Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Mechanisms underlying the downregulation of the transporter associated with antigen processing (TAP)-1… Setiadi, Alvernia Francesca 2007

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2007-319253.pdf [ 16.75MB ]
Metadata
JSON: 831-1.0100781.json
JSON-LD: 831-1.0100781-ld.json
RDF/XML (Pretty): 831-1.0100781-rdf.xml
RDF/JSON: 831-1.0100781-rdf.json
Turtle: 831-1.0100781-turtle.txt
N-Triples: 831-1.0100781-rdf-ntriples.txt
Original Record: 831-1.0100781-source.json
Full Text
831-1.0100781-fulltext.txt
Citation
831-1.0100781.ris

Full Text

M E C H A N I S M S U N D E R L Y I N G THE D O W N R E G U L A T I O N OF THE TRANSPORTER ASSOCIATED WITH A N T I G E N PROCESSING (TAP)-l IN CARCINOMAS by A L V E R N I A F R A N C E S C A SETIADI B.Sc., University ofBritish Columbia, 2001  A THESIS SUBMITTED IN P A R T I A L F U L F I L L M E N T OF THE REQUIREMENTS FOR THE D E G R E E OF DOCTOR OF PHILOSOPHY in THE F A C U L T Y OF G R A D U A T E STUDIES  (Zoology)  THE UNIVERSITY OF BRITISH C O L U M B I A June 2007  © Alvernia Francesca Setiadi, 2007  11  Abstract Expression of Transporter associated with Antigen Processing (TAP)-l is often lost in metastatic carcinomas, resulting in defective antigen processing and presentation, and escape of the cancer cell from immune surveillance. In this study, the nature of TAP1 deficiencies in tumors was investigated. By chromatin immunoprecipitation assay, it was shown that the recruitment of R N A polymerase II to the Tap-1 gene was impaired in TAP-deficient, metastatic cells derived from murine melanoma, prostate and lung carcinomas. Levels of TAP-1 promoter activity, as assessed by stable transfections with a reporter construct containing the TAP-1 promoter, were also relatively low in T A P deficient cells. These suggest that the deficiency in TAP-1 expression resulted—at least partially—from a reduced level of transcriptional activity of the Tap-1 gene. In order to examine genetic heritability of regulators of TAP-1 promoter activity, TAP- and M H C class I-deficient cells of H-2  b  origin were fused with wild-type  fibroblasts of H-2 origin. Fusion with TAP-expressing cells complemented the low k  levels of TAP-1 promoter activity in TAP-deficient cells. However, these fused cells exhibited lower levels of TAP-1 mRNA and H-2 than unfused fibroblasts. Further k  analysis showed that TAP-1 mRNA stability was lower in fused carcinoma-fibroblasts than in unfused fibroblasts. Taken together, TAP deficiency in many carcinomas appears to be caused by a decrease in activity/expression of ^ram-acting factors regulating TAP-1 promoter activity, as well as a decrease in TAP-1 mRNA stability. The hypothesis that epigenetic regulation plays a fundamental role in controlling TAP-1 transcription was also tested. Chromatin immunoprecipitation analyses showed that the lack of TAP-1 transcription correlated with low levels of recruitment of a histone  Ill  acetyltransferase, CBP, and of histone H 3 acetylation at the TAP-1 promoter, leading to a decrease in accessibility of the R N A polymerase II complex to the TAP-1 promoter. These findings lie at the heart of understanding immune escape mechanisms in tumors and suggest that the reversal of epigenetic codes may provide novel immunotherapeutic paradigms for intervention in cancer.  IV  Table of Contents Abstract  ii  Table of Contents  iv  List of Tables  vii  List of Figures  viii  List of Figures  '  viii  List ofAbbreviations  xiv  List ofAbbreviations  xiv  Acknowledgments  xviii  Dedication  xx  Co-Authorship Statement  xxi  Chapter 1: General Introduction 1.1  1  Overview of the Immune System  1.2  2  Antigen Presentation 1.2.1 1.2.2 1.2.3 1.2.4 1.2.5  3  Major Histocompatibility Complex (MHC) genetics M H C molecules M H C class I antigen presentation Transporters associated with Antigen Processing (TAP) structure and function M H C class 11 antigen presentation and C D 4 T cells in cancer immunity +  _3 5 6 7 8  1.3 Disruption of the M H C Class I Antigen Processing Pathway and the Development of Tumors 11 1.4 1.5  TAP-based Immunotherapy  13  Regulation of TAP-1 Expression  15  1.5.1 Organization of Tap and Lmp genes within the mouse M H C class II locus 1.5.2 Possible mechanisms of TAP-1 mRNA downregulation in carcinomas 1.5.2.1 Transcriptional mechanisms 1.5.2.2 Post-transcriptional mechanisms 1.5.2.3 Epigenetic mechanisms  15 16 16 16 17  1.6  Synopsis of Thesis Objectives, Hypotheses and Results  19  1.7  References  21  Chapter 2 : Identification of Mechanisms Underlying TAP-1 Deficiency in Metastatic Murine Carcinomas 28 2.1  Introduction  28  2.2  Materials and Methods  30  2.2.1 2.2.2 2.2.3 2.2.4  Cell lines Reverse transcription-PCR analysis Chromatin immunoprecipitation (ChIP) assays Cloning of the TAP-1 promoter  30 30 33 33  V  2.2.5 2.2.6 2.2.7 2.2.8 2.2.9 2.2.10 2.2.11 2.2.12  2.3  Transfection and selection Generation of pTAP-l-EGFP-transfected clones by F A C S Cell Fusion and F A C S analysis Endogenous levels and overexpression of 1RF-1 and IRF-2 in cell lines Luciferase and B-Galactosidase Assays Western Blot Analysis of mRNA stability Real time quantitative PCR analysis  .  Results  34 34 35 35 36 36 37 37  38  2.3.1 2.3.2 and B16, 2.3.3 2.3.4  Levels of TAP-1 mRNA in CMT.64, L M D , B16, Ltk and R M A cells 38 The recruitment of R N A polymerase II to the Tap-1 gene is lower in the CMT.64, L M D than in the Ltk and R M A cells 39 Cloning and analysis of the-557 to+1 region of the CMT.64-derived TAP-1 promoter 42 Activity of the -557 to +1 region of the TAP-1 promoter is impaired in TAP-deficient cells 43 2.3.5 Effects of fusions between carcinoma cells and wild type fibroblasts on TAP-1 promoter activity and M H C class 1 expression levels 47 2.3.6 Overexpression of IRF-1 and IRF-2 in CMT.64 cells did not result in significant changes in TAP-1 promoter activity 51 2.3.7 Analysis of TAP-1 expression in unfused and fused cells 54 2.3.8 TAP-1 mRNA stability decreases in carcinoma-fused fibroblasts 56  2.4  Discussion  58  2.5  References  61  Chapter 3 : Epigenetic Control of TAP-1 expression and the Immune Escape Mechanisms in Malignant Carcinomas 65 3.1  Introduction  _65  3.2  Materials and Methods  _68  3.2.1 3.2.2 3.2.3 3.2.4 3.2.5 3.2.6 3.2.7 3.2.8 3.2.9 3.2.10 3.2.11  3.3  Cell lines and reagents ' Reverse transcription-PCR analysis Real-time quantitative PCR analysis Flow cytometry : Chromatin immunoprecipitation assays ; Plasmid construction Transfection and selection Luciferase assays Western Blots Cytotoxicity assays Establishment of HP V-positive cancer xenografts and treatment with Trichostatin A  Results  3.3.1 Chromatin remodeling regulates TAP-1 transcription 3.3.2 Histone H3 acetylation within the TAP-1 promoter is low in M H C class I-deficient carcinomas 3.3.3 Identification of a region in TAP-1 promoter responsible for the differential activity in TAP-expressing and TAP-deficient cells 3.3.4 C B P binding to TAP-1 promoter is impaired in metastatic carcinomas  68 69 70 71 71 71 72 73 73 74 75  _76 76 80 82 85  3.3.5 IFN-y treatment increases the level of CBP, acetyl-histone H3 and R N A polymerase II recruitment to the TAP-1 promoter in TAP-deficient metastatic carcinomas 86 3.3.6 Trichostatin A (TSA), a histone deacetylase inhibitor, increases the expression of TAP-1 ; and other antigen-processing machinery (APM) components in metastatic (TAP-deficient) and pre: metastatic (TAP-expressing) carcinomas 88  vi 3.3.7 T S A treatment increases the expression of TAP-1 and surface M H C class I, resulting in an increased susceptibility of TAP-deficient metastatic carcinomas to C T L killing 91 3.3.8 T S A treatment suppresses the growth of TAP-deficient, metastatic tumors in vivo95  3.4  Discussion  98  3.5  References  103  Chapter 4 : Characterization of Novel TAP-1 Regulator Genes  109  4.1  Introduction  109  4.2  Materials and Methods  111  4.2.1 Cell lines 4.2.2 Human c D N A library ' 4.2.3 Cell Fusion and F A C S analysis 4.2.4 Determination of target cell transduction efficiency using the pFB-Luc control viral supernatant ; 4.2.5 Transduction of 1E10 cells with ViraPort c D N A library retroviral supernatants 4.2.6 Selection of positive transductants 4.2.7 Recovery of c D N A clones from positive transductants 4.2.8 Sub-cloning of TAP-regulator gene candidates__ 4.2.9 Transfection and selection 4.2.10 Reverse transcription-PCR analysis 4.2.11 Flow cytometry ;  4.3  Results  4.3.1 4.3.2 cells 4.3.3 4.3.4 4.3.5 4.3.6 regulates  111 111 T11 112 112 112 113 114 115 _115 116  117  Mouse TAP-1 promoter activity is up-regulated in the fused 1E10-A549 cells 117 The transduction efficiency of 1E10 cells is three times lower than that of the NIH/3T3 118 Identification of gene candidates from human lung c D N A library transductants 118 Identification of gene candidates from human spleen c D N A library transductants 121 Cancer-related information about the screened genes 124 Overexpression of several TAP-regulator gene candidates in CMT.64 and L M D cells upTAP-1 expression, but not H - 2 K expression 126 b  4.4  Discussion  129  4.5  References  133  Chapter 5: General Discussion 5.1  Summary and Conclusions  5.2  Future Work  5.3  The Big Picture  5.4  References _ _ _  137 137 '•  147 .•  Appendix A: Details of Methods  148  153  A . l Chromatin Immunoprecipitation Assay  .  A.2 Calculation of copy numbers of pTAP-l-EGFP construct integrated in stable transfectants  Appendix B: List of Cloning Vectors  143  .  .153 154  155  Appendix C: Comparison of TAP-1 Coding Sequence of CMT.64 and Ltk.cells  156  Vll  List of Tables Table 2.2.2.1: Primers used for RT-PCR analysis 32 Table 2.2.5.1: G418 doses for selection of transfectants in various cell lines 34 Table 2.3.4.1: Statistical Evaluation of the Transfected pTAP-l-EGFP Copy Numbers Per Cell 44 Table 3.2.2.1: Primers used for RT-PCR and real time P C R analysis 70 Table 3.2.6.1: Primers used for PCR amplifications of full TAP-1 promoter and its truncations 72 Table 4.2.8.1: Primers used for PCR amplification 114 Table 4.3.3.1: Identity of cDNAs recovered from bulk-sorted cells of human lung c D N A library transductants 119 Table 4.3.3.2: Identity of cDNAs recovered from single-cell clones of human lung c D N A library transductants 120 Table 4.3.4.1: Identity of cDNAs recovered from single-cell clones of human spleen c D N A library transductants 123 Table 4.3.5.1: Cancer-related information about the proteins that match the hits obtained from the screenings of human lung and spleen c D N A libraries 125  Vlll  List of Figures Figure 1.2.1.1: Genetic organization of human and mouse M H C genes (image reprinted from reference no. [10], by permission) 4 Figure 1.2.3.1: M H C class I antigen presentation pathway (image reprinted from reference no. [7], by permission) 6 Figure 1.2.4.1: A heterodimer of the TAP-1 and TAP-2 molecules (image reprinted from reference no. [7], by permission) 8 Figure 1.2.5.1: M H C class II antigen presentation pathway (image reprinted from reference no. [22], by permission) 9 Figure 1.2.5.2: The complex interaction between a tumor cell, professional antigenpresenting cells, CTLs, Th cells, B cells and other lymphocytes in the tumor microenvironment. A (+) sign indicates an activating signal on the antitumor response while a (-) sign indicates an inhibitory effect (image reprinted from reference no. [24], by permission) 10 Figure 1.5.1.1: Organization of Tap and Lmp genes in the mouse M H C class II locus. The sizes of the coding sequences (CDS) and intergenic regions are shown in the diagram 15 Figure 2.3.1.1: IFN-y-treatment restores TAP-1 expression in TAP-deficient murine lung, prostate and skin carcinoma cells (CMT.64, L M D and B16). Amplification of [3actin cDNA served as an internal control. RT-PCR analyses were performed at least three times and representative data are shown 38 Figure 2.3.2.1: The recruitment of R N A polymerase II to 3' coding region of the Tap-1 gene in CMT.64, L M D and B16 is impaired in comparison to that in Ltk and R M A . Chromatin immunoprecipitation using anti-RNA polymerase II antibody was performed in each cell line, and the eluted D N A fragments were purified and used as templates for real time PCR analysis using primers specific for the 3' coding region of the Tap-1 gene. Relative R N A polymerase II levels were determined as the ratio of copy numbers of the eluted 3' coding region of the Tap-1 gene and copy numbers of the corresponding inputs. The smallest ratio in each group of experiments was arbitrarily determined as 1. Columns, average of three to six experiments; bars, S E M . * P < .05 compared with TAP-expressing cells (Student's t-test) 40 Figure 2.3.2.2: The recruitment of R N A pol II to the TAP-1 promoter was low in TAPdeficient CMT.64, L M D and B16 cells. Chromatin immunoprecipitation using antiR N A polymerase II antibody was performed, and the relative levels of R N A polymerase II recruitment to the TAP-1 promoter were assessed as described above using primers specific for the TAP-1 promoter. Columns, average of three to six experiments; bars, S E M . * P < .05 compared with TAP-expressing cells (Student's t-test) : : 41 Figure 2.3.3.1: Nucleotide sequence of the CMT.64-derived TAP-1 promoter region is identical to the corresponding region in murine M H C class II locus. The A T G codon was arbitrarily determined as +1. Motifs located on the sense strand are indicated by a (+), and motifs located on the antisense strand are indicated by a (-) 43 Figure 2.3.4.1: TAP-1 promoter activity is impaired in TAP-deficient CMT.64, L M D and B16 cells. Flow cytometry analysis was performed to measure TAP-1 promoter activity, based on the levels of EGFP expression in pTAP-l-EGFP stable  ix transfectants after selection in G418 for 1 month. The IFN-y-treated cells were incubated with 50 ng/ml IFN-y for 48 hours prior to the F A C S analysis. Levels of EGFP in the cells transfected the pTAP-l-EGFP were normalized against corresponding values obtained upon transfection with pEGFP-1 vector alone. Data shown are the mean fluorescence intensity ± S E M of three independent experiments. * P < .05 compared with TAP-expressing cells; ** P < .05 compared with untreated cells (Student's t-test) 46 Figure 2.3.5.1: TAP-1 promoter-driven EGFP expression increased in the fused CMT.64Ltk and LMD-Ltk cells (thick line) in comparison to that in the unfused pTAP-1EGFP-transfected CMT.64 and L M D cells (thin line). Wild type CMT.64 and L M D were used as negative controls for EGFP expression (shaded area) 48 Figure 2.3.5.2: Surface expression of K was increased when CMT.64 or L M D (shaded areas) were fused to Ltk cells (broken line). Expression of K on fused CMT.64-Ltk and fused LMD-Ltk cells are displayed by thick lines. As a positive control, expression of K was assessed on IFN-y-treated CMT.64 and L M D cells (thin lines). 48 Figure 2.3.5.3: No induction of K surface expression in the fused CMT.64(pTAP-lEGFP)-CMT.64(pEYFP-Nl) cells (thick line). CMT.64 cells untreated (shaded area) or treated with IFN-y (thin line) were used as negative or positive control, respectively, for K expression 49 Figure 2.3.5.4: K surface expression was reduced in the fused CMT.64-Ltk and L M D Ltk (thick lines) in comparison to that in the wild type Ltk cells (thin lines). Wild type CMT.64 and L M D cells were used as negative controls for K expression (shaded area) 50 Figure 2.3.6.1: Endogenous levels of IRF-1 and -2 mRNA did not correlate with TAP levels in the cell lines 51 Figure 2.3.6.2: Overexpression of IRF-1 or -2 in a clone of pTAP-l-EGFP constructtransfected CMT.64 cells did not result in significant changes of the TAP-1 promoter activity. Representative histograms show EGFP expressed by the IRF-1 or IRF-2-overexpressing cells. The shaded areas indicate background green fluorescence of the cells transfected with PBS as negative controls, the thin and thick lines represent EGFP expression in cells overexpressing the IRF that were treated with IFN-y or left untreated, respectively 52 Figure 2.3.6.3: Overexpression of IRF-1 and -2 modulated IFN-(3 promoter activity linked to a luciferase gene. Luciferase activities were normalized against Pgalactosidase activities, to correct for variations in transfection efficiencies. Data shown are the average ± S E M of three independent experiments 53 Figure 2.3.7.1: No expression of TAP-1 mRNA from the CMT.64 genome was detectable by RT-PCR in the fused CMT.64-Ltk cells. Amplifications of reverse-transcribed CMT.64 TAP-1 mRNA from IFN-y-treated cells and P-actin mRNA were used as positive controls and loading controls, respectively 55 Figure 2.3.7.2: Total TAP-1 expression was reduced when CMT.64 and L M D cells were fused with wild type Ltk cells. Results from RT-PCR analysis and Western Blot were shown in top and bottom panel, respectively. Levels of P-actin were used as loading controls 56 Figure 2.3.8.1: TAP-1 mRNA is rapidly degraded in fused carcinoma-fibroblast cells. . 57 b  b  b  b  b  k  k  Figure 2.3.8.2: The stability of S15 and prion m R N A is similar in unfused and fused cells 57 Figure 3.3.1.1: Differences in TAP-1 promoter activity in stable transfectants generally match the TAP-1 expression profiles better than in transient transfectants. Relative luciferase activity (RLA) in transient (12-72 hours post-transfection) and stable (3-4 weeks post-transfection) transfectants. In the transient transfectants, the luciferase unit in each cell line was determined as the ratio of firefly :renila luciferase unit. In the stable transfectants, the luciferase unit in each cell line was determined as the ratio of firefly luciferase:copy number of pTAPl-Luc construct integrated into the genome. Relative luciferase activity (RLA) was determined as the luciferase unit in a particular cell line divided by the lowest value of luciferase unit obtained in that particular group of cells. Columns, average of three to six independent experiments; bars, S E M . * P < .05 compared with cells that expressed higher TAP-1 and M H C class I in the same group of cells (Student's t-test) 77 Figure 3.3.1.2: Analysis of TAP- 1 and surface M H C class I expression by RT-PCR and flow cytometry, respectively. Shaded area, thin and thick lines represent low (A9 or L M D ) , medium (Dl 1) and high (TC-1 or PA) levels of M H C class I expression, respectively. Amplification of 13-actin c D N A served as an internal control in the RTPCR analysis. Data are representatives of three experiments 78 Figure 3.3.1.3: R N A pol II binding to TAP-1 promoter is low in TAP-deficient carcinomas. The levels of R N A pol II in TAP-1 promoter of each cell line were assessed by chromatin immunoprecipitation using anti-RNA pol II Ab. The eluted D N A fragment were purified and used as templates for real-time PCR analysis using primers specific for the 3'-end of the TAP-1 promoter. Relative R N A pol II levels were determined as the ratio of copy numbers of the eluted TAP-1 promoter and copy numbers of the corresponding inputs. The smallest ratio in each group of experiments was arbitrarily determined as 1. Columns, average of three to six experiments; bars, S E M . * P < .05 compared with cells that expressed higher TAP-1 and M H C class I in the same group of cells (Student's t-test) 80 Figure 3.3.2.1: Acetyl-histone H3 binding to TAP-1 promoter is low in TAP-deficient carcinomas. The levels of acetyl-histone H3 in TAP-1 promoter of each cell line were assessed by chromatin immunoprecipitation using anti-acetyl-histone H3 Ab. The eluted D N A fragments were purified and used as templates for real-time PCR analysis using primers specific for the 3'-end of the TAP-1 promoter. Relative acetyl-histone H3 levels were determined as the ratio of copy numbers of the eluted TAP-1 promoter and copy numbers of the corresponding inputs. The smallest ratio in each group of experiments was arbitrarily determined as 1. Columns, average of three to six experiments; bars, S E M . * P < .05 compared with cells that expressed higher TAP-1 and M H C class I in the same group of cells (Student's t-test) 82 Figure 3.3.3.1: TAP-1 promoter sequence with transcription factor binding motifs and 5' truncation sites. The TAP-1 A T G codon was arbitrarily determined as +1. Truncation sites are indicated by numbered arrows. Motifs located on the sense strand are indicated by a (+) and motifs located on the antisense strand are indicated by a (-) 83 Figure 3.3.3.2: A critical region that is responsible for differential activity of the TAP-1 promoter in TAP-expressing and TAP-deficient cells is found in-between -427 and -  xi 401 region of the promoter. R L A was measured in stable transfectants. The largest value in each group of experiments was arbitrarily determined as 1. Columns, average of five experiments; bars, SEM. * P < .05 compared with TAP-expressing cells in the same group (Student's t-test). 84 Figure 3.3.4.1: Expression of CBP proteins is similar in TAP-expressing and in TAPdeficient carcinoma cells 85 Figure 3.3.4.2: CBP binding to TAP-1 promoter is impaired in TAP-deficient, metastatic carcinomas. Chromatin immunoprecipitation using anti-CBP antibody was performed as described earlier. Columns, average of four experiments; bars, S E M . * P < .05 compared with cells that expressed the highest TAP-1 and M H C class I in the same group of cells (Student's t-test) 86 Figure 3.3.5.1: IFN-y treatment improves the recruitment of CBP, acetyl-histone H3 and R N A pol II to TAP-1 promoter, most significatly in TAP-deficient cells. Chromatin immunoprecipitation using A, anti-CBP, B, anti-acetyl-histone H3 or C, anti-RNA pol II antibody was performed as described earlier. Columns, average of three to four experiments; bars, S E M . * P < .05 compared with untreated cells (Student's ttest) ., 87 Figure 3.3.6.1: TSA treatment enhances R N A pol II recruitment to TAP-1 promoter and TAP-1 promoter activity. A, The levels of R N A Pol II in TAP-1 promoter of each cell line were assessed by chromatin immunoprecipitation using anti-RNA pol II. B, TAP-1 promoter activity in stable transfectants was determined by luciferase assay. Columns, average of three to six experiments; bars, S E M . * P < .05 compared with untreated cells (Student's t-test) 89 Figure 3.3.6.2: TSA treatment does not significantly alter the levels of histone H3 acetylation in TAP-1 promoter. The levels of acetyl-histone H3 in TAP-1 promoter of each cell line were assessed by chromatin immunoprecipitation using anti-acetylhistone H3 antibody. Columns, average of three to six experiments; bars, S E M , . . . 90 Figure 3.3.7.1: TAP-1 expression in all cell lines, particularly in the TAP-deficient carcinomas, was up-regulated with TSA treatment. Up-regulated TAP-1 expression from IFN-y-treated cells was used as a positive control. P-actin expression served as a loading control. Data are representatives of three experiments 91 Figure 3.3.7.2: Expression of LMP-2, TAP^2 and tapasin in all cell lines, particularly in the TAP-deficient carcinomas, was up-regulated with TSA treatment. Amplification of A P M c D N A from IFN-y-treated cells was used as a positive control. P-actin expression served as a loading control. Data are representatives of three experiments 92 Figure 3.3.7.3: Surface H-2K expression, particularly on M H C class I-deficient cells, was enhanced by TSA treatment. Cells untreated (shaded areas) or treated with 100 ng/ml TSA (thick lines) or 50 ng/ml IFN-y (thin lines) were stained with PEconjugated anti-H-2K mAb. Data are representatives of three experiments 93 Figure 3.3.7.4: TSA treatment improves HPV-positive tumor cell killing by CTLs. Target cells were uninfected or VSV-infected, untreated or treated with TSA or IFN-y for 24 hours before infection with the V S V . C T L assays were performed using effector:target ratio of 0.8:1 to 200:1. Representative data using 22:1 effectontarget ratio are shown in this figure. A l l cells were infected with V S V at a MOI of 7.5 for b  b  Xll  16hr. Columns, average of three experiments; bars, S E M . * P < .05 compared with untreated cells (Student's t-test) 94 Figure 3.3.7.5: TSA treatment improves B16F10 tumor cell killing by CTLs. Target cells were uninfected or VSV-infected, untreated or treated with various concentrations of TSA for 24 hours before infection with the V S V . C T L assay was performed using effectontarget ratio of 2.5:1 to 67:1. A l l cells were infected with V S V at a MOI of 7.5 for 16hr 95 Figure 3.3.8.1: TSA treatment suppresses tumor growth in vivo. A9 (MHC class Ideficient cells) tumor growth was suppressed in mice treated with 500 pg/kg of TSA daily compared to in those treated with D M S O vehicle control (n = 8 per treatment group). TC-1 group represented tumor growth in mice injected with high M H C class I-expressing cells (n = 9). Data represent the mean tumor volume ± S E M 96 Figure 3.3.8.2: TAP-1 promoter activity is enhanced in TAP-deficient tumor cells isolated from TSA-treated mice. TAP-1 promoter-driven Luciferase (pTAPl-Luc) expression is higher in A 9 cells isolated from TSA-treated mice than in those isolated from DMSO-treated mice (n=4 per treatment group). * P < .05 compared with cells from DMSO-treated mice (Student's t-test) 97 Figure 4.3.1.1: TAP-1 promoter-driven EGFP expression is enhanced in the fused 1E10A549 cells. The levels of EGFP expression in untransfected CMT.64 cells, 1E10 (pTAPl-EGFP-transfected CMT.64) cells and fused 1E10-A549 cells are represented by a shaded area, a thin line and a thick line, respectively 117 Figure 4.3.3.1: The ORE found in the homologous region of human chromosome 3 clone RP11-27016 map 3p (NCBI accession no. AC090885) and the 1.3 kb sequence obtained from human lung c D N A library screening 119 Figure 4.3.6.1: RT-PCR analysis of the overexpression of the TAP-1 activator candidate genes in CMT.64 and L M D cells. G: cDNA template was derived from pIRES2gene transfectants; V : c D N A template was derived from pIRES2-EGFP transfectants. Amplification of P-actin cDNA served as a loading control 126 Figure 4.3.6.2: TAP-1 expression was up-regulated in some of the CMT.64 and L M D cells transfected with individual pIRES2-gene constructs. Amplification of c D N A from IFN-y-treated cells was used as a positive control, p-actin expression served as a loading control. Data are representatives of one set of RT-PCR analysis per group of CMT.64 and L M D transfectants 127 Figure 4.3.6.3: No upregulation of H-2K expression was detected on the surface of L M D cells overexpressing HLA-Cw*04 null allele and HC3 (thick lines). H-2K expression in pIRES-2-EGFP-transfected L M D cells (shaded areas) was similar to the negative control, the unstained pIRES-2-gene-transfected cells (thin lines). As a positive control, H-2K expression was assessed in IFN-y-treated L M D cells (broken lines) 128 Figure 5.1.1: A proposed model of the mechanisms underlying TAP-1 deficiency in carcinomas and release of the transcriptional repression upon relaxation of chromatin structure around the Tap-1 gene locus. The boxes on the D N A strand represent critical binding sites for various transcription factors that regulate TAP-1 transcription. CBP is a transcriptional co-activator that possesses intrinsic H A T activity. In this model, the recruitment of CBP to TAP-1 promoter facilitates histone acetylation that leads to relaxation of the chromatin structure around the region, b  b  Xlll  increasing the accessibility of the D N A template by transcription factors (TFs) and R N A pol II complex 140  List of Abbreviations  Cr  : chromium-51  ABC  : ATP-binding cassette  ACCRE  : autonomous chromatin condensation regulatory element  AMP  : adenosine monophosphate  APC  : antigen-presenting cell  APM  : antigen processing machinery  ARE  : adenosine-uracil-rich element  ATP  : adenosine triphosphate  P2m  : beta-2 microglobulin  bp  : base pair  CBP  : CREB-binding protein  cDNA  : complementary D N A  CDS  : coding sequence  ChIP  : chromatin immunoprecipitation  CREB  : cyclic A M P (cAMP) response element-binding  CTL  : cytotoxic T lymphocyte  DNA  : deoxyribonucleic acid  dsDNA  : double-stranded D N A  EDTA  : ethylenediaminetetraacetic acid  EGFP  : enhanced green fluorescent protein  EYFP  : enhanced yellow fluorescent protein  ER  : endoplasmic reticulum  XV  FACS  : fluorescent-activated cell sorting  FBS  : fetal bovine serum  FCS  : fetal calf serum  FITC  : fluorescein isothiocyanate  GM-CSF  : granulocyte-macrophage colony-stimulating factor  HAT  : histone acetyltransferase  HDAC  : histone deacetylase  HDACi  : histone deacetylase inhibitor  HLA  : human leukocyte antigen  HPV  : human papillomavirus  IFN  : interferon  Ii  : invariant chain  IL-2  : interleukin-2  i.p.  : intraperitoneal  IRES  : internal ribosome entry site  IRF  : interferon regulatory factor  kb  : kilo base pair  LMP  : low-molecular-weight protein  MHC  : major histocompatibility complex  MIIC  : major histocompatibility complex class II compartment  MOI  : multiplicity of infection  MW  : molecular weight  mRNA  : messenger ribonucleic acid  NBD  : nucleotide-binding domain  N K cell  : natural killer cell  PAGE  : polyacrylamide gel electrophoresis  PBS  : phosphate-buffered saline  PCAF  : p300/CBP-associated factor  PCR  : polymerase chain reaction  PE  : phycoerythrin  Poly(A)  : poly-adenylated  RNA  : ribonucleic acid  R N A pol II  : R N A polymerase II  RT-PCR  : reverse transcriptase PCR  s.c.  : subcutaneous  SD  : standard deviation  SDS  : sodium dodecyl sulfate  SEM  : standard error of the mean  TAP  : transporter associated with antigen processing  TCR  : T-cell receptor  TF  : transcription factor  TGF-P  : transforming growth factor beta  TMD  : transmembrane domain  TNF-a  : tumor necrosis factor alpha  TSA  : trichostatin A  TTP  : tristetraprolin  XVII  UTR  : untranslated region  VSV  : vesicular stomatitis virus  XV111  Acknowledgments This thesis could not have been written without the invaluable support I received from my thesis committee, family, friends and colleagues. I would like to acknowledge my thesis supervisor, Dr. Wilf Jefferies, for giving me the opportunity to do this graduate work in his laboratory, and for the support and guidance he has provided throughout my studies. I would also like to thank my committee members: Dr. Doug Waterfield, Dr. John Gosline, Dr. Linda Matsuuchi and Dr. Fumio Takei, and my external examiner, Dr. Soldano Ferrone, for discussions, guidance and encouragement throughout my studies, as well as for thorough reading of my thesis and excellent suggestions for improvements. I am deeply grateful to my mentor, Dr. Penny Le Couteur, who always believed in me and encouraged me to fly high. Penny has been an amazing role model as a great scientist, a good mother and a wonderful person. Many thanks to Dr. Muriel David, Susan Chen and Robyn Seipp for their great collaborations, ideas and input. This project would not have been a success without help from hardworking undergraduate project students, Alonso Garduno and Jennifer Hartikainen, as well as excellent technical assistance from Andy Johnson in flow cytometry, Kyung-Bok Choi, Linda L i and Bing Cai in molecular biology and immunology, and Ray Gopaul in in vivo experimentation. I would like to acknowledge the National Cancer Institute of Canada, Canadian Institutes of Health Research, Canadian Network for Vaccines and Immunotherapeutics, Prostate Cancer Research Foundation of Canada and Genemax, Inc. for providing grant support. I am grateful to all my wonderful labmates, especially Cheryl, Robyn, Anna, Kyla, Meimei and Kaan, for discussions and input, for being with me in good and in bad times at the lab, and of  xix course for all the good times we had together. I would also like to thank past and present members of the Biomedical Research Centre and Michael Smith Laboratories for their help, friendship and for a wonderful work environment. Finally, I would like to thank my parents, sister and grandparents for their unconditional love and support all these years. Very special thanks to Simon for his love and encouragement all along, especially over the miles in the past 3.5 years. This separation has been very difficult, but will hopefully only make us stronger. At the same time, this gave me an interesting thesis-writing experience up in the sky above every continent in-between Vancouver and Boston.  XX  Dedication This thesis is dedicated to my mother, Christiana Budiono, for her unconditional love, support and tireless encouragement from 12,783 km away.  xxi  Co-Authorship Statement Dr. Muriel D. David (Biomedical Research Centre, Vancouver, BC) provided guidance and technical help with promoter analysis, chromatin immunoprecipitation and luciferase assays reported in this thesis. She also performed the P-galactosidase assays and their data analysis reported in Chapter 2. . Susan S. Chen (Department of Zoology, University of British Columbia, Vancouver, BC) trained and helped me to master new laboratory techniques during the early stage of my doctoral research. Dr. John Hiscott (Lady Davis Institute of Medical Research, M c G i l l University, Montreal, QC) provided the interferon regulatory factor (IRF) expression vectors and the interferon beta ( I F N - P ) promoter construct reported in Chapter 2. Robyn P. Seipp (Department of Zoology, University of British Columbia, Vancouver, BC) performed the cytotoxicity (CTL) assays and C T L data analysis reported in Chapter 3. Jennifer  A . Hartikainen (Department  of Microbiology and  Immunology,  University of British Columbia, Vancouver, BC) provided help with the construction of truncated TAP-1 promoter constructs and the luciferase assays reported in Chapter 3. Rayshad Gopaul (Michael Smith Laboratories, Vancouver, BC) shared the duties with me in injecting mice, recording data and monitoring the animals during the in vivo experiment reported in Chapter 3. I performed all the other experiments and data analyses reported in this thesis.  GENERAL  1  INTRODUCTION  Chapter 1 : General Introduction Recognition of pre-cancerous and virus-infected cells by our immune system is critical for protecting us against malignant cells and viral infections. The host's immune system has the potential to kill abnormal cells before they become malignant cancers; however, many cancer cells have defects in components of the antigen processing and presentation pathways that allow them to avoid detection by the immune system [1-4]. One of the key components that is often missing in tumors is a heterodimer of the Transporters associated with Antigen Processing (TAP)-l and TAP-2 molecules that normally functions in transporting self-, virus-, or tumor-derived peptides into the endoplasmic  reticulum,  in  which  the  peptides  can  be  loaded  into  Major  Histocompatibility Complex (MHC) class I molecules. In a functional pathway, the M H C class I - peptide complexes are then transported via the Golgi and further displayed on the cell surface, where they can be recognized by the circulating cytotoxic T lymphocytes (CTLs). The CTLs function to bind to and eventually kill the cancer or virus-infected cells. The importance of TAP-1 function in immunosurveillance has been highlighted in previous studies that demonstrated that by restoring TAP-1 expression in TAP-deficient cancer cells, the entire M H C class I antigen presentation pathway can be reconstituted, leading to the elimination of the cancer cells by CTLs [1, 5-8]. However, the mechanisms underlying TAP-1 downregulation in cancer cells remain poorly understood [7]. The goal of this research is to contribute to a better understanding of the mechanisms that lead to TAP  downregulation in malignant cells, as well as to further characterize novel  transcriptional regulators of TAP-1.  GENERAL  INTRODUCTION  2  1.1 Overview of the Immune System The immune system that protects organisms from infections is divided into 2 components: the innate and the adaptive immune system. Innate immune systems, which are found in nearly all living organisms, provide an immediate, non-specific response against all invading pathogens [9, 10]. Jawed vertebrates possess another layer of protection provided by the adaptive immune system that elicits delayed, but specific and long-lasting immune responses against pathogens, as well as pre-cancerous cells that express tumor-specific antigens [10]. Tumor specific antigens can be classified either as self- or non-self antigens, depending on their origin. Tumor-specific antigens in cells transformed by viral infection, such as human papillomaviruses (HPV), the Epstein-Barr virus ( E B V ) a n d the human herpesvirus-8 (HHV-8), are mainly derived from viral proteins and can potentially be recognized by the host's immune system as non-self antigens [11]. Alternatively, tumors may develop from spontaneous transformation of normal cells, for example, due to mutations of self molecules [12]. Although T-cell receptors  (TCRs) can often  discriminate even single amino acid changes in peptides, thus allowing activated T cells to recognize cancer cells that express mutated self peptides bound to M H C class I molecules [12], immunotherapy approaches for these types of tumors are facing great challenges due to low immunogenicity against cells that express self antigens. Additional special strategies, such as vaccination and breaking of tolerance [11, 12], are required to be implemented in parallel with the treatments in order to enhance immune responses against the abnormal cells.  GENERAL  INTRODUCTION  3  1.2 Antigen Presentation Adaptive immunity relies on the ability of the T-cell receptors (TCRs) to distinguish between self and non-self molecules, bound by M H C molecules and presented on the cell surface. Presentation of peptides derived from self proteins on a cell surface does not normally trigger immune response, since T cells with the ability to recognize self-derived peptides are deleted during T-cell development in the thymus, in a process known as negative selection [10]. In contrast, recognition of cells that express foreign antigens or mutated self antigens by the T cells generally triggers a cascade of activation of components of the immune system, such as B cells, macrophages and other T cells, that leads to the elimination of the invading pathogens and the abnormal cells [10, 12].  1.2.1 Major Histocompatibility Complex (MHC) genetics The M H C locus that is located on chromosome 6 in humans and chromosome 17 in the mouse, contains the most polymorphic genes known in the living organisms [10]. M H C polymorphism is highly advantageous for the presentation of a wide range of diversity of peptides to T-cell receptors. In humans, the M H C is called the Human Leukocyte Antigen (HLA). In the mouse, the M H C genes are known as the H-2 genes. The cluster of M H C genes is divided into MHC class I, MHC class II and MHC class III genes. The organization of the M H C locus is similar in both species, although the H-2k gene in the mouse is translocated to the edge of the M H C gene cluster, near the Tapbp gene and the centromere (Figure 1.2.1.1). There are three main M H C class I genes in both species: HLA-A, -B and -C in humans, or H-2k, -d and -/ in the mouse. The M H C class II region includes the genes for H L A - D P , -DQ and -DR in humans, or H-2A and -E  GENERAL  4  INTRODUCTION  in the mouse. M H C class III region includes the genes encoding various other immune function proteins, including the complement proteins C4, C2 and factor B, as well as the tumor necrosis factor (TNF)-a and lymphotoxin.  Gen* structure a( tht human PHC  DO  DP OH ffl#8P (3 a a « p  LMPfW  1 (5 «  DR P p a  _ n r\r\ \jr\t~ MT] n r i .njTJ/i~4TiT^n i  r  liii  LJI ' ™J L_J i_J Gil L&J KE WSJ _JI  &  C  _r  _ M  «J iLJ L«J  ;  Gene structure ai the rnoiiea MHC H _ 0 iPK  * i  M  * i  n « ||  O A UlrVW  j  r—— ' s  P pa  E  f—'—t  pa  1 1 LrUU  D  L  _r^_r  ' Janeway C , et al., 2001. Copied under license from Access Copyright. Further reproduction prohibited.  Figure 1.2.1.1: Genetic organization of human and mouse M H C genes (image reprinted from reference no. [10], by permission).  GENERAL  1.2.2  5  INTRODUCTION  MHC molecules A n M H C molecule functions by binding peptide fragments and presenting the  complex on the cell surface. A c t i v a t i o n of immune responses only occurs upon T C R recognition of a complex of a foreign peptide or a mutated self peptide bound to an M H C molecule on the cell surface. The M H C molecules are divided into 2 classes: M H C class I and M H C class II molecules, which differ in their structure, their expression pattern on tissues, and the types and sizes of antigen presented [10]. M H C class I molecules are expressed on the surface of all nucleated cells, whereas M H C class II molecules are normally present only on B cells and on special antigen-presenting cells (APCs): dendritic cells and macrophages. M H C class I molecules generally present short (8-10 amino acids) intracellularly-derived peptides, such as viral antigens and tumor-specific antigens. Recognition of M H C class I - peptide complexes by specific TCRs on C D 8  +  cytotoxic T lymphocytes (CTLs) triggers the activation of CTL responses that ultimately result in killing of the virus-infected or cancerous cells. M H C class II molecules are capable of presenting longer (i.e., more than 13 amino acids) extracellularly-derived peptides, such as peptides generated from bacterial proteins. Peptides bound by M H C class II molecules can be recognized by C D 4 T cells, also known as T helper (Th) cells, +  which mainly function to activate other effector cells of the immune system. M H C class II antigen presentation and the importance of Th cells in cancer immunity will be further discussed in section 1.2.5.  GENERAL  6  INTRODUCTION  1.2.3 MHC class I antigen presentation T h e w o r k i n this thesis focuses o n the presentation o f t u m o r - s p e c i f i c antigens b y M H C class I m o l e c u l e s , since the r e c o g n i t i o n o f neoplastic c e l l s b y C D 8  +  C T L s has been  s h o w n to b e one o f the m o s t important events r e q u i r e d f o r a n e f f e c t i v e anti-tumor response [13]. M H C class I m o l e c u l e s generally present peptides that are generated i n t r a c e l l u l a r l y , hence the name endogenous antigens. V i r a l antigens a n d t u m o r - s p e c i f i c antigens are e x a m p l e s o f intracellularly-derived proteins. I n s o m e cases, M H C class I molecules  c a n present  peptides d e r i v e d f r o m e x t r a c e l l u l a r p r o t e i n s , o r e x o g e n o u s  antigens, i n a process c a l l e d cross presentation [14, 15]. T h i s thesis f o c u s e s o n the study o f t u m o r antigen presentation v i a the c l a s s i c a l M H C class I antigen presentation p a t h w a y ( F i g u r e 1.2.3.1).  Figure 1.2.3.1: M H C class I antigen presentation pathway ( i m a g e reprinted f r o m reference n o . [7], b y p e r m i s s i o n ) .  GENERAL  INTRODUCTION  7  In this pathway, endogenous proteins are degraded into smaller peptides by the action of multicatalytic enzyme subunits of the proteasome. The peptides are then transported by a heterodimer transporter that consists of TAP-1 and TAP-2 subunits into the lumen of endoplasmic reticulum (ER), in which M H C class I heavy chains are synthesized de novo, folded and coupled with beta-2 microglobulin ((32m) molecules in a process assisted by chaperone proteins (BiP, calnexin, calreticulin, ERp57 and tapasin) [16, 17]. In the lumen of ER, the peptides are loaded into an M H C class I heavy chain/(32m molecule, forming a stable ternary complex that can be transported onto the cell surface via the trans-Golgi network. The host's cytotoxic T lymphocytes (CTLs) have the potential to recognize neoplastic cells that express tumor-specific antigens on their surface, and furthermore, to kill the abnormal cells through the release of cytolytic granules: perforin and granzymes [10].  1.2.4 Transporters associated with Antigen Processing (TAP) structure and function TAP-1 and TAP-2 molecules belong to the superfamily of ATP-binding cassette (ABC) transporters, one of the largest protein families that span bacteria to humans. They are characterized by the presence of two cytoplasmic ATP-binding domains and two hydrophobic transmembrane domains (TMDs) [7, 18] (Figure 1.2.4.1). Most A B C transporters function by transporting a broad range of substrates, including amino acids, lipids, sugars, ions and drugs, across membranes by using the energy obtained from ATP hydrolysis [18, 19]. The TAP transporter, which consists of a heterodimer of TAP-1 and TAP-2 molecules embedded in the membranes of the endoplasmic reticulum (ER) and cz's-Golgi, specializes in transporting endogenous peptides from the cytosol into the  GENERAL lumen  INTRODUCTION  8  o f E R [ 7 , 2 0 , 2 1 ] . T h e energy  resulted  from  A T P hydrolysis  triggers  c o n f o r m a t i o n a l changes i n the nucleotide-binding d o m a i n ( N B D ) and the T M D s , c a u s i n g the b i n d i n g and m o v e m e n t o f peptides across the E R m e m b r a n e [21].  TAP1  TAP2  Figure 1.2.4.1: A heterodimer of the T A P - 1  and T A P - 2 molecules (image  reprinted f r o m reference no. [7], b y p e r m i s s i o n ) .  1.2.5 MHC class II antigen presentation and CD4* T cells in cancer immunity In the M H C class II antigen presentation p a t h w a y ( F i g u r e 1.2.5.1), e x t r a c e l l u l a r proteins are e n d o c y t o s e d into intracellular vesicles a n d degraded into peptides b y the a c t i o n o f cathepsins i n the vesicles. S i m i l a r l y to the M H C class I m o l e c u l e s , the M H C class II m o l e c u l e s are s y n t h e s i z e d de novo  inside the e n d o p l a s m i c r e t i c u l u m ( E R ) . A n  invariant c h a i n (Ii) m o l e c u l e b i n d s i n the groove o f a n e w l y s y n t h e s i z e d M H C class II m o l e c u l e to prevent the b i n d i n g o f peptides i n the E R . T h e M H C class II - I i c o m p l e x is then transported f r o m the E R into a v e s i c l e , c a l l e d the M H C class II c o m p a r t m e n t ( M I I C ) , w h e r e I i i s t r i m m e d into a short f r a g m e n t — c a l l e d the C L I P p e p t i d e — t h a t is still b o u n d to the M H C class II groove. A peptide-loaded v e s i c l e then fuses w i t h the M I I C ,  GENERAL  INTRODUCTION  9  where CLIP is removed by H L A - D M and antigenic peptides are loaded onto M H C class II molecules. The M H C class II - peptide complexes are then transported to the cell surface for surveillance by C D 4 T-helper (Th) cells. +  MHC class I (/peptide rtace expression  antigen proteolysis  class If peptide oading  <  ( (  >  Endoplasmic reticulum MHC class II Ii complex  li chain  MHC class I)  HLA-DM  Figure 1.2.5.1: M H C class II antigen presentation pathway (image reprinted from reference no. [22], by permission).  The two main subsets of C D 4 Th cells are the T h l and Th2 cells. They are +  classified based on their distinct cytokine production patterns [23]. The T h l cells are particularly important for antitumor immunity due to their ability to produce interferon gamma (IFN-y), tumor necrosis factor alpha (TNF-a) and interleukin-2 (IL-2), which are important for the development and sustained proliferation of C D 8 CTLs [24, 25]. The +  Th2 cells are predominantly involved in humoral immune response, producing IL-4 and IL-5 that stimulate antibody production by activated B cells [24]. The presence of a large number of Th2 cells in a tumor microenvironment generally impairs tumor immunity due  GENERAL  INTRODUCTION  10  to their p r o d u c t i o n o f IL-10 and TGF-(3 that act as i m m u n o s u p p r e s s i v e c y t o k i n e s [ 2 6 , 2 7 ] . H o w e v e r , i n rare cases, T h 2 c e l l s can produce natural antibodies against t u m o r s [28]. A s i m p l i f i e d d i a g r a m o u t l i n i n g c o m p l e x interactions between t u m o r c e l l s , p r o f e s s i o n a l antigen-presenting c e l l s a n d various l y m p h o c y t e s is s h o w n i n F i g u r e 1.2.5.2 b e l o w .  Figure 1.2.5.2: The complex interaction between a tumor cell, professional antigen-presenting cells, CTLs, Th cells, B cells and other lymphocytes in the tumor microenvironment. A (+) s i g n indicates a n a c t i v a t i n g s i g n a l o n the a n t i t u m o r response w h i l e a (-) s i g n indicates an i n h i b i t o r y effect ( i m a g e reprinted f r o m reference n o . [24], b y p e r m i s s i o n ) .  GENERAL  11  INTRODUCTION  1.3 Disruption of the MHC Class I Antigen Processing Pathway and the Development of Tumors Forty to ninety percent of H L A (or M H C in the mouse) class I-positive precursors of human tumors are found to develop into H L A class I-negative tumors [29]. T A P deficiency is one of the common phenotypes that distinguish malignant transformed cells from their normal precursors [20]. T A P downregulation leads to the disruption of the process by which tumor-specific peptides are transported into the lumen of E R and loaded onto M H C class I - P 2 m complex [1]. As a consequence, no stable complex of tumor peptide - M H C class I can be presented on the cell surface, rendering the abnormal cell to stay undetected by the immune surveillance. Downregulated or total loss of expression of TAP-1 and TAP-2 has been observed in many tumor cell lines and surgically-removed  tumor  specimens,  such as  Hodgkin's lymphoma, myeloma,  melanoma and many types of carcinomas, such as, colorectal, cervical, breast, lung, prostate, renal cell and hepatocellular carcinomas [1, 2, 4]. Interestingly, the level of TAP-1 downregulation in carcinomas was found to significantly correlate with tumor progression and reduced survival [1, 7, 8, 20]. The downregulation is more often caused by regulatory defects rather than by structural defects due to mutations within the TAP-1 gene itself [2, 4]. Other mechanisms that lead to an impaired M H C class I antigen presentation in tumor cells include the loss of one copy of the chromosome in which M H C class I genes are located, structural alterations, methylation, or deregulation of genes coding for the M H C class I heavy chain and P 2 m , as well as of those coding for antigen processing machinery (APM) components, such as Tapasin, and the proteasome subunits: LMP-2 and LMP-7 [4, 30].  GENERAL  12  INTRODUCTION  Based on surface M H C class I expression levels, a major anti-tumor mechanism other than that exerted by the C D 8 CTLs is provided by natural killer (NK) cells [31]. +  CD8 CTLs recognize and destroy target cells that express the surface M H C class I-tumor antigen complex, whereas N K cell activity is triggered upon recognition of cells that do not express surface M H C class I, since M H C class I molecules generally serve as ligands for N K cell inhibitory receptors [31]. N K cell-mediated cytotoxicity is regulated by a balance of signals transmitted by activating and inhibitory receptors. Unfortunately, N K cell infiltration is generally low in neoplastic tissues [29] and the N K activating signal is often hampered by immunosuppressive cytokines, such as TGF-[3, within the tumor microenvironment [13, 32]. Therefore, N K cell-mediated cytotoxicity is generally not sufficient to provide complete protection against a large proportion of cancer cells with down-regulated expression of M H C class I. Further research is needed in order to create ways to attract more N K cells into neoplastic tissues and to make the N K cell activating signal more favorable within the tumor microenvironment.  GENERAL  INTRODUCTION  13  1.4 TAP-based Immunotherapy The importance of TAP-1 function in immunosurveillance against cancers has been highlighted in several studies that demonstrated the reconstitution of M H C class I antigen presentation upon restoration of TAP-1 expression in cancer cell lines exhibiting downregulated expression of several A P M components [27, 33]. This finding is encouraging for the development of a general immunotherapy method for different types of cancers that possess multiple deficiencies of A P M components. Moreover, reconstitution of TAP 1 function in highly metastatic, M H C class I-deficient murine lung carcinoma and melanoma cell lines, CMT.64 and B16, respectively, has been shown to improve immune recognition of the cancer cells in vivo, resulting in a decrease of tumor growth and metastatic ability [5, 20, 34]. Restoration of TAP-1 alone resulted in an improved ability of cancer cells to present viral and/or tumor-specific peptides, yielding similar anti-viral and anti-tumor effects as those resulted from the induction of both TAP-1 and TAP-2, whereas expression of TAP-2 alone did not show the effects [6, 35, 36]. This may be caused by instability of TAP-2 molecule in the absence of pre-existing TAP-1, whereas TAP-1 molecule and assembled T A P heterodimer are highly stable in vivo [5, 6]. Heterodimerization of TAP subunits is required to protect TAP-2 from rapid degradation by a proteasome-dependent pathway [21]. These observations indicate that induction of TAP-1 expression is an important aspect that shall be considered in the development of immunotherapy for various types of cancers. The TAP-based immunotherapy approach possesses several advantages over many other immunotherapy methods. One of the advantages is that T A P is a component of normal cells, and to-date, no toxicity or autoimmunity reaction has been observed in  GENERAL  INTRODUCTION  14  animal tumor models that were given TAP-based therapy [21]. Therefore, based on the low risk of toxicity, it may not be necessary to target TAP exclusively into the cancer cells. This would make T A P an attractive candidate for cancer gene therapy since the development of methods to deliver an efficient dose of therapeutic gene remains the primary challenge in cancer gene therapy [6]. Another advantage of TAP-based therapy is that it is not restricted by the haplotype of M H C molecules and the type of tumor antigens, since T A P molecules act independently of the two factors [37]. M H C polymorphism and various types of tumorassociated antigens—many of them not yet characterized—remain as challenges in the development of immunotherapy approaches [6, 36]. Finally, recent studies have demonstrated that recombinant TAP could be used as a novel, non-toxic adjuvant that increases vaccine efficiency [38-41]. Adverse responses to standard doses of inocula are common problems encountered in vaccination, due to toxicity of vaccine components [42]. With the use of an adjuvant, immune responses could potentially be triggered by administering lower doses of inocula, thus decreasing the risk of adverse side effects. This finding denotes the importance of TAP, which is to be considered in the development of vaccines against cancers and widespread infectious diseases.  GENERAL  INTRODUCTION  15  1.5 Regulation of TAP-1 Expression The goal of this thesis is to gain an understanding of how Tap-1 gene expression is impaired in metastatic carcinomas. Initially, this work was focused on transcriptional regulation of TAP-1, since the TAP-1 downregulation observed in many carcinomas occurred at the mRNA level [5, 6, 43]. This work was then expanded to study epigenetic mechanisms that often also play significant roles in the regulation of gene expression [44]. Defects in translational mechanisms can also contribute to the impairment of a gene expression; however, translational regulation of TAP-1 is beyond the scope of this thesis.  1.5.1 Organization of Tap and Lmp genes within the mouse MHC class II locus The genes encoding TAP-1 and TAP-2 molecules are located within the M H C class II region, in close association with the genes encoding two proteasomal subunits: low-molecular-mass polypeptides (LMP)-2 and L M P - 7 [7, 10]. Multicatalytic enzyme subunits of the proteasome are capable of degrading intracellular proteins into smaller peptides that can be loaded into the lumen of the endoplasmic reticulum by a heterodimer of TAP-1 and TAP-2 molecules. A diagram outlining the organization of these genes within the mouse M H C class II locus is shown in Figure 1.5.1.1 below.  L M P - Z •570 bp  TAP-1  660 bp  2175 bp  1611 bp  LMP-7 ] 831 bp  3862 bp  TAP-2 2109 bp  Figure 1.5.1.1: Organization of Tap and Lmp genes in the mouse MHC class II locus. The sizes of the coding sequences (CDS) and intergenic regions are shown in the diagram.  GENERAL  INTRODUCTION  16  In humans, it was found that a bi-directional promoter of LMP-2 and TAP-1 genes is located in the 593 bp region in-between the two genes [45]. This promoter contains GC-rich regions characterizing putative Sp-1 binding sites, but does not contain a T A T A boxT At least 18 transcriptional start sites of TAP-1 gene were found within the promoter. This finding of multiple transcriptional start sites is consistent with observations in other TATA-less, GC-rich promoters [46]. Prior to the work in this thesis, mouse TAP-1 promoter had never been cloned and analysed. This work is described for the first time in Chapter 2.  1.5.2 Possible mechanisms of TAP-1 mRNA downregulation in carcinomas Several mechanisms tested in this thesis include: 1.5.2.1 Transcriptional mechanisms Reduced transcription of Tap-1 gene could be caused by mutations in cw-acting consensus sequences within its promoter. This might lead to the inability of important transcription factors to recognize and to bind to the mutated D N A template in the promoter.  Other possible mechanisms  include overexpression of transcriptional  repressors and/or the lack of ^ram-activators binding to the TAP-1 promoter.  1.5.2.2 Post-transcriptional mechanisms Degradation of mRNA transcripts is a normal turnover process of coordinated gene expression [44, 47, 48]! Stability of an mRNA depends on its structure and sequence, such as the presence of a cap in its 5' end that protects against 5'-3' exonucleases, the presence of de-stabilizing sequences, for example AU-rich elements  GENERAL  INTRODUCTION  (ARE) in the 3'-untranslated  17 region (3'UTR), and the length of poly-adenylated  (poly(A)) sequence in its 3' end that protects against 3'-5' exonucleases [44]. Gene mutation and/or aberrant expression of RNA-binding proteins with the ability to either promote or inhibit mRNA degradation might lead to accelerated rate of mRNA degradation, thus reduced expression of the gene.  1.5.2.3 Epigenetic mechanisms Epigenetic mechanism is described as a heritable change in gene expression that occurs without a change in D N A sequence [49]. Epigenetic modifications affect gene expression through modulation of chromatin structures and/or D N A methylation [44]. Epigenetic mechanisms could provide an extra layer of transcriptional control that regulates how genes are expressed, by modulating the interaction between histone and D N A complexes [49]. This would in turn affect the accessibility of D N A templates by transcriptional machinery. The key event that leads to the modulation of chromatin structures is the modification of N-terminal tails of the histone proteins, particularly of histone H3 and H4 [44]. Known modifications of histone proteins include: acetylation, methylation, phosphorylation, ubiquitination and sumoylation [44, 50-54]. To-date, histone acetylation is the most widely studied mechanism. A high level of acetylated core histones in a chromatin template, particularly in the proximal region of an acetylation-sensitive promoter [55, 56], has been associated with transcriptionally active sites [50, 51, 53, 56, 57]. The acetylation of N-terminal lysines of histones neutralizes positive charges in the proteins, thus loosening histone-DNA contacts and increasing the accessibility of transcription factors to the D N A template [56].  GENERAL INTRODUCTION  18  Epigenetic abnormalities have been found to be responsible for development of several cancers, genetic disorders and autoimmune diseases [49]. In parallel with the investigation of genetic-related mechanisms, epigenetic modifications are clearly important to be considered in the study of gene regulation.  GENERAL  INTRODUCTION  19  1.6 Synopsis of Thesis Objectives, Hypotheses and Results Chapter 2 focuses on elucidating the mechanisms underlying the transcriptional deficiency of TAP-1 in several metastatic murine carcinoma cell lines. The hypothesis tested was whether the deficiency is caused by mutations in c/s-acting elements of the TAP-1 promoter, the lack of transcription factors binding to TAP-1 promoter, overexpression of transcriptional repressors, and/or post-transcriptional defects. Experimental outcomes showed no mutation in cw-acting elements of the TAP-1 promoter, and that TAP-1 downregulation is caused by the lack of transacting factors binding to TAP-1 promoter and accelerated degradation of TAP-1 mRNA. .  The work in Chapter 3 aims to study the epigenetic regulation of TAP-1 expression and antigen processing in malignant cells. The hypothesis is that TAP-1 transcription is controlled by epigenetic mechanisms that regulate the permissive/repressive state of nucleosomal structure around the TAP-1 locus, thus controlling the accessibility of the D N A template by R N A pol II complex and general transcription factors. Experimental results revealed the lack of histone H 3 acetylation in TAP-1 promoter as an epigenetic mechanism that is likely to contribute to a condensed nucleosomal structure around the TAP-1 promoter in TAP-deficient cells, thus preventing the binding of transcriptional activators to the promoter.  •  Chapter 4 describes the characterization of several novel TAP-1 activator gene candidates obtained by cDNA library screenings. With the assumption that TAP-1 regulator genes are present in the highly complex c D N A library used, the hypothesis tested was that expression of genes (cDNAs) that have the ability to up-regulate TAP-  GENERAL  INTRODUCTION  20  1 promoter activity would enhance the expression of TAP-1 and surface M H C class I in TAP- and M H C class I-deficient carcinoma cells. Several TAP-activator gene candidates were recovered from cells that showed up-regulated TAP-1 promoter activity upon infection with c D N A library retroviral supernatants. The overall objective of this research is to contribute to a better understanding of tumor antigen presentation deficiency and furthermore, to the development of effective immunotherapeutic strategies for the treatment of cancer.  GENERAL  INTRODUCTION  21  1.7 References 1.  Seliger, B., M J . Maeurer, and S. Ferrone. TAP off—tumors on. Immunol Today, 1997. 18:292-9.  2.  Seliger, B., M.J. Maeurer, and S. Ferrone. Antigen-processing machinery breakdown and tumor growth. Immunol Today, 2000. 21:455-64.  3.  Ritz, U . and B. Seliger. The transporter associated with antigen processing (TAP): structural integrity, expression, function, and its clinical relevance. Mol Med, 2001.7:149-58.  4.  Seliger, B., T. Cabrera, F. Garrido, and S. Ferrone. H L A class I antigen abnormalities and immune escape by malignant cells. Semin Cancer Biol, 2002. 12:3-13.  5.  Gabathuler, R., G. Reid, G. Kolaitis, J. Driscoll, and W.A. Jefferies. Comparison of cell lines deficient in antigen presentation reveals a functional role for TAP-1 alone in antigen processing. J Exp Med, 1994. 180:1415-25.  6.  Alimonti, J., Q.J. Zhang, R. Gabathuler, G. Reid, S.S. Chen, and W.A. Jefferies. TAP expression provides a general method for improving the recognition of malignant cells in vivo. Nat Biotechnol, 2000. 18:515-20.  7.  Lankat-Buttgereit, B. and R. Tampe. The transporter associated with antigen processing: function and implications in human diseases. Physiol Rev, 2002. 82:187-204.  8.  Kageshita, T., S. Hirai, T. Ono, D.J. Hicklin, and S. Ferrone. Down-regulation of H L A class I antigen-processing, molecules in malignant melanoma: association with disease progression. A m J Pathol, 1999. 154:745-54.  GENERAL 9.  INTRODUCTION  22  L i t m a n , G . W . , J.P. C a n n o n , and L.J. D i s h a w . R e c o n s t r u c t i n g i m m u n e p h y l o g e n y : n e w perspectives. N a t R e v I m m u n o l , 2 0 0 5 . 5:866-79.  10.  Janeway, C , P. T r a v e r s , M . W a l p o r t , and M . S h l o m c h i k . I m m u n o b i o l o g y : the i m m u n e system i n health and disease. 5th ed. 2 0 0 1 , N e w Y o r k , N Y G a r l a n d Publishing.  11.  K l e i n , G . and E. K l e i n . S u r v e i l l a n c e against tumors—is it m a i n l y i m m u n o l o g i c a l ? I m m u n o l Lett, 2 0 0 5 . 100:29-33.  12.  H o u g h t o n , A . N . and J . A . Guevara-Patino. I m m u n e r e c o g n i t i o n o f s e l f i n i m m u n i t y against cancer. J C l i n Invest, 2 0 0 4 . 114:468-71.  13.  T o m a s i , T . B . , W . J . M a g n e r , and A . N . K h a n . E p i g e n e t i c r e g u l a t i o n o f i m m u n e escape genes i n cancer. C a n c e r I m m u n o l I m m u n o t h e r , 2 0 0 6 . 55:1159-84.  14.  R o c k , K . L . and L. S h e n . Cross-presentation: u n d e r l y i n g m e c h a n i s m s and role i n i m m u n e surveillance. I m m u n o l R e v , 2 0 0 5 . 2 0 7 : 1 6 6 - 8 3 .  15.  C r e s s w e l l , P., A . L . A c k e r m a n , A . G i o d i n i , D.R. Peaper, and P . A . W e a r s c h . M e c h a n i s m s o f M H C class I-restricted antigen p r o c e s s i n g and cross-presentation. Immunol Rev, 2005. 207:145-57.  16.  G e r m a i n , R . N . and D . H . M a r g u l i e s . T h e b i o c h e m i s t r y and c e l l b i o l o g y o f antigen p r o c e s s i n g and presentation. A n n u R e v I m m u n o l , 1993. 11:403-50.  17.  C r e s s w e l l , P. and J . H o w a r d . A n t i g e n r e c o g n i t i o n . C u r r O p i n I m m u n o l , 1999. 11:61-3.  18.  A l t e n b e r g , G . A . T h e engine o f A B C proteins. N e w s P h y s i o l S c i , 2 0 0 3 . 18:191-5.  19.  C h a n g , G . M u l t i d r u g resistance A B C transporters. F E B S Lett, 2 0 0 3 . 5 5 5 : 1 0 2 - 5 .  GENERAL 20.  INTRODUCTION  23  Abele, R. and R. Tampe. Modulation of the antigen transport machinery T A P by friends and enemies. FEBS Lett, 2006. 580:1156-63.  21.  Keusekotten, K., R . M . Leonhardt, S. Ehses, and M.R. Knittler. Biogenesis of functional antigenic peptide transporter TAP requires assembly of pre-existing TAP1 with newly synthesized TAP2. J Biol Chem, 2006. 281:17545-51.  22.  Kelly, A . MHC class II antigen presentation, [website] 2006 [cited; Available from: http://www.path.cam.ac.uk/pages/kelly/image/.  23.  Murakami, H., H . Ogawara, and H . Hiroshi. Thl/Th2 cells in patients with multiple myeloma. Hematology, 2004. 9:41-5.  24.  Knutson, K . L . and M . L . Disis. Tumor antigen-specific T helper cells in cancer immunity and immunotherapy. Cancer Immunol Immunother, 2005. 54:721-8.  25.  Wang, J.C. and A . M . Livingstone. Cutting edge: CD4+ T cell help can be essential for primary CD8+ T cell responses in vivo. J Immunol, 2003. 171:633943.  26.  Kidd, P. Thl/Th2 balance: the hypothesis, its limitations, and implications for health and disease. Altern Med Rev, 2003. 8:223-46.  27.  Wahl, S.M., J. Wen, and N . Moutsopoulos. TGF-beta: a mobile purveyor of immune privilege. Immunol Rev, 2006. 213:213-27.  28.  Chamuleau, M.E., G.J. Ossenkoppele, and A . A . van de Loosdrecht. M H C class II molecules in tumour immunology: prognostic marker and target for immune modulation. Immunobiology, 2006. 211:619-25.  29.  Bubenik, J. M H C class I down-regulation: tumour escape from immune surveillance? Int J Oncol, 2004. 25:487-91.  GENERAL 30.  INTRODUCTION  24  Meissner, M . , T.E. Reichert, M . Kunkel, W. Gooding, T.L. Whiteside, S. Ferrone, and B. Seliger. Defects in the human leukocyte antigen class I antigen processing machinery in head and neck squamous cell carcinoma: association with clinical outcome. Clin Cancer Res, 2005. 11:2552-60.  31.  Garrido, F., F. Ruiz-Cabello, T. Cabrera, J.J. Perez-Villar, M . Lopez-Botet, M . Duggan-Keen, and P.L. Stern. Implications for immunosurveillance of altered H L A class I phenotypes in human tumours. Immunol Today, 1997. 18:89-95.  32.  Albertsson, P.A., P.H. Basse, M . Hokland, R.H. Goldfarb, J.F. Nagelkerke, U . Nannmark, and P.J. Kuppen. N K cells and the tumour microenvironment: implications for NK-cell function and anti-tumour activity. Trends Immunol, 2003. 24:603-9.  33.  Rook, A . H . , J.H. Kehrl, L . M . Wakefield, A . B . Roberts, M . B . Sporn, D.B. Burlington, H.C. Lane, and A.S. Fauci. Effects of transforming growth factor beta on the functions of natural killer cells: depressed cytolytic activity and blunting of interferon responsiveness. J Immunol, 1986. 136:3916-20.  34.  Seliger, B., U . Ritz, R. Abele, M . Bock, R. Tampe, G. Sutter, I. Drexler, C. Huber, and S. Ferrone. Immune escape of melanoma: first evidence of structural alterations in two distinct components of the M H C class I antigen processing pathway. Cancer Res, 2001. 61:8647-50.  35.  Agrawal, S., K. Reemtsma, E. Bagiella, S.F. Oluwole, and N.S. Braunstein. Role of TAP-1 and/or TAP-2 antigen presentation defects in tumorigenicity of mouse melanoma. Cell Immunol, 2004. 228:130-7.  GENERAL 36.  INTRODUCTION  25  Lou, Y., T.Z. Vitalis, G. Basha, B. Cai, S.S. Chen, K . B . Choi, A.P. Jeffries, W . M . Elliott, D. Atkins, B . Seliger, and W.A. Jefferies. Restoration of the expression of transporters associated with antigen processing in lung carcinoma increases tumor-specific immune responses and survival. Cancer Res, 2005. 65:7926-33.  37.  Scanlon, K.J. Cancer gene therapy: challenges and opportunities. Anticancer Res, 2004.24:501-4.  38.  Lazoura, E. and V . Apostolopoulos. Insights into peptide-based vaccine design for cancer immunotherapy. Curr Med Chem, 2005. 12:1481-94.  39.  Mocellin, S. Cancer vaccines: the challenge of developing an ideal tumor killing system. Front Biosci, 2005. 10:2285-305.  40.  Morris, E., D. Hart, L. Gao, A. Tsallios, S.A. Xue, and H. Stauss. Generation of tumor-specific T-cell therapies. Blood Rev, 2006. 20:61-9.  41.  Ruttinger, D., H . Winter, N . K . van den Engel, R.A. Hatz, M . Schlemmer, H . Pohla, S. Grutzner, D.J. Schendel, B.A. Fox, and K.W. Jauch. Immunotherapy of lung cancer: an update. Onkologie, 2006. 29:33-8.  42.  Vitalis, T.Z., Q.J. Zhang, J. Alimonti, S.S. Chen, G. Basha, A. Moise, J. Tiong, M . M . Tian, K . B . Choi, D. Waterfield, A . Jeffries, and W.A. Jefferies. Using the TAP component of the antigen-processing machinery as a molecular adjuvant. PLoS Pathog, 2005. I:e36.  43.  Seliger, B., D. Atkins, M . Bock, U . Ritz, S. Ferrone, C. Huber, and S. Storkel. Characterization of human lymphocyte antigen class I antigen-processing machinery defects in renal cell carcinoma lesions with special emphasis on  GENERAL  INTRODUCTION  26  transporter-associated with antigen-processing down-regulation. Clin Cancer Res, 2003. 9:1721-7. 44.  Lewin, B. Genes IX, ed. J. Louis C. Bruno. 2008, Sudbury, M A : Jones and Bartlett Publishers.  45.  Wright, K . L . , L.C. White, A. Kelly, S. Beck, J. Trowsdale, and J.P. Ting. Coordinate regulation of the human TAP1 and L M P 2 genes from a shared bidirectional promoter. J Exp Med, 1995. 181:1459-71.  46.  Azizkhan, J.C., D.E. Jensen, A.J. Pierce, and M . Wade. Transcription from TATA-less promoters: dihydrofolate reductase as a model. Crit Rev Eukaryot Gene Expr, 1993. 3:229-54.  47.  Benjamin, D., M . Colombi, G. Stoecklin, and C. Moroni. A GFP-based assay for monitoring post-transcriptional regulation of A R E - m R N A turnover. Mol Biosyst, 2006. 2:561-7.  48.  Hau, H.H., R.J. Walsh, R.L. Ogilvie, D.A. Williams, C.S. Reilly, and P.R. Bohjanen. Tristetraprolin recruits functional mRNA decay complexes to A R E sequences. J Cell Biochem, 2006.  49.  Rodenhiser, D. and M . Mann. Epigenetics and human disease: translating basic biology into clinical applications. Cmaj, 2006. 174:341-8.  50.  Berger, S.L. Histone modifications in transcriptional regulation. Curr Opin Genet Dev, 2002. 12:142-8.  51.  Legube, G. and D. Trouche. Regulating histone acetyltransferases and deacetylases. E M B O Rep, 2003. 4:944-7.  GENERAL 52.  INTRODUCTION  27  Mahadevan, L.C., A . L . Clayton, C A . Hazzalin, and S. Thomson. Phosphorylation and acetylation of histone H3 at inducible genes: two controversies revisited. Novartis Found Symp, 2004. 259:102-11; discussion 111-4, 163-9.  53.  Eberharter, A., R. Ferreira, and P. Becker. Dynamic chromatin: concerted nucleosome remodelling and acetylation. Biol Chem, 2005. 386:745-51.  54.  Iniguez-Lluhi, J.A. For a healthy histone code, a little SUMO in the tail keeps the acetyl away. A C S Chem Biol, 2006. 1:204-6.  55.  Gregory, P.D., K . Wagner, and W. Horz. Histone acetylation and chromatin remodeling. Exp Cell Res, 2001. 265:195-202.  56.  Struhl, K . Histone acetylation and transcriptional regulatory mechanisms. Genes Dev, 1998. 12:599-606.  57.  Eberharter, A . and P.B. Becker. Histone acetylation: a switch between repressive and permissive chromatin. Second in review series on chromatin dynamics. E M B O Rep, 2002. 3:224-9.  MECHANISMS  UNDERLYING  TAP  Chapter 2: Identification  DEFICIENCY  of  28  Mechanisms Underlying  TAP-1 Deficiency in Metastatic Murine Carcinomas 2.1 Introduction Antigen processing and presentation play a crucial role in immune surveillance. Peptides derived from self, viral, or tumor-related proteins are generated in the cytoplasm by the action of proteasome. Transporter associated with antigen processing (TAP), a member of the ATP-binding cassette (ABC) transporter family, functions by transporting these peptides from the cytoplasm to the lumen of the endoplasmic reticulum (ER), where each peptide forms a ternary complex with beta-2 microglobulin (p2m) and major histocompatibility complex (MHC) class I heavy chain, a process promoted by chaperone proteins (BiP, calnexin, calreticulin, ERp57 and tapasin) [1, 2]. These complexes are then transported to the cell surface and recognized by cytotoxic T lymphocytes (CTLs), which eventually kill cells that present non-self antigens. Studies have shown that components of the antigen presentation pathway are impaired in the majority of human tumor cells [3, 4], allowing them to evade immune surveillance. In particular, low expression or absence of TAP (TAP-1 and -2) molecules, a feature common to many tumors [5-7], impairs the formation of the ternary complex in the lumen of ER. This results in a lack of M H C class I expression on the cell surface. As  A version of this chapter has been published. Setiadi, A . F . , David, M . D . , Chen, S.S., Hiscott, J., and Jefferies, W.A. (2005) Identification of Mechanisms Underlying T A P Deficiency in Metastatic Murine Carcinomas. Cancer Research. 65: 7485-92. © Cancer Research, 2005, 65: (16), adapted by permission.  MECHANISMS UNDERLYING TAP DEFICIENCY  29  a consequence, specific CTLs are unable to recognize and destroy many malignant cells [6]. The importance of TAP-1 function in immunosurveillance has been highlighted in studies using a mouse lung carcinoma cell line, CMT.64 [8]. It was demonstrated that the restoration of TAP-1 expression by introducing exogenous TAP-1 or by up-regulating endogenous TAP-1 expression upon interferon gamma (IFN-y) treatment, could correct the M H C class I deficiency, resulting in recognition of these antigen-presenting cells by CTLs in vitro, as well as in a decrease of tumor growth and incidence in vivo [3, 7, 9]. This finding is encouraging for the development of therapeutic approaches that could restore T A P deficiencies in cancer cells, therefore resurrecting immune recognition of neoplastic cells. However, the mechanisms underlying TAP-1 deficiency in tumor cells remain poorly understood. Previous studies reported that downregulation of TAP-1 expression in many cancer cells likely occurs at the mRNA level [3, 7, 10]; however, these studies did not distinguish between defects in transcription or stability of the R N A . Therefore, in this study, the properties and activities of the T A P - l / L M P - 2 bi-directional promoter in TAP-expressing and TAP-deficient cells were investigated in order to provide a better understanding of the transcriptional regulation of TAP-1 mRNA in tumor cells.  © Cancer Research, 2005, 65: (16), adapted by permission.  MECHANISMS  30  UNDERLYING TAP DEFICIENCY  2.2 Materials and Methods 2.2.1 Cell lines The CMT.64 cell line established from a spontaneous lung carcinoma of a C57BL/6 (H-2 ) mouse [8] and the Ltk fibroblast cell line derived from a C3H/An (H-2 ) b  k  mouse were grown in D M E M media. The L M D cell line derived from a metastatic prostate carcinoma of a 129/Sv mouse (a kind gift of Dr. T. C. Thompson) [11], as well as the B16F10 (B16) melanoma [12] and R M A lymphoma cell lines, both derived from C57BL/6 mice, were maintained in RPMI 1640 media. RPMI 1640 and D M E M media were supplemented with 10% heat-inactivated FBS, 2 m M L-glutamine, 100 U/ml penicillin, 100 pg/ml streptomycin, and 10 m M HEPES.  2.2.2 Reverse transcription-PCR analysis A l l primers used for P C R amplifications were purchased from Sigma-Genosys, Oakville, O N , and are listed in Table 2.2.2.1. Total cellular R N A were extracted using RNeasy Mini Kit (Qiagen, Mississauga, ON), and contaminating D N A was removed by treating the R N A samples with DNase 1 (Ambion Inc., Austin, TX). Reverse transcription of 1 ug of total cellular R N A was performed using the reverse transcription kit from Invitrogen (Carlsbad, CA), in a total volume of 20 pi. Two microliters aliquots of cDNA were used as a template for PCR in a total of 50 pi reaction mixture containing l x PCR buffer, 250 u M deoxynucleotide triphosphate, 1.5 m M M g C l , 0.2 u M of each 2  primer and 2.5 units Platinum Taq D N A Polymerase. A l l PCR reagents were obtained from Invitrogen. c D N A amplifications were carried out with specific primer sets in a T-  © Cancer Research, 2005, 65: (16), adapted by permission.  MECHANISMS UNDERLYING TAP DEFICIENCY gradient thermocycler  (Biometra, Goettingen, Germany) with 25-35  31 cycles of  denaturation (1 min, 95°C), annealing (1 min, 54-64°C), and elongation (2 min, 72°C). The cycling was concluded with a final extension at 72°C for 10 min. Twenty microliters of amplified products were analysed on agarose gels, stained with ethidium bromide and photographed under U V light.  © Cancer Research, 2005, 65: (16), adapted by permission.  MECHANISMS  32  UNDERLYING TAP DEFICIENCY  Table 2.2.2.1: Primers used for RT-PCR analysis. Oligonucleotide  P r i m e r sequence ( 5 ' - 3 ' )  Mouse P-actin  F: A T G G A T G A C G A T A T C G C T G C R:  T A P - 1 5'-end  a  Tm(°C)  bp  b  54.0  713  63.0  138  64.0  775  61.0  155  60.0  557  61.0  190  62.0  225  54.9  363  54.0  328  60.0  357  58.0  239  TTCTCCAGGGAGGAAGAGGAT  F: A T G G C T G C G C A C G T C T G G R: A C T C A G G C C C A C C A C C C A F: T G G C T C G T T G G C A C C C T C A A A  T A P - 1 3'-end  R: T C A G T C T G C A G G A G C C G C A A G A T A P - 1 3^-end  F: T T A T C A C C C A G C A G C T C A G C C T  (last 155 b p )  R: T C A G T C T G C A G G A G C C G C A A  TAP-1 promoter  0  F: c g g a a t t c G G C T C G G C T T T C C A A T C A R:gaggatccGAGCGTGAGCTGTCCAGAGTCT  pTAP-l-EGFP  F (TAP-1 promoter): T T C T T C C T C T A A A C G C C A G C A R (EGFP): C T C G C C C T T G C T C A C C A T  C M T . 6 4 TAP-1  F: C T C A C T C T G G T C A C C C T G A T C A A C R: T G G T C C A G A C T T C A G C C A C G  IRF1  F: C A A C T T C C A G G T G T C A C C C A T R: C A C A G G G A A T G G C C T G G A T  IRF2  F: T G A T G A A G A G A A C G C A G A G G G R: T T A A C A G C T C T T G A C A C G G G C F: T T C C G C A A G T T C A C C T A C C  S15  R: C G G G C C G G C C A T G C T T T A C G Prion protein  F: A T G G C G A A C C T T G G C T A C T R: C C A A C T A C C A C C A T G A G G T T G  a  F: f o r w a r d p r i m e r ; R: reverse p r i m e r .  b  L e n g t h o f the P C R a m p l i f i c a t i o n product.  L  R e s t r i c t i o n e n z y m e sites are u n d e r l i n e d .  © C a n c e r R e s e a r c h , 2 0 0 5 , 6 5 : (16), adapted b y p e r m i s s i o n .  MECHANISMS  UNDERLYING TAP  33  DEFICIENCY  2.2.3 Chromatin immunoprecipitation (ChIP) assays C h r o m a t i n i m m u n o p r e c i p i t a t i o n experiments u s i n g 2 x 1 0  7  cells o f C M T . 6 4 ,  L M D , B 1 6 , L t k or R M A c e l l lines w e r e p e r f o r m e d as d e s c r i b e d i n A p p e n d i x A . 1. F i v e m i c r o g r a m s o f a n t i - R N A p o l y m e r a s e II a n t i b o d y (N-20, sc-899, Santa C r u z ) was used f o r the i m m u n o p r e c i p i t a t i o n . L e v e l s o f m u r i n e T A P - 1 p r o m o t e r or T A P - 1 c o d i n g r e g i o n coi m m u n o p r e c i p i t a t i n g w i t h R N A p o l y m e r a s e II f r o m each sample w e r e q u a n t i f i e d b y real t i m e P C R , u s i n g p r i m e r s s p e c i f i c f o r the T A P - 1 p r o m o t e r or the last 155 b p o f  TAP-1  c o d i n g r e g i o n ( 3 ' e n d ) as listed i n T a b l e 2.2.2.1. S e r i a l d i l u t i o n s o f g e n o m i c D N A o r p l a s m i d c o n t a i n i n g the m u r i n e T A P - 1 p r o m o t e r w e r e u s e d to generate standard curves f o r real t i m e P C R u s i n g the c o r r e s p o n d i n g p r i m e r sets.  2.2.4 Cloning of the TAP-1  promoter  Sequence o f the m u r i n e Tap-I gene r e g i o n w a s obtained f r o m the N a t i o n a l C e n t e r f o r B i o t e c h n o l o g y I n f o r m a t i o n database ( G e n B a n k A c c e s s i o n N o . A F 0 2 7 8 6 5 ) . I n order to predict putative t r a n s c r i p t i o n factor b i n d i n g sites, the r e g i o n in-between Lmp-2 and Tap-I genes was a n a l y s e d u s i n g the M a t i n s p e c t o r software f r o m G e n o m a t i x website. T h e predicted m u r i n e T A P - 1 p r o m o t e r r e g i o n w a s then a m p l i f i e d b y P C R , u s i n g g e n o m i c DNA  from  CMT.64  cells  as a template  a n d the f o l l o w i n g  primers  5' c g g a a t t c G G C T C G G C T T T C C A A T C A 3 ' 5' g a g g a t c c G A G C G T G A G C T G T C C A G A G T C T 3 '  (Sigma): (forward),  (reverse).  A  TAP-1  promoter  construct ( p T A P - l - E G F P ) was then created b y inserting the P C R p r o d u c t in-between the E c o R I a n d B a m H I sites o f p r o m o t e r l e s s p E G F P - 1 vector ( C l o n t e c h , P a l o A l t o , (Appendix B).  © C a n c e r R e s e a r c h , 2 0 0 5 , 6 5 : (16), adapted b y p e r m i s s i o n .  CA)  MECHANISMS  34  UNDERLYING TAP DEFICIENCY  2.2.5 Transfection and selection The CMT.64, L M D , B16, Ltk and R M A cells were transfected with the pTAP-1EGFP construct or the promoterless pEGFP-1 vector using L I P O F E C T A M I N E PLUS Reagent (Invitrogen). Transfected cells were then selected in the presence of geneticin (G418) (Sigma) for 1 month (Table 2.2.5.1). Levels of EGFP expression in transfectants, treated or untreated with 50 ng/ml IFN-y for 48 hours, were assessed by flow cytometry (FACScan, Becton Dickinson, Mountain View, CA). Table 2.2.5.1: G418 doses for selection of transfectants in various cell lines. Cell line  Description  G418 dose (mg/ml)  CMT.64  TAP-deficient,  1  mouse lung carcinoma LMD  TAP-deficient,  1  mouse prostate carcinoma B16  TAP-deficient,  1  mouse melanoma Ltk  TAP-expressing,  0.8  mouse fibroblast RMA  TAP-expressing,  0.5  mouse lymphoma  2.2.6 Generation of pTAP-1-EGFP-transfected clones by FACS The pTAP-l-EGFP-transfected CMT.64, L M D and B16 cells that displayed a small level of EGFP were selected by flow cytometry using a FACSVantage DiVa cytometer (Becton Dickinson), grown in bulk culture, and treated with 50 ng/ml  © Cancer Research, 2005, 65: (16), adapted by permission.  MECHANISMS UNDERLYING TAP DEFICIENCY  35  recombinant murine IFN-y (R&D Systems, Minneapolis, MM) for 2 days. Cells that express high fluorescence in response to IFN-y were then sorted twice and cloned.  2.2.7 Cell Fusion and FACS analysis Twenty million cells from clones of the T A P - and M H C class I-deficient CMT.64, L M D and B16 cells stably transfected with pTAP-l-EGFP were fused with TAP- and M H C class I-expressing Ltk fibroblasts in a 1:1 ratio, following a polyethylene glycol cell fusion protocol [13]. Cells were then incubated with PE-conjugated anti-K  k  mouse monoclonal antibody at 4°C for 30 minutes. The fused cells, which displayed both red (PE-anti-K ) and green (EGFP) fluorescence, were selected by F A C S . Flow k  cytometry analyses of EGFP, K and K expression were performed 1 week after the b  k  fusions. PE-conjugated anti-K and anti-K mouse monoclonal antibodies were purchased b  k  from B D Pharmingen (San Diego, CA). Fusion experiments between a clone of pTAP-l-EGFP-transfected CMT.64 cells and a clone of pEYFP-Nl-transfected CMT.64 cells were also performed. The fused cells were then selected based on both yellow (EYFP) and green (EGFP) fluorescence. One week after the fusion, levels of EGFP and K in the fused cells were analysed by F A C S . b  2.2.8 Endogenous levels and overexpression of IRF-1 and IRF-2 in cell lines Levels of endogenous IRF-1 and -2 in CMT.64, L M D , B16, Ltk and R M A cells were assessed by RT-PCR using primers specific for IRF-1 and IRF-2, following the conditions described above. In order to investigate the effects of IRF-1 and -2 overexpression on TAP-1 promoter activity in TAP-deficient carcinoma cells, a pTAP-1© Cancer Research, 2005, 65: (16), adapted by permission.  MECHANISMS  UNDERLYING TAP DEFICIENCY  36  EGFP-transfected CMT.64 clone was co-transfected with 0.1 ug of p E Y F P - N l (enhanced yellow fluorescent protein) vector (Clontech) and 1 pg of pCMV/IRF-1 or pCMV/IRF-2 [14] expression vector. Since the pCMV/IRF vectors contained no selection gene, the E Y F P served as a marker to select for successfully transfected cells by F A C S . 48 hours after transfection, levels of EGFP in the CMT.64 transfectants were analysed by flow cytometry.  2.2.9  Luciferase andft-GalactosidaseAssays In order to demonstrate whether the overexpressed IRF-1 and -2 were functional,  cells were co-transfected with the IRF-coding constructs, an IFN-[3 promoter-luciferase construct [14], and a pCMV/B-galactosidase vector (Promega, Madison, WI) used to monitor transfection efficiency. A promoterless pGL3-luciferase vector (Promega) was also used as a background control. 48 hours after transfection, the cells were washed twice with PBS and lysed with Reporter Lysis Buffer (Promega). The luciferase and the B-galactosidase activity were measured using the Luciferase Assay System (Promega), and the B-galactosidase Enzyme Assay System (Promega), respectively.  2.2.10 Western Blot Fifty micrograms proteins per sample were separated through 8% SDS-PAGE. Proteins were transferred to a nitrocellulose membrane (Bio-rad, Hercules, CA). Blots were blocked with 5% skim milk in PBS, probed with rabbit anti-mouse TAP-1 polyclonal Ab (made by Linda L i in Jefferies Lab), followed by HRP-conjugated goat anti-rabbit secondary Ab (Jackson Immunoresearch Lab., West Grove, PA). The rabbit anti-mouse TAP-1 polyclonal antibody was made by immunizing rabbits with a common © Cancer Research, 2005, 65: (16), adapted by permission.  MECHANISMS UNDERLYING TAP DEFICIENCY  31  TAP1 peptide sequence, R G G C Y R A M V E A L A A P A D - C with a cysteine at the C terminal, linked to keyhole limpet hemocyanin (Pierce Biotechnology, Rockford, IL) [15]. For the loading controls, anti-(3-actin mouse monoclonal Ab (Sigma) was used, followed by HRP-conjugated goat anti-mouse secondary Ab (Pierce Biotechnology). Blots were developed using Lumi-light reagents (Pierce).  2.2.11 Analysis of mRNA stability Unfused Ltk fibroblasts, and fused CMT.64-Ltk, LMD-Ltk and Ltk-Ltk cells were treated with 5 pg/ml actinomycin D (Sigma) for 2, 4 or 8 hours, or left untreated. 4 ug of total cellular R N A were used as templates for reverse transcription and amplification by real time PCR, using TAP-1 (5'-end) or SI5 or prion protein-specific primer sets listed in Table 1. Serial dilutions of RT products were used as templates for P C R to generate the corresponding standard curves.  2.2.12 Real time quantitative PCR analysis In this study, this method was employed for quantification of levels of endogenous TAP-1 promoter or TAP-1 coding region co-precipitating with R N A polymerase II in ChIP assays, quantification of copy number of the p T A P - l - E G F P construct integrated in stably transfected cells, and measurement of TAP-1 mRNA levels in cells upon actinomycin D treatment. cDNAs reverse-transcribed from 1-4 ug R N A and genomic D N A were used as templates for amplifications using 200-500 n M of each primer and 10 ul S Y B R Green Taq ReadyMix (Sigma). Thirty five cycles of denaturation (5 seconds, 95oC), annealing (5 seconds, 61-63oC), and elongation (20 seconds, 72oC) were performed using a Roche LightCycler. © Cancer Research, 2005, 65: (16), adapted by permission.  MECHANISMS  38  UNDERLYING TAP DEFICIENCY  2.3 Results 2.3.1 Levels of TAP-1 mRNA in CMT.64, LMD, B16, Ltk and RMA cells To investigate the mechanism underlying the lack of TAP-1 expression in carcinoma cells, CMT.64 (lung), L M D (prostate) and B16 (melanoma) cell lines were used as models for TAP-deficient cells [3, 7, 11, 16], and Ltk and R M A cell lines [7] as models for TAP-expressing cells. RT-PCR analysis confirmed that the levels of TAP-1 mRNA were higher in Ltk and R M A cells than in CMT.64, L M D and B16 cells (Figure 2.3.1.1). Treatment of the TAP-deficient cells with IFN-y increased the TAP-1 mRNA expression to similar levels as in TAP-expressing cells (Figure 2.3.1.1).  z  + CO  CO  H  t— Q  LL  O  O  _J Q  _ l  I  I  z  LL  +  CO CD £fl CQ  J  r  z  z  4  J  U-  CC  DC  TAP-1 p-actin  Figure 2.3.1.1: IFN-y-treatment restores TAP-1 expression in TAP-deficient murine lung, prostate and skin carcinoma cells (CMT.64, L M D and B16). Amplification of p-actin cDNA served as an internal control. RT-PCR analyses were performed at least three times and representative data are shown.  © Cancer Research, 2005, 65: (16), adapted by permission.  MECHANISMS  2.3.2  UNDERLYING TAP DEFICIENCY  39  The recruitment of RNA polymerase II to the Tap-1 gene is lower in the CMT.64, LMD and B16, than in the Ltk and RMA cells In order to investigate whether the lack of TAP-1 mRNA expression in CMT.64,  L M D and B16 cells is due to an impairment of TAP-1 transcription, the levels of R N A pol II within the 3' end of the TAP-1 coding region in TAP-deficient and TAP-expressing cells were compared, by means of chromatin immunoprecipitation assay. The results showed that the levels of R N A pol II within the 3' end of the TAP-1 coding region were lower in CMT.64, L M D and B16 than in Ltk and R M A cells (Figure 2.3.2.1), indicating that deficiency in transcription is, at least partially, underlying T A P deficiency in the carcinoma cells.  © Cancer Research, 2005, 65: (16), adapted by permission.  40  MECHANISMS UNDERLYING TAP DEFICIENCY  9 8 _ 6 = 5  * i 0 CMT.64  LMD  B16  Ltk,  RMA  Cell lines  Figure 2.3.2.1: The recruitment of RNA polymerase II to 3' coding region of the Tap-1 gene in CMT.64, LMD and B16 is impaired in comparison to that in Ltk and RMA. Chromatin immunoprecipitation using anti-RNA polymerase II antibody was performed in each cell line, and the eluted D N A fragments were purified and used as templates for real time P C R analysis using primers specific for the 3'coding region of the Tap-1 gene. Relative R N A polymerase II levels were determined as the ratio of copy numbers of the eluted 3' coding region of the Tap-1 gene and copy numbers of the corresponding inputs. The smallest ratio in each group of experiments was arbitrarily determined as 1. Columns, average of three to six experiments; bars, S E M . * P < .05 compared with TAP-expressing cells (Student's t-test).  © Cancer Research, 2005, 65: (16), adapted by permission.  41  MECHANISMS UNDERLYING TAP DEFICIENCY  Using the same approach, but with primers specific for the TAP-1 promoter region, it was found that the recruitment of R N A pol II to the TAP-1 promoter was also relatively lower in TAP-deficient cells (Figure 2.3.2.2). Recruitment of R N A pol II complex to genes' promoters is an important event that supports transcription initiation [17].  Therefore, this result directly supported the notion that initiation of TAP-1  transcription was impaired in TAP-deficient cells.  vel  10 9 .8: •7. -  o  6~ 5 •: 4  _ _  Q.  < Z-:  3 2 .1  *  *  *  -i-  oCMT.64  LMD  B16  Ltk  RMA  Cell lines  Figure 2.3.2.2: The recruitment of RNA pol II to the TAP-1 promoter was low  in  TAP-deficient  CMT.64,  LMD  and  B16  cells.  Chromatin  immunoprecipitation using anti-RNA polymerase II antibody was performed, and the relative levels of R N A polymerase II recruitment to the TAP-1 promoter were assessed as described above using primers specific for the TAP-1 promoter. Columns, average of three to six experiments; bars, S E M . * P < .05 compared with TAP-expressing cells (Student's t-test).  © Cancer Research, 2005, 65: (16), adapted by permission.  MECHANISMS UNDERLYING TAP DEFICIENCY  42  2.3.3 Cloning and analysis of the -557 to +1 region of the CMT.64derived TAP-1 promoter One possible explanation for the impairment of transcription of the Tap-I gene in TAP-deficient cells was the presence of mutation(s) in cw-acting elements involved in the regulation of TAP-1 promoter activity. Previous studies have demonstrated that the 593bp-long region located in-between TAP-I and LMP-2 genes in humans acts as a bidirectional promoter: that drives the transcription of both genes [18]. Analysis of the murine TAP-1 promoter had not been reported in prior work; however, the organization of the murine Lmp-2/Tap-l genes within the M H C class II locus is reminiscent of its human ortholog [19]. Therefore, primers flanking the LMP-2/TAP-1 intergenic region were used to amplify the murine TAP-1 promoter region, using genomic D N A from CMT.64 cells as a template. The resulting PCR product was then cloned and sequenced. Analysis of the CMT.64-derived TAP-1 promoter region revealed the presence of putative binding sites for various transcription factors, including SP1, CREB, AP-1, P U . l , NF-KB and IRF (Figure 2.3.3.1), By alignment, the nucleotide sequence of the CMT.64-derived TAP-1 promoter region was found to be identical to the corresponding region in the murine M H C class II locus (NCBI accession no. AF027865). This result demonstrated that there was no mutation present in the -557 to +1 region of the CMT.64derived TAP-1 promoter. Additional analysis of TAP-1 promoter sequence amplified from genomic D N A of TAP-deficient L M D cells and TAP-expressing R M A cells also showed that the LMD-derived TAP-1 promoter sequence was identical to the published sequence in N C B I and to that of R M A cells.  © Cancer Research, 2005, 65: (16), adapted by permission.  MECHANISMS  43  UNDERLYING TAP DEFICIENCY  I  „„„ __ T  a  T  C  ,'< •.( ,(.","""  r  ,1  I  CGGC GCTCGG  Crt  -  ' SP  _.  ,  v  1  CL  ,1  / ' ,  i ' I*  ? _ / I T ,  <jt  ' ,i  — :t * 1  VV>-  i (,  _ ~J7  Cafe/  -  r  «  l f / <  -JO t >«< ' A C / & i . GREB(+)  .  r  C  ~t\A  "  O 7' F  IGAGATp ;..n+>  -'1 TCATGGAGAA  Crt^c  C " "?  - G i " A " C ~ T -C -  ~?  " \  i"C  A?-l( TCTCACMO n- • • l . l  -13 o-. •  TAGT  • <(;>. .  . •'  TCGAGCGGGT  T C r *  1u . ' l f ' -  I R F (-)•.• TCCfGGGGACT  1 '-j  «  ,. ' R  - A  1  ;  Ci , c  • T T A C G f G G C A C GCCCTGJGGAC  CCGCCCTTCfr  TCCI TCCCCA  N F - K B (.+).'  -.?0 CGGAGACTCC  TGTGCAGCGC- GGACGllCGAG  -1  -.10  CTCACGCTCG  ATGf  -HGC  GTCT G G A C . A G  TAP-r|=':>  Figure 2.3.3.1: Nucleotide sequence of the CMT.64-derived TAP-1 promoter region is identical to the corresponding region in murine M H C class II locus. The A T G codon was arbitrarily determined as +1. Motifs located on the sense strand are indicated by a (+), and motifs located on the antisense strand are indicated by a (-).  2.3.4 Activity of the -557 to +1 region of the TAP-1 promoter is impaired in TAP-deficient cells To demonstrate that this murine LMP-2/TAP-1 intergenic region indeed displays promoter activity, and to assess whether it contains cw-acting elements conferring a differential activity of the TAP-1 promoter between TAP-expressing and TAP-deficient cells, a reporter plasmid (pTAP-l-EGFP) was generated, containing the -557 to +1 region of the murine TAP-1 promoter upstream of the egfp gene in the pEGFP-1 vector.  © Cancer Research, 2005, 65: (16), adapted by permission.  44  MECHANISMS UNDERLYING TAP DEFICIENCY  CMT.64, L M D , B16, Ltk and R M A cells were then transfected with the pTAP-l-EGFP construct, or the pEGFP-1 vector as a control, and cultured for one month under selective pressure to generate stable transfectants. Real time P C R analysis was performed using TAP-1 promoter-specific forward and EGFP-speciflc reverse primers (Table 2.2.2.1), and 100 ng of genomic D N A from the stable pTAP-l-EGFP transfectants as templates. The results showed that, on average, one copy of the pTAP-l-EGFP construct was integrated per cell in all the cell lines used (Table 2.3.4.1). A n example of detailed calculations used to determine the copy numbers is outlined in Appendix A.2. Table 2.3.4.1: Statistical Evaluation  of the Transfected pTAP-l-EGFP Copy  Numbers Per Cell. Transfected cells  pTAP-l-EGFP-1 average copy number  SD  CMT.64  1.59  0.06  LMD  1.49  0.03  B16  1.42  0.01  Ltk  1.51  0.02  RMA  1.41  0.02  Furthermore, EGFP levels in these stable transfectants were assessed by flow cytometry. In all the cell lines, the promoterless pEGFP-1 vector transfectants displayed low levels of background EGFP expression; however, the levels of fluorescence were higher in cells transfected with the pTAP-l-EGFP construct than in cells transfected with the vector alone. In addition, the TAP-expressing Ltk and R M A cells expressed higher levels of EGFP than the TAP-deficient CMT.64, L M D and B16 cells. (Figure 2.3.4.1). This indicated that the -557 to +1 region indeed displayed promoter activity. Finally, treatment  © Cancer Research, 2005, 65: (16), adapted by permission.  MECHANISMS  UNDERLYING TAP  DEFICIENCY  45  w i t h IFN-y resulted i n 3- to 6-fold increases i n E G F P e x p r e s s i o n i n C M T . 6 4 , B 1 6 and LMD  c e l l s ( F i g u r e 2.3.4.1). T h i s treatment elevated E G F P  e x p r e s s i o n o f the  TAP-  d e f i c i e n t c e l l s to s i m i l a r or e v e n h i g h e r levels than those i n untreated T A P - e x p r e s s i n g c e l l s , suggesting that treatment w i t h IFN-y w a s  able to o v e r c o m e the  deficiencies  r e s p o n s i b l e f o r the l o w a c t i v i t y o f the T A P - 1 p r o m o t e r i n T A P - d e f i c i e n t c e l l s . T a k e n together, these results i n d i c a t e d that the c l o n e d T A P - 1 p r o m o t e r r e g i o n possesses f a i t h f u l p r o m o t e r a c t i v i t y and contains cw-acting elements c o n f e r r i n g the r e l a t i v e l y l o w p r o m o t e r a c t i v i t y i n T A P - d e f i c i e n t c e l l s . F u r t h e r m o r e , based o n the o b s e r v a t i o n that the l e v e l s o f E G F P t r i g g e r e d b y the c l o n e d T A P - 1 p r o m o t e r correlated w i t h the levels o f recruitment o f R N A P o l II to the endogenous T A P - 1 . p r o m o t e r observed b y C H I P , these transfected c e l l s w e r e p r o v e n to be suitable as tools to further investigate the m e c h a n i s m s u n d e r l y i n g the d i f f e r e n t i a l a c t i v a t i o n o f T A P - 1 p r o m o t e r i n T A P - d e f i c i e n t and T A P - e x p r e s s i n g c e l l s .  © C a n c e r R e s e a r c h , 2 0 0 5 , 6 5 : (16), adapted b y p e r m i s s i o n .  46  MECHANISMS UNDERLYING TAP DEFICIENCY  300  i  250  I  200  w .  S a) Q. LL  o  LU  150  **  50  • - IFN-gamma  1  100  • + IFN-gamma  -=E-  LMD  CMT.64 j r->  **  **  Ltk  B16  RMA  Cell lines ••- : •- -•  -  "  •••  : •  •  '  \  ^  •<•-••••• •. •  Figure 2.3.4.1: TAP-1 promoter activity is impaired in  . •• • --•  TAP-deficient  CMT.64, L M D and B16 cells. Flow cytometry analysis was performed to measure TAP-1 promoter activity, based on the levels of EGFP expression in pTAP-l-EGFP stable transfectants after selection in.G418 for 1 month. The IFNy-treated cells were incubated with 50 ng/ml IFN-y for 48 hours prior to the F A C S analysis. Levels of EGFP in the cells transfected the p T A P - l - E G F P were normalized against corresponding values obtained upon transfection with pEGFP1 vector alone. Data shown are the mean fluorescence intensity ± S E M of three independent experiments. * P < .05 compared with TAP-expressing cells; ** P < .05 compared with untreated cells (Student's t-test).  © Cancer Research, 2005, 65: (16), adapted by permission.  MECHANISMS  UNDERLYING TAP DEFICIENCY  47  2.3.5 Effects of fusions between carcinoma cells and wild type fibroblasts on TAP-1 promoter activity and MHC class I expression levels The relatively low activity of the -557 to +1 region of the TAP-1 promoter in TAP-deficient cells suggested that these cells might be deficient in positive trans-acting factors that regulate TAP-1 promoter activity, or that they might display an abnormally high level of activity of trans-acting factors that negatively regulate TAP-1 promoter activity. To test these hypotheses, the effects of fusing the T A P - and M H C class Iexpressing Ltk cells with TAP- and M H C class I-deficient carcinoma cells (CMT.64, L M D and B16) were investigated. Before fusion, stable pTAP-l-EGFP transfectants of carcinoma cells were sorted into single-cell clones by F A C S , and a clone that displayed high induction of TAP-1 promoter activity and M H C class I expression in response to IFN-y treatment was chosen. By flow cytometry, it was found that levels of EGFP were higher in the fused CMT.64Ltk and L M D - L t k cells than in the unfused CMT.64 and L M D cells (Figure 2.3.5.1).  © Cancer Research, 2005, 65: (16), adapted by permission.  MECHANISMS  UNDERLYING  TAP DEFICIENCY  CMT.64-Ltk fusion  48 LMD-Ltk fusion  EGFP  EGFP  Figure 2.3.5.1: TAP-1 promoter-driven EGFP expression increased in the fused CMT.64-Ltk and LMD-Ltk cells (thick line) in comparison to that in the unfused pTAP-l-EGFP-transfected  CMT.64 and L M D cells (thin line).  Wild type CMT.64 and L M D were used as negative controls for EGFP expression (shaded area). Further flow cytometric analysis indicated that K was expressed on the surface of b  the fused CMT.64-Ltk and LMD-Ltk cells, while the unfused cells did not express K (Figure 2.3.5.2).  CMT.64-Ltk fusion  LMD-Ltk fusion  Figure 2.3.5.2: Surface expression of K was increased when CMT.64 or b  LMD (shaded areas) were fused to Ltk cells (broken line). Expression of K on b  fused CMT.64-Ltk and fused LMD-Ltk cells are displayed by thick lines. As a positive control, expression of K was assessed on IFN-y-treated CMT.64 and L M D cells (thin lines). © Cancer Research, 2005, 65: (16), adapted by permission.  b  MECHANISMS UNDERLYING TAP DEFICIENCY  49  As a control, two groups of TAP-deficient cells were fused: the CMT.64 cells stably transfected with the pTAP-l-EGFP construct with another group of CMT.64 cells expressing EYFP. The results showed no induction of K surface expression in the fused b  CMT.64(pTAP-l-EGFP)-CMT.64(pEYFP-Nl) cells (Figure 2.3.5.3).  Figure 2.3.5.3: No  induction of K  b  surface expression in the  fused  CMT.64(pTAP-l-EGFP)-CMT.64(pEYFP-Nl) cells (thick line). CMT.64 cells untreated (shaded area) or treated with IFN-y (thin line) were used as negative or positive control, respectively, for K expression. b  The increase in EGFP expression of the pTAP-l-EGFP-transfected TAP-deficient carcinoma cells that were fused with TAP-expressing fibroblasts suggests that the T A P deficient cell lines studied display a relatively low level of activity of trans-dLC\'mg factor(s) positively regulating the TAP-1 promoter activity. This deficiency could, at least partially, be corrected by a fusion with TAP-expressing cells. Furthermore, the expression of M H C class I allotype of the fibroblasts (K ) in the fused CMT.64-Ltk and k  © Cancer Research, 2005, 65: (16), adapted by permission.  MECHANISMS UNDERLYING TAP DEFICIENCY  50  LMD-Ltk cells were also assessed. The results showed a slight but consistent decrease in the level of K expressed (Figure 2.3.5.4). k  CMT.64-Ltk fusion 8.  1 .  |  1: / io°  8  k  JS  8  LMD-Ltk fusion  M  A  \  y io'  2  LA  88-  \ IO  :  f  io  3  -  ,o  ()  io  1  'to ' 2  m  3  Figure 2.3.5.4: K surface expression was reduced in the fused CMT.64-Ltk k  and LMD-Ltk (thick lines) in comparison to that in the wild type Ltk cells (thin lines). Wild type CMT.64 and L M D cells were used as negative controls for K expression (shaded area). k  © Cancer Research, 2005, 65: (16), adapted by permission.  MECHANISMS UNDERLYING TAP DEFICIENCY  51  2.3.6 Overexpression of IRF-1 and IRF-2 in CMT.64 cells did not result in significant changes in TAP-1 promoter activity IFN-y treatment resulted in high induction of TAP-1 promoter activity and could subsequently overcome T A P and M H C class I deficiencies in carcinoma cells [11, 20, 21]. Therefore, factors that are known to be activated in response to IFN-y are attractive candidates for the future discovery of positive trans-acting factors that are either absent or functionally defective in TAP-deficient cells, thus accounting for the impairment of TAP-1 promoter activity in carcinoma cells. The interferon regulatory factors (IRFs), that binding motif was found in the TAP-1 promoter (Figure 2.3.3.1), were examples of proteins that expression could be regulated by IFN-y [22]. In order to investigate whether TAP downregulation might be caused by abnormally low or high levels of IRF-1 and IRF-2, respectively, endogenous levels of IRF-1 and -2 mRNAs in TAP-expressing and TAP-deficient cells were observed by RT-PCR. The results indicated that both IRF-1 and -2 mRNA levels did not correlate with TAP levels in the cell lines (Figure 2.3.6.1).  CD  <  U  r_  CO ^^^^^B?  fiiiwir  ^mmmfM  •  «m»  g^^s^^H  m^^&^m.:  ^^^MPR^  ^|jj|j||g(P  mm®  :ms  •ms  Figure 2.3.6.1: Endogenous levels of IRF-1 and -2 m R N A did not correlate with T A P levels in the cell lines.  © Cancer Research, 2005, 65: (16), adapted by permission.  MECHANISMS  UNDERLYING TAP DEFICIENCY  52  In order to further investigate the putative role of IRF-1 and -2 in modulating TAP-1  promoter activity in TAP-deficient cells, human IRF-1 and -2 [14] were  overexpressed in a clone of CMT.64 cells containing the p T A P - l - E G F P construct. Flow cytometry analysis showed that the overexpression of the IRFs had no significant effect on EGFP levels in the transfectants (Figure 2.3.6.2).  IRF-1  IRF-2  EGFP  EGFP  Figure 2.3.6.2: Overexpression of IRF-1 or -2 in a clone of pTAP-l-EGFP construct-transfected CMT.64 cells did not result in significant changes of the TAP-1 promoter activity. Representative histograms show EGFP expressed by  the IRF-1 or IRF-2-overexpressing cells. The shaded  areas indicate  background green fluorescence of the cells transfected with PBS as negative controls, the  thin and thick lines represent EGFP  overexpressing the  expression  in cells  IRF that were treated with IFN-y or left untreated,  respectively.  © Cancer Research, 2005, 65: (16), adapted by permission.  53  MECHANISMS UNDERLYING TAP DEFICIENCY  In order to test whether the transfected IRFs were functional, the cells were cotransfected with either an I F N - P promoter-luciferase construct or a promoterless pGL3luciferase vector. As expected [14], the overexpression of exogenous IRF-1 was found to increase the basal level of I F N - P promoter activity, whereas the IRF-2 decreased it (Figure 2.3.6.3). This indicated that overexpression of IRF-1  and IRF-2 alone was not  sufficient for modulating the TAP-1 promoter activity in CMT.64 cells.  Figure 2.3.6.3: Overexpression of IRF-1 and -2 modulated I F N - P promoter activity linked to a luciferase gene. Luciferase activities were normalized against P-galactosidase activities, to correct for variations in transfection efficiencies. Data shown are the average ± S E M of three independent experiments.  © Cancer Research, 2005, 65: (16), adapted by permission.  MECHANISMS  UNDERLYING TAP DEFICIENCY  54  2.3.7 Analysis of TAP-1 expression in unfused and fused cells During the course of these studies, it was noted that the TAP-1 promoter displayed a low but detectable activity in TAP-deficient cells, while TAP-1 mRNA was barely detectable in these cells. To investigate whether the low levels of TAP-1 m R N A in TAP-deficient cells resulted solely from the deficiency in TAP-1 promoter activity demonstrated above, the levels of TAP-1 mRNA transcribed from the CMT.64 genome and from the Ltk genome in fused CMT.64-Ltk cells were compared. To distinguish between TAP-1 expressed from the two genomes, analysis of the TAP-1 m R N A polymorphism in both cells was carried out by P C R amplifications of TAP-1 m R N A transcribed in each cell line. A total of 12 bp differences was found between the nucleotide, sequence of CMT.64-derived and Ltk-derived TAP-1 mRNAs (Appendix C). These polymorphisms are most likely strain-specific and are not responsible for TAPdeficiency in CMT.64 cells, since another analysis showed that the CMT.64 TAP-1 sequence was identical to that of TAP-expressing R M A cells. Both CMT.64 and R M A cells originated from C57/BL6 mice, whereas Ltk cells were derived from a C3H/An mouse. Primers specific to CMT.64-derived TAP-1 mRNA were then designed in order to investigate its levels in the fused CMT.64-Ltk cells. Non-polymorphic primers were used for further analysis of total TAP-1 expression in the fused cells. Despite the increase in TAP-1 promoter activity driving the egfp gene in the fused CMT.64-Ltk cells (Figure 2.3.5.1), no TAP-1 mRNA from the CMT.64 genome could be detected in cells that were not treated with IFN-y (Figure 2.3.7.1).  © Cancer Research, 2005, 65: (16), adapted by permission.  MECHANISMS UNDERLYING TAP DEFICIENCY  Figure 2.3.7.1: No expression of TAP-1 mRNA from the CMT.64 genome  55  was  detectable by RT-PCR in the fused CMT.64-Ltk cells. Amplifications of reverse-transcribed CMT.64 TAP-1 mRNA from IFN-y-treated cells and B-actin mRNA were used as positive controls and loading controls, respectively.  In fact, analysis of total TAP-1 expression showed that the fused CMT.64-Ltk and L M D Ltk cells displayed drastically lower levels of TAP-1 mRNA and protein than the unfused Ltk fibroblasts did (Figure 2.3.7.2). This suggested the existence of post-transcriptional mechanisms that further down-regulate levels of TAP-1 mRNA in TAP-deficient cells. Therefore, the possibility of a difference in TAP-1 mRNA stability between T A P expressing and TAP-deficient cells was further investigated.  © Cancer Research, 2005, 65: (16), adapted by permission.  MECHANISMS  UNDERLYING TAP DEFICIENCY  56  Total TAP-1 p-actin Total TAP-1 p-actin  Figure 2.3.7.2: Total TAP-1 expression was reduced when CMT.64 and L M D cells were fused with wild type Ltk cells. Results from RT-PCR analysis and Western Blot were shown in top and bottom panel, respectively. Levels of P-actin were used as loading controls.  2.3.8 TAP-1 mRNA stability decreases in carcinoma-fused fibroblasts To assess the regulation of TAP-1 at the level of mRNA stability, unfused Ltk fibroblasts, as well as fused CMT.64-Ltk, LMD-Ltk and Ltk-Ltk cells were treated with actinomycin D (Act. D) for 2 to 8 hours, in order to block neo-synthesis of mRNA. Residual levels of TAP-1 mRNA after treatment of cells with Act. D were then assessed by real time PCR, using constant amounts of total R N A as templates. Levels of TAP-1, S15 and prion mRNA in actinomycin D-treated cells are expressed as percentages of the levels of the corresponding mRNA in untreated cells. The results showed that TAP-1 mRNA stability decreased when fibroblasts were fused to carcinoma cells (Figure 2.3.8.1).  © Cancer Research, 2005, 65: (16), adapted by permission.  MECHANISMS UNDERLYING TAP DEFICIENCY  57  *- Ltk *~ Fused Ltk-Ltk Fused LMD-Ltk Fused CMT.64-Ltk  2  0  4  8  Hours of Actinomycin D treatment  Figure 2.3.8.1: TAP-1 mRNA is rapidly degraded in fused carcinomafibroblast cells.  As a control, the stability of unrelated mRNA, such as the mRNA coding for S15 and prion protein (Figure 2.3.8.2) was assessed. The results demonstrated that the S15 and prion m R N A stability was unaffected by the cell fusion events, and that the decrease in mRNA stability is fairly specific to TAP-1 in carcinoma-fused  cells. These results  suggest the existence of factors, which remain to be identified, that enhanced TAP-1 mRNA degradation in carcinoma cells.  140  120  120  100  I -o-  80  Ltk  ~»~B16  60  * 40  Fused LMD-Ltk  i—  < 100  1  80  £  60  - o - Ltk  -*- F u s e d  Ltk-Ltk  ~m— F u s e d LMD-Ltk -  ~m~ Fused CMT 64-Ltk  F u s e d CMT-Ltk  20 0 0  2  4  8  H o u r s of A c t i n o m y c i n D t r e a t m e n t  0  2  4  8  H o u r s of A c t i n o m y c i n D t r e a t m e n t  Figure 2.3.8.2: The stability of S 1 5 and prion mRNA is similar in unfused and fused cells. © Cancer Research, 2005, 65: (16), adapted by permission.  MECHANISMS  UNDERLYING TAP DEFICIENCY  58  2.4 Discussion TAP-1 downregulation in tumors has been reported in many studies [6, 10, 2325]; however, the molecular mechanisms underlying this defect remain poorly understood. One of the recently proposed mechanisms of A P M downregulation is the overexpression of oncogenes, for example HER-2/neu, that gives rise to the emergence of immune escape phenotype of tumors [26]. Related mechanisms of TAP downregulation may include an impairment of TAP-1 promoter activity (due to mutation in cw-acting elements in the promoter or in distal enhancer/silencer regions, chromatin remodeling at the TAP-1 locus, and/or difference in expression or functionality of trans-acting factors), as well as a relatively low stability of TAP-1 mRNA in these cells. In this study, murine lung, prostate and skin carcinoma cells (CMT.64, L M D and B16) were used as models for TAP- and M H C class I-deficient cancer cells. The results in this study suggested that T A P deficiency in these cells is caused by the lack of activation or expression of TAP-1 transcriptional activators, as well as a decrease in TAP-1 mRNA stability. These results demonstrated that: a) treatment of the T A P deficient cells with IFN-y increased the TAP-1 mRNA expression to similar levels as in TAP-expressing cells; b) the initiation of TAP-1 transcription was impaired in T A P deficient cells; c) the relatively low activity of TAP-1 promoter in the carcinoma cells is due to regulatory defects rather than mutations in the TAP-1 promoter; d) low TAP-1 promoter activity and M H C class I deficiency in carcinoma cells could be corrected, at least partially, by fusions with wild type fibroblasts; and e) a decrease in TAP-1 mRNA stability also contributed to TAP-1 deficiency in murine lung carcinoma cells.  © Cancer Research, 2005, 65: (16), adapted by permission.  MECHANISMS  59  UNDERLYING TAP DEFICIENCY  Based on the structural and functional analysis of TAP-1 promoter of T A P deficient cells, as well as results obtained from chromatin immunoprecipitation assays of endogenous TAP-1 promoter in various TAP-expressing and TAP-deficient cells, it was proposed that one mechanism underlying TAP deficiency in these cells is the impairment of the ability of TAP-1 promoter to drive transcription. As no mutation was observed in the CMT.64- and LMD-derived TAP-1 promoter, this deficiency was likely to be caused by the lack of transcriptional activators necessary for optimal binding of the R N A polymerase II complex to the TAP-1 promoter, or conversely, by the presence of transcriptional inhibitors that prevent the binding. F A C S analysis of the fusions between TAP- and M H C class I-deficient carcinoma cells (CMT.64, L M D and B16) of H-2 origin and TAP- and M H C class I-expressing b  fibroblasts (Ltk) of H-2 origin showed an increase of TAP-1 promoter activity and some k  increase in K expression. However, despite the increase of the promoter activity in the b  fused CMT.64-Ltk, no TAP-1 mRNA from the CMT.64 genome could be detected by RT-PCR (Figure 2.3.7.1); instead, total levels of TAP-1 mRNA and protein in the fused CMT.64-Ltk and LMD-Ltk cells were lower than in the unfused Ltk cells (Figure 2.3.7.2). This might have accounted for the decrease in surface expression of K that was k  observed in the fused cells (Figure 2.3.5.4). These unexpectedly low levels of TAP-1 mRNA  and protein in the fused fibroblasts-carcinoma cells had prompted  the  investigation whether other mechanisms contribute to the TAP-1 deficiency in carcinoma cells, in addition to the impairment of TAP-1 promoter activity that would also account for the disappearance of TAP-1 in the fused cells. It was then found that the stability of TAP-1 mRNA was decreased when fibroblasts were fused with carcinoma cells. This  © Cancer Research, 2005, 65: (16), adapted by permission.  MECHANISMS  UNDERLYING TAP DEFICIENCY  60  result suggests that the stability of TAP-1 mRNA is lower in CMT.64 and L M D cells than in the Ltk cells. Unfortunately, the extremely low levels of TAP-1 mRNA in the carcinoma cells, even in absence of actinomycin D, preclude direct confirmation of this hypothesis. Further studies will be required in order to precisely characterize the positive regulatory factors that are lacking or defective in carcinoma cells, as well as the mechanism that leads to a reduction of TAP-1 mRNA stability in carcinoma cells. These studies are of fundamental importance, as they will significantly contribute to a better understanding of the underlying cause of antigen processing deficiency in many tumor types.  This will in turn lead to new approaches to modify the  immunogenicity and antigenicity of tumor cells, thereby allowing recognition of tumors by immune surveillance mechanisms.  © Cancer Research, 2005, 65: (16), adapted by permission.  MECHANISMS  UNDERLYING TAP DEFICIENCY  61  2.5 References 1.  Germain, R.N. and D.H. Margulies. The biochemistry and cell biology of antigen processing and presentation. Annu Rev Immunol, 1993. 11:403-50.  2.  Cresswell, P. and J. Howard. Antigen recognition. Curr Opin Immunol, 1999. 11:61-3.  3.  Alimonti, J., Q J . Zhang, R. Gabathuler, G. Reid, S.S. Chen, and W.A. Jefferies. T A P expression provides a general method for improving the recognition of malignant cells in vivo. Nat Biotechnol, 2000. 18:515-20.  4.  Seliger, B., M . J . Maeurer, and S. Ferrone. Antigen-processing machinery breakdown and tumor growth. Immunol Today, 2000. 21:455-64.  5.  Ritz, U . and B. Seliger. The transporter associated with antigen processing (TAP): structural integrity, expression, function, and its clinical relevance. M o l Med, 2001. 7:149-58.  6.  Seliger, B., M.J. Maeurer, and S. Ferrone. T A P off—tumors on. Immunol Today, 1997. 18:292-9.  7.  Gabathuler, R., G. Reid, G. Kolaitis, J. Driscoll, and W.A. Jefferies. Comparison of cell lines deficient in antigen presentation reveals a functional role for TAP-1 alone in antigen processing. J Exp Med, 1994. 180:1415-25.  8.  Franks, L . M . , A.W. Carbonell, V.J. Hemmings, and P.N. Riddle. Metastasizing tumors from serum-supplemented and serum-free cell lines from a C57BL mouse lung tumor. Cancer Res, 1976. 36:1049-55.  9.  Jefferies, W.A., G. Kolaitis, and R. Gabathuler. IFN-gamma-induced recognition of the antigen-processing variant CMT.64 by cytolytic T cells can be replaced by  © Cancer Research, 2005, 65: (16), adapted by permission.  MECHANISMS UNDERLYING TAP DEFICIENCY  62  sequential addition of beta 2 microglobulin and antigenic peptides. J Immunol, 1993.151:2974-85. 10.  Seliger, B., D. Atkins, M . Bock, U . Ritz, S. Ferrone, C. Huber, and S. Storkel. Characterization of human lymphocyte  antigen  class I  antigen-processing  machinery defects in renal cell carcinoma lesions with special emphasis on transporter-associated with antigen-processing down-regulation. Clin Cancer Res, 2003. 9:1721-7. 11.  Lee, H.M., T.L. Timme, and T.C. Thompson. Resistance to lysis by cytotoxic T cells: a dominant effect in metastatic mouse prostate cancer cells. Cancer Res, 2000.60:1927-33.  12.  Poste, G., J. Doll, I.R. Hart, and I.J. Fidler. In vitro selection of murine B16 melanoma variants with enhanced tissue-invasive properties. Cancer Res, 1980. 40:1636-44.  13.  Ausubel, F.M., R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith,  and K. Struhl, Production of antibodies, in Current Protocols in Molecular Biology. 2001, John Wiley & Sons, Inc. p. 11.7.1-11.7.3. 14.  Lin, R., A. Mustafa, H . Nguyen, D. Gewert, and J. Hiscott. Mutational analysis of interferon (IFN) regulatory factors 1 and 2. Effects on the induction of IFN-beta gene expression. J Biol Chem, 1994. 269:17542-9.  15.  Zhang, Q.J., R.P. Seipp, S.S. Chen, T.Z. Vitalis, X . L . Li, K.B. Choi, A. Jeffries, and W.A. Jefferies. T A P expression reduces IL-10 expressing tumor infiltrating lymphocytes and restores immunosurveillance against melanoma. Int J Cancer, 2007.  © Cancer Research, 2005, 65: (16), adapted by permission.  MECHANISMS  16.  UNDERLYING  TAP  63  DEFICIENCY  Seliger, B., U . Wollscheid, F. Momburg, T. Blankenstein, and C. Huber. Characterization of the major histocompatibility complex class I deficiencies in B16 melanoma cells. Cancer Res, 2001. 61:1095-9.  17.  Burley, S.K. and R . G . Roeder. Biochemistry and structural  biology of  transcription factor IID (TFIID). Annu Rev Biochem, 1996. 65:769-99. 18.  Wright, K . L . , L . C . White, A . Kelly, S. Beck, J. Trowsdale, and J.P. Ting. Coordinate regulation of the human TAP1 and LMP2 genes from a shared bidirectional promoter. J Exp Med, 1995. 181:1459-71.  19.  Janeway, C , P. Travers, M . Walport, and M . Shlomchik. Immunobiology: the immune system in health and disease. 5th ed. 2001, New York, N Y Garland Publishing.  20.  Matsui, M . , S. Machida, T. Itani-Yohda, and T. Akatsuka. Downregulation of the proteasome subunits, transporter, and antigen presentation  in hepatocellular  carcinoma, and their restoration by interferon-gamma J Gastroenterol Hepatol, 2002. 17:897-907. 21.  Mikyskova, R., J. Bubenik, V . Vonka, M . Smahel, M . Indrova, J. Bieblova, J. Simova, and T. Jandlova. Immune escape phenotype of HPV16-associated tumours: M H C class I expression changes during progression and therapy. Int J Oncol, 2005. 26:521-7.  22.  Brucet, M . , L . Marques, C. Sebastian, J. Lloberas, and A . Celada. Regulation of murine Tapl and Lmp2 genes in macrophages by interferon gamma is mediated by STAT1 and IRF-1. Genes Immun, 2004. 5:26-35.  © Cancer Research, 2005, 65: (16), adapted by permission.  MECHANISMS UNDERLYING TAP DEFICIENCY 23.  64  Vitale, M . , R. Rezzani, L . Rodella, G. Zauli, P. Grigolato, M . Cadei, D.J. Hicklin, and S. Ferrone. H L A class I antigen and transporter associated with antigen processing (TAP1 and TAP2) down-regulation in high-grade primary breast carcinoma lesions. Cancer Res, 1998. 58:737-42.  24.  Restifo, N.P., F. Esquivel, Y . Kawakami, J.W. Yewdell, J.J. Mule, S.A. Rosenberg, and J.R. Bennink. Identification of human cancers deficient in antigen processing. J Exp Med, 1993. 177:265-72.  25.  Murray, P.G., C M . Constandinou, J. Crocker, L.S. Young, and R.F. Ambinder. Analysis of major histocompatibility complex class I, TAP expression, and LMP2 epitope sequence in Epstein-Barr virus-positive Hodgkin's disease. Blood, 1998. 92:2477-83.  26.  Herrmann, F., H.A. Lehr, I. Drexler, G. Sutter, J. Hengstler, U . Wollscheid, and B. Seliger. HER-2/neu-mediated regulation of components of the M H C class I antigen-processing pathway. Cancer Res, 2004. 64:215-20.  ©Cancer Research, 2005, 65: (16), adapted by permission.  EPIGENETIC CONTROL OF TUMOR IMMUNOEVASION  MECHANISMS  65  Chapter 3 : Epigenetic Control of TAP-1 expression and the  Immune , Escape  Mechanisms  in  Malignant  Carcinomas 3.1 Introduction The current paradigm is that emergence of tumors is limited by a robust adaptive immune response that recognizes aberrant expression of tumor associated antigens. This mechanism of immune-surveillance is thought to work efficiently until tumor cells undergo chromosomal alterations that result in phenotypic conversion to a form that is no longer recognizable by the immune system. This conversion closely parallels the emergence of metastatic forms of the tumor cells that, in turn, gain a growth advantage over non-metastatic forms that remain hampered by the fidelity of the immune system. Several immune escape mechanisms that allow the metastatic tumor to go undetected have been observed; however, most tumors down-regulate a cassette of genes involved in antigen processing and presentation [1-3]. These include the genes encoding beta-2 microglobulin (B2m), the transporters associated with antigen processing (TAP) -1 and -2, tapasin, the low molecular weight proteins (LMP)-2 and -7, as well as the proteasome activator PA28 [1, 4, 5]. TAP-1 down-regulation has specifically been attributed to tumor growth and metastatic ability, and is used as a predictor of rapid tumor  A version of this chapter has been submitted for publication. Setiadi, A.F., David, M.D., Seipp, R.P., Hartikainen, J.A., Gopaul, R., and Jefferies, W.A. (2007) Epigenetic Control of the Immune Escape Mechanisms in Malignant Carcinomas.  EPIGENETIC CONTROL OF TUMOR IMMUNOEVASION progression and poor survival rates in humans [1-3, 5-8].  MECHANISMS  66  Furthermore, this antigen  presentation deficiency can be temporarily reversed in vitro by treatment of the tumor cells with interferon gamma (IFN-y), and can also be genetically complemented in vivo by the sole restoration of TAP-1 expression [1, 8]. Therefore, the presence of TAP-1 improves the ability of the host to mount a therapeutic and protective tumor antigenspecific immune response. This finding is encouraging for the development of therapeutic approaches that can restore TAP deficiency in cancer cells, and thus result in restoration of immune recognition of tumors. However, the actual defect that leads to T A P downregulation and immune escape mechanisms remains undescribed. Previous studies in this thesis concluded that TAP-deficiency in metastatic carcinomas is not caused by mutations within the TAP-1 promoter. Instead, it was found that the. metastatic carcinomas lack positive trans-acting factors that regulate TAP-1 transcription [9]. A n intriguing observation at the initiation of the present study was that transient expression of episomal copies of a reporter gene driven by TAP-1 promoter led to high levels of expression even in TAP-deficient carcinomas, while stable transfection and genomic integration of the same plasmid led to transcriptional silencing. This lead to the investigation whether epigenetic mechanisms play a role in the regulation of antigen processing in tumors, and whether the transcriptional activators that are deficient or nonfunctional in malignant cells are those with intrinsic histone acetyltransferase (HAT) activity. Deregulation of genes involved in the modulation of chromatin structure has been closely linked to immune evasion, uncontrolled cell growth, and development of tumors [10-12]. The study in this chapter will provide fundamental insights into the  EPIGENETIC  CONTROL OF TUMOR IMMUNOEVASION  MECHANISMS  67  epigenetic mechanisms of tumor immune escape and metastatic diseases, which may help in revising immunotherapeutic methodologies for eradicating cancers.  EPIGENETIC CONTROL OF TUMOR IMMUNOEVASION  MECHANISMS  68  3.2 Materials and Methods 3.2.1  Cell lines and reagents The TC-1 cell line was developed by transformation of murine primary lung cells  with HPV16 E6 and E7 oncogenes and activated H-ras [13]. TC-1 cells display high levels of TAP-1 and M H C class I. TC1-/D11 (= Dll) and TC1-/A9 (= A9) were tumor cell clones that exhibited spontaneous downregulation of M H C class I expression, and were derived from TC-1-inoculated mice [14]. These cell lines were cultured in the presence of 0.4 mg/ml G418. Another model used in this study consists of a murine primary prostate cancer cell line, PA, and its metastatic, TAP- and M H C class I-deficient derivative, L M D , both derived from a 129/Sv mouse [15]. The TAP-deficient CMT.64 cell line was established from a spontaneous lung carcinoma in a C57BL/6 mouse [16]. The TAP-expressing Ltk (=L-M(TK-)) fibroblast cell line was derived from a C3H/An mouse (ATCC, Manassas, V A ) . A l l cell lines above were grown in D M E M . The C57BL/6-derived B16F10 melanoma [17] and R M A lymphoma [1] cell lines were cultured in RPMI 1640 media. RPMI 1640 and D M E M media were supplemented with 10% heat-inactivated fetal bovine serum (FBS), 2 m M L-glutamine, 100 U/ml penicillin, 100 ug/ml streptomycin, and 10 m M HEPES. When indicated, cells were treated with 100 ng/ml Trichostatin A (TSA) (Sigma, St. Louis, MO) for 24 hours (CMT.64, B16F10, PA and L M D ) or 48 hours (TC-1, D l 1 and A9), or with 50 ng/ml IFN-y for 48 hours.  EPIGENETIC CONTROL OF TUMOR IMMUNOEVASION 3.2.2  MECHANISMS  69  Reverse transcription-PCR analysis Total cellular R N A was extracted using Trizol Reagent (Invitrogen, Burlington,  ON); contaminating D N A was removed by treatment with DNase 1 (Ambion Inc., Austin, TX). Reverse transcription of 1 ug of total cellular R N A was performed using the reverse transcription kit (SSII RT) from Invitrogen, in a total volume of 20 pi. Two microliters aliquots of c D N A were used as a template for PCR in a total of 50 pi reaction mixture containing l x PCR buffer, 250 u M deoxynucleotide triphosphate, 1.5 m M MgCl2, 200 n M of each primer and 2.5 units Taq or Platinum Taq D N A Polymerase. c D N A amplifications were carried out in a T-gradient thermocycler (Biometra, Goettingen, Germany) with 25-35 cycles of denaturation (1 min, 95°C), annealing (1 min, 54-64°C), and elongation (2 min, 72°C). The cycling was concluded with a final extension at 72°C for 10 min. Twenty microliters of amplified products were analyzed on agarose gels, stained with ethidium bromide and photographed under U V light. Primers used for P C R amplifications (Sigma-Genosys, Oakville, O N and Integrated D N A Technologies (IDT), Coralville, IA) are listed in Table 3.2.2.1 below. A l l PCR reagents were obtained from Invitrogen and Fermentas (Burlington, ON).  EPIGENETIC CONTROL OF TUMOR IMMUNOEVASION  MECHANISMS  70  Table 3.2.2.1: Primers used for R T - P C R and real time P C R analysis. Oligonucleotide  P r i m e r sequence (5'-3')  TAP-1  F: T G G C T C G T T G G C A C C C T C A A A  a  Tm(°C)  bp  b  64.0  775  60.0  665  56.0  240  60.0  166  56.0  360  54.0  713  60.0  207  61.0  172  61.0  190  R: T C A G T C T G C A G G A G C C G C A A G A TAP-2  LMP-2  F:  GCTGTGGGGACTGCTAAAAG  R:  TATTGGCATTGAAAGGGAGC  F: C G A C A G C C C T T T A C C A T C G R:  Tapasin  TCACTCATCGTAGAATTTTGGCAG  F: A C G T C A C C C T G G A G G T G G C A R: A C T G G A G T C A T C T G G G C C A G  B2M  F: A T G G C T C G C T C G G T G A C C R: T C A C A T G T C T C G A T C C C A G T A G A  (3-actin  F: A T G G A T G A C G A T A T C G C T G C R:  TTCTCCAGGGAGGAAGAGGAT  TAP-1 promoter  F: G G C T C G G C T T T C C A A T C A  (5'-end)  R: G G A T G G G A A A A T T C A C G C A A  TAP-1 promoter  F: T T C T T C C T C T A A A C G C C A G C A  (3'-end)  R:  p T A P l - L u c copy  F (TAP-1 promoter): T T C T T C C T C T A A A C G C C A G C A  number  R ilucl):  CGAGCGTGAGCTGTCCAGAGTCT  AGTGGGTAGAATGGCGCTG  a  F: f o r w a r d p r i m e r ; R: reverse p r i m e r .  b  L e n g t h o f the P C R a m p l i f i c a t i o n product.  0  R e s t r i c t i o n e n z y m e sites are u n d e r l i n e d .  3.2.3 Real-time quantitative P C R analysis P u r i f i e d g e n o m i c D N A w a s used as template f o r a m p l i f i c a t i o n s u s i n g 200-500 n M o f each p r i m e r and 1 u l S Y B R G r e e n T a q R e a d y M i x ( R o c h e , M a n n h e i m , G e r m a n y ) i n a total o f 10 u l reaction m i x t u r e . 35-40 c y c l e s o f denaturation (5 seconds, 9 5 ° C ) ,  EPIGENETIC CONTROL OF TUMOR IMMUNOEVASION  MECHANISMS  71  annealing (5 seconds, 61-63°C), and elongation (20 seconds, 72°C) were performed using a Roche LightCycler.  3.2.4 Flow cytometry Flow cytometric analysis of H-2K  b  expression was performed using PE-  conjugated anti-K mouse monoclonal antibody (mAb) (BD Pharmingen, San Diego, C A ) b  and a FACScan cytometer (Becton Dickinson, Mountain View, CA).  3.2.5 Chromatin immunoprecipitation assays Chromatin immunoprecipitation experiments using 7 x 10 cells per sample were 6  done as previously described [18]. Five micrograms of anti-RNA pol II (N-20, sc-899, Santa Cruz Biotechnology Inc., Santa Cruz, C A ) , anti-acetyl-histone H3 (Upstate Biotechnology Inc., Lake Placid, N Y ) or anti-CBP (A-22, sc-369, Santa Cruz Biotechnology) polyclonal antibody (Ab) were used for the immunoprecipitation. Levels of murine TAP-1 promoter co-immunoprecipitating with the antibody from each sample were quantified by real-time PCR using primers specific for the TAP-1 promoter. Primers specific to the 3'-end of the TAP-1 promoter region were used for PCR when the templates were immunoprecipitated using anti-RNA pol II or anti-acetyl-histone H3 antibody, while 5'-end-specific primers were used for templates immunoprecipitated using anti-CBP antibody. Serial dilutions of plasmid containing the murine TAP-1 promoter were amplified following the same protocol to generate a standard curve.  3.2.6 Plasmid construction The plasmid containing an EGFP coding region driven by the TAP-1 promoter (pTAPl-EGFP) was described previously [9]. A similar construct containing a luciferase  EPIGENETIC CONTROL OF TUMOR IMMUNOEVASION  72  MECHANISMS  gene d r i v e n b y the T A P - 1 p r o m o t e r r e g i o n ( p T A P l - L u c ) w a s created b y i ns erti ng the T A P - 1 p r o m o t e r b e tw e e n the S a c I and B g l II sites o f the p G L 4 . 1 4 [ l u c 2 / H y g r o ] v e c t o r ( P r o m e g a , M a d i s o n , W I ) ( A p p e n d i x B ) . 5'-end truncations o f the T A P - 1 p r o m o t e r r e g i o n w e r e also c l o n e d into p G L 4 . 1 4 [ l u c 2 / H y g r o ] vector. T h e A T G c o d o n o f the Tap-1  gene  was arbitrarily n u m b e r e d as +1, and the truncated promoters w e r e n a m e d a c c o r d i n g to the starting base p o s i t i o n o f f o r w a r d p r i m e r s w i t h respect to the A T G c o d o n (-427, -401 and 150). P r i m e r s used for P C R a m p l i f i c a t i o n s o f the f u l l T A P - 1 p r o m o t e r and its truncations are listed i n T a b l e 3.2.6.1.  Table 3.2.6.1: Primers used for PCR amplifications of full TAP-1 promoter and its truncations. Oligonucleotide  P r i m e r sequence ( 5 ' - 3 ' )  Full TAP-1  F: c g a g a g c t c G G C T C G G C T T T C C A A T C A  promoter  R: gaagatctG A G C G T G A G C T G T C C A G A G T C T  c  F: c g a g a g c t c A T C T G C C C A G A G A C A G G T G A  -427 truncated TAP-1 promoter  0  c  TAP-1 promoter  0  b  60.0  557  55.0  427  55.0  401  60.0  150  R:gaagatctGAGCGTGAGCTGTCCAGAGTCT  a  F: f o r w a r d p r i m e r ; R: reverse p r i m e r .  b  L e n g t h o f the P C R a m p l i f i c a t i o n product.  0  bp  R:gaagatctGAGCGTGAGCTGTCCAGAGTCT F: c g a g a g c t c T T C T A G T C A G C T C C A C C A G C T C  -150 truncated  Tm(°C)  R:gaagatctGAGCGTGAGCTGTCCAGAGTCT F: c g a g a g c t c A G G G T C C T G C C C T C A A T C  -401 truncated TAP-1 promoter  a  R e s t r i c t i o n e n z y m e sites are u n d e r l i n e d .  3.2.7 Transfection and selection T C - 1 , D l l , A 9 , P A a n d L M D c e l l s w e r e transfected w i t h the p T A P l - L u c constructs o r the promoterless p G L 4 . 1 4 [ l u c 2 / H y g r o ] vector u s i n g E x G e n 5 0 0 in vitro  EPIGENETIC CONTROL OF TUMOR IMMUNOEVASION  MECHANISMS  73  Transfection Reagent (Fermentas). Transient transfectants were analysed between 12-72 hours after co-transfection of the p T A P l - L u c construct or the promoterless vector with pRL-TK plasmid (Promega) in 10:1 ratio. To obtain stable transfectants, the transfected cells were selected for three weeks in the presence of 200-550 ng/ml Hygromycin B (Sigma).  3.2.8 Luciferase assays Relative luciferase activity (RLA) in transient transfectants was assessed by dual luciferase assay (Promega) 12-72 hours after transfection. Copy numbers of the p T A P l Luc construct integrated into the genome of the stable transfectants were quantified by real time P C R using a forward primer specific for.the TAP-1 promoter and a reverse primer specific for the luc2 gene. R L A in stable transfectants (3-4 weeks posttransfection) was assessed by Bright-Glo luciferase assay (Promega) using 10,000 cells per sample and was determined by normalizing the luciferase values with copy number of plasmids integrated into the genome of each stable transfectant.  3.2.9 Western Blots Fifty micrograms of protein per sample were separated with 6% (CBP and TAP1) or 15% (P-actin and acetyl-histone H3) SDS-PAGE. Proteins were transferred to nitrocellulose membranes (Bio-rad, Hercules, CA). Blots were blocked with 5% skim milk in PBS and incubated with the following rabbit polyclonal antibodies: anti-mouse TAP-1 [19]; anti-acetyl-histone H3 (Upstate Biotechnology Inc.); anti-p300 (C-20, sc585, Santa Cruz); anti-CBP (A-22, sc-369, Santa Cruz). Secondary antibody was an HRP-conjugated goat anti-rabbit polyclonal antibody (Jackson Immunoresearch Lab.,  EPIGENETIC CONTROL OF TUMOR IMMUNOEVASION  74  MECHANISMS  West Grove, PA). For the loading controls, anti-P-actin mouse monoclonal antibody (Sigma) was used, followed by HRP-conjugated goat anti-mouse secondary antibody (Pierce, Rockford, IL). Blots were visualized using Lumi-light E C L reagents (Pierce). 3.2.10 Cytotoxicity assays CTL effector cells were generated by injecting a C57BL/6 mouse (Charles River, St. Constant, QC) with 10 tissue culture infectious particles (TCIP) of Vesicular 7  Stomatitis Virus (VSV). The spleen was harvested seven days later, homogenized, and cells were incubated for five days in RPMI-1640 containing 10% FBS (Hyclone), 20 m M HEPES, 1% N E A A , 1% sodium pyruvate, 1% L-glutamine, 1% penicillin/streptomycin and 0.1% 2-ME, in the presence of l u M V S V - N P peptide ( R G Y V Y Q G L ) . TC-1, D l l and A 9 cells were treated with IFN-y (50 ng/ml) or TSA (100 ng/ml) for 24 hours, or left untreated; V S V at an MOI of 7.5 was then added and the experiment was performed 16 hours later. Cells were washed with PBS and loaded with C r by incubating 10 cells 51  6  with 100 uCi of C r sodium chromate (Amersham, Arlington Heights, IL) in 250 ul of 5 1  culture media for one hour. Following three washes with PBS, the target cells were incubated with the effector cells at the indicated ratios for four hours. One hundred microliters of supernatant from each well were collected and the  51  C r release was  measured by a y-counter ( L K B Instruments, Gaithersburg, MD). The specific C r release 5 l  was calculated as follows: ((experimental - media control) / (total - media control)) x 100%. The total release was obtained by lysis of the cells with a 5% Triton X-100 solution.  EPIGENETIC CONTROL OF TUMOR IMMUNOEVASION 3.2.11 Establishment  of  HPV-positive  MECHANISMS  cancer  xenografts  75  and  treatment with Trichostatin A Four hundred thousand pTAPl-Luc stable transfectants of TC-1 or A 9 cells were resuspended in PBS, then injected subcutaneously (s.c.) into seven-week-old female C57BL/6 syngeneic mice. TSA was dissolved in D M S O to a concentration of 0.2 mg/ml. Daily treatment with 50 pi T S A (500 pg/kg) or D M S O (vehicle control) was administered via intraperitoneal (i.p.) injection for 20 days, starting on day seven after injection with tumor cells. The dose of 500 pg/kg TSA per animal per day was chosen as it had been successfully used by others to suppress other types of tumor growth in murine tumor models [20-22]. Mice were assigned to three groups (TC-1 treated with D M S O , A9 treated with D M S O and A9 treated with TSA) of four animals per group. Mice were weighed weekly, and their behavior and food intake were monitored throughout the course of the experiment. Tumors were measured three times a week and tumor volume was calculated using the formula: tumor volume = length x width x height x n/6 [20]. The study period was determined by the size of the tumors in the A 9 group treated with D M S O vehicle control. A l l procedures were performed in compliance with the Canadian Council on Animal Care (CCAC) guidelines.  EPIGENETIC CONTROL OF TUMOR IMMUNOEVASION  MECHANISMS  76  3.3 Results 3.3.1  Chromatin remodeling regulates TAP-1 transcription In order to investigate transcriptional regulation of TAP-1, a luciferase reporter  construct was generated by cloning the mouse TAP-1 promoter region upstream of the luc gene in the pGL4.14[luc2/Hygro] vector (pTAPl-Luc) and was transfected into the TAP-expressing (Ltk, R M A ) and TAP-deficient ( L M D , CMT.64, B16F10) cells. Consistent with previous results obtained with the TAP-1-promoter-EGFP reporter construct [9], the pattern of expression of luciferase (Luc) in these stable transfectants was found to correlate with the pattern of endogenous TAP-1 expression ([9] and Figure 3.3.1.1). However, when the TAP-expressing and TAP-deficient cells were transiently transfected with the same construct, the pattern of differential expression no longer correlate with endogenous TAP-1 expression. It was conceivable that this lack of correlation may have resulted, at least in part, from the fact that the cell lines used were derived from distinct types of carcinomas, and. therefore were unrelated to each other. To avoid this problem, two other models of TAP-expressing (TC-1 and PA) and T A P deficient (TC-1/A9 and L M D ) cells that were derived from primary tumors and their metastases, respectively, were used in subsequent experiments.  77  EPIGENETIC CONTROL OF TUMOR IMMUNOEVASION MECHANISMS  12-72 hrs post-transfection  3-4 weeks post-transfection Vector control  Vector control  raba L*  CMT.64  Uk  ^fT64  LB  I  CMT.64  Irfl ....Eia... D11  AS  TC-1  PA  Cell lines  D11  A9  TC-1  LMD  PA  D11  A9  LMD  Cell lines  Figure 3.3.1.1: Differences in TAP-1 promoter activity in stable transfectants generally match the TAP-1 expression profiles better than in transient transfectants. Relative luciferase activity (RLA) in transient (12-72 hours posttransfection) and stable (3-4 weeks post-transfection) transfectants. In the transient transfectants, the luciferase unit in each cell line was determined as the ratio of firefly:renila luciferase unit. In the stable transfectants, the luciferase unit in each cell line was determined as the ratio of firefly luciferasexopy number of pTAPl-Luc construct integrated into the genome. Relative luciferase activity (RLA) was determined as the luciferase unit in a particular cell line divided by the lowest value of luciferase unit obtained in that particular group of cells. Columns, average of three to six independent experiments; bars, S E M . * P < .05 compared with cells that expressed higher TAP-1 and M H C class I in the same group of cells (Student's t-test).  EPIGENETIC  CONTROL  OF TUMOR IMMUNOEVASION  MECHANISMS  78  It was confirmed that TAP-1 expression levels in these new models of T A P expressing and TAP-deficient cells correlated with M H C class I surface expression levels (Figure 3.3.1.2). In the prostate carcinoma model, P A cells that expressed a higher level of TAP-1 than L M D cells also expressed a higher level of surface M H C class I. Similarly, in the HPV-positive carcinoma model, TC-1, D l l and A 9 cells that express high, moderate and low levels of TAP-1, respectively, also expressed the same pattern of surface M H C class I.  Figure 3.3.1.2: Analysis of TAP- 1 and surface M H C class I expression by RT-PCR and flow cytometry, respectively. Shaded area, thin and thick lines represent low (A9 or L M D ) , medium ( D l l ) and high (TC-1 or PA) levels of M H C class I expression, respectively. Amplification of P-actin c D N A served as an internal control in the RT-PCR analysis. Data are representatives of three experiments.  EPIGENETIC CONTROL OF TUMOR IMMUNOEVASION  MECHANISMS  79  These TAP-expressing and TAP-defieient cells were then transfected with the pTAPl-Luc construct. With the TC-1/D11/A9 model, it was found that, again, the relative levels of luciferase expression in stable population of transfectants matched the profiles of endogenous TAP-1 expression better than those in transient transfectants. Taken together with the results obtained with Ltk, R M A , CMT.64 and B16F10 cells, this observation suggests that integration of the reporter construct into the chromatin correlates with the differential activity of the TAP-1-promoter between TAP-expressing and TAP-deficient cells. The prostate carcinoma model was an exception to this trend, since the luciferase expression patterns obtained from stable and transient transfection both correlated with the endogenous TAP-1 expression (Figure 3.3.1.1). As a control, it was  verified  that  luciferase  expression  in  all  cell  lines  transfected  with  pGL4.14[luc2/Hygro] vector alone was negligible compared to that in cells transfected with the pTAPl-Luc construct. Furthermore, it was found that R N A polymerase II (pol II) binding to the endogenous TAP-1 promoter was lower in cells with low TAP-1 expression levels than that in cells with high TAP-1 expression levels (Figure 3.3.1.3). One possible explanation to account for this phenomenon was that the chromatin structure was forming a physical barrier, reducing the access of R N A pol II complex to the TAP-1 promoter. The L M D cells, the only cells that did not follow the TAP-1 expression trend in stable versus transient transfection, are likely to have additional defects that impair the activity of the TAP-1 promoter in addition to those related to chromatin remodeling.  EPIGENETIC CONTROL OF TUMOR IMMUNOEVASION  80  MECHANISMS  • 3.5  I  .- 5  'ft*  ' ' lllilill  < • K  ..V  0  *  4  ' AS :  •TO;  11  s S2  • CelHsnes .:  *• RMA  r  i  CMTS4--  • Ceii hues .: :>.  Figure 3.3.1.3: R N A pol II binding to TAP-1 promoter is low in T A P deficient carcinomas. The levels of R N A pol II in TAP-1 promoter of each cell line were assessed by chromatin immunoprecipitation using anti-RNA pol II Ab. The eluted D N A fragment were purified and used as templates for real-time PCR analysis using primers specific for the 3'-end of the TAP-1 promoter. Relative R N A pol II levels were determined as the ratio of copy numbers of the eluted TAP-1 promoter and copy numbers of the corresponding inputs. The smallest ratio in each group of experiments was arbitrarily determined as 1. Columns, average of three to six experiments; bars, S E M . * P < .05 compared with cells that expressed higher TAP-1 and M H C class I in the same group of cells (Student's t-test).  3.3.2 Histone H3 acetylation within the TAP-1 promoter is low in M H C class l-deficient carcinomas A well-known epigenetic mechanism that regulates gene expression is the acetylation of histone H3 within a gene locus [23-25], which promotes relaxation of the nucleosome structure and allows the transcriptional machinery to access the promoter [24, 26]. Therefore, the hypothesis tested was that the differential TAP-1 promoter  EPIGENETIC CONTROL OF TUMOR IMMUNOEVASION  MECHANISMS  81  activity between TAP-expressing and TAP-deficient cells results from distinct levels of histone H3 acetylation within the TAP-1 promoter. In the HPV-positive carcinoma model, it was found that histone H3 acetylation within TAP-1 promoter was impaired in A9 cells, which express the lowest level of TAP 1. D l 1 cells that express intermediate levels of TAP-1 compared to TC-1 and A 9 also had intermediate levels of acetyl-histone H3 within the TAP-1 promoter (Figure 3.3.2.1). In the prostate carcinoma model, the metastatic, TAP-deficient L M D cells also had less acetyl-histone H3 within the TAP-1 promoter than in the non-metastatic, TAP-positive P A cells. In addition, the level of acetyl-histone H3 within the TAP-1 promoter in several other TAP-expressing (Ltk and R M A ) and TAP-deficient (CMT.64 and B16F10) cell lines was also assessed. Acetyl-histone H3 was again found in low levels in the TAPdeficient carcinomas; in fact, it was absent in the highly metastatic CMT.64 cells. Taken together, these results demonstrate a clear correlation between the levels of TAP-1 expression and histone H3 acetylation within the TAP-1 promoter.  EPIGENETIC CONTROL OF TUMOR IMMUNOEVASION  _o 2-  MECHANISMS  82  ?  <» \ Z-  rt  x 1 28 . ;-. . 1 s  RMA  •*• •.. ..Cell lines'  •• :Cf,fT.64-  ••. .Gel! >tnes\  Figure 3.3.2.1: Acetyl-histone H3 binding to TAP-1 promoter is low in TAPdeficient carcinomas. The levels of acetyl-histone H3 in TAP-1 promoter of each cell line were assessed by chromatin immunoprecipitation using anti-acetylhistone H3 Ab. The eluted D N A fragments were purified and used as templates for real-time P C R analysis using primers specific for the 3'-end of the TAP-1 promoter. Relative acetyl-histone H3 levels were determined as the ratio of copy numbers of the eluted TAP-1 promoter and copy numbers of the corresponding inputs. The smallest ratio in each group of experiments was arbitrarily determined as 1. Columns, average of three to six experiments; bars, S E M . * P < .05 compared with cells that expressed higher TAP-1 and M H C class I in the same group of cells (Student's t-test).  3.3.3 Identification of a region in TAP-1 promoter responsible for the differential activity in TAP-expressing and TAP-deficient cells In order to determine the critical region of the TAP-1 promoter that is responsible for the differential promoter activity in TAP-expressing and TAP-deficient cells, several constructs were made by cloning 5'-end truncations of the TAP-1 promoter into the pGL4.14[luc2/Hygro] vector (constructs -427, -401 and -150 in Figure 3.3.3.1).  EPIGENETIC CONTROL OF TUMOR IMMUNOEVASION  -55.01- •  .  CTTTCCMl'C  -490  MECHANISMS  AGCGGCTGCG • CGCGGTGCAG' :GCAACTTGCA-  ;  .  83  .•' GAC'llGAGGCC  .  CCGCCCCATJC  ..• SP-1 (-) •  .  • f ATCGCGCAAG GGGCGIGC.CG -TTCTACGAGC ' AT-TTGGCGCG CAGAGCRAAC• GTGAGCAGGG -430. ' r**-42?-• ' F~r-40r . • • •• CAAATCTGCC CAGAGACAGG,.|TGRCG ACAJGA: GGGTCCTGCC' CTCAA'IJCTGG GGTGGGGCC'XJ • . CRIBTh : V . .. • - '• SP.-K + ) -370' "• ' . :' •" . . '. GGGATGGGAA AATTCACGCA' AGCAAGTTAA, GGGGGCT[GGG rr  a  -310 -250  • f  •  1.1 i  n  r  f  •  ..  :  r  A  - :  .,:  I i  :• • -  -  GAAGAAJGAGG. r  -..  Cjx  . - .•  T " "  • • ,. .•,:••!• v..: •• — l *> -15D-  -190  If  / AP-1 ( + ) •  V " L  i  AGAATGAGAT  t  T  r C  i  • .. .  C T  TTLC :  I r II f I  1 (.  ATG  Kfc (  j  I  "  ur  k  f  k  )  )  Figure 3.3.3.1: TAP-1 promoter sequence with transcription factor binding motifs and 5' truncation sites. The TAP-1 A T G codon was arbitrarily determined as +1. Truncation sites are indicated by numbered arrows. Motifs located on the sense strand are indicated by a (+) and motifs located on the antisense strand are indicated by a (-).  It was found that progressive truncations of 5'-end of the TAP-1 promoter resulted in a gradual decrease in the promoter's activity (as measured by Luc expression) in the TAPexpressing cells (Figure 3.3.3.2). This decrease in promoter activity indicates that the deleted regions normally participate in TAP-1 promoter activity. Interestingly, the truncations up to -401 did not affect the activity of the TAP-1 promoter in the T A P deficient cells. This indicates that, in contrast to what was observed in TAP-expressing  EPIGENETIC CONTROL OF TUMOR  IMMUNOEVASIONMECHANISMS  84  c e l l s , the -567 to -401 r e g i o n o f the T A P - 1 p r o m o t e r does not participate i n the p r o m o t e r ' s a c t i v i t y i n T A P - d e f i c i e n t c e l l s . F i n a l l y , it is important to note that the -401 construct y i e l d e d s i m i l a r p r o m o t e r a c t i v i t y i n T A P - e x p r e s s i n g a n d T A P - d e f i c i e n t c e l l s . T a k e n together, these observations indicate that a l l the cw-acting elements r e s p o n s i b l e f o r the differential T A P - 1 p r o m o t e r a c t i v i t y i n T A P - e x p r e s s i n g versus T A P - d e f i c i e n t c e l l s are located i n the r e g i o n e n c o m p a s s i n g base pairs -567 to -401.  Figure 3.3.3.2: A critical region that is responsible for differential activity of the TAP-1 promoter in TAP-expressing and TAP-deficient cells is found inbetween -427 and -401 region of the promoter. R L A w a s m e a s u r e d i n stable transfectants. T h e largest value i n each group o f e x p e r i m e n t s w a s arbitrarily  determined as 1. Columns, average o f five e x p e r i m e n t s ; bars, S E M . * P < .05 c o m p a r e d w i t h T A P - e x p r e s s i n g c e l l s i n the same g r o u p (Student's t-test).  A m o r e detailed analysis revealed that the r e g i o n e n c o m p a s s i n g base pairs -427 to -401 w a s sufficient to c o n f e r the differential T A P - 1 p r o m o t e r a c t i v i t y o b s e r v e d i n T A P e x p r e s s i n g versus T A P - d e f i c i e n t cells. A n a l y s i s o f putative t r a n s c r i p t i o n factor b i n d i n g sites, u s i n g T f s i t e s c a n software ( w w w . i f t i . o r g ) , b i n d i n g site w i t h i n this r e g i o n ( F i g u r e 3.3.3.1).  suggested the presence o f a C R E B  EPIGENETIC CONTROL OF TUMOR  IMMUNOEVASIONMECHANISMS  85  3.3.4 C B P binding to TAP-1 promoter is impaired in metastatic carcinomas The existence of a putative CREB binding site in the region responsible for the differential activity of the TAP-1 promoter in TAP-expressing versus TAP-deficient cells is particularly interesting, since the CREB-binding protein (CBP) is one of the wellknown transcriptional co-activators that possess intrinsic histone acetyltransferase (HAT) activity [27-29]. In addition, C B P is known to acetylate histone H3 [30], and the H A T activity and recruitment of CBP can be stimulated by various transcription factors [27] including SP-1 and AP-1 whose binding sites are also found in the TAP-1 promoter (Figure 3.3.3.1). These notions are consistent with the hypotheses that the differential TAP-1 promoter activity results from differences in chromatin structure at the tap-1 locus, and that the /ram-acting factors deficient or non-functional in TAP-deficient carcinomas can be those with the ability to control chromatin structures. Therefore, whether CBP plays a role in the differential TAP-1 promoter activity in TAP-expressing versus TAP-deficient cells was further analysed. Western blot analysis showed that CBP is not lacking or truncated in T A P deficient metastatic carcinomas (Figure 3.3.4.1).  Q  0.  _ J  CBP  —  mm,  p-actin  —  mm*  1  O H  T—  *Q  a) <  mm mm mm mmm mmm mmm  Figure 3.3.4.1: Expression of CBP proteins is similar in TAP-expressing and in TAP-deficient carcinoma cells.  EPIGENETIC CONTROL OF TUMOR IMMUNOEVASION  MECHANISMS  86  However, chromatin immunoprecipitation analysis showed that CBP binding to the TAP1 promoter was significantly lower in TAP-deficient, metastatic carcinomas compared to TAP-expressing, pre-metastatic cells (Figure 3.3.4.2). These results suggest that, in TAPdeficient cells, the lack of H A T activity normally exerted by CBP in TAP-1 promoter is likely to play a role in the inaccessibility of the promoter to the R N A pol II complex and in the subsequent impairment of TAP-1 transcription.  4 j :  " 3.5 •]  1! 2  "  CO 1 5 ' O 1 ,  0.5  oi  05 '  0 '  D11  f+1 I  1  I  1  •• •  CelHines  Figure 3.3.4.2: CBP binding to TAP-1 promoter is impaired in TAPdeficient, metastatic carcinomas. Chromatin immunoprecipitation using antiCBP antibody was performed as described earlier. Columns, average of four experiments; bars, S E M . * P < .05 compared with cells that expressed the highest TAP-1 and M H C class I in the same group of cells (Student's t-test).  3.3.5 IFN-y treatment increases the level of C B P , acetyl-histone H3 and RNA polymerase II recruitment to the TAP-1 promoter in TAP-deficient metastatic carcinomas Since the lack of CBP-mediated acetylation of histone H3 at the TAP-1 promoter appears to contribute to the TAP-1 deficiency in metastatic carcinomas, the hypothesis  87  EPIGENETIC CONTROL OF TUMOR IMMUNOEVASION MECHANISMS  that IFN-y, a w e l l - k n o w n i n d u c e r o f T A P - 1 expression [9, 15, 3 1 , 3 2 ] , restored T A P - 1 e x p r e s s i o n b y i n c r e a s i n g histone H 3 acetylation at this l o c u s w a s tested. T h e results s h o w e d that IFN-y i n c r e a s e d the l e v e l o f C B P , acetyl-histone H 3 a n d R N A p o l II recruitment to the T A P - 1 p r o m o t e r ( F i g u r e 3.3.5.1 A , B and C , r e s p e c t i v e l y ) .  A. T  I  rti  25  EL  Q untreated  : Q untreated  E3 4- IFTFgarrma  £3 + IFN-garrma  2  ca i.r, o 1 0.5 0  PA  B.  3.5  41 _ 3-5 § 3 a> ~ 2.5 i CO X 2! 2-15-  LMD Cell lines  Cell lines  3  s Q untreated  rfi  • •HFN-gairirB  r> I  2  t  1  <  0.5  I  [•untreated j 8 + IFN-gamma  0.5  0 D11  PA  12 _ iO  B  8  « ....!  untreated  1 a. < z i: 6  LMD Cell lines  Cell lines  : m • IFN-gamma  5  = 0  1 2  90 80 70 60 50 40 30 20  • untreated E3+ IFN-gamma  o: ! 2  o  D11 Cell lines  Cell lines  Figure 3.3.5.1: IFN-y treatment improves the recruitment of CBP, acetylhistone H3 and RNA pol II to TAP-1 promoter, most significatly in TAPdeficient cells. C h r o m a t i n i m m u n o p r e c i p i t a t i o n u s i n g A, a n t i - C B P , B, anti-acetylhistone H 3 o r C, a n t i - R N A p o l II antibody w a s p e r f o r m e d as d e s c r i b e d earlier. Columns, average o f three to f o u r e x p e r i m e n t s ; bars, S E M . * P < .05 c o m p a r e d w i t h untreated c e l l s (Student's t-test).  EPIGENETIC CONTROL OF TUMOR IMMUNOEVASIONMECHANISMS  88  Based on these results, a possible mechanism of TAP-1 induction by IFN-y is proposed to be via the improvement of CBP binding to the TAP-1 promoter, thereby promoting histone H 3 acetylation in the region and leading to relaxation of the surrounding chromatin. This would in turn increase the accessibility of R N A polymerase II complex to the TAP-1 promoter and promote transcription of this gene. 3.3.6 Trichostatin A (TSA), a histone deacetylase inhibitor, increases the  expression  of  TAP-1  and  other  antigen-processing  machinery (APM) components in metastatic (TAP-deficient) and pre-metastatic (TAP-expressing) carcinomas As the acetylation level of histones in the TAP-1 promoter seems to regulate TAP-1 expression in carcinomas, an investigation was performed to test whether inhibition of histone deacetylase (HDAC) activity in TAP-deficient carcinoma cells with TSA would restore TAP-1 expression. T S A is a highly specific, hydroxamic acid-based H D A C inhibitor (HDACi) [33-35]. By chromatin immunoprecipitation assays, it was found that T S A treatment, indeed, enhanced the recruitment of R N A pol II complex to the TAP-1 promoter in most cell lines (Figure 3.3.6.1 A). This phenomenon was particularly prominent in the TAP-deficient cells, in which T S A treatment enhanced the recruitment of R N A pol II to levels similar to those in TAP-expressing cells. In addition, TAP-1 promoter activity also increased significantly in TAP-deficient cells upon treatment with T S A (Figure 3.3.6.IB). The fact that T S A treatment increases TAP-1 promoter activity confirms that chromatin remodeling plays a crucial role in the regulation of TAP-1 promoter activity.  EPIGENETIC CONTROL OF TUMOR IMMUNOEVASION A  MECHANISMS  89  6 _ S > „  i  3-  PI  Q. <  | • untreated JB + TSA  ^1  2  1  1  >  „  =  5  •  a* 2  3  rr 2  &sfci....  i  MS  1 o  D11  Cell lines B  6  Cell lines  Vector control  5 4  3 a  3 •  untreated  S + TSA  1  1 TC-1  D11  • untreated! |  <  a.  2  Vector control  4 • •  3  o  S + TSA  2 L  A9  TC-1 D11  Cell lines  untreated  H + TSA  A9  j  LMD  _ RA  Cell lines  Figure 3.3.6.1: T S A treatment enhances R N A pol II recruitment to TAP-1 promoter and TAP-1 promoter activity. A, The levels of R N A Pol II in TAP-1 promoter of each cell line were assessed by chromatin immunoprecipitation using anti-RNA pol II. B, TAP-1 promoter activity in stable transfectants was determined by luciferase assay. Columns, average of three to six experiments; bars, S E M . * P < .05 compared with untreated cells (Student's t-test).  EPIGENETIC CONTROL OF TUMOR IMMUNOEVASION  90  MECHANISMS  Based on the observations that levels of histone H3 acetylation correlate with TAP-1 expression and that T S A treatment enhances TAP-1-promoter activity, it was tempting to speculate that the effect of T S A on TAP-1 promoter activity could be occurring  via  an  increase  in  histone  H3  acetylation.  However,  chromatin  immunoprecipitation results showed that T S A treatment did not significantly alter the levels of acetyl-histone H3 in TAP-1 promoter in any of cell lines tested (Figure 3.3.6.2). This suggests that the mechanism by which T S A increases the TAP-1 promoter activity does not involve a direct improvement of histone H3 acetylation within the TAP-1 promoter itself. Further investigation will be required to delineate the exact mechanism underlying the effect of TSA on TAP-1 promoter activity.  3  2.5 -  • untreated  Cell lines  Cell lines  Figure 3.3.6.2: T S A treatment does not significantly alter the levels of histone H3 acetylation in TAP-1 promoter. The levels of acetyl-histone H3 in TAP-1 promoter of each cell line were assessed by chromatin immunoprecipitation using anti-acetyl-histone H3 antibody. Columns, average of three to six experiments; bars, SEM.  EPIGENETIC  3.3.7  CONTROL  OF  TUMOR  IMMUNOEVASION  91  MECHANISMS  T S A treatment increases the expression of TAP-1 and surface MHC class I, resulting in an increased susceptibility of T A P deficient metastatic carcinomas to C T L killing C o n s i s t e n t w i t h the increase i n T A P - 1 p r o m o t e r a c t i v i t y , the e x p r e s s i o n o f T A P - 1  at the m R N A  a n d p r o t e i n levels (as assessed b y R T - P C R a n d W e s t e r n B l o t ) w a s  enhanced i n response to T S A o r IFN-y treatment ( F i g u r e 3.3.7.1).  Figure 3 . 3 . 7 . 1 : TAP-1 expression in all cell lines, particularly in the TAPdeficient carcinomas, was up-regulated with TSA treatment. Up-regulated T A P - 1 e x p r e s s i o n f r o m IFN-y-treated c e l l s w a s used as a p o s i t i v e c o n t r o l , p-actin e x p r e s s i o n served  as a l o a d i n g c o n t r o l .  Data  are representatives  o f three  experiments.  R T - P C R analyses w e r e p e r f o r m e d to test whether treatment w i t h T S A o r IFN-y also restored the e x p r e s s i o n o f L M P - 2 a n d p o s s i b l y other A P M c o m p o n e n t s , since the T A P - 1 promoter is a b i - d i r e c t i o n a l p r o m o t e r that also controls the e x p r e s s i o n o f the LMP-2  gene  EPIGENETIC CONTROL OF TUMOR IMMUNOEVASION  MECHANISMS  92  [36]. T h e results s h o w e d that the Lmp-2 a n d Tap-2 genes have s i m i l a r patterns o f e x p r e s s i o n as the Tap-I gene i n T C - 1 , D l l a n d A 9 c e l l s ( h i g h , moderate a n d l o w , r e s p e c t i v e l y ) ( F i g u r e 3.3.7.2). T h e e x p r e s s i o n o f L M P - 2 , as w e l l as T A P - 2 a n d t a p a s i n , w a s also increased b y T S A o r IFN-y treatment i n the H P V - p o s i t i v e c a r c i n o m a c e l l lines.  LMP-2 TAP-2 Tapasin  p-actin  Figure 3.3.7.2: Expression of LMP-2, TAP-2 and tapasin in all cell lines, particularly in the TAP-deficient carcinomas, was up-regulated with TSA treatment. A m p l i f i c a t i o n o f A P M c D N A f r o m IFN-y-treated c e l l s w a s u s e d as a positive  control.  P-actin  e x p r e s s i o n served  as a l o a d i n g c o n t r o l .  D a t a are  representatives o f three e x p e r i m e n t s .  F l o w c y t o m e t r i c analyses o f surface H - 2 K whether  b  e x p r e s s i o n w e r e p e r f o r m e d t o test  T S A treatment w o u l d also result i n a n increase o f M H C class I antigen  presentation i n the metastatic c a r c i n o m a c e l l s , since the e x p r e s s i o n o f several a n t i g e n p r o c e s s i n g c o m p o n e n t s increases u p o n T S A treatment. T h e results demonstrated that T S A treatment increased the H - 2 K surface e x p r e s s i o n b y a p p r o x i m a t e l y 10 f o l d i n T A P b  EPIGENETIC CONTROL OF TUMOR IMMUNOEVASION  MECHANISMS  93  deficient c e l l s , whereas the levels w e r e u n c h a n g e d i n P A and TC-1 c e l l s , w h i c h naturally express h i g h levels o f surface H - 2 K  b  ( F i g u r e 3.3.7.3). IFN-y treatment increased the  surface H - 2 K e x p r e s s i o n i n a l l c e l l lines. b  PA  LMD  D11  Figure 3.3.7.3: Surface H-2K expression, particularly on M H C class Ideficient cells, was enhanced by TSA treatment. C e l l s untreated (shaded areas) or treated w i t h 100 n g / m l T S A (thick lines) o r 50 ng/ml IFN-y (thin lines) w e r e stained w i t h P E - c o n j u g a t e d a n t i - H - 2 K m A b . D a t a are representatives o f three b  experiments.  F u r t h e r m o r e , c y t o t o x i c i t y ( C T L ) assays w e r e p e r f o r m e d to test whether the increased e x p r e s s i o n o f H - 2 K at the c e l l surface after T S A treatment w o u l d i m p r o v e the b  r e c o g n i t i o n and the k i l l i n g o f v i r a l l y - i n f e c t e d cancer c e l l s b y v i r u s - s p e c i f i c c y t o t o x i c T  EPIGENETIC CONTROL OF TUMOR IMMUNOEVASION  MECHANISMS  94  lymphocytes. In this assay, VSV-derived peptides are presented by the infected target cells in the context of H-2K only i f the cells have functional antigen processing and b  presenting machinery [1, 8]. As expected, DI 1 and A9 cells, which express lower surface K than the TC-1, are less susceptible to killing by the CTLs (Figure 3.3.7.4). T S A b  treatment of the virus-infected DI 1 and A 9 cells enhanced C T L killing by approximately 6 and 7 fold, respectively. IFN-y treatment resulted in a drastic increase in the killing of all VSV-infected cell lines. However, L M D cells remained resistant to C T L killing despite a significant induction of A P M and M H C class I expression by IFN-y due to unknown mechanisms independent of M H C class I expression [15].  70 60 50 Jj  5'  I—I—I  40 30  20  *  *  7  10 0  C e l l lines  Figure 3.3.7.4: TSA treatment improves HPV-positive tumor cell killing by CTLs. Target cells were uninfected or VSV-infected, untreated or treated with TSA or IFN-y for 24 hours before infection with the V S V . C T L assays were performed using effector:target ratio of 0.8:1 to 200:1. Representative data using 22:1 effectontarget ratio are shown in this figure. A l l cells were infected with V S V at a M O I of 7.5 for 16hr. Columns, average of three experiments; bars, S E M . * P < .05 compared with untreated cells (Student's t-test).  EPIGENETIC CONTROL OF TUMOR IMMUNOEVASION  MECHANISMS  95  An additional experiment using VSV-infected, TAP-deficient B16F10 as target cells also showed a similar improvement in the ability of specific CTLs to kill the cancer cells upon TSA treatment (Figure 3.3.7.5). Taken together, these results indicate that T S A or IFNy treatment increases TAP-1 expression, and ultimately results in an increase in immune recognition of metastatic carcinoma cells.  • uninfected - 0 ng/ml TSA - 20 ng/rrt TSA - 50 ng/rr! TSA -100 ng/ml TSA  efrr  22:1  7.4:1  -*  2.5:1  Effector: Target Ratio  Figure 3.3.7.5: TSA treatment improves B16F10 tumor cell killing by CTLs. Target cells were uninfected or VSV-infected, untreated or treated with various concentrations of T S A for 24 hours before infection with the V S V . C T L assay was performed using effector:target ratio of 2.5:1 to 67:1. A l l cells were infected with V S V at a MOI of 7.5 for 16hr.  3.3.8 T S A  treatment  suppresses  metastatic tumors  the  growth  of TAP-deficient,  in vivo  As T S A treatment increased C T L killing of TAP-deficient cells in vitro, it was further investigated whether it would result in a decrease in tumor formation in vivo. The  EPIGENETIC CONTROL OF TUMOR IMMUNOEVASION  MECHANISMS  96  results indicate that indeed, daily treatment of mice with T S A reduced the growth rate of A9 tumors (Figure 3.3.8.1). In addition, as expected, the TAP-expressing TC-1 cells were significantly less tumorigenic than the TAP-deficient A9 cells. Only four out of nine mice injected subcutaneously with TC-1 cells grew small tumors that only appeared at approximately 3-4 weeks after the injection, as compared to one week in all mice injected with the A 9 cells.  700 n  600  500  day 5 day 9 day 13 day 17 day 21 day 26 Days after tumor cells injection  Figure 3.3.8.1: T S A treatment suppresses tumor growth in vivo. A 9 ( M H C class I-deficient cells) tumor growth was suppressed in mice treated with 500 ug/kg of TSA daily compared to in those treated with D M S O vehicle control (n = 8 per treatment group). TC-1 group represented tumor growth in mice injected with high M H C class I-expressing cells (n = 9). Data represent the mean tumor volume ± S E M .  EPIGENETIC CONTROL OF TUMOR  IMMUNOEVASIONMECHANISMS  97  TAP-1 promoter activity in A 9 tumor cells isolated from the TSA-treated mice was found to be significantly higher than in those isolated from the control mice (Figure 3.3.8.2). These observations support the hypothesis that the improvement of TAP-1 expression and M H C class I antigen presentation leads to increased killing of the TAPdeficient metastatic cancer cells, thus suppresses tumor growth in vivo.  A9 + DMSO  A9 + TSA Cells  Figure 3.3.8.2: TAP-1 promoter activity is enhanced in TAP-deficient tumor cells isolated from TSA-treated mice. TAP-1 promoter-driven Luciferase (pTAPl-Luc) expression is higher in A9 cells isolated from TSA-treated mice than in those isolated from DMSO-treated mice (n=4 per treatment group). * P < .05 compared with cells from DMSO-treated mice (Student's t-test).  EPIGENETIC CONTROL OF THE IMMUNE ESCAPE  MECHANISMS  98  3.4 Discussion The regulation of chromatin structure plays an important role in controlling gene expression. The observations that silencing of the TAP-1 promoter reporter construct occurs exclusively after the construct integrates into the genome, and that levels of R N A pol II bound to the TAP-1 promoter are relatively low in metastatic, TAP-deficient cells suggest that access of the R N A pol II complex to the TAP-1 promoter is limited in the TAP-deficient cells. A compact nucleosome structure around a promoter region can act as a physical barrier that prevents the binding of transcriptional activators to the promoter and consequently, halts the transcription process [37]. Therefore, it was tested i f T A P deficiency in metastatic cancer cells results from a repressive state of chromatin structure. A high level of acetylated core histones in a chromatin template, particularly in the proximal region of an acetylation-sensitive promoter [37, 38], has been associated with active transcription [23, 24, 26, 27, 38]. As the results in this study demonstrate a role for chromatin remodeling in the regulation of TAP-1 expression, the specific players involved were sought to be identified. Although histone H3 is not the only core histone whose modification has been shown to influence gene expression [23, 39], the correlation between the acetylation of histone H3 and activation of several genes has been widely studied and is now well established [23-25, 39]. Therefore, histone H3 acetylation status within TAP-1 promoter was investigated in this study. The results demonstrate that the levels of acetylated histone H3 within the TAP-1 promoter show a trend similar to the levels of R N A pol II binding to TAP-1 promoter, and to TAP-1 expression at both the R N A and the protein levels in all the cell lines tested. These observations suggest that the level of histone H3 acetylation within the TAP-1 promoter plays a role in the regulation  EPIGENETIC CONTROL OF THE IMMUNE ESCAPE  MECHANISMS  99  of TAP-1 transcription, although it is not likely to be the sole mechanism involved, since the activation of transcription generally involves synergistic actions of several factors [24]. Furthermore, it was found that the region in the TAP-1 promoter that is responsible for the differential activity in the TAP-expressing versus the TAP-deficient carcinoma cells is located between bases -427 and -401, and that this region encompasses a putative CREB binding motif. CBP, a mammalian histone acetyltransferase, is known to associate with CREB [28, 29]. Therefore, the recruitment of C B P to the TAP-1 promoter in TAP-deficient cells was investigated. It was found that, indeed, the levels of CBP binding to TAP-1 promoter in TAP-deficient cells were lower than in cells that express higher levels of TAP-1. C B P is known to acetylate histones around promoter regions, resulting in increased accessibility of the promoters to essential transcriptional regulators [29]. Current findings suggest that in the metastatic cancer cells, the lack of CBP binding to TAP-1 promoter potentially contributes to the TAP-1 deficiency, probably by impairing histone H3 acetylation. In the study described in the previous chapter, it was proposed that the lack of expression or activity of trans-acting factors is one of the mechanisms that contributes to TAP-1 deficiency in malignant cells [9]. C B P is likely to be one of these factors. The exact mechanisms responsible for the decreased recruitment of CBP to the TAP-1 promoter remain to be identified. IFN-y is known to be a potent inducer of TAP-1 and surface M H C class I expression in cancer cells [9, 15, 31, 32]; however, little is known about molecular mechanisms that lead to TAP-1 induction by IFN-y. The findings that the improvement of CBP recruitment to the TAP-1 promoter correlated with higher levels of histone H3  EPIGENETIC CONTROL OF THE IMMUNE ESCAPE  100  MECHANISMS  acetylation, and therefore, active transcription of the Tap-I gene, provide one mechanism by which IFN-y increases TAP-1 expression. Furthermore, it was demonstrated for the first time that treatment of T A P deficient cells with T S A resulted in a significant increase in R N A pol II binding to the TAP-1 promoter and in the promoter's activity. T S A belongs to a group of hydroxamic acid-based histone deacetylase inhibitors (HDACi) that act on selective genes, altering the transcription of only approximately 2% of expressed genes in cultured tumor cells [35]. Consistent with this notion is the fact that histone acetylases and deacetylases act selectively on specific genes, and hence do not universally affect the transcription of all genes [38]. TSA has been shown to confer anti-tumor effects in vitro and in vivo [33-35]. However, the mechanism underlying the effect of TSA in tumor antigen presentation was not fully understood. In addition to the improvement in TAP-1 expression, it was found that treatment with T S A also resulted in the upregulation of several other A P M components, such as TAP-2, LMP-2 and tapasin. Given the proximity of Tap-I, Tap-2 and Lmp-2 genes within the M H C class II locus, and the location of gene encoding tapasin in the same chromosomal region [40], it is likely that these genes are co-regulated at the chromatin level. It has been reported previously that a small region (approximately 300 bp) could control the transcription of a cluster of genes by serving as a binding site for factors involved in chromatin remodeling [41, 42]. Since transcription of a TAP-1 promoterdriven reporter gene in TAP-deficient cells was silenced as the construct integrated into random sites of the genome, and since both the endogenous and the transfected TAP-1 promoter  activity  improved  upon  TSA  treatment,  it  is  possible  that  EPIGENETIC CONTROL OF THE IMMUNE ESCAPE  MECHANISMS  101  an autonomous chromatin condensation regulatory element (ACCRE) at the M H C class II locus exists within the LMP-2/TAP-1 intergenic region. Despite the efficacy of TSA in improving M H C class I antigen presentation in metastatic cancer cells, it was observed that the levels of induction resulting from T S A treatments were never as strong as the effects generated by IFN-y. The results showed that one of the key differences is their distinct ability to enhance the levels of histone H 3 acetylation in the TAP-1 promoter. IFN-y treatment of TAP-deficient cells enhanced histone H 3 acetylation within the TAP-1 promoter to much higher levels than TSA did, up to similar or even higher levels than in the TAP-expressing cells. It is conceivable that IFN-y treatment results in a maximal state of relaxation of chromatin structures around the TAP-1 locus, thus enabling optimal levels of binding of general transcription factors and R N A pol II to the TAP-1 promoter, sufficient to support high levels of transcription of this gene. Finally, results from in vivo experiments showed that daily treatment with T S A suppressed tumor growth in mice inoculated with A 9 cancer cells. The increase in TAP-1 promoter activity, hence enhanced transcription of the Tap-1 gene and possibly the expression of other A P M components in TAP-deficient A 9 tumor cells of TSA-treated mice, may significantly contribute to the reduction of tumor growth in these mice. These findings are encouraging for the development of therapeutic approaches that aim to increase tumor antigen presentation as a way to improve the recognition and the killing of neoplastic cells by specific CTLs. Nevertheless, further studies are required to improve the in vivo efficiency of natural H D A C i , such as TSA, depudecin, trapoxins, apicidins, sodium butyrate, phenylbutyrate and suberoyl anilide hydroxamic acid (SAHA) as anti-  EPIGENETIC CONTROL OF THE IMMUNE ESCAPE  MECHANISMS  102  cancer agents, as their effectiveness is greatly impaired by their instability and low retention in vivo [43]. This study presents a great support for the notion that TAP-deficient carcinomas lack trans-acting factors that would normally enable relaxation of the chromatin structure to allow access of general transcription factors and R N A pol II to the Tap-I gene promoter. This provides new insights into the epigenetic mechanisms responsible for the immune escape of cancer cells. Further research that aims to identify more chromatin, remodeling factors that play roles in tumor antigen processing deficiencies will be essential for the development of novel therapeutic approaches against M H C class Ideficient cancers. In contrast to genetic etiology of cancer, the possibility of reversing epigenetic codes may provide new targets for therapeutic intervention in cancer.  EPIGENETIC CONTROL OF THE IMMUNE ESCAPE  MECHANISMS  103  3.5 References 1.  Gabathuler, R., G. Reid, G. Kolaitis, J. Driscoll, and W.A. Jefferies. Comparison of cell lines deficient in antigen presentation reveals a functional role for TAP-1 alone in antigen processing. J Exp Med, 1994. 180:1415-25.  2.  Seliger, B., M . J . Maeurer, and S. Ferrone. Antigen-processing machinery breakdown and tumor growth. Immunol Today, 2000. 21:455-64.  3.  Seliger, B., M.J. Maeurer, and S. Ferrone. T A P off-tumors on. Immunol Today, 1997. 18:292-9.  4.  Seliger, B., U . Wollscheid, F. Momburg, T. Blankenstein, and C. Huber. Coordinate downregulation of multiple M H C class I antigen processing genes in chemical-induced murine tumor cell lines of distinct origin. Tissue Antigens, 2000.56:327-36.  5.  Lankat-Buttgereit, B . and R. Tampe. The transporter associated with antigen processing: function and implications in human diseases. Physiol Rev, 2002. 82:187-204.  6.  Ritz, U . and B. Seliger. The transporter associated with antigen processing (TAP): structural integrity, expression, function, and its clinical relevance. M o l Med, 2001. 7:149-58.  7.  Johnsen, A . K . , D.J. Templeton, M . Sy, and C . V . Harding. Deficiency of transporter for antigen presentation (TAP) in tumor cells allows evasion of immune surveillance and increases tumorigenesis. J Immunol, 1999. 163:4224-31.  EPIGENETIC CONTROL OF THE IMMUNE ESCAPE 8.  MECHANISMS  104  Alimonti, J., Q.J. Zhang, R. Gabathuler, G. Reid, S.S. Chen, and W.A. Jefferies. TAP expression provides a general method for improving the recognition of malignant cells in vivo. Nat Biotechnol^2000. 18:515-20.  9.  Setiadi, A.F., M . D . David, S.S. Chen, J. Hiscott, and W.A. Jefferies. Identification of mechanisms underlying transporter associated with antigen processing deficiency in metastatic murine carcinomas. Cancer Res, 2005. 65:7485-92.  10.  Klenova, E . M . , H.C. Morse, 3rd, R. Ohlsson, and V . V . Lobanenkov. The novel BORIS + CTCF gene family is uniquely involved in the epigenetics of normal biology and cancer. Semin Cancer Biol, 2002. 12:399-414.  11.  Maio, M . , S. Coral, E. Fratta, M . Altomonte, and L . Sigalotti. Epigenetic targets for immune intervention in human malignancies. Oncogene, 2003. 22:6484-8.  12.  Lund, A . H . and M . van Lohuizen. Epigenetics and cancer. Genes Dev, 2004. 18:2315-35.  13.  Lin, K . Y . , F.G. Guarnieri, K.F. Staveley-O'Carroll, H.I. Levitsky, J.T. August, D . M . Pardoll, and T.C. Wu. Treatment of established tumors with a novel vaccine that enhances major histocompatibility class II presentation of tumor antigen. Cancer Res, 1996. 56:21-6.  14.  Smahel, M . , P. Sima, V . Ludvikova, I. Marinov, D. Pokorna, and V . Vonka. Immunisation with modified HPV16 E7 genes against mouse oncogenic TC-1 cell sublines with downregulated expression of M H C class I molecules. Vaccine, 2003.21:1125-36.  EPIGENETIC CONTROL OF THE IMMUNE ESCAPE 15.  MECHANISMS  105  Lee, H . M . , T.L. Timme, and T.C. Thompson. Resistance to lysis by cytotoxic T cells: a dominant effect in metastatic mouse prostate cancer cells. Cancer Res, 2000.60:1927-33.  16.  Franks, L . M . , A.W. Carbonell, V.J. Hemmings, and P.N. Riddle. Metastasizing tumors from serum-supplemented and serum-free cell lines from a C57BL mouse lung tumor. Cancer Res, 1976. 36:1049-55.  17.  Poste, G., J. Doll, I.R. Hart, and I.J. Fidler. In vitro selection of murine B16 melanoma variants with enhanced tissue-invasive properties. Cancer Res, 1980. 40:1636-44.  18.  Giraud, S., F. Bienvenu, S. Avril, H . Gascan, D . M . Heery, and O. Coqueret. Functional interaction of STAT3 transcription factor with the coactivator N c o A / S R C l a J Biol Chem, 2002. 277:8004-11.  19.  Zhang, Q.J., R.P. Seipp, S.S. Chen, T.Z. Vitalis, X . L . L i , K . B . Choi, A . Jeffries, and W.A. Jefferies. T A P expression reduces IL-10 expressing tumor infiltrating lymphocytes and restores immunosurveillance against melanoma Int J Cancer, 2007.  20.  Canes, D., G.J. Chiang, B.R. Billmeyer, C A . Austin, M . Kosakowski, K . M . Rieger-Christ, J.A. Libertino, and I.C. Summerhayes. Histone  deacetylase  inhibitors upregulate plakoglobin expression in bladder carcinoma cells and display antineoplastic activity in vitro and in vivo. Int J Cancer, 2005. 113:841-8. 21.  Mishra, N . , C M . Reilly, D.R. Brown, P. Ruiz, and G.S. Gilkeson. Histone deacetylase inhibitors modulate renal disease in the MRL-lpr/lpr mouse. J Clin Invest, 2003. 111:539-52.  EPIGENETIC CONTROL OF THE IMMUNE ESCAPE 22.  V i g u s h i n , D . M . , S. A l i , P.E.  106  MECHANISMS  P a c e , N . M i r s a i d i , K.  Ito, I. A d c o c k , and  R.C.  C o o m b e s . T r i c h o s t a t i n A is a histone deacetylase i n h i b i t o r w i t h potent antitumor a c t i v i t y against breast cancer i n v i v o . C l i n C a n c e r R e s , 2 0 0 1 . 7:971-6. 23.  B e r g e r , S.L. H i s t o n e m o d i f i c a t i o n s i n transcriptional regulation. C u r r O p i n Genet D e v , 2 0 0 2 . 12:142-8.  24.  Eberharter, A . and P.B. B e c k e r . H i s t o n e a c e t y l a t i o n : a s w i t c h between repressive and permissive chromatin. Second in review  series o n c h r o m a t i n d y n a m i c s .  E M B O R e p , 2 0 0 2 . 3:224-9. 25.  M a h a d e v a n , L . C . , A . L . C l a y t o n , C A . H a z z a l i n , and S. T h o m s o n . P h o s p h o r y l a t i o n and a c e t y l a t i o n o f histone H 3 at i n d u c i b l e genes: t w o controversies revisited. N o v a r t i s F o u n d S y m p , 2 0 0 4 . 2 5 9 : 1 0 2 - 1 1 ; d i s c u s s i o n 111-4, 163-9.  26.  Eberharter,  A.,  R.  F e r r e i r a , and P.  Becker.  Dynamic  chromatin:  concerted  n u c l e o s o m e r e m o d e l l i n g and acetylation. B i o l C h e m , 2 0 0 5 . 3 8 6 : 7 4 5 - 5 1 . 27.  Legube,  G.  and  D.  Trouche.  Regulating  histone  acetyltransferases  and  deacetylases. E M B O R e p , 2 0 0 3 . 4:944-7. 28.  G i o r d a n o , A . and M . L . A v a n t a g g i a t i . p 3 0 0 and C B P : partners f o r l i f e and death. J C e l l P h y s i o l , 1999. 181:218-30.  29.  K a l k h o v e n , E. C B P and p 3 0 0 : H A T s f o r different occasions. B i o c h e m P h a r m a c o l , 2004.68:1145-55.  30.  D a v i e , J . R . a n d V . A . Spencer. C o n t r o l o f histone m o d i f i c a t i o n s . J C e l l B i o c h e m , 1999. S u p p l 32-33:141-8.  31.  M i k y s k o v a , R., J . B u b e n i k , V . V o n k a , M . S m a h e l , M . I n d r o v a , J . B i e b l o v a , J . Simova,  and T .  Jandlova.  I m m u n e escape  phenotype  of  HPV16-associated  EPIGENETIC CONTROL OF THE IMMUNE ESCAPE  MECHANISMS  107  tumours: M H C class I expression changes during progression and therapy. Int J Oncol, 2005.26:521-7. 32.  Matsui, M . , S. Machida, T. Itani-Yohda, and T. Akatsuka. Downregulation of the proteasome subunits, transporter, and antigen presentation in hepatocellular carcinoma, and their restoration by interferon-gamma. J Gastroenterol Hepatol, 2002. 17:897-907.  33.  Mukhopadhyay, N.K., E. Weisberg, D. Gilchrist, R. Bueno, D.J. Sugarbaker, and M.T. Jaklitsch. Effectiveness of trichostatin A as a potential candidate for anticancer therapy in non-small-cell lung cancer. Ann Thorac Surg, 2006. 81:1034-42.  34.  Zhu, W.G. and G.A. Otterson. The interaction of histone deacetylase inhibitors and D N A methyltransferase inhibitors in the treatment of human cancer cells. Curr Med Chem Anticancer Agents, 2003. 3:187-99.  35.  Marks, P.A., V . M . Richon, R. Breslow, and R.A. Rifkind. Histone deacetylase inhibitors as new cancer drugs. Curr Opin Oncol, 2001. 13:477-83.  36.  Wright, K . L . , L . C . White, A . Kelly, S. Beck, J. Trowsdale, and J.P. Ting. Coordinate regulation of the human TAP1 and LMP2 genes from a shared bidirectional promoter. J Exp Med, 1995. 181:1459-71.  37.  Gregory, P.D., K . Wagner, and W. Horz. Histone acetylation and chromatin remodeling. Exp Cell Res, 2001. 265:195-202.  38.  Struhl, K . Histone acetylation and transcriptional regulatory mechanisms. Genes Dev, 1998. 12:599-606.  EPIGENETIC CONTROL OF THE IMMUNE ESCAPE 39.  MECHANISMS  108  Keen, J.C., E. Garrett-Mayer, C. Pettit, K . M . Mack, J. Manning, J.G. Herman, and N.E. Davidson. Epigenetic regulation of protein phosphatase 2A (PP2A), lymphotactin (XCL1) and estrogen receptor alpha (ER) expression in human breast cancer cells. Cancer Biol Ther, 2004. 3:1304-12.  40.  Janeway, C , P. Travers, M . Walport, and M . Shlomchik. Immunobiology: the immune system in health and disease. 5th ed. 2001, New York, N Y Garland Publishing.  41.  Kaneko, T., H . Hosokawa, M . Yamashita, C.R. Wang, A . Hasegawa, M . Y . Kimura, M . Kitajiama, F. Kimura, M . Miyazaki, and T. Nakayama. Chromatin remodeling at the Th2 cytokine gene loci in human type 2 helper T cells. M o l Immunol, 2007. 44:2249-56.  42.  Takemoto, N . , Y . Kamogawa, H . Jun Lee, H . Kurata, K.I. Arai, A . O'Garra, N . Arai, and S. Miyatake. Cutting edge: chromatin remodeling at the IL-4/IL-13 intergenic regulatory region for Th2-specific cytokine gene cluster. J Immunol, 2000. 165:6687-91.  43. . Monneret, C. Histone deacetylase inhibitors. Eur J Med Chem, 2005. 40:1-13.  CHARACTERIZATION  OF NOVEL TAP-1 REGULATORS  109  Chapter 4 : Characterization of Novel TAP-1 Regulator Genes 4.1 Introduction Previous studies have demonstrated that one of the underlying mechanisms contributing to T A P deficiency in metastatic carcinomas is the lack of activation or expression of TAP-1 transcriptional activators [1]. Therefore, expression of the functional activator(s) in TAP-deficient carcinoma cells should lead to increased TAP-1 expression and restoration of tumor antigen presentation. Results from a parallel study provided deeper insight into the characteristics of the unknown transcriptional activators, in that they might play a role in chromatin remodeling within the Tap-1 gene locus (Chapter 3). The present chapter describes the development of a new method and preliminary results obtained in the attempt to characterize novel TAP regulator genes. In this classical complementation study, a stable clone of p T A P l - E G F P transfected CMT.64 cells [1] was transduced with high complexity, human c D N A library retroviral supernatants derived from normal human lung or spleen specimens (ViraPort; Stratagene). The cDNA-packaging virus possesses vesicular stomatitis virus G (VSV-G) envelope protein, which recognizes common membrane phospholipids, such as phosphatidylserine [2]. Therefore, the VSV-G-coated retrovirus is capable of infecting a wide variety of living cells with enhanced transduction efficiency, unlike viruses with other commonly-used envelope proteins that recognize only specific cell surface receptors [2]. cDNA libraries from human sources were used since at the time of this work, the only VSV-G-packaged mouse cDNA library available was derived from testes,  CHARACTERIZATION  OF NOVEL TAP-1 REGULATORS  110  which was certainly not a good source of TAP and M H C class I activators, since a testis was an immune privilege site that displayed downregulated expression of M H C class I [3]. Normal lung-derived cDNA library was initially chosen since the CMT.64 target cells were originated from murine lung tumor cells. Expression of TAP-1 activators from normal lungs could potentially restore TAP and M H C class I expression in the metastatic cancer cells. A similar experiment using normal spleen-derived c D N A was performed to observe any similarities in the identity of TAP-activator candidates obtained from the lung cDNA library screening.  CHARACTERIZATION  OF NOVEL TAP-1  111  REGULATORS  4.2 Materials and Methods 4.2.1  Cell lines T h e C M T . 6 4 c e l l l i n e established f r o m a spontaneous l u n g c a r c i n o m a o f a  C 5 7 B L / 6 m o u s e [4], the L t k and N I H / 3 T 3 m o u s e fibroblasts ( A T C C , M a n a s s a s , V A ) , a n d A 5 4 9 h u m a n l u n g c a r c i n o m a c e l l l i n e ( A T C C ) were g r o w n i n D M E M  media.  C M T . 6 4 c e l l s used f o r i n f e c t i o n targets i n this study w e r e d e r i v e d f r o m a c l o n e o f p T A P l - E G F P stable transfectants [1], n a m e d 1 E 1 0 . T h e L M D c e l l l i n e w a s d e r i v e d f r o m a metastatic prostate c a r c i n o m a o f a 129/Sv m o u s e (a k i n d gift o f D r . T . C . T h o m p s o n ) [5] and m a i n t a i n e d i n R P M I 1640 m e d i a . B o t h the R P M I 1640 and the D M E M  media  w e r e s u p p l e m e n t e d w i t h 1 0 % heat-inactivated F B S or c a l f serum f o r the N I H / 3 T 3 , 2 m M L - g l u t a m i n e , 100 U / m l p e n i c i l l i n , 100 ug/ml s t r e p t o m y c i n , and 10 m M H E P E S .  4.2.2  Human cDNA library V i r a P o r t c D N A l i b r a r y r e t r o v i r a l supernatants f r o m different sources, the n o r m a l  h u m a n l u n g a n d h u m a n spleen s p e c i m e n s , w e r e p u r c h a s e d f r o m Stratagene ( L a  Jolla,  C A ) . I n d i v i d u a l c D N A l i b r a r y w a s harbored i n p F B r e t r o v i r a l vector (Stratagene).  4.2.3  Cell Fusion and F A C S analysis A f u s i o n b e tw e e n h u m a n ( A 5 4 9 ) and m o u s e ( 1 E 1 0 ) cells w a s p e r f o r m e d as a  p r e l i m i n a r y e x p e r i m e n t to test w h e t h e r proteins originated f r o m h u m a n c e l l s w o u l d be able to m o d u l a t e m o u s e T A P - 1 p r o m o t e r activity. T h e t w o groups o f c e l l lines w e r e f u s e d i n a 1:1 r a t i o , f o l l o w i n g a p o l y e t h y l e n e g l y c o l c e l l f u s i o n p r o t o c o l [6]. C e l l s w e r e then i n c u b a t e d w i t h PE-conjugated  a n t i - H L A - A , B,  C  mouse monoclonal antibody  (BD  CHARACTERIZATION  OF NOVEL TAP-1 REGULATORS  112  Pharmingen, San Diego, C A ) at 4°C for 30 minutes. The fused cells, which displayed both red (PE-anti-HLA) and green (EGFP) fluorescence, were selected by F A C S (FACSVantage DiVa, Becton Dickinson, Mountain View, CA). TAP-1 promoter-driven EGFP expression in the fused cells were then analysed by FACScan (Becton Dickinson).  4.2.4 Determination of target cell transduction efficiency using the p F B - L u c control viral supernatant Prior to the actual library screenings, both the 1E10 and the NIH/3T3 cell lines were infected with the pFB-Luc control retroviral supernatant, in order to assess both the quality of the retroviral supernatants and the transduction efficiency of 1 E l 0 as compared to that of the NIH/3T3 cells. This experiment was done according to the manufacturer's protocol.  4.2.5 Transduction of 1E10 cells with ViraPort cDNA library retroviral supernatants The multiplicity of infection (MOI) was adjusted so approximately 20% of the 1E10 cells were transduced, since positive transductants obtained with low MOI screens have higher probability of containing a single c D N A of interest [7].  4.2.6 Selection of positive transductants Forty eight hours after transduction with the c D N A library retroviral supernatants, human lung cDNA-infected 1E10 cells that displayed up-regulated expression of TAP-1 promoter-driven EGFP were selected by F A C S (FACSVantage DiVa). Alternatively, human spleen cDNA-infected 1E10 cells were incubated with PE-conjugated anti-K  b  mouse monoclonal antibody (BD Pharmingen) at 4°C for 30 minutes. Then, cells that  CHARACTERIZATION  OF NOVEL TAP-I  d i s p l a y e d up-regulated e x p r e s s i o n o f b o t h the H - 2 K FACS.  113  REGULATORS  b  and the E G F P w e r e selected b y  S e l e c t i o n and e x p a n s i o n i n culture w a s repeated t w i c e before the cells w e r e  f i n a l l y sorted into single-cell clones.  4.2.7  Recovery of c D N A clones from positive transductants G e n o m i c D N A f r o m the p o s i t i v e transductants, as w e l l as f r o m the  pFB-Luc-  infected 1 E 1 0 cells (control) w a s extracted and u s e d as a template f o r P C R r e c o v e r y o f the c D N A inserts. T h e p r i m e r s u s e d are s p e c i f i c f o r regions f l a n k i n g the m u l t i p l e c l o n i n g site ( M C S ) o f the p F B vector (Stratagene): G G C T G C C G A C C C C G G G G G T G G  (forward)  a n d C G A A C C C C A G A G T C C C G C T C A (reverse). T w o m i c r o l i t e r s aliquots o f g e n o m i c D N A w e r e u s e d as a template i n a total o f 50 p i reaction m i x t u r e c o n t a i n i n g l x  PCR  buffer, 2 5 0 u M d e o x y n u c l e o t i d e triphosphate, 1.5 m M M g C b , 2 0 0 n M o f e a c h p r i m e r and 2.5 units P l a t i n u m T a q D N A P o l y m e r a s e . c D N A a m p l i f i c a t i o n s w e r e carried out i n a t h e r m o c y c l e r ( U n o II, B i o m e t r a , G o e t t i n g e n , G e r m a n y ) w i t h 35 c y c l e s o f denaturation (1 m i n , 9 5 ° C ) , a n n e a l i n g (4 m i n , 6 5 ° C ) , and e l o n g a t i o n (2 m i n , 72°C). T h e c y c l i n g w a s c o n c l u d e d w i t h a final e x t e n s i o n at 72°C f o r 10 m i n . T w e n t y m i c r o l i t e r s o f a m p l i f i e d products were analysed o n agarose gels and then p u r i f i e d . A l l P C R  reagents  were  obtained f r o m I n v i t r o g e n ( B u r l i n g t o n , O N ) and Fermentas ( B u r l i n g t o n , O N ) . The  PCR  products w e r e sequenced and i d e n t i f i e d t h r o u g h a b i o i n f o r m a t i c s  database search ( h t t p : / / w w w . n c b i . n l m . n i h . g o v / B L A S T / ) .  B L A S T n was used to c o m p a r e  n u c l e o t i d e sequences obtained f r o m the screenings w i t h k n o w n nucleotide sequences i n the database; B L A S T x was u s e d to c o m p a r e translated nucleotide sequences w i t h k n o w n a m i n o a c i d sequences i n the database.  CHARACTERIZATION  OF NOVEL TAP-1  114  REGULATORS  4.2.8 Sub-cloning of TAP-regulator gene candidates S e v e r a l gene candidates obtained f r o m the screening w e r e P C R - a m p l i f i e d f r o m either g e n o m i c D N A f r o m p o s i t i v e transductants o r c D N A f r o m w i l d type c e l l s , u s i n g gene-specific p r i m e r s ( S i g m a - G e n o s y s , O a k v i l l e , O N ) ( T a b l e 4.2.8.1). G e n e e x p r e s s i o n constructs ( p I R E S 2 - g e n e ) were created b y l i g a t i n g the P C R products into the X h o l a n d E c o R I sites o f p I R E S 2 - E G F P vector ( C l o n t e c h , P a l o A l t o , C A ) ( A p p e n d i x B ) .  Table 4.2.8.1: Primers used for PCR amplification. Oligonucleotide  Primer sequence (5'-3')  ENO-1  F: c t c g a g A G T G G C T A G A A G T T C A C C A T G T C T A  a  b  P  1337  R: g a a t t c T G C C T G C C C A C A G C T T A C T T SFTPC  F: c t c g a g T A G C A C C T G C A G C A A G A T G  F: c t c g a g A T G C G G G T C A T G G C G  null allele  R: g a a t t c T C A G A T G C C T T T G C A G A A A G  Human chr. 3 O R F F: G A c t c g a g G A A A T G G G A T T T G G C C T C C T (HC3)  R: g a a t t c A A T G G G T C A A A C A G C A G C C  Mouse P N K P  F: c t c g a g G A G G A T G T C A C A G C T T G G A T C  (MPNKP)  R: g a a t t c G C T C A G C C C T C G G A G A A C T  Human P N K P  F: c t c g a g A C A C A A G G A T G C A A A T C C T G A C  (HPNKP)  R: g a a t t c G C T C A G C C C T C G G A G A A C T  27376 (unknown  F: c t c g a g G A A C C A T G G A A A C C C C A G C  protein)  R: g a a t t c G G C A C T T C T C C C T C T A A C A C T C T  Lungs ( 2  nd  0  sort)  genomic D N A 612  Clone 2B5 genomic D N A  R: g a a t t c T C C T A G A T G T A G T A G A G C G G C A HLA-Cw*04  Template  b  1197  Lungs (2  nA  sort)  genomic D N A 723  Clone 1C6 genomic D N A  1569  Ltk c D N A  1459  Clone P4-B9 genomic D N A  726  Clone P5-E10 genomic D N A  a  F: f o r w a r d p r i m e r ; R: reverse p r i m e r . R e s t r i c t i o n e n z y m e sites are u n d e r l i n e d .  b  L e n g t h o f the P C R a m p l i f i c a t i o n product.  0  G e n o m i c D N A f r o m 1 E 1 0 p o s i t i v e transductants o r c D N A f r o m w i l d type c e l l s .  CHARACTERIZATION  115  OF NOVEL TAP-1 REGULATORS  4.2.9 Transfection and selection C M T . 6 4 a n d L M D cells w e r e transfected w i t h the p I R E S 2 - g e n e constructs o r the p I R E S 2 - E G F P vector u s i n g E x G e n Because  5 0 0 in vitro T r a n s f e c t i o n Reagent  the I R E S sequence enables E G F P  (Fermentas).  to be translated f r o m the same  mRNA  transcript as the c l o n e d gene, E G F P - p o s i t i v e cells w e r e selected b y F A C S . T h e selected cells w e r e then c u l t u r e d i n 1 m g / m l G 4 1 8 - c o n t a i n i n g m e d i a p r i o r to further analyses, i n order to obtain a r i c h p o p u l a t i o n o f c e l l s that overexpress the gene o f interest.  4.2.10 Reverse transcription-PCR analysis T o t a l c e l l u l a r R N A w a s extracted f r o m p I R E S 2 - g e n e and p I R E S 2 - E G F P (control) stable transfectants u s i n g T r i z o l Reagent (Invitrogen); c o n t a m i n a t i n g D N A w a s r e m o v e d b y treatment w i t h D N a s e 1 ( A m b i o n Inc., A u s t i n , T X ) . R e v e r s e t r a n s c r i p t i o n o f 1 p g o f total c e l l u l a r R N A w a s p e r f o r m e d u s i n g the reverse transcription k i t (SSII R T ) f r o m I n v i t r o g e n , i n a total v o l u m e o f 2 0 p i . T A P - 1 e x p r e s s i o n w a s assessed b y R T - P C R analysis (forward)  using  TAP-1-specific  primers  (Sigma):  TGGCTCGTTGGCACCCTCAAA  and T C A G T C T G C A G G A G C C G C A A G A  amplified  as  an  internal  ATGGATGACGATATCGCTGC  control  using  (forward)  (reverse).  the  and  following  Mouse  P-actin w a s  primers  (Sigma):  TTCTCCAGGGAGGAAGAGGAT  (reverse). T w o m i c r o l i t e r s aliquots o f c D N A w e r e used as a template f o r P C R i n a total o f 50 p i reaction m i x t u r e c o n t a i n i n g l x P C R buffer, 2 5 0 u M d e o x y n u c l e o t i d e triphosphate, 1.5 m M M g C L : , 2 0 0 n M o f each p r i m e r a n d 2.5 units T a q o r P l a t i n u m T a q D N A Polymerase.  cDNA  amplifications were  carried  out i n a  T-gradient t h e r m o c y c l e r  ( B i o m e t r a ) w i t h 25-35 c y c l e s o f denaturation (1 m i n , 9 5 ° C ) , a n n e a l i n g (1 m i n , 54-64°C), and e l o n g a t i o n (2 m i n , 72°C). T h e c y c l i n g w a s c o n c l u d e d w i t h a final e x t e n s i o n at 72°C  CHARACTERIZATION  OF NOVEL TAP-1 REGULATORS  116  for 10 min. Twenty microliters of amplified products were analysed on agarose gels, stained with ethidium bromide and photographed under U V light.  4.2.11 Flow cytometry Flow cytometric analysis of H-2K  b  expression was performed using PE-  conjugated anti-K mouse monoclonal antibody (BD Pharmingen) and a FACScan b  cytometer (Becton Dickinson).  CHARACTERIZATION  OF NOVEL TAP-1  REGULATORS  117  4.3 Results 4.3.1  Mouse TAP-1 promoter activity is up-regulated in the fused 1E10-A549 cells S i n c e the c D N A  libraries a v a i l a b l e were d e r i v e d f r o m h u m a n s p e c i m e n s , a  p r e l i m i n a r y e x p e r i m e n t w a s p e r f o r m e d to test whether proteins f r o m T A P - e x p r e s s i n g h u m a n cells c o u l d up-regulate m o u s e T A P - 1  p r o m o t e r a c t i v i t y i n the T A P - d e f i c i e n t  C M T . 6 4 c e l l s . F l o w c y t o m e t r i c analysis results s h o w e d that m o u s e T A P - 1  promoter-  d r i v e n E G F P e x p r e s s i o n w a s i n d e e d up-regulated i n the f u s e d 1 E 1 0 - A 5 4 9 c e l l s ( F i g u r e 4.3.1.1). T h e extent o f this up-regulation w a s s i m i l a r to that o b t a i n e d f r o m the f u s i o n between  murine  carcinomas  a n d fibroblasts ( F i g u r e  2.3.5.1).  This  indicates  that  t r a n s d u c i n g 1 E 1 0 c e l l s w i t h n o r m a l h u m a n c D N A l i b r a r y r e t r o v i r a l supernatants w o u l d be a v a l i d m e t h o d to screen f o r genes ( c D N A s ) that can enhance T A P - 1 p r o m o t e r a c t i v i t y in mouse cells.  EGFP  Figure 4.3.1.1: TAP-1  promoter-driven EGFP expression is enhanced in the fused  1E10-A549 cells. T h e l e v e l s o f E G F P e x p r e s s i o n i n untransfected C M T . 6 4 c e l l s , 1 E 1 0 ( p T A P l - E G F P - t r a n s f e c t e d C M T . 6 4 ) c e l l s and fused 1 E 1 0 - A 5 4 9 c e l l s are represented b y a shaded area, a t h i n l i n e a n d a t h i c k l i n e , respectively.  CHARACTERIZATION  OF NOVEL TAP-1 REGULATORS  118  4.3.2 The transduction efficiency of 1E10 cells is three times lower than that of the NIH/3T3 cells The luciferase activity displayed by NIH/3T3 cells, 48 hours after transduction with 10-10,000x dilutions of pFB-Luc retroviral supernatant, was on average 3.2±1.2x higher as compared to 1E10 cells. This indicates that the NIH/3T3 cells are transduced approximately three times more effectively than the 1E10 cells. Therefore, three times less 1E10 cells than NIH/3T3 cells were plated one day prior to transduction with the c D N A library retroviral supernatant.  4.3.3 Identification of gene candidates from human lung c D N A library transductants Forty eight hours after infection of the 1E10 cells with the human lung cDNA library retroviral supernatant, 0.12% of the infected cells were found to display a high expression of TAP-1 promoter-driven EGFP. These cells were selected by F A C S and expanded in culture. Two weeks later, cells that still expressed high EGFP (8.3%) were re-selected by F A C S . Six integrants were recovered from the 1E10 bulk transductants. The results obtained from B L A S T x or B L A S T n hit are summarized in Table 4.3.3.1 below. A sequence obtained from the 1.3 kb band showed a homology to a region in human chromosome 3; however, no known protein is translated from this region. Interestingly, an open reading frame (ORF) consisting of 218 amino acids was detected, opening a possibility that a novel protein may be translated from this region (Figure 4.3.3.1). B L A T analysis (UCSC Genome Browser, www.genome.ucsc.edu) indicated that this ORF is located in the p25.1 locus of human chromosome 3.  CHARACTERIZATION  OF NOVEL TAP-1  119  REGULATORS  Table 4.3.3.1: Identity of cDNAs recovered from bulk-sorted cells of human lung cDNA library transductants. B L A S T n (nucleotide sequence) or  Amino acid identity  Insert size  NCBI accession #  B L A S T x (protein sequence) hit  (human)  (kb)  Enolase-1 (ENO-1)  182/185 (98%)  2.0  NP_001419  1.7  CAC05372  1.6  CAI12758  Total protein: 434 aa HLA-Cw*04 null allele  255/291 (87%) Total protein: 367 aa  Prostaglandin-D2 synthase  189/190 (99%)  (PTGDS)  Totalprotein: 190 aa  Human chr.3 clone RP11-27016  218 aa ORF  1.3  AC090885  Pulmonary surfactant protein C  174/191 (91%)  0.9  EAW63705  isoform C R A a (SFTPC)  Total protein: 240 aa  Tropomyosin-2 beta  121/160 (75%)  0.7  AAH11776  map 3p (HC3)  Total protein: 284 aa  atgggat ttggc'ctcct. • 2 05"81.: g g g t g a c a t t c c c t c a a g c a ' c cagt.'ctctg ga'gctg'ggtc- a g a g c c a t c c t c t g g t t g g a :  :  ;  2-0 641 g t t c c t g g t t c c a g g t c a e c •acagtccccg' gggct'ccctg gcccaggcccr 'tgtccetgc'c. ..  ;"'20701 t c t c c a t g c c •tggeccctgc' a.ggcttctga g t t t g t t g t c c t c a . c t t c a a g c c t g t g g a g ' v;  20761  tg'tcacatct  gtcacct'ggg a a a t g a g g a c a c g t c a g g c t  a g c c t g c t t t ggctcccaag  20821 tggat.taaag g g g c t g a g a a tge.a'gccctg gagcaggggc t g g c g a g a c c c c c t g a a g g g . 20881 t a a c c t c t c c c g c a t c c t t t ccaggg'gagc c a a g g c t a c a gggaagggag a'ggtg'gccga: 2 0.9:41:-g g c t c g g a c e ctggc'aagag  ctg'ggaagaa  c c g c t g e t g g g'ca'gcgtcc t c t g g a a g g c a ;'  2100T g c a t c c c c t g t c a t c c t . c c a a.tgctgcccc t c a c c a c c a g c c c c t c g c c t c c c c t t c . t t g ' 21061 c t t a c t c t g t c t g g g c a g t c •  21121 actgacagct  cc'cacacccg c c a t g c t g g g g g t t g g a t t c c a g g g t t a g c  gcagcctctc. acagtgatga  g t g c a g g c c c c c c a c a t c c c aaagcacagc  '21181-' tcatcca'gca c a g c a g g g c t g t g a g g t g g c t g c t g t t t g a  Figure 4.3.3.1: The ORF found in the homologous region of human chromosome 3 clone RP11-270I6 map 3p (NCBI accession no. AC090885) and the 1.3 kb sequence obtained from human lung cDNA library screening.  CHARACTERIZATION  120  OF NOVEL TAP-1 REGULATORS  Furthermore, the 1E10 bulk transductants were sorted into single-cell clones and expanded in culture. From the 20 clones that were analysed, 10 clones contained single integrants (Table 4.3.3.2). No integrants were detected in the remaining 10 clones. cDNAs that correspond to the SFTPC and the HC3 that were detected in previous screening of bulk transductants were recovered individually from the single-cell clones. A new sequence corresponding to the 3'-untranslated region of the N-deacetylase/Nsulfotransferase (NDST-1) gene, was obtained from two of the clones. No cDNAs that encode for human ENO-1, HLA-Cw*04 null allele, PTGDS and Tropomyosin 2 were recovered from the single-cell clones. Table 4.3.3.2: Identity of cDNAs recovered from single-cell clones of human lung cDNA library transductants. Clone  2B5  B L A S T n (nucleotide sequence) or  Base pairs or amino  Insert size  NCBI  B L A S T x (protein sequence) hit  acid identity (human)  (kb)  accession #  188/194 (96%)  0.9  EAW63705  0.9  EAW63705  0.9  EAW63705  Pulmonary surfactant protein C isoform C R A a (SFTPC)  Total protein: 240 aa 1A2  Pulmonary surfactant protein C isoform C R A a (SFTPC)  194/194(100%) Total protein: 240 aa  1F3  Pulmonary surfactant protein C isoform C R A a (SFTPC)  193/194 (99%) Total protein: 240 aa  1E3  Pulmonary surfactant protein C ?  n/a (bad sequence)  0.9  1C6  Human chr.3 clone RP11-27016 map 3p (HC3)  218 aa O R F  1.3  2H1  Human chr.3 clone RP11-27016 map 3p ?  n/a (bad sequence)  1.3  2A10  Human chr.3 clone RP11-27016 map 3p ?  n/a (bad sequence)  1.3  1H7  ?  n/a (bad sequence)  1.6  1C9  N-deacetylase/N-sulfotransferase (heparan glucosaminyl)  583/585 (99%)  2.0  NM_001543  1 (NDST1)  (outside of CDS)  2.0  NM_001543  AC090885  Total gene: 7913 bp 1E11  N-deacetylase/N-sulfotransferase (heparan glucosaminyl)  534/535 (99%)  1 (NDST1)  (outside of CDS) Total gene: 7913 bp  CHARACTERIZATION  121  OF NOVEL TAP-1 REGULATORS  Levels of surface K expression in the single-cell clones were then analysed by b  flow cytometry, since the upregulation of TAP-1 promoter activity may lead to enhanced transcription of the gene and reconstitution of M H C class I expression on the surface of 1E10 cells. However, no increase in the surface K expression on any of the clones was b  detected. This may be caused by low levels or total loss of protein expression encoded by the c D N A inserts, inability of the foreign proteins to induce M H C class I expression in CMT.64 cells, or false positive signals during the selection process. Indeed, loss of induction of TAP-1 promoter-driven EGFP expression was observed in most cells over the period in culture, indicating the instability of its enhanced state.  4.3.4  Identification of gene candidates from human spleen cDNA library transductants After several TAP-1-activator gene candidates were obtained from the screening  of human lung cDNA library, a similar experiment using human cDNA library derived from human spleen specimens was performed. However, in this experiment, the positive transductants were selected based on up-regulated expression of both the TAP-1 promoter-driven EGFP and the H-2K molecule. b  Forty eight hours after the infection with human spleen cDNA library retroviral supernatant, 0.1% of the infected 1E10 cells were found to display an up-regulated expression of both the EGFP and H-2K . After a month of expansion in culture, a b  population of cells that remained double-positive (0.5%) was re-selected by FACS and sorted into single-cell clones. Unfortunately, similar to the problem encountered during the lung c D N A library screening, most cells were no longer EGFP- and K -positive after b  being expanded in culture. From the 20 clones that were analysed, 5 clones contained  CHARACTERIZATION  OF NOVEL TAP-I REGULATORS  122  single integrants, 5 clones contained two integrants, and 10 clones contained no integrants (Table 4.3.4.1). No identical hits to those obtained from the lung c D N A library screening were discovered in this screening.  CHARACTERIZATION  OF NOVEL  TAP-1  123  REGULATORS  Table 4.3.4.1: Identity of cDNAs recovered from single-cell clones of human spleen cDNA library transductants. Clone  P4-A3  B L A S T n (nucleotide sequence) or  Base pairs or amino  Insert  NCBI  B L A S T x (protein sequence) hit  acid identity (human)  size (kb)  accession #  1.3  AAH02519.2  .6  NM_007367  1.3  AAH02519.2  Polynucleotide kinase 3'-phosphatase (PNKP)  81/95 (85%)  and  Total protein: 482 aa (bad sequence)  P4-B9  R N A binding protein, autoantigenic (hnRNP-  87/98 (88%)  associated with lethal yellow homolog (mouse))  Total CDS: 1541 bp  ( R A L Y ) , transcript variant 2, m R N A  (bad sequence)  Polynucleotide kinase 3'-phosphatase (PNKP)  469/482 (97%) Total protein: 482 aa  P5-A6  Polynucleotide kinase 3'-phosphatase (PNKP) ?  n/a (bad sequence)  1.3  Prosaposin (variant Gaucher disease and variant  38/38 (100%)  .75  CAI40836  metachromatic leukodystrophy) or sphingolipid  Total protein: 559 aa  .8  NW_922784  .4  NM_020137  .75  N W 922784  .4  NM_020137  1.2  NM_001614  1.1  CAA24917  and  activator proteins 1 and 2 processed mutant P4-E3  P5-F9  P4-F1  Human chromosome 5 genomic contig  92/100 (92%)  and  Total: 48999907 bp  Glucocorticoid receptor-interacting protein  115/120 (95%)  GRIP1 associated protein 1 (GRIPAP1)  Total CDS: 3032 bp  Human chromosome 5 genomic contig  91/100 (91%)  and  Total: 48999907 bp  Glucocorticoid receptor-interacting protein  106/111(95%)  (GR1P)1 associated protein 1 (GRIPAP1)  Total CDS: 3032 bp  Actin, gamma 1 (ACTG1)  812/931 (87%) Total CDS: 1919 bp  P5-B3  P5-E4 P5-E10  Unnamed protein product  253/254 (99%)  (from M H C 11 alpha domain)  Total protein: 254 aa  Unknown (protein for MGC:27376) ?  n/a (bad sequence)  1.2  Unknown (protein for MGC:27376)  210/235 (89%)  1.2  AAH16380  1.5  AAF86917  1.4  AAH16380  Total protein: 235 aa P5-F10  Immunoglobulin light chain variable region  112/179 (62%)  and  Total protein: 209 aa  Unknown (protein for MGC:27376)  104/165 (63%) Total protein: 235 aa .  CHARACTERIZATION  OF NOVEL TAP-1 REGULATORS  124  4.3.5 Cancer-related information about the screened genes A b e r r a n t e x p r e s s i o n o f m a n y o f the genes o b t a i n e d f r o m b o t h screenings has b e e n reported to contribute to d e v e l o p m e n t o f v a r i o u s cancers (Table 4.3.5.1). Interestingly, some o f these gene p r o d u c t s , s u c h as the E N O - 1 h o m o l o g , P T G D S , P N K P a n d R A L Y , have been reported to confer tumor-suppressing f u n c t i o n s [8-12]. H o w e v e r , n o cancerrelated i n f o r m a t i o n related to S F T P C , N D S T 1 , G R I P A P I a n d A C T G 1 has been reported to date.  CHARACTERIZATION  OF NOVEL TAP-I  REGULATORS  125  Table 4.3.5.1: Cancer-related information about the proteins that match the hits obtained from the screenings of human lung and spleen cDNA libraries. Isolated f r o m  P r o t e i n name  Cancer-related i n f o r m a t i o n  Lung cDNA library G l y c o l y t i c e n z y m e , of ten o v e r e x p r e s s e d i n  Enolase-1  metastatic cancers [13-15]  Shares a great structural s i m i l a r i t y w i t h c-myc  promoter binding protein ( M B P ) - l , a transcriptional  repressor o f c-myc oncogene [12] HLA-Cw  .  A l i g a n d f o r a n i n h i b i t o r y N K c e l l receptor [16] A l l o t y p e s are u s e d as p r o g n o s t i c markers f o r  autologous transplantation i n l y m p h o m a patients [16]  • PTGDS •  N u l l alleles are n o t expressed o n c e l l surface [17, 18] D o w n - r e g u l a t e d i n b r a i n t u m o r s and pre-malignant oral l e s i o n s [8, 19] Inhibit o r a l cancer c e l l p r o l i f e r a t i o n in vitro [8] P T G D S metabolites i n h i b i t prostate cancer c e l l g r o w t h v i a a p e r o x i s o m e proliferator-activated receptor g a m m a ( P P A R g a m m a ) - d e p e n d e n t m e c h a n i s m [10] L o s s o f e x p r e s s i o n w a s reported i n esophageal a n d  Tropomyosin 2  l u n g cancer tissues [20, 21]  SFTPC  N o record  NDST1  N o record  PNKP  •  Spleen cDNA library I n v o l v e d i n base e x c i s i o n repair as a m e c h a n i s m to prevent cancer d e v e l o p m e n t due to o x i d a t i v e damage o f D N A [9] RALY  R N A b i n d i n g p r o t e i n ; m u t a t i o n i s associated w i t h  GRIP API  p i 6 0 nuclear receptor co-activator  lethal y e l l o w h o m o l o g i n m i c e that phenotypes i n c l u d e a p r e d i s p o s i t i o n to t u m o r g r o w t h [11] •  O n e o f the t w o a u t o n o m o u s a c t i v a t i o n d o m a i n s o f G R I P 1 is m e d i a t e d b y C B P / p 3 0 0 [22, 2 3 ] Increased b i n d i n g o f G R I P 1 to E R a l p h a p r o m o t e r mediated g r o w t h and s u r v i v a l o f breast cancer c e l l s [24] no r e c o r d about G R I P A P I deregulation a n d d e v e l o p m e n t o f cancers  ACTG1  N o record  CHARACTERIZATION  OF NOVEL TAP-1 REGULATORS  126  4.3.6 Overexpression of several TAP-regulator gene candidates in CMT.64 and LMD cells up-regulates TAP-1 expression, but not H-2K expression b  To overexpress the TAP-regulator gene candidates, individual cDNA was subcloned into pIR£S2-EGFP vector. This vector contains a neomycin gene for selection of positive transfectants in G418-containing media. Seven pIRES2-gene constructs: the ENO-1, SFTPC, HLA-Cw*04 null allele, unknown protein (27376), mouse PNKP (MPNKP), human P N K P (HPNKP) and human chromosome 3 ORF (HC3) were completed. CMT.64 and L M D cells were independently transfected with pIRES2-gene constructs or pIRES2-EGFP vector. Overexpression of the transfected genes was confirmed by RT-PCR analysis using gene-specific primers (Figure 4.3.6.1).  o  LA-  LU  G  s  co CM  X  V  G  V  G  V  Q.  CD I-  G  V  G  Nd  O 0-  o c  Z  2  X  V  G  V  O  X  G  V  CMT.64 Genes p-actin 2.0 fcb1.0 kb0.5 kb-  LMD Genes p-actin  Figure 4.3.6.1: RT-PCR analysis of the overexpression of the TAP-1 activator candidate genes in CMT.64 and L M D cells. G: c D N A template was derived from pIRES2-gene transfectants; V : cDNA template was derived from pIRES2-EGFP transfectants. Amplification of p-actin cDNA served as a loading control.  CHARACTERIZATION  OF NOVEL  TAP-1  REGULATORS  127  Overexpression of the TAP-regulator gene candidates appeared to induce TAP-1 expression in TAP-deficient CMT.64 and L M D cells, although the levels of induction were very low compared to those from IFN-y treatment (Figure 4.3.6.2). Most inductions observed in three independent transfection experiments (two groups of CMT.64 cells and one group of L M D cells) were inconsistent, with the exception of HLA-Cw*04 null allele and the unknown protein from human chromosome 3 (HC3). In all the three experiments done, TAP-1 expression was consistently up-regulated in both the CMT.64 and L M D cells that overexpressed the HLA-Cw*04 null allele and the HC3 (Figure 4.3.6.2).  TAP-1  CMT.64 # 1  p-actin TAP-1 P-actin  MNHf  «MM»  mmm  TAP-1 p-actin  n—r WMf M M *  CMT.64 #2  mmm mmm >mmnt  LMD  Figure 4.3.6.2: TAP-1 expression was up-regulated in some of the CMT.64 and LMD cells transfected with individual pIRES2-gene constructs. Amplification of cDNA from IFN-y-treated cells was used as a positive control, p-actin expression served as a loading control. Data are representatives of one set of RT-PCR analysis per group of CMT.64 and L M D transfectants.  CHARACTERIZATION  OF NOVEL  TAP-1  REGULATORS  128  Finally, flow cytometric analyses were performed in order to assess induction of surface H-2K expression in the positive transfectants of CMT.64 and L M D cells. b  Unfortunately, no improvement in surface H-2K expression could be detected in any of b  the cell lines tested. This may due to fairly low levels of induction of TAP-1 expression in the transfectants.  Representative data from HLA-Cw*04 null allele- and HC3-  overexperessing L M D cells are shown in Figure 4.3.6.3.  HLA-Cw  HC3  Figure 4.3.6.3: No upregulation of H-2K expression was detected on the surface of b  LMD cells overexpressing HLA-Cw*04 null allele and HC3 (thick lines). H-2K  b  expression in pIRES-2-EGFP-transfected L M D cells (shaded areas) was similar to the negative control, the unstained pIRES-2-gene-transfected cells (thin lines). As a positive control, H-2K expression was assessed in IFN-y-treated L M D cells (broken lines). b  Further research is needed to confirm the ability of the TAP-1 regulator gene candidates, particularly the HLA-Cw*04 null allele and HC3, to up-regulate TAP-1 at the protein level, and possibly surface M H C class I expression in other TAP-deficient cell lines. In addition, ten further candidates obtained from the screenings remain to be subcloned and analysed.  CHARACTERIZATION  OF NOVEL TAP-1 REGULATORS  129  4.4 Discussion In order to identify novel TAP-1 activators, c D N A libraries from human lung and spleen specimens were screened for gene products that could up-regulate either TAP-1 promoter activity, or both the promoter's activity and surface M H C class I expression in p T A P l - E G F P stable transfectants of CMT.64 cells. A total of seven and nine candidates were obtained from the lung and the spleen c D N A library screening, respectively. Interestingly, deregulation of many of the genes identified, such as ENO-1, PTGDS, Tropomyosin-2, PNKP, and RALY, had been shown to associate with the development of various types of cancers (Table 4.3.5.1). To-date, only PTGDS and H L A - C have been shown to be involved in antigen processing. PTGDS, an enzyme responsible for the bio-synthesis of prostaglandin D2, is produced by resident macrophages and dendritic cells in spleen, thymus, and Peyer's patch of intestine [25]. Prostaglandin D2 was shown to affect the differentiation and functions of human dendritic cells [26]. In the presence of prostaglandin D2, dendritic cells demonstrated upregulated endocytic and antigen processing activities; however, their ability to stimulate naive T cells was impaired [26]. It has been reported that a variety of alleles in H L A - C locus increases the risk of bone marrow graft rejection in transplantations [27]. This might be caused by presentation of allogeneic, possibly nullderived peptides, by H L A class I molecules on cell surface, thus triggering allospecific T cell responses [18]. The precise role of H L A class I molecules with no cell surface expression, such as the HLA-Cw*04 null allele, in antigen presentation remains to be elucidated [18]. Interestingly, several candidates showed significant similarities to regions of human chromosomes with no known genes or to unnamed protein products. One  CHARACTERIZATION  OF NOVEL TAP-I  130  REGULATORS  sequence, with a similarity to an open reading frame encoding 218 amino acids in human chromosome 3, named HC3, was particularly intriguing. Overexpression of HC3 in three independent  groups of transfectants of TAP-deficient  CMT.64 and L M D cells  consistently showed up-regulated expression of TAP-1, as assessed by RT-PCR using c D N A templates from the transfectants (Figure 4.3.6.2). This result indicates that a novel protein with the ability to modulate TAP-1 expression could be translated from the newly-found ORF (Figure 4.3.3.1). However, TAP-1 upregulation was not consistently observed in CMT.64 and L M D cells that overexpressed most of the other gene candidates. More independent transfections of CMT.64, L M D and possibly other TAPdeficient cells,- RT-PCR and Western Blot analyses are required to confirm the consistency of TAP-1 induction in cells that overexpressed a specific gene of interest. Several problems encountered  during the  screening process  include the  acquisition of EGFP and K -positive clones with no integrants ("empty clones"), the loss b  of EGFP and K expression as the cells were expanded in culture, and the difficulty in b  obtaining sequencing results from P C R products. The first problem may result from the loss of c D N A inserts from the infected cells during the period in culture, prior to genomic D N A extraction, although this is unlikely as plasmids introduced by retroviral infection generally integrate into the genome of the infected cells. Also, false positive signals during FACS selection could result in unwanted selection of non-infected cells. Nevertheless, one or two inserts were successfully detected in many of the single-cell clones analysed, indicating that the multiplicity of infection (MOI) was correctly adjusted [7]. If the M O I used was too low, very few cells would be transduced. In contrast, transduction at high MOI would yield a higher number of cells transduced; however, the majority of the cells would bear multiple integrants, making it difficult to determine  CHARACTERIZATION  OF NOVEL TAP-1 REGULATORS  131  which of those was actually responsible for the phenotype. A similar problem was encountered during P C R recovery of cDNA inserts from selected bulk transfectants. Therefore, in future experiments, it is best to first sort positive transductants into singlecell clones. A n independent transduction of CMT.64 cells by human cDNA library retroviral supernatant from the same source is necessary to test the reproducibility of the primary screen hits. The absence of EGFP and K expression in selected cells after a period in culture b  may result from either false positive signal during the selection or diminishing expression of the inserted gene products. A n independent method, such as sub-cloning the c D N A into a different vector and over-expressing the gene product in TAP-deficient cancer cells (Figure 4.3.6.1), must be performed to confirm the validity of the acquired phenotypes. Difficulty in obtaining good quality results from the sequencing of PCR products accounts for errors in the percentage of sequence identity recorded in the data tables (Table 4.3.3.1, Table 4.3.3.2 and Table 4.3.4.1). It may also be one of the reasons many of the recovered cDNAs showed sequence similarities only to a part of specific genes, instead of to full-length cDNAs or protein products. However, some sequences were recovered from bands that were clearly smaller than the known, full-length sequences, for example the R A L Y , prosaposin and GRIP API (Table 4.3.4.1), indicating that sequencing errors were not the only reason for the finding of several incomplete sequences. The sequencing results could generally be improved by sub-cloning all P C R products individually into a TOPO vector (Invitrogen); however, this method is ineffective for screening large numbers of clones due to cost and time demands. Future research should include refinement  of the screening method and  verification of the results, followed by application of independent methods to confirm the  CHARACTERIZATION  OF NOVEL TAP-1 REGULATORS  132  validity of the primary screen hits, as discussed in the previous paragraph. Furthermore, a TAP-expressing, human primary cell line and its TAP-deficient, metastatic derivative may be used to assess differential endogenous expression levels and functionality of several strong candidates obtained from the initial screenings. Finally, it is intriguing to investigate whether disruption of a specific gene in TAP-expressing cells would cause detrimental effects on M H C class I antigen presentation. For example, it would be interesting to observe whether deletion of a region within the newly identified " H C 3 " ORF would transform human cells that displayed a functional antigen presentation pathway into antigen presentation-defective, metastatic cells. This would confirm whether the particular gene product has fundamental roles in tumor antigen processing and human malignancies.  CHARACTERIZATION  OF NOVEL TAP-1 REGULATORS  133  4.5 References 1.  S e t i a d i , A . F . , M . D . D a v i d , S.S. C h e n , J . H i s c o t t , and W . A . Jefferies. I d e n t i f i c a t i o n o f m e c h a n i s m s u n d e r l y i n g transporter associated w i t h antigen p r o c e s s i n g d e f i c i e n c y i n metastatic m u r i n e carcinomas. C a n c e r R e s , 2 0 0 5 . 6 5 : 7 4 8 5 - 9 2 .  2.  L e e , H . , J.J. S o n g , E. K i m , C O . Y u n , J . C h o i , B. L e e , J . K i m , J . W . C h a n g , a n d J . H . K i m . E f f i c i e n t gene transfer o f V S V - G p s e u d o t y p e d r e t r o v i r a l vector t o h u m a n b r a i n tumor. G e n e T h e r , 2 0 0 1 . 8:268-73.  3.  Ito, T . , N . Ito, A . B e t t e r m a n n , Y . T o k u r a , M . T a k i g a w a , and R. Paus. C o l l a p s e and restoration o f M H C class-I-dependent i m m u n e p r i v i l e g e : e x p l o i t i n g the h u m a n hair f o l l i c l e as a m o d e l . A m J P a t h o l , 2 0 0 4 . 164:623-34.  4.  F r a n k s , L . M . , A . W . C a r b o n e l l , V . J . H e m m i n g s , and P . N . R i d d l e . M e t a s t a s i z i n g t u m o r s f r o m serum-supplemented and serum-free c e l l lines f r o m a C 5 7 B L m o u s e l u n g tumor. C a n c e r R e s , 1976. 3 6 : 1 0 4 9 - 5 5 .  5.  L e e , H . M . , T . L . T i m m e , and T . C T h o m p s o n . Resistance to l y s i s b y c y t o t o x i c T c e l l s : a d o m i n a n t effect i n metastatic m o u s e prostate cancer cells. C a n c e r R e s , 2000.60:1927-33.  6.  F u l l e r , S.A., M . T a k a h a s h i , and J . G . R . H u r r e l l ,  Production of antibodies, i n  Current protocols in molecular biology, F . M . A u s u b e l , et a l . , E d i t o r s . 2 0 0 1 , J o h n W i l e y & Sons. p. 11.7.1-11.7.4. 7.  O n i s h i , M . , S. K i n o s h i t a , Y . M o r i k a w a , A . S h i b u y a , J . P h i l l i p s , L . L . L a n i e r , D . M . G o r m a n , G . P . N o l a n , A . M i y a j i m a , and T . K i t a m u r a . A p p l i c a t i o n s o f retrovirusm e d i a t e d e x p r e s s i o n c l o n i n g . E x p H e m a t o l , 1996. 24:324-9.  CHARACTERIZATION 8.  OF NOVEL TAP-1  REGULATORS  134  Banerjee, A . G . , I. B h a t t a c h a r y y a , a n d J . K . V i s h w a n a t h a . I d e n t i f i c a t i o n o f genes and m o l e c u l a r pathways i n v o l v e d i n the p r o g r e s s i o n o f p r e m a l i g n a n t o r a l e p i t h e l i a M o l C a n c e r T h e r , 2 0 0 5 . 4:865-75.  9.  H a z r a , T . K . , A . D a s , S. D a s , S. C h o u d h u r y , Y . W . K o w , a n d R. R o y . O x i d a t i v e D N A damage repair i n m a m m a l i a n c e l l s : A n e w perspective. D N A R e p a i r (Amst), 2006.  10.  K i m , J . , P. Y a n g , M . Suraokar, A . L . S a b i c h i , N . D . L l a n s a , G . M e n d o z a , V . Subbarayan, C.J. Logothetis, R . A . N e w m a n , S . M . L i p p m a n , and D . G . Menter. S u p p r e s s i o n o f prostate t u m o r c e l l g r o w t h b y s t r o m a l c e l l p r o s t a g l a n d i n D synthase-derived products. C a n c e r R e s , 2 0 0 5 . 6 5 : 6 1 8 9 - 9 8 .  11.  M i c h a u d , E.J., S.J. B u l t m a n , M . L . K l e b i g , M . J . v a n V u g t , L.J. Stubbs, L . B . R u s s e l l , a n d R.P. W o y c h i k . A m o l e c u l a r m o d e l f o r the genetic a n d p h e n o t y p i c characteristics o f the m o u s e lethal y e l l o w ( A y ) mutation. P r o c N a t l A c a d S c i U S A , 1994. 91:2562-6.  12.  O n y a n g o , P., B. L u b y o v a , P. G a r d e l l i n , R. K u r z b a u e r , a n d A . W e i t h . M o l e c u l a r c l o n i n g a n d e x p r e s s i o n analysis o f f i v e n o v e l genes i n c h r o m o s o m e l p 3 6 . G e n o m i c s , 1998. 50:187-98.  13.  D o w l i n g , P., P. M e l e a d y , A . D o w d , M . H e n r y , S. G l y n n , a n d M . C l y n e s . P r o t e o m i c analysis o f isolated m e m b r a n e fractions f r o m s u p e r i n v a s i v e cancer cells. B i o c h i m B i o p h y s A c t a , 2 0 0 7 . 1774:93-101.  14.  Z h a n g , D., L . K . T a i , L . L . W o n g , L . L . C h i u , S . K . Sethi, and E.S. K o a y . P r o t e o m i c study reveals that proteins i n v o l v e d i n m e t a b o l i c a n d d e t o x i f i c a t i o n p a t h w a y s are h i g h l y expressed i n HER-2/neu-positive breast cancer. M o l C e l l P r o t e o m i c s , 2005.4:1686-96.  CHARACTERIZATION 15.  OF NOVEL TAP-1  135  REGULATORS  A l t e n b e r g , B. and K . O . G r e u l i c h . G e n e s o f g l y c o l y s i s are u b i q u i t o u s l y overexpressed i n 24 cancer classes. G e n o m i c s , 2 0 0 4 . 84:1014-20.  16.  Skerrett, D., O . R o s i n a , C . B o d i a n , L. Isqla, O . G u d z o w a t y , E. S c i g l i a n o , a n d S. F r u c h t m a n . H u m a n l e u k o c y t e antigens ( H L A ) - C w as prognostic indicators i n autologous transplantation f o r l y m p h o m a . C a n c e r Invest, 2 0 0 1 . 19:487-94.  17.  W a n g , Z . C . , A . G . S m i t h , E.J. Y u n i s , A . S e l v a k u m a r , S. Ferrone, S. M c K i n n e y , J . H . L e e , M . F e r n a n d e z - V i n a , and J . A . H a n s e n . M o l e c u l a r characterization o f the H L A - C w * 0 4 0 9 N allele. H u m I m m u n o l , 2 0 0 2 . 6 3 : 2 9 5 - 3 0 0 .  18.  B a l a s , A . , S. Santos, M . J . A v i l e s , F. G a r c i a - S a n c h e z , R. L i l l o , A . A l v a r e z , L . M . V i l l a r - G u i m e r a n s , and J . L . V i c a r i o . E l o n g a t i o n o f the c y t o p l a s m i c d o m a i n , due to a p o i n t d e l e t i o n at e x o n 7, results i n an H L A - C n u l l allele, C w * 0 4 0 9 N . T i s s u e A n t i g e n s , 2 0 0 2 . 59:95-100.  19.  Saso, L., M . G . L e o n e , C . Sorrentino, S. G i a c o m e l l i , B. S i l v e s t r i n i , J . G r i m a , J . C . L i , E. S a m y , D . M r u k , a n d C . Y . C h e n g . Q u a n t i f i c a t i o n o f p r o s t a g l a n d i n D synthetase i n c e r e b r o s p i n a l f l u i d : a potential m a r k e r for b r a i n tumor. B i o c h e m M o l B i o l Int, 1 9 9 8 . 4 6 : 6 4 3 - 5 6 .  20.  J a z i i , F.R., Z . N a j a f i , R. M a l e k z a d e h , T . P . C o n r a d s , A . A . Z i a e e , C . A b n e t , M . Y a z d z n b o d , A . A . K a r k h a n e , and G . H . S a l e k d e h . I d e n t i f i c a t i o n o f squamous c e l l c a r c i n o m a associated proteins b y p r o t e o m i c s and loss o f beta t r o p o m y o s i n e x p r e s s i o n i n esophageal cancer. W o r l d J Gastroenterol, 2 0 0 6 . 12:7104-12.  21.  Pitterle, D . M . , E . M . J o l i c o e u r , and G . B e p l e r . H o t spots for m o l e c u l a r genetic alterations i n l u n g cancer. In V i v o , 1998. 12:643-58.  22.  H u a n g , S . M . and Y . S . C h e n g . A n a l y s i s o f t w o C B P  (cAMP-response-element-  b i n d i n g p r o t e i n - b i n d i n g protein) interacting sites i n G R I P 1 ( g l u c o c o r t i c o i d -  CHARACTERIZATION  OF NOVEL TAP-1  136  REGULATORS  receptor-interacting protein), and their i m p o r t a n c e f o r the f u n c t i o n o f G R I P 1 . B i o c h e m J , 2 0 0 4 . 382:111-9. 23.  L i u , P.Y., T . Y . H s i e h , W . Y . C h o u , and S . M . H u a n g . M o d u l a t i o n o f g l u c o c o r t i c o i d receptor-interacting p r o t e i n 1 ( G R I P 1 ) transactivation and co-activation activities t h r o u g h its C-terminal repression and self-association domains. F e b s J , 2 0 0 6 . 273:2172-83.  24.  W e i , X . , H . X u , and D. K u f e . M U C 1 o n c o p r o t e i n stabilizes and activates estrogen receptor a l p h a M o l C e l l , 2 0 0 6 . 2 1 : 2 9 5 - 3 0 5 .  25.  U r a d e , Y . , M . U j i h a r a , Y . H o r i g u c h i , K. I k a i , and O . H a y a i s h i . T h e m a j o r source o f endogenous p r o s t a g l a n d i n D 2 p r o d u c t i o n is l i k e l y antigen-presenting c e l l s . L o c a l i z a t i o n o f glutathione-requiring p r o s t a g l a n d i n D synthetase i n h i s t i o c y t e s , dendritic, and K u p f f e r cells i n v a r i o u s rat tissues. J I m m u n o l , 1989. 143:2982-9.  26.  Gosset, P., M . P i c h a v a n t , C . F a v e e u w , F. B u r e a u , A . B . T o n n e l , and F. T r o t t e i n . P r o s t a g l a n d i n D 2 affects the d i f f e r e n t i a t i o n and f u n c t i o n s o f h u m a n d e n d r i t i c c e l l s : i m p a c t o n the T c e l l response. E u r J I m m u n o l , 2 0 0 5 . 3 5 : 1 4 9 1 - 5 0 0 .  27.  Petersdorf, E.W.,  G . M . L o n g t o n , C. Anasetti, E . M . M i c k e l s o n , S.K.  McKinney,  A . G . S m i t h , P.J. M a r t i n , and J . A . H a n s e n . A s s o c i a t i o n o f H L A - C d i s p a r i t y w i t h graft failure after m a r r o w transplantation f r o m unrelated donors. B l o o d , 1997. 89:1818-23.  GENERAL  137  DISCUSSION  Chapter 5 : General Discussion 5.1 Summary and Conclusions To-date, l o w i m m u n o g e n i c response to t u m o r i m m u n o t h e r a p y due to escape m e c h a n i s m s u t i l i z e d b y t u m o r c e l l s remains the m a i n challenge i n c l i n i c a l trials [1-4]. T h i s is at least p a r t i a l l y caused b y the h i g h i n c i d e n c e o f M H C class I d o w n r e g u l a t i o n i n cancer c e l l s [1-3], w h i c h has been attributed to the decreased e x p r e s s i o n o f several A P M components,  i n c l u d i n g the heterodimer  o f TAP-1  and T A P - 2  molecules  [5-10].  Interestingly, restoration o f the T A P - 1 alone i n c e l l s w i t h m u l t i p l e d e f i c i e n c i e s o f other A P M c o m p o n e n t s has been s h o w n to reconstitute M H C class I antigen presentation a n d k i l l i n g o f the t u m o r cells b y s p e c i f i c C T L s [5, 11-13]. These effects c a n also be attained b y treatment o f T A P - d e f i c i e n t cancer c e l l s w i t h IFN-y in vitro [5, 6, 1 1 , 14]. H o w e v e r , the m e c h a n i s m t h r o u g h w h i c h this occurs is u n k n o w n . In order to d e v e l o p effective i m m u n o t h e r a p y approaches that a i m to restore T A P - 1 e x p r e s s i o n i n cancer c e l l s , a better understanding o f the m e c h a n i s m s b y w h i c h cancer c e l l s down-regulate T A P - 1 e x p r e s s i o n is essential. T h i s thesis contributes to the e l u c i d a t i o n o f m o l e c u l a r m e c h a n i s m s b y w h i c h metastatic c a r c i n o m a s down-regulate T A P - 1 e x p r e s s i o n and escape i m m u n e s u r v e i l l a n c e . It appears that T A P - 1 d e f i c i e n c y i n c a r c i n o m a s is caused b y t w o m a i n m e c h a n i s m s : l a c k o f transcriptional activators a n d r a p i d T A P - 1 m R N A degradation [14]. Studies a i m e d at i d e n t i f y i n g the t r a n s c r i p t i o n a l activator(s) i n d i c a t e d that these factors p l a y important roles i n c h r o m a t i n r e m o d e l i n g w i t h i n the T A P - 1 l o c u s .  By  p e r f o r m i n g a c h r o m a t i n i m m u n o p r e c i p i t a t i o n assay, it w a s f o u n d that histone H 3 acetylation w a s d e f i c i e n t i n T A P - 1 p r o m o t e r o f T A P - d e f i c i e n t c e l l s . T h i s l a c k o f histone  GENERAL  138  DISCUSSION  H 3 a c e t y l a t i o n l i k e l y leads to a c o n d e n s e d n u c l e o s o m a l structure a r o u n d the p r o m o t e r , w h i c h prevents the b i n d i n g o f R N A  TAP-1  p o l II c o m p l e x a n d o f other general  t r a n s c r i p t i o n factors to the p r o m o t e r r e g i o n . A s a result, further t r a n s c r i p t i o n a l a c t i v i t y is halted. C o m p a r i s o n o f f u l l T A P - 1 p r o m o t e r a c t i v i t y and that o f its truncations r e v e a l e d a r e g i o n that is responsible f o r differential a c t i v i t y o f the p r o m o t e r i n T A P - e x p r e s s i n g and T A P - d e f i c i e n t cells. I n t r i g u i n g l y , this r e g i o n was f o u n d to c o n t a i n a C R E B b i n d i n g site, p r o m p t i n g the s p e c u l a t i o n that C R E B - b i n d i n g p r o t e i n ( C B P ) , a w e l l - k n o w n histone acetyltransferase ( H A T )  [15-18], was one o f the p o s s i b l e factors r e s p o n s i b l e f o r the  d i f f e r e n t i a l a c t i v i t y o f the p r o m o t e r . It was f o u n d that i n d e e d , C B P b i n d i n g to p r o m o t e r was  i m p a i r e d i n T A P - d e f i c i e n t , metastatic  TAP-1  c a r c i n o m a s , strengthening the  h y p o t h e s i s that the l a c k o f histone acetyltransferase activities a r o u n d the T A P - 1 p r o m o t e r leads to a repressive structure o f the c h r o m a t i n that is i n a c c e s s i b l e b y t r a n s c r i p t i o n a l machinery complexes. Furthermore,  an interesting l i n k was  found between TAP-1  induction  and  i m p r o v e m e n t o f C B P b i n d i n g to T A P - 1 p r o m o t e r u p o n treatment o f T A P - d e f i c i e n t c e l l s w i t h IFN-y. T h i s effect m a y result f r o m IFN-y-induced a s s o c i a t i o n o f S T A T - l a a n d C B P [19]. T h i s i n turn modulates the T A P - 1 p r o m o t e r a c t i v i t y u p o n a s s o c i a t i o n o f the factors w i t h the p r o m o t e r and i m p r o v e m e n t o f histone a c e t y l a t i o n a r o u n d the r e g i o n , thus p r o m o t i n g a p e r m i s s i v e state o f the c h r o m a t i n structure. T h i s p r o v i d e s a n o v e l epigenetic m e c h a n i s m b y w h i c h IFN-y enhances T A P - 1 t r a n s c r i p t i o n . A l t e r n a t i v e l y , IFN-y m a y also act t h r o u g h S T A T - 1 independent p a t h w a y s , s u c h as t h r o u g h a n o v e l IFN-y-activated transcriptional element or t h r o u g h i m m e d i a t e early proteins and t r a n s c r i p t i o n factors [20].  GENERAL  DISCUSSION  139  By interacting simultaneously with the basal transcription machinery and with one or more upstream transcription factors, C B P may function as a physical bridge that stabilizes the transcription complex [17]. A l l the described mechanisms are summarized in Figure 5.1.1.  GENERAL  140  DISCUSSION  J,  Histone acetylation and chromatin relaxation  Figure 5.1.1: A proposed model of the mechanisms underlying T A P - 1 deficiency in carcinomas and release of the transcriptional repression upon relaxation of chromatin structure around the Tap-I gene locus. T h e boxes o n the D N A strand represent c r i t i c a l b i n d i n g sites f o r v a r i o u s t r a n s c r i p t i o n factors that regulate T A P - 1 t r a n s c r i p t i o n . C B P is a transcriptional co-activator that possesses i n t r i n s i c H A T activity. In this m o d e l , the recruitment o f C B P to T A P - 1 p r o m o t e r facilitates histone acetylation that leads to r e l a x a t i o n o f the c h r o m a t i n structure a r o u n d the r e g i o n , i n c r e a s i n g the a c c e s s i b i l i t y o f the D N A template b y t r a n s c r i p t i o n factors ( T F s ) and R N A p o l II c o m p l e x .  GENERAL  141  DISCUSSION  In a d d i t i o n to the m e c h a n i s m s d e s c r i b e d above, this thesis also contributes to the f i n d i n g that trichostatin A ( T S A ) , a histone deacetylase i n h i b i t o r ( H D A C i ) that has been u s e d i n c l i n i c a l trials f o r anti-cancer agents [21-23], has the a b i l i t y to i m p r o v e  TAP-1  e x p r e s s i o n , M H C class I antigen presentation and k i l l i n g o f m a l i g n a n t c e l l s b y  MHC  class I antigen-restricted, t u m o r antigen-specific c y t o t o x i c T l y m p h o c y t e s ( C T L s ) . T h e effects seen w e r e not as strong as those generated b y IFN-y treatment; h o w e v e r , this f i n d i n g is e n c o u r a g i n g f o r the d e v e l o p m e n t o f non-toxic, s m a l l m o l e c u l a r c o m p o u n d s w i t h the a b i l i t y to i m p r o v e patients' i m m u n o g e n i c responses i n cancer therapy. F i n a l l y , a n e w m e t h o d based o n c D N A l i b r a r y screening w a s d e v e l o p e d as an a p p r o a c h to i d e n t i f y other proteins w h i c h m a y i m p r o v e T A P - 1 e x p r e s s i o n and M H C class I  antigen presentation i n metastatic cancer c e l l s . B y  screening o f c D N A  libraries  o r i g i n a t i n g f r o m h u m a n l u n g and spleen s p e c i m e n s , several gene candidates that s h o w e d the a b i l i t y to activate the Tap-1  gene w e r e d i s c o v e r e d . Further research is r e q u i r e d to  refine the screening methods and to c o n f i r m the v a l i d i t y o f the p r i m a r y screen hits. In this thesis, the s e c o n d m e c h a n i s m that was f o u n d to cause T A P - 1 d e f i c i e n c y i n metastatic c a r c i n o m a s , the l o w stability o f T A P - 1  mRNA  [14], has not been further  investigated. A c c e l e r a t e d degradation o f T A P - 1 m R N A due to a m u t a t i o n w i t h i n the T A P - 1 c o d i n g sequence i n a m e l a n o m a c e l l l i n e has been reported [24]. H o w e v e r , the m e c h a n i s m s r e m a i n u n k n o w n i n the absence o f mutations w i t h i n the T A P - 1  coding  sequence itself, w h i c h is the case i n m o s t T A P - d e f i c i e n t c a r c i n o m a l e s i o n s [7, 9]. T h e presence o f a d e s t a b i l i z i n g A U - r i c h element ( A R E )  i n the 3'-untranslated  r e g i o n ( 3 ' U T R ) f o u n d i n a large variety o f c e l l u l a r transcripts is generally r e s p o n s i b l e f o r m R N A degradation i n a n o r m a l turnover process o f coordinated gene e x p r e s s i o n [25, 26].  GENERAL  142  DISCUSSION  A R E w a s o r i g i n a l l y i d e n t i f i e d as a c o m p o n e n t o f the granulocyte-macrophage c o l o n y s t i m u l a t i n g factor ( G M - C S F ) m R N A 3 ' - U T R [27]. I d e n t i f i c a t i o n o f b i n d i n g proteins w i t h the a b i l i t y to either p r o m o t e or i n h i b i t A R E - m e d i a t e d m R N A  i n s t a b i l i t y is o f great  interest i n the f i e l d o f post-transcriptional r e g u l a t i o n o f gene e x p r e s s i o n [28]. A w i d e l y studied group o f proteins that w a s tristetraprolin UUAUUUAUU decay  (TTP)  family  of  f o u n d to accelerate m R N A  CCCH  tandem  zinc  finger  degradation is the proteins  that  binds  consensus sequence i n A R E s o f m R N A [26, 2 8 ] . T T P recruits m R N A  complexes  to  ARE  sequences,  promoting  removal  of  the  poly(A)  tail  (deadenylation) and degradation o f the m R N A [26]. Interestingly, the core heptamer o f the i d e a l T T P b i n d i n g site, U A U U U A U , that is c o n s e r v e d i n m i c e and h u m a n s [28], is also present i n the 3'-untranslated r e g i o n ( 3 ' - U T R ) o f h u m a n and rat T A P - 1 m R N A ( N C B I a c c e s s i o n no. N M _ 0 0 0 5 9 3 and N M _ 0 3 2 0 5 5 , r e s p e c t i v e l y ) . H o w e v e r , n o p o l y A site w a s s p e c i f i e d i n a m o u s e T A P - 1 m R N A sequence p r o v i d e d i n the N C B I w e b s i t e ( N M O 1 3 6 8 3 ) . N e v e r t h e l e s s , the presence o f T T P b i n d i n g site i n h u m a n and rat T A P - 1 m R N A opens the p o s s i b i l i t y that the T A P - 1 m R N A regulated  i n TTP-dependent  manner.  Therefore,  it is i n t r i g u i n g to  study  is  whether  d e r e g u l a t i o n o f T T P f u n c t i o n i n T A P - d e f i c i e n t c e l l s is responsible f o r the accelerated degradation o f T A P - 1 m R N A .  GENERAL  DISCUSSION  143  5.2 Future Work Based on the findings of pre- and post-transcriptional, as well as epigenetic mechanisms underlying TAP-1 deficiencies in carcinomas, the research presented in this thesis could go forward in a number of interesting ways: 1. Characterization of TAP-activating factors. This would require a thorough dissection of specific mechanisms outlined in this thesis. Differential states of core histone modifications in TAP-1 promoter of TAPexpressing and TAP-deficient cells need to be explored in greater details. The strongest correlations of histone modifications and gene transcription observed so far are: methylation of lysine 4, 36 and 79 in histone H3 (H3K4me, H3K36me and H3K79me, respectively), as well as acetylation of lysine 9 and 14 (H3K9ac and H3K14ac) and lysine 16 in histone H4 (H4K16ac) with activation, while methylation of lysine 9 and 27 in histone H3 (H3K9me and H3K27me) and lysine 20 in histone H4 (H4K20me) with repression [4, 29]. The finding of more specific differences will aid the identification of specific factors involved. Exact mechanisms responsible for the impaired recruitment of C B P to TAP-1 promoter in TAP-deficient cancer cells are yet to be determined. It is important to determine whether the C B P itself is dysfunctional in TAP-deficient cancer cells, or whether the impairment is caused by deregulation of one or more upstream factors/coactivators. This study could be initiated by observing the effect of overexpressing normal CBP in TAP-deficient cells. If the results indicated that the defect does not lie in the CBP itself, it would be worth exploring the functionality of several CBP-associated factors,  GENERAL  DISCUSSION  144  s u c h as p/CIP a n d P C A F [17, 3 0 , 3 1 ] . It is also interesting to test whether the H A T a c t i v i t y o f C B P is a c r i t i c a l factor responsible f o r histone a c e t y l a t i o n a n d a c t i v a t i o n o f T A P - 1 p r o m o t e r . T h i s m a y be tested b y o v e r e x p r e s s i o n o f dominant-negative mutants o f C B P that l a c k the H A T d o m a i n . T h e c D N A l i b r a r y screening m e t h o d c o u l d be r e f i n e d b y d e v e l o p i n g a V i r a P o r t l i k e (Stratagene) c D N A l i b r a r y f r o m a T A P - e x p r e s s i n g , p r i m a r y cancer c e l l line. T h e c D N A l i b r a r y r e t r o v i r a l supernatant c o u l d then be used to transduce its T A P - d e f i c i e n t , metastatic derivatives. S c r e e n i n g o f p o s i t i v e transductants and r e c o v e r y o f candidate genes ( c D N A s ) c o u l d be p e r f o r m e d as d e s c r i b e d i n C h a p t e r 4. T h i s w a y , the candidates o b t a i n e d w o u l d l i k e l y to be m o r e s p e c i f i c to the type o f tissues f r o m w h i c h the cancers arose. M i c r o a r r a y analysis c o u l d be p e r f o r m e d to observe differential e x p r e s s i o n o f genes i n a T A P - e x p r e s s i n g , p r i m a r y cancer c e l l line a n d its T A P - d e f i c i e n t , metastatic d e r i v a t i v e . A b e r r a n t e x p r e s s i o n o f genes i n the metastatic c e l l s m i g h t be r e s p o n s i b l e f o r the d o w n r e g u l a t e d e x p r e s s i o n o f T A P a n d i m m u n e e v a s i o n m e c h a n i s m s .  2.  I n v e s t i g a t i o n o f the m e c h a n i s m s b y w h i c h T S A i m p r o v e d T A P - 1 e x p r e s s i o n a n d  t u m o r antigen presentation. T h e studies i n C h a p t e r 3 i n d i c a t e d that u n l i k e the IFN-y, T S A effects d i d not o c c u r t h r o u g h the i m p r o v e m e n t o f histone H 3 acetylation i n T A P - 1 promoter. O n e a p p r o a c h w o u l d be to isolate T S A - r e s p o n s i v e element(s) i n T A P - 1 p r o m o t e r b y testing the response o f f u l l T A P - 1 p r o m o t e r and its truncations to T S A treatment. I d e n t i f y i n g the m e c h a n i s m b y w h i c h T S A up-regulates T A P - 1 e x p r e s s i o n is o f f u n d a m e n t a l i m p o r t a n c e ,  GENERAL  145  DISCUSSION  since any non-toxic c o m p o u n d s w i t h the a b i l i t y to enhance T A P expression  in  cancer  cells  are  of  great  interest  for  the  and M H C  development  of  class I cancer  i m m u n o t h e r a p y approaches. In the future, the e f f i c a c y o f the treatment m a y be i m p r o v e d b y the i n v e n t i o n o f synthetic T S A - l i k e m o l e c u l e s w i t h a greater a b i l i t y to i n d u c e T A P and  MHC  class  I  expression in  cells  with  down-regulated  expression o f  APM  components.  3.  B r o a d e r a p p l i c a t i o n s o f the use o f p T A P l - E G F P construct f o r screening n o v e l T A P -  1-regulator genes. In contrast to the use o f this system to search f o r T A P - a c t i v a t i n g c D N A s i n T A P d e f i c i e n t c e l l s , it m a y also be used to hunt f o r n o v e l genes w i t h the a b i l i t y to repress T A P - 1 p r o m o t e r activity i n T A P - e x p r e s s i n g c e l l s . T A P - s u p p r e s s i n g c o m p o u n d s m a y be i n c o r p o r a t e d i n i m m u n o t h e r a p e u t i c approaches that a i m to i n h i b i t i m m u n e responses i n transplant r e j e c t i o n and a u t o i m m u n e diseases.  4.  Investigation o f the m e c h a n i s m s responsible f o r r a p i d T A P - 1  m R N A degradation i n  TAP-deficient carcinomas. T h i s i n v e s t i g a t i o n m a y be initiated b y m u t a t i n g the T T P - b i n d i n g sequence i n the 3'-UTR region o f TAP-1  and testing whether this w o u l d increase T A P - 1  m R N A stability  i n T A P - d e f i c i e n t c e l l s . W h e t h e r T T P p l a y s a role i n r e g u l a t i n g T A P - 1  m R N A stability  c o u l d also be d e t e r m i n e d b y c o m p a r i n g T A P - 1  m R N A stability i n c e l l s o r i g i n a t e d f r o m  n o r m a l versus T T P - d e f i c i e n t m i c e [32]. T h i s m a y be f o l l o w e d b y studies that a i m to  GENERAL  DISCUSSION  146  characterize proteins w i t h the a b i l i t y to prevent de-adenylation [33], thus protecting T A P 1 m R N A transcripts f r o m r a p i d degradation i n a poly(A)-dependent f a s h i o n .  GENERAL  DISCUSSION  147  5.3 The Big Picture According to Burnet's immune surveillance theory, thousands of tumor cells emerged de novo everyday and the hosts' immune surveillance system was able to kill these antigenic tumor cells [34]. Unfortunately, this perfect scenario does not always happen, since M H C class I antigen presentation is often disrupted in cancer cells, due to downregulation of A P M components, followed by immune selective pressure that works in favor of the outgrowth of cells that are unable to present tumor-specific antigens [3]. These cells can proliferate uncontrollably as they remain invisible by the circulating killer T cells (CTLs). This phenomenon remains a challenge for the development of anti-cancer vaccines and T-cell-based tumor immunotherapy methods that largely rely on the ability of CTLs to recognize abnormal cells expressing tumor-specific antigens. Effective approaches that lead to the induction of immune responses against neoplastic cells are of interest for the advancement of cancer immunotherapy. TAP-1-based therapy is a particularly attractive approach to be developed, since the entire M H C class I antigen presentation pathway in cells with multiple deficiencies of A P M components may be reconstituted by restoring the expression of this particular component. A successful clinical approach would require a combination of fundamental knowledge and application of TAP-1-activating factors and effective delivery methods.  GENERAL  DISCUSSION  148  5.4 References 1.  B u b e n i k , J . M H C class I d o w n - r e g u l a t i o n : t u m o u r escape f r o m i m m u n e s u r v e i l l a n c e ? Int J O n c o l , 2 0 0 4 . 2 5 : 4 8 7 - 9 1 .  2.  C a m p o l i , M . , C . C . C h a n g , a n d S. Ferrone. H L A class I antigen loss, t u m o r i m m u n e escape a n d i m m u n e selection. V a c c i n e , 2 0 0 2 . 2 0 S u p p l 4 : A 4 0 - 5 .  3.  C h a n g , C . C . a n d S. F e r r o n e . I m m u n e selective pressure a n d H L A class I antigen defects i n m a l i g n a n t lesions. C a n c e r I m m u n o l I m m u n o t h e r , 2 0 0 7 . 56:227-36.  4.  T o m a s i , T . B . , W.J. Magner, and A . N . K h a n . Epigenetic regulation o f immune escape genes i n cancer. C a n c e r I m m u n o l I m m u n o t h e r , 2 0 0 6 . 55:1159-84.  5.  A b e l e , R. a n d R. T a m p e . M o d u l a t i o n o f the antigen transport m a c h i n e r y T A P b y friends a n d enemies. F E B S Lett, 2 0 0 6 . 5 8 0 : 1 1 5 6 - 6 3 .  6.  Lankat-Buttgereit, B. a n d R. T a m p e . T h e transporter associated w i t h antigen p r o c e s s i n g : f u n c t i o n a n d i m p l i c a t i o n s i n h u m a n diseases. P h y s i o l R e v , 2 0 0 2 . 82:187-204.  7.  Seliger, B., T . C a b r e r a , F. G a r r i d o , a n d S. Ferrone. H L A class I antigen a b n o r m a l i t i e s a n d i m m u n e escape b y m a l i g n a n t cells. S e m i n C a n c e r B i o l , 2 0 0 2 . 12:3-13.  8.  Seliger, B., M . J . M a e u r e r , a n d S. Ferrone. T A P off—tumors on. I m m u n o l T o d a y , 1997. 18:292-9.  9.  Seliger, B., M . J . M a e u r e r , a n d S. Ferrone. A n t i g e n - p r o c e s s i n g m a c h i n e r y b r e a k d o w n and t u m o r growth. I m m u n o l T o d a y , 2 0 0 0 . 2 1 : 4 5 5 -6 4 .  149  GENERAL DISCUSSION 10.  R e s t i f o , N.P., F. E s q u i v e l , Y . K a w a k a m i , J . W . Y e w d e l l , J.J. M u l e , S . A . R o s e n b e r g , and J . R . B e n n i n k . Identification o f h u m a n cancers deficient i n antigen processing. J E x p M e d , 1993. 177:265-72.  11.  A l i m o n t i , J . , Q.J. Z h a n g , R. Gabathuler, G . R e i d , S.S. C h e n , and W . A .  Jefferies.  T A P e x p r e s s i o n p r o v i d e s a general m e t h o d for i m p r o v i n g the r e c o g n i t i o n o f m a l i g n a n t cells i n v i v o . N a t B i o t e c h n o l , 2 0 0 0 . 18:515-20. 12.  G a b a t h u l e r , R., G . R e i d , G . K o l a i t i s , J . D r i s c o l l , and W . A . Jefferies. C o m p a r i s o n o f c e l l lines deficient i n antigen presentation reveals a f u n c t i o n a l role f o r T A P - 1 alone i n antigen processing. J E x p M e d , 1994. 180:1415-25.  13.  S e l i g e r , B., U . R i t z , R. A b e l e , M . B o c k , R. T a m p e , G . Sutter, I. D r e x l e r , C . H u b e r , and S. Ferrone. I m m u n e escape o f m e l a n o m a : first evidence o f structural alterations i n t w o distinct components o f the M H C class I antigen p r o c e s s i n g pathway. C a n c e r R e s , 2 0 0 1 . 6 1 : 8 6 4 7 - 5 0 .  14.  S e t i a d i , A . F . , M . D . D a v i d , S.S. C h e n , J . H i s c o t t , and W . A . Jefferies. I d e n t i f i c a t i o n o f m e c h a n i s m s u n d e r l y i n g transporter associated w i t h antigen p r o c e s s i n g d e f i c i e n c y i n metastatic m u r i n e carcinomas. C a n c e r R e s , 2 0 0 5 . 6 5 : 7 4 8 5 - 9 2 .  15.  D a v i e , J . R . a n d V . A . Spencer. C o n t r o l o f histone m o d i f i c a t i o n s . J C e l l B i o c h e m , 1999. S u p p l 32-33:141-8.  16.  G i o r d a n o , A . and M . L . A v a n t a g g i a t i . p 3 0 0 and C B P : partners f o r l i f e and death. J C e l l P h y s i o l , 1999. 181:218-30.  17.  K a l k h o v e n , E. C B P and p 3 0 0 : H A T s f o r different occasions. B i o c h e m P h a r m a c o l , 2004.68:1145-55.  GENERAL 18.  150  DISCUSSION  L e g u b e , G . a n d D . T r o u c h e . R e g u l a t i n g histone acetyltransferases and deacetylases. E M B O R e p , 2 0 0 3 . 4:944-7.  19.  M a , Z., M . J . C h a n g , R . C . S h a h , and E . N . B e n v e n i s t e .  Interferon-gamma-activated  S T A T - 1 a l p h a suppresses M M P - 9 gene t r a n s c r i p t i o n b y sequestration o f the coactivators C B P / p 3 0 0 . J L e u k o c B i o l , 2 0 0 5 . 7 8 : 5 1 5 - 2 3 . 20.  R a m a n a , C . V . , M . P . G i l , R . D . Schreiber, and G . R . Stark. Stat 1-dependent a n d independent p a t h w a y s i n IFN-gamma-dependent s i g n a l i n g . T r e n d s I m m u n o l , 2002.23:96-101.  21.  J u n g , M . Inhibitors o f histone deacetylase as n e w anticancer agents. C u r r M e d C h e m , 2 0 0 1 . 8:1505-11.  22.  T a d d e i , A . , D . R o c h e , W . A . B i c k m o r e , and G . A l m o u z n i . T h e effects o f histone deacetylase i n h i b i t o r s o n h e t e r o c h r o m a t i n : i m p l i c a t i o n s f o r anticancer therapy? E M B O R e p , 2 0 0 5 . 6:520-4.  23.  Y o s h i d a , M . , R. F u r u m a i , M . N i s h i y a m a , Y . K o m a t s u , N . N i s h i n o , and S. H o r i n o u c h i . H i s t o n e deacetylase as a n e w target f o r cancer chemotherapy. C a n c e r C h e m o t h e r P h a r m a c o l , 2 0 0 1 . 48 S u p p l l : S 2 0 - 6 .  24.  Y a n g , T., B . A . M c N a l l y , S. Ferrone, Y . L i u , and P. Z h e n g . A single-nucleotide d e l e t i o n leads to r a p i d degradation o f T A P - 1 m R N A i n a m e l a n o m a c e l l line. J B i o l C h e m , 2003. 278:15291-6.  25.  B e n j a m i n , D., M . C o l o m b i , G . S t o e c k l i n , and C . M o r o n i . A G F P - b a s e d assay f o r m o n i t o r i n g post-transcriptional r e g u l a t i o n o f A R E - m R N A turnover. M o l B i o s y s t , 2 0 0 6 . 2:561-7.  GENERAL 26.  DISCUSSION  151  H a u , H . H . , R.J. W a l s h , R . L . O g i l v i e , D . A . W i l l i a m s , C . S . R e i l l y , a n d P.R. B o h j a n e n . T r i s t e t r a p r o l i n recruits f u n c t i o n a l m R N A decay c o m p l e x e s to A R E sequences. J C e l l B i o c h e m , 2 0 0 6 .  27.  S h a w , G . a n d R. K a m e n . A c o n s e r v e d A U sequence f r o m the 3' untranslated r e g i o n o f G M - C S F m R N A mediates selective m R N A degradation. C e l l , 1986. 46:659-67.  28.  L a i , W . S . , J . S . Parker, S.F. G r i s s o m , D.J. S t u m p o , a n d P.J. B l a c k s h e a r . N o v e l m R N A targets f o r tristetraprolin ( T T P ) i d e n t i f i e d b y g l o b a l analysis o f s t a b i l i z e d transcripts i n T T P - d e f i c i e n t fibroblasts. M o l C e l l B i o l , 2 0 0 6 . 2 6 : 9 1 9 6 - 2 0 8 .  29.  L o y o l a , A . , T . B o n a l d i , D . R o c h e , A . I m h o f , and G . A l m o u z n i . P T M s o n H 3 variants before c h r o m a t i n a s s e m b l y potentiate their f i n a l epigenetic state. M o l C e l l , 2 0 0 6 . 24:309-16.  30.  T o r c h i a , J . , D . W . R o s e , J . Inostroza, Y . K a m e i , S. W e s t i n , C . K . G l a s s , a n d M . G . R o s e n f e l d . T h e transcriptional co-activator p/CIP b i n d s C B P a n d mediates nuclear-receptor f u n c t i o n . N a t u r e , 1997. 387:677-84.  31.  H e r r e r a , J . E . , R . L . S c h i l t z , and M . B u s t i n . T h e a c c e s s i b i l i t y o f histone H 3 tails i n c h r o m a t i n modulates their acetylation b y P 3 0 0 / C B P - a s s o c i a t e d factor. J B i o l C h e m , 2000. 275:12994-9.  32.  L a i , W . S . , E. C a r b a l l o , J . M . T h o r n , E . A . K e n n i n g t o n , a n d P.J. B l a c k s h e a r . Interactions o f C C C H z i n c f i n g e r proteins w i t h m R N A . B i n d i n g o f tristetraprolinrelated z i n c f i n g e r proteins to A u - r i c h elements a n d d e s t a b i l i z a t i o n o f m R N A . B i o l C h e m , 2000. 275:17827-37.  J  GENERAL 33.  DISCUSSION  152  C o n r a d , N . K . , S. M i l i , E.L. M a r s h a l l , M . D . S h u , and J . A . Steitz. I d e n t i f i c a t i o n o f a r a p i d m a m m a l i a n deadenylation-dependent decay p a t h w a y and its i n h i b i t i o n b y a v i r a l R N A element. M o l C e l l , 2 0 0 6 . 2 4 : 9 4 3 - 5 3 .  34.  Burnet, M . C a n c e r ; a b i o l o g i c a l a p p r o a c h . I. T h e processes o f control. B r M e d J , 1957. 1:779-86.  153  APPENDIX  Appendix A: Details of Methods A. 1 Chromatin Immunoprecipitation Assay T w e n t y m i l l i o n cells were t r y p s i n i z e d , w a s h e d t w i c e w i t h P B S , p e l l e t e d , a n d i n c u b a t e d f o r 10 m i n u t e s at r o o m temperature i n P B S supplemented w i t h a cross-linker reagent, 1 % f o r m a l d e h y d e ( S i g m a ) . C r o s s - l i n k i n g w a s stopped b y a d d i t i o n o f g l y c i n e to a f i n a l c o n c e n t r a t i o n o f 125 m M f o r 5 m i n . C e l l s were w a s h e d t w i c e w i t h ice-cold P B S a n d c e n t r i f u g e d f o r 5 m i n at 4 ° C . C e l l s w e r e then l y s e d i n 1 m l c y t o p l a s m i c l y s i s b u f f e r (5 m M P i p e s , p H 8.0, 85 m M K C 1 , 0 . 5 % N P - 4 0 , a n d protease i n h i b i t o r ( C o m p l e t e R o c h e ) ) , and the p e l l e t e d  Mini,  f r a c t i o n w a s then l y s e d i n and 5 0 0 p i o f nuclear l y s i s b u f f e r  ( 1 % S D S , 10 m M E D T A , 50 m M T r i s - H C l , p H 8.0 and protease i n h i b i t o r ) . B o t h steps o f l y s i s w e r e c o n d u c t e d f o r 10 minutes. T h e n , c h r o m a t i n w a s sheared b y s o n i c a t i o n ( M i c r o s o n X L sonicator, M i s o n i x Inc., F a r m i n g d a l e , N Y ) ( p o w e r setting 13 W a t t s ; 3 x 1 5 seconds burst) to o b t a i n 0.5-1 k b fragments. S a m p l e s were centrifuged to pellet debris and d i l u t e d 4 times i n d i l u t i o n buffer ( 1 % T r i t o n X - 1 0 0 , 2 m M E D T A , 2 0 m M T r i s - H C l , p H 8.0, 150 m M N a C l a n d protease i n h i b i t o r ) . T w o m i c r o g r a m s s a l m o n s p e r m D N A ( S i g m a ) w a s a d d e d , and samples were pre-cleared w i t h 100 p i slurry o f protein A agarose beads ( P r o t e i n A Sepharose C L - 4 B , A m e r s h a m B i o s c i e n c e s , U p p s l a , S w e d e n ) for 2 hours at 4 ° C . I m m u n o p r e c i p i t a t i o n s were carried o u t overnight at 4 ° C w i t h 5 u g o f a n t i - R N A polymerase  Cruz). Immunoprecipitations  without  a n t i b o d y w e r e also i n c l u d e d as controls to assess levels o f b a c k g r o u n d signals.  Immune  complexes  II  antibody  (N-20,  sc-899, Santa  were c o l l e c t e d w i t h p r o t e i n A  agarose  beads  for 1 hour  and washed  s u c c e s s i v e l y i n l o w salt buffer, h i g h salt buffer and L i C l buffer f o r 10 m i n u t e s , then t w i c e  154  APPENDIX  i n T E f o r 2 minutes. T h e c o m p l e x e s w e r e then eluted i n 1 % S D S , 0.1 M N a H C 0 3 a n d cross-links were reversed b y heating at 6 5 ° C f o r 6 hours to overnight. F o l l o w i n g 1 h o u r o f proteinase K (Invitrogen) d i g e s t i o n at 4 5 ° C , D N A w a s p h e n o l - c h l o r o f o r m extracted and ethanol precipitated. Pellets were resuspended i n 5 0 p i m i l l i Q water, a n d 2 p i o f the i m m u n o p r e c i p i t a t e d D N A w a s used i n each P C R sample.  A.2 Calculation of copy numbers of pTAP-1-EGFP construct integrated in stable transfectants (6 x 1 0  2 3  [copies/mol] x concentration [g/uf]) / M W [g/mol] = amount [copies/ u l ]  1 m o l = m o l e c u l a r w e i g h t ( M W ) [g] 1 mol = 6 x 1 0  m o l e c u l e s (= copies)  Standard size o f m o u s e D N A : 2.7 x 1 0 b p . A s s u m e this is per c e l l . 9  Standard c o n v e r s i o n o f u g to p m o l : 1 i i g o f a 100 b p d s D N A fragment = (1 u g x 1515) / 100 = 15.2 p m o l T h e r e f o r e , 100 n g o f 2.7 x 1 0 b p d s D N A fragment = (0.1 u g x 1515) / (2.7 x 1 0 ) 9  9  = 5.61 x 10" p m o l = 5.61 x 1 0 " m o l = 3 3 , 6 6 0 copies 8  20  T h u s , i n 100 n g m o u s e D N A , there are 3 3 , 6 6 0 c o p i e s o f g e n o m i c D N A .  Sample calculation: U s i n g 100 n g o f C M T . 6 4 ( p T A P l - E G F P stable transfectants) g e n o m i c D N A as a r e a l t i m e P C R template, the average n u m b e r o f p T A P l - E G F P constructs integrated into the C M T . 6 4 cells w a s determined to be 53,535 c o p i e s . T h e r e f o r e , average n u m b e r o f p l a s m i d per c e l l = 53,535 / 3 3 , 6 6 0 = 1.59  155  APPENDIX  Appendix B: List of Cloning Vectors MCS  Stii\  © Clontech Laboratories, Inc. Reprinted by permission.  © Clontech Laboratories, Inc. Reprinted by permission.  156  APPENDIX  Appendix C: Comparison of TAP-1 Coding Sequence of CMT.64 and Ltk cells Black:  L t k sequence; I t a l i c s :  CMT.64 s e q u e n c e ; B o l d :  polymorphic  regions.  1  ATGGCTGCGC ACGTCTGGCT GGCGGCCGCC CTGCTCCTTC TGGTGGACTG GCTGCTGCTG  1 ''  ATGGCTGCGC ACGTCTGGCT GGCGGCCGCC CTGCCCCTTC TGGTGGACTG GCTGCTGCTG  61  CGGCCCATGC TCCCGGGAAT CTTCTCCCTG TTGGTTCCCG AGGTGCCGCT  GCTCCGGGTC  121  TGGGTGGTGG GCCTGAGTCG CTGGGCCATC CTAGGACTAG GGGTCCGCGG  GGTCCTCGGG  181  GTCACCGCAG GAGCCCATGG CTGGCTGGCT GCTTTGCAGC CGCTGGTGGC  CGCACTGAGT  241  TTGGCCCTGC CTGGACTTGC CTTGTTCCGA GAGCTGGCCG CCTGGGGAAC ACTCCGGGAG  301  GGTGACAGCG CTGGATTACT GTACTGGAAC AGTCGTCCAG ATGCCTTCGC TATCAGTTAT  361  GTGGCAGCAT TGCCCGCAGC CGCCCTGTGG CACAAGTTGG GGAGCCTCTG  421  GGCAACAGGG ACGCTGGAGA CATGCTGTGT CGGATGCTGG GCTTCCTGGG CCCTAAGAAG  481  AGACGTCTCT ACCTGGTTCT GGTTCTCTTG ATTCTCTCTT GCCTTGGGGA AATGGCCATT  541  CCCTTCTTCA CGGGCCGCAT CACTGACTGG ATTCTTCAGG ATAAGACAGT TCCTAGCTTC  601  ACCCGCAACA TATGGCTCAT GTCCATTCTC ACCATAGCCA GCACAGCGCT GGAGTTTGCA  661  AGTGATGGAA TCTACAACAT CACCATGGGA CACATGCACG GCCATGTGCA CAGAGAGGTG  661  AGTGATGGAA TCTACAACAT CACCATGGGA CACATGCACG GCCGTGTGCA CAGAGAGGTG  7 21  TTTCGGGCCG TCCTTCGCCA GGAGACAGGG TTTTTCCTGA AGAACCCAGC AGGTTCCATC  781  ACATCTCGGG TGACTGAGGA CACAGCCAAC GTGTGCGAGT CCATTAGTGG CACGCTGAGC  841  CTGCTGCTGT GGTACCTGGG GCGAGCCCTG TGTCTCTTGG TGTTCATGTT TTGGGGGTCA  61  121 181 241 301 361 421 481  CGGCCCATGC TCCCGGGAAT CTTCTCCCTG TTGGTTCCCG AGGTGCCGCT GCTCCGGGTC TGGGTGGTGG GCCTGAGTCG CTGGGCCATC CTAGGACTAG GGGTCCGCGG GGTCCTCGGG  GTCACCGCAG GAGCCCATGG CTGGCTGGCT GCTTTGCAGC CGCTGGTGGC CGCACTGAGT TTGGCCCTGC CTGGACTTGC CTTGTTCCGA GAGCTGGCCG CCTGGGGAAC ACTCCGGGAG  GGTGACAGCG CTGGATTACT GTACTGGAAC AGTCGTCCAG ATGCCTTCGC TATCAGTTAT GGCGCCCAGC  GTGGCAGCAT TGCCCGCAGC CGCCCTGTGG CACAAGTTGG GGAGCCTCTG GGCGCCCAGC  GGCAACAGGG ACGCTGGAGA CATGCTGTGT CGGATGCTGG GCTTCCTGGG CCCTAAGAAG  AGACGTCTCT ACCTGGTTCT GGTTCTCTTG ATTCTCTCTT GCCTTGGGGA AATGGCCATT  541 ' CCCTTCTTCA CGGGCCGCAT CACTGACTGG ATTCTTCAGG ATAAGACAGT TCCTAGCTTC 601  721 781  841  ACCCGCAACA TATGGCTCAT GTCCATTCTC ACCATAGCCA GCACAGCGCT GGAGTTTGCA  TTTCGGGCCG TCCTTCGCCA GGAGACAGGG TTTTTCCTGA AGAACCCAGC AGGTTCCATC  ACATCTCGGG TGACTGAGGA CACAGCCAAC GTGTGCGAGT CCATTAGTGG CACGCTGAGC CTGCTGCTGT GGTACCTGGG GCGAGCCCTG TGTCTCTTGG TGTTCATGTT TTGGGGGTCA  APPENDIX  157  901  CCGTACCTCA CTCTGGTCAC CCTGATCAAT CTGCCCCTGC TTTTTCTTTT GCCTAAGAAG  901  CCGTACCTCA CTCTGGTCAC CCTGATCAAC CTGCCCCTGC TTTTTCTTTT GCCTAAGAAG  961  CTGGGAAAAG TGCACCAGTC ACTGGCAGTG AAGGTGCAGG AGTCTCTAGC AAAGTCCACG  961  CTGGGAAAAG TGCATCAGTC ACTGGCAGTG AAGGTGCAGG AGTCTCTAGC AAAGTCCACG  1021  CAGGTGGCCC TTGAGGCCTT ATCGGCAATG CCTACTGTGC GGAGCTTTGC CAACGAGGAG  1021  CAGGTGGCCC TTGAGGCCTT ATCGGCGATG CCTACTGTGC GGAGCTTTGC CAACGAGGAG  1081  GGTGAGGCCC AGAAGTTCAG GCAGAAGTTG GAAGAAATGA AGACGCTAAA  CAAGAAGGAG  1081 GGTGAGGCCC AGAAGTTCAG GCAGAAGTTG GAAGAAATGA AGACTCTAAA CAAGAAGGAG 1141  GCCTTGGCTT ATGTCGCTGA AGTCTGGACC ACGAGTGTCT CGGGAATGCT GCTGAAGGTG  1141  GCCTTGGCTT ACGTGGCTGA AGTCTGGACC ACGAGTGTCT CGGGAATGCT GCTGAAGGTG  12 01  GGAATTCTGT ACCTGGGCGG GCAGCTGGTG ATCAGAGGGA CTGTCAGCAG CGGCAACCTT  1201  GGAATTCTGT ACCTGGGCGG GCAGCTGGTG ATCAGAGGGG CTGTCAGCAG CGGCAACCTT  12 61  GTCTCATTCG TTCTCTACCA GCTTCAGTTC ACCCACGCTG TTCAGGTCCT GCTCTCCCTC  1261  GTCTCATTCG TTCTCTACCA GCTTCAGTTC ACCCAGGCTG TTCAGGTCCT GCTCTCCCTC  1321  TACCCCTCCA TGCAGAAGGC TGTGGGCTCC TCAGAGAAAA TATTCGAATA CTTGGACCGG  1381  ACTCCTTGCT CTCCACTCAG TGGCTCGTTG GCACCCTCAA ACATGAAAGG CCTTGTGGAG  1321  TACCCCTCCA TGCAGAAGGC TGTGGGCTCC TCAGAGAAAA TATTCGAATA CTTGGACCGG  1381 ACTCCTTGCT CTCCACTCAG TGGCTCGTTG GCACCCTCAA ACATGAAAGG CCTTGTGGAG 14 41  TTCCAAGATG TCTCTTTTGC CTACCCAAAC CAGCCCAAAG TCCAGGTGCT TCAGGGGCTG  1441  TTCCAAGATG TCTCTTTTGC CTACCCAAAC CAGCCCAAAG TCCAGGTGCT TCAGGGGCTG  1501  ACGTTCACCC TGCATCCTGG AACGGTGACA GCGTTGGTGG GACCCAATGG ATCAGGGAAG  15 61  AGCACCGTGG CTGCCCTGCT GCAGAACCTG TACCAGCCCA CCGGGGGCCA GCTGCTGCTG  1621  GATGGCCAGC GCCTGGTCCA GTATGATCAC CATTACCTGC ACACTCAGGT AGCCGCAGTG  1621  GATGGCCAGT GCCTGGTCCA GTATGATCAC CATTACCTGC ACACTCAGGT GGCCGCAGTG  1681  GGACAAGAGC CGCTGCTATT TGGAAGAAGC TTTCGAGAAA ATATTGCGTA TGGCCTGAAC  1141  CGGACTCCAA CCATGGAGGA AATCACAGCT GTGGCCGTGG AGTCTGGAGC CCACGATTTC  18 01  ATCTCTGGGT TCCCTCAGGG CTATGACACA GAGGTAGGTG AGACTGGGAA CCAGCTGTCA  1501 ACGTTCACCC TGCATCCTGG AACGGTGACA GCGTTGGTGG GACCCAATGG ATCAGGGAAG 1561 AGCACCGTGG CTGCCCTGCT GCAGAACCTG TACCAGCCCA CCGGGGGCCA GCTGCTGCTG  1681 1741  GGACAAGAGC CGCTGCTATT TGGAAGAAGC TTTCGAGAAA ATATTGCGTA TGGCCTGAAC  CGGACTCCAA CCATGGAGGA AATCACAGCT GTGGCCGTGG AGTCTGGAGC CCACGATTTC  1801 ATCTCTGGGT TCCCTCAGGG CTATGACACA GAGGTAGGTG AGACTGGGAA CCAGCTGTCA 18 61  1861  GGAGGTCAGC GACAGGCAGT GGCCTTGGCC CGAGCCTTGA TCCGGAAGCC ACTCCTGCTT  GGAGGTCAGC GACAGGCAGT GGCCTTGGCC CGAGCCTTGA TCCGGAAGCC ACTCCTGCTT  APPENDIX  158  1921  ATCTTGGATG ATGCCACCAG TGCCCTGGAT GCTGGCAACC AGCTACGGGT  1981  CTGTATGAGA GCCCCAAGCG GGCTTCTCGG ACGGTTCTTC TTATCACCCA GCAGCTCAGC  2041  CTGGCAGAGC AGGCCCACCA CATCCTCTTT CTCAGAGAAG GCTCTGTCGG  2101  ACCCACCTGC AGCTCATGAA GAGAGGAGGG TGCTACCGGG CCATGGTAGA GGCTCTTGCG  2161  GCTCCTGCAG ACTGA  1921 1981 2041 2101 2161  CCAGCGGCTC  ATCTTGGATG ATGCCACCAG TGCCCTGGAT GCTGGCAACC AGCTACGGGT CCAGCGGCTC CTGTATGAGA GCCCCAAGCG GGCTTCTCGG ACGGTTCTTC TTATCACCCA GCAGCTCAGC CGAGCAGGGC  CTGGCAGAGC AGGCCCACCA CATCCTCTTT CTCAGAGAAG GCTCTGTCGG CGAGCAGGGC  ACCCACCTGC AGCTCATGAA GAGAGGAGGG TGCTACCGGG CCATGGTAGA GGCTCTTGCG GCTCCTGCAG ACTGA  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0100781/manifest

Comment

Related Items