Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Function of lipoprotein lipase and endothelial lipase in human macrophages Qiu, Guosong 2007

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Notice for Google Chrome users:
If you are having trouble viewing or searching the PDF with Google Chrome, please download it here instead.

Item Metadata

Download

Media
831-ubc_2007-319109.pdf [ 43.99MB ]
Metadata
JSON: 831-1.0100747.json
JSON-LD: 831-1.0100747-ld.json
RDF/XML (Pretty): 831-1.0100747-rdf.xml
RDF/JSON: 831-1.0100747-rdf.json
Turtle: 831-1.0100747-turtle.txt
N-Triples: 831-1.0100747-rdf-ntriples.txt
Original Record: 831-1.0100747-source.json
Full Text
831-1.0100747-fulltext.txt
Citation
831-1.0100747.ris

Full Text

Function of Lipoprotein Lipase and Endothelial Lipase in Human Macrophages by GUOSONG QIU B.Med., Zhejiang Medical University, 1996 M.Med., Zhejiang University, 1999 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Pathology) THE UNIVERSITY OF BRITISH COLUMBIA August 2007 © Guosong Qiu, 2007 A B S T R A C T Lipoprotein lipase (LPL) and endothelial lipase (EL) are expressed in atherosclerotic lesions, mainly in macrophages. However, the functional roles of LPL and EL in macrophages are not well characterized. In the present thesis, the effects of these lipases on cholesterol efflux, low density lipoprotein (LDL) catabolism, and proinflammatory cytokine secretion in human macrophages were investigated. Lentivirus transduction successfully induced EL suppression or over-expression in macrophages. LPL suppression was mediated by lentivirus transduction whereas dexamethasone was used to stimulate LPL expression. Apolipoprotein AI- (apoAI-) mediated cholesterol efflux was modestly reduced after LPL and EL suppression, but significantly increased in lipase-overexpressing macrophages as well as transfected 293 cells. This effect was partially inhibited after the elimination of either catalytic or non-catalytic lipase function, but completely abolished when both functions were blocked. The observed effect on cholesterol efflux was mediated partially by an increased apoAI binding, an effect dependent on cell surface lipase. Lipase expression was inversely associated with phosphatidylcholine and sphingomyelin levels, but positively with lysophosphatidylcholine production, the later was shown to promote apoAI-mediated cholesterol efflux dose-dependently. EL expression was positively correlated with both native and oxidized LDL binding and association via non-catalytic function as observed in both EL-suppressed and over-expressed macrophages. By contrast, the catalytic activity of EL did not have a significant role in oxidized LDL metabolism with the exception of a positive correlation with native LDL association, which also partially depended on the LDL receptor. The concentration of interleukin-ip and 6, macrophage chemoattractant protein-1, and tumor necrosis factor-a was reduced after LPL and EL suppression, The lipase suppression also amplified the inhibitory effect of oxidized LDL in macrophages. Microarray analysis indicated that >50 genes, mainly proinflammatory ones, had marked expression changes after lipase suppression. ii Atorvastatin treatment reduced LPL and EL expression as well as Rho, the liver X receptor (LXR), and nuclear factor-KB ( N F - K B ) levels. Mechanistic studies identified LXR and N F - K B to be involved in atorvastatin-induced suppression of LPL and EL, respectively. In summary, by promoting apoAI-mediated cholesterol efflux, lipoprotein binding and uptake, and proinflammatory cytokine expression in macrophages, EL and LPL may influence the atherogenic potential of macrophages. iii T A B L E O F C O N T E N T S ABSTRACT ii TABLE OF CONTENTS iv LIST OF TABLES xiii LIST OF FIGURES xiv AMINO ACID DESIGNATIONS xvii ABBREVIATIONS xviii ACKNOWLEDGEMENTS xxiii DEDICATION xxiv Chapter 1 Introduction 1 1.1 Atherosclerosis 1 1.1.1 General Facts 1 1.1.2 Pathology of Atherosclerosis 1 1.1.2.1 Intima Thickening 1 1.1.2.2 Fatty Streak 3 1.1.2.3 Intermediate Lesion (Type III) 3 1.1.2.4 Atheroma (Type IV) 4 1.1.2.5 Advanced Atheroma (type V) 4 1.1.2.6 Complicated Lesions (type VI) 4 1.1.3 Conventional Risk Factors 5 1.1.3.1 Age and Gender 5 1.1.3.2 Tobacco Smoking 5 1.1.3.3 Sedentary Life-Style 6 1.1.3.4 Diets 6 1.1.3.5 Family History and Genetic Makeup 7 1.1.3.6 Dyslipidemia 8 1.1.3.7 High Blood Pressure 8 1.1.3.8 Diabetes or Impaired Glucose Tolerance 9 1.1.3.9 Obesity 9 1.1.3.10 Psychological Factors 10 1.1.4 Emerging Risk Factors 10 iv 1.1.4.1 Homocysteine 10 1.1.4.2 Lipoprotein (a) 11 1.1.4.3 CRP U 1.1.4.4 Fibrinogen and Prothrombotic Status 12 1.1.4.5 Microorganism Infection 13 1.2 Macrophage and Atherogenesis • 14 1.2.1 Macrophage Recruitment and Migration 14 1.2.1.1 Adhesion Molecules 15 1.2.1.2 Chemokines 16 1.2.2 Monocyte Differentiation and Activation 16 1.2.3 Macrophage and Proinflammatory Response 17 1.2.4 Macrophage and Foam Cell Formation 18 1.2.5 Macrophage and Oxidative Stress 18 1.2.6 Macrophage and Endothelial Dysfunction 19 1.2.7 Macrophage and Plaque Vulnerability 19 1.3 Lipid Metabolism 21 1.3.1 Lipoprotein Classification 21 1.3.2 Lipoprotein Metabolism 22 1.3.2.1 Exogenous Pathway 22 1.3.2.2 Endogenous Pathway 24 1.3.3 Metabolism of HDL 26 1.3.3.1 HDL Classification 26 1.3.3.2 HDL Maturation and Related Enzymes 27 1.3.3.3 HDL Clearance 28 1.3.4 Pleiotropic Role of HDL 28 1.3.4.1 Anti-atherogenic Property 29 1.3.4.2 Anti-oxidative Property 29 1.3.4.3 Anti-inflammatory Property 29 1.3.4.4 Anti-thrombotic Property 30 1.4 Reverse Cholesterol Transport 31 1.4.1 Source, Storage, and Transport of Intracellular Cholesterol 31 1.4.2 Cholesterol-rich Domains in Cellular Membranes 32 1.4.2.1 Cholesterol-rich Rafts 32 v 1.4.2.2 Caveolae 3 3 1.4.2.3 Two Distinct Kinetic Pools of Membrane Cholesterol 34 1.4.3 Cholesterol Efflux 34 1.4.3.1 Free Diffusion 34 1.4.3.2 SR-BI-Mediated Cholesterol Efflux , 36 1.4.3.3 ABC-Mediated Cholesterol Efflux 37 1.4.3.3.1 ABCA1 38 1.4.3.3.2 ABCB 39 1.4.3.3.3 ABCG .' 39 1.4.3.4 Apo E induced Cholesterol Efflux 40 1.4.4 Reverse Cholesterol Transport In Blood 40 1.4.4.1 Cholesterol Transport by HDL in Blood 41 1.4.4.2 Cholesterol Transport by LDL in Blood 42 1.4.5 Biliary Secretion of Cholesterol 42 1.5 Lipase Gene Family 43 1.5.1 LPL 44 1.5.1.1 Gene Structure 44 1.5.1.2 Structure-Function Relationships 45 1.5.1.2.1 Protein Translation and Glycosylation 45 1.5.1.2.2 Homodimer Structure 45 1.5.1.2.3 Active Site and Lid Structure 47 1.5.1.2.4 Lipid Binding Domain .' 48 1.5.1.2.5 Heparin Binding Domain 49 1.5.1.2.6 Receptor Binding Domain 49 1.5.1.3 Regulation of Lipase Expression 50 1.5.1.3.1 Tissue Expression of LPL 50 1.5.1.3.2 Physiological Regulation of LPL Expression 51 1.5.1.3.3 Regulation of LPL Expression in Macrophages 51 1.5.1.4 Catalytic Function and Lipid Metabolism 53 1.5.1.4.1 Biochemistry of LPL 53 1.5.1.4.2 LPL and Metabolism of Triglyceride-rich Lipoproteins 54 1.5.1.4.3 LPL and Metabolism of ApoB Containing Lipoproteins 54 1.5.1.4.4 LPL and HDL Metabolism 55 vi 1.5.1.5 Non-Catalytic function of LPL and Lipoprotein Metabolism 55 1.5.1.5.1 Accelerated Catabolism of Lipoproteins by Catalytically-inactive LPL ... 55 1.5.1.5.2 Lipoprotein Receptor-Dependent Pathway 56 1.5.1.5.3 Lipoprotein Receptor-Independent Pathway 56 1.5.1.6 LPL and Atherosclerosis 56 1.5.1.6.1 LPL Expression in Atherosclerotic Lesions 56 1.5.1.6.2 Paradoxical Role of Systemic LPL Expression in Atherosclerosis 57 1.5.1.6.3 Pro-atherogenic Role of LPL Expression in Macrophage 59 1.5.1.6.4 Potential Pro-atherogenic Mechanisms of Macrophage LPL 59 1.5.2 EL 61 1.5.2.1 Gene Locus and Structure 61 1.5.2.2 Protein Structure-Function Relationships 61 1.5.2.2.1 Protein Sequence 61 1.5.2.2.2 Protein Glycosylation 62 1.5.2.2.3 Catalytic Triad and Surface Loop 62 1.5.2.2.4 C-terminus and Substrate Specificity 63 1.5.2.2.5 Heparin-Binding Domain 63 1.5.2.2.6 Homodimerization of EL Molecules 63 1.5.2.3 EL Expression and Regulation 64 1.5.2.3.1 Tissue Expression of EL 64 1.5.2.3.2 Atherosclerosis Risk Factors and EL Expression 64 1.5.2.3.3 Cytokines and EL Expression 65 1.5.2.4 EL and Lipoprotein Metabolism 66 1.5.2.4.1 Substrate Specificity 66 1.5.2.4.2 EL Activity and Apolipoprotein All 67 1.5.2.4.3 Regulation of HDL Metabolism 67 1.5.2.4.4 EL and ApoB Containing Lipoprotein Metabolism 69 1.5.2.5 EL and Atherosclerosis 70 1.5.2.5.1 EL Expression in Atherosclerotic Lesions 70 1.5.2.5.2 EL Polymorphism and Atherosclerosis 70 1.5.2.5.3 EL Expression and Atherosclerosis Risk Factors 71 1.5.2.5.4 EL and Monocyte Recruitment 72 1.5.2.5.5 EL Expression and Atherosclerosis in Animal Models 72 vii 1.6 Rationale 74 1.7 Hypotheses and Objectives 75 1.7.1 Overarching Hypotheses 75 1.7.2 Main Objectives 75 1.8 Experimental Design 76 1.9 Organization of Research Work 77 1.10 Reference: , 78 Chapter 2. The Expression of Endothelial Lipase and Lipoprotein Lipase Promotes Cholesterol Efflux in THP-1 Derived Human Macrophages 128 2.1 Introduction and Rationale 128 2.2 Hypotheses and Specific Aims 130 2.2.1 Hypotheses 130 2.2.2 Specific Aims 130 2.3 Material and Methods 132 2.3.1 Cell Culture 132 2.3.2 Candidate shRNA Selection and Incorporation into pSHAG Vector 132 2.3.3 Integration of shRNA Expression Cassette into Lentiviral Vector 133 2.3.4 Lentivirus Production 134 2.3.5 Lentivirus Production for EL Overexpression 134 2.3.6 Lentiviral Titration 136 2.3.7 Lentiviral Transduction of Monocytes/Macrophages 136 2.3.8 Construction of EL-Expressing FLP-1N 293 Cell Line 136 2.3.9 EL Purification 137 2.3.10 Up-regulation of Endogenous Lipoprotein Lipase in Macrophages 138 2.3.11 Trioleinase Activity Assay ; 138 2.3.12 Phospholipase Activity Assay 139 2.3.13 Real-Time One-step Quantitative Reverse Transcription PCR (qRT-PCR) 140 2.3.14 uMACS Microbead-based Immunoprecipitation 140 2.3.15 Western Blot 140 2.3.16 ApoAI Mediated Cholesterol Efflux .• .-. 141 2.3.17 ApoAI Binding Assay 142 2.3.18 Characterization of ABC A1 Expression 142 viii 2.3.19 Analysis of Cell Membrane Lipid Composition 142 2.3.20 Statistical Analysis 143 2.4 Results 144 2.4.1 Lentiviral Titration and Transduction 144 2.4.2 Lipase Knockdown by shRNA Lentivirus 145 2.4.3 Lipase Overexpression in Macrophages and FLP-IN 293 Cells 147 2.4.4 Lipases Promote Apo Al-mediated Cholesterol Efflux 150 2.4.5 The Differential Role of Catalytic and Non-Catalytic Functions of Lipase in Cholesterol Efflux 152 2.4.6 The Effect of Lipases on Cholesterol Efflux Is Independent of ABCA1 153 2.4.7 Lipases Increase ApoAI Binding via Bridging Function 155 2.4.8 Lipases Change Membrane Phospholipid Composition 156 2.4.9 Lysophosphatidylcholine Stimulates ApoAI-mediated Cholesterol Efflux 159 2.5 Discussion 160 2.6 References: ; 165 Chapter 3. Endothelial Lipase Expression Enhances the Binding and Uptake of Native and Oxidized Low Density Lipoprotein in Human Macrophages: A Mechanism Requiring Heparan Sulfate Proteoglycans 170 3.1 Introduction and Rationale 170 3.2 Hypotheses and Specific Aims 172 3.2.1 Hypotheses 172 3.2.2 Specific Aims: 172 3.3 Materials and Methods: 173 3.3.1 The suppression and over-expression in macrophages by lentivirus 173 3.3.2 Dil labeling and oxidation of LDL 173 3.3.3 LDL binding and association assay 173 3.3.4 Cell treatments in LDL binding and association assay 174 3.4 Results: 175 3.4.1 EL suppression reduces the binding and association of native and oxidized LDL 175 3.4.2 Overexpression of EL increases the binding and association of native and oxidized LDL 175 3.4.3 EL-mediated LDL binding and association is independent of catalytic function.. 176 3.4.4 Heparan sulfate proteoglycans are required for EL-mediated LDL binding ix and association 179 3.4.5 The role of lipoprotein receptors in EL-mediated LDL binding and association.. 180 3.5 Discussion 182 3.6 References: 186 Chapter 4. Suppression of endothelial lipase or lipoprotein lipase expression in THP-1 macrophages attenuates pro-inflammatory cytokine secretion 190 4.1 Introduction and rationale 190 4.2 Hypotheses and Specific Aims 192 4.2.1 Hypotheses 192 4.2.2 Specific Aims 192 4.3 Materials and Methods 193 4.3.1 Lentiviral Production, Macrophage Transduction, Lipase Quantitation by real-time qRT-PCR and Western Blot, and HPLC Assay of Phospholipid Composition 193 4.3.2 LDL Oxidation and Cell Treatment 193 4.3.3 Cytokine ELISA 193 4.3.4 Microarray 194 4.4 Results 195 4.4.1 Cytokine Expression Secondary to Lipase Suppression 195 4.4.2 Cytokine Expression Secondary to Treatment with Oxidized LDL 195 4.4.3 Lipase suppression superimposes the inhibitory effect on oxidized LDL treatment in cytokine expression 197 4.4.4 The effect of oxidized LDL on lipase expression in macrophages 199 4.4.5 Lipid Composition after Lipase Suppression 200 4.4.6 Microarray of Atherosclerosis Pathway Specific Genes 201 4.5 Discussion 203 4.6 References: 207 Chapter 5. Atorvastatin Decreases Lipoprotein Lipase and Endothelial Lipase Expression in Human THP-1 Macrophages 212 5.1 Introduction and Rationale 212 5.2 Hypotheses and Specific Aims 214 5.2.1 hypotheses 214 5.2.2 Specific Aims 214 5.3 Materials and Methods 215 x 5.3.1 Reagents 215 5.3.2 Cell Culture and Treatment 215 5.3.3 Rho Pull-Down Assay 215 5.3.4 Immunoprecipitation of Liver X Receptor 216 5.3.5 Nuclear Extraction and N F - K B ELISA 216 5.3.6 Trioleinase assay, RNA Extraction and Real-Time qRT-PCR, and Western Blot 216 5.4 Results 217 5.4.1 Atorvastatin decreases LPL and E L mRNA and protein level in THP-1 macrophages 217 5.4.2 Atorvastatin decreases Rho, LXR and N F - K B activity 218 5.4.3 Rho inactivation by atorvastatin does not mediate a decrease in EL or LPL expression in THP-1 macrophages 219 5.4.4 L X R inhibition by atorvastatin mediates LPL, but not E L suppression 221 5.4.5 EL suppression by atorvastatin is mediated by N F - K B inhibition 223 5.5 Discussion 225 5.6 References: 229 Chapter 6. General Discussion and Conclusion 232 6.1 Summary 232 6.2 Which is the dominant effect of macrophage-derived lipases, pro-atherogenic or anti-atherogenic? 235 6.3 Future Direction 236 6.4 Reference 238 Appendices 241 Appendix 1. Sequencing results of pSHAG-scramble-shRNA 242 Appendix 2. Sequencing results of pSHAG-LPL-shRNA 244 Appendix 3. Sequencing results of pSHAG-EL-shRNA 246 Appendix 4. Sequencing results of pWPI-EL 248 Appendix 5. Sequencing results of pcDNA5/FRT-EL 252 Appendix 6. Time-course curve of apoAI-mediated cholesterol efflux in macrophages..256 Appendix 7. Cytokine expression in lipase-suppressed macrophages 257 Appendix 8. Cytokine expression in mildly-oxLDL treated macrophages with or without lipase suppression 258 Appendix 9. Cytokine expression in extensively-oxLDL treated macrophages xi with or without lipase suppression 259 Appendix 10. Microarray of atherosclerosis-related genes in lipase suppressed Macrophages 260 xii LIST OF TABLES Table 1 -1. Cytokines and bioactive substances produced by macrophages 17 Table 1-2. The classification of lipoproteins 21 Table 1-3. HDL category 27 Table 2-1. Sequence of shRNA oligonucleotides for LPL, EL and control constructs 132 Table 4-1. Top 10 upregulated and downregulated genes in human atherosclerosis microarray for Lipase suppressed macrophages 202 xiii LIST OF FIGURES Figure 1-1. The classification of atherosclerotic lesions 2 Figure 1-2. The role of macrophage in atherogenesis 15 Figure 1-3. The classification of lipoproteins by size 22 Figure 1-4. Exogenous pathway of lipoprotein metabolism 23 Figure 1-5. Endogenous pathway of lipoprotein metabolism 25 Figure 1-6. The source, storage, trafficking of intracellular cholesterol 33 Figure 1-7. Reverse cholesterol transport 35 Figure 1-8. Schematic demonstration of the dimeric structure of LPL 46 Figure 1-9. The proatherogenic mechanisms of macrophage LPL 60 Figure 1-10. The experimental design 76 Figure 2-1. Hindlll digestion of pSHAG to confirm the shRNA inserts 133 Figure 2-2. Lentivirus production and transduction of monocytes 135 Figure 2-3. The generation of FLP-IN 293 cells stably expressing EL 137 Figure 2-4. EL purification from heparin-challenged conditioned medium of EL-overexpressing FLP-IN 293 cells 138 Figure 2-5. The quantitation of transduction efficiency by FACS and fluoroscopy 144 Figure 2-6. Lipase expression profile in macrophages after PMA stimulation 145 Figure 2-7. The suppression of LPL and EL by lentivirus 146 Figure 2-8. The LPL overexpression in macrophages 148 Figure 2-9. The EL overexpression in macrophages 149 Figure 2-10. The EL overexpression in FLP-IN 293 cells 150 Figure 2-11. The effect of lipase suppression and overexpression on apoAI-mediated cholesterol efflux in macrophages and FLP-IN 293 cells 151 Figure 2-12. The effect of exogenous lipases on apoAI-mediated cholesterol efflux in macrophages 152 Figure 2-13. The role of catalytic and non-catalytic functions of lipases in apoAI-mediated cholesterol efflux 153 Figure 2-14. ABCA1 expression after lipase suppression or overexpression in macrophages and FLP-IN 293 cells 154 Figure 2-15. ApoAI binding in macrophages and FLP-IN 293 cells after lipase xiv suppression or overexpression 155 Figure 2-16. Lipid composition in lipase-suppressed macrophages 157 Figure 2-17. Lipid composition in lipase-overexpressing macrophages and FLP - IN 293 cells 158 Figure 2-18. Lysophosphatidylcholine effect on apoAI-mediated cholesterol efflux 159 Figure 2-19. Proposed mechanisms of lipase-enhanced apoAI-mediated cholesterol efflux in macrophages 164 Figure 3 -1. LDL/oxLDL binding and association in EL-suppressed THP-1 derived macrophages 176 Figure 3-2. LDL/oxLDL binding and association in EL overexpressing THP-1 derived macrophages 177 Figure 3-3. Investigation of the role of EL catalytic activity on EL-mediated LDL/oxLDL binding and association in THP-1 derived macrophages 178 Figure 3-4. Investigation of the role of HSPG on EL-mediated LDL/oxLDL binding and association in THP-1 derived macrophages 179 Figure 3-5. Investigation of the role of LDLR, LRP, and CD36 on EL-mediated LDL/oxLDL binding and association in THP-1 derived macrophages 181 Figure 3-6. Proposed pathways for EL-mediated LDL binding and association in THP-1 derived macrophages 184 Figure 4-1. Cytokine expression in THP-1 macrophages following LPL or EL gene suppression 196 Figure 4-2. The effect of oxLDL on the production of proinflammatory cytokines in THP-1 macrophages 197 Figure 4-3. The additive effect of lipase suppression and oxidized LDL treatment on proinflammatory cytokine production 198 Figure 4-4. The effect of oxLDL on lipase expression in THP-1 macrophages 199 Figure 4-5. The effect of LPL or EL suppression on lipid composition in THP-1 macrophages 200 Figure 5-1. Lipase downregulation in THP-1 macrophages after atorvastatin 217 treatment Figure 5-2. The levels of Rho protein, LXR-a, and N F - K B in macrophages after atorvastatin treatment 218 xv Figure 5-3. The effects of Rho activators and inhibitor on LPL expression in macrophages in the presence or absence of atorvastatin 220 Figure 5-4. The effects of Rho activators and inhibitor on EL expression in macrophages in the presence or absence of atorvastatin 221 Figure 5-5. The effects of LXR agonists on LPL expression in macrophages in the presence or absence of atorvastatin 222 Figure 5-6. The effects of LXR agonists on EL expression in macrophages in the presence or absence of atorvastatin 223 Figure 5-7. The effect of SN50 on EL expression and the effects of Rho and LXR activators on N F - K B activity in macrophages 224 Figure 5-8. Schematic illustration of signaling pathways involved in LPL and EL expression in THP-1 macrophages 228 Figure 6-1. The Lipase Regulation by Atorvastatin and Their Effects on Cholesterol Efflux, Lipoprotein Binding/Uptake, and Proinflammatory Cytokine Expression in Macrophages 234 xvi AMINO ACID DESIGNATIONS Amino Acid Three Letter Code One Letter Code Alanine Ala A Arginine Arg R Asparagine Asn N Aspartate Asp D Cysteine Cys C Glutamate Glu E Glutamine Gin Q Glycine Gly G Histidine His H Isoleucine He I Leucine Leu L Lysine Lys K Methionine Met M Phenylalanine Phe F Proline Pro P Serine Ser S Threonine Thr T Tryptophan Tip W Tyrosine Tyr Y Valine Val Z xvii ABBREVIATIONS 12-HETE 12-hydroxyeicosatetraenoic acid ABC ATP-Binding Cassette Transporter ACAT acyl-CoA:cholesterol acyltransferase ANGPTL Angiopoietin-like Protein AP-1 Activator Protein 1 Apo Apolipoprotein ATIII Antithrombin III ATP Adenosine Triphosphate Caco-2 Human Colonic Epithelial Cell cAMP cyclic Adenosine Monophosphate CCL CC Motif Chemokine Ligand CE Cholesteryl Ester CEH Cholesteryl Ester Hydrolase CETP Cholesteryl Ester Transport Protein CHD Coronary Disease CHO Chinese Hamster Ovary CM Chylomicron CMV Cytomegalovirus Cos African Green Monkey Kidney Cell cRNA complementary Ribonucleic Acid CRP C-Reactive Protein CXCR CXC Motif Chemokine Receptor DIGs Detergent-Insoluble Glycolipid-Enriched Comple DOPC 1,2-dioleoyl-phosphatidylcholine DRM Detergent Resistant Membrane DXM Dexamethasone ECM Extracellular Matrix EL Endothelial Lipase ELC EB11 Ligand Chemokine xviii eNOS endothelial Nitric Oxide Synthase EPC Endothelial Progenitor Cell ERK Extracellular Signal-Regulated Kinase FBS Fetal Bovine Serum FDP Fibrin(ogen) Degradation Product FHD Familial HDL Deficiency FIB Fibrinogen G-CSF Granulocyte Colony Stimulating Factor GM-CSF Granulocyte-Macrophage Colony Stimulating Factor GMP Guanosine Monophosphate GPI Glycosylphosphatidylinositol HDL(-c) High Density Lipoprotein (Cholesterol) HEK Human Embryonic Kidney Cell HL Hepatic Lipase HMG-CoA P-hydroxy-P-methylglutaryl-CoA HSL Hormone-Sensitive Lipase HSPG Heparan Sulfate Proteoglycan HSV Herpes Simplex Virus HUVEC Human Umbilical Vein Endothelial Cell ICAM Intercellular Adhesion Molecule IFN Interferon IL Interleukin IMT Intimal-Medial Thickness iNOS inducible Nitric Oxide Synthase JAK Janus Kinase INK C-Jun N-Terminal Kinase kb Kilobase KD KiloDalton K m Apparent Michaelis Constant KO Knockout LCAT Lecithin:Cholesterol Acyltransferase xix LDL(-c) Low Density Lipoprotein (Cholesterol) L D L R Low Density Lipoprotein Receptor LIF Leukemia Inhibitory Factor L O X Lectin-like Oxidized Low-Density Lipoprotein Receptor Lp(a) Lipoprotein (a) LPL Lipoprotein Lipase LP-PLA2 lipoprotein-associated phospholipase 2 LPS Lipopolysaccharide LRP L D L Receptor-Related Protein L T Leukotriene L X R Liver X Receptor Lyso-PC/LPC lysophosphatidylcholine M A P K Mitogen-Activated Protein Kinase MCP Monocyte Chemoattractant Protein M-CSF Macrophage Colony Stimulating Factor M D C Macrophage Derived Chemokine MDR Multiple-Drug Resistance Protein MIF Macrophage Migratory Inhibitory Factor MIP Macrophage Inflammatory Protein MMP Matrix Metalloproteinase mRNA messenger Ribonucleic Acid NADPH Nicotinamide Adenine Dinucleotide Phosphate (Reduced form) N F - K B Nuclear Factor Kappa Beta NO Nitric Oxide NOS Nitric Oxide Synthase NPC Niemann-Pick type C OSM Oncostatin M oxLDL Oxidized Low Density Lipoprotein PAF Platelet-Activating Factor P A F - A H Platelet-Activating Factor Acetyl Hydrolase PAPC 1 -palmitoyl-2-arachidonoyl-3 -sn-phosphatidylcholine XX PARC Pulmonary and Activation-Regulated CC Chemokine PC Phosphatidylcholine PC-PLC Phosphatidylcholine-Specific Phospholipase C PCR Polymerase Chain Reaction PDGF Platelet-Derived Growth Factor PE Phosphatidylethanolamine PECAM Platelet-Endothelial Cell Adhesion Molecule PG Prostaglandin PI Phosphatidylinositol PKC Protein Kinase C PLPC 1 -palmitoyl-2-linoleoyl-3 -sn-phosphatidylcholine PLRP Pancreatic Lipase Related Protein PLTP Phospholipid Transport Protein PMA Phorbol 12-Myristate 13-Acetate PON1 Paraoxonase 1 POPC l-Palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine PPAR Peroxisome Proliferator-Activated Receptor PS Phosphatidylserine RAP Receptor Associated Protein rHDL reconstituted High Density Lipoprotein ROS Reactive Oxygen Species SAA Serum Amyloid-Associated Protein shRNA small hairpin Ribonucleic Acid SHR-SP Stroke-prone Spontaneously Hypertensive Rat siRNA small interfering Ribonucleic Acid SMC Smooth Muscle Cell SNP Single Nucleotide Polymorphism SP Specificity Protein SPH Sphingomyelin sPLA2 secretory Phospholipase A2 SR Scavenger Receptor xxi SRA Scavenger Receptor A SR-BI Scavenger Receptor Class B, Type 1 TARC Thymus- and Activation- Regulated Chemokine TC Total Cholesterol TG Triglyceride TGF Transforming Growth Factor THL Tetrahydrolipstatin TIMP Tissue Inhibitors of Metalloproteinase TNF Tumor Necrosis Factor T X A 2 Thromboxane A 2 VCAM Vascular Cell Adhesion Molecule V E G F R 2 Vascular Endothelial Growth Factor Receptor 2 VLDL Very Low Density Lipoprotein Vmax Maximal Rate of the Enzyme Reaction vWF von Willebrand factor WBC White Blood Cell WHHL Watanabe Heritable Hyperlipidemic Rabbit xxii ACKNOWLEDGEMENTS I am extremely grateful to my graduate supervisor, Dr. John Hill, for his tremendous support during my study. The guidance, encouragement and inspiring discussions he provided made this project proceed as well as it did. Moreover, I highly appreciate his patience and help in preparing manuscripts and this thesis. In addition, I must thank the members of my supervisory committee, Dr. Pritchard, Dr. Steinbrecher, and Dr. Pryzdial, for providing research direction, constructive suggestions and advices, and encouragement. A special "thank-you" has to be allocated to Penny Woo in the Department of Pathology and Laboratory Medicine, who answered many questions and provided up-to-date information timely. Appreciation is extended to the people, especially, Roger Dyer and Alice Mui, who provided me with reagents and technical assistance and to all graduate students who created a happy and collegial atmosphere in the lab. Finally, I would like to acknowledge the Heart and Stroke Foundation of B.C. and Yukon for providing me a Doctoral Research Award. xxiii DEDICATION I dedicate this thesis To my wife, Weiqi Wang, this thesis would not be possible without the loving support from you, you bring me joys and life goals, and you are still my strength and purpose of life. To my mother and father, your moral support and unconditional love cross the ocean, giving me huge encouragement and strength so that I can complete this thesis. Also to my mother-in-law, how grateful I am for your selfless and countless help. To the principle investigators and staff in the ASL lab and Healthy Heart Program, I have learned much from you during my training, and I owe you a lot. xxiv Chapter 1. Introduction 1.1 Atherosclerosis 1.1.1 General Facts Atherosclerosis is defined as the narrowing and hardening of large and medium-sized arteries, with the formation of atheromatous plaques containing cholesterol and lipids in the center. This insidious but progressive pathological process will lead to the disruption of artery blood flow due to either the chronic plaque volume expansion or abrupt plaque rupture and consequent thrombosis. Atherosclerosis is responsible for most cardiovascular diseases, including coronary heart diseases (CHD) such as angina pectoris and myocardial infarction, and ischemic stroke. Epidemiological studies have revealed that atherosclerosis-related cardiovascular disease is the leading cause of death (37.3 percent of all deaths) in most industrialized countries, with a prevalence of 17 per 1000 in the general population of the USA. This disease also accounts for 20,000 hospitalizations and 14,979 deaths per year. Patients afflicted with atherosclerosis have an average loss of 7.5 life years (2001 Heart and Stroke Statistical Update, American Heart Association). 1.1.2 Pathology of Atherosclerosis Atherosclerosis typically begins in major arteries in the early years of life, and slowly proceeds over years, yet is often asymptomatic until it occludes >50% of the vascular lumen. The pathological classification (Figure 1-1) is deduced from a series of postmortem examinations of many persons who died at different ages, although the distinctions between two successive pathological stages are ambiguous in most cases.1'2 Aorta, coronary artery, and ostia of branch vessels are the predisposing sites for atherosclerosis. 1.1.2.1 Intima Thickening The intima is defined as the region of the arterial wall from and including the endothelial surface at the lumen to the internal elastic lamina, the latter is the luminal margin of the media. Intima thickening is an adaptive reaction and regarded to be the initial lesion leading towards atherosclerosis. This lesion can be found as early as in infancy and childhood. The histological changes of this initial lesion are minor. In general, extracellular matrix, most of which is 1 Figure 1-1. The classification of atherosclerotic lesions. Atherosclerosis usually develops insidiously with ambiguous distinction between two consecutive categories. An initial intima thickening featuring the deposition of amorphous material and few lipoproteins progresses into yellow-appearing fatty streak when typical foam cells start to accumulate. Foam cells are derived mainly from infiltrating macrophages and to a lesser degree, smooth muscle cells. With the formation of fibrous tissue, aggregation of foam cells, and small lipid pools, an intermediate lesion develops. The persistence of risk factors drives intermediate lesion into a new stage of atheroma lesion characterized by a full-fledged fibrous cap, one or multiple necrotic lipid cores, and abundant cellularity. Advanced lesions are the continuation of atheromas, bulging inward to narrow vascular lumen. When lesions fissure or rupture, surface thrombosis surmounts with the consequence of partial or complete occlusion of vessel. Mural thrombi are the major cause of ischemic stroke of brain, (modified from Thromb Haemost 2002; 88:554-67) amorphorous material composed of biglycan, decorin, and chondroitin sulfates, deposits in the subendothelial space, whereas the content of heparan sulfate and hyaluronic acid are reduced.3'4 There is only a minor increase in cellularity in the intima at this stage. In the first 8 months of life, 45% of infants have macrophages in their coronary arteries.5'6 Smooth muscle cells (SMCs) in the intima may be the main source responsible for the production of extracellular matrix (ECM).7 Macrophages and smooth muscles are sparsely distributed, typical "foam cells" and 2 extracellular lipid deposition are seldom observed. The internal elastic lamina remains undisrupted at this stage. This initial stage of atherosclerosis can only be detected microscopically. 1.1.2.2 Fatty Streak If atherosclerosis progresses, the next stage is termed fatty streaks, which are yellow streaks, spots, or patches on gross inspection. Fatty streaks are inclined to occur at sites of eccentric intimal thickening, and stain red with Sudan III or Sudan IV. The lesion is usually characterized by the enrichment of macrophage foam cells and increased subendothelial lipid contents. A feature is the stratified aggregates of macrophage "foam cells" which is distinctive from that in the stage of intima thickening when isolated macrophages do not assume the appearance of foam cells. Foam cells are so-described because of their appearance resulting from the numerous internal lipid vesicles. Smooth muscle cells (SMCs) increase in number in the intima, also contribute to the foam cell formation after excessive lipid internalization. T lymphocytes are detected at this stage as well, but less numerous than macrophages and SMCs. Lipid droplets, which primarily consist of cholesteryl esters (CE), free cholesterol (FC), and phospholipids (PL), start to accumulate in the extracellular space.8 Extracellular matrix, especially collagen type I and III, increases noticeably. Another noteworthing feature for this stage is the disruption of endothelial lining and internal elastic lamina.9'10 Fatty streaks may regress with either therapeuti interventions or the removal of risk factors. A progression-prone lesion is typically characterized by a large number of macrophages and SMCs, abundant extracellular matrix and extensive lipid deposition. 1.1.2.3 Intermediate Lesion (Type III) A type III lesion is applied to the pathological change which forms the bridge between fatty streaks and atheromas; therefore, its pathological findings overlap adjacent lesion stages. In general, confluent, well-delineated lipid pools in the extracellular space are evident, with the accumulation of more macrophages and SMCs. A fibrous cap, composed of a collagen layer, is evident on the luminal surface. 3 1.1.2.4 Atheroma (Type IV) The features of a typical atheroma are lipid core, mature fibrous cap, and deformation of vascular structure. The excessive lipid deposition defined as the lipid core is believed to result from the continued insulation of lipoproteins from plasma and lipids released from necrosed foam cells. The enlargement of the lipid core markedly thickens and deforms the intima. Macrophages and SMCs are filled with lipid droplets in the cytoplasm; consequently, apoptotic/necrotic processes frequently take place in these cells. The basal part of the lesion is abundant in cellular components compared to the luminal surface which is covered by a fibrous cap. Connective tissue is also abundant in shoulder regions. More compellingly, the internal elastic lamina is largely destroyed or even disappears. The lesions at this stage usually bulge out from vascular surface; nevertheless, they often fail to narrow the vascular lumen due to the compensatory dilatation of the vascular wall. 1.1.2.5 Advanced Atheroma (type V) At this stage, the vascular lumen area is noticeably narrowed by the lesion expansion so that blood flow is compromised. Based on the amount of lipid content, this lesion can be subdivided into fibrous-lipid (fibroatheroma) plaque and fibrous (fibrotic) plaque. Fibrous-lipid plaques are richer in lipid content compared with fibrous plaques, and often take on a multilayered appearance of lipid-fibrous-lipid arrangement. In addition, cellular components such as macrophages and SMCs are more abundant than in fibrous plaques, in which lipid-laden cells are relatively rare and fibrous tissues are predominant. Fibrous-lipid plaques are more prone to develop complications. In addition, the third type lesion featuring extensive calcification is also included in this category. 1.1.2.6 Complicated Lesions (type VI) These lesions always occur on the basis of type IV and V lesions, and largely contribute to the morbidity and mortality from atherosclerosis. The lesions can be subdivided into: 1) intraplaque hemorrhage due to the erosion of neovaculature; 2) fissures, rupture, and ulceration, which typically occur on lesions rich in macrophages and lipid contents, the direct outcome of plaque rupture or fissure is the activation of platelets and coagulation, which leads to 3) thrombosis. Procoagulative components (tissue factor, collagen) are exposed towards platelets and coagulation factors following plaque rupture or fissure, as a consequence, a cascade of 4 coagulation process ensues in which vessels can be completely occluded. Recanalization can occur to resume the blood supply to some degree if patients survive. 4) embolism, thrombi or the remnants of thrombi are frequent findings on the surface of advanced atheromas. Those thrombi are vulnerable to shed, and lead to ischemic clinical encounters like cerebral strokes. 5) aneurysm: With the degradation of extracellular matrix in the media, mainly collagen type I, the atherosclerotic segment of vessels may bulge outwards, producing an aneurysm. Aneurysms often contain mural thrombi, both recent and old. Although the exact cause of atherosclerosis is not well-elucidated; epidemiological studies in large populations have identified various anatomical, physiological and behavioral risk factors for atherosclerosis. These risk factors can be divided into nonmodifiable/congenital and modifiable/acquired. Aging, family history, and other genetic makeups are nonmodifiable factors, whereas dyslipidemia, hypertension, and unhealthy lifestyles are categorized into modifiable factors as aggressive interventions can reduce their deleterious effects. 1.1.3 Conventional Risk Factors 1.1.3.1 Age and Gender The risk of atherosclerosis increases with age. In an Italian multicenter study, thirty-six percent of the patients under age 45 had a normal angiogram compared with 17% of the patients over 45 years.11 Age is associated with multiple modifiable risk factors, as pro-atherogenic lipid concentration tends to increase with age, so does the blood pressure, sugar level, homocysteine 12 13 level etc. ' Men are more likely to have atherosclerosis than women before age 60. However, the risk is equal for men and women after 60. Differences in lipid profile and sex hormones may account for the disparity of atherosclerosis prevalence between sexes before age 60.14"17 Salutary effects of estrogen also protect women from atherosclerosis, as increased postmenopausal androgenicity in women is associated with an unfavorable cardiovascular risk profile, which may contribute to the resurgence of atherosclerosis in postmenopausal women.18"21 1.1.3.2 Tobacco Smoking The Framingham study found smoking to be an independent factor for atherosclerosis and related complications.22'23 There are sex and age differences of smoking effect on atherosclerosis and its outcomes. The risk increase by smoking is only evident in men ages 45 to 5 64 but not for older men and women.22 Smoking men have a higher mortality than smoking women, cardiovascular mortality was 47% in men who smoked and only 10% in women who smoked in The Nutrition Canada Survey.24 1.1.3.3 Sedentary Life-Style About half of the population are physically inactive in modern society. Sedentary lifestyle is associated with increased cardiovascular events, and about 22% of global cases of CHD are attributed to physical inactivity. Physical inactivity is thought to double the risk of heart disease (WHO World Health Report, 2002 & World Heart Federation Fact-Sheet, 2002). The atherogenic lipid profile is more prevalent in the sedentary population than in the physically active one. Higher total cholesterol (TC), apolipoprotein B (apoB), and atherogenic index was 7S • • * observed in sedentary men. Physical inactivity also increases oxidative stress in the human body. Vascular nicotinamide adenine dinucleotide phosphate-oxidase (NADPH) oxidase expression and the production of reactive oxygen species (ROS) are enhanced with consequently increased vascular lipid peroxidation, impaired endothelium-dependent vasorelaxation, and accelerated atherosclerotic lesion development.26 By contrast, moderate and vigorous exercise substantially reduces the incidence of cardiovascular events in a series of 27 28 prospective epidemiological studies. ' Moreover, physical activity is associated with lower levels of atherogenic lipid profile, inflammatory, and coagulation markers [i.e., C-reactive protein (CRP), serum amyloid-A (SAA), interleukin (IL)-6, tumor necrosis factor (TNF) a, white blood cell (WBC) counts, and fibrinogen (FIB)].29"31 Physical training also improves 32 endothelial function. Physically active lifestyle improves collateral circulation and myocardial perfusion in patients with coronary artery disease and prevents the progression of carotid and coronary atherosclerosis.31'33'34 1.1.3.4 Diets A high-fat, animal based western-style diet is associated with an increased risk of atherosclerosis. Small increase in the consumption of animal-based foods is associated with increased disease risk. Preliminary results of "China Study II" disclose that the switch from traditional plant-based, high-fiber Chinese diet to a Western-style one, may account for the increasing prevalence of cardiovascular diseases (http://www.ctsu.ox.ac.uk/~china/monogi'aph/). Epidemiological evidence and secondary prevention trials suggest that the intake of omega-3 6 polyunsaturated fatty acids from fish oils offers protection from CHD, reduces overall mortality and mortality secondary to myocardial infarction, and reduces sudden death in patients with coronary heart disease.35 In addition, antioxidants may give rise to anti-atherogenic effects. Consumption of vitamin E, C, and beta-carotene could reduce the risk of CHD. " Polyphenols from plant and fruit juice and lycopene from tomato can improve endothelial function, suggesting their anti-atherosclerosis capability.39^2 1.1.3.5 Family History and Genetic Makeup. The risk for atherosclerosis is greater if there is a family history of premature coronary heart disease defined as coronary heart disease with onset age of <55 years for men and <65 years for women. In the four community-based cohorts of the ARIC Study, relatives of 3,034 African Americans and 9,048 white probands aged 45 to 64 years were assessed. Family risk score was associated positively with mean carotid artery intima-media wall thickness (IMT) in white and African-American women and white men 4 3 There are high levels of haemostatic variables (fibrinogen, factor VIIc, factor VIIIc, von Willebrand factor (vWF), antithrombin III (AT III), protein C) in both women and men who have a positive family history of atherosclerosis44. Quantitative trait locus analysis have shown that there are more than 80 genes participating in the regulation of plasma levels for high density lipoprotein (HDL) cholesterol, low density lipoprotein (LDL) cholesterol, and triglycerides. Those genes are potential genetic modifiers of atherosclerosis.45 In certain families and isolated communities, the effect of a single candidate gene upon atherosclerosis susceptibility may be profound, such as mutations in low-density lipoprotein receptor, which produce familial hypercholesterolemia. 4 6 More commonly, single gene polymorphisms (SNPs) cause intermediate phenotypes, and their direct effect on atherosclerosis may be difficult to define. When more than two candidate genes are defective concurrently, the risk for atherosclerosis then increases considerably because of the accumulative effect of intermediate phenotypes. The phenotype expression of the genetic makeup may not culminate until the human body is challenged under certain conditions related to the developmental stage, age, chronic and acute dietary influence, drug or toxin, the aggravating physiological state of organs. This is the basis of the gene-environment interaction hypothesis. 7 1.1.3.6 Dyslipidemia Elevated serum cholesterol has been long recognized as the risk factor of atherosclerosis. More severe and widely distributed atherosclerotic lesions are found in patients with familial hypercholesteremia compared to normolipidemic patients.47 Cholesterol exists in conjunction with lipoproteins, high LDL-cholesterol (LDL-c) level is directly related to atherosclerosis, whereas HDL-cholesterolholesterol (HDL-cholesterol) is negatively associated with athoerosclerosis. An elevated ratio of LDL-c to HDL-cholesterol is a common finding in patients with atherosclerosis. The level LDL is well correlated with coronary atherosclerotic lesions, the reduction of LDL cholesterol levels by diet and combined drug regimens can induce the regression of atherosclerotic lesions in patients with familial hypercholesterolemia.48'49 High LDL-c promotes atherosclerosis by a wide range of mechanisms, including impairing endothelial function,50 promoting foam cell formation, stimulating SMC proliferation and ECM production.51 Further modified LDL such as small-sized LDL, oxidized LDL (oxLDL), and glycated LDL are even more potent in biological activities. However, reduced levels have a reduced capacity to prevent the detrimental process so that atherogenesis is accelerated. The effect of triglycerides on atherosclerosis is increasingly recognized. A stronger association between plasma triglyceride levels and coronary heart disease is clearly demonstrated in patients with total cholesterol levels less than 5.7 mmol/L, or HDL-cholesterolholesterol levels less than 1 mmol/L. The reduction of plasma triglyceride levels significantly decreased coronary heart disease mortality by 36% in general and by 60% in patients whose triglyceride levels fell greater than 30%.52"54 Hypertriglyceridemia may affect atherogenesis through the increased production of atherogenic chylomicrons (CM) and very low density lipoprotein (VLDL) remnants, with the concurrent decreased HDL level. 1.1.3.7 High Blood Pressure Hypertension is associated with a 2 to 3 fold increase in risk for atherosclerosis-related cardiovascular events.55 In animal models, hypertensive mice and rabbits have significantly more extensive atherosclerosis in the abdominal aorta, brachial, iliac-femoral, and carotid 8 arteries. Prolonged existence of high blood pressure destroys endothelial integrity, induces SMC proliferation, and promotes atherosclerotic plaque progression.59 Proinflammatory cytokine expression associated with hypertension further aggravates the atherogenic process.60 1.1.3.8 Diabetes or Impaired Glucose Tolerance There is a wealth of clinical data supporting that impaired glucose tolerance, and of course type 1 and type 2 diabetes mellitus are positively correlated to atherosclerosis and related clinical complications. According to National Diabetes Information Clearinghouse USA, rates of stroke and CVD death are 2 to 4 times higher among adults with diabetes than in those without the disease (http://diabetes.niddk.nih.gov/). Hyperinsulinemia may be the first and genuine marker connected to the clinical manifestations of atherosclerosis.61 A variety of other mechanisms participate in the accelerated development of atherosclerosis in diabetics. Glycated end products and high-level insulin promote pro-inflammatory cytokine expression, SMC proliferation, lipid 62 65 accumulation, and lesion development. " Altered lipid metabolism, especially hypertriglyceridemia and low HDL level, also plays a contributory role to atherosclerosis. 1.1.3.9 Obesity The Framingham Heart Study in the United States has consistently shown that increased degree of obesity is accompanied by greater rate of CHD. 6 6 Obesity can be divided into two types: central/abdominal and gluteal ones. The risk level for atherosclerosis is much higher in patients with abdominal/central obesity in comparison with those with gluteal obesity. The indicators for central obesity such as waist-to-hip ratio and waist circumference are associated with accelerated atherosclerosis in common carotid artery in a 4-year observation period in men. In addition, the intravascular coronary ultrasound study reveals that obesity is independently associated with coronary atherosclerosis in patients with angiographically normal or mildly diseased coronary arteries.68'69 In young men, body mass index (BMI) is positively associated with both fatty streaks and raised atherosclerotic lesions in coronary arteries, however, the effect of obesity on atherosclerosis is less significant in women than in men.69 Further investigations disclosed the association of obesity with other conventional and emerging risk factors including atherogenetic lipid pattern, pro-thrombotic and hypofibrinolytic pattern, proinflammatory status, 70 and insulin resistance. 9 1.1.3.10 Psychological Factors Psychosocial stress or depression also influences the development and progression of atherosclerosis.71'72 The prevalence of carotid lesions among men in the highest stress quintile was 36% compared with 21% among men in the lowest quintile, an increased IMT was also 73 * observed in men in the highest quintile compared to the lowest. Conversely, stress reduction with the Transcendental Meditation program decreases coronary heart disease risk factors and cardiovascular mortality in general populations as well as in African Americans.74'75 1.1.4 Emerging Risk Factors 1.1.4.1 Homocysteine Homocysteine is an amino acid, derived from the metabolism of methionine. An elevated homocysteine level in blood is usually due to congenital enzyme defects or nutritional influences. High level of blood homocysteine is increasingly being recognized as an important risk factor for atherosclerosis. Wicken et al. first found that patients <50 years old with angiographically proven coronary artery disease had a higher homocysteine mixed disulfide than in control subjects using the methionine loading test.76 High level of blood homocysteine was also found 77 7R in patients with premature vascular disease and stroke. ' There is a linear relationship between the severity of coronary artery disease and cerebrovascular disease with homocysteine levels, higher homocysteine level is always associated with more severe atherosclerotic diseases.79 The association between fasting plasma homocysteine and CHD is also evident in other ethnic groups such as the Indian and Chinese populations.80 In the cellular biological levels, homocysteine has been proven to stimulate SMC proliferation,8 injure the endothelial function, and enhance monocyte margination. ' Homocysteine also increases the oxidative stress and lipid perioxidation, ~ interferes with coagulation and fibrinolysis, and stimulates platelet activation and aggregation. " Homocysteine levels can be reduced by low-dose folic acid combined with vitamins J36 and B12 as well as cereal consumption.91'92 Vitamin supplementation in addition to grain fortification to all men aged 45 years or older will be considered to be the preferred strategy in the primary and secondary prevention of coronary heart disease. 10 1.1.4.2 Lipoprotein (a) The size and structure of lipoprotein (a) [Lp(a)] is very similar to LDL, except that Lp(a) contains a unique protein called apolipoprotein (a) [apo(a)], which is covalently bound to apoBioo- Apo(a) is structurally homologous to plasminogen molecule so that Lp(a) may be involved in thrombotic process. Lp(a) tends to be more easily oxidized than LDL and increases its atherogenicity. High level of Lp(a) is an independent risk factor for atherosclerosis. Patients with coronary heart disease have a higher level of Lp(a) than controls.94 In general, a concentration of >30 mg/dl of Lp(a) in serum is associated with a 2- to 6-fold increase in risk, depending on the presence of other risk factors.95'96 Patients with increased Lp(a) levels are at increased risk of unstable angina and myocardial infarction.97 An increased level of Lp(a) was associated with increased / risk of cardiac death in patients with acute coronary syndrome.98 Moreover, rapid progression of coronary atherosclerotic lesions and restenosis after angioplasty and coronary bypass procedures were observed in patients with increased Lp(a) concentrations.99"102 The serum Lp(a) level also has a close correlation with angiographic progression, a much higher median Lp(a) concentration was found in the progression group than those in the no-change and regression 103 groups. 1.1.4.3 CRP C-reactive protein (CRP) is an acute phase reactant in the response to acute injury, infection, or other inflammatory stimuli. CRP is generally produced from inflammatory cells including monocytes, neutrophils, and lymphocytes, and has been recognized as a marker of chronic inflammation. Pathological investigation has disclosed that those inflammatory cells exist in atheromatous plaques, and that the recruitment of those cells is one of the earliest event in atherogenesis.104'105 Studies have shown a positive association between CRP and coronary artery disease. The odds ratio for coronary heart disease in participants in the top third percentile of CRP values was 1.45 in comparison with those in the bottom third percentile.106 High-sensitivity CRP (hs-CRP) level is also associated with the number and score of aortic plaques, even after the adjustment for age, 11 sex, smoking status, and additional atherosclerosis risk factors.107'108 As the plaque rupture appears to occur in the regions like the shoulder area which is abundant in inflammatory cells, thus the release of acute phase reactants such as CRP has been proposed as a potential marker of unstable atheromatous plaque and consequent ischemic cardiac events.109 Indeed, an elevated plasma CRP level increases the relative risk of initial myocardial infarction at every level of the ratio of plasma TC/HDL-cholesterol in apparently healthy men in the Physicians' Health Study.110 Multiple mechanisms have been proposed as a mechanistic link between CRP and cardiovascular diseases. High CRP is associated with profound endothelial dysfunction and disrupted nitric oxide (NO) production.111'112 CRP at high concentrations (> or =15 pg/ml) significantly inhibits endothelial progenitor cell (EPC) differentiation with decreased expression of the endothelial cell-specific markers vascular endothelial growth factor receptor 2 (VEGFR2)/Tie-2, endothelial cell-lectin, and vascular epithelium-cadherin, also reduces EPC cell number, increases EPC apoptosis, and impairs EPC-induced angiogenesis.113 CRP may also contribute to plaque vulnerability by inducing SMC apoptosis and expression of matrix metalloproteinase (MMP) 2. 1 1 4' 1 1 5 CRP stimulation can markedly increase ROS production in macrophages to increase oxidative stress.116 CRP may also stimulate the adhesion molecule expression by endothelial cell to attract more monocytes,"7'118 promoting the formation of macrophage-derived foam cells by increasing LDL internalization.119'120 1.1.4.4 Fibrinogen and Prothrombotic Status The cascade of coagulation and thrombosis, where fibrinogen is regarded as the central process, is closely involved in the pathogenesis of atherosclerosis.121 The occurrence of fibrinogen/fibrin I, fibrin II, and fibrin(ogen) degradation products (FDP) in fibrous and advanced plaques 122 indicates their critical role in the development of atherosclerosis. The case-control analysis of the ARIC Study demonstrated a significant association between 1 9^ plasma fibrinogen concentration and early atherosclerosis in the carotid arteries, this association was also found for femoral, and aortic plaque and coronary calcium deposit.124 Elevated fibrinogen is also associated with the progression of atherosclerosis, and predicts the risk of cardiovascular events. Adjusted hazard ratios for carotid atherosclerosis progression with 12 increasing quartiles of baseline fibrinogen were 1.83,2.09, and 2.45, respectively, compared with the lowest quartile.125 Increased FDP level was associated with both the frequency of • 126 complications and the mortality in patients with acute myocardial infarction. 1.1.4.5 Microorganism Infection The fact that many microorganisms have been detected in the atherosclerotic raises the infection hypothesis in atherogenesis. Viral infection as a potential cause of atherosclerosis was first proposed by Benditt EP and Melnick JL et. al in 1983127'128 as they showed that herpes simplex virus (HSV) and cytomegalovirus (CMV) infection were detectable in atherosclerotic specimens. In a case-control study, a high CMV antibody titer was associated with an adjusted odds ratio of 5.3 for atherosclerosis compared with a low CMV antibody titer.129 In-vitro studies show that HSV infection stimulates SMC proliferation and lipid accumulation,130 increases the prothrombotic activity,131'132 and promotes the inflammatory cell recruitment.132'133 However, the causative relation between HSV infection and atherosclerosis remains unconfirmed.134'135 The association between Chlamydia infection and atherosclerosis was first reported in patients with coronary heart disease in 1993. The C. pneumoniae index based on the relative amount of immune complex-derived antibodies and free antibodies was significantly higher compared with 136 control subjects. The direct evidence of Chlamydia pneumoniae infection in atherosclerotic lesions has already been demonstrated by polymerase chain reaction (PCR) assay, immunocytochemistry, electron microscopy, and in situ hybridization, and this pathogen is specifically localized in macrophages and SMCs. 1 3 7 ' 1 3 8 Chlamydia infection is also associated with asymptomatic atherosclerosis according to the Atherosclerosis Risk in Communities Study. The causative role of Chlamydia in atherogenesis is also confirmed in an animal model where Chlamydia infection accelerates the development of atherosclerosis and treatment with azithromycin prevents atherosclerosis.140 It is also reported that pathogens for periodontal diseases could be linked to atherosclerosis. Subjects infected with Campylobacter rectus and Peptostreptococcus micros were more likely to have higher IMT scores (OR 2.9).141 Porphyromonas gingivalis and Streptococcus sanguis are two major odontopathogens that have been detected in atherosclerotic plaques.142 13 1.2 Macrophage and Atherogenesis Macrophages are an essential component of body immune defense, assuming critical functions in both native and acquired immunity. In innate immunity, macrophages interact with the surface molecular pattern of pathogens, trigger phagocytosis and further processing in lysosomes to inactivate or detoxify them. In acquired immunity, phagocytosis of antigen by macrophages is enhanced by antigen-bound immunoglobulin G. Macrophages can also collaborate with T cells through cell-cell network and cytokine-mediated machinery to coordinate inflammatory responses.143 Many hypotheses for atherogenesis have been formulated, including response-to-injury hypothesis, inflammation hypothesis, oxidative stress hypothesis, and endothelial dysfunction hypothesis, however, the central process inevitably involves macrophages (Figure 1-2).105'144 The atherogenic process is believed to begin when endothelial cells become damaged. As a response to injuries, circulating white blood cells, especially monocytes, are attracted and adhere to the vessel wall, migrate underneath the surface layer, and initiate the inflammatory reaction. Even if the initial appearance of macrophages seems to be protective against vascular damage such as clearance of lipoproteins and increasing cholesterol efflux into HDL, the overall long-term effect is destined to be proatherogenic. For example, hypercholesterolemic mice become much more resistant to atherosclerosis after macrophage depletion through breeding with macrophage-deficient mice.145 1.2.1 Macrophage Recruitment and Migration The prerequisite for monocyte recruitment is the disruption of endothelial integrity so that adhesion molecules are over-expressed on the surface. So far, a variety of risk factors have been proven to be detrimental to endothelia and stimulate the production of adhesion molecules on endothelial lining.146"149 14 Modified from N EngJ Med 1999:115-26 Figure 1-2. The role of macrophage in atherogenesis. The overexpression of adhesion molecules and chemokines on atherosclerosis-prone sites under the abusing factors will attract and recruit monocytes into intima where they differentiate into macrophages. Activated macrophages obtain the enhanced ability to internalize lipoproteins to become lipid-laden foam cells. Also, macrophages are active in the secretion of various cytokines and bioactive substances which can magnify the reaction in a malicious feedback loop by stimulating SMC proliferation, impairing endothelial function, and increasing inflammatory and oxidative stresses. The massive degradation of extracellular matrix will lead to plaque rupture and serious outcomes. 1.2.1.1 Adhesion Molecules When injured, endothelial cells increase their expression of adhesion molecules such as selectins, integrins, intercellular adhesion molecule (ICAM) -1, vascular cell adhesion molecule (VCAM) -1. These adhesion molecules have relatively high affinity for monocytes, regarded as major players in early enrollment of monocytes.150 In ICAM-1 deficient mice, monocyte deposition in intima decreases with the accompaniment of reduced atherosclerosis.151 Selectins are also playing an important role in the recruitment of macrophages. Animals lacking P- or E-selectins have a decreased tendency to form atherosclerotic plaques.1 5 1"1 5 3 15 Generally, the margination of monocytes into intima can be divided into 3 phases, namely, rolling, anchoring/firm adhesion, and migration. The rolling step is thought to be mediated by P-, L-, and E-selectins as over-expression of those selectins in endothelial cells is associated with enhanced adherence of monocytes.153"156 Thereafter, this attachment is fortified by the sequential participation of integrins, VCAM-1, and ICAM-1. 1 5 7 The blockage of P-selectin or VCAM-1 158 significantly inhibits monocyte attachment and margination. 1.2.1.2 Chemokines Chemoattractants such as monocyte chemoattractant protein (MCP) -1/CCL2 (CC-motif chemokine ligand 2), IL-8, and CXC-motif chemokines are also important during monocyte infiltration. Like adhesion molecules, the expression of chemokines is elevated by risk factors, and is associated with an increased number of monocytes in the intima.159"161 Chemotactic receptors such as CCR-2 (CC-motif chemokine receptor 2) and CXCR-2 (CXC motif chemokine receptor 2) for MCP-1 and IL-8 respectively are found on the monocyte surface. Deficiency of MCP-1 or CCR-2 markedly decreased atherosclerotic lesion formation and limited the progression and destabilization of established atherosclerosis in the genetic background of apoE or low density lipoprotein receptor (LDLR) knockout as well as apoB transgenic mice.162"166 Concentration gradient of chemoattractants such as MCP-1 and IL-8 between epical and basal sides of endothelial layer is the driving force of monocyte migration through endothelial barrier 167 168 into intima. ' Although less well established, other chemokines such as RANTES (Regulated on Activation, Normal T-cell Expressed and Secreted), macrophage inflammatory protein (MIP) - la and MIP-lp\ MCP-4, EBI1 ligand chemokine (ELC) and pulmonary and activation-regulated CC chemokine (PARC) have also been implicated in atherosclerotic lesion formation.169 1.2.2 Monocyte Differentiation and Activation Undifferentiated monocytes are granted less capacity to internalize lipids in comparison with differentiated monocytes/macrophages. The differentiation is actually taking place during migration rather than an isolated event. Upon interaction with surface receptors, adhesion molecules and chemokines immediately trigger a series of complicated intracellular biochemical 16 reactions. For example, mitogen-activated protein kinases (MAPKs) like extracellular signal-regulated kinase (ERK), Janus kinase (JAK), c-Jun N-terminal kinase (JNK) and p38 are activated by MCP-1, 1 7 0 so are intracellular cyclic guanosine monophosphate (GMP) and cyclic GMP-dependent protein kinase,171 and calcium mobilization.172 The cascade activation of intracellular signaling molecules leads to the activation and translocation of nuclear transcription factors such as nuclear factor-kappa B ( N F - K B ) . 1 7 3 1.2.3 Macrophage and Proinflammatory Response Activated macrophages can de novo synthesize and release a large variety of cytokines (i.e., IL-1, IL-lra, IL-6, IL-8, IL-10, IL-12, TNF-alpha, interferon (IFN) a, IFN-y, MCP-1, MCP-3, macrophage migration inhibitory factor (MIF), macrophage colony stimulating factor (M-CSF), granulocyte CSF (G-CSF), granulocyte-macrophage CSF (GM-CSF), MIP-1, MIP-2, leukemia inhibitory factor (LIF), oncostatin M (OSM), transforming growth factor (TGF) -(3. Table 1-1). Table 1-1: Cytokines and bioactive molecules produced by macrophages174 Cytokines and its receptors Chemokines: MCP-1,2,3, IL-8, RANTES, ELC, PARC, MIP-1 a,b, macrophage-derived chemokine (MDC), thymus- and activation- regulated chemokine (TARC) Colony stimulating factors: M-CSF, G-CSF, GM-CSF Growth factors: platelet-derived growth factor (PDGF), TGF Interferons: IFN-a, IFN-y Interleukins: IL-lp\ 4, 6, 8, 10, 12, 13, 15, 18, Adhesion molecules and receptors ICAM-1, VCAM-1, platelet-endothelial cell adhesion molecule (PECAM) -1, P, E, L-selectin Arachidonic acid and phospholipid derivatives Prostaglandins (PGs), leukotrienes (LTs) (LTA4/LTB4/LTC4/LTD4/LTE4/LTF4), thromboxane A2 (TXA2), platelet activating factor (PAF), lysophosphatidylcholine (lyso-PC) Components of coagulation and fibrinolysis Tissue factor, PAF, Enzymes Oxidative stress related: secretory phospholipase A2 (sPLA2), cyclooxygenase, lipoxygenase, NADPH oxygenase, E C M related MMPs, Some cytokines can upregulate the production of other cytokines in macrophages for self-amplification of the inflammatory reaction. These cytokines and chemokines are involved in a 17 variety of biological and pathological processes, modulate many macrophage functions, lead to monocyte recruitment, increased lipid oxidation and uptake, compromised cholesterol efflux, SMC proliferation, and ECM remodeling. 1.2.4 Macrophage and Foam Cell Formation Foam cell formation is characteristic of atherosclerosis. Macrophages express several lipoprotein receptors that are responsible for lipid uptake. Although macrophages have constitutional expression of LDLR and LDL receptor related protein (LRP), the contribution of these to overall intracellular lipid deposition is relatively negligible. Most important receptors involved in lipid internalization are scavenger receptor (SR) A, CD36, and lectin-like oxidized low-density lipoprotein receptor-1 (LOX-l).Upon oxidation, the affinity of lipoproteins for receptors significantly increased in proportion to oxidized phospholipid content.175 Progressive decreases in oxidized phospholipids associated with apoB in oxLDL decreases the ability of the protein to compete for macrophage scavenger receptors and also decreases its reactivity with 176 antibodies against oxLDL. Scavenger receptor BI (SR-BI) generally is colocalized with and 177 178 regulated by caveolin-1 on the cell membrane. ' SR-BI was initially thought to be the HDL receptor and implicated in the selective cholesterol uptake in hepatocytes and steroidogenic tissues,179'180 recent findings support that SR-BI may serve as the receptor for oxLDL and hypochlorite-modified LDL in human macrophages to increase the cholesterol uptake.181'182 1.2.5 Macrophage and Oxidative Stress Accumulating evidence supports that the modification of lipoproteins is the essential step in its conversion towards atherogenic particles and sequential lipid accumulation in macrophages. The well-studied mechanism of lipoprotein modification is oxidation. Oxidation occurs mainly in intima as well as on the endothelial surface. The entrapment of lipoproteins in ECM is critical for the oxidation to be completed, because engineered LDL particles defective for binding to heparan sulfate proteoglycans are less atherogenic in LDLR-/- mice.183 Activated macrophages produce a large quantity of oxygen free radicals, free nitric and superoxide radicals, and reactive nitrogen species, which have been implicated for lipoprotein oxidation.184 Lipoxygenase, myeloperoxidase, and NADPH oxidase, are found to be highly expressed in macrophages and are regarded as primary enzymes in lipoprotein oxidation.185"188 Macrophages also produce 18 inducible nitric oxide synthase (iNOS) which may also elicit an oxidation reaction. However, its role is still controversial, as the overexpression of iNOS demonstrated protective effect in mouse models.189'190 Paraoxonase-1, bilirubin and heme oxygenase are enzymes thought to counteract excessive oxidative stress.191"193 Paraoxonase-1 activity is impaired in atherosclerosis-related diseases.194' 1 9 5 However, even with overexpression, the antioxidative capacity of heme oxygenase-1 and bilirubin are still not strong enough to eliminate the reactive oxygen and nitrogen species during atherogenesis.196 1.2.6 Macrophage and Endothelial Dysfunction Endothelial cells can produce a plethora of cytokines, chemokines, cell surface receptors, adhesion molecules, and other bioactive substances, playing an important role in thrombosis and coagulation, inflammation, vasodilation, and oxidation. Disrupted structural and functional integrity results in pathological states as exemplified by atherosclerosis. Overactivation of macrophages can impair the structural integrity of endothelia, resulting in high permeability of endothelial barrier.197 Elevated oxidative stress after macrophage activation further aggregates endothelial dysfunction, of which serum myeloperoxidase levels can serve as a strong and independent predictor.198 In addition, macrophage incubation with endothelial cells upregulates the expression of adhesion molecules,199 which recruit more inflammatory cells, and then trigger a malicious feedback loop. Impaired equilibriums of coagulation and fibrinolysis, vasodilation and vasoconstriction are also induced with the increased expression of plasminogen activator inhibitor-1, angiotensin II, and endothelin-1, the expression of which is closely related to macrophage activation.200 1.2.7 Macrophage and Plaque Vulnerability ECM proteins such as collagens encircle the necrotic core. The intensity and thickness dictate the plaque vulnerability. Atherosclerotic plaque vulnerable to rupture is characterized by high cellularity (especially macrophages), thin fibrous cap, and large lipid-rich necrotic core. The shoulder region of plaque where rupture usually occurs is correlated with the enrichment of macrophages. 19 Matrix Metalloproteinases (MMPs) and their tissue inhibitors of matrix metalloproteinases (TIMPs) are the enzymes responsible for the maintenance of E C M equilibrium. Enhanced regional expression of vascular MMPs has been detected in atherosclerotic plaques, which contributes to the thinning of matrix and favors plaque rupture. Matrix-degrading enzymes are 202 203 * constitutionally produced by macrophages, ' and their expression is enhanced by macrophage activation.2 0 4 Statin regimens have been proven to stabilize atherosclerotic plaque, and this effect may be partially due to their ability to suppress the expression of MMPs in human macrophages.205"207 E C M degradation is also intimately related to the formation of pseudo-aneurysm. In apo E knock-out mice also deficient in TIMP-1, the internal elastic lamina is apparently destroyed and inflicted regions are prone to dilation. 2 0 8 E C M degradation is also involved in intraplaque hemorrhage since a close association of macrophage activation with intraplaque microvessel hemorrhage was revealed by immunostaining in human endarterectomy samples.209 20 1.3 Lipid Metabolism 1.3.1 Lipoprotein Classification Cholesterol and triglycerides are insoluble in aqueous plasma, therefore, circulating lipids are incorporated into the form of lipoproteins, and delivered to various tissues for energy utilization, lipid deposition, steroid hormone production, and bile acid formation. A typical lipoprotein is composed of esterified and unesterified cholesterol, triglycerides, phospholipids, and protein contents, the latter are known as apolipoproteins and surround lipoprotein particle. Apolipoproteins are lipid-binding proteins that have a-helical structures in common. Due to their amphipathic properties, apolipoproteins are capable of solubilizing the hydrophobic lipid constituents of lipoproteins, and transport dietary lipids through the bloodstream from the intestine to the liver, and endogenously synthesized lipids from the liver to tissues. Also, apolipoproteins can serve as either enzyme co-factors or receptor ligands, participating in the regulation of lipoprotein metabolism. Lipoproteins can be classified into several classes according to their densities (Table 1-2), as such, they can be isolated using density gradient centrifugation. In addition, the density of lipoproteins is inversely related to their size, as chylomicron has the largest diameter but lowest density, and HDL is smallest in size but highest in density (figure 1-3). Table 1-2. The classification of lipoproteins Lipoprotein Density g/ml TG % CE % FC % PL % Apolipoprotein CM <0.95 85-88 3 1 8 J348, E, AI, All, AIV, ci, cn, cm, H VLDL 0.95-1.006 50-55 12-15 8-10 18-20 Bioo, E, ci , cn, c m IDL 1.006-1.019 25-30 32-35 8-10 25-27 B,oo, E, CI, CII, c m LDL 1.019-1.062 10-15 37-48 8-10 20-28 Bioo, E, CI, CII, c m HDL 1.063-1.20 3-15 15-30 2-10 26-46 AI, All, AIV, E, CI, cii , cm, D (TG: triglyceride, CE: cholesteryl ester, FC: free cholesterol, PL: phospholipids, CM: chylomicron, VLDL: very low density lipoprotein, IDL: intermediate density lipoprotein, LDL: low density lipoprotein, HDL: high density lipoprotein.) 21 Classification of Lipoproteins 1000 nm 70 nm 40 nm 20 nm 10 nm Chylomicron or Chylomicron Remnant Vary Low Density Lipoprotein Intermediate Low High Density Density Density Lipoprotein Lipoprotein Lipoprotein Figure 1-3. The classification of lipoproteins by size. Chylomicrons are largest in size and contain >90% triglycerides, very low density lipoprotein (VLDL) is 10 times smaller in size than chylomicrons with less triglyceride but higher cholesterol and phospholipid contents. Intermediate and low density lipoproteins (IDL and LDL) are derived from V L D L . Compared to V L D L , IDL and L D L have a progressive decrease in size and triglyceride content but relatively higher cholesterol percentage. High density lipoprotein (HDL) is smallest in size and rich in phospholipids and protein. 1.3.2 Lipoprotein Metabolism Lipoprotein metabolism can be divided into exogenous and endogenous pathways (Figure 1 -4 and 1-5). The exogenous pathway starts with the intestinal absorption of dietary lipids and formation of chylomicrons in enterocytes, and ends with the removal of chylomicron remnants by liver. The endogenous pathway is represented by hepatic synthesis of V L D L and its metabolism. 1.3.2.1 Exogenous Pathway Dietary lipids include triacylglycerol, diacylglycerol, monoacylglycerol, free fatty acids, and sterols (most are animal-origin cholesterol). Triglycerides contribute to >90% energy supply from fats. Most of phospholipids and bile salts in the gut are provided by biliary secretion. In order to translocate dietary lipids from the intestinal lumen into enterocytes, dietary lipids must undergo a series of physicochemical processes such as emulsification, lipolysis, and solubilization, also called the intraluminal phase of digestion. 22 Dietary lipids are virtually insoluble in aqueous solution, thus large aggregates of dietary lipids must be broken down physically and held in suspension, this process is called emulsification. Bile salts play a critical role in lipid emulsification. Bile salts are derived from cholesterol and have both hydrophobic and hydrophilic domains. The hydrophobic groups enable bile salts to interact with hydrophobic surface of dietary lipids, and the hydrophilic groups are arranged outwards. This coating process will lead to the breakdown of lipid aggregates into small lipid droplets, and suspend them in aqueous environment. Emulsification maximizes the efficiency of lipid hydrolysis, which is predominantly accomplished by pancreatic lipase. Pancreatic lipase hydrolyzes triglycerides at 1- and 3- positions to release two free fatty acids and one 2-monoacylglycerol. The liberated fatty acids and residual monoacylglycerol are associated with bile salts, and incorporate phospholipids to form a spherical structure called micelles. Dietary sterols like cholesterol are also integrated into micelles. Figure 1-4. Exogenous pathway of lipoprotein metabolism. Dietary triglycerides are emulsified by bile salts, then hydrolyzed by pancreatic lipase in intestine, the hydrolytic products, phospholipids, and cholesterol are solubilized in micelles, then absorbed into enterocytes where triglycerides are resynthesized. Chylomicrons (CM) are formed from absorbed phospholipids, cholesterol, and resynthesized triglycerides in enterocytes, transported into lymphatic vessels, and eventually enter the circulation. Chylomicrons lose triglycerides after lipoprotein lipase (LPL) hydrolysis in peripheral tissues like adipose tissues and skeletal muscles to become chylomicron remnants which are removed from blood by liver via a receptor-mediated pathway. Hepatic lipase (HL) may accelerate the C M remnant removal by hydrolysis and enhancing C M binding to hepatocytes. 23 Absorption takes place on the brush border of enterocytes. Free fatty acids and monoacylglycerol are able to cross the enterocyte membrane by free diffusion. Cholesterol is absorbed in the jejunal and ileal surface by both free diffusion and active transportation, ABC transporters are involved in this process.213'214 Also, the esterification of cholesterol in enterocytes can accelerate its absorption.215'216 The absorbed free fatty acids and monoacylglycerol are reassembled into triglycerides in smooth endoplasmic reticulum and then transported into Golgi apparatus, where they are packaged with cholesterol and apolipoproteins into chylomicrons. The synthesized chylomicrons are then secreted by exocytosis at the basolateral side of enterocytes. Chylomicrons eventually enter the lymphatic vessels in the microvilli of intestinal epithelia and transported through the thoracic duct into the circulation. Chylomicrons are associated with a variety of apolipoproteins, particularly apoB4g. Enterocytes also produce apoAI, All, and AIV, and those apolipoproteins are also incorporated into newly synthesized chylomicrons in the Golgi apparatus. After entering the blood, chylomicrons acquire apoE, apoCI, CII, CHI from HDL. Meanwhile, lipolysis, initiated mainly by lipoprotein lipase (LPL), occurs in tissues such as skeletal muscles and adipose tissues. The released fatty acids are absorbed and utilized for either energy supply or storage. With the decrease in size, chylomicrons undergo a remodeling process during which excess apoAs, apoCs, and phospholipids are transferred back to HDL. These remodeled chylomicrons are called chylomicron remnants, and contain primarily cholesterol, apoE, and apoB4g. Chylomicron remnants will be eventually removed by liver through LDL receptor or LDL receptor related 217 protein (LRP). A chylomicron remnant receptor, which interacts with apoE, also participates in the removal of chylomicron remnants.218 1.3.2.2 Endogenous Pathway The metabolic pathway of VLDL represents the endogenous pathway of lipid metabolism (Figure 1-5). VLDL is primarily produced by hepatocytes in liver, carrying endogenous triglycerides and to a lesser degree, cholesterol. The major apolipoprotein associated with VLDL is apoBioo- Upon secretion into the blood, VLDL acquires cholesteryl ester in exchange for triglycerides, apoCI, CII, CIII, and apoE from HDL. VLDL is hydrolyzed in a similar way as chylomicrons, LPL decreases the VLDL size by hydrolyzing triglycerides, transforms VLDL 24 into IDL. Components of apoC are shed off and return to HDL during the remodeling from VLDL to IDL. With the further loss of triglycerides, IDL converts into a dense and small-sized particle LDL. The LDL particle predominantly consists of cholesteryl ester, apoBioo, and apoE. LDL has been proven to be proatherogenic and is considered to be one of the most important risk factors for atherosclerosis. Another well-known proatherogenic lipoprotein is Lp(a) which is derived from LDL with apo(a) covalently bound to apoBioo- LDL can be chemically modified into various forms such as oxidized LDL and glycated LDL, and the latter are even more proatherogenic, as they can be rapidly ntenalzied by macrophage scavenger receptors. Figure 1-5. Endogenous pathway of lipoprotein metabolism. VLDL, which is synthesized by hepatocytes, loses its triglycerides by LPL hydrolysis in peripheral tissues to provide free fatty acids for energy consumption in skeletal muscles or storage in adipose tissues. With the progressive loss of lipid content, the remnant VLDL is transformed into IDL and then LDL, which are cleared by the liver via receptor-mediated pathway. VLDL and its derivatives IDL and LDL deliver triglycerides and cholesterol to tissues, where triglycerides are hydrolyzed to release free fatty acids for energy utilization and storage. Cholesterol, mainly in an esterified form, is also taken up by tissues for the purposes of hormone and steroid synthesis. Lei ion Formation Skeletal Muscle 2 5 IDL and LDL are generally removed from the blood via the LDL receptor and LRP, both of which interact with apoB and/or apoE components in IDL and LDL. The mutation of LDLR, as occurs in familial hypercholesterolemia, will result in elevated cholesterol levels in blood due to the defective clearance of LDL. Compared to native LDL, modified LDLs have higher affinity for scavenger receptors (i.e., SRA, CD36, CD68, and LOX-1). Upregulation of these receptors 219 in cells or target tissues cause excessive lipid retention and atherosclerosis. 1.3.3 Metabolism of H D L 1.3.3.1 H D L Classification The major apolipoprotein in HDL is apoAI, which is synthesized in the liver and small 220 221 intestine. * Most circulating apoAI is recycled from the transformation of lipoproteins. Chylomicrons are a significant carrier of intestine-synthesized apoAI. ApoAI can be transferred to HDL during chylomicron remodeling consequent to LPL lipolysis. When subjected to LPL catabolism, triglyceride-rich VLDL and LDL can be additional donors for apoAI.222 Similarly, redundant apoAI will be released during the transition of H D L 3 to H D L 2 . Regenerated free apoAI can be reincorporated back into HDL. ' HDL formation requires lipidation of free apoAI with cholesterol and phospholipids intracellularly or extracellularly. Extracellular lipidation takes place in two distinct pathways, an ATP-binding cassette transporter A l (ABCA1) -mediated and a non-ABC A1 mediated pathway. Free apoAI is a good lipid acceptor from peripheral tissues, predominantly through interacting with ABCA1. The mutation of ABCAlin the case of Tangier disease results in compromised lipidation and virtually undetectable plasma HDL levels.227 After initial binding of phospholipids, apoAI is transformed into discoidal pre-P HDL. This subsequently interacts with SR-BI, ABCG1, or caveolins to acquire cholesterol and become a mature spherical HDL particle. Pre-P HDL is associated with various apolipoproteins including apoAI, All, CI, CII, O i l , D, and E. This nascent discoidal HDL has a phospholipid bilayer and two or more apoAI molecules. Because Lecithinxholesterol acyltransferase (LCAT) can quickly convert discoidal HDL into spherical HDL, the concentration of pre-P HDL particle is considerably low. Spherical HDL 26 accounts for most circulating HDL in normal plasma, HDL2 and HDL3 are two major spherical HDL particles (Table 1-3), of which the hydrophobic core is composed of cholesteryl ester and a small portion of triglycerides, the periphery is surrounded by a monolayer of phospholipids, unesterified cholesterol, and apolipoproteins. 1.3.3.2 HDL Maturation and Related Enzymes LCAT plays an important role in the maturation of nascent HDL to mature HDL. Unesterified cholesterol is docked on the surface of discoidal pre-P HDL, where LCAT catalyzes the transfer of a fatty acid from phosphatidylcholine to cholesterol. Upon esterification, cholesterol will be translocated to the interior of HDL due to its hydrophobic character. In LCAT deficient states, this process for HDL maturation is blocked, apoAI and All containing-HDL are rapidly catabolized, thus, a marked reduction of HDL in blood is observed. ' Table 1-3. HDL category Category Shape Gel electrophoresis Density ApoAI molecules Lipid-free apoAI Pre-P migration >1.159 Single Pre-p HDL Discoid Pre-P to pre-alpha migration 1.159 2 or 3 HDL 3 Spherical Alpha migration 1.125<d<1.21 g/ml >=3 HDL 2 Spherical Alpha migration 1.063<d<1.125 g/ml >=3 With cholesterol esterification and further uptake of phospholipids, discoidal pre-P HDL becomes spherical HDL3. Lipid redistribution among lipoproteins occurs due to the action of cholesteryl ester transport protein (CETP) and phospholipid transport protein (PLTP). CETP is mainly synthesized by liver and adipose tissues, and circulates in blood in an associated form with lipoproteins. Due to the relative abundance of cholesteryl ester (CE) in immature HDL, cholesteryl ester flows towards apoB-containing lipoproteins such as VLDL, LDL, and IDL, as well as chylomicrons under the aid of CETP. In exchange, triglycerides are concurrently transported to HDL particle. It's not clear whether or not CETP-processed HDL is more efficient in functionality, however, CETP stimulates apoAI turnover and reduces HDL levels. In addition, CETP increases LDL-cholesterol implying a proatherogenic potential. The importance 27 of CETP in HDL maturation is well demonstrated in a CETP-deficient Japanese cohort, whose HDL level is strikingly increased.233 Conversely, transgenic expression of CETP in mice decreased HDL levels to a large degree.234 Furthermore, CETP deficiency has been reported to 235 accelerate the clearance of LDL. Conversely, PLTP transfers phospholipids from apoB-containing lipoproteins to HDL. PLTP is positively related to HDL level. The disruption of PLTP in mice results in reduced levels of 23f> 237 HDL and apoAI. By contrast, overexpression of PLTP increases pre-(3 HDL and apoAI. The remodeling of HDL with phospholipid integration by PLTP promotes HDL-and-cell 238 interaction so as to improve its ability to further remove cholesterol. With the incorporation of phospholipids, triglycerides and removal of CE, H D L 3 becomes the large and more buoyant H D L 2 through particle fusion, redundant apoAI is released during this process. 1.3.3.3 HDL Clearance HDL is mainly catabolized in liver, kidney and steroidogenic tissues, where HDL can be either removed of cholesteryl ester (termed selective cholesterol uptake) or endocytosed as a whole (termed holoparticle uptake). SR-BI, a member of the superfamily of scavenger receptors, has high affinity for HDL. This receptor is rich in liver and other steroidogenic tissues (ovary, adrenal glands), and mediates selective cholesterol uptake from HDL. In mouse model, overexpression of SR-BI accelerates HDL and apoAI clearance.239'240 Holoparticle clearance of HDL mainly occurs in liver and kidney and lysosomal enzymes are involved in that process. In kidney, the filtered HDL or apoAI are internalized into renal tubular epithelia via the cubilin/megalin system.241'242 1.3.4 Pleiotropic Role of HDL HDL carries not only apolipoproteins but also many enzymes and other bioactive substances including serum amyloid A (SAA), ceruloplasmin, transferrin, LCAT, paraoxonase 1 (PON1), platelet activating factor acetylhydrolase (PAF-AH/LP-PLA2). These components may give biological functions to HDL distinct from lipid metabolism. 28 1.3.4.1 Anti-atherogenic Property A high level of HDL is associated with low risk of atherosclerosis. The overexpression of apoAI in mice has significantly reduced the extent of atherosclerosis.243 ApoAI deficiency increases atherosclerosis in both animal models and human.244 2 4 6 As far as antiatherogenic properties of HDL are concerned, the reverse cholesterol transport of cholesterol from peripheral tissues to liver has received the most attention.247 In this pathway, HDL acts as the recipient of cholesterol in peripheral tissue, transports the cholesterol directly or through LDL indirectly to the liver for recycling or excretion to bile. HDL-associated SAA can stimulate ABCA1-dependent cholesterol efflux in fibroblasts, as well as, promoting SR-BI-dependent cholesterol efflux towards HDL. 2 4 8 1.3.4.2 Anti-oxidative Property There is substantial evidence to support that HDL has antioxidative properties. For example, apoAI can neutralize the peroxidation of LDL lipids.249 One of HDL components, PON 1, can also protect lipids and tissues from oxidation injury by hydrolyzing lipid peroxides, hydrogen 250 251 peroxides and hydroperoxides. ' Furthermore, PAF-AH can remove oxidized lipids and prevent the accumulation of oxLDL. LCAT level is positively related to PAF-AH and PON-1 activities. The gene transfer of LCAT significantly decreases atherosclerosis by elevating the HDL-associated antioxidant enzyme PON1. 2 5 3 ' 2 5 4 HDL also carries two additional antioxidants ceruloplasmin (copper-binding protein) and transferrin (iron-binding protein), which chelate plasma copper and iron respectively, and may attenuate the oxidative modification of lipids and other molecules. 1.3.4.3 Anti-inflammatory Property Atherogenesis is considered to be an inflammatory process, therefore, many inflammatory markers and cytokines have been implicated in this process. CRP, an emerging cardiovascular risk factor, has been found to be negatively associated with HDL levels. In addition, HDL inhibits the expression of adhesion molecules, including VCAM-1, ICAM-1, and E-selectin through NOS upregulation.256"258 Serum HDL level also influences IL-6 release, high HDL was associated with low IL-6 in patients undergoing surgical operations.259 The inverse correlation between TNF-a with HDL was also reported.260'261 29 1.3.4.4 Anti-thrombotic Property HDL has been attributed with anti-thrombotic properties. Patients with low HDL levels have a higher risk for venous thrombosis.262 Mechanistically, PAF can be degraded by HDL-associated enzyme PAF-AH, thus, platelet activation and subsequent thrombosis is confined.263'264 In addition, the synthesis of PAF by endothelial cells is also inhibited by HDL. 2 6 5 HDL is also a selective inhibitor of platelet 12-lipoxygenase, so the generation of 12-hydroxy-5,8,10,14-eicosatetraenoic acid (12-HETE) is suppressed.266 Furthermore, HDL is able to upregulate NOS to inhibit platelet aggregation.258'267 HDL can also modulate platelet function through regulating platelet membrane cholesterol content. The concentration of HDL particles is negatively correlated with platelet membrane cholesterol. The depletion of cholesterol reduces membrane rigidity and inhibits platelet aggregation.268 Moreover, the association of Gplb and FcyRII, which are critical for platelet activation and aggregation, is decreased upon incubation of platelets with H D L 3 . 2 6 9 30 1.4 Reverse Cholesterol Transport Cholesterol plays a critical role in membrane biogenesis, hormone synthesis, lipoprotein assembly, and cell growth. The functional integrity of mammalian cells requires the homeostasis of cellular cholesterol. Excess cholesterol is compartmentalized in the cell for either estification and storage or export to maintain the desired intracellular cholesterol level. The cholesterol on cell membranes can be picked up by cholesterol carriers such as apolipoproteins and lipoproteins; this process is termed cholesterol efflux. These cholesterol acceptors deliver the cholesterol to the liver for excretion with bile. 1.4.1 Source, Storage, and Transport of Intracellular Cholesterol Intracellular cholesterol can be derived from either de novo synthesis or uptake of exogenous cholesterol (Figure 1-6). Cholesterol is synthesize in the smooth endoplasmic reticulum. P-hydroxy-P-methylglutaryl-CoA (HMG-coA) reductase is the rate-limiting enzyme for de novo cholesterol synthesis, statins can competitively inhibit HMG-CoA reductase, and are extensively used to treat patients with hypercholesteremia.270 After synthesis, cholesterol is channeled to Golgi apparatus and packaged into lipid vesicles; the latter are then sorted to different organelles or compartments. Receptor-mediated lipoprotein internalization is another source of intracellular cholesterol. Internalized LDL will be hydrolyzed in lysosomes, released cholesterol is esterified and then stored in lipid droplets or utilized for membrane or hormone production. Intracellular cholesterol can also be obtained from HDL particles, and residual HDL particles are released back to extracellular compartments. Intracellular cholesterol is stored in an esterified form because free cholesterol is toxic to cells. To prevent the toxic effect, free cholesterol is converted into esterified cholesterol by the enzyme acyl coenzyme A cholesterol acyl transferase (ACAT). There are two isoforms of ACAT, ACAT1 and ACAT2. ACAT1 is present within endoplasmic reticulum of many cells, including macrophages, Kupffer cells in the liver, neurons, and steroidogenic cells in the adrenal. ACAT2 is present exclusively in hepatocytes and intestinal cells.271 The expression of ACAT1 in macrophages significantly increases cholesterol storage and transforms macrophages into lipid-laden foam cells.272 Conversely, the inhibition of ACAT by specific inhibitors mobilizes cholesterol from lipid droplet, decreases cholesterol accumulation in macrophages and prevents 31 TTX 7 7 ^ the progression of atherosclerotic lesions. ~ A different enzyme, cholesteryl ester hydrolase (CEH), acts in the opposite direction by liberating free cholesterol from CE. The overexpression 276 277 of CEH results in enhanced free cholesterol efflux from human THP1 -macrophages. ' Hormone sensitive lipase (HSL), has a similar function as CEH, and can also hydrolyze 778 cholesteryl ester into free cholesterol. 279 The cholesterol transport among cellular organelles is fulfilled by vesicular transport. These vesicles can bud from lysosomes, Golgi apparatus, and lipid droplets. The proteins intercalated in vesicular membrane direct cholesterol trafficking. Caveolins, which are mainly found in cholesterol rich domains on cell membrane, are also present in the plasma membrane of lipid vesicles. Caveolin can integrate heat-shock protein 56, cyclophilin 40, cyclophilin A, and cholesterol into a heat-shock protein-immunophilin chaperone complex. This compound transports cholesterol to cell membrane and the deficiency of caveolin causes the incapability of 7RO transporting newly synthesized cholesterol. Niemann-Pick type C protein (NPC) is also found 281 in vesicle membrane. In Niemann-Pick disease where NPC is mutated and non-functional, the transport of cholesterol from late endosomes to various destinations, including plasma * 282 283 membrane, is defective. ' Other lipid transfer proteins such as sterol carrier protein 2 are also closely related to intracellular cholesterol transport.284 1.4.2 Cholesterol-rich Domains in Cellular Membranes In order to release excess cholesterol from intracellular compartments, cholesterol must be first distributed on the membrane. The cell membrane is characteristic of uneven distribution of phospholipids in adaptation to cell functions, exofacial/exoleaflet membrane is predominant in phosphatidylcholine and sphingomyelin, whereas endofacial aspect is rich in phosphatidylefhanolamine, phosphatidylserine, and phosphatidylinositol. 1.4.2.1 Cholesterol-rich Rafts Cholesterol and sphingomyelin aggregation in the plane of the membrane is termed a cholesterol raft. Cholesterol-rich rafts are resistant to the non-ionic detergent (Triton X-100) action as a result of the tight packing of lipids and strong van der Waals forces. Rafts are also branded detergent resistant membranes (DRM) or detergent-insoluble glycolipid-enriched complexes 32 Figure 1-6. The source, storage, trafficking of intracellular cholesterol. Intracellular cholesterol can be either de novo synthesized or acquired via receptor-mediated lipoprotein internalization. Cholesterol can be de novo synthesized in smooth endoplasmic reticulum, then esterified by ACAT in Golgi apparatus and transported to lipid vesicles. Internalized lipoproteins are degraded in lysosomes and their cholesterol can be either stored in lipid droplets in an esterified form or channeled to membrane. Cholesteryl ester (CE) in lipid vesicles can be transformed under the action of cholesteryl ester hydrolase (CEH) and hormone sensitive lipase (HSL) into free cholesterol, the latter is then delivered to membrane for release. Caveolin and Niemann-pick type C protein (NPC) participate in cholesterol trafficking in cells. (DIGs). Besides sphingomyelin, phosphatidylinositol 4,5-bisphosphate is also enriched in 285 • DPvMs. Lipid rafts are also associated with specific proteins such as glycosylphosphatidylinositol (GPI)-anchored and acylated proteins which are typically situated on the outer leaflet and inner leaflet, respectively. These proteins may also participate in the regulation of cholesterol efflux. 1.4.2.2 Caveolae Caveoli are special rafts on the cellular membrane, which invaginate inward to form 50-70nm plasma membrane pits. This membrane invagination is coated with caveolin, a 22-kDa protein, instead of clathrin. Caveolin is palmitoylated at multiple sites." Caveoli are active cell 988 organelles, involved in material potocytosis and transcytosis. Recent findings demonstrate that caveolin is also associated with a variety of downstream signaling molecules, including Src-33 family tyrosine kinases, p42/44 MAPK, and endothelial nitric oxide synthase (eNOS), suggesting its important role in signal transduction.289 Equally important, caveolin can bind one mole of cholesterol per mole of protein,286 the expression of caveolin 1 in a caveolae-null cell causes the enrichment of FC in caveolae region,290 this implicates caveolae in the regulation of cholesterol trafficking and efflux. 1.4.2.3 Two Distinct Kinetic Pools of Membrane Cholesterol Membrane cholesterol can be divided into two pools: a fast pool and a slow pool. The cholesterol in the fast pool is always orientated on the external leaflet of membrane. However, the slow pool of cholesterol could be the cholesterol associated with rafts/caveolae or the cholesterol which is located the inner leaflet of membrane. With the progressive removal of the fast pool of cholesterol, the slow-pool cholesterol will move into the fast pool. Sphingomyelin and phosphatidylcholine are major phospholipids for the maintenance of two distinct kinetic pools of cholesterol. The treatment of membrane with sphingomyelinase or phospholipase C dramatically increases cholesterol efflux from the fast pool. This increase is not mediated by the lipid reorganization and randomization after the hydrolysis of phospholipids, but rather a shift of 292 cholesterol from the slow pool to the fast pool. 1.4.3 Cholesterol Efflux The process of cholesterol liberation from membrane into medium is called cholesterol efflux. Several mechanisms have been described, including free diffusion, receptor-facilitated efflux, and ABC transporter-mediated efflux (Figure 1-7). 1.4.3.1 Free Diffusion Passive aqueous free diffusion is driven by the concentration gradient from high to low concentration. The cholesterol which spontaneously desorbs from cell membranes into the aqueous environment is incorporated into lipoproteins such as HDL as well as apolipoproteins. It has been reported that a considerable proportion of total cholesterol efflux to human serum is mediated by free diffusion. One experiment has shown that ~70~90% of cholesterol efflux is not mediated by either SR-BI or ABC transporter pathways.293 Moreover, plasma proteins other than apoAI and HDL like cyclodextrins and albumins can also serve as cholesterol acceptors to induce cholesterol efflux by free diffusion.294'295 34 Figure 1-7. Reverse cholesterol transport. Apolipoprotein AI can be synthesized by liver or regenerated during the metabolism of chylomicron and HDL. Lipid-free apoAI and nascent HDLs (pre- P HDL and HDL3) are preferred acceptors for cholesterol released from peripheral tissues via free diffusion, SR-BI, and ABC transporter pathways. LCAT converts pre- 3 HDL into H D L 3 by esterifying cholesterol. Nascent HDL3 exchanges cholesteryl ester for phospholipids from chylomicron and LDL under the aid of CETP and PLTP. The cholesterol in mature H D L 2 is removed by liver and eventually secreted into bile via ABCB and ABCG transporters. The LDL cholesterol obtained from HDL in exchange with phospholipids can also be removed and excreted by liver. The rate of aqueous free diffusion is highly dependent on the structure of acceptor particles as well as the lipid composition of the membrane. Large HDL particles are less efficient as cholesterol acceptors.296 Phosphatidylcholine and its metabolite lysophosphatidylcholine have been reported to influence cholesterol efflux since 16% of the cholesterol molecules are directly hydrogen bonded to oxygen atoms in phosphatidycholine. Lysophosphatidylcholine increases 298 299 the non-apoAI-mediated cholesterol efflux in mouse macrophage foam cells. ' HDL-associated enzyme PON1 was found to increase cholesterol efflux, which may be ascribed to the 35 increased production of lysophosphatidylcholine.299. As mentioned before, cholesterol is clustered in sphingomyelin domains, thus, the degradation of sphingomyelin can cause cholesterol perturbation and subsequently influence cholesterol efflux. It is reported that the sphingomyelin metabolite ceramide is able to promote the cholesterol outflow in the fetal rat astrocytes and meningeal fibroblasts.300 Phosphatidylethanolamine and phosphatidylserine inhibits the formation of hydrogen bonds between cholesterol and sphingomyelin, thereby increasing the desorption of cholesterol.301 1.4.3.2 SR-BI-Mediated Cholesterol Efflux The receptor facilitated cholesterol efflux is primarily mediated by SR-BI. In Chinese hamster ovary cells (CHO), overexpression of SR-BI by stable transfection resulted in a 3 - 4 fold increase of cholesterol efflux to HDL. 3 0 2 More convincingly, when SR-BI was blocked by specific antibody, or SR-BI was mutated to lose its ability of HDL binding, the cholesterol efflux to HDL was markedly impaired.303'304 SR-BI is also able to bind LDL by the interaction with apoE and apo B, so that SR-BI could efflux cholesterol to lipidate LDL. For example, SR-BI overexpression increased LDL cholesterol level in rabbits.305'306 The extracellular domain of SR-BI is crucial for bidirectional flux of cholesterol. The SR-BI mediated cholesterol efflux is a function of PC content of the acceptor, larger reconstituted HDL bounds to SR-BI much better than small HDL particle, and promotes more cholesterol efflux than smaller particle:308 Enrichment of HDL with phospholipids appreciably promotes cholesterol efflux, and depletion by incubating HDL with phospholipase A 2 otherwise decreases SR-BI mediated efflux.309"311 Moreover, the HDL particle modified by endothelial lipase loses its phospholipid contents as 312 well as the capability to induce cholesterol efflux. The SR-BI mediated cholesterol transport is concentration-driven and bidirectional. The net movement of cholesterol via SR-BI depends on the direction of cholesterol gradient.313 One experiment, which was done in SR-BI-expressing cells loaded with different cellular cholesterol mass, clearly addressed the influence of cholesterol content on the cholesterol transport direction. When cells were cholesterol-depleted, SR-BI promotes net cholesterol influx from H D L 3 ; On the other hand, incubation of cholesterol-rich SR-BI-expressing cells with H D L 3 resulted in net efflux of cell cholesterol.313 Nevertheless, the direction of cholesteryl ester transport by SR-BI is unidirectional. In adrenocortical cells where cholesterol is required for 36 steroid synthesis, SR-BI delivers cholesteryl ester into the steroidogenic pathway. SR-BI also helps the clearance of cholesteryl ester from blood by the liver.3 1 5'3 1 6 The mechanism by which SR-BI facilitates cholesterol efflux still remains to be elucidated. It has been proposed that SR-BI promotes cholesterol efflux by enhancing free diffusion. In addition, SR-BI may change the distribution of cholesterol on membrane. It has been shown that SR-BI expression shifts FC from the slow pool into the fast pool, and the latter is more 317 accessible for cholesterol efflux. Interestingly, SR-BI is co-localized with caveolin in cholesterol-rich caveolae domains of membrane, and SR-BI is also shown to be able to stabilize caveolin, suggesting caveolin may play some role in SR-BI mediated cholesterol efflux.318'319 Caveolin assumes a critical role in 320 cholesterol trafficking from intracellular compartments to cell membrane. Caveolin transfection in hepatic cells led to a 40% increase in the amount of plasma membrane cholesterol in cholesterol-rich domains (caveolae and/or rafts) and a 67% increase in the rate of cholesterol trafficking from intracellular compartments to these domains.290 In NIH/3T3 cells, 321 expression of caveolin effluxed cholesterol more rapidly to HDL. In contrast, caveolin blockage by antisense DNA reduced cholesterol incorporation into HDL. 3 2 2 In view of their colocalization, this evidence implies that caveolin may play a role in SR-BI mediated cholesterol efflux. 1.4.3.3 ABC-Mediated Cholesterol Efflux The members of ATP-binding cassette (ABC) transporter family share a similar structure and nucleotide-binding domain, which enables them to bind and hydrolyze adenosine triphosphate (ATP) and use this energy to pump compounds across the membrane or to flip molecules from the inner to outer leaflet of the membrane.323 ABC transporter family can be divided into at least 8 subfamilies from A to H. ABCA and ABCC subfamilies are full transporters composed of two subunits. ABCD, ABCG, and ABCH subfamilies are half transporters consisting of one subunit. ABCB subfamily exists as either half or full transporter. In exception, ABCE and ABCF subfamilies have no transmembrane domains, no transport function has been described for those 2 subfamilies.323 Each subfamily can also be subdivided into several classes, each class is different in functions. ABC transporter family participates in various biological functions, one 37 well-known function is its anti-tumor drug transportation, which results in the drug resistance of tumors, therefore, some ABC genes are coined with the synonym - multiple drug resistance (MDR) genes. Furthermore, research advances prove that some ABC family members, for example, A, B, and G subfamilies, are involved in cholesterol transport. 1.4.3.3.1 ABCA1 The role of ABCA1 in cholesterol efflux was first observed in Tangier disease and familial HDL deficiency (FHD). These mutations cause the inability of cholesterol efflux and subsequent impaired apoAI lipidation, leading to a consequent low or undetectable HDL levels in plasma.324"326 Moreover, fibroblasts isolated from Tangier disease and FHD are defective to 'I'jf. I ' l l induce cholesterol efflux and generation of nascent HDL particles; ' upregulation of ABCA1 by cAMP promotes heterogeneous HDL particle formation in J774 macrophages.328 These results indicate that ABCA1 is the key gatekeeper protein for cholesterol efflux. ABCA1 seems to interact with apoAI specifically, because ABCA1 expression markedly increased cellular cholesterol efflux to apoAI but has only minor effects on lipid efflux to HDL, 329 furthermore, the direct evidence of apoAI binding to ABCA1 has been demonstrated. Lipid-rich apoAI or nascent HDL particles have a much lower affinity for ABCA1 in comparison with apoAI.327 Multiple amphipathic helices in the C-terminal domain of apoAI are responsible for the interaction between ABCA1 and apoAI.330 3 3 2 Within those helices, several tyrosine residues have been identified to be critical for apoAI-ABCAl binding since the peroxidation (nitration and chlorination) of tyrosine residues in apoAI by myeloperoxidase markedly impaired apoAI and ABCA1 interaction and subsequent cholesterol transport.333'334 A C-terminal VFVNFA motif of ABCA1 is responsible for its interaction with apoAI.335 Recently, it has been postulated that ABCA1-induced efflux is not restricted to apoAI, other apolipoproteins like apo All, apo AIV, apoCI, apoCII, apoCIII, apoE can also be the acceptors for cholesterol via ABCA1 pathway.331'336 Upon apoAI docking, ABCA1 transports lipid moieties onto apoAI via its lipid translocase driven by ATP consumption. Two hypotheses, one-step and two-step mechanism, have been proposed to explain the mechanism. According to the one-step pathway, after the interaction between apoAI and ABCA1, ABCA1 directly translocates phospholipids and unesterified 38 cholesterol from cell membrane to apoAI. By contrast, the two-step hypothesis suggests that ABCA1 exports phospholipids to apoAI first to convert apoAI particle into pre-P-migrating, discoidal HDL, then this pre-P HDL sequentially accepts free cholesterol by free diffusion.338"340 The two-step hypothesis is supported by several experiments. First, the phospholipid content in HDL particles is disproportionately lower than that of cholesterol in cells with an ABCA1 mutation.341 Secondly, apoAI conditioned in the medium with SMC induced higher rates of cholesterol efflux than non-primed apoAI.3 3 9 It is also worth mentioning that ABCAl-apoAI mediated cholesterol efflux pathway does not involve sphingomyelin-rich raft domains in membrane as the raft domain depletion do not disrupt apoAI mediated cholesterol transport.342 Several other A B C A members are also implicated in cholesterol efflux. ABCA7 contributes to nascent HDL formation by efflux lipids.343 However, ABCA7 differs from ABCA1 in terms of lipid efflux and HDL remodeling. HDL remodeling by ABCA7 mainly produces small HDL particles other than large HDL particle by ABCA1 pathway.344 Recently, ABCA7 was shown to transport only phospholipids and not cholesterol to apoAI. 3 4 5' 3 4 6 ABCA2, which is predominantly expressed in brain and neural tissues, shares high homology with ABCA1 and ABCA7, its expression in macrophages is induced during cholesterol loading, indicating that ABCA2 is a cholesterol-responsive gene.3 4 7'3 4 8 ABCA2-overexpressing reduce cholesterol esterification in CHO cells.349 Lack of ABCA3 causes defective secretion of phospholipids (primary coomponent of surfactants) by type II alveolar epithelia, and is causatively related to fetal respiratory distress syndrome.350 This gene could also be involved in cholesterol transport, although more work has to be done to address this question.351 1.4.3.3.2 ABCB The knowledge of ABCB subfamily in cholesterol transport is largely drawn from the mechanistic exploration of bile secretion, their effects in other organs or tissues whereas remain uncovered (the ABCB role in bile secretion is described in "reverse cholesterol transport"). 1.4.3.3.3 ABCG This A B C transporter subfamily is composed of at least 5 members, G l , G2, G4, G5, and G8. Except for G2, all members engage in the regulation of cholesterol transport.352 In 2000, 39 Klucken et. al reported that the ATP-binding cassette (ABC) transporter ABCG1 was expressed in monocyte-derived macrophages, and inhibition of ABCG1 by antisense DNA caused decreased HDL3-mediated cholesterol influx.353 In some tissues, the role of ABCG1 in cholesterol transport outweighs that of ABCA1, for example, it is ABCG1 but not ABCA1 responsible for lipid outflow in cerebellar astroglia.354 ABCG4 was also found to mediate the efflux of cellular cholesterol to H D L . 3 5 5 ABCG5 and ABCG8 are predominantly expressed in enterocytes and hepatocytes, and their localization on apical/luminal aspect of the membrane suggests a role in lipid absorption and bile secretion.356 The main acceptors for cholesterol from ABCG1 and ABCG4 are lipidated apoAI and HDL. In transfected 293 cells, ABCG1 and ABCG4 stimulate cholesterol efflux to both H D L 3 and H D L 2 subclasses but not to lipid-poor apoAI.3 5 5 The capacity of acceptors to induce ABCG1-mediated efflux is strongly correlated with their total phospholipid content, suggesting that acceptor phospholipids drive ABCG1-mediated efflux. Moreover, ABCA1 may synergize with ABCG1-mediated cholesterol export through lapidating lipid-free apoAI into pre-P-HDL.357 1.4.3.4 Apo E induced Cholesterol Efflux. ApoE-mediated but ABCA1-independent cholesterol efflux was demonstrated in several lines of experiments. First, adenoviral-mediated expression of apoE in dermal fibroblasts isolated from ABCA1(-/-) mice significantly increased both sterol and phospholipid efflux. Second, expression of human apoE in a macrophage cell line increased sterol efflux, and this increment in efflux was not reduced after ABCA1 suppression. Third, reduction of apoE expression using an apoE small interfering RNA (siRNA) significantly reduced sterol efflux from ABCA1(-/-) mouse peritoneal macrophages. " However, the recycling of apoE back into cells can be potentiated by ABCA1 expression and apoAI. This repeated cycle of secretion and recycling may maximize cholesterol outflow from cells, impaired recycling of apoE can lead to intracellular cholesterol accumulation.361 1.4.4 Reverse Cholesterol Transport in Blood The transportation of cholesterol from peripheral tissue to liver, followed by bile secretion, is defined as reverse cholesterol transport (Figure 1-7). This function is assumed largely by HDL, and to a lesser extent by L D L . 2 4 7 40 1.4.4.1 Cholesterol Transport by HDL in Blood The capability of HDL as cholesterol carrier can be regulated at the cholesterol efflux level as well as HDL maturation level. The regulation of SR-BI and ABC transporter mediated cholesterol efflux is discussed above; herein, the emphasis is placed on HDL maturation and remodeling. HDL maturation and remodeling involves cholesterol esterification and lipid exchange. The cholesterol which is effluxed from cells is unesterified, and associated on the surface of nascent/pre-P HDL. In order to maintain the concentration gradient between HDL surface and cell membrane to drive more cholesterol efflux, unesterified cholesterol on HDL surface must be removed. L C A T serves this purpose by esterifying free cholesterol into cholesteryl ester which moves into the core of HDL. The overexpression of LCAT considerably enhances cholesterol efflux and subsequent HDL cholesterol transport rate.302' 3 6 2 The accumulation of cholesteryl ester in the HDL core will limit HDL ability to receive more cholesterol, so the cholesteryl ester will be removed by CETP. Although CETP tends to decrease overall HDL-cholesterolholesterol level, CETP-modified HDL particles are more efficient to induce cholesterol efflux.363 However, recent research regards CETP as proatherogenic factor, as HDL secondary to CETP-deficiency has enhanced ability to promote cholesterol efflux from macrophages, and CETP overexpression aggravates atherosclerosis in APOE*3-Leiden mice.3 6 4 HDL is also remodeled by PLTP, the latter has been proven to increase HDL-mediated cholesterol transport.238'365 PLTP is also found to promote HDL remodeling and pre-P HDL regeneration, and stabilize A B C A 1 . 3 6 6 ' 3 6 7 Reverse cholesterol efflux ends with the uptake and secretion by liver. The HDL receptor SR-BI in liver accounts for selective cholesterol uptake. With the removal of cholesterol, residual HDL particles will return into circulation. ' ' Overexpression of SR-BI in liver promotes the cholesterol clearance and accelerates macrophage reverse cholesterol transport despite the decreased level of HDL in circulation.180'239 Thus, it is clear that SR-BI in liver is critically important to HDL metabolism and reverse cholesterol efflux. 41 1.4.4.2 Cholesterol Transport by LDL in Blood A certain portion of HDL cholesterol can be transferred to LDL in exchange for triglycerides by CETP. In a human study, HDL labeled with cholesteryl ester tracer was injected into circulation, a considerable portion of labeled cholesteryl ester was transferred to LDL, and eventually appeared in bile. 3 6 9 The liver is rich in LDL receptors, so cholesteryl ester transferring from HDL to LDL is regarded as another pathway for reverse cholesterol transport. 1.4.5 Biliary Secretion of Cholesterol The cholesterol taken up by liver will be ultimately secreted into bile in forms of bile salts and free cholesterol. ABCB and ABCG subfamilies are two important players for bile secretion. Mutation of either ABCB4 (MDR-3) or ABCB 11 (bile salt export pump) gives rise to progressive familial intrahepatic cholestasis,370'371 which is characterized by defective secretion of both phosphatidylcholine and associated cholesterol.372'373 Interestingly, overexpression of ABCB 11 in mice increased cholesterol secretion in biliary tree and consequent increase in the rate of cholesterol gall stone formation.374 ABCG5 and ABCG8 also participate in the regulation of sterol secretion. The mutation of ABCG5 and ABCG8 causes sitosterolemia which features increased level of blood cholesterol and impaired cholesterol secretion by liver. 3 7 5' 3 7 6 Because A B C G subfamily members are half transporters, they usually dimerize to become homodimer or heterodimer in order to function as a transporter.377'378 42 1.5 Lipase Gene Family Lipids such as triglycerides and phospholipids play a central role in a variety of physiological functions, including energy supply and storage, maintenance of cell membrane integrity, hormone production, and vitamin supply. From lipid absorption in intestine to lipid metabolism in tissues, various enzymes are involved, of which several are grouped into a lipase gene family due to the similarity in both protein and gene structures. This gene family is composed of at least 7 members. Among them, pancreatic lipase (PL), lipoprotein lipase (LPL), endothelial lipase (EL), and hepatic lipase (HL) are critical enzymes in human lipid metabolism. Sequence analysis has revealed remarkable homology among these lipases. The amino acid sequence of porcine pancreatic lipase was first determined in 1981 and so became the prototype of this lipase gene family.379 Tryptic digestion revealed that the peptic segments of bovine LPL 380 share a close homology with porcine pancreatic lipase in most instances, indicating that LPL belongs to the same family as pancreatic lipase. When human lipoprotein lipase cDNA and protein were compared to those of rat and porcine pancreatic lipases, extensive homologies among the enzymes were revealed as well. As expected, LPL from different species also share a high homology, there is 94% homology in amino acids between mouse and human LPL, and 92% between human and bovine LPL. 3 8 1 Human hepatic lipase, which is 85% identical to the protein sequence of pig pancreatic lipase and 70% identical to dog pancreatic lipase, has a same exon-intron arrangement as LPL. 3 8 2 3 8 4 Recently, EL was cloned from endothelial cells in 1999, sequence analysis revealed a 45% homology with LPL, 40% with HL, and 27% with pancreatic Although these lipases are thought to be derived from the same ancestral gene, they may have diverged into different evolutionary pathways to suit different environments. In the intestine, pancreatic lipase assumes a primary role in lipid digestion for the subsequent absorption of fatty acids by enterocytes. Pancreatic lipase is a strict triglyceride-hydrolyzing enzyme, secreted by the pancreas to digest triglycerides into 2 free fatty acids and 1 molecule of monoacylglycerol; the hydrolytic products are then absorbed by intestine. There are two other lipases produced by pancreatic cells called pancreatic lipase related protein (PLRP) 1 and 2. These two lipases also belong to the same lipase gene family. Among them, PLRP-2 is well known to be able to digest 43 intestinal lipids, with a substrate preference for phospholipids/8' PLRP-1, which was once 388 389 thought to be "inactive", may play a certain role in lipid digestion as well. ' Lipoproteins are lipid carriers in the circulation, delivering lipids throughout human body. As far as lipid utilization is concerned, three major enzymes including hepatic lipase, LPL, and EL are implicated. LPL, which is extensively expressed in muscles and adipose tissues, liberates free fatty acid from triglycerides for energy consumption in muscles and energy storage in adipose tissues. Hepatic lipase, mainly expressed in the liver, can hydrolyze both triglycerides and phospholipids, and plays a role in the selective uptake of HDL cholesterol. The expression of hepatic lipase is also found in steroidogenic tissues such as adrenal gland, ovary, and testes. With the aid of hepatic lipase, these tissues can utilize cholesterol for steroid hormone synthesis. EL preferentially hydrolyzes phospholipids, and is regarded as a modulator of HDL concentration. Besides their catalytic activities, these three lipases also bear heparin binding function through which lipases can provide substrates to proteoglycan-bearing tissues for metabolism; this is termed a "bridging" function. 1.5.1 LPL 1.5.1.1 Gene Structure Human genomic clones that span the entire LPL gene have been isolated and used to determine LPL structure. The LPL gene is mapped in human chromosome 8p22, approximately 30 kilobase (kb) pairs in length, containing 10 exons and 9 introns. Exons 1-9 have an average size of 105-243 base pairs whereas exon 10 is 1948 basepairs in length, which encodes the entire 3' noncoding sequence. Exon 1 codes for the signal peptide as well as the first two amino acid residues in mature LPL, exons 2 to 4 contain the protein domains responsible for lipoprotein binding, and exons 6 to 9 code for carboxyl terminal (C-terminal) sequence that is relatively rich in basic amino acids and therefore likely involved in anchoring of the enzyme to the acidic domain of heparan sulfates. The eighth exon codes for a domain containing another N-linked glycosylation site. The LPL gene appears to be regulated in a tissue-specific manner. Several motifs in the LPL gene may be responsible for the tissue-specific expression of LPL. First, there are four transcription initiation sites at the 5' terminal end. In addition, two potential enhancer sequences in the 5' upstream region are also observed, one is the response element to intracellular Ca mobilization, and another one is related to the expression in adipocytes. ' ' 44 3 9 1 There is 70% homology in cDNA among different species-derived LPLs, and more than 90% homology in protein structure is predicted. 1.5.1.2 Structure-Function Relationships 1.5.1.2.1 Protein Translation and Glycosylation LPL mRNA is translated into a 475 amino acid protein precursor, which is then translocated into endoplasmic reticulum, where the signal peptide of 27 amino acids is cleaved.393 Meanwhile, the LPL undergoes N-linked glycosylation in rough endoplasmic reticulum. The oligosaccharide chain accounts for approximate 10% molecular weight of mature LPL. Ong et al. examined the effects of glycosylation on rat LPL activity and maturation.394 They found that the non-glycosylated rat LPL was 49 kiloDaltons (kD) in molecular weight rather than 55 kD of the fully glycosylated structure. Furthermore, non-glycosylated LPL is unable to be secreted and dimerized in cells. When glycosylation was blocked by either tunicamycin or glucose deprivation, secreted rat LPL activity was reduced by 90%.394 There are two N-glycosylated sites on the LPL protein. Using site-specific mutagenesis, asparagines at positions 43 and 359 of human LPL were mutated, causing the elimination of N-linked glycosylation and consequent intracellular accumulation of inactive protein and marked decrease in secreted LPL activity.395' 3 9 6 Normal glycosylation is also required for LPL homodimerization and heparin binding as the abolishment of N-linked glycosylation dramatically decreased enzyme activity and heparin binding ability.397 Oligosaccharide chain trimming, during which the mannose is removed after glycosylation, is also critical for LPL maturation.398"400 1.5.1.2.2 Homodimer Structure Pancreatic lipase is the first member of this family to be crystallized, then a complete 3-dimentional model of protein structure of human pancreatic lipase was determined.401 In this model, pancreatic lipase contains a large N-terminal domain typical of a/p structure dominated by a central parallel P-sheet, and a C-terminal domain which is formed by two layers of P-sheets. A triad of Serl52-His263-Aspl67 is situated in N-terminal domain and recognized to be the catalytic site. The catalytic site is covered by a surface loop between the disulphide-bridge residues 237 and 261. Binding to substrates appears to result in a conformational change of the surface loop and neighboring structures so that the active site will be accessible to substrates. 45 The C-terminal domain in a p-sandwich organization is responsible for the binding of colipase, which anchors pancreatic lipase to the lipid/water interface.401 Two different crystal structures from pancreatic lipase and pancreatic lipase-procolipase-phospholipid complex were applied by Tilberugh et al. to implement molecular modeling for LPL 4 0 2 Due to the high homology between LPL and PL, most structure motifs are conserved in LPL, for example, the a/p structure is abundant in N-terminal domain. The conservation of the P-sandwich analogue is also noticed in the C-terminal domain. Surface loop and catalytic triad are also highly conserved in LPL. However, LPL differs from pancreatic lipase in several aspects, for example, the active form of LPL is in a homodimer organization, and have the ability to bind heparan sulfates (Figure 1-8). Figure 1-8. Schematic demonstration of the dimeric structure of LPL. The homodimer structure is generated by homology modeling using pancreatic lipase as a template. The cluster of hydrophobic residues Trp390, Trp393, and Trp394 (yellow) at C-terminus (blue) are postulated to be responsible for lipoprotein binding. The catalytic site (Serl32-Aspl56-His241, red) resides in N-terminal domain (brown) and is close to the lipid binding domain in another monomer. The lid structure (green, in an open form) controls the accessibility of active site to substrates. Four clusters (purple) of basic amino acids in both C- and N-terminal domains are proposed to be involved in HSPG binding. (Modifiedfrom Eur J Biochem, 2002:4701) When a head-to-tail association was observed in a crystallographic dimer of the open pancreatic lipase-colipase-phospholipid complex, this dimerization mode is also proposed for LPL through homology modeling (Figure 1-8).402 Since the C-terminus has been implicated in lipoprotein binding and the N-terminus for lipid hydrolysis, this head-to-tail orientation can facilitate the substrate transfer from C-terminus to N-terminus across lipase subunits. The homodimerization 46 of LPL is necessary for lipolytic activity as well as heparin binding. The dissociation of the LPL dimer leads to rapid loss of lipolytic activity.403 Interestingly, the existence of Ca 2 + rapidly converts LPL monomers into competent dimers.404 An LPL dimer has a higher affinity for heparin than LPL monomers and elutes from a heparin-Sepharose column at higher NaCl concentration 4 0 5 1.5.1.2.3 Active Site and Lid Structure Based on the sequence alignment between LPL and pancreatic lipase, the homologous catalytic triad in human LPL corresponds to Serl32-Aspl56-His241.401'406 The proposed active triad was confirmed from patients with LPL deficiency as well as by site-directed mutagenesis. The mutation of Aspl56->Gly was found in patients with familial type I hyperlipoproteinemia and this mutant is devoid of enzyme activity when expressed in COS cells.407'408 Furthermore, there are 8 serines in LPL protein, but only the mutation of serine at position 132 results into a complete loss of enzymatic activity of LPL. 4 0 9 The substitution of His241 by several different residues resulted in the expression of an enzyme lacking both triolein and tributyrin esterase activities.410 The presence of a mutation in the neighborhood of the catalytic triad also influences catalytic activity. For example, a substitution of Pro 157 for Arg was found in a proband of Dutch subject who was deficient in LPL activity 4 1 1 Asn291->Ser substitution in LPL gene was also reported in patients with LPL deficiency and hyperlipidemia412 This well-conserved catalytic triad (Serl32-Aspl56-His241) is situated in a groove in the heart of an LPL dimer, and shielded by a surface loop/lid structure (residues 216-239)402 The surface loop is thought to control LPL activity by conformational changes between closed and open forms which correspond to inactive and active forms of LPL, respectively. Compared to the closed conformation, the open form stretches the surface loop and exposes the catalytic triad-hosting groove, which makes the latter more accessible to substrates. A helix-turn-helix motif with two short amphipathic helices in loop structure is required for substrate binding/ hydrolysis.413 Site-directed mutagenesis which leads to reduced amphipathic property of the loop but does not change the predicted secondary structure of the loop deprives LPL of the ability to hydrolyze emulsified, long chain fatty acid triglycerides. Besides, trioleinase activity is still retained after replacing the loop of LPL with amphipathic loop of hepatic lipase, furthermore, the substitution of the LPL loop by a short four amino acid peptide abolishes the 47 ability of LPL to hydrolyze substrates.413 Meanwhile, the partial deletion or mutation of the middle/apical section of the loop reserves normal lipolytic activity, however, the mutation at the proximal section of the loop leads to LPL deficiency,414 suggesting the proximal and distal parts of the loop are critical for substrate hydrolysis. The lid structure controls not only substrate binding but also substrate specificity. This structure-function relation was elucidated by lid switching between LPL and other members of lipase family. For example, chimeric LPL containing the lid of HL had reduced triolein hydrolyzing activity, but increased phospholipase activity in l,2-di-oleoyl-sn-glycero-3-phosphocholine (DOPC) vesicle, DOPC proteoliposome, and DOPC-mixed liposome assay systems. In contrast, chimeric HL containing the LPL lid was more active in hydrolyzing triolein than DOPC. 4 1 5 Furthermore, the replacement of the LPL lid with the corresponding EL sequence also partially shifted the substrate specificity of LPL from triglycerides to phospholipids, and an EL chimera with an LPL lid shifted substrate specificity from phospholipids to triglycerides.416 ApoCII is the cofactor of LPL, activating LPL substantially after binding to LPL. 4 1 7 A specific region (residues 65-86) of LPL was identified to interact with apoCII, especially the 11 amino acid residues at position 65-68 and 73-79 of the N-terminus domain.418 On the other hand, another essential domain responsible for LPL binding was mapped to the C-terminus of apoCII.419 The residues 63, 66, 69, and 70 of apoCII have been implicated in binding to LPL, but no single amino acid residue seems to be absolutely critical.420 1.5.1.2.4 Lipid Binding Domain The relative hydrophobicity of the C-terminal domain of LPL facilitates the interaction with hydrophobic lipids. Lookene et al. constructed a LPL molecule lacking a C-terminus, this truncated LPL lost its ability to bind chylomicrons or milk fat globules 4 2 1 Antibody specific for the C-terminal segment of LPL was also able to influence trioleinase activity, possibly through interfering with substrate recognition site 4 2 2 This lipid binding site was pinpointed to a tryptophan cluster (Trp390-Trp-393-Trp-394) in the C-terminal domain.421'423 The interaction of LPL with lipoproteins like VLDL and CM is fairly complicated, involving electrostatic and hydrophobic forces. An accepted hypothesis is that LPL interacts with 48 apolipoproteins on the surface of lipoproteins. For example, expression of an N-terminal fragment of apoB significantly increased LPL binding to cell surface, and antibodies against the N-terminal region of apoB blocked LPL interaction with L D L . 4 2 4 " 4 2 6 However, this hypothesis has been challenged by several observations, suggesting LPL binds to phospholipids because the binding of LPL with lipoproteins occurs even in the absence of apoBioo.427 Also, partial delipidation of LDL markedly decreases its binding to LPL, whereas, phosphatidylcholine-containing liposomes efficiently compete with LDL for binding to L P L . 4 2 7 These findings suggest that a lipid-LPL interaction also plays a critical role in lipoprotein-LPL association. 1.5.1.2.5 Heparin Binding Domain The evidence of an ionic binding of LPL to heparin was demonstrated by Olivecrona in 1971 4 2 8 A 220-kD heparan sulfate proteoglycan on endothelial cell surface was identified as a receptor for L P L . 4 2 9 Due to the electrostatic nature and abundance of negative charges in heparin, the key heparin-binding residues were hypothesized to be the aggregates of positively charged residues such as arginine and lysine. Two consensus sequences X-B-B-X-B-X and X-B-B-B-X-X (B is basic amino residue and X represents a neutral residue) have been postulated as candidates for heparin binding. 4 3 0 , 4 3 1 Four clusters of lysine and arginine residues are present at the back of lipoprotein lipase by homology modeling, those alkaline amino acid clusters including Arg 263-Arg279-Lys280-Arg262, Arg294-Lys296-Arg297-Lys300, Lys319-Lys403-Arg405-Lys407-Lys414-Lys415, are dispersed in bothN- and C-terminal domains. 4 0 2' 4 0 5' 4 3 2' 4 3 3 The mutation of alkaline residues in cluster 1 (aa279-282) or 2 (aa292-304) into neutral ones strikingly reduces LPL affinity for heparin. 4 0 5' 4 3 3' 4 3 4 Recent findings also support the role of the C-terminus in heparin binding. The chimeric construct of the N-terminal domain of LPL with the C-terminal domain of HL has a lower affinity for heparin, suggesting the substitution of cluster 4 in the C-terminus leads to the change of affinity for heparin 4 3 5 This finding is also substantiated by an experiment using site-directed mutagenesis, where the mutation of residues Lys 321, Arg 405, Arg 407, Lys 409, and Lys 416 resulted in a decrease in the affinity of LPL for heparin 4 3 6 1.5.1.2.6 Receptor Binding Domain LPL also has been found to be capable of binding to lipoprotein receptors including the LDL receptor, LRP, and Glycoprotein 330 (a member of low density lipoprotein receptor family). 49 Glycoprotein 330 can form a saturable, divalent cation-dependent binding to LPL with high affinity.437 In a competition assay, LPL effectively displaces alpha 2-macroglobulin and 39-kD alpha 2M receptor-associated protein (RAP) from LRP in cultured mutant fibroblasts.423'438 LPL binding to highly purified LRP was also demonstrated in a solid-phase assay, furthermore, polyclonal antibody against LRP blocked cellular degradation of LPL in a dose-dependent manner. 4 2 3' 4 3 8 In addition, a high affinity of LPL to purified V L D L receptor was also demonstrated in an in-vitro binding experiments.439 The binding sites to cell surface receptors have been confirmed on the C-terminal domain of LPL. A fragment of human LPL containing the C-terminal residues 313-448 is able to bind LRP, and mutation of Lys407->Ala drastically reduces the affinity of LPL for LRP by 10-fold 4 4 0 Some other sites are also identified to contribute to the LPL affinity for LRP. The residues 378-423 at C-terminus of LPL bind to purified and cellular LRP, are also able to competitively inhibit the binding of LPL and the lipase-mediated binding of lipoproteins to LRP. 4 4 1 Residues 313-448, 380-384, and 404-414 are also vital for LPL binding to L R P . 4 4 2 ' 4 4 3 1.5.1.3 Regulation of Lipase Expression 1.5.1.3.1 Tissue Expression of LPL LPL plays a central role in triacylglycerol metabolism. It is most abundantly expressed in adipose and muscular tissues, where free fatty acids supplied by LPL are actively utilized for either energy storage by re-esterification or oxidation for energy supply, respectively 4 4 4 The mammary gland is another important source of LPL, but the synthesized enzyme is secreted in association with milk fat droplets 4 4 4 LPL is also detected in vascular smooth muscle cells in large arteries.445 LPL is found on the endothelial surface, but endothelial cells are not the primary source for LPL production. Surface-bound LPL is believed to be synthesized by parenchymal cells and transferred to the endothelium.444 In addition, activated macrophages produce LPL at high level, and this may aggravate the development of atherosclerosis.446'447 LPL expression is observed in adrenal, ovary, testes, lung, spleen, kidney, liver, and brain, the role of LPL in those tissues is not well-characterized.399 After secretion, LPL is docked on membrane-anchored proteoglycans, most of which are heparan sulfate proteoglycans (HSPGs). Small extracellular proteoglycans located in subendothelial layer also bind L P L . 4 4 8 ' 4 4 9 50 1.5.1.3.2 Physiological Regulation of LPL Expression LPL expression is regulated by a variety of factors in order to meet the physiological demands. For example, lactation markedly increases LPL level in mammary gland with corresponding decrease in adipose tissue, and fasting leads to the mobilization of LPL in adipose tissue and inactivation in cardiac muscle.450 The expression of LPL in adipose tissues was investigated in very obese subjects before and after weight reduction which was achieved by low-calorie diet. After weight loss, the expression level of LPL increased in all patients 4 5 1 Cold exposure elicits LPL elaboration in brown fat, so that normal cordial body temperature can be maintained.452 Food deprivation, cold environment, and stress all lead to blood level changes of hormones such as insulin, glucocorticoids, and adrenaline. Therefore, the effects of nutrition and other physiological factors on LPL are believed to be mediated primarily through hormone action. Growth hormone regulates in a positive way the transcription of LPL in preadipocyte Ob 1771 cells;453 isoproterenol and insulin upregulate LPL gene expression in rat adipocytes, but through different mechanisms. Catecholamines decrease LPL expression at both transcriptional and post-transcriptional levels, however, insulin increases LPL expression by stabilizing LPL mRNA without affecting gene transcription.454'455 Thyroid hormone has opposite effects on LPL expression in muscular and adipose tissues where LPL expression is up-regulated in adipocytes but down-regulated in cardiac myocytes.456'457 By contrast, glucocorticoids increase LPL expression in both cardiac myocytes and adipocytes 4 5 8 - 4 6 1 1.5.1.3.3 Regulation of LPL Expression in Macrophages Immunohistochemistry has colocalized LPL expression with macrophages in atherosclerotic lesions.462 It is evident that the switch of monocytes to macrophages is accompanied with a spike of LPL expression. It is well-known that inflammatory cytokines and a variety of growth factors and proteases are involved in macrophage activation and differentiation. For example, M-CSF stimulates monocyte growth and differentiation towards macrophages, and enhances LPL secretion in human monocyte-derived macrophages 4 6 3 51 Some risk factors have been investigated for their influences on LPL expression. Several lines of evidence indicate that oxidative stress plays a role in the pathogenesis of atherosclerosis. Treating cultured murine macrophages with hydrogen peroxide is associated with striking increases in both LPL activity and mRNA levels. Moreover, this stimulation offsets TNF-a induced LPL suppression.464 Exposure of macrophages to high glucose concentrations results in a dramatic upregulation of LPL at both mRNA and protein levels.465 High glucose levels in vivo also produce advanced glycation end products, the latter are proven to be able to potentiate the stimulatory effect of glucose on macrophage LPL expression 4 6 6 Homocysteine induces lipoprotein lipase expression in macrophages through protein kinase C activation and c-Fos upregulation.467 LPL expression is also regulated by several cytokines. Interleukins such as IL-1, IL-2, IL-6, and IL-11, which are involved in inflammatory processes, have an inhibitory impact on LPL expression in macrophages.468"470 Despite the stimulatory effect of LPL on TNF-a expression in macrophages, TNF-a inhibits LPL expression 4 7 1 - 4 7 3 One potential mechanism is the indirect action of TNF-a on LPL through NOS. The treatment of macrophage with TNF-a raises inducible NOS and subsequent NO production, and NO supplementation attenuates the LPL expression. In addition, a NOS inhibitor relinquishes TNF-a of suppressive action on L P L . 4 7 4 IFN-y is also shown to inhibit LPL expression in macrophages, with a synergism with TNF-a. 4 7 3' 4 7 5 Similarly, exposure of macrophages to LIF and IFN-y or IL-6 and LIF or INF-y and TNF-a results in a synergistic suppression of LPL activity.473 Lipopolysaccharides (LPS) suppress in a dose- and time-dependent manner the heparin-induced secretion of LPL from the macrophage-like tumor cell line J774.1 and bone marrow derived mononuclear phagocytes.476"478 The combination of LPS with INF-y also synergistically suppresses LPL production 4 7 9 By contrast, PDGF-BB stimulates LPL production via protein kinase C (PKC) activation in macrophages, and PDGF-BB induced LPL expression is reversed by the immunoneutralization with anti-PDGF-BB antibody.480 The mechanisms of LPL regulation have been investigated in several studies. There are numerous as-acting elements found in the LPL promoter and nearby region: (1) CT element; (2) sterol regulatory element; (3) interferon-gamma responsive element; (4) peroxisome proliferator activated receptor (PPAR) responsive element; (5) oxysterol liver X receptor (LXR) responsive element; (6) nuclear factor-1 receptor; and (7) activator protein 1 (AP-1) or AP-1 like element. 52 The activation of PPAR-y represses LPL expression,481'482 however, a contradictory report 483 states that PPAR-a and y agonists upregulate LPL expression in human macrophages. Cytokines can elicit either dissociation or association of these DNA binding proteins with specific regions in LPL gene so as to regulate LPL expression. For example, TNF-a disrupts the association of nuclear factor Y and an octamer-binding protein with the promoter of LPL gene. As a consequence, LPL gene expression is dampened.484 Additionally, IFN-y reduces the steady state level of Specificity protein (Sp) 3 protein and decreases the DNA binding activity of Spl. 4 8 5 Post-transcriptional regulation of LPL may also occur by influencing mRNA stability, translation, protein degradation, processing, secretion, translocation to the site of action, as well 478 486 as competitive inhibition by the catalytic products. ' 1.5.1.4 Catalytic Function and Lipid Metabolism 1.5.1.4.1 Biochemistry of LPL LPL is a primary triglyceride hydrolase, whose activity relies on intact homodimerization and apoCII presence. The LPL monomer has a lower affinity for heparin-sepharose than LPL 487 488 homodimer, the dissociation of homodimer leads to a minimal activity of triglyceridase. ' The presence of apoCII increases the LPL activity by more than 10 fold with corresponding decrease of the K m . 4 8 9 ' 4 9 0 Intestine-synthesized chylomicrons and liver-derived VLDLs are predominant substrates of LPL because the primary lipid content of those lipoproteins is triglycerides. After contacting endothelial surface where LPL is anchored, the hydrolysis of triglycerides to free fatty acids takes place. Interestingly, the hydrolytic product free fatty acids in return suppress the LPL activity.491 LPL also has a small amount of phospholipase activity, amounting to <2% of triacylglycerol hydrolase activity.492 LPL purified from bovine milk readily hydrolyzed chylomicron phosphatidylcholine to lysophosphatidylcholine, but the proportion and amount of phosphatidylcholine hydrolyzed is always less than that of triacylglycerols 4 9 3 Hydrolytic activity of LPL on phospholipids is showed to be of the phospholipase Ai as LPL cleaves phosphatidylcholine at 1-acyl ester bond.493 The phospholipase Ai activity of LPL relies on the presence of apoCII. The addition of apoCII is associated with a time-dependent release of lysolecithin in a concentration-dependent manner. 53 By contrast, apoCIII causes a strong inhibition of triglyceridase activity of LPL, however, the phospholipase Ai activity of LPL is not altered and even slightly stimulated after apoCIII addition.4 9 0'4 9 4'4 9 5 Paradoxically, the association between LPL and phospholipids decreases after the addition of apoCIII 4 9 6 The phospholipase Ai activity is also influenced by the composition of substrates or the type of lipoproteins. The hydrolysis of phospholipids by LPL is most efficient in VLDL followed in descending order by IDL, HDL, and L D L . 4 9 7 When VLDL is exposed to LPL, 85%-90% of the triacylglycerols are hydrolyzed to fatty acids and 25%-35% of phosphatidylcholine to lysophosphatidylcholine. In comparison, only 4% of phosphatidylcholine in HDL is hydrolyzed even after prolonged incubation of HDL with LPL. 4 9 8 Moreover, LPL hydrolyzes phospholipids containing unsaturated fatty acyl chains 5-10 times faster than saturated lipids, and the length of 16 carbons for fatty acyl chains is optimal.499 1.5.1.4.2 LPL and Metabolism of Triglyceride-rich Lipoproteins Chylomicrons and VLDL are abundant in triglycerides and represent favorable substrates for LPL. In a rat liver perfusion model, addition of LPL caused lipolysis of chylomicron triacylglycerols as evidenced by increased release of fatty acids in the perfusate. The removal of chylomicron core particle was also enhanced, and inhibition of lipolytic activity of LPL delayed chylomicron removal by the liver.500 In human, inhibition of LPL by specific antibodies retarded the clearance of chylomicrons from plasma and decreased their uptake by the liver.501 Furthermore, several mutations, like glycine 142 -> glutamic acid, proline207 leucine, Trp86-> Arg, and Asp250-> Asn, have been found in LPL gene which lead to a catalytic inhibition and consequent familial chylomicronemia (type I hyperlipoproteinemia).502"505 1.5.1.4.3 LPL and Metabolism of ApoB Containing Lipoproteins LPL is also involved in the metabolism of apoB containing lipoproteins. With the progressive loss of triglycerides and the enrichment of esterified cholesterol, VLDL remnants or IDL are remodeled into LDL. In vivo turnover studies have revealed that heterozygous LPL knockout mice have impaired VLDL clearance.506 In patients without functional LPL, the levels of LDL, VLDL, and triglyceride increase; however, the fractional secretion rate for apoB is significantly lower in the patients than those in controls.507 Furthermore, LPL can diminish apoB output by the liver to regulate the levels of apoB-containing lipoproteins in the blood. Compared to lipoproteins in the absence of LPL, apoB-containing lipoproteins associated with LPL have 54 significantly greater and faster clearance by the liver, and the clearance of apoB48-containing lipoproteins are also enhanced after association with LPL. 5 0 9 1.5.1.4.4 L P L and H D L Metabolism Although HDL is not the preferred lipoprotein for the lipolytic action of LPL, the HDL level is also influenced by LPL. Modest but significant changes are observed in carriers of N9 and S291 mutations in comparison with normal alleles.510 In the Copenhagen City Heart Study performed in the Danish general population, most genetic variants of LPL were associated with lower HDL and apoAI levels.5" This correlation is also substantiated by animal studies. The knockout of LPL led to undetectable HDL level at 18 hours after birth in mice.506 When LPL was inhibited, blood HDL levels in monkeys decreased, and apoAI catabolism in the kidney was correspondingly increased.512 CETP is involved in the regulation of HDL by LPL. The overexpression of LPL in CETP transgenic mice is associated with higher HDL levels compared with LPL-overexpressing littermates not carrying the CETP gene.513 In addition, the genotype of LPL influences the response of HDL to statin treatments. Certain haplotypes are associated with a decreased increment in HDL-cholesterolholesterol following statin treatment, however, some other haplotypes were associated with increased HDL-cholesterol response to therapies.514 1.5.1.5 Non-Catalytic function of L P L and Lipoprotein Metabolism 1.5.1.5.1 Accelerated Catabolism of Lipoproteins by Catalytically-inactive L P L Lipolytic modification of lipoproteins does not appear to be necessary for increased catabolism because the effect of LPL is not prevented by enzymatic inhibitors p-nitrophenyl N-dodecylcarbamate and phenylmethylsulfonyl fluoride.515'516 HSPGs are involved in LPL-mediated lipoprotein binding and uptake, as heparinase treatment sharply abrogates the enhancing effect of LPL on LDL and VLDL binding to cells.517 Lipoproteins such as chylomicrons, VLDL, and LDL can bind to HSPG due to the presence of apoE and B, this binding affinity for HSPG is increased by up to 40-fold by LPL. 5 1 7 " 5 1 9 In vivo studies demonstrate that the transgenic expression of catalytically inactive LPL in muscles enhances triglyceride hydrolysis as well as whole particle internalization and selective cholesteryl ester uptake.520'521 The impairment of LPL binding to HSPGs leads to a defective delivery and clearance of lipids to the liver, interfering with normal lipoprotein metabolism. 55 1.5.1.5.2 Lipoprotein Receptor-Dependent Pathway The LPL-enhanced metabolism of lipoproteins can be mediated by lipoprotein receptors. For example, LPL increases V L D L binding to the V L D L receptor via apoE. 5 2 3 ' 5 2 4 It is also reported that bovine and human LPLs were able to increase the specific binding of chylomicrons to LRP by up to 30-40 fold in human fibroblasts.518 Similarly, LDLR is involved in LPL-facilitated LDL uptake. The uptake of LDL into wild type (LDLR+/+) primary aortic endothelial cells was almost doubled after the addition of LPL, however, there was virtually no LPL-mediated change of LDL uptake into LDLR-/- cells.525 It is assumed that LPL can facilitating docking of L D L / V L D L or chylomicrons on cell surface via HSPGs, and then those bound lipoproteins are more susceptible for receptor-mediated internalization.515,526 Also, LPL may directly transfer lipoproteins to receptors since LPL has been found to have the affinity for both receptors and lipoproteins. 4 2 3' 4 3 7' 4 3 8' 4 4 0 , 5 2 7 1.5.1.5.3 Lipoprotein Receptor-Independent Pathway LPL can also facilitate lipoprotein clearance through non-receptor mediated pathways. For example, in vascular smooth muscle cells expressing LRP and the V L D L receptor but not the LDL receptor, the inhibition of V L D L receptor and LRP did not completely abolish the internalization and degradation of LPL-associated beta-VLDL, suggesting there is a receptor-independent pathway. Furthermore, the increased uptake of LDL by LPL is observed in LDLR and LRP deficient cell lines, further supporting that the LPL facilitated LDL uptake is con independent of LDLR and LRP pathways. This non-receptor dependent pathway is postulated to be the direct endocytosis via HSPG. 5 3 0 By immunoelectron microscopy, a difference between receptor-dependent and independent lipoprotein uptake has been described. In general, the receptor-dependent pathway is associated with a rapid internalization with the formation of central, lysosome-like vesicles in cells, however, the receptor-independent pathway is a slow endocytotic process with small, widely distributed intracellular vesicles.531 1.5.1.6 LPL and Atherosclerosis 1.5.1.6.1 LPL Expression in Atherosclerotic Lesions Several lines of evidence indicate that LPL is intimately involved in the pathogenesis of atherosclerosis. LPL expression in macrophages is correlated with risk factors for 56 atherosclerosis. In patients with type 2 diabetes, increased levels of LPL mRNA, activity, and protein were detected in macrophages when compared to macrophages from healthy control subjects.532 Similarly, macrophages from patients with familial hypercholesterolemia showed a significant increase in LPL production when compared with macrophages of control subjects.533 The higher expression of LPL in macrophages was also found in atherosclerosis-susceptible C57BL/6J mice in comparison to atherosclerosis-resistant C3H/HeN mice.5 3 4 Direct evidence of LPL upregulation in atherosclerotic tissue has been described in several in vivo studies. During the neointimal formation following balloon aortic denudation or placement of silastic collar around the aorta in normolipidemic rabbits and rats, striking LPL immunostaining was displayed, and the expression level was parallel to the extent of neointimal thickening.535 Northern blot analysis confirmed that macrophage-derived foam cells are the major source of LPL production.445 The upregulation of macrophage LPL synthesis in atherosclerosis is also evident in coronary arteries in hearts from patients undergoing cardiac allografts.462 1.5.1.6.2 Paradoxical Role of Systemic LPL Expression in Atherosclerosis Contracdictory results have been obtained in animal models where LPL was either overexpressed or knocked out to observe the outcomes in atherogenesis. In rabbits fed with a cholesterol-rich diet, systemic overexpression of LPL inhibited diet-induced hypercholesterolemia, and dramatically suppressed the development of aortic atherosclerosis.536 In apoE KO mice, overexpression also decreases the development of atherosclerosis, as the LPL transgenic mice had 2-fold smaller fatty streak lesions in the aortic sinus compared to the control apoE-/- mice.5 3 7 However, when human LPL was successfully expressed in apoE-/- mice, the extent of occlusion in the aortic sinus region of male LPL transgenic mice increased by 51% compared with control mice after 8 weeks on Western diet.538 Moreover, transgenic Watanabe heritable hyperlipidemic (WHHL) rabbits overexpressing human LPL developed two-fold greater aortic atherosclerosis than non-transgenic WHHL rabbits.539 In heterozygous (LPL+/-) mice with LDLR-/-background, a worse lipid profile was noted after 3-month atherogenic diet, but these mice did 57 not develop more atherosclerosis, as compared to LPL+/+ mice. It was suggested that the decreased expression of LPL in the atherosclerotic lesion may have beneficial effects by preventing the retention of atherogenic lipoproteins.540 The discrepancy of the LPL effect in animal models may originate from the use of different animal species and experimental strategies. In human, LPL deficiency or insufficiency has been described in several mutations in the LPL gene and associated with increased incidence of atherosclerosis. In the quantitative coronary angiographic clinical trial REGRESS, carriers with Asp9->Asn substitution in the LPL enzyme more often had a positive family history of cardiovascular disease and more progression of coronary atherosclerosis than non-carriers.541 Also, low enzymatic activity in patients with LPL gene mutations is associated with severe angina pectoris, suggesting an increased incidence of coronary atherosclerosis.542 In a 14 to 30-year follow-up of four patients with familial chylomicronemia, serial evaluations for carotid, peripheral, and coronary atherosclerosis revealed premature peripheral or coronary atherosclerosis (or both) before age 55 for all four patients.543 Furthermore, postheparin LPL mass and activity in patients are well correlated with the volume of total calcific atherosclerosis and coronary artery calcific atherosclerosis.544 Clinical data from LPL deficiency/insufficiency substantiate the anti-atherogenic character of LPL, this effect can be ascribed to a beneficial lipid profile associated with LPL. For example, LPL activity is positively related to HDL level, 5 4 1' 5 4 3 and helps the clearance of apoB-containing lipoproteins. It is clear that lipolytic products of lipoproteins by LPL can release LPL from HSPGs. With decreased LPL catalytic activity, there may be an increased retention of lipids on HSPGs in peripheral tissues, subsequently leading to increased LDL uptake. For example, catalytically dysfunctional LPL due to the D9N polymorphism caused 4.6 fold enhanced binding and 2.6 fold increased internalization of LDL in comparison to wild-type L P L . 5 4 5 Moreover, monocytes are more inclined to adhere to cells expressing catalytically inactive LPL than wild-type dimer.545 58 1.5.1.6.3 Pro-atherogenic Role of LPL Expression in Macrophage As described before, there is an increased expression of LPL in atherosclerotic tissues, especially in macrophages. Despite the low level of plasma LPL in diabetic patients, macrophages isolated from those patients produce more LPL than those from normal controls. These interesting findings raise the question of a potential pro-atherogenic role of macrophage LPL. Several animal models with macrophage-specific expression of LPL were generated to address this question. LPL knock-out in macrophages decreases atherosclerosis in animals. Lethally irradiated C57BL/6 mice transplanted with fetal liver cells or bone marrow from LPL-/- mice to produce macrophage specific knockout of LPL. After 19 weeks on the atherogenic diet, mice with macrophage LPL knockout developed less severe atherosclerosis in aorta with -50% reduction in mean lesion area. 4 4 7 ' 5 3 8 ' 5 4 6 Similarly, in LDLR(-/-) mice lacking macrophage LPL, the mean lesion area in the proximal aorta was significantly reduced compared with mice with macrophage LPL expression after 8 weeks on Western diet. A dose-dependent effect of macrophage LPL on mean aortic lesion area was also revealed by en face analysis of the aorta in an ascending order of LPL(-/-), LPL(-/+), and LPL(+/+).547 Increased atherosclerosis has been described in rabbits engineered to express human LPL under the control of the human scavenger receptor enhancer/promoter, which specifically drives macrophage-specific expression of human LPL gene. Atherosclerotic lesions were significantly increased in these transgenic rabbits compared to non-transgenic littermates after 16 weeks of a diet containing 0.3% cholesterol. A 1.4-fold increase in total aortic en face atherosclerotic lesions and a 2-fold increase in intimal lesions were also observed.548 In those animal models, there were no apparent differences in plasma post-heparin LPL activity and lipoprotein metabolism between two groups. These experimental results highly support a pro-atherogenic role of macrophage-derived LPL. 1.5.1.6.4 Potential Pro-atherogenic Mechanisms of Macrophage LPL Several mechanisms have been proposed to address the proatherogenicity of macrophage LPL (Figure 1-9). LPL on the macrophage cell surface may facilitate the binding and uptake of L D L 59 to promote foam cell formation. ' B y producing lipolytic products and NO, LPL increases the permeability of endothelium, so that lipoproteins can more readily infiltrate through the endothelial barrier into the intima.551'55 LPL diffused in the intima may accelerate the anchoring of penetrating lipoproteins to ECM, promoting their internalization by macrophages.551'553'554 LPL can also cause lipoproteins to aggregate, increasing the atherogenicity of LDL. 5 5 5 With cell surface HSPGs acting as extracellular chaperones, LPL can Figure 1-9. The proatherogenic mechanisms of macrophage LPL. Macrophage-expressed LPL is the major source of LPL in atherosclerotic lesions. Secreted LPL can adhere to endothelial surface to promote the LDL binding ((D) and subsequent retention in intima. Released free fatty acid can increase the endothelial permeability (©) to increase LDL and macrophage infiltration. LPL can increase the LDL atherogenicity by anchoring LDL on extracellular matrix (ECM) for modification ((g)) and aggregation (@). Meanwhile, LPL can act as adhesion molecule ((D) to recruit monocytes into local atherosclerotic sites. Furthermore, LPL promotes the LDL internalization by macrophages and smooth muscle cells (SMC) to form foam cells ( © ) . act as an adhesion molecule to recruit more monocytes into atherosclerosis-prone sites. ' Furthermore, LPL has already been proven to be able to act as a mitogen to stimulate SMC proliferation.558 This proliferative effect may be mediated by free fatty acids released from 60 lipoproteins by LPL lipolysis. Finally, LPL can magnify the inflammatory response of macrophages, as TNF-a and PDGF production in macrophages is upregulated after LPL stimulation.532-560"562 1.5.2 EL 1.5.2.1 Gene Locus and Structure The EL gene was discovered in 1999 by two independent research groups using different strategies.385-386 The human genome database revealed that the EL locus is on chromosome 18 (18q21.1),563 and has a homology of 45% with LPL, 40% with HL, and 27% with pancreatic lipase. Importantly, critical structural characteristics consistent with the lipase gene family are conserved in this gene.3 8 5'3 8 6 Comparison of the cDNA sequence with the human genome sequence indicates that EL contains at least 11 exons, within which the first exon is not translated and its function is unclear; the second exon codes for a signal peptide of 18 amino acid residues; the last exon has an untranslated region of 2172 nucleotides. The full open reading frame of EL gene is 1500 nucleotides in length encoding a highly conserved protein of 500 amino acids.563 1.5.2.2 Protein Structure-Function Relationships 1.5.2.2.1 Protein Sequence The mature human EL protein consists of 482 amino acids. Several truncated EL isoforms are also found due to varying splicing sites in mRNA; those truncated isoforms not functional and not secreted.386'563 The predicted molecular weight of mature EL protein is approximately 55 kD. There are also significant amounts of smaller EL species with a molecular weight of 40 kD, which is believed to be the product of specific proteolytic cleavage at the amino acid sequence of RNKR, a known recognition sequence for the proprotein convertase family.564 Ten cysteine residues which are found in all lipase family members are also conserved in EL to form disulfide bonds in order to create the 3-dimensional conformation necessary for enzymatic activity. 61 1.5.2.2.2 Protein Glycosylation Reduction in molecular mass of EL after treatment with glycosidases or treatment of EL-expressing cells with the glycosylation inhibitor tunicamycin suggests that EL is a glycosylated protein.385'565 Each putative glycosylation site of asparagine was examined by site-directed mutagenesis. Mutation at Asn60 markedly reduced the secretion and slightly increased the specific activity of EL; however, mutation of Asnl 16 increased the specific activity but not the secretion. Mutation of both Asn60 and Asn-116 resulted into an decreased apparent K m and increased apparent V m a x . Asn373 mutation significantly reduced the specific activity with a decreased apparent V m a x whereas the secretion was not influenced. Neither the secretion nor the specific activity was changed after the mutation at Asn471. Asn449 seemed not to be involved in glycosylation as mutation of this site resulted in no change in secretion, activity, or molecular mass. Among those glycosylation sites, only the Asn373 mutant demonstrated a 3-fold decrease in bridging function compared with wild-type EL, suggesting this glycosylation site also plays a role in the EL bridging function.565 1.5.2.2.3 Catalytic Triad and Surface Loop Alignment of the amino acid sequence of human LPL with HL reveals the conservation of the GXSXG lipase motif in EL, with serine at position 169, aspartic acid at 193, and histidine at 274 386 This motif functions as a catalytic center to hydrolyze specific substrates. Similar to LPL and HL, 19 residues from two stretches of hydrophobic amino acids at positions 163-172 and 272-281 form a conserved lid structure. The protein sequences among EL, LPL, and HL are almost identical in the regions bordering the lid, whereas the lid domain contains the greatest sequence divergence in these lipases. On this occasion, the EL lid region is three residues shorter and less amphipathic compared with LPL and HL. This difference may be responsible for different substrate preferences. The lid structure covers the catalytic center in 3-dimensional models and presumably controls the interaction of EL with lipid substrates 3 8 6 ' 4 1 6 . Mutation of specific residues of the EL lid (G241R, 245R, or E250Q) causes a moderate increase in the triglyceridase/phospholipase ratio compared with wild-type EL. In particular, the 245R mutation is more efficient in hydrolyzing triglycerides.416 By exchanging the EL lid domain with that of LPL, the substrate specificity of phospholipids in the newly formed EL chimera was greatly compromised. This study also demonstrated that the substrate specificity was determined by the 62 EL lid rather than C-terminal domain. Meanwhile, the lid domain could help substrate binding to EL C-domain.416 1.5.2.2.4 C-terminus and Substrate Specificity As well-recognized, the substrate specificity is usually conferred by the lid structure in N-terminus. Recent findings show that the C-terminal domain may play a role in the determination of substrate tropism. For example, inter-generic(rat-human) or human chimeras of HL(C-terminal)-LPL(N-terminal) or LPL(C-terminal)-HL(N-terminal) displays the similar triglyceride esterase activity as HL or LPL, respectively; moreover, LPL and HL antibodies against C-terminal domains reduce the enzymatic activity to a great degree.435'566'567 As for EL, the substitution of EL C-terminal domain for that of LPL switches substrate preference of wild-type EL from phospholipid-rich HDL to triglyceride-rich lipoproteins.568 These evidences suggest that the C-terminal domain of EL can be also involved in the determination of substrate specificity. 1.5.2.2.5 Heparin-Binding Domain EL is also a heparin binding protein. The secreted enzyme is bound on cell surfaces and can be displaced by heparin in vitro and in vivo. Alignment of human LPL sequence with other lipase family members demonstrates the conservation of heparin binding domains in EL in C-terminus. These heparin-binding amino acid residues are proposed to be cluster 1: Arg327-Lys329-Arg330-Lys333; cluster 2: Arg312-Lys313-Arg315; cluster 3: Glyl84-Argl88; and cluster 4, Lys352-Arg450-Lys452-Lys459.386 The heparin binding property of EL can be modulated by glycosylation. 1.5.2.2.6 Homodimerization of EL Molecules LPL and HL undergo homodimerization within cells before secretion. The binding of two identical monomers can stabilize the protein in extracellular milieus and is necessary to preserve enzymatic activity. There is no direct evidence to demonstrating EL homodimerization, however, a clue obtained from an in vitro cell model may imply that EL is able to form dimers. In this experiment, Cos-7 cells were stably co-transfected with both human and mouse EL. Human and 63 mouse EL are highly homologous so that dimerization between them is possible. Compellingly, human EL was coimmunoprecipitated with mouse EL by using an anti-mouse EL antibody, whereas mixing conditioned media from cells expressing either mouse or human EL alone did not produce coimmunoprecipitation of both human and mouse EL. Therefore, it was deduced that human EL may dimerize with mouse EL prior to secretion.569 1.5.2.3 E L Expression and Regulation 1.5.2.3.1 Tissue Expression of EL Endothelial cells do not produce LPL or HL, so the lipase found in endothelial cells such human umbilical vein endothelial cells, human coronary artery endothelial cells, and murine endothelial-like yolk sac cells with a hydrolytic preference on phospholipids is termed endothelial lipase 3 8 5 ' 3 8 6 . However, EL expression is not restricted to endothelial cells, as EL expression in the placenta, liver, lung, kidney, testis, thyroid, and corpus luteum of the ovary was also observed by in situ hybridization analysis, PCR, and Northern blot in several studies. " 3 8 6 , 5 7 0 § m a j j intestine, mammary gland, adipose tissue, and the adrenal gland are also able to produce endothelial lipase.571 In addition, the expression of EL is reported in several macrophage cell lines such as human THP-1 and mouse RAW 294.7 cells, as well as primary macrophages. ' The EL expression at specific tissue sites is regulated by both 5' and 3' flanking regions. Regulatory elements within 11.4 kb of 5' and 9.9 kb of 3' human EL flanking region control the expression of EL in the small intestine, ovary, testis, mammary gland, brain, lung, aorta, adipose tissue and the adrenals, whereas kidney-specific EL expression is under the control of regulatory sequences between 27.4 and 11.4 kb of 5' or 9.9 and 48.7 kb of 3' human EL flanking regions.571 1.5.2.3.2 Atherosclerosis Risk Factors and EL Expression As mentioned above, EL expression was significantly increased in THP-1 cells after oxLDL treatment. Secondly, in spontaneously hypertensive rats (SHR-SP) and Ang Il-induced hypertensive rats, multiple tissues were excised and analyzed by RNase protection assays for EL expression. This study showed that EL mRNA levels were upregulated in tissues including the aorta, heart, and lung from both hypertensive rats, compared to the control, with highest EL expression in the aorta.572 Furthermore, the effect of diabetes mellitus on EL expression was 64 examined in placenta taken from patients with type 1 diabetes mellitus. A higher expression level of EL was detected in placental tissues from these patients when compared to normal controls. In addition, the difference was even more pronounced in poorly controlled diabetics compared to well-controlled diabetics.573 Elevated inflammatory status triggered by lipopolysaccharide injection markedly increased EL mRNA and protein levels in diverse tissues from mice.574 Finally, shear stress and cyclic stretch have been found to induce 2~3 fold 575 increase of EL in endothelia from human umbilical veins and coronary arteries. 1.5.2.3.3 Cytokines and E L Expression As a new member of lipase gene family, the information regarding the regulation of EL by cytokines is relatively limited. Though EL mRNA is expressed at low levels in quiescent rat aortic SMCs, the treatment with angiotensin II and phorbol 12-myristate 13-acetate (PMA) significantly increased EL mRNA levels by 2.9- and 3.3-fold in a time-dependent manner, with a maximum expression at 24 hours.572 TNF-a and IL-lp are two well-known enhancers for EL expression. In HUVECs and human coronary artery endothelial cells, a dose-and time-dependent upregulation of EL secretion 575 576 ensues after the treatment with either TNF-a or IL-1 f3. ' One recent study reported an inhibitory effect of angiopoietin-like protein 3 (ANGPTL 3) on EL expression. ANGPTL 3, is a liver-specific secretory factor that has been shown to increase plasma triglyceride via LPL inhibition.577 The plasma level of ANGPTL 3 is found to be well correlated with plasma HDL cholesterol and phospholipid levels in human. In vivo, there is higher EL activity and resultant lower HDL levels in ANGPTL 3 knockout mice; the supplementation of adenovirus-ANGPTL 3 in turn decreases EL activity and reverses HDL level back to the normal. Furthermore, ANGPTL 3 suppresses the phospholipase activity of EL in vitro, this action is thought to be mediated by the interaction between EL and the heparin-binding domain in the N-terminus of ANGPTL 3. 65 Some nuclear receptors and transcriptional factors could be involved in the regulation of EL expression. Jin et al. had examined the effect of various signaling pathways on EL expression using SN50 (an N F - K B pathway inhibitor), SB 20358 (ap38 MAPK-specific inhibitor), PD 98059 (a p42/44 MAPK-specific inhibitor), GF 109203X (a PKC inhibitor), and D609 (a PC-PLC-activity inhibitor). None of these compounds had any effect on EL expression in human umbilical vein endothelial cells (HUVECs) after IL-ip and TNF-a stimulation except SN50. which diminished EL mRNA induction by above cytokines.576 PPARs and LXR, two important * gene expression regulators, also affect EL expression. Treatment of brain capillary endothelial cells with 24(S)OH-cholesterol (LXR agonist), bezafibrate (PPAR-a agonist), or pioglitazone (PPAR-y agonist) led to the EL down-regulation at mRNA and protein levels.579 1.5.2.4 E L and Lipoprotein Metabolism 1.5.2.4.1 Substrate Specificity EL exhibits a preference in hydrolyzing phospholipids, this phospholipase activity is inhibited 386 by apoCII when using dioleoylphosphatidylcholine liposomes as substrates. In contrast to 24.1 for HL and 139.9 for LPL, the ratio of triglyceridase to phospholipase activity for EL is 580 0.65, suggesting that EL is in favor of phospholipids as its substrates. EL has both phospholipase Ai and A2 activities. The liberation of either saturated or unsaturated fatty acids were detected by gas chromatography analysis in the reaction mixtures of EL with reconstituted discoidal HDLs (rHDLs) that contained free cholesterol, apolipoprotein AI, and either l-palmitoyl-2-oleoylphosphatidylcholine (POPC), l-palmitoyl-2-linoleoylphosphatidylcholine (PLPC), or l-palmitoyl-2-arachidonyl-phosphatidylcholine (PAPC). The cleavage of sn-1 fatty acids is the prerequisite for the cleavage of sn-2 acyl chain because EL-mediated deacylation does not occur in rHDLs containing l-0-l'-hexadecenyl-2-arachidonoylphosphatidylcholine, which is not cleavable due to a nonhydrolyzable alkyl ether linkage at sn-1 position. The lack of phospholipase A2 activity of EL in lysophosphatidylcholine consolidates that conclusion. In addition, hydrolysis rate at sn-1 site is higher than that at sn-2 ca 1 site of phospholipids. Even for phospholipids, EL displays different preferences on phospholipids, typically, in a descending order of (PAPC)rHDL ~ (PLPC)rHDL > (POPC)rHDL > (PDPC [ 1 -palmitoyl-2-docosahexaenoyl-phosphatidylcholine])rHDL.582 66 EL-released free fatty acids can be an alternative source for lipid synthesis in liver as well as energy storage in adipose tissues. When HepG2 hepatocytes with EL overexpression were incubated with [14JC-HDL-PC, and cellular lipids were analyzed by thin layer chromatography, there was an increased amount of cellular [14]C-lipids compared to non-EL-expressing hepatocytes. These EL-liberated fatty acids were mainly incorporated into phospholipids and triacylglycerols in hepatocytes.583 EL is generally expressed in adipocytes at a very low level. In contrast, EL expression and phospholipase activity are considerably increased in mouse adipose tissue as well as isolated adipocytes after LPL is knocked out. Since LPL deficiency does not cause abnormal adipose distribution, it is assumed that the EL overexpression compensates for LPL deficiency to produce fatty acids which are absorbed by adipocytes and incorporated into 1.5.2.4.2 E L Activity and Apolipoprotein A l l Mature HDL is the favored lipoprotein for EL due to the abundance of phospholipids on HDL particles. ApoAI and apoAII comprise about 90% of apolipoproteins in HDL particle, where ApoAII can compete with and displace apoAI from lipoprotein particles due to the higher lipid affinity than apoAI. ApoAII can modulate HDL metabolism via the inhibition of various enzymes including LCAT, CETP, and PLTP. Similarly, the enzymatic activity of EL is also inhibited by apoAII. Human EL was expressed in human apoAI or apoAI/All transgenic mice by the injection of low-dose EL-encoding adenoviral vectors. Despite similar levels of EL protein expression, the apoAI/All double transgenic mice had lower plasma phospholipase activity and less reduction of HDL-CHOLESTEROL, phospholipid, and apoAI levels than the 585 apoAI single transgenic mice; apoAII also reduced EL-mediated HDL binding to HSPGs. In vitro, EL did not hydrolyze reconstituted HDL containing only apoAII and phospholipids in one study, but the hydrolysis in rHDL containing both apoAI and All was greater than in rHDLs containing apoAI only in another study. ' 1.5.2.4.3 Regulation of HDL Metabolism An accumulating body of evidence indicates that EL is a major determinant of plasma HDL levels. In wild-type C57BL/6 mice, expression of human EL via intravenous injection of EL-encoding adenovirus reduced plasma HDL level significantly. The HDL level was undetectable 67 in the first 14 days after adenovirus injection and this effect lasted at least 41 days Similar results were also observed in human apoAI transgenic mice where HDL cholesterol and apoAI were reduced after EL overexpression. Using the same strategy, >80% decrease of HDL 385 cholesterol was observed in chow-fed LDL receptor-deficient mice as well/" Strikingly, HDL cholesterol, phospholipids and total cholesterol was increased 24-48 hours post intravenous administration of EL polyclonal antibodies in three mouse models: wild-type, hepatic lipase knockout, and human apoAI transgenic mice.588 In C57B1/6 background mice, fasting plasma HDL cholesterol was increased in EL(-/-) mice and EL(+/-) mice, whereas EL transgenic mice decreased HDL cholesterol level by 19%, when compared with syngeneic controls. Moreover, the turnover time of HDL was much longer in EL knockout mice than wild-type ones.589"591 In humans, 584C^T polymorphism of EL is relatively common, and this polymorphism could be associated with low phospholipase activity. An investigation has demonstrated that there is an allele-dependent variation in HDL cholesterol as well as apoAI, with the ranking order of TT > CT > C C . 5 9 0 These findings support that the genetic variation in the EL gene can influence plasma HDL cholesterol levels. The phospholipase activity of EL is sufficient to remodel HDLs into small particles. HDL particles after inhibition of EL by antibodies in wild-type, HL-/-, and human apoAI transgenic mice were noticeably larger in size and richer in phospholipid contents,589'590 similar results were also obtained from EL knockout mice.5 8 9'5 9 0 It is also reported that apoAI is not shed during EL-mediated HDL remodeling. Spherical rHDL particles containing apoAI or apoAI/All were incubated with EL, and the diameter decreased with the reduction of phospholipid contents. However, this change did not affect the conformation of apoAI, and neither apoAI nor apoAII dissociated from rHDLs. 5 8 6 The functional domains responsible for the cell surface binding of EL are separate from the catalytic site. As well-documented before, the non-catalytic function of LPL is shown to participate in the metabolism of lipoproteins, as such, the non-catalytic function of EL can also contribute to HDL metabolism. In order to test this hypothesis, the HDL binding and metabolism were investigated using an in vitro cell culture model. When the enzymatically inactive EL-S149A was expressed in CHO cells, the facilitation of HDL binding by EL-S149A was comparable to that by native EL. In 68 addition, the inhibition of EL catalytic activity by tetrahydrolipstatin (THL) increased EL-mediated HDL binding and selective cholesterol uptake by hepatocytes.593 Lipase-released free fatty acids can displace lipases from cell surface. Due to the reduced production of free fatty acids consequent to hydrolytic incapability of EL-S149A, EL bound HDL is then more inclined to adhere to cell surface. Unlike LDL, of which the majority is internalized after lipase bridging, 70% of bound HDL through EL is liberated back to medium in CHO cells.592 Cell surface HSPG is an obligatory component for the bridging function of EL. Associated with HSPG by electrostatic interaction, EL can mediate lipoprotein binding and internalization. The dissociation of EL from HSPGs resulted in decreased HDL and LDL binding by 3-4.4 fold compared to control conditions. Similarly, the abrogation of proteoglycan sulfation by either sodium chlorate or heparin eliminated EL-mediated HDL and LDL binding.592 Wild-type EL or catalytically inactive EL (AdELS149A) was delivered into wild-type, apoAI transgenic, and HL knockout mice by adenovirus. Both wild-type and catalytically-inactive E L were bound to HSPGs at a high expression level in mice. Overexpression of wild-type E L decreased levels of total cholesterol, HDL cholesterol, phospholipids, and apoAI in all 3 mouse models. Expression of catalytically-inactive EL did not decrease lipid or apoAI levels in wild-type and apoAI transgenic mice, whereas reduced total cholesterol, HDL cholesterol, and phospholipids levels in HL-deficient mice, but the magnitude of reduction was less than that in HL-/- mice overexpressing wild-type E L . 5 9 4 This experiment shows the evidence that catalytically-inactive EL has some ability to mediate HDL binding/uptake. EL may also regulate other regulatory factors in HDL metabolism. Despite increased levels of hepatic L C A T mRNA and plasma protein in EL"'" mice, the endogenous esterification rate of L C A T in these mice was significantly impaired (50-60%), suggesting EL may modulate L C A T activity.590' 5 9 5 HL and LPL are also upregulated after EL knockout, whereas, PLTP is downregulated.590'595 These changes after EL expression also could affect HDL metabolism. 1.5.2.4.4 EL and ApoB Containing Lipoprotein Metabolism The level of apoB-containing lipoproteins is regulated by EL although to a lesser extent than HDL. In chow-fed LDLR-/- mice, introduction of human EL by adenovirus reduced 69 V L D L / L D L cholesterol by approximately 50%.385 In C57B1/6 mice, the EL expression level is positively correlated with plasma LDL and cholesterol levels with an ascending order of EL-/ - , cog EL+/-, wild-type, and EL transgenic mice. The above findings were also confirmed in apoE-deficient, LDLR-deficient, and human apoB transgenic mice with hepatic expression of human EL. An marked decrease in VLDL/LDL cholesterol, phospholipid, and apoB levels was detected, as well, the catabolism of LDL apolipoprotein and phospholipid was increased.569 The deficiency of EL also elevates the level of other lipoproteins like chylomicrons, VLDL, remnants, VLDL, and I D L . 5 6 9 ' 5 8 8 - 5 9 0 ' 5 9 6 EL-mediated apoB-containing lipoprotein metabolism is dependent on its catalytic activity to a large extent, which is supported by a fact that a catalytically inactive form of human E L (ELS 149A) did not reduce but increased plasma lipids in the above 3 mouse models.569 The role of noncatalytic function of EL in apoB-containing lipoprotein metabolism is still unaddressed in mouse models. However, an in vitro study may suggest a role of noncatalytic function of EL in LDL metabolism. In that study, an enzymatically inactive EL-S149A was equally effective in facilitating LDL binding to CHO cells as native EL, and 90% of the bound LDL was internalized by CHO cells.592 1.5.2.5 EL and Atherosclerosis 1.5.2.5.1 EL Expression in Atherosclerotic Lesions Since EL can be synthesized by macrophages, EL expression in atherosclerotic lesions was then investigated. Ten autopsy specimens from coronary arteries were examined for EL immunohistochemically. Endothelial cells and SMCs in media constitutively expressed E L even in non-atherosclerotic arteries. However, in atheroma, EL is more highly expressed, and colocalized with infdtrated macrophages, SMCs, and endothelial cells.597 This supports the involvement of EL in the development of atherosclerosis. In cultured macrophages, oxLDL 385 treatment raises EL production, further suggesting the implication of EL in atherosclerosis. 1.5.2.5.2 EL Polymorphism and Atherosclerosis Several E L gene polymorphisms have been found to be associated with plasma HDL levels, and the T l 1II missense polymorphism in exon 3 is the most common allele in humans.598 70 In the Quebec family study where 281 women and 216 men aging 17 to 76 participated, the I allele was significantly correlated with higher apoAI and HDL cholesterol levels in women when compared with the T allele.599 The relationship of EL genetic variant T l 1II and HDL level was again confirmed in the Lipoprotein and Coronary Atherosclerosis Study (LCAS) in a population of 372 individuals. Patients with the TT allele had a 14% higher mean HDL cholesterol level compared with those with the CC allele.590 However, the clinical outcomes and coronary atherosclerotic progression were not significantly different regardless of T l 1II variation. So this raises the question whether the increased HDL consequent to low EL activity is functionally protective? In the same study, EL T l 1II variation changed the HDL composition, II homozygote had 10% higher HDL 3 than TT homozygotes in women.599 In general, HDL3 is more efficient than HDL2 for the removal of peripheral cholesterol. However, elevated HDL level secondary to low EL activity is predominant in HDL2 particles, the latter have the decreased capacity to induce reverse cholesterol transport, which may explain the lack of difference in clinical outcomes among different genotypes in the LCAS study.592 1.5.2.5.3 EL Expression and Atherosclerosis Risk Factors Despite the ambiguous relation between EL gene polymorphism and atherosclerosis, the level of EL expression is elevated in patients with risk factors for atherosclerosis. In a population of moderately obese men, plasma EL levels were increased, and positively correlated to an inflammatory score calculated from CRP, IL-6, and secretory phospholipase A2 concentrations.600 Moreover, a positive correlation between postheparin plasma EL levels and body mass index, visceral adipose tissue accumulation, and a proatherogenic lipid profile was also established in a sample of 80 healthy sedentary men.601 Family history of atherosclerosis-related diseases is another risk factor for atherosclerosis. In the Study of the Inherited Risk of Atherosclerosis which recruited a population of 858 healthy individuals with a family history of premature coronary heart disease, post-heparin E L mass concentration was approximately 3 fold higher than in controls. Both pre- and post-heparin plasma E L was significantly correlated with all metabolic syndrome factors: waist circumference, blood pressure, triglycerides, HDL cholesterol, and fasting glucose.602 After adjusting for age, gender, waist circumference, vasoactive medications, hormone replacement 71 therapy (women), and established cardiovascular risk factors, EL mass concentration in both routine and post-heparin plasma was associated with coronary artery calcification score.602 Hypertension is also associated with high expression of EL. In stroke-prone spontaneously hypertensive rats (SHR-SP) and Ang II-induced hypertensive rats, EL expression was upregulated in aorta, heart, and lung, as analyzed by RNase protection assays.572 Thus, it is speculated that EL expression might be increased in hypertensive human subjects. 1.5.2.5.4 EL and Monocyte Recruitment Monocytes are important in early stage of atherosclerosis, where thy may trigger cascades of inflammatory reactions in the intima. Like LPL, EL can act as an adhesion molecule to facilitate monocyte adherence to endothelial cell surface. More adherent monocytes on aortic strips from EL transgenic mice were demonstrated by ex vivo adhesion assays, and less monocytes on aortic strips from EL knock-out mice as compared with wild-type mice. Furthermore, overexpression of EL in COS7 or Pro5 cells significantly enhanced monocyte binding to EL-expressing cells; the EL effect on monocyte adhesion depends on its bridging function as heparin or heparinase treatment inhibited EL-mediated increase of monocyte adhesion in a dose-dependent manner.5 7 4'5 9 6 By facilitating monocyte recruitment, EL could contribute to the atherogenic process. 1.5.2.5.5 EL Expression and Atherosclerosis in Animal Models The EL knockout animals have been generated in order to investigate the role of EL in atherosclerosis. By were crossbreeding EL-null mice with apoE knockout mice, homozygous double knockout animals were generated. When compared with apoE knockout mice, EL/apoE double knockout mice had a relatively higher HDL cholesterol level. Levels of VLDL, IDL, and LDL cholesterol in apoE/EL double knockout mice were also greater than those in apoE knockout animals. Despite this atherogenic lipid profile, these mice with apoE/EL double knockout developed -70% less atherosclerotic lesions than apo E knockout mice on regular, chow, and high-fat diets.596 72 However, a different observation has been described by Ko et al.. In that study, the influence of EL on atherosclerosis was investigated in apoE knockout mice on the C57BL/6 background. After 26 weeks of chow diet, quantitative morphometric cross-sectional analysis of aortic atherosclerotic lesions displayed no difference between EL/apoE double knockout and apoE knockout mice. They repeated the same investigation in LDLR-/- mice fed a Western diet. Morphometric analysis again revealed no difference in atherosclerotic lesion area between two groups.603 By far, no more information from animal studies is available, and the role of EL in atherosclerosis remains unclear. 73 1.6 Rationale Macrophages play a critical role in the development and progression of atherosclerosis. Upon activation, macrophages obtain an enhanced ability of lipid internalization and accumulation, a process worsened by an impaired ability to efflux cholesterol. This imbalanced equilibrium between lipid uptake and efflux eventually leads to the formation of foam cells, a signature feature of atherogenesis. Concomitant with this process is an increased production of proinflammatory cytokines that augment inflammatory responses and accelerate atherogenesis. As a newly found lipase member, knowledge about the role of EL in atherosclerosis is very limited and results from animal studies by systemic EL knockout are inconsistent. Similar to EL, systemic expression of LPL gives rise to conflicting outcomes in mice, however, LPL expression in macrophages is consistently proatherogenic. It is possible that EL expression in macrophages may also be proatherogenic, but no studies have addressed this specific issue. The present thesis seeks to reveal new information regarding the specific attributes of EL in human macrophage function including influences on lipid binding/uptake, cytokine expression, and cholesterol efflux. Although LPL has been extensively investigated with regard to structure-function relationships as well as its role in lipoprotein metabolism, thus far, there is little information about its role in cholesterol efflux and cytokine expression in macrophages. The investigation of the effect of LPL expression on these two major events during atherogenesis will provide further understanding of the mechanisms responsible for the proatherogenic nature of macrophage-derived LPL. Statins which competitively inhibit HMG-CoA reductase to reduce cholesterol production have been extensively prescribed to treat patients with dyslipidemia. Although many effects in addition to lipid lowering of statins have been reported in previous studies, there are few reports about lipase regulation by statins. In the present thesis, I have investigated the specific role of atorvastatin on lipase expression which provide further insights on pathways of lipase regulation in human macrophages. 74 1 .7 Hypotheses and Objectives 1.7.1 Overarching Hypotheses The expression of lipases (LPL and EL) in macrophages will alter their functions in cholesterol efflux, lipoprotein binding and uptake, and proinflammatory cytokine expression, where differential roles are attributed to catalytic and non-catalytic functions of lipases. Furthermore, atorvastatin treatment will regulate the expression of lipases (LPL and EL) in macrophage through changes in signaling pathways. 1.7.2 Main Objectives 1. To establish macrophage cell models with lipase suppression or overexpression 2. To explore the effect of lipase suppression or overexpression on cholesterol efflux, lipoprotein binding and uptake, and pro-inflammatory cytokine expression in macrophages and related mechanisms 3. To investigate the effect of atorvastatin on lipase expression in macrophages and related mechanisms. 75 1.8 Experimental Design The study design is illustrated in figure 1-10. Monocytes/Macrophages ^LosTof Funct^n^ Lentivirus mediated ENAi Lentivirus Stable Transduction & Dexamethasone ApoAI-Mediated Cholesterol Efflux Lipoprotein Binding and Uptake A B C A 1 Expression ApoAI Binding Phospholipi d Analysis Pro -inflammatory Gene Expression Catalytic Function Bridging Function Lipoprotein Receptor Lipase Expression after Atorvastatin Cytokine ELISA Microarray of Genes Rho Activity LXR Activity N F - K B Activity Figure 1-10. The experimental design. The E L expression in macrophages will be modulated by lentivirus containing either shRNA for loss of function or E L cDNA for gain of function. The L P L expression will be upregulated by dexamethasone treatment or suppressed by lentivirus-mediated R N A interference. Thereafter, the functional changes of apoAI-mediated cholesterol efflux, lipoprotein binding and uptake, and pro-inflammatory gene expression in macrophages will be evaluated and related mechanisms will be also explored as well. Furthermore, the lipase expression after atorvastatin treatment and implicated signaling pathways will also be investigated. 76 1.9 Organization of Research Work Chapter 2. This chapter centers on the effect of LPL and E L on apoAI-mediated cholesterol efflux. The potential mechanisms such as ABCA1 expression, apoAI binding, and phospholipid metabolism have been investigated and a related model was proposed. Chapter 3. In this chapter, the effect of E L on the binding and uptake of both native and oxidized LDLs was investigated, and the contributory role of catalytic and non-catalytic functions of E L was differentiated. Chapter 4. After LPL and E L suppression, the production of proinflammatory cytokines IL-lp\ 6, 8, MCP-1, and TNF-a was measured in macrophages treated with or without oxidized L D L . Furthermore, the expression of atherosclerosis-related genes was analyzed by microarray. Chapter 5. The expression of LPL and E L was investigated in atorvastatin-treated macrophages, and major signaling pathways such as Rho protein, LXR, and N F - K B were also explored to elucidate their relationships with LPL and E L regulation by atorvastatin. Chapter 6. The research findings were summarized in this chapter, and a general discussion related to all research topics was provided. 77 1.10 Reference: 1. Stary HC, Chandler AB, Glagov S, Guyton JR, Insull W, Jr., Rosenfeld ME, Schaffer SA, Schwartz CJ, Wagner WD, Wissler RW. A definition of initial, fatty streak, and intermediate lesions of atherosclerosis. A report from the Committee on Vascular Lesions of the Council on Arteriosclerosis, American Heart Association. Circulation. 1994;89:2462-2478. 2. Stary HC, Chandler AB, Dinsmore RE, Fuster V, Glagov S, Insull W, Jr., Rosenfeld ME, Schwartz CJ, Wagner WD, Wissler RW. A definition of advanced types of atherosclerotic lesions and a histological classification of atherosclerosis. A report from the Committee on Vascular Lesions of the Council on Arteriosclerosis, American Heart Association. Circulation. 1995;92:1355-1374. 3. Stevens RL, Colombo M, Gonzales JJ, Hollander W, Schmid K. The glycosaminoglycans of the human artery and their changes in atherosclerosis. J Clin Invest. 1976;58:470-481. 4. Tammi M, Seppala PO, Lehtonen A, Mottonen M. Connective tissue components in normal and atherosclerotic human coronary arteries. Atherosclerosis. 1978;29:191-194. 5. Miller GJ, Cruickshank JK, Ellis LJ, Thompson RL, Wilkes HC, Stirling Y, Mitropoulos KA, Allison JV, Fox TE, Walker AO. Fat consumption and factor VII coagulant activity in middle-aged men. An association between a dietary and thrombogenic coronary risk factor. Atherosclerosis. 1989;78:19-24. 6. Stary HC. Macrophages, macrophage foam cells, and eccentric intimal thickening in the coronary arteries of young children. Atherosclerosis. 1987;64:91-108. 7. Nikkari ST, Jarvelainen HT, Wight TN, Ferguson M, Clowes AW. Smooth muscle cell expression of extracellular matrix genes after arterial injury. Am J Pathol. 1994;144:1348-1356. 8. Insull W, Jr., Bartsch GE. Cholesterol, triglyceride, and phospholipid content of intima, media, and atherosclerotic fatty streak in human thoracic aorta. J Clin Invest. 1966;45:513-523. 9. Jones GT, Jiang F, McCormick SP, Dusting GJ. Elastic lamina defects are an early feature of aortic lesions in the apolipoprotein E knockout mouse. J Vase Res. 2005;42:237-246. 10. Davies H. Atherogenesis and the coronary arteries of childhood. Int J Cardiol. 1990;28:283-291. 11. Candelise L, Bianchi F, Galligoni F, Albanese V, Bonelli G, Bozzao L, Inzitari D, Mariani F, Rasura M, Rognoni F, et al. Italian multicenter study on reversible cerebral ischemic attacks: III—Influence of age and risk factors on cerebrovascular atherosclerosis. Stroke. 1984;15:379-382. 78 12. Blann AD. Associations of von Willebrand factor with age, sex and other risk factors for atherosclerosis. Thromb Haemost. 1994;71:528-529. 13. Conlan MG, Folsom AR, Finch A, Davis CE, Marcucci G, Sorlie P, Wu KK. Antithrombin III: associations with age, race, sex and cardiovascular disease risk factors. The Atherosclerosis Risk in Communities (ARIC) Study Investigators. Thromb Haemost. 1994;72:551-556. 14. Stensland-Bugge E, Bonaa KH, Joakimsen O, Njolstad I. Sex differences in the relationship of risk factors to subclinical carotid atherosclerosis measured 15 years later : the Tromso study. Stroke. 2000;31:574-581. 15. Stensland-Bugge E, Bonaa KH, Joakimsen O. Age and sex differences in the relationship between inherited and lifestyle risk factors and subclinical carotid atherosclerosis: the Tromso study. Atherosclerosis. 2001;154:437-448. 16. Schreiner PJ, Heiss G, Tyroler HA, Morrisett JD, Davis CE, Smith R. Race and gender differences in the association of Lp(a) with carotid artery wall thickness. The Atherosclerosis Risk in Communities (ARIC) Study. Arterioscler Thromb Vase Biol. 1996;16:471-478. 17. Laws A, Hoen HM, Selby JV, Saad MF, Haffner SM, Howard BV. Differences in insulin suppression of free fatty acid levels by gender and glucose tolerance status. Relation to plasma triglyceride and apolipoprotein B concentrations. Insulin Resistance Atherosclerosis Study (IRAS) Investigators. Arterioscler Thromb Vase Biol. 1997; 17:64-71. 18. Lambrinoudaki I, Christodoulakos G, Rizos D, Economou E, Argeitis J, Vlachou S, Creatsa M, Kouskouni E, Botsis D. Endogenous sex hormones and risk factors for atherosclerosis in healthy Greek postmenopausal women. Eur J Endocrinol. 2006;154:907-916. 19. Phillips GB. Sex hormones and atherosclerosis. Lancet. 1977;2:511-512. 20. Labropoulos B, Velonakis E, Oekonomakos P, Laskaris J, Katsimades D. Serum sex hormones in patients with coronary disease and their relationship to known factors causing atherosclerosis. Cardiology. 1982;69:98-103. 21. Sex, hormones, and atherosclerosis. lance?. 1986;2:552-553. 22. Kannel WB, D'Agostino RB, Belanger AJ. Fibrinogen, cigarette smoking, and risk of cardiovascular disease: insights from the Framingham Study. Am Heart J. 1987;113:1006-1010. 23. Wolf PA, D'Agostino RB, Kannel WB, Bonita R, Belanger AJ. Cigarette smoking as a risk factor for stroke. The Framingham Study. Jama. 1988;259:1025-1029. 24. Semenciw RM, Morrison HI, Mao Y, Johansen H, Davies JW, Wigle DT. Major risk factors for cardiovascular disease mortality in adults: results from the Nutrition Canada Survey cohort. Int J Epidemiol. 1988;17:317-324. 79 25. Hostmark AT, Berg J, Brudal S, Berge SR, Kierulf P, Bjerkedal T. Coronary risk factors in middle-aged men as related to smoking, coffee intake and physical activity. Scand J Soc Med. 1992;20:196-203. 26. Laufs U, Wassmann S, Czech T, Munzel T, Eisenhauer M, Bohm M, Nickenig G. Physical inactivity increases oxidative stress, endothelial dysfunction, and atherosclerosis. Arterioscler Thromb Vase Biol. 2005;25:809-814. 27. Hakim AA, Petrovitch H, Burchfiel CM, Ross GW, Rodriguez BL, White LR, Yano K, Curb JD, Abbott RD. Effects of walking on mortality among nonsmoking retired men. ./V Engl J Med. 1998;338:94-99. 28. Manson JE, Greenland P, LaCroix AZ, Stefanick ML, Mouton CP, Oberman A, Perri MG, Sheps DS, Pettinger MB, Siscovick DS. Walking compared with vigorous exercise for the prevention of cardiovascular events in women. NEngl J Med. 2002;347:716-725. 29. Pitsavos C, Panagiotakos DB, Chrysohoou C, Kavouras S, Stefanadis C. The associations between physical activity, inflammation, and coagulation markers, in people with metabolic syndrome: the ATTICA study. Eur J Cardiovasc Prev Rehabil. 2005;12:151-158. 30. Hambrecht R, Wolf A, Gielen S, Linke A, Hofer J, Erbs S, Schoene N, Schuler G. Effect of exercise on coronary endothelial function in patients with coronary artery disease. N Engl J Med. 2000;342:454-460. 31. Schuler G, Hambrecht R, Schlierf G, Niebauer J, Hauer K, Neumann J, Hoberg E, Drinkmann A, Bacher F, Grunze M, et al. Regular physical exercise and low-fat diet. Effects on progression of coronary artery disease. Circulation. 1992;86:1-11. 32. Kingwell BA, Tran B, Cameron JD, Jennings GL, Dart AM. Enhanced vasodilation to acetylcholine in athletes is associated with lower plasma cholesterol. Am J Physiol. 1996;270:H2008-2013. 33. Belardinelli R, Paolini I, Cianci G, Piva R, Georgiou D, Purcaro A. Exercise training intervention after coronary angioplasty: the ETICA trial. J Am Coll Cardiol. 2001;37:1891-1900. 34. Nordstrom CK, Dwyer KM, Merz CN, Shircore A, Dwyer JH. Leisure time physical activity and early atherosclerosis: the Los Angeles Atherosclerosis Study. Am J Med. 2003;115:19-25. 35. Bucher HC, Hengstler P, Schindler C, Meier G. N-3 polyunsaturated fatty acids in coronary heart disease: a meta-analysis of randomized controlled trials. Am J Med. 2002;112:298-304. 36. Simon JA. Combined vitamin E and vitamin C supplement use and risk of cardiovascular disease mortality. Arch Intern Med. 2002; 162:2630; author reply 2630. 80 37. Nam CM, Oh KW, Lee KH, Jee SH, Cho SY, Shim WH, Suh I. Vitamin C intake and risk of ischemic heart disease in a population with a high prevalence of smoking. J Am CollNutr. 2003;22:372-378. 38. Liu S, Lee IM, Ajani U, Cole SR, Buring IE, Manson JE. Intake of vegetables rich in carotenoids and risk of coronary heart disease in men: The Physicians' Health Study. Int J Epidemiol. 2001;30:130-135. 39. Rao AV. Lycopene, tomatoes, and the prevention of coronary heart disease. Exp Biol Med (Maywood). 2002;227:908-913. 40. Rissanen TH, Voutilainen S, Nyyssonen K, Lakka TA, Sivenius J, Salonen R, Kaplan GA, Salonen JT. Low serum lycopene concentration is associated with an excess incidence of acute coronary events and stroke: the Kuopio Ischaemic Heart Disease Risk Factor Study. BrJNutr. 2001;85:749-754. 41. Ndiaye M, Chataigneau T, Andriantsitohaina R, Stoclet JC, Schini-Kerth VB. Red wine polyphenols cause endothelium-dependent EDHF-mediated relaxations in porcine coronary arteries via a redox-sensitive mechanism. Biochem Biophys Res Commun. 2003;310:371-377. 42. Hozumi T, Sugioka K, Shimada K, Kim SH, Kuo MY, Miyake Y, Fujimoto K, Otsuka R, Watanabe H, Hosoda K, Yoshikawa J, Homma S. Beneficial effect of short term intake of red wine polyphenols on coronary microcirculation in patients with coronary artery disease. Heart. 2006;92:681-682. 43. Bensen JT, Li R, Hutchinson RG, Province MA, Tyroler HA. Family history of coronary heart disease and pre-clinical carotid artery atherosclerosis in African-Americans and whites: the ARIC study: Atherosclerosis Risk in Communities. Genet Epidemiol. 1999;16:165-178. 44. Pankow JS, Folsom AR, Province MA, Rao DC, Eckfeldt J, Heiss G, Shahar E, Wu KK. Family history of coronary heart disease and hemostatic variables in middle-aged adults. Atherosclerosis Risk in Communities Investigators and Family Heart Study Research Group. Thromb Haemost. 1997;77:87-93. 45. Wang X, Paigen B. Genome-wide search for new genes controlling plasma lipid concentrations in mice and humans. Curr Opin Lipidol. 2005;16:127-137. 46. Ostlund RE, Jr., Levy RA, Witztum JL, Schonfeld G. Familial hypercholesterolemia. Evidence for a newly recognized mutation determining increased fibroblast receptor affinity but decreased capacity for low density lipoprotein in two siblings. J Clin Invest. 1982;70:823-831. 47. Rubba P, De Simone B, Postiglione A, Cortese C, Gnasso A, Mancini M. Extracoronary atherosclerosis in familial hypercholesterolemia. Atherosclerosis. 1988;71:205-213. 48. Kane JP, Malloy MJ, Ports TA, Phillips NR, Diehl JC, Havel RJ. Regression of coronary atherosclerosis during treatment of familial hypercholesterolemia with combined drug regimens. Jama. 1990;264:3007-3012. 81 49. Tatami R, Inoue N, Itoh H, Kishino B, Koga N, Nakashima Y, Nishide T, Okamura K, Saito Y, Teramoto T, et al. Regression of coronary atherosclerosis by combined LDL-apheresis and lipid-lowering drug therapy in patients with familial hypercholesterolemia: a multicenter study. The LARS Investigators. Atherosclerosis. 1992;95:1-13. 50. Shimokawa H, Vanhoutte PM. Impaired endothelium-dependent relaxation to aggregating platelets and related vasoactive substances in porcine coronary arteries in hypercholesterolemia and atherosclerosis. Circ Res. 1989;64:900-914. 51. Wilson D, Massaeli H, Pierce GN, Zahradka P. Native and minimally oxidized low density lipoprotein depress smooth muscle matrix metalloproteinase levels. Mol Cell Biochem. 2003;249:141-149. 52. Schwandt P. Triglyceride-rich lipoproteins and atherosclerosis. Drugs. 1990;40 Suppl 1:38-41. 53. Hodis HN. Triglyceride-rich lipoprotein remnant particles and risk of atherosclerosis. Circulation. 1999;99:2852-2854. 54. Hodis HN, Mack WJ. Triglyceride-rich lipoproteins and progression of atherosclerosis. Eur Heart J. 1998;19 Suppl A:A40-44. 55. MacMahon S, Peto R, Cutler J, Collins R, Sorlie P, Neaton J, Abbott R, Godwin J, Dyer A, Stamler J. Blood pressure, stroke, and coronary heart disease. Part 1, Prolonged differences in blood pressure: prospective observational studies corrected for the regression dilution bias. Lancet. 1990;335:765-774. 56. McGill HC, Jr., Carey KD, McMahan CA, Marinez YN, Cooper TE, Mott GE, Schwartz C J. Effects of two forms of hypertension on atherosclerosis in the hyperlipidemic baboon. Arteriosclerosis. 1985;5:481-493. 57. Chobanian AV, Lichtenstein AH, Nilakhe V, Haudenschild CC, Drago R, Nickerson C. Influence of hypertension on aortic atherosclerosis in the Watanabe rabbit. Hypertension. 1989;14:203-209. 58. Overturf M, Sybers H, Schaper J, Taegtmeyer H. Hypertension and atherosclerosis in cholesterol-fed rabbits. II. One-kidney, one clip Goldblatt hypertension treated with nifedipine. Atherosclerosis. 1987;66:63-76. 59. Chobanian A. Overview: hypertension and atherosclerosis. Am Heart J. 1988; 116:319-322. 60. Kojda G, Harrison D. Interactions between NO and reactive oxygen species: pathophysiological importance in atherosclerosis, hypertension, diabetes and heart failure. Cardiovasc Res. 1999;43:562-571. 61. Fontbonne A, Eschwege E. Diabetes, hyperglycaemia, hyperinsulinaemia and atherosclerosis: epidemiological data. Diabete Metab. 1987;13:350-353. 82 62. Stolar MW. Atherosclerosis in diabetes: the role of hyperinsulinemia. Metabolism. 1988;37:1-9. 63. Numano F, Tanaka A, Makita T, Kishi Y. Glycated lipoprotein and atherosclerosis. Ann NY Acad Sci. 1997;811:100-113; discussion 113-104. 64. Hattori Y, Kakishita H, Akimoto K, Matsumura M, Kasai K. Glycated serum albumin-induced vascular smooth muscle cell proliferation through activation of the mitogen-activated protein kinase/extracellular signal-regulated kinase pathway by protein kinase C. Biochem Biophys Res Commun. 2001;281:891-896. 65. Griffin E, Re A, Hamel N, Fu C, Bush H, McCaffrey T, Asch AS. A link between diabetes and atherosclerosis: Glucose regulates expression of CD36 at the level of translation. Nat Med. 2001;7:840-846. 66. Hubert HB, Feinleib M, McNamara PM, Castelli WP. Obesity as an independent risk factor for cardiovascular disease: a 26-year follow-up of participants in the Framingham Heart Study. Circulation. 1983;67:968-977. 67. Lakka TA, Lakka HM, Salonen R, Kaplan GA, Salonen JT. Abdominal obesity is associated with accelerated progression of carotid atherosclerosis in men. Atherosclerosis. 2001; 154:497-504. 68. Al Suwaidi J, Higano ST, Hamasaki S, Holmes DR, Lerman A. Association between obesity and coronary atherosclerosis and vascular remodeling. Am J Cardiol. 2001;88:1300-1303. 69. McGill HC, Jr., McMahan CA, Herderick EE, Zieske AW, Malcom GT, Tracy RE, Strong JP. Obesity accelerates the progression of coronary atherosclerosis in young men. Circulation. 2002; 105:2712-2718. 70. Grundy SM. Obesity, metabolic syndrome, and coronary atherosclerosis. Circulation. 2002;105:2696-2698. 71. Rozanski A, Blumenthal JA, Kaplan J. Impact of psychological factors on the pathogenesis of cardiovascular disease and implications for therapy. Circulation. 1999;99:2192-2217. 72. Kaplan JR, Manuck SB, Clarkson TB, Lusso FM, Taub DM, Miller EW. Social stress and atherosclerosis in normocholesterolemic monkeys. Science. 1983;220:733-735. 73. Nordstrom CK, Dwyer KM, Merz CN, Shircore A, Dwyer JH. Work-related stress and early atherosclerosis. Epidemiology. 2001;12:180-185. 74. Castillo-Richmond A, Schneider RH, Alexander CN, Cook R, Myers H, Nidich S, Haney C, Rainforth M, Salerno J. Effects of stress reduction on carotid atherosclerosis in hypertensive African Americans. Stroke. 2000;31:568-573. 83 75. Schneider RH, Nidich SI, Salerno JW, Sharma HM, Robinson CE, Nidich RJ, Alexander CN. Lower lipid peroxide levels in practitioners of the Transcendental Meditation program. Psychosom Med. 1998;60:38-41. 76. Wilcken DE, Wilcken B. The pathogenesis of coronary artery disease. A possible role for methionine metabolism. J Clin Invest. 1976;57:1079-1082. 77. Clarke R, Daly L, Robinson K, Naughten E, Cahalane S, Fowler B, Graham I. Hyperhomocysteinemia: an independent risk factor for vascular disease. NEngl J Med. 1991;324:1149-1155. 78. Homocysteine and risk of ischemic heart disease and stroke: a meta-analysis. Jama. 2002;288:2015-2022. 79. van den Berg M, Stehouwer CD, Bierdrager E, Rauwerda JA. Plasma homocysteine and severity of atherosclerosis in young patients with lower-limb atherosclerotic disease. Arterioscler Thromb Vase Biol. 1996; 16:165-171. 80. Chambers JC, Obeid OA, Refsum H, Ueland P, Hackett D, Hooper J, Turner RM, Thompson SG, Kooner JS. Plasma homocysteine concentrations and risk of coronary heart disease in UK Indian Asian and European men. Lancet. 2000;355:523-527. 81. Tsai JC, Perrella MA, Yoshizumi M, Hsieh CM, Haber E, Schlegel R, Lee ME. Promotion of vascular smooth muscle cell growth by homocysteine: a link to atherosclerosis. Proc Natl Acad Sci US A. 1994;91:6369-6373. 82. Chambers JC, Obeid OA, Kooner JS. Physiological increments in plasma homocysteine induce vascular endothelial dysfunction in normal human subjects. Arterioscler Thromb Vase Biol. 1999;19:2922-2927. 83. Zeng X, Dai J, Remick DG, Wang X. Homocysteine mediated expression and secretion of monocyte chemoattractant protein-1 and interleukin-8 in human monocytes. Circ Res. 2003;93:311-320. 84. Silverman MD, Tumuluri RJ, Davis M, Lopez G, Rosenbaum JT, Lelkes PI. Homocysteine upregulates vascular cell adhesion molecule-1 expression in cultured human aortic endothelial cells and enhances monocyte adhesion. Arterioscler Thromb Vase Biol. 2002;22:587-592. 85. Topal G, Brunet A, Millanvoye E, Boucher JL, Rendu F, Devynck MA, David-Dufilho M. Homocysteine induces oxidative stress by uncoupling of NO synthase activity through reduction of tetrahydrobiopterin. Free Radic Biol Med. 2004;36:1532-1541. 86. Tyagi N, Sedoris KC, Steed M, Ovechkin AV, Moshal KS, Tyagi SC. Mechanisms of homocysteine-induced oxidative stress. Am J Physiol Heart Circ Physiol. 2005;289:H2649-2656. 87. Voutilainen S, Morrow JD, Roberts LJ, 2nd, Alfthan G, Alho H, Nyyssonen K, Salonen JT. Enhanced in vivo lipid peroxidation at elevated plasma total homocysteine levels. Arterioscler Thromb Vase Biol. 1999;19:1263-1266. 84 88. Bienvenu T, Ankri A, Chadefaux B, Montalescot G, Kamoun P. Elevated total plasma homocysteine, a risk factor for thrombosis. Relation to coagulation and fibrinolytic parameters. Thromb Res. 1993;70:123-129. 89. Coppola A, Davi G, De Stefano V, Mancini FP, Cerbone AM, Di Minno G. Homocysteine, coagulation, platelet function, and thrombosis. Semin Thromb Hemost. 2000;26:243-254. 90. Dardik R, Varon D, Tamarin I, Zivelin A, Salomon O, Shenkman B, Savion N. Homocysteine and oxidized low density lipoprotein enhanced platelet adhesion to endothelial cells under flow conditions: distinct mechanisms of thrombogenic modulation. Thromb Haemost. 2000;83:338-344. 91. Lobo A, Naso A, Arheart K, Kruger WD, Abou-Ghazala T, Alsous F, Nahlawi M, Gupta A, Moustapha A, van Lente F, Jacobsen DW, Robinson K. Reduction of homocysteine levels in coronary artery disease by low-dose folic acid combined with vitamins B6 and B12. Am J Cardiol. 1999;83:821-825. 92. Bostom AG, Jacques PF, Liaugaudas G, Rogers G, Rosenberg IH, Selhub J. Total homocysteine lowering treatment among coronary artery disease patients in the era of folic acid-fortified cereal grain flour. Arterioscler Thromb Vase Biol. 2002;22:488-491. 93. Tice JA, Ross E, Coxson PG, Rosenberg I, Weinstein MC, Hunink MG, Goldman PA, Williams L, Goldman L. Cost-effectiveness of vitamin therapy to lower plasma homocysteine levels for the prevention of coronary heart disease: effect of grain fortification and beyond. Jama. 2001;286:936-943. 94. Schaefer EJ, Lamon-Fava S, Jenner JL, McNamara JR, Ordovas JM, Davis CE, Abolafia JM, Lippel K, Levy RI. Lipoprotein(a) levels and risk of coronary heart disease in men. The lipid Research Clinics Coronary Primary Prevention Trial. Jama. 1994;271:999-1003. 95. Luc G, Bard JM, Arveiler D, Ferrieres J, Evans A, Amouyel P, Fruchart JC, Ducimetiere P. Lipoprotein (a) as a predictor of coronary heart disease: the PRIME Study. Atherosclerosis. 2002; 163:377-384. 96. Wild SH, Fortmann SP, Marcovina SM. A prospective case-control study of lipoprotein(a) levels and apo(a) size and risk of coronary heart disease in Stanford Five-City Project participants. Arterioscler Thromb Vase Biol. 1997;17:239-245. 97. Zampoulakis JD, Kyriakousi AA, Poralis KA, Karaminas NT, Palermos ID, Chimonas ET, Cokkinos DV. Lipoprotein(a) is related to the extent of lesions in the coronary vasculature and to unstable coronary syndromes. Clin Cardiol. 2000;23:895-900. 98. Srubbs P, Seed M, Lane D, Collinson P, Kendall F, Noble M. Lipoprotein(a) as a risk predictor for cardiac mortality in patients with acute coronary syndromes. Eur Heart J. 1998;19:1355-1364. 85 99. Desmarais RL, Sarembock IJ, Ayers CR, Vernon SM, Powers ER, Gimple LW. Elevated serum lipoprotein(a) is a risk factor for clinical recurrence after coronary balloon angioplasty. Circulation. 1995;91:1403-1409. 100. Schumacher M, Tiran A, Eber B, Toplak H, Wilders-Truschnig M, Klein W. Lipoprotein (a) is not a risk factor for restenosis after percutaneous transluminal coronary angioplasty. Am J Cardiol. 1992;69:572. 101. Terres W, Tatsis E, Pfalzer B, Beil FU, Beisiegel U, Hamm CW. Rapid angiographic progression of coronary artery disease in patients with elevated lipoprotein(a). Circulation. 1995;91:948-950. 102. Enas EA. Rapid angiographic progression of coronary artery disease in patients with elevated lipoprotein(a). Circulation. 1995;92:2353-2354. 103. Matsumoto Y, Daida H, Watanabe Y, Sunayama S, Mokuno H, Yokoi H, Yamaguchi H. High level of lipoprotein(a) is a strong predictor for progression of coronary artery disease. JAtheroscler Thromb. 1998;5:47-53. 104. Libby P. Inflammation in atherosclerosis. Nature. 2002;420:868-874. 105. Libby P, Ridker PM, Maseri A. Inflammation and atherosclerosis. Circulation. 2002;105:1135-1143. 106. Danesh J, Wheeler JG, Hirschfield GM, Eda S, Eiriksdottir G, Rumley A, Lowe GD, Pepys MB, Gudnason V. C-reactive protein and other circulating markers of inflammation in the prediction of coronary heart disease. N EnglJ Med. 2004;350:1387-1397. 107. Agmon Y, Khandheria BK, Meissner I, Petterson TM, O'Fallon WM, Wiebers DO, Christianson TJ, McConnell JP, Whisnant JP, Seward JB, Tajik AJ. C-reactive protein and atherosclerosis of the thoracic aorta: a population-based transesophageal echocardiographic study. Arch Intern Med. 2004;164:1781-1787. 108. Hashimoto H, Kitagawa K, Hougaku H, Etani H, Hori M. Relationship between C-reactive protein and progression of early carotid atherosclerosis in hypertensive subjects. Stroke. 2004;35:1625-1630. 109. Ishikawa T, Hatakeyama K, Imamura T, Date H, Shibata Y, Hikichi Y, Asada Y, Eto T. Involvement of C-reactive protein obtained by directional coronary atherectomy in plaque instability and developing restenosis in patients with stable or unstable angina pectoris. Am J Cardiol. 2003;91:287-292. 110. Ridker PM, Glynn RJ, Hennekens CH. C-reactive protein adds to the predictive value of total and HDL cholesterol in determining risk of first myocardial infarction. Circulation. 1998;97:2007-2011. 111. Fichtlscherer S, Zeiher AM. Endothelial dysfunction in acute coronary syndromes: association with elevated C-reactive protein levels. Ann Med. 2000;32:515-518. 86 112. Cleland S J, Sattar N, Petrie JR, Forouhi NG, Elliott HL, Connell JM. Endothelial dysfunction as a possible link between C-reactive protein levels and cardiovascular disease. Clin Sci (Lond). 2000;98:531-535. 113. Verma S, Kuliszewski MA, Li SH, Szmitko PE, Zucco L, Wang CH, Badiwala MV, Mickle DA, Weisel RD, Fedak PW, Stewart DJ, Kutryk MJ. C-reactive protein attenuates endothelial progenitor cell survival, differentiation, and function: further evidence of a mechanistic link between C-reactive protein and cardiovascular disease. Circulation. 2004; 109:2058-2067. 114. Blaschke F, Bruemmer D, Yin F, Takata Y, Wang W, Fishbein MC, Okura T, Higaki J, Graf K, Fleck E, Hsueh WA, Law RE. C-reactive protein induces apoptosis in human coronary vascular smooth muscle cells. Circulation. 2004; 110:579-587. 115. Doronzo G, Russo I, Mattiello L, Trovati M, Anfossi G. C-reactive protein increases matrix metalloproteinase-2 expression and activity in cultured human vascular smooth muscle cells. J Lab Clin Med. 2005;146:287-298. 116. Miyagawa N, Okamoto Y, Nakano H. Effect of C-reactive protein on peritoneal macrophages. II. Human C-reactive protein activates peritoneal macrophages of guinea pigs to release superoxide anion in vitro. Microbiol Immunol. 1988;32:721-731. 117. Liang YJ, Shyu KG, Wang BW, Lai LP. C-reactive protein activates the nuclear factor-kappaB pathway and induces vascular cell adhesion molecule-1 expression through CD32 in human umbilical vein endothelial cells and aortic endothelial cells. J Mol Cell Cardiol. 2006;40:412-420. 118. Zhang J, Rui YC, Yang PY, Lu L, Li TJ. C-reactive protein induced expression of adhesion molecules in cultured cerebral microvascular endothelial cells. Life Sci. 2006;78:2983-2988. 119. Zwaka TP, Hombach V, Torzewski J. C-reactive protein-mediated low density lipoprotein uptake by macrophages: implications for atherosclerosis. Circulation. 2001;103:1194-1197. 120. Fu T, Borensztajn J. Macrophage uptake of low-density lipoprotein bound to aggregated C-reactive protein: possible mechanism of foam-cell formation in atherosclerotic lesions. Biochem J. 2002;366:195-201. 121. Sueishi K, Ichikawa K, Kato K, Nakagawa K, Chen YX. Atherosclerosis: coagulation and fibrinolysis. Semin Thromb Hemost. 1998;24:255-260. 122. Bini A, Fenoglio JJ, Jr., Mesa-Tejada R, Kudryk B, Kaplan KL. Identification and distribution of fibrinogen, fibrin, and fibrin(ogen) degradation products in atherosclerosis. Use of monoclonal antibodies. Arteriosclerosis. 1989;9:109-121. 123. Wu KK, Folsom AR, Heiss G, Davis CE, Conlan MG, Barnes R. Association of coagulation factors and inhibitors with carotid artery atherosclerosis. Early results of the Atherosclerosis Risk in Communities (ARIC) Study. Ann Epidemiol. 1992;2:471-480. 87 124. Levenson J, Giral P, Megnien JL, Gariepy J, Plainfosse MC, Simon A. Fibrinogen and its relations to subclinical extracoronary and coronary atherosclerosis in hypercholesterolemic men. Arterioscler Thromb Vase Biol. 1997;17:45-50. 125. Sabeti S, Exner M, Mlekusch W, Amighi J, Quehenberger P, Rumpold H, Maurer G, Minar E, Wagner O, Schillinger M. Prognostic impact of fibrinogen in carotid atherosclerosis: nonspecific indicator of inflammation or independent predictor of disease progression? Stroke. 2005;36:1400-1404. 126. Samarendra Lai C, Edge JR, Stansfield D. Serum fibrin/fibrinogen degradation products as a prognostic index in acute myocardial infarction. J Clin Pathol. 1975;28:821-824. 127. Benditt EP, Barrett T, McDougall JK. Viruses in the etiology of atherosclerosis. Proc Natl Acad Sci USA. 1983;80:6386-6389. 128. Melnick JL, Petrie BL, Dreesman GR, Burek J, McCollum CH, DeBakey ME. Cytomegalovirus antigen within human arterial smooth muscle cells. Lancet. 1983;2:644-647. 129. Nieto FJ, Adam E, Sorlie P, Farzadegan H, Melnick JL, Comstock GW, Szklo M. Cohort study of cytomegalovirus infection as a risk factor for carotid intimal-medial thickening, a measure of subclinical atherosclerosis. Circulation. 1996;94:922-927. 130. Hajjar DP, Pomerantz KB, Falcone DJ, Weksler BB, Grant AJ. Herpes simplex virus infection in human arterial cells. Implications in arteriosclerosis. J Clin Invest. 1987;80:1317-1321. 131. Key NS, Vercellotti GM, Winkelmann JC, Moldow CF, Goodman JL, Esmon NL, Esmon CT, Jacob HS. Infection of vascular endothelial cells with herpes simplex virus enhances tissue factor activity and reduces thrombomodulin expression. Proc Natl Acad Sci USA. 1990;87:7095-7099. 132. Span AH, van Dam-Mieras MC, Mullers W, Endert J, Muller AD, Bruggeman CA. The effect of virus infection on the adherence of leukocytes or platelets to endothelial cells. Eur J Clin Invest. 1991;21:331-338. 133. Etingin OR, Silverstein RL, Hajjar DP. Identification of a monocyte receptor on herpesvirus-infected endothelial cells. Proc Natl Acad Sci USA. 1991;88:7200-7203. 134. Sorlie PD, Nieto FJ, Adam E, Folsom AR, Shahar E, Massing M. A prospective study of cytomegalovirus, herpes simplex virus 1, and coronary heart disease: the atherosclerosis risk in communities (ARIC) study. Arch Intern Med. 2000;160:2027-2032. 135. Cour MI, Lopez de Atalaya FJ, Palau L, Fernandez Contreras E, Perezagua C. Lack of serological association between herpesvirus and atherosclerosis. Lancet. 1989; 1:279. 136. Linnanmaki E, Leinonen M, Mattila K, Nieminen MS, Valtonen V, Saikku P. Chlamydia pneumoniae-specific circulating immune complexes in patients with chronic coronary heart disease. Circulation. 1993;87:1130-1134. 88 137. Kuo CC, Gown AM, Benditt EP, Grayston JT. Detection of Chlamydia pneumoniae in aortic lesions of atherosclerosis by immunocytochemical stain. Arterioscler Thromb. 1993;13:1501-1504. 138. Ramirez JA. Isolation of Chlamydia pneumoniae from the coronary artery of a patient with coronary atherosclerosis. The Chlamydia pneumoniae/Atherosclerosis Study Group. Ann Intern Med. 1996;125:979-982. 139. Melnick SL, Shahar E, Folsom AR, Grayston JT, Sorlie PD, Wang SP, Szklo M. Past infection by Chlamydia pneumoniae strain TWAR and asymptomatic carotid atherosclerosis. Atherosclerosis Risk in Communities (ARIC) Study Investigators. Am J Med. 1993;95:499-504. 140. Muhlestein JB, Anderson JL, Hammond EH, Zhao L, Trehan S, Schwobe EP, Carlquist JF. Infection with Chlamydia pneumoniae accelerates the development of atherosclerosis and treatment with azithromycin prevents it in a rabbit model. Circulation. 1998;97:633-636. 141. Beck JD, Eke P, Lin D, Madianos P, Couper D, Moss K, Elter J, Heiss G, Offenbacher S. Associations between IgG antibody to oral organisms and carotid intima-medial thickness in community-dwelling adults. Atherosclerosis. 2005;183:342-348. 142. Chiu B. Multiple infections in carotid atherosclerotic plaques. Am Heart J. 1999;138:S534-536. 143. Gordon S, Clarke S, Greaves D, Doyle A. Molecular immunobiology of macrophages: recent progress. Curr Opin Immunol. 1995;7:24-33. 144. Ross R. Atherosclerosis—an inflammatory disease. NEngl J Med. 1999;340:115-126. 145. Smith JD, Trogan E, Ginsberg M, Grigaux C, Tian J, Miyata M. Decreased atherosclerosis in mice deficient in both macrophage colony-stimulating factor (op) and apolipoprotein E. Proc Natl Acad Sci USA. 1995;92:8264-8268. 146. Verhaar MC, Beutler JJ, Gaillard CA, Koomans HA, Fijnheer R, Rabelink TJ. Progressive vascular damage in hypertension is associated with increased levels of circulating P-selectin. JHypertens. 1998;16:45-50. 147. Takami S, Yamashita S, Kihara S, Kameda-Takemura K, Matsuzawa Y. High concentration of glucose induces the expression of intercellular adhesion molecule-1 in human umbilical vein endothelial cells. Atherosclerosis. 1998;138:35-41. 148. Davi G, Romano M, Mezzetti A, Procopio A, Iacobelli S, Antidormi T, Bucciarelli T, Alessandrini P, Cuccurullo F, Bittolo Bon G. Increased levels of soluble P-selectin in hypercholesterolemic patients. Circulation. 1998;97:953-957. 149. Chappell DC, Varner SE, Nerem RM, Medford RM, Alexander RW. Oscillatory shear stress stimulates adhesion molecule expression in cultured human endothelium. Circ Res. 1998;82:532-539. 89 150. Cybulsky MI, Gimbrone MA, Jr. Endothelial expression of a mononuclear leukocyte adhesion molecule during atherogenesis. Science. 1991;251:788-791. 151. Collins RG, Velji R, Guevara NV, Hicks MJ, Chan L, Beaudet AL. P-Selectin or intercellular adhesion molecule (ICAM)-l deficiency substantially protects against atherosclerosis in apolipoprotein E-deficient mice. J Exp Med. 2000;191:189-194. 152. Blann AD, Nadar SK, Lip GY. The adhesion molecule P-selectin and cardiovascular disease. Eur Heart J. 2003;24:2166-2179. 153. Dong ZM, Chapman SM, Brown AA, Frenette PS, Hynes RO, Wagner DD. The combined role of P- and E-selectins in atherosclerosis. J Clin Invest. 1998;102:145-152. 154. Sanz MJ, Johnston B, Issekutz A, Kubes P. Endothelin-1 causes P-selectin-dependent leukocyte rolling and adhesion within rat mesenteric microvessels. Am J Physiol. 1999;277:H1823-1830. 155. Ishii H, Yoshida M, Rosenzweig A, Gimbrone MA, Jr., Yasukochi Y, Numano F. Adenoviral transduction of human E-selectin into isolated, perfused, rat aortic segments: an ex vivo model for studying leukocyte-endothelial interactions. JLeukoc Biol. 2000;68:687-692. 156. Kumar P, Hosaka S, Koch AE. Soluble E-selectin induces monocyte chemotaxis through Src family tyrosine kinases. J Biol Chem. 2001;276:21039-21045. 157. Eriksson EE, Werr J, Guo Y, Thoren P, Lindbom L. Direct observations in vivo on the role of endothelial selectins and alpha(4) integrin in cytokine-induced leukocyte-endothelium interactions in the mouse aorta. Circ Res. 2000;86:526-533. 158. Ramos CL, Huo Y, Jung U, Ghosh S, Manka DR, Sarembock IJ, Ley K. Direct demonstration of P-selectin- and VCAM-1-dependent mononuclear cell rolling in early atherosclerotic lesions of apolipoprotein E-deficient mice. Circ Res. 1999;84:1237-1244. 159. Han KH, Tangirala RK, Green SR, Quehenberger O. Chemokine receptor CCR2 expression and monocyte chemoattractant protein-1-mediated chemotaxis in human monocytes. A regulatory role for plasma LDL. Arterioscler Thromb Vase Biol. 1998;18:1983-1991. 160. Wang G, O K. Homocysteine stimulates the expression of monocyte chemoattractant protein-1 receptor (CCR2) in human monocytes: possible involvement of oxygen free radicals. Biochem J. 2001;357:233-240. 161. Han KH, Hong KH, Park JH, Ko J, Kang DH, Choi KJ, Hong MK, Park SW, Park SJ. C-reactive protein promotes monocyte chemoattractant protein-1—mediated chemotaxis through upregulating CC chemokine receptor 2 expression in human monocytes. Circulation. 2004;109:2566-2571. 162. Gu L, Okada Y, Clinton SK, Gerard C, Sukhova GK, Libby P, Rollins BJ. Absence of monocyte chemoattractant protein-1 reduces atherosclerosis in low density lipoprotein receptor-deficient mice. Mol Cell. 1998;2:275-281. 90 163. Inoue S, Egashira K, Ni W, Kitamoto S, Usui M, Otani K, Ishibashi M, Hiasa K, Nishida K, Takeshita A. Anti-monocyte chemoattractant protein-1 gene therapy limits progression and destabilization of established atherosclerosis in apolipoprotein E-knockout mice. Circulation. 2002;106:2700-2706. 164. Gosling J, Slaymaker S, Gu L, Tseng S, Zlot CH, Young SG, Rollins BJ, Charo IF. MCP-1 deficiency reduces susceptibility to atherosclerosis in mice that overexpress human apolipoprotein B. J Clin Invest. 1999;103:773-778. 165. Boring L, Gosling J, Cleary M, Charo IF. Decreased lesion formation in CCR2-/- mice reveals a role for chemokines in the initiation of atherosclerosis. Nature. 1998;394:894-897. 166. Dawson TC, Kuziel WA, Osahar TA, Maeda N. Absence of CC chemokine receptor-2 reduces atherosclerosis in apolipoprotein E-deficient mice. Atherosclerosis. 1999;143:205-211. 167. Han KH, Han KO, Green SR, Quehenberger O. Expression of the monocyte chemoattractant protein-1 receptor CCR2 is increased in hypercholesterolemia. Differential effects of plasma lipoproteins on monocyte function. J Lipid Res. 1999;40:1053-1063. 168. Boisvert WA, Santiago R, Curtiss LK, Terkeltaub RA. A leukocyte homologue of the IL-8 receptor CXCR-2 mediates the accumulation of macrophages in atherosclerotic lesions of LDL receptor-deficient mice. J Clin Invest. 1998; 101:353-363. 169. Reape TJ, Groot PH. Chemokines and atherosclerosis. Atherosclerosis. 1999;147:213-225. 170. Werle M, Schmal U, Hanna K, Kreuzer J. MCP-1 induces activation of MAP-kinases ERK, JNK and p38 MAPK in human endothelial cells. Cardiovasc Res. 2002;56:284-292. 171. Kamisato S, Uemura Y, Takami N, Okamoto K. Involvement of intracellular cyclic GMP and cyclic GMP-dependent protein kinase in alpha-elastin-induced macrophage chemotaxis. J Biochem (Tokyo). 1997;121:862-867. 172. Sozzani S, Molino M, Locati M, Luini W, Cerletti C, Vecchi A, Mantovani A. Receptor-activated calcium influx in human monocytes exposed to monocyte chemotactic protein-1 and related cytokines. J Immunol. 1993;150:1544-1553. 173. Chandrasekar B, Bysani S, Mummidi S. CXCL16 signals via Gi, phosphatidylinositol 3-kinase, Akt, I kappa B kinase, and nuclear factor-kappa B and induces cell-cell adhesion and aortic smooth muscle cell proliferation. J Biol Chem. 2004;279:3188-3196. 174. Young JL, Libby P, Schonbeck U. Cytokines in the pathogenesis of atherosclerosis. Thromb Haemost. 2002;88:554-567. 91 175. Lougheed M, Steinbrecher UP. Mechanism of uptake of copper-oxidized low density lipoprotein in macrophages is dependent on its extent of oxidation. J Biol Chem. 1996;271:11798-11805. 176. Gillotte KL, Horkko S, Witztum JL, Steinberg D. Oxidized phospholipids, linked to apolipoprotein B of oxidized LDL, are ligands for macrophage scavenger receptors. J Lipid Res. 2000;41:824-833. 177. Matveev S, Uittenbogaard A, van Der Wesfhuyzen D, Smart EJ. Caveolin-1 negatively regulates SR-BI mediated selective uptake of high-density lipoprotein-derived cholesteryl ester. Eur J Biochem. 2001;268:5609-5616. 178. Matveev S, van der Westhuyzen DR, Smart EJ. Co-expression of scavenger receptor-BI and caveolin-1 is associated with enhanced selective cholesteryl ester uptake in THP-1 macrophages. J Lipid Res. 1999;40:1647-1654. 179. Acton S, Rigotti A, Landschulz KT, Xu S, Hobbs HH, Krieger M. Identification of scavenger receptor SR-BI as a high density lipoprotein receptor. Science. 1996;271:518-520. 180. Zhang Y, Da Silva JR, Reilly M, Billheimer JT, Rothblat GH, Rader DJ. Hepatic expression of scavenger receptor class B type I (SR-BI) is a positive regulator of macrophage reverse cholesterol transport in vivo. J Clin Invest. 2005;115:2870-2874. 181. Marsche G, Zimmermann R, Horiuchi S, Tandon NN, Sattler W, Malle E. Class B scavenger receptors CD36 and SR-BI are receptors for hypochlorite-modified low density lipoprotein. J Biol Chem. 2003;278:47562-47570. 182. Gillotte-Taylor K, Boullier A, Witztum JL, Steinberg D, Quehenberger O. Scavenger receptor class B type I as a receptor for oxidized low density lipoprotein. J Lipid Res. 2001;42:1474-1482. 183. Skalen K, Gustafsson M, Rydberg EK, Hulten LM, Wiklund O, Innerarity TL, Boren J. Subendothelial retention of atherogenic lipoproteins in early atherosclerosis. Nature. 2002;417:750-754. 184. Chisolm GM, 3rd, Hazen SL, Fox PL, Cathcart MK. The oxidation of lipoproteins by monocytes-macrophages. Biochemical and biological mechanisms. JBiol Chem. 1999;274:25959-25962. 185. Cyrus T, Witztum JL, Rader DJ, Tangirala R, Fazio S, Linton MF, Funk CD. Disruption of the 12/15-lipoxygenase gene diminishes atherosclerosis in apo E-deficient mice. J Clin Invest. 1999;103:1597-1604. 186. Harats D, Shaish A, George J, Mulkins M, Kurihara H, Levkovitz H, Sigal E. Overexpression of 15-lipoxygenase in vascular endothelium accelerates early atherosclerosis in LDL receptor-deficient mice. Arterioscler Thromb Vase Biol. 2000;20:2100-2105. 92 187. Carr AC, McCall MR, Frei B. Oxidation of LDL by myeloperoxidase and reactive nitrogen species: reaction pathways and antioxidant protection. Arterioscler Thromb Vase Biol. 2000;20:1716-1723. 188. Rosenblat M, Aviram M. Oxysterol-induced activation of macrophage NADPH-oxidase enhances cell-mediated oxidation of LDL in the atherosclerotic apolipoprotein E deficient mouse: inhibitory role for vitamin E. Atherosclerosis. 2002;160:69-80. 189. Detmers PA, Hernandez M, Mudgett J, Hassing H, Burton C, Mundt S, Chun S, Fletcher D, Card DJ, Lisnock J, Weikel R, Bergstrom JD, Shevell DE, Hermanowski-Vosatka A, Sparrow CP, Chao YS, Rader DJ, Wright SD, Pure E. Deficiency in inducible nitric oxide synthase results in reduced atherosclerosis in apolipoprotein E-deficient mice. J Immunol. 2000;165:3430-3435. 190. Ihrig M, Dangler CA, Fox JG. Mice lacking inducible nitric oxide synthase develop spontaneous hypercholesterolaemia and aortic atheromas. Atherosclerosis. 2001;156:103-107. 191. Rozenberg O, Shih DM, Aviram M. Paraoxonase 1 (PON1) attenuates macrophage oxidative status: studies in PON1 transfected cells and in PON1 transgenic mice. A therosclerosis. 2005; 181:9-18. 192. Shih DM, Xia YR, Wang XP, Miller E, Castellani LW, Subbanagounder G, Cheroutre H, Faull KF, Berliner JA, Witztum JL, Lusis AJ. Combined serum paraoxonase knockout/apolipoprotein E knockout mice exhibit increased lipoprotein oxidation and atherosclerosis. J Biol Chem. 2000;275:17527-17535. 193. Wu TW, Fung KP, Wu J, Yang CC, Weisel RD. Antioxidation of human low density lipoprotein by unconjugated and conjugated bilirubins. Biochem Pharmacol. 1996;51:859-862. 194. Karabina SA, Lehner AN, Frank E, Parthasarathy S, Santanam N. Oxidative inactivation of paraoxonase—implications in diabetes mellitus and atherosclerosis. Biochim Biophys Acta. 2005;1725:213-221. 195. Mackness MI, Durrington PN, Mackness B. The role of paraoxonase 1 activity in cardiovascular disease: potential for therapeutic intervention. Am J Cardiovasc Drugs. 2004;4:211-217. 196. Nakayama M, Takahashi K, Komaru T, Fukuchi M, Shioiri H, Sato K, Kitamuro T, Shirato K, Yamaguchi T, Suematsu M, Shibahara S. Increased expression of heme oxygenase-1 and bilirubin accumulation in foam cells of rabbit atherosclerotic lesions. Arterioscler Thromb Vase Biol. 2001;21:1373-1377. 197. Deng X, Wang X, Andersson R. Alterations in endothelial barrier permeability in multiple organs during overactivation of macrophages in rats. Shock. 1996;6:126-133. 198. Vita JA, Brennan ML, Gokce N, Mann SA, Goormastic M, Shishehbor MH, Penn MS, Keaney JF, Jr., Hazen SL. Serum myeloperoxidase levels independently predict endothelial dysfunction in humans. Circulation. 2004; 110:1134-1139. 93 199. Rimbach G, Valacchi G, Canali R, Virgili F. Macrophages stimulated with IFN-gamma activate NF-kappa B and induce MCP-1 gene expression in primary human endothelial cells. Moi Cell Biol Res Commun. 2000;3:238-242. 200. Davignon J. Beneficial cardiovascular pleiotropic effects of statins. Circulation. 2004;109:11139-43. 201. Galis ZS, Muszynski M, Sukhova GK, Simon-Morrissey E, Libby P. Enhanced expression of vascular matrix metalloproteinases induced in vitro by cytokines and in regions of human atherosclerotic lesions. Ann N Y Acad Sci. 1995;748:501-507. 202. Galis ZS, Sukhova GK, Kranzhofer R, Clark S, Libby P. Macrophage foam cells from experimental atheroma constitutively produce matrix-degrading proteinases. Proc Natl Acad Sci US A. 1995;92:402-406. 203. Shah PK, Falk E, Badimon JJ, Fernandez-Ortiz A, Mailhac A, Villareal-Levy G, Fallon JT, Regnstrom J, Fuster V. Human monocyte-derived macrophages induce collagen breakdown in fibrous caps of atherosclerotic plaques. Potential role of matrix-degrading metalloproteinases and implications for plaque rupture. Circulation. 1995;92:1565-1569. 204. Li Z, Li L, Zielke HR, Cheng L, Xiao R, Crow MT, Stetler-Stevenson WG, Froehlich J, Lakatta EG. Increased expression of 72-kd type IV collagenase (MMP-2) in human aortic atherosclerotic lesions. Am J Pathol. 1996;148:121-128. 205. Aikawa M, Rabkin E, Sugiyama S, Voglic SJ, Fukumoto Y, Furukawa Y, Shiomi M, Schoen FJ, Libby P. An HMG-CoA reductase inhibitor, cerivastatin, suppresses growth of macrophages expressing matrix metalloproteinases and tissue factor in vivo and in vitro. Circulation. 2001;103:276-283. 206. Marx N, Sukhova G, Murphy C, Libby P, Plutzky J. Macrophages in human atheroma contain PPARgamma: differentiation-dependent peroxisomal proliferator-activated receptor gamma(PPARgamma) expression and reduction of MMP-9 activity through PPARgamma activation in mononuclear phagocytes in vitro. Am J Pathol. 1998;153:17-23. 207. Furman C, Copin C, Kandoussi M, Davidson R, Moreau M, McTaggiart F, Chapman MJ, Fruchart JC, Rouis M. Rosuvastatin reduces MMP-7 secretion by human monocyte-derived macrophages: potential relevance to atherosclerotic plaque stability. Atherosclerosis. 2004;174:93-98. 208. Lemaitre V, Soloway PD, D'Armiento J. Increased medial degradation with pseudo-aneurysm formation in apolipoprotein E-knockout mice deficient in tissue inhibitor of metalloproteinases-1. Circulation. 2003;107:333-338. 209. Kockx MM, Cromheeke KM, Knaapen MW, Bosmans JM, De Meyer GR, Herman AG, Bult H. Phagocytosis and macrophage activation associated with hemorrhagic microvessels in human atherosclerosis. Arterioscler Thromb Vase Biol. 2003;23:440-446. 210. Alaupovic P. Significance of apolipoproteins for structure, function, and classification of plasma lipoproteins. Methods Enzymol. 1996;263:32-60. 94 211. Jackson RL, Morrisett JD, Gotto AM, Jr. Lipoprotein structure and metabolism. Physiol Rev. 1976;56:259-316. 212. Packard CJ, Howard BV. Lipoprotein metabolism: more than the sum of its parts. Curr Opin Lipidol. 1995;6:115-116. 213. Duan LP, Wang HH, Wang DQ. Cholesterol absorption is mainly regulated by the jejunal and ileal ATP-binding cassette sterol efflux transporters Abcg5 and Abcg8 in mice. J Lipid Res. 2004;45:1312-1323. 214. Hui DY, Howies PN. Molecular mechanisms of cholesterol absorption and transport in the intestine. Semin Cell Dev Biol. 2005;16:183-192. 215. Lopez-Candales A, Bosner MS, Spilburg CA, Lange LG. Cholesterol transport function of pancreatic cholesterol esterase: directed sterol uptake and esterification in enterocytes. Biochemistry. 1993;32:12085-12089. 216. Heidrich JE, Contos LM, Hunsaker LA, Deck LM, Vander Jagt DL. Inhibition of pancreatic cholesterol esterase reduces cholesterol absorption in the hamster. BMC Pharmacol. 2004;4:5. 217. de Faria E, Fong LG, Komaromy M, Cooper AD. Relative roles of the LDL receptor, the LDL receptor-like protein, and hepatic lipase in chylomicron remnant removal by the liver. J Lipid Res. 1996;37:197-209. 218. Sherrill BC, Innerarity TL, Mahley RW. Rapid hepatic clearance of the canine lipoproteins containing only the E apoprotein by a high affinity receptor. Identity with the chylomicron remnant transport process. J Biol Chem. 1980;255:1804-1807. 219. van Berkel TJ, Out R, Hoekstra M, Kuiper J, Biessen E, van Eck M. Scavenger receptors: friend or foe in atherosclerosis? Curr Opin Lipidol. 2005;16:525-535. 220. Dixon JL, Ginsberg HN. Hepatic synthesis of lipoproteins and apolipoproteins. Semin Liver Dis. 1992;12:364-372. 221. Danielsen EM, Hansen GH, Poulsen MD. Apical secretion of apolipoproteins from enterocytes. J Cell Biol. 1993;120:1347-1356. 222. Schaefer EJ, Wetzel MG, Bengtsson G, Scow RO, Brewer HB, Jr., Olivecrona T. Transfer of human lymph chylomicron constituents to other lipoprotein density fractions during in vitro lipolysis. J Lipid Res. 1982;23:1259-1273. 223. Rye KA, Clay MA, Barter PJ. Remodelling of high density lipoproteins by plasma factors. Atherosclerosis. 1999;145:227-238. 224. Kee P, Rye KA, Taylor JL, Barrett PH, Barter PJ. Metabolism of apoA-I as lipid-free protein or as component of discoidal and spherical reconstituted HDLs: studies in wild-type and hepatic lipase transgenic rabbits. Arterioscler Thromb Vase Biol. 2002;22:1912-1917. 95 225. Liang HQ, Rye KA, Barter PJ. Remodelling of reconstituted high density lipoproteins by lecithin: cholesterol acyltransferase. J Lipid Res. 1996;37:1962-1970. 226. Chisholm JW, Burleson ER, Shelness GS, Parks JS. ApoA-I secretion from HepG2 cells: evidence for the secretion of both lipid-poor apoA-I and intracellularly assembled nascent HDL. J Lipid Res. 2002;43:36-44. 227. Francis GA, Knopp RH, Oram JF. Defective removal of cellular cholesterol and phospholipids by apolipoprotein A-I in Tangier Disease. J Clin Invest. 1995;96:78-87. 228. Nichols AV, Blanche PJ, Gong EL, Shore VG, Forte TM. Molecular pathways in the transformation of model discoidal lipoprotein complexes induced by lecithinxholesterol acyltransferase. Biochim Biophys Acta. 1985;834:285-300. 229. Kuivenhoven JA, Pritchard H, Hill J, Frohlich J, Assmann G, Kastelein J. The molecular pathology of lecithin: cholesterol acyltransferase (LCAT) deficiency syndromes. J Lipid Res. 1997;38:191-205. 230. Rader DJ, Ikewaki K, Duverger N, Schmidt H, Pritchard H, Frohlich J, Clerc M, Dumon MF, Fairwell T, Zech L, et al. Markedly accelerated catabolism of apolipoprotein A-II (ApoA-II) and high density lipoproteins containing ApoA-II in classic lecithin: cholesterol acyltransferase deficiency and fish-eye disease. J Clin Invest. 1994;93:321-330. 231. Barrans A, Jaspard B, Barbaras R, Chap H, Perret B, Collet X. Pre-beta HDL: structure and metabolism. Biochim Biophys Acta. 1996;1300:73-85. 232. Forte TM, Bielicki JK, Knoff L, McCall MR. Structural relationships between nascent apoA-I-containing particles that are extracellularly assembled in cell culture. J Lipid Res. 1996;37:1076-1085. 233. Inazu A, Brown ML, Hesler CB, Agellon LB, Koizumi J, Takata K, Maruhama Y, Mabuchi H, Tall AR. Increased high-density lipoprotein levels caused by a common cholesteryl-ester transfer protein gene mutation. N Engl J Med. 1990;323:1234-1238. 234. Agellon LB, Walsh A, Hayek T, Moulin P, Jiang XC, Shelanski SA, Breslow JL, Tall AR. Reduced high density lipoprotein cholesterol in human cholesteryl ester transfer protein transgenic mice. J Biol Chem. 1991;266:10796-10801. 235. Ikewaki K, Nishiwaki M, Sakamoto T, Ishikawa T, Fairwell T, Zech LA, Nagano M, Nakamura H, Brewer HB, Jr., Rader DJ. Increased catabolic rate of low density lipoproteins in humans with cholesteryl ester transfer protein deficiency. J Clin Invest. 1995;96:1573-1581. 236. Jiang XC, Bruce C, Mar J, Lin M, Ji Y, Francone OL, Tall AR. Targeted mutation of plasma phospholipid transfer protein gene markedly reduces high-density lipoprotein levels. J Clin Invest. 1999;103:907-914. 237. Jiang X, Francone OL, Bruce C, Milne R, Mar J, Walsh A, Breslow JL, Tall AR. Increased prebeta-high density lipoprotein, apolipoprotein AI, and phospholipid in mice 96 expressing the human phospholipid transfer protein and human apolipoprotein AI transgenes. J Clin Invest. 1996;98:2373-2380. 238. Wolfbauer G, Albers JJ, Oram JF. Phospholipid transfer protein enhances removal of cellular cholesterol and phospholipids by high-density lipoprotein apolipoproteins. Biochim Biophys Acta. 1999;1439:65-76. 239. Kozarsky KF, Donahee MH, Rigotti A, Iqbal SN, Edelman ER, Krieger M. Overexpression of the HDL receptor SR-BI alters plasma HDL and bile cholesterol levels. Nature. 1997;387:414-417. 240. Wang N, Arai T, Ji Y, Rinninger F, Tall AR. Liver-specific overexpression of scavenger receptor BI decreases levels of very low density lipoprotein ApoB, low density lipoprotein ApoB, and high density lipoprotein in transgenic mice. J Biol Chem. 1998;273:32920-32926. 241. Hammad SM, Barth JL, Knaak C, Argraves WS. Megalin acts in concert with cubilin to mediate endocytosis of high density lipoproteins. J Biol Chem. 2000;275:12003-12008. 242. Hammad SM, Stefansson S, Twal WO, Drake CJ, Fleming P, Remaley A, Brewer HB, Jr., Argraves WS. Cubilin, the endocytic receptor for intrinsic factor-vitamin B(12) complex, mediates high-density lipoprotein holoparticle endocytosis. Proc Natl Acad Sci USA. 1999;96:10158-10163. 243. Rubin EM, Krauss RM, Spangler EA, Verstuyft JG, Clift SM. Inhibition of early atherogenesis in transgenic mice by human apolipoprotein AI. Nature. 1991 ;353:265-267. 244. Moore RE, Navab M, Millar JS, Zimetti F, Hama S, Rothblat GH, Rader DJ. Increased atherosclerosis in mice lacking apolipoprotein A-I attributable to both impaired reverse cholesterol transport and increased inflammation. Circ Res. 2005;97:763-771. 245. Ordovas JM, Cassidy DK, Civeira F, Bisgaier CL, Schaefer EJ. Familial apolipoprotein A-I, C-III, and A-IV deficiency and premature atherosclerosis due to deletion of a gene complex on chromosome U.J Biol Chem. 1989;264:16339-16342. 246. Schaefer EJ, Kay LL, Zech LA, Brewer HB, Jr. Tangier disease. High density lipoprotein deficiency due to defective metabolism of an abnormal apolipoprotein A-i (ApoA-ITangier). J Clin Invest. 1982;70:934-945. 247. Fielding CJ, Fielding PE. Molecular physiology of reverse cholesterol transport. J Lipid Res. 1995;36:211-228. 248. van der Westhuyzen DR, Cai L, de Beer MC, de Beer FC. Serum amyloid A promotes cholesterol efflux mediated by scavenger receptor B-I. J Biol Chem. 2005;280:35890-35895. 249. Hayek T, Oiknine J, Dankner G, Brook JG, Aviram M. HDL apolipoprotein A-I attenuates oxidative modification of low density lipoprotein: studies in transgenic mice. Eur J Clin Chem Clin Biochem. 1995;33:721-725. 97 250. Mackness MI, Arrol S, Mackness B, Durrington PN. Alloenzymes of paraoxonase and effectiveness of high-density lipoproteins in protecting low-density lipoprotein against lipid peroxidation. Lancet. 1997;349:851-852. 251. Watson AD, Berliner JA, Hama SY, La Du BN, Faull KF, Fogelman AM, Navab M. Protective effect of high density lipoprotein associated paraoxonase. Inhibition of the biological activity of minimally oxidized low density lipoprotein. J Clin Invest. 1995;96:2882-2891. 252. Marathe GK, Zimmerman GA, Mclntyre TM. Platelet-activating factor acetylhydrolase, and not paraoxonase-1, is the oxidized phospholipid hydrolase of high density lipoprotein particles. J Biol Chem. 2003;278:3937-3947. 253. Mertens A, Verhamme P, Bielicki JK, Phillips MC, Quarck R, Verreth W, Stengel D, Ninio E, Navab M, Mackness B, Mackness M, Holvoet P. Increased low-density lipoprotein oxidation and impaired high-density lipoprotein antioxidant defense are associated with increased macrophage homing and atherosclerosis in dyslipidemic obese mice: LCAT gene transfer decreases atherosclerosis. Circulation. 2003;107:1640-1646. 254. Forte TM, Oda MN, Knoff L, Frei B, Suh J, Harmony JA, Stuart WD, Rubin EM, Ng DS. Targeted disruption of the murine lecithin:cholesterol acyltransferase gene is associated with reductions in plasma paraoxonase and platelet-activating factor acetylhydrolase activities but not in apolipoprotein J concentration. J Lipid Res. 1999;40:1276-1283. 255. Kazumi T, Kawaguchi A, Hirano T, Yoshino G. C-reactive protein in young, apparently healthy men: associations with serum leptin, QTc interval, and high-density lipoprotein-cholesterol. Metabolism. 2003;52:1113-1116. 256. Kimura T, Tomura H, Mogi C, Kuwabara A, Damirin A, Ishizuka T, Sekiguchi A, Ishiwara M, Im DS, Sato K, Murakami M, Okajima F. Role of Scavenger Receptor Class B Type I and Sphingosine 1-Phosphate Receptors in High Density Lipoprotein-induced Inhibition of Adhesion Molecule Expression in Endothelial Cells. JBiol Chem. 2006;281:37457-37467. 257. Cockerill GW, Huehns TY, Weerasinghe A, Stocker C, Lerch PG, Miller NE, Haskard DO. Elevation of plasma high-density lipoprotein concentration reduces interleukin-1-induced expression of E-selectin in an in vivo model of acute inflammation. Circulation. 2001;103:108-112. 258. Yuhanna IS, Zhu Y, Cox BE, Hahner LD, Osborne-Lawrence S, Lu P, Marcel YL, Anderson RG, Mendelsohn ME, Hobbs HH, Shaul PW. High-density lipoprotein binding to scavenger receptor-BI activates endothelial nitric oxide synthase. Nat Med. 2001;7:853-857. 259. Fujita T, Hara A, Yamazaki Y. Relationship between circulating high density lipoprotein concentrations and interleukin-6 release during abdominal operations. Eur J Surg. 2001;167:347-350. 98 260. Cue JI, DiPiro JT, Brunner LJ, Doran JE, Blankenship ME, Mansberger AR, Hawkins ML. Reconstituted high density lipoprotein inhibits physiologic and tumor necrosis factor alpha responses to lipopolysaccharide in rabbits. Arch Surg. 1994;129:193-197. 261. Memon RA, Kifayet A, Shahid F, Lateef A, Chiang J, Hussain R. Low serum HDL-cholesterolholesterol is associated with raised tumor necrosis factor-alpha during ENL reactions. IntJLepr Other Mycobact Dis. 1997;65:1-11. 262. Deguchi H, Pecheniuk NM, Elias DJ, Averell PM, Griffin JH. High-density lipoprotein deficiency and dyslipoproteinemia associated with venous thrombosis in men. Circulation. 2005;112:893-899. 263. Tselepis AD, Dentan C, Karabina SA, Chapman MJ, Ninio E. PAF-degrading acetylhydrolase is preferentially associated with dense LDL and VHDL-1 in human plasma. Catalytic characteristics and relation to the monocyte-derived enzyme. Arterioscler Thromb Vase Biol. 1995;15:1764-1773. 264. Pritchard PH. The degradation of platelet-activating factor by high-density lipoprotein in rat plasma. Effect of ethynyloestradiol administration. Biochem J. 1987;246:791-794. 265. Sugatani J, Miwa M, Komiyama Y, Ito S. High-density lipoprotein inhibits the synthesis of platelet-activating factor in human vascular endothelial cells. J Lipid Mediat Cell Signal. 1996;13:73-88. 266. Fujimoto Y, Tsunomori M, Muta E, Yamamoto T, Nishida H, Sakuma S, Fujita T. High density lipoprotein inhibits platelet 12-lipoxygenase activity. Res Commun Moi Pathol Pharmacol. 1994;85:355-358. 267. Chen LY, Mehta JL. Inhibitory effect of high-density lipoprotein on platelet function is mediated by increase in nitric oxide synthase activity in platelets. Life Sci. 1994;55:1815-1821. 268. Grgurevich S, Krishnan R, White MM, Jennings LK. Role of in vitro cholesterol depletion in mediating human platelet aggregation. J Thromb Haemost. 2003; 1:576-586. 269. Barlage S, Boettcher D, Boettcher A, Dada A, Schmitz G. High density lipoprotein modulates platelet function. Cytometry A. 2006;69:196-199. 270. Clark LT. Treating dyslipidemia with statins: the risk-benefit profile. Am Heart J. 2003;145:387-396. 271. Meuwese MC, Franssen R, Stroes ES, Kastelein JJ. And then there were acyl coenzyme A:cholesterol acyl transferase inhibitors. Curr Opin Lipidol. 2006;17:426-430. 272. Miyazaki A, Sakashita N, Lee O, Takahashi K, Horiuchi S, Hakamata H, Morganelli PM, Chang CC, Chang TY. Expression of ACAT-1 protein in human atherosclerotic lesions and cultured human monocytes-macrophages. Arterioscler Thromb Vase Biol. 1998;18:1568-1574. 99 273. Ishii I, Yokoyama N, Yanagimachi M, Ashikawa N, Hata M, Murakami S, Asami Y, Morisaki N, Saito Y, Ohmori S, Kitada M. Stimulation of cholesterol release from rabbit foam cells by the action of a new inhibitor for acyl Co A: cholesterol acyltransferase (ACAT), HL-004. J Pharmacol Exp Ther. 1998;287:115-121. 274. Asami Y, Yamagishi I, Murakami S, Araki H, Tsuchida K, Higuchi S. HL-004, the ACAT inhibitor, prevents the progression of atherosclerosis in cholesterol-fed rabbits. Life Sci. 1998;62:1055-1063. 275. Nicolosi RJ, Wilson TA, Krause BR. The ACAT inhibitor, CI-1011 is effective in the prevention and regression of aortic fatty streak area in hamsters. Atherosclerosis. 1998;137:77-85. 276. Zhao B, Song J, St Clair R, Ghosh S. Stable Over-Expression of Human Macrophage Cholesteryl Ester Hydrolase (CEH) Results in Enhanced Free Cholesterol Efflux from Human THP1 -macrophages. Am J Physiol Cell Physiol. 2006. 277. Ghosh S, St Clair RW, Rudel LL. Mobilization of cytoplasmic CE droplets by overexpression of human macrophage cholesteryl ester hydrolase. J Lipid Res. 2003;44:1833-1840. 278. Escary JL, Choy HA, Reue K, Schotz MC. Hormone-sensitive lipase overexpression increases cholesteryl ester hydrolysis in macrophage foam cells. Arterioscler Thromb Vase Biol. 1998;18:991-998. 279. Chang TY, Chang CC, Ohgami N, Yamauchi Y. Cholesterol Sensing, Trafficking, and Esterification. Annu Rev Cell Dev Biol. 2006;22:129-157. 280. Uittenbogaard A, Ying Y, Smart EJ. Characterization of a cytosolic heat-shock protein-caveolin chaperone complex. Involvement in cholesterol trafficking. J Biol Chem. 1998;273:6525-6532. 281. Chang TY, Reid PC, Sugii S, Ohgami N, Cruz JC, Chang CC. Niemann-Pick type C disease and intracellular cholesterol trafficking. J Biol Chem. 2005;280:20917-20920. 282. Wojtanik KM, Liscum L. The transport of low density lipoprotein-derived cholesterol to the plasma membrane is defective in NPC1 cells. J Biol Chem. 2003;278:14850-14856. 283. Shamburek RD, Pentchev PG, Zech LA, Blanchette-Mackie J, Carstea ED, VandenBroek JM, Cooper PS, Neufeld EB, Phair RD, Brewer HB, Jr., Brady RO, Schwartz CC. Intracellular trafficking of the free cholesterol derived from LDL cholesteryl ester is defective in vivo in Niemann-Pick C disease: insights on normal metabolism of HDL and LDL gained from the NP-C mutation. J Lipid Res. 1997;38:2422-2435. 284. van Amerongen A, Demel RA, Westerman J, Wirtz KW. Transfer of cholesterol and oxysterol derivatives by the nonspecific lipid transfer protein (sterol carrier protein 2): a study on its mode of action. Biochim Biophys Acta. 1989;1004:36-43. 100 285. Pike LJ, Casey L. Localization and turnover of phosphatidylinositol 4,5-bisphosphate in caveolin-enriched membrane domains. JBiol Chem. 1996;271:26453-26456. 286. Murata M, Peranen J, Schreiner R, Wieland F, Kurzchalia TV, Simons K. VIP21/caveolin is a cholesterol-binding protein. Proc Natl Acad Sci USA. 1995;92:10339-10343. 287. Parat MO, Fox PL. Palmitoylation of caveolin-1 in endothelial cells is post-translational but irreversible. JBiol Chem. 2001;276:15776-15782. 288. Kurzchalia TV, Parton RG. And still they are moving.... dynamic properties of caveolae. FEBSLett. 1996;389:52-54. 289. Schwencke C, Braun-Dullaeus RC, Wunderlich C, Strasser RH. Caveolae and caveolin in transmembrane signaling: Implications for human disease. Cardiovasc Res. 2006;70:42-49. 290. Fu Y, Hoang A, Escher G, Parton RG, Krozowski Z, Sviridov D. Expression of caveolin-1 enhances cholesterol efflux in hepatic cells. J Biol Chem. 2004;279:14140-14146. 291. Simons K, Ikonen E. Functional rafts in cell membranes. Nature. 1997;387:569-572. 292. Haynes MP, Phillips MC, Rothblat GH. Efflux of cholesterol from different cellular pools. Biochemistry. 2000;39:4508-4517. 293. Duong M, Collins HL, Jin W, Zanotti I, Favari E, Rothblat GH. Relative contributions of ABCA1 and SR-BI to cholesterol efflux to serum from fibroblasts and macrophages. Arterioscler Thromb Vase Biol. 2006;26:541-547. 294. Yancey PG, Rodrigueza WV, Kilsdonk EP, Stoudt GW, Johnson WJ, Phillips MC, Rothblat GH. Cellular cholesterol efflux mediated by cyclodextrins. Demonstration Of kinetic pools and mechanism of efflux. J Biol Chem. 1996;271:16026-16034. 295. Zhao Y, Marcel YL. Serum albumin is a significant intermediate in cholesterol transfer between cells and lipoproteins. Biochemistry. 1996;35:7174-7180. 296. Phillips MC, Gillotte KL, Haynes MP, Johnson WJ, Lund-Katz S, Rothblat GH. Mechanisms of high density lipoprotein-mediated efflux of cholesterol from cell plasma membranes. Atherosclerosis. 1998;137 Suppl:S13-17. 297. Pasenkiewicz-Gierula M, Rog T, Kitamura K, Kusumi A. Cholesterol effects on the phosphatidylcholine bilayer polar region: a molecular simulation study. Biophys J. 2000;78:1376-1389. 298. Hara S, Shike T, Takasu N, Mizui T. Lysophosphatidylcholine promotes cholesterol efflux from mouse macrophage foam cells. Arterioscler Thromb Vase Biol. 1997;17:1258-1266. 101 299. Rosenblat M, Vaya J, Shih D, Aviram M. Paraoxonase 1 (PON1) enhances HDL-mediated macrophage cholesterol efflux via the ABCA1 transporter in association with increased HDL binding to the cells: a possible role for lysophosphatidylcholine. Atherosclerosis. 2005; 179:69-77. 300. Ito J, Nagayasu Y, Yokoyama S. Cholesterol-sphingomyelin interaction in membrane and apolipoprotein-mediated cellular cholesterol efflux. J Lipid Res. 2000;41:894-904. 301. McMullen TP, McElhaney RN. Differential scanning calorimetric studies of the interaction of cholesterol with distearoyl and dielaidoyl molecular species of phosphatidylcholine, phosphatidylethanolamine, and phosphatidylserine. Biochemistry. 1997;36:4979-4986. 302. Ji Y, Jian B, Wang N, Sun Y, Moya ML, Phillips MC, Rothblat GH, Swaney JB, Tall AR. Scavenger receptor BI promotes high density lipoprotein-mediated cellular cholesterol efflux. JBiol Chem. 1997;272:20982-20985. 303. Gu X, Kozarsky K, Krieger M. Scavenger receptor class B, type I-mediated [3H]cholesterol efflux to high and low density lipoproteins is dependent on lipoprotein binding to the receptor. JBiol Chem. 2000;275:29993-30001. 304. Liu T, Krieger M, Kan HY, Zannis VI. The effects of mutations in helices 4 and 6 of ApoA-I on scavenger receptor class B type I (SR-BI)-mediated cholesterol efflux suggest that formation of a productive complex between reconstituted high density lipoprotein and SR-BI is required for efficient lipid transport. J Biol Chem. 2002;277:21576-21584. 305. Tancevski I, Frank S, Massoner P, Stanzl U, Schgoer W, Wehinger A, Fievet C, Eller P, Patsch JR, Ritsch A. Increased plasma levels of LDL cholesterol in rabbits after adenoviral overexpression of human scavenger receptor class B type I. JMol Med. 2005;83:927-932. 306. Chroni A, Nieland TJ, Kypreos KE, Krieger M, Zannis VI. SR-BI mediates cholesterol efflux via its interactions with lipid-bound ApoE. Structural mutations in SR-BI diminish cholesterol efflux. Biochemistry. 2005;44:13132-13143. 307. Connelly MA, de la Llera-Moya M, Monzo P, Yancey PG, Drazul D, Stoudt G, Fournier N, Klein SM, Rothblat GH, Williams DL. Analysis of chimeric receptors shows that multiple distinct functional activities of scavenger receptor, class B, type I (SR-BI), are localized to the extracellular receptor domain. Biochemistry. 2001;40:5249-5259. 308. Thuahnai ST, Lund-Katz S, Dhanasekaran P, de la Llera-Moya M, Connelly MA, Williams DL, Rothblat GH, Phillips MC. Scavenger receptor class B type I-mediated cholesteryl ester-selective uptake and efflux of unesterified cholesterol. Influence of high density lipoprotein size and structure. JBiol Chem. 2004;279:12448-12455. 309. Jian B, de la Llera-Moya M, Royer L, Rothblat G, Francone O, Swaney JB. Modification of the cholesterol efflux properties of human serum by enrichment with phospholipid. J LipidRes. 1997;38:734-744. 102 310. Yancey PG, de la Llera-Moya M, Swarnakar S, Monzo P, Klein SM, Connelly MA, Johnson WJ, Williams DL, Rothblat GH. High density lipoprotein phospholipid composition is a major determinant of the bi-directional flux and net movement of cellular free cholesterol mediated by scavenger receptor BI. J Biol Chem. 2000;275:36596-36604. 311. de Beer FC, Connell PM, Yu J, de Beer MC, Webb NR, van der Westhuyzen DR. HDL modification by secretory phospholipase A(2) promotes scavenger receptor class B type I interaction and accelerates HDL catabolism. J Lipid Res. 2000;41:1849-1857. 312. Gauster M, Oskolkova OV, Innerlohinger J, Glatter O, Knipping G, Frank S. Endothelial lipase-modified high-density lipoprotein exhibits diminished ability to mediate SR-BI (scavenger receptor B type Independent free-cholesterol efflux. Biochem J. 2004;382:75-82. 313. de La Llera-Moya M, Connelly MA, Drazul D, Klein SM, Favari E, Yancey PG, Williams DL, Rothblat GH. Scavenger receptor class B type I affects cholesterol homeostasis by magnifying cholesterol flux between cells and HDL. J Lipid Res. 2001;42:1969-1978. 314. Temel RE, Trigatti B, DeMattos RB, Azhar S, Krieger M, Williams DL. Scavenger receptor class B, type I (SR-BI) is the major route for the delivery of high density lipoprotein cholesterol to the steroidogenic pathway in cultured mouse adrenocortical cells. Proc Natl Acad Sci USA. 1997;94:13600-13605. 315. Fluiter K, Sattler W, De Beer MC, Connell PM, van der Westhuyzen DR, van Berkel TJ. Scavenger receptor BI mediates the selective uptake of oxidized cholesterol esters by rat liver. JBiol Chem. 1999;274:8893-8899. 316. Ji Y, Wang N, Ramakrishnan R, Sehayek E, Huszar D, Breslow JL, Tall AR. Hepatic scavenger receptor BI promotes rapid clearance of high density lipoprotein free cholesterol and its transport into bile. JBiol Chem. 1999;274:33398-33402. 317. Kellner-Weibel G, de La Llera-Moya M, Connelly MA, Stoudt G, Christian AE, Haynes MP, Williams DL, Rothblat GH. Expression of scavenger receptor BI in COS-7 cells alters cholesterol content and distribution. Biochemistry. 2000;39:221-229. 318. Babitt J, Trigatti B, Rigotti A, Smart EJ, Anderson RG, Xu S, Krieger M. Murine SR-BI, a high density lipoprotein receptor that mediates selective lipid uptake, is N-glycosylated and fatty acylated and colocalizes with plasma membrane caveolae. JBiol Chem. 1997;272:13242-13249. 319. Frank PG, Marcel YL, Connelly MA, Lublin DM, Franklin V, Williams DL, Lisanti MP. Stabilization of caveolin-1 by cellular cholesterol and scavenger receptor class B type I. Biochemistry. 2002;41:11931 -11940. 320. Smart EJ, Ying Y, Donzell WC, Anderson RG. A role for caveolin in transport of cholesterol from endoplasmic reticulum to plasma membrane. J Biol Chem. 1996;271:29427-29435. 103 321. Frank PG, Galbiati F, Volonte D, Razani B, Cohen DE, Marcel YL, Lisanti MP. Influence of caveolin-1 on cellular cholesterol efflux mediated by high-density lipoproteins. Am J Physiol Cell Physiol. 2001;280:C1204-1214. 322. Arakawa R, Abe-Dohmae S, Asai M, Ito JI, Yokoyama S. Involvement of caveolin-1 in cholesterol enrichment of high density lipoprotein during its assembly by apolipoprotein and THP-1 cells. J Lipid Res. 2000;41:1952-1962. 323. Dean M, Annilo T. Evolution of the ATP-binding cassette (ABC) transporter superfamily in vertebrates. Annu Rev Genomics Hum Genet. 2005;6:123-142. 324. Brooks-Wilson A, Marcil M, Clee SM, Zhang LH, Roomp K, van Dam M, Yu L, Brewer C, Collins JA, Molhuizen HO, Loubser O, Ouelette BF, Fichter K, Ashbourne-Excoffon KJ, Sensen CW, Scherer S, Mott S, Denis M, Martindale D, Frohlich J, Morgan K, Koop B, Pimstone S, Kastelein JJ, Genest J, Jr., Hayden MR. Mutations in ABC1 in Tangier disease and familial high-density lipoprotein deficiency. Nat Genet. 1999;22:336-345. 325. Lawn RM, Wade DP, Garvin MR, Wang X, Schwartz K, Porter JG, Seilhamer JJ, Vaughan AM, Oram JF. The Tangier disease gene product ABC1 controls the cellular apolipoprotein-mediated lipid removal pathway. J Clin Invest. 1999; 104:R25-31. 326. Marcil M, Brooks-Wilson A, Clee SM, Roomp K, Zhang LH, Yu L, Collins JA, van Dam M, Molhuizen HO, Loubster O, Ouellette BF, Sensen CW, Fichter K, Mott S, Denis M, Boucher B, Pimstone S, Genest J, Jr., Kastelein JJ, Hayden MR. Mutations in the ABC1 gene in familial HDL deficiency with defective cholesterol efflux. Lancet. 1999;354:1341-1346. 327. Denis M, Haidar B, Marcil M, Bouvier M, Krimbou L, Genest J, Jr. Molecular and cellular physiology of apolipoprotein A-I lipidation by the ATP-binding cassette transporter A l (ABCAl). JBiol Chem. 2004;279:7384-7394. 328. Liu L, Bortnick AE, Nickel M, Dhanasekaran P, Subbaiah PV, Lund-Katz S, Rothblat GH, Phillips MC. Effects of apolipoprotein A-I on ATP-binding cassette transporter A l -mediated efflux of macrophage phospholipid and cholesterol: formation of nascent high density lipoprotein particles. JBiol Chem. 2003;278:42976-42984. 329. Wang N, Silver DL, Costet P, Tall AR. Specific binding of ApoA-I, enhanced cholesterol efflux, and altered plasma membrane morphology in cells expressing ABC 1. JBiol Chem. 2000;275:33053-33058. 330. Natarajan P, Forte TM, Chu B, Phillips MC, Oram JF, Bielicki JK. Identification of an apolipoprotein A-I structural element that mediates cellular cholesterol efflux and stabilizes ATP binding cassette transporter A l . JBiol Chem. 2004;279:24044-24052. 331. Remaley AT, Stonik JA, Demosky SJ, Neufeld EB, Bocharov AV, Vishnyakova TG, Eggerman TL, Patterson AP, Duverger NJ, Santamarina-Fojo S, Brewer HB, Jr. Apolipoprotein specificity for lipid efflux by the human ABCAI transporter. Biochem Biophys Res Commun. 2001;280:818-823. 104 332. Remaley AT, Thomas F, Stonik JA, Demosky SJ, Bark SE, Neufeld EB, Bocharov AV, Vishnyakova TG, Patterson AP, Eggerman TL, Santamarina-Fojo S, Brewer HB. Synthetic amphipathic helical peptides promote lipid efflux from cells by an ABCA1-dependent and an ABCA1-independent pathway. J Lipid Res. 2003;44:828-836. 333. Shao B, Bergt C, Fu X, Green P, Voss JC, Oda MN, Oram JF, Heinecke JW. Tyrosine 192 in apolipoprotein A-I is the major site of nitration and chlorination by myeloperoxidase, but only chlorination markedly impairs ABCA1-dependent cholesterol transport. JBiol Chem. 2005;280:5983-5993. 334. Bergt C, Pennathur S, Fu X, Byun J, O'Brien K, McDonald TO, Singh P, Anantharamaiah GM, Chait A, Brunzell J, Geary RL, Oram JF, Heinecke JW. The myeloperoxidase product hypochlorous acid oxidizes HDL in the human artery wall and impairs ABCA1-dependent cholesterol transport. Proc Natl Acad Sci USA. 2004;101:13032-13037. 335. Fitzgerald ML, Okuhira K, Short GF, 3rd, Manning JJ, Bell SA, Freeman MW. ATP-binding cassette transporter A l contains a novel C-terminal VFVNFA motif that is required for its cholesterol efflux and ApoA-I binding activities. JBiol Chem. 2004;279:48477-48485. 336. Krimbou L, Denis M, Haidar B, Carrier M, Marcil M, Genest J, Jr. Molecular interactions between apoE and ABCA1: impact on apoE lipidation. J Lipid Res. 2004;45:839-848. 337. Oram JF, Lawn RM. ABCA1. The gatekeeper for eliminating excess tissue cholesterol. J Lipid Res. 2001;42:1173-1179. 338. Yancey PG, Bortnick AE, Kellner-Weibel G, de la Llera-Moya M, Phillips MC, Rothblat GH. Importance of different pathways of cellular cholesterol efflux. Arterioscler Thromb Vase Biol. 2003;23:712-719. 339. Fielding PE, Nagao K, Hakamata H, Chimini G, Fielding CJ. A two-step mechanism for free cholesterol and phospholipid efflux from human vascular cells to apolipoprotein A-1. Biochemistry. 2000;39:14113-14120. 340. Saito H, Dhanasekaran P, Nguyen D, Holvoet P, Lund-Katz S, Phillips MC. Domain structure and lipid interaction in human apolipoproteins A-I and E, a general model. J Biol Chem. 2003;278:23227-23232. 341. Zheng H, Kiss RS, Franklin V, Wang MD, Haidar B, Marcel YL. ApoA-I lipidation in primary mouse hepatocytes. Separate controls for phospholipid and cholesterol transfers. JBiol Chem. 2005;280:21612-21621. 342. Mendez AJ, Lin G, Wade DP, Lawn RM, Oram JF. Membrane lipid domains distinct from cholesterol/sphingomyelin-rich rafts are involved in the ABCA1-mediated lipid secretory pathway. JBiol Chem. 2001;276:3158-3166. 105 343. Abe-Dohmae S, Ikeda Y, Matsuo M, Hayashi M, Okuhira K, Ueda K, Yokoyama S. Human ABCA7 supports apolipoprotein-mediated release of cellular cholesterol and phospholipid to generate high density lipoprotein. J Biol Chem. 2004;279:604-611. 344. Hayashi M, Abe-Dohmae S, Okazaki M, Ueda K, Yokoyama S. Heterogeneity of high density lipoprotein generated by ABCA1 and ABCA7. J Lipid Res. 2005;46:1703-1711. 345. Linsel-Nitschke P, Jehle AW, Shan J, Cao G, Bacic D, Lan D, Wang N, Tall AR. Potential role of ABCA7 in cellular lipid efflux to apoA-I. J Lipid Res. 2005;46:86-92. 346. Wang N, Lan D, Gerbod-Giannone M, Linsel-Nitschke P, Jehle AW, Chen W, Martinez LO, Tall AR. ATP-binding cassette transporter A7 (ABCA7) binds apolipoprotein A-I and mediates cellular phospholipid but not cholesterol efflux. J Biol Chem. 2003;278:42906-42912. 347. Kaminski WE, Piehler A, Pullmann K, Porsch-Ozcurumez M, Duong C, Bared GM, Buchler C, Schmitz G. Complete coding sequence, promoter region, and genomic structure of the human ABCA2 gene and evidence for sterol-dependent regulation in macrophages. Biochem Biophys Res Commun. 2001;281:249-258. 348. Schmitz G, Kaminski WE. ABCA2: a candidate regulator of neural transmembrane lipid transport. Cell Mol Life Sci. 2002;59:1285-1295. 349. Davis W, Jr., Boyd JT, He KE, Tew KD. Human ATP-binding cassette transporter-2 (ABCA2) positively regulates low-density lipoprotein receptor expression and negatively regulates cholesterol esterification in Chinese hamster ovary cells. Biochim Biophys Acta. 2004;1683:89-100. 350. Nagata K, Yamamoto A, Ban N, Tanaka AR, Matsuo M, Kioka N, Inagaki N, Ueda K. Human ABC A3, a product of a responsible gene for abca3 for fatal surfactant deficiency in newborns, exhibits unique ATP hydrolysis activity and generates intracellular multilamellar vesicles. Biochem Biophys Res Commun. 2004;324:262-268. 351. Cheong N, Madesh M, Gonzales LW, Zhao M, Yu K, Ballard PL, Shuman H. Functional and trafficking defects in ATP binding cassette A3 mutants associated with respiratory distress syndrome. JBiol Chem. 2006;281:9791-9800. 352. Schmitz G, Langmann T, Heimerl S. Role of ABCG1 and other ABCG family members in lipid metabolism. J Lipid Res. 2001;42:1513-1520. 353. Klucken J, Buchler C, Orso E, Kaminski WE, Porsch-Ozcurumez M, Liebisch G, Kapinsky M, Diederich W, Drobnik W, Dean M, Allikmets R, Schmitz G. ABCG1 (ABC8), the human homolog of the Drosophila white gene, is a regulator of macrophage cholesterol and phospholipid transport. Proc Natl Acad Sci USA. 2000;97:817-822. 354. Karten B, Campenot RB, Vance DE, Vance JE. Expression of ABCG1, but not ABCA1, correlates with cholesterol release by cerebellar astroglia. JBiol Chem. 2006;281:4049-4057. 106 355. Wang N, Lan D, Chen W, Matsuura F, Tall AR. ATP-binding cassette transporters Gl and G4 mediate cellular cholesterol efflux to high-density lipoproteins. Proc Natl Acad Sci USA. 2004;101:9774-9779. 356. Duan LP, Wang HH, Ohashi A, Wang DQ. Role of intestinal sterol transporters Abcg5, Abcg8, and Npclll in cholesterol absorption in mice: gender and age effects. Am J Physiol Gastrointest Liver Physiol. 2006;290:G269-276. 357. Gelissen IC, Harris M, Rye KA, Quinn C, Brown AJ, Kockx M, Cartland S, Packianathan M, Kritharides L, Jessup W. ABCA1 and ABCG1 synergize to mediate cholesterol export to apoA-I. Arterioscler Thromb Vase Biol. 2006;26:534-540. 358. Huang ZH, Fitzgerald ML, Mazzone T. Distinct cellular loci for the ABCA1-dependent and ABCA1-independent lipid efflux mediated by endogenous apolipoprotein E expression. Arterioscler Thromb Vase Biol. 2006;26:157-162. 359. Hirsch-Reinshagen V, Zhou S, Burgess BL, Bernier L, Mclsaac SA, Chan JY, Tansley GH, Cohn JS, Hayden MR, Wellington CL. Deficiency of ABCA1 impairs apolipoprotein E metabolism in brain. J Biol Chem. 2004;279:41197-41207. 360. Huang ZH, Lin CY, Oram JF, Mazzone T. Sterol efflux mediated by endogenous macrophage ApoE expression is independent of ABCA1. Arterioscler Thromb Vase Biol. 2001;21:2019-2025. 361. Hasty AH, Plummer MR, Weisgraber KH, Linton MF, Fazio S, Swift LL. The recycling of apolipoprotein E in macrophages: influence of HDL and apolipoprotein A-I. J Lipid Res. 2005;46:1433-1439. 362. Francone OL, Haghpassand M, Bennett JA, Royer L, McNeish J. Expression of human lecithin.xholesterol acyltransferase in transgenic mice: effects on cholesterol efflux, esterification, and transport. J Lipid Res. 1997;38:813-822. 363. Atger V, de la Llera Moya M, Bamberger M, Francone O, Cosgrove P, Tall A, Walsh A, Moatti N, Rothblat G. Cholesterol efflux potential of sera from mice expressing human cholesteryl ester transfer protein and/or human apolipoprotein AI. J Clin Invest. 1995;96:2613-2622. 364. Matsuura F, Wang N, Chen W, Jiang XC, Tall AR. HDL from CETP-deficient subjects shows enhanced ability to promote cholesterol efflux from macrophages in an apoE- and ABCG1-dependent pathway. J Clin Invest. 2006;116:1435-1442. 365. Lee-Rueckert M, Vikstedt R, Metso J, Ehnholm C, Kovanen PT, Jauhiainen M. Absence of endogenous phospholipid transfer protein impairs ABCA1-dependent efflux of cholesterol from macrophage foam cells. J Lipid Res. 2006;47:1725-1732. 366. Settasatian N, Duong M, Curtiss LK, Ehnholm C, Jauhiainen M, Huuskonen J, Rye KA. The mechanism of the remodeling of high density lipoproteins by phospholipid transfer protein. JBiol Chem. 2001;276:26898-26905. 107 367. Oram JF, Wolfbauer G, Vaughan AM, Tang C, Albers JJ. Phospholipid transfer protein interacts with and stabilizes ATP-binding cassette transporter A l and enhances cholesterol efflux from cells. JBiol Chem. 2003;278:52379-52385. 368. Kinoshita M, Fujita M, Usui S, Maeda Y, Kudo M, Hirota D, Suda T, Taki M, Okazaki M, Teramoto T. Scavenger receptor type BI potentiates reverse cholesterol transport system by removing cholesterol ester from HDL. Atherosclerosis. 2004;173:197-202. 369. Schwartz CC, VandenBroek JM, Cooper PS. Lipoprotein cholesteryl ester production, transfer, and output in vivo in humans. J Lipid Res. 2004;45:1594-1607. 370. Strautnieks SS, Bull LN, Knisely AS, Kocoshis SA, Dahl N, Arnell H, Sokal E, Dahan K, Childs S, Ling V, Tanner MS, Kagalwalla AF, Nemeth A, Pawlowska J, Baker A, Mieli-Vergani G, Freimer NB, Gardiner RM, Thompson RJ. A gene encoding a liver-specific ABC transporter is mutated in progressive familial intrahepatic cholestasis. Nat Genet. 1998;20:233-238. 371. de Vree JM, Jacquemin E, Sturm E, Cresteil D, Bosma PJ, Aten J, Deleuze JF, Desrochers M, Burdelski M, Bernard O, Oude Elferink RP, Hadchouel M. Mutations in the MDR3 gene cause progressive familial intrahepatic cholestasis. Proc Natl Acad Sci USA. 1998;95:282-287. 372. Smit JJ, Schinkel AH, Oude Elferink RP, Groen AK, Wagenaar E, van Deemter L, Moi CA, Ottenhoff R, van der Lugt NM, van Roon MA, et al. Homozygous disruption of the murine mdr2 P-glycoprotein gene leads to a complete absence of phospholipid from bile and to liver disease. Cell. 1993;75:451-462. 373. Oude Elferink RP, Ottenhoff R, van Wijland M, Frijters CM, van Nieuwkerk C, Groen AK. Uncoupling of biliary phospholipid and cholesterol secretion in mice with reduced expression of mdr2 P-glycoprotein. J Lipid Res. 1996;37:1065-1075. 374. Henkel A, Wei Z, Cohen DE, Green RM. Mice overexpressing hepatic Abcbl 1 rapidly develop cholesterol gallstones. Mamm Genome. 2005;16:903-908. 375. Berge KE, Tian H, Graf GA, Yu L, Grishin NV, Schultz J, Kwiterovich P, Shan B, Barnes R, Hobbs HH. Accumulation of dietary cholesterol in sitosterolemia caused by mutations in adjacent ABC transporters. Science. 2000;290:1771-1775. 376. Yu L, Li-Hawkins J, Hammer RE, Berge KE, Horton JD, Cohen JC, Hobbs HH. Overexpression of ABCG5 and ABCG8 promotes biliary cholesterol secretion and reduces fractional absorption of dietary cholesterol. J Clin Invest. 2002; 110:671-680. 377. Kosters A, Kunne C, Looije N, Patel SB, Oude Elferink RP, Groen AK. The mechanism of ABCG5/ABCG8 in biliary cholesterol secretion in mice. J Lipid Res. 2006;47:1959-1966. 378. Kobayashi A, Takanezawa Y, Hirata T, Shimizu Y, Misasa K, Kioka N, Arai H, Ueda K, Matsuo M. Efflux of sphingomyelin, cholesterol, and phosphatidylcholine by ABCG1. J LipidRes. 2006;47:1791-1802. 108 379. de Caro J, Boudouard M, Bonicel J, Guidoni A, Desnuelle P, Rovery M. Porcine pancreatic lipase. Completion of the primary structure. Biochim Biophys Acta. 1981;671:129-138. 380. Ben-Avram CM, Ben-Zeev O, Lee TD, Haaga K, Shively JE, Goers J, Pedersen ME, Reeve JR, Jr., Schotz MC. Homology of lipoprotein lipase to pancreatic lipase. Proc Natl Acad Sci USA. 1986;83:4185-4189. 381. Kirchgessner TG, Svenson KL, Lusis AJ, Schotz MC. The sequence of cDNA encoding lipoprotein lipase. A member of a lipase gene family. JBiol Chem. 1987;262:8463-8466. 382. Deeb SS, Peng RL. Structure of the human lipoprotein lipase gene. Biochemistry. 1989;28:4131-4135. 383. Cai SJ, Wong DM, Chen SH, Chan L. Structure of the human hepatic triglyceride lipase gene. Biochemistry. 1989;28:8966-8971. 384. Lowe ME, Rosenblum JL, Strauss AW. Cloning and characterization of human pancreatic lipase cDNA. JBiol Chem. 1989;264:20042-20048. 385. Jaye M, Lynch KJ, Krawiec J, Marchadier D, Maugeais C, Doan K, South V, Amin D, Perrone M, Rader DJ. A novel endothelial-derived lipase that modulates HDL metabolism. Nat Genet. 1999;21:424-428. 386. Hirata K, Dichek HL, Cioffi JA, Choi SY, Leeper NJ, Quintana L, Kronmal GS, Cooper AD, Quertermous T. Cloning of a unique lipase from endothelial cells extends the lipase gene family. JBiol Chem. 1999;274:14170-14175. 387. Roussel A, Yang Y, Ferrato F, Verger R, Cambillau C, Lowe M. Structure and activity of rat pancreatic lipase-related protein 2. J Biol Chem. 1998;273:32121-32128. 388. Crenon I, Foglizzo E, Kerfelec B, Verine A, Pignol D, Hermoso J, Bonicel J, Chapus C. Pancreatic lipase-related protein type I: a specialized lipase or an inactive enzyme. Protein Eng. 1998;11:135-142. 389. Crenon I, Jayne S, Kerfelec B, Hermoso J, Pignol D, Chapus C. Pancreatic lipase-related protein type 1: a double mutation restores a significant lipase activity. Biochem Biophys ResCommun. 1998;246:513-517. 390. Oka K, Tkalcevic GT, Nakano T, Tucker H, Ishimura-Oka K, Brown WV. Structure and polymorphic map of human lipoprotein lipase gene. Biochim Biophys Acta. 1990;1049:21-26. 391. Kirchgessner TG, Chuat JC, Heinzmann C, Etienne J, Guilhot S, Svenson K, Ameis D, Pilon C, d'Auriol L, Andalibi A, et al. Organization of the human lipoprotein lipase gene and evolution of the lipase gene family. Proc Natl Acad Sci USA. 1989;86:9647-9651. 392. Mead JR, Irvine SA, Ramji DP. Lipoprotein lipase: structure, function, regulation, and role in disease. J Moi Med. 2002;80:753-769. 109 393. Wion KL, Kirchgessner TG, Lusis AJ, Schotz MC, Lawn RM. Human lipoprotein lipase complementary DNA sequence. Science. 1987;235:1638-1641. 394. Ong JM, Kern PA. The role of glucose and glycosylation in the regulation of lipoprotein lipase synthesis and secretion in rat adipocytes. JBiol Chem. 1989;264:3177-3182. 395. Semenkovich CF, Luo CC, Nakanishi MK, Chen SH, Smith LC, Chan L. In vitro expression and site-specific mutagenesis of the cloned human lipoprotein lipase gene. Potential N-linked glycosylation site asparagine 43 is important for both enzyme activity and secretion. JBiol Chem. 1990;265:5429-5433. 396. Ben-Zeev O, Stahnke G, Liu G, Davis RC, Doolittle MH. Lipoprotein lipase and hepatic lipase: the role of asparagine-linked glycosylation in the expression of a functional enzyme. J Lipid Res. 1994;35:1511-1523. 397. Park JW, Oh MS, Yang JY, Park BH, Rho HW, Lim SN, Jhee EC, Kim HR. Glycosylation, dimerization, and heparin affinity of lipoprotein lipase in 3T3-L1 adipocytes. Biochim Biophys Acta. 1995;1254:45-50. 398. Semb H, Olivecrona T. The relation between glycosylation and activity of guinea pig lipoprotein lipase. JBiol Chem. 1989;264:4195-4200. 399. Braun JE, Severson DL. Regulation of the synthesis, processing and translocation of lipoprotein lipase. Biochem J. 1992;287 ( Pt 2):337-347. 400. Carroll R, Ben-Zeev O, Doolittle MH, Severson DL. Activation of lipoprotein lipase in cardiac myocytes by glycosylation requires trimming of glucose residues in the endoplasmic reticulum. Biochem J. 1992;285 ( Pt 3):693-696. 401. Winkler FK, D'Arcy A, Hunziker W. Structure of human pancreatic lipase. Nature. 1990;343:771-774. 402. van Tilbeurgh H, Roussel A, Lalouel JM, Cambillau C. Lipoprotein lipase. Molecular model based on the pancreatic lipase x-ray structure: consequences for heparin binding and catalysis. JBiol Chem. 1994;269:4626-4633. 403. Osborne JC, Jr., Bengtsson-Olivecrona G, Lee NS, Olivecrona T. Studies on inactivation of lipoprotein lipase: role of the dimer to monomer dissociation. Biochemistry. 1985;24:5606-5611. 404. Zhang L, Lookene A, Wu G, Olivecrona G. Calcium triggers folding of lipoprotein lipase into active dimers. JBiol Chem. 2005;280:42580-42591. 405. Hata A, Ridinger DN, Sutherland S, Emi M, Shuhua Z, Myers RL, Ren K, Cheng T, Inoue I, Wilson DE, et al. Binding of lipoprotein lipase to heparin. Identification of five critical residues in two distinct segments of the amino-terminal domain. J Biol Chem. 1993;268:8447-8457. 406. Blow D. Enzymology. More of the catalytic triad. Nature. 1990;343:694-695. 110 407. Faustinella F, Chang A, Van Biervliet IP, Rosseneu M, Vinaimont N, Smith LC, Chen SH, Chan L. Catalytic triad residue mutation (Asp 156—Gly) causing familial lipoprotein lipase deficiency. Co-inheritance with a nonsense mutation (Ser447—Ter) in a Turkish family. JBiol Chem. 1991;266:14418-14424. 408. Ma YH, Bruin T, Tuzgol S, Wilson BI, Roederer G, Liu MS, Davignon J, Kastelein JJ, Brunzell JD, Hayden MR. Two naturally occurring mutations at the first and second bases of codon aspartic acid 156 in the proposed catalytic triad of human lipoprotein lipase. In vivo evidence that aspartic acid 156 is essential for catalysis. J Biol Chem. 1992;267:1918-1923. 409. Faustinella F, Smith LC, Semenkovich CF, Chan L. Structural and functional roles of highly conserved serines in human lipoprotein lipase. Evidence that serine 132 is essential for enzyme catalysis. JBiol Chem. 1991;266:9481-9485. 410. Emmerich J, Beg OU, Peterson J, Previato L, Brunzell JD, Brewer HB, Jr., Santamarina-Fojo S. Human lipoprotein lipase. Analysis of the catalytic triad by site-directed mutagenesis of Ser-132, Asp-156, and His-241. JBiol Chem. 1992;267:4161-4165. 411. Bruin T, Kastelein JJ, Van Diermen DE, Ma Y, Henderson HE, Stuyt PM, Stalenhoef AF, Sturk A, Brunzell JD, Hayden MR. A missense mutation Pro 157 Arg in lipoprotein lipase (LPLNijmegen) resulting in loss of catalytic activity. Eur J Biochem. 1992;208:267-272. 412. Busca R, Peinado J, Vilella E, Auwerx J, Deeb SS, Vilaro S, Reina M. The mutant Asn291—>Ser human lipoprotein lipase is associated with reduced catalytic activity and does not influence binding to heparin. FEBSLett. 1995;367:257-262. 413. Dugi KA, Dichek HL, Talley GD, Brewer HB, Jr., Santamarina-Fojo S. Human lipoprotein lipase: the loop covering the catalytic site is essential for interaction with lipid substrates. JBiol Chem. 1992;267:25086-25091. 414. Henderson HE, Ma Y, Liu MS, Clark-Lewis I, Maeder DL, Kastelein JJ, Brunzell JD, Hayden MR. Structure-function relationships of lipoprotein lipase: mutation analysis and mutagenesis of the loop region. J Lipid Res. 1993;34:1593-1602. 415. Dugi KA, Dichek HL, Santamarina-Fojo S. Human hepatic and lipoprotein lipase: the loop covering the catalytic site mediates lipase substrate specificity. J Biol Chem. 1995;270:25396-25401. 416. Griffon N, Budreck EC, Long CJ, Broedl UC, Marchadier DH, Glick JM, Rader DJ. Substrate specificity of lipoprotein lipase and endothelial lipase: studies of lid chimeras. J Lipid Res. 2006;47:1803-1811. 417. Bengtsson G, Olivecrona T. Activation of lipoprotein lipase by apolipoprotein CII. Demonstration of an effect of the activator on the binding of the enzyme to milk-fat globules. FEBS Lett. 1982;147:183-187. I l l 418. Mcllhargey TL, Yang Y, Wong H, Hill JS. Identification of a lipoprotein lipase cofactor-binding site by chemical cross-linking and transfer of apolipoprotein C-II-responsive lipolysis from lipoprotein lipase to hepatic lipase. J Biol Chem. 2003;278:23027-23035. 419. Cheng Q, Blackett P, Jackson KW, McConathy WJ, Wang CS. C-terminal domain of apolipoprotein CII as both activator and competitive inhibitor of lipoprotein lipase. Biochem J. 1990;269:403-407. 420. Shen Y, Lookene A, Nilsson S, Olivecrona G. Functional analyses of human apolipoprotein CII by site-directed mutagenesis: identification of residues important for activation of lipoprotein lipase. JBiol Chem. 2002;277:4334-4342. 421. Lookene A, Bengtsson-Olivecrona G. Chymotryptic cleavage of lipoprotein lipase. Identification of cleavage sites and functional studies of the truncated molecule. Eur J Biochem. 1993;213:185-194. 422. Wong H, Davis RC, Thuren T, Goers JW, Nikazy J, Waite M, Schotz MC. Lipoprotein lipase domain function. JBiol Chem. 1994;269:10319-10323. 423. Nykjaer A, Bengtsson-Olivecrona G, Lookene A, Moestrup SK, Petersen CM, Weber W, Beisiegel U, Gliemann J. The alpha 2-macroglobulin receptor/low density lipoprotein receptor-related protein binds lipoprotein lipase and beta-migrating very low density lipoprotein associated with the lipase. JBiol Chem. 1993;268:15048-15055. 424. Sivaram P, Choi SY, Curtiss LK, Goldberg IJ. An amino-terminal fragment of apolipoprotein B binds to lipoprotein lipase and may facilitate its binding to endothelial cells. JBiol Chem. 1994;269:9409-9412. 425. Choi SY, Sivaram P, Walker DE, Curtiss LK, Gretch DG, Shirley SL, Attie AD, Deckelbaum RJ, Goldberg IJ. Lipoprotein lipase association with lipoproteins involves protein-protein interaction with apolipoprotein B. J Biol Chem. 1995;270:8081-8086. 426. Pang L, Sivaram P, Goldberg IJ. Cell-surface expression of an amino-terminal fragment of apolipoprotein B increases lipoprotein lipase binding to cells. J Biol Chem. 1996;271:19518-19523. 427. Boren J, Lookene A, Makoveichuk E, Xiang S, Gustafsson M, Liu H, Talmud P, Olivecrona G. Binding of low density lipoproteins to lipoprotein lipase is dependent on lipids but not on apolipoprotein B. J Biol Chem. 2001;276:26916-26922. 428. Olivecrona T, Egelrud T, Iverius PH, Lindahl U. Evidence for an ionic binding of lipoprotein lipase to heparin. Biochem Biophys Res Commun. 1971;43:524-529. 429. Saxena U, Klein MG, Goldberg IJ. Identification and characterization of the endothelial cell surface lipoprotein lipase receptor. JBiol Chem. 1991;266:17516-17521. 430. Cardin AD, Weintraub HJ. Molecular modeling of protein-glycosaminoglycan interactions. Arteriosclerosis. 1989;9:21-32. 112 431. Stuckey JA, St Charles R, Edwards BF. A model of the platelet factor 4 complex with heparin. Proteins. 1992;14:277-287. 432. Lookene A, Nielsen MS, Gliemann J, Olivecrona G. Contribution of the carboxy-terminal domain of lipoprotein lipase to interaction with heparin and lipoproteins. Biochem Biophys Res Commun. 2000;271:15-21. 433. Ma Y, Henderson HE, Liu MS, Zhang H, Forsythe IJ, Clarke-Lewis I, Hayden MR, Brunzell JD. Mutagenesis in four candidate heparin binding regions (residues 279-282, 291-304, 390-393, and 439-448) and identification of residues affecting heparin binding of human lipoprotein lipase. J Lipid Res. 1994;35:2049-2059. 434. Berryman DE, Bensadoun A. Site-directed mutagenesis of a putative heparin binding domain of avian lipoprotein lipase. J Biol Chem. 1993;268:3272-3276. 435. Davis RC, Wong H, Nikazy J, Wang K, Han Q, Schotz MC. Chimeras of hepatic lipase and lipoprotein lipase. Domain localization of enzyme-specific properties. J Biol Chem. 1992;267:21499-21504. 436. Sendak RA, Bensadoun A. Identification of a heparin-binding domain in the distal carboxyl-terminal region of lipoprotein lipase by site-directed mutagenesis. J Lipid Res. 1998;39:1310-1315. 437. Kounnas MZ, Chappell DA, Strickland DK, Argraves WS. Glycoprotein 330, a member of the low density lipoprotein receptor family, binds lipoprotein lipase in vitro. J Biol Chem. 1993;268:14176-14181. 438. Chappell DA, Fry GL, Waknitz MA, Iverius PH, Williams SE, Strickland DK. The low density lipoprotein receptor-related protein/alpha 2-macroglobulin receptor binds and mediates catabolism of bovine milk lipoprotein lipase. J Biol Chem. 1992;267:25764-25767. 439. Argraves KM, Battey FD, MacCalman CD, McCrae KR, Gafvels M, Kozarsky KF, Chappell DA, Strauss JF, 3rd, Strickland DK. The very low density lipoprotein receptor mediates the cellular catabolism of lipoprotein lipase and urokinase-plasminogen activator inhibitor type I complexes. JBiol Chem. 1995;270:26550-26557. 440. Williams SE, Inoue I, Tran H, Fry GL, Pladet MW, Iverius PH, Lalouel JM, Chappell DA, Strickland DK. The carboxyl-terminal domain of lipoprotein lipase binds to the low density lipoprotein receptor-related protein/alpha 2-macroglobulin receptor (LRP) and mediates binding of normal very low density lipoproteins to LRP. J Biol Chem. 1994;269:8653-8658. 441. Nykjaer A, Nielsen M, Lookene A, Meyer N, Roigaard H, Etzerodt M, Beisiegel U , Olivecrona G, Gliemann J. A carboxyl-terminal fragment of lipoprotein lipase binds to the low density lipoprotein receptor-related protein and inhibits lipase-mediated uptake of lipoprotein in cells. JBiol Chem. 1994;269:31747-31755. 442. Salinelli S, Lo JY, Mims MP, Zsigmond E, Smith LC, Chan L. Structure-function relationship of lipoprotein lipase-mediated enhancement of very low density lipoprotein 113 binding and catabolism by the low density lipoprotein receptor. Functional importance of a properly folded surface loop covering the catalytic center. JBiol Chem. 1996;271:21906-21913. 443. Nielsen MS, Brejning J, Garcia R, Zhang H, Hayden MR, Vilaro S, Gliemann J. Segments in the C-terminal folding domain of lipoprotein lipase important for binding to the low density lipoprotein receptor-related protein and to heparan sulfate proteoglycans. JBiol Chem. 1997;272:5821-5827. 444. Camps L, Reina M, Llobera M, Vilaro S, Olivecrona T. Lipoprotein lipase: cellular origin and functional distribution. Am J Physiol. 1990;258:C673-681. 445. Yla-Herttuala S, Lipton BA, Rosenfeld ME, Goldberg IJ, Steinberg D, Witztum JL. Macrophages and smooth muscle cells express lipoprotein lipase in human and rabbit atherosclerotic lesions. Proc Natl Acad Sci USA. 1991;88:10143-10147. 446. Okabe T, Yorifuji H, Murase T, Takaku F. Pulmonary macrophage: a major source of lipoprotein lipase in the lung. Biochem Biophys Res Commun. 1984;125:273-278. 447. Babaev VR, Fazio S, Gleaves LA, Carter KJ, Semenkovich CF, Linton MF. Macrophage lipoprotein lipase promotes foam cell formation and atherosclerosis in vivo. J Clin Invest. 1999;103:1697-1705. 448. Margelin D, Pigier AM, Gardette J, Bertrand J, Vu-Dac N, Picard J. Evidence for an interaction of lipoprotein lipase with artery wall proteoglycans. Int J Biochem. 1989;21:761-768. 449. Olin KL, Potter-Perigo S, Barrett PH, Wight TN, Chait A. Lipoprotein lipase enhances the binding of native and oxidized low density lipoproteins to versican and biglycan synthesized by cultured arterial smooth muscle cells. J Biol Chem. 1999;274:34629-34636. 450. Doolittle MH, Ben-Zeev O, Elovson J, Martin D, Kirchgessner TG. The response of lipoprotein lipase to feeding and fasting. Evidence for posttranslational regulation. J Biol Chem. 1990;265:4570-4577. 451. Kern PA, Ong JM, Saffari B, Carty J. The effects of weight loss on the activity and expression of adipose-tissue lipoprotein lipase in very obese humans. N Engl J Med. 1990;322:1053-1059. 452. Carneheim C, Nedergaard J, Cannon B. Cold-induced beta-adrenergic recruitment of lipoprotein lipase in brown fat is due to increased transcription. Am J Physiol. 1988;254:E155-161. 453. Padines-Figueres A, Barcellini-Couget S, Dani C, Vannier C, Ailhaud G. Transcriptional control of the expression of lipoprotein lipase gene by growth hormone in preadipocyte OM771 cells. J Lipid Res. 1990;31:1283-1291. 454. Raynolds MV, Awald PD, Gordon DF, Gutierrez-Hartmann A, Rule DC, Wood WM, Eckel RH. Lipoprotein lipase gene expression in rat adipocytes is regulated by 114 isoproterenol and insulin through different mechanisms. Moi Endocrinol. 1990;4:1416-1422. 455. Ong JM, Saffari B, Simsolo RB, Kern PA. Epinephrine inhibits lipoprotein lipase gene expression in rat adipocytes through multiple steps in posttranscriptional processing. Moi Endocrinol. 1992;6:61-69. 456. Saffari B, Ong JM, Kern PA. Regulation of adipose tissue lipoprotein lipase gene expression by thyroid hormone in rats. J Lipid Res. 1992;33:241-249. 457. Liu L, Severson DL. Regulation of myocardial lipoprotein lipase activity by diabetes and thyroid hormones. Can J Physiol Pharmacol. 1994;72:1259-1264. 458. Ashby P, Robinson DS. Effects of insulin, glucocorticoids and adrenaline on the activity of rat adipose-tissue lipoprotein lipids. Biochem J. 1980;188:185-192. 459. Speake BK, Parkin SM, Robinson DS. Regulation of the synthesis of lipoprotein lipase in adipose tissue by dexamethasone. Biochim Biophys Acta. 1986;881:155-157. 460. Fried SK, Russell CD, Grauso NL, Brolin RE. Lipoprotein lipase regulation by insulin and glucocorticoid in subcutaneous and omental adipose tissues of obese women and men. J Clin Invest. 1993;92:2191-2198. 461. Ewart HS, Carroll R, Severson DL. Lipoprotein lipase activity in rat cardiomyocytes is stimulated by insulin and dexamethasone. Biochem J. 1997;327 (Pt 2):439-442. 462. O'Brien KD, Gordon D, Deeb S, Ferguson M, Chait A. Lipoprotein lipase is synthesized by macrophage-derived foam cells in human coronary atherosclerotic plaques. J Clin Invest. 1992;89:1544-1550. 463. Mori N, Gotoda T, Ishibashi S, Shimano H, Harada K, Inaba T, Takaku F, Yazaki Y, Yamada N. Effects of human recombinant macrophage colony-stimulating factor on the secretion of lipoprotein lipase from macrophages. Arterioscler Thromb. 1991;11:1315-1321. 464. Renier G, Desfaits AC, Lambert A, Mikhail R. Role of oxidant injury on macrophage lipoprotein lipase (LPL) production and sensitivity to LPL. J Lipid Res. 1996;37:799-809. 465. Sartippour MR, Lambert A, Laframboise M, St-Jacques P, Renier G. Stimulatory effect of glucose on macrophage lipoprotein lipase expression and production. Diabetes. 1998;47:431-438. 466. Beauchamp MC, Michaud SE, Li L, Sartippour MR, Renier G. Advanced glycation end products potentiate the stimulatory effect of glucose on macrophage lipoprotein lipase expression. J Lipid Res. 2004;45:1749-1757. 467. Beauchamp MC, Renier G. Homocysteine induces protein kinase C activation and stimulates c-Fos and lipoprotein lipase expression in macrophages. Diabetes. 2002;51:1180-1187. 115 468. Tengku-Muhammad TS, Hughes TR, Cryer A, Ramji DP. Involvement of both the tyrosine kinase and the phosphatidylinositol-3' kinase signal transduction pathways in the regulation of lipoprotein lipase expression in ill A.l macrophages by cytokines and lipopolysaccharide. Cytokine. 1999;11:463-468. 469. Tengku-Muhammad TS, Hughes TR, Cryer A, Ramji DP. Differential regulation of lipoprotein lipase in the macrophage 1114.2 cell line by cytokines. Cytokine. 1996;8:525-533. 470. Querfeld U, Ong JM, Prehn J, Carry J, Saffari B, Jordan SC, Kern PA. Effects of cytokines on the production of lipoprotein lipase in cultured human macrophages. J LipidR.es. 1990;31:1379-1386. 471. Muhammad TS, Hughes TR, Cryer A, Ramji DP. The suppression of lipoprotein lipase expression in J774.2 macrophages by IFN-gamma and TNF-alpha is mediated at the transcriptional level. Biochem Soc Trans. 1998;26:S12. 472. Uchida Y, Ohba K, Ogawa A, Wada K, Yoshioka T, Muraki T. Protein kinase C mediates tumor necrosis factor-alpha-induced inhibition of obese gene expression and leptin secretion in brown adipocytes. Naunyn Schmiedebergs Arch Pharmacol. 1999;360:691-698. 473. Tengku-Muhammad TS, Cryer A, Ramji DP. Synergism between interferon gamma and tumour necrosis factor alpha in the regulation of lipoprotein lipase in the macrophage J774.2 cell line. Cytokine. 1998;10:38-48. 474. Uchida Y, Tsukahara F, Ohba K, Ogawa A, Irie K, Fujii E, Yoshimoto T, Yoshioka T, Muraki T. Nitric oxide mediates down regulation of lipoprotein lipase activity induced by tumor necrosis factor-alpha in brown adipocytes. Eur J Pharmacol. 1997;335:235-243. 475. Jonasson L, Hansson GK, Bondjers G, Noe L, Etienne J. Interferon-gamma inhibits lipoprotein lipase in human monocyte-derived macrophages. Biochim Biophys Acta. 1990;1053:43-48. 476. Sopher O, Goldman R. Bacterial lipopolysaccharide suppresses the expression of lipoprotein lipase in murine macrophages: a process independent of tumor necrosis factor or interleukin 1. Immunol Lett. 1987;15:261-265. 477. White JR, Chait A, Klebanoff SJ, Deeb S, Brunzell JD. Bacterial lipopolysaccharide reduces macrophage lipoprotein lipase levels: an effect that is independent of tumor necrosis factor. J Lipid Res. 1988;29:1379-1385. 478. Gouni I, Oka K, Etienne J, Chan L. Endotoxin-induced hypertriglyceridemia is mediated by suppression of lipoprotein lipase at a post-transcriptional level. J Lipid Res. 1993;34:139-146. 479. Tengku-Muhammad TS, Hughes TR, Cryer A, Ramji DP. Synergism between lipopolysaccharide and interferon gamma in the regulation of lipoprotein lipase in macrophages. Cytokine. 1999;11:408-415. 116 480. Inaba T, Kawamura M, Gotoda T, Harada K, Shimada M, Ohsuga J, Shimano H, Akanuma Y, Yazaki Y, Yamada N. Effects of platelet-derived growth factor on the synthesis of lipoprotein lipase in human monocyte-derived macrophages. Arterioscler Thromb Vase Biol. 1995;15:522-528. 481. Gbaguidi FG, Chinetti G, Milosavljevic D, Teissier E, Chapman J, Olivecrona G, Fruchart JC, Griglio S, Fruchart-Najib J, Staels B. Peroxisome proliferator-activated receptor (PPAR) agonists decrease lipoprotein lipase secretion and glycated LDL uptake by human macrophages. FEBS Lett. 2002;512:85-90. 482. Akiyama TE, Sakai S, Lambert G, Nicol CJ, Matsusue K, Pimprale S, Lee YH, Ricote M, Glass CK, Brewer HB, Jr., Gonzalez FJ. Conditional disruption of the peroxisome proliferator-activated receptor gamma gene in mice results in lowered expression of ABCA1, ABCG1, and apoE in macrophages and reduced cholesterol efflux. Mol Cell Biol. 2002;22:2607-2619. 483. Li L, Beauchamp MC, Renier G. Peroxisome proliferator-activated receptor alpha and gamma agonists upregulate human macrophage lipoprotein lipase expression. Atherosclerosis. 2002; 165:101-110. 484. Morin CL, Schlaepfer IR, Eckel RH. Tumor necrosis factor-alpha eliminates binding of NF-Y and an octamer-binding protein to the lipoprotein lipase promoter in 3T3-L1 adipocytes. J Clin Invest. 1995;95:1684-1689. 485. Hughes TR, Tengku-Muhammad TS, Irvine SA, Ramji DP. A novel role of Spl and Sp3 in the interferon-gamma -mediated suppression of macrophage lipoprotein lipase gene transcription. JBiol Chem. 2002;277:11097-11106. 486. Kamei Y, Kawada T, Fujita A, Etinne J, Noe L, Sugimoto E. Lipoprotein lipase enzyme expression in 3T3-L1 adipocytes is posttranscriptionally down-regulated by retinoic acid. Biochem Int. 1992;26:923-934. 487. Hata A, Ridinger DN, Sutherland SD, Emi M, Kwong LK, Shuhua J, Lubbers A, Guy-Grand B, Basdevant A, Iverius PH, et al. Missense mutations in exon 5 of the human lipoprotein lipase gene. Inactivation correlates with loss of dimerization. JBiol Chem. 1992;267:20132-20139. 488. Masuno H, Nakabayashi H, Kobayashi J, Saito Y, Okuda H. Reduced dimerization of lipoprotein lipase in post-heparin plasma of a patient with hyperchylomicronemia. Biochim Biophys Acta. 1995; 1254:30-36. 489. Musliner TA, Church EC, Herbert PN, Kingston MJ, Shulman RS. Lipoprotein lipase cofactor activity of a carboxyl-terminal peptide of apolipoprotein C-II. Proc Natl Acad Sci USA. 1977;74:5358-5362. 490. Shirai K, Fitzharris TJ, Shinomiya M, Muntz HG, Harmony JA, Jackson RL, Quinn DM. Lipoprotein lipase-catalyzed hydrolysis of phosphatidylcholine of guinea pig very low density lipoproteins and discoidal complexes of phospholipid and apolipoprotein: effect of apolipoprotein C-II on the catalytic mechanism. J Lipid Res. 1983;24:721-730. 117 491. Bengtsson G, Olivecrona T. Apolipoprotein CII enhances hydrolysis of monoglycerides by lipoprotein lipase, but the effect is abolished by fatty acids. FEBS Lett. 1979; 106:345-348. 492. Stocks J, Galton DJ. Activation of the phospholipase A l activity of lipoprotein lipase by apoprotein C-II. Lipids. 1980;15:186-190. 493. Scow RO, Egelrud T. Hydrolysis of chylomicron phosphatidylcholine in vitro by lipoprotein lipase, phospholipase A2 and phospholipase C. Biochim Biophys Acta. 1976;431:538-549. 494. Groot PH, Oerlemans MC, Scheek LM. Triglyceridase and phospholipase A l activities of rat-heart lipoprotein lipase. Influence of apolipoproteins C-II and C-III. Biochim Biophys Acta. 1978;530:91-98. 495. Muntz HG, Matsuoka N, Jackson RL. Phospholipase activity of bovine milk lipoprotein lipase on phospholipid vesicles: influence of apolipoproteins C-II and C-III. Biochem Biophys Res Commun. 1979;90:15-21. 496. Shirai K, Matsuoka N, Jackson RL. Interaction of lipoprotein lipase with phospholipid vesicles. Role of apolipoprotein C-II and heparin. Biochim Biophys Acta. 1981;665:504-510. 497. Deckelbaum RJ, Ramakrishnan R, Eisenberg S, Olivecrona T, Bengtsson-Olivecrona G. Triacylglycerol and phospholipid hydrolysis in human plasma lipoproteins: role of lipoprotein and hepatic lipase. Biochemistry. 1992;31:8544-8551. 498. Eisenberg S, Schurr D, Goldman H, Olivecrona T. Comparison of the phospholipase activity of bovine milk lipoprotein lipase against rat plasma very low density and high density lipoprotein. Biochim Biophys Acta. 1978;531:344-351. 499. Jackson RL, Demel RA. Lipoprotein lipase-catalyzed hydrolysis of phospholipid monolayers: effect of fatty acyl composition on enzyme activity. Biochem Biophys Res Commun. 1985;128:670-675. 500. Skottova N, Savonen R, Lookene A, Hultin M, Olivecrona G. Lipoprotein lipase enhances removal of chylomicrons and chylomicron remnants by the perfused rat liver. J Lipid Res. 1995;36:1334-1344. 501. Hussain MM, Goldberg IJ, Weisgraber KH, Mahley RW, Innerarity TL. Uptake of chylomicrons by the liver, but not by the bone marrow, is modulated by lipoprotein lipase activity. Arterioscler Thromb Vase Biol. 1997;17:1407-1413. 502. Ameis D, Kobayashi J, Davis RC, Ben-Zeev O, Malloy MJ, Kane JP, Lee G, Wong H, Havel RJ, Schotz MC. Familial chylomicronemia (type I hyperlipoproteinemia) due to a single missense mutation in the lipoprotein lipase gene. J Clin Invest. 1991 ;87:1165-1170. 118 503. Ishimura-Oka K, Faustinella F, Kihara S, Smith LC, Oka K, Chan L. A missense mutation (Trp86—Arg) in exon 3 of the lipoprotein lipase gene: a cause of familial chylomicronemia. Am J Hum Genet. 1992;50:1275-1280. 504. Ma Y, Henderson HE, Murthy V, Roederer G, Monsalve MV, Clarke LA, Normand T, Julien P, Gagne C, Lambert M, et al. A mutation in the human lipoprotein lipase gene as the most common cause of familial chylomicronemia in French Canadians. N Engl J Med. 1991;324:1761-1766. 505. Ma Y, Wilson BI, Bijvoet S, Henderson HE, Cramb E, Roederer G, Ven Murthy MR, Julien P, Bakker HD, Kastelein JJ, et al. A missense mutation (Asp250—Asn) in exon 6 of the human lipoprotein lipase gene causes chylomicronemia in patients of different ancestries. Genomics. 1992;13:649-653. 506. Weinstock PH, Bisgaier CL, Aalto-Setala K, Radner H, Ramakrishnan R, Levak-Frank S, Essenburg AD, Zechner R, Breslow JL. Severe hypertriglyceridemia, reduced high density lipoprotein, and neonatal death in lipoprotein lipase knockout mice. Mild hypertriglyceridemia with impaired very low density lipoprotein clearance in heterozygotes. J Clin Invest. 1995;96:2555-2568. 507. Pacy PJ, Mitropoulos KA, Venkatesan S, Watts GF, Reeves BE, Halliday D. Metabolism of apolipoprotein B-100 and of triglyceride-rich lipoprotein particles in the absence of functional lipoprotein lipase. Atherosclerosis. 1993;103:231-243. 508. Williams KJ, Petrie KA, Brocia RW, Swenson TL. Lipoprotein lipase modulates net secretory output of apolipoprotein B in vitro. A possible pathophysiologic explanation for familial combined hyperlipidemia. J Clin Invest. 1991 ;88:1300-1306. 509. Zheng C, Murdoch SJ, Brunzell JD, Sacks FM. Lipoprotein lipase bound to apolipoprotein B lipoproteins accelerates clearance of postprandial lipoproteins in humans. Arterioscler Thromb Vase Biol. 2006;26:891-896. 510. Gerdes C, Fisher RM, Nicaud V, Boer J, Humphries SE, Talmud PJ, Faergeman O. Lipoprotein lipase variants D9N and N291S are associated with increased plasma triglyceride and lower high-density lipoprotein cholesterol concentrations: studies in the fasting and postprandial states: the European Atherosclerosis Research Studies. Circulation. 1997;96:733-740. 511. Wittrup HH, Andersen RV, Tybjaerg-Hansen A, Jensen GB, Nordestgaard BG. Combined analysis of six lipoprotein lipase genetic variants on triglycerides, high-density lipoprotein, and ischemic heart disease: cross-sectional, prospective, and case-control studies from the Copenhagen City Heart Study. J Clin Endocrinol Metab. 2006;91:1438-1445. 512. Goldberg IJ, Blaner WS, Vanni TM, Moukides M, Ramakrishnan R. Role of lipoprotein lipase in the regulation of high density lipoprotein apolipoprotein metabolism. Studies in normal and lipoprotein lipase-inhibited monkeys. J Clin Invest. 1990;86:463-473. 513. Clee SM, Zhang H, Bissada N, Miao L, Ehrenborg E, Benlian P, Shen GX, Angel A, LeBoeuf RC, Hayden MR. Relationship between lipoprotein lipase and high density 119 lipoprotein cholesterol in mice: modulation by cholesteryl ester transfer protein and dietary status. J Lipid Res. 1997;38:2079-2089. 514. Goodarzi MO, Taylor KD, Scheuner MT, Antoine HJ, Guo X, Shah PK, Rotter JL Haplotypes in the lipoprotein lipase gene influence high-density lipoprotein cholesterol response to statin therapy and progression of atherosclerosis in coronary artery bypass grafts. Pharmacogenomics J. 2006. 515. Chappell DA, Fry GL, Waknitz MA, Muhonen LE, Pladet MW, Iverius PH, Strickland DK. Lipoprotein lipase induces catabolism of normal triglyceride-rich lipoproteins via the low density lipoprotein receptor-related protein/alpha 2-macroglobulin receptor in vitro. A process facilitated by cell-surface proteoglycans. JBiol Chem. 1993;268:14168-14175. 516. Preiss-Landl K, Zimmermann R, Hammerle G, Zechner R. Lipoprotein lipase: the regulation of tissue specific expression and its role in lipid and energy metabolism. Curr Opin Lipidol. 2002; 13:471 -481. 517. Mulder M, Lombardi P, Jansen H, van Berkel TJ, Frants RR, Havekes LM. Heparan sulphate proteoglycans are involved in the lipoprotein lipase-mediated enhancement of the cellular binding of very low density and low density lipoproteins. Biochem Biophys Res Commun. 1992;185:582-587. 518. Beisiegel U, Weber W, Bengtsson-Olivecrona G. Lipoprotein lipase enhances the binding of chylomicrons to low density lipoprotein receptor-related protein. Proc Natl Acad Sci USA. 1991;88:8342-8346. 519. Lookene A, Savonen R, Olivecrona G. Interaction of lipoproteins with heparan sulfate proteoglycans and with lipoprotein lipase. Studies by surface plasmon resonance technique. Biochemistry. 1997;36:5267-5275. 520. Merkel M, Heeren J, Dudeck W, Rinninger F, Radner H, Breslow JL, Goldberg IJ, Zechner R, Greten H. Inactive lipoprotein lipase (LPL) alone increases selective cholesterol ester uptake in vivo, whereas in the presence of active LPL it also increases triglyceride hydrolysis and whole particle lipoprotein uptake. JBiol Chem. 2002;277:7405-7411. 521. Merkel M, Kako Y, Radner H, Cho IS, Ramasamy R, Brunzell JD, Goldberg IJ, Breslow JL. Catalytically inactive lipoprotein lipase expression in muscle of transgenic mice increases very low density lipoprotein uptake: direct evidence that lipoprotein lipase bridging occurs in vivo. Proc Natl Acad Sci USA. 1998;95:13841-13846. 522. Lutz EP, Merkel M, Kako Y, Melford K, Radner H, Breslow JL, Bensadoun A, Goldberg IJ. Heparin-binding defective lipoprotein lipase is unstable and causes abnormalities in lipid delivery to tissues. J Clin Invest. 2001; 107:1183-1192. 523. Medh JD, Fry GL, Bowen SL, Ruben S, Wong H, Chappell DA. Lipoprotein lipase- and hepatic triglyceride lipase- promoted very low density lipoprotein degradation proceeds via an apolipoprotein E-dependent mechanism. J Lipid Res. 2000;41:1858-1871. 120 524. Tacken PJ, Beer FD, Vark LC, Havekes LM, Hofker MH, Willems Van Dijk K. Very-low-density lipoprotein binding to the apolipoprotein E receptor 2 is enhanced by lipoprotein lipase, and does not require apolipoprotein E. Biochem J. 2000;347:357-361. 525. Loeffler B, Heeren J, Blaeser M, Radner H, Kayser D, Aydin B, Merkel M. Lipoprotein lipase facilitated uptake of LDL is mediated by the LDL receptor. J Lipid Res. 2006. 526. Mulder M, Lombardi P, Jansen H, van Berkel TJ, Frants RR, Havekes LM. Low density lipoprotein receptor internalizes low density and very low density lipoproteins that are bound to heparan sulfate proteoglycans via lipoprotein lipase. JBiol Chem. 1993;268:9369-9375. 527. Medh JD, Bowen SL, Fry GL, Ruben S, Andracki M, Inoue I, Lalouel JM, Strickland DK, Chappell DA. Lipoprotein lipase binds to low density lipoprotein receptors and induces receptor-mediated catabolism of very low density lipoproteins in vitro. J Biol Chem. 1996;271:17073-17080. 528. Weaver AM, Lysiak JJ, Gonias SL. LDL receptor family-dependent and -independent pathways for the internalization and digestion of lipoprotein lipase-associated beta-VLDL by rat vascular smooth muscle cells. J Lipid Res. 1997;38:1841-1850. 529. Zimmermann R, Panzenbock U, Wintersperger A, Levak-Frank S, Graier W, Glatter O, Fritz G, Kostner GM, Zechner R. Lipoprotein lipase mediates the uptake of glycated LDL in fibroblasts, endothelial cells, and macrophages. Diabetes. 2001;50:1643-1653. 530. Makoveichuk E, Castel S, Vilaro S, Olivecrona G. Lipoprotein lipase-dependent binding and uptake of low density lipoproteins by THP-1 monocytes and macrophages: possible involvement of lipid rafts. Biochim Biophys Acta. 2004;1686:37-49. 531. Fernandez-Borja M, Bellido D, Vilella E, Olivecrona G, Vilaro S. Lipoprotein lipase-mediated uptake of lipoprotein in human fibroblasts: evidence for an LDL receptor-independent internalization pathway. J Lipid Res. 1996;37:464-481. 532. Sartippour MR, Renier G. Upregulation of macrophage lipoprotein lipase in patients with type 2 diabetes: role of peripheral factors. Diabetes. 2000;49:597-602. 533. Beauchamp MC, Letendre E, Renier G. Macrophage lipoprotein lipase expression is increased in patients with heterozygous familial hypercholesterolemia. J Lipid Res. 2002;43:215-222. 534. Renier G, Skamene E, DeSanctis JB, Radzioch D. High macrophage lipoprotein lipase expression and secretion are associated in inbred murine strains with susceptibility to atherosclerosis. Arterioscler Thromb. 1993;13:190-196. 535. Werba JP, Martinez V, Abulafia DP, Levy R, Magarinos G, Rey RH, Baetta R, Soma MR, Anel AD, Cuniberti LA. Marked neointimal lipoprotein lipase increase in distinct models of proclivity to atherosclerosis: a feature independent of endothelial layer integrity. Atherosclerosis. 2001;156:91-101. 121 536. Fan J, Unoki H, Kojima N, Sun H, Shimoyamada H, Deng H, Okazaki M, Shikama H, Yamada N, Watanabe T. Overexpression of lipoprotein lipase in transgenic rabbits inhibits diet-induced hypercholesterolemia and atherosclerosis. JBiol Chem. 2001;276:40071-40079. 537. Yagyu H, Ishibashi S, Chen Z, Osuga J, Okazaki M, Perrey S, Kitamine T, Shimada M, Ohashi K, Harada K, Shionoiri F, Yahagi N, Gotoda T, Yazaki Y, Yamada N. Overexpressed lipoprotein lipase protects against atherosclerosis in apolipoprotein E knockout mice. J Lipid Res. 1999;40:1677-1685. 538. Wilson K, Fry GL, Chappell DA, Sigmund CD, Medh JD. Macrophage-specific expression of human lipoprotein lipase accelerates atherosclerosis in transgenic apolipoprotein e knockout mice but not in C57BL/6 mice. Arterioscler Thromb Vase Biol. 2001;21:1809-1815. 539. Koike T, Liang J, Wang X, Ichikawa T, Shiomi M, Sun H, Watanabe T, Liu G, Fan J. Enhanced aortic atherosclerosis in transgenic Watanabe heritable hyperlipidemic rabbits expressing lipoprotein lipase. Cardiovasc Res. 2005;65:524-534. 540. Semenkovich CF, Coleman T, Daugherty A. Effects of heterozygous lipoprotein lipase deficiency on diet-induced atherosclerosis in mice. J Lipid Res. 1998;39:1141-1151. 541. Jukema JW, van Boven AJ, Groenemeijer B, Zwinderman AH, Reiber JH, Bruschke AV, Henneman JA, Molhoek GP, Bruin T, Jansen H, Gagne E, Hayden MR, Kastelein JJ. The Asp9 Asn mutation in the lipoprotein lipase gene is associated with increased progression of coronary atherosclerosis. REGRESS Study Group, Interuniversity Cardiology Institute, Utrecht, The Netherlands. Regression Growth Evaluation Statin Study. Circulation. 1996;94:1913-1918. 542. Kastelein JJ, Jukema JW, Zwinderman AH, Clee S, van Boven AJ, Jansen H, Rabelink TJ, Peters RJ, Lie KJ, Liu G, Bruschke AV, Hayden MR. Lipoprotein lipase activity is associated with severity of angina pectoris. REGRESS Study Group. Circulation. 2000;102:1629-1633. 543. Benlian P, De Gennes JL, Foubert L, Zhang H, Gagne SE, Hayden M. Premature atherosclerosis in patients with familial chylomicronemia caused by mutations in the lipoprotein lipase gene. N Engl J Med. 1996;335:848-854. 544. Dugi KA, Feuerstein IM, Hill S, Shih J, Santamarina-Fojo S, Brewer HB, Jr., Hoeg JM. Lipoprotein lipase correlates positively and hepatic lipase inversely with calcific atherosclerosis in homozygous familial hypercholesterolemia. Arterioscler Thromb Vase Biol. 1997;17:354-364. 545. Fisher RM, Benhizia F, Schreiber R, Makoveichuk E, Putt W, Al-Haideri M, Deckelbaum RJ, Olivecrona G, Humphries SE, Talmud PJ. Enhanced bridging function and augmented monocyte adhesion by lipoprotein lipase N9: insights into increased risk of coronary artery disease in N9 carriers. Atherosclerosis. 2003;166:243-251. 122 546. Van Eck M, Zimmermann R, Groot PH, Zechner R, Van Berkel TJ. Role of macrophage-derived lipoprotein lipase in lipoprotein metabolism and atherosclerosis. Arterioscler Thromb Vase Biol. 2000;20:E53-62. 547. Babaev VR, Patel MB, Semenkovich CF, Fazio S, Linton MF. Macrophage lipoprotein lipase promotes foam cell formation and atherosclerosis in low density lipoprotein receptor-deficient mice. JBiol Chem. 2000;275:26293-26299. 548. Ichikawa T, Liang J, Kitajima S, Koike T, Wang X, Sun H, Morimoto M, Shikama H, Watanabe T, Yamada N, Fan J. Macrophage-derived lipoprotein lipase increases aortic atherosclerosis in cholesterol-fed Tg rabbits. Atherosclerosis. 2005;179:87-95. 549. Auerbach BJ, Bisgaier CL, Wolle J, Saxena U. Oxidation of low density lipoproteins greatly enhances their association with lipoprotein lipase anchored to endothelial cell matrix. J Biol Chem. 1996;271:1329-1335. 550. Wang X, Greilberger J, Levak-Frank S, Zimmermann R, Zechner R, Jurgens G. Endogenously produced lipoprotein lipase enhances the binding and cell association of native, mildly oxidized and moderately oxidized low-density lipoprotein in mouse peritoneal macrophages. Biochem J. 1999;343 Pt 2:347-353. 551. Rutledge JC, Woo MM, Rezai AA, Curtiss LK, Goldberg IJ. Lipoprotein lipase increases lipoprotein binding to the artery wall and increases endothelial layer permeability by formation of lipolysis products. Circ Res. 1997;80:819-828. 552. Renier G, Lambert A. Lipoprotein lipase synergizes with interferon gamma to induce macrophage nitric oxide synthetase mRNA expression and nitric oxide production. Arterioscler Thromb Vase Biol. 1995;15:392-399. 553. Eisenberg S, Sehayek E, Olivecrona T, Vlodavsky I. Lipoprotein lipase enhances binding of lipoproteins to heparan sulfate on cell surfaces and extracellular matrix. J Clin Invest. 1992;90:2013-2021. 554. Saxena U, Ferguson E, Auerbach BJ, Bisgaier CL. Lipoprotein lipase facilitates very low density lipoprotein binding to the subendothelial cell matrix. Biochem Biophys Res Commun. 1993;194:769-774. 555. Heinecke JW, Suits AG, Aviram M, Chait A. Phagocytosis of lipase-aggregated low density lipoprotein promotes macrophage foam cell formation. Sequential morphological and biochemical events. Arterioscler Thromb. 1991; 11:1643-1651. 556. Mamputu JC, Desfaits AC, Renier G. Lipoprotein lipase enhances human monocyte adhesion to aortic endothelial cells. J Lipid Res. 1997;38:1722-1729. 557. Obunike JC, Paka S, Pillarisetti S, Goldberg IJ. Lipoprotein lipase can function as a monocyte adhesion protein. Arterioscler Thromb Vase Biol. 1997;17:1414-1420. 558. Mamputu JC, Levesque L, Renier G. Proliferative effect of lipoprotein lipase on human vascular smooth muscle cells. Arterioscler Thromb Vase Biol. 2000;20:2212-2219. 123 559. Gouni-Berthold I, Berthold HK, Seul C, Ko Y, Vetter H, Sachinidis A. Effects of authentic and VLDL hydrolysis-derived fatty acids on vascular smooth muscle cell growth. Br J Pharmacol. 2001;132:1725-1734. 560. Mamputu JC, Renier G. Differentiation of human monocytes to monocyte-derived macrophages is associated with increased lipoprotein lipase-induced tumor necrosis factor-alpha expression and production: a process involving cell surface proteoglycans and protein kinase C. Arterioscler Thromb Vase Biol. 1999;19:1405-1411. 561. Renier G, Skamene E, DeSanctis JB, Radzioch D. Induction of tumor necrosis factor alpha gene expression by lipoprotein lipase. J Lipid Res. 1994;35:271-278. 562. Stevenson FT, Shearer GC, Atkinson DN. Lipoprotein-stimulated mesangial cell proliferation and gene expression are regulated by lipoprotein lipase. Kidney Int. 2001;59:2062-2068. 563. Ishida T, Zheng Z, Dichek HL, Wang H, Moreno I, Yang E, Kundu RK, Talbi S, Hirata K, Leung LL, Quertermous T. Molecular cloning of nonsecreted endothelial cell-derived lipase isoforms. Genomics. 2004;83:24-33. 564. Jin W, Fuki IV, Seidah NG, Benjannet S, Glick JM, Rader DJ. Proprotein convertases [corrected] are responsible for proteolysis and inactivation of endothelial lipase. J Biol Chem. 2005;280:36551-36559. 565. Miller GC, Long CJ, Bojilova ED, Marchadier D, Badellino KO, Blanchard N, Fuki IV, Glick JM, Rader DJ. Role of N-linked glycosylation in the secretion and activity of endothelial lipase. J Lipid Res. 2004;45:2080-2087. 566. Wong H, Davis RC, Nikazy J, Seebart KE, Schotz MC. Domain exchange: characterization of a chimeric lipase of hepatic lipase and lipoprotein lipase. Proc Natl AcadSciUSA. 1991;88:11290-11294. 567. Dichek HL, Parrott C, Ronan R, Brunzell JD, Brewer HB, Jr., Santamarina-Fojo S. Functional characterization of a chimeric lipase genetically engineered from human lipoprotein lipase and human hepatic lipase. J Lipid Res. 1993;34:1393-1340. 568. Broedl UC, Jin W, Fuki IV, Glick JM, Rader DJ. Structural basis of endothelial lipase tropism for HDL. FasebJ. 2004;18:1891-1893. 569. Broedl UC, Maugeais C, Millar JS, Jin W, Moore RE, Fuki IV, Marchadier D, Glick JM, Rader DJ. Endothelial lipase promotes the catabolism of ApoB-containing lipoproteins. Circ Res. 2004;94:1554-1561. 570. Lindegaard ML, Nielsen JE, Hannibal J, Nielsen LB. Expression of the endothelial lipase gene in murine embryos and reproductive organs. J Lipid Res. 2005;46:439-444. 571. Broedl UC, Jin W, Marchadier D, Secreto A, Rader DJ. Tissue-specific expression pattern of human endothelial lipase in transgenic mice. Atherosclerosis. 2005;181:271-274. 124 572. Shimokawa Y, Hirata K, Ishida T, Kojima Y, Inoue N, Quertermous T, Yokoyama M. Increased expression of endothelial lipase in rat models of hypertension. Cardiovasc Res. 2005;66:594-600. 573. Lindegaard ML, Damm P, Mathiesen ER, Nielsen LB. Placental triglyceride accumulation in maternal type 1 diabetes is associated with increased lipase gene expression. J Lipid Res. 2006;47:2581-2588. 574. Kojma Y, Hirata K, Ishida T, Shimokawa Y, Inoue N, Kawashima S, Quertermous T, Yokoyama M. Endothelial lipase modulates monocyte adhesion to the vessel wall. A potential role in inflammation. JBiol Chem. 2004;279:54032-54038. 575. Hirata K, Ishida T, Matsushita H, Tsao PS, Quertermous T. Regulated expression of endothelial cell-derived lipase. Biochem Biophys Res Commun. 2000;272:90-93. 576. Jin W, Sun GS, Marchadier D, Octtaviani E, Glick JM, Rader DJ. Endothelial cells secrete triglyceride lipase and phospholipase activities in response to cytokines as a result of endothelial lipase. Circ Res. 2003;92:644-650. 577. Shimizugawa T, Ono M, Shimamura M, Yoshida K, Ando Y, Koishi R, Ueda K, Inaba T, Minekura H, Kohama T, Furukawa H. ANGPTL3 decreases very low density lipoprotein triglyceride clearance by inhibition of lipoprotein lipase. J Biol Chem. 2002;277:33742-33748. 578. Shimamura M, Matsuda M, Yasumo H, Okazaki M, Fujimoto K, Kono K, Shimizugawa T, Ando Y, Koishi R, Kohama T, Sakai N, Kotani K, Komuro R, Ishida T, Hirata K, Yamashita S, Furukawa H, Shimomura I. Angiopoietin-Like Protein3 Regulates Plasma HDL Cholesterol Through Suppression of Endothelial Lipase. Arterioscler Thromb Vase Biol. 2006. 579. Sovic A, Panzenboeck U, Wintersperger A, Kratzer I, Hammer A, Levak-Frank S, Frank S, Rader DJ, Malle E, Sattler W. Regulated expression of endothelial lipase by porcine brain capillary endothelial cells constituting the blood-brain barrier. JNeurochem. 2005;94:109-119. 580. McCoy MG, Sun GS, Marchadier D, Maugeais C, Glick JM, Rader DJ. Characterization of the lipolytic activity of endothelial lipase. J Lipid Res. 2002;43:921-929. 581. Gauster M, Rechberger G, Sovic A, Horl G, Steyrer E, Sattler W, Frank S. Endothelial lipase releases saturated and unsaturated fatty acids of high density lipoprotein phosphatidylcholine. J Lipid Res. 2005;46:1517-1525. 582. Duong M, Psaltis M, Rader DJ, Marchadier D, Barter PJ, Rye KA. Evidence that hepatic lipase and endothelial lipase have different substrate specificities for high-density lipoprotein phospholipids. Biochemistry. 2003;42:13778-13785. 583. Strauss JG, Hayn M, Zechner R, Levak-Frank S, Frank S. Fatty acids liberated from high-density lipoprotein phospholipids by endothelial-derived lipase are incorporated into lipids in HepG2 cells. Biochem J 2003;371:981-988. 125 584. Kratky D, Zimmermann R, Wagner EM, Strauss JG, Jin W, Kostner GM, Haemmerle G, Rader DJ, Zechner R. Endothelial lipase provides an alternative pathway for FFA uptake in lipoprotein lipase-deficient mouse adipose tissue. J Clin Invest. 2005;115:161-167. 585. Broedl UC, Jin W, Fuki IV, Millar JS, Rader DJ. Endothelial lipase is less effective at influencing HDL metabolism in vivo in mice expressing apoA-II. J Lipid Res. 2006;47:2191-2197. 586. Jahangiri A, Rader DJ, Marchadier D, Curtiss LK, Bonnet DJ, Rye KA. Evidence that endothelial lipase remodels high density lipoproteins without mediating the dissociation of apolipoprotein A-I. J Lipid Res. 2005;46:896-903. 587. Caiazza D, Jahangiri A, Rader DJ, Marchadier D, Rye KA. Apolipoproteins regulate the kinetics of endothelial lipase-mediated hydrolysis of phospholipids in reconstituted high-density lipoproteins. Biochemistry. 2004;43:11898-11905. 588. Jin W, Millar JS, Broedl U, Glick JM, Rader DJ. Inhibition of endothelial lipase causes increased HDL cholesterol levels in vivo. J Clin Invest. 2003; 111:357-362. 589. Ishida T, Choi S, Kundu RK, Hirata K, Rubin EM, Cooper AD, Quertermous T. Endothelial lipase is a major determinant of HDL level. J Clin Invest. 2003; 111:347-355. 590. Ma K, Cilingiroglu M, Otvos JD, Ballantyne CM, Marian AJ, Chan L. Endothelial lipase is a major genetic determinant for high-density lipoprotein concentration, structure, and metabolism. Proc Natl Acad Sci USA. 2003;100:2748-2753. 591. Maugeais C, Tietge UJ, Broedl UC, Marchadier D, Cain W, McCoy MG, Lund-Katz S, Glick JM, Rader DJ. Dose-dependent acceleration of high-density lipoprotein catabolism by endothelial lipase. Circulation. 2003;108:2121-2126. 592. Fuki IV, Blanchard N, Jin W, Marchadier DH, Millar JS, Glick JM, Rader DJ. Endogenously produced endothelial lipase enhances binding and cellular processing of plasma lipoproteins via heparan sulfate proteoglycan-mediated pathway. J Biol Chem. 2003;278:34331-34338. 593. Strauss JG, Zimmermann R, Hrzenjak A, Zhou Y, Kratky D, Levak-Frank S, Kostner GM, Zechner R, Frank S. Endothelial cell-derived lipase mediates uptake and binding of high-density lipoprotein (HDL) particles and the selective uptake of HDL-associated cholesterol esters independent of its enzymic activity. Biochem J. 2002;368:69-79. 594. Broedl UC, Maugeais C, Marchadier D, Glick JM, Rader DJ. Effects of nonlipolytic ligand function of endothelial lipase on high density lipoprotein metabolism in vivo. J Biol Chem. 2003;278:40688-40693. 595. Ma K, Forte T, Otvos JD, Chan L. Differential additive effects of endothelial lipase and scavenger receptor-class B type I on high-density lipoprotein metabolism in knockout mouse models. Arterioscler Thromb Vase Biol. 2005;25:149-154. 126 596. Ishida T, Choi SY, Kundu RK, Spin J, Yamashita T, Hirata K, Kojima Y, Yokoyama M, Cooper AD, Quertermous T. Endothelial lipase modulates susceptibility to atherosclerosis in apolipoprotein-E-deficient mice. JBiol Chem. 2004;279:45085-45092. 597. Azumi H, Hirata K, Ishida T, Kojima Y, Rikitake Y, Takeuchi S, Inoue N, Kawashima S, Hayashi Y, Itoh H, Quertermous T, Yokoyama M. Immunohistochemical localization of endothelial cell-derived lipase in atherosclerotic human coronary arteries. Cardiovasc Res. 2003;58:647-654. 598. deLemos AS, Wolfe ML, Long CJ, Sivapackianathan R, Rader DJ. Identification of genetic variants in endothelial lipase in persons with elevated high-density lipoprotein cholesterol. Circulation. 2002;106:1321-1326. 599. Paradis ME, Couture P, Bosse Y, Despres JP, Perusse L, Bouchard C, Vohl MC, Lamarche B. The Tl 1II mutation in the EL gene modulates the impact of dietary fat on the HDL profile in women. J Lipid Res. 2003;44:1902-1908. 600. Paradis ME, Badellino KO, Rader DJ, Deshaies Y, Couture P, Archer WR, Bergeron N, Lamarche B. Endothelial lipase is associated with inflammation in humans. J Lipid Res. 2006;47:2808-2813. 601. Paradis ME, Badellino KO, Rader DJ, Tchernof A, Richard C, Luu-The V, Deshaies Y, Bergeron J, Archer WR, Couture P, Bergeron N, Lamarche B. Visceral adiposity and endothelial lipase. J Clin Endocrinol Metab. 2006;91:3538-3543. 602. Badellino KO, Wolfe ML, Reilly MP, Rader DJ. Endothelial lipase concentrations are increased in metabolic syndrome and associated with coronary atherosclerosis. PLoS Med. 2006;3:e22. 603. Ko KW, Paul A, Ma K, Li L, Chan L. Endothelial lipase modulates HDL but has no effect on atherosclerosis development in apoE-/- and LDLR-/- mice. J Lipid Res. 2005;46:2586-2594. 127 Chapter 2. The Expression of Endothelial Lipase and Lipoprotein Lipase Promotes Cholesterol Efflux in THP-1 Derived Human Macrophages3 2.1 Introduction and Rationale Atherosclerosis is a multifactorial disease which indolently progresses into a symptomatic phase, causing severe sequelae such as myocardial infarction and stroke. Recently, a number of lines of research have demonstrated that atherosclerosis is an inflammatory process, where blood leukocytes are recruited into atherosclerosis-prone sites. Among these leukocytes, macrophages predominate in number, and play a pivotal role in the development and progression of atherosclerosis.1"4 The formation of macrophage-derived foam cells is a characteristic of atherogenesis.3 Cellular lipid homeostasis is dominated by the balance between lipid accumulation and efflux. It is well known that, when activated, macrophages acquire an enhanced ability to internalize lipoproteins and accumulate cholesterol and ultimately transform themselves into lipid-laden foam cells. Lipid efflux is a regulatory pathway which responds to an increased intracellular lipid content. The impairment of lipid efflux in macrophages may aggravate the lipid accumulation and accelerate the progression of atherosclerosis. Cholesterol is mosaiced in the phospholipid bilayer of cell membranes with an uneven distribution between exo- and endofacial membranes.5 The interaction of cholesterol with phospholipids such as phosphatidylcholine and sphingomyelin is critical for the maintenance of cholesterol integrity in membrane. ' Free diffusion, receptor-facilitated efflux, and ATP-binding cassette (ABC) transporters are the principal pathways for cholesterol efflux in macrophages. The active removal of cholesterol via ABC transporters, mainly ABCA1, assumes a major role in cholesterol efflux.8 For example, in ABCA1 mutated macrophages, cholesterol efflux was impaired and an increased accumulation of intracellular cholesterol followed.9'10 Extracellular apolipoprotein AI (ApoAI) is recognized as the primary acceptor of ABCA1-mediated cholesterol efflux. a A version of this chapter will be submitted for publication. Qiu, G. and Hill, J.S. The expression of endothelial lipase promotes apoAI-mediated cholesterol efflux from human macrophages. 128 Lipoprotein lipase (LPL) and endothelial lipase (EL) are two major lipases secreted by human macrophages, and their expression in macrophages have been found in human atherosclerotic lesions.11"13 Evidence from animal studies supports that LPL expression in macrophages is proatherogenic.14'15 Although the proatherogenic role of LPL has been largely ascribed to its facilitating role in LDL uptake by macrophages,15'16 it is still possible that LPL may modify the lipid deposition by altering cholesterol efflux. Thus far, the effect of LPL on macrophage cholesterol efflux has not been investigated. EL has also been implicated in atherosclerosis. For example, increased levels of plasma EL has been associated with visceral obesity, metabolic syndrome, inflammation, and premature coronary heart disease.1719 However, inconsistent outcomes have been described in two animal studies. One study in apo E knockout mice found that EL deficiency significantly decreased atherosclerosis.20 whereas no significant changes were observed after EL knockout in another study in which both apoE and LDLR knockout mice were investigated.21 Therefore, the role of EL in atherogenesis still remains unclear, and investigation of the effects of EL on macrophage function such as cholesterol efflux may provide useful information to help clarify the role of macrophage-derived EL in atherosclerosis. LPL and EL share common structural features including a large N-terminal domain responsible for lipid hydrolysis and a small C-terminal domain involved in ligand binding (bridging function). Also, two lipase monomer subunits are necessary to form a catalytically active dimer (probably in a head-to-tail manner).22 Despite varying substrate preferences, both LPL and EL are capable of hydrolyzing phospholipids,23"25 implying that LPL and EL may influence the membrane cholesterol integrity by altering phospholipid composition. Moreover, the intrinsic ability of these lipases to bind to apolipoprotein B100 (apoBioo) suggests they might also enhance the apoAI interaction with the membrane,26"28 thereby altering cholesterol efflux. However, the effects of LPL and EL in apoAI-mediated cholesterol efflux have not been investigated. 129 2.2 Hypotheses and Specific Aims 2.2.1 Hypotheses The expression of lipases (LPL and EL) will impair the apoAI-mediated cholesterol efflux in macrophages with specific roles attributed to their catalytic and non-catalytic functions. 2.2.2 Specific Aims 1. To establish lipase suppressed or overexpressing macrophage models. a. Lipase suppression by RNA interference through the transduction of lentivirus containing shRNA specific for each lipase b. LPL overexpression in macrophages by the treatment with dexamethasone c. EL overexpression in macrophages by lentivirus transduction of EL cDNA d. EL overexpression in FLP-IN 293 cells by stable transfection 2. To analyze apoAI-mediated cholesterol efflux in above cell models. a. Cholesterol efflux in lipase suppressed or overexpressing macrophages and 293 cells b. Cholesterol efflux in macrophages after the addition of exogenous bLPL and EL 3. To clarify the relative role of catalytic and non-catalytic function of LPL and EL in cholesterol efflux a. Cholesterol efflux after the catalytic inhibition by tetrahydrolipstatin in lipase-overexpressing macrophages b. Cholesterol efflux after the inhibition of lipase bridging function by heparin in lipase-overexpressing macrophages c. Cholesterol efflux in lipase-overexpressing macrophages after the treatment of both THL and heparin 4. To investigate LPL and EL effects on ABCA1 expression a. ABCA1 expression after lipase suppression b. ABCA1 expression after lipase overexpression 5. To analyze apoAI binding in macrophages after lipase suppression and overexpression a. ApoAI binding in lipase-suppressed macrophages b. ApoAI binding in lipase-overexpressing macrophages and 293 cells c. The role of catalytic and non-catalytic function of lipases on apoAI binding 130 To analyze lipid composition after lipase suppression and overexpression a. Analysis of lipid composition in lipase-suppressed macrophages b. Analysis of lipid composition in lipase-overexpressing macrophages c. Analysis of lipid composition in lipase-overexpressing 293 cells 131 2.3 Material and Methods 2.3.1 Cell Culture THP-1 human monocytes (ATCC number TIB-202) were maintained in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS), 1% antibiotic-antimycotic (Invitrogen, 15240-096), 2 mM L-glutamine, 1.5 g/L sodium bicarbonate, and 1.0 mM sodium pyruvate. 293T human embryonic kidney (HEK) cells were cultured in Dulbecco's modified Eagle's medium (DMEM), supplemented with 10% FBS, and 1% antibiotic-antimycotic. Flp-In™ 293 Cells (Invitrogen, R750-07) were cultured in DMEM with 10% FBS, 1% antibiotic-antimycotic, and 100p.g/ml Zeocin. All cells were incubated in humidified incubator at 95% air, 5% carbon dioxide, and 37°C and used within 20 passages. 2.3.2 Candidate shRNA Selection and Incorporation into pSHAG Vector Several web-based small interfering RNA (siRNA) design tools (Invitrogen, Qiagen, Dharmacon, Ambion, GeneScript, and RNAi Central) were utilized for the selection of candidate small hairpin RNA (shRNA) sequences, based on the sequence reproducibility in their outputs, and the accessibility of target sites (S-fold). Scrambled shRNA without homology with any known genes served as a control (shRNA sequences are listed in table 2-1). Table 2-1. Sequence of shRNA oligonucleotides for LPL, EL and control constructs. Name Target site Sequence LPL-shRNA-Forward 470 ACATTC<jAGTCTC<nTCTCTCT GCCACATOXAATCfrcAririrrr LPL-shRNA-Reverse 470 C A T C A A A A A A A T G A C A T T G G A A T C R J G ^ T G T A C A A G A G A G A A C C A G A C T O C A A T G T C G EL-shRNA-Forward 598 GGAGCCAGTCAACCACAACTACATTGGCGAAGCTTGGrcAGTGTAGTT GTC^inm^PGCOOCTCcrrirri EL-shRNA-Reverse 598 G A T C A A A A A A G G A G G A G C C A G C C A A C C A C A A C T A C A C T G A C C A A G C T T CCO^AATGTAGTTCflljCfrTC^ Scramble-shRNA-Forward None T G I T C A T A T G T C T G C T U I T G T A G C A G T A G A A G C T T G ^ ^ G C A G A C G T A T G A G C A C X J I I I T I I T Scramble-shRNA-Reverse None GAGCAAAAAAACXTIXXTrcATACGTCTGC TACTGCTACAAGAGCAGACATATGAACACG Paired shRNAs (Qiagen OPERON) were diluted to a final concentration of 50uM in the annealing buffer (1 mM MgCb, 20 mM Tris-HCl, pH 8.0). The mixture was then incubated at 95°C for 3 minutes, and cooled down naturally to room temperature. Thereafter; the annealed 132 shRNA diluted to 50nM in annealing buffer was used for ligation. Entry vector pSHAG (kind gift from Dr. Greg Hannon, Cold Spring Harbor Laboratory), was digested by restrict endonucleases BseRI and BamHI, and gel-purified (QIAquick gel extraction kit, 28704, QIAGEN). Annealed shRNAs were ligated into sticky-ended pSHAG at the molar ratio of 3-5:1 (50~100ng:lug of shRNA:pSHAG) at room temperature for 1 hour using T4 ligase of rapid ligation kit (Roche Applied Science, 11635379001). Heat-inactivated (10 minutes at 65°C) ligation mixture (5 uL) was used to transform Top 10 one-shot chemically competent E. coli (Invitrogen, C4040-03) following the factory's instructions. The transformation mixture (50 uL) was streaked on kanamycin+ agar medium and positive colonies were isolated for DNA (QIAprep Spin Miniprep Kit, 27106, Qiagen) which was thereafter digested with Hindlll for the confirmation of shRNA incorporation (Figure 2-1). pSHAG with shRNA (designated pSHAG-shRNA) was sequenced to assure the fidelity of shRNA sequence using U6 primer (5'-GGACTATCATATGCTTACCG-3', Qiagen OPERON, Appendices 1-3). Figure 2-1: Hind III digestion of pSHAG to confirm the shRNA inserts. shRNA oligo bears a Hind III site at the center so that pSHAG vectors containing shRNA insert will be digested by Hindlll enzyme as shown by the upward size shift (constructs 1, 2, 3, 4, 7, 8, and 10) on 2% agarose gel compared to pSHAG vectors without insert (constructs 5, 6, and 9). 2.3.3 Integration of shRNA Expression Cassette into Lentiviral Vector Lentiviral vector pHR-CMV-EGFP (kind gift from Dr. Alice Mui, UBC) engineered with gateway system (Invitrogen) in the Clal site located at the downstream of 5'-LTR and upstream of CMV-EGFP by Dr. Alice Mui's research group was maxpreped using QIAfilter Plasmid Maxi Kit (12262, Qiagen) and served as the destination vector. shRNA expression cassette (U6 promoter-shRNA) was transferred from pSHAG-shRNA into pHR-CMV-EGFP at attRl/2 sites by Gateway reaction using LR Clonase Enzyme (Invitrogen, 11791-019). Briefly, 300ng of pSHAG-shRNA and 300ng of pHR-CMV-EGFP were mixed with IX LR clonase reaction buffer in TE buffer (pH 8.0). After the addition of 4ul of LR clonase enzyme mixture, the reaction was carried out at 25°C for 60 minutes and terminated by incubating with 2pl of 133 proteinase K solution at 37°C for 10 minutes. Top 10 E. coli were transformed according to manual instructions, and plated on ampicillin+ agar medium overnight, positive colonies were isolated for DNA which was thereafter subjected to DNA sequencing for the confirmation of the insertion of shRNA expression cassette using U6 primer. pHR-CMV-EGFP inserted with shRNA expression cassette was designated as pHR-shRNA. 2.3.4 Lentivirus Production The production of lentivirus was illustrated in figure 2-2. Two additional vectors (pCMVAR8.2 and pMD.G), which encode viral integrase, protease, reverse transcriptase, capsid and matrix proteins, and vesicular stomatitis virus G protein, were used for lentiviral packaging and pseudotyping. Briefly, 40pl of lipofectamine 2000 (Invitrogen, 11668-019) was diluted in 1.5ml of OPTI-MEM I medium (31985, Invitrogen) for 5 minutes, and then combined with another 1.5ml OPTI-MEM I medium containing DNA mixture of 10pg pHR-shRNA, 7.5pg pCMVAR8.2, and 2.5jug pMD.G for 30 minutes. The lipofectamine 2000 and DNA mixture was added to poly-L-lysine (P4832, Sigma) coated culture dishes with 5ml of 10%-FBS containing OPTI-MEM I medium, and then 5ml of 293T HEK cells at 2.0xl06/ml were added. Medium was replaced with 6ml of DMEM medium with 10% FBS and 1% antibiotics-antimycotic next day. Viral supernatants were then collected for 4 consecutive days, cell debris were removed by centrifugation at 1500 rpm for 10 minutes and subsequent filtration through 0.45pm syringe filter. All viral supernatants were pooled, and concentrated 25-fold using Centricon Plus-20 Centrifugal Filter Units (cutoff molecular weight of 100KD, Millipore, UFC2BHK08), aliquoted and stored at -80°C. 2.3.5 Lentivirus Production for EL Overexpression A new lentiviral expression system (lentiviral vector pWPI plus two packaging vectors psPAX2 and pMD.2G, TronoLab) was used for EL overexpression. EL cDNA was separated from pDNA5-FRT-EL (kind gift from Dr. Howard Wong, UCLA) after PME I digestion. Gel-purified EL cDNA was then ligated into PME I site of lentiviral vector pWPI using T4 ligase of the rapid ligation kit (Roche Applied Science). Top 10 E. Coli were then transformed and streaked on ampicillin+ agar medium, positive clones were isolated and designated as pWPI-EL. The direction and sequence fidelity of EL cDNA were confirmed by DNA sequencing using 134 sliRN.4 N R EL cDNA I cmivir.tl Vector (pHR-CMV.EGFP oi pWTI) / — ' » ' — ! ] -v pCM\ AR8.2 or psPAX2 pMD.G or A . Cotraiisfection of 293T cells for lentiviral production B . Concentration and titration of lentivirus Lentivi!al RNA I mRNA \P\f\' 1 Assembly, Packaging and Budding C. Lentiviral transduction of monocytes \ CtMWM Figure 2-2. I l lustrat ion o f Len t iv i rus product ion and transduction o f monocytes for l ipase suppression and overexpression 135 forward primer CTCCTTGGAATTTGCCCT (at the site of 3201) and reverse primer TCAACAGACCTTGCATTC (at the site of 3690) (Appendix 5). The procedure for lentiviral production was the same as for shRNA. 2.3.6 Lentiviral Titration 293T HEK cells (5 x 105cells/well) were seeded in 6 well plates for 1 day, and then transduced with lentivirus by replacing with DMEM culture medium where stock virus was serially diluted by 1:100, 1:1000, 1:10,000, and 1:100,000. 293T cells were also counted in number at the same day for the titer calculation. Three days after transduction, 293T HEK cells were collected after trypsinization and re-suspended in culture medium, flow cytometry was applied to obtain the percentage of EGFP-positive 293T HEK cells. The lentiviral titers were calculated as follows: transduction units/ml = (average cell number at the time of transduction x % of GFP-positive cells)/100 x dilution factor. 2.3.7 Lentiviral Transduction of Monocytes/Macrophages THP-1 monocytes (5 x 105/well) were seeded in 12-well plate, and transduced at the same day with lentivirus at various multiplicity of infection (MOI). After 48 hours, monocytes were collected for FACS analysis to evaluate the transduction efficiency. Meanwhile, monocytes were also differentiated with lOOnM phorbol 12-myristate 13-acetate (PMA, Sigma-Aldrich, PI585) for additional 72 hours. Fluoroscopy was used to assess EGFP expression in mature macrophages. The optimal MOI was chosen for subsequent experiments. 2.3.8 Construction of EL-Expressing FLP-IN 293 Cell Line EL cDNA was transferred from pcDNA6/EL (A kind gift from Dr. Howard Wong, UCLA) into Pme I site of pcDNA5/FRT, and confirmed by sequencing (CMV forward primer: 5 '-CGCAAATGGGCGGTAGGCGTG-3', and BGH reverse primer: 5'-TAGAAGGCACAGTCGAGG-3', Appendix 5). A stable EL-expressing FLP-IN 293 cell line was constructed using the Flp-In™ System (Figure 2-3, Invitrogen). Briefly, one day before transfection, FLP-IN 293 cells (3 x 106) were cultured in growth medium without antibiotics in a 10cm culture dish. lOpg DNA (9pg pOG44 and lpg pcDNA5/FRT/EL) in 1.5ml of Opti-MEM® I Reduced Serum Medium were combined with 20pl of lipofectamine 2000 and 136 incubated at room temperature for 20 minutes, then added to 293 FLP-IN cell culture. Medium was replaced at 24 hours, and cells were passaged at 1:10 the next day under the selection pressure of 50pg/ml hygromycin. Selection medium with hygromycin was replaced every 3-4 days until cell foci were identified. 5-10 foci were isolated and expanded in new culture dishes. Conditioned culture medium was evaluated for trioleinase activity. Monoclonal FLP-IN 293 cells with highest trioleinase activity were selected for EL expression (named FLP-IN 293 EL cells). © Expression of lacZ and Zeocin fusion gene / / pSV-40 ATG FRT Amp^pUC ori ,, y Flp-ln 293 cell > 1. pFRT/lacZeo is stably transfected to generate Zeocin-resistent Flp4n 293 cells. 2. The pcDNA5/FRT vector containing EL cDNA is cotransf ected into FLP-ln 293 cells with pOG44 vector expressing Flp recombinase. © Amp 3. Integration of the expression construct allows transcription of EL and confers hygromycin resistance and zeocin sensitivity to Flp-ln 293 cells. Expression of hygromycin pUC ori Amp pCMV FRT Hygromycin Expression of EL EL BGH p Amp pUC ori ZZD4 Flp-ln 293 cell y / Figure 2-3. The generation of FLP-IN 293 cells stably expressing EL. EL cDNA was extracted from pcDNA6/EL and inserted into Pmel sites in pcDNA5/FRT, the latter was then cotransfected with pOG44 into FLP-IN 293 cells. The transfected cells were selected by hygromycin to obtain EL-overexpressing FLP-IN 293 cell line. {Modifiedfrom the manual of FLP-IN system for stable cell line generation, Invitrogen.) 2.3.9 E L Purification AKTA FPLC system (GE Health) was used for EL purification. Heparin-challenged conditioned Opti-MEM medium from FLP-IN 293 EL cells was collected for consecutive 5-7 days, centrifuged and 0.45um filtered to remove the cell debris, and then diluted with the equal 137 volume of sample buffer (50mM Tris-HCl, 0.15M NaCl, 20% glycerol, pH 7.4). HiTrap heparin column (GE Health, 5ml) was equilibrated with five volumes of equilibration buffer (50mM Tris-HCl, 0.15M NaCl, 10% glycerol, pH 7.4). Diluted sample was loaded onto column at the speed of 5ml/min, heparin-bound proteins were then eluted with 5 column volumes in gradient concentration from 0% to 100% of elution buffer (50mM Tris-HCl, 2.0M NaCl, 10% glycerol, pH 7.4) at the speed of 2ml/min (Figure 2-4). Fractionates were desalted using PD-10 columns (GE Health), and assessed for trioleinase activity and protein concentration. - HiTrap hepar in 5 m i column for EL0O1:1_UV HiTrap hepar in 6 m ! co lumn for EL001:1__Cond Ml y T <s P -r • ami •* ••* • • EUX'i V * HiTrap heparin flml column for E U J O I :1 fractions Loading of Conditioned Medium Elution by Gradual Increase of Elution Buffer 137.40 126,68 126.84 [35.36 [43.56 151,69 [59.71 167,92 176.08 |83.89 | 93.47 1102.20] j _ ,| "SB" IB" irio IS" A: HiTrap heparin 5ml column for EUP01:1_UV@47,PEAK Figure 2-4. EL purification from heparin-challenged conditioned medium in EL-overexpressing FLP-IN 293 cells. Fractionates were analyzed for trioleinase activity, with highest activity of 16.4nmoles/min/ml at the UV peak of 137.40mAU. Pooled EL preps from fractionates 7-11 had a trioleinase activity of 4.6nmoles/min/ml, compared to 0.05nmoles/min/ml in control preps from FLP-IN 293 cells. 2.3.10 Up-regulation of Endogenous Lipoprotein Lipase in Macrophages Dexamethasone (DXM) has been shown to upregulate the LPL gene expression in THP-1 cells.29 After 24 hours of PMA stimulation, THP-1 macrophages were treated with 0.1 uM dexamethasone for 48 hours in order to upregulate endogenous LPL expression. 2.3.11 Trioleinase Activity Assay LPL preferentially catabolizes triglyceride to release free fatty acids, and its triglyceridase activity is apoCII-dependent and salt-sensitive. Trioleinase activity was measured in heparin-challenged conditioned medium for LPL activity using a triolein emulsion containing 138 radiolabeled triolein as described previously.30 Briefly, lOOul of 7.5mg/mg triolein (Sigma), lOOul of l.Omg/ml phosphatidylcholine (Sigma), and 50uCi [3H]-triolein (Amersham) were combined and dried under nitrogen gas stream. For total trioleinase activity, dried lipids were added with 2.1ml of low salt-buffer (0.2M Tris-HCl, 0.15MNaCl, and pH 8.2) plus 0.4ml of 1% BSA in low salt buffer, and emulsified by sonication at 50% pulse and lowest power setting for 8 minutes (Sonifier Cell Disruptor 350, Branson Sonic Power Co.). Thereafter, 0.5ml of 4% BSA in low salt buffer and apoCII at final concentration of 2uM were added to the lipid emulsion. The salt-resistant trioleinase activity was measured in lipid emulsion where the same lipid composition was emulsified in high salt buffer (0.2M Tris-HCl, IM NaCl, and pH 8.8) without apoCII supplementation. 20ul of heparin-challenged conditioned medium was added to 80ul of either low-salt or high-salt buffer, and then lOOpl of substrate in low-salt or high-salt buffer were added to corresponding tubes and incubated at 37°C for 30 minutes. The reaction was terminated by adding 3.25ml of chloroform:methanol:heptane (1.25:1.41:1). The phases were separated by the addition of 1.05ml of 0.1M H 3 C 0 3 and 0.1M K 2 C 0 3 , pH 10.5 and centrifugation at 1500xg for 10 minutes after 15 seconds of vigorous vortexing. 1ml of the upper phase was aliquotted into scintillation tubes, mixed with 4ml of ACS scintillation fluid (Amersham), and counted for radioactivity. The trioleinase activity was calculated as: r r . • , • • • , / • , ,N rr- • radioactivityicpm) ™ T _,T Trioleinase activity (nmol/min/ml) = coefficient x — - — . The LPL activity was volume x time represented by the apoCII-dependent and salt-sensitive portion of total trioleinase activity. 2.3.12 Phospholipase Activity Assay EL preferentially hydrolyzes phospholipids more than triglycerides, so an in-well phospholipase activity assay modified from literatures was utilized to evaluate the EL activity 3 1 ' 3 2 . Briefly, self-quenched fluorescent substrate bis-BODIPY FL Ci i-PC (Invitrogen, B7701) sonicated in PBS was added into 1ml of cell culture at final concentration of 4pg/ml for 1 hour at 37°C in the presence of 10 units of heparin. 200ul of culture medium was transferred into a 96-well microplate and measured at excitation/emission wavelength of 488/530 nm for the fluorescence intensity, which was normalized for the total cellular protein. 139 2.3.13 Real-Time One-step Quantitative Reverse Transcription PCR (qRT-PCR) Total RNA was isolated from macrophages using RNAqueous® -4PCR (Ambion, 1914). 25pi of the reaction system for real-time one-step qRT-PCR was assembled with 0.5ul of Superscript III RT/platinum Taq mix, 12.5ul of 2X reaction mix, (Superscript™ III One-Step RT-PCR System with Platinum® Taq High Fidelity, Invitrogen, 12574-035), lOul of DEPC-treated ddH20, lul of RNA sample, and lp.1 of Assays-on-Demand primer set of either 18S rRNA (Hs99999901_sl), LPL (Hs00173425_ml), or EL (Hs00195812_ml). The reaction was carried out on ABI PRISM® 7900HT system with the parameter setting as followings: 50°C for 30 minutes, 95°C for 15 minutes, followed with 40 cycles of 95°C for 15 seconds and 60°C for 60 seconds. The standard curves were made using serially diluted RNA samples. 18S rRNA served as the internal control. 2.3.14 uMACS Microbead-based Immunoprecipitation Macrophages (5 x 106) were washed with ice-cold PBS twice, and then lysed in RIP A buffer supplemented with protease inhibitor cocktail (Sigma-Aldrich, P8340) on ice for 15 minutes. Lysates were scraped into microtubes and passed through small pipette tip several times, and then centrifuged at 10,000 rpm and 4°C for 5 minutes. The supernatants were collected, mixed with l~2ug of primary antibody (Rabbit anti-EL polyclonal antibody, Cayman Chemical; Mouse anti-LPL monoclonal antibody 5D2, kind gift from Dr. John Brunzell) and 50ul of protein A microbeads (Miltenyi Biotec, 130-071-001), and incubated on ice for 30 minutes. Thereafter, lysate-microbead mixture was loaded into p-columns which were mounted on uMACS separator and pre-equilibrated with 200 pi lysis buffer, letting the solution flow through by gravity, p-columns were then rinsed with 4 x 200 pi of RIP A lysis buffer, and 1 x 100 pi of low salt wash buffer (1% NP-40, 50mM Tris-HCl, pH 8.0). Bound analyates were eluted by adding 20ul of 95°C lx SDS loading buffer (50mM Tris-HCl, 50mM DTT, 1% SDS, 0.005% bromophenol blue, 10% glycerol) for 5 minutes, followed by additional 50ul of 95°C lx SDS loading buffer. 2.3.15 Western Blot For the regular Western blot, macrophages (5x 106) were lysed in RIP A lysis buffer supplemented with protease inhibitor cocktail (Sigma) and scraped into microtubes. Cell lysates 140 were obtained by collecting the supernatants after centrifugation at 10,000 rpm at 4 °C for 5 minutes. Cell lysates were quantitated for protein concentration, and equal amounts of total protein (20 pg) were mixed in lx Laemmli sample buffer (2x Laemmli sample buffer for 100ml: 40ml of 10% SDS, 12.5ml of IM Tris, pH6.8, 30ml of glycerol, 1ml of P -mercaptoethanol, 20pg of bromophenol blue, and 16.5ml of H 2 0) and boiled for 5 min. For electrophoresis, cell lysate samples and uMACS eluates were loaded onto 5% or 7.5% SDS-PAGE gel and electrophoresed in SDS running buffer (3.03g Tris base, 14.4g glycine, l.Og SDS inlL H2O) at 200v for 45-60 min. Gel-sized PVDF membrane (Millipore Immobion-P) was wetted in methanol for 30 seconds, then soaked in transfer buffer (14.4g Glycine, 3.0g Tris base, 0.75g SDS, 200ml Methanol, and 800ml H2O). The resolving gel was sandwiched in the order of (anode) sponge-filter paper-PVDF membrane-resolving gel-filter paper-sponge (cathode), and electrotransferred at lOOv and 4 °C for 1-1.5 hour. The PVDF membrane was blocked in Superblock buffer (Pierce) for 1 hour, and then incubated with primary antibodies (1:1000 dilution) with gentle shaking at 4°C overnight. After 3 times washes with TBS-Tween 20, the blot was incubated with secondary HRP-conjugated antibody (1:1000 dilution, either anti-Rabbit or anti-Mouse) with gentle shaking for 1 hour. The PVDF membrane was washed again with TBS-Tween 20 for 3 times, and then Supersignal West Femto Maximum Sensitivity substrate (Pierce, 34095) was added. The chemiluminescent signal was captured and quantitated by ChemiGenius2 system (SYNGENE, Frederick, MD USA). 2.3.16 ApoAI Mediated Cholesterol Efflux THP-1 (5xl05) cells stimulated with lOOnM PMA in 12-well plates and FLP-IN 293 EL (2xl05) cells in 6-well plates were cultured for 48 hours, and then labeled with luCi/ml 3H-cholesterol in base medium (For macrophages: RPMI 1640 containing 1% antibiotics-antimycotic, 2% bicarbonates, 1% pyruvate, 0.2% BSA, and lxlO"7 M PMA; For FLP-IN 293 cells: D M E M medium containing 1% antibiotics-antimycotic, and 0.2% BSA) for 24 hours. After two-hour equilibration with base medium, cholesterol efflux was induced with lOpg/ml apoAI in base medium for 4 hours. Exogenous bLPL or EL was added during the efflux stage. Cholesterol efflux is represented as the percentage of medium cpm to total cpm (medium plus cellular cpm), and apoAI-mediated cholesterol efflux is calculated as the total cholesterol efflux minus basal cholesterol efflux which is measured in the absence of apoAI. During cholesterol efflux, lOunits/ml heparin and 50ug/ml tetrahydrolipstatin (THL, kind gift from Hoffmann La Roche) 141 were added into cholesterol efflux medium alone or in combination to evaluate the contributory roles of lipolytic and non-catalytic functions. 2.3.17 ApoAI Binding Assay ApoAI was labeled with fluorescent dye Alexa Fluor 532 (Invitrogen) following manufacturer's instruction. Briefly, lOOul of IM sodium carbonate was added into 1ml of apoAI solution (concentration < 2mg/ml) to raise the pH value, and then the mixture was transferred into reaction vial containing fluorescent dye Alexa Fluor 532. Reaction vial wrapped in aluminum foil was placed on a magnetic stirrer and stirred at room temperature for 1 hour. The mixture was then dialyzed against two changes of 500 ml of PBS at room temperature for 1 hour. Optimal labeling degree of 4 moles dye per mole protein was obtained. The apoAI binding protocol was modified from literature,33 lOpg/ml fluorescence-labeled apoAI was added into cell culture in base medium for 4 hours, then washed with 0.2% BSA-PBS and PBS twice each. Cells were lysed in RIPA buffer, 200pl supernatants were measured for fluorescence at the excitation/emission wavelength of 53 l/554nm, and bound apoAI was calculated from a standard curve, and normalized for total cellular protein. 2.3.18 Characterization of ABCA1 Expression ABCA1 expression was evaluated at mRNA and protein levels. mRNA was isolated and quantitated by real-time qRT-PCR (Assay-on-demand ABCA1 primer set: Hs00194045_ml). Cell lysates were electrophoresed and transferred onto PVDF membrane, then detected by ABCA1 antibody (Abeam). The detailed procedures are described above. 2.3.19 Analysis of Cell Membrane Lipid Composition Lentivirus-transduced macrophages (5xl06) were detached using 1% EDTA-PBS solution and collected in a glass tube. Trypsinized 293-FLP-IN cells were collected as well. After a single PBS wash, cells were resuspended in 3 ml of chloroform/methanol (1:2) plus an additional 0.8 ml of distilled water, and vortexed vigorously for 30 seconds. After 30 minute incubation at room temperature, the mixture was centrifuged at 3000 rpm for 5 minutes, and the organic phase on the bottom was carefully transferred by glass pipettes into a filter paper-lined funnel. The filtrates collected in glass tubes were dried under a nitrogen gas stream, and then re-dissolved in 80uL of chloroform/methanol (1:2) and transferred onto an HPLC column with the addition of 142 50uL of betulin reference standard, and dried under nitrogen. The dried sample was re-dissolved in HPLC solvent (4:6:1:1 of chloroform/methanol/hexane/acetone in volume ratio) for analysis. Lipid composition was quantified using a method as described by Sheila M. Innis and Roger A. 2.3.20 Statistical Analysis All parametric data are presented as mean ± standard error of the mean. Data were analyzed with Prism 4 for Windows (GraphPad Software, Inc.) using either student's t test or two-way ANOVA, p value less then 0.05 was considered to be significant. 143 2.4 Results 2.4.1 Lentiviral Titration and Transduction Lentivirus containing either shRNA or EL cDNA was produced and titrated in 293T HEK cells, with a typical titer of 2~4x 10 transduction units/ml when concentrated by 25 fold. Lentivirus has been reported to have high transduction efficiency in a variety of cells including several terminally differentiated or non-dividing cells. However, the experience in monocytes/macrophage transduction is still limited, and differentiated macrophages are generally difficult to transduce, so THP-1 monocytes were transduced with lentivirus before PMA stimulation in order to increase the transduction efficiency. Two days after lentiviral transduction, monocytes were analyzed by FACS for EGFP expression. The results showed that 83% of monocytes expressed EGFP at MOI of 10, and 100% of monocytes were positive for EGFP at MOI of 20, meanwhile, the mean fluorescent intensity increased by 5 fold from MOI of 10 to MOI of 20 (Figure 2-5 A~C). Figure 2-5. The quantitation of transduction efficiency by FACS and fluoroscopy. Monocytes were transduced by lentivirus for 48 hours and evaluated by FACS for EGFP positivity; meanwhile, monocytes were differentiated into macrophages by PMA stimulation for 3 days, and assessed for EGFP expression under fluoroscope. Panel A. FACS and fluoroscope images at MOI of 0; Panel B. FACS and fluoroscope images at MOI of 10; Panel C. FACS and fluoroscope images at MOI of 20. (X axis: logrithium of fluorescence, Y axis: cell counts) 144 The EGFP expression was also verified by fluoroscopy in macrophages after three days of PMA stimulation. Consistent with FACS results, the percentage of EGFP positive macrophages under the fluoroscope increased accordingly with the increase of MOI value, and almost all macrophages were expressing EGFP with higher fluorescent intensity at MOI of 20 in comparison to that at MOI of 10 (Figure 2-5 B and C). Therefore, the MOI of 20 was chosen as the optimal lentiviral concentration for later experiments. 2.4.2 Lipase Knockdown by shRNA Lentivirus A morphologic observation showed that macrophages were fully differentiated 3 days after PMA stimulation, meanwhile, the expression of LPL and EL after PMA stimulation showed that the mRNA and protein/activity levels of LPL and EL reaches the peak at day 2 and day 3, respectively (Figure 2-6 A and B). Therefore, heparin-challenged conditioned medium and mRNA were collected at day 3, and analyzed by lipase activity/protein and real-time qRT-PCR, respectively. Figure 2-6. Lipase expression profile in macrophages after PMA stimulation. Panel A. LPL mRNA and trioleinase activity; Panel B. EL mRNA. Compared to the lentivirus containing a scrambled shRNA sequence, shRNA-lentivirus targeting LPL caused an 83% decrease in mRNA level (Figure 2-7A). LPL-shRNA lentivirus also led to a 70% decrease in apoC-II dependent, salt-sensitive trioleinase activity in heparin-challenged medium (Figure 2-7A). Correspondingly, the LPL protein level was decreased by more than 70% as determined by immunoprecipitation-Western blotting (Figure 2-7C). EL-shRNA lentivirus reduced EL mRNA by 76% in comparison to scrambled shRNA lentivirus as analyzed by qRT-PCR (Figure 2-7D). An in-well phospholipase assay, a method for the measurement of all-source phospholipase activity, was implemented in the culture condition 145 with the heparin addition. A reduction of 35% in total phospholipase activity was detected in EL-shRNA lentivirus (Figure 2-7D). The suppression of >70% E L was also evident on Western blot (Figure 2-7F). 120 10ft 8ft 6ft 4ft 2ft 0 B LPL Suppression by shRsIA Lentivirus • Central •LPL-UCF L J . x a 120 10ft o 8ft 1— c o 6ft (_> 4ft 2ft ft EL Suppression by shRNA Lentivirus • Cdrtrd C Z 1 B . - L C F I LPL mRNA Trioleinase Activity 3hospholipase Activity EL mRNA 'hospholipase Activit Trioleinase Activity D EL in LPL-LOF LPL in EL-LOF 125-1 * e o ° 5ft] * ft 15fti 1004 ss 504 LPL-LOF EL-LOF Control EL-LOF Figure 2-7: The suppression of L P L and EL by lentivirus containing shRNA specific for each lipase. Monocytes were transduced by shRNA lentivirus for 48 hours prior to P M A stimulation, and total R N A and heparin-challenged conditioned medium at day 3 of P M A stimulation were collected for real-time qRT-PCR, lipase activity, and Western blotting analyses. Panel A . L P L mRNA, trioleinase activity, and phospholipase activity; Panel B. E L mRNA expression in L P L suppressed macrophages. Panel C. L P L protein in Western blot; Panel D. E L mRNA, total phospholipase activity, and trioleinase activity; Panel E. L P L mRNA expression in EL suppressed macrophages. Panel F. E L protein in Western blot (the representative of 3 individual blots). Statistical comparisons between control and lipase suppression (LPL-LOF or EL-LOF) are indicated as: * p<0.05, ** p<0.0T. In order to exclude the cross-reactivity between L P L and E L shRNAs, each lipase other than shRNA target was evaluated by qRT-PCR and lipase activity. The results showed that there was no suppression or compensatory upregulation of the non-targeted lipase in each case (Figure 2-7 146 B and E). EL suppression did not cause significant decrease in trioleinase activity (Figure 2-7D), in contrast, the phospholipase activity in LPL-shRNA lentivirus transduced macrophages was moderately decreased by -20% (Figure 2-7A), suggesting LPL may contribute to a considerable portion of total phospholipase activity. 2.4.3 Lipase Overexpression in Macrophages and FLP-IN 293 Cells 29 DXM has been reported to be able to increase LPL expression in macrophages, thus, macrophages were treated with DXM to create an LPL-overexpressing cell model. The treatment of macrophages with 48-hour DXM significantly increased LPL mRNA by 12.8 fold, with a corresponding 3.6 fold increase in apoCII-dependent, salt-sensitive trioleinase activity (Figure 2-8 A). Despite the decreased expression of EL mRNA after the LPL overexpression by DXM, there was no significant change in total phospholipase activity (Figure 2-8 A and B). Lentivirus containing EL cDNA (EL lentivirus) was constructed with the similar transduction efficiency as lentivirus used for lipase suppression. At MOI of 20, EL lentivirus markedly increased EL mRNA by >100 fold (Figure 2-9A). Meanwhile, the EL protein was increased by 4.4 fold as shown on Western blot (Figure 2-9C). The drastic increase of EL mRNA transcription may overwhelm the mRNA translation machinery, which may explain the disproportionate increase in EL protein compared to mRNA expression. Accordingly, total phospholipase activity after EL-cDNA introduction by lentivirus was elevated by 50% (Figure 2-9A). Interestingly, LPL mRNA was decreased by 57% after EL overexpression, however, the total trioleinase activity was not affected (Figure 2-9 A and B), suggesting that EL over-expression compensates for the loss of triglyceridase activity associated with LPL down-regulation. Utilizing the facility of Flp-ln™ system, we generated stable FLP-IN 293 EL cells under the selection pressure of hygromycin. In a monoclonal FLP-IN 293 EL cell line, EL mRNA was markedly increased by more than 2000 fold when compared to the untransfected FLP-IN 293 cells, and the total phospholipase activity and EL protein increased by >4- and 6-fold, respectively (Figure 2-10 A and B). In addition, EL overexpression also led to a 1.9 fold increase in the trioleinase activity (Figure 2-1 OA). The 293 cell line expresses LPL at very low level, so the increased trioleinase activity was most likely due to the EL overexpression. 147 LPL Upregulation by DXM 140(h 12004 1000-L I Control DXM-LPL D- • 0-„1XL > " n 0-I—I L_ nn LPL mRNA 125-1 100-| J «H 25 0 Trioleinase Activity Phospholipase Activity E L in DXM-LPL B Control Control i DXM-LPL D X M Figure 2-8: The L P L overexpression in macrophages. Monocytes were differentiated into macrophages by P M A stimulation for 3 days with simultaneous addition of D X M for 48 hours. L P L mRNA, trioleinase activity and protein levels were analyzed. Panel A . L P L mRNA (n=4), trioleinase activity (n=7), and phospholipase activity (n=4) after D X M stimulation. Panel B. E L mRNA after D X M treatment in macrophages. Panel C. L P L protein in Western blotting (the representative of two individual blots). Statistical comparisons between control and D X M treatment (DXM-LPL) are indicated as: *** pO.OOl. 148 EL Overexpression by EL cDNA Lentivirus 12500-11250-= 10000* O 200T IOO4 I E L m R N A • Control CZ2 EL-QOF P h o s p h o l i p a s e A c t i v i t y T r i o l e i n a s e A c t i v i t y B 125^  LPL mRNA at EL-GOF C o n t r o l Control E L - G O F V-EL-GOF C Figure 2-9. The E L overexpression in macrophages. Monocytes were transduced by lentivirus containing E L cDNA for 2 days, followed by P M A stimulation for 3 days. Panel A. E L mRNA (n=4), total phospholipase activity (n=4), and trioleinase activity (n=4) levels; Panel B. LPL mRNA in EL-overexpressing macrophages. Panel C. E L protein in Western blotting (The representative of 3 individual blots). Statistical comparisons between control and E L overexpression (EL-GOF) in macrophages are indicated as: *** pO.001. 149 250000 200000 o 15000O | 10000O o a»T se 300-20O 10O 0 EL Overexpression in FLP-IN293 Cells *** CD293 • 293 EL EL mRNA T Phospholipase Activity Trioleinase Activity 293 293 FX B Figure 2-10. The E L overexpression in FLP-IN 293 cells. FLP-LN 293 cells were stably transfected with E L cDNA, EL mRNA, total phospholipase activity, and protein levels were analyzed. Panel A. E L mRNA (n=4) and total phospholipase activity (n=6) levels. Panel B. E L protein in Western blotting (the representative of 2 individual blots). Statistical comparisons between control (293) and lipase overexpression (293 EL) in FLP-LN 293 cells are indicated as: * p<0.05, ** pO.01. 2.4.4 Lipases Promote Apo Al-mediated Cholesterol Efflux In this study, apoAI was used to induce the cholesterol efflux in macrophages radiolabeled with 3Ff-cholesterol. Before the study, the kinetics of cholesterol efflux by apoAI was performed, showing that apoAI mediated cholesterol was saturated after 8-16 hours, even though the total effluxed cholesterol still increased with prolonged incubation (Appendix 6). The continuous increase in non-apoAI mediated cholesterol efflux could be most likely due to free diffusion, other mediators like bovine serum albumin in the medium could be cholesterol acceptors.35 Therefore, a four-hour incubation period with apoAI was chosen to evaluate the lipase effect on cholesterol efflux. When macrophage LPL and E L were suppressed by lentivirus, apoAI-mediated cholesterol efflux was moderately but statistically significantly decreased by 18% to 20%, respectively (Figure 2-11 A). This finding was reproduced in lipase-overexpressing macrophages, where apoAI-mediated cholesterol efflux was increased by almost 2 fold in DXM-treated macrophages, 150 and this effect was eliminated when DXM-induced LPL upregulation was abolished by LPL shRNA (Figure 2-1 IB). ApoAI mediated cholesterol efflux increased by ~1.5 fold in EL-overexpressing macrophages (Figure 2-1 IC). The stimulatory effect of EL on apoAI-mediated cholesterol efflux was also observed in FLP-IN 293 cells, with 2.3 fold increase in FLP-IN 293 EL cells compared with the control cells (Figure 2-1 ID). ApoAI-mediated Cholesterol Efflux in THP-1 Macrophages ApoAI-mediated Cholesterol Efflux in THP-1 Macrophages x S i i I 2 .C "1 Control LPL-LOF EL-LOF 12.5" X | 10.0-LU O 7.5-0 ) «a </> j> 5.0-o " 2.5-0.0- Control DXM DXM+LPL-LOF A B ApoAI-mediated Cholesterol Efflux in THP-1 Macrophages Control EL-GOF 1 5 -3.0-25-Z0-1.5-1.0-0.5-ArxjAI-rnediated Cholesterol Efflux in FLP-IN293 Cells o.r> X 293 293 EL D Figure 2-11: The effect of lipase suppression and overexpression on apo AI-mediated cholesterol efflux in macrophages and FLP-FN 293 cells. Cholesterol efflux was induced by lOug/ml apoAI for 4 hours. Panel A. apoAI-mediated cholesterol efflux in lipase suppressed macrophages (n=10); Panel B. apoAI-mediated cholesterol efflux in DXM treated macrophages (n>6); Panel C and D. apoAI-mediated cholesterol efflux in EL-overexpressing macrophages and FLP-IN 293 cells (n>6). Statistical comparisons between lipase suppression (LPL-LOF or EL-LOF), overexpression (DXM-LPL, EL-GOF, or 293 EL) and controls are indicated as: *** pO.001 The above findings were also verified in macrophages treated with exogenous lipases. When macrophages were treated with exogenous bovine LPL (bLPL), there was a dose-dependent increase in apoAI-mediated cholesterol efflux, with a 51% increase at the concentration of 5ug/ml (Figure 2-12A) In parallel, the addition of exogenous EL into macrophages dose-151 dependently increased apoAI-mediated cholesterol efflux with an increase of 25% at a concentration of 0.5ug protein/ml (Figure 2-12B). Bovine LPL Effect on ApoAI-Mediated Cholesterol Efflux in Macrophages Exogenous EL Effect on ApoAI-Mediated Cholesterol Efflux in Macrophages 1 4-0 1 2 3 4 bLPL Concentration (ug/ml) 5 0 1 2 3 4 EL concentration(ug/ml) 5 A B Figure 2-12. The effect of exogenous lipases on apoAI-mediated cholesterol efflux in macrophages. Cholesterol efflux was induced by lOug/ml apoAI in the presence of either bovine LPL or EL in macrophages. Panel A. The dose-dependent increase of apoAI-mediated cholesterol efflux by bovine LPL (bLPL) (n=4); Panel B. The dose-dependent increase of apoAI-mediated cholesterol efflux by exogenous human EL (n=4). Statistical comparisons between control (Oug/ml) and exogenous lipase are indicated as: * p<0.05, ** p<0.01, *** p<0.001. 2.4.5 The Differential Role of Catalytic and Non-Catalytic Functions of Lipase in Cholesterol Efflux In order to understand the role of catalytic and non-catalytic functions of lipases, we used THL and heparin alone or in combination to eliminate the catalytic and non-catalytic function or both. THL was shown to completely inhibit the LPL and EL activity as analyzed by trioleinase assay. In DXM-treated macrophages, LPL-related, apoAI-mediated cholesterol efflux was significantly reduced by 61% after the addition of THL, and 60% when LPL was removed from cell surface by heparin treatment. The elimination of both catalytic and non-catalytic functions of LPL by combined treatment of THL and heparin almost abolished the LPL effect on apoAI-mediated cholesterol efflux (Figure 2-13A). In EL-overexpressing macrophages, the same pattern was also observed, with 59% and 29% decreases in EL-dependent, apoAI-mediated cholesterol efflux after THL and heparin treatment, respectively. With the inhibition of catalytic and non-catalytic functions of EL, 93% of the EL effect on apoAI-mediated cholesterol efflux was removed (Figure 2-13B). The same experiment was also repeated in FLP-IN 293 cells, catalytic 152 and non-catalytic functions of EL played a similar role in apoAI-mediated cholesterol efflux as in macrophages (Figure 2-13C). THL and Heparin Effects on LPL-Mediated Cholesterol Efflux in Macrophages •o 5 1 = ** **_ 2 m T3 _ 4) O 5 I25n 100^  75-50-25-X DXM-LPL THL Heparin THL+Heparin B THL and Heparin Effects on EL-Mediated Cholesterol Efflux in Macrophages 125' I E E 2 O O 100-1 75' 50 25 EL-GOF THL Heparin THL+Heparin THL and Heparin Effects on EL-Mediated Cholesterol Efflux in 293 Cells 125' «1 ?> !fc S t ra 111 11 o 100' _ 7 5 50 25 X 293 EL THL Heparin THL+Heparin Figure 2-13: The role of catalytic and non-catalytic functions of lipases in apoAI-mediated cholesterol efflux. Lipase-related, apoAI-mediated cholesterol efflux (clear bars of DXM-LPL, EL-GOF, and 293 EL) is expressed as 100%, the apoAI-mediated cholesterol efflux after the treatment of either THL, heparin alone or in combination (THL+Heparin) was expressed as percentage of lipase-related efflux. Panel A. ApoAI-mediated cholesterol efflux in D X M treated macrophages (n>6); Panel B. ApoAI-mediated cholesterol efflux in EL-overexpressing macrophages (n=6); Panel C. ApoAI-mediated cholesterol efflux in EL-overexpressing FLP-IN 293 cells (n=6). Statistical comparisons between treatment and non-treatment in lipase-related cholesterol efflux are indicated as: * p<0.05, ** p<0.01, *** pO.001. 2.4.6 The Effect of Lipases on Cholesterol Efflux Is Independent of ABC A l ApoAI mediated cholesterol efflux is largely through ABCA1 transporter, thus we investigated whether the expression of lipases would alter the ABCA1 expression. In lipase-suppressed macrophages, the ABCA1 mRNA and protein were not significantly changed compared to the control (Figure 2-14A). The increase of apoAI-mediated cholesterol efflux by E L is not accompanied with a parallel increase in ABCA1 expression as the ABCA1 mRNA and protein levels were not altered in EL-overexpressing macrophages or in FLP-IN 293 cells (Figure 2-14 153 B and C). However, ABCA1 levels in DXM-treated macrophages were considerably decreased by 62% in mRNA and 80% in protein, respectively (Figure 2-14B). Taking the increased cholesterol efflux after DXM treatment into consideration, it can be deduced that the enhanced apoAI-mediated cholesterol efflux by LPL in macrophages was independent of ABCA1. ABCA1 mRNA in Lipase-Suppressed THP-1 Macrophages o 1 2 5 l o 100-1 < § 5CH o m < Control LPL-LOF EL-LOF ABCA1 mRNA in Lipase-Oerexpressing THP-1 Macrophages 125-i 100-75-50-25-0-Control DXM-LPL EL-GOF Control LPL-LOF Control EL-LOF Control DXM Control E L -GOF B 0 120' 1 100. 293 293 293-EL 293-EL I N Figure 2-14. ABCA1 expression after lipase suppression and overexpression in macrophages and FLP-IN 293 cells. Panel A. ABCA1 mRNA (n>7) and protein (n=3) levels in lipase suppressed macrophages (LPL-LOF or EL-LOF); Panel B. ABCA1 mRNA (n>4) and protein (n=2) levels in DXM-treated (DXM-LPL) and EL-overexpressing (EL-GOF) macrophages; Panel C. ABCA1 mRNA (n=6) and protein (n=2) levels in EL-overexpressing FLP-IN 293 cells (293 EL). Statistical comparisons between control and lipase suppression (LPL-LOF or EL-LOF) or overexpression (DXM-LPL, EL-GOF, or 293 EL) are indicated as: ** p<0.01. 154 2.4.7 Lipases Increase ApoAI Binding via Bridging Function Since the stimulatory effect of lipases on apoAI-mediated cholesterol efflux was independent of ABCA1 expression in macrophages and 293 cells, we thereafter looked into the effect of LPL and EL on apoAI binding. With the suppression of LPL and EL, the apoAI binding was reduced by 32% and 34% respectively (Figure 2-15A). Compared to the control, the increased apoAI binding (empty part of clear bar) was observed in macrophages after the lipase overexpression, with 1.4- and 1.2- fold increases in DXM-treated and EL-overexpressing macrophages, respectively (Figure 2-15 B and C). The increased apoAI binding with ApoAI Binding in Lipase-Suppressed ApoAI Binding in DXM-Treated Macrophages Macrophages Figure 2-15. Apo AI binding in macrophages and FLP-IN 293 cells after lipase suppression or overexpression. The apoAI binding was measured in the absence or presence of THL and heparin. Panel A. apoAI binding in lipase-suppressed cells (LPL-LOF, EL-LOF) (n>4); Panel B. apoAI binding in DXM treated macrophages (DXM-LPL, n=4); Panel C. apoAI binding in EL-overexpressing macrophages (EL-GOF) (n=4). Panel D. apoAI binding in EL-overexpressing FLP-IN 293 cells (293 EL, n=4). Statistical comparisons between the control (shaded bar) and lipase suppression (LPL-LOF or EL-LOF, clear bar) or overexpression (DXM-LPL, EL-GOF, or 293 EL, clear bar) in the absence or presence of treatments are indicated as: * p<0.05, ** p<0.01, *** p<0.001; Statistical comparisons between with and without treatment in lipase-related apoAI binding (empty part of clear bar) are indicated as: ft p<0.01, |tt p<0.001. 155 macrophages by either LPL or EL was not abolished after the catalytic inhibition of each lipase by THL; by contrast, heparin treatment eliminated 79% and 80% of lipase-related apoAI binding (empty part of clear bar) in macrophages in LPL- and EL-overexpressing macrophages, respectively (Figure 2-15 B and C). A similar relationship was also seen in FLP-IN 293 cells, EL increased apoAI binding by 34%, which was inhibited by heparin (40%) but not THL treatment (Figure 2-15D). 2.4.8 Lipases Change Phospholipid Composition in Macrophages The fact that the catalytic inhibition of lipases decreased apoAI-mediated cholesterol efflux raised a question whether lipases could modify the membrane lipid composition and thus influence cholesterol efflux. Therefore, cell lipids were extracted from both lipase-suppressed and overexpressing macrophages and FLP-IN 293 cells for the analysis of phospholipid composition. With the suppression of LPL and EL by shRNA lentivirus in macrophages, the intracellular total cholesterol including cholesteryl ester and free cholesterol was decreased by ~40%. A significant decrease in triglyceride level was detected only in EL suppressed macrophages. The major phospholipid component, phosphatidylcholine (PC), was increased in both LPL- and EL-suppressed macrophages where lysophosphatidylcholine (LPC), the metabolite of phosphatidylcholine, was significantly decreased (Figure 2-16 A and B). The levels of phosphatidylinositol (PI) and phosphatidylethanolamine (PE) were also modestly increased in LPL- and EL-suppressed macrophages, respectively (Figure 2-16 A and B). When LPL expression was upregulated by DXM treatment, the level of PC was decreased by 35%, with a corresponding 23% increase of LPC. Similarly, 10% decrease in PC and 26% increase in LPC were observed in EL-overexpressing macrophages. Consistently, PE and sphingomyelin (SPH) were reduced in both LPL- and EL-overexpressing macrophages (Figure 2-17 A and B). EL overexpression increased intracellular cholesterol content by -10%. However, the cholesterol level in DXM-treated macrophages was surprisingly decreased, mostly due to a 49% reduction in free cholesterol (Figure 2-17 A and B). This change could be explained by the drastic increase in cholesterol efflux after DXM treatment. 156 Phospholipid Composition in LPL Suppressed Macrophages Control LPL-LOF LPC PC T C C E FC TG FFA C L PE PI PS SPH A •2 0.40 Q. f 0.35 n •g o.3o< O 0.25-c 0.20-3 O 0.15-n 0.10-S •j| 0.05 n aj 0.00 or Phospholipid Composition in EL Suppressed Macrophages Control EL-LOF LPC PC TC CE FC TG FFA CL PE PI PS SPH B Figures 2-16. Lipid composition in lipase-suppressed macrophages. Panel A. Lipid composition in LPL suppressed macrophages (n=3); Panel B. Lipid composition in EL-suppressed macrophages (n=3). (LPC: lysophosphatidylcholine, PC: phosphatidylcholine, TC: total cholesterol, CE: cholesteryl ester, FC: free cholesterol, TG: triglycerides. FAA: free fatty acids, CL: cardiolipin, PE: phosphatidylethanolamine, PI: phosphatidylinositol, PS: phosphatidylserine, SPH: sphingomyelin. Statistical comparisons between the control and lipase suppression (LPL-LOF or EL-LOF) are indicated as: * p<0.05, ** p<0.01, *** p<0.001. The EL overexpression in FLP-IN 293 cells markedly increased cholesteryl ester and triglyceride levels by 4- and 1.7-fold, respectively. In parallel to the findings in lipase-overexpressing macrophages, a 14% reduction in PC and a corresponding 31% increase in LPC were detected in FLP-IN 293 EL cells as well (Figure 2-17C). 157 DXM-LPL Control DXM-LPL LPC PC TC CE FC TG FFA CL PE PI PS SPH A (A I 0.3i CO o 0.2-1 3 o E 0.1H m 0 > lo-oiOP 02 LPC PC TC EL-GOF Control EL-GOF CE FC TG FFA CL PE PI PS SPH B 293-FLP-1N-EL LPC PC TC CE FC TG FFA CL PE PI PS SPH • 293 C Z l 293 EL - t i P -Figure 2-17. Lipid composition in lipase-overexpressing macrophages and FLP-IN 293 cells. Panel A. Lipid composition in DXM-treated macrophages (n>2); Panel B. Lipid composition in EL-overexpressing macrophages (n=3); Panel C. Lipid composition in EL-overexpressing FLP-IN 293 cells (n=3). (LPC: lysophosphatidylcholine, PC: phosphatidylcholine, TC: total cholesterol, CE: cholesteryl ester, FC: free cholesterol, TG: triglycerides. FAA: free fatty acids, CL: cardiolipin, PE: phosphatidylethanolamine, PI: phosphatidylinositol, PS: phosphatidylserine, SPH: sphingomyelin) Statistical comparisons between control and lipase overexpression (DXM-LPL, EL-GOF, or 293 EL) are indicated as: * p<0.05, ** p<0.01, *** p<0.001.) 158 2.4.9 Lysophosphatidylcholine Stimulates ApoAI-mediated Cholesterol Efflux The effect of LPC on apoAI-mediated cholesterol efflux was also investigated in macrophages. With the increase in LPC concentration, apoAI-mediated cholesterol efflux was increased in a dose-dependent manner, with an 80% increase at the concentration of lOuM. (Figure 2-18). Lysophosphatidylcholine Effect on ApoAI-Mediated Cholesterol Efflux in Macrophages 25-X efflu 20-o 15-4> to a 10-chol 0-1 1 1 1 1 1 0 5 10 15 20 25 Lyso-PC (uM) Figure 2-18. Lysophosphatidylcholine (lyso-PC) effect on apoAI-mediated cholesterol efflux. Cholesterol efflux was induced by lOug/ml apoAI in macrophages at the various concentrations of lysophosphatidylcholine (n=3). Statistical comparisons between no lyso-PC and lyso-PC treatments are indicated as: ** p<0.01. 159 2.5 Discussion Lentivirus appears to be promising and advantageous in gene therapeutical modalities. The integration of HIV virus into the host genome does not necessitate cell division as successful transductions of differentiated cells and non-dividing cells (growth-arrested fibroblasts or non-dividing neuron, dendritic cells, and rat cardiac myocytes) have been reported. " In our experiment, we utilized the lentivirus to either suppress or increase lipase expression in monocytes/macrophages, achieving 100% transduction efficiency at MOI of 20 which was also confirmed by EGFP expression under the fluoroscope. Positive EGFP expression was still detected in -60% monocytes two weeks after the lentivirus transduction. Theoretically, a stable lentivirus-transduced THP-1 cell line could be established by fluorescence-activated cell-sorting. Lentiviral transduction introduced shRNA and EL cDNA into cells efficiently, with more than 75% suppression of target lipase and >100-fold increase of EL mRNA. Taken together, these results support that lentivirus can be used as a potential therapeutical tool to deliver either shRNAs or transgenes into monocytes/macrophages in clinical endeavors for disease treatment. In the present study, two complementary strategies of loss-of-function and gain-of-function were utilized in order to elucidate the lipase role in cholesterol efflux more convincingly. Accumulating evidence supports that LPL and EL can be proatherogenic, so we initially hypothesized that the expression of LPL and EL would impair the cholesterol efflux in macrophages. To our surprise, the lipase suppression decreased cholesterol efflux to a moderate extent. Moreover, in the GOF study where LPL and EL were added exogenously or expressed endogenously, an increase in apoAI-mediated cholesterol was observed consistently. Therefore, the stimulatory effect of both LPL and EL on apo AI-mediated cholesterol efflux was supported by both LOF and GOF strategies. The roles of the catalytic and non-catalytic functions of lipases appear to be additive since the inhibition of each function alone only partially decreased lipase-related, apoAI-mediated cholesterol efflux, and this was totally abolished after the removal of both catalytic and non-catalytic functions. No synergistic relationship between catalytic and non-catalytic functions in apoAI-mediated cholesterol efflux was found. In contrast to their facilitating role in lipid accumulation, the expression of LPL and EL promotes cholesterol efflux, adding to the complexity of the role of both lipases in the development of atherosclerosis. However, it 160 remains unclear whether lipase expression in macrophages in vivo can influence intracellular cholesterol concentration through this mechanism in an effort to maintain cholesterol homeostasis. Gauster et.al have reported that EL reduced cholesterol efflux in Cos-7 cells where HDL was modified by EL and then used as the cholesterol recipient. Compared to our study, a different cell line and cholesterol acceptor were used. THP-1 derived macrophages was also investigated in that study, however, no apparent effect of EL-modified HDL on cholesterol efflux was detected in macrophages.39 HDL has been proven to interact with cell surface SR-BI and ABCG transporters during cholesterol efflux, whereas, apoAI induces cholesterol efflux mainly via the ABCA1 transporter, which may also contribute to the explanation of the divergence between previous and current studies. The phospholipid content in HDL is an important determinant for HDL and cell surface interaction,40 and EL has been shown to be capable of hydrolyzing phospholipids. Thus, it was proposed that the depletion of phospholipids in HDL by EL compromised the HDL affinity for the cell membrane, leading to decreased cholesterol efflux. The relative role of phospholipids in apoAI-mediated cholesterol efflux is not well characterized. In one study, it was reported that the association of apoAI with phospholipids reduced its ability to interact with ABCA1. Here, we believe that the overexpression of lipases, especially EL, would deplete phospholipids from and convert lipidated apoAI into lipid-free apoAI, enhancing cholesterol efflux (illustrated as ® in figure 2-19). In the present study, lipases stimulated apoAI-mediated cholesterol efflux by increasing apoAI docking on the cell surface which was dependent on the non-catalytic function of the lipases. Both LPL and EL bear a lipid-binding domain in C-terminus, and interact with apoBlOO.26 2 8 EL and LPL also interact with HDL for the selective uptake of cholesterol,28'41 suggesting that lipases may have the intrinsic ability to interact with apoAI. The increased apoAI docking on cells by lipases makes the former much easier to accept cholesterol from membrane due to the spatial proximity. The increased apoAI docking by lipases may also increase the interaction between ABCA1 and apoAI, especially when apoAI is anchored in the vicinity of ABCA1. This speculation was suggested by the following observations. First, in the lipase suppressed macrophages, decreased 161 apoAI-mediated cholesterol efflux was not accompanied with a parallel change in ABCA1 expression. Second, the increased cholesterol efflux after EL overexpression was independent of ABCA1 level. Herein, we speculate that lipases increase the interaction of ABCA1 and apoAI through binding to and providing apoAI to the ABCA1 transporter (illustrated as © in figure 2-19). Although apoAI mainly interacts with ABCA1 to induce cholesterol efflux, the cholesterol outflow towards apoAI through a non-ABC A1 transporter pathway could also exist for lipase-related cholesterol efflux. In DXM-treated macrophages, there was a marked reduction of ABCA1, however, a significant increase in apo AI-mediated cholesterol efflux was still observed. This dissociation of ABCA1 expression with lipase-enhanced, apoAI-mediated cholesterol efflux indicates an alternative pathway for apoAI-induced cholesterol efflux. In support of this, a considerable portion of apoAI-mediated cholesterol efflux was preserved in ABCA1-/- mouse peritoneal macrophages.9 Similarly, an interaction of apoAI with membranes rather than proteins was suggested by diffusion parameters of membrane-associated apoAI.42 This evidence implies that apoAI can be docked by lipases independent of ABCA1, thus, increasing cholesterol efflux by facilitating free diffusion (illustrated as ® in figure 2-19). The modification of cellular phospholipid composition by lipase expression may also contribute to the change in apoAI-mediated cholesterol efflux (illustrated as © in figure 2-19). Phospholipids are proven to be preferred substrates for EL, ' and the lipolytic action of LPL on phospholipids has been documented as well,24'25 and LPL deficient patients have increased phosphatidylcholine content on red blood cell membrane.44 In this study, the relative levels of two major phospholipid components, phosphatidylcholine and sphingomyelin, were decreased with the overexpression of LPL and EL. Membrane cholesterol is classified into a fast pool and a slow pool, the former is located in the outer leaflet of cellular membrane rich in phosphatidylcholine, the latter is situated in sphingomyelin-rich domains like caveolae as well as the inner leaflet.5'45'46 Phosphatidylcholine and sphingomyelin present in the plasma membrane are critical to maintain the two kinetic pools of cholesterol. The treatment of membrane with sphingomyelinase or phospholipase C dramatically increases cholesterol efflux from the fast pool via free diffusion.46'47 162 In the fast pool, the hydrophobic interaction between cholesterol and phosphatidylcholine has been quantitatively measured,7 the decreased phosphatidylcholine content in the membrane after lipase overexpression may loosen the force to entrap cholesterol, accelerating the cholesterol desorption from the fast pool. The slow pool of cholesterol, which is stabilized by a relatively strong force of hydrogen bonding between sphingomyelin and cholesterol,48'49 can be also influenced as the sphingomyelin level was inversely related to lipase expression. The degradation of sphingomyelin significantly increases cholesterol desorption in fibroblasts, astrocytes, and CHO cells.50"52 As such, the reduction of sphingomyelin by lipase expression leads to the liberation of cholesterol from the slow pool. Furthermore, the removal of membrane phospholipids can also cause phosphatidylserine exofacial flipping during which an outward flow of cholesterol was driven concurrently.42'51 Other phospholipids like phosphatidylethanolamine and phosphatidylserine, the levels of which were changed with the modification of lipase expression, may impose some modulatory effects on membrane cholesterol stability as well. Throughout this process, apoAI docked on the cell surface by lipases becomes an immediate acceptor to receive cholesterol released from both fast and slow pools. The production of lysophosphatidylcholine (LPC) in macrophages and transfected FLP-IN 293 cells was positively correlated with lipase expression. A dose-dependent increase in apoAI-mediated cholesterol efflux by LPC was demonstrated in macrophages in this study, which is consistent with previous reports. In addition, paraoxonase 1 was found to increase cholesterol efflux, and this effect was ascribed to the increase of LPC production by paraoxonase action.54 The released LPC may incorporate into and microsolubilize apoAI to facilitate the acceptance of cholesterol (illustrated as © in figure 2-19). The metabolite of sphingomyelin, ceramide, was also reported to stimulate apoAI-mediated cholesterol efflux through ABCA1 pathway.55'56 The decreased level of sphingomyelin as found after lipase overexpression in this study may suggest that the production of ceramide may increase, and then enhance apoAI-mediated cholesterol efflux. In summary, lipoprotein and endothelial lipases in macrophages promote the apoAI-mediated cholesterol efflux through enhancing apoAI binding and modulating phospholipid composition of the membrane. We propose a model where the potential mechanisms of lipase effect on 163 apoAI-mediated cholesterol efflux are illustrated (figure 2-19). Briefly, phospholipid hydrolysis by lipases converts pre-P HDL into lipid-free apoAI, which is more efficient in inducing cholesterol efflux through the ABCA1 transporter. Moreover, lipases enhance the binding of apoAI to facilitate the cholesterol outflow by either active transport via ABCA1 or free diffusion. The perturbation of membrane phospholipid composition by lipases may liberate the cholesterol to apoAI, and this process can be accelerated by the simultaneous release of lysophosphatidylcholine. Figure 2-19. Proposed mechanisms of lipase-enhanced apoAI-mediated cholesterol efflux in macrophages. In this model, lipases (LPL and EL) convert pre-P HDL into lipid-free apoAI which can accept cholesterol from ABCA1 transporter more efficiently (indicated as ® ) . Lipases also enhanced apoAI binding, providing the spatial proximity between apoAI and ABCA1 (indicated as © ) or membrane cholesterol (indicated as ® ) to facilitate the cholesterol outflow. The alteration of phospholipid composition by lipase hydrolysis drives the cholesterol release more readily (indicated as © ) , the concurrent release of lysophosphatidylcholine also accelerates cholesterol release (indicated as ©) . 164 2.6 References: 1. Lusis AJ. Atherosclerosis. Nature. 2000;407:233-241. 2. Libby P. Inflammation in atherosclerosis. Nature. 2002;420:868-874. 3. Kruth HS. Macrophage foam cells and atherosclerosis. Front Biosci. 2001 ;6:D429-455. 4. Gordon S, Clarke S, Greaves D, Doyle A. Molecular immunobiology of macrophages: recent progress. Curr Opin Immunol. 1995;7:24-33. 5. Mahlberg FH, Rothblat GH. Cellular cholesterol efflux. Role of cell membrane kinetic pools and interaction with apolipoproteins AI, All, and Cs. J Biol Chem. 1992;267:4541-4550. 6. Silvius JR. Role of cholesterol in lipid raft formation: lessons from lipid model systems. Biochim Biophys Acta. 2003; 1610:174-183. 7. Pasenkiewicz-Gierula M, Rog T, Kitamura K, Kusumi A. Cholesterol effects on the phosphatidylcholine bilayer polar region: a molecular simulation study. Biophys J. 2000;78:1376-1389. 8. Tall AR, Costet P, Wang N. Regulation and mechanisms of macrophage cholesterol efflux. J Clin Invest. 2002; 110:899-904. 9. Bortnick AE, Rothblat GH, Stoudt G, Hoppe KL, Royer LJ, McNeish J, Francone OL. The correlation of ATP-binding cassette 1 mRNA levels with cholesterol efflux from various cell lines. JBiol Chem. 2000;275:28634-28640. 10. McNeish J, Aiello RJ, Guyot D, Turi T, Gabel C, Aldinger C, Hoppe KL, Roach ML, Royer LJ, de Wet J, Broccardo C, Chimini G, Francone OL. High density lipoprotein deficiency and foam cell accumulation in mice with targeted disruption of ATP-binding cassette transporter-1. Proc Natl Acad Sci USA. 2000;97:4245-4250. 11. Jaye M, Lynch KJ, Krawiec J, Marchadier D, Maugeais C, Doan K, South V, Amin D, Perrone M, Rader DJ. A novel endothelial-derived lipase that modulates HDL metabolism. Nat Genet. 1999;21:424-428. 12. Hirata K, Dichek HL, Cioffi JA, Choi SY, Leeper NJ, Quintana L, Kronmal GS, Cooper AD, Quertermous T. Cloning of a unique lipase from endothelial cells extends the lipase gene family. JBiol Chem. 1999;274:14170-14175. 13. Azumi H, Hirata K, Ishida T, Kojima Y, Rikitake Y, Takeuchi S, Inoue N, Kawashima S, Hayashi Y, Itoh H, Quertermous T, Yokoyama M. Immunohistochemical localization of endothelial cell-derived lipase in atherosclerotic human coronary arteries. Cardiovasc Res. 2003;58:647-654. 14. Wilson K, Fry GL, Chappell DA, Sigmund CD, Medh JD. Macrophage-specific expression of human lipoprotein lipase accelerates atherosclerosis in transgenic 165 apolipoprotein e knockout mice but not in C57BL/6 mice. Arterioscler Thromb Vase Biol. 2001;21:1809-1815. 15. Babaev VR, Patel MB, Semenkovich CF, Fazio S, Linton MF. Macrophage lipoprotein lipase promotes foam cell formation and atherosclerosis in low density lipoprotein receptor-deficient mice. JBiol Chem. 2000;275:26293-26299. 16. Wang X, Greilberger J, Levak-Frank S, Zimmermann R, Zechner R, Jurgens G. Endogenously produced lipoprotein lipase enhances the binding and cell association of native, mildly oxidized and moderately oxidized low-density lipoprotein in mouse peritoneal macrophages. Biochem J. 1999;343 Pt 2:347-353. 17. Badellino KO, Wolfe ML, Reilly MP, Rader DJ. Endothelial lipase concentrations are increased in metabolic syndrome and associated with coronary atherosclerosis. PLoS Med. 2006;3:e22. 18. Paradis ME, Badellino KO, Rader DJ, Deshaies Y, Couture P, Archer WR, Bergeron N, Lamarche B. Endothelial lipase is associated with inflammation in humans. J Lipid Res. 2006;47:2808-2813. 19. Paradis ME, Badellino KO, Rader DJ, Tchernof A, Richard C, Luu-The V, Deshaies Y, Bergeron J, Archer WR, Couture P, Bergeron N, Lamarche B. Visceral adiposity and endothelial lipase. J Clin Endocrinol Metab. 2006;91:3538-3543. 20. Ishida T, Choi SY, Kundu RK, Spin J, Yamashita T, Hirata K, Kojima Y, Yokoyama M, Cooper AD, Quertermous T. Endothelial lipase modulates susceptibility to atherosclerosis in apolipoprotein-E-deficient mice. J Biol Chem. 2004;279:45085-45092. 21. Koike T, Liang J, Wang X, Ichikawa T, Shiomi M, Sun H, Watanabe T, Liu G, Fan J. Enhanced aortic atherosclerosis in transgenic Watanabe heritable hyperlipidemic rabbits expressing lipoprotein lipase. Cardiovasc Res. 2005;65:524-534. 22. Winkler FK, D'Arcy A, Hunziker W. Structure of human pancreatic lipase. Nature. 1990;343:771-774. 23. McCoy MG, Sun GS, Marchadier D, Maugeais C, Glick JM, Rader DJ. Characterization of the lipolytic activity of endothelial lipase. J Lipid Res. 2002;43:921-929. 24. Fugman DA, Shirai K, Jackson RL, Johnson JD. Lipoprotein lipase- and phospholipase A2-catalyzed hydrolysis of phospholipid vesicles with an encapsulated fluorescent dye. Effects of apolipoproteins. Biochim Biophys Acta. 1984;795:191-195. 25. Stein O, Friedman G, Chajek-Shaul T, Halperin G, Olivecrona T, Stein Y. Transfer of cholesteryl linoleyl ether from phosphatidylcholine and phosphatidylethanolamine liposomes to cultured cells catalyzed by lipoprotein lipase. Biochim Biophys Acta. 1983;750:306-316. 26. Choi SY, Sivaram P, Walker DE, Curtiss LK, Gretch DG, Sturley SL, Attie AD, Deckelbaum RJ, Goldberg IJ. Lipoprotein lipase association with lipoproteins involves protein-protein interaction with apolipoprotein B. JBiol Chem. 1995;270:8081-8086. 166 27. Sivaram P, Choi SY, Curtiss LK, Goldberg IJ. An amino-terminal fragment of apolipoprotein B binds to lipoprotein lipase and may facilitate its binding to endothelial cells. JBiol Chem. 1994;269:9409-9412. 28. Fuki IV, Blanchard N, Jin W, Marchadier DH, Millar JS, Glick JM, Rader DJ. Endogenously produced endothelial lipase enhances binding and cellular processing of plasma lipoproteins via heparan sulfate proteoglycan-mediated pathway. J Biol Chem. 2003;278:34331-34338. 29. Domin WS, Chait A, Deeb SS. Transcriptional activation of the lipoprotein lipase gene in macrophages by dexamethasone. Biochemistry. 1991;30:2570-2574. 30. Hill JS, Yang D, Nikazy J, Curtiss LK, Sparrow JT, Wong H. Subdomain chimeras of hepatic lipase and lipoprotein lipase. Localization of heparin and cofactor binding. J Biol Chem. 1998;273:30979-30984. 31. Meshulam T, Herscovitz H, Casavant D, Bernardo J, Roman R, Haugland RP, Strohmeier GS, Diamond RD, Simons ER. Flow cytometric kinetic measurements of neutrophil phospholipase A activation. J Biol Chem. 1992;267:21465-21470. 32. Juhl K, Efanov AM, Olsen HL, Gromada J. Secretory phospholipase A2 is released from pancreatic beta-cells and stimulates insulin secretion via inhibition of ATP-dependent K+ channels. Biochem Biophys Res Commun. 2003;310:274-279. 33. Denis M, Haidar B, Marcil M, Bouvier M, Krimbou L, Genest J, Jr. Molecular and cellular physiology of apolipoprotein A-I lipidation by the ATP-binding cassette transporter A l (ABCA1). J Biol Chem. 2004;279:7384-7394. 34. Innis SM, Dyer RA. Brain astrocyte synthesis of docosahexaenoic acid from n-3 fatty acids is limited at the elongation of docosapentaenoic acid. J Lipid Res. 2002;43:1529-1536. 35. Ha JS, Ha CE, Chao JT, Petersen CE, Theriault A, Bhagavan NV. Human serum albumin and its structural variants mediate cholesterol efflux from cultured endothelial cells. Biochim Biophys Acta. 2003;1640:119-128. 36. Lewis PF, Emerman M. Passage through mitosis is required for oncoretroviruses but not for the human immunodeficiency virus. J Virol. 1994;68:510-516. 37. Naldini L, Blomer TJ, Gallay P, Ory D, Mulligan R, Gage FH, Verma IM, Trono D. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science. 1996;272:263-267. 38. Bambacioni F, Casati C, Serafini M, Manganini M, Golay J, Introna M. Lentiviral vectors show dramatically increased efficiency of transduction of human leukemic cell lines. Haematologica. 2001 ;86:1095-1096. 39. Gauster M, Oskolkova OV, Innerlohinger J, Glatter O, Knipping G, Frank S. Endothelial lipase-modified high-density lipoprotein exhibits diminished ability to mediate SR-BI 167 (scavenger receptor B type Independent free-cholesterol efflux. Biochem J. 2004;382:75-82. 40. Thuahnai ST, Lund-Katz S, Dhanasekaran P, de la Llera-Moya M, Connelly MA, Williams DL, Rothblat GH, Phillips MC. Scavenger receptor class B type I-mediated cholesteryl ester-selective uptake and efflux of unesterified cholesterol. Influence of high density lipoprotein size and structure. JBiol Chem. 2004;279:12448-12455. 41. Panzenboeck U, Wintersberger A, Levak-Frank S, Zimmermann R, Zechner R, Kostner GM, Malle E, Sattler W. Implications of endogenous and exogenous lipoprotein lipase for the selective uptake of HDL3-associated cholesteryl esters by mouse peritoneal macrophages. J Lipid Res. 1997;38:239-253. 42. Chambenoit O, Hamon Y, Marguet D, Rigneault H, Rosseneu M, Chimini G. Specific docking of apolipoprotein A-I at the cell surface requires a functional ABCA1 transporter. JBiol Chem. 2001;276:9955-9960. 43. Gauster M, Rechberger G, Sovic A, Horl G, Steyrer E, Sattler W, Frank S. Endothelial lipase releases saturated and unsaturated fatty acids of high density lipoprotein phosphatidylcholine. J Lipid Res. 2005;46:1517-1525. 44. Cantin B, Brun LD, Gagne C, Murthy MR, Lupien PJ, Julien P. Alterations in erythrocyte membrane lipid composition and fluidity in primary lipoprotein lipase deficiency. Biochim Biophys Acta. 1992;1139:25-31. 45. Slotte JP. Sphingomyelin-cholesterol interactions in biological and model membranes. Chem Phys Lipids. 1999;102:13-27. 46. Haynes MP, Phillips MC, Rothblat GH. Efflux of cholesterol from different cellular pools. Biochemistry. 2000;39:4508-4517. 47. Stein O, Ben-Nairn M, Dabach Y, Hollander G, Stein Y. Modulation of sphingomyelinase-induced cholesterol esterification in fibroblasts, CaCo2 cells, macrophages and smooth muscle cells. Biochim Biophys Acta. 1992; 1126:291-297. 48. Bittman R, Kasireddy CR, Mattjus P, Slotte JP. Interaction of cholesterol with sphingomyelin in monolayers and vesicles. Biochemistry. 1994;33:11776-11781. 49. Veiga MP, Arrondo JL, Goni FM, Alonso A, Marsh D. Interaction of cholesterol with sphingomyelin in mixed membranes containing phosphatidylcholine, studied by spin-label ESR and IR spectroscopies. A possible stabilization of gel-phase sphingolipid domains by cholesterol. Biochemistry. 2001;40:2614-2622. 50. Fukasawa M, Nishijima M, Itabe H, Takano T, Hanada K. Reduction of sphingomyelin level without accumulation of ceramide in Chinese hamster ovary cells affects detergent-resistant membrane domains and enhances cellular cholesterol efflux to methyl-beta -cyclodextrin. JBiol Chem. 2000;275:34028-34034. 51. Ito J, Nagayasu Y, Yokoyama S. Cholesterol-sphingomyelin interaction in membrane and apolipoprotein-mediated cellular cholesterol efflux. J Lipid Res. 2000;41:894-904. 168 52. Ohvo H, Olsio C, Slotte JP. Effects of sphingomyelin and phosphatidylcholine degradation on cyclodextrin-mediated cholesterol efflux in cultured fibroblasts. Biochim Biophys Acta. 1997;1349:131-141. 53. Hara S, Shike T, Takasu N, Mizui T. Lysophosphatidylcholine promotes cholesterol efflux from mouse macrophage foam cells. Arterioscler Thromb Vase Biol. 1997;17:1258-1266. 54. Rosenblat M, Vaya J, Shih D, Aviram M. Paraoxonase 1 (PON1) enhances HDL-mediated macrophage cholesterol efflux via the ABCA1 transporter in association with increased HDL binding to the cells: a possible role for lysophosphatidylcholine. Atherosclerosis. 2005;179:69-77. 55. Ghering AB, Davidson WS. Ceramide structural features required to stimulate ABCA1-mediated cholesterol efflux to apolipoprotein A-I. J Lipid Res. 2006;47:2781-2788. 56. Witting SR, Maiorano JN, Davidson WS. Ceramide enhances cholesterol efflux to apolipoprotein A-I by increasing the cell surface presence of ATP-binding cassette transporter A l . JBiol Chem. 2003;278:40121-40127. 169 Chapter 3. Endothelial Lipase Expression Enhances the Binding and Uptake of Native and Oxidized Low Density Lipoprotein in Human Macrophages: A Mechanism Requiring Heparan Sulfate Proteoglycansb 3.1 Introduction and Rationale One striking feature of atherosclerosis is the formation of lipid-laden foam cells, of which most are derived from macrophages. Lipids in foam cells are mostly from circulating lipoproteins, particularly low density lipoprotein (LDL) and its modified forms such as oxidized or aggregated LDL. Macrophages express several lipoprotein receptors, including low density lipoprotein receptor (LDLR), low density lipoprotein receptor-related protein (LRP), and several scavenger receptors like SRA and CD36. These receptors are intimately involved in the lipoprotein modification and subsequent internalization by macrophages, promoting the formation of macrophage-derived foam cells.1"6 The role of EL in atherosclerosis remains unclear, and the results obtained from animal studies are not consistent. Ishida et al. reported the EL knockout in apoE-deficient mice lessened the aortic atherosclerosis by ~70% on both regular and chow diets.7 By contrast, this relationship was not established in another study where both apoE-deficient and LDLR-deficient mice were bred with EL knockout mice. The development of atherosclerotic lesions in EL-knockout animals did not differ from their controls. However, several clinical studies suggest that EL could be potentially pro-atherogenic. EL was increased in a population of moderately obese men, and also correlated to the inflammatory score calculated on the basis of C-reactive protein, interleukin-6, and secretory phospholipase Al concentrations.9 The positive correlation of EL with metabolic syndrome factors and coronary calcification score was observed in 858 healthy participants with a family history of premature coronary heart disease.10 However, the proceeding experiments (Chapter 1) in this thesis indicate that macrophage-derived EL displayed an anti-atherogenic trait by promoting cholesterol efflux. b A version of this chapter has been submitted for publication. Qiu, G. and Hill, J.S. Endothelial lipase expression enhances the binding and uptake of native and oxidized low density lipoprotein in human macrophages. 170 EL has been regarded to be a genetic regulator of plasma high density lipoprotein (HDL), 1 1 1 3 and animal studies also show that EL can modulate plasma levels of apoB-containing lipoproteins.""15 EL expression in transfected Chinese Hamster Ovary (CHO) cells resulted in a marked increase of LDL binding and uptake.'6 However, the effect of EL on LDL metabolism in macrophages thus far has not been investigated. 171 3.2 Hypotheses and Specific Aims 3.2.1 Hypotheses The expression of EL in THP-1 derived macrophages will promote the binding and uptake of both native and oxidized LDL. EL-mediated LDL metabolism will be dependent on cell surface HSPGs, whereas the catalytic activity of EL will not play a critical role. Furthermore, the interaction between EL and lipoprotein receptors (LDLR, LRP, and CD36) may mediate part of LDL metabolism. 3.2.2 Specific Aims: 1. To generate EL suppressed or overexpressing macrophages 2. To measure the binding and association of native and oxidized LDL in macrophages a. Dil labeling of LDL b. The oxidation of LDL and quantitation of oxidation degree of oxLDL c. The binding and association of native and oxLDL with cells. 3. To differentiate the roles of the catalytic and non-catalytic functions of EL in LDL metabolism in macrophages a. LDL and oxLDL binding and association after the inhibition of catalytic activity by THL b. LDL and oxLDL binding and association after the elimination of cell surface HSPGs by heparinase I. 4. To investigate the role of lipoprotein receptors in EL-mediated LDL metabolism a. The blockage of lipoprotein receptors by LDLR antibody, receptor associated protein (RAP), CD36 antibody b. LDL and oxLDL binding and association after the blockage of lipoprotein receptors. 172 3.3 Materials and Methods: 3.3.1 The suppression and over-expression in macrophages by lentivirus The methods have been described in previous chapter. 3.3.2 Dil labeling and oxidation of LDL For l,r-dioctadecyl-3,3,3',3'-tetramethylindocarbocyanine perchlorate (Dil) labeling, native LDL (Biomedical Technologies INC., MA, USA) was incubated with Dil (final concentration of 300pg/ml) at 37°C overnight. Thereafter, both Dil-labeled and unlabeled LDLs were oxidized as following: LDL was incubated with 5 uM CuSGv for 2 hours or overnight at 37°C for mildly and extensively oxidized LDL (oxLDL), respectively. EDTA was added to final concentration of lmM to terminate the reaction before purification. Subsequently, LDL was re-isolated into PBS using a PD-10 desalting column pre-equilibrated with PBS (GE Healthcare). The protein concentration of the LDL preparations was measured using a BCA protein assay kit (Pierce). Thiobarbituric acid reacting substances (TBARS) assay (ZeptoMetrix Co., NY, USA) was used to evaluate the oxidation extent of LDL. The amount of TBARS was determined by comparison to a standard of malondialdehyde (MDA) equivalents. A LDL preparation with a TBAR value of 20~30 nmole/mg protein of MDA equivalents was classified as mildly oxidized LDL whereas TBAR values greater than 50 nmole/mg protein of MDA equivalents was classified as extensively oxidized LDL. 3.3.3 LDL binding and association assay THP-1 monocytes (5x 105) were transduced with lentivirus at MOI of 20 for 2 days, and then were differentiated into macrophages by lOOnM PMA stimulation for 2 days. Thereafter, macrophages were starved in RPMI 1640 medium containing lipoprotein deficient serum (LPDS) for 24 hours. Subsequently, macrophages were treated with lOug/ml Dil-LDL (native, mildly oxidized, and extensively oxidized LDLs), and incubated at 4°C or 37°C for the binding and association assays, respectively. For background binding/uptake analysis, 20-fold excess of non