Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Characterization of opsonins with potential for engagements in removal of dying tumour cells following… Merchant, Soroush 2007

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2007-0514.pdf [ 21.22MB ]
Metadata
JSON: 831-1.0100802.json
JSON-LD: 831-1.0100802-ld.json
RDF/XML (Pretty): 831-1.0100802-rdf.xml
RDF/JSON: 831-1.0100802-rdf.json
Turtle: 831-1.0100802-turtle.txt
N-Triples: 831-1.0100802-rdf-ntriples.txt
Original Record: 831-1.0100802-source.json
Full Text
831-1.0100802-fulltext.txt
Citation
831-1.0100802.ris

Full Text

CHARACTERIZATION OF OPSONINS WITH POTENTIAL FOR ENGAGEMENT IN REMOVAL OF DYING TUMOUR CELLS FOLLOWING PHOTODYNAMIC THERAPY  by  Soroush Merchant  B . S c , The University of British Columbia, 2004  A THESIS S U B M I T E D IN P A R T I A L F U L F I L L M E N T OF T H E R E Q U I R M E N T S F O R T H E D E G R E E OF  M A S T E R OF SCIENCE  in  The Faculty of Graduate Studies  (Pathology and Laboratory Medicine)  T H E UNIVERSITY OF BRITISH C O L U M B I A  October 2007  © Soroush Merchant, 2007  ABSTRACT It has become evident that mice bearing tumours treated with photodynamic therapy (PDT) exhibit three hallmarks o f acute phase response: neutrophilia, hypothalamic-pituitary-adrenal (HP A ) axis activation and the release o f acute phase proteins. The latter and a subset o f the innate immune system are the subjects o f this research for they have been shown to play critical roles i n the clearance o f dead and dying cells. A m o n g these respective proteins are participants i n a rapid and noninflammatory dead cell removal process, which is believed to be important for the outcome o f tumour P D T . Therefore, innate immune proteins including early complement components ( C l q , mannose-binding lectin ( M B L ) and ficolins), acute phase proteins including pentraxins (serum amyloid P component ( S A P ) & pentraxin-3 (Ptx3)), and heat shock protein-70 (Hsp70) were the focus o f our investigation. These proteins are implicated to be soluble sensors o f molecular patterns expressed on dying cells. Identification o f the critical candidates from this selection, and modulation o f their actions could optimize the PDT-induced development o f tumour specific immunity.  Hypothesis: Early complement components ( C l q , M B L and ficolins) and pentraxins ( S A P & Ptx3) are known to be involved in a rapid and non-immunogenic dead cell disposal method. Characterization o f their activity and o f Hsp70 when faced with the burden o f clearing P D T killed solid tumour cancer cells would be beneficial in development o f new therapeutic approaches.  The first objective o f this project was to determine the genes most involved in the removal o f apoptotic cells. In vivo gene expression studies were performed using Lewis Lung Carcinomas ( L L C ) growing in C57B1/6J mice. B y performing real-time P C R on different tissue samples collected from nai've, untreated and PDT-treated mice, the expression o f seven genes were evaluated: early complement components C l q , M B L - A , ficolins A & B ; pentraxins S A P and Ptx3; and Hsp70. A m o n g these candidates, Hsp70, S A P and ficolin B showed the most pronounced gene up-regulation in vivo i n response to P D T at both the local treated site (tumour) and at a systemic site (liver). These three proteins were therefore further investigated in this project. In order to pinpoint the sources responsible for the elevated expressions o f Hsp70, S A P and ficolin B , in vitro gene expression studies were performed using mouse peritoneal macrophages (IC-21), mouse hepatomas (Hepa 1-6) and L L C tumour cell line. The investigated genes were found to become highly up-regulated in PDT-treated L L C cells. Moreover, untreated macrophages and hepatoma cells up-regulated their S A P and Hsp70 genes respectively, when co-incubated with PDT-treated L L C cells.  Our second objective was to examine the mechanisms responsible for systemic up-regulation o f Hsp70, S A P and ficolin B . Since tumour P D T activates the hypothalamic-pituitary-adrenal ( H P A ) axis i n the host, we attempted to discover any links between the H P A activation and up-regulation o f these genes i n the liver. Experiments were done to test the effects o f the glucocorticoid (dexamethasone), its receptor antagonist (mifepristone) and its synthesis inhibitor (metyrapone) on nai've mice and mice with PDT-treated tumours, demonstrated that the up-regulation o f the  investigated three genes is at least partially mediated by the activation o f the H P A axis and the release o f glucocorticoids.  The final objective o f this study was to determine whether Hsp70 would act as an acute phase protein, produced and released systemically by the liver in response to P D T induced trauma. Lower levels o f Hsp70 were found in livers o f mice with P D T treated tumours compared to mice with untreated tumours. This demonstrates that Hsp70 is being released from the liver in response to tumour-localized PDT-induced trauma. In addition, L L C cells treated in vitro with P D T , but not untreated L L C cells, were found to bind extracellulary added Hsp70 protein. These findings suggest that released Hsp70 is capable o f binding to PDT-damaged and dying tumour cells, and indicate that this protein can have a critical role in the removal o f dying cells.  The results o f the experiments have demonstrated that among the investigated proteins Hsp70, S A P and ficolin B are highly transcribed at the local (tumour) and at a systemic (liver) site in response to tumour P D T treatment. Based on this evidence and previously published data, the three proteins studied appear to be the main candidates responsible for the effective removal o f dead cancer cells. Their activity in clearing large loads o f killed tumour cells could influence the development o f the adaptive immune response towards cancer cells, destroying the primary tumour as well as any metastases or re-occurrences o f the same type o f cancer. Further studies aimed at elucidating the activity o f these proteins in dead cell removal should identify therapeutic targets with potential for improved curative outcome.  TABLE OF CONTENTS ABSTRACT  ii  TABLE OF CONTENTS  v  LIST O F T A B L E S  x  LIST OF FIGURES  xi  ABBREVIATIONS  xiii  ACKNOWLEDGEMENTS 1) I N T R O D U C T I O N  xviii 1  '.  1.1) WASTE DISPOSAL HYPOTHESIS  1  1.2) PROTEINS INVOLVED IN DEAD CELL CLEARANCE  6  1.2.1) Complement system  6  1.2.1.1) Complement pathways  6  1.2.1.2) Complement receptors  8  1.2.1.3) Complement and apoptotic cells  8  1.2.1.4) Complement as a bridge between the innate and the adaptive immune systems  ••'  11  1.2.2) Pentraxins  13  1.2.2.1) Serum amyloid P component (SAP) 1.2.2.2) C-reactive protein (CRP)  14 :  1.2.2.3) Pentraxin-3 (Ptx3)  14 15  1.2.3) Heat shock proteins  17  1.2.3.1) The many roles of heat shock proteins  17  1.2.3.2) Heat shock protein receptors  18  1.2.3.3) Heat shock proteins as danger signals  19  1.3) ACUTE PHA SE RE SPON SE  21  1.3.1) Liver and acute phase proteins 1.3.2) APR and the hypothalamic-pituitary-adrenal 1.3.3) APR and metabolic changes  21 (HPA) axis  22 23  1.4) PHOTODYNAMIC THERAPY (PDT)  24  1.4.1) History ofphotodynamic therapy  24  1.4.2) Benefits ofphotodynamic therapy  25  1.4.3) Photofrin-based PDT in clinical use  26  1.4.4) Second generation photosensitizers  26  1.4.5) Photodynamic therapy mechanisms of action  27  1.4.6) Cascade of events after PDT-induced trauma  30  1.4.7) PDT and the complement system  31  1.4.8) PDT and cellular immunity  32  1.4.9) PDT and adaptive immunity  33  2) H Y P O T H E S I S  35  3) S P E C I F I C A I M S  35  4) M A T E R I A L S A N D M E T H O D S  36  4.1) ANIMAL MODEL  36  4.2) TUMOR MODEL  36  4.2.1) In vivo  36  4.2.2) In vitro culture  39  4.3) PHOTODYNAMIC THERAPY 4.4) IN VITRO CO-INCUBATION EXPERIMENT  40 41  4.5) SAMPLE COLLECTION AND R N A ISOLATION  43  4.5.1) Tissue collection for RNA isolation  43  4.5.2) RNA isolation from tissue homogenates  43  4.5.3) RNA purification from tissue homogenates  44  4.5.3.1) Phenolxhloroform R N A purification and ethanol precipitation  44  4.5.3.2) R N A concentration reading and DNase digestion  45  4.5.3.3) Phenolxhloroform R N A purification and ethanol precipitation  45  4.5.4) Cell culture collection for RNA isolation  46  4.5.5) RNA isolation and purification from cell culture extracts  47  4.6) QRT-PCR: QUANTITATIVE REVERSE TRANSCRIPTASE (RT) - POLYMERASE CHAIN REACTION (PCR)  49  vi  4.6.1) First-strand cDNA synthesis  50  4.6.2) Real-time quantitative PCR (qPCR) primer and amplicon designs  51  4.6.3) Relative real-time quantitative polymerase chain reaction (qPCR)  53  4 . 6 . 3 . 1 ) Real-time PCR system and reagents  53  4 . 6 . 3 . 2 ) Reaction components  53  4 . 6 . 3 . 3 ) qPCR cycling parameters  55  4 . 6 . 3 . 4 ) Optimized qPCR reactions  55  57  4.6.4) Real-time qPCR data analysis: Relative quantification 4 . 7 ) AGAROSE GEL ELECTROPHORESIS  58  4.7.1) Gel procedure  58  4.7.2) Gel imaging  •• 59  4 . 8 ) ENZYME-LINKED IMMUNOSORBENT ASSAY (ELISA)  4.8.1) ELISA procedure  60  :  60  4.8.2) Sample preparation  61  4 . 8 . 2 . 1 ) Liver samples  61  4 . 8 . 2 . 2 ) Serum samples  62  4.8.3) Hsp70 standard curves  62  4 . 8 . 3 . 1 ) Liver standard curve  62  4 . 8 . 3 . 2 ) Serum standard curve  63  4.8.4) ELISA data analysis  64  4.8.5) ELISA performance characteristics  66  4 . 9 ) FLOW CYTOMETRY AND ANTIBODY STAINING  67  4.9.1) Flow cytometry parameters 4.9.2) Staining procedure 4 . 1 0 ) P D T CELL DEATH ANALYSIS 4 . 1 1 ) PHARMACEUTICS 4 . 1 2 ) STATISTICAL ANALYSIS  5) R E S U L T S  •••• 67 ;  68 70 ••• 7 2 74  75  5 . 1 ) PDT-1NDUCED CHANGES IN THE EXPRESSION OF GENES FOR H S P 7 0 , PENTRAXIN AND COMPLEMENT PROTEINS AT THE LOCAL (TUMOUR) AND SYSTEMIC (LIVER AND SPLEEN) SITES  7  5  vii  5.1.1) Tumour  76  5.1.2) Liver  '.  79  5.1.3) Spleen  82  5.2) HSP70, S A P AND FICOLIN B GENES ARE HIGHLY UP-REGULATED IN A PDT-TREATED LEWIS LUNG CARCINOMA ( L L C ) CELL LINE  87  5.2.1) PDT induces a pronounced Hsp70, SAP, and ficolin B gene expression upregulations in LLC treated cells  87  5.2.2) Up-regulation of SAP, and ficolin B genes in IC-21 cells co-incubated with PDT-treated LLC cells  .'  89  5.2.3) Presence of PDT-treated LLC cells induce up-regulation of Hsp70 gene in Hepa 1-6 cells  91  5.3) SYSTEMIC HSP70, SAP AND FICOLIN B GENE EXPRESSION UP-REGULATION S-ARE MEDIATED PARTIALLY BY GLUCOCORTICOIDS (GCS)  93  5.3.1) The up-regulation of liver Hsp70 and SAP genes in mice treated by dexamethasone  93  5.3.2) Metyrapone prevents PDT-induced elevation of expression levels of the liver Hsp70, SAP and ficolin B genes  96  5.4) HSP70 PROTEINS ARE PRODUCED AND RELEASED FROM LIVERS OF PDT-TREATED MICE, AND TRAVEL AND BIND AT THE SITE OF TRAUMA  99  5.4.1) PDT-induced changes of serum Hsp70 levels..... 5.4.2) Liver Hsp70protein levels decline after PDT  99 101  5.4.3) Ex-vivo incubation reveals that PDT induces Hsp70protein production in host livers  103  5.4.4) Exogenous Hsp70 protein is capable of binding to PDT-treated LLC cells 105 5.4.5) Hsp70 binding to PDT-treated LLC cells includes linking to phosphatidylserine expressed on the cells 6) D I S C U S S I O N 6.1) THESIS RATIONALE  107 109  :  6.2) OPSONINS WITH POTENTIAL FOR REMOVAL OF DYING TUMOUR CELLS  109 110  6.3) CONSEQUENCES OF PDT-INDUCED TRAUMA: INITIATION OF A P R AND ACTIVATION OF THE H P A AXIS  115  viu  6.4) GLUCOCORTICOID EFFECTS ON HSP70, SAP AND FICOLIN B GENES  120  6.5) THE MANY ROLES OF HEAT SHOCK PROTEIN 70 (HSP70)  121  6.6) HSP70: POSSIBLE ACUTE PHASE REACTANT AND DEAD CELL OPSONIN.,  124  7) C O N C L U S I O N  128  8) F U T U R E D I R E C T I O N S  130  REFERENCES  133  APPENDIX  151  ETHICS CERTIFICATE.  151  ix  LIST Q F T A B L E S TABLE 4.1: DESCRIPTION OF OLIGO-NUCLEOTIDE PRIMER PAIRS USED IN QPCR REACTIONS. 52 TABLE 4.2: COMPONENTS OF 25 uL QPCR REACTIONS AND THEIR CONTRIBUTING VOLUMES TABLE 4.10: DISTRIBUTION OF PDT-INDUCED CELL DEATH IN VITRO  53 70  TABLE 5.1: SUMMARY OF PDT-INDUCED CHANGES IN THE EXPRESSION OF INVESTIGATED GENES  85  X  LIST OF FIGURES FIGURE 1 1: WASTE DISPOSAL HYPOTHESIS  2  FIGURE 1 2: COMPLEMENT SYSTEM.  7  ;  FIGURE 1 3: PHOTODYNAMIC THERAPY MECHANISMS OF ACTION  29  FIGURE 4 1 HEMOCYTOMETER SLIDE AND COVERSLIP  38  FIGURE 4 2 IN VITRO CO-INCUBATION EXPERIMENT...  :  42  FIGURE 4 3 SCHEMATICS OF R N A ISOLATION USING QIAGEN RNEASY® PLUS MINI KIT. 47 FIGURE 4 4 SAP STANDARD CURVE FOR THE ASSESSMENT OF REACTION OPTIMIZATION.. 56 FIGURE 4 5 QUANTITATIVE R T - P C R AMPLICONS  60  FIGURE 4 6 LIVER SERIAL DILUTION SCHEMATICS  63  FIGURE 4 7 SERUM SERIAL DILUTION SCHEMATICS  64  FIGURE 4 8 HSP70 STANDARD CURVES FOR LIVER AND SERUM SAMPLES:  65  FIGURE 4 9 E L I S A PERFORMANCE CURVE  67  FIGURE 4 10: CELL DEATH FLOW CYTOMETRY DOT PLOT  71  FIGURE 5 1 THE EFFECT OF TUMOUR P D T ON TUMOUR-LOCALIZED EXPRESSION OF GENES ENCODING HSP70, SAP, FICOLIN A & B, PTX3, ClQ AND M B L - A  77  FIGURE 5.2: RELATIVE GENE EXPRESSION PROFILES OF HSP70, SAP, FICOLIN B AND PTX3 IN PDT-TREATED TUMOURS  78  FIGURE 5.3: THE EFFECT OF P D T ON THE LIVER-LOCALIZED EXPRESSION OF GENES ENCODING HSP70, SAP, FICOLIN A & B , PTX3, CLQ AND M B L - A FOLLOWING THE TREATMENT  80  FIGURE 5.4: PDT-INDUCED CHANGES IN RELATIVE GENE EXPRESSION PROFILES FOR HSP70, SAP AND FICOLIN B IN LIVERS.....  81  FIGURE 5.5: EXPRESSION LEVELS OF HSP70, FICOLIN B AND C1Q GENES IN THE SPLEENS OF NAIVE, UNTREATED AND PDT-TREATED TUMOUR BEARING MICE  83  FIGURE 5.6: PDT-INDUCED CHANGES IN RELATIVE GENE EXPRESSION PROFILES FOR HSP70 AND FICOLIN B IN SPLEENS  :  84  FIGURE 5.7: THE EFFECT OF PHOTOFRIN TREATMENT ON THE RELATIVE GENE EXPRESSION PROFILES OF HSP70, SAP AND FICOLIN B IN THE LIVER AND TUMOUR  86  xi  FIGURE 5.8: RELATIVE GENE EXPRESSION PROFILES FORHSP70, SAP AND FICOLIN B IN P D T TREATED L L C CELLS  :.. 88  FIGURE 5.9: RELATIVE GENE EXPRESSION PROFILES FORHSP70, S A P AND FICOLIN B IN IC21 CELLS CO-INCUBATED WITH P D T TREATED L L C CELLS  90  FIGURE 5.10: RELATIVE GENE EXPRESSION PROFILES FOR HSP70, S A P AND FICOLIN B IN HEPA 1-6 CELLS CO-INCUBATED WITH P D T TREATED LLCs  92  FIGURE 5.11: THE EFFECT OF DEXAMETHASONE, MIFEPRISTONE AND THEIR COMBINATION ON LIVER GENE EXPRESSION PROFILES FOR HSP70, SAP AND FICOLIN B  95  FIGURE 5.12: RELATIVE GENE EXPRESSION PROFILES FOR HSP70, SAP AND FICOLIN B IN LIVERS OF MICE 4 HRS AFTER P D T TREATMENT AND INJECTION WITH METYRAPONE. 98 FIGURE 5.13: HSP70 PROTEIN LEVEL PROFILE IN SERA OF NAIVE, UNTREATED AND P D T TREATED MICE FIGURE 5.14: THE EFFECT OF P D T ON LIVER HSP70 PROTEIN LEVELS  100 102  FIGURE 5.15: HSP70 PROTEIN LEVELS IN LIVERS OF NAIVE, TUMOUR UNTREATED AND P D T TREATED MICE INCUBATED EX-VIVO  104  FIGURE 5.16: HSP70 PROTEIN ADDED TO CULTURE MEDIUM BINDS TO PDT-TREATED L L C CELLS  106  FIGURE 5.17: ANNEXIN V BINDING TO PDT-TREATED L L C CELLS INCUBATED WITH OR WITHOUT ADDED HSP70  108  FIGURE 6.1: PHOTOFRIN-BASED P D T INDUCES UP-REGULATION OF HSP70, S A P AND FICOLIN B GENES FOLLOWING TREATMENT FIGURE 6.2: THE HYPOTHALAMIC-PITUITARY-ADRENAL (HPA) AXIS  114 118  xii  ABBREVIATIONS '02: Singlet oxygen 5-ALA: 5-aminolevulinic acid 7-AAD: 7-amino-actinomycin D AIDS: Acquired immunodeficiency syndrome AP-1: Activator protein 1 A P C : Antigen presenting cells APR: Acute phase response A R C : Animal Research centre A T C H : Adrenocorticotropic hormone BLyS: B lymphocyte stimulator C3aR: C3a receptor C4BP: C4b binding protein C5aR: C5a receptor C5L2: C5a receptor L2 CD40L: CD40 ligand c D N A : Complementary strand D N A CNS: Central nervous system COX-2: Cyclooxygenase 2 CR: Complement receptor C R H : Corticotrophin-releasing hormone CRP: C-reactive protein C : Threshold cycle T  xiii  C T L : Cytotoxic T lymphocyte Cyclic A M P : Cyclic adenosine monophosphate D5W: Dextrose 5% in Water D C : Dendritic cell ddFLiO: Deionized distilled water D E P C : Diethylpyrocarbonate dsDNA: Double-stranded D N A E : Efficiency E D T A : Ethylenediamine tetraacetic acid E L A M - 1 : Endothelial cell-leukocyte adhesion molecule-1 ELISA: Enzyme-linked immunosorbent assay ER: Endoplasmic reticulum FBS: Fetal bovine serum F D C : Follicular dendritic cell FITC: Fluorescein isothiocyanate FS: Forward scatter G A P D H : Glyceraldehydes-3-phospahte dehydrogenase G C : Glucocorticoid G M - C S F : Granulocyte-macrophage colony-stimulating factor GR: Glucocorticoid receptor HBSS: Hank's balanced salt solution HPA: Hypothalamic-pituitary-adrenal (axis) HPD: Hematoporphyrin derivative  Hsp: Heat shock protein Hsp70: Heat shock protein-70 I/R: Ischemia-reperfusion iC3b: Inactivated C3b ICAM-1: Intercellular adhesion molecule-1 iDC: Immature dendritic cell IFN-y: Interferon-gamma IGF-I: Insulin-like growth factor-I IgG: Immunoglobulin G IL: Interleukin iNOS: Inducible nitric oxide synthase L L C : Lewis lung carcinoma L O X - 1 : Low density lipoprotein receptor-1 LPS: Lipopolysaccharide M A C : Membrane attack complex M A S P : MBL-associated proteases M B L : Mannose-binding lectin mCRP: Membrane complement regulatory protein MGI: Mouse genome informatics M H C : Major histocompatibility complex M s r l : Macrophage scavenger receptor-1 m-THPC: Meta-tetra hydroxyphenyl chlorine NCBI: National center for biotechnology information  N F - K B : Nuclear factor-kappa B N K : Natural killer N O : Nitric oxide PARP: Poly ADP-ribose polymerase PBS: Phosphate buffered saline solution PC: Phosphatidylcholine PCR: Polymerase chain reaction PDT: Photodynamic therapy PE: Phosphatidylethanolamine PE: Phycoerythrin PEG400: Polyethylene Glycol 400 PGE2'. Prostaglandin E2 P L A : Phospholipase A 2  2  PS: Phosphatidylserine Ptx3: Pentraxin-3 qRT-PCR: Quantitative reverse transcriptase polymerase chain reaction R : Coefficient of determination 2  ROS: Reactive oxygen species S A A : Serum amyloid A SAP: Serum amyloid P component SCC: Squamous cell carcinoma SE: Standard error SLE: Systemic lupus erythematosus  snRNP: Small nuclear ribonucleoprotein SS: Side scatter T A E : Tris-Acetate-EDTA T G F - P : Transforming growth factor p T L R : Toll-like receptor T M B : Tetramethylbenzidine T N F - a : Tumour necrosis factor a U D G : Uracil D N A glycosylase P - M E : P-mercaptoethanol  ACKNOWLEDGEMENTS I would like to express my deep and sincere gratitude to my supervisor, Professor Mladen Korbelik, Ph.D., Department of Phathology and Laboratory Medicine, University of British Columbia. His extensive knowledge in the fields of photodynamic therapy and cancer immunotherapy has been extremely valuble for me. His understanding, constant guidance and devoted attention have provided an excellent basis for the present thesis.  I extend my gratitude to the members of the Korbelik Lab, Dr. Jinghai Sun, M . D . , and Mr. Brandon Stott, M . S c , for their technical laboratory expertice and support.  I am grateful to Ms. K y i Min Saw and Ms. Margaret Hale, technical staff of the Terry Fox Laboratories, for their co-operation and guidance to use the Applied Biosystems 7500 Real-Time PCR System.  During this project I have worked alongside many colleagues for whom I have greate regard and I wish to extend my warmest thanks to all those who have helped me with my work in the Department of Cancer Imaging at the British Columbia Cancer Research Centre. In particular my sincere thanks to Professor Calum MacAulay, Ph.D., Head of the Department of Cancer Imaging.  My thanks go to Ms. Penny Woo, the Department of Pathology and Laboratory Medicine Program Assistant, for all her kind and compassionate support with the administrative work.  xviii  I also would like to acknowledge the National Cancer Institute of Canada and the Canadian Institutes of Health Reseach for funding and supporting this project.  Lastly I wish to thank my parents and sister, Mr. Dinshaw Merchant, Mrs. Katy Shahriari and Miss. Sepideh Merchant, on whose constant encouragement, love and support I have relied throughout my life. It is to them that I dedicate this work.  (  xix  Introduction  1) INTRODUCTION 1.1) Waste disposal hypothesis The justification behind this project emanates from the "Waste-Disposal Hypothesis" which elegantly illustrates the most plausible pathological mechanism responsible for the development o f the autoimmune disease, Systemic Lupus Erythematosus ( S L E ) [1]. This hypothesis proposes that massive apoptosis and failure o f the appropriate clearance by macrophages, immature dendritic cells and complement, potentially leads to the onset o f an autoimmune response [2]. This explains the importance o f complement and pentraxin proteins for the anti-inflammatory clearance o f apoptotic cells from tissues [3,4]. It further demonstrates the complications caused b y the failure o f such innate immune components i n ridding the body o f dead and dying cells. Impaired removal, and therefore accumulation, o f apoptotic cells due to the absence o f the early complement components and pentraxins could evoke an autoimmune response. This is supported by the very high correlations (>90%) between C l q and serum amyloid P component ( S A P ) deficiencies and the predisposition to autoimmunity i n both man and mouse [5, 6]. The fact that altered levels o f complement and pentraxins could induce an adaptive immune response is very intriguing. This phenomenon can be utilized by manipulating the levels o f key complement and pentraxin proteins involved i n clearance o f apoptotic tumour cells to elicit an adaptive immune response against tumours. Inducing such tumour specific immunity could very well eradicate the primary lesion as well as any secondary metastases.  1  Introduction  Th ro m bos pen . d i n  Phosphatidyl serine ^ receptor  Serum amyloid P component  Macrophage  —* i  iC3b Complement receptor  GM-CSF* -IJ  •  a  e  Immature ^ , n  <  k  m  c  imeHeuHn-w g  n  V  *  T N F  '*  Mature dendritic ceil  hf  Apoptotic cells j f  !m«r!«uki*v1  Tcell  Apoptotic cell  Activated Tcell  Autoreactive Bcell  BLyS receptor BLyS  Plasma cell  Autoantibodies  F i g u r e 1.1; Waste disposal hypothesis. Panel A : There is an array o f ligands and receptors on apoptotic cells and macrophages that make efferocytosis an extremely efficient process. Binding o f proteins such as C l q , C-reactive protein and I g M may initiate complement mediated opsonization o f apoptotic cells. These cells are engulfed following the ligation o f complement receptors on macrophages. Other bound proteins such as pentraxins (serum amyloid P component) mask auto-antigens and promote safe removal o f apoptotic cells. After efferocytosis, macrophages release the antiinflammatory cytokine T G F - p \ Panel B : Excess o f apoptotic cells accompanied by failure o f receptor-ligand mediated uptake may lead to the initiation o f adaptive immune response. In the presence o f inflammatory cytokines including G M - C S F , T N F - a and I L 1, antigen presenting cells mature after efferocytosis. T cells are activated upon dendritic cell mediated presentation o f auto-antigens i n the presence o f co-stimulatory molecules and cytokines. P a n e l C : Activated T cell expression o f co-stimulatory molecules and cytokines are involved i n maturation o f B cells that have taken up auto-antigens from apoptotic cells. The auto-reactive B cells divide and mature into plasma cells that secrete auto-antibodies. Walport, M . J . , Complement- Second of Two Parts. N Engl J M e d , 2001. 344(15): p. 1140-1144. Copyright © [2001] Massachusetts Medical Society. All rights reserved.  2  Introduction  Apoptosis, or programmed cell death, is recognized as an essential process during development and the maintenance o f normal tissue homeostasis. Apoptosis is a tightly regulated mode o f cell death that occurs without inflammation. However, when faced with an abnormally large load o f apoptotic cells and/or defective removal capacity as a result o f hampered opsonization by pentraxins and complement, non-ingested cells can proceed to secondary necrosis. Accompanied by swelling and eventual bursting, these necrotic cells release inflammatory and toxic contents, leading to severe tissue injury [7]. Apoptotic cells are also potential sources o f intracellular auto-antigens. The autoimmune disease S L E is characterized by the presence o f auto-antibodies to a wide range o f cellular and nuclear antigens, including D N A , R N A , chromatin, ribonucleoproteins (Ro, La), poly (ADP-ribose) polymerase ( P A R P ) , nucleosomes and histones [8], which are present within apoptotic blebs [9]. It is remarkable that 17 o f the known apoptotic protease substrates have been identified as auto-antigens or are constituents o f larger complexes such as nucleosomes that contain a protein recognized by auto-antibodies [10]. It is believed that during programmed cell death caspase enzymes w i l l cleave these well known auto-antigens, revealing potentially auto-reactive epitopes [11-13]. Due to harboring such dangerous materials, efficient elimination o f apoptotic cells and thus prevention o f unwanted immune reactions is essential. The clearance o f apoptotic cells by phagocytes not only functions to remove them from the surrounding tissue but also serves to protect against local damage resulting from uncontrolled leakage o f noxious contents.  Phagocytosis is the final common end stage o f cells undergoing apoptosis. The characteristic changes in the plasma membrane occurring during the apoptotic process  3  Introduction  and the binding o f complement and pentraxin proteins enable the recognition and efficient removal o f apoptotic cells by phagocytes including macrophages and dendritic cells (DCs) [7]. A m o n g the opsonins for apoptotic cells, complement factors including C l q , M B L , and complement-activating members o f the pentraxin family such as S A P , C R P and Ptx3 play an important role [14]. The binding o f these proteins and also natural antibodies to apoptotic cells may promote the activation o f complement, leading to the clearance o f apoptotic cells by ligation o f complement receptors. Once the macrophages have engulfed the apoptotic cells opsonized with classical short pentraxins such as C R P and complement, they secrete immunosuppressive cytokines, such as transforming growth factor (3 (TGF-(3) and interleukin 10 (IL-10) that prevent D C maturation [1]. Similar to macrophages, D C s show suppressed cytokine production upon their exposure to apoptotic cells and even stop cytokine production when stimulated through their iC3b receptors [15, 16]. Furthermore, antigens delivered to D C s via apoptotic cells induce tolerance in vivo [17].  If the clearance o f apoptotic cells is impaired, for example, when the availability o f complement components or pentraxins is limited i n combination with a large apoptotic load, cells may undergo post-apoptotic secondary necrosis, leading to the release o f their toxic and pro-inflammatory contents. Uptake o f post-apoptotic debris b y phagocytes i n the presence o f inflammatory cytokines such as granulocyte-macrophage colonystimulating factor ( G M - C S F ) , tumour necrosis factor a (TNF-a) and interleukin 1 (IL-1) [1], induce their subsequent activation/maturation and release o f more inflammatory cytokines. Alternatively, post-apoptotic/secondary necrotic cells may be opsonized with  4  Introduction  auto-antibodies, promoting their uptake through F c receptors on phagocytes and leading to the propagation o f an inflammatory response. During inflammation, D C s mature, express co-stimulatory signals and enhance their ability to cross-present antigens. After arrival at lymph nodes, they may stimulate T cells which in turn w i l l maintain their viability [18]. Activated T cells that express co-stimulatory molecules and cytokines including an important member o f the tumour necrosis family, B lymphocyte stimulator ( B L y S ) , also referred to as z T N F - 4 , help the maturation process o f B cells that have taken ,up antigens from apoptotic cells through their antibody receptors. The reactive B cells divide and mature into plasma cells that secrete antibodies.  The engagement o f the adaptive immune system associated with S L E can not be explained just by the large numbers o f apoptotic cells associated with this disease. Other diseases characterized b y proportionally high numbers o f apoptotic cells such as acquired immunodeficiency syndrome (AIDS), systemic vasculitis, and chemotherapy or irradiation-treated malignancies generally do not generate high titers o f specific antibodies such as those present in S L E [10]. This clear distinction could be due to the fact that i n the majority o f S L E cases, deficiencies o f complement and pentraxins can hamper the body's ability to remove the apoptotic/soon to be necrotic cells. Therefore, an adaptive immune response w i l l arise when large quantities o f apoptotic cells are generated i n the presence o f functional defects associated with their clearance [19].  5  Introduction  1.2) Proteins involved in dead cell clearance 1.2.1) Complement system The complement system is part o f the innate branch o f the host defense system and has multiple biological effects, most o f which contribute to the inflammatory reaction. It is made up o f over 30 cell membrane and plasma proteins that react with one another to opsonize or k i l l invading organisms. Complement components activate leukocytes and endothelial cells and induce inflammatory responses that help fight and clear infections [20-22]. Aside from these well-known functions, complement has been shown to be actively involved in the equally important task o f opsonizing and clearing immune complexes and altered host cells such as apoptotic cells. This system o f opsonization also plays an important role in modulating the adaptive immune system and inducing tolerance [1, 2, 23, 24].  1.2.1.1) Complement pathways There are three pathways o f complement activation; the classical, the lectin and the alternative pathways. The classical pathway is triggered b y natural or elicited antibodies or direct binding o f the complement component C l q to activating structures such as pathogens and altered host cells [20, 22, 23]. The lectin pathway is initiated by the recognition and binding o f lectin proteins such as mannose-binding lectin ( M B L ) and ficolins to carbohydrates such as N-acetyl glucosamine and mannose on microbes and altered host cells [25]. The alternative pathway is somewhat different from the first two modes i n that it by undergoes a low-grade spontaneous activation [20, 21].  Introduction  Figure 1.2: Complement system. Complement activation can be triggered by three pathways, the classical pathway, the mannose-binding lectin ( M B L ) pathway and the alternative pathway. The classical pathway is initiated by the binding o f C I complex (consisting o f C l q , two molecules o f C i r and C l s ) to antibody-antigen complexes, or to other structures such as pentraxins or apoptotic cells. The M B L pathway is initiated by binding o f the complex o f M B L and MBL-associated proteases 1 and 2, M A S P 1 and M A S P 2 respectively, to designated carbohydrates on cell surfaces. The alternative pathway is activated following low-grade spontaneous hydrolysis of C3 i n plasma and subsequent covalent binding o f C3b to hydroxyl groups on cell-surface carbohydrates and proteins. Each complement activating pathway generates a C3 convertase (C4b2a/C3bBbP), which mediates cleavage o f C 3 , followed b y activation o f a common terminal complement pathway and formation o f the membrane attack complex ( M A C ) (C5b-9). Walport, M . J . , Complement- First of Two Parts. N Engl J M e d , 2001. 344(14): p. 1058-1066. Copyright © [2001] Massachusetts Medical Society. All rights reserved.  7  Introduction  1.2.1.2) Complement receptors  The most important action of complement is to facilitate the uptake and removal of targeted entities. This occurs through specific recognition of bound complement components by complement receptors (CRs) on phagocytes. Complement receptors bind complement opsonized cells. CR1 (CD35) binds C3b, C4b, and iC3b. CR3 (CDI lb/CD18) binds iC3b. CR1 and CR3 are especially important in inducing phagocytosis of bacteria with complement components on their surfaces. CR2 (CD21) binds C3d, iC3b, C3dg. It is found mainly on B cells, acting as a part of the B cell coreceptor complex [22]. CR4 (CDI lc/CD18) binds iC3b. CR3 and CR4 are integrins. CR3 is known to be important for leukocyte adhesion and migration, while CR4 is only known to function in phagocytic responses [22, 26, 27].  1.2.1.3) Complement a n d apoptotic cells  One of the key functions of the complement system is its participation in the removal of apoptotic cells. The importance of this removal is supported by the evidence gathered from cases in which deficiencies of early components of the classical complement pathway, such as Clq, are strongly associated with susceptibility to systemic lupus erythematosus (SLE). Dying cells contain both antigens and adjuvants sufficient to initiate an autoimmune response [28, 29]. Finding SLE-targeted auto-antigens within apoptotic cells has led to the development of the waste disposal hypothesis [2].  Introduction  Immature dendritic cells (iDCs) have been recognized as one o f the major players in the removal o f apoptotic cells. Verbovetski and colleagues [23], showed that opsonization o f apoptotic Jurkat cells by autologous iC3b increased the efficiency o f their uptake b y i D C s but inhibited D C maturation. It has been suggested that the uptake o f apoptotic cells b y i D C s is mediated by the receptors av[33 (the vitronectin receptor) [30] and avp5 [31] with participation o f scavenger receptor C D 3 6 [31]. i D C s ingest antigens by phagocytosis, macropinocytosis or receptor-mediated endocytosis. After ingestion o f stimulatory entities such as pathogens, i D C s are triggered to undergo a developmental program called maturation [32]. However, after interaction with apoptotic cells, i D C s not only do not up-regiilate, but rather down-regulate M H C class II and C D 8 6 co-stimulatory molecules, showing the possible role o f D C s in the induction o f anergy rather than priming autoimmune T cells. This is further emphasized by anergy o f i D C s exposed to iC3b opsonized apoptotic cells. These i D C s do not up-regulate M H C II and C D 8 6 , nor release IL-12 after stimulation by C D 4 0 L or L P S [23].  When committed to apoptosis, cells follow an orderly process o f nuclear condensation, surface blebbing, cytoplasmic contraction, and packaging o f cellular components within membranes before their budding from the cell as apoptotic bodies [9]. A l s o during this process, tissue transglutaminases are responsible for cross linking proteins that prevent the leakage o f intracellular constituents from late apoptotic cells. Therefore normal conditions, apoptotic cells are sealed [33, 34].  9  Introduction  W e l l characterized surface changes during programmed cell death include loss o f phospholipid asymmetry and exposure o f such molecules as phosphatidylserine (PS) on the cell surface. Another important change is the alteration o f membrane carbohydrates, increased expression o f fucose and N-acetyl-glucosamine due to redistribution or clustering o f glycoproteins. These changes suggest that lectins including mannosebinding lectin ( M B L ) that bind such altered carbohydrates might have an important role in apoptotic cell clearance [7]. C l q also may be involved i n such a task because recent studies have demonstrated the high affinity o f this lectin molecule for surface blebs o f apoptotic cells, emphasizing its participation i n apoptotic cell removal [35].  Although early complement components appear to be important for the rapid clearance o f apoptotic cells, cells must be protected from the assembly o f later components in order not to provoke an inflammatory response triggered b y the complement system. Formation o f anaphylatoxins (mainly C 5 a and C3a) and opsonins (mainly C3b) promote inflammatory responses. Therefore, the presence o f complement inhibitors such as C4b binding protein (C4BP), a major inhibitor o f the classical pathway, may be very important for the inhibition o f inflammation close to apoptotic cells [24]. During the initial stage o f apoptosis, cells expose negatively charged phospholipids including phosphatidylserine on their surfaces. The vitamin K-dependent protein S has a high affinity for this type o f phospholipid. In human plasma, 60%-70% o f protein S circulates i n complex with C4b binding protein (C4BP). Therefore protein S, due to its high affinity for negatively charged phospholipids, localizes C 4 B P to areas where such phospholipids are exposed such as in apoptotic cells. C 4 B P is able to interact with the  10  Introduction  complement protein C4b and regulate the complement system b y preventing further assembly o f down-stream molecules on the surface o f the apoptotic cells [24].  1.2.1.4) Complement as a bridge between the innate and the adaptive immune systems  The complement system is also capable o f linking the innate and the adaptive immune systems. The evidence for this comes from experimental results showing that a transient reduction o f the amount o f circulating complement C3 led to disruption o f the antibody response. It is becoming increasingly clear that complement enhances B cell immunity, principally via the complement receptors CD21 and C D 3 5 [25, 36]. Uptake o f C3d-coated antigens by cognate B cells via the B cell antigen receptor and coengagement o f the C D 2 1 - C D 1 9 - C D 8 1 co-receptors, lowers the threshold o f B cell activation and provides an important survival signal [25, 37]. Follicular Dendritic Cells (FDCs) also have relatively high expressions o f CD21 and C D 3 5 , and this provides an effective mechanism for the retention o f C3-coated immune complexes within the lymphoid compartments [25, 38].  Control o f activated C D 4 T cells i n the periphery is mediated b y their specific +  elimination, anergy and transformation into regulatory T cells. The complement system seems to participate in the development o f human regulatory T cells via co-stimulation o f C D 3 and C D 4 6 . Cross-linking o f C D 3 and C D 4 6 on human C D 4 T cells led to induction +  o f a regulatory T phenotype and release o f IL-10 [39]. The induced regulatory T cells  11  Introduction  proliferate i n culture, block activation o f bystander T cells and differentiate into memory cells [39].  C 3 a and C 5 a peptides released during the activation o f the complement cascade are also involved i n bridging the innate and the adaptive immune systems. They serve as potent ligands for G protein-coupled chemo-attractant receptors referred to as C 3 a R and C 5 a R respectively [26, 40, 41]. These receptors are expressed on a wide range o f inflammatory cells, such as neutrophils, mast cells, eosinophils, basophils and lymphocytes. Aside from acting as chemo-attractants, C 3 a and C 5 a have an influence on the fate o f naive C D 4 (ThO) T cells. It has been shown that activation o f C 5 a R and +  signalling through C D 8 8 induces IL-12 production by antigen presenting cells ( A P C s ) which drives the T h l response, whereas signalling through C 5 L 2 , another receptor for C5a, inhibits the T h l response and/or promotes the Th2 response [42-44]. Conversely, C3b and iC3b can suppress IL-12 production by A P C s and favour the development o f a Th2 response. C 3 a may induce Th2 cytokine release from basophils/mast cells and promote Th2 polarization during sensitization on A P C s . It may also interact with activated T cells to maintain a Th2 response [26].  12  Introduction  1.2.2) Pentraxins Pentraxins are pattern recognition proteins o f the acute-phase response. They are characterized b y a cyclic pentameric structure and show strong inter-species homology [45]. The classical short pentraxins, C-reactive protein (CRP), and serum amyloid P component ( S A P ) are produced i n the liver i n response to inflammatory mediators [46]. Pentraxin-3 (Ptx3) is a prototypic long pentraxin and can be produced b y a variety o f cells in response to inflammatory cytokines [47, 48]. Pentraxins play a major role i n the innate immune response against microbes and in the regulation o f scavenging o f cellular debris [45]. Binding o f these pattern recognition molecules to apoptotic cells has also been demonstrated b y recent studies [49-51]. Opsonization o f apoptotic cells with pentraxins can lead to the binding o f C l q and subsequent activation o f complement [50] followed b y complement receptor (CR3 & C R 4 ) mediated phagocytosis [52, 53]. However, pentraxin opsonization may also directly promote uptake o f apoptotic cells by phagocytes [7, 54].  Human S A P and C R P , classical short pentraxins share 5 1 % o f amino acid identity and 59% nucleotide sequence identity. Their genes are closely linked, being located i n band q2.1 o f chromosome 1. In humans, C R P acts as an acute phase protein with its circulating levels increasing to up to 1000-fold during an acute phase response. However, in some other animal species such as laboratory mice, S A P rather than C R P reacts as the acute phase protein [46, 55].  13  Introduction  1.2.2.1) S e r u m amyloid P component (SAP) Serum amyloid P component (SAP) is a calcium-dependent pentameric glycoprotein. It has been suggested that this molecule has crucial roles in vivo because mice with targeted depletion o f the S A P gene developed antinuclear antibodies, reminiscent o f the human autoimmune disease S L E [9]. These observations were interpreted as evidence o f a role for S A P i n controlling the degradation o f chromatin. In the presence o f calcium ions, S A P has been shown to bind to several ligands among which D N A [56], chromatin [57, 58], histones [59, 60] and phosphoethanolamine containing compounds such as phosphatidylethanolamine [61, 62] are o f great importance. In normal cells, phospholipids are distributed asymmetrically between the inner and outer leaflet o f the cell membrane, with most amino-phospholipids such as phosphatidylserine and to a lesser extent phosphatidylethanolamine located i n the inner leaflet o f the plasma membrane [63-66]. During apoptosis, one o f the earliest events is the loss o f this asymmetry, leading to the exposure o f phosphatidylserine (PS) phosphatidylethanolamine (PE) and phosphatidylcholine (PC) i n the outer leaflet [14, 67]. In a study by Familian and colleagues it was demonstrated that i n fact S A P binds to P E exposed after membrane phospholipids flip-flop on the surface o f apoptotic cells [5, 49].  1.2.2.2) C-reactive protein ( C R P ) C R P , another member o f the classical short pentraxins acts as an acute phase protein i n humans and its serum levels rise dramatically i n response to the released pro-  14  Introduction  inflammatory cytokines such as IL-1 and TNF-ct. Various studies have demonstrated that C R P specifically binds to phosphorylcholine in membrane bilayers [68] as well as to H I containing chromatin [69] and small nuclear ribonucleoproteins (snRNP) [70]. However, it is becoming clear that the main target o f C R P on apoptotic cells are phosphorylcholine moieties that become accessible as a result o f oxidation o f phosphatidylcholine molecules [71]. Despite amplification o f the classical pathway, C R P paradoxically attenuates the formation o f the membrane attack complex on the surfaces o f apoptotic cells, thereby protecting the cells from lysis. This effect was achieved by the recruitment o f factor H , a complement regulatory protein that accelerates the decay o f the C3 and C 5 convertases [72]. Elevated serum C R P significantly increased phagocytosis o f apoptotic cells b y macrophages and sustained the production o f TGF-|3 by these phagocytes [50]. It should be emphasized however that the presence o f C l q is necessary for the C R P antiinflammatory clearance o f apoptotic cells [50].  1.2.2.3) Pentraxin-3 (Ptx3) Pentraxin-3 (Ptx3) is also a member o f the pentraxin family o f acute-phase proteins which is capable o f binding to apoptotic cells [49, 51]. This protein is structurally related to, but distinct from, classical cyclic pentameric short pentraxins. The C-terminal half o f Ptx3 aligns with the full-length sequence o f C R P and S A P , whereas the N-terminal region does not show any homology with these other proteins [73]. Ptx3 expression is induced by inflammatory cytokines such as IL-1 (3 and T N F - a in a variety o f cell types, including endothelial cells and monocytes. The expression o f Ptx3 increases early during inflammation, preceding the rise o f expression o f S A P and C R P [74].  15  Introduction  Therefore it is a perfect candidate for interaction with cells dying at inflammatory sites. C l q also interacts with immobilized Ptx3 via its globular head region and i n turn activates the classical complement pathway [75]. Specifically, Ptx3 enhances C l q binding and complement activation on apoptotic cells. A unique signature o f Ptx3 is that upon binding to apoptotic cells, it inhibits their phagocytosis b y dendritic cells ( D C ) , indicating a regulatory role for this prototypic long pentraxin in the clearance o f apoptotic cells by professional antigen-presenting cells ( A P C ) . Based on its biological role i n clearance o f apoptotic cells during inflammation, it may be very well involved i n the protection against the onset o f an adaptive immune response [51].  Therefore, the conclusion arrived from the above evidence is that pentraxins and the classical complement pathway appear to work i n concert to promote the clearance o f apoptotic cells i n an anti-inflammatory context.  16  Introduction  1.2.3) Heat shock proteins Heat shock proteins (Hsp) are one o f the most abundant and highly conserved soluble intracellular proteins found in all prokaryotic and eukaryotic organisms [76-78]. These proteins were initially identified b y their expression after exposure o f cells to elevated temperatures. In addition, Hsps are also up-regulated b y a large array o f stressful stimuli including environmental ( U V radiation, heat shock, heavy metals, oxidative stress and amino acid deprivation), pathological (viral, bacterial or parasitic infections, fever, inflammation, malignancy or autoimmunity) or physiological stimuli (growth factors, cell differentiation, hormonal stimulation, or tissue development) [79]. Hsps are a family o f polypeptides distributed across different sub-cellular compartments such as the cytosol, nucleus, endoplasmic reticulum (ER), and mitochondria. They are classified according to their molecular weight, for instance 70kDa Hsps belong to the Hsp70 family [80]. Located i n the cytosol and the nucleus, Hsp70s are the most conserved and the best studied among their class. They include the constitutively expressed Hsp73 (Hsc70) and the stress-inducible Hsp70 (Hsp72) [81].  1.2.3.1) T h e many roles of heat shock proteins  Hsps are involved in multiple vital cellular processes during normal and stress conditions [82]. Their best known role is that o f molecular chaperones, involved in the folding o f nascent proteins, degradation o f aberrantly folded or mutated polypeptides, translocation o f polypeptides across membranes, assembly o f macromolecule structures and maintenance o f membrane receptors [79, 80, 83-85], all o f which enables them to confer cyto-protection following stressful insults. Aside from being chaperons, they are  17  Introduction  established as the first adjuvants o f endogenous/mammalian origin [86]. Due to having peptide-binding sites analogous to that o f class I histocompatibility proteins, members o f the Hsp70 family are capable o f shuttling antigens to major histocompatibility complex ( M H C ) molecules [84]. This adjuvant characteristic o f Hsps was identified i n the field o f cancer immunology, i n studies where the investigators were looking for cancer-specific antigens, b y their ability to elicit protective immunity to cancer challenges. Purification o f the fractionated cancer homogenates which elicited protection, revealed Hsps o f the Hsp70 or Hsp90 family, including Hsp70, gp96 and Hsp90 to be the active components. Hsps purified from a given cancer were observed to elicit protective immunity specific to that particular cancer, whereas normal tissue Hsps did not confer such immunity [87-89]. Blachere and colleagues further demonstrated via in vitro studies that a combination o f non-immunogenic peptides chaperoned by Hsps elicited antigen-specific C D 8 cytotoxic +  T lymphocytes ( C T L ) [86]. Vaccination with non-covalent mycobacterial Hsp70-peptide complex has also been shown to establish C D 4 T-cell anti-peptide immunity [90], which +  also would promote the induction o f an antibody response. In another study, immunization with cancer-derived Hsp-peptide complexes were found to elicit, i n addition to the C D 8 and C D 4 T cell response, an N K response that may be crucial for +  +  adaptive immunity [91].  1.2.3.2) Heat shock protein receptors The observation that extremely small quantities o f Hsp-peptide complexes were effective in inducing specific immunity led to the suggestion that professional A P C s possess Hsp-specific receptors that take up Hsp-peptide complexes with specificity [92].  18  Introduction  Indeed, it has been demonstrated recently that these complexes can be taken up into nonacidic compartments via the scavenger receptor CD91 (a2-macroglobulin receptor) [93] and the low density lipoprotein receptor ( L O X - 1 ) [94]. These peptides are then processed and presented b y M H C class I molecules o f the A P C , initiating the activation o f cytotoxic T lymphocytes ( C T L ) [93]. Other proteins implicated o f having Hsp receptor activity on plasma membranes o f macrophages and A P C s include C D 4 0 [95-97], macrophage scavenger receptor ( M s r l ) [98], Toll-like receptor-2 (TLR-2) and T L R - 4 [99].  1.2.3.3) Heat shock proteins as danger signals Apart from acting as potent adjuvants, heat shock proteins, specifically Hsp70, seem to possess a cytokine activity [99]. D y i n g cells, especially necrotic, have been shown to release gp96, Hsp90 and Hsp70. U p o n interacting with their receptors on antigen-presenting cells ( A P C ) , these Hsps serve as danger signals [92, 100] and stimulate macrophages to secrete cytokines and induce expression o f antigen-presenting and co-stimulatory molecules on the DCs. Hsp70 induction o f pro-inflammatory cytokines may proceed by its binding to T L R - 2 and T L R - 4 receptors and the subsequent activation o f M V D 8 8 / I R A K / N F - K B signal transduction pathway [97]. T L R - 2 and T L R - 4 may also synergize to greatly augment Hsp70 induced cytokine production [97]. Ligation of these receptors results in phosphorylation of the intracellular inhibitory subunit I - K B O and subsequent activation o f nuclear transcription factor N F - K B . This leads to upregulation o f genes encoding pro-inflammatory and immune mediatory proteins such as tumour necrosis factor a (TNF-a), interleukin 1(3 (IL-1 (3), interleukin 6 (IL-6), interleukin 12 (IL-12), co-stimulatory molecules from the B 7 family and adhesion molecules  19  Introduction  including endothelial cell-leukocyte adhesion molecules ( E L A M - 1 , E-selectin) [95, 97, 101].  In a recent study, Arispe and colleagues also demonstrated that Hsp70 and Hsc70 are capable o f binding selectively and with high affinity to phosphatidylserine moieties uncovered on plasma membranes. This would also implicate Hsps o f having an immunoregulatory role in the removal o f dying host cells [82, 95].  20  Introduction  1.3) Acute phase response Acute phase response ( A P R ) refers to a regulated series o f distant systemic changes that occur i n response to a localized tissue injury [102]. It is regarded as a stress response at the level o f the organism initiated with the purpose o f creating an overall protective systemic environment required for coping with the inflicted insult and containing the disrupted homeostasis. In humans, stimuli that commonly give rise to the A P R include bacterial and, to a lesser extent, viral infections; surgical or other trauma; neoplasm; burn injury; tissue infarction; various immunologically mediated inflammatory states; strenuous exercise [103]; heatstroke; and childbirth. Psychological stress [104] and chronic fatigue syndrome [105] are also associated with acute phase changes. In a given individual, A P R represents the integrated sum o f multiple, separately regulated changes induced primarily by inflammation-associated cytokines and their modulators including endocrine hormones and other circulating molecules. The organ systems participating i n A P R include the liver, brain, adrenal gland, bone, muscle and adipose tissue.  1.3.1) Liver and acute phase proteins The liver is responsible for modifying the concentration o f a large number o f plasma proteins called the acute phase proteins. These changes largely reflect reprogramming o f plasma protein gene expressions i n hepatocytes. The primary mediator inducing A P R and triggering acute phase protein release is IL-6 but a number o f other cytokines, alone or in concert, may also be involved [106]. Plasma proteins that show 25% change o f their levels, either an increase or a decrease, are known as positive and negative acute phase proteins, respectively. Important positive acute phase proteins  21  Introduction  include C R P (or S A P in mice), serum amyloid A ( S A A ) , plasminogen, protein S, and complement system proteins such as M B L , C 3 , C 4 , factor B , C I inhibitor, and C4bbinding protein [107-110]. Recently recognized negative human acute phase proteins include transthyretin, a- fetoprotein, T4-binding globulin, and insulin-like growth factor-I (IGF-I) [111-113]. The plasma protein response to inflammatory stimuli seen i n hepatocytes can serve as a paradigm for the A P R in other organs and therefore the term A P R is frequently employed i n a narrow sense to refer only to changes i n the concentration o f acute phase proteins.  1.3.2) APR and the hypothalamic-pituitary-adrenal (HPA) axis Involvement o f the brain may result i n the activation o f the hypothalamicpituitary- adrenal (HP A ) axis resulting i n an increased synthesis o f hormones including corticotrophin-releasing hormone ( C R H ) , adrenocorticotropic hormone ( A T C H ) , and glucocorticoids such as Cortisol [114]. Fever is also another manifestation o f the brain's involvement i n the A P R . The mentioned neuroendocrine hormones have stimulatory effects on other participants o f the A P R including the adrenal gland. A T C H induces the production and release o f Cortisol (glucocorticoid) and aldosterone (mineralocorticoid) from the adrenal cortex. Signals from the sympathetic nervous system also act on the adrenal gland and bring about the release o f adrenal catecholamines (epinephrine) from the adrenalmedulla [114].  22  Introduction  1.3.3) APR and metabolic changes A P R involvement o f the bones/hematopoietic system includes the suppression o f erythropoiesis, induction o f leukocytosis and thrombocytosis, and the overall loss o f bone mass. Other metabolic changes w i l l also take place in the muscle and adipose tissue [115]. In the muscle, these include proteolysis and decreased protein synthesis which w i l l result i n the loss o f skeletal muscle. Alterations o f lipid metabolism, specifically the loss of adipose tissue results, at least in part, from inhibition o f lipoprotein lipase production by cytokines [115]. Increase i n serum triglycerides, very-low-density lipoproteins, and low-density lipoproteins could also be seen [116].  23  Introduction  1.4) Photodynamic therapy (PDT) 1.4.1) History of photodynamic therapy The therapeutic properties o f light have been recognized and utilized for the treatment o f various diseases such as vitiligo, psoriasis and skin cancer since the ancient civilizations o f Egypt, India and China [117, 118]. However, it was not untill the 2 0  th  century that the full extent and applications o f light i n treating disease "phototherapy" was realized and exploited [118]. After discovering that red and ultraviolet light could treat smallpox pustules and cutaneous tuberculosis respectively, Niels Finsen began the modern era o f light therapy for which was awarded a Nobel Prize i n 1903 [117, 118]. Photo-chemotherapy was first discovered b y Oscar Raab i n 1900 who reported that the compound Acridine i n combination with certain light wavelengths induced death o f Paramecium [118, 119]. In 1903 Herman V o n Tappeiner and A . Jesionek observed therapeutic effects o f topically applied Eosin and white light exposure on skin tumours and termed this effect "photodynamic action". This term is still used today and refers to the reactions following "photodynamic therapy" (PDT) [117-119]. In 1911 W . Hausmann characterized the photo-toxicity and biological effects o f hematoporphyrin, a member o f the family o f photosensitive molecules called the porphyrins, on the skin o f mice [119]. Taking this one step further, Friedrich Meyer-Betz tested the effects o f hematoporphyrin on his own hand and i n 1913 was the first to treat humans with porphyrin based P D T [119]. Samuel Schwartz developed a hematoporphyrin derivative ( H P D ) i n 1955 that was found to be twice as phototoxic and could be used at much smaller doses than unmodified hematoporphyrin [120]. Few years later Lipson and Baldes ushered i n a new era o f P D T at the M a y o Clinic using H P D [121, 122]. Diamond et al. (1972) was the first to utilize  24  Introduction  the tumour-localizing and phototoxic properties o f H P D to treat malignancies i n the lab including rat implanted gliomas [123]. A significant breakthrough occurred i n 1975 when Thomas Dougherty and colleague reported that activation o f H P D using red light completely destroyed mammary tumour growth in mice [124]. These studies were followed by the first human trials with H P D for the treatment o f cancers such as bladder (Kelly, 1975) [125] and skin (Dougherty, 1975-8)[126].  1.4.2) Benefits of photodynamic therapy P D T is a minimally invasive treatment which can be re-administered a number o f times. Unlike chemotherapy, radiotherapy and surgery it causes very few acute side effects and no systemic toxicity. Photosensitizers are non-toxic i n the absence o f light. The very short half-life and high reactivity o f PDT-induced reactive oxygen species (ROS) (<0.04^is), enforces a very small radius o f action (<0.02um) [127]. Due to limited migration potential o f R O S , sites o f photodamage i n P D T treated tumour closely match the localization o f photosensitizer molecules at the time o f illumination. This leads to a very controlled and precisely treated site which limits damage to the immediate surrounding healthy tissue. Contrary to ionizing radiation, P D T induces rapid and overwhelming apoptotic and necrotic cell death in a dose dependent manner [128, 129]. Furthermore, P D T elicits an immune response against the tumour and may induce tumour specific immunity [130, 131] which could eradicate the primary as well as any secondary metastases. Therefore, P D T is an excellent alternative to traditional treatment modalities because it offers very good cosmetic and functional results. For example i n treating oral squamous-cell carcinomas where radiotherapy and surgery result in impaired function o f  25  Introduction  the treated area, P D T can be used successfully [132]. Finally, this modality is an enticing palliative treatment or alternative option to those patients who have not responded well to other mainstream therapies or who exhibit malignancy in places not accessible to surgery [132-136].  1.4.3) Photofrin-based PDT in clinical use Further work on H P D led to the development o f porphimer sodium "Photofrin"®, a partially purified form o f H P D which is a mixture o f mono-, di-, and oligomers that all contain the porphyrin moiety. In 1993, P D T was first approved in Canada using photo frin for the treatment o f bladder cancer. This drug is also the most widely used photosensitizer today, both i n the clinic and i n research [136]. Photofrin-based P D T has been approved for the treatment o f cancers such as cervical and gastric cancers i n Japan; endobroncheal and esophageal cancers in North America, Europe and Japan; and papillary bladder cancer i n Canada [119]. It also has been approved for clinical use for the palliative treatment o f solid tumours where other treatments have failed [133]. A s the most popular drug in the field o f P D T , Photo frin possesses consistent and strong tumour ablating properties, l o w toxicity to normal cells in the absence o f light and better defined characteristics compared to the alternative P D T drugs [136].  1.4.4) Second generation photosensitizers The "second generation photosensitizers" were developed to absorb light at longer wavelengths to facilitate better light penetration and therefore drug activation deeper i n the tumour. Some o f these compounds also cause less skin photosensitivity and  26  Introduction  considerably cut down the 4-6 week sunlight ban required for patients treated with Photofrin-based P D T [118, 134, 136]. A systemic second generation drug that has received much attention and approval for treatment o f head and neck cancer and possible use for the treatment o f prostate and pancreatic cancers is meta-tetra hydroxyphenyl chlorine ( m - T H P C ) " F o s c a n " ® or Temoporfin. This drug is also administered for palliative treatment o f advanced head and neck cancer that is unsuitable for radiotherapy, surgery or chemotherapy, or that has not responded to these treatments [137, 138]. Topical 5-aminolevulinic acid ( 5 - A L A ) "Levulan"® and its methylesther " M e t v i x " ® are approved and widely used second generation photosensitizers for the treatment o f actinic keratosis and basal-cell carcinoma o f the skin [119].  1.4.5) Photodynamic therapy mechanisms of action Photodynamic therapy inflicts its tumouricidal properties via three mechanisms o f action. ( A ) The initial injurious impact is due to direct oxidative damage caused b y reactive oxygen species (ROS), mediating injury to cellular proteins and lipids. These may i n turn give rise to lethal photo-oxidative lesions with both apoptotic and necrotic cell death [133, 139, 140]. (B) P D T damages the normal and tumour vasculature and disrupts blood flow, causing severe ischemia leading to tumour infarction [133]. The ischemia developed during the treatment o f tumours by P D T is followed b y a restoration o f blood flow and induction o f ischemia-reperfusion (I/R) injury i n P D T - treated tumours [141]. (C) Activation o f the inflammatory/immune response is another method o f P D T induced cytotoxic action against the tumour. Inflicting phototoxic lesions and I/R injury brings about various inflammation-specific events following the treatment o f tumours  27  Introduction  with P D T , including: (i) release o f inflammatory cytokines and chemokines, arachidonic acid metabolites and various other inflammatory mediators; (ii) pro-inflammatory changes i n vascular endothelium; (iii) complement activation and engagement o f other plasma cascade systems (kinin-generation, coagulation, and fibrinolysis); (iv) invasion o f inflammatory cells; (v) activation o f N F - K B [139, 142-144].  Direct cytotoxicity o f photodynamic therapy requires the administration o f a photosensitive drug "photosensitizer", light o f a specific wavelength and the presence o f molecular oxygen. When exposed to its optimally absorbing wavelength o f light, the photosensitizer becomes activated from a ground to an excited state. It can then undergo two kinds o f reactions termed type I and type II [119, 133]. In a type I reaction, the activated photosensitizer reacts directly with cellular substrates such as membranes or other molecules, transferring a hydrogen atom to form intermediate free radicals. These free radicals i n turn w i l l interact with oxygen to produce toxic reactive oxygen species (ROS) such as singlet oxygen, hydrogen peroxide and hydroxyl radicals. These highly potent reactive species oxidize various cellular substrates including lipids and proteins and i n turn can lead to cellular toxicity and cell death [145]. In type II reactions, an activated sensitizer can transfer its energy directly to molecular oxygen to form R O S . Type I and II reactions occur simultaneously, and the ratio between them depends on the type o f sensitizer used, the concentrations o f substrates and oxygen, as well as the binding affinity o f the sensitizers for the substrates [145]. The extent o f photodamage caused b y P D T is dependent on many independent factors which include: the type o f photosensitizer used; tumor localization and location o f the sensitizer - extracellular  28  Introduction  versus intracellular; the total drug dose administered; the total light exposure dose; the light fluence rate; oxygen availability; the time between the administration of the drug and light exposure [119].  ' - SPSS •"  1  Type II reaction  -*  Figure 1.3: Photodynamic therapy mechanisms of action. Following the activation of a photosensitizer via specific wavelengths of light, two types of reactions take place. First, activated sensitizers can react with substrates creating radicals. These radicals in turn may further react with oxygen and produce singlet oxygen ('C^), a highly reactive oxygen species (type I). Alternatively, the activated photosensitizer can interact directly with oxygen to form 'C>2 and subsequently induce 'C^ dependent oxidative damage (type II). Reprinted with permission from Macmillan Publishers Ltd: [Nature Reviews Cancer] (Dolmans, D.E.J.G.J., D. Fukumura, and R.K. Jain, PHOTODYNAMIC THERAPY FOR CANCER. Nature Reviews Cancer, 2003. 3(5): p. 380-387.), copyright © (2003)  The insults inflicted on tumours by PDT are potent inflammatory and immune stimulating trauma. PDT-induced pro-inflammatory events include: (i) primary oxidative damage; (ii) direct complement activation; (iii) damage to the extracellular matrix; (iv) direct damage of the vascular wall; (v) engagement of cellular immunity.  29  Introduction  1.4.6) Cascade of events after PDT-induced trauma Primary oxidative damage is the initiator o f all the subsequent events taking place in the PDT-treated tumour. The modifications/damage inflicted to cellular lipids and proteins by the reactive oxygen species (ROS) are responsible for the induction o f various types o f stress proteins. Shortly after P D T , phospholipase activation and the elevation o f intracellular calcium occur due to photo-oxidative damage to cellular constituents such as membrane lipids [146]. These are examples o f typical yet crucial events eliciting early protein-kinase-mediated signal transduction pathways. Tyrosine phosphorylation, catalyzed by membrane-associated src family kinases, was observed as early as 20s after initiation o f P D T [147]. P D T activated phospholipases release arachidonic acid metabolites from the membrane phospholipids [148, 149]. These liberated lipids may be participating i n cell signaling pathways involved i n the expression o f stress proteins [150], including heat shock proteins (Hsp). Gomer and colleagues demonstrated increased levels o f Hsp70 m R N A and protein after P D T [151]. Expression o f other early stress proteins such as c-fos and c-jun are also induced by PDT-mediated oxidative damage [152]. Some o f these early stress-induced products function as transcription factors for inflammatory genes. For instance N F - K B and A P - 1 (c-fos and cjun heterodimeric complex) are among the transcription factors activated after P D T [142, 153]. The consequence o f such transcription factor activity is the expression o f various immunologically important molecules including cytokines, chemokines, adhesion proteins, growth factors, enzymes involved in arachidonic acid metabolism ( C O X - 2 ) and immune co-stimulation molecules [133].  30  Introduction  1.4.7) PDT and the complement system P D T treatment directly activates the complement system because this arm o f innate immunity recognizes injured autologous cells [154, 155]. The complement activation b y P D T can be attributed to different mechanisms o f action. It has been demonstrated that various forms o f oxidative damage can directly activate the complement system [156]. Therefore the induced oxidative damage could be responsible for PDT-mediated complement engagement. P D T instigated basement membrane exposure o f the tumour vasculature also prompts the complement activation [157, 158]. Other events brought about b y P D T including apoptosis [159], ischemia [160], and cytokine release [161] may down-regulate the membrane complement regulatory proteins ( m C R P ) and therefore reduce the inherent complement resistance o f the altered autologous cells. The activated complement system is capable o f stimulating a range o f inflammatory responses that promote the engagement o f the cellular arm o f the immune system (neutrophils and other leukocytes) [155].  Endothelial cells sustaining P D T damage lesions w i l l contract and therefore expose the basement membrane in the vessel walls [162, 163]. The exposed subendothelial matrix promotes the rapid binding and activation o f complement [158], and attachment o f neutrophils and platelets [164], all o f which bring about the release o f proinflammatory agents [165].  31  Introduction  1.4.8) PDT and cellular immunity The engagement o f cellular immunity is manifest as the sequestration o f neutrophils, mast cells and macrophages to the PDT-treated tumours. Their activity contributes to the eradication o f the tumour and also to the induction o f tumour specific immunity. Inflammatory mediators produced after P D T including complement proteins as well as cytokines, chemokines, coagulation cascade components, histamine and arachidonic acid metabolites are responsible for activation and accumulation o f inflammatory cells in P D T treated tumours [143]. Expression o f endothelial adhesion molecules such as I C A M - 1 and E-selectin in tumour vasculature after P D T also plays an important role in the invasion o f such inflammatory cells [166]. Neutrophils are the first and the most abundant immune cells infiltrating the PDT-treated tumour within 1 minute of treatment onset [167]. They produce a wide range o f toxic agents such as reactive oxygen species ( R O S ) and nitric oxide (NO), which they w i l l release into phagocytic vacuoles and/or the extracellular environment [168] destroying cancer cells [169-173]. Under appropriate conditions, these cells can also produce cytokines and chemokines [174], express M H C class II molecules and act as antigen-presenting cells [175-178]. D y i n g neutrophils w i l l discharge stimulators that trigger another wave o f inflammatory cell invasion, including more neutrophils as well as mast cells and monocytes.  Similar to neutrophils, mast cells show significant increase i n their numbers within 5 minutes o f the light treatment initiation [167]. These cells are powerful mediators o f inflammation. PDT-induced complement activation may be responsible for  32  Introduction  mast cell degranulation [179] which contributes to vascular permeability therefore increasing phototoxic tissue damage and neutrophil infiltration [180].  Macrophages are the most numerous population o f stromal leukocytes i n many tumours [181-183]. PDT-destroyed tumour macrophages are quickly repopulated b y new waves o f monocytes/macrophages, summoned b y PDT-released stimuli [167, 184, 185]. These newly activated arrivals, unlike their tumour resident predecessors, serve in the eradication o f tumour cells [182]. In a mouse S C C V I I tumour model, macrophages repopulating the post P D T treated tumours showed a five-fold greater tumouricidal effect than the resident macrophages [167]. Macrophage activity i n PDT-treated tumours is also regulated b y a variety o f induced inflammatory stimuli such as cytokines and chemokines [186]. Similar to neutrophils, macrophages infiltrating PDT-treated tumours may become stimulated to produce toxic levels o f N O [187]. These two types o f leukocytes w i l l also up-regulate complement receptors, C D I l b and C D I l c , upon infiltration and may be highly important i n removal o f complement opsonized cells following P D T [187].  1.4.9) PDT and adaptive immunity PDT-generated tumour-specific immunity was reported upon tumour re-challenge experiments b y Canti and colleagues [188]. Specific in vivo depletion studies demonstrated that both helper and cytotoxic T cells are responsible for this PDT-induced adaptive immunity [189]. In further studies, Korbelik and colleagues demonstrated that P D T is highly effective i n generating tumour-specific sensitized immune memory cells that can be recovered from lymphoid sites distant from the treated tumour at the  33  Introduction  appropriate time. These cells, when transferred into immunodeficient scid mice were able to restore PDT-based tumour curability [130]. Therefore based on these results, it is apparent that the conditions created b y tumour P D T treatment are favorable not just for the initiation o f innate but also adaptive immunity. Expression o f various molecules including cytokines, chemokines, adhesion and co-stimulatory proteins engage the innate immunity, but also promote cancer specific antigen presentation and development o f tumour specific adaptive immunity.  34  Hypothesis  2) HYPOTHESIS Early complement components ( C l q , M B L and ficolins) and pentraxins ( S A P & Ptx3) are known to be involved in a rapid and non-immunogenic dead cell disposal process. Characterization o f their activity and o f Hsp70 when faced with the burden o f clearing P D T - k i l l e d solid tumour cancer cells would be beneficial in development o f new therapeutic approaches.  3) SPECIFIC AIMS  1. Determine the most significant genes involved in the removal o f apoptotic cells and identify the sources responsible for their elevated expressions.  2. Examine the mechanisms responsible for the up-regulation o f genes encoding the significant proteins.  3. Determine whether Hsp70 acts as an acute phase protein, produced and released by the liver, and binds to PDT-damaged cells.  35  Materials and Methods  4) MATERIALS AND METHODS 4.1) Animal model The A n i m a l Ethics Committee o f the University o f British Columbia had approved all protocols. The mice used in the experiments were 8-12 week old C57B1/6J females, and kept in the A n i m a l Research Centre ( A R C ) at the B C Cancer Research Centre. They were housed on Allentown ventilated racks (http://www.allentowninc.com/PDFs/MicroEnviroSystems.pdf), 4 mice per cage. After injection with Photofrin®, the mice were quarantined on smaller altD racks (http://www.altdesign.com/asp/flex pi 24M.asp) that were kept in the dark. The food used was the lab diet food - H i g h fat 5058 251b bag and L o w fat 5053 251b bag. http://www.labdiet.com/indexlabdiethome.htm.  4.2) Tumor model 4.2.1) In  vivo  Mouse Lewis Lung Carcinoma ( L L C ) ( A T C C Number: CRL-1642) tumours were grown i n syngeneic, immunocompetent C57B1/6J mice and maintained in vivo by tumour brei inoculation. Tumour bearing (maintenance) mice were sacrificed using CO2 gas, the tumours were extracted aseptically from the hind legs using forceps and surgical scissors and minced by chopping using a number 22 scalpel. For the brei, the minced tumors were passed 10 times through 18 and then 20 gauge needles respectively so the homogenate that was suspended in phosphate buffered saline solution (PBS) would flow smoothly. After washing the recipients' legs with ethanol, 0.1 m L o f tumour brei was injected into  36  Materials and Methods  each thigh using a 20 gauge needle. If the implanting brei was frozen in liquid nitrogen, 0.4 m L was injected into each thigh. Maintenance was started from L L C cells grown in vitro and required 0.2 m L injection o f 2 x 10 L L C s into each thigh. 6  For experiments, minced tumour tissue was suspended i n P B S at 5 x the tissue volume. A n enzyme cocktail consisting o f 0.3 m L o f collagenase Type I V [4 mg/mL] (Sigma-Aldrich Co., St. Louis M O ) , 0.3 m L Dispase [3 mg/mL] (Boerhinger, Mannheim, Germany), and 0.3 m L D N A a s e Type I [10 mg/mL] (Sigma), was added for every 5 m L tumour-PBS suspension. This final suspension was vigorously shaken to m i x the contents, and then incubated at 37° Celsius for 30 minutes. After 15 minutes, the mixture was re-suspended by brief shaking. Following the incubation, the suspension was forced through a 100 micron filter using a 5 cc syringe and pelleted b y centrifugation at 1000 rpm for 10 minutes at 20°C. The supernatant was discarded and the cells were washed with the same aliquot o f P B S . Tumour cells were then counted using a hemocytometer and re-suspended i n an appropriate volume o f P B S . Each mouse received a 0.05 m L subcutaneous injection o f 2-3 x 10 tumour cells in the sacral dorsal region. 6  A l l subcutaneous tumours were treated with photodynamic therapy (PDT) at approximately 14 days post-inoculation when they had reached 8-10 m m i n diameter.  37  Materials and Methods  Figure 4.1: Hemocytometer slide and coverslip. Coverslip is applied to slide and cell suspension is added to the counting chamber. Each counting chamber has a 3 x 3 m m grid. Cells i n the four corner squares (1, 2, 3 and 4) and the central square (5) are counted using a hand-held counter. A n average count per square is determined. (Cells touching the middle line o f the triple lines bordering the top and left hand sides o f each square are counted and those from the bottom and right hand sides o f the squares are excluded. C e l l number per m L is calculated using the following formula: Cells/mL = (Average count per square) x (Dilution factor)x (l 0 ) 4  Total cells = (Cells/mL)x (Total original volume o f cell suspension) 10 is the volume correction factor for the hemacytometer: each square is 1 x 1 m m and the depth is 0.1 m m . Figure reprinted b y permission from Dr. W i l l i a m H . Heidcamp, ©1995 4  38  Materials and Methods  4.2.2) In  vitro  culture  L L C cells were cultured at 37°C, 5% CO2 and 95% humidity, i n alpha-minimal essential medium ( G I B C O Invitrogen C e l l Culture, Carlsbad, California, U S A ) supplemented with heat inactivated fetal bovine serum (10%) (Hyclone Laboratories Inc., Logan, Utah, U S A ) , [100 |J,g/mL] streptomycin and [100 Units/mL] penicillin (Sigma), and adhered to the bottom o f T175 cm plastic cell culture flasks (Corning Incorporated Life Sciences, L o w e l l , M A , U S A ) (Cat.No. 431080). The cells were allowed to grow until near confluency and treated for 10 minutes with T r y p s i n - E D T A ( G I B C O ) , collected with complete medium, pelleted b y centrifugation at 1000 rpm for 10 minutes at 20°C, and re-suspended i n complete medium at appropriate concentrations.  In the case o f in vitro studies, a predetermined number o f cells were plated into 3.5 c m diameter Petri dishes, so there would be approximately 0.7-0.8 x 10 cells at the 6  time o f treatment (two days post-plating). Photofrin® was added 24 hrs before light treatment. Just prior to light treatment, the cells were washed with P B S and 1 m L proteinfree/serum-free medium (Sigma, Cat.No. S8284) was added to each Petri dish.  In vitro cell images were taken using the Axiovert 40 C F L inverted microscope, a A x i o C a m M R m scientific 1.4 mega pixel digital camera and A x i o V i s i o n 4.2 digital imaging software (Carl Zeiss Canada Ltd., Toronto, Ontario).  39  Materials and Methods  4.3) Photodynamic therapy Photofrin® (Axcan Pharma Inc., Mont-Saint-Hilaire, Quebec, Canada) was used as the photosensitizing drug i n all the experiments. This drug was reconstituted i n 5% dextrose i n H2O to achieve a stock concentration o f 2.5 mg/mL. For in vivo experiments every 1 m L o f prepared stock, Photofrin® [2.5 mg/mL] was diluted in 1.5 m L o f 1 x sterile P B S solution to achieve a working concentration o f 1 mg/mL. This solution was then injected intravenously through the tail vein at a concentration o f 10 mg/kg (0.2 m L per 20 g mouse). For in vitro experiments, the final Photofrin® concentration o f 20 [ig/mL was achieved by adding 16 u X o f a [2.5 mg/mL] stock Photofrin® to 3.5 cm diameter Petri dishes or 3.0 cm diameter cell culture inserts yielding a final total volume o f 2.0 m L . The drug was administered 24 hours before light treatment for both the in vivo and in vitro experiments. Light o f 630 ± 10 nm (the absorption peak for Photofrin®), generated from a 150W Q T H lamp equipped high throughoutput fibre illuminator (Sciencetech Inc., London, Ontario), was delivered through an 8mm core diameter liquid light guide (model 77638, Oriel instruments, Stratford, C T , U S A ) . In vivo tumours received a light dose o f 150 J / c m and in vitro cells received a dose o f 1 2  J/cm . The exposure time, producing the appropriate dose was calculated using the 2  (r)  2  following equation:  Exposure T i m e  :  ( f l i g h t dose)  (Power output)  1 minute 60 seconds  Where T is the radius o f the area being illuminated, reported i n centimetres. Light dose is expressed in J/cm . Power output is i n Watts or J/s. The equation provides the required 2  exposure time in minutes. The decimals values are multiplied by 60 seconds to obtain the appropriate time in minutes and seconds.  40  Materials and Methods  Animals about to receive light treatment were restrained un-anaesthetized i n lead holders, exposing only the dorsal sacral region where the tumours were located.  4.4) In vitro co-incubation experiment C e l l types implicated in PDT-induced up-regulation o f the genes o f interest were investigated using the in vitro cultured mouse Lewis Lung Carcinoma ( L L C ) cell line, the S V 4 0 transformed mouse peritoneal macrophage (IC-21) cell line and the mouse hepatoma (Hepa 1-6) cell line. In these experiments, a predetermined number o f L L C cells were plated into 3.0 cm diameter Millicell-®PCF cell culture inserts to collect approximately 0.7-0.8 10 cells at the time o f treatment (two days post plating). x  6  Millicell-®PCF cell culture inserts (Millipore Corporation, Billerica, M A , U S A ) (Cat.No. P I H P 03050) contained Isopore™ membranes (polycarbonate) and were especially designed for transport/permeability applications. These P C F inserts had a pore size o f 0.4 um and a pore density o f 1  x  10 . Photofrin® was added 24 hrs before light treatment to 8  the appropriate cell culture inserts. IC-21 and Hepa 1-6 cells were also plated into 6-well plates at approximately 0.7-0.8 10 cells per well. Twelve wells o f IC-21 s were divided x  6  equally into 4 groups: 4 hr incubation with untreated L L C s ; 8 hr incubation with untreated L L C s ; 4 hr incubation with P D T treated L L C s ; and 8 hr incubation with P D T treated L L C s . Twelve cell culture inserts containing L L C s were also divided equally into 4 groups: 4 hrs untreated; 8 hrs untreated; 4 hrs after P D T ; and 8 hrs after P D T . Just prior to P D T and co-incubation, all the cells were washed with 1 P B S , and proteinx  free/serum-free medium was added to each well and cell culture insert. P D T was performed on the L L C groups designated 4 and 8 hrs after P D T and all the inserts (treated  41  Materials and Methods  and untreated) were immediately transferred to their appropriate IC-21 groups (untreated L L C inserts were transferred to the IC-21 group incubating with untreated L L C s ; treated inserts were transferred to the IC-21 group incubating with P D T treated L L C ) . Four hours into the co-incubation, the 4 hr untreated groups and the 4 hr treated groups (IC-21 + L L C co-incubating sets) were removed from the incubator, and the inserts were taken out o f the 6-well plates. Cells were collected and processed separately using the Qiagen R N e a s y ® Plus M i n i K i t , isolating and purifying their respective total R N A . The same procedure was done at eight hours into co-incubation and the 8 hr untreated and treated groups were removed and processed. Two-step real-time R T - P C R was performed on total R N A to analyze the gene expressions o f Ffsp70, S A P and ficolin B in the untreated and treated L L C s and their respective co-incubated IC-21s. The same co-incubation experiment was repeated using Hepa 1-6 cells instead o f IC-21 s.  Hepa 1-6  IC-21  LLC  Figure 4.2: In vitro co-incubation experiment First row: Hepa 1-6, IC-21 and L L C are the cell lines used. Second row: L L C s grown i n Millicell-®PCF cell culture inserts are P D T treated using the light source and co-incubated with Hepa 1-6 and IC-21 cells.  42  Materials and Methods  4.5) Sample collection and RNA isolation 4.5.1) Tissue collection for RNA isolation A t appropriate times following light treatment (or no treatment) mice were sacrificed using CO2 gas. Tissues were excised using surgical scissors and forceps and immediately placed i n 1.5 m L o f cold T R I z o l ® Reagent (Invitrogen) and kept on ice. The samples were then homogenised for approximately 1 minute (three 20 second intervals). Following homogenisation, the tissues were stored at - 8 0 ° C until R N A isolation.  4.5.2) RNA isolation from tissue homogenates Workspace and pipettes were cleaned with R N a s e - A W A Y ™ (Invitrogen) and all pipetting was done using aerosol-free, A R T Self-Sealing Barrier pipette tips ( V W R International, Mississauga, Ontario). The samples were removed from the - 8 0 ° C freezer and thawed at room temperature. They were then centrifuged at 13000 rpm for 10 minutes at 4°C (using a mini-centrifuge) to remove cell debris. The clear supernatants were transferred to new 2.0 m L microcentrifuge tubes. 200 u L o f chloroform for every 1 m L o f T r i z o l used was added. Samples were shaken vigorously for 20 seconds and incubated at room temperature for about 5 minutes. Then they were centrifuged at 13000 rpm for 15 minutes at 4°C. T w o phases o f liquid were present. The colourless upper aqueous phase containing the R N A prep was carefully transferred to a fresh 2.0 m L microcentrifuge tube for the phenol:chloroform R N A purification procedure.  Materials and Methods  4.5.3) RNA purification from tissue homogenates 4.5.3.1) Phenol:chloroform RNA purification and ethanol precipitation Equal volume o f phenol solution (Sigma, Cat.No. P4682) as the aqueous was added to each tube and then shaken vigorously for 20 seconds. After 5 minutes o f incubation at room temperature, chloroform-isoamyl alcohol mixture (Sigma, Cat.No. P25668), at about 0.4 times the volume o f phenol, was added and the tubes were shaken vigorously for another 20 seconds. After 5 minutes o f incubation at room temperature, the samples were centrifuged at 13000 rpm for 15 minutes at 4°C. The two liquid phases were separated with the upper aqueous layer containing the R N A . Subsequently, the layer containing the R N A was transferred to a new 2.0 m L microcentrifuge tube and a second wash, identical to the first, using phenol was done to remove any impurities. A t this stage, the aqueous layer was very clean and the purification was continued b y adding an equal amount o f chloroform as the aqueous layer to each sample. The tubes were shaken vigorously for 20 seconds and incubated at room temperature for 5 minutes. They were then centrifuged at 13000 rpm for 10 minutes at 4°C. A g a i n two liquid phases were present. The colourless upper aqueous phase containing the R N A was transferred to a new tube and mixed with 3 M sodium acetate (3 M N a O A c , p H : ~ 5.2) at about 0.1 times the volume o f the aqueous phase. Isopropanol (Sigma, Cat.No. 195162) was added at 2 times the volume o f the samples ( R N A prep + N a O A c ) for R N A precipitation. The liquids were mixed thoroughly by vigorous shaking and incubated at -20°C overnight (a minimum o f 1 hour incubation is needed). Centrifugation o f samples at 13000 rpm for 10 minutes at 4°C was performed to pellet the precipitated R N A . The supernatant was removed and the R N A pellet was washed with 1 m L o f 75% ethanol. Following  44  Materials and Methods  centrifugation at 13000 rpm for 10 minutes at 4°C, the supernatant was discarded and the pellet was air dried for approximately 30-45 minutes. Next, the precipitated R N A was dissolved i n 50 u L o f UltraPure™ DNase/RNase-Free Distilled Water (Invitrogen, Cat.No. 10977-015).  4.5.3.2) RNA concentration reading and DNase digestion The concentration o f the R N A samples was determined using the N a n o D r o p ® N D - 1 0 0 0 U V - V i s Spectrophotometer (NanoDrop Technologies, Bancroft Building, Wilmington, D E , U S A ) . Sufficient amounts o f R N A samples were then carried over for DNase digestion, removing genomic D N A contaminations. Appropriate amounts o f R Q 1 RNase-Free DNase, R Q 1 RNase-Free DNase 10 x Reaction Buffer (Promega Corporation, Madison, W I , U S A ) (Cat.No. M 6 1 0 A ) , and UltraPure™ DNase/RNase-Free Distilled Water (Invitrogen, Cat.No. 10977-015) were added to each R N A sample. Following incubation at 37°C for 30 minutes, the DNase treatment was terminated b y adding an appropriate volume o f DNase Stop Solution (Promega, Cat.No. M 6 1 0 A ) and incubation at 65°C for 10 minutes.  4.5.3.3) Phenol:chloroform RNA purification and ethanol precipitation A t this point, the phenol:chloroform R N A purification and ethanol precipitation was repeated to remove any protein and ion contaminations left behind from the DNase treatment step. The precipitated R N A was dissolved in 50 u L o f U l t r a P u r e ™ DNase/RNase-Free Distilled Water (Invitrogen, Cat.No. 10977-015) and the concentration was determined using the N a n o D r o p ® ND-1000 U V - V i s  45  Materials and Methods  Spectrophotometer (NanoDrop Technologies). The samples were then stored at - 8 0 ° C until use.  4.5.4) Cell culture collection for RNA isolation Mouse Lewis Lung Carcinoma ( L L C ) cell line ( A T C C Number: CRL-1642), S V 4 0 transformed mouse peritoneal macrophage (IC-21) cell line ( A T C C Number: T I B 186) and mouse hepatoma (Hepa 1-6) cell line ( A T C C Number: CRL-1830) were collected and processed using Qiagen R N e a s y ® Plus M i n i K i t (Qiagen Inc., Valencia, C A , U S A ) (Cat.No. 74134). Appropriate volumes o f P-mercaptoethanol (fi-ME) (Sigma, Cat.No. 63689) were added to the Qiagen kit supplied R L T Plus buffer to prepare the working lysis buffer. Cells grown i n monolayer (in 3.5 c m diameter Petri dishes/3.0 c m diameter cell culture inserts) were collected by adding the recommended volume o f R L T Plus buffer + P - M E , and scraping using a rubber policeman. Following homogenization, the cell lysates were transferred to 2.0 m L microcentrifuge tubes and frozen at - 8 0 ° C for future R N A isolation.  46  Materials and Methods  4.5.5)  RNA isolation and purification from cell culture extracts Cell culture samples were RNeasy Plus Procedure  collected and processed using Qiagen RNeasy® Plus Mini Kit  Ceils or tissue  (Cat.No. 74134). The detailed  Lyse a n d homogenize  procedures described here were in accordance with the Qiagen RNeasy® Plus Mini Handbook.  Figure 4.3; Schematics of RNA  Remove genomic D N A Total RNA  Genomic DNA  isolation using Qiagen RNeasy® Plus Mini Kit. After thawing the A d d ethanol  homogenized lysates at room temperature, they were transferred to the gDNA Eliminator spin  Bind total RNA  columns placed in 2.0 mL collection tubes. Following centrifugation for  Total RNA  30 seconds at >8000xg (> 10,000 rpm), the flow-through was mixed Wash  with one volume of 70% ethanol. Up to 700 uL of the samples at a time were transferred to the RNeasy spin column placed in 2.0 mL collection tubes. Samples were  Elute Eluted RNA  47  Materials and Methods  centrifuged for 15 seconds at >8000xg (>10,000 rpm) and the flow-throughs were discarded. (Sample volumes exceeding 700 u L were centrifuged i n successive aliquots i n the same RNeasy spin column). Added to each RNeasy spin column was 700 u L o f the Qiagen kit-supplied R W 1 buffer and they were spun for 15 seconds at >8000xg (> 10,000 rpm) to wash the spin column membranes. The flow-through was discarded. Next, 500 u L o f the Qiagen kit-supplied R P E buffer was added to each RNeasy spin column and centrifuged for 15 seconds at >8000xg (>10,000 rpm) to wash the spin column membrane. After discarding the flow-through, the spin column membrane wash was repeated using a second 500 u L aliquot o f the R P E buffer. Centrifugation for 2 minutes at >8000xg (> 10,000 rpm) ensured that no ethanol was carried over during R N A elution. RNeasy spin columns were then placed i n new 2.0 m L collection tubes and centrifuged at full speed for 1 minute to eliminate any possible carryover o f R P E buffer or residual flow-through. Spin columns were then placed in new 1.5 m L collection tubes, 50 u L o f RNase-free water was directly added to the column membranes and centrifuged for 1 m i n at > 8 0 0 0 x g (>10,000 rpm) to elute the R N A . Concentrations o f R N A samples were determined using the N a n o D r o p ® ND-1000 U V - V i s Spectrophotometer (NanoDrop Technologies).  48  Materials and Methods  4.6) qRT-PCR: Quantitative reverse transcriptase (RT) polymerase chain reaction (PCR) M a n y cellular functions are regulated by changes in gene expressions. Quantitation o f transcription levels would help to understand gene function and overall cellular status. This information can be obtained by analysis o f messenger R N A ( m R N A ) . Real-time quantitative reverse transcriptase P C R is the latest innovation in the filed o f P C R technology that provides a sensitive, reproducible and accurate method for determining m R N A levels i n cells. The method is based on the detection o f a fluorescent signal produced and monitored during the amplification process, without the need for post-PCR processing. S Y B R ® Green I based real-time P C R works by utilizing the double-stranded (ds) D N A minor groove binding ability o f this fluorescent dye. In q P C R , as d s D N A accumulates, S Y B R ® Green I generates signals that are proportional to the D N A concentration and that can be detected using the real-time P C R instrument. Unlike conventional (end-point) P C R , real-time P C R allows the accumulation o f amplified product to be detected and measured as the reaction progresses, enabling the determination o f the starting template copy numbers with accuracy and high sensitivity over a wide dynamic range.  The two-Step Real-Time Quantitative R T - P C R s were done using Invitrogen's S u p e r s c r i p t ™ III Platinum® Two-Step q R T - P C R K i t with S Y B R ® Green (Cat.No. 11735-040).  49  Materials and Methods  4.6.1) First-strand cDNA synthesis Complementary strand D N A or c D N A samples were synthesised from 0.132-1 |_ig o f total R N A using Invitrogen's S u p e r s c r i p t ™ III Platinum® Two-Step q R T - P C R K i t with S Y B R ® Green (Cat.No. 11735-040). U p to 1 jig o f total R N A was added to P C R tubes along with 10 u L o f 2 x reverse transcriptase (RT) Reaction M i x (containing oligo(dT)2o, random hexamers, M g C b , and dNTPs i n a buffer formulation optimized for use i n q P C R ) , 2 u L R T Enzyme M i x (containing S u p e r s c r i p t ™ III R T and R N a s e O U T ™ Recombinant Ribonuclease Inhibitor), and DEPC-treated water to achieve a final volume o f 20 pX. The contents were mixed gently and the tubes were spun down for few seconds and kept on ice. A 96-Well G e n e A m p ® P C R System 9700 thermocycler (Applied Biosystems, Foster City, C A , U S A ) was used for c D N A synthesis b y providing the following parameters: •  25°C for 10 minutes  •  42°C for 50 minutes  •  85°C for 5 minutes  A t this point, the samples were spun down and chilled on ice. One micro-litre (2 U ) o f E.coli RNase H and 1 u L o f DEPC-treated water were added to each sample and incubated at 37°C for 20 minutes. E.coli RNase H was used to remove the R N A template from the c D N A : R N A hybrid molecule after first-strand synthesis to increase the sensitivity o f downstream reactions. When finished, the reaction mixtures were stored at 20°C until use.  Materials and Methods  4.6.2) Real-time quantitative PCR (qPCR) primer and amplicon designs The complete genomic and c D N A sequences for the 7 genes o f interest (mouse complement components: C l q , M B L - A , ficolin A , ficolin B ; mouse pentraxins: serum amyloid P component (SAP), Ptx3; mouse heat shock protein 70 (Hsp70)), and housekeeping gene (mouse glyceraldehydes-3-phospahte dehydrogenase, G A P D H ) were found on the Entrez, The Life Sciences Search Engine (http://www.ncbi.nlm.nih.gov/gquerv/gquery.fcgi). Based on these sequences, we designed the primers as 17-22 nucleotides and checked them with NefPrimer software (http://www.premierbiosoft.com/netprimer/netprlaunch/netprlaunch.html) from P R E M I E R Biosoft International, a web-based program rating primer suitability. Most primers used were given a rating o f 100%, meaning they did not form hairpins, dimers and did not contain palindromes or repeats. Most were designed to be exon/exon spanning primers, alerting o f any genomic D N A contaminations. Primers were designed to produce 75200bp long amplicons. Templates with long (>4) single base repeats were avoided, and all amplicons were blasted using Mouse Genome Informatics (MGI) M o u s e B L A S T ( W U - B L A S T 2.0.) (http://mouseblast.informatics.jax.org/) to ensure that only the sequence o f interest was being amplified. The primers were ordered i n "desalted" format from Invitrogen's online Custom Primers ordering website. (https://catalog.invitrogen.conVindex.cfm?fuseaction=orderAssemble.simpleAddPrimerToCart& primerTypeCode=D&lid=DNABasic). The concentrations o f M g C b producing the lowest C T values were selected as the optimal M g C ^ concentrations. C j or threshold cycle is the cycle number at which fluorescent signal from the accumulated amplified product surpasses the background fluorescence levels and therefore is detectable.  51  Materials and Methods  Gene Hsp70 N M 010478 SAP (Apes) N M 011318 Ptx3 N M 008987 Clq N M 007572 MBL-A N M 010775 Ficolin A N M 007995 Ficolin B N M 010190 GAPDH NM 001001303  Primer sequence (5'-3') ATCACCATCACCAACGACAAG GAGATGACCTCCTGGCACTT TTTCAGAAGCCTTTTGTCAGA AAGGTCACTGTAGGTTCGGA AAACTTCGGTGCGTAATAGAC GCCTTCCCTTCAACTGTGT GTGGGACCTTTGTCTGTTTATC AAATGAGGAATCCGCTGAA TATGGAGGCAGAGATAAGGAT GGGATAGCCACAGTGCC GCCGAGATGAAAATCCGAG CCAGAGGGGAGTGTAGAGAGC GCAAATGGTGTCAACTGGA TAGCAGTGAAGATGGAAGAGTC TGGCATTGTGGAAGGGCT  Alignment Sense Anti-sense Sense Anti-sense Sense Anti-sense Sense Anti-sense Sense Anti-sense Sense Anti-sense Sense Anti-sense Sense  Tm  Rating  57.87 56.16 55.39 54.36 54.39 54.46 55.63 55.39 53.44 53.26 57.90 57.93 54.19 53.89 59.14  100% 100% 100% 100% 100% 100% 100% 100% 100% 92% 100% 100%. 100% 100% 100%  GCTCTGGGATGACCTTGC  Anti-sense  55.43  100%  MgCl 4.0 mM  Amp. size 236bp  3.5 m M  146bp  4.0 m M  93bp  4.0 m M  221 bp  3.5 mM  175bp  4.0 mM  152bp  4.0 mM  130bp  3.5 mM  167bp  2  Table 4.1: Description of oligo-nucleotide primer pairs used in qPCR reactions. Table 4.1 presents the genes o f interest and their N C B I accession numbers used i n this study; their respective primer pair sequences and alignments; their melting temperatures (Tm) i n degrees Celsius; respective ratings based on NefPrimer software shown i n percentage; optimal P C R M g C ^ concentrations i n m M ; and their resulting amplicon size.  52  Materials and Methods  4.6.3)  Relative real-time quantitative polymerase chain reaction (qPCR)  4.6.3.1) Real-time PCR system and reagents A l l relative q P C R s were performed using the Applied Biosystems 7500 RealTime P C R System and Invitrogen's Superscript™ III Platinum® Two-Step q R T - P C R K i t with S Y B R ® Green (Cat.No. 11735-040).  4.6.3.2) Reaction components Reaction samples were prepared i n accordance with instructions supplied by Invitrogen. Component volumes were scaled down to achieve 25 p X reaction mixtures. Each reaction mixture was prepared b y adding 12.5 u L o f Platinum® S Y B R ® Green q P C R S u p e r M i x - U D G , 0.5 u L forward primer (10 u M ) , 0.5 u L reverse primer (10 u M ) , 0.5 u L R O X reference dye ( 1 0 x diluted), 2.75 p L c D N A from the first-strand synthesis reaction, 0.25 u L [50 m M ] M g C b i f needed, and DEPC-treated water to reach the final reaction volume to 2 5 u L .  Components  Single rxn @ 3.5 Single rxn @ 4.0 mM [MgCl ] mM [MgCl ]  Platinum® S Y B R ® Green q P C R S u p e r M i x - U D G  12.5 p L  12.5 p L  Forward primer (10 u M )  0.5 p L  0.5 p L  Reverse primer (10 u M ) R O X Reference D y e M g C l (50 m M ) DEPC-treated water c D N A from the first-strand synthesis reaction  0.5 p L  0.5 p L  0.5 u L  0.5 u X  -  0.25 p L  8.25 p L  8.0 p X  2.75 p L  2.75 p L  Total  25.0 uL  25.0 uL  2  2  2  Table 4.2; Components of 25 tiL qPCR reactions and their contributing volumes. 53  Materials and Methods  Platinum® S Y B R ® Green q P C R S u p e r M i x - U D G contained Platinum® Taq D N A polymerase, S Y B R ® Green I dye, T r i s - H C l , K C 1 , 6 m M M g C l , 400 p M d G T P , 2  400 p M d A T P , 400 p M d C T P , 800 p M d U T P , uracil D N A glycosylase ( U D G ) , and stabilizers. Platinum® Taq D N A polymerase is a recombinant Taq D N A polymerase complexed with a proprietary antibody that blocks polymerase activity at ambient temperatures. Activity was restored after the denaturation step o f P C R cycling, providing an automatic hot start i n P C R for increased sensitivity, specificity and yield. U D G and d U T P in the q P C R SuperMix prevented the reamplification o f carryover P C R products between reactions. d U T P ensured that any amplified D N A contains uracil, while U D G removed uracil residues from single or double stranded D N A . A U D G incubation step before P C R cycling destroyed any contaminating dU-containing product from previous reactions. U D G was then inactivated by the high temperatures during normal P C R cycling, allowing the amplification o f genuine target sequences. S Y B R ® Green I included i n the q P C R SuperMix, is a fluorescent dye that binds directly to doublestranded D N A ( d s D N A ) . In q P C R , as d s D N A accumulates, the dye generates a signal that is proportional to the D N A concentration and one that can be detected using realtime P C R instruments. For multiple reactions, a master m i x for each gene was prepared by adding the appropriate volume o f Platinum® S Y B R ® Green q P C R S u p e r M i x - U D G , gene specific forward and reverse primer pairs, R O X reference dye (10x diluted), and DEPC-treated water. The master mixes were added to clear, elevated half-skirt 96-well plates (Axygen Scientific, Inc., Union City, C A , U S A ) (Cat.No. P C R - 9 6 - A B - C ) , and then the unique reaction components, first-strand c D N A s , representing different samples were added.  54  Materials and Methods  4.6.3.3) qPCR cycling parameters The following cycling parameters were used for all the P C R runs: •  50°C for 2 minutes ( U D G incubation)  •  95°C for 2 minutes  •  50 cycles of:  95°C for 15 seconds 60°C for 60 seconds  Dissociation analyses were performed after each run, and the specificity o f each q P C R reaction was confirmed by analyzing the melting curve signatures o f the reaction product.  4.6.3.4) Optimized qPCR reactions Linear standard curves (high coefficient o f determination, R >0.980), high amplification efficiencies (90-105%), and consistency across replicate reactions were achieved which illustrated optimized q P C R reactions. Standard curves were generated by amplifying 10-fold serial dilutions o f c D N A samples. They were constructed b y plotting the log o f the sample dilution against the C j values obtained from amplification o f each dilution. The equation o f the linear regression line, along with the coefficient o f determination (R ) were used to evaluate whether the q P C R assay was optimized. The R value o f a standard curve represents how well the experimental data fit the regression line, that is, how linear the data is. Linearity, i n turn, gives a measure o f the variability across assay replicates and whether the amplification efficiency is the same for different starting template copy numbers. ( A significant difference in observed C T values between  55  Materials and Methods  replicates w i l l lower the R value). R values > 0.980 are indications o f optimized q P C R 2  2  assays. The amplification efficiency, E , was calculated from the slope o f the standard curve using the following formula: g = JQ-1/slope  % Efficiency = ( E - l ) x 100% % Efficiency = ( 1 0 "  1/slope  - 1) x 100%  Efficiency close to 100% is the best indicator o f a robust, reproducible assay. For optimal q P C R reactions amplification efficiencies o f 90-105% are desired.  Figure 4.4: SAP standard curve for the assessment of reaction optimization. Figure 4.4 represents the standard curve generated using 10-fold dilutions o f a template amplified on the Applied Biosystems 7500 Real-Time P C R System to evaluate the assay's efficiency. The calculated amplification efficiency is 99.25%.  56  Materials and Methods  4.6.4) Real-time qPCR data analysis: Relative quantification A l l the q P C R reactions performed were relative quantifications, normalized to the reference gene G A P D H . Reference genes are characterised by possessing constant expression levels across all test samples and whose expressions are not affected by the experimental treatment under study. The A C T method using a reference gene was used for analysing the relative gene expressions. The relative expression levels o f the target genes in different samples were determined following these steps:  1. C j o f the target genes were normalized to that o f the reference (ref) gene G A P D H , in all the test and the calibrator samples (naive/untreated samples) AC  =C  "Witest)  T(ref, test)  AC  = C  *-"^T (Calibrator)  2.  -C W  (traget, test)  - C T (ref, calibrator)  (target, calibrator)  Expression ratios were calculated for each target and calibrator samples Ratio (target/ref) = 2  ACj  3.  To calculate relative expression, each sample ratio was normalized to that o f the calibrator 2 ACT(CalibraBr)  Calibrator normalized expression = 2 ^c ( ii ) T  C>  taBr  2 ACl(Tet)  Test normalized expression =  2 ^T(Calibrat)r)  The results obtained were fold increase/decrease o f the target genes i n the test samples relative to the calibrator samples (nai've/untreated samples) and were normalized to the expression o f the reference gene G A P D H .  57  Materials and Methods  4.7) Agarose gel electrophoresis 4.7.1) Gel procedure The gels were run to verify the products amplified by the real-time P C R . One litre of 50 x T A E buffer stock solution was prepared by mixing 242 g Tris base, 57.1 m L glacial acetic acid, 100 m L 0.5 M E D T A (pH 8.0), appropriate volume o f deionized distilled water ( d d H 0 ) and the p H adjusted to 8.0. The working 1 x T A E buffer was 2  prepared b y 50 x dilution o f the stock i n ddH^O. T w o percent w/v gels were prepared by adding l g agarose powder (Sigma, Cat.No. A9539-50G) to a 100 m L volumetric flask containing 50 m L o f 1 x T A E buffer. The mixture was swirled to disperse the agarose, covered with aluminium foil and heated using a microwave on high power for 30 seconds. The flask was removed briefly and shaken gently, put back and heated for 15 more seconds. Following heating, the flask was swirled for a few minutes and allowed to cool down to about 55°C. S Y B R ® Green I Nucleic A c i d G e l Stain (2.5 |j.L) (Invitrogen, Cat.No. S7563) was added (diluting the S Y B R ® Green 20000 x ) and the flask swirled to disperse the dye. The O w l EasyCast™ model B I horizontal mini gel electrophoresis system ( O w l Separation Systems Inc., Portsmouth, N H , U S A ) , was used i n conjunction with a V W R AccuPower electrophoresis power supply model 300 120 V 60 H z ( V W R International, Mississauga, Ontario). The U V T gel tray and the comb ( B l - 1 4 ; teeth thickness: 1.5 m m ; teeth width: 4.4 mm) were placed i n the buffer chamber i n the casting position and the mixture was poured into the gel tray. Once solidified, the tray was turned 90 degrees, the comb was removed, an appropriate volume o f 1 x T A E buffer was added and then the samples were loaded. The GeneRuler™ D N A Ladder, L o w Range, ready-touse (Fermentas Life Sciences, Burlington, Ontario) (Cat.No. SM1203), and  58  Materials and Methods  O ' G e n e R u l e r ™ lOObp D N A Ladder, ready-to-use (Fermentas Life Sciences, Cat.No. S M I 143) were diluted 3 x using UltraPure™ DNase/RNase-Free Distilled Water (Invitrogen, Cat.No. 10977-015) and 2 u L o f the mixtures were loaded into the appropriate wells. q P C R products were first diluted 2 x using UltraPure™ DNase/RNaseFree Distilled Water (Invitrogen, Cat.No. 10977-015). Subsequently, 5 volumes o f diluted samples were mixed with 1 volume o f 6 x Orange Loading D y e Solution (Fermentas, Cat.No. R0631) and 10 p L o f the mixtures were loaded into the appropriate wells. The gels were run at 60 volts : 30 m A m p s for 3 hours.  4.7.2) Gel imaging The D N A bands were visualized using a Herolab U V T - 2 8 M , standard - m i d range (312 nm) U V Transilluminator (Herolab G m b H Laborgerate, Wiesloch, Germany), and documented with a Kodak Digital Science D C 5 0 Electrophoresis Documentation and Analysis System 120 (Eastman Kodak Company, Rochester, N e w Y o r k , U S A ) .  59  Materials and Methods  Figure 4.5: Quantitative RT-PCR amplicons. A s shown in the above photograph, all the bands fall within their appropriate size ranges. Ficolin B (FB) amplicon is 130 bps. G A P D H (GAP) amplicon is 167 bps. Hsp70 amplicon is 236 bps. SAP amplicon is 146 bps. Ptx3 amplicon is 93 bps. M B L - A (MBL) amplicon is 175 bps. Ficolin A (FA) amplicon is 152 bps. Clq amplicon is 221  bps.  4.8) Enzyme-linked immunosorbent assay (ELISA) 4.8.1) ELISA procedure E L I S A was used for the detection and quantification o f Hsp70 i n tissue extracts and serum samples. Stressgen's Hsp70 StressXpress E L I S A kit was used (Assay Designs, Inc., A n n Arbor, Michigan, U S A ) (Cat.No. E K S - 7 0 0 A ) for detection. Before starting, the appropriate reagents were brought to room temperature. Recombinant Hsp70 standard (10 n g / m L stock solution o f inducible Hsp70 protein) and samples (liver and serum) were prepared b y diluting i n Sample Diluent 1 (buffer to dilute serum samples and accompanying standards) or Sample Diluent 2 (buffer to dilute cell lysates and tissue extracts and accompanying standards). Prepared standards, blanks (Sample Diluents 1 or 2) and samples, all i n 100 u L volumes were added to duplicate wells o f an anti-Hsp70  60  Materials and Methods  Immunoassay Plate ( 1 2 x 8 removable strips pre-coated plate with mouse monoclonal antibody specific for inducible Hsp70). The immunoassay plate was then covered and incubated at room temperature for 2 hours. Following the incubation, the wells were emptied and washed 4 x with 200 p L aliquots o f 1 x wash buffer (buffer solution and surfactant). Hundred micro-liters (100 p L ) o f anti-Hsp70 antibody (rabbit polyclonal antibody specific for inducible Hsp70) were added to each well and the plate covered and incubated at room temperature for 1 hour. Following 4 x wash with 1 x wash buffer, 100 p L o f Hsp70 conjugate (horseradish peroxidase conjugated anti-rabbit IgG) were added to each well. After incubation at room temperature for 1 hour, the wells were washed 4 x with 1 x wash buffer and 100 p L o f T M B substrate (stabilized tetramethylbenzidine substrate) were then added to each well. The plate was incubated at room temperature for 30 minutes. Subsequently, the reactions were stopped by adding 100 p L o f Stop Solution 2 (an acid solution to stop the colour reaction) to each well. Absorbance was measured at 450nm wavelength using the D Y N E X M R X ® Revelation™ E L I S A microplate reader ( D Y N E X Technologies, Chantilly, V A , U S A ) . For each step i n the procedure, total dispensing time for the addition o f the reagents and samples to the assay plate did not exceed 20 minutes.  4.8.2) Sample preparation 4.8.2.1) Liver samples Mouse liver sections ranging from 0.17 g to 0.92 g were homogenized in 1 m L P B S . A n appropriate amount of protease inhibitor cocktail (50 pL/g) (Sigma, Cat.No. P8340) was added. The mixtures were spun at 13000 rpm for 10 minutes to remove cell  61  Materials and Methods  debris and 1 m L o f this supernatant was then mixed with l m L o f 1 x Extraction Reagent (buffer for preparation o f cell and tissue extracts). This final supernatant was diluted l O x with Sample Diluent 2 to remove matrix interference and prepare the samples for E L I S A .  4.8.2.2) Serum samples B l o o d was collected by heart puncture and allowed to clot at room temperature for 30 minutes.The samples were centrifuged at 2700 x g for 10 minutes, and the serum was carefully collected and transferred to polypropylene tubes. Required dilutions o f the serum samples were prepared using Sample Diluent 1.  4.8.3) Hsp70 standard curves 4.8.3.1) Liver standard curve The Recombinant Hsp70 Standard, diluted with Sample Diluent 2, was used to generate a standard curve with 7 points ranging from 0.78-50 ng/mL for liver samples. Seven polypropylene tubes were labelled with the appropriate concentrations o f 50 ng/mL, 25 ng/mL, 12.5ng/mL, 6.25ng/mL, 3.125ng/mL, 1.56ng/mL, and 0.78ng/mL. Nine hundred and ninety five micro-litres (995 p L ) o f Sample Diluent 2 were added to the tube labelled 50 ng/mL (tube #1). Five hundred micro-litres (500 p L ) o f Sample Diluent 2 were added to the rest o f the tubes (tubes #2, 3 , 4 , 5, 6 and 7). Five micro-litres (5 p L ) o f the Hsp70 Standard stock solution (10 pg/mL) were added to tube #1 (50ng/ml) and mixed thoroughly. Five hundred micro-litres (500pl) from tube #1 (50 ng/mL) were then transferred to tube #2 (25 ng/mL) and mixed thoroughly. Similarly, 2-fold serial dilutions were carried out to generate the remaining standards (500 p L from tube #2 to  62  Materials and Methods  tube #3, mixed thoroughly, etc.) up to and including tube #7. Five hundred micro-litres (500 u L ) o f Sample Diluent 2 were added to another polypropylene tube (tube #8) which served as the assay blank (0 ng/mL).  Figure 4.6: Liver serial dilution schematics. 5ul  500^1  500 ul  500 ul  /^~\ r\ r\ r\ HSP70 Standard vial  ©  ©:  ©  ©j  ©  ! mm  !  50ng/ml lOug/ml  o r\ r\ 500 ul  500^1  ©j  1  .  12.Sng/rnl 25ngyrnl  •  ;  500 ul  !  ©  j L : :  •  3.125ng/M 0 78ngAnl 6.25ngAnl 1.56ngAnl  4.8.3.2) Serum standard curve The Recombinant Hsp70 Standard, diluted with Sample Diluent 1, was used to generate a standard curve with 10 points ranging from 0.049-25 ng/mL for serum samples. Eleven polypropylene tubes were labelled with the appropriate concentrations o f 50 ng/mL, 25 ng/mL, 12.5 ng/mL, 6.25 ng/mL, 3.125 ng/mL, 1.56 ng/mL, 0.780 ng/mL, 0.390 ng/mL, 0.195 ng/mL, 0.098 ng/mL, and 0.049 ng/mL (tubes #1-#11 respectively). Sample Diluent 1, 995 u L , was added to tube #1 (50 ng/mL). Five micro-litres (5 u L ) o f the Hsp70 Standard stock solution (10 (ig/mL) were added to tube #1 (50 ng/mL) and mixed thoroughly. Five hundred micro-litres (500 u L ) o f Sample Diluent 1 were added to the rest o f the tubes (tubes #2-11). Five hundred micro-litres (500 u L ) from tube #1 (50 ng/mL) were then transferred to tube #2 (25 ng/mL) and mixed thoroughly. Similarly, the  63  Materials and Methods  serial dilutions were carried out to generate the remaining standards (500 p L from tube #2 to tube #3, mixed thoroughly, etc.) up to and including tube #11. Five hundred microlitres (500 p L ) o f Sample Diluent 1 were added to another polypropylene tube (tube #12) which served as the assay blank (0 ng/mL). Samples from tubes #2-11 (0.049-25 ng/mL) were used to generate the serum Ffsp70 standard curve. The Recombinant Ffsp70 Standard was aliquoted appropriately to avoid more than two freeze/thaw cycles.  Figure 4.7: Serum serial dilution schematics. 5Ul  HSP70 Standard Vial  500 Ul  ©  500 Ul  ©  50ng/rnl 10u.g/ml  4.8.4)  500 Ul  ©  500 ul  500 Ul  500 ul  500 ul  500 ul  ©  ©  ©  ©  ®  © I  12.5ngAnl 25ng/ml  6  2  5  n  g  M  500 ul  ®  500 ul  ©  3.125ngAnl 0.78ng/hil 0.195ngAnl 0.049ngAnl 1.56ng*rt o. ng^l 0.098ngAr,l 39  ELISA data analysis The average o f the duplicate absorbance measurements for each standard, sample,  and blank was calculated. The average absorbance value obtained for the blank (0 ng/mL Ffsp70) was subtracted from the values obtained for standards and samples. To generate the standard curves, the Recombinant Ffsp70 Standard concentrations and their corresponding absorbance were plotted on a log to log scale graph. The best fit lines were determined for the data points. Trendline equations were used to calculate the log o f the concentration o f the experimental samples. Upon taking the anti-logs o f the values, and subsequently multiplying them by their respective dilution factors, total sample Hsp70  64  Materials and Methods  concentrations were determined. In order to assess the Hsp70 concentrations per unit weight for the liver samples, the total Hsp70 concentrations were then divided by the total weight o f their respective starting samples. In these E L I S A assays, values were considered statistically significant i f they were greater than 2 x the standard deviation o f the zero (0 ng/mL), anything less was considered assay noise.  Hsp70 Standard C u r v e for Liver S a m p l e s  Hsp70 S t a n d a r d C u r v e for S e r u m S a m p l e s  -2.5 I -1.5  1 -1  r-0.5  1 1 0 0.5 of Concentration  1  1  1  1  1.5 2 y = 1.0906x-0.8 ' , R = 0.9827  Figure 4.8: Hsp70 standard curves for liver and serum samples. The standard curves were produced b y graphing the log o f absorbance vs. log o f concentration o f 2-fold serially diluted Recombinant Hsp70 protein provided. For liver standard curve, Recombinant Hsp70 protein was diluted in Diluent 2 and for serum standard curve, Recombinant Hsp70 protein was diluted in Diluent 1.  65  Materials and Methods  4.8.5) ELISA performance characteristics Liver samples were diluted 10 x with the Sample Diluent 2 to remove any matrix interference during the assay. A n E L I S A was performed using VTo -fold serial dilutions o f the liver homogenates with Sample Diluent 2, which clearly validated the appropriateness o f 10 x dilution o f the samples. A liver sample homogenate with 50.175 ng/mL Hsp70 concentration was used for the serial dilutions. Four polypropylene tubes were labelled #1-4. T w o hundred and twenty five micro-litres (225 u L ) o f Sample Diluent 2 were added to tubes #1-4. Hundred and four micro-litres (104 u L ) o f liver sample were then transferred to tube #1 and mixed thoroughly. Similarly, VlO -fold serial dilutions were carried out to generate the remaining solutions (104 u L from tube #2 to tube #3, mixed thoroughly, etc.). T w o hundred and twenty five micro-litres (225 uL) o f Sample Diluent 2 were added to another polypropylene tube (tube #5) which served as the assay blank (0 ng/mL). Linearity o f the graph confirmed by a high coefficient o f determination ( R ) value, showed no matrix effect and assay interference when using the 2  dilutions performed in the experiment.  66  Materials and Methods  ELISA Performance for Liver Sample Serial Dilutions 0.20  3 o.oo « -0.20 5 -0.40 % -0.60 -0.80 ° -1.00  J  O)  o -1.20 -1.40 -2.5  -1.5  -1  Log of Dilution  -0.5  0  0.8602X + 0.5043 R = 0.989 2  Figure 4.9: ELISA performance curve. E L I S A performance was checked using serial sample dilutions. The high coefficient o f determination, R >0.980, illustrated that no matrix interference was present at the tested 2  dilutions,  vTo  , n = positive integers.  4.9) Flow cytometry and antibody staining 4.9.1) Flow cytometry parameters Flow cytometry was performed using a dual laser apparatus Coulter Epics Elite E S P (Coulter Electronics, Hialeah, F L , U S A ) . The staining with monoclonal antibodies were visualised by the fluorescent dyes fluorescein isothiocyanate (FITC) and phycoerythrin (PE), which were excited via a 488 nm laser. Emissions were split by a dichroic mirror and recorded after passing through 530 n m ± 15 and 580 n m ± 10 nm bandpass filters for the detection o f F I T C and P E respectively. Twenty thousand (20,000) cells were analyzed per sample. Also, forward and side light scatter (FS and SS) were recorded for each cell. The dead cells i n samples were easily distinguished by their  67  Materials and Methods  decreased F S and SS values. Additionally, the time o f flight parameter was used for gating out cell doublets.  4.9.2) Staining procedure In vitro cultured L L C cells were treated by Photofrin-PDT (Photofrin 20 [ig/mL for 24 hours in complete growth medium followed by light dose o f 1 J/cm ) and then left 2  in culture for 3 hours. The cells were then collected and transferred to 5.0 m L test tubes, kept on ice and shielded from light. Following centrifugation at 1000 rpm for 10 minutes at 5°C, the supernatants were removed. Samples were resuspended in Hank's balanced salt solution ( H B S S ) plus 2% heat inactivated fetal bovine serum (FBS) ( G I B C O Invitrogen C e l l Culture, Cat.No. 10082-147) and 0.09% sodium azide (Sigma, Cat.No. S8032), at [ L O x l o V m L ] . Subsequently, 200 u L o f the samples were spun at 1000 rpm for 10 minutes at 5°C, supernatants were removed and 100 u L o f Mouse B D F c B l o c k ™ monoclonal antibody ( B D Pharmingen™, Franklin Lakes, N J , U S A ) (Cat.No. 553141) were added to each tube i n order to block Fc receptor mediated non-specific binding o f immunoglobulins. Samples were vortexed and incubated on ice i n the dark. After 30 minutes, 400 u L o f H B S S were added to each sample. Cells were centrifuged at 1000 rpm for lOmins at 5°C, the supernatants were removed and 100 u L o f mouse anti-Hsp70 F I T C conjugated monoclonal antibody (Assay Designs, Inc., A n n Arbor, Michigan, U S A ) (Cat.No. SPA-810FI) were added to each tube, vortexed and incubated at 4°C in the dark for 30 minutes. H B S S 400 u L , were added to each sample and supernatants were removed after centrifuging at 1000 rpm for 10 minutes at 5°C. Following a second wash with 400 u L o f H B S S , the cells were resuspended in 400 u L o f H B S S (flow cytometry  Materials and Methods  buffer). A l l the samples were kept on ice in the dark prior to analysis.The same procedure was performed using F I T C conjugated annexin V ( B D P h a r M i n g e n ™ , Cat.No. 556419) to detect the amount o f annexin V bound to PDT-damaged L L C cells i n the absence or presence o f exogenously added Hsp70 protein. Annexin V is a phospholipid-binding protein that has a high affinity for phosphatidylserine, which makes it a sensitive probe for identifying apoptotic cells. Annexin V - F I T C was added at (5 uL/test) following the manufacturer instructions (including the use o f a special binding buffer with defined calcium and salt concentrations: 10 m M Hepes/NaOH, p H 7.4 with 140 m M N a C l , 2.5 m M CaCl ). 2  In vitro cultured L L C cells were treated by Photofrin-PDT (Photofrin 20 n g / m L for 24 hours i n complete growth medium followed by light dose o f 1 J/cm ) and then left 2  in culture for 4, 8, or 24 hours. The cells were then collected and resuspended i n phosphate buffered saline (PBS) at [ 1 . 0 x l 0 / m L ] . T w o hundred micro-liters (200 u L ) o f 6  this suspension were incubated with (0.25 ^g/sample) o f 7-amino-actinomycin D (7A A D ) obtained from B D P h a r M i n g e n ™ , ( B D Biosceiences, Mississauga, Ontario) (Cat.No. 559925) and (5 uL/sample) o f 488 Caspase-3 substrate (a component o f N u c V i e w caspase-3 assay kit produced by Biotium Inc., Hayward, C A , U S A ) (Cat.No. 30029-T); for 30 minutes at room temperature. The latter rapidly enters cells and is cleaved by caspase-3 to form a bright green dye that binds to D N A o f apoptotic cells. O n the other hand, 7 - A A D is a nucleic acid dye that can enter only necrotic cells, and formerly apoptotic cells undergoing secondary necrosis.  69  Materials and Methods  In an alternative staining procedure, FITC-conjugated annexin V ( B D PharMingen) (Cat.No. 556419) was used instead o f the 488 Caspase-3 substrate. Annexin V - F I T C was added at (5 pL/test) following the manufacturer's instructions (including the use o f a special binding buffer with defined calcium and salt concentrations: 10 m M Hepes/NaOH, p H 7.4 with 140 m M N a C l , 2.5 m M C a C l ) . 2  4.10) PDT cell death analysis Flow cytometry was used in this secetion to analyse the distribution o f cell death between apoptosis and necrosis after in vitro P D T treatment o f L L C cells. A n example o f the obtained fluorescence data is shown in Figure 4.10. The results summarized i n Table 4.10 serve as information illustrating the distribution o f cell death patterns after the P D T treatment used i n this work. The results with two types o f staining (caspase-3 substrate or annexin V ) were in a good agreement. The data indicate that at least a portion o f initially apoptotic cells has undergone later secondary necrosis. Complicating factors for cell death analysis at later time intervals are the disintegration o f dead cells and proliferation o f survivors.  Time after PDT  ' % Apoptotic cells ' % Necrotic cells '  % Viable cells  4 hours  j  io (±1)  j  1 (±0.2)  j  89 (±1.2)  8 hours  I  20 (±1.5)  ;  42 (±1)  ;  38 (±2.5)  24 hours  !  o  !  35 (±5)  1  65 (±5)  Table 4.10: Distribution of PDT-induced cell death in vitro. This table reveals the percentage o f cells dying via apoptosis or necrosis at different time intervals after P D T treatment o f in vitro L L C cells. Numbers i n parentheses are standard errors. % viable cells are calculated by subtracting the % apoptotic and necrotic cells from 100. S E for viable cells is calculated by adding the apoptotic and necrotic S E respectively.  70  Materials  i .1  1—rr 11 m i 1  I  T  I  n m — ~ r  \  ro  10  and  Methods  is I T • -*T—rr rrrtri 188 1880 J  C Y - C h r o m a LOG  7-AAD fluorescence  Figure 4.10: Cell deathflowcytometry dot plot. The graph shows a dot plot (dots representing individual cells) presenting a representative example o f the results obtained with cells collected at 4 hours after P D T treatment. The extent o f fluorescence associated with caspase-3 activity (ordinate) and 7 - A A D staining (abscissa) is depicted i n arbitrary units per cell.  71  Materials and Methods  4.11) Pharmaceutics The three drugs in this thesis were used to examine the role o f glucocorticoids (GC) i n regulation o f the Hsp70, S A P and ficolin B genes systemically. They included dexamethasone, mifepristone and metyrapone. Dexamethasone is a synthetic glucocorticoid, mifepristone is a G C receptor antagonist and metyrapone is an inhibitor o f G C synthesis.  Approved by the F D A i n 1958, dexamethasone is a synthetic glucocorticoid used as an anti-inflammatory or immunosupressive agent. It is roughly 20-30 times more potent than hydrocortisone and 5-7 times more potent than prednisone. Dexamethasone is usually selected for the management o f cerebral edema because o f its superior ability to penetrate the C N S . Similar to other glucocorticoids, unbound dexamethasone readily crosses cell membranes and binds to its cytoplasmic receptor. Modifying transcription and ultimately protein synthesis, dexamethasone inhibits leukocyte infiltration at the site o f inflammation, interferes with mediators o f the inflammatory response and suppresses humoral immunity. The anti-inflammatory actions o f this drug are thought to involve phospholipase A inhibitory proteins, lipocortins. Dexamethasone is available as oral, 2  parenteral, topical (spray) and ophthalmic dosage forms [190]. Purchased from Sigma (Cat.No. D1756) i n powder form, this drug was dissolved i n methanol and further diluted with D 5 W to achieve a working concentration o f 10 |ag/mL and 40 ug/kg was injected to mice intra-peritoneally [191, 192].  Mifepristone (RU-486) is a synthetic steroid with potent antiprogesterone and  72  Materials and Methods  antiglucocorticoid activities, antagonizing progesterone and glucocorticoid receptors. Initially used as an antiprogestagen that can terminate early pregnancy, mifepriston, at higher doses w i l l also inhibit the glucocorticoid receptor (GR). Negatively affecting G R , this drug blocks feedback regulation o f the H P A axis and subsequently increases endogenous A C T H and Cortisol levels. Because o f its ability to inhibit glucocorticoid action, mifepristone also has been studied as a potential therapeutic agent i n patients with hypercorticolism, currently being prescribed for inoperable patients with ectopic A C T H secretion or adrenal carcinoma who have failed to respond to other therapeutic manipulations [193]. Purchased from Sigma (Cat.No. M8046) i n powder form, this drug was dissolved i n P E G 4 0 0 with 2% ethanol to achieve a working concentration o f 10 m g / m L and 40 mg/kg was injected to mice subcutaneously [194].  Metyrapone is an oral agent commonly used i n tests o f adrenal function. It may also be used for pituitary-function tests. This compound is a relatively selective inhibitor of steroid synthesis. It inhibits 11-hydroxylation, interfering with Cortisol and corticosterone synthesis. Normally after administration o f metyrapone there is a compensatory increase o f pituitary A C T H release and adrenal 11-deoxycortisol secretion. Two-fold or greater increase o f the urinary 17-hydroxycorticoid excretion is also observed [195]. Purchased from Sigma (Cat.No. 856525) in powder form, this drug was dissolved i n P B S to achieve a working concentration o f 25 m g / m L and 100 mg/kg was injected to mice intra-peritoneally 15 minutes before P D T [194].  73  Materials and Methods  4.12) Statistical analysis A l l data represented i n the graphs are shown as the means plus standard errors. Non-parametric Wilcoxon-Mann-Whitney U tests were performed to compare the differences between two means and Kruskal-Wallis analysis was done to compare the differences between the means o f multiple sample groups. Differences were considered statistically significant at level P O . 0 5 . Microsoft Excel, and GraphPad P r i s m ® Version 4.0 software (GraphPad Software, Inc., San Diego, C A , U S A ) were used for statistical analysis and graphing purposes.  74  Results  5) RESULTS 5.1) PDT-induced changes in the expression of genes for Hsp70, pentraxin and complement proteins at the local (tumour) and systemic (liver and spleen) sites In order to identify which among the proteins known to be engaged i n the removal o f cell corpses play an important role i n the removal o f dead cells in PDT-treated tumours, gene expression profiles o f the possible candidates were analyzed locally (in tumour) and systemically (in liver and spleen).  Twenty-four mature female C57B1/6J mice bearing 8-10 m m subcutaneous L L C tumours were separated into 4 groups. One group was not treated and was used as the control. The remaining 3 groups were treated with P D T (Photofrin [10 mg/kg] injected intravenously via the tail vein followed 24 hours later by tumour-localized light treatment, delivering a dose o f 150 J/cm ). Subsequently, tissues such as tumours, livers, 2  spleens and blood were collected at 4 hrs, 8 hrs, and 24 hrs post light treatment. Samples were also collected from 6 healthy mice to serve as the designated naive control group. Tumours, livers and spleens were homogenized in T R I z o l ® Reagent (Invitrogen). The total R N A was isolated from each tissue and relative quantitative two-step real-time R T P C R was performed and the expression levels o f the candidate genes were determined. The genes under investigation included early complement components C l q , M B L - A , and ficolins A and B ; the pentraxins serum amyloid P component ( S A P ) and pentraxin 3 (Ptx3); and heat shock protein 70 (Hsp70). In all the gene expression studies, the  75  Results  housekeeping gene glyceraldehyde-3 -phosphate dehydrogenase ( G A P D H ) expression levels were also determined and used to normalize the P C R data. A n additional control group was used to assess the impact o f Photofrin injection without light treatment on the expression levels o f the investigated genes.  5.1.1) Tumour The results i n Figure 5.1 show the G A P D H normalized gene expression values o f early complement components C l q , M B L - A , ficolins A and B ; pentraxins S A P and Ptx3; and Hsp70 in untreated and P D T treated tumours collected at 4, 8 and 24 hrs post light treatment. The results indicate that among the 7 genes studied, Hsp70, S A P , ficolin B and Ptx3 gene expression levels are maximally and significantly (P<0.05) up-regulated at 4 hrs, 24 hrs, 8 hrs and 4 hrs post treatment respectively. The relative tumour gene expression profiles for Hsp70, S A P , ficolin B and Ptx3 are shown in Figure 5.2. A l l illustrated relative gene expressions i n P D T treated tumours are compared to the levels i n untreated tumours. Hsp70 gene expression increased to as high as ~ 170-fold at 4 hrs post treatment relative to the expression level in untreated tumours. Thereafter, its upregulation gradually subsided and was only around 9-fold at 24 hrs after P D T . Relative S A P gene expression gradually increased to over 4-fold at 24 hrs. Ptx3 gene exhibited around 18-fold increase at 4 hrs post treatment relative to untreated tumours. Its levels subsequently subsided to ~ 3.6-fold at 8 hrs, and then to ~ 1.6-fold at 24 hrs after P D T . Ficolin B relative gene expression increased gradually reaching over 18-fold upregulation at 8 hrs post P D T and then subsided to less than 2-fold at 24 hrs after P D T .  76  Results  Gene Expression Values in Tumour m  Hsp70  Figure 5.1: The effect of tumour PDT on tumour-localized expression of genes encoding Hsp70, SAP, ficolin A & B, Ptx3, Clq and MBL-A. LLC tumours growing subcutaneously in C57B1/6J mice were treated with Photofrin-based PDT (Photofrin [10 mg/kg] injected intravenously; followed 24 hours later by tumour-localized light treatment, delivering a dose of 150 J/cm ). Tumours were excised at 4, 8 and 24 hours after PDT, total RNA was isolated using Trizol and relative quantitative two-step realtime RT-PCR was performed to analyze the expression levels of selected genes. All the samples were normalized to GAPDH expression levels. Bars are standard errors. 2  77  Results  Relative Gene Expression in Tumour _  I <5  1 J  io°  A  I  10 -i  m Hsp70  3  I _  W W W—4*  •  i  w—w W W—P-*  /// /// /// # w /// ss$ A A  A A A  A A A  A A  A  Figure 5.2: Relative gene expression profiles of Hsp70. SAP, ficolin B and Ptx3 in PDT-treated tumours. M i c e bearing L L C tumours were P D T treated and gene expression analysis o f tumour tissue was performed as described for Figure 5.1. Present are the values o f G A P D H normalized gene expression from Figure 5.1 relative to that in the untreated tumour samples. The inserted graph presents the same relative expression profiles for all the genes tested. * = time points at which these genes were expressed at statistically significantly different levels relative to the untreated tumour samples (P<0.05). Bars are standard errors.  78  Results  5.1.2) Liver Figure 5.3 shows theGAPDFf normalized gene expressions o f early complement components C l q , M B L - A , ficolins A and B ; pentraxins S A P and Ptx3; and Hsp70 i n livers o f naive (tumour-free) and tumour-bearing mice, collected at 4, 8 and 24 hrs post light treatment. The results indicate that among the 7 genes studied Hsp70, S A P and ficolin B gene expression levels were highly up-regulated after treatment. The relative liver expression profiles for these 3 genes are shown in Figure 5.4. A l l illustrated relative gene expressions i n livers o f P D T treated mice are compared to the levels in livers o f mice bearing untreated tumours. Ffsp70 gene expression levels were lower in livers o f naive mice. The expression levels reached a 17.6-fold increase at 4 hrs after P D T . Thereafter, Hsp70 gene up-regulation subsided to ~ 7-fold at 8 hrs and then to ~ 5-fold at 24 hrs after P D T . S A P gene expression was at 0.5-fold i n naive livers. The expression levels for this gene gradually increased reaching 1.5-fold at 4 hrs, ~ 7-fold at 8 hrs and 10-fold at 24 hrs after P D T . Ficolin B relative gene expression was negligible in nai've livers, where following P D T treatment, relative expression levels rose to 3-fold after 4 hrs, 4-fold after 8 hrs and finally to ~ 13-fold after 24 hrs.  79  Results  Gene Expression Values in Liver  Figure 5.3: The effect of P D T on the liver-localized expression of genes encoding Hsp70, S A P , ficolin A & B , Ptx3. C l q a n d M B L - A following the treatment. L L C tumours growing subcutaneously in C57B1/6J mice were treated with Photofrin-based P D T as described for Figure 5.1. M i c e were sacrificed 4, 8 and 24 hours after P D T . Total R N A was isolated from excised liver tissues using Trizol and relative quantitative twostep real-time R T - P C R was performed to analyze the expression levels o f selected genes. A l l the values were normalized with G A P D H . Bars are standard errors.  80  Results  Relative Gene Expression in Liver 22^ •o  o  121  25n  0) O)  c re  JZ 20' o  Hsp70  o  SAP  S isH UJ a> c  Ficolin B  ioH  / / / / A  vy  A  A  vv>  «^/// A  <^  A  <^  A -ci-  *  ^  A  A  <y  S T /  F i g u r e 5.4: P D T - i n d u c e d changes i n relative gene expression profiles for H s p 7 0 , S A P and ficolin B i n livers. Columns represent the values o f G A P D H normalized gene expressions from Figure 5.3 relative to that in the untreated samples. The inserted graph presents the same relative expression profiles for all the genes tested. * = time points at which these genes express statistically significant difference relative to the values from the livers o f untreated mice (P<0.05). Bars are standard errors.  si  Results I  5.1.3) Spleen Figure 5.5 shows the G A P D H normalized gene expression values for the early complement components C l q and ficolin B as well as for Hsp70 i n spleens o f untreated, and P D T treated mice. Spleens o f mice bearing PDT-treated tumours were collected at 4 and 24 hrs post light treatment. The results indicate that among the 3 genes studied, ficolin B and Hsp70 became up-regulated post treatment. The relative spleen gene expression profiles for Hsp70 and ficolin B are shown in Figure 5.6. A l l illustrated relative gene expressions i n spleens o f P D T treated mice are compared to the levels i n spleens o f untreated tumour-bearing mice. Hsp70 gene expression was at 0.5-fold in spleens o f naive mice. A t 4 hrs after P D T , it elevated slightly to 1.3-fold, but the levels dropped to 0.6-fold at 24 hrs after P D T . Ficolin B gene expression levels were found to increase 3-fold at 4 hrs after P D T , and subsequently eased to 2-fold at 24 hrs after P D T .  82  Results  Gene Expression Values in Spleen  F i g u r e 5.5: Expression levels of Hsp70, ficolin B and C l q genes i n the spleens of naive, untreated and P D T - t r e a t e d t u m o u r bearing mice. L L C tumours growing subcutaneously in C57B1/6J mice were treated with Photofrin-based P D T as described for Figure 5.1. M i c e were sacrificed at 4 and 24 hours after P D T . Total R N A was isolated from excised spleen tissues using Trizol and relative quantitative two-step real-time R T P C R was performed to analyze the expression levels o f selected genes. A l l the values were normalized to G A P D H . Bars are standard errors.  83  Results  Relative Gene Expression in Spleen  F i g u r e 5.6: P D T - i n d u c e d changes i n relative gene expression profiles for Hsp70 and ficolin B i n spleens. Columns represent the ratios o f G A P D H normalized gene expression shown in Figure 5.5 compared to that i n the spleens o f untreated tumourbearing mice. The inserted graph presents the same relative expression profiles for Hsp70, ficolin B and C1 q genes tested. * = points at which genes are expressed at statistically significantly different levels compared to the values from spleens taken from untreated mice ( P O . 0 5 ) . Bars are standard errors.  84  Results  In summary (table 5.1), the results demonstrate the up-regulation o f 3 out o f 7 investigated genes locally and systemically. Hsp70, S A P and ficolin B show both local (tumour) and systemic (liver and spleen) up-regulation i n response to P D T .  Although the Ptx3 gene was found to be highly expressed in P D T treated tumours, its systemic expression was maximal i n the livers o f untreated mice. Therefore, it is highly unlikely that Ptx3 is up-regulated systemically in response to P D T and consequently was not studied further.  4hrs  a  Spleent  Liver  NTissue Tumo ur 8hrs  a  24hrs  a  Cont" 4hrs  a  8hrs  a  24hrs  a  Cont  4hrs  b  a  24hrs  a  Gene Hsp70  167.8  123.6  8.8  0.4  17.6  6.7  4.6  0.5  1.3  0.6  SAP  1.2  -  4.2  0.5  1.5  6.7  9.9  -  -  -  Ficolin B  2.3  18.3  1.8  0.2  3.4  4.4  12.6  0.8  2.8  2.1  Ficolin A  0.8  -  1.1  1.7  1.5  -  1.7  -  -  -  Ptx3  18.0  3.6  1.6  0.2  0.9  0.6  0.4  -  -  -  Clq  0.2  -  0.4  0.9  1.0  -  1.6  1.3  1.3  0.9  MBL-A  0.6  0.4  0.3  1.2  2.4  -  2.1  -  -  -  Table 5.1: Summary of PDT-induced changes in the expression of investigated genes. This table is based on the results obtained with mice bearing L L C tumours treated by Photofrin-PDT. A l l gene expression data are first normalized by G A P D H and represent fold-changes relative to tumour-bearing untreated controls, a = time after P D T ; b = tumor-free control  85  Results  The results obtained with control groups consisting o f mice treated with Photofrin alone demonstrated that i n the absence o f light exposure the photosensitizing drug could not induce significant up-regulation o f these genes (Figure 5.7). The data even suggest a trend for Photofrin-induced down-regulation for liver Hsp70, tumour S A P and tumour ficolin B genes, but none o f the changes in the gene expression levels were statistically significant.  Relative G e n e E x p r e s s i o n after " P h o t o f r i n o n l y " T r e a t m e n t  -sr 2.5n  Hsp70 SAP  •D  2.0-  Ficolin B  IS  .2  1.5H  c  j |  1.1.  Figure 5.7: The effect of Photofrin treatment on the relative gene expression profiles of Hsp70, SAP and ficolin B in the liver and tumour. M i c e bearing L L C tumours were given an intravenous injection o f Photofrin [10 mg/kg]. The mice were sacrificed 24 hours later and tissues were excised for gene expression analysis as described for Figure 5.1. Columns represent the values o f G A P D H normalized gene expressions relative to that in Photofrin-untreated tumour bearing mice. Liver and tumour samples were from the same cohort o f mice. Bars are standard errors. N o changes i n gene expression levels are statistically significant.  86  Results  5.2) Hsp70, SAP and ficolin B genes are highly up-regulated in a PDT-treated Lewis Lung Carcinoma (LLC) cell line 5.2.1) PDT induces a pronounced Hsp70, SAP, and ficolin B gene expression up-regulations in LLC treated cells Values o f G A P D H normalized gene expressions o f Hsp70, S A P and ficolin B i n L L C cells collected 4 and 8 hrs after P D T relative to that in the untreated samples are shown i n Figure 5.8. Hsp70 gene expression is increased over 40-fold i n P D T treated L L C cells after 4 hrs. This increase was even more dramatic (close to 280-fold) at 8 hrs after P D T . Expression o f the S A P gene increased almost 12-fold i n P D T treated L L C cells after 4 hrs and over 90-fold in P D T treated L L C cells after 8 hrs. The ficolin B gene also showed increased expression in response to P D T treatment. Its expression levels increased close to 5-fold i n P D T treated L L C cells after 4 hrs and then over 80-fold i n P D T treated L L C cells after 8 hrs.  A control experiment was performed to check the effects o f the photosensitizing drug alone on the Hsp70, S A P and ficolin B gene expressions i n L L C cells grown in vitro. Following 24 hrs o f incubation with Photofrin at a final concentration o f 20 pg/mL, L L C cells were collected and total R N A was isolated. Two-step real-time R T - P C R revealed that Hsp70 and S A P gene expressions were not significantly influenced and ficolin B levels were even down-regulated in response to Photofrin.  87  Results  Relative Gene Expression in In Vitro LLC Cells  F i g u r e 5 . 8 : R e l a t i v e gene e x p r e s s i o n p r o f i l e s f o r H s p 7 0 . S A P a n d ficolin B i n P D T  t r e a t e d L L C cells. In vitro cultured L L C cells were exposed to Photofrin [20 pg/mL] for 24 hours and then treated with 630 ± lOnm light (1 J/cm ). Cells were collected at 4 or 8 hours after light treatment for determining the expression o f investigated genes by twostep real-time R T - P C R . Columns depict the values o f G A P D H normalized gene expressions relative to that in the untreated samples. * = points at which genes are expressed at statistically significantly different relative to their respective controls ( P O . 0 5 ) . Bars are standard errors. 2  88  Results  5.2.2) Up-regulation of SAP, and ficolin B genes in IC-21 cells coincubated with PDT-treated LLC cells Figure 5.9 shows the values o f G A P D H normalized gene expressions o f Hsp70, S A P and ficolin B i n IC-21 cells collected at 4 and 8 hrs after co-incubation with P D T treated L L C cells relative to that i n the IC-21 cells co-incubated with untreated L L C cells. W h i l e the Hsp70 relative gene expression exhibited no significant change after 4 and 8 hr co-incubation, the S A P relative gene expression increased almost 6-fold i n IC-21 cells co-incubated 4 hrs with P D T treated L L C cells. That level subsided almost to pretreatment levels during the next 4 hours. The ficolin B gene expression i n IC-21 cells coincubated for 4 hrs with PDT-treated L L C s showed no significant change but after 8 hours o f co-incubation it exhibited more then 2-fold up-regulation.  89  Results  Relative Gene Expression in In Vitro IC-21 Cells  F i g u r e 5 . 9 : R e l a t i v e g e n e e x p r e s s i o n p r o f i l e s f o r H s p 7 0 , S A P a n d f i c o l i n B i n IC-21 cells c o - i n c u b a t e d w i t h P D T t r e a t e d L L C cells. L L C cells growing in culture inserts  were treated by P D T as described for Figure 5.8, and the inserts were then transferred to dishes with IC-21 macrophages for 4 or 8 hr co-incubations. This was followed b y harvesting IC-21 cells for determining the expression o f investigated genes by two-step real-time R T - P C R . Columns present the values o f G A P D H normalized gene expressions relative to that i n the IC-21s incubated with untreated L L C s . * = time points at which these genes are expressed at statistically significantly different relative to their respective controls ( P O . 0 5 ) . Bars are standard errors.  90  Results  5.2.3) Presence of PDT-treated LLC cells induce up-regulation of Hsp70 gene in Hepa 1-6 cells The experiment involving co-incubation with PDT-treated L L C cells was also performed with Hepa 1-6 cells instead o f IC-21. Untreated and P D T treated L L C s were incubated for 4 and 8 hrs with Hepa 1-6 cells in the same manner as before. A t the end o f the 4 and 8 hr co-incubations, the Hepa 1-6 cells were collected and two-step real-time R T - P C R was performed on total R N A to analyze the gene expressions o f Hsp70, S A P and ficolin B . The results shown in Figure 5.10 illustrate the values o f G A P D H normalized gene expressions o f Hsp70, S A P and ficolin B i n Hepa 1-6 cells collected at 4 and 8 hrs after co-incubation relative to that in Hepa 1 -6 cells incubated with untreated L L C cells. Hsp70 relative gene expression in Hepa 1-6 cells increased 4-fold and 4.6-fold after 4 and 8 hr co-incubations, respectively. S A P gene expression remained close to pretreatment levels after 4 hr co-incubation and was remained at 0.7-fold relative to the control after 8 hr co-incubation, but this decrease was not statistically significant. Ficolin B gene expression did not change significantly after 4 and 8 hr co-incubations, remaining at ~ l - f o l d relative to the level in control Hepa 1-6 cells.  91  Results  Relative Gene Expression in In Vitro Hepa 1-6  F i g u r e 5 . 1 0 : R e l a t i v e gene e x p r e s s i o n p r o f i l e s f o r H s p 7 0 , S A P a n d f i c o l i n B i n H e p a 1-6 cells c o - i n c u b a t e d w i t h P D T t r e a t e d L L C s . F o l l o w i n g the procedure for co-  incubation with PDT-treated L L C cells described for Figure 5.9, Hepa 1-6 cells were harvested for two-step real-time R T - P C R . Columns present the ratio o f G A P D H normalized gene expressions relative to that in Hepa 1-6 cells incubated with untreated L L C s . * = point at which gene expression has statistically significant difference compared to the levels i n respective controls (P<0.05). Bars are standard errors.  92  Results  5.3) Systemic Hsp70, SAP and ficolin B gene expression upregulations are mediated partially by glucocorticoids (GCs) Since the observed changes o f the expression o f the investigated genes are typical o f an acute phase response which, in turn, is influenced b y corticoid hormones, we examined whether glucocorticoids have a direct impact on the expression o f these genes in the liver tissue.  5.3.1) The up-regulation of liver Hsp70 and SAP genes in mice treated by dexamethasone Twenty-four mature female tumour-free C57B1/6J mice were separated into 4 groups receiving treatments with either mifepristone, dexamethasone, dexamethasone + mifepristone (Dexa.+Mifep.) or vehicle (solvent) alone. Mifepristone, a competitive antagonist o f the glucocorticoid receptor, was injected subcutaneously at a 40 mg/kg dose known to be effective i n rodent models. Dexamethasone, a potent synthetic glucocorticoid, was injected intra-peritoneally at 40 pg/kg dose. For the combined treatment group, dexamethasone injection was followed immediately b y an injection o f mifepristone. The appropriate amounts o f dexamethasone and mifepristone were delivered i n 100 p L injection volumes per mouse. The purpose o f the vehicle control group was to determine the effects o f dexamethasone and mifepristone vehicles (solvents) on the expressions o f our genes o f interest. For the vehicle group, 100 p L o f P E G 4 0 0 with 2 % ethanol was injected subcutaneously followed b y 100 p L o f D 5 W diluted methanol injected intra-peritoneally per mouse. The mice were sacrificed and  93  Results  their livers excised at 4 hrs after the injections and homogenized i n T R I z o l ® Reagent (Invitrogen). Total R N A was isolated, relative quantitative two-step real-time R T - P C R was performed and the expression levels o f the Hsp70, S A P and ficolin B were determined. The housekeeping gene G A P D H expression levels were also determined and used to normalize the P C R data. The results shown i n Figure 5.11 show the G A P D H normalized gene expression values and relative fold changes o f Hsp70, S A P and ficolin B obtained in this experiment. The results indicate that liver Hsp70 and S A P genes were up-regulated by dexamethasone treatment and that this effect was inhibited by the glucocorticoid receptor antagonist, mifepristone. Ficolin B gene expression was not significantly affected by these treatments. The presented relative gene expressions are shown compared to the levels in the vehicle control group. Hsp70 gene expression increased 2-fold i n the livers o f mifepristone injected mice. Dexamethasone induced a strong up-regulation o f Hsp70 gene reaching almost 5-fold increase i n livers o f injected mice. Following the treatment with the combination o f dexamethasone and its receptor antagonist, liver Hsp70 expression levels increased only 1.4-fold compared to that o f the vehicle group.  S A P gene expression decreased 0.5-fold level in the livers o f mifeprsitone injected mice relative to those o f vehicle group. Injection o f dexamethasone induced ~ 4fold up-regulation o f this gene. The injections o f both dexamethasone and mifepristone resulted in the down-regulation o f liver S A P gene expression to 0.5-fold levels compared to that o f the vehicle group. Ficolin B relative gene expression in the livers o f treated mice appeared unaffected by the injection o f mifepristone, dexamethasone, or the  94  Results  combination o f both. Statistical analysis confirmed that the gene expressions o f Hsp70 and S A P in the dexamethasone group were significantly higher (P<0.05) compared to that in the mifepristone, their combination, and the vehicle control groups.  Relative G e n e E x p r e s s i o n in L i v e r  g io'4  Figure 5.11: The effect of dexamethasone. mifepristone and their combination on liver gene expression profiles for Hsp70, SAP and ficolin B. Mature C57B1/6 mice were injected with either dexamethasone [40 ug/kg, i.p.], mifepristone [40 mg/kg, s.c] or their combination. Four hours later, the mice were sacrificed, the livers excised and processed for real-time R T - P C R based analysis o f genes encoding Hsp70, S A P , and ficolin B . Columns represent the ratio o f G A P D H normalized gene expressions compared to that i n the control group (injected with solvent/vehicle only). The inserted graph represents absolute G A P D H - n o r m a l i z e d gene expression values for all the tested groups. * = statistically significant difference compared to respective vehicle controls (P<0.05). Bars are standard errors.  05  Results  5.3.2) Metyrapone prevents PDT-induced elevation of expression levels of the liver Hsp70, SAP and ficolin B genes Metyrapone is an inhibitor o f adrenal corticosteroid synthesis that is frequently used to block the production o f glucocorticoids in vivo. In our study, this drug was dissolved in P B S and injected intra-peritoneally at 100 mg/kg dose delivered i n 100 p L injections per mouse. The P D T group was treated with Photofrin-based P D T (Photofrin [10 mg/kg] injected intravenously; followed 24 hours later by tumour-localized light treatment, delivering a dose o f 150 J/cm ). For the metyrapone plus P D T group, 2  metyrapone was injected 15 minutes before the P D T light treatment. The treated mice were sacrificed and their livers were collected at 4 hrs post P D T and homogenized in T R I z o l ® Reagent. The total R N A was isolated, relative quantitative two-step real-time R T - P C R was performed and the expression levels o f the Hsp70, S A P and ficolin B genes were determined. Figure 5.12 illustrates the G A P D H normalized gene expression values and relative fold changes o f Hsp70, S A P and ficolin B in this experiment. The results indicate that PDT-induced elevation o f Hsp70, S A P and ficolin B gene expression levels were at least partially inhibited by the metyrapone treatment. A l l the relative gene expressions are compared to the levels in the livers o f the control group that consist o f mice bearing untreated tumours. The results show that the treatment o f tumours by P D T provoked an over 15-fold up-regulation o f the expression o f the Hsp70 gene i n the livers o f host mice. Metyrapone injection before P D T reduced this increase to 7-fold. Metyrapone injection alone caused no statistically significant effect on liver Hsp70 gene expression except for a trend suggesting a possibility o f a small increase (presumably a reflection o f non-specific stress). Liver S A P gene expression was also not significantly  96  Results  affected by metyrapone alone. The expression o f this gene increased almost 4-fold after P D T , but it should be kept i n mind that a 4-hour interval is not optimal for S A P . A metyrapone injection before P D T reduced the expression level increase to 2-fold. For both the Hsp70 and S A P genes, metyrapone treatment blocked the PDT-induced increase in expression levels by almost 50%. The ficolin B gene expression remained unchanged at about 0.8-fold i n the livers o f metyrapone treated mice relative to untreated mice. P D T increased the ficolin B expression levels to almost 13-fold in the livers o f treated mice. This increase was almost completely abrogated by metyrapone injection before P D T . The results suggest that metyrapone may have a more potent effect on ficolin B regulation than on Ffsp70 or S A P genes.  97  Results  Relative Gene Expression in Liver  Figure 5.12: Relative gene expression profiles for Hsp70, S A P and ficolin B i n livers of mice 4 hrs after P D T treatment and injection w i t h metyrapone. M i c e bearing subcutaneous L L C tumours were treated by P D T (as described for Figure 5.1), metyrapone [100 mg/kg, i.p.] or their combination (metyrapone injected 15 minutes before the onset o f P D T light treatment). The mice were sacrificed at 4 hours after P D T and their livers were taken for real-time R T - P C R based analysis o f the expression o f genes encoding Hsp70, S A P and ficolin B . Columns represent the ratio o f G A P D H normalized gene expressions compared to that in the untreated control group. The inserted graph presents the absolute GAPDH-normalized gene expression values for all the tested groups. * = statistically significant difference compared to untreated control group ( P O . 0 5 ) . ** = Statistically significant difference compared to P D T group (P<0.05). Bars are standard errors.  98  Results  5.4) Hsp70 proteins are produced and released from livers of PDT-treated mice, and travel and bind at the site of trauma To determine the impact o f induced Hsp70 gene expression up-regulation i n the livers o f P D T treated mice, the levels o f the protein product o f this gene were measured in the sera and liver samples taken from mice bearing PDT-treated tumours.  5.4.1) PDT-induced changes of serum Hsp70 levels Following standard P D T treatment o f L L C tumours performed as i n the previous experiments, blood was collected from the host mice at 4, 8, or 24 hours post therapy. For controls, blood was taken from naive tumour-free mice and mice bearing untreated tumours implanted into the cohort used for P D T treatment. Hsp70 protein concentration measurement i n sera derived from these blood samples was performed using a commercially available E L I S A kit. The results reveal that mean serum levels o f Hsp70, which were very low i n naive mice ~ [0.8 ng/mL] and may become slightly elevated (37% on average) in mice carrying untreated L L C tumours, show a rising trend at 4 hours after P D T followed by a downturn at 8 hours after P D T and further sharp drop at 24 hours after P D T (Figure 5.13). Serum Hsp70 levels at this last time-point reached statistically significant difference compared to the levels measured at earlier time-points and with untreated tumour controls. The E L I S A data suggests that Hsp70 protein is released i n the blood and is subsequently cleared by 24 hrs post P D T treatment, possibly by being sequestered at the site o f trauma.  Results  H s p 7 0 P r o t e i n L e v e l s in S e r u m  Figure 5.13: Hsp70 protein level profile in sera of naive, untreated and PDT treated mice. M i c e bearing subcutaneous LLC tumours were treated by PDT (as described for Figure 5.1), and their blood was collected at 4, 8 and 24 hours after PDT. B l o o d was also collected from tumour-free control mice and controls with untreated tumours. The serum samples were used for an ELISA-based Hsp70 protein measurement. * = statistically significant difference relative to that in the 24hrs after PDT group (P<0.05). Bars are standard errors.  100  Results  A n additional control experiment was performed to check the effects o f Photofrin alone on the Hsp70 protein levels in the sera. Eight mature female C57B1/6J mice bearing 8-10 m m subcutaneous L L C tumours were separated into 2 groups. One group was not treated and used as the untreated control. The remaining group was injected with Photofrin [10 mg/kg]. A t 24 hours following the intravenous Photofrin injection, blood samples were collected. The results o f Hsp70 E L I S A with sera from the collected blood indicate that i n the absence o f tumour light treatment Photofrin injection had no detectable impact on Hsp70 protein levels in the serum.  5.4.2) Liver Hsp70 protein levels decline after PDT M i c e bearing PDT-treated L L C tumours were sacrificed at 3, 5, or 9 hours after therapy and their livers excised. The concentration o f Hsp70 protein in liver tissue homogenates was determined using E L I S A . The results (Figure 5.14) show that liver Hsp70 levels sharply declined, with an over 30% drop evident at 3 hours post P D T and remained depressed even further at 9 hours post P D T .  101  Results  H s p 7 0 P r o t e i n L e v e l s i n L i v e r s In Vivo _  20(H  Figure 5.14: The effect of PDT  on liver Hsp70 protein levels. M i c e bearing subcutaneous LLC tumours were treated b y PDT as described for Figure 5.1. They were sacrificed at 3, 5 or 9 hours after therapy and their livers were taken for Hsp70 protein measurement based on E L I S A . * = statistically significant difference compared to pretreatment levels (P<0.05). Bars are standard errors.  102  Results  5.4.3) Ex-vivo incubation reveals that PDT induces Hsp70 protein production in host livers Halves o f the liver tissues collected from nai've, tumour untreated, 3 and 5 hr post P D T treated mice for the previous experiment were used i n the ex-vivo experiment, performed to test the possibility that Hsp70 proteins produced in the liver are i n fact being released into the body. Both control liver samples were incubated ex-vivo for 9 hrs at 37°C. The liver samples collected 3 and 5 hrs post P D T were incubated ex-vivo for 6 and 4 hrs respectively in order to keep the total post-therapy time interval to 9 hours. Following incubation, liver samples and tissue supernatants were collected for E L I S A , the results o f which are illustrated in Figure 5.15. In order to display the results as total Hsp70 protein, the liver tissues and their supernatants were processed together. The Hsp70 protein levels determined in samples taken from naive, tumour untreated and 3 hrs post P D T groups were very similar (around 65 ng per gram o f liver). However livers collected from 5 hrs post P D T sacrificed mice and further incubated 4 hrs ex-vivo, produced significantly higher levels o f Hsp70 protein.  103  Results  H s p 7 0 P r o t e i n L e v e l s i n L i v e r s Ex-Vivo  Figure 5.15: Hsp70 protein levels in livers of naive, tumour untreated and PDT treated mice incubated ex-vivo. M i c e bearing subcutaneous LLC tumours were treated by PDT as described for Figure 5.1 and sacrificed at either 3 or 5 hours later. Their livers were excised and incubated ex-vivo for the duration needed to reach the total post-PDT time interval o f 9 hours. Control livers from tumour-free mice and mice with untreated tumours were also included and incubated ex-vivo for 9 hours. Thereafter, liver samples and their supernatants were collected for ELISA-based Hsp70 measurement; the results are presented as total Hsp70 protein (liver plus supernatant). * = statistically significant difference compared to untreated group (P<0.05). Bars are standard errors.  104  Results  5.4.4) Exogenous Hsp70 protein is capable of binding to PDT-treated LLC cells The results o f the previous experiments had led us to hypothesize that Hsp70 was released into the circulation. To determine whether it can be attracted to damaged tumour tissue, we designed an in vitro experiment to test whether Hsp70 protein is capable o f binding to PDT-damaged L L C cells. In this experiment, Petri dishes with growing L L C cells were separated into 4 groups: Untreated L L C cells incubated without exogenous Hsp70 protein added; Untreated L L C cells incubated with exogenous Hsp70 protein added; P D T treated L L C cells without exogenous Hsp70 protein added; and P D T treated L L C cells with exogenous Hsp70 protein added. For P D T treatment, the cells were incubated with Photofrin [20 ng/mL] for 24 hours and then exposed to light [1 J/cm ]. Recombinant Hsp70 [10 (ig/sample] was added immediately after P D T and cells were left i n culture at 37°C for 3 hours. Cells were then collected, stained with F I T C conjugated antibody to Hsp70, and the levels o f Hsp70 protein bound to the surface o f L L C cells were detected using flow cytometry. A s illustrated i n Figure 5.16, both untreated groups with and without the added exogenous Hsp70 proteins presented a background fluorescence signal o f about 1.2 a.u./cell. The P D T group not receiving the exogenous Hsp70 proteins expressed a 3-fold increase i n Hsp70-associated fluorescence. This is i n accordance with earlier findings i n our laboratory that a fraction o f intracellular Hsp70 moves to the cell surface after P D T treatment [196]. However, the P D T group that received the exogenous Hsp70 protein expressed significantly higher fluorescence at 4.7 a.u./cell compared to that obtained with PDT-treated L L C cells without exogenous Hsp70 protein added. This demonstrates that Hsp70 proteins can bind to P D T damaged cells.  105  Results  Exogenous Hsp70 Binding to PDT Treated LLC Cells  Figure 5.16: Hsp70 protein added to culture m e d i u m binds to P D T - t r e a t e d L L C cells. L L C cells growing in vitro were treated by P D T as described for Figure 5.8. Immediately after P D T , recombinant mouse Hsp70 was added to the cell medium [10 pg/sample] and the cultures were further incubated at 37°C. Other experimental groups included PDT-untreated L L C kept with or without added Hsp70 and PDT-treated cells left without the addition o f Hsp70. After 3 hours o f incubation, cells were harvested, stained with FITC-conjugated anti-mouse Hsp70 antibody and surface expression o f Hsp70 was analyzed b y flow cytometry. The results show the extent o f Hsp70-associated fluorescence in arbitrary units per cell. * = value with statistically significant difference compared to that with PDT-treated cells not incubated with Hsp70. Bars are standard errors.  106  Results  5.4.5) Hsp70 binding to PDT-treated LLC cells includes linking to phosphatidylserine expressed on the cells Since Hsp70 was reported to bind phosphatidylserine [82], this experiment was performed to investigate the possible role o f cell surface exposed phosphatidylserine i n mediating the Hsp70 protein attachment to the P D T treated L L C s . Samples collected i n the previous experiment were also stained with fluorochrome bound annexin V to determine the levels o f annexin V binding to the P D T treated L L C s incubated for 3 hrs with and without exogenous Hsp70 protein added. A s illustrated i n Figure 5.17, the extent o f annexin V binding to P D T treated L L C s incubated with exogenous Hsp70 protein was significantly lower than with P D T treated L L C s incubated without exogenous Ffsp70 protein. This result suggests that Hsp70 proteins can bind to cells via the exposed phosphatidylserines on the cell membranes and therefore compete with annexin V for the available exposed phosphatidylserines. This i n turn explains the decrease i n the annexin V associated fluorescence observed i n the P D T treated L L C s incubated for 3 hrs with exogenous Hsp70 protein added versus the P D T treated L L C s incubated for 3 hrs without exogenous Hsp70 protein added.  107  Results  Annexin V Binding to PDT Treated LLC Cells  F i g u r e 5 . 1 7 : A n n e x i n V b i n d i n g to P D T - t r e a t e d L L C cells i n c u b a t e d w i t h o r w i t h o u t  a d d e d H s p 7 0 . PDT-treated cells were incubated with or without added Hsp70 as described for Figure 5.16. The cells were then collected, stained with phycoerythrinconjugated annexin V and analyzed by flow cytometry. The results show the extent o f annexin V associated fluorescence i n arbitrary units per cell. * = value statistically significantly different than the value obtained with other treatment group. Bars are standard errors.  108  Discussion  6) DISCUSSION 6.1) Thesis rationale When an organism is faced with a large number o f dead cells, impaired clearance o f this burden due to the absence o f early complement components and pentraxins could result i n an adaptive immune response. This possibility is supported by the very high correlations between C l q and serum amyloid P component ( S A P ) deficiencies and a predisposition to autoimmunity in both man and mouse, respectively [5, 6]. Therefore by creating large volumes o f dead tumour cells and manipulating the key proteins involved in their removal, we can promote an adaptive immune response against tumours. A s well modulating the early components o f the complement system and/or pentraxins could also elicit the desired tumour specific immunity.  The proposed underlying mechanism for this phenomenon is as follows: Apoptotic cells are highly efficient at regulating the series o f events that would ensure their disposal in a timely manner and without any immune complications in vivo. In vitro however, unphagocytosed apoptotic bodies as well as remaining cell fragments ultimately proceed to the secondary necrosis stage during which they swell and lyse. This scenario could also take place in vivo when the body is faced with abnormally large loads o f apoptotic cells and a defective removal capacity. Non-ingested PDT-induced apoptotic cancer cells can proceed to secondary necrosis when an influx o f water and extracellular ions mediate the swelling and eventual rupture o f the cells and their organelles. Released cytoplasmic contents inflict tissue damage and result in an intense inflammatory response [ 197-200]. Uptake o f post-apoptotic debris by phagocytes i n the presence o f  109  Discussion  inflammatory cytokines such as granulocyte-macrophage colony-stimulating factor ( G M C S F ) , tumour necrosis factor a ( T N F - a) and interleukin 1 (IL-1) [1], induce subsequent phagocyte activation/maturation and the release o f more inflammatory cytokines. Such events create the perfect condition for the engagement o f the adaptive immune system. During inflammation, D C s mature, express co-stimulatory signals and enhance their ability to cross-present antigens. After arriving at the lymph nodes, they may stimulate and activate T cells [18]. Activated T cells that express co-stimulatory molecules and cytokines help mature B cells that have taken up antigens from PDT-induced apoptotic cancer cells. The reactive B cells could then divide and mature into plasma cells and secrete cancer specific antibodies [1].  A m o n g the opsonins for apoptotic cells, complement factors including C l q , M B L , ficolins and complement-activating members o f the pentraxin family such as S A P , C R P and Ptx3 seem to play important roles [14]. Therefore i n this study mouse C l q , M B L - A and their homologues ficolin A & B ; pentraxins S A P and Ptx3; and Hsp70 were evaluated for their potential involvement i n the opsonization and removal o f P D T induced apoptotic cancer cells.  6.2) Opsonins with potential for removal of dying tumour cells The first objective o f this project was to determine the genes most involved i n the removal o f dead cells. In vivo gene expression studies were performed using Lewis L u n g Carcinoma tumours ( L L C ) grown in C57B1/6J mice. B y performing real-time P C R on different tissue samples collected from naive, untreated and P D T treated mice, expression  110  Discussion  levels o f the mentioned seven genes were evaluated. A m o n g these candidates, Hsp70, S A P and ficolin B showed statistically significant gene up-regulations at both the local P D T treated site (tumour) and at a distant systemic site (liver). Our findings i n combination with other studies w i l l demonstrate the significance o f these genes in the opsonization and removal o f apoptotic cells.  Evaluating the Hsp70, S A P and ficolin B gene expressions i n tumour, liver and spleen (figure 6.1) has helped us uncover other valuable information regarding some o f the principal organs responsible for their synthesis. Figure 6.1 A presents the Hsp70 expression values in tumours and livers o f nai've, untreated and PDT-treated mice. Interestingly, tumours and livers o f untreated mice expressed Ffsp70 at similar levels. A s expected, PDT-treated tumours became the main source o f Hsp70 expression after treatment. Despite this fact, tumours possessed the fastest rate o f Hsp70 down-regulation between 8 and 24 hrs post P D T (56-fold faster than that o f the liver). A s shown i n the graph, the tumour and liver Ffsp70 curves are on a collision course after 24 hrs. Assuming the expression rates would hold beyond the 24 hr time point, one can speculate that very soon the liver becomes the major contributor to Hsp70 expression. This would support our proposed hypothesis that there is a new role for Hsp70 as an acute phase protein.  Comparing PDT-induced up-regulation o f S A P i n the tumour and the liver reveals a 20000-fold greater expression level o f this gene in the liver (figure 6. I B ) . These results are i n agreement with pervious studies reporting S A P as a major mouse acute phase protein o f liver origin [201-203]. P D T treatment o f the tumour greatly stimulated S A P  Discussion  transcription i n the liver which was still on the rise 24hrs after termination o f the light treatment.  Comparison o f ficolin B expression i n the tumour, liver and spleen clearly identified the spleen as the major organ that transcribes this gene i n naive, untreated and PDT-treated mice (figure 6.1C). Previous reports had implicated spleen myeloid cell lineages i n ficolin B expression [204], which is also supported by our gene expression results. H i g h levels o f ficolin B expression were also detected i n tumours after P D T which might originate from tumour-infiltrating immune cells. T o the best o f our knowledge, this is the first time that up-regulation o f ficolin B has been reported i n a post-natal liver i n response to PDT-induced tumour trauma. Even more interesting is the fact that 24 hrs after treatment, the liver ficolin B expression is still on the rise while the spleen's and the tumour's have plateaued or subsided. A t 24 hrs the levels o f ficolin B i n the liver had even reached the levels i n the tumour. Observing such up-regulation at systemic sites including the spleen and liver fuel speculations that ficolin B also may be an acute phase protein.  112  Discussion  6.1A: Hsp70 Gene Expression Values 10- i 3  113  Discussion  6.1 C: Ficolin B Gene Expression Values  Figure 6.1: Photofrin-based PDT induces up-regulation of Hsp70, SAP and ficolin B genes following treatment. L L C tumours growing subcutaneously in C57B1/6J mice were treated with Photofrin-based P D T as described i n figure 5.1. A t 4, 8 and 24 hours post treatment, tumours, livers and spleens were excised. Total R N A was isolated and analyzed for the expression levels o f selected genes. Panel A : Ffsp70 expression levels i n tumours and livers. Panel B : S A P expression levels in tumours and livers. Panel C : Ficolin B expression levels in tumours, livers and spleens. A l l the samples are normalized with G A P D H . Bars are standard errors.  In order to identify the sources responsible for the elevated expressions o f Hsp70, S A P and ficolin B , in vitro gene expression studies were performed using mouse peritoneal macrophages (IC-21), mouse hepatomas (Hepa 1 -6) and the L L C tumour cell line. The three investigated genes were highly up-regulated in PDT-treated L L C cells, supporting their in vivo tumour up-regulation. Moreover, untreated macrophages upregulated S A P when co-incubated with P D T treated L L C cells, illustrating their ability to  114  Discussion  transcribe this gene remotely in response to trauma. Ficolin B also showed an increase (although modest) i n IC-21 cells, which would support the reports attributing ficolin B expression to myeloid cell lineages [204]. Since the liver is comprised o f three distinct cell types, one o f which is macrophage-like Kupffer cells [205], one can speculate that the observed liver ficolin B up-regulation may be due to transcription in these cells. U p o n co-incubation with PDT-treated L L C s , Hepa 1-6 cells up-regulated their Hsp70 gene expression further suggesting that the in vivo liver Hsp70 expressions is due to transcription in the hepatocytes.  U s i n g our in vitro co-incubation techniques, we have identified the possible sources responsible for the up-regulation o f Hsp70, S A P and ficolin B in vivo. A further significant finding o f this in vitro study is the ability o f Hsp70 and S A P to be upregulated remotely in untreated macrophages and hepatomas, further inferring the possibility o f these proteins to act as acute phase reactants.  6.3) Consequences of PDT-induced trauma: Initiation of A P R and activation of the HPA axis PDT-inflicted trauma initiates the acute phase response ( A P R ) which is a highly conserved sequence o f physiologic events that occur whenever a tissue injury is o f sufficient consequence to require a systemic response [206]. A s described i n more detail in the Introduction, A P R is characterized by metabolic and hormonal changes including immunological, neuroendocrinological and neurological modifications [207].  Discussion  One o f the immunological responses initiated by trauma is the production and release o f cytokines. These intercellular signaling proteins are regulators o f the host response to infection, inflammation, and trauma [208] and are the chief stimulators o f the A P R [209]. Besides having local effects mediating the inflammatory response to tissue injury, cytokines also initiate systemic changes. The primary cytokines engaged after trauma are interleukin-1 (IL-1) and tumour necrosis factor-a ( T N F - a). They are released from activated tissue macrophages and circulating monocytes in the damaged tissue. IL-1 and T N F - a subsequently stimulate the production and release o f more cytokines, i n particular interleukin-6 (IL-6), the main instigator o f A P R [210]. Consequently the liver is stimulated to begin de novo synthesis o f a wide variety o f proteins that are important for the protection o f the organism and restoration o f homeostasis [192]. The principal constituents o f these liver proteins are the acute phase reactants including C-reactive protein ( C R P ) , serum amyloid P component (SAP), and coagulation factors such as fibrinogen, a2-macroglobulin and many more. These molecules participate i n inflammatory mediation, scavenging and tissue repair [210]. Aside from triggering the production o f more cytokines, IL-1, T N F - a and IFN-y w i l l induce the expression o f proinflammatory mediators which include chemokines and enzymes such as type II phospholipase (PLA2), cyclooxygenase ( C O X ) - 2 and inducible nitric oxide synthase (iNOS). They also up-regulate endothelial adhesion molecules which are essential for the adhesion o f leukocytes prior to their emigration into tissues [208]. Consequences o f these events are elevated levels o f prostaglandins (PGE2), leukotrienes, nitric oxide (NO) and the migration o f activated neutrophils. These events collectively result i n inflammation, tissue destruction and loss o f function [208]. It is noteworthy to mention that P D T seems  116  Discussion  to trigger the inflammatory and the acute phase response regardless o f the targeted tissue. However the intensity o f these two responses is far less pronounced when a normal rather than a tumourous tissue is treated. PDT-induced inflammation o f tumour tissue is grater because o f a more prominent exhibition o f danger signal molecules i n cancerous tissue. A n example is the abundance o f alkyl-lipid derivatives (highly potent inflammatory/immune activators) among degradation products o membrane lipids that are hardly detectable i n the membranes o f normal cells [211]. A P R activation characterized b y serum S A P elevation was also reported following P D T treatment o f normal peritoneal tissue o f mice, but increase was around 10 times lower than previously documented after tumour P D T treatment [212]  The neuroendocrinological response is initiated by complex interplay between neural and circulatory events [192]. Afferent neural impulses and cytokines generated at the site o f injury can activate the hypothalamic-pituitary-adrenal (HP A ) axis. The neural inputs travel along sensory nerve roots through the dorsal root o f the spinal cord, up the spinal cord to the medulla to activate the hypothalamus [207]. Cytokines also act on the C N S to activate the H P A axis via a corticotrophin-releasing hormone ( C R H ) dependent/independent stimulation o f adrenocorticotropic hormone ( A T C H ) [114, 213, 214]. When the hypothalamus is appropriately activated, C R H is released into the pituitary portal veins and descends into the anterior pituitary. After binding to plasma membrane receptors, this 41 amino acid peptide stimulates the release and synthesis o f A C T H via calcium and cyclic A M P as second messengers [215]. A C T H is a 39 amino  Discussion  acid peptide that increases the synthesis and immediate release o f glucocorticoids (Cortisol), other hormones such as aldosterone, adrenal androgens and their precursors.  F i g u r e 6.2: T h e hypothalamic-pituitary-adrenal ( H P A ) axis. The H P A axis refers to the communication network between the hypothalamus, pituitary and the adrenal glands. It is linked with the immune response via a feedback loop in which specific cytokines signal the brain and activate the H P A axis. Following activation, there is an increase in Cortisol secretion which in turn feeds back and suppresses the immune reaction. Copyright © C N S f o r u m by The Lundbeck Institute.  Glucocorticoids ( G C ) act by binding to intra-cytoplasmic glucocorticoid receptors (GR). G C s enter target cells via facilitated diffusion and bind to their receptor at the carboxyl-terminus which contains an AF2 domain and is responsible for hormone binding [216, 217]. The mid-portion o f the G R contains a D N A binding structure consisting o f 2 zinc fingers. After binding, the G C - G R complex undergoes a conformational change and  118  Discussion  becomes activated during which it displaces a blocking protein from the receptor. Hsp90 is the blocking protein bound to the G R and it masks the nuclear localization signal necessary for the subsequent migration o f the activated G R to the nucleus. Upon removal o f Hsp90, the activated G R - G C complex translocates to the cell nucleus where it binds as a dimer to hormone regulatory elements on target D N A molecules and induces or represses their transcription [215, 218]. There are about 100 genes thought to be directly regulated b y glucocorticoids. There is evidence that the G C - G R complex also can indirectly regulate genes through induction o f anti-inflammatory proteins and transrepression mechanisms [219].  The presence o f G C response elements was found in the promoter regions o f some o f the hepatic acute-phase proteins [220]. Also, there is substantial experimental evidence to support the observation that G C s enhance cytokine, especially IL-6, effects on hepatic cell protein synthesis during the acute phase response [221]. For example, incubation o f human hepatic cells with 50-100 n M concentrations o f dexamethasone, markedly increased cytokine-induced transcriptional activation o f the serum amyloid A gene [222]. Additionally, a single intraperitoneal injection o f dexamethasone to normal rats increased 5-fold the hepatic IL-6 receptor m R N A in harvested hepatocytes within 12 hrs [223]. A n indirect contribution o f G C s to the synthesis o f acute-phase proteins is the ability o f these hormones to stimulate protein catabolism which frees up amino acids that may be used i n the liver to form new polypeptides, particularly acute-phase proteins [207].  119  Discussion  6.4) Glucocorticoid effects on Hsp70, SAP and ficolin B genes Since tumour P D T activates the hypothalamic-pituitary-adrenal ( H P A ) axis i n the host [224], we attempted to discover any links between H P A activation and the upregulation o f Hsp70, S A P and ficolin B seen i n the liver. A s mentioned before, G C s have considerable influence on liver metabolism, especially on gene regulation [220, 221]. Consequently we hypothesized that release o f glucocorticoids from the adrenal gland upon stimulation, may be responsible for the hepatic up-regulation o f these three genes. Authenticating our postulate, naive mice were injected with a synthetic glucocorticoid, dexamethasone, and its receptor antagonist, mifepristone, i n our first experiment. Liver samples were collected 4 hrs post injections and Hsp70, S A P and ficolin B gene expressions were measured. Administration o f dexamethasone indeed significantly increased the transcription o f Hsp70, and S A P . This effect is dexamethasone specific because injection o f mifepristone was able to inhibit the respective gene expressions.  In a complementary experiment, a glucocorticoid synthesis inhibitor, metyrapone, was administered to mice whose tumours were subsequently treated with P D T . In support o f our hypothesis, metyrapone down-regulated the expressions o f Hsp70 and S A P 4 hrs after light treatment. W e concluded that Hsp70 and S A P gene expressions are at least partially regulated b y glucocorticoids.  These two experiments, however, suggest that ficolin B may be regulated differently from Hsp70 and S A P . Interestingly, ficolin B seemed to be unaffected to stimulation with dexamethasone, mifepristone or the combination o f both. T w o  120  Discussion  possibilities may explain this. First, the concentrations o f the drugs used may not have been appropriate to stimulate a ficolin B response. Second, the hepatic up-regulation o f this gene may be dependent on more factors than just glucocorticoids. This latter scenario is supported by our second experiment, demonstrating the down-regulatory effects o f metyrapone on the hepatic gene expression levels o f ficolin B in mice carrying P D T treated tumours. A plausible explanation could be that the P D T treatment o f the tumour creates other necessary factors, complementing the glucocorticoid's stimulatory effects on hepatic ficolin B expression. Therefore exclusive injection o f dexamethasone may not be enough, however blocking the synthesis o f glucocorticoids may eliminate a crucial ingredient, resulting in the inhibitory effects o f metyrapone.  6.5) The many roles of heat shock protein 70 (Hsp70) Heat shock proteins (Hsp) are highly conserved polypeptides found i n all prokaryotic and eukaryotic organisms. A m o n g them, the Hsp70 family constitutes the most conserved and best studied group, consisting o f the stress-inducible Hsp70 (Hsp72: 72kDa), constitutively expressed Hsc70 (Hsp73: 73kDa), the mitochondrial Hsp75 (75kDa), and the endoplasmic reticulum(ER) Grp78 (78kDa) [81, 225]. In this study we have focused on the stress-inducible Hsp70.  Cellular levels o f Hsp70 are very low in un-stimulated cells, however, transcription and translation o f this protein is rapidly induced upon exposure to noxious stimuli [226]. The functions o f intracellular Hsp70 include chaperoning proteins, limiting protein aggregation and facilitating protein refolding [227]. These functions enable  121  Discussion  Hsp70 to protect and improve cell survival against a wide variety o f stressors [227]. Aside from its intracellular molecular chaperone modality, the evidence implicates Hsp70 in other roles depending on the context o f its localization and interaction. The immunological properties o f Hsps were proposed and demonstrated in the last two decades o f the 2 0 century. Specifically, Udono and Srivastava indicated that tumourth  derived Hsp70-peptide complexes are capable o f eliciting cancer specific immunity [87, 88]. A l s o it has been illustrated that this molecule can be expressed on outer cellular membranes [228-233] and even released from damaged cells [93, 234-236], including PDT-treated tumor cells [196]. Hsp70 cell surface localization has been recently verified on the cells o f primary human tumours (head and neck cancers) [228]. P D T , chemotherapy, radiotherapy and hyperthermia also increase surface expression o f this molecule on treated cancer cells [196, 228, 233]. M a n y studies have proposed different functions for surface Hsp70, including the stabilization and preservation o f lipid membrane integrity in the face o f deleterious circumstances [237]. These proteins have also been attributed to plasma membrane cation channel formation [238-240]. Y e t another group has suggested the transport o f Hsp70 as a part o f a larger molecular complex involved i n regulation o f certain surface receptors [230]. Release o f Hsp70 has been reported b y different groups [93, 235, 236, 241-244].  Other results indicate that released/extracellular Hsp70 fits the criteria o f an endogenous "danger signal". Postulated by Matzinger, [245, 246] the danger theory proposes that immune activation involves danger and non danger molecular schemas. It has been hypothesized that when the integrity o f the host is threatened by noxious  122  Discussion  stimuli, cells w i l l release endogenous stress and/or damaged self-proteins (danger signals) which would alert and activate the immune system [245, 246]. When incubated with antigen presenting cells ( A P C ) , extracellular Hsp70 molecules act as potent cytokines. Binding with high affinity to A P C s , exogenous Hsp70 elicit a rapid intracellular C a  2 +  flux; activate the  NF-KB  and its subsequent nuclear translocation;  augment the expression and release o f pro-inflammatory cytokines such as T N F - a , IL-1 P, IL-6 [95, 243, 247-249]; induce the release o f N O [250]; up-regulate co-stimulatory molecule expressions such as C D 8 0 and C D 8 6 [97, 99]; and bring about dendritic cell (DC) stimulation [95, 97, 251, 252]. Different receptors have been identified as participents in Hsp70-mediated signaling and uptake. Endocytotic receptors include C D 9 1 , L O X - 1 [94, 96, 253], whereas certain other receptors are specifically involved i n signaling (CD40, T L R - 2 / T L R - 4 ) [96, 97, 101 ].  U p o n further investigation, Hsp70 seems to be involved in more biological process than previously believed. For example, this protein has recently been implicated in binding selectively and with high affinity to phosphatidylserine moieties uncovered on damaged plasma membranes [82]. Moreover, Guzhova and colleagues discovered the presence o f antibodies against Hsp70 i n patients with autoimmune disease [236]. This evidence, together with studies demonstrating the PDT-mediated induction o f Hsp70 [151, 254], has induced us to pursue this protein as a possible candidate involved in the removal o f dead cells after P D T . Observing Hsp70's immune modulating roles, its ability to bind altered plasma membranes, its documented synthesis i n rodent liver i n response to  123  Discussion  exercise [255, 256] and its reported release into the circulation even i n the absence o f tissue injury [243], prompted us to hypothesize that Hsp70 may be an acute phase protein, released b y the liver into the circulation in response to stress.  6.6) Hsp70: Possible acute phase reactant and dead cell opsonin In order to confirm our hypothesis, subsequent experiments were performed. M i c e carrying L L C tumours were treated with Photofrin-based P D T and their livers were collected at 3, 5 and 9 hrs post light treatment. E L I S A was performed on the prepared liver homogenates. The results from these experiments illustrate an interesting trend. Liver Hsp70 protein levels were at their maximum concentrations in nai've and untreated tumor-bearing mice. Three hours after termination o f the light treatment, Hsp70 concentrations were significantly lower than i n the livers o f nai've and untreated mice. The levels recovered slightly at 5 hrs post P D T which corresponds to the in vivo liver Hsp70 gene up-regulations observed previously i n this study. Thereafter, Hsp70 dropped to a new significantly lower concentration compared to that in nai've livers. A plausible conclusion from these kinetics is the release o f Hsp70 by the liver into the circulation.  A parallel study was performed to capture any Hsp70 released from the liver. Appropriate liver sections from the mice used i n the previous experiment were further incubated ex-vivo upon excision. Hepatic fractions from nai've and untreated mice were incubated ex-vivo for 9 hrs. Those from mice sacrificed 3 and 5 hrs post light treatment were incubated for 6 and 4 hrs respectively. W e hypothesized that by incubating these  124  Discussion  liver sections ex-vivo, we would capture the released protein within the closed confinements o f the culture dish and accurately measure, using E L I S A , the amount o f Hsp70 that would have been released in vivo. Interestingly, there was a significant increase o f the liver Hsp70 levels collected 5 hrs post P D T which corresponds to the in vivo liver gene up-regulation seen 4 hrs post treatment. However to our surprise, there Was about a 62% drop in the level o f Hsp70 in the livers o f naive and untreated ex-vivo incubated samples compared to those observed in the in vivo experiment. This unexpected finding has complicated the interpretation o f the ex-vivo data. Further experiments are required to evaluate the rate o f loss o f Hsp70 during the incubation which would clarify our ex-vivo results.  The next step taken to better illustrate the release o f Hsp70 by the liver into the circulation was an experiment i n which serum samples from naive, untreated and P D T treated mice were analyzed using E L I S A . The tabulated serum Hsp70 graph resembles a bell-shaped curve which is inversely correlated to in vivo liver Hsp70 concentrations. Derived from the previous experiment, the in vivo hepatic Hsp70 levels were at their highest in livers o f naive mice. However, serum Hsp70 levels i n these mice were relatively low. This is logical because i n healthy mice there is no stress or trigger what would necessitate the release o f this stress-inducible protein. Livers o f untreated mice with tumors had the second highest concentration o f Hsp70. Moreover, serum samples taken from them had more Hsp70 than nai've animals. This might be due to the fact that the body senses the presence o f the tumour as a stressor, therefore signaling the release o f this protein from the liver. A t the 4 hr time point, hepatic Hsp70 levels were lower than  125  Discussion  the untreated. However serum collected 4 hrs after treatment contained the highest concentrations o f Hsp70. Since P D T is a modality inflicting trauma, treating the tumour would serve as a powerful inducer o f stress that may signal the release o f Hsp70 from the liver, explaining the relatively lower hepatic and higher serum levels o f Hsp70 protein. The same principle can be utilized to explain the liver and serum Hsp70 levels 8 hrs post P D T . However, there is a noticeable and important difference between the 4 and the 8 hr time points. A t 8 hrs, the hepatic Hsp70 levels declined compared to 4 hrs. Serum concentrations o f this protein-were also lower i n samples collected 8hrs post P D T . This suggests that Hsp70 was depleted from the blood. The serum collected 24 hrs post P D T also continues this trend. In fact the 24 hr serum samples contained significantly lower Hsp70 than that collected from nai've, untreated, 4 and 8 hr post P D T treated mice. Observing this interesting drop in concentration, and knowing that Hsp70 is capable o f binding to apoptotic cells [82], we hypothesized that blood Hsp70 is being attracted b y the PDT-damaged apoptotic cells. In order to address this hypothesis, an in vitro experiment was performed i n which L L C cells where treated with P D T and incubated i n the presence or absence o f exogenous Hsp70. After 3 hrs, samples were collected and Hsp70 bound to cell surfaces was measured using flow cytometry. The results indicated that indeed the levels o f membrane-bound Hsp70 are significantly higher i n the treated group incubated with exogenous Hsp70. To further explore this phenomenon and confirm the previously reported importance o f phosphatidylserine moieties i n this interaction [82], flow cytometry was extended by analyzing cells stained with fluorphore-conjugated annexin V . The significant decrease found i n the annexin V-associated fluorescence i n  126  Discussion  the "exogenous Hsp70 added" group confirms that this protein competes with annexin V for binding to phosphatidylserine on the cell membranes.  In summary, our studies have demonstrated that liver originated Hsp70 may be released into the circulation upon infliction o f PDT-induced trauma, and PDT-treated tumours appear to be the site absorbing this circulating Hsp70. This interaction is achieved at least i n part by the presentation o f phosphatidylserine on P D T damaged tumour cells and the affinity o f Hsp70 for such moieties presented on compromised cells.  127  Conclusion  7) CONCLUSION Photodynamic therapy is capable o f inflicting overwhelming trauma to the targeted solid cancer tumours. Faced with such tremendous injury, the body mounts array o f responses to engage and contain the damaged tissue. Tissue repair and reconstitution o f homeostasis, which are dependent on the proper disposal o f dead and damaged cells, soon follow. A subset o f the innate immune system and acute phase proteins are among the crucial participants in the removal o f dead cells. Absence and/or failure o f these players, including the early complement components and pentraxins, when faced with large loads o f apoptotic cells could result in the generation o f an adaptive immune response.  This phenomenon could be utilized to elicit cancer specific immunity b y manipulating the levels o f key proteins involved in the clearance o f PDT-induced apoptotic tumour cells. In order to achieve this, we examined the gene expressions o f the early complement components ( C l q , M B L - A and ficolins A & B ) , pentraxins ( S A P & Ptx3) and Hsp70 to determine the genes most involved in the removal o f apoptotic cells, and to establish an understanding o f the mechanisms responsible for the transcription o f these genes.  A m o n g the genes studied, Hsp70, S A P and ficolin B show gene expression upregulation at the local (tumour) and at the systemic (liver) sites and therefore appear to be the main candidates for the removal o f P D T killed cancer cells. It is interesting to note that PDT-damaged L L C cells highly up-regulate the expression o f Hsp70, S A P and  128  Conclusion  ficolin B genes, possibly to increase the efficiency o f their removal. The systemic upregulation o f these 3 genes are mediated at least in part by the activation o f the hypothalamic-pituitary-adrenal ( H P A ) axis and the release o f glucocorticoids which demonstrate the importance o f the systems and organs indirectly affected. Another significance o f this study is the demonstration o f a novel attribute o f the Hsp70 protein. Based on the results described here, Hsp70 may act as an acute phase protein involved in the opsonization o f dead cells.  129  Future Directions  8) FUTURE DIRECTIONS W e have only begun to explore the possibility o f eliciting an anti-tumour adaptive immune response by manipulation o f the innate immune system. There is strong evidence implicating the early complement components and pentraxins i n the development o f an adaptive immunity. Exploring this phenomenon, one would be tempted to try and utilize it as an arsenal in cancer immunotherapy.  In this thesis we have performed the pioneering work, studying the gene expressions o f the early complement proteins ( C l q , M B L - A , ficolins A & B ) , pentraxins ( S A P , Ptx3) and Hsp70. B y doing so, we discovered that Hsp70, S A P and ficolin B show significant gene up-regulation at the local PDT-treated (tumour) and at the systemic (liver) sites. Our results combined with those from previous studies suggest that Hsp70, S A P and ficolin B appear to be the main candidates for the removal o f P D T - k i l l e d cancer cells.  Despite these findings, much more remains to be elucidated. Further studies supplementing the results o f this project could be aimed at verifying the major candidates involved i n opsonization and removal o f dead cells. Although we looked at gene expressions o f the suspected players, other proteins may be stored i n protein deposits and discharged upon demand without prior up-regulation o f their respective genes. Therefore proteomic studies exploring such potentials are valuable.  130  Future Directions  The chief unanswered question is whether the genomic/proteomic manipulation o f the key candidates would have the desired immunological effects. In order to understand and interpret the results o f such studies, more insight into the mechanism o f action o f these proteins are needed. One such area o f research is the study o f the receptors involved and the consequences o f their engagement. A s demonstrated for Hsp70, six different receptors may contribute to a wide variety o f outcomes. The presence o f different combination o f receptors on distinct cells, at specific times, could spatially and temporally regulate the effects o f Hsp70. Therefore cataloguing the complement, pentraxin and Hsp70 receptors would help us to better understand and to ultimately achieve the desired immunological effects by manipulating these receptors and/or their expressing cells.  The ex-vivo Hsp70 E L I S A was performed to support the trends seen in vivo and also to validate our hypothesis that this stress-inducible protein is being released from the liver into the circulation. However, due to complications, the results o f the ex-vivo study is very hard to interpret. Further experiments would be helpful to calculate the rate o f loss o f Hsp70 ex-vivo. Tabulating this unknown would allow us to quantify the amount o f Hsp70 accumulated as the result o f synthesis. Other in vivo experiments using Colchicine-like drugs that would stop the export and/or release o f proteins from the liver could reveal the amount o f Hsp70 protein released into the circulation as a result o f P D T induced tumour trauma.  131  Future Directions  Issues to be taken into consideration when interpreting the results from this thesis are the animal and tumour models used. Although the murine immune system and murine tumours closely resemble those o f man, only clinical studies would demonstrate this with any certainty. Therefore it is the wish o f this author to be able to perform preliminary investigations on patients' samples in the near future.  132  References 1. 2.  3.  4.  5.  6.  7.  8.  9.  10.  11.  12.  13.  Walport M J , Complement- Second of Two Parts. N Engl J M e d , 2001. 344(15): p. 1140-1144. Nauta A J , Castellano G , X u W , Wormian A M , Borrias M C , Daha M R , van Kooten C , and Roos A , Opsonization with Clq and Mannose-Binding Lectin Targets Apoptotic Cells to Dendritic Cells. J Immunol, 2004. 173(5): p. 30443050. Korb L C and Ahearn J M , Clq binds directly and specifically to surface blebs of apoptotic human keratinocytes: complement deficiency and systemic lupus erythematosus revisited. J Immunol, 1997. 158(10): p. 4525-4528. Taylor P R , Carugati A , Fadok V A , Cook H T , Andrews M , Carroll M C , Savill JS, Henson P M , Botto M , and Walport M J , A Hierarchical Role for Classical Pathway Complement Proteins in the Clearance of Apoptotic Cells In Vivo. J. Exp. M e d . , 2000. 192(3): p. 359-366. Bickerstaff M C M , Botto M , Hutchinson W L , Herbert J, Tennent G A , Bybee A , Mitchell D A , Cook H T , Butler P J G , Walport M J , and Pepys M B , Serum amyloid P component controls chromatin degradation and prevents antinuclear autoimmunity. Nat M e d , 1999. 5(6): p. 694-697. Botto M , Dell' Agnola C , Bygrave A E , Thompson E M , Cook H T , Petry F , Loos M , Pandolfi P P , and Walport M J , Homozygous Clq deficiency causes glomerulonephritis associated with multiple apoptotic bodies. Nat Genet, 1998. 19(1): p. 56-59. Nauta A J , Daha M R , van Kooten C , and Roos A , Recognition and clearance of apoptotic cells: a role for complement and pentraxins. Trends i n Immunology, 2003. 24(3): p. 148-154. Stollar B , The antigenic potential and specificity of nucleic acids, nucleoproteins, and their modified derivatives. Arthritis & Rheumatism, 1981 Aug;24(8): p. 1010-8. Casciola-Rosen L A , Anhalt G , and Rosen A , Autoantigens targeted in systemic lupus erythematosus are clustered in two populations of surface structures on apoptotic keratinocytes. J. Exp. M e d . , 1994. 179(4): p. 1317-1330. U t z P J and Anderson P, Posttranslational protein modifications, apoptosis, and the bypass of tolerance to autoantigens. Arthritis & Rheumatism, 1998. 41(7): p. 1152-1160. Casciola-Rosen L A , M i l l e r D K , Anhalt G J , and Rosen A , Specific cleavage of the 70-kDa protein component of the Ul small nuclear ribonucleoprotein is a characteristic biochemical feature of apoptotic cell death. J. B i o l . Chem., 1994. 269(49): p. 30757-30760. Casciola-Rosen L A , Anhalt G J , and Rosen A , DNA-dependentprotein kinase is one of a subset of autoantigens specifically cleaved early during apoptosis. J. Exp. M e d . , 1995. 182(6): p. 1625-1634. Casiano C A , Martin SJ, Green D R , and Tan E M , Selective cleavage of nuclear autoantigens during CD95 (Fas/APO-1)- mediated T cell apoptosis. J. E x p . M e d . , 1996. 184(2): p. 765-770.  133  14.  15.  16.  17.  18.  19.  20. 21. 22. 23.  24.  25. 26.  27.  28.  Roos A , X u W , Castellano G , Nauta A J , Garred P, Daha Mohamed R, and van Kooten C , Mini-review: A pivotal role for innate immunity in the clearance of apoptotic cells. European Journal o f Immunology, 2004. 34(4): p. 921-929. M o r e l l i A E , Larregina A T , Shufesky W J , Zahorchak A F , Logar A J , Papworth G D , Wang Z , Watkins S C , Falo L D , Jr., and Thomson A W , Internalization of circulating apoptotic cells by splenic marginal zone dendritic cells: dependence on complement receptors and effect on cytokine production. Blood, 2003. 101(2): p. 611-620. Stuart L M , Lucas M , Simpson C , Lamb J, Savill J, and Lacy-Hulbert A , Inhibitory Effects of Apoptotic Cell Ingestion upon Endotoxin-Driven Myeloid Dendritic Cell Maturation. J Immunol, 2002. 168(4): p. 1627-1635. L i u K , Iyoda T, Saternus M , K i m u r a Y , Inaba K , and Steinman R M , Immune Tolerance After Delivery of Dying Cells to Dendritic Cells In Situ. J. Exp. M e d . , 2002. 196(8): p. 1091-1097. Inaba K , Turley S, Yamaide F, Iyoda T, Mahnke K , Inaba M , Pack M , Subklewe M , Sauter B , Sheff D , Albert M , Bhardwaj N , M e l l m a n I, and Steinman R M , Efficient Presentation of Phagocytosed Cellular Fragments on the Major Histocompatibility Complex Class II Products of Dendritic Cells. J. E x p . M e d . , 1998. 188(11): p. 2163-2173. van Nieuwenhuijze A E M , van Lopik T, Smeenk R J T , and Aarden L A , Time between onset of apoptosis and release of nucleosomes from apoptotic cells: putative implications for systemic lupus erythematosus. A n n Rheum D i s , 2003. 62(1): p. 10-14. Mollnes T E , Song W - C , and Lambris J D , Complement in inflammatory tissue damage and disease. Trends in Immunology, 2002. 23(2): p. 61-64. W a l p o r t M J , Complement- First of Two Parts. N Engl J M e d , 2001. 344(14): p. 1058-1066. Janeway C A , Immunobiology. 5 ed. 2001, N e w Y o r k : Garland Publishing. 43-64. Verbovetski I, Bychkov H , Trahtemberg U , Shapira I, Hareuveni M , Ben-Tal O, Kutikov I, G i l l O, and Mevorach D , Opsonization of Apoptotic Cells by Autologous iC3b Facilitates Clearance by Immature Dendritic Cells, Downregulates DR and CD86, and Up-regulates CC Chemokine Receptor 7. J. E x p . Med., 2002. 196(12): p. 1553-1561. Webb J H , B l o m A M , and Dahlback B , Vitamin K-Dependent Protein S Localizing Complement Regulator C4b-Binding Protein to the Surface of Apoptotic Cells. J Immunol, 2002. 169(5): p. 2580-2586. Carroll M C , The complement system in regulation of adaptive immunity. Nat Immunol, 2004. 5(10): p. 981-986. Hawlisch H , Wills-Karp M , Karp C L , and K o h l J, The anaphylatoxins bridge innate and adaptive immune responses in allergic asthma. Molecular Immunology, 2004. 41(2-3): p. 123-131. Fishelson Z , Donin N , Zell S, Schultz S, and Kirschfink M , Obstacles to cancer immunotherapy: expression of membrane complement regulatory proteins (mCRPs) in tumors. Molecular Immunology, 2003. 40(2-4): p. 109-123. Larsson M , Fonteneau JF, and Bhardwaj N , Dendritic cells resurrect antigens from dead cells. Trends in Immunology, 2001. 22(3): p. 141-148.  134  29. 30.  31.  32. 33. 34.  35.  36.  37. 38. 39.  40.  41. 42. 43.  44.  Rosen A and Casciola-Rosen L , Clearing the way to mechanisms of autoimmunity. Nat M e d , 2001. 7(6): p. 664-665. Rubartelli A , Poggi A , and Zocchi M , The selective engulfment of apoptotic bodies by dendritic cells is mediated by the alpha(v)beta3 integrin and requires intracellular and extracellular calcium. Eur J Immunology, 1997 Aug;27(8)(8): p. 1893-900. Albert M L , Pearce S F A , Francisco L M , Sauter B , R o y P, Silverstein R L , and Bhardwaj N , Immature Dendritic Cells Phagocytose Apoptotic Cells via alpha vbeta 5 and CD36, and Cross-present Antigens to Cytotoxic TLymphocytes. J. Exp. M e d . , 1998. 188(7): p. 1359-1368. Banchereau J and Steinman R M , Dendritic cells and the control of immunity. Nature, 1998. 392(6673): p. 245-252. Piacentini M and C o l i z z i V , Tissue transglutaminase: apoptosis versus autoimmunity. Immunology Today, 1999. 20(3): p. 130-134. Piredda L , Amendola A , C o l i z z i V , Davies P J A , Farrace M G , Fraziano M , Gentile V , Uray I, Piacentini M , and Fesus L , Lack of ^tissue' transglutaminase protein cross-linking leads to leakage of macromolecules from dying cells: relationship to development of autoimmunity in MRLlpr/lpr mice. C e l l Death & Differentiation, 1997. 4(6): p. 463. Navratil JS, Watkins S C , Wisnieski JJ, and Ahearn J M , The Globular Heads of Clq Specifically Recognize Surface Blebs of Apoptotic Vascular Endothelial Cells. J Immunol, 2001. 166(5): p. 3231-3239. M o l i n a H , Kinoshita T, Webster C B , and Holers V M , Analysis of C3b/C3d binding sites and factor I cofactor regions within mouse complement receptors 1 and 2. J Immunol, 1994. 153(2): p. 789-795. Carter R H and Fearon D T , CD19: lowering the threshold for antigen receptor stimulation of B lymphocytes. Science, 1992. 256(5053): p. 105-107. Carroll M C , The complement system in B cell regulation. Molecular Immunology, 2004. 41(2-3): p. 141-146. Kemper C , Chan A C , Green J M , Brett K A , Murphy K M , and Atkinson JP, Activation of human CD4+ cells with CD3 and CD46 induces a T-regulatory cell 1 phenotype. Nature, 2003. 421(6921): p. 388-392. Crass T, Raffetseder, U . , Martin, U . , Grove, M . , K l o s , A . , K o h l , J., Bautsch, W . , Expression cloning of the human C3a anaphylatoxin receptor (C3aR) from differentiated C-937 cells, Eur J Immunology, 1996 Aug;26(8)(8): p. 1944-50. Gerard N P and Gerard C , The chemotactic receptor for human C5a anaphylatoxin. Nature, 1991. 349(6310): p. 614-617. Braun M C , Lahey E , and Kelsall B L , Selective Suppression of IL-12 Production by Chemoattractants. J Immunol, 2000. 164(6): p. 3009-3017. Karp C L , Grupe A , Schadt E , Ewart S L , Keane-Moore M , Cuomo P J , K o h l J, W a h l L , Kuperman D , Germer S, A u d D , Peltz G , and W i l l s - K a r p M , Identification of complement factor 5 as a susceptibility locus for experimental allergic asthma. Nat Immunol, 2000. 1(3): p. 221-226. Wittmann M , Zwirner J, Larsson V - A , Kirchhoff K , Begemann G , Kapp A , Gotze O, and Werfel T, C5a Suppresses the Production of IL-12 by IFN-{gamma}-  135  45. 46.  47.  48.  49.  50.  51.  52.  53.  54.  55.  56.  Primed and Lipopolysaccharide-Challenged Human Monocytes. J Immunol, 1999. 162(11): p. 6763-6769. Gewurz H , Zhang X - H , and Lint T F , Structure and function of the pentraxins. Current Opinion i n Immunology, 1995. 7(1): p. 54-64. Steel D M and Whitehead A S , The major acute phase reactants: C-reactive protein, serum amyloid P component and serum amyloid A protein. Immunology Today, 1994. 15(2): p. 81-88. Bottazzi B , Vouret-Craviari V , Bastone A , De G i o i a L , Matteucci C , Peri G , Spreafico F , Pausa M , D'Ettorre C , Gianazza E , Tagliabue A , Salmona M , Tedesco F , Introna M , and Mantovani A , Multimer Formation and Ligand Recognition by the Long Pentraxin PTX3. SIMILARITIES AND DIFFERENCES WITH THE SHORT PENTRAXINS C-REACTIVE PROTEIN AND SERUM AMYLOID P COMPONENT. J. B i o l . Chem., 1997. 272(52): p. 32817-32823. Breviario F , d'Aniello E M , Golay J, Peri G , Bottazzi B , Bairoch A , Saccone S, Marzella R , Predazzi V , and Rocchi M , Interleukin-1-inducible genes in endothelial cells. Cloning of a new gene related to C-reactive protein and serum amyloid P component. J. B i o l . Chem., 1992. 267(31): p. 22190-22197. Familian A , Zwart B , Huisman H G , Rensink I, Roem D , Hordijk P L , Aarden L A , and Hack C E , Chromatin-Independent Binding of Serum Amyloid P Component to Apoptotic Cells. J Immunol, 2001. 167(2): p. 647-654. Gershov D , K i m S, Brot N , and Elkon K B , C-Reactive Protein Binds to Apoptotic Cells, Protects the Cells from Assembly of the Terminal Complement Components, and Sustains an Antiinflammatory Innate Immune Response: Implications for Systemic Autoimmunity. J. Exp. Med., 2000. 192(9): p. 13531364. Rovere P, Peri G , Fazzini F , Bottazzi B , Doni A , Bondanza A , Zimmermann V S , Garlanda C , Fascio U , Sabbadini M G , Rugarli C , Mantovani A , and Manfredi A A , The long pentraxin PTX3 binds to apoptotic cells and regulates their clearance by antigen-presenting dendritic cells. Blood, 2000. 96(13): p. 43004306. Mevorach D , Mascarenhas J O , Gershov D , and Elkon K B , Complementdependent Clearance of Apoptotic Cells by Human Macrophages. J. E x p . M e d . , 1998. 188(12): p. 2313-2320. Takizawa F , Tsuji S, and Nagasawa S, Enhancement of macrophage phagocytosis upon iC3b deposition on apoptotic cells. F E B S Letters, 1996. 397(2-3): p. 269272. M o l d C , Baca R, and D u Clos T W , Serum Amyloid P Component and C-Reactive Protein Opsonize Apoptotic Cells for Phagocytosis through FcfgammaJ Receptors. Journal o f Autoimmunity, 2002. 19(3): p. 147-154. Pepys M B , Baltz, M L . , Acute phase proteins with special reference to C-reactive protein and related proteins (pentaxins) and serum amyloid A protein. A d v Immunol., 1983. 34: p. 141-212. Pepys M B and Butler PJG, Serum amyloid P component is the major calciumdependent specific DNA binding protein of the serum. Biochemical and Biophysical Research Communications, 1987. 148(1): p. 308-313.  136  57.  58.  59.  60.  61.  62.  63.  64.  65. 66. 67.  68. 69.  70. 71.  Breathnach S M , Kofler H , Sepp N , Ashworth J, Woodrow D , Pepys M B , and Hintner H , Serum amyloid P component binds to cell nuclei in vitro and to in vivo deposits of extracellular chromatin in systemic lupus erythematosus. J. E x p . Med., 1989. 170(4): p. 1433-1438. Pepys M B , Booth, SE., Tennent, G A . , Butler, PJ., Williams, D G . „ Binding of pentraxins to different nuclear structures: C-reactive protein binds to small nuclear ribonucleoprotein particles, serum amyloid P component binds to chromatin and nucleoli. Clinical & Experimental Immunology, 1994 Jul;. 97(1): p. 152-7. Butler P J , Tennent G A , and Pepys M B , Pentraxin-chromatin interactions: serum amyloid P component specifically displaces HI-type histones and solubilizes native long chromatin. J. Exp. M e d . , 1990. 172(1): p. 13-18. Hicks P S , Saunero-Nava L , D u Clos T W , and M o l d C , Serum amyloid P component binds to histones and activates the classical complement pathway. J Immunol, 1992. 149(11): p. 3689-3694. Emsley J, White H E , O'Hara B P , Oliva G , Srinivasan N , Tickle IJ, Blundell T L , Pepys M B , and W o o d SP, Structure of pentameric human serum amyloid P component. Nature, 1994. 367(6461): p. 338-345. Schwalbe R A , Dahlbaeck B , Coe J E , and Nelsestuen G L , Pentraxin family of proteins interact specifically with phosphorylcholine and/or phosphorylethanolamine. Biochemistry, 1992. 31(20): p. 4907-4915. Seigneuret M and Devaux PF, ATP-Dependent Asymmetric Distribution of SpinLabeled Phospholipids in the Erythrocyte Membrane: Relation to Shape Changes. P N A S , 1984. 81(12): p. 3751-3755. Daleke D L and Huestis W H , Incorporation and translocation of aminophospholipids in human erythrocytes. Biochemistry, 1985. 24(20): p. 54065416. Connor J and Schroit A J , Determination of lipid asymmetry in human red cells by resonance energy transfer. Biochemistry, 1987. 26(16): p. 5099-5105. Zwaal R F A and Schroit A J , Pathophysiologic Implications of Membrane Phospholipid Asymmetry in Blood Cells. Blood, 1997. 89(4): p. 1121-1132. Martin SJ, Reutelingsperger C P , M c G a h o n A J , Rader J A , van Schie R C , LaFace D M , and Green D R , Early redistribution of plasma membrane phosphatidylserine is a general feature of apoptosis regardless of the initiating stimulus: inhibition by overexpression ofBcl-2 andAbl. J. Exp. M e d . , 1995. 182(5): p. 1545-1556. Volanakis J E and Wirtz K W A , Interaction of C-reactive protein with artificial phosphatidylcholine bilayers. Nature, 1979. 281(5727): p. 155-157. Robey F A , Jones K D , Tanaka T, and L i u T Y , Binding of C-reactive protein to chromatin and nucleosome core particles. A possible physiological role of Creactiveprotein. J. B i o l . Chem., 1984. 259(11): p. 7311-7316. D u Clos T W , C-reactive protein reacts with the Ul small nuclear ribonucleoprotein. J Immunol, 1989. 143(8): p. 2553-2559. Chang M - K , Binder C J , Torzewski M , and Witztum J L , From the Cover: Creactive protein binds to both oxidized LDL and apoptotic cells through recognition of a common ligand: Phosphorylcholine of oxidized phospholipids. P N A S , 2002. 99(20): p. 13043-13048.  137  72. 73.  74.  75.  76.  77. 78. 79. 80. 81. 82.  83.  84. 85.  86.  87.  V i k D , Munoz-Canoves, P., Chaplin, D D . , Tack, B F . , Factor H. Current Topics i n Microbiology and Immunology, 1990. 153: p. 147-62. Nauta A l m a J, Bottazzi B , Mantovani A , Salvatori G , Kishore U , Schwaeble W i l h e l m J, Gingras Alexandre R, Tzima S, Vivanco F , Egido J , Tijsma O , Hack C E , Daha M R , and Roos A , Biochemical and functional characterization of the interaction between pentraxin 3 and Clq. European Journal o f Immunology, 2003. 33(2): p. 465-473. Peri G , Introna M , Corradi D , Iacuitti G , Signorini S, Avanzini F , Pizzetti F, Maggioni A P , Moccetti T, Metra M , Cas L D , Ghezzi P, Sipe J D , R e G , Olivetti G , Mantovani A , and Latini R, PTX3, A Prototypical Long Pentraxin, Is an Early Indicator of Acute Myocardial Infarction in Humans. Circulation, 2000. 102(6): p. 636-641. Nauta A l m a J, Raaschou-Jensen N , Roos A , Daha Mohamed R, Madsen Hans O, Borrias-Essers Maria C , Ryder Lars P, K o c h C , and Garred P, Mannose-binding lectin engagement with late apoptotic and necrotic cells. European Journal o f Immunology, 2003. 33(10): p. 2853-2863. Srivastava P K , Menoret A , Basu S, Binder R J , and McQuade K L , Heat Shock Proteins Come of Age: Primitive Functions Acquire New Roles in an Adaptive World. Immunity, 1998. 8(6): p. 657-665. Beck G and Habicht G S , Immunity and the invertebrates. Scientific American, 1996. 275(5): p. 60. Craig E A and Gross C A , Is hsp70 the cellular thermometer? Trends in Biochemical Sciences, 1991. 16: p. 135-140. Lindquist S and Craig E A , The Heat-Shock Proteins. Annual Review o f Genetics, 1988. 22(1): p. 631-677. De M a i o A , Heat shock proteins: facts, thoughts, and dreams. Shock, 1999 Jan. 11(1): p. 1-12. Jaattela M , Heat shock proteins as cellular lifeguards. A n n M e d . , 1999 A u g . 31(4): p. 261-71. Arispe N , D o h M , Simakova O, Kurganov B , and De M a i o A , Hsc70 andHsp70 interact with phosphatidylserine on the surface of PCI 2 cells resulting in a decrease of viability. F A S E B J., 2004. 18(14): p. 1636-1645. Morimoto R I , Heat shock: the role of transient inducible responses in cell damage, transformation, and differentiation. Cancer Cells, 1991 A u g . 3(8): p. 295-301. W e l c h W , How cells respond to stress. Scientific A m e r i c a n . , 1993 M a y . 268(5): p. 56-64. Beckmann R P , M i z z e n L E , and Welch W J , Interaction of Hsp 70 with newly synthesized proteins: implications for protein folding and assembly. Science, 1990. 248(4957): p. 850-854. Blachere N E , L i Z , Chandawarkar R Y , Suto R, Jaikaria N S , Basu S, Udond H , and Srivastava P K , Heat Shock Protein-Peptide Complexes, Reconstituted In Vitro, Elicit Peptide-specific Cytotoxic T Lymphocyte Response and Tumor Immunity. J. E x p . M e d . , 1997. 186(8): p. 1315-1322. Udono H and Srivastava P K , Heat shock protein 70-associated peptides elicit specific cancer immunity. J. Exp. M e d . , 1993. 178(4): p. 1391-1396.  138  88.  89.  90.  91.  92.  93.  94.  95.  96.  97.  98.  99. 100. 101.  102.  Udono H and Srivastava P K , Comparison of tumor-specific immunogenicities of stress-induced proteins gp9 6, hsp90, and hsp70. J Immunol, 1994. 152(11): p. 5398-5403. Udono H , Levey D L , and Srivastava P K , Cellular Requirements for TumorSpecific Immunity Elicited by Heat Shock Proteins: Tumor Rejection Antigen gp96 Primes CD8+ T Cells in vivo. P N A S , 1994. 91(8): p. 3077-3081. Roman E and Moreno C , Synthetic peptides non-covalently bound to bacterial hsp&nbsp;70 elicitpeptide-specific T-cell responses in vivo. Immunology, 1996. 88(4): p. 487-492. Tamura Y , Peng P, L i u K , Daou M , and Srivastava P K , Immunotherapy of Tumors with Autologous Tumor-Derived Heat Shock Protein Preparations. Science, 1997. 278(5335): p. 117-120. Srivastava P K , Udono H , Blachere N E , and L i Z , Heat shock proteins transfer peptides during antigen processing and CTL priming. Immunogenetics, 1994. 39(2): p. 93-98. Dybdahl B , Wahba A , Lien E , Flo T H , Waage A , Qureshi N , Sellevold O F M , Espevik T, and Sundan A , Inflammatory Response After Open Heart Surgery: Release of Heat-Shock Protein 70 and Signaling Through Toll-Like Receptor-4. Circulation, 2002. 105(6): p. 685-690. Delneste Y , Magistrelli G , Gauchat J-F, Haeuw J-F, A u b r y J-P, Nakamura K , Kawakami-Honda N , Goetsch L , Sawamura T, Bonnefoy J - Y , and Jeannin P, Involvement of LOX-1 in Dendritic Cell-Mediated Antigen Cross-Presentation. Immunity, 2002. 17(3): p. 353-362. Asea A , Kraeft S - K , Kurt-Jones E A , Stevenson M A , Chen L B , Finberg R W , K o o G C , and Calderwood S K , HSP70 stimulates cytokine production through a CD14dependant pathway, demonstrating its dual role as a chaperone and cytokine. Nat M e d , 2000. 6(4): p. 435-442. Becker T, Haiti F U , and Wieland F , CD40, an extracellular receptor for binding and uptake ofHsp70-peptide complexes. J. C e l l B i o l . , 2002. 158(7): p. 12771285. Asea A , Rehli M , Kabingu E , B o c h J A , Bare O, Auron P E , Stevenson M A , and Calderwood S K , Novel Signal Transduction Pathway Utilized by Extracellular HSP70. ROLE OF Toll-LIKE RECEPTOR (TLR) 2 AND TLR4. J. B i o l . Chem., 2002. 277(17): p. 15028-15034. Berwin B H J , Rice S, Gass C , Pizzo S V , Post SR, Nicchitta C V . , Scavenger receptor-A mediates gp96/GRP94 and calreticulin internalization by antigenpresenting cells. E M B O J., 2003 N o v 17. 22(22): p. 6127-36. Binder R J , Vatner R, and Srivastava P, The heat-shock protein receptors: some answers and more questions. Tissue Antigens, 2004. 64(4): p. 442-451. Binder R J , Han D K , and Srivastava P K , CD91: a receptor for heat shock protein gp96. Nat Immunol, 2000. 1(2): p. 151-155. Vabulas R M , Ghose S, Ahmad-Nejad P, Kirschning C J , Issels R D , and Wagner H , HSP70 as Endogenous Stimulus of the Toll/Interleukin-1 Receptor Signal Pathway. J. B i o l . Chem., 2002. 277(17): p. 15107-15112. Kushner I, THE PHENOMENON OF THE ACUTE PHASE RESPONSE*. Annals o f the N e w Y o r k Academy o f Sciences, 1982. 389(1): p. 39-48.  139  103.  104.  105.  106.  107. 108.  109.  110.  111.  112.  113.  114. 115.  116.  Castell L M , Poortmans JR, Leclercq R, Brasseur M , Duchateau J, and Newsholme E A , Some aspects of the acute phase response after a marathon race, and the effects of glutamine supplementation. European Journal o f Applied Physiology, 1996. 75(1): p. 47-53. L e M a y L G , Vander A J , and Kluger M J , The effects of psychological stress on plasma interleukin-6 activity in rats. Physiology & Behavior, 1990. 47(5): p. 957961. Buchwald D , Wener M H , Pearlman T, and K i t h P, Markers of inflammation and immune activation in chronic fatigue and chronic fatigue syndrome. J Rheumatol., 1997 Feb. 24(2): p. 372-6. Kushner I and Rzewnicki D , Acute Phase Response, i n Inflammation: Basic Principles and Clinical Correlates, Gallin JI and Snyderman R, Editors. 1999, Lippincott W i l l i a m s & Wilkins: Philadelphia, p. 317-329. Colten H R , Tissue-specific regulation of inflammation. J A p p l Physiol, 1992. 72(1): p. 1-7. Zuraw B L and Lotz M , Regulation of the hepatic synthesis of CI inhibitor by the hepatocyte stimulating factors interleukin 6 and interferon gamma. J. B i o l . Chem., 1990. 265(21): p. 12664-12670. Garcia de Frutos P, A l i m RI, Hardig Y , Zoller B , and Dahlback B , Differential regulation of alpha and beta chains of C4b-binding protein during acute-phase response resulting in stable plasma levels of free anticoagulant protein S. Blood, 1994. 84(3): p. 815-822. Ezekowitz R A , Day L E , and Herman G A , A human mannose-bindingprotein is an acute-phase reactant that shares sequence homology with other vertebrate lectins [published erratum appears in J Exp Med 1991 Sep 1;174(3):753]. J. Exp. M e d . , 1988. 167(3): p. 1034-1046. Beauchamp R D , Sheng H M , A l a m T, Townsend C M , Jr., and Papaconstantinou J, Posttranscriptional regulation of albumin and alpha-fetoprotein messenger RNA by transforming growth factor-beta 1 requires de novo RNA and protein synthesis. M o l Endocrinol, 1992. 6(11): p. 1789-1796. Bartalena L , Farsetti A , Flink IL, and Robbins J, Effects of interleukin-6 on the expression of thyroid hormone-binding protein genes in cultured human hepatoblastoma-derived (Hep G2) cells. M o l Endocrinol, 1992. 6(6): p. 935-942. W o l f M , B o h m S, Brand M , and Kreymann G , Proinflammatory cytokines interleukin 1 beta and tumor necrosis factor alpha inhibit growth hormone stimulation of insulin-like growth factor I synthesis and growth hormone receptor mRNA levels in cultured rat liver cells. Eur J Endocrinol, 1996. 135(6): p. 729737. Chrousos G P , The Hypothalamic-Pituitary-Adrenal Axis and Immune-Mediated Inflammation. N Engl J M e d , 1995. 332(20): p. 1351-1363. Grunfeld C , Soued M , A d i S, Moser A H , Fiers W , Dinarello C A , and Feingold K R , Interleukin 4 Inhibits Stimulation of Hepatic Lipogenesis by Tumor Necrosis Factor, Interleukin 1, and Interleukin 6 but not by Interferon-falpha}. Cancer Res, 1991. 51(11): p. 2803-2807. Liao W and Floren C H , Hyperlipidemic response to endotoxin—a part of the hostdefence mechanism. Scand J Infect Dis., 1993. 25(6): p. 675-82.  140  117. 118.  119.  120.  Daniell M D and H i l l JS, A history of photodynamic therapy. Aust N Z J Surg., 1991 M a y . 61(5): p. 340-8. A c k r o y d R , Kelty C , Brown N , and Reed M , The History of Photodetection and Photodynamic Therapy&para. Photochemistry and Photobiology, 2001. 74(5): p. 656-669. Dolmans D E J G J , Fukumura D , and Jain R K , PHOTODYNAMIC THERAPY FOR CANCER. Nature Reviews Cancer, 2003. 3(5): p. 380-387.  Schwartz S K , A b o l o n K , and Vermund H , Some relationships of porphyrins, Xrays and tumors. Univ. M i n n . M e d . B u l l . , 1955. 27: p. 7-8.  121. 122. 123.  124.  125.  126.  127.  128.  129.  130.  131. 132.  133.  Lipson R L and Baldes E J , The photodynamic properties of a particular hematoporphyrin derivative. A r c h Dermatol., 1960 Oct. 82: p. 508-16. Lipson R L , Baldes E J , and Olsen A M , The use of a derivative ofhematoporhyrin in tumor detection. J Natl Cancer Inst., 1961 Jan. 26: p. 1-11. Diamond I, M c D o n a g h A , Wilson C , Granelli S, Nielsen S, and Jaenicke R , PHOTODYNAMIC THERAPY OF MALIGNANT TUMOURS. The Lancet, 1972. 300(7788): p. 1175-1177. Dougherty T J , Grindey G B , Fiel R , Weishaupt K R , and Boyle D G , Photoradiation therapy. II. Cure of animal tumors with hematoporphyrin and light. J Natl Cancer Inst, 1975 Jul. 55(1): p. 115-21. K e l l y JF and Snell M E , Hematoporphyrin derivative: a possible aid in the diagnosis and therapy of carcinoma of the bladder. J Urol., 1976 Feb. 115(2): p. 150-1. Dougherty T J , Kaufman J E , Goldfarb A , Weishaupt K R , Boyle D , and Mittleman A , Photoradiation Therapy for the Treatment of Malignant Tumors. Cancer Res, 1978. 38(8): p. 2628-2635. M o a n J and Berg K , The photodegradation of porphyrins in cells can be used to estimate the lifetime of singlet oxygen. Photochemical & Photobiological Sciences, 1991 A p r . 53(4): p. 549-53. Laukka M A , Wang K K , and Bonner J A , Apoptosis occurs in lymphoma cells but not in hepatoma cells following ionizing radiation and photodynamic therapy. Digestive Diseases and Sciences, 1994. 39(11): p. 2467-2475. Heckenkamp J, Leszczynski D , Schiereck J, K u n g J, and LaMuraglia G M , Different Effects of Photodynamic Therapy and {gamma}-Irradiation on Vascular Smooth Muscle Cells and Matrix : Implications for Inhibiting Restenosis. Arterioscler Thromb Vase B i o l , 1999. 19(9): p. 2154-2161. Korbelik M and Dougherty G J , Photodynamic Therapy-mediated Immune Response against Subcutaneous Mouse Tumors. Cancer Res, 1999. 59(8): p. 1941-1946. Gollnick SO, Vaughan L , and Henderson B W , Generation of Effective Antitumor Vaccines Using Photodynamic Therapy. Cancer Res, 2002. 62(6): p. 1604-1608. Hopper C , Kiibler A , Lewis H , Tan I B , and Putnam G , mTHPC-mediated photodynamic therapy for early oral squamous cell carcinoma. International Journal o f Cancer, 2004. 111(1): p. 138-146. Dougherty T J , Gomer C J , Henderson B W , Jori G , Kessel D , Korbelik M , M o a n J, and Peng Q, Photodynamic therapy. J. Natl. Cancer Inst., 1998. 90(12): p. 889905.  141  134. 135. 136.  137.  138.  139.  140.  141. 142.  143. 144.  145. 146.  147.  148.  149.  Hopper C, Photodynamic therapy: a clinical reality in the treatment of cancer. The Lancet Oncology, 2000. 1(4): p. 212-219. McBride G, Studies Expand Potential Uses of Photodynamic Therapy. J. Natl. Cancer Inst., 2002. 94(23): p. 1740-1742. Brown SB, Brown E A , and Walker I, The present and future role of photodynamic therapy in cancer treatment. The Lancet Oncology, 2004. 5(8): p. 497-508. Cramers P, Ruevekamp M , Oppelaar H, Dalesio O, Baas P, and Stewart FA, Foscan (R) uptake and tissue distribution in relation to photodynamic efficacy. British Journal of Cancer, 2003. 88(2): p. 283-290. Ris HB, Altermatt HJ, Inderbitzi R, Hess R, Nachbur B, Stewart J C M , Wang Q, Lim C K , Bonnett R, Berenbaum M C , and Althaus U , Photodynamic Therapy with Chlorins for Diffuse Malignant Mesothelioma - Initial Clinical-Results. British Journal of Cancer, 1991. 64(6): p. 1116-1120. Korbelik M and Cecic I, Mechanism of Tumor Destruction by Photodynamic Therapy, in Handbook of Photochemistry and Photobiology, Nalwa HS, Editor. 2003, American Scientific Publishers: Stevenson Ranch, C A . p. 39-77. Pangburn M K , Pangburn K L W , Koistinen V , Meri S, and Sharma A K , Molecular Mechanisms of Target Recognition in an Innate Immune System: Interactions Among Factor H, C3b, and Target in the Alternative Pathway of Human Complement ,2. J Immunol, 2000. 164(9): p. 4742-4751. Korbelik M , Sun J, and Zeng H, Ischaemia-reperfusion injury in photodynamic therapy-treated mouse tumours. British Journal of Cancer, 2003. 88(5): p. 760. Ryter SW and Gomer CJ, Nuclear Factor Kappa-B Binding-Activity in Mouse LI210 Cells Following Photofrin Ii-Mediated Photosensitization. Photochemistry and Photobiology, 1993. 58(5): p. 753-756. Cecic I and Korbelik M , Mediators of peripheral blood neutrophilia induced by photodynamic therapy of solid tumors. Cancer Letters, 2002. 183(1): p. 43-51. Sun J, Cecic I, Parkins CS, and Korbelik M , Neutrophils as inflammatory and immune effectors in photodynamic therapy-treated mouse SCCVII tumours. Photochemical & Photobiological Sciences, 2002. 1(9): p. 690-695. Henderson B W and Dougherty TJ, How Does Photodynamic Therapy Work. Photochemistry and Photobiology, 1992. 55(1): p. 145-157. Agarwal M L , Larkin HE, Zaidi SIA, Mukhtar H, and Oleinick N L , Phospholipase Activation Triggers Apoptosis in Photosensitized Mouse Lymphoma Cells. Cancer Res, 1993. 53(24): p. 5897-5902. Xue L Y , He J, and Oleinick N L , Rapid tyrosine phosphorylation ofHSl in the response of mouse lymphoma L5178Y-R cells to photodynamic treatment sensitized by the phthalocyanine Pc 4. Photochemical & Photobiological Sciences, 1997 Jul. 66(1): p. 105-13. Ochsner M , Photophysical and photobiological processes in the photodynamic therapy of tumours. Journal of Photochemistry and Photobiology B: Biology, 1997. 39(1): p. 1-18. Penning L C , Keirse M J , VanSteveninck J, and Dubbelman T M , Ca(2 r)-mediated prostaglandin E2 induction reduces haematoporphyrin-derivative-induced J  142  150.  151.  152. 153. 154.  155. 156.  157.  158.  159.  160. 161.  162.  163. 164.  cytotoxicity of T24 human bladder transitional carcinoma cells in vitro. Biochem. J., 1993. 292(1): p. 237-0. Haliday E M , Ramesha CS, and Ringold G, TNF induces c-fos via a novel pathway requiring conversion of arachidonic acid to a lipoxygenase metabolite. E M B O J., 1991 Jan. 10(1): p. 109-15. Gomer CJ, Ryter SW, Ferrario A , Rucker N , Wong S, and Fisher A M R , Photodynamic Therapy-mediated Oxidative Stress Can Induce Expression of Heat Shock Proteins. Cancer Res, 1996. 56(10): p. 2355-2360. Luna M C , Wong S, and Gomer CJ, Photodynamic Therapy Mediated Induction of Early Response Genes. Cancer Res, 1994. 54(5): p. 1374-1380. Wisdom R, AP-1: One Switch for Many Signals. Experimental Cell Research, 1999. 253(1): p. 180-185. Cooper NR, Biology of the Complement System, in Inflammation: Basic Principles and Clinical Correlations, Gallin JI, Snyderman, Ralph., Editor. 1999, Lippincott Williams & Wilkins: Philadelphia, p. 281-315. Lambris JD and Holers V M , eds. Therapeutic Interventions in the Complement System. 2000, Humana Press: Totowa, NJ. Collard CD, Lekowski R, Jordan JE, Agah A , and Stahl GL, Complement activation following oxidative stress. Molecular Immunology, 1999. 36(13-14): p. 941-948. Kilgore KS, Todd III RF, and Lucchesi BR, Reperfusion Injury, in Inflammation: Basic Principles and Clinical Correlates, Gallin JI and Snyderman R, Editors. 1999, Lippincott Williams & Wilkins: Philadelphia, p. 1047-1060. Hindmarsh EJ and Marks R M , Complement Activation Occurs on Subendothelial Extracellular Matrix In Vitro and Is Initiated by Retraction or Removal of Overlying Endothelial Cells. J Immunol, 1998. 160(12): p. 6128-6136. Hara T, Matsumoto M , Tsuji S, Nagasawa S, Hiraoka A , Masaoka T, Kodama K , Horai T, Sakuma T, and Seya T, Homologous complement activation on druginduced apoptotic cells from a human lung adenocarcinoma cell line. Immunobiology, 1996-1997. 196(5): p. 491-503. Vakeva A and Meri S, Complement activation and regulator expression after . anoxic injury of human endothelial cells. APMIS, 1998 Dec. 106(12): p. 1149-56. Spiller OB, Criado-Garcia O, Rodriguez De Cordoba S, and Morgan BP, Cytokine-mediated up-regulation of CD55 and CD59 protects human hepatoma cells from complement attack. Clinical & Experimental Immunology, 2000. 121(2): p. 234-241. de Vree WJ, Fontijne-Dorsman A N , Koster JF, and Sluiter W, Photodynamic treatment of human endothelial cells promotes the adherence of neutrophils in vitro. Br. J. Cancer, 1996 Jun. 73(11): p. 1335-40. Bugelski PJ, Porter CW, and Dougherty TJ, Autoradiographic distribution of HPD in normal and tumour tissue ofthe mouse. Cancer Res, 1981. 41: p. 4606. Fingar V H , Wieman TJ, Wiehle SA, and Cerrito PB, The Role of Microvascular Damage in Photodynamic Therapy: The Effect of Treatment on Vessel Constriction, Permeability, and Leukocyte Adhesion. Cancer Res, 1992. 52(18): p. 4914-4921.  143  165. 166. 167.  168. 169.  170.  171.  172.  173. 174. 175.  176.  177.  178.  Fingar V H , Vascular effects of photodynamic therapy. J Clin Laser Med Surg., 1996 Oct. 14(5): p. 323-8. Henderson B W and Gollnick SO. in 9th Congress of the European Society for Photobiology. September 3-8, 2001. Lillehammer, Norway. Krosl G, Korbelik M , and Dougherty GJ, Induction of immune cell infiltration into murine SCCVII tumour by photofrin-based photodynamic therapy. Br. J. Cancer, 1995 Mar. 71(3): p. 549-55. Weiss SJ, Tissue destruction by neutrophils. N Engl J Med, 1989. 320(6): p. 365376. Lichtenstein A and Kahle J, Anti-tumor effect of inelammatory neutrophils: Characteristics of in vivo generation and in vitro tumor cell lysis. International Journal of Cancer, 1985. 35(1): p. 121-127. Vadas M A , Nicola N A , and Metcalf D, Activation of antibody-dependent cellmediated cytotoxicity of human neutrophils and eosinophils by separate colonystimulating factors. J Immunol, 1983. 130(2): p. 795-799. MacPherson G G and North RJ, Endotoxin-mediated necrosis and regression of established tumours in the mouse. A correlative study of quantitative changes in blood flow and ultrastructural morphology. Cancer Immunol Immunother., 1986. 21(3): p. 209-16. Colombo M P , Lombardi L , Stoppacciaro A , Melani C, Parenza M , Bottazzi B , and Parmiani G, Granulocyte colony-stimulating factor (G-CSF) gene transduction in murine adenocarcinoma drives neutrophil-mediated tumor inhibition in vivo. Neutrophils discriminate between G-CSF-producing and GCSF- nonproducing tumor cells. J Immunol, 1992. 149(1): p. 113-119. Mitsuo Katano M T , Neutrophil-Mediated Tumor Cell Destruction in Cancer Ascites. Cancer, 1982. 50(1): p. 62-68. Cassatella M A , Neutrophil-derivedproteins: selling cytokines by the pound. Adv Immunol., 1999. 73: p. 369-509. Gosselin EJ, Wardwell K , Rigby WF, and Guyre P M , Induction of MHC class II on human polymorphonuclear neutrophils by granulocyte/macrophage colonystimulating factor, IFN-gamma, andIL-3. J Immunol, 1993. 151(3): p. 14821490. Okuda K , Tani K , Ishigatsubo Y , Yokota S, and David CS, Antigen-pulsed neutrophils bearing la antigens can induce T lymphocyte proliferative response to the syngeneic or semisyngeneic antigen-primed T lymphocytes. Transplantation, 1980 Nov. 30(5): p. 368-72. Fanger N A , L i u C, Guyre P M , Wardwell K , O'Neil J, Guo T L , Christian TP, Mudzinski SP, and Gosselin EJ, Activation of Human T Cells by Major Histocompatability Complex Class II Expressing Neutrophils: Proliferation in the Presence of Superantigen, But Not Tetanus Toxoid. Blood, 1997. 89(11): p. 41284135. Oehler L , Majdic O, Pickl W F , Stockl J, Riedl E, Drach J, Rappersberger K , Geissler K , and Knapp W, Neutrophil Granulocyte-committed Cells Can Be Driven to Acquire Dendritic Cell Characteristics. J. Exp. Med., 1998. 187(7): p. 1019-1028.  144  179.  180.  181.  182.  183.  184. 185.  186. 187.  188.  189.  190. 191.  192.  193.  194.  L i m H W , Y o u n g L , Hagan M , and G i g l i I, Delayed phase of HematoporphyrinInduced Phototoxicity: Modulation by Complement, Leukocytes, and Antihistamines. J Investig Dermatol, 1985. 84(2): p. 114-117. Kamide R , G i g l i I, and L i m H W , Participation of Mast Cells and Complement in the Immediate Phase of Hematoporphyrin-Induced Phototoxicity. J Investig Dermatol, 1984. 82(5): p. 485-490. Mantovani A , Bottazzi B , Colotta F , Sozzani S, and Ruco L , The origin and function of tumor-associated macrophages. Immunol Today., 1992 Jul. 13(7): p. 265-70. M i l a s L , W i k e J, Hunter N , Volpe J, and Basic I, Macrophage Content of Murine Sarcomas and Carcinomas: Associations with Tumor Growth Parameters and Tumor Radiocurability. Cancer Res, 1987. 47(4): p. 1069-1075. Eccles S A and Alexander P, Macrophage content of tumours in relation to metastatic spread and host immune reaction. Nature, 1974. 250(5468): p. 667669. Korbelik M and Krosl G , in The Fundamental Bases of Phototherapy, Berg K , Honigsman H , Jori G , and Y o u n g A R , Editors. 1996, O E M F spa: M i l a n , p. 229. Gollnick S O , L i u X , Owczarczak B , Musser D A , and Henderson B W , Altered Expression of Interleukin 6 and Interleukin 10 As a Result of Photodynamic Therapy in Vivo. Cancer Res, 1997. 57(18): p. 3904-3909. Metcalf D , Control of granulocytes and macrophages: molecular, cellular, and clinical aspects. Science, 1991. 254(5031): p. 529-533. Korbelik M and Krosl G , Enhanced macrophage cytotoxicity against tumor cells treated with photodynamic therapy. Photochemical & Photobiological Sciences, 1994 N o v . 60(5): p. 497-502. Canti G , Lattuada D , N i c o l i n A , Taroni P, Valentini G , and Cubeddu R, Antitumor immunity induced by photodynamic therapy with aluminum disulfonatedphthalocyanines and laser light. Anticancer Drugs, 1994 A u g . 5(4): p. 443-7. Korbelik M and Cecic I, Contribution of myeloid and lymphoid host cells to the curative outcome of mouse sarcoma treatment by photodynamic therapy. Cancer Letters, 1999. 137(1): p. 91-98. Gomella L G and Haist S A , Commonly Used Medications, in Clinician's Pocket Reference, 11th Edition. 2007, The M c G r a w - H i l l Companies, Inc. Stein O, Dabach Y , Hollander G , Ben-Nairn M , Halperin G , and Stein Y , Dexamethasone impairs cholesterol egress from a localized lipoprotein depot in vivo. Atherosclerosis, 1998. 137(2): p. 303-310. Yeager M P , Guyre P M , and Munck A U , Glucocorticoid regulation of the inflammatory response to injury. Acta Anaesthesiologica Scandinavica, 2004. 48(7): p. 799-813. Loose D S and Stancel G M , Estrogens and Progestins, i n Goodman & Gilman's The Pharmacological Basis of Therapeutics, 11th Edition, Brunton L L , Keith L . Parker, Iain L . O. Buxton, and Blumenthal D K , Editors. 2007, The M c G r a w - H i l l Companies, Inc. Craft T K S and DeVries A C , Role of IL-1 in Poststroke Depressive-like Behavior in Mice. Biological Psychiatry, 2006. 60(8): p. 812-818.  145  195.  196.  197.  198.  199. 200.  201.  202.  203.  204.  205.  206. 207. 208. 209. 210. 211.  Chrousos G P , Adrenocorticosteroids & Adrenocortical Antagonists, i n Basic & Clinical Pharmacology, Tenth Edition, Katzung B G , Editor. 2007, The M c G r a w H i l l Companies, Inc. Korbelik M , Sun J , and Cecic I, Photodynamic Therapy-Induced Cell Surface Expression and Release of Heat Shock Proteins: Relevance for Tumor Response. Cancer Res, 2005. 65(3): p. 1018-1026. Darzynkiewicz Z , Juan G , L i X , Gorczyca W , Murakami T, and Traganos F, Cytometry in cell necrobiology: Analysis of apoptosis and accidental cell death (necrosis). Cytometry, 1997. 27(1): p. 1-20. Fink S L and Cookson B T , Apoptosis, Pyroptosis, and Necrosis: Mechanistic Description of Dead and Dying Eukaryotic Cells. Infect. Immun., 2005. 73(4): p. 1907-1916. Bhatia M , Apoptosis versus necrosis in acute pancreatitis. A m J Physiol Gastrointest Liver Physiol, 2004. 286(2): p. G189-196. Amedeo C , Cell death: Current difficulties in discriminating apoptosis from necrosis in the context ofpathological processes in vivo. Journal o f Cellular Biochemistry, 1995. 58(2): p. 181-190. Baltz M L , Gomer K , Davies A J , Evans D J , Klaus G G , and Pepys M B , Differences in the acute phase responses of serum amyloid P-component (SAP) and C3 to injections of casein or bovine serum albumin in amyloid-susceptible and -resistant mouse strains. Clinical & Experimental Immunology, 1980 Feb. 39(2): p. 355-60. Baltz M L , D y c k R F , and Pepys M B , Amyloid P-component in mice injected with casein: identification in amyloid deposits and in the cytoplasm ofhepatocytes. Immunology, 1980 Sep. 41(1): p. 59-66. Tatsuta E, Sipe J D , Shirahama T, Skinner M , and Cohen A S , Different regulatory mechanisms for serum amyloid A and serum amyloid P synthesis by cultured mouse hepatocytes. J . B i o l . Chem., 1983. 258(9): p. 5414-5418. L i u Y , Endo Y , Homma S, Kanno K , Yaginuma H , and Fujita T, Ficolin A and ficolin B are expressed in distinct ontogenic patterns and cell types in the mouse. Molecular Immunology, 2005. 42(11): p. 1265-1273. Dhainaut J-F, Marin, Nathalie., Mignon, Alexandre., Vinsonneau, Christophe., Hepatic response to sepsis: Interaction between coagulation and inflammatory processes.. Critical Care Medicine, 2001 July. 29(7): p. Supplement 1: S42-S47. Baumann H and Gauldie J, The acute phase response. Immunology Today, 1994. 15(2): p. 74-80. Desborough JP, The stress response to trauma and surgery. B r . J . Anaesth., 2000. 85(1): p. 109-117. Dinarello C A , Proinflammatory Cytokines. Chest, 2000. 118(2): p. 503-508. Gabay C and Kushner I, Acute-Phase Proteins and Other Systemic Responses to Inflammation. N Engl J M e d , 1999. 340(6): p. 448-454. Sheeran P and H a l l G M , Cytokines in anaesthesia. B r . J . Anaesth., 1997. 78(2): p. 201-219. Yamamoto N and Ngwenya B Z , Activation of Mouse Peritoneal Macrophages by Lysophospholipids and Ether Derivatives of Neutral Lipids and Phospholipids. Cancer Res, 1987. 47(8): p. 2008-2013.  146  212.  213.  214.  215.  216.  217. 218.  219. 220.  221.  222.  223.  224.  225.  Jolles C , Ott M , Straight R, and Lynch D , Systemic immunosuppression induced by peritoneal photodynamic therapy. A m J Obstet Gynecol., 1988 Jun. 158(6 Pt 1): p. 1446-53. Schreiber W , Pollmacher T, Fassbender K , Gudewill S, Vedder H , Wiedemann K , Galanos C , and Holsboer F, Endotoxin- and corticotropin-releasing hormoneinduced release of ACTH and Cortisol. Neuroendocrinology, 1993 Jul. 58(1): p. 123-8. Elenkov IJ, Kovacs K , K i s s J, Bertok L , and V i z i E S , Lipopolysaccharide is able to bypass corticotrophin-releasing factor in affecting plasma ACTH and corticosterone levels: evidence from rats with lesions of the paraventricular nucleus. J Endocrinol, 1992. 133(2): p. 231-236. Genuth S M , General Principles of Endocrine Physiology, i n PRINCIPLES OF PHYSIOLOGY, Berne R M , Levy, Matthew. N . , Editor. 2000, Mosby, Inc.: St. Louis, Missouri, p. 484-493. Pelaia G , Vatrella A , Cuda G , Maselli R, and Marsico S A , Molecular mechanisms of corticosteroid actions in chronic inflammatory airway diseases. Life Sciences, 2003. 72(14): p. 1549-1561. Leung D Y M and B l o o m J W , Update on glucocorticoid action and resistance. Journal o f A l l e r g y and Clinical Immunology, 2003. 111(1): p. 3-22. Reichardt H M , Tuckermann JP, Gottlicher M , Vujic M , W e i h F, Angel P, Herrlich P, and Schiitz G , Repression of inflammatory responses in the absence of DNA binding by the glucocorticoid receptor. E M B O J., 2001 Dec. 20(24): p. 7168-73. Cosio B G , Torrego A , and Adcock I M , Molecular Mechanisms of Glucocorticoids. Archivos de Bronconeumologia, 2005. 41(1): p. 34-41. Nishio Y , Isshiki H , Kishimoto T, and A k i r a S, A nuclear factor for interleukin-6 expression (NF-IL6) and the glucocorticoid receptor synergistically activate transcription of the rat alpha 1-acid glycoprotein gene via direct protein-protein interaction. M o l . C e l l . B i o l . , 1993. 13(3): p. 1854-1862. Baumann H , Prowse K R , Marinkovic S, W o n K A , and Jahreis G P , Stimulation of Hepatic Acute Phase Response by Cytokines and Glucocorticoids. Annals o f the N e w Y o r k Academy o f Sciences, 1989. 557: p. 280-296. Thorn C F and Whitehead A S , Differential Glucocorticoid Enhancement of the Cytokine-Driven Transcriptional Activation of the Human Acute Phase Serum Amyloid A Genes, SAA1 and SAA2. J Immunol, 2002. 169(1): p. 399-406. Geisterfer M , Richards C , Baumann M , Fey G , Gywnne D , and Gauldie J, Regulation of IL-6 and the hepatic IL-6 receptor in acute inflammation in vivo. Cytokine, 1993. 5(1): p. 1-7. Cecic I, Stott B , and Korbelik M , Acute phase response-associated systemic neutrophil mobilization in mice bearing tumors treated by photodynamic therapy. International Immunopharmacology, 2006. 6(8): p. 1259-1266. Bausero M A , Gastpar R, Multhoff G , and Asea A , Alternative Mechanism by which IFN-{gamma} Enhances Tumor Recognition: Active Release of Heat Shock Protein 72. J Immunol, 2005. 175(5): p. 2900-2912.  147  226.  227. 228.  229.  230.  231.  232.  233.  234. 235.  236.  237.  238.  K i a n g J G and Tsokos G C , Heat Shock Protein 70 kDa: Molecular Biology, Biochemistry, and Physiology. Pharmacology & Therapeutics, 1998. 80(2): p. 183-201. Hartl F U , Molecular chaperones in cellular protein folding. Nature, 1996. 381(6583): p. 571-580. Kleinjung T, Arndt O, Feldmann H J , Bockmuhl U , Gehrmann M , Z i l c h T, Pfister K , Schonberger J, Marienhagen J, Eilles C, Rossbacher L , and Multhoff G , Heat shock protein 70 (Hsp70) membrane expression on head-and-neck cancer biopsy-a target for natural killer (NK) cells. International Journal o f Radiation Oncology*Biology*Physics, 2003. 57(3): p. 820-826. Multhoff G , Botzler C , Wiesnet M , Miiller E , Meier T, Wilmanns W , and Issels R, A stress-inducible 72-kDa heat-shock protein (HSP72) is expressed on the surface of human tumor cells, but not on normal cells. Int J Cancer, 1995 A p r . 61(2): p. 272-9. Kurucz I, Tombor B , Prechl J, Erdo F, Hegediis E , Nagy Z , Vitai M , Koranyi L , and Laszlo L , Ultrastructural localization ofHsp-72 examined with a new polyclonal antibody raised against the truncated variable domain of the heat shock protein. C e l l Stress Chaperones, 1999 Jun. 4(2): p. 139-52. Shin B K , Wang H , Y i m A M , L e Naour F, Brichory F, Jang J H , Zhao R, Puravs E , Tra J, Michael C W , Misek D E , and Hanash S M , Global Profiling of the Cell Surface Proteome of Cancer Cells Uncovers an Abundance of Proteins with Chaperone Function. J. B i o l . Chem., 2003. 278(9): p. 7607-7616. Hantschel M , Pfister K , Jordan A , Scholz R, Andreesen R, Schmitz G , Schmetzer H , Hiddemann W , and Multhoff G , Hsp70plasma membrane expression on primary tumor biopsy material and bone marrow of leukemic patients. C e l l Stress Chaperones, 2000 N o v . 5(5): p. 438-42. Gehrmann M , Pfister K , Hutzler P, Gastpar R, Margulis B , and Multhoff G , Effects of antineoplastic agents on cytoplasmic and membrane-bound heat shock protein 70 (Hsp70) levels. B i o l Chem., 2002 N o v . 383(11): p. 1715-25. Pockley A G , Heat shock proteins as regulators of the immune response. The Lancet, 2003. 362(9382): p. 469-476. Guzhova I, Kislyakova K , Moskaliova O, Fridlanskaya I, Tytell M , Cheetham M , and Margulis B , In vitro studies show that Hsp70 can be released by glia and that exogenous Hsp70 can enhance neuronal stress tolerance. Brain Research, 2001. 914(1-2): p. 66-73. Guzhova I V , Arnholdt A C , Darieva Z A , Kinev A V , Lasunskaia E B , Nilsson K , Bozhkov V M , Voronin A P , and Margulis B A , Effects of exogenous stress protein 70 on the functional properties of human promonocytes through binding to cell surface and internationalization. C e l l Stress Chaperones, 1998 Mar. 3(1): p. 6777. Tsvetkova N M , Horvath I, Torok Z , Wolkers W F , Balogi Z , Shigapova N , Crowe L M , Tablin F, V i e r l i n g E , Crowe J H , and V i g h L , Small heat-shock proteins regulate membrane lipid polymorphism. P N A S , 2002. 99(21): p. 13504-13509. Arispe N , D o h M , and De M a i o A , Lipid interaction differentiates the constitutive and stress-induced heat shock proteins Hsc70 and Hsp70. C e l l Stress Chaperones, 2002 Oct. 7(4): p. 330-8.  148  239.  240.  241.  242.  243.  244.  245.  246. 247.  248.  249.  250.  251.  252.  Negulyaev Y A , Vedernikova E A , Kinev A V , and Voronin A P , Exogenous heat shock protein hsp70 activates potassium channels in U937 cells. Biochem Biophys Acta., 1996 Jun. 1282(1): p. 156-62. Gross C, Koelch W, DeMaio A , Arispe N , and Multhoff G, Cell Surface-bound Heat Shock Protein 70 (Hsp70) Mediates Perforin-independent Apoptosis by Specific Binding and Uptake of Granzyme B. J. Biol. Chem., 2003. 278(42): p. 41173-41181. Wright B H , Corton J M , El-Nahas A M , Wood RF, and Pockley A G , Elevated levels of circulating heat shock protein 70 (Hsp70) in peripheral and renal vascular disease. Heart Vessels., 2000. 15(1): p. 18-22. Febbraio M A , Ott P, Nielsen HB, Steensberg A , Keller C, Krustrup P, Secher N H , and Pedersen B K , Exercise induces hepatosplanchnic release of heat shock protein 72 in humans. J Physiol, 2002. 544(3): p. 957-962. Campisi J, Leem T H , and Fleshner M , Stress-induced extracellular Hsp72 is a functionally significant danger signal to the immune system. Cell Stress Chaperones, 2003 Fall. 8(3): p. 272-86. Fleshner M , Campisi J, Amiri L, and Diamond D M , Cat exposure induces both intra- and extracellular Hsp72: the role of adrenal hormones. Psychoneuroendocrinology, 2004. 29(9): p. 1142-1152. Matzinger P, Tolerance, danger, and the extended family. Annual Review of Immunology, 1994. 12: p. 991-1045. Matzinger P, An innate sense of danger. Seminars in Immunology, 1998. 10(5): p. 399-415. Asea A , Kabingu E, Stevenson M A , and Calderwood SK, HSP70 peptide-bearing andpeptide-negative preparations act as chaperokines. Cell Stress Chaperones, 2000 Nov. 5(5): p. 425-31. Basu S, Binder RJ, Suto R, Anderson K M , and Srivastava PK, Necrotic but not apoptotic cell death releases heat shock proteins, which deliver a partial maturation signal to dendritic cells and activate the NF-{kappa}B pathway. Int. Immunol., 2000. 12(11): p. 1539-1546. Binder RJ, Harris M L , Menoret A , and Srivastava PK, Saturation, Competition, and Specificity in Interaction of Heat Shock Proteins (hsp) gp96, hsp90, and hsp70 with CDlIb+ Cells. J Immunol, 2000. 165(5): p. 2582-2587. Panjwani N N , Popova L , and Srivastava P K , Heat Shock Proteins gp96 and hsp70 Activate the Release of Nitric Oxide by APCs. J Immunol, 2002. 168(6): p. 2997-3003. Kuppner M C , Gastpar R, Gelwer S, Nossner E, Ochmann O, Scharner A , and Issels R D , The role of heat shock protein (hsp70) in dendritic cell maturation: hsp70 induces the maturation of immature dendritic cells but reduces DC differentiation from monocyte precursors. Eur J Immunology, 2001 May. 31(5): p. 1602-9. Noessner E, Gastpar R, Milani V , Brandl A , Hutzler PJS, Kuppner M C , Roos M , Kremmer E, Asea A , Calderwood SK, and Issels RD, Tumor-Derived Heat Shock Protein 70 Peptide Complexes Are Cross-Presented by Human Dendritic Cells. J Immunol, 2002. 169(10): p. 5424-5432.  149  253.  254.  255.  256.  Basu S, Binder R J , Ramalingam T, and Srivastava P K , CD91 Is a Common Receptor for Heat Shock Proteins gp96, hsp90, hsp70, and Calreticulin. Immunity, 2001. 14(3): p. 303-313. Curry P M and L e v y J G , Stress protein expression in murine tumor cells following photodynamic therapy with benzoporphyrin derivative. Photochem Photobiol, 1993 Sep. 58(3): p. 374-9. Salo D C , Donovan C M , and Davies K J , HSP70 and other possible heat shock or oxidative stress proteins are induced in skeletal muscle, heart, and liver during exercise. Free Radic B i o l Med., 1991 11(3): p. 239-46. Kregel K C and Moseley P L , Differential effects of exercise and heat stress on liver HSP70 accumulation with aging. J A p p l Physiol, 1996. 80(2): p. 547-551.  150  APPENDIX Ethics certificate T H E UNIVERSITY OF BRITISH COLUMBIA  ANIMAL CARE CERTIFICATE Application Number: A05-0240 j Investigator or Course Director: Mladen KorbelikDepartment: Pathology & Laboratory Medicine  Animals:  Start Date:  Mice C3H/HeK, C57BL/6J, B612984C3 660  j June! 16,2005  Approval Date:  June 2,2006  Funding Sources:  Grant Agency: Grant Title: !  National Cancer Institute of Canada Relevance of complement activation in photodynamic therapy-mediated eradication of solid tumors I  Unfunded! title: i None The Animal Care]Committee has examined and approved] the use of animals for the above experimental project. This certificate is valid for one year from the above start or approval date (whichever is later) provided there is no change in the experimental procedures. Annual review is required by the C C A C and some granting agencies.;  A copy of this certificate must be displayed in your animal facility.  151  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0100802/manifest

Comment

Related Items