UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Induction of neuronal apoptosis inhibitory protein expression in response to androgen deprivation by… Chiu, Helen Hoi-Lun 2007

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2007-0359.pdf [ 8.66MB ]
Metadata
JSON: 831-1.0100770.json
JSON-LD: 831-1.0100770-ld.json
RDF/XML (Pretty): 831-1.0100770-rdf.xml
RDF/JSON: 831-1.0100770-rdf.json
Turtle: 831-1.0100770-turtle.txt
N-Triples: 831-1.0100770-rdf-ntriples.txt
Original Record: 831-1.0100770-source.json
Full Text
831-1.0100770-fulltext.txt
Citation
831-1.0100770.ris

Full Text

I N D U C T I O N O F N E U R O N A L A P O P T O S I S I N H I B I T O R Y P R O T E I N E X P R E S S I O N I N R E S P O N S E T O A N D R O G E N D E P R I V A T I O N B Y N F - K B I N P R O S T A T E C A N C E R C E L L S by HELEN HOI-LUN CHIU B.Sc, The University of British Columbia, 2003 A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Pathology) THE UNIVERSITY OF BRITISH COLUMBIA October 2007 © Helen Hoi-Lun Chiu, 2007 A B S T R A C T Androgen deprivation therapy is an efficacious treatment for advanced prostate cancer (CaP) by inducing apoptosis of prostate cells. Despite the initial effectiveness of this systemic therapy, the cancer will inevitably recur and progress to an androgen-independent stage. The molecular mechanism by which some CaP cells may bypass the cell death induced by androgen deprivation is unclear. Emerging studies have highlighted the role of the inhibitor of apoptosis protein (IAP) family members in conferring an enhanced ability of malignant cells to survive in conditions normally resulting in cell death. Therefore, we explored levels of expression of these anti-apoptotic proteins in CaP cells in response to androgen deprivation. Levels of neuronal apoptosis inhibitory protein (NAIP) mRNA were significantly increased in response to castration of hosts. The increase in NAIP mRNA levels in response to androgen deprivation was further confirmed in an in vitro system. Nuclear factor (NF)-K;B, for which constitutive activity has been implicated in CaP, is suspected to play a role in the expression of IAPs. Using a N F - K B luciferase reporter construct, we demonstrated that the transcriptional activity of N F - K B was inhibited by androgen. In vitro, nuclear localization of N F - K B correlated with the DNA-binding activity of N F - K B as determined by electrophoretic mobility shift assay in human CaP cell lines with different androgen requirement and androgen receptor status. However, in vivo, the DNA-binding activity of N F - K B was independent from its protein levels in the nucleus. Importantly, elevated expression of NAIP correlated to the increased DNA-binding activity of N F - K B in vivo in response to castration of the hosts. To determine if the transcription of NAIP was directly regulated by NF-icB, subsequent characterization of three icB-like sites in the regulatory regions of the NAIP locus led us ii to confirm the physiological relevance of the ^B-like site within the second intron of the gene locus using chromatin immunoprecipitation assay. Our observations suggest that transcription of NAIP may be regulated by N F - K B via regulatory element(s) in the NAIP locus in response to androgen deprivation Thus, this study underlines a plausible mechanism by which some CaP cells may acquire the ability to resist apoptosis in androgen-deprived conditions. T A B L E O F C O N T E N T S A B S T R A C T ii T A B L E O F C O N T E N T S iv L I S T O F T A B L E S vi L I S T O F F I G U R E S vii L I S T O F A B B R E V I A T I O N S ix A C K N O W L E D G E M E N T S xi D E D I C A T I O N xii C O - A U T H O R S H I P S T A T E M E N T xiii 1 I N T R O D U C T I O N 1 1.1 PROSTATE CANCER 1 1.1.1 Epidemiology and the challenge 1 1.1.2 The prostate 2 1.1.3 Detection and diagnosis 9 1.1.4 Natural history 11 1.1.5 Treatment options 15 1.2 MODELS FOR STUDYING THE HORMONAL PROGRESSION OF PROSTATE CANCER 20 1.3 INHIBITOR OF APOPTOSIS PROTEINS 23 1.4 NUCLEAR FACTOR-KB 28 1.5 RESEARCH OBJECTIVES AND HYPOTHESIS 32 1.5.1 Objectives and hypothesis 32 1.5.2 Specific aims 33 1.6 REFERENCES 34 2 I N D U C T I O N O F N E U R O N A L A P O P T O S I S I N H I B I T O R Y P R O T E I N E X P R E S S I O N I N R E S P O N S E T O A N D R O G E N D E P R I V A T I O N B Y N F - K B I N P R O S T A T E C A N C E R C E L L S 5 6 2.1 INTRODUCTION 56 2.2 MATERIALS AND METHODS 58 2.2.1 Animals, cell culture and reagents 58 2.2.2 LNCaP hollow fibre model and castration 59 2.2.3 LNCaP xenograft model 60 2.2.4 Serum PSA levels 60 2.2.5 Lrimunohistochemistry 61 2.2.6 In-vitro androgen deprivation 61 2.2.7 RNA extraction and RT-PCR 62 2.2.8 Real-time quantitative PCR analysis 62 2.2.9 Subcellular protein extracts preparation 64 2.2.10 Western blot analysis 65 2.2.11 Electrophoretic mobility shift assay 66 2.2.12 N F - K B luciferase reporter activity assay 67 2.2.13 Chromatin immunoprecipitation 68 2.2.14 Statistical analysis 69 2.3 RESULTS 69 2.3.1 LAP genes are differentially expressed in vivo in response to castration 69 2.3.2 Androgen alters the levels of NAIP mRNA and the transcriptional activity of N F - K B in prostate cancer cells 71 2.3.3 Expression and DNA-binding activity of N F - K B in prostate cancer cells maintained in vitro 74 2.3.4 Expression of NAIP and N F - K B in vivo in response to castration 75 2.3.5 DNA-binding activity of N F - K B in prostate cancer cells in vivo 78 2.3.6 Binding of N F - K B in the NAIP locus 82 2.4 DISCUSSION 87 2.5 CONCLUSION AND SIGNIFICANCE 91 2.6 REFERENCES 93 3. CONCLUDING CHAPTER 102 3.1 PERSPECTIVES AND FUTURE DIRECTIONS 102 3.2 REFERENCES 107 4. APPENDIX 109 4.1 ANIMAL CARE CERTIFICATES 109 4.2 BIOHAZARD APPROVAL CERTIFICATE Ill v LIST OF TABLES Table 2.1 Primers for gene expression analyses using qPCR 63 Table 2.2 Primers used in the ChIP assay 70 Table 2.3 NF-KB-binding sites in the NAIP promoter and second intron 84 vi LIST OF FIGURES CHAPTER 1 Figure 1.1 Zonal anatomy of the prostate 3 Figure 1.2 Morphology of the prostatic duct 4 Figure 1.3 Functional domains of AR 7 Figure 1.4 Mechanism of androgen-dependent AR signalling 8 Figure 1.5 Gleason grading system 12 Figure 1.6 The progression of prostate cancer 13 Figure 1.7 The activation of the apoptotic pathway in response to androgen withdrawal 18 Figure 1.8 Domain structure of the mammalian IAP family 25 Figure 1.9 Intrinsic and extrinsic cell death pathways 26 Figure 1.10 Domain structure of the mammalian N F - K B family 29 Figure 1.11 N F - K B signal transduction pathways 30 CHAPTER 2 Figure 2.1 Differential expression levels of IAP genes in response to castration in the LNCaP hollow fibre model 72 Figure 2.2 Androgen inhibits expression of NAIP and the transcriptional activation of N F - K B 73 Figure 2.3 Differential expression and DNA-binding activity of N F - K B in CaP cells 76 Figure 2.4 Levels of NAIP and N F - K B protein in LNCaP tumours before and after castration of the hosts 77 Figure 2.5 Levels of NAIP and N F - K B protein in LNCaP cells from the LNCaP hollow fibre model before and after castration of the hosts 79 Figure 2.6 Levels of NAIP and N F - K B protein in LNCaP cells from the LNCaP hollow fibre model in procedural control mice 80 Figure 2.7 Increased DNA-binding activity of N F - K B in response to castration of the hosts 81 Figure 2.8 DNA-binding activity of N F - K B in procedural control mice 83 Figure 2.9 N F - K B is recruited to the regulatory elements in the NAIP locus 86 vm LIST OF ABBREVIATIONS ABC avidin: biotinylated enzyme complex ADT androgen deprivation therapy ANOVA analysis of variance AR androgen receptor ARE androgen response element Bcl-2 B cell lymphoma-2 BIR baculoviral IAP repeat bp base pair Brn-2 brain-2 BSA bovine serum albumin CARD caspase recruitment domain ChIP chromatin immunoprecipitation DRE digital rectal examination DHT dihydrotestosterone DMEM Dulbecco' s Modified Eagle' s Medium DU145 brain-derived metastatic prostate cancer cell line EMSA electrophoretic mobility shift assay FBS fetal bovine serum GAPDH glyceraldehyde-3-phosphate dehydrogenase GST glutathione-S-transferase HSP heat-shock protein IAP inhibitor of apoptosis protein IHC immunohistochemistry I K B inhibitor of K B IKK I K B kinase LNCaP lymph-node carcinoma of the prostate cell line NAIP neuronal apoptosis inhibitory protein NCoR nuclear receptor co-repressor NEMO nuclear factor-KB essential modulator N F - K B nuclear factor-KB NOD nucleotide-binding oligomerization domain NOD-SCID non-obese diabetes-severe combined immunodeficient PAX-2 DNA paired box-2 PBS phosphate buffered saline PC3 bone metastatic prostate cancer cell line PCR polymerase chain reaction PIA proliferative inflammatory atrophy PIN prostatic intra-epithelial neoplasia PSA prostate-specific antigen qPCR real-time quantitative PCR RING finger really interesting new gene zinc-finger RNAi RNA interference RPMI medium developed at Roswell Park Memorial Institute RT-PCR reverse transcription PCR S.C. subcutaneously SD standard deviation SDS-PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresis SFM serum-free medium SMA spinal muscular atrophy SRC-1 steroid receptor co-activator 1 TBE Tris-borate EDTA TBS Tris-buffered saline TE Tris-EDTA TNF-a tumor necrosis factor-a TNM tumour-node-metastasis UGE urogenital sinus epithelium UGM urogenital sinus mesenchyme UGS urogenital sinus X ACKNOWLEDGEMENTS There are many people I wish to thank for their support throughout the process of my research thesis. Firstly, I would like to thank my supervisor, Dr. Marianne Sadar, for giving me the invaluable opportunity to pursue my studies in her laboratory. Her patient guidance, constant support and continual encouragement have been paramount to my studies. Thanks to Rina Mawji who provided countless advices and shared her extensive knowledge about laboratory work. Thanks to Jean Wang and Gang Wang who contributed to the technical work of this thesis. My gratitude to all the members and alumni of the Prostate Group of the Genome Sciences Centre (Theresa L'Heureux, Teresa Tarn, Terence Yung, Tammy Romanuik, Dr. Steven Quayle, Dr. Richard Sobel, Nasrin Mawji, Mary Flores, Dr. Katie Meehan, Dr. Jae Kyung Myung, Heidi Hare, Dr. Barbara Comuzzi, Angela Beckett) for their assistance, insightful discussions, constructive feedbacks and moral support. It has been a pleasure working with such an incredible research team. Thank you to my committee members, Dr. Peggy Olive, Dr. Cheryl Helgason and Dr. David Walker for their insights and critical review of my thesis. My sincere thanks to Dr. Jaclyn Hung and Joanna Ip for opening the doors of cancer research to me at the B.C. Cancer Research Centre and the constant encouragement. Special thanks to a number of family members and friends who have given me much help and support during the challenging times in the course of this research experience. I am particularly indebted to my parents, Maria and David, and my younger sister, Vivian, for their unwavering love and support. Words cannot fully express how thankful I am. From the bottom of my heart, thank you all! DEDICATION To my parents xii CO-AUTHORSHIP STATEMENT CHAPTER 2 The experiments were designed, conducted and analyzed by myself, Helen Chiu, and my supervisor, Dr. Marianne Sadar. Additionally, Jean Wang co-authored and performed the experiments involving the animal work of the LNCaP hollow fibre model and the LNCaP xenograft model and immunohistochemistry described in the chapter. Dr. Marianne Sadar and I were responsible for the remainder of the manuscript preparation. 1 INTRODUCTION 1.1 PROSTATE CANCER 1.1.1 Epidemiology and the challenge Prostate cancer is the most common cancer affecting 0.8 % of the male population and the third leading cause of cancer death in Canadian men (1). According to the Canadian Cancer Statistics, it is estimated that 22,300 men will be diagnosed with prostate cancer and 4,300 men will die from the disease in 2007 (1). In the United States where prostate cancer is the second cancer killer in men, an estimated 218,890 new cases and 27,050 deaths will occur in 2007 due to the cancer (2). Intriguingly, about 30 % of men over the age of 50 who were not clinically diagnosed with prostate cancer had histological evidence of prostate cancer based on autopsy studies (3). Hence, most men who have prostate cancer will likely die with the cancer instead of dying from the disease. Prostate cancer primarily affects the elderly worldwide with three-quarters of cases occurring in men aged 65 years and older (4). The incidence and mortality of prostate cancer is the highest among African-American men (5,6). The disease prevails as a major male health problem in Western countries, whereas the incidence and mortality associated with the disease is intermediate among the European and South American countries and lowest in the Asian population (4). The risk factors contributing to the ethnic and geographic differences have yet to be identified and confirmed. Approximately 10 % of prostate cancer is associated with family history while most cases appear to be sporadic, and little is known about the aetiology of prostate cancer (7). Deciphering the molecular abnormalities in prostate cancer remains a very complex issue due to the heterogeneous and multifocal nature of the tumours (8,9). 1 1.1.2 The prostate Structure and function. The prostate is a tubuloalveolar exocrine gland of the male reproductive system that is posterior to the rectum and superior to the urinary bladder. It is roughly the shape and size of a walnut. The gland is penetrated by the urethra and the ejaculatory ducts. The prostate is defined into three major histologically distinctive glandular zones: peripheral (70—75 %), central (20—25 %) and transitional (5—10 %) zones (Fig. 1.1) (10,11). The main function of the adult prostate gland is to store and secrete a large number of compounds such as lipids, acid phosphatase, citric acid, kallikrein proteases and other proteolytic enzymes. The alkaline serous white fluid constitutes a major fraction of the seminal fluid that liquefies and nourishes sperms. The formation, synthesis and release of prostatic secretions are regulated by androgens, primarily dihydrotestosterone (DHT), the more potent form of testosterone. Mature prostatic duct is composed of distinct cell types: luminal secretory (columnar) epithelial cells, basal epithelial cells, stromal smooth muscle cells, some rare neuroendocrine cells and prostatic stem cell candidates (Fig. 1.2) (12). These cells express unique patterns of differentiation markers. For examples, the most common prostatic epithelial cells, the luminal secretory cells, express cytokeratin 8 and 18, the basal epithelial cells express markers such as cytokeratin 19, p63 and glutathione-S-transferase (GST)-pi, whereas the scarce neuroendocrine cells display chromogranin A and secrete products such as serotonin and neurophysin (13-16). Physiological development. The prostate begins to develop from the endodermal urogenital sinus (UGS) derived from the cloacae of the hindgut in human foetus. UGS consists of urogenital sinus epithelium (UGE) and the embryonic connective tissue, 2 [Figure removed for copyright reasons. Refer to figure legend for original source.] Figure 1.1. Zonal anatomy of the prostate. The prostate is divided into several anatomic regions. The regions with defined architecture are designated relative to the urethra as the reference point. Adapted from De Marzo et al., 2007 (17). [Figure removed for copyright reasons. Refer to figure legend for original source.] Figure 1.2. Morphology of the prostatic duct. A diagram of a cross-section of a prostatic duct illustrating the cell types present. The cell types found in the prostatic duct include luminal secretary epithelial cells, basal epithelial cells, stromal smooth muscle cells, neuroendocrine cells and stem cell candidates. A list of commonly used differentiation markers is labelled for each cell type. Adapted from Marker et al., 2003 (12) 4 urogenital sinus mesenchyme (UGM). During normal development, the process of differentiation and growth is tightly controlled and highly orchestrated by androgens and various growth factors. Mesenchymal-epithelial interactions are critical in prostatic development as interactions between UGE and UGM are required for the prostate to develop from UGS in the presence of androgens. Specifically, the UGM is responsible for the fate of the prostatic epithelium, formation and growth of epithelial buds, ductal morphogenesis, differentiation of secretory epithelium and expression of specific secretory proteins (reviewed in (18)). In turn, the differentiation of the UGM to surrounding smooth muscles of the epithelium is governed by the paracrine signals from UGE (19,20). The development of the prostate is completed by the end of puberty. The highly differentiated adult prostate is normally maintained at a growth-quiescent state. It is postulated that perturbations of the homeostatic interactions between epithelium and stromal smooth muscles leads to prostatic pathologies such as prostatic carcinoma (21). This hypothesis is supported by the observation that dysplastic epithelial sites in an in vivo prostatic carcinogenesis model are associated with dedifferentiation of adjacent stromal smooth muscle cells towards fibroblastic characteristics (22). Nevertheless, further decipherment in the molecular mechanisms involved in the stromal-epithelial interactions contributing to the carcinogenesis of prostate cancer is keenly awaited. Androgen signalling. Androgen signalling plays a pivotal role in the normal physiological development, growth and function of the prostate. The majority of androgens are secreted by Leydig cells of the testes, while a minor amount is synthesized by the adrenal cortex of the adrenal gland in men. The cytoplasmic enzyme 5a-reductase, primarily isoform type II, synthesizes DHT from circulating testosterone (23). 5 The effect of androgens is mediated through the steroid hormone receptor, androgen receptor (AR). The gene encoding AR is located on the X chromosome at Xql 1-12 (24). AR is a multi-domain protein containing an N-terminal domain that is involved in transcriptional activation, a DNA binding domain with two zinc finger motifs, a hinge region and a C-terminal ligand-binding domain (Fig. 1.3). The AR modulates androgen-regulated gene transcription (Fig. 1.4). In its inactive state, AR is mostly found in the cytoplasm stabilized by heat-shock proteins (HSP) (25). HSP-bound AR is inactive and cannot bind to regulatory elements on target genes. Androgen-binding induces dissociation from heat shock proteins, hyperphosphorylation, conformational changes and dimerization of the receptor (25-27). DHT has an affinity for the AR as much as 10 times higher than testosterone (28). Upon activation, the AR homodimers translocate to the nucleus where they bind to androgen response elements (ARE) in the androgen-regulated gene loci (29,30). Nevertheless, it is important to note that the naturally occurring AREs are generally unique from each other and distinct from the consensus ARE, 5'-GGA/TACANNNTGTTCT- 3' (where N = any nucleotide), as determined by Roche et al. (31) using in vitro biochemical assays. As a part of the transcriptional machineries, AR modulates the expression of target genes in conjunction with co-activators, such as steroid receptor co-activator 1 (SRC-1) (32), and co-repressors, such as nuclear receptor co-repressor (NCoR) (33). Interestingly, androgen-independent prostate cancer cells frequently retain the expression of AR. Specifically, AR has been implicated in androgen-independent prostate cancer as a result of hypersensitive AR due to gene amplification and/or mutations, constitutive activity of AR by non-androgenic molecules, constitutively active AR co-6 558 NH2 919 — COOH Figure 1.3. Functional domains of AR. Androgen receptor (AR) is a multi-domain transcription factor that consists of an N-terminal domain (NTD) that is involved in transcriptional activation, a DNA binding domain (DBD) with two zinc finger motifs, a hinge region and a C-terminal ligand-binding domain (LBD). 7 Figure 1.4. Mechanism of androgen-dependent AR signalling. Before binding to the AR, Testosterone (T) is transported and converted into dihydrotestosterone (DHT) by 5a-reductase in the cytoplasm. Binding of ligand promotes the release of AR from the heat-shock proteins (HSP) and phosphorylation of AR. Subsequently, the activated AR dimerizes, translocates into the nucleus, binds to androgen response element in the target gene locus and modulates the transcription of the target gene together with co-activators, such as steroid receptor co-activator 1 (SRC-1). 8 regulators or crosstalk of AR signalling with other signalling pathways (i.e. growth factors) (extensively reviewed in (34,35)). These observations strongly suggest that AR plays a significant role in prostate cancer progression to androgen independence. They also imply that therapy targeting any aspect of the mechanisms of AR action could treat both androgen-dependent and androgen-independent prostate cancer effectively. 1.1.3 De tec t i on a n d d iagnosis Detection and diagnosis of malignant cells that are clinically significant and require treatments is a constant challenge in the clinical setting. The digital rectal examination (DRE) combined with a blood test for serum prostate specific antigen (PSA) levels are the standard methods of detection for prostate cancer. Digital rectal examination. Prostate cancer typically arises in the peripheral zone (36). Since this part of the prostate lies in close proximity with the rectum, physicians may perform DRE by inserting a gloved finger inside the rectum to examine the part of the prostate that is closest to the rectal wall for any abnormal lump or nodule in the region. However, such an abnormality may or may not indicate the presence of prostate cancer. Moreover, for many cases, the DRE does not reveal abnormality that the doctor can palpate, because a tumour may be too small to be palpable or may locate in a part of the prostate that is inaccessible from the rectal area. Furthermore, DRE is not standardized and highly variable among physicians (37,38). Thus, a relatively more sensitive blood test for PSA is commonly employed in concert with DRE. PSA Test. PSA is the principle serum biomarker for prostate cancer since the early 1990s. The 33 kDa serine protease, first described in 1971 and purified in 1979, is normally secreted by the luminal epithelial cells of the prostate (39-41). The expression 9 of this human kallikrein family member located on chromosome 19 is regulated by AR (42). The primary function of PSA is to liquefy seminal coagulum in ejaculate through its proteolytic function (39). PSA measurement reflects prostate cancer risk, with the risk and aggressiveness of cancer increasing with the PSA level in the blood serum (43-45). After confirming its usefulness in a multi-institutional study, total PSA with a threshold of 4.0 ng/ml as the upper limit of "normal" is commonly adopted thereafter (46). Using PSA cut-off of 4.0 ng/ml, two groups (47,48) found that most prostate cancer patients with localized disease could have been diagnosed about 5 years earlier than their clinical diagnosis without PSA testing. Subsequently, PSA testing in conjunction with other diagnostic procedures was approved by the United States Food and Drug Administration for early detection of prostate cancer in 1994 (49). Prostatic biopsy and Gleason grade. Definitive diagnosis of prostate cancer requires a biopsy. A biopsy is an invasive procedure of removing prostate tissue with a needle. Multiple biopsies may be performed to remove multiple samples from different parts of the prostate. To enhance specificity and increase detection rate, additional biopsies may be taken as guided by transrectal ultrasound of the prostate (50). As a pathologist examines the prostate tissue from a biopsy for histological abnormalities, the Gleason score is assigned to help predict the behaviour of the cancer if it is indeed present (51). Grade ranges from 1 (the least aggressive) to 5 (the most aggressive histological pattern) are assigned to each of the two most prevalent foci in a biopsy (Fig. 1.5). The grades are added together to give a Gleason score. The scored histological patterns correlate with the clinical outcome of the patients: the higher the score, the higher the likelihood for the cancer to progress and spread (51,52). 10 Staging. In the diagnosis of prostate cancer, the cancer is staged according to the tumour-node-metastasis (TNM) system established in 1992 (53). The TNM system describes the extent of the cancer. Stage TI to T4 is designated to the primary tumour confined in the prostatic capsule and neighbouring seminal vesicles and bladder. Stage N is assigned to cancer metastasized to regional lymph nodes, whereas stage M is attributed to metastasis at distant sites, such as non-regional lymph nodes and bone. Together with other considerations, such as tumour grade, family history of prostate cancer and age of the patients, the staging allows the physicians to advise the appropriate treatment options to the patients. 1.1.4 Natural history Prostatic intra-epithelial neoplasia. The natural history of prostate cancer is reflected in its malignant potential, the extent to which the malignancy contributes to the progression and its response to treatment (Fig. 1.6). Early prostate cancer usually has no symptom and the carcinogenesis of prostate cancer remains ambiguous. Morphologically, prostatic epithelial lesion with disruption of the basal layer of acini appears to be a good indicator of early invasion. Based on the observations of the morphologic features in radical prostatectomy specimens, McNeal and Bostwick (54) proposed in 1986 that intraductal dysplasia or prostatic intra-epithelial neoplasia (PIN) is the precursor lesion that precedes invasive carcinoma. Specifically, early invasion of prostate cancer occurs frequently in association with foci of increasing grades of PIN with the loss of basal cell layer integrity (55). Proliferative inflammatory atrophy. More recently, it is postulated that prostate cancer may be driven by chronic inflammation in the prostate due to continuous injuries 11 [Figure removed for copyright reasons. Refer to figure legend for original source.] Figure 1.5. Gleason grading system. The Gleason grading is a system for classifying prostate cancer tissue by assigning a number (1-5) to the differentiation of the cells in the specimen when examined under a microscope. Grade 1: Circumscribed nodule of closely packed but separate, uniform, rounded to oval, medium-sized acini (larger glands than grade 3). Grade 2: Like grade 1, fairly circumscribed, yet at the edge of the tumour nodule, there may be minimal infiltration. Glands are more loosely aggregated and not quite as uniform as grade 1. Some glands infiltrate into surrounding stroma. Grade 3: Discrete glandular units; typically smaller glands than seen in grade 1 or 2; infiltrates in stroma; prominent variation in size and shape; smoothly circumscribed small cribriform nodules of tumour. Grade 4: Fused acinar glands; disruption and loss of gland units. Poorly differentiated. Grade 5: Total disruption and loss of gland units. No glandular differentiation, composed of solid sheets, cords, or single cells. Source: Epstein et al, 2006 (52) 12 Normal prostate High-grade PIN Localized CaP Metastatic CaP Androgen-i independent CaP F i g u r e 1.6. T h e p rogress ion o f p ros ta te cancer . The normal prostate progresses through a series of morphological and molecular changes forming proliferative inflammatory atrophy (PIA) and prostatic intra-epithelial lesion (PIN) followed by carcinoma of the prostate (CaP). Eventually, malignant cells gain the ability to metastasize to distant sites, such as lymph nodes and bone. The final stage of CaP occurs when cancer cells no longer require androgen to grow and survive. See text for the detailed discussion on the natural history of prostate cancer. 13 and insults in the prostate (17). The hypothesis stems from the earlier observations that prostatic focal atrophy, termed proliferative inflammatory atrophy (PIA), exhibited an increased expression of the proliferation marker, Ki-67, GST-pi and Bcl-2, indicating enhanced proliferation, stress-induced response and reduced apoptosis at the regenerative lesions respectively (56). The group further demonstrated that high-grade PIN, but not carcinoma, merged with PIA (57). These findings suggest that PIA may give rise to prostate cancer directly or indirectly via high-grade PIN. Like prostate cancer, both high-grade PIN and PIA are found predominantly in the peripheral zone (58-63). Whether PIA and PIN are causative in the evolution of prostate cancer remains a debateable topic; moreover, the exact mechanism by which PIA and PIN contribute to tumourigenesis awaits further investigation that may involve development of animal models which mimic the progression. Invasive and metastatic carcinoma. Accumulating somatic alterations and genetic instability may enable the malignant prostate tumours to undergo transforming proliferation and dedifferentiation and progress to invasive carcinoma (64,65). A pooled analysis from six non-randomized studies and a population-based study demonstrate that men with poorly differentiated prostate cancer had approximately 10-times higher risk of dying from the disease than those who had well-differentiated tumours with favourable clinical outcomes (66,67). Locally advanced prostate cancer refers to the disease that has started to invade nearby organs, such as the seminal vesicles and bladder without evidence of distant metastasis. At the terminally advanced stage, prostate cancer tends to metastasize to the lymph node and the bone of the patient. Mortality from prostate cancer is directly related to metastasis. Better understanding of the underlying molecular 14 mechanisms involved in the progression of prostate cancer will not only enable early detection and prevention but also improve the prognosis coupled with appropriate treatments for the patients. 1.1.5 T r e a t m e n t op t ions The decision on appropriate treatment strategy should be based on factors such as the staging of the tumour, the extent of the disease, the patient's life expectancy and requirements for the quality of life by weighing the benefits against the side effects of the therapeutic options. In most cases, prostate cancer is a chronic disease with slow progression; consequently, watchful waiting by monitoring the disease regularly without undergoing any immediate therapy may be considered for men with a low risk of dying from the cancer in their life-time to avoid harmful side effects of treatments. Localized therapies. Local prostate cancer is conventionally treated with radical prostatectomy and external-beam radiotherapy. Newer treatments include brachytherapy (reviewed in (68)) by implanting radioactive seeds into the prostate and cryotherapy (reviewed in (69)) by using pressurized gas-driven probes to destroy cancer cells with rapid freezing and thawing. Total PSA and its kinetic variations, such as PSA velocity and PSA doubling time (i.e. time to double the PSA level), may be used to monitor the effect of therapy. Failure of therapy is characterized by a biochemical recurrence based on a rising PSA level. For men undergoing local therapy, the serum PSA level should become undetectable after treatment. Thus, a subsequent increase in PSA is usually the earliest sign of cancer progression. Following radical prostatectomy for organ-confined prostate cancer, about 15% of men will develop biochemical failure that precedes clinical evidence of metastatic disease at a median of 8 years followed by a median of 5 years to 15 death (70). Androgen deprivation therapy (ADT) may be employed as neoadjuvant or adjuvant treatment in combination with all the treatment options described thus far to downsize the tumours and enable complete eradication of the cancer (reviewed in (71-73)). For instance, neoadjuvant androgen ablation prior to radiotherapy significantly minimized the neighbouring gastrointestinal and genitourinary tissue from exposure to high-dose radiation by reducing the field size (74). Systemic therapies. For the management of metastatic disease, the role of ADT is well-established since its inception more than 65 years ago by Huggins and Hodges (75). A population study based on the Surveillance, Epidemiology and End Results (SEER)-and Medicare-linked database with 6,098 men 65 years and older concludes that the median survival for men with metastatic cancer was 26 months after androgen deprivation therapy, approximately 13 months more than those who were untreated (76). ADT may be performed by surgical castration with orchiectomy to remove testicles or chemical castration with drugs that suppress testosterone production or its effects. Bilateral orchiectomy is permanent and irreversible. Medical castration may be achieved with luteinizing hormone-releasing hormone agonists, steroidal and non-steroidal antiandrogens and inhibitors of steroid synthesis such as ketoconazole that inhibits cytochrome P450 enzymes in adrenal cells (77). Both orchiectomy and luteinizing hormone-releasing hormone agonists have an adverse effect on bone mass causing osteoporosis as a result of long-term androgen deprivation (78-80). The rationale for ADT is based on the dependency of prostate cells on androgens to grow and survive. The series of events immediately following castration are well-characterized in rat and collectively contribute to the programmed cell death of the 16 prostate cells (reviewed in (81); Fig. 1.7). Briefly, upon castration, the serum testosterone levels rapidly decline and a dramatic response in prostate cells frequently occurs within 24 hours after castration. At the molecular level, castration induces changes in the expression of a wide range of genes in addition to androgen-responsive genes, giving rise to the systemic biochemical and morphological changes in the hosts. ADT may thereby upset the intricate cellular pathways in the prostate cells by affecting the expression of a wide catalogue of genes involved in AR-dependent and AR-independent prostate cancer progression (82). As an early event after castration, the fragmentation of genomic DNA is catalyzed by calcium magnesium-dependent endonuclease activity (83). Castration also induces apoptosis and degeneration of capillaries and constriction of larger blood vessels in the prostate (84). Hence, with the dramatic changes in gene expression, induction of genomic instability and reduction of blood flow, the homeostasis in prostate cells is disrupted by ADT in a highly complex manner. Eventually, the responses to ADT will lead to the rapid apoptotic involution of prostatic tissue due to a major irreversible loss of prostatic epithelial cells (85). Despite initial effectiveness in eliminating non-cancerous and cancerous prostate cells, the major disadvantage of ADT is that eventually some prostate cancer cells will become resistant to the loss of androgen. The androgen-independent prostate cancer cells will begin to proliferate and grow despite the absence of androgen as reflected in increasing PSA levels subsequent to treatment. Relapsed disease after primary treatment with surgery or hormonal therapy is referred to as hormone-escaped, therapy-resistant, hormone-refractory, recurrent or androgen-independent; the latter term will be used in this thesis. 17 [Figure removed for copyright reasons. Refer to figure legend for original source.] Figure 1.7. The activation of the apoptotic pathway in response to androgen withdrawal. A schematic summary of the biochemical and morphological events in prostate cells following androgen withdrawal. While the epigenetic reprogramming of cells is reversible at the initiation of the cascade, prolonged androgen deprivation results in the irreversible steps leading to induced apoptotic death of the prostate cells. See text for details. ODC, ornithine decarboxylase; CDK-2, cyclin-dependent kinase-2; TFG, transforming growth factor; TRPM-2, testosterone-repressed prostate message-2; PARP, poly-(ADP-ribose) polymerase. Source: Denmeade et al., 1996 (81) 18 It appears that androgen ablation fails to initiate the programmed cell death pathway in a subset of androgen-independent cells. Possible mechanisms for this failure could involve increased expression of genes associated with enhanced cellular survival or decreased expression of genes that are involved in triggering apoptosis. Evidences with the expression of Bcl-2, an anti-apoptotic oncoprotein, correlate with disease state, particularly with an augmented expression at the androgen-independent state (86,87). Moreover, Lin et al. (88) demonstrated in the classical prostate cancer cell line model, LNCaP, that the anti-apoptotic ability of Bcl-2 is required for the progression from an androgen-dependent to an androgen-independent state. Nevertheless, it is unclear how the increased expression occurs and if it is an absolute requirement for the progression of prostate cancer. Furthermore, multiple mechanisms may be involved in conferring anti-apoptotic ability to prostate cancer cells and enhance their survival to progress to androgen-independence. Intermittent ADT was introduced recently aiming to delay androgen-independent outgrowth, improve the patients' quality of life and minimize the long-term complications associated with androgen deprivation such as osteoporosis (reviewed in (89)). Briefly, with constant monitoring of PSA levels, the modified ADT involves cyclic administration of androgen deprivation by chemical castration until a clinical response is demonstrated and followed by an off-therapy interval until symptoms recurred. Intermittent ADT is considered experimental with anticipation of the results from long-term randomized clinical trials to determine whether it will produce any survival advantage (90). Androgen-independent disease causes death. Unfortunately, besides palliation 19 with chemotherapy, there is no known cure for androgen-independent prostate cancer, and the cellular mechanisms associated with the hormonal progression remain elusive. Nevertheless, like many other cancers, the current strategic trend is geared towards identifying specific cellular targets involved, so that novel non-surgical, non-invasive, personalized adjuvant treatment options may be developed for the disease. 1.2 MODELS FOR STUDYING THE HORMONAL PROGRESSION OF PROSTATE CANCER In vitro models. A variety of human prostate cell lines have been derived from primary tissue sources, and clonal derivatives of previously established lines have been developed for investigating various aspects of prostate cancer using in vitro and in vivo model systems (91,92). To better understand the effect of androgen on the progression of prostate cancer, in vitro human prostate cancer cell lines with different androgen requirements and origins in the disease state may be employed selectively for independent experiments. LNCaP is the classic prostate cancer cell line derived from a supraclavicular lymph node of a patient whose prostate cancer was exhibiting androgen-independent growth and this cell line retains PSA expression and androgen sensitivity (93). LNCaP cells express a mutated AR (T877A) that is functional but can be activated by not only androgens but also other steroids, such as progesterone, estradiol and anti-androgens (94). Androgens increase the levels of PSA mRNA, and attenuate the levels of prostatic acid phosphatase mRNA, another major prostate-specific protein (95). In contrast to LNCaP cells, DU145 cells and PC3 cells are two widely used androgen-insensitive cell lines that do not express AR or PSA. DU145 cells (96) were derived from a brain metastasis from an untreated prostate cancer patient with a history of leukemia, 20 whereas PC3 cells (97) were established from bone metastasis of a patient with androgen-independent prostate cancer. In vivo models. Murine models that mimic the progressive biochemical features of prostate cancer have been developed using human prostate cancer lines to facilitate our understanding of the hormonal progression of prostate cancer at the molecular level. Xenograft models are commonly employed to investigate various aspects of the hormonal progression of prostate cancer. Prostate cancer cell suspensions consisting of LNCaP cells can be grafted subcutaneously or intraprostatically in male nude mice or male severe combined immunodeficient (SCID) mice to generate tumours (98,99). To stimulate androgen deprivation, surgical castration is performed on the hosts. In parallel to the clinical representation, LNCaP xenograft mimics the hormonal progression from androgen-sensitive to androgen-independence as monitored by the host's serum PSA level that correlates with tumour volume (100). Tumours may be harvested from the host at various stages of the hormonal progression to androgen independence. Interestingly, LNCaP xenografted tumours were not accompanied by reduction in tumour volume upon castration (100). DU145 cells and PC3 cells can also be used in xenografts; in fact, these poorly differentiated cells exhibit a higher malignant potential than LNCaP cells in xenografts. In addition to xenografts developed from human prostate cancer cell lines, several xenograft models have been developed from primary human prostate tumour tissues from prostate cancer patients grafted subcutaneously in nude or SCID mice in the past years (101-105). Similar to LNCaP, CWR22 tumour expressed a mutated AR (H874Y) that can be activated by adrenal androgen dehydroepiandroesterone, estradiol, progesterone and 21 the antiandrogen hydroxyflutamide (106). Like LNCaP xenografts, some of these xenografts of primary tumours, such as CWR22 (107,108), PC-346 (102) LuCaP 23 (104), LAPC-4 (103), LuCaP 35 (105) are androgen-sensitive with PSA expression, respond to castration to varying extents and relapse in an androgen-independent manner, though generally at a slower rate and are more challenging to establish initially as compared to the LNCaP xenografts. All xenograft models allow stromal-microenvironment interactions which are suggested to play a critical role in the pathogenesis and progression of prostate cancer (109). However, tumour cells from xenograft systems are highly vascularised and thus infiltrated with host cells, impeding them from providing pure samples for subsequent molecular analyses. To circumvent the contamination by host cells associated with xenograft models, the in vivo LNCaP hollow fibre model was developed by Sadar et al. (110). This model enables retrieval of "pure" populations of prostate cancer cells devoid of host cells during various stages of the hormonal progression from androgen-sensitive to androgen-independence upon castration as monitored by serum PSA levels in male immunocompromised mice. Briefly, suspensions of LNCaP cells in matrigel are loaded into porous polyvinylidene difluoride hollow fibres with a molecular weight cut-off of 500 kDa (i.e. approximately 20 nm in pore size) that permit efficient exchange of soluble factors and provide attachment support. The ends of the fibre are sealed prior to subcutaneous implantation of the fibres into the back of the mice. Androgen deprivation is achieved by surgical castration of the hosts. Subsequent to castration, the prostate cancer cells will progress in a manner that involves an initial regression in levels of serum PSA prior to an upsurge of serum PSA in the host. The animals bearing the hollow 22 fibres of LNCaP cells are generally healthy as indicated by weight and behaviour. While xenograft models require sacrificing different animals for each time-point along the hormonal progression, the hollow fibre model is ideal for obtaining matched in vivo prostate cancer cells from the same animals at each time-point throughout the course of the experiment, as packages of prostate cancer cells in hollow fibres may be retrieved from the same hosts at the desired time-points. Both the LNCaP xenograft model and LNCaP hollow fibre model mirror the clinical progression of prostate cancer in response to androgen ablation therapy, and both in vivo models permit the use of serum PSA to monitor hormonal progression. Potentials of these models are yet to be realized. Unexplored manipulation of the host, such as medical castration, may be performed in these in vivo models to investigate other aspects in the hormonal progression to androgen-independence. To investigate the molecular mechanisms underlying the hormonal progression of prostate cancer, the hollow fibre model could also be optimized to provide suitable in vivo sources for various biochemical applications, such as co-immunoprecipitation and chromatin irnmunoprecipitation assays. In this study, a protocol has been established to isolate biologically active nuclear extracts from the LNCaP hollow fibre model for DNA-binding assays to investigate changes in transcriptional activity in response to androgen deprivation by surgical castration of the host. 1.3 INHIBITOR OF APOPTOSIS PROTEINS The newly identified inhibitors of apoptosis proteins (IAPs) family plays a role of apoptotic resistance in prostate cancer. IAPs protect cells from apoptosis induced from a variety of stimuli primarily by direct interactions with caspases, a class of cystein-23 aspartyl proteases that are fundamental for most of the properties of apoptotic cell death, though other mechanisms have also been described. Homologues of IAPs have been identified from a variety of life forms from viruses to vertebrates. The first mammalian IAP, neuronal apoptosis inhibitory protein (NAIP/BIRC1) was identified by positional cloning in an effort to determine the genetic defect in spinal muscular atrophy by positional cloning (111). Deletions in the gene encoding NAIP are associated with the severity of the disease due to the loss of neuroprotective activity in suppressing apoptosis (112). Subsequently, seven human IAPs identified so far include c-IAPl (BIRC2/HIAP2), C-IAP2 (BIRC3/HIAP1) (113), XIAP (BIRC4) (112), survivin (BIRC5) (114), apollon (BIRC6) (115), livin (BIRC7/KIAP/ML-IAP) (116) and IAP-like protein-2 (BIRC8/ILP-2) (117). All family members are characterized by one or more 70-80 cysteine- and histidine-rich baculoviral IAP repeat (BIR) domains, consisting of core variable sequence C(X)2C(X)6W(X)3D(X)5H(X)6C (X = any amino acid) (Fig. 1.8). The BIR domains, which directly interact with caspases and other proteins, are central to the ability of IAP to block apoptosis. As the only known intrinsic regulators of the caspase cascade that modulate the activity of both initiator and effector caspases, IAPs can block apoptotic cell death triggered via the intrinsic or the extrinsic death pathways through caspase inhibition, among other mechanisms (Fig. 1.9) (118). Most IAPs have demonstrated direct binding to and inhibited activated caspase-3 and capase-7, the effector caspases of both the intrinsic and extrinsic pathways (119). Additionally, all IAPs, except survivin, directly interact with and inhibit caspase-9, the initiator caspase of the intrinsic pathway (119,120). It seems to be a general rule that the first two BIR domains are associated with 24 survivin 142 apolion livin ILP-2 4829 .298 236 BIR domain RING finger CARD Figure 1.8. Domain structure of the mammalian IAP family. IAP members typically contain one to three N-terminal baculovirus IAP repeat (BIR) domains. RING finger, really interesting new gene zinc-finger; CARD, caspase recruitment domain; NOD, nucleotide-binding oligomerization domain; LRR, leucine-rich repeats; UBC domain, ubiquitin-conjugating domain. Adapted from Hunter et al, 2007 (118). 25 Figure 1.9. Intrinsic and extrinsic cell death pathways. The intrinsic pathway triggered by various forms of stress results in the release of mitochondrial proteins, such as cytochrome c. In the cytoplasm, cytochrome c interacts with the apoptotic protease activating factor 1 (Apaf-1) and ATP to form the apoptosome with procaspase-9. The apoptosome binds and activates caspase-9 which then recruits the effector caspases, such as caspase-3 and caspase-7. The extrinsic pathway involves binding of death signals, such as tumour necrosis factor (TNF) and Fas ligand, to their corresponding cell surface death receptors, such as TNF receptor and Fas receptor. Recruitment of adaptor proteins to the intracellular death domains of the death receptors leads to procaspase-8 activation and subsequent activation of effector caspases. Activation of the effector caspases leads to a series of proteolytic events which result in the disintegration of the cell. IAPs can effectively inhibit the initiator and effector caspases and other components involved in both intrinsic and extrinsic pathways. Adapted from Hunter et al., 2007 (118) 26 direct binding and inhibition of capase-3 and caspase-7, whereas the third BIR domain is attributed to the inhibition of caspase-9 (121-126). Certain IAPs, such as XIAP, c-IAPl, C-IAP2 and livin, also possess RING domains with E3 ubiquitin ligase activity to target their substrates for ubiquitinylation and subsequent proteosomal degradation (Fig. 1.8) (127). Additional functional domains, such as caspase recruitment domain (CARD) and nucleotide-binding oligomerization domain (NOD), confer uniqueness to individual IAP members with distinct structures and functions that are yet to be confirmed (Fig. 1.8). With their pivotal roles in regulating apoptosis, it is not surprising that the deregulation of IAPs is associated with various malignancies, suggesting the idea that IAPs may facilitate escape of cancer cells from apoptosis (extensively reviewed in (118)). Emerging studies on the expression and relevance of IAPs highlight their roles in the prognosis of prostate cancer. Elevated expression of c-IAPl, C-IAP2, XI AP and survivin has been shown by immunochemistry and immunoblotting in a transgenic mouse model of prostate cancer and prostatectomy specimens from cancer patients (128). Furthermore, the increased IAP expression appears to be an early event in the development of prostate cancer (128). Specifically, survivin is associated with resistance to cell death in response to anti-androgen therapy and chemotherapy in prostate cancer cells, as a double negative survivin mutant tends to sensitize the cells to death induced by flutamide and paclitaxel in vitro and in vivo respectively (129,130). Similarly, a pre-clinical study demonstrated that an antisense oligonucleotide directed towards XIAP in the prostate cancer xenograft model appears to lower the apoptotic threshold to taxanes in a dose-dependent manner (131). Hence, elucidation of the mechanism by which IAPs protect prostate cancer cells from dying by induced cell death will be invaluable for the development of novel 27 therapeutic strategies to prevent the progression to androgen-independence. 1.4 NUCLEAR FACTOR-KB The nuclear factor (NF)-KB is a family of ubiquitously expressed dimeric transcription factors that modulate a multitude of immune and inflammatory responses as well as cell proliferation, differentiation, apoptosis, adhesion, survival and oncogenesis (reviewed in (132,133) ). The mammalian N F - K B family is comprised of five members: p65/RelA, RelB, c-Rel, p50/pl05/NF-KBl, p52/pl00/NF-KB2 (reviewed in (133)). These proteins share a Rel homology domain that mediates DNA-binding, dimerization and specific interactions with inhibitor of KB (IKB) (Fig. 1.10) (134-136). Dormant N F - K B is bound by IKB and is retained primarily in the cytoplasm (137). A variety of stimuli, such as cytokines (e.g. tumour necrosis factor-a (TNF-a), interleukins), viral infection and intracellular stresses, activate N F - K B mainly through the canonical pathway that involves the phosphorylation of the IKB kinase (IKK) complex, which consists of the catalytic subunits (IKK-a and IKK-p) and the regulatory component (IKK-y/ NEMO), and subsequent ubiquitylation and proteosomal degradation of IKB (Fig. 1.11) (138-140). An alternative signalling pathway of N F - K B involves the activation of p52/RelB dimers as a result of the processing of the pi 00 precursor protein, which mostly associates with RelB as a heterodimer in the cytoplasm (Fig. 1.10) (141). The liberated N F - K B dimers are then activated to translocate to the nucleus and bind to regulatory KB elements of a diverse array of target genes (142,143). Different N F - K B dimers exhibit different binding affinities for the KB site, bearing the consensus sequence 5'-GGGRNNYYCC-3' [R = purine, N = any base, Y = pyrimidine] (144). Constitutive activation of N F - K B has been attributed to the aggressiveness of 28 p 6 5 -RelB -557 c-Rel H 619 p100/52 -I II III I • • • • • • • M B 898 I I I I I I I p105/50 -433 969 RHD T A D LZD m i A n k y r i n repea ts i G R R Figure 1.10. Domain structure of the mammalian N F - K B family. All N F - K B members contain an N-terminal Rel homology domain (RHD) that is important for DNA-binding, dimerization and nuclear localization. p65, RelB and c-Rel have C-terminal transactivation domains (TAD). Additionally, RelB has a leucine-zipper domain (LZD). pi00 and pi05 contain glycine-rich regions (GRR) and C-terminal domains with ankyrin repeats which block DNA-binding in the native protein. Adapted from Hayden and Ghosh, 2004(133). 29 canonical alternative pathway pathway /—\ i—» MM MM t proliferation Figure 1.11. N F - K B signal transduction pathways. In the classical pathway, N F - K B dimers, such as p65/p50 heterodimers, are maintained in the cytoplasm by interaction with inhibitor of K B ( I K B ) . Ligand-activation of cell surface receptors leads to activation of the I K B kinase (IKK) complex containing the catalytic subunits, IKK-a and IKK-p, and the regulatory subunit, IKK-y. IKK complex then phosphorylates I K B at two serine residues, leading to the phosphorylation, ubiquitinylation and proteosomal degradation of the inhibitors. Dissociation from I K B allows the N F - K B dimers to enter the nucleus to modulate the transcription of target genes. The alternative pathway involves activation of an IKK complex that contains two IKK-a subunits. The IKK complex phosphorylates two serine residues on pi00, leading to its partial processing at the C-terminal. The resulting p52/RelB heterodimer then translocates to regulate the transcription of target genes. The two pathways are involved in different cellular functions by modulating the expression of distinct sets of genes. Adapted from Karin and Greten, 2005 (145). 30 prostate cancer. In a recent immunohistochemical evaluation of prostatectomy specimens, elevated N F - K B immunoreactivity directly relates to the tumour stage, tumour grade and biochemical relapse (146,147). Crosstalk has been described between N F - K B and AR signalling pathways. Mutual antagonistic effects of N F - K B and AR were demonstrated in transient transfections of N F - K B and AR in COS-1 cells (148). Furthermore, the p65 subunit was able to inhibit AR-mediated transactivation at the PSA promoter in LNCaP cells (149). In contrast, Suh et al. (150) demonstrated that transient transfection of AR in the AR-negative PC3 cells and DU145 cells induced NF-KB-dependent transcriptional activity, even though the stimulation was blunted in the presence of ligand. It also appears that the survival signalling of androgen may be attributed to increased N F - K B DNA-binding activity in response to treatment with ligand (151). Although different experimental conditions may contribute to these contradictory data, the pleomorphic relationship between N F - K B and AR remains to be clarified. Importantly, the oncogenic role of N F - K B lies in its ability to modulate anti-apoptotic gene targets (132). The anti-apoptotic activity of N F - K B in prostate cancer cells has been attributed to its ability to transcriptionally up-regulate Bcl-2 expression through binding to a site in the promoter region of the gene (152). Bcl-2 appears to confer resistance to apoptosis in prostate cancer cells from androgen ablation and radiotherapy (153-155). Moreover, the expression of Bcl-2 is required for the hormonal progression of prostate cancer cells to androgen-independence (88). More recently, the expression of IAPs have also been attributed to the anti-apoptotic activity of N F - K B . N F - K B signalling induces the expression of c-IAPl, c-IAPl and XIAP (156). The expression of C-IAP2 and survivin are confirmed to be directly regulated by N F - K B through binding on the 31 regulatory elements of the genes (157,158). Consistently, IKK inhibitor inhibited C-IAP2 expression and sensitized prostate cancer cells to apoptosis induced by TNF-a (159). In turn, the TNF-a -induced transcriptional activity of N F - K B can be regulated by C-IAP2 involving its C-terminal RING domain in a possible positive feedback mechanism (160). As the anti-apoptotic role of N F - K B in the progression of prostate cancer is being further discerned, insights into the mechanisms will enable intervention to breakdown the NF-KB-dependent anti-apoptotic barrier. 1.5 RESEARCH OBJECTIVES AND HYPOTHESIS 1.5.1 Objectives and hypothesis Androgen deprivation therapy by medical or surgical castration is the cornerstone treatment for advanced prostate cancer. The rationale for this systemic therapy is that prostate cancers cell will die in response to decreased circulating androgen. Nevertheless, despite the initial effectiveness of this treatment, the patients will inevitably succumb as the cancer recurs in an androgen-independent manner. The mechanism(s) by which prostate cancer cells escape the apoptotic fate in androgen-deprived conditions are poorly understood. Recent findings suggest that IAPs and constitutive N F - K B enable cancer cells to resist induced apoptosis. Furthermore, the transcription of some IAPs can be directly regulated by N F - K B , a transcription factor which constitutive activity has been implicated in prostate cancer. It is the goals of this thesis to investigate the expression of IAPs in prostate cancer cells in response to androgen deprivation and to determine if the anti-apoptotic role of N F - K B is involved in the expression of IAPs through transcriptional regulation. The hypothesis of this thesis is that the expression of IAPs involves the transcriptional regulation by N F - K B in response to androgen deprivation in prostate 32 cancer cells. 1.5.2 Speci f ic a ims 1. To identify which IAPs are increasingly expressed in response to castration by employing the in vivo LNCaP hollow fibre model. This work will identify IAPs that may be responsible for enhancing the anti-apoptotic ability in some prostate cancer cells in response to androgen deprivation and determine a candidate IAP for further study on its transcriptional regulation. 2. To determine the effect on N F - K B activity in response to castration by employing the in vivo LNCaP hollow fibre model. This work will highlight the effect of androgen ablation on N F - K B activity. 3. To investigate the effect of androgen on the expression of the candidate IAP and N F - K B transcriptional activity in vitro. This aim will confirm if the expression of the candidate IAP and N F - K B transcriptional activity are similarly affected by androgen. 4. To decipher the molecular mechanism by which the expression of the candidate IAP may be regulated by N F - K B . Work towards this aim will provide insight into a potential mechanism by which prostate cancer cells may bypass apoptosis in the loss of androgen. 33 1.6 REFERENCES 1. Canadian Cancer Society, National Cancer Institute of Canada, Statistics Canada, Provincial/ Territorial Cancer Registries and Public Health Agency of Canada. (2007). Canadian Cancer Statistics. 2. American Cancer Society. (2007). Cancer Facts & Figures. 3. Scardino, P.T. (1989) Early detection of prostate cancer. Urol Clin North Am, 16, 635-655. 4. Quinn, M. and Babb, P. (2002) Patterns and trends in prostate cancer incidence, survival, prevalence and mortality. Part I: international comparisons. BJUInt, 90, 162-173. 5. Gronberg, H. (2003) Prostate cancer epidemiology. Lancet, 361, 859-864. 6. Powell, I.J. (2007) Epidemiology and pathophysiology of prostate cancer in African-American men. J Urol, 111, 444-449. 7. Whittemore, A.S., Wu, A.H., Kolonel, L.N., John, E.M., Gallagher, R.P., Howe, G.R., West, D.W., Teh, C.Z. and Stamey, T. (1995) Family history and prostate cancer risk in black, white, and Asian men in the United States and Canada. Am J Epidemiol, 141, 732-740. 8. Konishi, N., Shimada, K., Ishida, E. and Nakamura, M. (2005) Molecular pathology of prostate cancer. Pathol Int, 55, 531-539. 9. Ruijter, E., van de Kaa, C, Miller, G., Ruiter, D., Debruyne, F. and Schalken, J. (1999) Molecular genetics and epidemiology of prostate carcinoma. Endocr Rev, 20, 22-45. 10. McNeal, J.E. (1981) The zonal anatomy of the prostate. Prostate, 2, 35-49. 34 11. McNeal, J.E. (1968) Regional morphology and pathology of the prostate. Am J Clin Pathol, 49, 347-357. 12. Marker, P.C, Donjacour, A.A., Dahiya, R. and Cunha, G.R. (2003) Hormonal, cellular, and molecular control of prostatic development. Dev Biol, 253, 165-174. 13. Wang, Y., Hayward, S., Cao, M., Thayer, K. and Cunha, G. (2001) Cell differentiation lineage in the prostate. Differentiation, 68, 270-279. 14. di SantAgnese, P.A. and de Mesy Jensen, K.L. (1987) Neuroendocrine differentiation in prostatic carcinoma. Hum Pathol, 18, 849-856. 15. Turbat-Herrera, E.A., Herrera, G.A., Gore, I., Lott, R.L., Grizzle, W.E. and Bonnin, J.M. (1988) Neuroendocrine differentiation in prostatic carcinomas. A retrospective autopsy study. Arch Pathol Lab Med, 112, 1100-1105. 16. Sherwood, E.R., Theyer, G., Steiner, G., Berg, L.A., Kozlowski, J.M. and Lee, C. (1991) Differential expression of specific cytokeratin polypeptides in the basal and luminal epithelia of the human prostate. Prostate, 18, 303-314. 17. De Marzo, A.M., Platz, E.A., Sutcliffe, S., Xu, J., Gronberg, H., Drake, C.G., Nakai, Y., Isaacs, W.B. and Nelson, W.G. (2007) Inflammation in prostate carcinogenesis. Nat Rev Cancer, 7, 256-269. 18. Cunha, G.R., Ricke, W., Thomson, A., Marker, P.C, Risbridger, G., Hayward, S.W., Wang, Y.Z., Donjacour, A.A. and Kurita, T. (2004) Hormonal, cellular, and molecular regulation of normal and neoplastic prostatic development. J Steroid Biochem Mol Biol, 92, 221-236. 19. Hayward, S.W., Haughney, P.C, Rosen, M.A., Greulich, K.M., Weier, H.U., Dahiya, R. and Cunha, G.R. (1998) Interactions between adult human prostatic 35 epithelium and rat urogenital sinus mesenchyme in a tissue recombination model. Differentiation, 63, 131-140. 20. Cunha, G.R., Battle, E., Young, P., Brody, J., Donjacour, A., Hayashi, N. and Kinbara, H. (1992) Role of epithelial-mesenchymal interactions in the differentiation and spatial organization of visceral smooth muscle. Epithelial Cell Biol, 1, 76-83. 21. Cunha, G.R., Hayward, S.W., Wang, Y.Z. and Ricke, W.A. (2003) Role of the stromal microenvironment in carcinogenesis of the prostate. Int J Cancer, 107, 1-10. 22. Wong, Y.C. and Tarn, N.N. (2002) Dedifferentiation of stromal smooth muscle as a factor in prostate carcinogenesis. Differentiation, 70, 633-645. 23. Russell, D.W. and Wilson, J.D. (1994) Steroid 5 alpha-reductase: two genes/two enzymes. Annu Rev Biochem, 63, 25-61. 24. Brown, C.J., Goss, S.J., Lubahn, D.B., Joseph, D.R., Wilson, E.M., French, F.S. and Willard, H.F. (1989) Androgen receptor locus on the human X chromosome: regional localization to Xql 1-12 and description of a DNA polymorphism. Am J Hum Genet, 44, 264-269. 25. Veldscholte, J., Berrevoets, C.A., Zegers, N.D., van der Kwast, T.H., Grootegoed, J.A. and Mulder, E. (1992) Hormone-induced dissociation of the androgen receptor-heat-shock protein complex: use of a new monoclonal antibody to distinguish transformed from nontransformed receptors. Biochemistry, 31, 7422-7430. 26. Wong, C.L, Zhou, Z.X., Sar, M. and Wilson, E.M. (1993) Steroid requirement for 36 androgen receptor dimerization and DNA binding. Modulation by intramolecular interactions between the NH2-terminal and steroid-binding domains. J Biol Chem, 268, 19004-19012. 27. Kuil, C.W., Berrevoets, CA. and Mulder, E. (1995) Ligand-induced conformational alterations of the androgen receptor analyzed by limited trypsinization. Studies on the mechanism of antiandrogen action. J Biol Chem, 270, 27569-27576. 28. Deslypere, J.P., Young, M., Wilson, J.D. and McPhaul, M.J. (1992) Testosterone and 5 alpha-dihydrotestosterone interact differently with the androgen receptor to enhance transcription of the MMTV-CAT reporter gene. Mol Cell Endocrinol, 88, 15-22. 29. Ham, J., Thomson, A., Needham, M., Webb, P. and Parker, M. (1988) Characterization of response elements for androgens, glucocorticoids and progestins in mouse mammary tumour virus. Nucleic Acids Res, 16, 5263-5276. 30. Georget, V., Lobaccaro, J.M., Terouanne, B., Mangeat, P., Nicolas, J.C. and Sultan, C. (1997) Trafficking of the androgen receptor in living cells with fused green fluorescent protein-androgen receptor. Mol Cell Endocrinol, 129, 17-26. 31. Roche, P.J., Hoare, S.A. and Parker, M.G. (1992) A consensus DNA-binding site for the androgen receptor. Mol Endocrinol, 6, 2229-2235. 32. Ma, H., Hong, H., Huang, S.M., Irvine, R.A., Webb, P., Kushner, P.J., Coetzee, G.A. and Stallcup, M.R. (1999) Multiple signal input and output domains of the 160-kilodalton nuclear receptor coactivator proteins. Mol Cell Biol, 19, 6164-6173. 37 33. Cheng, S., Brzostek, S., Lee, S.R., Hollenberg, A.N. and Balk, S.P. (2002) Inhibition of the dihydrotestosterone-activated androgen receptor by nuclear receptor corepressor. Mol Endocrinol, 16, 1492-1501. 34. Feldman, B.J. and Feldman, D. (2001) The development of androgen-independent prostate cancer. Nat Rev Cancer, 1, 34-45. 35. Heinlein, CA. and Chang, C. (2004) Androgen receptor in prostate cancer. Endocr Rev, 25, 276-308. 36. McNeal, J.E., Redwine, E.A., Freiha, F.S. and Stamey, T.A. (1988) Zonal distribution of prostatic adenocarcinoma. Correlation with histologic pattern and direction of spread. Am J Surg Pathol, 12, 897-906. 37. Andriole, G.L., Levin, D.L., Crawford, E.D., Gelmann, E.P., Pinsky, P.F., Chia, D., Kramer, B.S., Reding, D., Church, T.R., Grubb, R.L. et al. (2005) Prostate Cancer Screening in the Prostate, Lung, Colorectal and Ovarian (PLCO) Cancer Screening Trial: findings from the initial screening round of a randomized trial. J Natl Cancer Inst, 97, 433-438. 38. Schroder, F.H., van der Maas, P., Beemsterboer, P., Kruger, A.B., Hoedemaeker, R., Rietbergen, J. and Kranse, R. (1998) Evaluation of the digital rectal examination as a screening test for prostate cancer. Rotterdam section of the European Randomized Study of Screening for Prostate Cancer. J Natl Cancer Inst, 90,1817-1823. 39. Lilja, H. (1985) A kallikrein-like serine protease in prostatic fluid cleaves the predominant seminal vesicle protein. J Clin Invest, 76, 1899-1903. 40. Wang, M.C., Valenzuela, L.A., Murphy, G.P. and Chu, T.M. (1979) Purification 38 of a human prostate specific antigen. Invest Urol, 17, 159-163. 41. Hara, M., Koyanagi, Y., Inoue, T. and Fukuyama, T. (1971) Some physico-chemical characteristics of "y-seminoprotein", an antigenic component specific for human seminal plasma. Forensic immunological study of body fluids and secretion. VII. Nihon Hoigaku Zasshi = The Japanese journal of legal medicine, 25, 322-324. 42. Riegman, P.H., Vlietstra, R.J., Klaassen, P., van der Korput, J.A., Geurts van Kessel, A., Romijn, J.C. and Trapman, J. (1989) The prostate-specific antigen gene and the human glandular kallikrein-1 gene are tandemly located on chromosome 19. FEBS Lett, 247, 123-126. 43. Wang, M.C, Papsidero, L.D., Kuriyama, M., Valenzuela, L.A., Murphy, G.P. and Chu, T.M. (1981) Prostate antigen: a new potential marker for prostatic cancer. Prostate, 2, 89-96. 44. Stamey, T.A., Yang, N., Hay, A.R., McNeal, J.E., Freiha, F.S. and Redwine, E. (1987) Prostate-specific antigen as a serum marker for adenocarcinoma of the prostate. N Engl J Med, 317, 909-916. 45. Stamey, T.A. and Kabalin, J.N. (1989) Prostate specific antigen in the diagnosis and treatment of adenocarcinoma of the prostate. I. Untreated patients. J Urol, 141, 1070-1075. 46. Catalona, W.J., Richie, J.P., Ahmann, F.R., Hudson, M.A., Scardino, P.T., Flanigan, R.C., deKernion, J.B., Ratliff, T.L., Kavoussi, L.R., Dalkin, B.L. et al. (1994) Comparison of digital rectal examination and serum prostate specific antigen in the early detection of prostate cancer: results of a multicenter clinical 39 trial of 6,630 men. J Urol, 151, 1283-1290. 47. Carter, H.B., Pearson, J.D., Metter, E.J., Brant, L.J., Chan, D.W., Andres, R., Fozard, J.L. and Walsh, P.C. (1992) Longitudinal evaluation of prostate-specific antigen levels in men with and without prostate disease. JAMA, 267, 2215-2220. 48. Gann, P.H., Hennekens, CH. and Stampfer, M.J. (1995) A prospective evaluation of plasma prostate-specific antigen for detection of prostatic cancer. JAMA, 273, 289-294. 49. United States Food and Drug Administration Approval Document P94-16. (1994) FDA approves test for prostate cancer. Press Release. 50. Melchior, S.W. and Brawer, M.K. (1996) Role of transrectal ultrasound and prostate biopsy. J Clin Ultrasound, 24, 463-471. 51. Gleason, D.F. and Mellinger, G.T. (1974) Prediction of prognosis for prostatic adenocarcinoma by combined histological grading and clinical staging. J Urol, 111, 58-64. 52. Epstein, J.L, Allsbrook, W.C, Jr., Amin, M.B. and Egevad, L.L. (2006) Update on the Gleason grading system for prostate cancer: results of an international consensus conference of urologic pathologists. Adv Anat Pathol, 13, 57-59. 53. Schroder, F.H., Hermanek, P., Denis, L., Fair, W.R., Gospodarowicz, M.K. and Pavone-Macaluso, M. (1992) The TNM classification of prostate cancer. Prostate Suppl, 4, 129-138. 54. McNeal, J.E. and Bostwick, D.G. (1986) Intraductal dysplasia: a premalignant lesion of the prostate. Hum Pathol, 17, 64-71. 55. Bostwick, D.G. and Brawer, M.K. (1987) Prostatic intra-epithelial neoplasia and 40 early invasion in prostate cancer. Cancer, 59, 788-794. 56. De Marzo, A.M., Marchi, V.L., Epstein, J.I. and Nelson, W.G. (1999) Proliferative inflammatory atrophy of the prostate: implications for prostatic carcinogenesis. Am J Pathol, 155, 1985-1992. 57. Putzi, M.J. and De Marzo, A.M. (2000) Morphologic transitions between proliferative inflammatory atrophy and high-grade prostatic intraepithelial neoplasia. Urology, 56, 828-832. 58. Franks, L.M. (1954) Atrophy and hyperplasia in the prostate proper. J Pathol Bacteriol, 68, 617-621. 59. Gardner, W.A., Jr. and Culberson, D.E. (1987) Atrophy and proliferation in the young adult prostate. J Urol, 137, 53-56. 60. Billis, A. (1998) Prostatic atrophy: an autopsy study of a histologic mimic of adenocarcinoma. Mod Pathol, 11, 47-54. 61. de la Torre, M., Haggman, M., Brandstedt, S. and Busch, C. (1993) Prostatic intraepithelial neoplasia and invasive carcinoma in total prostatectomy specimens: distribution, volumes and DNA ploidy. Br J Urol, 72, 207-213. 62. Troncoso, P., Babaian, R.J., Ro, J.Y., Grignon, D.J., von Eschenbach, A.C. and Ayala, A.G. (1989) Prostatic intraepithelial neoplasia and invasive prostatic adenocarcinoma in cystoprostatectomy specimens. Urology, 34, 52-56. 63. Silvestri, F., Bussani, R., Pavletic, N. and Bassan, F. (1995) Neoplastic and borderline lesions of the prostate: autopsy study and epidemiological data. Pathol ResPract, 191,908-916. 64. Karayi, M.K. and Markham, A.F. (2004) Molecular biology of prostate cancer. 41 Prostate Cancer Prostatic Dis, 7, 6-20. 65. Shand, R.L. and Gelmann, E.P. (2006) Molecular biology of prostate-cancer pathogenesis. Curr Opin Urol, 16, 123-131. 66. Chodak, G.W., Thisted, R.A., Gerber, G.S., Johansson, J.E., Adolfsson, J., Jones, G.W., Chisholm, G.D., Moskovitz, B., Livne, P .M. and Warner, J. (1994) Results of conservative management of clinically localized prostate cancer. N EnglJ Med, 330, 242-248. 67. Lu-Yao, G.L. and Yao, S.L. (1997) Population-based study of long-term survival in patients with clinically localised prostate cancer. Lancet, 349, 906-910. 68. Ellis, W.J. (2002) Prostate brachytherapy. Cancer Metastasis Rev, 21, 125-129. 69. Merrick, G.S., Wallner, K . E . and Butler, W . M . (2005) Prostate cryotherapy: more questions than answers. Urology, 66, 9-15. 70. Pound, C.R., Partin, A.W., Eisenberger, M.A. , Chan, D.W., Pearson, J.D. and Walsh, P.C. (1999) Natural history of progression after PSA elevation following radical prostatectomy. JAMA, 281, 1591-1597. 71. Zlotta, A.R. and Schulman, C C . (2000) Neoadjuvant and adjuvant hormone therapy for prostate cancer. World J Urol, 18, 179-182. 72. Tyrrell, C.J. (1999) Adjuvant and neoadjuvant hormonal therapy for prostate cancer. Eur Urol, 36, 549-558. 73. Kucway, R., Vicini, F., Huang, R., Stromberg, J., Gonzalez, J. and Martinez, A . (2002) Prostate volume reduction with androgen deprivation therapy before interstitial brachy therapy. J Urol, 167, 2443-2447. 74. Zelefsky, M.J. and Harrison, A . (1997) Neoadjuvant androgen ablation prior to 42 radiotherapy for prostate cancer: reducing the potential morbidity of therapy. Urology, 49, 38-45. 75. Huggins, C. and Hodges, C.V. (1941) Studies on prostatic cancer: The effect of castration, of estrogen and of androgen injection on serum phosphatases in metastatic carcinoma of the prostate. Cancer Res, 293-297. 76. Lu-Yao, G., Moore, D.F., Oleynick, J.U., DiPaola, R.S. and Yao, S.L. (2007) Population based study of hormonal therapy and survival in men with metastatic prostate cancer. J Urol, 177, 535-539. 77. Loose, D.S., Kan, P.B., Hirst, M.A. , Marcus, R.A. and Feldman, D. (1983) Ketoconazole blocks adrenal steroidogenesis by inhibiting cytochrome P450-dependent enzymes. J Clin Invest, 71, 1495-1499. 78. Daniell, H.W. (1997) Osteoporosis after orchiectomy for prostate cancer. J Urol, 157, 439-444. 79. Daniell, H.W., Dunn, S.R., Ferguson, D.W., Lomas, G., Niazi, Z. and Stratte, P.T. (2000) Progressive osteoporosis during androgen deprivation therapy for prostate cancer. J Urol, 163, 181 -186. 80. Morote, J., Martinez, E. , Trilla, E. , Esquena, S., Abascal, J.M., Encabo, G. and Reventos, J. (2003) Osteoporosis during continuous androgen deprivation: influence of the modality and length of treatment. Eur Urol, 44, 661-665. 81. Denmeade, S.R., Lin, X.S. and Isaacs, J.T. (1996) Role of programmed (apoptotic) cell death during the progression and therapy for prostate cancer. Prostate, 28, 251-265. 82. Nelson, E.C., Cambio, A.J., Yang, J.C., Lara, P.N., Jr. and Evans, C P . (2007) 43 Biologic agents as adjunctive therapy for prostate cancer: a rationale for use with androgen deprivation. Nat Clin Pract, 4, 82-94. 83. English, H.F., Kyprianou, N. and Isaacs, J.T. (1989) Relationship between DNA fragmentation and apoptosis in the programmed cell death in the rat prostate following castration. Prostate, 15, 233-250. 84. Hayek, O.R., Shabsigh, A., Kaplan, S.A., Kiss, A.J., Chen, M.W., Burchardt, T., Burchardt, M . , Olsson, C A . and Buttyan, R. (1999) Castration induces acute vasoconstriction of blood vessels in the rat prostate concomitant with a reduction of prostatic nitric oxide synthase activity. J Urol, 162, 1527-1531. 85. Kerr, J.F. and Searle, J. (1973) Deletion of cells by apoptosis during castration-induced involution of the rat prostate. Virchows Archiv, 13, 87-102. 86. McDonnell, T.J., Troncoso, P., Brisbay, S.M., Logothetis, C , Chung, L.W., Hsieh, J.T., Tu, S.M. and Campbell, M.L. (1992) Expression of the protooncogene bcl-2 in the prostate and its association with emergence of androgen-independent prostate cancer. Cancer Res, 52, 6940-6944. 87. Colombel, M . , Symmans, F., Gil, S., O'Toole, K . M . , Chopin, D., Benson, M . , Olsson, C.A., Korsmeyer, S. and Buttyan, R. (1993) Detection of the apoptosis-suppressing oncoprotein bcl-2 in hormone-refractory human prostate cancers. Am J Pathol, 143, 390-400. 88. Lin, Y., Fukuchi, J., Hiipakka, R.A., Kokontis, J.M. and Xiang, J. (2007) Up-regulation of Bcl-2 is required for the progression of prostate cancer cells from an androgen-dependent to an androgen-independent growth stage. Cell Res, 17, 531-536. 44 89. Wright, J.L., Higano, C.S. and Lin, D.W. (2006) Intermittent androgen deprivation: clinical experience and practical applications. Urol Clin North Am, 33, 167-179. 90. Pether, M . and Goldenberg, S.L. (2004) Intermittent androgen suppression. BJU Int, 93, 258-261. 91. Sobel, R.E. and Sadar, M.D. (2005) Cell lines used in prostate cancer research: a compendium of old and new lines—part 2. J Urol, 173, 360-372. 92. Sobel, R.E. and Sadar, M.D. (2005) Cell lines used in prostate cancer research: a compendium of old and new lines—part l.J Urol, 173, 342-359. 93. Horoszewicz, J.S., Leong, S.S., Chu, T .M. , Wajsman, Z.L. , Friedman, M . , Papsidero, L. , Kim, U., Chai, L.S., Kakati, S., Arya, S.K. etal. (1980) The LNCaP cell line—a new model for studies on human prostatic carcinoma. Prog Clin Biol Res, 37, 115-132. 94. Veldscholte, J., Ris-Stalpers, C , Kuiper, G.G., Jenster, G., Berrevoets, C , Claassen, E. , van Rooij, H.C., Trapman, J., Brinkmann, A.O. and Mulder, E. (1990) A mutation in the ligand binding domain of the androgen receptor of human LNCaP cells affects steroid binding characteristics and response to anti-androgens. Biochem Biophys Res Commun, 173, 534-540. 95. Ffenttu, P., Liao, S.S. and Vihko, P. (1992) Androgens up-regulate the human prostate-specific antigen messenger ribonucleic acid (mRNA), but down-regulate the prostatic acid phosphatase mRNA in the LNCaP cell line. Endocrinology, 130, 766-772. 96. Stone, K.R., Mickey, D.D., Wunderli, FL, Mickey, G.H. and Paulson, D.F. (1978) 45 Isolation of a human prostate carcinoma cell line (DU 145). Int J Cancer, 21, 274-281. 97. Kaighn, M.E. , Narayan, K.S., Ohnuki, Y., Lechner, J.F. and Jones, L.W. (1979) Establishment and characterization of a human prostatic carcinoma cell line (PC-3). Invest Urol, 17, 16-23. 98. Horoszewicz, J.S., Leong, S.S., Kawinski, E. , Karr, J.P., Rosenthal, H. , Chu, T.M. , Mirand, E.A. and Murphy, G.P. (1983) LNCaP model of human prostatic carcinoma. Cancer Res, 43, 1809-1818. 99. Sato, N., Gleave, M.E. , Bruchovsky, N., Rennie, P.S., Beraldi, E. and Sullivan, L.D. (1997) A metastatic and androgen-sensitive human prostate cancer model using intraprostatic inoculation of LNCaP cells in SCID mice. Cancer Res, 57, 1584-1589. 100. Gleave, M.E. , Hsieh, J.T., Wu, H.C., von Eschenbach, A.C. and Chung, L.W. (1992) Serum prostate specific antigen levels in mice bearing human prostate LNCaP tumors are determined by tumor volume and endocrine and growth factors. Cancer Res, 52, 1598-1605. 101. Pretlow, T.G., Wolman, S.R., Micale, M.A., Pelley, R.J., Kursh, E.D., Resnick, M.I., Bodner, D.R., Jacobberger, J.W., Delmoro, C M . , Giaconia, J.M. et al. (1993) Xenografts of primary human prostatic carcinoma. JNatl Cancer Inst, 85, 394-398. 102. van Weerden, W.M., de Ridder, C M . , Verdaasdonk, C.L., Romijn, J.C., van der Kwast, T.H., Schroder, F.H. and van Steenbrugge, G.J. (1996) Development of seven new human prostate tumor xenograft models and their histopathological 46 characterization. Am J Pathol, 149, 1055-1062. 103. Klein, K.A. , Reiter, R.E., Redula, J., Moradi, H., Zhu, X .L . , Brothman, A.R., Lamb, D.J., Marcelli, M . , Belldegrun, A., Witte, O.N. et al. (1997) Progression of metastatic human prostate cancer to androgen independence in immunodeficient SCID mice. Nat Med, 3, 402-408. 104. Ellis, W.J., Vessella, R.L., Buhler, K.R., Bladou, F., True, L.D., Bigler, S.A., Curtis, D. and Lange, P.H. (1996) Characterization of a novel androgen-sensitive, prostate-specific antigen-producing prostatic carcinoma xenograft: LuCaP 23. Clin Cancer Res, 2, 1039-1048. 105. Corey, E. , Quinn, J.E., Buhler, K.R., Nelson, P.S., Macoska, J.A., True, L.D. and Vessella, R.L. (2003) LuCaP 35: a new model of prostate cancer progression to androgen independence. Prostate, 55, 239-246. 106. Tan, J., Sharief, Y., Hamil, K.G. , Gregory, C.W., Zang, D.Y., Sar, M . , Gumerlock, P.H., deVere White, R.W., Pretlow, T.G., Harris, S.E. et al. (1997) Dehydroepiandrosterone activates mutant androgen receptors expressed in the androgen-dependent human prostate cancer xenograft CWR22 and LNCaP cells. Mol Endocrinol, 11, 450-459. 107. Wainstein, M.A., He, F., Robinson, D., Kung, H.J., Schwartz, S., Giaconia, J.M., Edgehouse, N.L., Pretlow, T.P., Bodner, D.R., Kursh, E.D. et al. (1994) CWR22: androgen-dependent xenograft model derived from a primary human prostatic carcinoma. Cancer Res, 54, 6049-6052. 108. Nagabhushan, M . , Miller, C M . , Pretlow, T.P., Giaconia, J.M., Edgehouse, N.L., Schwartz, S., Kung, H.J., de Vere White, R.W., Gumerlock, P.H., Resnick, M.I. et 47 al. (1996) CWR22: the first human prostate cancer xenograft with strongly androgen-dependent and relapsed strains both in vivo and in soft agar. Cancer Res, 56, 3042-3046. 109. Chung, L.W., Baseman, A., Assikis, V. and Zhau, H.E. (2005) Molecular insights into prostate cancer progression: the missing link of tumor microenvironment. J Urol, 173, 10-20. 110. Sadar, M.D., Akopian, V .A. and Beraldi, E. (2002) Characterization of a new in vivo hollow fiber model for the study of progression of prostate cancer to androgen independence. Mol Cancer Ther, 1, 629-637. 111. Roy, N., Mahadevan, M.S., McLean, M . , Shutler, G., Yaraghi, Z., Farahani, R., Baird, S., Besner-Johnston, A., Lefebvre, C , Kang, X. et al. (1995) The gene for neuronal apoptosis inhibitory protein is partially deleted in individuals with spinal muscular atrophy. Cell, 80, 167-178. 112. Liston, P., Roy, N., Tamai, K., Lefebvre, C , Baird, S., Cherton-Horvat, G., Farahani, R., McLean, M . , Ikeda, J.E., MacKenzie, A. etal. (1996) Suppression of apoptosis in mammalian cells by NAIP and a related family of IAP genes. Nature, 379, 349-353. 113. Rothe, M . , Pan, M.G. , Henzel, W.J., Ayres, T .M. and Goeddel, D.V. (1995) The TNFR2-TRAF signaling complex contains two novel proteins related to baculoviral inhibitor of apoptosis proteins. Cell, 83, 1243-1252. 114. Ambrosini, G., Adida, C. and Altieri, D.C. (1997) A novel anti-apoptosis gene, survivin, expressed in cancer and lymphoma. Nat Med, 3, 917-921. 115. Chen, Z., Naito, M . , Hori, S., Mashima, T., Yamori, T. and Tsuruo, T. (1999) A 48 human IAP-family gene, apollon, expressed in human brain cancer cells. Biochem Biophys Res Commun, 264, 847-854. 116. Vucic , D . , Stennicke, H.R. , Pisabarro, M . T . , Salvesen, G.S. and Dixi t , V . M . (2000) M L - I A P , a novel inhibitor of apoptosis that is preferentially expressed in human melanomas. Curr Biol, 10, 1359-1366. 117. Richter, B . W . , M i r , S.S., Eiben, L . J . , Lewis, J., Reffey, S.B., Frattini, A . , Tian, L . , Frank, S., Youle, R.J . , Nelson, D . L . et al. (2001) Molecular cloning of ILP-2, a novel member of the inhibitor of apoptosis protein family. Mol Cellular Biol, 21, 4292-4301. 118. Hunter, A . M . , Lacasse, E . C . and Korneluk, R . G . (2007) The inhibitors of apoptosis (IAPs) as cancer targets. Apoptosis, 12, 1543-1568. 119. Liston, P., Fong, W . G . and Korneluk, R . G . (2003) The inhibitors of apoptosis: there is more to life than Bcl2 . Oncogene, 22, 8568-8580. 120. Davoodi, J., L i n , L . , Ke l ly , J. , Liston, P. and MacKenzie, A . E . (2004) Neuronal apoptosis-inhibitory protein does not interact with Smac and requires A T P to bind caspase-9. J Biol Chem, 279, 40622-40628. 121. Maier, J .K., Lahoua, Z . , Gendron, N . H . , Fetni, R., Johnston, A . , Davoodi, J., Rasper, D . , Roy, S., Slack, R.S. , Nicholson, D . W . et al. (2002) The neuronal apoptosis inhibitory protein is a direct inhibitor of caspases 3 and 7. J Neurosci, 22, 2035-2043. 122. Huang, Y . , Park, Y . C . , Rich, R . L . , Segal, D . , Myszka, D . G . and Wu, H . (2001) Structural basis of caspase inhibition by X I A P : differential roles of the linker versus the B I R domain. Cell, 104, 781-790. 49 123. Takahashi, R., Deveraux, Q., Tamm, I., Welsh, K . , Assa-Munt, N . , Salvesen, G.S. and Reed, J.C. (1998) A single B I R domain of X I A P sufficient for inhibiting caspases. JBiol Chem, 273, 7787-7790. 124. Suzuki, Y . , Nakabayashi, Y . , Nakata, K . , Reed, J.C. and Takahashi, R. (2001) X -linked inhibitor of apoptosis protein (XIAP) inhibits caspase-3 and -7 in distinct modes. JBiol Chem, 276, 27058-27063. 125. Deveraux, Q.L. , Leo, E . , Stennicke, H.R. , Welsh, K . , Salvesen, G.S. and Reed, J.C. (1999) Cleavage of human inhibitor of apoptosis protein X I A P results in fragments with distinct specificities for caspases. EMBO J, 18, 5242-5251. 126. Eckelman, B .P . and Salvesen, G.S. (2006) The human anti-apoptotic proteins c I A P l and cIAP2 bind but do not inhibit caspases. J Biol Chem, 281, 3254-3260. 127. Vaux, D . L . and Silke, J. (2005) IAPs, R INGs and ubiquitylation. Nat Rev Mol Cell Biol, 6, 287-297. 128. Krajewska, M . , Krajewski, S., Banares, S., Huang, X . , Turner, B . , Bubendorf, L . , Kall ioniemi, O.P., Shabaik, A . , Vit ie l lo , A . , Peehl, D . et al. (2003) Elevated expression of inhibitor of apoptosis proteins in prostate cancer. Clin Cancer Res, 9, 4914-4925. 129. Zhang, M . , Latham, D .E . , Delaney, M . A . and Chakravarti, A . (2005) Survivin mediates resistance to antiandrogen therapy in prostate cancer. Oncogene, 24, 2474-2482. 130. Zhang, M . , Mukherjee, N . , Bermudez, R.S. , Latham, D .E . , Delaney, M . A . , Zietman, A . L . , Shipley, W . U . and Chakravarti, A . (2005) Adenovirus-mediated inhibition of survivin expression sensitizes human prostate cancer cells to 50 paclitaxel in vitro and in vivo. Prostate, 64, 293-302. 131. LaCasse, E . C , Cherton-Horvat, G . G . , Hewitt, K . E . , Jerome, L . J . , Morris, S.J., Kandimalla, E.R. , Y u , D. , Wang, H . , Wang, W. , Zhang, R. et al. (2006) Preclinical characterization of A E G 3 5 1 5 6 / G E M 640, a second-generation antisense oligonucleotide targeting X-l inked inhibitor of apoptosis. Clin Cancer Res, 12, 5231-5241. 132. Dutta, J., Fan, Y . , Gupta, N . , Fan, G . and Gelinas, C. (2006) Current insights into the regulation of programmed cell death by NF-kappaB. Oncogene, 25, 6800-6816. 133. Hayden, M . S . and Ghosh, S. (2004) Signaling to NF-kappaB. Genes Dev, 18, 2195-2224. 134. Jacobs, M . D . and Harrison, S.C. (1998) Structure o f an IkappaBalpha/NF-kappaB complex. Cell, 95, 749-758. 135. Nolan, G.P. , Ghosh, S., L iou , H . C , Tempst, P. and Baltimore, D . (1991) D N A binding and I kappa B inhibition of the cloned p65 subunit o f NF-kappa B , a rel-related polypeptide. Cell, 64, 961-969. 136. Kieran, M . , Blank, V . , Logeat, F. , Vandekerckhove, J., Lottspeich, F. , Le Ba i l , O., Urban, M . B . , Kourilsky, P., Baeuerle, P . A . and Israel, A . (1990) The D N A binding subunit of NF-kappa B is identical to factor K B F 1 and homologous to the rel oncogene product. Cell, 62, 1007-1018. 137. Baeuerle, P . A . and Baltimore, D . (1988) I kappa B : a specific inhibitor of the N F -kappa B transcription factor. Science, 242, 540-546. 138. Rothwarf, D . M . , Zandi, E . , Natoli , G . and Karin, M . (1998) IKK-gamma is an 51 essential regulatory subunit of the IkappaB kinase complex. Nature, 395, 297-300. 139. Yamaoka, S., Courtois, G . , Bessia, C , Whiteside, S.T., Wei l , R., Agou, F. , Ki rk , H .E . , Kay , R.J . and Israel, A . (1998) Complementation cloning of N E M O , a component of the IkappaB kinase complex essential for NF-kappaB activation. Cell, 93, 1231-1240. 140. Zandi, E . , Rothwarf, D . M . , Delhase, M . , Hayakawa, M . and Karin, M . (1997) The IkappaB kinase complex ( I K K ) contains two kinase subunits, IKKalpha and IKKbeta, necessary for IkappaB phosphorylation and NF-kappaB activation. Cell, 91, 243-252. 141. Senftleben, U . , Cao, Y . , X iao , G . , Greten, F.R., Krahn, G . , Bonizz i , G . , Chen, Y . , Hu, Y . , Fong, A . , Sun, S.C. et al. (2001) Activation by IKKalpha of a second, evolutionary conserved, NF-kappa B signaling pathway. Science, 293, 1495-1499. 142. Hoffmann, A . , Natoli , G . and Ghosh, G . (2006) Transcriptional regulation via the NF-kappaB signaling module. Oncogene, 25, 6706-6716. 143. Perkins, N . D . and Gilmore, T .D . (2006) Good cop, bad cop: the different faces of NF-kappaB. Cell Death Differ, 13, 759-772. 144. Gr i l l i , M . , Chiu, J.J. and Lenardo, M . J . (1993) NF-kappa B and Rel : participants in a multiform transcriptional regulatory system. Int Rev Cytol, 143, 1-62. 145. Karin, M . and Greten, F.R. (2005) NF-kappaB: linking inflammation and immunity to cancer development and progression. Nat Rev Immunol, 5, 749-759. 146. Domingo-Domenech, J., Mellado, B . , Ferrer, B . , Truan, D . , Codony-Servat, J., Sauleda, S., Alcover, J., Campo, E . , Gascon, P., Rovira, A . et al. (2005) Activation of nuclear factor-kappaB in human prostate carcinogenesis and 52 association to biochemical relapse. Br J Cancer, 93, 1285-1294. 147. Ross, J.S., Kallakury, B . V . , Sheehan, C .E . , Fisher, H . A . , Kaufman, R.P. , Jr., Kaur, P., Gray, K . and Stringer, B . (2004) Expression of nuclear factor-kappa B and I kappa B alpha proteins in prostatic adenocarcinomas: correlation of nuclear factor-kappa B immunoreactivity with disease recurrence. Clin Cancer Res, 10, 2466-2472. 148. Palvimo, J.J., Reinikainen, P., Ikonen, T., Ka l l io , P.J., Moilanen, A . and Janne, O .A . (1996) Mutual transcriptional interference between Rel A and androgen receptor. J Biol Chem, 271, 24151-24156. 149. Cinar, B . , Yeung, F. , Konaka, PL, Mayo, M . W . , Freeman, M . R . , Zhau, H . E . and Chung, L . W . (2004) Identification of a negative regulatory cis-element in the enhancer core region of the prostate-specific antigen promoter: implications for intersection of androgen receptor and nuclear factor-kappaB signalling in prostate cancer cells. Biochem J, 379, 421-431. 150. Suh, J., Payvandi, F. , Edelstein, L . C . , Amenta, P.S., Zong, W . X . , Gelinas, C. and Rabson, A . B . (2002) Mechanisms of constitutive NF-kappaB activation in human prostate cancer cells. Prostate, 52, 183-200. 151. Coffey, R . N . , Watson, R .W. , O 'Nei l l , A . J . , M c Eleny, K . and Fitzpatrick, J . M . (2002) Androgen-mediated resistance to apoptosis. Prostate, 53, 300-309. 152. Catz, S.D. and Johnson, J .L. (2001) Transcriptional regulation of bcl-2 by nuclear factor kappa B and its significance in prostate cancer. Oncogene, 20, 7342-7351. 153. Apakama, I., Robinson, M . C , Walter, N . M . , Charlton, R . G . , Royds, J .A. , Fuller, C .E . , Neal , D . E . and Hamdy, F . C (1996) bcl-2 overexpression combined with 53 p53 protein accumulation correlates with hormone-refractory prostate cancer. Br J Cancer, 74, 1258-1262. 154. Huang, A . , Gandour-Edwards, R., Rosenthal, S.A., Siders, D . B . , Deitch, A . D . and White, R . W . (1998) p53 and bcl-2 immunohistochemical alterations in prostate cancer treated with radiation therapy. Urology, 51, 346-351. 155. Mackey, T.J., Borkowski, A . , A m i n , P., Jacobs, S.C. and Kyprianou, N . (1998) bcl-2/bax ratio as a predictive marker for therapeutic response to radiotherapy in patients with prostate cancer. Urology, 52, 1085-1090. 156. Stehlik, C , de Martin, R., Kumabashiri, I., Schmid, J .A. , Binder, B . R . and Lipp, J. (1998) Nuclear factor (NF)-kappaB-regulated X-chromosome-linked iap gene expression protects endothelial cells from tumor necrosis factor alpha-induced apoptosis. J Exp Med, 188, 211-216. 157. Kawakami, H . , Tomita, M . , Matsuda, T., Ohta, T., Tanaka, Y . , Fuji i , M . , Hatano, M . , Tokuhisa, T. and M o r i , N . (2005) Transcriptional activation of survivin through the NF-kappaB pathway by human T-cell leukemia virus type I tax. Int J Cancer, 115, 967-974. 158. L i u , Y . , Denlinger, C .E . , Rundall, B . K . , Smith, P .W. and Jones, D.R. (2006) Suberoylanilide hydroxamic acid induces Akt-mediated phosphorylation of p300, which promotes acetylation and transcriptional activation of RelA/p65. J Biol Chem, 281,31359-31368. 159. Yemelyanov, A . , Gasparian, A . , Lindholm, P., Dang, L . , Pierce, J.W., Kisseljovi F. , Karseladze, A . and Budunova, I. (2006) Effects of I K K inhibitor PS1145 on NF-kappaB function, proliferation, apoptosis and invasion activity in prostate 54 carcinoma cells. Oncogene, 25, 387-398. 160. Chu, Z . L . , McKinsey , T .A . , L i u , L . , Gentry, J.J., Ma l im , M . H . and Ballard, D . W . (1997) Suppression of tumor necrosis factor-induced cell death by inhibitor of apoptosis C - IAP2 is under NF-kappaB control. Proc Natl Acad Sci USA, 94, 10057-10062. 55 2 I N D U C T I O N O F N E U R O N A L A P O P T O S I S I N H I B I T O R Y P R O T E I N E X P R E S S I O N I N R E S P O N S E T O A N D R O G E N D E P R I V A T I O N B Y N F - K B I N P R O S T A T E C A N C E R C E L L S * 2.1 I N T R O D U C T I O N Androgen deprivation with medical or surgical castration is an effective systemic approach for the treatment of prostate cancer (CaP). This therapy is based on the dependency of prostate cells on androgen to grow and survive. Thus, the effectiveness of androgen deprivation lies in its ability to induce cell death in prostate cells (1). Unfortunately, despite the initial responsiveness to androgen ablation, the cancer w i l l only regress transiently before it eventually recurs and progresses to androgen-independence. The molecular mechanism by which CaP cells survive under the androgen-depleted conditions remains unclear. Specifically, different factors may render some cancer cells less prone to the cell death induced by androgen deprivation. A family of proteins termed inhibitors of apoptosis proteins (IAPs), characterized by the presence of one or more baculoviral I A P repeat domains, is capable of rescuing cells destined for death via the caspase cascade (reviewed by (2)). To date, eight human IAPs have been identified. These are the neuronal apoptosis inhibitory protein (NAIP/BIRC1) , c - I A P l (BIRC2/HIAP2) , C - IAP2 (BIRC3/HIAP1) , X I A P (BIRC4), survivin (BIRC5), apollon (BIRC6), l iv in ( B I R C 7 / K I A P / M L - I A P ) and IAP-l ike protein-2 (BIRC8/ILP-2) (3-9). IAPs primarily function by restraining the activity of the caspase family. For instance, N A I P was shown to directly inhibit the cell death effector proteases, caspase-3 and caspase-7 (10) and associate with the initiator caspase, caspase-9 (11). * A manuscript version of this chapter has been submitted. Chiu, H H L , Wang, J., Sadar M D . Induction of neuronal apoptosis inhibitory protein expression in response to androgen deprivation by N F - K B in prostate cancer cells. Submitted. 56 IAPs also modulate the survival of cells through other determined as well as unexplored means. Thus, it is not surprising that many have discovered deregulation of IAPs in various malignancies (reviewed in (12)). Elevated expression of IAPs was evident as an early event in the pathogenesis of CaP (13). Emerging studies also demonstrate the role of IAPs in conferring drug-resistance in CaP cells (14-16). Recently, the cytoprotective properties of IAPs have been shown to be associated with the nuclear factor ( N F ) - K B signalling pathway (reviewed by (12,17)), and c-IAPl, c-IAP2,XIAP and survivin are confirmed N F - K B targets (18-21). The ubiquitously expressed N F - K B family includes p65/RelA, Re lB , c-Rel, p50 /p l05 /NF -KBl and p52/pl00/NF -KB2. Homodimers and heterodimers comprising these subunits regulate a multitude of genes and proteins that are involved in survival and programmed cell death among a variety of other critical biological functions (reviewed in (22)). Although other non-canonical pathways have been described, the activation of N F -K B typically involved phosphorylation of the inhibitor of K B ( IKB ) , associated with the N F - K B factors, by I K B kinase complex. Subsequent ubiquitylation and proteosomal degradation of I K B allows the nuclear translocation, DNA-binding and transcriptional regulation of the transcription factor on target genes by binding to the K B sites in the gene loci. The N F - K B signalling pathway is strongly associated with the development and progression of CaP as well as other malignancies (reviewed in (23-25)). Constitutively active N F - K B , p65/p50 heterodimer, has been implicated in several studies to have a crucial role in the resistance to apoptosis in CaP cells and in the disease progression (26-29). The most common approach for N F - K B to antagonize apoptosis is by modulating the expression of anti-apoptotic genes at the level of transcription (30). To this end, IAPs 57 might play a key role in resistance to apoptosis in CaP cells via N F - K B signalling. Here we evaluated the expression of IAPs in CaP in response to androgen deprivation both in vivo and in vitro and detected statistically significant increases in NAIP expression that correlated with increased N F - K B DNA-binding . We report for the first time functional cis-regulatory elements of N F - K B on the NAIP locus. These findings underlie a novel mechanism by which some CaP cells may acquire enhanced anti-apoptotic properties, thereby promoting the progression to an androgen-independent state. 2.2 M A T E R I A L S A N D M E T H O D S 2.2.1 Animals , cell culture and reagents Male athymic nude mice and male N O D - S C I D mice were obtained from Taconic Farms (Germantown, N Y , U S A ) and the Animal Research Centre of the B . C . Cancer Agency (Vancouver, B . C . Canada) respectively. A l l procedures on the mice were performed in compliance with regulations on the care and use of experimental animals under the Animal Care Certificates issued by the University of British Columbia (Vancouver, B C , Canada). Human CaP cell line, L N C a P , was routinely maintained in R P M I 1640 supplemented with 5 % (v/v) F B S (HyClone, Logan, U T , U S A ) . PC3 and DU145, the other human CaP cell lines used in this study, were cultured in D M E M with 4500 mg D-glucose/L supplemented with 5 % and 10 % F B S respectively. A l l cell lines were maintained at 37 °C in 5 % CO2 in a humidified incubator. A l l cell culture media were supplemented with 100 units/ml penicillin and 100 ug/ml streptomycin. L N C a P cells were provided by L . W . K . Chung (Emory University School of Medicine, Atlanta, G A , U S A ) , whereas PC3 cells and DU145 cells were obtained from American Type 58 Culture Collection (Rockville, M D , U S A ) . Ce l l culture media and antibiotics were purchased from StemCell Technologies (Vancouver, B C , Canada). Dihydrotestosterone (DHT) and synthetic androgen, R1881 (Perkin-Elmer, Woodbridge, O N , Canada), were reconstituted in ethanol (vehicle). Human recombinant tumour necrosis factor-a (TNF-a) (Roche Diagnostics) was used in the presence of 1 mg/ml B S A . A l l chemicals were obtained from Sigma-Aldrich (St. Louis, M O , U S A ) , unless otherwise stated. 2.2.2 L N C a P h o l l o w fibre m o d e l a n d c a s t r a t i o n The experimental procedure involved in the L N C a P hollow fibre model was performed in male athymic nude mice as described previously (31). Briefly, subconfluent cultures of L N C a P cells in R P M I 1640 supplemented with 10 % F B S were loaded into polyvinylidene difluoride hollow fibres (Spectrum Laboratories, Laguna Hi l l s , C A , U S A ) using an 18-gauge needle at a seeding density of 3 x 10 7 cells/ ml with B D Matrigei™ Basement Membrane Matrix (Becton Dickinson Biosciences, San Jose, C A , U S A ) . The fibres were cut into about 2-cm pieces, the ends were heat-sealed and the fibres were implanted into the nude mice that were 6-8 weeks of age. A total of 20-24 fibres were implanted in bundles at different regions subcutaneously (s.c.) at the back of each animal. Serum P S A was monitored weekly after implantation. Seven days after implantation of the fibres, castration of mice was performed by making a small incision in the scrotum to excise each testicle after ligation of the cord. To close the incision, surgical suture was used. A group of 5 mice were left intact from any major surgical procedure. For two other groups of 5 procedural control mice, a mock castration was performed by making the incision without removal of the testicles or a testosterone pellet (2.5 mg; Innovative Research of America, Sarasota, F L , U S A ) was added s.c. to the back of the mice anterior 59 to the fibres upon castration. A n equal number of fibres from each animal was retrieved at each of the indicated time points. L N C a P cells within the fibres were harvested in ice cold P B S and subjected to total R N A isolation or subcellular protein extraction. Except for collection of blood samples, mice were anesthetised with isofluorane (Abbott Laboratories, Montreal, Q B , Canada) administered by a vaporizer before any invasive procedure. 2.2.3 L N C a P xenograft model L N C a P cells suspended in R P M I 1640 with 5 % (v/v) F B S and 50 % (v/v) Growth Factor-Reduced Matrigel™ were injected and inoculated via 27-gauge needle s.c. into the backs of male N O D - S C I D mice, 6-8 weeks old. Tumour volume and serum P S A were monitored weekly after inoculation. The tumours were measured with callipers and their volumes were calculated by the formula: length x width x height x 0.5236. When each tumour averaged - 1 0 0 m m 3 in volume, the animal was castrated in the same manner as described for the hollow fibre model. Mice were anesthetised with isofluorane administered by a vaporizer before castration. A t the time points indicated, mice were sacrificed using CO2 gas, and the tumours were excised and prepared for immunohistochemistry. 2.2.4 Serum P S A levels Blood samples were obtained from mice weekly subsequent to implantation of fibres (i.e. hollow fibre model) or inoculation (i.e. xenografts) by a small incision in the dorsal tail vein using a sterile scalpel, and 50 ul was collected in a hematocrit capillary tube. The IMx® Total P S A Assay (Abbott Laboratories), an enzymatic immunoassay kit, was used to determine the serum P S A levels according to the manufacturer's protocol. 60 The mouse sera were diluted 10 times in diluent to perform the assay. For the hollow fibre model, the serum levels were normalized to the number of fibres in the mice at the time of the assay. 2.2.5 Immunohistochemistry Xenograft tumours were fixed in formalin and embedded in paraffin blocks. Tissue sections (5 pm thick) were deparaffinised and rehydrated in deionized water. These sections were pretreated for antigen retrieval by heating in microwave and applying Antigen Unmasking Solution (Vector Laboratories, Burlingame, C A , U S A ) and soaked in 3 % H2O2 to block endogenous peroxidase activity. After washing with water and P B S , the samples were blocked in Clear Vision™ Immunohistochemistry (IHC) Blocking Solution (ImmunoVision Technologies, Brisbane, C A , U S A ) . The slides were immunostained with anti-p65 antibody (C-20; Santa Cruz Biotechnologies, Santa Cruz, C A , U S A ) at 1:100 in P B S overnight at 4 °C. A s negative controls, rabbit immunoglobulin (Vector Laboratories, Burlingame, C A , U S A ) was used to replace the primary antibody. The VECTASTAIN® A B C K i t (Vector Laboratories, Burlingame, C A , U S A ) was used for detection. Peroxidase activity was localized with 3,3'-diaminobenzidin, and the sections were counterstained with hematoxyline before dehydration and mounting. The slides were examined using a Zeiss AxioPlan 2 Microscope (Carl Zeiss, Toronto, O N , Canada) and images were taken. The same sections of the same animals were stripped and reprobed with anti-human N A I P antibody ( R & D Systems, Minneapolis, M N , U S A ) at 1:50 in P B S following the same procedure. 2.2.6 In-vitro androgen deprivation L N C a P cells (1.5 x 106) were plated in 10-cm dishes. After 24 h, the media was 61 replaced with R P M I 1640 supplemented with 5 % charcoal-stripped bovine serum and 10 n M D H T . After 20 h of culture in the presence of D H T , the cells were washed with serum-free medium (SFM) to remove residual D H T . For in-vitro androgen deprivation, the media was replaced with fresh S F M and the cells were cultured in the androgen-deprived environment for another 27 h before harvesting. Control cells were maintained in S F M supplemented with 10 n M D H T after washing. Cells were harvested and total R N A was isolated. 2.2.7 RNA extraction and RT-PCR Total R N A was extracted from cells using Trizol® Reagent (Invitrogen) according to the manufacturer's instructions. Reverse transcription (RT-PCR) and real-time quantitative P C R (qPCR) were performed separately. Po ly (A) + R N A was reverse transcribed using oligo(dT) and the Superscript™ III First-Strand Synthesis System (Invitrogen) according to the manufacturer's instructions. c D N A was diluted 10 times after reverse transcription. Subsequent qPCRs were performed using 1 ul of the diluted c D N A as template. 2.2.8 Real-time quantitative PCR analysis q P C R was performed in triplicates for each biological sample with Plat inum® SYBR® Green q P C R Supe rMix-UDG with R O X (Invitrogen) according to the manufacturer's instructions using the A B I Prism 7900 Sequence Detection System (Applied Biosystems, Foster City, C A , U S A ) . A s listed in Table 2.1, primers were designed to generate a P C R products of <200 bp. Thermal cycling conditions were 50 °C for 2 min, 95 °C for 2 min, followed by 45 cycles of 30 s at 95 °C, 30 s at 55 °C and 15 s at 72 °C. Levels of expression were normalized to the glyceraldehyde-3-phosphate 62 Primers Gene Size Sense Antisense GAPDH CTGACTTCAACAGCGACACC TGCTGTAGCCAAATTCGTTG 114 PSA CCAAGTTCATGCTGTGTGCT CCCATGACGTGATACCTTGA 111 NAIP CGAAGAACTACGGCTGGACT GGAAAAGCACTGGACGATGT 121 C-IAP1 GTTTCAGGTCTGTCACTGGAAG TGGCATACTACCAGATGACCA 122 XIAP GCTTGCAAGAGCTGGATTTT GTTGTTCCCAAGGGTCTTCA 110 Survivin TCCGGTTGCGCTTTCCT TCTTCTTATTGTTGGTTTCCTTTGC 121 Table 2.1. Pr imers for gene expression analyses using qPCR. The common name of each gene, sequences of sense and antisense in 5' to 3' orientation and size of the specific product size (in base pairs) are shown The sequences of c-IAPl primers and survivin primers were obtained from Primer Bank (http://pga.mgh.harvard.edu/primerbank/) and Real Time P C R Primer and Probe Database (http://medgen.ugent.be/rtprimerdb/) respectively. 63 dehydrogenase (GAPDH) housekeeping gene. 2.2.9 Subcellular protein extracts preparation L N C a P cells were plated at 3.5 x 10 6 per 15-cm dish. After 24 h, the media was replaced with S F M . After 24 h, the cells were treated with S F M supplemented with B S A (1 mg/ml) in the presence or absence of T N F - a (10 ng/ml), an inducer of N F - K B activity, and harvested after 15 min in ice cold P B S . PC3 cells and DU145 cells were plated at 3 x 10 6 per 15-cm dish and harvested after 24 h in ice cold P B S . The protein extraction protocol was modified from that of Andrews and Faller (32). Briefly, cells were allowed to swell and lysed in 1 ml hypotonic buffer containing 10 m M KC1, 10 m M H E P E S [pH 7.9], 0.5 % (v/v) NP-40, 1.5 m M M g C l 2 , 0.5 m M D T T , l x Complete™ EDTA-free protease inhibitor (Roche Diagnostics), l x phosphatase inhibitor cocktails 1 & 2 (Sigma-Aldr ich, St. Louis, M O , U S A ) for 10 min followed by vigorous vortexing for 10 s. Cells were pelleted for 30 s. The pellet was resuspended and washed in 1 ml of fresh hypotonic buffer and centrifuged for 30 s. The supernatant (i.e. cytosolic fraction) was removed to a fresh 1.5 ml tube and frozen at -80 °C. The pellet was resuspended in 100 ul high salt buffer containing 420 m M N a C l , 20 m M H E P E S [pH 7.9], 25 % (v/v) glycerol, 1.5 m M M g C b , 0.2 m M E D T A , 0.5 m M D T T , l x protease inhibitor, l x phosphatase inhibitor cocktails 1 & 2, and the suspension was vigorously shaken on ice for 30 min with occasional vortexing. After centrifugation for 5 min, the supernatant (i.e. nuclear fraction) was removed and stored at -80 °C. The protein concentration of the extracts was quantified by Bradford assay using protein assay dye reagent (Bio-Rad, Hercules, C A , U S A ) as measured at 595 nm using the VersaMax tunable microplate reader (Molecular Devices, Sunnyvale, C A , U S A ) . The proteins were subjected to Western blot analysis and 64 electrophoretic mobility shift assay ( E M S A ) . 2.2.10 Western blot analysis For the detection of the subunits of N F - K B , p65 and p50, nuclear extracts (20 ug proteins) were denatured in 2x S D S - P A G E loading buffer and boiled for 5 min prior to being separated by electrophoresis through 10 % S D S - P A G E gel and transferred onto Hybond™-C Extra nitrocellulose membrane (Amersham Biosciences, Buckinghamshire, U K ) . After blocking with Odyssey® blocking buffer ( L I - C O R Biosciences, Lincoln, N E , U S A ) in P B S (1:1) for 1 h, membranes were probed with anti-p65 (C-20) and anti-p50 (H-119) antibodies from Santa Cruz Biotechnologies (Santa Cruz, C A , U S A ) at 1:1,000 and monoclonal anti-P-actin antibody (ab8226) from Abeam (Cambridge, M A , U S A ) at 1:1,000 in Odyssey® blocking buffer in P B S (1:1) with 0.1% Tween® 20. Subsequent to incubation with primary antibodies overnight at 4 °C, the blots were incubated with appropriate IRDye® secondary antibodies ( L I - C O R Biosciences) at 1:10,000 and visualized with Odyssey® Infrared Imaging System ( L I - C O R Biosciences). For the detection of N A I P , cytosolic extracts (60 pg proteins) were denatured in 4x S D S - P A G E loading buffer and boiled for 5 min prior to being separated by TM electrophoresis through 9 % S D S - P A G E gel and transferred onto Immobilon P V D F membrane (Millipore, Bil lerica, M A , U S A ) overnight at 4 °C. After blocking with 5 % dry skim milk (w/v) T B S blotto with 0.1% Tween® 20, membranes were probed with anti-human N A I P antibody (ab25968) from Abeam at 1:500. Subsequent to incubation with primary antibodies in blotto overnight at 4 °C, the blots were incubated with appropriate secondary horseradish peroxidase-conjugated antibody (Santa Cruz) at 1:5,000 and developed with SuperSignal® West Femto Maximum Sensitivity Substrate 65 (Pierce, Rockford, IL) . The membranes were stripped with Restore™ Western Blot Stripping Buffer according to the manufacturer's instructions and reprobed with monoclonal anti-P-actin antibody (ab8226) from Abeam. 2.2.11 Electrophoretic mobil i ty shift assay Double-stranded oligonucleotides (22 base pairs), N F - K B consensus oligonucleotide (5' - A G T T G A G G G G A C T T T C C C A G G C - 3 ' ) , N F - K B mutant oligonucleotide (5 ' - A G T T G A G G C G A C T T T C C C A G G C - 3 ' ) , K B - l i ke -1 consensus oligonucleotide ( 5 ' - A T T C A G G G G G A T T T A C A G T C A T - 3 ' ) , K B - l i ke -1 mutant oligonucleotide (5'- A T T C A G G G C G A T T T A C A G T C A T - 3 ' ) , K B - l i k e - 2 consensus oligonucleotide (5'- A G G A T G G G G G C T A T C C C C T G A A - 3 ' ) , K B - l i k e - 2 mutant oligonucleotide (5'- A G G A T G G G C G C T A T C C C C T G A A - 3 ' ) , K B - l i ke -3 consensus oligonucleotide (5'- A T A G A A G G T A A T T T C C C A G G C T - 3 ' ) , K B - l i k e - 3 mutant oligonucleotide (5'- A T A G A A G C T A A T T T C C C A G G C T - 3 ' ) , were radiolabeled and used for E M S A . The N F - K B consensus and mutant oligonucleotides were obtained from Santa Cruz Biotechnologies. Briefly, the oligonucleotides were annealed (for all custom-designed oligonucleotides) and labelled with Redivue™ adenosine 5'-[y- 3 2P] using T4 polynucleotide kinase (Invitrogen) at 37 °C for 45 min. After labelling, the oligonucleotides were purified with ProbeQuant™ G-50 Micro Columns (Amersham Biosciences) prior to use in E M S A s . For DNA-binding , nuclear extracts (5-10 p.g proteins) were incubated in a final volume of 25-30 ul of 10 m M H E P E S (pH 7.9), 80 m M N a C l , 10 % (v/v) glycerol, 1 m M dithiothreitol, 1 m M E D T A , 1 ug poly(dl-dC) (Amersham Biosciences) with the 3 2 P -labeled oligonucleotides for 30 min at room temperature. For supershift assays, the 66 nuclear extracts were preincubated with 2 ug of anti-p65 antibody ( A X ) or anti-p50 antibody (C-19X) from Santa Cruz Biotechnologies for 30 min at room temperature. For competition binding assays, the nuclear extracts were preincubated with 250-fold excess unlabeled oligonucleotides for 30 min at room temperature. The protein-DNA complexes were resolved in a non-denaturing 4.5% polyacrylamide gel containing 2.5% glycerol and 0.5x T B E (45 m M Tris base, 45 m M boric acid, 1 m M E D T A ) at room temperature. The gels were dried, exposed on Phosphor screen (Molecular Dynamics, Sunnyvale, C A , U S A ) and subjected to autoradiography using STORM™ 860 Phosphorlmager (Molecular Dynamics). The density of the shifted band that corresponds to a protein-DNA complex was analyzed using ImageQuant® 5.2. 2.2.12 N F - K B luciferase reporter activity assay L N C a P cells were plated at 3 x 10 5 cells per well in six-well plates. After 24 h, a N F - K B luciferase reporter vector (Panomics, Fremont, C A , U S A ) containing six tandem copies of the consensus K B site were transiently transfected into the cells at 3 ug per well using Lipofectin reagent (Invitrogen). After 24 h, cells were treated as indicated in figure legends for an additional 24 h. The cells were then harvested in 1 x Passive Lysis Buffer (Promega, Madison, W l , U S A ) and frozen at -80 °C. Prior to measurement of luciferase activity, the lysates were thawed and the debris was spun down at 12,500 rpm for 5 min at 4 °C. Luciferase activity in the cell lysates (i.e. supernatant) collected was measured using the Luciferase Assay Reagent (Promega, Madison, W l , U S A ) as detected by a multifunctional microplate reader, Safire2™ (Tecan, Grodig, Austria). The luciferase activity was normalized to the protein concentration in each well as determined using Bradford assay. 67 2.2.13 C h r o m a t i n i m m u n o p r e c i p i t a t i o n Chromatin immunoprecipitation (ChIP) was modified from that of Narayanan et al. (33). L N C a P cells were plated at 3.5 x 10 6 in 15-cm dish. After 24 h, the media was replaced with S F M . After 24 h, the cells were treated with S F M supplemented with B S A (1 mg/ml) in the presence or absence of T N F - a (10 ng/ml) for 30 min. The proteins were cross-linked with 1 % formaldehyde for 10 min at 37 °C. The cells were washed with cold P B S once, scraped in 1 ml of P B S with l x Complete™ EDTA-free protease inhibitor (Roche Diagnostics), pelleted and resuspended in SDS lysis buffer (1 % SDS, 10 m M E D T A , 50 m M Tr i s -HCl [pH 8.1], l x protease inhibitor). After lysis on ice for 10 min, the cell extract was sonicated (Sonicator 3000 Ultrasonic Liquid Processor, Misonix, Farmingdale, N Y , U S A ) in an ice water bath ten times for 30 s each with an output level of 1. The average length of the sheared D N A fragments was 200-800 bp as monitored by agarose gel electrophoresis. The sonicated sample was pelleted at 13,000 rpm for 5 min at 4 °C. The supernatant was diluted 10-fold with ChIP dilution buffer (0.22 % Triton X -100, 1.2 m M E D T A , 16.7 m M Tr i s -HCl [pH 8.1], 167 m M N a C l , l x protease inhibitor). 100 p i was reserved as input. After preclearing with 50 pi nProtein A-Sepharose™ beads (Amersham Biosciences) in T E (1:1) with 2 ug of sheared salmon sperm D N A for 30 min at 4 °C, the remaining proteins were incubated with 5 ug of anti-p65 antibody (C-20; Santa Cruz Biotechnologies) or rabbit IgG overnight at 4 °C. The antibody-protein-DNA complex was precipitated by incubating with 100 ul of 1:1 nProtein A-Sepharose™ beads for 2 h at 4 °C. The beads were pelleted for 30 s at 4 °C and washed once each sequentially with low-salt wash buffer (0.1 % SDS, 1 % Triton X-100, 2 m M E D T A , 20 m M Tr i s -HCl [pH 8.1], 150 m M NaCl ) and T E . The protein-DNA complex was eluted 68 from the beads with 50 ul elution buffer (1 % SDS, 0.1 M N a H C 0 3 ) two times at room temperature. The cross-linking of the D N A protein complex was reversed by incubating at 65 °C for 6 h. The D N A was recovered and purified using the QIAquick® P C R Purification K i t ( Q I A G E N ) according to the manufacturer's instructions. The promoter and intronic regions of IKB-O. and NAIP were amplified using the primers in Table 2.2 using qPCR. The thermal cycling conditions were 50 °C for 2 min, 95 °C for 2 min, followed by 45 cycles of 30 s at 95 °C, 30 s at 55 °C and 30 s at 72 °C. Percentage input was calculated from dividing the arbitrary q P C R numbers obtained by each sample by that of the input. 2.2.14 Statistical analysis Data are presented as the mean ± standard deviation (SD). To assess statistical significance of differences, unpaired Student's Mest was used for statistical analysis, except for the analyses of experiments using the in vivo hollow fibre samples where 2-way Analysis of Variance ( A N O V A ) was applied. P-value < 0.05 was considered significant as indicated by asterisks. 2.3 RESULTS 2.3.1 IAP genes are differentially expressed in vivo in response to castration To assess the expression of the IAPs genes, NAIP, c-IAPl,XIAP and survivin, in response to androgen deprivation, the in vivo L N C a P hollow fibre model was applied. The model provides human CaP cells that are free from contamination with host cells by maintaining the cells in hollow fibres implanted subcutaneously in nude mice (31). L N C a P cells are the best-characterized CaP cell line that secretes prostate-specific antigen (PSA), the biomarker for CaP as well as other prostatic diseases, and responds, at 69 Binding Site Primers Size Sense Antisense IKB-O G A C G A C C C C A A T T C A A A T C G T C A G G C T C G G G G A A T T T C C 3 0 0 NAIP_KB-like-1 A A T C A A T G C A A C A A G G C A A T C A C G T T G T T G A C C C T T C T C C 2 9 5 NAIP_KB-like-2 T G G T C T T G G T T C C T G A C A C A T C A C T G G C A A C T G G T G G T T A 2 2 9 NAIP_KB-like-3 G A G C T G T G A T T G T G C C A T T G C A T T C A T T G G G C T G G G T A T T 2 5 6 T a b l e 2.2 P r i m e r s used i n the C h I P assay. q P C R assays were established for the K B -like sites on NAIP. The K B - l i k e sites in the promoter and the second intron of NAIP, the sequences of the sense and antisense in 5' to 3' orientation and the size of the specific amplified product (in base pairs) are shown. The primer pair for the N F - K B binding site on IKB-CX (34) was included as a positive control. 70 least initially, to androgen deprivation. Serum P S A levels were monitored weekly subsequent to implantation of hollow fibres. A s shown in F ig . 2.1 A , the serum P S A levels of hosts dropped by an average of 57 % by 10 days after castration. Total R N A was isolated from L N C a P cells retrieved before castration (i.e. 7 days after implantation) and 10 days after castration (i.e. 17 days after implantation). Levels of I A P m R N A , NAIP, c-IAPl, XIAP and survivin, were assessed using q P C R (Fig. 2 . IB) . In parallel to its serum level, PSA was down-regulated in response to castration as expected, consistent with clinical representation (35,36). The levels of m R N A for the IAPs, except survivin, were increased in response to castration. However, only the above 2-fold increase in NAIP expression was statistically significant. Thus, androgen deprivation by castration increases the levels of NAIP m R N A in CaP cells in vivo. 2.3.2 Androgen alters the levels of NAIP mRNA and the transcriptional activity of N F - K B in prostate cancer cells To test whether the increased levels of NAIP m R N A measured from in vivo samples were due to decreased androgen, we isolated total R N A from in vitro L N C a P cells that were subjected to 28 h of androgen deprivation subsequent to a 24-h pre-treatment in 10 n M D H T . The expression of PSA (i.e. as a control) and NAIP were evaluated using q P C R (Fig. 2.2A). The levels of PSA m R N A were decreased as expected while levels of NAIP m R N A were increased in the cells subjected to androgen deprivation as compared to cells without androgen deprivation. These results are consistent with the in vivo expression of NAIP in response to castration, and the data suggest that androgen deprivation increases the expression of NAIP in CaP cells. Previous studies demonstrate crosstalk between the androgen receptor (AR) and 71 Pre-Cx PostCx PSA NAIP C-IAP1 XIAP Survivin Figure 2.1. Differential expression levels of IAP genes in response to castration in the LNCaP hollow fibre model. (A) Effects of castration on nude mice bearing L N C a P cells were monitored by measuring serum P S A levels. The serum P S A levels were normalized to the number of hollow fibres remaining in the hosts. Pre-castrate levels of P S A were in the range of 14-18 ng/ml and set at 100 % for each host. The bars represent the mean percentages of the pre-castrate serum P S A levels ± SD (n = 4) on 7 d after implantation (pre-Cx) and 10 d after castration (post-Cx). (B) Total R N A was isolated from the in vivo L N C a P hollow fibre models 7 d after implantation (pre-Cx) and 10 d after castration (post-Cx). q P C R was performed with primers specific for each gene. The expression levels of each gene were normalized to the m R N A levels of G A P D H in each biological replicate. Data are calculated as mean fold change relative to the pre-castrate levels (set as 1-fold) from three different animals (n = 3). PSA, an androgen-regulated gene, was assessed as a positive control. The levels of significance between cells obtained from each time point were determined by 2-way A N O V A : * P < 0.05, ** P < 0.01. 72 F i g u r e 2.2. A n d r o g e n i n h i b i t s express ion o f N A I P a n d the t r a n s c r i p t i o n a l ac t i v i t y o f N F - K B . (A) L N C a P cells were maintained in 10 n M D H T for 24 h prior to separating them into two groups (n = 3 for each group). While one group was maintained in 10 n M D H T (no A D ) , the other group was replenished with S F M devoid of androgen (AD) . After 2 7 h of culture, total R N A was isolated from the cells and the expression levels of PSA and NAIP were assessed using qPCR. Levels of m R N A for these genes were normalized to levels of G A P D H m R N A in each replicate. P S A m R N A was included as a positive control. (B) L N C a P cells were transfected with the N F - K B luciferase reporter gene construct (3 ug). The cells were treated with 10 ng/ml T N F - a , 10 n M R1881 or S F M with vehicle (i.e. B S A for T N F - a treatment and ethanol for R1881 treatment). After 24 h of culture, the cells were harvested and luciferase activities were measured. Luciferase activities were normalized to the protein levels in each well . A D , androgen deprivation. The means ± SD of triplicates are shown. The levels of significance between cells subjected to different treatments were determined by Student's Mest: * P < 0.05, ** P < 0.01. Representative results of multiple experiments are shown. 73 N F - K B in an androgen-responsive fashion (37,38). To confirm i f androgen has a direct effect on N F - K B in our model, the transcriptional activity of N F - K B was evaluated through the use of a luciferase reporter construct with six tandem K B sites in the promoter region. The reporter was transfected into L N C a P cells which were then treated with 10 n M R1881, a synthetic androgen. Treatment of cells with T N F - a was used as a positive control to induce N F - K B transcriptional activity. A s shown in Fig . 2.2B, the treatment of L N C a P cells with R1881 for 24 h resulted in a 27 % reduction in N F - K B activity as compared to the vehicle control. Thus, androgen inhibits the transcriptional activity of N F - K B . 2.3.3 Expression and DNA-binding activity of N F - K B in prostate cancer cells maintained in vitro To further investigate the influence of androgen and A R on N F - K B , the levels of nuclear N F - K B protein and the DNA-binding activity of N F - K B were examined using human CaP cell lines with different androgen requirements and A R status. Unlike L N C a P cells, PC3 cells and DU145 cells are androgen-insensitive and lack a functional A R . Nuclear extracts obtained from unstimulated L N C a P cells, TNF-a-stimulated L N C a P cells, PC3 cells and DU145 cells were subjected to Western blot analysis to determine relative protein levels of the N F - K B subunits, p65 and p50. These nuclear extracts were also used to determine the DNA-binding activity of N F - K B using E M S A . Nuclear extract from TNF-a-stimulated L N C a P cells were included as a positive control. The specificity of the shifted bands corresponding to the different N F - K B - D N A complexes was confirmed by supershift assay in the presence of anti-p65 or -p50 antibody or by competition assay in the presence of excess non-labelled consensus or mutant 74 oligonucleotide probes. Different CaP cell lines exhibited varying levels of N F - K B proteins in nuclear extracts (Fig. 2.3A). A s shown in Fig . 2.3B, the differential levels of p65 and p50 proteins corresponded with differential N F - K B - D N A - b i n d i n g activity in the nuclear proteins of in vitro CaP cells. Specifically, the androgen-insensitive DU145 cells exhibited the highest nuclear levels of protein and DNA-binding activity of N F - K B amongst the unstimulated CaP cells. Interestingly, the nuclear levels of protein and D N A -binding activity of N F - K B in unstimulated cells were DU145 > PC3 > L N C a P . This observation implies that DNA-binding activity of N F - K B is related to the nuclear localization and levels of the N F - K B subunits present in the nuclear proteins. Moreover, as expected, these results also suggest that the nuclear levels of protein and DNA-binding activity of N F - K B may involve multiple mechanisms in addition to androgen requirement and A R status in vitro. 2.3.4 Expression of N A I P and N F - K B in vivo in response to castration Correlation between expression of N A I P and p65, the subunit of N F - K B with a transactivation domain, in response to androgen deprivation was examined by I H C using L N C a P xenografts harvested from hosts before castration and 10 days after castration. A s shown in Fig . 2.4, the levels of p65 protein increased slightly while the levels of N A I P protein increased much more noticeably in response to castration of the host. Specifically, the increases of N A I P protein localized near the periphery of the tumour tissue near blood vessels, whereas the increase of p65 protein was relatively homogeneous within the tumour tissue. However, the heterogeneity of N A I P staining may be attributed to macrophages residing in these tissues (39) and was thus further examined using the hollow fibre model that restricts infiltration of cells as described below. Immunostaining 75 TNF- a: p65 ft-actin p50 (i-actin B <b s/ v 3 v v v >• >/ TNF- a: Ab: CNF-KB: mNF-KB: S S * S S * p65/p50 ( N F - K B ) * p50/p50 • Free oligo* Figure 2 .3 . Differential expression and D N A - b i n d i n g activity of N F - K B in C a P cells. Nuclear extracts were prepared from untreated LNCaP cells, TNF-a-stimulated LNCaP cells (i.e. positive control), PC3 cells and DU145 cells. (A) Levels of NF-KB protein in the nucleus were measured using Western blot analysis with anti-p65, anti-p50 and anti-p-actin (as loading control) antibodies and nuclear extracts (20 ug proteins) from LNCaP, PC3 and DU145 cells. (B) DNA-binding activity of NF-KB was assessed using EMSA. EMS As were performed by incubation of the nuclear extracts (10 ug proteins) of CaP cell lines with P-labelled oligonucleotide probe containing a consensus NF-KB DNA-binding motif. To ensure specificity, nuclear extracts were preincubated with antibodies (Ab) for p65 or p50 or an excess of non-labelled consensus (CNF-KB) or mutant (mNF-K B ) NF-KB oligonucleotides. SS, supershifted antibody-protein-DNA complex. Representative results of multiple experiments are shown. 76 Pre-Cx Post-Cx Figure 2.4. Levels of N A I P and N F - K B protein in L N C a P tumours before and after castration of the hosts. L N C a P xenograft tumour tissues were obtained from mice sacrificed when the tumour averaged =100 m m 3 in volume before castration (pre-Cx) and 10 days after castration (post-Cx). Sections of tumour tissues were immunostained (diaminobenzidine with hematoxylin counterstaining) for N A I P and the p65 subunit of N F - K B . The box within each image is a cropped region from the upper right-hand corner of the image to enable a closer view of the expression levels. Tumour tissues from the same L N C a P xenografts were incubated with secondary antibody only prior to staining with hematoxylin as a control. Magnification, 400x. 77 with secondary anti-rabbit antibody alone (Fig. 2.4) indicated that the positive staining was not due to non-specificity of secondary antibodies or the I H C procedures. The expression of N A I P and N F - K B were also examined in the subcellular extracts of pure population of CaP cells obtained from the L N C a P hollow fibre model as described earlier using Western blot analysis. On the one hand, levels of N A I P protein at approximately 160-kDa were consistently elevated in three hosts subsequent to castration (Fig. 2.5A). The protein levels correlated with the transcript levels of N A I P in CaP cells devoid of macrophages harvested from the hollow fibre model. On the other hand, the protein levels of the N F - K B subunits, p65 and p50, remain constant in the nucleus upon castration of the hosts (Fig. 2.5B). Three groups of procedural control mice (i.e. intact, mock castration, castration with the addition of testosterone pellet) were maintained throughout the same length of time as the hollow fibre model experiment with castrated mice. L ike the castrated mice, serum P S A levels were monitored weekly subsequent to implantation (Fig. 2.6A) and the protein levels of N F - K B were determined (Fig. 2.6B-D). The results obtained from the procedural control mice confirmed that the results obtained from the castrated mice were not due to artefacts from the invasive surgical procedures performed on the hosts, but in fact due to the castration and reduction of androgen. 2.3.5 D N A - b i n d i n g a c t i v i t y o f N F - K B i n p ros ta te cancer cells in vivo To study the effect of castration on DNA-binding activity of N F - K B , nuclear extracts isolated from the L N C a P hollow fibre model before castration and after castration were subjected to E M S A (Fig. 2.7A). The specificity of the shifted bands corresponding to the different N F - K B - D N A complexes was confirmed by supershift assay in the presence of anti-p65 or -p50 antibody or competition assay in the presence of 78 Figure 2.5. Levels of N A I P and N F - K B protein in L N C a P cells from the L N C a P hollow fibre model before and after castration of the hosts. (A) Cytosolic extracts (60 ug proteins) from L N C a P cells harvested from the hollow fibre model after implantation (pre-Cx) and 10 d after castration (post-Cx) were subjected to Western blot analysis with anti-NAIP antibody. Bands at 160 kDa corresponded to N A I P protein. The membrane was stripped and reprobed with anti-P-actin as a loading control. (B) The nuclear extracts (20 |o,g protein) from L N C a P cells harvested from the hollow fibre model were also investigated in Western blot analysis (Odyssey® detection method) with anti-p65, anti-p50 and anti-P-actin (as a loading control) antibodies. Solid bars mark protein extracts from the same animal before and after castration (n = 3). A l l images are representative of biological replicates and multiple experiments. 79 Figure 2.6. Levels of NAIP and N F - K B protein in LNCaP cells from the LNCaP hollow fibre model in procedural control mice. (A) Serum P S A levels were monitored in the L N C a P hollow fibre model. The serum P S A levels were normalized to the number of hollow fibres remaining in the hosts. Pre-castrate levels of P S A were in the range of 14-18 ng/ml. The solid bars represent the mean percentages of the pre-castrate serum P S A levels ± SD (n = 4) on 7 d and 17 d after implantation. Intact, no surgical procedures; Mock C x , surgery but no removal of gonads; C x + T, castration and immediate testosterone replacement. Mock castration or castration was performed on day 7. The levels of significance between cells obtained from each time point were determined by 2-way A N O V A : * P < 0.05. Nuclear extracts were prepared from L N C a P cells harvested from the procedural control mice at the same time points used for castrated mice, 7d and 17 d after implantation of the hollow fibres. (B) Intact, no major surgical procedure was performed on the mice throughout the experiment after implantation of the fibres. ( Q Mock Cx , a small incision in the scrotum was made without removal of the testicles; (D) C x + T, a testosterone pellet was added to each mouse upon castration on 7 d after implantation. Levels of N F - K B in the nuclear extracts (20 ug proteins) were measured by Western blot analysis using anti-p65, anti-p50 and anti-P-actin (as loading control) antibodies. A l l images are representative of biological replicates. 80 Figure 2.7. Increased D N A - b i n d i n g activity of N F - K B in response to castration of the hosts. (A) E M S A s were performed by incubating nuclear extracts (5 ug protein) obtained from the in vivo L N C a P hollow fibre models with 3 2 P-labelled oligonucleotide probe containing a consensus N F - K B DNA-binding motif. Controls for binding specificity include nuclear extracts of in vitro untreated L N C a P cells and T N F - a -stimulated L N C a P cells that were preincubated with antibodies (Ab) for p65 or p50 or an excess of non-labelled consensus ( C N F - K B ) or mutant ( m N F - K B ) N F - K B oligonucleotides. SS, supershifted antibody-protein-DNA complex. (B) E M S A s were performed using matched samples (pre-Cx and post-Cx) from 3 different animals (n = 3). The bands corresponding to the N F - K B - D N A complex in E M S A s were quantified using densitometry. The solid bars represent the mean fold-change of the biological triplicates of post-Cx as compared with the pre-Cx levels (set as 1-fold). The levels of significance between cells obtained from each time point were determined by 2-way A N O V A : * P < 0.05. 81 excess non-labelled consensus or mutant oligonucleotide probes. The densities of the bands corresponding to the N F - K B - D N A complexes were quantified and expressed as average fold-induction relative to the pre-castrate levels from biological triplicates (Fig. 2.7B). Intriguingly, despite similar nuclear expression of the N F - K B subunits (Fig. 2.5B), N F - K B DNA-binding activity was elevated significantly in response to castration. Importantly, the changes in DNA-binding activity correlated with the expression of N A I P at the m R N A and protein levels (Fig. 2 . IB & 2.5A). Nuclear extracts from procedural control mice obtained at different times (described earlier) had similar N F - K B D N A -binding activity as shown using E M S A (Fig. 2 .8A-C) , thereby eliminating the possibility that the results with castrated mice were due to artefacts from surgical procedures. Thus, castration and the reduction of androgen increase N F - K B DNA-binding activity. 2.3.6 B i n d i n g o f N F - K B i n the N A I P locus N F - K B may promote anti-apoptotic properties via transcriptional regulation of anti-apoptotic genes. In fact, some members of the I A P family, C-IAP2 (40) and survivin (18), are direct binding targets of N F - K B . Recent studies suggest that the expression of NAIP may be directly regulated by N F - K B (41,42), but biological confirmation has not been shown. Here we observed that the increase in N A I P expression correlated with N F -KB-DNA-bind ing activity in response to androgen deprivation. Based upon this correlation, we sought to determine a potential role for N F - K B in the transcriptional regulation of NAIP. The human NAIP locus [GeneBank Accession N o . U19251] (43) on chromosome 5 was examined for putative K B site, G G G R N N Y Y C C [R = purine, N = any base, Y = pyrimidine] using ConSite [http://asp.ii.uib.no:8090/cgi-bin/CONSITE/consite/] (44) with 80 % cut-off. A s shown in Table 2.3, initial screening 82 T N F - a: Ab: C N F - K B : mNF-KB-like: It p65/p50 ( N F - K B ) * p50/p50> - - - p65 p50 - - - -_ _ _ _ _ _ + B S S * s s * p65/p50 ( N F - K B ) * p50/p50* S S * S S * p65/p50 ( N F - K B ) * p50/p50* y Intact MockCx Cx + T Figure 2.8. D N A - b i n d i n g activity of N F - K B in procedural control mice. Nuclear extracts were prepared from L N C a P cells of the in vivo hollow fibre implanted in procedural control mice at the same time points used for castrated mice, 7 d and 17 d after implantation of the hollow fibres, (a) Intact, no surgical procedure was performed on the mice throughout the experiment; (b) Mock Cx , a small incision in the scrotum was made without removal of the testicles on 7 d after implantation; (c) C x + Testosterone, a testosterone pellet was added to each mouse upon castration on 7 d after implantation. E M S A s were performed by incubating the nuclear extracts (5 ug proteins) with P-labelled oligonucleotide probe containing a consensus N F - K B DNA-bind ing motif. To ensure binding specificity, nuclear proteins of in vitro untreated L N C a P cells and T N F - a -treated L N C a P cells were preincubated with antibodies (Ab) for p65 or p50 or an excess of non-labelled consensus ( C N F - K B ) or mutant ( m N F - K B ) N F - K B oligonucleotides. SS, supershifted antibody-protein-DNA complex. E M S A s were performed using in vivo samples from biological triplicates. A l l images are representative of biological replicates. 83 Site Coordinates Sequence (5'—3'> Identity Concensus GGGRNYYYCC KB-oligo GGGACTTTCC KB-like-1 -1520to-1511 GGGGATTTAC 9/10 KB-like-2 -241 to-232 GGGGCTATCC 9/10 KB-like-3 498 to 507bp 5' to exon 3 GGTAATTTCC 9/10 T a b l e 2.3. N F - K B - b i n d i n g sites i n the NAIP p r o m o t e r a n d second i n t r o n . The sequences and location of KB-like sites in the promoter and second intron of NAIP. Identity indicates the number of nucleotides which are identical to the 10 nucleotides of the N F - K B consensus sequence. Coordinates determined from the sequence are based on GeneBank Accession No . U19251 (43). R = any purine, N = any nucleotide, Y = any pyrimidine. 84 with ConSite revealed two K B - l i k e sites in the promoter region and one K B - l i k e site within the second intron of NAIP that are highly homologous to the consensus K B site. To test N F - K B binding on these K B - l i k e sequences, E M S A was employed using custom oligonucleotide probes containing the K B - l i k e sites and nuclear extracts from in vitro and in vivo (i.e. from the hollow fibre model) L N C a P cells (Fig. 2 .9A-C). Mutant oligonucleotide probe with a mutated base pair for each custom probe was used in competition assay to confirm the specificity of the binding sequence in the N F - K B - D N A complexes. N F - K B from nuclear extracts demonstrated enhanced DNA-binding activity on all K B - l i k e sites (Fig. 2 .9A-C) similar to that achieved with the consensus K B sites (Fig. 2.7A). N F - K B complexes binding on these K B - l i k e sites suggested that the expression of N A I P may be transcriptionally regulated by N F - K B binding to these sites located within the promoter and intronic regions in the gene locus. To validate the physiological relevance of N F - K B binding on these K B - l i k e sites in the promoter and intronic regions of NAIP, ChIP assays were performed on the K B - l i k e sites in L N C a P cells stimulated with T N F - a . Subsequent to cross-linking of protein-DNA complexes and sonication of the nuclear proteins, immunoprecipitations were performed using an antibody specific for p65. Primers specific for the K B - l i k e sites on the promoter and intronic regions of NAIP were used to amplify immunoprecipitated D N A using qPCR. Immunoprecipitation of sonicated nuclear extracts with rabbit IgG was performed in place of anti-p65 antibody as controls for no antibody. A s shown in Fig . 2.9D, the recruitment of p65 was modestly enhanced on all K B - l i k e sites in the NAIP locus in response to T N F - a as compared with the recruitment in the vehicle control. Only the recruitment on KB - l ike -3 site located within the second intronic region demonstrated 85 TNF- a: Ab: C N F - K B : mNF-KB-like: p65/p50 ( N F - K B ) * ' 5 0 * p50/p C B s s * s s * p65/p50 ( N F - K B ) * p50/p50* 5 S * 5 S * p65/p50 ( N F - K B ) * p50/p50* _ + _ _ _ _ _ _ - - p65 p50 hB-like-1 KB-like-2 KB-like-3 60.0' •g 400-J. i i I __£J BSA - IgG _2_3 TNF-a - IgG o a BSA - p65 ••TNF-a - p65 /xfi-fx KB-like1 KB-like2 KB-like 3 Figure 2.9. N F - K B is recruited to the regulatory elements in the NAIP locus. Nuclear proteins from untreated L N C a P cells, TNF-a-treated L N C a P cells and the L N C a P cells obtained from the in vivo hollow fibre models at the time points of pre-castration (pre-Cx) and 10 d after castration (post-Cx) were used to perform E M S A using 3 2 P-labelled oligonucleotide probes containing (A) KB - l ike-1 site, (B) KB - l i ke -2 site and ( Q KB-like-3 site in the NAIP locus. E M S A was performed using in vivo samples from biological triplicates; all images are representative of the replicates. (D) L N C a P cells were treated with 10 ng/ml T N F - a (or B S A only as the vehicle control) for 30 min and used in ChIP assay with rabbit IgG (i.e. no antibody control) or anti-p65 antibody as described in Materials and Methods. Eluted D N A fragments were then purified and used for q P C R with primers designed to amplify the I K B - O enhancer (i.e. positive control) or the KB-like sites in the promoter and second intron of NAIP locus. The percentage input of each sample was averaged from triplicates. The levels of significance between cells subjected to different treatments were determined by Student's f-test: * P < 0.05, ** P < 0.01. 86 statistically significant increase in physical association. 2.4 D I S C U S S I O N Despite much effort in investigating the hormonal progression of CaP in the past decades, the underlying molecular mechanism remains elusive. It is postulated that androgen deprivation may lead to new outgrowth of cells with distinct molecular properties that are resistant to apoptosis (45). In the current study, we have profiled the expression of IAPs, which are known for their anti-apoptotic functions, in response to androgen deprivation in the in vivo hollow fibre model, and we have investigated the possible role of N A I P in the survival of CaP cells in androgen-deprived conditions as a direct regulatory target of N F - K B . Accumulating evidence from recent studies supports the role of IAPs in CaP as anti-apoptotic regulators of caspase (reviewed in (46)). Here we identified that one of these I A P genes, NAIP, was significantly up-regulated in the in vivo L N C a P hollow fibre model in response to castration of the host. Unexpectedly, the expression of survivin was significantly down-regulated and the expression of c-IAPl and XIAP were not significantly altered. c-IAPl and XIAP are known to be transcriptionally regulated by N F -K B (19,20), and thus the lack of statistical significance may be due to the subtle changes in N F - K B activity demonstrated at the designated time points during the hormonal progression or differences in the kinetics of individual genes. Alternatively, the expression of these genes and survivin might require factor(s) which facilitate the N F - K B signalling and the transcriptional regulation may vary depending on the cellular context and experimental conditions. Collecting in vivo samples from additional time-points after castration may help to address these unknowns by providing a comprehensive profile of 87 IAPs expression and N F - K B activity during the hormonal progression to androgen independence. Here, only NAIP was consistently and significantly differentially expressed in response to androgen ablation of the hosts with the increase in transcript levels corresponding to the protein expression in response to androgen deprivation. N A I P is the founding member of the human IAPs identified. Its deficiency, as a result of deletions in a gene region, has been primarily associated with the most severe phenotypes of a hereditary neurodegenerative disorder, spinal muscular atrophy ( S M A ) , due to the loss of its neuroprotective activity in motor neurons in the spinal cord (9). Expression of N A I P in tissues that are not exclusively neuronal and not directly associated with S M A suggests functions beyond its neuronal context (39,47). N A I P protects mammalian cells from apoptosis induced by a variety of stimuli (7). A s a caspase regulator, native N A I P inhibits caspase-3 and caspase-7, the effector caspases, and associates with caspase-9, the initiator caspase, in the presence of A T P (10,11). The presence of a central nucleotide binding oligomerization domain and a carboxyl-terminal leucine-rich repeat domain might enable N A I P to promote additional cytoprotection and other functions uniquely from other I A P members (11). However, little is known about the regulatory events of N A I P . In this study, we observed a direct link between N A I P expression and N F - K B DNA-binding activity in response to androgen deprivation. The upregulation of NAIP gene expression and its dependence on androgen was validated by in vitro experiments controlling for the presence of androgens. Androgen deprivation increased levels of N A I P m R N A , and the complementary experiment showed that the presence of androgen inhibited N F - K B activity. The reduction in N F - K B transcriptional activity in the presence 88 of androgen as demonstrated by the N F - K B luciferase reporter assay suggests that the differential N F - K B binding activity evident from in vivo L N C a P cells corresponded to the androgen levels in the microenvironment of the CaP cells. This means that when a host bearing CaP cells is castrated, an increase in N F - K B DNA-binding activity should be observed in response to castration. Previously reported crosstalk between A R and N F - K B may suggest the mechanism by which this occurs. A R and p65 were shown to mutually repress the transactivation activity of each protein (37,38). Consistent with these studies, here, transfecting a N F - K B luciferase reporter construct similar to that used by Palvimo et al. (38) in L N C a P cells with endogenous A R yielded similar inhibition in the presence of androgen. In vitro CaP cell lines demonstrated distinctive nuclear levels and DNA-binding activity of N F - K B that was independent of A R status. These results were consistent with previous reports that nuclear localization of the subunits, p65 and p50, was responsible for the corresponding N F - K B activity associated with the disease progression and androgen-responsiveness of CaP cells (48-51). Curiously, nuclear levels of N F - K B did not correlate to its binding activity when using extracts prepared from samples maintained in vivo in response to castration of the hosts. Thus, N F - K B activity in vivo may be modulated by post-translational modification of the N F - K B subunits, such as phosphorylation and acetylation (reviewed in (52)). Nevertheless, while results from the in vivo L N C a P hollow fibre model suggest that the NAIP expression and N F - K B activity responded to changes in androgen status, results using AR-negative cells suggest that it is important to consider the cellular context when studying the effect of androgen deprivation in CaP cells. Moreover, it would be unreliable to study the effect of androgen 89 deprivation employing an in vitro strategy alone. To this extent, how the A R status would affect N F - K B activity remains a challenging concept to be interpreted since studies which suggested crosstalk between A R and N F - K B signalling pathways were only conducted in vitro. Our observations of elevated levels of N A I P that correlated with the N F - K B binding activity in in vivo CaP cells during hormonal progression are consistent with the results of Poma et al. (41) which showed that the novel N F - K B inhibitor, dehydroxymethylepoxyquinomicin, decreased m R N A levels of N A I P in human hepatic cancer cells. They also agree with the findings of Notarbartolo et al. (42) that the multi-drug-resistant leukemia cells with abundant N A I P expression exhibited constitutive activation of N F - K B . These data suggest that N A I P may be transcriptionally regulated by N F - K B . Here, the application of E M S A revealed N F - K B DNA-binding to three previously uncharacterized N F - K B regulatory binding elements in the NAIP promoter (about 1.5 kb and 200 bp upstream of transcriptional start site) and intronic (between exon 2 and exon i 3) regions. However, ChIP experiments validated increased N F - K B binding in situ on only one of these sites. This was the regulatory element in the second intron. Although these ChIP experiments did not show statistically significant increase in N F - K B D N A -binding on the other K B - l i k e sites in the promoter region, they may still be functional K B -like sites merely requiring optimization and/or a different set of experimental conditions. The increase in N F - K B binding on the K B - l i k e sites as demonstrated by ChIP is minimal as compared to the binding on the IKB-OI enhancer upon T N F - a stimulation. This is not surprising as NAIP expression may be regulated by multiple factors. Previous studies demonstrate that P A X 2 (53), a developmental transcription factor and Brn-2 (54), a P O U 90 domain transcription factor may regulate the transcription of NAIP via direct binding on putative regulatory elements in the gene locus. However, since the binding of those transcription factors to their respective putative regulatory elements on the NAIP locus was only demonstrated in E M S A , an in vitro assay, the binding in situ has yet to be confirmed using method by which physiological conditions, i.e. chromatin structure, are considered. Yet another possibility is that there are differences in cofactors involved in the transcriptional complexes under different conditions. Furthermore, putative regulatory elements of other transcription factors are yet to be validated (54). Alternatively, N F - K B activity induced by androgen-deprivation may be different from that induced by T N F - a . Together, these findings demonstrate that N F - K B can regulate the transcription of the NAIP gene through cis-regulatory elements that resemble the N F - K B consensus binding motif. Intriguingly, the KB - l ike -3 site which demonstrated the significant increase in binding upon T N F - a stimulation lies 5' upstream and in close proximity to the constitutive transcription start site within the non-long-terminal-repeat promoter as identified by Romanish et al. (47). The resulting transcript w i l l yield the same protein product as the commonly-cited transcript described by Chen et al. (43). A l l in all , our observations demonstrate that N A I P may jo in c - I A P l , C - IAP2 and survivin as N F - K B -regulated IAPs via transcriptional regulation on regulatory elements in the gene locus. 2.5 C O N C L U S I O N A N D S I G N I F I C A N C E In summary, the current study identified a direct link between the expression of N A I P and N F - K B activity in vitro and in vivo in response to androgen deprivation in CaP cells and characterized three functional cis-regulatory elements of NAIP in the promoter and intronic regions. The elevated expression of N A I P in androgen-depleted conditions, 91 at least in part, is mediated through N F - K B regulation on the icB-like sites in the gene locus. Our results, coupled with other groups' observations, suggest that N A I P may enhance survival of CaP cells by allowing them to bypass the apoptotic fate in response to androgen deprivation. The enhanced survival may enable the CaP cells to progress to the terminal stage with androgen-independent phenotypes. This mechanism may involve clonal selection for a subpopulation of pro-survival CaP cells that may prevail by increased N F - K B DNA-binding activity in response to androgen withdrawal. Thus, although androgen ablation remains the most effective means to reduce the tumour burden of androgen-dependent disease, our findings reveal a potential mechanism by which the disease may progress to the androgen independent stage. It is hopeful that elucidation of the molecular pro-survival mechanism mediated by N F - K B w i l l translate into improved management of CaP through modulating the anti-apoptotic activity. Further investigation on how N A I P and other IAPs are regulated and expressed is warranted and could lead to development of novel intervention to prevent CaP progression. 92 2.6 R E F E R E N C E S 1. Huggins, C. and Hodges, C . V . (1941) Studies on prostatic cancer: The effect of castration, of estrogen and of androgen injection on serum phosphatases in metastatic carcinoma of the prostate. Cancer Res, 293-297. 2. Liston, P., Fong, W . G . and Korneluk, R . G . (2003) The inhibitors of apoptosis: there is more to life than Bc l2 . Oncogene, 22, 8568-8580. 3. Chen, Z . , Naito, M . , Hori , S., Mashima, T., Yamori , T. and Tsuruo, T. (1999) A human IAP-family gene, apollon, expressed in human brain cancer cells. Biochem Biophys Res Commun, 264, 847-854. 4. Vucic , D . , Stennicke, H.R. , Pisabarro, M . T . , Salvesen, G.S. and Dixit , V . M . (2000) M L - I A P , a novel inhibitor of apoptosis that is preferentially expressed in human melanomas. Curr Biol, 10, 1359-1366. 5. Rothe, M . , Pan, M . G . , Henzel, W.J . , Ayres, T . M . and Goeddel, D . V . (1995) The T N F R 2 - T R A F signaling complex contains two novel proteins related to baculoviral inhibitor of apoptosis proteins. Cell, 83, 1243-1252. 6. Ambrosini, G . , Adida, C. and Alt ier i , D . C . (1997) A novel anti-apoptosis gene, survivin, expressed in cancer and lymphoma. Nat Med, 3, 917-921. 7. Liston, P., Roy, N . , Tamai, K . , Lefebvre, C , Baird, S., Cherton-Horvat, G . , Farahani, R., McLean, M . , Ikeda, J.E., MacKenzie, A . et al. (1996) Suppression of apoptosis in mammalian cells by N A I P and a related family of I A P genes. Nature, 379, 349-353. 8. Richter, B . W . , M i r , S.S., Eiben, L . J . , Lewis, J., Reffey, S.B., Frattini, A . , Tian, L . , Frank, S., Youle, R.J . , Nelson, D . L . et al. (2001) Molecular cloning of ILP-2, a 93 novel member of the inhibitor of apoptosis protein family. Mol Cell Biol, 21, 4292-4301. 9. Roy, N . , Mahadevan, M . S . , McLean , M . , Shutler, G . , Yaraghi, Z . , Farahani, R., Baird, S., Besner-Johnston, A . , Lefebvre, C. , Kang, X . et al. (1995) The gene for neuronal apoptosis inhibitory protein is partially deleted in individuals with spinal muscular atrophy. Cell, 80, 167-178. 10. Maier, J .K. , Lahoua, Z . , Gendron, N . H . , Fetni, R., Johnston, A . , Davoodi, J., Rasper, D . , Roy, S., Slack, R.S. , Nicholson, D . W . et al. (2002) The neuronal apoptosis inhibitory protein is a direct inhibitor of caspases 3 and 7. J Neurosci, 22, 2035-2043. 11. Davoodi, J., L i n , L . , Ke l ly , J., Liston, P. and MacKenzie, A . E . (2004) Neuronal apoptosis-inhibitory protein does not interact with Smac and requires A T P to bind caspase-9. J Biol Chem, 279, 40622-40628. 12. Hunter, A . M . , Lacasse, E . C . and Korneluk, R . G . (2007) The inhibitors of apoptosis (IAPs) as cancer targets. Apoptosis, 12, 1543-1568. 13. Krajewska, M . , Krajewski, S., Banares, S., Huang, X . , Turner, B . , Bubendorf, L . , Kall ioniemi, O.P., Shabaik, A . , Vit ie l lo , A . , Peehl, D . et al. (2003) Elevated expression of inhibitor of apoptosis proteins in prostate cancer. Clin Cancer Res, 9, 4914-4925. 14. Tirro, E . , Consoli , M . L . , Massimino, M . , Manzella, L . , Frasca, F. , Sciacca, L . , Vicar i , L . , Stassi, G . , Messina, L . , Messina, A . et al. (2006) Altered expression of c - I A P l , survivin, and Smac contributes to chemotherapy resistance in thyroid cancer cells. Cancer Res, 66, 4263-4272. 94 15. Zhang, M . , Latham, D .E . , Delaney, M . A . and Chakravarti, A . (2005) Survivin mediates resistance to antiandrogen therapy in prostate cancer. Oncogene, 24, 2474-2482. 16. Nomura, T., Yamasaki, M . , Nomura, Y . and Mimata, H . (2005) Expression of the inhibitors of apoptosis proteins in cisplatin-resistant prostate cancer cells. Oncol Rep, 14, 993-997. 17. LaCasse, E . C , Baird, S., Korneluk, R . G . and MacKenzie, A . E . (1998) The inhibitors of apoptosis (IAPs) and their emerging role in cancer. Oncogene, 17, 3247-3259. 18. Kawakami, H . , Tomita, M . , Matsuda, T., Ohta, T., Tanaka, Y . , Fujii , M . , Hatano, M . , Tokuhisa, T. and M o r i , N . (2005) Transcriptional activation of survivin through the NF-kappaB pathway by human T-cell leukemia virus type I tax. Int J Cancer, 115, 967-974. 19. Stehlik, C , de Martin, R., Kumabashiri, I., Schmid, J .A. , Binder, B . R . and Lipp, J. (1998) Nuclear factor (NF)-kappaB-regulated X-chromosome-linked iap gene expression protects endothelial cells from tumor necrosis factor alpha-induced apoptosis. J Exp Med, 188, 211-216. 20. Wang, C . Y . , Mayo, M . W . , Korneluk, R . G . , Goeddel, D . V . and Baldwin, A . S . , Jr. (1998) NF-kappaB antiapoptosis: induction of T R A F 1 and T R A F 2 and c - I A P l and C-IAP2 to suppress caspase-8 activation. Science, 281, 1680-1683. 21. Chu, Z . L . , McKinsey , T . A . , L i u , L . , Gentry, J.J., Ma l im , M . H . and Ballard, D . W . (1997) Suppression of tumor necrosis factor-induced cell death by inhibitor of apoptosis C-IAP2 is under NF-kappaB control. Proc Natl Acad Sci USA, 94, 95 10057-10062. 22. Dutta, J., Fan, Y . , Gupta, N . , Fan, G . and Gelinas, C. (2006) Current insights into the regulation of programmed cell death by NF-kappaB. Oncogene, 25, 6800-6816. 23. Courtois, G . and Gilmore, T .D. (2006) Mutations in the NF-kappaB signaling pathway: implications for human disease. Oncogene, 25, 6831-6843. 24. Karin , M . (2006) Nuclear factor-kappaB in cancer development and progression. Nature, 441,431-436. 25. Suh, J. and Rabson, A . B . (2004) NF-kappaB activation in human prostate cancer: important mediator or epiphenomenon? J Cell Biochem, 91, 100-117. 26. Sweeney, C , L i , L . , Shanmugam, R., Bhat-Nakshatri, P., Jayaprakasan, V . , Baldridge, L . A . , Gardner, T., Smith, M . , Nakshatri, H . and Cheng, L . (2004) Nuclear factor-kappaB is constitutively activated in prostate cancer in vitro and is overexpressed in prostatic intraepithelial neoplasia and adenocarcinoma of the prostate. Clin Cancer Res, 10, 5501-5507. 27. Shukla, S. and Gupta, S. (2004) Suppression of constitutive and tumor necrosis factor alpha-induced nuclear factor (NF)-kappaB activation and induction of apoptosis by apigenin in human prostate carcinoma PC-3 cells: correlation with down-regulation of NF-kappaB-responsive genes. Clin Cancer Res, 10, 3169-3178. 28. Yemelyanov, A . , Gasparian, A . , Lindholm, P., Dang, L . , Pierce, J.W., Kisseljov, F. , Karseladze, A . and Budunova, I. (2006) Effects of I K K inhibitor PSI 145 on NF-kappaB function, proliferation, apoptosis and invasion activity in prostate 96 carcinoma cells. Oncogene, 25, 387-398. 29. Huerta-Yepez, S., Vega, M . , Garban, H . and Bonavida, B . (2006) Involvement of the TNF-alpha autocrine-paracrine loop, via NF-kappaB and Y Y 1 , in the regulation of tumor cell resistance to Fas-induced apoptosis. Clin Immunol, 120, 297-309. 30. Kucharczak, J., Simmons, M . J . , Fan, Y . and Gelinas, C. (2003) To be, or not to be: NF-kappaB is the answer—role of Rel/NF-kappaB in the regulation of apoptosis. Oncogene, 22, 8961-8982. 31. Sadar, M . D . , Akopian, V . A . and Beraldi, E . (2002) Characterization of a new in vivo hollow fiber model for the study of progression of prostate cancer to androgen independence. Mol Cancer Ther, 1, 629-637. 32. Andrews, N . C . and Faller, D . V . (1991) A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Res, 19, 2499. 33. Narayanan, R., Adigun, A . A . , Edwards, D.P. and Weigel, N . L . (2005) Cycl in-dependent kinase activity is required for progesterone receptor function: novel role for cyclin A /Cdk2 as a progesterone receptor coactivator. Mol Cell Biol, 25, 264-277. 34. Yeung, F., Hoberg, J.E., Ramsey, C.S. , Keller, M . D . , Jones, D.R. , Frye, R . A . and Mayo, M . W . (2004) Modulation of NF-kappaB-dependent transcription and cell survival by the SIRT1 deacetylase. EMBO J, 23, 2369-2380. 35. Stamey, T .A . , Yang, N . , Hay, A . R . , McNea l , J.E., Freiha, F.S. and Redwine, E . (1987) Prostate-specific antigen as a serum marker for adenocarcinoma of the 97 prostate. N Engl J Med, 317, 909-916. 36. Kellokumpu-Lehtinen, P., Nurmi , M . , Koskinen, P. and Irjala, K . (1989) Prostate-specific antigen as a marker of adenocarcinoma of prostate. Urol Res, 17, 245-249. 37. Cinar, B . , Yeung, F. , Konaka, H . , Mayo, M . W . , Freeman, M . R . , Zhau, H . E . and Chung, L . W . (2004) Identification of a negative regulatory cis-element in the enhancer core region of the prostate-specific antigen promoter: implications for intersection of androgen receptor and nuclear factor-kappaB signalling in prostate cancer cells. Biochem J, 379, 421-431. 38. Palvimo, J.J., Reinikainen, P., Ikonen, T., Ka l l io , P.J., Moilanen, A . and Janne, O . A . (1996) Mutual transcriptional interference between R e l A and androgen receptor. JBiol Chem, 271, 24151-24156. 39. Maier, J .K. , Balabanian, S., Coff i l l , C.R. , Stewart, A . , Pelletier, L . , Franks, D.J . , Gendron, N . H . and Mackenzie, A . E . (2007) Distribution of Neuronal Apoptosis Inhibitory Protein in Human Tissues. J Histochem Cytochem, 55, 911-923. 40. L i u , Y . , Denlinger, C .E . , Rundall, B . K . , Smith, P .W. and Jones, D.R. (2006) Suberoylanilide hydroxamic acid induces Akt-mediated phosphorylation of p300, which promotes acetylation and transcriptional activation of RelA/p65. J Biol Chem, 281, 31359-31368. 41. Poma, P., Notarbartolo, M . , Labbozzetta, M . , Sanguedolce, R., Alaimo, A . , Carina, V . , Maurici , A . , Cusimano, A . , Cervello, M . and D'Alessandro, N . (2006) Antitumor effects of the novel NF-kappaB inhibitor dehydroxymethyl-epoxyquinomicin on human hepatic cancer cells: analysis of synergy with 98 cisplatin and of possible correlation with inhibition of pro-survival genes and IL-6 production. Int J Oncol, 28, 923-930. 42. Notarbartolo, M . , Cervello, M . , Poma, P., Dusonchet, L . , M e l i , M . and D'Alessandro, N . (2004) Expression of the IAPs in multidrug resistant tumor cells. Oncol Rep, 11, 133-136. 43. Chen, Q., Baird, S.D., Mahadevan, M . , Besner-Johnston, A . , Farahani, R., Xuan, J., Kang, X . , Lefebvre, C , Ikeda, J.E., Korneluk, R . G . et al. (1998) Sequence of a 131-kb region of 5q 13.1 containing the spinal muscular atrophy candidate genes S M N and N A I P . Genomics, 48, 121-127. 44. Sandelin, A . , Wasserman, W . W . and Lenhard, B . (2004) ConSite: web-based prediction of regulatory elements using cross-species comparison. Nucleic Acids Res, 32, W249-252. 45. Tso, C . L . , McBride , W . H . , Sun, J., Patel, B . , Tsui, K . H . , Paik, S.H., Gitlitz, B . , Cal i l iw, R., van Ophoven, A . , Wu , L . et al. (2000) Androgen deprivation induces selective outgrowth of aggressive hormone-refractory prostate cancer clones expressing distinct cellular and molecular properties not present in parental androgen-dependent cancer cells. Cancer J, 6, 220-233. 46. Watson, R . W . and Fitzpatrick, J . M . (2005) Targeting apoptosis in prostate cancer: focus on caspases and inhibitors of apoptosis proteins. BJU Int, 96 Suppl 2, 30-34. 47. Romanish, M . T . , Lock, W . M . , van de Lagemaat, L . N . , Dunn, C A . and Mager, D . L . (2007) Repeated recruitment of L T R retrotransposons as promoters by the 99 anti-apoptotic locus N A I P during mammalian evolution. PLoS Genet, 3, elO: 0051-0062. 48. Shukla, S., Maclennan, G.T., Marengo, S.R., Resnick, M . I . and Gupta, S. (2005) Constitutive activation of P 13 K - A k t and NF-kappaB during prostate cancer progression in autochthonous transgenic mouse model. Prostate, 64, 224-239. 49. Suh, J., Payvandi, F., Edelstein, L . C . , Amenta, P.S., Zong, W . X . , Gelinas, C. and Rabson, A . B . (2002) Mechanisms of constitutive NF-kappaB activation in human prostate cancer cells. Prostate, 52, 183-200. 50. Lessard, L . , Begin, L . R . , Gleave, M . E . , Mes-Masson, A . M . and Saad, F . (2005) Nuclear localisation of nuclear factor-kappaB transcription factors in prostate cancer: an immunohistochemical study. Br J Cancer, 93, 1019-1023. 51. Domingo-Domenech, J., Mellado, B . , Ferrer, B . , Truan, D . , Codony-Servat, J., Sauleda, S., Alcover, J., Campo, E . , Gascon, P., Rovira, A . et al. (2005) Activation of nuclear factor-kappaB in human prostate carcinogenesis and association to biochemical relapse. Br J Cancer, 93, 1285-1294. 52. Perkins, N . D . (2006) Post-translational modifications regulating the activity and function of the nuclear factor kappa B pathway. Oncogene, 25, 6717-6730. 53. Dziarmaga, A . , Hueber, P .A . , Iglesias, D. , Hache, N . , Jeffs, A . , Gendron, N . , Mackenzie, A . , Eccles, M . and Goodyer, P. (2006) Neuronal apoptosis inhibitory protein is expressed in developing kidney and is regulated by P A X 2 . Am J Physiol,29\, F913-920. 54. X u , M . , Okada, T., Sakai, H . , Miyamoto, N . , Yanagisawa, Y . , MacKenzie, A . E . , Hadano, S. and Ikeda, J .E. (2002) Functional human N A I P promoter transcription 100 regulatory elements for the NAIP and PsiNAIP genes. Biochim Biophys Acta, 1574, 35-50. V 101 3. CONCLUDING CHAPTER 3.1 PERSPECTIVES AND FUTURE DIRECTIONS Androgen deprivation is an effective systemic treatment for prostate cancer. Normally, androgen deprivation results in apoptosis of prostate cells. The molecular mechanism by which a subpopulation of prostate cancer cells escapes cell death normally achievable by androgen deprivation is unclear. In this thesis, the I A P family was explored in prostate cancer cells which do not undergo apoptosis in spite of androgen deprivation. The levels of N A I P m R N A were significantly increased in vivo in response to castration of hosts as well as in vitro in response to androgen deprivation. Increased levels of N A I P m R N A corresponded to increased DNA-binding activity of N F - k B in vivo. Androgens inhibited the transcriptional activity of N F - k B which is postulated to play a role in the expression of IAPs. N F - k B was shown to physically associate to previously uncharacterized kB-l ike sites in the NAIP locus. The physiological relevance of N F - k B interaction with one of the putative kB-l ike sites within the second intron of the N A I P gene locus was validated using the ChIP assay. Hence, the findings of the work in this thesis suggest that N F - k B may transcriptionally regulate N A I P in response to androgen deprivation in prostate cancer cells. These data point to a molecular mechanism by which IAPs may contribute to the loss of apoptosis of prostate cancer cells under androgen-deprived conditions. To establish the role of IAPs in the progression of prostate cancer, much work still needs to be done. Potential future directions of investigation may include characterization of 1) the anti-apoptotic role of N A I P and other IAPs in response to androgen deprivation; 2) the undefined roles of IAPs; 3) the transcriptional regulation by 102 N F - k B and other candidate transcription factors in response to androgen withdrawal; 4) IAPs and their transcriptional regulation at different stages of prostate cancer progression. To confirm the role of N A I P in conferring prostate cells with enhanced resistance to apoptosis induced by androgen deprivation, functional experiments are required. I f N A I P plays a major role in reducing apoptosis of prostate cancer cells in response to androgen deprivation, then overexpressing N A I P using expression vector constructs in an androgen-dependent xenograft model should result in the loss of tumour regression in response to castration of hosts when compared to animals with control vectors. Alternatively, antisense oligonucleotide and R N A interference ( R N A i ) strategies specifically designed against endogenous N A I P transcripts may be employed to block the expression of N A I P in the xenograft model. Such experiments would be expected to yield data showing an increase in sensitivity to androgen deprivation as compared to injection of control oligonucleotides or R N A i . For these overexpression and knockdown studies, C W R 2 2 , a serially transplantable prostate cancer xenograft may be an ideal model to use as the tumour regresses upon androgen withdrawal and relapses to an androgen-independent stage subsequent to biochemical recurrence (1). A similar in vitro and in vivo approach described in the work of this thesis and discussed above may also be applied to explore the anti-apoptotic role of other IAPs, such as l iv in and apollon, which are relatively understudied in the context of prostate cancer. Alternatively, flow cytometry may be applied to assess the apoptotic property of cells that highly express IAPs using specific antibodies for the IAPs and caspases to confirm the effect of IAPs on the specific I A P targets in the apoptotic pathways. The roles of IAPs may appear to be redundant as endogenous caspase inhibitors. 103 However, the presence of functional domains, such as C A R D and N O D , in addition to the B I R domains suggests that IAPs may possess unique characteristics in enhancing the survival of cancer cells. For example, N O D is commonly associated with sensing apoptosis, innate immunity and inflammatory responses (2), but recently this functional domain in N A I P was shown to be involved in the ATP-dependent interaction with caspase-9 (3). A n alternative approach to study the role of IAPs in prostate cancer could involve the characterization of the unexplored functions of IAPs and their variants. One general way to investigate this aspect is by studying the functional effects, such as apoptosis and proliferation, with mutated IAPs containing part of or completely devoid of the functional domain of interest. Intriguingly, C - IAP2 was suggested to be involved in regulating N F - k B in a positive feedback loop (4). Hence, it w i l l be of interest to determine i f other IAPs can similarly contribute to a positive feedback mechanism. This could be explored by manipulating levels of IAPs by overexpression or knockdown of IAPs and measuring the effects on the activity of N F - k B followed by elucidating the underlying mechanism leading to such effects. N F - k B stands out as a good candidate for a diverse scope of investigation in the progression of prostate cancer due to its multifaceted roles in the cell. These roles include resistance to apoptosis, cytokine production and proliferation. A s described in Chapter 2, the N F - k B DNA-binding activity was increased, whereas the nuclear levels of N F - k B subunits were unchanged after androgen ablation in hosts. While lack of correlation between the N F - k B DNA-binding activity and nuclear levels of the subunits may be due to subtle differences that are undetectable by Western blot analyses, the results also suggest that the activity of N F - k B may be altered without inducing the translocation of 104 the subunits to the nucleus. Specifically, post-translational modifications or cooperative interactions with modulators may allow N F - k B to selectively regulate the transcription at distinct target regulatory elements (5). Nuclear modifications, such as phosphorylation and acetylation, of p65 have been described to modulate the N F - k B activity depending on the cellular context (6). It is critical to determine the triggers and outcomes of the post-translational modifications of N F - k B on the malignant effect conferred by this multi-functional transcription factor, and data on these understudied aspects in the context of prostate cancer are keenly awaited. Besides N F - k B , other transcription factors may also regulate the transcription of IAPs in response to androgen deprivation in prostate cancer cells. Two examples are P A X 2 (7) and Brn-2 (8) which have been suggested to regulate the transcription of N A I P . However, expression and activities of these transcription factors has not been examined for correlation with expression of N A I P in the context of hormonal manipulation in prostate cancer cells. Investigation of the regulation of transcription of other I A P genes by N F - k B or by other suspected transcription factors in prostate cancer in response to androgen deprivation could involve a similar in vitro and in vivo approach as outlined in this thesis. To determine the mechanism of regulation of transcription of the I A P family, the possibility of performing in vivo ChIP assays using the hollow fibre model could be explored. Global mapping of binding sites of N F - k B and other candidate transcription factors during the hormonal progression of prostate cancer using high throughput ChIP technologies, such as ChIP with D N A microarray analysis and ChIP with D N A sequencing (9,10), may provide a comprehensive profile of the differential transcriptional regulation during various stages of prostate cancer progression. Validation of the differential bindings should accompany these studies by 105 regular ChIP assays with conventional P C R or q P C R of the target regulatory regions. However, this is a biased approach and cannot identify unexpected proteins binding to the regulatory regions. Thus, alternative approaches such as in vivo D N A footprinting could be used to identify differentially occupied D N A sequences on the regulatory region of genes during hormonal progression. Currently, the underlying molecular mechanisms involved in the loss of apoptosis in response to androgen ablation therapy and hormonal progression of prostate cancer are not fully understood. Therefore, it w i l l also be of interest to investigate the anti-apoptotic role of IAPs using in vivo samples obtained from prostate cancer xenografts and L N C a P hollow fibre model at multiple time-points leading to androgen-independence as characterized by a rising titre of serum P S A in castrated hosts. Finally, to exploit the possibility of targeting I A P , more clinical studies w i l l be required to determine the prevalence of individual IAPs at different clinical stages of prostate cancer as well as neoplastic lesions, i.e. P IN, since the number of similar studies is currently limited. A n understanding of the expression profile of individual IAPs in clinical samples with advanced methods such as laser capture microdissection and microarray analyses wi l l provide new insights and comprehensive profile on the molecular mechanisms involved in the initiation and progression of prostate cancer. A l l in al l , data gathered from these proposed studies could lead to the development of novel strategies to induce cell death in selectively targeted tumour cells. The knowledge gained could potentially have prognostic value or could be translated into therapeutic solutions for the effective clinical management of prostate cancer. 106 3.2 REFERENCES 1. Nagabhushan, M . , Mil ler , C M . , Pretlow, T.P., Giaconia, J . M . , Edgehouse, N . L . , Schwartz, S., Kung, H.J . , de Vere White, R .W. , Gumerlock, P .H . , Resnick, M . I . et al. (1996) C W R 2 2 : the first human prostate cancer xenograft with strongly androgen-dependent and relapsed strains both in vivo and in soft agar. Cancer Res, 56, 3042-3046. 2. Inohara, N . and Nunez, G . (2003) N O D s : intracellular proteins involved in inflammation and apoptosis. Nat Rev Immunol, 3, 371-382. 3. Davoodi, J., L i n , L . , Ke l ly , J., Liston, P. and MacKenzie, A . E . (2004) Neuronal apoptosis-inhibitory protein does not interact with Smac and requires A T P to bind caspase-9. JBiol Chem, 279, 40622-40628. 4. Chu, Z . L . , McKinsey , T .A . , L i u , L . , Gentry, J.J., Ma l im, M . H . and Ballard, D . W . (1997) Suppression of tumor necrosis factor-induced cell death by inhibitor of apoptosis C - IAP2 is under NF-kappaB control. Proc Nal Acad of Sci USA, 94, 10057-10062. 5. Perkins, N . D . and Gilmore, T .D. (2006) Good cop, bad cop: the different faces of NF-kappaB. Cell Death Differ, 13, 759-772. 6. Perkins, N . D . (2006) Post-translational modifications regulating the activity and function of the nuclear factor kappa B pathway. Oncogene, 25, 6717-6730. 7. Dziarmaga, A . , Hueber, P .A . , Iglesias, D . , Hache, N . , Jeffs, A . , Gendron, N . , Mackenzie, A . , Eccles, M . and Goodyer, P. (2006) Neuronal apoptosis inhibitory protein is expressed in developing kidney and is regulated by P A X 2 . Am J Physiol, 291, F913-920. 107 8. X u , M . , Okada, T., Sakai, H . , Miyamoto, N . , Yanagisawa, Y . , MacKenzie, A . E . , Hadano, S. and Ikeda, J.E. (2002) Functional human N A I P promoter transcription regulatory elements for the N A I P and Ps iNAIP genes. Biochim Biophys Acta, 1574, 35-50. 9. Martone, R., Euskirchen, G . , Bertone, P., Hartman, S., Royce, T.E. , Luscombe, N . M . , Rinn, J .L. , Nelson, F . K . , Mil ler , P., Gerstein, M . et al. (2003) Distribution of NF-kappaB-binding sites across human chromosome 22. Proc Natl Acad Sci USA, 100, 12247-12252. 10. Euskirchen, G . M . , Rozowsky, J.S., Wei , C . L . , Lee, W . H . , Zhang, Z .D . , Hartman, S., Emanuelsson, O., Stole, V . , Weissman, S., Gerstein, M . B . et al. (2007) Mapping of transcription factor binding regions in mammalian cells by ChIP: comparison of array- and sequencing-based technologies. Genome Res, 17, 898-909. 108 4. A P P E N D I X 4.1 A N I M A L C A R E C E R T I F I C A T E S T H E U N I V E R S I T Y O F B R I T I S H C O L U M B I A U B C ANIMAL CARE CERTIFICATE Application Number: A03-0260 Investigator or Course Director: Marianne Sadar Department: Endocrinology & Metabolism Animals: Mice 120 Start Date: September IS, 2003 Funding Sources: Approval October 25, 2006 Date: Funding Agency: Funding Title: US Army Development of a Potential Therapy for Prostate Cancer Based Upon the Androgen Receptor Funding Agency: Funding Title: Novel Approaches for Blocking Activation of the Androgen Receptor US Department of Defense Funding Agency: Funding Title: US Department of Defense Development of a Potential Therapy for Prostate Cancer Based Upon the Androgen Receptor Unfunded title: N/A The Animal Care Committee has examined and approved the use of animals for the above experimental project. This certificate is valid for one year from the above start or approval date (whichever is later) provided there is no change in the experimental procedures. Annual review is required by the C C A C and some granting agencies. A copy of this certificate must be displayed in your animal facility. Office of Research Services and Administration 102,6190 Agronomy Road, Vancouver, B C V6T 1Z3 Phone: 604-827-5111 Fax: 604-822-5093 The University of British Columbia Animal Care Certificate Application Number: AOS-1794 Investigator or Course Director: Marianne Sadar Department: Medicine, Department of Animals Approved: Mice Male athymic Nude mice, BALB/c Strain 180 Start Date: November 1,2005 Approval Date: January 6,2006 Funding Sources: Funding Agency: Funding Title: National Institutes of Health Genomic and proteomic analysis of androgen independent prostate cancer Funding Agency: Funding Title: Health Canada Proteomics associated with the progression of prostate cancer to androgen-independence. Unfunded title: N/A The Animal Care Committee has examined and approved the use of animals for the above experimental project. This certificate is valid for one year from the above start or approval date (whichever is later) provided there is no change in the experimental procedures. Annual review is required by the CCAC and some granting agencies. A copy of this certificate must be displayed !c your animal facility Office of Research Services and Administration 102,6190 Agronomy Road, Vancouver, V6T 1Z3 Phone: 604-827-5111 Fax: 604-822-5093 110 4.2 BIOHAZARD APPROVAL CERTIFICATE The University of British Columbia Bfohazard Approval Certificate P R O T O C O L N U M B E R : H07-0047 I N V E S T I G A T O R O R C O U R S E D I R E C T O R : Sadar, Marianne D E P A R T M E N T : Medicine P R O J E C T O R C O U R S E T I T L E : Genomic and proteomic analysis of androgen independent prostate cancer A P P R O V A L D A T E : 07-03-05 A P P R O V E D C O N T A I N M E N T L E V E L : 2 F U N D I N G A G E N C Y : National Institutes of Health The Principal Investigator/Course Director is responsible for ensuring that all research or course work involving biological hazards is conducted in accordance with the Health Canada, Laboratory Biosafety Guidelines. (2nd Edition 1996). Copies of the Guidelines (1996) are available through the Biosafety Office. Department of Health, Safety and Environment, Room 50 - 2075 Wesbrook Mall, UBC, Vancouver, BC, V6T 1Z1, 822-7596, Fax: 822-6650. Approval of the UBC Biohazards Committee by one of: Chair. Biosafety Committee Manager, Biosafety Ethics Director, Office of Research Services This certificate is valid for one year from the above start or approval date (whichever is later) provided there is no change in the experimental procedures. Annual review is required. A copy of this certificate must be displayed In your facility. Off ice o f R e s e a r c h S e r v i c e s 102. 6 1 9 0 A g r o n o m y R o a d . V a n c o u v e r . V 6 T 1Z3 P h o n e : 6 0 4 - 8 2 7 - 5 1 1 1 F A X : 6 0 4 - 8 2 2 - 5 0 9 3 111 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0100770/manifest

Comment

Related Items