Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The human cationic host defense peptide LL-37 modulates neutrophil apoptosis and chemokine responses Li, Yue Xin 2007

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2007-0163a.pdf [ 6.53MB ]
Metadata
JSON: 831-1.0100840.json
JSON-LD: 831-1.0100840-ld.json
RDF/XML (Pretty): 831-1.0100840-rdf.xml
RDF/JSON: 831-1.0100840-rdf.json
Turtle: 831-1.0100840-turtle.txt
N-Triples: 831-1.0100840-rdf-ntriples.txt
Original Record: 831-1.0100840-source.json
Full Text
831-1.0100840-fulltext.txt
Citation
831-1.0100840.ris

Full Text

THE HUMAN CATIONIC HOST DEFENSE PEPTIDE LL-37 MODULATES NEUTROPHIL APOPTOSIS AND CHEMOKINE RESPONSES by Yue X i n L i B.Med, Tianjin Medical University, 1998  A THESIS S U B M I T T E D I N P A R T I A L F U L F I L M E N T O F THE REQUIREMENTS FOR THE DEGREE OF Master of Science  in T H E F A C U L T Y O F G R A D U A T E STUDIES (Microbioloy & Immunology)  T H E UNIVERSITY OF BRITISH C O L U M B I A January 2007 ® Yue X i n Li, 2007  Abstract L L - 3 7 is a human cationic peptide expressed primarily by neutrophils and epithelial cells. It is a 37 amino acid peptide that belongs to the cathelicidin family o f the cationic host defense peptides. Accumulating evidence has demonstrated that L L - 3 7 has multiple immunomodulatory properties. The modulatory effects o f L L - 3 7 on neutrophils were investigated here, and L L - 3 7 was shown to be a potent inhibitor o f spontaneous apoptosis i n human neutrophils, signalling through P2X7 receptors and G-protein-coupled receptors other than the formyl peptide receptorlike-1 molecule. Inhibition o f neutrophil apoptosis involved modulation o f Mcl-1 expression, inhibition o f B I D and procaspase-3 cleavage, and the activation o f phosphatidylinositol-3 kinase and protein kinase C but not the extracellular signal-regulated kinase 1/2 mitogen-activated protein kinase (ERK1/2) pathway. In addition, L L - 3 7 modified neutrophil cytokine/chemokine responses to pro-inflammatory stimuli i n a stimulus-specific manner.  Specifically,  LL-37  abrogated LPS-induced T N F - a cytokine production while enhancing I L - i p elicited release o f T N F - a as well as a number o f chemokines including IL-8, Gro-a, C C L - 2 2 and M i p - l a . The increased release o f chemokines induced synergistically b y L L - 3 7 and I L - i p resulted from de novo protein synthesis and was found to be associated with the signalling through the E R K 1 / 2 and p38 M A P kinases and nuclear factor KB pathways. These novel immunomodulatory properties o f L L - 3 7 may contribute to peptide-mediated enhancement o f innate host defenses against acute infection and are o f considerable significance i n the development o f such peptides and their synthetic analogs as potential therapeutics for use against multiple antibiotic-resistant infectious diseases.  ii  Table of Contents ABSTRACT  ii  TABLE OF CONTENTS  iii  LIST O F T A B L E S  iv  LIST O F FIGURES  v  LIST O F ABBREVIATIONS  vi  viii  ACKNOWLEDGEMENTS CO-AUTHORSHIP STATEMENT  1.0  ix  INTRODUCTION  .....1  1.1 1.2 1.3  CATIONIC HOST DEFENSE PEPTIDES , CATHELICIDIN FAMILY PEPTIDES AND THE HUMAN HOST DEFENSE PEPTIDE LL-37 NEUTROPHILS ARE IMPORTANT PLAYERS IN IMMUNE RESPONSE  1 2 8  1.3.1 1.3.2 1.3.3 1.4  THE APOPTOSIS PATHWAYS R O L E OF B C L - 2 FAMILY PROTEINS IN MITOCHONDRIAL APOPTOSIS PATHWAY NEUTROPHILS ARE IMMUNOMODULATORY .1. EXPERIMENTAL M O D E L  9 10 11 12  1.5 1.6  HYPOTHESIS & EXPERIMENTAL GOALS BIBLIOGRAPHY  14 15  2.0  T H E H U M A N C A T I O N I C H O S T D E F E N S E P E P T I D E L L - 3 7 IS A N T I - A P O P T O T I C F O R NEUTROPHHJS 2.1 2.2 2.3 2.4 2.5  3.0  INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION BIBLIOGRAPHY  '.  ) ;  19  19 21 26 36 41  T H E H U M A N HOST D E F E N S E PEPTIDE LL-37 D I F F E R E N C I A L L Y M O D U L A T E S NEUTR...45 NEUTROPHIL C Y T O K I N E / C H E M O K I N E RESPONSES T O I N F L A M M A T O R Y STIMULI 3.1 3.2 3.3 3.4  INTRODUCTION MATERIALS & METHODS RESULTS DISCUSSION  45 47 50 61  3.5  BIBLIOGRAPHY  65  4.0  DISCUSSION 4.1 4.2 4.3 4.4 4.5 4.6  68  PROLONGED NEUTROPHIL SURVIVAL IS NECESSARY TO CONTROL ACUTE INFECTIONS BUT DETRIMENTAL68 WHEN DYSREGULATED THE PL3K AND P K C PATHWAYS ARE IMPORTANT IN LL-37-MEDIATED NEUTROPHIL SURVIVAL 69 L L - 3 7 MEDIATES INHIBITION OF NEUTROPHIL APOPTOSIS THROUGH EFFECTS ON BOTH INTRINSIC AND ....74 EXTRINSIC APOPTOTIC PATHWAYS LL-37 AMPLIFIES BENEFICIAL INFLAMMATORY SIGNALS BY ENHANCING NEUTROPHIL CHEMOK.INE 77 RESPONSES INDUCED BY IL-1B CONCLUSIONS 80 BIBLIOGRAPHY 81  iii  List of Tables  T A B L E 3.1.  PRIMER SEQUENCES USED IN THIS STUDY  List of Figures  FIGURE 1 . 1 . T H E STRUCTURE OF THE CATHELICIDINS FIGURE 1 . 2 . EXPERIMENTAL M O D E L  FIGURE FIGURE  2.1. 2.2.  INHIBITION OF NEUTROPHIL APOPTOSIS BY L L - 3 7 MODULATION OF NEUTROPHIL M C L - 1 EXPRESSION AND CLEAVAGE OF  3 13  2 6 B I D  IN RESPONSE TO  L L - 3 7 . 3 0  FIGURE 2 . 3 . FIGURE 2 . 4 .  MODULATION OF PRO-CASPASE-3 CLEAVAGE IN L L - 3 7 - T R E A T E D NEUTROPHILS 31 L L - 3 7 - I N D U C E D INHIBITION OF NEUTROPHIL APOPTOSIS IS MEDIATED BY P 2 X 7 AND A G-PROTEIN . . . 3 3 COUPLED RECEPTOR FIGURE 2 . 5 . L L - 3 7 - I N D U C E D NEUTROPHIL SURVIVAL INVOLVES MULTIPLE SIGNALLING PATHWAYS 3 5  FIGURE 3 . 1 . FIGURE 3 . 2 . FIGURE 3 . 3 . FIGURE 3 . 4 . FIGURE 3 . 5 .  MODULATION OF NEUTROPHIL T N F - A PRODUCTION BY L L - 3 7 L L - 3 7 ENHANCES IL-1B-INDUCED CHEMOKINE SECRETION BY NEUTROPHILS EFFECT OF L L - 3 7 AND I L - 1 B ON CHEMOKINE GENE EXPRESSION IN NEUTROPHILS INCREASED CHEMOKINE RELEASE AS A RESULT OF DENOVO PROTEIN SYNTHESIS SIGNALLING REGULATION OF CHEMOKINE RESPONSE INDUCED BY L L - 3 7 AND I L - 1 B  FIGURE 4 . 1 . FIGURE 4 . 2 . FIGURE 4 . 3 . FIGURE 4 . 4 .  M C L - 1 A N D A I GENE EXPRESSION IN NEUTROPHILS T H E P 3 8 SIGNALLING PATHWAY IS INVOLVED IN L L - 3 7 - I N D U C E D NEUTROPHIL SURVIVAL BID GENE EXPRESSION IN NEUTROPHILS EFFECT OF L L - 3 7 AND G M - C S F CO-STIMULATION ON CHEMOKINE RELEASE IN NEUTROPHILS  51 5 4 5 6  58 6 0  7 2 7 4 7 6 78  v  List of Abbreviations Akt Apafl BAK BAL BAX Bcl-2 BH3 BID BIK CF CGD CHDP CREB EGFR ELISA ERK1/2 FBS FPRL-1 GAPDH G-CSF GM-CSF Gro-a HBE HB-EGF HEK HRP IAP ILIKB IP-10 JNK LBP LPS MAPK Mcl-1 MCP-1 MCP-3 MIG MlP-la MIP-ip NF-KB NK PBMC PBS PE PI3K PKC  v-akt murine thymoma viral oncogene homolog 3 apoptotic protease-activating factor 1 BCL2-antagonist/killer 1 bronchial alveolar lavage BCL2-associated X protein B-cell leukemia/lymphoma 2 Bcl-2 homologous region 3 B H 3 interacting death agonist BCL2-interacting killer (apoptosis-inducing) cystic fibrosis chronic granulomatous disease cationic host defense peptide cAMP-responsive element-binding protein epidermal growth factor receptor enzyme-linked immunosorbent assay extracellular regulated protein kinase foetal bovine serum formyl peptide like receptor-1 glyseraldehyde-3-phosphate dehydrogenase granulocyte-colony stimulating factor granulocyte macrophage- colony stimulating factor growth-regulated oncogene alpha human bronchial epithelial cells heparin-binding E G F - l i k e growth factor human embryonic kidney horseradish peroxidase inhibitor o f apoptosis protein interleukin Inhibitory KB interferon-inducible protein 10 Jun N-terminal kinase lipopolysaccharide binding protein lipopolysaccharide mitogen activated protein kinase myeloid cell leukemia 1 macrophage chemotattractant protein 1 monocyte chemdtactic protein 3 monokine induced b y interferon-y macrophage inflammatory protein alpha macrophage inflammatory protein beta nuclear factor KB natural killer peripheral blood mononuclear cells phosphate buffered saline phycoerythrin phosphatidylinositol-3 -kinase protein kinase C  PLC PTX RANTES ROI RT-PCR SDS SDS-PAGE STAT TBS TBST TLR TNF-a  phospholipase C pertussis toxin regulated on activation, normal T-cell expressed and secreted Reactive oxygen intermediates reverse transcriptase polymerase chain reaction sodium dodecyl sulphate S D S polyacrylamide gel electrophoresis signal transducer and activator o f transcription tris buffered saline tris buffered saline + 0.1% Tween 20 toll-like receptor tumor necrosis factor alpha  Acknowledgements I sincerely thank m y supervisor, Dr. B o b Hancock, for his support and mentoring at every step o f the way. The trust he always placed i n me has helped me become an independent thinker and above all a responsible professional. B o b , I cannot thank you enough. I would also like to thank m y committee members Dr.Brett Finlay and Dr. Linda Matssuchi who always provided me with excellent suggestions and comments i n our meetings. I also thank the professors at the B . C . Childrens' hospital including Dr. David Speert, Dr. Stuart Turvey and Dr.Tobias Kollmann, for their invaluable advice and support whenever I was i n need for it. David, I w i l l always remember your delicious deep-fried turkey at your Christmas parties as well as the wacky gift exchange! In addition, m y very special thanks to Dr. Donald Davidson: Donald, you mentored me, all the way from Scotland: the distance didn't matter, I emailed you all kinds o f questions from statistics to graph making. I could not have published m y paper without you. I cannot express m y gratitude enough, to all the wonderful people at the Hancock lab. In particular, I would like to thank Jelena, Jessie and Linda for the brainstorming sessions we engaged i n over our projects. The most important thing though, was the mental support we provided for each other. I could not have made it through this program without you. Finally huge thanks to Susan, Barbara and Bernadette for helping me with various things: Susan, I always borrowed your swipe card for L S C and o f course, it rarely ever made it back on time to its rightful owner. Barb, without your help with all the paper work and the hectic scheduling, I wouldn't have made it to the finish line in time. Finally, I would like to thank m y parents, sister and o f course R a l f who have always been there for me. M y friends, Richa Anand and Kate Tanner, have helped me with everything, especially with putting m y misplaced confidence and commas back i n place, at the times when I seemed to have lost both. I hope I w i l l do justice to all the trust and effort you all have placed i n me, i n all aspects o f m y life.  viii  Co-authorship Statement Chapter 2 was originally published as; L i , Y . , Barlow P . G . , Wilkinson, T . S., Bowdish, D . M . E . , L a u , Y . E . , Cosseau, C , Haslet, C , John Simpson, A . , Hancock, R . E . W . and Donald J . Davidson. 2006. The human cationic host defense peptide L L - 3 7 mediates contrasting effects on apoptotic pathways i n different primary cells o f the innate immune system. J Leukoc Biol Sep;80(3):509-520. Chapter 3 is being prepared for publication as; L i , Y . , Pistolic, J . and Robert E . W . Hancock. 2006. The role o f human cationic host defense peptide L L - 3 7 i n regulating chemokine responses i n neutrophil and airway epithelial cell and their interactions.  In all instances where previously published materials are reproduced i n this thesis, they represent the original research and writing o f the author. A footnote at the beginning o f each chapter clearly indicates the contributions o f each author. Professor R . E . W . Hancock has co-authored all o f the publications listed here and his reading o f the thesis w i l l serve to verify this statement o f authorship.  ix  1.0  Introduction  1.1  Cationic host defense peptides  Cationic host defense peptides are widely distributed i n nature. Initially, these peptides were viewed as "nature's antibiotics" owing to their broad spectrum o f antimicrobial activity. More recent advances i n the field o f immunology suggest that i n addition to their ability to k i l l microorganisms directly, many o f these peptides have varied immunomodulatory effects (1). For example, the porcine peptide PR-39 has been shown to have the ability to stimulate wound healing v i a the induction o f proteoglycans termed syndecans (2). Following this, the same peptide has been demonstrated to protect against acute myocardial infarction and acute pancreatitis i n rodent models (2). It has become clear that cationic host defense peptides, an ancient component o f the innate immunity, are more than simply "nature's antibiotics" but rather play a complex role i n attenuating inflammation and resolving infections. To date, more than 700 eukaryotic cationic host defense peptides have been described (http://www.bbcm.univ.trieste.it/~tossi/antimic.htmlV with all deriving from larger precursors which undergo post-translational modifications to generate mature peptides (3). Mature cationic host defense peptides show an extraordinary molecular diversity, with most ranging i n size from 12 to 50 amino acids, containing two or more positively charged residues (due to the presence o f basic residues such as arginine and lysine) and a large proportion (generally >50%) o f hydrophobic residues [reviewed i n (4)]. Although varying greatly i n size, these peptides assume secondary structures which fall into four classes, including: i) a-helical, ii) P-stranded due to the presence o f two or more disulphide bonds, iii) P-hairpin or loop due to the presence o f a single disulphide bond and/or cyclization o f the peptide chain, and iv) extended (Figure 1.1). It should  1  be noted that many o f these peptides are unstructured i n free solution, and only fold into their final configurations upon partitioning into biological membranes (4-6). In mammals, one o f the best characterized families o f peptides is the cathelicidins, which have been isolated from all mammalian species studied, including humans, monkeys, rats, mice, cattle, pigs, rabbits [reviewed in (7)]. W h i l e humans and mice each encode one cathelicidin peptide, namely L L - 3 7 and C R A M P , some mammalian species contain multiple genes encoding peptides that belong to this family (7).  1.2  Cathelicidin family peptides and the human host defense peptide LL-37 The first well studied peptide i n the cathelicidin family was the bovine neutrophil peptide  Bac5. In the process o f cloning Bac5 more than ten years ago, Zanetti's group  detected  additional c D N A s which displayed a high degree o f identity to Bac5, yet predicted different peptide sequences (8). These c D N A sequences also showed a significant sequence homology i n the  pro-region to  an  earlier identified porcine  leukocyte peptide  named  cathelin  (9).  Consequently, this group o f peptides were termed cathelicidin after the porcine peptide (now known as PR-39) and thus, initiated the discovery o f other members within this peptide family (7). L i k e any other cationic host defense peptide, cathelicidins are also derived from larger precursors. The precursor molecules consists o f an N-terminal pre-region called the cathelin domain and a C-terminal domain encoding for the mature peptides, as illustrated i n Figure 1.1. There is significant conservation o f amino-acid sequence (greater than 70% sequence identity) i n the cathelin domain o f the precursor molecules across this class o f peptides (10). The C-terminal peptide domain shares little homology, and is released i n its active form v i a proteolytic processing. The first event occurring is the cleavage by the signal peptidase to remove the signal  2  sequences, which serves to direct the cellular trafficking o f the peptide during biosynthesis. For most o f the bovine and porcine cathelicidins, the release o f the mature peptide from the cathelin domain is accomplished b y elastase derived from neutrophils (11). W h i l e the mature peptides have been shown to have diverse biological activities, our current understanding o f the roles o f the cathelin domain is limited.  H  C o n s e r v e d Pre-pro region 29-30 amino acids  98-114 amino acids  Mature Peptide Antimicrobial & Immunomodulatory 12-100 amino acids  PRO Signal Peptide C l e a v a g e site  LL-37 BMAP-27 - CAP18 Protegrin-1 PR39 f t Indo licit) in Bactenecin  LLG DFFR KS K E K I G K E F K R I V Q RIKDFLRN LVP RTES • RFKRFR K K F K K L F K K L S P VIP LLH LG G LR KR LR KFRN KIKEKLKKIG QKIQ G LLP K I A P RTDY RGGRLCYCRRRFCVCVGRG RRRPRPPYLPRPRPPPFFPPRLPPRIPPGFPPRFPPRFPG ILPWKWPWWPWRRG RLCRIWIEVCR  1  cc-helical  p-sheet  extended  loop  Figure 1.1. The Structure of the Cathelicidins. The cathelicidins shared a conseved pre-proregion with homology to the cathelin doman. The N-terminal domain contains a signal  sequence  while  the  C  terminal  contains  both  the  antimicrobial  and  immunomodulatory properties. The four classes o f secondary structure are represented by various peptides with their sequences shown [this figure is modified from (12, 13) and http://www.bbcm.univ.trieste.it/~tossi/antimic.html1  3  The sole human cathelicidin h C A P 1 8 / L L - 3 7 was discovered i n 1995 independently b y three groups (14-16). H i g h concentrations o f the unprocessed pro-peptide were first found i n the specific granules o f neutrophils (14). Following this, it became clear that when h C A P 1 8 is released extracellularly as a result o f neutrophil degranulation, the pro-peptide is processed b y proteinase 3 (17), liberating the mature peptide L L - 3 7 which contains 37 amino acids ( L L G D F F R K S K E K I G K E F K R I V Q R I K D F L R N L V P R T E S ) (18). In neutrophils, proteinase 3 is stored i n a different compartment, referred to as the azurophil granule, thereby preventing the cleavage o f h C A P I 8 while it is still inside o f specific granules (17). In addition to neutrophils, h C A P 1 8 / L L - 3 7 has been found i n a variety o f blood cell populations including N K cells, y8T cells, B cells, monocytes and mast cells, although at relatively small concentrations. The h C A P 1 8 precursor is also expressed i n various epithelial tissues and keratinocytes i n response to stimulation b y inflammation signals [reviewed i n (19)], suggesting its important role at the mucosal surfaces where initial host-pathogen encounters occur. H o w these epithelium-derived h C A P 1 8 molecules are processed to generate mature L L - 3 7 i n general remains unclear. One recent report demonstrated that seminal h C A P - 1 8 is processed i n acidic vaginal fluid (pH 4) b y a prostate-derived protease gastricsin, resulting i n a 38 amino acid peptide, A L L - 3 8 (20). However, the biological functions o f the peptide variants have not been extensively studied.  The earliest information on the biological functions o f L L - 3 7 (other than antimicrobial activity) defined its ability to bind L P S , and to confer protection against sepsis i n mice and inhibit the LPS-induced release o f nitric oxide from macrophages (14). In the past five years, there has been a marked increase i n the information o n novel immunomodulatory activities o f L L - 3 7 , gained from in vivo and in vitro studies. For example, recent microarray experiments i n our laboratory have shown that L L - 3 7 selectively modulates the transcription o f specific L P S induced inflammatory genes i n human monocytic cells (21). Moreover, L L - 3 7 is directly  4  chemotactic for a variety o f cells i n the innate and adaptive immune response, including human peripheral blood derived neutrophils, mast cells, eosinophils and C D 4 + T cells (22-24). L L - 3 7 also induces mast cell degranulation, which results i n the release o f inflammatory mediators such as chemoattractants and histamine (25). These substances increase vascular permeability thereby aiding neutrophils to extravasate to inflamed tissues.  In addition, L L - 3 7 has been shown to  induce chemokine (such as M C P - 1 , M C P - 3 , M l P - l a and M I P - i p ) gene expression i n human peripheral blood derived monocytes, and Gro-a and R A N T E S production from airway epithelial cells (Bowdish, Pistolic and Hancock, unpublished results). Further, the chemokine IL-8 has been well documented to be induced b y L L - 3 7 i n various cells types (20, 26, 27). Collectively, these activities enhance the recruitment o f effector cells o f the immune response to the site o f infection to eliminate invading pathogens. Interestingly, L L - 3 7 does not induce release o f proinflammatory cytokine T N F - a  from monocytes or epithelial cells [(21), and Pistolic and  Hancock, unpublished results]. Indeed, L L - 3 7 has been shown to inhibit the production o f T N F a induced by L P S i n human monocytic cells (21), thereby protecting the host from excessive induction o f immune responses which often result i n sepsis. L L - 3 7 further facilitates hosts to resolve infection b y stimulating wound neovascularization and re-epithelialization o f healing skin, thereby promoting wound healing, as demonstrated ex vivo and i n an animal model (28, 29). Interestingly, high concentrations o f L L - 3 7 (> 50 |ig/ml) have been recently shown to induce apoptosis i n cultured lung and airway epithelial cell lines, and in vivo i n the murine airway (30). In that report, it was shown that LL-37-induced apoptosis in vitro involved the activation o f caspase pathways and was substantially inhibited b y an inhibitor o f caspase 3. It was not investigated, however, which signalling pathways were implicated and whether any o f the proposed L L - 3 7 receptors were involved. Indeed, the signalling mechanism through which L L - 3 7 exerts its immunomodulatory effects has been o f particular interest and continues to be a very active area o f research. 5  To  date, three receptors have been shown to be associated with LL-37-mediated  immonomodulatory activities, including P2X7 (31), F P R L - 1 (formyl peptide receptor-like 1) (22), and E G F R (epidermal growth factor receptor) (20). The purinergic receptor P2X7 has been shown to mediate LL-37-induced I L - i p release from LPS-primed human primary monocytes, as inhibitors o f P 2 X partially blocked this effect. F P R L - 1 is a G-protein coupled receptor and is 7  found to be associated with a number o f LL-37-mediated effects. For example, LL-37-induced angiogenesis v i a a direct effect on endothelial cells was suggested to be mediated by F P R L - 1 (32). F P R L - 1 is also utilized by L L - 3 7 to induce chemotaxis o f a number o f human blood cell types (22). In addition, FPRLl-transfected H E K 2 9 3 cells migrated i n response to L L - 3 7 whereas the parental cells did not. It has been proposed that L L - 3 7 activates this receptor v i a specific, yet low-affinity binding (22). Indeed, L L - 3 7 has been demonstrated to bind two receptors i n lung epithelial cells, a high affinity and a low affinity receptor, and the low-affinity receptor appears to be F P R L - 1 (33). It is also thought that a G-protein coupled receptor other than F P R L - 1 may be involved  in LL-37  mediated  effects.  For example,  LL-37-induced  IL-8 production in  keratinocytes is pertussis toxin sensitive, but a specific agonist for F P R L - 1 , W K Y M V M - N H 2 , does not induce these effects even at high concentrations (29).  U n l i k e P2X7 and F P R L - 1 , E G F R has been proposed to be trans-activated by L L - 3 7 . In airway epithelial cells, L L - 3 7 induces E G F R activation and subsequent IL-8 production, and this effect requires metalloproteinase activity because broad spectrum metalloproteinase inhibitors block IL-8 release (20). It has therefore been proposed that L L - 3 7 , b y as-yet undetermined means, activates a metalloproteinase which subsequently cleaves membrane-anchored E G F R ligands, resulting i n E G F R activation. It is important to note that there are indications that not all o f the LL-37-induced effects require a receptor. Probably the strongest evidence is that IL-8 can be induced b y the D amino acid analog o f L L - 3 7 i n keratinocytes, and the induction is even more  6  potent than caused b y the naturally occurring L-form peptide, possibly due to the increased resistance o f the D peptide to proteolytic degradation (29). Although there are exceptions, in general  most  receptors  do  not  recognize  D-amino  acids  formed  ligands  owing  to  stereospecificity. W i t h regards to signalling pathways, it appears that M A P kinases play an important role in L L - 3 7 mediated effects. L L - 3 7 has been shown to induce E R K 1 / 2 , p38 and I N K activation i n the airway epithelial cell line N C I - H 2 9 2 (20). E R K 1 / 2 and p38 are also phosphorylated in response to L L - 3 7 i n human keratinocytes, mast cells, 16HBE4o" and monocytes (24, 26, 27). In addition to M A P kinases, L L - 3 7  phosphorylates  STAT3  via HB-EGF-mediated  EGFR  transactivation i n keratinocytes (34). Y u , Bowdish and Hancock found that i n human P B M C s , L L - 3 7 induces transient degradation o f phosphorylated IKB and subsequent nuclear translocation of NFKB subunit p50 ( Y u et al, manuscript submitted), indicating that L L - 3 7 may interact with the T L R pathways at undetermined levels. Y u also demonstrated, through conventional inhibitor studies, that the PI3 kinase and downstream A k t pathways are also involved i n LL-37-mediated IL-8 release i n human P B M C s . Although the knowledge o f how L L - 3 7 modulates the immune response has increased markedly i n recent years, in-depth studies are still needed to fully understand the complex roles of this peptide i n innate immunity. T o date, much o f the information on the immunomodulatory properties o f L L - 3 7 has been derived from studies on monocytes, airway epithelial and keratinocytes. However, at the infection foci, the most abundant leukocytes are neutrophils, and as discussed earlier, the concentration o f L L - 3 7 at these sites can be high owing to neutrophil degranulation, yet very little is known how L L - 3 7 interacts with neutrophils. Neutrophils are major effector cells i n innate immunity and are able to regulate immune responses via secretion  7  o f cytokines, it is therefore logical and meaningful to examine how L L - 3 7 affects the functions o f neutrophils and modulates their immune responses i n physiological settings.  1.3  Neutrophils are important players of immune response Human neutrophils represent the most abundant granulocyte subtype (50% to 60% o f the  total leukocytes) i n circulation (35). They play a key role i n the early stages o f the acute inflammatory responses to microbial infections. After pathogen invasion, neutrophils are quickly recruited from circulation to the site o f infection where they, along with tissue macrophages, eliminate pathogens v i a phagocytosis (36). Activated neutophils also release toxic granular contents such as reactive oxygen species and granular enzymes like proteases to k i l l pathogens; however, these toxic compounds also cause collateral host tissue damage (36). In addition to their ability to directly k i l l pathogens, neutrophils can, when exposed to inflammatory mediators such as L P S , produce a variety o f cytokines and chemokines which subsequently modulate the inflammatory response (37). In this sense, neutrophils are also considered immunomudulators i n addition to their long recognized role i n phagocytosing invading microbes. Neutrophils are developed in bone marrow from myeloid stem cells and are then released into the circulation where they survive for approximately 24 to 36 hours (38). The turnover o f neutrophils is rapid and is important for the maintenance o f the homeostasis o f the immune system. Efficient and safe elimination o f aging neutrophils is achieved by constitutive apoptosis, a process permitting the removal o f dead cells without the massive release o f cytotoxic contents into the surrounding tissues (36). Aged, apoptotic neutrophils migrate to tissues and are removed by macrophages or other cells (e.g., fibroblasts) by phagocytosis (39). While neutrophils have a very short life-span i n the circulation, their survival time can increase significantly once they extravasate into the inflamed tissues where they become exposed to pro-inflammatory mediators such as G M - C S F and L P S , or to certain environmental conditions such as hypoxia. O n the 8  contrary, a number o f so-called death factors [for example, reactive oxygen intermediates (ROI) or IL-10] can accelerate spontaneous apoptosis o f the neutrophils (40). Neutrophils from patients with chronic granulomatous disease have prolonged life spans as these cells are deficient i n generating R O I (41). W h i l e extended survival o f neutrophils is essential to clear pathogens during acute infection, dysregulation o f the apoptosis processes may be responsible for the persistence o f immune cells at inflammatory sites and the development o f chronic inflammatory disease (40). For example, cystic fibrosis ( C F ) is a disease characterized by neutrophil dominated lung inflammation. Even i n the absence o f detectable infection, substantially elevated amounts o f pro-inflammatory cytokines and large numbers o f neutrophils are found i n the airways o f C F infants. It has been proposed that enhanced neutrophil survival may be attributed to the effects o f increased expression o f epithelial derived G M - C S F and G - C S F (42).  1.3.1  The apoptosis pathways In humans cells, apoptosis can be initiated through two distinct but ultimately converging  signalling pathways, namely the extrinsic and the intrinsic pathways [reviewed i n (43)] . The extrinsic pathway can be induced by the activation o f death receptors such as T N F R family and Fas with their cognate ligands. (44). A s an example, the ligation o f FasL triggers the trimerization o f the Fas receptors and recruits initiator caspases (predominantly procaspase 8 or procaspase 10) through specialized adaptor proteins (45, 46). This promotes the aggregation o f procaspase 8 and triggers autoproteolysis to generate active caspase 8 (47). Activated caspase-8 elicits apoptosis by means o f two parallel cascades: it directly cleaves and activates caspase-3 (48) and it cleaves B i d , a pro-apoptotic Bcl-2 family protein (see below). Truncated B I D (tBID) translocates to the outer membrane o f mitochondria and induces cytochrome c release which ultimately leads to the activation o f caspase 3 (38).  9  The  intrinsic pathway can be induced b y developmental cues such as growth factor  withdrawal, and intrinsic factors such as D N A damage and unfolded proteins [reviewed i n (38)]. These factors promote the depolarization o f the mitochondrial membrane and subsequent release of cytochrome c. U p o n release from mitochondria, cytochrome c binds A p a f l  (apoptotic  protease-activating factor 1) and forms an activation complex with caspase-9, leading to the activation o f the latter which subsequently cleaves and activates caspase 3 (49).  1.3.2  Role of Bcl-2 family proteins in mitochondrial apoptosis pathway A s mentioned earlier, B I D belongs to the Bcl-2 family which can be functionally  categorized into two groups by ability to inhibit or activate cell death: a) the pro-apoptotic proteins ( B A X , B A D and B I K , to name a few) and b) the anti-apoptotic proteins (such as B c l - 2 , B c l - x , Mcl-1 and A l ) [reviewed in (50)]. These proteins form a complex network o f checkpoints and balances that regulate the mitochondrial permeability and the release o f cytochrome c. Although it is not currently known how exactly these proteins interact to control cell death, it has been proposed that following death signalling, pro-apoptotic B A X and B A K disrupt the outer mitochondrial membrane by forming channels or b y modifying membrane pores (51). Such disruptions w i l l cause the release o f cytochrome c and other apoptotic proteins, irreversibly executing the death program. In contrast, anti-apoptotic proteins have been shown to form heterodimers w i t h , B A X and B A K , suggesting their role as a "sink" to reduce the level o f free pro-apoptotic Bcl-2 proteins (52). A subgroup o f pro-apoptotic proteins (including BID) does not directly disrupt mitochondrial membrane; however, they "sensitize" cells to death stimuli by a) binding to anti-apoptotic proteins thereby displacing and relieving inhibition o f the bound B A K / B A K , or b) directly triggering the activity o f B A X / B A K (52).  10  Neutrophils constitutively express a variety o f pro-apoptotic B c l - 2 proteins including B A X , B A D and B A K ; however, their cellular levels change very little when neutrophils are exposed to agents that either delay or accelerate apoptosis (53). A m o n g the anti-apoptotic B c l - 2 proteins, M c l - 1 , A l and BC1-XL have been reported to be expressed i n neutrophils, yet immunoblotting fails to detect significant levels o f BC1-XL protein using a variety o f commercial antibodies i n all studies (54) despite the detection o f BC1-XL m R N A i n RNase protection assays. To date, Mcl-1 is the best characterized anti-apoptotic B c l - 2 family member i n human neutrophils apoptosis studies. Mcl-1 is a unique member o f the B c l - 2 family i n that it has a very short half life, estimated between 1 hour and a few hours before degradation by proteinases (53). The expression o f this protein can be up-regulated at the transcriptional level in conditions like hypoxia (55) or i n response to certain cytokines such as IL-3 and G M - C S F (54). G M - C S F can also increase Mcl-1 protein stability thereby protecting it from degradation (56). Conversely, deprivation o f G M - C S F has been shown to result i n a significant decrease o f Mcl-1  protein i n the human myeloid  progenitor cell line TF-1 (57). The high turnover rate o f Mcl-1 leads to rapid loss o f this antiapoptotic Bcl-2 protein i n neutrophils undergoing apoptosis. Indeed the loss o f Mcl-1 has been postulated to be the major inducer o f spontaneous apoptosis i n neutrophils (53). It is also conceivable that the apoptotic program is initiated i n neutrophils as soon as they are released from bone marrow into the circulation, i n which survival factors such as G M - C S F are no longer present.  1.3.3  Neutrophils are immunomodulatory Neutrophils are terminally differentiated cells, and they have been conventionally  considered to lack the ability to synthesize new proteins i n circulation. However i n recent years, they have been shown to express and secret a variety o f pro- and anti-inflammatory proteins 11  including cytokines, chemokines, growth factors, and interferons i n characteristic patterns i n response to stimulatory agents (37). A m o n g these, chemokines represent a group o f structurally related cytokines with the ability to specifically recruit distinct leukocyte subpopulations (58). In addition to their role i n coordinating the immune responses, these proteins have also been shown to be involved i n B and T-cell development and i n the modulation o f angiogenesis (59). Neutrophils have been demonstrated to express and secrete a number o f chemokines including IL-8, Gro-a, M i p - l a , M i p - i p , IP-10, and M I G (60). It is interesting to note that, while neutrophils are a major source o f IL-8 production, these cells are also the primary targets o f IL-8. Specifically, IL-8 is chemotactic for neutrophils and induces neutrophil respiratory burst activity, enhanced expression o f surface adhesion molecules, and increased adherence to endothelial cells (60). These reciprocal interactions would amplify inflammatory responses, allowing the host to rapidly resolve acute infections. Given the essential roles o f cytokines and chemokines in the host immune defense, it is reasonable to consider neutrophils as important regulators o f the immune responses.  1.4  Experimental Model A t the site o f infection, the expression o f h C A P - 1 8 is induced in local epithelia upon  detection o f infection (61, 62).  Elevated levels o f L L - 3 7 , together with other inflammatory  mediators such as IL-8, would create a gradient permitting chemotaxis o f neutrophils to the infection  focus.  Recruited neutrophils  would  release  granule  contents  including  high  concentrations o f antimicrobial peptides such as h C A P 1 8 . This would further increase the local concentration o f L L - 3 7 as the precursor h C A P - 1 8 is processed b y proteinase 3. Raised levels o f L L - 3 7 would then, according to this thesis, enhance the survival o f neutrophils, and modulate neutrophil chemokine responses to endogenous inflammatory signals. Thus collectively, L L - 3 7  12  would augment the innate host defenses mediated through neutrophils to counter acute infectious challenge through multiple mechanisms. The experimental model proposed and pursued i n this thesis is summarized i n Figure 1.2.  ACUTE INFECTION  D. J. Davidson  Figure 1.2. Experimental hCAPl8/LL-37.  Model. U p o n infection, l o c a l epithelia release  L L - 3 7 , together w i t h other i n f l a m m a t o r y m e d i a t o r s ,  chemoattract neutrophils to the site o f infection. Recruited neutrophils release granule contents, and this further increases the local concentration o f L L - 3 7 . Thus, raised levels o f L L - 3 7 in an acute inflammatory scenario could contribute to innate host defenses b y mediating recruitment and enhanced survival o f neutrophils and the modulation o f innate immune cell responses to endogenous inflammatory signals, to enhance the resolution o f an acute infectious insult (Art by Donald Davidson).  13  1.5  Hypothesis & Experimental Goals The primary goal o f this study was to define the immunomodulatory effects o f L L - 3 7 on  human neutrophil responses, with particular focus on their apoptotic processes.  I hypothesized  that L L - 3 7 enhances innate immunity at sites o f infection / inflammation by affecting apoptosis and other functions o f neutrophils. A t the beginning o f this study, I examined the ability o f L L 37 to inhibit neutrophil apoptosis in an efficient and timely manner, as well as the mechanisms through which L L - 3 7 exerts its effects. In particular, because Bcl-2 family proteins play an important role i n regulating apoptosis, one o f the goals was to evaluate the cellular levels o f important members o f this family such as M c l - 1 and B I D . M y aim was also to elucidate signalling pathways and putative receptors through which L L - 3 7 mediates its inhibitory effects on neutrophil apoptosis. Another important aspect o f this study was to evaluate how L L - 3 7 affects the chemokine responses o f neutrophils, i n the presence or absence o f other inflammatory stimuli including I L - i p and L P S .  14  1.6  Bibliography  1.  Finlay, B . B . , and R . E . Hancock. 2004. C a n innate immunity be enhanced to treat microbial infections? Nat Rev Microbiol 2:497-504. L i , J . , M . Post, R . V o l k , Y . Gao, M . L i , C . Metais, K . Sato, J. Tsai, W . A i r d , R . D . Rosenberg, T. G . Hampton, F . Sellke, P . Carmeliet, and M . Simons. 2000. P R 3 9 , a peptide regulator o f angiogenesis. Nat Med 6:49-55. Gao, Y . , S. Lecker, M . J. Post, A . J. Hietaranta, J. L i , R . V o l k , M . L i , K . Sato, A . K . Saluja, M . L . Steer, A . L . Goldberg, and M . Simons. 2000. Inhibition o f ubiquitinproteasome pathway-mediated I kappa B alpha degradation b y a naturally occurring antibacterial peptide. J Clin Invest 106:439-448. Zasloff, M . 2002. Antimicrobial peptides o f multicellular organisms. Nature 415:389395. Hancock, R. E . 2001. Cationic peptides: effectors i n innate immunity and novel antimicrobials. Lancet Infect Dis 1:156-164. Scott, M . G . , and R . E . Hancock. 2000. Cationic antimicrobial peptides and their multifunctional role i n the immune system. Crit Rev Immunol 20:407-431. Sitaram, N . , and R . Nagaraj. 2002. Host-defense antimicrobial peptides: importance o f structure for activity. Curr Pharm Des 8:727-742. Zanetti, M . 2004. Cathelicidins, multifunctional peptides o f the innate immunity. J Leukoc Biol 75:39-48. Zanetti, M . , G . D e l Sal, P . Storici, C . Schneider, and D . Romeo. 1993. The c D N A o f the neutrophil antibiotic Bac5 predicts a pro-sequence homologous to a cysteine proteinase inhibitor that is common to other neutrophil antibiotics. J Biol Chem 268:522-526. Ritonja, A . , M . Kopitar, R . Jerala, and V . Turk. 1989. Primary structure o f a new cysteine proteinase inhibitor from pig leucocytes. FEBS Lett 255:211-214. Gennaro, R . , and M . Zanetti. 2000. Structural features and biological activities o f the cathelicidin-derived antimicrobial peptides. Biopolymers 55:31-49. Shinnar, A . E . , K . L . Butler, and H . J. Park. 2003. Cathelicidin family o f antimicrobial peptides: proteolytic processing and protease resistance. Bioorg Chem 31:425-436. Mookherjee, N . , K . L . Brown, D . M . Bowdish, S. Doria, R . Falsafi, K . Hokamp, F . M . Roche, R. M u , G . H . Doho, J . Pistolic, J. P. Powers, J . Bryan, F . S. Brinkman, and R. E . Hancock. 2006. Modulation o f the TLR-mediated inflammatory response b y the endogenous human host defense peptide L L - 3 7 . J Immunol 176:2455-2464. Tomasinsig, L . , and M . Zanetti. 2005. The cathelicidins-structure, function and evolution. Curr Protein Pept Sci 6:23-34. Larrick, J . W . , M . Hirata, R . F . Balint, J . Lee, J . Zhong, and S. C . Wright. 1995. Human C A P 18: a novel antimicrobial lipopolysaccharide-binding protein. Infect Immun 63:12911297. Cowland, J . B . , A . H . Johnsen, and N . Borregaard. 1995. h C A P - 1 8 , a cathelin/probactenecin-like protein o f human neutrophil specific granules. FEBS Lett 368:173-176. Agerberth, B . , H . Gunne, J . Odeberg, P . Kogner, H . G . Boman, and G . H . Gudmundsson. 1995. F A L L - 3 9 , a putative human peptide antibiotic, is cysteine-free and expressed i n bone marrow and testis. Proc Natl Acad Sci USA 92:195-199. Sorensen, O . E . , P. Follin, A . H . Johnsen, J. Calafat, G . S. Tjabringa, P . S. Hiemstra, and N . Borregaard. 2001. Human cathelicidin, h C A P - 1 8 , is processed to the antimicrobial peptide L L - 3 7 b y extracellular cleavage with proteinase 3. Blood 97:3951-3959.  2.  3.  4. 5. 6. 7. 8. 9.  10. 11. 12. 13.  14. 15.  16. 17.  18.  15  19.  20.  21.  22.  23.  24.  25.  26.  27.  28.  29.  30.  31.  32.  Davidson, D . J., A . J . Currie, G . S. Reid, D . M . Bowdish, K . L . M a c D o n a l d , R . C . M a , R . E . Hancock, and D . P . Speert. 2004. The cationic antimicrobial peptide L L - 3 7 modulates dendritic cell differentiation and dendritic cell-induced T cell polarization. J Immunol 172:1146-1156. Durr, U . H . , U . S. Sudheendra, and A . Ramamoorthy. 2006. L L - 3 7 , the only human member o f the cathelicidin family o f antimicrobial peptides. Biochim Biophys Acta 1758:1408-1425. Sorensen, O . E . , L . Gram, A . H . Johnsen, E . Andersson, S. Bangsboll, G . S. Tjabringa, P. S. Hiemstra, J. M a l m , A . Egesten, and N . Borregaard. 2003. Processing o f seminal plasma h C A P - 1 8 to A L L - 3 8 b y gastricsin: a novel mechanism o f generating antimicrobial peptides i n vagina. J Biol Chem 278:28540-28546. D e , Y . , Q . Chen, A . P. Schmidt, G . M . Anderson, J . M . Wang, J . Wooters, J. J . Oppenheim, and O . Chertov. 2000. L L - 3 7 , the neutrophil granule- and epithelial cellderived cathelicidin, utilizes formyl peptide receptor-like 1 ( F P R L 1 ) as a receptor to chemoattract human peripheral blood neutrophils, monocytes, and T cells. J Exp Med 192:1069-1074. Tjabringa, G . S., D . K . Ninaber, J . W . Drijfhout, K . F . Rabe, and P . S. Hiemstra. 2006. Human cathelicidin L L - 3 7 is a chemoattractant for eosinophils and neutrophils that acts via formyl-peptide receptors. IntArch Allergy Immunol 140:103-112. Niyonsaba, F., K . Iwabuchi, A . Someya, M . Hirata, H . Matsuda, H . Ogawa, and I. Nagaoka. 2002. A cathelicidin family o f human antibacterial peptide L L - 3 7 induces mast cell chemotaxis. Immunology 106:20-26. Niyonsaba, F., A . Someya, M . Hirata, H . Ogawa, and I. Nagaoka. 2001. Evaluation o f the effects o f peptide antibiotics human beta-defensins-l/-2 and L L - 3 7 on histamine release and prostaglandin D(2) production from mast cells. Eur J Immunol 31:1066-1075. Tjabringa, G . S., J . Aarbiou, D . K . Ninaber, J . W . Drijfhout, O . E . Sorensen, N . Borregaard, K . F . Rabe, and P. S. Hiemstra. 2003. The antimicrobial peptide L L - 3 7 activates innate immunity at the airway epithelial surface b y transactivation o f the epidermal growth factor receptor. J Immunol 171:6690-6696. Bowdish, D . M . , D . J . Davidson, D . P. Speert, and R . E . Hancock. 2004. The human cationic peptide L L - 3 7 induces activation o f the extracellular signal-regulated kinase and p38 kinase pathways i n primary human monocytes. J Immunol 172:3758-3765. Niyonsaba, F., H . Ushio, I. Nagaoka, K . Okumura, and H . Ogawa. 2005. The human beta-defensins (-1, -2, -3, -4) and cathelicidin L L - 3 7 induce IL-18 secretion through p38 and E R K M A P K activation i n primary human keratinocytes. J Immunol 175:1776-1784. Heilborn, J. D . , M . F . Nilsson, G . Kratz, G . Weber, O . Sorensen, N . Borregaard, and M . Stahle-Backdahl. 2003. The cathelicidin anti-microbial peptide L L - 3 7 is involved i n reepithelialization o f human skin wounds and is lacking i n chronic ulcer epithelium. J Invest Dermatol 120:379-389. Dorschner, R . A . , V . K . Pestonjamasp, S. Tamakuwala, T. Ohtake, J . Rudisill, V . Nizet, B . Agerberth, G . H . Gudmundsson, and R . L . Gallo. 2001. Cutaneous injury induces the release o f cathelicidin anti-microbial peptides active against group A Streptococcus. J Invest Dermatol 117:91-97. Lau, Y . E . , D . M . Bowdish, C . Cosseau, R . E . Hancock, and D . J . Davidson. 2006. Apoptosis o f airway epithelial cells: human serum sensitive induction b y the cathelicidin L L - 3 7 . Am JRespir CellMol Biol 34:399-409. Elssner, A . , M . Duncan, M . Gavrilin, and M . D . Wewers. 2004. A novel P 2 X 7 receptor activator, the human cathelicidin-derived peptide L L 3 7 , induces IL-1 beta processing and release. J Immunol 172:4987-4994. 16  33.  34.  35.  36.  37.  38. 39. 40.  41. 42.  43. 44.  45. 46. 47. 48.  49.  50.  Koczulla, R., G . von Degenfeld, C . Kupatt, F . Krotz, S. Zahler, T. Gloe, K . Issbrucker, P. Unterberger, M . Zaiou, C . Lebherz, A . K a r l , P. Raake, A . Pfosser, P. Boekstegers, U . Welsch, P. S. Hiemstra, C . Vogelmeier, R. L . Gallo, M . Clauss, and R . Bals. 2003. A n angiogenic role for the human peptide antibiotic L L - 3 7 / h C A P - 1 8 . J Clin Invest 111:1665-1672. Lau, Y . E . , A . Rozek, M . G . Scott, D . L . Goosney, D . J. Davidson, and R. E . Hancock. 2005. Interaction and cellular localization o f the human host defense peptide L L - 3 7 with lung epithelial cells. Infect Immun 73:583-591. Braff, M . H . , M . A . Hawkins, A . D i Nardo, B . Lopez-Garcia, M . D . Howell, C . Wong, K . L i n , J . E . Streib, R . Dorschner, D . Y . Leung, and R . L . Gallo. 2005. Structure-function relationships among human cathelicidin peptides: dissociation o f antimicrobial properties from host immunostimulatory activities. J Immunol 174:4271-4278. Tokumaru, S., K . Sayama, Y . Shirakata, H . Komatsuzawa, K . Ouhara, Y . Hanakawa, Y . Yahata, X . D a i , M . Tohyama, H . Nagai, L . Yang, S. Higashiyama, A . Yoshimura, M . Sugai, and K . Hashimoto. 2005. Induction o f keratinocyte migration v i a transactivation o f the epidermal growth factor receptor b y the antimicrobial peptide L L - 3 7 . J Immunol 175:4662-4668. Selvatici, R . , S. Falzarano, A . M o l l i c a , and S. Spisani. 2006. Signal transduction pathways triggered b y selective formylpeptide analogues i n human neutrophils. Eur J Pharmacol 534:1-11. Simon, H . U . 2003. Neutrophil apoptosis pathways and their modifications i n inflammation. Immunol Rev 193:101-110. Cassatella, M . A . 1999. Neutrophil-derived proteins: selling cytokines b y the pound. Adv Immunol 73:369-509. Scheel-Toellner, D . , K . Q . Wang, P . R . Webb, S. H . Wong, R . Craddock, L . K . A s s i , M . Salmon, and J. M . Lord. 2004. Early events i n spontaneous neutrophil apoptosis. Biochem Soc Trans 32:461-464. Savill, J . , and C . Haslett. 1995. Granulocyte clearance b y apoptosis i n the resolution o f inflammation. Semin Cell Biol 6:385-393. Hofman, P. 2004. Molecular regulation o f neutrophil apoptosis and potential targets for therapeutic strategy against the inflammatory process. Curr Drug Targets Inflamm Allergy 3:1-9. Heyworth, P . G . , A . R . Cross, and J . T. Curnutte. 2003. Chronic granulomatous disease. Curr Opin Immunol 15:578-584. Saba, S., G . Soong, S. Greenberg, and A . Prince. 2002. Bacterial stimulation o f epithelial G - C S F and G M - C S F expression promotes P M N survival i n C F airways. Am J Respir Cell Mol Biol 27:561-567. Hengartner, M . O . 2000. The biochemistry o f apoptosis. Nature 401:110-116. Krammer, P . H . 2000. CD95's deadly mission i n the immune system. Nature 407:789795. Green, D . R. 1998. Apoptotic pathways: the roads to ruin. Cell 94:695-698. Wang, J., H . J. Chun, W . Wong, D . M . Spencer, and M . J . Lenardo. 2001. Caspase-10 is ' an initiator caspase i n death receptor signaling. Proc Natl Acad Sci USA 98:1388413888. Fanzo, J. C , M . P. Lynch, H . Phee, M . Hyer, A . Cremesti, H . Grassme, J. S. Norris, K . M . Coggeshall, B . R . Rueda, A . B . Pernis, R. Kolesnick, and E . Gulbins. 2003. C D 9 5 rapidly clusters i n cells o f diverse origins. Cancer Biol Ther 2:392-395. M u z i o , M . , B . R . Stockwell, H . R . Stennicke, G . S. Salvesen, and V . M . Dixit. 1998. A n induced proximity model for caspase-8 activation. J Biol Chem 273:2926-2930. 17  51.  52. 53. 54. 55. 56.  57. 58.  59.  60. 61. 62.  63. 64.  L i , P., D . Nijhawan, I. Budihardjo, S. M . Srinivasula, M . A h m a d , E . S. Alnemri, and X . Wang. 1997. Cytochrome c and dATP-dependent formation o f Apaf-l/caspase-9 complex initiates an apoptotic protease cascade. Cell 91:479-489. Walensky, L . D . 2006. B C L - 2 i n the crosshairs: tipping the balance o f life and death. Cell Death Differ 13:1339-1350. Wang, X . 2001. The expanding role o f mitochondria i n apoptosis. Genes Dev 15:29222933. Strasser, A . 2005. The role o f B H 3 - o n l y proteins in the immune system. Nat Rev Immunol 5:189-200. Edwards, S. W . , M . Derouet, M . Howse, and R. J. Moots. 2004. Regulation o f neutrophil apoptosis by M c l - 1 . Biochem Soc Trans 32:489-492. Moulding, D . A . , C . A k g u l , M . Derouet, M . R. White, and S. W . Edwards. 2001. B C L - 2 family expression in human neutrophils during delayed and accelerated apoptosis. J Leukoc Biol 70:783-792. Leuenroth, S. J., P. S. Grutkoski, A . A y a l a , and H . H . Simms. 2000. Suppression o f P M N apoptosis by hypoxia is dependent on M c l - 1 and M A P K activity. Surgery 128:171-177. Derouet, M . , L . Thomas, A . Cross, R. J. Moots, and S. W . Edwards. 2004. Granulocyte macrophage colony-stimulating factor signaling and proteasome inhibition delay neutrophil apoptosis by increasing the stability o f M c l - 1 . J Biol Chem 279:26915-26921. Chao, J. R., J. M . Wang, S. F. Lee, H . W . Peng, Y . H . L i n , C . H . Chou, J. C . L i , H . M . Huang, C . K . Chou, M . L . K u o , J. J. Y e n , and H . F. Y a n g - Y e n . 1998. mcl-1 is an immediate-early gene activated by the granulocyte-macrophage colony-stimulating factor ( G M - C S F ) signaling pathway and is one component o f the G M - C S F viability response. Mol Cell Biol 18:4883-4898. Rollins, B . J. 1997. Chemokines. Blood 90:909-928. Zlotnik, A . , and O. Yoshie. 2000. Chemokines: a new classification system and their role in immunity. Immunity 12:121-127. Scapini, P., J. A . Lapinet-Vera, S. Gasperini, F. Calzetti, F. Bazzoni, and M . A . Cassatella. 2000. The neutrophil as a cellular source o f chemokines. Immunol Rev 177:195-203. Erdag, G . , and J. R. Morgan. 2002. Interleukin-1 alpha and interleukin-6 enhance the antibacterial properties o f cultured composite keratinocyte grafts. Ann Surg 235:113-124. Hase, K . , M . Murakami, M . Iimura, S. P. Cole, Y . Horibe, T. Ohtake, M . Obonyo, R. L . Gallo, L . Eckmann, and M . F. Kagnoff. 2003. Expression o f L L - 3 7 b y human gastric epithelial cells as a potential host defense mechanism against Helicobacter pylori. Gastroenterology 125:1613-1625.  18  2.0 2.1  The Human Cationic Host Defense Peptide LL-37 is Anti-apoptotic For Neutrophils" Introduction Cationic host defense peptides ( C H D P ; also known as antimicrobial peptides) are key,  evolutionarily-conserved components o f host defenses (1). The importance o f C H D P to human immunity is indicated by the increased susceptibility to infection o f individuals with specific granule deficiency (2) and o f morbus Kostmann patients (3) (representing conditions i n which neutrophil deficiency i n defensins and cathelicidin, respectively, constitute key components o f the disease) and by the up-regulation o f peptide expression in the lung (4), skin (5), or other sites in response to inflammation. Furthermore, studies using knockout mouse models, transgenics, and gene therapy augmentation clearly demonstrate the significance o f C H D P to host defense against infections (6-11).  Recently, various C H D P have been shown to have immunomodulatory properties (11), with a growing number o f these demonstrated in vivo, including chemokine production, angiogenesis, anti-endotoxin activity, and chemotaxis (12-15). In addition, multiple studies o f C H D P have demonstrated broad-spectrum antimicrobial activities in vitro. Consequently, the development o f C H D P and their synthetic derivatives is likely to yield future antimicrobial therapeutics relatively unaffected b y common bacterial resistance mechanisms and potentially combining microbicidal activities with immunomodulatory properties (16).  * The majority o f this work was originally published i n the Journal o f Luecocyte Biology 2006 Sep; 80(3):509-520. A l l data was generated b y Y . L i except Figure 2.1 A and 2.4 that was produced by Barlow, W i l s o n and Davidson. Figure 2.1 B - D and 2.5 represent updated data. The text has been updated to reflect advances in the literature.  19  The C H D P demonstrating the most significant immunomodulatory potential to date is L L - 3 7 , the predominant, mature peptide fragment o f the sole human cathelicidin, human cationic antimicrobial protein (hCAP)-18. This peptide is found i n the specific granules o f neutrophils, and is also produced by a range o f epithelial cells and to a lesser extent, by lymphocytes and macrophages (17). L L - 3 7 expression has been detected at ~5 ng/ml i n bronchoalveolar lavage ( B A L ) from healthy infants and is up-regulated by inflammation, being detected in B A L from infants with pulmonary infections and i n individuals with cystic fibrosis lung disease at up to - 3 0 pg/ml and - 1 5 pg/ml, respectively (4, 18), and at levels o f -1.5 mg/ml i n psoriatic skin lesions (5).  The  full extent o f the immunomodulatory functions o f L L - 3 7 and the underlying  mechanisms involved remain undetermined  and are o f considerable significance i n the  development o f therapeutic, synthetic analogs. W e hypothesized that the potential for L L - 3 7 to modulate the function and survival o f key innate-immune effector cells could be critical to enhancing the clearance o f infection and resolution o f inflammation. In particular, neutrophils, a cell type for which L L - 3 7 is both directly and indirectly chemotactic (12, 19-22), represent a key component o f innate defenses against infection. These cells have a short half-life, "programmed" to die by apoptosis, and exert a defensive role by intracellular k i l l i n g and the release o f defensins and cathelicidins, lytic enzymes, proteases, and inflammatory mediators (23, 24). In this study, we demonstrate that L L - 3 7 acted as a potent inhibitor o f human neutrophil apoptosis, signalling through P2X7 receptors and G-protein-coupled receptors, other than formyl peptide receptorlike-1 molecule ( F P R L - 1 ) . L L - 3 7 modulated M c l - 1 expression and inhibited cleavage o f B I D and procaspase-3, acting through activation o f phosphatidylinositol-3 kinase (PI3K) and protein kinase C ( P K C ) , but not the extracellular signal-regulated kinase ( E R K ) 1/2 mitogen-activated protein kinase ( M A P K ) pathway. 20  2.2  Materials & Methods  Reagents H-Trp-Arg-Trp-Trp-Trp-Trp-CONH2  (WRW4)  and  H-Trp-Lys-Tyr-Met-Val-D-Met-  C O N H 2 ( W K Y M V m ; both reconstituted i n dimethyl sulfoxide, according to the manufacturer's instructions), and pertussis toxin ( P T X ) were purchased from Calbiochem, M e r k Biosciences (Nottingham, U K ) . Oxidized adenosine 5'-triphosphate ( A T P ) , SB203580 and rottlerin were purchased from Sigma-Aldrich (Poole, U K , or Oakville, Ontario, Canada). Inhibitors L Y 2 9 4 0 0 2 and PD98059 were purchased from C e l l Signalling Technology, Inc. (Mississauga, O N , Canada). Rabbit polyclonal antibodies against M c l - 1 , B I D , and cleaved caspase-3 were purchased  from  C e l l Signalling Technology (Mississauga, Ontario, Canada). Mouse polyclonal antibody against caspase-3 was purchased from A l e x i s Biochemicals (Axxora, San Diego, C A ) . Horseradish peroxidase (HRP)-conjugated goat antirabbit and antimouse immunoglobulin G antibodies were purchased  from  Cell  Signalling Technology (Beverly, M A ) and Amersham  Biosciences  (Piscataway, N J ) , respectively. Lipopolysaccharide (LPS) from Pseudomonas aeruginosa Strain H I 0 3 was highly purified free o f proteins and lipids using the Darveau-Hancock method as 1  described previously (25). Briefly, P. aeruginosa was grown overnight i n Luria-Bertani broth at 37°C. Cells were collected and washed, and the isolated L P S pellets were extracted with a 2:1 chloroform:methanol  solution to remove contaminating  lipids. Purified L P S samples were  quantitated using an assay for the specific sugar 2-keto-3-deoxyoctosonic acid assay and then resuspended i n endotoxin-free water (Sigma-Aldrich). L L - 3 7 was synthesized b y N-(9-fluorenyl) methoxycarbonyl chemistry at the Nucleic Acid/Protein Service unit at the University o f British Columbia ( U B C , Vancouver, Canada), as described previously (26). Peptides were purified b y reverse-phase high-performance liquid chromatography and were at least 98% pure. L L - 3 7 was dissolved i n endotoxin-free water (Sigma-Aldrich) and stored at - 2 0 ° C until further use. The 21  concentration o f the peptides i n solution was determined by amino acid analysis. A l l reagents were tested to ensure that they were free o f endotoxin and reconstituted i n endotoxin-free water.  Isolation of human blood neutrophils Fresh human venous blood was collected from volunteers, according to U B C Clinical Research Ethics Board protocol C02-0091 or University o f Edinburgh (Scotland) Research Ethics Committee approval #1702/95/4/72,  using Vacutainer® collection tubes containing  sodium heparin ( B D Biosciences, Mississauga, Ontario, Canada) or sodium citrate solution (Phoenix Pharma Ltd., Gloucester, U K ) as an anticoagulant.  Neutrophils were purified by Ficoll-Paque gradient centrifugation as described previously (27). Briefly, blood was mixed, at 1:1 ratio, with 2 % Dextran T-500 (Amersham Pharmacia Biotech, Buckingham, U K ) i n 0.9% saline and sedimented for 30 m i n at room temperature. The leukocyte-rich upper layer was then centrifuged at 200 g for 7 min, and remaining erythrocytes were lysed hypotonically with ice-cold, distilled water for 30 s, followed b y restoration o f tonicity with 2.5% saline. Neutrophils were then separated by centrifugation over a Ficoll-Paque Plus (Amersham Pharmacia Biotech) density gradient at 400 g f o r 25 m i n at 4 ° C . The cells were washed with Krebs-Ringerphosphate buffer (pH 7.3), containing glucose (10 m M ) and M g ( 1 . 5 2+  m M ) , and resuspended i n RPMI-1640 media (Invitrogen), supplemented with 10% (v/v) heatinactivated F B S , 1% (v/v) L-glutamine, and 1 n M sodium pyruvate. Alternatively, blood was centrifuged at 300 g for 20 m i n at room temperature, platelet-rich plasma was removed, and cells were suspended gently i n 1% Dextran T-500 (Amersham Pharmacia Biotech, Buckingham, U K ) in 0.9% saline and sedimented for 30 m i n at room temperature. The leukocyte-rich upper layer was then fractionated by using three-step discontinuous, isotonic Percoll gradients as described previously (28). Briefly, cells were centrifuged at 300 g for 6 min, resuspended i n 55% isotonic  22  Percoll (Amersham Pharmacia Biotech), layered on top o f 68% and 81% isotonic Percoll layers, and centrifuged at 700 g for 20 m i n at room temperature. Neutrophils were collected, washed i n phosphate-buffered saline (PBS) without calcium or magnesium, and resuspended i n Iscoves's Dulbecco's modified Eagle's medium ( I D M E M ; Invitrogen, Paisley, U K , or Burlington, Ontario, Canada)  with 10% (v/v) heat-inactivated  fetal bovine serum  (FBS).  Polymorphonuclear  leukocytes isolated were 95-4>8% neutrophils using morphological criteria, and viability was assessed by trypan blue exclusion. Dose-dependent LL-37-mediated inhibition o f neutrophil apoptosis  was  observed by fluorescent-activated  cell sorter  (FACS),  irrespective o f the  anticoagulant or methodology used to isolate cells. The former method was used i n analyses by Western immunoblot and other inhibitor studies, and the latter method i n morphological studies and receptor inhibitor studies.  Neutrophil apoptosis Freshly isolated human blood neutrophils were incubated at 37°C, 5% C O 2 , for 0, 1,4, or 20 h, at 1 x 10 cells i n 1 m l R P M I with 10% (v/v) heat-inactivated F B S i n 24 well tissue culture 6  plates i n the presence o f L L - 3 7 , G M - C S F , or W K Y M V m at the stated concentrations or a vehicle control, at least i n duplicate. Where inhibitors were used, these (or vehicle control) were added 30 m i n before the addition o f L L - 3 7 . Apoptosis was assessed b y flow cytometry using Phycoerythrin (PE)-labeled Annexin V (Biolegend, San Diego, C A ) and nucleic acid dye 7 A A D ( B D Biosciences, Mississauga, O N , Canada) diluted 1:100 with binding buffer provided by Biolegend (San Diego, C A ) at room temperature. The samples were analyzed using a F A C S C a l i b u r system ( B D Biosciences), counting a minimum o f 10,000 cells. In addition to F A C S analyses, apoptosis was assessed using standard morphological analysis o f distinctive apoptotic morphology. Samples (100 pi) o f cells were cytocentrifiiged, fixed i n methanol, stained with Reastain Q u i c k - D i f f  (Reagena, Garridor, U K ) , and examined using o i l immersion 23  microscopy. Total cell counts were performed i n duplicate by haemocytometer and light microscopy (using standard methodology) for each well upon removal o f gently resuspended cells for F A C S analysis and cytospin.  Western immunoblotting Fresh human blood neutrophils ( 7 . 5 x l 0 ) , per condition, i n 5 m l R P M I - 1 6 4 0 media 6  [supplemented with 10% (v/v) heat-inactivated F B S , 1% (v/v) L-glutamine, and 1 n M sodium pyruvate] were exposed to L L - 3 7 at the concentrations detailed or endotoxin-free water as a vehicle control and incubated at 37°C, 5% C O 2 , for 4 h. Cells were washed with ice-cold P B S containing 1 raM sodium orthovanadate (Sigma-Aldrich) and lysed with 150 jxl 1% Triton X-100, 10 m M Tris, p H 7.5, 150 m M N a C l , 2 m M E D T A , 1 m M phenylmethylsulfonyl fluoride buffer containing Sigma protease inhibitor cocktail [104 m M 4-(2-aminoethyl) benzenesulfonyl fluoride, 0.08 m M aprotinin, 2 m M leupeptin, 4 m M bestatin, 1.5 m M pepstatin A , 1.4 m M E-64] and phosphatase inhibitor cocktail 2 (sodium orthovanadate, sodium molybdate, sodium tartrate, imidazole). The protein concentrations o f lysates were determined using a bicinchoninic acid assay (Pierce, Rockford, I L , or Cramlington, U K ) . Equivalent lysate (15-40 pg) was resolved on a 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis ( S D S - P A G E ) and transferred to nitrocellulose membranes (Bio-Rad, Hercules, C A ) , which were blocked for 1 h with 20 m M Tris, p H 7.4, 150 m M N a C l , and 0.1% Tween 20 ( T B S T ) containing 5% skimmed milk powder ( T B S T / m i l k ) . Subsequently, the nitrocellulose membranes were incubated with anti-Mcl-1, antiB I D , anti-caspase-3, or anti-cleaved caspase-3 antibodies at 1/1000 dilution i n T B S T / m i l k for 1 h at room temperature. Membranes were washed for 30 m i n i n T B S T and then incubated with a 1/5000 dilution o f HRP-conjugated goat anti-mouse or anti-rabbit antibody (in T B S T / m i l k ) for 1 h. The membranes were washed for 30 m i n i n T B S T and developed with chemiluminescence peroxidase substrate (Sigma-Aldrich), according to the manufacturer's instructions. T o quantify 24  bands, the luminescence was detected with Versadoc (Bio-Rad). The blots were stripped using Restore™ Western blot stripping buffer (Pierce), according to the manufacturer's instructions, and reprobed with an anti-glyceraldehyde 3-phosphate dehydrogenase ( G A P D H ) antibody, and densitometry was performed to allow correction for protein loading.  Chemotaxis Assay Transwell® polyester permeable supports (pore size 3.0 urn, diameter 6.5 m m ; Corning Life Sciences, U K ) were utilised for chemotaxis studies. Briefly, each chemoattractant sample (600 Lil) was loaded into the lower well and 100 p:l o f P B S without C a  2 +  and M g  2 +  containing 1 x  10 fresh human blood neutrophils added to the apical compartment o f each transwell. The plates 5  were incubated for 60 m i n at 37°C i n 5% C O 2 . Chemoattractants tested were sterile P B S without Ca  and M g  (negative control) and W K Y M V m . For inhibition studies, neutrophils were pre-  treated with 10 f i M W R W 4 for 30 m i n at room temperature prior to use i n the chemotaxis assay. Following incubation, the supernatants from both the upper and lower compartments  were  removed and a cytospin was performed. The upper surface o f the polyester membranes were wiped with cotton buds to remove non-migrated cells and the cells on the underside o f the membranes were fixed with methanol and stained with a Reastain Q u i c k - D i f f (Reagena). The polyester membranes with migrated cells were removed with a curved serrated scalpel, and mounted 'cell side up' on a microscope slide. The migrated cells were then counted using a Zeiss light microscope at lOOOx magnification. For each membrane, five fields o f view were counted and results expressed as a chemotactic index correct for migration observed i n the negative control. Statistical analysis Student's Mests were performed to determine statistical significance, and P < 0.05 was considered significant. Values shown are expressed as mean ± S E M . 25  2.3  Results  LL-37 inhibits neutrophil apoptosis To evaluate the effect o f L L - 3 7 exposure on spontaneous neutrophil apoptosis, fresh human peripheral blood neutrophils were isolated and incubated i n culture over a range o f L L - 3 7 concentrations. The level o f apoptosis was assessed by F A C S quantification o f PE-labeled annexin V and 7 A A D staining. Confirmation o f apoptosis was obtained b y morphological evaluation o f cytospins, revealing the classical appearance o f cell shrinkage and nuclear condensation in apoptotic cells (Figure 2.1 A ) . In untreated cells, spontaneous apoptosis was observed i n 65.3% ± 3.2% (n=5) o f cells at 20 h. Exposure to L L - 3 7 was demonstrated to inhibit neutrophil apoptosis significantly at 20 h (Figure 2.IB). This inhibition was dose-dependent, with significant inhibition (P=0.03) at L L - 3 7 concentrations o f 250 ng/ml or greater, and profound inhibition o f apoptosis observed at 10 |ag/ml (diminished b y 49% o f control levels; P=0.004)or above.  0 Lig/ml LL-37  Figure  1 ng/ml LL-37  2.1A. Inhibition of neutrophil apoptosis by LL-37.  26  B)  0  0  Figure 2.1  0.1 0.25 0.5 1 LL-37 (ug/ml)  0.1  (B-D). Inhibition  0.25 0.5 1 LL-37 (Mg/ml)  10  25  10  25  of neutrophil apoptosis by LL-37.  Figure 2.1. Inhibition of neutrophil apoptosis by L L - 3 7 . Neutrophils were incubated for 20 h over a range o f L L - 3 7 concentrations. Modulation o f spontaneous apoptosis was examined by F A C S analysis and morphology. ( A ) Representative fields from cytospins. White arrows indicate examples o f apoptotic neutrophils, 320x original magnification. ( B - D ) F A C S analysis was used to determine the percentage o f neutrophils, which were (B) apoptotic (PE-annexin V-positive, 7AAD-negative), (C) viable (PE-annexin V negative, 7AAD-negative), and (D) necrotic (PE-annexin V-positive, 7AAD-positive). Figures represent the percentage o f cells i n LL-37-treated samples as a proportion o f that observed i n the vehicle alone-treated controls to correct for donor variation and indicate mean values ± S E M , for three replicates for each condition, using five different donors. Significance was assessed using relative values i n LL-37-treated samples compared with vehicle alone-treated controls by paired sample Student's Mest analyses. *, P <0.05; **, P<0.01.  The consequence o f LL-37-mediated inhibition o f apoptosis i n neutrophils at 20 h was evaluated by F A C S analysis, assessing the number o f annexin V-negative/7AAD-negative (viable) and annexin V-positive/7AAD-positive (necrotic) cells. In the absence o f L L - 3 7 , 27.3% ± 2.4% (n=5) o f cells were viable, and 6.32% ± 1.3% (n=5) o f cells were necrotic at 20 h. Exposure to L L - 3 7 resulted i n dose-dependent increases i n the proportions o f viable (Figure 2.1C) and necrotic (Figure 2. ID) cells. The proportion o f viable cells increased significantly after exposure to 250 ng/ml L L - 3 7 (P=0.02) or greater and by up to 93.8% o f control levels at 10 Hg/ml. In contrast, the proportion o f necrotic cells did not increase significantly at concentrations of L L - 3 7 below 1 |ag/ml but was greatly increased by exposure to higher levels o f L L - 3 7 , by approximately 2.5 fold o f control levels at 10 jxg/ml. Neutrophils were also examined over a time course using F A C S analyses and total cell counts. In contrast to inhibition o f apoptosis by L L - 3 7 at 20 hours, negligible levels o f apoptosis and necrosis were observed by F A C S at 0 hours, 1 hour and 4 hours (data not shown).  28  LL-37 exposure modulates expression ofMcl-1 and inhibits cleavage ofBID and procaspase-3 in neutrophils To study the mechanisms b y which L L - 3 7 can modulate the apoptosis o f neutrophils, the expression o f critical apoptosis-regulating Bcl-2 family proteins and the cleavage o f procaspase-3 were examined b y Western immunoblot. Fresh human peripheral blood neutrophils were examined at 4 h after exposure to L L - 3 7 i n the presence o f 10% F B S , a time-point chosen to precede any substantial apoptosis or necrosis with 94-96% cell viability observed, irrespective o f exposure to L L - 3 7 . Expression o f the anti-apoptotic protein Mcl-1 is o f particular importance i n neutrophils (29) and was found to be significantly higher i n neutrophils after 4 h exposure to L L 37 (Figure 2.2A) with dose-dependent regulation. Cleavage o f the " B H 3 domain only" Bcl-2 protein B I D b y caspase-8 generates a pro-apoptotic fragment (30, 31) and was demonstrated to be inhibited significantly i n neutrophils exposed to L L - 3 7  (Figure 2.2B).  In addition,  significantly higher levels o f the inactive procaspase-3 protein, with a corresponding, significant decrease i n levels o f active-cleaved caspase-3, were observed after exposure to L L - 3 7 (Figure 2.3A and 2.3B), indicating inhibition o f the activation pathways for the effector caspase-3 and correlating with LL-37-mediated inhibition o f neutrophil apoptosis.  29  Mcl-1  •40 kDa  BID  •22 kDa  GAPDH  -36kDa  GAPDH  •36 kDa 5  c 6  o </>  Q-  0  0.25  ,  1  10  LL-37 (ug/ml)  1  50 GM-CSF i  .9 4 in (J)  a  o J  5 2 Q  5  1 0  0.25  1  10  1  50 GM-CSF i  LL-37 (ug/ml)  Figure 2.2. Modulation of neutrophil Mcl-1 expression and cleavage of B I D in response to L L - 3 7 . Neutrophils were exposed to a concentration range o f 0.25-50 pg/ml L L - 3 7 , 30 ng/ml G M - C S F as a positive control, or endotoxin-free water as a vehicle control for 4 h. W h o l e cell protein lysates were prepared and analyzed by S D S - P A G E and Western immunoblotting. Immunoblots for expression o f ( A ) M c l - 1 and (B) uncleaved B I D are shown, each representative o f three different donors, and expression of the housekeeping protein G A P D H was assessed as a loading control. Quantitative densitometry was performed, corrected for protein loading, expressed as a proportion o f the vehicle alone-treated control sample, and displayed as mean values ± S E M for three different donors. Student's f-test analyses were used to compare Mcl-1 or B I D expression in L L - 3 7 - or G M - C S F - e x p o s e d samples with vehicle alone-treated controls. *, P <0.05.  30  B)  A) ro co E T3> 3.  ro  CO  co o  CO CO  I  E  o  cn  o in  *  c:  2 0  oO C 32 kDa  Cleaved caspase-3  17 kDa 19 kDa 36 kDa  0  0.25  1  LL-37 oo  co <n _  0.75  <-> co  0.5  1 CD Q>  o  10  50 GM-CSF  (ng/ml)  1  O  CL CO  i  6 4  2 co  cn  Pro-caspase-3  GAPDH  O  II  O  in  8 c  $ 0.25 0  ** 0  0.25  1  10  50 GM-CSF  LL-37 (ng/ml)  Figure 2.3. Modulation  of pro-caspase-3 cleavage in LL-37-treated  neutrophils.  Neutrophils were exposed to a concentration range o f 0.25 - 50 (ig/ml o f L L - 3 7 , 30 ng/ml G M - C S F as a positive control, or endotoxin free water as a vehicle control, for 4 hours. Whole cell protein lysates were prepared and analysed by S D S - P A G E and Western Immunoblotting. A ) Immunoblots for expression o f inactive pro-caspase-3 and active cleaved caspase-3 are shown, representative o f five different donors, with expression o f the house-keeping protein G A P D H assessed as a loading control. B ) Quantitative densitometry was performed, corrected for protein loading, expressed as a proportion o f the vehiclealone treated control sample, and displayed as mean values ± S E M , for five different donors. Student's t-test analyses were used to compare pro-caspase-3 and cleaved caspase3 expression i n L L - 3 7 or G M - C S F exposed samples with vehicle-alone treated controls, *, p<0.05, **,p<0.01.  P2X7 and a G-protein involved receptor is involved in LL-37-induced inhibition of neutrophil apoptosis The  immunomodulatory effects o f L L - 3 7 have been proposed to be dependent on  signalling through a number o f receptors, potentially relevant in this system, including the G -  31  protein-coupled receptor F P R L - 1 (19) and the purinergic receptor P 2 X (32). Additional, as-yet7  unidentified G-protein-coupled receptors and undetermined high- and low-affinity receptors have also been proposed (33-35). To assess the possible significance o f these receptors, human peripheral blood neutrophils were pre-incubated with P T X (to inhibit G-protein-coupled receptors), W R W 4 , or oxidized A T P (specific inhibitors o f F P R L - 1 (36) and P 2 X  7  (32)  receptors, respectively) before exposure to a concentration range o f L L - 3 7 . The levels o f spontaneous apoptosis were subsequently determined after 20 h incubation (Figure 2.4A). N o significant LL-37-mediated inhibition o f neutrophil apoptosis occurred i n the presence o f oxidized A T P or P T X at concentrations o f L L - 3 7 up to 1 pg/ml, demonstrating effective blockade o f L L - 3 7 activity. In contrast, W R W 4 , at the optimal concentration for near-complete inhibition o f the FPRL-1-specific a g o n i s t W K Y M V m (36), did not impair the activity o f L L - 3 7 , and significant LL-37-mediated inhibition o f neutrophil apoptosis was observed at 250 ng/ml (P=0.009) and 1 ug/ml L L - 3 7 (/M).01) i n the presence of W R W 4 . T o further evaluate the role o f F P R L - 1 i n this system, human peripheral blood neutrophils were incubated with the F P R L - 1 specific agonist W K Y M V m at 0.2 p M and 10 u M (approximately equimolar with 1 pg/ml and 50 pg/ml L L - 3 7 , respectively). N o significant effects o f this agonist were observed on the level o f spontaneous apoptosis after 20 h incubation (Figure 2.4B). To confirm the biological activity o f our W K Y M V m and W R W 4 peptides, chemotaxis o f fresh human neutrophils was studied. A s described previously (37), significant chemotaxis o f neutrophils was observed in response to 10 u M W K Y M V m (P=0.001). This chemotaxis was inhibited significantly b y preincubation with 10 p M W R W 4 (P=0.02; Figure 2.4C). These data suggest that P 2 X receptors and an undetermined 7  G-protein-coupled receptor other than F P R L - 1 are required for LL-37-mediated inhibition o f neutrophil apoptosis.  32  C)  •  OHM WRW4  •  10nMWRW4  ** x  1  0  I  8 .y 6 « -—• o  3 4  I O  2  0  0  •  10 10 WKYMVm (\xM)  Figure 2.4. LL-37-induced inhibition of neutrophil apoptosis is mediated by P2X7 and a G-protein coupled receptor. Neutrophil apoptosis over 20 h incubation was examined i n duplicate by F A C S analysis for PE-annexin V-positive, 7AAD-negative cells after ( A ) incubation with 0.25 pg/ml or 1 |!g/ml L L - 3 7 or endotoxin-free water as a vehicle control, added 30 m i n after 100 uM-oxidized A T P , 10 u M W R W 4 , 200 ng/ml P T X , or a vehicle-alone control i n the presence o f 10% F B S . Results represent the percentage o f apoptotic cells as mean ± S E M for four or more replicates per condition from five different donors. Paired sample Student's Mest analyses were used to compare LL-37-treated samples with controls under the same inhibitor controls under the same  inhibitor conditions. **, P <0.01, or (B) incubation with 1 ug/ml L L - 3 7 , 0.2 u M or 10 \iM W K Y M V m , or a vehicle-alone control. Results represent the percentage o f apoptotic cells as mean ± S E M for three replicates from three different donors. Paired sample Student Mest analyses were used to compare treated samples with controls. **, P <0.01. (C) Neutrophil chemotaxis was assessed i n triplicate in response to 10 u M W K Y M V m or vehicle-alone control after preincubation with 10 u M W R W 4 or vehicle-alone control, and the chemotactic index was displayed as mean ± S E M for 3 repeats from three different  donors. Paired sample Student's M e s t  WKYMVm-treated  samples  with  controls  and  analyses were used to  compare  WRW4-pretreated samples  with  W K Y M V m alone. *, P <0.05; **, P £ 0 . 0 1 .  LL-3 7-induced inhibition of neutrophil apoptosis involves multiple signalling pathways L L - 3 7 has been demonstrated to induce M A P K activation i n a cell type-specific manner, through a PTX-insensitive pathway (22, 27), and to enhance the GM-CSF-dependent activation of these pathways i n primary monocytes (38). G M - C S F is a potent inhibitor o f neutrophil apoptosis, with this effect mediated through the activation o f E R K 1 / 2 M A P K and P I 3 K pathways (39). In addition, P K C signalling has also been implicated in LL-37-induced angiogenesis b y a direct effect on endothelial cells v i a P L C - y / P K C / N F - K B . Thus, to determine the significance o f these pathways i n this system, human peripheral blood neutrophils were. pre-incubated with PD098059 (inhibitor o f the E R K 1 / 2 M A P K pathway v i a M A P K kinase), L Y 2 9 4 0 0 2 (PI3K inhibitor), or rottlerin (inhibitor o f P K C ) before exposure to 1 tig/ml L L - 3 7 . The levels o f spontaneous apoptosis were subsequently determined after 20 h incubation (Figure 2.5). The inhibition o f the E R K 1 / 2 M A P K pathway alone resulted i n a degree o f inhibition o f neutrophil apoptosis but did not impair the effects o f L L - 3 7 , and significant LL-37-mediated inhibition o f neutrophil apoptosis was observed at 1  ng/ml L L - 3 7  contrast, i n the presence o f LY294002 or rottlerin, 1  (P=0.03) i n the presence o f PD098059. In  ng/ml  o f L L - 3 7 was unable to significantly  34  inhibit neutrophil apoptosis. These data suggest that L L - 3 7 may use the P I 3 K and P K C but not the E R K 1 / 2 M A P K pathway in the inhibition o f neutrophil apoptosis.  • 0 no/ml LL-37 • 1 pg/ml LL-37  Figure 2.5. LL-37-induced neutrophil survival involves multiple signalling pathways. Neutrophil apoptosis over 20 h incubation was examined by F A C S analysis for PE-annexin V-positive, 7AAD-negative cells after incubation with 1 pg/ml L L - 3 7 or endotoxin-free water as a vehicle control, added 30 m i n after 10 u M L Y 2 9 4 0 0 2 , 10 u M rottlerin, 10 u M PD98059, or a vehicle-alone control. Results represent the percentage o f apoptotic cells as mean ± S E M for three replicates per condition from four different donors. Paired sample Student's Mest analyses were used to compare LL-37-treated samples with controls under the same inhibitor conditions, or to compare LL-37-treated samples under inhibitor conditions to samples without inhibitor treatments. *, P <0.05.  35  2.4  Discussion Various cationic host-defense peptides [including L L - 3 7 and the murine homologue  cathelicidin-related antimicrobial peptide ( m C R A M P ) ] have been demonstrated recently to have multiple immunomodulatory capabilities, potentially representing key mechanisms b y which these peptides can enhance host clearance o f infection in vivo. The full extent o f these immunomodulatory functions and the precise mechanisms b y which these peptides contribute to innate immunity remain undetermined in vivo and are o f clear significance in the development o f such peptides and their synthetic analogs as novel, antimicrobial therapeutics for multiple antibioticresistant infections.  The microbicidal activity o f L L - 3 7 is acutely sensitive to serum proteins and largely inhibitable under physiologically relevant, ionic conditions (40), although other  recently  proposed cleavage forms o f h C A P - 1 8 may have more effective microbicidal activities (41, 42). However, various immuno-modulatory properties have been demonstrated i n physiological ionic environments, including leukocyte chemotaxis, stimulation o f epithelial cell IL-8 production, post-translational modification o f I L - i p , modulation o f macrophage transcription, angiogenesis, enhanced wound-healing, modulation o f dendritic cell differentiation and function, and adjuvant properties (12, 14, 19-22, 32, 34, 35, 43-46). It remains challenging to demonstrate the relative contribution o f direct microbicidal activity versus antimicrobial immuno-modulatory functions in vivo. Studies o f m C R A M P indicate that despite high minimum inhibitory concentration values (even against a susceptible mutant bacteria), direct microbicidal activity may contribute to host defense in vivo i n specific systems, perhaps at higher concentrations under favorable conditions in a protected niche or functioning synergistically (47, 48). However, our laboratory has recently described in vivo protection against infection i n animal models using a synthetic  CHDP  36  derivative with no direct in vitro antimicrobial activity (40). Thus, the multiple immunomodulatory properties described for L L - 3 7 in vitro and in vivo seem likely to be fundamental to the importance o f this peptide to the innate immune system.  The precise mechanisms underlying the immunomodulatory effects o f L L - 3 7 are in many cases unknown. A number o f identified and undefined receptors have been described for L L - 3 7 , including F P R L - 1 and other G-protein-coupled receptors, epidermal growth factor receptor ( E G F R ) , responsive v i a metalloproteinase-mediated cleavage o f membrane-anchored ligands, and P 2 X significance  7  EGFR  receptors acting v i a caspase-1 (19, 22, 32-35, 38). However, the relative  o f these receptors remains unclear, and traditional, ligand-binding receptor  mechanisms may not fully determine peptide activities (42). In addition, M A P K activation is involved i n G-protein-independent L L - 3 7 stimulation o f monocytes (38), and endocytic peptide uptake i n airway epithelial cells in vitro is required for LL-37-induced IL-8 expression (33, 40).  It is demonstrated here that, i n addition to the previously described immunomodulatory functions o f L L - 3 7 , this C H D P is capable o f modulating apoptotic pathways i n primary human neutrophils. The capacity o f L L - 3 7 to act as a potent inhibitor o f spontaneous neutrophil apoptosis was demonstrated to involve signalling v i a P 2 X  7  receptors and G-protein-coupled  receptors other than F P R L - 1 . These data confirm and complement some o f the observations made i n a recent related paper (49). However, i n contrast to our observations, Nagaoka et al. observed a role for F P R L - 1 i n LL-37-mediated inhibition o f neutrophil apoptosis (49). The reasons for this difference remain to be determined but may relate to alternate sources o f F P R L - 1 antagonistic and agonistic peptides (subjected to functional validation by reproducing wellcharacterized activities o f these peptides i n other systems i n our study), different peptide solvents, or technical differences i n neutrophil purification, which might result i n differential background  37  levels o f contaminant cell types with FPRL-1-mediated responses to L L - 3 7 , which could influence the response o f neutrophils i n these assays. Nevertheless, the observation that a combination o f receptor types could be involved i n L L - 3 7 signalling was also the conclusion o f a recent study examining the effects o f L L - 3 7 on keratinocyte functions (42). That study, interestingly, also demonstrated similar responses when using D - L L - 3 7 (composed o f amino acids i n the synthetic D form), arguing against a highly structure-specific interaction between L L - 3 7 and cell surface receptors. Thus, we cannot exclude a complexity exceeding the use o f P2X7 receptors and G-protein-coupled receptors i n LL-37-mediated inhibition o f neutrophil apoptosis. Regardless, our data suggest that this process involves subsequent  downstream  activation o f P I 3 K and P K C but not the ERK1/2 M A P K pathway. The latter observation is i n keeping with the recent demonstration that i n contrast to its effects i n monocytes and epithelial cells (22, 38), L L - 3 7 does not stimulate ERK1/2 phosphorylation i n neutrophils (20).  W e also demonstrate that L L - 3 7 mediates anti-apoptotic effects i n neutrophils v i a an inhibitory effect on the activation o f the effector caspase-3 and by altering the balance o f Bcl-2 family proteins. It is interesting to note that these effects, observed after 4 h o f incubation with L L - 3 7 , preceded substantial membrane translocation o f phosphatidylserine (PS), assessed by F A C S analyses o f PE-annexin V / 7 A A D - s t a i n e d cells. After this time-point, apoptosis determined by translocation o f PS increased rapidly, and - 1 5 % o f control neutrophils were PE-annexin V positive/7AAD-negative at 6 h (data not shown), demonstrating the temporal sequence o f events in apoptosis o f these cells. These data support previous studies indicating that the translocation o f PS is a caspase-3-dependent event downstream o f caspase activation (50) and that L L - 3 7 mediated inhibition o f caspase-3 cleavage precedes effects on translocation o f PS i n neutrophils undergoing spontaneous apoptosis.  38  L L - 3 7 modulated expression o f the anti-inflammatory protein M c l - 1 , preventing the loss o f expression associated with spontaneous apoptosis. This Bcl-2 family protein has a short halflife, providing rapid response to environmental stimuli and playing a critical role i n promoting neutrophil survival b y inhibiting mitochondrial damage and cytochrome c release (29, 51). L L - 3 7 also inhibited cleavage o f the B H 3 domain-only Bcl-2 protein B I D , thereby decreasing generation o f the pro-apoptotic p i 5 B I D cleavage fragment, believed to translocate to the mitochondria and trigger release o f cytochrome c during the induction o f apoptosis (30, 31). Cleavage o f B I D b y caspase-8 is critical for death receptor-induced apoptosis but also plays an important role i n spontaneous neutrophil apoptosis, even i n the absence o f death receptor stimulation (52). In addition to the inhibition o f cleavage o f the key effector caspase-3, these observations suggest that L L - 3 7 exerts its anti-apoptotic effect on neutrophils by acting upstream o f mitochondria on intrinsic and traditionally extrinsic pathways  for the induction o f  programmed cell death.  The consequences for LL-37-mediated inhibition o f neutrophil apoptosis in vitro were demonstrated to be dependent on the concentration o f L L - 3 7 . After 20 h exposure to lower concentrations o f L L - 3 7 , significant increases were observed i n the proportion o f viable cells at the expense o f apoptotic cells. However, at higher concentrations o f L L - 3 7 , despite further increases i n the proportion o f viable cells, the more dramatic decreases i n apoptotic cells were accompanied b y an increase i n neutrophil necrosis. This switch i n cellular fate, evident at approximately 10 pg/ml, could represent a transition to inflammatory concentrations o f L L - 3 7 in vivo (4). The neutrophil necrosis observed is likely a consequence o f the inhibition o f apoptotic pathways, rather than secondary necrosis o f apoptotic cells, given the potent inhibition o f apoptotic pathways observed after 4 h exposure to L L - 3 7 , before any substantial, detectable cell death, and bears similarities to the recently reported effects o f L P S i n inhibiting apoptosis but 39  inducing necrosis i n neutrophils (53). In contrast, the anti-apoptotic factor G M - C S F acts primarily as a potent neutrophil-survival factor (54). Thus, although LL-37-mediated inhibition o f apoptosis led to a dose-dependent increase i n neutrophil survival, higher concentrations o f peptide also promoted an additional switch from apoptotic to necrotic cell death.  The in vivo consequences o f LL-37-mediated inhibition o f neutrophil apoptosis remain to be determined. Low-level, acute increases i n L L - 3 7 may primarily enhance neutrophil survival, promoting the  clearance  o f infection. However, although  necrosis  induced by  higher  concentrations o f L L - 3 7 could be beneficial to the host by amplifying the acute inflammatory response [as proposed previously for LPS-induced necrosis (53)], the uncontrolled release o f neutrophil contents i n chronic inflammation would be expected to result i n host damage and impair the resolution o f inflammation. In addition to enhancing neutrophil survival, L L - 3 7 has previously been demonstrated to be chemotactic for neutrophils in vitro, directly (19) and indirectly, b y inducing IL-8 production by epithelial cells (12), and the murine homologue C R A M P has been shown to induce neutrophil recruitment in vivo i n a mouse model (21). Further, L L - 3 7 release by recruited neutrophils would therefore amplify these responses and the effects o f L L - 3 7 on neutrophil apoptosis.  Thus, raised levels o f L L - 3 7 i n an acute inflammatory scenario could contribute to innate host defenses by mediating recruitment and enhanced survival o f neutrophils to enhance the resolution o f an acute, infectious insult. A full knowledge o f the in vivo significance o f these L L 37-mediated immunomodulatory activities and their applicability to other C H D P is essential i n developing the potential o f C H D P as future immunomodulatory, antimicrobial therapeutics.  40  2.5 1. 2.  3.  4.  5.  6.  7.  8.  9.  10.  11. 12.  13.  14.  Bibliography Zasloff, M . 2002. Antimicrobial peptides o f multicellular organisms. Nature 415:389-395. Ganz, T., J. A . Metcalf, J. I. Gallin, L . A . Boxer, and R. I. Lehrer. 1988. Microbicidal/cytotoxic proteins o f neutrophils are deficient i n two disorders: ChediakHigashi syndrome and "specific" granule deficiency. J Clin Invest 82:552-556. Putsep, K . , G . Carlsson, H . G . Boman, and M . Andersson. 2002. Deficiency o f antibacterial peptides i n patients with morbus Kostmann: an observation study. Lancet 360:1144-1149. Schaller-Bals, S., A . Schulze, and R. Bals. 2002. Increased levels o f antimicrobial peptides i n tracheal aspirates o f newborn infants during infection. Am J Respir Crit Care Med 165:992-995. Ong, P. Y . , T. Ohtake, C . Brandt, I. Strickland, M . Boguniewicz, T. Ganz, R. L . Gallo, and D . Y . Leung. 2002. Endogenous antimicrobial peptides and skin infections i n atopic dermatitis. N Engl J Med 347:1151-1160. Nizet, V . , T. Ohtake, X . Lauth, J. Trowbridge, J. Rudisill, R. A . Dorschner, V . Pestonjamasp, J. Piraino, K . Huttner, and R. L . Gallo. 2001. Innate antimicrobial peptide protects the skin from invasive bacterial infection. Nature 414:454-457. Wilson, C . L . , A . J. Ouellette, D . P. Satchell, T. Ayabe, Y . S. Lopez-Boado, J. L . Stratman, S. J. Hultgren, L . M . Matrisian, and W . C . Parks. 1999. Regulation o f intestinal alpha-defensin activation by the metalloproteinase matrilysin i n innate host defense. Science 286:113-117. Salzman, N . H . , D . Ghosh, K . M . Huttner, Y . Paterson, and C . L . Bevins. 2003. Protection against enteric salmonellosis i n transgenic mice expressing a human intestinal defensin. Nature 422:522-526. Iimura, M . , R. L . Gallo, K . Hase, Y . Miyamoto, L . Eckmann, and M . F. Kagnoff. 2005. Cathelicidin mediates innate intestinal defense against colonization with epithelial adherent bacterial pathogens. J Immunol 174:4901-4907. Bals, R., D . J. Weiner, A . D . Moscioni, R. L . Meegalla, and J. M . W i l s o n . 1999. Augmentation o f innate host defense b y expression o f a cathelicidin antimicrobial peptide. Infect Immun 67:6084-6089. Bowdish, D . M . , D . J. Davidson, and R. E . Hancock. 2005. A re-evaluation o f the role o f host defence peptides i n mammalian immunity. Curr Protein Pept Sci 6:35-51. Scott, M . G . , D . J. Davidson, M . R . G o l d , D . Bowdish, and R. E . Hancock. 2002. The human antimicrobial peptide L L - 3 7 is a multifunctional modulator o f innate immune responses. J Immunol 169:3883-3891. Welling, M . M . , P. S. Hiemstra, M . T. van den Barselaar, A . Paulusma-Annema, P. H . Nibbering, E . K . Pauwels, and W . Calame. 1998. Antibacterial activity o f human neutrophil defensins i n experimental infections i n mice is accompanied b y increased leukocyte accumulation. J Clin Invest 102:1583-1590. Koczulla, R., G . von Degenfeld, C . Kupatt, F. Krotz, S. Zahler, T. Gloe, K . Issbrucker, P. Unterberger, M . Zaiou, C . Lebherz, A . K a r l , P. Raake, A . Pfosser, P. Boekstegers, U . Welsch, P. S. Hiemstra, C . Vogelmeier, R. L . Gallo, M . Clauss, and R. Bals. 2003. A n angiogenic role for the human peptide antibiotic L L - 3 7 / h C A P - 1 8 . J Clin Invest 111:1665-1672.  41  15.  16. 17. 18.  19.  20.  21.  22.  23. 24. 25.  26. 27.  28.  29.  30.  Fukumoto, K . , I. Nagaoka, A . Yamataka, H . Kobayashi, T. Yanai, Y . Kato, and T. Miyano. 2005. Effect o f antibacterial cathelicidin peptide C A P 1 8 / L L - 3 7 on sepsis i n neonatal rats. Pediatr Surg Int 21:20-24. Finlay, B . B . , and R. E . Hancock. 2004. Can innate immunity be enhanced to treat microbial infections? Nat Rev Microbiol 2:497-504. Zanetti, M . 2004. Cathelicidins, multifunctional peptides o f the innate immunity. J LeukocBiol 75:39-48. Chen, C . I., S. Schaller-Bals, K . P. Paul, U . Wahn, and R. Bals. 2004. Beta-defensins and L L - 3 7 i n bronchoalveolar lavage fluid o f patients with cystic fibrosis. J Cyst Fibros 3:4550. De, Y . , Q. Chen, A . P. Schmidt, G . M . Anderson, J. M . Wang, J. Wooters, J. J. Oppenheim, and O. Chertov. 2000. L L - 3 7 , the neutrophil granule- and epithelial cellderived cathelicidin, utilizes formyl peptide receptor-like 1 ( F P R L 1 ) as a receptor to chemoattract human peripheral blood neutrophils, monocytes, and T cells. J Exp Med 192:1069-1074. Tjabringa, G . S., D . K . Ninaber, J. W . Drijfhout, K . F. Rabe, and P. S. Hiemstra. 2006. Human cathelicidin L L - 3 7 is a chemoattractant for eosinophils and neutrophils that acts via formyl-peptide receptors. Int Arch Allergy Immunol 140:103-112. Kurosaka, K . , Q. Chen, F. Yarovinsky, J. J. Oppenheim, and D . Y a n g . 2005. Mouse cathelin-related antimicrobial peptide chemoattracts leukocytes using formyl peptide receptor-like 1/mouse formyl peptide receptor-like 2 as the receptor and acts as an immune adjuvant. J Immunol 174:6257-6265. Tjabringa, G . S., J. Aarbiou, D . K . Ninaber, J. W . Drijfhout, O. E : Sorensen, N . Borregaard, K . F. Rabe, and P. S. Hiemstra. 2003. The antimicrobial peptide L L - 3 7 activates innate immunity at the airway epithelial surface b y transactivatioh o f the epidermal growth factor receptor. J Immunol 171:6690-6696. Simon, H . U . 2003. Neutrophil apoptosis pathways and their modifications i n inflammation. Immunol Rev 193:101-110. Borregaard, N . , and J. B . Cowland. 1997. Granules o f the human neutrophilic polymorphonuclear leukocyte. Blood 89:3503-3521. Darveau, R. P., and R. E . Hancock. 1983. Procedure for isolation o f bacterial lipopolysaccharides from both smooth and rough Pseudomonas aeruginosa and Salmonella typhimurium strains. JBacteriol 155:831-838. Gough, M . , R. E . Hancock, and N . M . K e l l y . 1996. Antiendotoxin activity o f cationic peptide antimicrobial agents. Infect Immun 64:4922-4927. B o y u m , A . , D . Lovhaug, L . Tresland, and E . M . Nordlie. 1991. Separation o f leucocytes: improved cell purity b y fine adjustments o f gradient medium density and osmolality. Scand J Immunol 34:697-712. Dransfield, I., A . M . Buckle, J. S. Savill, A . M c D o w a l l , C . Haslett, and N . Hogg. 1994. Neutrophil apoptosis is associated with a reduction i n C D 16 (Fc gamma RIII) expression. J Immunol 153:1254-1263. Moulding, D . A . , C . A k g u l , M . Derouet, M . R. White, and S. W . Edwards. 2001. B C L - 2 family expression i n human neutrophils during delayed and accelerated apoptosis. J Leukoc Biol 70:783-792. L u o , X . , I. Budihardjo, H . Zou, C . Slaughter, and X . Wang. 1998. B i d , a B c l 2 interacting • protein, mediates cytochrome c release from mitochondria i n response to activation o f cell surface death receptors. Cell 94:481 -490.  42  31. 32.  33.  34.  35.  36.  37.  38.  39.  40. 41.  42.  43.  44.  45.  L i , H . , H . Zhu, C . J. X u , and J. Y u a n . 1998. Cleavage o f B I D b y caspase 8 mediates the mitochondrial damage i n the Fas pathway o f apoptosis. Cell 94:491-501. Elssner, A . , M . Duncan, M . Gavrilin, and M . D . Wewers. 2004. A novel P 2 X 7 receptor activator, the human cathelicidin-derived peptide L L 3 7 , induces IL-1 beta processing and release. J Immunol 172:4987-4994. Lau, Y . E . , A . Rozek, M . G . Scott, D . L . Goosney, D . J. Davidson, and R. E . Hancock. 2005. Interaction and cellular localization o f the human host defense peptide L L - 3 7 with lung epithelial cells. Infect Immun 73:583-591. Davidson, D . J., A . J. Currie, G . S. Reid, D . M . Bowdish, K . L . M a c D o n a l d , R. C . M a , R. E . Hancock, and D . P. Speert. 2004. The cationic antimicrobial peptide L L - 3 7 modulates dendritic cell differentiation and dendritic cell-induced T cell polarization. J Immunol 172:1146-1156. Niyonsaba, F., K . Iwabuchi, A . Someya, M . Hirata, H . Matsuda, H . Ogawa, and I. Nagaoka. 2002. A cathelicidin family o f human antibacterial peptide L L - 3 7 induces mast cell chemotaxis. Immunology 106:20-26. Bae, Y . S., H . Y . Lee, E . J. Jo, J. I. K i m , H . K . Kang, R. D . Y e , J. Y . K w a k , and S. H . R y u . 2004. Identification o f peptides that antagonize formyl peptide receptor-like 1mediated signalling. J Immunol 173:607-614. Dahlgren, C , T. Christophe, F. Boulay, P. N . Madianos, M . J. Rabiet, and A . Karlsson. 2000. The synthetic chemoattractant T r p - L y s - T y r - M e t - V a l - D M e t activates neutrophils preferentially through the lipoxin A(4) receptor. Blood 95:1810-1818. Bowdish, D . M . , D . J. Davidson, D . P. Speert, and R. E . Hancock. 2004. The human cationic peptide L L - 3 7 induces activation o f the extracellular signal-regulated kinase and p38 kinase pathways i n primary human monocytes. J Immunol 172:3758-3765. K l e i n , J. B . , M . J. Rane, J. A . Scherzer, P. Y . Coxon, R. Kettritz, J. M . Mathiesen, A . Buridi, and K . R. M c L e i s h . 2000. Granulocyte-macrophage colony-stimulating factor delays neutrophil constitutive apoptosis through phosphoinositide 3-kinase and extracellular signal-regulated kinase pathways. J Immunol 164:4286-4291. Bowdish, D . M . , D . J. Davidson, Y . E . Lau, K . Lee, M . G . Scott, and R. E . Hancock. 2005. Impact o f L L - 3 7 on anti-infective immunity. JLeukoc Biol 77:451-459. Murakami, M . , B . Lopez-Garcia, M . Braff, R. A . Dorschner, and R. L . Gallo. 2004. Postsecretory processing generates multiple cathelicidins for enhanced topical antimicrobial defense. J Immunol 172:3070-3077. Braff, M . H . , M . A . Hawkins, A . D i Nardo, B . Lopez-Garcia, M . D . H o w e l l , C . Wong, K . L i n , J. E . Streib, R. Dorschner, D . Y . Leung, and R. L . Gallo. 2005. Structure-function relationships among human cathelicidin peptides: dissociation o f antimicrobial properties from host immunostimulatory activities. J Immunol 174:4271 -4278. Mookherjee, N . , K . L . Brown, D . M . Bowdish, S. Doria, R. Falsafi, K . Hokamp, F. M . Roche, R. M u , G . H . Doho, J. Pistolic, J. P. Powers, J. Bryan, F. S. Brinkman, and R. E . Hancock. 2006. Modulation o f the TLR-mediated inflammatory response by the endogenous human host defense peptide L L - 3 7 . J Immunol 176:2455-2464. Heilborn, J. D . , M . F. Nilsson, G . Kratz, G . Weber, O. Sorensen, N . Borregaard, and M . Stahle-Backdahl. 2003. The cathelicidin anti-microbial peptide L L - 3 7 is involved i n reepithelialization o f human skin wounds and is lacking i n chronic ulcer epithelium. J Invest Dermatol'120:379-389. Shaykhiev, R., C . Beisswenger, K . Kandler, J. Senske, A . Puchner, T. Damm, J. Behr, and R. Bals. 2005. Human endogenous antibiotic L L - 3 7 stimulates airway epithelial cell proliferation and wound closure. Am J Physiol Lung Cell Mol Physiol 289:L842-848. 43  46.  47.  48.  49.  50.  51. 52. 53.  54.  55.  56.  57.  A n , L . L . , Y . H . Y a n g , X . T. M a , Y . M . L i n , G . L i , Y . H . Song, and K . F . W u . 2005. L L 37 enhances adaptive antitumor immune response i n a murine model when genetically fused with M - C S F R (J6-1) D N A vaccine. LeukRes 29:535-543. Braff, M . H . , M . Zaiou, J . Fierer, V . Nizet, and R . L . Gallo. 2005. Keratinocyte production o f cathelicidin provides direct activity against bacterial skin pathogens. Infect Immun 73:6771-6781. Lee, P. H . , T. Ohtake, M . Zaiou, M . Murakami, J. A . Rudisill, K . H . L i n , and R. L . Gallo. 2005. Expression o f an additional cathelicidin antimicrobial peptide protects against bacterial skin infection. Proc Natl Acad Sci USA 102:3750-3755. Nagaoka, I., H . Tamura, and M . Hirata. 2006. A n antimicrobial cathelicidin peptide, human C A P 1 8 / L L - 3 7 , suppresses neutrophil apoptosis v i a the activation o f formylpeptide receptor-like 1 and P 2 X 7 . J Immunol 176:3044-3052. Y u , A . , D . M . Byers, N . D . Ridgway, C . R . McMaster, and H . W . Cook. 2000. Preferential externalization o f newly synthesized phosphatidylserine i n apoptotic U937 cells is dependent on caspase-mediated pathways. Biochim Biophys Acta 1487:296-308. Michels, J., P . W . Johnson, and G . Packham. 2005. M c l - 1 . Int J Biochem Cell Biol 37:267-271. Daigle, I., and H . U . Simon. 2001. Critical role for caspases 3 and 8 i n neutrophil but not eosinophil apoptosis. Int Arch Allergy Immunol 126:147-156. Turina, M . , F . N . M i l l e r , P . P. M c H u g h , W . G . Cheadle, and H . C : Polk, Jr. 2005. Endotoxin inhibits apoptosis but induces primary necrosis i n neutrophils. Inflammation 29:55-63. Brach, M . A . , S. deVos, H . J . Gruss, and F. Herrmann. 1992. Prolongation o f survival o f human polymorphonuclear neutrophils b y granulocyte-macrophage colony-stimulating factor is caused b y inhibition o f programmed cell death. Blood 80:2920-2924. Bowdish, D . M . , D . J . Davidson, M . G . Scott, and R . E . Hancock. 2005. Immunomodulatory activities o f small host defense peptides. Antimicrob Agents Chemother 49:1727-1732. Turner, J., Y . Cho, N . N . Dinh, A . J . Waring, and R. I. Lehrer. 1998. Activities o f L L - 3 7 , a cathelin-associated antimicrobial peptide o f human neutrophils. Antimicrob Agents Chemother 42:2206-2214. Scott, M . G . , A . C . Vreugdenhil, W . A . Buurman, R . E . Hancock, and M . R . Gold. 2000. Cutting edge: cationic antimicrobial peptides block the binding o f lipopolysaccharide (LPS) to L P S binding protein. J Immunol 164:549-553.  44  3.0  3.1  The Human Host Defense Peptide LL-37 Differentially Modulates Neutrophil Cytokine /chemokine Responses To Inflammatory Stimuli  Introduction Cathelicidins are cationic host defense peptides found in mammals. These peptides are  important components in host defense against pathogenic microbial challenge. Cathelicidins have been demonstrated to have a broad range o f biological functions in modulating the immune response as well as direct antimicrobial activities that are observed for only certain peptides under physiological conditions. h C A P - 1 8 is the sole human cathelicidin and is stored at high concentrations in the specific granules o f neutrophils and upon release, is processed to its active form, L L - 3 7 , a 37 amino acid peptide (1). This peptide is also found at low concentrations i n a variety o f blood cell populations including N K cells, ybT cells, B cells, monocytes and mast cell (2). The precursor h C A P - 1 8 is also expressed in a range o f epithelial cells and keratinocytes upon stimulation with bacterial components or pro-inflammatory cytokines (3, 4), and the processed peptide L L - 3 7 is found in various body fluids including sweat, gastric fluid, airway surface liquid, breast milk, and saliva (2). L L - 3 7 has been shown to have diverse functions i n the innate immune response exemplified b y its ability to promote angiogenesis and wound healing (5-7), to prolong the life span  o f neutrophils  as  demonstrated  in  Chapter  2,  and  to  protect  rodents  against  endotoxemia/sepsis induced by L P S (8, 9). Consistent with this, L L - 3 7 has also been shown to inhibit LPS-induced pro-inflammatory cytokine T N F - a production in human monocytic cells (10). In addition, L L - 3 7 acts in synergy with cytokine G M - C S F i n inducing increased IL-8  * The majority o f this work is being prepared for publication: L i , Y . , Pistolic, J. and Robert E . W . Hancock. The human cationic host defense peptide L L - 3 7 in regulating chemokine responses o f neutrophils and airway epithelial cells and their interactions.  45  production v i a enhanced activation o f E R K 1 / 2 and p38 M A P kinases (11). One o f the important roles o f inflammation is to deliver additional effector molecules and cells to sites o f infection to augment the elimination o f invading pathogens. Leukocytes, in response to chemoattractic agents, accumulate i n the inflamed tissues during the course o f early infection and dissipate as the infection is resolved (12). L L - 3 7 has been shown to act as a chemoattractant to directly induce chemotaxis o f a range o f blood cells including neutrophils, monocytes, eosinophils, mast cells and C D 4 + T cells although the L L - 3 7  concentrations  necessary for chemotaxis appear to be much higher than conventional chemokines (13, 14). L L 37 may also contribute to the recruitment o f leukocytes by inducing the production o f chemokines. For example, L L - 3 7 has been well demonstrated to induce IL-8 production from airway epithelial cells, keratinocytes and human peripheral blood derived monocytes (6, 15-17). Although neutrophils are terminally differentiated cells, they are able to express and secrete inflammatory cytokines such as T N F - a and a number o f chemokines including IL-8, Gro-a, M I G , IP-10, M i p - l a and Mip-1(3 in response to inflammatory signals such as L P S (18). A s neutrophils are predominate leukocytes at the site o f infection, it is essential to understand the effects o f L L - 3 7 on cytokine/chemokine production o f these cells. In addition to L L - 3 7 , there are many other important inflammatory mediators, such as endogenous I L - i p or bacterial molecules like L P S , in the inflammatory milieu, and these various effector molecules interact to ensure efficient and balanced functioning o f the innate immune system. T o understand the role of L L - 3 7 in regulating neutrophil cytokine/chemokine responses in the presence or absence o f other key inflammatory signals, I examined the production o f T N F - a cytokine and chemokines including Gro-a, M i p - l a , IL-8 and C C L 2 2 i n neutrophils. I provide evidence in this Chapter that human host defense peptide L L - 3 7 has potent anti-endotoxin properties in neutrophils, acting at the transcriptional level.  It is further 46  demonstrated here that L L - 3 7 enhances IL-ip-induced release o f chemokines including C C L 2 2 , IL-8, M i p - l a , and Gro-a, all o f which are important i n recruiting leukocytes to the site o f infection/inflammation. These secreted chemokines result from de novo protein synthesis but are not regulated at the transcriptional level. In addition, the NFKB and E R K 1 / 2 and p38 M A P K signalling pathways are involved i n the enhanced release o f most chemokines induced b y costimulation with L L - 3 7 and IL-1 p.  3.2  Materials & Methods  Reagents Recombinant human interleukin I L - i p was purchased from Research Diagnostics Inc. (Flanders,  N J ) . Pharmacological inhibitor B A Y 1 1 - 7 0 8 5  was purchased  from  Biomol  International (Plymouth Meeting, P A . ) and PD98059 was from Cell Signalling Technology, Inc. (Mississauga, O N , Canada). Cycloheximide and SB203580 were purchased from Sigma (Oakville, Ontario, Canada). Lipopolysaccharide (LPS) from Pseudomonas aeruginosa Strain H I 0 3 was highly purified free o f proteins and lipids using the Darveau-Hancock method as described previously (19). Briefly, P. aeruginosa was grown overnight i n Luria-Bertani broth at 37°C. Cells were collected and washed, and the isolated L P S pellets were extracted with a 2:1 chloroform:methanol solution to remove contaminating lipids. Purified L P S samples were quantitated using an assay for the specific sugar 2-keto-3-deoxyoctosonic acid assay and then resuspended  i n endotoxin-free  water (Sigma-Aldrich). L L - 3 7 was synthesized by N - ( 9 -  fluorenyl) methoxycarbonyl chemistry at the Nucleic Acid/Protein Service unit at the University o f British Columbia ( U B C , Vancouver, Canada), as described previously (20). Peptides were purified by reverse-phase high-performance liquid chromatography and were at least 98% pure. L L - 3 7 was dissolved i n endotoxin-free water (Sigma-Aldrich) and stored at - 2 0 ° C until further  47  use. The concentration o f the peptides in solution was determined by amino acid analysis. A l l reagents were tested to ensure that they were free o f endotoxin and reconstituted in endotoxinfree water.  Isolation of human blood neutrophils Fresh human venous blood was collected from volunteers, according to University o f British Columbia Clinical Research Ethics Board protocol C02-0091, using Vacutainer® collection tubes containing sodium heparin ( B D Biosciences, Mississauga, Ontario, Canada). Blood was mixed, at 1:1 ratio with 2 % Dextran T-500 (Amersham Pharmacia Biotech, Buckingham, U K ) in 0.9% saline and sedimented for 30 m i n at room temperature. The leukocyte-rich upper layer was then fractionated by Ficoll-Paque gradient centrifugation as described previously (21). Briefly, cells were centrifuged at 200 g for 7 min, remaining erythrocytes were lysed hypotonically with ice-cold, distilled water for 30 seconds, followed by restoration o f tonicity with 2.5% saline, and neutrophils were separated by centrifugation over a Ficoll-Paque Plus (Amersham Pharmacia Biotech) density gradient at 400 g for 25 m i n at 4 ° C . The cells were washed with Krebs-Ringer phosphate buffer (pH 7.3), containing glucose (10 m M ) and M g  2 +  (1.5 m M ) , and resuspended in RPMI-1640 media (Invitrogen), supplemented  with 10% (v/v) heat-inactivated F B S , 1% (v/v) L-glutamine, and 1 n M sodium pyruvate.  Detection of cytokines Fresh human blood neutrophils were plated at 1 x 10 cells in 1 m l RPMI-1640 media 6  (supplemented with 10% (v/v) heat-inactivated F B S , 1% (v/v) L-glutamine, 1 n M sodium pyruvate) i n 24-well plates. Cells were then incubated i n media for 20 h i n the presence o f P. aeruginosa H I 0 3 L P S , L L - 3 7 , IL-1B (at the stated concentrations), or endotoxin-free water as a vehicle control, i n at least triplicate. Supernatants were collected and stored at - 2 0 ° C until used.  48  The concentrations o f cytokine or chemokines in the supernatants were measured using commercially prepared  ELISA  kits in accordance  with the manufacturer's  instructions.  Specifically, E L I S A kits were purchased for T N F - a (eBioscience, San Diego, C A ) , M i p - l a and IL-8 (BioSource International, Camarillo, C A ) , and G r o - a / C C L 2 2 ( R & D Systems, Minneapolis, MN).  RNA extraction and quantitative PCR Fresh human blood neutrophils were plated at 3 x 10 cells in 3 m l RPMI-1640 media 6  (supplemented with 10% (v/v) heat-inactivated F B S , 1% (v/v) L-glutamine, 1 n M sodium pyruvate) in 6-well plates. Cells were then incubated for 2 h in the presence o f P. aeruginosa H103 L P S , L L - 3 7 , I L - i p (at the stated concentrations), or endotoxin-free water as a vehicle control. R N A was isolated from neutrophils with RNeasy M i n i kit, digested with RNase-Free DNase (Qiagen, Mississauga, Ontario), and eluted in RNase-free water (Ambion, Austin, T X ) in accordance with the manufacturer's instructions. R N A concentration, integrity, and purity were assessed by Agilent 2100 Bioanalyzer using R N A 6000 Nano kits (Agilent Technologies, Santa Clara, C A ) . Reverse transcription and q P C R was performed using Superscript III Platinum Two-Step q R T - P C R kit with S Y B R Green (Invitrogen Life Technologies, Burlington, Ontario) according to the manufacturer's instructions, in the A B I Prism 7000 sequence detection system (Applied Biosystems). A melting curve was performed to ensure that any product detected was specific to the desired amplicon. Fold changes were calculated after  normalization to  endogenous G A P D H and using the comparative Ct method (22). The primers used for q R T P C R are reported in Table 3.1.  49  Table 3.1. Primer sequences used in this study. Primer MIP-la/CCL3 Gro-a/CXCLl IL-8/CXCL8 * CCL22 TNF-a GAPDH  Reverse Sequence (5'-3')  Forward sequence (5'-3') GCATCACTTGCTGCTGACAC GCCAGTGCTTGCAGACCCT GACCACACTGCGCCAACAC TGCCGTGATTACGTCCGTTA AGGGAGCCTTTGGTTCTGG  CTGGACCCACTCCTCACTGG GGCTATGACTTCGGTTTGGG CTTCTCCACAACCCTCTGCAC AAGGTTAGCAACACCACGCC TCAGCAATGAGTGACAGTTGG  GAAACTGTGGCGTGATGG  GTCGCTGTTGAAGTCAGAGG  Statistical analysis Student's Mests were performed to determine statistical significance, and P <0.05 was considered significant. Values shown are expressed as mean ± S E M .  3.3  Results  LL-37 differentially modulates neutrophil TNF-a cytokine response to inflammatory stimuli It is well known that L L - 3 7 neutralizes T N F - a induced by L P S i n human monocytes and a monocytic cell line (THP-1) (10). T o evaluate the effect o f L L - 3 7 on T N F - a release from neutrophils induced by L P S or another inflammatory cytokine I L - i p , neutrophils were incubated for 20 h with L P S or I L - i p i n the presence or absence o f 10 pg/ml L L - 3 7 , with subsequent determination o f the T N F - a release b y E L I S A analysis o f cell supernatants (Figure 3.1 A ) . A s expected, on the basis o f the well-characterized, anti-endotoxic effects ascribed to this peptide i n the responses o f other cell types, L L - 3 7 inhibited the release o f T N F - a i n response to L P S exposure. However, i n contrast, L L - 3 7 exposure o f neutrophils led to an significant but modest enhancement o f the release o f T N F - a (PK).04) i n the presence o f I L - i p . These data demonstrate functional cytokine responses i n LL-37-treated neutrophils and indicate that L L - 3 7 modulates the cytokine responses o f neutrophils to inflammatory signals i n a stimulus-specific manner. To examine whether the effect o f L L - 3 7 on T N F - a release was regulated at the transcriptional level, peripheral blood neutrophils were exposed for 2 hours to L P S or I L - i p i n  50  the presence or absence o f L L - 3 7 . Total R N A was extracted, and the expression o f the T N F - a gene was examined by quantitative R T - P C R analysis. A s shown i n Figure 3 . I B , exposure to L L - 3 7 substantially inhibited LPS-induced T N F - a m R N A (by approximately 89%), which is consistent with the decreased T N F - a release at the protein level. In contrast, L L - 3 7 did not significantly alter IL-ip-mediated increased T N F - a transcription. In summary, L L - 3 7 inhibited LPS-induced pro-inflammatory cytokine T N F - a production at the transcriptional level, but through different mechanisms, it modestly enhanced  IL-ip-induced T N F - a release from  neutrophils.  A)  300  O 0 (ig/ml LL-37 • 10 Ltg/ml LL-37  J= 200 o> 3  a' £ 100 h-  **  0 Control  IL-13  LPS  Figure 3.1 A . Modulation of neutrophil T N F - a production by LL-37.  51  B) 25 n 20 -  • 0 HQ/ml LL-37 • 10 ng/ml LL-37  U  2 10 o LL  *  5 0  Control  IL-1R  LPS  Figure 3.1. Modulation of neutrophil T N F - a production by LL-37. A ) The T N F - a release b y neutrophils was assessed b y E L I S A analysis o f culture supernatants following incubation o f cells for 20 h i n the presence o f 100 ng/ml L P S , 10 ng/ml IL-1B or vehiclealone control, i n the presence o f absence o f 10  ng/ml L L - 3 7 .  S E M for three replicates per condition from four different  Data represent means ± donors. Paired  sample  Student's Mest analyses were used to compare LL-37-treated samples with controls under the same stimulatory conditions. *, P <0.05; **, P <0.01. B ) Neutrophils were incubated for 2 hours with 100 ng/ml L P S , 10 ng/ml IL-1 p, or vehicle-alone control, i n the presence or absence o f 10  ng/ml  L L - 3 7 , and the T N F - a gene expression was  examined b y q P C R . Fold changes (y-axis) were normalized to G A P D H and are relative to the gene expression i n unstimulated cells (normalized to 1) using the comparative C t method (see Materials and Methods for details). q P C R data represent means ± S E M for duplicates per condition from four different  donors. Paired sample Student's Mest  analyses were used to compare LL-37-treated samples with controls under the same stimulatory conditions. *, P<0.05.  52  LL-37 synergizes with IL-l(5in regulating neutrophil chemokine responses It is well documented that L L - 3 7 is able to induce chemokine IL-8 production i n human leukocytes, airway epithelial cells and keratinocytes (6, 11, 23). In addition, L L - 3 7 induces the gene expression o f chemokines including M C P - 1 , M l P - l a , M I P - i p i n human monocytes (11). It is known that neutrophils express a number o f chemokines i n response to inflammatory signals (24). T o examine the role o f L L - 3 7 i n modulating neutrophil chemokine response to I L - i p , human peripheral blood derived neutrophils were stimulated for 20 h with L L - 3 7 and/or I L - i p , with subsequent determination o f the chemokine responses b y E L I S A analysis o f cell supernatants. A s demonstrated by Figure 3.2, L L - 3 7 alone induced a small but significant amount o f C C L - 2 2 , Gro-a, M i p - l a and IL-8 release from neutrophils. Neutrophil chemokine responses to I L - i p appear to be donor dependent, ranging from virtually unresponsive to moderately induction o f chemokines. However, L L - 3 7 exposure o f neutrophils significantly enhanced the release o f all chemokines tested (P <0.05) i n the presence o f I L - i p . These results demonstrated that the host defense peptide L L - 3 7 acted i n synergy with I L - i p to augment the inflammatory chemokine responses i n neutrophils.  53  • 0 pg/ml LL-37 Gro-a  • 10|jg/mlLL-37  400 300 200 100 0 E  "B) a c o  "•S3 (0  Control  Control  IL-1 B  Mip-1a  IL-1 B  IL-8 800  c a> o c o o  600 400 200  Control  IL-1B  Control  IL-1 B  Figure 3.2. LL-37 enhances IL-lp-induced chemokine secretion by neutrophils. The C C L 2 2 , G r o - a , M i p - l a , and IL-8 release by neutrophils was assessed by E L I S A analysis o f culture supernatants following incubation o f neutrophils for 20 hours with 10 ng/ml IL-1 B, or a vehicle-control alone, i n the presence or absence o f 10 )J.g/ml L L 37. Data represent means ± S E M for three replicates per condition from four different donors. Paired sample Student's Mest analyses were used to compare LL-37-treated samples with controls under the same stimulatory conditions. * P <0.05.  54  Synergistic inductions of the chemokines by LL-37 and IL-1(5 are not regulated at the mRNA level To examine whether the synergistic effect between L L - 3 7 and I L - i p i n inducing chemokine release is regulated at the transcriptional level, neutrophils were exposed for 2 hours to L L - 3 7 in the presence or absence o f I L - i p , and total R N A was extracted from the cells. Quantitative R T - P C R analysis was used to examine the gene expression o f C C L 2 2 , G r o - a , M i p l a , and IL-8. A s shown i n Figure 3.3, the gene expression o f these chemokines was not induced by L L - 3 7 alone but was enhanced in various degrees i n response to IL-1 B stimulation. In contrast to augmented  chemokine protein release, L L - 3 7 did not further increase gene  expression o f these chemokines induced b y I L - i p . These results suggest that the synergistic effect o f L L - 3 7 and IL-1 p i n chemokine production is not regulated at the transcriptional level in neutrophils.  55  Gro-a  CCL22  • 0 (jg/ml LL-37 • lOpo/ml LL-37  CD O) c co .c o ;g o  Control  Control  IL-1p  Mip-1a 20.  1  16  IL-8  1 1 •  i i  12 8 4 0  Control  IL-1P  IL-1P  4  1  3  Control  1 IL-ip  Figure 3.3. Effect of LL-37 and I L - i p on chemokine gene expression in neutrophils. Neutrophils were incubated for 2 hours with 10 ng/ml I L - i p or vehicle-alone control, with or without 10 ug/ml L L - 3 7 , and the gene expression o f C C L 2 2 , G r o - a , M i p - l a , and IL-8 were examined by q P C R . Fold changes (y-axis) were normalized to G A P D H and are relative to the gene expression i n unstimulated cells (normalized to 1) using the comparative Ct method (see Materials and Methods for details). The result o f an experiment from one donor, representative o f four, is shown.  56  De novo protein synthesis is required for chemokine release induced by co-stimulation of LL-37 andlL-lB L L - 3 7 has been shown to induce rapid release o f IL-8 from monocytes, as early as 15 minutes after stimulation (Bowdish and Hancock, unpublished results). It has been suggested that this induction results from de novo synthesis o f IL-8, since it can be inhibited b y cycloheximide, an inhibitor o f protein synthesis (25). To examine whether the chemokines induced by costimulation o f L L - 3 7 and I L - i p were the result o f de novo protein synthesis or release from internal stores, neutrophils were pre-treated with cycloheximide prior to stimulation with L L - 3 7 and/or I L - i p for 20 hours (Figure 3.4). A s expected, the presence o f cycloheximide substantially reduced the amount o f all chemokines released in the supernatant, indicating these chemokines were primarily newly synthesized due to co-stimulation o f L L - 3 7 and I L - i p .  57  Gro-a  CCL22 400  400  300  300 ^  I  200  E Q. C o  2 0 0  100  100 0-  Mip-1a  (0  c o c o o  • (-) cycloheximide • (+) cycloheximide  IL-8 800  800  I  600  600  I  200 0  I  400  400  .  A  S 1^  o O  *  CO  CO.  I,  X  200 0  co +  c o  CO  o  CO  + oa.  CO.  Figure 3.4. Increased chemokines release as a result of de novo protein synthesis. Neutrophils were incubated for 30 minutes with 1  ng/ml  cycloheximide before exposure to 10  ng/ml I L - i p or vehicle-alone control, i n the presence or absence o f 10  ng/ml  L L - 3 7 . The IL-8,  M i p l - a , C C L 2 2 , and Gro-a release was assessed by E L I S A analysis o f culture supernatants following incubation o f cells for 20 hours. Data represent means ± S E M , for three replicates per condition from four donors. Paired sample Student's Mest analyses were used to compare LL-37-treated samples with controls under the same stimulatory conditions. *, p<0.05.  58  ERK1/2 and p38 signalling pathways are involved in the synergistic induction of chemokines by LL-37 and IL-ip L L - 3 7 has been shown to mediate its effects through the activation o f a number o f signalling pathways. For example, LL-37-induced IL-8 production is mediated v i a the p38 and E R K 1 / 2 M A P K signalling pathways i n human monocytes and airway epithelial cells (6, 11). NFKB signalling has also been implicated i n inducing the transcription o f IL-8 (Bowdish and Hancock, unpublished results). T o determine the significance o f these pathways i n the enhanced chemokine production induced b y co-stimulation o f L L - 3 7 and I L - i p , neutrophils were preincubated with inhibitors including PD098059 (inhibitor o f the E R K 1 / 2 M A P K pathway via M A P K kinase), SB203580 (inhibitor o f p38 M A P K ) or B A Y 1 1 - 7 0 5 8 (inhibitor o f the NFKB pathway via IKB) prior to exposure to L L - 3 7 and/or I L - i p . Subsequent chemokine responses were determined b y E L I S A analysis o f cell supernatants (Figure 3.5). The inhibition o f the E R K 1 / 2 , p38 M A P K or NFKB pathways significantly suppressed production o f IL-8, M i p l - a , and C C L 2 2 ; however, among the four donors, only two donors showed a reduction on G r o - a levels in the presence o f these inhibitors (data not shown). The other two donors had very l o w level o f Gro-a release even in the presence o f both L L - 3 7 and I L - i p . These results demonstrate that the M A P K and NFKB pathways are involved i n regulating the release o f IL-8, M i p l - a , and C C L 2 2 induced synergistically by L L - 3 7 and I L - i p .  59  IL-8  CCL22 800  C  o co vC (D O C  600  400  400  200  200  0  0  o O  600  t *  c o O  Mip-1a 800  • (+) SB203580 • (+) BAY11-7085  800  600  +-»  • (-) Inhibitor • (+) PD98059  co  % co  + CO.  400 200  *  **  ^*  *  0 c o O  CO  i-  CO  + CO.  Figure 3.5. Signalling regulation of chemokine responses induced by LL-37 and IL1(3 in neutrophils. Neutrophils were pre-treated for 30 minutes with 12.5 u M SB203580, 10 u M PD098059 or 8 u M B A Y 1 1 - 7 0 8 5 before they were exposed to 10 ng/ml I L - l p or vehicle-alone control, i n the presence or absence o f 10 fig/ml L L - 3 7 . The IL-8, C C L 2 2 , and  Mip-la  release by neutrophils was assessed by E L I S A analysis o f culture  supernatants following incubation o f cells for 20 hours. Data represent means ± S E M , for three replicates per condition from 4 different donors. Paired sample Student's Mest analyses were used to compare inhibitor-treated samples with controls under the same stimulatory conditions. * p<0.05.  60  3.4  Discussion Growing body o f evidence shows that the human cathelicidin L L - 3 7 is a multi-functional  immunomodulator, and the underlying mechanism o f these effects has been investigated extensively i n recent years. The functions o f L L - 3 7 tend to be studied i n an isolated manner; however, the immune system comprises numerous immune mediators which would also arise i n the inflammatory milieu. The interplay o f these molecules is important in defining the outcome of  the  immune  responses.  In  this  Chapter,  I  examined  how  LL-37  modified  the  cytokine/chemokine responses induced by different inflammatory mediators, and I demonstrate that, while L L - 3 7 alone induced a small amount o f chemokine release from neutrophils, it greatly enhanced IL-ip-induced release o f chemokines including IL-8, Gro-a, C C L 2 2 , and M i p l a . The increased production o f chemokine was not regulated at the m R N A level, but resulted from de novo protein synthesis, presumably from existing pools o f m R N A s . The E R K 1 / 2 and p38 M A P K and NFKB signalling pathways were involved i n regulating the synergistic release o f IL-8, C C L 2 2 , and M i p - l a , but not Gro-a. In contrast to its effect on I L - i p - i n d u c e d chemokine responses, L L - 3 7 abrogated LPS-induced T N F - a gene expression as well as protein release. These  results  demonstrated  that  the  modulatory  effects  of  LL-37  on  neutrophil  cytokine/chemokine responses to distinct inflammatory signals are stimulus-specific.  Pro-inflammatory mediators are essential  for an effective host  defense to clear  infections; however, uncontrolled and excessive production o f T N F - a often results i n sepsis and even septic shock (26-29). L P S is the most common agent to cause sepsis. The ability o f L L - 3 7 to block L P S induced pro-inflammatory cytokine production is thought to confer a protective effect to the host against sepsis. Neutrophils account for the majority o f infiltrated leukocytes at the infection foci and are a main source o f T N F - a induced by inflammatory stimuli including 61  L P S (24). I demonstrate here that LPS-induced T N F - a release from neutrophils can be substantially blocked by L L - 3 7  and that this blockade o f T N F - a  is regulated  at  the  transcriptional level. This could be due i n part to the direct binding o f L L - 3 7 to the lipid A core o f L P S , thereby impeding the binding o f L P S to L B P and subsequent activation o f T L R signalling (30). However, more recent evidence strongly suggests that the anti-endotoxin activity o f L L - 3 7 involves additional mechanisms o f action (10). However, the potential binding between L L - 3 7 and L P S complicates analysis o f the effects resulting from other regulatory systems, and further well-designed experiments are needed to gain full understanding. In contrast to its anti-endotoxin activity, L L - 3 7 was demonstrated here to synergize with the inflammatory cytokine IL-1 P in inducing chemokine production from neutrophils. IL-1B is an important cytokine induced v i a the activation o f T L R signalling by pathogen-derived stimuli at the sites o f infection (31). The concentration o f L L - 3 7 w i l l also rise at these sites due to neutrophil degranulation and increased expression i n epithelia (32, 33). Thus it is not surprising that I L - i p and L L - 3 7 would co-exist i n the inflammatory milieu at the infection focus. Neutrophils co-stimulated with L L - 3 7  and I L - i p  released  significantly higher level o f  chemokines than those o f exposed to either stimulus alone. These released chemokines are essential components o f the immune response as they recruit effector cells to infected tissues to eliminate pathogens.  The synergistic effect between  LL-37  and IL-1 B is o f advantage  particularly at the onset o f infection when the concentration o f either is too l o w to independently induce sufficient chemokines. The ability o f L L - 3 7 to amplify favourable inflammatory signals further demonstrates that L L - 3 7 functions as a modulator o f immune responses.  To gain insights into the mechanisms by which L L - 3 7 and IL-1B synergistically regulate neutrophil chemokine response, I examined the signalling pathways that have been implicated i n  62  the LL-37-mediated effects. For example, low concentrations o f L L - 3 7 (5-10 ug/ml) have previously been shown to induce activation o f E R K 1 / 2 and p38 M A P kinases i n synergy with G M - C S F , resulting i n increased IL-8 production i n monocytes (11). These M A P K s are clearly involved i n the synergistic effect o f L L - 3 7 and I L - i p induced release o f IL-8, C C L 2 2 , and M i p l a from neutrophils. The p38 M A P K is known to regulate cytokine/chemokine production at the post-transcriptional level b y controlling the stability o f m R N A (34). A common feature o f inflammatory m R N A s , including chemokines, is the presence o f A U - r i c h sequences i n the 3' untranslated regions (35). The sequences o f A U - r i c h elements ( A R E ) target m R N A for rapid degradation through mechanisms such as deadenylation (36) or b y exosome which is recruited to m R N A via certain A R E binding proteins (34). The activated M A P kinase p38 has been shown to stabilize these m R N A s , although the precise mechanism is not entirely understood. The involvement o f the p38 pathway suggests that the enhanced chemokine production induced by IL-1 B and L L - 3 7 is partly due to increased chemokine m R N A stability. In agreement with this, I showed here that the translation inhibitor cycloheximide abrogated the release o f all chemokines, indicating that the chemokines were newly synthesised proteins rather than released from a pre-stored pool.  In contrast to the aforementioned well-established role of p38, it is not entirely clear how E R K 1 / 2 regulates chemokine production. It has been proposed that the IL-8 expression regulated b y E R K 1 / 2 is exerted through the activation o f NFKB (35). NFKB signalling has also been implicated i n LL-37-induced production o f IL-8 i n human P B M C s , since an inhibitor o f IKB degradation suppressed IL-8 release b y approximately 96% (Mookerjee and Hancock, unpublished results). In addition, Y u , Bowdish and Hancock have shown that L L - 3 7 induces transient IKB degradation and nuclear translocation o f certain NFKB subunits i n P B M C s , and i n the presence o f I L - i p , the magnitude o f IKB degradation is increased ( Y u et al, manuscript 63  submitted). However, i n m y study, L L - 3 7 alone did not induce expression o f any o f the chemokines genes, nor did it enhance IL-ip-induced chemokine gene expression. These results indicate that the LL-37-mediated effects in this context may not involve the activation of NFKB, and the observed inhibition o f chemokine release i n the presence of the inhibitor o f NFKB signalling is primarily due to its known inhibitory effect on IL-ip-induced activities. This further demonstrates that some, i f not all, o f the effects o f L L - 3 7 on the immune response are cell type specific. Unlike other chemokines, the inhibitors for M A P K and NFKB pathways had inconsistent effects on the release o f Gro-a. A m o n g the four donors tested, two donors showed reduction o f Gro-a release i n response to the inhibitors while others did not. Associated with this, the two donors who did not respond to the inhibitors had very low Gro-a protein release i n all conditions, which could be responsible for the insignificant inhibition due to relatively large errors. Further studies involving a large number o f donors are needed to solve the issues related to donor variation and to ultimately draw clear conclusions with this chemokine.  Elevated  cytokine/chemokine  production  at the  site o f infection and  leukocyte  infiltration are general features o f inflammation and essential to control infections. L L - 3 7 contributes to innate host defenses by modulating neutrophil cytokine/chemokine responses. Specifically, this peptide enhances the release o f chemokines in the presence o f endogenous inflammatory mediators while minimizing the level o f detrimental pro-inflammatory cytokine T N F - a resulted from L P S stimulation. These abilities to augment the innate immune response clearly represent novel and potentially powerful means to prevent or treat infections.  64  3.5  Bibliography  1.  Sorensen, O. E . , P. Follin, A . H . Johnsen, J. Calafat, G . S. Tjabringa, P. S. Hiemstra, and N . Borregaard. 2001. Human cathelicidin, h C A P - 1 8 , is processed to the antimicrobial peptide L L - 3 7 by extracellular cleavage with proteinase 3. Blood 97:3951-3959. Zanetti, M . 2004. Cathelicidins, multifunctional peptides o f the innate immunity. J Leukoc 5/0/75:39-48. Frohm, M . , B . Agerberth, G . Ahangari, M . Stahle-Backdahl, S. Liden, H . Wigzell, and G . H . Gudmundsson. 1997. The Expression o f the Gene Coding for the Antibacterial Peptide L L - 3 7 Is Induced i n Human Keratinocytes during Inflammatory Disorders. J. Biol. Chem. 272:15258-15263. N e l l , M . J., G . Sandra Tjabringa, M . J. V o n k , P. S. Hiemstra, and J. J. Grote. 2004. Bacterial products increase expression o f the human cathelicidin h C A P - 1 8 / L L - 3 7 i n cultured human sinus epithelial cells. FEMS Immunology and Medical Microbiology 42:225-231. Koczulla, R., G . von Degenfeld, C . Kupatt, F. Krotz, S. Zahler, T. Gloe, K . Issbrucker, P. Unterberger, M . Zaiou, C . Lebherz, A . K a r l , P. Raake, A . Pfosser, P. Boekstegers, U . Welsch, P. S. Hiemstra, C . Vogelmeier, R. L . Gallo, M . Clauss, and R . Bals. 2003. A n angiogenic role for the human peptide antibiotic L L - 3 7 / h C A P - 1 8 . J Clin Invest 111:1665-1672. Sorensen, O. E . , L . Gram, A . H . Johnsen, E . Andersson, S. Bangsboll, G . S. Tjabringa, P. S. Hiemstra, J. M a l m , A . Egesten, and N . Borregaard. 2003. Processing o f seminal plasma h C A P - 1 8 to A L L - 3 8 by gastricsin: a novel mechanism o f generating antimicrobial peptides i n vagina. J Biol Chem 278:28540-28546. Heilborn, J. D . , M . F. Nilsson, G . Kratz, G . Weber, O. Sorensen, N . Borregaard, and M . Stahle-Backdahl. 2003. The cathelicidin anti-microbial peptide L L - 3 7 is involved in reepithelialization o f human skin wounds and is lacking i n chronic ulcer epithelium. J Invest Dermatol 120:379-389. Scott, M . G . , D . J. Davidson, M . R. Gold, D . Bowdish, and R. E . W . Hancock. 2002. The Human Antimicrobial Peptide L L - 3 7 Is a Multifunctional Modulator o f Innate Immune Responses. J Immunol 169:3883-3891. Fukumoto, K . , I. Nagaoka, A . Yamataka, H . Kobayashi, T. Yanai, Y . Kato, and T. Miyano. 2005. Effect o f antibacterial cathelicidin peptide C A P 1 8 / L L - 3 7 on sepsis i n neonatal rats. Pediatr Surg Int 21:20-24. Mookherjee, N . , K . L . Brown, D . M . E . Bowdish, S. Doria, R. Falsafi, K . Hokamp, F. M . Roche, R. M u , G . H . Doho, J. Pistolic, J.-P. Powers, J. Bryan, F. S. L . Brinkman, and R. E . W . Hancock. 2006. Modulation o f the T L R - M e d i a t e d Inflammatory Response by the Endogenous Human Host Defense Peptide L L - 3 7 . J Immunol 176:2455-2464. Bowdish, D . M . , D . J. Davidson, D . P. Speert, and R. E . Hancock. 2004. The human cationic peptide L L - 3 7 induces activation o f the extracellular signal-regulated kinase and p38 kinase pathways in primary human monocytes. J Immunol 172:3758-3765. Papadakis, K . A . 2004. Chemokines i n inflammatory bowel disease. Curr Allergy Asthma Rep 4:83-89. Y a n g , D . , Q . Chen, A . P . Schmidt, G . M . Anderson, J . M . Wang, J . Wooters, J . J . Oppenheim, and O. Chertov. 2000. L L - 3 7 , the Neutrophil Granule- and Epithelial cellderived Cathelicidin, Utilizes Formyl Peptide Receptor-like 1 ( F P R L 1 ) as a Receptor to  2. 3.  4.  5.  6.  7.  8.  9.  10.  11.  12. 13.  65  14.  15.  16.  17.  18.  19.  20. 21.  22. 23.  24. 25.  26.  27.  Chemoattract Human Peripheral B l o o d Neutrophils, Monocytes, and T Cells. J. Exp. Med. 192:1069-1074. Niyonsaba, F . , K . Iwabuchi, A . Someya, M . Hirata, H . Matsuda, H . Ogawa, and I. Nagaoka. 2002. A cathelicidin family o f human antibacterial peptide L L - 3 7 induces mast cell chemotaxis. Immunology 106:20-26. Bowdish, D . M . E . , Davidson, D . J . , Speert, D . P . , Hancock, R . E . W . 2004. The Human Cationic Peptide L L - 3 7 Induces Activation o f the Extracellular Signal-Regulated Kinase and p38 Kinase Pathways i n Primary Human Monocytes. Journal of Immunology 172:3758 -3765. Lau, Y . E . , A . Rozek, M . G . Scott, D . L . Goosney, D . J . Davidson, and R . E . Hancock. 2005. Interaction and cellular localization o f the human host defense peptide L L - 3 7 with lung epithelial cells. Infect Immun 73:583-591. Braff, M . H . , M . i . A . Hawkins, A . D . Nardo, B . Lopez-Garcia, M . D . H o w e l l , C . Wong, K . L i n , J . E . Streib, R . Dorschner, D . Y . M . Leung, and R . L . Gallo. 2005. StructureFunction Relationships among Human Cathelicidin Peptides: Dissociation o f Antimicrobial Properties from Host Immunostimulatory Activities. J Immunol 174:4271 4278. Scapini, P., J . A . Lapinet-Vera, S. Gasperini, F . Calzetti, F . Bazzoni, and M . A . Cassatella. 2000. The neutrophil as a cellular source o f chemokines. Immunol Rev 177:195-203. Darveau, R . P., and R . E . Hancock. 1983. Procedure for isolation o f bacterial lipopolysaccharides from both smooth and rough Pseudomonas aeruginosa and Salmonella typhimurium strains. JBacteriol 155:831-838. Gough, M . , R . E . Hancock, and N . M . K e l l y . 1996. Antiendotoxin activity o f cationic peptide antimicrobial agents. Infect Immun 64:4922-4927. B o y u m , A . , D . Lovhaug, L . Tresland, and E . M . Nordlie. 1991. Separation o f leucocytes: improved cell purity b y fine adjustments o f gradient medium density and osmolality. Scand J Immunol 34:697-712. Pfaffl, M . W . 2001. A new mathematical model for relative quantification i n real-time R T - P C R . Nucleic Acids Res 29:e45. Niyonsaba, F . , H . Ushio, I. Nagaoka, K . Okumura, and H . Ogawa. 2005. The Human {beta}-Defensins (-1, -2, -3, -4) and Cathelicidin L L - 3 7 Induce IL-18 Secretion through p38 and E R K M A P K Activation i n Primary Human Keratinocytes. J Immunol 175:17761784. Cassatella, M . A . 1999. Neutrophil-derived proteins: selling cytokines b y the pound. Adv Immunol 73:369-509. Gudmundsson, G . H . , K . P . Magnusson, B . P. Chowdhary, M . Johansson, L . Andersson, and H . G . Boman. 1995. Structure o f the Gene for Porcine Peptide Antibiotic PR-39, a Cathelin Gene Family Member: Comparative Mapping o f the Locus for the Human Peptide Antibiotic F A L L - 3 9 . PNAS 92:7085-7089. Hancock, R . E . , and M . G . Scott. 2000. The role o f antimicrobial peptides i n animal defenses. Proceedings of the National Academy of Sciences of the United States of America 97:8856-8861. Platzer, C , E . Fritsch, T. Eisner, M . H . Lehmann, H . D . V o l k , and S. Prosch. 1999. C y c l i c adenosine monophosphate-responsive elements are involved i n the transcriptional activation o f the human IL-10 gene i n monocytic cells. European journal of immunology 29:3098-3104.  66  28. 29. 30. 31. 32.  33.  34.  35. 36.  L i u , S. F., and A . B . M a l i k . 2006. NF-kappa B activation as a pathological mechanism o f septic shock and inflammation. Am J Physiol Lung Cell Mol Physiol 290:L622-L645. Fiuza, C , and A . F. Suffredini. 2001. Human models o f innate immunity: local and systemic inflammatory responses. 7:385-388. Papo, N . , and Y . Shai. 2005. A molecular mechanism for lipopolysaccharide protection o f Gram-negative bacteria from antimicrobial peptides. J Biol Chem 280:10378-10387. Takeda, K . , T. Kaisho, and S. A k i r a . 2003. Toll-like receptors. Annu Rev Immunol 21:335-376. Schaller-Bals, S., A . Schulze, and R. Bals. 2002. Increased levels o f antimicrobial peptides i n tracheal aspirates o f newborn infants during infection. Am J Respir Crit Care Med 165:992-995. X i a o , W . , Y . P. Hsu, A . Ishizaka, T. Kirikae, and R. B . Moss. 2005. Sputum cathelicidin, urokinase plasminogen activation system components, and cytokines discriminate cystic fibrosis, C O P D , and asthma inflammation. Chest 128:2316-2326. De, Y . , Q. Chen, A . P . Schmidt, G . M . Anderson, J. M . Wang, J. Wooters, J. J. Oppenheim, and O. Chertov. 2000. L L - 3 7 , the neutrophil granule- and epithelial cellderived cathelicidin, utilizes formyl peptide receptor-like 1 ( F P R L 1 ) as a receptor to chemoattract human peripheral blood neutrophils, monocytes, and T cells. J Exp Med 192:1069-1074. Hoffmann, E . , O. Dittrich-Breiholz, H . Holtmann, and M . Kracht. 2002. Multiple control o f interleukin-8 gene expression. JLeukoc Biol 72:847-855. Mookherjee, N . , H . L . Wilson, S. Doria, Y . Popowych, R. Falsafi, J. J. Y u , Y . L i , S. Veatch, F. M . Roche, K . L . Brown, F. S. Brinkman, K . Hokamp, A . Potter, L . A . Babiuk, P. J. Griebel, and R. E . Hancock. 2006. Bovine and human cathelicidin cationic host defense peptides similarly suppress transcriptional responses to bacterial lipopolysaccharide. J Leukoc Biol.  67  4.0  4.1  Discussion  Prolonged neutrophil survival is necessary to control acute infections but detrimental when dysregulated Neutrophils generally have a critical role i n eliminating pathogenic bacteria and fungi.  This important role can be demonstrated i n those conditions i n which neutrophils do not function properly. For example, neutrophils with C D 1 8 / L F A deficiency are not able to transmigrate from circulation to the site o f infection; and the patients with these defective neutrophils suffer from recurrent infections (1). To function properly, neutrophils need to be present in adequate numbers and to have an appropriately functioning machinery to phagocytose and k i l l infecting microorganisms. However their disadvantageous short life span may pose a problem i n resolving acute infections as rapidly aging neutrophils lose the ability to k i l l pathogens. Fortunately i n such conditions, there are ample micro-environmental inflammatory signals which would activate neutrophils, not only enhancing their microbicidal functions, but also prolonging their life span. A s demonstrated i n Chapter 2, L L - 3 7 serves as a survival agent, potently extending the half life of neutrophils even at l o w concentrations (Figure 2.1). This essentially enables rapid removal o f invading pathogens to avoid unnecessary activation o f adaptive immunity and/or chronic infectious  conditions. However, because  activated neutrophils release  cytotoxic cellular  components to the surrounding tissues while eliminating pathogens, a common view is that this can  cause detrimental host tissue damage (2). Conversely, early i n infection, small-scale  neutrophil-mediated tissue destruction would serve to disassemble local collagen fibrils that could potentially obstruct neutrophil-pathogen contact (3). Obviously, prolonged neutrophil survival should be minimized i n situations like chronic infections or pathological conditions such as chronic granulomatous disease ( C G D ) . C G D is a rare condition i n which one o f several components o f the N A D P H oxidase system is dysfunctional, rendering all cells incapable o f 68  generating toxic reactive oxygen species ( R O S ) [reviewed i n ref (4)]. R O S , a so-called death factor for neutrophils, is largely responsible for causing cells to become apoptotic and susceptible to non-inflammatory removal (5). A s the neutrophils i n C G D patients lose the capacity to make R O S , they have extended life spans and have been shown to have enhanced production o f pro-inflammatory cytokines (1). A s a result, these patients are highly susceptible to infections with a narrow range o f pathogens and are plagued by many different and profound inflammatory conditions, including inflammatory bowel disease, periodontal inflammation, granulomatous obstruction o f the urinary and gastrointestinal tract and "sterile" inflammation o f the lungs and other organs (1). The aforementioned clearly demonstrates that dysregulation o f neutrophil apoptosis is detrimental to the host, and i n conditions such as C G D , the prolonged survival o f neutrophils caused by L L - 3 7 and other survival factors might be unfavorable and even i n normal individuals must be managed.  4.2  The PI3K and P K C pathways are important in LL-37-mediated neutrophil survival.  The phosphatidylinositol 3-kinases (PI3Ks) are members o f a conserved family o f intracellular lipid  kinases  that phosphorylate  phosphatidylinositol and  phosphoinositides  [reviewed i n (6)]. These phosphorylated lipids subsequently contribute to the activation o f various intracellular signalling pathways that regulate diverse functions such as cell survival and proliferation, differentiation, trafficking and metabolism. PI3 kinases can be activated b y a number o f receptors including growth factor receptor tyrosine kinases ( R T K s ) , G proteincoupled receptors ( G P C R s ) , cytokine receptors and integrins (7). In addition, the purinergic receptor P 2 X  7  has been demonstrated to activate the P I 3 K / A k t pathway i n astrocytes (8). In  Chapter 2, ?2X-j receptor and an unidentified G protein-coupled receptor were shown to be  69  associated with LL-37-induced inhibition o f apoptosis (Figure 2.4). However, it is not clear whether this effect was linked to P I 3 K activation, which was also shown to mediate L L - 3 7 induced neutrophil survival (Figure 2.5). T o test this, the above-mentioned two receptors could be blocked using specific inhibitors and the effect on the subsequent phosphorylation status o f P I 3 K could be examined. This would help to link these isolated events in a coherent paradigm and to gain a complete understanding o f the precise mechanism by which L L - 3 7 regulates neutrophil apoptosis.  The most characterized downstream effector molecule o f P I 3 K is A k t (also called protein kinase B , P K B ) . Once activated, A k t can phosphorylate a host o f other proteins that affect diverse cellular responses including cell growth, cell cycle entry, and cell survival (6). One o f the target proteins o f A k t is the apoptosis-inducing protein B A D . Phosphorylation o f B A D b y A k t prevents B A D from binding to anti-apoptotic Bcl-2 family members B c l - 2 and B c l - x L , thereby promoting cell survival (9). A s an example, G M - C S F has been shown to inhibit neutrophil spontaneous apoptosis through activating P I 3 K / A k t and subsequent phosphorylation o f B A D (10). Since it was recently shown that L L - 3 7 induces phosphorylation o f A k t i n human P B M C s and that this event is linked to chemokine regulation i n these cells ( Y u and Hancock, manuscript submitted), it is possible that L L - 3 7 exerts its anti-apoptotic effect through the activation o f Akt. Thus i n future studies the phosphorylation state o f A k t and B A D as well as the mitochondrial translocation o f B A D should be examined, and this information w i l l be valuable to gain insights into the mechanism through which L L - 3 7 regulates apoptosis i n neutrophils.  In addition to PI3K, P K C signalling also appears to be involved i n LL-37-mediated neutrophil survival, since rottlerin, an inhibitor for P K C 8 (which also inhibits other P K C isoforms to a lesser extent), suppressed LL-37-induced neutrophil survival (Chapter 2, Figure  70  2.5).  P K C 8 has been implicated in regulating cell cycle and apoptosis i n many cell types, and  one key downstream pathway that P K C 8 can activate is the NFKB signalling (11). A P K C - 8 to NFKB pathway has been shown to be involved in enhanced neutrophil adhesion i n endothelial cells and i n the induction o f LAP (inhibitor o f apoptosis protein, which functions as an endogenous caspase inhibitors) (12, 13). P K C signalling has also been implicated i n L L - 3 7 induced angiogenesis b y a direct effect on endothelial cells v i a the P L C - y / P K C / N F - K B signalling pathway (14). In neutrophils, inhibition o f P K C - 8 attenuates TNF-a-mediated activation o f NFKB, resulting i n diminished antiapoptotic signalling (15). These facts demonstrate that the NFKB pathway is an important downstream signalling pathway involved in various effects mediated by certain P K C isoforms including P K C 8 . The NFKB pathway regulates cell apoptotic processes through its effects on the transcription o f survival proteins including M c l - 1 , A l and I A P (16, 17). However, I have found that L L - 3 7 failed to induce Mcl-1 and A l gene expression in neutrophils (Figure 4.1), indicating that mechanisms other than transcriptional regulation o f anti-apoptotic Bcl-2 proteins are involved i n LL-37-mediated neutrophil survival. The gene expression o f Mcl-1 and A l in these experiments was examined at 2 hours post-stimulation by L L - 3 7 , which might not be an appropriate time point. Thus, a time course experiment would clarify whether L L - 3 7 regulates the expression o f these proteins at the transcriptional level. In addition, although L L - 3 7 has been shown to induce transient activation o f NFKB i n human P B M C s ( Y u and Hancock, manuscript submitted), this effect has not been investigated in neutrophils. Thus nuclear translocation o f NFKB subunits needs to be examined i n neutrophils treated with L L - 3 7 to draw any further conclusions.  71  A1  Mcl-1  0)  X  O) c  c CO £ U  *  _r_  (0  X  o  X  u o  r-co  o O  UL  co O  co  + LL CO  o o  c o  o  r-co  CO  co  O I  o  + LL CO  o I  o  Figure 4.1. Mcl-1 and A l gene expression in neutrophils. Neutrophils were exposed to 10 pg/ml L L - 3 7 and/or 30 ng/ml G M - C S F , or vehicle-alone control for 2 hours, and the gene expression o f M c l - 1 and A l was examined by q P C R . F o l d changes (y-axis) were normalized to G A P D H and are relative to the gene expression i n un-stimulated cells (normalized to 1) using the comparative Ct method (see Materials and Methods i n Chapter 2 for details). Data represent means ± S E M for duplicates per condition from three different donors. Paired sample Student's r-test analyses were used to compare treated samples with controls. *, P <0.05.  In addition to PI3K, I have also examined the role o f E R K 1 / 2 and p38 M A P K i n the regulation o f LL-37-induced neutrophil survival and apoptosis. Although E R K 1 / 2 has been implicated i n the anti-apoptotic effect o f many survival factors, it appears to be irrelevant in L L 37-induced inhibition o f neutrophil apoptosis (Figure 2.5). In contrast to the well-accepted role o f E R K 1 / 2 i n suppressing neutrophil spontaneous apoptosis, the function o f p38 M A P K seems to be complex. It appears that the involvement o f p38 i n stimuli-induced survival is stimulus dependent. For instance, G M - C S F stimulation does not activate p38 (18), whereas hypoxia-  72  mediated inhibition o f apoptosis requires p38 M A P K activity (19), and further, p38 activation promotes apoptosis i n LPS-stimulated neutrophils (20). Indeed, it has also been shown that p38 is activated by cellular stress, a so-called death factor, and results in subsequent apoptosis (21). In resting neutrophils, Aoshiba et al demonstrated that p38 was constitutively phosphorylated and activated, and inhibition o f p38 by a specific inhibitor and an antisense oligonucleotide delayed apoptosis (18). However, conflicting reports exist, such that the role o f p38 i n constitutive spontaneous apoptosis is not entirely clear (21). These contradicting data suggest that p38 M A P K activation can generate downstream signals that either promote cell death or survival, depending on the specific stimulus and the interactions between p38 and other signalling pathways (17). Nonetheless, i n m y experiments, inhibition o f the p38 pathway b y specific inhibitor SB203580 suppressed spontaneous apoptosis i n resting neutrophils but also modestly impaired LL-37-induced neutrophil survival (Figure 4.2). These results support the concept that p38 activation promotes apoptosis i n resting cells, and they also indicate that, like hypoxia, LL-37-mediated inhibition o f neutrophil apoptosis involves p38 activation.  73  • 0 pg/ml LL-37 • 1 pg/ml LL-37  100 CO  w 80 o a.  •  160 o40 0>  X  III  20 0  I  c o O  o CO in CO o CM m co  CM O O CM >•  in o oo o> Q CL  Figure 4.2. The p38 signalling pathway is involved in LL-37-induced neutrophil survival. Neutrophil apoptosis over 20 h incubation was examined by F A C S analysis for PE-annexinV-positive, 7AAD-negative cells after incubation with 1 pg/ml L L - 3 7 or endotoxin-free water as a vehicle control, added 30 m i n after 12.5 p M SB203580,  10  u M LY294002, 10 p M PD98059, or a vehicle-alone control. Results represent the percentage o f apoptotic cells as mean ± S E M for three replicates per condition from four different donors. Paired sample Student's Mest analyses were used to compare inhibitorstreated samples with samples that were not exposed to inhibitors under the same stimulation conditions (LL-37-treated or vehicle-control treated samples). *, P <0.05.  4.3  LL-37 mediates inhibition of neutrophil apoptosis through effects on both intrinsic and extrinsic apoptotic pathways. A s described i n detail i n Chapter 1, two pathways, the intrinsic mitochondrial pathway  and extrinsic death receptor pathway, are known to initiate the apoptosis cascades in neutrophils.  74  M y results indicate that L L - 3 7 has effects on both pathways. Firstly, i n Chapter 2,1 showed that LL-37-treated neutrophils have a significantly higher level o f the anti-apoptotic Mcl-1 protein as opposed to unstimulated cells (Chapter 2, Figure 2.2). M c l - 1 is a key regulator o f the mitochondrial pathway, and it is known that the gene expression o f M c l - 1 can be induced b y certain cytokines including G M - C S F (22). In addition, the cellular level o f this protein can also be regulated at the post-translational level since it has a P E N T motif which would target it for proteolysis v i a the proteasome (17). Interestingly, a recent report demonstrated that G M - C S F , i n addition to its modest effect on Mcl-1 transcription, also increases the stability o f Mcl-1 protein, rendering it more resistant to proteasome degradation (17). It was not investigated i n this thesis whether L L - 3 7 has the similar M c l - 1 stabilization effect, but it is clear that L L - 3 7 does not regulate Mcl-1 expression at the transcriptional level, as demonstrated b y Figure 4.1. However, this peptide may conceivably sustain Mcl-1 gene expression b y stabilizing transcripts o f Mcl-1 through activation o f p38 M A P K . In addition to the mitochondrial intrinsic pathway, death receptor apoptotic pathway also appears to be regulated by L L - 3 7 , as I showed i n Chapter 2 that higher levels o f full length B I D were found i n L L - 3 7 treated neutrophils than i n unstimulated cells (Figure 2.2). In apoptotic cells, B I D is cleaved by activated caspase 8 v i a the activation o f death receptors. Desagher et al have demonstrated that when full length B I D is phosphorylated, it becomes insensitive to cleavage b y caspase 8, thereby rendering H e L a cells resistant to death-receptor induced apoptosis (23). This group has also identified the candidate kinases that phosphorylate B I D , including both casein kinases ( C K ) I and II. Both kinases appear to be ubiquitously expressed and constitutively active. It is not entirely clear how casein kinases are regulated, but it has been proposed that casein kinases work only in conjunction with other protein kinases to phosphorylate certain substrates (23).  For example, P K C is one such kinase which is implicated i n P M A - i n d u c e d B I D  75  phosphorylation via C K i n Jurkat cells (24). Interestingly, P K C appears to play a role i n L L - 3 7 mediated anti-apoptotic effect as demonstrated i n Chapter 2 (Figure 2.5). Thus it is possible that L L - 3 7 activates P K C , which i n turn phosphorylates B I D i n conjunction with C K s . To test this hypothesis, the phosphorylation state o f B I D could be examined under conditions i n which P K C is blocked. Naturally, B I D can also be regulated at various levels through other mechanisms such as by controlling the expression or activation state o f caspase 8, the up-stream molecule o f B I D . However, it seems that gene expression o f B I D is not affected b y L L - 3 7 , as demonstrated by Figure 4.3.  0)  o> c o o  c o O  r»  LL  _j  o  «  £0 0  CO Q_  1  CO  o  Figure 4.3. B I D gene expression in neutrophils. Neutrophils were exposed to 10 |ig/ml L L - 3 7 and/or 30 ng/ml G M - C S F , 100 ng/ml L P S or vehicle-alone control for 2 hours, and the gene expression o f B I D was examined by q P C R . F o l d changes (y-axis) were normalized to G A P D H and are relative to the gene expression i n unstimulated cells (normalized to 1) using the comparative Ct method (see Materials and Methods i n Chapter 2 for details). Data represent means ± S E M for duplicates per condition from three different donors. Student's /-test analyses were used to compare treated samples with controls. * P<0.05. 76  4.4  L L - 3 7 amplifies beneficial inflammatory signals by enhancing chemokine production induced by IL-lp\ Neutrophils are released from the bone marrow into circulation at a rate o f l x l O  1 2  cells /  day and constitute 60 % o f blood cells. Monocytes, on the other hand, represent a mere 10 % o f the blood cell population (25). Neutrophils are terminally differentiated cells and perhaps produce low level o f cytokines on a per cell basis as compared to macrophages; but early on at the infection foci, they outnumber macrophages by a considerable extent (26). Thus as a whole, neutrophils are one o f the major sources o f cytokine/chemokine, should infection occur, and as a result, they are increasingly appreciated as an important immunomodulator (26). Neutrophils have been shown to produce a number o f chemokines i n response to pro-inflammatory stimuli such as L P S (26). These chemokines recruit other effector cells to the infection foci to eliminate invading microbes, and therefore are an essential component o f the immune response. A m o n g the chemokines tested, I have shown that L L - 3 7 is able to induce Gro-a, M i p - l a , IL-8, and C C L 2 2 release from human neutrophils (Chapter 3, Figure 3.2). Unlike monocytes and airway epithelial cells, neutrophils only release small amounts o f these chemokines i n response to L L - 3 7 , although they are capable o f producing much larger quantities o f chemokines i n conditions such as co-stimulation with L L - 3 7 and IL-1B (Figure 3.2) and stimulation by L P S (Figure 3.1). These results demonstrate that some o f the LL-37-mediated effects are specific to distinct cell types. This view is further supported b y the fact that the synergistic effect between L L - 3 7 and cytokines is not a general mechanism that applies to all cell types. For example, i n human peripheral derived monocytes, G M - C S F has also been to act i n synergy with low concentrations o f L L - 3 7 (< 10  ng/ml) i n inducing augmented  effect that would require at least 50  ng/ml L L - 3 7  activation o f E R K 1 / 2 and p38, an  used alone (27). However, according to m y  results, co-stimulation o f G M - C S F and L L - 3 7 did not induce considerably higher levels o f  77  chemokine release from neutrophils (Figure 4.4). N o r did these two molecules act i n synergy i n inducing an enhanced inhibition o f apoptosis in neutrophils (data not shown), although they are both potent survival factors.  1200  f  a.  £  a.  n  i  a.  Mip-1a  X  ^1000  800 -  1a>  600 -  800  *  op 600  400 -  ~  0-  *  1200  1000 -  200 -  IL-8  1400  on • Q 2  o O  CO  -  1  LL CO  o  co  CO  O  400 200  CO Q-  0  * I  .a • o c o O  £ ± 1  CO  co  o co o O  L!  co  CL  Figure 4.4. Effect of LL-37 and GM-CSF co-stimulation on chemokine release in neutrophils. The Mip-loc and IL-8 production by neutrophils was assessed b y E L I S A analysis o f culture supernatants following incubation o f neutrophils for 20 hours with 10 ug/ml L L - 3 7 , 30 ng/ml G M - C S F with or without L L - 3 7 , 100 ng/ml L P S , or vehiclealone control. Data represent means ± S E M for three replicates per condition. The result o f an experiment from one donor, representative o f three, is shown. Paired sample Student's /-test analyses were used to compare treated samples with controls. *, P <0.05.  The synergistic effect between L L - 3 7 and I L - i p is particularly relevant as I L - i p is a major proinflammatory stimulus, and by activating the I L - 1 R / T L R signalling pathway, it induces the production o f numerous inflammatory mediators. During the course o f infection, neutrophils and  78  monocytes rapidly migrate to the site o f infection, where L L - 3 7 accumulates as a result o f neutrophil degranulation and up-regulated expression i n epithelial cells. The elevated levels o f L L - 3 7 also contribute i n part to the induction o f IL-1 (3 from human monocytes (28). Interestingly, IL-1 (3 on its own is not a potent inducer o f chemokine release from neutrophils (Figure 3.2); however, the presence o f both stimuli significantly enhances neutrophil chemokine responses even with low concentrations o f L L - 3 7 (10 jxg/ml). L L - 3 7 expression has been detected at ~5 pg/ml  i n bronchoalveolar lavage ( B A L ) from  healthy infants  and is up-regulated  by  inflammation, being detected in B A L from infants with pulmonary infections and i n individuals with cystic fibrosis at up to - 3 0  ng/ml and  -15  ng/mh respectively (29, 30). M a n y  effects o f L L -  37 observed from in vitro studies cannot be induced by this peptide alone with these abovementioned concentrations (5-30 iig/m\); however, L L - 3 7 or any other inflammatory mediator would not exist in isolation because the innate immune system has  numerous  components with complex interactions to control the outcome o f an infection. Thus studies on the  synergistic effects  between  LL-37  and  IL-1 (3 would  provide information  towards  understanding o f immune response under physiological conditions.  4.5  Conclusions M y results presented i n this thesis add yet another aspect to our ever expanding  knowledge o f the complex modulatory role o f L L - 3 7 i n innate immunity. It is intriguing that this small peptide with a simple structure displays incredibly diverse and often times specific effects on distinct cell types. Because L L - 3 7 and other cationic host defense peptides generally enhance host defenses at the infection foci while diminishing harmful inflammatory effects such as T N F a induction by certain T L R agonists, these peptides show great promise as a therapeutic adjuvant to prevent or treat infections (31). However, at high concentrations L L - 3 7  demonstrates  79  cytotoxicity due to cell membrane damage, which limits its potential for therapeutic use. Understanding the immunomodulatory functions and the underlying mechanisms would provide invaluable information i n developing synthetic peptides. The successful synthetic peptide should have high potency o f antimicrobial activity yet l o w cytotoxicity to host cells, and the ability to boost beneficial immune responses and dampen detrimental effects. Results o f this study w i l l assist further understanding o f how L L - 3 7 regulates infectious and inflammatory processes in vitro and ultimately in vivo, and point to new directions for controlling infectious diseases.  80  4.6 1. 2. 3. 4. 5.  6.  7. 8.  9.  10.  11. 12.  13. 14.  15.  16.  Bibliography Lakshman, R., and A . Finn. 2001. Neutrophil disorders and their management. J Clin Pathol 54:7-19. Simon, H . U . 2003. Neutrophil apoptosis pathways and their modifications i n inflammation. Immunol Rev 193:101-110. Nathan, C . 2006. Neutrophils and immunity: challenges and opportunities. Nat Rev Immunol 6:173-182. Heyworth, P. G . , A . R . Cross, and J. T. Curnutte. 2003. Chronic granulomatous disease. Curr Opin Immunol 15:578-584. Hofman, P. 2004. Molecular regulation o f neutrophil apoptosis and potential targets for therapeutic strategy against the inflammatory process. Curr Drug Targets Inflamm Allergy 3:1-9. Katso, R . , K . Okkenhaug, K . Ahmadi, S. White, J. Timms, and M . D . Waterfield. 2001. Cellular function o f phosphoinositide 3-kinases: implications for development, homeostasis, and cancer. Annu Rev Cell Dev Biol 17:615-675. Engelman, J. A . , J. Luo, and L . C . Cantley. 2006. The evolution o f phosphatidylinositol 3-kinases as regulators o f growth and metabolism. Nat Rev Genet 7:606-619. Jacques-Silva, M . C , R. Rodnight, G . Lenz, Z . Liao, Q. K o n g , M . Tran, Y . Kang, F . A . Gonzalez, G . A . Weisman, and J. T. Neary. 2004. P 2 X 7 receptors stimulate A K T phosphorylation i n astrocytes. Br J Pharmacol 141:1106-1117. Zha, J., H . Harada, E . Y a n g , J. Jockel, and S. J. Korsmeyer. 1996. Serine phosphorylation o f death agonist B A D i n response to survival factor results i n binding to 14-3-3 not B C L X ( L ) . Cell 87:619-628. K l e i n , J. B . , M . J. Rane, J. A . Scherzer, P. Y . Coxon, R . Kettritz, J. M . Mathiesen, A . Buridi, and K . R . M c L e i s h . 2000. Granulocyte-macrophage colony-stimulating factor delays neutrophil constitutive apoptosis through phosphoinositide 3-kinase and extracellular signal-regulated kinase pathways. J Immunol 164:4286-4291. Steinberg, S. F . 2004. Distinctive activation mechanisms and functions for protein kinase Cdelta. Biochem J384:449-459. Rahman, A . , K . N . Anwar, S. Uddin, N . X u , R . D . Y e , L . C . Platanias, and A . B . M a l i k . 2001. Protein kinase C-delta regulates thrombin-induced I C A M - 1 gene expression i n endothelial cells v i a activation o f p38 mitogen-activated protein kinase. Mol Cell Biol 21:5554-5565. Wang, Q., X . Wang, and B . M . Evers. 2003. Induction o f cIAP-2 i n human colon cancer cells through P K C delta/NF-kappa B . JBiol Chem 278:51091-51099. Koczulla, R., G . von Degenfeld, C . Kupatt, F . Krotz, S. Zahler, T. Gloe, K . Issbrucker, P. Unterberger, M . Zaiou, C . Lebherz, A . K a r l , P. Raake, A . Pfosser, P. Boekstegers, U . Welsch, P. S. Hiemstra, C . Vogelmeier, R . L . Gallo, M . Clauss, and R . Bals. 2003. A n angiogenic role for the human peptide antibiotic L L - 3 7 / h C A P - 1 8 . J Clin Invest 111:1665-1672. Kilpatrick, L . E . , J. Y . Lee, K . M . Haines, D . E . Campbell, K . E . Sullivan, and H . M . Korchak. 2002. A role for P K C - d e l t a and PI 3-kinase i n TNF-alpha-mediated antiapoptotic signaling i n the human neutrophil. Am J Physiol Cell Physiol 283:C48-57. Walmsley, S. R., C . Print, N . Farahi, C . Peyssonnaux, R . S. Johnson, T. Cramer, A . Sobolewski, A . M . Condliffe, A . S. Cowburn, N . Johnson, and E . R . Chilvers. 2005. Hypoxia-induced neutrophil survival is mediated by HIF-1 alpha-dependent NF-kappaB activity. J Exp Med 201:105-115. 81  17.  18.  19. 20.  21.  22.  23.  24.  25.  26. 27.  28.  29.  30.  31.  Moulding, D . A . , C . A k g u l , M . Derouet, M . R . White, and S. W . Edwards. 2001. B C L - 2 family expression i n human neutrophils during delayed and accelerated apoptosis. J Leukoc Biol 70:783-792. Aoshiba, K . , S. Yasui, M . Hayashi, J . Tamaoki, and A . Nagai. 1999. Role o f p38mitogen-activated protein kinase i n spontaneous apoptosis o f human neutrophils. J Immunol 162:1692-1700. Leuenroth, S. J., P . S. Grutkoski, A . A y a l a , and H . H . Simms. 2000. Suppression o f P M N apoptosis b y hypoxia is dependent on M c l - 1 and M A P K activity. Surgery 128:171-177. Nolan, B . , A . Duffy, L . Paquin, M . De, H . Collette, C . M . Graziano, and P. Bankey. 1999. Mitogen-activated protein kinases signal inhibition o f apoptosis i n lipopolysaccharidestimulated neutrophils. Surgery 126:406-412. Frasch, S. C , J. A . N i c k , V . A . Fadok, D . L . Bratton, G . S. Worthen, and P . M . Henson. 1998. p38 mitogen-activated protein kinase-dependent and -independent intracellular signal transduction pathways leading to apoptosis i n human neutrophils. J Biol Chem 273:8389-8397. Schubert, K . M . , and V . Duronio. 2001. Distinct roles for extracellular-signal-regulated protein kinase ( E R K ) mitogen-activated protein kinases and phosphatidylinositol 3kinase i n the regulation o f M c l - 1 synthesis. Biochem J356:473-480. Desagher, S., A . Osen-Sand, S. Montessuit, E . Magnenat, F. Vilbois, A . Hochmann, L . Journot, B . Antonsson, and J. C . Martinou. 2001. Phosphorylation o f b i d b y casein kinases I and II regulates its cleavage b y caspase 8. Mol Cell 8:601-611. Scaffidi, C , I. Schmitz, J . Zha, S. J. Korsmeyer, P. H . Krammer, and M . E . Peter. 1999. Differential modulation o f apoptosis sensitivity i n C D 9 5 type I and type II cells. J Biol Chem 274:22532-22538. Scheel-Toellner, D . , K . Q . Wang, P . R . Webb, S. H . Wong, R. Craddock, L . K . A s s i , M . Salmon, and J . M . Lord. 2004. Early events i n spontaneous neutrophil apoptosis. Biochem Soc Trans 32:461-464. Cassatella, M . A . 1999. Neutrophil-derived proteins: selling cytokines b y the pound. Adv Immunol 73:369-509. Bowdish, D . M . , D . J. Davidson, D . P . Speert, and R . E . Hancock. 2004. The human cationic peptide L L - 3 7 induces activation o f the extracellular signal-regulated kinase and p38 kinase pathways in primary human monocytes. J Immunol 172:3758-3765. Elssner, A . , M . Duncan, M . Gavrilin, and M . D . Wewers. 2004. A novel P 2 X 7 receptor activator, the human cathelicidin-derived peptide L L 3 7 , induces IL-1 beta processing and release. J Immunol 172:4987-4994. Schaller-Bals, S., A . Schulze, and R . Bals. 2002. Increased levels o f antimicrobial peptides i n tracheal aspirates o f newborn infants during infection. Am J Respir Crit Care Med 165:992-995. Chen, C . I., S. Schaller-Bals, K . P. Paul, U . Wahn, and R. Bals. 2004. Beta-defensins and L L - 3 7 i n bronchoalveolar lavage fluid o f patients with cystic fibrosis. J Cyst Fibros 3:4550. Finlay, B . B . , and R . E . Hancock. 2004. C a n innate immunity be enhanced to treat microbial infections? Nat Rev Microbiol 2:497-504.  82  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0100840/manifest

Comment

Related Items