml bovine pituitary extract, 50 pg/ml gentamicin, 5.0 pg/ml hydrocortisone, 5.0 pg/ml bovine insulin, and 10 ng/ml phorbol 12-myristate 13-acetate (PromoCell, Heidelberg, Germany). All cells were maintained in 5% CO2 at 37°C. 2.2 Reverse Transciptase-Polymerase Chain Reaction (RT-PCR) Total RNA of all melanoma cell lines and normal human melanocytes was extracted with TriZol reagent (Invitrogen). RNA concentrations were measured with a spectrophotometer at 260 nm. 2 ug of total RNA was reverse-transcribed into cDNA using 1 uM oligo(dT)i2-i8 primers, 4 unit Omniscript reverse transcriptase (Qiagen, Mississauga, ON, Canada) and dNTP mix (10 mM each) in the presence of 10 unit RNase inhibitor in a total volume of 20 ul. The RT mix was incubated at 37°C for 1 h followed by a 5 min heating at 93 °C to inactivate the enzyme. The PCR reaction included 1.0 to 2.5 pi of the first strand reaction product, 5 mM dNTP mix, 2.5 unit Tag DNA polymerase and lOx Qiagen PCR buffer (Qiagen) together with 0.5 uM each of XAF1 specific primers (forward: 5'-GAGC ACC AGC AGGTTGGGTG-3'; reverse: 5'-AATCATTTGGTTGCAATAAT-3'). The forward primer was designed to overlap the exon boundary of exon 2 and 3, whereas the reverse primer was designed to span exon 5 to the XAF1 gene. Therefore, the primers are able to amplify XAF1A and XAF1C with a 35 fragment size of 304 bp and 476 bp respectively. Amplification was carried out as follows: (a) initial denaturation at 94°C for 3 min, (b) denaturation at 94°C for 1 min, (c) annealing at 50.6°C for 1 min, (d) polymerization at 72°C for 1 min. The reaction was repeated for 35 cycles followed by final polymerization at 72°C for 10 min. Samples were then electrophoresed on a 2% agarose gel containing 0.5 ug/ml of ethidium bromide. The XAFl specific primers generate a 324 bp product as visualized under ultraviolet light. 2.3 Immunofluorescent Staining For immunofluorescent staining of XAFl, cells were grown on cover slips at a density of 2 x 104 cells/well in a 6-well plate for 24 h. After washing twice in cold phosphate buffered saline (PBS), cells were fixed and permeabilized with 2% paraformaldehyde, 0.5% Triton X-100 in PBS at 4°C for 30 min. Slides were washed twice with PBS and cells were blocked overnight with normal goat serum at 4°C, followed by staining with rabbit anti-XAFl antibody (a kind gift from Dr. Robert G. Korneluk, University of Ottawa) at a dilution of 1:25 for 1 h at room temperature. The cells were washed for 5 min in three changes of PBS and incubated at room temperature for 1 h with Cy3-conjugated goat anti-rabbit IgG at 1:500 dilution (Jackson ImmunoResearch, West Grove, PA). DNA contents were stained with 2 mg/ml Hoechst 33258 for 1 min. After washing, the cells were mounted in Permount mounting media (Fisher Scientific, Ottawa, ON, Canada), and images were taken under a Zeiss Axioplan 2 upright microscope (Carl Zeiss Canada, Toronto, ON) To determine the proliferation rate of migrating cells, stable clones of melanoma cells expressing ILK short-hairpin RNA (shRNA) were analyzed for the Ki-67 staining. Cells were allowed to migrate for 24 h and then fixed in 3.7% paraformaldehyde in PBS, 36 pH 7.4 for 10 min. Fixed cells were permeabilized with PBS + 0.1% Triton X-100 for 10 min followed by incubation with blocking reagent (Dako, Mississauga, ON) for 30 min at room temperature. A monoclonal mouse anti-Ki-67 primary antibody (Dako) diluted at 1:75 in antibody diluent solution (Dako) was incubated for 1 h at room temperature. The cells were washed with PBS three times for 5 min each and incubated with Cy5 conjugated goat anti-mouse IgG at 1:500 dilution (Jackson ImmunoResearch). Images were acquired under a Zeiss Axiovert 200 inverted microscope (Carl Zeiss Canada) coupled with a Retiga 1300 cooled charge-coupled device camera (Qimaging, Vancouver, BC). 2.4 Tissue Microarray (TMA) The construction and composition of the melanoma TMA were described previously (Dai et al., 2003). Briefly, formalin-fixed, paraffin-embedded tissue blocks containing 46 benign nevi and 87 primary melanomas were retrieved from the 1990-1997 archives of the Vancouver General Hospital Department of Pathology. The use of human skin tissues in this study was approved by the medical ethical committee of the University of British Columbia and was performed in accordance with the Declaration of Helsinki Guidelines. For each case, the most representative tumor area was selected and marked on hematoxylin and eosin stained slides. To ensure an adequate representation of the whole tumor tissue, three or fewer cylindrical cores, depending on the size of nevi and tumors, were obtained from corresponding marked area of each tissue specimen and transferred to the recipient block at defined array positions using a Tissue Arrayer (Beecher Instruments, Sun Prairie, Wl) with a 0.6 mm needle. Multiple 4-urn sections 37 were cut from the recipient block using a Leica microtome and mounted on microscope slides. 2.5 Immunohistochemistry TMA slides were deparaffinized by heating at 55°C for 30 min followed by three washes with xylene. Tissues were rehydrated in a series of ethanol washes and rinsed with PBS. Antigen retrieval was carried out by microwaving the slides at high power in 10 mM citrate buffer (pH 6.0) for 4 min. Endogenous peroxidase activity was quenched with 0.3% hydrogen peroxide in PBS for 20 min. Non-specific binding was blocked with normal goat serum for 30 min. XAF1 immunoreactivity was studied using the rabbit anti-XAFl antibody (a kind gift from Dr. Robert G. Korneluk, University of Ottawa) at a dilution of 1:25. The antibody was applied for 1 h at room temperature. The slides were washed with PBS and then incubated with a biotinylated anti-rabbit antibody (Santa Cruz Biotechnology, Santa Cruz, CA) for 30 min. After washing with PBS, the slides were incubated with horseradish peroxidase-conjugated streptavidin (Santa Cruz Biotechnology) for 45 min. Following the wash with PBS, the signals were developed with 3,3'-diaminobenzidine substrate (Vector Laboratories, Burlington, ON, Canada) for 5 min and counterstained with hematoxylin. The slides were dehydrated and sealed with coverslips. Negative control was performed by omitting the primary XAF1 antibody. 2.6 Evaluation of Tissue Immunostaining 46 benign nevi and 87 primary melanoma cases were included in the array. Of the 46 nevi case, informative staining was obtained in 40 cases. Of the 87 primary melanoma cases, informative tumor staining and complete clinical pathological information were available for 70 cases. For survival analysis, 69 patients that have their 38 5-year overall survival information and informative tumor staining available were included in the evaluation. Melanoma staging was classified according to Breslow thickness (Marghoob et al., 2000); <0.75 mm (low risk), 0.76-1.5 mm (intermediate risk), 1.51-4.0 mm (high risk), and >4.0 (very high risk). Tissue scoring was carried out simultaneously by three independent observers (including one dermatopathologist) and a consensus score was reached for each core. Overall intensity was assessed on a four-point scale: negative (0), weak (1), moderate (2), or strong (3), regardless of tissue type. In addition, the percentage of cells showing positive staining in the nucleus and cytoplasm was assessed independently. For both nuclear and cytoplasmic staining, we defined the staining as strongly positive if >50% of cells contained XAF1 in the respective compartment, weakly positive if <50% of cells showing XAF1 staining, and negative if complete absence of staining. For cases in which multiple biopsy cores were available, 80% of the biopsies had uniform staining for both nevoid and tumor tissues. In the event of inconsistent staining for either normal and tumor tissue, the highest score was used for statistical analysis. The percentages of cells showing positive XAF1 staining were averaged among the multiple biopsy cores. 2.7 Statistical Analysis The level of XAF1 expression in tumors versus the benign melanocyte nevi was compared using the Pearson chi-square (x 2 ) test. The frequency of cells showing positive staining in the nucleus and cytoplasm respectively between nevi and tumor tissues was compared using the Mann-Whitney test. The relationship between XAF1 expression and clinical pathological parameters, including gender, age, tumor thickness, location, histological subtype was evaluated by %2 test or Fisher's Exact test, where appropriate. 39 The percentages of cells showing XAFl staining in the nucleus at different thicknesses were compared using Kruskal-Wallis test. Survival curves were plotted according to Kaplan and Meier method and comparison of survival times was carried out with the log-rank test. A p-value of less than 0.05 was considered to be significant. All statistical analyses were performed with SPSS standard version 11.5 (SPSS, Chicago, B L ) . 2.8 Small Interfering RNA (siRNA) A 21 bp double-stranded siRNA molecule specifically targeting the integrin-binding domain (ILK-A), the PH domain (ILK-H) of ILK or a control, nonsilencing sequence was synthesized (Qiagen, Mississauga, ON). The sequence of the siRNA molecules has been published from previous study (Troussard et al., 2003). Cells reaching a confluency of 40% were transfected overnight with 25 nM of siRNA using SiLentFect lipid reagent (BioRad), according to the manufacturer's instructions. ILK protein expression was then evaluated 4 days post-transfection by immunoblotting. Cell migration assay was performed 3 days post-transfection. 2.9 ILK Inhibitor Treatment Cells were treated with 50 or 100 uM KP-392 (formerly KP-SD-1, QLT Inc., Vancouver, BC), a selective small molecular inhibitor of ILK kinase activity (Persad et al., 2000), for 24 h in serum-free media. An equivalent amount of dimethyl sulfoxide (DMSO) was added to the control reaction to serve as vehicle control. 2.10 shRNA Gonstructs and Stable Transfection The shRNA sequences of ELK corresponded to the nucleotides 472-492 of human ILK gene (NCBI accession number NM_004517) relative to the first nucleotide of the start codon in the coding region. The sense oligonucleotide containing ILK targeting 40 sequence (underlined) is as follow: 5'-GATCCCCTCTCAACCGTATTCCATACTTCAAGAGAGTATGGAATACGGTTGAG ATTTTTA-3', and the antisense oligonucleotide is: 5'-AGCTTAAAAATCTCAACCGTATTCCATACTCTCTTGAAGTATGGAATACGGTT GAGAGGG. To generate shRNA duplexs, the sense and antisense oligonucleotides were synthesized (Qiagen) and annealed in the PCR thermocycler. Double stranded oligonucleotides were subsequently cloned into the pSUPERIOR-neo plasmid (OligoEngine, Seattle, WA), in the frame of the Bgffl and HindlU sites. The correct insertion of the double stranded oligonucleotides was screened by restriction enzyme digestion with EcoRI and HindlU and the inserts were confirmed by sequencing. To establish MMRU cells with stable expression of ELK shRNA (MMRU-shELK472), the plasmid was transfected into MMRU cells using Effectene transfection regeat (Qiagen) according to vendor's instructions. A non-silencing vector control was also generated (MMRU-shControl) by transfecting pSUPERIOR-neo plasmid into MMRU cells. At 24 h post transfection, the cells were split at an appropriate dilution into medium supplemented with 800 p,g/ml G418. Individual stable clones were selected and expanded. Clones were screen for ELK expression by western analysis. To obtain pure MMRU-shELK472 clones from single cell, selection was repeated for another round by limiting dilution method to ensure that the clones were expanded from single cell. All clones were subsequently maintained in medium supplemented with 400 pg/ml G418. 2.11 Western Blot Cells were washed with ice cold PBS, harvested by scraping on ice and pelleted by centrifugation at 1,000 g for 10 min. Cells were then lysed in NP-40 lysis buffer (1% 41 Nonidet P-40, 0.5% sodium deoxycholate, 50mM Hepes, pH 7.5, 150mM NaCl, 5mM sodium fluoride, and ImM sodium ortho vanadate) supplemented with protease inhibitor cocktail (Roche Diagnostics, Quebec, QC). Lysates were cleared by centrifugation at 12,000 g for 20 min at 4°C. Protein concentration was determined by Bradford method. 25 ug of whole cell lysate were resolved by SDS-PAGE and were electro-transferred onto polyvinylidene difluoride (PVDF) membrane (BioRad, Hercules, CA). The membrane was blocked with 5% skim milk for 1 h at room temperature before probing with primary antibody in 5% BSA-PBS solution overnight at 4°C. Blots were washed three times in TBS with 0.05% Tween 20 (TBS-T) for 5 min each followed by probing with horseradish peroxidase-conjugated anti-rabbit or anti-mouse secondary antibodies for 1 h at room temperature (Jackson ImmunoResearch, West Grove, PA). After washing the blot four times for 5 min each in TBS-T, protein expression was determined by enhanced chemoluminescence (GE Healthcare, Quebec, QC). The following primary antibodies were used: rabbit anti-ELK (Cell Signaling Technology, Danvers, MA), mouse anti-PTEN (Calbiochem, San Diego), rabbit anti-phospho-Ser473-AJct (Cell Signaling Technology), mouse anti-Akt (BD Biosciences, Mississauga, ON), and mouse anti-beta-actin (Sigma-Aldrich, Oakville, ON). 2.12 Cell Migration Assay Cell migration was determined by wound-healing assay. Cells were grown to confluent. A wound was made in the confluent monolayer by pressing a razor blade down on the plate and sliding across to mark the origin. The blade was moved to one side to remove part of the cell monolayer. The debris was removed by washing the monolayer twice with serum-free medium and the cells were cultured for an additional 42 24-36 h in serum-free medium in the presence or in the absence of 50 or 100 uM KP-392. After 24 h, cell migration was visualized using the Zeiss Axiovert 200 inverted microscope (Carl Zeiss Canada) and images were acquired with a Retiga 1300 cooled charge-coupled device camera (Qlmaging). The number of cells past the origin was counted in 5 separate microscopic fields and the results from the 5 fields were averaged (magnification: x40). 2.13 Cell Proliferation Assay Cells were seeded on to 24-well plates at low density. At 24, 48, 72 h intervals after seeding, plates were removed from the incubator and cell proliferation was determined by sulforhodamine B (SRB) staining. Briefly, cells were washed with PBS and fixed with 10% trichloroacetic acid for 1 h at 4°C. Residual acid was washed with tap water. The cells were then air-dyed and stained with 0.4% SRB (Sigma-Aldrich) dissolved in 1% acetic acid for 30 min at room temperature, followed by destaining with 1% acetic acid. For quantification, the bound dye was dissolved in 10 mM Tris (pH 10.5) and measured by reading absorbance at 550 nm. 2.14 Small GTPase Pull-down Assay The GST fusion protein of p21-binding domain of PAK1 (GST-PBD) and Rho-binding doman of Rhotekin (GST-RBD) were expressed in BL21 strain of Escherichia coli as described previously (Sander et al., 1998; Sorg et al., 2001). Briefly, overnight cultures were diluted 1:100 and grown at 37°C to an absorbance of 0.3. Expression of recombinant protein was induced by addition of O.lmM isopropylthiogalactoside for 2 h. Cells were harvested and resuspensed in 10 ml lysis buffer (50 mM Tris-Hcl (pH 8), 2 mM MgCl2, 0.2 mM Na2S20, 10% glycerol, 20% sucrose, 2 mM dithiothreitol) supplemented with EDTA-free protease inhibitor cocktail (Roche Diagnostics). Cells lysed by sonication on ice for eight 15 sec pulses and cooled for 1 min between sonications. Cell lysate were centrifuged at 4°C for 20 min at 45,000 g and the supernatant was incubated with glutathione Sepharose 4B beads (GE Healthcare). Protein bound to the beads was washed three times in lysis buffer and the amount of bound fusion protein was estimated using Coomassie-stained SDS gel. The recombinant proteins were kept frozen in -80°C. Activation of Rac, Rho, and Cdc42 was analysed by pulldown assays. MMRU cells were washed twice with ice-cold PBS and lysed for 5 min in 350 pi lysis buffer (50 mM Tris, pH 7.5, 150 mM NaCI, 1% Triton X-100, 10 mM MgCl2, 10% glycerol, EDTA-free protease inhibitor cocktail (Roche Diagnostics), 5 mM sodium fluoride, and 1 mM sodium orthovanadate). The samples were clarified by centrifugation at 12,000 g at 4°C for 15 min and equivalent amount of each cell lysate adjusted to 500 pi was incubated with 20 pg of GST-RBD beads at 4°C for 45 min to 1 h for capturing active Rho or GST-PBD beads for capturing active Rac and Cdc42. The beads were collected and were washed three times with lysis buffer and subsequently eluted with SDS sample buffer. Active Rac, Rho, and Cdc42 were detected by immunoblot with an anti-Racl antibody (Upstate, Lake Placid, NY), anti-RhoA antibody (Upstate), and anti-Cdc42 antibody (Upstate). 2.15 Cell Invasion Assay 24-well Transwell culture chambers coated with Matrigel was used to assay for cell invasion. The Polyethylene membranes (8.0 pm pore size) of the upper compartment were coated with 18 pi Matrigel (BD Biosciences) diluted to 5 mg/ml in serum-free 44 medium. 5 x 104 cells suspended in 250 pi serum-free medium was applied on the upper compartment in triplicate, and the lower compartment was filled with 750 pi of complete medium supplemented with 10% FBS. After 24 h of incubation, cells were fixed with 10%) trichloroacetic acid at 4°C for 1 h. Uninvaded cells on the upper surface of the filer were removed carefully with a cotton swab. Cells invaded to the lower side of the filter were stained with 0.2% crystal violet solution in 20% methanol for 2 h and the stained filters were photographed. The crystal violet dye retained on the filters was extracted with 30% acetic acid and cell invasion was quantitative measured by reading the absorbance colorimetrically at 590 nm. 2.16 Soft Agar Assay Melanoma cells growing in soft agar were performed to study the anchorage-independent growth. 35 mm gridded culture plates were first layered with 0.5% noble agar (Sigma-Aldrich) diluted in complete medium supplemented with 10% FBS. 1.3 x 104 cells were suspended in 1 ml of 0.3% agar in 10% FBS-supplemented complete media and were plated on top of the bottom agar. Plates were maintained in a humidified chamber at 37°C with 5% C0 2 for 15 days and were photographed under the inverted Zeiss Axiovert 200 microscope at 320x magnification (Carl Zeiss). Colonies with more than 30 cells or greater than 50 um were counted within a total of 21 different square grids. Plates were set up in triplicate and the results were averaged. 2.17 Melanoma Xenograft Tumors were induced by injecting 4 x 106 melanoma cells subcutaneously into the right and left flanks of 12-week-old male severe combined immunodeficient (SCED) mice. The control group comprised of MMRU melanoma cells stably transfected with 45 shRNA empty vector injected to the left flanks of SCUD mice and the right flank was injected with clone 21 of ILK shRNA stably transfected MMRU cells. Growing tumors were measured twice weekly using calipers. Tumor volumes were calculated according to the following formula: Volume = Length x Width2 x 71 / 6 (Tomayko and Reynolds, 1989). Experiments were stopped when the tumor burdens of the control group became excessive. 46 2.18 References Dai, D.L., Makretsov, N., Campos, E.I., Huang, C , Zhou, Y., Huntsman, D., Martinka, M. and Li, G. (2003) Increased expression of integrin-linked kinase is correlated with melanoma progression and poor patient survival. Clin Cancer Res, 9, 4409-4414. Marghoob, A.A., Koenig, K., Bittencourt, F.V., Kopf, A.W. and Bart, R.S. (2000) Breslow thickness and clark level in melanoma: support for including level in pathology reports and in American Joint Committee on Cancer Staging. Cancer, 88, 589-595. Persad, S., Attwell, S., Gray, V., Delcommenne, M., Troussard, A., Sanghera, J. and Dedhar, S. (2000) Inhibition of integrin-linked kinase (ILK) suppresses activation of protein kinase B/Akt and induces cell cycle arrest and apoptosis of PTEN-mutant prostate cancer cells. Proc Natl Acad Sci USA, 97, 3207-3212. Sander, E.E., van Delft, S., ten Klooster, J.P., Reid, T., van der Kammen, R.A., Michiels, F. and Collard, J.G. (1998) Matrix-dependent Tiaml/Rac signaling in epithelial cells promotes either cell-cell adhesion or cell migration and is regulated by phosphatidylinositol 3-kinase. J Cell Biol, 143, 1385-1398. Sorg, I., Goehring, U.M., Aktories, K. and Schmidt, G. (2001) Recombinant Yersinia YopT leads to uncoupling of RhoA-effector interaction. Infect Immun, 69, 7535-7543. Tomayko, M.M. and Reynolds, CP. (1989) Determination of subcutaneous tumor size in athymic (nude) mice. Cancer Chemother Pharmacol, 24, 148-154. Troussard, A.A., Mawji, N.M., Ong, C , Mui, A., St -Arnaud, R. and Dedhar, S. (2003) Conditional knock-out of integrin-linked kinase demonstrates an essential role in protein kinase B/Akt activation. JBiol Chem, 278, 22374-22378. 47 CHAPTER 3. XAF1 EXPRESSION IS SIGNIFICANTLY REDUCED IN HUMAN MELANOMA 1 3.1 Rationale and Hypothesis One of the obstacles in melanoma treatment is its notorious resistance to conventional chemotherapy. It appears that the low therapeutic efficacy is related to the inability to induce apoptosis probably due to defective apoptotic machinery (Soengas and Lowe, 2003). The ability of anticancer drug to trigger caspases activation appears to be a major determinant of sensitivity or resistance to the cytotoxic agents. Transformed caspase 3"'" mouse embryonic fibroblasts (MEFs) displayed reduced chemotherapy-induced apoptosis (Woo et al., 1998). Caspase 9'1' MEFs and embryonic stem (ES) cells were also resistant to apoptosis induced by UV, y-irradiation, doxorubicin, and etoposide (Hakem et al., 1998; Kuida et al., 1998). Likewise, Apaf-1"'" ES cells and embryonic fibroblasts show profound resistance to most proapoptotic stimuli (Yoshida et al., 1998). Therefore, inhibition of caspase activity or activation is an important factor in chemoresistance. However, in the cell there exists additional layers of control to allow fine tuning of apoptosis pathway such that the cell commits suicide only as the last resort. The IAPs, particularly XIAP, can suppress cell death by inhibiting the activity of caspases via their BIR domain. The IAPs, in turn, are antagonized by other mitochondrial proteins such as Smac and HtrA2 (Du et al., 2000; Faccio et al., 2000; Gray et al., 2000; Verhagen et al., 2000). Recently, another negative regulator of XIAP termed XAF1 has been identified and is able to reverse the protection mediated by XIAP 1 A version of this chapter has been published. Ng, K.C., Campos, E.I., Martinka, M. and Li, G. (2004) XAF1 Expression is Significantly Reduced in Human Melanoma. J Invest Dermatol. 123(6): 1127-34. 48 (Liston et al., 2001). Intriguingly, XAFl expression is missing or reduced in many cancers (Fong et al., 2000). It is well known that altered expression or mutation of genes encoding key components of apoptosis can provide cancer cells with both an intrinsic survival advantage and inherent resistance to chemotherapeutic agents. Thus, the genotype and the expression profile of proteins involved in apoptosis are one of the key determinants of clinical outcome and provide a basis for development of target-specific therapy. We, therefore, investigate the expression of XAFl in primary melanoma at different stage using tissue microarray technology. In the present study, we propose that XAFl protein expression is reduced in primary melanoma tissues and hypothesize that reduced XAFl expression is associated with melanoma progression and poor patient survival. 3.2 Results 3.2.1 Reduced XAFl mRNA Expression in Melanoma Cell Lines Using NCI 60 cell line panel, previous study has shown that XAFl RNA expression was lost in majority of cancer cell lines (Fong et al., 2000). To determine the expression level of XAFl in melanoma, we characterized XAFl mRNA expression in 16 melanoma cell lines using RT-PCR. XAFl mRNA expression was very weak or undetectable in 9 melanoma cell lines (Fig. 3.1). Six melanoma cell lines had a reduced expression of XAFl transcript and only one cell line (Sk-mel-24) expressed high level of XAFl comparable to the normal human epidermal melanocyte. Of the four cell lines that showed detectable expression of XAFl mRNA (RPEP, KZ-13, Sk-mel-24, and melanocyte), we also detected two larger bands of much weaker intensity, with the size of 49 the PCR products falling between 400 bp and 500 bp. We believed one of these larger PCR products is the splice variant XAF1C that has been described by Yin et al (2006). We then determined the XAF1 protein expression in 14 melanoma cell lines and normal human melanocyte. The XAF1 antibody (a gift from Dr. Liston) specifically detected a major band of -35 kDa, which corresponds to the estimated size of XAF1A (Fig. 3.2a, b). A weaker band of ~30 kDa can also be detected and is likely the protein product of other XAF1 isoforms (Fig. 3.2b). However, we were unable to detect the endogenous expression of XAF1 protein in all melanoma cell lines as well as in normal human epithedermal melanocyte where it has been shown above to have high XAF1 mRNA expression. Since the majority of XAF1 protein has previously been demonstrated to reside in nucleus (Liston et al., 2001), our inability to detect endogenous XAF1 expression was likely due to the NP-40 lysis buffer that we commonly used for cell lysis was inefficient for the disruption of cell nucleus. To determine the subcellular localization of the endogenous XAF1, we therefore performed indirect immunofluorescence. In normal melanocyte, high level of XAF1 protein can be detected in both the cell body and the projection, with majority of endogenous XAF1 densely packed in the nucleus (Fig. 3.3). In melanoma cells, XAF1 protein can also be visualized in both nuclear and cytoplasm, but the staining intensity was significantly reduced in both compartments. Although our data agreed with previous studies that XAF1 is predominantly reside in nucleus and that our inability to detect endogenous expression of XAF1 from western blot could be due to the inefficient lysis of cell nucleus, please note that our results cannot exclude the possibility that the fluorescence signal that we see could be due the autofluorescence. 50 Figure 3.1 Expression of XAFl transcript in melanoma cell lines. RT-PCR was performed and the 324 bp PCR products were resolved on a 2% agarose gel. GAPDH was used as an endogenous control. PCR products amplified from 200 ng of XAFl expression plasmid served as a positive control. For the negative control, RT-PCR was performed in the same manner except RNA was omitted from the reaction. 51 Figure 3.2 Protein expression of XAF1. (a) MMRU overexpressing increasing amount of XAF1 showed a dose-dependent increase of XAF1 protein expression corresponding to the predicted size of ~35 kDa. (b) A western blot comparing the endogenous expression of XAF1 in 14 melanoma cell lines and normal human epidermal melanocyte (NHEM). MMRU cells overexpressing XAF1 was used as positive control (MMRU-XAF1). < >' .V- / J f # -^ 4^ <r J * J ? Jr & <£? «*f Ai A} M - X A F 1 A P-actin 52 Figure 3.3 Nuclear and cytoplasmic distribution of XAFl in melanoma cell lines and melanocytes. Subcellular localization of XAFl was visualized by performing indirect immunofluorescence. Cells were stained using a rabbit anti-XAFl antibody and the nuclei were stained with Hoechst 33258. Magnification, x400. X A F 1 DNA 3.2.2 Clinicopathological Features To determine whether aberrant XAFl expression also occurs in primary melanoma, we evaluated XAFl protein expression in a tissue microarray containing 87 primary melanomas using immunohistochemical method. Of the 70 cases which were informative, there were 38 male and 32 female. The mean age of the patients was 56.7 year with the age ranged from 21 to 92. Breslow thickness, which measures from the top layer of epidermis to the deepest point of tumor penetration, was used as the criteria for melanoma staging (Marghoob et al., 2000). Among the 70 informative cases, 16 were <0.75 mm, 39 were 0.76-1.5 mm, 9 were 1.51-4.0 mm, and 6 were >4.0 mm (Table 3.1). Superficial spreading melanoma accounted for 32 cases, lentigo maligna melanoma accounted for 11 cases, and the remaining 27 cases consisted of nodular melanoma, acrolentigous melanoma, and desmoplastic melanoma. Majority of the melanomas were isolated from sun-protected sites (56 cases; trunk, arm leg, and feet) and 14 cases were obtained from sun-exposed sites (head and neck). 54 Table 3.1 X A F 1 expression and clinicopathological characteristics. No significant association was found between X A F 1 staining intensity and other clinical characteristics including gender, age, location of tumors and histological subtype. Overall intensity of XAF1 staining 1+ 2+ 3+ total p value Age <55 12 (35%) 14 (41%) 8 (24%) 34 /»0.05 >55 11 (31%) 17 (47%) 8 (22%) 36 Gender Male 11 (29%) 17 (45%) 10 (26%) 38 p>0.05 Female 12 (38%) 14 (44%) 6 (19%) 32 Tumor thickness (mm) <0.75 6 (38%) 5 (31%) 5 (31%) 16 p>0.05c 0.76-1.5 15 (38%) 17 (44%) 7 (18%) 39 1.51-4.0 1 (11%) 7 (78%) 1 (11%) 9 >4.0 1 (17%) 2 (33%) 3 (50%) 6 Tumor subtype3 SSM 12 (38%) 11 (34%) 9 (28%) 32 p>0.05d LMM 2 (18%) 8 (73%) 1 (9%) 11 Other 9 (33%) 12 (44%) 6 (22%) 27 Siteb Sun-exposed 5 (36%) 7 (50%) 2 (14%) 14 p>0.05d Sun-protected 18 (32%) 24 (43%) 14 (25%) 56 a SSM, superficial spreading melanoma; LMM, lentigo maligna melanoma; Other includes desmoplastic melanoma, acrolentigous melanoma, and nodular melanoma. b Sun-protected sites: trunk, arm, leg, and feet. Sun-exposed sites: head and neck. c Chi-square test using contingency table for low (1+), and moderate to high XAF1 expression (2+, 3+) against thickness <1.5 mm and >1.5 mm. d Chi-square test for low (1+) versus moderate to high XAF1 expression (2+, 3+). 55 3.2.3 Reduction of X A F l Protein Expression in Primary Melanoma To determine whether XAFl is specifically reduced in melanoma, we set out to compare the overall intensity of XAFl staining between the tumor and benign nevi. Among the primary melanomas, XAFl was weakly expressed in 23 cases (32.9%), moderately expressed in 31 cases (44.3%) and highly expressed in 16 cases (22.9%) (Table 3.2). In contrast, 37.5% of the informative nevi cases (15/40) showed a high expression of XAFl, 50% of the cases (20/40) showed a moderate expression, and only 12.5% of the nevi (5/40) showed a weak expression. None of the tumor or nevi were negative for XAFl. The reduction of XAFl expression in primary melanoma was found to be statistically significant (p < 0.001, %2 test) (Fig. 3.4). As it is believed that XAFl-mediated translocation of XIAP from the cytoplasm to nucleus functions to neutralize the antiapoptotic action of XIAP (Liston et al., 2001), we also examined the percentage of cells showing positive XAFl staining in the nucleus and cytoplasm for both nevi and tumor cells. In 81.4% (57/70) of all melanoma cases, XAFl nuclear staining was observed in less than 50% of the cells. On the other hand, most of the normal nevi tissues showed nuclear immunoreactivity in the majority of cells (33/40, 82.5%) (Table 3.2). On average, nuclear XAFl staining was seen in 28.1%> of melanoma cells, which is significantly lower than 68.4% seen in the nevi tissue (p < 0.001, Mann-Whitney test) (Fig. 3.5a). Similar to nuclear staining, XAFl cytoplasmic staining in melanoma tissues was missing in the majority of melanoma cells as 33 out of the 70 melanoma cases (47%) were positive for XAFl in less than 50% of the cells; in contrast, most of the 40 nevi cases (36/40, 90%) were strongly positive for XAFl. Similar to the nuclear reduction, cytoplasmic staining was also found to be significantly 56 reduced as we observed that cytoplasmic XAF1 staining was seen in 54.2% of melanoma cells on average, which is significantly lower than 83.3% in the nevi tissue (p < 0.001, Mann-Whitney test) (Fig. 3.5b). Although the reduction in cytoplasmic staining is prevalent in tumor tissues, cytoplasmic reduction of XAF1 was not as pronounced compared to the nuclear reduction of XAF1 and there were still a substantial portion of cells containing XAF1 protein in the cytoplasm (54.2%). Table 3.2 Distribution of XAF1 expression in normal nevi and primary melanomas. Normal Nevi Primary Melanoma Intensity* 1+ 5 (13%) 23 (33%) 2+ 20 (50%) 31 (44%) 3+ 15 (38%) 16 (23%) Nuclear positive* < 50% 7 (18%) 57 (81%) > 50% 33 (83%) 13 (19%) Cytoplasmic positive* < 50% 4 (10%) 33 (47%) > 50% 36 (90%) 37 (53%) Total 40 70 V< 0.001, x2 test 57 Figure 3.4 XAF1 is significantly reduced in melanoma tissues compared to benign nevi. (a) Normal nevi showing strong XAF1 expression (3+). (b-d) Melanoma showing weak XAF1 expression (1+), moderate XAF1 expression (2+), and strong XAF1 expression (3+) respectively. Magnification, x400. (e) Statistical analysis showing significantly reduced XAF1 expression in tumor tissues compared to benign nevi. p < 0.001, %2 test. Nevi Tumor 58 Figure 3 . 5 XAFl expression is reduced in both nucleus and cytoplasm of melanoma cells. The percentage of tumor cells containing nuclear staining (a) and cytoplasmic staining (b) are significantly less compared to normal nevi. p < 0.001 for both, Mann-Whitney test. Bar and number indicate the mean of the number of cells showing nuclear or cytoplasmic staining. 100H j? 75 'E CO a> u 3 Z Ul c c 'Si CO o I w ro a o O 50 25 0 100 75 50 25 0 A » , A " A » J^U 68.4 A * * A • A » » i' " i A A A A A A •••• 28.1 •••• ••••• Nevi A £ A A A A A A A A A A A A A A £ A A A A A Primary tumor • •• | 83.3 A A A • A A A • A • ••• • •• • •• • •• • Nevi Primary tumor 59 3.2.4 XAF1 Expression in Melanoma Progression and Survival The clinical outcome of melanoma patients is strongly influenced by the depth of invasion. When we examined XAF1 staining intensity at different tumor thicknesses, we found no association existed between XAF1 intensity and tumor thickness (p = 0.119, x 2 )-Interestingly, when we examined the percentage of cells positive for nuclear staining at different tumor thicknesses, we found that thicker tumor tended to have a greater reduction of nuclear XAF1 expression, although the difference was not statistical significant (p = 0.156, Kruskal-Wallis test) (Fig. 3.6). Analysis of XAF1 expression and other clinical characteristics including gender, age, location of tumors and histological subtype did not reveal any significant association (Table 3.1). Since the XAF1 expression was reduced in majority of melanoma tumors, we plotted Kaplan-Meier survival curves to determine if any correlation exists between XAF1 expression and patient outcome. Our analysis showed that weakly and moderately stained tumors did not yield a poorer 5-year overall survival when compared to tumor biopsies of strong staining (p = 0.889, log-rank test) (Fig. 3.7a). In addition, the 5-year overall survival between tumors samples showing high nuclear positivity and low nuclear positivity did not significantly differ (p = 0.896, log-rank test) (Fig. 3.7b). 60 Figure 3.6 XAFl nuclear expression did not correlate with melanoma thickness, p = 0.156, Kruskal-Wallis test). Bar and number indicate the mean of the number of cells showing nuclear or cytoplasmic staining. C P 80n 1 60H in o o 2 20-u. : 37.4% 25.7% 23.0% <0.75 0.76-4 >4 Tumor thickness (mm) 61 Figure 3.7 Correlation between XAFl expression and 5-year patient survival. Neither XAFl staining intensity (a) nor the XAFl nuclear positivity (b) correlated with 5-year overall patient survival, p > 0.05 for both, log-rank test. 100H 9<H > E 3 </) E O 80 -—1+ , 2+ 3+ 70^ 10 40 20 30 Time (month) 50 60 100-> Surv 90-Cum. 80-70-10 —•£50% — >50% 20 30 40 50 60 Time (month) 62 3.3 Discussion In the present study, we sought to determine the role of XAFl in the development and progression of malignant melanoma. We started by analyzing the XAFl mRNA expression level in melanoma cell lines and found that XAFl transcript was either absent or reduced in 15 of the 16 melanoma cell lines examined (Fig. 3.1). In contrast, the level of XAFl mRNA in normal human melanocyte was considerably higher. Using the TMA technology, we for the first time found a significant reduction of the XAFl expression in primary melanomas (Fig. 3.4). In addition, XAFl reduction occurred both in the nucleus and cytoplasm of tumor cells (Fig. 3.5a, b). Our data were consistent with the results reported by other groups. Several studies have shown XAFl mRNA expression to be drastically reduced or undetectable in many different cancer cell lines (Byun et al., 2003; Chung et al., 2007; Fong et al., 2000; Lee et al., 2006; Ma et al., 2005). Some recent studies had also explored the level of XAFl expression in tumor tissue samples. In particular, the mRNA expression of XAFl was substantially lower in human gastric cancer, colorectal cancer, renal cell carcinoma, and bladder transitional cell carcinoma compared to the noncancerous counterparts (Byun et al., 2003; Chung et al., 2007; Lee et al., 2006; Ma et al., 2005; Shibata et al., 2007). The differential expression of XAFl in benign nevi and melanoma tissues we reported here, together with evidences from other studies, strongly implicates that XAFl plays a role in the malignant transformation process. Despite the observation that XAFl expression was markedly reduced in melanoma, our results did not show a statistically significant correlation between reduction of XAFl nuclear expression and tumor thickness (Fig. 3.6). In addition, 63 reduction of XAF1 in melanoma did not associate with poorer 5-year patient survival (Fig. 3.7a, b). This is in contrast to some studies done on gastric, hepatocellular, and renal cell carcinoma, in which they found a significantly lower expression of XAF1 in high grade tumors compared with tumors of early stage, thus suggesting that loss of XAF1 expression correlates with tumor progression (Byun et al., 2003; Lee et al., 2006; Sakemi et al., 2007; Shibata et al., 2007). More intriguingly, Kempkensteffen et al (2007) found that low XAF1 expression levels increased the relative risk of tumor recurrence and tumor-related death of renal cell carcinoma by 6.6 and 3.4 respectively, according to multivariable-adjusted Cox regression analyses. The predictive value of XAF1 is further supported by survival outcome of patients in that both the recurrence-free and disease-specific survivals were significantly decreased in patients with low XAF1 expression. The discrepancy between our results and that of others can be partly explained by our relatively small sample size on thick melanoma. Our new array, with the inclusion of twenty T4 grade primary melanomas and 53 metastatic cases, will allow us to determine whether the loss of XAF1 correlates with melanoma progression and also addresses the role of XAF1 in contributing to metastasis. On the other hand, the reduction of XAF1 in melanoma could be an early event and may be crucial for the initiation of melanoma. In addition, we speculate that due to the complexity of apoptotic pathways, a change in cell behavior will probably require multiple levels of dysregulation. Thus, the reduction of XAF1 expression in primary melanomas is likely part of the many alternations acquired during melanoma progression or serves to prime for other malignant events that seriously hamper patient survival. Beside XAF1, other defects in the apoptotic pathway have been implicated in melanoma pathogenesis. When compared to melanocyte cells, melanoma 64 cells differentially express elevated levels of antiapoptotic molecules including members of Bcl-2 family (Bcl-XL and Mcl-1), and the IAPs (XIAP and livin) (Bowen et al., 2003). On the other hand, the proapoptotic Bcl-2 member, Bax and Bim, was found to be underexpressed in melanoma cells (Bowen et al., 2003; Dai et al., 2007). Interestingly, primary cultures of cells from melanoma patient expressing high level of the LAP member livin were resistant to etoposide (Nachmias et al., 2003). Patients that died or had disease progression while on chemotherapy showed intermediate to high levels of livin. In contrast, disease-free patients were livin negative, while chemoresponsive patients either showed no expression or weak expression of livin (Nachmias et al., 2003). Another IAP protein, Survivin, was also found to be strongly expressed in invasive melanomas and metastatic lesions, but was undetectable in normal melanocytes (Bowen et al., 2003; Grossman et al., 1999). The role of Survivin on melanoma development has been illustrated by the reduction of tumorigenicity in melanoma xenograft of topotecan treated mice when subjected to ribozyme-mediated downregulation of Survivin (Pennati et al., 2004). Due to the complexity of regulatory pathways in the apoptosis process, further studies on the expression profiles of pro- and anti-apoptotic proteins in the same set of melanoma biopsies may provide useful information on the prognostic value of these proteins. Many studies have attributed the loss of XAFl expression to the abnormal hypermethylation of XAFl promoter. The promoter region and exon 1 of XAFl gene encompassing -109 to +164 nt contains a cluster of 8 CpG sites, of which the sites at the -2nd, -1st, and +3rd position are the most important for transcription activation and are targeted for methylation (Zou et al., 2006). Hypermethylation of XAFl promoter was 65 highly prevalent in many cancers versus normal or benign tissues and the degree of methylation was inversely correlated -with XAF1 transcript levels (Byun et al., 2003; Lee et al., 2006; Micali et al., 2007; Zou et al., 2006). Beside promoter methylation, a recent study also identified XAF1 as a target of loss of heterozygosity (LOH) (Chung et al., 2007). LOH of XAF1 gene was more frequent in advance colorectal tumors. In addition, the remaining alleles in LOH tumors exhibited frequent methylation. Thus, biallelic inactivation ofXAFl via genetic and epigenetic mechanisms may be necessary to inactivate the tumor suppressive function of XAF1 in the course of tumor development and progression. XAF1 promoter activity and its transcription are apparently subjected to multiple controls. A possible crosstalk between MAP kinase signaling pathway and XAF1 has been demonstrated, in that inhibition of ERK1/2 induced XAF1 expression and overexpression of XAF1 in turn sensitized U0126-induced apoptosis (Yu et al., 2007). Furthermore, XAF1 expression was downregulated by stress stimuli such as heat, oxidation, and hypo-osmolarity and the repression of XAF1 transcription was associated with the binding of heat-shock transcription factor 1 to the putative heat-shock element within the 5'-flanking region ofXAFl gene (Wang et al., 2006a). Since it is well known that cancer cells encounter increased levels of stress, the adaptive response to suppress stress-induced apoptosis through downregulation of tumor suppressor genes such as XAF1 might confer tumor cells survival advantage in tumorigenesis. In addition to the negative regulation on XAF1 expression, XAF1 expression was induced by tumor necrosis factor-a (TNF-a) in a mechanism dependent on nuclear translocation and activation of N F - K B (Straszewski-Chavez et al., 2007). Furthermore, XAF1 was found to 66 be positively modulated by interferon (EFN) and all-trans retinoic acid (Leaman et al., 2003; Wang et al., 2006b). This upregulation of XAFl promoter activity is mediated by the binding of ENF-regulatory factor-1 to the corresponding element on XAFl promoter (Wang et al., 2006b). Demethylation of XAFl promoter may also contribute to the EFN-induced XAFl expression but unlikely to be the sole mechanism (Micali et al., 2007). Of particular interest is the finding that XAFl sensitize melanoma cells to TRATL-induced apoptosis (Leaman et al., 2002). JJSfFs have been effective for treating human malignancies due to its potent antitumor effects on cellular proliferation, differentiation and immunomodulatory responses by inducing the expression of LFN-stimulated genes (ISGs). Both XAFl and TRAIL have been identified to be ISG (Leaman et al., 2003). However, substantial variability has been observed on the overall sensitivity of tumors cells to the antiproliferative or apoptotic effects of EFNs. In particular, apoptosis is defective in many cell lines that show TRAIL induction by EFN or when treated with TRAIL as a single agent (Chawla-Sarkar et al., 2002; Leaman et al., 2002). XAFl induction appears to be a critical determinant on the sensitivity of TRAEL-induced apoptosis since XAFl protein expression greatly enhanced TRAEL or EFN-induced apoptosis in a synergistic fashion (Leaman et al., 2002). Our finding that the protein expression of XAFl is reduced in majority of melanoma tissues coupled with the failure to induce XAFl expression in response to EFN treatment may negatively impact the effectiveness of using EFN-a2 as an adjuvant therapy for advance melanoma and could possibly explain for the lack of improvement on overall survival in the past randomized trials (Eggermont and Punt, 2003). 67 Since the initial discovery of XAF1, a total of five isoforms have been identified. Full length XAF1 (XAF1 A) possesses an N-terminal TRAF type zinc finger domain and a C-terminal region. The other four variants (XAF1B, XAF1C, XAF1D, and XAF1E) are truncated at the C-terminal region or at the TRAF type zinc finger domain or both (Fig. 3.8). The existence of multiple XAF1 splice variants led to the speculation that they may function differently from XAF1A or act in a dominant-negative fashion. Many speculations about the functions of the truncated variants came from an early study that an artificially truncated form of XAF1 lacking the C-terminus but retaining the N-terminal zinc finger domain acted in dominant negative manner by blocking the ability of IFN-P to sensitize cells to TRAIL-induced apoptosis (Leaman et al., 2002). However, this artificially truncated form bears little resemblance to the physiological splice variants. Another study has identified XAF1A and XAF1C mRNA were differentially expressed in cancer cell lines and non-malignant cell lines (Yin et al., 2006). Therefore, the authors believed that XAF1C may have an antiapoptotic function and suggested that the ratio between XAF1A and XAF1C may be important in determining the overall effect on apoptosis. However, the biochemical data on the function of the XAF1C variant was lacking. Interestingly, treating prostate cancer cell lines with demethylating agent resulted in a splicing switch to express the full-length transcript that was missing before the treatment, suggesting that alternative splicing is controlled by epigenetic mechanism which allows differential regulations of the functions of these variants during tumor progression and pathogenesis (Fang et al., 2006). Our analysis of XAF1 protein expression utilized the rabbit polyclonal XAF1 antibody generated from GST-XAF1 as the immunogen (a gift from Dr. Liston) and therefore our antibody could not be able to 68 distinguish the expression of different isoforms. However, a recent study by Chung et al (2007) has identified a concomitant reduced mRNA expression of all five XAFl variants in colorectal cancer tissues and cell lines. Thus, it appears that there is a global downregulation of XAFl during tumorigenesis. The same study has also found that all five XAFl isoforms may have tumor suppressive ability, albeit of different degree, due to the observation that overexpression of each isoform was able to suppress colony formation in soft agar and increase the sensitivity to 5-FU-induced apoptosis (Chung et al., 2007). In our analysis of XAFl mRNA expression, we have designed a pair of primers that would allow us to determine the mRNA expression of both XAFl A and XAF1C (Fig. 3.8). We believe that the 400-500 bp PCR products as shown in Fig. 3.1 were likely the transcripts of XAF1C. If this is confirmed to be true, then the mRNA expression of XAFl C was also significantly reduced or missing in melanoma cell lines and its expression level was even lower than that of XAFl A. This would support the results from Chung et al (2007) that the splice variants of XAFl are downregulated during tumorigenesis and they may all exhibit tumor suppressive functions. Previous biochemical study revealed that XAFl was able to reverse the anti-caspase activity of XIAP (Liston et al., 2001). The importance of XAFl in regulating apoptosis has been demonstrated by the observations that overexpression or restoration of XAFl expression greatly enhanced apoptosis by different stimuli (Byun et al., 2003; Lee et al., 2006; Liston et al., 2001; Reu et al., 2006). Mice inoculated with XAFl stable transfectant together with all-trans retinoic acid treatment, which stimulates XAFl expression, dramatically suppressed the growth of or eliminated the tumors (Wang et al., 2006b). Strikingly, a conditional-replicative adenovirus carrying XAFl gene and a 69 deletion of E1B 55-kD gene was able to regress established tumors and caused a complete eradication of tumors in four of eight mice (Qi et al., 2007). This antitumor effect was owing to both the proapoptotic ability of XAF1 and the tumor selective replication and killing induced by the virus. Since the decision of whether a cell undergoes apoptosis depends on the relative balance between pro- and anti-apoptotic regulators, tumor-specific reduction of XAF1 may lessen the check on the prosurvival members of the apoptotic pathway (eg. XIAP) and potentially tilt the balance toward enhanced cell survival. The loss of XAF1 expression may also increase the threshold necessary for effective killing of cancerous cells by chemotherapeutic agents, and together with other factors, may contribute to the chemoresistance in melanoma. In support of this, siRNA-mediated knockdown of XAF1 expression attenuated the apoptotic response to EFN or chemotherapeutic drugs (Lee et al., 2006; Reu et al., 2006). Our immunofluorescent staining of normal melanocytes and melanoma cells shows that XAF1 predominantly resides in the nucleus, although caution need to be taken when interpreting our data that the fluorescence signal could be due to autofluorescence. Tissue staining by immunohistology also supports the nuclear localization of XAF1 in benign nevi, but the expression was lost in the malignant process (Fig. 3.4). Liston et al (2001) has shown that XAF1 overexpression could alter the localization of XIAP from the cytoplasm to the nucleus and speculated that the neutralization of XIAP-mediated anti-caspase activity by XAF1 was due to XIAP being sequestered away from the cytoplasm, thereby preventing XIAP from binding to caspases and allowing apoptosis to proceed unimpeded in response to apoptotic stimuli. However, many studies since then failed to show any nuclear redistribution of XIAP (Chung et al., 2007; Lee et al., 2006; 70 Wang et al., 2006b; Xia et al., 2006), thus raising the suspicion that observations from the initial study might have been an artifact of XAFl and/or XIAP overexpression and that the mechanism by which XAFl induces apoptosis may be independent of caspases or XIAP. Interestingly, inducing expression of XAFl in fibroblast derived from XIAP deficient mice was still able to increase sensitivity to apoptotic response of TNF-a (Xia et al., 2006). The apoptosis-sensitizing effect of XAFl in XIAP"7" HCT116 cells was also comparable to that detected in XIAP positive cells, but the proapoptotic effect was not observed if Smac/DIABLO was overexpressed in XIAP deficient cells (Chung et al., 2007). Therefore, XAFl may exert a XIAP-independent proapoptotic function. An analysis of the localization of XAFl in the first trimester trophoblast cells that was undergoing apoptosis could detect the presence of XAFl in the mitochondrial fraction, with XAFl expression peaked at around 48 h post-transfection (Straszewski-Chavez et al., 2007). The translocation of XAFl was accompanied by the release of cytochrome c and Bax. Overexpression of Bcl-2 inhibited all apoptosis triggered by XAFl, suggesting that the apoptosis induced by XAFl requires engagement of mitochondrial apoptotic pathway (Xia et al., 2006). In supporting this, XAFl expression led to the accumulation of p53 and a dose-dependent induction of p53-target gene expression includingp21Wafl, PUMA and NOXA (Lee et al., 2006). This XAFl-mediated event relied on the expression of functional p53 as the proapoptotic effect of XAFl was ablated in p53-null prostate cell lines or in cell line that expressed dominant-negative p53. Thus, XAFl-mediated engagement of mitochondrial apoptotic pathway may be due to the ability of BH3-only proteins such as Puma in neutralizing the activity of prosurvival Bcl-2 members or activating Bax (Karst and Li, 2007). In addition, a recent study by Arora et al (2007) has 71 found that XAF1 promoted association of Survivin with XIAP by forming a ternary complex and reversing the stabilizing effects of Survivin on XIAP. As a result, Survivin is degraded owing to the RING E3 ligase activity of XIAP. Thus, XAF1 appears to exert the proapoptotic effect through multiple mechanisms. It will be interesting to see whether other XAF1 isoforms possess the same function. In summary, our study has demonstrated that XAF1 expression is dramatically reduced in melanoma. Our study prompts for further characterization of the functional role of XAF1 in the chemoresistance and progression of melanoma. 72 Figure 3.8 The schematic structures of XAFl gene and alternate splice variants. The XAFl gene has 8 exons (gray boxes). The forward and reverse primers for RT-PCR analysis were also indicated. CDS, protein coding sequences. Forward Backward XAF1 Gene - T H 2 inn * I—H—I 5 h XAF1D XAF1E ATG ± XAF1A -fi~H 2 H 3 |-| 4 \ -X4F*B -fni 2 ~i—[ •EI •EI >-C 7 h-TAG C D S 6 | 7 TAG 6 | 7 6 | 7 TAA * ^ * i 7 TAA 6 | 7 h- 906 nt - 495 nt - 426 nt r- 369 nt 73 3.4 References Arora, V., Cheung, H.H., Plenchette, S., Micali, O.C., Liston, P. and Korneluk, R.G. (2007) Degradation of survivin by the XIAP-XAF1 complex. J Biol Chem. Bowen, A.R., Hanks, A.N., Allen, S.M., Alexander, A., Diedrich, MJ. and Grossman, D. (2003) Apoptosis regulators and responses in human melanocyte and keratinocytic cells. J Invest Dermatol, 120, 48-55. Byun, D.S., Cho, K., Ryu, B.K., Lee, M.G., Kang, MJ., Kim, H.R. and Chi, S.G. (2003) Hypermethylation of XIAP-associated factor 1, a putative tumor suppressor gene from the 17pl3.2 locus, in human gastric adenocarcinomas. Cancer Res, 63, 7068-7075. Chawla-Sarkar, M., Leaman, D.W., Jacobs, B.S. and Borden, E.C. (2002) IFN-beta pretreatment sensitizes human melanoma cells to TRAIL/Apo2 ligand-induced apoptosis. J Immunol, 169, 847-855. Chung, S.K., Lee, M.G., Ryu, B.K., Lee, J.H., Han, J., Byun, D.S., Chae, K.S., Lee, K.Y., Jang, J.Y., Kim, H.J. and Chi, S.G. (2007) Frequent alteration of XAF1 in human colorectal cancers: implication for tumor cell resistance to apoptotic stresses. Gastroenterology, 132, 2459-2477. Dai, D.L., Wang, Y., Liu, M., Martinka, M. and Li, G. (2007) Bim Expression Is Reduced in Human Cutaneous Melanomas. J Invest Dermatol. Du, C, Fang, M., Li, Y., Li, L. and Wang, X. (2000) Smac, a mitochondrial protein that promotes cytochrome c-dependent caspase activation by eliminating LAP inhibition. Cell, 102, 33-42. Eggermont, A.M. and Punt, C J. (2003) Does adjuvant systemic therapy with interferon-alpha for stage 11-111 melanoma prolong survival? Am J Clin Dermatol, 4, 531-536. Faccio, L., Fusco, C , Chen, A., Martinotti, S., Bonventre, J.V. and Zervos, A.S. (2000) Characterization of a novel human serine protease that has extensive homology to bacterial heat shock endoprotease HtrA and is regulated by kidney ischemia. JBiol Chem, 275, 2581-2588. 74 Fang, X., Liu, Z., Fan, Y., Zheng, C, Nilson, S., Egevad, L., Ekman, P. and Xu, D. (2006) Switch to full-length of XAF1 mRNA expression in prostate cancer cells by the DNA methylation inhibitor. Int J Cancer, 118, 2485-2489. Fong, W.G., Liston, P., Rajcan-Separovic, E., St Jean, M., Craig, C. and Korneluk, R.G. (2000) Expression and genetic analysis of XIAP-associated factor 1 (XAF1) in cancer cell lines. Genomics, 70, 113-122. Gray, C.W., Ward, R.V., Karran, E., Turconi, S., Rowles, A., Viglienghi, D., Southan, C, Barton, A., Fantom, K.G., West, A., Savopoulos, J., Hassan, N.J., Clinkenbeard, H., Harming, C , Amegadzie, B., Davis, J.B., Dingwall, C , Livi, G.P. and Creasy, CL. (2000) Characterization of human HtrA2, a novel serine protease involved in the mammalian cellular stress response. Eur J Biochem, 267, 5699-5710. Grossman, D., McNiff, J.M., Li, F. and Altieri, D.C. (1999) Expression and targeting of the apoptosis inhibitor, survivin, in human melanoma. J Invest Dermatol, 113, 1076-1081. Hakem, R., Hakem, A., Duncan, G.S., Henderson, J.T., Woo, M., Soengas, M.S., Elia, A., de la Pompa, J.L., Kagi, D., Khoo, W., Potter, J., Yoshida, R., Kaufman, S.A., Lowe, S.W., Penninger, J.M. and Mak, T.W. (1998) Differential requirement for caspase 9 in apoptotic pathways in vivo. Cell, 94, 339-352. Karst, A.M. and Li, G. (2007) BH3-only proteins in tumorigenesis and malignant melanoma. Cell Mol Life Sci, 64, 318-330. Kempkensteffen, C , Hinz, S., Schrader, M., Christoph, F., Magheli, A., Krause, H., Schostak, M., Miller, K. and Weikert, S. (2007) Gene expression and promoter methylation of the XIAP-associated Factor 1 in renal cell carcinomas: Correlations with pathology and outcome. Cancer Lett. Kuida, K., Haydar, T.F., Kuan, C.Y., Gu, Y., Taya, C, Karasuyama, H., Su, M.S., Rakic, P. and Flavell, R.A. (1998) Reduced apoptosis and cytochrome c-mediated caspase activation in mice lacking caspase 9. Cell, 94, 325-337. Leaman, D.W., Chawla-Sarkar, M., Jacobs, B., Vyas, K., Sun, Y., Ozdemir, A., Yi, T., Williams, B.R. and Borden, E.C (2003) Novel growth and death related interferon-stimulated genes (ISGs) in melanoma: greater potency of IFN-beta compared with IFN-alpha2. J Interferon Cytokine Res, 23, 745-756. 75 Leaman, D.W., Chawla-Sarkar, M., Vyas, K., Reheman, M., Tamai, K., Toji, S. and Borden, E.C. (2002) Identification of X-linked inhibitor of apoptosis-associated factor-1 as an interferon-stimulated gene that augments TRAIL Apo2L-induced apoptosis. J Biol Chem, 277, 28504-28511. Lee, M.G., Huh, J.S., Chung, S.K., Lee, J.H., Byun, D.S., Ryu, B.K., Kang, M.J., Chae, K.S.,, Lee, S J.L., C. H., Kim, J.I., Chang, S.G. and Chi, S.G. (2006) Promoter CpG hypermethylation and downregulation of XAF1 expression in human urogenital malignancies: implication for attenuated p53 response to apoptotic stresses. Oncogene, 25, 5807-5822. Liston, P., Fong, W.G., Kelly, N.L., Toji, S., Miyazaki, T., Conte, D., Tamai, K., Craig, C.G., McBurney, M.W. and Korneluk, R.G. (2001) Identification of XAF1 as an antagonist of XIAP anti-Caspase activity. Nat Cell Biol, 3, 128-133. Ma, T.L., Ni, P.H., Zhong, J., Tan, J.H., Qiao, M.M. and Jiang, S.H. (2005) Low expression of XIAP-associated factor 1 in human colorectal cancers. Chin J Dig Dis, 6, 10-14. Marghoob, A.A., Koenig, K., Bittencourt, F.V., Kopf, A.W. and Bart, R.S. (2000) Breslow thickness and dark level in melanoma: support for including level in pathology reports and in American Joint Committee on Cancer Staging. Cancer, 88, 589-595. Micali, O.C., Cheung, H.H., Plenchette, S., Hurley, S.L., Liston, P., LaCasse, E.C. and Korneluk, R.G. (2007) Silencing of the XAF1 gene by promoter hypermethylation in cancer cells and reactivation to TRAIL-sensitization by IFN-beta. BMC Cancer, 7, 52. Nachmias, B., Ashhab, Y., Bucholtz, V., Drize, O., Kadouri, L., Lotem, M., Peretz, T., Mandelboim, O. and Ben-Yehuda, D. (2003) Caspase-mediated cleavage converts Livin from an antiapoptotic to a proapoptotic factor: implications for drug-resistant melanoma. Cancer Res, 63, 6340-6349. Pennati, M., Binda, M., De Cesare, M., Pratesi, G., Folini, M., Citti, L., Daidone, M.G., Zunino, F. and Zaffaroni, N. (2004) Ribozyme-mediated down-regulation of survivin expression sensitizes human melanoma cells to topotecan in vitro and in vivo. Carcinogenesis, 25, 1129-1136. Qi, R., Gu, J., Zhang, Z., Yang, K., Li, B., Fan, J., Wang, C , He, Z., Qiao, L., Lin, Z. and Liu, X.Y. (2007) Potent antitumor efficacy of XAF1 delivered by conditionally 76 replicative adenovirus vector via caspase-independent apoptosis. Cancer Gene Ther, 14, 82-90. Reu, F.J., Bae, S.I., Cherkassky, L., Leaman, D.W., Lindner, D., Beaulieu, N., MacLeod, A.R. and Borden, E.C. (2006) Overcoming resistance to interferon-induced apoptosis of renal carcinoma and melanoma cells by DNA demethylation. J Clin Oncol, 24, 3771-3779. Sakemi, R., Yano, H., Ogasawara, S., Akiba, J., Nakashima, O., Fukahori, S., Sata, M. and Kojiro, M. (2007) X-linked inhibitor of apoptosis (XIAP) and XIAP-associated factor-1 expressions and their relationship to apoptosis in human hepatocellular carcinoma and non-cancerous liver tissues. Oncol Rep, 18, 65-70. Shibata, T., Mahotka, C , Wethkamp, N., Heikaus, S., Gabbert, H.E. and Ramp, U. (2007) Disturbed expression of the apoptosis regulators XIAP, XAFl, and Smac/DIABLO in gastric adenocarcinomas. Diagn Mol Pathol, 16, 1-8. Soengas, M.S. and Lowe, S.W. (2003) Apoptosis and melanoma chemoresistance. Oncogene, 22, 3138-3151. Straszewski-Chavez, S.L., Visintin, LP., Karassina, N., Los, G., Liston, P., Halaban, R., Fadiel, A. and Mor, G. (2007) XAFl mediates tumor necrosis factor-alpha-induced apoptosis and X-linked inhibitor of apoptosis cleavage by acting through the mitochondrial pathway. JBiol Chem, 282, 13059-13072. Verhagen, A.M., Ekert, P.G., Pakusch, M., Silke, J., Connolly, L.M., Reid, G.E., Moritz, R.L., Simpson, R.J. and Vaux, D.L. (2000) Identification of DIABLO, a mammalian protein that promotes apoptosis by binding to and antagonizing IAP proteins. Cell, 102, 43-53. Wang, J., He, H., Yu, L., Xia, H.H., Lin, M.C., Gu, Q., Li, M., Zou, B., An, X., Jiang, B., Kung, H.F. and Wong, B.C. (2006a) HSF1 down-regulates XAFl through transcriptional regulation. JBiol Chem, 281, 2451-2459. Wang, J., Peng, Y., Sun, Y.W., He, H., Zhu, S., An, X., Li, M., Lin, M.C., Zou, B., Xia, H.H., Jiang, B., Chan, A.O., Yuen, M.F., Kung, H.F. and Wong, B.C. (2006b) All-trans retinoic acid induces XAFl expression through an interferon regulatory factor-1 element in colon cancer. Gastroenterology, 130, 747-758. 77 Woo, M., Hakem, R., Soengas, M.S., Duncan, G.S., Shahinian, A., Kagi, D., Hakem, A., McCurrach, M., Khoo, W., Kaufman, S.A., Senaldi, G., Howard, T., Lowe, S.W. and Mak, T.W. (1998) Essential contribution of caspase 3/CPP32 to apoptosis and its associated nuclear changes. Genes Dev, 12, 806-819. Xia, Y., Novak, R., Lewis, J., Duckett, CS. and Phillips, A.C (2006) Xafl can cooperate with TNFalpha in the induction of apoptosis, independently of interaction with XIAP. Mol Cell Biochem, 286, 67-76. Yin, W., Cheepala, S. and Clifford, J.L. (2006) Identification of a novel splice variant of X-linked inhibitor of apoptosis-associated factor 1. Biochem Biophys Res Commun, 339, 1148-1154. Yoshida, H., Kong, Y.Y., Yoshida, R., Elia, A.J., Hakem, A., Hakem, R., Penninger, J.M. and Mak, T.W. (1998) Apafl is required for mitochondrial pathways of apoptosis and brain development. Cell, 94, 739-750. Yu, L.F., Wang, J., Zou, B., Lin, M.C, Wu, Y.L., Xia, H.H., Sun, Y.W., Gu, Q., He, H., Lam, S.K., Kung, H.F. and Wong, B.C. (2007) XAFl mediates apoptosis through an extracellular signal-regulated kinase pathway in colon cancer. Cancer, 109, 1996-2003. Zou, B., Chim, C.S., Zeng, H., Leung, S.Y., Yang, Y., Tu, S.P., Lin, M.C, Wang, J., He, H., Jiang, S.H., Sun, Y.W., Yu, L.F., Yuen, S.T., Kung, H.F. and Wong, B.C. (2006) Correlation between the single-site CpG methylation and expression silencing of the XAFl gene in human gastric and colon cancers. Gastroenterology, 131, 1835-1843. 78 CHAPTER 4. THE ROLE OF INTEGRIN-LINKED KINASE IN MELANOMA C E L L MIGRATION, INVASION, AND TUMOR GROWTH 2 4.1 Rationale and Hypothesis Melanoma is a highly aggressive skin cancer because of its high capability of invasion and rapid metastasis to other organs. During tumor progression and metastasis, an active crosstalk mediated by cell contact or paracrine growth factor signaling occurs between tumor cells and their surrounding microenvironment and allows tumor cells to outgrow, migrate and invade to other tissues. In this process, the cells are able to sense the dynamic extracellular matrix (ECM) through the interaction of heterodimeric cell-surface receptors called integrins with the ECM. Integrins provide an essential link between the ECM and the actin cytoskeleton. Importantly, binding to the ECM components activates integrins, which in turn transduces signals affecting cell proliferation, survival, motility, polarity and differentiation through various integrin-binding proteins. One of the key molecules in integrin signaling is integrin-linked kinase (ILK), which was first identified to interact with pi and P 3 integrins through its C-terminal serine/threonine kinase domain (Hannigan et al., 1996). Since its discovery, ILK has been shown to plays an important role in regulation of cell survival, cell cycle progression, epithelial-mesenchymal transition (EMT), tumor angiogenesis, and many other oncogenic processes (Hannigan et al., 2005). Our previous study has characterized the expression of ILK in 67 primary melanoma and 12 benign nevi biopsies using tissue microarray (Dai et al., 2003) and found that ELK expression was significantly increased 2 A version of this chapter has been published. Wong, R.P., Ng, P., Dedhar, S. and Li, G. (2007) The Role of Integrin-linked kinase in Melanoma Cell Migration, Invasion, and Tumor Growth. Mol Cancer Ther. 6(6): 1692-700. 79 in melanoma tissues compared to benign nevi. ELK expression was higher in tumor of increased thickness and was more prevalent in melanomas having lymph node invasion, suggesting that the increased in ELK expression may have an influence on melanoma progression and invasion. In this study, we sought to further investigate the role of ELK in melanoma invasion and to determine the therapeutic value of targeting ILK by the use of RNA interference. We propose that inhibition expression via ELK specific siRNA or shRNA will lead to inhibition of oncogenic processes such as melanoma cell migration, invasion, anchorage-independent growth and tumor growth in vivo. 4.2 Results 4.2.1 Aberrant Activation of PI3K Signaling Pathway We first characterized the endogenous expression of ILK in 14 melanoma cell lines and normal human epidermal melanocyte (NHEM). ELK was ubiquitously expressed in all cell lines (Fig. 4.1a). The expression level was generally higher in melanoma cell lines with eight of them showing an increase of over 10% in ELK expression compared to normal melanocytes (Fig. 4.1b). However, the upregulation of ILK in melanoma cells lines requires further characterization since our result was obtained from only single trial. PTEN is a negative regulator of PI3K-mediated signaling pathway and is therefore is critical determinant of the activities of PI3K downstream targets such as Akt and the activation of ILK. Since inactivation of the tumor suppressor PTEN is frequent in melanoma, we also determine if the protein expression of PTEN is altered in melanoma cell lines. Surprisingly, four melanoma cell lines namely MMRU, RPEP, PMWK, and Sk-mel-3 did not express detectable level of PTEN (Fig. 4.1a). This is likely due to homozygous deletion of PTEN gene or mutation that leads to a frameshift or creation of premature stop codon as reported in other melanoma cell lines (Tsao et al., 1998). In addition, biallelic inactivation of PTEN due to an epigenetic silencing has also been indicated (Zhou et al., 2000). The identification of PTEN loss in some melanoma cell lines suggests an aberrant activation of PI3K and its downstream effector Akt. We therefore examined the phosphorylation of Akt on Ser473 in melanoma cells of different PTEN status. Ser473 phosphorylation was high for all PTEN-negative cell lines in the presence or in the absence of serum (Fig. 4.2), with MMRU and Sk-mel-3 showing a modest reduction of Ser473 level under serum starvation which could be due to the existence of PI3K-independent mechanism in controlling Akt activation or the action of another lipid phosphatase such as SHIP2. In contrast, the PTEN-positive melanoma cell lines exhibited marked lower level of Ser473 phosphorylation. The phosphorylation of Akt is inducible in most PTEN-positive melanoma cells when the cells were exposed to serum with the exception of Sk-mel-2 cells, in which the phosphorylation levels were almost undetectable under both conditions. The PTEN-positive Sk-mel-24 cell line only showed a modest reduction of Akt phosphorylation under serum starvation and this could be due to inactivation of a single PTEN allele or mutation or post-translational modification that decreases the lipid phosphatase activity. 81 Figure 4.1 Expression of ILK and PTEN in 14 melanoma cell lines and normal human epidermal melanocyte (NHEM). (a) Melanoma cell lines expressed equal or higher level of ILK protein. PTEN expression was lost in four melanoma cell lines, (b) Bar graph showing normalization of ILK expression levels. 82 Figure 4.2 Phosphorylation of Akt at serine 473 was reduced in PTEN-positive melanoma cells under serum starvation. Cells were either deprived of serum for 24 h or grown in medium supplemented with 10% serum. Phosphorylation of Akt at serine 473 was analyzed by western blot. RPEP-PED1 is derived from RPEP melanoma cell line which has been stably transfected with an expression vector (pEDl) that carries a dominant-negative mutant p53 gene. 83 4.2.2 Inhibition of ILK Activity did not Reduce Akt Activation ILK is a serine/threonine kinase and the kinase activity is stimulated by binding of phosphatidylinositol triphosphate to its central PH-like domain. Many ILK substrates have been identified, including two key effectors of PI3K pathway, Akt and GSK3 (Delcommenne et al., 1998; Persad et al., 2000). Since our results showed that Akt is constitutively active in PTEN-deficient melanoma cell lines, it would be interesting to see if inhibition of the kinase activity of ELK leads to a decrease in Akt activation. A PTEN-null melanoma cell line (MMRU) was treated with three different small-molecule pharmacological inhibitors of ELK. KP-392 (or KP-SD-1) functions as an ATP antagonist and has an IC50 of 0.3 uM toward the kinase activity of ELK1. The treatment with KP-392 has been demonstrated to reduce the phosphorylation of Akt at Ser473 and GSK-3 in a dose-dependent manner (Mills et al., 2003; Persad et al., 2000; Persad et al., 2001a; Tan et al., 2004). KP-307-2, an analog of KP-392, has been shown to reduce tumor growth and tumor vascularization in prostate carcinoma xenograft model (Tan et al., 2004). To our surprise, treatment of different ILK inhibitors did not result in a decrease in Akt phosphorylation (Fig. 4.3a). To confirm our observation, we transfected MMRU cells with a wild-type or a kinase deficient ELK and analyzed for Akt phosphorylation. The E359K mutant bears a point mutation of a conserved glutamic acid located in subdomain VEEl of ELK and has been reported to function in a dominant negative fashion (Delcommenne et al., 1998; Persad et al., 2000; Persad et al., 2001a; Troussard et al., 1999). Additionally, the E359K ELK mutant is unable to bind to a-parvin and paxillin (Nikolopoulos and Turner, 2002). Ectopic expression of E359K ILK mutant failed to alter the phosphorylation of Akt (Fig. 4.3b). The expression of wt-ELK also did not result in a simulation of Ser473 phosphorylation. To see if the above 84 observations were cell-specific, we treated five melanoma cells of different PTEN status with ILK inhibitor KP-392. Only slight reduction of Ser473 levels was observed after treatment with 100 uM KP-392 (Fig. 4.3c). However, at this concentration the phosphorylation of Akt is significantly reduced in prostate carcinoma cell line PC3 (Fig.4.3c) (Filipenko et al., 2005; Persad et al., 2000; Persad et al., 2001a; Tan et al, 2004). 85 Figure 4.3 Inhibition of ILK activity did not reduce Akt activation, (a) MMRU cells were treated with ILK selective inhibitors including 100 uM KP392, 25 uM 307-2, or 20 uM 674728 or DMSO as vehicle control overnight in serum-free medium. The activation of Akt was analyzed by examining the phosphorlyation at serine 473. (b) Five melanoma cell lines of different PTEN status were treated with 100 uM ILK inhibitor KP392 and phosphorylation of Akt at Ser473 was analyzed. Prostate cancer cell line PC3 was used as a positive control for inhibition of Akt activation by treatment with ILK inhibitor, (c) MMRU cells were transfected with wt-ILK or dominant-negative ILK (E359K) or vector and Ser473 phosphorylation of Akt was analyzed. a o ILK Inhibitor CM S s cr> a ~ co n E 0. 0. 2 * * © pAkt Ser 473 Total Akt V5-ILK P-actin pAkt Ser 473 Total Akt _ J w KP392 W 4r 4r pAkt Ser 473 Total Akt 86 4.2.3 Silencing ILK Expression by RNA Interference Several studies suggested that the kinase activity of ELK is dispensable and that ILK mainly functions as an adaptor protein, transducing signal via the assembly of multiprotein complex (Mackinnon et al., 2002; Zervas et al., 2001). To further investigate the functions of ELK in melanoma, we have taken the approach of depleting endogenous ILK expression by utilizing RNA interference. ELK siRNA specifically targeting the pH domain (ELK-IE), or the integrin binding domain (ELK-A) were found to be effective on knocking down the endogenous expression of ELK in MMRU and Sk-mel-110 cells (Fig. 4.4a). The reduction is greatest with ELK-A siRNA, showing a reduction of >70% in both cell lines. The sequences of both double stranded siRNA molecules has been published in previous study by Troussard et al (2003). Through the use of ELK siRNA, we have also confirmed that depleting endogenous expression of ELK did not result in a reduction of Ser473 phosphorylation on Akt (Fig. 4.4b). This suggests that our inability to reduce Ser473 phosphorylation by using ELK inhibitor KP-392 was not due to the ineffectiveness or non-function of ELK inhibitor. In order to determine the effect of long term depletion of ILK expression on melanoma cellular functions, we also establish a melanoma MMRU cell line stably expressing ILK shRNA. We have identified a 21-mer nucleotide sequence targeting the ILK transcript at the 472 to 492 position that is effective in knocking down ELK protein expression. Fig. 4.5b shows a decrease in ELK expression of 7 selected clones comparing to a control stable clone. 87 Figure 4.4 siRNA-mediated knockdown of endogenous ILK expression and its effect on the phosphorylation of Akt at serine 473. (a) MMRU and Sk-mel-110 melanoma cells were transfected with 25 pM of ILK siRNA specifically targeting the pH domain (ILK-H) or integrin binding domain (ILK-A) or nonsilencing control siRNA. Protein expression was analyzed by western blotting 72 h (MMRU) or 96 h (Sk-mel-110) after transfection. (b) MMRU cells transfected with ILK-H siRNA did not result in a reduction of serine 473 phosphorylation. MMRU Sk-mel-110 o o o is i B < is x < o * o * o * * O d O d O d d ILK P-act in 2 i is w O d ILK pAKT Ser 4 7 3 Total Akt 88 Figure 4.5 shRNA-mediated knockdown of endogenous ILK expression, (a) Schematic diagram showing the targeting region of ILK shRNA. (b) MMRU cells were transfected with ILK shRNA or empty vector and stable clones were selected with G418. The expression of ILK in these clones was analyzed by western blot. a I L K nuc leo t i des472 -492 540 636 Ankyrin repeats PH domain K inase domain stable clones B O o 17 9 21 10 23 16 I L K (3-actin 89 4.2.4 Effect of ILK Knockdown on Melanoma Cell Migration We have previously reported that the increase in ELK expression in melanoma was correlated with tumor thickness and lymph node invasion (Dai et al., 2003). ELK elevation could possibly implicate in the pathological progression and metastasis of malignant melanoma. Therefore, we would like to determine whether ELK is crucial to melanoma invasiveness. One of the characteristics of tissue metastasis is the gain or enhancement of the ability to migrate over distance to remote sites. We first examine the effect of inhibition of ELK activity on cell migration in a wounding assay. Treatment with ILK inhibitor KP-392 decreased cell migration in a dose-dependent manner for both MMRU and Sk-mel-110 melanoma cell lines (Fig. 4.6). Similarly, knockdown of ELK expression by siRNA or by sustained expression of ELK shRNA in clone 16 and 21 significantly reduced cell migration (Fig. 4.7). To check that the reduction of cell migration across the wounded area was due to inhibition of ELK activity or expression, but not as a result of inhibition of cell proliferation, we stained the migrating cells with the proliferation marker Ki-67. Our result showed that downregulation of ILK did not seem to alter the proliferation rate (Fig. 4.7b). A more quantitative cell proliferation assay was performed and confirmed that the proliferation of the shRNA clones was only about 10% slower than the control cells (Fig. 4.8). Therefore, the significant inhibition of melanoma cell migration after ILK siRNA or shRNA treatment was mainly due to the effect of ELK knockdown on cell migration and the attribution from cell proliferation seems to be minor. 90 Figure 4.6 Inhibition of ILK kinase activity inhibited melanoma cell migration, (a) MMRU and Sk-mel-100 melanoma cells were treated with 50 uM or 100 uM ILK inhibitor KP-392 or DMSO as vehicle control. A wound was created in the confluent cell monolayer by using a razor blade. After 24 h, cell migration was photographed (magnification: xlOO). (b) Quantitation of cell migration. Cells migrated across the wound were scored in five different microscopic fields and results were present as mean plus standard deviation. OuM 50 uM 100 MM KP392 (uM) 0 50 100 0 50 100 MMRU Sk-mel-110 91 Figure 4.7 Silencing ILK expression inhibited melanoma cell migration, (a) MMRU cells were transfected with ILK-A siRNA molecules at a concentration of 25 nM. Sixty hours after transfection, a wound was created in the confluent cell monolayer by using a razor blade and cells were allowed to migrate for 36 h (magnification: xlOO). (b) Stable clones expressing ILK shRNA and vector-transfected control stable clone analyzed for cell migration. After 24 hours, migrating cells were stained for nuclear antigen Ki-67. Fluorescent imaging of Ki-67 staining was carried out at an exposure setting of 5 sec and both phase-contrast, left, and fluorescence images were taken, right (magnification: xlOO). (c) Quantitation of cell migration. Cells migrated across the wound were scored in five different microscopic fields and results were present as mean plus standard deviation. 92 Figure 4.7 Continued, c 120 Control Control ILK Clone 16 Clone 21 siRNA clone siRNA Figure 4.8 Cell proliferation of ILK shRNA-stable clones. Parental MMRU cells, vector control stable cells, and ILK shRNA-stable clones were grown in 24-well plates for 24, 48, and 72 h. Cells were then fixed with trichloroacetic acid and were stained with sulforhodamine B. The dye was solubilized and cell proliferation was determined by spectrophotometric readings at 550 nm. Results were the mean of sextuplet samples plus standard deviation. 1.2 0 J 1 1 • — 24 h 48 h 72 h 94 4.2.5 Role of ILK in GTPase Activation Cell migration requires coordination of leading edge protrusion, establishment of new adhesion sites, and cell-body contraction with detachment of adhesion sites at the rear. Each step involves the assembly, disassembly or reorganization of the actin cytoskeleton, and must be coordinated both spatially and temporally to generate net protruding movement. It is well recognized that the Rho family of small GTPases, which includes Rac, Rho, and Cdc42, regulates these cytoskeleton dynamics (Jaffe and Hall, 2005). We therefore determine whether the perturbation of ELK activity or expression has an effect on the activation of Rho GTPases. We found that inhibition of ILK kinase activity by treating MlvIRU cells with ELK inhibitor KP-392 or depleting ELK expression by siRNA both produced a small but detectable reduction of both active Rac and Cdc42 (Fig. 4.9b). Our assay was able to detect the active GTP-bound form of Rac and Cdc42 since cell lysate preloaded with GTPyS, a non-hydrolysable GTP analogy, significantly stimulated the amount of activated GTPases, whereas cell lysate preloaded with GDP effectively prevent the activation (Fig. 4.9a). However, the activation status of Rho A upon KP-392 or siRNA treatment was less than conclusive. Inhibiting ELK activity was able to reduce the activation of Rho A, but knocking down ELK expression did not show any difference in the amount of RhoA activation (Fig. 4.9b). We believe that this discrepancy may be due to the non-specific activity of ILK inhibitor. Second generation of ELK inhibitor that derived from KP-392 (QLT0267) can inhibit the kinase activity of purified recombinant ILK in a cell-free assay at 26 nmol/L and display a -1000-fold selectivity over other kinases including CK2, CSK, DNA-PK, PEM1, PKC and Akt isoforms, and ~100-fold selectivity over kinases such as Erk-1, GSK3p\ LCK, PKA, p70S6K, and RSK1 (Troussard et al., 2006; Younes et al., 2005). The working concentration of QLT0267 is between 1 and 10 micromolar range and therefore the new inhibitor may provide a more potent and specific targeting of ELK kinase activity. On the other hand, the inability to reduce RhoA activation upon siRNA transfection may be due to the incomplete silencing of ELK proteins such that a small fraction of residual ELK may be enough to activate the downstream targets. It has been demonstrated that the formation of ternary complex composed of ELK, PINCH 1 and a-parvin is not only essential for the localization of the complex to the adhesion sites (Zhang et al., 2002b), but is also important for the stability of each component of the complex. ELK is stabilized by PINCH 1 and PINCH2 through the interaction with the first LEVI domain of PINCH against proteosome degradation and re-expression of PINCH 1 or PENCH2 in PENCHl-depleted cells rescued the ELK protein expression (Fukuda et al., 2003; Stanchi et al., 2005; Xu et al., 2005). Therefore, the mutual stabilization provided by the formation of ternary complex may prevent the complete ablation of the endogenous ELK expression. 96 Figure 4.9 Activation of Rac, RhoA and Cdc42 in melanoma cells, (a) Cell lysates from MMRU cells were preloaded with either GDP or GTPyS prior to analysis for Rac and Cdc42 activation, (b) Serum-starved MMRU cells were treated with 100 pM of either ILK inhibitor KP392 or DMSO as vehicle control, or 25 nM of either ILK siRNA or non-silencing control siRNA. The cells were then stimulated with serum for 30 min prior to analysis for GTPase activation by pulldown assay. Immunoblots of Rac, RhoA, and Cdc42 from the whole cell lysate were used as the loading control. a Pulldown Rac Total Rac Pulldown Cdc42 Total Cdc42 ILK Inhibitor Pulldown Rac Total Rac Pulldown Cdc42 Total Cdc42 Pulldown RhoA Total RhoA —...)||r mum mm —. ILK siRNA 4-97 4.2.6 ILK Regulates Anchorage-independent Growth and Cell Invasion in Melanoma Cells It is well recognized that cell anchorage via binding of integrins to the matrix proteins provides pivotal survival signals to the cell. Disturbance of cell-anchorage will lead to the initiation of suicide program termed anoikis. During invasion, tumor cells need to survive the anchorage-independent condition until reaching a distant target organ. The anoikis-resistant capabilities of cancer cells endow them with the metastatic potential. To test if ILK plays an essential role in promoting this process in melanoma cells, we assessed the anchorage-independent growth of ELK shRNA stable clones by testing their ability to form colonies in a semisolid medium. Both clones stably expressing ELK shRNA exhibited a reduced capacity for soft agar colony formation, with a significant lower number of colonies and reduced colony size (Fig. 4.10). In contrast, the parental MMRU cells and control stable clone showed a higher number of large colonies. For melanoma cells to invade into other tissues, proteolytic degradation of the extraceullar matrix and the basement membrane is required. The ability of melanoma cells to invade across a basement membrane-like layer composed of Matrigel was investigated. We found that knocking down of ELK expression in both ELK shRNA stable clones attenuated the invasive capacity, with a stronger inhibition of invasiveness observed in clone 21 (Fig. 4.11). Our data thus suggest a prominent role of ILK in regulating melanoma invasion. 98 Figure 4.10 ILK regulates melanoma anchorage-independent growth, (a) Cell suspensions of parental MMRU or MMRU stable cells containing shRNA vector or ILK shRNA in 0.3% agar were overlaid on top of a 0.5% agar bed. After 15 d, colonies were photographed (magnification, x32), and were counted under a light microscope, (b) Results from three independent experiments are presented as mean plus standard deviation. 99 Figure 4.11 ILK regulates melanoma cell invasion, (a) Control or ILK shRNA stable clones were allowed to invade across the 8 pm pore-size filter precoated with 5 mg/ml Matrigel. Invaded cells were stained with crystal violet. Bright field images of invaded cells (Top, magnification ><32) and images of the filter (Bottom) are shown, (b) Quantitations of invaded cells are shown as mean from three independent experiments plus standard deviation. a Contro l C lone 16 C lone 21 b Control C lone 16 Clone 21 100 4.2.7 Knockdown of I L K Expression Suppress Melanoma T u m o r Growth To determine if inhibition of ELK expression would have an impact on melanomagenesis in vivo, control or clone 21 of ELK shRNA stable transfectants were respectively inoculated into the left and right flank of severe combined immunodeficient mice and tumor growth was monitored. A total of two mice were used in this pilot study. We found that inhibition of ILK expression drastically reduce the tumor growth by 90% when compared with control stable transfectant (Fig. 4.12). A full-scale study using a larger number of mice and with the inclusion of clone 16 of ELK shRNA stable transfectants has been published and similar results were found, with xenografts of clone 16 and clone 21 showing a growth reduction of 90% and 80% respectively (Wong et al, 2007). 101 Figure 4.12 ILK shRNA inhibits the growth of melanoma xenografts, (a) Image of tumors excised from the severe combined immunodeficient mice s.c. injected with control or ILK shRNA stable clone 21. (b) Estimated tumor volume of control (n = 2) and ILK shRNA stable clones (n = 2). Control Clone 21 i | : ' i | : : - | T ' p | i i ! | " i " j ' i 7 0 9 10 1 "I b 2500 i Days 102 4.3 Discussion During process of malignant transformation of melanocytes, melanoma cells acquire the ability to survive under adverse conditions. The Akt signaling pathway is recognized as one of the most critical pathways in regulating cell survival. Our previous study has identified the phosphorylation level of Akt at serine 473 is an independent prognostic factor in melanoma (Dai et al., 2005). The phosphorylation level was also correlated with the melanoma progression and was inversely correlated with 5-year patient survival. Here, we show that loss of PTEN protein expression was detected in 4 of 14 (29%) melanoma cell lines and those cell lines with PTEN loss showed a constitutive activation of Akt (Fig. 4.1, 4.2). This is consistent with previous study that showed a diminished Akt phosphorylation upon expression of PTEN in PTEN-deficient melanoma cell lines (Stahl et al., 2004). Thus, our data support the notion that the Akt survival pathway is frequently perturbed in melanoma and that the tumor suppressor PTEN is crucial for the regulation the activity of this pathway. ILK has been implicated in the activation of Akt. The kinase activity of ILK is stimulated by PEP3 binding and is sensitive to PI3K inhibitor wortmannin and LY294002 (Delcommenne et al, 1998). ILK has been shown to phosphorylate Akt on Ser473 in vitro and introduction of kinase-deficient ELK as well as knocking out ILK expression using the Cre-Lox system inhibit Akt phosphorylation (Persad et al., 2000; Persad et al., 2001a; Troussard et al, 2003). Here we show that treatment with small molecule ELK inhibitors or overexpression of a kinase-deficient version of ILK resulted in little or no inhibition of Ser473 phosphorylation in melanoma cell lines (Fig. 4.3), raising the possibility that the regulation of Akt phosphorylation on Ser473 in melanoma cells is 103 independent of ELK. Several reports have questioned about the role of ELK in Akt phosphorylation. Hill et al (2002) found that the supernatant of the ELK-enriched lipid raft after the depletion of ILK by immunoprecipitation still retained kinase activity toward Ser473 of Akt. The phosphorylation of Akt is unimpaired in ILK^'1^ mouse fibroblast, embryonic neurons or chondrocytes (Grashoff et al., 2003; Niewmierzycka et al., 2005; Sakai et al., 2003). In addition, studies on invertebrate Drosophila and Caeonorhabditis elegans suggest an evolutionary conserved, noncatalytical adaptor function of ELK, based on the observation that kinase-defective ELK is able to rescue the phenotypes produced by the lack of functional ELK (Mackinnon et al., 2002; Zervas et al., 2001). The disparity in the literatures along with the discrepancy from our data that the prostate carcinoma cell line PC3 is sensitive to ELK inhibitor treatment in inhibiting the phosphorylation of Akt, whereas melanoma cells are not (Fig. 4.3c), suggests that the regulation of Akt phosphorylation may depend on cell type. It is also possible that differential regulation of signaling pathways occurs at different stages of tumorigenesis. To illustrate this point, Troussard et al (2006) found that the regulation of Akt activation is independent of ELK activity in normal mammary epithelial cells and the cells were insensitive to ILK inhibition. In contrast, inhibition of ILK activity in human breast cancer cells resulted in the inhibition of Akt Ser473 phosphorylation. Apparently, breast cancer cells rely on ELK-mediated activation of survival pathway for their survival advantage. On the other hand, normal breast epithelial cells, which do not need to resist apoptosis to prolong survival, do not require ELK for their protection. The reason that melanoma cells do not require ILK for the activation of Akt may be due to the presence of an alternate, constitutive active mechanism for Akt activation as a result of certain 104 genetic or epigenetic alternations characteristic in melanomas. Another possibility is the existence of a parallel, independent pathway for the activation of Akt, so that the inhibition of Akt phosphorylation after ELK perturbation will only become apparent when components of the other pathway are also disturbed. Many kinases have been implicated in the phosphorylation of Akt at serine 473 (Dong and Liu, 2005), including DNA-PK and rictor-mTOR complex (Feng et al., 2004; Sarbassov et al., 2005). Further studies are needed to determine the physiological upstream kinase of Akt phosphorylation at the hydrophobic motif and its regulation in melanoma cells as well as in other cancer models. Our result on Akt phosphorylation, however, does not exclude the possibility that ELK may regulate the phosphorylation of specific isoform of Akt. Akt3 seems to play a prominent role in melanoma tumorigenesis as it has been reported that both the Akt3 expression and the phosphorylation level of Akt3 was significantly elevated in melanomas compared to the other two isoforms (Stahl et al., 2004). En addition, siRNA specifically targeting Akt3 decrease the levels of total phosphorylated Akt in PTEN-negative or PTEN depleted melanoma cells, whereas siRNA to Aktl or Akt2 had a negligible effect. The underlying molecular basis for selective Akt3 activation, over Aktl and Akt2, is currently unknown. It may involve differential post-translational modification or preferential interaction of PEP3 or other accessory proteins with the PH domain (Robertson, 2005). Our previous study on ELK expression suggests that ELK may play an important role in melanoma invasion (Dai et al., 2003). Cell motility, one of the key determinants of the invasive ability of the cell, is regulated in complex manner. We show that attenuation of ELK activity or expression both inhibited the ability of melanoma cells to 105 migrate (Fig. 4.6, 4.7). This inhibition of cell migration across the wounded area by ILK shRNA was not mainly as a result of the inhibition of cell proliferation, as we have shown that similar fraction of ELK knockdown cells and control cells were positive for the proliferation maker Ki-67 (Fig. 4.7b), and that the proliferation rates of the ILK knockdown stable clones were only marginally slower than the control cells (Fig. 4.8). The relatively little impact of ELK inhibition on melanoma cell proliferation is surprising given that ILK overexpression has been shown to induce cyclin DI promoter activity and inhibition of ELK kinase activity suppressed the Wnt-1-stimulated production of cyclin DI (D'Amico et al., 2000). Furthermore, introduction of dominant-negative ELK induced cell cycle arrest at the Gi phase in prostate cancer cell lines (Persad et al., 2000). The effect of ELK on cell cycle progression is mediated by phosphorylation and inactivation of GSK-3. The inactivation of GSK-3 leads to the activation of multiple pathways. These include the activation of transcription factor AP-1, and cAMP responsive element binding protein (CREB), as well as the nuclear accumulation of p-catenin that leads to the formation of a functional transcription complex with the T cell factor/lymphoid enhancer factor (TCF/LEF) proteins (D'Amico et al, 2000; Persad et al., 2001b; Troussard et al, 1999). All of these pathways stimulate the production of cyclin DI. Although the inactivation of GSK-3 by ELK can occur through ELK-mediated direct phosphorylation of GSK-3 or indirectly through ELK-induced activation of Akt and subsequently phosphorylation of GSK-3 by Akt, the relative contribution of Akt activity in the inactivation of GSK-3 appears to be minor and has only been shown to regulate CREB transactivation. We have shown that ILK plays a minor role in regulating the activation of Akt in melanoma cells; it remains to determine whether knockdown of ELK has any 106 effect on GSK-3 activity, cyclin Dl production, as well as the level of cyclin-dependent kinase inhibitors p 2 l C I P 1 / W A F 1 and p27KIP1. Cell migration involves dynamic changes of cell shape. ELK and its associated factors including a-parvin, P-parvin, and PINCH are important regulators of cell shape and thus are critical in regulation of cell motility. Disruption of ELK and PINCH-1 interaction or overexpression of PHSfCH-2, which competes with PINCH-1 for interaction with ELK, has been shown to impair cell migration (Zhang et al., 2002a; Zhang et al., 2002c). ILK specifically interacts with the second CH domain of a-parvin and P-parvin (Tu et al., 2001; Yamaji et al., 2001). ILK and P-parvin accumulate in cell surface blebs during the early phase of the cell spreading process (Yamaji et al., 2001). These blebs are out-pouchings of plasma membrane that are commonly found at the leading edge of moving cells and are transient structures that leads to the formation of other protrusion such as membrane ruffles on lamellipodia. Expression of the deletion mutant containing only the second CH domain of a-parvin or P-parvin disrupted the formation of focal adhesion and stress fiber (Yamaji et al., 2001). In addition, the p-parvin deletion mutant arrested the cells at early stage of cell spreading and the effect was absent when kinase-deficient ILK was co-expressed, suggesting that kinase active ELK is required for cell spreading. Other evidences that indicate the key role of kinase activity of ELK in cell adhesion and migration comes from the observation that inhibition of ELK expression or kinase activity leads to the disruption of ILK and a-parvin interaction, as well as disruption of proper F-actin organization and inhibition of cell migration (Attwell et al., 2003). The kinase activity of ILK has also been shown to be needed for the interaction between p-parvin and a-actinin, an actin cross-linking protein abundant in focal adhesion 107 and important in nascent focal adhesion assembly and stress fiber extension (Yamaji et al., 2004). Since P-parvin has been identified to be a direct substrate of ELK (Yamaji et al., 2001), it has been suggested that phosphorylation of P-parvin by ELK induces a conformational change which enables p-parvin to interact with a-actinin to induce the stabilization of the nascent substrate adhesion, lamellipodia development, and formation of stress fibres. Small GTPases of Rho family such as Rac, Cdc42, and Rho are well-known regulators of cell spreading and cell migration through their effects on the cytoskeleton. Activated Rac and Cdc42 induces the polymerization of actin at the leading edge to form sheet-like structures known as lamellipodia, and finger-like structures known as filopodia respectively, whereas Rho regulates the formation of stress fibres and myosin-mediated contractility (Burridge and Wennerberg, 2004). ELK has been shown to regulate the activation of Racl in a PI3K- and p70S6Kl-dependent manner (Qian et al., 2005). In addition, inhibition of ELK expression or kinase activity results in a reduction of both Rac and Cdc42 activation in mammary epithelial cells and prostate cancer cells (Filipenko et al., 2005). Since it has been demonstrated that a-PEX, a Rac/Cdc42-specific guanine nucleotide exchange factor, interacts with ELK-binding partner p-parvin (Mishima et al., 2004; Rosenberger et al., 2003), it has been proposed that the interaction between ILK and P-parvin and perhaps the kinase activity of ILK toward p-parvin are required for the stimulation of the guanine nucleotide exchange activity of a-PEX, thereby leading to the activation of Rac and Cdc42. Our results showed that inhibition of ELK activity or its expression significantly reduced melanoma cell migration but only resulted in a minor reduction of Rac and Cdc42 activation (Fig. 4.9b), suggesting that the ELK-mediated 108 organization of actin cytoskeleton may occur through a Rac- and Cdc42-independent pathway. Interestingly, Boulter et al (2006) also suggested that an additional ELK-dependent signal exists for the regulation of cell spreading. This is based on the finding that expression of constitutively active Rac only partially restores the spreading defects of ELK-depleted fibroblasts. It is well recognized that direct cell movement consists of cycles of ordered processes: membrane protrusion at the leading edge, adhesion to the substrate, translocation of the cell body, and retraction of the trailing edge. ELK may modulate cell migration through the regulation of cell contractility (Lauffenburger and Horwitz, 1996). The assembly of stress fibres and contraction of actin filament is provided by myosin II, in which phosphorylation of its myosin light chain (MLC) by calcium-dependent myosin light chain kinase (MLCK) promotes contraction. ELK isolated from chicken gizzard smooth muscle has been identified to phosphorylate MLC at serine 19 and threonine 18 (Deng et al., 2001). ELK is also implicated in the inactivation of myosin phosphatase, which is responsible for the dephosphorylation and inactivation of myosin EJ. In particular, ELK has been shown to phosphorylate and inactivate the non-catalytic subunit of myosin phosphatase called myosin phosphatase target subunit (Muranyi et al, 2002). ELK has also been shown to phosphorylate the protein inhibitors of myosin phosphatase including CPI-17, PHI-1, and KEPI and enhance their inhibitory activities toward myosin phosphatase (Deng et al., 2002; Erdodi, 2003). It remains to be determined whether ELK-mediated regulation of myosin II phosphorylation has any effect on the contractility and migration of non-smooth muscle cells, in particular melanoma cells. Another possible way for ELK to influence actin cytoskeleton dynamics and cell migration is through ELK-interacting protein PINCH. 109 The fourth LEVI domain of PINCH binds to the third SH3 domain of Nck-2 (Tu et al., 1998). Nck-2 is known to interact with p21-activated kinase and Wiskott-Aldrich syndrome proteins, proteins that are directly involved in the regulation of actin polymerization and membrane protrusion (Buday et al., 2002; Li et al., 2001). Therefore, ILK, through its interaction with PINCH and Nck-2, could potentially recruit proteins that are involved in actin polymerization into proximity of cell-matrix adhesion sites and promote cell migration. Furthermore, RhoC has been implicated in melanoma migration and invasion and whether ILK regulates the activation of RhoC remains to be determined. Clark et al (2000) used an in vivo scheme of repeat tail vein injection to select highly metastatic melanoma cells from pulmonary metastases and identified RhoC as a key regulator of melanoma metastasis. Expression of RhoC enhanced the migratory and invasive capacity in poorly metastatic melanoma cell line without significantly affecting cell proliferation, whereas expression of dominant negative Rho in highly metastatic cell line inhibited motility and invasion. It will be interesting to determine whether melanoma cells deficient of ILK expression or kinase activity can be rescued by the introduction of constitutively active RhoC to see if RhoC could be downstream of ILK in regulating melanoma cell migration and invasion. The integrins, which mediate anchorage of cells to components of the extracellular matrix, transmit pivotal survival signals to the cells. The ocvP3 integrin is predominantly expressed in melanoma cells and promote melanoma tumor progression (Albelda et al., 1990). ILK, which binds to the cytoplasmic tails of pi, and P 3 integrins and links the cell surface integrins to the actin cytoskeleton, is thus implicated in regulation of anchorage-dependent survival. Here we show that ILK knockdown 110 impaired the anchorage-independent growth of melanoma cells (Fig. 4.10). We have shown that ILK shRNA stable clones have a minor effect on cell proliferation. Therefore, we suspected that the inhibition of anchorage-independent growth of melanoma cells after ELK knockdown was mainly attributed to the disruption of cell survival. Ki-67 staining and cell cycle analysis on cells growing in suspension would be useful in determining the contribution of mitosis to the anchorage-independent growth. The anchorage-independent survival has been previously demonstrated to involve the ILK-mediated activation of Akt, as it has been shown that the dominant negative Akt or kinase deficient ILK was able to reverse the inhibition of anoikis (Attwell et al., 2000). The ILK-mediated anchorage-independent survival may also depend on the upregulation of cyclin Dl and A, leading to the hyperphosphorylation of retinoblastoma protein (Radeva et al., 1997). However, we have shown that ELK does not appear to be involved in the regulation of Akt activation in melanoma cells (Fig. 4.3). Therefore, the role of Akt in ELK-mediated anchorage-independent survival of melanoma cells seems to be minor and the survival and growth of ELK-expressing melanoma cells under non-anchorage condition may involve other signaling pathways. One possibility is via the activation of MAP kinase pathway. Integrin-mediated survival signaling has been known to activate Erk via the activation of She (Wary et al., 1996; Wary et al., 1998). ILK has also been shown to stimulate the phosphorylation of Erk-1 (Troussard et al., 1999). Additional studies are needed to address the possible crosstalk between ELK and the MAP kinase survival pathways, as well as between other factors that has been implicated in cell survival such as NF-K |3 . I l l The poor prognosis of melanoma is mainly because of the propensity of this tumor to metastasize to distant organs. We found that suppression of ILK expression greatly inhibits the ability of melanoma cells to invade (Fig. 4.11). Cell invasion requires the degradation of extracellular matrix by secretion of proteolytic enzymes such as the urokinase plasminogen activation (uPA) and matrix metalloproteinases (MMPs). Of these, the MMP-2 and MMP-9, which degrade basement membrane collagen, are thought to be particularly important in tumor cell invasion. Our published results show that inhibition of ILK leads to a reduction of MMP-9 proteolytic activity without significant change in MMP-2 activity (Wong et al., 2007). This is in agreement with previous studies showing that the invasive fibroblastoid phenotype of HT-144 melanoma cells is associated with an increased ELK expression and elevated MMP-9 expression (Janji et al., 1999) and ELK overexpression resulted in an increase in invasiveness of mouse mammary epithelial cells through an increase in MMP-9 expression (Troussard et al., 2000). The increase in MMP-9 expression has been shown to be due to the inactivation of GSK-3 and subsequently activation of transcription factor AP-1 (Troussard et al., 2000). Thus it appears that the inhibition of melanoma cell invasion after ELK knockdown was due to both the inability to degrade matrix components and the inability to migrate To illustrate the importance of ELK in regulation of melanoma tumorigenesis, we compared the tumor growth of the melanoma tumor xenograft with or without ILK knockdown. We found that inhibition of ILK expression profoundly impair the growth of melanoma tumor xenograft by as much as 90% in SCED mice (Fig. 4.12). Since ELK knockdown did not significantly affect melanoma cell proliferation in vitro (Fig. 4.8), we believe that the inhibition of tumor growth by ILK knockdown was due to the disruption 112 of cell survival such that melanoma cells lacking ELK was unable to thrive under adverse environments and conditions making tumor growth impossible. It would be interesting to determine the phosphorylation of Akt at serine 473 from the frozen tumor sections to found out the regulation of Akt phosphorylation in vivo. In addition, TUNNEL staining on the tumor sections would allow us to determine the impact of ELK knockdown on apoptosis. Our in vivo data also highlight the efficacy of using ELK shRNA molecule in suppressing tumor growth. However, it should be kept in mind that one of the major drawbacks of RNA interference is the presence of off-target effect and this may potentially contribute to the dramatic growth suppression of melanoma xenografts. Therefore, in addition to ELK shRNA, we also make use of ELK siRNAs that target different regions of ELK. Both ILK shRNA and ILK-A siRNA produces a similar level of inhibition on melanoma cell migration, indicating that our siRNA and shRNA are specific and that the effect we saw was indeed a result of ELK knockdown. Thus, our study strongly suggested that inhibiting ILK expression through the use of ELK shRNA could serve as an effective therapeutic approach for melanoma. 113 4.4 References Albelda, S.M., Mette, S.A., Elder, D.E., Stewart, R., Damjanovich, L., Herlyn, M. and Buck, CA. (1990) Integrin distribution in malignant melanoma: association of the beta 3 subunit with tumor progression. Cancer Res, 50, 6757-6764. Attwell, S., Mills, J., Troussard, A., Wu, C. and Dedhar, S. (2003) Integration of cell attachment, cytoskeletal localization, and signaling by integrin-linked kinase (ELK), CH-ELKBP, and the tumor suppressor PTEN. Mol Biol Cell, 14, 4813-4825. Attwell, S., Roskelley, C. and Dedhar, S. (2000) The integrin-linked kinase (ILK) suppresses anoikis. Oncogene, 19, 3811-3815. Boulter, E., Grail, D., Cagnol, S. and Van Obberghen-Schilling, E. (2006) Regulation of cell-matrix adhesion dynamics and Rac-1 by integrin linked kinase. FASEB J, 20, 1489-1491. Buday, L., Wunderlich, L. and Tamas, P. (2002) The Nek family of adapter proteins: regulators of actin cytoskeleton. Cell Signal, 14, 723-731. Burridge, K. and Wennerberg, K. (2004) Rho and Rac take center stage. Cell, 116, 167-179. Clark, E.A., Golub, T.R., Lander, E.S. and Hynes, R.O. (2000) Genomic analysis of metastasis reveals an essential role for RhoC. Nature, 406, 532-535. Dai, D.L., Makretsov, N., Campos, E.I., Huang, C , Zhou, Y., Huntsman, D., Martinka, M. and Li, G. (2003) Increased expression of integrin-linked kinase is correlated with melanoma progression and poor patient survival. Clin Cancer Res, 9, 4409-4414. Dai, D.L., Martinka, M. and Li, G. (2005) Prognostic significance of activated Akt expression in melanoma: a clinicopathologic study of 292 cases. / Clin Oncol, 23, 1473-1482. D'Amico, M., Hulit, J., Amanatullah, D.F., Zafonte, B.T., Albanese, C , Bouzahzah, B., Fu, M., Augenlicht, L.H., Donehower, L.A., Takemaru, K., Moon, R.T., Davis, R., Lisanti, M.P., Shtutman, M., Zhurinsky, J., Ben-Ze'ev, A., Troussard, A.A., Dedhar, S. and Pestell, R.G. (2000) The integrin-linked kinase regulates the cyclin Dl gene through glycogen synthase kinase 3beta and cAMP-responsive element-binding protein-dependent pathways. JBiol Chem, 275, 32649-32657. 114 Delcommenne, M., Tan, C , Gray, V., Rue, L., Woodgett, J. and Dedhar, S. (1998) Phosphoinositide-3-OH kinase-dependent regulation of glycogen synthase kinase 3 and protein kinase B/AKT by the integrin-linked kinase. Proc Natl Acad Sci USA, 9 5 , 11211-11216. Deng, J.T., Sutherland, C., Brautigan, D.L., Eto, M. and Walsh, M.P. (2002) Phosphorylation of the myosin phosphatase inhibitors, CPI-17 and PHI-1, by integrin-linked kinase. Biochem J, 367, 517-524. Deng, J.T., Van Lierop, J.E., Sutherland, C. and Walsh, M.P. (2001) Ca2+-independent smooth muscle contraction, a novel function for integrin-linked kinase. 276 , 16365-16373. Dong, L.Q. and Liu, F. (2005) PDK2: the missing piece in the receptor tyrosine kinase signaling pathway puzzle. Am J Physiol Endocrinol Metab, 2 8 9 , El 87-196. Erdodi, F. (2003) Phosphorylation of protein phosphatase type-1 inhibitory proteins by integrin-linked kinase and cyclic nucleotide-dependent protein kinases. 306 , 382-387. Feng, J., Park, J., Cron, P., Hess, D. and Hemmings, B.A. (2004) Identification of a PKB/Akt hydrophobic motif Ser-473 kinase as DNA-dependent protein kinase. J Biol Chem, 279,41189-41196. Filipenko, N.R., Attwell, S., Roskelley, C. and Dedhar, S. (2005) Integrin-linked kinase activity regulates Rac- and Cdc42-mediated actin cytoskeleton reorganization via alpha-PLX. Oncogene, 24 , 5837-5849. Fukuda, T., Chen, K., Shi, X. and Wu, C. (2003) PINCH-1 is an obligate partner of integrin-linked kinase (ELK) functioning in cell shape modulation, motility, and survival. J Biol Chem, 2 7 8 , 51324-51333. Grashoff, C , Aszodi, A., Sakai, T., Hunziker, E.B. and Fassler, R. (2003) Integrin-linked kinase regulates chondrocyte shape and proliferation. EMBO Rep, 4, 432-438. Hannigan, G., Troussard, A.A. and Dedhar, S. (2005) Integrin-linked kinase: a cancer therapeutic target unique among its ELK. Nat Rev Cancer, 5 , 51-63. Hannigan, G.E., Leung-Hagesteijn, C, Fitz-Gibbon, L., Coppolino, M.G., Radeva, G., Filmus, J., Bell, J.C. and Dedhar, S. (1996) Regulation of cell adhesion and 115 anchorage-dependent growth by a new beta 1-integrin-linked protein kinase. Nature, 379, 91-96. Hill, M.M., Feng, J. and Hemmings, B.A. (2002) Identification of a plasma membrane Raft-associated PKB Ser473 kinase activity that is distinct from ELK and PDK1. Curr Biol, 12, 1251-1255. Jaffe, A.B. and Hall, A. (2005) Rho GTPases: biochemistry and biology. Annu Rev Cell Dev Biol, 21, 247-269. Janji, B., Melchior, C , Gouon, V., Vallar, L. and Kieffer, N. (1999) Autocrine TGF-beta-regulated expression of adhesion receptors and integrin-linked kinase in HT-144 melanoma cells correlates with their metastatic phenotype. Int J Cancer, 83, 255-262. Lauffenburger, D.A. and Horwitz, A.F. (1996) Cell migration: a physically integrated molecular process. Cell, 84, 359-369. Li, W., Fan, J. and Woodley, D.T. (2001) Nek/Dock: an adapter between cell surface receptors and the actin cytoskeleton. Oncogene, 20, 6403-6417. Mackinnon, A.C, Qadota, H., Norman, K.R., Moerman, D.G. and Williams, B.D. (2002) C elegans PAT-4/ELK functions as an adaptor protein within integrin adhesion complexes. Curr Biol, 12, 787-797. Mills, J., Digicaylioglu, M., Legg, A.T., Young, C.E., Young, S.S., Barr, A.M., Fletcher, L., O'Connor, T.P. and Dedhar, S. (2003) Role of integrin-linked kinase in nerve growth factor-stimulated neurite outgrowth. J Neurosci, 23, 1638-1648. Mishima, W., Suzuki, A., Yamaji, S., Yoshimi, R., EJeda, A., Kaneko, T., Tanaka, J., Miwa, Y., Ohno, S. and Ishigatsubo, Y. (2004) The first CH domain of affixin activates Cdc42 and Racl through alphaPLX, a Cdc42/Racl-specific guanine nucleotide exchanging factor. Genes Cells, 9,193-204. Muranyi, A., MacDonald, J.A., Deng, J.T., Wilson, D.P., Haystead, T.A., Walsh, M.P., Erdodi, F., Kiss, E., Wu, Y. and Hartshorne, D.J. (2002) Phosphorylation of the myosin phosphatase target subunit by integrin-linked kinase. Biochem J, 366, 211-216. 116 Niewmierzycka, A., Mills, J., St-Arnaud, R., Dedhar, S. and Reichardt, L.F. (2005) Integrin-linked kinase deletion from mouse cortex results in cortical lamination defects resembling cobblestone lissencephaly. J Neurosci, 25, 7022-7031. Nikolopoulos, S.N. and Turner, CE. (2002) Molecular dissection of actopaxin-integrin-linked kinase-Paxillin interactions and their role in subcellular localization. JBiol Chem, 277, 1568-1575. Persad, S., Attwell, S., Gray, V., Delcommenne, M., Troussard, A., Sanghera, J. and Dedhar, S. (2000) Inhibition of integrin-linked kinase (ELK) suppresses activation of protein kinase B/Akt and induces cell cycle arrest and apoptosis of PTEN-mutant prostate cancer cells. Proc Natl Acad Sci USA, 97, 3207-3212. Persad, S., Attwell, S., Gray, V., Mawji, N., Deng, J.T., Leung, D., Yan, J., Sanghera, J., Walsh, M.P. and Dedhar, S. (2001a) Regulation of protein kinase B/Akt-serine 473 phosphorylation by integrin-linked kinase: critical roles for kinase activity and amino acids arginine 211 and serine 343. JBiol Chem, 276, 27462-27469. Persad, S., Troussard, A.A., McPhee, T.R., Mulholland, DJ. and Dedhar, S. (2001b) Tumor suppressor PTEN inhibits nuclear accumulation of beta-catenin and T cell/lymphoid enhancer factor 1-mediated transcriptional activation. J Cell Biol, 153, 1161-1174. Qian, Y., Zhong, X., Flynn, D.C, Zheng, J.Z., Qiao, M., Wu, C , Dedhar, S., Shi, X. and Jiang, B.H. (2005) ILK mediates actin filament rearrangements and cell migration and invasion through PI3K/Akt/Racl signaling. Oncogene, 24, 3154-3165. Radeva, G., Petrocelli, T., Behrend, E., Leung-Hagesteijn, C , Filmus, J., Slingerland, J. and Dedhar, S. (1997) Overexpression of the integrin-linked kinase promotes anchorage-independent cell cycle progression. JBiol Chem, 272, 13937-13944. Robertson, G.P. (2005) Functional and therapeutic significance of Akt deregulation in malignant melanoma. Cancer Metastasis Rev, 24, 273-285. Rosenberger, G., Jantke, I., Gal, A. and Kutsche, K. (2003) Interaction of alphaPIX (ARHGEF6) with beta-parvin (PARVB) suggests an involvement of alphaPIX in integrin-mediated signaling. Hum Mol Genet, 12, 155-167. Sakai, T., Li, S., Docheva, D., Grashoff, C, Sakai, K., Kostka, G., Braun, A., Pfeifer, A., Yurchenco, P.D. and Fassler, R. (2003) Integrin-linked kinase (ELK) is required for 117 polarizing the epiblast, cell adhesion, and controlling actin accumulation. Genes Dev, 17, 926-940. Sarbassov, D.D., Guertin, D.A., Ali, S.M. and Sabatini, D.M. (2005) Phosphorylation and regulation of Akt/PKB by the rictor-mTOR complex. Science, 307, 1098-1101. Stahl, J.M., Sharma, A., Cheung, M., Zimmerman, M., Cheng, J.Q., Bosenberg, M.W., Kester, M., Sandirasegarane, L. and Robertson, G.P. (2004) Deregulated Akt3 activity promotes development of malignant melanoma. Cancer Res, 64, 7002-7010. Stanchi, F., Bordoy, R., Kudlacek, O., Braun, A., Pfeifer, A., Moser, M. and Fassler, R. (2005) Consequences of loss of PENCH2 expression in mice. J Cell Sci, 118, 5899-5910. Tan, C, Cruet-Hennequart, S., Troussard, A., Fazli, L., Costello, P., Sutton, K., Wheeler, J., Gleave, M., Sanghera, J. and Dedhar, S. (2004) Regulation of tumor angiogenesis by integrin-linked kinase (ILK). Cancer Cell, 5, 79-90. Troussard, A.A., Costello, P., Yoganathan, T.N., Kumagai, S., Roskelley, CD. and Dedhar, S. (2000) The integrin linked kinase (ELK) induces an invasive phenotype via AP-1 transcription factor-dependent upregulation of matrix metalloproteinase 9 (MMP-9). Oncogene, 19, 5444-5452. Troussard, A.A., Mawji, N.M., Ong, C , Mui, A., St -Arnaud, R. and Dedhar, S. (2003) Conditional knock-out of integrin-linked kinase demonstrates an essential role in protein kinase B/Akt activation. J Biol Chem, 278, 22374-22378. Troussard, A.A., McDonald, P.C, Wederell, E.D., Mawji, N.M., Filipenko, N.R., Gelmon, K.A., Kucab, J.E., Dunn, S.E., Emerman, J.T., Bally, M.B. and Dedhar, S. (2006) Preferential dependence of breast cancer cells versus normal cells on integrin-linked kinase for protein kinase B/Akt activation and cell survival. Cancer Res, 66, 393-403. Troussard, A.A., Tan, C , Yoganathan, T.N. and Dedhar, S. (1999) Cell-extracellular matrix interactions stimulate the AP-1 transcription factor in an integrin-linked kinase- and glycogen synthase kinase 3-dependent manner. Mol Cell Biol, 19, 7420-7427. 118 Tsao, H., Zhang, X., Benoit, E. and Haluska, F.G. (1998) Identification of PTEN/MMAC1 alterations in uncultured melanomas and melanoma cell lines. Oncogene, 16, 3397-3402. Tu, Y., Huang, Y., Zhang, Y., Hua, Y. and Wu, C. (2001) A new focal adhesion protein that interacts with integrin-linked kinase and regulates cell adhesion and spreading. J Cell Biol, 153, 585-598. Tu, Y., Li, F. and Wu, C. (1998) Nck-2, a novel Src homology2/3-containing adaptor protein that interacts with the LHVI-only protein PINCH and components of growth factor receptor kinase-signaling pathways. Mol Biol Cell, 9, 3367-3382. Wary, K.K., Mainiero, F., Isakoff, S.J., Marcantonio, E.E. and Giancotti, F.G. (1996) The adaptor protein She couples a class of integrins to the control of cell cycle progression. Cell, 87, 733-743. Wary, K.K., Mariotti, A., Zurzolo, C. and Giancotti, F.G. (1998) A requirement for caveolin-1 and associated kinase Fyn in integrin signaling and anchorage-dependent cell growth. Cell, 94, 625-634. Wong, R.P., Ng, P., Dedhar, S. and Li, G. (2007) The role of integrin-linked kinase in melanoma cell migration, invasion, and tumor growth. Mol Cancer Ther, 6, 1692-1700. Xu, Z., Fukuda, T., Li, Y., Zha, X., Qin, J. and Wu, C. (2005) Molecular dissection of PINCH-1 reveals a mechanism of coupling and uncoupling of cell shape modulation and survival. JBiol Chem, 280, 27631-27637. Yamaji, S., Suzuki, A., Kanamori, H., Mishima, W., Yoshimi, R., Takasaki, H., Takabayashi, M., Fujimaki, K., Fujisawa, S., Ohno, S. and Ishigatsubo, Y. (2004) Affixin interacts with alpha-actinin and mediates integrin signaling for reorganization of F-actin induced by initial cell-substrate interaction. J Cell Biol, 165, 539-551. Yamaji, S., Suzuki, A., Sugiyama, Y., Koide, Y., Yoshida, M., Kanamori, H., Mohri, H., Ohno, S. and Ishigatsubo, Y. (2001) A novel integrin-linked kinase-binding protein, afiixin, is involved in the early stage of cell-substrate interaction. J Cell Biol, 153, 1251-1264. Younes, M.N., Kim, S., Yigitbasi, O.G., Mandal, M., Jasser, S.A., Dakak Yazici, Y., Schiff, B.A., El-Naggar, A., Bekele, B.N., Mills, G.B. and Myers, J.N. (2005) 119 Integrin-linked kinase is a potential therapeutic target for anaplastic thyroid cancer. Mol Cancer Ther, 4, 1146-1156. Zervas, C.G., Gregory, S.L. and Brown, N.H. (2001) Drosophila integrin-linked kinase is required at sites of integrin adhesion to link the cytoskeleton to the plasma membrane. J Cell Biol, 152, 1007-1018. Zhang, Y., Chen, K., Guo, L. and Wu, C. (2002a) Characterization of PINCH-2, a new focal adhesion protein that regulates the PINCH-1-ILK interaction, cell spreading, and migration. J Biol Chem, 277, 38328-38338. Zhang, Y., Chen, K., Tu, Y., Velyvis, A., Yang, Y., Qin, J. and Wu, C. (2002b) Assembly of the PINCH-ILK-CH-ILKBP complex precedes and is essential for localization of each component to cell-matrix adhesion sites. J Cell Sci, 115, 4777-4786. Zhang, Y., Guo, L., Chen, K. and Wu, C. (2002c) A critical role of the PINCH-integrin-linked kinase interaction in the regulation of cell shape change and migration. J Biol Chem, 277,318-326. Zhou, X.P., Gimm, O., Hampel, H., Niemann, T., Walker, M.J. and Eng, C. (2000) Epigenetic PTEN silencing in malignant melanomas without PTEN mutation. Am J Pathol, 157, 1123-1128. 120 CHAPTER 5. GENERAL CONCLUSION 5.1 Summary and Future Directions During the course of cancer development, cancer cells are able to promote survival by evasion of apoptosis, become insensitivity to growth-inhibitory signal, and gain the capability to metastasize to remote tissues (Hanahan and Weinberg, 2000). These acquired capabilities make cancer cells more malignant and render them insensitive to common chemotherapeutic agents. In melanoma, we have shown that the expression of the putative tumor suppressor, XAF1, is frequently altered in primary melanoma tissues compared to benign nevi. The XAF1 expression was found to be reduced in both nucleus and cytoplasm of melanoma tissues. Although no statistical significant association of XAF1 reduction with melanoma progression or 5-year patient survival was found, our data indicates that thicker tumor tended to have a greater reduction of nuclear XAF1 expression. Our findings, coupled with other studies that demonstrated the biological functions of XAF1 and its role in enhancing chemosensitivity, all implicate that XAF1 is an important regulator of apoptosis and disruption of XAF1 contributed to the malignancies. Our study also points out the significance of ELK in melanoma migration and invasion. We found that Akt was constitutively activated in PTEN-negative melanoma cell lines. However, disruption of ELK activity or its expression did not result in significant reduction of Akt phosphorylation, suggesting that the activation of Akt is independent of ELK activity in melanoma. Interestingly, ELK knockdown by ELK shRNA inhibited melanoma anchorage-independent growth and significantly reduced melanoma cells migration and invasion through matrigel. The effect of ILK on melanoma cell 121 migration is partially mediated by modulation of Rac and Cdc42 GTPases, as well as by a GTPase-independent mechanism. More intriguingly, we found that ELK knockdown impaired the growth of melanoma tumor xenograft in vivo, implicating ELK as an important regulator of melanoma tumorigenesis. Our study raises many questions that need to be further investigated. We and others have shown that XAFl is predominantly expressed in the nucleus and therefore it raises the speculation that XAFl may have a biological role in the nucleus. Since the apoptosis sensitizing and growth suppressive function of XAFl depends on functional p53 and XAFl overexpression led to the accumulation of p53 and the induction of p53-target gene expression (Lee et al., 2006), it is possible that XAFl may exert its nuclear function by modulating the p53 transcriptional activities or the stability of p53 through influencing the association with MDM2. In addition, information on the differential protein expression of XAFl spice variants and the role of each variant in apoptosis regulation seems to be inconsistent and lacking. Gene knockdown of the specific XAFl isoform by the use of RNA interference should provide valuable insight on the relative contribution of each splice variant to the proapototic function of XAFl. Although ELK has been identified as a serine/theronine kinase whose kinase activity is stimulated by growth factor and cell-matrix adhesion in PI3K-dependent manner (Delcommenne et al., 1998), ELK signaling pathway is likely complex and the downstream effects as a result of ELK stimulation are likely agonist and cell-context specific. In this study, we have found that RNA interference-mediated knockdown of ILK expression inhibited melanoma cell migration, invasion, anchorage-independent growth as well as tumor growth in vivo. These ELK-mediated effects were independent 122 of Akt activation. In addition, our study also suggests a possible role of ELK in modulating melanoma cell migration by a Rho GTPase-independent mechanism. Further studies are required to elucidate the signaling events downstream of ELK and the differential regulation of these signaling pathways. Recently, the rictor-mTOR complex has been implicated in actin cytoskeleton regulation, cell spreading and Akt phosphorylation (Jacinto et al., 2004; Sarbassov et al., 2004; Sarbassov et al., 2005). A recent study by Troussard et al (2006) has also demonstrated a possible regulation of mTOR expression by ELK. Therefore, the effects of ILK on melanoma cell migration, invasion and anchorage-independent growth may be mediated through the regulation of mTOR expression and rictor-mTOR complex formation. Furthermore, it is well recognized that integrin-mediated cell adhesion to extraceullular matrix leads to the activation of Ras/Raf/MEK/MAPK pathway (Lin et al., 1997; Renshaw et al., 1997). Further studies are needed and to see if MAP kinase activity is required for the ELK-dependent regulation of melanoma cell migration and invasion and to determine the possible crosstalk between ELK and other signaling pathways. 123 5.2 References Delcommenne, M., Tan, C , Gray, V., Rue, L., Woodgett, J. and Dedhar, S. (1998) Phosphoinositide-3-OH kinase-dependent regulation of glycogen synthase kinase 3 and protein kinase B/AKT by the integrin-linked kinase. Proc Natl Acad Sci USA, 95,11211-11216. Hanahan, D. and Weinberg, R.A. (2000) The hallmarks of cancer. Cell, 100, 57-70. Jacinto, E., Loewith, R., Schmidt, A., Lin, S., Ruegg, M.A., Hall, A. and Hall, M.N. (2004) Mammalian TOR complex 2 controls the actin cytoskeleton and is rapamycin insensitive. Nat Cell Biol, 6, 1122-1128. Lee, M.G., Huh, J.S., Chung, S.K., Lee, J.H., Byun, D.S., Ryu, B.K., Kang, M.J., Chae, K.S.,, Lee, S.J.L., C. H., Kim, J.I., Chang, S.G. and Chi, S.G. (2006) Promoter CpG hypermethylation and downregulation of XAF1 expression in human urogenital malignancies: implication for attenuated p53 response to apoptotic stresses. Oncogene, 25, 5807-5822. Lin, T.H., Chen, Q., Howe, A. and Juliano, R.L. (1997) Cell anchorage permits efficient signal transduction between ras and its downstream kinases. J Biol Chem, 272, 8849-8852. Renshaw, M.W., Ren, X.D. and Schwartz, M.A. (1997) Growth factor activation of MAP kinase requires cell adhesion. Embo J, 16, 5592-5599. Sarbassov, D.D., Ali, S.M., Kim, D.H., Guertin, D.A., Latek, R.R., Erdjument-Bromage, H., Tempst, P. and Sabatini, D.M. (2004) Rictor, a novel binding partner of mTOR, defines a rapamycin-insensitive and raptor-independent pathway that regulates the cytoskeleton. Curr Biol, 14, 1296-1302. Sarbassov, D.D., Guertin, D.A., Ali, S.M. and Sabatini, D.M. (2005) Phosphorylation and regulation of Akt/PKB by the rictor-mTOR complex. Science, 307, 1098-1101. Troussard, A.A., McDonald, P.C., Wederell, E.D., Mawji, N.M., Filipenko, N.R., Gelmon, K.A., Kucab, J.E., Dunn, S.E., Emerman, J.T., Bally, M.B. and Dedhar, S. (2006) Preferential dependence of breast cancer cells versus normal cells on integrin-linked kinase for protein kinase B/Akt activation and cell survival. Cancer Res, 66, 393-403. 124 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0100902/manifest

Comment

Related Items