Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The effects of vitronectin at sites of myocardial ischemia and infarction Walinski, Hubert Paul 2007

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2007-319529.pdf [ 28.75MB ]
Metadata
JSON: 831-1.0100850.json
JSON-LD: 831-1.0100850-ld.json
RDF/XML (Pretty): 831-1.0100850-rdf.xml
RDF/JSON: 831-1.0100850-rdf.json
Turtle: 831-1.0100850-turtle.txt
N-Triples: 831-1.0100850-rdf-ntriples.txt
Original Record: 831-1.0100850-source.json
Full Text
831-1.0100850-fulltext.txt
Citation
831-1.0100850.ris

Full Text

The Effects of Vitronectin at Sites of Myocardial Ischemia and Infarction by HUBERT PAUL WALINSKI B. Sc. (Honours), McMaster University Hamilton, Ontario, 2001 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE D E G R E E OF DOCTOR OF PHILOSOPHY in THE FACULTY OF G R A D U A T E S T U D I E S (PATHOLOGY AND L A B O R A T O R Y MEDICINE) THE UNIVERSITY OF BRITISH COLUMBIA August 2007 © Hubert Paul Walinski 2007 ABSTRACT Myocardial infarction (Ml) results from the thrombotic occlusion of an atherosclerotic coronary artery in patients with ischemic heart disease. The plasminogen activator (PA)/plasmin system plays significant roles in events leading to wound healing following Ml. Vitronectin (VN) is an acute phase plasma protein which has a direct influence over the constituents of the plasminogen activator/plasmin system. However, the effects of VN on cardiac function and wound healing following ischemia and infarction remain to be elucidated. My dissertation addresses the investigation of the specific role of VN at sites of myocardial ischemia, infarction and fibrosis. More specifically, my work focused on the function of VN in modulation of cardiomyocyte contractility, its effects on cardiac function, and regulation of extracellular matrix degradation in ischemic and infarcted hearts. In vitro and in vivo models have been employed to study the detailed role of VN at sites of ischemia and infarction. Isolated neonatal and adult rat cardiomyocytes, as well as left anterior descending (LAD) coronary artery-ligated transgenic mice have been used to investigate post-MI function and left ventricular (LV) healing. The main findings in this work include the demonstration that during ischemia and infarction VN modulates post-MI myocardial repair/remodeling and cardiac function. VN enters ischemic cardiomyocytes and binds to sarcomeric desmin intermediate filaments apparently causing significant reduction in cardiomyocyte contractility. Further, following infarction VN affects myocardial wound healing by regulating the PA/plasmin and matrix metalloproteinase systems. As well, exercise training in a rat model of LAD ligation induced cardiomyocytes to synthesize and secrete tissue-type plasminogen activator, which may have a role in myocardial healing post-MI. My work on myocardial healing and repair in ii experimental Ml models indicates a potentially important role for plasma proteins such as VN on the PA/plasmin system. iii TABLE OF CONTENTS A B S T R A C T ii TABLE OF C O N T E N T S iv LIST OF T A B L E S ix LIST OF F IGURES x ABBREVIATIONS xiv A C K N O W L E D G E M E N T S xvi DEDICATIONS xviii C H A P T E R I B A C K G R O U N D 1.1 Myocardial ischemia and infarction 1 1.1.1 Incidence and epidemiology 1 1.1.2 Pathogenesis of myocardial infarction 2 1.1.3 Post-infarction remodeling 5 1.1.3.1 Structural and functional alterations 8 1.1.3.2 Cellular alterations 10 1.1.3.3 Strategies for preventing left ventricular remodeling and progression to heart failure 11 1.2 Vitronectin 13 1.2.1 Introduction 13 1.2.2 Distribution and localization 14 1.2.3 Structure and function 15 1.3 Plasminogen activator/plasmin and matrix metalloproteinase system 20 1.3.1 System components 20 1.3.1.1 Plasminogen activator/plasmin system 20 1.3.1.2 Matrix metalloproteinase system 24 1.3.2 Role in the cardiac health and disease 26 1.3.3 Role in coronary artery disease and thrombosis 27 1.3.4 Role in myocardial wound healing 29 1.3.5 Effects of hypertrophic stimuli 33 1.4 Intermediate filaments 34 1.4.1 Structure and function 33 1.4.2 Desmin-associated cardiomyopathies 36 1.4.3 Ischemia, stunning and hibernation 38 C H A P T E R II HYPOTHESIS AND SPECIFIC AIMS 42 C H A P T E R III R E S E A R C H QUESTIONS AND STRATEGIES 44 iv C H A P T E R IV E F F E C T S OF VITRONECTIN ON CARDIAC S T R U C T U R E AND FUNCTION POST-MYOCARDIAL INFARCTION 4.1 Rationale 4.2 Experimental methodology 46 4.2.1 Genotyping of vitronectin knockout mice 47 4.2.1.1 Isolation of genomic DNA 47 4.2.1.2 Determining mouse strain using polymerase chain reaction 47 4.2.2 Mouse model of left anterior descending coronary artery ligation 49 4.2.2.1 Anesthetic technique 49 4.2.2.2 Surgical ligation of left anterior descending artery 52 4.2.3 Assessment of cardiac function 53 4.2.3.1 Echocardiography 53 4.2.3.2 Millar data 54 4.2.4 Histology and morphometry 55 4.2.4.1 Infarct size and infarct expansion 55 4.2.4.2 Left ventricle, right ventricle and septum geometry 56 4.2.4.3 Inflammatory infiltration and angiogenesis 56 4.2.5 Immunohistochemistry 58 4.2.6 Statistics 58 4.3 Results 59 4.3.1 Genotyping 59 4.3.2 Coronary artery anatomy 59 4.3.3 Murine model of left anterior descending coronary artery ligation 60 4.3.4 Comparison of mouse body weights post-myocardial infarction 62 4.3.5 Assessment of infarct induction in wild-type and vitronectin knockout mice at 28 days post-myocardial infarction 62 4.3.6 Accumulation of vitronectin in the infarcted myocardium overtime 63 4.3.7 Examination of fibrous scar formation post-myocardial infarction 67 4.3.8 Assessment of left ventricular and right ventricular area in wild-type and vitronectin knockout mice 67 4.3.9 Examination of wall structure and chamber geometry post-myocardial infarction 72 4.3.10 Examination of leukocyte infiltration at 3 days post-myocardial infarction 73 4.3.11 Examination of vessel formation at 7 and 28 days post- myocardial infarction 77 4.3.12 Assessment of cardiac function post-myocardial infarction 82 v 4.3.12.1 Evaluation of hemodynamic parameters by echocardiography 82 4.3.12.2 Evaluation of hemodynamic parameters by Millar catheter analysis 83 4.4 Discussion 88 4.5 Conclusions 97 4.6 Additional considerations 98 C H A P T E R V E F F E C T S OF VITORNECTIN ON REGULATION OF THE PA/PLASMIN AND MMP S Y S T E M S IN WOUND HEALING POST-MYOCARDIAL INFARCTION 5.1 Rationale 100 5.2 Experimental methodology 101 5.2.1 mRNA expression using reverse transcriptase-polymerase chain reaction 101 5.2.2 Protein distribution in the infarcted left ventricle 102 5.2.3 Western blot protein analysis 102 5.2.4 Matrix metalloproteinase-2 and 9 activity gelatin zymography 102 5.2.5 Statistics 103 5.3 Results 104 5.3.1 Differential gene expression of plasminogen activator/plasmin system components post-myocardial infarction 104 5.3.2 Protein distribution in the infarcted left ventricle 105 5.3.3 t-PA, u-PA, PAI-1 and desmin protein expression post-myocardial infarction 106 5.3.4 Immunostaining for t-PA, u-PA and PAI-1 at 3, 7 and 28 days post- myocardial infarction 111 5.3.5 Evaluation of matrix metalloproteinase-2 and 9 activity in the infarcted left ventricle 111 5.3.6 Distribution of alpha v integrin post-myocardial infarction 112 5.4 Discussion 117 5.5 Conclusions 120 5.6 Additional considerations 120 C H A P T E R VI E F F E C T S OF VITORNECTIN AT SITES OF HYPOXIA AND MYOCARDIAL ISCHEMIA 6.1 Rationale 122 6.2 Experimental methodologies 124 6.2.1 Ex vivo Langendorff perfusion of rat heart with rat serum and fibrinogen 124 6.2.2 Mouse model of left anterior descending coronary •artery ligation 124 vi 6.2.3 Immunohisto- and immunocytochemistry 125 6.2.4 Rat heart and neonatal cardiomyocyte cytoskeleton preparation 126 6.2.5 Western and ligand blot analysis 127 6.2.6 Vitronectin binding activity 128 6.2.7 Isolation of adult rat ventricular myocytes 129 6.2.8 Measurement of cardiomyocyte fractional shortening and shortening velocity 130 6.2.9 Desmin and vimentin alignment 131 6.2.10 Statistics 131 6.3 Results 133 6.3.1 Accumulation of plasma proteins in ischemia-reperfused rat myocardium 133 6.3.2 Influx of vitronectin into ischemic and infarcted myocardium 133 6.3.3 Localization of vitronectin at Z-lines of cardiomyocyte sarcomeres coincides with desmin in at sites of acute myocardial infarction 139 6.3.4 Association of vitronectin with desmin and vimentin cytoskeleton of neonatal and adult cardiomyocytes 139 6.3.5 Vitronectin binds directly to cardiomyocyte desmin intermediate filaments with high affinity 140 6.3.6 Influx of vitronectin into hypoxic cardiomyocytes localizes to desmin intermediate filaments in an energy dependent manner 145 6.3.7 Fetal bovine serum reduces cardiomyocyte contractility in normoxic and hypoxic cardiomyocytes 145 6.3.8 Dose dependent effects of vitronectin on hypoxic cardiomyocytes 146 6.3.9 Vimentin and desmin amino acid sequence alignment 147 6.4 Discussion 151 6.5 Conclusions 158 6.6 Additional considerations 160 C H A P T E R VII E X P R E S S I O N OF CARDIOMYOCYTE TISSUE PLASMINOGEN ACTIVATOR FOLLOWING MYOCARDIAL INFARCTION 7.1 Rationale 162 7.2 Experimental methodology 163 7.2.1 Rat model of myocardial infarction 163 7.2.2 Exercise protocol 164 7.2.3 Isolation and culture of adult and neonatal rat cardiomyocytes 165 7.2.4 Immunohistochemistry and immunocytochemistry 165 7.2.5 Cell and tissue RNA extraction and reverse vii transcription-polymerase chain reaction 166 7.2.6 Microscopy and image analysis 168 7.2.7 Western immunoblotting 168 7.3 Results 170 7.3.1 Increased expression of t-PA, PAI-1 and vitronectin in the infarcted left ventricle 170 7.3.2 Exercise training induces t-PA expression in normal and infarcted ventricles 170 7.3.3 t-PA synthesis, storage and secretion by neonatal rat cardiomyocytes 175 7.3.4 t-PA synthesis, storage and secretion by adult rat cardiomyocytes 177 7.4 Discussion 182 7.5 Conclusions 188 7.6 Additional considerations 189 C H A P T E R VIII CONCLUSIONS AND F U T U R E DIRECTIONS 191 8.1 Contributions to scientific knowledge 194 8.2 Strategies for future directions 195 8.3 Final remarks 201 C H A P T E R IX BIBLIOGRAPHY 202 APPENDIX I LIST OF PUBLICATIONS, A B S T R A C T S AND PRESENTATIONS 232 APPENDIX II A W A R D S 238 APPENDIX III U B C R E S E A R C H ETHICS BOARD CERTIFICATES OF A P P R O V A L 239 viii LIST OF TABLES Table 4-1. Primer sequences used for genotyping of VN+/+ and VN- / - mice 48 Table 4-2. Measurements of age, body weights, and the site of ligation in WT and VN- / - mice at baseline and 28 days post-LAD ligation 63 Table 4-3. Summary of measurements for hemodynamic parameter acquired by echocardiography in baseline and infarcted WT and VN- / - mice 78 Table 4-4. Hemodynamic parameter evaluation in sham-operated control WT and VN- / - mice 83 Table 4-5. Hemodynamic parameter evaluation in WT and VN- / - mice 28 days post-MI using Millar catheter 84 Table 4-6. Summary of morphological analysis associated with sham-operated and infarcted WT and VN- / - mice 85 Table 4-7. Baseline hemodynamic parameter following aortic occlusion evaluated by Millar catheterization in WT and VN- / - mice 86 Table 4-8. Hemodynamic parameter following aortic occlusion evaluated by Millar catheterization in WT and VN- / - mice at 28 days post-MI 86 Table 4-9. Baseline hemodynamic parameter following occlusion of the inferior vena cava as evaluated by Millar catheterization in WT and VN- / - mice 86 Table 4-10.Hemodynamic parameter following occlusion of the inferior vena cava evaluated by Millar catheterization in WT and VN- / - mice at 28 days 86 Table 5-1. Sequences and sizes of primers used for R T - P C R 101 Table 5-2. Numerical data corresponding to quantitative R T - P C R from histograms in Figure 5-1 b. All mRNA level measurements are expressed as a ratio of Ml group/control group or as % G A P D H 105 Table 6-1. Summary of results corresponding to fractional shortening and shortening velocity of VN treated adult rat cardiomyocytes 147 Table 7-1. Sequences and sizes of primers used for amplification of ratt-PA 167 Table 7-2. Sequences and sizes of primers used for amplification of rat t-PA and ANF 167 ix LIST OF FIGURES Figure 1-1. Time course of myocardial response to ischemia 7 Figure 1-2. Linear organization of VN 17 Figure 1-3. Major biological functions of VN 18 Figure 1-4. The effects of VN at sites of myocardial injury 21 Figure 1-5. Regulation of E C M remodeling by the PA/plasmin and MMP Systems 32 Figure 1-6. Fate of myocardium following acute and chronic ischemia injury 39 Figure 4-1. Mouse genotyping performed by P C R 50 Figure 4-2. Summary of experimental methods utilized in mouse model of LAD ligation 51 Figure 4-3. Schematic representation used to determine tissue morphology analysis 57 Figure 4-4. Differences encountered in mouse coronary artery anatomy 61 Figure 4-5. Distribution of body weight of practice mice over time following LAD ligation 64 Figure 4-6. WT and VN- / - mice exhibit no changes in body weights post-MI 65 Figure 4-7. VN accumulates in the infarcted myocardium 66 Figure 4-8. VN- / - mice exhibit a decrease in collagen accumulation 28 days post-MI 69 Figure 4-9. VN- / - mice exhibit no significant changes in infarct expansion 28 days post-MI 70 Figure 4-10. VN- / - and WT mice exhibit no differences in unaffected areas of myocardium 71 Figure 4-11. VN- / - mice exhibit altered wall structure 28 days post-MI 74 Figure 4-12. VN- / - mice exhibit no change in LV diameter 28 days post-MI 75 Figure 4-13. VN- / - mice exhibit reduced MPO staining in the infarcted LV at 3 days post-MI 76 > x Figure 4-14. Accumulation of new vessels in hearts of WT and VN- / - mice 3 days post-MI .79 Figure 4-15. VN- / - mice exhibit a reduction in CD31 positive microvessels 3 days post-MI 80 Figure 4-16. VN- / - mice exhibit a reduction in vWF positive vessels 28 days post-MI 81 Figure 4-17. Measuring hemodynamic parameters by echocardiography 87 Figure 4-18. Representative echocardiographic M-mode tracing 88 Figure 4-19. VN- / - mice exhibit significant improvement in cardiac function 28 days post-MI 89 Figure 4-20. VN modulates cell migration at sites of post-MI injury 93 Figure 5-1 a. Representative gels of PAI-1, t-PA, u-PA, MMP-2 and 9, and desmin mRNA expression levels at 3, 7 and 28 post-MI 107 Figure 5-1 b. VN- / - mice exhibit different mRNA expression of PAs, PAI-1 and gelatinases in the infarcted LV over time 108 Figure 5-2. Protein distribution in Triton-X soluble and insoluble LV fractions of WT and VN- / - mice 109 Figure 5-3. VN affects the regulation of the PAs and PAI-1 post-MI 110 Figure 5-4. Localization of t-PA, u-PA and PAI-1 in infarcted LV o fWT and VN-/ -mice 113 Figure 5-5. MMP-2 and MMP-9 activity in Triton-X soluble LV fraction o fWT and VN- / - mice 114 Figure 5-6. MMP-2 and MMP-9 activity in Triton-X insoluble LV fraction o fWT and VN-/-mice 115 Figure 5-7. VN localizes to integrin alpha v in the infarcted LV 14 days post-MI 116 Figure 6-1. Measuring rat cardiomyocyte contractility using soft edge detection and lonWizard 132 Figure 6-2. In situ and ex vivo acute ischemia-reperfusion injury results in increased vascular permeability and accumulation of circulating VN and fibrin(ogen) within the myocardium and walls of coronary blood vessel 134 xi Figure 6-3. VN progressively accumulates in the ischemic myocardium of LAD ligated mice 136 Figure 6-4. VN accumulates in the Triton-X insoluble cytoskeletal fraction of ischemic myocardium 137 Figure 6-5. VN mRNA is absent from H9C2 cells 138 Figure 6-6. VN localizes to desmin in Z-lines of sarcomeres in ischemic human cardiomyocytes 141 Figure 6-7. Desmin IF are associated with Triton-X insoluble extracts from rat hearts and cultured cardiomyocytes 142 Figure 6-8. Vimentin IF are associated with the Triton-X insoluble extracts from rat hearts and cultured cardiomyocytes 143 Figure 6-9. VN binds to desmin IF with high specificity 144 Figure 6-10. Localization of VN to sarcomeres of hypoxic cardiomyocytes 148 Figure 6-11. FBS reduces contractility of isolated rat cardiomyocytes 149 Figure 6-12. VN exhibits dose dependent effects on fractional shortening and shortening velocity of cultured rat cardiomyocytes 150 Figure 6-13. Proposed model of VN-desmin interactions in regulation of cardiomyocyte sarcomere contractility 159 Figure 7-1. t-PA, PAI-1 and VN accumulate in infarcted rat myocardium 171 Figure 7-2. Exercise increases t-PA in rat myocardium 172 Figure 7-3. Exercise training increases rat cardiomyocyte t-PA synthesis 174 Figure 7-4. ISO-stimulated neonatal rat cardiomyocytes produce and express t-PA 176 Figure 7-5. ISO-stimulated neonatal rat cardiomyocytes store t-PA in vesicles 178 Figure 7-6. ISO-stimulatation increases t-PA accumulation in adult rat cardiomyocytes over time 179 Figure 7-7. ISO-stimulation increases adult rat cardiomyocyte t-PA secretion over time 184 Figure 7-8. Localization of t-PA, PAI-1 and VN at sites of myocardial injury 177 Figure 8-1. Schematic model of VN in regulation of cardiomyocyte contractility and E C M remodelling 193 Figure 8-2. Construction of human desmin peptides and identification of the VN-binding site on the N-terminus of desmin 196 Figure 8-3. Bone marrow cells migrate to a VN-rich infarct region at 14 days post-MI 200 xiii ABBREVIATIONS Ab - antibody A C E - angiotensin converting enzyme ANF - atrial natriuretic factor ATIII - antithrombin III bp - base pairs BSA - bovine serum albumin C A D - coronary artery disease C O - cardiac output C V B 3 - coxsackievirus B3 C V D - cardiovascular disease E C M - extracellular matrix EF - ejection fraction eNOS - endothelial nitric oxide synthase ERK - extracellular signal-regulated kinase FBS - fetal bovine serum FN - fibronectin G A P D H - glyceraldehyde 3-phosphate dehydrogenase H9C2 - embryonic rat heart cell line H&E - hematoxylin and eosin IgG - immunoglobulin G IGF-1 - insulin-like growth factor IL-1 - interleukin 1 IL-6 - interleukin 6 IF - intermediate filaments INF-y - interferon gamma ISO - isoproterenol IVC - inferior vena cava kb - kilobase Kd - dissociation constant kDa - kilo-Dalton LAD - left anterior descending coronary artery LV - left ventricle LVEDP - left ventricular end diastolic pressure L V E S P - left ventricular end systolic pressure xiv MAC - membrane attack complex MAP - mitogen-activated protein MHC - major histocompatibility complex Ml - myocardial infarction MMP - matrix metalloproteinase MPO - myeloperoxidase mRNA - messenger ribonucleic acid PA - plasminogen activator PAI-1 - plasminogen activator inhibitor type 1 PBS - phosphorous buffered saline P E C A M - platelet and endothelial cell adhesion molecule P M S F - phenylmethylsulfonyl fluoride RGD - arg-gly-asp R T - P C R - reverse transcriptase polymerase chain reaction RV - right ventricle S D S - P A G E - sodium dodecyl sulfate polyacrylamide gel electrophoresis S M C - smooth muscle cells T-system - transverse tubular system TBS - tris-buffered saline TGF-f i - transforming growth factor beta TIMP- tissue inhibitor of MMPs TNF-a - tumor necrosis factor alpha t-PA - tissue plasminogen activator TUN EL - terminal deoxynucleotidyl transferase mediated nick-end labeling u-PA - urokinase plasminogen activator uPAR - urokinase plasminogen activator receptor V E G F - vascular endothelial growth factor vWF - von Willebrand factor VIM - vimentin VN - vitronectin WHO - world health organization WT - wild-type ACKNOWLEDGEMENTS Throughout the years, there have been tremendous changes in the landscape with rapid advances in the field of research relating to remodeling following myocardial infarction. Novel mechanisms relating to breakthroughs in understanding the progression of wound healing post-MI are updated each month in a multitude of publications, advancing the field of cardiac pathogenesis. It would be impossible to keep up with this new knowledge and the technologies without the help of my mentors, collaborative scientists, laboratory technicians, fellow graduate students, computing and other laboratory support staff at the James Hogg iCAPTURE Centre for Cardiovascular and Pulmonary Research. I would like to express my sincere gratitude to all of those who were involved in or associated with my thesis project and those who have been a part of my life throughout this exciting journey. In addition, I would like to express my sincere appreciation to the funding agencies, the Canadian Institutes of Health Research and the St. Paul's Hospital Foundation. Their financial assistance has ensured the continuation of my program. Of particular importance to my academic development were both, Dr. Thomas Podor and Dr. Bruce McManus. I am most grateful for their leadership and willingness to mentor me as a graduate student. Drs. Podor and McManus have been highly dedicated to my progress in science and have nurtured me as a young apprentice. Their leadership, attention and patience have been most crucial to my academic development. Moreover, their encouragement and support have helped me endure difficult times throughout my doctoral career. I sincerely thank both Drs. Podor and McManus for their dedication to my projects, in the improvement of my research methods and strategies and refining my manuscripts. I would like to emphasize that I am deeply thankful to both of my mentors who have always encouraged and challenged me to be creative in my thinking, precise and thorough in experimental work, insightful in analysis and hard working when undertaking difficult assignments. I am also most thankful to my supervisory committee members, Dr. John Hill (chairman), Dr. Michael Allard, Dr. Edward Pryzdial and Dr. Keith Walley, who have generously and frequently offered and presented me with insight and guidance. Throughout my program, their advice and constructive criticism have been much xvi appreciated and most essential to the incorporation of new ideas into my work, to the refinement of my research skills and to the generation of the thesis. At the same time, I would like to thank other scientists and collaborators who have worked with me closely over my graduate career. Primarily I would like to thank Dr. Gordon Pate and Mr. Lubos Bohunek for their tremendous work and support with the establishment of the model of myocardial infarction and tireless efforts in working on many aspects of this project. There are numerous people who also deserve special recognition for all of their help and effort with my thesis project. I would like to thank Caroline Cheung, Maziar Rahmani, Hon Leong, Melissa Westoby and Agripina Saurez along with many members of the Podor and McManus laboratories for their assistance and execution of key experiments. Further, I would like to acknowledge Dr. Ana Milena Herrera who has been an understanding and altruistic friend during my years of graduate studies. I am indebted to her for her support, companionship, and compassion during both pleasant and difficult times. Finally, I would like to thank my parents Lech and Alexandra Walinski, as well as my brother Maciej for their infinite love and support over the years. I am deeply grateful for their sacrifice, motivation, inspiration and beliefs, all of which contributed to success in my graduate studies. xvii DEDICATIONS I would like to dedicate this work to my beloved parents Alexandra and Lech for all the love and support, and for creating all of the opportunities that permitted me to explore my talents and pursue my dreams. xviii CHAPTER I BACKGROUND 1.1 Myocardial ischemia and infarction 1.1.1 Incidence and epidemiology Cardiovascular disease (CVD) is the leading cause of mortality and morbidity in men and woman in the industrialized world. The World Health Organization (WHO) estimates that in 2003 16.7 million people around the globe died of CVD, which is over 29 percent of all deaths globally [1]. Today, men, women and children are at risk, and 80 percent of the burden is in low- and middle-income countries. It is estimated that by 2020 heart disease and stroke will become the leading cause of both death and disability worldwide, with the number of fatalities projected to increase to more than 20 million per year and to more than 24 million a year by 2030 [2]. In Canada, it is estimated that a person dies of CVD every seven minutes, thus accounting for more deaths than any other disease. In the year 2000, this totaled 34 percent of male and 36 percent of female deaths in Canada. Moreover, CVD elicits a heavy burden on the Canadian economy costing about $18.4 billion annually [3]. Coronary artery disease (CAD) is the most prevalent type of CVD worldwide. Myocardial infarction (Ml) is the most common consequence of CAD in both the developed and developing world. In Canada approximately eighty thousand people suffer a Ml each year. Although the frequency of Ml increases progressively with age, it may occur at any age. Mis affect only 5% of the population under the age of 40 and 45% occur in patients over the age of 65 [4]. Further, men are more likely to suffer an Ml than women at an earlier age, however the incidence of CAD and Ml 1 has doubled among women of all ages combined in the past decade. In the United States 49.4% of deaths caused by Ml were women in the year 2001 [5]. Risk factors for Ml are these associated with atherosclerosis being influenced by such factors as dyslipidemia, hypertension, tobacco use, diabetes mellitus, lipid rich diet and age. The final determination of risk from any of these factors involves genetic and hormonal interactions. However, over the past several years novel risk factors for CAD have been identified and include elevated homocysteine, C-reactive protein, and fibrinogen levels. Despite the fact that the worldwide incidence of Ml is expected to increase over the next decades, some studies indicate that the incidence of heart failure has been gradually yet steadily declining over the years [6]. Such trends are encouraging and hopefully continue in the future as we strive to explore novel therapies. 1.1.2 Pathogenesis of myocardial infarction Occlusion of a major coronary artery results in ischemia throughout the anatomic region supplied by that artery known as the area at risk, and is most pronounced in the subendocardium. Acutely ischemic myocardium undergoes progressive biochemical, functional, and morphologic changes, the outcome of which largely depends on the severity and duration of flow deprivation. The principal biochemical consequence of myocardial ischemia is the onset of anaerobic glycolysis within seconds, leading to inadequate production of high-energy phosphates (e.g., creatine phosphate and adenosine triphosphate [ATP]) and accumulation of potentially noxious breakdown products such as lactic acid [7]. Myocardial function is exceedingly sensitive to severe ischemia and a striking loss of contractility is evident within 60 seconds of onset. Ultrastructural changes 2 develop within minutes after the onset of ischemia and include sarcoplasmic reticulum and mitochondrial swelling, glycogen depletion and nuclear chromatic clumping and margination [8]. These early changes are reversible, and cell death is not immediate. Ultrastructural evidence of irreversible myocyte injury, primarily structural defects in the sarcolemmal membrane, develop after 20 to 40 minutes in severely ischemic myocardium (with blood flow of 10% or less of normal). As demonstrated experimentally in the dog, only severe ischemia lasting at least 20 to 40 minutes or longer leads to necrosis of affected cardiomyocytes [7]. Classic acute Ml with extensive necrosis occurs when the perfusion of the myocardium is reduced severely below its needs for an extended interval (hours), causing profound, prolonged ischemia and resulting in wavy fibers and permanent loss of function through cell death by coagulation necrosis [9]. In contrast, if restoration of myocardial blood flow follows periods of deprivation less then 20 minutes, loss of cell viability generally does not result. Myocardial ischemia also contributes to arrhythmias. Sudden death, a leading cause of mortality in CAD patients occurs usually due to ventricular fibrillation caused by myocardial irritability induced by ischemia or infarction. Irreversible injury of ischemic myocytes initially occurs in the subendocardial zone. Continuous ischemia causes a wavefront of cell death from the subendocardial region to the less ischemic subepicardial region involving progressively more of the transmural thickness of the ischemic zone. The precise location, size, and specific morphologic features of an acute Ml depend on several factors, including (1) the location, severity, and rate of development of coronary atherosclerotic obstructions; (2) the size of the vascular bed perfused by the obstructed vessels; (3) the duration of the occlusion; (4) the extent of collateral 3 blood vessels; and (5) other factors, such as alterations in blood pressure, heart rate, and cardiac rhythm [4]. There are two types of Mis, each having differing morphology and clinical significance. The more common type is the transmural infarct, in which the ischemic necrosis involves the full or nearly full thickness of the ventricular wall in the distribution of a single coronary artery. The loss of the structural integrity of the collagen-rich ventricular extracellular matrix can result in cardiac rupture, and is one of the major life-threatening complications associated with the early (<72 hours) period after a transmural infarct [4]. In contrast, subendocardial (non-transmural) infarct constitutes an area of ischemic necrosis limited to the inner one-third or at most one-half of the ventricular wall, often extending laterally beyond the perfusion territory of a single coronary artery [4]. The two types of infarcts, however, are closely interrelated because, in experimental models and likely in humans, the transmural infarct begins with a zone of subendocardial necrosis that extends in a wavefront across the full thickness of the ventricular wall. Therefore a subendocardial infarct can occur as a result of a plaque rupture followed by coronary thrombus that becomes lysed before myocardial necrosis extends across the major thickness of the wall. Thrombolytic therapy with various fibrinolytic agents such as streptokinase or tissue plasminogen activator (t-PA) is often used in an attempt to dissolve the thrombus to re-establish blood flow to the area at risk for infarction, and possibly to rescue the viable, ischemic heart muscle. Thrombolysis re-establishes the patency of the occluded coronary artery in about 70% of cases and significantly improves the survival rate. Thrombolysis, however, can at best remove a thrombus occluding a coronary artery; insignificant changes take place in the underlying atherosclerotic 4 plaque that initiated it. Emergency coronary angioplasty to open blocked coronary arteries may be performed instead of thrombolytic therapy, or in cases where thrombolytics should not be used. Stents are also commonly inserted into the artery to prevent re-occlusion of the vessel post-angioplasty. Emergency coronary artery bypass surgery may be required in cases where multiple vessels are occluded [10-12]. A partially completed infarct that is then reperfused can become hemorrhagic due to vascular injury that occurs during the period of ischemia as it turns leaky upon restoration of flow. Moreover, morphologic disintegration of cardiomyocytes that are critically damaged by the preceding ischemia becomes accentuated or accelerated by reperfusion [13, 14]. With early reperfusion of an area of ischemia, irreversibly injured myocytes often have necrosis with contraction bands which are intensely eosinophilic transverse bands that span the involved myofibers [15]. Contractile bands are produced by hypercontraction of myofibrils in the dying cell that has damaged membranes after ischemia due to exposure to plasma calcium ions. Thus, reperfusion has a dual effect salvaging reversibly injured cells, as well as in altering the morphology of lethally injured cells at the time of reflow [13, 16, 17]. 1.1.3 Post-MI cardiac remodeling To date, current therapies are able to restore blood flow and limit the area of infarction, however efforts to manage myocardial healing proved of diminutive benefit. Immediately following ischemic injury the heart undergoes a complex wound healing process also referred to as remodeling. Specifically, cardiac remodeling is a process by which the size, shape, and function of the heart are 5 regulated by mechanical, neurohormonal, and genetic factors. The remodeling is ongoing and extends for weeks to months depending on severity of injury sustained by the left ventricle (LV) [18-20] (Figure 1-1). In mammals cardiac wound healing is greatly hampered as virtually no regeneration of the myocardium occurs and dead cells are replaced by a scar. The remodeling process is highly regulated and involves invasion, transformation and death of various cell types. Remodeling of the infarcted LV involves genomic, molecular, cellular and interstitial modifications to the infarcted and non-infarcted myocardium as evident by structural and functional changes. The initial remodeling phase improves cardiac output (CO) and may actually serve a beneficial role by promoting survival, however progressive long-term remodeling results in reduction of ejection fraction (EF), a strong predictor of mortality. Within hours following ischemia, cardiomyocytes undergo necrosis that initiates the activation of the complement cascade and cytokine-driven events, that in turn signal the inflammatory response necessary to clear away the debris and orchestrate downstream healing events. Similarly, myofibroblasts appear a short period following inflammatory cells and are essential for reconstruction of new collagen tissue and organization of the scar. In studies using a rat model of Ml alterations to connective tissue were evident within the first hour and significant degradation in collagen was noted by 1 day [21]. Days to weeks following the injury, chronic inflammatory cells such as macrophages and mast cells secrete cytokines and growth factors which promote collagen synthesis by proliferating fibroblasts in order to replace myocyte loss. Additionally, neovascularization is also stimulated by the release of growth factors from the inflammatory cells. During 6 Myocardial Ischemia T Hours Necrosis/Apoptosis Cytokine Activation Inflammatory Reaction Fibroblast Proliferation T Provisional Matrix Healing/Scar Formation Myocardial Dysfunction Neovascularization Days Weeks Months Figure 1-1. Time course of myocardial response to ischemia. Hours following ischemia, cardiomyocytes undergo necrosis. Activation of the complement cascade and cytokines serves to recruit leukocytes and initiate the inflammatory response. Inflammation, while potentially detrimental to surviving cardiomyocytes is necessary to clear away the debris and orchestrate downstream healing events. Chronic inflammatory cells such as macrophages and mast cells secrete cytokines and growth factors, which in turn activate fibroblasts to proliferate and synthesize collagen to replace myocyte loss. Neovascularization is also stimulated by the release of growth factors from the inflammatory cells. Scar remodeling may continue for months to years, depending on the extent of the initial ischemic event. 7 the first week post-MI, the infarcted region may either contract or expand after loss of viable muscle is completed [22] and following several weeks a solid scar with a solid collagen structure is formed, depending on the extent of the myocardial injury. Cardiac fibrosis is reparative replacing areas of myocyte loss with structural scar or reactive involving diffuse increases in extracellular matrix (ECM) deposition at sites unrelated to focal injury. Furthermore, perivascular fibrosis surrounding intracoronary arterioles impairs myocyte oxygen availability, reduces coronary reserve, and exacerbates myocyte ischemia. Timing of control of post-MI fibrosis is critical since if prolonged it leads to progressive hypertrophy and dilation, eventually resulting in global fibrosis causing heart failure [23, 24]. Collagen-rich scar remodeling may however continue for up to months and even years post-MI. Several factors have been implicating in having a substantial effect on infarct healing. Reperfusion promotes cardiomyocyte viability and thus limits infarct size along with other beneficial effects on healing. Furthermore, factors such as age, sex, drugs and neurohumoral response have also been suggested to contribute to infarct healing and expansion [25]. Thus, cardiac remodeling is an important aspect of cardiovascular disease progression and is therefore emerging as a therapeutic target in heart failure. 1.1.3.1 Structural and functional alterations Progressive remodeling post-MI causes significant changes in heart geometry, mass and volume, which adversely affects cardiac function [26-29]. LV remodeling is an age dependant process [30] that is typically proportional to infarct size, and is directly proportional to decline in EF [31]. In the infarcted heart LV remodeling typically involves a combination of infarct expansion, pressure and 8 volume overload. Extensive studies using animal models of Ml have been utilized to examine the relationship between infarct/remodeling myocardium and ventricular function [32-34]. Post-MI ventricular remodeling in a rat, for example, closely resembles what is observed in the human and is therefore a useful tool. In experimental models infarct expansion, dilation and thinning can occur as early as one day post-MI [35] and can progress for days to weeks post-infarction [34]. LV dysfunction associated with the structural changes is apparent as soon as several days after the insult [26, 34], however some studies report that normal muscle function is maintained for several weeks post-MI before a difference is noted [36]. Drastic changes are also noted in the function of the heart, which corresponds to the extent of myocardial loss. Interestingly, in small infarcts (less then 20%) no hemodynamic changes are noted in the rat hearts. On the other hand in animals with large infarcts (greater then 20%), post-MI LV enlargement has been characterized not as a result of progressive infarct expansion but, rather, is caused by the increase in length of the remaining viable cardiac tissue [37]. The non-infarcted myocardium hypertrophies as a compensatory mechanism in response to the increased stress and causes increased left ventricular end diastolic pressure (LVEDP) with progressive LV dilation occurring for several months and up to a year [38]. Over time myocardial fibrosis itself has important functional consequences for the remodeling heart. Progressive increases in fibrosis can cause systolic dysfunction and LV hypertrophy. Furthermore, fibrosis causes increases in the volume of the heart relative to the volume of muscle when compared to normal hearts [39]. Exaggerated mechanical stiffness caused by increased E C M content results in diastolic dysfunction. Moreover, at the myocyte level increased collagen content disrupts electrotonic connectivity between cells providing an electrical 9 substrate for reentrant arrhythmogenesis [40]. By impairing cardiomyocyte contractility, oxygenation and metabolism, fibrosis contributes significantly to post-MI ventricular dysfunction [41]. 1.1.3.2 Cellular alterations Following Ml various cell types are involved in remodeling process. Cardiomyocytes are the most abundant cell type by volume and significantly contribute to overall heart mass and function. Post-MI, surviving cardiomyocytes become elongated or hypertrophied with the sarcolemma expanded as a compensatory response in order to maintain contractile function. These alterations are associated with the activation of hypertrophy-induced genes which regulate the assembly of contractile proteins and new sarcomeres [34, 42]. Increased levels of cardiomyocyte apoptosis are also evident following Ml although the exact role of this mode of cell death as a part the remodeling process is poorly understood. Apoptosis may act as an important regulatory mechanism which is involved in the adaptive response to cardiac hypertrophy as previously indicated in a model of pressure-overload [43]. Cardiac fibroblasts also play a major role in post-MI remodeling. Fibroblasts play a central role as mediators of inflammatory and fibrotic myocardial remodeling in the injured and failing heart. Proliferating fibroblasts stimulate collagen synthesis to replace necrotic cardiomyocytes in the region of infarction, as well as in the non-infarcted region [44]. Within the infarct zone these cells first construct the immature scar of thin, loosely packed collagen fibers and subsequently produce a mature scar. The fibroblast phenotype and functional capabilities are regulated by cytokines and growth factors such as interleukin 1 (IL-1), tumor necrosis factor 10 alpha (TNF-a), Interferon-gamma (IFN-y), and interleukin 6 (IL-6) that are released by various cell types including fibroblasts themselves. IL-1 is a robust and multipotent agonist that strongly inhibits proliferation and enhances chemotaxis [45], while TNF-a and IFN-y are less effective by themselves but potentiate antiproliferative and pro-migratory responses of IL-1. Furthermore, fibroblasts serve as intermediate sensors and amplifiers of signals from immune cells and cardiomyocytes, through production of cytokines, growth factors, prostaglandins, and nitric oxide [46, 47]. Excessive remodeling and chronic injury ultimately overcomes the compensatory reactions of the myocardium and progresses to heart failure which is accompanied by persistent inflammation and fibrosis in which cardiac fibroblasts have an active role. However, to date the specific mechanisms of chronic activation of cardiac fibroblasts is poorly understood. Additionally, myofibroblasts are also involved in post-MI wound healing. This specialized phenotype of activated fibroblasts express contractile proteins and intermediate filaments (IF), including smooth muscle a-actin, vimentin and desmin; contract collagen gels in vitro; and may potentially play an important role in wound closure and structural integrity of healing scars. Cardiac myofibroblasts were shown to persist in mature infarct scars and drive the progression to fibrosis [48]. 1.1.3.3 Strategies for preventing LV remodeling and progression to heart failure It is evident that the neurohumoral system plays a major role in post-MI remodeling. Activation of the neurohumoral systems results in increased wall stress, thus causing LV dilation and progression to heart failure [49, 50]. Additionally, chronic activation promotes generation of reactive oxygen species (ROS) impairing cardiac function [51, 52]. Over the years interventions have been 11 used with favourable impact on the remodeling process in order to prevent progression to heart failure. Drugs such as statins have been shown to increase endothelial nitric oxide synthase (eNOS) production while reducing formation of reactive oxygen species [53, 54]. Angiotensin converting enzyme (ACE) inhibitors, angiotensin receptor blockers and beta blockers have been shown to alter LV remodeling [55, 56]. Additionally, inhibitors of matrix metalloproteinases (MMPs) can also be used as potential therapy as they have been shown to attenuate LV dilation. Furthermore, utilization of left ventricular assistance devices can lead to normalization of LV chamber geometry, regression of cardiomyocyte hypertrophy, and reduction in collagen [57]. In recent years regeneration of cardiac muscle has also received increased attention. It is thought that following Ml the ideal treatment would not only induce angiogenesis and improve cardiac function, but also replace dead cardiomyocytes. To date there exists a great deal of controversy about the regenerative capability of cardiomyocytes and therefore other methods such as cell transplantation have been implemented. While smooth muscle cells (SMC), skeletal myocytes and bone marrow cells have been successfully engrafted into the infarcted myocardium with modest enhancement to cardiac function [58-60], engraftment of fetal cardiomyocytes provide contradicting results in various studies [61-64]. Increase in cardiac function following cell transplantation can be caused by a number of mechanisms which include; increasing wall thickness and decreasing dilation, secretion of growth factors which promote angiogenesis; decreasing apoptosis of non-infarcted cardiomyocytes; and the formation of new cardiomyocytes [42]. Despite the potential therapeutic benefit of stem cells for post-MI LV regeneration, 12 extensive knowledge is still required in order to understand and combat heart failure in a clinical setting. 1.2 Vitronectin 1.2.1 Introduction Vitronectin (VN) is an acute phase plasma protein with multiple ligands that is produced primarily in the liver and is found mainly in the blood plasma and E C M [65]. VN is involved in numerous physiological processes such as fibrinolysis, coagulation, humoral immune response, angiogenesis and tumor metastasis [66]. In the extracellular matrix VN has multiple roles in cell adhesion, spreading, and migration by signaling Arg-Gly-Asp (RGD) sequence and, in particular, the regulation of plasminogen activator inhibitor type 1 (PAI-1) [67-69] by stabilizing the active, inhibitory conformation [70-72]. The diverse role of VN is dependent on its interactions with multiple ligands. VN binds glycosaminoglycans [73], collagen [74], heparin [75], plasminogen [76] and the urokinase-receptor [77], as well as various integrins including avb3, avB5, avB1, allB3, avB6 and avB8 [78, 79]. In both normal and injured tissues VN binds IF such as vimentin and keratin [80, 81], while proteins such as factor XIII and PAI-1 promote conformational change in VN allowing for its self-association into multimeric structures which are involved in the control of different biological reaction systems [82, 83]. Additionally, VN interacts with membrane attack complex of C5b-9 [84], and to thrombin-antithrombin III (ATIII) complexes [85] implicating its participation in the immune response and in the regulation of clot formation. 13 1.2.2 Distribution and localization VN was first discovered in 1967 by Holmes et al labeled as serum spreading factor or S-protein [86] and first purified from human serum in 1983 by Heymens et al [65], as well as Barnes et al [87]. The majority of VN is synthesized in the liver, however VN was present in E C M of other organs such as kidney, spleen, lung, brain and heart in lower concentrations [87] and has been purified from human, rabbit, mouse, rat, hamster, guinea pig, dog, horse, porcine, bovine, goat, sheep, chicken and goose tissues [88, 89]. Although VN biosynthesis is predominantly attributed to hepatocytes in vivo, a number of other cells are capable of its synthesis. Macrophages, monocytes, HUVECs and different hepatoma cells are all sources of VN ..production in vitro. Biosynthesis of VN is regulated by different factors including transforming growth factor beta (TGF-B), platelet-derived growth factor, epidermal growth factor and IL-6 [90, 91]. VN is highly conserved among species sharing significant sequence homology, with some species-specific variations [89]. In the plasma VN circulates in concentrations of 200-400 ug/mL or 3-5 uM and constitutes 0.2-0.5% of total plasma protein [92]. Concentrations of VN in the plasma do not differ from that in serum as encountered with fibronectin (FN) and fibrinogen. Platelets contain approximately 0.2% of VN which is stored primarily in alpha-granules [93, 94]. VN is also found in urine, amniotic fluid and bronchoalveolar lavage fluid with no age dependent difference in concentrations. In the circulation VN is primarily found in the "closed" confirmation, while a small fraction (~ 2%) is in the "open" form [95]. Moreover, "open" VN occurs in a monomeric form which typically binds to other VN molecules forming multimers and ternary complexes, or other associated factors such as ATI 11, C5b-9 complex. In the E C M VN is predominately multimeric and 14 bound to the matrix, heparin or forms multimers where it serves a function in adhesion, spreading, migration and stabilization of PAI-1 [96]. Accumulation of VN has been identified at sites of tissue damage particularly in areas of sclerosis, fibrosis and necrosis of various tissues including the liver, skin, kidney, nerve, vessels, bone marrow, lymphoid tissue and heart [97-101]. 1.2.3 Structure and function VN is composed of several structural domains as detailed by Suzuki et al [102]. The first 45 (amino acids 1-44) form the amino terminal segment of VN which is also know as somatomedin B due to its identical structure. The somatomedin B domain harbors functional groups which are involved in the binding of PAI-1 [69]. The Arg-Gly-Asp (RGD) sequence (residues 45-47) follows the somatomedin B domain and is responsible for mediating the attachment and spreading of cells to the E C M via its specific integrin receptors. Residues 53-64 are involved in the binding of the ATI 11 complex, and in neutralizing at least part of VN's polycationic domain (residues 348-379), present at its carboxyl-terminal end. An ionic interaction between the above mentioned acidic and basic stretches is probably involved in stabilizing the 3-dimensional (3-D) VN structure as well as in the formation of its multimers. There are two collagen binding domains on V N . A sequence adjacent to the R G D sequence as well as a site adjacent to the heparin binding domain. A region spanning the majority of the VN molecule (residues 132-459) accommodates six hemopexin repeats which also anchors a disulfide bridge (Cys274-Cys453). Cleavage of this bond results in 10 and 65 kDa fragments of V N . In the carboxyl terminal of VN two distinct domains are found. Residues 332-348 is the binding site for plasminogen, which is directly followed by heparin 15 binding sequence, in which the glycosaminoglycan binding sequence is also found (residues 348-379) [103]. Also found in the carboxyterminal region is an additional binding site for PAI-1 found between residues 348-370 [104]. VN also contains numerous sites for proteolytic cleavage and phosphorylation sites. VN becomes phosphorylated in the amino terminus by casein kinase II Thr 50 and Thr 57 [105], as well as in the carboxyl terminus edge of VN by protein kinase C at Ser 362 and by cAMP-dependent protein kinase at Ser 378 [106]. Degradation of VN occurs by thrombin, elastase, plasmin and Granzyme B as demonstrated by in vitro experiments. Furthermore, in blood it appears that VN is also cleaved endogenously at Arg379-Ala380, by an unidentified protease. Linear organization of VN is described in Figure 1-2. The functions of VN are both diverse and complex in nature. As previously mentioned, VN participates in pericellular proteolysis of the E C M through its localization and binding to PAI-1, participates in the immune response by binding to complement, as well as in regulation of clot formation by heparin and ATI 11 (Figure 1-3). One the most essential functions of VN is in regulating hemostasis. Following vascular injury the coagulation cascade is initiated in order to prevent excessive loss of blood. A series of steps take place which eventually results in the generation of thrombin, a serine protease which in turn cleaves soluble fibrinogen into insoluble fibrin. It is fibrin in conjunction with aggregating platelets that establish a haemostatic plug at the site of injury. In the circulation thrombin is bound and inhibited by ATIII, a serpin which forms a tight complex. VN acts as a pro-coagulant through its interactions with heparin. By binding heparin, VN neutralizes it and together they are cleared from the circulation. The absence of heparin prevents the facilitation of ATIII binding, allowing for interactions with 16 332 348 361 370 PAI-1, UPAR U integrin I l collagen, TAT plasminogen I i Heparin PAI-1 C O O H Figure 1-2. Linear organization of VN. Upper panel: localization of the binding domains of VN towards various ligands; the binding sites for plasminogen activator inhibitor-1 (PAI-1), urokinase receptor (uPAR), integrins, thrombin ± antithrombin III complex (TAT) and collagen are located in the N-terminus of the molecule, while the binding domains for plasminogen, heparin and PAI-1 are located in the carboxyl terminal edge. Lower panel: localization of the proteolytic cleavage and phosphorylation sites in V N . In vitro, VN undergoes phosphorylation by casein kinase II (CKII) at threonine50 and threonine57 adjacent to the R G D domain, by protein kinase C (PKC) at serine362 and by cAMP-dependent protein kinase (PKA) at serine378, both in the carboxyl terminus edge of V N . In vitro, VN is susceptible to degradation by thrombin, elastase and plasmin at the indicated cleavage sites. The endogenous cleavage site of VN isolated from human blood is also indicated. Adapted from Int J Biochem Cell Biol. 1999 May;31(5):539-44. 17 Cell contractility Ceil signaling (integrins, uPAR, growth factors) Extracellular anchoring (GAG, collagen) Cell adhesion, migration, spreading (integrin. uPAR) Vitronectin Immune defense (complement) Fibrinolysis (PAI-1, uPAR) Hemostasis (thrombin, factor Xa) Figure 1-3. Major biological functions of VN. VN is anchored to the extracellular matrix via its collagen binding domain, and its glycosaminoglycan (GAG) binding-domain. It promotes cell adhesion, spreading and migration by interaction with specific integrins, as well as with the urokinase receptor (uPAR). The interaction of VN with integrins, in the presence of growth factors (insulin, basic fibroblast growth factor), has been also implicated in cell proliferation. VN is involved in fibrinolysis, due to its ability to stabilize the active conformation of plasminogen activator inhibitor-1 (PAI-1), and to bind the uPAR. It is also involved in the immune defense through its interaction with the terminal complex of complement and in hemostasis through its binding to heparin and thereby neutralizing the antithrombin III inhibition of thrombin and factor Xa . VN also exhibits a key role in cell contractility. Adapted from Int J Biochem Cell Biol. 1999 May;31(5):539-44 . 18 thrombin and therefore preventing fibrin formation [107, 108]. VN also binds directly to the ATIII complex and clears the inactivated pair from circulation [85]. Furthermore, through its interaction with PAI-1, VN stabilizes its conformation and promotes its inhibitory activity. Prevention of plasminogen activation exerts changes in a number of physiological and pathological processes. The binding of VN to PAI-1 inhibits fibrinolysis, interferes with cell adhesion and migration, and promotes thrombus formation. Moreover, this interaction affects vital pathological processes including tissue remodeling, angiogenesis, tumor growth and metastasis. Through specific interactions with various integrins, VN is involved in cell adhesion, regulation of cytoskeletal reorganization, intracellular ion transport, lipid metabolism, activation of signaling pathways and gene expression. As previously stated numerous VN receptors have been identified which come from the integrin family consisting of non-covalently linked a and B subunits. VN receptors share either the av or 63 subunits and include avB1, avB3, avB5, avB6, avB8, and allbB3 [78, 79, 109]. All these receptors use the R G D sequence as a common binding motif within their ligands to bind to V N . Integrin avB5 exhibits selective affinity binding strictly to VN in the E C M . However, not all of these receptors are specific for binding V N ; some bind other proteins containing the R G D sequence such as fibrinogen, FN, von Willebrand factor and thrombospondin. avB3, which binds VN with high affinity, is primarily responsible for cell migration onto various substrates and E C M of tissues. VN also has a strong function in linking urokinase-dependent events, particularly in directing the localization of urokinase plasminogen activator receptors (uPAR) into focal adhesions in order to promote urokinase plasminogen activator (u-PA) mediated proteolysis. Binding of E C M VN to uPAR is regulated by u-PA which increases VN-uPAR association and thus promotes cell adhesion. However, 19 the binding of uPAR to VN can be inhibited by PAI-1, as both uPAR and PAI-1 bind overlapping regions on VN that is located close to the integrin binding site [110]. Moreover, through its binding to uPAR, VN promotes interactions with integrins av, a5, 61 and 63 [111] thereby regulating actin cytoskeleton reorganization and induction of cell motility [112]. VN-uPAR interactions have also been implicated in uPAR-mediated signaling as demonstrated by S M C chemotaxis and cytoskeletal rearrangements [113]. Extensive research has shown that VN induces uPAR-dependent signaling primarily through p130Cas/Crk/DOCK180/Rac and is independent of MEK/ERK activity [114]. Therefore, through its interactions with uPAR VN plays a key role in regulating cell adhesion, migration as well as cytoskeletal reorganization which are important to both physiological and pathological processes. Thus, VN encompasses multiple functions which promote wound healing and contribute to a variety of mechanisms controlling and minimizing tissue injury during persistent inflammation in various tissues including the heart (Figure 1-4). However, despite clear evidence of VN in both health and disease VN knockout mice (VN-/-) mice exhibit normal mammalian development, fertility and survival [115]. 1.3 Plasminogen activator (PA)/plasmin and matrix metalloproteinase (MMP) systems 1.3.1 Components 1.3.1.1 PA/plasmin system The fibrinolytic system also referred to as the plasminogen activator (PA)/plasmin system has many diverse physiological and pathological functions. Its primary role is in the dissolution of fibrin however its role has also been implicated 20 Figure 1-4. Potential effects of VN at sites of myocardial injury. Following myocardial ischemia inflammatory cells and plasma proteins influx into the E C M through permeabilized vessels. VN may potentially effect fibroblasts, inflammatory and endothelial cells by mediating adhesion, migration and proliferation, which in turn influence. E C M remodeling. Influx of VN into cardiomyocytes may reduce contractility and potentially affect structural integrity. 21 in regulation of cellular activity, tissue development and E C M remodeling. Activation of the liver derived proenzyme plasminogen into the active enzyme plasmin causes plasmin-dependent cleavage of E C M proteins, as well as activation of proteinases and growth factors. Plasminogen activators t-PA and u-PA belong to the family of serine proteases, which are the primary initiators of the conversion of pro-form plasminogen into the active plasmin through enzymatic cleavage. Typically t-PA is associated with maintaining vascular patency [116] while u-PA mediates tissue remodeling [117, 118] however both PAs exhibit a high functional overlap. The activation of plasminogen is regulated by the balance between PAs and PAI-1. t-PA has a primary role in the lysis of fibrin clots in the circulation. t-PA is continuously secreted in the active form by endothelial cells, mast cells, keratinocytes, melanocytes, neurons, S M C , fibroblasts, as well as cardiomyocytes [119-123]. In the absence of fibrin, t-PA activates plasminogen at a low rate. As a 70 kDa glycoprotein, t-PA exists primarily in the single-chain form but is cleaved by plasmin to a two-chain form similar to u-PA. The protein consists of 5 distinct domains including the finger domain in the N-terminus followed by a growth factor domain and two kringle domains [124]. The C-terminal region contains the serine protease domain. Symbolic of all serine proteases t-PA also contains a catalytic triad (His322/Asp371/Ser463) which is involved in substrate cleavage. The finger and kringle domains are important in binding of t-PA to fibrin [125]. u-PA is a single-chain glycoprotein with a molecular mass of 53 kDa which is converted to a two-chain form by plasmin cleavage. The structure of u-PA protein is composed of three domains. In the N-terminus the growth factor domain is followed by the kringle domain, together known as the amino-terminal fragment. 22 The serine protease domain is found in the carboxyl-terminal region. Like t-PA, u-PA is secreted by various types of cells including numerous inflammatory and cancer cells (breast, colon, ovarian, gastric, cervix, endometrium, bladder, kidney, and brain [126]. Furthermore, u-PA has a high-affinity binding site on the cell surface for its receptor, u-PAR. u-PAR is a heavily glycosylated 55 kDa protein that is composed of three domains D1, D2 and D3 and contains a glycosyl-phosphatidyl-inositol or GPI anchor in the C-terminus which is integrated into the outer leaflet of cell membrane [127]. u-PAR is responsible for the primary activation of plasminogen in tissues via u-PA binding, however its role extends further than local proteolysis participating in intracellular signal transduction [128]. The diverse functions of PAI-1 have been demonstrated in regulating hemostasis, wound healing, atherosclerosis, metabolic disturbances such as obesity and insulin resistance, tumor angiogenesis, chronic stress, bone remodeling, asthma, rheumatoid arthritis, fibrosis, glomerulonephritis and sepsis [129]. These functions are attributed to a combination of factors including the antiproteolytic activity of PAI-1, as well as to the binding interactions with V N . PAI-1 is a 54 kDa glycoprotein which belongs to a family of serine protease inhibitors (serpins) and is primarily found in blood, stored in a-granules of platelets. PAI-1 is expressed and secreted by a variety of cells including endothelial cells, adipocytes and cardiomyocytes, S M C , fibroblasts, monocytes and macrophages [129-131] and is significantly increased in the acute phase of injury which is influenced by a large number of factors including: cytokines, thrombin, insulin and atherogenic lipoproteins [132]. PAI-1 inhibits plasminogen activation preventing t-PA and u-PA activity by forming a 1:1 stoichiometric reversible complex, hence decreasing proteolytic activity and promoting fibrin matrix stability. Additionally, active PAI-1 23 interacts specifically with VN which alters VN's structural confirmation by binding to the reactive centre loop of PAI-1, thus making it more stable [133]. Binding of PAI-1 to VN also competes with uPAR-dependent or integrin dependent binding of cells to the E C M which are crucial to numerous physiological and pathological processes [134]. PAI-1 may therefore play a role in cell adhesion and/or migration via a mechanism independent of its antiproteolytic activity. The binding of u-PA to uPAR stimulates intracellular signaling [114] and induces conformational changes in uPAR [135] which increase its affinity for VN and promote its interaction with a variety of integrins [114, 136]. By disrupting u P A R - V N and integrin-VN interactions, PAI-1 can detach cells from E C M as a result of binding to u-PA present in u - P A - u P A R -integrin complexes [134, 137]. Moreover, the anti-adhesive effect of PAI-1 on cells adherent to VN have been associated with apoptosis mediated through the caspase 3 pathway [138]. 1.3.1.2 MMP system MMPs are proteases which hydrolyze the E C M and have a diverse role in both physiological and pathological functions. All MMPs consist of a pro domain, catalytic domain, a hinge region and hemopexin domain [139], and are either anchored to cell plasma membrane or secreted. All MMPs possess common functional features including: 1) they are secreted in a latent proform and require activation for proteolytic activity, 2) they contain zinc at their active site, 3) they need calcium for stability, 4) they function at neutral pH, and 5) their function is inhibited by tissue inhibitors of MMPs (TIMPs) [140]. MMPs are categorized into six groups based on their substrate specificity, domain organization and sequence specificity. The groups are collagenases (MMP-1, 8 and 13), gelatinases (MMP-2 24 and 9), stromelysins (MMP-3 and 10), metrilysins (MMP-7 and 26), membrane-type MMPs or MT-MMPs (MMP-14, 15, 16, 17, 24 and 25) and other (MMP-12, 19, 20, 21, 23, 27 and 28). All collagenases cleave fibrillar collagens (types I, II, and III) which are tightly bound and cross-linked. Gelatinases are capable of degrading gelatin, but also type IV collagen in basement membranes. Stromelysins are active against a broad spectrum of E C M components including proteoglycans, laminins, FN , V N , and collagens, while MT-MMPs activate some latent MMPs, having the capacity to cleave many of the E C M components [139]. Although MMPs are best known for their role in the proteolysis of extracellular protein targets, some MMPs are also localized to the cells [141]. For example, MMP-2 is also localized to the sarcomere within cardiomyocytes where it proteolyzes contractile proteins causing acute, reversible contractile dysfunction [142]. The regulation of MMP activity is under a tight control and occurs at three levels; transcription, activation of latent proform, and inhibition by TIMPs. In normal adult mammalian tissues MMPs expression is generally low, however it is substantially upregulated under various conditions. Induction and stimulation of MMP at the transcriptional level is regulated by a variety of mediators including cytokines, hormones and growth factors [140]. Latent MMPs are activated by three different mechanisms which include 1) stepwise activation, 2) activation on the cell surface by MT-MMPs and by 3) intracellular activation [143]. Pro-MMP are activated through the cleavage of the pro-peptide domain by proteinases including trypsin, chymase, elastase, and plasmin, the most potent proteinases in vivo. Cleavage of the propeptide region induces a conformational change in MMP structure, rendering the activation site exposed. MT-MMPs also activate latent MMP particularly on the surface of cells. 25 Inhibition of active MMPs occurs by the binding interactions with TIMPs. There are four members in the TIMP family; 1, 2, 3 and 4 that bind to MMPs in a 1:1 molar ratio and inhibit its activity by interacting with its zinc-binding site within the catalytic domain. TIMPs generally vary in the degree of specificity towards different MMPs. TIMPs 1 and 2 exhibit more diverse biological functions potently inhibiting the majority of MMPs with exception of MMP-2 and 9. TIMP-3 specifically inhibits MMP-1, 2, 3, 9 and 13, while TIMP-4 is highly expressed in cardiac tissue and inhibits MMP-1, 3 ,7 and 9 [144]. Furthermore, other naturally occurring inhibitors such as a 2-macroglobulin prevents activity of all four MMPs along with other proteases. 1.3.2 Role of PA/plasmin and MMP systems in cardiac health and disease The PA/plasmin system has been implicated in a variety of physiological and pathological processes such as fibrinolysis, cell migration, cell-cell signaling, inflammation, tumor invasion and metastasis and wound repair [145]. Elevated levels of PAI-1 associated with vascular thrombosis, Ml [146, 147], and cardiac fibrosis [131] occur as a direct consequence of PAI-1 binding with PAs to form complexes inhibiting plasmin generation and activation of MMPs [140] preventing pericellular proteolysis. Furthermore, the PA/plasmin system also exhibits essential roles in hemostasis by regulating cell adhesion, migration, expression of growth factors and angiogenesis [148-150]. MMPs are produced in a number of myocardial cells including fibroblasts, inflammatory cells and cardiomyocytes. Involvement of MMPs is clearly noted in the heart, particularly in the wound healing/repair process. During post-MI cardiac 26 remodeling a number of MMPs including MMP-1, 2, 3 and 9 are expressed and elevated in both human and animal myocardium [151, 152]. During the remodeling process following Ml, MMPs have a significant role in E C M degradation, cell migration, angiogenesis and regulation of growth factors. Furthermore, increased MMP activity has also been associated with dilated cardiomyopathy [118, 153] and vascular remodeling [154, 155]. The activity of TIMPs has also been implicated in numerous cardiac diseases. Reduced levels of TIMPs were noted in ischemic cardiomyopathy, as well as at sites of Ml [156, 157]. Reduction of TIMPs following Ml severely affects myocardial structure and ventricular performance [158]. 1.3.3 Role of PA/plasmin and MMP systems in coronary artery disease and thrombosis Hemostasis plays an important role in the progression of atherosclerosis and development of cardiac complications of acute coronary syndromes. In most cases of acute coronary syndromes, the pathogenesis is formation of a mural thrombus on a ruptured or eroded atherosclerotic plaque. t-PA plays a key role in physiological plasminogen activation to plasmin [159]. In the presence of a fibrin clot, t-PA has a 100-fold greater affinity for plasminogen. Digestion of fibrin clots via plasmin-dependent cleavage results in soluble fibrin degradation products. Deficiency in t-PA greatly reduces the capacity to remove fibrin clots potentially resulting in thromboembolic disease [160]. t-PA deficient mice (t-PA-/-) exhibit abnormal accumulation of fibrin due to impaired fibrinolysis, resulting in a severe thrombotic phenotype with a global decrease in cardiac function [161-165]. Animal models of Ml demonstrate that infusion of t-PA elicits myocardial salvage by restoring blood 27 flow and intermediary metabolism in the region of risk by prompting thrombolysis [166]. Furthermore, endogenous fibrinolytic capacity is predictive of future rates of morbidity and mortality associated with Ml, stroke, angina pectoris, and post-operative thrombosis [167-172]. The role of PAI-1 in stabilization of thrombi and post-MI coagulative necrosis has been recognized and received much consideration. Studies using overexpression of human PAI-1 in mice demonstrate the development of spontaneous venous thrombosis [173]. Also, enhanced thrombosis in atherosclerosis-prone mice was associated with increased arterial expression of PAI-1 [174]. Hence, at sites of vascular damage the tightly regulated fibrinolytic balance is offset, favouring fibrin clot formation due to overwhelming inhibitory activity of PAI-1. Such imbalance results in thrombosis leading to myocardial ischemia with progression to infarction. Moreover, increased levels of PAI-1 are observed in patients with occluded arteries and are associated with higher incidence of Ml. Although contribution of MMPs to vascular fibrinolysis are not substantial, they have also been implicated at sites of vascular remodeling and thrombosis. Increased levels of MMP activation, particularly caused by increased inflammation contribute to pathological matrix destruction and atherosclerotic plaque rupture. Plaque rupture represents a failure of intimal remodeling, where the fibrous cap overlying an atheromatous core of lipid undergoes catastrophic mechanical breakdown. Plaque rupture promotes coronary thrombosis leading to Ml. Fibrin can be directly solubilized by MMPs, as demonstrated by Bini et al [175], yielding fibrin degradation products. These are either different from that of plasmin, 28 resulting in a D-like monomer fragment [175] or of similar molecular mass to that of the plasmin product depending on the specific MMPs involved [176]. Moreover, the MMP and PA/plasmin systems act in synchrony to degrade the major components of the vascular extracellular matrix. Activation of MMPs contributes to intimal growth and vessel wall remodeling in response to injury by promoting migration of vascular S M C . Inhibiting the activity of specific MMPs or preventing their upregulation could ameliorate intimal thickening and prevent Ml. 1.3.4 Role of PA/plasmin and MMP systems in myocardial wound healing Reduced fibrinolytic activity by virtue of low PA activity and enhanced levels of PAI-1 not only promotes thrombosis, but is critical in the fibrotic reorganization and post-MI tissue remodelling. Cardiac E C M is a dynamic structure, which has a prominent role in a variety of disease processes. The E C M is composed of numerous constituents and cells which produce them [177-179]; all essential for maintenance of proper cardiac geometry and function [180]. The PA/plasmin and MMP systems modulate wound healing by regulating E C M breakdown and synthesis [150, 181] (Figure 1-5). Post-MI the heart undergoes a complex healing process that involves a series of phases including inflammation, granulation, removal of necrotic tissue and tissue repair [116, 182]. Activation of plasmin regulates degradation of fibrin and other matrix proteins involved in migration of inflammatory cells, MMP and growth factor activation, angiogenesis and collagen remodeling [117, 183-189]. There is functional overlap of the activation of plasmin with the activation of the MMP system [190], as well as with stimulation of growth factors (i.e. TGF-B), both crucial in the remodeling phase 29 post-MI [191]. Studies in human and animal models of Ml and heart failure suggest that impaired PA/MMP activity attenuates revascularization and promotes cardiac fibrosis [117, 185, 192-194]. Infarct healing was virtually absent 5 weeks following surgically-induced Ml in plasminogen knockout mice in which inflammatory cells did not migrate into the infarcted myocardium, necrotic cardiomyocytes were not removed and the formation of granulation tissue did not occur [185]. However, these mice also showed a complete absence of fibrotic scar formation and no LV dilation was observed. Moreover, plasminogen knockout mice also had depressed MMP-2 and 9 activity, suggestive of plasmin specific effects [185]. Mice with u-PA deficiency were protected against early cardiac rupture. Similar results were also observed in wild-type (WT) mice by injection of adenoviral vector overexpressing PAI-1 prior to Ml. However subsequent long-term inhibition of PA activity impaired LV remodeling and prevented therapeutic myocardial angiogenesis [117]. It was also evident that MMP activity was significantly reduced in both plasminogen and u-PA deficient mice. Together these findings indicate that the effects of plasminogen and/or u-PA deficiency are at least in part mediated by activation of MMPs. PAI-1 and t-PA also play a role in post-MI wound healing, as expression levels for both genes were upregulated for weeks in the infarcted rat cardiac tissue [195-197]. Immunoperoxidase staining for PAI-1 and t-PA distribution in human and rat [198] samples of acute and healed myocardial infarcts demonstrated that high levels of both antigens localized within the healing infarct days post-MI. This suggests that the PA/plasmin system plays a key role in myocardial wound healing, and elevated activation of t-PA is suggestive of its imperative function post-MI. Although the role of t-PA and the PA/plasmin system have been described with 30 regard to many diverse pathologies [199-203], the specific role of t-PA in myocardial repair post-MI remains to be elucidated. Recently more emphasis has also been given to the function of t-PA in remodeling of E C M by activation of plasmin and augmentation of MMPs at sites of injury [204-208]. Preliminary observations from our laboratory further uphold the notion that t-PA plays a key role in remodeling as expression and secretion levels of t-PA were increased in cultured rat cardiomyocytes and healing myocardium of male adult rats for weeks post-MI. 31 Figure 1-5. Regulation of post-MI ECM remodeling by PA/plasmin and MMP systems. In the E C M t-PA and u-PA stimulate plasmin generation which initiates fibrin lysis into degradation products, and activation of latent MMPs. Active MMPs degrade E C M unless inhibited by TIMPs. At sites of infarction plasma VN enters both reversibly and irreversibly injured cardiomyocytes and binds to PAI-1 in the E C M forming steady complexes to enhance PAI-1 stability and activity. PAI-1 inhibits plasmin activation preventing E C M degradation and promotes fibrosis. 32 Thus, the PA/plasmin and MMP systems are essential in regulating wound healing following Ml. Interactions between the two systems regulate the E C M remodeling particularly in the post-MI myocardium. The mechanisms involved in infarct healing are primarily based on the proteolytic activity of plasmin, promotes E C M degradation and activation of MMPs, and hence promote cell migration, activates growth factors, and prevents the inhibitory activity of TIMPs [209]. 1.3.5 Effects of hypertrophic stimuli Cardiac tissue levels of t-PA and u-PA increase when subjected to a variety of stimuli. Exercise training is known to induce cardiac hypertrophy and increase in systemic fibrinolytic activity [210, 211] with enhanced t-PA and u-PA plasma levels [212, 213] suggesting an increased fibrinolytic reserve. Similarly, exercise training also enhances MMPs 2 and 9 levels in muscle and connective tissue [214, 215]. Following Ml, the beneficial effect of exercise training is also evident. Exercise training exhibits favourable effects on post-MI ventricular remodeling by increasing the wall thickness of the non-infarcted myocardium, limiting wall tension and attenuating LV dilation when compared with sedentary control animals [198]. These effects may be in-part related to increases in PAs and/or MMP activity [216, 217] which may influence myocardial hypertrophy. Pathological hypertrophy has also been associated with altered cardiac fibrinolytic activity. Hypoxia-induced ventricular hypertrophy stimulates synthesis of cardiac mRNA levels of both t-PA and PAI-1, with increased secretion of t-PA into the vasculature of perfused hearts [218]. Pressure overload-induced LV hypertrophy in a porcine model demonstrated increases in ventricular mRNA for PA and PAI-1 which preceded morphological changes in the early stages prior to 33 development of heart failure [219]. Conversely, loss or inhibition of u-PA or MMP-9 attenuated LV remodeling and preserved cardiac function after acute pressure overload in mice [118]. The PA/plasmin and MMP systems are also activated in response to activation with beta-adrenergic stimuli. Levels of t-PA and u-PA secretion were increased in plasma from patients treated with isoproterenol (ISO) [212]. Moreover, when induced with ISO, activities of MMP-1 and -2 increased in hypertrophied rat cardiac tissues and enhanced cardiomyocyte MT1-MMP synthesis and release was noted in the remodeling porcine LVs [220, 221]. 1.4 Intermediate Filaments 1.4.1 Structure and function Intermediate filaments (IF) are a major component of the cytoskeleton, and of the nuclear lamina in most eukaryotic cells. The organization of IFs and their association with plasma membranes suggests that the principal function of IFs is mainly structural, to reinforce cells and organize them into tissues [222, 223]. The most important function of the IFs however, is to provide mechanical support for the plasma membrane where it comes in contact with other cells or with the E C M . Also, IF proteins exhibit a strong specificity of expression for particular cell types, for example desmin is expressed in all muscle cells [222]. In contrast to the other two major cytoskeletal systems of eukaryotes, microfilaments and microtubules, IFs appear to be much simpler in their basic properties. The basic subunit of IF assembly is an anti-parallel tetramer. IFs are formed of a dimers composed of two a-helical chains interwound in a coiled-coil rod [223]. Most IF proteins assemble under suitable conditions to form uniform 8-12 nm 34 wide filaments. However, several types of IF proteins are obligate heteropolymers and require presence of heterologous IF proteins in order to assemble in the co-polymer form. IFs are classified into classes based on their sequence similarities, including: (a) keratins (types I and II), (b) vimentin-like proteins (type III), (c) neuronal proteins (type IV), and (d) lens IF proteins (type V) [222, 224]. Vimentin and desmin belong to type III IF proteins. Vimentin is typically expressed in blood vessel endothelial cells, other mesenchymal cells such as fibroblasts and in some epithelial cells [222]. Vimentin fibers terminate at the nuclear membrane, and at the cell-surface desmosomes and hemidesmosomes. In those locations vimentin IFs keep the nucleus and other organelles in defined places within the cell. Vimentin tends to form radial networks, but can also form a ring and wrap around a cellular component like a lipid droplet. Vimentin is also frequently cross-linked with microtubules [225]. Desmin is another type III IF that is expressed in all types of muscle and functions in linking myofibrils into bundles [222]. Desmin is associated with Z-lines and sites of muscle-tendon and muscle-muscle cell attachment. Desmin filaments encircle the Z-disks and make connections between neighboring Z-disks or with the overlying plasma membrane. Through the inter-myofibrillar connections, desmin filaments align Z-disks in neighboring cells. Thus, desmin is responsible mainly for stabilizing sarcomeres in contracting muscle. Desmin also copolymerizes with vimentin, and various other proteins. As a major component of cardiomyocytes, desmin IFs also forms physical links with the nucleus, contractile proteins, sarcolemma, E C M as well as, other organelles [226]. Additionally, the cellular distribution of desmin IFs in the cardiomyocyte makes it an ideal candidate for cellular signaling. 35 In most myogenic systems, synthesis of the IF protein vimentin precedes that of muscle specific desmin. It was illustrated that after the initial synthesis of vimentin myogenic differentiation begins and cells synthesize desmin [227]. Thereafter, vimentin and desmin readily coassemble with one another both in vitro and in vivo. Newly synthesized desmin integrates into the preexisting vimentin filament network. As myogenic differentiation proceeds, relative levels of vimentin and desmin interchange where vimentin synthesis ceases and desmin becomes the major, and in most cases the only IF protein in the mature muscle cell. Change in the composition of the IF is accompanied by an alteration of IF organization in which the longitudinal system is transformed into a transverse system associated with Z-lines, the sarcolemma and the myotendinous junction. The pattern of desmin organization during myotome differentiation differs markedly from systems in which vimentin is present. Desmin fails to form the longitudinal IF system characteristic of vimentin-containing myotubes and it is initially concentrated at the intersomite junction and the lateral sarcolemma. As myogenic differentiation proceeds, a reticular network of desmin filaments appears followed by the association of desmin with Z-lines. Thus, vimentin and desmin differ significantly in the types of IF networks they form in vivo [227]. 1.4.2 Desmin-associated cardiomyopathies Desmin IFs are critical mechanical integrators of the cytoskeleton that protect the cell from repeated mechanical stress. There have been increasing reports of human cardiomyopathies associated with abnormal accumulation and aggregation of desmin IFs. Recently identified desmin mutations in humans suffering from skeletal muscle myopathy and cardiomyopathy suggest that these diseases might 36 arise as a consequence of impaired function of desmin filaments. Studies with null mice for desmin demonstrate that desmin is essential for normal cardiac function and suggest that the absence of an intact desmin filament system, rather than accumulation of the protein, may be responsible for the pathology seen in some of the desmin-associated cardiomyopathies. It is also apparent that mutant desmin interferes with the normal assembly of IFs, resulting in fragility of the myofibrils and severe dysfunction of skeletal and cardiac muscles [228]. Skeletal and cardiac myopathies develop in mice that lack desmin, suggesting that mutations in the desmin gene may be pathogenic [228]. Mice lacking desmin have hypertrophied cardiomyocytes arising from increase in cross-sectional cell area. Moreover, desmin null mice exhibit increased ventricular free wall thickness, and also experience wall thinning, dilation and impaired function at 12 months [229]. Ultrastracturally, desmin null mice exhibit sub-sarcolemmal clumping and proliferation of mitochondria that is associated with reduced mitochondrial respiration. It has also been suggested that by promoting anchorage of mitochondria to areas of high energy demands, desmin regulates cellular energy production [230]. This insinuates that although desmin is not required for the differentiation of skeletal, cardiac, and smooth muscle, it is essential to strengthen and maintain the integrity of these tissues. Functional studies provide compelling evidence that mutations in the human desmin gene are pathogenic and interfere with the assembly of IFs [228, 231-233]. Functional abnormalities caused by the mutant desmin can be reversed by the insertion of WT desmin. In skeletal and cardiac muscles, normal desmin encircles the Z bands that hold together the actin filaments and help transmit tension along the myofibrils, protecting their structural integrity during repeated muscle 37 contractures over time [228]. Defects in the function of desmin as well as desmin-associated proteins may therefore cause fragility of the myofibrils and impair contraction. In both mice and humans that lack desmin, cardiomyopathy, skeletal myopathy and metabolic myopathy develop with advancing age as mechanical stress disrupts myofibrils and affects the Z bands [228]. Moreover, myocardial tissue of patients with end-stage heart failure of ischemic origin showed a decreased number of desmin-positive myocytes which is associated with reduced cardiac function [234]. This deficiency in myocardial desmin could potentially lead to increase in LV diastolic pressure due to reduced LV contractility. Although cytoskeletal desmin is clearly involved in numerous genetic and non-genetic forms of cardiac diseases, recent study of infarcted rat hearts show no changes in desmin cardiac levels in post-MI remodeling [235]. Thus, despite the extensive knowledge regarding the role of desmin deficiency and/or accumulation in various pathologic states, further work is required in order to investigate its effects in many unidentified cardiac disease states. 1.4.3 Ischemia, stunning and hibernation Following a period of ischemia, regional mechanical function of the myocardium can remain depressed acutely for several hours to days (stunning), or chronically for days to weeks (hibernation) (Figure 1-6). Myocardial stunning is a mechanical process that occurs following ischemia and reperfusion despite absence of irreversible damage or restoration of coronary flow [236]. At sites of myocardial stunning, myocardial contractility remains depressed for variable 38 Apoptosis Figure 1-6. Fate of myocardium following acute and chronic ischemia injury. Following a period of ischemia and reperfusion, regional mechanical function of the myocardium can remain depressed acutely for several hours to days (stunning), or chronically for days to weeks (hibernation) despite absence of irreversible damage. Prolonged ischemia without reperfusion results in cell death. 39 intervals. There are a number of potential mechanisms involved in the pathogenesis of myocardial stunning by which contractile dysfunction can be explained. It has been suggested that contractile dysfunction in stunned myocardium is strongly correlated with the disappearance of cytoskeletal proteins which could be mediated by a calcium-dependent intracellular protease activated during reperfusion [237]. Disruption of cytoskeletal proteins may be a possible mechanism for stunning, although it may be a secondary effect of protease activation. In the stunned myocardium, regions of reduced desmin IF are evident which likely contribute to a reduction of contractility. Chronic myocardial dysfunction which results in long-term oxygen consumption and contractile depression is termed hibernation. Hibernation is a reversible condition in which the dysfunctional, viable myocardium recovers following reperfusion [238]. Although hibernating myocardium is considered independent of stunned myocardium, both conditions involve reduced expression of cytoskeletal proteins, including desmin IF. In hibernating myocardium structural degeneration is commonly characterized by reduced mRNA and protein expression and disorganization of cytoskeletal proteins, including desmin [239]. Structural changes occur in which both temporal and spatial variations of structural proteins are evident. The expression of these proteins is continuously changing from stunned to hibernating myocardium occurring globally and independent of regional reduction of coronary flow [240]. Spatial reorganization of desmin in the cytoplasm and a loss of colocalization with desmoplakin at the intercalated disks are evident in stunned myocardium after 24 hours. With progression to hibernating myocardium, desmin expression is lost at the intercalated disks [240]. 40 Thus, desmin along with other contractile and cytoskeletal proteins exhibit an important function in myocardial stunning and hibernation following an ischemic episode. Although the precise role of desmin IF in mechanical regulation of cardiomyocyte contractility remains to be investigated, it is clear that desmin plays an essential role in structural stability and may promote survival of the myocytes following ischemia. 41 CHAPTER II HYPOTHESIS AND SPECIFIC AIMS The central hypothesis of this work is that vitronectin 1) modulates cardiac function by impairing cardiomyocyte contractility 2) modulates post-MI remodeling in by regulating extracellular matrix proteolysis and cell-matrix interactions The following specific aims to be addressed are the following: Aim 1 To determine the effects of vitronectin in wound healing following myocardial infarction Sub aim 1 Investigate the effects of vitronectin in regulation of post-MI extracellular matrix remodeling Sub aim 2 Examine the effects of vitronectin on cardiac structure and function Aim 2 To investigate the distribution and function of vitronectin at sites of hypoxic and ischemic injury Sub aim 1 Examine the binding interactions of vitronectin with cytoskeletal desmin intermediate filaments 42 Sub aim 2 Investigate the effects of vitronectin on regulation of cell contractility To investigate the effects of hypertrophic stimuli on the localization of plasminogen activator/plasmin systems components at sites of acute myocardial infarction 43 CHAPTER III RESEARCH QUESTIONS AND STRATEGIES The questions relevant to the hypothesis and specific aims are: 1) How does accumulation of VN affect the expression, distribution, levels and activity of proteins responsible for E C M degradation/synthesis? Does VN cause specific differences in enzymatic activity post-MI? Does post-MI VN accumulation affect levels of post-MI fibrosis? Is VN involved in post-MI remodeling by regulating the adhesion/migration of inflammatory cells, endothelial cells and fibroblast. Does VN exhibit an effect on post-MI hypertrophy of non-infarcted myocardium? Do VN- / -mice exhibit differences in cardiac architecture post-MI? Does post-MI VN accumulation have an effect on cardiac function? 2) Does VN enter ischemic cardiomyocytes? Does this occur by active or passive transport? Does VN bind to sarcomeric desmin in ischemic cardiomyocytes? What is/are the specific region(s) responsible for binding of VN to desmin? Does VN have an effect on cardiomyocyte function? 3) Does exercise modulate the fibrinolytic system (i.e. t-PA, u-PA and PAI-1) and VN following Ml? Are cardiomyocytes capable of t-PA expression, storage and secretion? Is cardiomyocyte t-PA expression induced by hypertrophic stimuli? 44 To answer these questions, I have conducted research with a strategy described in the materials and methods, these approaches and the results and discussion of the experiments are detailed in the following four chapters: Chapter IV, "Effects of vitronectin on cardiac structure and function post-myocardial infarction". Chapter V, "Effects of vitronectin on regulation of the plasminogen activator/plasmin and matrix metalloproteinase systems in wound healing post-myocardial infarction". Chapter VI, "Effects of vitronectin at sites hypoxia and myocardial ischemia", and Chapters VII, "Expression of cardiomyocyte tissue plasminogen activator following myocardial infarction". 45 CHAPTER IV EFFECTS OF VITRONECTIN ON CARDIAC STRUCTURE AND FUNCTION POST-MYOCARDIAL INFARCTION 4.1 Rationale Following Ml there is extensive cardiac remodeling resulting in LV dilation, a major cause of congestive heart failure and sudden cardiac death. VN is a diverse glycoprotein which has numerous biological functions many important to tissue healing process. In the E C M , VN exhibits multiple functions including cell adhesion, migration, and spreading. VN has multiple ligands and accumulates at various sites of inflammatory cell-induced damage and necrosis. Additionally, VN localizes at sites of Ml, and prolonged accumulation of VN at sites of damage of various tissues reflects chronic injury associated with fibrosis. Preliminary studies from our laboratory demonstrated an accumulation of VN at sites of ischemic myocardial damage and post-MI fibrosis. Thus, we were interested in investigating the effects of VN on the post-MI remodeling, particularly with respect on cardiac structure and function. 46 4.2 Experimental Methodology 4.2.1 Genotyping of VN -/- mice 4.2.1.1 Isolation of genomic DNA Cryo-derived CD57BL/6J VN- / - mice were obtained from Jackson Laboratories (Bar Harbor, Maine) and were cross-bred with mice on a CD57B6/6J background. In order to determine whether mice expressed the VN gene, mouse tails were clipped, genomic DNA isolated and subjected to P C R . Tail biopsies (~ 0.5 cm) were obtained from 3 week old mice. Tail clips were placed in TNES buffer (10mM Tris, pH = 7.5, 400mM NaCl , 100mM EDTA, 0.6% SDS) containing with 35 uL Proteinase K (10 mg/mL) and incubated overnight at 55°C. Following the incubation period 167 uL of 6M NaCl was added to the digested tail clips, shaken vigorously for 15 seconds, then centrifuged at 14000 x G for 5 minutes at room temperature. Supernatants were then removed and 1 volume of 95% cold ethanol added. DNA was precipitated by centrifugating for 10 minutes at 14000 x G . Following discarding of the supernatants the DNA was washed with 70% ethanol, then allowed to air dry. DNA pellet was then resuspended in 100 uL of TE buffer (10 mM Tris, 1mM EDTA pH = 8.0) and placed at 65°C to assist in dissolution. DNA yield was determined using spectrophotometry and stored at 4°C. 4.2.1.2 Determining mouse strain using P C R Five microliters (5-20 ng) of DNA was used per reaction to a final reaction volume of 30 uL. DNA was amplified for 35 cycles at the following primer conditions used 94°C for 3 minutes, 94°C for 30 seconds, 67°C for 1 minutes, 72°C for 1 minutes, 72°C for 2 minutes, then 4°C until further use. DNA was amplified in 47 four parallel P C R reactions using specific primers (Table 4-1) and Taq polymerase. R T - P C R products were separated on 1.5 % agarose gels containing ethidium bromide. Results were evaluated as the reaction product appeared as either 442 bp band (+/+, VN homozygous), 442 bp & 280 bp bands (+/-, heterozygous), or 280 bp band (-/-, Neomyocin homozygous) (Figure 4-1). After establishing the phenotypes, 5 sets of breeding pairs from both WT and VN- / - mice were selected for propagation of the colonies. Primer Sequence Designation Sense Strand Primer (5* - 3") Anti-Sense Strand Primer (3" - 5") Size (bp) Neomyocin C T T G G G T G G A G A G G C T A T T C C T A G A G G A C A G T A G A G T G G A 280 VN G T G C C A G T G C T T G G A A T T T G G C T T C T T A T C T G A G A C T G G G T G A T G 442 Table 4-1. Primer sequences used for genotyping of VN+/+ and VN- / - mice. Sequences were obtained from http://iaxmice.iax.org/ 4.2.2 Mouse model of left anterior descending coronary artery ligation The mouse model of wound healing following acute Ml has been described previously [241] [242]. All animal experiments were approved by the University of British Columbia Committee on Animal Care. Briefly, 12-week-old C57B6/6J WT and VN- / - mice (n = 201, weight 20-25-g) underwent surgical ligation of LAD. Infarction was sustained for 3, 7, 14, 28, 60 and 90 days. Prior to sacrifice mice were weighed, then a thoracotomy was performed and hearts rapidly excised into ice-cold saline, then manually compressed to remove residual blood. For hearts designated for protein and R N A studies, infarcted LV, the right ventricle (RV) and atria were dissected out under a surgical microscope and weighed. The tissues were flash-frozen in liquid nitrogen or placed in RNAIater® solution (Ambion, Austin, TX) and stored at -80°C. For histological studies hearts were sectioned mid-ventricle into two pieces and designated as either apex or base. These were 48 perfused-fixed under constant pressure then placed in 4% paraformaldehyde. Specific experiments and sample size for each time-point is described in Figure 4-2. 4.2.2.1 Anesthetic technique Mice were weighed before administering the appropriate amount of anesthetic subcutaneously; 50 uL/10 g of weight of a mixture of xylazine (120 uL) and ketamine (900 \iL) in 0.9% saline (6980 MJ_), equivalent to 28 |ig ketamine and 3.8|ig xylazine per gram bodyweight. Ophthalmologic ointment was applied to the eyes to prevent corneal drying. Once anesthetized, chest hair was removed using Nair™ hair removal lotion. Following a short period of isoflurane inhalation in an anesthetic box, intubation was performed using an intravenous cannula into the trachea (a 22-gauge cannula for animals up to 30 g of weight and a 20-gauge cannula for animals heavier than 30 g). The cannula was connected to the ventilator outlet delivering a mixture of oxygen (4L/minute) and isoflurane 1-2% to keep the animal under deep anesthesia (tidal volume 0.5 mL, rate 120 strokes/minute). 49 VN -/- VN +/- VN +/+ Vitronectin Neo 1 2 1 2 1 2 Figure 4-1. Mouse genotyping performed by PCR. Genomic DNA was isolated from mouse tails at 3-5 weeks of age. Presence of a 280 bp band signified the presence of a neomyocin cassette (Neo) (lanes 1) while the presence of a 442 bp band signified the presence of VN (lanes 2) which replaced the entire VN locus. Mice with a single band at 442 bp represented VN+/+ progeny. Mice with bands at 442 bp and 280 bp represented the heterozygous (VN+/-) progeny. Mice with a single band at 280bp represented the VN- / - progeny. 50 LAD Ligated Mice n - 201 VN 4-\ 0 n = 14 3 n = 13 7 n = 12 14 n = 12 28 n = 27 WT 0 n = 20 3 n = 10 7 n = 11 14 n = 11 28 n = 24 60 n = 6 60 n = 2 Time of Infarction (days) Echocardiography Histology Pressure-Volume Assessment Morphometry Figure 4-2. Experimental methods utilized in mouse model of LAD ligation. Detailed experimental protocol describing the WT and VN- / - mice sample size and experiments conducted at different times of infarction. 51 4.2.2.2 Surgical ligation of left anterior descending (LAD) artery The animal was placed in a supine position and tilted to its right side on a heated pad and secured by tape. A skin incision was made parallel with the midline and halfway between the midline and left leg. Skin and subcutaneous muscles were separated from the layers of muscle underneath using serrated forceps and the transverse pectoral muscle was retracted using a suture to expose the rib cage. Sharp pointed scissors were used to separate rib muscles longitudinally between the second and third ribs just above the left lung contour. Blunt-tipped bone scissors were then inserted into the opening and underneath the chest wall being careful to avoid cutting any major blood vessels whilst cutting three ribs. The chest was then opened with a retractor. The LAD was identified as it appeared from under the left atrial appendage. At time of ligation the initial strategy was to ligate mid-LAD after the origin of the first diagonal branch. Occasionally, a suture placed at this point did not result in LAD occlusion and a second suture had to be placed. The second suture was usually positioned at the level of the left main stem, just below the left atrial appendage. In some animals the LAD could not be visualised and occasionally only a large left diagonal branch to the apex could be seen in which case it was tied; otherwise the main vessel was tied using 8-0 polypropylene monofilament it was ligated. If blanching of the myocardium was not observed, ligation was repeated. The chest was closed using a two-layer closure with 5/0 Vicryl for ribcage and skin. Isofluorane was discontinued and ventilation maintained until the return of spontaneous respiration. Mice were allowed to recover in a heated chamber under observation for a few hours. Thereafter, they were monitored daily until time of sacrifice. 52 4.2.3 Assessment of cardiac function To evaluate the effects of VN on myocardial healing and cardiac function, hemodynamic measurements were obtained from WT and VN- / - at baseline and mice at 28 days post-MI using transthoracic echocardiography and pressure-volume conductance Millar catheterization. 4.2.3.1 Echocardiography Echocardiographic evaluation was performed at 28 days using a Visual Sonics 700 V E V O system, a platform, a 30 MHz probe, probe holder and data analysis unit. Animals were lightly sedated with 0.1 mL/30 g of a mixture of ketamine (300 uL) and xylazine (40 uL) solution (1/3 of the dose used for ligation purposes), using the lightest sedation compatible with keeping animals sedated whilst in the supine position. Chest wall hair was removed and the animal was taped in the left lateral position on the examination table. Liberal quantities of Depo™ Cardiac Contrast agent was applied to the chest wall. By using different size probes and various table positions multiple echocardiographic images were obtained, including a parasternal long axis view and parasternal short axis view at the levels of (a) immediately below the mitral valve (b) papillary muscle (c) sub-papillary muscle and (d) apex. Ejection fraction (EF) was calculated using Simpson's method in all animals where adequate images could be obtained as described in Figure 4-24. Off-line analysis was performed in a blinded manner using only numeric identifiers. The largest circumference in diastole and the smallest diameter in systole were measured for three different beats at all four parasternal short axis levels. Finally, using the parasternal long axis views, the longest distance between the apex and 53 the base of the mitral valve leaflets in diastole and the shortest axis between the same points were measured on three separate beats. Measurements resulted in three separate EF calculations with mean average determined for each animal. Averaged EF was compiled and the group means were compared using the Student's t-test. M-mode measurements were obtained at papillary muscle level; where possible measurements were made while directing the beam between the papillary muscles at the maximal diameter. M-mode measurements were used to calculate heart rate and estimate EF (Teicholz method). EF was calculated using the following formula: Ejection Fraction = (Stroke Volume / End-Diastolic Volume) x 100 4.2.3.2 Pressure-volume conductance Following echocardiographic evaluation, animals were again sedated using Ketamine and Xylazine to a total of 0.1 mL per 10 g. Intubation was performed under direct visualisation and animals were ventilated using a small animal ventilator (MiniVent Ventilator for Mice, 230 V A C , Harvard Apparatus, Holliston, Massachusetts). Under a dissecting microscope (Carl Zeiss Canada Ltd., Toronto, Canada), the chest wall was opened using a mid-sternal incision, which was extended caudally into the abdomen. The pericardium was opened and dissected away from the infarct to allow access to the apex. A visual estimation of infarct size was made and recorded (none, small, medium, large). The apex was grasped with a sharp forceps and punctured using a 21 gage needle. A 1.2 French fine-tipped pressure transducer (Millar Pressure-Volume System, Millar Instruments, Houston, 54 TX) was introduced into the apex of the LV and manipulated as required to obtain the best possible wave-form. Once adequate steady-state loops were obtained aortic occlusion was performed. This was done using a cotton-tipped swab placed just below the diaphragm after re-locating the intestines and mesentery to the left. This occlusion was performed for approximately 10 beats, allowing the wave-form to return to baseline. Occlusion was repeated 2 to 4 times as required to obtain a satisfactory increase in aortic pressure. A similar process was repeated by performing occlusion of inferior vena cava (IVC). Pressure was applied to the IVC until LV pressure dropped satisfactorily. The swab was then removed to allow recovery to baseline. This process was repeated 2 to 4 times. After obtaining measurements the catheter was removed and animals were sacrificed under anaesthesia and the hearts excised. The heart was rinsed in cold saline to remove residual blood. Hearts were arrested by immersion in a 0.1 mM solution of potassium chloride. 4.2.4 Histology and morphometry 4.2.4.1 Infarct size and infarct expansion Following sacrifice the hearts were excised and weighed. Hearts were cannulated by the aorta and perfused-fixed with 4% paraformaldehyde at a constant pressure. Hearts were kept in 10% formalin overnight then embedded in paraffin. Paraffin embedded sections were cut into 5-um slices, which were stained with H&E and picrosirius red (1mg Sirius red per 1mL picoric acid). Slides were scanned under high resolution (300 dpi) then analyzed using a computerized morphometric system (Image Pro Plus, Media Cybernetics). The area occupied by 55 the infarct was measured and expressed as ratio of picrosirius red positive scar area to total LV area. Measurements were performed in serial sections. Successive heart slices were taken beginning at mid-ventricle and spaced every 500 urn until the apex (Figure 4-3A). Final infarct size was expressed as the mean area of each heart. Additional methods used to determine collagen content was also performed in which the internal circumference of the picrosirius red positive scar was measured and expressed as a ratio to total LV chamber circumference. 4.2.4.2 LV. RV and septum geometry As outlined by Hochman [19] et al and Weisman et al [35], LV diameter was measured as the maximum distance from the endocardial surface of the septum to the endocardial surface of the LV anterior free wall along a perpendicular line. LV anterior free wall thickness in infarcted rat hearts was measured at three distinct points as described in Figure 4-3B, and the mean of the three points determined. Septum and RV thickness were measured at three distinct points, two located at the origin of attachment and one through the centre. Mean of the three points was then determined (Figure 4-3B). 4.2.4.3 Inflammatory infiltration and angiogenesis Paraffin-embedded mouse heart tissue sections were subjected to routine immunohistochemical staining for myeloperoxidase (MPO), platelet-endothelial cell adhesion molecule 1 (CD31) and von Willebrand factor (vWF). Staining was visualized with the chromagen Vector Red (Vector Laboratories, Burlingame, CA), which possesses both, colorimetric and fluorescent properties. Slides were examined by light microscopy under a 40 x objective across 5 fields of view in the anterior free wall (infarct and peri-infarct zones). Same methodology was followed 56 Figure 4-3. Schematic representation used to determine tissue morphology analysis. A) Mouse hearts (lateral view) were sectioned in 500 urn intervals beginning mid-ventricularly and progressing toward the apex. B) Representative tissue slice in cross section. LV diameter was determined by taking the single most-widest measurement from the endocardial aspect of the septum to the endocardial aspects of the anterior LV free wall. LV thickness, RV thickness and septum thickness were each determined by averaging three measurements obtained from various myocardial areas. 57 for sections stained with CD31 and vWF. Number of MPO positive inflammatory cells, and CD31 and vWF positive vessels were identified using a computerized morphometry system (Image Pro Plus, Media Cybernetics) and counted manually. 4.2.5 Immunohistochemistry Paraffin-embedded mouse heart tissue sections were subjected to routine immunohistochemistry (as described in Chapter IV) using purified Abs to V N , t-PA, u-PA, PAI-1 or pre-immune IgG obtained from Molecular Innovations. Staining was visualized with the chromagen Vector Red, or peroxidase diaminobenzidine tetrahydrochloride (DAB). Nuclei were counterstained with hematoxylin. 4.2.6 Statistics Statistical significance of differences was assessed using Student's f-tests and comparison among multiple groups was performed one-way analysis of variance (ANOVA); p-value of 0.05 or less was considered significant. All values are expressed as means ±SEM or means ±SD. 58 4.3 Results 4.3.1 Genotyping Detection of the VN gene by P C R demonstrated unexpected ratios of WT : VN+/- : VN- / - mice (10:85:5). Homozygous WT and VN- / - mice were then used to propagate each phenotype. Heterozygous mice were excluded from the study. 4.3.2 Coronary artery anatomy Ligation of the mid-LAD resulted in infarction of the LV free wall with blanching usually evident within moments of ligation. LAD ligation did not result in septal or papillary muscle infarction, and the apex was generally spared. Two major variants were recognized in mouse coronary anatomy. In the first variant a large single artery coursed from the left atrial appendage down to the apex with no major branches (Figure 4-4A). In the second variant there was a single large branch of this artery, analogous to a large first diagonal branch (or the circumflex artery) in the human. This branch usually was located just below the tip of the left atrium passing laterally to the left (Figure 4-4B). Occasionally only the diagonal branch was visualized passing laterally with no obvious LAD. Ml was induced in a combined total of 167 mice, with an additional 34 sacrificed as sham-operated controls. Infarcted WT mice experienced a mortality rate of 20.5%, of those, 3 mice suffered peri-operative mortality and 12 expired post-operatively. VN- / - mice suffered 17.6% mortality, of which 4 died peri-operatively and 11 post-operatively. Seven mice from both, WT and VN- / - Ml groups died as a consequence of cardiac rupture within first 7 days of infarction. Sample sizes and allocation of mice at each time-point are provided in Figure 4-2. 59 4.3.3 Establishment of murine model of left anterior descending coronary artery ligation Prior to performing the procedure on mice used in our study, practice C57B6/6J mice (n = 100) were subjected to ligation of the LAD to ensure accuracy and consistency of infarct size. Once the mouse model of Ml was established and the surgeons were confident in obtaining reproducible results WT and VN- / - mice were randomly selected into two groups; sham-operated and Ml. Ligation of the mid-LAD resulted in infarction of the LV free wall with blanching usually evident within moments of ligation. Some infarcts were located antero-apically rather then in LV free wall. This was likely caused by differences in mouse coronary artery anatomy. Mid-LAD ligation did not result in septal or papillary muscle infarction and the apex was generally spared. Generally a mid-LAD ligation resulted in a small-to-medium sized infarct, whereas a main trunk ligation resulted in a large infarct. Mid-LAD ligation resulted in 13% mouse mortality, whereas mortality after left main trunk ligation was 30%. Mortality post-operatively occurred almost exclusively between days three and nine. In all mice that were analysed by post-mortem cardiac rupture appeared to be the cause resulting in either massive haemopericardium or haemothorax. Surviving mice lost approximately 10% total body weight by day 2 with recovery back to baseline by the end of week one. By four weeks post-MI body weight had increased approximately 15% above baseline (Figure 4-5). 60 Figure 4-4. Differences encountered in mouse coronary artery anatomy. In our model of LAD ligation two major variants in mouse coronary anatomy were predominant. In the first, a major single artery courses from the left atrial appendage and concluding at the apex with no major branches (A). In the second variant there is a single large (main) branch of this artery, analogous to a large, first diagonal branch (circumflex artery in the human). This branch is usually given off just below the tip of the left atrium passing laterally to the left (B). In rare instances only the diagonal branch was seen passing laterally without a noticeable LAD (not shown). 61 4.3.4 Comparison of post-MI mouse body weights Both WT (n = 57) and VN- / - (n = 73) mice demonstrated an 5-7% decline in weight during the first 3 days post-MI. Weight returned back to baseline by 14 days post-MI and increased an additional 2% in WT and 5% in VN- / - mice above baseline by day 28 (Figure 4-6). No statistically significant differences were noted at any time-point between the WT and VN- / - groups. 4.3.5 Assessment of infarct induction in WT and VN-/- mice 28 days post-MI There were no significant differences in age or weight recorded between the WT (n = 27) and VN- / - (n = 31) groups at baseline. In majority of the mice mid-LAD ligation was performed (84%). At time of sacrifice at 28 days post-MI, no significant differences in age, weight or time of infarction were noted between WT (n = 24) and VN- / - (n = 27) mice. Similarly, no significant differences in infarct size were noted at time of initial ligation or at time of sacrifice, although smaller infarcts were more commonly observed in VN- / - mice, (p = 0.07, Chi-squared test for trend, Table 4-3) 62 WT VN-/- P value BASELINE (Day 0) (n = 27) (n = 31) Mean StDev Mean StDev AGE AT LIGATION (weeks) 11.4 0.9 10.6 0.7 NS BODY WEIGHT (g) 29.2 1.8 27.9 2.2 NS (n) (n) SITE OF LIGATION Mid LAD 23 Mid LAD 26 Main LAD 3 Main LAD 5 POST-MI (Day 28) (n = 24) (n = 27) Mean StDev Mean StDev DAYS POST-MI 28.6 0.9 28.4 0.7 NS BODY WEIGHT (g) 29.0 6.4 28.5 6.0 NS Table 4-2. Measurements of age, body weights, and the site of ligation in WT and VN- / - mice at baseline and 28 days post-LAD ligation. Mid-LAD ligation was performed in most cases (23 of 26 WT and 26 of 31 VN-/-), with no significant differences in site of ligation or visual estimate of infarct size observed between the groups peri-operatively. No significant differences in age or weight were noted at baseline or at 28 days post-MI between the WT and VN- / - mice. P value as determined by a paired Student's Mest. 4.3.6 Accumulation of VN in the infarcted myocardium over time We have examined the accumulation of VN following Ml in WT and VN- / -mice by Western blot and immunohistochemistry. VN was accumulated in the Triton-X insoluble cytoskeletal fraction from isolated LV. VN was present in WT mice at 3, 7, 14, 28 and 60 days post-MI. Peak amounts of VN were noted 7 days post-MI as determined by densitometry, following which a gradual decline was observed over time (Figure 4-7 A and B). VN was absent from the Triton-X soluble cytoplasmic fraction of the infarcted LV of WT. No VN was found in the infarcted VN- / - mice at any timepoint. Similarly, immunostaining for VN in WT mice showed its accumulation throughout the infarcted myocardium primarily localized to the LV. Corresponding to the Western blots, VN staining appeared progressively weaker in intensity although thinning of the LV anterior wall was also evident. (Figure 4-7C). 63 Figure 4-5. Distribution of body weight of practice mice over time following LAD ligation. Mouse weight declined 10% by day 2 post-MI with a return to baseline by day 7. At four weeks post-MI, mouse weight had increased 15% above baseline. 64 110 - 105 ej> c 0> n o u, ro +J c <u o !_ CD 100 95 90 85 WT (n=57) VN-/- (n=73) DayO Day 3 Day 7 Day 14 Day 28 Time post-ligation Figure 4-6. WT and VN-/- mice exhibit no changes in body weights post-MI. Both, WT and VN- / - mice experienced approximately a 10% decline in body weight in the first 3 days post-MI. Mouse weight returned back to baseline by 14 days post-MI and increased an additional 3 - 5% above baseline weight by day 28. Similar trends were observed in WT and VN- / - mice with no significant differences noted between the groups at any timepoint. 65 Days Post-MI 14 28 60 +/+ -/- +/+ -/- +/+ -/- +/+ +/+ -/-B 28 60 Days Post-MI 3 Day 7 Day 14 Day 28 Day 60 Day Figure 4-7. VN accumulates in the infarcted myocardium. A) Western blotting showed increased levels of VN in the Triton-X insoluble cytoskeletal fraction of infarcted LV. No VN was present in the cytoskeletal heart extracts of VN- / - mice. B) VN accumulated progressively reaching peak levels at 7 days post-MI, followed by a gradual decline up to 60 days post-MI. C) Staining for VN (red) in infarcted hearts (10x objective) of WT mice demonstrated an accumulation of VN in the anterior LV free wall which gradually decreased in size (top panel: brightfield and bottom panel: darkfield). Scale bar = 1 mm. 66 4.3.7 Examination of post-MI fibrous scar formation To determine if VN affected myocardial healing, we quantified the area of picrosirius red positive collagen staining as percent of LV at 28 days post-MI. Collagen staining was absent from both, WT (n = 8) and VN- / - (n = 8) non-infarcted control groups (WT controls 0.58 ± 0.2 vs. VN- / - controls 0.68 ±0.1). (Figure 4-8, A and C). It appeared that at 28 days post-MI, WT mice exhibited prominent and altered remodeling of the infarcted LV when compared to VN- / - (Figure 4-8, arrows). Morphometric analysis showed a significant reduction in total collagen accumulation in the VN- / - Ml group (n = 8) when compared to WT Ml mice (n = 8) at 28 days (WT Ml 19.2 ± 3.6 vs. VN- / - Ml 8.1 ±1.9, p < 0.05) (Figure 4-8C). Staining for interstitial collagen was included in the measurement of the LV scar. To further evaluate the effects of VN on post-MI heart remodeling infarct expansion was measured and expressed as percent of internal circumference. Surprisingly, only a slight difference was noted between the WT and VN- / - Ml groups (WT Ml; 34.6 ± 3.01 vs. VN- / - Ml; 31.3 ± 2.3, p = 0.43) (Figure 4-9). 4.3.8 Assessment of viable LV and RV myocardium in WT and VN-/-mice No significant differences in viable myocardial areas were noted in either the RV or LV of sham-operated WT and VN- / - mice as determined by area of viable myocardial tissue (Figure 4-10). At 28 days post-MI there was evident increase in the viable RV and LV area in WT and VN- / - mice which may be attributed to compensatory hypertrophy. Differences found were not significant in nature, either in the RV (WT Ml mice; 3590.34 ± 463.22 pixels/area vs. VN- / - Ml mice 4139.97 ± 516.96, p = 0.44) or LV (WT Ml mice; 22097.29 ± 1767.77 VN- / - Ml mice; vs. 67 23238.65 ± 1483.13, p = 0.63) were noted between the WT and VN- / - Ml groups (Figure 4-10). Thus, there was an increase in total myocardial area (RV + LV) in Ml WT mice when compared to sham-operated mice. Interestingly, VN- / - Ml mice exhibited only a nominal change in the total myocardial area when compared to V N -/- sham-operated mice. Right and left atria were excluded when quantitating viable myocardial area. 68 WT VN-/- WT VN -7 -Control Ml Figure 4-8. VN-/- mice exhibit a decrease in collagen accumulation 28 days post-MI. A) Heart serial sections from non-infarcted (WT; n = 8, VN- / - ; n = 8) and Ml mice (WT; n = 8, VN- / - ; n = 8) were stained with picrosirius red stain (red) for collagen. Picrosirius red stain demonstrated an accumulation of collagen in the thinning anterior LV free wall of both WT and VN- / - Ml mice. B) Higher magnification images taken at mid-ventricularly designated localization of collagen (arrows) in the fibrosed LV. C) WT mice exhibited a significant increase in collagen staining when compared to VN- / - (WT Ml 19.2 ± 3.6 % LV area vs. VN- / - Ml 8.1 ± 1.9, p < 0.05). Only trivial amount of collagen staining was evident in LV of sham-operated mice. 69 o ing ren c CO •*-> E </> 3 U >_ s* u _1 sir nal o i_ i_ o <i> CL c WT Control V N -/-Control WT Ml VN -/-Figure 4-9. VN-/- mice exhibit no significant changes in amount of subendocardial fibrosis at 28 days post-MI. Morphometric analysis of subendocardial fibrosis quantitated as a percentage of internal LV circumference demonstrated only trivial differences between infarcted WT (n = 8) and VN- / - (n = 8) mice (WT Ml; 34.6 ± 3.01 vs. VN- / - Ml ; 31.3 ± 2.3, p = 0.43). 70 LV RV 35000 30000 25000 re 2| 20000 .£ 15000 a. 10000 WT VN-/- WT Ml VNV-MI Control Control WTMI VN4-MI Total (LV + RV) 5 i2 20000 WT Ml VN-/- Ml Control Control Figure 4-10. VN-/- and WT mice exhibit no differences in remote areas of myocardium. Area of normal myocardium was quantitated in both sham-operated (WT; n = 8, VN- / - ; n = 8) and Ml (WT; n = 8, VN- / - ; n = 8) mice at 28 days post-MI. Sham-operated VN- / - mice exhibited slightly larger LV area when compared to sham-operated WT mice, however no differences in RV areas were noted. At 28 days post-MI VN- / - mice exhibited a similar LV and RV sizes when compared to infarcted WT mice. Interestingly, there was no change in the total myocardial area (LV + RV) between the sham-operated and Ml VN- / - mice. 71 4.3.9 Examination of post-MI wall structure and chamber geometry Morphometric analysis of infarcted mice (n = 24) at 28 days showed profound differences between WT and VN- / - mice. Analysis of cardiac architecture determined as measures of LV diameter, LV anterior free wall thickness, RV thickness and septum thickness are presented in Table 4-4. There were no differences in parameters between sham-operated WT and VN- / - mice. As anticipated, LV free wall thickness of infarcted mice was diminished when compared to sham-operated VN- / - and WT mice. However we also found that infarcted LV free wall of VN- / - mice was increased in thickness when compared to WT (WT Ml; 0.72 ± 0.05mm VN- / - Ml; vs. 0.82 ± 0.04mm, p = 0.1) (Figure 4-11). Despite the apparent changes to infarcted mouse hearts no significant differences were noted in the RV and septum thickness between infarcted WT and VN- / - mouse groups (WT Ml; 0.31 ± 0.01mm vs. VN- / - Ml; 0.28 ± 0.01mm, p = NS) and (WT mice; 0.87 ± 0.01mm vs. VN- / - mice; 0.9 ± 0.01mm, p = NS) respectively (Figure 4-11). However, both the RV and septum thickness were notably increased in infarcted WT or VN- / - mice compared to their representative sham-operated mice (RV thickness, WT mice; 0.25 ± 0.02 mm vs. 0.31 ± 0.02, p = 0.06) and (RV thickness, VN- / - mice; 0.28 ± 0.01 vs. 0.33 ± 0.02, p = 0.1) and (Septum thickness, WT mice; 0.7 ±0 .1 vs. 0.87 ± 0.05, p = 0.12) and (Septum thickness, VN- / - mice; 0.74 ± 0.01 vs. 0.9 ± 0.01, p = 0.09) (Figure 4-11). Alterations in cardiac architecture occur likely as a compensatory hypertrophic response to excessive LV thinning to maintain sufficient function. LV diameter was increased in the Ml groups of both, WT (WT controls; 2.99 ± 0.33 vs. WT Ml 3.73 ± 0.23 mm, p = 0.09) and V N -/- (VN-/- controls; 2.5 ± 0.4 mm vs. VN- / - Ml 3.77 ± 0.17 mm, p = 0.006) mice compared to their respected sham-operated controls (Figure 4-12). Surprisingly, 72 sham-operated WT mice appeared to exhibit an increase in LV diameter compared to VN- / - , although the difference was not significant (p = 0.38). 4.3.10 Examination of leukocyte infiltration 3 days post-MI Three days post-MI VN- / - mice experienced reduced myocardial necrosis and showed a reduction in inflammatory cell infiltration determined by accumulation of M P O positive cells in the infarcted LV (WT Ml 167 ± 33 vs. VN- / - Ml 118 ± 34 cells/500um 2; p = 0.34). The majority of MPO positive cells were localized to the infarct area abundant in enucleated (dead) cardiomyocytes in both WT and VN- / -mice. M P O positive cells were mainly absent from the RV and posterior non-infarcted LV in both WT and VN- / - Ml mice (Figure 4-13). 73 LV Anterior Free Wall RV E 0.8 cu 0.6 c O jE 0.4 0.2 0.0 p " 0.22 p = 0.21 | \ I Rllll p = 0.62 p = 0.1 II WT VN-/- WTMI VN-V-MI Control Control VN Ml £ 0.1 E Septum p = 0.09 I p = 0.12 WT VN-I- WTMI VN-/-MI Control Control Figure 4-11. VN-/- mice exhibit altered wall structure 28 days post-MI. VN- / -mice experienced a marked decrease in the infarcted LV free wall thickness when compared to WT mice at 28 days post-MI (WT Ml; 0.57 ± 0.02mm VN- / - Ml; vs. 0.74 ± 0.04 mm 05, p = 0.1). No significant differences were noted in the RV and septum thickness between infarcted WT and VN- / - mice (WT controls; 0.31 ± 0.01mm vs. VN- / - controls; 0.28 ± 0.01mm, p = NS) and (WT controls; 0.87 ± 0.01mm vs. VN- / - controls; 0.9 ± 0.01mm, p = NS) respectively. Slight increase in the thickness of anterior LV free wall was noted between the WT and VN- / - sham-operated controls, however no differences were noted in either the RV and septum thickness. 74 Figure 4-12. VN-/- mice exhibit no change in LV diameter 28 days post-MI. Morphometric analysis demonstrated no significant changes in LV diameter between WT and VN- / - sham-operated controls (WT controls; 2.99 ± 0.33. VN- / -controls; vs. 2.5 ± 0.4 mm, p = 0.38) and between WT and VN- / - Ml groups (WT Ml; 3.73 ± 0.23 vs. VN- / - Ml; 3.77 ± 0.17 mm, p = 0.89). 28 days post-MI infarcted LVs of both WT and VN- / - were significantly increased in size compared to their respective sham-operated control groups. 75 A W T V N -/-B WT Ml VN -/- Ml Figure 4-13. VN-/- mice exhibit reduced MPO staining in the infarcted LV at 3 days post-MI. A) Myeloperoxidase (MPO) positive inflammatory cells (red) in the infarcted LV of WT and VN- / - mice at 3 days. Localization of M P O positive cells was particularly observed in area of myocardial necrosis (insets, lower right). Staining was absent from WT and VN- / - sham-operated control mice. B) Quantitative morphometry (40x objective, 5 fields of view) demonstrated a reduction in the M P O positive cells in the infarcted VN- / - mice when compared with WT (WT Ml; 167 ±33 vs. V N - / - M l ; 118 ± 34 cells/100pm 2). Scale bar = 100 pm. 76 4.3.11 Examination of vessel formation 7 and 28 days post-MI Angiogenesis is an essential part of post-MI remodeling. In order to investigate the effects of VN on development of new microvessel, slides were stained with CD31 and examined by brightfield microscopy (Figure 4-14). Quantitative morphometry of CD31 staining 3 days post-MI demonstrated a decline in the number of newly formed capillaries in the infarct (WT Ml 9.75 ± 1.89 vs. VN- / -Ml 4.67 ± 2.09 vessels/500um 2 , p = 0.13) and peri-infarct regions (WT Ml 10.38 ± 1.82 vs. VN- / - Ml 5.42 ± 1.72 vessels/500um 2 , p = 0.09) of VN- / - mice. Quantification of total CD31 positive vessels throughout the entire anterior LV further showed a significant reduction in VN- / - Ml mice when compared to WT Ml (WT Ml 13.5 ± 0.71 vs. VN- / - Ml 6.08 ± 2.5 vessels/500um 2 , p = 0.04). Furthermore, although significant differences in the number of CD31 positive vessels was noted between WT sham-operated and WT Ml groups (WT Controls 2.15 ± 1.83 vs. WT Ml 13.5 ± 0.71 vessels/500um 2 , p < 0.001), sham-operated V N -/- mice exhibited no differences when compared to the VN- / - Ml mice (VN-/-Controls 5 ± 3.89 vs. VN- / - Ml 6.08 ± 2.5, p = 0.81) (Figure 4-15). vWF staining was used to identify vascular endothelial cells in mature vessels. Examination of vWF positive vessels demonstrated a reduction in the number of vessels found in the infarct and peri-infarct regions of VN- / - mice at 28 days. There was an overall increase in vessel number found in LV of WT mice when compared to VN- / - (WT Ml 32.06 ± 6.83 vs. VN- / - Ml 23.9 ± 3.01 vessels/500um 2 , p = 0.27). Distribution of vWF positive vessels by region showed an increase in the peri-infarct zone of WT mice when compared to VN- / - (WT Ml 37.14 ± 9.53 vs. VN- / - Ml 19.94 ± 2.77 vessels/500um 2 , p = 0.09), with no 77 significant changes noted in the infarct zone between the two groups (WT Ml 30.86 ± 7.09 vs. VN- / - Ml 21.75 ± 4.28 vessels/500um 2 , p = 0.76) (Figure 4-16). WT Sham VN-/- Sham P value WTMI VN-/- Ml P value MPO positive stain (cells/500um2) - - - 167 ±33 118 ±34 NS CD31 positive stain (vessels/500pm2) 2.15 ±1.83 5 ± 3.88 NS 13.5 ±0.71 6.08 ±2.5 <0.05 Collagen deposition (% LV area) 0.12 ±0.05 0.19 ±0.03 NS 19.21 ±3.57 8.12 ±1.92 <0.05 Collagen deposition (% LV internal circumference) 0.53 ±0.06 0.65 ±0.13 NS 34.6 ±3.01 31.3 ±2.3 NS LV diameter (mm) 2.99 ±0.33 2.5 ±0.4 NS 3.73 ±0.23 3.77 ±0.17 NS LV thickness (mm) 0.67 ±0.06 0.77 ±0.03 NS 0.73 ± 0.04 0.82 ± 0.05 NS RV thickness (mm) 0.25 ± 0.02 0.28 ± 0.02 NS 0.3 ±0.01 0.32 ±0.02 NS Septum thickness (mm) 0.7 ±0.1 0.74 ± 0 NS 0.87 ±0.05 0.9 ±0.48 NS Table 4-3. Summary of morphological analysis associated with sham-operated and infarcted WT and VN- / - mice. P value as determined by a paired Student's f-test. 78 Figure 4-14. Accumulation of new vessels in hearts of WT and VN-/- mice 3 days post-MI. Brightfield images stained for CD31 showed immature vessels (red) localized in the peri-infarcted region at 3 days post-MI. Marginal staining was also observed in sham-operated control mice. Scale bar = 100 urn. 79 Peri-lnfarct Region Infarct Region E i D O p = 0.13 LiJ WTMI £- 10 a o Overall 0.81 0.53 WT VN Control Control WT Ml VN -/- Ml Day 3 Figure 4-15. VN-/- mice exhibit a reduction in CD31 positive microvessels 3 days post-MI. Morphometric analysis of CD31 positive vessels in WT and VN- / -hearts demonstrated a marginal increase in the infarct and peri-infarct regions of WT mice when compared to VN- / - . Overall, no significant differences were observed between the WT and VN- / - sham-operated control mice groups (WT controls 2.15 ± 1.83 vs. VN- / - controls 5.0 ± 3.89, p = 0.53). In contrast, significant increases were noted in WT Ml mice when compared to VN- / - Ml mice (WT Ml 13.5 ± 0.71 vs. VN- / - Ml 6.08 ± 2.5, p < 0.05). Furthermore, there was a significant increase in vessel formation between WT Ml mice 3 days post-MI when compared to WT controls (p < 0.001). No changes were noted between VN- / - sham-operated controls and VN- / - Ml mice (p = 0.81). 80 Peri-infarct Region Infarct Region Figure 4-16. VN-/- mice exhibit a reduction in vWF positive vessels 28 days post-MI. Morphometric analysis of von Willebrand factor (vWF) staining for mature endothelial cells in WT and VN- / - hearts demonstrated a notable increase in peri-infarct region (WT Ml 37.14 ± 9.53 vs. VN- / - Ml 19.94 ± 2.77, p = 0.09), with only trivial increase noted in the infarct region (WT Ml 30.86 ± 7.09 vs. VN- / - Ml 21.75 ± 4.28, p = 0.76) of WT mice when compared to VN- / - . Overall, there was an increase in vWF positive vessels throughout the LV of WT Ml mice when compared to VN- / - Ml mice (WT Ml 34 ± 5.77 vs. VN- / - Ml 24.43 ± 3.43, p = 0.15). 81 4.3.12 Assessment of cardiac function post-MI 4.3.12.1 Evaluation of hemodynamic parameters by echocardiography Details regarding body weight, age and site of ligation of mice are detailed in Table 4-3. Baseline evaluation of hemodynamic parameters was performed on 21 mice, 11 WT and 10 VN-/ - . There was no difference in age or weight at time of assessment. Dimensions and function were assessed by both M-mode and by Simpson's method. No significant differences were noted in any of the parameters measured between baseline control WT and VN- / - mice. Initial reduction in body weight was noted in the post-MI WT or VN- / - groups however the weight returned back to baseline by day 28. Cardiac function was evaluated by M-mode and 2D transthoracic echocardiography at baseline and 28 days post-MI (Figure 4-17 and 4-18). No differences in hemodynamic parameters were evident between WT and VN- / - baseline controls (Table 4-5). Significant differences in hemodynamic parameters were observed between WT and VN- / - mice 28 days post-MI (Table 4-5). Both systolic and diastolic volumes were greatly diminished in post-MI VN- / -mice when compared to WT. VN- / - mice showed significant improvement over WT mice in EF (41.8 ± 7% vs. 48.5 ± 7.5%, p < 0.001) (Figure 4-19). Furthermore, significant changes in EF were observed in both, WT and VN- / - baseline control mice when compared to the corresponding Ml groups. Major differences were also noted in fractional area of contractility between the two Ml groups (WT Ml 35.9 ± 9.3% vs. VN- / - Ml 43.7 ± 7.4%, p < 0.01) (Figure 4-19B). Significant changes in fractional area of contractility were also noted, in both WT and VN- / - baseline control mice when compared to the corresponding Ml groups. No significant differences in stroke volume, cardiac output, and heart rate were evident between WT and VN- / - mice at baseline or 28 days post-MI (Figure 4-19B). 82 Variables Baseline 28 days post-MI WT (n=11) VN-/-(n=10) P value WT (n=20) VN-/-(n=19) P value Systolic Volume (ML) 28.8±10.7 27.5±8.2 NS 68.7±25.2 49.0±14.0 <0.01 Diastolic Volume (ML) 66.1 ±22.5 62.1±15.4 NS 114.5±30.1 94.9±21.7 <0.05 Stroke Volume (uL/sec) 37.3±13.2 34.6±8.4 NS 45.9±8.8 45.9±11.9 NS Ejection Fraction (%) 56.3±7.0 55.9±4.9 NS 41.4±7.6 48.4±7.0 . <0.005 Cardiac Output (mL/min) 9.0±6.5 8.1 ±3.2 NS 9.7±1.9 10.0±4.5 NS Fractional Area of Contractility (%) 51.2±6.8 51.9±8.4 NS 35.9±9.3 43.7±7.4 <0.01 Heart Rate (beats/min) 28.8±10.7 27.5±8.2 NS 219±61 215±73 NS Table 4-4. Summary of measurements for hemodynamic parameter acquired by echocardiography in baseline and infarcted WT and VN- / - mice. 4.3.12.2 Evaluation of hemodynamic parameters by Millar catheter analysis Pressure-volume conductance data adequate for analysis were obtained from 18 of 22 non-infarcted mice (WT, n = 10 and VN-/ - , n = 8). Millar catheter insertion was attempted on infarcted mice following echocardiography with adequate data obtained from 16 of 20 WT and 16 of 19 VN- / - mice (other seven animals either died before or shortly after catheter insertion), although standard deviation were substantial accounting for approximately one-third of the mean. No differences in any hemodynamic parameter were noted between WT and VN- / -mice at baseline or at 28 days post-MI. Data detailing all pressure-volume assessment using Millar catheters are detailed in Tables 4-6, 4-7, 4-8, 4-9, 4-10 and 4-11. 83 Steady State Parameters WTMice (n = 10) VN-/- Mice (n = 8) P value Heart Rate (bpm) 203.9 ±49.9 214.7 ±66.1 NS Maximum Volume (uL) 53.5 ± 11.4 45.8 ±5.2 NS Minimum Volume (uL) 35.3 ±5.4 33.5 ±5.6 NS End-systolic Volume (uL) 36.5 ±5.9 34.9 ± 6 NS End-diastolic Volume (uL) 52.9 ±11.3 45.3 ±5.3 NS Maximum Pressure (mmHg) 97.9 ±37.1 92.9 ± 35.6 NS Minimum Pressure (mmHg) 4.6 ±4.9 4.5 ±4.3 NS End-systolic Pressure (mmHg) 96.2 ± 37.9 92.9 ± 35.6 NS End-diastolic Pressure (mmHg) 8.2 ±4.4 7.2 ±4.3 NS Stroke Volume (uL) 18.2 ±8.5 12.3 ±3.4 NS Ejection Fraction (%) 32.5 ±9.9 27 ± 8 NS Cardiac Output (uL/min) 3423.2 ±1172.6 2604 ± 1050.1 NS Stroke Work (mmHg x uL) 1125.2 ±489.7 760.9 ± 226.8 NS dP/dt max (mmHg/sec) 4530.6 ±1143.9 5055.9 ± 1239 NS dP/dt min (mmHg/sec) -2253.2 ±761.8 -2554.9 ±692.1 NS dV/dt max (uL/sec) 321.3 ±123 232.3 ± 55.5 NS dV/dt min (uL/sec) -425.2 ±179.3 -325 ±132.8 NS Table 4-5. Hemodynamic parameter evaluation in baseline control W l mice using Millar catheter. P value as determined by a paired Student's r and VN- / -f-test. All t-tests assume Gaussian distribution and unequal variance between groups. 84 Steady State Parameters WTMice (n = 10) VN-/- Mice (n = 8) P value Heart Rate (bpm) 169.3 ±31.4 165.8 ±56.3 NS Maximum Volume (uL) 47.2 ±20 49.6 ±16.6 NS Minimum Volume (uL) 38.3 ±17 39.1 ± 12.4 NS End-systolic Volume (uL) 39.8 ± 17.4 40.1 ± 12.7 NS End-diastolic Volume (uL) 46.1 ±20.4 48.8 ± 16.1 NS Maximum Pressure (mmHg) 67.3 ±19.3 76.9 ±21.1 NS Minimum Pressure (mmHg) 3.4 ±4.6 1.6 ±3.1 NS End-systolic Pressure (mmHg) 66.3 ±19.6 76.2 ±21 NS End-diastolic Pressure 5.8 ±4.8 4.6 ± 3.2 NS (mmHg) Stroke Volume (uL) 8.9 ±6.2 10.6 ±6.2 NS Ejection Fraction (%) 21.1 ± 15.6 20.5 ±7.8 NS Cardiac Output (pL/min) 1449.6 ±993 1629.4 ±938.7 NS Stroke Work (mmHg x uL) 467.5 ±501.6 597.8 ±441.6 NS dP/dt max (mmHg/sec) 3314.4 ± 1471.9 3480.1 ± 1234.9 NS dP/dt min (mmHg/sec) -1655.2 ±773.9 -1825.3 ±875 NS dV/dt max (uL/sec) 208.5 ± 127.7 239.3 ±165.5 NS dV/dt min (uL/sec) -225.6 ± 154.3 -304.1 ±242.3 NS Table 4-6. Hemodynamic parameter evaluation in WT and VN- / - mice 28 days post-MI using Millar catheter. P value as determined by a paired Student's Mest. All t-tests assume Gaussian distribution and unequal variance between groups. 85 Hemodynamic Parameters WTMice (n = 10) VN-/- Mice (n = 7) P value Ees 10.58 ±9.59 12.86 ±9.24 NS Emax 17.08 ±11.42 22.74 ± 14.25 NS dP/dt - EDV 257.55 ± 372.03 573.74 ± 505.96 NS dP/dt - EDV intercept 48.01 ±12.26 27.88 ± 23.34 NS Table 4-7. Baseline hemodynamic parameter following aortic occlusion evaluated by Millar catheterization in WT and VN- / - mice. P value as determined by a paired Student's /-test. All t-tests assume Gaussian distribution and unequal variance between groups. Hemodynamic Parameters WTMice (n = 13) VN-/- Mice (n = 13) P value Ees 10.88 ±8.81 9.77 ±6.03 NS Emax 17.38 ± 10.16 11.86 ±6.46 NS dP/dt - EDV 303.61 ±561.62 151.36 ±214.13 NS dP/dt - EDV intercept 52.26 ± 59.62 50.79 ±52.12 NS Table 4-8. Hemodynamic parameter following aortic occlusion evaluated by Millar catheterization in WT and VN- / - mice at 28 days post-MI. P value as determined by a paired Student's West. All t-tests assume Gaussian distribution and unequal variance between groups. Hemodynamic Parameters WT Mice (n = 7) VN-/- Mice (n = 4) P value Ees 8.66 ±11.53 16.14 ±20.96 NS Emax 11.55 ± 12.69 19.66 ±21.11 NS dP/dt - EDV 106.64 ±65.52 234.59 ± 87.78 <0.05 dP/dt - EDV intercept 6.45 ±19.28 24.55 ±10.7 NS Table 4-9. Baseline hemodynamic parameter fol vena cava as evaluated by Millar catheterization i as determined by a paired Student's /-test, distribution and unequal variance between groups owing occlusion of the inferior n WT and VN- / - mice. P value All t-tests assume Gaussian Hemodynamic Parameters WT Mice (n = 9) VN-/-Mice(n =5) P value Ees 16.85 ± 16.98 15.66 ± 10.69 NS Emax 22.98 ± 17.59 19.95 ±12.56 NS dP/dt - EDV 389.39 ±314.58 178.53 ±259.73 NS dP/dt - EDV intercept 33.15 ±13.97 44.49 ± 23.26 NS Table 4-10. Hemodynamic parameter following occlusion of the inferior vena cava evaluated by Millar catheterization in WT and VN- / - mice at 28 days post-MI. P value as determined by a paired Student's /-test. All t-tests assume Gaussian distribution and unequal variance between groups. 86 Figure 4-17. Evaluation of hemodynamic parameters by echocardiography. Intraventricular length (L) and ventricular cross sections at the sub-mitral valve (A1), papillary (A2), sub-papillary (A3) and apical (A4) levels in diastole and systole were obtained using echocardiography. The images were used to determine the systolic and diastolic volume of the hearts, which were than used to calculate ejection fraction and other hemodynamic paerameters in sham-operated and infarcted hearts by using Simpson's method. 87 Figure 4-18. Representative echocardiographic M-mode tracing. M-mode tracing across the LV at the level of the papillary muscles was used to measure interventricular septal (IVS) and posterior wall thickness (PWT) in systole and diastole. M-mode measurements were also used to obtain LV internal diameter (LVID) in systole and diastole at baseline controls which allowed for estimation of the ejection fraction using the Teicholz method. 88 A B Control Ml Control Ml Figure 4-19. VN-/- mice exhibit significant improvement in cardiac function 28 days post-MI. Echocardiographic evaluation of ejection fraction and fractional area of contractility displayed no differences between WT and VN- / - mice at baseline. In contrast, infarcted VN- / - mice exhibited significant improvements in ejection fraction (WT Ml 41.4 ± 7.6% vs. VN- / - Ml 48.4 ± 7.0%, p < 0.005) and fractional area of shortening (WT Ml 35.9 ± 9.3% vs. VN- / - Ml 43.7 ± 7.4%, p < 0.01) when compared to WT mice at 28 days post-MI. 89 4.4 Discussion Post-MI wound healing is a complex process that involves proteolysis, cell migration and proliferation, and fibrosis. Many of the functions attributed to VN overlap with the responses to wound healing following ischemic injury [243]. Multiple mechanisms can be implicated in regulation of myocardial wound healing and here we investigated the potential role of VN in regulation of wound repair following Ml. Following Ml, VN may regulate post-MI healing by providing abundant attachment sites for various cell types through interactions with integrins and is therefore crucial in the adhesion, migration and proliferation- processes particularly in area of damage. Additionally, following infarction VN may have a role in regulating cardiac function by potentially modulating/interfering with sarcomeric and/or cytoskeletal proteins, or another unidentified mechanism. We have examined the effects of VN on cardiac structure and function following Ml. The major novel finding from our study demonstrated that mice lacking VN exhibit an improvement in healing and cardiac function following infarction. Overall, deficiency in VN proved to be beneficial to post-MI wound healing which was further established by morphometric analysis of infarcted mouse hearts at 3, 7 and 28 days. Improvements could be mainly attributed to a reduction in inflammatory infiltrate and attenuation in tissue fibrosis, despite a diminished angiogenic response. A dramatic reduction in collagen scaring of LV anterior free wall was noted in VN- / - mice when compared to WT. Furthermore, both the anterior LV free wall thickness and total non-infarcted myocardial regions were increased at 28 days post-MI in VN- / - mice, suggesting of diminished remodeling taking place. The differences in wall structure of the infarcted LV observed between WT and V N -/- mice at 28 days were probably instigated by an apparent arrest in LV remodeling 90 due to a reduction in leukocyte infiltration in the absence of V N . LV remodeling in infarcted mice was accompanied by changes to the unaffected myocardium. However, no changes in LV diameter, RV or septum thickness were noted between WT and VN- / - at 28 days post-MI. Moreover, no significant changes in wall structure and chamber geometry were noted between the sham-operated groups. Alterations in post-MI remodeling between WT and VN- / - mice were perhaps best exemplified by the apparent differences in cardiac function. Hemodynamic measurements acquired by echocardiography demonstrated that post-MI VN- / -mice showed a significantly improved cardiac function compared to WT mice at 28 days. The dramatic differences associated with the manifestation of VN at sites of Ml are likely attributed to either plasmin dependent and/or independent mechanism(s). VN has previously been shown to have a dominant role in cell adhesion, spreading and migration. VN contains attachment sites for a number of cells including inflammatory cells, S M C , myofibroblasts and endothelial cells [244-246]. Hours to days following ischemic injury the accumulation of VN in the myocardium can promote migration and adhesion of inflammatory cells which are responsible for removal of necrotic tissue and clearing debris for the formation of new collagen network. VN which enters from plasma is localized in the E C M via the collagen binding domain and glycosaminoglycan domain [73, 74]. In the E C M , migrating cells bind via RGD sequence of VN by forming interactions with integrins (avB3, av65) and uPAR expressed on the surface of the cell [127, 247, 248]. Days following infarction, fibroblasts begin the remodeling process by producing collagen and other structural proteins. Additionally, endothelial progenitor cells migrate to areas of damage to stimulate angiogenesis [248]. Thus, E C M VN can significantly 91 influence post-MI remodeling by modulating the localization of various cell types to the area of injury (Figure 4-20). The function of VN in regulation of vascularization following injury was previously demonstrated in a number of models [109, 249-251]. These studies suggest the absence of VN considerably reduces angiogenesis, while the reverse was noted in its presence. Our findings are consistent with the above allegation as VN- / - mice experienced a reduction of CD31 and vWF positive vessels post-MI. These observations can be rationalized two-fold. First, VN is a ligand for integrin av63 and avB5 on the surface of endothelial cells and is therefore important for vascular development [247, 252]. The absence of VN can not only limit the migration, and proliferation of endothelial cells through integrin-cytoskeletal interactions, but also lead to changes in intracellular signaling pathways which enlists an apoptotic response [109, 249, 250, 253]. Secondly, PAI-1 is a substantial factor in the angiogenic response. While a lack of PAI-1 completely abolished angiogenesis in mice, at physiological concentrations PAI-1 promotes angiogenesis [254, 255]. Although such effects are accomplished through PAI-1's antiproteolytic activity rather than by its interactions with V N , in the absence of VN levels of PAI-1 are considerably reduced [254, 256]. However, despite the unfavorable antiangiogenic effects, VN- / - mice sustained better cardiac healing and function post-MI. The importance of integrins in post-MI cardiac remodeling has been recognized for some time. In addition to controlling growth factors and hemodynamic effects, regulation of integrin activity through E C M protein interactions also affect cardiac fibrosis and remodeling process. E C M proteins can 92 ECM Figure 4-20. VN modulates cell migration at sites of post-MI injury. In the E C M , migrating cells bind VN and fibronectin (FN) via R G D sequence by forming interactions with integrins (avB1, avB3, avB5) and u-PA receptor (uPAR) expressed on the surface of the cell. In days post-infarction the accumulation of VN in the myocardium promotes migration and adhesion of inflammatory cells such as monocytes (Mono), eosinophils (Eos) and polynuclear monocytes (PMN) which are responsible for clearing of necrotic debris. The binding of fibroblasts (FB) and endothelial cells (EC) also assist in the remodeling process by producing collagen and other structural proteins, and stimulate vascular genesis. 93 influence integrin activity and vice versa. For example, both collagen and FN induces MMPs, collagenases and gelatinases through their interactions with integrins [257, 258]. Additionally, shape, migration, proliferation and apoptosis are all regulated by E C M molecules through integrin-cytoskeleton and intracellular pathways in S M C and endothelial cells [252, 258]. Integrins which bind to the R G D motif are also imperative in the angiogenic process [249, 257, 259]. VN binds to various integrins and interacts preferentially with avB1, avB3, avB5 which may be responsible for attachment of cells, prevention of microvascular cell apoptosis, as well as neo-vessel synthesis and regeneration in the infarcted myocardium [260, 261]. Specifically, integrin av33, also known as the VN receptor has a significant role in vascular remodeling and cardiac fibroblast action [247, 262]. Thus, as anticipated VN- / - mice exhibited some attenuation of angiogenesis and fibrosis post-MI. However, it is highly improbable that VN is the sole E C M R G D protein involved in the post-MI E C M remodeling process [247, 263, 264]. Undoubtedly, other R G D proteins such as FN are involved in leukocyte recruitment and migration, angiogenesis, and tissue fibrosis. Therefore, although the wound healing response following Ml is notably altered in the VN- / - mice compared with WT it is not drastic in nature. Work from our laboratory also demonstrates that bone marrow cells localize particularly in the VN-rich infarct region (Figure 7-3). Such cells have the potential to differentiate into functional cardiomyocytes or other cardiogenic cell types [265-267] [268, 269]. Thus, in absence of V N , there are profound changes to integrin-dependent attachment of cell to E C M scaffold, as well as VN-stimulated intracellular signaling pathways. uPAR is another important regulator of cellular communication which is in-part controlled by interacting with V N . This molecule is expressed on a number of 94 cell types including leukocytes, endothelial, S M C , fibroblasts and bone marrow cells [248, 270]. uPAR is a receptor for V N , and by binding u-PA it increases its affinity for VN and enhances the adhesiveness of uPAR-expressing cells [271-273]. Furthermore, the association of uPAR with integrins and/or VN allows for regulation and modulation of ligand binding, cellular signaling, as well as control cell uptake/invasion [259, 270]. Thus, uPAR may also play an integral role in post-MI wound healing through its participation in cell adhesion and signaling. However, through differential interactions uPAR and integrin av mediated cell adhesion is competed for by PAI-1 [270, 274, 275]. Binding sites for uPAR and PAI-1 lie within close proximity along the amino-terminal domain of V N , thus there is direct competition between uPAR and PAI-1 VN binding. Previous studies demonstrated that in mice deficient in PAI-1, neovascularization is significantly impaired suggesting an anti-adhesive function of PAI-1 in cellular interactions [276]. Although the role of uPAR and its interactions with VN and integrins was not explored in this study, uPAR expression is observed in organs undergoing extensive tissue remodeling [277]. Thus, it is probable that uPAR is also involved in the regulative processes associated with post-MI wound healing by interacting with VN although the exact role remains to be investigated. Integrin-dependent migration of cells to sites of injury is in-part contingent on the accumulation of VN in the E C M [67, 274]. However, binding of PAI-1 to the somatomedin B domain of VN sterically inhibits the integrin recognition site, thus preventing cell migration, adhesion and spreading [251, 278]. Recent studies with mouse models of pulmonary and dermal injury suggest that through interactions with PAI-1, VN is the driving force in preventing repair and commencing fibrosis [279, 280]. Similar to human studies, post-MI, WT mice experience elevated PAI-1 95 levels which block integrin binding sites on VN partially limiting the attachment of cells, however in absence of VN the binding of cells is severely limited. Therefore, a deficiency in VN reduces PAI-1 levels and activity in the wound matrix, concurrently reducing cell adhesion and migration. Despite the fact that VN is involved in various physiological and pathological functions, the VN- / - phenotype is not embryonic lethal [115]. Thus, it is probable that other protein(s) facilitate similar function in the absence of V N . FN is one such potential candidate, since like VN it is a major adhesion protein with common structural and functional characteristics [281]. Like V N , FN mediates a wide variety of cellular interactions with the E C M and plays important roles in cell adhesion, migration, growth and differentiation [282, 283]. Moreover, besides binding to cell surfaces via integrins, FN binds to a number of biologically important molecules including heparin, collagen/gelatin, and fibrin [282]. It is also probable that VN may influence post-MI cardiac function directly by modulating cardiomyocyte contractility. The regulation of cardiomyocyte contractility may potentially involve the binding of VN to sarcomeric and/or cytoskeletal proteins. One such candidate protein includes desmin IF, as discussed in detail in Chapter 6. Additionally, VN may also regulate cell contractility via integrin specific interactions. Previous studies reported that by binding to av and p1 integrins on S M C , VN inhibits contractility by stimulating phenotypic cell transformation [245]. Furthermore, VN reduced the contractile ability and altered the phenotype of human lung fibroblasts down-regulating a-smooth muscle actin expression via integrin- dependent interactions [284]. Adult cardiomyocytes express numerous integrins including alpha 1, 3, 5, 6, 7, 9, and 10, as well as beta 1, 3 and 5 [76, 285]. Thus, it is plausible that through specific interactions with 96 integrins, VN is involved in signaling pathways which may depress contractility by regulating sarcomeric protein(s) expression. Alternatively, improvement in cardiac function can be attributed to increased numbers of surviving myocytes and/or a reduction in fibrosis. VN- / - mice sustained a substantial decrease in post-MI collagen deposition in the infarcted LV as demonstrated by picrosirius red staining at 28 days. Moreover, when compared to WT mice, VN- / - exhibited an increase in area of viable muscle 28 days post-MI. Thus, the VN- / - phenotype may be inclined to protect the myocardium from ischemic damage and/or prevent excessive remodeling, thus improving cardiac function. 4.5 Conclusions Here we have shown the detrimental effects of VN in wound healing following Ml. Ligation of the LAD in mice deficient in VN demonstrated a reduction in the inflammatory response, decreased collagen scar formation, altered angiogenesis and improved cardiac function. Together, our findings suggest that VN plays a detrimental role in post-MI wound healing. Thus, potential strategies aimed at preventing VN deposition at sites of ischemic myocardium may be a novel means of preserving function and improving healing post-MI. VN may modulate cardiac fibrosis through integrin-dependent attachment of inflammatory cells at sites of infarction although PAI-1-dependent anti-proteolytic properties may also play a significant role. The precise role of VN in post-MI remodeling remains to be further consideration, however our work suggests that absence of VN exhibits substantial cardioprotective effects by preventing damage to the myocardium during ischemia and/or promoting post-MI healing. Exploring and understanding the means of VN regulation of processes involved in post-MI remodeling and analysis of 97 mechanism(s) of action can advance our knowledge with respect to post-MI cardiac healing. Consequently, this may stimulate exciting opportunities to develop new therapeutic strategies to prevent or treat Ml. 4.6 Additional Considerations Although VN is also thought to participate in various other pathological processes such as the regulation of the immune and complement systems, the work presented here did not investigate the role of VN in that respect. At sites of myocardial ischemic injury VN is co-deposited with membrane attack complex (MAC) and may encourage the clearance of injured cells [286]. Furthermore, VN may also play a role in post-MI apoptosis. Previous reports demonstrated that VN is involved in E C M remodeling via granzyme B dependent activity. Granzyme B which is released from cytotoxic lymphocytes has a role in the induction of target cell apoptosis and anoikis, and is stimulated in part by cleaving the R G D motif of VN affecting the integrin-binding site [287]. Preliminary immunohistochemical studies from our laboratory demonstrated that VN- / - mice exhibited an increase in terminal deoxynucleotidyltransferase-mediated dUTP nick-end labeling (TUNEL) stained cells at 3 and 7 days post-MI, contrary to expectations. However, further studies are necessary in order to examine the role of VN in post-MI apoptosis. Furthermore, despite only minor complications experienced in obtaining functional measurements using echocardiography, it should be stated that these experiments were performed on mildly sedated animals. Though previous studies have successfully performed echocardiography in non-sedated animals, we were unable to use this technique in our facility. The probe used contained a mechanical transducer in a liquid medium which could only be mounted in a vertically and 98 required the animal to be oriented in a supine position. Attempts to orient the probe in a different fashion resulted in formation of air bubbles which prevented obtaining usable images. Additionally, we experienced difficulties obtaining open-chest hemodynamic assessment using pressure-volume conductance systems. By using a 1.2 French probe inserted trans-apically we were able to obtain data only 70% of time and were not always able to obtain adequate wave-forms for aortic and IVC occlusions. Aortic occlusion seemed to be more reliably reproducible and IVC occlusion could only be repeated a few times before the animal succumbed. Although smaller probes are currently available, we did not wish to substitute the probe used during the course of the experiment and managed to conduct all the tracings for the whole experiment using a single catheter. Finally, functional evaluation of infarcted mice was performed at 28 days only, with no subsequent testing taking place. Development of heart failure traditionally begins to manifest six to eight weeks in murine models post-MI which generally results in rapid increase in weight caused by excessive fluid retention and development of dyspnoea caused by LV dysfunction. These outcomes were not observed in the infarcted animals at the time of the experiment as the duration of the experiment was relatively short. Although we were able to study the effects of VN on post-MI remodeling, we were unable to investigate the function of VN in the development of heart failure. 99 CHAPTER V EFFECTS OF VITORNECTIN ON REGULATION OF THE PA/PLASMIN AND MMP SYSTEMS IN WOUND HEALING POST-MYOCARDIAL INFARCTION 5.1 Rationale Although in the last decade our understanding of post-MI remodeling has considerably advanced, to date the precise mechanism(s) of wound healing requires additional clarification. Studies described in Chapter 4 demonstrated that VN plays a significant role in post-MI remodeling by influencing cardiac structure and function. The PA/plasmin and M M P systems play a major role in wound healing post-MI. VN is an acute phase plasma protein which closely interacts with components of PA/plasmin system, regulating the deposition of PAI-1 in damaged tissues. Many unique VN-dependent binding interactions which regulate the deposition of PAI-1 in thrombi and damaged tissues have been studied. These include the biochemical, morphologic and functional characterization of the multimeric form of the VN:PAI-1 complexes, and the VN-dependent binding of these multivalent VN:PAI-1 complexes to the surface of fibrin fibrils expressed on the surface of activated platelets and platelet microparticles. Additionally, studies demonstrated that VN prevents proper remodeling at sites of skin and lung injury directly by interacting with PAI-1. Hence, it is plausible that VN by mediating the binding of VN:PAI-1 complexes to polymeric structures in damaged myocardium, may also be an important determinant of post-MI ventricular revascularization and remodeling. Since we have established that VN has a significant role in post-MI remodeling, we wanted to determine whether it does so through the regulation of the PA/plasmin system. 100 5.2 Experimental Methodology 5.2.1 mRNA expression using RT-PCR Tissue samples stored in RNAIater® solution at -80°C were lysed by mechanical homogenization at medium speed to avoid RNA degradation. Total RNA was extracted using RNeasy Protect Mini Kit (Qiagen) RNA expression within the infarcted LV and non-infarcted RV were measured using spectrophotometry following which 6 ug of total RNA was reverse transcribed in 60 uL volume using reverse transcriptase with 1 ug random primers. For each RT product, aliquots (2-10 pi) of the final reaction volume were amplified in four parallel P C R reactions using V N , PAI-1, MMP-2 and 9, t-PA, u-PA, desmin and GAPDH-specif ic primers (NAPS, University of British Columbia, Vancouver) (Table 5-1) and Taq polymerase. R T - P C R products were separated on agarose gels containing ethidium bromide and quantification performed by densitometry using Image J v1.38. All measurements were expressed as the ratio between the target genes and G A P D H , or as a comparison of target genes from control mice and Ml mice. mRNA from three animals from each group at each time-point were used and the mean value calculated and compared by ANOVA. Primer Sequence Designation Sense Strand Primer (5' - 3') Anti-Sense Strand Primer (3" - 5*) Size (bp) VN AAG ATGTCTG G G G C ATTG AG CAAGGCAAAGTGCTCAAACA 332 u-PA TGCTGTCCTTCAGAAAC GCTCCACCTCAAACTTC 491 t-PA G CTG AGTG C ATCAACTG G AA GCCACGGTAAGTCACACCTT 242 PAI-1 TCATCAATGACTGGGTGGAA GCCAGGGTTGCACTAAACAT 508 MMP-2 GGCCATGCCATGGGGCTGGA CCAGTCTGATTTGATGCTTC 762 MMP-9 CTACTCTGAAGACTTG CCG CCATACAGTTTATCCTGGTC 881 GAPDH ATCACCATCTTCCAGGAGC ATCACAAACATGGGGGCATCGG 179 Table 5-1. Sequences and sizes of primers used for RT-PCR. 101 5.2.2 Protein distribution in the infarcted LV Modified Triton-X soluble and insoluble LV heart extracts (50 ug/lane) were treated with sample buffer (100 mM Tris buffer, pH 8.3 containing 2% S D S , 5 mM EDTA, 10% glycerol, 15 mM dithiothreitol) and fractionated by S D S - P A G E . The gel was washed in distilled water and incubated with EZBlue™ gel staining reagent (Sigma Aldrich) overnight at room temperature. The EZBlue™ gel staining reagent was then removed and gel washed in distilled water for 1 hour. The gel was scanned in and visualized (Adobe Photoshop Professional 7.0). 5.2.3 Western blot protein analysis Western blot analysis was conducted as previously described [287]. Briefly, Triton-X soluble and insoluble heart extracts (20 pg/lane) were treated with lysis buffer (100 mM Tris buffer, pH 8.3 containing 2% S D S , 5 mM EDTA, 10% glycerol, 15 mM dithiothreitol) and fractionated by S D S - P A G E . After fractionation, the gels were electrophoretically transferred onto nitrocellulose membranes. Subsequently, the membranes were blocked with PBS containing 10% casein (PBS/casein), then incubated with either anti-mouse t-PA IgG, anti-mouse u-PA IgG, anti-mouse PAI-1 IgG, anti-mouse desmin and anti-mouse B-actin IgG (Sigma Aldrich) for 1 hour. The membranes were then incubated with alkaline phosphatase-conjugated secondary Ab and processed for colour development with the Fast Red system. 5.2.4 MMP-2 and 9 activity gelatin zymographv Gelatin zymography for MMP-2 and MMP-9 activity in extracts reflects the influence of plasmin-mediated activation of MMPs [189]. Homogenized tissue was 102 separated on S D S - P A G E gels containing gelatin substrate to analyze MMP-2 and 9 activity. Following electrophoresis, gels were washed in distilled water containing 5% Triton-X-100 for 1 hour, then incubated in incubation buffer and stained with Coomassie blue staining reagent. Gels were then de-stained and bands indicating areas of substrate proteolysis were visualized. Clear bands seen on gelatin gels were confirmed as MMPs by addition of 10mM EDTA to the incubation buffer to inhibit enzyme activity. Digestion bands were quantified by densitometry using Image J v1.38. 5.2.5 Statistics Statistical significance of differences was assessed using Student's f-tests and comparison among multiple groups was performed one-way analysis of variance (ANOVA); p-value of 0.05 or less was considered significant. All values are expressed as means ±SEM or means ±SD. 103 5.3 Results 5.3.1 Differential gene expression of PA/plasmin system components post-MI We have assessed mRNA expression levels of genes associated with the PA/plasmin and M M P systems (u-PA, t-PA, PAI-1, MMP-2 and 9), involved in the regulation of E C M remodeling at 3, 7, 14 and 28 days post-MI in WT and VN- / -mice. Representative gels demonstrated differences in mRNA expression levels between WT and VN- / - mice (Figure 5-1 a). VN- / - Ml mice exhibited more robust band in t-PA at 3 days post-MI. At 7 days post-MI VN- / - exhibited increased u-PA mRNA, while PAI-1 was decreased when compared to WT. MMP-2 levels were slightly higher in WT mice particularly at 3 and 7 days post-MI, with only trivial differences noted in MMP-9 mRNA levels. Desmin mRNA was expressed at all time-points in WT and VN- / - mice with slightly more robust bands noted in sham-operated and infarcted WT mice at 3 days post-MI. Pooling and averaging of data gathered from individual WT (n = 3) and VN- / -(n = 3) mice demonstrated common trends in mRNA expression (Figure 5-1 b). V N -/- exhibited a decrease in RNA levels of all genes at 3 and 7 days when compared to WT Ml mice. At 3 days post-MI all genes in WT mice were elevated with at least a 2-fold difference compared to VN- / - mice. Interestingly, mRNA levels for all genes investigated were elevated above baseline at 3 and 7 days post-MI in the WT Ml group, then returning near baseline levels by day 28. No distinct pattern in mRNA expression was noted in the VN- / - Ml group at 3, 7 and 28 post-MI. Results of mRNA expression levels are detailed in Table 5-1. 104 Fold Change vs. Control (n = 12) % of GAPDH (n = 12) WT Ml VN-/- Ml WT Ml VN-/- Ml 3 Days post-MI PAI-1 8.29 2.4 54.86 46.10 t-PA 2.93 -2.98 10.82 4.4 u-PA 5.03 2.55 46.25 41.5 MMP-2 2.09 -1.15 94.76 41.03 MMP-9 4.08 3.26 67.06 58.04 desmin 1.14 1.24 55.7 42.51 GAPDH 1.05 1.14 N/A N/A 7 Days post-MI PAI-1 8.79 -3.59 55.7 7.37 t-PA 3.16 2.69 11.19 48.68 u-PA 5.99 1.8 52.76 40.34 MMP-2 2.53 1.51 109.9 98.03 MMP-9 3.47 1.69 54.52 41.28 desmin 1.2 1.28 51.74 66.02 GAPDH 1.01 1.2 N/A N/A 28 Days post-MI PAI-1 1.7 2.34 9.25 50.64 t-PA 1.19 -2.98 3.61 4.95 u-PA 3.69 2.19 27.89 40.32 MMP-2 1.52 1.89 56.8 100.48 MMP-9 1.06 1.7 14.36 34.17 desmin 1.28 1.26 47.31 52.88 GAPDH 1.16 1.02 N/A N/A Table 5-1. Numerica data corresponding to quantitative R T - P C R from histograms in Figure 5-1. All mRNA level measurements are expressed as a ratio of Ml group/control group or as % G A P D H . 5.3.2 Protein distribution of infarcted myocardium of WT and VN-/-mice Proteins from infarcted LV were fractionated using Triton-X 100 soluble and insoluble lysis buffer to depict the relationship between the morphological fractionation and the protein populations obtained after each fractionation step. Proteins obtained from each fraction step were visualized using EZblue stain (Figure 5-2). The Triton-X-100-soluble "cytoplasmic" proteins constituted - 7 5 % of the total cell protein. The Triton-X-insoluble "cytoskeletal" fraction was - 2 0 % with the remaining 5% of the total cell protein regarded as the "chromatin" fraction. The soluble fraction represents the majority of cellular proteins while the remaining proteins were primarily cytoskeletal in composition. 5.3.3 Post-MI t-PA. u-PA. PAI-1 and desmin expression We have investigated the effects of VN in regulation of components of PA/plasmin system following Ml. Western blotting analysis demonstrated presence of t-PA in the infarcted LV of WT and VN- / - mice. Increased levels of t-PA were noted in VN- / - primarily at 3 and 7 days post-MI compared to WT mice, with peak accumulation seen at day 7 (Figure 5-3). u-PA was noted from 3 to 28 days post-MI, with slight differences in levels noted between WT and VN- / - mice at 3, 7 and 14 days (Figure 5-3). Additional strong bands - 82 kDa were noted in VN- / - mice at 3 and 7 days post-MI (arrowheads). Presence of bands - 100 kDa likely represent u-PA : PAI-1 complex formation and were more pronounced at 3 and 7 days post-MI in WT and VN- / - mice. Unidentified high molecular weight bands that appeared -170 kDa may represent additional complex formation between u-PA, PAI-1 and uPAR (arrowhead). Reduced levels of PAI-1 were primarily noted in control and infarcted mice from 3 to 28 days post-MI. In contrast to both PAs, PAI-1 bands were markedly reduced in VN- / - at all time-points (Figure 5-3). Furthermore, robust desmin bands were observed at 7, 14 and 28 post-MI in WT and VN- / - mice. Interestingly, WT mice exhibited an increase in desmin levels when compared to VN- / - , which was particularly evident at 7 and 14 days post-MI (Figure 5-3). 106 Cont 3 Day 7 Day 28 Day WT VN-/- WT VN-/- WTVN-/-WT VN-/- Neg MMP-9 I 1 jjguji Desmin *»** m§ * GAPDH Figure 5-1 a. Representative gels of PAI-1, t-PA, u-PA, MMP-2 and 9, and desmin mRNA expression levels at 3, 7 and 28 post-MI. Infarcted VN- / - mice exhibited notable differences between of t-PA, u-PA, PAI-1, MMP-2, MMP-9 and desmin mRNA expression levels when compared to WT mice. 107 Desmin 1.30 Days Post-MI Figure 5-1 b. VN-/- mice exhibit different mRNA expression of PAs, PAI-1 and gelatinases in the infarcted LV over time. Assessment of mRNA expression for genes involved in regulation of post-MI E C M remodeling indicated substantial variability between WT and VN- / - mice at 3, 7 and 28 days post-MI. Generally, mRNA expression levels were markedly elevated in WT mice with a minimum 2-fold difference above baseline. WT mice followed a common pattern in which mRNA levels were increased between day 3 and 7 post-MI, returning back to baseline levels by day 28. No steady patterns of mRNA expression were evident in VN- / -mice, although levels for all evaluated genes were lower when compared to WT mice at days 3, 7 and 28 post-MI respectively. 108 Triton-X Soluble Fraction Triton-X Insoluble Fraction |-5f ' JKK. '• Figure 5-2. Protein distribution in Triton-X soluble and insoluble LV fractions of WT and VN-/- mice. EZblue stain shows an accumulation of proteins in the Triton-X 100 soluble "cytoplasmic" and insoluble "cytoskeletal" fractions derived from normal and infarcted LVs. 109 Days Post-MI 115 55-4 115 I 1 1 5 -Control 3 7 14 28 +/+ +/+ -/- +/+ -1- +/+ -/- +/+ -/-WM -* Control 3 7 14 28 +/+ - / - 4-/4- - / -r— f 4-/4- • / - +/+ -/- +/+ t-PA u-PA: u PAR: PA!-1 u-PA:PAI-1 U-PA Control 3 7 14 28 1 1 5 -85— 55— -/- +/+ -/- +/+ -/- +)+ -I- +!+ -/-PAI-1 :t-PA complex PAI-1 :u-PA complex PAI-1 Control 14 28 4-/4- - / - 4/4- - / - +/+ •!- +/+ - i - +/4- - / -J * * * jt,* ^HMII .^ af Desmin Beta-actin Figure 5-3. VN affects the regulation of the PAs and PAI-1 post-MI. Western blotting of Triton-X soluble extracts of sham-operated and infarcted adult rat hearts (20 pg/lane) reveals the accumulation of the PAs, PAI-1 and desmin. Infarcted V N -/- mice exhibited notable differences between of t-PA, u-PA, PAI-1, compared to WT mice. Levels of t-PA and u-PA appeared increased in VN- / - mice mainly in the first 7 days post-MI. Conversely, PAI-1 was found predominantly in WT mice. 110 5.3.4 Immunostaininq for t-PA. u-PA and PAI-1 at 3. 7 and 28 days post-MI Staining for both t-PA and u-PA was absent from the hearts of sham-operated controls. PAI-1 staining was present in hearts of both WT and VN- / -sham-operated mice (Figure 5-4). Staining for t-PA was localized in WT mouse hearts primarily at 3 days post-MI, with reduced staining observed at 7 and 28 days (Figure 5-4). Similar pattern in t-PA staining was noted in hearts of VN- / - mice at 3, 7 and 28 post-MI. Positive staining for u-PA was observed at 3 days post-MI in heart of WT mice, while staining was primarily absent at 7 and 28 days (Figure 5-4). VN- / - mice experienced faint staining for u-PA at 3 days post-MI, and more prominent staining noted at 7 days. Strong staining for PAI-1 was observed in both WT and VN- / - mouse hearts and distributed in throughout the viable myocardium at 3 and 7 days post-MI, with faint staining observed in WT mice at day 28 (Figure 5-4)-5.3.5 Evaluation of MMP 2 and 9 activity in infarcted myocardium Gelatin zymography was performed in order to investigate the effects of post-MI M M P 2 and 9 activity. MMP-2 and 9 activity was absent from control mice. We observed a modest increase in MMP-9 activity in the cytoplasmic fraction of the infarcted LV of VN- / - mice 3 and 28 days post-MI. Levels of both pro- and active MMP-2 levels were also significantly elevated 14 days post-MI in VN- / - mice when compared to WT (Figure 5-5). The increase in MMP activity noted in infarcted VN- / -mice were likely attributed to the elevated PA levels. Moreover, cytoskeletal fraction of the infarcted LV from both, WT and VN- / - mice showed comparable 111 results to those observed in the cytoplasmic fraction with negligible reduction in MMP 2 and 9 activity (Figure 5-6). 5.3.6 Post-MI distribution of alpha v integrin We have investigated the localization and distribution of av integrin present on the surface of FB, S M C and endothelial cells by confocal microscopy. In WT mice, intense staining for av integrin was observed in the infarcted LV at 14 days post-MI where it was colocalized with VN (Figure 5-7, arrow). Faint av staining was also noted in the healthy myocardium of the peri-infarct region in which staining for VN was absent (Figure 5-7,*). Higher magnification images of the infarct region showed accumulation of VN distributed in between cells positive for av. Normal myocardium from sham-operated control mice exhibited uniform staining for av throughout the myocardium (Figure 5-7, inset). 112 t-PA u-PA PAI-1 WT V N -/- WT V N - / - WT V N -/-Control 3 day 7 day mini'ijii ill 28 day Figure 5-4. Localization of t-PA, u-PA and PAI-1 in infarcted LV of WT and VN-/- mice. Brightfield images (4x) depict the accumulation of t-PA, u-PA and PAI-1 in the infarcted LV at 3, 7 and 28 days post-MI. Scale bar = 1000 urn. 113 A Days Post-MI Control 3 7 14 28 60 4 - / 4 - . / - + / + -/" + / + - / - + / + - / - + / + "/- + / + - / -MMP-9 « — proMMP-2 « — MMP-2 B 20000 15000 A 10000 5000 H i WT VN-/ - WT VN- / - WT VN li WT VN -;-MMP 9 pro-MMP 2 MMP 2 X 1 WT VN -/- WT VN -/-Contro l Day 3 Day 7 Day 14 Day 28 Day 60 Days Post-MI Figure 5-5. MMP-2 and MMP-9 activity in Triton-X soluble LV fraction of WT and VN-/- mice. A) Representative zymograms for MMP-2 and MMP-9 in infarcted WT and VN- / - mice. B) Relative levels of pro and active MMP-2 were significantly increased in both WT and VN- / - mice post-MI. Compared to WT, VN- / - mice had increased MMP-2 activity at 14 days post-MI. MMP-9 activity was elevated in WT and VN- / - mice 3 days post-MI, following which only trivial activity was noted until day 28. 114 Days Post-MI Control 3 7 14 28 60 +/+ -/- +/+ -/- +/+ -/- +/+ -/- +/+ -/- +/+ -/-Triton-X Insoluble MMP-9 proMMP-2 MMP-2 Figure 5-6. MMP-2 and MMP-9 activity in Triton-X insoluble LV fraction of WT and VN-/- mice. Representative zymograms demonstrated increased pro and active MMP-2 in both WT and VN- / - mice beginning at 7 days post-MI. Compared to WT, VN- / - mice exhibited increased pro and active MMP-2 activity at 14 days post-MI, however activity was minimally increased in WT at days 28 and 60. Weak signal for MMP-9 was only observed at 3 days post-MI in WT and VN- / - mice. 115 alpha v VN Overlay 10x Figure 5-7. VN localizes to integrin alpha v in the infarcted LV 14 days post-MI. Confocal images from infarcted WT mice demonstrated the accumulation of VN (red) in the infarct region (arrow) which localized to areas of alpha v integrin (blue). Accumulation of VN and alpha v staining were more pronounced in areas of the infarcted LV. Reduced staining for both alpha v integrin and VN were localized in the peri-infarct region (*). Alpha v staining was prominent throughout the myocardium of sham-operated control mouse heart (inset). Scale bar = 200 pm (10x) and 40 pm (63x). 116 5.4 Discussion The PA/plasmin and MMP systems have been implicated in regulating post-MI wound repair process [117, 216]. Although excessive PA and/or MMP levels, or the absence of their inhibitors are associated with a detrimental outcome post-MI [156, 181, 185], modest expression/activity are essential to normal wound healing. PAI-1, the major inhibitor of PAs, has been implicated in adverse post-MI remodeling as its increased expression prevents matrix degradation and promotes cardiac fibrosis [131, 216]. By interacting with PAI-1, VN stabilizes PAI-1 's conformation and promotes its inhibitory activity in the blood and tissue matrix [82, 288, 289]. Thus, the binding of VN to PAI-1 inhibits fibrinolysis, interferes with cell adhesion and migration, and therefore alters tissue remodeling. Investigation at the molecular level demonstrated that VN manipulated the remodeling process by regulating the PA/plasmin system as observed when comparing WT and VN- / - mice post-MI. VN- / - mice demonstrated reduced mRNA expression of PAI-1, u-PA, t-PA and MMPs 2 and 9 when compared to WT mice, particularly in the first week post-MI. At 28 days post-MI mRNA expression levels returned back to baseline or were only slightly elevated in WT and VN- / - mice. Protein levels were not consistent with that of mRNA expression levels at the specified time-points as VN- / - mice exhibited increased t-PA at seven days post-MI and differences in u-PA levels were negligible between WT and VN- / - mice. Interestingly, unknown bands noted at ~ 82 kDa were found only in the infarcted VN- / - hearts when detected with anti-u-PA Ab. This may suggest that in the absence of V N , u-PA is better able to interact with a specific protein(s) of unknown origin. Binding interactions of u-PA with other proteins in the absence of VN should be explored in more detail as they may be relevant to post-MI wound healing. 117 Interestingly, despite the elevation of t-PA and u-PA, and decrease in PAI-1, we did not observe delayed clotting or excessive bleeding in VN- / - mice at time of surgery. Conversely, infarcted WT mice exhibited increased levels of PAI-1, with a reduction of t-PA and u-PA. Additionally, bands indicative of complexes formed between PAI-1 with either t-PA and u-PA were more profound in WT mice, suggesting an increase in PAI-1 levels and/or activity. Desmin levels were also increased in both, WT and VN- / - particularly at 7 and 14 days post-MI. These findings were likely associated with post-MI cardiomyocyte hypertrophy which initiates changes in sarcomeric proteins commonly noted in the progression to heart failure [290, 291]. Additionally, the increase in desmin noted in infarcted WT mice was consistent with increases in viable myocardial areas, not observed in infarcted VN- / - mice. In comparison to VN- / - mice, increased desmin levels in infarcted hearts of WT mice was potentially attributed to an elevated hypertrophic response resulting from increased myocardial loss which was reflected by augmented fibrosis. Even though discrepancies in expression levels of mRNA and protein were observed, such results are relatively common and have been previously described in the literature [292-294]. Poor correlations between protein and mRNA can be attributed to a number of reasons. First, there are many complicated and varied post-transcriptional mechanisms involved in turning mRNA into protein which lack sufficient understanding to be able to compute protein concentrations from mRNA; furthermore, proteins may express substantial differences in half-life; and/or significant amount of errors and noise in both protein and mRNA experiments are present [292, 293]. Interestingly, gelatin zymograms were in accordance with protein expression levels as determined by Western blotting, as post-MI VN- / - mice 118 exhibited increased MMP-2 and -9 activity compared with that of WT. These findings suggest that activation of the MMPs in the post-MI myocardium is primarily a plasmin-dependent event which is, at least in part, manipulated by VN [181, 295]. The PA/plasmin and MMP systems are involved in cell migration, activation of proteases and inflammatory cytokines, as well as E C M synthesis and degradation [181]. Remodeling following Ml requires modifications to the E C M which is achieved in-part by a tight regulation of proteases and their inhibitors for the maintenance of proper function. PAI-1 plays a major role in post-MI myocardial fibrosis by preventing the activation of PA (and hence MMPs) which may contribute to progression of LV dysfunction [216, 296]. Significant increase in PAI-1 levels have also been observed in aging hearts and scars from failing hearts [296-298]. Moreover, deficiency in PAI-1 is not only protective from myocardial, pulmonary and cutaneous fibrosis but also accelerates wound healing [129, 297-299]. Deposition of VN conceivably regulates the fibrinolytic response in the provisional wound matrix by binding and stabilizing PAI-1 [300]. By forming complexes with PAI-1, VN extends the half-life of PAI-1 ultimately reducing plasmin activity. Additionally, binding of VN to PAI-1 causes a conformational change which promotes VN multimerization [288] and stimulates additional PAI-1 binding [82]. Prolonged accumulation of VN at sites of damage of various tissues reflects chronic injury and is associated with fibrosis [301-303]. We also found that VN localized at sites of chronically infarcted and scarred myocardium in both human and mouse. In our study the absence of VN in infarcted mice was correlated with reduced leukocyte infiltration and angiogenesis, and importantly a dramatic reduction in myocardial fibrosis. Thus, it is possible that VN may participate in regulating fibrosis and progression to heart failure by modulating PAI-1 activity. One prospective 119 mechanism for induction of post-MI fibrosis is based on increased activation of TGF-B which is caused by increased PAI-1 and decreased plasmin activity [304]. Based on our study it is apparent that the results from infarcted VN- / - mice are at least partially attributed to a decline in PAI-1 expression and activity levels, which drastically affected PAs and MMPs. Thus, VN appears to be a modulator of proteolytic cascades responsible for plasmin-dependent E C M proteolysis by interacting with PAI-1. 5.5 Conclusions VN plays an important role in wound healing following Ml. Here, we have established that VN mediates post-MI remodeling in a plasmin-dependent manner likely by regulating PAI-1 levels. Mice deficient in plasminogen lack proper wound healing post-MI which suggests that u-PA, possibly in conjunction with t-PA, is important in the pathogenesis of post-MI myocardial fibrosis. Thus, the increased levels of the PAs and MMP-2 and 9 promote tissue healing, and hence cardiac function as noted in the post-MI VN- / - mice. Although further studies are necessary to establish the precise involvement of VN in regulating the PA/plasmin and MMP systems, it can be concluded that VN is involved in modulation of these systems post-MI. 5.6 Additional Considerations We have suffered unfortunate complications identifying the expression of various proteins using Western blotting. Difficulty arose mainly from the inability to visualize proteins on our membrane, even though experiments were excessively 120 replicated. Due to a limited number of mouse heart tissue samples designated for protein studies we could only perform a finite number of experiments for each individual protein of interest. We have failed to obtain suitable Western blots for MMPs 2 and 9, uPAR, or TIMPs 1 and 4. Additionally, it would be both interesting and beneficial to investigate the function of various other proteins which are important in post-MI remodeling. These proteins can come from diverse families including inflammatory cytokines; TGF-B, TNF-a , IL-6, structural and motility proteins; TIMPs, myosin, actin, collagen and vimentin, cell defense; complement protein and MHC class I, to list a few. Regrettably lack of sufficient protein and mRNA tissue samples significantly hindered our efforts in looking at expression and activity levels of several other proteins of interest. We have performed a thorough assessment with regard to mRNA and protein expression and activity in the infarcted myocardium of WT and VN- / - mice. However, further exploration on the molecular events occurring in the viable, non-infarcted myocardium would be useful in developing a better understanding in the role VN plays in post-MI healing. Although we did not commence such experiments at the present time, we are planning on pursuing them in the near future. 121 CHAPTER VI EFFECTS OF VITRONECTIN AT SITES OF HYPOXIA AND MYOCARDIAL ISCHEMIA 6.1 Rationale Results from Chapter 4 and 5 demonstrate that the presence of VN in the infarcted myocardium significantly reduces cardiac function. Upon closer examination of infarcted myocardium we noted that VN accumulated in ischemic cardiomyocytes and localizes to sacromeric proteins. Although the accumulation of VN at sites of Ml has previously been observed the exact mechanism(s) involved in its regulation of cardiac function have not been elucidated. Previously we have shown that VN-dependent binding of multivalent VN:PAI-1 complexes is mediated by vimentin. Vimentin expresses high affinity binding of VN on surface of activated platelets. Desmin, an IF structurally similar to vimentin is integral to maintaining the structural and functional integrity of cardiomyocytes by linking myofibrils in bundles and the entire contractile apparatus to the sarcolemmal cytoskeleton, cytoplasmic organelles and nucleus. Additionally, through the inter-myofibrillar connections desmin filaments align Z-lines in neighboring cells stabilizing sarcomeres in contracting muscle and protecting cells from repeated mechanical stress. Numerous types of cardiomyopathies are associated with acquired desmin mutations in humans or transgenic mice which underscores the importance of desmin in cardiac function. Furthermore, it was previous established that contractility was significantly reduced in myofibroblasts and smooth muscle cells in the presence of V N . Thus, in this study we explored the binding interactions of VN with desmin IF at sites of 122 myocardial ischemia and infarction and investigated whether the accumulation of VN within ischemic rat cardiomyocytes was associated with a reduction of contractility. 123 6.2 Experimental Methodology 6.2.1 Ex vivo Langendorff perfusion of rat heart with rat serum and fibrinogen Adult male Sprague Dawley rats were sedated with isofluorane and the hearts excised and collected for ex-vivo Langendorff perfusion. The perfusate was a modified Tyrode solution (128 mM NaCl, 4.7 mM KCI, 1 mM MgCI 2 , 0.4 mM N a H 2 P 0 4 , 1.2 mM N a 2 S 0 4 , 20.2 mM N a H C 0 3 , and 1.3 mM CaCI 2) containing 11.0 mM glucose. Perfusate temperature was kept at 37°C and equilibrated with either 95% 0 2 - 5 % C 0 2 at pH 7.35 for up to 1 hour. In some experiments rat serum or Alexa 594 conjugated fibrinogen was added to the perfusate. Following the experiment the hearts were perfused-fixed with 4% paraformaldehyde and sectioned serially for immunofluorescence studies. 6.2.2 Mouse model of left anterior descending coronary artery ligation Detailed mouse model of Ml by LAD ligation has been described previously [304]. All animal experiments were approved by the University of British Columbia Committee on Animal Care. Briefly, 12-week-old C57B6/6J mice (n = 18, weight 20-25-g) underwent surgical ligation of the LAD, resulting in anterior wall Ml. Animals were intubated and ventilated with room air at 100 breaths per minute using a rodent ventilator (Inspira, Harvard Apparatus, Holliston, MA). Under microscopy (Zeiss Contraves, Carl Zeiss Inc, Thornwood, NY), sternotomy was performed and the proximal LAD was identified as it appeared below the left atrium and ligated with 8/0 Prolene (Surgical Specialities Corp, Reading, PA). Blanching and dysfunction of the anterior wall verified LAD ligation. Ligation was sustained for 45 minutes, 90 minutes, 3 hours, 6 hours and 1 day, following which a thoracotomy 124 was performed and hearts rapidly excised into ice-cold saline, then manually compressed to remove residual blood. Hearts for histology were cannulated by the aorta and perfused-fixed with 4% paraformaldehyde at a constant pressure. Hearts were kept in 10% formalin overnight and then embedded in paraffin. In hearts for protein analysis, infarct regions were dissected out under a surgical microscope and both infarcted (LV) and non-infarcted (RV and interventricular septum) myocardium was flash-frozen in liquid nitrogen and stored at -80°C. 6.2.3 Immunohisto- and immunocvtochemistrv Paraffin-embedded human heart tissues were obtained from the Cardiac Registry at St. Paul's Hospital in Vancouver, British Columbia. For brightfield/polarized light microscopy mouse hearts were serially sectioned and subjected to routine immunohistochemistry using purified polyclonal rabbit anti-VN antibody (Ab) (Molecular Innovations) and polyclonal anti-human albumin Ab (Sigma) or pre-immune IgG. Anti-albumin Ab was used as a control to determine whether accumulation in the damaged myocardium was specific to VN and not artifactual. Slides were baked at 60°C for 1 hour, then dewaxed in xylene then rehydrated in graded alcohols (100% Ethanol 2 x 5 minutes, 90% Ethanol 1 x 5 minutes, 70% Ethanol 1 x 5 minutes and distilled water 1 x 5 minutes). Slides were washed TBS-T pH 7.6 and carefully dried and serum block applied in 10% normal serum (NS) solution then incubated for 1 hour. Following the serum block primary Ab was prepared in NS (10 - 20 pg/mL) and applied to the tissues for a minimum of 1 hour in a humidity chamber. Slides were then washed 3 x 5 minutes in TBS-T pH 7.6 and secondary Ab solutions (1-2 pg/mL) applied for 1 hour. Slides were washed 3 x 5 minutes in TBS-T pH 7.6, dried and coverslipped. Staining was 125 visualized with Vector Red, which possesses both, colorimetric and fluorescent properties (Vector Laboratories, Burlingame, CA) or peroxidase diaminobenzidine tetrahydrochloride (DAB). Nuclei were counterstained with Mayers' hematoxylin. Cardiomyocytes were isolated from Langendorff-perfused adult male Sprague-Dawley rat hearts [304] were fixed in 4% paraformaldehyde in TBS, washed, then neutralized for 10 minutes in 0.2 M glycine in TBS. Cells were permeabilized with 0.01% Triton-X-100 in TBS for 5 minutes. For confocal microscopy immunolabeling for cardiomyocytes and cardiac tissues was performed with polyclonal murine anti-VN (Molecular Innovations), polyclonal rabbit anti-desmin (Abeam) or goat anti-murine albumin (Sigma Aldrich) and specific mouse or human and monoclonal IgG Ab. Tissue sections were then incubated with AlexaFluor® 594 donkey anti-sheep and AlexaFluor® 488-conjugated goat-anti-rabbit IgG diluted to 2 ug/mL, then incubated with Hoechst 33342 nuclear dye diluted to 1 ug/mL. Rat cardiomyocytes were incubated for 1 hour with either 488 AlexaFluor® phalloidin, AlexaFluor® 594-conjugated goat-anti-rabbit IgG and Hoechst 33342 nuclear dye. The slides were washed, cover slipped and then examined by Leica SP2 A O B S confocal laser scanners on a Leica DM IRE inverted microscope. 3-D volume rendering was achieved using MetaMorph (Universal Imaging Corp, Downingtown, PA) and Volocity software (Improvision, Lexington, MA). Line-scanning was performed using LiCore® confocal software (Leica Microsystems). 126 6.2.4 Rat heart and neonatal cardiomyocyte cytoskeleton preparation Neonatal cardiomyocytes were isolated from the ventricles of a litter of 1-day-old Sprague Dawley rat pups (n = 16) using a modified method described by Simpson et al. [305] and grown in 10% fetal calf serum (FCS) and 90% of media containing insulin, transferin, lithium, ascorbic acid and vitamin E. The cells were then incubated at 37°C for 72 h, collected, centrifuged and the cell pellets stored at - 4 ° C until processed. Sections of frozen myocardium or neonatal cardiomyocytes cell pellets were thawed out and washed with P B S , then soluble proteins were extracted with 1 mL of cytoskeletal extraction buffer (100 mM NaCl, 300 mM sucrose, 10 mM PIPES [pH 6.8], 3 mM MgCI 2 , 0.5% Triton-X-100 and 1.2 mM PMSF) by manual homogenization for 10 minutes at 0°C then centrifuged 2000 x g for 2 minutes. The supernatant (Triton-X soluble fraction) was removed and insoluble structures (Triton-X insoluble fraction) further extracted by addition of modified cytoskeletal extraction buffer (250 mM ammonium sulfate, 300 mM sucrose, 10 mM PIPES [pH 6.8], 3 mM MgCI 2 , 1.2 mM P M S F and 2% SDS) for 10 minutes at 0°C, then centrifuged 2000 x g for 2 minutes. The supernatant (Triton-X insoluble fraction) containing cardiomyocyte cytoskeleton was then removed. The samples were stored at -80°C until further use. 6.2.5 Western and ligand blot analysis Western and ligand blot analysis for VN and VN-binding proteins was optimized and described previously [306]. Cytoskeletal heart extracts (10 pg/lane) or neonatal cardiomyocytes (10 pg/lane) were treated with sample buffer (100 mM Tris buffer, pH 8.3 containing 2% SDS, 5 mM EDTA, 10% glycerol, 15 mM 127 dithiothreitol) and fractionated by S D S - P A G E . Purified standards of human endothelial cell vimentin (0.25 ug/lane) and recombinant human desmin (0.25 ug/lane) were used as controls. After fractionation, the gels were electrophoretically transferred onto nitrocellulose membranes. Subsequently, the membranes were blocked with PBS containing 10% casein (PBS/casein), then incubated with PBS/casein containing either biotinylated V N , anti-vimentin IgG, mouse anti-desmin IgG or goat anti-albumin for 1 hour. The membranes were then incubated with alkaline phosphatase-conjugated streptavidin and processed for colour development with the Fast Red chromagen system (Axxora). Relative intensity of bands was compared by densitometry using Image J v1.38 (http://rsb.info.nih.gov/ij/download.html) and tabulated using SigmaPlot 8.0 (Systat Software, Point Richmond, CA). 6.2.6 Vitronectin binding activity To examine the binding properties of VN (Molecular Innovations) to desmin, 96-well microtitre plates (Costar, Dallas, TX) were coated with purified recombinant human desmin (Research Diagnostics) in PBS [pH 7.7] (3.3 ug/mL) overnight at 4°C, and the excess protein binding sites were blocked with 3% BSA in P B S . The cells were washed with SPIRA buffer, then were incubated with various concentrations of biotinylated-VN diluted in dilution buffer (PBS containing 3% BSA, 0.1% Tween 80, 5mM EDTA and 20 U/ml aprotinin) at 37°C for 1 hour. Specific binding of biotinylated-VN was determined by measuring the change in absorbance at 405 nm after the addition of streptavidin-conjugated alkaline phosphatase/pNPP substrate and subtracting the background of biotinylated-VN binding to BSA-coated wells. 128 6.2.7 Isolation of adult rat ventricular myocytes Male Sprague-Dawley rats (250-300g) were anesthetized using 3% halothane, and the heart was excised and mounted on a modified Langendorff apparatus and perfused with oxygenated (95% 02-5% CO2) HEPES-Joklik-modified MEM buffer (GIBCO-BRL, Grand Island, NY) at 37°C for 2 minutes. The perfusate was changed to 30 mL of recirculating Ca 2+-free MEM containing 236 U/mL collagenase (Worthington Biochemical, Freehold, NJ). At 15 and 20 minutes, the Ca 2 + concentration was increased stepwise to 0.025 and 0.075 mmol/L. After 3 0 -40 minutes, the ventricles were removed from the perfusion system, gently teased apart, and agitated for 2 -3 minutes at 37°C. The tissue and dispersed cells in solution were filtered through a 200-pm nylon mesh. The cells were washed three times at 37°C in MEM containing increasing Ca 2 + concentrations (200 pM, 500 pM, and 1 mM), with the cells allowed to settle by gravity for 10 minutes between each wash. Cells were resuspended in 37°C HEPES-modif ied M199 buffer (GIBCO-BRL) with 1% BSA. The cells were diluted to a final concentration of 5 x 10 4 cells/mL, 100 pi were loaded into each well of 96-well plates, and the plates were incubated at 37°C in 95% 0 2-5% C 0 2 . At 90 minutes, the medium was changed to fresh M199 with BSA, and the cardiomyocytes were incubated for 24 hour to allow them to become relatively quiescent. After 24 hour, the cells were considered viable if they demonstrated a characteristic rod shape without cytoplasmic blebbing. This morphometric assessment of viability was confirmed in a subset of experiments with trypan blue exclusion. We have found that the fraction of viable cardiomyocytes is always >85%. 129 6.2.8 Measurement of cardiomyocyte fractional shortening and shortening velocity Cultured adult rat cardiomyocytes were incubated at normal conditions (95% 0 2 , 5% C 0 2 at 37°C) or subjected to hypoxic conditions (90min, P 0 2 <15mmHg at 37°C) in the presence or absence of 10% fetal bovine serum (FBS) containing VN or purified monomeric VN at 1, 2.5, 10 and 20 pg/mL, Molecular Innovations). For the measurement of fractional shortening and shortening velocity a platinum electrode was lowered into each well of a 96-well plate and the cardiomyocytes were electrically stimulated (Grass S48 stimulator, West Warwick, Rl ; 45 mV, 2.2-ms duration, 25-Q resistance) while being recorded by video-microscopy (Sony SLV-760HF). The electrical stimulus was chosen from preliminary threshold experiments as two times the minimum electrical stimulus required to maximally contract the cardiomyocytes. Still frames of cardiomyocytes in diastole (unstimulated) and systole (stimulated) were captured and the time of contraction recorded (Figure 6-1). Based on the video recording, myocyte fractional shortening and shortening velocity were then determined using Scion ImagePC (Scion, Frederick, MD). Experiments were performed in quadruplicate each time with cardiomyocytes isolated from individual rat hearts. To determine effects on contractility, cardiomyocytes under either normal or hypoxic conditions were treated with either F B S and/or recombinant VN (20 ug/mL), following which fractional shortening was measured as described above. Cardiomyocyte fractional shortening and shortening velocity were calculated using the following formulas: Fractional Shortening = (Diastolic length - systolic length) x 100 Diastolic length Shortening Velocity = A length A time 130 6.2.9 Desmin and vimentin alignment In order to determine sequence homology, protein sequences of human, rat and mouse desmin [307] and vimentin [308] were obtained from the NCBI website www.ncbi.nlm.nih.gov. The sequences were aligned using "BLAST 2 Sequences" engine for local alignment found on the NCBI website http://www.ncbi.nlm.nih.gov/blast/bl2seq/wblast2.cgi. 6.2.10 Statistics Statistical significance of differences was assessed using ANOVA; p-value of 0.05 or less was considered significant. 131 Figure 6-1. Measuring rat cardiomyocyte contractility using soft edge detection and lonWizard®. Isolated cells were treated with V N under normal or hypoxic conditions for 45 minutes. Cells were then electrically stimulated with the length, as well as the duration of contraction recorded. A) Graphical and visual representation of an unstimulated, cardiomyocyte in diastole. In a resting state there is no change in cardiomyocyte size (blue circle). B) Graphical and visual representation of a stimulated cardiomyocyte in systole. During stimulation the cell contracts maximally following which normal size is gradually re-established (blue circle). 132 6.3 Results 6.3.1 Exudation and localization of plasma proteins in ischemic and ischemia-reperfused rat myocardium We examined the distribution of plasma proteins VN and fibrinogen in rat hearts following varied periods of acute ischemia and ischemia/reperfusion by coronary artery occlusion in situ, or in isolated hearts subjected to Langendorff perfusion with plasma or saline ex wVo. Hearts were perfused with Alexa 594-conjugated-fibrinogen in order to fluorescently define areas of vascular damage and permeability. Fibrin(ogen) deposits were evident in the coronary vessel wall and peri-vascular area (Figure 6-2A). In hearts infused with rat serum, fibrin(ogen) colocalized with VN in ischemic blood vessel walls and the perivascular myocardium (Figure 6-2B). Examination of the VN within the ischemic cardiomyocytes revealed the characteristic banding pattern of sarcomere-associated proteins. These studies provide evidence that the accumulation of plasma VN in the ischemic myocardium characteristically defines the area of risk as it was noted within minutes following the onset of ischemia and reflects the binding of VN to sarcomeres-associated proteins of reversibly and irreversibly injured cells (Figure 6-2C). Both fibrin(ogen) and VN staining was absent from normal rat hearts. 6.3.2 Influx of VN into ischemic and infarcted myocardium Following LAD ligation, VN immunostaining of the injured mouse myocardium was first apparent within 45 minutes, with progressively more positive staining evident up to 1 day (Figure 6-3A). Extravascular VN was absent from non-133 Figure 6-2. In situ and ex vivo acute ischemia-reperfusion injury results in increased vascular permeability and accumulation of circulating VN and fibrin(ogen) within the myocardium and walls of coronary blood vessels. Brightfield/fluorescence micrograph of frozen sections from isolated rat hearts subjected to 20 minutes global ischemia (A and B), or LAD ligation followed by 15 minutes reperfusion (C). Prior to reperfusion, trace quantities of fluorescently-labeled Alexa 594-fibrinogen (red) was infused into the circulation (A and B). A) Fibrin(ogen) was localized to ischemic vessel wall with trace amounts found in the myocardium (arrows). B) Immunolocalization of VN (green) accumulated in the blood vessel wall (arrows) and peri-vascular space, and colocalized with fibrin(ogen) deposits. C) VN staining is localized to sarcomeres of ischemic cardiomyocytes. 134 ischemic myocardium. VN progressively accumulated in the myocardium with prolonged exposure to ischemia, and was localized particularly to myofibers. To confirm that the influx into the ischemic myocardium was a VN-specific event, we also stained for albumin. In contrast to VN staining, faint albumin staining was observed throughout the acute ischemic myocardium between 45 minutes and 6 hours with majority localized to the extracellular space. Slightly increased staining was visualized 1 day post-MI (Figure 6-3A). Furthermore, magnified images taken 1 day following LAD ligation displayed an accumulation of VN staining that was localized primarily to ischemic cardiomyocytes while staining for albumin was primarily absent (Figure 6-3B). Triton-X soluble and insoluble protein fractions isolated from mouse hearts were fractionated using gel electropheresis and their distribution visualized by EZBlue™ gel staining reagent. A majority of the bands appeared in the Triton-X soluble fraction, fewer bands in the cytoskeletal Triton-X insoluble fraction. Western blotting of tissue extracts isolated from the ischemic LV showed a lack of VN in the Triton-X soluble cytoplasmic fraction (Figure 6-4). Conversely, prominent albumin levels were evident in the cytoplasmic fractions which increased over time from 45 minutes up to 1 day post-MI. VN was present in the Triton-X insoluble cytoskeletal fraction of ischemic myocardium commencing at 45 minutes. Between 45 minutes and 6 hours VN levels appeared constant, with increased accumulation observed at 1 day post-MI (Figure 6-4). In contrast albumin was relatively absent from the Triton-X insoluble cytoskeletal fraction extracts from the ischemic myocardium. Accumulation of VN within cardiomyocytes occurred at sites of ischemia. Unlike VN, low levels of albumin were present in the Triton-X soluble 135 A Vitronectin Albumin Vitronectin Albumin Vitronectin Figure 6-3. VN progressively accumulates in the ischemic myocardium of LAD ligated mice. A) Immunostaining in ischemic mouse hearts showed progressive localization of VN in the LV from 45 minutes to 1 day post-ischemia. No VN was observed in non-ischemic control hearts. Albumin staining was primarily absent from the normal or ischemic myocardium for up to 1 day post-ischemia. (Insets, lower right). Higher magnification images of VN accumulation in the ischemic myocardium over time. B) Magnified image taken from LV of ischemic mice at 90 minutes demonstrated VN staining localized to sarcomeres (arrows) of viable cardiomyocytes (intact nuclei). Scale bars equals 500 pm (A, 100x magnified) and 10 pm (B, 800x magnified). 136 Triton-X Soluble Fraction C 45 3h 6h 1 min day Vitronectin Albumin Triton-X Insoluble Fraction C 45 3 h 6h 1 min day Vitronectin mm Albumin Figure 6-4. VN accumulates in the Triton-X insoluble cytoskeletal fraction of ischemic myocardium. Western blotting showed absence of V N , but increasing levels of albumin in the Triton-X soluble cytoplasmic fraction between 45 minutes and 1 day post-LAD ligation. In contrast, VN accumulated in a time-dependent manner in Triton-X insoluble cytoskeletal fraction, while albumin was primarily absent. VN was detected as early as 45 minutes post-LAD ligation with notable increase observed at 1 day. Both VN and albumin were absent from non-ischemic Triton-X insoluble controls. 137 I • I ' I * I ' I ' I ' I ' « • I • I • t • I ; 0 5 10 15 20 25 30 35 40 45 50 551 CjicleNumbef j Figure 6-5. VN mRNA is absent from differentiated rat embryonic ventricular myocytes. Semi-quantitative RNA analysis using real-time P C R demonstrated a lack of VN expression in differentiated H9C2 cells as tested at different primer concentrations (coloured lines). 138 fraction of control hearts. Albumin and VN were absent from the Triton-X insoluble fractions of sham-operated control hearts (Figure 6-4). Furthermore, embryonic ventricular cardiomyocytes were not an active source of VN as semi-quantitative R T - P C R demonstrated an absence of VN mRNA expression in these cells (Figure 6-5). 6.3.3 Localization of VN at Z-lines of cardiomyocyte sarcomeres coincides with desmin at sites of acute Ml Immunohistochemical staining of acutely infarcted human myocardium obtained from St. Paul's Hospital Cardiovascular Registry showed the accumulation of VN in both necrotic and viable cardiomyocytes with no VN visible in the non-ischemic cells in the peri-infarct region (Figure 6-6A). Immunofluorescent staining showed localization of VN to sarcomeric bands within ischemic cardiomyocytes. Moreover, staining for sarcomeric desmin revealed co-localization of VN with desmin IF at the Z-lines of ischemic cardiomyocytes (Figure 6-6 B-F). VN staining was absent from adjacent healthy cardiomyocytes. 6.3.4 Association of VN with desmin and vimentin cytoskeleton of neonatal and adult cardiomyocytes To demonstrate the presence of polymeric IF proteins in the myocardium, equal quantities of protein extracts from the Triton-X soluble and insoluble cytoskeleton fractions of adult rat hearts, neonatal rat cardiomyocytes, as well as purified recombinant human desmin and endothelial cell vimentin were electrophoretically fractionated by S D S - P A G E , and then subjected to Western blot analysis with Abs directed against desmin and vimentin. Figure 6-7 illustrates that both the heart and cardiomyocyte samples contained a single band of desmin (MW 139 = 53 kDa) that was also concentrated in the Triton-X insoluble fraction. Similarly, both heart and cardiomyocyte samples contained two major vimentin bands that migrated at 58 and 56 kDa molecular weight, and was associated exclusively with the Triton-X insoluble fraction (Figure 6-8). Both desmin and vimentin IFs were absent from the Triton-X soluble heart and cardiomyocyte extracts. Ligand blot analysis on equal quantities of S D S - P A G E fractionated neonatal cardiomyocytes-derived Triton-X insoluble protein fractions and purified protein controls was performed to determine whether myocardial IF cytoskeletal proteins interact with V N . VN bound specifically to the bands corresponding to the native vimentin and desmin, as well as the purified desmin control (Figure 6-9). Additional unidentified higher molecular weight bands displayed VN binding activity, suggesting that other cytoskeleton-associated protein, or possibly IF multimers, may also bind V N . 6.3.5 VN binds directly to cardiomyocyte desmin IFs with high affinity Analysis of the binding affinity of VN for desmin showed protein interactions in a dose-dependent, saturable manner, with an apparent dissociation constant (Kd) of 25 nM (Figure 6-9). High affinity binding interaction between VN and vimentin were also noted and involved the amino terminal head domain of vimentin (kD = 80 nM) as previous demonstrated in our laboratory [307]. 140 Figure 6-6. VN localizes to desmin in Z-lines of sarcomeres in ischemic human cardiomyocytes. A-B) Polarized light and immunofluorescent imaging demonstrated VN localization in sarcomeres of ischemic and necrotic cardiomyocytes, however no staining was observed in non-ischemic healthy cells in the peri-infract zone. C-F) Magnified image from region of acutely infarcted human myocardium stained for desmin (green), VN (red) and nuclei (blue) revealed co-localization of VN with desmin on the Z-line of sarcomeres in the damaged cells. Scale bars = 40 pm. 141 Triton X Triton X Soluble Extracts Insoluble Extracts Figure 6-7. Desmin IF are associated with Triton-X insoluble extracts from rat hearts and cultured cardiomyocytes. Triton-X soluble extracts from adult rat hearts (lane 1) and neonatal rat ventricular cardiomyocytes (lane 2) were both deficient in desmin. In contrast, desmin was present in Triton-X insoluble extracts from adult rat hearts and neonatal rat ventricular cardiomyocytes. Purified recombinant human desmin used as a positive control (lane 3). 142 Triton X Soluble Extracts Triton X Insoluble Extracts Figure 6-8. Vimentin IF are associated with the Triton-X insoluble extracts from rat hearts and cultured cardiomyocytes. Triton-X soluble extracts of adult rat hearts (lane 1) and neonatal rat ventricular cardiomyocytes (lane 2) were both deficient in vimentin. In contrast, vimentin (double band 56 and 58 kDa) was present in Triton-X insoluble extracts from adult rat hearts and neonatal rat ventricular cardiomyocytes. Endothelial cell vimentin was used as a positive control (lane 3). 143 0 2 4 6 8 10 | Vitronectin (ug/mL) Figure 6-9. VN binds to desmin IF with high specificity. A) Western (left) and ligand (right) blot analysis of biotinylated VN binding to purified desmin from extracts of neonatal rat cardiomyocytes. Triton-X insoluble extracts (10pg/lane) of neonatal rat ventricular cardiomyocytes (Cardiomyocytes) and purified recombinant human desmin (Desmin Std) were fractionated and subjected to Western blotting ligand binding using biotinylated-VN. In neonatal cardiomyocyte extracts VN was bound to both vimentin and desmin at 56 and 53 kDa respectively. B) Affinity binding assay in which increasing concentrations of biotinylated VN was added to purified desmin. VN formed specific, saturable, high affinity binding interaction with desmin. (kD apparent = 25 nM). 144 6.3.6 Influx of VN into hypoxic cardiomyocytes localizes to desmin IF in an energy-dependent manner In order to test whether VN accumulation into ischemic cardiomyocyte was energy-dependent, isolated adult rat cardiomyocytes were subjected to hypoxic conditions for 45 minutes at either 4°C or 37°C. Cells were then fixed, permeabilized, fluorescently stained and imaged by confocal microscopy. Staining for VN and desmin was evident in viable cultured cardiomyocytes subjected to hypoxic conditions, both at 4°C or 37°C in the presence of purified VN (20 pg/mL) (Figure 6-1 OA), however increased VN staining was evident in cells at 37°C as determined using color segmentation (ImagePro). Furthermore, staining was localized to sarcomeres (insets, upper right, arrows) of ischemic cardiomyocytes and appeared co-localized with desmin IF. In contrast, staining for VN was noted in normoxic cells at 4°C or 37°C localized primarily only to the sarcolemma. Staining for albumin was mostly uniformly distributed throughout the cytoplasm with increased accumulation noted in the cell periphery of both normoxic and hypoxic cells at both 4°C and 37°C (Figure 6-1 OA, insets, lower right). Line scanning for the relative signal intensity of VN with desmin present at sarcomeric Z-lines (Figure 6-10A, insets, arrowheads) showed an overlap of VN and desmin (at ~ 0.3 and 2.9 pm) at areas indicating colocalization at sarcomeric Z-lines (Figure 6-1 OB). This distance was consistent with that of a single sarcomere. 6.3.7 FBS reduces cardiomyocyte contractility in normoxic and hypoxic cardiomyocytes To test whether serum proteins have an effect on cardiomyocyte contractility, isolated rat cardiomyocytes have been subjected to electrical stimulation in the presence of 10% FBS which contains micromolar quantities of VN under either 145 normal or hypoxic conditions. Fractional shortening of both normoxic and hypoxic cardiomyocytes decreased in the presence of FBS (24.14% ± 1.18 vs. 19.25% ± 1.11, p = 0.003; 16.95% ± 1.33 vs. 13.7% ± 1.19, p = 0.06) (Figure 6-11 A). Similarly, shortening velocity of both normoxic and hypoxic cardiomyocytes decreased in the presence of FBS (normoxic conditions; 52.56% ± 3.72 vs. 41.46% ± 3.97, p = 0.04; hypoxic conditions 41.43 pm/second ± 4.04 and 34.85 pm/second ±3.07, p = 0.18) (Figure 6-11B). 6.3.8 Dose dependent effects of VN on hypoxic cardiomyocytes To investigate whether VN accumulation exhibited effects on cell function, isolated adult rat cardiomyocytes were incubated under either normal or hypoxic conditions in the presence or absence of purified V N , then electrically stimulated to measure cell contractility. Treatment with VN had a profound effect on hypoxic isolated rat cardiomyocytes by significantly reducing contractility. Exposure to increasing concentrations of VN (1, 2.5, 10, 20 pg/mL) showed a significant, dose-dependent decrease in fractional shortening of hypoxic cardiomyocytes (Figure 6-12). VN has minimal effects on fractional shortening of the normoxic groups. As expected, compared to normoxic cells, hypoxia alone had a significant effect on the isolated cardiomyocytes, reducing fractional shortening (24.1% ± 1.2 vs. 17.2% ± 1.3, p < 0.0001). However, addition of VN to hypoxic cardiomyocytes led to further reduction in fractional shortening with the greatest reduction observed at 20 pg/mL (12.3 pm/second ± 0.9 vs. 24.0 pm/second ± 1.3, p < 0.000001) (Figure 6-12). Reduction in the shortening velocity was also noted in hypoxic cells, with a significant difference noted only at 20 pg/mL of VN treatment. All results are summarized in Table 6-1. 146 Fractional Shortening (%) Shortening Velocity (um/sec) VN (ug/mL) Normoxic Hypoxic P value Normoxic Hypoxic P value 0 24.14 ± 1.18 17.16 ± 1.33 < 0.0001 53.15 ± 3 . 7 6 41.92 ± 4 . 0 4 <0.05 1 22.9 ± 1.08 17.23 ±1 .21 < 0.0005 36.29 ± 2.86 36.89 ± 3.08 NS 5 20.46 ± 1 . 0 3 16.1 ± 0 . 9 7 < 0.005 32.18 ± 1.98 32.98 ± 1.97 NS 10 20.18 ± 0 . 5 6 14.18 ± 1 . 1 5 < 0.00005 38.01 ± 2 . 2 8 31.26 ± 2 . 9 9 NS 20 24.05 ± 1.27 12.33 ± 0 . 8 6 0 45.87 ± 4 . 0 2 27.48 ± 2.23 < 0.0001 Table 6-1. Summary of results corresponding to fractional shortening and shortening velocity of VN treated adult rat cardiomyocytes. 6.3.9 Vimentin and desmin amino acid sequence alignment Amino acid sequence comparison of the protein structures for desmin and other IF subunits revealed a highly conserved region (80%) among different members of the IF protein gene superfamily [307]. The global alignment of the desmin and vimentin sequences showed 61.1% homology between the IF proteins. Significant sequence homology was observed within the first 120 residues of the amino terminal head domains of both IF proteins, which share two specific regions; a nonapeptide (SSYRRTFGG) and an arginine and proline-containing RP-box ( R L G S F R A P R A G A L R L P ) . These two regions have been previously recognized to contain the high affinity VN binding site for vimentin [309-311]. Both sequences contain phosphorylation sites that are critical for the assembly and disassembly of type III IF proteins. Both regions are possible binding sites and may exhibit high affinity for V N . 147 A Normoxia Hypoxia 4°C 37°C B 0,5 pm 1.5 pm 0 5 pm Length (um) Figure 6-10. Localization of VN to sarcomeres of hypoxic cardiomyocytes. A) Confocal images of VN localization in cultured adult rat cardiomyocytes in the presence or absence of VN (20pg/ml) under normal and hypoxic conditions (45 minutes) at 4°C and 37°C. Cardiomyocytes were stained for VN (red) and desmin (green). Normoxic cells at 4°C and 37°C showed VN staining in cellular periphery (arrow), but was absent intracellularly. Staining for VN was localized to the sarcomeres of hypoxic cardiomyocytes treated with purified recombinant VN both at 4°C and 37°C (inset, upper right). Insets, lower right: Staining of albumin (pink) and desmin (green). Staining for albumin was present throughout on cellular periphery and diffusely throughout cytoplasm under normal and hypoxic conditions both at 4°C and 37°C. No albumin staining was localized to cardiomyocyte sarcomeres. B) Representative line scan of a single sarcomere (A, insert, arrowsheads) demonstrates the colocalization of VN (red line) with desmin (green line) at the Z-bands. At peak signal intensities ~ 0.3 and 2.9 pm (arrows) there was an overlap of VN and desmin corresponding to areas of colocalization. 148 A B • • • Normoxic s^s Hypoxic Figure 6-11. FBS reduces contractility of isolated rat cardiomyocytes. Isolated rat cardiomyocytes have been incubated with or without 10% F B S added to the culture medium under either normal or hypoxic conditions (30 minutes). Cardiomyocytes have been electrically stimulated (45 mV) and the distance and duration of the contraction measured. A) In the presence of FBS a noticeable decrease in fractional shortening of both normoxic and hypoxic cardiomyocytes was observed (Control 24.14 ± 1.18 vs. 19.25 ± 1.11, p = 0.003; F B S 16.95 ± 1.33 versus 13.70 ± 1.19, p = 0.06). B) Similarly, shortening velocity of both normoxic and hypoxic cardiomyocytes decreased in the presence of FBS (Control 52.56 ± 3.7158 vs. 41.46 ± 3.97, p = 0.04; F B S 41.43 ± 4.04 and 34.85 ± 3.07, p = 0.18). 149 30 O) c c <u o V) "<5 c o tl <0 1 2.5 10 Vitronectin (ug/mL) 1 2.5 10 Vitronectin (ug/mL) • • • Normoxic Hypoxic Figure 6-12. VN exhibits dose dependent effects on fractional shortening and shortening velocity of cultured rat cardiomyocytes. Isolated adult rat cardiomyocytes were incubated with increasing concentrations of purified VN (1, 2.5, 10 and 20 pg/mL) under either normal or hypoxic conditions (45 minutes). Following the incubation period cells were electrically stimulated with the distance and duration of contractions measured. Fractional shortening (top panel) and shortening velocity (bottom panel) progressively decreased in hypoxic cardiomyocytes with increasing doses of V N . Untreated hypoxic cardiomyocytes exhibited a marked reduction of both fractional shortening and shortening velocity when compared to normoxic cells. Significant reduction in fractional shortening was noted between normoxic and hypoxic in all VN treated groups independent of the dose (top panel). Significant differences in shortening velocity were observed only in cardiomyocytes treated with 20 pg/mL purified VN (bottom panel). 150 6.4 Discussion VN accumulates in the E C M of the heart [286] and localizes at sites of Ml [309-311]. We have further investigated the localization, distribution and function of VN following hypoxic and ischemic injury by using in vitro and in vivo models. The work described here demonstrated that VN is found at sites of hypoxic (in vitro) and ischemic (in vivo) damage and localizes not only in the E C M but also within compromised cardiomyocytes wherein it is involved in regulation of cell function. Initial observations gathered from infarcted human myocardial tissue revealed VN accumulation at sites of ischemia, acute and chronic Ml, as well as cardiac rupture (Figure 7-8). Thus, VN is deposited at the site of injury within hours of myocardial ischemia, and persists for a prolonged period of weeks to months post-MI. Furthermore, accumulation of VN was associated with staining of other proteins important in ischemic tissue remodeling such as PAI-1, t-PA and u-PA which may be influenced by its versatile nature. Thus, VN likely plays an important role at sites of ischemic myocardial injury, and it is essential to investigate the function(s) and dissect its mechanism(s) of action in more detail. Following LAD ligation in mice, VN begins to accumulate in ischemic myocardium within 45 minutes and progressively increases over time localizing in both ischemic and necrotic cells. VN was primarily observed in the LV free wall and partially in the lateral wall supplied by the LAD. Closer examination of VN localization in the infarcted human myocardium revealed that it was found intracellularly within ischemic and necrotic cardiomyocytes. Furthermore, diminutive amounts of VN were found in the cell cytoplasm while the majority was associated with the sacromeric cytoskeleton, and particularly noted at the Z-lines. The clear VN striation pattern co-localized with desmin in the Z-line, thus we 151 investigated the potential binding interactions that occur between these two proteins. Desmin which exists in adult cardiomyocytes, is a type III IF protein homologous to vimentin, another structural IF protein found in neonatal and regenerating myocardium. In cardiac muscle, desmin has a function in maintaining structural and functional integrity, as well as differentiation [312-314] and both desmin and vimentin play a role in muscle regeneration [314, 315]. However, unlike vimentin, desmin persists between the Z-lines after sarcomeres are properly aligned and can also be found at the intercalated disk region of adult cardiomyocytes [316, 317]. Thus, we perceived that the accumulation of VN within viable cardiomyocytes within minutes to hours of ischemia encompasses a specific function, rather then simply general exudation of plasma proteins caused by augmented vessels permeability. In vivo studies using a mouse model of myocardial ischemia confirmed our human-based observations in which VN accumulates in cardiomyocytes and is bound to sarcomeric Z-lines. Confocal line scanning verified that peak signal intensities were noted overlapping in areas of VN-desmin co-localization notably at sarcomeric Z-lines. Protein fraction extraction from ischemic hearts demonstrated that majority of VN was observed in the IF cytoskeletal fraction and is potentially associated with sarcomeric or IF proteins as previously reported [307]. The deposition of other plasma antigens such as fibrinogen, FN and the terminal complement complex C5b-9 was previously noted within the ischemic heart [286, 307, 318]. Serum albumin is another abundant plasma protein with similar molecular weight to VN and was therefore used as a control. Interestingly, unlike V N , absence of albumin from the cytoskeletal fraction of ischemic hearts suggests that this phenomenon was not simply a passive effect of ischemia causing an 152 increase in membrane permeability. This offers additional support for a specific function of VN in binding to cytoskeletal proteins of compromised cardiomyocytes. Although incidence of VN in the ischemic myocardium has also been described, the focus was mainly on its immunolocalization within the E C M rather than cardiomyocytes [319, 320]. We did not re-examine the function of VN deposition within the E C M , but rather concentrated on the novel observation of VN accumulation in ischemic cardiomyocytes. In vitro studies with cultured adult rat ventricular cardiomyocytes indicated that VN is not expressed by the muscle cells. We found that the route of VN influx into ischemic/hypoxic cardiomyocytes occurs both dependent and independent of energy as VN accumulated in hypoxic cells at 4°C or 37°C consistent with passive and active transport respectively. However, further studies are required in order to clearly determine whether VN transport through the cell sarcolemma is receptor-mediated and potentially associated with the transverse tubular system (T-system). Cardiac muscle fibers possess a well developed T-system that traverses every fiber at the level of the Z band [321, 322] [321-324]. The lumen of the T tubules connects directly to the extracellular space permitting entrance of large, serum derived proteins as elegantly shown in previous studies [321-324]. Thus it is possible that VN may also be internalized via the T-system. We have previously described the specific binding interactions of vimentin IF with VN and PAI-1 on activated platelets and platelet microparticles promoting the regulation of fibrinolysis in plasma and thrombi [307]. Studies with neonatal cardiomyocytes demonstrated that VN binds vimentin, as well as to desmin IF. Biochemical studies indicated that VN binds desmin specifically and with high affinity forming Triton-X soluble complexes. Desmin plays essential roles in cell 153 survival [325], maintenance of functional and mechanical integrity of the cells [314], sarcomerogenesis [316], as well as counteracting external stresses [326]. Desmin, along with other cytoskeletal proteins is more resistant to ischemia than contractile filaments, although significant losses of cross striations occur as early as within ninety minutes of onset [318, 323]. One potential theory is that rapid influx of VN into ischemic cardiomyocytes may inhibit depolymerization of desmin by binding the IF, stabilizing its conformation and cross linking the desmin tetramers. Alternatively, binding of VN to desmin may serve as a mediating step that promotes association of VN-desmin complexes with other protein(s) which together maintain and regulate cellular function during ischemia. Similarly, interactions between platelet-derived VN-PAI-1 complexes and vimentin on activated platelets and endothelial cells have previously been observed [307]. We observed a significant compromise of contractile function following in vitro hypoxic injury, which was further exacerbated by V N . Loss of contractile function was also noted in cardiomyocytes subjected to F B S treatment although we could not attribute these effects solely to the presence of VN in the serum. Unexpectedly, along with a reduction of function in hypoxic cells, normoxic cells treated with FBS also exhibited a significant decline in contractility, unlike those treated with purified V N . Thus, VN potentially reduces contractility in cardiomyocytes compromised by hypoxia, but exhibits trivial effects under normal conditions. This compromise to cardiomyocyte function may possibly be attributed to the binding of VN to desmin IFs potentially reducing metabolic demands. Our findings suggest that VN binds to desmin within ischemic cardiomyocytes, potentially disrupting IF-dependent regulation of sarcomere contractility, reducing cardiomyocyte shortening and decreasing the duration of contraction. Desmin is 154 connected with the sarcomeres at the Z disks and, along with other IF proteins, plays a regulatory role on the normal contractile function of myofibrils [234]. Thus, there likely exists a myofibril-desmin relationship in the sarcomere and its integrity is essential for normal contraction of the myocyte. Our work demonstrated that V N binds to desmin IF with high affinity, an interaction which was noted in ischemic/infarcted cardiomyocytes. Reduction of cardiomyocyte contractility may represent a protective effect during ischemia by reducing metabolic requirements in favor of sustaining critical function for survival of the cell. Thus, VN may potentially exhibit an additional roles in regulation of stunning/hibernating of the myocardium through its interactions with desmin IF. Structural proteins such as desmoplakin, cardiotin, actin, titin and desmin commonly undergo changes in stunned myocardium [240]. Of these, cytoskeletal desmin levels are reduced throughout the dysfunctional myocardial regions while a global decrease is noted during hibernation [327]. Disorganized expression and loss of cytoskeletal, as well as intercalated disk desmin have been commonly noted in stunned myocardium. Desmin is indispensable for force generation and maintenance of passive tension. The absence of desmin significantly hinders the mechanical properties of muscle tissue. In visceral smooth muscle the absence of desmin caused contractile dysfunction allowing for only 40% of the normal contractile force and a 25-40% reduction of maximal shortening velocity [328]. Disruption of cytoskeletal proteins including desmin is a possible mechanism for stunning, although it may be a secondary effect of protease activation. Furthermore, in end-stage heart failure total absence of desmin from some myocytes is associated with cellular loss of the IF protein and exhaustion of its compensatory reserve [329]. Such desmin alterations are responsible for LV dysfunction causing a reduction in EF [330, 331]. 155 Thus binding of VN to desmin, the major stress-bearing element of the sarcomere, may promote desmin stability, in an effort to maintain sarcomeric integrity and cellular function. Although the role for VN in regulation of ischemic cardiomyocyte contractility and maintenance of cellular integrity is sensible, additional functions should also be considered. For example, by regulating cardiomyocyte contractility VN may partake in lowering cellular energy demands during a period of reduced oxygen concentration [331]. Furthermore, VN-desmin interactions may also play a role in progression to heart failure. Systolic heart failure results from an inadequate number of cardiomyocytes, or reduced contractile function of the muscle cells. In the latter situation myocardial function is impaired although the pathophysiological mechanism behind this cellular defect is unknown. It has been suggested that during extensive oxygen deprivation, cell viability is severely compromised and results from lysis of lateral Z-, M-, and A-band IF attachments, vesiculation of sarcoplasmic reticulum, and rupture of sarcolemmal membranes. Furthermore, IF attachments with nuclear membranes are disrupted and microtubules disappear from the perinuclear space. Sarcomere changes include distortion of Z bands, loss of lateral Z band-sarcolemmal attachments, and separations of myofibrils from internal faces in intercalated disks [331-333]. These alterations could help explain the reduced contractility observed during hypoxia, ischemia, and in the failing hearts [229, 333]. Although the role of desmin on cardiomyocyte function has been well described [314, 334] the importance of VN-desmin interactions in ischemic myocardium are unclear and require closer investigation. Our findings determined that VN binds to desmin with a high affinity, however the details of this interaction are yet to be determined. Previous findings from our 156 laboratory have shown that VN binds to the amino-terminal end of vimentin [307]. Amino acid sequence comparison of desmin to other IF subunits revealed a region that is highly conserved (80%) among different members of the IF protein gene superfamily [307]. Global alignment of human desmin and vimentin sequences showed 61.1% homology between the two IF proteins. Significant sequence homology exists within the first 120 residues of the amino-terminal head domains, including the highly conserved nonapeptide motif S S Y R R T F G G (residues 12-21 of desmin) and an arginine and proline containing domain known as the RP-box found in type III IF such as vimentin, desmin, peripherin and glial fibrillary acidic protein [224, 335]. Both of these sequences contain phosphorylation sites that are critical for the assembly and disassembly of type III IF proteins [336]. It is probable that VN also binds to the amino-terminal end of desmin, similar to vimentin which contains a high affinity VN binding site [307]. These are possible binding regions that exhibit high affinity for V N , thus promoting its incorporation into the cardiomyocytes. Further experiments using peptides generated from the amino-terminus of human desmin are essential to identify the specific region involved in binding of V N . Three peptides have been designed to illuminate the specific region responsible for the binding to V N ; peptide 1 a 25-mer which includes a nonapeptide ( S S S Q R V S S Y R R T F G G A P G F P L G S P L ) , peptide 2 is a 27-mer which spans the middle of the amino-terminus ( S P V F P R A G F G S K G S S S S V T S R V Y Q V S ) and peptide 3 a 26-mer containing the RP-box ( R T S G G A G G L G S L R A S R L G T T R T P S S Y ) . Future experiments using these peptides will provide us with a clearer idea about the specific region(s) responsible for the interaction between these two proteins. Inhibition of VN-desmin interaction may potentially exhibit cardioprotective effects by preventing VN multimerization and binding to sarcomeric desmin IF, thus 157 restoring cardiomyocyte contractility. Therefore, plausible novel therapeutics could target methods and compositions for inhibiting the multimerization of VN in cardiovascular tissue. Development of specific compound(s) that specifically inhibits VN polymerization and the binding of polymerized VN to desmin IF are necessary for further investigation of interactions between these proteins, particularly in ischemic cardiomyocytes. 6.5 Conclusion The roles of VN in growth, motility and matrix remodeling strongly indicate its importance as a mediator in response to injury, both in the extra- and intracellular environment. In this study we have shown that during acute ischemia VN influx into damaged myocardium progressively accumulates over time. Furthermore, VN enters ischemic cardiomyocytes specifically binding to desmin with high affinity wherein it may play a role in regulating cardiac function by significantly inhibiting cardiomyocyte contractility as proposed in Figure 6-14. The binding of VN to desmin and inhibition of contractility during the early ischemia period in injured cells suggests a novel role of VN that may be independent of its role as a PAI-1 binding cofactor. Based on our findings we suggest that through direct binding to cardiomyocyte desmin IF, VN compromises cellular function in response to ischemic injury. In an ongoing and exciting avenue of this investigation we are working towards identifying and assessing the functional roles of VN through comprehensive in vitro and in vivo methodologies using transgenic models in order to determine: 1) mechanism of entry for VN into ischemic cardiomyocytes, 2) whether the accumulation of VN in cardiomyocytes has an impact on long-term cardiac function, and 3) whether VN affects post-MI wound healing. By 158 Z-hne Z-line — , K Sarcomere A Relaxed Contracted B Vitronectin Relaxed Contracted Figure 6-14. Proposed model of VN-desmin interactions in regulation of cardiomyocyte sarcomere contractility. A) Under physiologic conditions actin thin filaments slide past myosin thick filaments allowing the sarcomeres to maximally contract. B) During myocardial ischemia there is an influx of plasma VN into compromised cardiomyocytes reducing sarcomeric contraction potentially by binding to desmin IFs. 159 understanding specific roles of VN in acute and chronic phases of cardiomyocyte response to injury and repair, approaches to alter pathological aberrations could be developed. These developments will provide vital groundwork to the discovery of future molecular therapy targets using endogenous elements providing potential therapies for various diseases. 6.6 Additional Considerations Although we have established that VN influxes into ischemic myocardium, and more specifically into cardiomyocytes in which it exhibits a role in mediating cardiomyocyte contractility, effects of VN on myocardial wound healing and regeneration remain unknown. VN has multiple ligands, the major one of which appears to be PAI-1 [280, 337, 338] . Binding to VN stabilizes the conformation of PAI-1 , in turn promoting its inhibition of t-PA and u-PA preventing plasmin generation, hence limiting E C M degradation [339]. VN also mediates cell adhesion and migration by binding to integrins and the uPAR. When bound to V N , PAI-1 can inhibit both uPAR activity and integrin association [136, 274, 275], impeding inflammatory cell recruitment to the area of injury. Thus, following acute ischemia and infarction, VN rapidly influxes into the injured myocardium where, by binding to PAI-1, it may modulate E C M remodeling and fibrosis. Moreover, following infarction, hypertrophic and failing hearts exhibit disorientation and increase in desmin filaments [340, 341] which likely occurs to counteract abnormal stresses experienced by cardiomyocytes. Thus, binding of VN to desmin may also be involved in mediating and reducing myocardial stresses through inhibition of contractility in response to post-MI remodeling. Further studies need to be undertaken to determine the immediate and long-effects of VN-desmin interactions 160 post-MI. These would best be investigated using a double knockout (VN and desmin) mouse model of LAD ligation. Alternatively, to test the specific effects of VN-desmin interaction on cell contractility an in vitro study can be conducted in which cardiomyocytes from desmin knockout mice treated with VN under hypoxic conditions. Additionally, WT cardiomyocytes can be blocked with various anti-VN Abs. Although at this time we have preliminary data supportive of VN binding to the desmin N-terminus, further experiments are essential to determine the exact location and characterization of the binding site on VN for desmin. 161 CHAPTER VII EXPRESSION OF CARDIOMYOCYTE TISSUE PLASMINOGEN ACTIVATOR FOLLOWING MYOCARDIAL INFARCTION 7.1 Rationale Impaired cardiovascular fibrinolytic activity is implicated in the pathogenesis of acute Ml. Subsequently, impaired fibrinolytic activity in the infarct region promotes fibrosis and a loss of myocardial function. Tissue remodelling is dependent on the activity of proteinases, such as the PA, that convert plasminogen to plasmin, the biologically active form. Although physiologically the function of plasmin is primarily related to fibrinolysis, it also activates MMPs capable of degrading the fibrillar collagen that accumulates at sites of myocardial injury. Activation of PAs is impaired by PAI-1. Elevated PAI-1 post-MI impaires angiogenesis and promotes fibrosis in the infarct region which may eventually result in heart failure. PAI-1 activity is maintained by V N , which stabilizes its active inhibitory conformation and mediates its binding to structural proteins. Although u-PA is a major PA associated with post-MI tissue remodeling we observed increased cardiac t-PA levels in infarcted VN- / - mice. Thus, we investigated the previously unrecognized effects of t-PA in contribution to post-MI remodelling. Additionally, t-PA levels increase with various hypertrophic stimuli. Exercise training is known to induce an increase in systemic fibrinolytic activity, suggestive of an enhanced fibrinolytic reserve including increased levels of plasma t-PA. Therefore, following Ml the beneficial effect of exercise training may be related to increases in t-PA activity. Here we investigated whether hypertrophy instigated by exercise training or ISO stimulation induced cardiac t-PA synthesis and whether cardiomyocytes are a contributing source of t-PA in the heart. 162 7.2 Experimental Methodology 7.2.1 Rat Ml model A rat model of Ml was performed as described by Orenstein et al [198]. Male 12-14 week-old Sprague Dawley rats were randomized prior to proximal LAD occlusion or sham-operated groups. To create the model, animals were anesthetized with ketamine hydrochloride (90 mg/kg) and xylazine (10 mg/kg) intraperitoneally. After adequate anaesthesia they were intubated with a 14-gauge polyethylene catheter and ventilated with room air using a small animal ventilator (model 683; Harvard Apparatus, Boston, MA). A left thoracotomy was performed in the fifth intercostal space and the pericardium was opened. The proximal left coronary artery under the tip of the left atrial appendage was encircled and ligated using a 6-0 silk suture. Proximal LAD ligation in a rat model created a reproducibly large lateral wall infarction. The muscle and skin were closed in layers. In sham-operated animals, the LAD was encircled but not ligated and the muscle layers and skin were closed similarly. Five weeks post-surgery, rats from both groups were randomized to exercise training or sedentary lifestyles. Rats in the exercise treated group swam daily for 6 weeks with increasing time periods from 5-40 minutes. This resulted in four final groups: Ml sedentary (n = 28), Ml exercise (n = 30), sham-operated sedentary (n = 11), and sham-operated exercise (n = 11). During the 6 week of intervention, five rats died in the infarction sedentary group, and two rats died in the infarction exercise group. To determine the natural progression of molecular changes within the myocardium in the infarct and non-infarction regions of the heart following coronary occlusion an additional 50 rats of similar weight and age were subjected to sedentary conditions. The rats were randomized to be 163 sacrificed on days 1, 2, 7, 14, 21, 28, and 35 after ligation, and some hearts were processed for histology. Of these, five animals were also randomized to receive sham ligation and were sacrificed on day 0 to act as controls. All animal experiments were approved by the University of Toronto Committee on Animal Care. 7.2.2 Exercise protocol The swimming protocol began on day 35 for 5 minutes/day initially, and increased by an additional 5 minutes/day until the rats were swimming continuously for 40 minutes/day. Swim frequency was 5 days/week for a total duration of 6 weeks. The rats swam in a 60-cm-deep tub with water temperature maintained at 35°C in groups of four animals, and were towel-dried following each session. The rats randomized to sedentary conditions were dipped in the water for 30 seconds and towel-dried 5 days/week. All rats were then sacrificed at 11 weeks and randomized to hemodynamic/morphometry analysis or molecular studies. To ensure that we investigated a model of severe LV dysfunction, all hearts with infarction involving less than 45% of LV perimeter were excluded after pathologic and morphometric analysis. Thus, seven sedentary and seven exercise infarcted hearts were excluded from their respective groups. In total, 51 infarcted rats were used in the study protocol. 164 7.2.3 Isolation and culture of adult and neonatal rat cardiomyocytes Adult cardiomyocytes were isolated from Langendorff perfused adult male Sprague-Dawley hearts as previously described [198]. Neonatal cardiomyocytes were isolated from the ventricles of a litter of 1-day-old Sprague Dawley rat pups (n = 14) using a modified method described by Simpson et al. [198]. Rat endothelial cells were isolated from epididymal fat pad and maintained in M199 media with 20% fetal calf serum and supplemented with 10 ng/mL endothelial cell growth factor [305] (ICN, Montreal, P.Q.). Neonatal cells were treated with 10nM isoproterenol for 72 hours. Adult rat cardiomyocytes were 10nM isoproterenol for 30, 60 and 90 min. 7.2.4 Immunohistochemistry and immunocytochemistry Rats heart tissues were fixed in 4:1 formaldehyde/glutaraldehyde. The tissues were paraffin embedded and serially sectioned, then stained for H&E and Massons' trichrome or for immunohistochemical staining using polyclonal Abs to t-PA, PAI-1 and VN (Affinity Biologicals, Hamilton, O N , Canada). Isolated neonatal and adult rat cardiomyocytes were grown on 2-well chamber slides (Lab-Tek®, Campbell, California), fixed in 4% paraformaldehyde in TBS, washed, neutralized for 10 minutes in 2 pl/mL glycine in TBS then permeabilized with 0.01% Triton-X-100 in TBS for 5 minutes. Immunolabeling for neonatal cardiomyocytes was performed with polyclonal rat anti-GLUT 4 (Santa Cruz Biotechnology, Inc., Santa Cruz, California), polyclonal anti-murine t-PA (Molecular Innovations, Southfield, Ml) and polyclonal anti-murine actin (Sigma Aldrich) then incubated for 1 hour with either AlexaFluor® 488 goat anti-murine and AlexaFluor® 594 goat-anti-rabbit IgG (Molecular Probes). Adult cardiomyocytes 165 were stained with polyclonal murine anti-t-PA (Molecular Innovations), anti-desmin (Abeam) and specific mouse and rabbit monoclonal IgG Ab, then incubated for 1 hour with either AlexaFluor® 594 goat-anti-murine, AlexaFluor® 488-conjugated goat-anti-rabbit IgG and Hoechst 33342 nuclear dye (Molecular Probes). The slides were washed, mounted with cover slips using SlowFade® (Molecular Probes) mounting medium. 7.2.5 Cell and tissue RNA extraction and RT-PCR Neonatal rat heart cell or whole block RNA extraction on paraffin embedded rat heart tissue was performed. Previous studies describing efficacy of extracting RNA from fixed tissues yielded good quality results despite the high probability of degraded RNA signal [198, 306, 342]. Since the majority of RNase activity was localized to the 5' and 3' ends of mRNA transcripts, primers were designed to amplify internal regions of the rat t-PA mRNA sequence (Gl: M23697). For RNA extracted from paraffin-embedded tissues two short P C R amplicons of 130 bp and 79 bp were chosen, representing regions of the internal sequences of rat t-PA mRNA with low likelihood of mRNA degradation (Table 7-1). The short length of these primers further increased the likelihood of P C R amplification from interrupted and degraded mRNA. Both primers (NAPS, University of British Columbia, Vancouver) were used to determine t-PA mRNA expression in each group. RNA isolated from cultured Bowes melanoma cells [343] and 18S primers were used as positive controls. For RNA extracted from neonatal rat hearts a different set of primers was used specific for rat t-PA mRNA expression (800 bp) from both cardiomyocyte and non-cardiomyocyte populations of cells. Atrial natriuretic factor (ANF) mRNA 166 primers (246 bp) were also designed for the detection (Table 7-2). Reverse transcription reactions were carried out with ~ 0.1u.g/|iL of total RNA using random decamers supplied with the RetroscriptRT reaction kit (Ambion Inc., Austin, TX). Briefly, RNA and random decamers were heated to 70°C for 2 minutes and then placed on ice. 5X first strand buffer, 25 mmol/L MgCI 2 , 10 mmol/L dNTPs, 50 U/pL RNase inhibitor, 100 mmol/L DTT and M-MLV reverse transcriptase (Invitrogen, Burlington, ON) were added to the reaction which was performed at 42°C for 1 hour and stopped by heating at 70°C for 10 minutes. P C R reactions were carried out in a Thermohybrid P C R express machine in a final volume of 20 pL using HotStarTaq Polymerase (Qiagen, Mississauga, Ontario). Cycling conditions were at 94°C for 15 minutes; then 94°C for 30 seconds, followed by 48°C for 30 seconds and 72°C for 30 seconds for 35 cycles; followed by a final extension at 72°C for 3 minutes. All P C R products were visualized by gel electrophoresis, additionally the products obtained form paraffin embedded hearts were subjected to nucleotide sequencing. Sense Strand (5' - 3") Anti-Sense Strand (5' - 3') Size (bp) t-PA 1 T A A C A A A A C C A T C A C G A G C A A G T C A T C C G C T T A T C G A T C A 130 t-PA 2 A A T A T T G C G A C A T G T C C C C A G A G T C C T C C T T T A A T T C G A A 79 Table 7-1. Sequences and sizes of primers used for amplification of rat t-PA. Sense Strand (5' - 3') Anti-Sense Strand (5' - 3') Size (bp) t-PA T G G C A C C C A C A G C T T T A C C -A C A T C C A A G G C T C C T G A G T C A C C T G G C A -C G C G T C A T G G 800 ANF A T C T G C C C T C T T G A A A G C A C T C C A G G A G G G T A T T C A C C A 246 Table 7-2. Sequences and sizes of primers used for amplification of rat t-PA and ANF. 167 7.2.6 Microscopy and image analysis Stained tissue sections were imaged and captured on Nikon Eclipse 600 using 20x and 40x objective lenses and analyzed. Quantitation of relative tissue t-PA staining intensity was measured over 20 fields of view (40x objective) per stained section using Northern Exposure software (Empix Imaging, Mississauga, ON) [344]. Images of cells were captured by either florescence or phase contrast microscopy (neonatal cardiomyocytes) on a Nikon Eclipse 600 using 20x and 40x objective lenses, or a Leica SP2 A O B S confocal laser scanners on Leica DM IRE inverted microscope using 40x objective lenses (adult cardiomyocytes). For some images 3-D volume rendering was performed using MetaMorph (Universal Imaging Corp, Downingtown, PA) and Volocity imaging software (Improvision Inc, Lexington, MA). The point spread functions of the microscope optical system was measured by imaging standardized fluorescent beads (PS™-Speck Microscope point source kit; Molecular Probes) and processing these images with those of the z-scan stacks of the cells using Openlab deconvolution software and the 3-D restoration module (Improvision Inc). 7.2.7 Western immunoblotting Culture supernatants or cell fractions were run on 8% S D S - P A G E gel under non-reducing conditions and transferred to Immobulon-P membranes (Millipore). The membranes containing neonatal heart extracts were probed with murine anti-t-PA polyclonal Ab (Molecular Innovations) or mouse anti-human PAI-1 monoclonal Ab (Affinity Biologicals). Membranes containing adult cardiomyocyte culture supernatants were probed with murine anti-t-PA polyclonal Ab. Membranes were visualized using LI-COR Odyssey infrared imaging system (LI-COR Inc. Lincoln, 168 Nebraska). Relative intensity of bands was compared using Image J v1.38 and tabulated using SigmaPlot 8.0 (Systat Software, Point Richmond, CA). 169 7.3 Results 7.3.1 Increased expression of t-PA. PAI-1 and VN in the infarcted LV LVs from sedentary sham-operated controls and RVs from sedentary acute Ml rat heart showed normal morphology using H&E staining (Figure 7-1 A-B). In contrast, infarctions were evident in LVs of LAD ligated rats (Figure 7-1 C). Minimal PAI-1 or VN staining was observed in the normal LV of sedentary sham-operated rat hearts, or in the RV of sedentary infarcted rat hearts using immunohistochemistry (Figure 7-1 J-K, M-N). Similarly, only faint t-PA staining was found in the myocardium of sham LV and normal RV of Ml sedentary rat hearts (Figure 7-1 G-H). Following Ml, t-PA staining was present throughout the LV, both in cardiomyocytes and with marked intensity in small blood vessels within the peri-infarct zone (Figure 7-1 I, arrow, high magnification inset). Intense staining of both PAI-1 and VN co-localized in the infarct with faint staining also noted in the peri-infarct zones (Figure 7-1 L, O). Both PAI-1 and VN were absent from the non-infarcted RV. 7.3.2 Exercise training induces t-PA expression in normal and post-MI ventricles A marked increase of t-PA immuno-reactivity was seen in cardiomyocytes in hearts of exercise-trained Ml rats particularly in the peri-infarct region (Figure 7-2). Moreover t-PA staining was limited primarily to cardiomyocytes, with only relatively trivial expression in endothelial cells within the myocardial vessels (Figure 7-2, arrows). Increased t-PA was also observed in sham-operated exercised rat hearts. Similar to hearts of exercise-trained Ml rats, intracellular t-PA was visible throughout the myocardium, primarily in cardiomyocytes. In contrast, only minimal t-PA staining was evident in both, sham-operated or acute Ml hearts of sedentary rats. 170 SEDENTARY SEDENTARY SEDENTARY SHAM GROUP, LV Ml GROUP, RV Ml GROUP. LV Figure 7-1. t-PA, PAI-1 and VN accumulate in infarcted rat myocardium. A-C) Haematoxylin and eosin staining displayed the morphology of sham-operated LV, and infarcted RV and LV of sedentary rats. LV of sham-operated or contra-lateral non-infarcted RV of infarcted animals showed occasional, faint staining for t-PA (G-H) and negligible staining for PAI-1 (J-K) and VN (M-N). Marked accumulation of PAI-1 and VN staining was evident within the peri-infarct and infarcted region (L, O). Elevated t-PA staining was evident within the endothelium of small blood vessels of the peri-infarct zone (I, arrow, inset high magnification). Faint staining was also present in ventricular cardiomyocytes. No staining was noted in control normal rabbit IgG (NRG) (D-F). Scale bar = 100 pm. 171 Figure 7-2. Exercise increases t-PA in rat myocardium. Immunohistochemical staining (40x objective) demonstrated an accumulation of t-PA in hearts of rats subjected to a regular exercise regimen, with increased intensity noted particularly post-MI. t-PA staining was observed localized primarily to ventricular cardiomyocytes and was reduced in vascular endothelial cells (arrows). Scale bar = 100 pm. 172 Exercise-trained Ml rats showed highest levels of t-PA staining which was significantly increased when compared to Ml hearts of sedentary animals (13.3 ± 1.5% LV vs. 1.2 ± 0.4% LV t-PA positive area, p < 0.01) (Figure 7-3 A). Sham-operated exercised rat hearts also showed increased t-PA staining which was significantly elevated when compared to hearts of sham-operated sedentary animals (6.9 ± 2.9% vs. 1.8 ± 1.1% p < 0.01) (Figure 7-3 A). Furthermore, t-PA was also considerably increased between the sham-operated and Ml exercise groups (P < 0.05) (Figure 7-3 A). Levels of t-PA mRNA levels extracted from the paraffin embedded rat hearts were examined using RT-PCR. Low levels of the two selected t-PA amplicons (130 bp and 79 bp) were detected in rat hearts from the sham-operated and acute Ml sedentary groups (Figure 7-3 B). Conversely, both t-PA amplicons were detected at increased intensity in rat hearts of both sham-operated and Ml exercise groups, where band were consistent with those expressed by the Bowes melanoma cell standard. The use of primer set t-PA-1 revealed a strong band in both sham-operated and Ml animals subjected to exercise. DNA sequencing of the 130 bp P C R product revealed a 95% sequence identity to rat t-PA mRNA and corresponded to the correct site on the known rat t-PA mRNA sequence. Additionally, an unexpected distinct band (~ 200 bp) was detected above the 130 bp t-PA amplicon when using the t-PA primer (t-PA-1, Table 7-1) and was found exclusively in hearts of rats from both exercise groups (Figure 7-3 B). The upper ~ 200 bp band also revealed homology to sequences corresponding to rat t-PA mRNA. The use of primer set t-PA-2 also revealed a distinct band in animals from all groups consistent with rat t-PA mRNA. This band was noted in both exercise groups, and was particularly robust in the exercised Ml mice. 173 B Sham Sham Ml Ml Bowes Sedentary Exercise Sedentary Exercise Melanoma t-PA1 t-PA2 18S t-PA1 »-PA2 18S t-PA1 I-PA2 18S t-PA1 t-PA2 18S I-PA1 1-PA2 18S 1 mm mm m - § m • min-Figure 7-3. Exercise training increases rat cardiomyocyte t-PA synthesis. A) Quantitation of t-PA positive rat myocardium demonstrated a significant increase in t-PA positive area in rats subjected to an exercise regimen, both sham-operated and infarcted. Bars represent mean ± standard error of mean, (*) represents significant difference in optical densities; p < 0.05. B) Two t-PA amplicons at 130 bp (lane 1) and 79 bp (lane 2), and positive control mRNA isolated from Bowes melanoma cells (lane 3) were present in all four groups of rats. Increased expression of both t-PA amplicons (lanes 1 and 2) was observed in sham-exercised and AMI exercised groups. Sequence analysis of an intense band located above the 139 t-PA amplicon, at -200 bp, exclusive to both exercised groups was found to encode the rat t-PA gene (lane 1). Amplicon expression of 18S mRNA (488 bp) was present in all four groups. 174 7.3.3 t-PA synthesis, storage and secretion by neonatal rat cardiomyocytes Neonatal rat cardiomyocytes were cultured under serum free conditions in the absence or presence of ISO for 72 hours. Total RNA was subjected to reverse transcription and P C R amplification using primers specific for rat t-PA. mRNA was detected as a 800 bp band corresponding to the 5' and 3' untranslated regions of the rat t-PA cDNA. The t-PA message was found in the isolated neonatal cardiomyocytes, as well as in the non-cardiomyocytes cell population (endothelium and fibroblasts) and positive control rat cDNA from cultured endothelial cells (Figure 7-4A, upper bands). Additional P C R for ANF was used to validate the identity of the isolated cells as cardiomyocytes. ANF mRNA expression was identified as a 246 bp cDNA fragment in the cultured cardiomyocytes, but was absent from non-cardiomyocytes cultures (Figure 7-4A, lower bands). Western immunoblotting of the 72 hour serum free culture supernatants from the neonatal cardiomyocytes treated in the presence or absence of ISO confirmed inducible t-PA antigen secretion. The majority of the t-PA in the cardiomyocyte culture supernatants was complexed with released PAI-1 (-115 kDa), with low levels of free t-PA (60 kDa) (Figure 7-4B). In contrast, the majority of cardiomyocyte PAI-1 was in the free form detected as a heavy band at 45 kDa (Figure 7-4B, top, lane 2-3). Treatment of cardiomyocytes with ISO increased the total secreted t-PA and PAI-1 by an estimated 2-fold as detected by densitometry. 175 A //// <^ <F C -t-PA -ANF B P A I - 1 t - P A D t-PA: PAI-1 Complexes «-PAI-1 t-PA: PAI-1 Complexes t-PA Figure 7-4. ISO-stimulated neonatal rat cardiomyocytes produce and express t-PA. Cells from neonatal rat hearts were cultured and separated into cardiomyocytes (CM) and non-CM populations. A) Primers specific for rat t-PA were used to identify t-PA (800 bp) mRNA expression from both C M and non-CM populations of cells. ANF (246 bp) mRNA was only detected in the C M population. B) Western blot of serum free (SF) culture supernatants from rat endothelial cells (ECs) and C M treated in the presence or absence of isoproterenol (ISO) for 72 hours. Majority of t-PA in both untreated and ISO treated cells was complexed with PAI-1 while majority PAI-1 was in the free, uncomplexed form. 176 Distribution of t-PA in neonatal cardiomyocytes was also examined by confocal microscopy analysis. In the absence of ISO treatment, neonatal cardiomyocytes were generally small in volume with low t-PA and actin immunoreactivity (Figure 7-5A). ISO stimulation increases cardiomyocytes size, with concurrent increases in the actin cytoskeleton along with the number of t-PA positive vesicles per cell (Figure 7-5B). To test whether t-PA was secreted in a regulated secratory manner dual labelling with Abs against t-PA and GLUT-4 was performed. t-PA-positive granules co-localized with GLUT-4 in the ISO treated neonatal cardiomyocytes (Figure 7-5 C-F). 7.3.4 t-PA synthesis, storage and secretion by adult rat cardiomyocytes To test whether acute t-PA secretion can be induced in cultured adult rat cardiomyocytes we tested the effects of B-adrenergic agonist ISO on the acute inducible secretion of t-PA. Immunofluorescence staining revealed a time-dependent increase in the accumulation of t-PA evident throughout the cytoplasm of ISO-treated cells (Figure 7-6 E-H and l-L) relative to non-stimulated cardiomyocytes (Figure 7-6 A-D). t-PA staining was absent from IgG treated control cells (Figure 7-6 A-D). Desmin staining demarcated the sarcomeric Z-lines and intercalated discs of the isolated cardiomyocytes (Figure 7-6 B, F, J). Intracellular t-PA staining demonstrated a time-dependent accumulation of t-PA in discrete secretory granules within ISO-treated cardiomyocytes, and became progressively more evident by 30 and 90 minutes after treatment (Figure 7-6 E, I). A deconvolved higher magnification image of a single cardiomyocyte after 90 minutes of treatment with ISO reveals distinct t-PA vesicles dispersed throughout the cell (Figure 7-6 M). 177 A _ B W c D / E F / / Figure 7-5. ISO-stimulated neonatal rat cardiomyocytes store t-PA in vesicles. A-B) Confocal microscopic images of immunolabelled cultured neonatal cardiomyocytes in the absence (A) or presence (B) of ISO for 72 hours showed an ISO-inducible increase in intracellular t-PA (yellow/green) localized within discrete peri-nuclear vesicles (arrow). C-F) Hypertrophic effects of ISO were also evident on cardiomyocyte growth and actin cytoskeleton development (red). GLUT-4 (C) and t-PA (D) within ISO-treated cells. E-F) Higher magnification images of serial 2-plane composite of GLUT-4 (C), t-PA (D), and phase contrast images revealed colocalization of t-PA with GLUT-4 (arrows, yellow, Panels E-F). Scale bars = 5 pm. 178 Figure 7-6. ISO-stimulatation increases t-PA accumulation in adult rat cardiomyocytes over time. Immune-fluorescent staining of cultured adult rat cardiomyocytes at 0 (A, B, C, D), 30 (E, F, G , H) and 90 (I, J , K, L) minutes following treatment with ISO stained for t-PA (green; A, E, I), desmin (red; B, F, J) and nuclei (blue; C, G, K). Intracellular t-PA accumulation increased over time of treatment with ISO. t-PA was present within discrete secretory vesicles and localized to cellular periphery (D, H, L). Scale bar = 20 pm. Higher resolution images demonstrated distinct t-PA granules (arrow) confined to the cytoplasm and sarcolemma following 90 minutes of ISO stimulation (M, N). Scale bar = 10 pm. 179 Closer examination of a magnified region (box) reveals t-PA positive secretory granules localized within the cytoplasm (Figure 7-6 N, arrow), as well as at the cell periphery. The time-dependent effect of ISO on adult cardiomyocytes t-PA biosynthesis was also confirmed by Western blotting. The constitutive release of t-PA antigen into the supernatants of cultured cells after 24 hours of culture with no ISO-treatment is evident lane 1 (Figure 7-7 A). Furthermore, the acute regulated release of t-PA from the cultured cells was evident following the addition of ISO detected as robust bands at ~ 70 kDa (Figure 7-7 A, arrow). t-PA levels increased by ~ 1.5 fold following 30 minutes and ~ 3.2 fold following 90 minutes of ISO stimulation when compared the untreated controls indicative of release from an apparent t-PA storage pool (Figure 7-7 B). 180 A & > t-PA 70 kD 1 2 3 4 B No ISO 30 min 90 min ISO Figure 7-7. ISO-stimulation increases adult rat cardiomyocyte t-PA secretion over time. A-B) Isolated rat cardiomyocytes cultured for 24 hours then treated with ISO showed an acute time-dependent secretion of cardiomyocyte t-PA into the culture supernatant. A) Western blot of serum-free culture supernatants demonstrated a time-dependent increase in t-PA secretion following treatment with ISO. Low levels of t-PA were detected in the culture supernatants after 24 hours without treatment (lane 1). t-PA was levels progressively increased over time following ISO treatment as noted at 30 and 90 minutes (lanes 2 and 3 respectively). t-PA standard appeared in lane 4. 181 7.4 Discussion The PA7plasmin system plays a major role in post-MI wound healing and LV remodeling [116, 181, 185]. In Chapter V we demonstrated the effects of VN on post-MI tissue healing, by means of regulating the PA/plasmin system. Although t-PA levels are elevated in heart post-MI [216], its importance to the myocardial remodeling process is not commonly recognized [117]. Interestingly, our observations from ischemic and infarcted human tissue suggest that t-PA is localized throughout the myocardium and consequently may be involved in the remodeling process (Figure 7-8). In this chapter we have investigated the effects of hypertrophic stimuli on regulation of the fibrinolytic system in infarcted myocardium and cultured rat cells. We provided several lines of evidence which suggests that both neonatal and adult cardiomyocytes are a significant cellular source of t-PA under certain hypertrophic conditions. First, we have shown that following a six-week exercise regimen, expression of t-PA increased in rat hearts; this was observed throughout the infarcted, peri-infarcted and non-infarcted myocardial regions of LAD ligated and sham-operated animals. t-PA staining was not exclusive to endothelial cells, but occurred predominantly in cardiomyocytes. In comparison no increase was evident in sedentary animals following Ml or sham-operation. The increased tissue staining was accompanied by increased t-PA mRNA expression in both exercised groups. Furthermore, we were able to confirm that cardiomyocytes were the source of the t-PA, as evidenced by the ISO-induced synthesis, storage and secretion of t-PA by cultured adult rat cardiomyocytes. Additionally, consistent with our mouse studies we discovered that under sedentary conditions accumulation of PAI-1 and VN was observed in the infarct and peri-infarct regions 182 following acute Ml. Exercise exhibits favorable effects on ventricular remodeling in rats subjected to LAD ligation [117]. Those results demonstrated that exercise can modulate myosin heavy chain (MHC) gene expression, which is normally expressed during fetal development but also occurs following infarction. Others have demonstrated that a-MHC, but not B-MHC, is significantly up-regulated following exercise training in rats [117]. Exercise is known to alter gene expression in the rat heart [198, 345]. The current study confirms that exercise also increases t-PA mRNA expression throughout both infarcted and non-infarcted hearts. These observations are consistent with previous clinical findings demonstrating that exercise increases t-PA antigen and activity in the circulation [345, 346]. Of note, it appears that it is primarily physiological rather than pathological hypertrophic stimuli that is responsible for significant induction of t-PA expression, synthesis and secretion [347]. This may help explain why rats in the exercise groups demonstrated increased cardiac t-PA levels, while t-PA levels in the sedentary acute Ml group were not elevated compared to sham-operated sedentary controls. Furthermore, an additional mRNA band observed in the exercise trained groups was absent from sham-operated and infarcted sedentary rat hearts. Sequence homology analysis determined this band to be homologous with t-PA. Thus, it is possible that exercise induces the expression of an additional t-PA splice variant, as previously noted with expression of other factors such as vascular endothelial growth factor (VEGF) and insulin-like growth factor 1 (IGF-1) [348, 349]. It is plausible that the additional t-PA isoform may be responsible for the increase of total t-PA levels present in the myocardium and circulation. Stimulation of isolated cardiomyocytes with ISO, an agent known to induce cardiomyocyte hypertrophy both in vivo and in vitro [350, 351], also demonstrated an accumulation of inducible 183 Cardiac Control Acute Ischemia Acute Ml Chronic Ml Rupture H&E TRI > • n 7 H jHBHjjHHH H B H H | IgG tPA !•• « PAI-1 • M B H H M h H I I H B * ^ E m H H N H M H M E 'IMHHHHRHHMr V N 1 Figure 7-8. Local izat ion of t -PA, PAI-1 and VN at si tes of myocardial injury. H&E staining demonstrated tissue morphology and Masson's Trichrome (TRI) areas of collagen deposition. Immunohistochemical staining demonstrated an accumulation of t-PA, PAI-1 and VN in the myocardium with severity of infarction, t-PA staining was present at sites of acute Ml and at sites of cardiac rupture. PAI-1 and VN staining localized initially at sites of myocardial ischemia and progressively accumulated at sites of acute and chronic Ml. Staining for VN was also evident at sites cardiac rupture. Scale bar = 300 pm. 184 intracellular t-PA. Confocal microscopy of adult rat cardiomyocytes demonstrated ISO-stimulated, time-dependent secretion of t-PA localized in apparent secretory granules. Although vesicular storage and secretion of t-PA in cardiomyocytes is a possibility, additional experiments confirming this phenomenon are required. Moreover, ISO stimulation of neonatal cardiomyocytes in vitro demonstrated the colocalization of t-PA with GLUT-4 suggesting that t-PA may be secreted in a fashion similar to other storage proteins [349, 351] . The trafficking of GLUT-4 in various cell types is accomplished via a regulated secretory pathways including in cardiomyocytes [352]. Thus, it is probable that cardiomyocyte-derived t-PA traffics via the regulated secretory pathway, similar to that of GLUT-4. Although t-PA is expressed by various known cell types [352, 353], our data suggest that a certain quantity of t-PA can be attributed to the heart muscle itself, particularly when stimulated by exercise training. Interestingly, exercise increases circulating t-PA levels, while simultaneously reducing PAI-1, hence reducing the risk of repeat coronary thrombosis [147, 354]. The concept that impaired plasma fibrinolytic activity is associated with low t-PA activity due to elevated plasma PAI-1 levels and is a risk factor for IHD has been strongly supported by numerous studies [147, 169]. PAI-1 promotes thrombosis and its persistence is a critical determinant in the fibrotic reorganization of the thrombi by inhibiting plasmin-mediated degradation of fibrin and other E C M proteins through MMPs [169, 189, 355, 356]. Thrombi will ultimately prevent revascularization of ischemic myocardium and may also contribute to the increased incidence of reinfarction in patients with impaired fibrinolysis [357, 358]. Reports suggest that impaired thrombolysis of t-PA deficient or PAI-1 overexpressing mice can be completely restored using adenoviral-mediated gene transfer of recombinant t-PA [359]. Thus, increased expression of t-185 PA can promote thrombus dissolution restoring myocardial flow, potentially averting Ml. We have demonstrated that exercise influences increase of cardiac t-PA levels due to elevated cardiomyocyte synthesis. Whether cardiomyocyte derived t-PA contributes to the systemic t-PA population promoting thrombolysis at sites of vascular occlusion is unclear. However, it is feasible that exercise training may not just influence ventricular remodeling post-MI but also improve the fibrinolytic potential of the heart [360, 361]. Blood samples were not available from the original experiments so we could not examine the relative contribution of t-PA secreted from cardiomyocytes, vessel wall endothelium and that from the systemic circulation. However, it is likely that t-PA from all sources contributes by attempting to regulate the overwhelming pathological effects of PAI-1 in the myocardium [118, 131, 358]. In addition, it is evident that u-PA has a major function in ventricular remodeling [118, 277], and therefore it is also crucial to investigate the effects of exercise training on u-PA expression in the heart. A central component of post-MI remodeling is tissue fibrosis which leads to compromised cardiac function and heart failure [131,216]. Cardiac t-PA expression may play an essential role in the wound healing response to Ml by stimulating plasmin-dependent fibrin degradation. In addition to increased t-PA expression in the infarcted LVs, we also observed increased accumulation of PAI-1, and its binding cofactor V N , that co-localized at sites of infarction and fibrosis (Figure 7-8). Increased PAI-1 levels post-MI contribute to the development of cardiac tissue fibrosis probably by preventing E C M turnover by inhibiting PAs [216, 362]. Increased synthesis and secretion of t-PA into the E C M , collectively with u-PA, MMPs and other proteases derived from infiltrating mononuclear and various myocardial cells render an important role in remodeling of the infarcted myocardium 186 [363]. E C M remodeling post-MI is a complex process that involves activation of cytokines, MMP/plasmin systems and synthesis of fibrin and collagen. Collagen accumulation is more profound in t-PA-deficient animals when compared to WT mice in models of lung and skin fibrosis [180, 205, 364]. Thus, it is also probable that insufficient t-PA reduces fibrinolysis and can contribute to enhanced collagen accumulation in the infarcted myocardium. This process may occur by means of one or multiple mechanisms: 1) increase in fibrin deposition may increase fibroblast proliferation and migration; 2) by serving as a reservoir for growth factors increase in fibrin can promote E C M protein synthesis; 3) by reducing plasmin-mediated activation of MMPs. Consequently, increased exercise-induced cardiomyocyte t-PA expression post-MI can avert excessive accumulation of collagen, thus preventing tissue stiffness and ventricular dysfunction which leads to heart failure [180]. In addition, cardiomyocyte-derived t-PA-mediated proteolysis could facilitate the infiltration of other cells required for wound healing [180] including endothelial cells and fibroblasts [58, 117, 365]. Thus, it is possible that induction of t-PA expression by cardiomyocytes at sites of post-MI injury prevents fibrin accumulation and promotes MMP-dependent proteolysis resulting in favourable remodeling and improved cardiac function. These findings are likely secondary to release of acute inflammatory mediators that increase vascular permeability and plasma VN exudate into the tissues, together with stimulation of PAI-1 biosynthesis by activated endothelial cells or cardiomyocytes [365]. Only negligible PAI-1 and VN were noted in the LV of the sham-sedentary group, as well as in the non-infarcted RV of the sedentary acute Ml group. However, VN commonly accumulates at sites of tissue injury where it can be bind PAI-1 promoting its activity. The increased presence of PAI-1 and VN in the infarcted LV of sedentary mice are likely responsible for 187 increased tissue fibrosis. Therefore, a balance between t-PA, PAI-1 and VN is critical in the acute and chronic healing process following Ml. In the acute post-MI period, cardiomyocytes produce t-PA in an acute attempt to remodel the interstitium, while PAI-1 limits tissue proteolysis and prevents cardiac rupture by inhibiting both cardiomyocyte t-PA and u-PA secreted by infiltrating leukocytes [117, 212]. We speculate that VN facilitates PAI-1 deposition in damaged tissues promoting its inhibitory activity against t-PA, thereby augmenting fibrosis. Thus, timely intervention with controlled, sustained regular exercise following Ml may increase t-PA levels in the peri-infarct region thereby limiting myocardial fibrosis and improving cardiac function. 7.5 Conclusions In conclusion, we found that exercise trained rats exhibited increased cardiac t-PA levels compared to sedentary animals, with a more significant increase evident following Ml. In accordance with previous studies [68] t-PA mRNA levels were also enhanced in exercised rats, both sham-operated and post-MI. The lack of a major increase of t-PA staining in sedentary-MI rats suggests that t-PA gene expression was predominantly related to exercise and not ischemia, however the greater increase in infarcted, exercised rat hearts suggest a synergistic effect. It is plausible that increases in circulating and tissue t-PA following exercise may be regulated by the PA/plasmin system, and more specifically via V N . Thus, exercise-induced t-PA gene expression leading to increased t-PA production by cardiomyocytes may promote favorable ventricular remodeling by reducing post-MI cardiac fibrosis. Furthermore, we have demonstrated that adult rat cardiomyocytes 188 are capable of inducible synthesis and storage of t-PA, particularly when subjected to hypertrophic stimuli. 7.6 Additional Considerations It is probable that exercise attributed not only to increased t-PA levels but also to a reduction of PAI-1. Immunohistochemistry for PAI-1 showed a decrease in PAI-1 staining in exercised Ml hearts when compared to sedentary. However, PAI-1 is regulated at multiple levels including stimulation/inhibition by inflammatory cytokines as well as by VN in the plasma and E C M . Examination of circulating t-PA, PAI-1 and VN levels and activity post-MI would lead to understanding the {therapeutic benefits of exercise. However, since the original study was completed in 1994, there was a significant lack of experimental tissue available while remaining available tissue was excessively degraded and sufficient data was not obtained. Thus we did not investigate the influence of PAI-1 on t-PA levels or other components of the fibrinolytic system. Additionally, tissue used for the experiments described above was derived from rat hearts which have undergone exercise training for six weeks post-MI. It would be of interest to investigate the effects various durations and frequencies of exercise required for an increase in cardiomyocyte t-PA. Another crucial aspect which remains unanswered at the present time is whether cardiomyocyte-derived t-PA contributes to total plasma t-PA. By determining whether cardiomyocyte t-PA enters into circulation would decipher its involvement in maintaining elevated fibrinolytic activity in addition to the potential role in post-MI wound healing. 189 Although much remains to be answered about the attribution of cardiomyocytes to t-PA synthesis particularly in regulation of post-MI wound healing, it is recognized that exercise significantly increased t-PA levels. Further work must be undertaken to better understand the means by which t-PA synthesis, storage and secretion is regulated in cardiomyocytes. 190 CHAPTER VIII CONCLUSIONS AND FUTURE DIRECTIONS During the course of my graduate studies, I have had the opportunity to investigate the effects of VN on hypoxic and ischemic injury both, in vitro and in vivo. Specifically, I have had the privilege to investigate the role of VN in regulation of intracellular and extracellular protein interactions, exploring mechanisms associated with regulation of cardiomyocyte contractility and pursue its function in myocardial healing post-MI. Although much has been established about the contributions of VN in various pathological states, prior to the commencement of my studies little was understood regarding the role of VN following ischemic injury and post-MI wound healing. To date, limited work is published on the involvement of VN in cell function and post-MI cardiac remodeling. My study made the first attempt to verify the role of VN in the heart, particularly its interactions with sarcomeric proteins, as well as regulation of the PA/plasmin and MMP systems following infarction. Work completed over the last five years has allowed me to elucidate the role of VN in Ml. Particularly I tried to gain novel insight into the function of VN at the molecular, cellular and tissue levels in inhibiting cardiomyocyte function and adaptation during the complex process of tissue remodeling. We have made significant strides towards comprehending how VN is involved in regulating processes modulating myocardium healing following ischemic injury. My studies have contributed to several facets of scientific knowledge and have exhibited potential clinical significance which has resulted.in obtaining of a provisional patent (US60/836,932). Furthermore, our additional finding related to the healing of the myocardium following infarction 191 focused on the expression of t-PA in cardiomyocytes, particularly when challenged by physical stimuli. Our work for the first time demonstrated that t-PA is expressed by cardiomyocytes especially following the induction of exercise. These studies which served as a stepping stone and went hand-in-hand with studies exploring the effects of VN in post-MI wound healing, as we recognized a potentially vital relationship between VN and regulation of PA/plasmin system. Thus, our studies have provided novel evidence that VN is an important component in regulation of contractility in compromised adult cardiomyocytes which is associated with the binding of IF proteins. Moreover, we recognized that VN exhibits adverse effects in the healing process following Ml as demonstrated in VN null mice over a period of 60 days. Additionally, based on our findings we propose mechanisms by which VN commands post-MI remodeling. A proposed model summarizing the effects of VN in regulating cell function (intracellular) and E C M remodeling (extracellular) are presented in Figure 8-1. 192 Figure 8-1. Schematic model of VN in regulation of cardiomyocyte contractility and ECM remodeling. At sites of myocardial ischemia VN enters damaged cardiomyocyte and binds to desmin IF. By binding to desmin VN disrupts sarcomeric machinery inhibiting cell contractility. Influx of VN from plasma into the E C M causes binging to PAI-1, inhibiting t-PA and u-PA which in-turn prevent the generation of plasmin. Reduction in plasmin prevents activation of pro-MMP which in-turn can reduce intracellular and extracellular degradation. Additionally, by binding to integrins and/or uPAR on the cell surface, VN stimulate various signaling pathways which are involved in adhesion, migration, proliferation and contractility. 193 Contributions to Scientific Knowledge 1. VN localizes at sites of ischemic heart damage, a. Intracellularly; binding to the desmin IF cytoskeleton b. Extracellularly; binding to proteins in the E C M 2. Entry of VN into hypoxic cardiomyocytes occurs by: a. energy-independent diffusion of permeabilized sarcolemma and/or b. energy-dependent process 3. VN binds desmin IF with a high affinity 4. VN significantly impairs in vitro cardiomyocyte contractility under hypoxic conditions 5. VN- / - mice display reduced collagen deposition in the infarcted LV 28 days post-MI 6. Normal and infarcted VN- / - mice exhibit comparable cardiac geometry to those of WT mice 7. VN- / - mice exhibit a reduction in neo-vessel formation at 7 and 28 days post-MI 8. VN- / - mice exhibit reduced inflammatory cell infiltration 3 days post-MI 9. VN- / - mice exhibit reduced t-PA, u-PA and PAI-1 mRNA expression particularly at 3 and 7 days post-MI 10. VN- / - mice exhibit increased protein levels of t-PA and decreased expression of PAI-1 11. VN- / - exhibit trivial differences in MMP-2 and MMP-9 activity compared to infarcted WT mice 12. Adult cardiomyocytes are capable of t-PA expression, storage and secretion 194 13. Exercise training allows for increased cardiomyocyte t-PA expression particularly following Ml 8.2 Strategies for Future Directions 1. Investigate the specific region on desmin responsible for the binding interactions with V N . To identify the specific binding region(s) on desmin responsible for binding VN we have designed 3 specific peptide sequences from the N-terminus of desmin (Figure 8-2). These peptides were designed based on the previously published studies identifying the region on vimentin responsible for binding V N , which shares over 80% sequence homology to that of desmin. We will perform binding assays in which high-affinity 96 well plates with be coated with purified human desmin at a constant concentration or with blocking buffer containing BSA overnight at 4°C. Wells will then be incubated with either purified human biotinylated-VN (at constant concentration), a mixture of biotinylated-VN with desmin peptide (variable concentrations), or a scrambler peptide as control. These experiments will allow us to determine whether such engineered specific peptides are able to inhibit VN binding to desmin IF. 195 PEPTIDE 1 (25aa) I PEPTIDE 2 (27aa) I PEPTIDE 3 (26aa) msqaysssqrvssyrrtfggapgfsl V / ; p v f p r a g f g t k g s s s s m t s r v y q v s r t s g g a g g l g s Figure 8-2. Construction of human desmin peptides and identification of the VN-binding site on the N-terminus of desmin. Schematic representation of peptides generated from human desmin of N-terminus domain used to investigate the specific binding site for V N . The N-terminal region of desmin, shares over 80% homology with vimentin IF, containing a non-a-helical domain with two motifs crucial for filament assembly. Peptide 1 (yellow) is composed of the first 25 amino acids and contains nonameric sequence S S Y R R T F G G . Peptide 2 (green) is 27 amino acid and Peptide 3 (blue) 26 amino acids in length. Peptides 2 and 3 contain an arginine and proline-rich region known as the RP-box. 196 2. Investigate the interaction of VN with integrin and uPAR at sites of myocardial ischemia and infarction. Specific integrins are implicated in mediating adhesion and functional activation of many different types of cells by binding to E C M proteins. Interactions of various integrins with different E C M proteins regulate homing, secretion and distribution of these cells in the tissue. We would like to examine the effects of VN on integrin expression and integrin regulated adhesion, migration and differentiation of inflammatory, endothelial progenitor, fibroblasts. We propose investigating the VN-integrin interactions by immunofluorescence staining and evaluate the distribution by confocal laser scanning microscopy. This data will provide a morphological correlate to previously reported functional studies, demonstrating the distribution of selected integrins during E C M adhesion at sites of infarction. 3. Investigate the effects on VN on cell signaling pathways. FN exerts a strong angiogenic influence on endothelial cells which is mediated through the a5B1 and avB3 integrins via mitogen-activated protein (MAP) kinase signaling [366]. We would like to investigate whether VN also plays an active part in cell signaling enlisting an angiogenic response post-MI. To analyze the specific signaling pathways involved in angiogenesis that are stimulated by VN through interactions with specific integrins we propose in vitro experiments in which cells are treated with different pathway inhibitors to evaluate their effects. 197 4. Investigate the effects of VN on remodeling of the non-infarcted myocardium. It is well known that following Ml functionally distinct cardiac regions exhibit distinct mRNA and protein profile [367]. To have a more complete understanding of VN function on post-MI remodeling we propose further studies using the viable, non-infarcted portion of LV. Experiments should follow a similar protocol to these performed on infarcted LV. Specifically, we would like to explore the PA and PAI-1 levels, as well as levels and activity of MMPs and its inhibitors in the non-infarcted myocardium using protein and activity assays. Additionally, we would also determine mRNA levels of genes associated with E C M remodeling and hypertrophy. 5. Investigate the effects of VN on stem cell migration and homing in the infarcted myocardium. There is growing evidence that stem cells promote regeneration of myocardium following Ml. We have performed pilot experiments in which chimeric mice expressed green fluorescent protein (GFP) positive peripheral blood leukocytes and were then subjected to LAD ligation to examine post-MI stem cell distribution. Preliminary data from infarcted WT mice revealed an accumulation of GFP-positive stem cells in the infarcted regions of LV rich in VN at 14 days post-MI (Figure 8-3). It is well established that VN has a major role in cell adhesion and migration. We have found that VN accumulates in areas of ischemia and infarction. Thus, we propose to analyze the precise role of VN in adhesion, proliferation and homing of stem cells and in repair of the infarcted myocardium. We propose investigating stem cell distribution in both, chimeric WT and VN- / - mice post-MI by visualizing the cells by confocal microscopy. By staining for cardiac-specific 198 proteins such as troponin I, connexin 43 and actin we can determine whether VN promotes cell proliferation into cardiomyocyte-like phenotype. Furthermore, echocardiography would be used to establish whether VN promotes regeneration of damaged myocardium and improves cardiac function. 199 Normal LV Nuclei (blue) 50 u.m 14 Post-Infarction LV GFP-Stem Cells (green) Infarct Zone Peri-infarct Zone •4 • \ ^ VN Deposits (red) in Infarct .GFP-Stem Cells (green) Figure 8-3. Bone marrow cel ls migrate to a VN-r ich infarct region at 14 days post-MI. Normal (left panel) and infarcted (right panel) myocardium of chimeric WT mice expressing green fluorescent protein (GFP)-positive bone-marrow cells (green) stained for VN (red) and nuclei (blue). 14 days post-MI GFP-positive bone-marrow cells accumulated in the VN-rich region of infarcted myocardium. Only trivial amounts of G F P positive bone-marrow cells were present in the non-infarcted myocardium. Scale bar = 50 pm. 200 8.3 Final Remarks In summary, over the course of my graduate studies I have attempted to explore the role of VN with respect to ventricular remodeling in the event of Ml . Specifically, my research focused on investigating the effects of VN and its influence on the PA/plasmin and MMP systems in post-MI wound healing. The findings acquired thorough my investigations provided new insights into the cellular mechanisms of regulation contractility at sites of ischemia and infarction. Further investigation VN regulation of the PA/plasmin and MMP systems as well as of purpose of VN-desmin interactions, will hopefully provide a better understanding of the post-MI wound healing process and provide insights into the pathobiology of heart failure. I hope that this newly acquired knowledge can have an impact on future strategies in advancing therapies for the treatment of ischemic heart disease and prevention of heart failure. 201 CHAPTER IX BIBLIOGRAPHY 1. Cardiovascular disease: prevention and control. In. World Health Organization (WHO); 2003. 2. Atlas of Heart Disease and Stroke. In.: World Health Organization (WHO); 2004: 112. 3. 2004 QuickFacts. In.: Heart and Stroke Foundation of Canada; 2004. 4. Cotran R S , Kumar V, Collins T, Robbins SL: Robbins pathologic basis of disease, 6th edn. Philadelphia: Saunders; 1999. 5. American Heart Association - Heart and Stroke facts: 2002 statistical supplement. In. Dallas: American Heart Association; 2002. 6. Hellermann J P , Goraya TY, Jacobsen S J , Weston SA, Reeder G S , Gersh BJ , Redfield MM, Rodeheffer R J , Yawn BP, Roger VL: Incidence of heart failure after myocardial infarction: is it changing over time? Am J Epidemiol 2003, 157(12):1101-1107. 7. Reimer KA, Jennings RB, Tatum A H : Pathobiology of acute myocardial ischemia: metabolic, functional and ultrastructural studies. Am J Cardiol 1983, 52(2):72A-81A. 8. Kloner RA, Fishbein MC, Hare C M , Maroko PR: Early ischemic ultrastructural and histochemical alterations in the myocardium of the rat following coronary artery occlusion. Exp Mol Pathol 1979, 30(2): 129-143. 9. Bouchardy B, Majno G: Histopathology of early myocardial infarcts. A new approach. Am J Pathol 1974, 74(2):301-330. 10. Antman E M , Kereiakes DJ: Antithrombotic therapy in unstable angina/non-ST elevation myocardial infarction: the evolving role of low-molecular-weight heparin. J Invasive Cardiol 2000, 12 Suppl E:E1-4;discussion E25-28. 11. Antman E M , Anbe DT, Armstrong PW, Bates ER, Green LA, Hand M, Hochman J S , Krumholz HM, Kushner F G , Lamas GA et al: A C C / A H A guidelines for the management of patients with ST-elevation myocardial infarction; A report of the American College of Cardiology/American Heart Association Task Force on Practice Guidelines (Committee to Revise the 1999 Guidelines for the Management of patients with acute myocardial infarction). J Am Coll Cardiol 2004, 44(3):E1-E211. 12. Antman E M , Fox K M : Guidelines for the diagnosis and management of unstable angina and non-Q-wave myocardial infarction: proposed revisions. International Cardiology Forum. Am Heart J 2000, 139(3):461-475. 13. Buja LM: Myocardial ischemia and reperfusion injury. Cardiovasc Pathol 2005, 14(4):170-175. 202 14. Hoffman JW, Jr., Gilbert TB, Poston R S , Silldorff E P : Myocardial reperfusion injury: etiology, mechanisms, and therapies. J Extra Corpor Technol 2004, 36(4):391-411. 15. Kloner RA, Ganote C E , Whalen DA, Jr., Jennings RB : Effect of a transient period of ischemia on myocardial cells. II. Fine structure during the first few minutes of reflow. Am J Pathol 1974, 74(3):399-422. 16. Eefting F, Rensing B, Wigman J , Pannekoek W J , Liu W M , Cramer MJ , Lips DJ , Doevendans PA: Role of apoptosis in reperfusion injury. Cardiovasc Res 2004, 61 (3):414-426. 17. Brennan J : Reperfusion injury of cardiac myocytes: mechanisms, treatment, and implications for advanced practice nursing. AACN Clin Issues 2000, 11(2):252-260. 18. Eaton LW, Bulkley BH: Expansion of acute myocardial infarction: its relationship to infarct morphology in a canine model. Circ Res 1981, 49(1):80-88. 19. Hochman J S , Bulkley BH : Expansion of acute myocardial infarction: an experimental study. Circulation 1982, 65(7):1446-1450. 20. Korup E, Dalsgaard D, Nyvad O, Jensen TM, Toft E, Berning J : Comparison of degrees of left ventricular dilation within three hours and up to six days after onset of first acute myocardial infarction. Am J Cardiol 1997, 80(4):449-453. 21. Cannon RO, 3rd, Butany JW, McManus B M , Speir E, Kravitz A B , Bolli R, Ferrans V J : Early degradation of collagen after acute myocardial infarction in the rat. Am J Cardiol 1983, 52(3):390-395. 22. Holmes JW, Yamashita H, Waldman LK, Covell JW: Scar remodeling and transmural deformation after infarction in the pig. Circulation 1994, 90(1):411-420. 23. Pfeffer MA, Braunwald E, Moye LA, Basta L, Brown E J , Jr., Cuddy TE , Davis BR, Geltman E M , Goldman S, Flaker G C et al: Effect of captopril on mortality and morbidity in patients with left ventricular dysfunction after myocardial infarction. Results of the survival and ventricular enlargement trial. The S A V E Investigators. N EnglJ Med 1992, 327(10):669-677. 24. GISSI-3: effects of lisinopril and transdermal glyceryl trinitrate singly and together on 6-week mortality and ventricular function after acute myocardial infarction. Gruppo Italiano per lo Studio della Sopravvivenza neH'infarto Miocardico. Lancet 1994, 343(8906):1115-1122. 25. Ertl G , Frantz S: Healing after myocardial infarction. Cardiovasc Res 2005, 66(1):22-32. 203 26. Anversa P, Olivetti G, Capasso J M : Cellular basis of ventricular remodeling after myocardial infarction. Am J Cardiol 1991, 68(14):7D-16D. 27. Gaudron P, Eilles C, Kugler I, Ertl G: Progressive left ventricular dysfunction and remodeling after myocardial infarction. Potential mechanisms and early predictors. Circulation 1993, 87(3):755-763. 28. Grossman W, Jones D, McLaurin LP: Wall stress and patterns of hypertrophy in the human left ventricle. J Clin Invest 1975, 56(1):56-64. 29. Hirose K, Shu NH, Reed J E , Rumberger JA: Right ventricular dilatation and remodeling the first year after an initial transmural wall left ventricular myocardial infarction. Am J Cardiol 1993, 72(15): 1126-1130. 30. Raya TE, Gaballa M, Anderson P, Goldman S: Left ventricular function and remodeling after myocardial infarction in aging rats. Am J Physiol 1997, 273(6 Pt 2):H2652-2658. 31. Pfeffer MA, Braunwald E: Ventricular remodeling after myocardial infarction. Experimental observations and clinical implications. Circulation 1990, 81(4):1161-1172. 32. Pfeffer MA, Pfeffer J M , Fishbein MC, Fletcher P J , Spadaro J , Kloner RA, Braunwald E: Myocardial infarct size and ventricular function in rats. Circ Res 1979,44(4):503-512. 33. Fishbein MC, Maclean D, Maroko PR: Experimental myocardial infarction in the rat: qualitative and quantitative changes during pathologic evolution. Am J Pathol 1978, 90(1):57-70. 34. Lutgens E, Daemen MJ , de Muinck ED, Debets J , Leenders P, Smits JF : Chronic myocardial infarction in the mouse: cardiac structural and functional changes. Cardiovasc Res 1999, 41(3):586-593. 35. Weisman HF, Bush DE, Mannisi JA, Bulkley BH: Global cardiac remodeling after acute myocardial infarction: a study in the rat model. J Am Coll Cardiol 1985, 5(6):1355-1362. 36. Litwin S E , Litwin C M , Raya TE, Warner AL, Goldman S: Contractility and stiffness of noninfarcted myocardium after coronary ligation in rats. Effects of chronic angiotensin converting enzyme inhibition. Circulation 1991, 83(3):1028-1037. 37. Mitchell GF , Lamas GA, Vaughan DE, Pfeffer MA: Left ventricular remodeling in the year after first anterior myocardial infarction: a quantitative analysis of contractile segment lengths and ventricular shape. J Am Coll Cardiol 1992, 19(6): 1136-1144. 38. Pfeffer J M , Pfeffer MA, Fletcher P J , Braunwald E: Progressive ventricular remodeling in rat with myocardial infarction. Am J Physiol 1991, 260(5 Pt 2):H1406-1414. 204 39. Weber KT, Janicki J S , Shroff S G , Pick R, Chen R M , Bashey Rl : Collagen remodeling of the pressure-overloaded, hypertrophied nonhuman primate myocardium. Circ Res 1988, 62(4):757-765. 40. Brown RD, Ambler SK, Mitchell MD, Long C S : The cardiac fibroblast: therapeutic target in myocardial remodeling and failure. Annu Rev Pharmacol Toxicol 2005, 45:657-687. 41. Weber KT, Brilla C G , Campbell S E , Zhou G, Matsubara L, Guarda E: Pathologic hypertrophy with fibrosis: the structural basis for myocardial failure. Blood Press 1992, 1(2):75-85. 42. Gaballa MA, Goldman S: Ventricular remodeling in heart failure. J Card Fail 2002, 8(6 Suppl):S476-485. 43. Teiger E, Than VD, Richard L, Wisnewsky C, Tea BS, Gaboury L, Tremblay J , Schwartz K, Hamet P: Apoptosis in pressure overload-induced heart hypertrophy in the rat. J Clin Invest 1996, 97(12):2891-2897. 44. Volders P G , Willems IE, Cleutjens J P , Arends JW, Havenith MG, Daemen MJ : Interstitial collagen is increased in the non-infarcted human myocardium after myocardial infarction. J Mol Cell Cardiol 1993, 25(11 ):1317-1323. 45. Koudssi F, Lopez J E , Villegas S, Long C S : Cardiac fibroblasts arrest at the G1/S restriction point in response to interleukin (IL)-1beta. Evidence for IL-1 beta-induced hypophosphorylation of the retinoblastoma protein. J Biol Chem 1998, 273(40):25796-25803. 46. Gallin J l G R , Snyderman R: Inflammation: Basic Principles and Clinical Correlates, vol. Wound Repair, 2nd edn: Raven Press; 1992. 47. Brown RD MM, Long C S : Interstitial Fibrosis in Heart Disease: Proinflammatory cytokines and cardiac extracellular matrix: regulation of fibroblast phenotype. New York: Springer; 2004. 48. Sun Y, Weber KT: Infarct scar: a dynamic tissue. Cardiovasc Res 2000, 46(2):250-256. 49. Weber KT: Extracellular matrix remodeling in heart failure: a role for de novo angiotensin II generation. Circulation 1997, 96(11):4065-4082. 50. Sutton M G , Sharpe N: Left ventricular remodeling after myocardial infarction: pathophysiology and therapy. Circulation 2000, 101(25):2981-2988. 51. Griendling KK, Sorescu D, Ushio-Fukai M: NAD(P)H oxidase: role in cardiovascular biology and disease. Circ Res 2000, 86(5):494-501. 52. Dhalla AK, Hill MF, Singal PK: Role of oxidative stress in transition of hypertrophy to heart failure. J Am Coll Cardiol 1996, 28(2):506-514. 205 53. Wagner A H , Kohler T, Ruckschloss U, Just I, Hecker M: Improvement of nitric oxide-dependent vasodilatation by HMG-CoA reductase inhibitors through attenuation of endothelial superoxide anion formation. Arterioscler Thromb Vase Biol 2000, 20(1):61-69. 54. Hernandez-Perera O, Perez-Sala D, Navarro-Antolin J , Sanchez-Pascuala R, Hernandez G, Diaz C, Lamas S: Effects of the 3-hydroxy-3-methylglutaryl-CoA reductase inhibitors, atorvastatin and simvastatin, on the expression of endothelin-1 and endothelial nitric oxide synthase in vascular endothelial cells. J Clin Invest 1998, 101 (12):2711-2719. 55. Doughty R N , Whalley GA, Gamble G , MacMahon S, Sharpe N: Left ventricular remodeling with carvedilol in patients with congestive heart failure due to ischemic heart disease. Australia-New Zealand Heart Failure Research Collaborative Group. J Am Coll Cardiol 1997, 29(5):1060-1066. 56. Khattar R S , Senior R, Soman P, van der Does R, Lahiri A: Regression of left ventricular remodeling in chronic heart failure: Comparative and combined effects of captopril and carvedilol. Am Heart J 2001, 142(4)704-713. 57. Radovancevic B, Vrtovec B, Frazier OH: Left ventricular assist devices: an alternative to medical therapy for end-stage heart failure. Curr Opin Cardiol 2003, 18(3):210-214. 58. Kocher AA, Schuster MD, Szabolcs MJ , Takuma S, Burkhoff D, Wang J , Homma S, Edwards NM, Itescu S: Neovascularization of ischemic myocardium by human bone-marrow-derived angioblasts prevents cardiomyocyte apoptosis, reduces remodeling and improves cardiac function. Nat Med 2001, 7(4):430-436. 59. Yoo KJ , Li RK, Weisel RD, Mickle DA, Li G, Yau TM: Autologous smooth muscle cell transplantation improved heart function in dilated cardiomyopathy. Ann Thorac Surg 2000, 70(3):859-865. 60. Jain M, DerSimonian H, Brenner DA, Ngoy S, Teller P, Edge A S , Zawadzka A, Wetzel K, Sawyer DB, Colucci W S et al: Cell therapy attenuates deleterious ventricular remodeling and improves cardiac performance after myocardial infarction. Circulation 2001, 103(14):1920-1927. 61. Li RK, Jia ZQ, Weisel RD, Mickle DA, Zhang J , Mohabeer MK, Rao V, Ivanov J : Cardiomyocyte transplantation improves heart function. Ann Thorac Surg 1996, 62(3):654-660; discussion 660-651. 62. Connold AL, Frischknecht R, Dimitrakos M, Vrbova G: The survival of embryonic cardiomyocytes transplanted into damaged host rat myocardium. J Muscle Res Cell Motil 1997, 18(1):63-70. 63. Watanabe E, Smith DM, Jr., Delcarpio JB , Sun J , Smart FW, Van Meter C H , Jr., Claycomb W C : Cardiomyocyte transplantation in a porcine myocardial infarction model. Cell Transplant 1998, 7(3):239-246. 206 64. Zhang M, Methot D, Poppa V, Fujio Y, Walsh K, Murry C E : Cardiomyocyte grafting for cardiac repair: graft cell death and anti-death strategies. J Mol Cell Cardiol 2001, 33(5):907-921. 65. Hayman E G , Pierschbacher MD, Ohgren Y, Ruoslahti E: Serum spreading factor (vitronectin) is present at the cell surface and in tissues. Proc Natl Acad Sci USA 1983, 80(13):4003-4007. 66. Preissner KT: Structure and biological role of vitronectin. Annu Rev Cell Biol 1991,7:275-310. 67. Deng G, Curriden SA, Hu G, Czekay R P , Loskutoff DJ : Plasminogen activator inhibitor-1 regulates cell adhesion by binding to the somatomedin B domain of vitronectin. J Cell Physiol 2001, 189(1):23-33. 68. Declerck P J , De Mol M, Alessi MC, Baudner S, Paques E P , Preissner KT, Muller-Berghaus G, Collen D: Purification and characterization of a plasminogen activator inhibitor 1 binding protein from human plasma. Identification as a multimeric form of S protein (vitronectin). J Biol Chem 1988, 263(30):15454-15461. 69. Seiffert D, Loskutoff DJ: Evidence that type 1 plasminogen activator inhibitor binds to the somatomedin B domain of vitronectin. J Biol Chem 1991, 266(5):2824-2830. 70. Sawa H, Lundgren C, Sobel BE, Fujii S: Increased intramural expression of plasminogen activator inhibitor type 1 after balloon injury: a potential progenitor of restenosis. J Am Coll Cardiol 1994, 24(7): 1742-1748. 71. Lupu F, Bergonzelli G E , Heim DA, Cousin E, Genton C Y , Bachmann F, Kruithof EK: Localization and production of plasminogen activator inhibitor-1 in human healthy and atherosclerotic arteries. Arterioscler Thromb 1993, 13(7):1090-1100. 72. Kono S, Rao J S , Bruner J M , Sawaya R: Immunohistochemical localization of plasminogen activator inhibitor type 1 in human brain tumors. J Neuropathol Exp Neurol 1994, 53(3):256-262. 73. Akama T, Yamada KM, Seno N, Matsumoto I, Kono I, Kashiwagi H, Funaki T, Hayashi M: Immunological characterization of human vitronectin and its binding to glycosaminoglycans. J Biochem (Tokyo) 1986, 100(5):1343-1351. 74. Gebb C, Hayman E G , Engvall E, Ruoslahti E: Interaction of vitronectin with collagen. J Biol Chem 1986, 261 (35):16698-16703. 75. Barnes DW, Reing J E , Amos B: Heparin-binding properties of human serum spreading factor. J Biol Chem 1985, 260(16):9117-9122. 76. Preissner KT, Grulich-Henn J , Ehrlich HJ , Declerck P, Justus C, Collen D, Pannekoek H, Muller-Berghaus G: Structural requirements for the 207 extracellular interaction of plasminogen activator inhibitor 1 with endothelial cell matrix-associated vitronectin. J Biol Chem 1990, 265(30):18490-18498. 77. Moser TL, Enghild J J , Pizzo SV, Stack MS: Specific binding of urinary-type plasminogen activator (u-PA) to vitronectin and its role in mediating u-PA-dependent adhesion of U937 cells. Biochem J 1995, 307 ( Pt 3):867-873. 78. Hess S, Kanse S M , Kost C, Preissner KT: The versatility of adhesion receptor ligands in haemostasis: morpho-regulatory functions of vitronectin. Thromb Haemost 1995, 74(1):258-265. 79. Huang X, Wu J , Spong S, Sheppard D: The integrin alphavbeta6 is critical for keratinocyte migration on both its known ligand, fibronectin, and on vitronectin. J Cell Sci 1998, 111 ( Pt 15):2189-2195. 80. Hintner H, Stanzl U, Dahlback K, Dahlback B, Breathnach S M : Vitronectin shows complement-independent binding to isolated keratin filament aggregates. J Invest Dermatol 1989, 93(5):656-661. 81. Podor TJ , Joshua P, Butcher M, Seiffert D, Loskutoff D, Gauldie J : Accumulation of type 1 plasminogen activator inhibitor and vitronectin at sites of cellular necrosis and inflammation. Ann N Y Acad Sci 1992, 667:173-177. 82. Minor KH, Peterson C B : Plasminogen activator inhibitor type 1 promotes the self-association of vitronectin into complexes exhibiting altered incorporation into the extracellular matrix. J Biol Chem 2002, 277(12):10337-10345. 83. Sane DC, Moser TL, Parker C J , Seiffert D, Loskutoff DJ , Greenberg C S : Highly sulfated glycosaminoglycans augment the cross-linking of vitronectin by guinea pig liver transglutaminase. Functional studies of the cross-linked vitronectin multimers. J Biol Chem 1990, 265(6):3543-3548. 84. Podack ER, Kolb W P , Muller-Eberhard HJ: The C5b-6 complex: formation, isolation, and inhibition of its activity by lipoprotein and the S-protein of human serum. J Immunol 1978, 120(6):1841-1848. 85. Ill C R , Ruoslahti E: Association of thrombin-antithrombin III complex with vitronectin in serum. J Biol Chem 1985, 260(29):15610-15615. 86. Holmes R: Preparation from human serum of an alpha-one protein which induces the immediate growth of unadapted cells in vitro. J Cell Biol 1967, 32(2):297-308. 87. Barnes DW, Silnutzer J : Isolation of human serum spreading factor. J Biol Chem 1983, 258(20): 12548-12552. 88. Kitagaki-Ogawa H, Yatohgo T, Izumi M, Hayashi M, Kashiwagi H, Matsumoto I, Seno N: Diversities in animal vitronectins. Differences in molecular weight, immunoreactivity and carbohydrate chains. Biochim Biophys Acta 1990, 1033(1 ):49-56. 208 89. Nakashima N, Miyazaki K, Ishikawa M, Yatohgo T, Ogawa H, Uchibori H, Matsumoto I, Seno N, Hayashi M: Vitronectin diversity in evolution but uniformity in ligand binding and size of the core polypeptide. Biochim BiophysActa 1992, 1120(1 ):1-10. 90. Seiffert D, Geisterfer M, Gauldie J , Young E, Podor TJ : IL-6 stimulates vitronectin gene expression in vivo. J Immunol 1995, 155(6):3180-3185. 91. Koli K, Lohi J , Hautanen A, Keski-Oja J : Enhancement of vitronectin expression in human HepG2 hepatoma cells by transforming growth factor-beta 1. Eur J Biochem 1991, 199(2):337-345. 92. Preissner KT, Wassmuth R, Muller-Berghaus G: Physicochemical characterization of human S-protein and its function in the blood coagulation system. Biochem J 1985, 231(2):349-355. 93. Roger M, Halstensen TS, Hogasen K, Mollnes TE, Solum NO, Hovig T: Platelets and vitronectin: immunocytochemical localization and platelet interaction with exogenously added vitronectin. Nouv Rev Fr Hematol 1992, 34(1):47-54. 94. Preissner KT, Holzhuter S, Justus C, Muller-Berghaus G: Identification of and partial characterization of platelet vitronectin: evidence for complex formation with platelet-derived plasminogen activator inhibitor-1. Blood 1989, 74(6):1989-1996. 95. Izumi M, Yamada KM, Hayashi M: Vitronectin exists in two structurally and functionally distinct forms in human plasma. Biochim Biophys Acta 1989, 990(2):101-108. 96. Preissner KT: Biology of Vitronectins and Their Receptors. New York: Excerpta Medica; 1993. 97. Rus HG, Niculescu F, Vlaicu R: Presence of C5b-9 complement complex and S-protein in human myocardial areas with necrosis and sclerosis. Immunol Lett 1987, 16(1): 15-20. 98. Dahlback K, Lofberg H, Dahlback B: Immunohistochemical studies on vitronectin in elastic tissue disorders, cutaneous amyloidosis, lichen ruber planus and porphyria. Acta Derm Venereol 1988, 68(2): 107-115. 99. Dahlback K, Lofberg H, Dahlback B: Immunohistochemical demonstration of vitronectin in association with elastin and amyloid deposits in human kidney. Histochemistry 1987, 87(6):511-515. 100. Zanusso GL, Moretto G, Bonetti B, Monaco S, Rizzuto N: Complement neoantigen and vitronectin are components of plaques in amyloid AL neuropathy. Ital J Neurol Sci 1992, 13(6):493-499. 101. Reilly JT, Nash JR: Vitronectin (serum spreading factor): its localisation in normal and fibrotic tissue. J Clin Pathol 1988, 41(12):1269-1272. 209 102. Suzuki S, Pierschbacher MD, Hayman E G , Nguyen K, Ohgren Y, Ruoslahti E: Domain structure of vitronectin. Alignment of active sites. J Biol Chem 1984, 259(24):15307-15314. 103. Kost C, Stuber W, Ehrlich HJ , Pannekoek H, Preissner KT: Mapping of binding sites for heparin, plasminogen activator inhibitor-1, and plasminogen to vitronectin's heparin-binding region reveals a novel vitronectin-dependent feedback mechanism for the control of plasmin formation. J Biol Chem 1992, 267(17):12098-12105. 104. Gechtman Z, Belleli A, Lechpammer S, Shaltiel S: The cluster of basic amino acids in vitronectin contributes to its binding of plasminogen activator inhibitor-1: evidence from thrombin-, elastase- and plasmin-cleaved vitronectins and anti-peptide antibodies. Biochem J 1997, 325 ( Pt 2):339-349. 105. Seger D, Gechtman Z, Shaltiel S: Phosphorylation of vitronectin by casein kinase II. Identification of the sites and their promotion of cell adhesion and spreading. J Biol Chem 1998, 273(38):24805-24813. 106. Shaltiel S, Schvartz I, Korc-Grodzicki B, Kreizman T: Evidence for an extra-cellular function for protein kinase A. Mol Cell Biochem 1993, 127-128:283-291. 107. Peterson C B , Blackburn MN: Antithrombin conformation and the catalytic role of heparin. II. Is the heparin-induced conformational change in antithrombin required for rapid inactivation of thrombin? J Biol Chem 1987, 262(16):7559-7566. 108. Rosenberg RD, Damus P S : The purification and mechanism of action of human antithrombin-heparin cofactor. J Biol Chem 1973, 248(18):6490-6505. 109. Felding-Habermann B, Cheresh DA: Vitronectin and its receptors. Curr Opin Cell Biol 1993, 5(5):864-868. 110. Delias C, Loskutoff DJ : Historical analysis of PAI-1 from its discovery to its potential role in cell motility and disease. Thromb Haemost 2005, 93(4):631-640. 111. Xue W, Mizukami I, Todd RF, 3rd, Petty HR: Urokinase-type plasminogen activator receptors associate with betal and beta3 integrins of fibrosarcoma cells: dependence on extracellular matrix components. Cancer Res 1997, 57(9):1682-1689. 112. Kjoller L, Hall A: Rac mediates cytoskeletal rearrangements and increased cell motility induced by urokinase-type plasminogen activator receptor binding to vitronectin. J Cell Biol 2001, 152(6):1145-1157. 113. Degryse B, Orlando S, Resnati M, Rabbani SA, Blasi F: Urokinase/urokinase receptor and vitronectin/alpha(v)beta(3) integrin induce chemotaxis and 210 cytoskeleton reorganization through different signaling pathways. Oncogene 2001, 20(16):2032-2043. 114. Kjoller L: The urokinase plasminogen activator receptor in the regulation of the actin cytoskeleton and cell motility. Biol Chem 2002, 383(1):5-19. 115. Zheng X, Saunders TL, Camper SA, Samuelson LC, Ginsburg D: Vitronectin is not essential for normal mammalian development and fertility. Proc Natl AcadSciUSA 1995, 92(26):12426-12430. 116. Li WY, Chong S S , Huang EY, Tuan TL: Plasminogen activator/plasmin system: a major player in wound healing? Wound Repair Regen 2003, 11(4):239-247. 117. Heymans S, Luttun A, Nuyens D, Theilmeier G, Creemers E, Moons L, Dyspersin GD, Cleutjens J P , Shipley M, Angellilo A et al: Inhibition of plasminogen activators or matrix metalloproteinases prevents cardiac rupture but impairs therapeutic angiogenesis and causes cardiac failure. Nat Med 1999, 5(10):1135-1142. 118. Heymans S, Lupu F, Terclavers S, Vanwetswinkel B, Herbert J M , Baker A, Collen D, Carmeliet P, Moons L: Loss or inhibition of uPA or MMP-9 attenuates LV remodeling and dysfunction after acute pressure overload in mice. Am J Pathol 2005, 166(1): 15-25. 119. Rickles R J , Strickland S: Tissue plasminogen activator mRNA in murine tissues. FEBS Lett 1988, 229(1): 100-106. 120. Bjorkman JA, Jem S, Jern C: Cardiac sympathetic nerve stimulation triggers coronary t-PA release. Arterioscler Thromb Vase Biol 2003, 23(6):1091-1097. 121. Bankl HC, Radaszkiewicz T, Pikula B, Baghestanian M, Mehrabi MR, Bankl H, Lechner K, Valent P: Expression of fibrinolytic antigens in redistributed cardiac mast cells in auricular thrombosis. Hum Pathol 1997, 28(11):1283-1290. 122. Salame MY, Samani NJ , Masood I, deBono DP: Expression of the plasminogen activator system in the human vascular wall. Atherosclerosis 2000, 152(1):19-28. 123. Walinski HP, Gyorffy SF , Leong HS, Slaughter GR, Dawood F, Pate G E , Liu P P , Parker TG, Podor TJ : Exercise increases tissue-type plasminogen activator expression in rat cardiomyocytes. Thromb Haemost 2006, 96(6):859-861. 124. Rickles R J , Darrow AL, Strickland S: Molecular cloning of complementary DNA to mouse tissue plasminogen activator mRNA and its expression during F9 teratocarcinoma cell differentiation. J Biol Chem 1988, 263(3): 1563-1569. 211 125. Kohnert U, Rudolph R, Verheijen J H , Weening-Verhoeff E J , Stern A, Opitz U, Martin U, Lill H, Prinz H, Lechner M et al: Biochemical properties of the kringle 2 and protease domains are maintained in the refolded t-PA deletion variant BM 06.022. Protein Eng 1992, 5(1):93-100. 126. Myohanen H, Vaheri A: Regulation and interactions in the activation of cell-associated plasminogen. Cell Mol Life Sci 2004, 61(22):2840-2858. 127. Myohanen HT, Stephens RW, Hedman K, Tapiovaara H, Ronne E, Hoyer-Hansen G, Dano K, Vaheri A: Distribution and lateral mobility of the urokinase-receptor complex at the cell surface. J Histochem Cytochem 1993, 41(9):1291-1301. 128. Chapman HA, Wei Y, Simon Dl, Waltz DA: Role of urokinase receptor and caveolin in regulation of integrin signaling. Thromb Haemost 1999, 82(2):291-297. 129. Lijnen HR: Pleiotropic functions of plasminogen activator inhibitor-1. J Thromb Haemost 2005, 3(1 ):35-45. 130. Hekman C M , Loskutoff DJ : Endothelial cells produce a latent inhibitor of plasminogen activators that can be activated by denaturants. J Biol Chem 1985, 260(21):11581-11587. 131. Takeshita K, Hayashi M, lino S, Kondo T, Inden Y, Iwase M, Kojima T, Hirai M, Ito M, Loskutoff DJ et al: Increased expression of plasminogen activator inhibitor-1 in cardiomyocytes contributes to cardiac fibrosis after myocardial infarction. Am J Pathol 2004, 164(2):449-456. 132. Dobrovolsky AB, Titaeva EV: The fibrinolysis system: regulation of activity and physiologic functions of its main components. Biochemistry (Mosc) 2002, 67(1):99-108. 133. Gibson A, Baburaj K, Day DE, Verhamme I, Shore JD, Peterson C B : The use of fluorescent probes to characterize conformational changes in the interaction between vitronectin and plasminogen activator inhibitor-1. J Biol Chem 1997, 272(8):5112-5121. 134. Deng G, Curriden SA, Wang S, Rosenberg S, Loskutoff DJ : Is plasminogen activator inhibitor-1 the molecular switch that governs urokinase receptor-mediated cell adhesion and release? J Cell Biol 1996, 134(6):1563-1571. 135. Wei Y, Eble JA, Wang Z, Kreidberg JA, Chapman HA: Urokinase receptors promote betal integrin function through interactions with integrin alpha3beta1. Mol Biol Cell 2001, 12(10):2975-2986. 136. Chapman HA, Wei Y: Protease crosstalk with integrins: the urokinase receptor paradigm. Thromb Haemost 2001, 86(1): 124-129. 212 137. Czekay R P , Aertgeerts K, Curriden SA, Loskutoff DJ : Plasminogen activator inhibitor-1 detaches cells from extracellular matrices by inactivating integrins. J Cell Biol 2003, 160(5):781-791. 138. Al-Fakhri N, Chavakis T, Schmidt-Woll T, Huang B, Cherian S M , Bobryshev YV, Lord R S , Katz N, Preissner KT: Induction of apoptosis in vascular cells by plasminogen activator inhibitor-1 and high molecular weight kininogen correlates with their anti-adhesive properties. Biol Chem 2003, 384(3):423-435. 139. Visse R, Nagase H: Matrix metalloproteinases and tissue inhibitors of metalloproteinases: structure, function, and biochemistry. Circ Res 2003, 92(8):827-839. 140. Creemers EE , Cleutjens J P , Smits JF , Daemen MJ : Matrix metalloproteinase inhibition after myocardial infarction: a new approach to prevent heart failure? Circ Res 2001, 89(3):201-210. 141. Schulz R: Intracellular targets of matrix metalloproteinase-2 in cardiac disease: rationale and therapeutic approaches. Annu Rev Pharmacol Toxicol 2007,47:211-242. 142. Sawicki G, Leon H, Sawicka J , Sariahmetoglu M, Schulze C J , Scott P G , Szczesna-Cordary D, Schulz R: Degradation of myosin light chain in isolated rat hearts subjected to ischemia-reperfusion injury: a new intracellular target for matrix metalloproteinase-2. Circulation 2005, 112(4):544-552. 143. Nagase H: Activation mechanisms of matrix metalloproteinases. Biol Chem 1997, 378(3-4):151-160. 144. Liu Y E , Wang M, Greene J , Su J , Ullrich S, Li H, Sheng S, Alexander P, Sang QA, Shi Y E : Preparation and characterization of recombinant tissue inhibitor of metalloproteinase 4 (TIMP-4). J Biol Chem 1997, 272(33):20479-20483. 145. Wun TC: Plasminogen activation: biochemistry, physiology, and therapeutics. Crit Rev Biotechnol 1988, 8(2):131-148. 146. Kohler HP, Grant P J : Plasminogen-activator inhibitor type 1 and coronary artery disease. N EnglJ Med 2000, 342(24): 1792-1801. 147. Wiman B: Plasminogen activator inhibitor 1 (PAI-1) in plasma: its role in thrombotic disease. Thromb Haemost 1995, 74(1):71-76. 148. Chapman HA: Plasminogen activators, integrins, and the coordinated regulation of cell adhesion and migration. Curr Opin Cell Biol 1997, 9(5):714-724. 149. Rifkin DB, Gleizes P E , Harpel J , Nunes I, Munger J , Mazzieri R, Noguera I: Plasminogen/plasminogen activator and growth factor activation. Ciba Found Symp 1997, 212:105-115; discussion 116-108. 213 150. Li YY , McTiernan C F , Feldman A M : Interplay of matrix metalloproteinases, tissue inhibitors of metalloproteinases and their regulators in cardiac matrix remodeling. Cardiovasc Res 2000, 46(2):214-224. 151. Danielsen C C , Wiggers H, Andersen HR: Increased amounts of collagenase and gelatinase in porcine myocardium following ischemia and reperfusion. J Mol Cell Cardiol 1998, 30(7): 1431-1442. 152. Cleutjens J P , Kandala J C , Guarda E, Guntaka RV, Weber KT: Regulation of collagen degradation in the rat myocardium after infarction. J Mol Cell Cardiol 1995, 27(6):1281-1292. 153. Coker ML, Thomas CV, Clair MJ , Hendrick JW, Krombach R S , Galis ZS, Spinale F G : Myocardial matrix metalloproteinase activity and abundance with congestive heart failure. Am J Physiol 1998, 274(5 Pt 2):H1516-1523. 154. Watanabe N, Ikeda U: Matrix metalloproteinases and atherosclerosis. Curr Atheroscler Rep 2004, 6(2): 112-120. 155. Sluijter J P , de Kleijn DP, Pasterkamp G: Vascular remodeling and protease inhibition-bench to bedside. Cardiovasc Res 2006, 69(3):595-603. 156. Tyagi S C , Campbell S E , Reddy HK, Tjahja E, Voelker DJ : Matrix metalloproteinase activity expression in infarcted, noninfarcted and dilated cardiomyopathic human hearts. Mol Cell Biochem 1996, 155(1 ):13-21. 157. Spinale F G , Coker ML, Thomas CV, Walker JD, Mukherjee R, Hebbar L: Time-dependent changes in matrix metalloproteinase activity and expression during the progression of congestive heart failure: relation to ventricular and myocyte function. Circ Res 1998, 82(4):482-495. 158. Roten L, Nemoto S, Simsic J , Coker ML, Rao V, Baicu S, Defreyte G, Soloway P J , Zile MR, Spinale F G : Effects of gene deletion of the tissue inhibitor of the matrix metalloproteinase-type 1 (TIMP-1) on left ventricular geometry and function in mice. J Mol Cell Cardiol 2000, 32(1):109-120. 159. Collen D, Stassen J M , Marafino BJ , Jr., Builder S, De Cock F, Ogez J , Tajiri D, Pennica D, Bennett WF, Salwa J et al: Biological properties of human tissue-type plasminogen activator obtained by expression of recombinant DNA in mammalian cells. J Pharmacol Exp Ther 1984, 231(1): 146-152. 160. Brandt JT: Plasminogen and tissue-type plasminogen activator deficiency as risk factors for thromboembolic disease. Arch Pathol Lab Med 2002, 126(11):1376-1381. 161. Christie PD, Edelberg J M , Picard MH, Foulkes AS , Mamuya W, Weiler-Guettler H, Rubin R H , Gilbert P, Rosenberg RD: A murine model of myocardial microvascular thrombosis. J Clin Invest 1999, 104(5):533-539. 214 162. Matsuno H, Kozawa O, Ueshima S, Matsuo O, Collen D, Uematsu T: Lack of tPA significantly affects antithrombotic therapy by a GPIIb/llla antagonist, but not by a thrombin inhibitor in mice. Thromb Haemost 2000, 83(4):605-609. 163. Carmeliet P, Schoonjans L, Kieckens L, Ream B, Degen J , Branson R, De Vos R, van den Oord J J , Collen D, Mulligan R C : Physiological consequences of loss of plasminogen activator gene function in mice. Nature 1994, 368(6470):419-424. 164. Carmeliet P, Bouche A, De Clercq C, Janssen S, Pollefeyt S, Wyns S, Mulligan R C , Collen D: Biological effects of disruption of the tissue-type plasminogen activator, urokinase-type plasminogen activator, and plasminogen activator inhibitor-1 genes in mice. Ann N Y Acad Sci 1995, 748:367-381; discussion 381-362. 165. Carmeliet P, Collen D: Genetic analysis of the plasminogen and coagulation system in mice. Haemostasis 1996, 26 Suppl 4:132-153. 166. Bergmann SR, Fox KA, Ter-Pogossian MM, Sobel BE, Collen D: Clot-selective coronary thrombolysis with tissue-type plasminogen activator. Science 1983, 220(4602):1181-1183. 167. Bounameaux H, Kruithof EK: On the association of elevated tPA/PAI-1 complex and von Willebrand factor with recurrent myocardial infarction. Arterioscler Thromb Vase Biol 2000, 20(8):1857-1859. 168. Grzywacz A, Elikowski W, Psuja P, Zozulinska M, Zawilska K: Impairment of plasma fibrinolysis in young survivors of myocardial infarction with silent ischaemia. Blood Coagul Fibrinolysis 1998, 9(3):245-249. 169. Nilsson IM, Ljungner H, Tengborn L: Two different mechanisms in patients with venous thrombosis and defective fibrinolysis: low concentration of plasminogen activator or increased concentration of plasminogen activator inhibitor. Br Med J (Clin Res Ed) 1985, 290(6480): 1453-1456. 170. Wiman B, Hamsten A: Correlations between fibrinolytic function and acute myocardial infarction. Am J Cardiol 1990, 66(16):54G-56G. 171. Juhan-Vague I, Pyke SD, Alessi MC, Jespersen J , Haverkate F, Thompson S G : Fibrinolytic factors and the risk of myocardial infarction or sudden death in patients with angina pectoris. ECAT Study Group. European Concerted Action on Thrombosis and Disabilities. Circulation 1996, 94(9):2057-2063. 172. Kassis J , Hirsh J , Podor TJ : Evidence that postoperative fibrinolytic shutdown is mediated by plasma factors that stimulate endothelial cell type I plasminogen activator inhibitor biosynthesis. Blood 1992, 80(7): 1758-1764. 173. Erickson LA, Fici G J , Lund J E , Boyle TP, Polites HG, Marotti KR: Development of venous occlusions in mice transgenic for the plasminogen activator inhibitor-1 gene. Nature 1990, 346(6279):74-76. 215 174. Schafer K, Muller K, Hecke A, Mounier E, Goebel J , Loskutoff DJ , Konstantinides S: Enhanced thrombosis in atherosclerosis-prone mice is associated with increased arterial expression of plasminogen activator inhibitor-1. Arterioscler Thromb Vase Biol 2003, 23(11):2097-2103. 175. Bini A, Itoh Y, Kudryk BJ , Nagase H: Degradation of cross-linked fibrin by matrix metalloproteinase 3 (stromelysin 1): hydrolysis of the gamma Gly 404-Ala 405 peptide bond. Biochemistry 1996, 35(40): 13056-13063. 176. Bini A, Wu D, Schnuer J , Kudryk BJ : Characterization of stromelysin 1 (MMP-3), matrilysin (MMP-7), and membrane type 1 matrix metalloproteinase (MT1-MMP) derived fibrin(ogen) fragments D-dimer and D-like monomer: NH2-terminal sequences of late-stage digest fragments. Biochemistry 1999, 38(42):13928-13936. 177. van der Flier A, Sonnenberg A: Function and interactions of integrins. Cell Tissue Res 2001, 305(3):285-298. 178. Hynes RO: Integrins: bidirectional, allosteric signaling machines. Cell 2002, 110(6):673-687. 179. Takeda K, Kusachi S, Ohnishi H, Nakahama M, Murakami M, Komatsubara I, Oka T, Doi M, Ninomiya Y, Tsuji T: Greater than normal expression of the collagen-binding stress protein heat-shock protein-47 in the infarct zone in rats after experimentally-induced myocardial infarction. Coron Artery Dis 2000, 11(1):57-68. 180. Cleutjens J P , Verluyten MJ , Smiths JF , Daemen MJ: Collagen remodeling after myocardial infarction in the rat heart. Am J Pathol 1995, 147(2):325-338. 181. Cleutjens J P , Creemers E E : Integration of concepts: cardiac extracellular matrix remodeling after myocardial infarction. J Card Fail 2002, 8(6 Suppl):S344-348. 182. Cleutjens J P , Blankesteijn W M , Daemen MJ , Smits JF : The infarcted myocardium: simply dead tissue, or a lively target for therapeutic interventions. Cardiovasc Res 1999, 44(2):232-241. 183. Ploplis VA, French EL, Carmeliet P, Collen D, Plow EF: Plasminogen deficiency differentially affects recruitment of inflammatory cell populations in mice. Blood 1998, 91(6):2005-2009. 184. Romer J , Bugge TH, Pyke C, Lund LR, Flick MJ , Degen JL, Dano K: Impaired wound healing in mice with a disrupted plasminogen gene. Nat Med 1996, 2(3):287-292. 185. Creemers E, Cleutjens J , Smits J , Heymans S, Moons L, Collen D, Daemen M, Carmeliet P: Disruption of the plasminogen gene in mice abolishes wound healing after myocardial infarction. Am J Pathol 2000, 156(6):1865-1873. 216 186. Ranson M, Andronicos NM, O'Mullane MJ , Baker MS: Increased plasminogen binding is associated with metastatic breast cancer cells: differential expression of plasminogen binding proteins. Br J Cancer 1998, 77(10):1586-1597. 187. Bezerra JA, Bugge TH, Melin-Aldana H, Sabla G, Kombrinck KW, Witte DP, Degen JL: Plasminogen deficiency leads to impaired remodeling after a toxic injury to the liver. Proc Natl Acad Sci U S A 1999, 96(26):15143-15148. 188. Oh CW, Hoover-Plow J , Plow EF: The role of plasminogen in angiogenesis in vivo. J Thromb Haemost 2003, 1(8):1683-1687. 189. Carmeliet P, Moons L, Lijnen R, Baes M, Lemaitre V, Tipping P, Drew A, Eeckhout Y, Shapiro S, Lupu F et al: Urokinase-generated plasmin activates matrix metalloproteinases during aneurysm formation. Nat Genet 1997, 17(4):439-444. 190. Lund LR, Romer J , Bugge TH, Nielsen BS, Frandsen TL, Degen JL, Stephens RW, Dano K: Functional overlap between two classes of matrix-degrading proteases in wound healing. Embo J 1999, 18(17):4645-4656. 191. Rifkin DB, Mazzieri R, Munger J S , Noguera I, Sung J : Proteolytic control of growth factor availability. Apmis 1999, 107(1 ):80-85. 192. Hosgor I, Yarat A, Yilmazer S, Girisken G, Ahmad S: Collagen deposition in myocardium after inhibition of fibrinolytic activity. Blood Coagul Fibrinolysis 2005, 16(1):25-30. 193. Lijnen HR: Plasmin and matrix metalloproteinases in vascular remodeling. Thromb Haemost 2001, 86(1):324-333. 194. Tyagi S C , Kumar S G , Banks J , Fortson W: Co-expression of tissue inhibitor and matrix metalloproteinase in myocardium. J Mol Cell Cardiol 1995, 27(10):2177-2189. 195. Heling A, Zimmermann R, Kostin S, Maeno Y, Hein S, Devaux B, Bauer E, Klovekorn WP, Schlepper M, Schaper W et al: Increased expression of cytoskeletal, linkage, and extracellular proteins in failing human myocardium. Circ Res 2000, 86(8):846-853. 196. Stanton LW, Garrard LJ , Damm D, Garrick BL, Lam A, Kapoun A M , Zheng Q, Protter AA, Schreiner GF , White RT: Altered patterns of gene expression in response to myocardial infarction. Circ Res 2000, 86(9):939-945. 197. Sehl PD, Tai JT, Hillan KJ , Brown LA, Goddard A, Yang R, Jin H, Lowe DG: Application of cDNA microarrays in determining molecular phenotype in cardiac growth, development, and response to injury. Circulation 2000, 101(16):1990-1999. 198. Orenstein TL, Parker TG, Butany JW, Goodman J M , Dawood F, Wen WH, Wee L, Martino T, McLaughlin PR, Liu P P : Favorable left ventricular 217 remodeling following large myocardial infarction by exercise training. Effect on ventricular morphology and gene expression. J Clin Invest 1995, 96(2):858-866. 199. Xiao Y, Li H, Bunn C, Bartold P M : The expression of plasminogen activator system in a rat model of periodontal wound healing. J Periodontol 2001, 72(7):849-857. 200. Weckroth M, Vaheri A, Virolainen S, Saarialho-Kere U, Jahkola T, Siren V: Epithelial tissue-type plasminogen activator expression, unlike that of urokinase, its receptor, and plasminogen activator inhibitor-1, is increased in chronic venous ulcers.'8r J Dermatol 2004, 151 (6): 1189-1196. 201. Kucharewicz I, Kowal K, Buczko W, Bodzenta-Lukaszyk A: The plasmin system in airway remodeling. Thromb Res 2003, 112(1-2):1-7. 202. Melchor J P , Strickland S: Tissue plasminogen activator in central nervous system physiology and pathology. Thromb Haemost 2005, 93(4):655-660. 203. de Vries TJ , van Muijen G N , Ruiter DJ: The plasminogen activation system in tumour invasion and metastasis. Pathol Res Pract 1996, 192(7):718-733. 204. Yang Z, Eton D, Zheng F, Livingstone A S , Yu H: Effect of tissue plasminogen activator on vascular smooth muscle cells. J Vase Surg 2005, 42(3):532-538. 205. de Giorgio-Miller A, Bottoms S, Laurent G, Carmeliet P, Herrick S: Fibrin-induced skin fibrosis in mice deficient in tissue plasminogen activator. Am J Pathol 2005, 167(3):721-732. 206. Tsuji K, Aoki T, Tejima E, Arai K, Lee SR, Atochin DN, Huang PL, Wang X, Montaner J , Lo EH: Tissue plasminogen activator promotes matrix metalloproteinase-9 upregulation after focal cerebral ischemia. Stroke 2005, 36(9): 1954-1959. 207. Zhao BQ, Ikeda Y, lhara H, Urano T, Fan W, Mikawa S, Suzuki Y, Kondo K, Sato K, Nagai N et al: Essential role of endogenous tissue plasminogen activator through matrix metalloproteinase 9 induction and expression on heparin-produced cerebral hemorrhage after cerebral ischemia in mice. Blood 2004, 103(7):2610-2616. 208. Tyagi S C , Kumar S G , Haas S J , Reddy HK, Voelker DJ, Hayden MR, Demmy TL, Schmaltz RA, Curtis J J : Post-transcriptional regulation of extracellular matrix metalloproteinase in human heart end-stage failure secondary to ischemic cardiomyopathy. J Mol Cell Cardiol 1996, 28(7):1415-1428. 209. Okada Y, Watanabe S, Nakanishi I, Kishi J , Hayakawa T, Watorek W, Travis J , Nagase H: Inactivation of tissue inhibitor of metalloproteinases by neutrophil elastase and other serine proteinases. FEBS Lett 1988, 229(1): 157-160. 218 210. Lindahl B, Nilsson TK, Jansson J H , Asplund K, Hallmans G: Improved fibrinolysis by intense lifestyle intervention. A randomized trial in subjects with impaired glucose tolerance. J Intern Med 1999, 246(1):105-112. 211. van den Burg P J , Hospers J E , van Vliet M, Mosterd WL, Bouma BN, Huisveld IA: Effect of endurance training and seasonal fluctuation on coagulation and fibrinolysis in young sedentary men. J Appl Physiol 1997, 82(2):613-620. 212. Chandler WL, Levy W C , Stratton JR : The circulatory regulation of TPA and UPA secretion, clearance, and inhibition during exercise and during the infusion of isoproterenol and phenylephrine. Circulation 1995, 92(10):2984-2994. 213. van den Burg P J , Dooijewaard G, van Vliet M, Mosterd WL, Kluft C, Huisveld IA: Differences in u-PA and t-PA increase during acute exercise: relation with exercise parameters. Thromb Haemost 1994, 71(2):236-239. 214. Carmeli E, Moas M, Lennon S, Powers SK: High intensity exercise increases expression of matrix metalloproteinases in fast skeletal muscle fibres. Exp Physiol 2005, 90(4):613-619. 215. Koskinen SO, Heinemeier KM, Olesen JL, Langberg H, Kjaer M: Physical exercise can influence local levels of matrix metalloproteinases and their inhibitors in tendon-related connective tissue. J Appl Physiol 2004, 96(3):861-864. 216. Gaertner R, Jacob MP, Prunier F, Angles-Cano E, Mercadier J J , Michel JB : The plasminogen-MMP system is more activated in the scar than in viable myocardium 3 months post-MI in the rat. J Mol Cell Cardiol 2005, 38(1):193-204. 217. Tayebjee MH, Lip GY , Blann AD, Macfadyen R J : Effects of age, gender, ethnicity, diurnal variation and exercise on circulating levels of matrix metalloproteinases (MMP)-2 and -9, and their inhibitors, tissue inhibitors of matrix metalloproteinases (TIMP)-1 and -2. Thromb Res 2005, 115(3):205-210. 218. Bansal DD, Klein R M , Hausmann EH, MacGregor RR: Secretion of cardiac plasminogen activator during hypoxia-induced right ventricular hypertrophy. J Mol Cell Cardiol 1997, 29(11):3105-3114. 219. Bloor C M , Nimmo L, McKirnan MD, Zhang Y, White F C : Increased gene expression of plasminogen activators and inhibitors in left ventricular hypertrophy. Mol Cell Biochem 1997, 176(1-2):265-271. 220. Miura S, Ohno I, Suzuki J , Suzuki K, Okada S, Okuyama A, Nawata J , Ikeda J , Shirato K: Inhibition of matrix metalloproteinases prevents cardiac hypertrophy induced by beta-adrenergic stimulation in rats. J Cardiovasc Pharmacol 2003, 42(2):174-181. 219 221. Coker ML, Jolly JR, Joffs C, Etoh T, Holder JR , Bond BR, Spinale F G : Matrix metalloproteinase expression and activity in isolated myocytes after neurohormonal stimulation. Am J Physiol Heart Circ Physiol 2001, 281(2):H543-551. 222. Lodish H: Chapter 23: Microtubules and Intermediate Filaments: Scientific American Books Inc.; 1995. 223. Fuchs E, Cleveland DW: A structural scaffolding of intermediate filaments in health and disease. Science 1998, 279(5350):514-519. 224. Parry DA, Steinert P M : Intermediate filaments: molecular architecture, assembly, dynamics and polymorphism. O Rev Biophys 1999, 32(2):99-187. 225. Draberova E, Draber P: A microtubule-interacting protein involved in coalignment of vimentin intermediate filaments with microtubules. J Cell Sci 1993, 106 ( Pt4):1263-1273. 226. Capetanaki Y: Desmin cytoskeleton in healthy and failing heart. Heart Fail Rev 2000, 5(3):203-220. 227. Cary RB, Klymkowsky MW: Differential organization of desmin and vimentin in muscle is due to differences in their head domains. J Cell Biol 1994, 126(2):445-456. 228. Dalakas MC, Park KY, Semino-Mora C, Lee HS, Sivakumar K, Goldfarb LG: Desmin myopathy, a skeletal myopathy with cardiomyopathy caused by mutations in the desmin gene. N Engl J Med 2000, 342(11):770-780. 229. Milner DJ , Taffet G E , Wang X, Pham T, Tamura T, Hartley C, Gerdes A M , Capetanaki Y: The absence of desmin leads to cardiomyocyte hypertrophy and cardiac dilation with compromised systolic function. J Mol Cell Cardiol 1999, 31(11):2063-2076. 230. Capetanaki Y: Desmin cytoskeleton: a potential regulator of muscle mitochondrial behavior and function. Trends Cardiovasc Med 2002, 12(8):339-348. 231. Goldfarb LG , Park KY, Cervenakova L, Gorokhova S, Lee HS, Vasconcelos O, Nagle JW, Semino-Mora C, Sivakumar K, Dalakas MC: Missense mutations in desmin associated with familial cardiac and skeletal myopathy. Nat Genet 1998, 19(4):402-403. 232. Park KY, Dalakas MC, Semino-Mora C, Lee HS, Litvak S, Takeda K, Ferrans V J , Goldfarb LG: Sporadic cardiac and skeletal myopathy caused by a de novo desmin mutation. Clin Genet 2000, 57(6):423-429. 233. Li Z, Colucci-Guyon E, Pincon-Raymond M, Mericskay M, Pournin S, Paulin D, Babinet C: Cardiovascular lesions and skeletal myopathy in mice lacking desmin. Dev Biol 1996, 175(2):362-366. 220 234. Di Somma S, Di Benedetto MP, Salvatore G, Agozzino L, Ferranti F, Esposito S, La Dogana P, Scarano Ml, Caputo G , Cotrufo M et al: Desmin-free cardiomyocytes and myocardial dysfunction in end stage heart failure. Eur J Heart Fail 2004, 6(4):389-398. 235. Wilding JR, Lygate CA, Davies KE, Neubauer S, Clarke K: MLP accumulation and remodelling in the infarcted rat heart. Eur J Heart Fail 2006, 8(4):343-346. 236. Bolli R, Marban E: Molecular and cellular mechanisms of myocardial stunning. Physiol Rev 1999, 79(2):609-634. 237. Matsumura Y, Saeki E, Inoue M, Hori M, Kamada T, Kusuoka H: Inhomogeneous disappearance of myofilament-related cytoskeletal proteins in stunned myocardium of guinea pig. Circ Res 1996, 79(3):447-454. 238. Dutka DP, Camici P G : Hibernation and congestive heart failure. Heart Fail Rev 2003, 8(2):167-173. 239. Elsasser A, Schlepper M, Klovekorn W P , Cai W J , Zimmermann R, Muller KD, Strasser R, Kostin S, Gagel C, Munkel B et al: Hibernating myocardium: an incomplete adaptation to ischemia. Circulation 1997, 96(9):2920-2931. 240. Thijssen VL, Borgers M, Lenders MH, Ramaekers FC , Suzuki G, Palka B, Fallavollita JA, Thomas SA, Canty J M , Jr.: Temporal and spatial variations in structural protein expression during the progression from stunned to hibernating myocardium. Circulation 2004, 110(21):3313-3321. 241. Rezai N, Walinski H, Kerjner A, Bohunek L, Rossi FM, McManus B M , Podor TJ : Methods for examining stem cells in post-ischemic and transplanted hearts. Methods Mol Med 2005, 112:223-238. 242. Hochman J S , Bulkley BH: Pathogenesis of left ventricular aneurysms: an experimental study in the rat model. Am J Cardiol 1982, 50(1 ):83-88. 243. Peacock E: Wound Repair, 3rd edn. Philadephia: W B Saunders; 1984. 244. Marks PW, Hendey B, Maxfield FR: Attachment to fibronectin or vitronectin makes human neutrophil migration sensitive to alterations in cytosolic free calcium concentration. J Cell Biol 1991, 112(1 ):149-158. 245. Dahm LM, Bowers CW: Vitronectin regulates smooth muscle contractility via alphav and betal integrin. J Cell Sci 1998, 111 ( Pt 9):1175-1183. 246. Preissner KT, Anders E, Grulich-Henn J , Muller-Berghaus G: Attachment of cultured human endothelial cells is promoted by specific association with S protein (vitronectin) as well as with the ternary S protein-thrombin-antithrombin III complex. Blood 1988, 71 (6):1581-1589. 247. Ruoslahti E: R G D and other recognition sequences for integrins. Annu Rev Cell Dev Biol 1996, 12:697-715. 221 248. Kanse S M , Kost C, Wilhelm O G , Andreasen PA, Preissner KT: The urokinase receptor is a major vitronectin-binding protein on endothelial cells. Exp Cell Res 1996, 224(2):344-353. 249. Isik FF , Gibran NS, Jang Y C , Sandell L, Schwartz S M : Vitronectin decreases microvascular endothelial cell apoptosis. J Cell Physiol 1998, 175(2): 149-155. 250. Friedlander M, Brooks P C , Shaffer RW, Kincaid C M , Varner JA, Cheresh DA: Definition of two angiogenic pathways by distinct alpha v integrins. Science 1995, 270(5241 ):1500-1502. 251. Jang Y C , Tsou R, Gibran NS, Isik FF: Vitronectin deficiency is associated with increased wound fibrinolysis and decreased microvascular angiogenesis in mice. Surgery 2000, 127(6):696-704. 252. Brooks P C , Clark RA, Cheresh DA: Requirement of vascular integrin alpha v beta 3 for angiogenesis. Science 1994, 264(5158):569-571. 253. Wang N, Ingber DE: Control of cytoskeletal mechanics by extracellular matrix, cell shape, and mechanical tension. Biophys J 1994, 66(6):2181-2189. 254. Devy L, Blacher S, Grignet-Debrus C, Bajou K, Masson V, Gerard RD, Gils A, Carmeliet G , Carmeliet P, Declerck P J et al: The pro- or antiangiogenic effect of plasminogen activator inhibitor 1 is dose dependent. Faseb J 2002, 16(2):147-154. 255. McMahon GA, Petitclerc E, Stefansson S, Smith E, Wong MK, Westrick R J , Ginsburg D, Brooks P C , Lawrence DA: Plasminogen activator inhibitor-1 regulates tumor growth and angiogenesis. J Biol Chem 2001, 276(36):33964-33968. 256. Bajou K, Masson V, Gerard RD, Schmitt P M , Albert V, Praus M, Lund LR, Frandsen TL, Brunner N, Dano K et al: The plasminogen activator inhibitor PAI-1 controls in vivo tumor vascularization by interaction with proteases, not vitronectin. Implications for antiangiogenic strategies. J Cell Biol 2001, 152(4):777-784. 257. Preissner KT .May A E , Wohn KD, Germer M, Kanse S M : Molecular crosstalk between adhesion receptors and proteolytic cascades in vascular remodelling. Thromb /-/aemosf 1997, 78(1):88-95. 258. Tremble P, Damsky C H , Werb Z: Components of the nuclear signaling cascade that regulate collagenase gene expression in response to integrin-derived signals. J Cell Biol 1995, 129(6): 1707-1720. 259. Preissner KT, Seiffert D: Role of vitronectin and its receptors in haemostasis and vascular remodeling. Thromb Res 1998, 89(1):1-21. 222 260. Ashizawa N, Graf K, Do Y S , Nunohiro T, Giachelli C M , Meehan W P , Tuan TL, Hsueh WA: Osteopontin is produced by rat cardiac fibroblasts and mediates A(ll)-induced DNA synthesis and collagen gel contraction. J Clin Invest 1996, 98(10):2218-2227. 261. Choi ET, Engel L, Callow AD, Sun S, Trachtenberg J , Santoro S, Ryan US: Inhibition of neointimal hyperplasia by blocking alpha V beta 3 integrin with a small peptide antagonist G p e n G R G D S P C A . J Vase Surg 1994, 19(1):125-134. 262. Masunaga Y, Asakura S, Muto S, Ando Y, Homma S, Kusano E, Matsuda M, Asano Y: Multimeric vitronectin in ascites is involved in fibroblast spreading of E P S in patients on C A P D therapy. Clin Exp Nephrol 2003, 7(2):150-156. 263. Kotoh K, Nakamuta M, Kohjima M, Fukushima M, Morizono S, Kobayashi N, Enjoji M, Nawata H: Arg-Gly-Asp (RGD) peptide ameliorates carbon tetrachloride-induced liver fibrosis via inhibition of collagen production and acceleration of collagenase activity. Int J Mol Med 2004, 14(6): 1049-1053. 264. Yi M, Sakai T, Fassler R, Ruoslahti E: Antiangiogenic proteins require plasma fibronectin or vitronectin for in vivo activity. Proc Natl Acad Sci USA 2003, 100(20):11435-11438. 265. Wu RX, Laser M, Han H, Varadarajulu J , Schuh K, Hallhuber M, Hu K, Ertl G, Hauck C R , Ritter O: Fibroblast migration after myocardial infarction is regulated by transient S P A R C expression. J Mol Med 2006, 84(3):241-252. 266. Fukuda K, Yuasa S: Stem cells as a source of regenerative cardiomyocytes. Circ Res 2006, 98(8):1002-1013. 267. Yoon Y S , Lee N, Scadova H: Myocardial regeneration with bone-marrow-derived stem cells. Biol Cell 2005, 97(4):253-263. 268. Andreasen PA, Egelund R, Petersen HH: The plasminogen activation system in tumor growth, invasion, and metastasis. Cell Mol Life Sci 2000, 57(1 ):25-40. 269. Plesner T, Behrendt N, Ploug M: Structure, function and expression on blood and bone marrow cells of the urokinase-type plasminogen activator receptor, uPAR. Stem Cells 1997, 15(6):398-408. 270. Wei Y, Waltz DA, Rao N, Drummond R J , Rosenberg S, Chapman HA: Identification of the urokinase receptor as an adhesion receptor for vitronectin. J Biol Chem 1994, 269(51 ):32380-32388. 271. Hoffmann S, He S, Jin M, Ehren M, Wiedemann P, Ryan S J , Hinton DR: A selective cyclic integrin antagonist blocks the integrin receptors alphavbeta3 and alphavbeta5 and inhibits retinal pigment epithelium cell attachment, migration and invasion. BMC Ophthalmol 2005, 5:16. 223 272. Noutsias M, Fechner H, de Jonge H, Wang X, Dekkers D, Houtsmuller AB, Pauschinger M, Bergelson J , Warraich R, Yacoub M et al: Human coxsackie-adenovirus receptor is colocalized with integrins alpha(v)beta(3) and alpha(v)beta(5) on the cardiomyocyte sarcolemma and upregulated in dilated cardiomyopathy: implications for cardiotropic viral infections. Circulation 2001, 104(3):275-280. 273. Rosenberg S: New developments in the urokinase-type plasminogen activator system. Expert Opin Ther Targets 2001, 5(6):711-722. 274. Stefansson S, Lawrence DA: The serpin PAI-1 inhibits cell migration by blocking integrin alpha V beta 3 binding to vitronectin. Nature 1996, 383(6599):441-443. 275. Lopez-Alemany R, Redondo J M , Nagamine Y, Munoz-Canoves P: Plasminogen activator inhibitor type-1 inhibits insulin signaling by competing with alphavbeta3 integrin for vitronectin binding. Eur J Biochem 2003, 270(5):814-821. 276. Bajou K, Noel A, Gerard RD, Masson V, Brunner N, Holst-Hansen C, Skobe M, Fusenig NE, Carmeliet P, Collen D et al: Absence of host plasminogen activator inhibitor 1 prevents cancer invasion and vascularization. Nat Med 1998,4(8):923-928. 277. Solberg H, Ploug M, Hoyer-Hansen G, Nielsen BS, Lund LR: The murine receptor for urokinase-type plasminogen activator is primarily expressed in tissues actively undergoing remodeling. J Histochem Cytochem 2001, 49(2):237-246. 278. Lazar MH, Christensen P J , Du M, Yu B, Subbotina NM, Hanson KE, Hansen J M , White E S , Simon RH, Sisson TH: Plasminogen activator inhibitor-1 impairs alveolar epithelial repair by binding to vitronectin. Am J Respir Cell Mol Biol 2004, 31(6):672-678. 279. Tomasini BR, Mosher DF: Vitronectin. Prog Hemost Thromb 1991, 10:269-305. 280. Underwood PA, Steele J G , Dalton BA: Effects of polystyrene surface chemistry on the biological activity of solid phase fibronectin and vitronectin, analysed with monoclonal antibodies. J Cell Sci 1993, 104 ( Pt 3):793-803. 281. Pankov R, Yamada K M : Fibronectin at a glance. J Cell Sci 2002, 115(Pt 20):3861-3863. 282. Miyamoto S, Katz BZ, Lafrenie R M , Yamada KM: Fibronectin and integrins in cell adhesion, signaling, and morphogenesis. Ann N Y Acad Sci 1998, 857:119-129. 283. Wang J , Milner R: Fibronectin promotes brain capillary endothelial cell survival and proliferation through alpha5beta1 and alphavbeta3 integrins via MAP kinase signalling. J Neurochem 2006, 96(1): 148-159. 224 284. Scaffidi AK, Moodley Y P , Weichselbaum M, Thompson P J , Knight DA: Regulation of human lung fibroblast phenotype and function by vitronectin and vitronectin integrins. J Cell Sci 2001, 114(Pt 19):3507-3516. 285. Ross R S , Borg TK: Integrins and the myocardium. Circ Res 2001, 8 8 ( 1 1 1 2 - 1 1 1 9 . 286. Vakeva A, Laurila P, Meri S: Regulation of complement membrane attack complex formation in myocardial infarction. Am J Pathol 1993, 143(1 ):65-75. 287. Buzza MS, Zamurs L, Sun J , Bird C H , Smith A l , Trapani JA, Froelich C J , Nice E C , Bird PI: Extracellular matrix remodeling by human granzyme B via cleavage of vitronectin, fibronectin, and laminin. J Biol Chem 2005, 280(25):23549-23558. 288. Minor KH, Schar CR, Blouse G E , Shore JD , Lawrence DA, Schuck P, Peterson C B : A mechanism for assembly of complexes of vitronectin and plasminogen activator inhibitor-1 from sedimentation velocity analysis. J Biol Chem 2005, 280(31 ):28711-28720. 289. Seiffert D, Wagner NN, Loskutoff DJ : Serum-derived vitronectin influences the pericellular distribution of type 1 plasminogen activator inhibitor. J Cell B/b/1990, 111(3): 1283-1291. 290. Kostin S, Hein S, Arnon E, Scholz D, Schaper J : The cytoskeleton and related proteins in the human failing heart. Heart Fail Rev 2000, 5(3):271-280. 291. Schaper J , Froede R, Hein S, Buck A, Hashizume H, Speiser B, Friedl A, Bleese N: Impairment of the myocardial ultrastructure and changes of the cytoskeleton in dilated cardiomyopathy. Circulation 1991, 83(2):504-514. 292. Chen G, Gharib TG, Huang C C , Taylor J M , Misek DE, Kardia SL, Giordano TJ , lannettoni MD, Orringer MB, Hanash S M et al: Discordant protein and mRNA expression in lung adenocarcinomas. Mol Cell Proteomics 2002, 1(4):304-313. 293. Orntoft TF, Thykjaer T, Waldman FM, Wolf H, Celis J E : Genome-wide study of gene copy numbers, transcripts, and protein levels in pairs of non-invasive and invasive human transitional cell carcinomas. Mol Cell Proteomics 2002, 1(1):37-45. 294. Greenbaum D, Colangelo C, Williams K, Gerstein M: Comparing protein abundance and mRNA expression levels on a genomic scale. Genome Biol 2003,4(9):117. 295. Guettier C, Hinglais N, Bruneval P, Kazatchkine M, Bariety J , Camilleri J P : Immunohistochemical localization of S protein/vitronectin in human atherosclerotic versus arteriosclerotic arteries. Virchows Arch A Pathol Anat Histopathon989, 414(4):309-313. 225 296. Sobel BE , Lee Y H , Pratley R E , Schneider DJ: Increased plasminogen activator inhibitor type-1 (PAI-1) in the heart as a function of age. Life Sci 2006, 79(17):1600-1605. 297. Eitzman DT, McCoy RD, Zheng X, Fay W P , Shen T, Ginsburg D, Simon RH: Bleomycin-induced pulmonary fibrosis in transgenic mice that either lack or overexpress the murine plasminogen activator inhibitor-1 gene. J Clin Invest 1996, 97(1 ):232-237. 298. Chan J C , Duszczyszyn DA, Castellino F J , Ploplis VA: Accelerated skin wound healing in plasminogen activator inhibitor-1-deficient mice. Am J Pathol 2001, 159(5):1681-1688. 299. Askari AT, Brennan ML, Zhou X, Drinko J , Morehead A, Thomas JD, Topol E J , Hazen SL, Penn MS: Myeloperoxidase and plasminogen activator inhibitor 1 play a central role in ventricular remodeling after myocardial infarction. J Exp Med 2003, 197(5):615-624. 300. Seiffert D, Loskutoff DJ : Type 1 plasminogen activator inhibitor induces multimerization of plasma vitronectin. A suggested mechanism for the generation of the tissue form of vitronectin in vivo. J Biol Chem 1996, 271(47):29644-29651. 301. Sobel RA, Chen M, Maeda A, Hinojoza JR: Vitronectin and integrin vitronectin receptor localization in multiple sclerosis lesions. J Neuropathol Exp Neurol 1995, 54(2):202-213. 302. Koukoulis GK, Shen J , Virtanen I, Gould V E : Vitronectin in the cirrhotic liver: an immunomarker of mature fibrosis. Hum Pathol 2001, 32(12):1356-1362. 303. Dahlback K, Lofberg H, Alumets J , Dahlback B: Immunohistochemical demonstration of age-related deposition of vitronectin (S-protein of complement) and terminal complement complex on dermal elastic fibers. J Invest Dermatol 1989, 92(5):727-733. 304. Lim H, Zhu YZ: Role of transforming growth factor-beta in the progression of heart failure. Cell Mol Life Sci 2006, 63(22):2584-2596. 305. Simms M G , Walley KR: Activated macrophages decrease rat cardiac myocyte contractility: importance of ICAM-1-dependent adhesion. Am J Physiol 1999, 277(1 Pt 2):H253-260. 306. Simpson P, McGrath A, Savion S: Myocyte hypertrophy in neonatal rat heart cultures and its regulation by serum and by catecholamines. Circ Res 1982, 51(6):787-801. 307. Podor TJ , Singh D, Chindemi P, Foulon DM, McKelvie R, Weitz J l , Austin R, Boudreau G, Davies R: Vimentin exposed on activated platelets and platelet microparticles localizes vitronectin and plasminogen activator inhibitor complexes on their surface. J Biol Chem 2002, 277(9):7529-7539. 226 308. Lilienbaum A, Li Z, Butler-Browne G, Bolmont C, Grimaud JA, Paulin D: Human desmin gene: utilization as a marker of human muscle differentiation. Cell Mol Biol 1988, 34(6):663-672. 309. Latif N, Sarathchandra P, Taylor P M , Antoniw J , Yacoub MH: Localization and pattern of expression of extracellular matrix components in human heart valves. J Heart Valve Dis 2005, 14(2):218-227. 310. Sumida H, Nakamura H, Satow Y: Distribution of vitronectin in the embryonic chick heart during endocardial cell migration. Arch Histol Cytol 1990, 53(1):81-88. 311. Bouchey D, Drake C J , Wunsch A M , Little CD : Distribution of connective tissue proteins during development and neovascularization of the epicardium. Cardiovasc Res 1996, 31 Spec No:E104-115. 312. Capetanaki Y, Milner DJ , Weitzer G: Desmin in muscle formation and maintenance: knockouts and consequences. Cell Struct Funct 1997, 22(1):103-116. 313. Li Z, Mericskay M, Agbulut O, Butler-Browne G, Carlsson L, Thornell LE, Babinet C, Paulin D: Desmin is essential for the tensile strength and integrity of myofibrils but not for myogenic commitment, differentiation, and fusion of skeletal muscle. J Cell Biol 1997, 139(1): 129-144. 314. Milner DJ, Weitzer G , Tran D, Bradley A, Capetanaki Y: Disruption of muscle architecture and myocardial degeneration in mice lacking desmin. J Cell Biol 1996, 134(5): 1255-1270. 315. Bornemann A, Schmalbruch H: Desmin and vimentin in regenerating muscles. Muscle Nerve 1992, 15(1): 14-20. 316. Lazarides E, Granger BL, Gard DL, O'Connor C M , Breckler J , Price M, Danto SI: Desmin- and vimentin-containing filaments and their role inthe assembly of the Z disk in muscle cells. Cold Spring Harb Symp Quant Biol 1982,46 Pt 1:351-378. 317. Christopher RA, Judge SR, Vincent PA, Higgins P J , McKeown-Longo P J : The amino-terminal matrix assembly domain of fibronectin stabilizes cell shape and prevents cell cycle progression. J Cell Sci 1999, 112 ( Pt 19):3225-3235. 318. Ortmann C, Pfeiffer H, Brinkmann B: A comparative study on the immunohistochemical detection of early myocardial damage. Int J Legal Med 2000, 113(4):215-220. 319. Chavakis T, Kanse S M , Yutzy B, Lijnen HR, Preissner KT: Vitronectin concentrates proteolytic activity on the cell surface and extracellular matrix by trapping soluble urokinase receptor-urokinase complexes. Blood 1998, 91(7):2305-2312. 227 1 320. Seiffert D, Mimuro J , Schleef RR, Loskutoff DJ : Interactions between type 1 plasminogen activator inhibitor, extracellular matrix and vitronectin. Cell Differ Dev 1990, 32(3):287-292. 321. Forssmann W G , Girardier L: A study of the T system in rat heart. J Cell Biol 1970,44(1):1-19. 322. Ayettey A S , Navaratnam V: The T-tubule system in the specialized and general myocardium of the rat. J Anat 1978, 127(Pt 1): 125-140. 323. Hill DK: The Space Accessible to Albumin within the Striated Muscle Fibre of the Toad. J Physiol 1964, 175:275-294. 324. Yokota S: Immunoelectron microscopic localization of albumin in smooth and striated muscle tissues of rat. Histochemistry 1982, 74(3):379-386. 325. Weitzer G, Milner DJ, Kim J U , Bradley A, Capetanaki Y: Cytoskeletal control of myogenesis: a desmin null mutation blocks the myogenic pathway during embryonic stem cell differentiation. Dev Biol 1995, 172(2):422-439. 326. Hein S, Scheffold T, Schaper J : Ischemia induces early changes to cytoskeletal and contractile proteins in diseased human myocardium. J Thorac Cardiovasc Surg 1995, 110(1):89-98. 327. Rappaport L: Ischemia-reperfusion associated myocardial contractile dysfunction may depend on Ca(2+)-activated cytoskeleton protein degradation. Cardiovasc Res 2000, 45(4):810-812. 328. Ganote C E , Vander Heide R S : Cytoskeletal lesions in anoxic myocardial injury. A conventional and high-voltage electron-microscopic and immunofluorescence study. Am J Pathol 1987, 129(2):327-344. 329. Di Somma S, Marotta M, Salvatore G, Cudemo G, Cuda G, De Vivo F, Di Benedetto MP, Ciaramella F, Caputo G, de Divitiis O: Changes in myocardial cytoskeletal intermediate filaments and myocyte contractile dysfunction in dilated cardiomyopathy: an in vivo study in humans. Heart 2000, 84(6):659-667. 330. Vogt A M , Kubler W: Heart failure: is there an energy deficit contributing to contractile dysfunction? Basic Res Cardiol 1998, 93(1):1-10. 331. Karsanov NV, Guledani NE, Kuchava LT: Role of actin and myosin in the mechanism of the decrease of myocardial contractility and efficiency of energy transformation by myocardial myofibrils in chronic heart failure in humans. Bull Exp Biol Med 2001, 132(5):1100-1105. 332. Bito V, Heinzel FR, Weidemann F, Dommke C, van der Velden J , Verbeken E, Claus P, Bijnens B, De Scheerder I, Stienen G J et al: Cellular mechanisms of contractile dysfunction in hibernating myocardium. Circ Res 2004, 94(6).794-801. 228 333. Webster KA, Bishopric NH: Molecular regulation of cardiac myocyte adaptations to chronic hypoxia. J Mol Cell Cardiol 1992, 24(7):741-751. 334. Wang X, Osinska H, Dorn GW, 2nd, Nieman M, Lorenz J N , Gerdes A M , Witt S, Kimball T, Gulick J , Robbins J : Mouse model of desmin-related cardiomyopathy. Circulation 2001, 103(19):2402-2407. 335. Geisler N, Weber K: The amino acid sequence of chicken muscle desmin provides a common structural model for intermediate filament proteins. Embo J 1982, 1(12):1649-1656. 336. Ralton J E , Lu X, Hutcheson A M , Quinlan RA: Identification of two N-terminal non-alpha-helical domain motifs important in the assembly of glial fibrillary acidic protein. J Cell Sci 1994, 107 ( Pt 7): 1935-1948. 337. Zhou A, Huntington JA, Pannu NS, Carrell RW, Read R J : How vitronectin binds PAI-1 to modulate fibrinolysis and cell migration. Nat Struct Biol 2003, 10(7):541-544. 338. Schroeck F, Arroyo de Prada N, Sperl S, Schmitt M, Viktor M: Interaction of plasminogen activator inhibitor type-1 (PAI-1) with vitronectin (Vn): mapping the binding sites on PAI-1 and Vn. Biol Chem 2002, 383(7-8):1143-1149. 339. Wun TC, Palmier MO, Siegel NR, Smith C E : Affinity purification of active plasminogen activator inhibitor-1 (PAI-1) using immobilized anhydrourokinase. Demonstration of the binding, stabilization, and activation of PAI-1 by vitronectin. J Biol Chem 1989, 264(14):7862-7868. 340. Wang X, Li F, Campbell S E , Gerdes A M : Chronic pressure overload cardiac hypertrophy and failure in guinea pigs: II. Cytoskeletal remodeling. J Mol Cell Cardiol 1999, 31(2):319-331. 341. Hein S, Kostin S, Heling A, Maeno Y, Schaper J : The role of the cytoskeleton in heart failure. Cardiovasc Res 2000, 45(2):273-278. 342. Madri JA, Williams SK: Capillary endothelial cell cultures: phenotypic modulation by matrix components. J Cell Biol 1983, 97(1 ):153-165. 343. Coombs NJ , Gough A C , Primrose J N : Optimisation of DNA and RNA extraction from archival formalin-fixed tissue. Nucleic Acids Res 1999, 27(16):e12. 344. Abrahamsen HN, Steiniche T, Nexo E, Hamilton-Dutoit S J , Sorensen BS: Towards quantitative mRNA analysis in paraffin-embedded tissues using real-time reverse transcriptase-polymerase chain reaction: a methodological study on lymph nodes from melanoma patients. J Mol Diagn 2003, 5(1):34-41. 345. Strom C C , Aplin M, Ploug T, Christoffersen TE, Langfort J , Viese M, Galbo H, Haunso S, Sheikh S P : Expression profiling reveals differences in 229 metabolic gene expression between exercise-induced cardiac effects and maladaptive cardiac hypertrophy. Febs J 2005, 272(11 ):2684-2695. 346. Urano T, Suzuki Y, Arakida M, Kanamori M, Takada A: The expression of exercise-induced tPA activity in blood is regulated by the basal level of PAI-1. Thromb Haemost 2001, 85(4):751-752. 347. Hilberg T, Glaser D, Reckhart C, Prasa D, Sturzebecher J , Gabriel HH: Blood coagulation and fibrinolysis after long-duration treadmill exercise controlled by individual anaerobic threshold. Eur J Appl Physiol 2003, 90(5-6):639-642. 348. Greig CA, Hameed M, Young A, Goldspink G, Noble B: Skeletal muscle IGF-I isoform expression in healthy women after isometric exercise. Growth Horm IGF Res 2006, 16(5-6):373-376. 349. Jensen L, Pilegaard H, Neufer PD, Hellsten Y: Effect of acute exercise and exercise training on V E G F splice variants in human skeletal muscle. Am J Physiol Regul Integr Comp Physiol 2004, 287(2):R397-402. 350. Clark WA, Rudnick S J , LaPres J J , Lesch M, Decker R S : Hypertrophy of isolated adult feline heart cells following beta-adrenergic-induced beating. Am J Physiol 1991, 261(3 Pt 1):C530-542. 351. Ennis IL, Escudero E M , Console G M , Camihort G, Dumm C G , Seidler RW, Camilion de Hurtado MC, Cingolani HE: Regression of isoproterenol-induced cardiac hypertrophy by Na+/H+ exchanger inhibition. Hypertension 2003, 41(6):1324-1329. 352. Slot JW, Garruti G, Martin S, Oorschot V, Posthuma G, Kraegen EW, Laybutt R, Thibault G, James DE: Glucose transporter (GLUT-4) is targeted to secretory granules in rat atrial cardiomyocytes. J Cell Biol 1997, 137(6):1243-1254. 353. Raghunath P N , Tomaszewski J E , Brady ST, Caron R J , Okada S S , Barnathan E S : Plasminogen activator system in human coronary atherosclerosis. Arterioscler Thromb Vase Biol 1995, 15(9): 1432-1443. 354. Dawson S, Henney A: The status of PAI-1 as a risk factor for arterial and thrombotic disease: a review. Atherosclerosis 1992, 95(2-3): 105-117. 355. Lijnen HR, Van Hoef B, Lupu F, Moons L, Carmeliet P, Collen D: Function of the plasminogen/plasmin and matrix metalloproteinase systems after vascular injury in mice with targeted inactivation of fibrinolytic system genes. Arterioscler Thromb Vase 81011998, 18(7): 1035-1045. 356. Konstantinides S, Schafer K, Thinnes T, Loskutoff DJ: Plasminogen activator inhibitor-1 and its cofactor vitronectin stabilize arterial thrombi after vascular injury in mice. Circulation 2001, 103(4):576-583. 230 357. Hamsten A, Wiman B, de Faire U, Blomback M: Increased plasma levels of a rapid inhibitor of tissue plasminogen activator in young survivors of myocardial infarction. NEnglJMed 1985, 313(25): 1557-1563. 358. Wiman B, Andersson T, Hallqvist J , Reuterwall C, Ahlbom A, deFaire U: Plasma levels of tissue plasminogen activator/plasminogen activator inhibitor-1 complex and von Willebrand factor are significant risk markers for recurrent myocardial infarction in the Stockholm Heart Epidemiology Program (SHEEP) study. Arterioscler Thromb Vase Biol 2000, 20(8):2019-2023. 359. Carmeliet PF : Physiological consequences of over- or under-expression of fibrinolytic system components in transgenic mice. Baillieres Clin Haematol 1995, 8(2):391-401. 360. Kvernmo HD, Osterud B: The effect of physical conditioning suggests adaptation in procoagulant and fibrinolytic potential. Thromb Res 1997, 87(6):559-569. 361. Fernhall B, Szymanski LM, Gorman PA, Milani J , Paup DC, Kessler C M : Fibrinolytic activity is not dependent upon exercise mode in post-myocardial infarction patients. Eur J Appl Physiol Occup PhysioH998, 78(3):247-252. 362. Schleef RR, Loskutoff DJ , Podor TJ : Immunoelectron microscopic localization of type 1 plasminogen activator inhibitor on the surface of activated endothelial cells. J Cell Biol 1991, 113(6): 1413-1423. 363. Podor TJ , Hirsh J , Gelehrter TD, Zeheb R, Torry D, Guigoz Y, Sierra F, Gauldie J : Type 1 plasminogen activator inhibitor is not an acute phase reactant in rats. Lack of IL-6- and hepatocyte-dependent synthesis. J /mmuno/1993, 150(1):225-235. 364. Swaisgood C M , French EL, Noga C, Simon R H , Ploplis VA: The development of bleomycin-induced pulmonary fibrosis in mice deficient for components of the fibrinolytic system. Am J Pathol 2000, 157(1): 177-187. 365. Tyagi S C , Lewis K, Pikes D, Marcello A, Mujumdar V S , Smiley LM, Moore CK: Stretch-induced membrane type matrix metalloproteinase and tissue plasminogen activator in cardiac fibroblast cells. J Cell Physiol 1998, 176(2):374-382. 366. Melle C, Camacho JA, Surber R, Betge S, Von Eggeling F, Zimmer T.-Reg ion-specific alterations of global protein expression in the remodelled rat myocardium. Int J Mol Med 2006, 18(6):1207-1215. 367. Grigoropoulos NF, Mathur A: Stem cells in cardiac repair. Curr Opin Pharmacol 2006, 6(2): 169-175. 231 APPENDIX I LIST OF PUBLICATIONS, ABSTRACTS AND PRESENTATIONS Publications: 1. Rezai N, Walinski H, Kerjner A, Bohunek L, Rossi FM, McManus BM, Podor TJ . Methods for examining stem cells in post-ischemic and transplanted hearts. Methods Mol Med. 2005;112:223-38. Review. 2. Rahmani M, Wong B.W, Ang L, Cheung C C , Carthy J .M, Walinski H, McManus B.M. Versican: Signaling to transcriptional control pathways. Review. Can J Physiol Pharmacol. 2006 Jan;84(1):77-92. Review. 3. Walinski H, Gyorffy S.F, Pate, G .E , Slaughter G, Leong H, Dawood F, Liu P, Parker T and Podor T.J. Exercise training simulates cardiomyocyte tissue-type plasminogen activator expression following myocardial infarction. Thromb Haemost. 2006 Dec;96(6):859-61. 4. Walinski H, Pate, G.E, Leong H, Rahmani M, Cheung C.T.Y, McManus B.M, Podor T.J . Binding of vitronectin to desmin at sites of acute myocardial ischemia reduces cardiomyocyte contractility (under review, Journal of Molecular and Cellular Cardiology, 2007). 5. Khazaei M, Moien A.F , Merchant S, Podor T, Walinski H, McNeil J , Reddy P, Kieffer T, Laher I. Exercise improves endothelial dysfunction in db/db mouse model of type II diabetes (under review, Journal of Clinical Investigation, 2007). 6. Poburko D, McLarnon H, Walinski H, van Breemen E, van Breemen C. Localization of inositol trisphosphate and ryanodine receptors on separate elements of the sarcoplasmic reticulum in vascular smooth muscle cells, (under review, American Journal of Physiology, 2006). 7. Walinski H, Pate, G.E, Bohunek L, Leong H, Rahmani M, Cheung C.T.Y, McManus B.M, Podor T.J. Vitronectin inhibits ventricular remodeling and cardiac function in mice following acute myocardial ischemia, (under review, Proc Natl Acad Sci U S A , 2007) 8. Cheung C, Luo H, Zhang J , Luo Z, Yanagawa B, Rahmani M, Walinski H, Si X, Yuan J , Walker E, Cox J , Overall C, Senior R, McManus BM. Ablation of matrix metalloproteinase-9 in Coxsackievirus-infected mice increases severity of myocarditis, (under review, Cardiovascular Research, 2007). 9. Leong HS, Batemen R M , Walinski H, Podor TJ . Targeting of endogenous PAI-1-dsRed and exogenous vitronectin to storage granules in endothelial and megakarycyte cell cultures, (under review, to Blood, 2007). 232 10. Leong HS, Batemen R M , Whalen B, Meredith A, Van Eeden S, Walinski H, Podor TJ . Distribution of PAI-1-vitronectin-vimentin ternary complexes on activated platelets and platelet microparticles by atomic force microscopy, (under review, Blood, 2007). Intellectual Property UBC File 07-046US "Improved ventricular remodeling and cardiac function following acute myocardial ischemia". US Patent: US60/836,932 "Compositions and methods for treatment of myocardial injury". Highlights of Abstracts and Presentations: 1. Podor T.J , Gyorffy S.F, Walinski H, Slaughter G , Parker T, Dawood F, and Liu P. Distribution of PAI-1, vitronectin and tissue-type plasminogen activator at sites of myocardial infarction. XVIIIth International Society of Thrombosis and Hemostasis, Paris, France. J Thromb Haemost. 2001, Suppl 1A. 2. Yanagawa B, Spiller B.O, Proctor D.G, Choy J , Luo H, Walinski H, Cheung P, Zhang M, Suarez A, Zhang J , Yang D.C, McManus B.M. C A R - F c to treat early CVB3-induced myocarditis. Presented at Providence Health Care Institute Annual Research Day, Vancouver, BC, Canada, (2002). 3. Yanagawa B, Luo H, Carthy C, Cheung C, Choy J , Walinski H, Zhang M, Cheung P, Zhang J , Chau D, Yang D.C, McManus B.M. The role of apoptosis in myocarditis. Presented at Providence Health Care Institute Annual Research Day, Vancouver, BC, Canada, (2002). 4. Walinski H, Loo S, Wang Y, Walley K.R, McManus B.M and Podor T.J . Binding of plasma vitronectin to cardiomyocyte intermediate filaments at sites of myocardial ischemia and infarction. University of British Columbia Pathology Research Day, Vancouver, BC, Canada, (2003). 5. Walinski H, Loo S, Wang Y, Walley K.R, McManus B.M and Podor T.J. Binding of plasma vitronectin to cardiomyocyte intermediate filaments at sites of myocardial ischemia and infarction. Providence Health Care Institute Annual Research Day, Vancouver, BC, Canada, (2003). 6. Walinski H, McManus B.M, Podor T.J. Role of vitronectin in the response to myocardial injury. Research in Progress, St. Paul's Hospital, Vancouver, BC, Canada, (2003). 233 7. Walinski H, Loo S, Wang Y, Walley K.R, McManus B.M and Podor T.J. Binding of plasma vitronectin to cardiomyocyte intermediate filaments at sites of myocardial ischemia and infarction. Scientific Conference on Molecular Mechanisms of Growth, Death and Regeneration in the Myocardium: Basic Biology and Insights into Ischemic Heart Disease and Heart Failure. American Heart Association, Snowbird, Utah, (2003). 8. Walinski H, Lowe R, Bohunek L, Leong H, Pate G, Fong P, Hamburger Y and Podor T.J. Vitronectin-deficient mice exhibit reduced cardiac contractility following acute myocardial infarction. Frontiers in Cardiovascular Science, Vancouver, BC, Canada (2003). 9. Walinski H, Rezai N, Sutherland A. Bioinformatical tools for the analysis of gene expression data. Research in Progress, St. Paul's Hospital, Vancouver, BC, Canada (2003). 10. Walinski H, Wang Y, McManus B.M and Podor T.J. Vitronectin is localized with intermediate filaments in reversibly damaged cardiomyocytes at sites of acute myocardial ischemia and infarction. United States and Canadian Academy of Pathology, Vancouver, BC, Canada, Mod Pathol. 2004;17, Suppl 1: 60A. 11. Walinski H, Wang Y, McManus B.M and Podor T.J. Serum-derived factors inhibit contractility of adult rat ventricular cardiomyocytes. Presented at International Vascular Biology Meeting, Toronto, O N , Canada. Cardiovasc Pathol. 2004;13(S3), Suppl: S142-S143. 12. Cruz R, Rezai N, Walinski H, Luo Z, Triche T, McManus B.M and Granville D.J. Mitral valve disease: A genomic comparison of valvular interstitial cells from normal, floppy and rheumatic valves. International Vascular Biology Meeting, Toronto, ON, Canada, Cardiovasc Pathol, 2004;13(S3), Suppl: S32. 13. Walinski H, Wang Y, McManus B.M and Podor T.J . Vitronectin is localized with intermediate filaments in reversibly damaged cardiomyocytes at sites of acute myocardial ischemia and infarction. Graduate Student Seminar Series, Department of Pathology and Laboratory Medicine, Vancouver General Hospital, Vancouver, BC, Canada. (2004). 14. Walinski H, Leong H.S, McManus B.M and Podor T.J . Vitronectin inhibits contractility in hypoxia-induced adult rat cardiomyocytes. National Research Forum for Young Investigators in Circulatory and Respiratory Health in Winnipeg, Manitoba, Canada, (2004). Clin Cardiol. 2004; 9 (1): 19. 15. Lowe R, Bohunek L, Pate G, Fong P, Walinski H, Podor T.J and Hamburger J . Natural history of the contribution of bone marrow derived cells to cardiac remodeling and wound healing Following Acute Myocardial Infarction. Canadian Cardiovascular Congress, Calgary, Alberta, Canada. Can J Cardiol. 2004;20, Suppl D: 157D. 234 16. Leong H.S, Walinski H, Westoby M and Podor T.J. Characterization of PAI-1-dsRed chimeric protein expression by cultured megakaryocyte and endothelial cells. Centre for Blood Research, University of British Columbia, Vancouver, BC, Canada. (2004). 17. Leong H.S, Walinski H, Westoby M and Podor T.J . Contribution of platelet PAI-1 ternary complexes in the development of transplant vascular disease. British Columbia Transplant Society 8th Annual Transplantation Research Day, Vancouver, BC, Canada, (2004). 18. Walinski H, Lowe R, Bohunek L, Pate G, Fong P, Hamburger J and Podor T.J. Vitronectin-deficient mice exhibit reduced cardiac remodeling and wound healing following acute myocardial infarction. Experimental Biology XXXVth International Congress of Physiological Sciences, San Diego, CA. F A S E B J . 2005; 19(4): A487. 19. Poburko D, McLarnon H, Walinski H, van Breemen E, van Breemen C. Activation of different G-protein linked receptors leads to convergent mitochondrial calcium signaling in aortic smooth muscle cells. Experimental Biology XXXVth International Congress of Physiological Sciences, San Diego, CA. F A S E B J . 2005;19(4): A667. 20. Walinski H, Pate G, Leong H. S., Bohunek L, McManus B. M. and Podor T. J . Vitronectin promotes wound healing following myocardial infarction. National Research Forum for Young Investigators in Circulatory and Respiratory Health in Winnipeg, Manitoba, Canada. Clin Cardiol. 2005; 10(1): 32. 21. Walinski H, Pate G, Bohunek L, Leong, H.S, McManus B.M and Podor T.J . Vitronectin accumulation regulates inflammatory migration and remodeling following myocardial infarction. 12th International Congress on Heart Disease, Vancouver, BC, Canada, (2005). Advances in Heart Disease -Proceedings of the 12th World Congress on Heart Disease - New Trends in Research, Diagnosis and Treatment, 2006. 22. Leong H. S, Bateman R. M, Walinski H, Podor T.J . Chimeric PAI-1-dsRed fusion protein characterization in MEG-01 megakaryocytic cells: model for PAI-1 trafficking from a-granules to cell surfaces. XXth Congress of the International Society on Thrombosis & Haemostasis. J Thromb Haemost. 2005; 3, Suppl 1. 23. Leong H. S, Bateman R. M, van Eeden S, Jiao Y.K, Walinski H, Podor T.J. Imaging of highly organized vitronectin-vimentin polymeric complexes that express on the surface of activated platelets and platelet microparticles using atomic force microscopy. XXth Congress of the International Society on Thrombosis & Haemostasis. J Thromb Haemost. 2005; 3, Suppl 1. 235 24. Pate G, Lowe R, Bohunek L, Walinski H, Fong P, Rossi F, Podor T, Hamburger J .N. Time-dependent contribution of bone marrow derived cells to cardiac remodeling and development of cardiomyocytes following acute myocardial infarction in Chimeric Mice. European Society of Cardiology Congress, Stockholm, Sweden. Eur Heart J . 2005 Sep;26(18):Suppl: #3736 25. Pate G, Lowe R, Bohunek L, Walinski H, Fong P, Heine H, Podor T.J, Hamburger J .N. Differentiation of bone marrow derived cells into cardiomyocytes: time to appearance and pattern of connexin staining suggests a timeframe to functional integration of several months. European Society of Cardiology Congress, Stockholm, Sweden, Eur Heart J . 2005 Sep;26(18):Suppl:#869 26. Podor T.J , Hodgson K, Pate P.E, Bohunek L, Lowe R.R, Walinski H, Saw J , Hamburger J .N . Spectral scanning by single and dual photon laser imaging with spectral scanning enables differentiation of true green fluorescent protein from background autofluorescence. European Society of Cardiology Congress, Stockholm, Sweden, Eur Heart J . 2005 Sep;26(18):Suppl: #1077 27. Walinski H, Pate G, Bohunek L, Fong P, Rossi F, Heine H, Hamburger J .N, Podor T.J . Bone marrow derived cells migrate to areas of vitronectin deposition in infarcted myocardium. Canadian Cardiovascular Congress, Montreal, Quebec, Canada, Can J Cardiol. 2005; 21, Suppl C: 254. 28. Rahmani M, Wong B, Cheung C, Allahverdian S, Carthy J , Walinski H, B McManus. B-catenin/TCF signaling in vascular response to injury: role of proteoglycan versican and matrix metalloproteinase cross-talk on remodeling events. Canadian Cardiovascular Congress, Montreal, Quebec, Canada, Can J Cardiol. 2005; 21, Suppl C: 589. 29. Walinski H, Pate G , Bohunek L, Fong P, Rossi F, Heine H, Hamburger J .N , Podor T.J. Bone marrow derived cells migrate to areas of vitronectin deposition in infarcted myocardium. Challenges in Regenerative Medicine, Toronto, Ontario, Canada, (2005). 30. Walinski, H. Studying gene function: creating knockout mice. The Science Creative Quarterly. University of British Columbia, Issue 2, Sept-Nov (2006). 31. Rahmani M, Ang L, Walinski H, McManus BM. C-terminal tails of T C F isoforms differentially control transcription of target genes in smooth muscle cells. Keystone Symposia, Snowbird Utah, (2006). 32. Walinski H, Pate G E , Bohunek L, McManus BM, Podor TJ . Vitronectin regulates remodeling post-myocardial infarction by regulating PAI-1, MMPs and cell migration. National Research Forum for Young Investigators in Circulatory and Respiratory Health in Winnipeg, Manitoba, Canada. Clin Cardiol. 2006;11(1); 44. 236 33. Walinski H, Pate G E , Bohunek L, McManus BM, Podor TJ . Vitronectin knockout mice exhibit improved healing and function following myocardial infarction. 10th Annual Scientific Meeting of the Heart Failure Society of America, Seattle, Washington. J Card Fail. 2006; 12(6); Suppl 1;S26-S27. 34. Walinski H, Pate G E , Bohunek L, Rahmani M, Cheung C, McManus BM, Podor TJ . Vitronectin deficiency promotes healing and improves function following myocardial infarction. Canadian Cardiovascular Congress, Vancouver, BC, Canada. Can J Cardiol. 2006; 22, Suppl D: 479. 35. Rahmani M, Ang L, Carthy J , Boroomand S, Walinski H, Wong BW, Chau E, McManus BM. TCF transcription factors: differential distribution and function in arterial wall cells. Vascular Matrix Biology and Bioengineering, Whistler, BC, Canada, (2007). 237 APPENDIX II AWARDS Heart Failure Society of America Travel Grant (2006) Young Investigator Forum Travel Award (2006) Young Investigator Forum Travel Award (2005) Canadian Cardiovascular Academy "Have A Heart" Bursary Winner (2004) The Xlllth International Vascular Biology Meeting Travel Award (2004) United States and Canadian Academy of Pathology Oral Presentation (2004) UBC Graduate Student Travel Award (2003) University of British Columbia PhD Tuition Award (2003-2007) APPENDIX III UBC RESEARCH ETHICS BOARD CERTIFICATES OF APPROVAL 239 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0100850/manifest

Comment

Related Items